AMERICAN ee
FERN Number 1
J O y R NAL anuary—Marc.

QUARTERLY JOURNAL OF THE AMERICAN FERN SOCIETY

The Structure of Petioles in Pteris (Pteridaceae)
Olga G. Martinez and Ignacio Vilte 1

The Role of Aquaporins in Water Balance in Cheilanthes lanosa (Adiantaceae) Gameto-

phytes
Hope L. Diamond, Heather R. Jones, and Lucinda J. Swatzell 11

The Effects of Exogenous Cytokinin on the Morphology and Gender Expression of Os-
regalis Gametophytes
Gary K. Greer, Margaret A. Dietrich, Joseph A. DeVol, and April Rebert 32

Optimization of Protocol for Isolation of Genomic DNA from Leaves of —— Spe-
cies Suitable for RAPD Analysis and Study of their Genetic Variati
Sayantani Das, Maumita cia Subir Bera 47

Molecular — on the Origin of Osmunda xmildei (Osmundaceae)
C. Tsutsumi, Y. Hirayama, M. Kato, Y. Yatabe- keliown and S.-Z. Zhang 55

The Tree Fern Highland Lace is a Cultivar of Sphaeropteris cooperi
Daniel G. Yansura and Barbara J. Hoshizaki 69

Elaphoglossum montanum, a New —— es Southern Brazil
Tia A. Kieling-Rubio and Paulo G. Windisch 78

SHorTER Notes

Biret 2 ot wt tl tre (De ss 1c

razil
Leonardo Biral and Jefferson Prado 83

Ratryrh: 7, Ue ek AL MA Me
3 iF the Indian Himalayan

Mountains
B.S. Kholia 86

The American Fern Society
Council for 2012

MICHAEL WINDHAM, Dept. of Biology, Duke University, P.O. Box 90338, Durham, NC 27708.
President
KATHLEEN PRYER, Dept. of Biology, Duke University, P.O. Box 90338, Durham, NC 27708.
President-Elect
MARY STENSVOLD, USDA Forest Service, 204 Siginaka Way, Sitka, AK 99835.

Secretary
JAMES D. CAPONETTL, Div. of Biology, University of Tennessee, Knoxville, TN 37996-0830.
Treasurer
GEORGE YATSKIEVYCH, Missouri Botanical Garden, P.O. Box 299, St. Louis, MO 63166-0299.
Membership Secretary

JAMES D. MONTGOMERY, Ecology III, 804 Salem Blvd., Berwick, PA 18603-9801.
Curator of Publications
JENNIFER M. O. GEIGER, Dept. of Natural Sciences, Carroll College, Helena, MT 59625.

: Journal Editor
R. JAMES HICKEY, Dept. of Botany, Miami University, Oxford, OH 45056.
Memoir Editor
JOAN N. E. HUDSON, Dept. of B i State University, Huntsville, TX 77341-2116
DAVID SCHWARTZ, 9715 pete ina temas CA 93312-5617.
Bulletin Editors
American Fern Journal
EDITOR
JENNIFER M. O. GEIGER Dept. of | oro Carroll College, Helena, MT 59625,
h. ( 447-4461, e-mail: jgeiger@carroll.edu

a EDITOR
JILL ANNE DILI

MT 59625
ph. pry 447-5176, — penpemehies edu

ASSOCIATE EDITORS

Seine es Dept. of Geoscience, Hobart & William Smith Colleges, — NY 14456
rae MARIA aimee. Y GALAN =3. Dept. de Biologia Vegetal I, Universidad Complutense de Madrid,
d, Spain 28040
GERALD 1 GASTONY: (in) ec Dept. of Biology, Indiana University, Bloomington, IN 47405-6801
GARY K. GREBR oo eee asain Biology Dept., Grand Valley State University, Allendale, MI 49401
CHRISTOPHER H. HAUFLER ................... Dept. of Ecology and Evolutionary Biology, University of Kansas,
wrence, KS 66045-2106
R. JAMES HICKEY .-.. Dept. of Botany, Miami University, Oxford, OH 45056
PAULO LABIAK .............. Universidade Federal d 4 aie de Botanica, 81! we see Curitiba-PR, Brasil
ROBBIN C. MORAN ... : w York Botanical Gar Bronx, NY 10458-5126

NATHALIE NAGALINGUM saat lowice Garden “eit Sydney, NSW, Aus
cate ROTHFELS Botany Dept., Duke University, Durham, NC 27708
EMILY SESSA Botany Dept., University of Wisconsin-Madison, Madison, WI cae

MICHAEL SUNDUE inaie Herbarium, The Uni iversi ity of Vermont, Burlin ngton, VT

JAMES E. WATKINS, JR. y, > Conbinige ,MA 2138

The “American Fern Journal” (ISSN 0002-8444) is an illustrated quarterly devoted to the general study of
ferns. It is owned by the American Fern Society, and published at The American Fern Secon %e Missouri
Botanical Garden, P. O. Box 299, St. Louis, MO 63166-0299. Periodicals postage paid at St. Louis, MO, and

lai rd pepe Hage (A: uct tn 14 ‘shes £5. Cs + ae

for back issues should be addressed to Dr. James D. Montgomery, Peed Il, 804 Salem Blvd., Berwick, PA
18603-9801.

4a [ple aps i ne 4.5. = Wik i hae 1, RS

>" ’ > 1d i * r *
rh +: cd + 6

Back volumes are avalible for most years as = pied issues or on microfiche. Please contact the Back Issues
Curator for ee and availability.

Sooner ener: USA, Canada, Mexico (includes Journal and Fiddlehead Fort $25
ee. cf. i, T 1, s+ 2 _341..1. 3 + . Zz
c. ‘se 24) cian i < £ tte as
ic. 2 ¥ Ce if, i A, bey ind ng Ft 7 re -4
Society tiling 2 itside Canada, Mexico)
Repl Mente = USA, Canada, Mexico (includes Fiddiehead Forum)
ve + Ss. Tt 331 .t 2. y -
. ) $19
Insti : - $35 to USA, Canada ees. As al 1, (-$2 agency
$35

z sex Send adress changes o Ameean Fern Jura Missouri Botanical Caren, PO Box 299,
| St Lous MO 63166029.

American Fern Journal 102(1):1—10 (2012)

The Structure of Petioles in Pteris (Pteridaceae)

Ouca G. Martinez and IcNaAcio VILTE
IBIGEO, Herbario MCNS, Fac. Cs. Naturales, Universidad Nacional de Salta, Av. Bolivia 5150,
4400-Salta, Argentina, e-mail: martinog@unsa.edu.ar

ABsTRACT.—We studied the petiole structure of twelve American species of Pteris: P. ciliaris, P.
cretica, P. deflexa, P. denticulata, P. ensiformis, P. exigua, P. inermis, P. multifida, P. mutilata, P.

lateral ventilation areas. Internally, petioles are monostelic V-, U- or inverted-Q-shaped axes. The
vascular system is surrounded by one endodermis cell layer and 1-3 pericycle strata. We propose a
classification of the vascular bundles into four types considering their shape, the shape of the xylem
ends, the number of protoxylem zones and the presence of parenchyma bands in the xylem.

Key Worps.—Pteris, vascular bundles, petioles, ventilation areas

The paraphyletic genus Pteris (Schuettpelz and Pryer, 2007; Prado et al.,
2007) includes about 200 mainly pantropical species (Prado and Windisch,
2000). In the American continent there are about 60 species (Tryon and Tryon,
1982). In this paper we report the structure of vascular bundles of the petioles
of twelve Pteris species, native or naturalized in the Americas: P. ciliaris D.C.
Eaton, P. cretica L., P. deflexa Link, P. denticulata Sw., P. ensiformis Burm.f.,
P. exigua O.G. Martinez and J. Prado (Martinez and Prado, 2011), P. inermis
(Rosenst.) de la Sota, P. multifida Poir., P. mutilata L., P. quadriaurita Retz., P.
tristicula Raddi and P. vittata L.

Many authors consider the structure of vascular bundles significant in
identifying different taxonomic groups, including Ogura (1972), White (1974),
Lin and De Vol (1977, 1978), Gracano et al. (2001), Hernandez et al. (2006),
Hernéndez-Hernandez et al. (2007), Srivastava (2008a, 2008b), among others.
Ogura (1972) describe the structure of petioles in Pteris as being made only by
one stele along their entire course, or several at the base that at some point meet.
Lin and De Vol (1977) present a key to Taiwan ferns on the basis of petiole
structure, and they provide diagnostic value to the number and shape of vascular
bundles, sclerenchyma distribution, presence and number of adaxial grooves,
ventilation areas and indument. Lin and De Vol (1978) describe the petiole
structure of nine Pteris species (including P. multifida) and recognize “V”, “U”
or ““Q”-shaped vascular bundles. Gragano et al. (2001) indicate that the petiole
vascular bundles of P. denticulata and P. leptophylla Sw. are “U’’-shaped, and
assume an inverted Q shape in P. propinqua J. Agardh. Bondada et al. (2006)
report that the petiole in P. vittata has a “U’’-shaped vascular bundle. In all cases,
the xylem is described with the ends folded of the “hippocampus” type.

There have been no prior anatomical studies of most of the species treated in
this work, so we expect our results will add to the anatomical and
phylogenetic knowledge about this genus.

2 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

MATERIALS AND METHODS

The studies were conducted on herbarium material provided by the
following institutions: BA, BM, CTES, G, K, LP, LPB, MCNS, NY, P, S, SI,
SP, UNR, US and Z. Living specimens were collected in Argentina and were
deposited in the MCNS Herbarium.

For anatomical studies, we considered three areas of the petiole: basal (next to
the rhizome), middle (half of the petiole) and distal (next to the blade).
Histological sections were made with a rotary microtome and freehand, stained
with Safranin-Fast Green and mounted in Canada balsam. The histochemical
tests used to detect cutin and suberin, lignin and tannins were Sudan III and
fluoroglucine Fe3;Cl with CaCO3, respectively (D ’Ambrogio Argiieso, 1986). To
observe xylem we macerated using the Jeffrey technique (Jeffrey, 1917).

Observations, illustrations and photographs were done with a light Zeiss
Standard 16 microscope and a scanning electron microscope of the JEOL JSM
6480LL model, belonging to the Universidad Nacional de Salta (Argentina).
Samples for SEM observations were subjected to an increasing alcohol series,
and then dried to critical point with CO. The metallization was carried out
with a thin gold-palladium coating. For the schemes, the conducting tissues
are represented by Metcalfe and Chalk (1950), as suggested by Martinez (2003).
Illustrations were made with the aid of a camera lucida.

Materia StupiepD. P. ciliaris—CUBA. East: without locality, 150 m, 9/VI/1915,
Ekman 5364 (S); Santiago de Cuba: 1843-4, Linden 1924 (P). HAITI. South:
Jérémie, Massif de la Hotte, western group, 800 m, 22/VII/1948, Ekman 10403
(G); Idem, 700 m, 25/XII/1926, Ekman 7415 (BM).

P. cretica—ARGENTINA. Salta: Dpto. Capital, Quebrada de San Lorenzo,
1500 m, 10/III/2002, Martinez 913 (MCNS). MEXICO. Distrito Federal: Cafiada
de Contreras, 2800 m, 30/IV/1966, Rzedowski 22 217 (LP). PERU. Amazonas:
Chachapoyas, 5/VI/1962, Wurdack 776 (K).

P. deflexa.—ARGENTINA. Jujuy: Dpto. Manuel Belgrano, camino a Tiraxi,
9 km of RN 9, 10/XII/1998, Morrone 3202 (CTES). Salta: Dpto. Santa Victoria,
Parque Nacional Bariti, Abra de Minas, S 22° 27.4" W64°44.4’, 1400 m, 10/
VIII/2009, Martinez et al. 1831 (MCNS). Tucuman: Dpto. Monteros, Qda. del
Portugués, 1550 m, Martinez 703, 30/XI/1999 (MCNS).

P. denticulataa—ARGENTINA. Jujuy: Dpto. Ledesma, Parque Nacional
Calilegua, camino a Valle Grande, 20/IV/2002, Martinez 914 (MCNS). Misiones:
Dpto. Candelaria, Candelaria, 8/IX/1993, Arbo et al. 6007 (LP). BOLIVIA. Santa
Cruz: Valle Grande, S18°48’ W63°49’, 1000 m, 24/V/1996, Kessler et al. 6043
(LPB); CUBA. Oriente: Pinar de Yigiie, 500 m. 29/III/1915, Ekman 5138 (S).

P. ensiformis.—UNITED STATES OF AMERICA. California: Los Angeles,
20/XI/2002, Hoshizaky s.n. (MCNS 1814). JAPAN. Hong Kong: Tai Po Kau
Forest Reserve, 21/XI/1980, Kramer et al. 8225 (Z). TAIWAN. Satun, E100°10’
N 6°42’, 100 m, daca Larsen et al. 46081 (NY).

exigua.—ARGENTINA. Jujuy: Dpto. Ledesma, camino Calilegua-San
Francisco, 17/THl/2009, ates y Chambi 1802 (MCNS), Salta: Dpto. Capital,

MARTINEZ & VILTE: PETIOLE STRUCTURE IN PTERIS 3

Quebrada Los Berros, 1500 m, 11/IV/2002, Martinez 881 (MCNS), Tucuman:
Dpto. Burruyacu, Cerro Nogalito, 12/VI/1929, Venturi 8879 (SI).

P. inermis.—ARGENTINA. Jujuy: Dpto. Ledesma, camino a Valle Grande,
22/11/1972, Cabrera et al. 22384 (LP), Parque Nacional Calilegua, RP 83
23°41,9' W 64° 52,8’,’ 1365 m, 17/III/2009, Martinez y Chambi 1778 (MCNS).
Salta: Dpto. Capital, Quebrada de San Lorenzo, S 24°43.1 'W 65°30.5’, 10/VII/
2010, Martinez y Chambi 1919 (MCNS).

P. multifida.—ARGENTINA. Chaco: Dpto. Primero de Mayo: Colonia
Benitez, IV/1983, Romero 1 (LP). BOLIVIA. Santa Cruz de la Sierra: Biocentro
Gembé, 400 m, 02/IV/2010, Martinez 1872 (MCNS). CUBA. La Habana:
Guanabacoa 7/XII/1921, Ekman 13543 (S).

P. mutilata.—CUBA. La Habana: Lomas de la Jaula, 11/VI/1914, Ekman 1313
(S). HAITI. West: Gonave Island, VIII/1927, Eyerdam 247 (CA). PUERTO RICO.
Rio Abajo State Forest, N 18°20,3’ W 66°42,0’, 4/VI/1999. Acevedo-Rodriguez
10657 (US).

P. quadriauritaa—ARGENTINA. Jujuy: Dpto. Ledesma, Parque Nacional
Calilegua, ruta provincial 83, Mesada Las Colmenas, Martinez y Guerra 1993,
24/VIII/2010 (MCNS). Salta: Dpto. Ordn, Los Naranjos, a orillas del rio San
Andrés, 1150 m, Martinez y Prada 1746, 18/06/2008 (MCNS): Rio Pescado,
8 km de Arazayal, 25/X/1970, Vervoorst y Cuezzo 7804 (BA).

P. tristicula—ARGENTINA. Corrientes: Ituzaing6, Arroyo Garapé y rio
Parana, 45 km E de Ituzaing6, Tressens et al. 408, 23-24/10/1974 (LP). Salta:
Dpto. Oran, Rio Blanquito a los Naranjos, S 23°41.7’ W 64°51.9’, 610 m, Martinez
y Prada 1697, 17/VI/2008 (MCNS). BRAZIL. Rio de Janeiro, Sao Carlos, Fazenda
Canchim, ca. 8 km. NE of Sao Carlos, 22/VI/1961, Eiten et al. 3182 (SP).

P. vittata.—ARGENTINA. Entre Rios: Dpto. Rosario del Talar, Acebal, Sorarti
39, 31/11/1963 (LP). Jujuy: Dpto. Ledesma, Libertador General San Martin,
600 m, Martinez 1399, 13/V/2007 (MCNS). Santa Fe: Facultad de Ciencias
Agrarias, Universidad Nacional de Rosario, Lewis 1585, 25/III/1983 (UNR 4624).

RESULTS

Externally, the petioles are green, yellow with macules or brown, always
with a dark base. Their length varies between 1/2—2/3 of the total length of the
fronds. The petioles of the fertile fronds are longer than those of the sterile
fronds. The diameter in the middle ranges from 1 mm in P. ensiformis up to
20 mm in P. deflexa.

In cross section, petioles (Figs. 1-18) have bases with triangular or tetragonal
boundaries (Figs. 1, 4, 7, 10, 13, 16), and subcircular middle (Pigs. 2, 5, &, 11,
14, 17) to upper sections (Figs. 3, 6, 9, 12, 15, 18) with a simple groove on
the adaxial side. This groove runs lengthwise over the entire axis including the
rachis, with a considerable depth from the lower basal third, and, as in the
base, it is usually slightly concave. Two continuous white lines parallel to this
groove, one on each side, are ventilation areas.

The indumentum of petioles consists of scales and trichomes. Scales are
common in the base, similar to the rhizomatic structure; they are basifixed,

4 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

. 1-18. Petioles cross- “section. 1-3. Pteris cretica L. 4-6. Pteris relies chant 7-9. Pteris
k

denial Sw. 1 : vittata 3-15. Pteris caagapeiiess Retz., 16-18 ris deflexa Lin
wok 10,1 si 16. Basal paenl close to the rhizome. 2, 5, 8, 11, 17. sapere section of petioles.
, 18. Upper section, near the blade. - = ee. thick line = endodermis +

Sees pomeg era parallel lines = xylem

brown, deltoid, subulate, linear-lanceolate, sub-opaque, colored in all taxa
except P. ciliaris, which presents discolored scales and a sclerotic middle area
of more intense color. Trichomes are simple, translucent to whitish, 2—4—cell,
except P. multifida with 5—9-cell, and usually deciduous; thus the petioles of
mature plants are glabrous except in the region of the longitudinal groove.

MARTINEZ & VILTE: PETIOLE STRUCTURE IN PTERIS 5

Fics. 19-22. SEM photograph of monostelic petioles, in the middle of the shaft. 19. Stele in V-
shaped of Pteris cretica L. 20. St ele eina a sha ped of Pteris vittata L. showing scales around the
petiole. 21. areas in a U-sahped Pt Retz. with ends largely elongated and bent over
the main shaft. 22. Stele inverted Q- Shaped of Pred: exigua O.G. Martinez and J. Prado with
trichomes in the pe groove

In cross section (Fig. 19-22), petioles show a cortex formed -from the outside
in- of a monostratified epidermis covered by a thick cuticle, and 2-18 layers of
sclerenchyma and parenchyma (Fig. 23). In large plants as P. deflexa the whole
cortex is sclerified. This subepidermal supporting tissue has two gaps along
the petiole formed by the ventilation areas. The presence of tannins is common
in the cortex, which gives the mature petioles a brown to dark color

In young and fragile petioles, of 1 mm in diameter, ventilation areas are
substomatal chambers, while in the robust petioles these areas are composed of
parenchymatous tissue, with few intercellular spaces (Fig. 24).

In the medulla, depending on the cross section area, there are one or two
vascular bundles. In P. cretica and P. multifida, there are two bundles on the base
that fuse in the lower third of the petiole by the V-shaped abaxial ends (Fig. 1—3).
The nine remaining species have monostelic petioles along the entire shaft.

The stele is ‘‘V’’-shaped (Fig. 19) in P. ensiformis, P. ciliaris, P. cretica, P.
multifida and P. mutilata, ‘‘U’’-shaped (Figs. 20, 21) in P. vittata and P.
denticulata, P. tristicula, P. quadriaurita, and “‘inverted Q-shaped”’ (Fig. 22) in
P. deflexa, P. exigua and P. inermis. The opening of the vascular bundle is
located towards the adaxial side in all cases.

The vascular bundle is surrounded externally by the monostratified
endodermis with thickening on the radial walls and a pericycle consisting of
(1-)2—3 cell layers surrounding the phloem and xylem (Fig. 25). Morpholog-
ically, the xylem is characterized by having curved ends in P vittata or long
bent ends which sometimes make contact with the main axis in P. denticulata,
P. tristicula and P. quadriaurita. Around the vascular bundles, strands of fibers
consist of 4-12 cells, which are isolated in small plants or together in a
continuous or discontinuous ring depending on the age of plants.

Depending on the shape of the vascular strands and xylem structure, we
propose a Classification of the vascular bundles in four possible types:

Type I. V-shaped (Fig. 19), with the ends of the xylem folded in a short
hook, with three protoxylem areas: P. ciliaris, P. cretica, P. ensiformis, P.
multifida and P. mutilata.

Type II. U-shaped, with two forms: type Il-a (Figs. 20, 26) with shortly
curved xylem ends and with five to six protoxylem areas observed in P.

oO

AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

Fics. 23-28. Cross section of petioles photographed with SEM and light microscope. 23. Cortex of
Pteris cretica L., showing epidermis, sclerenchyma (Scl) and parenchyma (Pq). 24. Cortex of Pteris
tristicula Raddi, the arrow points to the ventilation area. 25. Middle zone of the petiole in Pteris
denticulata Sw., pointing parenchyma with chloroplasts (Pq), endodermis composed of a layer of
rectangular cells (Ed), and pericycle (Pc) with more or less isodiametric cells. 26. Xylem of Pteris
vittata he arrows indicate protoxylem areas. 27. Part of the vascular bundle of Pteris deflexa
Link, the arrows point to protoxylem areas. 28. Detail of xylem interrupted by a parenchyma band
in Pteris inermis (Rosenst.) de la Sota.

j=)

yn

vittata, and type II-b (Fig. 21) with the ends long extended, sometimes
joined to the main axis, with four protoxylem areas: Pteris denticulata,
P. quadriaurita and P. tristicula.

MARTINEZ & VILTE: PETIOLE STRUCTURE IN PTERIS 7

. 29-36. SEM photographs of tracheids. 29. Helical thickening in the protoxylem of Pteris
pcsrains Sw. 30. Tracheids with scalariform thickening in Pteris mutilata L. Detail of the pits 31.
Pteris mutilata L. 32-33. Pteris cretica L. 34-35. Pteris deflexa Link. 36. Pteris inermis (Rosenst.) de
la Sota.

Type III. Inverted-Q-shaped (Figs. 22, 27), with more than ten
protoxylem areas and the xylem interrupted he parenchyma bands
(Fig. 28): Pteris deflexa, P. exigua and P. inerm

The xylem is mesarch, with protoxylem of helical to ringed walls (Fig. 29).
The metaxylem has elongated to lenticular pits (Figs. 30-36).

DISCUSSION

The external morphological characters of the Pteris petioles, such as a
central channel and two lines covering the ventilation areas, have also been

8 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

observed in Asplenium, Christella, Dennstaedtia, Microlepia, Pteridium, and
others by Lin and De Vol (1978). The brown to purple coloration of petioles, a
color also frequent in Adiantum, Cheilanthes and Pytirogramma, among
others, is attributed to the presence of tannins.

The number of steles is an important characteristic for rapid identification of
different taxonomic groups. Lin and De Vol (1978) characterized Pteridaceae
by the presence of two vascular bundles in the base of petioles that fuse
upwards. This has been found in two species, P. cretica and P. multifida,
whose xylem bundles join by the abaxial ends in the lower basal third of the
shaft. Ogura (1972) finds such development of the vascular bundle in Onoclea,
Woodsia and Athyrium, and calls it the ““Onoclea form.”

The twelve species studied have a monostelic axis from the middle petiole,
although the stele shape varies. According to the classification proposed by
Ogura (1972) for the monostelic axes, P. ensiformis, P. ciliaris, P. cretica, P.
multifida and P. mutilata present Hymenophyllaceae type stele, whereas P.
denticulata, P. quadriaurita and P. tristicula have Loxoma type vascular
strand, and P. deflexa, P. exigua and P. inermis present the Pteris podophylla
type. This author also describes two distinct types for the genus Pteris, the
Loxoma type in P. longifolia Wall., P. tremula R. Br. and P. flavellata Sieb. et
Zucc. and the Pteris podophylla type for the same species.

According to the classification suggested in this study, the type I, or V-
shaped Hymenophyllaceae type (Ogura 1972), has been mentioned for
Adiantum (Pteridaceae) and identified by Bidin and Walker (1985) as ‘‘saucer”
shaped. Ogura (1972) considers this type to be a derivative of the Loxoma type.
Lin and De Vol (1978) describe a petiole cross section of P. multifida that
matches that described here for the species.

The type II, U-shaped or Loxoma type, has been reported for P. denticulata,
P. excelsa Gaudich., P. leptophylla Sw., P. semipinnata L. and Pteris vittata
(Lin and De Vol, 1977, 1978; Gragano et al., 2001; Bondada et al., 2006). Ogura
(1972) mentioned the existence of modified forms within the Loxoma type,
due to the presence of a varying number of protoxylem areas, i.e., five in P.
longifolia L. and four to eight in P. tremula and P. flavellata. In this study, we
found differences in the number of protoxylem bundles and in the ends of the
xylem, so we proposed two different subtypes, II a and b. The first subtype is
characteristic of P. vittata while the subtype II-b, is characterized by having
ends fused to the main shaft, which gives the appearance of rounded ends, and
this is likely why Ogura (1972) considered the species of Pteris mentioned
above to have a xylem devoid of hooks.

The type III, inverted Q-shaped, has been reported for P. propinqua (Gragano
et al., 2001) and P. wallichiana J. Agardh (Lin and De Vol, 1978). This
monostelic type is considered by Ogura (1972) as a simple form derived from a
polystelic type comprising several meristeles arranged in a horseshoe, called
Saccoloma. Also Gifford and Foster (1996) qualify the monostelic condition of
vascular bundles as primitive, and the polystelic condition as specialized.
According to this criterion and considering that several interruptions caused
by parenchyma bands have been found in the Q form and the fact that the

MARTINEZ & VILTE: PETIOLE STRUCTURE IN PTERIS 9

numerous protoxylem groups are distributed regularly, we may consider this
type to be a derivative form within the genus Pteris. The presence of
parenchyma in the xylem has been cited in the rhizome of Astrolepis sinuata
(Lag. ex Sw.) D.M. Benham & Windham (Scheiner and Carlquist, 1997), but no
studies describing this feature in petioles have been found.

Potgieter and van Wyk (1992) mention the existence of intercellular pectic
projections in the petioles of many ferns, including some Pteris species. These
structures have not been recorded in the specimens studied, although specific
future studies with more precise techniques could detect them. Inthesame
way, the ultrastructural details of the xylem of these species could be studied.

The results of this work show that Pteris vittata has different characteristics in
the vascular bundles from other species of Pteris. Martinez (2010) showed that
spore characteristics of P. vittata are different from other species of Pteris. With
the spore differences, these vascular bundle results reaffirm the results of
molecular studies by Prado et al. (2007), which determined that to achieve
monophyly of Pteris P. vittata should be segregated from other species of Pteris.

ACKNOWLEDGMENTS

We thank the herbarium curators who provided the material. We also thank Sherwin Carlquist
for his valuable suggestions and review, one anonymous reviewer and the editor Jennifer Geiger
who contributed to improve this manuscript; Pedro Villagrén for his help during the scanning
electron microscopy process and Maria del C. Otero Cabada for the outline of the drawings. This
project has been subsidized by the Consejo de Investigacién de la Universidad Nacional de Salta.

LITERATURE CITED

Bini, A. and T. WALKER. 1985. Comparative — of the stipe of the fern genus Adiantum L.
apis Gard. Bull. Sing. 38(2):227-233.
gene B., C. Tu and L. Q. Ma. 2006. Su ea ce io mee ig mais aspects of Chinese brake
mm (Pteris ae se Har Brittonia. 58(3):2
alles S. a E. L. SCHNEIDER. 1997. SEM studies on iene in Ferns. Astrolepis. Amer. Fern J.
87:43—

D’ Amsrocio . Arcueso, A, 1986. Manual de Técnicas en Histologia Vegetal. Ed. Hemisferio Sur,
Buenos Aires.

GirrorD, E. M. and A. S, Foster. 1996. Morphology and evolution of vascular plants. Freeman, New
York

Gracano, D., A. ALVEs eerie nd J. Prapo. 2001. Anatomia foliar das especies de Pteridaceae do
Parque aha do Rio Doce (PERD-MG) Rvta. brasil. Bot., Sao Paulo 24(3):333-347, http://
www-.scielo. sin re eeu ries pdf

HERNANDEZ, V., T. TeRRAZAS and G. ANGELES. 2006. Anatom{a de seis especies de helechos del género
Dryopteris (Dryopteridaceae) de. México, Rev. - Biol. seiko 54(4):1157-1169. itp: //www.scielo.

sa.cr/scielo.php?script=sci_art g esandnrm
iso>. ISSN 0034-7744.

HERNANDEZ-HERNANDEZ, V., T. TERRAZA and K. MEHLTRETER. 2007. pores vegetativa de Ctenitis
separ yeni (Dryopteris, Pteridophyta). Bol. Soc. Bot. Mex. 80:7—17.

Jerrrey, E. C. 1917. The anatomy of Wood ew. Lianhveraity Chicago Press, Chicago, USA.

Ln, B. L. and - ns De VoL. 1977. Th I. Taiwania 22:91-99.

Lin, : ie and C. D. De Voi. 1978. The use ‘of stipe characters in fern texonomny Il. Taiwania
777-95.

10 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

Martinez, O. G. 2003. Morfologia esporofitica y revisién sistemdtica del complejo Pteris cretica
(Pteridaceae-Pteridophyta) en América. Tesis Doctoral. Universidad Nacional de Salta, Salta,
entina.

Martinez, O. G. 2010. Gametéfitos y esporéfitos j jovenes de cuatro especies de helechos del género
Pteris (Pteridaceae) naturalizadas en América. Rev. Biol. Trop. 58(1):89-102.
Manrtinez, O. G. and J. O. 2011. Pteris exigua (Pteridaceae), a new endemic species from
i 95-299.

Ocura, Y. 1972. Comparative anatomy of the vegetative organs of the Pteridophytes. Handbuch der
Pflanzenanatomie. Borntraeger, ae Alemania.
PortcieTer, M. J. and A. E. Van Wyk. 1992. Intercellular pectic protuberances in plants: their
structure and taxonomic . Bot. Bull. Acad. Sinica 33:295-316.
Prapo, J. and P. G. Winpiscu. 2000. The genus Pteris L. (Pteridaceae) in Brazil. Bol. Inst. Bot.
13:103-199.
Prapo, J., C. Det N., Ropricugs, A. SALatino and M. L. F. Satatino. 2007. Phylogenetic relationships
among argue including Brazilian species, inferred from rbcL sequences. Taxon
56:355—
SCHNEIDER, Et a S. Car.quist. 1997. SEM studies on vessels in Ferns. III. Phlebodium and
Polystichum. Int. J. Plant. Sci. 158(3):343-349
SCHUETTPELZ, E. and K. M. Pryer. 2007. Fern phylogeny inferred from 400 leptosporangiate species
and three Pome genes. Taxon 56:1037
Srivastava, K, 2008a. The Petiolar Structure mn se dentata (Forssk.) Brownsey and wae
thn ies Leaflets 12:96-102. http://opensiuc.lib.siu.edu/cgi/
article=1045andcontext=ebl
Srivastava, K, 2008b. Epidermal Features and Petiolar Anatomy of Angiopteris erecta (Forst.)
Ho ee hatte Peridophyts)- Ethnobotanical Leaflets 12:139-149. http://opensiuc.lib.

edu

ee z M. sal A _ F. Tryon. 1982. Fern and allied plants with special reference to tropical
America. Springer-Verlag, New York. Heidelberg. Ber
Wuire, R. A. 1974. Comparative anatomical studies of the nes Ann. Mo. Bot. Gard. 61:379-387.

American Fern Journal 102(1):11-31 (2012)

The Role of Aq ins in Water Balance in

oi

Cheilanthes lanosa (Adiantaceae) Gametophytes

Hope L. DiaMOND
University of North Texas, Risk Management Services, 1155 Union Circle #310950, Denton,
Texas 76203-5017

HEATHER R. JONES and Lucinpa J. SWATZELL*
Southeast Missouri State University, Department of Biology, MS 6200, Cape Girardeau,
Missouri 63701

ABSTRACT. oni raperias “s heoeneo ages proteins that move water specifically and bidirection-
ally in ell signaling. With aquaporins, plant cells can control how, where, and

when water moves across ere aoe Thus, plants are in strong control of their environmental
responses. Therefore, it seems likely that aquaporins would have | a key role in water balance in

osmolytes, and quantified the efflux of water from the cells was quantified. Results strongly suggest
that aquaporins may very well play a role in water balance, but also pose some questions
concerning the ability of the protonemal stage to fully manage water flow

Key Worps.—aquaporin, Cheilanthes lanosa, fern, flux, gametophyte, mercury, NaCl, osmotic
potential, sucrose, water

Water and osmoregulation has been a challenge since the beginning of
cellular life. The first protocells would have had to constantly control the
solutes and water content of the cytoplasm to maintain life. Therefore, it seems
plausible that all bacterial, protozoan, animal, fungal, and plant cells would
have and should still contain highly conserved mechanisms to move water in

and out _ cells (Chrispeels and Agre, 1994; Chrispeels and Maurel, 1994;
Maurel, 1997).

Water- soars channels for water balance, aquaporins, exist in every
kingdom and species. And, although common sense calls for the existence of
such a practical mechanism, discovery of these channels was difficult. Indirect
evidence demonstrated the rationale for such a simple mechanism at least
twenty years before their discovery. Philip (1958) reviewed the data on water
movement across lipid bilayers, and averred that the actual rate of water
movement into cells is much more rapid than what should occur across a lipid
bilayer. Yet, all future botanists were taught that water movement occurs
through osmosis across a plant plasma membrane. Finally, in 1984, aquaporins
were concurrently discovered in bovine eyes (Gorin et al., 1984) a
erythrocytes (Macey, 1984; Agre et al., 1987). Very quickly, aquaporins were

* Author for communication

12 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

identified in rat kidney tubules, fungi, bacteria, and of course, plants
(reviewed in Agre et al., 1995; Chrispeels and Agre, 1994).

One impediment to the discovery of aquaporins was specificity. Any water-
specific channel would have to exclude ions, which are smaller than water
molecules. Confusion over potential structure helped delay the search for a
water control mechanism. However, following the discovery of aquaporins, the
elucidation of the structure revealed how an organism could effectively move
water and exclude ions. The proteins are a constructed from six membrane
regions that form a spiral internal channel (Fotiadis et al., 2001). Water, which
is angled, flows through the spiraled channels but smaller molecules, such as
sodium and potassium, cannot pass through the center (Fotiadis et al., 2001).
Aquaporins are controlled by a phosphorylation switch (Johnson and
Chrispeels, 1991; Johansson et al., 1996, 1998), and thus, cells are in control
of water movement. The channels are also bidirectional; water may flow out of
cells or into cells (Steudle, 1992; Tyerman et al., 1999). For plants, this is a
perfect control mechanism. Cytoplasm solute control and aquaporin gating
combine to allow a functional cytoplasmic environment within a range of
conditions (Kaldenhoff et a/., 1993, 1995; Maurel et al., 1995; Maurel, 1997).

Studies on aquaporins have resolved many complicated questions regarding
plant functions. Aquaporins exist in xylem and phloem and help prevent
cavitation (Voicu et al., 2009). Aquaporins exist in root cortical and
endodermal cells and help generate or resolve pressure of water flow
(Vandeleur et al., 2005; Steudle and Peterson, 1998). Aquaporins in guard
cell tonoplasts respond to changes in blue light and abscisic acid and allow
water flow into and out of the vacuole (Kaldenhoff et al., 1993). Aquaporins are
also involved in water movement and management during water stress (Suga
et al., 2002).

Based on the above findings, we hypothesized that aquaporins may play a
key role in the survival of fern gametophytes in xeric environments as
mechanisms for water management. To test this hypothesis, we chose a
common North American xerophytic fern, Cheilanthes lanosa (Michx.) D.C.
Eat. for this study because it inhabits a variety of substrates (Mickel, 1979),
though it is commonly found among other xerophytic species (Mohlenbrock,
1959), and possesses many of the features that other xerophytic ferns possess,
such as microphylly (Pickett, 1931; Hevly, 1963; Quirk and Chambers, 1981),
trichomes (Quirk and Chambers, 1981), mycorrhizal associations (Palmieri and
Swatzell, 2004), cuticle on the gametophyte (Lingle et al., 2004), and the ability
to regenerate after desiccation (Diamond et al., 2003). In addition, like many
other xerophytic gametophytes, C. lanosa gametophytes are apogamous (Steil,
1933, 1939; Hevly, 1963). The gametophytes are also not heavily covered with
wax, are one-cell in thickness, and appear generally unprotected from their
surroundings. Thus, the C. Janosa gametophytes could represent the
physiological state of numerous xerophytic ferns. We predicted that if it was
possible to identify aquaporins in this fern gametophyte, and if we could
poison these proteins with low levels of mercury, which blocks the protein
channel (Preston et al., 1993; Kuwahara et al., 1997), we could effectively

DIAMOND ET AL.: AQUAPORINS IN CHEILANTHES LANOSA 13

control water movement out of desiccating cells. This would suggest at least a
potential role for aquaporins in xerophytic gametophyte water management.

MATERIALS AND METHODS

To test our hypothesis, we examined different developmental stages and in
different microclimates for the Cheilanthes lanosa gametophyte. Each
development stage and microclimate condition will heretofore be designated
as simply a “‘stage.”

Plant Collection

Cheilanthes lanosa sporophylls were collected in the fall of 2003 after the
first frost from Makanda, Illinois, placed in glass 9 cm Petri dishes, and stored
in the dark at 4°C. After several months, sporophylls were crushed using a
mortar and pestle. Cheilanthes lanosa spores average 40 um in diameter (Devi
et al., 1971) and thus spores were separated from the plant material using a
65 um brass mesh sieve. Spores were stored at 4°C in the dark.

Culture Conditions

Wet grown (WG) gametophytes and protonema! callus (callus).—Spores were
surface sterilized in a 7% (v/v) commercial bleach solution with 0.1% (v/v)
Triton X-100 for 10 min. Spores were then rinsed in sterile ddH,O and sown ona
modified tissue culture medium (TCM; 20 mM NH,NO3;, 20 mM KNOs, 1.5 mM
MgSO,:7H.0, 1.0 mM MnSO,-H,0O, 30.0 uM ZnSO,-7H,O, 0.1 uM CuSO,-5H.O,
3.0 mM CaC],-2H,0, 5.0 uM KI, 0.1 uM CoCl,-6H.0, 0.8 mM KH2PO,, 0.9 mM
H3BO3, 1.0 uM Na,MoQ,-2H,O, 0.1 mM FeSQO,:7H,O, 0.1 mM Na,EDTA,
0.23 uM kinetin, 0.86 uM 2,4-D, 0.4 uM nicotinic acid, 0.3 uM pyridoxine, 1.3 nM
thiamine, 0.56 mM myo-inositol, pH 5.7; Smith, 1992) in 9 cm Petri dishes.
Spores were incubated at 25°C in 0.175 umol-m 7-s"' of continuous far red light
(650—705 nm) for 10 d.

Following germination and protonemal development, the plates were
separated. Some plates were left in the far red light to enhance callus growth
and the remaining plates were then exposed to continuous white light and the
protonema began planar growth into gametophytes.

Dry grown (DG) gametophytes.—Dry grown gametophytes were sown on fine
grain white sand (Décor Sand, Activa Products Inc., Marshall, Texas, USA)
wetted with 20 mL of TCM and incubated as the WG and callus cultures
described above. Thereafter, upon drying, DG gametophytes wetted erratically
with ddH,O.

Antibody Production

To establish the molecular weight of the target protein, ensure specificity of
binding of the anti-aquaporin antibody, and to detect the presence of

14 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

aquaporin-like proteins in gametophytes, an antibody against maize PIP1
aquaporin was raised using a homologous sequence from previously mapped
aquaporins in maize (Chaumont et al., 2000). Rabbit anti-aquaporin antibody was
produced by Biosource (Invitrogen; Biosource, Camarillo, California, USA)
against a conserved amino terminus sequence of PIP1 maize aquaporin,
MEGKEEDVRVGANKFPERQPIGTSAQS as described by Chaumont et al. (2000).

ELISA (enzyme-linked immunosorbent assay)

In order to test for the presence of aquaporin-like proteins, an enzyme-linked
immunosorbent assay was performed to detect a wide range of aquaporin
concentrations in various gametophyte stages. Approximately 20 mg of WG
gametophyte material was homogenized in 200 uL of coating buffer (15 mM
Na2HCO3, 35 mM NaHCOs, pH 9.5) in a mortar and pestle. The sample was
then centrifuged at 10,000 rpm for 10 min. The supernatant was retained and
centrifuged again at 10,000 rpm for 10 min. The sample was then diluted in
1 ml of coating buffer. The concentration was approximately 3 ug of material
for every 50 uL of coating buffer. The antigen-coating buffer solution was then
pipetted in 50 pL increments into a 96-well polystyrene microtiter plate. The
plate was covered and allowed to incubate overnight at 4°C. The following
morning, the antigen solution was removed by inverting the plate and washing
three times with Tris-Tween washing buffer (TTW; 10 mM Tris, 150 mM NaCl,
0.1% Tween-20, pH 7.2). In all the washing steps, the wells were completely
filled (~350 uL). Plates were blocked with 3% (w/v) low-fat milk powder in
TTW for 30 min. The wells were then washed three times with TTW. Once the
TTW was removed, 100 uwL of rabbit anti-aquaporin (1:500; Biosource,
Camarillo, California, USA) in TTW, rabbit preimmune serum (1:500;
Biosource, Camarillo, California, USA) in TTW, or TTW only (secondary
antibody only control) was placed into the wells and allowed to incubate for
60 min. The wells were washed three times with TTW. The TTW was removed
and 50 uL of goat anti-rabbit horseradish peroxidase (1:500; Sigma-Aldrich, St.
Louis, Missouri, USA) in TTW, or TTW only (primary antibody only control)
was added and allowed to incubate for 60 min. The wells were again washed
three times with TTW. The chromogenic enzyme reaction was then initiated
by addition of freshly prepared solution of 1.5 mg o-phenylenediamine and
2 uL of 30% (v/v) H2O0, dissolved in 2 mL of citrate-phosphate buffer (0.2 M
NazHPO,, 0.1 M citric acid, pH 5.0) at 50 uL per well. HO, was added
immediately prior to use. The enzyme reaction was allowed to incubate for
15 min and the reaction was halted by oy addition iS 50 uL of 0.5 M H,SO,
per well. The plate was then read at 492 nm a Beckman DU640B
spectrophotometer (Beckman Coulter, =a we California, USA).

Immunoblotting

To establish the molecular weight of the target protein and to ensure
specificity of binding of the anti-aquaporin antibody, immunoblotting was

DIAMOND ET AL.: AQUAPORINS IN CHEILANTHES LANOSA 15

performed. Approximately 100 uL of Cheilanthes lanosa callus, WG, or DG plant
material was ground in homogenization buffer [10 mM KCl, 1 mM MgCl., 50 mM
HEPES, 300 mM sorbitol, 0.1% (w/v) BSA and 1 mM EDTA, pH to 7.2]. Samples
were mixed 1:1 2X Laemmli sample buffer [Sambrook et al., 1989; 4% (w/v) SDS,
10% (v/v) mercaptoethanol, 0.002% (w/v) Bromphenol Blue, 20% (v/v) glycerol,
120 mM Tris, pH 6.8], incubated for 10 min at 90° C, centrifuged at 10,000 rpm for
10 min. Total protein concentration was determined using the Bradford Assay
(Stoschek, 1990). Samples were loaded onto a 12% (w/v) polyacrylamide gel at
35 ul per well and 20 pg/mL concentration. Samples were electrophoresed at
16 mA constant current for approximately 30 min. A broad range marker
(Kaleidoscope; BioRad, Hercules, California, USA) was used for reference.
Proteins were then transferred at 45 mA constant current for 20 min onto a
nitrocellulose membrane (0.2 um pore size). Following transfer, the membranes
were rinsed three times in TTBS [137 mM NaCl, 2.7 mM KCl, 24.8 mM Tris, 0.2%
Tween (v/v)], and blocked in 3% (w/v) bovine serum albumin (BSA) in TTBS.
Membranes were then rinsed three times for 5 min each in TTBS. Membranes
were then incubated overnight at 4°C in either preimmune serum (BioSource,
Camarillo, California, USA; 1:500 in TTBS), rabbit anti-PIP1 aquaporin
(BioSource, Camarillo, California, USA; 1:500 in TTBS), or TTBS only (secondary
antibody only control). Membranes were again rinsed 3 times for 5 min in TTBS.
Following the rinse, membranes were incubated in goat anti-rabbit alkaline
phosphatase (1:500 in TTBS; Sigma-Aldrich, St. Louis, Missouri, USA), with the
exception of the primary antibody only control, which was incubated in TTBS
only, each for 1 h at 25°C. Membranes were rinsed three times for 5 min each in
TTBS. The membrane was then colorized with a fresh mixture of 20 mL of
alkaline phosphate buffer (100 mM NaCl, 5 mM MgCl», 100 mM Tris, pH 9.5),
132 uL of nitro blue tetrazolium (NBT) stock, and 66 uL of 5-Bromo-4-chloro-3’-
indolyphosphate P-Toluidine (BCIP) stock (Sambrook et al., 1989). After agitation
for 5 min, the membrane was briefly rinsed with ddH,O and the reaction was
stopped with 20 mM ethylene diamine tetraacetic acid (EDTA).

Osmolality Stress

In order to test for aquaporin function and potential control of function in
gametophyte stages, gametophytes were exposed to desiccating levels of
osmolytes with and without mercury exposure. Although the preferred test for
function of aquaporins is expression of mRNA in Xenopus oocytes (which do
not express aquaporins), PIP1 mRNA does not express well in oocytes (Preston
et al., 1992). Therefore, another standard, the immersion of samples in
mercuric chloride at low levels (1 mM; Macey, 1984) was used. Wet grown
(WG) gametophytes, callus and dry grown (DG) gametophytes were exposed to
2 separate treatments. One treatment consisted of time increments of NaCl,
CaCl, or sucrose and was used to show gametophyte response to long term
increasing environmental stress. Gametophytes were pretreated in 200 uL well
slides in 100 pL of ddH.O or ddH,O plus 1 mM HgCl, for 20 min. Gametophyte
images were captured digitally. At to, and subsequently every 5 min afterward,

16 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

50 mM increments of the respective solute were added until the solution in the
well slide reached 500 mM osmolality. Images of gametophytes were captured
after 1 h. The second treatment was used to show gametophyte response to
immediate stress. This treatment began with a 20 min pretreatment in a 200 uL
well slide in 100 mM isotonic solute solution (NaCl, CaCl,, or sucrose) or
100 mM isotonic solution plus 1 mM HgCl,. Gametophyte images were
captured digitally. At to, 400 mM of solute in 100 wL of ddH,O was added to
the well so that the solution in the well reached 500 mM osmolality. Images of
the gametophytes were captured after 1 h.

Cell volume was determined using six diameter measurements. Average
radii were used to extrapolate the sphere volume and surface area. Only hourly
rates of efflux were calculated. This is because diffusion out of these cells was
slow enough to allow the necessary resolution to demonstrate loss of function
of water channels under mercury poisoning. Well slides were incubated in a
moisture chamber in the interim times between increments to prevent water
loss from the wells. The efflux of water out of each of 100 cells from each
treatment was measured using Fick’s Law:

Flux = —PS/(Osm, —Osm;)/D]

Where -P = permeability (negative because against the concentration gradient),
S = surface area, Osm, = osmolality outside of cell, Osm; = osmolality inside
of cell, and D = distance (modified from Qui et al., 2000).

Data Capture and Image Analysis

For cell volume and trichome position, gametophyte images were captured
digitally on an Olympus SZ40 (Olympus America, Center Valley, Pennsylvania,
USA) with SPOT Advanced 3.2 software (Diagnostic Instruments, Sterling
Heights, Michigan, USA). Measurements were made using SPOT Advanced 3.2
_ software. Measurements of 100 cells were conducted for each treatment. To assess
the influence of treatment, medium, fern stage and timing, a three-way Analysis of
Variance (ANOVA; P = 0.05; n = 3600) with interaction was undertaken using
the SAS General Linear Model Procedure (SAS 1999-2000; SAS, Cary, North
Carolina, USA). A Tukey’s Studentized test was then performed to determine
significant differences between media, with a primary focus on the comparison of
HgCl, and ddH,O pretreatments. To graph individual treatments, box plots were
developed using JMP Statistical Discovery Software (SAS Programming, Serial
No. GVOKZ9JJ07, © 2007; SAS, Cary, North Carolina, USA) and modified using
PaintShopPro 6.02 (Jasc Software, Ottawa, Ontario, Canada).

RESULTS
ELISA and Immunoblotting

To establish the potential presence of an aquaporin-like protein in
germinating spores and gametophytes, ELISA was performed on callus and

DIAMOND ET AL.: AQUAPORINS IN CHEILANTHES LANOSA 17

immunoblotting was performed on DG and WG gametophytes. In ELISA,
primary antibody only, secondary antibody only, and the preimmune serum
controls were negative (Fig. 1A). The positive control, application of anti-
aquaporin antibody applied to radish root homogenate, resulted in a strong
cross-reaction of root total protein with the anti-aquaporin antibody. The
immunoblotting procedure produced a single band when the anti-aquaporin
antibody was applied to the mature gametophyte sample (Fig. 1B). Primary
antibody only, secondary antibody only, and preimmune serum controls were
negative. The positive control, application of anti-aquaporin antibody applied
to radish root homogenate, resulted in a strong cross-reaction of root total
protein with the anti-aquaporin antibody.

Increment Solute Treatments

NaCl and CaCl,.—To measure the response of different stages of gametophytes
to hyperpolarizing solutes, which destabilize plasma membranes and often alter
membrane protein function, samples were exposed to incremental increases of
NaCl and CaCl,. When preincubated in ddH,O and then exposed to NaCl
increments, callus quickly plasmolyzed to the extent that protoplasm fluid was
almost entirely extracted and chloroplasts clumped tightly with nuclei and other
cell contents (Fig 2A). Callus cells visibly plasmolyzed when exposed to slow
increments in NaCl concentrations. Mean of cell volume loss in treatments in
which NaCl was added in slow increments was 6.65:10 * cm~* + 10.85-107*
Following an incubation in HgCl,, callus flux levels significantly dropped
(Fig. 2B). Cells appear fully intact up to 500 mM NaCl. In addition, variation in
the response was greatly reduced. Mean of cell volume flux in NaCl treatments
with a HgCl, incubation prior to the incremented NaCl treatment was
0.21:10 *cm * + 0.47-10 *. Plasmolysis also occurred when WG gametophytes
were exposed to slow increases in NaCl (Fig. 2C). Mean of cell volume loss in
treatments in which NaCl was added in slow increments was 4.86-:10 * cm ° +
6.93-10 *. WG flux levels significantly dropped after the introduction of HgCl,
(Fig. 2D). Cells appear uncompromised. Standard deviations and variation was
similar for both WG treatments. Mean of cell volume flux in NaCl treatments with
HgCl, incubation prior to the incremented NaCl treatment was 0.55-:10 * cm~? +
3.23-10 *. DG gametophytes appeared to maintain cell viability in NaCl
increments up to 500 NaCl (Figs. available from author). Some cell volume loss
was visible in older cells toward the center of the gametophyte. Mean of cell
volume loss following a slow increase in NaCl was 3.96-10 * cm ° + 0.40-10~,
Mean of cell volume loss in NaCl increment treatment following a pre-incubation
in HgCl, was 0.80-10°* cm ~* + 0.15-10"*. DG flux levels significantly dropped
after the introduction of HgCly.

These results were mirrored in the CaCl, increment treatments (F ig. 3). Callus
cells visibly plasmolyze when exposed to slow increments in CaCl, concentrations
(Fig 3A). Mean of cell volume loss in treatments in which CaCl, was added in slow
increments was 12.18-10 * cm ° + 6.59-10 *. Flux in callus cell volume levels
significantly dropped following pre-incubation in HgCl, (Fig 3B). Mean of cell

18 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

S

Ss | &

oS 2 2 2 Ss

A SSFSES

™ ~ ~~ ~ ™ ~~

2° only
preimmune
C. lanosa
radish root
2° only

no sera
or antibody

?
a

Fic. 1. immunolabeling of Aquaporin-like Protein. (A) ELISA signal from cross-reaction of anti-
aquaporin antibody with callus total protein is yellow. Stronger cross-reaction due to greater
concentrations of antibody (antibody omer of 1:50, 1:100, 1:500, 1:1000, 1:5000, 1:10000)
results in more intense coloration and absorbance. Primary neety only (not Son secondary
antibody only, and preimmune serum c ieee were negative. The posit 1, anti-aquaporin
antibody cross-reaction with radish root, is not shown in this image, but is located on the same

DIAMOND ET AL.: AQUAPORINS IN CHEILANTHES LANOSA 19

volume loss following CaCl, treatment with a pre-incubation in HgCl, was
2.20-10 “ cm™ + 2.80-10-*. The treatment with pre-incubation in HgCl, also
exhibited a much smaller amount of variation than the treatment without HgCl,.
Heavy plasmolysis occurred when WG gametophytes were exposed to slow
increments of CaCl, up to 500 mM (Fig. 3C). Mean of cell volume loss in treatments
in which CaCl, was added in slow increments was 6.95-10~* cm~? + 6.59-10-7. WG
flux levels significantly dropped after the introduction of HgCl, (Fig. 3D). Mean of
cell volume loss in CaCl, increment treatments were preceded by pre-incubation in
HgCl, was 1.95-10 * cm™* + 1.23-10-*. DG gametophytes (Figs. available from
author) plasmolyzed at higher concentrations of CaCl, (up to 500 mM). Mean of cell
volume loss after increasing increments of CaCl, was 5.75-10-* cm~? + 2.381074,
DG cell volume flux levels were significantly lower when gametophytes were pre-
incubated in HgCl,. There was also a substantial increase in variation in the response
with pre-incubation in HgCl,. Mean of cell volume loss in gametophytes pretreated
with HgCl, was 2.65-10 * cm~* + 1.05-10~7.

Sucrose.—Sucrose was used to test gametophyte response to a pure osmolyte
that does not depolarize or hyperpolarize membranes (Fig. 4). Callus cells
were desiccated in a treatment of slow sucrose increments up to a total o
500 mM sucrose. Mean of cell volume loss was 9.45-10°-* cm? + 8.86-10~4.
Callus flux levels significantly dropped in treatments that included a pre-
incubation in HgCl, (Fig. 4B). Mean of callus cell volume loss was
0.09-10 “ cm™* + 0.51-10°*. In addition, variation was greatly reduced when
protonemal callus was pre-incubated in HgCl,. WG gametophytes in a
treatment in which sucrose is increased in increments up to 500 mM exhibited
some cell volume loss in older cells (Fig. 4C). Mean of cell loss in sucrose
increment treatment was 9.62:10 * cm * + 1.64:10°*. WG flux levels
significantly dropped in sucrose increment treatments that were pre-incubated
in HgCl, (Fig. 4D). Mean of cell volume loss in these treatments with HgCl,
pre-incubation was 0.48-10 * cm™* + 3.20-10~*. Variation in response
decreased markedly when gametophytes were pre-incubated in HgCl,. DG
gametophytes (Figs. available from author) experienced some cell volume loss
in treatments involving increments in sucrose molarity (up to 500 mM). Mean
of DG cell volume loss in sucrose increment treatments was 10.80-10-* cm~? +
54.15:10 *. DG cell volume loss significantly dropped in sucrose increment
treatments that included a pre-incubation in HgCl.. Variation in gametophyte
response was also less in treatments that included HgCl, pre-incubation.
Mean of cell volume loss in treatments with HgCl, pre-incubation was
0.95-10 * cm™* + 2.45-10°4.

en

plate. (B) ELISA Positive Radish Root Control. Each i blot and ELISA contained a radish root
control. PIP1 aquaporins express in germinating seeds and new plant roots and freshly germinated
radish root reliably produced a strong signal. (C) Immunoblotting procedures resulted in a single
band of total protein that cross-reacted with anti-aquaporin antibody. *= approximately 22.4 kD.
Secondary only (SO), preimmune serum (PI), and primary only (PO) controls did not result in any
cross reaction with the primary or secondary antibodies alone, or with the pre-inoculation serum.

20 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

Fic. 2. Flux in Cell Volume i Gametophytes exposed to NaCl Increments. " sage vant setae
plasmolyze when exposed to slow increments in NaCl concentrations. Mean of cell v e lo

treatments in which NaCl was levies in slow increments = 6.65-:10 *cm “3 + 10.85: e Bs 8) na, an
incubation in HgCly, callus flux levels significantly dropped. Cells appear fully intact up to 500 mM NaCl.
In addition, variation in the response was greatly reduced. Mean of cell — flux in ‘NaCl cae
with a HgCl, incubation prior to the incremented NaCl treatment was 0.21-10 * cm * + 0.47-10 *. (CG)
Plasmolysis occurred when WG gametophytes were exposed to slow increases in NaCl. sea of cell
volume loss in treatments in which NaCl was added in slow increments = 4.86-10 *cm * + 6.93-10 *. (D)
WG flux levels significantly dropped after the introduction of HgCl2. Cells appear pape asians
Standard deviations and variation was similar for both WG treatments. Mean of cell volume flux aCl
treatments with HgCl, incubation prior to the incremented NaC] treatment = 0.55-10 *cm ° + <aeoe

Immediate Immersion Treatments

NaCl, and CaCl,.—To test for differences in flux that could be based on
diffusion or aquaporin deactivation, stages were introduced to the same solute
treatments but the timing of introduction was changed to immediate
immersion in 500 mM solute. Following HgCl, pretreatment, all stages
exhibited a significant reduction in flux. Callus cells lost cell volume very
quickly when immersed in 500 mM NaCl (Fig. 5A). Mean of cell volume loss
was 6.30-10 * cm * + 3.82-10°*. Callus pre-incubated in HgCl, before
immersion remains intact (Fig. 5B). Cell volume was significantly different
than those cells treated only with NaCl. Mean cell volume loss in treatment

DIAMOND ET AL.: AQUAPORINS IN CHEILANTHES LANOSA 21

Fic. 3. Flux in Cell Volume of Gametophytes exposed to CaCl, Increments. (A) Callus cells some
plasmolyze when exposed to slow increments in CaCl, concentrations. Mean of cell volume loss
treatments in which CaCl, was added in slow increments = 12.18-10 *cm~° + 6.59-10 +. (B \Plaxi in
callus cell volume levels significantly dropped following pre-incubation in HgCl,. Mean of cell
volume loss following CaCl, treatment with a pre-incubation in HgCl, = 2.20-10°* cm~? +
2.80-10 *. The treatment with pre-incubation in gc: also exhibited a much smaller amount of
variation than the treatment without HgCl,. (C) Heavy p occurred when WG _
were exposed to slow increments of CaCl, up to 500 mM. Mean of cell volume loss in treatments
which CaCl, was added in slow increments = 6.95-10°* cm * + 6.59:10 *. (D) WG flux a
significantly dropped after the introduction of HgCl,. Mean of coll volume loss i in Cat; 2 increment
treatments were preceded by pre-incubation in HgCl, = 1.95-10 * cm 23-10 *

with pre-incubation in HgCl, was 0.26-:10 * cm * + 14.29-10-*. Variation in
responses was also reduced when callus was exposed to HgCl, pre-incubation.
WG gametophytes also plasmolyzed immediately in 500 mM NaCl (Fig. os
Mean of cell volume flux in NaCl immersion was 5.08-10 * cm? + 0.72

Conversely, change in WG cell volume was minimal following treatment iat
included pre-incubation in HgCl, (Fig. 5D). Mean of cell volume flux in
treatments that included HgCl, pretreatment was 1.85-10 * cm~* + 0.37-10~%.
Variation in flux amounts also significantly decreased in the HgCl, pre-
incubation treatment. DG gametophytes (Figs. available from author) were
visibly affected by immediate immersion in 500 mM NaCl. Mean of cell
volume loss in NaCl immediate immersion was 3.10-10 * cm ~° + 1.00-10~.
However, when DG gametophytes were pre-incubated in HgCl, prior to the
NaCl immersion, there was a decrease in cell volume loss. Mean of cell volume

22 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

Fic. 4. Gametophytes and Sucrose Increments. (A) Callus cells were mess in a treatment of
slow sucrose increments oe to a total of 500 mM sucrose. Mean of cell volume loss =
9.45-10 * cm * + 8.86-10°*. (B) Callus flux levels significantly cropped, in treatments that
included a pre- Baar asiats in HeCl. Mean of callus cell volume loss =

In addition, variation was greatly reduced when protonemal callus was pre- incubated in in HeCh. (c)
WG gametophytes in a treatment in which sucrose is increased in increments up to 500 mM
exhibited some Cell volume loss in older cells. Mean of cell loss in sucrose increment treatment =
9.62-10 ~* + 1.64-10°%. (D) WG flux levels significantly dropped in sucrose increment
treatments anes were pre- ‘incubated in Lae ean 1 of cell volume loss in these treatments with
HgCl, pre-incubation = 0.48-1 cm 20-10 “. Variation in response decreased markedly
when gametophytes were pre- peers in sai

loss in HgCl, pretreated gametophytes was 0.80-10_, cm ° + 1.55-10 *. There
was also a substantial increase in variation in the response with pre-incubation
in HgClp.

CaCl, immediate immersion (Fig. 6) results were only slightly different than
NaC] results. Callus plasmolyzed heavily upon immediate immersion in
500 mM CaCl, (Fig. is lenge of callus cell volume loss in CaCl, was
6.72-:10 * envy = 2.9 . However, callus gametophytes that were
pretreated in HgCl, a immersion in CaCl, exhibited little volume flux
(Fig ean of callus. cell volume loss in treatments with HgCl,
preincubation was 0.55-10 * cm® + 0.50-10 *. Variation in the responses also
decreased in those cells preincubated in HgCl,. WG gametophyte cells also
plasmolyzed heavily in CaCl, immediate immersion treatment (Fig. 6C). Mean

DIAMOND ET AL.: AQUAPORINS IN CHEILANTHES LANOSA 23

, “a
pes

_-

ae és -

Fic. 5. Gametophytes and NaCl Immediate Immersion. (A) alae ee en sage volume very
quickly when immersed in 500 mM NaCl. Mean of cell volume loss = em ~ = 3.62-10
(B) Callus pre-incubated in HgCl, before immersion remains intact. ee hs was significantly
different than those cells treated only with NaCl. Mean cell volume loss in treatment with pre-
incubation in HgCl, = 0.26-10 * cm * + 14.29-10-*. Callus cell volume loss significantly dropped
after the introduction of HgCly. Variation 4 in responses was also reduced when callus was exposed
to HgCl, pre-incubation. (C) WG gametophytes also — Aigeprganaecs in 500 mM NaCl.
Mean of cell volume flux in N NaCl immersion = 5.0 . (D) Conversely,
change in WG cell volume was minimal f treat included thi taken) in HgCl..
Mean of cell volume flux in uNaea that included HgCl, pretreatment = 1.85-10°* cm * +
0-*. Variation in flux amounts also significantly decreased in the HgCl, pre-
incubation treatment.

of cell volume loss in CaCl, immediate immersion was 6.77:10-* cm? +
2.76-10 *. WG gametophytes that were incubated in HgCl, prior to immediate
immersion in CaCl, showed no visible volume loss (Fig. 6D). Mean od
measured volume loss in this treatment was 0.44-:10°* cm * + 0.08-107

DG gametophytes (Figs. available from author) also underwent volume loss
following immediate immersion in 500 CaCl,. Mean of DG volume loss was
3.0410 * cm* + 1.14-:10 *. Mean of DG treatments that included pretreatment

24 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

Fic. 6. Gametophytes in ee Immediate Immersion (A) Callus namie hice ee apn
immediate i immersion in 5 CaCl,. Mean of callus cell volume loss in CaCl, =

+ 2.98-10 *. (B) Callus platen aie that were pretreated in HgCl, co fore immersion in CaCl,
exhibited little volume flux. Mean of callus cell volume loss in treatments with HgCl,
preincubation = 0.55-10 0.50-10 * iati

cells preincubated in HgCl,. (C) WG gametophyte cells also plasmolyzed heavily in CaCl,
immedi ale imm nersion treatment Mean of cell volume loss in CaCl, immediate immersion =
6.7710 * cm” 2.7610 “. (D) WG gametophytes that were incubated in HgCl. prior to
immediate immersion in CaCl, 2 showed no visible volume loss. Mean of measured volume loss in
this treatment = 0.44-10 * cm * + 0.08-10—

in HgCl2 was 0.49:10 * cm® + 0.16-10 *. There was also much less variation in
the response with respect to volume loss. Overall, callus was the most
vulnerable to desiccation from NaCl and CaCl, introduction. DG gametophytes
were the least affected and visually seemed impervious to NaCl and CaCl,
perturbation.

Sucrose.—Sucrose introduction following pretreatment with ddH,O result-
ed in a mode of very little or no water loss in callus (Fig. 7) and WG stages
(Fig. 7). Mean of callus cell volume loss was 0.24-:10°* cm’ * + 0.98-10 4
(Fig. 7A). Callus cells that were preincubated in HgCl, experienced ba = in

oe ace (Fig. 7B). Mean change in cell volume gain was 0.10-10 7
0.4 . Variation in cell volume was less in treatments that inched a

DIAMOND ET AL.: AQUAPORINS IN CHEILANTHES LANOSA 25

Fic. 7. Gametophytes in sag Immediate Immersion (A) Callus cell moderately plasmolyzed
ey immediate immersion in 500 mM sucrose. Mean of callus cell volume loss =

+ 0.98-10 *. (B) Callus cells aed in 500 mM sucrose took on cell volume during ——
that tachaded a preincubation in HgCl,. Mean change in cell volume = 0.10-10°7 cm~
0.48-10 *. Variation in cell volume decreased in treatment that included a preincubation in any
(C) WG gametophyte cells sequins lost no cell volume in 500 mM sucrose, but that result was
highly variable. Mean of cell loss when immediately immersed in sucrose = 0.91-10°* cm~* +
3.00-10 *. (D) WG sce heen that were pretreated with HgCl, also showed very little cell
volume loss and the variation was quite pein in ate seeped to the treatment with sucrose alone.
Mean volume loss in this treatment = 0.93-10°* cm

preincubation in HgCl, than those preincubated in ddH,O. WG gametophyte
cells statistically lost no cell volume in 500 mM sucrose (Fig. 7C), but that
result was highly daca Mean of WG cell loss when immediately immersed
in sucrose was 0.91:10 * cm * + 3.00-10 *. WG gametophytes that were
pretreated with HgCl, also showed very little cell volume loss and the variation was
quite small in comparison to the treatment with sucrose alone (Fig. 7D). Mean
volume loss in this treatment was 0.93-10 * cm™* + 0.24-10° +. Likewise, when WG
gametophytes were pretreated with HgCl., cells showed very little cell volume loss
and the variation was quite small in comparison to the treatment vias sucrose
alone. Mean volume loss in this treatment was 0.93-10 * cm ~° + 0.24-10~7, The

26 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

response to 500 mM sucrose in DG gametophyte cells (Figs. available from author)
was similar to that of the WG gametophytes. There was some cell volume loss and
the results were highly variable. Mean DG cell volume loss was 0.55-10 * cm™? +
5.04:10 *. When DG gametophyte cells were preincubated with HgCl., volume loss
dropped dramatically with much less variation. Mean of cell volume loss in this
treatment was 0.24-10 * cm * + 0.76-10 *

DISCUSSION

Aquaporin-like proteins were present in all stages of gametophyte growth
and play a role in water balance. Overall, HgCl, pretreatment inhibited water
loss in all stages and even resulted in water uptake in some treatments of
thinly walled protonemal cells.

Presence of an Aquaporin-like Protein

Results from ELISA controls, the preimmune serum, primary antibody only
control, and secondary antibody only control, were negative. Preimmune serum,
which is serum from rabbits prior to inoculation with the polypeptide that
correlates with the N-terminus of aquaporins (Chaumont et al., 2000), did not show
any aquaporins from plants. The primary antibody bound to a single band only
when followed by the secondary antibody and neither antibody bound alone. In
addition, the antibody bound strongly (not shown) in ELISA and immunoblotting
treatments to radish root homogenate (total protein fraction) as a positive control for
the procedure. Germinating radish seeds were used as a positive control since PIP1
aquaporins are found primarily in germinating seeds and young shoots (Chaumont
et al., 2000). Cross reaction of anti-PIP1 antibodies and radish antigen produced a
strong signal. In all gametophyte samples, signal increased linearly with the
concentration of the antibody. Significant levels of signal (2-3 times control) were
detected in all stages. Immunoblotting resulted in no detectable bands with the
preimmune serum control, primary antibody only control, and secondary antibody
only control. Only one band in the range of 28 kD, (Agre et al., 1987) was observed,
thereby excluding cross-reactivity with other proteins. Taken together, these data
suggest that the antibody bound to only one antigen and the procedure was
reasonably free of background signal. They also suggest that a PIP1 aquaporin-like
protein is found in all stages of gametophyte growth

Mercury and Aquaporin Function

PIP1 aquaporin-like protein presence and function in Cheilanthes lanosa
gametophytes is partially responsible for water balance. Because the primary
risk for gametophytes in an arid environment is desiccation (Boullard, 1979;
Raven et al., 2003), a test of efflux of water from three types of gametophytes
was performed: the first, presumably most vulnerable stage, the protonemata
[maintained on agar as callus under red light (Raghavan, 1980; Raghavan et
al.,1989)], the more mature gametophyte [maintained on agar and prompted to
mature by blue light (Raghavan, 1980; Raghavan et al.,1989), and mature

DIAMOND ET AL.: AQUAPORINS IN CHEILANTHES LANOSA 27

gametophytes grown in drier conditions [on sand, erratically watered
(Diamond and Swatzell, 2003)]. These were exposed to different types of
solutes. NaCl and CaCl, were used to hyperpolarize plasma membranes and
sucrose was used as an osmolyte (Lodish et al., 2008). In all solutes, the
gametophytes were introduced to up to 500 mM of solutes, either in one large
increment or though gradual increments in molarity. Mercury pretreatments in
all solutes were adequate to slow or stop water efflux for up to 1 h, even in
500 mM NaCl. Mercury is a direct aquaporin poison (Maggio and Joly, 1995;
Heymann et al., 1998). It binds to a cysteine within the water channel and
blocks water movement (Preston et al., 1993; Zhang et al., 1993).

Although greater concentrations of HgCl, could block water movement more
aggressively, mercury can also affect other physiological functions in plants
(Macey, 1984). The preferred method to show aquaporin function involves the
introduction of potential aquaporin mRNA into Xenopus oocytes. These
oocytes are among the few types of cells that do not express aquaporins.
Subsequent production of aquaporins in oocytes prompts water influx and cell
disruption (Preston et al., 1992). However, PIP1 aquaporins do not express
well in Xenopus oocytes (Chaumont et al., 2000). Therefore, a minimum of
mercury was used, 1 mM HgCl, (Carvajal et. al., 1996; Maggio and Joly, 1995;
Kaldenhoff et al., 1995), which effectively blocked water flow for the duration
of the test. Results suggest that aquaporins are responsible for the majority of
water flow across C. lanosa plasma membranes, since without HgCl, in the
same respective salt or sucrose solutions, cells immediately desiccate.

Cellular Control of Aquaporin-like Protein Function

Mercury treatment, however, can only show the basic function of aquaporins
in gametophytes. Beyond basic function, control mechanisms can alter the way
aquaporins function (Luu and Maurel, 2005). Changes in plant cell response to
environmental perturbation suggest changes in control methods or activity
(Luu and Maurel, 2005). For this reason, gametophytes were challenged with
desiccation risk in two different ways. In the first set of tests, gametophytes
were exposed to slowly increasing osmolalities. Cells were isotonic at 100 mM
of NaCl. For perspective, this concentration would completely plasmolyze a
tomato plant cell (Maggio and Joly, 1995). In ddH.0, callus cells were rounded
with substantial turgor. As the solute concentration increased, however, to
what would be considered by most plant cells to be a devastating
concentration, cells often lost water. Mercury pretreatment was able to block
this loss, suggesting flow through aquaporin-like proteins. Most cells were able
to avoid desiccation until they reached approximately 350 mM solute
concentration. For example, after ddH,O pretreatment, most callus cells were
completely plasmolyzed by the time they reached 500 mM of solute and almost
entirely desiccated, with roughly only enough volume for organelles.
Desiccation occurred in the final 10-15 min as the environment solution
increased beyond 350 mM of solute. However, preincubation in HgCl,
apparently poisoned the major route of water loss. This suggests the presence

28 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

of proteins that are aquaporin-like in nature and function but does not test
cellular control.

In the second set of tests, the immediate immersion tests, gametophytes were
exposed to immediate and violent increases in solutes (Figs. 5-7). Gameto-
phyte response to hyperpolarizing NaCl and CaCl, (Figs. 5, 6) were
appropriately dramatic. Gametophytes desiccated. Due to the hyperpolarizing
nature of the solutes, there should have been no control over an aquaporin-like
protein (Luu and Maurel, 2005; Qui et al., 2000). The channels would have
opened and cells would have predictably desiccated just as the results
showed. However, when presented with a true osmolyte, sucrose, the
gametophytes with intact and controllable aquaporin-like proteins should
have been able to alter aquaporin-like protein function and shut off water
efflux (Luu and Maurel, 2005; Chaumont et al., 2000). Predictably, with
immediate immersion in sucrose (Fig. 7), gametophytes maintained water
balance. Variation may be due to differences in the ability to defer diffusion or
differences in development and physiology induced by their respective
microenvironments. Therefore, the immediate immersion tests were able to
demonstrate control of aquaporin-like protein function. [Higher plants control
aquaporin function through phosphorylation (Maurel, 1997). Blue light also
stimulates PIP function and inhibits TIP, which suggests signal transduction
and cellular control (Ma et al., 2001).

One exception to the differences between increments and immediate
immersion experiments was the treatment of the DG gametophytes with
sucrose. The treatment means were generally the same (0.0005) in preincu-
bation with ddH2O. However, the immediate immersion treatment is revealing.
In the immediate immersion treatment, preincubation with ddH,0, there is a
huge variation in response. Yet, with preincubation of HgCly, there is little or
no efflux. Clearly, the one difference between these two treatments is the flow
of water across the membrane. The rapid influx of water may destabilize the
cell and force the cell to rapidly adjust internally (Fitter and Hay, 1987; Taiz
and Zeiger, 2006). The large amount of variation possibly suggests the
occurrence of numerous signal transduction events or vacuolar adjustments
that would characterize a stress response (Fitter and Hay, 1987; Taiz and
Zeiger, 2006).

Conclusion

In the first stage of the fern life cycle, protonemal cells express aquaporins, but
have thin cell walls and no cuticle. These cells are vulnerable to desiccation.
They are also at risk in hypotonic situations. The one thing that protonema can
control is aquaporin function. When perturbed, protonema can prevent
immediate desiccation by disrupting water flow. However, the much slower
osmotic diffusion would eventually result in desiccation. It is not surprising,
then, that the protonemal stage thrives in sedimentary rock outcrops, which
provide a small and continuous amount of water in the optimal amounts for the
gametophytes (Dooley and Swatzell, 2002). WG gametophytes are somewhat

DIAMOND ET AL.: AQUAPORINS IN CHEILANTHES LANOSA 29

better at desiccation resistance in the face of sucrose, but membrane
hyperpolarization in NaCl and CaCl, still promote rapid desiccation. Admit-
tedly, a Petri dish and agar medium is atypical habitat. The effects on
development and function may not be meaningful by themselves. What WG

owth does show in conjunction with the DG, more typical growth, is that
natural development confers resistance to desiccation. Under long term stress,
regardless of the nature of the season, the mature gametophyte in its natural
habitat is undeniably impervious to desiccation. This may be the fate of the C.
lanosa gametophyte generation. The fern’s ability to survive desiccation appears
to be limited by that brief but vulnerable protonemal stage and by its very need
for aquaporins to manage water balance and uptake. Its mechanism for water
uptake can become the pathway of its water loss.

ACKNOWLEDGMENTS

Funding for this study was provided by the Grants and Research Fundi ing Committee of
Southeast Missouri State University. The authors thank Dr. Hite, Truman University, and Janese
Jones for many helpful discussions.

SUPPLEMENTAL DATA WEBSITE

http://cstl-csm.semo.edu/ tzell/AFJ/di 12011.htm

LITERATURE CITED

Acre, P., D. Brown and S. Nissen. 1995. Aquaporin channels: Unanswered questions and
unresolved controversies. Bae Opinion in Cell Biology 7:472—483.

Acre, P., A. M. Sasoort, A. Asimos and B. L. Smir. 1987. Purification and partial characterization of
the M, 30,000 integral me an e protein associated with the erythrocyte Rh(D) antigen.
Journal of Biological Chemistry 262:17497-1750

BouLLarb, B. 1979. Considerations sur la Symbiose Fongique chez les Pteridophytes. Syllogeus 19.
National Museum of Natural Science, Ottawa. pp. 1-61.

CarvajaL, M., D. T. Cooxe and D. LARKSON. 1996. Responses of wheat plants to nutrient
deprivation may sass regulatian of water-channel function. Planta 199:372-381.
Cxaumont, F., F. Barrieu, R. Junc and M. J. Curispeets. 2000. Plasma membrane MIP proteins

from maize cluster in two sequence subgroups with differential eaiarag activity. Plant
Physiology 122:1025-1034.
Curisreeis, M. J. and P. Acre. 1994. Aquaporins: water channel proteins of plant and animal cells.

CurispeeLs, M. J. and C. Mauret. 1994. Aquaporins: The — — of Facilitated Water
Movement through Living _ owed Plant Physiology 105:9—

Devi, S., B. K. Nayar and I. W. Kn 1874. cei morphology vg some American species of
Cheilanthes and Notholaena. pret 11:27-3

Diamonp, H. L. and L. J. SwatzeLu. 2003. ecu of — species. http://www.american-
fernsoc. org/pages/swatzell/cultivation.. of | — _speci.htm. American Fern Society.

Diamonp, H. L., H. - JONES, J. Jonas and 7° ATZELL. 2003. Vater balance in the xerophytic fern
Chllantoslnoee M American Society of Plant Biologists, Ames, IA. March.

Dootey, M. A. and L. J. Swarze.t. 2002. Porosity and specific retention of Eminence-Potosi
Dolomite Limestone from Cheilanthes feei eH in southeast Missouri. Botanical Society of
America. Madison, WI. August

30 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

Fitter, A. H. and R. K. M. Hay. 1987. Environmental Physiology of Plants. 2nd Edition. Academic
Press Limited, London.

Fotiapis, D., P. Jenos, T. Mini, S. Wirtz, S. MuLLER, L. Fraysse, P. KjELLBoM and A. ENGEL. 2001.
Structural haracactiettion of tw iene isolated from native spinach leaf plasma
eer The Journal of Biological lar oaied 19:1707-1714.

Gorin, M. B., S. B. Yancey, J. Cine, J. P. Reve and J. H . 1984. The major intrinsic protein
(MIP) of the alae lens fiber era i ahaa and structure based on cDNA
cloning. rg 9-59.

HevLy, R. H. 19) Ae of cheilanthoid ferns to desert environments. Journal of the Arizona
pies “d Science 2:164—

peg J. B., P. Acre and A. ENcEL. 1998. Progress on the structure and function of aquaporin 1.

rnal of chances Biola ee 191-206.
ics. I., C. Larsson, B. Ex and P. KjELLBom. 1996. The major integral proteins of spinach a
ma alae are putative aquaporins and are phosphorylated in response to Ca**
apoplastic water potential. Plant Cell 8(7):1181-1191.

JoHANSsON, I., M. Karisson, V. K. SHukia, M. J. CHRISPEELS, C. Larsson and P. KjELLBOM. 1998. Water
transport activity of the plasma aa aquaporin PM28A is regulated by phosphoryla-
tion. The Plant Cell 10:451-459.

Jounson, K. and M. Curispeets. 1991. Tonoplast-bound protein kinase phosphorylates tonoplast
intrinsic protein. Plant Physiology 100:1787-1795

Ka.penuorF, R., A. KSLuING and G. Ricurer. 1993. A euvel blue light- and abscisic acid- inducible
gene of Arabidopsis thaliana encoding an intrinsic membrane protein. Plant Molecular
Biology 23:1187-1198.

KaLDENHOFF, R., A. KSLLING, J. Meyers, U. KARMANN, G. Ruppet and G. RicuTer. 1995. The blue light-
responsive AthH2 gene of om Nees thaliana is primarily expressed in expanding as well
as in differentiating cells and encodes a putative channel protein of the plasmalemma. Plant
Journal 7: 5

Kuwanara, M., Y. Gu, K. IsHipasut, F. Marumo and S. Sasaki. 1997. cpp ag residues and
pore site in AQP3 water channel. Biochemistry 36(46): nee

LincLte, M. A., H. L. DitaMonp and L. J. Swarzeti. 2004. ne ng a Cheilanthes lanosa
gametophytes. Student Research ‘Conference: Southeast Missouri State University, Cape
Girardeau, Missouri. April.

LopisH, H., A. Berk, S. L. Zipursky, P. Matsuparra, D. BALTIMORE one DarneELL. 2000. Molecular Cell
Biology, 4th ed. W. H. Freeman, New York, New York. 11

Luu, D.-T. and C. Maur... 2005. Aquaporins in a challenging aan molecular gears for
ae plant water status. Plant, Cell and Environment 28:85-

Ma, L., J. Li, L. Qu, J. Hacer, Z. CHEN, H. ZHao and X. W. Dene. 2001. Light control of Arabidopsis
deve elopsiset ou en re oo regulation of genome expression and cellular pathways.
The Plant Cell 13:2

Macey, R. I. 1984. Tran eee ee cae and urea in red blood cells. American Journal of Physiology
246(Cell Physiology 15):C195—C203.

Maccaio, A. and R. J. Jory. 1995. Effects of hlorid the hydrauli ductivity of tomato
root systems. Plant — _ 331-335

Maur, C., R. T. Kano, J. Gue M. J. Connrests, 1995. ggg pss ate nsvepnioon ia water

channel eat of the mae pt aquaporin o-TIP. The O Journal 14:302 5:

MaureL, C. 1997. Aquaporins and water permeability of plant x ise pe ual review io Plant

ee and Plant Molecular Biology 48:399-429.

MickeL, J. T. wit set A Know the Ferns and Fern Allies. WCB McGraw-Hill, St. Louis, MO. 229 pp.

MOHLENBROCK bi: ween in Jackson County, Illinois. Bulletin of the Torrey
parry as peed 109—

Patmieri, M. and L. J. es cine Mycorrhizal fungi associated with the fern Cheilanthes
lanosa os southeast Missouri and southern Illinois. Northeastern Naturalist 11(1):57-6

Pup, J. R. 1958. Osmosis and diffusion in tissue: Half-times and internal gradients. Plant
rite: ~ 27

Pickett, F. L. 1931. Notes on gerephytic ferns. American Fern Journal 21(2):49-57.

DIAMOND ET AL.: AQUAPORINS IN CHEILANTHES LANOSA 31

Preston, G. M., T. P. Carroii, W. B. Guccino and P. Acre. 1992. Appearance os water channels in
Xenopus oocytes expressing red CHIP28 — perteae 256:385-—387.

Preston, G. M., J. S. Junc, W. B. Guccino and P. . The mercury-sensitive os at
cysteine 189 in the CHIP28 water cheat he ee - Biological Chemistry 268:

Qui, Q. S., Z. Z. Wane, N. Zuanc, Q. G. Car and R. X. Jianc. 2000. Aquaporins in the eis
membrane of leaf callus protoplasts of ‘Actin deliciosa Var. deliciosa cv. Hayward.
Australian eesti of Plant sea bata A 257

Qurk, H. ~~ C. CHampers. 1981. D sip ah in Cheilanthes with special reference to the

nohyic. Fern Gazette 12(3):121-129

pete i 1980. Cytology, sieecice: and biochemistry of germination of fern spores.
ai caietappes agit of Cytology 62:69-11

RaGHavan, V. 9. Developmental biology of ae gametophytes. Cambridge University Press,
Cambri ay

Raven, P. H., R. F. Ever and S. E. EicHHorn. 2003. The biology of plants. 6th Edition. WH Freeman

and Company.
SAMBROOK, \. E. F. Fritch and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual.
olume 3. 2nd edition. Cold Spring Harbor Laboratory Press
SteiL, W. N. 1933. New cases of apogamy in certain homosporous leningperauaiats ferns. Botanical
a

Ste, W. N. 1939. Apogamy, apospory and parthenogenesis in the pteridophytes. The Botanical
Review a 433-453

STEUDLE, E. 1992. The biophysics of plant water: iba pn oars: coupling with metabolic
processes, and water flow in plant roots. In Water and Life: A Comparative Analysis of Water
Relationships at the Organismic, Cellular, and Molecular spies Springer-Verlag, Berlin. pp.
173-204.

STEuDLE, E. and C. PeTerson. 1998. How Does Water Get Through Roots? Journal of Experimental
Botany 49(92) Soe he

STOscHEK, C. - Quantitation of Proteins. Methods in Enzymology: Guide to Protein

Puriaton ae 0-60.

SmitH, R. H. 1992. Plant Tissue Culture: Techniques and Experiments. Academic Press, Inc, San
Diego, ne ae pp.

Suca, S., S. Komatsu and M. Magsuima. 2002. Aquaporin isoforms responsive to salt and water
stresses and phytohormones in radish seedlings. Plant Cell Physiology 43(10):1229-1237.

Taiz, L. and E. Zeicer. 2006. Plant Physiology. 4th Edition. Sinauer Associates, Inc., Sunderland,

Massachusetts.

TyERMAN, S. D., H. J. BonNnert, E. Steupie and J. A. SmirH. 1999. Plant aquaporins: Their molecular
biology, biophysics a significance for plant water relations. Journal of Experimental
Biology 50:1

VANDELEUR, R., C. Nicer 1ETZ, J. TILBROOK and S. D. TyERMAN. 2005. Role of aquaporins in responses to
root irrigation. Plant and Soil 274:141-161.

Voicu, M. C., J. E. K. Cooke and J. J. Zwiazex. 2009. Aquap
flow in bur oak (Quercus macrocarpa) leaves ‘in polation to the light response of “ee bate
conductance. Journal of fea pregend 60(14):40

ZHANG, R., A. N. VAN Hokk, J. Brwerst and A. S. VERKMAN. 1 vie poi oint mutation at cysteine 189
blocks ee water parmeability of rat kidney water channel CHIP28k. Biochemistry
32:2938—2941.

American Fern Journal 102(1):32—46 (2012)

The Effects of Exogenous Cytokinin on the Morphology
and Gender Expression of Osmunda
regalis Gametophytes

Gary K. GrEER*, MarGarRET A. DretricH, JosepH A DEVoL, and Apri REBERT
Grand Valley State University, Biology Department, 1 Campus Drive, Allendale, Michigan 49401

Asstract.—The goal of this study was to determine the function of cytokinin in the morphological
development and gender expression of gametophytes of Osmunda regalis, a member of
o al

gametophyte size (area), disrupted correlations observed in the control between rates of apical
notch formation and thallus widening, increased the proportions of asexuals and males, decreased
the proportion of females in the population, and correspondingly increased male reproductive
effort (antheridia per unit thallus area) and decreased female reproductive effort (archegonia per
unit thallus area) compared to the control. Low concentrations of exogenous kinetin increased the

ameters were independent of gametophyte size and gender. Thus, variance in the rate and
planes of cell division and patterns of cell expansion and casein. most likely genetic in
basis, were observed in the control, and the observed effects of exogenous kinetin were more than a
simple “‘push” towards a phenotype already present in the contro

Key Worps.—cytokinin, development, kinetin, leptosporangiate, fern, gametophyte, morphology,
Osmunda regalis, gender expression

Current models of phytohormonal control of seed plant shoot apical
meristems (SAM) emphasize the role of cytokinin (Stahl and Simon, 2010;
wa et al., 2007; Kyozuka, 2007; Sablowski, 2007; Hwang and Sakakibara

2006; Kepinski, 2006; Shani et al., 2006; Hudson, 2005; Rashotte et al., 2005;
Higuchi et al., 2004). Cytokinin maintains indeterminism and stimulates cell
division in SAM and apical dominance and other source sink relationships.
Cytokinins are also involved in a wide range of developmental processes
including vascular development and senescence (Mok and Mok, 2001),
phyllotaxy (Guilini et al., 2004), cotyledon expansion (Stoynova-Bakalova
t al., 2003; Huff and Ross, 1975), and chloroplast maturation (Stetler and
Laetsch, 1965), and they are involved in a wide range of responses to abiotic
and biotic stimuli, including light responses, drought resistance, ion uptake,
pathogen defense and symbiont interaction (Werner and Schmiilling, 2009). In
contrast, cytokinins have the opposite developmental role in the root apical

*Author for correspondence

GREER ET AL.: EFFECTS OF EXOGENOUS CYTOKININ ON OSMUNDA REGALIS oo

meristem, where they control root meristem size via regulation of auxin
distribution (which stimulates cell proliferation and maintains totipotency in
the root apical meristem (RAM); Stahl and Simon, 2010; R&Ziéka et al., 2009),
stimulate elongation and differentiation in the transition zone (Moubayidin
et al., 2009; loio et al., 2008; Kyozuka, 2007), and stimulate root nodulation
(Frugier et al., 2008). Plant reproduction is also governed by SAM behavior;
however, mechanisms governing gender expression and reproductive effort
(unit investment into reproduction per unit vegetative investment) vary widely
among and within plant groups (Tanurdzic and Banks, 2004). In taxa where
phytohormones rather than sex-determining genes control gender expression,
cytokinins are associated with reproduction (e.g., flowering) and femaleness
(Tanurdzic and Banks, 2004; Khryanin, 2002; Lejeune et al., 1988).

In mosses, cytokinins also play a key role in SAM behavior in the
gametophyte, governing the transition from a filamentous protonema to a 3-
dimensional leafy thallus (Cove et al., 2006). Whereas picomolar concentra-
tions of kinetin initiate the formation of caulonema initials that produce
filamentous growth, micromolar concentrations stimulate the assembly of 3-
dimensional buds in Funaria hygrometrica Hedwig (Schumaker and Dietrich,
1997; Bopp and Jacob, 1986). This change in morphology was initiated by a
dramatic swelling of the initial and a subsequent change from periclinal to
oblique and anticlinal divisions. Our search of the literature failed to find
studies investigating the role of cytokinins in moss reproduction.

Among the majority of leptosporangiate families, morphological develop-
ment of the gametophyte proceeds from spore germination through filamen-
tous and spathulate forms culminating in a cordate form that exhibits taxon-
specific propensities for subsequent elongation and branching (Nayar and
Kaur, 1971). The transition from a spathulate to a cordate form reflects an
increase in the rate of anticlinal divisions (i.e., perpendicular to the apical
surface), as opposed to periclinal and oblique divisions, in a single plane
within the single-celled or pluricellular apical meristem and prolonged
meristematic activity by its derivatives (von Aderkas and Cutter, 1983).
Formation of the apical notch characteristic of a cordate morphology is
reproductively significant in the taxa in which it occurs as it always precedes
female gender expression (i.e., production of archegonia). In species with an
antheridiogen system, sensitivity to antheridiogen diminishes with the onset
of an apical notch. Thus, to the extent that cytokinin influences the rate and
orientation of cell division of the apical meristem, it governs morphological
form and gender expression in leptosporangiate fern gametophytes.

Cytokinins have been identified in leptosporangiate fern sporophytes (Stirk
and van Staden, 2003 and citations therein); however, our search of the
literature did not any find reports regarding cytokinin functions in these
plants. Similarly, we found only two reports regarding the role of cytokinins in
leptosporangiate gametophyte development (Menendez et al., 2009: Spiro
et al., 2004). Pico and nanomolar concentrations of kinetin (BAP, 6-
Benzylaminopurine) induced formation of the notch meristem Ceratopteris
richardii Brongn. grown in the dark, resulting in a decrease in thallus length:

34 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

width ratio (Spiro et al., 2004), partially overcoming etiolation. Exogenous
cytokinin did not accelerate the rate of reproductive maturation in this study;
however, the possibility of a delay in reproductive maturity or effects on
gender expression and reproductive effort (gametangia per unit thallus area)
were not explored. In contrast, micromolar concentrations of exogenous BAP
delayed formation of an apical notch and production of gametangia in light-
grown gametophytes of Blechnum spicant (L.) Smith (Menendez et al., 2009).
In the same study, endogenous levels of six cytokinins were found to be higher
in female than in male gametophytes in this species. These observations
establish the presence of cytokinins in sporophytes and gametophytes of
leptosporangiate ferns, the influence of light on cytokinin response by
gametophytes, and that, like seed plants, cytokinins are associated with the
maintenance of an apical meristem and female gender expression of
gametophytes.

The study we report here investigated the effects of exogenous kinetin on
morphological development, gender expression, and reproductive effort in
Osmunda regalis L., a member of Osmundales, sister-group to all other extant
leptosporangiate ferns (Smith et al., 2006; Pryer et al., 2004). Our goal was to
generate information regarding cytokinin that may be useful in reconstructing the
evolution of developmental mechanisms in leptosporangiate fern gametophytes.

MATERIALS AND METHODS

Spores of the fern O. regalis were collected from a minimum of three
sporophytes growing in Pigeon Creek Park, Ottawa County, Michigan, and
stored in aggregate for 10 days at 3°C. Preliminary experiments using spore
sterilization and antibiologicals (Nystatin® and streptomycin) resulted in
reduced germination and atypical morphology, namely branched rather than a
non-branched, globular form. Thus, the green spores of this species were
repeatedly centrifugally rinsed, but, not surface sterilized in our study. No
bacterial, fungal, or algal contaminations were observed throughout the study.

Concentrations (1 nM, 1 4M, and 1 mM) of kinetin were prepared with C-fern
nutrient media (Carolina Biological Supply) and 1.5% agar with the control
group containing only nutrient media. Each treatment was replicated five
times. Spores were sown at an approximate density of four per cm’ and the
plates arranged in a fully randomized design under full spectrum lights
producing light levels of approximately 29.5 umol~', m~?, sec ' at dish level
using a 16 hour light: 8 hour dark-regime at 20°C.

Data collection.—Six weeks after sowing, gametophytes were harvested
haphazardly from the lowest density neighborhoods within each plate, totaling
30-35 gametophytes per treatment. Although efforts were made to create an
even density of gametophytes within each plate, variation occurred.
Gametophytes in high-density neighborhoods are subject to competitive
interactions resulting in reduced growth rate (Greer, 1993; Huang et al.,
2004) and more vulnerable to damage during harvest and were therefore
avoided. The harvested gametophytes were fixed with Clarion©® mounting

GREER ET AL.: EFFECTS OF EXOGENOUS CYTOKININ ON OSMUNDA REGALIS 35

medium as semi-permanent slides. Dissecting microscopes were used under
uniform magnification to digitally photograph each gametophyte. Morpholog-
ical traits were measured in pixels using the trace measurements feature in
SigmaScan Pro 5.0 (Fox and Urich, 1993) following the methodology of Greer
and Curry (2004) and included thallus area (size), thallus length, thallus width
and notch depth. Thallus length extends from the caudal “tail” to the apical
notch. Notch depth was measured as an extension of the thallus length line
terminated by a line that connects the anterior apex of each thallus lobe.
Thallus width was measured as the longest possible line perpendicular to the
thallus length line. Silhouettes are shown at the same scale; scale shown with
silhouette taken from 1 nM kinetin treatment. Three morphological metrics,
thallus length / width ratio (LW), notch depth / thallus length ratio (NDL), and
shape factor (SF = circularity = 4x X (object area / perimeter’); 0 = line, 1.0 =
a perfect circle) were used to assess developmental status, namely develop-
ment of an apical notch. As a fern gametophyte develops, its NDL and SF are
expected to increase and its LW decrease as a notch-bearing apical meristem
develops and, subsequently, widening growth outpaces lengthening growth.
Although included here for comparative purposes, Greer et al. (2009) rejected
shape factor as a reliable metric of developmental status. Each gametophyte
was also scored for the number of antheridia and archegonia present.

Data analyses.—One-way parametric or non-parametric (Kruskal-Wallis)
ANOVA were used to test for treatment effects on thallus size and shape.
Bonferroni multiple comparisons were used following significant parametric
ANOVA and Tamhane’s T2 multiple comparisons were used following
significant Kruskal-Wallis ANOVA. Spearman’s ranked correlations were used
to compare relationships among thallus size and the three morphological
metrics within each kinetin treatment group.

Chi-square tests of independence including all four kinetin concentrations
were used to test for treatment effects on gender ratios. When a multi-treatment
chi-square was found significant, pair-wise chi-square tests of independence
were performed between all six treatments pairings. Parametric and Kruskal-
Wallis ANOVA were used to test for treatment effects on numbers of antheridia
and archegonia per gametophyte after adjusting for thallus size and each of the
three morphological metrics; i.e., size and morphologically-based measures of
reproductive effort. Bonferroni and Tamhane’s multiple comparisons were
used accordingly.

Assumptions of normality and homogeneity were tested using Kolmogorov-
Smirnov’s and Levene’s tests respectively. P-values were considered signifi-
cant when = 0.05 and marginally significant when between 0.05 and 0.10.
When warranted, P-values were adjusted using Bonferroni-Holm’s correction
for multiple comparison error rates.

RESULTS

Treatment effects on morphology.—All gametophytes were cordate at
harvest. Of the morphological traits assessed, only gametophyte area differed

36 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

among kinetin treatments (Table 1). Gametophytes exposed to the highest
kinetin concentration (1 mM) were approximately 50% smaller than
gametophytes all other treatment groups (Fig. 1a, e—h). Visually consistent
but statistically non-significant declines in LW and SF, and to a lesser extent
NDL, were observed with increasing kinetin concentration (Fig. 1b—h).

Thallus area did not correlate with the three morphological metrics within
any treatment group. Among the three morphological metrics, correlations
involving NDL were the strongest and most frequently significant, whereas
correlations involving SF were the weakest and least frequently significant
(Table 2). Thallus NDL correlated negatively with LW in all treatments
(maximum R* = —0.404 in the 1nM Kinetin treatment) except within the
highest (1 mM) kinetin treatment. Similarly, NDL correlated negatively with
SF in the control and lowest (1 nM) kinetin treatment (Table 2). LW correlated
positively with SF (maximum R* = 0.258) only in the 1 uM kinetin treatment.
Thus, control thalli possessing deeply formed apical notches tended to have
wider thallus widths relative to their lengths and more linear silhouettes than
thalli with shallowly formed apical notches (Fig. 2), and these relationships
weakened (i.e., became non-significant) at higher (1 uM and 1 mM) kinetin
concentrations (Fig. 1).

three metrics used to assess the morphology of O. regalis

gametophytes, NDL correlated more strongly with LW and SF, than either of
the latter with one another. A similar observation was made by Greer et al.
(2009) in assessing gametophyte morphology of O. regalis and Athyrium filix-
femina (L.) Mertens, thus, NDL appears to be the most reliable of these metrics
for assessing the developmental status of leptosporangiate species with
gametophytes that form an apical-notch. However, each metric provides a
slightly different insight and we recommend using all three metrics when
assessing gametophyte morphology and reproductive effort.

TaBLE 1. ANOVA of morphological traits ane Osmunda regalis gametophytes exposed to 0, 1 nM,
1 uM, and 1 mM concentrations of kinet

Parametric ANOVA Groups Df MS F r

Thallus Area Between = 6S. haga 40.04 <0.001
Within 128 1.32
Total 13%

Thallus Length / Width (LW) Between 3 0.006 1.88 0.135
Within 128 0.003
Total ion

Notch depth / Thallus Length (NDL) Between 3 0.001 0.039 0.990
Within 128 0.012
Total 131

Thallus Shape Factor (SF) Between 3 0.006 1.32 0.271
Within 128 0.004

GREER ET AL.; EFFECTS OF EXOGENOUS CYTOKININ ON OSMUNDA REGALIS 37

2s

Thallus
Area (pixels)
>
au
oS
o
l

2700 + } Control

(b)

Thallus
Length / Width

0.34 - 1nM

(c)

Notch depth /
Thallus Length
i=]
&
|

0.50 -

are srsnmpens
1pM 1mM
Kinetin concentration

2s
Thallus Shape Factor
oO
8
l

Fic. 1. Morphological measurements (a—d) and representative silhouettes (e-i) of O. regalis

gametophytes measured in pixels in response to 0 (control), 1 nM, 1 uM, and 1 mM kinetin
treatments. Treatments ai the = letter are — menihcethy different (P > 0.05) from one
another based on Bonferroni mult ests (a—d). Linear morphological measurements

are shown with the silhouette taken feck the aba and are described in the methods.

Treatment effects on reproductive traits—No differences in thallus area,
NDL, LW or SF were observed among gender categories within the control or 1
mM kinetin treatments (Table 3).

Gender ratios differed only between the highest (1 mM) kinetin treatment
group and all lower treatment groups with one exception (Fig. 3). The
proportion of asexuals and males in the 1 mM kinetin treatment group
increased significantly relative to the control by 48% and 876% (0.48 and 8.76-
fold) increase, respectively (Fig. 3). Expected values for males in the lower
kinetin treatment groups fell below five therefore results from chi-square tests
for this gender should be viewed with caution. Correspondingly, the

38 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

TaslLe 2. Spearman’s ranked correlation coefficients (R*) between morphological traits among
Osmunda regalis ppecontiny exposed to 0 (control), 1 nm, 1 uM and 1 mM kinetin treatments.
Asterisks indicate P-value = 0.05. N = number of gametophytes per treatment group.

Thallus Length / Width Notch Depth / Thallus Thallus Shape Factor
Length (NDL) (SF)

Control (N = 42)

Area —0.022 —0.021 —0.0003

LW —0.320° 0.058

NDL —0.149"
1 nM Kinetin (N = 26)

Area —0.011 0.027 —0.032

LW —0.404° 0.258

NDL —0.309°
1 uM Kinetin (N = 32)

Area —0.230* —0.003 —0.016

LW —0.325° 0.001

NDL —0.076
1 mM Kinetin (N = 32)

Area —0.0007 —0.041 0.005

LW 0.047 0.082

NDL —0.062

proportions of females in the 1 mM kinetin treatment group decreased
significantly (58%) relative to the control (Fig. 3). The only other kinetin
treatment with detectable effects on gender expression was the lowest (1 nm)
kinetin treatment, where the proportion of females was marginally (P < 1.0)
greater than in the control or 1 mM kinetin treatment (Fig. 3). Differences in the
proportion of hermaphrodites were non-significant among all treatment groups.

Significant differences in the number of antheridia per antheridium-bearing
gametophyte were detected only when corrected for thallus area (Table 4,
Fig. 4a—d). Gametophytes in the 1 mM treatment groups possessed more
antheridia after correcting for size than in all lower kinetin treatment groups
(Fig. 4a). Similarly, gametophytes in the second highest (1 uM) kinetin
treatment group possessed more antheridia than those in the control (Fig. 4a).

In contrast, no significant differences in the number of archegonia per
archegonium-bearing gametophyte were observed when corrected for thallus
area, but were observed when corrected for each of the three morphological
metrics (Table 5, Fig. 4e—h). Gametophytes in the 1mM treatment group
possessed fewer archegonia, when corrected for NDL, LW or SF, than those in
the control and lower kinetin treatments (Table 5, F ig. 4e—h). Interpretation of
gametophyte reproductive effort is straightforward when gametangium
production is adjusted for thallus area; however, adjustments using morpho-
logical metrics that are themselves fractions (e.g., number of archegonia /
(notch depth / thallus length)) require careful interpretation as there are three
means by which such a measure of reproductive effort can change in the same

GREER ET AL.: EFFECTS OF EXOGENOUS CYTOKININ ON OSMUNDA REGALIS 39

g 0.55; : R? = -0.320, P < 0.01
5 0.50 +
5 . .
S 0.45) Peery gee.
z oe *. 3 Pog .
(a) 2 pn '
& 0.35} es ee
en « ee *
3 0.30; oe
os
= 0.25
— R* = -0.149, P< 0.05

(b

Shape factor
°
3

0.10 0.20 0.30 0.40 0.50 0.60 0.70
Notch depth: Thallus length ratio

Fic. 2. Significant correlations among morphological metrics within the control. Scatterplots of
notch depth: thallus length ratio versus (a) thallus length: width ratio and (b) shape factor. R? an

values taken from Table 2. Silhouettes of representative thalli possessing fae desks low NDL
and high LW and SF (c) and comparatively high NDL and low LW and SF (d); shown at same scale.

direction. Three comparisons between the morphological and reproductive
data support the conclusion that the decline in the 1 mM kinetin treatment in
archegonium production when corrected for morphological status reflects a
biologically meaningful decrease in reproductive effort: (1) thallus LW
declined (visually) in stepwise manner (Fig. 1b), whereas archegonia / LW
remained essentially constant among the lower kinetin treatments and
declined 51% in the 1 mM kinetin treatment relative to the control (Fig. 4b);
(2) NDL showed no visual change with increasing kinetin concentration
(Fig. 1c) yet archegonia / NDL declined 46% in the 1 mM treatment relative to
the control (Fig. 4c); (3) SF decline began (visually) with the 1 nM kinetin
treatment (Fig. 1d), whereas archegonia / SF declined 53%, relative to the
control, only at 1mM kinetin treatment (Fig. 4d).

DIscussION

At the higher concentrations used in this study (1 uM and 1 mM), exogenous
kinetin reduced the size (area) of O. regalis gametophytes, disrupted the

40 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

TaBLE 3. Kruskal-Wallis ANOVA of pong size and morphology among gender categories in the
control and 1 mM kinetin treatments. Only one male occurred within the control; however,
exclusion of males did not change the outcome of the analysis and were therefore retained here.
NDL = Notch depth / Thallus length. LW = Thallus length / width. SF = Shape factor. N =
number of gametophytes per treatment group.

Control 1 mM Kinetin
Mean Mean
Trait Gender N rank i P N rank r P
Area Asexual 8 19.25 3.506 0.320 9 14.44 0.742 0.863
Male* 1 21.00 vs 16.29
Female a2 20.18 7 18.14
Hermaphrodite 11 24.00 9 17.44
NDL _ Asexual 8 22.00 2.037 0.565 2 13.67 0.714 0.870
Male* 1 15.00 7 16.43
Female 22 21.23 7 19.86
Hermaphrodite 11 22:27 9 16.78
LW Asexual 8 17.88 1.005 0.800 9 14.67 0.793 0.793
Male* 1 24.00 7 17.00
Female 22 21.77 7 19.29
Hermaphrodite 11 23.36 9 15.78
SF Asexual 8 21.63 0.349 0.951 9 18.22 4.726 0.631
Male* . 11.00 3 17.00
Female 22 23.50 ‘4 16.29
Hermaphrodite 11 18.34 9 14.56

*Exclusion of males did not change the significance of these analyses and were therefore retained.

positive correlation between apical notch formation (NDL) and the rate of
thallus widening (LW and SF) observed in the control, increased the
proportions of asexuals ae males and decreased the proportion of females
in the population, and correspondingly increased male reproductive effort and
decreased female reproductive effort. In the control, thalli with a compara-
tively deep apical notch tended to be wider (relative to length) and possess a
more circular silhouette relative to thalli with a comparatively shallow apical
notch; however, morphological status was independent of gametophyte size.
These observations reveal variance, potentially genetic in basis, in the
prevailing rate and planes of cell division and patterns of cell expansion and
differentiation. Variations in gametophyte size and morphology in the control
were not associated with differences in gender, therefore the effects of
exogenous kinetin treatment on notch development, thallus sane gender
expression, and reproductive effort were more than a simple “‘push’’ towards a
phenotype already present in the control. In contrast, Huang et g (2004)
observed the following size hierarchy among one year-old gametophytes of
Osmundastrum cinnamomeum (L.) C. Presl: female — hermaphrodite — male —
asexual, with females three times larger than hermaphrodites. Osmundastrum
is sister to all other genera within extant Osmundales (Metzgar et al., 2008).
Assuming O. regalis exhibits similar gender-based size hierarchies at the same age
and densities as Osmundastrum, latent differences in size or, correspondingly,

GREER ET AL,: EFFECTS OF EXOGENOUS CYTOKININ ON OSMUNDA REGALIS 41

AMF*H AF*H AMF*H H

| 3 Hermaphrodite
7 = 1.339, P = 0.201

80:
> Wi Female
oS 77 = 17.263, P< 0.001
- 60 -
2 Male
CT) 7 = 6.648, P = 0.011
« 40;

[] Asexual
20 7 = 3.897, P = 0.048

0 1nM ‘14uM 1mM
Kinetin concentration

growth rate in six week-old gametophytes have on gender expression increase
with gametophyte age.

Production of archegonia in O. regalis, as with all known cordate-forming
leptosporangiate ferns, is preceded by the formation of a pluricellular apical
meristem and corresponding apical notch. Reduction of female reproductive
effort by exogenous kinetin was largely independent of thallus area and closely
associated with measures of cordate morphology (i.e., NDL, LW and SF),
reflecting the activity of the apical meristem.

In contrast, the stimulating effect of high levels of exogenous kinetin on the
frequency of males and on male reproductive effort (i.e., the rate of
antheridium production) was associated with its reducing effect on thallus
area. All gametophytes in this experiment were observed only once, six-weeks
after spore sowing, and all were cordate, therefore the timing of antheridium
development relative to the development of an apical notch is unknown. The
sequence of gender expression in Osmundales is poorly known. A male to
hermaphrodite sequence was reported for Osmundastrum cinnamomea
(Huang et al., 2004) which, as noted above is sister to all other extant genera
within Osmundales, and O. regalis (Klekowski, 1973), and Todea barbara (L.)
T. Moore (von Aderkas and Cutter, 1983); however, the relationship between
apical notch formation and antheridium production was not reported in these
studies. In a time-series study of multispore populations of congeners O.
lancea Thunb. and O. japonica Houtt., Hiyama et al. (1992) observed
antheridia only after, or corresponding to, the formation of a cordate

42 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

TaBLe 4. ANOVA of ee adjusted rates of antheridium production among male and

hermaphrodite O. regalis gametophytes exposed to O (control), 1 nM, 1 and 1 mM

concentrations of kinetin. NDL = No Si depth / Thallus length. LW = Thallus length / width.
= Shape factor. N = sumber of gametophytes per treatment group.

Parametric ANOVA Groups df MS F Pr
Antheridia / NDL Between 3 4.917 0,306 0.821
Within 42
otal 45
Kruskal-Wallace ANOVA Kinetin Concentration N Mean Rank x” P
Antheridia / Area 0 12 14.75 15.56 0.002
1 nM 5 17.20
1 uM TS 22.19
1 mM 16 33.13
Antheridia / LW 0 AS 468; 37 2.856 0.414
1 nM 5 23.80
1 uM 13 24.38
1 mM 16 26.69
Antheridia / SF 0 12 20.00 1.380 0.710
1nM 5 22.80
1 uM 13 26.15
1mM 16 24.19

morphology. Similarly antheridia were observed only after the formation of an
apical notch in a time-series of O. cinnamomeum isolates, (Hollingsworth
et al., in press). Thus, antheridium production in Osmundastrum and at least
two species of Osmunda appears to be dependent upon the formation of an
apical notch. If cordate dependence of antheridium production exists in O.
regalis as well, it would explain why the effect of exogenous kinetin on
antheridium production was independent of NDL, LW or SF. The rate of
antheridium production in O. regalis also appears to be largely independent of
DL, LW and SF among cordate gametophytes, but is dependent on area as
evidenced in the control. This may reflect the fact that antheridia were
produced in the basal region, the region most independent of the influence of
the apical meristem. As was observed in the control, variations in size and
morphology were not associated with differences in gender in the highest
(1 uM) kinetin treatment. Thus, the effects of kinetin on female and male
reproductive efforts appear to be independent of latent, potentially genetic,
differences in the rates of growth and development. The absence of males in
the lowest kinetin treatment (1 nM) group and corresponding increase in the
proportion of females relative to the control and 1 uM kinetin treatment supports the
hypothesis that cytokinin effects on gender expression are concentration dependent.
The morphological and reproductive changes in O. regalis induced by high
levels of exogenous kinetin are most readily explained by one or more of the
following effects on the apical meristem: (1) an increase in the ratio of
anticlinal versus periclinal-oblique divisions, (2) reduced expansion of
derivatives, and (3) a delay in the differentiation of the derivatives.

GREER ET AL.: EFFECTS OF EXOGENOUS CYTOKININ ON OSMUNDA REGALIS 43

as
s 0.88- % ma
< 0.70- B < av
© AB et,
(a) § 0.53- (e)€ os-
= aD
2 0.35- £ Oty
& x ee
< 0.18- oe
0.5-
12- A
dnt gee eer
(b)S ¢_ € 12-
= 6 (f) 3
2 aa T o 9-
5 ae
2 34 E i
0- =
5 oy
me a 18- A A
- 4 Z 15- A
a4 o
() § 6-4 { (9) 12 |
ts o
7 © 2 9-
& =
<5 < 6- t
0-
8-4
LL Pees u 12 ae .
= ae G A 4
s 5 5 10.0-
Cc sist —_
OF 4 | (hy § 7.54 | |
S mes o
2 ; i = 5.0- T
$e * 25-
+ T iB sara T
Control 1nM 1pM i1mM Control 1nM 1pM 1mM
Kinetin concentration Kinetin concentration

Fic. 4. Production of gametangia per O. regalis gametophyte after correcting for size (area) and
morphology in response to 0 (control), 1 nM, 1 uM, and 1 mM kinetin treatments. Archegonia per
pixel area was multiplied 100 fold for visual purposes. Treatments that possess the same letter are
not significantly different (P > 0.05) from one another based on Bonferroni and Tamhane’s T2
multiple-comparisons tests.

Greer et al. (2009) also increased the cytokinin: gibberellin ratio in O. regalis;
however, they did so by lowering endogenous gibberellin levels. Nevertheless,
they also observed an increase in the proportion of asexual and male
gametophytes, suggesting that the cytokinin: gibberellin ratio may be more
important than absolute phytohormone levels in determining the specifics of
cell division and differentiation. If a high cytokinin: gibberellin ratio is
necessary for production of archegonia, then these observations emphasize that
exogenous cytokinins do not precisely mimic the effects of endogenous
cytokinins as revealed by the control in the present study.

In contrast to the present study using kinetin, exogenous cytokinin (BAP)
accelerated the development of an apical notch and significantly decreased

44 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

TaBLe 5. ANOVA of genre coen! adjusted rates of archegonium Arey hone female
and hermaphrodite O. regalis gametophytes exposed to 0 (control), 1 nM, and 1 mM
concentrations of kinetin. NDL = Notch depth / Thallus length. LW = vik re / with: SF =
Shape factor. N = number of gametophytes per treatment group.

Parametric ANOVA Groups df MS F P
Archegonia / Thallus Area Between 3 0.185 0.891 0.449
Within 97
otal 100
Kruskal-Wallace ANOVA Kinetin Concentration N Mean Rank x? P
Archegonia / LW 0 33 52.15 14.52 0.002
1nM 24 o2.30
1 uM 28 62.04
1 mM 16 2/31
Archegonia / NDL 0 33 69.57 26.24 <0.001
1 nM 24 77.08
1 uM 28 82.56
1 mM 16 37.81
Archegonia / SF 0 33 53.64 15.71 0.001
1 nM 24 53.13
1 uM 28 60.71
1 mM 16 25.38

LW in dark-grown gametophytes of Ceratopteris richardii (Spiro et al., 2004).
Similarly, exogenous BAP reduced LW and delayed the production of both
antheridia and archegonia in Blechnum spicant and endogenous levels of six
cytokinins were higher in females than in males (Menendez et al., 2009). The
different results between these studies of core-leptosporangiate species and the
present study of a member of the Osmundales may underscore phylogenet-
ically relevant differences in phytohormonal controls of development.

ACKNOWLEDGMENTS

* +} 5 as mie ie . £ Pode | wl:
sh to B t t 1]

versions of this manuscript.

LITERATURE CITED

Bopp, M. and Jacos, H. J. 1986. Cytokinin effect on branching and bud formation in Funaria. Planta

169:462—464

Cove, D., M. Brzanita, P. Harries and R. QuATRANO. 2006. Mosses as model systems for the study of
metabolism ad developadmat Annu. Rev. Plant Bio. 57:497-520

Fox, E. C. and G. Uric. 1993. Sigma-scan user’s manual. Jandel Scientific, San Rafel, California.

Frucirr, F., S. Kosuta, J. D. Murray, M. Crespt a gy K. SzczyGLowskI. 2008. Cytokinin: secret agent of
symbiosis. Trends Plant Sci. 13:115-12

Greer, G, K. and D. Curry. 2004. ornate interactions g cordate gametophytes of the lady
fern, Athyrium filix- gegen Am. Fern ;

Greer, G. K., IcH, S. Stewart, J. Deva and A. Repert. 2009. Morphological functions of

M. Dretr
gibberellins in eon am fern oo inibbghte into the evolution of form and
gender expression. Bot. J. Linean Soc. 159:

GREER ET AL.: EFFECTS OF EXOGENOUS CYTOKININ ON OSMUNDA REGALIS 45

Greer, G. K. 1993. The influence of soil topography and spore-rain density on gender expression in
gametophyte populations of the homosporous fern Aspidotis densa (Brack. in Wilkes)
Lellinger. Am. Fern J. 84:54—59

seis S., E. Anpres and G. Greer. In press. Pheromonal Interactions Among aa

Osmundastrum cinnamomeum and the Origins of Antheridiogen Systems in Leptos

Guiini, A., J. Wanc and D. cn i 2004. Control of phyllotaxy by the cytokinin-control response
regulator ae BPHYL1. Nature 430:1031-1034

Hicucu, M., M. S. — M. P. rage ONEN, K. MIyaKaw1, y. Hasuimorto, M. Sexi, M. Kosayasui, K.
Suinozaki, T. Kato, S. Tapata, Y. HELARRIUTA, M. SussMaN and T. Kampanro. 2004. In planta
ser of the Abide cytokinin receptor family. Proc. Nat. Acad. Sci. US
101:8821—882

Hiyama, ee R. age HI rand M. Kato. 1992. Comparative development of gametophytes of Osmunda
Jancea and O. japonica oe Adaptation of Rheophillous gametophyte. The
Botanical Magazine, Tokyo 105:215-225,

Huane, Y., H. Cuou and W. Cuiovu. 2004. ts affects gametophyte growth ~ sexual expression

n Osmunda cinnamomea (Osmundaceae, Pteridophyta). Ann. Bot. 94:229-232.

‘Ginn A. 2005. Pl cages pea mobile mediators of ‘ell fate. Curr. Biol. = 803-805

Hurr, A. K. and C. W. Ros 5. Promotion of radish cotyledon enlargement and pedicdeg sugar
content by zeatin i cael ari Plant Physiol. 56:429-433

Hwane, I. and H. Saxkakipara. 2006. Kinetin biosynthesis sik perception. Physiol. Plantarum
126:528—-538.

Toro, R. D., F. S. Linnares and S. pogens 2008. Emerging role of cytokinin as a regulator of cell fate.
Curr. Opin. Plant Biol. 11:2

KepinskI, S. 2006. Integrating hormone signaling and patterning mechanisms in plant development.

Opin. Plant Biol. 9:28-34.

oan. V.N = ~~ Role of hci in sex determination in plants. Russ. J. Plant Physiol.
49:6

Be ist EI : . 1973. Genetic =. in seta regalis a Am. J. Bot. 60:146—154.

KurRAKAW , N. Uspa, M. Maekawa, K. Kos HI, M. Kosuipa, Y. Nacato, H. SakakiBpara and J.
see 2007. Direct ceded of shoot cacao caters by a cytokinin-activating enzyme.
Nature 445:652-6

Kyozuka, J. 2007. Control of shoot and root meristem function by cytokinin. Curr. Opin. Plant Biol.

10:442-446.

LeJEEUNE P., J. Kiner and G, BERNIER. 1988. Reiner pit during floral induction in the long day
plant Sinapis alba L. Plant Physiol. 86:1095—
_—. V., M. A. Revitta, M. A. Fat and H. Fae 2009. The effect of cytokinins on growt
sexual pling development in the gametophyte of Blechnum spicant L. Plant Cell Tiss.

Ore. 96:245—
Metzcar, J. S., J. ee E. A. Zimmer and K. M. Prver. 2008. The Paraphyly . Osmunda is
Confirmed by Phylogenetic Analyses om Seven Plastid Loci. Syst. Bot. 33:31-3
Mok, D. and M. C. Mok. 2001 Annu. Rev. Plant Phy oe 52:89-118.
Movsayipwn, L., R. Di Mamsro and S. Sasatini. 2009. Cytokinin-auxin crosstalk. Trends Plant Sci.
14:557-562.
Nayar, B, K. and S. Kaur. 1971. ernest of nore pipe ferns. Bot. Rev. 37:295-396.
Pryer, K. M., E. Scuuerrpiez, P. G. Woir, H. Scunemer, A. R. Smrru and R. Cranritt. 2004. Phylogeny

and evolution of fers Siaclighytas} with a focus on the early leptosporangiate divergences.
Am. J. Bot. 91:1582-1598.
Rasuotte, A. M., H. it K, B. B. MAxweLL and J. J. Keser. 2005. The interaction of kinetin with other
signals. Physiol. Plantarum 123:184—194
RwzicKa, K., M. SIMA8KOvA, J. Ducierca, J. PETRASEK, E. ZaZIMALOVA, S. ~~ J. Frm, M. C. E. Van
84—428

SaBLowskI, R. 2007. din dynamic stem cell niches. Curr. Opin. Plant iy 10:6
Setilive ac activity of the gibberellins in the antheridium nan of Anemia
phillitidis. rete 201:98—99.

46 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

Scuumaker, K. S. and M. sepa 1997. Programmed changes in form during moss development.
The Plant Cell 9:1009-110

SHANI, E., O. Yanai and N. Ori. ie The role of hormones in shoot apical function. Curr. Opin.
Plant sige 9:484—489.

SmitH, A. R., K. M. Pryer, E. ScHeurrpetz, P. Korratt, H. ScHNewer and P. Wotr. 2006. A
classification for extant ferns. Taxon 55 :705— 731.

Spiro, M. D., B. Torasi and C. N. Cornet. 2004, I d d
dark-grown gametophytes of Ceratopteris richardii. Plant ‘Cell hats 45(9): 1252-1260.

STAHL, Y. and R. Simon. 2010. Plant pr Bore nee shared functions and regulatory
mechanisms. Curr. Opin. shan Biol. 13:53-5

STETLER, D. A. and W. M. Laers pence ages piace chloroplast maturation in cultures of
tobacco tissue. Science an pee

Stirk, W. A. and J. vAN STADEN. 2003. pete of cytokinin-like compounds in to aquatic ferns
and their exudates. Environ. Exp. Bot. 49:77—85.

Stoyonova-BakaLova, E., E. Karanov, P. Perrov and M. A. Hat. 2003. Cell ctl and cell
expansion in cotyledons of Arabidopsis seedlings. New Phytol. 162:471-4

Tanurozic, M. and J. A. Banks. 2004. Sex-determining mechanisms in sete The Plant Cell
16: :

von Aperkas, P. and E. G. Cutter. 1983. The role of the aaa in pe arin rie development of
osmundaceous fern Todea barara (L.) Moore. Bot. Gaz.
Werner, T. and T. SCHMULLING. 2009. Cytokinin action in plant preeriies iia ae Opin. Plant Biol.
12:1—12.

American Fern Journal 102(1):47—54 (2012)

Optimization of Protocol for Isolation of Genomic DNA
from Leaves of Selaginella Species Suitable for RAPD
Analysis and Study of their Genetic Variation

SAYANTANI Das, MAumITA BANDYOPADHYAY, and Susir BERA*
Centre of Advanced Studies, Department of Botany, University of Calcutta, 35, B.C.Road,
Kolkata- 700019, India

Asstract.—A simple and efficient protocol for isolating genomic DNA from leaves of Selaginella
spp. (S. delicatula, S. repanda, S. bryopteris, S. plana, S. monospora) was developed, involving a
modified CTAB protocol of Rogers and Benedich (1994). Increasing the incubation time with the
Saas buffer (1X CTAB) from 1-3 hours to 12-14 hours helped achieve higher quantity
genomic DNA from the specimens, when compared with DNA extracted by protocols reported by
pce et al. (1983), Murray and Thompson (1980) and Doyle and Doyle (1987). The DNA yield
ranged from 846-1836 ug/ml from fresh and herbaria-preserved leaf samples. The DNA samples
were found suitable for genetic diversity analysis with Random Amplified Polymorphic DNA
(RAPD) markers. Nine random primers (OPA A17, OPB 4, OPB13, OPC 2, OPC 11, OPD 5, OPG 2,
OPG 19 and OPK 10) were studied, of which two primers (OPD 5 and OPG 2) yielded reproducible
amplification profile of polymorphic fragments.

Key Worps.—DNA extraction, RAPD, Selaginella, modified protocol

Selaginella (spike moss) is an enigma in the plant kingdom. At present only
one genus is recognized in the Selaginellaceae, i.e., Selaginella (Family
Selaginellaceae, Order Selaginellales, Class Lycopsida). The genus Selaginella
is cosmopolitan in distribution and contains approximately 700 species that
include temperate, tropical, frost-tolerant arctic, and drought-tolerant desert
species. Such extremes are very rarely found in the same genus, and hence
the family Selaginellaceae has been treated differently and sub-divided
into myriad taxa by researchers (Spring, 1850; Braun, 1857; Baker, 1883;
Hieronymus, 1901; Walton and Alston, 1938; Jermy,

Selaginella shows morphological variation within species and as such it is
difficult to distinguish species depending on traditional morphology only.
Thus, researchers have concentrated on molecular phylogenetic analysis to

ain information about its evolutionary relationships. A recent molecular
phylogenetic analysis of the genus has revealed that rates of molecular
evolution among species are remarkably high, including when compared to the
angiosperm families (Korall and Kenrick, 2004). Although many subtle
morphological and developmental differences exist between species, few of
these differences are phylogenetically useful markers for classifying the
species in a way that is consistent with molecular data (Korall and Kenrick

* Corresponding author: berasubir@yahoo.co.in

48 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

2002, 2004). In this perspective, studies involving isolation and characteriza-
tion of DNA are very useful, since they open up the possibility for detection of
an evolutionary pattern that implies both morphological and genetic changes.
Molecular marker based phylogenetic studies (e.g., RAPD, ISSR, SNP, etc.)
have been utilized in complementing and supplementing morpho-taxonomy
in many cases. The success of these procedures relies on inexpensive, rapid
and simple DNA extraction methods (Weishing et al., 1995), as they require
large amounts of high quality genomic DNA.

The main aim of the present study is to evaluate different protocols of DNA
isolation and to standardize a protocol for obtaining better DNA yield and
amplification quality for RAPD analysis from milligram amounts of living and
herbarium Selaginella leaf specimens. The use of dried herbarium specimens
is essential due to the unavailability of suitable quantity of required plant
material from the living plant materials. The detriment is that satisfactory
quantity and quality of DNA from herbarium specimens cannot be obtained
due to the rapid degradation of plant material during preservation. DNA
isolation from dried specimens usually requires some modifications to
frequently used protocols (Rogers, 1994) to ensure quality DNA extraction
from even very small amounts of dry herbarium tissues are available. Here we
report a DNA isolation protocol from milligram amounts of both living and
herbarium plant materials that has been standardized and proved to be suitable
for RAPD analysis.

MATERIALS AND METHODS

Sample collection.—Selaginella samples including S. delicatula (Desv. ex
Poir) Alston, S. repanda (Desv. ex Poir) Spring, S. bryopteris (L.) Baker, S. plana
(Desv. ex Poir) Hieron., S. monospora Spring were collected from the Darjeeling
district (West Bengal) and Nainital (Uttarakhand) regions of India. Herbarium
specimens were obtained from the Calcutta University Herbarium (CUH).

Genomic DNA isolation.—Genomic DNA was extracted from fresh and dried
leaf samples using several reported protocols, including those of Dellaporta
et al. (1983) (Protocol 1); Doyle and Doyle (1987) (Protocol 2); Murray and
Thompson (1980) (Protocol 3); Rogers and Benedich (1994) (Protocol 4). A
modified Rogers and Benedich (1994) protocol was devised to increase DNA
yield. The essential modification is an increase in the incubation time which
involves incubation of supernatant containing DNA after a second chloroform-
isoamyl alcohol extraction with 1X CTAB overnight, instead of 1-3 hours as
reported in the original protocol, and an additional step of RNase treatment
was added, when required.

The modified protocol of Rogers and Benedich, 1994 (Protocol 5) that was
standardized is as follows: fresh leaves (0.5 g) frozen at —20°C for 7-15 days or
herbarium or dried leaves of Selaginella (0.2 g) were freeze dried in liquid
nitrogen and crushed in a mortar and pestle. The crushed powder was
transferred to a 50 ml tube and mixed with 2X CTAB extraction buffer
(2% CTAB, 100 mM Tris, 20 mM EDTA, 1.4 M NaCl, 1% PVP) with

DAS ET AL.; ISOLATING GDNA FROM SELAGINELLA 49

§-mercaptoethanol, warmed at 55°C before use. The mixture was incubated
while shaking at 66°C for 45 minutes. Then an equal volume of chloroform:
isoamyl alcohol (24:1) was mixed and gently shaken for 10 minutes at room
temperature. The mixture was centrifuged for 20 minutes at 10,000 rpm and
the supernatant was recovered to which 1/10 volume of 10% CTAB warmed at
55°C was added. Equal volume of chloroform:isoamy] alcohol (24:1) was added
again and mixed gently. The mixture was centrifuged at 10,000 rpm for
20 minutes. The supernatant was pipetted into a new tube and 2 volumes of 1X
CTAB were added to it; after mixing, it was incubated overnight at room
temperature. The mixture was centrifuged for 20 minutes at 10,000 rpm. The
pellet thus obtained was dissolved in high salt TE to which 2 volumes of ice-
cold ethanol were added and the mixture was incubated overnight at —20°C,
and later centrifuged at 10,000 rpm for 10 minutes. The pellet was washed
with cold 80% ethanol before centrifugation for 5 minutes at 10,000 rpm. The
pellet containing nucleic acids thus obtained was dried and redissolved in
30 ul TE and stored

In the case of DNA extraction from fresh Selaginella specimens, an
additional step of RNase treatment was required. The RNase treatment was
not an essential step for the herbarium specimens as RNA interference is
absent in the case of preserved specimens.

The extracted genomic DNA was tested for purity index (Azgo/Azgo
absorbance ratio) on UV-VIS Spectrophotometer and for size, purity and
integrity on 1% agarose gel at 80V for 40 minutes.

Polymerase Chain Reaction.—PCR reactions for RAPD analysis were
performed in a 25 ul volume containing 100 ng genomic template DNA,
2.5 ul of reaction buffer, 100 mM dNTP mix, 2.5 ng primer (random primer,
Operon Technologies), and 3 U/ul Taq polymerase. Amplification was
performed in a Gradient Thermal Cycler (Eppendorf). The reaction mixtures
were amplified in an initial step of 94°C for 3 min and then subjected to 35
cycles of the following program: 94°C for 1 min, 37°C for 1 min, 72°C for 1 min.
After the last cycle, the temperature was maintained at 72°C for 8 min.
Amplified DNA was electrophoresed in a 1.2% agarose gel containing
ethidium bromide and photographed on a UV transilluminator. Amplification
products generated by a few decamer primers from OP series (Operon
Technologies) are presented in the current study.

RESULTS

When a modified version of the original CTAB protocol (Rogers and
Benedich, 1994) was used for the extraction of DNA from the dried herbarium
and living leaves of different species of Selaginella, DNA yield and quality was
significantly increased. The extraction protocol of Dellaporta et al. (1983) and
Doyle and Doyle (1987) did not yield quantifiable amounts of genomic DNA,
while the extraction protocol of Murray and Thompson (1980) yielded
comparatively less quantifiable DNA, which was not suitable for RAPD
analysis. The spectrophotometric results for the five different species of

50 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

TaBLE 1. Yield of genomic DNA measured by quantity and purity index of Selaginella obtained
from five different species using different protocols.

Modified Rogers and Original Rogers and Murray and Thompson
Benedich protocol (1994) Benedich protocol (1994) protocol (1980)

Plant Quantity Purity index Quantity Purity index Quantity Purity index
sample (ug/ml ) (Az6o/Azgo ratio) (ug/ml) (Azgo/Azgo ratio) (ug/ml) (Az6o/Azgo ratio)

Selaginella 1164 1.84 486 1.92 294 1.36
elicatu
Selaginella 924 1.69 390 a tar 246 1.41
pter:
Selaginella 1836 2.01 696 1.96 366 1.60
Selaginella 846 a ears 318 2.65 276 1.53
monospora
Selaginella 912 1.87 450 2.08 234 1.34
repanda

Selaginella obtained using the original protocols of Rogers and Benedich
(1994), Murray and Thompson (1980) and the modified protocol of Rogers and
Benedich (1994) are given in Table 1.

For RAPD analysis, initial PCR amplification of genomic DNA from the five
species of Selaginella was done. Among the nine random primers tried, two
primers from OP series (OPD 5 and OPG 2) were selected for RAPD analysis
which could amplify the template DNA from the five leaf samples of
Selaginella using PCR. From the study we obtained a number of RAPD bands
from two different primers for the samples of Selaginella studied (Table 2).

DISCUSSION

A cost effective DNA extraction procedure greatly facilitates genetic
diversity analysis. The present study demonstrates that the DNA extraction
procedure significantly affects yield and quality in Selaginella, as well as the

TABLE 2. Primers used in RAPD analysis.

Total number Total number Percentage of
of amplified of polymorphic polymorphic
Primer Sequence bands bands ands (%)
OPA A117 55’- GAG CCC GACT - 3’ Absent
OPB 4 5'- GGA CTG GAGT - 3’ Absent
OPC 11 '- AAA GCT GCGC -3’ Absent
OPD 5 5'- TGA GCG GAC A- 3’ 26 21 84.7
OPG 2 5'- GGC ACT GAG G- 3’ 19 9 47.3
OPG 19 5’- GTC AGG GCA A- 3’ Absent
OPK 10 5’- GTG CAA CGTG- 3’ Absent
OPC 2 5’- GTG AGG CGT C -- 3’ Absent

OPB 13 5 Fre CCC CGC P-3' Absent

DAS ET AL.: ISOLATING GDNA FROM SELAGINELLA 51

Lane 1 - Selaginella plana
Lane 2 - Selaginella monospora

Lane 5 - Selaginella bryopteris

Fic. 1. Electrophoretic analysis of total DNA from leaves of Selaginella plana, Selaginella
monospora, Selaginella delicatula, Selaginella i preg and Selaginella bryopteris extracted by
the modified protocol of Roger and enodicd: (1994

efficiency of RAPD amplification. Upon gel electrophoresis a clear continu-
ous band of DNA was obtained showing that the quality of DNA had
improved and was consistently suitable for PCR amplification for RAPD
analysis (Fig. 1). After PCR optimization for RAPD analysis, the generated
amplification products were found to be of good quality and could be used to
discriminate the genetic polymorphisms present in different species of
Selaginella used in the study. Yield of gnomic DNA was increased by certain
modifications of the protocol. The modification involved increasing the time
of incubation in 1X CTAB buffer. CTAB being a cationic detergent, it can form
a CTAB-nucleic acid precipitate at room temperature, when the salt
concentration is lower than 0.5 M. We observed that increasing the
incubation time of the chloroform-isoamyl alcohol extract in precipitation
buffer (1X CTAB solution) may cause more nucleic acids to be selectively
precipitated, thus increasing the net yield.

We also observed that, in general, the Rogers and Benedich (1994) protocol
yielded higher quantities of DNA compared to the protocol of Murray and

52 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

1

&

a

2 OModified Rogers and
‘* Benedich Protocol

z

S @Original Rogers and
: Benedich Protocol

2 @Murray and Thompson
S Protocol

=

i

o

Fic. 2. Graphical representation showing the quantity of DNA obtained from different protocols
for the five different species of Selaginella.

SLTLLLLLELLL LYLE LLL LLY.
Zee

S.monospora

UUELLILLILIILLLLLLL LE SMurray and Thompson
Splana (ee) Protocol
OOriginal Rogers and
Benedich Protocol
LLL :
s és Coy Modified Rogers and
— Benedich Protocol
VALLE LLL ELD
Seélicaula Ce
ay
0 85 1 18.2:°25 3
Purity Index of DNA (A260/ A280)

Fic. 3. Graphical representation showing the purity index of DNA obtained from different
protocols for the five different species of Selaginella.

DAS ET AL.: ISOLATING GDNA FROM SELAGINELLA 53

Lane 1 - Selaginella plana Lane 4 - Selaginella repanda
Lane 2 - Selaginella monospora Lane 5 - Selaginella bryopteris
Lane 3 - Selaginella delicatula Lane 6 - Control

Fic. 4. PCR amplification profile of five different species of Selaginella using the primer OPD 5
using genomic DNA extracted from two different protocols, (A) modified Roger and Benedich
(1994), and (B) original Roger and Benedich (1994).

Thompson (1980). The modified Rogers and Benedich (1994) protocol, on the
other hand, yielded better quantity (2-3 times more) and quality genomic DNA
than the original protocol of Rogers and Benedich (1994) (Fig. 2 and Fig. 3).
The isolation protocols of Dellaporta et al. (1983) and Doyle and Doyle (1987)
did not yield quantifiable amounts of genomic DNA.

The present study revealed that though the modified protocol of Rogers and
Benedich (1994) required longer time (nearly three days) than the other
methods followed, better quality DNA was extracted using this protocol
(Fig. 1). Since the quantity and purity of extracted genomic DNA plays a
crucial role for analysis of molecular diversity and optimization of different
parameters for PCR (Weeden et al., 1992; Staub et al., 1996), the modified DNA
extraction protocol of Rogers and Benedich proved to be most useful, as both
the quality and quantity of genomic DNA significantly increased, yielding
better results in RAPD-PCR analyses compared to the original DNA extraction
protocol of Rogers and Benedich (Fig. 4 a and b).

Further analyses using more RAPD primers are necessary to obtain
molecular markers for distinguishing the different subgenera of Selaginella,
which would give valuable information regarding genetic diversity of
Selaginella species.

54 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

ACKNOWLEDGMENTS

The authors wish to thank the Programme Coordinator, CAS and the Head, Department of

pi University of Calcutta, for facilities aig The authors would also like to acknowledge

UPE for financial assistance. Thanks are also due to Prof. Radhanath Mukhopadhyay,
Departigaet of Botany, University of irda for his assistance in identifying the plant species.

LITERATURE CITED

a. J. G. 1883. A ag of the genus Selaginella. J. Bot. 21:1-5, 42-46, 80-84, 97-100, 141-
45, 210-213,

ma A. 1857 pea Plantarum novarum et minus cognitarum. pp. 12—22, in Horto regio
botanico Borolinensi coluntu

De.iaporta, S. L., J. Woop da B. ‘Hocxs. 1983. A plant DNA mini-preparation: version II. Plant.
Mol. Biol. Rep. 1:19-

Doyte, J. I and J. L. Dove. ar A rapid DNA isolation procedure for small quantities of fresh leaf
tissue. Phytochem Bull. 19:11—15.

Hizronymus, G. 1901. Selaginellaceae. Vol. 1(4), Pp. 621-716, In A. pail and K. Prantl, eds., Die
Natiirlichen Pflanzenfamilien. W. a Sg lo Germ

a.

Jermy, A. C. 1986. Subgeneric S in S m Gaz. 124: eel
Korat, P. and P. Kenrick. 2002. Phylogenetic ee in Gelagtnellaosan based on rbcL
equences. Am. J. Bot

Kora.t, P. and P. Kenrick. 2004. a phylogenetic history of Selaginellaceae based o
sequences from the Page and nucleus: extreme substitution rates and rate NR
Mol. Phylogenet. Evol. 31:852-64.

Murray, M. and W. F. THompson. 1980. Rapid isolation of molecular weight plant DNA. Nucleic

Acid. 8:4321-5.
Rocers, - O. 1994 psi ear and taxonomic information from herbarium and mummified
Vol. 48, In R. P. Adams, J. Miller, E. Golenberg and J. E. Adams, a of

aie genes II: Utilization of ancient and modern DNA. Miss Bot Gard, M
Rocers, S. O. and A. J. BeNepicH. 1994. Extraction of total cellular DNA from ar dese and fungi.
Pp. 1-8, In S. B. Gelvin and R. A. Schilerpoort, eds. Plant Molecular Biology Manual. Kluwer
Academic, Dordrecht, The Netherlands.
Straus, J. J., J. BACHER and K. Porter. 1996. Sources of elie errors in the application of random
a eas polymorphic DNAs in cucumber. Hort. Sci. 31:262—266.
Sprinc, A. F. 1850. Monographie de la famille des A icasadlicdse Second partie. Mémoires de
Vacadémie Royale des Sciences, des Lettres et des Beaux-arts de Belgique. 24:1-358.
Wa ron, J. and A. H. G. Atston. 1938. Lycopodiinae. Pp. 500-506, In F. Verdoorn, ed., Manual of
Pteridology. pendicee cage The Hague, The Netherlands.
Weepen, N. F., M. TiMMERMAN, M. Heromat, B. E. KNEEN and M. A. Loput. 1992. ep HPT of
RAPD Technolog to ir Breeding. Symposium Proceeding, Minnepolis. Pp. 12-17.
WEIsHING, K., H. Nysom, K. Woirr and W. Meyer. 1995. DNA isolation and purification. . 44-59,
In: DNA Paceisens in plants and fungi. CRC Press, Boca Raton, Florida.

American Fern Journal 102(1):55—68 (2012)

Molecular Evidence on the Origin of Osmunda
x mildei (Osmundaceae)

C. Tsutsumi*, Y. Hirayama, and M. Kato
Department of Botany, National Museum of Nature and Science, Amakubo,
Tsukuba 305-0005, Japan
Y. YATABE-KAKUGAWA
Botanical Gardens, Graduate School of Science, the University of Tokyo, Hakusan,
Tokyo 112-0001, Japan
S.-Z. ZHANG
Shenzhen Fairylake Botanical Garden, Luohu District, Shenzhen, Guangdong, China 518004

Asstract.—The southern Chinese Osmunda X mildei has been suggested to be an intersubgeneric
hybrid, i.e., O. japonica (subgenus Osmunda) x O. angustifolia (subgenus Plenasium) or O
japonica X O. vachellii (subgenus Plenasium). These interpretations were based on morphological,
cytological, and/or chloroplast DNA data, yet the parents of the hybrid remained unclear.

nuclear DNA markers show that O. xmildei is most likely a hybrid between the paternal O.
japonica and the maternal O. vachellii.

Key Worps.—EST, intersubgeneric hybrid, Osmunda japonica, Osmunda Xmildei, Osmunda
vachellii, rbcL

The genus Osmunda of the leptosporangiate fern family Osmundaceae has
natural hybrids (Kato, 2009; Tsutsumi et al., 2011). One such is Osmunda
x mildei C.Chr. (=O. bipinnata Hook., a later homonym of O. bipinnata L.),
which nearly became extinct in its known range in Hong Kong. However, this
hybrid was recently found in Shenzhen, Guangdong, and Mt. Qiyun, Jiangxi
(Zhang et al., 2008), and less than 10 individuals are known. It was also found
in Zhangjiajie, Hunan (Y.-H. Yan, pers. comm.). It can propagate via spores in
experimental conditions (J.-F. Yang, unpubl. data), but it is uncertain if the
individuals were derived from spore propagations or from independent
formations of the hybrid. Osmunda Xmildei is characterized by subcoria-
ceous, bipinnate-bipinnatifid leaves with round, entire pinnules, and fertile
pinnae inserted below the middle of the leaf. For the origin of O. x mildei,
two possibilities were proposed (Fig. 1). Based on karyological and
morphological analyses, He et al. (2006) suggested that O. Xmildei is a
hybrid of O. japonica Thunb. (subgenus Osmunda) and O. angustifolia Ching
(subgenus Plenasium). Zhang et al. (2008) observed the absence of
chromosome pairings at meiosis and resulting abortive spores in O. Xx mildei,
and suggested that it is a sterile F1 hybrid, but argued that the parents were O.

* Corresponding author: (e-mail: tsutsumi@kahaku.go.jp)

AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

O. angustifolia (A) x O. japonica (J) — O. xmildei (M)

ISU

Z

i

|

VO. vachellii (V) x O. japonica (J) —> O. xmildei (M)

Fic. 1. Candidate parentage of Osmunda X mildei. A: O. angustifolia: pinna (on left side) and part
(on right side). J: O. japonica: pinnule and part. M: O. <mildei: pinna and O. vachellii:
pinna and part. Scale unit is cm. Two proposed crossings are illustrated at the top and bottom.

japonica and O. vachellii Hook. (subgenus Plenasium), because O. vachellii
co-occurs with O. Xmildei, but O. angustifolia does not occur in some of the
localities of O. Xmildei (Fig. 2). Gou et al. (2008) also proposed that O.
vachellii is the maternal progenitor of O. X mildei, based on inferences from
chloroplast DNA sequence data. Under either parentage hypothesis O.
x mildei is likely an intersubgeneric hybrid between the subgenera Osmunda
and Plenasium.

There are three more known hybrids reported in Osmundaceae (Kato, 2009).
Eastern North American O. Xruggii Tryon is O. regalis L. (subgenus Osmunda)
x O. claytoniana L. (subgenus Claytosmunda) (Tryon, 1940; Wagner et al.,
1978; Whetstone and Atkinson, 1993; Li and Haufler, 1994). Japanese O.
xnipponica Makino is O. japonica (subgenus Osmunda) x O. claytoniana
(subgenus Claytosmunda) (Ito, 1964), but Sugimoto (1979) suggested that it is
an intergeneric hybrid, i.e., O. japonica X Osmundastrum cinnamomeum (L.)
C.Presl. Neither is given molecular evidence. Finally, Japanese O. x intermedia
(Honda) Sugim. is O. japonica x O. lancea Thunb. (both in subgenus
Osmunda; Tagawa, 1959; Iwatsuki, 1995; Tatuno and Yoshida, 1966; Yatabe
et al., 2009).

TSUTSUMI ET AL.: ORIGIN OF OSMUNDA xX MILDEI
Q
50 pf
= i pee ; / ‘ ’

sroes su as \, .

om ' *y

yet ' 1

sar ee}
40 b aad H H

BEE epee) '

i

‘ ‘

==--5 / H

= a pa a / '

i. 4 a me i ;

a rf ’ a0 f

30 c* . Ba ay 2
ss ’ Po
/ ve
¢ /
7

ie ,
5 7
Tie] e.g es ig traap
ie Da ee
ed ce pan wet
Mee
;

Sele
ae

20 ie e
oo]? ee, \ Pe
tarm=t Me Ps at
ie}
TON be tcc Sen Sat pea ON CR beam ge an yy, s
0 ree t* O. mildei
8 eed = O. angustifolia
3 — O. vachellii
Yo --- O. japonica P|
0 500 1900 0
— ao.
10S ca SS.
g
90E 100 110 120 130

Map showing distribution of Osmunda angustifolia (solid squares), O. japonica (broken

Fic. 2
line), O. Xmildei (asterisks) and O. vachellii (solid line). Solid asterisk shows the place of O.

x mildei sampled in this study.

The evidence offered to support the parentage of O. Xmildei in previous
studies is inconclusive, because it lacked nuclear sequence data. Combining
nuclear and chloroplast DNA data are useful to identify a maternal and a paternal
parent. This study examines the aforementioned alternative origins of the hybrid,
based on chloroplast rbcL sequences and three nuclear DNA sequences.

MATERIALS AND METHODS
Materials.—Samples of three species of subgenus Plenasium (O. vachellii, O.
banksiifolia (C.Presl) Kuhn, O. angustifolia), the putative intersubgeneric

58 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

hybrid O. <mildei, one species of subgenus Claytosmunda (O. claytoniana),
Osmundastrum cinnamomeum, and Todea barbara (L.) T.Moore, along with
three species of subgenus Osmundda (O. japonica, O. lancea, O. regalis), were
collected in the field or botanical gardens. The sources of materials used are
shown in Table 1.

Sequencing of chloroplast and nuclear DNA.—Leaf fragments were used for
molecular analysis. DNA was extracted from fresh or silica-gel-dried material
using a QIAGEN DNeasy Mini Kit (QIAGEN, Valencia, CA) following the
manufacturer’s instruction. Three nuclear DNA markers (EST_LO058,
EST_L110, EST_L258) selected from the expressed sequence tag library
developed by Yatabe et al. (2009) and the chloroplast locus rbcL were
analyzed. Primers for amplification and sequencing, and detailed information
on the three nuclear markers are shown in Table 2 and Table 3, respectively.
PCR was performed using a Perkin-Elmer 9700 DNA thermal cycler (Applied
Biosystems, Foster, CA) with Ex Taq DNA polymerase (TaKaRa Bio, Tokyo,
Japan) and Ampdirect Plus (Shimadzu, Kyoto, Japan) in 35 denaturation,
annealing, and elongation cycles (30 sec at 94°C; 30 sec at 50°C for the rbcL and
58°C in the three nuclear markers; and 90 sec at 72°C) with a final elongation
step (7 min at 72°C). The PCR products were purified with ExoSAP-IT (USB
corporation, Cleveland, OH) following the manufacturer’s instructions.
Sequencing was conducted using an ABI PRISM 3130xl Genetic Analyzer
(Applied Biosystems). The raw sequence data were assembled using Seqman II
(Dnastar, Madison, WI). For the sample of O. x mildei, PCR of the nuclear DNA
markers was performed with PrimeSTAR Max DNA polymerase (TaKaRa Bio)
in 35 cycles (10 sec at 98°C, 5 sec at 55°C and 5 sec at 72°C). The PCR products
were Cloned using a pGEM-T Vector System I (Promega, Madison, WI) and at
least 10 clones were sequenced. Minor variants from single clones, presumably
sequencing errors, were observed. Therefore a consensus sequence was used
for each allele type; the differences between each consensus sequence and the
original clones are shown in Table 4. The assembled sequences were aligned
by Clustal X program (Thompson et al., 1997) and then aligned manually.

Molecular phylogeny.—Phylogenetic analyses were performed by maximum
parsimony (MP) and Bayesian analysis. Registered sequences of Osmundaceae
in Genbank were added into the analyses (see Table 1). Maximum parsimony
(MP) inference was conducted with PAUP* 4.0b10 (Swofford, 2002). The bases
that could not been identified were treated as unknown (N), and gaps were
treated as missing data. All characters were equally weighed and heuristic
searches were conducted with 1000 random addition replicates involving TBR
branch swapping. Bootstrap values were calculated from 1000 pseudorepli-
cates, each with 100 random additions. For the Bayesian analyses, MrMod-
eltest 2.0 (Nylander, 2004) was used to determine the nucleotide substitution
model. Bayesian searches were conducted by MCMC with two independent
sets of four chains, each run for ten million generations, sampling every 100
generations by MrBayes 3.1.2 (Huelsenbeck and Ronquist, 2001; Ronquist and
Huelsenbeck, 2003). The nucleotide model selected was: rbcL, GTR + I + G;
EST_L058, HKY + I; EST_L110, GTR + I; EST_L258, GTR + I. The program

TSUTSUMI ET AL.: ORIGIN OF OSMUNDA X MILDEI

SOEO-66 IDIIFT NY

ZS6PZ0EV ‘OAYOL, JO A}ISIOATUL] ‘BMPYTYSIOY ‘suepsey [eoruR}Og Ut yny 13]
OP8ZZ9AV ZO8ZZ9AV P9LZZOAV LIZPEPAV (SNL) ‘U's fuDjruDUIy *\, “Jaig PyezeAT ‘uede{ a
GE87Z9HV LOBZZ9AGV §=E9LZZ9AV ELLPEPAV (2Z999Z:SN.L) 80FI-Z00ZDN “[D 38 DADYIQY “Y “Joig TyDOy ‘uede{ zl
(SNL) ‘U's furnsjns yy °D ‘(-Joig eyonziys
SE8ZZ9MV O08ZZ9EV Z79L7ZZ9GV LIZP6raV wo poyue[dsuen) Uepiey [eoruR}Og eqnyNsy, UT yD lI] ‘qunyy, paouDy °C
- Le6rZ0dV £0€0-66 AqvIDA ‘X Jai eyouzrys ‘uede{ 18{
'SNLL) ‘U's suryuef-~iaspiy “Yy ‘5 ‘(Qemedueyy woy
‘yreseIOY}g ‘adeT[oD eyenpess}sog JUsUWTUIAAOS)
LE87Z9GV 66LZZ9HV =: L9ZZZ9AV FOLBE9EV ‘uepie) Usa] Woy ‘eAeTeUTH [eUeD ‘eIpUy af
(LZE0PZ:SNL) “U's suryua/-rasv1y “Yy “2 ‘,,e8po'] yeog,, pourns
QE8Z7Z9AV 86Z7ZZ9EV O092Z7Z9NV S9lBE9aV jo outs Aq ‘edpii yeag SuoTrys ‘ayeig eAepeyseyy ‘erpuy val
GSE8zZ9GV Z6ZZZ9NV G6SLZZ9EV LIZP6raV (SNL) FZE'W'9'M OjOuNsjoP *g ‘Suemesu-eys ‘ueynyg of
PEScL9AV 96ZZZ90V 8SZ7Z9GV Z9L6E9RV (HIV.L) 8966 ONY *{-"7 ‘TYDTYD ‘ueYyssuoy ‘ueuun, ‘Bury cf
€€8ZZ9GV S6LZZ49HV ZLSZ7Z9EV ZLZb6raV (LLLZ9Z:SN.L) ‘U's DaDyIqy “VY ‘TAN “IA “uRINy ‘eUTYyD b[
(PELP9ZL:SNLL) ‘U's ‘[D Ja
ZESZZ9AV «= PBLZZZOGV =: SGLZZOAV ZILLb6PAV ojDY "W ‘uUeMNA ‘A ‘puels] tweUry “Jorg eurrysosey ‘uede/ ef
T€8zZ9dV €6ZZ7Z9AV SSL7Z9GV FIZbGPAV (SNL) 9LFEYD DIDSoqnyoy ‘4H ‘1yseAeqoy “Jorg PyezeAtp ‘uede{ zi
(SNL) ‘U's Tumsjns 7°59
O€8zZ94V ~26LZZ90V PSZZZ9AV LIZPErAV ‘(uede{ woy payeursuio) ueprey [eotuRjog eqnyNsy, Ut yn tf ‘qunyy, varuodol “QO
ppunusg¢) ‘sqns ppunuis¢
Z0€-66 OJOUIAN “Sg ‘OAYO],
- : - LS6PZ0EV jo AjIsioatuy) ‘OXYIN ‘suepsey yeotuRjOg UT YyND =—- Z9-7D
OS6PZOdV Z0€0-66 YOAAATYsIDX “H ‘usepses) [RITURJOY LNossTyy Ul “y[ND 1879
6z87Z9GV 1642Z9GV ESL7ZZ9GV 9BT6E9RV (ATV.L) S8r6 ONY *{-"7 ‘TYDTYD ‘ueYyssuoyH ‘ueuUN, ‘eUTYD z10
(SNLL) ‘u's rumnsjns ‘5 ‘(uede{
8787Z9GV O6242Z9HV ZSLZZ9V LPLZZ9aV WOY peyPuIs110) UepreD yeoruR}Og eqnyNsy, Ut yn LTD “] pupruojAvja ‘O
pupruo}Ap]) “Sqns ppunurs¢—
(usyzueys ‘Suopsuensy ‘euryy woy
F 9qel 9S Ff 8[GeI, 88g fF AIGR], 998g O9FZZZ9GV poyeulsi10) ueprey [eoruRjOg eye[Ate,y UeyZueYs UT “y[ND IYD'D lepjtux 'O
«8S7T LSA xOLTT LSH x«8S0T LSA = +79qI Jayonoa puke adIn0g soroads

dl I
ajdmeg ‘snue8qns ‘snuery

*SnOO] FORO JO SIequINU UOIsseooR yuRquaer) smous
: *

‘Apnys sty} Ul pasn syeieyeyy

‘L Fav],

AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

(SN.L) €F2T “ON ‘]D Ja
‘Sally, DZaW ‘Tq ‘Aeyensesey oAowe je oyun! opeyeg

ZE8ZZ9GV OZ8ZZ9AV ZB8ZZZ9HV Z8l6E9dV “NQUIe}ENA) BIUOTOD ‘sojIeD a]UOy ‘souOIsT] ‘eUTUesIY sly

9S8Z7Z9GV 6L8Z7ZZ9GV 18Zz7Z9GV T8l6E9aV ‘u's DITUOW “2D “Y :OOlxeyy Zu

- 818zZZ9dV O8ZzZ9aV O8l6E9aV (SN.L) ‘U's ony *4-"T ‘VSN 9M
(809LZZ:'SN.L) 91-20

SS87Z9GV LI8ZZ9GV -BLLZZZ9AV BZIGE9EV yodaarysoX “) tpuog Aineyp ‘oD sproudey ‘unossip “ysn sla
(909LZZ:SN.L)L6-Z0 YyoAaarys}DX “5 ‘said

PS87Z94V 9I8ZZ9GV S8LLZZ9GV 8ZI6E9aV ‘JEN Spoomyeyy Jepqury ‘oD ay10de’] ‘euerpuy ‘ysn rly

€S8Z7Z9HV SI8ZZ9qV ZLZZZ9GV ZZI6E9RV 62£18 UBIO: “Y ‘AWD YIOX MON JO N JOA MON “VSN ely

ZS8Z7Z9GV PlI8zZ9dV 9ZZZZ9GV 9YZI6E9RV (SNL) ‘U's DInuIDYDNY “J, “eueUIYOA “JoULIeg ‘Ieosesepeyy zu

TS8ZZ9GV €18zZ9dV SZLzZZ9aV SZI6E9EV (SN.L) ‘U's DINuIDYDNY *f, ‘eqisepuy ‘joule ‘1eosesepey ILY
(SN.L) L#I-YND

OS8ZZ94V ZI8ZZ9GV PZZZZ9GV PLIGE9aV ‘[D Ja OJDY "W ‘toatTy SuOAN ‘osoqy ‘oAeuTeqw ‘uOOraUTeT) OLN
(6ZPZEL:SNL) “U's

6P8cZ94V LI8zZ9dV 6ELLZZ7Z9GV ELI6E9EV ‘yp ja UN], “Y ‘URULIC ‘OUTSe;OyY ‘BOTUINAS ‘erUOpaoRyy 6u
(PZPLEL‘SN.L) “u's

8P8ZZ9GV OL8ZZ9dV ZZZ7Z9GV ZZI6E9RV ‘]D ja IN], “y ‘UeULIQ ‘OUTse[Oy ‘BOTWUNYS ‘erTUOpaDRyy au
"WS. YUIZ W ‘UI9}NE[SIOSTeY jo S Uy cL ‘QAIOSOy

ZU8CZ9GV G6O8ZZ9EV 8 TZZ7Z9GV LZI6E9RV aroydsorg jsolo ayeuyeyeg ‘ayeurjeleg-puepeuryy ‘AUBULIOS) QI
(7) ‘u's

9P8ZZ9AV B08ZZ9GV OLZ7Z9EV OL16E9RV dupyuaaozy ‘g ‘Aord Bnquiry] ‘opueA Jo § WY ZI ‘spuepIeyEN ou

GSP87Z9GV ZLO8zZ9GV 69Z7Z9AV 69LBEIAV Spue[IayJaN Ul WIOOga}0ON ‘q *H JO Uspses eUIOY ey) UT “}~ND ou
(SNL) ‘U's OJDY ‘Pw ‘(Usprey OLUR}]Og a}N}ysUT

brSZTZ9AV 908ZZ9EV B89ZZZ9AV 89l6E9RdV yoreesoy [BOTUk}Og [PUOTFRN UI "}[Nd) ryseUYIeg ‘eIpUT ru
(SN.L) [#698

€v8cZ9GV SO8zZ9dV Z9ZZ7Z9GV ZLOL6S9EV daappig "y "VY ‘eyPUTIeTIaA “ISIC 9poOxlYZoy ‘“e[eIay ‘etpuy eu
(LL) ‘u’S DIDINA ‘H 4 DIDINJN 7 ‘esoulrys

ZPSZZ9AV = POBZZ9EV =: P9LZZZ9AV YOLBE9AV eau [punseueUUay “}sIq] PSOWITYS ‘eyeyeUIeY ‘eIpuy 7u
(ZL9LZZ:SN.L)

LP87Z9GV e087Z9EV S9ZZZ9GV S9l6E9NV Zozez daapoig ‘y ‘Y ‘e[PUILIET[OA “SIG EpoyryZoy ‘epe1ey ‘eIpUT as "| sl]Dsal ‘CE
*8SZT LSA xOLLT LSA .8S0T LSH 79qQI JeqONOA puke adinog dl soroeds
ajdureg = ‘snueSqns ‘snuey

‘ponuyuoy *“[ aTaVvy,

TSUTSUMI ET AL.: ORIGIN OF OSMUNDA XMILDEI

SX90£0-66 9qDIDX *X ‘(puepeaZ

- - - 6S6FZ0ONV MON wold} pojeurstio) ueprery) yeoruejog sepoqiy ul WD 18 a1O0J' L CT)
cO8ZZ9AV 8 SzZ87Z9HV 86ZBLZZ9HV ISL7Z9EV (SNL) ‘u's Jurnsynsy, ‘2D ‘uaprey [eotuRjOg sepoqgry ut ‘yng ae DIDgIDg DapoL,
papoy,
(LL) PZ92z eqaspyy
- - - Z88Prla ‘OAYOY, JO A}ISIAATUL) ‘OYFIN ‘suepresy [eoruR}Og ut yng 231)
- . * 6r6PZ0EV LOE-86 YyOAAaLyNs}DX “5 ‘uaprey [eotuejog Wnossty ur VND 1319 sad) ("TD
T98ZZ9GV b28ZZ9NV 8 6—9BLZ7ZZ9GV OSZZZ90V (SNL) ‘U's Jurnsjns], “2D Sueprey [eoTuR}Og eqnyNs], Ut yND TD) Wineaurourpuuld '—C
umnysppunuts¢)
ISI (Yoeag)
: : = 8S6FZ04V 90WZZ6 DMDYDSY “|, g OY ‘W ‘eTuopaTey) MeN DUDISY]IM “T
seid’ (YN)
: E : £S6F20dV 608426 DMDYDSY ‘J, 4 Ol ‘W ‘pueleez MeN umyjAydouautAy “7
strajdojdaT
- * - PS6PcOdV ELW-86 fulpyoiny ‘N ‘erskeyeW ‘WM Ut WN 8A,
O98ZZ94V EZ87Z9GV S8ZZZ9NV 6PLZZ9EV UspIeD [eoTURjOg eye[AIIe,] UeyZueyg uy VND TA = “YOOH /JaYIDA "CE
- - ‘ €S6PZ0dV ZLN-86 lurpypinyw ‘N ‘eishepeY ‘WAN Ut yND aun g Darupap{ °C
= - - SS6PZORV 292-26 IDJIH “Y ‘eremesesg ‘oAyo], ‘uede{ zsq
- - - 9S6hZ0EV 68-06 IOIIH “NY “joi pyezeAT ‘uede{ 18q
(uede{ “Jorg emeuTyO uyny ([se1q"D)
6S8ZZ94V 7zZ8ZZ9GV P8LZZ9AV 9S6rZ0aV WO payeUIsIIO) Uspsey yeoTUR}Og eqnyNsy, UT “y[N5 la pIoftisyuDg ‘CQ
Bury
S8S87Z94V IZ8ZZ9dV €8ZZZ9AV 8PZZZ9GV Uepiey [eoTuejOg eye]Arrey UeyZueYs Ut “WIND pjofisnsup ‘CQ
ulnispua]d *8qns ppunus¢
= - - 8h6rcOdV POE-66 YOAAATYSIDA “H ‘Uepsey [ROTUR}OYg LInossIy UT WIND Edy
- - : 6SZ9Z0EV wopsury peyuy 28y
. : - 8SZ9Z0EV ieosesepey 18y
*«8SZ7T LSH ,xOLLT LSA «8S0T LSA x TIGL JayINOA pue soaInog di soroeds

ajdures ‘snuesqns ‘snuas)

‘panuyuoy *[ aTaVvy,

62 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

TaBLE 2. Primers used for the analyses of three nuclear markers.

Marker Primer Primer sequence Reference
EST_L058 EST_LO58F ATAAGGTTTCGCCCTCGAAT Yatabe et al. 2009
EST_LO58R TCTTGCAGTTGCGAGTTCAC Yatabe et al. 2009
EST_L110 EST_L110F (P108) CATTGCACATCGGAGATGAT Yatabe et al. 2009
EST_L110R (P107) CACAGCTGAAACACCCTGAA Yatabe et al. 2009
EST_L258 EST_L258F TCATGGCGACTGTGAAGAAG Yatabe et al. 2009
EST_L258R CGCCCTTTGGATTTACGATA Yatabe et al. 2009

Tracer (Rambaut and Drummond, 2009) was used to check the runs had
reached stationarity and effective sample size of all the parameters was high
(>100). The first 2.5 million generations before sufficient stationary genera-
tions were discarded as burn-in periods and the rest of trees were used to
calculate posterior probabilities. Osmundastrum cinnamomeum and Todea
barbara were used as outgroups (Yatabe et al., 1999; Metzgar et al., 2008).

RESULTS

Bayesian and maximum parsimony analyses of each dataset produced
congruent topologies (Bayesian consensus trees shown in Figs. 3-6). Maxi-
mum parsimony analyses resulted in three shortest trees of a length of 146
steps (CI = 0.77, HI = 0.23, RI = 0.93) for chloroplast rbcL (1227 bp) with 101
nego -informative characters, 78 shortest trees of a length of 47 steps (CI

0.89, HI = 0.11, RI = 0.88) for nuclear EST_L0O58 (198 bp) with 18
parsimony-informative characters, ten shortest MP trees of a length of 125
steps (CI = 0.91, HI = 0.09, RI = 0.91) for nuclear EST_L110 (572 bp) with 57
parsimony-informative characters, and two shortest trees of a length of 122
steps (CI = 0.89, HI = 0.12, RI = 0.94) for nuclear EST_L258 (361 bp) with 59
parsimony-informative characters.

TasLe 3. Total lengths of three nuclear markers, coding and non-coding regions in Osmunda
japonica (J3 in Table 1), and identified genes with one of the highest E-value (< 0.001) obtained by
Blast search (blastn) using sequences of EST libraries (Yatabe et al. 2009).

GenBank hit
Accession _ Total length Coding re- Non-coding Putative gene accession no.
Marker no. (bp) gion (bp) _ region (bp) (species) (E-value)
EST_L058 FS993661 198 101 97 glycolate oxidase AY173074
gox Qxie*
(Zantedeschia
aethiopica
EST_L110 FS993713 548 148 400 glycerol-3- EU964956
phosphate (9 * 40.77)
(Zea mays)
EST_L258 FS993861 317 79 238 ribosomal AF334838
protein L17 (9.x 100°)

(Castanea sativa)

TSUTSUMI ET AL.: ORIGIN OF OSMUNDA XMILDEI 63

TasLE 4. Allele types, numbers of clones used, and variations between a consensus sequence and
the original clones for Osmunda Xmildei samples in three nuclear markers examined.

Number of clones:

cluded in Identical to

Genbank ac- consensus consensus sie. by Differing by Differing by
Allele cession No. seq. seq. subst’n two subst’ns three subst’ns
EST_LO58 A <AB672788 11 - 4+ _ =>
B AB672789 4 + : s “
EST_L110 A AB672826 10 4 3 1 2
AB672827 4 2 A - 1
EST_L258 A AB672863 6 3 3
B AB672864 7 4 1 2

The rbcL sequence of O. X mildei is identical to that of O. vachellii and also
was similar to those of O. banksiifolia and O. javanica Blume (Fig. 3). The
Osmunda X mildei sequence was more distantly related to O. angustifolia (but
with low support), and very far from O. japonica and other species of subgenus
Osmunda.

In the three nuclear markers, the O. x mildei sample has two distinct allele
types (Figs. 4-6). One type (Type A) had the same sequence as some plants of
O. japonica, while the other (Type B) had the same sequence as O. vachellii (in
EST_L58 and L110 in Figs. 4 and 5) or a sequence very similar to it (in
EST_L258 in Fig. 6). In each of the three nuclear-marker trees, O. X mildei was
more Closely related to O. vachellii than to O. angustifolia.

DISCUSSION

Our trees constructed from the chloroplast gene and nuclear DNA sequences
agree with previous trees in the monophyly of the three subgenera of Osmunda
(Yatabe et al., 1999; Gou et al., 2008; Metzgar et al., 2008). The rbcL
phylogenetic relationships of the subgenera are the same as Yatabe et al.’s
(1999) from the same gene and Metzgar et al.’s (2008) from seven chloroplast
loci including rbcL, and different from Gou et al. ’s (2008) rbcL relationships.
The relationships deduced from the three nuclear EST markers are not
consistent with each other, but the relationship of the EST_L110 agrees with
the rbcL relationship in the subgenera Osmunda and Plenasium being sister to
each other.

All the phylogenetic trees inferred from the three nuclear EST markers show
that Osmunda Xmildei has two distinct allele types, and one is identical to
those of O. japonica, and the other formed a monophyletic clade with those
of Plenasium species (Figs. 4-6). It is suggested that O. Xmildei is an
intersubgeneric hybrid between the subgenera Osmunda and Plenasium. The
Type B alleles of O. Xmildei have the same EST_L058, EST_L110 sequences
and the closest EST_L258 sequences to those of O. vachellii, suggesting that O.
x mildei is most likely derived by hybridization of O. japonica and O. vachellii

64 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

O. regalis R1

O. regalis R5-10,Rg2_ | Osmunda
O. regalis R13-18, Rg3

O. claytoniana CLg1
1.00 O. claytoniana CL2 :
97 O. claytoniana CLg2 Claytosmunda

O. claytoniana CL1
Leptopteris hymenophyllum
00 Leptopteris wilksiana
Todea barbara Tg1
Todea barbara
0. strum cinnamomeum Cg1
Osmundastrum cinnamomeum
L Osmundastrum cinnamomeum Cg2 —— 5 changes

Fic. 3. Bayesian consensus tree based on chloroplast rbcL (1227 bp). Values above branches
indicate posterior probabilities (>0.9) calculated by Bayesian analysis and those below branches
indicate maximum parsimony bootstrap values (>60). Thick branches are highly ee Larbe
(posterior probabilities p>0.95 and a values >90). Arrowhead indicates O. Xmildei
Abbreviations of materials follow Table

(Figs. 4-6). The chloroplast rbcL sequence of O. X mildei is identical to that of
O. vachellii (Fig. 3), suggesting that it is the maternal progenitor of O. x mildei;
hence O. japonica is paternal. This suggested parentage agrees with Zhang et
al. sag and Gou et al. (2008), who suggested O. vachellii as the maternal
parent, based on chloroplast DNA data and distributional data. Osmunda
beaLahes is also very closely related to O. Xmildei, however, comparative
morphology does not support that O. banksiifolia is a parent, because it has
prominently dentate pinnae, whereas O. vachellii and O. X mildei (and also O.
japonica) are both distinct with entire or somewhat serrate pinnae or pinna-
segments.

This study analyzed a sample of O. Xmildei from Shenzhen, Guangdong
(Fig. 2). It has very low spore viability and a very low offspring reproduction
rate even in carefully controlled culture conditions (Zhang et al., 2008; J.-F.
Yang et al., unpubl. data). Considering the low reproductive ability and a few
isolated localities in southern China, it is possible that O. xmildei is of
multiple origins, although no molecular evidence is available. Osmunda
<ruggii of eastern North America (Connecticut and Virginia, USA) is an

TSUTSUMI ET AL.: ORIGIN OF OSMUNDA x MILDEI 65

O. lancea L1

O. lancea L2
O. lancea L3
O. japonica J6-8

O. japonica J1-5
O. xmildeiA q

O. regalis R13-18

smunda
-—— O. regalis R10

Pe ie O. regalis R11-12
‘ af” regalis R42 R59
O. regalis R58 R85
1.00

cen eee i— O. regalis R5-9

| O. banksiifolia

O. vachellii ‘
NS oleae: Bd Plenasium
O. angustifolia

O. claytoniana CL1-2. Claytosmunda

Todea barbara

Osmundastrum cinnamomeum — 1change

Fic. 4. Bayesian consensus tree based on nuclear EST_L058 (198 bp). Figures above branches
indicate posterior probabilities (>0.9) calculated by Bayesian analysis and those below branches
indicate maximum parsimony bootstrap values (>60). Thick branches are highly supported
(posterior probabilities >0.95 and bootstrap values >90). Abbreviations of materials follow

. Arrowheads —— allele types obtained from O. Xmildei. Numbers of clones of each
allele type are in Table

intersubgeneric sterile hybrid derived from O. regalis (subgenus Osmunda)
and O. claytoniana (subgenus Claytosmunda; Tryon, 1940; Wagner et al., 1978;
Whetstone and Atkinson, 1993; Li and Haufler, 1994). Like O. <mildei, O.
Xruggii grows together with the parents in a few localities (Wagner et al.,
1978). Wagner et al. (1978) described that transplants produced fertile pinnae,
but produced aborted spores and only univalent chromosomes at meiosis,
suggesting its high sterility. Osmunda Xintermedia, which is widely
distributed across Japan, is suggested to be an intrasubgeneric hybrid of
multiple origins from O. japonica and O. lancea, and it is self-reproducible
(Shimura, 1972; Yatabe et al., 2009). The differing levels of fertility and
sterility in the three hybrids may reflect close or remote phylogenetic affinities
(Yatabe et al., 1999; Metzgar et al., 2008

Osmunda japonica is distributed in eastern Asia extending west to the
Himalayas and south to northern Vietnam (Kato, 2007). It is a likely parent for
O. Xmildei, O. Xnipponica and O. Xintermedia, all three of which occur
within the distributional range of O. japonica. Osmunda vachellii, the other
parent for O. Xmildei, also co-occurs with O. Xmildei (Fig. 2). From this

66 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

O. lancea L1, L3
O. lancea L2
O. japonica J3 J5-8
O. xmildei A
0.9317 O. japonica J2, J4
O. japonica J1

} Osmunda
O. regalis R15-18

0.96 fe} i

~ O. regalis R10
+—— O. regalis R11-12
- O. regalis R13-14

+— O. regalis R5-9
80

_. O. regalis R1-4

0 a banksiifolia
O. vachellii
— O. xmildei Bq Plenasium

100

O. angustifolia
4.00 r O. claytoniana CL1
1 O. claytoniana CL2

Claytosmunda

Todea barbara

Osmundastrum cinnamomeum
— 5changes
. Bayesian consensus tree based on nuclear EST_L110 (572 bp). Values above branches
fice posterior probabilities (>0.9) calculated by Bayesian analysis and those below branches
indicate maximum parsimony bootstrap values (>60). Thick branches are highly supported
(posterior probabilities >0.95 and bootstrap values >90). Abbreviations of materials follow
e 1, Arrowheads indicate allele types obtained from O. Xmildei. Numbers of clones of each
allele type are in Table 4.

distributional pattern, along with the distributions of O. xruggii and its
arents, we suggest that overlap of the parental species allowed the
interspecific hybridization relatively recently. On the contrary, a fertile
tetraploid species of hybrid origin between O. japonica and O. regalis
(subgenus Osmunda), occurs in northern Central Laos distant from the
distribution ranges of both parents, and in northern Myanmar, distant from
Central India where O. regalis occurs (Kato, 2007; Tsutsumi et al., 2011).
Tsutsumi et al. (2011) suggested that the hybrid species arose when the
distribution ranges of the parents overlapped, a pattern different from the
current pattern.

ACKNOWLEDGMENTS

We thank S. Akiyama, M. K. Bhattacharya, W.-L. Chiou, A. Ebihara, C. R. Fraser-Jenkins, P.
Hovenkamp, N. Katayama, S. Kobayashi, S. Koi, G. Kokubugata, L.-Y. Kuo, T. Minamitani, R. C.
Monica, R. Moran, H. Murata, J. Murata, T. Nakamura, H. P. Nooteboom, T. Oka, A. K. Pradeep, S.
Suddee, A. Tuji, T. Wongprasert, G. Yatskievych, X.-C. Zhang, and M. Zink for their help during
the trips or providing materials. We also thank H. Liu, Shenzhen Fairylake Botanical Garden for

TSUTSUMI ET AL.: ORIGIN OF OSMUNDA X MILDEI 67

0.95 O. japonica J4, J6-8
O. japonica J2
O. japonica 31,05; 55
O. xmildei A 4
O. lancea L1
O. lancea L2-3
1.00 O. regalis R1, R4
93 10.99] 8° LO. regalis R2-3
86 Osmunda
O. regalis R10

0.90 + O. regalis R11-12

nT cn regalis R14
1.00 921 ©. regalis R13

— O. regalis R5-9

O. regalis R15, R17-18

1.0 O. banksiifolia
O. vachellii

Plenasium
nae O. xmildei Bq

100 | aw
0.99 O. angustifolia
91

O. claytoniana CL1

1.00
99 O. claytoniana CL2
Todea barbara

Claytosmunda

Osmundastrum cinnamomeum 5 changes

Fic. 6. Bayesian consensus tree based on nuclear EST_L258 (361 bp). Values above branches

indicate posterior probabilities (>0.9) calculated by Bayesian analysis and those below branches

indicate maximum parsimony bootstrap values (>60). Thick branches are highly supported

eis etaves p>0.95 and bootstrap values >90). Abbreviations of materials follow
wheads craeane allele types obtained from O. Xmildei. Numbers of clones of each

allele type are in Table

sending a copy of a reference cited here and M. Nakajima for the illustrations. This study was
supported by a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of
Science.

LITERATURE CITED

Gou, C.-Y., S.-Z. ZHanc and S.-L. Genc. 2008. Phylogenetic position and genetic relationship of
Cannas mildei igen eee evidence from rbcL gene and trnL-trnF region. Acta Bot.
— agar Sin. 28:2178-2183.

He, Z.-C., . YAN, M. ZHENG se S.-Z. ZHANG. 2006. Karyotype analysis of five species in
Aa (Osmaniac Acta Phytotax. Sin. 44:617-626.

HUELSENBECK, J. P. and F. =— 2001. MrBayes: Bayesian inference of phylogenetic trees.

Saeki 17:754-755.

Ivo, H. 1964. Type specimens of ferns in Makino Herbarium. J. Jap. Bot. 39:247-249
IwaTsukI, K. 1995. Osmundaceae. In K. Iwatsuki et al (eds.), Flora of Japan. Vol. 1. Pteridovhytn and
Gymnospermae, pp. 31-33. Kodansha, Tokyo, Japan

68 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

Kato, M. 2007. Distribution of Osmundaceae. Bull. Natl. Mus. Nat. Sci., ser. B (Bot.) 33:81—90.

Kato, M. 2009. — in og fern genus Osmunda (Osmundaceae). Bull. Natl. Mus. Nat. Sci.,
ser. B (Bot.) 3

Li, J.-W. and C. H. sai 1994. Phylogeny, nclnacap peat — biology of Osmunda
species: insights from isozymes. Amer. Fern J. 8

Merzear, J. S., J. E. Skoc, E. A. Zimmer and K. M. ea 8. The pee of Osmunda is
confirmed by se season ge of seven plastid rn pu Bot. 33:31-36.
Ramsaut, A. and A. J. DRuMMo 009. Tracer v1.5. http://beast.bio.ed.ac.u

er

Ronauist, F. and J. P. ican. poe MrBayes 3: Gaacctan phylogenetic inference under mixed
models. Bioinformatics 19:1572—1574.

Suimura, Y. 1972. Study of reproduction of Osmunda Xintermedia Sugimoto. J. Geobot. 20:38—42.

SucimorTo, J. 1979. Keys to Soh Plants of Japan. III. Pteridophyta. Revised and enlarged ed.

Inoue oe sphere To

Sworrorp, D. PAUPS, . Phylogenetic analysis using parsimony (* and other methods).
Sinauer, Sundoriand

Tacawa, M. 1959. Coloured ee of the Japanese Pteridophyta. Hoikusha, Osaka.

TATUNO, S. a en Yosuipa. 1966. siecle agh Untersuchungen iiber Osmundaceae I. Chromoso-
men der Gattung rena aus tebe ot. Mag., Tokyo 79: signee

THompson, J. D., T. J. Gisson, F. PLew F. JEANMOUGIN aad D. G. Hiccins. 1997. The Clustal X

windows interface: flexible st deae for multiple sequence alignment aided by quality

analysis tools. Nucl. Acids Res. 25:4876—4882

Tryon, R. M. Jr. 1940. An Osmunda cay Amer. Fen f 30:65-68.

Tsutsumi, C., S. Matsumoto, Y. YatTase, Y. Hirayama and M. Karo. 2011. A new allotetraploid

lois of Osmunda (Gin wat Syst. Bot. 36(4):836-844.
Wacner, W. H. Jr., F. S. Wacner, C. N. MILLer, Jr. and D. H. — 1978. New observations on the
royal fern ae Osmunda Xruggii. Rhodora 80:92—10'
Wetstong, R. D., T. A. ATKINSON. 1993. Osmundaceae tnt & J. Pres]. In Flora of North Ameri-
ca Editorial uate (ed.). 1993. Flora of North — rica. Vol. 2. Pteridophytes and
York.

gym: ie goa pp. 107—109. a University Press,

Yatabe, Y., H. NisHipa and N. Murakami. 1999. ch cae of mien seen inferred a rbcL
eee sequences and comparison to the fossil evidence. J. Plant Res. 112:397.

Yatabe, Y., C. Tsutsumi, Y. HirayaMa, K. Mort, N. Murakami and M. Kato es Cae population
structure of Osmunda oe rheophilous O. Jancea and their hybrids. J. Plant Res.
122:585—-595.

ZHANG, S.-Z., Z.-C. He, C.-R. Fan and B. YAN. 2008. A cytogenetic study of five species in the genus
Osmunda. J. Syst. Evol. 46:490-498

American Fern Journal 102(1):69—77 (2012)

The Tree Fern Highland Lace is a Cultivar of
Sphaeropteris cooperi

DANIEL G. YANSURA
330 Carmel Ave., Pacifica, CA, 94044-2407, USA
BARBARA J. HOSHIZAKI
557 N. Westmoreland Ave., Los Angeles, CA, 90004-2210, USA

Asstract.—The tree fern Highland Lace had an unusual introduction into cultivati st thirty
years ago in Eastern Australia and was initially identified as Sphaeropteris tomentosissima
(Copel? R.M.Tryon. Since then, it has been introduced to Europe and the US, and it remains a
popular ‘te fern found in both public and private collections. We re-examined this fern,
comparing it to a herbarium type specimen, and conclude that it is not S. tomentosissima, but is
most likely a variant form of Sphaeropteris cooperi (F.V. Mueller) R.M.Tryon. Sequence analysis of
chloroplast DNA [rbcL, atpA and trnL (UAA) intron] confirmed this species identification.

Key Worns.—Highland Lace, Sphaeropteris tomentosissima, Sphaeropteris vn ee sega
excelsa, tree ferns, chloroplast DNA sequence analysis, rbcL, atpA, trnL (UAA) in

A distinctive tree fern with narrow pinnules and relatively small fronds
appeared in Australian cultivation in the 1980s. It was a robust grower and its
reduced pinnules imparted a lacy look to the leaves. Compared to most tree
ferns, it was smaller, but it also seemed to bear more leaves in its crown. It
originated as an unknown contaminant in a sporing pot at a wholesale nursery
on the north coast of New South Wales, Australia. The late Rod Hill, an
Australian tree fern enthusiast, made an attempt to identify the species and his
closest match was Sphaeropteris tomentosissima (Copel.) R.M. Tryon, which
grows in the highlands of west central New Guinea.

In the 1980s this plant spread among tree fern collectors and commercial
growers in Australia and by the 1990s it was being grown in Europe and the
United States. It is called either Highland Lace, New Guinea Treefern or
Sphaeropteris tomentosissima. Its lacier appearance compared to other
cultivated tree ferns has led to its high popularity, and it was awarded a first
place and a trophy at the Los Angeles International Fern Society’s annual
Exotic Plant Show in 1997 and 2003 (Lois and Kurt Rossten, Huntington
Beach, California).

Despite the enthusiasm for this new addition to the limited list of
commercially available cultivated tree ferns, the identity of this fern was
always a bit suspect, as noted by the question mark next to the species name on
Rod Hill’s former web site (Treeferns Down Under). We have re-examined this
fern, and based on scale morphology and chloroplast DNA sequence analysis,
conclude that it is actually a variant form of Sphaeropteris cooperi (F.V.Muell.)
R.M.Tryon, rather than S. tomentosissima.

70 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

TaBLeE 1. Voucher information and GenBank accession numbers for tree ferns examined.

GenBank accession and
reference

Species Provenance ID number
S. tomentosissima Papua New Guinea UC640117
S. tomentosissima Papua New Guinea Conant 4581 (LSC) Korall et al., 2006
atpA - AM176460
Korall et al., 2007
rbcL — AM177352
trnL intron — AM410304
S. cooperi Highland Lace Yansura 1 (UC) rbecL — JN106035
‘‘Cultivated’’ Australia atpA - JN106039
trnL intron - JN106036
S. cooperi “Cultivated’’ Australia Yansura 2 (UC) rbcL — HM347350
atpA — JF690125
trnL intron — JF742607
S. cooperi Flecker Botanical Yansura 3 (UC) rbcL — JN106038
Gardens, Cairns Australia atpA — JN106040

trnL intron — JN1060367

MATERIALS AND METHODS

The type specimen of Sphaeropteris tomentosissima (Cyathea tomentosis-
sima Copel.) was examined and stipe scales were photographed at high
resolution at the University and Jepson Herbaria at the University of California
Berkeley (Brass 9116; UC 640117).

Leaf material for isolating chloroplast DNA was obtained from three sources:
a cultivated plant of Highland Lace and a cultivated Sphaeropteris cooperi,
both from the US (Hoshizaki’s and Yansura’s gardens); and four S. cooperi
plants in the Flecker Botanical Gardens in Cairns, Australia. The latter four
plants were carefully checked to be sure they had stipe scales consistent with
S. cooperi as the garden had one plant labeled Sphaeropteris excelsa
(Endlicher) R.M. Tryon, which could be confused with S. cooperi except for
the scale differences. DNA was extracted from leaf material using the DNeasy
Plant Mini Kit from QIAGEN (Valencia, California, USA), and the purified
DNA was then used as a template to amplify three plastid loci (rbcL, atpA, trnL
intron) using the polymerase chain reaction (PCR). The reaction was carried
out with the appropriate set of primers and Cloned Pfu DNA polymerase from
New England Biolabs (Ipswich, MA, USA) according to manufacturer’s
protocols. The PCR products were purified using the MinElute Reaction
Cleanup kit from QIAGEN and then subjected to DNA sequencing on an
ABI3730xl DNA Analyzer. All sequences (the four plants from the Flecker
Botanical Garden had one common sequence) were deposited in GenBank
(Table 1).

The beginning of the rbcL gene and the atpB-rbcL spacer were amplified
with the primers atpBR or atpBR1 and RBCL158R, the middle of the rbcL gene
with primers brun1 and brun2, and the 3’ end as well as the rbcL-accD spacer
with primers RBCL1187F and ACCD887R. The atpA gene was amplified by

YANSURA & HOSHIZAKI: A CULTIVAR OF SPHAEROPTERIS COOPERI a1

TaBLE 2. Primers used in amplification and sequencing. F = forward; R = reverse; S = sequencing.

Loci primer Usage Sequence (5’-3’) Reference

rbcL atpBR F TGAGCTTTGGCAATATTATTG This study

rbcL atpBR1 F TAATCTCTTGACCCGCTGGGTTAC This study

rbcL RBCL158R RS AAGATTCCGCAGCTACTGCAGCTCC Pryer, 2004

rbcL brun1 FS Oo er ee This study

rbcL RBCL1187F FS GGAACYTTGGGACATCCTTGG Korall,2007

rbcL ACCD887R R app tsncrsan tag ibhimtilary Korall,2007

rbcL rbcf1 S CCAAA GGGCTTATCTGCT This study

rbcL rbcf2 S CTAGCITCGOCTTCTA TTGCCG This stud

atpA ESATPF415F FS CARGTTCGACAGCAAGTYTCTCG Schuettpelz,2006
atpA ESTRNR46F RS GTATAGGTTCRARTCCTATTGGACG Schuettpelz,2006
atpA atpAf S GACAGACTGGTAAAACAGCAGTAG This study

atpA atpAr s TTGCCGGTCGAATGCCAGCATTAA This study

trnL trn1 RS ATTTGAACTGGTGACACGAGGATT This study

trnL trn2 FS CGAAATCGGTA! roca da This study

trnL trn5 S CTACCCTGTTCTGTTGGGG This study

trnL trn6 S TOSAErn eee This study

trnL trn9 S TCGAGTCTCTGTACCTATC This study

PCR using the primers ESATPF415F and ESTRNR46F, and the trnL intron and
flanking sequences were amplified with the primers trn1 and trn2. All primers
used for PCR amplification and sequencing are listed in Table 2.

RESULTS

Our first indication that this tree fern might be misidentified was based on
the stipe scales, which did not match the published description for
Sphaeropteris tomentosissima (Holttum, 1963). Comparison with the type
specimen reaffirmed that the two plants were very different in scales, leaf, and
other details (Fig. 1 and 2A-C). Surprisingly, however, the stipe scales on
Highland Lace closely match those of the commonly cultivated Australian tree

B

Fic. 1. A comparison of the pinnae. A: — tomentosissima; B: Highland Lace; C:
Sphaeropteris cooperi. The bars represent 1 c

72 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

A

Fic. 2. A comparison of the stipe scales of Sphaeropteris tomentosissima, Highland Lace, and
Sphaeropteris cooperi. A: Scales of S. tomentosissima are brown and twisted. B and C: Highland
Lace and S. cooperi respectively both have large pale scales with dark setae on the edge as well as
smaller narrow dark-red scales. The bars represent 1 cm.

fern Sphaeropteris cooperi despite their distinct differences in pinnae and leaf
shape (Fig. 1).

The scales of Highland Lace were compared to Sphaeropteris cooperi and
Sphaeropteris tomentosissima. The S. tomentosissma stipe scales are brown,
twisted, and have edges bearing setae of the same color as the scales. In
contrast, the broader stipe scales of Highland Lace and S. cooperi are whitish
to light tan, with their margins usually bearing a very narrow row of dark
reddish brown marginal cells and setae of the same color. Additionally,
Highland Lace and S. cooperi have small narrow dark reddish brown scales on
the stipe, which are absent on S. tomentosissima (Fig. 2A—C). Also particularly
noticeable on S. tomentosissima are the very dense mats of small woolly scales
on the abaxial side of all rachises (Fig. 3A—C), which are not present on S.
cooperi or Highland Lace. The comparison of scales alone is highly suggestive
that Highland Lace is much more closely related to S. cooperi than to S.
tomentosissima.

In order to ascertain if Highland Lace is possibly Sphaeropteris cooperi and
to further rule out Sphaeropteris tomentosissima, we compared rbcL DNA

Fic. A comparison of the costae of Sphaeropteris tomentosissima, Highland Lace and
Sphaeropteris cooperi. A: S. tomentosissima has a dense: mat of small — scales on the abaxial
ds

side. B and C: Highland Lace and I ooly scales.

YANSURA & HOSHIZAKI: A CULTIVAR OF SPHAEROPTERIS COOPERI 73

TaBLE 3. Dissimilarity matrix indicating the number of base-pair changes observed for the three
loci, rbeL, atpA and trnL intron. Numbers in parenthesis indicate the total base pairs compared.

Cultivated S. Flecker

Highland Lace cooperi aly S. tomentosissima

S. tomentosissima rbcL 4 (1309) 4 (1309) 4 (1309) -

atpA 1 (1514) 1 (1514) 1 (1514) -

trnL 2 (554) 2 (554) 2 (554) -
Flecker S. cooperi rbcL 0 (1428) 0 (1428) -

atpA 0 (1521) 0 (1521) -

0 (554) 0 (554) -

Cultivated S. cooperi = rbcL 0 (1428) -

atpA 0 (1521) .

trnL 0 (554)
Highland Lace rbcL -

atpA -

trnL -

sequence data for both species (Newmaster et al., 2006; Korall et al., 2007). The
Highland Lace sequence differed from the partial gene sequence of S.
tomentosissima in GenBank by four changes over the 1309 base pair (bp)
length, further evidence that they were different species (Table 3). This
sequence was then searched on GenBank and surprisingly the top BLAST
match for Highland Lace was a sequence from Sphaeropteris excelsa rather
than the expected S. cooperi. The 1309 bp sequence of S. excelsa (AM410213)
was identical to that portion in Highland Lace, while the S. cooperi sequence
(SCU05944) differed by four changes over 1320 bp.

This rbcL sequence comparison seemed to indicate that Highland Lace was
closer to S. excelsa than to either S. cooperi or S. tomentosissima. However,
the scales on Highland Lace did not match this conclusion. Highland Lace and
S. cooperi have both broad pale scales as well as small narrow dark red scales
on its stipe, while S. excelsa has only broad pale scales. Additionally,
Highland Lace (and S. cooperi) has small narrow dark red scales on its costa
and costule while S. excelsa has a mat of whitish scales and hairs (Hoshizaki
and Yansura, 2005). Since the scales on Highland Lace matched those of S.
cooperi rather than S. excelsa, we decided to obtain additional S. cooperi rbcL
sequence data from a cultivated plant and from four plants from the Flecker
Botanical Gardens (Table 1). All five sequences were identical over the
complete rbcL gene of 1428 bp, and these were exact matches for the Highland
Lace gene.

In order to further confirm the identity of Highland Lace, the chloroplast
atpA gene sequence (Schuettpetz et al., 2006) was obtained from this plant,
from the cultivated S. cooperi plant and from the four tree ferns in the Flecker
Botanical Garden. All six sequences matched perfectly over the complete gene
sequence of 1521 bp, while the GenBank partial sequence for Sphaeropteris
tomentosissima differed by one change over 1514 bp (Table 3), resulting in one

74 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

amino acid change (T213N). There were no reference atpA sequences in
GenBank for S. cooperi or S. excelsa.

As a final step, we obtained DNA sequences for the trnL (UAA) intron
(Taberlet et al., 2007). Highland Lace perfectly matched that of cultivated S.
cooperi and the four Flecker Botanical Gardens specimens over the intron’s
554 bp (Table 3), and these sequences also matched exactly the partially
overlapping 534 bp of S. cooperi in GenBank (EU554328) and S. excelsa over
525 bp (AM410341). The S. tomentosissima sequence in GenBank differed by
two bp over the complete 554 bp overlap (Table 3).

Sphaeropteris excelsa and S. cooperi are closely related (Tryon and Tryon,
1959; Tryon, 1970; Jones and Clemesha, 1981) and share at least partial
common rbcL and trnL (UAA) intron DNA sequences. These S. excelsa
sequences were subsequently reconfirmed using leaf material from a cultivated
plant (Hoshizaki and Yansura, 2005). The phylogenetic relationship between
these species is unknown, but less conserved non-coding (Shaw et al., 2005;
Kress and Erickson, 2007) or nuclear sequences (Sang, 2002) could resolve this
question.

DISCUSSION

The identification of tree ferns is especially difficult when the country of
origin is not known (Pryer et al., 2010). While Australia has only eleven native
species (Jones and Clemesha, 1980), the possibility of non-native spore
arriving from nearby New Guinea or from the collections of tree fern
enthusiasts within the country is certainly reasonable. The unique appearance
of Highland Lace, in particular the reduced pinnules, almost certainly led Rod
Hill to identify it as the non-Australian species S. tomentosissima. Upon re-
examining Highland Lace, the traditional use of stipe scales for tree fern
identification suggested that this identity was incorrect.

The more recently developed approach of using chloroplast or nuclear DNA
sequences as barcodes for species identification (Kress et al., 2005; Chase et al.,
2005; CBOL Plant Working Group, 2009) has been shown to complement
traditional analyses based on morphological characters. While DNA sequence
analysis is becoming a more widely used tool for this purpose, the public
database is still somewhat limited in terms of species coverage. There are only
about 150 rbcL sequences from Sphaeropteris, Cyathea and Alsophila in
GenBank, while worldwide there are over 600 Cyatheaceae tree fern species
(Large and Bragins, 2004). However, an enlarged DNA database will eventually
provide a more robust system.

The confirmation that Highland Lace is S. cooperi required the use of both
morphological characters and DNA sequence analysis. The early study of stipe
scales showed that Highland Lace was not Sphaeropteris tomentosissima, but
it did not demonstrate that it was S. cooperi. To do so was more tenuous
considering that there are approximately 120 Sphaeropteris species worldwide
(Large and Braggins, 2004), many with similar scale morphologies.

YANSURA & HOSHIZAKI: A CULTIVAR OF SPHAEROPTERIS COOPERI 75

Fic. 4. An overall view of the tree ferns Highland Lace (A) and “Wild-type” Sphaeropteris cooperi
(B) showing the significant differences in their general appearance.

Our first DNA sequence analysis based on rbcL confirmed that Highland
Lace was not S. tomentosissima, but the effort to determine if it was related to
S. cooperi resulted in the discovery of a GenBank voucher that was
misidentified (see Results for details). As a result, new reference sequences
were made for S. cooperi, which all proved identical to the Highland Lace
sequence. Further DNA sequence analysis based on the chloroplast atpA gene
and the trnL (UAA) intron also confirmed that Highland Lace is S. cooperi
(Table 3

As a practical way to identify a tree fern species, DNA barcoding is an
important tool, but with the limited data available, it cannot be used
exclusively. The initial Highland Lace rbcL sequence quickly showed that
this tree fern was not S. tomentosissima. However, given the sequences that
currently exist in GenBank, DNA barcoding could not distinguish whether S.
excelsa or S. cooperi was the correct species. Morphologically specific
features, particularly the leaf scales in tree ferns, still play an important role
in fern identification. The use of morphological characters that initiated this
investigation later led to the discovery of the error in the database and its
subsequent correction, and scale characteristics ultimately allowed us to
choose S. cooperi as the correct species. The interplay of these two methods
was important throughout this study.

At first glance, it is difficult to think that Highland Lace and S. cooperi are
actually the same species because their general appearances are so strikingly
different (Fig. 4). Sphaeropteris cooperi is native to eastern coastal Australia

is known to be variable in form (producing cultivars including Brentwood,
Robusta, Allyn Lace, and Allyn Kiest). Most of these variants, however, are
uite modest compared to what is observed in Highland Lace with its
conspicuously contracted, recurved margins and the reduced size of the

76 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

pinnules. Sphaeropteris cooperi shares this ability to produce multiple

variants with a limited number of other ferns. Species such as Athyrium
filix-femina (L.) Roth and Polystichum setiferum (Forssk.) Moore ex Woynar
are also known to produce many variants that have contracted or reduced
blade surfaces, recurved margins, and smaller dimensions, plus many more
deviations from the typical shape (Rickard, 2000; Hoshizaki and Moran, 2001).

A search of the literature suggests that this unusual tree fern may have been
reported earlier. A description of Sphaeropteris cooperi (in Flora of Australia,
1998) mentions the existence of an unnamed narrow pinnule variant:

“An occasionally cultivated form of Cyathea (Sphaeropteris) cooperi from central
and northern Queensland has narrow recurved abaxially glaucous pinnule lobes,
with the majority of rhizome and stipe scales lacking any brown coloration. The sori
in this form are commonly restricted to the basal part of each pinnule, at least on
younger plants. The Victorian collection may be an isolated accidental occurrence
rather than a sample from a naturalized population.”

This is possibly the same plant as Highland Lace. However, in the Flora of
Australia description, the stem and stipe scales of this fern are said to lack any
brown coloration while the Highland Lace specimens in the US have dark red-
brown margins, bearing setae. The sori on Highland Lace also may extend well
beyond the basal part of each pinnule to near the tip in the US specimens. If
Rod Hill’s website is correct concerning the origin of this unusual fern in a
spore pan (but in New South Wales instead of Queensland), we may consider
this form an accidental occurrence. However it cannot be ruled out that this
aberrant plant may also exist in the wild.

ACKNOWLEDGMENTS

We are indebted to Chris Goudey and Neil Shirley, both of Australia, for their help in providing
information pertaining to this cultivar. We also thank the Flecker Botanical Gardens in Cairns,

assistance in locating specimens; Kelly Agnew took and then provided us with the high-resolution
photographs used in this article.

LITERATURE CITED

CBOL PLANT epgiea Group. 2009. A DNA barcode for land plants. Proc. Natl. Acad. Sci.
106: ptt 2797

CHASE, M. Pe ALAMIN, M. WILKINSON, J. M. DuNweELL, R. P. KEsANAKURTHI, N. Hamar and V.
Honiley 2005. ispee Loves and DNA barcodes: short-term and long-term goals. Phil.
Trans. R. Soc. B 360:1889-1895.

FLoRA OF AUSTRALIA. 1998. ae erns Gymnosperms and Allied Groups. 48:203. Australian Biological
Resources Study/CSIRO Publishing.

Hottrum, R. E. 1963 Cyatheaceae. Flora — Il Pteridophyta 1:128.

Hosnizaxi, B. J. and D, G. YANsura. 2005. Cooper's tree fern and Norfolk Island tree fern (Cyathea

cooperi (F. v. M, ell.) Domin and Cyathea enc Domin). Fiddlehead forum 32(3):17-20.

YANSURA & HOSHIZAKI: A CULTIVAR OF SPHAEROPTERIS COOPERI ‘We

Hosuizaki, B. J. and R. C. Moran. 2001. Fern Grower’s Manual. Timber Press, Portland, Oregon,
US

Jones, D. L. and S. C. Ciemesua. 1980. Australian Ferns and Fern Allies. Reed Books PTY LTD,
NSW, Australia.

Kora.t, P., D. S. Conant, J. S. Merzcar, H. ScHNemer and K. M. Pryer. 2007. A molecular phylogeny
of erage tree ferns (Cyatheaceae). Am. J. Bot. 94:873-886.

Kora.t, P., M. Pryer, J. S. Merzc H. ScHNEIDER and D. S. Conant. 2006. Tree Ferns:
Theor groups en — relationships as revealed by four protein-coding plastid loci.
Mol. ede tre Evol. 39:830-84

Kress, J. W., K. J. Wurpack, E. re ee tie A. Weict and D. H. JANZEN. sea Use of DNA barcodes to
identify seep ee plants. Proc. Natl Acad. Sci. USA 102:8369-837

Kress, J. W. and D. L. Erickson. 2007. A two-locus global DNA barcode Als land api ey sei
rbcL gene complements the non-coding trnH-psbA spacer region. PLoS ONE 2:e

Newmaster, S. G., A. J. Fazekas and S. Racupatuy. 2006. DNA barcoding in land plants: evaluation
of rbcL in a multigene tiered approach. Can. J. oe 84: tps

Pryer, K. M., E. ScHuETTPELz, P. G. WotF, H. Scunemer, A. R. Sm TH and R. CranFiLL. 2004. Phylogeny
and evolution of ferns (monilophytes) with a focus on ‘2 early leptosporangiate divergences,

Pryer, K. M., E. Scuetrpeiz, L. Hurt, A. L. Grusz, C. J. RoTHFELS, T. AvENT, D. Scuwartz and M

armas 2010. DNA barcoding exposes a case of mistaken identity in the fern catia!
e. Mol. Ecol. Resour. 10:979-985.

M. Ha fs 2000. The Plantfinder’s Guide to Garden Ferns. David & Charles Publishers Brunel
House, Newton Abbot, Devon, UK.

SanG, T. 2002. Utility of murda dd nuclear gene sequences in plant phylogenetics. Crit. Rev.
Biochem. Mol. Biol. 37(3):121-147.

ScHUETTPELZ, E., P. Koraui and K. a Pryer. 2006. Plastid atpA data provide improved support for
deep pec aawiny among ferns. Taxon 55:897—906.

Suaw, J., E. B. Lickey, J. T. Beck, S. B. Farmer, W. Liu , J. Miuier, K. C. Siripun, C. T. Wiper, E. E.
ScHILLING and R. L. SMaLL. pel The Tortoise aad the Hare II: pret utility of 21 noncoding
chloroplast DNA = for phylogenetic randy Am. J. Bot. 92:142—166.

TABERLET, P., E. Coissac, F. PoMPANON, on Sane C. Miquet, A. Vicinie T. VERMAT, G. CorTHier, C.
Br NN and E. WILLERSLEV. . Power and oo, of the chloroplast trnL (UAA)
intron for plant DNA inp onthe Acids Res. 35:e

Tryon, R. and A. Tryon. 1959. Observations on Fs eats bbe ems: os Hardy Species of Tree erns
(Dicksonia and Cyatheaceae). Am. Fern J. 49(4):1

Tryon, R. 1970. The classification of the Cyatheaceae. faa: oe Herb. 200:3-53.

American Fern Journal 102(1):78-82 (2012)

Elaphoglossum montanum, a New Species from
Southern Brazil

Maria A. KIELING-RuBIO
Universidade Federal do Rio Grande do Sul, PPG Botanica, Prédio 43433, CEP: 91501-970 Porto
Alegre, Brazil. e-mail: angelrubio@ig.com.br
PauLo G. WINDISCH
Universidade Federal do Rio Grande do Sul, PPG Botanica, CP 15020, UFRGS Campus do Vale;
91501-970 Porto Alegre, Brazil. e-mail: pteridos@gmail.com

Di

ABSTRACT hogl ntanum, a new fern species of the Atlantic Forest in southern Brazil,
is s described, illustrated, and apace to the most similar species. It belongs to the Elaphoglossum

Subulate scales clade” and occurs in the upper montane forest regions in the States of Rio Grande
do Sul and Santa Catarina, between 600 and 1400 m

Key Worps.—Atlantic Forest, southern Brazil, pteridophytes, taxonomy, floristic diversity

Elaphoglossum Schott ex J. Sm. contains ca. 600 species and ranks as one of
the largest and most complex genera of ferns (Mickel and Atehorttia, 1980). It is
pantropical but it is most diverse in the Neotropics, where ca. 80% of the
species occur (Moran et al., 2007). In Brazil, the highest species diversity is
in the Atlantic Forest biome (Windisch and Kieling-Rubio, 2010), which is
considered by Tryon (1972) as one of the three main centers of fern endemism
and speciation in Tropical America. In southern Brazil (States of Parana, Santa
Catarina, Rio Grande do Sul), about 40 species of Elaphoglossum occur
(Windisch and Kieling-Rubio, 2010), most of them occuring in humid forests,
especially in montane and submontane areas.

Mickel and Atehorttia (1980) considered the genus Elaphoglossum as
presenting nine sections, based on morphological characters. Part of these
sections was supported by the molecular phylogeny presented by Skog et al.
(2004) and Rouhan et al. (2004). Among the clades recovered by those studies
is the ‘“‘Subulate scales clade’’. Rouhan et al. (2004) indicated more details
studies should precede a formal taxonomic definition of this group within the
genus Elaphoglossum

During a study on the genus Elaphoglossum for Brazil, we found a new
species with subulate scales and hydathodes on the laminar margin, belonging
to the ““Subulate scales clade’’, sensu Skog et al. (2004), which we describe as
follow.

Elaphoglossum montanum Kieling-Rubio & P.G. Windisch, sp. nov. TYPE.—
BraziL. Santa Catarina: Lauro Miiller, Serra do Rio do Rastro (28°23'58.1"S
49°33’0.3”W), 1372 m, 10 Mar 2011, Kieling-Rubio & Windisch 900 (holotype
ICN; isotypes B, RB). Figs. 1-2.

KIELING-RUBIO & WINDISCH: ELAPHOGLOSSUM MONTANUM IN BRAZIL 79

1p"

Fic. 1. Elaphoglossum montanum. A) Habit. B) Sterile lamina. C) Fertile lamina. D) Fertile lamina
partially gue exposing sporangia. E) Rhizome scale. F—G) Laminar scales. (All Kieling-Rubio &
Windisch 900 ICN).

Species Elaphoglossum piloselloides (C. Presl) T. Moore habitu aliquot sassoomig a
qua frondibus fertilibus rotundatis et sporis uniformiter echi
Plants litophytic. Rhizomes short-ascending, 1.5-2.9 mm diam., steel:
scales 0.2-0.4 X 2.5 mm, brown, lanceolate. Fronds dimorphic, 2.8-9 cm long.

MitiGitl,

80 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

Fic. 2. A—C. Scanning electron micrographs of spore of Elaphoglossum montanum (Spanholi s.n.
ICN). A) Distal face. B) Proximal face. C) Detail of the echinate perispore.

Sterile fronds simple, 2.8—7 cm long; stipes 1.5-4.0 cm long X 0.5—0.8 (1.0) mm
diam., light green, covered with subulate scales (bases flat or somewhat
enrolled), 2-5 mm long, light brown sometimes darker at the base, with dentate
margins and a hair-like apex; laminae 1.3-3.0 cm long x 0.4—0.8 mm wide,
chartaceous to coriaceous, elliptic, apices rounded, margins recurved when
dry, veins barely visible, terminating in hydathodes close to the margins;
laminar scales similar to those of the stipes, densely covering both surfaces
when young, then glabrescent on the adaxial surface. Fertile fronds equaling or
usually longer than the sterile ones; stipes 2.5-6.0 cm long < 0.6—1.0 mm
diam., brown, scales similar to those on sterile fronds; fertile laminae 0.5—
3.0 cm long X 0.4-1.0 cm wide, rounded (appearing reniform when
conduplicate), base narrowly decurrent, adaxial surfaces covered with
subulate scales similar to those of the sterile fronds; margins membranous.
Spores monolete with a uniformly echinate perispore (Fig. 2).

DISTRIBUTION AND EcoLocy.—Elaphoglossum montanum is only known from the
upper montane region between the States of Rio Grande do Sul and Santa
Catarina, in areas with humid forests, from 600 to ca. 1400 m. The two known
populations were found on wet cliffs, in shaded places, ae (and even
underneath) individuals of Gunnera manicata Linden ex Andr

EtymMoLocy.—The specific epithet ““montanum’’ refers the occurrence of the

species in the mountains of the Serra Geral.

ADDITIONAL SPECIMENS EXAMINED.—BraAzIL. Rio Grande do Sul: Barracdo, Rio
Bernardo José com rio Pelotas, 02 Sep 2000, Spanholi s.n. (HAS 39037, MBM
256416); Bom Jesus, Barragem — Rio dos Touros, 09 Dec 1958, Camargo s.n.

KIELING-RUBIO & WINDISCH: ELAPHOGLOSSUM MONTANUM IN BRAZIL 81

(PACA 79067); Sado Francisco de Paula, Taimbé, 27 Feb 1959, Sehnem s.n.
(HUCS 7292); 17 Feb 1953, Sehnem 6328 (PACA); Taimbezinho, 30 Apr 1967,
Sehnem s.n. (PACA 79068). Santa Catarina: Bom Jardim da Serra, Serra do Rio
do Rastro, 09 Dec 1994, Bueno 4468 (ICN); Col6nia Anita Garibaldi, 1907,
Spannagel 405 (B, RB); Lages, 1906, Spannagel 165 (HB); Urubici, Serra do
Corvo Branco, 01 Jan 2009, Buzatto 411 (ICN); Urubici, Serra do Corvo Branco,
09 Nov 2010, Dettke 452 (ICN); Urubici, Serra do Corvo Branco, 28°03'25”S
49°21.5'41”W, 1200 m, 11 Mar 2011, Kieling-Rubio & Windisch 915 (ICN).

Elaphoglossum montanum is similar to E. piloselloides (from Peru to
southeastern and central-western Brazil), and E. jJamesonii (Hook. & Grev.)
T. Moore (Andean region) by presenting small fertile fronds that remain
conduplicate until the full maturation of the sporangia, and by the subulate
scales with dentate margins and hair like tips present on the fronds. However,
Elaphoglossum montanum can be easily distinguished by having a more
rounded fertile laminae, echinate spores, and light brown subulate scales on
the adaxial surfaces of the sterile laminae. In contrast, E. piloselloides has
narrowly and oblong fertile laminae, crested spores (Moran et al. 2007) and
dark brown subulate scales on the adaxial surfaces of the sterile laminae.
Elaphoglossum jamesonii, on the other hand, can be distinguished by its
crested perispores (SEM of spore from the type at Berlin, B-200070911).

aphoglossum minutissimum R. C. Moran & Mickel, from Costa Rica

(Moran and Mickel, 2004) is also a similar species, which differs from E.
montanum by not having conduplicate fronds.

ACKNOWLEDGMENTS

To the Federal haptiny of Rio Grande do Sul for the research facilities, to the “‘Coordenagao de
Aperfeigoamento de Pessoal de Nivel Superior” (CAPES) for the Doctoral Fellowship awarded to
the first author; to “Deutscher Akademischer Austauschdienst’’ (DAAD) for financial aid
during the visit to the collections abroad (B, BM, K, and M), to the Brazilian Research Council
(CNPq) for research grants. To the curators of the following Herbaria for the loans and assistance
during our visits (B, BM, CORD, D, HAS, HB, HBG, HBR, HUCS, ICN, K, M, MBM, MO, PAGA, P,
PR, R, RB, S, SJRP, SP, SPF, UPCB), especially to Dr. Brigitte Zimmer and Dr. Robert Vogt for their
support at the Botanical Gardens of Berlin. Dr. David Lellinger and Dr. Robbin Moran kindly
provided suggestions on a first version of the manuscript. To botanists present and past who
contributed with their collections, as well as to Greta Aline Dettke for assistance in SEM and to
Cristiano Roberto Buzatto for the illustrations.

LITERATURE CITED

MIcKEL, ' T. and L. AreHorTua. 1980. Subdivision of the genus Elaphoglossum. Am. Fern J.
70:47-68.

Moran, ‘ a J. Garrison-Hanxs and G. RouxHan. 2007. Spore morphology in relation to phylogeny
in he fern is Elaphoglossum Ait ndigeeis Int. J. of Plant Sci. 168:905-929.

Moran, R. C. and J. T. MickeL. 2004. Three new neotropical species of Elaphoglossum
(Elaphoglossaceae) with subulate scales. nant 56(3):200—204.

82 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

Rounan, G., J. Dusuisson, F. RAKOTONDRAINIBE, T. J. Mottey, J. T. MIcKEL, J. Lasat and R. C. Moran.
004. Molecular phylogeny of the fern genus Elaphoglossum (Elaphoglossaceae) based on
chloroplast non-coding DNA sequences: contributions of species from the Indian Ocean area.
ol. Phyl. Evo. nies
Skoe, J. E., J. T. MickeL, R. C. Moran, M. Vo.ovsek and E. A. Zimmer. 2004. Molecular studies of the
New World species in ibe a genus is ri (Dryopteridaceae) based on chloroplast
DNA sequences, Int. J. Plant Sci. 165:1063—
Tuiers, B. [continuously updated]. Index lei oie A global directory of public herbaria and
associated staff. New York Botanical Garden’s Virtual Herbarium. Available online at http://
rite dose oe org/ihy/. he ete Linea 21, 2010.
Tryon, R. M. 1 g I tion in tropical American ferns. Biotropica

Winoiscu, P. G. and M. A. Kreiinc-Rusio. 2010. Elaphoglossum. In: Lista de Espécies da Flora do
Brasil. Jardim Botanico do Rio de Janeiro. Available online at http://floradobrasil.jbrj.gov.br/
2010/FB09100. Accessed march 30, 2011.

American Fern Journal 102(1):83-85 (2012)

SHORTER NOTES

First Record of Pellaea ovata (Pteridaceae) from Brazil.—According to the
monograph of Pellaea sect. Pellaea by Alice Tryon (Ann. Missouri Bot. Gard.
44:125-193. 1957), the members of this section (about 10 species) occur
primarily in the southwestern United States and Mexico and four species and
their varieties (P. ternifolia Cav., P. ovata (Desv.) Weath., P. sagittata (Cav.)
Link, and P. myrtillifolia Mett. ex Kuhn) are also distributed along the Andes,
reaching to Argentina and Chile; only one species occurs in Africa (P. rufa A.F.
Tryon). Alice Tryon (l.c.) also commented that Hicken (Soc. Arg. Cienc. Nat.
13:206. 1916) had reported P. ternifolia from Minas Gerais, Brazil, but she had
not seen material of this species from Brazil during the revision of this group.
Subsequent authors such as Sota (in Cabrera, Fl. Prov. Jujuy Rep. Argentina
13:109-111. 1977), Tryon and Stolze (Fieldiana, Bot., n.s. 22:2-83. 1989),
Murillo-Pulido and Harker-Useche (Helechos y Pl. Afines Col.:158-159. 1990),
Yatskievych (in Moran and Riba, Fl. Meso. 1:136—137. 1995), Arbeldez (in
Jorgensen and Le6én-Yanez, Monogr. Syst. Bot. Missouri Bot. Gard. 75:168—176.
1999), Prado (in Hokche et al., Nuevo Cat. Fl. Vasc. Venez.:162. 2008), and
Ponce et al. (in Zuloaga et al., Monogr. Syst. Bot. Missouri Bot. Gard. 107:161.
2008) also confirmed this pattern of distribution of these four Pellaea species
along the Andean Cordillera, and Prado and Sylvestre (in Forzza et al., Cat. Pl.
and Fungi of Brazil, 1:557-558. 2010) corroborated their absence in Brazil.

However, recently, in 2010, the first author, during field work for his Master
thesis, found a population of Pellaea ovata growing in the mountains in the
center of the state of Sao Paulo, more precisely in the Municipality of
Botucatu, Pavuna Farm, trail to the waterfall, 22°50’15”S, 48°30'40”W, 750 m,
13 Jan 2010, Biral & Gomes 511 (BHCB, HRCB, SP). In 2011 we visited the same
population of this species and another sample was collected: Pavuna Farm,
Road Marechal Rondon (SP 300), km 259, between Botucatu and S40 Manuel,
22°50'S, 48°30'W, 600 m, 6 May 2011, Prado et al. 2143 (DUKE, HRCB, MO,
NY, P, SP, UC). Pellaea ovata belongs to the Section Pellaea and it can be
easily recognized by the scandent habit, creeping and dichotomously branched
rhizomes, flexuous and pubescent rachises, stalked and ovate to cordate
segments, and lamina glabrous on both surfaces (Fig. 1). Our two collections
represent the first record of P. ovata from Brazil.

Pellaea ovata is distributed from the southern United States (Turner et al.,
Atlas Vasc. Pl. Texas, v.2, Sida, Bot. Misc., pg. 666. 2003) to Argentina,
including Central America and Hispaniola (Tryon l.c.). At the Pavuna Farm,
it grows among grasses and at the bases of Aechmea distichantha Lem.
(Bromeliaceae) and Praecereus euchlorus (F.A.C. Weber) N.P. Taylor (Cacta-
ceae). The Pavuna Farm encompasses the largest fragment of the “Mata da
Pavuna” and occupies an area of 378.49 ha at an elevation of 600-761 m. The
relief is steep, with slopes between 30°—90° of inclination, and soils that are
shallow, dry, and sandy. There are two distinct climatic seasons in this region,

84 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

Fic. 1. A-F Pellaea ovata. A. Habit. B. Rhizome. C. Detail of the pinnules abaxially. D. Detail of
the hairs on the segment stalk. E. Rhizome scale. F. Detail of the rhizome scale (Prado et al.
Z SP).

the rainy summer and dry winter. Average monthly temperatures range from
12.4°C (September) to 28.1°C (January) and mean monthly rainfall from
270.15 mm (January) to 27.92 mm (August) (data graciously provided by the
Meteorological Station of Experimental Farm Sao Manuel, Faculdade de

SHORTER NOTES 85

Ciéncias Agrarias, University of Sdo Paulo State, Botucatu, SP, Brazil). The
main vegetation in the area is semideciduous forest (i.e., non-Atlantic forest)
and on the tops of the slopes there are some xerophitic elements among rocks,
such as Aechmea distichantha, Praecereus euchlorus and Cereus hildmannia-
nus K. Schum. (Cactaceae). This area belongs to the ‘‘Residual Pleistocenic
Seasonal Formations Arc”’ in South America (Prado and Gibbs, Ann. Missouri
Bot. Gard. 80:902—927. 1993). According to these authors, nowadays this arc
contains remnants of the dry vegetation of that time, including the genera
noted above. The arborescent component of the slopes in this area is
dominated by Aspidosperma riedelii Mill. Arg. (Apocynaceae), a species
cited by Prado and Gibbs (l.c.) as typical of dry seasonal forests of South
America. Pellaea ovata can be added here as another example of a relictual
element, because its distribution is coincident with this dry arc, especially
along the line of latitudes between 15°—28°S, between Bolivia (Chuquisaca, La
Paz, Tarija, Cochabamba), Argentina (Catamarca, Salta and Tucumdan), and
Brazil (Sao Paulo). It is also cited as occurring in dry vegetation in Ecuador
(Wiggins, Amer. Fern J. 36(1):1—7. 1946).

This note is one of the results of the project “Vascular flora of ‘Mata da
Pavuna’, Botucatu, SP, Brazil’ developed by the first author and Julio A.
Lombardi, and was supported by The National Council for Scientific and
Technological Development (CNPq). We thank Klei Souza for preparing the
drawings.—Leonarpo Bir, Universidade Estadual Paulista “Julio de Mesquita
Filho”, Instituto de Biociéncias, Depto. de Botanica, CEP 13506-900, Rio Claro,
SP, Brazil, and JEFFERSON Prapo, Instituto de Botanica, Herbario SP, Av. Miguel
Stéfano, 3687, CEP 04301-012 Sao Paulo, SP, Brazil.

American Fern Journal 102(1):86—90 (2012)

SHORTER NOTES

Botrychium simplex E. Hitchcock: a New Moonwort for the Indian
Himalayan Mountains.—The genus Botrychium Sw., has a nearly cosmopol-
itan distribution in the subtropical, temperate, boreal and polar regions of the
world (Copeland, Genera Filicum. Cronica Botanica Co. Waltham Mass. USA.
1947; Wagner Jr., Ophioglossaceae. In: K. Kubitzki, ed. The Families and
Genera of Vascular Plants. I. Pteridophytes and Gymnosperms pp. 193-197.
Vol. eds.: K. U. Kramer and P. S. Green, Springer-Verlag. 1990). The genus is
represented by 50-60 species (Wagner and Wagner, Ophioglossaceae C.
Agardh: Adder’s-tongue family. pp. 85-106. In: Flora of North America
Editorial Committee, eds. Flora of North America, north of Mexico, Part 2:
Pteridophytes and gymnosperms. Oxford University Press, New York. 1993) of
which 19 occur in Asia (Sahashi, Preliminary review on Asian Botrychiaceae.
pp. 54-75. In: X. -C. Zhang and K. -H. Shing, eds. Ching Memorial Volume.
China Forestry Publishing House, Beijing. 1999). In India, the genus is well
studied at national and regional levels (Beddome, Handbook to the Ferns of
British India: Ceylon and the Malay Peninsula. pp. 469, Thacker, Spink, and
Co., Calcutta, India. 1883; Clarke, Trans. Linn. Soc. Ser. 2: Botany, Vol. 1. 587.
1880; Panigrahi and Dixit, Proc. Nat. Inst. Sci. India 35 B (3): 230-266. 1969;
Goswami, Bionature. 7:47—89. 1987; Bir and Bhusri, Indian Fern J. 2: 39-56.
1985; Khullar, An illustrated fern flora of West Himalaya Vol. I. pp. 1-15.
International Book Distributors, Dehradun, India. 1994) and is included in
several checklists and survey reports (Iwatsuki, Pteridophyta. In: Flora of the
eastern Himalaya. pp. 166-205. In: Ohashi, ed, 3rd report. Bull. Univ. Mus.
Univ. Tokyo. 1975; Dixit, A Census of the Indian Pteridophytes. pp 21-22.
Botanical Survey of India. Howrah, India. 1984). Following Panigrahi and
Dixit (1969), recently Fraser-Jenkins (Taxonomic revision of three hundred
Indian subcontinental Pteridophytes. pp 21-22; 525-526. Bishen Singh
Mahendra Pal Singh, Dehradun, India. 2008) recognized six species of
Botrychium from India; these are: Botrychium daucifolium Wall. ex Hook. et
Grev., Botrychium lanuginosum Wall. ex Hook. et Grev., Botrychium lunaria
(L.) Sw., Botrychium multifidum(Gmel.) Rupr., Botrychium ternatum (Thunb.)
Sw. and Botrychium virginianum(L.) Sw. However, he did not accept various
subspecies or varieties others described from India or the Himalayas. The
present author follows this treatment, because most of these taxa from the
Indian region are based on abnormal specimens or on minor geographical or
climatic variations. Moreover, these variations are neither stable nor found as
populations. Most of the Indian Botrychium are distributed throughout the
hilly regions, but Botrychium lunaria, the common moonwort, is restricted to
the alpine regions of the Himalayas (Beddome, 1883; Clarke, 1880; Hope, J.
Bombay Nat. His. Soc. 15: 108. 1903).

Botrychium simplex E. Hitchcock, the least moonwort, was described by
Hitchcock in 1823 (American Journal of Science and Arts. 6:103. 1823). In

SHORTER NOTES 87

1821, plants initially considered to be B. Junaria had been discovered in
Massachusetts, USA; after careful study, Hitchcock (1823) determined they
were distinct enough from B. Junaria to warrant the status of species. Several
varieties have been recognized by Eaton (Fern Bulletin 7:7-8. 1899), Clute (Our
ferns in their haunts: a guide to all the native species. pp. 51-63. Frederick A.
Stokes Co. New York. 1901), Clausen (Mem. Torrey Bot. Club 19:1-177. 1938)
and Wherry (Amer. Fern J. 27: 58. 1937). Wagner and Wagner (1993) advocated
that B. simplex exhibits phenotypic responses to different habitats and
climates, hence almost all infraspecific taxa are environmental forms and
juvenile stages of B. simplex; however, they accepted the alternate concept of
“eastern” and “western” forms (Anderson, Botrychium simplex E. Hitchcock
(little grape fern): a technical conservation assessment. 2006. USDA Forest
Service, Rocky Mountain Region. [Online] http://www. fs.fed.us/r2/projects/
p/ ts/botrychi implex.pdf, accessed on 3rd December 2010).
Farrar (Botrychium simplex. In: Moonwort (Botrychium) Systematics. Iowa State
University, Department of Ecology, Evolution and Organismal Biology, Ada
Hayden Herbarium. 2005. [online] http://www. public.iastate.edu/~herbarium/
botrychium/B-simplex.pdf. accessed on 7 August 2011) recognizes these as B.
simplex var. simplex and B. simplex var. compositum (Lasch) Milde. Recent
genetic analysis suggests that there is genetic variation within B. simplex (Hauk,
Am. Fern J. 85:375-394.1995; Farrar, Population genetics of moonwort
Botrychium. In: N. Berlin, P. Miller, J. Borovansky, U. S. Seal, and O. Byers
(Eds.), Population and _ habitat viability assessment for the goblin fern
(Botrychium mormo), 109-113, Final Report. The Conservation Breeding
Specialist Group, Apple Valley, Minnesota, USA. 1998; Farrar, Systematics of
western moonworts Botrychium subgenus Botrychium. In: Popovich, S. J. (ed.).
United States Forest Service moonwort workshop. Arapaho-Roosevelt National
Forests and Pawnee National Grassland, Fort Collins, Colorado, 2005).
Botrychium simplex is predominantly an American species, growing in
western and eastern temperate to boreal North America and southern
Greenland (Wagner and Wagner, 1993). It is rare in Iceland and according to
Oligaard (Scandinavian ferns: a natural history of the ferns, clubmosses,
quillworts, and horsetails of Denmark, Norway, and Sweden. Rhodos,
Copenhagen, Denmark. 1993) is distributed across Europe, where it is rare in
the west, but is more abundant in eastern Europe and adjacent western Russia.
Clausen (1938) cites a report of it by Nakai from Yizo, Japan. In his treatment of
Botrychium in the Flora of Japan,Kato (Ophioglossaceae. In K. Iwatsuki, T.
Yamazaki, D.E. Boufford and H. Ohba eds.: Flora of Japan. Vol. I. Pteridophyta
and Gymnospermae. pp. 22-29. Kodansha, Tokyo. 1995.) placed plants
previously identified B. simplex var. tenebrosum under B. lunaria. Botrychium
simplex is not mentioned by Zou and Wagner (Am. Fern J. 78:122—135. 1988)
as occurring in China. In his review of Asian Botrychiaceae, Sahashi (Ching
Mem. Vol. 1999) did not mention the occurrence of B. simplex from Asia and
he again advocated his previous report (Sahashi Japan. J. Jap. Bot. 58: 109-
112.1983) about the merging of previously indentified B. simplex (Faurie’s
specimen no. 5473 from Mt. Sharidake, Hokkaido in P) in to B. Junaria.

88 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

Furthermore, Kato (personal comm. 16-Aug. 2011) mentioned that there is no
recent report of this species from Japan, and previous records of B. simplex
from Japan (cited by Clausen 1938; and Nishida in Acta Phytotax. Geobot. 18:
39-43. 1959) are for dwarfed B. Junaria. In their treatment of B. simplex in the
Flora of North America, Wagner and Wagner (1993) do not mention Asian
plants. However, in Asia, B. simplex may have been overlooked by
pteridologists because of its similarity to B. Junaria, and because the many
cryptic species of Botrychium are extraordinarily difficult to distinguish from
each other due to their morphological similarity (Hauk, Am. Fern J. 85: 375—
394.1995).

Recently, Fraser-Jenkins (2008) found three herbarium sheets (one at PE and
two at BM) of B. simplex within the bundles of B. Junaria collected by F.
Kingdon-Ward from Tibet (Xizang) province of China. Because of the close
proximity of the B. simplex Tibetan locality to the Indian frontiers, as well as
climatic similarities between the regions, Fraser-Jenkins postulated that the B.
simplex should also be present in India. He also noticed that Sino-Himalayan
and American-European plants of B. simplex were morphologically distinct
and the latter was given a new rank of subspecies as Botrychium simplex
subsp. kannenbergii (Klinsm.) Fraser-Jenk. However, for the Asian plants he
retained the name Botrychium simplex subsp. simplex (Syn. Botrychium
tenebrosum A. A. Eaton, Botrychium simplex var. tenebrosum (A. A. Eaton)
R. T. Clausen). Clausen (1938) placed B. kannenbergii in synonymy with B.
simplex var. typicum Clausen, which is synonymous with B. simplex var.
simplex. So, based on the text here, Sino-Himalayan and American-European
plants are the same i.e., B. simplex var. simplex. Similarly, according to
Clausen (1938), B. tenebrosum or B. simplex var. tenebrosum and B. simplex
var. simplex are not synonymous, hence both are different taxa. But according
to Fraser Jenkins (2008), the variations in Botrychium simplex var. tenebrosum
(taller plants with fertile branched attached further up) are under the normal
morphological range of Botrychium simplex subsp. simplex and are due to
environmental factors and he treated them as synonyms.

While on a fern collection trip to high altitudes of North Sikkim, India,
the author found some interesting Botrychium (B. S. Kholia no. 35481, 9
September 2010, BSHC) from ca. 4—5 km West of Thangu. After crossing the
Thangu river via a foot bridge, and after ascending a few meters, the right foot
path goes to Chopta valley and the left ascends to another beautiful valley and
a Shiv temple. The plants were found growing near the mountain summit of
these two valleys, on a SE facing slope hardly 5-10 m below the mountain top,
ca. 4320 m elev., ca. 27° 53’ 41” N, 88° 31’ 23 E”. These plants are small (6—
13 cm tall) with somewhat deltate, shortly stalked trophophores, which are
attenuate at the base and have only one or two pairs of pinnae. Pinnae are
asymmetrical, spathulate or obovate deltate, cuneate and adnate to the winged
rachis. The sporophore is also very short with large sessile globose sporangia
arising from the rachis except the lowest pair which are short stalked and often
slightly branched and bear 3-5 sporangia. These plants are markedly different
from B. lunaria. In B. Junaria the trophophore is lanceolate to narrowly ovate,

SHORTER NOTES 89

Fic. 1. Botrychium simplex A: Habit; B—D: Close up of trophophore and sporangiophores. (Scale
bar: A= 2.5 cm, B= 1.5 cm, C = 2 cm, D = 0.5 cm).

90 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 1 (2012)

generally long stalked, once pinnate with ca. 5-10 pairs of pinnae which are
broadly fan-shaped or lunate in shape and stalkless to shortly stalked. The
sporophores of B. lunaria are pinnate (sometimes the lower pairs are
bipinnate).

During the International Symposium on Pteridophytes (November, 2010,
Palampur Himachal Pradesh, India) photos of this Botrychium (Fig. 1 A-D)
were shown to C. R. Fraser-Jenkins, who identified them as B. simplex. These
photos were also sent to Prof. Donald Farrar, who agreed with Fraser-Jenkins’
determination. Thus, this is the first record of B. simplex in the Indian
Himalayan Mountains. This find expands the range of B. simplex. At present,
in India, this species is known only from the locality mentioned above. More
plants are likely to be found after thorough surveys in similar habitats of Indian
and Sino Himalayan regions.

The author is greatly indebted to Mr. C. R. Fraser-Jenkins for identifying the
specimens and his kind help throughout my studies of Himalayan ferns.
Grateful thanks are also due to Prof. D. R. Farrar for encouragement. I
profoundly thank Dr. M. C. Stensvold and Dr. J. M. Sharpe for their review of
the previous draft and encouragements. Thanks are also due to Profs. M. Kato,
S. Masuyama and N. Sahashi for the status of species in Japan. Two
anonymous reviewers are also thanked for their fruitful comments. I also
acknowledge Dr. D. K. Singh, Director B. S. I. and Dr. K. Das, Scientist In-
charge, B.S.I. Sikkim for their help with this project.—B. S. Knot, Botanical
Survey of India, Sikkim Himalayan Regional Center Gangtok, Sikkim, 737 103
INDIA.

INFORMATION FOR AUTHORS

Authors are encouraged to submit manuscripts pertinent to pteridology for publica-
tion in the American Fern Journal. Manuscripts should be sent to the managing editor at
amerfernj@hotmail.com. Acceptance of papers for publication depends on merit as
judged by two or more referees. Authors are encouraged to contribute toward publishing
costs; however, the payment or non-payment of page charges will affect neither the accept-
ability of manuscripts nor the date of publication.

Authors should adhere to the following guidelines, sanieca pts net so prepared may be
returned for revision prior to review. E Oow-
ever if it is necessary to submit hard copy, please submit one copy of the manuscript and
include a review copy of illustrations and originals is illustrations. After acceptance, please
submit final versions of manuscripts via FTP (conta fi
email, or on diskette or CD ROM (see below ne Rit formating: If submitting hard
copies, use standard 8. 5 by 11 inch paper of good quality, not “erasable” paper. Double-

t, including title, author’s names and full addresses, a short,
informative abstract, key words, text (including heads and keys), literature cited, tables
(separate from text), and figure captions (grouped as consecutive paragraphs separate from
figures). Arrange parts of manuscript in order just given. Include author’s name and page
number in the upper right corner of every sheet, and provide an abbreviated running title.
Provide margins of at least one inch (25 mm) all around on typed pages. Do not submit
right-justified text, avoid footnotes, and do not break words at end of lines. Make table
headings and figure captions self-explanatory. Use S.I. (metric) units for all measures (e.g.,
distance, elevation, weight) unless quoted or cited from another source (e.g., specimen
citations). For nomenclatural matters (i.e., synonymy and typification), use one paragraph
per basionym (see Regnum Veg. 58:39-40. 1968). Abbreviate titles according to Botanico-
Periodicum-Huntianum (Lawrence et al., 1968, Hunt Botanical Library, Pittsburgh) and its
supplement (1991). References cited only as part of nomenclatural matter are not included
in literature cited. For shorter notes and reviews, omit the abstract and put all references
parenthetically in text. Use Index Herbariorum (Regnum Veg. 120:1-693. 1990; or http://
websun.nybg.org/bsci/ih/) for designations of herbaria. For more detailed instructions on
manuscript preparation, see http://amerfernsoc.org/.

Illustrations should be proportioned to fit page width (5 inches or 12.5 cm) with caption
ultimately to be included on the same page. Halftone and color images should be scanned
at a minimum of 300 pixels per inch (ppi). Line art should be scanned at 1200 ppi when-
ever possible. Please note that nearly all images that are downloaded from the Internet or
that are in JPEG or GIF format will be 72 dpi and not acceptable for the printing process.
Indicate the file format of the graphics. Please submit image files in TIFF (preferable) or
EPS format. Provide margins of at least 25 mm on all illustrations. For continuous-tone
illustrations, design originals for reproduction without reduction or by uniform amount.
In composite blocks, abut edges of adjacent photographs. Avoid combining continuous-
tone and line-copy in single illustrations or blocks. Coordinate sequence and numbering
of figures (and tables), with order of citation in text. Explain scales and symbols in figures
themselves, not in captions. Include a scale and reference to latitude and longitude in each
map.

£ 4 Pot fe od A eee

by the printer. Authors should ‘send proof corrections of corrected ae ge the editor ae

reprint orders to the printer. Authors 2

after type has been set. :
For other matters of form or aie consult recent issues of the American Fern Joie

nal and The Chicago Manual of Style, 14° ed. (1993, Univ. of sine Press, nave ce

Occasionally, departure from these guidelines may be justified. Auth

consult the editor for assistance with any aspect of manuscript f :
Papers of longer than 32 pag 5 i of Pedal (emoir .

Editor, see — cover page 2). :

~~

PTERIDOLOGIA ISSUES IN PRINT

The following issues of Pteridologia, the memoir series of the American Fern Society,
are available for purchase:

1. Wagner, David H. 1979. Systematics of Polystichum in Western North America
North of Mexico. 64 pp. $10.00 plus postage and handling.

2A. Lellinger, David B. 1989. The Ferns and Fern-allies of Costa Rica, Panama, and
the Choc6 (Part 1: Psilotaceae through Dicksoniaceae). 364 pp. $32.00 plus postage and
handling.

3. Lellinger, David B. 2002. A Modern Multilingual Glossary for Taxonomic Pteri-
dology. 263 pp. $28.00 plus postage and handling.

For orders and more information, please contact our authorized agent for sales at:
Missouri Botanical Garden Press, P.O. Box 299, St. Louis, MO 63166-0299, tel. 314-577-
9534 or 877-271-1930 (toll free). For online orders, visit: http://www.mbgpress.org.

AMERICAN FERN JOURNAL ON MICROFICHE

Volumes 1-61 of the American Fern Journal are available as archival quality, silver
positive microfiches. Single volumes or the entire run may be purchased. The fiches are
easily read with 10x or greater magnification (using a dissecting microscope and transmit-
ted illumination or a fiche reader). Silver negative microfiches of vols. 1-50 are also avail-
able. The price is $4.00 per volume or $244.00 per set of 61 volumes, postpaid.

Send your inquiry or order with a check or money order to: American Fern Society,

Inc., % Ecology III, 804 Salem Blvd., Berwick, PA, 18603-9801.
FIDDLEHEAD FORUM

The editor of the Bulletin of the American Fern Society welcomes contributions from
members and non-members, including miscellaneous notes, offers to exchange or purchase
materials, personalia, horticultural notes, and reviews of non-technical books on ferns.

SPORE EXCHANGE
Ms. Denia Mandt, 12616 Ibbetson Ave., Downey, CA 90242-5050, is Director. Spores
exchanged and lists of available spores sent on request. http://amerfernsoc.org/sporexy.
html

_ GIFTS peed BEQUESTS

SER AMAL

F nba 7 IL + na t

interested in ferns. Back issues of the Journal and cash or other aes are always welcomed
are tax-deductible. Inquiries should be addressed to the Membership Secretary.

VISIT THE AMERICAN FERN SOCIETY’S

WORLD WIDE WEB HOMEPAGE:
http://amerfernsoc.org/

AMERICAN Volume 102
FERN wes
JOURNAL ae

QUARTERLY JOURNAL OF THE AMERICAN FERN SOCIETY

The Anatomy and Occurrence of Foliar Nectaries in zai fap (Cyatheaceae)
hard A. White and Melvin D. Turner

An Expanded Plastid sie dry oue of Marsilea with Emphasis on North American Species
Mark Whitten, Colette C. Jacono, and Nathalie S. Nagalingum

Effect of Habitat Modification on the Distribution of the Endangered Aquatic Fern Cera-
topteris pteridoides prasad in China
an-Huo Dong, Qing-Feng Wang, and Robert Wahiti Gituru

Negative Gravitropism in Dark-Grown Gametophytes of the Fern Ceratopteris richardii
Hiroyuki Kamachi and Munenori Noguchi

Antimicrobial and Modulatory Activity of Ethanol Extract of the Leaves from Lygodium
venustum SW.
M. F. B. Morais-Braga, T. M. Souza, K. K. A. Santos, J. C. Sap ee
G. M. M. Guedes, S. R. Tintino, C. E. Sobral-Souza, J. G. M. Cos
IR. A, Mivoncs A. A. F, Saraiva, and H. D. M. Casitas

A New Species and a New Hybrid in the Grammitid Fern Genus Stenogrammitis

(Polypodiaceae)
Paulo H. Labiak
Diplazium fimbriatum (Athyri }, a New Species from

Brazil
Claudine M. Mynssen and Fernando B. Matos

Isoetes mourabaptistae, a New Species from Southern Brazil
Jovani B. Pereira, Paulo G. Windisch, Maria L. Lorscheitter, and Paulo H. Labiak

Suorter Notes

A =~ say” cs} 4h fain ag fa
oO b ei -

Sara Magrini and Anna Scoppola

Cheilanthes — r Moore Pteridacesc) and Dryspteris erythrosora (D.C. Eaton) Kunze

Coy Rothfels, E. M Sigel, and M. D. Windham

Reviews
rl oe gid A ee eo q Alan? 1 Ambor6, Bolivia, Vol. 1 Licofitas y Helechos, Gim-
nospermas ;
Michael Kessler
Erratum

114

136

147

161

167

174

181

187

The American Fern Society
Council for 2012

MICHAEL WINDHAM, Dept. of Biology, Duke University, P.O. Box 90338, Durham, NC 27708.
President
KATHLEEN PRYER, Dept. of Biology, Duke University, P.O. Box 90338, Durham, NC 27708.
President-Elect
MARY STENSVOLD, USDA Forest Service, 204 Siginaka Way, Sitka, AK 99835.
Secretary
JAMES D. CAPONETTI, Div. of Biology, University of Tennessee, Knoxville, TN 37996-0830.
Treasurer
GEORGE YATSKIEVYCH, Missouri B ical Garden, P.O. Box 299, St. Louis, MO 63166-0299.
Membership Secretary

JAMES D. MONTGOMERY, Ecology II, 804 Salem Blvd., Berwick, PA 18603-9801.
Curator of Publications
JENNIFER M. O. GEIGER, Dept. of Natural Sciences, Carroll College, Helena, MT 59625
Journal Editor
R. JAMES HICKEY, Dept. of Botany, Miami University, Oxford, OH 45056.
Memoir Editor
JOAN N. E. HUDSON, Dept. of Biological Science, Sam Houston State tree snes Huntsville, TX 77341-2116.
DAVID SCHWARTZ, 9715 Christey Way, Bakersfield, CA 93312-5617

Bulletin Editors
American Fern Journal
EDITOR

JENNIFER M. O. GEIGER Dept. of Natural Sciences, Carroll College, Helena, MT 59625,

ph 447-4461, e-mail: jgeiger@carroll.edu
MANAGING EDITOR

JILL ANNE DILL Dept. of Natural Sciences, Carroll College, Helena, MT 59625,

ph. (406) 447-5176, e-mail: jdill @carroll.edu
ASSOCIATE EDITORS
NAN CRYSTAL ARENS o2 cos Dept. of Geoscience, Hobart & William Smith Colleges, Geneva, NY 14456
JOSE MARIA GABRIEL Y GALAN ............ Dept. de Biologia Vegetal I, Universidad Sepa 5 tense de Madrid,
pain 28
GERALD J. GASTONY Dept. of Biology, Indiana University, Bloom: ee n, IN 47 genet
GARY K. GREER Biology Dept., Grand Valley State Ueiecesi, Allendale, MI 4940

CHRISTOPHER H. HAUFEER |... Dept. of Ecology and claead se Roa of = at
66045-2106
R. JAMES HICKEY Dept. of ges. jami Gaivenity. ‘Oxford, OH iar
PAULO LABIAK ... Universidade Federal do Parana se — 81531 -980, Curitiba-PR, Brasil
ROBBIN C. MORAN Bronx, NY 10458-5126
NATHALIE NAGALINGUM ese oa a Sydney, Siac NSW, Australia
CARL ROTHFELS Botany Dept., — University, ain C 27708
EMILY SESSA Botan one University 0 of Wisconsin-Madison, Madison, WI 53706

MICHAEL SUNDUE Pringle Herbarium, The University of Vermont, Burington, VT 05405
JAMES E. WATKINS, JR. mbridge, MA 02138
The “American Fern — pease 0002- seals is an illustrated es devoted to the general study of
ferns. It is owned oe the an Fern Society, and published at The A n Fern Society, % Missouri
Botanical PO. Me 299, St tous} MO 63166-0299. Periodicals aie paid at St. Louis, MO, and

additional entry.

cy

for back issues should be addressed to Dr. James D. i ay bat Il, 804 | Sale Bivd., teang: PA
18603- 9801.

o at “ re r © P
Fan t pee | ee 44. e

Back volumes are avalible for most years as rind issues or on microfiche. Please contact the Back Issues
Curator for pect and availability.
Subseri

. 4: ES 2 + 1 L ie a + AL x | mee 9]

‘Society Membership - USA, ‘Canada, Mexico (i lud Journal FEA ae $30

es A, 7 ee me re ay 5

: QUCICLY Membersh $40
Society Lif © Membership fs (add $120 Stee harge fe ide USA, Canada, Mexico)
a $15
Mente Al ie (includes Fiddlehead Forum) © $22
Membership — $40 to USA, pecrouopsanemnst $50 elsewhere $3 agency fee)

American Fern Journal 102(2):91—113 (2012)

The Anatomy and Occurrence of Foliar Nectaries
in Cyathea (Cyatheaceae)

RicHarp A. Wuire* and MELvin D. TURNER
Department of Biology, Duke University, P.O. Box 90338, Durham NC 27708

Asstract.—This study reports the widespread occurrence of foliar nectaries in most New World
species of the genus Cyathea. The anatomy of these glands and the variation in structure among the
species is described. Some Cyathea species primitively lack glands, and the presence or absence of
these glands and their structure correlate with recent molecular phylogenies.

Key Worps.—anatomy, Cyathea, glands, nectaries, phylogeny

In contrast to the widespread prominence of both floral and extrafloral
nectaries in the flowering plants, nectaries have been reported in relatively few
pteridophytes. Here we report the widespread occurrence of nectary-like foliar
glands among many New World species of the tree fern genus Cyathea, and
describe the anatomical structure of these glands for the first time.

Classifications of Cyatheaceae are still variable at the generic level. Some
researchers include all species in Cyathea, while many others recognize three
or more genera. DNA phylogenies have now greatly clarified the main
subgroups of the scaly tree ferns (e.g., Korall et al., 2007, Janssen et al.,
2008, and Bystriakova et al., 2011). The described differences in morphological
features among these major groups have chiefly involved the details of scales
and spores. Here, we report on a distinctive characteristic of a large group of
species within the genus Cyathea: the occurrence of foliar nectaries or nectary-
like glands on the fronds. These nectaries are often conspicuously present on
Cyathea pinna and pinnule bases, but previously have been little noted in the
literature.

There is a long history of studies of the structure and function of nectaries,
both floral and extrafloral (Zimmerman, 1932; Fahn, 1979). The major focus in
studies of floral nectaries in angiosperms is primarily on their role in the
pollination biology of the species; studies of extrafloral nectaries tend to
consider the nectaries in relationship to insect-plant mutualism and defense
strategies of plants (e.g., Agrawal, 2011; Bentley, 1977; Fahn, 1979; Bentley
and Elias, 1983; Elias, 1983; Elias and Sun An-ci, 1985; Freitas et al., 2001;
Koptur, 1985, 1992; Rosumek et al., 2009).

Detailed anatomical descriptions of nectar glands are available for numerous
flowering plants (e.g., Elias, 1983; Marginson et al., 1985; Durkee, 1987;
McDade and Turner, 1997; Machado et al., 2008; Thadeo et al., 2008)). In

*Corresponding author

92 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

contrast, detailed studies of nectaries in the ferns are relatively rare. Early
studies include a pioneer description of glands in Pteridium (Darwin,
1877). Another early study reported the presence of nectaries in Angiopteris
and in two species of the Cyathea group of tree ferns (Bonnier, 1879), but
provided little detail of anatomical structure. Over the many years of
subsequent research additional examples of ferns with foliar nectaries have
been added to the list: Platycerium (Diimmer, 1911); the Aglaomorpha
and Drynaria group (Liittge, 1971; Zamora and Vargas, 1974; Potes, 2010);
Polybotrya and Pleopeltis (as Polypodium) (Koptur, 1982; Koptur
et al.,1998).

As in many studies of angiosperm extrafloral nectaries, research on fern
nectaries has focused on the composition of the exudate (e.g., Koptur et al.,
1982) and the interaction between the plants and nectar-feeding ants
(Tempel, 1983; Rashbrook et al., 1992; Koptur et al., 1998). Few of these
fern nectaries have been described anatomically, with the notable
exception of those of Pteridium, which have been described in ultrastruc-
tural detail (Power and Skog, 1987; Rumpf et al., 1994). Most recently the
anatomy of nectaries of Aglaomorpha and Drynaria was described (Potes,
2010).

After the initial early report of nectaries in Cyathea species (e.g., Bonnier,
1879), more than a century elapsed before the next significant notice of their
existence. However, some careful descriptions of new Cyathea species
described recently do refer to aerophores, and to ‘dark circular or oblong
patches”’, as well as to nodules present at the bases of pinnae (Moran, 1991).
Additionally, there are examples of structures at the pinna bases that are
illustrated for the new species, but not described in the text (Moran, 1991;
1995). More recently, in the description of a new species of Cyathea, C.
planadae, the presence of distinctive pads of tissue on the fronds and an
association of these areas with feeding activity by ants was described (Arens
and Smith, 1998). The discussion here, as with Cnemidaria (Mickel and Beitel,
1988), focused on these areas as being associated with aerophores and on their
possibly being glandular.

In the recent description of a new species of Cyathea in Bolivia, Cyathea
dintelmannii, reference is made to “...a conspicuous black spot...” at the
termination of the pinna with the rachis of the leaves and to “‘... one black
(when dried) glutinous spot...’ at that location (Lehnert, 2006). This ... “black
spot can be regarded as homologue [sic] with the nectaries found in Cyathea
planadae ... where an interaction between the fern and ants has been
documented.” (Arens and Smith, 1998; Lehnert, 2006).

Our examination of numerous species of Cyathea in the field, as liquid-
preserved material and as dried herbarium specimens, confirms that these
pinna-base glands in fact characterize a large group of species within the
genus. We describe the anatomy of the glands, which differs from previously
described nectaries in other ferns. Comparisons of the anatomical results with
recent analyses of tree fern phylogeny may help elucidate the evolutionary
origin of nectaries in the tree ferns.

WHITE & TURNER: NECTARIES IN CYATHEA 93

MATERIALS AND METHODS

The anatomy of the glands was examined in the Cyathea species listed in
Table 1. In addition, the following non-Cyathea species were examined:
Sphaeropteris cooperi (W.J. Hooker ex F. von Mueller) Tryon, S. medullaris (G.
phe Bernhardi, Alsophila firma (Baker) Conant, and A. polystichoides

All aoe are deposited in the Duke University Herbarium [DUKE] unless
otherwise noted, e.g., Museo National de Costa Rica [CR], University of
California [UC] and Lyndon State College Herbarium [LSC].

In addition to the anatomical study of ooganbee materials, a survey was
made of herbarium collections (UC, DUKE and CR), based on which the
presence or absence of glands was described for 161 species of Cyathea. This
represents a large proportion of the total number of Cyathea species, which has
been estimated to be between ca. 200 (Lehnert, 2011b) and 270 species (based
on Tryon, 1970). The latter number includes Tryon’s estimated totals for

TABLE 1.

Cyathea species included in the anatomical survey.

Species

Vouchers

Cyathea acutidens (Christ) Domin

vathea alata Cope

'vathea andina (H. — ) Domin

vathea arborea [L.) S

yathea armata (Sw.) a

yathea barringtonii A.R. Sm. ex me esaiat

Pye Cy Cy OY ON Cy Cyt ts
—
me

pie
Q
= 8
g
ee
Q
&
oD
3
Q
=
ee
°
&
ale
°
5

vathea decomposita (Karsten) Domin
vathea dejecta (Baker) Christenh.

yathea horrida (L. 4 pe

yathea multiflora

yathea mutica (H. pus Domin
yathea parvula (Jenman) Domin.
vathea planadae N.C.Arens & A.R.Sm.
yathea poeppigii (Hook.) Domin

SRPRSKSRSRSRS AS)
<
a4
>
Q
g

yathea senilis (Klo‘zsc!:) Domin

vathea squamata (Kiotzsch) Domin
yathea squamulosa [I. Losch] R. C. Moran
yathea suprastrigosa (Christ) Maxon
vathea tenera (J. Sm. ex Hook.) T. Moore
vathea trichiata (Maxon)

6 OO 0.

White 200205 [DUKE]

[LSC]
Conant 4893; Conant 4894 [LSC]
Conant 4881 [LSC]

White & Lucansky 1970127 [DUKE]
Conant 4872 [

Conant 4884 [LSC

White 200201 [DUKE

Wilbur 11111 [DUKE]

McAlpin 1089 [DUKE]

White 1969238 [DUKE]

Beitel 8517 [UC]

White 199906 [DUKE]

Soeder 90-3 [DUKE

Conant 4873 [LSC]

White 199907; White 200207 [DUKE]
White 200204 [DUKE]

Conant 4885 [LSC]

Arens, s.n. [UC]

White pec [DUKE]

White & Lucansky 1969222 [DUKE]
White 1970159 pra

White 200203 [DUKE]

White & ieee 1971035 [DUKE]
Conant 4869 [LSC]

White 199904 [DUKE]

94 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

Cyathea, Trichipteris, and Cnemidaria, and those Cyathea species he had
assigned to Sphaeropteris and Alsophila. It also includes the species formerly
classified as Hymenophyllopsis. Recent phylogenetic studies indicate that
these groups are nested within Cyathea (Smith et al., 2006; Smith et al., 2008).

In order to study the anatomy of the glands, expanding crosiers and frond
axes were preserved in formalin-acetic-acid-alcohol (FAA). Samples were
processed through a tertiary butyl alcohol dehydration series, embedded and
sectioned in paraffin, and stained with safranin, fast green and iron
hematoxylin (Johansen, 1940). In addition, fragments of dried herbarium
specimens were rehydrated, embedded and sectioned.

Limited field observations were made of Cyathea mutica, C. choricarpa, C.
multiflora, C. delgadii, C. trichiata and C. poeppigii. Fronds of these species
were examined for the presence of glands, liquid drops and ants.

RESULTS

Foliar glands in Cyathea spp. occur on the abaxial surface of the frond axes
at the bases of the pinnae near their points of attachment to the rachis (Figs. 1
and 2). In most species with pinna-base glands, anatomically similar but much
smaller glands occur on the bases of the pinnule stalks (Fig. 3).

The characteristic anatomy of the pinna axis immediately distal to the gland
is histologically similar in the main stipe and rachis: there is an epidermis
which bears trichomes and small scales, a few-seriate parenchymatous outer
hypodermis and an inner hypodermis of elongate fiber-like sclerified cells.
The anatomy of the leaf glands described below is distinctly different: no
scales or hairs occur on the gland, and the cells of the gland are organized in
characteristically distinct zones, which are absent in the non glandular
regions.

No vascular bundles extend to or into the glands, and adjacent vascular
strands of the nearest parts of the rachis and pinna lack any obvious
modifications.

This review of the anatomical diversity of the glands among the tree ferns
that were studied suggests three broad categories of glands, which have been
designated the Cyathea delgadii (Type I), Cyathea multiflora (Type I) and
Cyathea trichiata (Type III) types as exemplified by these species (Table 2). In
addition, there are Cyathea species that lack glands.

Cyathea delgadii (Type I)

The most commonly occurring anatomical “‘type’’ of gland among the
species of Cyathea we studied is represented by Cyathea delgadii.

Organography.—The pinna bases in croziers and young fronds bear a
prominent rounded green waxy-appearing gland (Figs. 2 and 4). The gland in
mature leaves is less prominent (Fig. 5). An aerophore is adjacent to the gland,
is oval in shape and proximal to the gland on the pinna base.

WHITE & TURNER: NECTARIES IN CYATHEA

eH
aise
+

aN
>
oe

ASS

ute
se

s. 1-6. Type I foliar glands. 1. Cyathea choricarpa, expanding young frond showing prominent

vi gland and adjacent aerophore. 2. C. delgadii, crozier with some scales removed

expose glands. 3. C. multiflora, detail of expanding crozier with pinna-base gland adjacent to small

aerophore. Small pinnule-base glands also visible. 4. C. delgadii, young mame fragment, glands

are of the scurf covering the frond axes. 5. C. delgadii, pinna base of a mature frond with gland
d

less raised. 6. C. delgadii, section of “Type I’ gland showing 4 tissue zones. ae aerophore;
rachis cortical parenchyma; e=

p
e= epidermis; G= gland; g= ground tissue parenchyma of gland;
s= subepidermal cell zone; t= zone of tanniniferous cell: s.

onal
°

TABLE 2.

AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

Summary of anatomical observations, and distribution of gland types.

Type I. Cyathea
delgadii type

Type Il. aopien

multiflora ty

Gland bulging; secretory

s
prominent; fiber layer interrupted.

Gland bulging; one or two
layered secretory epidermis of
anticlinally elongate cells;
distinctive subepidermal layer;

us

isodiametric parenchyma cells;
fiber layer interrupte

Type III. Cyathea Gland flat (no bulge); secretory

trichiata type

Glands lacking

parenchymatous zone e ackngtber
layer not interrupte

No parenchymatous bulge;

fibrous layer not interrupted.

Cyathea barringtonii A.R. Sm. ex

Lellinger; Cyathea caracasana
(Klotzsch) Domin; Cyathea
choricarpa (Maxon) Domin; Cyathea
cocleana (Stolze) Lehnert; Cyathea
decomposita (Karsten) Domin;
Cyathea delgadii Sternb.; Cyathea

(H. Christ) Domin; Cyathea pungens
(Willd.) Domin; Cyathea schiedeana
(C. Presl) Domin; Cyathea senilis

(Klotzsch) Domin; Pie a squamata

Cyathea suprastrigosa (Christ)
Maxon; Cyathea tenera
(J. Sm. ex Hook.) T. Moore

Cyathea acutidens (Christ) Domin;

Cyathea andina (H. Karst.
Domin; Cyathea multiflora Sm.

Cyathea armata (Sw.) Domin; Cyathea
trichiata (Maxon) Domin

Cyathea alata Copel.; Cyathea arborea

_

.) Sm.; Cyathea costaricensis
Domin; Cyathea parvula (Jenman)
Domin; Cyathea poeppigii (Hook.)
Domin; Alsophila firma (Baker
D.S.Conant; Alsophila polystichoides

Sphaeropteris elaitat {G. Vomseci
Bernhardi.

An unusual feature seen only in Cyathea delgadii among the species we

surveyed is an asymmetric distribution of unusually prominent glands on the
pinnule bases along the pinnae. These are restricted to the distal region of each
pinna and occur only on the pinnules of the acroscopic side of the pinna.

WHITE & TURNER: NECTARIES IN CYATHEA 97

Anatomy.—Glands are prominently raised above the surrounding leaf
surface (Figs. 2 and 4), and histological sections reveal that four main zones
of cells compose the gland (Fig. 6). The epidermis of the gland is composed of
a single layer of densely-staining anticlinally elongate cells. A thick cuticle
covers the surface of the gland; no stomates are present, and scales and
trichomes are absent. Subjacent to this layer is a discrete subepidermal zone of
parenchyma which is 3-6 cells seriate. These cells are more or less
isodiametric in shape and highly vacuolated. They are larger than the
epidermal cells but smaller than the parenchyma cells which characterize
the parenchyma tissue of the leaf axis. Subjacent to this zone of parenchyma is
a zone of transversely- elongate cells which are usually densely stained, with
granular cytoplasm. This tanniniferous layer is laterally continuous with the
hypodermal fibrous layer of the pinna axis and rachis. Finally, subjacent to
this tanniniferous zone is a zone of ground tissue parenchyma similar to the
subjacent cortical ground tissue of the leaf axis.

Adjacent aerophores have numerous stomates and prominent intercellular
spaces.

Numerous Cyathea species, including those formerly named Cnemidaria
(see below), which were seen to have glands histologically similar to those of
Cyathea delgadii include Cyathea borinquena (Fig. 7), C.caracasana, (Fig. 8),
C. decomposita (Fig. 9), C. divergens (Fig. 10), C. furfuracea (F ig. 11), C. senilis
(Fig. 12), C. squamata (Fig. 13), C. tenera (Figs 14 and 15). Other species
included in the anatomical survey with Type I glands include C. barringtonia,
C. fulva, C. gibbosa, C. horrida, C. planadeae, C. pungens, C. schiedeana, C.
squamulosa and C. suprastrigosa.

Cyathea choricarpa (formerly Cnemidaria) (Type 1)

Material was examined originally as Cnemidaria species. These have now
been incorporated into Cyathea (Korall et al., 2007; Lehnert, 2011a). The
anatomy of the glands, which is similar to that which characterizes most
Cyathea species, is consistent with this.

Organography.—Glands in this species are recognized as bulbous waxy
regions on the abaxial side of the leaflet base (Figs. 1 and 16). A bulge is
present in young leaf material, but it is not as prominent in mature leaves. The
gland tends to be somewhat elongate along the pinna base. A small aerophore
is located immediately proximal to each gland.

Anatomy.—The epidermis of the gland is a single layer of anticlinally-
elongate cells which are slightly larger than the cells which characterize the
epidermis adjacent to the gland (Fig. 17). Subjacent to the secretory epidermis is
a zone of isodiametric parenchyma cells 6-10 cell layers deep. There is a
gradation of cell size in this zone. The cells of the 3-4 layers immediately
subjacent to the epidermis are smaller and more compact than the cells of the
more internal layers. Immediately subjacent to this subepidermal parenchyma-
tous zone is a zone composed of 10-12 layers of thick-walled cells. This zone is
laterally continuous with the fibrous hypodermal layer of the pinna and rachis.

98 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

Hive
Pa

ke =a eT ee we ¥-
ek “eo i : S75
me * ro =

*
eo
o~
~~
S

Fics. 7-12. Sections of Type I foliar glands showing tissue zonation. Figs 7-11 sections of glands
from croziers; Fig 12. from a fully mature gland. 7. Cyathea borinquena. 8. C. caracasana. 9. C.
decomposita. 10. C. divergens. 11. C. furfuracea. 12. C. senilis. c= rachis cortical parenchyma; e=
epidermis; g= ground tissue parenchyma of gland; s= subepidermal cell zone; t= zone of
tanniniferous cells.

WHITE & TURNER: NECTARIES IN CYATHEA 99

Fics. 13-18. Cyathea foliar glands. 13. Cyathea squamata, section of mature Type I gland. 14. C.

A= aerophore; e= epidermis; G= gland; g= ground tissue parenchyma of gland; s= subepidermal
cell zone; t= zone of tanniniferous cells.

100 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

The aerophore immediately adjacent to each gland (Fig. 16) has numerous
stomata and prominent airspaces.

Three other species of Cyathea (formerly Cnemidaria) with gland anatomy
similar to that of Cyathea choricarpa included in this survey are C. cocleana,
C. horrida, and C. mutica.

Cyathea multiflora (Type I)

This species is characterized by the most structurally elaborate foliar glands
seen in this stu

Organography.—A prominent bright green gland occurs on each pinna base
on fresh croziers and expanding fronds. The glands appear as rounded or
bulging, shiny, glabrous patches on the abaxial surface of the pinna base
immediately distal on the pinna to its junction with the rachis (Fig. 3). Pinnule
bases of this species have much smaller glands (Fig. 3), which have anatomy
similar to that of the larger glands on the pinna. This is also true, for example
for Cyathea tenera (Fig. 14). As in the other species of Cyathea, the glands on
more mature and expanded fronds appear less prominent (Fig. 18).

In addition to the gland, there is a distinctive aerophore which tends to be a
relatively small oval patch adjacent to the gland at its border with the rachis
(Fig. 3; Fig. 18).

Anatomy.—The epidermal layer of the gland consists of a region of narrow
anticlinally-elongate cells with densely staining cytoplasm and a thick cuticle.
These cells are characterized by having prominent large nuclei and dense granular
cytoplasm with small vacuoles (Fig. 20). Many of the cells in this epidermal layer
are subdivided by periclinal cross walls, so that the palisade-like glandular
epidermis varies locally from 1-seriate to 2-seriate. Stomata, trichomes and scales
are absent. Immediately subjacent to this characteristic epidermis, is a 1- to 2-
seriate zone of rounded isodiametric cells that are distinctly larger and lighter-
staining than cells of surrounding layers (Figs. 19 and 20). Subjacent to this
subepidermal zone, the fiber layer characteristic of the non-glandular area is
interrupted. In place of hypodermal fibers, multiple layers of parenchyma cells
afi a zone of cells waich are smaller and more densely staining than those of
t to the secretory epidermis (Fig. 19). This inner
pated haces zone forms most of the characteristic bulge of the gland. Finally
this latter zone is subtended by several layers of tanniniferous-staining cells which
are similar to, and continuous with, the ground tissue of the pinna axis (Fig. 19).

Characteristic aerophores adjacent to each gland (Figs. 3 and 18) have
numerous stomata and prominent air spaces.

Species in this survey characterized by gland anatomy similar to Cyathea
multiflora include Cyathea acutidens (Fig. 21) and Cyathea andina (F ig. 22).

Cyathea trichiata (Type IID)

Organography.—There is no prominently elevated glandular bulge in this
species, but the glandular area is recognizable as an irregularly-shaped area of

WHITE & TURNER: NECTARIES IN CYATHEA 101

section of Type III gland lacking extensive subepidermal layers. A= aerophore; e= 1-2-seriate
epidermis; G= gland; p= multiple-layered parenchymatous zone of gland; s= subepidermal cell
zone; t= zone of tanniniferous cells.

102 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

the epidermis at the pinna base which lacks trichomes and scales (Fig. 23). An
aerophore is associated with the pinna base, and is clearly separate from the
gland. Small amounts of a liquid secretion were observed on glands in field
observations of this species.

Anatomy.—The epidermis of the gland is composed of one or two rows of
cells which are anticlinally elongate and larger than the cells of the single
layered epidermis of the pinna adjacent to the gland (Figs. 24 and 25). The
secretory epidermis has a thick cuticle, and the area has no stomata, hairs or
scales. Subjacent to the epidermis is a one- to three-layered zone of
isodiametric, highly vacuolated parenchyma cells. Finally, subjacent to this
subepidermal zone is a multi-layered zone of densely-staining fiber cells.
These cells are longitudinally elongate with respect to the pinna axis and are
continuous with, though somewhat less elongate than, the fibrous layer which
is characteristic of the main axis and rachis (Fig. 25). Unlike the other gland
types, there is no interruption of the fibrous layer below the gland. Also, there
is no extensive inner parenchymatous zone and consequently the glands are
not elevated or bulging.

The characteristic aerophore has numerous stomata and prominent
airspaces.

Cyathea armata (Fig. 26) has glands similar to those of Cyathea trichiata.

Cyathea Species Lacking Glands

The anatomical survey revealed that the following Cyathea species lack
glands: Cyathea alata, C. arborea, C. costaricensis, C. parvula, and C.
poeppigii. The survey of herbarium specimens confirmed the lack of glands
in these species, and in addition noted the lack of glands in several other
species (Table 3).

No glands were observed on the species which were examined of Alsophila
(e.g., Alsophila firma and A. polystichoides) and Gymnosphaera. The species of
Sphaeropteris that were examined anatomically (Sphaeropteris cooperi, and S.
medullaris) also lacked glands. However, observations of herbarium specimens
suggest that glands similar to those of Cyathea spp. may be present in
Sphaeropteris robinsonii (Copel.) R. M. Tryon of the Philippines, and possibly
in a few other Sphaeropteris species. Except for S. robinsonii, observations of
herbarium specimens of numerous species of the other Cyatheaceous genera
indicate a general lack of glands throughout Cyatheaceae other than in Cyathea.

Field observations have so far provided few data in regard to the function of
the putative pinna-base nectaries in Cyathea species. In the Cyathea multiflora
and C. delgadii types, the glands are large and bright green in young expanding
leaves (Fig. 3; Fig. 2), but much less conspicuous in mature leaves (Fig. 18;
Fig. 5). Despite their prominence, the glands on young fronds of both these
species were never observed to be wet with secretions when closely examined
in the field. However, small droplets of liquid were observed on the pinna-base
glands of young expanded fronds of Cyathea choricarpa, and small amounts of
secreted liquid were consistently present on glands of Cyathea trichiata, both

WHITE & TURNER: NECTARIES IN CYATHEA 103

pas an ~ e 50um

er 5 speshse Je eons iy

BONS i

er Saree Ne ‘

eo tosh: ott 7 )
2 -

possible evidence of insect damage to gland (small dark lesions), Type II gland. 29. C. delgadii
[White & Lucansky 196824 (DUKE)]: Gland of dry herbarium specimen visible as dark drcatoon
area adjacent to aerophore, Type I gland. 30. C. multiflora [Wilbur & Luteyn 18252 (DUKE)]: Dark
shriveled gland (Type Il) present next to aerophore. A= aerophore; e= epidermis; G= gland;
s=subepidermal cell zone; t= zone of tanniniferous cells.

104 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

TaBLE 3. Cyathea glands presence/absence based on herbarium survey.

Old World Cyathea species
NO GLANDS:
Species
Cyathea alata Copel.
Cyathea decurrens Cop
Cyathea epaleata ae Holttum
Cyathea robertsiana (F.Muell.) Domin
New World Cyathea species
NO GLANDS:
Species
Cyathea arborea (L.) Sm
Cyathea costaricensis Domin
Cyathea myosuroides (Liebm.) Domin
Cyathea parvula (Jenman) Dom
Cyathea poeppigii wae : pea
Formerly Hymenophyllop
Cyathea asplenioides (A. Cc Sm.) Christenh.
Cyathea ctenitoides (Lellinger) Christenh.
eee dejecta (Baker) Christenh.
Cyathea hymen Sik Sips (L. D. Gémez) Christenh.
Cyathea tepuiana Chri
Cyathea puny erie ea.
GLANDS PRESENT:
Cyathea acutidens (Christ) Domin
Cyathea alatissima (Stolze) sonia
Cyathea alfonsiana L. D. Gom
Cyathea amabilis (GON. Morton Lehnert

Cyathea atahuallpa (R. M. Tryon) Lellinger
Cyathea aterrima (Hook.) Domin

Cyathea atrovirens (Langsd. & ela ) Domin
Cyathea austropallescens Lehne

Cyathea barringtonii A.R. Sm. ex ie ie
Cyathea bicrenata Liebm

Cyathea bipinnata (R.M.Tryon) R.C.Moran
Cyathea bipinnatifida (Baker) Domin
vat. i

vathea borinquena (Maxon) Domin
Cyathea bradei rWindlechd beans
Cyathea brevistipes R. C. Mor
Cyathea brunnescens doatenes R. C. Moran
Cyathea caracasana (Klotzsch) Domin
Cnemidaria chocoense Stolze
Cyathea choricarpa (Maxon) Domin

Representative Specimen
[UC]
van der Werff & Gray 17037 [UC]

Representative Specime

& Anderson (Oa [DUKE]
Hellwig & Whitaker 1437 [DUKE]
Mexia 9244 [UC]
Hespenheide 957 [DUKE
White & Lucansky 1968212 [DUKE]

Maguire & amy 27764 [UC]
i 34175 [UC]

eitel 8517 a
-qeetit 32895 [DUKE]
Liesner 25302 [UC]
Beitel 85314 [UC]

Stone 2104 [DUKE]
van der Werff et al. 19540 [UC]
Trusty 528 [DUKE
Meier & Molina 9217 [UC]
G)

White & White 197073 [DUKE]
Forero et al. 6803 [UC]
White & feces 1970150 [DUKE]
Mickel 5935 [UC]
Watt 194 [UC]
Nicolson 1934 [DUKE
Hutchinson & Wright 6922 [UC]
van der Werff et al. 16327 [UC]
Hatschbach 27670 [UC]
Smith, Le6én & Young 13134 [DUKE]
White & Lucansky 1970126 [DUKE]
Hellwig 302 [DUKE]

der Werff, Gray, & Tipas 12002 [UC]
Beitel 85102 [UC
Smith, Quintana & Garcia 13415 [DUKE]
Blomquist 11740 [
van der Werff, Vasquez & Jaramillo 10179
van der Werff & Palacios 9185 [UC]
Moran & eugene 5297
Lehnert 998 KE]
Lellinger & am % Sota 853 [CR]
Wilbur 27576 [DUKE]

WHITE & TURNER: NECTARIES IN CYATHEA

TABLE 3.

Continued.

Cyathea cnemidaria Lehnert

Cyathea decomposita (Karsten) Domin
Cyathea decorata (Maxon) R.M. Tryon
Cyathea pss ai eta Domin
Cyathea delgadii St
Cyathea Hisannellente (F6e) apa
Cyathea dintelmannii Lehne
Cyathea dissimilis {E.V; “some Stolze

Cyathea frigida (H. Karst.) Domin
Cyathea fulva hen oli & Galeotti) Fée
Cyathea furfura
Cyathea eee (Kt Domin
Cyathea gracilis Gri
Cyathea grandifolia Willd.
Cyathea grayumii A. Rojas
Cyathea guentheriana Lehnert
Cyathea hemiepiphytica R. C. Moran

hea

Cyathea iheringii (Rosenst, i Domin
Cyathea impar R. M. Try

Cyathea karsteniana (Klotesch) =
Cyathea lasiosora

Cyathea lechleri Met

Cyathea PL Hae Alston
Cyathea lindenia C. Pres

Cyathea lindigii (Baker) D:

Cyathea lockwoodiana (P. C. . Windy Lellinger
esl)

Cyathea macrocarpa on

Cyathea macrosora (Baker) uta

Cyathea marginalis (Klotzsch) Domin
t on

Cop
Cyathea ae (es: ) Domin
Cyathea moranii Lehn
Cyathea mucilagina R - Moran
Cyathea multiflora Sm
Cyathea mutica (H. Christ) Domin

Cyathea nervosa (Maxon) Lehnert

Metcalf & Cuatrecasas 30122 [UC]
Wilbur 11111 [DUKE]

Rubio, Tipaz & Taicuz 2114 [UC]
White & White 197027 [DUKE]

U
Cremers 9834 [DUKE]
White & White 1970104 [DUKE]
Croat & Watt 70293 [UC]
Hodel 1466 [UC]
Stone 2700 [DUKE]
Brade 8594 [UC]
van der Werff et al. 20269 [UC]

Palacios & van der Werff 3748 [UC]
van der Werff, et al. 15823 [UC]
Schuettpelz 208 [DUKE]
van der Werff & Palacios 9425 [UC]
White & Lucansky 1969237 [DUKE]
Hellwig & Whitaker 1472 [DUKE]
White & White 197017 [DUKE]
Crosby et al. 316 [DUKE]
Wilbur 7781 [DUKE]
Hodel 1486 [UC]
Vargas, et al. 2179 [UC]
van der Werff, Gray & Tipas 11951 [UC]
van der Werff et al. 18570 [UC]
Mexia 4956 [UC]
White & Lucansky 1970130 [DUKE]
Brade 9842 [UC]

Neves, Hammel & Herrera 8529 [UC]
Meier et al. 3962 [
van der Werff & Palacios 10320 [DUKE]
Neill et al. 15286 [DUKE]
QOlgaard 99065 [UC]
van der Werff & Rivero 8761 [UC]
van der Werff & Ortiz 5681 [UC]
Mesi & White 197047 [DUKE]

Boudrie MB-3024 [UC]

van der Werff et al. 18171 [UC]
Liesner 19544 [UC]
Wilbur & Luteyn 18370 [DUKE]

uno & Riina 1469 [UC]

g

Lehnert 1076 [UC
van . Werff et al. 13295 [UC]
r & Luteyn 18252 [DUKE]
aia 1281 [DUKE]
Stergios 11892 [UC]
van der Werff, et al. 8562 [UC]
Mexia 6291 [UC]

AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

TaBLE 3. Continued.

Cyathea nesiotica (Maxon) Domin

Cyathea parianensis (P. G. Windisch) Lellinger
Cyathea parvifolia Sodiro

Cyathea patens H. Karst.

Cyathea pauciflora (Kuhn) siren

Cyathea petiolata (Hook.) R. M. Tryon

Cyathea phalerata Mart

Cyathea pilozana Murillo & Murillo

Cyathea platylepis neg Domin
Cyathea plicata Lehne

sae pseudonanna ef D. Gémez) oa
‘vathea punctata R.C.Moran & B.Ollg

ete pungens (Willd. - oa

Cyathea purpurea C.V. Morton

Cyathea roraimensis sae

Cyathea rufa (Fée) Lellinger

Cyathea ruiziana Klotzsc

Cyathea sagittifolia (Hook.) Domin.

Cyathea sipapoensis (R.M. Tryon) Lellinger
Cyathea speciosa Willd.

Cyathea spectabilis (Kunze) Domin
Cyathea squamata ogni Domin
Cyathea squamipes H

Cyathea squamulosa (I. ae R. C. Moran
Cyathea squarrosa (Rosenst) Domin
Cyathea stipularis (H. Christ) Domin
Cyathea stolzei A.R. Sm. ex Lellinger
Cyathea straminea H. Karst.

Cyathea subincisa (Kunze) Domin.

Cyathea suprapilosa Lehnert

Cyathea suprastrigosa (Christ) Maxon

C

Cyathea thysanolepis (Barrington) A. R. Sm.
Cyathea tortuosa R. C. M

Cyathea trailii (Desv.) K. U. Kramer
Cyathea trichiata (Maxon) Domin

Trusty 527 [DUKE]

Forero & Jaramillo 5315 [DUKE]

Grayum, Herrera & Santana 7800 [CR]
DUKE

Wilson & Wilson 69-26 [UC]
Mellado & Monteagudo 0464 [UC]
Neill, et al. 14437 [UC]

Lellinger & de la Sota 374 [CR]
Meier & Elsner 6647 [UC]

van der Werff & Palacios 9185 [UC]
Lehnert 950 [DUKE

White & Lucansky 1970125 [DUKE]
Croat 4299 [DU

White & White 197046 [DUKE]
Betancur et al. 3213 [UC]

]

Palacios & Freine 4988 [UC]
Liesner, Steyermark & Holst 20873 [UC]
Lehnert 844 [UC]
Moran 4013 [UC]
Lehnert 1581 [UC]
White & Lucansky 1969224 [DUKE]
Huber 11879 [UC]
Liesner & Stannard 16919 [UC]
Rodin 8856 [UC]

der Werff et al. 21185 [UC]
Hekking 1438 [DUKE]
Morton 7588 [DUKE]
MacDougal et al. 4023 [UC]
White & Lucansky 1969222 [DUKE]
Mellado & Monteagudo 464 [UC]
Maguire & Politi 28765 [UC]
White & Lucansky 1969223 [DUKE]
Fendler 25 [UC]
White & White 197016 [DUKE]
Gentry et al. 55093 [UC]
Wilbur & Stone 8914 [DUKE]
Brade 405 [UC]
Wilbur & Luteyn 18299 [DUKE]
Kennedy 2750 [DUKE]
Palacios & Tirado 12952 [UC]
Wood 14938 [UC]

Morton 5492 [DUKE

van der Werff, et al. 16323 [UC]
Boom & Weitzman 5825 [UC]
van der Werff, et al. 16542 [UC]
van der Werff, et al. 19965 [UC]
Wilbur & Luteyn 18225 [DUKE]

WHITE & TURNER: NECTARIES IN CYATHEA 107

TasLe 3. Continued.

Cyathea tryonorum (Riba) rere i White & White 197049 [DUKE]
Cyathea tuerckheimii Maxo Hallberg 1531 [UC

Cyathea tungurahuae Sodir Wilson et al. 2770 [UC]
Cyathea uleana (A. Samp.) ne Kessler et al. 7289 [UC]
Cyathea ulei (H. Christ) Domin Anderson 13415 [DUKE]
Cyathea ursina (Maxon) Lellinger Hammel 8710 [DUKE]
Cnemidaria varians R. C. Moran Valdespino & Aranda 139 [UC]
Cyathea venezuelensis A. R. Smith Steyermark et al. 21547 [UC]
Cyathea villosa Humb.& Bonpl. ex Willd. Hatschbach 29880 [UC]
Cyathea weatherbyana (C.V. Morton) C.V. Morton Mears & Adsersen 5390 [UC]
Cyathea wendlandii ( Mett. ex. Kuhn) Domin White & Lucansky 1968185 [DUKE]
Cyathea werffii R.C. Moran van der Werff & Gudino 11386
Cyathea williamsii (Maxon) Domin Foster & Kennedy 1878 [DUKE]
Cyathea windischiana A. R. Smith van der Werff, et al. 16207
Cyathea xenoxyla Lehnert Kessler et al. 7220 [UC]

in the field and in the greenhouse. A small number of ants was observed on
fronds of some plants of Cyathea choricarpa, but ants were not observed visiting
the glands. Gland surfaces in some species (e.g. C. acutidens, Fig. 27; C
multiflora, Fig. 28) were frequently observed to be damaged and scarred,
possibly due to feeding by ants or other insects. The glands of Cyathea acutidens
were heavily damaged in this way, including the small pinnule-base glands.

The review of selected herbarium sheets indicates that indeed glands can be
identified on the dried leaves of Cyathea species. These structures appear as
dark, often shiny and shriveled spots, and are located where glands are seen to
occur in live plants (Cyathea delgadii, Fig. 29; C. multiflora, Fig. 30; Cyathea
horrida, Fig. 31). Some of these spots appear to have visible surface deposits of
dried secretion, and others appear to be sticky, with spores and sporangia
attached to the gland areas (e.g., Cyathea cocleana (Fig. 32).

Table 3 summarizes our herbarium survey of Cyathea foliar glands. For each
species cited, a single representative specimen is listed. The four species we
examined of Old World Cyatheas (the Cyathea decurrens group) lack glands.
Among the New World species surveyed, there were five species which were
observed to lack glands, in addition to six glandless species formerly members
of the genus Hymenophyllopsis. Glands were observed to be present in
specimens of the remaining 146 Cyathea species surveyed.

Where species were included in both the anatomical survey and the
herbarium survey, the observations are consistent. Of the 15 Cyathea species in
the herbarium survey that lack nectaries, the absence of glands was confirmed
anatomically for five of them. Similarly, of the 146 gland-bearing species in the
herbarium survey, the glands were studied anatomically for 25 species.

DISCUSSION

The anatomy of the foliar glands in the species of Cyathea which were
examined is distinctly different from the foliar nectaries that have been

108 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

Fics. 31-32. Foliar glands on dried herbarium specimens. 31. Cyathea horrida [White & Lucansky
1970130 (DUKE)], with large dark gland adjacent to prominent pinna-base aerophore. 32.
cocleana [Wilbur, et al. 11111 (DUKE)], showing numerous loose sporangia apparently stuck
dried secretions on gland surfaces. A= aerophore; G= gland.

previously described for a few other species of ferns (e.g., Bonnier, 1879;
Power and Skog, 1967; Potes, 2010). We have identified three distinctive
anatomical features which characterize Cyathea glands: (1) the cells of the
epidermis of the gland can be distinguished from the epidermal cells adjacent
to the glands. The secretory epidermal cells of the gland are densely staining,
anticlinally elongate, have a thick cuticle, and scales, scurf and trichomes are
absent; (2) subjacent to the epidermis there is a subepidermal zone of a few to
several layers of larger more highly vacuolated parenchyma cells; and (3)
subjacent to this latter zone is an inner zone of parenchyma and an
interruption of the fibrous hypodermal zone (except for Type III) characteristic
of adjacent areas of the pinna axis and rachis. We have observed no
modification or specialization of vascular tissue associated with nectaries in
any Cyathea species.

The glands of the Cyathea species we reviewed can be organized into three
general groups. This characterization of gland “‘types’’ is not intended to be
rigid, however. The detailed anatomical structure of the glands in Cyathea
varies from the more standard and general form which is widely distributed
among the species we examined (Type J) to a more elaborate and distinctive
type found in only a few species (Type II), to a form which is far less elaborate
in anatomy compared to the other types, with less modified epidermal cells
and fewer cells composing the subjacent parenchyma zones. These most
simple glands are not associated with an interruption of the fibrous layer, and
do not form an elevated bulge on the leaf surface (Type III).

The presence of nectaries varies among the species in Cyathea. As noted, in
addition to species with nectaries, there are Cyathea species which lack them.
The presence and absence of glands among species of a given genus has been
reported in other genera (e.g., Pleopeltis as Polypodium: P. plesiosorus Kunze
and P. furfuraceum Schltdl. & Cham. lack glands (Koptur et al., 1998). In this

WHITE & TURNER: NECTARIES IN CYATHEA 109

survey, as noted earlier, Alsophila and Gymnosphaera consistently lack
glands. Although nearly all species of Sphaeropteris we examined lacked
glands, a very few species appear to have them (e.g., S. robinsonii).

Based on these results compared with recent phylogenetic analyses, the
presence and structure of the foliar glands appear to have potential value as
markers of major clades within Cyathea. The members of the earliest diverging
branch of the genus, the Old World Cyathea decurrens group (e.g., Conant et
al., 1995, 1996; Korall et al., 2007; Janssen et al., 2008; Bystriakova et al., 2011),
lack these glands, as do the other genera of Cyatheaceae (viz. Alsophila,
Gymnosphaera and some species of Sphaeropteris). Within another early
branch of the Cyathea clade, which includes the C. armata group of Korall et
al. (2007), several species were observed to lack glands, including C. arborea,
C. parvula and C. poeppigii. However, within this group there is a distinctive
sub-group, the Trichipteris armata group of Barrington (1978) and Gastony
(1979), including C. armata, C. trichiata, C. stipularis and C. nesiotica, which
do have glands. It is noteworthy that the glands of C. armata and C. trichiata
are of the simplest anatomical type we have seen (Type III).

A large clade of New World Cyathea species comprising the Cnemidaria
group, the Cyathea gibbosa group, and the Cyathea divergens group (sensu
Conant et al., 1995, 1996; Korall et al., 2007) includes most species of this
genus. The members of this large group that we have examined all possess
well-developed foliar glands of Type I or Type II. Although we made only a
modest anatomical survey of species, the review of herbarium specimens has
identified the presence of foliar glands in numerous other species of Cyathea
throughout these groups. Thus, these more elaborate, more prominent foliar
glands appear to be a shared derived characteristic which marks the largest
clade within New World Cyathea.

The presence of the group of Cyathea species with Type III glands (e.g., C.
armata, C. trichiata, and C. stipularis) within a clade that otherwise lacks glands
(e.g., C. arborea, C. parvula and C. poeppigii) is problematic. Possible
explanations include: (1) the common ancestor of this clade with the
Cnemidaria-C. gibbosa-C. divergens group had glands, and the glandless C.
armata group members have lost glands; (2) the C. armata/ C. trichiata gland-
bearing subgroup represents an independent, parallel or convergent origin of
glands; or (3) it is possible that an ancient hybridization between an ancestor of
the C. armata/ C. trichiata species group and an early member of the gland-
bearing Cnemidaria-C. gibbosa-C. divergens group would explain the presence
of glands in this group. The glandless Cyathea arborea is known to form hybrids
with different gland-bearing Cyathea species today (Conant, 1975; Caluff, 2002).
Early members of the two groups might similarly have been able to hybridize.

The group of Cyathea species that was formerly considered the genus
Hymenophyllopsis has recently been reclassified as subgenus HymenophyI-
lopsis of Cyathea (Christenhusz, 2009). This group has been weakly supported
as the sister group to all other New World Cyathea species (Korall et al., 2007),
or sister to a large group corresponding to the Cnemidaria-C. gibbosa-C.
divergens group (Janssen et al., 2008; Bystriakova et al., 2011). The observed

110 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

lack of pinna-base glands in Cyathea (Hymenophyllopsis) dejecta may be
consistent with either position. On the other hand, the absence of glands might
be expected from its great reduction in size and complexity, even if
Hymenophyllopsis was derived from gland-bearing Cyathea ancestors.

The presence of nectaries marks a large group of Cyathea species and the
shared presence of nectaries helps unify the group which contains most New
World Cyathea species. This includes the species formerly included in the
genus Cnemidaria (Korall et al., 2007; Lehnert, 2011a), Trichipteris (Lellinger,
1987) and a group of Cyathea species formerly included in Sphaeropteris
(Tryon, 1970; Windisch, 1977, 1978).

The comparatively simple morphology and anatomy of the glands in the
C.armata/C. trichiata group may well represent the most primitive state of the
gland seen in extant gland-bearing Cyathea.

As mentioned earlier, although all the Sphaeropteris species we examined
anatomically lack glands, herbarium specimens of S. robinsonii of the
Phillipines (e.g., Ramos & Edané, Bureau of Sci. 47350 [UC]) do have dark
areas similar in appearance and position to the pinna-base glands of Cyathea
species. An anatomical examination of this and related Sphaeropteris species
is needed. If pinna-base nectaries are indeed present in this one or a few
Sphaeropteris species, most likely they will have evolved independently from
the Cyathea nectaries reported here.

In previous tree fern literature, reference is made to observations of glands and
aerophores at the base of fern pinnae. Ants have been observed on “glabrous
pads at the base of primary pinnae” (Arens and Smith, 1998), ‘swollen dark
glossy aerophores” have been described (Holttum and Edwards,1983), dark
spots have been observed on herbarium specimens (Arens and Smith, 1998) and
reference has been made to the need to clarify ‘‘the dark spots at the base of each
pinna...regarding its fundamental origin as a possible nectary or aerophore”
(Mickel and Beitel, 1988; Mickel and Smith, 2004; Lehnert, 2006).

It is clear that there has been some confusion in the literature in
distinguishing between pinna-base glands and aerophores. Our observations
confirm that these glands have a distinctive anatomy and that they exist as
structures independent of the adjacent aerophores. Functionally, they have
been shown to have exudate of interest to ants (Arens and Smith, 1998), and to
have fungi associated with them, reflecting the likely presence of sugary
exudate. The dark spots on herbarium specimens have been useful in
identifying the presence and location of nectaries. All of this is to say that
careful observations are necessary in order to describe the presence of
nectaries and to distinguish these from aerophores.

Field observations have so far provided few data in regard to the function of
the pinna-base glands in Cyathea species. In Cyathea multiflora, and C.
delgadii, the glands are large and bright green in young expanding leaves, but
much less conspicuous in mature leaves. Despite their prominence, the glands
on young fronds of both these species were never observed to be wet with
secretions when examined closely in the field. Cyathea leaf glands are not
vascularized, and this may explain the very low secretion rates that we

WHITE & TURNER: NECTARIES IN CYATHEA 111

observed. However, droplets of liquid were observed on the pinna-base glands
of young expanded fronds of Cyathea choricarpa, and small amounts of
secreted liquid were consistently present on glands of Cyathea trichiata, both
in the field and in the greenhouse. A small number of ants was observed on the
fronds of some plants of Cyathea choricarpa, but were not observed in
association with the glands. The surfaces of glands in some species, for
example in Cyathea acutidens, were frequently observed to be damaged and
scarred, possibly due to feeding by ants or other insects.

On the basis of these anatomical studies, their location on the leaves, and the
modest observations of droplets, and insect activity, we have concluded that
these glands are indeed nectaries. In support of this conclusion there is an
obvious need for more extensive field observations and greenhouse studies as
well as chemical analyses of the exudate. The presence or absence of glands
and the variation in gland anatomy may well be useful as markers in analyses
of species relationships within a genus and among fern families. A broader
survey of the presence or absence of fern glands, their distribution and their
Tesaiuical structure is fully warranted.

ACKNOWLEDGMENTS

We thank the following people for their advice, materials and technical assistance: David
Conant, Marcus Lehnert, Robin Moran, Kathleen Pryer, Amber Ratchford, and Alan Smith. We also
acknowledge the support of the herbarium curators of CR, DUKE, LSC and UC

LITERATURE CITED

AcrawaL, A. A, 2011. Current trends in evolutionary ecology of plant defences. Functional Ecology
:420—432.

Arens, N. C, and A. R. Smit. 1998. Cyathea eee a remarkable new creeping tree fern from
Colombia, South America. Amer. Fern J. 88:49-59.

BarrinctTon, D. S. 1978. A Revision of the Genus ae Contrib. Gray Herbarium. Harvard
Univ. 208:3-93.

BenTLey, B. L. 1977. Extrafloral nectaries and protection by pugnacious bodyguards. Ann. Rev. Ecol
Syst. 8:407—427.

BenTLeY, B. L. and T. Eas. (eds). 1983. The Biology of Nectaries. Columbia Univ. Press, N.Y.

Bonnier, G. 1879. Les nectaries: étude critique, anatomique et physiologique. Ann. Sci. Nat. [Ser.
VI) 8 2.

Bystriakova, N., H. ScHNeweR and D. Coomes. 2011. sssinage of the climatic niche in scaly tree
ferns pa dapcen tone Polypodopsida). Bot. J. Linn. Soc. 165:1-19.

Ca.urF, M. xCyathidaria, a new recat ep in ie Cyatheaceae (Pteridophyta).
Wilden 32: 281-283.

sige caer M. J. M. 2009. New — and an overview of Cyathea subg. Hymenophyl-
lop pi eingrecan Phytotaxa 1:37—42.

ae D. S. 1975. Hybrids in pre Cyatheaceae. — 77:441-455.

Conant, D. S., . Rauseson, D. K. Atrwoop and D. B. 1995. vee relationships of Papuasian
Cyatheaceae to New World tree ferns. Amer. Fern I : 328—

npc D. S., L. A. Raupeson, D. K. Atrwoop, S. Perera, E. A. — LA Sweere and D. B. STE.

96. Phylogenetic and evolutio pug Doi rapa of combin ed analysis of DNA and

nite ls in the Cyatheaceae. Pp. 231-248, in Pte soiled in Perspective, J. M. Camus,
M. Gibby and R. J. Johns, eds, Royal cree Gardens, Kew

112 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

Darwwy, F. 1877. On the nectar-glands of the common brakefern. J. Linn. Soc. Bot. 15:407—-409.

Dtmner, R. 1911. Grape sugar as an excretion in Platycerium. Ann. Bot. 25:1205—1206.

Durkee, L. T. 1987. apceotaaiete of extrafloral nectaries in Aphelandra spp. (Acanthaceae). Proc.
Iowa. Acad. Sci. 9

Euias, T. S. 1983. oie fiebiates their structure and distribution, Pp. 175-203, in The Biology
of Nectaries, B. L. Bentley and T. S. Elias, eds, Columbia University Press, NewYork.

Euias, T. S. and Sun An-cl. 1985. Morphology and anatomy of foliar nectaries and associated leaves
in Mallotus (Buphorbiacee). Aliso 11

Fann, A. 1979. Sec edema in Plants. Pees Press, London; New York.
FREITUS, L., G. BERN Pest L. Gatetto and A. A. . Pao. 2001. Nectaries pe reproductive biology
roton phenientite Guapbistiacess). B t. J. Linn. Soc. 136:267—27

Pouce J. 1979. Spore morphology in the a ie III. The Genus sien Amer. J. Bot.
66:1 aes

Ho.ttum, : nd P. J. Epwarps. 1983. The tree ferns of Mount Roraima and garages areas of
the Guayana Highlands with comments on the family Cyatheaceae. Kew es 38:155-18

JANSSEN, T., N. Bystriakova, F. RAKOTONDRAINIBE, D. Coomes, J. N. Lapat and H 20
Neoendemism in Madagascan scaly tree ferns results fron recent peeieae divenifcatios
bursts. ab nngs 62:1876—-1889.

JOHANSEN, D. A. 0. Plant Microtechnique. McGraw-Hill Book os New York.

PTUR, S., A. : ae and I. Baker. 1982. Nectaries in some neotropical poe - Polypodium

(P: aeoegye Preliminary observations and analyses. onopiva 14:108-11

Koptur, S. 1985 mative defenses against eens in Inga (Fabaceae, ieaes over an
dlevetional sees Ecology 66:1639-1

Koptur, S. 1992. Extrafloral nectary-mediated ‘bea isteach insects and plants. Pp. 81-129,

in Insect-Plant Interactions vol. IV, E. A. Bernays, ed, CRC Press, Boca Raton, Fl, USA
Kortur, S., V. Rico-Gray and M. Patacios- Rios. 1998. Ant protection of the nectaried fern
Polypodium plebium in central Mexico. Amer. J. Bot. 85:736—739.
Korat, P., D. S. Conant, J. S. Merzcar, H. A. ScHNEIDER and K. M. Pryer. 2007. A molecular

phylogeny of scaly tree ferns. Amer. J. Bot. 94:873-8
LEHNERT, M. 2006. The Cyatheaceae and Dicksoniaceae (Ptedidophyta} of Bolivia. Brittonia

58:229-—244.

LEHNERT, M. 2011a. The Cyatheaceae Bed BRP of Peru. Brittonia 63:11—45.

LEHNERT, M. 2011b. Species of Cyathea in America related to the western Pacific species C.
decurrens. Phytotaxa 26:39-59

Le.uinceER, D. B. 1987. The disposition of Trichopteris peepee. Amer.Fern J. 77:90—94.

Lortcg, V. 1971. Structure and function of plant glands. Ann. Rev.Pl. Physiol. 22:23-44.

Macuapo, S. R., L. P. C. Moretiato, M. G. Sajo and P. S. OLxtverra. 2008. Morphological patterns of
extrafloral nectaries in woody plant species of the Brazilian cerrado. Plant Biology
10:660—673

Marcinson, R., M. Sepc.ey and R. B. Knox. 1985. Structure and histochemistry of the extrafloral
nectary of Acacia terminalis (Salisb). McBride (Leguminosae, Mimosoideae). Protoplasma.
oes

McDape, L. A. and M. D. Turner. 1997. replied a dha hansen of bracteal nectary glands in

Aphelandra (Acanthaceae). Amer. J. Bot. 8
sian - T. and J. Berre. 1988. Pteridophyte pte of pene Mexico. New York Botanical Gardens,
w York

ay 1 a sil A. R. Smiru. 2004. The Pteridophytes of Mexico. Mem. N.Y. Bot Garden 88:216.

Moran, R. C. 1991. Eight new species of tree ferns (Cyathea, Cyatheaceae) from the American
tropics eo three new combinations. Novon 1:88—10:

Moran, R. C. 1995. Five new species and two new combinations of ferns (Polypodiopsida) from
Ecuador. cin Jour. Bot. 15:49-58.

Portes, A. 2010 rosa oni sngons by the nectaries of Agloamorpha and Drynaria (Poly-
poiiiaceae). Amer. Fern J. 100:8

Power, M. S. and J. E. ss fier Chas truct f the extrafloral nectaries of Pteridi jlinum

mer. Fern J. 77:1—15.

WHITE & TURNER: NECTARIES IN CYATHEA pis

RASHBROOK, V. K., S. G. Compton and J. H. Lawton. 1992. Ant-herbivore caine aaa reasons for the
absence of benefits to a fern with foliar nectaries. Ecology 73:216

RosumgkK, F. B., F, A. O. Siverra, F. D. Neves, N. P. D. Barsosa, L. oe ¥. Oxi, F. Pezzini, G. W.
FerNaNpEs and T. CorNELISSEN. 2009. Ants on plants: a meta-analysis of the role of ants as plant
biotic ee Oecologia 160:537-549.

Rumer, S. M., M. Cromey and C. J. Wess. 1994. Ultrastructure and function of the nectaries of New
Zenland bracken (Pteridium ppererhicai (Forst. f.) Cockayne). New Zealand J. Bot.

87
SmitH, A. R., K. M. Pryer, E. ScHuerrperz, P. Korat, H. ScHNEmER and P. G. Woxr. 2006. A
classification for ati ferns, Taxon 55:705-731
SmitH, A. R., K. M. Pryer, E. ScHuetrpetz, P. Koraut, H. ScHNEmER and P. Wo r. 2008. Fern
ecipie gti Pp. ree 7-467, in Biological Bvoluiion x Ferns and Lycophytes, T. A. Ranker
d C. H. Haufler, eds, Cambridge Univ. Press, New York.
TEMPEL, A. S. 1983. Bracken fern (Perio aquilinum) aay nectar-feeding ants: a non-mutualistic
interaction. Ecology 64:14 42
TuHapeo, M., sil sonnei aba a ee ae vEDO, J. M. Araujo, V. M. M. VaLENTE and R
8. Anatomical and histochemical characterization of extrafloral necturies “f
fakes crucis eae Amer. J. Bot. 95:1515—1522.
a R. M. 1970. classification of the pee sick Contrib. from the Gray Herb. 200:3—50.
Winoiscx, P. G. 1977. Synopsis of the genus Sphaeropteris with a revision of the neotropical
oF siate RSs Bot. Jahr. fiir Systematic Pflanzengeschicte und Pflanzengeographie
92:176—-198.

WInbIscH, a G. 1978. The systematics of the group of ecrane gah hirsuta dae onto ace In The
Botany of the oo. Highland, B. Maguire, ed. Mem. N t. Gar

Zamora, P. M. and N. S. bres 1974. Nectary-costule arts in ee ra one ferns.
The dre oe :72—-88.

ZIMMERMAN, J. 1 Uber ae extrafloralen Nektarien der Angiospermen. Beih. Bot. Zentralbl.
peat

American Fern Journal 102(2):114—135 (2012)

An Expanded Plastid Phylogeny of Marsilea with
Emphasis on North American Species

W. Mark WHITTEN
Florida Museum of Natural seuueire a Dickinson ron Gainesville, FL 32611-7800, email:
ten@flmnh.u
este C. a
Center for Aquatic son parsed Plants, University of Florida, 7922 NW 71" Street, Gainesville,
653-3701, email: Colette.C.Jacono@aphis.usda.gov
NATHALIE S. NAGALINGUM
Royal Botanic Garden Sydney, National serbia si New South Wales, Mrs Macquaries Road,
Sydney, NSW, Australia, 2000, email: nathal g 1.nsw.gov.au

AsstTract.—Ferns of the genus Marsilea (water clover) are potentially invasive aquatic and wetland
plants. They are difficult to identify to species because of subtle diagnostic characters, the sterile
condition of many specimens, and unresolved taxonomic problems. We sequenced four plastid

U.S., and 2) assess species delimitation using molecular data. Florida specimens previously
identified as M. aff. oligospora do not match true M. oligospora (native to the western USA), and
might represent an undescribed native species. The molecular data fail to resolve many species as
monophyletic within the New World Marsilea section Nodorhizae. The data reveal two strongly
supported clades within section Nodorhizae: 1) A western U.S. /Mexican clade; and 2) A U.S. Gulf
coastal plain/Florida/Caribbean clade. This DNA/morphology discordance suggests that these taxa
either may have hybridized extensively or that the number of Marsilea species within these clades
may be overestimated. Either case warrants the addition of nuclear data sets and reevaluation of the
species boundaries within the genus.

Key Worps.—Marsilea, phylogenetics, plastid, species delimitations

Marsilea L. (ca. 50 spp.) occur worldwide as two ecological types: 1) true
aquatic species with glabrous leaves and fleshy rhizomes that inhabit more
permanent water bodies, and 2) semi-aquatic species with hairy leaves and
tough, fibrous rhizomes that prefer fluctuating wetland habitats and prevail
through seasonal extremes in wet and dry periods (Jacono and Johnson, 2006).
Marsilea have few dependable morphological characters on which to base
species-level identifications. Phenotypic plasticity is widespread, and sporo-
carps, which contain many characters used for species delimitation, are
commonly absent in field populations. Because identification of Marsilea
based upon morphology is so difficult, molecular data might provide more
reliable tools for identification.

The impetus for this study was an applied resource management need to
clarify the identity of three western North American species of Marsilea in
Florida (Jacono and Johnson, 2006). Marsilea vestita Hook. & Grev. and
macropoda Engelm. ex A. Braun have been regarded as introduced to eastern

WHITTEN ET AL.: MARSILEA PHYLOGENETICS 135

North America based on their disjunct and widely scattered populations at
ruderal sites in Gulf coastal Alabama and Florida. A third species, centered on
three central Florida counties, was tentatively identified as M. aff. oligospora
Goodd. (Jacono and Johnson, 2006) based on sporocarp morphology; however,
Marsilea oligospora is a semi-aquatic North American species otherwise
endemic to the northern fringe of the Great Basin. Variation was noted between
the Florida and the Great Basin material and it was difficult for the authors to
speculate how a geographically restricted plant with no known economic
value might have become established in central Florida over 100 years ago. The
great difference in climate between northwestern U.S. and Florida added to
our suspicion that these were two different taxa. These Florida M. aff.
oligospora were first collected in the early 1890s near Eustis, Florida, and their
determination has vacillated from M. vestita, an introduction from the western
U.S. (Ward and Hall, 1976) to M. ancylopoda A.Braun, a rare and potentially
extinct native species (FNA, 1993).

Here we use DNA sequences of four plastid regions (rbcL, rps4, the rps4-trnS
spacer, and the trnL-F spacer) to expand upon the recent molecular phylogeny
of Marsilea (Nagalingum et al., 2007), using a greater sampling of North
American specimens. Our first objective was to determine the status of the
Florida plants assigned to M. aff. oligospora. We surveyed all known
populations of Marsilea within Florida and compared them to all U.S.,
Mexican, and Caribbean species, as well as Marsilea species common in the
aquatic plant trade that are established in the southeastern U.S. These data will
provide a baseline for evaluating M. aff. oligospora in Florida and for
distinguishing future introductions of Marsilea. Our second objective is to
assess species monophyly using multiple accessions of each species,
particularly for the North American specimens assigned to Marsilea sect.
Nodorhizae.

MATERIALS AND METHODS

Thirty-three samples were included from Nagalingum et al. (2007), and are
distinguished by the GenBank prefix DQ; the remainder were generated in this
study (Table 1). Because Florida collections of M. oligospora were hypothe-
sized to be introductions from the western U.S. (Jacono and Johnson, 2006), we
included as many specimens as possible from western states. Species not
present in the Nagalingum et al. (2007) study include M. coromandelina
Willd., M. costulifera D.L.Jones, M. crenulata Desv., M. deflexa A.Braun, M.
exarata A.Braun, M. fournieri C.Chr., M. hirsuta R.Br., M. mexicana A.Braun,
M. mucronata A.Braun, M. scalaripes D.M. Johnson, M. tenuifolia Engelm. ex
Kunze, and M. uncinata A.Braun.

Samples were taken from herbarium specimens. Leaf samples (ca. 25 mm?)
were ground using a tissue mill and extracted using a modified version of the
2x CTAB procedure of Doyle and Doyle (1987) with exclusion of beta-
mercaptoethanol and inclusion of 5 units of proteinase K. Primers for rbcL
were designed to allow amplification and sequencing in two overlapping

AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

116

axe] “Ta “VSN zZg ouoDeRf SVTH =: OG OFES(A SOBEES(A Ze6EEsly ‘ppooy psodsosijo ‘yye pajisiny beo
axT “Td :vVSa TZg ouoseRf SYA 680rES(4 POBEEs(a I966EES(A ‘ppooy niodsosijo *jye vajrsinp ££0
exe “Td :vsn Itg ouoseRf = SYA B8o0rEes(a soBEsEs(a se6EeEsla “‘ppoory piodsosijo ‘jye vayrsinpy zE0
exe'T “TH -Vvsn OLS OuosRf SYA Z80rES(4 ZOBEES(A PEGEEsl(a ‘ppooy piodsosijo ‘ye vayisinpy Leo
axeT “TA VSN g0g OUDDRf SYA gsores(4 Losess(a es66eesl(y ‘ppooy piodsosijo ‘jye payisinpy O£0
uoNey “TY “VSN zOg OuDDef = SVIA Z8OrEs(4 ZESEEsla seEEeEsly ‘HOW DaNUI dDalisinp| 8z0
uoneyy TY :-VSN ‘us eUdIID §=SVWIA L8ores(a 968EES( ge6eesly ‘HaW DINU dDalIsiDyy 2z0
ysnosogs| [tH Ta VSA u's siospoy SV" osores(a seEgeEes(a zeeeesl(a HWaW DIWNUI Dalis1DW 9z0
enypoe[y “Ta “Vso g0zL slaeq) §=SV'IA 6ZOPES(4 PESEEs(a g9e6EES{A ‘HAW DaNuUr vajisippy Sz0
uosIpeyy :SW “VSN ‘ws WT SVT ZZILL€90H 89ZLE9OH SZOLE9DH HEY DINU DaTISIDY $Z0
surpreds :v5 :vsn Lg¢ ouosef = SVT SZOrEes(a EsEseEes(a seeeesla Hay DayNur vayIsipp_y £20
uoyNY “VO “VSN u's adooyQ) SV" LZOvES(4 zeseEes(a Peeessla HaW vIyNUI dDa[IsiDp_ zz0
qreX°d ‘VO :vsn zge ouodRf SY TA 9ZOres(a teseEes(a se6eesla Ha dIVNUI valIsiDp_ 1zo
seysny :y¥O ‘vsn €0¢ ouoseRf SYA SZOPES(A Z9ZLEIOH FZOLE9OH He VIyNUL DayIsID[_y 0z0
aron'y 1S “TA Vso 86h OUDDRf SVT T90rES(H4 ZzZ8EES(4 B9BEEslA "] DynurUT DalIsIDpy 8Lo
erquieosy 4 “VSN POEEL JoyeyyINg §SV TA o90res{a gzeeesl4 sg96eEsla “| DjnUIUT Da/IsIDW Z10
eiquieosy :T4 ?VSN p6E OUDDe{ SYA 6SOrES(4 Szeees(a zo6eEsl(a “| DINUIUT DalIsIDAy 910
ayNqgoW -VD :vsn ‘u's uueULIa) “{ SY TY esores(4 Ppzgees(d g996EEeS{a “| Djnurur vajisinyy SLO
qqoD :VD :vsn 1008 UostTy { SVTd Zsores(a ezeees(a so9eses(a “] DJNUIUL DayIsIDy FLO
oostye[ :oorxeyy IZee HOTA SVIA IZILE90H 99ZLE9DH EZOLE9DH uneig “y ppodojAoun bayisinpy E10
BJOSPIeS ‘TA -VSN ‘u's uld;yow SVT1HA tsores(a Z98EeEes(a 6SBEES(T unebig ‘Y xe “‘WpesUy ppodosapur Da]IsIDIN ZLO
a[IqoW “TV :-vsn 229 JoyeyyIng § SVT osores(a g9geEsc(a gs6EeEes(y UNeIg “y xe ‘wesuq DpodoroDUT DajIsID ILO
s[IqoW ?TV :-VSN Orgs JayeyyINg SVT 6rOrEs(4 sogeEes(a LoeEEs(y uneIg ‘y xe ‘wyesuq DpodosspuT vajIsiDp OLo
se[jeuld : Td *VSn Sez ouosRf | SYA Leores(4 zosees(4 Pseees(a ‘Ig “Y DINsSITY DalIsIDW 600
ysnorogs| [tH “Td ‘VSO Z£Sz ouosef | SYA gProres(d L9seEsl(a eseeesla ‘Ig "UY DINsIIY DajIsinp 800
OlLneg ues XL, :VSN €Z79Z PleM SVTA eu pgosees(y gSG6EES{4 UNeIg “y xe ‘Wyesuy DpodosapuT DajIsIDjy Z00
se[[euld : Ta *VSn 619z¢ JouyI9g «= SVT Tpores(4 sseees(a sPrecesl(a ‘Ig “Y Dnsiry vayisipyy 900
oostyTe{ :OoTxXayy zee WOT A =SV1d orores(a Pssees(a zreecesla uneig “vy ppodojAoun bajisiny S00
Aytyeo0'T rayono,, uotptsodap psd 4-7 oq UOXe |, Jequinu

jo e,dures

umnyreqiaH VvNa

‘Ayunoo Aq peMmoyjoy UONRIAaIqge 9je}s BpNIUT saNITe9o] YSN
‘ApNys St} UI pe}eieues alam Japuteulal ay} ‘(Z00Z) ‘[D 72 oe Woy Pep re O8Z—9Sz SIequINU VNC “TL ‘BIy Ul seureu UOXe} SuLMOT[O} ssaquinu
}I81p-9ei4} 0} puodsazioo ({ UUIN]O) s1equINU YN | jueg Apnjs sty} ut stsAjeue YN 10 poydures suourtsedg = “| w1avy,

117

WHITTEN ET AL.: MARSILEA PHYLOGENETICS

BIOUOG ‘:OdTxayy P8h-S8 es}a4 “Yo ASV OLLbEs(d Pz6ees(a ZLorEes(a “ABI BY “YOOH VJYSAA vayIsuvpy 990
edoouey :ZV :VSN 0602 ssuTyeW eT ~=ASV Ppeores(y 6EseEs{a Le66EEeslA ‘Ig “Y DyNsury DajisuDpy £90
edooueyy :ZV :VSN 6zrz jammed ‘qd NSVv esores(d sé6gees(d o66EeEsla “WaW DINU DaIsIDW £90

seT[euld “Tq *VSn S9EOL Te 19 UTJepunM “Y ASM YZILEYOH segsEeEs{a sseEEsla ‘Ig "YM Dynsary vayisiny 090
seT[euld “Ty *VSn 619z Jeuyseg ‘{ ASN sPorEes(a ZZZLE9OH OSOLE9OH ‘Ig “Y DINsAry vayIsIDW 6S0
pieaalg T4 -VSn Z99 ouoDef = S/N. e90res(a4 osseesld zZeees(4 "| DNUIUT DaTIsIDW gs0
erquieosy Td -VSn POEL Joyeyying { ASM SZILE9OH 6ZeEEs{4 TLZ6EEsl4 “| DyNUIUT DalIsuDyy ZS0
uIpuely “Ta “VSn ESZLL [ea uosjoyH "yY ASN *PLILEVOH LZZ1E9DOH 9LOFESl[4 “ABI Y “YOOH DJSea DayrsiDpy 9S0
Ja[9D “14 *VSN us uld[yoN “@ 4Ssn psores(d Lzeeesfd e96ees{y Unig “y xe ‘Wesuq Dpodo9DUI DarIsIDy sso
eyoseres 4 -vVSn us urd, yoWw el asa esores(y ozeees(4 zoeeesla uneig ‘'y x9 ‘upasuy ppodolopur DalIsIDIN eso
Jat]9D “Ta -VSN gcel Aefpeig NY = =ASN zsores(d e9sees(a L96ees(y UNeIg “y xe ‘Wyesuq DpodosoDUI DazIsIDy eso
uoyrmeH ¢NL vsn Z9g€ eq ‘L'{ NNAL EeZIle€9OH szeees(a oOzeeesla “] DjNUIU DalIsIDy zso
sueatiQ VI VSN zesZ JepjoH ‘§ 8 AlpueyT "5 =NNAL eu gosees(d oO96eesl{y UNeIg “y xe ‘W[asuq Dpodor9DUT DaTIs.IDy Iso
uoysuyof{ “YO :vsn 66262 JojAeL ‘{ NNAL G6OlPEs{d ezeees(a storesla "A@ID) YB “YOOH DJYSAA vDajIsiDpy oso
seue{ IS :VT?VSn usTV WO 8 semoy, ‘ad NNAL solres(d zz6ees(a PLlores(a A@IF) 2B “YOOH DINSAA DalISIOPy 6b0
Tl24PlePD -VT FVSn ZLLPLL semoyy, ‘Gd NNAL ZOLPES(a Lz6eEesla eloresl{a AID) BY “YOOH DJNSAA vajIsiDpy 8b0
UjOIUTT “AV ‘VSN FZPZ9T [epuNg ‘qexseMoyL’d NNAL g0lPEesld oOz6EeEsla 6ZOLE9OH ‘ABIF) BY “YOOH VINSAA Dajrsuopy aa)
ysnosoqs| [IH “Ta VSN PLP IPH SV GOLPES{A OZZLE9OH 8ZOLEIOH ‘A@IS) 2B “YOOH VINSAA DajTSID[y 90
urpyuely ¢ Ta ¢VSn POS OUDDR{ SYA POLPEs(a 6L6EESlA LLor|esfa ‘AOID) BY “YOOH DINSaA vajisivpy cto
urpyued : Ta VSn €8l ouooRf SYTA COLPES(d Sleees(a oLlores(a A@IF) Y “YOOH VJIPSAA DajIsIDW PPO
urpyuely “Ta “Vso 9geZ uosIapuy = SVTA zOLPEs(4 ZL6EES{4 GOOrESA A@IE) Y “YOOH DjISaa vapIsiD zbo
Jet[OD *T4d *VSn 619 OUDDef SVT LoltPes(a 9L6EEs(4 so00rEes(a AGI) Y "YOOH YINSaA vajisivpy Lbo
Jato) “Ta -vsn ‘u's aIpolg = SVTH OOTPES[H STeEeEs(t Zoores(a AGI) Y “YOOH DJIsaa vajisivpy at)
Tl2“pled ‘VT -vsn PSLZ'PLL sewoyy, SVTA 7ZLPES(A =SEEeEs(a BzorEesla “A@IE) Y “YOOH DJYSIA vais 6£0
Tl®™PlPD :V'T -vsn 1g Jayureg Y puowAseYy Syd s60rES(4 El6eesld soores(a ‘A@I‘) 2B “YOOH VINSAA Daytsivy geo
BISN[OA Ta “VSN ‘u's Sinquesia—] = SV" e60rEs(y Lo6EEs{a ZZOLE9DOH ppooy piodsosijo ‘jye vayisiD Z£0
apourwmas “Ty “VSN Z£t ouosef SV Z60PES(4 69ZLEYOH 9ZOLE9OH ppooy piodsosrjo ‘jye vayisavpy 9£0
ejoulWles * Tq ?VSN ‘u's UOsSuUNg §=SVTd leores{a g06eesld g66eEsla ‘ppoory piodsosrjo ‘jye vapisippy seo

Ayyeoo'y Jayono,, uottsodep psd q-Tuy oqi UOXR |, Jequinu

a ajdures
ummieqiapH VNC

‘panuyuory * aaVy,

AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

118

a0yseM ?AN ‘VSN Z9zst WYyaIL VI Gzlres(a geeees(d Leores(a ‘AOID) BY YOOH VINSAA vayisiopy 160
9018q ZEN :CI ‘VSN ws wolg ‘WO I pelres(a Zeeees(d oeoresla ‘ABID 8 "YOOH DISAA vajisivy 060
a018q ZON ‘CI ?VSO 8989 Wolg WO =I ezlpes(a ge6eesld 6zOrESlA ‘ABID) BY “YOOH VINSAA vayIsiDp 680

yuyed ‘VA ‘VSN Us a}euIgoYy We IdA SgOres(a OO6EESld ze6EEsly “HOW DITNUT DajIsIDy 880
T“PTeD ‘VT “VSN PSZPLL seuloyy, ‘du IdA 660rES(A PFL6EEs(4 g900FES{A ‘ABID) B ‘YOOH DINSAA dajisipp 280
ouruoon0):7V :-VSN u's ‘[e je BARYUTYG ‘(GC NSV €ZOrEs(4 G6SBEES(4 Te6BEEesl(a pleusey 8% ‘qoy “Tg sijjour pajisuppw 980
ourtuos0;5 ‘ZV ‘VSN CP’lLO wWeypulm ‘WW ASV zZOves(y gegees(d og6eesly pleusey 8 “qoy “Td Sijjour vajisinp S80

estyooy'ZV *VSN 0989 [[ID9N “I ASV tZores(a zesees(a 6z26eesla pleusey 8 “qoy “Tg sijjour vayisiDpy >80
ouluos0D ‘ZV ‘VSN S6S8 Jeyeg IW ASV OZOrES(A 98BEEsly sZeEEslA pleusey 8 “qoy “T'g sijjour vais. £80
oulu090D ‘ZV ?VSN Lesbz OPT “A =OSV 690rES( sesees(a ZZ6EEslA pleusey 8 “Goy "Tg Sijour vayrs.inpw z80

astq90D ¢ZV :VSN ‘u's sulqjoD “{ ASV 890PES(4 SLZZLEQOH E80LE9OH Pleura, ¥ Goy “Tq s1jjour payrsuppyy 180

redneA :ZV °VSN ZOT-£6 Jeyxeg ‘WW BIWSUM'L ASV tztpes(a pesees(a Zzoresl(a pleusey 8 “qoy “Tg syjour payisinpy 080

BTID ‘ZV ‘vsn V-2z9 Jormeq ‘q@ Sv Oztres(4 eeseesl(a gz0rEsla Pleusay 8 ‘Goy "T_ sijjou va/isinpyy 620

astyoo; :Z7V :vSN ILZL Wluig-sueyl “ASV 6ITrEs(d zeeees(a szoresla “AOID) BY “YOOH DJNSaa dayis.ippy 820
ouruos0D :ZV VSN ‘u's uosuyof LM SV SLLPES(d PZZLE9OH Z80LE9DH PlPUley 8 “GOY “Tg syjour vaprsippyy £20

esty90 *ZV ?VSN £022 [IIDIN “I ASV ZULbes(a Leeees(d Pzoresla “ABIE) B “YOOH D}NSAA DapIsiDW 920

oqstqg stn]
ues ‘VO ‘vsn pc0sl [9X Ad NSV Qltpes(d oe6ees(a ezoresla ‘ABID 8 YOOH DINSaA vayisivypy S20
eun’y ‘IN ‘VSO P68LZ UOWUIYWOM Y ASV GLIPES(A 6z6eEs(a zzoresla “AGIL) BY “YOOH DIJISAA DayISIDA, p20

ogstqO sin]
ues ‘VO ‘vsn 9IZT OSIM ‘A = NSV PLIPes(a ezeees(d Lzoresla ‘ABI B "YOOH DJNSaa dayis.ivp £20

Ing PBIUIOfITeED
eleg :ooIxeW] = PROT STAR “DB URUIGey ‘[ MSV srores(4y oggees(a zseeesla ‘IYO ‘DO Maruinof pajisipjy zZ0

SBO9}BIRZ :OOIXa/, ‘U's ZOPUPUIOLL *f AsV 9SOrEes(a EZZLE9OH L80LE9OH uneIg ‘Y DUDIIXaUT Da[IsIDA tZO

PBNYPNYIY!) :Oorxajy SLL uosnsi9,J =) OnsvVv LOOFES(AT PEBEEes(y 9Z6EES(A pl[eusey 8 'goy "TE syjyjour DaISIDIN 0Z0

BIOUOS :OOIxaW $6-9SPUOSUYO{“y-YUeLIPEL'S MSV Eltres(d Lz6eEesla4 Ozores(a ‘AID B “YOOH DINSAA vajisiDW 690
prusoyTyeD eleg :oorxeyy = 8097 Zedo] ‘HB URWIGey ‘{ ASV ZILPEesla 9z6eEesld 6LOPES(A “ABI B "YOOH DIISAA vayis.iDW 890
BIOUNG :OOIxe €ZE-€6 ‘eR Jo URUIUTa}g §=SV Litpes(a Szeees(4 esloresla uneig “y Dxejfap vayisinyy 290
Ayr[eo0'[T JayonNoA uoytsodap = ¢sda q-qun oqa uOXP J, Jaquinu
jo a,dures
umnyreqiaH VNd

‘penuyuory ‘LT aiaVvy

119

WHITTEN ET AL.: MARSILEA PHYLOGENETICS

eueueg :eureueg £009 J9e[ssaIq "Ys SVT T8LLE9OH BZZLE9OH S80LE90H “AOI Y ‘"YOOH pd.1p2Ajod Da[IsID]N Zell
plojypeig -Vd ‘VSN 2g ouode{") SVIA O8LLE9OH ZZZLE9DH Z80LE90H ‘T pypofiaponb papisinyy LZ
aped ‘Td ‘Vso 8Z98 HOqqV [M SVT G6ZLLLE9OH 9ZZLE9DH 98OLE9DH ‘MiapUy) [YysDU DajIsIDy BLL
TeaoueH ?VA ‘VSN ‘us a8eq MIdA celres(d g9b6EES(H S8OLE9OH ‘HOW DINU DaLISIDY OLL
eyey eyoy
oury :eLasIN zZt waAq ‘We HOIN erores(d gseees(y oseses(a ‘PILLM DuljapubUtoL09 DaTIsID ZUL
sesuely ‘XL ‘VSN 1zZ uosuyo[ ‘wd =HDIW SSOPES( zzeees(a PoBeEs(a unelg 'y xo ‘upasUy ppodo.opur DaTISIDIN, LIL
RJsOD BNUOD ?VD ‘VSN LELs ‘[e 19 Jog “Gg = HOIN ZeLPes(a sPeees(a seores(a ‘ABI Y ‘YOOH VjIsaA vaprsivpy OLL
sedery) :oorxe, POPL UosuYyo{ ‘wg AeLMy'N HOI pLZOrEes(a o6gEEs(a zeeeesla pleusay ¥ “qoy “Tq sijour pajisinpy 601
aindy :ejanzeue,, £6Z UOsUYyOo( ‘WG HON Z60rES(4 ZL6EES(a POOrES[A ‘A@IN 2B ‘YOOH DdsvoAjod vaytsnpy g0L
BZ[0] OOTY OWeNng TauseM "M HOIN 8ZILE9OH Lleees{d eooresly ‘ABID B ‘YOOH Vdupodjod vayisivpy LOL
eyey eyoy
‘ouRy :BL0SIN eZLiokq ‘We HOIN 990r8S{4 eggees(a szeeesla “"] DynuUrUT dDa[IsIDA 901
oreuant)
‘Oost[e{ :OIXeW = Z8GE SIapURG “VY RHOT'Y HOIN LLILEIOH ZseEes(a PROLEIOH uneig “y vpodojAoun balisinjy SOL
so]Udlor) :euTUesIYy €ZZ uosuyo( wed HOIW crorEes(y 9Seees(y ePrerEs[4a uneig “y ppodoyAoup vais FOL
oolsens) :epenzeue,, P6Z UOsUYO{ Wd HOIN brores(a 6ESsEEs(d Lsesesl(a uneig ‘y Dxajfap vajisinjy £0L
[e00D PAWeN :pepruLny, 008 UosuYyo{ "Wd =HOIW sgores(a zesees(d pzegesly "| DNUIUT DaIsIDW zOL
Ald “TV ‘vsn 69ZbL puowleIq ‘y'V SSIN poores(a Tesees{a ezeees(a T DyNUIU DETISIDA’ LoL
aXe] -LW VSN g86r MeEYS WE TM OLN Lelbes(a Preces(a Leores(a ‘ABIE) 8 “YOOH DjI}SAA DalTsio Oot
korg :OD :vsn BSSBl UURUIM B tegen OLN Oflres(a ereges(a gE0resla ‘ABI BY “YOOH DjI}SAA DajIsivw 660
PIETTN 3.LN VSN goze MeyS [HY OLN 6zLresld zPreeEes(a4 sEeoresla ‘ABIE) BY “YOOH DjYSIA vajisivpy 860
OFA ‘AN ‘VSN 69Sbl UYPIL VY OLN BZLresld LpEeEs(a Peoresla ‘ABI) BY “YOOH VJISaa vapis.iv 260
OFA ‘AN ‘VSN uaIsWOH ‘dq 8'N OLA Z7lves(d Oreees(a eeor|es(a AGI BY “YOOH DjYSaa dayis.ivp 960
SMAaIPUY ‘1G ‘ROIUTWIOG] ggRgRgz adyytyd "T 8 [PH ‘WS OW 960PES(4 OL6EES(4 zoorEesla ‘ABIE) Y ‘YOOH pd.paAjod DajIsIDy S60
oyepl ‘dl ‘vsn us wosuyof ‘q’4 dl S60resia B6O6EEs(4 LoOPEsla ‘ppoos niodsosijo pajisinp 60
sayAMO :CI ?VSN 9166 Wolg wD re0rEes(4 so6eEs{d oOOOFES[A ppooy viodsosijo veisinpy £60
meyeW xO :vsn pore Wolg ‘wD sd QzLrEesla 6Ee6EEs(a zEorEeslA ‘ABI) BY “YOOH DJYSaA vais 260
Aqtyeoo'T rayono A uoytsodep psdi Ayu oq uOXR J, Jequinu
jo a,dures
unweqiey] VNC
‘penuyuory ‘TL rave

AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

120

yerjooyag “5D YIM

aoyseM :AN ‘VSN 66LEL WYPIL “VY SVD 90ZLE9DH SOSTE9DH LITLE90H ‘ppoor piodsosrjo vayisinpy ZSL

seunid ‘VO VSN 6P69E []9MOH L'[ SVO SOZLE9IOH ZOETEIOH ae ‘ppoor) piodsostjo vajisinjy IST

BZIO'T ‘OOTY OVLONG 8LOzs JouseM HM SVD FOZLEIOH LO€LE9DH ‘AOIL) BY “YOOH pd.ipaAjod DaIsIDN OSL
ogsez ‘podxy og noyzinsg

noyzins) :euryy Te 39 Mowofoyyeg ‘g SVD F0ZLEIOH OOSLE9OH eu mai profizponb Da[IsIDIN 6PL

OFA ‘AN ‘VSN BEBLL WYP, VY SVD ZOZLE9DH 66ZLE9DH GOLTE9DH A@ID BY ‘YOOH DINSAA valIsivy 8bL

Jeyng ‘vo :vsn bOrh WeYY "IT SVD LOZLE9OH 86ZLE9DOH BOLTE9OH “AOID) 2B “YOOH DIYSAA Da/ISIDy Zbl

pede VO -vsn 6s-e8 Aeq"y SVD O0ZLE9DH Z6Z1E9DH ZOLLE9OH ‘A@IE) Y “YOOH VJNSAA DapIsIDy 9FL

sueUIn[d ‘VONVSN UeYoRys ‘[ TM F68E JONI" G@ = SVD 66LLTE9OH 96ZTE9OH YOLLE9DOH uneig “y DjpuOLONUI DayIsIDy StL
eon] eT S1apUursg ")'V

odjy :OOsTTe[ :OOTXeyy YM Z86E HOT [| 3 Svo 86LLE9OH S6ZLE9OH SOLLE9OH uneig "VY ppodoyAoup Da]ISIDI PPL

[R002 PAWN :peprulty, 008 Uosuyo( "Wd =SVD = Z6LLE9OH F6ZLE9OH FOLLEVOH “"y] DINUIUT DA[IsSIDY LPL

OoTxey 68S UINSeLIY "TW SVD 961 LE9DH €6ZLE9DH SOLLE9OH pleusay % qoy “T sijjour vaprsappy 6EL

LN ‘etyeqsny 0666 9IM0D ‘T'] TWA S6LLE9OH Z6ZLE9DH ZOLLE9OH ‘Ig “Y Dinsary DayisiDpy BEL

ATO ‘eyeusny 18902 J9}Ss10f ‘['q THAN P6LLE9OH 1T6ZLE9OH LOLLE9OH Ig ‘Y Dynsary DaTIsID LEL

VS ‘eI[Rysny ‘Ws YOY NM THN &6LLE9OH 06ZLE9DH OOLLE9OH Ig “Y Dynsary dayisiD 9EL

10 ‘eryeysny LZpoz 19)s104 ‘['d THN Z6LLE9OH 68ZLE9OH 660LE9DH uneIg ‘VY DJDIDXA Da[IsIDW GEL

VM ‘eTyesny Q9ZSST uespray, “TW 'TAW —OLGLLE9OH 88ZLE9OH B601E9DH uneIg “VY DjJDIDXa Da/ISID PEL

LN :etyeysny EZ8LL ZIT Md ‘THIN = OB LLEYOH -Z8ZLE9OH Z60LE9DH uneIg “VY DJDIDXA Da[IsIDW €€L

On seyeysny ‘u's preyuey ‘| THIN 68LLE9OH 98ZLE9DOH 960LE9DH sauof “Tq Diafijnjsoo vajIsiDy ZEL

LN :etyeysny SPL UPUYSIM ' IAW 88LLE90H S8ZLE9DH S60LE9D0H [Sed °D DjDUAII Da[IsID TEL

LN ‘e1yeQsny SPE6 AIMOD ‘C'T THN Z8LLE9OH P8ZLE9OH FEOLE9DH Ig “Yy Dyofysnsup vajrsiny O&€L

LBXO[OW ‘TH ‘VSN STO neyD ueweyY = HSIA Y98LLTE9OH E8ZLE9OH E601LE9DH ‘J[NBY DsO]IA DayIsipy 6ZL

LPBXO[OWM ‘TH ‘VSN Zz0 ney uewey, HSIG S8LLE9OH Z8zZLE9OH Z60LE90H J[NeY DSO]IA dalIsiD 8Z1

nyeo ‘IH ‘vsn 6z0 neyD uewe~ =HSIA F8LLE9OH L8ZLE9OH L60LE9DH J[NBY DSO]IA DayIsiDW IAA

nyeoO ‘IH ‘vsn z00 neyD ueWeyWY =HSIA e8LIE9OH O8ZLE9DH O6OTE9DH J[MeY DSOLIA Da[IsIDy GZL

MSN :elyeqsny 9SZe UNIYM ‘W SV'ld =Z8LL€9DH 6ZZLE9DH 680LE9DH sauof “T'( DiafijN}s09 Da[IsID PZ

Ayryeoo0'y ayono, uontsodep —_ psda Ayu ror uOXxe J, Jequinu

jo ajdures

umnyreqioy] VNd

‘panunuoy “LT aTaVvy,

121

WHITTEN ET AL.: MARSILEA PHYLOGENETICS

uB}eONA :OOrxXepy OPZ9 ‘[e }8 TTPAOUIeD “5 H FEZLEIOH O€ELEQOH BEL LE9OH “AOIZ) 2B “YOOH DIYSAIA vayisivw O6L
SNe[STUR]S ?VD :VSN LO99T UeARY ‘H'd HD ZEZLEIOH BZELEYOH ZELLEVOH “AOIF) BY “YOOH DIYSAA valIsiDW 68L
BIUIOFT TED eleg :oorxXey] 62r87 URIOW Y HD LEZLEQOH BZELEVOH YELLEMOH pleustey 8 “qoy “Tg sijjour vayrsinp g8L
o[qed ues ose]
‘Bingequy :1openoy ZUE Zo[ezZUuOy FY snoeulay, YOO OfSZLEIOH ZZELEIOH SELLE9OH P[PUsay 8 “GOY “T'g sijjour payisinpw Z8L
TO :elyeysny 16/L uepey"y sn 6ZZLEIOH YZELEIOH FELLEIOH UNRIg “Y DJDIDXa DaTISIDW 981
osaIq ues :v9:vsn 8028 JJ19M JOp UPA “TY sn 8ZZLE9OH SZELEIOH EELLEIOH ABI) Y ‘YOOH DjYSaA vajis1ppy ZBL
suRa_IO : Vl? VSN €pZe Fismig ‘{ Sn LZ2ZLEIOH PZELEIOH ZELLEVOH ‘AOIE) BY “YOOH VjSea valisunp BLL
SB[OSIN UeBg nod LObZ ZOIING) ¥ seye[T"S (SN) A Y9ZZLE9DH EZELEIDOH LELLEVOH uneig ‘y ppodoyAoun vayisiny LLU
UBJBON, :OOTXa| Z6St ‘Je yoetdey T{ AIO SZZLE9DOH ZZELE9OH OLLLE9OH ‘ABID) BY “YOOH VINSaA valIsipy QL
enseIeIN LZZl snujog ‘ys epeny wy =O bZZLEQOH LZELE9OH 6ZLLE9OH uneig "y Dxajfap DajIsiny GLI
elle, :eLATjog cbZ WouyaT ‘WOON EZZLEIOH OZELEVOH BZLLEYOH uneig “y ppodo/Aoup verisippy PLL
soyseM ‘AN ‘VSN logzt wYysIL "vy On ZZZLEIOH BLELEVOH ZZLLE9OH AID) B “YOO DINJsaA vapisipjy ELL
ueysTyed pZeel HOYIG'g€@ ON LZZLE9OH BLELEGVOH 9ZLLE9OH “"T pyoftaponb vayrsanyy ZZ1
BIOUOG :OOIxe|/y LZGEL ‘[B }9 SdapuRS “"D'V 9n OZZLEIOH ZLELE9OH SZL LE90H “AOIF) YB “YOOH VJISAA DalIsIDA iZt
S1apuRs ‘D'V
oastye{ :oorxeyy TMM 2866 HOT (A ON 6LZLE9OH YLELEIOH FZLLEVOH uneig ‘y ppodojAoun veyrsinpy OZT
so}UaLior) :euuesIy 69Z UosuyOo( Wwq on 8LZLE9OH SLELEVOH EZLLEIOH uneig “y ppodoyAoupn pajisinyy 69L
MSN ‘e1yeqsny ES9ZL ‘Tela AueAoD ‘Ny ON ZLZLEVOH FLELE9YOH ZZELE9OH sauol “Tq Diafijnjsoo vaisin 291
eI[NZ :ejenzoue, gg ‘[R }9 premAeyy ‘au 9n 9LZLE9OH ELELEIOH LZLLE90H unelg ‘vy ppodojAaup DaIsIDA SOL
UasseyT ‘VO ‘VSN 9ZTS WeYY "TS PleMSO ‘HA 9 SLZLE9OH ZLELE9OH OZLLEIOH ‘ppooy viodsosijo pajisinpy Z9L
sung :VO'VSN ZEsh WeYY "TS PleMSO "HA ON PLZLE9OH LLELE9VOH BILLE9OH ‘ppooy piodsosijo vajis.inpy LOL
Jopeuty :vO ‘vsn 9696 IA ‘gq On ELZLE9OH OLELE9OH BILLE9OH ‘ABI BY “YOOH DISAA valIsiv O9L
sewnid ‘VO ‘vsn Oze6 WeYV "IT Sda{ ZLZLE9OH BOELE9DH ZILLE9OH ‘ABID) BY “YOOH VJIJSaA DayIsiDW 6SL
eqny ‘VO ‘VSN 6Z4Shl MeyyY "IT Sda{ LIZLE9D0H 80€1S9OH YILLE9OH ABID) BF ‘YOOH VINjSaA valIsipy gS
anng -vO ‘vsn €8hrl WeyV "] Sdaf OLZLE9OH ZOELE9DH STL TE9OH A@IE) BY “YOOH VjIJSaA vapIsiny ZS
eyng :vo :vsn s80el Weyy "l Sda{f 60ZLE9DH 9OETE9OH FLILLEIOH A@IE) B “YOOH VjIjSaA DapIsivpy 9ST
S0PEW VO -VSN 2656 Heyy "T 8 PIPMSO 'H'A SdH{ 80ZLE9DH SOELTE9DH ELLLE9OH ‘ppoor piodsosijo vajisinyy SSL
POW :VO-VSN 1696 Heyy "T 8 PlPMSO "HA SdH{ LOZLE9DOH POETE9DOH ZILLE9OH ‘ppoory piodsosyjo vajisinjy PSL
Aytpeo0'T Iayono, uoytsodap psdi A-TuQ oq UOXP Jequinu
jo ajdures
urnteqiaH VNd
‘ponuyuoy ‘fT a1aVvy,

AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

122

eIqrueN 6SS66 Wd VV O9ZLEVOH ZSELE9DOH S9YLLE9OH uoysy Ddapvorddiyda vayisappy 6EZ
PRITOD °XL ‘VSN 9bSt7 UEDA M XL 6SZLE9OH 9SELE9OH P9LLEVOH UNeIg “y xe “wjesuq DpodoovUT vaTIs1OW Sez
1194105 “XL :vsn €91¢ UesueH] “T"] XL 8SZLE9DOH SSELE9DH E9TTE9OH "AGID) B “YOOH YINSAA va/Ts1D bez
UaTTNWDW *X.L ?VSn elesz URED UM XL LSZLE9OH PSELE9DH Z9LLEYOH ABIE) BY “YOOH 0INSAA DajIsIOW ££2
yueAeN :091xa Z8Z6L YBNEAIW YA AN Y9SZLEYOH ESELEYOH LYLLEYOH unelg "y Dxajfap DalIsiny lez
9]SBIBUENS) BONY BySOF) 9687 [OPIN Lf AN SSZLE9OH ZSELE9OH O9LLE9DH uneig "y pxajfap va/rsinpy O£Z
oostye{ :0o1xey ZIG9L YBNEAIW A =AN _ FSZLEYOH LSELEYOH BSLLEIOH pleusey ¥ ‘qoy “Td sijjour vayisinpy Ltz
anid -LA ‘VSN £66p OAR] "VY AN = ESZLEVOH OSETE9DOH BSTLE9OH “ABID) B “YOOH DINSAA dDajIssD Szz
urpyuely : 74 ?vsn S68 [eB 9 pleuoaT "M'S AN ZSZLEVOH GPELEYDH ZSTLE9IOH uneig "y DjDUIIUN DaIsIDW $2Z
eqn) 9geze [P19 assIg = AN ISZLE9VOH BFELEIOH YSLLE9OH A@IE) BY “YOOH DINSAA DalIsIDW Z2z
OF ‘Oo1xapyy 67P8zZ URIOW YAN OSZLE9OH ZPELEYDOH SSTLE9OH ABIE) B “YOOH DINSAA valisiop 02Z
OWA AN ‘VSN SPZFl UeIsUTIOH “Yd B"H'N AN _ 6hZLE9OH YFELEYOH PSTLEIOH A@IE) B “YOOH VjNsaA vapisivpy £12
enng ‘vO ‘vsn 92€z WeYVY “I AN 8FZLE9OH SPELEQOH ESTLE9OH AGID) >B “YOOH 0IN}SaA valisinpy g1z
ue[epng ‘osey euppINng €lo9 uespe= “Af AN LbZLE9OH PRELTEVDH ZS1TE9DH AS@(] DID[NUAID DAa]ISID- 11z
LN ‘PYPRStY 66 SSI[2D ‘SA 8 TPIN WO AN 9PbZLEIOH EFELEYDH ISLLE9OH Ig "Y DINsaTY Da/IsIDW 802
VS ‘eleqsny 6P69 UeUIpeg [4 AN SbZLE9OH ZPELEIOH OSLLE9OH uneig “Y DjDIDXa DalIsiDy £02
pepruly 862 Uosuyo[ ‘Wd =AN $bZLE9DH TPELE9DH GFLIE9OH “| Dynurur DaytsIDy soz
pueAnyy yoUual, L61lpzZayezuoy’sg Youpnog' We AN EPZLEIOH OFPELEIOH BPELLE9OH ‘AOI‘) BY “YOOH] DdsvoAjod vayisivpy $0Z
OT YO VSN s$es6 ueisW[OH “Yd ¥"H'N AN ZbZLE9OH GEELEGOH ZPLLE9OH AGI) BF “YOOH DISA vaisioyy £02
Surysied :AN ‘VSN Q9ZIL UYAIL VY AN LbZLE9OH SEELE9OH YPLLEVOH AGIE) B “YOOH VINJSAA valIsIOW 10Z
GRIN -LN “VSN Osse |uUpooh *g yaewoyL yy AN OFZLEIOH ZEELEIOH SPLLEIOH ABI) B “YOOH 0INJSAA DaIsIDW 00z
meyleW “xO *vsn Tet wahAT ‘Gd AN G6€ZLE9DH 9EELE9DH PELLESOH Ppoog piodsosijo vayisinjy 661
BMOry ‘SY ‘VSN 9Esl eyeG "LM AN 8EZLE9OH SEELE9DH EFLLEVDH ‘AID BF “YOOH VINSAA vajisiD £61
wekeN :ooxeW BcpLuosuyo(prqRAeEMVN AN ZEZLEYOH PEELE9YOH ZPLLEIOH uneig “y DpodojAoun pajis.inpy 961
Yysied

aT®SeT “V1 =vsn €z1z uosuyof ‘Wd MMO 9€ZLE9DH EEELE9DH IFLLE9OH ‘AIL BY “YOOH VjISAA vapissvy S61
uosey] -X.L “VSO PZIZ uosuyo{ ‘Wad AMO SEZLEIOH ZEELEIOH OFL L€90H azuny xo “Wesug piyojinua, Da[ISIDIV PbL
sa]Uallio7) :euUesIy LOO BAN StjOS “A Hd BU LEELEQOH BELLEIOH uneig “Vy ppodojAoup DayIsiDjy Z61
Aytyeo0'] Iayono, uontsodap psdi aA-Toan oq uOoxe |, Jequinu
jo ojdures
umnLeqiay VNd

‘ponuyuoy ‘[ adv]

123

WHITTEN ET AL.: MARSILEA PHYLOGENETICS

SOT) BY SYN], LE99F [[eL10; A epegesOd szeerodd oLleer90a “MJapuy) HYysDu Da]IsIOW 827
Sarpuy S98, ‘u's []9410) FNNd Pregesoa 9zeer9Dd Lleer9od Miapuy) MysbU Da/IsIDPy £22
eIuopayey Man ore FyezrysoH «ANNG zbegesoa aida weenie NeW ONNUL dayIsIDY 922
oolxeyy u’s uosuyo{ a Lregesod pleuse,y 8 -qoy “Tq sljyour Dayisippy GZZ

POLY Zez FeztysoH «ANNA = oregesoa ieee sone “| DJNUTUT DaTISID blz

eIpuy se628 yseley yNNG s6Eeegesoa eu Zoeer90d "| DyNUTUT DaTISIDWW £22

euLing u's ouozouyg NANG seegesHa zzeer9dad goeer9Dd “| DjnuyW DalIsIDpy ZL

XL ‘vsn BSbl FezIysoH ANNA zeegvesHa LzeeP9Ha soeeP9Hd UNeIg “"y xe ‘wye8uq DpodassDUI DalIsID 1Zz
POLY yNog gez ezIySoHH«s«:ON sé EGESDA OLEEr9da FOEsr9da [s@1q “Q Vdipv0190UI DayIsIOWY LZ
eduey = €£/Z8 OUBM,3N puke uapey SH seegesdd e9eEr9dd coeer9da uneig “Vy Dqq!s DalIsiD 6972

eAuay z06/0Z Uepey SN peegesOd sgeer9dd zoeer9dd Weune’y] DsouLipf vayis10y 892

eAuay cg TFyaMyrepy pue sueagq sn — Zoeero0d Loeero0d Weune'] Dupruapp{ vajisippy 292
amqequirz cczz esey)) SN eu ooeer90d uoysty Ddin20rddryda payis.0py 992
eTeqsny 22g ryeztysoH Ss ON se g9eer90d 66zEr90d uneig “y /fpuouUNIp DajisIDW g9z
BLIOSIN LZzg9 seul0y Wa LteeoesOoa eu eu uneIg "Y DJJOjsIp DayIssDpy $97

BIAI[Og LOSP ‘Te }9 JONI H ogegesod eu g6zer9g0d uosuyo{ ‘;w'q Proydojol9 DAa]ISID £972
puerreyy ‘ws oyey FNNd 6zEe9Eesod s9eer9dd Z6zEr9Da [S@1q °D DyDUAII DaTIsSIDY 792
eIsauopuy se-(oRyY aNNdG szegesba P9eer9dad 96zer90a [8@1d "DQ DJDUAID DaLISIDy 19z
eueMs}Og u's Sraquey FyNNG Lze9esOa eveer9da sezer9oad uneig “y sfsuadno paisiopy 092
eAuey ‘usuepey ON gzegesda z9eEer9dd PEZzEP9DA paelyeg odin90A.j0q vajisiopy 6SZ
eleysny oszt FyezrysoH ON czegesdd Loser9dad s6zer90d Ig “Y Dyojusnsup vayrsinpy gSZ

oory oyeng £96 JeIseAIg =f pzegesOd ogeer9da z6zEr90d uneig “y DpodojAoun vajisippy LZ
BIqIuUIeN ezge WMS «60 CéS@zEGESDOA SSEEP9DA L6zEr9DAd PIM vondasan vayisinpy 9Sz
BIOUOG :OO1xaW SLLI-S8 JeB[eq “SU AXAN S9ZLE9OH Z9ELE9DH OZLLE9OH AGID Y “YOOH DNSaa payisiopy bez
BIOUOG :O1xa] 9bZ-L0 188Ja4 ‘SM NXAWN F9ZLEYDH LYELE9DH B9LLEIOH AGI) BY “YOOH VjNSaa valisiop ebZ
BIOUOG :O1xayy 889-S8 Jes[aI “SU OXAW e9ZLE9DH OVELE9DH BYLLEIOH ‘ADID BF “YOOH VINSEA vaypisiopy Zbz
puepreyy, 9946 UIHIYM SVIA Z9ZLE9DH GSELEQOH Z9LLEMOH uosuyo{ *W'q sedjipjpos paris LZ
puereq. S9ZE UPHIYM SVId L9ZLEYOH BSELE9OH Y9LLEVOH [881g “D DJDUAaII DalISIDW ObZ
Aypeoo0'[] JayONoA uoyisodep = psdu A-TUy poqu uOXe |, Jaquinu
jo ajdures

unieqiaH VNa

‘panuyjuog

*L aTaV,

AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

124

vo ‘vsn 846 Ja4Ig ANNA ssegesda eseer9oa sezer9oa unelg “Y DUDOLIaUID DIIDIN| Id 682

IH :vsn 6P06 Jousseq] = Sf) psegesOd zeeer9dd Lzeer90d ‘J[NeY soya vais 882
adjaysg % UO\sTy xe

eueMsS}0g ZEzTE Uasuepy wa esegesoa eu Ozeer9go0d wag ¥ ‘Weig DIOfi]]IA Da[IsiD L8Z

vo ‘vsn O9PZr [9MOH = zsegesOd Leeer9d0d SLeer9od “ABID) 2B “YOO DINSAA DayIsiIDW 987

euems}og 9IZ€ smoling Wa Tse9esOd eu gleer90d }aUNe'] DIVA DalIsSIDAY G8z

BOLgVy yynog cp TyeztysuoHH ANNA osEegEesHd oseer9bad ZiEeer90d Woune'y] DuDadjayos vaprsiny PBZ

uede{ ‘wsouuy FING 6rEgEesod 6ZEEP9H YTEEr9od T byoftaponb vayisinjy €87Z

oony o}eng 096 oAIg ANNA sPegesHa szeet9dad sleer9oa AGI ¥ ‘YOOH DdivoAjod vayrsinpy Z8Z

AN :VSn 66IEL WYATT, ON cregesda Zzeer9da Plesr9oa ppooy viodsosijo vayisinpy 18Z
Woune’7T] (uneig ‘y) pdin90uwiAB

PLOSIN 6ZE9 seuUloOy «NA EGESOA bu ereer90d ‘IRA DIIGNU DA[IsSIDW 08z
woune’y] (uneig ‘y) odips0uwiAS

eueMsjog es6l IuMsgS §WAa sPregesoda eu ZLEer90d ‘IRA DIIGNU DALTSIDW] 627

Ayryeo0'[T Jayono A, uontsodeap = psdu 4-7 oqa UOXR J, Jaquinu

yo ajdures

umMtdeqiap}{ VNG

‘penuyuoy ‘, aTaV],

WHITTEN ET AL.: MARSILEA PHYLOGENETICS

a
To Fig. 1b

M. hirsuta 006 USA: FL

branch length= 5 steps

—___—._—_—s Bootstrap values 0-69% Clade H
subgroup
Bootst lues 70-89% :
arctic ee Marsilea III
ummm = Bootstrap values 90-100%
@ Node collapses in
strict consensus
Clade G
subgroup
Marsilea II

38 steps M. quadhnifolia 283 Japan Clade F
i i. M. quadrifolia 121 USA:PA | sg ae ey
M. quadnifolia 149 Chin subgrou| rsilea
Group II M. quadiolia 172 Pakistan rw
|. nubica nocarpa 279 Botswana
sommmecame iso Nera Clade E
nubica
Clade D
subgroup
macrocarp:
lade
stank subgroup
capen:
pa 282 Puerto Rico
xa 067 Mexico:Sonot
: uela
rench Guyana
ta Rica lade B
M. scalaripes 241 Thailand presn P
08 Venezuela
polycarpa 122 Panama
M. polycarpa 175 Nicaragua
polycarpa 095 Dominica
M. mutica 021 USA:GA
34 steps :
i acehiintcneetteaiateel
Group | use
roup _—
: Clade A
subgroup
fr mutica
i M. mutica 116 USA: VA
M. mutica 276 New Caledonia
——_———_ Pijularia americana 289 USA Outgroup

ingle randomly-chosen shortest tree from maximum parsimony analysis of
L-F s

(a-c). A s
Mars combined plastid DNA deta matrix (rbclL, pes rps4- -trnS Epacer, and trnL-F spacer).
anch lengths are indicated by 1a); bootstrap support
nsensus are marked

is apace: by branch thickness/grayscale. Nodes that. Goltaes | in the strict
with a black dot. Tree length = 743; consistency index (CI) = 0.80; conics index (RI) = 0.96.
Major clades are labeled A-L; the informal clade names (groups and subgroups) correspond to

ose used in Nagalingum et al. (2007).

To Fig. 1c

[—— M. macropoda 007 USA: T:

Yi

SA: TX
icylopoda 005 Mexico: Jal

lisco

ancylopoda 104 Argentina
elgoapers 030 USA: FL
= aff.

ligospora
Ps Florida)

| mollis
M. mollis 077 USA:

: Jalisco
M. mexicana 071 Mexico: Zacatecas
M. mollis 109 Mexico: Chiapas

To Fig. 1a

Fic. 1 Continued.

AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

— M. vestita 049 USA: LA Clade K
M. jpoda 051 USA: LA subgroup
egg macropoda 053 U: L :
M. macropoda 054 USA: FL Nodorhizae

|
(U.S. Gulf Coastal Plain,

ucatan
northern Caribbean)

Clade J

subgroup
Nodorhizae II

branch length = 5 steps
bootstrap values 0-69%
bootstrap values 70-89%
bootstrap values 90-100%

Node collapses in strict consensus

pieces, facilitating amplification from degraded total DNAs. Primers for rbcl.

are: rbc.
TAAACTCCCAACCATTCA

GAGACTAAA

GC; rbcL int¥ TGAGAACG-
; rbcL intR CTGTCTATCGATAACAGCATGCAT;

and rbcLR GCAGCAGCTAGTTCCGGGCTCCA. The rps4 exon and the adjacent

WHITTEN ET AL.: MARSILEA PHYLOGENETICS 427

C

M. oligospora 093 USA: ID
M. vestita 097 USA: NV

M. vestita 188 Me lexico: Baja Cal.
M. vestita 220 7g gees ja Cal.
M. vestita 089 USA: |
ee ie vestita 148 USA: NV
M. vestita 092 USA: OR
+ i U

A: CA
- oe 281 USA: NV
estita 147. USA: CA

branch length = 5 steps

bootstrap values 0-69%
ootstrap values 70-89%

ST

M. vestita 171 Mexico: bon onora

ode collapses in strict consensus

To Fig. 1b

Fic. 1 Continued.

rps4-trnS spacer were amplified in one piece using the primers rps4F

intF TGCCAAACGAGAATCTATGG and rps4 intR CGATGGGTTGT-
TAGTTGTTAG., Primers for the trnL-F spacer (primers E&F) were those of
Nagalingum et al. (2007). All amplifications utilized Sigma Jumpstart Taq
polymerase and reagents (Sigma-Aldrich, Inc., St. Louis, MO, USA) in 25 ul
reactions with 3.0 mM MgCl,. Thermocycler conditions were: 94 °C for

128 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

3 minutes followed by 37 cycles of 94 °C for 30 s, 56 °C for 30 s, 72 °C for 2 min,
with a final extension of 3 min at 72 °C. Problematic taxa were amplified using
Phusion polymerase (New England Biolabs, Ipswitch, MA, USA) according to
manufacturer’s protocols. PCR products were sequenced in both directions
using the Big Dye Terminator reagents on an 3130 automated sequencer
following manufacturer’s protocols (Applied Biosystems, Inc.). Electrophero-
grams were edited and assembled using Sequencher 4.10 (GeneCodes Inc.,
Ann Arbor, MI, USA), and the resulting sequences were aligned manually
using SE-AL (Rambaut, 1996). All sequences were deposited in GenBank
(Table 1). A 25 bp portion of the rps4-trnS spacer contained a homopolymer
region of ambiguous alignment; this region was excluded from analyses. We
analyzed the data using maximum parsimony rather than maximum likelihood
because the number of steps in the resulting trees more clearly represents the
number of base pair differences among accessions. Analyses were performed
using PAUP* version 4.0 b10 (Swofford, 2003) with Fitch parsimony (equal
weights, unordered characters, ACCTRAN optimization and gaps treated as
missing data). Heuristic searches consisted of 1000 random taxon addition
replicates of subtree-pruning-regrafting (SPR) and ‘‘keeping multiple trees’’
(MULTREES) with the number of trees limited to 10 per replicate to minimize
extensive swapping on islands with many suboptimal trees; 10,000 shortest
trees were saved. Support was estimated by 1000 bootstrap (BS) replicates,
saving only 5 trees per replicate and ten trees per bootstrap replicate. The data
matrix is available from the senior author or at ftp://ftp.flmnh.ufl.edu/Public/
Marsilea/.

RESULTS

In total, our dataset comprised 2629 characters for a total of 223 ingroup
accessions, plus Pilularia americana A.Braun. We used existing sequence data
for 33 accessions from 26 species and newly sequenced data for an additional
190 accessions from 12 species (Table 1).

Figure 1 (a, b, c) presents a single randomly-chosen maximum parsimony
(MP) phylogram out of 10,000 shortest trees saved. Tree length = 743;
consistency index (CI) = 0.80; retention index (RI) = 0.96; ACCTRAN
optimization. BS values are indicated by line thickness and shading of branches.

The DNA data revealed that several specimens sampled in this study were
misdetermined (based upon their anomalous placement in the tree and
reexamination of the voucher specimens). DNA data were especially effective
in clarifying the identification of sterile specimens of both North American
and introduced origin.

The cladogram is distinguished by a basal dichotomy separating two
strongly supported clades, earlier designated informally as Groups I and II
(Schneider and Pryer, 2001; Nagalingum et al., 2007). Group I comprises
informal subgroups “‘mutica’/A and ‘‘clemys’’/B, and Group II includes
subgroups ‘‘capensis’’, ‘“‘macrocarpa’’, “‘nubica’’, ‘“‘marsilea I-III’, and ‘‘no-
dorhizae I-IV’’, here designated Clades C through H, respectively. Clades A

WHITTEN ET AL.: MARSILEA PHYLOGENETICS 129

and C-H are Old World (Launert, 1968) and Clades A—G have glabrous leaves.
Clade H includes hairy-leafed species from Australia. Clades I, J, K, and L are
New World, have hairy leaves typical of the semi-aquatic ecotype, and include
the majority of the specimens sequenced in this study. These latter four clades
are united by high BS support into a single clade that corresponds to Johnson’s
Marsilea sect. Nodorhizae (Johnson, 1986; Nagalingum et al., 2007), which
includes six species (plus many names that Johnson synonymized).

Clade A is monotypic, consisting only of M. mutica Mett. It is clearly distinct
from all other taxa in terms of DNA sequence and morphology, with its two-
toned leaflets and petioles inflated at the apex to function as air bladders for
floating leaves. This species has elliptical sporocarps that lack a transverse
vein, are borne at the base of the petiole, and are either solitary or in clusters of
2—4 on branched pedicels. Indigenous to Australia and New Caledonia, M.
mutica may be the most popular species in the water garden trade. The
southeastern U.S. specimens plus one from Oklahoma are genetically distinct
from specimens from Arizona and Virginia, a result suggestive of at least two
distinct geographic origins for material introduced into the U.S.

Clade B includes several species that share the distinctive feature of linear
rows of globose sporocarps borne on the petiole and a transverse sporocarp
veining; this clade corresponds to Marsilea sect. Clemys (Johnson, 1986, 1988).
The inclusion of M. scalaripes and M. deflexa in this clade confirms their
hypothesized placement in the clemys subgroup (Nagalingum et al., 2007).
However, these plastid data do not resolve the sampled taxa into monophyletic
species. There are two well-supported (between 90-100% BS) clades, both of
which include samples of M. polycarpa Hook. & Grev. and M. deflexa. The non-
monophyly of species in this clade and Johnson’s (1986) putative designation of
hybrids of these species may warrant a reexamination of determinations of these
specimens and/or species concepts. Sample #175 from Nicaragua is sterile and
its determination as M. deflexa is tentative.

Clade C contains five African species: M. capensis A.Braun, M. gibba
A.Braun, M. crenulata Desv., M. distorta, and M. coromandelina, which as
described by Launert (1968) are all of the glabrous leaflet type. Although this
clade is strongly supported (100% BS), the plastid data fail to fully resolve
relationships among these species.

Clade D contains eight African species: M. schelpeana Launert, M. aegyptica
Willd., M. botryocarpa Ballard, M. ephippiocarpa Alston, M. farinosa Launert,
and M. macrocarpa C.Presl, and partial plastid data also place M. vera Launert
and M. villifolia Brem. & Oberm. ex Alston & Schelpe in this clade. In contrast
to Clade C, all eight species of Clade D are of the hairy leaflet type (Launert,
1968).

Clade E consists of two samples of M. nubica A.Braun, a glabrous species
from Africa that forms abundant colonies (Launert, 1968).

Clade F consists entirely of M. quadrifolia L., the type species of the genus,
the only glabrous species from a cool-temperate climate, and a protected
species in Europe. Four accessions from different continents, both native and
introduced in range, display little sequence variation.

130 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

Clade G is moderately supported (84% BS) and includes a single accession
of the African species M. fadeniana Launert, several Asian accessions of M.
crenata C.Presl, and numerous accessions of M. minuta L., including several
from introduced populations in the southeastern U.S. and Trinidad. The M.
crenata — M. minuta complex is one of the largest and most variable groups
within the genus (Launert, 1968). Earlier molecular data showed that M.
crenata was nested within M. minuta (Nagalingum et al., 2007), and the
addition of more accessions provides additional evidence that the two taxa are
likely conspecific. Three samples from Trinidad (introduced) form a
moderately supported clade with samples from Kenya and Nigeria. A single
accession (#138) originally determined as M. hirsuta was probably misde-
termined, but was not available for examination.

Clade H includes Australian hairy-leaved species: M. drummondii A.Braun,
M. exarata, M. hirsuta R.Br., M. angustifolia R.Br., and M. costulifera. There are
several subclades resolved, but only one has high (90-100%) bootstrap
support. None of the species within this clade are resolved as monophyletic.
DNA data fail to distinguish M. hirsuta from M. angustifolia. Morphologically,
M. angustifolia differs from M. hirsuta in having smaller and more elongated
leaves and smaller sporocarps (Aston, 1973). These characters, however, are
typically considered insufficient for species distinction within the genus
(Launert, 1968). This clade includes a single specimen (#131) determined as
M. crenata; it is probably misdetermined, as all other specimens of M. crenata
fall in Clade G.

The majority of the specimens sampled are in Clades I, J, K, and L; these
form a highly supported group that include all species native to North and
South America. Species within each clade are poorly resolved due to low
sequence divergence. Both clades K and L include members of a complex of
mainly North American species related to M. vestita Hook. & Grev. and M.
oligospora. Although they receive moderate to high bootstrap support, clades
K and L correlate strongly with geographic origin (K=U.S. Gulf coastal plain,
Yucatan, Mexico, and the northern Caribbean; L= Mexico, western U.S., and
Hawaii), but not with accepted species concepts.

Clade I consists primarily of accessions of M. mollis B.L.Rob. & Fernald from
north central Mexico, Arizona, and one from Bolivia. One specimen from
Zacatecas, Mexico is determined as M. mexicana; the molecular data do not
distinguish it from M. mollis.

Clade J has partially resolved but unsupported internal structure and
includes M. aff. oligospora from Florida, M. ancylopoda from west-central
Mexico, Puerto Rico and northeastern Argentina, plus one sterile sample
(#187) originally determined as M. mollis from Andean Ecuador (Lago San
Pablo). Johnson (1986) cited three sterile collections of M. mollis from this
same lake and suggested that many sterile Andean collections above 1500 m
are probably referable to M. mollis. Our molecular data indicate these
Ecuadorian collections are not M. mollis, but instead belong to this clade that
includes M. ancylopoda.

WHITTEN ET AL.: MARSILEA PHYLOGENETICS 431

Sample #38 (M. vestita from Louisiana) is sister to all other taxa in this clade
in the strict consensus of all trees; its anomalous placement caused us to
resequence this specimen, but the second sequence was identical to the first.

Clade K includes specimens of M. vestita, M. macropoda, and one of M.
uncinata from the Gulf coastal plain of the southeastern U.S., together with
several accessions of M. nashii from Yucatan and the northern Caribbean.
Johnson (1986) regarded M. uncinata as a synonym of M. vestita, but
considered M. nashii to be a valid species distinguished by its strongly
nodding sporocarps (vs. slightly nodding to ascending in M. vestita), a feature
which we have found to vary greatly across and within species, presumably in
response to the microenvironment under which sporocarps develop. The
molecular data provide no resolution within this clade.

Clade L consists mostly of specimens of M. vestita and M. oligospora from
central Texas through the western United States and northwestern Mexico,
plus a specimen of M. mucronata A.Braun from California, which Johnson
(1986) regarded as a synonym of M. vestita. It also includes two specimens of
M. ancylopoda from Venezuela and Peru, but they are not resolved as sister
taxa. The clade also includes several accessions of M. villosa Kaulf., an
endangered Hawaiian endemic, which form a weakly supported clade with M.
vestita and M. fournieri, both from Baja California, Mexico. Johnson (1986)
considered M. fournieri C.Chr. to be a small-leaved form of M. vestita. This tree
is consistent with the hypothesis that M. villosa arose via long-distance
dispersal of M. vestita from western Mexico to the dry lowlands of Moloka’i,
Ni’ihau, and O’ahu where seasonal flooding of shallow depressions offers
restricted habitats (Wester, 1994). This clade also includes samples of M.
oligospora from northern California and Idaho; the type locality of this species
is in Wyoming (see discussion of M. aff. oligospora in Florida in clade J). The
ten samples of M. oligospora are not monophyletic and are scattered
throughout this clade, but without resolution or support.

DISCUSSION
Evaluation of Florida Marsilea aff. oligospora

Based on our phylogenetic trees, the eight accessions of M. aff. oligospora
from central Florida (samples 30-37) fall within Clade J; these plants form a
weakly supported clade distinct from all others and are sister to M. ancylopoda
from Mexico and Argentina. These eight plants also share a four basepair
insertion in the trnL-F spacer that is absent in all other Marsilea; this indel is
an unambiguous synapomorphy that distinguishes these Florida plants. Jacono
and Johnson (2006) tentatively identified these populations as M. aff.
oligospora, although noting subtle morphological differences from western
U.S. M. oligospora, and they regarded the Florida populations as introductions
from the western U.S. Our data contradict their hypothesis; ‘true’ M.
oligospora (e.g., samples 93 and 94, from near the type locality in the western
U.S.; Jackson Hole, Wyoming) fall in clade L, and our data clearly distinguish

igZ AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

the Florida populations from all other taxa. The molecular data indicate that
these Florida populations are nested within M. ancylopoda from Mexico,
Puerto Rico, Argentina, and Ecuador (based on current sampling).

According to Johnson’s (1986) morphological concept of M. ancylopoda, the
species includes considerable variation in sporocarp morphology, but the
sporocarps always lack a superior tooth. The Florida populations of M. aff.
oligospora (sensu Jacono and Johnson, 2006) bear sporocarps with prominent
tooth. The presence of toothed and toothless taxa together in Clade J indicate
that this character may be homoplasious and may not provide reliable
characters for diagnosis of species, at least within this species complex.

The data show that central Florida specimens of M. aff. oligospora (samples
30-37) are distinct from all other sampled Marsilea and might represent an
undescribed species or a morphological and molecular variant of M.
ancylopoda. We are unable to match them with Marsilea from any other
geographic locality. Our sampling of the Caribbean, Central America, and
northern South America is poor, and more extensive sampling might provide a
match for the Florida populations. The type of M. ancylopoda is from coastal
arid lowlands just north of the Gulf of Guayaquil, Ecuador. Future studies
should include material from the type locality. Although our sampling does
not include material from the type locality of M. ancylopoda, it does include
Peruvian material from similar low-lying habitats along the arid west coastal
strip of South America. This specimen (#177, Llatas & Quiroz 2401), is in
Clade L where it groups weakly with M. vestita from the desert regions of New
Mexico and Arizona. Additional sampling from low elevation neotropical
localities is also needed to seek matches for M. ancylopoda from west-central
Mexico and northeastern Argentina, as included in Clade J of this study. Until
further sampling yields a match for the Florida plants, we suggest that the
populations should be regarded as endemic and given protected status by
vegetation managers until its status as native or alien is resolved more
definitively.

Evaluation of Morphological Species Concepts in Marsilea Section Nodorhizae

These plastid data provide an independent dataset with which to evaluate
morphological species concepts in Marsilea, especially for the North American
species that were heavily sampled. The failure of the plastid data to resolve
specimens into clades that correspond to morphospecies is most obvious in
Marsilea sect. Nodorhizae (M. oligospora, M. mollis, M. villosa, M. vestita, M.
macropoda, M. nashii, and M. ancylopoda). Instead, plastid data group these
seven species into four distinct clades with strong geographic structure that
correspond to climactic and habitat zones: Clade L includes western North
American accessions from ephemeral ponds in arid climates; Clade K includes
plants from humid, seasonally influenced low elevation floodplains and wet
depressions of the Gulf coastal plain, Florida, and the northern Caribbean;
Clade I consists only of M. mollis from Arizona to Bolivia; Clade J includes M.
ancylopoda (from Mexico and Argentina), the central Florida material (M. aff.

WHITTEN ET AL.: MARSILEA PHYLOGENETICS 133

ancylopoda) and nearby Puerto Rico, plus a geographically disparate accession
om the montane highlands of north central Ecuador and an aberrant sterile
specimen from Louisiana (#038).

The incongruence of these plastid trees and the currently accepted species of
Marsilea may have several explanations, which we discuss below. Extensive
hybridization among Marsilea species might have led to chloroplast capture of
a single plastid type among many species resulting in plastid trees that do not
accurately reflect phylogenetic relationships. Johnson (1986) cited several
specimens as putative interspecific hybrids, based solely on interpretation of
subtle morphological characters. To our knowledge, no one has created
artificial Marsilea hybrids, nor used molecular data to demonstrate the
parental origin of putative hybrids. Additionally, the non-monophyly of
species may be due to incomplete lineage sorting. However, we did not
examine the individual gene trees to determine if this could be the cause of
non-monophyly.

The absence of monophyletic species may also be due to the presence of
cryptic species. This is exemplified by our finding that the plants originally
identified as M. aff. oligospora are a potentially undescribed species (see
above). These plants display subtle morphological differences compared to all
other known Marsilea, and molecular data indicate that they have a unique
molecular signature as well. Therefore, it is possible that through more intense
sampling and reassessment of morphology, the non-monophyletic species may
reveal the presence of underlying cryptic species.

Through our analyses we discovered several accessions that were misiden-
tified, and it is possible that some of polyphyletic species are due to
identification errors. However, given the extent of polyphyletic species (and
that many specimens were annotated by D.M. Johnson), we suggest that this is
unlikely.

A final explanation for failure of the existing alpha-taxonomy could be an
inflated number of species within Marsilea sect. Nodorhizae (clades J, K, L).
Many species of Marsilea are based upon subtle morphological traits that are
phenotypically plastic or that represent homoplasious local adaptations to
environmental conditions. We found that plant size, leaflet size, extent of
leaflet hairiness, the angle and extent of sporocarp nodding, and the curvature
of the peduncle demonstrated variability that might preclude their taxonomic
utility for species delimitation.

It was beyond the scope of this project to re-examine all of the specimens
used in this study. However, we suggest that future work include re-
examination of the morphology of multiple accessions within a phylogenetic
framework to ascertain the reliability of the existing characters for species
delimitation and to determine if cryptic species are present. There is also the
need for more extensive sampling and sequencing of more variable plastid
regions, to be contrasted with nuclear gene data sets, which will provide a
better framework to settle questions of hybridization and incomplete lineage
sorting as well as provide greater resolution and support for the relationship
among species.

134 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

Conclusions

Using the extensively sampled phylogeny, we found that Florida plants
earlier identified as M. aff. oligospora possess a unique molecular signature (an
insertion in the trnL-F spacer) but morphological characters that distinguish it
from other taxa in M. sect. Nodorhizae are subtle and require more detailed
analyses (Jacono and Johnson, 2006). It is possible that these plants represent
an undescribed, cryptic species endemic to Florida, or a geographically
restricted variant of an existing species. Our plastid trees reveal the same major
clades as the previous study by Nagalingum et al. (2007). Although our
increased taxon sampling reveals no conflicts, many species are not resolved
as monophyletic within these informally named clades. We were unable to
determine if this is due to hybridization, incomplete lineage sorting,
misidentification of specimens, the presence of cryptic species, and/or
inappropriate morphological characters for species delimitation—the present
data are inadequate to resolve these large taxonomic questions. We advise that
the existing alpha-taxonomic classification and circumscription of species in
Marsilea, especially M. sect. Nodorhizae, should be treated with caution.

ACKNOWLEDGMENTS

This work was funded by Florida Dept. of Environmental Protection Bureau of Invasive Plant

Management Grant wail and by The St. ee igre Management District Contract #74607. We
thank curators of m herbaria for permission to destructively sample specimens; we are
especially grateful to Kent Perkins (FLAS) for management of loans. We thank Marian Chau, Robert
Gibson, and Siriporn Zungsontiporn for specime

LITERATURE CITED

Aston, H. 1973. Aquatic Plants of Australia: A guide to the identification of the aquatic ferns and
flowering plants of Australia, both native and naturalized. National Herbarium of Victoria,
Melbourne University Press, Melbourn
rent J. J. and J. L. Doyte. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf
tissue. Phytochemical Bull. 19:11—-15.
(FNA) Fora or NortH America EprrortaL Committee (eds.). 1993. Flora of North America North of
Mexico. hoes 2. Pteridophytes and Gymnosperms. Oxford University Press, New Yor

Jacono, C. C. and D. M. JoHNson. 2006. Water-clover Ferns, Marsilea, in the southeastern United
States. rages 71(1):1-14,
JouNson, D. M. 1986. Systematics of the new world species of Marsilea (Marsileaceae). Syst. Bot.
Mon eae 11:1
se D. M. 1988. Marsilen slant anew member of M il ti Cl Vy fr the Asian
ia Pasa Fern J. 78:68—71
coe E. 8. A monographic survey of the genus Marsilea Linnaeus: I. The species of Africa
and epost Senckenbergiana i. 49:273-315.
see ac N. S., H. Scunemwer and K. M. Pryer. 2007. Molecular phylogenetic relationships and
morphological evolution in the heteccecorue fern genus Marsilea. Sy:

Ramsaut, A. 1996. Se-Al: sequence areas editor, Ver. 2.0a11. Website http://tree.bio.ed.ac.uk/
software/seal/ [accessed conse

SCHNEIDER, H. an . Pryer. 2001. fea and function of spores in the aquatic heterosporous
fern family Memileacaen. at J. Plant Sci. 163:485-505.

WHITTEN ET AL.: MARSILEA PHYLOGENETICS 135

Sworrorp, D. L. 2003. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods).
Version 4 beta 10. see Associates, Sunderland, Massachusetts
Warp, D. B. and D. W. Hatt. 1976. Re-introduction of Marsilea vestita inte Florida. Amer. Fern J.

Wester, L. 1994. Weed management and the habitat protection e rare species: a case study of the
endemic Hawaiian fern, Marsilea villosa. Biol. Conserv. 68:1—9

American Fern Journal 102(2):136-146 (2012)

Effect of Habitat Modification on the Distribution of the
Endangered Aquatic Fern Ceratopteris pteridoides
(Parkeriaceae) in China

Yuan-Huo Donc*
Department of Biologic — capi of — Jianghan University,
30056,
State Key entre of Lake Science aa ak Nanjing Institute of peer R &
nology, Chinese Academy of Sciences, Nanjing 210008, Chin

QiNnG-FENG WANG

Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan 430074, China, email:
qfwang@wbgcas.cn

Rospert Waniti GITURU

Botany Department, Lome Kenyatta University of Agriculture and pease P.O. Box 62000-
00200, Nairobi, Kenya, email: wahitigituru@yahoo

ABsTRACT.—Sixteen sites in China where Ceratopteris pteridoides occurs based on historical
records wade from observations were surveyed during preliminary field surveys. Eight previously
recorded populations were fonee » have sen extirpated Decline in natural populations of C.

pteridoides has resulted from the d ti omplete loss of its primary habitat. Analysis of 7
parameters of water quality cadicetea that ditvene in pH and dissolved oxygen might be
principal factors determining the ciomccanoiaed sia nasil bel C. pteridoides. The sites of the
extirpated populations had higher water pH valu ites of the extant populations
(P < 0.05). The value of dissolved oxygen concentration at the sites of the extirpated populations
was lower than at the sites of the extant populations (P < 0.05). The degeneration of primary

pteridoides populations. Because the habitat and population characteristics of eleven remaining
populations were different, different sites should adopt different conservation methods as
appropriate. Some small populations could be conserved by establishing conservation areas; other
relatively large populations could be conserved by establishing nature reserves.

Key Worps.—Ceratopteris pteridoides, endanger, habitat modification, distribution, conservation

Ceratopteris pteridoides (Hook.) Hieron. (Parkeriaceae), an annual diploid (n
= 39), is an aquatic, homosporous, floating fern. The species displays clonal
owth by means of numerous marginal leaf buds that rapidly develop into
plantlets (Hickok et al., 1987). Both spores and the plantlets from marginal leaf

principally been identified in Central and South America, Southeastern Asia,
Eastern India, and China (Diao, 1990; Hickok et al., 1995). In China, C.

“Corresponding author: E-mail: dongyh2008@yahoo.com.cn; Tel: +86-27-84230422

DONG ET AL.: CONSERVATION OF CERATOPTERIS PTERIDOIDES IN CHINA 137

pteridoides is mainly distributed in central, eastern, and southern China (Diao,
1990). Although C. pteridoides was widely distributed in China, in recent
decades the species has declined rapidly in the numbers and sizes of
populations, and has even disappeared from many locations (Yu, 1999; Dong
et al., 2007). Ceratopteris pteridoides is now considered endangered and is
listed in the second category of the National Key Protected Wild Plants in
China (Yu, 1999). Several factors, including the degeneration of primary
habitats, the decline in area of coverage of wetlands, and the deterioration of
water quality due to human activities, have been identified as being
responsible for the reduction in C. pteridoides populations (see Dong et al.,
2007). However, no data have been provided to support these assertions.

Earlier studies on Ceratopteris pteridoides have mainly focused on
taxonomy and morphology (Hickok et al., 1995; Fan and Dai, 1999; Carquist
and Schneider, 2000). In recent years, Dong et al. (2007, 2010), using RAPD
and ISSR data, revealed low levels of genetic diversity (the percentage of
polymorphic bands (PPB): RAPD, 33.6%; ISSR, 25.2%) and high levels of gene
flow between the remaining C. pteridoides populations in China. Tao et al.
(2008) reported that bensulfuron-methyl inhibits gametophyte growth and sex
organ differentiation of C. pteridoides at low concentration and may pose a risk
to sexual reproduction of C. pteridoides in the field. However, the information
available on the conservation biology of C. pteridoides in China is limited in
comparison with that for the more widely studied closely related species
Ceratopteris thalictroides (L.) Brongn. This latter species is now also
considered to be endangered in China (Yu, 1999).

It is probable that additional studies on the various aspects of the
conservation biology of Ceratopteris pteridoides will provide information that
will justify more stringent conservation practices for this rare plant. The
important objective in the present study was to report the current distribution
of C. pteridoides in China, its habitats, and population characteristics. Another
aim was to investigate the natural distribution of C. pteridoides in China in
relation to habitat characteristics, especially wetland and water chemistry
parameters, in order to contribute to the available information on the biology of
this endangered species.

MATERIALS AND METHODS

From August of 2003 to October of 2006, sixteen sites throughout the historic
geographic distribution of Ceratopteris pteridoides in China were investigated
(Fig. 1). The sites were identified on the basis of records on labels of herbarium
specimens and/or observations during field surveys. The sixteen sites
surveyed are located in Hubei, Jiangxi, Anhui, Zhejiang, Jiangsu, Fujian and
Shandong provinces in Mainland China. At each sampling station elevation,
latitude, and longitude were measured by Global Positioning System (GPS).
The habitat characteristics of C. pteridoides were recorded (Table 1). The
population characteristics of the species including population numbers and

AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

138

}SO| OFT )PS.9LL/,ZL.0€ 91 younXy I-HV aoutAoid mnyuy ‘nysu0g

axel LU.PLL/, 10.08 OZ younxXy Ll-dH aoutaoid reqny ‘nynoyny

ILOAIOSAYY {ZEcZLL/,905ES - younxXy OL-dH aoutaoid taqny ‘nyuepnypy

aye, /CLoCLL/, PPO 6L yoUunXy 6-dH aoutaAoid taqny ‘nysueyy

aye] —_, ET. ELT /,SS.62 bz youNxXY 8-4H aouyaoid jeqny ‘nysu0H

axe] L1.STL/,Z0.0€ gL puyxy 2-H goutaoid jaqny ‘nynoyrepy

aye] ,LE.STL/,8S.62 PL younxXy 9-H aoutAoid reqny ‘nyreqre y,

aye'_| /SLLLL/,0P.PE OL younxy 1-ds aoutaoid Suopsueys ‘nylsuey

c-§ c-¢ youd /LO.81L/,9P.LZ - JUP}X YT t-{a soutaoid uerlny ‘ueystAn iy

000T—00S OS-OF puod ‘puepeaM ,60.0Z1/,LS.0€ - yue}Xy 1-[Z soutaoid Suerleyz ‘noyzny

0s—0Z 00€-002 aye] (bP.SLL/,8P.62 1Z yuR}Xy 1-x{ soutaoid xBuel( ‘Bueyomny

000T—-008 os—-og puog ,6S.€11/,58.62 6L yue]Xy S-dH soutaoid jeqny ‘nAer{

00009-00006 0002-0081 puodysty 6S.€11/,SS.62 tL yuR}Xy b-dH soutaoid eqn} ‘urxdue x

00061-00001 00S-00F aye] ,bE.PLL/,ST.0€ ST UR}XY £-4H soutAoid teqny ‘nyrzsuery

00S-002 0S-OF aye] LO.PLL/, FS.62 61 yue}Xy z-dH aoutaoid teqny ‘nAeT{

00001-0009 008-002 puodysty ‘youd /EL.ELL/,SS.62 bz yueyxy 1-dH goutaoid jeqn} ‘suesorry
azis uolepndog (,t) sje}IqeH (q)epnyrsu0'T (ut) uoyeyndod apoo uoT}e90'T

eerie uonepndog /(NJepryneyT uoTnRAs[y pouyxe /juRyxq uonepndog

"BUIYD Ul sapfopiiajd si1ajdojpi1ay Jo suoyejndod youynxe pue jue}xo Jo sorst19j9eIeYO suoye[ndod pue jeyqey ‘uoNNqIystp o1ydes30e5) *T a1aVy,

DONG ET AL.: CONSERVATION OF CERATOPTERIS PTERIDOIDES IN CHINA 139

105° 110° ag 120°

Fic. 1. Distribution map and water sampling sites of Ceratopteris pteridoides in China. @ Sites of
extant populations. © Sites extirpated populations. Eleven water sampling sites including HB-1,
HB-2, HB-3, HB-4, HB-6, HB-7, HB-9, HB-10, HB-11, JX-1, and SD-1. Codes and names of
populations see Table z.

population area, population sizes (numbers of individuals), and companion
species were investigated (Ta

Eleven sites of the sixteen sites waere investigated in 2003. Thus, in order to
decrease statistical error, the water chemistry parameters of only the 11 sites
surveyed from August to September of 2003 were analyzed (Fig 1). Five sites
which still have populations of Ceratopteris pteridoides were designated as
type A sites while six sites from which the species has been extirpated were
designated as type B sites (Table 2). Seventeen water parameters were
measured at seventeen sites (Table 2). The chemical parameters, including
NO;-N, NH3-N, PO,°-, total Cl, Ca, Mg, Fe, Cu, Zn, Mo, and Cr, were
measured from the sample with a multi-parameter ion-specific photometer
(C200, Hanna Co., Italy) in the laboratory using a 500 ml water sample
collected in a plastic bottle in eleven sites respectively.

pH was measured with a portable meter (HI 98107, Hanna Co., Italy), as was
conductivity (HI 983004, Hanna Co., Italy). Dissolved oxygen, dissolved
carbon dioxide, alkalinity, and hardness were measured in the field with a
portable test kit (HI 3814, Hanna Co., Italy). The water temperature of the water
sample sites were about 25-30°C from August to September.

The mean values of the 17 chemistry parameters of water at the type A and
type B sites were compared statistically using a one-way ANOVA when the

AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

BLE 2. i gets tests of water chemical parameters at the sample sites in 2003. sos sc
ons

na for all compar
extirpated sone i

son LAN =

0.05; Type A: Sites of extant populations; Type B: Sites

Statistical Tests

ype Type B One-way ANOVA Rank sum
Parameters (X =sdn=5) (X + sdn = 6) (F-test) test (U-value)
Ch (mg/L) 0.23 + 0:03 0.24 + 0.07 0.02 -
Cu (mg/L) G27 2 O41 0.45 + 0.27 1.93 -
ee (mg/L) 17 = 0.22 0.20 + 0.20 0.07 -
Mg (mg/L) 0.38 + 0.16 0.40 + 0.17 0.03 -
es (mg/L) Oot = p14 0.20 = 0.33 0.28 -

Mo (mg/l 4:26 © 1:32 Lo. O35 0.002 _
PO,°” (mg/L) 0.26 + 0.25 0.56 + 0.34 2.68 ~
Dissolved carbon dioxide (mg/L) 22.60 + 9.71 24.83 + 13.67 0.09 _
pH fare 2. O22 297 = O.27 7.90* -

Dissolved oxygen (mg/L) pee Slacks Cle Bs | 5.05 + 1.15 41,57" ~

Alkalinity (mgCaCO;/L) 97.80 + 28.11 109.50 + 50.33 0.21

Hardness (mgCaCO;/L) 93.00 + 26.07 136.00 + 79.41 - 25.00
NH,-N (mg. 0.12 + 0.04 0.19 + 0.14 - 24.50
Fe (mg/L) 0.28 + 0.45 0.06 + 0.08 ~ 32.34
Cr® (ug/L) 2.80 + 6.26 9.83 + 23.12 ~ 28.00
NO;-N (m g/L ) 0.60 + 0.82 0.19 = 0.24 _ 32.00
Conductivity (ms/cm) 0.22 + 0.08 0.36 © 0:27 _ 26.00

variance was homoscedastic and using a rank sum test when the variance was
heteroscedastic. The homogeneity of variance of all factors was assessed using
the Bartlett test (Li, 2002). Any factors that showed significant difference
between the type A and type B sites were evaluated further by analysis of
multiple comparison using Least Significant Difference. Level of significance
was set at P < 0.05

RESULTS

A total of eight extant populations of Ceratopteris pteridoides were found in
the 16 sites surveyed from August of 2003 to October of 2006 across the natural
geographic distribution range of C. pteridoides in Mainland China (Fig. 1,
Table 1). These extant populations of C. pteridoides were found growing in
ponds, lakes, rivers, and ditches. These extant populations are located mainly
in the middle and lower reaches of the Yangtze River, which is also the site of
thousands of shallow lakes most of which are interconnected to the main
artery of the Yangtze River. With the exception of five populations (Jx-1, FJ-1,
HB-2, ZJ-1 and HB-5) that had fewer than 1000 individuals, the rest of the
populations (HB-1, HB-3, and HB-4) had more than 1000 C. pteridoides
individuals per population. Most of the individuals were floating. Ceratopteris
pteridoides mainly grows together with Nelumbo nucifera Gaertn., Hydro-
charis dubia (Blume.) Backer., Phragmites communis Trin., Alternanthera
philoxeroides (Mart.) Griseb., Phalaris arundinacea Linn., Trapa bispinosa

DONG ET AL.: CONSERVATION OF CERATOPTERIS PTERIDOIDES IN CHINA 141

Roxb., and Potamogeton distinctus A. Benn. Ceratopteris pteridoides was the
dominant species in three of the extant populations including (HB-1, HB-4,
HB-5). The habitats at the sites of the extinct populations of C. pteridoides have
been greatly modified. At some stations, including at the Nansi, Taibai,
Haikou, Honghu, and Changhu Lakes, water pollution was clearly evident,
while some lakes and wetlands including Dongliu Lake (AH-1 population) in
Anhui province have vanished (Table 1). Area of coverage of wetland in site of
ZJ-1 population was reduced due to uncontrolled real estate development.

Analysis of the 17 parameters of water quality indicated that type B sites had
significantly higher mean pH (P < 0.05) and lower dissolved oxygen (P < 0.05)
than type A sites (Table 2). None of the remaining chemical variances differed
significantly between type A sites and type B sites.

DISCUSSION

Various kinds of human activities can bring about changes of wetlands and
aquatic habitats (Carrier, 1991). Loss of habitat is the single most important
cause of extinction of species (Primack, 1993). The accelerated loss of habitat of
Ceratopteris pteridoides in China, together with a decline in the wetland surface
area might have put the species at the risk of becoming extirpated in this
expansive region and resulted in the extinction of C. pteridoides population at
some sites. In recent decades, C. pteridoides in Mainland China have declined
rapidly in number of individuals and populations, and plants have disappeared
from many locations. For instance, loss of Dongliu Lake, which was part of the
Yangtze River system in Anhui province undoubtedly led to the disappearance
of this species from the site. Excessive aquaculture and water pollution have
been identified as the most likely cause for the extinction of C. pteridoides at
Haikou, Taibai, and Honghu Lakes (Jian et al., 2001; Lu and Jiang, 2003).

Five of the eight extant populations of Ceratopteris pteridoides in Hubei
province of central China are located in an area which was occupied by a large
wetland known as the Yunmeng marshland in ancient times. In 239 B.C. the
Yunmeng marshland was reputed to have a surface area spanning more than six
million ha and plants of the genus Ceratopteris were recorded there (Liu, 1984;
Shi et al., 1989; Diao, 1990). Over a period in excess of two thousands years, the
surface coverage of the wetland has continued to decline at different rates in
different historical periods, mainly due to overexploitation, irrigation and
tourism activities. As a result, the number of lakes in Hubei Province, which is
known in China as “The province of a thousand lakes’’, decreased from 305 in
the 1950s to 217 currently. Compared with the 1950s, the total area of lakes in
Hubei Province was reduced by 66% to 2438.6 km’ at present (Wang et al.,
2009). In addition, due to overexploitation and uncontrolled real estate
development (Wan et al., 2004), the number of urban lakes in Wuhan of Hubei
Province was reduced from 89 in 1949 to 38, within which C. pteridoides only
exists in one lake (HB-3 population) in this study (Table 1). Our own field
investigations also have indicated that population ZJ-1 is in imminent danger of
extirpation due to rapid expansion of Huzhou city. The current body of evidence

142 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

gathered in several studies, including our present study, shows that the
progressive reduction in the numbers and sizes of C. pteridoides populations is
likely attributable to sedimentation from the upper reaches of the Yangtze River
(Shi et al., 1989) and to human activities including farming, excessive
aquaculture, overexploitation of water bodies, building of irrigations works,
reclamation of land from lakes, tourism activities, uncontrolled real estate
development and run-off water pollution (Shi et al., 1989; Jian et al., 2001; Lu
and Jiang, 2003; Dong et al., 2007).

Potamic and lacustrine water chemical properties are among the principal
factors determining the kind, number, and distribution of aquatic plants (Shi
et al., 1989; Yang and Ye, 2001; Liu et al., 2003). Hydrobiological communities
are greatly threatened by water pollution (Moyle and leidy, 1992). Analysis of
17 parameters of water quality indicated that type B sites had significantly
higher mean pH (P < 0.05) than type A sites (Table 2) in 2003. The mean pH of
type A was 7.16 + 0.49 in August of 2011, and lower than that of type B sites,
which was consistent with the results in 2003. At the same stations, some sites
of extant populations had higher pH values than the recorded primary habitat
indicated on the labels of herbarium specimens. For example, the mean water
pH value at Haikou Lake site has risen from 6.3 recorded in 2001 to 7.9 (Jian
et al., 2001). While the pH value at both type A and Type B sites indicated a
progressive rise in the recent past, the proportional increase is markedly higher
for the type B sites. Significant variability of pH at different sites might be
largely due to different levels of pollution at the sites. Excessive aquaculture
and land usage (Ivahanenko et al., 1988; Downey et al., 1994) could have a
profound influence on pH variation in wetlands.

Significant changes in water pH may interfere with physiological activities
of aquatic plants (Tang et al., 2002). Water pH affects the bioavailability of Ca,
Fe, Mn and Zn to rooted aquatic macrophytes (Jackson et al., 1993).
Furthermore, variation of pH may upset the subtle ionic balance in the
environment; For example, pH variability affects the ionic balance between
ammonium and ammonia in water (Kérner et al., 2001). pH variation has been
shown to be the principal factor affecting the distribution of Ceratopteris
thalictroides, a closely related species which is also endangered in China
(Dong et al., 2005), as well as the endangered aquatic fern Isoétes sinensis
Palmer (Wen et al., 2003). Considering that pH may influence the absorption of
ions and metabolic activities of aquatic plants including C. pteridoides, it
could be an important factor leading to extirpation of this endangered species
from its habitats. This finding suggests that change in pH may be associated
with the disappearance of C. pteridoides populations from the type B sites.

The different tests of water chemical parameters of these sample sites
indicated that type B sites had significantly lower dissolved oxygen (P < 0.05)
than type A sites (Table 2). Several studies, including Yang et al. (2001) and
Shi et al. (1989), have demonstrated that dissolved oxygen is a principal factor
that affects the distribution of aquatic plants. The absorption of minerals by
plant roots is closely related to respiration in plants. Variation in oxygen
availability influences absorbability of minerals by the roots. Generally

DONG ET AL.: CONSERVATION OF CERATOPTERIS PTERIDOIDES IN CHINA 143

speaking, the higher the oxygen concentration, the more efficient the
absorption of minerals by roots. Ceratopteris pteridoides is primarily a floating
plant in lakes and ponds and absorbs minerals chiefly through its roots. It is
probable that the lower concentrations of dissolved oxygen at these sites of
extinct populations affects the intake of oxygen and consequently respiration
in C. pteridoides plants, thus interfering with the physiological activities of the
plants. This could be detrimental to the health of the populations and may
have contributed to the extirpation of the species from these sites. Therefore,
the significant differences in pH and dissolved oxygen between type A and
type B sites indicated that distribution and occurrence of C. pteridoides are
closely correlated with water chemical characteristics.

Biodiversity has declined in freshwater lakes in China in recent times (Jian
et al., 2001). The factors leading to biodiversity reduction mainly include
water pollution and excessive aquaculture, with the latter having been
identified as the single most important factor (Jian et al., 2001). At the sites
of the eight extinct populations at Taibai, Haikou, Honghu and Changhu Lakes,
observations and interviews with the locals revealed a long history of intensive
aquaculture. It is likely that this is a major reason for the decline of
Ceratopteris pteridoides at these sites and elsewhere in China. Field surveys
also showed that fishing activities by local fishermen destroyed C. pteridoides
in the Yangxin (HB-4) and Jiayu (HB-5) populations in Hubei province, which
compromised the self- maintenance and self- renewal abilities of the
populations, leading to gradual decline of the populations.

Five populations among the eight extant populations of Ceratopteris
pteridoides were relatively small with fewer than 1000 individuations
(Table 1). Most of the eight extant C. pteridoides populations grew in ponds,
ditches, shallow lakes, and kaleyards, while others (ZJ-1, HB-3, and HB-5)
were located among city regions that have undergone rapid expansion. Such
populations can be highly susceptible to the effects of environmental changes
and disasters, which heighten the possibility of species extirpation.

We have shown that the distribution and occurrence of Ceratopteris pteridoides
are correlated with water chemistry, with pH value and dissolved oxygen being
the most important factors. Evidence from the present study supports the idea that
the observed decline in C. pteridoides populations is associated with the
destruction and the loss of their primary habitats, especially the reduction in
wetland areas and the increase in water pollution. Human activities such as
farming, tourism, real estate development, fisheries, and run- off water pollution
are the most important reasons. It is of critical importance that are taken
to establish appropriate conservation strategies to stem and even reverse the
decline in populations of C. pteridoides observed in mainland China.

Both in situ and ex situ conservation approaches are important conservation
strategies for rare and endangered species. However, the most appropriate
conservation strategy is to protect the habitats of the species (Primack 1993).
Because habitat and population characteristics of the remaining populations
are different, a uniform approach may not apply for all sites, and different sites
should adopt different conservation methods as appropriate. Some small

144 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

populations such as Jx-1, FJ-1, HB-2, ZJ-1, and HB-5 could be better conserved
by establishing small, protected areas. Other relatively large populations, such
as HB-1, HB-3, HB-4 should be conserved by establishing nature reserves. At
the same time, there should be a government policy implementing complete
cessation of farming activities in selected areas to allow forest to regenerate.

In recent years, in order to protect natural species and renew lake habitat,
some government policies have been implemented at Xilianghu Lake (HB-2),
Liangzihu Lake (HB-3) in Hubei province, including a complete cessation of
farming activities, purse seine cultures, and fill-up of urban lakes. The HB-3
population, located at Wuhan, Hubei province, could be better conserved by
actualizing local projects such as the expansion of lake areas and the
connection of the surrounding lakes. These policies and measures could be a
good approach towards improving the lacustrine ecosystem and protecting
threatened aquatic life forms including Ceratopteris pteridoides. At the same
time, in order to better protect threatened aquatic species, we advise
establishing a list of lakes for conservation in China, and taking effective
and long-term population and community characteristic measurements of
these lakes, as well as monitoring the changes in water chemical parameters.

Botanical gardens have played an increasingly important role in the ex situ
conservation of rare and endangered plants (Maunder, 1994). Wuhan Botanical
Garden (WBG), is ranked as one of three core research botanical gardens in China.
It houses the largest aquatic plant garden in East Asia, and has theme gardens
such as Central China relicts, and a rare and endangered plant garden. WBG
currently plays an important role in the conservation of aquatic species. The
botanical garden has shown preliminary success in the conservation of
Ceratopteris including C. pteridoides and C. thalictroides. Ceratopteris pter-
idoides was mainly protected at a pond in a zone of aquatic plants. The species in
WBG mainly grows together with Nelumbo nucifera Gaertn., Hydrocleys
nymphoides (Willd.) Buchenau., Potamogeton lucens Linn., Triarrherca sacchar-
iflora (Maxin.) Nakai., Pistil stratiotes L., and Vallisneria natans (Lour.) Hara.

A key aim of conservation, in addition to habitat preservation, is to maintain a
species’ existing level of genetic variation in order to maximize its chances for
persistence in the face of changing environments (Keiper and McConchie, 2003).
Dong et al. (2007, 2010) used ISSR and RAPD data that revealed low levels of
genetic diversity at the species level and low levels of genetic variation among
populations of Ceratopteris pteridoides in China. The studies have also
demonstrated a high level of interpopulation gene flow in the extant populations
of C. pteridoides in China. In light of the genetic information for C. pteridoides,
we recommend establishing as many in situ conservation spots as possible and
cross-transplanting plants between populations in order to increase gene flow
and preserve to the greatest extent possible the genetic resources of the species.

ACKNOWLEDGMENTS

The authors are particularly indebted to Dr. Jin-Ming Chen, Dr. Can Dai, Xing-Wei Wang, and
Yu-Dei Huang for their assistance. The study was supported by grants from the Natural Science

DONG ET AL.: CONSERVATION OF CERATOPTERIS PTERIDOIDES IN CHINA 145

Foundation of China (No. 31170341), the Natural Science Foundation of Hubei province
(No. 2011CDB001), Science and Technologic Project of Wuhan City (201150699189-02), and State
Key Laboratory of Lake Science and Environment (2010SKL011), and the “100 Talents Program’’ of
CAS granted to WQF (KSCX2-YW-Z-0805).

LITERATURE CITED

eres S. and E. L. ScHNEtDeR. 2000. SEM studies of vessels in ferns 14. Ceratopteris. Aquat. Bot

CARRIER, 1 1901. The Colorado: a river drained dry. National init Magazine 179:4-35.
990. Aquatic weeds in China. wap Press, Chon
Dona, y. fy W. G. Roserr., J. M. CHEN and Q. F. Wane. 2005. Effect of habitat modification on the
distribution of the enda eee aquatic pity poets thalictroides (Parkeriaceace) in
China. J. oars Ecol 20:689-693

Done, Y. H., J. M. Cuen., W. G. Roses end Q. F. Wanc. 2007. Gene flow in populations of the
vase neg oat fern Ceratopteris pteridoides in China as revealed by ISSR markers.
Aquat. 74

Done, Y. He Hg ~ (a BERT . M. Cuen and Q. F. Wanc. 2010. Genetic variation and gene flow in the
endangered aquatic fern Ceratopteris pteridoides in China, and conservation implications.
Ann. Bot. Fennici 47:34—44

Downey, D. M., C. R. FRENcH and M. Opom. 1994. Low cost limestone treatment of acid sensitive
trout si in the Appalachian mepclantes of Virginia. Water Air Soil Pollut 77:49—77.

Fan, - W. a S. J. Dar. 1999. oe on spore morphology of the pteridophyta by SEM. Nat.

rig 2 Harbin Normal Univ 15:73—

oo a G., T. R. Warne and R. S. Ae pbs Noe biology of the fern Ceratopteris and its use
as a ye tage Int. J. Plant Sci 156:3

Hickok, L. G., . Warne and M. K. Stocum. en Ceratopteris richardii: applications for
salad ae biology. Am. J. Bot 74: pets 316.

IvVAHNENKO, T. I., J. J. RENTON and H. W. Raucu. 1988. Effects of liming on water quality of two
cea in West Virginia. Water Air oe ery 41:331-357

Jackson, L. J., J. Katrr and J. B. Rasmussen. 1993. Sediment oH @ and redox potential affect the
bioavailability of Al, Cu, Fe, Mn, and oe to rooted aquatic macrophytes. Can. J. Fish. Aquat.
Sci 5

Jian, Y es oe Wane, G. Q. HE., J. Li and J. K. CHen. 2001. A comparative study of aquatic plant
oblaiena of ee Taibai and Wushan lakes in Hubei province of China. Acta Ecol. Sin

co ss : ae “ ‘Metoncan 2000. An analysis of genetic variation in natural populations of
Sticherus Cpresih [R.Br.(St John)] using amplified fragment length polymorphism (AFLP)
571-581.

markers.
Korner, S., S. Das., S. VEENTRA and J. E. VerMAAT. 2001. The effect of pH variation at the
a equilibrium in wastewater and its toxicity to Lemna gibba. Aquat. Bot
:71-78.

Li, S. G. 2002. Applied biology statistics. Beijing University Press, Be
Li, J. K. ee Lakes of the middle and lower basins of the Chang ans (Chine). Pp. 331-355, In:
Tabu F. B. Lakes and Reservoirs. Elsevier, Amsterdam

Liu, X., X. A. Panc and Q. F. Wanc. 2003. Character and variation of chemical properties of the
water in the natural habitats af three species of Isoetes in China. Acta Phytoecologica Sin
27:510—515

Lioyp, R. M. 1974. Systematics of the genus Ceratopteris Brongn. (Parkeriaceae). II. Taxonomy.
Brittonia 26:139-160.

Lu, S. and J. H. Jianc. 2003. The wetland resources of Honghu Lake and countermeasures of its
protection. J. Lake Sci 15:281—284.
Mavnper, M. 1994. Botanical gardens: future challenges and responsibilities. Biodivers Conserv

3:97—103

146 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

Mov1e, P. B. and R. A. Lety. 1992. Loss of biodiversity in aquatic ecosystems: Evidence from fish
faunas. Pp. 127—169, In: Fiedler P. L. and S. K. Jain. Conservation Biology: the Theory and
reeset of Nature Conservation, Precervolion and Management. Chapman and Hall, New

‘nai R B. 1993. Essentials of conservation ee Sinauer Associates, Inc, Sunderland M.A.
Sui, C. X., X. C. Wane., H. S. Dou, L. ZHanc and H. D. Wanc. 1989. A general outline of Chinese
lakes. gees Press, Beijing.

Tane, T., Q. H. Cat, R. Q. Liu, D. F. Li and Z. C. Xm. 2002. Distribution of epilithic algae in the
ha River system ae their relationships with environmental factors. J. Freshwater Ecol
a73 352,

Tao, L., es y. Yin and W. Li. 2008. Effects of herbicide bensulfuron-methyl on gametophyte
development and sex organ differentiation in Ceratopteris pteridoides. J. Plant Ecol (Chinese
ree 32:408—412.

. Wu and J. T. Liv. 2004. Quality status urban lake water in Wuhan city with
ntated approaches on restoration. Resources and Environment in the Yangtze Basin.

Wan,

Win: at 7 e Wu., H. L. Wane, C. J. KE ost Rox: or gen Problems in lake protection and
management of Hubei Province and countermeasures. Yangtze River. 20:10-11
Wen, M. Z., X. A. Pane and Q. F. Wane. a een between water chemistry and the
distribution of the ieee aquatic quillwort Isoétes sinensis Palmer in China. J.
6

Yanc, H. L. and J. X. Ye. ss ane study on interrelation between aquatic vascular plant
communities and environmental factors in Jiangxi province. Chinese Journal of Ecology.
20:45—47.

Yu, Y. F. 1999. A milestone of wild plant conservation in China. Plants. 5:3—11.

American Fern Journal 102(2):147—153 (2012)

Negative Gravitropism in Dark-Grown Gametophytes
of the Fern Ceratopteris richardii

Hiroyuki! KAMACHI* and MuneNort Nocucui
Graduate School of Science and Engineering (Science), University of Toyama, 3190 Gofuku,
Toyama 930-8555, Japan

Asstract.—This study examined whether gravity influences the growth direction of dark-grown
gametophytes of the fern Ceratopteris richardii. Analyses of directional growth of gametophytes in
response to gravitropic stimulation demonstrated that gametophytes showed negative gravitrop-
ism. Dark-grown gametophytes of dkg1 her1 mutants, which germinate in complete darkness,
displayed a more distinct negative gravitropism. Unlike her1 spores, dkg1 her1 spores do not
require light irradiation to induce spore germination. Therefore, light irradiation on her1 spores
was possibly inhibiting the negative gravitropism of her? gametophytes. In the present study,
prolonged white-light irradiation on her1 spores inhibited negative gravitropism in the
gametophytes. Light irradiation on spores therefore affects the later negative gravitropism of
dark-grown gametophytes.

Key Worps.—Ceratopteris richardii, gametophyte physiology, gravitropism

Spore germination is the first event in the life cycle of ferns. Germinated
spores progress autotrophically through many developmental stages to form a
mature gametophyte with rhizhoids and gametangia (Momose, 1967; Ragha-
van, 1989). During this time many environmental factors influence develop-
ment and morphogenesis of the fern gametophyte. In vascular plants gravity is
an important factor controlling plant morphogenesis and directional growth
(Morita and Tasaka, 2004; Hoson et al., 2010); similar responses in fern
gametophytes have not yet been described in detail.

The fern Ceratopteris richardii Brogn. is often used as a plant model system
(Hickok et al., 1995; Banks, 1999; Salmi et al., 2005). In the germinating spores
of C. richardii, Edwards and Roux (1994, 1998) found that the primary rhizoid
emerged in a downward direction with respect to gravity, suggesting that
germinating spores could sense the direction of gravity. After germination the
rhizoid failed to respond to changes in gravity, indicating that the rhizoid itself
was not gravitropic (Edwards and Roux, 1994). Gravitropism in Ceratopteris
richardii gametophytes other than in the rhizoids has not yet been examined.
Investigation of gravity sensing by gametophytes is of interest because it is a
poorly understood environmental response in gametophyte development. If
C. richardii gametophytes can sense the direction of gravity and then show
gravitropism, the gametophytes will be useful for investigating mechanisms of

“Corresponding Author: E-mail: kamachi@sci.u-toyama.ac.jp

148 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

gravitropic responses in non-vascular plants. In the present study, C. richardii
gametophytes were examined for directional gravitropic responses.

MATERIALS AND METHODS

Morphogenesis between male and hermaphroditic gametophytes varies
greatly in Ceratopteris richardii (Kamachi et al., 2004). Male gametophytes,
which are induced by the pheromone antheridiogen (Kamachi et al., 2007),
were insensitive to light for induction of asymmetric cell division followed by
rhizoid development (Murata and Sugai, 2000), suggesting that male
gametophytes might be less sensitive to environmental changes. Therefore
her1 mutants, which are antheridiogen-insensitive mutants and do not
develop into males (Banks, 1994), were used for this work. In this study,
dkg1 her1 double mutants were also used. The dkg1 (dark-germinator 1)
mutant allele enables the spore to germinate in complete darkness (Scott and
Hickok, 1991; Kamachi et al., 2004).

Ceratopteris richardii spores of her1 and dkg1 her1 mutants were collected
from fertile fronds in a greenhouse at Toyama University. The spores were
sterilized for 3 min in commercial 5% NaOCl bleach, 0.02% (w/v) Triton X-
100, rinsed with distilled water, and incubated in the dark for 7 days to
synchronize germination. Spores were then irradiated for 24 h at 26°C under
white light (5.0 J m~* s_'), and germinated in the dark to obtain strap-shaped
gametophytes (Fig. 1B). Spores of the dkg1 her1 mutants were germinated in
the dark immediately after the sterilization because these mutants can
germinate in the dark. A 1:4 dilution of Murashige and Skoog (MS) salt
mixture (Wako Pure Chemical Industries, Osaka, Japan) solidified with 0.3%
(w/v) Bacto Agar (Difco) was used as the germination medium.

Gravitropism of Ceratopteris richardii gametophytes was evaluated in 9-day
old gametophytes grown on agar medium in the dark. Observations were made
using a stereoscopic zoom microscope (Nikon, SMZ-1000). In each experiment
50-100 gametophytes were classified into three types: gametophytes that grew

Fic. 1. Morphological profiles of 7-d-old Ceratopteris richardii gametophytes grown in the light
(A) and in the dark (B). am Apical meristem, cz basal growth cessation zone, /m lateral meristem, r
rhizoid, sa subapical elongation zone, sc spore coat. Scale Bar = 0.2 mm.

KAMACHI & NOGUCHI: GRAVITROPISM OF DARK-GROWN GAMETOPHYTES 149

upward, downward, and horizontally with respect to the surface of the agar
medium. Results were expressed as mean values of percentages obtained from
three separate experiments.

RESULTS

Figure 1 shows typical morphological profiles of 7-day old Ceratopteris
richardii gametophytes grown in the light (A) and dark (B). The dark-grown
gametophytes have a strap-shape with 3-6 rows of cells in a single plane, an
apical meristem, a subapical elongation zone, and a basal growth cessation
zone where the cells are extremely elongated. A similar growth habit was also
described in a study by Murata et al. (1997).

Dark-grown gametophytes were first examined for a display of gravitropism.
Sixty one percent of the 8-day old, dark-grown gametophytes grew upward
with respect to gravity, and 10% grew downward (Fig. 2), which suggests that
Ceratopteris richardii gametophytes display a tendency toward negative
gravitropism. For a clearer demonstration of negative gravitropism, gameto-
phytes were turned upside down one and two days before observation. These
gametophytes changed their direction of growth from “upward” to ‘‘down-
ward” following this rotation (Fig. 2), which further demonstrates that C.
richardii gametophytes display negative gravitropism.

Figure 2 shows results from gametophytes with the dark germinator 1 (dkg1)
mutant allele, which enables spores to germinate in complete darkness (Scott
and Hickok, 1991; Kamachi et al., 2004). Interestingly, 89% of these
gametophytes grew upward, and only 1% grew downward. Thus, these
mutants showed an enhancement of negative gravitropism compared with the

— 1007 DC Upwara
& Downward a
g 80}
Ss
a
8 20
rT)
£
& 40+
z
=
Fae |
a
co (+«CO a
rd
a
S)
so 207
EB
40° 1 2 3 4 5

Fic. 2. Percentages of dark-grown Ceratopteris richardii gametophytes that grew upward and
downward directions in her1 mutants (1, 2, 3) and dkg1 her1 mutants (4, 5). Gametophytes grown
on agar medium placed horizontally (1 and 4); gametophytes turned upside down one day before
the observation (2); gametophytes turned upside down two days before the observation (3 and 5).
Values represent the means evaluated from three separate experiments. In each experiment 50-100
gametophytes were observed. Bars are standard errors.

150 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

her1 mutants. These results imply that white light, which is required to induce
spore germination, may inhibit the subsequent gravitropism of developing
gametophytes.

To confirm this hypothesis, white-light irradiation effects on gravitropism
were examined using herl gametophytes (Fig. 3). When the length of
irradiation time was changed from 18 h to 48 h, the negative gravitropic
response weakened. Seventy-four percent of gametophytes grew upward when
the irradiation time was 18 h, as opposed to 48% when irradiation time was
extended to 48 h. On the other hand, the percentages of gametophytes that
grew downward and horizontally increased to 14 and 35% from 4 and 22%,
respectively, when the length of irradiation time was changed from 18 h to
48 h. Thus, the white light irradiation during the initial developmental steps in
spore germination inhibited negative gravitropism in Ceratopteris richardii
gametophytes.

DISCUSSION

This research was conducted to determine whether gravity affects the
directional growth of dark-grown gametophytes of Ceratopteris richardii.
Gametophytes showed negative gravitropism similar to that as seen in most
seedlings of vascular plants, caulonema of the moss Physcomitrella patens

E

T

3

8

12 24 36 48 60
Illumination time (h)

Upward, downward and horizontal growth (%)
5

Fic. 3. White-light irradiation effects on negative gravitropism in Ceratopteris richardii
gametophytes. The her1 spores were irradiated by white light for the designated times to induce

separate experiments. In each experiment 50-100 gametophytes were observed. Bars are
standard errors.

KAMACHI & NOGUCHI: GRAVITROPISM OF DARK-GROWN GAMETOPHYTES 151
(Martin et al., 2009), and protonemata of characean algae (Braun and Limbach,

Gravitropism in plants occurs in three temporal stages: gravity perception,
signal transduction, and organ response (Kumar et al., 2008). The detailed
mechanisms of gravity perception have been unveiled mostly in vascular plants.
In Arabidopsis thaliana (L.) Heynh. amyloplast movement along the gravity
vector within gravity-sensing cells is the most likely trigger of a subsequent
gravitropic response (reviewed in Morita and Tasaka, 2004). In contrast, no data
are available to explain how Ceratopteris richardii gametophytes might sense
the direction of gravity. Amyloplasts would not seem to be involved in gravity
perception in C. richardii gametophytes because no starch-accumulating
amyloplasts were found in dark-grown gametophyte cells following I,-KI
staining (data not shown). This suggests the involvement of some other statolith
in triggering the gravitropic response in C. richardii gametophytes.

Edwards and Roux (1994) found that germinating spores of Ceratopteris
richardii could sense the direction of gravity because gravity directed the
nuclear migration in the germinating spores, as well as the initial direction of
growth of the primary rhizoid. They detected a calcium flux in the germinating
spores as the earliest gravity-directed event (Chatterjee et al. 2000), suggesting
that calcium channels and pumps may be involved in the primary gravity
perception mechanism in C. richardii spores. Recently, Salmi et al. (2011)
proposed that the gravity-directed calcium current is regulated primarily by
the activation of mechanosensitive calcium channels at the bottom of the
spore, based on data obtained from a silicon microfabricated sensor array.
Thus, the nuclear migration and the following calcium flux might be important
in the gravity perception mechanism in C. richardii gametophytes.

As shown in Figure 3, the white-light irradiation that is required to induce
spore germination weakened the negative gravitropism in her1 gametophytes,
indicating that light irradiation on spores influences the later negative
gravitropism of dark-grown gametophytes. In fact, the dark-grown gameto-
phytes with the dkg1 mutant allele showed distinct negative gravitropism as
compared with the gametophytes without the dkg1 allele (Fig. 2). The dkg1
mutants were shown to be constitutively active in several photomorphogenic
responses mediated by phytochrome (a red and far-red light photoreceptor)
through the gametophytic phase (Kamachi et al., 2004), in addition to the dark-
germinating property. Considering these characteristics of the dkg1 mutants,
phytochrome may not be responsible for the inhibitory effect of white light on
subsequent negative gravitropism. In preliminary experiments, blue- and
green-light, but not red light, affected the inhibition of negative gravitropism
(Adachi and Kamachi, unpublished data).

The gravitropic growth-orientation of the seedlings of flowering plants is
also inhibited by light (Correll and Kiss, 2002). In contrast to C. richardii
gametophytes, however, phytochrome is responsible for the inhibition of
gravitropism in Arabidopsis thaliana (Poppe et al. 1996; Lariguet and
Fankhauser, 2004), where phytochrome is found to promote the conversion
of amyloplasts to other forms of plastids in the endodermis, causing cessation

152 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

of hypocotyl gravitropism (Kim et al., 2011). Thus, the mechanisms involved
in the light-induced inhibition of negative gravitropism in C. richardii
gametophytes are likely to be different than those operating in A. thaliana
seedlings. Further analyses are required to determine how the negative
gravitropism of the gametophytes is inhibited by light and to identify the
gravity-sensing mechanisms of C. richardii gametophytes.

ACKNOWLEDGMENTS

art of this research was supported by Grants-in-Aid for Scientific Research, MEXT
(No. 21657011).

LITERATURE CITED

Banks, J. A. 1994. Sex-determining genes in the homosporous fern Ceratopteris. Development

120:1949-1958.
Banks, J. A. es Gametophyte development in ferns. Annu. Rev. Plant Physiol. Plant Mol. Biol.
50:163

Braun, M. and . Limsacu. 2006. Rhizoids and protonemata of characean ms pe cells for
research on polarized growth and plant gravity sensing. Protoplasma 229:133-

Cuatterjee, A., D. M. Porrerriep, P. S. Smrrx and S. J. Roux. 2000. Gravity- directed aa current
in gp bps: spores of itr sttices richardii. Planta 210:607-610

Cooke, T. J., L. G. Hickox, W. J. VAN Der Woune, J. A. Banks and R. J. Scott. 1993. Photobiological
characterization of a spore eae ination mutant dkgi with — photoregulation in the
fern ses Sagi Photochem. Photobiol. 57:1032-1041.

Corre, M. J. and J. Z. Kiss. 2002. Interactions between pnt and phototropism in plants. J.
Plant Growth Regal as

Epwarps, E. S. and S. J. Roux. 1994. coon? oe of graviresponsiveness in germinating spores of
Ceratopteris richardii. Plant 195:1

Epwarps, E. S. and S. J. Roux. 1998. betes . peavity and light on the developmental polarity of
Ceratopteris seine fare spores. Planta 205:553-560

Hickok, L. G., T. R. Warne and R. S. Friourc. 1995. et bislopy of the fern Ceratopteris and its use
as a model system. be J. Plant Sci. 156:332-

Hoson, T., S. Matsumoto, K. Soca and K. WaKABAYASHI. os Cortical microtubules are responsible
for gravity resistance in plants. Plant Signal. and Behav. 5:752-754.

Kamacui, H., E. Matsunaca, M. Nocucui and H. Inoug. 2004. Novel mutant phenotypes of a dark-
germinating mutant dkg?/ in the fern Ceratopteris oot J. Plant Res. 117:163-170.

Kamacut, H., O. Iwasawa, L. G. Hickox, M. Nakayama, M. Nocucui and H. INoug. 2007. The effects of
light on sex determination in gametophytes of the fern catige k richardii. J. Plant Res.
120:629-634.

Kw, K., J. Sun, S.-H , H.-S. Kweon, J. N. Matoor and G. Cxor. 2011. Phytochromes inhibit
hypocotyl sce gravitropisan “by regulating the development of endodermal amyloplasts
through phytochrome-interacting ae Proc Natl. Acad. Sci. USA 108:1729-1734.

Kumar, N. S., M. H. H. Stevens and J. Z . 2008. Plastid movement in statocytes of the arg1
(altered response to gravity) mutant. ie J. Bot. 95:177-184,

LariGuET, P. and C. Fa eh ngs sielades Mtoe growth orientation in blue light is determined by
phytochrome A inh nd phototropin promotion of phtotropism. Plant J.
40:826-834.

Martin, A., L. DanteL, S. T. Hanke, S. J. X. MUELLER, E. SARNIGHAUSEN, M. VERVLIET-SCHEEBAUM and R
Reski. 2009. Targeted gene knockouts reveal overlapping functions of the five Physcomitrella
patens FtsZ isoforms in chloroplast division, eae ad shaping, cell patterning, plant
development, and gravity sensing. Mol. Plant 2:1359-13

KAMACHI & NOGUCHI: GRAVITROPISM OF DARK-GROWN GAMETOPHYTES 153

Morita, 8 7 and M. Tasaxa. 2004. Gravity sensing and signaling. Curr. Opin. Plant Biol.

718.
Momose, os 1967. Prothallia of My oot! pe (Filicales). University of Tokyo Press, Tokyo.

Murata, T., A. Kapota and M. W 1997. Effects of blue light on cell elongation and microtubule
orientation in deceit: ee of Ceratopteris richardii. Plant Cell Physiol.
38:201—209.

Murata, T. and M. Sucal. 2000. Photoregulation of asymmetric cell division onto by rhizoid
development in the fern Ceratopteris prothalli. Plant Cell Physiol. 41:1313-1320

Poppe, C., R. P. HANGARTER, R. A. SHARROCK, F. Nacy and E. Scuarer. 1996. ee light-inditeed
reduction of the gravitropic growth-orientation of seedlings of Arabidopsis thaliana (L.)
Heynh. is a photomorphogenic response mediated synergistically by the far-red-absorbing
forms of phytochromes A and B. Planta 199:511-514.

Racuavan, V. 1989. Developmental biology of fern gametophytes. Cambridge University Press,

mbridge.

Sati, M. L., T. J. Busouart, S. C. Stout and S. J. Roux. 2005. Profile and analysis of gene expression
changes during nes Sra in germinating spores of Ceratopteris richardii. Plant
Physiol. 138:1734—

SALMI, M. L., A. HAQUE, ey if pane S. C. Stout, S. J. Roux and D. M. PorrterFiELD. 2011. Changes in
gravity ae alter the magnitude and direction of a cellular calcium current. Planta
eS Eeehis

Scott, R. J. a L.G. Hickox. 1991. Inheritance and characterization of a dark-germinating, light-
aa mutant in the fern Ceratopteris richardii. Can. J. Bot. 69:2616—2619.

American Fern Journal 102(2):154—-160 (2012)

Antimicrobial and Modulatory Activity of Ethanol
Extract of the Leaves from Lygodium venustum SW.

Maria F. B. Morats-Braca*, TEGGENES M. Souza, KarLa K. A. SANTOS, JACQUELINE
C. ANDRADE, GLAucIA M. M. Guepes, SAuLo R. TinTINO, CELESTINA E. SoBRAL-SOUZA,
Jost G. M. Costa, IRwin R. A. Menezes, ANTONIO A. F. SaraIva,
and Henrique D. M. CoutiInHo
Universidade Regional do Cariri - URCA, Crato-CE, Brasil. Rua Cel. Antonio Luis 1161,
Pimenta, 63105-000

Asstract.—The evolution of microorganism defense systems has led to int
drugs extracted from various natural products to fight microbial infections. This staidy coals
the antibacterial and antifungal activity of Lygodium venustum, a climbing fern. A phytochemical

Candida albicans, C. krusei and C. tropicalis was evaluated using the microdilution method,
resulting in inhibitory concentrations = 1024 yg/mL. Using a subinhibitory concentration of

clinical isolates, resulting in synergism when combined with Gentamicin and actually altering the
phenotype of S. aureus from sensitive to resistant. The extract also increased the effect of the

amycin against S. aureus. This was the first report of modulatory antibiotic activity by a
member of Lygodium.

Key Worps.—Lygodium venustum, microdilution, antimicrobial, modulator

Microbial infectious diseases have prompted the development of studies to
understand their drug resistance mechanisms and the creation of drugs to
avoid these defenses. Infection by Staphylococcus aureus is among the most
common problems in hospitals due to its resistance against several antibiotics.

intestinal tract, but certain strains have been closely linked to serious urinary
tract infections and diarrhea (Tortora et al., 2008). Klebsiella pneumonia,
although confined to the normal flora, has emerged as an important hospital
pathogen capable of causing severe morbidity and mortality in pediatric
patients (Pfaller et al., 1998). Strains of Candida have concerned the medical
community due to their role in high-morbidity and mortality infections,

“Corresponding author: Laboratério de apenas e Biologia Molecular, Departamento de
Quimica Biolégica, Universidade Regional do C — URCA, Crato-CE, Brasil. Rua Cel. Antonio
Luis 1161, Pimenta, 63105-000. Phone: pete Fax +55(88) 31021291. E-mail:
flavianamoraisb@yahoo.com.br

MORAIS-BRAGA ET AL.: ANTIMICROBIAL ACTIVITY OF LYGODIUM VENUSTUM 155

particularly in immunocompromised patients (Richardson and Lass-Florl,
2008; Coutinho, 2009).

Through natural selection plants have developed several mechanisms
against parasitism and herbivory. The production of defensive chemical
compounds, such as secondary metabolites, indicates evolutionary adaptive
responses from the pressure caused by these ecological relationships (Rhodes,
1994). Products derived from plants that feature antimicrobial properties or the
ability to improve the antimicrobial potential of existing drugs play an
important role in battling infectious diseases (Coutinho et al., 2009). They can
serve as alternative therapeutic agents with the ability to directly counter
natural microbial resistance to drugs.

Lygodium venustum is a fern with a pantropical distribution used as a
bioindicator of degraded environments (Mehltreter, 2006). This fern is used as
a medicinal plant in Latin America due to its antifungal, trichomonacidal,
antidiarrheal, anti-inflammatory and analgesic activity (Duke and Ottesen,
2009; Argueta et al., 1994). It is used in the Peruvian Amazon as an adaptogen
and as an ingredient of the sacred beverage “‘ayahuasca” (Rivier and Lidgren,
1972). Few studies have reported on the bioactivity of L. venustum in
aeeaea studies (Alanis et al., 2005; Calzada et al., 2007; Calzada et al.,

2010), as is true in others ferns (Xavier, 2007).

In this work, a phytochemical screening was performed on the ethanol extract
from leaves of L. venustum; its antimicrobial activity was assayed against
bacterial and fungal strains, as well the modulatory potential against
aminoglycosides and antifungal drugs.

MATERIAL AND METHODS
Plant Material

Leaves of L. venustum were collected in the city of Crato, Ceara, Brazil. The
plant was identified by Dr. Antonio Alamo Feitosa Saraiva and voucher
specimens were Seeanied at the Herbarium Caririense Dardano de Andrade-
Lima of the Regional University of Cariri— URCA, under number 5569 HCDAL.

Preparation of Ethanol Extract from Leaves of L. venustum (EELV)

The leaves were partially milled and 211.18 g of powdered material was
extracted by maceration using 1 L of 95% ethanol as solvent at room
temperature. The mixture was allowed to stand for 72 h at room nepecasaesrats
The extract was then filtered and concentrated under vacu in a rotary
evaporator at 60°C and 760 mm/Hg, yielding 103.9 g Brasileiro . al., 2006).

Phytochemical characteristics

The phytochemical assays were used for the qualitative analysis of the
presence of secondary metabolites. The detection tests to evaluate the presence

156 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

TaBLE 1. Bacterial source and antibiotic resistance profile.

Bacteria Source Antibiotic resistance
Escherichia coli 27 Surgical wound Ast, Ax, Ami, Amox, Ca, Cfc, Cf, Caz,
Cip, Clo, Im, Can, Szt, Tet, Tob
Staphhylococcus aureus 358 Surgical wound Oxa, Gen, Tob, Ami, Can, Neo, Para,
But, Sis, Net
Pseudomonas Aeruginosa 03 Urine culture Cpm, Ctz, Imi, Cip, Ptz, Lev, Mer, Ami

Ast-Aztreonam; Ax-Amoxacillin; Amp-Ampicillin; Ami-Amicilina; Amox-Amoxillin, Ca-Cefa-
droxil; Cfc-cefaclor; Cf-Cephalothin; Caz-Ceftazinidima; Cip-Ciprofloxacin; Clo-ChlorampKenicol;
Imi-Imipenem; Can-Canamycin; Szt-Sulfametrim; Tet-Tetracycline; Tob-Tobramycin; Oxa-Oxacil-
lin; Gen-Gentamicin; Neo- Neomycin; Para- Paramomicina; But-Butirosina; Sis-Sisomicin; Net-
cme Com-Cefepime; Ctz- Ceftazidime; Ptz-Piperacilina-tazobactam; Lev-Levofloxacina; Mer-
Merpen

of heterosides, saponins, phenols, tannins, flavonoids, steroids, triterpenes,
coumarins, quinones, organic acids and alkaloids were performed according to
the method described by Matos (2009). The tests are based on the visual
observation of color modifications and formation of precipitate after the
addition of specific reagents.

Microbial strains

The bacteria used in the Minimal Inhibitory Concentration (MIC) test were the
standard strains of E. coli ATCC25923, S. aureus ATCC10536, P. aeruginosa
ATCC15442 and K. pneumonia ATCC4362. The antifungal assays used standard
strains of Candida albicans ATCC40006, C. krusei ATCC2538 and C. tropicalis
ATCC40042. To evaluate the modulatory activity of the extract, the following
multi-resistant bacterial strains were used, isolated from clinical environments:
P. aeruginosa 03, E. coli 27 and S. aureus 358, with the resistance profile
demonstrated in Table 1 and the same fungal strains used in the MIC test. All
strains were obtained from the Laboratory of Clinical Mycology — UFPB.

Drugs

The drugs used in the tests were the aminoglycosides kanamycin, amikacin,
neomycin and gentamicin, and antifungals mebendazole, amphotericin B,
nystatin and benzoyl metronidazole (Sigma Co., St. Louis, USA). All drugs
were diluted in sterile water.

Minimal Inhibitory Concentration

Broth microdilution was the method used. The EELV solution was dissolved
using DMSO and diluted to 1024 ug/mL using sterile distilled water. The
bacterial inoculum was diluted using BHI to a final concentration of 10° CFU/
mL. A total of 100 uL of each inoculum was distributed in each well of a
microtiter plate with 96 wells, and then submitted to a twofold serial dilution

MORAIS-BRAGA ET AL.: ANTIMICROBIAL ACTIVITY OF LYGODIUM VENUSTUM 457.

TaBLeE 2. Phytochemical characterization of ethanol extracts of L. venustum.

Metabolites
1 Z a 4 5 6 if 8 9 10 11 42 a3 14 15
+ + — — + + + + — + - _- + +

1 — Phenols; 2 — Tannin pyrogallates; 3 - Tannin Phlobaphenes; 4 — Anthocyanidins; 5 —
Anthocyanins; 6 — Flavones; 7 — flavonols; 8 — Xanthones; 9 — Chalcones; 10 — Aurones; 11 —
Flavononls; 12 — Leucoanthocyanidins; 13 — Catechins; 14 — Flavonones; 15 — Alkaloids: (+)
presence; (—) absence.

using 100 uL of the extract, with concentrations ranging between 8 and 512
ug/mL. The plates were incubated for 24 hours at 35 °C (Javadpour et al., 1996).
Bacterial MIC was determined using resazurin, while the MIC of fungi was
determined by turbidity. The MIC was defined as the lowest concentration
where no growth can be observed, according to NCCLS (2008).

Drug Modulation Test

To observe whether the extract would alter the action of antimicrobial drugs
against the tested strain, the method proposed by Coutinho et al. (2008) was
used. The EELV was tested at a sub-inhibitory concentration (MIC/8 = 128
ug/mL). A 100 wL sample of a solution containing BHI, the microbial
inoculums and extract were placed in each well. After this, 100 uL of the
antimicrobial drug was mixed with the first well, following the twofold
dilution. Concentrations of aminoglycosides and antifungals ranged between
2.44 and 2500 ywg/mL and 2 to 512 ug/mL, respectively.

RESULTS

The phytochemical characterization showed the presence of phenols,
tannins, flavonoids and alkaloids, as shown in Table 2.

The antibacterial and antifungal assays of EELV did not demonstrate
clinically relevant results, with MICs =1024 ug/mL. However, when the
modifying activity of EELV against aminoglycosides was evaluated, the Gram-
negative E. coli 27 and Gram-positive S. aureus 358 strains showed synergistic
activity when combined with gentamicin and kanamycin (Table 3). The
combination of the extract with antifungals did not show any modulatory
activity against strains of Candida.

DIscUusSION

Several plants used in the religious beverage ‘‘ayahuasca’’, such as L.
venustum, contain alkaloids (Rivier and Lidgren, 1972). This fact is
corroborated by the results of our phytochemical screening. Other species
from the genus Lygodium have been the subjects of more detailed chemical
studies, including the isolation of some compounds (Zhang et al., 2005;

158 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

TaBLE 3. Antibacterial activity modulating the ethanol extract from leaves of L. venustum (ug/mL).

Modulation of antibiotic for EELV

E. coli 27 S. aureus 358
Extract/ Antibiotic MIC combined MIC alone MIC combined MIC alone
EELV/ Kanamycin 156.25 156.25 39.06 156.25
EELV/ Amikacin 312.5 312.5 78.125 78.125
EELV/ Neomycin 150.25 156.25 39.06 39.06
EELV/ Gentamicin 39.06 1250 2.44 19.53

MIC: Minimal Inhibitory Concentration; EELV: Ethanol Extract of L. venustum.

Kurumatani et al., 2001; Achari et al., 1986). However, this is the first work to
focus on the chemical composition of L. venustum.

The lack of the antibiotic activity of L. venustum against strains of E. coli was
verified in another report (Alanis et al., 2005). The results demonstrate that the
extracts were not efficient inhibitors of bacterial growth, as their inhibition
percentages were lower than 50%. A relevant note regarding this research is
the value of the extract concentration used in the test, 8 mg, which is
considered high for clinical applications (Houghton et al., 2007), as
demonstrated in our work. Additionally, it is important to note that the
microdilution method used in present study is currently the preferred
technique to evaluate antimicrobial activity, compared to other methodologies
using agar diffusion (Greger and Hadacek, 2000).

The methanol extracts of other plants from the genus Lygodium such as
Lygodium japonicum (Thumb.) SW. was tested against strains of P. aeruginosa,
S. aureus, E. coliand C. albicans using the disk diffusion method, impregnated
with 40 ug of dried plant material/disk, but no bioactivity was demonstrated
(Taylor et al., 1995). Our results corroborate those obtained in this work by
Taylor et al. (1995).

Compared with the isolated action of drugs, EELV increased the antibiotic
activity of amikacin against S. aureus. When associated with gentamicin, it
demonstrated a very promising modulatory activity against E. coli an
aureus, causing a reversal of the resistant phenotype of this strain to sensitive
according to the classification of NCCLS (2005). The observed bioactivity of
the extract in combination with the antibiotics may indicate that secondary
metabolites such as tannins, flavonoids and alkaloids —all secondary
metabolites with well-known antimicrobial activity and found in the EELV—
could be acting in association with the assayed drugs, enhancing the activity of
these drugs at lower concentrations (Scalbert 1991; Bylka et al., 2004; Zongo
et al., 2009).

This is the first report on the modulatory activity against aminoglycosides by
a fern. This activity indicates the possibility of development of new drugs
derived from the association between natural products isolated from L.
venustum with antibiotics, to be used in antibiotic therapy against multi-drug
resistant bacteria, as well as prevent the emergence of drug resistant bacteria.

MORAIS-BRAGA ET AL.: ANTIMICROBIAL ACTIVITY OF LYGODIUM VENUSTUM 159

LITERATURE CITED

Acuakrl, B., K. Basu, C. R. Sana and S. C. Pakrasut. 1986. A New Triterpene Ester, an Anthraquinone
d Other Constituents of the Fern Lygodium flexuosum. Plant Med 52:329-30
Auanis, A. D., F. Catzapa, J. A. CERVANTES and G. M. Cesa.tos. 2005. Antibacterial properties
plants used in Mexican traditional — for the treatment of Scoiteat disorders.
Journal of pang ade 100:153-—157.

Arcueta, A., L. Cano and M. Rop gon Atlas de las Plantas de la Medicina Tradicional

exicana, vol. Lit Instituto ped Indigenista, Mexico City.

BrasiLeiro, B. G., V. R. Przzioto, D. S. Rastan, C. M. Jama and D. Siverra. 2006. Antimicrobial and
cytotoxic activities screening of some ee medicinal plants used in Governador
Valadares district. Braz. J. Pharm. Sci. 42:195—202.

Byxa, W., I. MatLawska and N. A. aie fore Natural flavonoids as antimicrobial agents. JANA

Cauzapa, F., Y. M. Litian and A. T. Contreras. 2007. Effect of Mexican medicinal plant used to treat
trichomoniasis on Trichomonas vaginalis trophozoites. Journal of Ethnopharmacology
113:248—25

Cauzapa, F., R. Arista and H. Pérez. 2010. Effect of plants used in Mexico to treat gastrointestinal
disorders on charcoal - gum acacia - induced hyperperistalsis in rats. Journal of Ethnophar-
macology 128:49-51.

mauler a a M. 2009. Factors Influencing the Virulence of Candida Spp. West Indian Med J

ean a . M., J. G. M. Costa, E. O. Lima, V. S. FatcAo-Sitva and J. P. Siquerra-JUNIoR. 2008.
Enhancement of the Antibiotic phe against a sip Escherichia coli by Mentha
arvensis L. and Chl ev ne. otherapy 5 0

saciid H. ‘D. M., J. G. M. Costa, E. ‘A, Va Se ceniins and J. P. Siquerra-JGNior. 2009.

f the Aminogli d Aer Activity Against a — -Resistant E. coli by
Turnera a ulmifolia L. and Chlorpromazine. Biol Res. Nurs 11:33
Duke, — Duke’s Handbook of Medicinal Plants of Latin poe 2008. New York: CRC
Tess bonita & Francis group. 832 he

nai H. and F. Hapacex. 2000. Testing of arttifungal natural products: —
ei renee of results and assay choice. Phytochemical Analysis 11:137—1

caeee P. J., M. J. Howes, C. C. Lez and G. Srevenron. 2007. Uses and abuses on in pens tests in

opharmacology: Visualising an pegoat : Leyes ecuae 110:391—400.

ee M. M., M. M. Jusan, W. C. Lo, S. M. BisxHop, J. B. ALBerTy, S. M. Cowes i, C. L. Becker and

M. L. McLaucuLin. 1996. De novo aia peptides with low mammalian cell toxicity.
Med Chem 39:107-3113.

Kurumatant, M., K. Yaci, T. Murata, M. Tezuka, L. N. MANperR, M. NisuryAMA and H. Yama. 2001.
Isolation and identification of antheridiogens in the ferns, Lygodium microphyllum and
Lygodium rowspeulear Biosci Biotechnol Biochem 65(10):2311—-4.

Matos, F. J. A. 2009. Introdugao a fitoquimica experimental. 3 ed. Fortaleza. Editora: UFC.
HLTRETER, K, a6 Leaf Phenology of the Climbing Fern Lygodium venustum in a Semideciduous
Lowland Forest on the Gulf of Mexico. American Fern Journal 96(1):21—30

NCCLS. 2005. National Comitte for Clinical Laboratory Standards. Methods for dilution
antimi caine susceptibility tests for bacteria that grow aerobically: Approved standar
ed. NCCLS document M7-A6. Wayne: National Committee for Clinical Laboratory Standards.

PFALLER, A. 7 R. N. Jones, G. V. Doern and K. Kuc.er. 1998. Bacterial pathogens isolated from
patients with bloodstream opetiaei frequencies of occurrence and antimicrobial suscepti-
bility patterns from the SENTRY antimicrobial bangs program (United States and
Canada, 1997). Antimicrob Agent Chemother 42:1762-70.

Ruopes, M. J. C. 1994. Ph econdary seh in plants: from progress, many
outstanding problems. Plant Mol. Biol 24: 1-20.

CHARDSON, M. and C. Lass-Fiori. 2008. a epidemiology of systemic fungal infections.
Clinical Microbiology and Infection 14:5—24

2
Ee

160 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

Rivier, L. and J. E. Lincren. 1972. ““Ayahuasca: the South American pe. ise drink. An
ethnobotanical and chemical investigation”. Economic Botany 26(2):1
ScALBERT, A. 1991. Antimicrobial properties of gece niet ianiege | 30: 387 a

TAYLor, R. S., N. P. MANANDHAR and G. H. N. Towers. 1 medicinal plants of
Nepal for antimicrobial activities. apices of Set eaes ot 46:153-159.
Tortora, G. J., B. R. Funke and C. L. Case. 2008. Microbiologia, 8° ed. Porto Alegre, A

XAVIER, S. R. S. 2007. Pterid6fitas da Sains: Lista anotada, Andlise da Composigao Floristica ©
Padrées de Distribuigaéo Geografica. Tese (Doutorado em Botanica) - Universidade Federal
Rural de hip tesla Recife. 147

ZHANG, L. H., Z. Q. Yin, W. C. Ye, S. X. ZHao, L. Wanc and F. Hu. 2002. Studies on the chemical
constituents in herb of fal gan japonicum. ase Zhong Yao Za Zhi 30(19):1522-4.

ZONGO, . F. O. Axomo, A. Savapoco, L. C. Osame, J. Koupou and A. S. Traore. 2009. In vitro
antibacterial properties of total alkaloids extract cous Mitragyna inermis idan ) O. Kuntze, a
West African traditional medicinal plant. Asian J. Plant Sci. 8:172—17

American Fern Journal 102(2):161—166 (2012)

A New Species and a New Hybrid in the Grammitid
Fern Genus Stenogrammitis (Polypodiaceae)

PauLo H. Lasiak
Universidade Federal do Paranda, Departamento de Botanica, Caixa Postal 19031,
531-980, Curitiba-PR, Brazil, e-mail: plabiak@ufpr.br

—A new species and a new hybrid in the genus Stenogrammitis are here described, and
iecceptcak illustrations, and comments on the most similar species are provided. Stenogrammi-
tis brevipubens is characterized by having hemidimorphic laminae, with the fertile portion
narrower and less dissected than the sterile portion, and by its indument, which is composed of

and 3-celled hairs that are spreading on the petiole and lamina. Based on the hybrid morphology,
the putative parents are S. prionodes and S. limula.

Key Worps.—diversity, Guatemala, hybridization, Panama

Stenogrammitis Labiak is a pantropical genus recently segregated from
Lellingeria. It comprises about 25 species, of which 12 are currently known
from the Neotropics, six species from the continental Africa, four from
Madagascar, and three that occur in some Islands of the Atlantic and Pacific
Oceans (Labiak, 2011). The genus is characterized by its small size and narrow
laminae (fronds generally less than 10 cm long and 0.5 cm wide), clathrate and
iridescent rhizome scales that are glabrous throughout or with only one apical
cilium, laminae with only one sorus per segment, and fertile veins that present
the sclerenchyma visible beneath the sporangia.

Phylogenetic studies (Labiak et al., 2010; Ranker et al., 2010) showed that
Stenogrammitis is most closely related to Lellingeria A. R. Sm. & R. C. Moran
and Melpomene A. R. Sm. & R. C. Moran. Lellingeria differs by having broader
laminae (usually more than 1 cm wide), rhizome scales that are usually ciliate,
multiple sori per segment (except for L. militaris that has one), and fertile veins
not visible beneath the sporangia (Labiak, 2011). Melpomene differs by pre-
senting reddish setae on the fronds and also by rhizome scales with papillate
apex (Lehnert, 2008; Labiak, 2011).

While studying the Neotropical species of Stenogrammitis | found a new
species and a new hybrid that deserve recognition, which I describe as follow.

Stenogrammitis brevipubens Labiak, sp. nov. TYPE.—Panama. Prov. de
Panama: Cerro Jefe, cabecera del Rio San Cristobal, 900 m, 27 Dec 1986, I.
Valdespino et al. 268 (holotype: US; isotype PMA). Fig. 1. A-E

Species Stenogrammitidi myosuroidi similaris, sed pilis brevibus, indivisis
(vs. furcatis), hyalinis (vs. subrubris) differt.

AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

2 Grneiro. 204

Fic. 1. A-E. Stenogrammitis brevipubens (all from the holotype). A. Habit. B. Detail showing the
hemidimorphic lamina. C. Detail of the segments from the sterile portion. D. Detail showing the
hairs on the abaxial surface. E. Rhizome scale. F-K. Stenogrammitis < guatemalensis (all from the
holotype). F. Habit. G. Detail of the segments. H. Petioles showing the hairs. I. Detail of the fertile
portion of the lamina. J. Furcate hair from the laminar tissue. K. Rhizome scale.

LABIAK: A NEW SPECIES AND A NEW HYBRID IN STENOGRAMMITIS 163

Plants epipetric; rhizome short creeping, radially symmetrical, scaly, the
scales lanceolate, castaneous, clathrate, 1.5-2 mm long, glabrous or with a
single apical cell, the cells in the medial portion isodiametric to elongate (two
or three times longer than wide); petiole 0.5-1 cm X 0.3 mm, dark brown,
slightly pubescent, the hairs hyaline, soft, straight, 2-celled, simple, appressed;
lamina 2-5 cm long, erect or slightly arcuate, linear, chartaceous, hemi-
dimorphic; sterile portion deeply pinnatisect, abruptly reduced at the base, the
basal segment decurrent, but not ending in a long and narrow wing to the
petiole base, the segments at the medial portion 1.8—2 X 0.5—0.7 mm, linear, set
at 70-80° to the rachis, symmetrical or slightly asymmetrical at the base, the
apex acute to obtuse, laminar tissue and veins slightly pubescent on both
sides, the hairs hyaline, 1 or 2-celled, simple, appressed, margin glabrous;
fertile portion slightly crenulate, cut ca. 1/5 the way to the rachises, equal to or
shorter than the sterile portion; rachis with dark sclerenchyma exposed
abaxially, covered by the laminar tissue adaxially, flexuous, pubescent, the
hairs hyaline, soft, 0.1 mm long, 2-celled, simple, appressed; sinuses as broad
as the width of the segments; veins simple, not visible in the sterile portion,
the dark sclerenchyma slightly exposed in the fertile portion beneath the
sporangia, adaxially with linear, well-marked hydathodes; sori inframedial,
rounded to oblong, indistinct, confluent when mature, extending beyond the
bases of the sinuses and the rachis, slightly sunken, leaving an impression on
the laminar upper surface; sporangia glabrous; spores green, trilete.

ErymMoLocy.—The specific epithet “‘brevipubens” refers to the short hairs that
are present on the petiole, rachis, and laminar tissue, which are the main
character that helps to distinguish this species from its congeners.

DIsTRIBUTION.—Stenogrammitis brevipubens is known by a single collection
from Panama.

Stenogrammitis brevipubens is characterized by having a hemidimorphic
lamina, flexuous rachis, and hyaline, simple, soft, straight, 1 or 2-celled, and
appressed hairs present on the petiole, rachis and laminar tissue. Among the
species with hemidimorphic lamina S. myosuroides (Sw.) Labiak and S.
jamesonii (Hook.) Labiak are the most similar species, which can be
distinguished by having straight (or only slightly flexuous) rachis and red-
dish, furcate, 3-4-celled, spreading hairs. Furthermore, S. brevipubens is an
epipetric species, whereas S. myosuroides and S. jamesonii are usually
epiphytes

Another Neotropical species that also present simple and hyaline hairs on
the petiole and rachis is S. pumila (Labiak) Labiak, from southeastern Brazil. It
differs from S. brevipubens by its monomorphic lamina.

CoNsERVATION STaTuS.—This species is currently known by a single collection,
but with several individuals present in the type collection. This suggests that it
might have a very narrow distribution but may form a dense population on the
rocks of Cerro Jefe. Therefore, according to IUCN Red List Criteria (IUCN,
2001), it is assessed here as Data Deficient (DD).

164 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

Stenogrammitis <guatemalensis Labiak, hybrid nov. TYPE.—Guarema.a.
Depto. Alta Verapaz: Mun. Cobén Chicu’sha’b, 8 km al SW de Coban,
15°26'N, 90°27’W, 22 Jul. 1988, P. Tenorio et al. 14729 (holotype: MO).
Fig. 1. F-K

Hybrida inculta e Stenogrammitide prionode et S. limula genita. Plantae
epiphyticae; rhizoma erectum, paleis brunneis, iridescentibus. Frondes fasci-
culatae; petioli setis brevibus, furcatis vestiti; laminae pro partibus sterilibus
pinnatisectae; segmenta deltata vel deltato-linearia, nervis indivisis; sori
lineares, impressi.

Plants epiphytic; rhizome erect, radial, scaly, the scales lanceolate, dark
brown, iridescent, clathrate, 1-1.4 mm long, glabrous or with a single and
furcate cilium at the apex, the cells in the medial portion isodiametric; petiole
0.5-1.5 cm X 0.3 mm, dark brown, slightly pubescent, the hairs spreading,
reddish, rigid, straight, 3-celled, 1-furcate; lamina 10-15 cm long, arcuate,
linear, chartaceous, slightly hemidimorphic; sterile portion deeply pinnatifid
to pinnatisect, gradually reduced at the base, basal segment long-decurrent,
ending in a long and narrow wing to the petiole base, the segments at the
medial portion 1.5-2 X 1-1.5 mm, deltate to linear-deltate, set at 70—-80° to the
rachis, symmetrical to slightly asymmetrical at the base, the apex obtuse,
laminar tissue, veins, and margins glabrous; fertile portion pinnatifid, cut ca.
1/3 the way to the rachises, about as long as the sterile portion, the segments
deltate, obtuse; rachis on both sides with dark sclerenchyma exposed,
pubescent, the hairs spreading, reddish, rigid and straight, 1-furcate,ca.
0.2 mm long; sinuses equal to or broader than the width of the segments;
veins simple, not visible in the sterile portion, but with the dark sclerenchyma
exposed in the fertile portion beneath the sporangia, adaxially with linear,
well-marked hydathodes; sori inframedial, linear, distinct, not extending
beyond the bases of the sinuses and the rachis, sunken, leaving an impression
on the laminar upper surface; sporangia not well formed; spores not seen.

ErymMoLocy.—The epithet “‘guatemalensis” refers to the type locality where the
hybrid was found: Guatemala.

DisTRIBUTION.—Stenogrammitis <guatemalensis is known only from the type
collection from Guatemala.

Stenogrammitis Xguatemalensis is known by a single collection, which
suggests a sporadic event of hybridization. Based on its intermediate
morphology, the most probable parents are Stenogrammitis limula (H. Christ)
Labiak and S. prionodes (Mickel & Beitel) Labiak, two of the commonest
species of Stenogrammitis in Guatemala.

With S. limula it shares reddish, rigid, straight and 1-furcate hairs on the
petiole and rachis, rhizome scales with isodiametric cells, and also linear and
sunken sori that leave an impression on the adaxial surface of the lamina. It
differs from S. limula by its slightly hemidimorphic lamina (vs. monomor-
phic), and longer rhizome scales (1—1.4 vs. 0.8—1.2), characters that are shared
with S. prionodes.

LABIAK: A NEW SPECIES AND A NEW HYBRID IN STENOGRAMMITIS 165

Comparison of the main characters that distinguish the sp f Stenog |
to etn and the hybrid.
Leaf Rhizome scales Cells of the
dimorphism length rhizome scales Sori
S. limula monomorphic 0.8-1.2 mm ___isodiametric sy me sunken,
S. prionodes hemidimorphic 2-3 mm elongate roundish rand superficial,
S. jamesonii hemidimorphic 1.5-2 mm isodiametric to saat at maturity,
elongate indistinct
x slightly isodiametric linear and sunken,
guatemalensis hemidimorphic 1-1.4mm to elongate distinct

Other than Stenogrammitis limula and S. prionodes, the only other species
of Stenogrammitis known to Guatemala is S. jamesonii (Hook.) Labiak. Like S.
prionodes, it also has a hemidimorphic lamina, and reddish and furcate hairs
on the petiole and rachis. However, its fertile portion is shallowly crenulate,
and the sori are conspicuously confluent when mature—characteristics that
are not present in the hybrid. A summary of characters useful for distin-
guishing the species and hybrid of Stenogrammitis known from Guatemala is
presented in Table 1.

Although hybridization is a common event among some groups of terrestrial
ferns (e.g., Anemia, Blechnum, and Dryopteris), it seems to be very rare and
occasional among epiphytic plants (Gémez, 1985). Records of hybrids among
the Grammitid ferns are scarce in the literature and, as far as I know, only four
cases have been reported so far (Parris, 1977; Parris, 1984; Labiak and Matos
2007; Christenhusz, 2009). Therefore, because it is an uncommon event among
the Grammitid ferns, I consider it worthwhile to recognize this hybrid, even
though it is represented by only a few individuals.

ACKNOWLEDGMENTS

This study was funded by a grant from the CNPq—Brazil (CNPq Proc. n° 301997/2010-1). I thank
The New York Botanical Garden for providing herbarium and laboratory facilities, as well as the
Curators of the seg: herbaria for loans: AAU, B, BM, BR, F, FR, GH, K, MAPR, MICH, MO, NY,
P, PMA, S, SP, U, UC, US, and WU. I also thank Robbin Moran, John Mickel, Alejandra Vasco, and
Michael Sundue for their help during my visit to NY. Diana Carneiro prepared the line drawings.

LITERATURE CITED

mug iene M. 2009. Index Pteridophytorum Guadalupensium or a revised checklist to the ferns
club mosses of Guadeloupe (French West Indies). Botanical Journal of the Linnean
mig 161:213—-277
GOmEz, L. D. 1985. Kealigy of some ori ore hybrid pteridophytes. Proceedings of the Royal
Society of Edinburgh 86B:347-3
IUCN. ne Red List Categories and a eria, Version 3.1. Prepared by the IUCN Species Survival
Commission, IUCN, Gland, Switzerland, and Cambridge, United Kingdom.

166 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

Lasiak, P. H. 2011. Stenogrammitis, a new genus of Grammitid Ferns segregated from Lellingeria
hid seb eanranie Saga 63:139-149.

Lasiak, P. H. and F. B. Matos. 2007. A new hybrid and two new combinations in neotropical
gram anmiti ferns: gil 59:182-185.

Lasiak, P. H., M. SunpuE and G. RouHaN. 2010. Molecular phylogeny, character evolution and
bogey of soe eguacne fern genus pr aan (Polypodiaceae). American Journal of
Botany 97:1354—

NERT, Me 2008. a: new species in the Grammitid fern genus Melpomene (Polypodiaceae).

American Fern Journal 98:214—250.

Parris, B. S. 1977. A naturally occurring intergeneric hybrid in Grammitidaceae (Filicales):
Ctenopteris heterophylla XGrammitis billardierei. New Zealand Journal of Botany

7597-59

Parris, B. S. 1984. Another intergeneric hybrid in Grammitidaceae: Ctenopteris longiceps
x Grammitis sumatrana. Fern Gazette 12:337-340.

Ranker, T. A., M. Sunpue, P. H. Lasiax, B. S. Parris and G. RounHan. a0n0. new insights into the
phylogeny and sao biogeography of the Lellingeria
[Internet]. Vers 48. PLoS Currents: Tree of ie. 2010 Nov 18 cured: 2010 How
22]:PMC298983

American Fern Journal 102(2):167—173 (2012)

Diplazium fimbriatum (Athyriaceae), a New Species
from Brazil

CLAUDINE M. MyNSSsEN
Instituto de Pesquisas Jardim Botanico do Rio de Janeiro, Rua Pacheco Leao 915, Rio de Janeiro,
RJ 22460-030, Brazil. e-mail: cmynssen@jbrj.gov.br
FERNANDO B. Matos
The New York Botanical Garden, 2900 Southern Blvd., Bronx, NY 10458, U.S.A.
-mail: fmatos@nybg.org

Asstract.—A new species, Diplazium fimbriatum (Athyriaceae), is described and illustrated. It is
endemic to the humid montane forests of eastern Brazil, a region known for its high level of
endemism and species richness. A comparative table to distinguish it from similar species of
Diplazium occurring in Brazil is provided.

Key Worps.—Athyrioid ferns, Atlantic Forest, Bahia, Espinhago Mountains, Minas Gerais,
taxonomy

The Athyriaceae comprises five genera and ca. 600 species (Christenhusz
et al., 2011; Rothfels et al., 2012), the majority of which were placed in
Woodsiaceae by Smith et al. (2006, 2008). Diplazium comprises approximately
400 species, with well over 100 in tropical America, where the highest diversity
is concentrated in the Andean and Guyanan regional centers (Tryon, 1972). The
present work is part of a revision of the genus Diplazium in Brazil, which has
indicated the occurrence of 22 species in the country, most of these being widely
distributed in the coastal Atlantic Forest (Mynssen et al., 2009), including eight
endemics (Mynssen, 2010). During this revision more than 30 localities were
visited, including the states of Bahia, Espirito Santo, Minas Gerais, Parana, and
Rio de Janeiro. Furthermore, specimens from 45 herbaria were examined,
including B, BM, BHCB, CEPEC, CESJ, HB, HBR, INPA, IPA, K, MBM, MBML,
MG, NY, OUP, P, R, RB, S, SP, SPF, UPCB, and US (Thiers, 2009).

The species of Diplazium are predominantly terrestrial, rarely epipetric, and
can be distinguished by the following characters: stems usually ascending to
erect, rarely long-creeping, bearing scales at the apex; scales usually non-
clathrate, brown to blackish-brown, margin entire or toothed; leaves monomor-
phic, rarely dimorphic; petioles with two crescent-shaped vascular bundles at
the base (in cross section), these uniting distally; lamina simple to 1—-4-pinnate-
pinnatifid, glabrous or pubescent; veins generally free (simple or furcated), or
anastomosing without included veinlets; sori elongate, elliptic to linear, borne
on both sides of the vein (diplazioid) or on only one side; indusia generally
present, rarely absent (among Brazilian species, indusia are absent, or nearly so,
only in D. lindbergii), paraphyses absent; spores ellipsoidal, monolete, with
wing-like folds, the surface smooth, reticulate or papillate to echinate between
the folds.

168 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

a eertte fimbriatum Mynssen & F. B. Matos, sp. nov. TYPE.—Brazit. Bahia:

macan, Serra Bonita, Fazenda Uiracu, trilha da Bapeba, 15°23'30"S,

an 33'55"W, 890 m, 22 Oct 2009, C. M. Mynssen & F. B. Matos 1167
(holotype: RB; isotypes: CEPEC, MO, NY, UC, UPCB). Figs. 1, 2.

Diplazium fimbriatum D. mutilo Kunze multis notis simile a quo margine
longo-fimbriato indusii et praesentia gemmarum in rachidi recedit. Diplazium
mutilum a D. fimbriato etiam margine integro vel dentato indusii sui et gemmis
in rachidi absentibus differt

EtymMoLocy.—From Latin “‘fimbriatus,”’ fringed; referring to the fimbriate
margins of the indusia.

Plants terrestrial; stem 20-40 x 1-1.5 cm, ascending to erect, bearing scales
at the apex; scales 1.2-2 x 0.1-0.3 cm, concolorous, brown, lanceolate,
basifixed, the apices acuminate, sinuate, margins entire to dentate; leaves to

150-180 cm long, erect to arched, fasciculate; petioles 55-80 X 0.8-1 cm,
brown, tomentose, with septate hairs 0.1—0.3 mm, and scales like those of the
stems; Jamina 94-149 X 40-65 cm, chartaceous, 1—pinnate-pinnatifid,
lanceolate, gradually tapering to a pinnatifid apex, with proliferous buds in
the axils of distal pinnae; rachises with septate hairs 0.2-0.4 mm long in
adaxial grooves, linear scales 1.5-2.5 X 0.1-0.2 mm and lanceolate scales 1.5—4
0.5—0.8 mm abaxially and adaxially; pinnae 28-37 x 3-5.5 cm, stalked to
0.4—1.2 cm, 6-14 pairs per lamina, oblong-ovate to deltate, incised 2/3 or less
to the costae, bases truncate or round, apices acuminate, margins crenate to
slightly serrate, without differentiated marginal cells; costae grooved adaxi-
ally, with vertical laminar wings 0.2-0.5 mm wide; veins free, pinnate, simple
or furcate; indument adaxially restricted to costal grooves, the hairs similar to
those on the rachis, abaxial side of the veins with linear scales, 0.8-1 X ca.
0.1 mm, laminar tissue between veins glabrous on both sides of the lamina; sori
5-8 xX 0.3 mm, oblong, diplazioid or not; indusia commonly persistent,
membranaceous, brownish, melee fimbriate, the fimbriae 0.4—0.6 mm long;
spores brown, ellipsoidal, monolet

DisTRIBUTION AND EcoLocy.—Restricted to the humid montane forests of southern
Bahia and Minas Gerais, Brazil, where it grows in deep shade and along stream
banks, at 250-1200 m. Diplazium fimbriatum occasionally shares its habitat
with D. celtidifolium Kunze, D. lindbergii (Mett.) Christ, and D. mutilum
Kunze, which could favor hybridization within the genus.

CONSERVATION STATUS.—Vulnerable (VU), under criteria D2 (IUCN, 2010). Based
on the available collections and recent expeditions carried out by the authors
throughout the Brazilian Atlantic Forest, Diplazium fimbriatum has a very
restricted distribution, being known from only six localities in eastern Brazil
(Fig. 2). Although most of these populations are within legally protected areas
(ie., national parks and biological reserves), human activities such as logging
and replacement of forests by cattle ranches and plantations (cocoa, coffee and
sugarcane) continue to be serious threats. Particularly alarming is the rapid
deforestation of Serra do Corcovado, in the municipality of Almadina, a

MYNSSEN & MATOS: A NEW BRAZILIAN SPECIES OF DIPLAZIUM

2mm
ORME TRACER

3cm
es

0.5mm

0.5mm

Fic. 1. Diplazium fimbriatum A. Lamina (C. M. Mynssen & F. B. Matos 1167). B. Proximal pinnae.
C. Abaxial side of median segment, showing sori and indusial margin. D. Lanceolate scale of the
36).

lamina. E. Septate hair of the lamina (F. B. Matos et al. 2

AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

Distribution map of Diplazium fimbriatum, with protected areas indicated.

MYNSSEN & MATOS: A NEW BRAZILIAN SPECIES OF DIPLAZIUM a7)

locality that is becoming well known for increasing records of rare species of
ferns (e.g., Adiantum diphyllum (Fée) Maxon, Asplenium truncorum F. B.
Matos, Labiak & L. Sylvestre, and Megalastrum indusiatum R. C. Moran, J.
Prado & Labiak) and angiosperms (A.M. Amorim, pers. comm.).

PaRATYPES.—BRAZIL. Bahia: Almandina, Serra do Corcovado, 9.8 km ao SW de
Coaraci pela estrada para Almandina, seguindo N até a Fazenda Sao José,
14°42'21"S, 39°36'12”"W, 650-750 m, 29 Jan 2005, F. B. Matos et al. 236
(CEPEC, MBM, NY, RBR, UPCB); Idem, 19 Apr 2007, F. B. Matos et al. 1395
(CEPEC, NY, UPCB); Arataca, Serra do Peito de Moga, estrada entre Arataca e
Una, ramal ca. 22.4 km de Arataca, entrada pelo assentamento Santo Anténio,
Reserva Particular do Patriménio Natural Caminho das Pedras, 15°10'25’S,
39°20'30’W, 1000 m, 16 Feb 2006, F. B. Matos et al. 994 (CEPEC, UPCB);
Camacan, Serra Bonita, Fazenda Paris, trilha 4s margens de cérrego,
15°30'52”S, 39°40'27”W, 250m, 21 Oct 2009, C. M. Mynssen & F. B. Matos
1154, 1155 (CEPEC, RB); Wenceslau Guimaraes, Estagao Ecolégica Estadual
Nova Esperanga, inicio da trilha para o Pico do Urubu, 13°35'34"S,
39°42’58"W, 450-650 m, 4 May 2007, J. Jardim et al. 5024 (CEPEC, UPCB).
Minas Gerais: Conceigéo do Mato Dentro, Parque Natural do Ribeiraéo do
Campo, 1 Oct 2002, R. C. Mota et al. 1540 (BHCB); Idem, mata de galeria do
coérrego da mina, 19°06'19"S, 43°34'04”W, 1175m, 30 May 2005, A. Salino et al.
8748 (BHCB).

Diplazium costale (Sw.) C. Presl var. robustum (Sodiro) Stolze, endemic to
Ecuador (Stolze et al. 1994), resembles D. fimbriatum in blade dissection, leaf
length, and presence of proliferous buds on the axils of distal pinnae.
Nevertheless, it differs from D. fimbriatum by abundant costal scales and the
robust falcate sori closer to the costae with entire indusia (vs. delicate oblong
sori with fimbriate indusia). Fée (1869) applied the name D. costale to two
specimens collected in Brazil; however, a careful examination of these
specimens shows that Blanchet 535 (NY) refers to D. celtidifolium Kunze,
whereas D. rostratum Fée would be the correct name for Miers 164 (K).

Also similar is Diplazium macrophyllum Desv. (Venezuela, Colombia,
Ecuador, Peru, and Bolivia), which differs by the broader pinnae (9-22 vs.
3-5.5 cm), and the shape of the apices of ultimate segments, which are
attenuate or acuminate (vs. obtuse to acute in D. fimbriatum). Furthermore, the
veins of D. macrophyllum are sparsely provided abaxially with lanceolate to
deltate scales (1-1.5 X 0.3-0.5 mm), whereas in D. fimbriatum these scales are
filiform to linear.

Several other species that occur in Brazil are also probably related to the new
species (Table 1). Diplazium celtidifolium Kunze has similar linear and
lanceolate scales on the rachises, and also has buds on the axils of distal
pinnae, but differs from D. fimbriatum by the shape of the pinnae (oblong to
lanceolate vs. oblong-ovate to deltate), and indusia margins (entire to dentate
vs. fimbriate). Moreover, the pinnae of D. celtidifolium are usually less incised,
often entire. From D. mutilum Kunze, a Brazilian endemic, D. fimbriatum
differs by the presence of proliferous buds and fimbriate indusia (vs. entire to

172 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

TABLE 1. a between Diplazium fimbriatum and other similar species of Diplazium
occurring in Brazi

Species Proliferous buds Proximal pinnae Pinnae indument Indusia
D. fimbriatum Present (axils of oblong to ovate __ septate hairs plus linear long-fimbriate
istal pinnae) and lanceolate scales catenate
D, mutilum Absent oblong septate hairs and entire to dentate
filiformis scales
D. celtidifolium Present or not (axils oblong to septate hairs and entire to dentate
of distal pinnae) lanceolate linear scales
D. lindbergii Absent oblong septate hairs and absent or vestigial

filiform scales

dentate in D. mutilum). Another species in Brazil, D. lindbergii (Mett.) Christ,
has similar habit, blade dissection and leaf length, but can be easily
distinguished by indusia absent or vestigial and lack of proliferous buds on
the lamina.

ACKNOWLEDGMENTS

We thank Dr. : André M. Amorim (CEPEC, UESC), Dr. Vitor O. Becker (RPPN Serra Bonita), and
work in southern Bahia, Brazil. Thanks also to Dr.

illiam A. Rodrigues (UFPR) for the Latin diagnosis, Tainan Messina and Nina P. Monteiro
(CNCFlora) for drafting the map, and Maria Alice Rezende for preparing the illustrations. Special
thanks to Dr. Lana S. Sylvestre for supervising and suggestions, Dr. Robbin C. Moran and Dr. James
L. Luteyn for helpful comments on the manuscript. This research was largely funded by CAPES
and the Kew Latin America Research Fellowship Programme - Prance Fellowship in Neotropical
Sage (2007).

LITERATURE CITED

TUCN Stanparps AND PetTiTIONs SuscommiTTEE. 2010. Guidelines for Using the IUCN Red List
Categories and Criteria. Version 8.1. Prepared a the Standards and Petitions Subcommittee
in March 2010. Downloadable from http://intranet.iucn.org/webfiles/doc/SSC/RedList/
ST

CurisTENHusZ, M. J. M., X.-C. ZHanc and H. ScHNeIDeR. 2011. A linear sequence of extant families and
genera . baste sae and ferns. Phytotaxa 19:7—

Fée, A. L.A 9. Cryptogames vasculaires du Brésil. v. 1 Veuve Berger-Levrault & Fils Libraires,
Pari

aris.
Mynssen, C. M. 2010. Woodsiaceae. Pp. 566-567. In: R. C. Forzza, J. F. Baumgratz, C. E. M. Bicudo,
A. Carvalho Jr, A. Costa, D. P. Costa, M. J. G. Hopkins, P. Leitman, L. G. Lohmann, L. C. Maia,

bg Martinelli, M. Menezes, M. P. Morim, M. A. Sageabor A. L. Peixoto, J. R. Pirani, J. Prado,
L. P. Queiroz, V. C. Souza, J. R. Stehmann, L. S. Sylvestre, B. M. T. Walter and D. Zappi
(Orgs.). Catalogo de plantas e fungos do Brasil 1. pe ite Jardim Bone do Rio ss nage
Mynssen, C. M., A. Sauino and T. E. ALMema. 2009. Woodsiaceae. In:J. R RG a, A,
Salino, M. Sobral, D. P. Costa and L. H. Y. Kamino. Plantas da ee Pres pend

Proctor, G. R. 1985. Ferns of Jamaica. British Museum (Natural History), London.

RotHFELS, C. J., M. ve SunnueE, L. -Y. Kuo, A. Larrsen, M. Kato, E. ScHuerrpetz and K. M. Pryer. 2012.
A revised ig -level classification for eupolypod II ferns (Polypodiidae: Polypodiales).
Taxon, (in pres

MYNSSEN & MATOS: A NEW BRAZILIAN SPECIES OF DIPLAZIUM 173

SmitH, A. R., K. M. Pryer, E. ScHUETTPELZ, ch csi” H. ScHNemwer and P. G. Wo rr. 2006. A
classification for extant ferns. Taxon 55 731,

SmitH, A. R., K. M. Pryer, E. SCHUETTPELZ, P. pe , H. ScHNEwER and P. G. Wotr. 2008. Fern
classification. Pp. 417-467. In: T. A. Ranker and CH H. Haufler, eds. seid and evolution of
ferns and lycophytes. Cambridge ageelacinct Press, United —

Stouze, R. G., L. Pacheco and B. @tiGaarp. 1994. P Phy ti In:
G. Harling and L. Andersson, wig Flora of Bouader 49: 1-108.

Tiers, B. 2009 [continuously updated]. Index Herbariorum: A global directory of public herbaria

d associated staff. New York Botanical Garden’s Virtual Herbarium. http://sweetgum.nybg.

ih/

Tuomas, W. W., A. M. CarvatHo, A. M. Amorim, J. Garrison and A. L. ARBELAEZ. 1998. Plant
endemism in two forests in southern Bahia, Brazil. Biodiversity ne Scaseacee thei 7:311-322
Tryon, R. M. 1972. Endemic areas and geographic speciation in tropical American ferns. Biotropica

American Fern Journal 102(2):174—180 (2012)

Isoetes mourabaptistae, a New Species from
Southern Brazil

JOVANI B. PEREIRA
Universidade Federal do Parana, — de Botanica, C.P. 19031, 81531-980, Curitiba, PR, Brazil,
mail: jovanibio@gmail.co
PauLo G. Vc
Universidade Federal do Rio Grande do Sul, Depto. de Botanica, P. 43433, 91501-970, Porto
Alegre, RS, Brazil, e-mail: pteridos@gmail.c
Maria L. LORSCHEITTER
Universidade Federal do Rio Grande do Sul, Instituto de Biociéncias, Depto. de Botanica, C.P.
500, 91540-000, Porto Alegre, RS, Brazil, e-mail: mlorsch@uol.com.br
PauLo H. LaBiak*
Universidade Federal do Parana, Depto. de Botanica, C.P. 19031, 81531-980, Curitiba, PR, Brazil,
e-mail: plabiak@ufpr.br

Asstract.—Isoetes mourabaptistae, a new species from southern Brazil, is described, illustrated,
and compared to the most similar species. This new species is apparently restricted to southern
Brazil, and is characterized by cristate to irregularly reticulate megaspores and microechinate
microspores. It is an aquatic plant, occurring among submersed rocks along rivers, at about 900—
1100 m in elevation.

Key Worps.—Isoetaceae, taxonomy, lycophytes, diversity, aquatic plants

The genus Isoetes L. comprises approximately 350 species (Hickey et al.,
2003), most of them occurring as aquatic plants in lakes and streams, but also
as terrestrials on permanent or seasonally wet soils. The genus is widely dis-
tributed around the world, but many of its species tend to have very narrow
distributions (Hickey, 1986; Hickey et al., 2003; Small and Hickey, 2001;
Luebke and Budke, 2003; Choi et al., 2008)

Hickey (1990) considered South America to be a center of both morpholog-
ical and taxonomic diversity for Isoetes. However, this is still one of the less
known regions, and published estimates of the diversity of Isoetes in South
America vary considerably. Two of the most important contributions to South
American Isoetes, provided by Fucks-Eckert (1982) and Hickey (1985), suggest,
respectively, between 75 and 47 species for this region. Undoubtedly much
work is still needed to assess the actual diversity in South America. In Brazil
particularly, Isoetes is one of the less known groups of lycophytes, and most of
the species are represented by a very limited number of collections. Prado and
Sylvestre (2010) recorded 14 species for Brazil (12 endemics), most of them

“Corresponding author

PEREIRA ET AL.: A NEW ISOETES FROM BRAZIL 175

distributed along the coastal mountains of the southeastern and southern
regions.

A study on the spore morphology of ferns and lycophytes of Rio Grande
do Sul (Lorscheitter et al., 2009), and additional fieldwork conducted by the
authors, has identified the presence of a new species of Isoetes that we
describe herein

Isoetes mourabaptistae J. B. S. Pereira, P. G. Windisch, M. L. Lorscheitter, and
Labiak, sp. nov. TYPE.—Brazit. Rio Grande do Sul, Sao Francisco de Paula,
Rio Tainhas, 1 Oct. 2005, P. G. Windisch 10056 (Holotype: PACA 107431).
Figs. 1 A-B; 2 A-D; 3 A-D.

Plantae parvae, minus quam 15 cm altae. Cormus erectus, bilobatus. Radices
synchronae, dichotome divisae, conspicue succulentae. Folia chartacea, 10—
35, ascendentia, 6-11 cm longa. Alae castaneae, apice vulgo truncatae, 20—
25% per foliae longitudinem ascendentes. Subula olivacea, ascendens, apice
attenuata. Squamae absentes. Labium absens. Ligula deltato-lanceolata. Velum
incompletum. Sporangium basale ellipticum, hyalinum. Megasporae albae,
triletae, 558-736 ym diametro, hemisphaero distali reticulato vel cristato,
hemisphaerio proximali reticulato. Microsporae monoletae, microechinatae,
24—31 um longae, 13-22 um latae.

Plants submerged, growing among rocks in streams, less than 15 cm tall.
Corm erect, bilobed, 3-10 mm wide. Roots synchronous, dichotomous.
Microphylls 10-35, ascending, linear, chartaceous, 6-11 cm long, 4-6 mm
wide at the base and 1—2.5 mm wide in the medial portion, base of the
microphylls alate, the alae 1.4-2.3 cm long, 0.5—-0.8 mm wide (above the
sporangium), extending 20-25% the length of the microphyll, castaneous,
apices often truncate. Subula olive green, ascending, semiterete, the apex
atenuate. Scales absent. Labium absent. Ligule deltate-lanceolate, membrana-
ceous, 2.2—-2.5 mm long and 1.4—1.8 mm wide. Velum incomplete, covering
50-75% of the sporangium width, and 25-50% of the sporangium length.
Sporangium basal, elliptic, hyaline, 3.1-3.4 mm long, 1.9-2.4 mm wide.
Megaspores whitish, trilete, globose in equatorial view, globose to subtrian-
gular in proximal view, 558-736 (xX = 669) um wide, irregularly reticulate to
densely cristate distally, irregularly reticulate proximally. Microspores gray,
monolete, elliptic, 30-38 (x = 34) um long, 23-28 (x = 25) um wide, perispore
microechinate.

ADDITIONAL SPECIMENS EXAMINED.—BraziL. Rio Grande do Sul: Sao José dos
Ausentes, Silveira, 09 Dez. 1994, R. Bueno 4471 (ICN

EtyMoLocy.—The specific epithet honors Dr. Luis Rios de Moura Baptista,
botanist from the Federal University in Porto Alegre, Rio Grande do Sul.
DIsTRIBUTION AND EcoLocy.—Isoetes mourabaptistae is known from only two
collections: one from Sao Francisco de Paula, and the other from Sao José dos
Ausentes, both in the northeastern part of Rio Grande do Sul. It was found

176 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

Fic. 1. A-—B. A. Habit of Isoetes mourabaptistae. B. Velum (the arrow indicates the edge of the
velum with the fenestra below). Scale bars; A = 2 cm and B = 1 mm. (All from the Holotype, P. G.
Windisch 10056, PACA).

growing submerged, on rocks in shallow, clear waters, at altitudes of about
900—1100

TaxoNoMic Notes.—According to Hickey et al. (2009), in the southern part of
tog America there is a group of species with reticulate megaspores that is

ery complex taxonomically. This group includes species such as I.
hndeslierisie H. P. Fuchs, I. ekmanii U. Weber, I. fuscomarginata H. P. Fuchs,

PEREIRA ET AL.: A NEW ISOETES FROM BRAZIL 77

Fic. 2. A-F. SEM images of the megaspores of Isoetes coe ny nEG I. sehnemii, and I.
spannagelii. A-D. etes mourabaptista ephagiees 100 AC f verview of the
megaspores. B. Festal view. C. Distal view. D. Detail of nh iegaepures j in distal view. E. I.

sehnemii (Sehnem 17094, PACA), megaspore in prison: view. F. I. spannagelii (Pereira et al.
626, UPCB), wi = on in different positions. Scale bars: A = 500 um; B, C, and E = 100 pm; D =
50 um and F =

I, martii A. Br., I. organensis U. Weber, I. ramboi Herter, I. smithii H. P. Fuchs,
I. sehnemii H. P. Fuchs, and I. spannagelii H. P. Fuchs. Because Isoetes
mourabaptistae has megaspores that are irregularly reticulate, we believe that
it may belong to this group. It can be distinguished from most of those species,
however, by its larger megaspores (558-736 um in diameter), and by its

178 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

Fic. 3. A-F. SEM of the microspores of Isoetes mourabaptistae, I. sehnemii and I. spannagelii.
A-D. Isoetes mourabaptistae (Windisch 10056, PACA). A-B. Overview of the microspores. C. Distal
view of a microspore. D. Detail of the outer coating showing the microechinate surface.
sehnemii (Sehnem 17094, ACA), scrapes view. F. I. sana ae cks et al. 626, U PCB),
overview of the microspores. Scale bars: A = 50 um; B, C and F = 10 um; D = 1 um and E =5um

microechinate microspores. In contrast, the megaspores of most of the species
from southern Brazil are usually less than 400 um in diameter, and the
microspores always have smooth outer coatings.

In the size of the microphylls (up to 11 cm long) and habit (Fig. 1 A), Isoetes
mourabaptistae resembles I. sehnemii H. P. Fuchs and I. spannagelii H. P.
Fuchs. However, the megaspores of I. sehnemii are much smaller (332-480

PEREIRA ET AL.: A NEW ISOETES FROM BRAZIL 179

(-554) um diam.) and the microspores are smooth (Figs. 2E and 3E). In I.
spannagelii the megaspores are 406—562(—603) um in diameter and borane
and consistently reticulate. The microspores are also smooth (Figs. 2F and 3F).

Hans Peter Fucks-Eckert labeled a collection made by Luis Rios Moura-
Baptista as ‘Isoetes batistae’ (Moura-Baptista 7719, PACA), and also cited this
name on pages 237 and 256 of his work published in 1982 (Fucks-Eckert,
1982). However, Fucks-Eckert never validly published this new name
(therefore a nomen nudum). The specimen at the PACA Herbarium is very
depauperate, with only fragments of the microphylls. Even though it was
collected in the same river, and likely represents the species described here,
we cannot be sure about its identity given the absence of the characters that
distinguish this species from its congeners.

CONSERVATION STaTUs.—Isoetes mourabaptistae is currently known from only
two collections, from two different rivers in southern Brazil. This suggests that
it is locally rare and has a narrow distribution, therefore deserving special
attention relative to its conservation status. However, based on our current
knowledge of its population size and geographic distribution, and according to
IUCN Red List Criteria (IUCN, 2001), it is assessed here as Data Deficient (DD).

ACKNOWLEDGEMENTS

We thank the “Centro de Microscopia Eletrénica da UFPR” and Priscila Izabel Tremarin for their
help with the SEM images. We also thank Dr. Thelma Veiga Ludwig and Dr. William Rodrigues for
their valuable help in this work. This study is part of Jovani Souza’s Master Dissertation, which

as made possible through a fellowship from CAPES. Paulo Labiak, Paulo Windisch, and M. Luisa
Lorscheitter are Research Grant recipients from the Brazilian Research Council (CNPq).

LITERATURE CITED

Cuo, H.-K., J. Junc and C. Km. gee Two new species of Isoetes (Isoetaceae) from Jeju Island, South

Fucus-EcxerTt, H. P. 1982. ea bosons Kenntnis von Vorkmmen und Liplapiben der
sii ee ee Isoetes-Arten. Proc. Koninkl. Neder. Akad. Wetensch. Ser. C. 85:205—260.
FUucHs- ene HP. 6. Isoetéceas. Pp. 3-43, in R. Reitz, ed. Flora Ilustrada Catarinense. Itajai,
Cobian, mail
Hickey, ® J. 1985. Revisionary studies of Neotropical Isoetes Ph.D. Dissertation, The University of
; Gt.

ITS

Hickey, R. J. 1986. The onty evolutionary and morphological diversity of Isoetes, with description
of two new Neokop ical species. Syst. Bot. 11:309-321.

Hickey, - J. 1990. stdies . Neotropical Isoetes L. I. Euphyllum, a new Subgenus. Ann. Missouri.

Gard. 77:2

Hickey, 7 J... W. CG. oo i N. T.Lugsxe, N. T. 1989. The species concept in Pteridophyta with
special reference to Isoetes. Amer. Fern. J. 79:78—-89.

Hicxey, R. J., C. C. Mac.ur and W. C. Taytor. Bate A re-evaluation of Isoetes savatieri Franchet in
Argentina and Chile. Amer. Fern. J. 93:126—

Hickey, R. J., C. C. Mactur and M. Link-Prréz. pa maxima, a new species from Brazil. Amer.
Fern. J., 99:194-199.

Lorscuertter, M. L., A. R. AsHrar, P. G. Winpiscu and V. Mossruccer. 2009. ee spores of
Rio Grande do Sul flora, Brazil, Part VI. Palaeontographica 281:1

180 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)
LueBke, N. T. and J. M. Bupxe. oi Ne tennesseensis (Isoetaceae), an octoploid quillwort from
90.

Tennessee. Amer. Fern. J. 9
Prapo, J. and L. S. SyLvestre. 2010. "Taoetacoee in Lista. de Espécies da Flora do Brasil. Jardim

Botanico do Rio de Janeiro. (

SMALL, o L. and R. J. vege 2001. eae of the Northern Andean Inoetes i tenii Complex.
T. Fern. fe
ean 'W. Gea . How. 1992. Habitat, evolution, and speciation in Jsoetes. Ann. Missouri.

t. Gard. eo 613-

American Fern Journal 102(2):181-183 (2012)

SHORTER NOTES

Agravitropic Growth of the Early Leaves of Apogamous Sporophytes of
Dryopteris tyrrhena.—Dryopteris tyrrhena Fraser-Jenk. & Reichst., a Western
Mediterranean endemic, is a threatened species represented by a few
populations in Spain, France, and Italy (Magrini and Scoppola, Inform. Bot.
Ital. 42(2):595-597. 2010). The relict type of its distribution (rare and scattered
with big gaps between different localities, mostly in crevices and caves)
suggests that D. tyrrhena is an old species of the Tertiary flora of the Med-
iterranean mountains (Fraser-Jenkins et al., Fern Gaz. 11(2—3):177—198. 1975;
Bernardello and Martini, Felci e piante affini in Liguria e in Italia. Le Mani-
Microart’s Edizioni, Recco-Genova. 2004). It is an allotetraploid species
(2n=164) originated by interspecific hybridization between the diploid species
D. oreades Fomin (2n=82) and D. pallida (Bory) Maire & Petitm. (2n=82) with
subsequent chromosomes doubling (Fraser-Jenkins et al., 1975).

This study on the in vitro development of apogamous sporophytes of
Dryopteris tyrrhena (Magrini, Plant Biosystems 145(3):635-637. 2011; Magrini
et al., Studi Trent. Sci. Nat. 90:165-169. 2012) was undertaken in summer
2008 at the Tuscia Germplasm Bank of the Botanic Gardens of Viterbo (Italy) in
order to learn about its reproductive biology, and for conservation purposes, to
obtain information on the biological factors that may have contributed to
the strong fragmentation of its distribution. Fresh spores were collected in
September 2007 from a wild population of D. tyrrhena growing within the
Cinque Terre National Park (Riomaggiore, La Spezia, Italy). Studies of
gametophyte and sporophyte development were carried out according to the
protocol of Menendez et al. (Plant Cell Rep. 25:85—91. 2006; Quintanilla and
Escudero, Ann. Bot. 98:609-618. 2006; Magrini et al., 2012). All the spores
were separated from sporangia using sieves with a mesh size of 71 um, and
then were soaked in Eppendorf tubes with 1.5 ml of distilled water for 24 h.
After, they were surface sterilized for 3 min. in a 0.5% NaOCl solution,
supplemented with a drop of Tween 20 to improve the efficiency of the ster-
ilization. They were then rinsed three times with sterile distilled water and
centrifuged at 6,000 rpm for 3 min. between rinses. The spores were sown with
three replicates in sterile plastic Petri dishes (6 cm diameter) containing 15 ml
of MS medium (Murashige and Skoog, Physiol. Plant. 15:473-497. 1962)
(PhytoTechnology Laboratories® Shawnee Mission, KS, USA), supplemented
with 0.7% agar (Plant tissue culture grade, AppliChem, Darmstadt, Germany)
and a Nystatin solution (100 Uml~*), which was added as a fungicide
(AppliChem, Darmstadt, Germany). The cultures were maintained under cool-
white fluorescent illumination (Osram Dulux L 36W/840 Lumilux, 2900 lm), a
12-h photoperiod, and a temperature of 20+1°C (Sheffield et al., Amer. Fern J.
91(4):179-186. 2001; Magrini et al., 2012). The dishes were examined daily for
spore germination (defined as the first emergence of the rhizoid) and weekly
for gametophyte growth and sporophyte development.

182 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

Fic. 1. a) Cordate piensa of yop tyrrhena, with rhizoids in the ventral side and an
apogamous bud in the d cushion area behind the apical notch. b) First fronds arose
from the apogamous bud, eat Pate vernation. c) Apogamous sporophyte with young
pinnate fronds grown upward, each diverging at an angle of about 100° from the previous one.

A low percentage (<5%) of the spores germinated after 36 days after sowing.
All gametophytes were filamentous at the beginning and they followed a
normal trend of development in the transition from protonema to the laminar-
cordate phase: the first oblique division of the terminal cell of the germ fil-
ament started after the fourth longitudinal division (Raghavan, Developmental
biology of fern gametophytes. Cambridge University Press. 1989), resulting in
laminar heart-shaped gametophytes 15 days after germination. All the cordate
gametophytes produced rhizoids in the ventral side and developed apogamous
buds in the dorsal side, in the cushion area behind the apical notch (Fig. 1a),
about 60-70 days after germination (Magrini et al., 2012). This same pattern
has been previously recorded for D. affinis (Lowe) Fraser-Jenk. subsp. affinis
(Menéndez et al., 2006). Sporophytes arose from these buds in a few days, with
young pinnate fronds, which started to quickly grow, showing circinate
vernation (Fig. 1

During the apogamous sporophyte development, an interesting phenome-
non was noticed. In the beginning, the leaves grew upward, each diverging at
an angle of about 100° from the previous one (Fig. 1c), as has been observed by

a feeb response: some leaves developed downward and they grew into the agar of
a culture mediu

SHORTER NOTES 183

Duncan (Bot. Gaz., 105:202—211, 1943) for certain apogamous forms of D.
affinis (Lowe) Fraser-Jenk. subsp. borreri (Newman) Fraser-Jenk. An anoma-
lous growth was observed a few days later as the leaves showed an agravitropic
response. They developed both upward and downward, growing also into
the agar of the culture medium (Fig. 2). Other studies are testing the already
known induction factors of apogamy, like the presence of sucrose in the
culture medium, high light intensity, and the vertical growth of the ga-
metophytes (Magrini et al., 2012). Their preliminary results led us to
hypothesize that apogamy may have been induced by ethylene production
during in vitro culture (Elmore and Whittier, Can. J. Bot. 53:375-381, 1975). In
fact, the dishes were sealed with Parafilm, in order to reduce contamination, to
prevent excessive water loss, and to reduce air exchange. Menéndez et al.
(2006) showed how auxins play a stimulatory role during the induction and
differentiation of apogamous embryo development in D. affinis. Van der Laan
(1934) was the first to consider the possibility that ethylene acts on auxin in
plants. Given its potential role in apogamy, it is possible that ethylene could
also be influencing the normal gravitropic response. However, more experi-
mental work is needed to study the influence of ethylene on tropisms and
to clarify the effective cause of this agravitropic response.—Sara MAacnrinI,
Tuscia Germplasm Bank, Botanic Gardens of Viterbo, Tuscia University, largo
dell’Universita, Blocco C, 01100, Viterbo, Italy, e-mail: magrini@unitus.it, and
ANNA ScoppoL.a, Department of Agriculture, Forestry, Nature, and Energy,
Tuscia University, via S. Camillo de Lellis, 01100, Viterbo, Italy, e-mail:
scoppola@unitus.it.

American Fern Journal 102(2):184-186 (2012)

SHORTER NOTES

Cheilanthes feei T. Moore (Pteridaceae) and Dryopteris erythrosora (D.C.
Eaton) Kunze (Dryopteridaceae) New for the Flora of North Carolina.—Recent
field and herbarium work has added these two species to the spontaneous flora
of the state of North Carolina, USA. Cheilanthes feei is native to the center of
the continent; its core range extends from eastern Minnesota and Texas, south
to northern Coahuila and Chihuahua, and west to southern Nevada and
extreme southeastern British Columbia (Windham and Rabe, Cheilanthes. In:
Flora of North America. Oxford University Press, New York. 1993; Mickel and
Smith, The Pteridophytes of Mexico. The New York Botanical Garden Press,
New York. 2004). From this core area, there are two reported disjunctions. The
first, in central northern Kentucky (Reed. Amer. Fern J. 42:53-56. 1952.) is
approximately 200 km east of the main range, and the second, along the New
River in western Virginia (Wieboldt and Bentley, Amer. Fern J. 72:76-78.
1982.) is another 450 km to the east. In both cases, the species was found on
limestone or dolomitic cliffs, its typical habitat.

Recent curatorial activities at the Duke University herbarium (DUKE)
resulted in the discovery of this species as new for North Carolina. A single
specimen was collected in 1930 by Hugo Blomquist in Durham County (some
200 km SE of the nearest station, in Virginia), but was misidentified as the
more common Cheilanthes tomentosa Link. The Blomquist specimen is
undoubtedly C. feei and not C. tomentosa, based on the absence of scales on
the rachises and costae, and the glabrescent adaxial surfaces of the ultimate
segments. Unfortunately, the label data describe the collection location merely
as “Eno River, Durham, NC.” Given that Blomquist was based in Durham, and
that his databased collections from June 1930 are all from North Carolina
(including one from Durham County: www.herbarium.unc.edu/seflora; www.
tropicos.org), it seems unlikely that this record is due to a labeling error.
Subsequent searches by the authors and associates along the Eno River failed
to discover any extant populations, but such may well still exist.

This record continues a noteworthy pattern of disjunction for western
cheilanthoid ferns: in most cases where a predominantly western species has
populations east of the Appalachians, the species involved is an apomictic
triploid. Species fitting this pattern include Cheilanthes feei, C. eatonii Baker
(C. castanea Maxon), C. alabamensis (Buckley) Kunze, and C. tomentosa. This
pattern is also seen in the related genus Astrolepis, where two apomictic
triploids (A. sinuata (Lagasca ex Swartz) D.M. Benham & Windham ssp.
sinuata and A. integerrima (Hooker) D.M. Benham & Windham) have eastern
disjunct populations far from their core western ranges (disjunct to Georgia
and Alabama, respectively; Weakley, Flora of the Southern and Mid-Atlantic
States. The University of North Carolina Herbarium, Chapel Hill, NC. 2011).
This tendency for apomictic taxa to have long-distance geographic disjunc-
tions is consistent with their breeding system. As asexuals, they need only a

SHORTER NOTES 185

Dryopteris erythrosora along the Ellerbe Creek, Durham, North Carolina. A) Habit and
habitat. B) Close-up of a leaf. Photos: Sarah Zylinski.

single spore to land in a suitable habitat in order to potentially establish a new
population. In contrast, many sexual cheilanthoid ferns appear unable to
undergo intragametophytic selfing, and thus require two spores to establish

oduce gametophytes in close enough proximity to permit cross-
fertilization before a population can be established.

Cheilanthes feei T. Moore. Eno River, Durham, North Carolina. Exposed rocks.
H.L. Blomquist 1649 (DUKE 10973). June, 1930. Det’d M.D. Windham, 2006.

Like C. feei, Dryopteris erythrosora is an apomictic triploid. It is native to
woodlands of eastern Asia but is common in the North American horticultural
trade, where it is sold under the name Autumn Fern (Hoshizaki and Wilson,
Amer. Fern J. 89:1—98. 1999; Hoshizaki and Moran, Fern Grower’s Manual.
Timber Press, Portland, OR. 2001). In North America, it has been reported from
Georgia (Weakley, 2011) and Arkansas (Simpson et al., Amer. Fern J. 98:111—
112. 2008). We found it growing in a typical habitat—a disturbed suburban
woodlot—in Durham County, North Carolina. It was uncommon, in the
company of other native and nonnative taxa, without any indication of it (or
anything else) having been planted on the site or in the vicinity (Fig. 1).

While Dryopteris erythrosora does not appear to be spreading aggressively in
Durham, this report extends a potentially worrisome trend of non-native
temperate ferns naturalized from presumably horticultural sources (e.g
Macrothelypteris—Gorman et al., Journal of the Botanical Research beditute
of Texas 5:343-344. 2011; Athyrium nipponicum and Deparia petersenii—
Weakley, 2011; Hypolepis tenuifolia (G. Forster) Bernh.—Peck, Phytoneuron
30:1-33. 2011; Arachniodes—Gordon, Amer. Fern J. 71:65—68. 1981).

Dryopteris erythrosora (D.C. Eaton) Kunze. Durham County, North Carolina.
Durham, Old West Durham neighborhood. Tributary of Ellerbe Creek, just

186 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

north of Sunset Ave, between Carolina Ave and Albany St. N36.02361
W78.92577 +/—8m. Elevation: 153 m. Two plants seen (but there were more
earlier in the year; they presumably got washed away). Just above scour zone
of small suburban creek, on disturbed, steep sandy banks, with Impatiens,
Toxicodendron, Polystichum, Viola, Boehmeria, Vinca, other invasive
shrubs, etc. Under Morus, Acer negundo, Fraxinus, etc., in weedy ridge
through floodplain forest. 2010-August-08. C.J. Rothfels 3959, with S.
Zylinski (DUKE 401869). Det’d C.J. Rothfels & E. Sigel, August 2010. ! C.
Fraser-Jenkins (from photos), August 2010.

We thank Christopher Fraser-Jenkins for confirming the identification of the
Dryopteris, Dylan Burge, Amanda Grusz, Beth Guy, Layne Huiet, Fay-Wei Li,
and Lisa Pokory for their efforts in our as-yet unsuccessful attempts to locate
extant North Carolina populations of Cheilanthes feei, and Jennifer Geiger
(Editor) and two anonymous reviewers for improvements to the manuscript.—
C. J. Rorureis, E. M. SiceL, and M. D. WinpuaM, Department of Biology, Duke
University, Durham, North Carolina.

American Fern Journal 102(2):187—189 (2012)

REVIEW

Flora de la Regién del Parque Nacional Amboré, Bolivia, Vol. 1 Licofitas y
Helechos, Gimnospermas, the flora edited by Michael H. Nee, the volume
authored by Michael Sundue and Michael H. Nee. 2011. Published by Editorial
FAN, Santa Cruz de la Sierra, Bolivia. Hardcover Price $20. ISBN 978-99905-
66-54-3, 464 pages, 61 color and 115 black-and-white photographs. In Spanish.

The tropical Andean fern flora is — along with that of Southeast Asia and
New Guinea — the richest worldwide. Despite (or perhaps because of) this,
floristic treatments of Andean ferns are rare. Peru and Venezuela are the only
countries with fully published fern floras, although these are now becoming
outdated as fern taxonomy evolves and new species are recorded. For Ecuador
and Colombia, only selected families have been treated so far in the series of
national floras. In addition, there are a number local or regional floras and
checklists. Bolivia, which harbors about 1200 known fern species, has so far
had no floristic fern treatment. Now, Michel H. Nee and Michael Sundue have
produced the first flora for part of the country, namely Amboré National Park
and surrounding areas.

Amboré National Park is located on the “‘Andean elbow” where the Andes
turn abruptly southwards and where the humid tropical Andes that extend
from western Venezuela to central Bolivia meet the arid subtropical Andes
that reach from here to northwestern Argentina. As a result of this position at
a major biogeographical meeting point and because of its high diversity of
habitats, Amboré is one of most diverse protected areas worldwide. Covering
442,500 hectares plus 195,000 hectares in a surrounding ‘Natural Area of
Integrated Management’’, Amboré ranges from 235 m to 3100 m elevation
and includes vast tracts of evergreen rainforest as well as smaller areas of
drier and seasonally deciduous forest types. So far, over 3000 species of
vascular plants have been recorded from the park. Dr. Michael H. Nee from
the New York Botanical Garden has been working intensively of the flora of
this region for decades and is the driving force behind the preparation of the
flo

ra.

The first volume of the flora of Ambor6, published in Spanish in 2011 by the
Bolivian conservation NGO Fundacién Amigos de la Naturaleza (FAN), covers
all 429 species of ferns and lycophytes as well as 11 species of gymnosperms
so far known from the park and adjacent areas. Because large parts of the
national park, especially in the wet montane rainforests at 1000—2000 m which
harbour the highest fern diversity are largely inaccessible and have not yet
been explored botanically, there is no doubt that many more fern species
actually occur in the park, probably in the order of 600-800 species. However,
this is true for much of the Bolivian Andes where collecting activity is very
localized and where new records are commonplace.

The fern treatment was prepared over several years by Dr. Michael Sundue,
with significant input from numerous taxonomic specialists for a variety of

188 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 2 (2012)

taxa. The treatment covers 331 pages and follows the standard format of floras,
including dichotomous keys to families, genera, and species, full descriptions
of families, genera and species, taxonomic or morphological notes, specimen
citations, and some ecological information for each species (elevation and
vegetation types in which the species has been found); nomenclatural remarks
are kept to a minimum. In addition, the flora includes 61 color photographs (49
of ferns) and 115 black-and-white photographs of herbarium specimens (107 of
ferns). There are 20 pages of general introduction giving a brief outline of the
vegetation types of the flora region and of the history of its botanical
exploration plus no less than 15 pages of glossary explaining botanical terms.

Overall, the taxonomic treatment is of very high quality. Dr. Sundue has
invested an inordinate amount of work into clarifying even the most obscure
taxonomic problems and into making sure that all the latest developments of
fern classification/taxonomy, both at the family and generic level as well as at
species level, are taken into account. Unavoidably, some of the very latest
developments, such as the segregation of Neotropical species of Micropolypo-
dium into the new genus Moranopteris, have not been considered. I have used
some of the keys and have found them to work very well even for difficult
groups such as Elaphoglossum or Campyloneurum. This is certainly one of the
best fern floras currently available for any part of the tropical Andes.

As a result, this is a highly important work for anybody interested in
tropical Andean ferns. Because of it’s location in central Bolivia, the flora —
which covers about one third of the Bolivian fern flora — nicely fills the gap
between the fern floras of Peru and Jujuy in northern Argentina, and includes
a number of endemic Bolivian species not covered by either of the other
floristic works. Until the publication of a forthcomming fern flora for the
entire country (Kessler and Smith, in prep.), this will be the major reference
for Bolivian ferns, and will also be useful for northern Argentina and to a
lesser degree southern Peru. That the flora is written in Spanish makes it
readily accessible to the Bolivian researchers and public (the main audience)
while perhaps limiting its use to non-Spanish speakers, although the
technical terminology is so similar that most of the text can be used by
anybody with a good foundation in English botanical terminology. If you are
interested in Andean ferns, then there is much to learn from and enjoy in this
book. The authors and FAN are to be highly commended for producing this
important piece of literature for what is probably the botanically least well
known South American country.

Unfortunately, I must end this review on a critical note. While preparing this
review, I also inquired about the availability of the book outside of Bolivia and
to my great disappointment had to learn that the book can only be ordered
directly from the publisher (www.fan-bo.org) and that this is very complicated.
At the time of writing, the book was not even listed on their website so that you
had to know that it exists and specifically ask for it via e-mail, and payment
was only possible by money order. I have also learnt that Missouri Botanical
Garden considered obtaining a number of these books to be able to make them
available to a wider public, but that this project was cancelled due to

REVIEW 189

communication problems with the publisher. It is sad to realize that unless a
solution is found for these problems, this important publication will likely
receive much less distribution outside of Bolivia than it would deserve.—
MicHAEL KEssLer, Systematic Botany and Botanical Garden, University of
Zurich, Zollikerstrasse 107, CH-8008 Zurich, Switzerland.

American Fern Journal 102(2):190 (2012)

ERRATUM

AFJ volume 101, issue 4, pp. 282-294

In describing the new species Bolbitis lanceolata J.Y. Xiang & S.K. Wu
(Amer. Fern J. 101(4): 287-290. 2011), we inadvertently omitted the explicit
designation of a holotype from among the duplicates of the type gathering. The
corrected type citation appears below. This validates the species description
by direct association with the original protologue and delays the effective date
of publication for the name to that of the present issue.

Bolbitis lanceolata S. K. Wu & J. Y. Xiang, sp. nov. TYPE.—LAOS.
ammoun Province: Nakai District, Nakai Village, Phou Ar. (Dan
Feuang), 17°43'217” N, 105°07'663” E, in evergreen forest, on limestone
rocks, 650-750 m, Oct. 31, 2007, Wu SG, Liu ED, Xiang JY, Somsanith B,
Onevilay S 121 (holotype: KUN; isotypes: MO, TMRC). Fig. 1: A-C, Fig. 2.

INFORMATION FOR AUTHORS

Authors are encouraged to submit manuscripts pertinent to pteridology for publica-
tion in the American Fern Journal. Manuscripts should be sent to the managing editor at
hauk @denison.edu. Acceptance of papers for publication depends on merit as judged by
two or more referees. Authors are encouraged to contribute toward publishing costs; how-
ever, the payment or non-payment of page charges will affect neither the acceptability of
manuscripts nor the date of publication.

Authors should adhere to the following guidelines; manuscripts not so prepared may be
returned for revision prior to review. E 1; how-
ever if it is necessary to submit hard copy, please submit one copy of the manuscript an
include a review copy of illustrations and originals of illustrations. After acceptance, please
submit final versions of manuscripts via FTP (contact the managing editor for instructions),
email, or on diskette or CD ROM (see below for figure formatting). If submitting hard
copies, use standard 8.5 by |1 inch paper of good quality, not “erasable” paper. Double-
space manuscripts throughout, including title, author’s names and full addresses, a short,
informative abstract, key words, text (including heads and keys), literature cited, tables
(separate from text), and figure captions (grouped as consecutive paragraphs separate from
figures). Arrange parts of manuscript in order just given. Include author’s name and page
number in the upper right corner of every sheet, and provide an abbreviated running title.
Provide margins of at least one inch (25 mm) all around on typed pages. Do not submit
right-justified text, avoid footnotes, and do not break words at end of lines. Make table
headings and figure captions self-explanatory. Use S.I. (metric) units for all measures (e.g.,
distance, elevation, weight) unless quoted or cited from another source (e.g., specimen
citations). For nomenclatural matters (i.e., synonymy and typification), use one paragraph
per basionym (see Regnum Veg. 58:39-40. 1968). Abbreviate titles according to Botanico-
Periodicum-Huntianum (Lawrence et al., 1968, Hunt Botanical Library, Pittsburgh) and its
supplement (1991). References cited only as part of nomenclatural matter are not included
in literature cited. For shorter notes and reviews, omit the abstract and put all references
parenthetically in text. Use Index Herbariorum (Regnum Veg. 120:1-693. 1990; or http://
websun.nybg.org/bsci/ih/) for designations of herbaria. For more detailed instructions on
manuscript preparation, see http://amerfernsoc.or,

Illustrations should be proportioned to fit page width (5 inches or 12.5 cm) with caption
ultimately to be included on the same page. Halftone and color images should be scanned
at a minimum of 300 pixels per inch (ppi). Line art should be scanned at 1200 ppi when-
ever possible. Please note that nearly all images that are downloaded from the Internet or
that are in JPEG or GIF format will be 72 dpi and not acceptable for the printing process.
Indicate the file format of the graphics. Please submit image files in TIFF (preferable) or
EPS format. Provide margins of at least 25 mm on all illustrations. For continuous-tone
illustrations, design originals for reproduction without reduction or by uniform amount.
In composite blocks, abut edges of adjacent photographs. Avoid combining continuous-
tone and line-copy in single illustrations or blocks. Coordinate sequence and numbering
of figures (and tables), with order of citation in text. Explain scales and symbols in figures
themselves, not in captions. Include a scale and reference to latitude and longitude in each

map.

fi t fe are sent to authors
by the printer. Authors should send proof corrections of corrected proofs to the editor and
reprint orders to the printer. Authors wil sive alterations made
after type has been set.

For other matters of form or style, consult recent issues of the American Fern Jour-
nal and The Chicago Manual Fae Style, 14" ed. (1993, Univ. of Chicago Press, Seniesa
are encouraged

Occasionally, departure from — may be a Authors are
consult the editor for oarepen oe t preparation.

Papers of lon; ger Midy UC ’ PEP LCOLOS

3 Editor, se journal cover page 2).

PTERIDOLOGIA ISSUES IN PRINT

The following issues of Pteridologia, the memoir series of the American Fern Society,
are available for purchase:

1. Wagner, David H. 1979. Systematics of Polystichum in Western North America
North of Mexico. 64 pp. $10.00 plus postage and handling.

2A. Lellinger, David B. 1989. The Ferns and Fern-allies of Costa Rica, Panama, and
the Choco (Part 1: Psilotaceae through Dicksoniaceae). 364 pp. $32.00 plus postage and
handling.

3. Lellinger, David B. 2002. A Modern Multilingual Glossary for Taxonomic Pteri-
dology. 263 pp. $28.00 plus postage and handling.

For orders and more information, please contact our authorized agent for sales at:
Missouri Botanical Garden Press, P.O. Box 299, St. Louis, MO 63166-0299, tel. 314-577-
9534 or 877-271-1930 (toll free). For online orders, visit: http://www.mbgj org

AMERICAN FERN JOURNAL ON MICROFICHE

Volumes 1-61 of the American Fern Journal are available as archival quality, silver
positive microfiches. Single volumes or the entire run may be purchased. The fiches are
easily read with 10x or greater magnification (using a dissecting microscope and transmit-
ted illumination or a fiche reader). Silver negative microfiches of vols. 1—50 are also avail-
able. The price is $4.00 per volume or $244.00 per set of 61 volumes, postpaid.

Send your inquiry or order with a check or money order to: American Fern Society,
Inc., % Ecology Ill, 804 Salem Blvd., Berwick, PA, 18603-9801.

FIDDLEHEAD FORUM
The editor of the Bulletin of the American Fern Society welcomes contributions from
members and non-members, including miscellaneous notes, offers to exchange or purchase
materials, personalia, horticultural notes, and reviews of non-technical books on ferns.
SPORE EXCHANGE

Ms. Denia Mandt, 12616 Ibbetson Ave., Downey, CA 90242-5050, is Director. Spores
exchanged and lists of available spores sent on request. http://amerfernsoc.org/sporexy.
html

GIFTS AND BEQUESTS

, ew wa At + +L c

st ft, ik Al ¢,

ee ee ey ble

interested in ferns. Back issues of the Journal and cash or other gifts are always wclooreind
and are tax-deductible. Inquiries should be addressed to the Membership Secretary.

VISIT THE AMERICAN FERN SOCIETY’S

WORLD WIDE WEB HOMEPAGE:
http://amerfernsoc.org/

AMERICAN Volume 102
i Ss i N Number 3
JOURNAL ee

QUARTERLY JOURNAL OF THE AMERICAN FERN SOCIETY

Farina Suite by Gametophytes of Argyrochosma nivea (Poir.) Windham (Pterida-
eae) and its Implications for Cheilanthoid Phylog
Jose Maria Cabriel y Galdn and Carmen Prada

Cytotoxic and Tripanocide oe of Pityrogramma calomelanos (L.) Link.
Teo s M. de Souza, Maria F. B. M. Braga, Rogério A. Saraiva,

Ss Vega, Antonieta Rojas de Arias, Jose G. M. Costa,
rwin R. Alencar de Menezes, Henrique D. M. Coutinho
and Anténio A. F. Saraiva

Effects of Ageratina adenophora on Spore Germination and Gametophyte Development
of Neocheiropteris palmatopedata

K. M. Zhang, J. H. Liu, X. Cheng, G. F. Zhang,

. M. Fang, and H. J. Zhang

Occurrence of Dark Septate E Christella dentata
Rebeca Ghanta, Sikha Dutta, and Radhanath Mukhopadhyay

Azolla cristata in the Kashmir Himalay
Burhan pres Zafar A. Reshi, Aijaz H. Ganaie, and A. R. Yousuf

SHorRTER NOTES

New Country and Regional R ds from the Brazilian Side of Neblina Massif
Fernanda Antunes Carvalho, Alexandre Salino, and Charles Eugene Zartman

New Records Of Ferns From Chiapas, Mexico
oe A pi bien ecrigee Ma. Evangelina Lépez-Molina,
Nayely M deléndez, and Héctor Gomez-Dominguez

Obituary: The Rev. Father Dr. V. S. Manickam S. oe gee 012)
A. Benniamin and Chris Fraser-Jenkins

191

198

208

216

224

228

233

pe St Lous MO S3166029.

The American Fern Society
Council for 2012

KATHLEEN PRYER, Dept. of Biology, Duke University, P.O. Box 90338, Durham, NC 27708.

President
JAMES E. WATKINS, JR., Dept. of Biology, Colgate University, Hamilton, NY 13346.

President-Elect

MARY STENSVOLD, USDA Forest Service, 204 Siginaka Way, Sitka, AK 99835.

Secretary
JAMES D. CAPONETTI, Div. of Biology, University of Tennessee, Knoxville, TN 37996-0830.

Treasurer

GEORGE YATSKIEVYCH, Missouri Botanical Garden, P.O. Box 299, St. Louis, MO 63166-0299.
AA, h hin &

JAMES D. MONTGOMERY, Ecology III, 804 Salem Blvd., Berwick, PA 18603-9801.
Curator of Publications
JENNIFER M. O. GEIGER, Dept. of Natural Sciences, Carroll College, Helena, MT 59625
Journal Editor
R. JAMES HICKEY, Dept. of Botany, Miami University, Oxford, OH 45056.
Memoir Editor
JOAN N. E. HUDSON, Dept. of Biological Science, Sam Houston 7 sees Huntsville, TX 77341-2116.
DAVID SCHWARTZ, 9715 Christey Way, Bakersfield, CA 93312-561

Bulletin Editors
American Fern Journal
EDITOR
JENNIFER M. O. GEIGER Dept. of Natural Sciences, Carroll College, Helena, MT 59625,
447-4461, e-mail: jgeiger@carroll.edu
MANAGING EDITOR
JILL ANNE DILL Dept. of Natural Sciences, Carroll College, Helena, MT 59625,
ph. (406) 447-5176, e-mail: jdill @carroll.edu
SSOCIATE EDITORS
NAN CRYSTAL ARENS .............. Dept. of Geoscience, Hobart & William Smith Colleges, Geneva, NY 14456
JOSE MARIA ScneeL Y GALAN |... Dept. de Biologia Vegetal L, Universidad Complutense de Madrid,
Madrid, Spain 28040
capt J. GASTONY Dept. of Biology, Indiana University, Bloomington, IN 47405-6801
MS CREE ee rect seats ces Biology Dept., Grand Valley State sores Allendale, MI 49401
CERSTORHER H. HAUFLER BONES aan er Dept. of Ecology and Evolutionary B gehts gee of Kansas,
66045-2106
R. JAMES HICKEY Dept. of Botany, Miami inne Oxford OH 45056
PAULO LABIAK ....... © Ueienidade Federal do Parana, ioe de Botanica, 81531-980, Curitiba-PR, Brasil
ROBBIN C. MORAN .. New York Botanical Garden, Bronx, “NY 10458-5126
NATHALIE NAGALINGUM sala oe Garden Sydney, Sydney, NSW, Australia
CARL ROTHFELS tany Dept., Duke University, Durham, = 27708
AILY SESSA Botany Dept., Sad wa — —. Madison, WI 53706
MICHAEL SUNDUE Pringle Herbarium, The University of Vi nt, Burlington, se ee
AMES FH WAIRING JRe oii cic Dept. of ile Coles chive: Hamilton, NY 13346
The “American 5; Journal” ae 0002-8444) is an a quarterly devoted to the general study of
ferns. It is owned by the American Fern Society, and published at The American Fern Society, % Missouri
Botanical penis r 0. Box 299, St. apes MO 63166-0299. Periodicals postage paid at St. Louis, MO, and
for back issues should be addressed to Dr. James D. Alt oto 7 Ill, 804 Salem Blvd., Berwick, PA
_ 18603-9801.
Back a are avalible “at most years as rarest issues or on pu . Pl ntact the Back Issues
—— for ns and aveiointity.
«Sosy Menten - USA ‘Canada M i (ine ludes J | and Fiddlehead F ) $30
. = r s _ $40

. Regular Membership ae Fiddlet pits
. siege seeporinn * Sabo USA, Canal, Meio $50 elsewhere (-$3 agency fee)
; address changes to mney Deon Recent

—— FO. Box 299,

American Fern Journal 102(3):191—197 (2012)

Farina Production by Gametophytes of Argyrochosma
nivea (Poir.) Windham (Pteridaceae) and its
Implications for Cheilanthoid Phylogeny
Jos—E Maria GapriEL Y GALAN and CARMEN PRADA

Departamento de Biologia Vegetal I, Universidad Complutense de Madrid, Avda.
Jose Antonio Novdis, 2, 28040 Madrid (Spain)

AssTract.—Modern molecular phylogenetic studies of the Pteridaceae have recognized a well
supported cheilanthoid clade that includes four major subclades: myriopteroids, pellaeoids,

adaptation to xeric environments. Faced with the apparent lac] PpOroy is p

the cheilanthoid subclades, farina production by gametophytes has been proposed as a character of
possible phylogenetic utility. All the notholaenoid species observed to date produce farina in their
gametophytes, but species of the other cheilanthoid clades (pellaeoids, hemionitidoids, and

gametophyte of a non-notholaenoid: two accessions of Argyrochosma nivea from different
geographical localities were found to have farina on their gametophytes, suggesting that this
gametophytic character is not a synapomorphy for the notholaenoids, and may have had several
independent evolutionary origins.

Key Worps.—Pteridaceae, cheilanthoids, Argyrochosma, farina, gametophyte, Notholaena

Pteridaceae is a large family with ca. 50 genera and about 1000 species. In its
modern conception it is monophyletic and includes, among others, the
Adiantaceae and Vittariaceae (Smith et al., 2008). However, internal
relationships within the family and circumscription of many genera are still
under review. Based on recent molecular analyses, five monophyletic groups
can be recognized: cryptogrammoids, ceratopteridoids, pteridoids, chei-
lanthoids and adiantoids (Schuettpelz et al., 2007; Schuettpelz and Pryer,
2008; Smith et a/., 2008). Cheilanthoid ferns comprise around 400 species, and
form a very well supported clade (Gastony and Rollo, 1995; Schuettpelz and
Pryer, 2007). Within this group, molecular studies suggest the existence of four
major clades (Fig. 1): myriopteroids, pellaeoids, hemionitidoids, and notho-
laenoids (Rothfels et al., 2008; Windham et al., 2009). Cheilanthoid taxonomy
is particularly difficult, due to their great morphological diversity (for ex-
ample, in frond architecture and presence of pseudoindusium) and to
convergent evolution resulting from their adaptation to arid environments
(Rothfels et a/., 2008). In this last sense, one of the most confusing characters is
the presence of farina in the sporophytes. Farina is a white or yellow powder,
produced by glandular hairs and of variable composition, but often containing
flavonoids. Farina is produced by sporophytes of a number of species within
each of these cheilanthoid subclades, and is thus a homoplastic character.

192 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 3 (2012)

myriopteroids

pellaeoids
(incl. Argyrochosma)

me:
a rt
60 eee ee
SES eee

hemionitidoids
SS aes notholaenoids

7
UA
‘6

Fic. 1. Simplified to-date phylogenetic scheme of cheilanthoid clade (Pteridaceae), showing the
position of Argyrochosma within the pellaeoids. A hypothetical history of gametophyte evolution
has been represented over this tree: non-farinose gametophyte is the ancestral condition, shared by
all the lineages except the notholaenoids.

Some morphological characters, however, may function as synapomorphies
for some of the cheilanthoid lineages. One of these potential synapomorphies
is the production of farina by the gametophyte (Rothfels et al., 2008). All
notholaenoid species observed to date produce farina on their gametophytes,
but those of the other cheilanthoid subclades (pellaeoids, hemionitidoids,
myriopteroids) do not (Fig. 1). Thus, the presence of farina in the gametophyte
is potentially an important feature for defining the notholaenoid group. This is
very interesting, given the traditional lack of attention paid by taxonomists to
gametophytic characters, a fact that is likely attributable to their reduced levels
of morphological variation.

ochosma is a New World genus, segregated from Notholaena R. Brown
some decades ago (Windham, 1987), and comprises around 16 species (Sigel
et al., 2011). Argyrochosma nivea (Poir.) Windham consists of a complex of
three mainly apogamous taxa, considered as varieties: two of them, var. nivea
and var. flava (Hook.) Ponce, produce farina on their sporophytes, and the
other, var. tenera (Gilles ex Hook.) Ponce, has glabrous (non-farinose)
sporophytes (Sigel et al., 2011).

The haploid phase of A. nivea var. nivea is very well known, from studies on
spore morphology (Morbelli et al., 2001), spore germination and gametophyte
development (Gabriel y Galan, 2011) and reproduction via apogamy (Woronin,

GABRIEL Y GALAN & PRADA: FARINA IN GAMETOPHYTES OF ARGYROCHOSMA NIVEA 193

1907; Gabriel y Galan, 2011). These studies report the gametophyte of A. nivea
as non-farinose, in agreement with the pellaeoid gametophyte concept
described above.

Nevertheless, as relatively few cheilanthoid gametophytes have been studied,
more effort is required before accepting definitively the synapomorphic status of
gametophytic farina for the notholaenoids. With this in mind, and within a
broader framework of observing morphology, development, and reproduction of
Pteridaceae gametophytes, the goal of the current study was to determine if other
A. nivea varieties besides var. nivea also produce non-farinose gametophytes.

MATERIAL AND METHODS

Samples of Argyrochosma used in this study were collected from the
following locations: Argyrochosma nivea var. nivea: Peru, Cuzco Department,
Urubamba Province, Ollantaytambo, beyond Huillog, 13°14'50.5”S
72°15'28.8"W, 2920 m, in rocks, JM Gabriel y Galdn, 28-04-2008. Argentina,
Catamarca, El Alto Department, Sierra de Ancasti, between El Portezuelo and
El Alto, 28°27'52”S 65°35'10”W, 1855 m, granite rocks, Prada, 16-09-2010.
Argyrochosma nivea var. flava: Argentina, Cordoba, San Alberto Department,
Quebrada Los Pozos, dique La Vifia, 31°52'24"S 65°01'54”W, 910 m, granite
rocks, Prada, 17-09-2010. Material was identified following local floras (Tryon
and Stolze, 1989; de la Sota et al., 2009), and is deposited in the Herbarium of
the Real Jardin Botanico de Madrid (MA).

Spore samples for cultures were taken from two different sporophytes at each
location and kept dry at room temperature. Multispore cultures on mineral agar
medium (Dyer, 1979) were established by manually removing spores from fertile
pinnae on a weigh paper, and placing them in Petri dishes 6 cm in diameter. The
sowing of each sample was replicated three times. Gametophytes were grown
under fluorescent light on a 12-h light, 12-h dark cycle at 20 + 2°C, for c.
8 months. At different stages of maturity, random gametophyte samples of each
culture were stained with chloral hydrate acetocarmine (Edwards and Miller,
1972). Fixed and in vivo materials were mounted in water and observed undera
light microscope. In total, c. 150 gametophytes were assayed, c. 50 of each of the
three samples (two of var. nivea and one of var. flava).

RESULTS

Both varieties of Argyrochosma nivea produced cordate gametophytes
following the Vittaria type of development, although a notable number of
prothalli acquired an irregular shape. Because description of the development
and complete morphological features of the gametophytes exceeds the
objectives of this work, we will focus specifically on farina production.

Gametophytes of A. nivea var. flava remained glabrous throughout the
observational period. In contrast, some of the gametophytes of A. nivea var.
nivea, about 20% of the total observed, produced short glandular hairs along
their margin, which produced farina with time (Fig. 2). With very few

194 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 3 (2012)

Fic. 2. Farina production in gametophytes of Argyrochosma nivea var nivea. A-B: pametophytes

with glandular hairs and white farina, under transmitted light bino
incident light binocular microscope ‘(B); gg= ‘gametophyte g fe sae peg ‘eapogamneus sporophyte
glands. C: detail of hair witht ie tari maiatracoe (arrow).
D: detail of a gland it ith the fari sh Be “A i gth ns g ). Bar= 0.12 cm
in A-B; 20 um in C; 14 um in D.

exceptions, these hairy gametophytes were those with cordate shape. The
morphology of the hairs was constant in all the gametophytes: two cells, a
more-or-less elongated basal one and a capitate secretory apical one. The hairs
aeons more abundant near the apical notch, but they also spread towards
the w

Thes e marginal gametophytic trichomes could be detected towards maturity
of the gametophytes, which occurred 30-40 days after sowing. Their

GABRIEL Y GALAN & PRADA: FARINA IN GAMETOPHYTES OF ARGYROCHOSMA NIVEA 195

emergence coincided in time with the first visible indications of an apogamous
sporophyte, which was the production under the notch of 2-5 very long hairs
that finally reached up to 40 cells. These hairs associated with the apogamous
sporophyte were very different to the ones of the gametophyte. All the
gametophytes that produced sporophytes (about 75% of the total observed)
also formed these long hairs associated with the sporophytes, but not all
produced short marginal ones. Secretion of white farina by the marginal
gametophytic hairs began within a few days following their formation. All of
the observed marginal hairs produced farina. Sometimes, the long glandular
hairs associated to the apogamous sporophyte produced farina also.

While the long glandular hairs elongated and the short hairs began to
produce farina, proliferative areas appeared below the notch that gave rise to
the new apogamous sporophyte. Some 3-5 days later, a dense cluster of cells
emerged from these areas and began to produce 2-6 celled hairs that also
secreted farina. Finally, as the new sporophyte elongated and acquired a leafy
shape, glandular hairs appeared over its margins and lamina.

DISCUSSION

Observations to date of cheilanthoid gametophytes have shown that
development of naked, hairless, non-glandular bodies predominates (Nayar
and Kaur, 1971; Gabriel y Galan and Prada, 2009). Some gametophytes were
known to produce hairs, however (Gabriel y Galan and Prada, 2010), and less
frequently, even glandular secretions including farina (Tryon, 1947; Giauque,
1949; Nayar and Kaur, 1971; Atkinson, 1973).

Following the availability of molecular phylogenies, it became clear that all
the glandular farinose gametophytes observed were restricted to members of
the notholaenoid lineage (Rothfels et al., 2008). This was then proposed as a
synapomorphic character supporting the notholaenoid clade, although with
caution, due to the small number of observed gametophytes, (Rothfels et al.,
2008; Sigel et al., 2011).

In this work we document for the first time farina production in gametophytes
of the pellaeoid species Argyrochosma nivea. As far as is known, there are only
three previous studies on gametophytes of Argyrochosma, one of A. incana (C.
Presl) Windham (Nayar and Bajpai, 1964) and two of A. nivea (Woronin, 1907;
Gabriel y Galan, 2011). All of these studies described naked, non-farinous
gametophytes. The new observations made in this work report the presence of
marginal glandular hairs in some of the gametophytes, which produce white
farina at maturity. Timing in farina production is quite delayed in comparison
with other known farinous gametophytes, as in some Notholaena (Nayar and
Kaur, 1971): in Argyrochosma the phenomenon seems to occur towards game-
tophyte maturity. Several characters of the gametophytic farina indicate that it is
independent of the sporophytic farina, including hair morphology (2-celled
farinous gametophytic hairs vs. up to 40-celled first sporophytic farinous hairs),
timing and amount of farina production (marginal gametophytic farina appears
days before the proliferative clusters of sporophytes produce signals of farina,

196 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 3 (2012)

and reduced farina production by the gametophyte compared to the sporophyte
is similar to that in some notholaenoid species [Nayar and Kaur, 1971]), and
location of farinose cells (marginal hairs develop near the notch but also in the
wings). However, gametophytic farina appears identical to that produced by the
sporophytes, in both color and texture, as seen under a microscope. Chemical
analyses to confirm these observations should be undertaken.

Farina production in gametophytes of A. nivea var. nivea seems to be

facultative, as only some individuals from each of the two different localities
showed the character, while the majority remained glabrous. There is no ob-
vious correlation between farina production and ecology by which to explain
this facultative nature, as all of the sporophytes collected for this work lived
under the same xeric conditions in exposed rock crevices, at more or less
similar altitude. It may be that farina production in the gametophyte is
triggered by the development of the apogamous sporophyte, because farina
production by the gametophytes only occurs at gametophytic maturity. This
deserves further investigation, but if this hypothesis is considered, it will be
necessary to explain why some gametophytes produced sporophytes but not
farina.
Whatever the trigger for farina production may be, its occurrence in game-
tophytes of Argyrochosma is no longer in doubt. The presence of farinous
gametophytes in members of the pellaeoid subclade of cheilanthoid ferns
indicates that this character should no longer be considered a synapormorphy
for the notholaenoids. It seems that farina production by gametophytes, like
farina production by sporophytes, is a convergent character within chei-
lanthoids, appearing independently in at least the notholaenoid and pellaoid
lineages (Rothfels et al., 2008; Sigel et al., 2011). In addition to observation of
more gametophytes from all the Pteridaceae lineages, a more detailed
ecological study is necess in order to determine which variables may
influence farina production in gametophytes of A. nivea.

AACKNOWLEDGMENTS

Field trips were made with financial support from the Spanish Red Universitaria de
Investigacién sobre Cooperacién para el Desarrollo geass G07/10) and the Ministerio de Ciencia
e Innovacién (project CGL 2009-13622, Subprograma BOS).

LITERATURE CITED

ATKINSON, L. R. 1973, The gametophyte and family relationships. J. Linn. Soc. Lond. Bot. 67:73—-90.

DELA SOTA, ., M. L. Luna, G. E. Grupice and J. P. Ramos Giacosa. 2009. Sinopsis de las pteridofitas
de la provincia de San ee (Argentina). Bol. Soc. Argent. Bot. 44:367-3

Dyer, A. 1979. The culture of fern gametophytes for experimental Sate Pp. 254-305, In: A.
Dyer, ed. The experimental pies of ferns. Academic Press, Lon

Epwarps, M. E. and J. H. Miter. 1972. Growth prwreiee by ethylene in on gametophytes .3.
Inhibition of spore aria eh Am. J. Bot. 59:458—465.

GasriE Y GALAN, J. M. 2011. Gametophyte development and reproduction of Argyrochosma nivea
(Poir.) Windham (Pteridaceae). Biologia 65:50-54.

GABRIEL Y GALAN & PRADA: FARINA IN GAMETOPHYTES OF ARGYROCHOSMA NIVEA 197

GasrigL Y GALAN, J. M. and C. Prapa. 2009. Gametophytes of Pleurosorus papaverifolius (Kunze) Fee
(A reps aul and Cheilanthes glauca (Cav.) Mett. (Pteridaceae), two South American fern.
a Bot. Bras. 23:805-811.
oe Y ea J. M. and C. Prana. 2010. Wai Besta of the Andean fern Cheilanthes pilosa
Goldm. ee Amer. en as 0:32-3

Gastony, G. J. and D. R. Roto. 199 a ic ci ipti f cheilanthoid ferns
Se ie at ideas inferred ae rbcL nucleotide ‘sequences. Amer. Fern J.
1-3
GIA ue, M. F. A. 1949. Wax glands and prothallia. Amer. Fern J. 39:33—

Pandan M. A., M. M. Ponce, C. C. Mactur and M. R. Pingo. 2001. Palynology of South American
Argyrochosma and Notholaena (Pteridaceae) species. Grana 40:

Nayar, B. K. and N. Bajpai. 1964. Se diag ca = cy gametophytes of some species of Pellaea and
Notholaena. J. Linn. Soc. Lond. Bot

Nayar, B. K. and S. Kaur. 1971. ance fe a ferns. Bot. wes 37:295-396.

Rotures, C. J., M. D. WinpHam, A. L. Grusz, G. J. Gastony and K. M. Pryve . 2008. Toward a
monophyletic Notholaena (Pteridaceae): resolving patterns of pees bata convergence in
xeric-adapted ferns. Taxon 57:712-724.

SCHUETTPELZ, E. and K. M. Prver. 2007. Fern be inferred from 400 leptosporangiate species
and three plastid genes. Taxon 56:1037-1

ScHUETTPELZ, E. and K. M. Pryer. 2008. Fern ee Pp. 395-416, In: T. A. Ranker and C. H.
Hauffler, eds. Biology and evolution of ferns and lycophytes. Cambridge University Press,
Cambridge.

SCHUETTPELZ, E., H. Scunemer, L. Hurer, M. D. WinpHam and K. M. Pryrr. 2007. A molecular
phylogeny of the ton family Ptoridaceas: Assessing — relationships and the affinities of
auabpeeed unsampled genera. Mol. Phylogenet. Evol. 4

SIcEL, E. M., M. D. WinpuaM, L. Hurt, G. ar KIEVYCH and K, - pel 2011. Species Segre

and farina evolution in the Cheilanthoid fern genus Argyrochosma (Pteridaceae). Syst. Bot

54-564.

SmitH, A. R., K. M. Pryer, E. ScHuetrpetz, P. Koraut, H. ScHNEwer and P. G. Wor. 2008. Fern

Tryon, A. F. 1947. Glandular ones of Notholanea standleyi. Amer. Fern J. 37:88—89.

Tryon, R. M. and R. G. Stouze. 1989. ri ag aa of Peru. Part. II: soune asd Conidae ie
Fieldiana Bot., new series 22:1—-128

WinpuaM, M. D. 1987. Argyrochosma, a new genus of cheilanthoid ferns. Amer. Fern E77:37-41.

WinpuaM, M. D., L. one, E. ScHUETTPELZ, A. L. Grusz, C. J. RoTHFELS and J. Beck. 2009. Using Plastid

Weteae H. 1907. Apogamie und Aposparie bei einigen Piensa. Ber. Deutsch. Bot. Ges. 25:115-135,

American Fern Journal 102(3):198—207 (2012)

Cytotoxic and Tripanocide Activities of Pityrogramma
calomelanos (L.) Link.

TEOGENES M. DE Souza*, Maria F. B. M. Braca, RoGERIO A. SARAIVA,
Pasio A. Nocara, Diones C. BuENo, ALINE A. BOLIGON, MARGARETH L. A. FONE,
and JoAo B. T. pA RocHa
Laboratério de Microbiologia e Biologia Molecular, Universidade Regional do Cariri, Crato (CE), Brasil
MiriAM RoLon, CELESTE VEGA, and ANTONIETA Rojas DE ARIAS
Centro para el Desarrollo de la Investigacién Cientifica (CEDIC), Fundacién Moisés Bertoni/
Laboratorios Diaz Gill, Asuncién-Paragua
Jose G. M. Costa
Laboratério de Pesquisa em Produtos Naturais, Universidade Regional do Cariri, Crato (CE), Brasil
IRWIN R. ALENCAR DE MENEZES
Laboratério de Farmacologia e Quimica Molecular, Universidade Regional do Cariri, Crato (CE), Brasil
HENRIQUE D. M. CoutinHo and ANTONIO A. F. SARAIVA
Laboratério de Microbiologia e Biologia Molecular, Universidade Regional do Cariri, Crato (CE), Brasil

ApstTract.—Chagas disease is nsec by T: i, and i idered a public health problem.
The current treatments for this the synthetic drugs nifurti d benzonidazol, which are

ianiy keee Pityrog I e t 1 in traditi ] dici t, analgesic

rthagic, pectoral depurative gogue, anti-hypertensive, anti i-pyretic and an; anti-tussive

ae 7 +h ] 1] lomelanos

repared and tested against I: cruzi sal (CL B5 pgriaecy The effective concentration os of killing

aie ‘Parasites (EC;,) was 55.26 g/mL and 73.57 pg/mL for the ethanol extract and hexane fraction,

respectively. This is the first record of tripanocidal activity for P. calomelanos. Our results indicate that

P. calomelanos could be a source of antiepimastigote natural products with only moderate toxicity
toward healthy human cells.

Key Worps.—Antiepimastigote activity, Chagas disease, cytotoxicity, Pityrogramma calomelanos

Developing countries with abundant traditional knowledge and rich bio-
diversity, as in the case of Brazil, still grapple with a high incidence of so-called
“neglected diseases,” such as tuberculosis, malaria and Chagas disease (Croft et al.,
2005); diseases that have the potential to be treated with natural products of plant
origin from Brazil (Croft et al., 2005). Brazil has the greatest biodiversity in the
world, with more than 55,000 species of plants cataloged, and an estimated total of
550,000 species (Croft and Sundar, 2006), but only 8% have been studied in the

search for bioactive compounds (SimGes et al., 2007).
Chagas disease is caused by the flagellate protozoan Trypanosoma cruzi,
transmitted mainly by the insects from the genus Triatoma, representing a

* Corresponding author: Departamento de Quimica Biolégica, Universidade Regional do Cariri —
URGA, Crato-CE, Brasil. Rua Cel. Antonio Luis 1161, Pimenta, 63105-000. Fone: +55(88)31021212;
Fax +55(88) 31021291. E-mail: teogenesms@yahoo.com.br

DE SOUZA ET AL.: P. CALOMELANOS AND T. CRUZI 199

public health problem in South America with 20 million people infected and
90 million at risk in endemic areas (WHO, 2000). The parasite can be trans-
mitted to humans by triatomine insects, foods contaminated with feces, blood,
organ transplants, and by the transplacental route (Prata, 2001).

The treatment of this disease remains ineffective. Several compounds have
been tested to evaluate their ability to eliminate infection by T. cruzi (Lana and
Tafuri, 2005). Two drugs are currently used: nifurtimox and benzonidazole.
These drugs are active against the parasite blood and tissue forms. However, side
effects of these drugs are the most significant argument against their general use:
the use of nifurtimox is associated with weight loss, psychic alterations and
gastric problems; the use of benzonidazole is associated with cutaneous prob-
lems such as hypersensitivity, dermatitis, edema, fever, lymphadenopathy and
muscle pain (Castro et al., 2006).

Due to these side effects, there is an urgent need for the development of new
drugs, and a source for these new drugs can be natural products with anti-T.
cruzi activity (WHO, 2002). Coura and Castro (2002) reported that several
herbal products, such as alkaloids, taxoids, estilbenoids, hormones, propolis,
naphthoquinones and crude extracts from plants, have activity against T.
cruzi. In their work, Menezes et al. (2005) related that coumarinic compounds
with the highest binding affinity, such as chapelin, isolated from Rutaceae
species promoted the inhibition of glyceraldehyde-3-phosphate dehydroge-
nase (GAPDH). In this binding study, the affinity of the compounds was
determined by their ability to displace NAD+ from the enzyme receptor site.
The inhibition of this enzyme affects the process of energy generation by
glycolysis in the amastigote forms of T. cruzi.

Pityrogramma calomelanos (L.) Link. (Pteridaceae), known in Brazil as
“avenca-branca” or ‘“‘avenca-preta” is used as an ornamental and medicinal
plant. This fern has several biological properties reported in the literature such
as astringent, analgesic, anti-hemorrhagic, anti-hypertensive, anti-pyretic,
anti-tussive (Barros and Andrade, 1997). Many compounds from the leaves
of P. calomelanos that have been isolated are flavonoids, [(8-phenylpropiony]l)-
5,7-dihydroxydihydroneoflavone] and {8-[3-(4-p-methoxyp] yl)porpiony]]
7-dihydrodihydroxyneofl } named calomelanol (Fujio et al., 1991),
terpens, as calomelanolactone (Victor et al., 1978) and chalcones, as 2’ 6’.
dihydroxy-4’,4’-dihydroxychalcone (Sukuruman and Ramadasan, 1991). Due
to the social and economic importance of Chagas disease and the absence of
studies reporting on the effect of this fern against T. cruzi, the purpose of this
work was to demonstrate the anti-Trypanosoma activity of Pityrogramma
calomelanos.

MATERIALS AND METHODS
Plant Material

Leaves of Pityrogramma calomelanos were collected in the rainy season
(September, 2009) in the city of Crato, Ceara State, Brazil. The plant material

200 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 3 (2012)

was identified by Dr. Antonio Alamo Feitosa Saraiva and the voucher speci-
men was deposited with the identification number 5570 in the Herbarium
“Dadrdano de Andrade Lima” of University of the Region of Cariri, Crato, CE,
Brazil.

Preparation of Ethanol Extract (EEPC) and Hexane Fraction (HFPC) of
Pityrogramma Calomelanos

Nine hundred fifty grams of leaves were dried and kept at room temperature.
The powdered leaf material was macerated using 1 L of 95% ethanol as the
solvent for 72 h at room temperature. The mixture was filtered and con-
centrated under vacuum in a rotary evaporator under 60°C and 760mm/Hg of
temperature and pressure, respectively (Brasileiro et al., 2006). Nine hundred
fifty grams of aerial parts yielded 50 g of ethanol extract (EEPC). After this, 40 g
of EEPC were dissolved in 95% ethanol mixed with silica gel (Merck®) and
fractionated with hexane by percolation with the solvent. The hexane fraction
(HFPC) was concentrated under vacuum in a rotary evaporator under 60°C and
760 mm/Hg of temperature and pressure, producing 0.56 g of HFPC. The
hexane was chosen to extract nonpolar compounds of the EEPC. After this, the
ethanol extract and hexane fraction were diluted using 1 mL of DMSO to the
assays.

Phytochemical Screening

The qualitative phytochemical assays were performed to detect the presence
of secondary metabolites. The tests are based in the visual observation of color
modifications or by precipitation after the use of reagents to detect each group
of secondary metabolites. The tests were performed according Matos (2009).

Quantification of Phenolics Compounds of Hexane Fraction by HPLC-DAD

Reverse phase chromatographic analyses were carried out under gradient
conditions using C,g column (4.6 mm X 250 mm) packed with 5 um diameter
particles; the mobile phase was water containing 2% acetic acid (A) and
methanol (B), and the composition gradient was: 5% of B until 2 min and
changed to obtain 25%, 40%, 50%, 60%, 70% and 100% B at 10, 20, 30, 40, 50
and 80 min, respectively, following the method described by Laghari et al.
(2011), with slight modifications. The fern extract was analyzed and dissolved
in hexane at a concentration of 3 mg/mL. The presence of six phenolic com-
pounds was investigated, namely, gallic, chlorogenic and caffeic acids and the
flavonoids quercetin, rutin and kaempferol. Identification of these compounds
was performed by comparing their retention time and UV absorption spectrum
with those of the commercial standards. The flow rate was 0.6 mL/min, in-
jection volume 40 uL and the wavelengths were 254 nm for gallic acid, 325 nm
for caffeic and chlorogenic acids, and 365 nm for quercetin, rutin and kaem-
pferol. The hexane fraction and mobile phase were filtered through 0.45 um

DE SOUZA ET AL.: P. CALOMELANOS AND T. CRUZI 201

membrane filter (Millipore) and then degassed by ultrasonic bath prior to use.
Stock solutions of standard references were prepared in the HPLC mobile
phase at a concentration range of 0.020-0.200 mg/mL for kaempferol, quercetin
and rutin; and 0.050—-0.250 mg/mL for gallic, caffeic and chlorogenic acids.
The chromatography peaks were confirmed by comparing retention time with
those of reference standards and by DAD spectra (200-400 nm). All chromatog-
raphy operations were carried out at ambient temperature and in triplicate.

Cell Strains Used

For in vitro studies of Trypanosoma cruzi, the clone CL-B5 was used (Buckner
et al., 1996). The stable parasite, transfected with Escherichia coli (lacZ) that
have the gene coding for B-galactosidase, was kindly provided by Dr. F. Buckner
through Instituto Conmemorativo Gorgas (Panama). Epimastigotes were grown
at 28°C in liver infusion tryptose broth (Difco, Detroit, MI) with 10% fetal bovine
serum (FBS) (Gibco, Carlsbad, CA), penicillin (Ern, S.A., Barcelona, Spain) and
streptomycin (Reig Jofr’e S.A., Barcelona, Spain), as described previously (Le
Senne et al., 2002), and harvested during the exponential growth phase.

Murine J774 macrophages were grown in plastic 25 uL flasks in RPMI 1640
medium (Sigma®; with glutamine, without bicarbonate and phenol red
indicator), supplemented with 20% heat inactivated (30 min, 56°C) fetal
bovine serum (FBS) and penicillin G (100 U/mL) and streptomycin (100 ug/
mL) in a humidified 5% CO,/95% air atmosphere at 37° C. For the exper-
iments, cells in the pre-confluence phase were harvested with trypsin. Cell
cultures were maintained at 37°C in a humidified 5% CO, atmosphere. Cell
viability was evaluated colorimetrically with resazurin according to a
previously described method (Rolon et al., 2006).

Reagents

Chlorophenol red-B-D-galactopyranoside (CPRG; Roche, Indianapolis, IN)
was dissolved in 0.9% Triton X- 100 (pH 7.4). Penicillin G (Ern, S.A.,
Barcelona, Spain), streptomycin (Reig Jofre S.A., Barcelona, Spain). Resazurin
sodium salt was obtained from Sigma-Aldrich (St Louis, MO) and stored at 4°C
protected from light. A solution of resazurin was prepared in 1% phospha-
tebuffered solution (PBS), pH 7, and filter sterilized prior to use.

Epimastigote Susceptibility Assay

The screening assay was performed in 96-well microplates with cultures that
had not reached the stationary phase, as described (Vega et al., 2005). Briefly,
epimastigotes were seeded at 1 X 10° mL * in 200 uL of liver tryptose broth
medium. The plates were then incubated with EEPC and HFPC (0.1-50 ug/mL)
at 28°C for 72 h, at which time 50 wL of CPRG solution was added to give a final
concentration of 200 uM. the plates were incubated at 37°C for an additional 6 h
and were then read at 595 nm. Nifurtimox was used as the reference drug. Each

202 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 3 (2012)

concentration was tested in triplicate. Each experiment was performed twice
separately. The efficacy of each compound was estimated by calculating the
antiepimatigote percent (AE%).

Cytotoxicity Assays

Murine J774 macrophages were seeded (5 x 10* cells/well) in 96-well flat-
bottom microplates with 100 uL of RPMI 1640 medium. The cells were allowed
to attach for 24 h at 37°C, 5% COnz, after which the medium was removed and
replaced with medium containing different concentrations of treatment.
Macrophages were incubated with treatment for another 24 h. Growth controls
were also included. Afterwards, 20 uL of 2 mM resazurin solution was added
and plates were returned to incubator for another 3 h. to evaluate cell viability.
The reduction of resazurin was determined by dual wavelength absorbance
measurement at 490 nm and 595 nm. Background was subtracted. Each con-
centration was assayed three times. Blanks include medium and treatment
only. The cytotoxicity of each compound was estimated by calculating the
cytotoxic percentage (EC;,), cells surviving/cells dead.

Statistical Analysis

The statistical analysis was performed using Prism program 5.0. The
effective concentration (EC;,) was calculated by the linear regression method.

RESULTS AND DISCUSSION

The phytocompounds are shown in Table 1. Two groups of substances were
observed in the hexane fraction but not detected in the ethanol extract:
flavonols and chalcones.

HPLC Analysis

Due to the results obtained with the hexane fraction, this product was subjected
to HPLC analysis for quantification of phenol compounds. HPLC fingerprinting of
hexane fraction of Pityrogramma calomelanos revealed the presence of the gallic
acid (tg = 17.83 min; peak 1), chlorogenic acid (tg = 28.14 min; peak 2), caffeic
acid (tp = 34.09 min; peak 3), quercetin (tp = 49.78 min; peak 5) and kaempferol
(tp = 58.96 min; peak 6) (Fig. 1 and Table 2). The HPLC analysis, according to the
chemical analysis, revealed the presence of flavonoids (quercetin and kaempferol)
and phenolic acids (chlorogenic and caffeic acids) in the HFPC.

Our results indicate that HFPC, when tested at a concentration of 50 ug/mL,
was active against epimastigote forms of T. cruzi, killing 71% of the parasites
with 0% cytotoxicity. This article is the first report relating the chemical
composition of P. calomelanos with the trypanocidal activity. Hayacibara et al.
(2005) reported that the chemical composition of propolis (a resinous mixture
collected by honey bees from tree buds, flowers or other botanical sources) is

DE SOUZA ET AL.: P. CALOMELANOS AND T. CRUZI 203

TaBLe 1. Phytochemical screening of ethanol extract and hexane fraction of Pityrogramma
calomelanos (L.) Link.

METABOLITES

ee

EEPC + - - + + = + + - - ~ a eS
HFPC = ae = oe ei fk = + ce + =

1 — Alkaloids; 2 - Anthocyanidins; 3 — Anthocyanins; 4 — Aurones; 5 — Catechins; 6 — Chalcones;
7 — Flavones; 8 — Flavonones; 9 — Flavonols; 10 — Flavononols; - enols;: 12 —
Leucoanthocyanidins; 13 Xanthones — 14 — Pyrogallics Tannins; 15 — Saponins; (+) presence;
(—) absence; EEPC (ethanol extract of Pityrogramma calomelanos); HFPC (hexane fraction of
Pityrogramma calomelanos).

rich in phenylpropanoids (chlorogenic and caffeic acids) and Prytzyk et al.
(2003), tested the in vitro activity of the propolis extract against Trypanosoma
cruzi, detecting an interesting activity against epimastigote forms of this
parasite. These results are similar to our work, showing a relationship between
phenylpropanoids and tripanocidal activity. Chalcones isolated from Myrcia
hiemales Camb. demonstrated an inhibitory effect against the cruzaine (Deise
et al., 2006; Silva, 2007). This is one of the most important cysteine-proteases
in Trypanosoma cruzi, being essential for the parasite multiplication (Simeo-
nov, 2008).

Several biological activities associated with flavonoids have been reported.
Quercetin, the most common flavonoid detected in foods, presented antiproto-
zoal effects against Plasmodium falciparum, Leishmania donovani, Trypanoso-
ma brucei and T. rhodesiense (Camacho et al., 2002; Williamson and Finnigan,

UJ

6

EA SS as Pe Re. ie a 2 a ee oe ee oe ee aan co

0 10 20 50 70 min

Fic. 1. Representative high performance liquid chromatography profile of (HFPC), detection UV
was at 327nm. Gallic acid (peak 1), chlorogenic acid (peak 2), caffeic acid (peak 3), rutin (peak 4),
quercetin (peak 5) and kaempferol (peak 6).

204 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 3 (2012)

TaBLE 2. Phenolics and flavonoids composition of hexane fraction of Pityrogramma calomelanos
(L.) Link.

HFPC
Compounds mg/g Percent
Gallic acid - -
pay acid 1.05 + 0.01 a 0.10
Pra cid 4.59 + 0.03 b 0.45
nae ercetin 1.14 + 0.02 a 0.11
Kaempferol 0.93 + 0.01 a 0.09

Results are expressed as mean + standard deviations (SD) of three determinations. Averages
followed by different letters differ by Tukey test at p < 0.005

1978). Ana et al. (2010), demonstrated that quercetin and taxifolin, isolated from
a hexane fraction of Rapanea Jancifolia (Mart.) Mez, demonstrated a low
trypanocidal activity. Takeara et al. (2003) evaluated the quercetin-3-methyl
ether isolated of extract from Lychnophora staavioides Mart. (Asteraceae),
demonstrating a promising potential for the use against T. cruzi, not affecting the
blood cells.

Trypanosoma cruzi Epimastigote Susceptibility Assay

The trypanocidal activity of EEPC and HFPC is shown in Table 3. The re-
sults demonstrated that HFPC was active against the strain CL-B5 strain of T.
cruzi with a concentration 50 ug/mL, inhibiting 71% for T. cruzi (EC59 =
73.57ug/mL). This is impressive due the fact that an ECs. lower than 500 pg/
mL is considered clinically relevant (Rosas et al., 2007). However, the ethanol
extract of P. calomelanos did not show a clinically relevant inhibitory activity
against the epimastigote forms due its toxicity against murine macrophages.

Other plants of the Brazilian flora have shown trypanocidal activity, such as
extracts and fractions of Ampelozizyphus amazonicus Ducke (Rosas et al.,
2007), the ethyl acetate fraction of Camellia sinensis (L.) Kuntze (Paveto et al.,
2004) and polar extracts of Siphoneugena densiflora O. Berg (Gallo et al.,
2008).

Cytotoxic Activity

Also important in the search for active compounds with trypanocidal ac-
tivity is the toxicity against mammalian host cells. J774 macrophages were
utilized to evaluate the cytotoxity and determine the selectivity of EEPC and
HFPC. The results are presented in Table 2. No toxicity was observed at
concentrations of 5, 12, 25, and 50 pg/mL of the hexane fraction. The HFPC
showed a low toxicity against macrophages J774 when compared with Roldos
et al. (2008). In this study, the semi-synthetic compound 1,4-Hydroxylunu-
larin, a derivative hydroxybibenzyl showed a toxic effect against 18.88% of

DE SOUZA ET AL.: P. CALOMELANOS AND T. CRUZI 205

TasLE 3. Percent of parasite lysis induced by ethanol extract and hexane ideas of Pityrogramma
calomelanos against the epimastigote forms of Trypanosoma cruzi CL-B5 s

Concentration
Extract (ug/mL) % AE %SD %-C ECs9
500 91 30 100 55.26
200 i ack 86
100 74 ot fa
EEPC 50 rs Wd 1.8 6
50 4 2 0 taor
25 67 0.7 0
HFPC 42,5 47 0.9 0
10 89.1 aio - 0.91
1 54.9 0.7 -
Nifurtimox 0.5 45.6 4.2 -

% AE — Percent of inhibition of epimastigote forms; %SD — Standard deviation; % C — cytotoxic
effect; EC;, — Concentration with 50% of the maximum activity; EEPC (ethanol extract of P.
sil malaria’, HFPC (hexane fraction of P. calomelanos).

macrophages in a concentration of 21.7 ug/mL. The hexane fraction (HFPC) of
P. calomelanos appears to be promising in the development of new drugs to
treat T. cruzi, mainly due to the low toxic effect in vitro and due the
antiepimastigote activity demonstrated in our work, indicating the necessity to
proceed with in vivo studies.

Conclusion

Our results indicate that Pityrogramma calomelanos could be a source of
plant-derived natural products with antiepimastigote activity and low toxicity,
representing an interesting alternative to other efforts to combat infectious
diseases such Chagas disease.

LITERATURE CITED

Araya, J. E., I. Netra, S. Sitva, R. A. Mortara, P. MANQUE and E. Corbero. 2003. Diterpenoids from
Azorella compacta (Umbelliferae) active on Trypanosoma cruzi. Mem. Inst. Oswaldo Cruz
98:413-418.

Barros, I. C. L. and L. H. C. Anprabe. 1997. Pterid6fitas medicinais (samambaias, avencas e plantas

afins). Recife, Ed. Universitéria da Universidade Federal de Pernam

BrasiLeiro, B. G., V. R. Pizzioio, D. S. RAsLan, C. M. JAMAL and D. Sitverra. as : Actinicnbial and
cytotoxic activities screening of some peer, medicinal plants used in Governador
Valadares ates raz. J. Pharm. Sci. 42:195—202.

BUCKNER, es it C. L. Veruinpe, A. C. La FLAMME — V. W. C. Van. 1996. Efficient technique for

drugs for activity against Trypanosoma cruzi using parasites expressing beta-
plinieres im hia icrob. Agents files ge 2592-2597.

Camacuo, M. D., J. D. PHituipson, S. L. Crorr, D. Maruey, G. C. Kirsy and D C. Waruurst. 2002.
Absesaniout of the antiprotozoal paisa of ia Papp and the toulation of new nor-
pee ere es and nor-friedelanes. J, Nat. Prod. 65:1457-1461.

Castro, J. A., M. M. De Mecca and L. Cc BARTEL. 2006. a side effects of — used to treat
Chagas’ disease (American tripanosomiasis). Hum. Exp. Toxicol. 25:471-4

206 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 3 (2012)

Coura, J. R. and S. L. Castro, 2002. A critical rewiew on Chagas disease chemotherapy. Mem. Inst.
Oswaldo Cruz 97:3—24.
Crort, S. L. and A. H. Sunpar. 2006. Tae ppemorigoniggo ne: iasis. Clin. Microbiol. Rev. 19:111-126.
Crort, S. L., M. P. Barretr and J. A. Ursina. 2005. Chemotherapy of trypanosomiases and
leishmaniasis. Sy se Parasitol. 21: hate
Detse, M. B., M. L. D. C. ALEssanpra, J. N. Ricarpo, . O. Giauctus, A. Y. Rosenpo and D. A. ApriANo,
2006. ae e avaliagao Saree de uma série de Chalconas como inibidores be cruzaina
de Trypanosoma cruzi. In: 29° Reuniao Anual da Bw Brasileira de Quim
Fuyio, A., I. Munexazu, T. THOosuryuki and M. Mizuo. 1991. eorge oe in aoe exudate
from Pityrogramma calomelanos. Phytochemistry 30:3091— ‘
Gatto, M. B. C., A. S. F. Marques, P. C. Vieira, M. F. G. D. Siva, J. : a and M. Sitva. 2008.
Enzymatic Inhibitory activity and trypanocidal effects of extracts and compounds from
Siphoneugena densiflora O. Berg and Vitex polygama Cham. Z. Naturforsch. C 63:371-382.
Hayacipara, M. F Koo, P. L. Rosaten, S. Duarte, E. M. Franco, W. H. Browsen, M. Ikecaki and J. A
Cury 2005. Ia vitro and vivo effects of isolated fractions of Pienian propolis on caries
development. 2 ii ge sae 101:110—-115.
.caprunietes alee ag npr x arse OFAR, Past M. _ ae and A; TADEN. obs Daten ees of free
lic aci d leaves

of ee nies lt album. Food Chem. "126: 1850-1855.
Lana, M. and W. L. Tarurt. 2005. Trypanosoma cruzi e Doenga de Chagas. In: , D. P. Neves, A. L.
Me o, O. Genaro and P. M. Linarp. 2005. mare ate Humana. 11. ed. Sao Paulo: teen

Leire, A. C., A. P. Neto, A. R. P. Amprozin, J. B. FERNANDES, P. C. Vieira, M. F. G. F. Sttva and S.
LBUQUERQUE. 2010. Trypanocidal activity of flavonoids and limonoids isolated from

Myrsinaceae and Meliaceae active a t extracts Rev. Bras. Farmacogn. 20:1-6

Le SENNE, A., S. MUELAS-SERRANO, C. FERN coomeih schesiivses J. A. Escario and A. Gomez-Barrio. 2002.
Biological agueemten ola beta ing cl f Trypanosoma cruzi CL
strain. Mem. Inst. Oswaldo Cruz 97: 1101-110 5.

Matos, F. J. A. 60. Ein UFC. Introdugao 4 quimica experimental, 3:4—74.

Menezes, I. R. J. C., C. A. Lopes, G. O. Montanari, F. M. S. Pavao and V. P. C. CastitHo. 2003. 3D

oO

QSAR adie on binding affinities of coumarin natural pL aenty for glycosomal GAPDH of
Trypanosoma cruzi. J. Comput. Aid. Mol. Des. 17:277-9

Paveto, C., M. C. Gita, M. I. Estreva, V. Martino, J. Coussio and M. M. Fiawid. 2004. Anti
Trypanosoma cruzi activity of Green tea iualic sinensis) Catechine Antimicrob. Agents
Chemother. 48:69—79.

Prata. A. 2001 i logical pect f Ch di Lancet. Infect. Dis. 1:92—100.

Prytzyk, E., A. P. Dantas, K. “SALOMAO, A. S. Pereira, V. S. Banxova, S. L. De Castro and N. F. R.
Aquino. 2003. Flavonoids and trypanocidal activity of Bulgarian propolis. J Ethnopharmacol.
88:189—-193

Rowpos, V., H. Nakayama, M. Roton, A. Montero-Torres, F. Trucco and S. Torres. 2008. Activity of a
hydroxybibenzyl tevonkate constituent against Leishmania spp. and oo cruzi: In
silico, in vitro and in vivo aoe dies. J. Med. Chem. 43:1797-18

Ro on, M., E. Seco, C. Veca, J. J. NoGAL, J. A. ce and A. Gomez-Barrio. ae Selective activity of
polyene macrolides produced a, fried modified Streptomyces on Trypanosoma cruzi.

t. J. Antimicrob. ic 28: 09.

Rosas, L. V., M.S. G. G ea ee Nascimento, A. H. JanuArio and S. C. F

2007. In vitro oahu of the cytotoxic and trypanocidal activities of Mapeloal abe
(

dos flavondides isolados de Myrcia hiemalis (Myrtaceae). apse Federal da Bahia,
Instituto de ea Programa de Pés ~~ em Quimica (MSc sis).

SIMEONOV, A., A. JADHAV, C. : Tuomas, Y. Wanc, R. Huane, N. T. Pane rE. rai) J. Smitu, C. P
Austwn, D. S. apa d J. INGLEse. Bit yp aodonian spectroscopic profiling of compound
libraries. J. Med. Chem. 51:236—37

DE SOUZA ET AL.: P. CALOMELANOS AND T. CRUZI 207

oe G, bee se E. P. SCHENKEL, G. GosMann, J. C. P. MELLO, L. A. Mentz and P. R. Petrovick. 2003.
sia: da — ao medicamento. 5 ed. Porto Alegre/Florianépolis: Editora da
os TE Bditora UFS
SUKURUMAN, K. and K. Bie. 1991. Screening of 11 fernsfor cytotoxic and antitumor potential
4:93-—96

TakearA, R., S. ALBUQUERQUE, N. P. Lopes and J. L. C. Lopgs. 2003. Trypan seats gativity of
Lyc eye staavioides Mart. (Vernonieae, Asericas 4. Phytomedicine 1 0-493.

Veca, C., M. R - R. MarTinez-FERNANDEZz, J. A. Escario and A. Gomez-Barrio. 2005. A new

harmaco lo sate screening assay with Trypanosoma cruzi epimastigotas eue beta-

galactosidase. Parasitol. Res. 95:296-298.

bes B., S. M. Batpwin, H. ae ee Jon. 1978. Sesquiterpenes from Pityrogramma calomelanos.

Phytochemistry 17:275-2

Wiuiamson, J. and T. J. S. Sie 1978. Trypanocidal aioe i peoiae antibiotics and other
metabolic inhibitors. Antimicrob. Agents. Chemother. 13 744.

Wortp HEALTH OrGaNnizaTioN (WHO). 2000. Special aoe me ae Research and nea in
Tropical Disease (TDR). Natural products for parasitic diseases. TDR News 62:

Wor tp HEALTH ORGANIZATION (WHO). 2002. Police perspectives on medicines. Geneva: oe Health
Organization.

American Fern Journal 102(3):208—215 (2012)

Effects of Ageratina adenophora on Spore
Germination and Gametophyte Development of
Neocheiropteris palmatopedata

K. M. ZuHanc and J. H. Liu

College of Forest Resources and Environment, peaahy Forestry University, Nanjing, 210037,

Jiangsu, Chin
X. CHENG
Kunming Institute of Botany, Chinese Academy of Sciences, Kunming, 650201, Yunnan, China
G. F. ZHANG
Yunnan University, Kunming, 650091, Yunnan, China

Y. M. Fanc*

College of Forest Resources and Environment, Nanjing Forestry University, Nanjing, 210037
Jiangsu, China
H. J. ZHANG

Nanjing Forestry University, Nanjing, 210037, Jiangsu, China

Asstract.—As one of the worst invasive alien plant species in China, Ageratina adenophora has
caused serious economic losses and reduced the diversity of native species, possibly due to
allelopathic interactions. However, we have little knowledge of its effects on ferns. In Petri dish
bioassays, the effects of the aqueous leachates from roots, stems and leaves of A. adenophora on
spore germination and gametophyte development of Neocheiropteris palmatopedata were
investigated. All leachates inhibited spore germination and rhizoid growth of N. palmatopedata.

rmore, the inhibitory effects increased with increasing leachate concentrations, and root
leachates exhibited the greatest inhibition. Possible inhibitory causes are discussed in the present
study. Additionally, the gametophytes of N. palmatopedata treated with the leachates of A.
adenophora did not show morphological differences compared with the control. This result differs
from previous studies investigating morphological changes in other fern species when associated
with A. adenophora. Varying sensitivity of different fern species to the same allelochemicals of A.
adenophora may partly be responsible for this difference

—Ageratina adenophora, oe palmatopedata, spore germination, gameto-
phyte pen Ras allelopathic interactio

At present, there are about 170 species of terrestrial invasive plants in China.
Ageratina adenophora Sprengel (Synonym: Eupatorium adenophora) (Asteraceae)
is a very successful invasive species (Sang et al., 2010). It is native to Mexico, where
it is common (Cronk and Fuller, 1995). It first invaded Yunnan Province in China in
the 1940s. Since then it has intensively colonized southwest China, reduced
agricultural production and strongly altered plant community structures (Wang
et al., 2011). It survives and proliferates under various conditions and may

* Author for correspondence - jwu4@njfu.com.cn

ZHANG ET AL.: INHIBITION OF AGERATINA ADENOPHORA TO NEOCHEIROPTERIS
PALMATOPEDATA 209

adversely affect the surrounding vegetation through allelopathic effects in China
(He and Liu, 1990; Song et al., 2000; Yu et al., 2004; Yang et al., 2006; Yang et al.,
2008).

Most previous studies of Ageratina adenophora (Ageratina) have focused on its
deleterious effects on spermatophytes (Wan et al., 2010). It excretes allelochem-
icals into the soil, which hinder the germination and seedling growth of potential
competitors (Sang et al., 2010). However, studies of the effects of A. adenophora
invasion on ferns (including gametophytes and sporophytes) have received
comparatively little attention (Zhang et al., 2007; Zhang et al., 2008a, 2008b).

unnan is one of the richest regions in species diversity in China (Wang and
Wang, 2006), with 762 documented fern species (Kunming Institute of Botany,
Chinese Academy of Sciences, 2006). Our field observations showed that some
ferns failed to establish in pure patches of Ageratina adenophora. Previous
studies by Zhang et al. (2007, 2008a, 2008b) provide strong evidence in support of
the inhibitory effects of A. adenophora on three fern species, Macrothelypteris
torresiana (Gaud.) Ching, Pteris finotii Christ and Cibotium barometz (i.) Son.
Those studies showed that all leachates of A. adenophora inhibited spore
germination and growth of the first rhizoid of the three fern species, and
inhibitory effects increased with increasing leachate concentrations.

Neocheiropteris palmatopedata (Baker) H. Christ (Polypodiaceae) is endemic
to China and is distributed in Yunnan, Sichuan and Guizhou. It is well known
for its ornamental and medicinal value (Lin, 2000; Ding, 1982). Furthermore,
in China, it is rare in the wild (Yu, 1999). Hence, understanding the biology of
N. palmatopedata is of great importance for conservation purposes.

The distribution of Neocheiropteris palmatopedata overlaps with that of
Ageratina adenophora in Yunnan. Allelopathic activity is more readily observed
in the sensitive stage of plant growth (Petersen and Fairbrothers, 1980). In ferns, the
activity is easily detected in stages such as spore germination and gametophyte
development (Petersen and Fairbrothers, 1980). Hence, this study had two main
objectives: (i) to determine the potential effects of A. adenophora on spore
germination and gametophyte development of N. palmatopedata; and (ii) to
examine the allelopathic potential of roots, stems and leaves of A. adenophora.

MATERIALS AND METHODS
Plant Leachates

The effects of Ageratina adenophora leachates on Neocheiropteris palmatopedata
were evaluated in three ways in this study: 1) rate of rhizoid elongation, 2) rate and
percentage of spore germination, and 3) gametophyte morphology. Whole fresh
plants of A. adenophora were collected from Nanjing Forestry University. The root,
stem and leaf leachates were made according to Zhang et al. (2008a) and were
sterilized by passing them through Duropore ® PVDF membrane (0.45 uum,
Carrigtwohill, Co. Cork. Ireland). For the determination of rhizoid elongation, the
sterile leachates were diluted with sterile double-distilled water to give six
concentrations (0, 10, 20, 30, 40 and 50% leachate). For trials of spore germination

210 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 3 (2012)

and gametophyte growth, the sterile leachates were diluted with B; basal medium
(Gamborg et al., 1968) containing 0.7% agar and 2% sugar to give these six con-
centrations. In all the trials, B; basal an containing 0.7% agar and 2% sugar was
used as a control. All media were added at 6 mL per Petri dish (3.4 cm diameter).

Spore Collection, Incubation, Germination and Gametophyte Growth

Spores of Neocheiropteris palmatopedata were collected from 15-20 fertile
fronds with mature but closed sporangia from 15 individuals on December 2010 in
Yunnan University. The collected fronds were immediately sent to Nanjing. The
fronds were unfolded, placed in clean paper bags and air dried at room
temperature. Spores were collected and cleared by a mesh with pores 0.088 mm
in diameter (Zhejiang Shangyu Yarn and Sieve Factory, Shangyu, China) one week
later. About 2 mg of spores was packed into a 1 X 1 cm* bag made of clean filter
paper. Thereafter, the spores were immersed into distilled water and washed five
times in sterile water after surface-sterilizing in 5% sodium hypochlorite for 4 min.
The spore suspension was prepared by adding sterile double-distilled water to the
sterilized spores. Spores were inoculated evenly in each Petri dish at a density of
30 spores/cm? for the determination of thizoid elongation and 400 spores/cm? for
the trials of sp and gamet t. After inoculation, all
Petri dishes were ‘put into larger Petri dishes. (12 cm diameter) to avoid desiccation
and pollution. The larger Petri dishes were placed in the dark at 25 °C for 24 h and
then transferred to fluorescent light (photon flux density 1X10* » mol m * s_*) at
25 °C at 12 h light photoperiod. Five visual fields were observed in each of the Petri
dishes, through a gridding ocular at a magnification of 20 < 1.5 in a microscope
(No. XTS 20130, Beijing Tech Instrument Co., Ltd., Beijing, China).

Germination time was calculated as the time elapsed from sowing to the
observance of the first germinated spore (i.e., when signs of a first rhizoid were
evident). For each dish, fourteen days after the first observed germination, about
400 spores were selected randomly for the calculation of the germination
percentage and also for gametophyte development observation. Thereafter, the
germination percentage was calculated every 6 days until no further increase was
detected. Data for spore germination and gametophyte assays is presented as the
mean value of the three Petri dishes of each treatment.

For the determination of rhizoid elongation, after growing for 2 weeks in
medium without leachate, six healthy gametophytes with uniform rhizoids in
each Petri dish were selected for further observation. Afterwards, all
gametophytes were treated with various leachates. One week later, length of
rhizoid was recorded using a crossed ocular micrometer in a dissecting
microscope (No. XTS 20130, Beijing Tech Instrument Co., Ltd., Beijing, China).

Statistics

The effects of Ageratina adenophora leachates on spore germination and
gametophyte development of Neocheiropteris palmatopedata were analyzed by
ANOVA using the SPSS 10.0 package (SPSS, Chicago, IL, USA).

ZHANG ET AL.: INHIBITION OF AGERATINA ADENOPHORA TO NEOCHEIROPTERIS
PALMATOPEDATA

—@ Root —s— Stem —a— Leaf

Germination time (d)
Db

0 10 20 30 40 50
Leachate concentration (%)

Fic. 1. Germination time of the spores of Neocheiropteris palmatopedata in the control and
treated with root, stem and leaf leachates of Ageratina adenophora after inoculation. Different
letters indicate significantly different (P < 0.05).

RESULTS
Spore Germination

Spores of Neocheiropteris palmatopedata germinated 12 days after inoculation in
the control and continued until 35 days. Root, stem and leaf leachates of Ageratina
adenophora delayed spore germination. The time needed for spore germination
differed among treatments. Spores treated with stem leachates germinated faster than
those treated with root and leaf leachates (Fig. 1). The inhibition of root, stem and leaf
leachates of A. adenophora to spore germination percentage of N. palmatopedata
increased with increasing concentrations (P < 0.05) (Fig. 2). As time went by, the
germination percentages of N. palmatopedata treated with the root, stem and leaf
leachates of A. adenophora went up and then leveled off (P < 0.05) (Fig. 2).

Rhizoid Growth

The root, stem and leaf leachates of Ageratina adenophora inhibited the
rhizoid growth of Neocheiropteris palmatopedata and the inhibitory effect
generally increased with increasing leachate concentrations. Root leachates
were the most potent inhibitor, followed by the leaf leachates (P < 0.05) (Fig. 3).

Gametophyte Development

Gametophyte morphology of Neocheiropteris palmatopedata in the contro]
was in agreement with the previous research carried out by Deng et al. (2009).

Fie: 2:
treated with root (A),

Germination percentage (%) Germination percentage (%)

Germination percentage (%)

AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 3 (2012)

—a— 14d —#—- 21d —#— 28d —e— 35d

A

Leachate concentration (%)

—— 14d —w— 21d —e 28d —e— 35d

Leachate concentration (%)

—s— 14d —*-21d —#-28d —*—- 35d

C

Germination percentage of the spores o d
stem (B) and leaf (C) leachates of Ageratina ge ames Statistically

Leachate concentration (%)

AT, L

significant differences among treatments are indicated by letters above or below lines based on
least significant difference (LSD) multiple comparison tests. Two similar letters indicate no
significant difference between treatments, and dissimilar letters indicate a significant difference
between treatments (P < 0.05).

ZHANG ET AL.: INHIBITION OF AGERATINA ADENOPHORA TO NEOCHEIROPTERIS
PALMATOPEDATA

—=—Stem —#—Leaf —eRoot

Rhizoid elongation (mm)
S
pot
on
l

1 20 30 40
Leachate concentration (%)
G. 3. Mean (+ SD) of the rhizoid elongation of Neocheiropteris palmatopedata in the control

and treated with root, stem and leaf leachates of Ageratina adenophora. Different letters indicate
significantly different (P < 0.05).

The gametophytes produced from the spores treated with the leachates of
Ageratina adenophora did not show morphological differences from the
control.

DISCUSSION

Our results indicated that spore germination of Neocheiropteris palmatopedata
was lower when treated with the root, stem and leaf leachates of Ageratina
adenophora as compared to the control. Spore germination of N. palmatopedata is
essential for its sexual reproduction. If this germination inhibition also occurs in
nature, where spores of N. palmatopedata overlap with plants of A. adenophora,
these leachates could potentially drastically decrease the abundance of this plant in
the community. The delay in germination of N. palmatopedata spores could
severely affect the competition ability of this fern species for resources.

All leachates of Ageratina adenophora inhibited rhizoid growth of Neocheir-
opteris palmatopedata. Furthermore, the inhibitory effects increased with the
increasing leachate concentrations. It is generally believed that the rhizoids of
fern gametophytes function as organs of uptake and absorption. Inhibition of N.
palmatopedata rhizoid growth by the root, stem and leaf leachates could reduce
the ability of gametophytes to absorb water and nutrients, which could affect the
production and potential growth of the future sporophyte and its function in the
community. Racusen (2002) demonstrated that rhizoids were the primary site of
uptake for monovalent cations in the gametophytes of Onoclea sensibilis L.
Kamachi et al. (2005) showed that Athyrium gametophytes had the ability to

214 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 3 (2012)

accumulate lead in the rhizoids. Therefore, we hypothesize that the active
component(s) in the root of A. adenophora entered and accumulated in the
rhizoids of N. palmatopedata, which inhibited the rhizoid elongation of N.
palmatopedata.

In this study, the gametophytes produced from the spores of N. palmatopedata
treated with the leachates of A. adenophora did not show morphological
differences when compared with the control. However, in a study of Macro-
thelypteris torresiana, the rhizoids of the young gametophytes treated with various
root leachates of A. adenophora were erect, curved, or swollen and the curving and
swollen rhizoids increased with the increasing concentrations of A. adenophora
(Zhang et al., 2008a). The gametophytes from the spores of Pteris finotii treated with
higher concentrations of root leachates of A. adenophora suffered morphological
changes (Zhang et al., 2007). This difference might be attributed to differences in
sensitivity to the same allelochemicals.

In our experiments, greater inhibitory effects on gametophyte development
of N. palmatopedata occurred with the root leachates of A. adenophora,
as compared to stem and leaf leachates. This result was consistent with
previous studies, which showed that the root leachates resulted in greater
inhibition than the stem and leaf leachates (Zhang et al., 2007; Zhang et al.,
2008a; Tripathi et al., 1981). However, He and Liu (1990) observed that the
aqueous leaf extracts of A. adenophora were the most allelopathic to the seed
germination of four plants. Tripathi et al. (1981) also reported that the aqueous
extracts of different parts of A. adenophora caused different effects on other
plants. This difference might due to the differences in the sensitivity to same
allelochemicals, concentration of the allelochemicals, or variations in al-
lelochemicals among the tissues. The leachates of A. adenophora were
identified as phenolic compounds (Yang et al., 2006), which might act as the
allelopathic substances (Kim et al., 2005). Further investigation is needed to
better understand the chemistry of the allelopathic activity.

Sustainable management of A. adenophora in China includes ecological
restoration by competitive replacement of A. adenophora and biological control
agents against A. adenophora (Wan et al., 2010). Future efforts will concern the
effective control of A. adenophora as well as its utilization.

ACKNOWLEDGMENTS

This work was supported by the Priority Academic Program Development of Jiangsu Higher
Education Institutions (PAPD), Jiangsu Planned Projects for Postdoctoral Research Funds
(1001078C) and China Postdoctoral Science Foundation funded project (20100481152).

LITERATURE CITED

Cronk, Q. C. B. and J. L. sheesh 1995. Plant invaders: the threat to natural ecosystems. Chapman
and Hall, London, U
Deno, Y. N., omer ee 009. Th hyte devel tand
mechanism of Neocheiropteris ctescedate seenanir daa Fern). Acta Bot. Yunnanica.
31:138—144.

ZHANG ET sg INHIBITION OF AGERATINA ADENOPHORA TO NEOCHEIROPTERIS
PALMATOPEDATA 215

Dine, H. S. 1982. Medicinal pak plants in China. The Science & Technology Press, Beijing, China.

Gampore, O. L., R. A. Minter and K. Oya. 19 ~ Nutrient requirements of suspension cultures of
soybean root cells. “8 Cell Res. a 151-158.

He, A. J. and L. H. Liu. 1990. Effects of water extract of vedguiglecsi adenophorum on the
seria a of several plants. Chin. J. Weed Sci. 4:35—3

Kamacul, H., I. Komori, H. Tamura, Y. Sawa, I. KARAHA’ as , N. Wana, T. Kawanata, K.
Matsupa, S. Ikeno, M. Nocucut and INouE. 2005. Lead soldiers a accumulation in the
oe of the fern Dep agee Ssscas ea J. Plant Res. 118: 137 —1

Kunminc INstrruTe Or Botany, CHINESE ACADEMY OF SCIENCES. 2006. Flora of nah ae Press,
Beijing, China.

Lin, Y. X. 2000. Flora Reipublicae Popularis Sinicae. Science Press, Beijing, China.

Nayar, B. K. and S. Kaur. 1971. Gametophytes of homosporous ferns. Bota Rev. 37:295-396.

PeTerseN, R, L. and D. E. FaiRBROTHERS. 1980. Reciprocal pugs sone, lasanig the gametophytes of
— pe pone and Dryopteris rag Am. Fern. J. 70:7

RacusEn, R. 2002. Early development in fern gametophytes: Kieran the transition to
cans ee in terms of coordinated pealemeeit production and osmotic ion
uptake. Ann. Bot. iy 227-240.

Sane, W. G., L. Zuu and C. J. AXMACHER. 2010. Invasi tt f Eupatorium adenoph Spreng
in southern China. Biol. Invasions. Aa el 1730.

Tripatui, R. S., R. S. Sincu and J. P. N. Rai. 1 i l denoph 3
a dominant ruderal ae of Mégndane Proc. Indian. Acad. Sci. 47: 458-465.

Wan, F. H., W. X. Lru, J. Y. Guo, S. Quanc, B. P : Ua. 1 J. Wane, G. Q: Yane, H. B. Niu, F. R. Gut, W. K.

ANG, Z. L. JIANG and W. 0 Wane. 2010. I I strategy of Ageratina

adenophora (Sprengel). Sci. China Life Sci. 53:1291—1298.

Wane, R., J. F. Wane, Z. J. Qru, B. Menc, F. H. Wan and Y. Z. Wanc. 2011. eee mechanisms

underlie rapid expansion of an invasive dey plant. New Phytol. 191:8

Wane, R. and Y. Z. Wane. 2006. Invasion dynamics and potential spread of ae invasive alien plant
species Ageratina adenophora (Asteraceae) in China. Diver. Distri. 12:397. 8.

Yane, G. Q., F. H. Wan, W. X. Liu and J. Y. Guo. 2008. Influence of two allelochemicals from Ageratina
adenophora Sprengel on ABA, IAA and ZR contents in roots of upland rice seedlings.
ee 21:253-262.

Yan, G. Q., F. H. Wan, W. X. Liu and X. W. Zxanc. 2006. Physiological effects of allelochemicals
tom leachates a Apia adenophora (Spreng.) on rice seedlings. Allelopathy J.
18:237—246

Yu, %. ED. Yu and K. P. Ma. 2004. Relationships between allelopathy ae invasiveness by

Eupatorium edenophoam in —— sites. Acta Phytoecol. Sin. 28:773-7

Yu, Y. F. 1999. The milestone of the work of protecting wild plant of China - The list of Chinese
urgently protected wild plants (the 1st group). Plants. 5:3-11.

ZHANG, K. M., L. Sut, C. D, Jianc and Z. Y. Li. 2007. Influence of root, stem and leaf leachates of
eb adenophora weed on the gametophyte development of Pteris finotii. Allelopathy J.

203-212.

Be ys M., ae SHL, -G D. JIANG jag Z. - Li. 2008a. Inhibition of Ageratina adenophora on spore
J. Integr. Plant Biol.

50: 559-564.
pcan M., L. Sut. C. D. Jianc and Z. Y. Lr. 2008b. Allelopathic effects of F. i d I
ore germination and gametophyte development in Cibotium barometz. Acta Pratac.
Sinica. 7:19—25.

American Fern Journal 102(3):216—223 (2012)

Occurrence of Dark Septate Endophytes in the
Sporophytes of Christella dentata

REBECA GHANTA, SIKHA DutTa*, and RADHANATH MUKHOPADHYAY
Department of Botany, UGC Centre For Advanced Study, The University of Burdwan,
Burdwan-713104, West Bengal, India

BsTRAcT.—Mycorrhizal fungi form dynamic symbiotic association in the roots of about 80% of the
total terrestrial vascular land plants. Among the pteridophytes, mycorrhizal associations are more

exhibit obligate mycotrophy. Despite several benefits oe, from the mycorrhizal furel, very
little work has been done surveying the distribution and diver (AM
fungi in pteridophytes. We intensified our studies in the roots ay sporophytes of Christella dentata
(Forssk.) Brownsey & Jermy (Thelypteridaceae) to understand the distribution of AM fungi in
different parts of the main adventitious root and its lateral branches, along with percent ee
colonization. We also evaluated spore anaeity of AM fungi in the — and semsonal variations in the
hyphal colonization ri formation of d arbuscules. R was present in the
lateral roots only and not on the main adventitious roots. Percent root colonization also varied in
different parts of the pial roots. The results indicated that root colonization percentage of AM
mycorrhizal fungi varies not only by the growth stages of host plants but also by season. Soil spore
count was highest in the winter and lowest during the rainy season. In addition to AM fungi,
another type of root colonizing fungi, dark septate fungi (DSF) or dark septate endophytes (DSE),
has also been recorded in the roots of C. dentata. Dark septate fungi with melanized hyphae and
microsclerotia were documented.

Key Worps.—Christella dentata, arbuscular mycorrhizae, dark septate fungus, Glomus sp

In addition to art hizal fungi (AMF), another type of root colonizing
fungi, dark septate a (DSF), has been reported within the roots of different
seedless vascular plants (Cooper, 1976; Berch and Kendrick, 1982; Dhillion, 1993;
Jumpponen and Trappe, 1998). Dark septate fungi are defined by Jumpponen (2001)
as conidial or sterile fungi that colonize living plant roots without causing any
apparent negative effects. The ecology, taxonomic affinities and host range of these
DSF are largely unknown, as is their influence on the host and plant communities
(Peterson et al., 2004). However, evidence exists showing that DSE fungi can, under
some environmental or experimental conditions, enhance host growth and nutri-
ent uptake, hence functioning in a manner typical of mycorrhizal associations
(Mandyam and Jumpponen, 2005). If it is accepted that mycorrhizal fungi cause host
responses mainly mutualistic with long-term fitness effects, the DSE ee
should be included when the diversity of mycorrhizal symbioses and responses are
considered. Including DSE in mycorrhizal studies would yield valuable fieucion
about the importance and frequency of these root colonizers (jumpponen and
Trappe, 1998). Hence, in the present study, an attempt has been made to investigate

“Corresponding author: E mail. Sikha_bu_bot@yahoo.com

GHANTA ET AL.: DARK SEPTATE ENDOPHYTES IN CHRISTELLA DENTATA 217

the association of DSE and AM in the roots of a common pteridophyte, Christella
dentata (Forssk.) Brownsey & Jermy to understand the diversity of fungal root
endosymbionts in this plant.

MATERIALS AND METHODS

Christella dentata, a common terrestrial fern in the plains of India, grows in
broad ecological conditions. Ten young and 10 mature sporophytes were collected
from Onda, Bankura district of West Bengal, India at latitude 23°14’N and longitude
87°14’E in each of the three different seasons: winter (November to February), late
spring to summer (March to May) and rainy season or monsoon (June to October)
for two consecutive years: 2008 and 2009.

Roots were collected by digging and uprooting the whole plant along with the
rhizospheric (root region) soil. Root samples were thoroughly washed in running
tap water and rootlets were selected. The average root length of the main ad-
ventitious root system was measured to be 10.00—11.33 cm. Then, the root system
was grouped into two categories: main roots and lateral roots. Each of the root
categories was divided into three equal portions: the distal, the middle and the
basal portions to determine the variation of mycorrhizal colonization in different
regions of the root. Each was cut into small pieces (1 cm in length) and fixed in
formaldehyde acetic acid solution (Johansen, 1940) and stored at 4°C.

About 10 g of soil were collected from the rhizosphere of C. dentata by digging
the soil up to a depth of 15 cm. The soil that adhered to the uprooted roots was
separated and added to the soil collection. The total soil collected from around each
sporophytic plant of C. dentata was kept in separate polythene packets, labeled and
stored at 4°C until analysis. Three such soil samples were collected in each season.

Root samples were stained following the method of Phillips and Hayman (1970).
For each specimen, 100 root pieces from each of the samples were thoroughly
washed in water and boiled at 95°C for 1 hour in 10% KOH. The root segments were
washed in distilled water, acidified with 1(N) HCl for 5 minutes and stained in
0.05% trypan blue in acidic glycerol for overnight. The excess colorant was re-
moved by washing with 10% glycerol. Root segments were mounted on slides in
acetic acid and glycerol (1:1 V/V) and the edges of the cover slips were sealed with
DPX and observed under microscope (Leica, model no. DMLB).

The mycorrhiza type present in the root samples was determined according to
the method of Harley and Smith (1983). Arbuscular mycorrhizae were examined in
the root samples as percent mycorrhizal association and was calculated as follows:

No. of mycorrhizae associated segments
Total No. of segments scored

% Mycorrhizal association = x 100

Ten grams of soil was dissolved in 100 ml of distilled water in a conical flask. The
conical flask was shaken for 30 min and then kept in undisturbed condition for
30 min. The soil particles precipitated and the spores floated on the surface of the
liquid. Mycorrhizal spores were obtained by wet sieving and decanting technique
as followed by Gerdemann and Nicolson (1963).

218 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 3 (2012)

The soil solution was passed through 350, 300, 53 and 45 um sieves and the
spores were collected from the residue deposited on the sieves. For this, residue
present on the sieve was dissolved first in distilled water and then filtered with
filter paper. The residue present in the filter paper was taken and mounted on a
slide in lactophenol and cotton blue and was examined under a microscope (Leica,
model no. DMLB). The decantant was filtered through a filter paper with grid lines.
The filter paper was then spread on a glass plate under a dissecting microscope and
spores were counted and expressed as spores per 100 g of dry soil.

The prepared root samples (trypan blue stained) were also examined for septate
hyphae and microsclerotia corresponding to DSE under a Leica microscope. The
mature microsclerotia were allowed to germinate and grow in different media viz.
potato dextrose agar medium, Saberoud medium and malt agar medium. The roots
containing mature microsclerotia were surface sterilized and put in potato dex-
trose agar medium at pH 6.5 and incubated for 30 days for germination of the
microsclerotia and to develop the fresh culture of the dark septate endophytic
fungus.

RESULTS

The root samples showed the presence of DSE. The septation of the dark septate
endophytic fungal hyphae was very prominent and visible even with a very light
stain of trypan blue (Fig. 1A). The colonization percentage of DSE was highest in
winter to spring and lowest in the rainy season (Table 1). The DSE with
microsclerotia (Fig. 1B, C) of different shapes and sizes were highly melanized.
The immature microsclerotia (Fig. 1B) took the stain of trypan blue and appeared
light blue in color and with maturity the cell wall became thicker and the degree
of melanization increased. The microsclerotia were without definite shape, often
grew together with the mycelium and remained embedded in the mycelium,
bound together with the mycelial strands. Mature microsclerotia (Fig. 1C) did not
show well-developed zones of tissue. They were made up of central part made
up of pseudoparenchymatous tissue but the hyphal nature exists. Towards the
outside of the microsclerotia the hyphae were more loosely arranged.

Upon culturing, branched, dark-colored septate hyphae of the DSE developed,
showing small constrictions at branch points. The pure culture of the DSE
developed after 30 days of incubation and it was observed that the potato dextrose
agar (PDA) medium was most suitable at an optimum pH of 6.5. In culture,
microsclerotia developed, the sclerotial initials were found to arise by branching
and septation of hyphae. The cells became barrel shaped and considerably wider
than the vegetative hyphae, dark brown to reddish — brown in color and was
identified as Rhizoctonia spp.

Arbuscular mycorrhizae were found in all the lateral root samples studied
(Table 1). Both arbuscules (Fig. 2A & B) and vesicles (Fig. 2E) were seen in the roots
of C. dentata. The number of vesicles was less than the number of arbuscules. The
vesicles were large, measuring 38 to 56 4m in diameter, oval to round in shape.

The aseptate hyphae of arbuscular mycorrhizal fungi grew parallel to each
other. As the roots were grouped into two categories, main roots and lateral

GHANTA ET AL.: DARK SEPTATE ENDOPHYTES IN CHRISTELLA DENTATA 219

Fic. 1. (A—C) DSE hyphae and microsclerotia within Christella dentata A. Septate DSE melanized
hyphae B. Immature microsclerotia C. Mature microsclerotia

roots, they were studied separately and it was evident that the main roots in all
the cases showed no mycorrhizal colonization. In contrast, the lateral roots in
almost all the cases exhibited mycorrhizal colonization. Percentage of
colonization was higher in mature lateral roots (24 to 58.5%) than in young
lateral roots (11 to 29%). However, it was noticed that in young plants, the distal
portions of the lateral roots had greater mycorrhizal colonization whereas, in
mature plants, the basal portions of the lateral roots showed more hyphae and
arbuscules. The number of arbuscules and the colonization of aseptate
mycorrhizal hyphae was highest in winter and lowest in the rainy season
(Table 1). No vesicles were found in young plant roots. Only the mature plant
roots possessed vesicles (Fig. 2E) in very low frequency (0.1 to 0.7%).

The root samples of C. dentata presented the Paris- type of AM colonization
(Fig. 2A & B) as the arbuscules, vesicles and intraradical, non-septate hyphae of
mycorrhizal fungi were intracellular.

AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 3 (2012)

220

seyeot|dai Ua} JO sanyeA UReU ay) ore PyeG,

10 BDUaSald

IO aDuesalg

uoTezuojoo Sq

UOTeZIUOTOD [ezTyMOIAWy

- te S60 + TL a 0 6 yeseg
= = col + GCL Ge 0) OL @[PPIW
5 er eel + ZL z 0 OL diy, Aurey
= = OMT + GEL c's 0 8L yeseg
=i = 080 + GC Ge 0 IZ 98TPPIN Iewiuuns 0}
- ~ G90 + LZ Z 0 0z dry, Sulids 9}e']
= a2 88°0 + 62 6 0 0Z yeseq
_ + £8°0 + OLT 1'6 ) S's 8[PPIN
oa + GL'0 + 62 OL 0 6L diy, ToyUlM LNV'Id SNNOA
= a OO'T + S'972 GZ 0 cl jeseg
~ + SPL + 62 1Z 0 E 8[PPIN
os - OSL + SZ 0z 0 G dtp Aurey
- + col + OEP G8 L'0 S Teseg
ay = 06'°0 + S'0€ G'GZ 0 G 9[PPIN JaUIUINS 0}
+ - 680 + SP of 0 St diy Suds 93k]
+ + OTT + S'8S cs 0 ce yeseg
+ + cel + EF OF 0 € SIPPIN
- + TLL + Gs £98 Z'0 8T diy, TayUTM, LNV'TId SaN.LVAN
PIOLE,ISOIOUL aeydAy , WOTeZIUO[OD aposnqie Jo A[DISAA JO aeyddy jo JOOL [P10}P] uoTeT[OO ase\s
jo aouesqe jo aouasqe JOO JUSDI0g asejuso10g 98P]UdI10q ase} us010g jo uoljl0g jouoseag yymols juelg

‘DjDjUap DIJA}SI1Y7) JO SJOOI ut sung aye}des YAep pUe aeZTYIODAUL Ie[NOsNqse Ie|NIISAA JO UOTeZIUO[OT) *] A1aV],

GHANTA ET AL.: DARK SEPTATE ENDOPHYTES IN CHRISTELLA DENTATA 221

Fic. 2. (A-E) Mycorrhizal arbuscules, vesicle and extra radical spores within roots of Christella
dentata. A. Arbuscules within Christella dentata. B. Arbuscules within Christella dentata. C-D.
Extra radical spores E. Vesicle within Christella dentata.

Spore (Fig. 2C, D) counts per 100 g of soil showed 550 + 10.44 spores in the
winter season, 370 + 9.89 spores in the late spring to summer, and 210 + 11.30
spores in the rainy season. The AM fungus has been identified as Glomus sp.

DISCUSSION

In this paper, we report occurrence of Glomus sp. as arbuscular mycorrhizal
fungus in the lateral roots of Christella dentata along with dark septate
endophytes (DSE), which has been identified as Rhizoctonia sp. The arbuscular
mycorrhizal fungus Glomus was characterized by the formation of large swollen
vesicles, well developed arbuscules and extraradical round spores. Though
Glomus and Sclerocystis have been reported earlier by Muthukumar and Udaiyan
(2000) as AM in Christella dentata, to the best of our knowledge this is the first
report of presence of DSE in Christella dentata along with microsclerotia.

Mycorrhizal colonization pattern was found to be of Paris-type in Christella
dentata (Fig. 2 A-C). This finding is in conformity with the observations of other
studies where this morphotype has been found in other pteridophytes (Zhang
et al., 2004; Dickson, 2004; Zubek et a/., 2010) and the percent root colonization
by AMF varies with the host plants and the habitats have been shown by a
number of authors (e.g., Muthukumar and Udaiyan, 2000; Zubek et al., 2010).

222 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 3 (2012)

Zubek et al. (2010) recorded highest AM colonization (M=78%) and arbuscule
richness (A = 76%) in Thelypteris patens (Sw.) Small and lowest AM
colonization and arbuscule abundance in Sticherus underwoodianus (Maxon)
Nakai (M= 4%, A = 3%). Muthukumar and Udaiyan (2000) showed the
intensity of mycorrhizal colonization was significantly influenced by the type of
substrate in which the plants grow. Pteridophytes growing in soil (terricolous)
had the highest mean colonization levels followed by lithophytic and epiphytic
species. As we have studied only one terrestrial member, we are not in a position
to compare the result of mycorrhizal colonization in different habitats. However,
we have noted that percentage of AM colonization varies not only on the growth
stages (young / mature) of host plants but also with the seasonal variations of the
year. We found the highest mycorrhizal colonization (58.5 + 1.10) and spores
and arbuscule formations in Christella dentata in the winter months and the
lowest in the rainy season (Table 1). No vesicles were observed in the rainy
season. In summer, there was much less vesicle formation (0.1 0 + 0.01) than in
winter (0.7 + 0.1). Mycorrhizal colonization was moderate in the summer
months. In young lateral roots mycorrhizal colonization percentage was always
less than that of the mature roots (Table 1)

It is assumed that the vesicles, being the storage organs of the AM, are generally
produced at comparatively later stages of growth (Powell and Bagyaraj, 1984).
Bajwa et al. (2001), while surveying AM association in wetland plants, noticed
that vesicular infection, in general, started in spring and reached its maximum in
summer, autumn or winter depending upon the host species. Another possible
reason for the disparity in the pattern of AM development may correspond to
variations in stages of completion of life cycles of various AM species involved in
forming this association. In a survey on AM association in different vascular
plants it was found that colonization remained stable during spring to summer
and maximum colonization has been observed during winter (Bajwa et al., 2001).
The spore population in association with dicotyledonous species remained
consistently high except for a decline in autumn. These results corroborate our
present findings on C. dentata where AM colonization percentage in the roots and
spore number in the soil was highest in winter.

ACKNOWLEDGMENTS

We thank Mr. Kaushik Sarkar for helping in microscopic photography.

LITERATURE CITED

Bajwa, R., A. Yaqoos and A. Javan. pots Seasonal variation in VAM in Wetland Plants. Pakistan
Journal of Biological Sciences 4:464—470.

Bercu, S. M. and B. Kennprick. 1982. Vesicular arbuscular y hi f South Ontario f 1
fern pres pig a 74:769-776.
Cooper, K. A field survey of mycorrhizas in New Zealand ferns. New Zealand J.Bot

14: eee
DHILLION, S. S. 1993. Vesicular arbuscular mycorrhizae of ene species inNorway and USA.:
occurrence and mycotrophy. Mycol. Res. 97:656—-660

GHANTA ET AL.: DARK SEPTATE ENDOPHYTES IN CHRISTELLA DENTATA 223

Dickson, S. 2004. The nha? Paris Continuum of mycorrhizal symbioses. New Phytol. 163:187—200.
GERDEM T. H. Nicotson. 1963. Spores of mycorrhizal endogone sp. Extracted from soil
by wet-sieving and eee, Trans Brit. alii Soc. 46:23 35-244

at

JoHANSEN, D. A. 1940. Plant Tsien ue. McGraw

JUMPPONEN, A. 2001. Dark seine endophytes — are Sie mycorrhiza? Mycorrhiza 11:207—211.

JumpponeN, A. and J. M. Trappe. 1998. Dark septate endophytes: a review of facultative biotrophic
root-colonizing fungi. New Phytol. 140:295-310

Manpyay, K. and A. Jumpponen. 2005. Seeking the aineive function of the root-colonising dark
septate endophytic fungi. Studies in Mycology 53:17

— KUMAR, T. and K. Uparyan. 2000. Vesicular arbus pila mycunhizas in pteridophytes of

estern sats southern up Phytomorphology 50:132—142.

er M. and D. S. Hayman. 1970. Improved procedure for Clearins roots and staining practice

and pa arbuscular myeori fungi for rapid assessment of infection. Trans. Brit.

jefe. Guo and: R.) Liv, poe, Arbuscular mycorrhizal se associated with common
a agra met in Dujiangyan, southwest China. Mycorrhiza 14
ZuBEK, S., K. PiatK, P. Naxs, W. Hiese, M. Waypa and P. MLEczko. sae : Fungal root endophyte
sepa of fern and lycophyte species from the Celaque National Park in Honduras.
Amer. Fern J. 100(2):126—-136.

American Fern Journal 102(3):224—227 (2012)

Azolla cristata in the Kashmir Himalaya

BuRHAN AHAD*, ZAFAR A. REsuHI, and Ayaz H. GANAIE
Department of Botany, University of Kashmir, Srinagar-190006, Jammu and Kashmir, India
A. R. Yousur
Department of Environmental Sciences University of Kashmir, Srinagar-190006,
Jammu and Kashmir, India

ct.—The identity of Azolla species in the Kashmir Valley has been confusing, with most
populaiiins being reported as Azolla pinnata. Morphological evidence demonstrates that the
species introduced to Kashmir is not A. pinnata, but rather Azolla cristata, a new species for the
Kashmir Valley and a potentially ae biological invader.

Key Worps.—Azolla caroliniana, Azolla cristata, Azolla filiculoides, Kashmir Valley, invasive
species

The genus Azolla Lam. consists of small, free-floating aquatic ferns, which are
invasive in many parts of the world (Garcia-Murillo, 2007), including the Kashmir

alley, where Azolla is one of the most prolific invasive alien taxa of aquatic
ecosystems (Fig. 1A). The species of Azolla that grows in Kashmir has been
previously reported as Azolla pinnata R. Br. (Mir and Pandit, 2008), referring to
the native Indian taxon A. pinnata subsp. asiatica R.M.K. Saunders & K. Fowler.
A detailed study of vegetative and reproductive characters of Azolla specimens
collected from several water bodies in Kashmir Valley revealed that this species
has been incorrectly identified and is, instead, A. cristata Kaulf.

MATERIALS AND METHODS

Fresh specimens with sporocarps were collected from five different water
bodies of the Kashmir Valley, and deposited in Kashmir University herbarium,
KASH (Table 1). Additional material from this herbarium was examined under
a stereomicroscope (Zeiss, Discovery V8) and optical trinocular microscope
(Leica DMLS2). The branching pattern and leaf trichomes were observed by
immersing fresh plants in 95% ethanol for 1 hour. The leaves were then rinsed
with water and immersed in concentrated bleaching solution under vacuum
for 15 minutes, again rinsed with water, then mounted in lactophenol and
observed under the microscope. The structure of glochidia was observed by
immersing dry microsporangia in water:ethanol:glycerol (1:1:1) solution for
24 hours. The massulae were then dissociated by gently squashing them under
a cover glass. Samples for Scanning Electron Microscopy (SEM) were fixed
with 3% glutaraldehyde in 0.2 M phosphate buffer of pH 7.4. The samples

“Corresponding author: burhanahad@gmail.com, burhanahad@rediffmail.com

AHAD ET AL.: AZOLLA CRISTATA IN KASHMIR 225

Fic. 1. A. A population of Azolla forming a mat in Dal Lake. B) Sporophyte of Azolla cristata.
Reshi & Ahad 2101 (KASH). C) Bicellular leaf-trichome. Reshi & Ahad 2101 (KASH).

were then fixed in 1% osmium tetraoxide, and graded in acetone series. Fixed
samples were dried by critical point method in dry carbon dioxide and
examined under the SEM (Hitachi S3000-H).

RESULTS AND DISCUSSION

The plants are free-floating, up to 4 cm long, and polygonal in shape.
Sporophytes consist of a thin axial stem, bearing small leaves and delicate brown
rootlets up to 6 cm long. Leaves are alternate, imbricate, and bilobed; the hyaline
ventral leaf lobe and an aerial chlorophyllous dorsal lobe are covered with short
bicellular trichomes and bear an extracellular cavity housing filamentous
Anabaena (Figs. 1B and 1C). Rootlets are solitary, from stem branching points.
Sporocarps are borne in pairs at the base of branches. Microspores are aggregated
in stalked massulae, massulae with arrow shaped glochidia (Figs. 2A and 2B).
Megasporocarps contain a solitary megaspore; megaspore apparatus with three
floats, and granular perine (Fig. 2C).

To understand the identification of these plants that were earlier misidentified
as A. pinnata in the Kashmir valley (a species of section Rhizosperma,
characterised by hookless glochidia and megaspore apparatus with nine floats)
a short background in Azolla taxonomy is necessary. One of the earliest
classifications of Azolla section Azolla by Mettenius (1847) recognized four

TaBLE 1. Collection information. Elevations are in meters above sea level. Vouchers are deposited
at KASH.

Site Elevation Coordinates Voucher
Anchar Lake 1584 34.23°N, 74.90°E Reshi & Ahad 2103
Dal Lake 1584 34.60°N, 74.80°E Ahad & Ganaie 2102
Hokersar wetland 1500 34.05°N, 74.43°E Reshi & Ahad 2105
Manasbal Lake 1584 34.15°N, 74.41°E Ahad & Ganaie 2104

Wular Lake 1580 34.20°N, 74.44°E Reshi & Ahad 2101

226 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 3 (2012)

Fic. 2. A. Massulae. Reshi & Ahad 2101 (KASH). B. Arrow shaped glochidia.Reshi & Ahad 2101
(KASH). C. SEM of megasporocarp showing perine architecture. Reshi & Ahad 2101 (KASH).

species: A. cristata Kaulf, A. caroliniana non Willd., Azolla magellanica Willd.
(syn. Azolla filiculoides Lam.) and A. microphylla non Kaulf. Mettenius (1867)
reduced the New World species number to two by combining A. microphylla, A.
caroliniana and A. cristata into A. caroliniana and at the same time placing A.
magellanica and A. rubra into A. filiculoides Lam. Strastburger (1873) upheld the
later Mettenius taxonomy and recognised only two species of section Azolla: A.
caroliniana and A. filiculoides, which he distinguished on the basis of bicellular
trichomes and granular perine present in the former species and unicellular
trichomes and warty perine present in the latter. The most widely accepted
classification of section Azolla is currently that of Svenson (1944), however, who
returned to a four-species system: Azolla caroliniana Willd., A. filiculoides Lam.,
A. microphylla Kaulf. and A. mexicana Presl. Recent reassessments of species
limits in Azolla have found that taxonomic treatment to be unsatisfactory
(Dunham and Fowler, 1987; Zimmerman et al., 1989, 1991; Pereira et al., 2001;
Evrard and van Hove, 2004). These authors have shown that earlier circumscrip-
tions of these species were based on misapplied names, including the fact that the
types of A. caroliniana and A. microphylla are indistinguishable from the oldest
name in the group, A. filiculoides. The taxon frequently treated as A. caroliniana
sensu Mettinius, then, needs a name, and the oldest available is A. cristata.
Compounding this confusion is the natural variation present in these species, and
noticeable environmental plasticity among the populations (Zimmerman et al.,
1989; Pereira et al., 2001). Zimmerman et al. (1989) demonstrated that in section
Azolla, A. filiculoides was easily distinguishable from the other taxa on the basis
of leaf trichome morphology and enzyme electrophoresis pattern. Zimmerman
et al. (1991) suggested that the taxa frequently treated as A. microphylla, A.
mexicana and A. caroliniana be regarded as a single species, on the basis of
RFLPs, isozymes, phosphorus deficiency symptoms and breeding experiment
analysis. These results thus agree perfectly with the existence of two species in
section Azolla, as advocated by Evrard and Van Hove (2004). One is A. cristata
Kaulf., which includes A. caroliniana non Willd., A. mexicana Presl and A.
microphylla non Kaulf.; the other species is A. filiculoides Lam. (including A.
rubra R. Br., often recognized at the rank of variety).

AHAD ET AL.: AZOLLA CRISTATA IN KASHMIR 227

Following this taxonomy, all plants examined were Azolla cristata, on the
basis of the presence of bicelled trichomes, hook shaped, multiseptate
glochidia, and a 3-float megaspore apparatus with a granular perine surface
(Figs. 1C, 2B and 2C). It is possible that A. filiculoides is also present in the
Kashmir Valley (as an introduction), although we know of no documented
occurences; populations of Azolla section Azolla should be carefully examined
to determine which species is involved.

ACKNOWLEDGMENTS

The authors highly acknowledge the help of Prof. Charles van Hove, Emeritus Professor, Catholic
University of Louvain, and Prof. I. Watanabe who confirmed our identifications. The authors also
take the opportunity to thank Carl Rothfels mlb Editor), Christopher Fraser-Jenkins, and an
anonymous reviewer for their helpful comme

LITERATURE CITED

DunuaM, D. G. and K. FowLer. 1987. Taxonomy and species recognition in Azolla Lam. Pp. 7-16 in:
IRRI (Eds), Azolla Utilization. International Rice Research Institute, Los Banos, Laguna,
Philippines

Evrarp, C, and C. Vin How, 2004. Taxonomy of the American Azolla species (Azoll ) itical
review. Systematics and Geography of Plants 74:301-318.

Garcia-MuriLLo, P., R. FERNANDEZ-ZaMupbIO, S. CirujaNo, A. Sousa and J. M. Espmnar. 2007. The
invasion of Donana eee ses Park (SW Spain) by the mosquito fern (Azolla filiculoides Lan).
Limnetica 26:243-25

Metrtentus, G. 1847. Ueber ae Linnaea 20:259-282.

Mettentus, G. 1867. Filicinae. Pp. 51-54, in Plantae Tinneanae. Vien

Mr, S. S. and A. K. Panprr. 2008. Macrophytic features of Wular Lake (a Ramsor Site) in Kashmir. J.
Res. Dev. 8:1-11.

Pereira, A. L., G. Texeira, I. SzvNaTE-Pinto, T. ANTUNES and F. CarraPico. oa Taxonomic re-
evaluation of the Azolla genus in Portugal. Plant Biosystems 135:285-

STRASBURGER, E. 1873. Ueber Azolla. Jena, Hermann Dabis.

SveNsON, H. K. 1944. The New World species of Azolla. Amer. Fern J. 34:69-84.

ZIMMERMAN , T. A. Lumpkin and I. WarTanase. 1989, Isozyme differentiation of Azolla Lam.
Euphytica a2 163-170.

ZIMMERMAN, W. J., I. WaTANABE, T. VENTURA, P. Payawal and T. A. LumpKIN. 1991. Aspects of the

penotic and botanical i of Neotropical Azolla species: New Phytol. 119:561—566.

American Fern Journal 102(3):228—232 (2012)

SHORTER NOTES

New Country and Regional Records from the Brazilian Side of Neblina
Massif.—A list of 37 species is reported here for the first time to the Brazilian
side of Neblina Massif: one of the largest sandstone mountains of the western
portion of the Guyana Shield along the Venezuelan-Brazilian border. Twenty-
seven species represent new additions to the Brazilian Fern Flora (marked
with an asterisk) and ten species are the first record to the northwestern
portion of the Brazilian Amazon with their closest known Brazilian
populations from the Atlantic Rainforests (marked with two asterisks). We
provide information on previous geographic ranges and full specimen citation
including habit, habitat, and elevation for all taxa.

The specimens were collected by the first author during an expedition to the
Cachoeira do Anta (Anta waterfall), Amazonas, Brazil, at the southeastern part
of Neblina massif from 24 December 24, 2003 to January 5, 2004. The expedition
began at the foot of the Serra da Neblina, from the mouth of the Tucano River
(0°37'14"N, 65°55'29.5”W, 50 m elevation) to the top of the Anta waterfall
(0°51'20.3’N, 65°56’30.1”W, 2400 m elevation).

The botanical novelties presented here illustrate how the Brazilian side of the
Guyana shield is relatively understudied compared to its neighboring areas in
Venezuela. All specimens were fixed in 70% ethanol in the field and dried about
a month after in an oven at 60° C. A complete set of vouchers is housed at the
Herbarium of the Institute for Amazonian Research (INPA) in Manaus, Brazil,
with duplicates (when available) sent to the Herbarium of the Federal University
of Minas Gerais (BHCB).

**Asplenium harpeodes Kunze—Carvalho et al., 351. Epiphyte. Cloud
forests, 2300 m. Distributed from Mexico to Brazil where it was previously
known only from the Atlantic Rain Forest in Brazil.

**Asplenium raddianum Gaudich.—Carvalho et al., 341. Epiphyte. Upper
montane forest, 1900 m. Previously known from Colombia, Venezuela,
Ecuador, Peru, Bolivia and Brazilian Atlantic Forest.

**Blechnum schomburgkii (Klotzsch) C. Chr.—Carvalho et al., 380. Terres-
trial. Tepui flat summit near rocks, 2300 m. Distributed from Costa Rica to
Bolivia and southeastern Brazil.

**Ceradenia capillaris (Desv.) L. E. Bishop—Carvalho et al., 384. Rocks
crevices along Rio Anta. Rocky outcrop, 2400 m. Previously known from
Cuba, Jamaica, Hispaniola, Colombia, Venezuela, Ecuador, Peru, Bolivia,
and the Atlantic forest in southeastern Brazil.

SHORTER NOTES 229

*Cochlidium connellii (Baker ex C. H. Wright) A. C. Sm.—Carvalho et al., 383.
Rocky crevices along Rio Anta, growing with mosses. Rocky outcrop,
2300 m. Previously known only from Guyana and Venezuela.

* Cyathea vel aff. aurea Klotzsch—Carvalho et al., 344. Terrestrial. Fruticose
meadows, 2300 m. The range of this taxon is from the Cordillera de la Costa
in Venezuela along the northern Andes in Colombia, probably reaching
northern Ecuador.

*Cyathea gracilis Griseb.—Carvalho et al., 347. Terrestrial. Fruticose
meadows, 2200 m. Previous records are from Costa Rica, Panama, Jamaica,
Colombia, Ecuador, and northern Peru.

*Cyathea marginalis (Klotzsch) Domin—Carvalho et al., 385. On rocks near
stream. Rocky outcrop, 2300 m. It is widespread in the Guayana shield from
French Guiana to Venezuela.

*Cyathea neblinae A.R. Sm.—Carvalho 308, 320. Terrestrial. Montane forests,
1300 m. Endemic from Neblina massif. Previous known from Venezuela.

*Cyathea sipapoensis (R. M. Tryon) Lellinger—Carvalho et al., 335.
Terrestrial. Upper montane forest, 1700 m. Previously known only from
Cerro Sipapo (Venezuela), 550 km from Serra da Neblina.

*Cyathea spectabilis (Kunze) Domin—Carvalho et al., 249. Terrestrial. Montane
forests, 1100 m. Previous records are from Panama, Colombia, Venezuela,
Guyana, Suriname, and French Guiana. The closest record of this species is
from Serrania de Imataca, Venezuela, about 850 km from Sierra de la Neblina.

* Cyathea steyermarkii R. M. Tryon—Carvalho et al., 237. Terrestrial. Montane
forest, 1000 m. Previously known only from Cerro Autana (Venezuela), 490 km
from Serra da Neblina.

*Diplazium centripetale (Baker) Maxon—Carvalho et al., 304. On rocks along
stream. Montane forest, 1300 m. Previously known from the Antilles, Venezuela,
and Trinidad.

*Elaphoglossum crispatum Mickel var. beitelii Mickel—Carvalho et al., 293.
Epiphyte. Montane forests, 1300 m. Endemic to Serra da Neblina. Previous
records from Venezuela.

“Elaphoglossum wurdackii Vareschi—Carvalho et al., 337. Epiphyte in fallen
branch. Upper montane forests, 1700 m. Previously known only from Venezuela.

230 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 3 (2012)

*Enterosora campbellii Baker subsp. campbellii—Carvalho et al., 366. Epiphyte.
Cloud forest, 2000 m. Previously known from Jamaica and Venezuela.

*Enterosora trichosora (Hook.) L. E. Bishop—Carvalho et al., 354. Epiphyte. Cloud
forest, 2300 m. Enterosora trichosora is a rarely collected but widespread species
with about ten known collections, including three from the Venezuelan side of
Serra da Neblina (Alan Smith, pers. comm.). Previously known from Mexico,
Guatemala, Costa Rica, Ecuador, and Peru. The nearest published record prior
this one is from the Andes in Quito, Ecuador, 1400 km far from Serra da Neblina.

*Enterosora parietina (Klotzsch) L. E. Bishop—Carvalho et al., 368. Epiphyte.
Cloud forests, 1900 m. Previously known from Central America, Antilles,
Colombia, Ecuador, Peru, and Venezuela.

*Grammitis peritimundi L. E. Bishop & A. R. Sm.—Carvalho et al., 339. Epiphyte.
Upper montane forests, 1800 m. Previously known only from Venezuela.

“i hyllum karsteni J. W. Sturm—Carvalho et al., 338. Epiphyte on
fallen branch. ae montane forests, 1800 m. Previously known only from
Venezuela and Peru

*Hymenophyllum lindenii Hook.—Carvalho et al., 355, 361, 394. Epiphyte.
Upper montane forests, 1900 m, and Cloud forests, 2300 m. Previously
known only from Colombia, Venezuela, and Peru.

**Lindsaea arcuata Kunze—Carvalho et al., 329. Terrestrial. Montane forest,
1500 m. Previously known from Venezuela, Colombia, Guyana, Suriname,
French Guiana, and from the Atlantic forests in southern and southeastern Brazil.

*Lindsaea cultriformis K. U. Kramer—Carvalho et al., 291. Terrestrial. Montane
forest, 1300 m. Previously known only from Colombia and Venezuela. The
nearest record of this species is from Cerro Aratitiyope about 200 km from
Serra da Neblina.

*Lindsaea stricta (Sw.) Dryand. var. jamesoniformis K. U. Kramer—Carvalho
et al., 386. Rock crevices along Rio Anta. Rocky outcrops, 2400 m. Previously
known from Porto Rico, Colombia, Venezuela, Guyana, and Suriname.

*Lycopodiella steyermarkii B. @llg.—Carvalho et al., 348. Terrestrial.
Fruticose meadows, 2300 m. Previously known from Costa Rica, Panama,
Colombia, Venezuela, and Ecuador.

** Polyphlebi (Kunth) Ebihara & Dubuisson—Carvalho et al., 396.
Epiphyte. Cloud forests, near streams, 2300 m. Polyphlebium diaphanum

SHORTER NOTES 231

occurs from Mexico to Brazil. Previous records in Brazil are from the Atlantic
forest region.

*Polypodium aturense Maury—Carvalho et al., 319. Arching epiphyte.
Montane forest, 1300 m. Previously known only from semideciduous forests
in Venezuela, 100—400 m.

*Pterozonium paraphysatum (A. C. Sm) Lellinger—Carvalho et al., 390. Rock
crevices along Rio Anta, erect rhizome. Rock outcrop, 2400 m. Previously
known from Venezuela, Guyana, and Suriname.

*Serpocaulon sessilifolium (Desv.) A. R. Sm.—Carvalho et al., 377. Epiphyte.
Semideciduous forest, 2400 m. Previously known from Costa Rica, Colombia,
Venezuela, Ecuador, Peru, and Bolivia. The nearest record is from Cerro
Marahuaka, Venezuela, about 300 km from Serra da Neblina.

*Stenogrammitis jamesonii (Hook.) Labiak—Carvalho et al., 343, 357. Epiphyte.
Upper montane forest, 2000 m; and Cloud forests, 2300 m. Previously known
from Guatemala, Costa Rica, Venezuela, Colombia, Ecuador, Peru, and Bolivia.

*Stigmatopteris longicaudata (Liebm.) C. Chr.—Carvalho et al., 324. Terres-
trial. Montane forest, 1300 m. Previously known from Mexico to Bolivia
including Venezuela and French Guiana.

**Terpsichore asplenifolia (L.) A. R. Sm.—Carvalho et al., 363. Epiphyte. Cloud
forest, 1900 m. Previously known from Mexico, Antilles, Mesoamerica, Colombia,
Venezuela, Ecuador, Peru, Bolivia, and Atlantic forest in northeastern Brazil.

**Terpsichore taxifolia (L.) A. R. Sm.—Carvalho et al., 244. Epiphyte on moss-
covered trunk. Montane forest, 1100 m. Previously known from Costa Rica,
Panama, Antilles, Colombia, Venezuela, Guyana, Suriname, Ecuador, Peru,
Bolivia, and Atlantic forest in Brazil. The nearest record for this species is
from Cerro Duida, Venezuela, about 300 km from Serra da Neblina.

*Trichomanes caliginum Lellinger—Carvalho et al., 278. On rocks along
stream. Montane forests, 1300 m. Previously known from Venezuela, Guyana,
and Suriname. The nearest record of this species is from Cerro Marahuaca,
about 325 km from Serra da Neblina.

*Trichomanes dactylis Sodiro—Carvalho et al., 346. Terrestrial. Cloud forests,
1900 m. Previously known from Panama, Colombia, Venezuela, and Ecuador.

**Trichomanes robustum E. Fourn.—Carvalho et al., 333. Epiphyte on moss-
covered trunk. Upper montane forest, 1700 m. Previously known from Antilles,

232 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 3 (2012)

Venezuela, Colombia, Ecuador, and Brazil. Prior Brazilian records are from the
Atlantic Forest, northeastern Brazil.

**Thelypteris gardneriana (Baker) C. F. Reed—Carvalho et al., 358, 395.
Terrestrial near stream. Cloud forest, 2300 m. Previously known from Venezuela,
Colombia, Ecuador, Peru, Bolivia, and southern and southeastern Brazil.

We thank the Yanomamis from Maturacd who allowed the first author to
collect in their area. We thank the following researchers who have helped with
the identifications and providing information on rare species: Dr. Alan Smith
(Enterosora) and Dr. Marcus Lehnert (Cyathea). Financial and logistic support
was provided by the National Park of Pico da Neblina, ICMBio/MMA/Brazilian
Government. The third author received financial support from PROTAX
(MCT/CNPq/MEC/CAPES N° 52/2010) during the production of this manu-
script.—FERNANDA ANTUNES CARVALHO, Instituto Nacional de Pesquisas da
Amaz6nia, Coordenagaéo de Botanica, Av. André Aratijo 2936, Manaus,
Amazonas, 69060-001, Brazil; ALEXANDRE SALINO, Universidade Federal de
Minas Gerais, Instituto de Ciéncias Biolégicas, Departamento de Botdnica,
Caixa Postal 486, Belo Horizonte, Minas Gerais, 30123-970, Brazil; and CHARLES
EUGENE ZARTMAN, Instituto Nacional de Pesquisas da Amazdénia, Coordenagao
de Botanica, Av. André Aratijo 2936, Manaus, Amazonas, 69060-001, Brazil.

American Fern Journal 102(3):233—235 (2012)

SHORTER NOTES

New Records Of Ferns From Chiapas, Mexico.—As part of an Inventory of
Pteridophytes of the Biosphere Reserves of “El Triunfo” and ‘“‘La Sepultura” in
the Sierra Madre and of the deciduous tropical forest in the Jiquipilas Valley in
the Central Depression of Chiapas, Mexico, as well as explorations in other
areas of this state between 1998 and 2003, five fern species previously were
reported for Chiapas: Hemionitis levyi and Doryopteris concolor var. concolor
(Amer. Fern. J. 90:104—111. 2000); Thelypteris rachiflexuosa (Sida 20:1309—
1313. 2003), Elaphoglossum ipshookense and Anemia guatemalensis (Amer.
Fern J. 93:152—163. 2003). These were determined as new records for the state
by comparison to those taxa reported from Chiapas by Mickel and Smith
(Mem. New York Bot. Gard. 88:1-1054. 2004). Subsequent explorations of
other physiographic regions of Chiapas have resulted in the discovery of the
following five additional new records for Chiapas.

These new records are confined to physiographic regions of Chiapas
such as the Central Depression, Northern Highlands, and Sierra Madre of
Chiapas. The Central Depression is important as a biological corridor to all
dry forest in southern Mexico and to the Yucatan Peninsula, according to
Rzedowski and Calderon de Rzedowski (Florist. Invent. Trop. Country.
New York Bot. Garden: 273.1989), and the Northern Highlands region is
important because it is considered part of the Mesoamerican biological
corridor (CI & CAP. Northern Region Mesoamer. Biodiver. Hotspot. 2004)

The Central Depression is a great valley located between the Sierra Madre
and the Northern Highlands of Chiapas (Miillerried, La Geografia de Chiapas.
1957). This valley is dominated by deciduous tropical forest, and few botanical
studies have been conducted in this area (La Veg. Chis. Vol. 1. 7. 1952). It has
been considered an important zone for endemic taxa (Reyes, List. Florist. Mex.
XVII. Dep. Central Chis. 1997). The Northern Highlands is a mountainous
region located between the Central Depression and Gulf Coastal Plain of
Chiapas, and is dominated mainly by tropical rain forest and Quercus forest.
This area is poorly known botanically. The Sierra Madre is located between the
Pacific Coastal Plain and the Central Depression (La Geog. Chis. 1957), and is
dominated by montane cloud forest. Several floristic studies have shown this
area to be rich in vascular plant diversity (Long and Heath, Ann. Inst. Biol. Ser.
Bot. 6. 1990; Matuda, Amer. Mid. Nat. 43:195—223. 1950). Unfortunately, all
of these areas are becoming heavily deforested and altered due mainly to
anthropogenic activities such as cattle ranching, and coffee and maize
plantations.

New Records

Adiantopsis seemannii (Hook.) Maxon—Mexico, Chiapas, Mpio. Tonalé,
8 Km N of Ejido Raymundo Flores in the Biosphere Reserve La Sepultura,

234 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 3 (2012)

16°02'20” N, 93°35’'30” W, 900 m, deciduous tropical forest, 5 Sep 1995,
Pérez-Farrera 741 (HEM). This differs from Adiantopsis radiata (L.) Fée, a
very common species in deciduous tropical forest, in its ovate, pinnate
blades. Adiantopsis seemannii is a very rare species at this locality, and
grows with A. radiata on rock in open-canopy forest. Adiantopsis
seemannii ranges along the Pacific coast of Mexico between 100-1400 m
(Mickel and Smith, 2004). It also has been reported in Guatemala and
Belize.

Doryopteris palmata (Willd.) J. Sm.—Mexico, Chiapas, Mpio. Villaflores,
between El Ejido Tres Picos and Nueva Independencia, in the Biosphere
Reserve La Sepultura, 16°10’ N, 93°35’ W, 1700 m, montane forest, 8 Aug 1995;
Mpio. Villaflores, between El Ejido Tres Picos and Nueva Independencia, in
Biosphere Reserve La Sepultura, (16°10’ N, 93°35’ W), 1700 m montane forest,
10 Aug 1995, Pérez-Farrera 672 (CHIP, UAMIZ); Pérez-Farrera 2983 (HEM);
Mpio. La Concordia, Finca Cuxtepex, 50 Km S of Nueva Independencia, in
Biosphere Reserve El Triunfo, 15°43’49” N, 92°57'57” W, 1000 m montane
forest, 14 Jun 2006, Mendez-Guzman 66 (HEM). This species differs from D.
concolor (Langsd. et Fisch.) Kuhn var. concolor in its areolate venation and
finely puberulous stipe grooves. Smith (Fl. Chiapas 2:1-370. 1981), Moran
(Flora Mesoamericana 1:129, 1995), and Mickel and Smith (2004) cited
Rovirosa 1084 (PH, NY and K) as a voucher for Chiapas. This specimen was
cited by Rovirosa (Pterid. Sur Mex. 142. 1909), but has not been located by
anyone since Rovirosa, thus the record remains unverified. Rovirosa collected
in the Northern Highlands of Chiapas in a locality named ‘El Rosario’,
between Bochil and Ixtapa. The present record is the first report of D. palmata
from the Sierra Madre region and confirms the unseen Rovirosa report for
Chiapas. This species is very rare and grows on rocky slopes in very wet
montane, open-canopy forest.

Selaginella convoluta (Arn.) Spring—Mexico, Chiapas, Mpio. Jiquipilas,
El Campanario, 2.5 Km N of Ejido Andrés Quintana Roo, (16° 37’ 30” N,
93°34'28” W), 650 m, deciduous forest, 16 Jun 2004, Gémez-Dominguez
780 (HEM); E] Campanario, 2.5 Km N of Ejido Andrés Quintana Roo, 650 m
altitude (16° 37’ 30” N, 93°34'28” W), deciduous forest, 16 Jun 2004, Pérez-
Farrera (CHIP); El Campanario, 2.5 Km N of Ejido San Andrés Quintana
Roo, 16° 37’ 30” N, 93°34'28” W, 650 m, deciduous tropical forest, 16 Jun
2004, Farrera-Sarmiento 440 (CHIP). This species is closely related to S.
lepidophylla (Hook. et Grev.) Spring, but differs by its peltate lateral leaf
bases with a single auricle. This record for Chiapas extends the
distribution farther south and west in Mexico. Previously, according to
Mickel and Smith (2004) the species was known in Mexico only from
Yucatan, but it is widespread in the Neotropics (Guatemala, Honduras,
Cuba, Hispaniola, Brazil, Bolivia, Paraguay, and Argentina). Selaginella
convoluta grows on rocks in open deciduous forests, and is very abundant
alongside species of Selaginella, Cheilanthes, Lygodium, and Hemionitis.

SHORTER NOTES 235

Asplenium dissectum Sw.—México, Chiapas, Mpio. Cintalapa, in forest, to
3 km NW of Ejido Rafael Cal y Mayor, La Ventana, 50 km to NW of Cintalapa,
(16°58.370’ N, 94°01.589”W), 942 m, montane tropical forest, 20 Aug 2005,
Martinez-Meléndez N. 1234 (HEM). This species is a member of sect.
Sphenopteris and is closely related to A. serra Langsd. & Fisch., but differs
by its thin blade texture and bilacerate pinnae. This record for Chiapas extends
the distribution farther southeast in Mexico. Previously, the species was
known in Mexico only from Oaxaca, but it is widespread in the Neotropics
(Guatemala, Nicaragua, Costa Rica, Panama, Cuba, Jamaica, Hispaniola,
Colombia, Venezuela, Ecuador, and Brazil) (Mickel and Smith, 2004).
Asplenium dissectum grows terrestrially in dense montane tropical forests.

Anemia tomentosa (Savigny) Sw. var. mexicana (C. Presl) Mickel—
México, Chiapas, Mpio. Cintalapa, to 3 km al Rafael Cal y Mayor 50 km to
NW of Cintalapa, (16°55.789’ N, 93°59.649’ W), 727 m, 20 de aug de 2005,
Martinez-Meléndez N. 1232 (HEM); growing on rocks in Quercus forest. This
variety is widely distributed in almost all states of Mexico. However it has
not been recorded previously from Chiapas or the Yucatan Peninsula. This
taxon is distributed in Hispaniola; Colombia, and Venezuela (Mickel and
Smith, 2004). In Mexico, its closest relative appears to be Anemia
karwinskyana (C. Presl) Prantl, from which it is distinguished by its thinner
leaf texture and bipinnate-pinnatifid blades. Two other varieties of A.
tomentosa are distributed in South America (Mickel, Iowa St. J. Sci. 36: 349—
482. 1962).

We thank Dr. Christopher Davidson and Sharon Christoph for their financial
support for the Floristic inventory of the Triunfo Biosphere Reserve, Chiapas.
We also thank Jorge Martinez-Mélendez, Nicolas Méndez-Guzman, and
Jeremias L6pez-Chagala for their help in the field and processing of plants.
Special thanks to Dr. Alan R. Smith for the verification of specimens and
comments on the manuscript.—MIGuEL A. PéREz-FARRERA, Ma. EVANGELINA LOPEZ-
Mo.ina, NAYELY MartTiNez-MELENDEZ, and H&écror Gomez-DomincuEz, Herbario
Eizi Matuda, Facultad de Ciencias Biolégicas, Universidad de Ciencias y Artes
de Chiapas, Libramiento Norte Poniente 1150, Tuxtla Gutiérrez, Chiapas,
México, 29039.

American Fern Journal 102(3):236—239 (2012)

Obituary: The Rev. Father Dr. V. S.
Manickam §S. J. (1944-2012)

Dr. A. BENNIAMIN
Botanical Survey of India, Itanagar

CHRIS FRASER-JENKINS
Kathmandu and Royal Botanic Garden, Edinburgh

With the passing away of Rev. Father Dr. Visuvasam Sousai Manickam,
Pteridology in India has lost one of its great stalwarts. Father Manickam died
on the 30" March 2012 at St. Mary’s Higher Secondary School, Madurai,
bringing to an end a life of 68 years spent in spiritual quest and in the pursuit
of Pteridology.

Born on 1*' June 1944, in the small village of Kamalapuram, Dindigul District
of Tamil Nadu, as one of several children, the second son of Visuvasam
Paripooranam. After his local school studies he joined the Society of Jesus at
Beschi College, Dindigul, in 1961 and studied religion for two years. He then
went to Chennai to pursue his college studies and was ordained as a priest at
Loyola College, Madras (as Chennai then was) in 1964—1967. He chose an
undergraduate course in Botany at Loyola College, which he passed with a
high mark and then went on to do a postgraduate course in Botany at St.
Joseph’s College, Tiruchirappalli (Trichy), earning a first class degree through
his dedication and attention to detail.

Following this and his awakening interest in Botanical studies, he was
awarded a Ph.D. in Botany in 1975 at the University of Kerala, Thiruvananta-
puram (Trivandrum), which he joined in 1971. He studied there under the
guidance of Professor C. A. Ninan, in the school of the late Professor A.
Abraham, to learn fern cytology. It was under Prof. Ninan’s stimulating
supervision that he developed his ground-breaking research studying the
cytology of South Indian ferns and carried out extensive detailed fieldwork on
the Pteridophytes of the Western Ghats from 1969 onwards. He was able to
explore the entire Palni Hill range, surveying and collecting some 2500

BENNIAMIN & FRASER-JENKINS: OBITUARY: V.S. MANICKAM 237

pteridophytes, and simultaneously pursued his profound religious develop-
ment and studies. These pteridophyte collections were the basis for the
taxonomic part of his Ph.D. work, which he completed at Kerala University
from 1971-74. He also studied in detail the ecology of ferns of the Palni Hills,
under the guidance of the French Institute, Pondicherry. This included
correlating the distribution of ferns in the various phytogeographic zones of
the Palni Hills to the micro- and macro-climate. During this work he in-
vestigated the cytology of about 35 species of ferns. The results were published
in three books, Manickam & Ninan’s Enumeration of ferns of the Palni Hills
(1976) and Ecological Studies on the Fern Flora of the Palni Hills (S. India)
(1984) and Manickam’s Fern Flora of the Palni Hills (South India) (1986), as
well as a further research-paper on cytology (Manickam, 1984). In these works
Father Manickam made every effort to communicate with other botanical
authorities internationally and to revise and update the taxonomy and
nomenclature to a superior level. It was also a great advantage that unlike his
predecessors he documented and numbered his collections conscientiously,
providing the numbers and details in his publication, something that no other
cytotaxonomists in India were doing at that time. As a result, it has still been
possible 35 years later for one of us (CRF)) to find and photographically record all
his cytological voucher-specimens in various herbaria and apply a much
changed, more critical modern taxonomy to them, long after he had produced
his important cytological results. This has not been possible for the pteridological
studies of any other workers from Trivandrum, even recently, who neither kept
actual voucher-specimens, nor cited numbers in their publications, and the same
applies to many of the earlier publications of the Prof. P.N. Mehra School at
Panjab University, Chandigarh, or the work of Prof. T.S. Mahabale at Pune, and
others. In South India only Manickam’s and Dr. J. Ghatak’s cytological work can
be properly verified today and applied to modern pteridology.

After his Ph.D. he joined as Lecturer in Botany from 1979-1981 at the
Rapinat Herbarium, St. Joseph’s College, Trichy, working with the accom-
plished Botanist, Dr. K.M. Mathew, on the ferns of Karnataka and the whole of
the Western Ghats. His extensive herbarium collection from the earlier as well
as more recent work is thus mainly housed at Trichy (RHT) and the well-
documented, good quality cytological and distributional voucher-specimens
he published have been photographed there and when necessary, critically re-
identified by CRFJ. But he was not happy at Trichy, and in 1982 he transferred
to St. Xavier’s College, Palayamkottai, as Lecturer in Botany. From 1982 to
2008 he was settled and worked for nearly 30 years at his beloved St. Xavier’s
College and continued the bulk of his research career there, also supervising
many students and introducing them to the fascinating world of Pteridology,
and Botany in general, in a series of major projects. His extensive later her-
barium collections are housed at St Xavier’s (XCH) and again nearly all the
important voucher-specimens of his and his students’ have been photographed
there for preservation by CRF).

During 1984-87, funded by the Department of Science & Technology, he
carried out a major project on the Biosystematics of ferns of the Western Ghats

238 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 3 (2012)

covering an area of 18,000 sq. km., and collecting some 5000 numbers of
pteridophytes. Detailed field work was done in all the mountain ranges of
Tamil Nadu and Kerala between Kanyakumari and Palghat. Assisted by his
accomplished student, Dr. Varaprasatham Irudayaraj (b. 1960), who carried out
a spectacular number of well-documented chromosome-counts, he investigat-
ed the cytology of 110 ferns collected from the area. The cytological and tax-
onomic results were published in two books, Manickam and Irudayaraj’s
Cytology of ferns of the Western Ghats South India (1988) (with an addition
and correction, Manickam and Iruadayaraj, 1989) and the outstandingly useful
and major illustrated work, Manickam and Irudayaraj’s Pteridophyte Flora of
the Western Ghats - South India (1992).

In a second project funded by European Jesuits, the Western Ghats were
explored from Palghat to Coorg in Karnataka. Detailed fieldwork was carried
out in the Nilgiris, Silent Valley, Wyanad and Coorg, collecting 3500 num-
bers. As a part of this project, five families of ferns were subjected to pre-
liminary phytochemical analysis by his research-scholars. A third related
project concentrated on re-exploring several of the higher mountains such as
the Anamallays, Palnis and Tirunelveli hills (resulting in a further book,
Manickam and Irudayaraj’s Pteridophyte Flora of Nilgiris, South India
(2003)).

In 1987 he crowned his research-career with the opening of a new and
modern Research Laboratory at St. Xavier’s, the Centre for Biodiversity and
Biotechnology (CBB), affiliated to Manonmanium Sundarnar University,
Tirunelveli District. He was the founder and Director of the Laboratory, which
concentrated on research on Pteridophytes, Angiosperms, and also environ-
mental education to school teachers and children. In all, he supervised 25
Ph.D. students there, who all now have good positions in various organiza-
tions. He was successfully able to raise funding grants for the Laboratories’
Research-Projects amounting to more than two crore rupees (20 million Indian
rupees, or c. 400,000 U.S.D.) from various International and National scientific
and educational funding agencies.

Father Manickam was elected a Life Fellow of the Indian Fern Society in
recognition of the high quality of his work. He published 10 botanical books
and more than 180 papers (a selection of his publications is in Indian Fern J.
22(1—2):204—208 (2005)). Later in his life he also wrote a number of spiritually
insightful religious discussions with a very practical and down to earth context
designed to help young people.

Father Manickam has been honored with the naming of four fern taxa after
him, Polystichum manickamianum Benniam., Fraser-Jenk. & Irud. (2008),
Thelypteris parasitica (L.) Tardieu subsp. manickirudorum Fraser-Jenk. (2008),
Athyrium x manickamii Fraser-Jenk. (2008) and Pteris manickamii Dom.Rajk.,
and three Angiosperms, Memycelon manickamii Murugan et al (2002),
Xanthophyllum manickamii Murugan (2002) and Eugenia manickamiana
Murugan (2002). It is much to his credit that unlike other contemporaries he
himself did not descend into naming many erroneous and spurious “new
species” etc. that has so damaged Indian pteridology.

BENNIAMIN & FRASER-JENKINS: OBITUARY: V.S. MANICKAM 239

Unfortunately in the last five years of his life the College wished to take over
his grants and therefore sent him to stay at Madurai away from his former
students at work. During this time he remained of perfectly sound mind and
memory despite the injustice and disappointment of the situation. Even after
his unwanted retirement Father Manickam was highly active intellectually. He
had learned the Thirukural (of Tamil poetic literature) by heart and spent
much time translating and expounding it. He was not only an excellent teacher
but also a philosopher who would always guide young students in their
chosen direction in life.

In the last year of his life, on 14° Aug. 2011, his village people celebrated a
Golden Jubilee for Father Manickam’s 50 years since joining the Society of
Jesus (1961-2011). It was a most happy occasion, which he enthusiastically
enjoyed.

Father Manickam’s contribution to science, especially in Pteridology,
amounts to a definitive and monumental treatment of the ferns of South
India. The loss to science and Botany from his death is immense, as is the loss
to humanity of his delightful personality. It is hard indeed to think of his
beloved establishment now no longer filled with his jovial laughter, and his
lifetime’s expertise uniquely guiding his active students along the path of
pteridology he trod so splendidly and dedicatedly. May his soul rest in peace.

INFORMATION FOR AUTHORS

Authors are encouraged to submit manuscripts pertinent to pteridology for publication
in the American Fern Journal. Manuscripts should be sent to the editor at hauk @denison.
edu. Acceptance of papers for publication depends on merit as judged by two or more ref-
erees. Authors are encouraged to contribute toward publishing costs; however, the payment
or non-payment of page charges will affect neither the acceptability of manuscripts nor the
date of publication.

Authors should adhere to the following guidelines; manuscripts hot so prepared nese be
returned for revision prior to review. E
ever if it is necessary to submit hard copy, please submit one copy of the eds pe
include a review copy of illustrations and originals of illustrations. After acceptance, please
submit final versions of manuscripts via FTP (contact the managing editor for instructions),
email, or on diskette or CD ROM (see below for figure formatting). If submitting hard
copies, use standard 8.5 by 11 inch paper of good quality, not “erasable” paper. Double-
space manuscripts throughout, including title, author’s names and full addresses, a short,
informative abstract, key words, text (including heads and keys), literature cited, tables
(separate from text), and figure captions (grouped as consecutive paragraphs separate from
figures). Arrange parts of manuscript in order just given. Include author’s name and page
number in the upper right corner of every sheet, and provide an abbreviated running title.
Provide margins of at least one inch (25 mm) all around on typed pages. Do not submit
right-justified text, avoid footnotes, and do not break words at end of lines. Make table
headings and figure captions self-explanatory. Use S.I. (metric) units for all measures (e.g.,
distance, elevation, weight) unless quoted or cited from another source (e.g., specimen
citations). For nomenclatural matters (i.e., synonymy and typification), use one paragraph
per basionym (see Regnum Veg. 58:39-40. 1968). Abbreviate titles according to Botanico-
Periodicum-Huntianum (Lawrence et al., 1968, Hunt Botanical Library, Pittsburgh) and its
supplement (1991). References cited only as part of nomenclatural matter are not included ~
in literature cited. For shorter notes and reviews, omit the abstract and put all references
parenthetically in text. Use Index Herbariorum (Regnum Veg. 120:1-693. 1990; or http://
websun.nybg.org/bsci/ih/) for designations of herbaria. For more detailed instructions on
manuscript preparation, see http://amerfernsoc.org/.

Illustrations should be proportioned to fit page width (5 inches or 12.5 cm) with caption
ultimately to be included on the same page. Halftone and color images should be scanned

at a minimum of 300 pixels per inch (ppi). Line art should be scanned at 1200 ppi when-
ever possible. Please note that nearly all images that are downloaded from the Internet or
that are in JPEG or GIF format will be 72 dpi and not acceptable for the printing process.
Indicate the file format of the graphics. Please submit image files in TIFF (preferable) or
EPS format. Provide margins of at least 25 mm on all illustrations. For continuous-tone
illustrations, design originals for reproduction without reduction or by uniform amount.
In composite blocks, abut edges of adjacent photographs. Avoid combining continuous-
tone and line-copy in single illustrations or blocks. Coordinate sequence and numbering
of figures (and tables), with order of citation in text. Explain scales and symbols in figures
themselves, not in captions. Include a scale and reference to — and —_ in each
map.

+ Pe ££ a 1 bd + - 4 _ ee Inge

by the printer. Authors should s send proof corrections of corrected proofs to ‘the editor and
reprint orders to the printer. Authors will be ; g
after type has been set.

For other matters of form or style, consult recent issues of the Antics Fern sae : oo
nal and The Chicago Manual of Style, 14° ed. (1993, Univ. of Chicago Press, Chicago). s oS

Occasionally, departure from these guidelines may be justified. Authors are Seaver gare es
consult the editor for assistance with any aspect of manuscript preparation. See

Papers of longer than 32 g ay f P. ridotoia (memoir S 5
Editor, ——— cover page 2). = ee oo

PTERIDOLOGIA ISSUES IN PRINT

The following issues of Pteridologia, the memoir series of the American Fern Society,
are available for purchase:

1. Wagner, David H. 1979. Systematics of Polystichum in Western North America
North of Mexico. 64 pp. $10.00 plus postage and handling.

2A. Lellinger, David B. 1989. The Ferns and Fern-allies of Costa Rica, Panama, and
the Chocé (Part 1: Psilotaceae through Dicksoniaceae). 364 pp. $32.00 plus postage and
handling.

3. Lellinger, David B. 2002. A Modern Multilingual Glossary for Taxonomic Pteri-
dology. 263 pp. $28.00 plus postage and handling.

For orders and more information, please contact our authorized agent for sales at:
Missouri Botanical Garden Press, P.O. Box 299, St. Louis, MO 63166-0299, tel. 314-577-
9534 or 877-271-1930 (toll free). For online orders, visit: http://www.ml org

or

AMERICAN FERN JOURNAL ON MICROFICHE

Volumes 1-61 of the American Fern Journal are available as archival quality, silver
positive microfiches. Single volumes or the entire run may be purchased. The fiches are
easily read with 10x or greater magnification (using a dissecting microscope and transmit-
ted illumination or a fiche reader). Silver negative microfiches of vols. 1—50 are also avail-
able. The price is $4.00 per volume or $244.00 per set of 61 volumes, postpaid.

Send your inquiry or order with a check or money order to: American Fern Society,
Inc., % Ecology III, 804 Salem Blvd., Berwick, PA, 18603-9801.

FIDDLEHEAD FORUM
The editor of the Bulletin of the American Fern Society welcomes contributions from
members and non-members, including miscell notes, offers to exchange or purchase

materials, personalia, horticultural notes, and reviews of non-technical books on ferns.

SPORE EXCHANGE
Ms. Denia Mandt, 12616 Ibbetson Ave., Downey, CA 90242-5050, is Director. Spores
exchanged and lists of available spores sent on request. http://amerfernsoc.org/sporexy.
html

GIF TS AND BEQUESTS -

Pano 7%. Seas Sa ble — nvr

interested in ferns. Back issues of the Kae and cash or other gifts are always eelcaniod
and are tax-deductible. Inquiries should be addressed to the Membership Secretary.
VISIT THE AMERICAN FERN SOCIETY’S
WORLD WIDE WEB HOMEPAGE:
http://amerfernsoc.org/

AMERICAN Volume 102
ce Re N Number 4

October-December 2012

JOURNAL

QUARTERLY JOURNAL OF THE AMERICAN FERN SOCIETY

The Distinguished Legacy of DMB: Donald MacPhail Britton (1923-2012)
Kathleen M. Pryer

The Life of Barbara Joe Hoshizaki (1928-2012)
Robbin C. Moran

Low ceca Population Genetic Variation and High Among Population Differentiation
jum falcatum (L.f.) C. Presl Acid di ecieerapiease in Southern Korea:
arta of Population-Establishment H
Mi Yoon Cisne: Jordi Lépez-Pujol, Jae Min Chung,
Ki-Joong Kim, and Myong Gi Chung

SEM Studies on Ti heid: AA se ee }
Sherwin et Edward L. Schneider, and Kevin F. Kenneally

DLI. “ z s* (LT.
o o r

New Hanging Firmoss from T:
Tung- Yu Hsieh, Kent A. Hatch, and in Mou Chang

Lectotypification of Marsilea quadrifolia L. (Marsileaceae)
Duilio lamonico

Referees for 2012

Table of Contents for Volume 102

241

252

256

273

The American Fern Society
Council for 2012

KATHLEEN PRYER, Dept. of Biology, Duke University, P.O. Box 90338, Durham, NC 27708.
President
JAMES E. WATKINS, JR., Dept. of Biology, Colgate University, Hamilton, NY 13346.
President-Elect
MARY STENSVOLD, USDA Forest Service, 204 Siginaka Way, Sitka, AK 99835.

Secretary
JAMES D. CAPONETTI, Div. of Biology, University of Tennessee, Knoxville, TN 37996-0830.
Treasurer
GEORGE YATSKIEVYCH, Missouri Botanical Garden, P.O. Box 299, St. Louis, MO 63166-0299.
Moaemb, hin &

JAMES D. MONTGOMERY, Ecology III, 804 Salem Blvd., Berwick, PA 18603-9801.
Curator of Publications
WARREN D. HAUK, Dept. of Biology, Denison University, Granville, OH 43023.
Journal Editor
R. JAMES HICKEY, Dept. of Botany, Miami University, Oxford, OH 45056.
Memoir Editor
JOAN N. E. HUDSON, Dept. of Biological Science, Sam Houston State brie Huntsville, TX 77341-2116.
DAVID SCHWARTZ, 9715 Christey Way, Bakersfield, CA 93312-5617

Bulletin Editors
American Fern Journal
EDITOR
WARREN D. HAUK Dept. of Biology, Denison University, Granville, OH 43023,
ph. (740)587-5758, e-mail: hauk @denison.edu
ASSOCIATE EDITORS

NAN CRYSTAL ARENS oo. Dept. of Geoscience, Hobart & William Smith Colleges, Geneva, NY 14456
JOSE MARIA GABRIEL Y GALAN ............ Dept. de Biologia Vegetal I, Universidad egeian — de Madrid,
Spain 28040

GERALD J. lt ONY Dept. of Biology, Indiana University, ice ae 2 47405-6801
GARY K. GR Biology Dept., Grand Valley State Loita Allendale, MI 49401
ore =e HAUPLER. 6 oicceccccns Dept. of Ecology and Evolutionary B Demsgpre: of Kansas,
pro e, KS 66045-2106
R. JAMES HICKEY Dept. of Botany, Miami Uni pati a 1 Oxford, OH 45056
PAULO LABIAK .............. Universidade Federal do Parana, Dept. de —— 81531 -980, Curitiba-PR, Brasil
ROBBIN C. MORAN New York Botani Bronx, NY 10458-5126
eee NAGALINGUM 3 d eects Sydney, NSW, Australia
ROTHFELS . any Dept., Duke Univers ersity, Durham , NC 27708
EMILY megents Botany Dept., University = isteemess —: Madison, WI 53706
Ee trees .... Pringle es The University of Vermont, Burlington, VT 05405
ee KE. wee JR. of aettery Colente Carnsiey: Hamilton, NY 13346
The “American Fern Journal” (ISSN 0002-8444) is an illustrated Ae -eatace to the general study of
ferns. It is owned by the American Fern Society, and published at The American Fern Society, % Missouri

Botanical Garden, P.O. Box 299, St. Louis, MO 63166-0299. Periodicals saa paid at St. Louis, MO, and
additional entry.

12 months (foreign) after the date of issue, and orders
for back issues should be addressed to Dr. James D. Montgomery, Ecology III, 804 Salem Blvd., Berwick, PA
18603- 9801

fades ge TG dues, a nd = £ } ae i ih ae pe; L pened as
nses oo 8 if ' r 7°
nm + £, bh eg Ad. ty San, =p

Back volumes are avalible for most years as sere issues or on microfiche. Please contact the Back Issues
Curator for — and availability.
5

, eae
Society Membership — USA, Canada, Mi (includes Joumal and Fiddiehead F 530
Society M be up : rf lud T 1 10 idlet << eon ) : $40
‘Society L “> Rg LL Lt CICN ¢(.2.AA CAN L g s 2 - d USA, Canada, Merico)
Regular Membership — USA, ‘Canada, Mexico (includes Fiddlehead F 2.
j, cr 331 Ss. im wy $22

Institutional Membership — ~ $40 to USA, Canada, Mexico; $50 elsewhere (-$3 agency fee)
| PosTMASTER: _ Se So roe heen tee hee ees i Botanical Garden, P.O. Box 299,
: St. Louis, me 63166-0299.

American Fern Journal 102(4):241-251 (2012)

The Distinguished Legacy of DMB:
Donald MacPhail Britton (1923-2012)

KATHLEEN M. PRYER
Department of Biology, Duke University, Durham, NC 27708-0339, USA
e-mail: pryer@duke.edu

In a letter dated 23 May 1995, Donald M. Britton wrote to me, “... things are
moving along at a leisurely pace and my lifestyle is changed — No pipe, No
coffee, No chocolate peppermints, No stress, No strain. ...Dan [Brunton] and I
are still banging away at Isoetes ...it is nice to have a hobby project so the old
neurons do not completely short-circuit ...I noticed when I passed 70 that mail
eased up considerably. I guess workers feel that either you are retired, or
should be! One looks a bit furtively at the obits to see who has made the list”’.

Fortunately for pteridology, Don Britton remained active in research
throughout his “retirement” (Brunton, 2012a, 2012b; Brunton and Catling,
2012) and he published nearly 20 more papers after the aforementioned letter
(Appendix 1). Most of these were with his longtime friend and collaborator
Daniel F. Brunton. From 1995 to 2006 “Brunton and Britton” and “Britton and
Brunton” described seven new North American species and hybrids of Isoetes
(Appendix 2), and also published studies clarifying the distribution, status,
and taxonomy of several more in this notoriously difficult genus (Appendix 3).

Donald MacPhail Britton (Fig. 1) was born on March 6, 1923 in Toronto,
Canada, the youngest son of Arthur Britton and Marjorie Spence. He attended
University of Toronto Schools (UTS) and was awarded a J. S. McLean
Scholarship in Science to the University of Toronto in 1942. Britton was a
hard-working and successful student, receiving the I. M. Gilchrist Prize in
Botany (1944) and graduating with first class honors in science and biology
(1946). That fall, he entered the graduate program at the University of Virginia
under the auspices of a Philip Francis du Pont Fellowship. His time at UVA
involved a semiannual migration, with the academic year spent at the Miller
School of Biology (Charlottesville, VA), and the summer working at Blandy
Experimental Farm (Boyce, VA). In 1950, Britton completed his Ph.D. with a
dissertation entitled “Cytogenetic studies on the Boraginaceae” and received
an honorable mention from the Virginia Academy of Science. The following
year he married Mary Cronyn, whom he had met at the University of Toronto.

With Ph.D. in hand, Britton pursued a postdoctoral fellowship at the
Department of Plant Science at the University of Alberta. F ollowing this, he
worked several years as an Assistant Professor of Horticulture at the University
of Maryland, where he specialized in the cytogenetics and breeding of Rubus
and other flowering plants. In 1958 he moved to the University of Guelph and,
in 1971, became a Full Professor in the Department of Botany and Genetics. He
spent the remainder of his academic career at Guelph.

242 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

Fic. 1. Photograph of Donald M. Britton taken in 1996 on the occasion of the Richard and Minnie
Windler Award presented by the Southern Appalachian Botanical Society for the publication:
Brunton, D. F., D. M. Britton, and T. F. Wieboldt. 1996. Taxonomy, identity, and status of Isoetes
virginica (Isoetaceae). Castanea 61:145—160.

Showing an early interest in ferns, Britton became a member of the American
Fern Society in 1946. Later in his career, he would be awarded an honorary
membership in this Society—a special category for persons who have made
outstanding contributions to the study of ferns. Britton’s early emphasis on
angiosperms eventually gave way to a career-long focus on ferns. Building on
his strong interest in cytogenetics, his first fern paper, entitled “Chromosome
studies on ferns,” was published in the American Journal of Botany in 1953.
This was a landmark paper following up on Manton’s (1950, see also 1973)
methodological breakthrough combining acetocarmine staining with a squash
technique that flattened dividing cells so that their chromosomes could be
photographed in one focal plane. Prior to the introduction of this technique,
the only method available to count chromosome numbers was to compare
camera lucida drawings based on serial microtome sections of paraffin-

PRYER: DONALD M. BRITTON (1923-2012) 243

embedded material. Britton’s paper (1953) provided chromosome numbers for
25 species of ferns collected in southern Ontario. Because many of the species
were also native to the British flora studied by Manton (1950), his work
provided vital corroboration of Manton’s results, along with additional
evidence of polyploidy in ferns.

While at Guelph, Britton supervised four graduate students in pteridology:
Jane Rigby (M.Sc.1969, Pellaea), Laima Kott (M.Sc. 1972, Polypodium; Ph.D.
1980, Isoetes), Ruth Hersey (M.Sc. 1979, Lycopodium), and me, Kathleen Pryer
(M.Sc. 1981, Gymnocarpium), all of whom published their work with him
(Appendix 1). I remember how he would frequently come into the lab to read
us letters (while smoking his pipe with tobacco from the local Wiffn Puff) that
he received from scientists all over the world who sought his opinion and
shared new information with him. What a great way for students to learn about
ferns and the kinds of research questions being asked at the time! This was
well before Chris Haufler (who Britton referred to as the “wunderkind in
Kansas’’) took the fern world by storm with isozymes.

Britton also took his students to important fern meetings, including the
famous New England Fern Conference that was held in Petersham,
Massachusetts at Harvard Forest. These meetings were critical for fostering
communication among botanists working on ferns, but in diverse disciplines.
One of these trips included an introduction to the herbaria at Harvard and the
wonderful hospitality of Alice and Rolla Tryon at their residence within a
stone’s throw from the herbarium (where we feasted on the best fiddlehead
appetizers ever...!).

I never called him Don, always Dr. Britton. But after I graduated with my
M.Sc. from Guelph in 1981, I addressed him by his initials in correspondence
and that is how I have always referred to him since—DMB. DMB was
extremely generous with his time and very patient with everyone (students,
colleagues, and amateur enthusiasts, alike), and through his example showed
us how to put in the long hours to get those almost-perfect chromosome
squashes, and to locate those hard-to-find ferns when doing fieldwork. DMB’s
connection with those outside the academic world was particularly evident in
how he was always so welcoming to anyone interested in his area of study. His
quiet encouragement and the confidence it ‘instilled in those working with
natural history and regional conservation organizations were both effective
and appreciated, as acknowledged when he was awarded an Honorary
Membership by the Ottawa Field-Naturalists’ Club in recognition of both his
scholarly and conservation contributions (Brodo et al., 2001).

Doing fieldwork with DMB was a treat (Fig. 2). It was a natural talent for
him—it was as though he had special radar in the field for finding the ferns he
was after. One does not learn how to do that from books, but by watching and
observing, if you are fortunate to be with someone who has the “know how”.
Field trips with DMB were meticulously planned—everything happened on
schedule, ALWAYS with good humor, and without a hitch.

Except for one trip, a trip that is a favorite memory that still makes me smile,
to a special Gymnocarpium collecting site in Wellington County, near Guelph,

244 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

Fic. 2. DMB in 1979, collecting ferns in northwestern Ontario (near Thunder Bay).

to which we returned a few times to collect chromosome and spore material. It
meant driving about 20 minutes from campus, parking on the side of the road,
then trudging our way though a few acres of pasture with all our collecting gear
in tow, to get to a woodlot that had the patch of ferns we were after. On one
occasion, as we were making our way through the pasture, I spotted a bull facing
us.... and he seemed to be pawing at the ground. I squinted for a better look, and
nervously whispered to DMB “‘What is one supposed to do when you think a
bull might be getting ready to charge?” Not getting an answer, I glanced over my
shoulder and there was DMB, in the distance, with his great long legs hightailing
it over the fence. I bolted after him at the speed of light, and learned another
important lesson; don’t waste time asking questions, just watch and learn...
After his official retirement at age 65, DMB was awarded the title of Professor
Emeritus by the University of Guelph. For nearly 20 more years, he enjoyed

PRYER: DONALD M. BRITTON (1923-2012) 245

going to his office every day, socializing with the younger members of his
department, and continuing his scientific studies. The year following his retirement
from Guelph, DMB coauthored a book with William J. Cody from Agriculture
Canada entitled “Ferns and Fern Allies of Canada” (1989). Nearly 25 years later, it
still is (and long will be) the definitive reference book on the ferns of Canada. In
1991, DMB was awarded the Lawson Medal for “outstanding scientific achi t
over the period of a career” from the Canadian Botanical Association. He was
awarded the Richard and Minnie Windler Award for his publication on Isoetes
virginica with Brunton et al. (1996) in the journal Castanea. In 2007, the Field
Botanists of Ontario awarded him the inaugural John Goldie Award for his dedicated
service to the field of botany. The three fern taxa named in his honor (Appendix 4)
provide further tribute to DMB’s contribution to our knowledge of ferns.

The last time I saw DMB was when I visited him in Guelph in June 2000 and
we spent two days together racing over the countryside collecting as many
different species of Equisetum as possible. It was a very productive effort—9 of
the 15 species of Equisetum that are known worldwide can be found within a
short distance from Guelph and he led me to all of them. This resulted in a
phylogenetic publication in 2003 (Des Marais et al.) that was DMB’s first and
only publication to include molecular DNA sequence data (or what he would
call “the O. J. solution”). A paper presenting a molecular phylogeny of
Cystopteridaceae (including Cystopteris and Gymnocarpium, two of DMB’s
favorite ferns), and currently in press at Systematic Botany (Rothfels et al.
2013), is dedicated to the memory of DMB.

With a “second retirement”’ at age 80 (see tributes by: Brunton, 2003; Catling,
2003; Ceska and Ceska, 2003; Pryer, 2003; Reznicek, 2003), DMB’s world
contracted, especially after being diagnosed with Alzheimer’s disease in 2008
and the death of his wife Mary in 2010. DMB was hospitalized on May 15, 2012
with pneumonia and died peacefully in hospice on May 18. A private family
funeral service was held on May 19, followed by a memorial service to
celebrate his life on July 28 at St. George’s Anglican Church in Guelph. He
leaves behind his son Robert, and two daughters, Anne (Terry Greenlay) and
Barbara, as well as two grandsons, Scott and Ben, of whom he was very proud.

To me, DMB embodies all that is essential to being a great scientific advisor,
including a wry sense of humor and the ability to get students to move beyond
their comfort zone. He is the one I have always tried to measure up to in my own
scientific interactions, especially with graduate students. Several people contacted
me this summer to say how very sorry they were to hear about our loss of DMB.
They all described him as “‘a larger-than-life guy”. I will be forever grateful to DMB
for the guidance and opportunities that he provided. His influence in my life has
been pervasive—I think of him every time I interact with my own graduate
students, every time I do fieldwork, and every time I see a bull in a pasture...

ACKNOWLEDGEMENTS

I am very grateful to DMB’s children (Robert, Anne, and Barbara), Dan Brunton, Usher
Posluszny, Dean Whittier, and Michael Windham for their encouragement, insightful comments,

246 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

d help with preparing this tribute. David Barrington made useful comments in review, and
George Yatskievych provided information regarding DMB’s American Fern Society membership.

LITERATURE CITED

Britton, D. M. 1953. Chromosome studies on ferns. Amer. J. Bot. 40:575—58
Bropo, I. M., C. HANRAHAN, S. Darpysuire and S. bie ria 2001. The Ottawa on Naturalists’ Club
Awards April 2001, Honorary Mem mbership: Donald M. Britton. Can. Field-Naturalist 115:728.
eee D. F. 2003. Don Britton at 80. sesame! Electronic News (BEN) 305. Retrieved 30 August
2, from http: //bomi.ou
Pett - F. 2012a. Donald M. eet (is2s-2012) Botanical Electronic —_ Mpctee 458.
Retrieved . August 2012, from http:/
BRUNTON, eft F.2 12b. A tribute to Donald M. Britton (1923-2012), Canada’s premier Midis
Can. Field- Newie 126: in pre
BRUNTON, ‘s and P. M. CatLinc. i ee tribute for Donald M. Britton (1923-2012), a wonderful
botanist! Can. Bot. Assoc. Bull. 45:104—-105.
Brunton, D. F., D. M. Brirron and T. F. Wieso.pt. 1996. Taxonomy, identity, and status of Isoetes
virginica cA GEE Castanea 61:145—160.
M. 2003. Don

rane P: onald M. Britton—1991 Recipient eh eee oe hea Bexeninal ieee
ws (BEN) 304. smi 30 August 2012, from h
aa 0. and A. Ceska. 2003. Isoetes minima—guess ahi Tented. it Botanical Electronic News
(BEN) 304. danieead 30 August 2012, from http://bomi.ou 4.htm!]
Copy, W. J. and D. M. Brirron. 1989. Ferns and fern allies of Canada. Agriculture Canada Research
Branch nant ue Ottawa. 430 pp.
Des Marais, D. miTH, D. M. Britton and K. M. Pryer. 2003. Phylogenetic relationships and

evolution of extent horsetails, wlan: based on chloroplast DNA sequence data (rbcL and
Int. J. Pl. Sci. 164:737—
HERSEY, R. E. 1979. Study of variation in ae species of Lycopodium L. (section Complanata Vict.)
in Ontario. M.Sc. thesis, University of Guelph, ON, Canada.
Korr, L. 5. 1972. Morphological study of the cytotypes of Polypodium virginianum L. in southern
Ontario. M.Sc. thesis, University of Guelph, ON, Canada.
Korr, L. S. 1068 The taxonomy and biology of the os L. in northeastern North America.
Ph.D. dissertation, University of Guelph, ON, Canada.
Manton, I. 1950. Problems of cytology and svehine in the Pteridophyta. University Press,
Cambridge.
Manton, I. ae — How it sas ioe nee Fern Gaz. 10: 285-292.
Pryer, K. M. 1 S ] n North America. M.Sc
thesis, Saleen of Guelph, ON, Can
Pryer, K. M. 2003. Don Britton (DMB) turns se Botanical Electronic News (BEN) 304. Retrieved 30
st pe, from http://bomi.ou.edu/ben/ben304.html.
Mee A. A. 2003. Don Britton — Appreciation. Botanical sa News (BEN) 304. Retrieved
30 August nas from http://bomi.ou.edu/ben/ben304.htm
Ricsy, S. J. 1969. Investigation of Pellaea glabella Mett. ex Kuhn a Pellaea atropurpurea (L.) Link
and their relationships. M.Sc. thesis, iayoneed of Guelph, ON, Canada.
RoTHFELs, C. R., M. D. WinpHaM and K. M. Pryer. 2013. A plastid phylogeny
family Cystopteridaceae pivotal. Syst. Bot. 38: in pre

“

f th litan fern

PRYER: DONALD M. BRITTON (1923-2012) 247

APPENDIX 1. Fern bibliography (including abstracts and reviews) of Donald M.
Britton, arranged first by decade, and then alphabetically within each decade.

1950s

BRITTON, D. M. 1953. Chromosome studies on ferns. Amer. J. Bot. 40:575-5

Tryon, A. F. and D. M. Briton. 1958. Cytotaxonomic studies on the fern genus Pellaea. Evolution

2137-145.

1960s

BRITTON, D. M. 1960. Recent fern literature—Ferns of Alberta. Amer. ere 50:156—-157.

Britton, D. M. 1960. Report on the Rougemont field trip. Amer. Fern J. 50:216-218.

Britton, D. M. 1961. The problems of variation in North American aaa Amer. Fern J.
51:23-20.

Britton, D. M. Jee LA ao us (Hoffm.) A. Gray in North America. Rhodora 64:207—212.

Britton, D. M. 1964. Chromo mbers of ferns in Ontario. Canad. J. Bot. 42:1349-1354.

Britton, D. M. ae Hybrid wee ferns in in Ontario. Michigan Botanist 4:3—9

Britton, D. M. 1966. Review of Flore Laurentienne by Frére Marie- seseuay Amer. Fern J. 56:84—86.

Britton, D. M. poi Diploid conan dilatata from Quebec. Rhodora 69:1—4.

Britton, D. M. 1968. The spores of four species of spinulose wood pi (Dryopteris) in eastern
North 7.

Britton, D. M. and S. J. RicBy. 1969. In search of the purple cliff brake. Ontario Nature 8(5—7):12.
ae D. M.a nd J H. Pag 1966. The cytology and distribution of Dryopteris species in Ontario.
anad. J. Ste 44:63-78.

Poi ae D. M., A. Lecautr and 8S. J. RicBy. 1967. ae atropurpurea (L.) Link and Pellaea glabella
Mett. in ceri Naturaliste Canad. 94:7

Knos.ocu, I. W. an . BRITTON sangre The een number and possible ancestry of Pellaea
wrightiana. Amer. J. Bot. 50:52-55.

TrYON, R. M. and D. M. Brirton. ai A study of variation in the cytotypes of Dryopteris spinulosa.
Rhodora mE gis

Wwén, C.-J. an Barreca: 1969. A chromatographic and a study of Dryopteris
ao in gece North America. Canad. J. Bot. 47:1337-134

ae D. M. cis sci woodferns (Dryopteris) in western North America. Canad. Field-
Natali 0: sia

Britton, D. tous ornamentation in the Dryopteris spinulosa complex. Canad. J. Bot.
50:16 a

Brirron, D. M. 1972. The spores of Dryopteris clintoniana and its relatives. Canad. J. Bot.
50:2027—2029.
Britton, _ - 1974. The significance of chromosome numbers in ferns. Ann. Missouri Bot. Gard.
1:310-317

BRITTON, . M. 1976. The distribution of Dryopteris spinulosa and its relatives in eastern Canada.
Amer. Fern J. 66:69—74.

Britton, D. M. 1976. Two decades of cytotaxonomic research on Canadian ferns hapiried anon
Pp. 116-126 in P. Kachroo, ed., Recent Advances in Botany (Prof. P.

Co

Britton, D. M. 1977. “A Note: Solicited review of The gas — oo campyloptera by M.
Gibby, sores J. Bot. 55:1419-1428.”’ Amer. Fern J. 67:

Britton, D. M. 1977. The fern eae pe (Spreng) Sate in Gace Canad. Field-Naturalist
9 .

i: :
Britton, D. M. 1978. Review of “Cytotaxonomical Atlas of the Pteridophyta. sabeageptonnetis
Atlases, Volume 1 Ill by A. Love, D. Love, and R. E. G. Pichi Sermolli. Germany: J. Cram
uart. cay 53: 64-65.
Britton, D. M. 978. Review of ‘Evolutionary Patterns and Process in Ferns, by Lovis In:
pee in Botanical Research, Volume 4’’. Bull. Torrey Bot. Club 105:245-24

248 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

Britton, D. M. 1979. Review of ‘‘Ferns of the Ottawa District, by W. J. Cody, Supply and Services,
Canada’’. Canad. cid oi 93:345.
Britton, D. M. and A. C. Jermy. 4. The spores of Dryopteris filix-mas and related taxa in North
America. Casiad: J. Bot. tae 926
Britton, D. M. and C.-J. WEN. 1974. Che pitevoncenic studies on Dryopteris from Quebec and
_ J. Bot. 52:627-6

Britton, D. M., C.-J. Winen, D. F. Brunton and P. A. Keppy /.1975. A new hybrid woodfern, Dryopteris
x algonquinensis D. M. Brirron, from Algonquin Park, Ontario. Canad. Field-Naturalist

89:163-171
CampseLL, C. A. and D. M. Britton. 1977. Pteridophytes of the Regional Municipality of Waterloo,
Ontario. Canad. Field-Naturalist 91:262—268.

Ricsy, > 7 =areh M. Britron. 1970. The distribution of PelJaea in Canada. Canad. Field-Naturalist
—144.
Wisk: — and D. M. Britton. 1971. A chromatographic and mA Satie study of Dryopteris
dilatata in North America and eastern Asia. Canad. J. Bot. 4
Wen, C.-J. and D. M. Brirron. 1971. A chromatographic and cae as stad of Dryopteris filix-
mas and related taxa in North America. Canad. ot
Wien, C.-J. and D. M. Britton. 1971. CheneAakinionnit ance ea on Dryopteris fragrans.

See ye nye ae 989-992.
Wien, C.-J. an M. Britton. 1971. lps ns na investigations on the Dryopteris cristata
eet in a America. Canad. J. Bot. 49:1141—1154.

Wintn, C.-J., D. M. Brirron, W. H. WAGNER, JR. ste F. S. Wacner. 1975. Chemotaxonomic studies on
hybrids of Dryopteris in eastern North America. Canad. J. Bot. 53:1554—1567.

1980s

Britton, D. M. 1981. Review of Pie of Northwestern Himalayas, by K. K. Dhir, 1980’’. Canad.
i 95:119-12

Britton, D. M. 1981. Review of vues Plants of Continental Northwest Territories, omy by

A. E. pana nee W. J. Cody, National Museum of Canada, 1980”. Amer. Fern
aout D. M. 1983. Review of ‘Ferns and Allied Plants with Special fe * “eel
merica, by R. ryon and A. F. Tryon, New York: stad Sue 1982”. Canad. Field-
Naturalist 97:361.

Britton, D. M. 1984. Biosystematic studies on pteridophytes in Canada: — ~ problems.
Pp. 543-560 in W. F. Grant, ed., Plant Sheet Academic Press, Toro

Britton, D. M. 1984. Checklist of Ontario pteridophytes. Part One: Fern Allies. Pl. sane 2(4): ene

Britton, D. = soos Checklist of Ontario ne arte Part Two: Ferns. Pl. Press 3(1):14—

i. 986. Review of — Field Manual of the Ferns and Fern-Allies of United an od

ax ob 69 4(1):34—

— D. M. and A. B. ps 1986. The ferns of Manitoulin Island. Notes and a new record.
Pl. Press 4(2):60-61.

Britton, D. M. and D. F. Brunton. 1989. A new Isoetes hybrid (Isoetes echinospora X riparia) for
Canada. Canad. J. Bot. 67:2995—3002.

Britton, D. M., H. L. Dickson and D. Wuire. 1983. Rare species of Ophioglossaceae. In G. W. Argus
and D. J. White, eds., een of Rare Vascular Plants of Ontario/Atlas des plantes vasculaires
rares de |’Ontario, Part 2. Ottawa: — Meeenn of Netaral Soeate es.

Britton, D. M., W. G : Srawase and W. J. Copy. 1985. g Fragile Fern), an
addition to the flora of Canada. ee Field- Naturalist 99: 380-382.

Britton, D. M., H. L. Dickson, K. M. Pryer and D. J. Wuire. 1987. Rare species of Ophioglossaceae
(additions). In K. M. Pryer and G. W. Argus, atts em of Rare Vascular Plants of Ontario/
Atlas des plantes vasculaires rares de l'Ontario, Part 4. Ottawa: National Museum of Sct

cienc
Britton, D. M., P. M. Cattiinc, H. L. Dickson, K. M. Pryer and D. J. Wuire. 1987. Rare species of
Aspleniaceae (additions). In K. M. Pryer and G. W. Argus, eds., Atlas of Rare Vascular Plants
of Ontario/Atlas des plantes vasculaires rares de l'Ontario, Part 4. Ottawa: National Museum
of Natural Sciences.

PRYER: DONALD M. BRITTON (1923-2012) 249

Copy, Hae J. and D. M. Brirron. 1985. Dryopteris filix-mas (Male Fern), a sone asian
ortant oo. in northern Saskatchewan. Canad. Field-Naturalist 99:101—
Copy, w. J. and D. M. Brirron. 1989. Ferns and fern allies of Canada. Agriculture paeariee oe
anch Samira 1829/E, Ottawa. 430
eae R. and D. M. Brirron. 1983. Typification within the Polypodium virginianum complex
Polypodiaceee). Taxon 32:557—560.
Haurter, C. H., M. D. Winpuam, D. M. Brirron and S. J: gpa 1985. sp aera and its
evolutionary snifcanc in Cystopteris protrusa. Canad. J. Bot. 63:1855—
Hersey, R. E. and D. M. Bri . 1981. A cytological study of three ee cad a sents taxon of
fel dn (section pines in Ontario, Canad. J. Gen. Cytology 23:497-504.
Korr, i,¢S: D. M. Britton. 1980. Chromosome numbers for Isoetes in northeastern North
PE Canad. J. Bot. 58:980—984
Kort, L. S. and D. M. Britron. 1982. A comiparetive study of spore octyl of some Isoetes
species of pethisadinen North America. Canad. J. Bot. 60:1679-16
Kort, L. S. and D. M. Brirron. 1982. A comparative study of sporophyte morphology of the three
cytotypes of Polypodium virginianum in Ontario. Canad. J. Bot. 60:1360—
Kort, L. S. and D. M. Brirron. 1982 . Comparison = chromatographic zm poet gr some North
American Isoetes species. Amer. Fern J. 72:15—18
Kort, L. S. and D. M. Brirron. 1983. Spore morphology and taxonomy of Isoetes in northeastern
North pres Canad. J. Bot. 61:3140-
Kort, L. S. and D. M. Brirron. 1985. Role ee neelasaeal characteristics of leaves and the
sporangia region in the taxonomy of Isoetes in northeastern North America. Amer. Fern J.
5:44—5

ne K. M. a D. M. Brirron. 1983. Spore studies in the genus Gymnocarpium. Canad. J. Bot.
61:377-388.
Pryer, K. M., D. M. Britton and J. McNEILL. 1983. A numerical analysis of chromatographic profiles
in North pais taxa se the fern genus Gymnocarpium. Canad. J. Bot. 61:2592—2602.
Pryer, K. M., D. M. Brirron and J. McNgmL. 1983. Systematic studies in the genus Gymnocarpium
Newm. (Apleniacene) i in North America. Amer. J. Bot. 70(5):60. (Abstract).

Pryer, K. M., D. M. Brirron and J. McNEILL. 1984. aera ug in the fern genus Gymnocarpium
Newman (Aspleniaceae) in North America. Amer. J. Bot. 71(5):142. (Abstract).

SaRVELA, J., D. M. Brrrron and K. M. Pryer. 1981. Studies on the Gymnocarpium robertianum

c
Wien, C.-J. and D. M. Britton. 1985. iseoacraine paged of Dryopteris ar eee and the

missing genome in D. cristata and D. carthusiana. Am t. J. Bot. 72(6):929. (Abstract).
Woén, C.-J. and D. M. Brirron. 1985. Phloroglucinol ram of Dryopteris se aes and the
missing genome in D. cristata and D. carthusiana. Ann. Bot. Fenn. 22:213—

Wien, C.-J., J. SaRveLa and D. M. Brirron. 1983. On the location and distribution of Phorogcinols
(filicin) in ferns. New results and review of the literature. Ann. Bot. Fenn. 20:407

1990s
BRITTON, i Nig — A hybrid Isoetes, I. x harveyi, in northeastern North America. Canad. J. Bot.
69:6

Britton, ie ages D. F. — 1991. The spores and affinities of Isoetes taiwanensis (Isoetaceae:

Periophy Fern Gaz. 14:73-81.
RITTON, nai is cab 1992. Isoetes x jeffreyi, hyb. nov., a new Isoetes (Isoetes

sre esas x spb riparia) from Quebec, Canada. C. ak J. Bot. 70:447-452.

Britton, D. M. 1993. a reticulata R. S. Hill 1987 (Acheringa 12: 158) is an illegitimate name.
Amer. Fern J. 83:128.

Britton, D. M. and D “ BRUNTON. 1993. Isoetes X truncata: teria considered pentaploid hybrid
from western North America. Canad. J. Bot. 71:1016-102

Britton, D. M. and D. F. Brunton. 1995. Isoetes X marensis, a new interspecific hybrid from
western Canada. Canad. J. Bot. 73:1345-1353.

Britton, D. M. and D. F. Brunton. 1996. Isoetes . Ue tape a new triploid hybrid from
western Canada te Alaska. Canad. J. Bot. 7

250 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

Britron, D. M. and D. F. Brunton. 1999. Rush quillwort (Isoetes junciformis, sp. nov.), a new
pesidophte from Bie hern Georgia. Amer. Fern J. 89:187-197.
Britton, D. M. and J. P. Go.rz. 1991. Isoetes prototypus, a new diploid species from eastern Canada.

Britton, D. M., D. F. Brunton and S. S. Ta.sor. 1997. Isoetes in Alaska, the Yukon, and the
J

Aleutians - a classical biosystematic study and its limitations. Amer. J. Bot. 84:5161.
mgeaoras
Britton, D ; oe and S. S. Ta.Bot. 1999. Jsoetes in Alaska and the Aleutians. Amer.

Britton, D. M., P. M. oe J. Norris and S. Varca. 1991. Engelmann’s aan Isoetes
engelmannii, an addition to the Flora of Canada. Canad. Field-Naturalist 105:67—70.
Brunton, D. F. and D. M. Britton. 1993. Isoetes prototypus (Isoetaceae) in the eee States.
Rhodora 95:122-128.
Brunton, D. F. and D. M. Brirron. 1996. Noteworthy collections: Alabama and Georgia. Castanea
61:398-—399.
BRUNTON, 7 F. and D. M. Britton. 1996. Taxonomy and distribution of Isoetes valida. Amer. Fern J.

86:16—25.

Brunton, D. F. and D. M. Brirron. 1996. The status, distribution, and identification of Georgia
quillwort (Jsoetes i enti Isoetaceae). Amer. Fern J. 86:105—113.

Brunton, D. F. and D. M N. 1997. A new Appalachian Isoetes species in the eastern United
States. Amer. ee Bot. oe igen payee

Brunton, D, F. and D. M. Brirron. 1997. Appalachian quillwort (Isoetes appalachiana, & nov.;
Isoetaceae), a new gestion ade ae the eastern United States. Rhodora 99:118—13

Brunton, D. F. and D. M. Brr . 1998. Isoetes microvela ae a new quillwort > the
coastal plain of the spatiale United States. Rhodora 100:261—275.

Brunton, D. F. and D. M. Brirron. 1999. Maritime quillwort, maritima (Isoetaceae), in the
Yukon Territory. Canad. Field-Naturalist 113:641—-645.

Brunton, D. F., D. M. Brirron and W. C. Taytor. 1994. Isoetes apes: ais nov. (Isoetaceae): A new
quillwort from the southeastern United States. Castanea

Brunton, D. F., D. M. Brirron and T. F. Wiesoipr. 1996. ennai janie and status of Isoetes
sida sootace sce ea 61:145-160.

Suarp, M. J. and D. M. Brr - 1991. Isoetes tuckermanii, ina quillwort, an addition to
the flora “of Ontario. Canad. F ield-Naturalist 105:283-2

TayLor, W. C., N. T. Lueske, MB RITTON, R. J. HICKEY ne D. F. Brunton. 1993. Isoetaceae
Ratchenbach——Grillwert Pomly. Pp. 64-75 in FNA Editorial Committee, eds. Flora of North
America North of Mexico, Volume 2. Oxford: Oxford University Press.

Wuirtr, D. P. and D. M. Britton. 1995. Gametophytes of Diphasiastrum < habereri. Amer. Fern J.
85:89-94

2000s

Britton, D. M. 2002. “In His cease A reminiscence within ‘Obituary: Warren H. Wagner, Jr.
(1920-2000). Amer. Fern J. 92:4

Brunton, D. F. and D. M. Britton. si Isoetes X echtuckerii, specs nov., a new triploid quillwort
from northeastern North America. Canad. J. Bot. 77:1662—166

Brunton, D. F. and D. M. Brirron. 2006. Isoetes melanopoda spp. pe (subsp. nov.), a new
quillwort (Isoetaceae) — eastern North America. Castanea 71:15—30.

Brunton, D. F. and D. M. Britron. 2006. Isoetes X novae-angliae (Isoetaceae), an additional hybrid
quillwort from New fant Rhodora 108:228-241.

Des Marais, D. L., A. R. Smrru, D. M. Brirron and K. M. Pryer. 2003. Phylogenetic relationships and
evolution of extant horsetails, aS based on chloroplast DNA sequence data (rbcL and
trnL-F). Int. J. Pl. Sci. 164:737—

PRYER: DONALD M. BRITTON (1923-2012) 251
AppeNpIx 2. Pteridophyte taxa authored or co-authored by D. M. Britton.
Family Taxon name Citation
Dryopteridaceae ne Acoiged x algonquinensis Canad. Field-Naturalist 89: 165.
itton 1975.
Isoetaceae ere ‘Gapalachiain D. F. Brunt. Rhodora 99: 129. 1997.
& ritton
Isoetaceae Isoetes X echtucker D. F. Brunt. Canad. J. Bot. 77: 1667. 2000.
& D. M. Britton
Isoetaceae Isoetes hillii = M. Britton Amer. Fern J. 83: 128. 1993.
Isoetaceae Isoetes X ae D. M. Britton & Canad. J. Bot. 70: 451. 1992.
F..B
Isoetaceae Isoetes jciorms D. F. Brunt. & Amer. Fern J. 89: 193. 1999.
D. M. B
Isoetaceae Isoetes X marensis D. M. Britton & ape J. Bot. 73: 1352-1353.
. F. Brunt.
Isoetaceae Isoetes melanopoda J. Gay & cane 7: 26. 2006.
Durieu subsp. silvatica D. F. Brunt. &
. Britton
Isoetaceae Isoetes X novae-angliae D. F. Brunt. & Rhodora 108: 238. 2006.
D. M. Britton
Isoetaceae Isoetes prototypus D. M. Britton Canad. J. Bot. 69: 278. 1991.
Isoetaceae Isoetes X pseudotruncata Canad. J. Bot. 74: 58. 1996.
D. M. Britton & D. F. Brunt.
ApPENDIx 3. Pteridophyte taxa redefined/recircumscribed by D. M. Britton and D. F. Brunton.
Family Taxon name Citation
Isoetaceae Isoetes X dodgei A. A. Eaton pro ia Canad. J. Bot. 67: 3001. 1989.
Isoetaceae Isoetes X harveyi A. A. Eaton pro anad. J. Bot. 69: 640. 1991.
Isoetaceae Isoetes X truncata (A. A. shes Clute pro sp. Canad. J. Bot. 71: 1024. 1993
Isoetaceae Isoetes hyemalis D. F. Bru stanea 59: 13.1
Isoetaceae Isoetes microvela D. F. She Rhodora 100: 270. 1998
Isoetaceae Isoetes valida (Engelm.) Clute mer. Fern J. 86; 23. 1996
Isoetaceae Isoetes virginica Pfeiffer Castanea 61: 154. 1996.
APPENDIX 4. Pteridophyte taxa named in honor of D. M. Britton.
Family Taxon name Citation
Cystopteridaceae Gymnocarpium X brittonianum Syst. Bot. 18: 168. 1993.
(Sarvela) K. M. Pryer & Haufler
Dryopteridaceae Dryopteris filix-mas (L.) Schott Advances Forest. Res. India 29.
subsp. brittonii Fraser-Jenk. & Widén 2006.
Isoetaceae onii mer. Fern J. 80: 85. 1990.

owls x cine
D. F. Brunt. & W. C. Taylor

American Fern Journal 102(4):252—255 (2012)

The Life of Barbara Joe Hoshizaki (1928-2012)

Rossin C. Moran
The New York Botanical Garden, Bronx, NY 10458-5126, USA, e-mail: rmoran@nybg.org

Barbara Joe Hoshizaki (Fig. 1), past president and life member of the
American Fern Society, died on 30 May 2012. She was one of the country’s
leading fern horticulturists. Besides the American Fern Society, Barbara served
as president of the Southern California Horticultural Institute and the Los
Angeles International Fern Society. She had also served as vice-president of
the Pacific Horticultural Foundation. Furthermore, she was an honorary
member of the Los Angeles International Fern Society and the Tropical Fern
and Exotic Plant Society, Inc. Throughout her career she collaborated with
researchers in academia and with commercial and amateur horticulturalists.
Traveling widely, she studied ferns in their native habitats in North and South
America, the Pacific Islands, Southeast Asia, Australia, New Zealand, and
Africa. She introduced many fern species into cultivation and wrote scientific
and popular papers on ferns. An avid taxonomist, she corrected the scientific
names of many ferns that had been misidentified in the horticultural trade.

Born June 14, 1928, Barbara attended public schools in Los Angeles. In 1951
she received a BS from the University of California, Los Angeles. There she
met Mildred Mathias, a professor of botany, who became Barbara’s mentor and
encouraged her to study ferns. In 1954 Barbara received an MS from UCLA and
soon afterwards became a professor of biology at Los Angeles City College
where she taught for 28 years. She was also Curator of Ferns at the UCLA
Herbarium.

In 1967 Barbara spent eight weeks in Costa Rica on a fern course sponsored
by the Organization for Tropical Studies (OTS). The course, taught by Warren
H. Wagner, Jr., and John T. Mickel, introduced her to the diversity of tropical
ferns and lycophytes, an experience she never forgot. She requested that, after
her death, donations in her name be sent to OTS.

Barbara was best known for her book Fern Growers Manual (Knopf, 1975).
This work, which treated about 390 species, served as a standard reference for
ferns cultivated in the United States and Canada. A revised edition, which
included about 700 species, was later published with Robbin C. Moran as co-
author (Timber Press, 2001). It described and illustrated nearly all of the ferns
and lycophytes commonly found in the horticultural trade in North America.

A personal reminiscence: While revising the Fern Grower’s Manual, I spent
three days with Barbara and her husband, Takashi, a plant physiologist, at
their home in Los Angeles. Their greenhouse and yard encompassed a superb
collection of living ferns, which at its peak harbored about 1000 species. The
purpose of my visit was to compare our descriptions of fern species in the
revised manuscript with the living ferns in her garden. At the end of the three
days, we had not completed the task. The collection was so extensive that we

MORAN: BARBARA JOE HOSHIZAKI (1928-2012) 253

Fic. 1. Barbara Joe Hoshizaki at her home in Los Angeles, California (1999). (Photo by Robbin
C. Moran.)

were able to examine only about four-fifths of the outdoor ferns—and we never
made it to the greenhouse! During the visit, it was apparent that Barbara’s first-
hand knowledge of ferns in her garden was remarkable. She often pointed out
subtle distinctions between related species such as differences in shades of
green of the leaves, how the leaves oriented themselves above ground, and
seasonal timing in the production of leaves. I remember her telling me—much
to my amazement as a “‘northerner’’—that her biggest problem growing ferns
was not cold weather but the fiercely hot and dry Santa Ana winds that
barreled down from the San Bernardino mountains in the fall, sucking the
moisture out of the soil and plants. Besides serving for research, Barbara’s
garden was the source of plants that she generously sent to whoever requested
a particular species.

bara will be greatly missed. A warm, gentle, easy-going person, she
readily helped others with all aspects of fern horticulture. She did much to
popularize ferns, especially as a sought-after public speaker for horticultural
societies and garden clubs. The fern world has lost a dear friend.

BIBLIOGRAPHY OF BARBARA JOE Hosuizaki (1928-201 2)

Hosuizaki, B. J. 1962. Summer fern foray in Oregon. Amer. Fern J. 52:166—167.

254 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

Hosuizakl, B. J. 1968. Ferns and fertilizer. Amer. Fern J. 58:49-53

Hosuizax!, B. J. 1970. The genus Adiantum in cultivation (Polypodiaceae). Baileya 17:97-19, 145—
191.

Hosuizakt, B. J. 1970. Rhizome scales of Platycerium. Amer. Fern J. 60:144—160.

Hosuizakl, 16 ee Morphology and phylogeny of agi haiees species. Biotropica 4:93—-117.

Ho 973.

OSHIZAKI, ee fern cultivar. Amer. Fer
Hosnizakl, : 7 oe Fern growing in ri ele Sie ren Hort. J. 34:47—54.
Hosuizaki, B. J. 1973. Ferns for subtropical gardens. Fairchild Trop. Gard. Bull. 28:4—9.

Hosuizaki, B. J. 1975. As pean fern pias hybrid. Amer. Fern J. 65:99—101.

Hosuizakl, B. J. 1975. On growing staghorn ferns. Fiddlehead Forum 2:2

Hosuizakl, 5 J. 1975. Fern propagation for the home grower. Calif. Hort, J. 36:158-162.

Hosuizakt, B. J. 1975. Larry L. Kiefer (1935-1975). Amer. Fern J. 65:120—121.

Hosuizak, B. J. el Fern owe’ s Manual. Knopf, Inc, New York.

Hosuizakt, B. J. 1976. Maidenhair ferns of California. Fremontia 4:17—20.

Hosuizakt, B. J. a Staghorn ferns today and tomorrow. Garden’s Bulletin, Singapore 30:13—-15.

Hosnizaki, B. J. 1979. Getting started on ferns. Pacific Hort. Winter, pp. 44—46.

Hosuizakl, B. J. 1980. Maidenhair ferns outdoors. Pacific Hort. Winter, pp. 43-44.

Hosuizaki, B. J. 1981. The fern genus Davallia in cultivation (Davalliaceae). Baileya 21:1-42

ee B. J. 1981. Davallia relatives in cultivation: Araiostegia, Davallodes, Humata, and

iene (Davalliaceae). Baileya 21:43—-50.

Fhe B. J. 1981. The genus Pyrrosia in cultivation (Polypodiaceae). Baileya 21:53-76.

Hosuizakt, B. J. : ny Review of ‘‘Trees and shrubs for dry California landscapes — plants for water
nservation,’’ by Bob Perry. Crossomsoma 7:5—6.

ie B. J. 1981. The genus Polypodium in cultivation (Polypodiaceae). Baileya 22:1-52.

Hosnizakt, B. J. 1982, The se Polypodium in cultivation (Polypodiaceae). crea blame

Hosnizakl, B. J. 1982. New Humatas in cultivation fasta temgacs Baileya 22:99-10
ssgs B. J. 1984. Tree ferns. Pacific Hort. Spring, pp. 2
Hosnizaxi, B. J. 1985. Review of “Ferns to know and eed te i John T. Mickel. Quart. Rev.Biol.

Hosuizakl, sy a 1987. Review of ‘Encylopedia of ferns,’’ by David L. Jones. Amer. Fern J.
zee

Hosuizakl, ee ae Ferns of the future. Greenhouse Grower. May, pp. 3

Hosuizakt, B. J. 1989. sighribe of ‘‘Pteridophyte flora of Oaxaca, Mexico,” ie en Mickel. Pacific
Hort. Winter, pp. 1

Hosnizaki, B. J. 1990. ini eek: Pp. 162-166, In: G. Waters and N. Harlow, eds. The Pacific
horticulture book of western gardening. David Godine, Inc

Hosnizakt, B. J. 1990. Aiergin to ferns? Fiddlehead Forum 17:31.

Hosnizakt, B. J. 1991. An “intergen neric’”’ hybrid: Aglaomorpha X Drynaria. spe eorr 81:37-43.

Hosuizakt, B. J. 1991. A Goniophlebium (Polypodium) hybrid. Amer. Fern J. 8

Hosuizaki, - J. 1991. covpiclorias | in cultivation. South Florida Fern Society, ang Ack Bulletin,

7-1

HosHizakl, ss J. 1992. A Pteris hybrid. L. A. L. F. S. [Los _— Pau, Fern Society] 19:47.

Hosuizaki, B. J. 1992. pi arepe in cultivation. L. A. S. [Journal of the Los Angeles
International Fern Society] 19:48—5

Hosuizakt, B. J. 1992. Nephrolepis semua ae its identify. L. A. I. F. S. [Journal of the Los

Angeles international Fern Society] 19:64—-6

Hosuizakl, B. J. 1 The eee for new fom raciosias Pp. 97-103, In: Jennifer M. Ide, A.
Clive Je esagel as Alison M. Paul (eds.). Fern Horticulture: Past, Present, and Future
Perspec ganee Intercept, pte etal United Kingdom

Hosuizaki, B. J. 1993. Review = — - distribution maps of pteridophytes in Asia,”’ ed. 2, by T.
Nakaike. rate Fern J. 9.

Hosuizaki, B. J. 2009. Review “state flora of ferns and soi eee of South Pacific Islands,”’
dited by T. Nakamura and S. Matsumoto. Amer. Fern J. 9

Hosuizaki and M. G, Price. 1990. Pisce update. Amer. oo 80:53-69.

MORAN: BARBARA JOE HOSHIZAKI (1928-2012) 255

Hosnizakt and K. Witson. 1999. Dryopteris in cultivation in the United States. Amer. Fern J.
89:1—100.

Jor, B. 1958. Pteris species cultivated in California. Lasca Leaves . hate

Hosnizaki, B. J. The fern ball in cultivation. Amer. Fern J. 48:72—

Hosuizaki, B. J. 1959. Ferns cultivated in California: Phyllitis, peaie, Pyrrosia, Llavea. Lasca
Leaves 9: 1- 14.

Hosnizaxi, B. J. 1959. Ferns cultivated in California: Woodwardia, Aglaomorpha, Pityrogramma.
Lasca Leaves 9:6

Hosuizakt, B. J 1959. Fors cultivated in California: Cyrtomium, Onychium, Stenochlaena. Lasca
Leaves —67

59. Ferns cultivated in California: Hypolepis. Lasca Leaves 9:74-75.

Hosnizakl, B. J. 1963. Species of Thelypteris cultivated in California. Baileya 11:99—-110.
Hosnizakt, B. J. 1963. Species of Dryopteris cultivated in California. Baileya 11:117-130.
Hosuizakt, B. J. 1964. Notes and news:a new locality for Asplenium vespertinum. Madrofio 17:172.

a
je}
n
E
>
a
oo
—
joan
©
o>)
ras
2
|
oe
nn
Q
<j
-e
Pha
as
oO
on
~
=}
ot.
=
©
yy
-#
|
Q
ise)
i)
i
3
i=}
Rp
i)
ry
N
|
=

Hosuizakt, B. J. 1964. A review of the species of Platycerium (Polypodiaceae). Baileys 12:137-146.
Hosuizaki, B. J. 1964. Cultivated tree ferns of the genus Cibotium (Dicksoniaceae). Baileya

ios B. J. 1965. Cup ferns (Dennstaedtia) cultivated in California. Amer. Fern J. ee:
FER, L. L. ea B. Jor. 1967. Check sit > California pteridophytes. Madrofio 3:65—7
Matuias, M. E., F. H. Lewis and B. Hosnizaki. 1977. Key to the vascular plant a - southern
California. University of California, Los Angeles,

American Fern Journal 102(4):256—272 (2012)

Low Within Population Genetic Variation and High
Among Population Differentiation in Cyrtomium
falcatum (L.f.) C. Presl (Dryopteridaceae) in Southern
Korea: Inference of Pop t History

Mr Yoon CHuNG
Department of Biology, Gyeongsang National University, Jinju 660-701, Republic of Korea
Jorp1 Lopez-Pujou
BioC-GReB, Laboratori de Botanica, Facultat de Farmacia, Universitat de Barcelona,
Barcelona 08028, Spain

JAE Min CHUNG

Department of Plant Resources Conservation, Korea National Arboretum, Pocheon 487-821,
Republic of Korea

Ki-JOoNG Kim
School of Life Sciences, Korea University, Seoul 136-701, Republic of Korea
Myonc Gi Cxunc'*

Department of Biology and the Research Institute of Natural Science,
Gyeongsang National University, Jinju 660-701, Republic of Korea

AB .—In the Korean Peninsula, the current distribution of the warm-temperate and
subtropical ee (including many homosporous ferns) is limited to southern coastal areas.
Paleoecological data suggest that during the Last Glacial Maximum this vegetation retreated to
glacial refugia putatively located in southern Japan and/or southern China, followed by a post-
glacial recolonization. Two broad scenarios of post-glacial recolonization could be hypothesized:

extant Korean populations are derived from multiple source populations (i.e., from multiple
refugia); alternatively, they originate from a single refugium. To test which of these scenarios is
more likely, we surveyed patterns of genetic diversity in eight (n = 307) populations of Cyrtomium
falcatum from southern Korea. We found extremely low levels of allozyme variation within
populations coupled with high among-population diNenesitioticn: These data best support the

glacial — dispersal events and subsequent founder effects. In addition, restricted gene
flow among the discontinuous populations of C. falcatum in southern Korea has likely contributed
to the high degree of among-population lager poigersgtiries From a conservation perspective,
several populations should be targeted for both in situ and ex situ conservation, as C. falcatum
exhibits a high degree of divergence pole seeresae

Key Worps.—Dryopteridaceae, Cyrtomium, allozymes, conservation, founder effect, glacial refugia,
homosporous fern, gametophytic selfing, population history, population structure

Genetic diversity patterns of plant species are shaped by interacting
historical, biological, ecological, and demographic factors (Nevo et al., 1984;

‘Author for correspondence. Tel: +82 055 772 1343, Fax: +82 055 772 1349, email:
mgchung@nongae.gsnu.ac

CHUNG ET AL.: GENETIC VARIATION IN CYRTOMIUM FALCATUM 257

Hamrick and Godt, 1989; Gray, 1996; Duminil et al., 2007). From a historical
viewpoint, the Quaternary glacial-interglacial oscillations played an increas-
ingly recognized role in shaping the current distribution of plant species and
thus, their contemporary levels and partitioning of genetic diversity within
and among populations (Hewitt, 1999, 2000; Hu et al., 2009). For example,
populations/species that occurred in formerly glaciated regions usually show
lower levels of genetic diversity than those from unglaciated areas (e.g., glacial
refugia) through founder effects and bottlenecks as a result of multiple
stepwise colonization events (Hewitt, 1996; Widmer and Lexer, 2001; Jiménez
et al., 2010). Thus, the patterns of genetic diversity maintained by the species
(especially the spatial distribution of genotypes) are often used to infer the
location of refuges and the post-glacial migration routes from these, and this
has been particularly fruitful in Europe and North America (Soltis et al., 2006;
Weiss and Ferrand, 2007, Hu et al., 2009; Hewitt, 2011).

Ferns have some life-history traits that are strikingly different from seed
plants and that have potentially significant effects on patterns of population
genetic variation. First, fern dispersal occurs via haploid spores. Second, their
gametophytic generation is independent from the maternal sporophytes.
Third, owing to their small size, fern spores tend to be dispersed much farther
by wind compared to most seeds (Tryon, 1970, 1972), although this feature is
analogous to the tiny, dust-like seeds of orchids (Arditti and Ghani, 2000). As
in many seed plants, however, the majority of propagules fall around the
immediate vicinity of the parent (Peck et al., 1990). Fourth, since spermato-
zoids require transport in water, male gamete dispersal distance of ferns tends
to be very limited (within a few centimeters; Peck et al., 1990). Finally, in
many homosporous ferns, in the absence of genetic load a single spore could
produce a sporophyte via intragametophytic selfing (self-fertilization of a
haploid gametophyte), enabling the successful colonization of new sites
(Lloyd, 1974; Flinn, 2006; Edgington, 2007; Wubs et al., 2010). Intragameto-
phytic selfing results, in a single generation, in completely homozygous
sporophytes (Klekowski, 1972; Vogel et al., 1999a), a situation without
analogue in seed plants. Thus, it has been suggested that genetically
polymorphic populations could be attributed to the occurrence of multiple
independent spore dispersal and establishment events over time, whereas
genetically monomorphic homosporous fern populations are more likely to
have arisen from single colonists (i.e., single spores; Pryor et al., 2001).

Habitat specificity and recurrent gene flow of homosporous ferns should be
regarded as factors determining the degree of population differentiation. Soltis
et al. (1989) hypothesized that xeric or rock dwelling ferns would exhibit
higher among-population differentiation than would ferns occurring in mesic
habitats, due to limited gene flow among isolated rocky habitats. Since then,
several population-genetics studies have supported this hypothesis (Pryor
et al., 2001 and references therein).

In Korea, many ferns are characteristic of the warm-temperate and
subtropical vegetation, such as Cyrtomium falcatum (L.f.) C. Pres] (Dryopter-
idaceae), a rock dwelling homosporous fern native to southern and eastern

258 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

Asia, which is taken here as a case study. This vegetation belt currently occurs
in a narrow zone along the southeastern and southern coast (Yi, 2011). The few
available pollen and spore records suggest, however, that this warm-temperate
A coieeiin was likely absent from the Korean Peninsula during the Last Glacial

m (LGM, ca. 21,000 yr ago; e.g., Choi, 1998; Chung et al., 2006; Chung,
ae ee et al., 2010; Yi and Kim, 2010), a scenario consistent with
regional vegetation reconstructions (e.g., Adams and Faure, 1997; Harrison
et al., 2001; Hope et al., 2004; Prentice et al., 2011). On the southern coast of
Korea, the onset of the Holocene (ca. 11,000 years BP) and the accompanying
climatic amelioration were marked by a sudden increase in abundance of ferns
in the family Polypodiaceae, and an abrupt decline in herbaceous taxa,
together with the expansion of cool temperate deciduous broad-leaved forests
(Chung et al., 2010). The first appearance after the LGM of broad-leaved
evergreen vegetation in the Korean Peninsula was approximately 8,500 years
ago (Chung, 2011) and somewhat earlier in Jeju Island (ca. 12,000—10,000 yr
BP; Chung, 2007), which also coincided with a rise of fern spores, indicating
warmer and more humid conditions (Chung et al., 2010). These paleovegeta-
tion studies suggest that post-glacial colonization either from southern Japan
(e.g., Kyushu; Fig. 1) or southern China, which harbored glacial refugia for
warm-temperate vegetation (e.g., Hope et al., 2004; Gotanda and Yasuda, 2008;
L6épez-Pujol et al., 2011; Qiu et al., 2011), would be much more plausible than
persistence of warm-temperate and subtropical vegetation in Korean refugia
during the Pleistocene glaciations.

Cyrtomium falcatum is an evergreen homosporous fern that usually grows
on coastal rocky slopes in the warmer parts of south to northeastern Asia
(India, Vietnam, eastern and southern China, Taiwan, southern Korea, and
Japan; Iwatsuki, 1992). However, it has become naturalized in many parts of
the world (including Hawaii, North America, Australia, western and southern
Europe, Réunion Island, and South Africa) because it escaped from gardens
(Roux, 2011). The species, 10-60 cm tall, has a short, erect rhizome, and thus,
it is highly likely that proximally located individuals within populations are
distinct genets. In southern Korea, C. falcatum usually grows on crevices in
steep cliffs, rocks, and man-made vertically oriented stone walls near
seashores, and thus, populations occur discontinuously. Chromosome num-
bers of n = 41 (diploid) or n = 82 (tetraploid) have been reported for C.
falcatum in Japan (Iwatsuki, 1992).

Based on the life-history and ecological traits of homosporous ferns, together
with the information available on the paleoecology of the Korean Peninsula,
we hypothesize two broad scenarios for the origin of current populations of
warm-temperate homosporous fern species in southern Korea. If contemporary
populations were derived from multiple source populations (i.e., from
multiple glacial refugia), presumably from southern Japan and/or southern
China, we would expect high levels of within-population genetic variation as
consequence of the admixture of genetically divergent lineages arriving from
different refugia (i.e., the ‘melting pot’ effect that has been described for many
European trees and shrubs; Petit et al., 2003). Regarding among-population

CHUNG ET AL.: GENETIC VARIATION IN CYRTOMIUM FALCATUM 259

1.5 km) in Oenaro Island; CF-4 in Naenaro Island; CF-5 in Hong Island; CF-6 in Heuksan Island;
and CF-8 in Haenam-gun (mainland Korea).

genetic differentiation, either low or high values would be exhibited
depending on ecological factors (Hamrick and Nason, 1996). Large populations
that are continuously distributed should exhibit low inter-population
variation probably due to high recurrent gene flow between adjacent
populations. In contrast, high genetic divergence would be expected among
small disjunct populations because of low rates of gene flow between isolated

260 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

TaBLE 1. Summary of genetic diversity measures and mean fixation values (Fjs) observed in eight
populations of Cyrtomium falcatum.

Population n %P A AR H, (SE) H, (SE) Fis
CF-1 36 14.3 1.14 1.14 0.044 (0.053) 0.043 (0.042 —-):071
CF-2 36 14.3 1.14 1:12 0.039 (0.042) 0.046 (0.049 0.154
CF-3 51 9.5 1.10 1.08 0.024 (0.036) 0.019 (0.028 —0.270°
CF-4 42 14.3 1.14 1.14 0.028 (0.026) 0.027 (0.025 =O.057
CF-5 23 28.6 1.29 126 0.050 (0.041) 0.071 (0.050 0.299*
CF-6 18 4.8 1.05 1.05 0.019 (0.030) 0.018 (0.030 —0.008
CF-7 76 9.5 140 1:10 0.044 (0.057) 0.044 (0.049 0.001
CF-8 25 0.0 1.00 1.00 0.000 (0.000) 0.000 (0.000) na
Average 38 11.9 4.12 1.1] 0.031 (0.006) 0.034 (0.008) 0.030°
Pooled samples 307 38.1 1.38 0.033 (0.018) 0.069 (0.034)
Homosporous ferns® a6.1. 1.63 0.132

Abbreviations: n, sample size; %P, percentage of polymorphic loci; A, mean number of alleles ae
locus; AR, mean allelic richness based on a minimum sample size of 18 individuals; ae seers
heterozygosity H,, Hardy-Weinberg (H-W) expected heterozygosity o di ty; fabiecd
error; Fis, fixation index within populations; na, not available aes of Aca chia across
all pies loci examined in this population).

* Denotes significance (P < 0.05) based on permutation (999 replicates) under the null hypothesis
of Fis mS,

* Non-significant Weir and Cockerham (1984) estimate of Fis over populations.

“ Allozyme-based genetic data from Tables 7 and 8 in Li and Haufler (1999).

populations. Alternatively, if extant populations were established from
colonizers coming from a single source (i.e., a single refugium), then within-
population genetic variation would be low because of long-distance dispersal
associated bottlenecks (e.g., Hewitt, 1996, 2000). Genetic differentiation among
populations would be high or low depending on rates of contemporary gene

ow among the Korean populations. To date, these colonization hypotheses
have not been empirically tested for the warm-temperate and subtropical
homosporous ferns native to the Korean Peninsula. In this study, we surveyed
the levels and distribution of allozyme-based genetic diversity in C. falcatum
to test which of the post-glacial colonization hypotheses is most likely.
Achieving a better understanding of the genetic structure of this currently rare
fern in the Korean Peninsula, in addition, will provide guidelines for its
recovery and management.

MATERIALS AND METHODS

Sample collection—We collected one leaf segment (pinna) from each
individual to minimize damage to the plants. A total of 307 individuals were
sampled from eight populations of C. falcatum from southern Korea, including
several islands (Fig. 1 and Table 1). All sampled leaf tissue was kept on ice
until its transportation to the laboratory, where it was stored at 4°C until
enzyme extraction.

CHUNG ET AL.: GENETIC VARIATION IN CYRTOMIUM FALCATUM 261

Allozyme electrophoresis.—We extracted enzymes by finely cutting leaf
samples, adding an extraction buffer (Mitton et al., 1979), and then crushing
them with a mortar and pestle. Enzyme extracts were absorbed onto
chromatography wicks and stored in microtiter plates in an ultra-cold
(—70°C) freezer until analyzed. We conducted electrophoresis on 13% starch
gels, with three buffer systems. We used a modification (Haufler, 1985) of
system 6 of Soltis et al. (1983) to resolve alcohol dehydrogenase (Adh),
diaphorase (Dia-1, Dia-2), fluorescent esterase (Fe-1, Fe-2), and cathodal
peroxidase (Cpx). We used system 11 of Soltis et al. (1983) to resolve
glyceraldehyde-3-phosphate dehydrogenase (G-3-pdh-1, G-3-pdh-2), hexoki-
nase (Hk-1, Hk-2), isocitrate dehydrogenase (Jdh), phosphoglucoisomerase
(Pgi-1, Pgi-2), phosphoglucomutase (Pgm-1, Pgm-2, Pgm-3), and shikimate
dehydrogenase (Skdh). In addition, we used the morpholine-citrate buffer
system (pH 6.1) of Clayton and Tretiak (1972) to resolve fructose-1,6-
diphosphatase (F1,6) and malate dehydrogenase (Mdh-1, Mdh-2, Mdh-3). We
followed stain recipes from Soltis et al. (1983) except for diaphorase (Cheliak
and Pitel, 1984). We designated putative loci sequentially, with the most
anodally migrating isozyme designated as 1, the next 2, and so on. We also
designated different alleles within each locus sequentially by a, the next b, and
so on. The observed enzyme banding patterns were consistent with their
typical subunit structure and subcellular compartmentalization in diploid
plants (Weeden and Wendel, 1989).

Data analysis.—We considered a locus to be polymorphic when two or more
alleles were observed, regardless of their frequencies. We estimated the genetic
diversity parameters within populations using the programs POPGENE (Yeh
et al., 1999) and FSTAT (Goudet, 1995): percent polymorphic loci (%P), mean
number of alleles per locus (A), allelic richness (AR) corrected by minimum
sample size (n = 18 at CF-6, the population with the smallest sample size),
observed heterozygosity (H,), and Hardy-Weinberg (H-W) expected heterozy-
gosity or Nei’s (1978) gene diversity (H,). Except for AR and H,, these
parameters were also estimated for the total samples as a whole (i.e., at the
species level). To test for recent decreases in effective population size
(bottlenecks), we evaluated differences across loci between the H-W H, and
the equilibrium heterozygosity (H.,) expected assuming mutation-drift
equilibrium. H-W H, is not very sensitive to the fate of low frequency alleles,
whereas H,, is relatively sensitive to population bottlenecks, and declines as a
result of the loss of such alleles. These differences (H. — Hi, calculated for a
number of independent loci) were evaluated using a sign test and a Wilcoxon
sign-rank test under an infinite allele model using the program BOTTLENECK
(Piry et al., 1999). Since allelic diversity is generally lost more rapidly than H,
(Nei et al., 1975), recently bottlenecked populations will exhibit an excess of
H-W H, relative to H,, (Cornuet and Luikart, 1996; Luikart et al., 1998).

We used the program SPAGeDi (Hardy and Vekemans, 2002) to calculate
population-level Fis (inbreeding) and its significance level by 999 permuta-
tions under the null hypothesis of Fis = 0. To measure deviations from H-W
equilibrium at each polymorphic locus, we calculated averages of Wright’s

262 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

TABLE 2. Results of statistical tests for evidence of recent population bottlenecks in Cyrtomium
falcatum. Numbers reported are P-values of sign and Wilcoxon sign-rank tests conducted using the
program BOTTLENECK.

Population Sign test Wilcoxon sign-rank test

CF-1 0.406 0.188
CF-2 0.442 0.188
CF-3 0.659 0.875
CF-4 0.605 0.938
CF-5 0.445 0.578
CF-6 0.519 0.250
CF-7 0.162 0.125
CF-8 na na

(1965) Fis and Fsr (deviations from H-W equilibrium of individuals relative to
their local populations and local populations relative to the total population,
respectively) following Weir and Cockerham (1984). Using FSTAT, we
constructed 95% bootstrap confidence intervals (CI; 999 replicates) around
means of Fis and Fs, and considered the observed Fis and Fz to be significant
when the 95% CI did not overlap zero.

To test the overall pattern of genetic structure at the regional scale (i.e.,
isolation-by-distance effects), we conducted a Mantel test (Mantel, 1967) with
999 replicates, between all pairwise Fs7/(1 — Fsr) (Fsr was calculated
following Weir and Cockerham, 1984) and the corresponding logarithm
pairwise geographical distance (Rousset, 1997) under the null hypothesis of
no spatial genetic structure (regression slope, B = 0). Finally, to determine the
degree of genetic divergence among populations of C. falcatum, we calculated
Nei’s (1978) unbiased genetic identity (J) and distance (D) between pairs of
populations. Using Nei’s D values, we clustered populations into a phenogram
following unweighted pair-group method using arithmetic averages (UPGMA).

RESULTS

Allozyme variation within populations.—Of the 21 putative loci resolved for
C. falcatum, eight were polymorphic (Dia-1, F1,6, Fe-1, Fe-2, Hk-2, Idh, Pgm-2,
and Pgm-3). Allozyme variation within populations was extremely low across
the eight studied populations: mean percentage of polymorphic loci within
populations (%P) was 11.9, mean number of alleles per locus (A) was 1.12, and
mean genetic diversity (H,) was 0.034 (Table 1). Population CF-5 harbored the
highest allelic richness and genetic diversity (AR = 1.28 and H, = 0.071;
Table 1), whereas no allozyme variation was found in CF-8 (Table 1). Slightly
higher levels of genetic diversity were estimated from pooled samples over all
populations (n = 307): %P = 38.1; A = 1.38; and H, = 0.069 (Table 1).
Although we did not conduct any bottleneck test on CF-8 because it had no
allozyme polymorphism, we found no significant indications of recent
bottlenecks in any of the remaining seven populations (Table 2).

CHUNG ET AL.: GENETIC VARIATION IN CYRTOMIUM FALCATUM 263

TasLe 3. Allele frequencies for the three loci with the highest degree of population differentiation
(F1,6, Pgm-2, and Pgm-3).

Allele frequency

Fi,6 Pgm-2 Pgm-3
Population a b a b a b
CF-1 0.000 1.000 0.194 0.806 0.931 0.069
CF-2 0.000 1.000 0.514 0.486 0.292 0.708
CF-3 0.000 1.000 0.980 0.020 0.765 0.235
CF-4 0.000 1.000 0.083 0.917 0.083 0.917
CF-5 0.565 0.435 0.109 0.891 0.000 1.000
CF-6 0.750 0.250 1.000 0.000 0.000 1.000
CF-7 0.000 1.000 0.704 0.296 0.480 0.520
CF-8 1.000 0.000 0.000 1.000 0.000 1.000

Population genetic structure.—Except for CF-3 and CF-5, population-level
Fis estimates were not significantly different from zero at the 0.05 level
(Table 1). These results, as well as the non-significant multi-population-level
Fis (Fis = 0.030; Table 1 and 95% CI = —0.254 to 0.401), indicated that
populations were generally at H-W equilibrium. Deviations from H-W
expectations due to allele frequency differences between populations were,
in contrast, significantly high (Fs; = 0.543, 95% CI = 0.218 to 0.703). This
level of among-population differentiation was largely due to skewed allele
frequencies at the three loci F1,6, Pgm-2, and Pgm-3 (Table 3).

Pairwise Nei’s (1978) J values between populations were high, ranging from
0.878 (CF-3 vs. CF-8) to 0.997 (CF-2 vs. CF-7) and with a mean of 0.951 + 0.011
(SD), which is comparable with the average values reported for other conspecific
populations of homosporous pteridophytes (average J = 0.911 + 0.086, N = 16:
Soltis and Soltis, 1989) and of plants overall (average I = 0.950 + 0.059, N =
1,572; van der Bank et al., 2001). The apparent discordance between the high
values of Fsy and the high values of I in C. falcatum is simply due to the fact that
only polymorphic loci are used for the calculation of Fs, whereas both
monomorphic and polymorphic loci are employed for estimating pairwise Nei’s
I. The UPGMA phenogram showed that the eight populations were clustered
largely in accordance with their geographical locations: CF-1/CF-2 and CF-5/CF-
6/CF-8 (which are located in the eastern and western extremes of southern part of
Korea, respectively) were clustered separately (Fig. 2). However, we found no
significant correlation between pairwise genetic differentiation estimates and
their corresponding between-population logarithm pairwise geographical dis-
tance (B = 0.069, R* = 0.016, P = 0.277; Fig. 3), indicating that most variation (ca.
98%) in genetic differentiation was due to factors other than geographic distance.

DIscussION

Genetic diversity and structure—Levels of within-population genetic
diversity are extremely low in C. falcatum (mean population-level estimates:

264 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

CF-1

CF-2

CF-7

r

0.065 0.049 0.033 0.016 0.000
Genetic distance

Fic. 2. UPGMA phenogram based on Nei’s genetic distances between populations of
Cyrtomium falcatum.

%P = 11.9, A = 1.12, H, = 0.034). Although slightly higher values for these
genetic diversity measures were obtained from pooled samples over all
populations (%P = 38.1, A = 1.38, H, = 0.069), A and H, are still lower than
expected for homosporous ferns (mean species-level estimates; %P = 36.1, A
= 1.63, H, = 0.132; Li and Haufler, 1999). The low levels of genetic variation in
the southern Korean populations may be a consequence of post-glacial long-
distance dispersal events and subsequent founder effects (see below for a
detailed discussion).

Populations of C. falcatum were generally at H-W equilibrium (multi-
population level Fis = 0.030), a relatively unexpected finding since many
homosporous ferns have potential for intragametophytic selfing (Klekowski
and Baker, 1966), which could cause a substantial deviation from H-W
equilibrium (i.e., a deficit of heterozygotes) within populations. Consistent
with this expectation, a considerable excess of homozygotes has been found
within populations of species of Botrychium and Mankyua (Ophioglossaceae),
which have subterranean gametophytes that obligately self-fertilize via
intragametophytic selfing (McCauley et al., 1985; Soltis and Soltis, 1986;
Watano and Sahashi, 1992; Hauk and Haufler, 1999; M. Y. Chung et al., 2010).
However, many diploid homosporous ferns exhibit high outbreeding rates (as
inferred from inbreeding coefficients; Soltis and Soltis, 1989, 1992; Ranker and
Geiger, 2008), and some studies have suggested that they possess mechanisms
that promote outcrossing in natural populations (Klekowski, 1973; Haufler and
Gastony, 1978; Haufler and Ranker, 1985; Wubs et al., 2010). Some of these
mechanisms promote the formation of functionally unisexual gametophytes

CHUNG ET AL.: GENETIC VARIATION IN CYRTOMIUM FALCATUM 265

e
y =0.231x + 0.894
R2=0.016

Pairwise F5,/(1-Fe;)
or NRW kw Ds ww

i)
-
N
w
be
wn
an

Pairwise distance (Ln km)
Fic. 3. Differentiation between populations of Cyrtomium falcatum. Multilocus estimates of
pairwise differentiation of Fs;/(1 — Fsy) are plotted against pairwise logarithm (Ln) geographical
distances in kilometers according to Rousset (1997). There was a non-significant positive
relationship between pairwise Fs7/(1 — Fs) and pairwise Ln geographical distance (r = 0.126,
P = 0.277).

through the asynchronous maturation of male and female gametes and the
control of antheridia initiation by the pheromone antheridiogen produced by
maturing female gametophytes (Dépp, 1950; Lloyd, 1974; Haufler and Welling,
1994; Pajaron et al., 1999). This seems to apply for populations of C. falcatum,
although we do not know which of the above-mentioned mechanisms is
promoting outcrossing in the Korean populations of this fern.

Outcrossing plant species usually maintain most of their genetic variation
within rather than among populations, whereas selfing species show the
reverse trend (Brown,.1979; Hamrick et al., 1979). Thus, because populations
of C. falcatum exhibit high inter-population divergence (Fsy = 0.543), factors
other than mating system are probably important in shaping genetic structure
among populations of C. falcatum. A high degree of genetic differentiation
among populations has been observed in other homosporous ferns, including
Adiantum capillus-veneris (Pryor et al., 2001), Asplenium csikii (Vogel et al.,
1999b), Asplenium ruta-muraria (Schneller and Holderegger, 1996), Asple-
nium septentrionale (Holderegger and Schneller, 1994), Asplenium tricho-
manes subsp. quadrivalens (Suter et al., 2000), Cheilanthes gracillima (Soltis
et al., 1989), and Sadleria cyatheoides and S. pallida (Ranker et al., 1996). For
all these cases, patchiness of suitable habitat (which caused restricted gene
flow) has been proposed as a major driver of population divergence. This
habitat trait may also account for the high among-population differentiation
found in C. falcatum in southern Korea, which is primarily due to allele
frequency differences at three loci (Table 3). For example, six of eight
populations were monomorphic at F1,6; of these, the CF-8 population was
fixed for the allele a, whereas the other five populations were fixed for the
allele b. At Pgm-2, CF-6 was fixed for the allele a, whereas CF-8 was fixed for
the alternative allele b. Apart from the low levels of gene flow, genetic drift
would have been enhanced by small population sizes. Although current
populations are of moderate size (M. Y. Chung and M. G. Chung, pers. observ.)

266 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

and we did not find any indications of recent bottlenecks (BOTTLENECK is
only able to detect those bottlenecks that have occurred within approximate-
ly the past 2N.-4N, generations; Piry et al., 1999), the possibility of older
bottlenecks should not be dismissed.

Inference of colonization history of C. falcatum in the southern Korean
Peninsula.—Since C. falcatum is a member of the warm-temperate and
subtropical vegetation community, and the Korean populations are at the
northern edge of the species’ geographic range, one may hypothesize that it
endured the Quaternary glacial periods at more southerly latitudes. Glacial
refugia for many elements of warm-temperate and subtropical flora have been
proposed to occur in southern Kyushu and also in southern Honshu, Japan (see
Fig. 1; Tsukada, 1984; Hattori, 1985; Matsuoka and Miyoshi, 1998; Aoki et al.,
2004; Gotanda and Yasuda, 2008). Fern spores usually have a high dispersal
potential; ca. 500 ~ 800 km and even 3,200 km are suggested as maximum spore-
dispersal distances (Tryon, 1970, 1972). The Tsushima (Korean) Strait was only
about 10-20 km wide during the LGM and remained relatively narrow until ca.
14,000—12,000 yr BP (Park et al., 2000; Lee et al., 2008) being therefore easily
passable. Even during the Holocene the 200 km channel width would have not
constituted an insurmountable barrier for spore dispersal. Current populations
of C. falcatum could also have arrived from the more distantly located southern
regions, as the East China Sea (ECS) was largely exposed until at least 10,000 yr
BP (Xu et al., 2010). Therefore, migrations from southern China, Taiwan or even
from some locations offshore in the southern part of the ECS cannot be ruled out
(see Harrison et al., 2001; Hope et al., 2004; Prentice et al., 2011).

The low within-population genetic variation for C. falcatum argues against
the multiple-refugia hypothesis and supports the second hypothesis that
the contemporary Korean populations of C. falcatum are descendant from
colonizers from a single glacial refugium, presumably from southern Japan
and/or southern China. However, we should bear in mind that these two
proposed scenarios (multiple vs. single source populations) are the two
extremes of a spectrum of possibility (e.g., some of the extant Korean
populations could come from a single source, whereas others could originate
from the admixture of several lineages). Moreover, many factors could have
altered and/or modeled these ‘‘ideal’’ patterns, such as the number of
colonization events, the number of propagules arriving at each colonization
event, and the occurrence of genetic bottlenecks. For example, if population
sizes have been historically small, random genetic drift since the post-glacial
colonization events would have lead to low levels of intrapopulation genetic
diversity even if the populations originated from multiple sources. In this
latter case, patterns of genetic variation will be hardly distinguishable from
those expected for species that immigrated from a single refugium. Clearly,
more species (especially those continuously distributed) should be studied to
draw firm conclusions about the post-glacial colonization history of warm-
temperate homosporous fern populations currently occurring in Korea.

A similar scenario of glacial survival in remote refugia and post-glacial
recolonization has been proposed for the homosporous fern Dryopteris

CHUNG ET AL.: GENETIC VARIATION IN CYRTOMIUM FALCATUM 267

aemula. Jiménez et al. (2009) reported a total lack of allozyme variation (Hy =
0.000) of this fern in the Iberian Peninsula, which was attributed to founder
effects during the Holocene expansion. Later, using five microsatellite loci and
adding one population from the Macaronesian archipelago of Azores, Jiménez
et al. (2010) found low levels of genetic variation within populations (total
heterozygosity, Hy = 0.447) and a high degree of population genetic
differentiation (Fs; = 0.520) in D. aemula. Interestingly, the Macaronesian
population was much more variable than the Iberian ones and, based on these
findings, the authors suggested that the Azores acted as a glacial refugium from
which D. aemula spread northeastward and recolonized mainland Europe
(Jiménez et al., 2010). The role of glacial refugia as sources of plant diversity
for the post-glacial recolonization in Europe of the Macaronesian Islands has
been acknowledged in recent years (e.g., Caujapé-Castells, 2011; Ferndndez-
Palacios et al., 2011; Hutsemékers et al., 2011).

In sum, southern Korean populations of C. falcatum exhibit low within-population
genetic variation, which may be a consequence of post-glacial long-distance dispersal
events, presumably from a single glacial refugium, and subsequent founder effects. In
addition, restricted gene flow among the highly specific rock habitats on which C.
falcatum occurs discontinuously in southern Korea would have contributed to the
high degree of among-population genetic differentiation.

Conservation implications.—An understanding of how genetic diversity is
partitioned within and among populations is critical to design adequate plant
conservation plans (Godt and Hamrick, 2001; Sun and Wong, 2001). In order to
preserve a representative sample of the genetic variation, species with high
population differentiation require the conservation of more populations in
situ, and also a more extensive population sampling for ex situ conservation.
Since C. falcatum exhibits a high degree of divergence among populations, a
relatively large number of populations should be targeted for both in situ and
ex situ conservation. Using the formula proposed by Ceska et al. (1997), P =
1 — (Fsy)" (where P is the proportion of genetic variation desired to be
preserved and n is the number of populations to be sampled/protected), we
should protect/sample at least four populations in order to conserve => 90% of
the genetic diversity found in C. falcatum. Considering allelic richness, allele
frequencies, and the UPGMA phenogram, we suggest that the populations CF-
1 and CF-7 from one of the clusters and CF-5 and CF-6 from the other cluster
deserve both in situ preservation and ex situ conservation in southern Korea.
Thus, these populations should be protected by law (e.g., by designing plant
reserves), whereas spores should be collected and deposited in spore storage
facilities (e.g., by cryoconservation; Ballesteros et al., 2012).

ACKNOWLEDGMENTS

The authors thank Cheol Hwan Kim for helping us in locating populations of Cyrtomium
falcatum in southern Korea, and B. J. Shim, E. J. Im, M. S. Park, and C. H. Chung for field and
laboratory assistance. This work was supported by the Korea Research Foundation Grant funded by
the Korean Government (MOEHRD) (RO5-2004-000-11055-0) to MGC.

268 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

LITERATURE CITED

Apams, J. M. and H. Faure. 1997. Review and atlas of Siemens preliminary land ecosystem
maps of the world since the Last Glacial Maximum. ae iguanas eee Oak
Ridge (TN). [cited 2012 May 12]. Available at: http i
html.

tm.
Aoki, K., T. Suzuki, T.—W. Hsu and N. Murakami. 2004. P
broad-leaved evergreen forests in Japan, based on cect DNA variation. J: “PL. Res.
117:77-94.

Aroirti, J. ae K. A. Guan. 2000. Tansley review No. 110: Numerical and physical properties of
orchid seeds and their biological implications. New Phytol. 145:367—421.

Ba.testeros, D., E. Estrettes, C. Watters and A. M. Ipars., 2012. Effects of ci a oy and
desiccation on ex situ conservation of nongreen fern spores. Amer. J. Bot. 99

Brown, A. H. D. 1979. Enzyme polymorphism in plant populations. Theor. Pap uiit. aL 15:1-42.

Caujapé-CasTELLs, J. 2011. Jesters, red queens, boomerangs and surfers: A molecular outlook on the
diversity of the Canarian endemic flora, Pp. 284-324, In: D. Bramwell and J. Caujapé-Castells,
eds. The biology of island floras. SS . University Press, London

Ceska, J. F., J. M. AFFOLTER and J. L. Hamrick . Developing a sampling sind for Baptisia
arachnifera based on allozyme diccadie eRe Biol. 11:1

CuHELIAK, W. M. and J. P. Prre.. 1984. Technique for starch gel eres 7 ce from forest
tree sean oe report PI-X-42. Petawawa National Forestry Institute, Chalk River,
Ontario,

CHol, = -R. 1998. =e anal vegetation history of the lowland in Korean Peninsula. Korean J.

col. 21: nabs

ee CH. 2007. Vegetation response to climate change on Jeju Island, South Korea, during the
last deglaciation based on pollen record. Geosci. J. 11:147—155.

Cuunc, C.-H. 2011. Holocene vegetation dynamics and its climatic implications inferred from
pollen record in Boseong area, South Korea. Geosci. J. 15:257—264.

Cuunc, C.-H., H. S. Liv and H. I. Yoon. 2006. Vegetation and climate changes during the Late
Pistocene to Holocene inferred from pollen record in Jinju area, South Korea. Geosci. J.

oe

i)
co

pe C.-H., H. S. Lim and H. J. Lee. 2010. Vegetation and climate history during the late
eas and early Holocene inferred from pollen record in Gwangju area, South Korea.

Cuunc, M. Y., J. D. Nason, B.-Y. Sun, M.-O. Moon, J. M. Cuune, C.-W. Park and M. G. Cuune. 2010.
Extremely low levels of genetic variation in the critically endangered monotypic fern genus
Mankyua chejuense (Ophioglossaceae) from Korea: Implications for conservation. Biochem.

888-896

Crayton, J. W. and D. N. ‘Trenax. 1 972. Amine citrate ea for pH control in starch gel
electrophoresis. J. Fish. Res. Board Canada 29:1169—

+ f, tink 4; +

CoRNUET, . and G. Lurxart. 1996. Description and po
population | sgenapen from allele frequency — Genetics 144:2001-2014.

Dopp, W. 1950. Eine die depeableimE aes bei farn bstanz in den prothallien von
Pteridium aula (L.) Kuhn. Ber. serene ot: Gan 63: 139-147.

Dumini, J., S. Finescul, A. Hampe, P. ce o, D. Savini, G. G. VENDRAMIN and R. J. Petir. 2007. Can

ia peices structure be aticed from life-history traits? Amer. Naturalist
662-672.

ae J. A. 2007. Dynamics of long-distance dispersal: the spread of Asplenium adiantum-
nigrum and Asplenium trichomanes (Aspleniaceae; Pteridophyta) on London walls. Fern
Gaz. 18:31—38.

FERNANDEZ-PALACIOS, J. M., L. pg Nascimento, R. Otro, J. D. Detcapo, E. Garcfa-pEL-REy, J. R. AREVALO
and R. J. Wurrraker. 2011. A reconstruction of Palaeo-Macaronesia, with parti pie spats
to the long-term biogeography of the Atlantic island laurel forests. J. Biogeogr. 38: 246

Finn, K. M. 2006. Reproductive biology of three fern species may contribute to thecal
semua ex success in post-agricultural forests. Amer. J. Bot. 93:1289-1294.

CHUNG ET AL.: GENETIC VARIATION IN CYRTOMIUM FALCATUM 269

Goonr, ee a and J. L. Hamrick. 2001. Genetic diversity in rare southeastern plants. Nat. Areas J.

Gorn, K ae - Yasupa. 2008. Spatial biome changes in southwestern Japan since the Last
jal Mucdnuns . Quatern. Int. 184:84—-93.
GoupeT, i sigh FSTAT (Version 1.2): A computer program to calculate F-statistics. J. Heredity
86:4
Gray, A. ee sige diversity and its conservation in natural populations of plants. Biodivers.
Lett. 3:71-
silat Jet. meee J. W. Gopr. 1989. Allozyme a) in plant species, Pp. 43-63, In: A. H. D.
own, M. T. Clegg, A. L. Kahler and B. S. Weir, eds. Plant population genetics, breeding and
ae resources. Sinauer Shoko Sunderl oe
Hamrick, J. L. and J. D. Nason. 1996. pea ss of dispersal in Aer Sse ee In: O. -
Rhodess Jr, R. K. Chiveaar and M. H. Smith, eds. Population dy
time. University of Chicago Press, Chicago.
bee

Hamrick, J. Linnart and J. B. Mirron. 1979. Relationships between life history
charactertatics and electrophoretically decbie genetic variation in plants. Annual Rev.
Eco 7173-200.

Harpy, O. J. and X. Vexemans. 2002. SPAGeDi: a versatile computer program to wre ee
genetic structure at the individual or population levels. Molec. Ecol. Notes 2:618-620

seasasenh S. P., G. Yu, H. Takanara and I. C. Prentice. 2001. Diversity of temperate ee in east

Asia. Nature 413:129-130.
oe T. 1985. Synecological study on the lucidophyllous forest of Castanopsis-Persea type in
ee Bull. Kobe. Geobot. Soc. 1:1-98 (in Japanese with English abstract).

ne. = oe 5. Enzyme variability and modes of evolution in Bommeria (Pteridaceae). Syst.
Bot ou

HAUFLER, : pee d G. J. Gastony. 1978. Sa cela and the breeding system in the fern genus
Bommeria. Canad. J. Bot. 56:159

Haurter, C. H. and T. A. RANKER. ee Effects of penne antheridiogen response on
evolutionary mechanisms in Cystopteris. Amer. J. Bot. 71:878-881.

Haurter, C. H. and C. B. Wetiinc. 1994. Antheridiogen, dak — ne eipaa tia and outcrossing
mechanisms in nde able Pe EER Amer. J. Bot. 81:616-621.

Hauk, W. D. and C. H. Haurier. 1999. Isozyme variability pen crytic species of Botrychium
sen Botrychium (Ophioglossaceae). Amer. J. Bot. 86:614—633.

, G. M. Some genetic c pea? ences of ice ages, and their role in divergence and
speciation, Bi Linn. Soc. 58:2 6.
Hewnrt, G. M. 1 0, Post-elacial enponreelirar of European biota. Biol. J. Linn. Soc. 68:87—112.

Hewrt, G. M. 2011. Quaternary phylogeography: the roots of hybrid zones. Genetica 139 617-638

HOLDEREGGER, R. and J. J. ScHNELLER. 1994. Are small Scan populations of Asplenium
saps eid Milena Biol. J. Linn. ea 51:377-

Horz, G., , S. VAN DER X. Sun, P.-M. ee L. E. Heusser, H. TAKAHARA, M.
Arai ges sane and P. T. Moss. 2004. lah of vegetation and habitat Saas in the
Aor ae region. aa Int. Heat. 103-1

Hu, F. S., A. Hamre and R. J. P 2009. Paleoecology genetics: deciphering past vegetational
dynamics. Frontiers Ecol. E Environ. 7:371-379.

Huts , V., P. Szoveny, A. J. SHAw, J.-M. GonzALez-Manceso, J. MuNoz and A. VANDERPOORTEN.

2011. Oceanic islands are not sinks of biodiversity in spore-producing plants. Proc. Natl.
Acad. Sci. USA 108:18989-18994
IwaTsukI, K. 1992. Ferns and fern allies of Japan. ala on Ltd., Tokyo, Japan.

Jiménez, A., L. G. QuINTANILLA, S. PajaROn and E. PANcua. 2009. Genetic variation in the econ on
oT corleyi and its diploid parental sch in the Iberian Peninsula. Amer. J. B
96:1880—1886.

Jiménez, A., R. Hopereccer, D. Csencsics and L. G. QuinTANILLA. 2010. Microsatellites reveal
substantial among-population cen oo and strong inbreeding in the relict fern
Dryopteris aemula. Ann, Bot. 106:1

270 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

K.iexowskl, E. J. 1972. Genetical features of ferns as contrasted to seed plants. Ann. Missouri Bot.

Gard. ot
eS E, J. 1973. hig and subsexual systems in the homosporous ferns: a new hypothesis.
Amer. J. Bot. 60: 4
Kiss, % J. and H. G. aise 1966. Evolutionary significance of polyploidy in the Pteridophyta.
Science 153:305—-3
Lex, E., . ey and S. ees 2008. Paleo-Tsushima Water and its effect on surface er properties in
the East Sea during the last glacial maximum: Revisited. Quatern. Int. 176-177:3-12
Li, J. and C. H. Haurter. 1999. Genetic variation, sre oe and patterns of leunieie:
in eames Agile dium (Polypodiaceae). Syst. 3339-355.
pics R. M. 1974. Reproductive biology and ei, te in i Pteridophyta. Ann. Missouri Bot.
ard. 61: ot
nena. J., F.-M. ZHanc, H.-Q. Sun, T.-S. Yinc and S. Ge. 2011. ponte of plant endemism in
hin ee for cone or for meciation? J: > ait 38:12 280
LurKart, G., F. W. ALLENDorF, J. M. Cornugt and W. B. SHERWIN. 1998. ae of allele frequency
distributions age ge a test for recent population bottlenecks. J. Heredity 89:238—247.
ManteL, N. A. 1967. The detection of disease clustering and a generalized regression approach.
Cancer Res. 7. 209-220.
Matsuoka, K, and N. Mryosui. 1998. Chapter III-4, Pp. 224—236, In: Y. Yasuda and N. Miyoshi, eds.
The eget eceaiion history of the Japanese Archipelago. Asakura-shoten, Toyko,
Japan (in Japanese).
McCautey, D. E., DP. Worrtier and L. M. Remy. 1985. Int 1 tl te of self-fertilization in
a grape fern, “piace dissectum. Amer. J. Bot. 72: 1978-1981
Mitton, J. B., Y. B. , K. B. Srurceon and J. L. Hamrick. 1979. hevethie polymorphisms
detected in ee ale tissue of ponderosa pine. J. Heredity 70:86-89
NEI, M. 1978. Estimation of beat crtewas saae and genetic distance fen a small number of
individuals. Genetics 89:5
Nel, M., T. MARUYAMA and R. ae es 1975. The bottleneck effect and genetic variability in
populations. Evolution 29:1-10.
Nevo, E., A. Beres and R. BEN-SHLOMo. 1984. The evolutionary significance of genetic en nee
Ecological, demographic and life history correlates, Pp. 13-213, In: G. S. Mani, e
Evolutiona dynamics of genetic diversity — Lecture Notes in Ricmathematics fis. 53).

PajarOn, S., E. PANcua and 4 GarciaA- ALVAREZ. 1999. Sexual expression and genetic diversity in
populations of Cryptogramma crispa (Pteridaceae). Amer. J. Bot. 86:964—973.

Park, S.-C., D.-G. Yoo, C.-W. Lee and E.-I. Lee. 2000. agape sea level changes and
i of the Korea (shina Strait. Geo-Mar. Lett. 20:64—-71.

Peck, J. H., C. J. Peck and D. R. Farrar. 1990. Influences life cae attributes on formation of
local a dat fern populations. ree Fern J. 80
Petit, R. J., I. AGUINAGALDE, J. L. DE BEAULIEU, C. BitrKau, S. Bas R. Cueppapi, R. ENNos, S. FINESCHI,

Grivet, M. Lascoux, A. Monanty, G. MUELLER-STaRcK, B. DemMesurE-Muscu,
Makin, S. RenbELL and G, G. Vinca. 2003. Glacial ae hotspots but not malting pots of
~~ paises Science 300:1563—1565

Piry, S., G. Lurkarr and J.-M. Cornuet. 1999. Haltionork: a computer program for detecting recent
seit in oe effective population size using allele frequency data. J. Heredity
mhpitals

Prentice, I. C., S. P. Harrison and P. J. BARTLEIN. 2011. a oo and terrestrial carbon cycle
changes sees! fea last ice 8 New Phytol. 189:988—

Pryor, K. V., J. E. ING, F. J. Rumsey, K. J. ast rps, M. W. eaetiee and H. J. Rocers. 2001. Diversity,
genetic ibis and ae ce of outcrossing in British populations of the rock fern
ae capillus-veneris rea microsite Molec. Ecol. 10:1881—1894.

Qu, Y.-X., C. oni Fu and H. P. Comes. 2 1. Plant molecular phylogeography i in Chins and adjacent
regions: Tracing th tic i change in the
world’s most diverse temperate flora. Molec. Phylogen. Evol. 59:225—244.

CHUNG ET AL.: GENETIC VARIATION IN CYRTOMIUM FALCATUM 271

Ranker, T. A. and J. MM O. Gace. 2008. Population genetics, Pp. 175-198, In: R. A Ranker and C. H.

Haufler, ahs tes. Cambridge Uni , Cambridge.

Ranker, T. A., C. E. C. Genoa, P.G. TRAPP , A. HAMBELTON and K. Ha. 1996. Ponulation genetics and

cote biology of lava-flow Soloataine species of Ha awaian Sadleria (Blechnaceae),
81-598, In: J. M. ein mus, M. Gibby and R. J. Johns, eds. Pteridophytes in perspective

ns
Rousset, F. 1997. Genetic fee ion _ estimation of gene flow from F-statistics under
isolation by distance. Genetics 145:1219-1228.
Roux, . 2011. The genus Cyrtomium ear Dryopteridaceae) in Africa and Madagascar.
. Linn. ce 167:449-465.
ces J. J. and R. Houpereccer. 1996. ete sag and genetic variability within
seco of sf earnings ruta-muraria L., Pp. 5 80, In: J. M. neneles M. Gibby and R. J.
Johns, eds. Pteridophytes in perspective. Royal a Gardens
SHI, Y. sat Characteristics of late Quaternary monsoonal glaciation on pte Tibetan Plateau and in
ast Asia. Quatern. Int. 97-98:79—-91.
Soxtis, D. E. and P. S. Soxtis. 1986. Electrophoretic evidence for inbreeding in the fern Botrychium
viginianum (Ophioglossaceae). Amer. J. Bot. 73:588-592.
Soxtis, D. E. and P. S. Soxtis. 1989. ayer breeding systems, and genetic differentiation in
mosporous Pteridophytes. Pp. 241-258, In: D. E. Soltis and P. S. Soltis, eds. Isozymes in
eee biology. ee corides Sau. Portland.
Sottis, D. E. and P. S. Sottis. 1992. The distribution of selfing rates in homosporous ferns. Amer. J.

SOLTIS, DE, GH: Bae: R, D. C. Darrow and G. J. Gasrony. 1983. Starch gel electrophoresis of
ferns: a compilation of grinding buffers, gel and electrode buffers, and staining schedules.
Amer. Fern J. 73:9—27.

Soitis, D. E., A. B. as RRIS, J. S. McLACHLAN and P. S. Manos. 2006. Pre, cu phylogeography of
wees eastern North America. Molec. Ecol. 15:4261—4

Soxtis, P. . E. Sottis and B. D. Ness. 1989. Population cue structure in Cheilanthes
eh Amer. J. Bot. 76:1114—1118.

Sun, M. and K. C. Wonc. 2001. Genetic structure of three orchid ae with aubetin breeding
systems using RAPD and allozyme markers. Amer. J. Bot. 88:2180—218

Suter, M., J. J. SCHNELLER and J. C. VocEL. 2000. Investigations into the sacaie variation, population
structure ie — system of the fern Asplenium trichomanes subsp. quadrivalens. Int. J.
Pl. Sci. 161:

TrYON, R. 1970. Bie and evolution of fern floras of oceanic islands. Biotropica 2:76-84.

Tryon, R. syd Endemic areas and geographic speciation in tropical American ferns. Biotropica

2121-1

TSUKADA, M. ae A vegetation map in the Japanese aa cn approximately 20,000 years B.P.
Jap. J. Ecol. 34:203-208 (in Japanese with English abstract).

VAN DER Bank, H., M. VAN DER BaNK and B.-E. van Wyk. 2001. A review of the use of allozyme
slectrophoresis in plant systematics. Hiochen: Syst. a) 29:469—-483.

VocEL, J. C., F. J. Rumsey, J. J. ScHNELLER, J. A. Barretr and M. Gipsy. 1999a. pings are the glacial
rehusin | in Europe? Evidence from da Biol. J. Linn. Soc. 66:23-

VocEL, J. C., F. J. Rumsey, orga eet J. S. Hotmes, W. Buynocu, C. Sta
M. Gissy. 1999b. Genetic structure, reproductive biology and ecology of hia populations
of Asplenium csikii (Aspleniacon, Pteridophyta). Heredity 83:604—-612

Watano, Y. and N. Sanas 992. Predominant inbreeding and its genetic consequences in a
homosporous fern genus, gai cid en Syst. Bot 86-502.

Weepen, N. F. and J. F. WENDEL. 1989. Genetics of plant isozymes. Pp. re D. E. Soltis and P.
S. ee eds. Isozymes in aes biology. Dioscorides Press, Portland.

and C. C.

Weir, B. CockERHAM. 1984. Estimating F-statistics for the analysis of population
pace Evolution 38: prune
Weiss, S. and N. Ferranp, (eds.) 2007. Phylogeography of soutl E Evolutionary

perspectives on the origins and conservation of European biodiversity. sacotra Dordrecht.

272 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

Woomer, A. and C. Lexer. 2001. acta Sosa sanctuaries for allelic richness, but not for gene
diversity: Trends Ecol. Evol. 16

Wricut, S. 1965. The interpretation of population structure by F-statistics with special regard to
peng of — Evolution 19:395—4

Wuss, E. R., DE Groot, H. J. Durinc, J. a Nog L, M. GRUNDMANN, P. BREMER and H. SCHNEIDER.

2010 aint mating ase in She fern panes scolopendrium: implications for
colonization potential. Ann. Bot. 106:583-590.

Xu, D., H. Lu, N. Wu and Z. Liu. 2010. 30 000-Year vegetation and climate change around the East
China Sea shelf inferred from a high-resolution pollen record. Quatern. Int. 227:53-60.

Yeu, F. C., Yano, R.-C. and T. B. J. BoyLe. 1999. POPGENE version 1.31-Microsoft Windows-based
freeware for population genetic analysis. Quick users’ guide. University of Alberta,
Edmonton.

Yi, S. 2011. Holocene vegetation responses to East Asian monsoonal changes in South Korea.
Pp. 157-178, In: J. Blanco and H. Kheradmand, eds. Climate change-geophysical foundations
and ecological effects. In Tech, Rijeka (Croatia).

Yi, S. and S.-J. Kim. 2010. Vegetation changes in western ae sane of Korean Peninsula during
the last glacial (ca. 21.1-26.1 cal kyr BP). Geosci. J. 14

American Fern Journal 102(4):273—282 (2012)

SEM Studies on Tracheids of Lycopodiaceae;
Observations on Adaptations in Phylloglossum

SHERWIN CARLQUIST
Santa Barbara Botanic Garden, 1212 Mission Canyon Road, oP Barbara, CA 93105, USA,
ail: s.carlquist@verizon.ne
pe L. SCHNEIDER
Department of Horticultural Sciences, 258 Alderman Hall, University of Minnesota, Twin Cities
Campus, St. Paul, MN 55108, and University of Minnesota Landscape Arboretum, 3675 Arboretum
Drive, Chaska, MN 55318, USA, email: edschnei@umn.edu
KEVIN F. KENNEALLY
School of Earth and Geographical Sciences, Faculty of Natural and capes Sciences,
The University of Western Australia, 35 Stirling Highway, Crawley, WA 6009, Australia,
and Western Australian Herbarium (PERTH), Department of eA Heal and Conservation,
Kensington, WA 6152, Australia, email: kevin.kenneally@uwa.edu.au

Asstract.—Scanning electron microscope (SEM) studies of stem and strobilus longisections of
Huperzia, Lycopodium, and Phylloglossum were undertaken to explore ultrastructure of pit
membranes in tracheids. The membranes do not characteristically have pores and may often lack
evidence of cellulosic fibrils. Some pit membranes in Lycopodium did show cellulosic fibrils.
Porose membranes were seen in some tracheids, an appearance probably related to scraping away
of layers in pit membranes by the sectioning process, or in other cases, artifact formation.

nested in Huperzia, lacks metaxylem and has numerous other adaptations to the distinctive
ephemeral vernal bogs of Australia and New Zealand, similar to those in Droseraceae and
Orchidaceae.

Worps.—adaptation to fire, Huperzia, Lycopodium, Phylloglossum, pit membranes, tracheid
ultrastructure, vernal bogs, xylem

Tracheids of Lycopodium were studied by Bierhorst (1960, 1971) and by
Wilder (1970) by means of light microscopy. Although the total number of
species studied was small, the differences among species were not great, so a
broad-based survey of tracheids in the family has not been undertaken by those
authors or by us. Cook and Friedman (1998) and Friedman and Cook (2000)
offered some fascinating new data on ultrastructure of Huperzia (formerly a
section of Lycopodium) tracheids. They demonstrated that the secondary wall
of Huperzia tracheids is composed of a ‘template layer’? on which is
superimposed a “‘resistant layer.’’ The template layer is lignin-poor, whereas
the resistant layer is rich in lignin

Cook and Friedman (1998) and Friedman and Cook (2000) as well as Kenrick
and Crane (1991, 1997) and Edwards (1993) have sought to integrate
information on tracheid ultrastructure of early vascular plants with facts on
the ultrastructure of tracheary elements in extant groups of vascular plants.

274 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

Lycopodiaceae, along with Equisetum, play an important role in these
considerations because they may retain some characteristics of tracheary
element ultrastructure from early times (e.g., Devonian).

Our goals in the present study complement the abovementioned studies by
offering scanning electron microscope (SEM) studies of primary walls in three
of the four genera currently recognized in Lycopodiaceae. We investigated
primary wall microstructure with respect to protoxylem versus metaxylem.
Also, we have included the first studies on ultrastructure of Phylloglossum
tracheids. We have focused on the possible existence of thin areas or porosities
in tracheid primary walls, and whether or not cellulosic fibrils are visible with
SEM in primary walls of tracheids. Such structures have been evident in
tracheids and/ or vessel elements of ferns (Carlquist and Schneider, 2007),
Equisetum (Carlquist and Schneider, 2011a), cycads (Schneider et al., 2007),
and various families of monocotyledons (Carlquist and Schneider, 2010a,
2010b; Carlquist, 2012). Presence of pores and abundance of cellulosic fibrils
vary considerably among these groups. For example, the end wall of a grass
vessel contains a single large pit membrane that dissolves as the vessel
matures; we were unable to demonstrate cellulosic fibrils in those pit
membranes (Carlquist and Schneider, 2011b). By contrast, the cellulosic
fibrils in perforations of Canna vessel elements are striking and persist in the
mature vessel elements (Carlquist and Schneider, 2010b). The presence of a
reticulum of cellulosic fibrils or of pores in an intact pit membrane appears to
mediate the balance between conductive safety (restricting air bubbles to a
single tracheary element) and conductive efficiency (porousness permitting
passage of greater volumes of water per unit time than non-porous pit
membranes). Where the tracheids of Lycopodiaceae fall in this gamut is the
point of interest in our investigation.

Study of three genera of Lycopodiaceae permits a preliminary examination
of diversity of tracheid ultrastructure for the family. One of these genera,
Phylloglossum, is of especial interest because of the distinctive habit, which in
turn is related to a special ecological niche. Phylloglossum plants consist of a
so-called tuber (coexisting with the production of a single new tuber), a root,
several leaves, and a strobilus. There is no stem in any accepted sense, merely
a junction among these organs. Each spring, as moisture permits, the tuber
produces leaves, a root, and a strobilus, and a geotropic new tuber. The plant
oversummers and survives fire by means of the tuber. The vascular system of
Phylloglossum consists of a plexus of tracheids interconnecting root, leaves,
and strobilus. No vascular tissue enters the tuber, and thus vascular tissue is
not intercontinuous from one year’s plant body to the next year’s. The
distinctive habitat occupied by Phylloglossum can be characterized as
ephemeral bogs, shallow depressions of acid sand, underlain by a hardpan,
that accumulate rainwater during the winter months but evaporate as spring
progresses into summer. The interrelationships between this distinctive
habitat and the unique morphology of Phylloglossum form an obvious reason
for special attention to Phylloglosum xylem. The habits of remaining
Lycopodiaceae, which consist of horizontal and/or upright or pendant stems,

CARLQUIST ET AL.: TRACHEIDS OF LYCOPODIACEAE 275

is relatively uniform, but no less interesting in terms of mechanical and
physiological aspects.

MATERIALS AND METHODS

Sources of material are as follows. Huperzia lucidula (Michx.) Trevis:
supplied by Carolina Biological Supply Company. Lycopodium annotinum L.,
L. dichotomum L., and L. complanatum L.: collected by E. L. Schneider at the
moose-viewing platform along the Gunflint Trail, Minnesota, on September 12,
2011. Phylloglossum drummondii Kunze: specimen used for paraffin section-
ing: collected between 120 and 121 mile post on highway between Brookton
and Mt. Barker, Western Australia, on flat with grasses and sedges and annual
Stylidium species; 9 October 1974, by Sherwin Carlquist (RSA). Phylloglossum
drummondii used for SEM work: collected at Forrestdale Lake Nature Reserve,
Western Australia, in seasonally waterlogged sandy clay flat (palusplain) with
Drosera spp., Utricularia multifida and Philydrella pygmaea, 6 September
2007 by C. Tauss 1640 (PERTH). Recognition of genera in this paper follows
that of Wikstroém and Kenrick (1997). The system for the family by Wagner and
Beitel (1992) preceded molecular investigations and some genera recognized
by them have not been followed in subsequent treatments.

All collections were preserved in 50% aqueous ethanol. The 1974 collection
of Phylloglossum was embedded in paraffin according to the usual techniques;
sections were stained with a safranin—fast green combination. Collections of all
other Lycopodiaceae were sectioned by hand with a single-edged razor blade.
The sections were subjected to three changes of distilled water, dried (with
pressure applied) on a warming table, mounted on aluminum stubs, sputter-
coated with gold, and examined with a Hitachi S2600N SEM. These methods
have been described in more detail by Carlquist and Schneider (2007).

RESULTS

Huperzia lucidula (Fig. 1A—D). SEM micrographs of H. lucidula in our
preparations show a range of conditions. The metaxylem pit membranes in
Fig. [A show numerous holes of various sizes, but no convincing evidence of
cellulosic fibrils. The holes may represent thin areas in the pit membrane,
revealed only when portions of the pit membrane are shaved away by the
sectioning process. No holes are evident in the pit membrane shown in
Fig. 1B, which has not been affected by the sectioning process. Likewise, the
metaxylem tracheids in Fig. 1C show no evidence of pores in the pit
membranes (tears represent obvious artifacts).

In protoxylem of H. Jucidula (Fig. 1D), primary walls (equivalent to pit
membranes in metaxylem) without pores were observed. This appearance
accords with the illustration for this species by Friedman and Cook (2000).
Also in agreement with their illustration, we found a relatively abrupt shift
from protoxylem to metaxylem wall patterns, with few reticulate tracheids.

276 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

Fic. 1. SEM micrographs of tracheids from longisections of stems of Lycopodiaceae. A—D.
aria lucidula. A. Metaxylem tracheid outer surface, showing porous appearance of the pit
e. B. M

membran etaxylem tracheid in sectional view, showing pit membranes in face view (above)
and in cotiniel view (lower right); no porosities evident. C. Outer surfaces of two metaxylem
tracheids; no pores evidence in pit membranes (which do show some tears). D. Protoxylem (below)
and metaxylem (above). E-F. Lycopodium complanatum. E. Protoxylem; some interconnections
between the secondary wall helices occur in the tracheid above; no pores evident in primary wall.

F. Porous primary wall in protoxylem, probably eid to the sectioning process.

CARLQUIST ET AL.: TRACHEIDS OF LYCOPODIACEAE 277

Lycopodium complanatum (Fig. 1E-F).

Protoxylem tracheids of L. complanatum in Fig. 1E show thin non-porose pit
membranes on helical (below) and transitional (above) tracheids. Pores may be
found on primary wall areas scraped away by sectioning (Fig. 1F), although the
primary walls are otherwise non-porose.

L. annotinum (Fig. 2A—D).

In metaxylem, pit membranes of L. annotinum tracheids are typically non-
porose (Fig. 2A). Tracheid pits that presumably have not been affected by
sectioning (because they are viewed from the tracheid inside and seem intact),
some pit membranes have a few small holes (Fig. 2B—G). These porosities may
be irregularly distributed (Fig. 2B), and may represent some degree of artifact
formation. In pits that have experienced scraping from the knife, a fibrillar
structure is evident (Fig. 2D).

L. dichotomum (Fig. 2E—-H).

Scattered small pores were observed in an apparently intact metaxylem
tracheid (Fig. 2E). Protoxylem tracheids show pores to the degree that portions
of the primary wall are shaved away by the sectioning process (Fig. 2F—G). The
pit membrane portion shown in Fig. 2H is suggestive of presence of a fibrillar
reticulate background. In the other instances, there is no indication of a
fibrillar background because the porosities are circular rather than angular.

Phylloglossum drummondii (Fig. 3A-F).

The xylem studied in this species is derived from study of the vascular
plexus, which interconnects strobilus, leaves, and root (see Introduction for a
description of the plant body). Phylloglossum has no metaxylem. The bands of
secondary wall in protoxylem tracheids are annular in a few places, but mostly
helical (Fig. 3A). There are very few interconnections (indicating an approach
to reticulate wall pattern) between the helices. The secondary wall annuli and
helices are not bordered (Fig. 3B).

Primary walls of Phylloglossum tracheids are thin and homogeneous
(Fig. 3C, E). Some areas show faint dark spots as recorded by the SEM
(Fig. 3D). This rendering suggests that they are depressions. Areas of primary
wall that have experienced some shaving from the sectioning process show
pores (Fig. 3F) that correspond to the depression seen in Fig. 3D.

DiscUSSION AND CONCLUSIONS

Ultrastructure of the primary walls of tracheids.—Pits in metaxylem
tracheids are oval in shape and prominently bordered in all Lycopodiaceae,
as shown in the illustrations of Bierhorst (1960, 1971), Wilder (1970), Cook and
Friedman (1998), and Friedman and Cook (2000). The appearances of pit

278 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

Fic. 2. SEM micrographs of tr ds from longisecti Lycopodium. A-D. L. annotinum. A. Outer

surface of metaxylem trac hei. shows ing non- porous pit membrane extending across the pit border.

B, CG. Vi iews of metaxylem pit membranes that have not been affected by sectioning, see n from inside the
e

| om
By
ps
|
&
a
Q
oO
>
baa)
<
wn
yg
i ¢
ie)
i
eet
|
°
53
is")
aA
2°]
a=:
[e*)
2)
©
=
a
_
°
io]
~~
g
5
oO
i2¥)
as)
=)
5
°
2)
x
=
foo
is")
a
vz)
ie)
2)
fom
=
is)
Lm
is)
a
s
—
co
E. &
i
i=]
ao)
=
i
=:
ion
Lew |
jet)
|
ise)

reticuham with strands. E-H. L. dichotomum. E. Pit membrane seen from inside a me axylem tracheid,

owing some holes of various sizes. F—H. Portions “of protoxylem tracheids seen from their outer
aba F. Primary wall non-porose, except at left; guest wall thickenings are bordered. G. Porose
sara nce in n peer wall of helical — H. A n of a primary wall from a helical tracheid,
showing a pp suggestive of a fibrillar parcel

CARLQUIST ET AL.: TRACHEIDS OF LYCOPODIACEAE 279

Hoary

wes us +47)

Fic. «3. Serger of tracheids from the vascular plexus in plants of Phylloglossum
drummondii. A, ight micrographs. A. Portions of tracheids to show annular (a) and helical
(b) secondary sea os B. Optical sections of secondary wall bands (center), showing non-
h

bordered condition. C-F. SEM micrographs. C. Portions of several adjacent tracheids, showing

280 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

membranes that have experienced some degree of shaving away of wall
material during the sectioning process suggest the presence of cellulosic
fibrils, but this is not evident in the intact pit membranes we viewed. The
circular shape and distribution of pores we observed in pit membranes that
have not been affected by sectioning suggests the possibility that such holes
may be artifacts caused by drying. However, porose appearances that are
related to shaving away of wall material could indicate genuine thin areas in
primary walls.

The abovementioned appearances are also found in primary walls of
protoxylem tracheids. Homogeneous non-porose wall surfaces predominate in
our material. This finding is in accord with the illustration of Friedman and
Cook (2000) for Huperzia lucidula, which is based upon an SEM image of
rotary microtome sections.

The paucity of cellulosic fibrils in primary walls of lycopodiaceous
tracheids contrasts with appearances found in ferns (Carlquist and Schneider,
2007), cycads (Schneider et al., 2007), and monocots (Carlquist and Schneider,
2010a, 2011b). In the monocots, fibrillar appearances are common in end walls
of tracheary elements of families with more numerous plesiomorphic features
(Carlquist, 2012). Cellulosic fibrils are, by contrast, few in the pit membranes
of the end walls, prior to lysis, of vessel elements of grasses (Carlquist and
Schneider, 2011b), which have simple perforation plates. More observations
on a diversity of pit membranes, preferably with transmission electron
microscopy (TEM) is desirable. The electron microscope data of Friedman
and Cook (2000) were focused on the secondary walls of Huperzia tracheids.

In monocots (Carlquist, 2012) and in some genera of ferns, (e.g., Blechnum,
Carlquist and Schneider, 2007), there is differentiation between end walls and
lateral walls of tracheary elements with respect to size of pits (or perforations),
pit membrane porousness, and presence of evident cellulosic webs. This may
be related to incipient tendencies toward acquisition of some characteristics of
vessels. Such differentiation was not evident to any appreciable extent in our
studies on cycad tracheids (Schneider et al., 2007). There is no differentiation
between end walls and lateral walls in tracheids of Lycopodiaceae. This
suggests that fascicles of tracheids, as in vascular cryptogam steles, serve as
conductive units conjunctively, whereas individual vessels or tracheids with
differentiation of end walls are the conductive units in monocots

Unique adaptations of Phylloglossum.—Wikstrém and Kenrick (1997) found
that Huperzia is paraphyletic, because Phylloglossum is nested within it
(Lycopodium + Lycopodiella forms the other clade of the family). If we regard
Phylloglossum as an extreme adaptation of the Huperzia clade, a number of
adaptations become evident. The meristem that gives rise to each new
geotropic tuber is exogenous, formed from surface tissue where the leaves and
strobili join the old tuber. As the tuber elongates geotropically, a negatively
geotropic meristem, which will give rise to the next year’s leaves and stems,
forms within the new tuber at its upper end (see Bierhorst, p. 25). This is a
unique structure within vascular plants. At this stage when the parent plant
has produced leaves and a strobilus, the new tuber has no vascular tissue. The

CARLQUIST ET AL.: TRACHEIDS OF LYCOPODIACEAE 281

vascular plexus that interconnects root with juncture between leaves and
strobilus does not even take the form of any discernable stem or stelar
configuration. As the current year’s plant body dries with the onset of the
warm and dry season, the only surviving portion is the maturing new tuber,
which contains no vascular tissue. Vascular tissue is initiated from the
negatively geotropic meristem of the new tuber, apparently in response to leaf
and strobilus initiation.

The vascular plexus, as we have seen, consists wholly of protoxylem. This
fact is compatible with changing turgor in the plant, facilitated by the annular
and helical patterns of the secondary wall within the tracheids. This correlates
with changes in water availability in the wet vernal flats—ephemeral bogs of a
sort—in which Phylloglossum grows.

Friedman and Cook (2000) illustrated borders on secondary wall in
protoxylem tracheids of Huperzia. This corresponds with our observations
on Huperzia and Lycopodium tracheids, although the sections of Friedman
and Cook (2000) are clear in this respect because they observed rotary
microtome sections with SEM. Phylloglossum, by contrast, lacks borders on
the secondary wall annuli and helices of tracheids. The borderless condition
confers more flexibility, because the investment in cellulosic wall material
is less.

There are several interesting implications of the anatomy of Phylloglossum
and its xylem. One can regard the plant body of Phylloglossum as
paedomorphic, as Wikstrém and Kenrick (1997) do, in that it produces so
few leaves and only one root, and yet produces a strobilus with this minimal
vegetative apparatus. The tuber does not represent a juvenilization of a stem,
but a new kind of appendage. This innovation within Lycopodiaceae is truly
remarkable, because it runs counter to the intuitive idea that an ancient group
of vascular plants is less likely to produce a vegetative structure sui generis.
The gemmae of Huperzia spp. are rather easily categorized, in contrast, as
products of shoot dimorphism.

The xylem of Phylloglossum may certainly be regarded as paedomorphic,
because it consists of protoxylem only, whereas all other Lycopodiaceae have
metaxylem as well as protoxylem. The wall strength of metaxylem is sufficient
to promote a self-supporting stem structure. Although sclerenchyma develops
in the cortex of some Lycopodium species, it develops later than metaxylem
(original data). The central issue at hand is whether or not one invokes the
term ‘“‘paedomorphic,” a functional correlation exists between the mechanical
strength provided by cellulose deposition and the mechanical strength (or lack
of it) in tracheids of Phylloglossum as compared to those of the remaining
Lycopodiaceae. This relative lack of tracheids with reticulate wall thickenings
in tracheids of Lycopodiaceae other than Phylloglossum suggests that
elongation (congruent with annular and helical wall thickenings of protoxy-
lem) abruptly yields to self-support (a characteristic of pitted tracheary
elements with appreciable wall thickness).

Interestingly, Phylloglossum shares its habitat with other vascular plants
that produce tuber-like structures with various modes of origin, notably

282 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

Droseraceae, certain Stylidiaceae, and Utricularia menziesii R. Br. (Utricular-
iaceae). Studies on the comparative physiology and timing of photosynthate
storage and retrieval of these plant assemblages together with xylem
characteristics would be of interest. One should point out, as do Wikstrém
and Kenrick (1997) with respect to Phylloglossum, that tuber formation is also
a strategy of fire avoidance. Data on soil temperature gradients with respect to
the species with tuber-like perennation structures in these areas would be of
special interest, because most of these structures are relatively close to the
ground surface in the ‘“‘vernal bog” habitats. More deeply buried tuber-like
structures are formed in various Orchidaceae native to sand areas of Australia
(especially Western Australia), a fact which correlates with the fact that those
Orchidaceae tend to co-exist with more shrubs, which would provide greater
heat when burned.

LITERATURE CITED

ance D. W. 1960. Observations on tracheary elements. Phytomorphology 10: sods

Breruorst, D. W. 1971. Morphology of vascular plants. The Macmillan Company, New York.

reall S. 2012. Monocot xylem revisited: new information, new paradigms. Bot. fis 78:87—
153.

Caruquist, S. and E. L. ScHNeter. 2007. incites elements in ferns: new techniques, observations,
and concepts. Amer. Fern J. 97:2

Car.quist, S. and E. L. SCHNEWER. 2010a. He and nature of vessels in cca hel pa 12; .
memb i re

sagen S. and E. L. Scunemer. 2010b. Origin and nature of vessels in monobokyledons. a

mary eylons microstructure, with examples from Zingiberales. Int. J. Pl. Sci. 171:258-266.

aie S. and E. L. Scunewer. 2011a. Equisetum xylem: SEM studies and their implications.
Amer. Fer Sie 133-14

Cariquist, S. and E. L. Scunewer. 2011b. Origin and nature of vessels in monocotyledons. 13.
Scanning cane microscope studies on xylem in large grasses. Int. J. Pl. Sci. 172:345—-351.
Cook, M. E. and W. E. FriepMan. 1998. Tracheid structure in a primitive extant Saee provides an

evolutionary link to earliest fossil tracheids. Int. J. Pl. Sci. 159(6):881-8
Epwarps, D. 1993. Cells and tissues in the vegetative sporophytes of early land te New Phytol.
125:225—247.

FRIEDMAN, W. E. and M. E. Coox. 2000. The origin and early evolution of tracheids in Maa
plants: integration of palaeobotanical and neobotanical data. Phil. Trans. R. Soc. London
355:857—868

Kenrick, P. and P. R. Crane. 1991. Water-conducting cells in early fossil land plants: implications
for the early evolution of tracheophytes. Bot. Gaz. 152:335—-356.

Kenrick, P. and P. R. Crane. 1997. The origin and early diversification of land plants: a cladistic
study. Washington and London, Smithsonian Institution Press

Scunewer, E. L., S. Car.quist and J. G. CHemnick. 2007. Scanning aloctton microscope studies of
cycad tracheids. S. African J. Bot. 73:512-517.

vaca W. H. and M. J. Berret. 1992. Generic classification of modern North American

copodiaceae. Ann. Mo. Bot. Gard. 79:676—686.
Wi Blom N. and P. Kenrick. 1997. Phylogeny of pee ee eens (Lycopsida) 8 as separa y
de ecosin drummondii Kunze based on rbcL sequences. Int. J. P . 158:862—

Wane, G. J. 1970. Structure of tracheids in hate species of oaks isa Pf. ee

ee

American Fern Journal 102(4):283-288 (2012)

Phlegmariurus changii (Huperziaceae), a New
Hanging Firmoss from Taiwan

Tunc-Yu HsiEx
School of Forestry and Resource Conservation, National Taiwan University, No. 1, Section 4,
Roosevelt Road, Taipei, 10617, Taiwan
Kent A. Hatcu
Biology Department, C.W. Post Campus of Long Island University, 720 Northern Boulevard,
Brookville, NY 11548, USA
Yuan-Mou CHanc*
Department of Ecoscience and Ecotechnology, National University of Tainan, 33 Su-Lin Street,
Section 2, Tainan 700, Taiwan

AssTRACT.—We describe and illustrate a new firmoss, Phlegmariurus changii (Huperziaceae),
which is endemic to eastern Taiwan. This new species is most similar to Phlegmariurus carinatus
(Desv. ex Poiret) Ching; however, it differs by leaves that are flat abaxially. In addition, the
sporophylls and trophophylls are conspicuously dimorphic for Phlegmariurus changii, but
essentially monomorphic in Phlegmariurus carinatus. The ecology, conservation status, and
morphology of P. changii is compared to that of species in three other sections (Sect.
Phlegmariurus, L. B. Zhang, Sect. Huperzioides H. S. Kung et L. B. Zhang, and Sect. Carinaturus
(Herter) H. S. Kung et L. B. Zhang) of Phlegmariurus in East Asia.

Key Worps.—Phlegmariurus, flora of Taiwan, taxonomy, ornamental fern, tassel fern, extinct in the
ild

This species belongs to the Lycopodiales. The Lycopodiales were histori-
cally considered a single family, the Lycopodiaceae, which contained two
genera, Phylloglossum Kunze and Lycopodium L. Phylloglossum is a genus
containing only one species and endemic to Australia and New Zealand,
whereas Lycopodium sensu Linnaeus are widely distributed in temperate and
tropical regions. Lycopodium L. is a complex group and has undergone many
changes in taxonomy and nomenclature (Holub, 1991; Wagner and Beitel,

“Corresponding author; email: changyuanmou@gmail.com

284 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

1992; Wagner, 1993; Ollgaard, 1987). Lycopodium has been separated into two
families, the Urostachyaceae Rothm. (=Huperziaceae Rothm.) and the
Lycopodiaceae (Rothmaler, 1944), and several genera. There are two genera—
Phlegmariurus and Huperzia Bernh.—in Huperziaceae. In this article, we
follow Wagner’s classification and include this species in Phlegmariurus
(Wagner and Beitel, 1992).

Many species of Phlegmariurus (Herter) Holub are important traditional
medicines and popular ornamental ferns in the flower markets, such as
Phlegmariurus squarrosus (Forst.) Love et Love, P. carinatus (Desv. ex Poiret)
Ching, and P. cunninghamioides (Hayata) Ching. Consequently, over-collection of
plants from the wild for medicinal and horticultural purposes threatens many
species (Yumkham and Singh, 2011). Of the ten species of Phlegmariurus that
occur in Taiwan, all but P. fordii (Baker) Ching are threatened (Moore, 2000; Moore,
2001; Kuo, 1997). This makes the finding of a new species in Taiwan important.

Phlegmariurus changii T. Y. Hsieh, sp. nov. TYPE.—Taiwan. Hualien County:
Wanrong Township, Hsilin Village. 6 April 2006, Tung-Yu Hsieh 516
(holotype: TAI 281321). Figs. 1, 2.

This new species is similar to P. carinatus (Desv. ex Poiret) Ching, but differs
by having leaves that are flat, vs. carinate or raised abaxially in P. carinatus.

Epiphytes, pendant firmoss; stems 0.6—0.9 m long, 3-5 mm in diameter,
dichotomously branching 5-8 times. Leaves sessile, leathery, lanceolate,
entire, with tapering apex, 7-9 mm long, 3-4 mm wide, imbricate, pointing
towards the apex of the shoot, appressed, decreasing in size towards apex and
gradually changing into sporophylls. Fertile spikes terminal, 0.15—0.2 m long,
2 mm thick. Sporangia reniform, borne in the axil of the sporophyll, green
turning to yellow when mature, ca.1.3 X 1.2 mm. Spores trilete, radially
symmetrical, foveolate, tetrahedral from the polar view, having a laesura with
three radiating branches near to the equator, ca. 34 X 32 um.

ADDITIONAL SPECIMENS EXAMINED.—T arwaN. Hualien County: Wanrong Township,
Hsilin Village, ca. 200 m alt., 6 Apr 2006, T. C. Hsu 461 (TAIF); same l6c.; $.d.,
Liang-Ru Chang s.n. (TAI).

ErymMo.ocy.—The specific epithetic commemorates the original discoverer of
this species, Liang-Ru Chang. He is an active amateur fern and orchid lover
(Lin et al., 2006).

Nores.—Liang-Ru Chang first found this hanging firmoss in the spring of 2006,
from the type locality at Hsilin Village, Wanrong Township, Hualien County.
The holotype was collected from the trunk of an old Schefflera tree (Schefflera
octophylla (Lour.) Harms) on a cliff beside a valley, at about 200m altitude,
growing with many plants of Vittaria zosterifolia Willd. (Fig. 2A).

After the initial discovery, the first author conducted a long-term, regular
and exhaustive field investigation for P. changii thorough the island during the
field work for his PhD study in 2006-2011 (Hsieh et al., 2007; Hsieh et al.,

HSIEH ET AL.: PHLEGMARIURUS CHANGII FROM TAIWAN 285

A 10cm

Fic. 1. Phlegmariurus changii T. Y. Hsieh. A. Whole plant; B. Abaxial side of sporophyll; :
Adaxial side of sporophyll and sporangium; D. Trophophyll; E. Middle part of stem;
Fertile spike.

2011; Hsieh, 2011). During this period, only three habitats were found. All
three were found at separate locations in lowland of Taitung and Hualien
County, in eastern Taiwan. Unfortunately, all known wild individuals have
since been removed by other collectors. There are two cultivated individuals

286 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

"amps
LEER RE
a COE

Fic. 2. Phlegmariurus changii T. Y. Hsieh. A. Habitat; B. Whole plant; C. Middle part of stem; D.
Fertile spikes; E. Trophophyll; F. Sporophylls; G. Sporangium, SEM microphotograph; H. Spore,
SEM microphotograph.

as far as we know. Given this situation, according to the IUCN (The
International Union for Conservation and Natural Resources) ranking system
(IUCN, 2008), this species should be considered extinct in the wild (EW)
temporarily. We will continue our field investigation for this species and hope
that we can find the individuals of this species in the wild again in the future.
By doing so, we can re-evaluate the conservation status of this species.
Phlegmariurus carinatus is the only species that is morphologically similar
to P. changii. Phlegmariurus changii can be distinguished from species in the

HSIEH ET AL.: PHLEGMARIURUS CHANGII FROM TAIWAN 287

three sections of Phlegmariurus in East Asia., Sect. Phlegmariurus, L. B.
Zhang, Sect. Huperzioides H. S. Kung et L. B. Zhang, and Sect. Carinaturus
(Herter) H. S. Kung et L. B. Zhang. Phlegmariurus changii can be distinguished
from species in both Sect. Phlegmariurus and Sect. Huperzioides by having all
leaves appressed on the stem, imbricate, and pointing towards the apex of the
shoot. This is not the case in the later two groups (Zhang and Kung, 1999;
Zhang and Kung, 2000). Compared to species of Sect. Carinaturus, the leaves
of P. changii are relatively large and flat. By comparison, the leaves of Sect.
Carinaturus are Carinate or raised on the abaxial side, whereas they are but flat
in P. changii. Sporophylls and trophophylls are homomorphic for species of
Sect. Carinaturus (Zhang and Kung, 2000), but dimorphic for P. changii
(Figs. 1B, 1D, 2E, 2F)

ACKNOWLEDGMENTS

We greatly ae Jian-Hong Chen for help with fieldwork; Che-Wei Lin for preparing ge
line drawings; Liang-Ru Chang and Tian-Chuan Hsu for the useful habitat information; and Kua
Ming Hsu for me SEM photos. We also thank Professor Tsung-Hsin Hsieh and two kong
reviewers for commenting on an earlier draft of this manuscript. This study was supported in part
by grants from the Research Center for Biodiversity, Academia Sinica (Taipei, Taiwan) to Ching-I
Peng (HAST) and the Division of Silviculture, Taiwan Forestry Research Institute (Taipei, Taiwan)
to Ching-Te Chien.

LITERATURE CITED

Cuine, R. . eas The taxonomy of Chinese Lycopodiaceae (sen. lat.) II. Acta Botan. Yunnan.
aoe 5B.
Cuinc, R. Z tek The taxonomy of Chinese Lycopodiaceae (sen. lat.) I. Acta Botan. Yunnan.

Cuinc, R. C. 1982. The taxonomy of Chinese Lycopodiaceae (sen. lat.) I-IV. Acta Botan. Yunnan.

4.119-128.
Cuinc, R. C. and C. F. ZHaNc. 1983. New ferns of ree Province. Bull. Bot. Res., Harbin 3:1-55.
FERNANDEZ Prieto, J. A., C. Acuiar, E. Dias, M. D. L. A. F. Casapo and J. Homer. 2008. bie genus

Hup erzia (Lycopodiaceae) in the Azores me Madei ira. Bot. J. Linn. Soc. 158:522—5

Hous, J. 1991. Some taxonomic changes within Lycopodiales. Folia Geobot. Phytotax. oe bL Ok

Hsien, T. Y. 2011. Taxonomy and distribution - indigenous Actinidia in Taiwan. PhD, National
Chung-Hsing University, Taichung, Taiw

Hsien, T. Y., T. C. Hsu, Y. Kono, S. M. Ku and C oes tee nee Payton bambuseti (Gentianaceae), a
new species from Taiwan Botanical gees 48: _—

Hsien, T. Y., S. M. Ku, C. T. Cuten and Y. T. Liou. 2011. Classifi li 1 ical taxonomy
of Actinidia LActinidiscees) in ele. ee Studies 52:337— 357.

Huane, T. C. £. a. (ed.) 1994, Flora of Taiwan, 2nd edition., Vol. 1., Taipei, Editorial Committee of

IUCN. 2008. IUCN Red list categories and criteria: version 7, [UCN—The World Conservation
Union, Gland, Switzerland and Cambridge, United Kingdom
Knapp, R. 2011. Ferns and Fern Allies of Taiwan, KBCC Press.
Kuo, C. M. 1985. Taxonomy and phytogeography of Taiwanese pteridophytes. Taiwania 30:5-100.
Kuo, C. M. 1997. Lycopodium. Rare and Endangered Plants in Taiwan (II), Council of Agriculture,
Tai

alpel
Ls So ay S. Liu, T. P. Huanc, T. Koyama and E. Cuares. 1975. am of Taiwan (1st edn.), Vol. 1,
Pteridophyta and Gymnospermae, Epoch Publishing Compan

288 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

Lin, W. M., L. L. Kuo Huane and T. Lin. 2006. Newly discovered native orchids of Taiwan. Taiwania
51:162.

Ma, C. Y. 1990. New Taxa of genus Phlegmariurus from China. Bull. Bot. Res., Harbin 10:57-16

Meperros, A., W. WaGNER JR and R. Hospy. 1996. A new Hawaiian ake stg peat IE
Phlegmariurus) from the eastern Hawaiian Islands. Amer. Fern J. 86:89-97.

Mook:, S. J. 2000. Lycopodium. Rare and Endangered Plants in Taiwan Se Council of Agriculture,

aipei.
Moore, S. J. 2001. Lycopodium. Rare and Endangered Plants in Taiwan (VI), Council of
eager Taipei.
QOLLGAARD, B. 7. A revised classification of Lycopodiaceae s. Jat. Opera Bot. 92:153-178.
ROTHMALER, - srs Pteridophyten-Studien I. Repertorium novarum specierum regni vegetabilis
5-82

Wacner, W., F. S. Wacner and T. ogee 1995. Taxonomic notes on pteridophytes of Hawaii. Contr.
i —260.

Wacner, W. H. 1993. A New cents for a North American Lycopod. Novon 3:305.
Wacner, W. H. cae J. M. Berre.. 1992. Generic classification of modern North American
Sg pera Ann. Missouri Bot. Gard. 79:676-686.
Wacner, W. H., D. D. Patmer and R. W. Hospy. 1999. Taxonomic notes on the pteridophytes of
Hawaii: II. Contr. Univ. Michigan Herb. 22:135—187.
Yano, C. Y. 1984. A new species of the genus Phlegmariurus from Guangxi, China. Acta Phytotax.
Sin. 22:87-88.
YuMKHAM, S. D. and P. K. Sincu. 2011. Huperzia squarrosa (G. ng Trev. (Lycopodiaceae) in
Manipur: Taxonomy and Biological Aspects. Taiwania 56:157—
ZHANG, L. B. 2004. Phlegmariurus. Flora Reipublicae Popularis pees : 31-54
B. and H. S. Kune. 1999. On taxonomy of Phlegmariurus aged Holub sect.
“Hopersioides H. S. Kung et L. B. Zhang (sect. nov.) with notes a we infrageneric
classification of the genus Phlegmariurus in China. Acta Phytotax. Ss
ZHANG, L. B. and H. S. Kunc. 2000. Two sections of Phlegmariurus (Herter) oe (Huperziaceae)
from China. Acta Phytotax. Sin. 38:23-29.

American Fern Journal 102(4):289-292 (2012)

Lectotypification of Marsilea quadrifolia
L. (Marsileaceae)

Duttio IAMONICO
Laboratory of Phytogeography and Applied Geobotany, Department DATA, Section Environment
and Landscape, University of Rome Sapienza, 00185 Rome, Italy,
e-mail: d.iamonico@yahoo.it

Asstract.—The typification of the binomium Marsilea quadrifolia L. (Marsileaceae) is discussed.
To fix the application of the species name an iconography by de Jussieu is designated as the
lectotype.

Key Worps.—Marsilea, Linnaean names, nomenclature, typification

Marsilea L. (Marsileaceae Mirb.: Salviniales Bartl.) is a genus of approxi-
mately 45-50 species and has a cosmopolitan distribution, although it is
infrequent in cool-temperate regions and oceanic islands (Kubitzki, 1990;
Johnson, 1993; Nagalingum et al., 2007).

Linnaeus published three names under Marsilea (M. minuta, M. natans, M.
quadrifolia; Jarvis, 2007: 657), of which one (M. natans) is now placed in
Salvinia Ség. (Salviniaceae T. Lestib.), as S. natans (L.) All. Of the other two
names, only M. quadrifolia appears not to be typified. It is investigated here.

Typification

Linnaeus’ protologue (Linnaeus, 1753: 1099) consists of a short diagnosis,
with seven synonyms cited from de Jussieu (1740: 263), Guettard (1747: 62),
Bauhin (1623: 362; 1651: 789), Mappus (1742: 166), Morison (1699: 619), and
Matthioli et al. (1586: 853). All these authors (except Guettard, 1747) provided
illustrations that are thus original materials.

Bobrov (1984: 20) indicated the sheet No. 1254.2 at LINN as type. Although
this plant agrees with the diagnosis, the sheet lacks the relevant Species
Plantarum number (‘‘2” in the case of M. quadrifolia) including only the
Linnaean script ‘‘Marsilea quadrifolia.” So, it is to be considered a post-1753
addition to the collection and therefore not original material for the name (see
Jarvis, 2007). According to Art. 9.2 of the ICNB (McNeill et al., 2012) a
lectotype is “*... a specimen ... designated from the original material ...” and,
as reported in the Art. 9.3 “... original material comprises: (a) those specimens
and illustration ( ... published either prior to or together with the protologue)
upon which it can be shown that the description or diagnosis validating the
name was based ...”. So, the choice by Bobrov (1984) is not correct. Johnson
(1986: 35) proposed a de Jussieu collection (No. 1599-A at P-JU) as lectotype,
but this would not have been studied or examined by Linnaeus (see Jarvis,
2007). In fact, although Stearn (1957: 106) reported that Linnaeus received

290 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

Bini Si sare ere eee we“ Cdead. 740. plaS. pag 276 |

hee

M Basseporte del. Sumonneaua Sou

Fic. 1. Lectotype of Marsilea quadrifolia L. (from de Jussieu, 1740, pl. 15).

IAMONICO: LECTOTYPIFICATION OF MARSILEA QUADRIFOLIA L. 291

“many” specimens from de Jussieu, it is very difficult to know which
specimens may have come from the author as there are no explicit annotation
that might indicate this. The collection No. 1599-A at P-JU is therefore not
original material for the name, and thus Johnson’s (1986) lectotypification is
incorrect, too. We have been unable to trace original material in any of the
other Linnaean and Linnaeus-linked herbaria.

All original material (the images cited by Linnaeus from de Jussieu, Bauhin,
Mappus, Morison and Matthioli et al.) clearly show leaves whose blades
(cruciform, consisting of two pair of opposite and sessile leaflets) are the only
feature that marks the Linnaean concept of the species (““MARSILEA foliis
quaternatis’’). de Jussieu’s illustration (1740: pl. 15; see Fig. 1) is the most

lete, showing a large part of a plant (letter “A” in the de Jussieu plate)
including details of two leaves (letters “n’” and ‘‘o’”’) and a series of 11 drawings
(some magnified) of the sporocarps (both entire and in longitudinal or
transversal sections), sori, and spores (letters ‘“B’’ —‘‘m”). This iconography
also agrees with the current application of this name (e.g., Akeroyd, 1993;
Johnson, 1993). Thus, it is here designated as the lectotype for the name
Marsilea quadrifolia.

Marsilea quadrifolia L., Sp. Pl. 2: 1099. 1753. Lectotype (designated here):
Lemma, pl. 15 in de Jussieu (1740: Histoire de Lemma). Fig. 1

LITERATURE CITED

aripeasin J. R. 1993. Marsilea L. Vol. 1, Pp. 31-32, In: T. G. Tutin, V. H. Heywood, D. M. Moo
H. Valentine, S. M. Walters and D. A. Webb, eds. Flora Europaea, ed. 2. Cambridge
eatin Press, Cambridge
Baunin, C. 1623. Pinax theatri botanici. Ludovici Regis, Basileae.
Baunin, C. 1651. Historia Plantarum Universalis 3. Ebro
Bosrov, 3 bi ibe Conspectus filicarum Asiae sodiinas et kee Novosti Syst. Vyssh.

cae a ia Observation sur les plantes 1. Durand, Par
— D. M. 1986. la moe: of the New World species ee ee (Marsileaceae). Syst. Bot.

mogr.

Rone D. M. pony SRS Mirb. Vol. 2, Pp. 331-335, In Flora of North America Editorial
Committee, eds. Flora of North America North of Mexico. Oxford University Press, New York
and Oxford.

Jussieu, B. pe. 1740. Histoire du Lemma. Mém. Acad. Roy. Sci. 1740:263-275.

Kusirzki, K. 1990. Pteridophytes and gymnosperms, Vol. 1, Pp. 1-404, In K. U. Kramer and P. S.
Green, eds. The families and genera of vascular plends. Springer-Verlag, Berlin.

Mappus, M. 1742. Historia Plantarum Alsaticarum. Petrum Mortier, Amstelodami.

Matruiou, P. A., eh Camerario and F. Catceo.ario. 1586. De plantis epitome utilissima. Francoforti

ad M
McNEILL, - won. F. R., Buck, W. R., Demouuin, V., GReuTER, D. L., sp aaadege D. L., HERENDEEN,
APP, S., MARHOLD, PRapo, J., PRoUD’HOMME VAN Reig, W. F., Soitu, J. F. and WierseEMa, J.
a eds. 2012. International Code of Nomenclature for algae, fungi and plants (Melbourne
ode). Regnum Vegetabile 154. Gantner, Ruggell.
eee R. 1699. Plantarum historia universalis oxoniensis 3. Theatro Sheldoniano, Oxonii.

292 AMERICAN FERN JOURNAL: VOLUME 102 NUMBER 4 (2012)

Naca.incuM, N. S., H. ScHNemer and K. M. Pryer. 2007. Molecular phylogenetic relationships and
morphological evolution i in the heterosporous fern genus Marsilea. Syst. Bot. 32(1):16—25.

STEARN, W. T. 1957. An introduction to the Species Plantarum and cognate botanical works of Carl
Linnaeus 1. Ray oa London

American Fern Journal 102(4):293 (2012)

Referees for 2012

All papers submitted to the journal are peer reviewed. Members of the editorial board and the
American Fern Society, as well as additional scientists in cognate areas do these reviews on a
voluntary basis. It is their work that contributes to the high quality of articles in the American Fern
Journal and to its continued success. The American Fern Society and I extend our thanks to the
following reviewers for the assistance, diligence, and patience in the year 2012 (My sincere
apologies if I inadvertently omitted anyone from this list).

NAN CrystaL ARENS CHRISTOPHER H. HAUFLER Ep SCHNEIDER
Curtis ByorK PauLo LABIAK Jim SEAGO
Maria REGINA T. BOEGER OLGA MAartTINEZ EmiLy SEssA
PATRICK BROWNSEY Anby McCati JOANNE SHARPE
SHERWIN CARLQUIST KLaAus MEHLTRETER Kirk STOWE
WEn-LIAN CHIou JORDAN METzGaR Mer SUN
MartHa Cook Rossin C. Moran MICHAEL SUNDUE
IM DuNN NATHALIE NAGALINGUM Wes TEsto
LEY Fiz Joe. Nitra Dori THOMPSON

CHRISTOPHER FRASER-JENKINS JARMILA PITTERMANN OLENA VASHEKA
Jos—E Maria GaprigEL Y GALAN Monica PoNcE MaccigE R. WAGNER
JENNIFER GEIGER JEFFERSON PRADO James E. WATKINS, JR.

RY GREER KAREN RENZAGLIA DEAN WHITTIER
G.A. bE Groot Car. ROTHFELS MicHAEL WINDHAM
AMANDA GrRuUSz GERMINAL ROUHAN LIBING ZHANG

Statement of Ownership, Management, and Circulation

Publication title and number: American Fern Journal (0002-8444). Date
of filing: September 4, 2012. Frequency of issue: quarterly. Annual
subscription price 2012: $25.00. Office of Publisher: c/o Missouri Botanical
Garden, P.O. Box 299, St. Louis, MO 63166-0299. Editor: Jennifer Geiger.
The American Fern Journal is wholly owned by the American Fern
Society, Inc., with no bond holders. Physical address of the Society: c/o
Missouri Botanical Garden, 4344 Shaw Blvd., St. Louis, MO 63110. The
purpose, function, and nonprofit status of the Society and its tax exempt
status for Federal income tax purposes remains the same as in past years.
The average press run for Volume 102 is 800, and was 800 for the issue
appearing immediately prior to the filing date, for which 712 copies were
mailed as paid circulation and 0 copies were mailed as free distribution,
leaving 88 copies for office use and back-issues sales. I certify that these
statements are correct and complete. Georce YATsKIEVycH, Membership
Secretary of AFS.

Table of Contents for Volume
(A list of articles arranged alphabetically by author)

AHAD, BuRHAN, ZAFAR A. RESHI, AND AyAz H. Ganate. Azolla cristata in the Kashmir

BUR a ee iain tis os hs oo I op ee ek
AADENCAR De Muinezes; 1 Ro (See T.-M: DE SOUZA)” fee ieee ee
pment) 0 ea We OA AA on oo a sas oc wee bee ene
BANDYOPADHYAY> Mic (SCG oe DAS) oy ce ee ois cris ava Mena es (Aras

BENNIAMIN Dr. A. AND CHRIS FRASER-JENKINS. Obituary: The Rev. Father Dr. V. S.
DAAC th, 1 UE ois ow ke ea eee eee ee eras

BORA S ESGG BO DAS) ee ee ee ee er i es ae re os

BirAL, LEONARDO AND JEFFERSON Prapo. First Record of Pellaea ovata (Pteridaceae)
Cre PN oy ie shred Ge a ok os Fa A a ee

Tet An, Cer A, Oe SOUSAL feos SR aaa Ce ee wp aoe Da ae ee ee
BRAGA MAP M4. tSee 1, ME me SOUZAD oo ee eed ooo hs es
Bueno, D.C) (See T. Mi) tie SOUDAT 5s se aa iS is ee

CaRLQUIST, SHERWIN, EDwarD L. SCHNEIDER, AND KEvIN F. KENNEALLY. SEM Studies on
Tracheids of Lycopodiaceae; Observations on Adaptations in Phylloglos-

CARVALHO, FERNANDA ANTUNES, ALEXANDRE SALINO, AND CHARLES EUGENE ZARTMAN. New
Country and Regional Records from Brazilian Side of Neblina Massif ....

Cyan, YM. (See TV. Fis) sc a ee ess i a
CHENG; (See KM. ARANG) i ec a
(GHUNG, J: Ma (See M: Ys CHUNG) Ge eee a ee ey

CuuNG, Mi Yoon, Jorpr Lopez-PujoL, JAE MIN Cuunc, KiI-Joonc Kim, AND Myonc Gi
Cuunc. Low Within Population Genetic Variation and High Among
Population Differentiation in Cyrtomium falcatum (L.f.) C. Pres] (Dryop-
teridaceae) in Southern Korea: Inference of Population-Establishment
Be ee es vos bia ees ceases ae eee

Ciera a, ty. WE Eee 1 A Oe SAD a ho a ees
GosTa, J. <3, Mo tee BL Fo B. MORAIS-DRAGA) 6.0 ip ce vies
OUTINEO, FL DOME. (Seo EF Me pe SOUZA) eis oie ee ee
Courma, 1, DM (Gee MF. 3. MamAIs-BRAGA) (cc. oi i ooo ee eek ee wee es
mA Roca, 7. 6. TY. Goem To Me. te Sea oe oes ech ne a weece dni aie ek

Das, SAYANTANI, MAUMITA BANDYOPADHYAY, AND Suir Bera. Optimization of Protocol
for Isolation of Genomic DNA from Leaves of Selaginella Species Suitable
for RAPD Analysis and Study of their Genetic Variation ...............

294

Te ARIAS; A ee 1. 6G Pe SOUZA) io ae a

DE Souza, TEOGENES, M., Maria F. B. M. Braca, Rocério A. SarRaIvA, PABLO A.
Nocara, Diones C. Bueno, ALINE A. BOLIGON, MARGARETH L. A. Fone, JoAo B.
T. DA Rocua, Miriam RoLon, CELESTE VEGA, ANTONIETA Rojas DE ARIAS, JOSE G.
M. Costa, IRwIn R. ALENCAR DE MENEzES, HENRIQUE D. M. CouTINHO AND
Antonio A. F. Saraiva. Cytotoxic and Tripanocide Activities of Pityro-
grammoa calomelanos (L.) Links 23.35

DeVo, J. A. (See G, K, Gam) ea ee ae se

Diamonp, Hope L., HEATHER R. JONES, AND Lucinpa J. SwatzeLL. The Role of
Aquaporins in Water Balance in Cheilanthes lanosa (Adiantaceae)
Gemetophytes: isis ee ee

Dermucn, M.A. (See G. K: Games) ee

Donc, Yuan-Huo, Qinc-FencG Wanc, AND Rosert Waniti Giruru. Effect of Habitat
Modification on the Distribution of the Endangered Aquatic Fern
Ceratopteris pteridoides (Parkeriaceae) in China ...................000-

DRTA, BS. 1b00 Ro GHANTAD iso is ee ee a ee
Pang, Y: Mi. (See K. Mi aa) ee
FONE, Mi LA. See Ti re Soma) oe a ee
Drage jomans, ( (See Dn. A. BEnnAMIN): 62... os ec se

GapRIEL Y GALAN, Jose Maria and Carmen Prana. Farina Production by Gameto-
phytes of Argyrochosma nivea (Poir.) Windham (Pteridaceae) and its
Implications for Cheilanthoid Phylogeny «.:...........2 06 ..665e ee cee

Sram A Te (Oe AAI a

GuHanTA, REBECA, SIKHA Dutta, AND RADHANATH MUKHOPADHYAY. Occurrence of Dark
Septate Endophytes in the Sporophytes of Christella dentata ..........

Gi Conc, Mi iSee MY tines) a
Coruna, K. Wo (S6e Vite as) eo
Gonaz-Domorcurz, H, (See M. A. Pérez-FARRERA) ooo 56 oo kc occ cd oe eee ctcecssscae,

Greer, Gary K., Marcaret A. Dierricu, JosepH A. DeVo, AND Apri REBERT. The Effects
of Exogenous Cytokinin on the Morphology and Gender Expression of
CRIN Pel CREO i oes so os eek ec bees sc ohh sede cbecs

Roses, Gr, A. A Soe A PL Mia ea) ie ea
BERTON, We. ac EE ot, PRD sa os ooo iv ov hak coc nbe baeeecs
PUBATAMA, F.C GSO ke oe ei i ee, ok ee a,
FROSHIPARL, FCW): GG. VANGURBAP Oo 55 oo oe oe ee oe is Se ier:

HsteH, Tunc-Yu, Kent A. Hatcu, Yuan-Mou Cuanc. Phlegmariurus changii
(Huperziaceae), a New Hanging Firmoss from Taiwan .................

295

Tamonico, DuiLio. Lectotypification of Marselia quadrifolia L. (Marseliaceae) ....
JAGCONG, Co . (S00 WM Warrren) ooo. as SoBe Cd ee
JONES, FL RR See FL DIAMOND) © oe ck oe es ok ee oe ee

KaMACHI, HIROYUKI AND MuNENoRI Nocucui. Negative Gravitropism in Dark-Grown
Gametophytes of the Fern Ceratopteris richardii ................00e000:

RT ee es 5 os cb eels See ae ee
EAA re I oie eee eee ee

Kuouia, B. S. Botrychium simplex E. Hitchcock: a New Moonwort for the Indian
PUA AC a i ck ce vas aes oe nee ea

KieLinc-Rusio, Maria, A., AND Pauto G. WinpiscH. Elaphoglossum montanum, a
New Species rom Souther Brasil: 5.00.55. oa a ea

tea, Bork, Ce ee wee eran be tk pave eee k an
LaApIAK, F370 |B Perma) ne ese cas bk cee vin a-chGs ves bape denen

Lasiak, PAULO H., A New Species and a New Hybrid in the Grammitid Fern Genus
URTIONTORIREIA (POLY OCIBCORE c's /560.5 55 nc eo wien 9 ban dw pe aoe do sin's Ca

Rs oe i ec ae oy ed se de a ape we
LLOPEZ-MOLINA, IVIASE. (500 M.A. PEREZ-FARRERA) {202 eck oes ce cb nce bas ba eee
TiPEE FOIL Ae Oe te ING a ee
RCMSCTIRT ET ac 1 Ce PA as cis nv aevin econ wa ok poet con ken bucwes

Macrini, SARA AND ANNA ScoppoLa. Agravitropic Growth of the Early Leaves of
Apogamous Sporophytes of Dryopteris tyrrhena ............0.eeee eee

Martinez, Ouca, G., AND IcNacio Vite. The Structure of Petioles in Pteris
(Piovidacene) 5 a

MartTiNez-MELENDEZ, N. (See M. A. PEREZ-FARRERA) .......00cccccceececeeeceecees
Maros, F..B. (See CM. MYNSSENY (52060
Menezes, |. R.A. (See M. F; B: Monais-Baaca) 2.) .. ce ce a
Morais-Braca, M. F. B., T. M. Souza, K. K. A. Santos, J. C. ANDRADE, G. M. M.
Guepes, S. R. Tintino, C. E. Soprat-Souza, J. G. M. Costa, I. R. A. MENEzEs, A.
A. F. Saratva, AND H. D. M. Coutinno. Antimicrobial and Modulatory
Activity of Ethanol Extract of the Leaves from Lygodium venustum SW.
Moran, Rossin C., The Life of Barbara Joe Hoshizaki (1928-2012) ..............
Musmorapnyay, R: (See BR: GHANTAY 5 ois i wi as oh ee es
MynssEN, CLAUDINE M., AND FERNANDO B. Matos. Diplazium fimbriatum (Athyr-
iaceas), a New Species frown Brazil. 6... cee ieee ei

Nacauncum, N.S, (See W. MM. Wairtes) 0 ee a a

NOGARA, T1000 1. WE DE ROUTA) cic 198
NocuttH, Di. (500: Fi. KAMACH) ois cos fos Sic db oe ol ore 147
PEREIRA, JOVANI B., PauLo G. WinpiscH, Maria L. LORSCHEITTER, AND PAULO H. LaBIAK.
Isoétes mourabaptistae, a New Species from Southern Brazil ........... 174
PEREZ-FARRERA, MiGuEL A., Ma. EVvANGELINA LOpEz-MoLINA, NAayYELY MaArtiNEz-
MELENDEZ, AND Héctor GoOmeEz-Domincugz. New Records Of Ferns From

COUSDAR, MAGKICD <cicsn ses dns veda eee eohvewe ei biiee ek 6-205 1s dea 228
PRADA, ©. (Seo J. Mi. Gappn ¥ GALAN) on oe oes a 191
PRADO, Fee BRAL oi ee A eee ee ee 83
PRYER, KATHLEEN M., The Distinguished Legacy of DMB: Donald MacPhail Britton

PEGE POCULEL cceu luis ssucenvirressyi ct ee 241
ea, A ee he en ee. 32
Reon, 2. A. (S00 BD. AWAD) o.oo yok bleeds cas bo sacs ee 224
BOL) Mi iSee. TM. pe SouzA) . fee os a a 198

RotHFELs, C. J., E. M. Sice., AnD M. D. WinpHam. Cheilanthes feei T. Moore
(Pteridaceae) and Dryopteris erythrosora (D.C. Eaton) Kunze (Dryopter-

idaceae) New for the Flora of North Carolina .................e.eceeue- 184
Satna, A. (See FA Cavalera 228
Santos, Bk. A. (Seu MF. B. Momars-Decca): 20 154
DARAIVA, 7a A. F. (S00 'T; Mo ne Sousa) 198
Saraiva, A. A. Fo (S00 M. Fo RB. Monac-Baaca) 3. oc 154
SARAIVA, B.A, (See To M. pe SOUSA) oo os. rere ee 198
mcr cL. (see 8: Capote) oe a 273
COPPOLA, A. (See 5, MAGN ..5 05.6 181
mace, EM. (See C.. 3. Roriegis) oe 184
NOBRAL-SOUZA, ©. KE. (S00 M. PF. B. Mopars-BrAGal 2... ois ioe ieee 154
Souza, Ti, (Seem Fon, Moss Beical oo 154
Ae ek em i ick ck a +11
Unt, oo. Me, LO A AIO-RAGAY Ce ecb es 154
TsutsuMI, C., Y. Hirayama, M. Kato, Y. YatTaBE-KAKUGAWA, AND S.-Z. ZHANG.

Molecular Evidence on the Origin of Osmunda x mildei (Osmundaceae) 55
Wie OF 1h: (ee BAL Witte es, 198
wees, C. (508 7: MM. vb SOUZA) o.oo ee 91
Ware (ome OO Marin cc 4

Weare 47. Gon Yai De oe ec ac chev coco bes eee ds ee ees

White, RicHARD A., AND MELvIN D. Turner. The Anatomy and Occurrence of Foliar
WNecterias In Grithed (Cyatiioacege) 5 ci. 6c eis) cove cdvevedstysecceiges

WhiTTEN, W. Mark, Couette C. JAcONo, AND NATHALIE S. NAGALINGUM. An Expanded
Plastid Phylogeny of Marsilea with Emphasis on North American
SOEMMOW Fis cas Kees CANOE Ue cae Vow a Een bey ee WEE CEN

Mine, WA Et i 0D IL sa os vk ve hk a oo do wk a ees
emia Tt. Tae BAL A. RING UO) ek 6 a i Cc hv Chae
Wenn. Fis (See FB Pe a a i ee GS

YansurA, DANIEL G., AND BarBara J. Hosuizaki. The Tree Fern Highland Lace is a
Saltiver of Spliaeronteris cooperl ees ieee ce ee de

VATABE-KAKUGAWA; Y. [Se ©. TSUTSUMI 652 6a 5 ees re
ZNRIMAN: GP (S00 FcAOCARVAIHO) cog ee ee ee ee
Si Ge, FAO Bi. GANG) seis oe as oe ee
Pritt, 3c (ee Bo ZAG ie ee a eee
PA, So mie, Leo CP AIYORM ee Co ee eee

ZHANG, K. M., J. H. Liu, X. CHENG, G. F. ZHANG, Y. M. Fane, AND H. J. ZHANG. Effects
of Ageratina adenophora on Spore Germination and Gametophyte
Development of Neocheiropteris palmatopedata ...........+..0+eeeees

Volume 102, number 1, January—March, pages 1—90, issued 21 June 2012
Volume 102, number 2, April-June, pages 91-190, issued 17 July 2012
Volume 102, number 3, July-September, pages 191—240, issued 15 October 2012
Volume 102, number 4, October-December, pages 241-298, issued 4 April 2013

INFORMATION FOR AUTHORS

Authors are encouraged to submit manuscripts pertinent to pteridology for publication
in the American Fern Journal. Manuscripts should be sent to the editor at hauk @deniso
edu. Acceptance of papers for publication depends on merit as judged by two or more ref-
erees. Authors are encouraged to contribute toward publishing costs; however, the payment
or non-payment of page charges will affect neither the acceptability of manuscripts nor the
date of publication.

Authors should adhere to the following guidelines; manuscripts not so prepared may be
returned for revision prior to review. Electronic submission is strongly ged; how-
ever if it is necessary to submit hard copy, please submit one copy of the manuscript and
include a review copy of illustrations and originals of illustrations. After acceptance, please
submit final versions of manuscripts via FTP (contact the managing editor for instructions),
email, or on diskette or CD ROM (see below for figure formatting). If submitting hard
copies, use standard 8.5 by 11 inch paper of good quality, not “erasable” paper. Double-
space manuscripts throughout, including title, author’s names and full addresses, a short,
informative abstract, key words, text (including heads and keys), literature cited, tables
(separate from text), and figure captions (grouped as consecutive paragraphs separate from
figures). Arrange parts of manuscript in order just given. Include author’s name and page
number in the upper right corner of every sheet, and provide an abbreviated running title.
Provide margins of at least one inch (25 mm) all around on typed pages. Do not submit
right-justified text, avoid footnotes, and do not break words at end of lines. Make table
headings and figure captions self-explanatory. Use S.I. (metric) units for all measures (e.g.,
distance, elevation, weight) unless quoted or cited from another source (e.g., specimen
citations). For nomenclatural matters (i.e., synonymy and typification), use one paragraph
per basionym (see Regnum Veg. 58:39-40. 1968). Abbreviate titles according to Botanico-
Periodicum-Huntianum (Lawrence et al., 1968, Hunt Botanical Library, Pittsburgh) and its
supplement (1991). References cited only as part of nomenclatural matter are not included
in literature cited. For shorter notes and reviews, omit the abstract and put all references
parenthetically in text. Use Index Herbariorum (Regnum Veg. 120:1-693. 1990; or http://
websun.nybg.org/bsci/ih/) for designations of herbaria. For more detailed instructions on
manuscript preparation, see http://amerfernsoc.org/.

Illustrations should be proportioned to fit page width (5 inches or 12.5 cm) with caption
ultimately to be included on the same page. Halftone and color images should be scanned
at a minimum of 300 pixels per inch (ppi). Line art should be scanned at 1200 ppi when-
ever possible. Please note that nearly all images that are downloaded from the Internet or
that are in JPEG or GIF format will be 72 dpi and not acceptable for the printing process.
Indicate the file format of the graphics. Please submit image files in TIFF (preferable) or
EPS format. Provide margins of at least 25 mm on all illustrations. For continuous-tone
illustrations, design originals for reproduction without reduction or by uniform amount.
In composite blocks, abut edges of adjacent photographs. Avoid combining continuous-
tone and line-copy in single illustrations or blocks. Coordinate sequence and numbering
of figures (and tables), with order of citation in text. Explain scales and symbols in figures
themselves, not in captions. Include a scale and reference to latitude and longitude in each
map.

g eR Ree, : ee 1 Ss

£, -

proofs to the editor and

2s T ee het £. ital by 7
by the printer. Authors should send proof corrections of corrected
eS ee Pe aa FP aoy * Sy Pe) ae en te r a
o

after type has been set. a
For other matters of form or style, consult recent issues of the American Fern Jour-

nal and The Chicago Manual of Style, 14° ed. (1993, Univ. of Chicago Press, Chicago).

Occasionally, departure from these guidelines may be justified. Authors are encouraged to

consult the editor for assistance with any aspect of manuscript

Papers of longer than 32 printed pages may be sent to the Editor of Pteridologia (memoir 2 oe

s _ Editor, see journal cover page 2).

PTERIDOLOGIA ISSUES IN PRINT

The following issues of Pteridologia, the memoir series of the American Fern Society,
are available for purchase:

1. Wagner, David H. 1979. Systematics of Polystichum in Western North America
North of Mexico. 64 pp. $10.00 plus postage and handling.

2A. Lellinger, David B. 1989. The Ferns and Fern-allies of Costa Rica, Panama, and
the Chocé (Part 1: Psilotaceae through Dicksoniaceae). 364 pp. $32.00 plus postage and
handling.

3. Lellinger, David B. 2002. A Modern Multilingual Glossary for Taxonomic Pteri-
dology. 263 pp. $28.00 plus postage and handling.

14. Hirai, Regina Y., and Jefferson Prado. es —— of Moranopteris (Poly-
podiaceae). 113 pp. $28.00 plus postage and handlin

For orders and more information, please contact our authorized agent for sales at:
Missouri Botanical Garden Press, P.O. Box 299, St. Louis, MO 63166-0299, tel. 314-577-
9534 or 877-271-1930 (toll free). For online orders, visit: http://www.mbgpress.org.

FIDDLEHEAD FORUM
The editor of the Bulletin of the American Fern Society welcomes contributions from
members and non-members, including miscellaneous notes, offers to exchange or purchase
materials, personalia, horticultural notes, and reviews of non-technical books on ferns.

SPORE EXCHANGE
Mr. Brian S. Aikin, 3523 Federal Ave, Everett, WA 98201-4647 (spores.afs@comcast.
net), is Director. Spores exchanged and lists of available spores sent on request. http://
amerfernsoc.org/sporexy.html

GIFTS AND BEQUESTS

Cis fen Ah te trth 4 h nod ¢,
Y enable itt

interested in ferns. Back issues of the Journal and cash or other fe are always welcouicl
and are tax-deductible. Inquiries should be addressed to the Membership Secretary.

VISIT THE AMERICAN FERN SOCIETY’S

WORLD WIDE WEB HOMEPAGE:
http://amerfernsoc.org/