(navigation image)
Home American Libraries | Canadian Libraries | Universal Library | Community Texts | Project Gutenberg | Children's Library | Biodiversity Heritage Library | Additional Collections
Search: Advanced Search
Anonymous User (login or join us)
Upload
See other formats

Full text of "1985 Annual Report-Joint Committee on Administrative Rules, Illinois General Assembly"

Digitized by the Internet Archive 

in 2012 with funding from 

CARLI: Consortium of Academic and Research Libraries in Illinois 



http://archive.org/details/1985annualreport00illi 



April 
1986 



1985 



ILLINOIS STATE LIBRARY 

JUN 5 1986 
ILLINOIS DOCUMENTS 

ANNUAL 

REPORT 

TO THE 

ILLINOIS 

GENERAL 

ASSEMBLY 



JOINT 
COMMITTEE 

ON 
ADMINISTRATIVE 
RULES 




JOINT COMMITTEE ON ADMINISTRATIVE RULES 

ILLINOIS GENERAL ASSEMBLY 



CO-CHAIRMEN 
EN. TED LECHOWICZ 
EP. SAM VINSON 

VICE-CHAIRMAN 
EN. PRESCOTT E. BLOC 

SECRETARY 
EP. MONROE L. FLINN 




509 S. SIXTH STREET • ROOM 500 

SPRINGFIELD, ILLINOIS 62701 

217/ 785-2254 



HOUSE MEMBERS 
MICHAEL CURRAN 
ELLIS B. LEVIN 
AT. "TOM" MCMASTER 
MYRON J. OLSON 

SENATE MEMBERS 

LAURA KENT DONAH 
EMIL JONES, JR. 
JEREMIAH E. JOYCE 
DORIS C. KARPIEL 



HONORABLE MEMBERS OF THE 84th GENERAL ASSEMBLY 



Ladies and Gentlemen: 

We respectfully submit the 1985 Annual Report of the Joint Committee on 
Administrative Rules for your consideration. This report, as mandated by 
Section 7.10 of the Illinois Administrative Procedure Act (III. Rev. Stat. 1983, 
ch. 127, par. 1007.10) contains the "findings, conclusions, and 
recommendations, including suggested legislation," issued by the Committee 
throughout 1985. 

As the Co-Chairmen of the Joint Committee, we have witnessed the continued 
progress which the oversight process has made toward ensuring that 
government policies are. open and available to the public. Like the Illinois 
Open Meetings Act and the Illinois Freedom of Information Act, the Illinois 
Administrative Procedure Act is designed to guarantee that the public's right 
to know is protected, and that public business is conducted in the daylight of 
public scrutiny. 

Through the Joint Committee on Administrative Rules we, as elected 
representatives, are provided an opportunity to oversee and directly influence 
the content of rules and regulations which affect the citizens of Illinois. The 
Joint Committee also works to ensure fairness in agency actions by 
encouraging agencies to state their policies in uniform rules which are applied 
equally to everyone regulated. 

In addition to its other oversight functions, the Joint Committee presents its 
legislative agenda to the General Assembly each year. These bills are the 
result of problems with rules or policies which the Committee has determined 
will best be remedied through legislation. Also included in the Committee's 
legislative package is a proposed amendment to the Illinois Administrative 
Procedure Act which further clarifies and defines the rulemaking process. 
Our thanks to all of you who either supported or sponsored the Committee's 
recommended bills for 1985. The continued success of our legislative agenda 
is essential as we seek to strengthen and develop the oversight role. 



3 1129 00351 2175 



We encourage all members of the 84th General Assembly to take an active part 
in this vital oversight function. We welcome your suggestions and comments 
on specific agency rules as well as on the development of the role of the Joint 
Committee. Cnly as each of us as elected representatives becomes concerned 
and involved in the oversight process can the Committee, acting on your 
behalf, ensure that the intent of the legislation which we pass is upheld. 



Respectfully 




Senator Ted Lech 



Representative Sam Vinson 



Co-Chairmen, Joint Committee on 
Administrative Rules 



020:ar85 



J^TfltU 1985 ANNUAL REPORT 

/^ - TABLE OF CONTENTS 



Paae 



List of Tables iv 

SECTION ONE: Joint Committee Activities 

Introduction 1 

Review of General Rulemaking 7 

Review of Emergency Rulemaking 25 

Review of Peremptory Rulemaking 35 

Five Year Review 39 

Complaint Review Program and Review of Existing Rules 47 

Publications of the Joint Committee on Administrative Rules ... 71 

Court Decisions 75 

SECTION TV/0: Specific Statements of Objection and Recommendation 

Introduction 85 

1985 Objections and Recommendations to General Rules 87 

1985 Objections and Recommendations to Emergency Rulemaking. . 147 

1985 Objections and Recommendations to Peremptory Rulemaking . 157 

1985 Objections and Recommendations Issues Pursuant to 

the Five Year Review 159 

1985 Objections and Recommendations to Existing Rules 165 

SECTION THREE: Legislative Activity 

Legislative Package for 1986 173 

1985 Legislative Activity 439 

APPENDIX A: History of the Joint Committee on Administrative Rules 

and the Illinois Administrative Procedure Act .... 447 

APPENDIX B: Illinois Administrative Procedure Act 463 



LIST OF TABLES 



TABLE 1 Organization Chart 

TABLE 2 General Rulemaking by Agency 1985 

TABLE 3 Statements of Objection and Recommendation 

Issued in 1985 to General Rulemaking 

TABLE 4 Objections to General Rulemaking by Type .... 

TARLE 5 Emergency Rulemaking by Agency 1985 

TABLE 6 Statements of Objection and Recommendation 

Issued in 1985 to Emergency Rulemaking 

TABLE 7 Objections to Emergency Rulemaking by Type. . . 

TABLE 8 Peremptory Rulemaking by Agency 1985 

TABLE 9 Statements of Objection and Recommendation 

Issued in 1985 to Peremptory Rules 

TABLE 10 Statements of Objection and Recommendation Issued 

in 1985 to Rules as a Result of Five Year Review . 

TABLE 11 Statements of Objection and Recommendation 

Issued in 1985 to Existing Rules 

TABLE 12 83rd General Assembly Public Acts Which May 

Require Rulemaking 

TABLE 13 84th General Assembly Public Acts Which May 

Require Rulemaking 

TABLE 14 Comparison of General Rulemaking by Agency 

1978 through 1985 

TABLE 15 Comparison of Emergency Rulemaking by Agency 
1980 through 1985 

TABLE 16 Comparison of Peremptory Rulemaking by Agency 
1980 through 1985 

TABLE 17 Comparison of Agency Responses to Objections 

1978 through 1985 



Page 

6 
18 

20 
22 
31 

32 
33 
37 

38 

45 

52 

55 

56 

453 

458 

460 

461 



019 



SECTION ONE 
JOINT COMMITTEE ACTIVITIES 

Introduction 

The Joint Committee on Administrative Rules was created in 1977 by the 
Illinois General Assembly as a mechanism for uniform oversight of the 
rulemaking process in Illinois. The role of the Joint Committee is best 
described in Section 7.04(1) of the Illinois Administrative Procedure Act: 
"The function of the Joint Committee shall be the promotion of adequate and 
proper rules by agencies and an understanding on the part of the public 
respecting such rules." This statement established two major responsibilities 
for the Joint Committee which have remained intact throughout its history: 
(1) working with State agencies to improve the rulemaking process and 
agency rules, and (2) promoting public understanding of the rulemaking 
process and of the rules themselves. 

Members of the Joint Committee are appointed by the House and Senate 
leaders for a term of two years. Appointments are made in January, with 
officers elected by the members of the Joint Committee in February of each 
odd numbered year. Section 1-5 of the Legislative Commission Reorganization 
Act (III. Rev. Stat. 1984 Supp., ch. 63, par. 1001-5) outlines the Committee 
appointment procedures as well as those used for filling Joint Committee 
vacancies. 

The involvement of the Joint Committee in the day-to-day operations of the 
Joint Committee's staff has proven essential to the overall effectiveness of the 
oversight process. Legislative oversight activities, more frequently than not, 
take a back seat to the more visible and personally rewarding issues dealt 
with by the legislator. Nevertheless, legislators have found that by utilizing 
the oversight process they are better able to represent their constituents 
while having an impact on government operations which directly affect the 
people of the State of Illinois. 

Legislators who were appointed or reappointed to the Joint Committee during 
1985 are: 



- 1 - 



Appointed by the President of the Senate: 

Senator Emil Jones 
Senator Jeremiah E. Joyce 
Senator Ted Lechowicz 

Appointed by the Senate Minority Leader: 

Senator Prescott E. Bloom 
Senator Laura Kent Donahue 
Senator Doris Karpiel 

Appointed by the Speaker of the House: 

Representative Michael Curran 
Representative Monroe Flinn 
Representative Ellis Levin 

Appointed by the House Minority Leader: 

Representative Tom McMaster 
Representative Myron Olson 
Representative Sam Vinson 

The officers of the Joint Committee are elected to serve two year terms. The 

officers handle the business operations of the Joint Committee, including 

serving as the Personnel Committee for evaluating employee performance. 

Officers for the Joint Committee are: 

Co-Chairmen: Senator Ted Lechowicz 

Representative Sam Vinson 

Vice-Chairman: Senator Prescott E. Bloom 

Secretary: Representative Monroe Flinn 

The Joint Committee staff is headed by an Executive Director who is selected 
by the Joint Committee on Legislative Support Services. The Executive 
Director is charged with the overall development, management, and operation 
of the staff of the Committee. The Director is assisted by two Deputy 
Directors, who each work in one of the Committee's Divisions. The Rules 
Review and Compliance Division is responsible for the review of proposed ana 
existing rules. The Policy, Planning and Administration Division investigates 
complaints, develops and monitors legislation, compiles special Joint Committee 
projects and plans, and implements Committee organizational policies and 
objectives. Approximately one-half of the professional staff are attorneys 



with the remainder as subject area specialists with such disciplines as social 
services, administration, policy analysis, political studies and public 
administration. Table One illustrates the organization of the Joint Committee 
staff. The Joint Committee's two responsibilities are accomplished through 
several integrated review programs. 

1. REVIEW OF GENERAL RULEMAKING. 

Each new rule, amendment to an existing rule and repeal of an existing rule 
proposed by a State agency is reviewed by the Joint Committee. This 
review, which must be accomplished within a strict 4S day time period, is 
primarily intended to ensure that new rulemaking proposals are within the 
agency's statutory authority and are legally proper and meet the procedural 
requirements of the Illinois Administrative Procedure Act. 

2. REVIEW OF EMERGENCY AND PEREMPTORY RULEMAKING. 

Emergency and peremptory rules are not required by the Illinois 
Administrative Procedure Act to be published in the Illinois Register for 
public notice and comment prior to becoming effective. The Joint Committee, 
however, firmly believes that due to the fact that these rules are not subject 
to the public comment period they must, therefore, be carefully reviewed in 
order to ensure that they comply with the statutory constraints that are 
placed upon them. 

3. FIVE YEAR REVIEW OF ALL EXISTING RULES. 

The Illinois Administrative Procedure Act requires the Joint Committee to 
conduct a systematic review of all existing rules of State agencies, regardless 
of when the rules were adopted. Rules reviewed during this process are 
grouped by topic, rather than by agency. This program complements the 
review of proposed rulemakings by providing an examination of rules by 
subject area to reduce areas of conflict and overlap between rules, and to 
eliminate obsolete rules. 

H. COMPLAINT REVIEWS. 

Formal complaints from the public concerning State agency rules may be 
submitted to the Joint Committee for investigation and possible action. 
Typically, these complaints allege that a rule is unauthorized or unreasonable, 
and result in a serious impact on the affected public. In certain instances, 

- 3 - 



the Joint Committee may issue a formal objection in response to a complaint. 
In addition to formal complaints, the Joint Committee staff is available to 
answer questions raised by members of the public regarding rules or the 
rulemaking process. 

5. PUBLIC ACT REVIEW. 

The Joint Committee reviews each new public act in order to determine the 
necessity for new or amendatory rulemaking. Each agency is informed in 
writing of any public act which affects the agency and which may require 
rulemaking. The Joint Committee monitors each agency response in order to 
ensure that all public acts are implemented and promptly translated into rules 
whenever necessary. 

It is with the public in mind, that the Joint Committee staff has drafted the 
1985 Annual Report. This report, as well as the previous yearly reports, 
serves as a research tool of the oversight process. The 1985 Annual Report 
has been divided into three sections and several appendices. Section One, 
pages 1-82, contains a narrative of the Joint Committee's activities for 1985, 
as well as a statistical summary of rulemaking actions taken by State 
agencies. Tables present the statistical breakdown by agency and the type 
of rulemaking action that was taken. 

Summaries of the formal statements of objection and recommendation issued by 
the Joint Committee during 1985 can be found in Section Two, pages 
85 - 171 . These statements were published in the Illinois Register at the time 
they were were issued and are organized in this report by agency along with 
background information relating to the history of the rulemaking. Section 
Three, which begins on page 173, includes the legislation recommended by the 
Joint Committee for consideration during the 1986 appropriation session of the 
84th Ceneral Assembly. In addition, a summary of the Joint Committee 
drafted and sponsored bills which were passed by the 84th Genera! Assembly 
and which have become law during the substantive session have been included 
in this section. All Joint Committee legislation is the result of the review of 
agency rules. 



4 - 



Appendix A, pages 447 - 461 , contains a historical overview of the Joint 
Committee as well as pertinent statistics of Joint Committee activity throughout 
the years. 



007:ar85 



5 - 



-2 




£ 














1 


p 




i/l eg 

5 


— 


-" 











I 



* 




fc 




En 


g 




>; 




> 


£ 




| 




| 












h- 




*l 




"1 




^ 




k) 













—si —a 



i] 



-il 









REVIEW OF GENERAL RULEMAKING 

The Joint Committee reviewed 538 general rulemakings promulgated by state 
agencies during 1985. An average of 39 proposals was considered by the 
Committee at each of its monthly meetings. The Committee issued 128 formal 
objections to 78 of the proposals, and 73 recommendations to 56 general 
rulemakings (see TABLE 3, pages 20-21). The Joint Committee's review 
resulted in changes to virtually every proposal. Changes varied from minor 
drafting and editing revisions to extensive, substantive rewrites of agency 
rules. 

As seems to be the pattern, the level of rulemaking considered by the Joint 
Committee has once again been high. This section discusses the general 
rulemaking process, the criteria used by the Committee in evaluating rules, 
and a summary of some of the significant rulemakings considered by the 
Committee, as well as objections and recommendations issued by the Committee 
in 1985. 

General Rulemaking Process 

Section 5.01 of the Illinois Administrative Procedure Act governs the general 
rulemaking procedures of state agencies. General rulemaking is all 
rulemaking which is not: (1) related solely to interna! agency management, 
(2) an emergency rulemaking as defined by Section 5.02 of the Act, or (3) a 
peremptory rulemaking as defined by Section 5.03 of the Act. 

Section 5.01(a) of the Act sets forth specific requirements governing how 
first notices must appear in the Illinois Register . Among other things, the 
agency is required to publish the full text of the proposed rule, amendment, 
or the material to be repealed. There are also requirements relative to 
public comment by which the agencies must abide when submitting first notice 
material for the Illinois Register . 

Agencies are required to give at least 45 days' notice of their intended 
rulemaking action to the general public. This period of time is referred to as 
the "first notice" period. The first notice period begins on the day that the 
notice of a general rulemaking appears in the Illinois Register . 



The primary purpose of the first notice period is to provide an opportunity 
for comment by members of the public when they are affected by a general 
rulemaking. Each first notice contains information as to the time, place and 
manner in which persons may comment upon the rulemaking. By law, 
agencies are required to consider all public comments received within the first 
14 days after the first notice period has commenced. In addition, agencies 
are required to consider all comments received pursuant to requests to 
comment submitted within the fourteen day time period provided that such 
comments are received in writing within a reasonable time. Agencies may 
extend the period during which comments from members of the public will be 
accepted, and many agencies allow between 30 to 45 days for submission of 
such comments. 

Section 5.01 of the Illinois Administrative Procedure Act requires agencies to 
hold a public hearing whenever the agency finds that a public hearing would 
elicit public comment which might not otherwise be submitted. In addition to 
agency-initiated public hearings, the Act requires agencies to hold a public 
hearing whenever the agency receives a request for a hearing within 14 days 
of publication of the notice of general rulemaking in the Illinois Register from 
25 interested persons, an association representing at least 100 persons, the 
Governor, the Joint Committee on Administrative Rules, or a unit of local 
government. 

Following the expiration of the first notice period, agencies are required to 
provide a "second notice" period. The second notice period allows for the 
review of the general rulemaking by the Joint Committee. The agency 
proposing the rulemaking is required to present to the Joint Committee a 
written request for commencement of the second notice period. The specific 
form of this notice is set forth in Section 5.01(b) of the Act. The second 
notice period commences on the date that this formal second notice is received 
and accepted as being complete and in proper form by the Joint Committee, 
and extends for a maximum of 45 days. 

The Joint Committee will not accept a second notice unless it contains the 
following information: (1) the text and location of any changes in the general 
rulemaking made during the first notice period; (2) a final regulatory 



flexibility analysis of the effects of the rulemaking on small businesses; (3) 
an analysis of the economic and budgetary effects of the rules, if one is 
requested by the Committee within 30 days of the commencement of first 
notice; (4) an evaluation of all comments regarding the general rulemaking 
received during the first notice period; (5) an analysis of the anticipated 
effects of the general rulemaking; and (6) a justification and rationale for the 
general rulemaking. 

Following the acceptance of the required second notice submissions, the 
review of the general rules by the Joint Committee begins in earnest. The 
review of the general rules is based upon the criteria set forth in Sections 
220.900 and 220.950 of the Operational Rules of the Committee (1 III. Adm. 
Code 220.900, 200.950). A list, of the review criteria is found on page 10. 
Pursuant to the review criteria, the Joint Committee develops written 
questions based upon a review of the rules. The agency responses to these 
questions are evaluated, and any responses which do not appear to 
adequately address the questions raised are presented in the form of 
recommendations for Joint Committee action. These recommendations vary to 
fit the particular circumstances. The Joint Committee can object to a general 
rule, suspend the rule (in very limited circumstances), recommend legislation, 
or recommend further action. If the Committee finds that all issues and 
problems are satisfactorily resolved, the Committee will issue a "Certification 
of No Objection" which permits agencies to adopt the general rules. 

In the event that recommendations for objection are adopted by the Joint 
Committee, the agency has 90 days in which to respond. The agency may 
modify the rules in response to the Committee's objection, refuse to modify 
the rules, or withdraw the general rules. Failure of an agency to respond to 
a Committee objection within 90 days results, by operation of law, in an 
automatic withdrawal of the general rules. Both the Committee's statement of 
objection, and the agency's response to the objection are published in the 
Illinois Register . Agency responses to Committee objections, along with 
evaluations of those responses, are presented to the Committee for review at 
a scheduled meeting of the Committee, and may result in additional Committee 
action. Agencies are free to adopt rules subsequent to a response to a 
Committee objection. 



- 9 - 



Agencies are requested to respond to Joint Committee recommendations. 
However, the failure of an agency to respond to a recommendation does not 
result in the automatic withdrawal of the rules. Responses to 

recommendations are published in the Illinois Register and are evaluated and 
reviewed by the Joint Committee. TABLE 3 (pages 20-21) illustrates, by 
agency, the number of objections and recommendations issued by the Joint 
Committee and the agencies' responses to them. TABLE 4 (pages 22-23) 
breaks down the objections by type, and illustrates the number of responses 
received for each type. 

Review Criteria 

The Joint Committee utilizes the criteria for review listed in Section 220.900 of 

the Committee's Operational Rules. The factors which the Committee considers 

during the systematic review of the general rulemaking can be summarized as 

follows: 

1. Legal authority for the general rulemaking. 

2. Compliance of the general rulemaking with legislative intent and 
statutory authority. 

3. Compliance with state and federal constitutional requirements and 
other law. 

4. Inclusion of adequate, clear standards and criteria for each exercise 
of discretionary power. 

5. Presence of a statement of justification and rationale for the general 
rulemaking. 

6. Consideration of the economic and budgetary effects of the genera! 
rulemaking. 

7. Clarity of the language of the general rulemaking. 

8. Presence of redundancies, grammatical deficiencies and technical 
errors in the general rulemaking. 

9. Compliance with the requirements of the Illinois Administrative 
Procedure Act. 

10. Compliance v/ith the requirements of the Secretary of State's 
Administrative Code Unit. 

11. Compliance with additional requirements imposed by state and/or 
federal laws. 

12. Compliance v/ith the agency's rulemaking requirements. 



- 10 - 



13. Agency responsiveness to public comments received concerning the 
rulemaking proposal. 

14. Compliance with the Regulatory Flexibility requirements contained in 
Section 4.03 of the Illinois Administrative Procedure Act. 

Significant Rulemakings for 1985 

All of the statements of objection or recommendation which were issued by the 
Joint Committee in 1985 have been summarized in Section Two of this report, 
see pages 87 - 171. Several of the more salient issues handled by the 
Committee during 1985 are discussed in the following pages. 

Attorney General 

The Joint Committee considered the Attorney General's rules entitled 
"Programmatic and Fiscal Requirements for Administering Funds Under the 
Violent Crime Victims Assistance Act" at its October 16, 1985 meeting. The 
general rulemaking, which was identical to an emergency rulemaking which 
was in effect at the time of the review, implements the Violent Crime Victims 
Assistance Act which became effective on January 1, 1984. The rulemaking 
proposed requirements for the receipt and use of State grants by public and 
non-profit agencies. The grants which are provided through the Violent 
Crime Victims 1 Assistance Fund are the result of fines which are imposed by 
the court when it enters a conviction of a scheduled offense. The rulemaking 
also described eligibility criteria, personnel requirements, fiscal monitoring, 
and audit requirements. Also provided within the rules are suggestions on 
program content and procedures which are to serve as "model" programs for 
agencies. These models include sexual assault and domestic violence 
programs. No recommendations or objections were issued and the Committee 
determined that no further action was necessary for this rulemaking, although 
numerous changes were made in the rule during the review process. 

Department of Commerce and Community Affairs 

At the July 25, 1985 meeting, the Joint Committee reviewed the comprehensive 
guidelines and procedures by which the Department of Commerce and 
Community Affairs administers the Enterprise Zone Program which is 
authorized by the Illinois Enterprise Zone Act. The program allows for 
government controls to be relaxed, and tax incentives to be provided in 

- 11 - 



depressed areas for the purpose of stimulating business and industrial growth 
as well as the revitalization of neighborhoods. The rules, as reviewed by the 
Joint Committee, identify eligible enterprise zone applicants, eligibility criteria 
as well as the review and evaluation of applications. The rules also provide 
application guidelines and provisions for zone boundary changes. Designated 
zones are described in terms of eligibility, Departmental approval, and 
charitable contributions. Finally, the rules address the local responsibilities 
which include reporting, monitoring, and administering of the Enterprise Zone 
Program. The Joint Committee did not object to the Department's rules. 

Department of Conservation 

The Joint Committee considered, and issued three objections and two 
recommendations to the Department of Conservation's rules entitled "Historic 
Preservation Grants-ln-Aid" at the February 21, 1985 meeting. 

The first objection cited the Department's failure to accurately set forth its 
policies relative to imposing sanctions upon those who do not comply with the 
Grants-ln-Aid program. The Department had included federal sanctions in its 
rules which the Department believed were required by the National Park 
Service, in addition to incorporating the sanction procedures set forth in the 
Illinois Grant Funds Recovery Act. However, in certain respects, the federal 
sanctions and State sanction procedures were in conflict. The Committee 
recommended that the Department contact the National Park Service in order 
to resolve the conflict. The Park Service notified the Department that the 
federal sanctions did not have to be included in the rules, and the Committee 
then suggested that the Department initiate rulemaking to delete the federal 
sanctions. 

The second objection issued by the Joint Committee was based upon the 
failure of the Department to comply with the requirements for incorporation 
by reference pursuant to Section 6.02 of the Illinois Administrative Procedure 
Act. The Department was incorporated into its rule OMB Circulars A-87 and 
A-110. These circulars are not "rules or regulations" of an agency of the 
United States and therefore cannot be incorporated. The Department was 
advised by letter that it should amend Section 310.50 to incorporate by 
reference the specific federal regulation involved. The Department of 



12 



Conservation did not respond to the May 28, 1985 correspondence due to the 
tact that the administration of the Historic Preservation Grants-ln-Aid 
Program was transferred to the Department of Historic Preservation on July 
1, 1985. The Committee has contacted the Department of Historic 
Preservation in regard to these rules. In addition, the Illinois Administrative 
Procedure Act has been amended to allow for the incorporation of standards 
and guidelines of agencies of the United States, in certain instances (P. A. 
84-784, effective January 1, 1986). 

The Joint Committee also objected to the Department's Grants-ln-Aid Program 
because the proposed rules failed to include the standards that will be used 
by the Department in determining what project proposals will receive grant 
awards. The Department did not modify or withdraw the rules based upon 
the anticipated promulgation of rules by the Department of Historic 
Preservation regarding the selection procedures. 

Finally, in addition to the recommendation issued in response to the 
Committee's first objection, it also recommended that the Department initiate 
rulemaking to include within the rules its policies concerning application 
procedures and project evaluation. The Department once again anticipated 
that these areas would be addressed by the Department of Historic 
Preservation. 

Environmental Protection Agency 

On August 28, 1985, the Joint Committee objected to three general 
rulemakings of the Environmental Protection Agency entitled "Procedures for 
Measuring Emissions of Particulate Matter from Stationary Sources," 
"Procedures for Measuring Emissions of Carbon Monoxide," and "General 
Procedures for Stack Testing." The Committee issued a total of 4 objections 
and 3 recommendations to the rulemakings as follows: 

The Committee issued three objections to rules based upon the Agency's lack 
of statutory authority to promulgate such rules. It has been, and continues 
to be, the opinion of the Joint Committee that Section 10(g) of the 
Environmental Protection Act grants the Pollution Control Board the specific 
rulemaking authority for monitoring sources of air pollution. 



- 13 - 



The Joint Committee issued the fourth objection based on the fact that the 
agency had made a substantive change to the rulemaking after its publication 
in the Illinois Register , not in response to public comment. Such action on 
the part of any agency circumvents the public notice and comment provisions 
of Section 5.01 of the Illinois Administrative Procedure Act. 

In response to each of its objections based upon the lack of statutory 
authority, the Joint Committee issued recommendations directing the Committee 
staff to draft legislation to clarify the Environmental Protection Agency's 
authority, or lack thereof, to promulgate as rules, procedures for monitoring 
contaminant discharges of sources of air pollution and collection samples, for 
monitoring contaminant discharges. A copy of each legislative proposal 
appears in Section Three of this report. 

Department of Public Aid 

Two recommendations for legislation were issued by the Joint Committee at its 
April 16, 1985 meeting. The recommendations were in response to the 
Department of Public Aid's general rules concerning Medical Payment under 
the Illinois Competitive Access and Reimbursement Equity (ICARE) Program. 

The first recommendation advised the Department to seek legislation amending 
the Illinois Health Finance Reform Act to grant the Department the statutory 
authority to require hospitals to agree to the enforcement of a pledge of 
confidentiality by the issuance of a preliminary or permanent injunction, or 
other court order, and to limit the form of recordkeeping allowed during 
negotiating sessions. The Department declined to seek legislation stating that 
it believed that the Illinois Health Finance Reform Act already provides the 
Department with the authority to require court enforceable pledges of 
confidentiality, as well as the power to limit recordkeeping. Due to the 
Department's refusal, the Joint Committee directed staff to draft the 
appropriate legislation for consideration during the 1986 spring session of the 
General Assembly. A copy of that proposal appears in Section Three of this 
report. 

The Department of Public Aid responded positively to the Joint Committee's 
recommendation that, it seek legislation to amend the Illinois Health Finance 



Hi 



Reform Act to allow it to enter into contracts under the I CARE program with 
hospitals located outside the boundaries of Illinois. The Department has 
amended the Illinois Health Finance Reform Act to meet the Joint Committee's 
recommendation via Senate Bill 103 which was signed into law by the Governor 
on September 14, 1985, as P. A. 84-0325. 

The Joint Committee also considered the Department of Public Aid's Food 
Stamp rules entitled "Amount of Benefits" at its April 16, 1985 meeting. The 
Committee voted to object to that rulemaking because, contrary to federal law 
and regulations, the Department, in determining eligibility for the food stamp 
program, considers the penalty amount for failure to comply with a federal, 
state, or local welfare program as available unearned income without 
determining whether the failure to comply was intentional. The Committee 
directed its staff to contact the United States Department of Agriculture to 
seek clarification as to the proper interpretation of federal food stamp 
regulations. A response was received by the Joint Committee from the 
Secretary of Agriculture John Block on July 15, 1985. Secretary Block 
confirmed that the Department of Public Aid cannot determine that all client 
failures to comply with a welfare program are intentional. The Secretary 
advised that the regional office of the U.S.D.A. would aid the Department of 
Public Aid in clarifying the procedures. 

Department of Public Health 

At the September 17, 1985 meeting, the Joint Committee on Administrative 
Rules objected to the Department of Public Health's rulemaking entitled 
"Hospice Programs." The Joint Committee issued three objections to the rules 
all based upon a lack of statutory authority on the part of the Department to 
promulgate such rules. Specifically, the Joint Committee objected to the 
Department's lack of authority to: (1) issue a hospice license to a hospice 
program which is not in compliance with the Hospice Program Licensing Act 
and the Department's rules governing hospice programs based upon the 
submission of a plan of correction by the hospice; (2) require hospices to be 
subject at all times to inspection by the Department of Public Health; and (3) 
delegate to hospices the authority to determine the number and qualifications 
of persons providing direct hospice services. 



15 



In addition, the Joint Committee issued a recommendation directing staff to 
develop legislation in response to the Committee's first objection. The 
legislation would provide the Department with the authority to issue a hospice 
license to a hospice program which is not in compliance with the hospice 
Program Licensing Act and the Department's rules governing hospice 
programs. A copy of the legislative proposal appears in Section Three of this 
report. 

Department of Rehabilitation Services 

The Joint Committee issued two objections at its May 14, 1985 meeting to the 
rules of the Department of Rehabilitation Services governing the "Vending 
Stand Program for the Blind." The Department responded by refusing to 
modify the rules to meet the objections of the Joint Committee. 

The Committee voted to object to the Vending Stand Program for the Blind 
because the Department overregulates "self-employed" vending stand 
operators. Overregulation on the part of the Department violates the 
legislative intent of Section 2 of "An Act in relation to the operation of 
vending facilities on public and private property by blind persons, and to 
repeal certain Acts herein named" (III. Rev. Stat. 1983, ch. 23, par. 3331 et 
seq.) 

The Committee's second objection to the Vending Stand Program for the Blind 
was issued because, contrary to Section 4.02 of the Illinois Administrative 
Procedure Act, the rules did not include clear and precise standards to be 
used by the Department in determining whether a vendor will be suspended 
prior to an evidentiary hearing. In response to each objection, the Joint 
Committee directed staff to monitor the progress of the Department of 
Rehabilitation Services in reviewing its policies. In particular, the Committee 
has recommended that the Department review its policies in regard to "the 
self-employment" of blind vendors as well as the procedures used in 
determining cause for suspension. 



008:ar85 

- 16 - 



17 



TABLE 2 
GENERAL RULEMAKING BY AGENCY 1985 



Administrative Rules, Joint Committee on 3 

Aging, Department on 4 

Agriculture, Department of 15 

Alcoholism and Substance Abuse, Department of 5 

Attorney Ceneral 2 

Auditor General 1 

Capital Development Board 9 

Centra! Management Services, Department of 10 

Children and Family Services, Department of 14 

Civil Service System, State Universities 1 

Commerce and Community Affairs, Department of 29 

Commerce Commission, Illinois 22 

Community College Board, Illinois 2 

Comptroller 1 

Conservation, Department of 34 

Corrections, Department of 1 

Court of Claims 1 

Criminal Justice Information Authority, Illinois 1 
East St. Louis, Board of Trustees of the State Community College of 

Education, Board of Higher 5 

Education Loan Authority, Illinois Independent Higher 1 

Education, State Board of 12 

Elections, State Board of 1 

Employment Security, Department of 13 

Energy and Natural Resources, Department of 3 

Environmental Protection Agency 10 

Experimental Organ Transplantation Procedures Board, Illinois 1 
Export Development Authority 

Farm Development Authority, Illinois 1 

Financial Institutions, Department of 4 

Fire Marshal, Office of the State 3 

Governor's Purchased Care Review Board 1 

Guardianship and Advocacy Commission 3 

Health Care Cost Containment Council 10 

health Facilities Planning Board 1 

Housing Development Authority, Illinois 5 

Illinois, Board of Trustees of the University of 1 

Industrial Commission 7 

Insurance, Department of 9 

Labor, Department of 3 

Labor Relations Board, Illinois Educational 3 

Labor Relations Board, Illinois Local 1 

Labor Relations Board, Illinois State 1 

Law Enforcement Merit Board, Department of 1 

Mental Health and Developmental Disabilities, Department of 8 

Military and Naval Department 1 

Mines and Minerals, Department of 7 

Nuclear Safety, Department 3 



TABLE 2 

GENERAL RULEMAKING BY AGENCY 1985 

(continued) 



Pollution Control Board 32 

Prisoner Review Board 1 

Property Tax Appeal Board (1) 1 

Public Aid, Department of 94 

Public Health, Department of 25 

Racing Board, Illinois 13 

Registration and Education, Department of 16 

Rehabilitations Services, Department of 13 

Retirement System of Illinois, State Employees' 3 

Retirement System of The State of Illinois, Teachers' 2 

Revenue, Department of (1) 7 

Savings and Loan Associations, Commissioner of 2 

Scholarship Commission, State 14 

Secretary of State 19 

Select Joint Committee on Regulatory Agency Reform 
State Police, Department of (formerly the 

Department of Law Enforcement) 2 

Transportation, Department of 16 

Travel Control Board, Higher Education 1 

Treasurer 1 



TOTAL 538 



(1) The Property Tax Appeal Board became an agency separate from the 
Department of Revenue in 1985. 



017:ar85 



19 



CJ< 

<Q 

h~z 

111 

;: 
v- 

-j 



c 

re 

"C 

c 

0) 

E 
E 

£ 

c 


Lf. 

c 



r 

u 
c: 


GV 

C 

'■5 

a> 

a. 


"O 

a> c 

u o 


03 

a> 

L- 

cn 

(0 

C/1 

O 


a) 
o> 

01 
< 


c 
_o 

u C 

-a E 

~z- y 


c 
•• 

. 

'■' 

L/' 
'j 
O 

S) 

5 

a. 

2 


c 
'■5 

c 


si 


4) 


'■5 

o 
5 


° c 
L. .2 

.Q <-> 

Ei 
Z G 


5 
< 



■oQ 



L C 

I 0) 

E Q 

E 



E cL 
>• c 

O Q 

a 

E 



ro q. 

c a 



20 



£| a 



t- c 

Is 

s 

c 
u 



p 

2 u 



II 



E.SJ 

3 J3 

■2L O 



- 21 



U) 


c 


'■5 


c 


<y 


Q. 


-O 


C 


•8. 
liS 


"co* 


"" © 






ra 




>§ 




U CO 




C «- 




0) "D 




Oil 




< S 






c 






•;;> 




'.■J 




i:' 




■v. 








£ 




') 









OJ 


Q£ 


(fl 




c 











in 




a 




K 






> 




<+- 




"■D 




O 




S 


<+- in 


c 


1. .2 


O *-> 


& y 


e-2. 


3-0 


ZO 


<4- C 


c 


t"! 


Si 


hfi 


O 



o 

<T> O 





O 


CM 


r 






c • 


s 


CO ^3- 


< 


(/> c 




XJ 


> 


J- '£ 

TO (J 





"O <U 


— 


C LO 


*j 



, — , 








U) 














T— 








c 










QJ 




O 


Cn 
c 




+-> 

c 













U 

c 




LT) 


i-i 




-M 


_ra 














c 



'il 

c 




c 


=3 
CD 


u 








_0J 




O'l'-M 


X". 




a> 


(1) 


0) 






£1 


CO 


c u 

■* I/) 

f0 w 


3 
< 




> 
ra 


u.' 


0) 

a-. 


>- 

u 


3 

or 


ffl 




ra 


— 0) 


£ 




(0 

'ai 


l. 




c 








L. 




■a 










PO 


C • 


cu 

■0 


3 t_ 


> 




a> 


'i 


z: 







O -M 

a u 
00 


V 


o: 3 

"0 
ca 3 

f 1 °- 


m 


c 


3 

CO 


0; 
to 


LL 

a; 
ra 



Q 

in 


u 

c 

(V 
01 


21 
in 

O 


C 

_o 
u 
m 


LL 

1/1 
0) 

ra 


CO 








~ 


< 


" — 


- — - 


u *-> 


O 


<u 















O 




c 




U 


U 




> 


> 


o: 




0. 




> 



22 



ji 

d: c 

LL O 

z£ 

LU 

u 

c 
h- 

2: 
o 

h- 
u 

LU 

— > 

m 
o 



en 


c 


'■v 


c 


0) 


CL 


! "O 


C 


2$ 


'5* 


^ O 






TO 




>£ 




u nj 




C *- 




O T3 




cn.c 




<£ 




^ 


c 







°+J 




u 




(V 








jQ 




O 


0) 


O 


3 


" 1 ~ J 


fl) 


03 


0£ 


V) 




c 





















£ 






>s 




**- 




'•5 









2 


*fc w 


c 


u O 


<y +j 




3-Q 


zo 


M- C 


O 


<u ■?. 


P-o 


»"»*^ 


1-5 


c 



'1 





0) 


>- 


3 


to 

CD 


(0 
> 


u 


>s 




m 








T 7 







c 


a? 


E 




L. 


j 


O 


a: 


H 



3 ro -Q 

o X 
£ 53 m 

3 £ o 
°"-~ * 

■° C r- 

^ o 

*- c 73 

O O u 

ra 



CD 




W) 




3 




CD 




U 




0) 




£ 




<x> 




a 




> 




«-> 




>. 




j2 


, 


■a 


c 



E 


u 


'w 


CD 


to 


!c 







u 




to 
C 


c 
ro 


O 


1- 


4J 


a 


<tf 


in 





ro 


c 


n 


03 


c 



I/) 


c 


« 






s: 






U1 




■"" 


0J 


3 


£ 




.£ 






c 



CD 

x: 


"+-» 




u 




<u 


m 




CD 


Id 1 


,,,, 





03 




U 


<+- 







</) 


CD 


3 
O 


-Q 


<D 


e 


£ 


3 


3 


z 


c 



23 - 



- 24 - 



REVIEW OF EMERGENCY RULEMAKING 

Occasionally, agencies are confronted with situations where the general 
rulemaking process is not feasible, because the rulemaking must be done 
within a shorter period of time than that provided by the general rulemaking 
process. The Illinois Administrative Procedure Act contains two provisions 
which permit agencies to bypass the general rulemaking process. There are 
provisions for emergency rulemaking and for peremptory rulemaking. 
However, the use of these provisions is scrutinized by the joint Committee 
because they permit an agency to circumvent the public notice and comment 
procedures required by the Act when the general rulemaking process is used. 
The following discussion explains the emergency rulemaking procedure, 
analyzes the total emergency rulemaking activity during 1985, and presents 
examples of emergency rulemaking by several State agencies. 

Emergency Rulemaking 

Section 5.02 of the Act authorizes the use of emergency rulemaking in certain 
instances. In order to utilize the emergency rulemaking process, an agency 
must first determine that a situation exists which threatens the public 
interest, safety or welfare, and which requires the adoption of a rule on 
fewer days notice than is required for general rulemaking. In such 
instances, the rule can be adopted immediately, without going through the 
public notice and comment period. Rules adopted though the use of this 
provision can remain in effect for a maximum of 150 days. There are, 
however, restrictions upon the use of emergency rulemaking. The emergency 
rule must contain only those provisions which are in direct response to the 
actual emergency. In addition, an agency may not adopt an emergency rule 
that has the same purpose and effect as any emergency rule adopted within 
the previous 24 months. Finally, despite the agency's ability to forgo the 
notice and comment period, the Act requires the agency to make reasonable 
efforts to inform the affected public about the emergency rulemaking. 
Through the procedure of emergency rulemaking, the Illinois Administrative 
Procedure Act provides agencies with the flexibility they need to respond to 
emergency situations, but balances this with the temporary nature of the 
emergency rule, and the restrictions placed upon it. The criteria used by 
the Joint Committee in reviewing emergency rules are found in Sections 



25 



230.400 and 230.500 of the Joint Committee's Operational Rules (1 III. Adm. 
Code 230.400 and 230.500). 

Emergency Rulemaking Activity During 1985 

State agencies adopted 73 emergency rules during 1985. (see TABLE 5, page 
31) The Joint Committee issued 21 objections to 73 emergency rules and 
rulemakings during this year, (see TABLE 6, page 32). This is an increase 
from 1984, during which time 18 objections were issued to 78 emergency 
rulemakings. (see Appendix TABLE 15, pages 458 - 459). TABLE 7 (page 
33) breaks down the objections issued by type and agency response. The 
greatest number of objections were based upon the fact that the emergency 
situation was agency created, and therefore emergency rulemaking could not 
be used (see Senn Park Nursing Center v. Miller) , 118 III. App. 3d 504, 455 
N.E. 2d 153 (III. App. 1 Dist. , 1983), aff'd , 104 III. 2d 169, 470 N.E. 2d 
1029 (1984) and the fact that the rule was not limited to the emergency 
situation. Although agencies are not required by law to respond to Joint 
Committee objections issued to emergency rulemakings, responses were 
received from three agencies. The Department of Public Aid agreed than an 
emergency rulemaking which was necessary to raise Medical Assistance - No 
Crant (MANC) standards also contained changes which were not related to the 
emergency. In addition, the Department of Public Aid, the Secretary of 
State, and the Treasurer issued 6 refusals to modify or withdraw emergency 
rulemaking. Agencies failed to respond to the 7 remaining objections. 
Several emergency rulemakings promulgated by State agencies are summarized 
in the following pages. 

Attorney Ceneral 

In an emergency rulemaking of interest, the Attorney Ceneral adopted 
"Programmatic and Fiscal Requirements for Administering Funds Under the 
Violent Crime Victims Assistance Act" (89 III. Adm. Code 1100) to implement 
the Violent Crime Victims Assistance Act (Ml. Rev. Stat. 1984 Supp., ch. 
70, par. 501 et seq.). These rules described a program to fund 
community-based programs providing services to victims and witnesses of 
violent crimes. In an effort to inform affected members of the public about 
this emergency rulemaking, the Office of the Attorney Ceneral sent copies of 
the emergency rules to all agencies involved in a statewide needs assessment 



- 26 - 



survey on current levels of victim and witness services, to all agencies that 
had submitted funding requests, and all agencies that offered victim and /or 
witness services. The Office of the Attorney General explained that there 
had been insufficient funding and an inability to recruit trained staff during 
the period between the effective date of the Act and the starting date of the 
program, and that many existing programs would go out of existence if rules 
for funding were not established by April 15, 1985. No objection to the 
Attorney General's use of emergency rulemaking in this instance was issued 
by the Joint Committee. 

Department of Commerce and Community Affairs 

The Department of Commerce and Community Affairs adopted 5 emergency 
rules early in September, 19S5 to implement several articles of The Buila 
Illinois Act (Public Act 84-109, effective July 25, 1985). This Act was the 
Governor's comprehensive economic package designed to foster business 
development and modernize the infrastructure for private sector business in 
the State. The three emergency rulemakings entitled "Illinois Equity 
Investment Fund" (14 III. Adm. Code 600), "Illinois Small Business 
Development Program" (14 III. Adm. Code 570), and "Illinois Small Business 
Incubator Program" (14 111. Adm. Code 560) established programs to 
encourage the entrepreneurial efforts of small business and to assist small 
firms with business financing. The emergency rulemaking entitled "Illinois 
Large Business Development Program" (14 III. Adm. Code 590) established a 
program to assist large businesses with business financing. In addition, one 
emergency rulemaking entitled "Illinois Public Infrastructure Loan and Grant 
Program" (14 III. Adm. Code 610) also established a program to support the 
efforts of local government in economic development and creation of private 
sector jobs. The Department explained, as justification for the use of 
emergency rulemaking in each instance, that the immediate implementation of 
Public Act 84-109 was vital for the economic stability of the State because the 
programs were designed to create and retain jobs. No objections were issued 
by the Joint Committee to any of the Department's emergency rules. 

State Board of Education 

Between August and October 1985, the State Board of Education adopted nine 

emergency rulemakings in response to the 1985 Illinois educational reform 



11 



package, "An Act in relation to education reform and the financing thereof, 
amending Acts therein named" (Public Act 84-126, effective August 1, 1985). 
The Board explained that the emergency process was necessary because the 
Public Act made it clear that programs should be established as soon as 
possible. The first two emergency rulemakings, "Dismissal of Tenured 
Teachers" (23 III. Adm. Code 51) and "Dismissal of Tenured Teachers and 
Civil Service Employees Under Article 34" (23 III. Adm. Code 52), amended 
Board rules governing the dismissal proceedings of tenured teachers and civil 
service employees at the sections concerning notice and hearing rights. At 
the November 14, 1985 meeting, the Joint Committee issued two objections to a 
provision contained in the second of these emergency rulemakings. This 
provision allowed one party to reject all of the names contained on a list of 
prospective hearing officers and allowed the Board to provide a second list of 
prospective hearing officers. The objections stated that this provision was in 
conflict with The School Code. (III. Rev. Stat. 1983, ch. 122, par. 34-85, as 
amended by Public Act 84-126), and was not required by the emergency 
situation. The Board has not yet responded to these two objections. 
However, the Board proposed similar general rulemaking early in November, 
under Section 5.01 of the Illinois Administrative Procedure Act with the 
offending section deleted. 

The Joint Committee found no problems with the seven remaining emergency 
rulemakings adopted by the State Board of Education in 1985. The first of 
these, entitled "Reorganization Committees" (23 III. Adm. Code 550), 
described the organization and function of Educational Service Regional 
Reorganization Committees, created to recommend, and allow voters to act 
upon, school district consolidation plans. The Board expanded this 
emergency rule with another emergency rulemaking to add sections 
establishing requirements for plan contents, hearings and to submit plans to 
the voters. The Board adopted an emergency amendment to rules entitled 
"Driver Education" (23 III. Adm. Code 252) to specify the fee that school 
districts can charge and to clarify included services. The Board explained 
that the new authorization corrected inequities in fee assessment ana 
protected the welfare of students who are not able to afford the fees assessed 
by local school districts. Emergency rulemaking entitled "Educational Service 
Centers" (23 III. Adm. Code 500) established procedures for a network of 



educational service centers to coordinate and combine services such as gifted 
education, computer technology, mathematics, science, and reading resources 
and several optional programs. The Board adopted an emergency rulemaking 
"Reading Improvement Program" (23 III. Adm. Code 260) to fund reading 
improvement programs in local school districts. An emergency rulemaking, 
"Staff Development Plans and Programs" (23 ML Adm. Code 30) was adopted 
to explain the procedures and criteria used by the Board to approve and 
fund school district staff development programs. In addition, the Board 
adopted an emergency rulemaking entitled "Truant's Alternative and Optional 
Education Programs" (23 III. Adm. Code 205) to fund local pilot projects to 
encourage school attendance by dropouts, truants, and unmotivated students. 
In reference to this last program, the Board explained that a program to 
encourage school attendance had been in effect for some time, however, 
Public Act 84-126 gave the Board rulemaking authority for the first time in 
the area. 

Illinois Ed ucational Labor Relations Board 

The Board adopted emergency rules entitled "Fair Share Fee Objections" (80 
III. Adm. Code 1125), to describe procedures by which the Board would 
resolve disputes that arose over fair share fee payments by non-union 
employees who were assessed such fees pursuant to collective bargaining 
agreements. The Board explained that the critical period for teacher contract 
negotiations was approaching and procedures must be in effect in order that 
school districts and unions would not unnecessarily reach impasses over the 
question of "fair share." However, the Board had delayed general rulemaking 
because it believed that an Illinois Supreme Court case and two district court 
cases would probably affect the fair share objection rules. The emergency 
rulemaking was also necessary because the Board had received a large number 
of fair share fees, and failure to promulgate rules could have paralyzed the 
Board's process. The Board explained that general rulemaking has been 
proposed on this issue and stated that they were studying recent court 
orders, awaiting other court decisions, and considering comments received on 
the emergency rule as they prepared the second notice on the more recently 
proposed rulemaking. The Board stated that efforts to inform the public 
about the emergency rulemaking included mailing copies to affected parties 
and announcing the proposed general rulemaking in a press release. The 



29 



Joint Committee objected to this emergency rulemaking at the November 14, 
1985 meeting. The Joint Committee stated that the Board could have adopted 
a general rulemaking on this subject as early as July 26, 1985, thus avoiding 
a need for the use of the emergency rulemaking procedure. Therefore, the 
Joint Committee objected to the rulemaking because any emergency situation 
that may have existed was created solely by the failure of the Board to act in 
a timely fashion. 

Illinois Experimental Organ Transplantation Procedures Board 
In June, 1985, the Board adopted an emergency rule entitled "Experimental 
Organ Transplantation Program" (77 III. Adm. Code 2100). This rulemaking 
created procedures and requirements for the submission and consideration of 
applications from teaching hospitals or affiliated medical centers which 
nominate Illinois residents for funding to cover the expenses of an 
experimental organ transplantation procedure. The Board stated that the 
emergency rulemaking was necessary because the Governor's Office did not 
appoint the Board until March, 1985, which did not leave enough time to 
propose rules pursuant to general rulemaking provisions of the Act, and have 
them adopted by June 30, 1985. The Board explained that applications were 
being submitted to the Board, and considering the nature of the procedures 
that were involved, delays in the Board's ability to provide recommendations 
could have serious consequences for many of the potential organ recipients 
The Board distinguished the situation from that of an agency created 
emergency (as discussed in Senn Park Nursing Center v. Miller) by stating 
that the circumstances which led to the emergency were beyond the control of 
the Board. The Board explained that an effort was made to inform the 
affected public by sending copies of the rules to all medical teaching facilities 
and to physicians of individuals who had requested information from the 
Board. In addition, certain medical associations had published information on 
the program at the request of the Board. The Joint Committee found no 
problems with this emergency rulemaking. 



007:ar85 



30 



TABLE 5 
EMERGENCY RULEMAKING BY AGENCY 1985 



Agriculture, Department of 2 

Alcoholism and Substance Abuse, Department of 1 

Attorney General 1 

Capital Development Board 1 

Central Management Services, Department of 6 

Commerce and Community Affairs, Department of 6 

Commerce Commission, Illinois 1 

Conservation, Department of 7 

Criminal Justice Information Authority, Illinois 1 

Education, State Board of 9 

Environmental Protection Agency 2 

Experimental Organ Transplantation Procedures Board, Illinois 1 

Farm Development Authority, Illinois 2 

Financial Institutions, Department of 1 

Housing Development Authority, Illinois 1 

Industrial Commission 2 

Insurance, Department of 2 

Labor, Department of 2 

Labor Relations Board, Illinois Educational 1 

Nuclear Safety, Department 1 

Pollution Control Board 3 

Public Aid, Department of 6 

Public Health, Department of 2 

Racing Board, Illinois 2 

Registration and Education, Department of 1 

Retirement System of Illinois, State Employees' 1 

Savings and Loan Associations, Commissioner of 1 

Secretary of State 6 

State Mandates Board of Appeals 1 

Transportation, Department of 1 

Treasurer 1 



TOTAL 73 

017:ar85 



- 31 - 









C7 








: 
















a 
























■• 




1/1 




a- 




c 

























D 

C 

V 

L 


L. 

2 


C 




ft 


<S 


*"^ <u 






_ 


a. 




















o 




Q 












131 




a) 








in 
















3 




:: 




Q. 






















c: 




< 






in 






c 






o 












= ? 






t. c 






c: ■.:, 






xi E 






E E 






3 o 








Z » 



E 
3 £1 

Z C 



h Q 



03 


CD 


Q 


_'L J 




(0 






C 


t/i 


o 






c 


> 








o 




- 








J 





32 



TABLE 7 
OBJECTIONS TO EMERGENCY RULEMAKING BY TYPE 



Type of 
Objection 


Number of 
Objections 


Response to Objection 


Pending 


Modify I Refuse 


Failure 
to Respond 



Agency Created Emergency 



3 (60%) 



1 (20%) 1 (20%) 



Rule Not Limited 
To Emergency 



No Emergency Existed 



2 (40%) 
1 (25%) 



2 (40%) 1 (20%) 



1 (25%) 2 (50%) 



Lack of Statutory 
Authority 



2 (66.7%) 1 (33.3%) 



Conflict with Statute 



1 (50%) 1 (50%) 



No Threat to the Public 



1 (50%) 



1 (50%) 



TOTAL 
014:ar85 



:>i 



1 (4.8%) 6 (28.6%) 7 (33.3%) 7 (33.3%) 



33 



- 34 



REVIEW OF PEREMPTORY RULEMAKING 

Section 5.03 of the Illinois Administrative Procedure Act authorizes the use of 
the peremptory rulemaking process. This procedure, and the emergency 
rulemaking provisions discussed in the preceding section, are the two 
provisions that permit agencies to bypass general rulemaking procedures. 
Because peremptory rulemaking precludes any participation bv the public and 
becomes effective immediately upon filing with the Secretary of State, the use 
af this procedure is permitted only under the most narrow of circumstances. 
The criteria for this review are contained in the Joint Committee's rules 
entitled "Review of Peremptory Rulemaking" (1 III. Adm. Code 240). In 
brief, peremptory rulemaking may be utilized only when required by federal 
law, federal rules and regulations, or a court order. Furthermore, the 
content of the rule must be limited to what is required by the law, rule, or 
order, the agency may have no discretion as to the rule's contents, and the 
rulemaking must be accomplished within 30 days after the change is required. 

Peremptory Rulemaking Activity During 1985 

Five State agencies adopted 23 peremptory rulemakings in 1985. (see TABLE 
8, page 37). The Joint Committee issued two objections to one of these 
peremptory rulemakings, the Department of Employment Security's 
"Supplemental Federal Benefits." (see TABLE 9, page 38). This rulemaking 
is discussed in the following section. 

In 19 of the peremptory rulemakings, agencies justified the use of peremptory 
rulemaking using federal and state laws which included "equal to" language 
requiring that the State adopt all federal changes. For example, the 
Department of Agriculture is required by both the Federal Poultry Inspection 
Act and Illinois' Meat and Poultry Inspection Act to maintain an "equal to" 
status with federal regulations. Consequently, in 1985 the Department 
amended state meat and poultry regulations using the peremptory rulemaking 
(8 III. Adm. Code 125) process eight times to incorporate references to 
federal regulatory changes in such areas as voluntary post-mortem turkey 
inspection, testing carcasses that show lesions, the use of lecithin as an 
emulsifier in meat products, and the use of brand identification symbols. 



- 35 - 



The Department of Conservation adopted two peremptory rulemakings in 1985 
entitled "Duck, Goose and Coot Hunting Regulations" (17 111. Adm. Code 590) 
and "Woodcock, Snipe, Rail and Teal Hunting Regulations" (17 III. Adm. Code 
740). The peremptory amendments required the use of steel shot when 
hunting migratory waterfowl in certain parts of Illinois. The Department 
adopted these two amendments in September and October in response to a 
case brought in federal court by the Wildlife Federation in which the 
conservation organization demonstrated that lead shot had caused the death of 
bald eagles feeding upon birds killed with lead shot. The Joint Committee did 
not issue any objections regarding these rulemakings. 

The Department of Employment Security amended its Supplemental Federal 
Benefits rules (56 III. Adm. Code 1875) using peremptory rulemaking. This 
amendment altered benefits for some Illinois recipients of supplemental 
compensation and was based upon a series of letters from the United States 
Department of Labor to the Department. In August, the Joint Committee 
issued two objections to this rulemaking. The Joint Committee found that the 
Department had failed to comply with the 30 day filing requirement specified 
in Section 5.03 of the Illinois Administrative Procedure Act because the 
change in federal law that prompted the rulemaking had occurred more than 
eighteen months earlier. Furthermore, the Joint Committee found that the 
Department had discretion as to the contents of the rule as demonstrated by 
the fact that they had the option to word the rule as they chose or to refer 
or not refer to the federal law. In addition, the Joint Committee found that 
the Department's interpretation of federal law was too broad and would allow 
federal administrative officials to trigger peremptory rulemaking by merely 
sending letters. The Committee found that if the Department felt constrained 
to act because of deadlines imposed by the U.S. Department of Labor's letter, 
the Department should have used the emergency rulemaking procedures found 
at Section 5.02 of the Act. The Department refused to amend or repeal the 
rule in response to the objection. 



007:ar85 



36 



TABLE 8 
PEREMPTORY RULEMAKING BY AGENCY 1985 



Agriculture, Department of 9 

Conservation, Department of 2 

Employment Security, Department of 1 

Pollution Control Board 9 

Public Aid, Department of 2 



TOTAL 23 



017:ar85 



- 37 



ions 
Pending 


ra 

« * £ 

= 3 Q. 

O <o 2> 
u n_ q; 


esponse to 
Disagree 


a 

a 
< 


c 
o 

°l 

i- c 

0) 0) 

11 

3 O 
Z & 


cr 

c 

c 

0) 

a. 


o Objections 
Failure 

to 
Respond 


Response i 
Refuse 


> 

•5 

o 

5 


c £ 

i. .2 

IS 

zo 


< 



33 



FIVE YEAR REVIEW 

Section 7.08 of the Illinois Administrative Procedure Act requires the Joint 
Committee to review the existing rules of all State agencies at least once 
every five years. The Act requires that this review be conducted by 
systematically grouping all rules into subject areas. This procedure ensures 
that rules which are similar in nature are reviewed at the same time. For 
this reason, a five year review report normally contains rules from several 
agencies, with each set of rules relating to the same topic, such as consumer 
protection, vocational and professional education, or records and information 
management. The review focuses upon several issues, including 
organizational and procedural reforms; the modification or abolition of rules; 
the elimination of obsolete, overlapping or conflicting rules and language; and 
the economic and budgetary effects of the rules. 

The five year review process is conducted in several different stages. 
Initially, specific information is requested from the agencies which have rules 
which are scheduled to be included in the review. The request usually 
concerns the statutory authority upon which the rule is based, the cost to 
implement the rule, and the current need for the rules. At least one public 
hearing to gather information and views from interested persons will also be 
scheduled when such hearings are necessary for a complete review of the 
rules. During this stage, the agency and the Joint Committee often reach 
tentative agreements to correct problems which have been discovered in the 
rules. 

Stage two of the review process is the preliminary written report which is 
presented to the Joint Committee and agency representatives for their 
consideration. The report includes suggestions and recommendations for Joint 
Committee action. At this stage, the agency representatives are requested to 
respond in writing to the suggestions and recommendations for action. These 
written responses are included in the final report which is presented to the 
Joint Committee for formal action at a hearing as part of stage three. At the 
hearing, agency representatives present their position on the proposed 
recommendations, and the Joint Committee votes to either accept or reject the 
recommendations . 



39 



Finally, stage four is the "follow-up" stage of the review. The Joint 
Committee monitors and reports on agency action and prepares any necessary 
reports. This procedure ensures that the Joint Committee recommendations 
are being followed. 

In 1985, the Joint Committee began to revise the five year review program 
within the statutory constraints of the program. As revised, the review 
program will operate as a discrete entity which will not overlap, but will 
complement the proposed rulemaking review program. This revision will 
ensure that the five year review program is completed in a timely manner and 
that concentration is given to the interrelationship between rulemakings. 
This revision has only become appropriate at this time because the great 
majority of State agency rules have been reviewed in the proposed rulemaking 
process. 

The Joint Committee issued one five year report in 1985. The Records and 
Information Management Report consisted of sixteen sets of rules from the 
following agencies: Department of Central Management Services (1), 
Department of Children and Family Services (.3), Department of Conservation 
(1), Criminal Justice Information Authority (2), Environmental Protection 
Agency (1), Department of Law Enforcement (2), Legislative Information 
System (1), Local Records Commission (1), Department of Public Health (1), 
Secretary of State (2) and the State Board of Education (1). During the 
course of the review, 297 substantive issues were raised concerning these 
rules. Of the substantive issues raised, 156, or 53% resulted in tentative 
agreements being reached at the staff level. This figure is somewhat lower 
than that of previous five-year review reports. Ordinarily, between 65 and 
70 percent of all issues raised result in tentative agreements at the staff level 
to amend the rules. The lower number of tentative agreements reached in 
this review can be explained, in part, by the fact that the rules under 
review in this report have been updated by the agencies more frequently than 
was the case with the rules reviewed in previous reports. The answers to 
131, or 44% of the questions asked, were deemed to be adequate, and no 
agreements for change or recommendations for formal Joint Committee action 
were made. Of the substantive issues raised in the review, 14, or 4.78% of 
the total, resulted in Joint Committee action. The Joint Committee voted eight 



40 



recommendations for objections to existing rules, three recommendations for 
rulemaking by the affected agencies, one recommendation for corrective 
legislation, and two recommendations for administrative study by the various 
agencies at the January, 1985 meeting, (see TABLE 10, page 45). 

During the course of the review, a number of problems were encountered 
which became significant either because of the importance of the problem as it 
relates to the effect of the improper rule, or because of the frequency with 
which the issue was encountered. The following paragraphs discuss some of 
the important issues and problems discovered during this review. 

The Illinois Freedom of Information Act 

The Illinois Freedom of Information Act became effective on July 1, 1984. 
This legislation has had a profound effect upon the rules of all State agencies 
which deal with public records and information. 

The Act requires that each "public body" within Illinois make its "public 
records" available to any person, upon request, for inspection and copying. 
The term "public body," as defined by the Act, includes all legislative, 
executive, administrative, and advisory bodies of the State. Also included 
within this definition are the State universities and colleges and generally ail 
units of local government. The Act provides an inclusive definition of public 
records to allow liberal access to information in the possession of the various 
public bodies throughout the State by members of the public, with certain 
specific exceptions. 

Section 4(a) of the Freedom of Information Act requires that each public body 
prominently display at each administrative or regional office, and make 
available for copying, a brief description of the public body, including a 
short summary of its purpose, a diagram with functional subdivisions, the 
agency's operating budget, the number and location of its separate offices, 
the approximate number of employees, and the identification and membership 
of any advisory boards and commissions associated with the public body. 
Section 4(b) of the Act requires that each public body also make available a 
brief description of the manner in which the public may request information 
and public records. 



- 41 



In an attempt to provide consistency between the public information rules of 
each State agency, the Governor's Office drafted a model set of rules which 
incorporate the requirements of the Freedom of Information Act. The model 
rules provide a general framework for rules which can be tailored by each 
agency to meet its own unique requirements. As part of the five year 
review, the Joint Committee recommended that all agencies subject to the 
Illinois Administrative Procedure Act adopt the model rules developed by the 
Office of the Governor to implement the Illinois Freedom of Information Act. 
These rules were to be adopted pursuant to the internal rulemaking procedure 
of the Illinois Administrative Procedure Act, which provides that such rules 
shall become effective upon filing. At the time the Joint Committee issued 
this report, 40 agencies had filed with the Administrative Code Unit of the 
Office of the Secretary of State rules to implement the Freedom of Information 
Act. 

In addition to promulgating rules regarding the availability of public records 
pursuant to the interna! rulemaking procedure of the Illinois Administrative 
Procedure Act, there are provisions of the Freedom of Information Act which 
State agencies may be required to implement through the general rulemaking 
provisions of the Act. Therefore, the Joint Committee recommended that all 
State agencies subject to the Illinois Administrative Procedure Act undertake 
rulemaking to fully implement the requirements of the Freedom of Information 
Act which are not covered by the model rules adopted through the internal 
rulemaking process. 

Simplicity and Clarity 

Simplicity and clarity tend to be two of the more serious obstacles to public 
understanding of agency rules, and two of the most frequently recurring 
problems targeted by the Joint Committee's review criteria. 

In this report, 47% of all agreed changes in the rules reviewed involved 
agreements to modify existing rules to provide greater simplicity and clarity. 
The agencies agreed to rephrase many rules or provisions that contained 
unnecessarily complicated or vague language. In the report, the Joint 
Committee expressed the hope that with increased public and governmental 
awareness of rules, all State agencies would attempt to write rules in a 



H2 



simple, clear, and precise manner. The continuing review of all rules by the 
Joint Committee should aid significantly in simplifying unnecessarily complex 
rules and regulations. 

Accuracy and Currency 

It is not uncommon, as the Joint Committee's review process moves forward, 
for agencies to conclude that portions of rules, or even entire sets of rules, 
are unnecessary. That was the case with several sets of rules reviewed in 
this report. 

In the case of the Local Records Commission's "Specifications for Safety 
Photographic Film," the Commission concluded that the rules and regulations 
were outdated and unenforced. The Commission therefore, repealed the 
entire set of rules. 

In the case of the Secretary of State's rules pertaining to a resolution 
adopted by the State Records Commission relating to the maximum standards 
for quality for permanent record photographic microcopying film, the 
Secretary concluded that the rules were outdated and unenforced. The 
Secretary therefore, repealed this set of rules. 

The repeal of obsolete rules fulfills a portion of the Joint Committee's 
"Sunset" function of reducing the number and bulk of rules. The five year 
review process has uncovered numerous instances where rules remained on 
file long after their usefulness, and in some cases, statutory authority, had 
expired. While the primary responsibility for keeping the rules accurate and 
current remains with the agencies who promulgated the rules, the fact that 
agencies do not always meet this responsibility illustrates the need for 
continuing review of rules by the Joint Committee, so that a continuous 
impetus is provided. 

Lack of Validly Promulgated Rules 

It was discovered during the course of the review that the Cook County Local 
Records Commission had not promulgated rules governing its procedure 
pursuant to the Illinois Administrative Procedure Act as required by the Local 
Records Act. Section 7 of the Local Records Act provides that the Local 



43 



Records Commission for Cook County and the counties co-terminous to Cook 
County, and the Local Records Commission for all the remaining counties of 
the State of Illinois are to promulgate rules. The Downstate Local Records 
Commission had promulgated rules as required by the Local Records Act. 

As part of this report, the Joint Committee informed the Local Records 
Commission of Cook County that it was required to promulgate rules pursuant 
to the Illinois Administrative Procedure Act. The Committee also directed its 
staff to work with the Local Records Commission of Cook County in the 
development of such rules. As of the end of 1985, the Commission had not 
promulgated rules. 



002:ar85 



4 4 






a -J 
■z. - 
< V}, 





1 ~" 













c 












■o 






c 






<u 




c 






3 






3 










ro 






9 


■o 




S 


i~ c 




E 


i2% 

re aj 




E 






u 


x o: 




c 






v 






<L 




« 






in 


O 




c 






o 






a 


a 




0) 










C£ 


0) 

CJ 

< 






n 






C 

























°-3 






•_ c 






u 






-a E 






E E 






3 






z H 






<y 






ai 






c 






c 












"O 


















o 






Qu 




•l 






c 

o 


ID 




o> c 






l- o 




0) 


i°£ 










s 


f ro o 




o 


LL IX 




o 






0) 

in 


4) 




5 


3 




CL 


"S 




V 


a: 












>■ 


















13 






O 












"=* 












o £ 






u 5 












V' t' 






1 « 






3 £ 






z O 












y 












0) 






en 






< 





go Eo 

E <c 

0) *; U- — 

Di C *. 

(0 Oj -c c 

Z c C t. 

* (B _ TO 

- a § a 

(DO) J_ 0> 



D 2 1 





= o E 




or oj 




u- *- u 






c 


tion 
Stat 

merl 
Enf 


uJ 


E.2.2 1 


8 


In for 
lllinc 
of ( 
of L 


a 


* *c c 



a a 

a -> 



45 



46 



COMPLAINT REVIEW PROGRAM AND 
REVIEW gE EXISTING k\JL E5 

Sections 7.04 and 7.07 of the Illinois Administrative Procedure Act grant the 
Joint Committee the authority to review agency rules and policies. Section 
7.04 allows the Joint Committee to "undertake studies and investigations 
concerning rulemaking and agency rules" and requires that the Committee 
"monitor and investigate" agency compliance with the provisions of the Illinois 
Administrative Procedure Act, "make periodic investigations of the rulemaking 
activities of all State agencies, and evaluate and report on all rules in terms 
of their propriety, legal adequacy, relation to statutory authorization, 
economic and budgetary effects and public policy." 

Section 7.07 of the Act authorizes the Joint Committee to issue objections to 
existing rules and assigns to the Committee the task of examining "any rule 
for the purpose of determining whether the rule is within the statutory 
authority upon which it is based, and whether the rule is in proper form." 

Part 260 of the Joint Committee's Operational Rules (1 III. Adm. Code 260) 
outlines the complaint review procedure. Upon receipt of a complaint, an 
initial review is conducted to determine the need for a full complaint 
investigation. Most of the inquiries received by the Joint Committee require 
basic information, such as copies of rules, explanations of the rulemaking 
process, or referrals to appropriate agencies. These inquiries are easily 
answered without a full investigation. Others, however, require more 
extensive research and study prior to formal Joint Committee action. 

Four formal reviews were commenced in 1985. Reviews are still in progress 
for three of these complaints. In addition, the Joint Committee is monitoring 
the progress of rulemaking by two state agencies regarding complaints which 
resulted in Joint Committee recommendations in 1984. 

1985 Complaints 

In June 1985, the Joint Committee received a complaint concerning the Illinois 
Environmental Protection Agency's use of draft rules entitled "Procedures to 
be Followed in the Performance of Annual Inspection of Motor Vehicles 
Emissions." The complaint alleged that the agency was using rules that had 



47 



not been formally promulgated pursuant to the Illinois Administrative 
Procedure Act as part of the competitive bidding procedures for automobile 
vehicle emission inspection stations. 

The Joint Committee received copies of the information which was sent by the 
Agency to potential bidders. This information included a description of the 
inspection program and a copy of the agency's rules. The Agency stated 
that the rules were provided for the bidders to use as guidelines for 
technical qualifications. However, throughout the information on the 

program requirements provided by the Agency to the bidders, the Agency 
referred to the rules and the technical requirements contained therein as 
being mandatory requirements. 

Section 4(c) of the Illinois Administrative Procedure Act prohibits the 
enforcement of any rule not adopted pursuant to the procedures set forth in 
the Illinois Administrative Procedure Act. The Joint Committee, at its 
September 19, 1985 meeting, objected to the Environmental Protection 
Agency's use of its draft rules because the Agency asked bidders to base 
their technical proposals on the specifications and requirements set forth in 
rules which were not promulgated pursuant to the Act. The Joint Committee 
also recommended that the Agency promulgate rules pursuant to the Act. As 
of the end of 19C5, no such rules were proposed. 

Another complaint received by the Joint Committee in 1985 concerned the 
Department of Rehabilitation Services' policies regarding the Illinois Visually 
Handicapped Institute, a residential training center for blind adults which is 
operated and administered by the Department. The complaint concerned 
whether the Department of Rehabilitation Services' policies regarding the 
Institute were promulgated as rules pursuant to the Illinois Administrative 
Procedure Act. 

When the issue was discussed, the Department stated that it was developing 
proposed rulemaking with input from the Institute Advisory Council, which 
consists of former Institute students and other representatives of the blind 
community, to implement its policies regarding the Institute. The Department 
further indicated that the policies from which the proposed rulemaking was 



4 8 



being developed were in place at the Institute before it became a part of the 
Department of Rehabilitation Services, and that students were informed of 
these policies prior to enrollment at the Institute. The Department formally 
proposed rulemaking to implement these policies in the May 10, 1985 issue of 
the Illinois Register . The second notice was received in December, at which 
time the Joint Committee commenced its formal review of the proposed 
rulemaking. This rulemaking was not adopted by the end of 1985. 

In August 1985, the Joint Committee received an inquiry concerning the Job 
Training Partnership Act Dislocated Workers Program (JTPA Title III), which 
is administered by the Department of Commerce and Community Affairs. JTPA 
Title III provides for the retraining of dislocated workers who have no 
reasonable prospect of returning to their old employment due to plant closings 
or other technological changes in the economy. Central to the requirements 
for program eligibility is the fact that an individual's separation from his or 
her prior employment must be involuntary, i.e., termination or layoff. 

According to a JTPA Technical Assistance/ Information Letter which the Joint 
Committee received, it appeared as though honorably discharged veterans 
were not eligible for the JTPA program due to the fact that they did not 
re-enlist for another tour of duty, thereby voluntarily terminating their 
employment. 

During a discussion concerning the eligibility of honorably discharged 
veterans for the program, the Department indicated that the issue was not 
specifically addressed in the rules and that the eligibility criteria for the 
program which pertain to all applicants were contained in Section 2620.90 of 
the Department's rules. The Department further stated that veterans are not 
eligible for Title II! simply by virtue of being veterans, however the 
occupations held while serving in the armed forces are a valid part of the 
applicant's work history, and may be used in establishing the prerequisites 
needed for participation in the JTPA Title III program. The Department's 
rules clearly state the intent and requirements necessary for applying of the 
JTPA Title III program. After discussion, the Department agreed to amend 
the Technical Assistance/ Information Letter to more adequately reflect its 
policy regarding JTPA applicants who served in the military. The amended 



49 



Technical Assistance/ Information Letter v/as distributed by the Department in 
December 1985. 

In late 1985, the Joint Committee received an inquiry regarding the 
Department of Employment Security's policies concerning telephone hearings. 
Section 2720.215 of the Department's rules (56 III. Adm. Code 2720.215) gives 
claims adjudicators discretion to determine whether hearings on unemployment 
claims will be conducted by telephone or in person. However, the 
Department's rule contains no standards as to when such discretion may be 
exercised, as required pursuant to Section 4.02 of the Illinois Administrative 
Procedure Act. Furthermore, it is questionable as to whether the Department 
has the statutory authority to allow telephone, rather than in-person 
hearings. The issue will be considered by the Joint Committee in early 1986. 

TABLE 11 fpage 52) illustrates the number of objections and recommendations 
issued by the Joint Committee in 1985 to existing rules. The table includes 
complaint reviews and objections and recommendations issued to rules which 
were adopted prior to the completion of the review. The specific objections 
and recommendations are summarized in Section Two. 

1984 Complaints 

The Joint Committee is monitoring the progress of the Department of 
Transportation, Division of Water Resources, in its promulgation of "Rules for 
Construction in Rivers, Lakes, and Streams." In 1984, after a complaint 
review revealed that the rules had not been formally promulgated pursuant to 
the Act, but had been enforced by the Department for a number of years, 
the Joint Committee recommended that the Department adopt these rules 
pursuant to the Illinois Administrative Procedure Act. The Department 
proposed rules in December 1984. However, due to the extent and nature of 
the comments received by the Department during public hearings pertaining to 
the rules, the Department ceased the promulgation effort. The Department 
further indicated that it would re-promulgate rules on this subject in the 
summer of 1985. As of the end of 1985, the Department had not 
re-promulgated the rules. 



50 



The Joint Committee also issued 14 recommendations for rulemaking regarding 
the Department of Rehabilitation Services' policies for Social Security 
disability determinations in 1984, Of primary concern to the Joint Committee 
was whether, in making disability determinations, the Department was 
implementing policies of its own and those of the United States Social Security 
Administration which had not been promulgated pursuant to the procedures of 
the Illinois Administrative Procedure Act. 

As a result of the Joint Committee's actions, the Department agreed to 
promulgate rulemaking pursuant to the Illinois Administrative Procedure Act to 
meet the recommendations. The Department agreed to propose the rulemaking 
in stages, the latest proposal to be completed by October, 1985. However, 
the Department informed the Joint Committee on several occasions that the 
timetable could not be met due to the Department's review of policies which 
were to be contained in the rules, and the fact that the Federal government 
had not yet formally promulgated its policy. The matter will be discussed 
again with the Department in early 1986. 



0G3/ar85 



- 51 



5 1 

o 
u 







CT 




















c 








































■D 




















C 






CN 














CJ 
















l/l 




D. 
















C 




















C 




















^ 
























ro 

"0 




X: 
















c 
o 

§ 


o 


c 



































3 


~ 0> 


















ro 


*~ 








r-i 


rs 


*~ 


5 


LL 


K 
















01 




























01 
















o 




0) 




















3 
















t> 




















in 








































C 




C, 
















CI 
























K 




O 




















V 








































01 




















< 


















IT. 




.'. 


















C 




































°l 


















k c 


















0) 4> 


















■a £ 


















E £ 


















3 o 




































■x 




















en 






c 








































i 




















c 




















'v 




















0. 
















1/) 




















;j 


a 


"0 


















u 



















o 


___.; 


3^ 




- 


,~ 


- 








_5" 


'It; 


01 


















!■■_. 


Of 
















o 




















1) 

in 






















CJ 


c 

Q. 






cs 






^ 


i£> 


10 








a: 


















>■ 














































■o 




















c 




















5 


















o£ 


















o X 




















a- 










O 






I: « 










«~ 


"~ 






3 X! 


















Z O 


























'3 


c 








"ro >*- 






i/i 


c 








a> 4-' 






'o 




a 








11 






c 




< 












= 


■d 


r- 
















5 

0, 








o U 




> 


c 
o 


ro 

O 


re O 


ro 


ro 


oi a. 
Q o> 




c 

< 


E 

E 


o 
c 
O 


£ 

0. 


o 5 
CD ro 

C T3 


c 

co _ 
.„ re 

8 g 


o 

ca 

c 2 


a 

■D 






o 


CJ 


<2 


C u 


.2 -J 


c w 


£ 5 






'_) 




















> 


V 


ro jfl 


re _ui 


ro _i/> 


— Q 






01 


| 


E 

C 

o 


0) O 


or c 


Oi 'o 

a c 






| 


E 




o "" 


o — 


5 — 


ro 






1 E 






J3 


X 


.Q 


C 








i 5 




U 


LJ 


3 


-J 


ro 


0) 

2 



1- J 



- 52 



PUBLIC ACT REVIEW 

Section 7.05(3) of the Illinois Administrative Procedure Act (III. Rev. Stat. 
1983, ch. 127, par. 1007.05) provides that the Joint Committee will maintain a 
review program to study the impact of legislative changes on agency rules 
and rulemaking. The Joint Committee fulfills this statutory obligation through 
its public act review program. Under this program, the Commttee reviews 
each public act filed during the year and determines whether the legislation 
requires agency rulemaking. Upon making this determination, the Committee 
notifies each agency that will be required to promulgate rulemaking and 
requests information regarding the status of such rulemaking. The Committee 
then monitors the agency's progress in fulfilling the rulemaking requirement. 

A primary goal of the Joint Committee in this program is to ensure that the 
rulemaking is implemented in an expeditious manner as required by Section 8 
of the Illinois Administrative Procedure Act (111. Rev. Stat. 1983, ch. 127, 
par. 1008). 

The Joint Committee reviewed 49 public acts where were passed by the 83rd 
General Assembly (TABLE 12, page 55), and 1004 public acts which were 
passed during 1985 by the 84th Genera! Assembly (TABLE 13, pages 56 - 
68). Among these, letters stating that rulemaking may by required by 518 of 
the acts were sent by the Joint Committee to 65 State agencies. The 
following table summarizes the Committee's findings. The tables list each 
public act which may require new or amendatory rulemaking, the agency or 
agencies involved, and the agency's response to the Joint Committee's request 
regarding the status of such rulemaking. 



010:ar85 



53 - 



54 



•otn3"0 
c c c c 
o o o o 
a a a a 
(/)(/)</>(/) 
cu a> cu a> 
qi o£ a: a: 

o c o o 
c; a> ■*-" *-" •*-' 4J 






ro ro 
in in • 



5 'ro 'io ro cn cn.ii cn. 



8 w 



a) 



cn cn. 



OJCLIDIIOOI!) 
J_i_— L.i„S_US- 

cn.L' cn cn^ cn cn cn cn cn 



0) <D 

cu a; 

ro ~ 



'■ 



<<CCjLL-LLU_LL<<Q<QU.O<<G<Q<<1J-<<<<< 



i_ •« i « t_ 

,a>.!£.!2 cn 
< a a < 



< 
ijj 

>.* 

->UJ 

l£ 

UJ X> 

cn a 

r>J LO LLJ 

i- < o: 

< LU ^ 
UJ (j 

u- 

x 

< 



j 
•-. 
a; 

CD 

< 



I 

Q. >• 

S'lS 

fls 

E 3 03 
in 

0-?£ 



c Q 
go 

_J "O 

o 



°< 
-^ . 

g> 

CO CJ 



+3 3 



■■' 



•+j -^ -^ o £ 
DDDLL -a 
u u u c "^ 

3 3 3 i- •- 

i a, q, d U 





L= 




<, 


N 


n 


■H ro 


<~ 


C X 




E-a: 

>. E z 


iL 


a. 


Q-qIq 


tn 


£ -- 




cu < < 




C Q.Q. 


X> UJ LU 



a. £ 

a "j: 

a u 
-o ^ 
o c 
U _cu 

o 
£> 

3» 



> u 

b> 



a. ~ 

° luck: 
£<< 

< .2 .2 

.-3 3 

U o. a. 



; 



c a 

CU -- 

E « 

>. in if) "5 

ro cu cu o 
Q. £ £U 

o o 
2ii • 

*£ cn cn"0 
u .£ £ < 

— m in . 
3 3 3.^ 

a. x x u 



i/> in 

£ £ 

o o 

r x 



>j 



in 
c cu 

u c.2 



cnaiV: rr>£> j» 3 



oj cn 

3 3 a o O ro 

ZZO^Gh 



£*3 

a> (j u 
in 

c v £ 

g ro 2 

a 



do « 

coffl 
b £ cl 



1?" 

ra 3 ifl 
LL £ ^ 

tj § g 

3£ . . 

.2 -a E E 
s- ~ E E 
cn^ o o 
< u uu 



ro c C 

9 o c 



mil 

cn E £ 

c c o 

>°° 

ro <u o 

LH U U 

• a' cu 
E E E 
£ £ £ 
o o o 

UUU 



2 3 



I * 

E C 
o o 
U U 



^? ro 

.2 CQ 

S 5 



m > 

c cu 
— o; 



ro *- 

— cu 

£ ° 

ro m 

.E 'Z 

ll a. 



c c 
.2 .2 

"-M '4-» 
rc ro m 

u o ^ 

33g 

■o -o •- 

LU UJ > 

■DTJ « 
C C ^ 

ro ro 



"2 2 "22. "2 2888 

<<<<<<xxx 



c c .2 

O O -M 

h'43 ro 

ro ra .t: 



J2J2XJX1XJJDJDJ3X} 
333DDDD3D 
0.0.0.0,0.0.0.0.0. 



ca cu cu cu 

_3333 

.S2 .12 ro cu cu cu a; 

cn cn.c > > > > 

cu cu cu cu cu cu cu 

01 CC CL OL C£ C£ Cl 



Oir-fNOcnnmd-cicnocncscNcriaioicnooMrocntoroor-rocrir-r-m 

TTTTTTTTT7TT7 7TTTTTTT7TT7TT77TTT 

OOCJCOOOCOMCOCOWCOCOOOCOCOOOCOCOCOCOCOMCOCOaiCOOOCOOOCOCOCOCO 



55 







< 






2E 






LU 






-J 






D 




> 


tt 




_J 


LU 




CO 


(Y 




V 






uu 


-J 




oo a 


ro 


to 


LU 


*- 


< q: 


LL1 

-1 

CO 

< 


^5 


1- 


z X 




LU 


u 




u 


X 




r 


: £ 










00 


C/) 

i— 
U 
< 



-o td ~o "a td T5 u 

c c c c c c c 

o o o o o o o 

a a a a a a a 

i/i in w w in in in 

cu cu cu cu Q) cu <U 

ttL C£ C£ C£ X. C£ 0£ 

o o o o o o o 

+j+->4_i4-'-(-J-t-> qj CU CU (U + " 1 CU CD CD Q) <0 CD CO <D 

u u u v v u £ Z* ^a^ ££££££ 

r_____t.rai.L.i. ( u ( ''Lrarra(orrara(Oti3rarar 

— — — — — — m W Si mra m l/l r^W — </> Ml rn^ </> WW l/) l/i J^s 

H3 03 fO 03 (TJ A3 Oi~ O" O) Dl— — D> — 03 — — Ol — — .— — — — Ol 

LLLLLLlLLLIl<Q<<<QD<QLLQQ<QQClQQQ< 





tj -a 










c 


c 










o 


o 










a a 










m 


in 










cu 


a 










a. zl 










o 


o 










-*- 1 


■M 


a) 


a; 






a 


c 


a 


a; 




CO 


(D U 

<y 3 


3 


n3 ro 


CD 

to 


oi cn'fo 


m 






on 


<<LLLLQQ< 



o _ 
s- cu 
a. m 

c 
cu 3 

u.t; o 

cu au 
E <fl 

< Si ,„ 



c £ 
o 

■J 



o ra 



cnaicn— C7i ro i-a J3 <u 
<<<<<>Olocl 



in in 

i- cu 

s»z 

03 03 



o co 



g»S 






c <2 




£ ° 


o S w 




r t- 


T5 <U U 

to « « 




CO £ 

°- o 


^ C Ol-J n3 

.£• - c cu 




« o-qQ 


4) 


5 rn 


■j ro ~o c 




03 •- 


O ^ 03 — U 


-"» 


a; in 






q_ ~ - 1 - in +-> 
u a> in 


3 
U 


Oi > ro o •£ 
Oi o cu l. .c 


!_ 


.bo 


ai? l 


LLlCQ:gO__l<oO|- 



c 
cu 
E w 

<o _< 
5 E ro 
ro-!2 « 

W ro m 

■§L£l 

O C 3 
l/)<X 



a> 
<u u 
ui c 

3 CD 



in 

0) 

+J CD 

5 *!?■ ^ 



e 

Q. 

cn 

i. 
Q 


13 

< 

CD 
3 
L. 

Q 


t/1 

a 
o 


ID 

QJ 

C 


■a 

3 
P3 
<^ 
LL 

s_ 

£ 


c 

CD 

£ 

O 

> 

n 


c 
cu 
U 

cu 
X3 

ro 

H 


U 

< 

in 
O 


•o 




u 


c 


E 
u 


in 


cu 
a 


15 
s- 
O 


2 

'5 


U-Q<U>OC3^CQ 



CU 0) cu 
in in in 
D 3 O 
12 13 J2 
<<< 
CU CU 0) 

u u u 

c c c 

CD CO fO 

4-J 4-> +-> 

in in in 

3 3 3 s_ i_ 
CO 00 00 CU CU 

c c _ 
cuacuacucucucucucucucucucucucucucpcu ^ n c n 5 

3333333333=>3D333D33^^^ >>s 3 

aiaiaiaicnaiuutjuuuuuuoutjouuuuoux:^:^:!-!- 
.E .E .E .E .E .E C C il il H "C Z Z il C u C *u C C s_ i^ \_ C ° ° ° c ° ^tu 

cn'cnoi'oTOi'oSaicioioioicnaioicnoic^CTOTOicrioiCT 

<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<CQ 



JZ 


r 


4- 1 


o 


J 




< 


ro 




(j 


c 


3 

■a 


F 


lO 


a 




o 


<\> 






0> 


j_ 


> 


01 


G 


X 




H- 


0) 









ro 


X3 


00 


m 


._ 


CJ 


CO CO 



U3t^-Or-cr>LnoooroiO(N 



o ^- t- 



ininoOr-^NiNrninmcocoor-fNtTioOi-mioiNrnoM-^i-hioiD 
fomnmoioor- ^r-i— t— (NNiNNrMrororocrr-ioMMiNCOr- i-- 
i I I I i I i i i I I I I I i l I I I i l i i I I i i I I 

oooooooooooooooocooooooococooocoooooooooooooooooooooooooco 



ro r^ ai 

=r ^r o 

n in r- 

.=r x- =r 



5b 







•O TJ "O 






C C C 






o o o 






a a a 






10 (/) 1/) 






GJ QJ QJ 






a: oi qs 






o o o 


GJ <U <U 




+■' +-• ** a> o oj <u 


QJ 0) QJ 




^"^^ 


1_ L. L. 




cn cn cn 

ro ro ro 


o 


5 ^ 5 cn en oi ci 


LO CD CO 


^ 


— — — i/i ui tn to 
ro fa ro — — •— — 



£i_i_s-roro££ra£n:ro£ 



Cn CD CD Cn._ 



cn.:u .^ atjm cn enen cn 



QQQ<U.u.U.QaQQ<<<<lL<<a<<<<QQ<<0<3Q<Q<<<< 



.15 

3 c 



H<i 



y 






Jr. a; to ro .. 

.ti - 3 3 O 

£ O 13 "O C 

nUUJUJr 






.IT, 
0) O ^'.^' 3 

to a x x m 



0) 



= ce 



lu < a, 



c 
o.2 
< £ 

in 
co O 

■5 0. 

c _ 
~ qj 
— c 
"~ c 

2S 

3 Si 

CQ 0. 



co 

to qj qj 



a) a> 

CO L0 

n <u o> 
ro a a 
a x x 

to uj uj > > 

£ > > aa£ 

St fO f0 o O r 

<^ I- I- a. a. u_ 



C Q._ 

qj p a; 

ffl ll3 | 

& ro s- 
ro .m a) 






.E TO 

ro ~ 



vy vy w ^ w ,. ^f 



E o 

.E « 

J2 c 

-C o 

U (A 



c 
,2 
cn • ro 
c cn u 
'E 2?'E 
ro to E 

CD E 

s- qj E 
ro <u o 
oq >* u 

o qj 

® a« 

.^ EH 

ti UJ 



-' 



QJ 

o sz 
£ ro 

UJ o 



■■ 



.„ +J QJ 

-J to a. 



Uro ro ro ro ro 
+j +j +j +j ^_ 

Qtototototoato 



4= =5 



ra h l-^ 



3 a; 
a. a. 



co 2 

o5<J 
(J L) Q 



qj a> qj 

CO 01 CO 

3 3 3 
ro L0 < < < 
to -o "O -o 

>»U- ~ ~ ~ 
roU£££ 
QQ U O O 



(J 






L-< 


X 


u 






rv. 




- 


;•', 






i» 


< 


in 
LLI 


, 3 ) 


5 
jE <u 






1 


...■ 


u «- 


Lt. 


C 




j-; 


ro 




o 


m 


< 


-0<~> 


i 


•■-•' 
Q, 
O 


■V 
D 
O 


5 


to T5 
3 — 


(.A 


•D 


L 


JD £U 


<a.o<(JQ 



c c c c 
o o o o 



T5 -O 



13 

CD 

>. to i/> 

4- a; a) 
o u u 



CO CO CO (/) CO CO 

o <u a o o d) 
u u o u u u 



lOlOCOlOCOWLOCOCOCO 

<u<uflj<uccjQj<ucu<y 
uuouuuouou 



V" 


•:- -' 


'■P 


-f^ 1 


Ti 


ro 




1 

(■ ■ 


ro 


iti 


ca cq 


3 


-• 


- 


3 






•D "0 'O X5 




C 

.I? 


UJ LU UJ UJ 


!_ 


t. 


v. 


!,. 


E 


r- 


a> 


--„ 


CI) 


CJ 


a. a 


jr £ jz x: 


o 





.? B 1 .?.? 


<D 


QJ 



X X X I > > 

-•- -*- - 1 - - 1 - a; qj 

^4_ ^-^- QQ 

o o o o 

L. S_ L. L. «•- 

ro ro ro ro Q. Q. 

o o o o ro ro 

CQ CQ CO Q u u 



ro > > 
met. 

OJ QJ 
QJ CO CO 

2 4J +J 

oE c c 

QJ QJ 
QJ QJ 0; 

3 ro ro 
E c c 
< ro ro 
55 



ro 

> ro ro 

•- v. t. 

C -H +-> 

U C C 

ro qj qj 
UUU 



>>>>>> 

t. t- S- S_ S_ L. 
QJ QJ QJ QJ GJ QJ 
tO tO tO CO OT tO 



c c c c c c 

a qj gj qj qj a 

E £ E E E E 

GJ 0) QJ QJ QJ QJ 

cn cn cn ai ai o 

ro ro ro ro ro ro 

c c c c C c 

ro ro ro ro ro ro 
5255 25 



>>>>>>>>>> 

C.US-1-S-t-t-L.L.L. 

Q^QJGJQJGJCyQJCJCDQ) 

COUOtOcOtOLOtOtOtOtO 



cccccccccc 

QJQJQJQJQJQJQJQJQJQJ 

EEEEEEEEEE 

QJQJQJQJQJOJ0QJClJaj 

icncncncncncncncnaricn 
rorororororororororo 

rorororororororororo 
5555555555 



CO t/1 
QJ QJ 
U U 



cotocococococococo 
QJQJQJaJQjQJQJQJQJ 

uouuuuuuu 



>>>>>>>>>>> 



" QJ QJ 

*-> to to 

QJ > > 

E = = 

a> E E 

cn ro ro 

ro LL LL 

c 

ro go oo 



1_ 1- s_ s_ 

QJCUQjQJQjaJQJCUQJ 

oTtototoiototrjtoto 

■^^^^^^^^^ 

E £ E E E E E E E 
rororororororororo 

U.LLU.LLU.U.LLLLU. 
oOcOoOuioOoOoOcOiO 



cccccccc 

Q)Q;Q;QJQ)CJQJa. , 



C £ C 
QJ GJ QJ 



c c c c c c 

GJ GJ QJ GJ QJ QJ 

ouuuuu 



cccccccccc 

GJQJQJQJQJQJQJQJQJGJ 

uuuuuuuuuu 



T0 - D-O _ DT>"U - 3 _ OT>"D - a 



qjx:x:£:x:x:jcx:j=x:^:x 
uuouuouuuuuu 



cooud i- CDoofOOOiinair^roMLD^DcncnooLntNit— vxsr^roi— oocofMcoiooo**r- r-co 

fOOrMOO^ClMOr-WSO^O^d'^COfMfOinMNOa-lDlOVCNCnOMffi^r-rO* 

miohco r- oiLOOt—i— r-T— NNtoroMM^a'ocotacftoiOr- t— i— tsmroa-inujcoifl 
i i i l I I i l I I I l i i I I I i l I i I i i i i i i i I i i I I i i i 

oooocooooooocooooocooococooocoooaooocooocooocooocooooocooooooooocococococo 



- 57 



■O "O "D T3 "O "O 

c c c a c c 

o o o o o o 
a a c. a a a 

V) Ifl V) V) V) (A 

<y <y <o o <y 

o: a: a: q: a: o£ 

o o o o o o 



<y cy CD a) o CD 



«(ucj(i)a)<U(U(UQJ(i;fl)rarara <ul - Ll - LLU ninira <uc 'ni l] ' <u n> 1,LW(l 'ra^ 
ooa;a<ua>cucua)<ua;S'^^'<uaD33a3Sm^^^S a ^m <l, 3<i)<i)°'a 



-s_us-i-s-i-.s- n '' 1 3 ro s- — — — — — — roron: 

cncr. aicncnCTCTcr. aiai cn.!£ .12 .£ 01 « "5 ra ra ra ro •- •- •- 

<<<<<<<<<<<QQQ<LLU.LLLLU-U.QQC<<J<<Q<U.<<Q< 



03 5_ i_ ro 

en en.- en cn.!£ cn"c5 cncn.L' en 



c 


c 


•-■ 


3 


..'I 


< 


E 


b 




- 


0. 


m 









-1 





O 


cr 


u 


. 


UJ 


= 


1/) 


>■ 


■n 


H 


■■■■ 




U 




3 


Q C/> CQ 



U- CD 

3 o a; 

qN +: 

CD *J= 



(/1 



c 
£ 

0) 

S 1 <n 
« a; 

™ o 

2 M 

1 a; 

I? 

-^ 1— 



c 
S 2 3 -5 u £ 

— C 3 •- U o 

U lu a. U a u. 



E 
a 
c 

> <u C 

a; c i: 

O o i/i 

E '£ - 

O s_ 5 < < s_ 

a .22 «- UU « 

E c SOU c 

UJ UJ < Q Q UJ 



ID D 
■ y y 
5 25 

3 3 

a. a. 



in vi 

<D V) 

II 
= 3 

y _ 
u E 



c Si 3 

— U t. +j 



CO 



c g ui +5 

03 O 3 VI 

a- 1 t- c 

lO 03 



3 3 



.± -* 



£ 12 " 3 > c 

<U 3 « l- Jo 03 .£ 
> 0. UJ h- 10 QQ LL 



E 
E 
o 
O ^ 

03 ^* 
O 



o 

c c 
o 



03 



.ti a 3 

3 §>£ 

z: v> 

C Of d) 



vi a) u c 75 



V) ~ 

01 

1/3 CG 



•J > E w jjj c -o 

J- 3 Q.«J fc- y 

o E e a> a. 2 1= 

c £ Si £ £ - -Q 

CD O C CD O 3 3 

l^UDUU03l 



v> v> in vi v> 



V) V) 

c c 

in in ifl in in 5 5 
3 3 3 3 3 O O 

S_ i_ t. !_ 1_ — I — I 

"iwi/ii/imifluiifliflininifli/ii/iifl H- H h - h- r- ^ ^ 

0<Di_i_s_^i_i_s_t_i_i_j_l_i. _ _ _ 

— — 030303 03 0303 03 030303030303 ^^^CnOl^^^ 

« a<<<<<<<<<<<<< c c c c c c-^^^-^-^.£.Eoo^ 

^^ 2 000 22roo5oi >> 

>. > E £ E £ E E E £ £ E E E ESS S SSSoocaDD^JJg, 

•-'-EEEEEEEEEEEEE'rrrrc'rWVVif.WtUlID 

E£ooooooooooooo = ££E£E 0000000 — — — 
roraUUUUUUUUUUUUUEEEEEE 000 

u_u_ oooooou.i_ui_t_s_t.r)(jQ 

(Ddjdjojiu^oaja'oajDDiDaiip^fljajOoooooo+j+j+j 

£ ?, u u £ £ u u u u u u if u u u b! t? u £ £ '^ '«« '"' '«" « ' S ,JJ5 C C C O O O O O 

-D-uEE£EEEEE£££EEE£E££E£E£EEE£EE£aaaca 
-•-EE£EEEEE££E£££E£££££EEE££E££EEEEEE 

JIXOCOOOOOOOOOOOOCOOOOOOOOOOOCOOOOOOO 

OOUUUUUOOUCJUUUUUUOUUUUUUOUUUUUCJUUUUU 



loair-i/iiDiiiinaiM 

foo^iDDJin^crir-ouuiu 

cnt— 1— 1— t— rMoor^r~-oooooocna>mintoa3oj 



(NOror^hooN^^MusaiMinommoicocinOfficnin 
cocncnoiOror-i»5cnr>t- =rooo^tor- - 
^ in in 01 t- in in 



C003COCOCOCOCOCOCOCOCC1COC00005 



zj =r 3- ^r ^r 



00 co 00 co 00 CO 



in 
. , ONMWtf (N 

mino rsiNioco 
l 1 l 1 1 1 1 

COCOOOCOOOCOCOCOCOCCCOCO 



58 



l/l 

c 
o 

Q. 
in 
Q) 

at 



O "O TJ 'O'D-D-OTD'O-U-OXS'a'D-OtJ-O 

cc c cccccccccccccc 

oo o oooooooooooooo 

Q.a o. aaaaaaaaaaaao-Q. 

a> a» <u a)Gjaja)<uoj(i;<ua><u<uo<va> 

a: o: a: 0:0:0:0:0:0:0:0:0:0:0:0:0:0: 

00 o"0 oooooooooooooo 

CU D O O <DO(Ua)<D" , -' +J <D +J<U <l> Q ,4~>4->4->4J4->4J4-<4->4->4-l4-l4-<4->4-> 

.52 cn cn en 01 cn.2 .£ .S2 ai.52 .22 J2 .2 .£ „ 75 £ 73 c J2 c*.!2 75 73 73 75 75 75 75 73 75 73 ro 75 75 75 

□ <<<<<2QQ<QQQOOLLU.QU.DQ<QU.U.U.Ll.LLU.U.LLU.U.U.lLlLLL 



o o 

<£ 

.2 2 

s_ ._ 

ra 3 
>co 



■•■■: 



O > -o 
O ro = 



.C 

a o: 
■a 

o o 

or 



O £ 



a u ^ u_ 1 ^ 



ro co 
i. s> C 

O 
1/1 id — • 



cn ro 
a> a> > 

o: o: *- 

ro ro C 
OOO 
01 CO U 



3 9 

o :- 

■— I/) 
C £ 

I? 



1 

'j' 

W £*4_. 

.2 a< c 

■it-,— ro 

-J -H __ .y\ 

+■• *- 2 "a 

Q. J- .- c 

a» o 3 ra 

Q O CQ _I 



E 
a 

O a; 

"a3 .2 

<U D CO J- 

</, ou- o 

c era 

o • o -J 

? 5» 'I - 

O W 3 ȣ 

i- co "O C 

0- LU LU ZD 



u 

IT, C 

Irt CO 

4) S_ 

C 3 

0) 00 + _ / 

CO £ u 
< C 1/1 

ago 

ro >•- 

3 © - 

cr a 

LU D CO 



... 


r> 


u 






^ 




w 


u 


n*, 






U 




"1 




- 






<. 




z 


C 
u 




>» > 


(/, 


r 




3 


-- 


cn cn 


r> 





r 

.2 
'■*-> 


CO 

1 0: 
< 0: 


c c 

LJJ LU 
1- i- 


71 


75 


--■• 





'I 


_ro 


re. 




t. 



CO O 

o: Q 



uj o O 3 ._ 

Q co co co < 



c 

I? 

^ 

<U CO 

> cO 

a; 

OT5 
' -| 
< o 

o. -c 
LU U 





4-1 




T3 




73 




C 

> 
CD 


.'."), 


u 




4_i 


!_ 








■',■) 


f" 


U 




r; 


CO 


< 


E 


0! 


LJ_ 


i/J 


•■ 


c 


> 


O 

c 


£ 


'.,,.. 


u 


- 


L, 


r" 


~~ 


.--.j 





«-i 


— 




t/i 


O 


2 


E 


ra 


b 


:j 


ra 


^» 


LU CO LL 



u 

c 

< 











: i; 






^- ^ ^ ^ ^ 

u u u u u 










u 


<C in in in 1/1 1/1 ») 


c c c c c 

CU a» 0) <D 0) 














cncncncncn>^>.> 








SZ SI 


— £- 




<D 03 <U C CJ 0) 
u U U U U u U 


< < < < < a ±: .t. 










+ J 


(D U S_ S_ <- !_ i- 










3 3 
<< 


J) 3 


< co 


£ 3 3 3 3 3 3 

£ OOOOOO 

™ 1/1 (A 1/1 in v) 1/1 


cccccooo 
000 oox:^:^ 
■^3 "43 °JZ '43 '^ tf tf t^ 

a)<ua<u<u<<< 

+J U +J 4J 4-t 








u u 


'E>- 


cu 0: 


q ^0: 0: 0: 0: 0: 0: 








c c 


d) (D 


."t: u. 


's ,___ 


OOOOOw-'^+j 








ro co 


CO Q 


— 


^Dtofororararo 


t-L.s_s_i-cCC 








c c 


0^ 

CO CO 


(J i- k. i_ i. s_ l_ 


clclq.o.0. <v a> a> 








il IT 


C W 


^0)333333 

<J to ro ra ro co 


EEE 


cccccccaccc 






•M 4-1 


.2 5 


u 1 


rccorococoClCLQ. 

4-4J4-I4-I4JQOO 

ccccc — — — 


.2 .2 .2 2 .2 2 .2 2 2 ° 2 w w 


t/i 




c c 
a> <u 


jo - 1 
. 

CL CO 


To To 


>^zzzzzz: 


'4_> +3 '4^ '4J "4^ '^j '^3 Vj '^ '43 "J c c 


ruajcuaia)^^^ 


cocococorccofOcoracocooo 





,0 


E E 
a 0. 



c c 


<1> <U (.O lO oO tO tO 00 


fpppp>>> 
= = = = = <ua><i; 

0000 oQQQ 

S_ S_ L. 1_ t_ 


>>>>>>>>>>> '43 7S 


I"; 


«J 


.2 .2 


co E 


<ua)cuci)aJa)CL)<Da)cu(i)(D(u 


•;:; 


1: 




(0 ro 


• cn cn rji cn cn cn 


u)inc/)(/){nv)<n(/)(/)(/>(/>i_&. 


i_ 


L. 


75 "S 







1--LCLLCS. 


.b .b .b .b .b £ £ £ 
>>>>>l_i-t_ 


cccccccccc:cs_j_ 


s_ 


?_ 


> > 


> £ 
— ra 


3 3 


ClLij)(U(i)(Dj)5) 


0000000000000 





O 


<u <u 


-0 -0 


cECCCCCC 


CCCCCmmm 


UUUUUUUUUUUUUUUQQQLLlLULUliiaiLUlULULllLULLlLyLULUUUJlIli 



m cn 00 
cn m 

O r- .- 





c 
in 


m 


ro in 
r-j r- 
ct in 


to CO Zf 
^- r> 00 

0010> 


CM 1^- 

r- CO 

t- 


^- j- =r 

00 CO 00 


CO 


co 




CO CO 


sj- 3- cr 
00 00 CO 


=r =r 

CO CO 



OOlOllDiOCMniOMDClOlr-CMCOr-OlCMD 

^■lOOmrNr-oicNtNCNOO^uico^omiB 

iNtDr-mCOU5CTr- r^-Oi— t— 1^ 1^ N CO r- ID ID 
I I I I I I I I I I I I I I I I I I I 

cr=rcrcrcr=rcr=r=r=rcrcrj-cr=rcr=r=rcr 

COOOCOCOCOCOCOCOCOCOCOCOCOCOCOCOCOCOCO 



cm r~- 
in in 

co cn 


o 


o 
o 


St 

LO 


=r =r 

CO CO 


CO 


cr 

CO 


cr 

CO 



- 59 - 



LL3QQQQa<Q<OQQQ<QQlLlllL<U.lLQQQLLQlJ.QClU.Q<U.QQ 







-O'O-O 




TJ "D 








"O 




■o 






■o 






T3 






C C C 




C C 








C 




c 






c 






C 






O O O 




o o 








o 




o 






o 






o 






a a a 




Cl Q. 








a 




a 






a 






a 






m m w 




(/) </) 








en 




w 






(/) 






w 






0) 0) 0) 




0) 0) 








CD 




0) 






CD 






CD 






oia: & 




a: a: 








LI 




a: 






a: 






QL 






o o o 




o o 








o 











o 






o 


0)0)0)0)0)0) 0) 0) CD 0) 0) 




0) 0) +J +J +J 




■M +J 


OJ 


CD 


CD 


+-> 


0) 


+-* 


CD 


4) 


-t-" 


CD 




•^ 0) o 


0)0)0)0)0)0) 0) 0)0)0)0) 




agre 
agre 
lure 
lure 
lure 




0) 0) 

i. •_ 

3 3 


cu 


CD 


CD 


CD 


CD 


0) 


CD 


CD 


CD 

i_ 

3 


CD 




« 0) CD 
W S_ t_ 


cti ct> cti ct> ct cti £ oim ct> ct cti cti 

rorororororoiCOtrocororo 


0) 


CD 
CD 


l_ 


!- 


!_ 


s_ 


L. 


s_ 


i- 




CT) CT) CT 

(0 (0 (D 


3 


CT) 

TO 


'— 


CT) CT 
ro ro 


01 

ro 


c 

0.' 
S- 

CT 


t en cn 

.=1 03 TO 


u)wi/)ifti/ii/imi/)j»iflifli«n 


CD 


in in ._ — — 


CT 




I/) 


tf) 


in 




l/l 




(/) 


(/) 




i/i 


— (/)(/) 


•— •— (0 ro CO 


'co 'fO 








ro 




to 






ro 




ro — — 



3 X 

♦^ in 



0) — 

> o 

O co 



U C 
O CD 



jcnxoiu 



c 
>. ro 

u o 

C -1 
0) 

o>« 

0) l/> 
U LU 

c 
g ro 

h CD 
U. ££ 



2< 



— t/i 



.c i/> 

u i 

"o r 

§:> 

ro </i 

u 0) 

1" 

C o) 



u. x o 



3 

o 



CD 



■T- 



C 

c o 
.2 ^*= 

+-. > 3 

ro CT o 

l/l O 0) 

i/i i/i in i/i i/i Q.._ 
£ E 
o 



si si si si 

CT) CT) CT) CTl 



£ 

O Q£ qc cccn DC 

c 



it 

I! 

-J X 



c c c c 

ro ro ro ro 

£ £ £ £ 

3 3 3 3 

X X X X 



O CD 
i- CT 

a. o 

& ,n ^ ♦= U 
„ 12 U « C 
0) 0) 



0) jr (/) 

« « £ 



CD 
?"8 



'."' 



.X .* 



ro 

£ _ 

3 o o ro 

x^ss 



C w 

JE c o) < X-' a) o) 

a. o) u x u u 

_ O C tf> c c 

ro ro — "1 ro 3 _c ro ro 

ro — ■ i_ © J - 



CL 3 



C X 



m t- a. [« i- ro 
X. CD ro r ro <W 
h QH->X 



<? t/) 



3 3 



i/i 



CT 

C 






vD 

CT 














W 












1/1 


01 




£ 


CD 


0) 


CD 


CD 


CD 


E 


E 


£ 

_0) 


ro 


CT 
O 


> TO CT CT 

OOOO 


ro 


ro 


ou 


J 


















(V 


CD 


a; 


0) 


CD 


cu- 


0. 





CD 




U 


■j 


'.' 




ll 


U 


U 


u 


> 

U 

c 

0) 
CTl 

««f* 


c 


c 


c 


C 


c 


c 


c 


c 


ro 


ro 


ro 


ro 


ro 


ro 


ro 


ro 


L. 


s. 


L. 


s_ 


L. 


i- 


L. 


L. 


3 


-5 


3 


3 


3 


3 


3 


3 


IT. 


tfl 


'.0 


(1) 


(/) 


L'l 


W 


W 


c 


c 


C 


c 


C 


c 


£ 


c 



> 
a) 

ccccccc LJ o 

v..2 -2 .2 .2 .2 .2 .2 • "•£ 
^•'.3 +3 43 +3 '3 Vj '-3 p ro 
•-3333333£> 

O +3 ^ ^ ^ +j '43 +3 O 0) 
-i-WUllflt/ll/ll/lV) 1 — '(/) 

< _ _ c a. 

0) .2 .2 .2 .2 .2 .2 2 — u 
u "u 'u 'u 'u u 'u 'u °- T 

CCCCCCCC .0 

rororororororofOv.-t-' 
c c c c c c c £ 5 w 

LiZiZiZLiZiZLox 



C C 3 c 

.2 .2 .2 .2 
(/>(/){/)(/] 

i/i in ui w c £ 
£ £ E £ .2 .2 

FP C F ui in 

oooo.K!.!f! 
UU U U E E 

ifli/iifli/iwi/iii 

+J -t-J +J 4-J 4-J +- 1 OO 

^:x:x:j:x:x:UU 

CTlCTDlCTlCTlCT) 

5 5 C£ c2 5 dZ .2 .2 

rorororororoi"ii? 
£EEEE£ D 
3 3 3 3 3 3 



X X X X X X 



0)0)0)0)0)0)0)0)010)0)0)00)0)0)0)0) 
UUUOOUUUUUOOUUUUUU 

cccccccccccccccccc 
rororororororororotororororororororo 

333333333333333333 

TJT3i/iininiflwifli/)i/)B»)i/)i'ii/)WinK)i/)i/) 
cccccccccccccccccccc 



coaiOfsj^r-OMrnoinfiina-inciOi-hr-ai^jiooroinhOMOMair-coo 
raoi^iooo^o^fNO=rix>^roocjotx)ir)inooo<-Ni^-iooooMrgoooLr)OOr-r^-r^oo 
3-i— * 3- in r^ 01 r- inor^^in^^crir)^^ofNfNtNic-~4(NfNroro^r=rir)Lnini£ivi5<X)0 
1 1 1 1 1 1 1 l 1 1 1 l 1 1 1 1 1 1 l 1 1 l 1 1 1 1 1 l 1 1 1 1 1 1 1 i 1 

COa300COOOOOCOOOOOOD0030COOOOOcnOOCOa3COCX30003C0000003COCO<X)OOOOOOCOOOCOOO 



60 



0) QJ qj 

<y a) a* 

u u u A) 
cn di cn g 
ro «i to £ 
Cn 



cn cn -, 
fa ro jd 
w *2 -=5 



cngj g cncncn£ cn oi cn g 



i_ ra ra fa j_ 



■a -o 

c c 

o o 
o. a 

</> i/> 

qj a; 

a: oi 



=. :=. aj qj +-» 

D> 0> QJ <y jg 



a> <d a; 

0) <U QJ 

L L i. 

cn $ cn cn 



cn.L' .: 



cn 



QaQ<QQU.D<<GQQ<QQ l 3<Q<QLLlLQQ<<Z 



cn.£ 75 -js .!£.!£ cn 5 © J2 cn.£ .2 
~ o < g a 



o 
£ « £ 

c_ ro _ fa 

=» 1/5 — (/I 

cn— ro — 

< a u. a 



c 
o 

ro 

CO 

C 
<D 
Q. 

e 

o 
U a) 

<U o 



in 

.2 

'E 

to to 
Q. s_ 
E © 
o£ 



M cn.£ 

Sis'E 

cn o T3 



> O < X < 

u qj qj a <y 

a» o u u u 

a c c c c 

v> ro ro ro ro 

O i- L- i- %m 

^- 3 3 3 3 

■K w w wi w 

£££££ 



c 

0) 

E 

0) 

J- — 

'5 . 
o* a 

e o qj 

s°£ 

c £- 

ra £ ro 

Si? 






c jr 
c 

'■£ "^ 
« f, x 

s- 0» ro 
oEh 

U Ift o; 
O 3 +j 

Up (3 

c 5 * J 
_ < i/> 



c 

.2 > 

■£ w 

ro i_ 

c a 

lo 

u c 

ra 



a; a; E 

> > 3 

T)°° £ 

— a a ••? 

•$ e E i 
O uj uJ 2 



a: > c 

i- '43 qj 

£ o ro E 

g-Si= > 

« c 

2 = £ cn 
E ^ "D to 
<<J<5= 



O O 

1° 

a:.? 



LO O 

E5 
s_ 
ro QJ 

QJ -M 

s- ro 






t | 

a d 
3 a: 

£ « 

ri cn 

LL < 



t/» <u 

qj _* 

c .- o 
o:=3: 

■p-S- 

3 5.2 



a o — S ^ 3 



r.l 




") 




c. 








1/1 




3 




n:< 




OJ 








ro 




r 




a> 


X 


u„ 


ro 


"~" 


H 


o 


QJ 


t: 


ro 



S LO 



u 

C 
QJ 

u 

< 



QJ 


OJ 




o:: 


0) 


OJ 


.-!■ 


::(': 


U 


u 


u 


U 




' 




u 


c 


c 


'. 


r; 


C 


c 


>" 


c 


ra 


ro 


-■' 


('• 


ra 


; vj 


''-' 


ro 


L- 


s_ 


L. 


u 


'-,„ 


L. 


L_ 


i^ 


3 


3 


?' 


3 


3 


3 


3 


_' 


Vi 


U) 


r: 


; i 


c; 


W 


o-i 


!.'! 


C 


c 


c 


C 


C 


C 


C 


£ 



U0Cni/)l/)L0t/>t0t/1l/) 

• QjQJQJajrjjQjQjaJO- 

ry S • 222S222S3< 

rCCC rororororoioroforo 

~00 — (rttfli/ii/iifli/iwi/iiflr: 

e m w"tfi£ bb55bb555§ 

■O .S2.S2H ^ 

**■ o | | • >>*>>>' > > > > . 

r cEEt; QJQJQJQJQJQJQJQJQJ^uO 

o £ocjO QQQQQQQQQ37a 

QJ ^ . ^oOfOoOoJiOiOuSoO^^ 

E aj£C; rorororOiororororoE 

C ^OO^ QjQJQJQJQJQJQjQJQ;aj"D 

§ £<~>0^ XXXXXXXXXLLC 

-Or5o^fer5r3r5oo5§§7aSS--------- • S 

^-orororcjfarorororororoa>.— .— ooo < i' (y< i ,< i }( i J< i ,< i ,< i J ^ — — 
*--,_J_i_i_i_j_i_i_i_i_i_i_j_i_i_i_i252^SS2222^ 



mrNLor-sTr-cn^i-ooi— <r>mr-cMromrococr 

>-tfoajmcD(»ooorsntMMfonNOiooN 
r^r~-cococr>CT>cnr-^orN=j-LOu-)ininvor^oo~" 



=r 

=r S3- 3- =* 

CO CO COCO CO to 



CO 

vor^r^^troT— c7»r-~rNcn^T— csooOt— 
— LncocNm<x>or>itorQ(£>r^o»— ocn 
cn r>t m =r -*■ 



— ' w^ * # w *«•* ^A^ ^^ *"^ *-f fc-1 »-H v# \- 1 I ~* W* W * -^ l U t *-^f \ ^* K' I >A^ *^ V ^* SU *' / Si-* I ^ *^ 1 **^» V ^ 

»cooio^cnr>ofNfl - inifiir)inior^cooococoa-r-(NfNMS-3-inrNcoc7ior-rN 
i I I I I I I I l I I I I I l I l I i i i I t I I I i I I I I I I 

sococococococococococococococoaooocococococococoncocococococococo 



61 - 



(U 4) 0) <U 

o <y <d 

i_ S_ 1_ Sw 

en en en en 3; 2j 

i-o ro ro ro l t 

I/) V) (/) V) 



ro a: 









fO TO _ 

en en en en en en .n .^ .2 .£ en cn.2 .!f? en.if? .52 .£ en ai en 6VH2 .!£ eh en en cn.2 cn.S2 .12 en en 

<<<<<<aDQQ<<QQ<QGD<<<<QQ«<<a<QQ<< 



01 


<D 


cl< 


™ 


1' 


+-> 




u 


',': 


71 


::*. 


in 


ro 


n 




a. 


;» 


5 


o 




a; 


cu 


0. 




> 


> 










o 


> 


I • 


D 


in 


ro 


ro 


+-> 


o 


O 


c 


r:j 



x ro 



■o a 

ro ro 



03 

J 

C 

^ in ro 

ro s- "^ 
C/) O _ 

^ ro 

i_ o 

s^ u 

U 0i< 

3 i a. 

2 X LU 



in 

j~ 
o 
■*-> 
ro 

en c 

.£ a 

c c 
o — 

M 3 

< < in 
Q_Q.ro 
LU UJ ^ 



i- en 
V) .£ 

S- U 

< I 

Q-< 





CD 


<L> £ 


^ ^ 


u <u 


-* £ 


c £ 


m ft 


ro o 


QJ N 


C X "O 


I- +-> 


x m< 


<^u 


_C c u 


£ U 



J) 

£ 
o 

X 

en 

.Era 
in "s_ 

Is 

£ 



s- .a 
2 O. 



_ .a 
<< < 



■a -o X3 



rj o 

._ <y 
U CO 



o 

_ .c 

XI U .Q R 
3 3 3^ 
0. Q- Q. < 



U U U U 



1/1 

1- 

c E 
o .£ 

ro .c 
s- N 

S< 
TJ jj^TJ TJ T3 T5 TJ T5 

.y ' .y .y .y .y .y .y 

3^-333333 

O.OQ-O.O.O.Q.O. 







>- 






U 


in 

O) 

c 




c 

rtj 

C 


a> 




0) 


'0 




a. 


3 




■ — 


a 




in 


i 


TJ 









< 


0) 


<r 


01 






_ro 


o 


ro 
U 


<~ 






i_ 


£1 





ro 


3 


4) 


«=: 


0. 


^ 



"O T> TJ TJ 

s_ j_ i_ i_ 

ro ro ro ro 

o o o o 

en co cq ca 



o o o o 
SSSSScooo 
L L L «_ c 5 S 5 c<<<<<<<<<<<<< <<<<<<<<<<< 

-= — — — — D 3 3 D — — — ~ — — — — — — — — — — — —— — — — — — — — 

U U U O U — — — — JDXiJDXJXlJ2jaja^jajD-QI2JD£>JD^X)ja£].O.O.Q.O 

3DDD3oo003J323D333DD33DDD333Dai53^ 

2222120.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0. 



r- 

co 




cr. 
— 


en 
.3- 


o 


ro 
ro 

cr. 


m 


CO 


3" 
o 




-J" 


CO 


co 


CD 



io in r^ rs m in ro 
r- o in rs co (N co 
«X) r-~ cd o t— oo m 



r-r^cooocorsfocoro 
(\iino(Niohr>mr> 



a-injmcocom 
orstnin co 



OMiohMnhootsuiincoO'- 
LnLninininM^cooocococooocncn 
i i i i i i I i I I i i I i i 



cococowoococococococococooocococococococococococo 



62 















-a 






















"0 














c 






















c 














o 






















o 














o 


















CD 




a 














in 


















CD 




en 














CD 


















S_ 




CD 














a: 


















01 

en 




a: 














o 




















o 




CD CD CD CD O CD CD 






0.* 




+J 


03 


CD 


a» 










CD 


^ CD CD CD CD CD 
LJ CD CD CD CD CD 




CD CD +J 




cd cd cd cd cd cd cd 






CD 






2 


CD 


"' 


o> 










CD 




agre 
agre 
lure 


03 

V 
i~ 




aiaiaiai £ & cd ^ ^& ^ 
foracocDr~i_.coro.co 




0! 




CD 
CD 


i_ S_ i_ 

a> ai ai 

CO (0 to 


CD 


cj 

0) 




0) 




rrarora£ra£ra 


CD 

"J 
---- 


.£.!£.!£ .!£ aicx. cn.if2 .£ o>.£ 


a> ai 


,..: 


C7 


CO 








a> en ai en 




ai.iS .£ .12 o).£ oi.!2 


On 


— •— CO 



<2QQQ<<<QQ<a<<0<lLQQQ<<<<Q<QQQ<Q<Q<QQu. 



22?x 
<< o£ 

— — j. CD 
■Q.Q W *£ 
3 13 CD 



CD 

£ 
o 

E CD 

I- to 

CD CO 

JZ CD 

[— in 
I.2 5 

o. e " 

?i Q 



u 

CO 
LL, 

3 -s 







CD 






CO CD 






CO (/) 






CD CO 


[„ 




in cd 


II 




•- in 


L. 




£> m X 


o 





Q 



>>? 



C CD CD 

v ° E £ 



CD 



CO CD 



a.Q-Q.l/)QU:<U-Ul/)Q.<< 



Cd 




.X 


a 


i_ 




ra 


> 


;';?, 


-a 

CD 

Q 


Q 
in 


CO 

r 

3 


a. 


c 




c 
o 

u 
o» 

0.) 


5 

in 


S- CD 
CD S- 

cn < 
>« r 




CD 


iX 


CO 


CD 




u 

>- 


O 




b 


> 


.- 


>.l' 


u> 


b 


ai 




.2 


N 


u 
c 

CD 


cu 


c 

3 


CT 


sz 

N 



03 


CD 


3 


cn co 


O 


l> 


r 


n, 


ca<< 


-£ 


> Q< U CH 



CO u 



o 

U CO 

<-" 
Si 

on U 



c 

0) 

E 

CO +j 



in — ■ _ 

xelz 

^ s: o cq 

.£ c s_ 5 
q) vi t <u 

fO 3.- 3 
JZJU, 



-I 3 3 to 

^ TJ CD 
1 Q OX 

$ ' ct- 

in 7-j .+_ 

i- o££ o 

3 o — 

zn2^ 



c 

CD 
<S in 



> 

ai 
o 
o 
u 

if 

CO 



CD — £ 

_ £2 I 

< ° c 3 
^ X CD J 

w £ 
o ai c 

c o 



Q£ 



in ._ 

cd in ._ 

J3 ^> 
3 r 



<ZUJ< 



> 
u 

c 



jzs.jzjzs:s:si^s:sijzs.s:jz^szs:s:s:s:s:s:£:s:i:sisis:six:s:x:^si'P 



CO(0C0<0C0t0(0t0C0(Ot0t0t0tOt0C0t0t0(0tOt0COt0t0 

CDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCDCD 

<xxxn:xxxn:xxxxx^;xxxxxxa:x^:xxxn:xxxn: 

UUUUUOUUUOOUUOUOUUUOUUUUUCJUUOUUUUUU 



co to to o 

CD CD CD /X 
X X X m 

ai 

c 



A&nJ2J2J2AnA&£>£i£lJZlSlJ3£t£lJZ>JZlA&£iJZiA£in£iJ2J2£l£i 
33333333333333333333333333333333 
CLCXQuQ-Q.CLQ.a.a.a.Q-CLQ.IXa.a.Q.Q.Q.CLa.a.Q.Q.Q-Q.CLCuQ.CLCLCL 



X5 -Q ID U 
3 3 3 (0 
Q. C Q. C£ 



OOOI-<i— NOn^OOr-fNC0r-inOM31Oin(n*OOOmC0(DCflOr-OCflT-inNh 

T-criu-(>ir^ai»-rsicru>votDi^coor^rNicocricnT-r^Lnr>.ocNcri«— ro^oi^tNuimcocN 
o^o^T-cNrNC^roc^cororoc^rnro^^^^^^Lnina3tor^r^r^cooococo(Tia»CT>CT»CT>^ 
i l I l I l I l l I i l l l i l I I l I I l I l I I I I l l I I I I I I i 

cococococococcMccoocooooscccococccococoracococococooococoncocococxicococc 



- 63 - 



-o 
c 
o 
a 
in 



en 



ty a> o a; 



_rara£££ra£raro££ro£s_t_nit_fljro2.i..~ 

.^i cn.lU oi en en en.!-! o>.S oi cn.i!2 o>.!2 .!£ en en cn.!£ en.£ .£ en cn.!£ en en cn.£ cn.£ .!£ en a-."™ 
Q<Q<<<<Q<0<<Q<QQ<<<^<QQ<<0<<<Q<QQ<<LL 






en ^ a 



cn£ 

03 V 



ro 






b 


■o -o 




s_ 


k. 




ro 





C£ 


o o 


> 

u 
c 


en en 


c 


C 


CJ 


u 


u 


en co 


ro 


< CC & 



c 

ro a; 

y £ 



■£■3 

* o £3 

•E aj £ 

£ * 2 
ro 4_. x: 

Ql l/)Q- 



O 


> 


[fl 


U 


c 


c 


C! 


cu 


y 


en 


_J 


< 



iiis 

• — 

ro ro 
a. c£ 



ro p* 3 -= 



a. ui 



= -a 
o <u 
OS 



<s 

C 3 UJ 

w.2_ 
«- t_ ro 
a ro a> 
z> a: 



c 

.'2 

!y 
'£ £ 

tj 0) 03 

cr-Q- 

ro 

c >.2 



u. ro 



■'-) 



ai <u c 
XX 



.y ro 

■+-> u 

y r- 

ro .e: 

i_ *-> 

ro U 

0) CL 

Q U 



.* 




a <u 


CD 


ro 


0) 


ro 


r 


u 


'- 


u 


c_ 


tn 




g> 


+-> 


a> 


c 




3 
£ 


u 


->_ 


( 1 


" 


ro 
s- 
Q. 


H 


to 




> 

u 

c 


75 


(VJ 

y 

'in 


ro 
ro 


1? 


a> 


c 


> 


k- 


'."■■ 


en <u sl 




■■'-■ 


<QQ-Q2 



c 

o 

ro i/i 

.y. c 



£ ro <u 2 

r'C +■» LU 

c c +j ro 

T3 ._ <U ty 



ro £ 

CQ E 

ro5 
C> 

1 1 

UJ < 



N 



< c 

-— o 
• in 

££ 



•I 



< 

tt in 

<! 

ro c 
in .- 

5 CQ 



c c c c c c 
o o c o o o 



c c c c 
o o o o 



ccczcccccc 
oooooooooo 



c c c c 
o o o o 











IT; 


■■:; 


ro 


ro 


n; 


• D 


i0 


at 


ro 


ro 


m 


ro 


ro 


ro 


r;l 


ro 


ro 


ro 


ro 


ro 


ro 


ro 


> ■ 


ra 


ro 


ro 










u 


U 


U 


u 


U 


i,' 




u 


u 


y 


<j 


o 


i' 


U 


y 


ij 


U 


u 


u 


u 


U 


\> 


U 


u 


u 


u 










3 


D 


3 


3 


3 


-■ 


-■ 


) 


3 


3 


3 


.'» 


3 


3 


3 


3 


3 


3 


3 


3 


3 


3 


3 


3 


3 


3 










-a"D"a _ o _ D"D-ox»T3-u-o-o-o _ o-o"et'o-e> 


•a-oxj'o-oTJ-D'a 










UJUJUJUJUJIJJUJUJUJIJUUJIJJUJUJLIJIJJUJUJUJUJUJU^ 




>5 


cO 


oO 


ui 


u5 


U) 


CO 


■1.': 


cO 


o 


CO 


US 


CO 


US 


cO 


cO 


cO 


cO 


uS 


US 


uS 


cO 


uS 


cO 


cO 


^o 


L. 


L. 


L. 


(_ 


c 


C 


c 


C 


c 


c 


C 


r- 


C 


C 


r. 


c 


C 


r 


C 


C 


C 


C 


- 


C 


r. 


r 


C 


<~ 


C 


ro 










o 


o 


o 


c 


a 


o 


c 


C 


o 


o 


o 





o 


c 


o 


o 


O 


o 


o 


o 


o 


o 


o 


o 


o 


o 




4_l 


-*- 1 


^_< 


4-J 


-■_j 


+-• 




4- 


4-' 


,_/ 


^_' 


^_ 


+J 


4_J 


4J 


+j 


+_j 


4-' 


^J 


+-' 


-t-" 


j-j 


■»-' 


4-J 


+J 


+-j 










ra 


r,< 


ra 


01 


ro 


ro 


ra 


ra 


ra 


ro 


ro 


ro 


ro 


m 


ro 


ro 


ro 


ro 


ro 


ra 


ro 


ro 


ro 


ro 


a) 


n 










L. 


c _ 


i- 


u 


L 


i_ 


v_ 


i_ 


s_ 


L 


i_ 


;, . 


L, 


i_ 


!_ 


t_ 


i_ 


i_ 


i_ 


v_ 


L. 


u 


L. 


L. 


V_ 


s_ 


O" en 


+-> 










-i- 1 




-)-' 


■H 


+ " 












•*-> 








s'-' 


+- 1 


+-■ 


+-• 








c 


c 


c 


c 


i/i 


w 


Ul 


U1 


l/l 


LO 


LO 


>r, 


10 


in 


W 


in 


in 


w 


ro 


W 


in 


w 


OT 


ro 


LO 


ro 


10 


tfl 


ro 


ro 



u u u o cncncncncncn 
rorororoa)oua;a)<U(U 
a: cd q: a: cc cc or cc a: a: 



en en en en 
<jj oj a> qj 
a: a a: oi 



cncncncncncncncno"tcn 



en en en en 
a; ai a oj 
dl a: r^: cc 



c c 

o o 

in in in in in 
d) d> 4> o ty 

y y .y y y 
> > > > > 

L. S_ s_ c_ c_ 

ai n ai a) oj 

CO U~> U) (/) LO 

c c c c c 
o o o _o o 

r^ ro ro ro ro ro 
~ ir ir ™- -jz ° 

S!5!5!5!5 c 

ro ro to ro ro <u 
en cn.c x: je s: sl > 
cyojcucucuojQjti) 



c*i t~ m o> ^ id o [>eo r- (NcoroiDtriLniOr- in^MJunMiini- co ro co 
nnr-oiiocoffii-i- (Nj^uiioNiNCNiniOr- fNCT)cr>LnintTirMoor-=i" 
a'lorNOir-r-r-fSfSfMiNMiNrMfMMroivifo^j^i^iorNMJOcocoa) 
i I i i i I I l I I I I I I I I i i I i i i l I I l I I I l 

cccoajaiooooJoocococoeoeoiocococoMcococoioiDoococococooDoo 



(TO 
OO 


o 

rsi 


a. 


co 

CO 


en 
in 

ai 


fM 


co 


CO 


co 


CO 


00 


4 



61 - 





C £ 




O s_ *J 


u 


missi 
Refo 

pmen 


IV 

zr 

en 


er Com 

cation 
Dme Ta 
m Equi 




+■> J o *- 
ro "O r ro 






5 uj h LL 



■D "O 

c c 
o o 
a a 

i/> in 

OJ OJ 



T3 "O "O TJ O 

c c c c c 

o o o o o 

a a a a a 

1/1 ui in 1/1 v) 

j) J) (D D 0) 



O O O O O O O 



"O "U "O 'O TJ "O "O U 

c ccccccc 

o ooooooo 

a a a a a a a a 

w i/j w w </> w) «n </> 

(V oj o oj oj oj oj <u 

CI QL QL QtZ. LL Lt. C£ Ul 

O OOOOOOO 



•D -a -a T3 

c c c c 

o o o o 
a a a a 

Ifl Ifl ITi Ifl 

a> a> oj <d 

a: a: a: a: 

o o o c 



a 

c 
o 
a 
w 

f," 



T3 "O 

c c 

o o 

a a 

05 (/> 

OJ (U 

cl a: 

o o 



a.) cu a) a) cu q; q) <v <v o) <v <v <v 

l_L.L.l~i-0JL.QJ&-l_L.!_L.L.L. 

33333<U3<1>3333333 



L. L- L. L. 

3 3 3 3 



"O 



(OQforora^aj^iontOfomiaio u 1 — co ro co ro c7> 03 



in in — — 

ro ro 



c .- cn.L' .1' 



oj oj oj oj 

<v <v <v v 

S_ S_ !_ l_ 

a> en o\ ai 

(0 03 f0 (0 



LL LL LL 



<LL<LLLLLLLLU.LLLL<QLLLLLLLL<LLQQlJLLUlDQ<QQQiO 



."' 



o 

c 
o x 

-I ro 



;< 
o3^ora.:ifldi30 



03 S_ 

U X D 

3 ro vi 

-O I- O 

LU y 

■M V> O 

ro '-LL 

ai -.3 
X^ID 

ro — M ro <v 

2-- PPE 



a. c 

•^ o 



•r.: 



c 
o 

N 
V) 

M 

<v «J 
Q +- , C (::A+Ja '~C— O C +- 1 > 

U<lOSOfflD2Q-i-OuJCQi:h5DlrtQ3lOQ.WUJ^ 



ro 
OJ 



rr s_ o 



c 
o 

a 

£ in v 

® c ro 
X O £ 

LU •£ r- 

tf> LU , 

OJ 



X 

X ra 
ro h- 

•- M 



x Z~ 
ro XJ 



5?lxSa.S?S§- 



I/) 

<r ro 
oj^ 5 
> i/> a> 

Eg! 

5- .E C£ 

*-> — 

c w 

.= -o c 

£.— « 
■o 3" 






a5 <u.y « 
> to -c •- 

— +2 OJ S- 

CO CO > Q 



OJ OJ 4) 



OJ OJ 

ro ro 



oj ro ro 

2 +-• +j *-> +-»+-• -t-j 

en co a) co ot co 

OJ .. .. . .. .. . 



o c o o o o 



> > >» > 




<J> l— r>4 

r-fNIN 
fNfNM 

I I I 
=T =f =t 
CO 00 CO 



M oo en 
<nj rsi r>i 

fN (N (N 



i— t^r^»— cou3(Nr^orMOu3r^inr^r-ooorooifMi— «— oo 
U3<3r-=j-(j3r--cr>cricifNfOr-ooror^o=roocr>Or-fnfNfNir^ 
cNmrocnroromoocrci-crinior^r~»ooo->cr)r^T-r-i— rs in in 
i I I l I I I l l I i i i I I l i I i I I I I I i 

cooocooooooooococooooooocooocooooooocooooooooococo 



65 



01 oi 
ro to 
V) (/> ~ Ifi 



a> o <u 
a a; a> 
s_ s_ s_ 



a; OJ 



t- s_ 



cp5 5 o>s s gt S oio>8 5 



£ oS.i2 .!_! .12 ai._2 tT>.-2 oi._- oi.!_! 
<QQ<Q<Q<QQQ<Q<Q<Q<Q<<Q<<Q<QQ<<U.<OQ<QQQ 



(/> 

c 

in OJ 

a .a 

o £■£'-. 
< CO £ o 

t oq. oj a 



c c 

£ £ 
<_> ru 



n 



_ fC 



si 

o <u 



__ +3 £ « 

__) o o 



p — is 
•| 8 ^ 

Si; 

= ro 13 



Q. en 

1_ S_ 

r, ° & 

g(J -C 

r u 

(0 ~ o 

s_ O !_ 

« u- a; 

ra i- .— 

o o s- 

QZQ 









a - cr 










5 

ro 
_J 


3 

Q 


(J a) 

a: a_ 
a- a; 


£ £ 
ra ro 

S_ l_ 

ai en 


a, 

'rf, 




r* 


LL 


11... 


o 

_. 


O 

_. 


p_- 


a. 


a* 




9. 




a. a. 


ro 

'11 


'i> 


*-> 


,'■■ 


S- 


i_ 


u 


-.' 


-- 


n 

■S: 






O 


o 


^. 


~ 




j 


D 


a. a 

S_ _- 


'■■■• 


s_ 


:--' 


U\ O 


r.' 


■ ■ * 




3 


QU)<UUJJ5 



c 

•B = 

do 

§ o< 

rUtn 

-a . o 

• - >T c 

5=1 

><£ -D 
IE = 

03 O 3 
LU O CD 



o 




(ii 




0) "D 




u 


s_ 


L& 


" 


■-• 




i 


■-■ 


ft 
r 






- 


'« 


+J 


+j 




- 


-• 


"■■' 


v. 


>--' 


o 


n 


«■ 


4C' 


i 


a 


U 




UJ to CO 



J2 vi 
o E 2 



c 
c .2 

o +- 

to en x c 

- c <=£ 

C' 






-n ro O U 

S OT « © £ 

ra m J x: +j 

CO C/J ^ CO LO Q. 



— — . <U 

O c £ 

O £ = U 

tj — O (V 
LOXUH 



c c 
.2 2 .2 

i°| 



u 


a 






c: 




u 


ro 




■^ 


O 


..'-' 


aj 


u 


>r. 


j: 


'_ 


S- 




ro 


^ 


<z: a. 



cuOflJ0Jli<y<U<DCi)a)C;<U(DQ;Q;fi)c>(U 
roforaroforarafOforofOfoiororaroiORj 
cocococococ-ncococococococococouTcocococo 



cccccccccccccccccc 
.2 .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 .2 

rofOfOfOrorofOforoforoforcfororofOfc 
uuuouuuouuuuuouuuu 
„ ,,333333333333333333 
^JiJ'O-O'O-DTJ-D-a-O-O-D'OTJTS-a'OTD-D-D 



OOOOOOOOOOOOOCOCOO 



O 
O O TJ 



rororaroraraturofOfora 



>->>->><>«> 



S_ i_ I_ s_ 



ro ro ro ro ra cc 

uuucuouuouuuuuuuuu 
ajcufu^ojajajajaiQjaoQjrijiijrjjaici) 
onoTcocococococococntocococOcocococo 



(POlD(y0i)(D(l)(U4; 
s_s-______s_______ 



ra ro u] 
u u ro 

CO CO CO 



ooooooooooooooooo 

XJX5 - OX5X3"OX!-i-3XJ - OX)X5T:-0 - D - DX3 

S_S_S_.S_S_S_S__.i_S__._-S__.S_S_.S_ 

rororororororororororororororororo 
ooooooooooooooooo 
_0__if_QD3_a_QO_f_3_Lltl3_Q_t_l_0 

d)c_)t_)fi)4)(_)<_)(U(_)ci)<_ia)ajci)<_ic_><_) 

rororororororororororororororororo 

4_'+J+J+->+J<->+-'+J+-'^'+J4-'+-'+->4-'+-'4-' 

to CO CO CO CO CO CO CO CO CO CO CO CO CO CO I/) CT 



tNc-ir— jni- o^Mionmaiwo'. 3-^cooiDcoinonDtOr-r- ^rr--cnoojr^oioroyDci- 
r^cNi^rrc5^ooc^a^c^ro^vou3C^<^ir)vr>ooc»--oorsr^c^(^oocooot^Lnoo£^rNirN)oo 

iNro^3-ioy:^hhhcocoeoa3cocriffiO)OiciOr---r-r-i-fNfS(NrNr<ia-Lni/iifiininm 
i i i i i i i i i I i I i i i l I I I l l l l I i l I I I i l I l I I I l I 
y3-4-d-^3-j^^^^^^a^^^ir^^^3-4-d-cr3;f^jj'4 , =r3-3 , ^3-cr3- 
cocoMooraoooocoajoDcococooococococooococraajcococoaicococoaDoococooococcco 



66 



■o-o-DTi-a-o-o-o-D-a-o-o-o-rs-D-o-o-DTJ 

ooooooooooooooooooo 
ao.Q.aaaaQ.Q.aaaaQ.aaaQ.a 
i/iinmviviviiAinvivii/iini/ii/itfiuii/iiAi/i 

OOOOOOOOOOOOOOOOOOO 

.22 .£ cn.!£ .52 .H2 o>.!£ en en av!2 .S2 .£ ai.i2 oi.!£ C7» *ra '5 "ra "co ro ro "15 ro *ro "ro *r3 ro 'ro 'to '5 'ro 'ra '5 'ro 

aa<QOQ<Q<<<QQQ<0<0<LLU.LLU.U-U.LJ.lLU.U.LLLLU.U.LLU.U.LLLL 



i/) 



.2 £ = 3 



CO 

c .2 

^ c _ 

'■p.2 r 

u z; «- 
«t> 

«" ® m 

DO £ 
< «.J2 

— 03 £ 

UI-< 



„>, 



■o £. 

LU O 

u 

+J O 
ro <D +J 

d Q. c 
So? 

°155 
£•8 

QX 2 



< c 
q."q3 

is 

CO « o 
°- w o 
c-g-g 



u •- ra 

3 X .Q 

"O o J- 

uj h- D 



c 
o 

ra 
o 

E3 

II 

a? 

c a 
o — 

c a: 



CO < 



o 
o 
x: 

U 4- 

LO O 

£-2.1 

c -a <y 

oS > 



in 
o c 



U X w 

<" o *- 
fO 

it- C fO 

<u ro o> 

OX X 



16 

o 

Q.-0 
0) .Q 

cc «- 

3 
LU *•' 

5.52 
en Q 



J2 ° 

.c -m 

u o 

LO ~ 

a, 

c 

ra j* 

.Q i- 

s- O 

3 S 



II 

3 U 4- 

^ .2 
ro "^: +J 
> ro o 

UJ £ > 

a> £ a> 

>.u ^ 

-2 <u a 

LU CO < 



r> 




U"i 




(U 




0) 


C 


l/J 

c 

.2 
*-< 

+3 


CO 

<• 





",:■ 
~3 

C 


c it 

> -a 




Q. 


3 

tx 


u 


U 


v-J 


-1 ' 




c 
o 


> 

1.1 


c 


u 

1 


c 


C 


4-J 


> 








n 


m 


u 


: 


(J 




w 


o 


a> 


-L' 


ai 


0) 


L, 


CJ 


C 


a: lu < lu 


X: 


LU ID 



C 

"0 a> 



Oj 3 ui 
C- T3 +; 

"— (V o 

~~" u = 
,n ° ro 

o <u 
& > a; 

y ■£ 

. c c 
ro <» 
u tn 
ro J2 



ra a) 

'I 

IIS 

<u ra o 

a:u>xcQO<uJu 





OJ 


O 
> 


C 






tfl 


o 






• 

.-J 


<i'i 




^_ 


a 


i- 


> 


'J! 


o 


X 

r.j 


ace: 




%■■' 




3 




u 


(fl 00 


0} 


t 


c 




TJ 


at 




'-■ 




n 


t_ 


c, 




C 


U 


Q. 


< 




c 


C 





': 






-Q 


"— 


- 


ui 


u 


- 


(VJ 


o 


t/j 


O 



c c 
o o 



c c c 
o o o 



c c c c 
c o o o 



c c c c c c 
o o o o o o 



c c c c 
o o o o 



rororororororororororororororororo 
oouuuuuouuuuuuuuu 

33333D3D333333333 



ro ro 
u u 

D 3 

■a -o 

LU LU 



ccccccccccccccccccc 
ooooooooooooooooooo 



uouuuuuuuuuuuouooou 

mUJmmULUUJIJJUJlilLUUJUJUJUJLIJUJlliliJIilUUJliJllJlilllJUJLIdLJUJUJUJLJLaUJ 



ooooooooooooooooooooocoooooooooooooooo 

^T3T3X>T3T:OX)T3TDT3^T3T3T3T3T3T3T3T31DT3T>^T3T31DTDTDT3T3T:T>T3T3-UX>-0 

rorororororororororororororororororororororororororororororororororororo 
ooooooooooooooocooooocoooooooooooooo 
Q3QfjQa3a]a3ca(ii£acflcari3cicQcQL^c2L^f^LtiaDm 



ro ro 

o o 

CQ CO 

<D OJ 

■•-' -M 

ro ro 

+-> +-» 

LO LO 



(UJ)0)8(l)OO0)IU0)O(IJ(UO(DJ)J)C!ll)l!J)Oll)S)DUO0)UO(l)8ll)(DOO 

rororororororororarororororororororororororororororororororororororororo 



rNOinrNJ-r-tNinaifMroa-oid'Or- LncorMr^cr>vOt— r^vDoocnooT-r^rNOoocT>or-«T-cN 
ro^NiciDr-r-Na-ooait-fNi-fNfSforot^i-tNoooiNWintnoiuimiocioofsfOioio 
inminu3iorNi^i^Ni^r>oooooicDO^cn(TioiOfOM4-3-inii>(D^or^r>r^r^oooocooocooo 
I I I i i I I I I I i I I I i I I I I I I i I i I I I i I I I I I i i i i i 

cooooococoooairacocooooocoaicoaioccooQcoaioococococoKcococooocsoocoooacoco 



67 



•O T3 T3 "O "O T3 

c c c c c c 

o o o o o o 

a a a a a a 

aj c> o d) o ii 

o: ql qz oz cz oz 

o o o o o o 



c 

n 
03 



a> a> u o» o> a> cu 

3333DD 0> 3 

T5 75 T5 75 To 75 o'fo 

LLLLLLLLLLLL<LL 



"O "O T5 "O TS "O O T3 - 0-a _ DTD - D"0-0"0 

ccccccc ccccccccc 

ooooooo ooooooooo 

a a a a. a a a 0.0.0.0.0.0.0.0.0. 

V) (/> en (/> (A v) t/i mtoiAwmifltniAvi 

0) j) C 0) 5) ID 0) D^OJOCJOJIUD© 

a: Q£ q: q: a: q: ci c£ a: o: c£ oz oz az az cz 

ooooooo ooooooooo 

+">+-» 4-* +-> 4-> 4-> •*-> 0)0) (1)^4) Q+^^+J4J+J4J+JHJP 

a <o o> v o> o> 0) P P PPrL<uo;a)(ua>aja)(i)a; 

2222222 £ 2 £ £ £ ro ro £ « %nnv222222222 

75 To 'ro To 75 75 75 oi gi o> gi a>.2 .if) oi en.- — .- ~ 75 75 'ro 75 "fa 'fa "fa 'fa 73 

LLLLIi_IXU-LLU-<<<<<QQ<<QGQQLLLLLLLLLLLLLLLLLL 



o 
a» 



r 





4: 


.> 


■:■ 




3 


c 




!|i 


CO 


'"" 




1) 


01 


i> 


a: 




'«> 


:- 


c 


E 


V} 


- 


.U 


•-> 


<u 



•V 



c 

o trt C fa c 

u <u ta cj c 

a) 0">cO 

oi -a 



IS 



Q LU CO CO U_ > 



c 

«-^ 

U T3 

c .- 
<u sz 
oO 



o ro 



0>> CD 

c c 

.2 S .2 
SO 2 









JZ 

u 


Q 


o 




3 


_> 


.2 °- 


I 


if, 


01 

,3 J 

or: 










£". 


0) 


-:-" 


fv 


i_ 


"i* 


•'-■■ 


k. 


u a: cq u_ 



I 2 

in < y 

_ .2 Ol 03 

a o < o 

W - ° m 

ro fa at 
T5 2.£ H 

CO cq a a 



£ 03 03 03 

£ -a -o T3 

0) o o o 

Q.UUU 

v _y jy _03 

y y y y 

££££ 
a> a) cj <u 

>>>> 



3 <U XJ 
H O o 

ro <u O 

o>a 





(0 




(!■ 


(') 


' 


!^ 


U 


..ti 


•-- 


D 




r 


(fl 


0) 


a- 


> 


Di 



— ta 



■- £ 

1/1 IT. 

E -2 

^ C o o 

S S I- u- c O c 

■* "* ^ (a y <a 

a a) a i{> Jr. -^ Jr. 

ro fa to S -h < -M 

^_i +j +j O o — o> 

co co co a. > 2 > 



c c 
o o 



ta jo 

" o 

3 r 

03 u 

CO 

c c 

03 (0 



a> q 
>> 



(A 1/1 

c c 
o o 



</> I/) 

c c 
o o 



u u 

<D (U — 

— — 03 

LU LU x: 

*-«- u 

o o ro 



03 03 



__ ro ro 
-o-o-o-o-^^^ a; 



ro ro 
o o 
CQ CQ 

<U (D 
ro ro 
CO CO 



ro ro £ 

o o .h 

CQ CQ LL 

a) o> a> 

+-> +j ■*-> 

ro ro ro 

CO CO CO 



a; o> .i: 

.bio 
LL LL a. 



a a> a> 
ro ro ro 
CO CO CO 



:= = ir •- = ~ — -- s: 
oooooooou 

a_CLCLCLO_Q_CLCLCO 



s_ooooooooo 
_ro - 4tj 'zz 'zz +3 'z; '^ 'z; *^ 'z; 
nfororororororororo 



c c 
o o 



\0 














<0 














01 














■t- 1 














w 














3 














L. 


[/l 


!/l 


l/l 


00 


(/! 


Ifl 


1— 


i_ 


C 


(. 


L. 


i- 


l_ 




(?> 


10 


ra 


ro 


ra 


."0 


o 


t 


l 4-" 


t 




t 





0>0>0>0>0!<DO)0)0> 

+->+-'4-'+J+-'+-'+-'4->+-> 

rorarororororororo^ 
cocococOcOc^cOcOcoHHHHHHHHH 



J_l_l_Ll_l_S_S-U.UL.i_(li 

OOOOOOOOOOOOi_ 

aaaaaaaaaaaarj 

(/)(/>(/)(/)(/)(/)(/)(/)(/) u)i/)V)(n 

CCCCCCCCCCCCro 

rorororororororororororoo> 



r-hhr- 



t--o______ 

o»rn ui i/i in t/i v) i/i 

i= c c c c c c 

-J— rorororororo 

w i_ u t. i_ u s_ 

ro>4_Q;0Qj(l)(y<p 

s_ a> aj a; a) a> a; 
\- 3 >>>>>> 



rNooiDr-d-Ni/nooor-r- ^iDiNiDOir-'ffii- ts 10 oo r- ommoon^oit- ro in in m 
t— rMasr^ror^r^cMinr^romLn-^-rrr— ooNOnooicjifOp- r^OLncnoii— fNooro^=r 

O^Oia>aiCDOO<J10r-r-M(N(Ng-l0003-r-^(NiriiniOI>C00001ffimi-ri(Ni-r-i-r- 



- 68 - 



- 69 



70 



PUBLICATIONS OF THE 
JOINT COMMITTEE ON ADMINISTRATIVE RULES 

Illinois Regulations , a weekly publication of the Joint Committee on 
Administrative Rules, is the result of the Regulatory Flexibility Law which 
became effective in Illinois on January 1, 1982. This law assumes that small 
businesses may be unduly burdened by rules promulgated by State agencies. 
Agencies, therefore, are required to provide some flexibility for small 
businesses regarding compliance and reporting requirements contained in rules 
whenever possible. To do this, small businesses are afforded the opportunity 
to raise issues and to suggest alternatives to rulemakings proposed by State 
agencies. In return, agencies, prior to the adoption of any rule, must 
acknowledge any comments offered and provide an explanation as to why it 
declined to implement any suggestions made by small businesses. 

Subscribers to Illinois Regulations receive a weekly summary of proposed new 
and amendatory rulemakings published in the Illinois Register , rulemakings 
affecting small businesses, and adopted rules; a list of rulemakings scheduled 
to be considered by the Joint Committee, and a summary of recommendations 
and objections issued by the Joint Committee. The section on proposed 
rulemaking also provides the name and address of agency contact persons and 
the length of time the agencies have allowed for public comments. 

Illinois Regulations is currently undergoing an extensive revision in order to 
make the information provided in the publication more understandable to small 
businesses and other subscribers. The revised format will be implemented in 
early 1986. The format of each section will be changed to a subject area 
classification of rules, rather than the current method of listing rules 
according to agency. In addition, the publication will contain more 
commentary on subjects of interest to small businesses, such as information on 
pertinent legislation, an explanation of Joint Committee actions and the 
provisions of the Illinois Administrative Procedure Act, and in-depth analyses 
of rulemakings of interest to subscribers. By implementing these changes, 
the focus of Illinois Regulations , which will become Illinois Regulation , will be 
directed toward the individuals being regulated, rather than the governmental 
agencies which are doing the regulating. The Joint Committee believes that 



- 71 - 



this revised report will provide a more understandable and comprehensive 
reporting of the changes in Illinois rules, and will encourage subscribers to 
submit their comments to the agency and to the Joint Committee. 

In addition to Illinois Regulations , the Joint Committee has two publications 
available which have also been designed to enhance the public's knowledge of 
the rulemaking process. A Citizen's Guide to the Illinois Administrative 
Procedure Act (1986) and Catalog of Business Regulations (1983) each provide 
the information necessary for interpreting the effects of agency administrative 
action upon small businesses as well as providing the procedures necessary to 
participate in the rulemaking process. 

A Citizen's Guide to the Illinois Administrative Procedure Act provides a clear 
and simple explanation of the Act to participants and potential participants in 
the rulemaking process. In addition to explaining the significance of the Act, 
the Citizen's Guide gives a section-by-section explanation of every provision 
of the Act. Also found in the Guide are answers to frequently asked 
questions concerning the citizen's role in the rulemaking process as well as 
sources of additional information for interested persons. In 1985, the 
Citizen's Guide was revised and updated to reflect changes made in the 
Illinois Administrative Procedure Act subsequent to the initial publication of 
the Guide in 1983, making it current through January, 1986. The Joint 
Committee is confident that the Guide will increase the users' confidence in 
their ability to influence the substance of agency rules, and consequently, 
increase the level of public participation in the rulemaking process. 

The Catalog of Business Regulations , which was published in conjunction with 
the Department of Commerce and Community Affairs and the Illinois 
Commission on Intergovernmental Cooperation, identifies thirty-three different 
agencies with more than five hundred sets of rules that impact business. 
The rules are separated into nine categories, with the official name of each 
rule appearing as it does in the set of rules filed with the Secretary of State, 
along with the agency responsible for administration of the rule, and the law 
that the rule implements. Related State or federal laws or professional 
standards affecting the substance of the rule are also included. A synopsis 
of the scope of the rule and the agencies contact address also appear for 



7 2 



each of the more than 500 rules included in the catalog. The Catalog of 
Business Regulations has been praised by national associations as the first 
compilation of its type produced by any State. 

These educational publications demonstrate the Joint Committee's commitment to 
ensuring that the public is made aware of the opportunities for public 
participation in the rulemaking process available through the Illinois 
Administrative Procedure Act. 



004:ar85 



73 



- 74 



COURT DECISIONS 

Section 7.05 of the Illinois Administrative Procedure Act requires that the 
Joint Committee study the impact of court rulings and administrative actions 
on agency rules and rulemaking. In order to carry out this responsibility, 
the Joint Committee reviews recent court decisions and Attorney General 
opinions, and monitors pending litigation which may affect administrative 
rulemaking. Several noteworthy legal decisions involving interpretations of 
the Illinois Administrative Procedure Act were issued during the past year by 
Illinois courts. The following is a brief summary of those decisions. 

1. In Hernandez v. Fahner , 125 III. App. 372, 481 N.E.2d 1004 (1st Dist. 
1985), the appellate court considered an appeal from the Cook County Circuit 
Court invalidating an Attorney General policy requiring applicants under the 
Crime Victims Compensation Act to document their citizenship or legal alien 
status. 

There were two issues in this case. First, whether the Attorney General 
abused his discretion by defining a "person" in a manner contrary to statute. 
Second, whether the invalidated policy qualified as a "rule" under the Illinois 
Administrative Procedure Act thus entitling the plaintiff to attorney's fees 
under Section 14.1 of the Illinois Administrative Procedure Act (III. Rev. 
Stat. 1983, ch. 127, par. 1014.1). 

With respect to the first issue, the court found that a State agency or official 
cannot impose by regulation or practice requirements inconsistent with the 
statute conferring authority to that agency. The Crime Victims Compensation 
Act (III. Rev. Stat. 1983, ch. 270, par. 76.1) provides that a "person" is 
entitled to compensation under the Act if he or she complies with six 
enumerated conditions. Immigration status was not enumerated as a condition. 
The Attorney General contended the Crime Victims Compensation Act gave 
broad discretionary power to administer the rule. However, the court found 
that discretionary rulemaking authority must be governed by "intelligible 
standards" found in the statute granting the agency its authority. The court 
held that an agency cannot go beyond these statutory standards in making 
rules. 



- 75 - 



With respect to the second issue, the court found the plaintiff was entitled to 
attorney's fees under Section 14.1 of the Illinois Administrative Procedure 
Act. Section 14.1(b) of the Act provides for litigation expenses and 
attorney's fees to any party which has an administrative rule invalidated (III. 
Rev. Stat. 1983, ch. 127, par. 1015.1(b)). 

The court found the documentation requirement was a "rule" pursuant to 
Section 3.09 of the Illinois Administrative Procedure Act, which defines rule 
as "each agency statement of general applicability that implements, applies, 
interprets or prescribes law or policy . . . ." (III. Rev. Stat. 1983, ch. 
127, par. 1003.09) 

The Attorney General contended that the Illinois Administrative Procedure Act 
did not apply in this case because the Attorney General's office was not an 
agency nor was the policy invalidated a rule. The court found that based on 
the Attorney's General's function in administering the Crime Victims 
Assistance Act, the Attorney General was an administrative agency. The 
court also found since the policy affected the private rights and procedures 
available to persons outside the Attorney General's office that this type of 
policy is specifically included within the definition of a "rule." 

Since the rule was invalidated for being beyond the agency's statutory 
authority, the plaintiff was entitled to attorney's fees under Section 14.1 of 
the Illinois Administrative Procedure Act. 

2. In Fuller v. Coler , No. 84-L-20, Champaign County Circuit Court 8, 
entered April 26, 1985, the court considered the Illinois Department of Public 
Aid's use of peremptory rulemaking to invalidate the supplemental assistance 
program. The court found that the rulemaking was improper and reversed 
the agency's decision based upon the Department's improper use of 
peremptory rulemaking, which precluded the general rulemaking provisions of 
the Illinois Administrative Procedure Act. 

Under Section 5.03 of the Illinois Administrative Procedure Act (III. Rev. 
Stat. 1983, ch. 127, par. 1005.03), peremptory rulemaking is used when 
rulemaking is required by federal law, federal rules and regulations, or an 



76 



order of the court and the agency is precluded from fulfilling the 
requirements imposed by Section 5.01 of the Illinois Administrative Procedure 
Act, and the agency is precluded from exercising discretion as to the content 
of the rule. 

The Department contended that the withdrawal of federal matching funds to 
the supplemental assistance program by the federal government required the 
State to abolish the program under federal law, thus invoking peremptory 
rulemaking. 

The court found this contention to be against the manifest weight of the 
evidence. The court reasoned that the State had a complete range of choices 
to continue, modify or abolish the program. Abolition, the court stated, was 
in no way mandated, and therefore peremptory rulemaking was improper. 

3. In Franz v. Edgar , 113 III. App. 3d 523, 478 N.E.2d 1165 (4th Dist. 
1985) the appellate court found the Secretary of State violated the plaintiffs 
due process rights by denying reinstatement of the plaintiff's driving 
privileges. The plaintiff, who had lost his license for a Driving Under the 
Influence of Controlled Substances conviction (DUI), was required under a 
Secretary of State rule to show 12 consecutive months of "documented 
sobriety" or documented abstinence by any applicant with a "clinical 
impression" of alcohol abuse. The plaintiff's reinstatement was denied on the 
ground he failed to meet this requirement at the hearing. 

The court found the rule provided so little guidance as to what the applicant 
is required to prove for reinstatement that due process was offended. 
Section 4.02 of the Illinois Administrative Procedure Act requires an agency 
to state the standards by which it exercises discretionary power. The court 
reasoned that "minimal due process requires that an applicant know the 
standards under which his request for reinstatement will be judged." Since 
the rule gave no guidance as to what constitutes a "clinical impression" of 
alcohol abuse or "documented sobriety," the plaintiff was denied due process. 

4. In Clingenpeel v. Edgar , 133 III. App. 3d 507, 478 N.E.2d 1172 (4th 
Dist. 1985) the court reviewed the application of a Secretary of State rule 



77 



enforced retroactively in a reinstatement of driving privileges hearing. The 
court found the plaintiff's reinstatement denial was based on an policy which 
was later codified into a rule that multiple Driving Under the Influence of 
Controlled Substances (DU1) convictions create a presumption of an alcohol 
problem and denies reinstatement until 5 years after the last conviction. 

The court found that application of the rule denied the plaintiff due process. 

The court found the policy qualified as "rule" as defined in the Illinois 

Administrative Procedure Act because it affects the private rights and 

procedures available to persons outside the agency. Section 4.02 of the 

Illinois Administrative Procedure Act states: 

Each rule which implements a discretionary 
power to be exercised by an agency shall 
include the standards by which the agency 
shall exercise the power. Such standards 
shall be stated as precisely and clearly as 
practicable under the conditions, to inform 
those affected. (III. Rev. Stat. 1983, ch. 
127, par. 1004.02) 

Moreover, Section 4(c) of the Act. states: 

No agency rule is valid or effective against 
any person or party, nor may it be invoked 
by the agency for any purpose, until it has 
been made available for public inspection and 
filed with the Secretary of State as required 
by this Act. This provision is not 
applicable in favor of any person or party 
who has actual knowledge thereof. (III. Rev. 
Stat. 1983, ch. 127, par. 1004(c)) 

At the time of the hearing, the Secretary's policy had not been promulgated 
as a rule pursuant to the Act. Since the rule was not properly promulgated 
until after the hearing, the court found the plaintiff's due process rights 
were violated since he could not know the standards under which 
reinstatement was judged. 

5. In Mahonie v. Edgar , 131 III. App. 3d, 476 N.E.2d 474 (1st Dist. 1985), 
the court heard the appeal of motorists whose driving privileges had been 
revoked. The plaintiff contended that she was denied due process because in 
the conduct of the administrative hearing the defendant representative was 
allowed to engaged in leading, argumentative, suggestive, and badgering 



78 



questions. She further contends that the hearing officer joint in the "attack" 
and never allowed her to explain her answers or cross-examine witnesses. 

The court agreed with the plaintiff that an administrative proceeding should 
not be partisan but should be an investigation conducted for the purpose of 
finding fact. The opportunity to be heard, raise objections, and 
cross-examine adverse witnesses are essential to a fair hearing. 

However, the court found nothing in the record to indicate the plaintiff was 
denied the right to cross-examine witnesses and presenting evidence, nor was 
the victim of unfair rulings. The court disagreed with the plaintiff's 
characterization of the hearing and commented many of her difficulties 
resulted from not being represented by counsel. 

6. In Breiner v. Edgar , 86 III. Dec. 176, 130 III. App. 3d 1010, 473 N.E.id 
1373 (4th Dist. 1985) the court heard the Secretary of State's appeal of a 
circuit court order overturning the agency's decision to deny reinstatement of 
plaintiff's driving privileges permit on the grounds it was against the manifest 
weight of the evidence, and was denied due process in the hearing to 
consider the request for restricted driver's permit. 

The courts recognized that that courts of review should not reweigh the 
evidence and should only overturn an agency decision if it is contrary to the 
manifest weight of the evidence. The reviewing court agreed with the 
agency's findings of fact, and therefore was not contrary to the manifest 
weight of the evidence. 

The plaintiff further claimed that introduction of incompetent evidence 
prejudiced him at the hearing to issue a restricted driver's permit. The 
court reasoned that admission of incompetent evidence in an administrative 
hearing is not grounds for reversal if the decision of the administrative 
agency is supported by substantial competent evidence and therefore is not a 
denial of due process. The court found the decision was based on substantial 
competent evidence, therefore, there was no basis for reversal. 



79 



7. The courts will give great weight to an agency's interpretation of its own 
rules but will overturn an agency construction of a rule which is considered 
unreasonable, arbitrary, or capricious. In the case of Continental Grain 
Company v. Illinois Pollution Control Board , 131 III. App. 3d 838, 475 N.E.2d 
1362 (5th Dist. 1985), the petitioner filed suit seeking to overturn a Pollution 
Control Board decision to fine Continental $10,000 for violating Air Pollution 
Rule 203(d) (8)(B) (iv) (c)(2). The agency claimed that though the Continental 
facility was not in the specifically mentioned townships covered by the rules, 
that township was intended to be covered. 

The court rejected this contention. The court reasoned that rules are 
governed by the same rules of construction as statutes. Rules of 
construction are only useful when there is some ambiguity in the language. 
In this case, the court found the plain meaning of the rule prevailed. If 
there was an oversight it had to be rectified by proper amendment of the 
rules. Agencies were not allowed to change their rules by interpretation 
when that interpretation is clearly contrary to the language of the rules. 

8. In Monetary v. Civil Service Commission , 131 III. App. 3d 198, 474 
N.E.2d 1291 (4th Dist. 1985), the appellate court considered the case of 
Jacksonville Mental Health Center employee who appealed a Civil Service 
Commission decision to lay her off. The plaintiff raised two issues. First 
she claimed that the Civil Service Commission decision was against the 
manifest weight of the evidence and the layoff, therefore, was improper. 
Second, she claimed that statistical methodology used to measure the impact of 
the layoff on her sex and race group was improperly applied in her layoff 
hearing because it was not promulgated as a rule under the Illinois 
Administrative Procedure Act (III. Rev. Stat 1983, ch. 127, par. 1001 et 
seq.) 

As to the first issue, the court found the findings and conclusions of an 
administrative agency are considered prima facie true and the court may not 
reweigh the evidence or make independent determinations of fact. The court 
found that the decision was not against the manifest weight of the evidence. 



- 80 



With respect to the second issue, the court found that the statistical 
methodology was not a rule under the Illinois Administrative Procedure Act. 
Under Section 3.09 of the Act, a "rule" does not include statements 
concerning only internal management of an agency and does not affect the 
rights and procedures of parties outside the agency (III. Rev. Stat. 1983, 
ch. 127, par. 1003.09.) The statistical methodology did not qualify as a rule 
because it was an internal management statement which the court said was 
simply reasoning by which the agency reached its decision. 

9. In Bodine v. Civil Service Commission , 134 Mi. App. 3d 341, 480 N.E.2d 
160 (4th Dist. 1985), the appellate court considered an appeal from a civil 
Service Commission decision discharging a Department of Central Management 
Services employee. The plaintiff raised two issues. First, a letter sent from 
the director of the Department to the Civil Service Commission urging 
discharge should have been stricken because it violated Section 15 of the 
Illinois Administrative Procedure Act (III. Rev. Stat. 1983, ch. 127, par. 
1015) and due process. Second, the findings of fact were not specific 
enough for a court to review. 

With respect to the first issue, the court found that the letter did not violate 
the Illinois Administrative Procedure Act. Section 15 of the Act states that 
after notice of a contested case, communication by agency members, 
employees, or hearing examiners with any person or party connected with the 
case is banned (III. Rev. Stat. 1983, ch. 127, par. 1015). 

The court pointed out Section 15 prohibits ex parte communications by agency 
personnel rather than persons connected with a party such as the Central 
Management Services director. 

However, the court did find that the letter violated the plaintiffs due process 
rights because the additional memorandum in favor of the Management 
Services' position was inherently unfair and prejudicial on the grounds that 
the plaintiff did not have an opportunity to respond. 

As to the second issue, the court found that the findings of fact were 
insufficiently specific. Section 14 of the Illinois Administrative Procedure Act 



- 81 



requires that an agency put findings of fact in writing along with a concise 
statement of underlying facts supporting the findings (III. Rev. Stat. 1983, 
ch. 127, par. 1015). The court found that these finds must be specific 
enough for a reviewing court to make an intelligent decision. 

Five separate charges were made against the plaintiff. The general statement 
of facts incorporated in the decision was found to be insufficiently specific to 
indicate which charges the Commission found to have been proved to support 
the discharge. 

10. In City of Chicago v. People of Cook County , 133 III. App. 3d 435, 478 

N.E.2d 1639 (1st Dist. 1985) the court reviewed ICC standards for utility 

rate-making. One of the parties to the litigation contended the interim 

standard was void because it was never promulgated as an agency rule 

pursuant to Section 17 of the Illinois Administrative Procedure Act. Section 

17 of the Illinois Administrative Procedure Act states: 

Every agency which is empowered by law to 
engage in ratemaking activities shall 
establish by rule not inconsistent with the 
provisions of the law establishing such 
ratemaking jurisdiction, the practice and 
procedure to be followed in rate-making 
activities before the agency. (IN. Rev. Stat. 
1983, ch. 127, par. 1017) 

The court found that this section is not applicable to the standards used by 
an administrative agency in arriving at its decisions. The court reasoned 
that this section only requires that rules relating to "practice and procedure" 
be promulgated. The choice of proceeding by rule or by informal processes, 
the court found, was up to the discretion of the agency in this case. 

While Section 4.02 of the Illinois Administrative Procedure Act requires that 
standards for the exercise of discretionary power be stated, Section 17 only 
requires standards for practice and procedure in rate-making. 



011 :ar85 



82 - 



- 83 



SECTION TWO 

SPECIFIC STATEMENTS OF OBJECTION AMD RECOMMENDATION 

Introduction 

Section Two summarizes each Statement of Objection and Statement of 
Recommendation issued by the Joint Committee on Administrative Rules in 
1985. This section is divided into five parts to correspond to the five review 
programs which are conducted by the Joint Committee: review of general 
rulemaking, review of emergency rulemaking, review of peremptory 
rulemaking, review of existing rules, and the complaint review program. An 
in-depth discussion of these five programs, including a statistical analysis of 
these Joint Committee Objections and Recommendations, is found in Section 
One of this report. Within each part, the material is organized alphabetically 
by issuing agency, and rule title. In addition to the summary, each entry 
contains the rule title and Administrative Code citation, and, in the case of 
proposed, emergency and peremptory rulemakings, the date and citation to 
the issue of the Illinois Register when the rulemaking was originally 
published, and where the text of any statements of objection and/or 
recommendation issued by the Joint Committee can be found. 



005:ar85 



85 



86 



1985 OBJECTIONS AND RECOMMENDATIONS TO GENERAL RULES 

ACINC, DEPARTMENT ON 

Community Care Program (89 III. Adm. Code 240) 

Proposal Originally Published in the Illinois Register , September 13, 1985 (9 
III. Reg. 13857). This Joint Committee action from the meeting of December 
11, 1985 was published in the Illinois Register , December 27, 1985 (9 111. 
Reg. 20942). 

Objection : The Joint Committee objected to Sections 240.963(b)(2)(B) and 
240.966(b) (2) (A) of the Department on Aging's proposed rules governing 
educational requirements for homemaker and program staff aide positions 
because the Department has not provided an adequate justification and 
rationale for the proposed rules as required by Section 220.900(b)(1) of the 
Joint Committee's Operational Rules. 

Agency Response: Pending. 

Joint Committee Response: Pending. 

Published as Adopted: Pending. 

AGRICULTURE, DEPARTMENT OF 

Meat and Poultry Inspection (8 III. Adm. Code 125.20(c)) 

Proposal Originally Published in Illinois Register , October 5, 1984 (8 III. Reg. 
18734). This Joint Committee action from the meeting of January 17, 1985 was 
published in the Illinois Register , February 1, 1985 (9 III. Reg. 1458). 

Objection : The Joint Committee objected to Section 125.20(c) of the 
Department of Agriculture's proposed Meat and Poultry Inspection rules 
because, contrary to the provisions of Section 6.02 of the Illinois 
Administrative Procedure Act, that section incorporates by reference 
guidelines of United States Department of Agriculture, which are not 
"regulations or rules of an agency of the United States or of a nationally 
recognized organization or association." 

Agency Response: Refusal to Modify or Withdraw, published February 8, 
1985 (9 III. Reg. 1477). Response received by the Joint Committee January 
22, 1985. 

Joint Committee Response: February 19, 1985, no further action. 

Published as Adopted: February 8, 1985 (9 III. Reg. 1782), effective 
January 24, 1985. 

CAPITAL DEVELOPMENT BOARD 

Prequalification and Suspension of Contractors (44 III. Adm. Code 950) 

- 87 - 



Proposal Originally Published in the Illinois Register , April 26, 1985 (9 III. 
Reg. 5468). This Joint Committee action from the meeting of July 25, 1985 
was published in the Illinois Register , August 9, 1985 (9 III. Reg. 12395). 

Objection : The Joint Committee objected to Section 950.510(f)(9) of the 
Capital Development Board rules entitled "Prequalification and Suspension of 
Contractors" (44 III. Adm. Code 950) because the "standards of quality" for 
the construction industry used by the Board in determining whether a 
contractor will be suspended from prequalification for construction projects 
are not stated as precisely and clearly as practical, in order to inform those 
persons affected, in violation of Section 4.02 of the Illinois Administrative 
Procedure Act. 

Agency Response: Agreement to Modify, published November 8, 1985 (9 III. 
Reg. 17455). Response received by the Joint Committee December 27, 1985. 

Joint Committee Response: Pending. 

Published as Adopted: November 8, 1985 (9 III. Reg. 17321), effective 
October 29, 1985. 



Prequalification of Architects and Engineers (44 III. Adm. Code 980) 

Proposal Originally Published in the Illinois Register , April 26, 1985 (9 III. 
Reg. 5475). This Joint Committee action from the meeting of July 25, 1985 
was published in the Illinois Register , August 9, 1985 (9 III. Reg. 12395). 

Objection : The Joint Committee objected to Section 980.180(b)(2) of the 
Capital Development Board's rules entitled "Prequalification of Architects and 
Engineers" (44 III. Adm. Code 980) because the standards and codes to be 
used by architects and engineers in construction contracts are not stated as 
precisely and clearly as practicable in order to inform those persons affected, 
in violation of Section 4.02 of the Illinois Administrative Procedure Act. 

Agency Response: Refusal to Modify or Withdraw, published November 11, 
1985 (9 III. Reg. 17456). Response received by the Joint Committee December 
27, 1985. 

Joint Committee Response: Pending. 

Published as Adopted: November 8, 1985 (9 III. Reg. 17329), effective 
October 20, 1985. 



CENTRAL MANAGEMENT SERVICES, DEPARTMENT OF 

Merit and Fitness (80 III. Adm. Code 302.785(b)) 

Proposal Originally Published in Illinois Register , January 4, 1985 (9 III. Reg. 
3). This Joint Committee action from the meeting of April 16, 1985 was 
published in the Illinois Register , May 3, 1985 (9 III. Reg. 6396). 



Objection : The Joint Committee objected to Section 302.785(b) of the 
Department of Central Management Services' rules entitled "Merit and Fitness" 
(80 III. Adm. Code 302) because the rule does not include the standards used 
by the Director of the Department in determining whether to grant, at an 
employee's request, initial or ongoing approval of indefinite leave status 
without pay to said employee, in violation of Section 4.02 of the Illinois 
Administrative Procedure Act. 

Agency Response: Agreement to Modify, published May 24, 1985 (9 III. Reg. 
7946). Response received by the Joint Committee May 3, 1985. 

Joint Committee Response: June 19, 1985, no further action. 

Published as Adopted: May 24, 1985 (9 III. Reg. 7907), effective May 15, 
1985. 



Standard Procurement (44 III. Adm. Code 1) 

Proposal Originally Published in the Illinois Register , May 3, 1985 (9 111. Reg. 
5877). This Joint Committee action from the meeting of December 11, 1985 
was published in the Illinois Register , December 27, 1985 (9 III. Reg. 20945). 

Objection 1 : The Joint Committee objected to Section 1.2215(g)(3) of the 
Department's proposed rules entitled "Standard Procurement" because the 
Department has limited the definition of "minority" to minority males in 
violation of Section 2(e) of the Minority and Female Business Enterprise Act. 

Objection 2 : The Joint Committee objected to Section 1.2215(b) of the 
Department's rules entitled "Standard Procurement" because that section 
conflicts with Section 4 of the Minority and Female Business Enterprise Act. 

Objection 3 : The Joint Committee objected to Section l.2215(i)(5) of the 
Department's proposed rules because this section fails to provide the 
standards used by the Minority and Female Business Enterprise Council in 
determining whether to accept a certification that a business is minority or 
female-owned which has been issued by another organization in violation of 
Section 4.02 of the Illinois Administrative Procedure Act. 

Objection 4 : The Joint Committee objected to Section 1.2215(d) of the 
Department's rules because the rule conflicts with Section 7(2) of the Minority 
and Female Business Enterprise Act. In addition, the Joint Committee 
objected to Section 1.2215(d) of the Department's proposed rules because that 
section fails to enumerate as precisely and clearly as practicable, the 
standards the Council will use in determining whether to exempt a class of 
contracts from the requirements of the Minority and Female Business 
Enterprise Act in violation of Section 4.02 of the Illinois Administrative 
Procedure Act. 

Objection 5 : The Joint Committee objected to Section 1.2215(m)(4) of the 
Department's proposed rules because this section fails to provide the 
standards used by the Council in determining whether to require an agency 
to appear before the Council and whether to prepare a report specifying that 



89 - 



an agency has not made a serious effort to reach goals set by the Minority 
and Female Business Enterprise Act and the Department's rules. 

Recommendation 1 : The Joint Committee recommended to the Department of 
Central Management Services that it seek legislation amending Section 4 of the 
Minority and Female Business Enterprise Act clarifying the division of 
contracts intended for minority and female owned businesses. 

Recommendation 2 : The Joint Committee recommended to the Department of 
Central Management Services that it seek legislation amending the Illinois 
Purchasing Act to authorize the Department to revoke its approval of State 
agency procurement rules. 

Agency Response to Objections: Pending. 

Agency Response to Recommendations: Pending. 

Joint Committee Response: Pending. 

Published as Adopted: Pending. 

CHILDREN AND FAMILY SERVICES, DEPARTMENT OF 

Facilities and Programs Exempt From Licensure (89 III. Adm. Code 377.4(d)) 

Proposal Originally Published in Illinois Register , February 1, 1985 (9 III. 
Reg. 1193). This Joint Committee action from the meeting of May 14, 1985 
was published in the Illinois Register , May 31, 1985 (9 III. Reg. 8198). 

Reco mmendation : The Joint Committee suggested to the Department of 
"Children and Family Services that it seek legislation amending the Child Care 
Act of 1969 to delete the requirement of Section 7.1 that a child care facility 
have on file records designating the manner in which children are to be 
released. 

Agency Response: Agree. Response received by the Joint Committee 
September 10, 1985. 

Joint Committee Response: September 19, 1985, recommendation to draft 
legislation. 

Published as Adopted: July 19, 1985 (9 III. Reg. 11282), effective July 15, 
1985. 



Governor's Youth Services Initiative (89 III. Adm. Code 311) 

Proposal Originally Published in the Illinois Register , April 5, 1985 (9 III. 
Reg. 4254). This Joint Committee action from the meeting of August 28, 1985 
was published in the Illinois Register , September 13, 1985 (9 III. Reg. 
14032). 



90 



Recommendation : The Joint Committee suggested to the Department of 
Children and Family Services that it seek legislation to amend "An Act 
creating the Department of Children and Family Services, codifying its powers 
and duties, and repealing certain Acts and Sections herein named" (III. Rev. 
Stat. 1983, ch. 23, par. 5001 et seq.) to provide specific statutory 
authorization for the Governor's Youth Services Initiative. 

Agency Response: Agree. Response received by the Joint Committee 
November 15, 1985. 

Joint Committee Response: December 11, 1985, recommendation to draft 
legislation. 

Published as Adopted: October 11, 1985 (9 III. Reg. 15486), effective 
October 15, 1985. 

Licensing Standards for Child Care Institutions and Maternity Centers (89 111. 
Adm. Code 404) ™~"" ~~ 

Proposal Originally Published in the Illinois Register , July 12, 1985 (9 III. 

Reg. 10499). This Joint Committee action from the meeting of October 16, 

1985 was published in the Illinois Register , November 1, 1985 (9 III. Reg. 
17053). 

Recommendation : The Joint Committee suggested that the Department of 
Children and Family Services seek legislation to amend the Child Care Act of 
1969 (III. Rev. Stat. 1983, ch. 23, par. 2211 et seq.) to allow the Department 
to require child care institutions and maternity centers to provide services to 
persons age 18 and older who have not completed a public school secondary 
education or who have been referred by a parent or guardian. 

Agency Response: Agree. Response received by the Joint Committee 
December 4, 1985. 

Joint Committee Response: Pending. 

Published as Adopted: Pending. 

Relat ive Home Placement (89 III. Adm. Code 335.200, 335.302, 335.302(d), 
335.304, 335.306, 335.308, 335.310, 335.314, 335.316, 335.318, 335.320, 
335.322, 335.328, 335.330, 335.338) 

Proposal Originally Published in the Illinois Register , March 1, 1985 (9 111. 
Reg. 2598). This Joint Committee action from the meeting of September 19, 
1985 was published in the Illinois Register , October 4, 1985 (9 III. Reg. 
15071). 

Objection 1 : The Joint Committee objected to Sections 335.200, 335.302 and 
335.316 of the Department of Children and Family Services' proposed 
rulemaking because the rules violate Section 4.02 of the Illinois Administrative 
Procedure Act by not providing, as clearly and practicably as possible, 



91 



standards for use by supervising agencies governing placement 
pre-conditions, general foster heme requirements and the number of children. 

Objection 2 : The Joint Committee objected to Sections 335.308, 335.310, 
335.314 and 335.338 of the Department of Children and Family Services' 
proposed rulemaking because the rules violate Section 4.02 of the Illinois 
Administrative Procedure Act by not providing, as clearly and practicably as 
possible, standards for use by supervising agencies governing business and 
employment of relative foster parents, qualifications of relative foster parents 
and cooperation with the supervising agency and the Department. 

Objection 3 : The Joint Committee objected to Sections 335.304, 335.306, 
335.318, 335.320, 335.322 335.326, 335.328 and 335.330 of the Department of 
Children and Family Services' proposed rulemaking because the rules violate 
Section 4.02 of the Illinois Administrative Procedure Act by not providing, as 
clearly and practicably as possible, standards for use by supervising agencies 
governing sleeping arrangements, nutrition and meals, basic needs and health 
needs, religion, discipline, emergency care and release of children in relative 
home placements. 

Objection 4 : The Joint Committee objected to Section 335.202(d) of proposed 
rulemaking of the Department of Children and Family Services because, 
contrary to the requirements of Section 4.02 of the Illinois Administrative 
Procedure Act, the rule does not contain adequate standards for determining 
when waiver of an approval standard will be granted; the resultant vagueness 
in effect allowing the Department to amend its rules on approval standards 
without resort to the rulemaking procedures required by Section 5.01 of the 
Illinois Administrative Procedure Act. 

Agency Response: Pending. 

Joint Committee Response: Pending. 

Published as Adopted: Pending. 



COMMERCE AND COMMUNITY AFFAIRS, DEPARTMENT OF 

Local Tourism and Convention Bureau Program (14 III. Adm. Code 550.20, 
550.40, 550.50, 550.60) 

Proposal Originally Published in Illinois Register , December 14, 1984 (8 III. 
Reg. 23940). This Joint Committee action from the meeting of March 19, 1985 
was published in the Illinois Register , April 12, 1985 (9 III. Reg. 4870.) 

Objection 1 : The Joint Committee objected to Sections 550.20, 550.40 and 
550.60 of the rules of the Department of Commerce and Community Affairs 
entitled "Local Tourism and Convention Bureau Program" because the 
Department lacks the statutory authority to impose certification requirements 
on local tourism and convention bureaus and to require local tourism and 
convention bureaus to have a least one full-time staff person and to provide 
dollar-for-dollar matching funds. 



92 - 



Objection 2 : The Joint Committee objected to Sections 550.40, 550.50, and 
550.60 of the rules of the Department of Commerce and Community Affairs 
entitled "Local Tourism and Convention Bureau Program" because the 
Department lacks statutory authority to impose program, administrative, and 
application requirements on local tourism and convention bureaus which are 
eligible to receive grants from the Convention and Local Tourism Bureau 
Account. 

Objection 3 : The Joint Committee objected to the rules of the Department of 
Commerce and Community Affairs entitled "Local Tourism and Convention 
Bureau Program" because the Department has been implementing the rules 
prior to their having been adopted in accordance with the Illinois 
Administrative Procedure Act. 

Recommendation 1 : The Joint Committee suggested that the Department of 
Commerce and Community Affairs seek legislation to amend Section 46.6a of 
the Civil Administrative Code (III. Rev. Stat. 1984 Supp., ch. 127, par. 
46.6a) to grant the Department the specific statutory authority to require 
local tourism and convention bureaus to be certified, to have a least one 
full-time staff person and to provide dollar-for-dollar matching funds. 

Recommendation 2 : The joint Committee suggested to the Department of 
Commerce and Community Affairs that the Department cease and desist its 
practice of requiring that local tourism and convention bureaus applying for 
grant awards submit the detailed information required on its grant application 
form relative to the bureaus' proposals for expenditure of grant funds. 

Agency Response to Objections: Refusal to Modify or Withdraw, published 
April 12, 1985 (9 III. Reg. 4860). Response received by the Joint Committee 
April 2, 1985. 

Agency Response to Recommendations: Agree, Response received by the 
Joint Committee April 2, 1985. 

Joint Committee Response: May 14, 1985, 1 recommendation to monitor 
rulemaking and 4 recommendations to monitor legislation. 

Published as Adopted: April 12, 1985 (9 III. Reg. 4775), effective April 4, 
1985. 



Service Delivery System and State Responsibilities (56 111. Adm. Code 
2600.40(e)(1)) 

Proposal Originally Published in Illinois Register , November 16, 1984 (8 ill. 
Reg. 22392). This Joint Committee action at the meeting of March 19, 1985 
was published in the Illinois Register , April 12, 1985 (9 III. Reg. 4882). 

Objection : The Joint Committee objected to Section 2600.40(e)(1) of the 
Department of Commerce and Community Affairs' rules entitled "Certification 
of Private Industry Councils" because the Department's definition of 
"experience in administering job training programs" conflicts with Section 102 
of the Job Training Partnership Act. 



S3 



Agency Response: Agreement to Modify, published April 20, 1985 (9 III. 
Reg. 5752). Response received by the Joint Committee April 15, 1985. 

Joint Committee Response: May 14, 1985, no further action. 

Published as Adopted: April 26, 1985 [9 III. Reg. 5591), effective April 17, 
1985. 



Technology Commercialization Grant-ln-Aid Program (14 III. Adm. Code 
540.50) 

Proposal Originally Published in Illinois Register , October 26, 1984 (8 III. 
Reg. 21021). This Joint Committee action from the meeting of February 21, 
1985 was published in the Illinois Register , March 8, 1985 (9 III. Reg. 2987) 

Objection : The Joint Committee objected to Section 540.50 of the Department 
of Commerce and Community Affairs' proposed rules concerning Technology 
Commercialization Crant-In-Aid Program because, contrary to the provisions of 
Section 4.02 of the Illinois Administrative Procedure Act, this section does not 
clearly and precisely set forth the standards used by the Department to rank 
Requests for Proposals submitted by applicants under the Technology 
Commercialization Grant-ln-Aid Program. 

Agency Response: Refusal (in part) and Modification (in part), published 
March 29, 1985 (9 III. Reg. 4171). Response received by the Joint Committee 
March 21, 1985. 

Joint Committee Response: April 16, 1985, no further action. 

Published as Adopted: February 15, 1985 (9 III. Reg. 2256), effective 
February 6, 1985. 

Technology Commercialization Crant-In-Aid Program (14 III. Adm. Code 540) 

Proposal Originally Published in the Illinois Pegister , May 10, 1985 (9 III. 
Reg. 6545). This Joint Committee action from the meeting of August 28, 1985 
was published in the Illinois Register , September 13, 1985 (9 III. Reg. 
14036). 

Recommendation : The Joint Committee suggested to the Illinois Department of 
Commerce and Community Affairs that it seek legislation amending Section 
46.19a of the Civil Administrative Code (III. Rev. Stat. 1984 Supp. , ch. 127, 
par. 46.19a) to .grant it specific statutory authority to require recipients of 
grants under the Technology Commercialization Grant-ln-Aid Program to hold 
the State of Illinois harmless from any and all claims and actions based upon 
or arising out of any services provided by themselves or their associates and 
employers. 

Agency Response: Failure to respond. 

Joint Committee Response: Pending. 



94 



Published as Adopted: October 18, 1985 (9 III. Reg. 15829), effective 
October 9, 1985. 



COMMERCE COMMISSION, ILLINOIS 

Elimination of Nonessential Uses of Natural Gas (CO. 202) (38 III. Adm. Code 
5T5T 

Proposal Originally Published in the Illinois Register , April 19, 1985 (9 III. 
Reg. 5007). This Joint Committee action from the meeting of December 11, 
1985 was published in the Illinois Register , December 27, 1985 (9 111. Reg. 
20958). 

Objection : The Joint Committee objected to Section 515.45 of the rules of the 
Illinois Commerce Commission entitled "Elimination of Nonessential Uses of 
Natural Gas" (83 III. Adm. Code 515) because the Commission lacks the 
statutory authority under Section 49a of "An Act concerning public utilities" 
to prohibit the use of gas for the purpose of outdoor lighting. 

Recommendation : The Joint Committee suggested to the Commerce Commission 
that, if the Commission believes it should have the authority to prohibit the 
use of gas for outdoor lighting, the Commission seek legislation granting it 
such authority. 

Agency Response to Objection: Pending. 

Agency Response to Recommendation: Pending. 

Joint Committee Response: Pending. 

Published as Adopted: Pending. 

Charitable Contributions (83 III. Adm. Code 325) 

Proposal Originally Published in the Illinois Register , September 28, 1984 (8 
III. Reg. 17943). This Joint Committee action from the meeting of July 25, 
1985 was published in the Illinois Register , August 9, 1985 (9 III. Reg. 
12397). 

Objection 1 : The Joint Committee objected to Section 325.20(a) of the rules 
of the Illinois Commerce Commission entitled "Charitable Contributions" 
because the rule presumes that one-half of every charitable contribution is 
not reasonable in amount, and thus may not be treated as an operating 
expense, in violation of Section 41 of "An Act concerning public utilities." 

Objection 2 : The Joint Committee objected to Section 325.20(a) of the rules 
of the THinois Commerce Commission entitled "Charitable Contributions" 
because the rule is not simple and clear, in violation of Section 220.900(b)(3) 
of the Operational Rules of the Joint Committee. 

Objection 3 : The Joint Committee objected to Section 325.20(b) of the rules 
of the TiTinois Commerce Commission entitled "Charitable Contributions" 

- 95 - 



because the rule is vague and violates Section 4.02 of the Illinois 
Administrative Procedure Act in that it fails to provide standards for 
determining when contributions directed to charitable agencies not serving 
Illinois may be considered as utility operating expenses. 

Agency Response: Refusal to Modify or Withdraw (Objection 1), Agreement to 
Modify (Objections 2 and 3), published October 4, 1985 (9 III. Reg. 15065). 
Response received by the Joint Committee September 18, 1985. 

Joint Committee Response: October 16, 1985, Joint Committee draft legislation 
(Objection 1 ) , no further action (Objections 2 and 3). 

Published as Adopted: October 4, 1985 (9 III. Reg. 14999), effective 
November 1 . 1985. 



Rules of Practice (09 III. Adm. Code 200.710(a)) 

Proposal Originally Published in Illinois Register , April 13, 1984 (8 III. Reg. 
4728). This Joint Committee action at the meeting of March 19, 1985 was 
published in the Illinois Register , April 12, 1985 (9 111. Reg. 4887). 

Objection : The Joint Committee objected to Section 200.710(a) of the Illinois 
Commerce Commission's rules entitled "Rules of Practice" because the 
Commission lacks the statutory authority to exempt employees who are not 
witnesses from the requirements of Section 15 of the Illinois Administrative 
Procedure Act. 

Recommendation 1 : The Joint Committee suggested that the Illinois Commerce 
Commission seek legislation which would clarify the applicability of Section 15 
of the Illinois Administrative Procedure Act to Commission employees who are 
not staff witnesses in Commission proceedings. 

Recommendation 2 : The Joint Committee suggested that the Illinois Commerce 
Commission seek legislation which would clarify the applicability of Section 15 
of the Illinois Administrative Procedure Act to Commission proceedings. 

Agency Response to Objection: Refusal to Modify or Withdraw, published 
April 20, 1985 (9 III. Reg. 5753). Response received by the Joint Committee 
April 18, 1985. 

Agency Response to Recommendations: Failure to Respond. 

Joint Committee Response: May 14, 1985, no further action. 

Published as Adopted: April 26, 1965 (9 III. Reg. 5627), effective April 15, 
1985. 



Standards of Service for Electric Utilities (General Order 161) (83 III. Adm. 
Code 410) 

Proposal Originally Published in the Illinois Register , April 19, 1985 (9 III. 
Reg. 5017). This Joint Committee action from the meeting of December 11, 

- 96 - 



1985 was published in the Illinois Register , December 27, 1985 (9 III. Reg. 
20964). 

Objection : The Joint Committee objected to Section 410.350(f) of the Illinois 
Commerce Commission's rules entitled "Standards of Service for Electric 
Utilities" (83 III. Adm. Code 410.350) because contrary to Section 4.02 of the 
Illinois Administrative Procedure Act, the rule does not include the standards 
to be used by the Commission for reviewing the criteria to be applied by 
utilities for determining which small commercial and/or industrial customers 
shall be included within the classification called for by this Section. 

Agency Response: Pending. 

Joint Committee Response: Pending. 

Published as Adopted: Pending. 

Standards of Service for Gas Utilities (General Order 159) (83 III. Adm. Code 
500] " 

Proposal Originally Published in the Illi nois Register , April 19, 1985 (9 III. 
Reg. 5023). This Joint Committee action from the meeting of December 11, 
1985 was published in the Illinois Register , December 27, 1985 (9 III. Reg. 
20966). 

Objection : The Joint Committee objected to Section 500.330(f) of the Illinois 
Commerce Commission's rules entitled "Standards of Service for Gas Utilities" 
(83 III. Adm. Code 500.330) because contrary to Section 4.02 of the Illinois 
Administrative Procedure Act, the rule does not include the standards to be 
used by the Commission for reviewing the criteria to be applied by utilities 
for determining which small commercial and/or industrial customers shall be 
included within the classification called for by this Section. 

Agency Response: Pending. 

Joint Committee Response: Pending. 

Published as Adopted: Pending. 

COMMUNITY COLLEGE BOARD, ILLINOIS 

Administration of the Illinois Public Community College Act (23 III. Adm. Code 
T50T] ~~~ — " ™~ — — 

Proposal Originally Published in Illinois Register , October 5, 1984 (8 III. Reg. 
18939). This Joint Committee action from the meeting of January 17, 1985 was 
published in the Illinois Register , February 1, 1985 (9 III. Reg 1461). 

Objection : The Joint Committee objected to Part 1501 of the rules of the 
Illinois Community College Board because they are incomplete since they do 
not specify the information which the Board requires of districts when they 



97 - 



apply for approval of new colleges and branches and when they apply to 
extend courses into non-district territory. 

Recommendation : The Joint Committee suggested that the Board promulgate 
rules to specify the information which the Board requires of districts when 
they apply for approval of new colleges and branches and when they apply to 
extend courses into non-district territory. 

Agency Response to Objection: Refusal to Modify or Withdraw, published 
April 20, 1985 (9 III. Reg. 2552). Response received by the Joint Committee 
February 4, 1985. 

Agency Response to Recommendation: Agree. Response received by the 
Joint Committee February 4, 1985. 

Joint Committee Response: March 19, 1985, recommendation to draft 
legislation. 

Published as Adopted: Withdrawn, March 29, 1985 (9 III. Reg. 4173). 

Administration of the Illinois Public Community College Act (23 III. Adm. Code 
1501 .201 and 1501.202) ~ " ~~ 

Proposal Originally Published in Illinois Register , September 6, 1985 (9 III. 
Reg. 13587). This Joint Committee action at the meeting of November 14, 
1985 was published in the Illinois Register , November 29, 1985 (9 III. Reg. 
18561). 

Objection : The Joint Committee objected to Sections 1501.201 and 1501.202 of 
the rules of the Illinois Community College Board entitled "Administration of 
the Illinois Public Community College Act" (23 III. Adm. Code 1501) because 
the rules do not include the standards to be used by the Board in 
determining whether a college is in substantial compliance with Board 
standards, contrary to Section 4.02 of the Illinois Administrative Procedure 
Act. 

Recommendation : The Joint Committee suggested that the Board adopt within 
one year rules establishing the standards used by the Board to determine 
whether a college is in substantial compliance with Board standards. 

Agency Response to Objection: Pending. 

Agency Response to Recommendation: Pending. 

Joint Committee Response: Pending. 

Published as Adopted: Pending. 

Administration of the Illinois Public Community College Act (23 III. Adm. Code 
1501 .514(i)l 



98 



Proposal Originally Published in Illinois Register , November 30, 1984, (8 III. 
Reg. 23110). This Joint Committee action from the meeting of February 21, 
1985 was published in the Illinois Register , March 8, 1985 (9 III. Reg. 2993). 

Objection : The Joint Committee objected to Section 1501.514(0 of the Illinois 
Community College Board's rules entitled "Administration of the Illinois Public 
Community College Act" because contrary to the requirements of Section 4.02 
of the Illinois Administrative Procedure Act, the rule does not contain clear 
and precise standards so as to fully inform those affected of the way in which 
the Board will determine whether Business Assistance Grants will be awarded. 

Recommendation : The Joint Committee suggested to the Illinois Community 
College Board that, prior to the adoption of 23 III. Adm. Code 1501.515, it 
submit to the Joint Committee for review and examination a copy of the form 
required by Section 1501.515(h) of the rules, to be used by colleges in filing 
financial reports. 

Agency Response to Objection: Refusal to Modify or Withdraw, published May 
17, 1985 (9 III. Reg. 7228). Refusal to Modify received by the Joint 
Committee May 2, 1985. Withdrawal published March 29, 1985 (9 III. Reg. 
4173). 

Agency Response to Recommendation: Agree. Response received by the 
Joint Committee March 6, 1985. 

Joint Committee Response: April 16, 1985, objection to existing rule 
(Objection) published May 3, 1985 (9 III. Reg. 6447); and monitor the form 
( Recommendation ) . 

Published as Adopted: June 21, 1985 (9 III. Reg. 9470). 

Administration of the Illinois Public Community Colleg e Act (23 III. Adm. Code 
1501.604(c) and 1501.507(c)) 

Proposal Originally Published in the Illinois Register , May 31, 1985 (9 III. 

Reg. 8025). This Joint Committee action from the August 28, 1985 meeting 

was published in the Illinois Register , September 13, 1985 (9 III. Reg. 
14038). 

Objection 1 : The Joint Committee objected to Section 1501.604 of the rules of 
the Illinois Community College Board governing the "Administration of the 
Illinois Public Community College Act" because the Board lacks the statutory 
authority to approve locally funded capital projects for which no State 
funding is requested. 

Objection 2 : The Joint Committee objected to Section 1501.507(c) of the rules 
of the Illinois Community College Board entitled "Administration of the Illinois 
Public Community College Act" (23 III. Adm. Code 1501) because the rules do 
not contain the standards used by the Board to determine whether a course 
may be repeated for credit hour grants, in violation of Section 4.02 of the 
Illinois Administrative Procedure Act. 



99 



Agency Response: Refusal to Modify or Withdraw, published October 4, 1985 
(9 III. Reg. 15068). Response received by the Joint Committee October 17, 
1985. 

Joint Committee Response: Pending. 

Published as Adopted: November 1, 1985 (9 III. Reg. 16813), effective 
October 21, 1985. 



CONSERVATION, DEPARTMENT OF 

Cock Pheasant Hungarian Partridge, Bobwhite Quail, Rabbit and Crow 
"Hunting Regulations (17 III. Adm. Code 530.80 and 530.100) 

Proposal Originally Published in the Illinois Register , June 28, 1985 (9 III. 
Reg. 9715). This Joint Committee action from the meeting of September 19, 
1985 was published in the Illinois Register , October 4, 1985 (9 III. Reg. 
15081). 

Objection : The Joint Committee objected to Sections 530.80 and 530.100 of the 
Department of Conservation's rules entitled "Cock Pheasant, Hungarian 
Partridge, Bobwhite Quail, Rabbit and Crow," (17 III. Adm. Code 530) 
because the Department lacks the statutory authority to retain a hunter's 
hunting license or Firearm Owner's Identification Card while he or she is 
hunting on a Department-owned or managed site. 

Recommendation : The Joint Committee suggested to the Department of 
Conservation that it seek legislation to allow it to retain hunting licenses of 
persons who wish to enter Department-managed areas in order to participate 
in the controlled pheasant hunt, pursuant to Section 530.80, or the Illinois 
Youth Pheasant Hunt, pursuant to Section 530.100, and in order to retain the 
Firearm Owners Identification Card of those same persons who,' under the 
law, are not required to obtain a hunting license. 

Agency Response to Objection: Refusal to Modify or Withdraw, published 
October 18, 1985 (9 III. Reg. 15986). Response received by the joint 
Committee October 23, 1985. 

Agency Response to Recommendation: Disagree. Response received by the 
Joint Committee October 23, 1985. 

Joint Committee Response: November 14, 1985, agency seek legislation 
(Objection); Joint Committee develop legislation (Recommendation). 

Published as Adopted: October 10, 1985 (9 III. Reg. 15846), effective 
October 8, 1985. 

Consignment of Licenses (17 III. Adm. Code 2520) 

Proposal Originally Published in the Illinois Register , May 24, 1985 (9 III. 
Reg. 7321). This Joint Committee action from the meeting of August 28, 1965 



- 100 - 



was published in the Illinois Register , September 13, 1985 (9 III. Reg. 
14043). 

Objection 1 : The Joint Committee objected to the rules of the Department of 

Conservation entitled "Consignment of Licenses" (17 III. Adm. Code 2520) 

because the Department failed to comply with the regulatory flexibility 

requirements of Section 5.01 of the Illinois Administrative Procedure Act. 

Objection 2 : The Joint Committee objected to Section 2520.30(a) of the 
Department of Conservation's rules entitled "Consignment of Licenses" because 
the Department lacks the necessary authority to require that funds received 
in payment for licenses be deposited to an identifiable bank account and that 
no other funds belonging to the vendor be deposited therein. 

Recommendation 1 : The Committee suggested that the Department seek 
legislation authorizing it to require that funds received in payment for 
licenses be deposited to an identifiable bank account and that no other funds 
belonging to the vendor be deposited therein. 

Recommendation 2 : The Joint Committee suggested to the Department of 
Conservation that it develop legislation to amend Section 5.22 of the Fish 
Code and Section 3.37 of the Wildlife Code such that each section is made to 
conform with Section 9(a) of Article VII of the Constitution of the State of 
Illinois. 

Agency Response to Objections: Refusal to Modify or Withdraw (Objection 1), 
Withdrawal (Objection 2), published September 27, 1985 (9 III. Reg. 14736). 
Response received by the Joint Committee October 8, 1985. 

Agency Response to Recommendations: Agree. Response received by the 
Joint Committee October 8, 1985. 

Joint Committee Response: November 14, 1985, no further action (Objection 
1), agency seek legislation [Objection 2), Joint Committee monitor agency 
legislation (Recommendations 1 and 2). 

Published as Adopted: September 27, 1985 (9 ill. Reg. 145626), effective 
September 17, 1985. 

Designation of Restricted Waters in the State of Illinois (17 III. Adm. Code 
2030) 

Proposal Originally Published in Illinois Register , November 30, 1984 (8 III. 
Reg. 23396). This Joint Committee action from the meeting of March 19, 1985 
was published in the Illinois Register , April 12, 1985 (9 III. Reg. 4896). 

Recommendation : The Joint Committee suggested to the Department of 
Conservation That it seek legislation to provide the Department with the 
authority to promulgate rules regarding the procedure it uses to designate 
restricted waters. 

Agency Response: Agree. Response received by the Joint Committee April 
3, 1985. 

- 101 - 



Joint Committee Response: May 14, 1985, recommendation to monitor agency 
legislation. 

Published as Adopted: April 12, 1985 (9 III. Reg. 4789), effective April 2, 
1985. 



Field Trials on Frivate Lands (17 Hi. Adm. Code 930) 

Proposal Originally Published in the Illinois Register , April 26, 1985 (9 III. 
Reg. 5511). This Joint Committee action from the meeting of July 25, 1985 
was published in the Illinois Register , August 9, 1985 (9 III. Reg. 12408). 

Recommendation : The Joint Committee suggested to the Department of 
Conservation that it seek to amend the Wildlife Code to allow the Department 
to waive the Illinois hunting license requirement for non-resident participants 
at field trials if they reside in a state that reciprocates by allowing Illinois 
residents to participate in field trials in that state without obtaining a 
hunting license for that state. 

Agency Response: Agree. Response received by the Joint Committee 
November 18, 1985. 

Joint Committee Response: Pending. 

Published as Adopted: September 13, 1985 (9 III. Reg. 13951), effective 
September 4, 1985. 

Fish Stocking, Importation, and/or Possession of Aquatic Life (17 III. Adm. 
Code 870) ™ 

Proposal Originally Published in the I llinois Register , August 9, 1985 (9 III. 
Reg. 12543). This Joint Committee action from the meeting of December 11, 
1985 was published in the Illinois Register , December 27, 1985 (9 III. Reg. 
20968). 

Objection : The Joint Committee objected to Section 870.10(b) of the 
Department of Conservation's rules entitled "Fish Stocking, Importation and 
Possession of Aquatic Life" because, by making it unlawful to import, 
possess, transport, or ship certain species of fish without Departmental 
permission, the Department has exceeded the authority accorded it under 
Section 3.20 of the Fish Code. 

Recommendation : The Joint Committee suggested to the Department of 
Conservation that, if the Department believes it should have the authority to 
regulate the transportation and possession of aquatic life, the Department 
should seek legislation granting it such authority. 

Agency Response to Objection: Pending. 

Agency Response to Recommendation: Pending. 

Joint Committee Response: Pending. 

- 102 - 



Published as Adopted: Pending. 

Historic Preservation Grants-ln-Aid (17 III. Adm. Code 310.60, 310.50(b), 
and 310.20) ~ 

Proposal Originally Published in Illinois Register , October 5, 1984 (8 III. Reg. 
18843). This Joint Committee action from the meeting of February 21, 1985 
was published in the Illinois Register , March 8, 1985 (9 111. Reg. 3001). 

Objection 1 : The Joint Committee objected to Section 310.60 of the rules of 
the Department of Conservation entitled "Historic Preservation Grants-ln-Aid 
Program" because that section fails to set forth accurately the Department's 
policies relative to imposing sanctions upon those who do not comply with the 
program requirements. 

Objection 2 : The Joint Committee objected to Section 310.50(b) of the 
Department of Conservation's rules concerning the Historic Preservation 
Grants-ln-Aid Program because the proposed rules fail to comply with the 
requirements for incorporation by reference under Section 6.02 of the Illinois 
Administrative Procedure Act. 

Ob jection 3 : The Joint Committee objected to Section 310.20 of the 
TJepartment of Conservation's proposed Historic Preservation Grants-ln-Aid 
Program rules because the rules fail to include the standards that will be 
given priority for grant awards, in violation of Section 4.02 of the Illinois 
Administrative Procedure Act. 

Recommendation 1 : The Joint Committee suggested to the Illinois Department 
of Conservation that it petition the United States Department of the Interior 
to allow the Illinois Department to utilize the sanctions for non-compliance set 
forth in the Illinois Grant Funds Recovery Act in lieu of the federal sanctions 
(III. Rev. Stat. 1983, ch. 127, par. 2310 et seq), In addition, the Joint 
Committee directed staff to contact the President's Task Force on Regulatory 
Reform, chaired by Vice President Bush, to request the Task Force's 
assistance in resolving the matter. 

Recommendation 2 : The Joint Committee suggested that the Department of 
Conservation initiate rulemaking to amend Section 310.20 of the Department's 
rules concerning Historic Preservation Grants-ln-Aid to include the 
Department's policies concerning application procedures and evaluation and 
prioritization of proposed historic preservation projects. 

Agency Response to Objections: Refusal to Modify or Withdraw, published 
May 17, 1985 (9 III. Rea. 72291). Response received by the Joint Committee 
May 3, 1985. 

Agency Response to Recommendations: Agree. Response received by the 
Joint Committee May 3, 1985. 

Joint Committee Response: April 16, 1985, no further action. 

Published as Adopted: May 17, 1985 (9 III. Reg. 7132), effective May 3, 
1985. 



103 



EDUCATION, STATE BOARD OF 

Gifted Education (23 III. Adm. Code 227.50 and 227.50(b)(9)) 

Proposal Originally Published in Illinois Register , July 13, 1984 (8 III. Reg. 
11981). This Joint Committee action from the meeting of April 16, 1985 was 
published in the Illinois Register , May 3, 1985 (9 III. Reg. 6400). 

Objection 1 : The Joint Committee objected to Section 227.50 of the State 
Board of Education's rules entitled "Gifted Education" because the Board lacks 
the statutory authority to impose requirements for college credit, institute 
training, or experience upon professional personnel employed in gifted 
education programs receiving reimbursement funds from the State Board. 

Objection 2 : The Joint Committee objected to Section 227.50(b)(9) of the 
rules of the State Board of Education entitled "Gifted Education" because, 
contrary to Section 4.02 of the Illinois Administrative Procedure Act, the rule 
does not fully inform local education agencies (LEAs) of the standards by 
which dates for submission of applications and evaluation reports will be 
determined. 

Recommendation 1 : The Joint Committee suggested that the State Board of 
Education seek Tegislation to amend Section 14A of the School Code to 
authorize the Board to impose requirements upon teachers, supervisors, and 
administrators employed in gifted education programs. 

Recommendation 2 : The Joint Committee suggested that the Board promulgate 
rules to specify the information which the Board requires of local education 
agencies when they apply for approval of gifted education programs. 

Agency Response to Objections: Refusal to Modify or Withdraw (1), 
Agreement to Modify (2), published June 28, 1985 (9 III. Reg. 10110). 
Response received by the Joint Committee June 13, 1985. 

Agency Response to Recommendations: Agree. Response received by the 
Joint Committee June 13, 1985. 

Joint Committee Response: July 25, 1985, request timetable. 

Published as Adopted: June 28. 1985 (9 III. Reg. 9989), effective June 14, 
1985. 



ELECTIONS, STATE BOARD OF 

Voting Accessibility for the Elderly and Handicapped (2b III. Adm. Code 
209.50(f), 209.70(d)) 

Proposal Originally Published in Illinois Register , June 7, 1985 (9 III. Reg. 
8357). This Joint Committee action at the meeting of November 14, 1985 was 
published in the Illinois Register , November 29, 1985 (9 III. Reg. 18568). 

Objection 1 : The Joint Committee objected to Section 209.50(f) of the State 
Board of Elections' rulemaking entitled "Voting Accessibility for the Elderly 

- 104 - 



and Handicapped" because the Board lacks the statutory authority to rescind 
a two-year exemption from accessibility requirements once granted pursuant to 
Sections 7-47.1 (a) and 17-13(a) of the Election Code. 

Objection 2 : The Joint Committee objected to Section 209. 70 Id) of the State 
Board of Elections' rulemaking entitled "Voting Accessibility for the Elderly 
and Handicapped" because that provision violates Sections 7-47.1 (b), 
11-4. 2(b) and 1 7-1 3(b) of the Election Code by permitting delivery of a 
ballot, on election day, without prior notice, to a handicapped voter who is 
unable to reach the polls. 

Recommendation 1 : The Joint Committee suggested that the State Board of 
Elections Board seek legislation to grant it the statutory authority to rescind 
an exemption from accessibility requirements within two years after the 
exemption is granted. 

Recommendation 2 : The Joint Committee suggested to the State Board of 
Elections that it seek legislation to provide that a handicapped voter unable to 
continue toward a polling place should be allowed to request delivery of a 
ballot at any time up through and including election day in those instances 
where an established polling place has been moved after notice of the polling 
place location has been published. 

Agency Response to Objections: Pending. 

Agency Response to Recommendations: Pending. 

Joint Committee Response: Pending. 

Published As Adopted: Pending. 

Voting Systems (26 III. Adm. Code 204) 

Proposal Originally Published in Illinois Register , June 29, 1984 (8 III. Reg. 
9863). This Joint Committee action from the meeting of April 16, 1985 was 
published in the Illinois Register , May 3, 1985 (9 III. Reg. 6408). 

Objection 1 : The Joint Committee objected to the State Board of Elections' 
rulemaking entitled "Voting Systems" (26 III. Adm. Code 204) because the 
Board lacks statutory authority to approve, and to withdraw approval of, any 
"activities, materials, and equipment utilized in the preparation, delivery, 
casting, examination, tabulating and preservation of ballots, and in reporting 
results" as specified in the Section 204.20 definition of "Voting Systems." 

Objection 2 : The Joint Committee objected to Section 204.100(c) of the State 
Board of Elections' rules entitled "Voting Systems" (26 III. Adm. Code 204) 
because the Board lacks statutory authority to condition its final approval of 
a voting system on the filing by the applicant of a written agreement to file 
certain documents and computer programs with the Board. 

Objection 3 : The Joint Committee objected to Section 204.140 of the State 
Board of Elections' rulemaking entitled "Voting Systems" (26 III. Adm. Code 
204) because the provision violates Section 4.02 of the Illinois Administrative 

- 105 - 



Procedure Act in that it fails to set forth the standards used by the State 
Board of Elections to determine whether to inspect, test and monitor an 
approved voting system. 

Recommendation 1 ; The Joint Committee suggested that the Board of Elections 
develop and introduce appropriate legislation to grant it the authority to 
approve and to withdraw approval of "voting systems." 

Recommendation 2 : The Joint Committee suggested that the State Board of 
Elections develop and introduce legislation to grant it the authority to require 
written agreement by the applicant to file certain documents and computer 
programs with the Board. 

Agency Response to Objections: Agreement to Modify, published July 12, 
1985 (9 III. Reg. 11136). Response received by the Joint Committee July 2, 
1985. 

Agency Response to Recommendations: Agree. Response received by the 
Joint Committee July 2, 1985. 

Joint Committee Response: August 28, 1985, no further action. 

Published as Adopted: July 12, 1985 (9 III. Reg. 10733), effective July 1, 
1985. 



EMPLOYMENT SECURITY, DEPARTMENT OF 

Recovery of Benefits (56 III. Adm. Code 2835.15 and 2835, Table A) 

Proposal Originally Published in the Illinois Register , May 17, 1985 (9 111. 
Reg. 7100). This Joint Committee action from the meeting of August 28, 1985 
was published in the Illinois Register , September 13, 1985 (9 III. Reg. 
14050). 

Objection : The Joint Committee objected to Sections 2835.15 and 2835. Table A 
of the Department of Employment Security's rule entitled "Recovery of 
Benefits" because the rule provides for the indefinite recoupment of benefits 
non-fraudulently obtained, to the extent of 100% of weekly benefits, in 
violation of Section 900 of The Unemployment Insurance Act. 

Agency Response: Agreement to Modify, published October 25, 1985 (9 III. 
Reg. 16357). Response received by the Joint Committee October 7, 1985. 

Joint Committee Response: November 14, 1985, no further action. 

Published as Adopted: October 25, 1985 (9 III. Reg. 16225), effective 
October 15, 1985. 



106 



Wages (56 III. Adm. Code 2730) 

Proposal Originally Published in the Illinois Register June 7, 1985 (9 III. Reg. 
8375). This Joint Committee action from the meeting of October 16, 1985 was 
published in the Illinois Register , November 1, 1985 (9 III. Reg. 17057). 

Recommendation : The Joint Committee suggested to the Illinois Department of 
Employment Security that it seek legislation amending Section 234 of the 
Unemployment Insurance Act to require employers to notify each individual of 
his "duty" rather than "right" to report currently the amount of gratuities to 
the employer so as to be consistent with federal law regarding the reporting 
of gratuities (22 U.S.C. Section 3306, as amended by P.L. 98-369. 98 Stat. 
1052). 

Agency Response: Pending. 

Joint Committee Response: Pending. 

Published as Adopted: Pending. 

ENVIRONMENTAL PROTECTION AGENCY 

Design, Operation and Maintenance Criteria (35 III. Adm. Code 653) 

Proposal Originally Published in the Illinois Register , March 15, 1985 (9 ill. 
Reg. 3132). This Joint Committee action from the meeting of June 19, 1985 
was published in the Illinois Register , July 5, 1985 (9 III. Reg. 10305). 

Objection 1 : The Joint Committee objected to the Environmental Protection 
"Agency's rules entitled "Design, Operation and Maintenance Criteria" (35 III. 
Adm. Code 653) because the Environmental Protection Act does not give the 
Agency the authority to require that cross-connection control devices be 
inspected by a person approved by the Agency, nor does it give the Agency 
the authority to grant approval to persons to inspect cross-connection control 
devices. 

Objection 2 : The Joint Committee objected to Section 653.802(d)(1) of the 
Environmental Protection Agency's rules entitled "Design, Operation and 
Maintenance Criteria" (35 III. Adm. Code 653) because the rule fails to reflect 
the Agency's actual policy that, it will not let individuals tested for approval 
as "Cross-Connection Control Device Inspectors" view their graded 
examinations. 

Recommendation 1 : The Joint Committee recommended to the Environmental 
Protection Agency that it make a recommendation to the Pollution Control 
Board, pursuant to Section 4(i) of the Environmental Protection Act, to adopt 
rules containing procedures to insure safe cross-connection control. 

Recommendation 2 : The Joint Committee recommended to the Environmental 
Protection Agency, that it promulgate hearing rules which will sufficiently 
describe the procedure it uses to suspend or revoke Cross-Connection Control 
Device Inspector Approval. 



107 - 



Agency Response to Objections: Refusal to Modify or Withdraw (Objection 1), 
Agreement to Modify (Objection 2), published September 27, 1985 (9 III. Reg. 
14738). Response received by the Joint Committee September 13, 1985. 

Agency Response to Recommendations: Disagree (Recommendation 1), Agree 
(Recommendation 2). Response received by the Joint Committee September 
13, 1985. 

Joint Committee Response: November 14, 1985, recommendation to draft 
legislation (Objection 1 and Recommendation 1). No further action (Objection 
2 and Recommendation 2). 

Published as Adopted: November 8, 1985 (9 III. Reg. 17367), effective 
October 23, 1985. 



Genera! Procedures for Stack Testing (35 III. Adm. Code 283) 

Proposal Originally Published in the Illinois Register , September 14, 1984 (8 
III. Reg. 16946). This Joint Committee action from the meeting of August 28, 
1985 was published in the Illinois Register , September 13, 1985 (9 111. 
Reg. 14054). 

Objection : The Joint Committee objected to the Environmental Protection 
Agency's rules entitled "General Procedures for Stack Testing" (35 III. Adm. 
Code 283) because the Agency lacks the proper statutory authority to 
promulgate rules for procedures for monitoring contaminant discharges and 
the collection of samples. 

Recommendation : The Joint Committee suggested to the Environmental 
Protection Agency that, it propose rulemaking to the Pollution Control Board 
so that specific procedures for monitoring containment discharges and the 
collection of samples are promulgated through the Board as established in the 
Environmental Protection Act. 

Agency Response to Objection: Refusal to Modify or Withdraw, published 
September 27, 1985 (9 III. Reg. 14739). Response received by the Joint 
Committee September 17, 1985. 

Agency Response to Recommendation: Disagree. Response received by the 
Joint Committee September 17, 1985. 

Joint Committee Response: October 16, 1985, 1 recommendation for Joint 
Committee legislation. 

Published as Adopted: September 27, 1985 (9 III. Reg. 14633), effective 
September 13, 1985. 

Policy for Granting Permission to Operate During Periods of Excess Emissions 
(35 III. Adm. Code 260) 

Proposal Originally Published in the Illinois Register , March 15, 1985 (9 III. 
Reg. 3145). This Joint Committee action from the meeting of August 28, 1985 

- 108 - 



was published in the Illinois Register , September 20, 1985 (9 III. Reg. 14387 
and 14390). 

Objection : The Joint Committee objected to the Environmental Protection 
Agency's rules entitled "Policy for Granting Permission to Operate During 
Periods of Excess Emissions" (35 III. Adm. Code 260) because the Agency 
lacks the statutory authority to promulgate standards for granting permission 
to operate during periods of excess emissions. 

Recommendation : The Joint Committee suggested to the Environmental 
Protection Agency that it. propose rulemaking to the Pollution Control Board 
that would establish what the Agency considers the necessary standards for 
granting permission to operate during periods of excess emissions caused by 
malfunctions, breakdowns or startups. 

Agency Response to Objection: Refusal to Modify or Withdraw, published 
November 22, 1985 (9 III. Reg. 18168). Response received by the Joint 
Committee September 17, 1985. 

Agency Response to Recommendation: Disagree. Response received by the 
Joint Committee September 17, 1985. 

Joint Committee Response: December 11, 1985, recommendation to draft 
legislation. 

Published as Adopted: December 2, 1985 (9 III. Reg. 18489), effective 
November 15, 1985. 



Procedures for Determining and Protecting Confidential Information (35 III. 
Adm. Code 161.202) ~ ~~ ™ 

Proposal Originally Published in Illinois Register , June 7, 1985 (9 III. Reg. 
11242). This Joint Committee action at the meeting of November 14, 1985 was 
published in the Illinois Register , November 29, 1985 (9 III. Reg. 18576). 

Objection: The Joint Committee objected to Section 161.202 of the rules of 
trie Environmental Protection Agency entitled "Procedures for Determining and 
Protecting Confidential information" (35 III. Adm. Code 161.202) because that 
Section conflicts with Section 120.265 of the rules of the Pollution Control 
Board, the agency which, under Section 7.1(b) of the Environmental 
Protection Act (III. Rev. Stat. 1983, ch. 11U, Section 1007.1(b)), has the 
statutory responsibility for adopting regulations prescribing procedures to be 
used by the Agency in determining whether information constitutes a trade 
secret. 

Recommendation : The Joint Committee suggested to the Environmental 
Protection Agency that it petition the Pollution Control Board by January 1 , 
1986, to amend Section 120.265 of its rules to provide for the protection of 
articles in the possession of the Agency which have not been determined to 
be trade secrets in compliance with the Board's existing rules. 



Agency Response to Objection: Pending. 



109 



Agency Response to Recommendation: Pending. 
Joint Committee Response: Pending. 
Published as Adopted: Pending. 



Procedures for Measuring Emissions of Carbon Monoxide (35 III. Adm. Code 
.__ _ _ 

Proposal Originally Published in the Illinois Register , September 14, 1984 (8 
III. Peg. 16960). This Joint Committee action from the meeting of August 28, 
1985 was published in the Illinois Register , September 13, 1985 (9 III. Reg. 
14062). 

Objection : The Joint Committee objected to the Environmental Protection 
Agency's rules entitled "Procedures for Measuring Emissions of Carbon 
Monoxide from Stationary Sources" (35 III. Adm. Code 277) because the 
Agency lacks the statutory authority to promulgate procedures for monitoring 
contaminant discharges of sources of air pollution and the collection of 
samples. 

Recommendation : The Joint Committee suggested to the Environmental 
Protection Agency that it propose rulemaking to the Pollution Control Board 
so that specific procedures for monitoring contaminant discharges and the 
collection of samples are promulgated through the Board as established in the 
Environmental Protection Act. 

Agency Response to Objection: Refusal to Modify or Withdraw, published 
September 27, 1985 (9 III. Reg. 14740). Response received by the Joint 
Committee Septemer 17, 1985. 

Agency Response to Recommendation: Disagree. Response received by the 
Joint Committee September 17, 1985. 

Joint Committee Response: October 16, 1985, recommendation to draft 
legislation. 

Published as Adopted: September 27, 1985 (9 III. Reg. 14653), effective 
September 13, 1985. 

Procedures for Measuring Emissions of Particulate Matter from Stationary 
Sources (35 III. Adm. Code 263) 

Proposal Originally Published in the Illinois Register , September 14, 1984 (8 
III. Reg. 16966). This Joint Committee action from the meeting of August 28, 
1985 was published in the Illinois Register , September 13, 1985 (9 III. Reg. 
14070). 

Objection 1 : The Joint Committee objected to the Environmental Protection 
Agency's rules entitled "Procedures for Measuring Particulate Matter from 
Stationary Sources" (35 III. Adm. 263) because the Agency lacks the 



110 



statutory authority to prescribe procedures for monitoring contaminant 
discharges and collection of samples. 

Obje ction 2 : The Joint Committee objected to the Environmental Protection 
Agency's rules entitled, "Procedures for Measuring Emissions of Particulate 
Matter from Stationary Sources" (35 III. Adm. Code 263) because the Agency 
made a substantive change to the rulemaking after publication in the Illi nois 
Register, not in response to public comment, thus circumventing the public 
notice and comment provisions of Section 5.01 of the Illinois Administrative 
Procedure Act. 

Recommendation : The Joint Committee suggested to the Environmental 
Protection Agency that it propose rulemaking to the Pollution Control Board 
so that specific procedures for monitoring contaminant discharges and the 
collection of samples are promulgated through the Board as established in the 
Environmental Protection Act. 

Agency Response to Objections: Refusal to Modify or Withdraw, published 
September 27, 1985 (9 HI. Reg. 14741). Response received by the Joint 
Committee September 17, 1985. 

Agency Response to Recommendation: Disagree. Response received by the 
Joint Committee September 17, 1985. 

Joint Committee Response: October 16, 1985, recommendation to draft 
legislation. 

Published as Adopted: September 27, 1985 (9 III, Reg. 14660), effective 
September 13, 1985. 

FARM DEVELOPMENT AUTHORITY, ILLINOIS 

Rul es of the Illinois Farm Development Authority (8 111. Adm. Code 1400) 

Proposal Originally Published in the Illinois Register , May 31, 1985 (9 111. 
Reg. 8096). This Joint Committee action from the meeting of August 28, 1985 
was published in the Illinois Register , September 13, 1985 (9 III. Reg. 
14080). 



Recommendation 



The Joint Committee suggested to the Illinois Farm 



Development Authority that it seek legislation to amend the Emergency Farm 
Credit Allocation Act (P. A. 84-1) to clarify the manner in which the 
Authority may determine, from the previous year's federal income tax 
returns, whether an applicant for a payment adjustment, pursuant, to the 
Operating interest Adjustment Loan Program, has demonstrated a positive 
cash flow where depreciation and net income do not exceed 25% of gross 
income. 



Agency Response: Failure to Respond. 
Joint Committee Response: Pending. 



- 111 - 



Published as Adopted: October 11, 1985 19 III. Reg. 15493), effective 
October 1, 1985. 



FINANCIAL INSTITUTIONS, DEPARTMENT OF 

Illinois Credit Union Act (38 III. Adm. Code 190) 

Proposal Originally Published in the Illinois Register , February 1, 1985 (9 III. 
Reg. 1219). This Joint Committee action from the meeting of July 25, 1985 
was published in the Illinois Register , August 9, 1985 (9 III. Reg. 12414). 

Recommendation : The Joint Committee suggested to the Department of 
Financial Institutions that it draft and introduce legislation explicitly 
permitting the Department to require credit unions to provide fidelity bond 
and insurance coverage for the unlawful acts of third persons and credit 
union officials in addition to officers and employees of the credit union having 
custody of or handling funds. 

Agency Response: Agree. Response received by the Joint Committee October 
24, 1985. 

Joint Committee Response: November 14, 1985, no further action. 

Published as Adopted: October 25, 1985 (9 III. Reg. 16231), effective 
October 10, 1985. 



HUMAN RIGHTS COMMISSION 

Joint Rules of the Department of Human Rights and the Human Rights 
Commission: Rules on Sex Discrimination in Employment (56 III. Adm. Code 
5210.40, 5210.50, 5210.70, 5210.70(b)(4), 5210.100 and 5210.110(a)) 

Proposal Originally Published in the Illinois Register , November 16, 1984 (8 
III. Reg. 22472). This Joint Committee action from the meeting of October 16, 
1985 was published in the Illinois Register , November 1, 1985 (9 III. Reg. 
17059). 

Objection 1 : The Joint Committee objected to Section 5210.40 of the 
Department of Human Rights' and Human Rights Commission's "Rules on Sex 
Discrimination in Employment" because the rule does not state the policy of 
the Department and Commission in a simple and clear manner, in violation of 
Section 220.900(b)(3) of the Operational Rules of the Joint Committee. 

Objection 2 : The Joint Committee objected to Section 5210.50 of the 
Department of Human Rights' and the Human Rights Commission's "Rules on 
Sex Discrimination in Employment" because the rule fails to include the 
standards used by the Department and Commission in determining what 
constitutes "substantially similar" or "substantially the same" work, in 
violation of Section 4.02 of the Illinois Administrative Procedure Act. 

Objection 3 : The Joint Committee objected to Section 5210.70 of the "Rules on 
Sex Discrimination in Employment" of the Department of Human Rights and the 

- 112 - 



Human Rights Commission because contrary to the requirements of Section 
4.02 of the Illinois Administrative Procedure Act, the rule fails to include the 
standards used by the Department and Commission in determining what 
constitutes a "bona fide occupational qualification" or the standards used in 
determining when a bona fide occupational qualification is "necessary for safe 
and efficient job performance," 

Objection 4 : The Joint Committee objected to Section 5210.70(b)(4) of the 
"Rules on Sex Discrimination in Employment" of the Department of Human 
Rights and the Human Rights Commission because the rule fails to include the 
standards used by the Department and Commission in determining what 
constitutes a "clearly unreasonable expense," in violation of Section 4.02 of 
the Illinois Administrative Procedure Act. 

Objection 5 : The Joint Committee objected to Section 5210.100 of the "Rules 
on Sex Discrimination in Employment" of the Department of Human Rights and 
Human Rights Commission which prescribes payments by employers for 
employee's memberships in private clubs in certain instances because the term 
"overall professional status" as used in the rule is vague and ill-defined and 
results in that portion of the rule being vague and susceptible to inconsistent 
interpretations and applications. 

Objection 6 : The Joint Committee objected to Section 5210.110(a) of the 
"Rules on Sex Discrimination in Employment" of the Department of Human 
Rights and the Human Rights Commission because the rule fails to include the 
standards by which the Department and Commission will determine when a 
pregnant woman is "unable" to be trained for or to perform in the job in 
question, in violation of Section 4.02 of the Illinois Administrative Procedure 
Act. 

Agency Response: Refusal to Modify or Withdraw, published December 2, 
1985 (9 ill. Reg. 18553). Response received by the Joint Committee November 
14, 1985. 

Joint Committee Response: December 11, 1985, no further action. 

Published as Adopted: December 2, 1985 (9 III. Reg. 18507), effective 
November 14, 1985. 



Procedural Rules (56 Hi. Adm. Code 5300) 

Proposal Originally Published in Illinois Register, November 9, 1984 (8 111. 
Reg. 21969). This Joint Committee action from the meeting of March 19, 1985 
was published in the Illinois Register , April 12, 1985 (9 111. Reg. 4901). 

Objection 1 : The Joint Committee objected to the rules of the Human Rights 
Commission entitled "Procedural Rules" (56 III. Adm. Code 5300) because the 
Commission failed to comply with the regulatory flexibility requirements of 
Section 5.01 of the Illinois Administrative Procedure Act. 

Objection 2 : The Joint Committee objected to Section 530C. 835(b) of the 
Human Rights Commission's rules entitled "Procedural Rules" (56 III. Adm. 
Code 5300.835(b)) because the rule does not include the standards used by 

- 113 - 



the Chairperson of the Commission in determining whether extensions of filing 
deadlines will he granted, in violation of Section 4.02 of the Illinois 
Administrative Procedure Act. 

Agency Response: Refusal to Modify or Withdraw, published May 3, 1985 (9 
III. Reg. 6341). Response received by the Joint Committee June 20, 1985. 

joint Committee Response: July 25, 1985, no further action. 

Published as Adopted: May 3, 1985 (9 III. Reg. 6207), effective April 24, 
1985. 



HUMAN RIGHTS, DEPARTMENT OF 

Joint Rules of the Department of Human Rights and the Human Rights 
Commission: Rules on Sex Discrimination in Employment (56 ML Adm. Code 
5210.40, 5210.50, 5210.70, 5210.70(b)(4), 5210.100 and 5210.110(a)) 

Proposal Originally Published in the Illinois Register , November 16, 1984 (8 
III. Reg. 22483). This Joint Committee action from the meeting of October 16, 
1985 was published in the Illinois Register , November 1, 1985 (9 III. Reg. 
1V 070). 

Objection 1 : The Joint Committee objected to Section 5210.40 of the 
Department of Human Rights 1 and Human Rights Commission's "Rules on Sex 
Discrimination in Employment" because the rule does not state the policy of 
the Department and Commission in a simple and clear manner, in violation of 
Section 220.900(b)(3) of the Operational Rules of the Joint Committee. 

Objection 2 : The Joint Committee objected to Section 5210.50 of the 
Department of Human Rights' and the Human Rights Commission's "Rules on 
Sex Discrimination in Employment" because the rule fails to include the 
standards used by the Department and Commission in determining what 
constitutes "substantially similar" or "substantially the same" work, in 
violation of Section 4.02 of the Illinois Administrative Procedure Act. 

Objection 3 : The Joint Committee objected to Section 5210.70 of the "Rules on 
Sex Discrimination in Employment" of the Department of Human Rights and the 
Human Rights Commission because contrary to the requirements of Section 
4.02 of the Illinois Administrative Procedure Act, the rule fails to include the 
standards used by the Department and Commission in determining what, 
constitutes a "bona fide occupational qualification" or the standards used in 
determining when a bona tide occupational qualification is "necessary for safe 
and efficient job performance." 

Objection 4 : The Joint Committee objected to Section 5210.70(b)(4) of the 
"Rules on Sex Discrimination in Employment" of the Department of Human 
Rights and the Human Rights Commission because the rule fails to include the 
standards used by the Department and Commission in determining what 
constitutes a "clearly unreasonable expense," in violation of Section 4.02 of 
the Illinois Administrative Procedure Act. 



114 



Objection 5: The Joint Committee objected to Section 5210 .1 0C of the "Rules 
on Sex Discrimination in Employment" of the Department of Human Rights and 
Human Rights Commission which prescribes payments by employers for 
employee's memberships in private clubs in certain instances because the term 
"overall professional status" as used in the rule is vague and ill-defined and 
results in that portion of the rule being vague and susceptible to inconsistent 
interpretations and applications. 

Objection 6 : The Joint Committee objected to Section 5210.110(a) of the 
""Rules on Sex Discrimination in Employment" of the Department of Human 
Rights and the Human Rights Commission because the rule fails to include the 
standards by which the Department and Commission will determine when a 
pregnant woman is "unable" to be trained for or to perform in the job in 
question, in violation of Section 4.02 of the Illinois Administrative Procedure 
Act. 

Agency Response: Refusal to Modify or Withdraw, published December 2, 
1985 (9 III. Reg. 18553). Response received by the Joint Committee November 
14, 1985. 

Joint Committee Response: December 11, 1985, no further action. 

Published as Adopted: December 2, 1985 (9 111. Reg. 18507), effective 
November 14, 1985. 



INDUSTRIAL COMMISSION 

Pre-Arbitration (50 III. Adm. Code 7020) 

Proposal Originally Published in the Illinois Register , May 3, 1985 (9 III. 
Reg. 5931) . This Joint Committee action from the meeting of August 28, 1985 
was published in the Illinois Register , September 13, 1985 (9 III. Reg. 
14083). 

Objection : The Joint Committee objected to Section 7020.80(b) (2) (A) (iii) of 
the rules of the Illinois Industrial Commission entitled "Pre Arbitration" (50 
III. Adm. Code 7020.80(b) (2) (a) (iii) because the Commission does not have 
the statutory authority to allow the amendment of Section 19(b-1) Petitions. 

Recommendation : The Joint Committee suggested to the Illinois Industrial 
Commission that it seek legislation amending the Workers' Compensation Act 
(III. Rev. Stat. 1983, ch. 48, par. 138 et seq.) to allow for the amendment of 
Section 19(b-1) Petitions. 

Agency Response to Objection: Refusal to Modify or Withdraw, published 
October 25, 1985 (9 III. Reg. 16358). Response received by the Joint 
Committee October 9, 1985. 

Agency Response to Recommendation: Disagree. Response received by the 
Joint Committee October 16, 1985. 



- 115 - 



Joint Committee Response: October 16, 1985, 2 recommendations to draft 
legislation. 

Published as Adopted: October 25, 1985 (9 III. Reg. 16238), effective 
October 15, 1985. 



INSURANCE, DEPARTMENT OF 

Accident and Health Risk Ratio Notice (50 III. Adm. Code 938.50 and 938.60) 

Proposal Originally Published in the Illinois Register , February 15, 1985 (9 
III. Reg. 1996). This Joint Committee action from the meeting of June 19, 
1985 was published in the Illinois Register , July 5, 1985 (9 III. Reg. 10314 
and 10318). 

Objection: The Joint Committee objected to Sections 938.50 and 938.60 of the 
Department of Insurance's rulemaking entitled "Accident and Health Risk Ratio 
Notice" because the Department lacks statutory authority to permit insurance 
companies to sell insurance, without notice to the Director, after a specified 
percentage increase in premium volume has been achieved. 

Recommendation 1 : The Joint Committee suggested to the Department of 
Insurance that it seek legislation amending Section 144.2 of the Illinois 
Insurance Code to show that companies may wait for quarterly financial data 
to make the determination that notice based on annualized premium volume 
figures is required. 

Recommendation 2 : The Joint Committee suggested to the Department of 
Insurance that ft seek legislation amending Section 144.2 of the Illinois 
Insurance Code to clarify the fact that the Department is to require use of 
quarterly premium volume "on an annualized basis" to determine whether a 
company must make further calculations, and possibly notify the Department 
of premium volume growth. 

Agency Response to Objection: Refusal to Modify or Withdraw, not 
published. Response received by the Joint Committee September 13, 1985. 

Agency Response to Recommendations: Agree. Response received by the 
Joint Committee September 13, 1985. 

Joint Committee Response: October 16, 1985, recommendation that agency 
develop legislation (Objection); no further action (Recommendation). 

Published as Adopted: Pending. 

Licensed Persons In Military Service (50 III. Adm. Code 3110) 

Proposal Originally Published in Illinois Register , September 28, 1984 (8 III. 
Reg. 17962). This Joint Committee action from the meeting of March 19, 1985 
was published in the Illinois Register , April 12, 1985 (9 III. Reg. 4906). 



- 116 - 



Recommendation : The Joint Committee suggested that the Department of 

Insurance draft and introduce legislation to amend the Illinois Insurance Code 

to authorize the Department to waive license renewal fees for Insurance 
Producers in the military service. 

Agency Response: Agree. Response received by the Joint Committee April 
8, 1985. 

Joint Committee Response: May 14, 1985, recommendation to monitor 
legislation. 

Published as Adopted: April 19, 1985 (9 III. Reg. 5332), effective April 8, 
1985. 

LABOR, DEPARTMENT OF 

Toxic Substances Disclosure to Employees (56 III. Adm. Code 205) 

Proposal Originally Published in Illinois Register , August 30, 1985 (9 III. 
Reg. 13242). This Joint Committee action at the meeting of November 14, 
1985 was published in the Illinois Register , November 29, 1985 (9 III. Reg. 
& 18582). 

Objection : The Joint Committee objected to the hearing procedures followed 
"By the Department of Labor in its proposed revisions to the List of Toxic 
Substances because the Department has violated the procedures set forth in 
Section 5(c) of the Toxic Substances Disclosure to Employees Act. 

Agency Response: Pending. 

Joint Committee Response: Pending. 

Published as Adopted: Pending. 

LABOR RELATIONS BOARD, ILLINOIS EDUCATIONAL 

Hearing Procedures (80 ill. Adm. Code 1105.40 and 1105.150) 

Proposal Originally Published in Illinois Register , January 18, 1985 (9 111. 
Reg. 603). This Joint Committee action from the meeting of May 14, 1985 was 
published in the Illinois Register , May 31, 1985 (9 III. Reg. 8201). 

Objection: The Joint Committee objected to Sections 1105.40 and 1105.150 of 
the rules of the Illinois Educational Labor Relations Board entitled "Hearing 
Procedures" because those rules permit the unauthorized practice of law, in 
violation of "An Act to revise the laws in relation to attorneys and 
counselors." 

Recommendation: The Joint Committee suggested to the Illinois Educational 
Labor Relations Board that it seek legislation to allow union members and 
school board members to represent their union and school board, 
respectively, in Board proceedings. 

- 117 - 



Agency Response to Objection: Refusal to Modify or Withdraw, published 
June 21, 1985 (9 III. Reg. 9583). Response received by the Joint Committee 
June 6, 1985. 

Agency Response to Recommendation: Agree. Response received by the 
Joint Committee June 6, 1985. 

Joint Committee Response: July 25, 1985, recommendation to monitor agency's 
progress in drafting and introducing legislation. 

Published as Adopted: June 21, 1985 (9 III. Reg. 9491), effective June 11, 
1985. 



MINES AND MINERALS, DEPARTMENT OF 



Permanent Program Performance Standards 
III. Adm. Code 1816.190) ~~ 



Surface Mining Operations (62 



Proposal Originally Published in Illinois Register , September 7, 1984 (8 III. 
Reg. 16220). This Joint Committee action from the meeting of May 14, 1985 
was published in the Illinois Register , May 31, 1985 (9 III. Reg. 8207). 

Objection: The Joint Committee objected to the Department of Mines and 
Minerals' amendment to 62 III. Adm. Code 1816.190 because the Department, 
by stating in the first notice that, comments would only be received by the 
Department for 14 days, misinformed the public of the actual amount of time 
in which comments would be received on this rulemaking in violation of 
Section 5.01(a) of the Illinois Administrative Procedure Act and Section 
9.01(d) of the Illinois Surface Coal Mining Land Conservation Reclamation Act. 

Agency Response: Refusal to Modify or Withdraw, published August 2, 1985 
^9 III. Reg. 12026). Response received by the Joint Committee August 15, 
1985. 

Joint Committee Response: August 28, 1985, no further action. 

Published as Adopted: August 30, 1985 (9 III. Reg. 13310), effective October 
10. 1985. 



Pe rmanent Program Performance Standards 
(62 III. Adm. Code 1817.65) 



Underground Mining Operations 



Proposal Originally Published in Illinois Register , September 7, 1984 (8 III. 
Reg. 16225). This Joint Committee action from the meeting of May 14, 1985 
was published in the Illinois Register , May 31, 1985 (9 III. Reg. 8210). 

Objection : The Joint Committee objected to the Department of Mines and 
Minerals' amendment to 62 III. Adm. Code 1817.65 because the Department, by 
stating in the first notice that comments would only be received by the 
Department for 14 days, misinformed the public of the actual amount of time 
in which comments would be received on this rulemaking in violation of 



111 



Section 5.01(a) of the Illinois Administrative Procedure Act and Section 
9.01(d) of the Illinois Surface Coal Mining Land Conservation Reclamation Act. 

Agency Response: Refusal to Modify or Withdraw, published August 2, 1985 
(9 III. Reg. 12028). Response received by the Joint Committee August 15, 
1985. 

Joint Committee Response: August 28, 1985, no further action. 

Published as Adopted: August 30, 1985 (9 III. Reg. 13315), effective October 
10, 1985. 



Requirements for Permits for Special Categories of Mining (62 III. Adm. Code 
1785.17(a) ~~~ ™~~ ' 

Proposal Originally Published in Illinois Register , September 7, 1984 (8 III. 
Reg. 16234). This Joint Committee action from the meeting of May 14, 1985 
was published in the Illinois Register , May 31. 1985 (9 111. Reg. 8213). 

Objection 1 : The Joint Committee objected to the Department of Mines and 
Minerals' amendment to 62 111. Adm. Code 1785.17 because the Department, by 
stating in the first notice that comments would only be received by the 
Department for 14 days, misinformed the public of the actual amount of time 
in which comments would be received on this rulemaking in violation of 
Section 5.01(a) of the Illinois Administrative Procedure Act and Section 
9.01(d) of the Illinois Surface Coal Mining Land Conservation Reclamation Act. 

Objection 2 : The Joint Committee objected to Section 1785.17(a) of the 
Special Prime Farmland Permit and Reclamation Rules of the Department of 
Mines and Minerals because, the rule will be afforded retroactive effect, in 
violation of Section 9.01(h) of the Surface Coal Mining Land Conservation and 
Reclamation Act and Section 5.01 of the Illinois Administrative Procedure Act. 

Agency Response: Refusal to Modify or Withdraw, published August 2, 1985 
(9 III. Reg. 13324). Response received by the Joint Committee July 19, 1985. 

Joint Committee Response: August 28, 1985, no further action. 

Published as Adopted: August 30, 1985 (9 III. Reg. 13324), effective October 
10, 1985. 



State Enforcement (62 III. Adm. Code 1843.12) 

Proposal Originally Published in Illinois Register , September 7, 1984 (8 III. 
Reg. 16244). This Joint Committee action from the meeting of May 14, 1985 
was published in the Illinois Register , May 31, 1985 (9 III. Reg. 8219). 

Objection: The Joint Committee objected to the Department of Mines and 
Minerals amendment to 62 III. Adm. Code 1843.12, "State Enforcement" 
because the Department, by stating in the first notice that comments would 

- 119 - 



only be received by the Department for 14 days, misinformed the public of 
the actual amount of time in which comments would be received on this 
rulemaking in violation of Section 5.01(a) of the Illinois Administrative 
Procedure Act and Section 9.01(d) of the Illinois Surface Coal Mining Land 
Conservation Reclamation Act. 

Agency Response: Refusal to Modify or Withdraw, published August 2, 1985 
(9 III. Reg. 12033). Response received by the Joint Committee July 19, 1985. 

Joint Committee Response: August 28, 1985, no further action. 

Published as Adopted: August 30, 1985 (9 III. Reg. 13334), effective October 
10. 1985. 



Training, Examination and Certification of Blasters (62 III. Adm. Code 1850) 

Proposal Originally Published in the Illinois Register , February 15, 1985 (9 
ill. Reg. 2008). This Joint Committee action from the meeting of December 
11, 1985 was published in the Illinois Register , December 27, 1985 (9 III. 
Reg. 20972). 

Objection 1 : The Joint Committee objected to the proposed amendment in 
Section T850. 15(d) of the Department of Mines and Minerals' rules entitled 
"Training, Examination and Certification of Blasters" (62 III. Adm. Code 
1850), because the Department has failed to provide proper standards for its 
action in violation of Section 4.02 of the Illinois Administrative Procedure Act. 

Objection 2 : The Joint Committee objected to Section 1850.16(b)(1) of the 
Department of Mines and Minerals' rules entitled "Training, Examination and 
Certification of Blasters" (62 III. Adm. Code 1850) because contrary to 
Section 4.C2 of the Illinois Administrative Procedure Act, the rule does not 
include the standards to be used by the Department in determining when to 
issue a notice of infraction. 

Agency Response: Pending. 

Joint Committee Response: Pending. 

Published as Adopted: Pending. 

NUCLEAR SAFETY, DEPARTMENT OF 

Licensing Persons in the Practice of Radiation Technology (32 III. Adm. Code 
401 .100(d), and 401 .110(d)) 

Proposal Originally Published in Illinois Register , November 9, 1984 (8 III. 

Reg. 21998). This Joint Committee action from the meeting of January 17, 

1985 was published in the Illinois Register , February 1, 1985 (9 III. Reg. 
1471) 

Objection : The Joint Committee objected to Sections 401.100(d) and 
401.110(d) of the Department of Nuclear Safety's rules entitled "Licensing 

- 120 - 



Persons in the Practice of Radiation Technology," because the rules conflict 
with Section 4.2 of the Radiation Protection Act (III. Rev. Stat. 1983, ch. 
111^, par. 214.2) by establishing two-year initial issuance periods for 
Conditional Accreditation Type II licenses. 

Agency Response: Modification, published February 22, 1985 (9 III. Reg. 
2553). Response received by the Joint Committee February 8, 1985. 

Joint Committee Response: March 19, 1985, no further action. 

Published as Adopted: February 22, 1985 (9 III. Reg. 2499), effective 
February 13, 1985. 

Safe Operation of Nuclear Facility Boilers and Pressure Vessels (32 III. Adm. 
Code 505) 

Proposal Originally Published in the Illinois Register , February 8, 1985 (9 III. 
Reg. 1573). This Joint Committee action from the meeting of December 11, 
1985 was published in the iliinois Register, December 27, 1985 (9 III. Reg. 
20976). 

Objection 1 : The Joint Committee objected to Section 505.30 of the 
Department of Nuclear Safety's rules on "Safe Operation of Nuclear Facility 
Boilers and Pressure Vessels" (32 III. Adm. Code 505.30) because, contrary 
to Section 6.02 of the Illinois Administrative Procedure Act, the rule 
incorporates by reference the Boiler and Pressure Vessel Code of the 
American Society of Mechanical Engineers as "hereafter amended" and without 
identifying the incorporated matter by date. 

Objection 2 : The Joint Committee objected to Section 505.170 of the rules of 
the Department of Nuclear Safety entitled "Nuclear Facility Safety" (32 III. 
Adm. Code 505) because this Section delegates the authority for commissioning 
Authorized Inspectors to the Office of the State Fire Marshal, contrary to the 
provisions of Section 2a of the Boiler Safety Act and Section 71(C)(3) of the 
Civil Administrative Code. 

Recommendation : The Joint Committee recommended to the Department of 
Nuclear Safety that it seek legislation to amend the Boiler Safety Act and the 
Civil Administrative Code so as to clarify what Department shall be 
responsible for certifying Authorized Inspectors. 

Agency Response to Objection: Pending. 

Agency Response to Recommendation: Pending. 

Joint Committee Response: Pending. 

Published as Adopted: 

POLLUTION CONTROL BOARD 

Organic Emission Standards and Limitations (35 III. Adm. Code 215) 

- 121 - 



Proposal Originally Published in the Illinois Register , August 31, 1984 (8 III. 
Reg. 15864). This Joint Committee action from the the meeting of July 25, 
1985 was published in the Illinois Register , August 9, 1985 (9 III. Reg. 
12417). 

Objection : The Joint Committee objected to the imposition of the requirements 
of Subpart Q of the Pollution Control Board's rules entitled "Organic Material 
Emission Standards and Limitations" (35 III. Adm. Code 215) on those plants 
located outside of "nonattainment" counties was accomplished without the 
Board taking into account the economic reasonableness of measuring and 
reducing "Organic Material" emissions, because the rule violates Section 27(a) 
of the Environmental Protection Act. 

Agency Response: Refusal, published September 6, 1985 (9 III. Reg. 13757). 
Response received by the Joint Committee September 10, 1985. 

Joint Committee Response: October 16, 1985, no further action. 

Published as Adopted: September 13, 1985 (9 III. Reg. 13960), effective 
August 28, 1985. 



Radiation Hazards (35 III. Adm. Code 1000.403) 

Proposal Originally Published in the Illinois Register , May 10, 1985 (9 III. 
Reg. 6569). This Joint Committee action from the meeting of September 19, 
1985 was published in the Illinois Register , October 4, 1985 (9 III. Reg. 
15087). 

Objection : The Joint Committee objected to Section 1000.403 of the Pollution 
Control Board's rules entitled "Radiation Hazards"; 35 III. Adm. Code 1000, 
because the Board has failed to include within the referenced section the 
proper standards, pursuant to Section 4.02 of the Illinois Administrative 
Procedure Act, by which it will exercise its discretionary power. 

Agency Response: Pending. 

Joint Committee Response: Pending. 

Published as Adopted: Pending. 

Solid Waste (35 III. Adm. Code 807.503, 807.507, 807.523, 807.600, 807.601, 
807.620) 

Proposal Originally Published in Illinois Register , August 10, 1985 (8 III. 
Reg. 14145). This Joint Committee action from the meeting of March 19, 1985 
was published in the Illinois Register , April 12, 1985 (9 III. Reg. 4909 and 
4914). 

Objection : The Joint Committee objected to Sections 807.503, 807.507, 
807.523, 807.600, 807.601 and 807. 62C of the Pollution Control Board's rule 
entitled "Solid Waste'' (35 III. Adm. Code 807.503, 807.507, 807.523, 807.600, 
807.601 and 807.620) because the Pollution Control Board lacks the statutory 



122 - 



authority to require a waste disposal operator to post security to cover the 
cost of closure and post-closure care of waste treatment and waste storage 
operations. 

Recommendation: The Joint Committee suggested to the Pollution Control Board 
that it seek legislation to clarify the intent of Public Act 83-775 with respect 
to the posting of security for the cost of closure and post-closure care of 
waste treatment and waste storage operations. 

Agency Response to Objection: Refusal to Modify or Withdraw, published May 
10, 1985 (9 III. Reg. 6880). Response received by the Joint Committee April 
29, 1985. 

Agency Response to Recommendation: Agree. Response received by the 
Joint Committee April 29, 1985. 

Joint Committee Response: June 19, 1985, recommendation for legislation. 

Published as Adopted: May 10, 1S85 (9 III. Reg. 6722), effective April 29, 
1985. 



PRISONER REVIEW BOARD 

Prisoner Review Board Rules (20 III. Adm. Code 1610.35(b) and 1610.40) 

Proposal Originally Published in the Illinois Register , March 8, 1985 (9 III. 
Reg. 2856). This Joint Committee action from the meeting of June 19, 1985 
was published in the Illinois Register , July 5, 1985 (9 ill. Reg. 10324). 

Objection 1 : The Joint Committee objected to Section 1610.35(b) of the rules 
of the Prisoner Review Board (20 111. Adm. Code 1610) because, contrary to 
Section 4.02 of the Illinois Administrative Procedure Act, the rule does not 
include the standards to be used by the Board in determining whether a 
youth is in need of further institutional programs or that parole would not be 
in the best interests of the community. 

Objection 2 : The Joint Committee objected to Section 1610.40 of the rules of 
the Prisoner Review Board because the rules are vague and do not include 
clear and precise standards to be used by the Board in determining whether 
information will be considered as evidence, as is required by Section 4.02 of 
the Illinois Administrative Procedure Act. 

Agency Response: Agreement to Modify, published October 25, 1985 (9 III. 
Reg. 16360). Response received by the Joint Committee August 2, 1985. 

Joint Committee Response: August 28, 1985, no further action. 

Published as Adopted: October 25, 1985 (9 111. Reg. 16257), effective 
October 10, 1985. 



123 



PUBLIC AID, DEPARTMENT OF 

Administration of Social Service Programs (89 III. Acim. Code 130.110(c)) 

Proposal Originally Published in Illinois Register , November 30, 1984 (8 III. 
Reg. 23135). This Joint Committee action from the meeting of February 27, 
1985 was published in the Illinois Register , March 15, 1985 (9 III. Reg. 3372). 

Objection : The Joint Committee objected to Section 130.110(c) of the rules of 
the Department of Public Aid because, contrary to the provisions of Section 
4.02 of the IAPA, the Department has not clearly and precisely set forth 
standards used to select service providers under the donated funds initiative. 

Agency Response: Agreement to Modify, published June 7, 1985 (9 III. Reg. 
8907). Response received by the Joint Committee May 20, 1985. 

Joint Committee Response: June 19, 1985, no further action. 

Published as Adopted: June 7, 1985 (9 III. Reg. 8645), effective May 22, 
1985. 



Aid to Families with Dependent Children (89 III. Adm. Code 112.80 and 
112.73) " 

Proposal Originally Published in Illinois Register , November 2, 1984 (8 III. 
Reg. 21496). This Joint Committee action from the meeting of February 27, 
1985 was published in the Illinois Register , March 15, 1985 (9 III. Reg. 3375). 

Objection 1 : The Joint Committee objected to the proposed amendment to 
Section 112.80 of the rules of the Department of Public Aid because, contrary 
to Section 2634 of the Deficit Reduction Act of 1984 and 45 C.F.R. 
234.60(a) (12) and (13), the Department proposes to make AFDC payments to 
sanctioned individuals without first making all reasonable efforts to locate an 
individual to serve as a protective payee. 

Objection 2 : The Joint Committee objected to the proposed amendment to 
Section 112.73 of the rules of the Department of Public Aid because, contrary 
to Section 2634 of the Deficit Reduction Act of 1984, the Department proposes 
to make AFDC payments to sanctioned individuals without first making all 
reasonable efforts to locate an individual to serve as a protective payee. 

Agency Response: Refusal to Modify or Withdraw, published May 31, 1985 (9 
III. Reg. 8194). Response received by the Joint Committee May 17, 1985. 

Joint Committee Response: June 19, 1985, no further action. 

Published as Adopted: June 7, 1985 (9 III. Reg. 8155), effective May 17, 
1985. 



Aid to the Aged, Blind or Disabled (Day Care) (89 III. Adm. Code 113.303) 

Proposal Originally Published in Illinois Register , February 8, 1985 (9 III. 
Reg. 1591). This Joint Committee action from the meeting of May 14, 1985 

- 124 - 



was published in the Illinois Register , May 31, 1S85 (9 III. Reg. 8225). 

Recommendation : The Joint Committee suggested to the Department of Public 
Aid that ft petition the Department of Children and Family Services to 
promulgate rules to place its maximum rates for day care, or its methodology 
for establishing such rates, in its rules prior to the Department of Public 
Aid's adoption of its amendments to Section 113.303. 

Agency Response: Disagree. Response received by the Joint Committee July 
1 , 1985. 

Joint Committee Response: July 25, 1985, no further action. 

Published as Adopted: July 19, 1985 (9 III. Reg. 11302), effective July 5, 
1985. 



Aid to Families with Dependent Children (Maximum Amounts for Therapeutic 
Diet) 189 III. Adm. Code 112.308) 

Proposal Originally Published in Illinois Register , February 8, 1985 (9 III. 
Reg. 1591). This Joint Committee action from the meeting of May 14, 1985 
was published in the Illinois Register , May 31, 1985 (9 III. Reg. 8222). 

Recommendation: The Joint Committee suggested to the Department of Public 
Aid that It petition the Department of Children and Family Services to 
promulgate rules to place its maximum rates for day care, or its methodology 
for establishing such rates, in its rules prior to the Department of Public 
Aid's adoption of its amendments to Section 112.308. 

Agency Response: Disagree. Response received by the Joint Committee July 
1, 1985. 

Joint Committee Response: July 25, 1985, no further action. 

Published as Adopted: July 19, 1985 (9 III. Reg. 11317), effective July 5, 
1985. 



Aid to the Aged, Blind or Disabled (Residence) (89 III. Adm. Code 113) 

Proposal Originally Published in the Illinois Register , June 14, 1985 (9 III. 
Reg. 9086). This Joint Committee action from the meeting of September 19, 
1985 was published in the Illinois Register , October 4, 1985 (9 III. Reg. 
15090). 

Recommendation : The Joint Committee suggested to the Department of Public 
Aid that it seek legislation amending the residency requirements contained in 
Section 2-10 of the Public Aid Code (III. Rev. Stat. 1983, ch. 23, par. 2-10) 
to conform to Federal residency requirements for Aid to the Aged, Blind and 
Disabled of 42 CFR 435.403(i) (ii). 

Agency Response: Pending. 

Joint Committee Response: Pending. 

- 125 - 



Published as Adopted: October 25, 1985 (9 III. Reg. 16291), effective 
October 10, 1985. 



Food Stamps (Assets) (89 III. Adm. Code 121 .57(b) (1 ) (B) ) 

Proposal Originally Published in I llinois Register , August 16, 1985 (9 III. 

Reg. 12815.) This Joint Committee action at the meeting of November 14, 

1985 was published in the Illinois Register , November 14, 1985 (9 111. Reg. 
18586). 

Objection : The Joint Committee objected to Section 121.57(b)(1)(B) of the 
Department of Public Aid's rules governing the treatment of assets for 
eligibility for the Food Stamp Program because, contrary to federal 
regulations (7 C.F.R. 273.8 (1984)) the Department does not exempt all 
Keogh plans which involve a contractual relationship between a member of a 
food stamp household and a nonmember. 

Agency Response: Pending. 

Joint Committee Response: Pending. 

Published as Adopted: Pending. 

Food Stamps (Amount cf Eenefits) (89 III. Adm. Code 121.30) 

Proposal Originally Published in Illinois Register , February 1, 1985 (9 III. 
Reg. 1229). This Joint Committee action from the meeting of April 16, 1985 
was published in the Illinois Register , May 3, 1985 (9 III. Reg. 6428) 

Objection : The Joint Committee objected to Section 121.30 of the proposed 
rules of the Department, of Public Aid because, contrary to the provisions of 
Section 164 of the Omnibus Budget Reconciliation Act of 1982 and Federal 
Regulations (49 Fed. Reg. 48681, 12/14/84), the Department considers the 
penalty amount imposed for failure to comply with a federal, state, or local 
welfare program as available unearned income for determining eligibility for 
and coupon allotment under the Food Stamp program without determining 
whether the failure to comply was intentional. 

Agency Response: Refusal to Modify or Withdraw, published May 10, 1985 (9 
III. Reg. 6882). Response received by the Joint Committee May 7, 1985. 

Joint Committee Response: June 19, 1985, no further action. 

Published as Adopted: May 10, 1985 (9 III. Reg. 6804), effective May 1, 
1985. 



Food Stamps (Exempt Assets) (89 III. Adm. Code 121.58(b) 

Proposal Originally Published in Illinois Register , October 19, 1984 (8 III. 
Reg. 20634). This Joint Committee action from the meeting of February 27, 
1985 was published in the Illinois Register , March 15, 1985 (9 111. Reg. 3381). 

- 126 - 



Objection : The Joint Committee objected to Section 121.58(b) of the 
Department of Public Aid's rules governing the treatment of assets for 
eligibility for the Food Stamp program because, contrary to federal 
regulations (7 C.F.R. 273.8 (1984) the Department does not exempt all Keogh 
plans which involve a contractual relationship between a member of a food 
stamp household and a nonmember. 

Agency Response: Refusal to Modify or Withdraw, published June 7 , 1985 (9 
III. Reg. 8912). Response received by the Joint Committee May 24, 1985. 

Joint Committee Response: June 19, 1985, no further action. 

Published as Adopted: June 7, 1985 (9 III. Reg. 8665), effective May 29, 
1985. 



Food Stamps (Students) (89 III. Adm. Code 121.75(b)) 

Froposal Originally Published in Illinois Register , October 19, 1984, (8 III. 
Reg. 20634). This Joint Committee action from the meeting of February 27, 
1985 was published in the Illinois Register , March 15, 1985 (9 III. Reg. 3385). 

Objection : The Joint Committee objected to Section 121.75(b) of the 
Department of Public Aid's proposed rules because the language of this 
provision is inconsistent with the provisions of the United States Department 
of Agriculture regulations under the Food Stamp Act (7 C.F.R. Section 
273.5(b)). 

Agency Response: Refusal to Modify or Withdraw, published July 7, 1985 (9 
III. Reg. 8912). Response received by the Joint Committee May 24, 1985. 

Joint Committee Response: June 19, 1985, no further action. 

Published as Adopted: June 7, 1985 (9 III. Reg. 8665), effective May 29, 
1985. 



General Assistance (Therapeutic Diet, Day Care, Substitute Parental 
Care/Supplemental Child Care) (89 III. Adm. Code 114.402) "~~ " ~" 

Proposal Originally Published in Illinois Register , February 8, 1985 (9 III. 
Reg. 1620). This Joint Committee action from the meeting of May 14, 1985 
was published in the Illinois Register , May 31, 1985 (9 III. Reg. 8228). 

Recommendation: The Joint Committee suggested to the Department of Public 
Aid that it petition the Department of Children and Family Services to 
promulgate rules to place its maximum rates for day care, or its methodology 
for establishing such rates, in its rules prior to the Department of Public 
Aid's adoption of its amendments to Section 114.402. 

Agency Response: Disagree. Response received by the Joint Committee July 
1, 1985. 

Joint Committee Response: July 25, 1985, no further action. 

- 127 - 



Published as Adopted: July 12, 1985 (9 III. Reg. 10764), effective July 5, 
1985. 



Medical Payment (Coverage of Disabled Persons 20 Years Old or Younger) (89 
III. Adm. Code 140.645) 

Proposal Originally Published in Illinois Register , December 21, 1984 (8 III. 
Reg. 24525). This Joint Committee action from the meeting of March 19, 1985 
was published in the Illinois Register , April 12, 1985 (9 III. Reg. 4920). 

Objection : The Joint Committee objected to Section 140.645 of the proposed 
rules of the Department of Public Aid because, contrary to Section 5-2(7) of 
the Public Aid Code, the Department of Public Aid has proposed to provide 
medical and in-home care services to persons over eighteen years of age. 

Agency Response: Refusal to Modify or Withdraw, published July 5, 1985 (9 
III. Reg. 10301). Response received by the Joint Committee June 19, 1985. 

Joint Committee Response: July 25, 1985, no further action. 

Published as Adopted: July 5, 1985 (9 III. Reg. 10255), effective June 26, 
1985. 



Medical Assistance Programs (Residence) (89 III. Adm. Code 120) 

Proposal Originally Published in the Illinois Register , June 14, 1985 (9 III. 
Reg. 9094). This Joint Committee action from the meeting of September 19, 
1985 was published in the Illinois Register , October 4, 1985 (9 III. Reg. 
15092). 

Recommendation : The Joint Committee suggested to the Department of Public 
Aid that it seek legislation amending the residency requirements contained in 
Section 2-10 of the Public Aid Code (III. Rev. Stat. 1983, ch. 23, par. 2-10) 
to conform to Federal residency requirements for Aid to the Aged, Blind and 
Disabled of 42 CFR 435.403(0 (ii)) . 

Agency Response: Pending. 

Joint Committee Response: Pending. 

Published as Adopted: October 25, 1985 (9 III. Reg. 16300), effective 
October 10. 1985. 



Medical Payment (Illinois Competitive Access and Reimbursement Equity 
[ICAREJ Program) (89 III. Adm. Code 140) 

Proposal Originally Published in Illinois Register , December 7, 1984 (8 III. 
Reg. 23576). This Joint Committee action at the meeting of April 16, 1985 
was published in the Illinois Register , May 3, 1985 (9 III. Reg. 6431). 



128 - 



Recommendation 1 : The Joint Committee suggested that the Department of 
Public Aid seek legislation amending the "Illinois Health Finance Reform Act" 
(Supp. to III. Rev. Stat. 1983 , ch. 1111, par. 6501 et seq.) to allow the 
Department to require hospitals to agree to enforcement of a pledge of 
confidentiality through the issuance of a preliminary or permanent injunction 
or other court order and to limit the forms of recordkeeping to hand written 
notes. 

Recommendation 2 : The Joint Committee suggested that the Department of 
Public Aid seek legislation amending the "Illinois Health Finance Reform Act" 
(Supp. to III. Rev. Stat. 1983, ch. 111£, par. 6501 et seq.) to allow the 
Department to enter into contracts under the ICARE program with hospitals 
located outside the boundaries of the State of Illinois. 

Agency Response: Agree. Response received by the Joint Committee June 5, 
1985. 

Joint Committee Response: July 25, 1985, no further action. 

Published as Adopted: May 3, 1985 (9 III. Reg. 6235), effective April 19, 
1985. 



Medical Payment (Developmental Services) (89 III. Adm. Code 140) 

Proposal Originally Published in the Illinois Register , March 29, 1985 (9 III. 
Reg. 3974). This Joint Committee action from the meeting of June 19, 1985 
was published in the Illinois Register , July 5, 1985 (9 III. Reg. 10328 and 
10331). 

Objection: The Joint Committee objected to Section 140.648 of the proposed 
rulemaking of the Department of Public Aid governing the provision of day 
program services to residents of group care facilities because this rule fails 
to state the policy of the Department regarding when it will reimburse 
facilities for provision of day program services during the change-over from 
the system of prospective reimbursement currently operated by the 
Department of Mental Health and Developmental Disabilities to the system of 
retrospective reimbursement authorized by this proposed rulemaking. 

Recommendation 1 : The Joint Committee suggested to the Department of 
Public Aid that it seek legislation specifically authorizing it to pay for day 
programming services provided to its mentally retarded clients who reside in 
long term care facilities as a separate component of long term care facility 
rates and authorizing it to require that long term care facilities pass this 
reimbursement on to the day program providers. 

Recommendation 2 : The Joint Committee suggested that the Department of 
Public Aid seek legislation clarifying its authority to impose a penalty on long 
term care facilities that do not pass through funds for day programming 
services within three days. 

Recommendation 3 : The Joint Committee suggested to the Department of 
"Public Aid that it seek legislation clarifying its authority to require 



129 



submission of cost reports from day program providers who contract with long 
term care facilities. 

Recommendation 4 : The Joint Committee suggested to the Department of 
Public Aid that it promulgate rules to detail the information required of day 
program providers when submitting the cost reports required by Section 
140.542 of its rules governing day program providers. 

Recommendation 5 : The Joint Committee suggested to the Department of 
Public Aid that it promulgate rules describing the bases on which the monthly 
rate for day programming services provided to developmentally disabled 
residents of long term care facilities may be appealed and the procedures for 
such an appeal. 

Recommendation 6 : The Joint Committee suggested to the Department of 
Public Aid that it promulgate rules to detail the manner in which day program 
providers may receive reimbursement for the provision of transportation to 
residents of group care facilities with whom they have contracted to provide 
day program services. 

Agency Response to Objection: Agreement to Modify, published July 19, 1985 
(9 III. Reg. 11419). Response received by the Joint Committee June 27, 1985. 

Agency Response to Recommendations: Failure to Respond. 

Joint Committee Response: Pending. 

Published as Adopted: July 19, 1985 (9 III. Reg. 11357), effective June 28, 
1985. 



Medical Payment (Reimbursing Support Costs of Nursing Homes) 89 III. Adm. 
Code 140.561) 

Proposal Originally Published in Illinois Register , July 12, 1985 (9 III. Reg. 
10619). This Joint Committee action at the meeting of November 14, 1985 was 
published in the Illinois Register , November 29, 1985 (9 III. Reg. 18589). 

Objection : The Joint Committee objected to the proposed amendment to 
Section 140.561 of the Department of Public Aid's rules governing 
reimbursement of support costs of nursing homes because the Department does 
not base the support cost rate of nursing home facilities on projected budgets 
submitted by nursing homes which is required by Section 5-5.4 of the Illinois 
Public Aid Code (III. Rev. Stat. 1984, ch. 23, par. 5-5.4). 

Agency Response: Pending. 

Joint Committee Response: Pending. 

Published as Adopted: Pending. 

Related Program Provisions (89 III. Adm. Code 117.10(b)(3)(B)) 



- 130 



Proposal Originally Published in the Illinois Register , February 15, 1985 (9 
ill. Reg. 2134). This Joint Committee action from the meeting of May 14, 
1985 was published in the Illinois Register , May 31, 1985 (9 III. Reg. 8231). 

Objection: The Joint Committee objected to the proposed amendment to 
Section 117.10(b)(3)(B) of the rules of the Department of Public Aid because, 
contrary to Section 2634 of the Deficit Reduction Act of 1984 and 45 C.F.R. 
234.60(a) (12) and (13), the Department proposes to make AFDC payments to 
sanctioned individuals without first making all reasonable efforts to locate an 
individual to serve as a protective payee. 

Agency Response: Refusal to Modify or Withdraw, published June 7, 1985 (9 
III. Reg. 8917). Response received by the Joint Committee May 24, 1985. 

Joint Committee Response: June 19, 1985, no further action. 

Published as Adopted: June 7, 1985 (9 III. Reg. 8733), effective May 29, 
1985. 



Related Program Provisions (Substitute Parental Care/Supplemental Child 
Carej ("89 III. Adm. Code 117.60) — — - — — - 

Proposal Originally Published in the Il linois Register , February 8, 1985 (9 III. 
Reg. 1669). This Joint Committee action from the meeting of May 14, 1985 
was published in the Illinois Register , May 31, 1985 (9 III. Reg. 8235). 

Recommendation: The Joint Committee suggested to the Department of Public 
Aid that it petition the Department of Children and Family Services to 
promulgate rules to place its maximum rates for day care, or its methodology 
for establishing such rates, in its rules prior to the Department of Public 
Aid's adoption of its amendments to Section 117.60. 

Agency Response: Disagree. Response received by the Joint Committee July 
1, 1S85. 

Joint Committee Response: July 25, 1985, no further action. 

Published as Adopted: July 12, 1965 (9 III. Reg. 10779), effective July 5, 
1985. 



DEPARTMENT OF PUBLIC HEALTH 

Asbestos Abatement for Private and Public Schools in Illinois (77 111. Adm. 
Code 855) ~" — 

Proposal Originally Published in Illinois Register , August 9, 1985 (9 111. Reg. 
12189). This Joint Committee action at the meeting of November 14, 1985 was 
published in the Illinois Register , November 29, 1985 (9 III. Reg. 18591). 

Recommendation : The Joint Committee requested that the Illinois Department 
of Public FTealth agree to submit to the Joint Committee the U.S. 
Environmental Protection Agency guidelines referenced in Sections 855.10, 

- 131 - 



855.120 and 855.23 of the Asbestos Abatement Act regulations for review and 
approval pursuant to the provisions of Section 6.02(b) of the Illinois 
Administrative Procedure Act (effective January 1, 1986) and that the Joint 
Committee review this submission using the standards for evaluation of Section 
6.02(b) incorporations detailed in proposed rules of the Joint Committee 
published in the October 25, 1985 Illinois Register at page 16146. As an 
element of this agreement, the Department would agree that if the Joint 
Committee determines that this material may not be validly incorporated 
pursuant to Section 6.02(b) of the IAPA, the Department will immediately 
initiate rulemaking deleting these incorporations. 

Agency Response: Pending. 

Joint Committee Response: Pending. 

Published as Adopted: December 6, 1985 (9 III. Reg. 19052), effective 
November 29, 1985. 

Asbestos Abatement for Private and Public Schools (77 III. Adm. Code 855) 

Proposal Originally Published in the Illinois Register , August 9, 1985 (9 III. 
Reg. 12189). This Joint Committee action from the meeting of December 11, 
1985 was published in the Illinois Register , December 27, 1985 (9 III. Req. 
20984). 

Recommendation 1 : The Joint Committee suggested to the Department of 
Public Health that within 30 days of December 9, 1985, the date upon which 
House Bill 1252 became law (P. A. 84-1096), it initiate rulemaking pursuant to 
Section 5.01 of the Illinois Administrative Procedure Act to amend its rules 
governing Asbestos Abatement for Private and Public Schools in Illinois to 
implement the changes in the Asbestos Abatement Act to be made by HB 1252, 
which passed both Houses of the General Assembly on October 30, 1985 and 
was sent to the Governor on November 13, 1985. 

Recommendation 2 : In addition, because P. A. 84-1096 significantly amends 
the Asbestos Abatement Act, the Joint Committee requested that the 
Department of Public Health provide the Joint Committee with a specific 
timetable for the adoption of rules implementing. P. A. 84-1096, including dates 
for initial proposal, public hearings, second notice submission to the Joint 
Committee, and final adoption. 

Agency Response to Recommendations: Pending. 

Joint Committee Response: Pending. 

Published as Adopted: Pending. 

Control of Communicable Diseases (77 III. Adm. Code 690.1100(b)(2)(D)) 

Proposal Originally Published in Illinois Register , December 7, 1984 (8 III. 
Reg. 23580). This Joint Committee action from the meeting of March 19, 1985 
was published in the Illinois Register , April 12, 1985 (9 III. Reg. 4925). 

- 132 - 



Objection : The Joint Committee objected to Section 690.1100(b) 12) (D) of the 
Department of Public Health's rules entitled "Control of Communicable 
Diseases" (77 III. Adm. Code 690.1100(b)(2)(D)) because the Department 
lacks the statutory authority to promulgate rules requiring certain individuals 
to report cases of venereal diseases in children under age 11 to the 
Department of Children and Family Services. 

Recommendation: The Joint Committee suggested to the Department of 
Children and Family Services that it amend its rules to clarify its disclosure 
and reporting policies in view of Public Act 83-1406. 

Agency Response to Objection: Agreement to Modify, published June 14, 1985 
(9 III. Reg. 9255). Response received by the Joint Committee June 17, 1985. 

Agency Response to Recommendation: Refusal to Modify or Withdraw. 
Response received by the Joint Committee June 17, 1985. 

Joint Committee Response: July 25, 1985, no further action. 

Published as Adopted: June 14, 1985 (9 III. Reg. 9124), effective June 3, 
1985. 



Hospice Pr ograms (77 III. Adm. Code 280.202(c) ,280.205, 280.303(g)) 

Proposal Originally Published in the Illinois Register , May 17, 1985 (9 III. 
Reg. 7104). This Joint Committee action from the meeting of September 19, 
1985 was published in the Illinois Register , October 4, 1985 (9 III. Reg. 
15094). 

Objection 1 : The Joint Committee objected to Section 280.202(c) of the 
Department of Public Health's rules entitled "Hospice Programs" because the 
Department lacks the statutory authority to issue a hospice license, based 
upon submission of a plan of correction by the hospice, to a hospice program 
which is not in compliance with the Hospice Program Licensing Act and the 
Department's rules governing hospice programs. 

Objection 2 : The Joint Committee objected to Section 280.205 of the 
Department of Public Health's rules entitled "Hospice Programs" because the 
Department lacks the statutory authority to require hospices to be subject at 
all times to inspection by the Department. 

Objection 3 : The Joint Committee objected to Section 280.303(g) of the 
Department of Public Health's rules entitled "Hospice Programs" because the 
Department lacks the statutory authority to delegate to hospices the authority 
to determine the number and qualifications of persons providing direct hospice 
services. 

R ecommendation : The Joint Committee suggested to the Department of Public 
Health that it seek legislation to amend the Hospice Program Licensing Act to 
explicitly grant the authority to issue a hospice license to a hospice program 
which is not in compliance with the Hospice Program Licensing Act and the 
Department's rules governing hospice programs. 



133 



Agency Response to Objection: Refusal to Modify or Withdraw, published 
October 11, 1965 (9 III. Reg. 15593). Response received by the Joint 
Committee October 1, 1985. 

Agency Response to Recommendation: Agree. Response received by the 
Joint Committee October 1, 1985. 

Joint Committee Response: November 14, 1985, recommendation to draft 
legislation. 

Published as Adopted: October 11, 1985 (9 III. Reg. 15521), effective 
October 3, 1985. 



REGISTRATION AND EDUCATION, DEPARTMENT OF 

Funeral Directors and Embalmers Act (68 111. Adm. Code 250) 

Proposal Originally Published in Illinois Register , May 11, 1984 (8 III. Reg. 
6646). This Joint Committee action from the meeting of February 21, 1985 
was published in the Illinois Register , March 15, 1985 (9 III. Reg. 3388). 

Recommendation : The Joint Committee suggested that the Department of 
Registration and Education seek legislation to amend the Funeral Directors and 
Embalmers Licensing Act of 1935 to grant it the specific authority to impose 
restrictions and prohibitions concerning the advertising and solicitation of 
funeral services to the extent that such restrictions and prohibitions are 
constitutional 

Agency Response: Failure to Respond. 

Joint Committee Response: July 25, 1985, no further action. 

Published as Aaopted: April 5, 1985 (9 III. Reg. 4529), effective March 27, 
1985. 



Illinois Architecture Act (68 III. Adm. Code 150.80(c)) 

Proposal Originally Published in Illinois Register , June 22, 1984 (8 III. Reg. 
8984). This Joint Committee action from the meeting of March 19, 1985 was 
published in the Illinois Register , April 12, 1985 (9 III. Reg. 4929). 

Objection : The Joint Committee objected to Section 150.80(c) of the rules of 
the Department of Registration and Education entitled "Illinois Architecture 
Act" because that provision violates Section 4.02 of the Illinois Administrative 
Procedure Act because it fails to set forth the standards used by the 
Department to determine the time within which it will issue a certificate or 
notify the applicant of denial of a certificate of registration. 

Agency Response: Agreement to Modify, published April 12, 1985 (9 III. 
Reg. 5388). Response received by the Joint Committee April 17, 1985. 

Joint Committee Response: May 15, 1985, no further action. 

- 134 - 



Published as Adopted: April 26, 1985 (9 III. Reg. 5691), effective April 16 
1985. 



Illinois Public Accounting Act (68 III. Adm. Code 420) 

Proposal Originally Published in the Illinois Register , February 15, 1985 (9 
III. Reg. 2196). This Joint Committee action from the meeting of July 25, 
1985 was published in the Illinois Register , August 9, 1985 (9 III. Reg. 
12428). 

Objection : The Joint Committee objected to Section 420.65(e) of the 
Department of Registration and Education's rules entitled "Public Accounting 
Act" because that section violates Section 4.02 of the Illinois Administrative 
Procedure Act in that it fails to set forth the standards used by the 
Department to determine v/hether to waive enforcement of a CPE requirement, 
as opposed to extending the time for compliance or establishing a particular 
program or schedule of continuing education. 

Agency Response: Refusal to Amend or Withdraw, published August 30, 1985. 
Response received by the Joint Committee August 22, 1985. 

Joint Committee Response: September 19, 1985, no further action. 

Published as Adopted: August 30, 1985 (9 III. Reg. 13360), effective August 
21 , 1985. 



Pharmacy Practice Act (68 III. Adm. Code 330) 

Proposal Originally Published in the Illinois Register , April 5, 1985 (9 III. 
Req. 4409). This Joint Committee action from the July 25, 1985 meeting was 
published in the Illinois Register, August 9, 1985 (9 III. Reg. 12422). 

Objection 1 : The Joint Committee objected to Sections 330.92 and 330.93 of 
The Department of Registration and Education's rules under the Pharmacy 
Practice Act, which prohibit of the transfer of prescriptions more than once 
between pharmacies for the purpose of refill dispensing, because the rule 
goes beyond legislative intent. 

Objection 2 : The Joint Committee objected to Section 330.91(c) of the rules 
oF the Department of Registration and Education because the Department does 
not have the statutory authority to require that a pharmacy licensed in more 
than one Division designate a different pharmacist-in-charge for each 
Division. 

Objection 3 : The Joint Committee objected to Section 330.20(a)(2) of the 
rules of the Department of Registration and Education entitled "Pharmacy 
Practice Act" because the Department lailed to provide the standards used to 
determine what constitutes a "sufficient number of full-time instructors" by 
the Department, in violation of Section 4.02 of the Illinois Administrative 
Procedure Act. 



135 



Agency Response: Refusal to Modify or Withdraw, published November 1, 
1985 (9 III. Reg. 17049). Response received by the Joint Committee October 
11 , 1985. 

Joint Committee Response: November 14, 1985, recommendation to draft 
legislation (Objections 1 and 2). 

Published as Adopted: November 1, 1985 (9 III. Reg. 16918), effective 
October 23. 1985. 



Professional Engineering Act (68 III. Adm. Code 380.210(a)(2)) 

Proposal Originally Published in Illinois Register , October 26, 1984 (8 III. 
Reg. 21174). This Joint Committee action from the meeting of April 16, 1985 
was published in the Illinois Register , May 3, 1985 (9 111. Reg. 6436). 

Objection : The Joint Committee objected to Section 380.210(a)(2) of the rules 
of the Department of Registration and Education entitled "Professional 
Engineering Act" because the Department failed to provide the standards used 
to determine what constitutes a "sufficient number of full-time instructors" by 
the Department, whether faculty members are from "reputable" colleges and 
what constitutes "sufficient time" for research and professional development 
for the faculty, in violation of Section 4.02 of the Illinois Administrative 
Procedure Act. 

Agency Response: Refusal to Modify or Withdraw, published June 28, 1985 (9 
III. Reg. 10040). Response received by the Joint Committee June 11, 1985. 

Joint Committee Response: July 25, 1985, no further action. 

Published as Adopted: June 28, 1985, (9 III. Reg. 10C4C), effective June IS, 
1985. 



Veterinary Medicine and Surgery Practice Act (68 III. Adm. Code 
500. 5(a)(1)(B), 500. 5(b)(1), 500.50(a), 500.50(a)(9), 500.50(a) (1 1 ) and 
500.50(a)(12)) 

Proposal Originally Published in the Illinois Register , March 15, 1985 (9 III. 
Reg. 3193). This Joint Committee action from the meeting of September 19, 
1985 was published in the Illinois Register , October 25," 1985 (9 III. Reg. 
16361). 

Objection 1 : The Joint Committee objected to Section 500.5(a)(1)(B) of the 
Department of Registration and Education's rules entitled "Veterinary Medicine 
and Surgery Practice Act" because it violates Section 4.02 of the Illinois 
Administrative Procedure Act in that it fails to set forth the standards used 
by the Department to determine what constitutes "reputable" professional 
colleges or institutions. 

Objection 2 : The Joint Committee objected to Sections 500.5(b)(1), 500.50(a), 
500.50(a)(9) , (11) and (12) of the Department of Registration and Education's 
rules entitled "Veterinary Medicine and Surgery Practice Act" because, 

- 136 - 



contrary to the requirements of Section 4.02 of the Illinois Administrative 
Procedure Act, the proposed rules fail to include the standards used in 
making discretionary determinations and the Department has failed to include 
relevant agency policy within the rules. 

Agency Response: Pending. 

Joint Committee Response: Pending. 

Published as Adopted: October 25, 1985 (9 III. Reg. 16327), effective 
October 10, 1985. 



REHABILITATION SERVICES, DEPARTMENT OF 

Vending Stand Program for the Blind (89 III. Adm. Code 650.1000 and 
650.70(a)(4)(A))" " ~~" 

Proposal Originally Published in Illinois Register , August 3, 1984 (8 III. Reg. 
13615). This Joint Committee action from the meeting of May 14, 1985 was 
published in the Illinois Register , May 31, 1985 (9 III. Reg. 8237). 

Objection 1 : The Joint Committee objected to Section 650.1000 of the rules of 
the Department of Rehabilitation Services entitled "Vending Stand Program for 
the Blind" because it over-regulates "self-employed" vending stand operators, 
and violates the legislative intent of Section 2 of "An Act in relation to the 
operation of vending facilities on public and private property by blind 
persons, and to repeal certain Acts herein named" (111. Rev. Stat. 1983, ch. 
23, par. 3331 et seq.). 

Objection 2 : The Joint Committee objected to Section 650.70(a)(4)(A) of the 
rules of the Department of Rehabilitation Services entitled "Vending Stand 
Program for the Blind (89 III. Adm. Code 650) because, contrary to Section 
4.02 of the Illinois Administrative Procedure Act, the rule does not include 
clear and precise standards to be used by the Department to determine 
whether a vendor will be suspended prior to an evidentiary hearing. 

Agency Response: Refusal to Modify or Withdraw, published August 9, 1985 
(9 ill. Reg. 12390). Response received by the Joint Committee August 1, 
1985. 

Joint Committee Response: August 28, 1985, no further action. 

Published as Adopted: August 9, 1985 (9 III. Reg. 12347), effective 
August 5, 1985. 

RETIREMENT SYSTEM OF THE STATE OF ILLINOIS, TEACHERS' 

Administration and Operation of the Teachers' Retirement System (80 III. 
Adm. Code 1650.450(a)(4), 1650.450(b)(5), 1650.250(a), 1650.230(b) and (c), 
1650.580) 

Proposal Originally Published in the Illinois Register , June 7, 1985 (9 III. 
Reg. 8543). This Joint Committee action from the meeting of September 19, 

- 137 - 



1985 was published in the Illinois Register , October 4, 1965 (9 III. Reg. 
15113). 

Objection 1 : The Joint Committee objected to Section 1650.450(a)(4) of the 
System's rulemaking because that provision violates Section 4.02 of the Illinois 
Administrative Procedure Act in that it fails to set forth the standards used 
to determine if fringe benefits are "recognized by the System." 

Objection 2 : The Joint Committee objected to Section 1650.450(b)(5) of the 
System's rulemaking because that provision violates Section 4.02 of the Act in 
that it fails to adequately set forth the criteria used by the System to 
determine the purpose of an employer's payment in lieu of fringe benefits. 

Objection 3 : The Joint Committee objected to Section 1650.250(a) because it 
violates Section 16-141 of the Pension Code by requiring that a designated 
dependent beneficiary receive an annuity where the designated non-dependent 
beneficiary disclaims a survivor's benefit. 

Objection 4 : The Joint Committee objected to Sections 1650.230(b) and (c) of 
the rules of the Teachers' Retirement System because, contrary to the 
requirements of Section 4.02 of the Illinois Administrative Procedure Act, the 
rules fail to articulate the standards used by the System in determining 
whether to require additional medical examinations and request hospital 
information and other data. 

Objection 5 : The Joint Committee objected to Section 1650.580 of the rules of 
the Teachers' Retirement System because, contrary to the requirements of 
Section 4.02 of the Illinois Administrative Procedure Act, the rule fails to set 
forth the standards used by the System in determining what evidence of 
eligibility will be determined satisfactory. 

Agency Response: Agreement to Modify (Objection 3), Refusal to Modify or 
Withdraw (Objections 1, 2, 4, and 5) published December 13, 1985 (9 III. 
Reg. 19419). Response received by the Joint Committee December 5, 1985. 

Joint Committee Response: Pending. 

Published as Adopted: Pending. 

Pr ocurement Rules (44 III. Adm. Code 1225) 

Proposal Originally Published in the Illinois Register , June 7, 1985 (9 III. 
Reg. 8570). This Joint Committee action from the meeting of September 19, 
1985 was published in the Illinois Register , October 4, 1985 (9 III. Reg. 
15111). 

Objection : The Joint Committee objected to the rulemaking of the Teachers' 
Retirement System of the State of Illinois entitled "Procurement Rules" 
because the System lacks statutory authority to file such rules without the 
approval of the Department of Central Management Services (DCMS) and such 
approval has been denied by DCMS. 



138 - 



Agency Response: Withdrawal, published December 13, 1985 (9 III. Reg. 
19422). Response received by the Joint Committee December 5, 1985. 

Joint Committee Response: Pending. 

REVENUE, DEPARTMENT OF 

Income Tax Regulations (86 III. Adm. Code 100) 

Proposal Originally Published in the Illinois Register , April 12, 1985 (9 III. 
Reg. 4754). This Joint Committee action from the meeting of September 19, 
1985 was published in the Illinois Register , October 4, 1985 (9 III. Reg. 
15106). 

Recommendation : The joint Committee suggested to the Department of 
Revenue that it seek legislation amending Section 2-203(c) of the Illinois 
Income Tax Act to specifically authorize the reduction of the add-back 
provision of 2-203(c) (2) (B) in an amount which the taxpayer would otherwise 
be entitled to take as a charitable deduction. 

Aaency Response : Agree. Response received by the Joint Committee October 
18~, 1985. 

Joint Committee Response: November 14, 1985, monitor legislation. 

Published as Adopted: November 1, 1985 (9 III. Reg. 16986), effective 
October 21, 1985. 



SCHOLARSHIP COMMISSION, STATE 

Correctional Officers' Survivor Grant Program (23 III. Adm. Code 1731) 

Proposal Originally Published in the Illinois Register , August 16, 1985 (9 III. 
Reg. 12594). This Joint Committee action from the meeting of December 11, 
1985 was published in the Illinois Register , December 27, 1985 (9 III. Reg. 
20987). 

Objection : The Joint Committee objected to Section 1731.20(c) of the rules of 
the Illinois State Scholarship Commission (ISSC) governing the Correctional 
Officer's Survivor Grant Program because the ISSC lacks the statutory 
authority to require that grant recipients maintain satisfactory academic 
progress. 

Recommendation : The Joint Committee suggested to the ISSC that if it 
believes that it should be able to require that grant recipients maintain 
satisfactory academic progress that it seek legislation amending the 
Correctional Officer's Survivor Grant Program to grant the ISSC such 
authority. 

Agency Response to Objection: Pending. 

Agency Response to Recommendation: Pending. 

- 139 - 



Published as Adopted: Pending. 



General Provisions (23 III. Adm. Code 1700) 

Date Originally Published in the Illinois Register :, August 16, 1985 (9 III. 
Reg. 12598). This Joint Committee action from the meeting of December 11, 
1985 was published in the Illinois Register , December 27, 1985 (9 III. Reg. 
20993). 

Objection : The Joint Committee objected to Section 1700.70 of the rules ot 
the Illinois State Scholarship Commission (ISSC) entitled "General Provisions" 
(23 III. Adm. Code 1700) because the rules are vague and, contrary to the 
requirements of the Illinois Administrative Procedure Act, fail to inform those 
affected of the procedures that will be used by the ISSC in hearing contested 
cases. 

Agency Response: Pending. 

Joint Committee Response: Pending. 

Published as Adopted: Pending. 

Limitation, Suspension or Termination Proceedings (23 III. Adm. Code 1790) 

Proposal Originally Published in the Illinois Register , August 16, 1985 (9 III. 
Reg. 12641). This Joint Committee action from the meeting of December 11, 
1985 was published in the Illinois Register , December 27, 1985 (9 III. Reg. 
20996). 

Objection : The Joint Committee objected to Section 1790.110(c) of the rules 
of the Illinois State Scholarship Commission (ISSC) entitled "Limitation, 
Suspension, or Termination Proceedings" (23 III. Adm. Code 1790) because, 
contrary to Section 4.02 of the Illinois Administrative Procedure Act, the rule 
does not include the standards to be used by the ISSC in determining 
whether to require a lender to proceed with collection efforts on all loans 
made prior to the effective date of a termination. 

Agency Response: Pending. 

Joint Committee Response: Pending. 

Published as Adopted: Pending. 

M erit Recognition Scholarship (MRS) Program (23 III. Adm. Code 
1761.30(b)(3), 1761.20, and 1761.30) 

Proposal Originally Published in Illinois Register , February 1, 1985 (9 III. 
Reg. 1308). This Joint Committee action from the meeting of May 14, 1985 
was published in the Illinois Register , May 31, 1985 (9 III. Reg. 8242). 



- 140 - 



Objection 1 The Joint Committee objected to Section 1761.30(b)(3) of the 
Illinois S~tate Scholarship Commission's rules for the Merit Recognition 
Scholarship Program because the Commission lacks the statutory authority to 
require that the initial merit scholarship be utilized in the academic year 
following high school graduation. 

Objection 2: The Joint Committee objected to Section 1761.20 of the rules of 
the Illinois State Scholarship Commission regarding the Merit Recognition 
Scholarship (MRS) Program (23 III. Adm. Code 1761) because the Commission 
lacks the statutory authority to require high schools to designate one 
graduation date per academic year. 

Recommendation 1 : The Joint Committee suggested that the Illinois State 
Scholarship Commission seek legislation to amend Section 30-1 5. 7b of the 
School Code (III. Rev. Stat. 1984 Supp., ch. 122, par. 30-15. 7b) to state 
explicitly the period of time during which Merit Recognition Scholarship funds 
must be used. 

Recommendation 2 : Because the Joint Committee believes that one graduation 
date per academic year should be designated, it suggested that the Illinois 
State Scholarship Commission seek legislation to amend Section 30-1 5. 7b of the 
School Code (III. Reg. Stat. 1983, ch. 122, par. 30-15. 7b to grant the 
Commission the authority to require high schools to designate one graduation 
date per academic year. 

Agency Response to Objections: Refusal to Modify or Withdraw, published 
July 5, 1985 (9 III. Reg. 10303). Response received by the Joint Committee 
June 27, 1985. 

Agency Response to Recommendations: Disagree. Response received by the 
Joint Committee June 27, 1985. 

Joint Committee Response: July 25, 1985, recommendation to draft legislation. 

Published as Adopted: July 5, 1985 (9 III. Reg. 10277), effective July 5, 
1985. 



SECRETARY OF STATE 

Certification of Title, Registration of Vehicles (92 III. Adm. Code 101) 

Proposal Originally Published in Illinois Register , September 27, 1985 (9 III. 
Reg. 14539). This Joint Committee action from the meeting of December 11, 
1985 was published in the Illinois Register , December 27. 1985 (9 III. Reg. 
20998). 

Recommendation : The Joint Committee recommended to the Secretary of State 
that he seek legislation to specifically allow him to require documentation to 
prove that an imported vehicle not manufactured in accordance with federal 
safety and emission standards has received final admittance by Customs before 
receiving title and registration. 

Agency Response: Pending. 

- 141 - 



Joint Committee Response: Pending. 
Published as Adopted: Pending. 

Certificates of Title, Registration of Vehicles (92 III. Adm. Code 1010) 

Proposal Originally Published in the Illinois Register , April 26, 1985 (9 III. 
Reg. 5575). This Joint Committee action from the meeting of July 25, 1985 
was published in the Illinois Register , August 9, 1985 (.9 III. Reg. 12431). 

Recommendation : The Joint Committee suggested to the Secretary of State 
that he seek legislation allowing a vehicle registration discount for the 
spouses, widows and widowers of claimants eligible under Section 3-806.3 of 
the "Illinois Vehicle Code." 

Agency Response: Agree. Response received by the Joint Committee October 
22, 1985. 

Joint Committee Response: November 14, 1985, recommendation to monitor 
agency legislation. 

Published as Adopted: August 16, 1985 (9 III. Reg. 12863), effective August 
2, 1985. 



Issuance of Licenses (92 III. Adm. Code 1030.55(a)) 

Proposal Originally Published in Illinois Register , June 22, 1984 (8 III. Reg. 
9044}. This Joint Committee action from the meeting of January 17, 1965 was 
published in the Illinois Register , February 1, 1985 (9 III. Reg. 1474). 

Objection : The Joint Committee objected to Section 1030.55(a) of the 
Secretary of State's rules entitled "Issuance of Licenses" because that 
provision violates Section 4.02 of the Illinois Administrative Procedure Act by 
failing to set forth the standards for successfully completing Class A and B 
license driving tests. 

Agency Response: Modification, published March 1, 1985 (9 III. Reg. 2720). 
Response received by the Joint Committee February 18, 1985. 

Joint Committee Response: March 19, 1985, recommendation to monitor 
rulemaking. 

Published as Adopted: March 1, 1985 (9 111. Reg. 2716), effective February 
20. 1985. 



Local Records Commission (44 III. Adm. Code 4000) 

Proposal Originally Published in the Illinois Register , July 12, 1S85 (9 111. 
Reg. 10635). This Joint Committee action from the meeting of September 19, 
1985 was published in the Illinois Register , October 4, 1985 (9 III. Reg. 
15109). 

- 142 - 



Recommendation : The Joint Committee suggested to the Local Records 
Commission that it promulgate as rules, in accordance with Section 5 of the 
Illinois Administrative Procedure Act, its retention schedules used in the 
granting of approval to destroy or dispose of records. 

Agency Response: Disagree. Response received by the Joint Committee 
received November 18, 1985. 

Joint Committee Response: Pending. 

Published as Adopted: Pending. 

Public Library C onstruction Grants (23 III. Adm. Code 3060) 

Proposal Originally Published in the Illinois Register , April 5, 1985 (9 111. 
Reg. 4464). This Joint Committee action from the meeting of August 28, 1985 
was published in the Illinois Register , September 13, 1985 (9 III. Reg. 
14091). 

Objection 1 : The Joint Committee objected to Section 3060.800(c) of the 
Secretary of State's (Illinois State Library) rules governing Public Library 
Construction Grants because the State Library lacks the statutory authority 
to require that grantee libraries place a plaque in the completed building 
stating that funds administered by the Secretary of State and State Librarian 
were used for the building's construction and to require that grantee libraries 
display a sign on the construction site stating that State funds administered 
by the Secretary of State and State Librarian are being used for the 
construction. 

Objection 2 : The Joint Committee objected to Section 3060.800(c) (23) of the 
rules of the Secretary of State governing "Public Library Construction 
Grants" (23 III. Adm. Code 3060) because, contrary to Section 4.02 of the 
Illinois Administrative Procedure Act, this section does not include the 
standards to be used by the Illinois State Library in approving the use of a 
library building for purposes other than as a library. 

Rec ommendation 1 : The Joint Committee suggested that the Secretary of State 
( Illinois State Library) promulgate rules to set forth the information which the 
State Librarian requires to be included in a library's quarterly narrative and 
financial reports related to construction grant policies. 

Recommendation 2 : The Joint Committee suggested to the Secretary of State 
(State Library) that prior to the adoption of its rules governing Public 
Library Construction Grants (23 III. Adm. Code 3060) it work with the Joint 
Committee to review and examine the policies of the American Institute of 
Architecture as they relate to construction contracts required by Section 
3060.800. 

Agency Response to Objection: Refusal to Modify or Withdraw, published 
October 4, 1985 (9 III. Reg. 15069). Response received by the Joint 
Committee October 4, 1985. 



- 143 



Agency Response to Recommendation: Agree. Response received by the 
Joint Committee October 18, 1985. 

Joint Committee Response: November 14, 1985, no further action (Objections 
1 and 2); Joint Committee monitor rulemaking (Recommendation 1); and agency 
submit form required by rules to Department of Central Management Services 
for review (Recommendation 2). 

Published as Adopted: October 4, 1985 (9 III. Reg. 15005), effective 
September 25, 1985. 

STATE POLICE, DEPARTMENT OF 

Intergovernmental Drug Enforcement Act (20 III. Adm. Code 1220.340(b)) 

Proposal Originally Published in the Illinois Register , April 29, 1985 (9 111. 
Reg. 5039). This Joint Committee action from the meeting of October 16, 1985 
was published in the Illinois Register , November 1, 1985 (9 III. Reg. 17081). 

Objection 1 : The Joint Committee objected to Section 1220.340(b) of the 
Department of State Police's rulemaking entitled "Intergovernmental Drug 
Enforcement Act" because the rulemaking violates Section 4.02 of the Illinois 
Administrative Procedure Act in that it fails to set forth the standards used 
by the Director to determine which applicant, or applicants, will be awarded 
the auditing contract. 

Objection 2 : The Joint Committee objected to Section 1220.340(b) of the 
rulemaking of the Department of State Police entitled "Intergovernmental Drug 
Enforcement Act" because the Department lacks statutory authority to file 
such a rule without the approval of the Department of Central Management 
Services (DCMS), as required in Section 5 of the Illinois Purchasing Act, and 
such approval has not been obtained from DCMS. 

Agency Response: Pending. 

Joint Committee Response: Pending. 

Published as Adopted: Pending. 

VETERANS' AFFAIRS, DEPARTMENT OF 

Vietnam Veterans' Act Program (95 III. Adm. Code 117.70(d)) 

Proposal Originally Published in Illinois Register , November 26, 1985 (8 III. 
Reg. 22837). This Joint Committee action from the meeting of March 19, 1985 
was published in the Illinois Register , April 12, 1985 (9 III. Reg. 4932). 

Objection : The Joint Committee objected to Section 117.70(d) of the rules of 
the Department of Veterans' Affairs because, by requiring directors ot 
multi-purpose service centers to submit quarterly reports of programmatic and 
financial activities the Department has exceeded its statutory authority under 
Section 6(d) of the Vietnam Veterans' Act. 



144 



Recommendation : The Joint Committee suggested that the Department of 
Veterans' Affairs, in conjunction with the staff of the Joint Committee on 
Administrative Rules, develop legislation amending the Vietnam Veterans' Act 
(111. Rev. Stat. 1983, ch. 126*, par. 201 et seq.) to grant the explicit 
statutory to require quarterly reports of programmatic and financial activities 
from multi-purpose service centers. 

Agency Response to Objection: Agreement to Modify, published May 10, 1985 
(9 III. Reg. 6883). Response received by the Joint Committee May 14, 1985. 

Agency Response to Recommendation: Agree. Response received by the 
Joint Committee May 14, 1985. 

Joint Committee Response: June 19, 1985, no further action. 

Published as Adopted: July 26, 1985 (9 III. Reg. 11665), effective July 31, 
1985. 



145 - 



146 



1985 OBJECTIONS AND RECOMMENDATIONS TO EMERGENCY RULEMAKING 

CAPITAL DEVELOPMENT BOARD 

Prequalification and Suspension of Contractors (44 II!. Adm. Code 950.280) 

Emergency Rule Originally Published in Illinois Register , March 22, 1985 (9 
III. Reg. 3821), effective March 5, 1985 for a maximum of 150 days. This 
Joint Committee action from the meeting of April 16, 1985 was published in the 
Illinois Register , May 3. 1985 (9 III. Reg. 6393) 

Objection to Emergency Rulemaking : The Joint Committee objected to the 
emergency amendment to Section 950.280 of the "Prequalification and 
Suspension of Contractors" rules of the Capital Development Board because, 
contrary to the requirements of Section 5.02 of the Illinois Administrative 
Procedure Act, the emergency situation requiring rulemaking was 
agency-created. 

Agency Response: Failure to Respond. 

Joint Committee Response: August 28, 1985, no further action. 

CENTRAL MANAGEMENT SERVICES, DEPARTMENT OF 

Pay Plan (80 III. Adm. Code 310.230, 310.290, 310. Appendix A, Table G and 



& 



Table P) 

Emergency Rule Originally Published in Illinois Register , October 4, 1985 (9 
III. Reg. 15C43), effective September 24, 1985 for a maximum of 150 days. 
This Joint Committee action from the meeting of November 14, 1985 was 
published in the Illinois Register , November 29, 1985 (9 III. Reg. 18595). 

Objection to Emergency Rulemaking : The Joint Committee objected to the 
Department's emergency amendments to Sections 310.230, 310.290, 310. 
Appendix A Table G and 310. Appendix A Table P because there was no 
emergency which justified the use of emergency rulemaking under Section 5.02 
of the Illinois Procedure Act. 

Agency Response: Pending. 

Joint Committee Response: Pending. 

COMMUNITY COLLEGE BOARD, ILLINOIS 

Administration of the Illinois Public Community College Act (23 III. Adm. Code 
1501 .501 , 1501.503) 

Emergency Rule Published in Illinois Register , November 16, 1984 (8 III. Reg. 
22603), effective November 7, 1984, for a maximum of 150 days. This action 
from the Joint Committee meeting of January 17, 1985, was published in the 
Illinois Register , February 1, 1985 (9 ill. Reg. 1467). 

- 147 - 



Objecti on to Emergency Rulemaking : The Joint Committee objected to Sections 
1501.501 and 150.503 of the emergency rulemaking amending the rules of the 
Illinois Community College Board because, contrary to the provisions of 
Section 5.02 of the Illinois Administrative Procedure Act, the Board has 
included in those sections amendments for which no emergency exists. 

Agency Response: Failure to Respond. 

Joint Committee Response: April 16, 1985, no further action. 

CONSERVATION, DEPARTMENT OF 

Duck, Goose and Coot Hunting Regulations (17 III. Adm. Code 590) 

Emergency Rule Originally Published in Illinois Register , October 18, 1985 (9 
III. Reg. 15928), effective October 8, 1985 for a maximum of 150 days. This 
Joint Committee action from the meeting of November 14, 1985 was published 
in the Illinois Register , November 29, 1985 (9 III. Reg. 18597). 

Objection to Emergency Rulemaking : The Joint Committee objected to the 
Department of Conservation's October 7, 1985 emergency amendment to 17 III. 
Adm. Code 590.60, "Duck, Goose and Coot Hunting Regulations" because no 
emergency situation exists which requires the use of the emergency 
rulemaking procedure of Section 5.02 of the Illinois Administrative Procedure 
Act. 

Agency Response: Pending. 

Joint Committee Response: Pending. 

EDUCATION, STATE BOARD OF 

Dismissal of Tenured Teachers and Civil Service Employees Under Article 34 
(23 III. Adm. Code 52.35(a)(4)) 

Emergency Rule Originally Published in Illinois Register August 23, 1985 (9 
III. Reg. 13123), effective August 9, 1985 for a maximum of 150 days. This 
Joint Committee action from the meeting of November 14, 1985 was published 
in the Illinois Register , November 29, 1985 (9 III. Reg. 18600). 

Objection 1 to Emergency Rulemaking : The Joint Committee objected to 
Section 52 .35(d) (4) of the Board's emergency rulemaking because the rule 
conflicts with Section 34-85 of the School Code (III. Rev. Stat. 1983, ch. 122, 
par. 34-85, as amended by P. A. 84-126, effective August 1, 1985). 

Objection 2 to Emergency Rulemaking: The Joint Committee objected to 

Section 52.35(d)(4) of the Board's emergency rulemaking because this section 
implements policies which are not required by the emergency situation in 
violation of Section 5.02 of the Illinois Administrative Procedure Act. 

Agency Response: Pending. 



148 



Joint Committee Response: Pending. 

ELECTIONS, STATE BOARD OF 

Established Political Party and Independent Candidate Nominating Petitions (26 
III. Adm. Code 201) 

Emergency Rule Published in Illinois Register , December 14, 1984 (8 III. Reg. 
24311) effective November 29, 1984, for a maximum of 150 days. This Joint 
Committee action at the meeting of February 27, 1985 was published in the 
Illinois Register , March 15, 1985 (9 III. Reg. 3366). 

Objection 1 to Emergency Rulemaking : The Joint Committee objected to 
Section 210.50(b) of the emergency rulemaking of the Illinois State Board of 
Elections entitled "Established Political Party and Independent Candidate 
Nominating Petitions" (26 III. Adm. Code 201.50(b)) because the rule conflicts 
with Section 7-1 0(k) of the Election Code regarding the number of signatures 
needed for nominating petitions for wards or districts of political 
subdivisions. 

Objection 2 to Fmergency Rulemaking : The Joint Committee objected to 
Section 201.50(c) of the emergency rulemaking of the Illinois State Board of 
Elections entitled "Established Political Party and Independent Candidate 
Nominating Petitions" (26 III. Adm. Code 201.50(c) because no emergency 
exists which requires use of the emergency rulemaking procedures of Section 
5.02 of the Illinois Administrative Procedure Act. 

Recommendation to Emergency Rulemaking : The Joint Committee suggested 
that the State Board of Elections seek legislation to amend the Election Code 
to authorize the imposition of a signature requirement for wards or districts 
of political subdivisions which differ from the requirement stated in Section 
7-1 0(k) of the Election Code. 

Agency Response: Failure to Respond. 

Joint Committee Response: July 25, 1985, no further action. 

ENVIRONMENTAL PROTECTION AGENCY 

Procedures for Collection of Permit and Inspection Fees (35 III. Adm. Code 
856.204(a)) " 

Emergency Rule Published in Illinois Register , January 11, 1985 (9 III. Adm. 
Code 399), effective January 1, 1985 for a maximum of 150 days. This Joint 
Committee action from the meeting of March 19, 1985 was published in the 
Illinois Register , April 12, 1985 (9 III. Reg. 4899). 

Objection to Emergency Rulemaking : The Joint Committee objected to Section 
856.204(a) 57 tKe Environmental Protection Agency's December 28, 1984 
emergency rulemaking entitled "Procedures for Collection of Permit and 
Inspection Fees" (35 III. Adm. Code 856) because the Agency lacks the 



149 



statutory authority to require inspection and permit fees to be paid 
subsequent to the quarter for which the fees are applicable. 

Agency Response: Failure to Respond. 

Joint Committee Response: July 25, 1985, no further action. 

FARM DEVELOPMENT AUTHORITY, ILLINOIS 

Rules of the Illinois Farm Development Authority (8 III. Adm. Code 1400) 

Emergency Rule Published in the Illinois Register , May 31, 1985 (9 III. Reg. 
8186), effective May 16, 1985 for a maximum of 150 days. This Joint 
Committee action from the meeting of July 25, 1985 was published in the 
Illinois Register , August 9, 1985 (9 III. Reg. 12411). 

Recommendation to Emergency Rulemaking : The Joint Committee suggested to 
the Illinois Farm Development Authority that it seek legislation to amend the 
Emergency Farm Credit Allocation Act to clarify the manner in which the 
Authority may require a recipient of a payment adjustment, pursuant to the 
Operating Interest Adjustment Loan Program, to secure the payment 
adjustment. 

Agency Response: Agree. Response received by the Joint Committee August 
9, 1985. 

Joint Committee Response: December 11, 1985, no further action. 

FINANCIAL INSTITUTIONS, DEPARTMENT OF 

Illinois Credit Union Act (38 III. Adm. Code 190.5) 

Emergency Rule Originally Published in Illinois Register, September 20, 1985 
(9 111. Reg. 14378), effective September 11, 1985 for a maximum of 150 days. 
This Joint Committee action from the meeting of November 14, 1985 was 
published in the Illinois Register , November 29, 1985 (9 III. Reg. 18608). 

Objection 1 to Emergency Rulemaking : The Joint Committee objected to 
Section 190.5 o7 the Department's emergency rulemaking regarding Illinois 
Credit Unions because no threat to the public interest, safety or welfare 
exists to require the use of emergency rulemaking under Section 5.02 of the 
Illinois Administrative Procedure Act. 

Objection 2 to Emergency Rulemaking : The Joint Committee objected to 
Section 190.5 of the Department's emergency rulemaking regarding Illinois 
Credit Unions because the Department lacks the statutory authority under the 
Illinois Credit Union Act (III. Rev. Stat. 1983, ch. 17, par. 4401 et seq.) to 
require a credit union to obtain approval from the Department prior to loaning 
to, investing in, or participating in credit union service organizations. 

Agency Response: Pending. 



- 150 



Joint Committee Response: Pending. 

FIRE MARSHAL, OFFICE OF THE STATE 

Storage Transportation, Sale and Use of Gasoline and Volatile Oils; Gasoline 
and Volatile Oils - General Rules (11 III. Adm. Code 180.20) 

Emergency Rule Published in Illinois Register , December 21, 1984 (8 III. Reg. 
24744) effective December 7, 1984, for a maximum of 150 days. This Joint 
Committee action from the meeting of February 27, 1985 was published in the 
Illinois Register , March 15, 1985 (9 III. Reg. 3369). 

Objection to Emergency Rulemaking : The Joint Committee objected to Section 
180.20 of this emergency rule of the Office of the State Fire Marshal because 
the rule fails to meet the requirements of Section 5.02 of the Illinois 
Administrative Procedure Act in that the rule contains provisions not required 
to meet the emergency. 

Agency Response: Failure to Respond. 

Joint Committee Response: July 25, 1985, no further action. 



LABOR, DEPARTMENT OF 

Carnival and Amusement Ride Inspection Law (56 111. Adm. Code 1 600) 

Emergency Rule Published in the Illinois Register , May 15, 1985 (9 III. Reg. 
7176), effective May 3, 1985 for a maximum of 150 days. This Joint 
Committee action from the meeting of July 25, 1985 was published in the 
Illinois Register , August 9, 1985 (9 ill. Reg. 12438). 

Recommendation 1 to Emergency Rulemaking : The Joint Committee suggested 
to the Department of Labor that it seek legislation granting it the authority to 
regulate the operation of water slides. 

Recommendation 2 to Emergency Rulemaking : The Joint Committee suggested 
to the Department of Labor that it seek legislation granting it the authority to 
regulate "Dry Type Slides." 

Agency Response: Agree. Response received by the Joint Committee October 
n, 1985. 

Joint Committee Response: November 14, 1985, Joint Committee moniter 
legislation. 

LABOR RELATIONS BOARD, ILLINOIS EDUCATIONAL 

Fair Share Fee Objections (80 III. Adm. Code 1125) 

Emergency Rule Originally Published in Illinois Register , August 23, 1985 (9 
III. Reg. 12873), effective August 8, 1985 for a maximum of 150 days. This 

- 151 - 



Joint Committee action from the meeting of November 14, 1985 was published 
in the Illinois Register , November 29, 1985 (9 111. Reg. 18604). 

Objection to Emergency Rulemaking : The Joint Committee objected to the 
Board's emergency rulemaking entitled "Fair Share Fee Objections" (80 III. 
Adm. Code 1125) because any emergency situation which may exist has been 
created solely by the failure of the Board to act in a timely fashion. 

Agency Response: Pending. 

Joint Committee Response: Pending. 

PUBLIC AID, DEPARTMENT OF 

Medical Payment (AFDC-MANG; GA and Functions and Duties of liospital 
Services Procurement Advisory Board) (89 111. Adm. Code 140) 

Emergency Rule Published in Illinois Register , January 11, 1985 (9 III. Reg. 
407) effective January 1, 1985, for a maximum of 150 days. This Joint 
Committee action from the meeting of March 19, 1985 was published in the 
Illinois Register , April 12, 1985 (9 III. Reg. 4923). 

Recommendation to Emergency Rulemaking : The Joint Committee suggested to 
the Department Public Aid that Ft seek legislation amending the "Open 
Meetings Act" (III. Rev. Stat. 1984 Supp., ch. 102, par. 42(b)) to clarify 
the additional situations under which the Health Services Procurement 
Advisory Board may conduct closed sessions. 

Agency Response: Agree. Response received by the Joint Committee May 
24, 1985. 

Joint Committee Response: June 19, 1985, no further action. 

Medical Assistance Programs (Income Standards) (89 III. Adm. Code 120.30) 

Emergency Rule Published in Illinois Register , January 18, 1985 (9 III. Reg. 
830) effective January 3, 1985, for a maximum of 150 days. This Joint 
Committee action from the meeting of March 19, 1985 was published in the 
Illinois Register , April 12, 1985 (9 III. Reg. 4918). 

Objection to Emergency Rulemaking : The Joint Committee objected to the 
emergency amendment of Section 120.30 of the Medical Assistance Programs 
rules of the Department of Public Aid because, contrary to the requirement of 
Section 5.02 of the Illinois Administrative Procedure Act, the amendment was 
not necessitated by a threat to the public interest, safety or welfare. 

Agency Response: Agreement to Modify, published May 17, 1985 (9 111. Reg. 
7231). Response received by the Joint Committee May 1, 1985. 

Joint Committee Response: June 19, 1985, no further action. 



152 



Medical Payment (Methodology for Reimbursing Support Costs of Nursing 
Homes) (89 111. Adm. Code 140.561) 

Emergency Rule Published in the Illinois Register , July 19, 1985 (9 III. Reg. 
11403), effective June 27, 1985. This Joint Committee action from the meeting 
of August 28, 1985 was published in the Illinois Register , September 13, 1985 
(9 III. Reg. 14105). 

Objection to Emergency Rulemaking : The Joint Committee objected to the 
emergency rulemaking of the Department of Public Aid which amends Section 
140.561 concerning the computation of reimbursement for support costs of long 
term care facilities because, contrary to the requirements of section 5.02 of 
the Illinois Administrative Procedure Act, any emergency which may exist has 
been created solely by the failure of the Department of Public Aid to 
promulgate rules in a timely fashion. 

Agency Response: Refusal to Modify or Withdraw. Response received by the 
Joint Committee October 31, 1985. 

Joint Committee Response: December 11, 1985, no further action. 

SECRETARY OF STATE 

Public Library Construction Grants (23 III. Adm. Code 3060) 

Emergency Rule Published as adopted in the Illinois Register , April 5, 1985 
(9 III. Reg. 4560), effective March 20, 1985 for a maximum of 150 days. This 
Joint Committee action from the meeting of June 19, 1985 was published in the 
Illinois Register , June 19, 1985 (9 III. Reg. 10349). 

Objection 1 to Emergency Rulemaking The Joint Committee objected to the 
Secretary of State's emergency rulemaking entitled "Public Library 
Construction Grants" because any emergency that may exist has been created 
solely by the Secretary's failure to proceed in a timely fashion in amending 
its rules. 

Objection 2 to Emergency Rulemaking The Joint Committee objected to the 
Secretary of State's emergency rulemaking because portions of the rulemaking 
are not related to the existence of the purported emergency. 

Agency Response: Refusal. Response received by the Joint Committee 
September 18, 1985. 

Joint Committee Response: October 16, 1985, no further action. 

Repeal - Public Library Construction Grants (23 III. Adm. Code 3060) 

Emergency Rule Published as adopted in Illinois Register , April 5, 1985 (9 
III. Reg. 4548), effective March 20, 1985 for a maximum of 150 days. This 
Joint Committee action from the meeting of June 19, 1985 was published in the 
Illinois Register , July 5, 1S65 (9 III. Reg. 10346). 



153 



Objection 1 to Emergency Rulemaking : The Joint Committee objected to the 
Secretary o7 State's emergency repeal of the Secretary's rules governing 
Public Library Construction Grants because any emergency that may exist has 
been created solely by the Secretary's failure to proceed in a timely fashion 
in amending its rules. 

Objection 2 to Emergency Rulemaking : The Joint Committee objected to the 
Secretary of State's emergency rulemaking because portions of the rulemaking 
are not related to the existence of the purported emergency. 

Agency Response: Refusal. Response received by the Joint Committee 
September 18, 1985. 

Joint Committee Response: October 16, 1985, no further action. 

Rulemaking (1 III. Adm. Code 100.335(a)(1)) 

Emergency Rule Published in Illinois Register , January 11, 1985 (9 III. Reg. 
427) effective January 1, 1985, for a maximum of 150 days. This Joint 
Committee action from the meeting of February 27, 1985 was published in the 
Illinois Register , March 15, 1985 (9 III. Reg. 3391). 

Objection to Emergency Rulemaking : The Joint Committee objected to Section 
100.335(a)(1) of the rules of the Secretary of State entitled "Rulemaking" (1 
111. Adm. Code 100) because the Secretary of State lacks the statutory 
authority to include a requirement that a repeal date cannot be more than two 
(2) years after the effective date of the rulemaking in which the automatic 
repeal date was incorporated into the rule. 

Agency Response: Failure to Respond. 

Joint Committee Response: July 25, 1985, no further action. 

TREASURER 

Di sbursement of Funds — Special Handling (74 111. Adm. Code 710) 

Emergency Rule Published in the Illinois Register , April 19, 1985 (9 III. 
Reg. 5384), effective April 5, 1985 for a maximum of 150 days. This Joint 
Committee action from the meeting of June 19, 1985 was published in the 
Illinois Register , July 5, 1985 (9 III. Reg. 10352). 

Objection to Emergency Rulemaking: The Joint Committee objected to the 
State Treasurer's April 5, 1985 emergency rulemaking entitled "Disbursement 
of Funds — Special Handling" (74 III. Adm. Code 710) because no emergency 
situation exists which requires use of the emergency rulemaking procedures of 
Section 5.02 of the Illinois Administrative Procedure Act. 

Agency Response: Refusal. Response received by the Joint Committee June 
27, 1985. 

Joint Committee Response: August 28, 1985, no further action. 

- 154 - 



155 



156 



1985 OBJECTIONS AND RECOMMENDATIONS TO PEREMPTORY RULEMAKING 

EMPLOYMENT SECURITY, DEPARTMENT OF 

Supplemental Federal Benefits (56 III. Adm. Code 2875.40(a) and 2875.40(b)) 

Peremptory Rule Published in the Illinois Register , April 26, 1985 (9 111. 
Reg. 5749), effective April 15, 1985T This Joint Committee action from the 
meeting of August 28, 1985 was published in the Illinois Register , September 
13, 1985 (9 III. Reg. 14099). 

Objection 1 to Peremptory Rulemaking : The Joint Committee objected to the 
peremptory rule amending Section 2875.40(a) of the Department of Employment 
Security's rule entitled Supplemental Federal Benefits (56 III. Adm. Code 
2875) because the Department's use of the peremptory rulemaking procedure 
was not required as a result of federal law or federal rules and regulations 
and, thus, violated Section 5.03 of the Illinois Administrative Procedure Act. 

Objection 2 to Peremptory Rulemaking : The Joint Committee objected to the 
peremptory rule amending Section 2875.40(b) of the Department of Employment 
Security's rule entitled "Supplemental Federal Benefits" (56 III. Adm. Code 
2875) because notice of the rulemaking was not filed within 30 days after a 
change in the rule was required as a result of federal law, and because 
conditions did not preclude discretion by the agency as to the content of the 
rule it was required to adopt, in violation of Section 5.03 of the Illinois 
Administrative Procedure Act. 

Agency Response: Refusal to Modify or Withdraw. Response received by the 
Joint Committee November 22, 1985. 

Joint Committee Response: Pending. 



157 



158 



1985 OBJECTIONS AND RECOMMENDATIONS ISSUED PURSUANT 
TO THE HIVE YEAR REVIEW 



ALL STATE AGENCIES 

Rulemaking for Freedom of Information Rules - Recommendation 

The basis for this review is the RECORDS AND INFORMATION MANAGEMENT 
Five Year Report which was discussed at the Joint Committee meeting of 
January 17, 1985. This action was published in the Illinois Register , 
February 8, 1985 (9 III. Reg. 1936). 

Recommendation 1 : At its meeting on January 17, 1985, the Joint Committee 
recommended that all agencies subject to the Illinois Administrative Procedure 
Act adopt the model Section 4.01 rules developed by the Office of the 
Governor to implement the Illinois Freedom of Information Act. 

Recommendation 2 : The Joint Committee further recommended that all 
agencies subject to the Illinois Administrative Procedure Act undertake 
rulemaking pursuant to Section 5.01 of the IAPA to fully implement all 
requirements of the Illinois Freedom of Information Act not covered by the 
Model Section 4.01 rules. 



CENTRAL MANAGEMENT SERVICES. DEPARTMENT OF 

The basis for this review is the RECORDS AND INFORMATION MANAGEMENT 
Five Year Review Report which was discussed at the Joint Committee meeting 
of January 17, 1985. 

Recommendation : The Joint Committee suggested that the Department of 
Central Management Services undertake an examination of the "State of Illinois 
Forms Management Manual" for the purpose of determining whether this 
manual contains any polices and procedures which should be promulgated as 
rules pursuant to the requirements of Section 5.02 of the Illinois 
Administrative Procedure Act. 

Agency Response: Disagree. 

CHILDREN AND FAMILY SERVICES, DEPARTMENT OF 

The basis for this review is the RECORDS AND INFORMATION MANAGEMENT 
Five Year Review Report which was discussed at the Joint Committee meeting 
of January 17, 1985. 

Objection 1 : The Joint Committee objected to Section 430.9 of the "Public 
Information" rules of the Department of Children and Family Services because 
it fails to delineate the standards and criteria used by the Director in 
evaluating an appeal of a decision of non-disclosure. 

Objection 2 : The Joint Committee objected to Section 430.10 of the 
Department of Children and Family Services' "Public Information" rules 

- 159 - 



because the term "reasonable fees" is vague and does not adequately inform 
the affected public of the charges being imposed by the Department for 
retrieving, assembly, copying, and presenting requested information. 

Agency Response: Agreement to modify. 

Published as Adopted: September 21, 1984 (8 III. Reg. 17275). 

CONSERVATION, DEPARTMENT OF 

The basis for this review is the RECORDS AND INFORMATION MANAGEMENT 
Five Year Review Report which was discussed at the Joint Committee meeting 
of January 17, 1985. 

Objection : The Joint Committee objected to the rules of the Department of 
Conservation on "Access to Archaeological Files" because the Department lacks 
the statutory authority to restrict access to archaeological data. 

Recommendation : The Joint Committee suggested that the Department of 
Conservation seek legislation modifying the Illinois Historic Preservation Act 
to specifically grant the Department the authority to restrict access to 
archaeological data. 

Agency Response: The Department disagreed, but repealed these rules 
December 14, 1984 (8 III. Reg. 24116). 



CRIMINAL JUSTICE INFORMATION AUTHORITY, ILLINOIS 
LAV/ ENFORCEMENT, DEPARTMENT OF 

The basis for this review is the RECORDS AND INFORMATION MANAGEMENT 
Five Year Review Report which was discussed at the Joint Committee meeting 
of January 17, 1985. 

Recommendation : The Joint Committee suggested to the Illinois Criminal 
Justice Information Authority and the Department of Law Enforcement that 
they meet and decide upon one time limit for the filing of appeals and that 
time limitation be placed on the rules of each agency. 

Agency Response: Agree. 

Published as Adopted: Department of Law Enforcement, March 8, 1985 (9 III. 
Reg. 2945). 

LOCAL RECORDS COMMISSION OF COOK COUNTY 

The basis for this review is the RECORDS AND INFORMATION MANAGEMENT 
Five Year Review Report which was discussed at the Joint Committee meeting 
of January 17 # 1985. This action was published in the Illinois Register , 
February 8. 1985 (9 III. Reg. 1924). 



160 



Recommendation to Commence Rulemaking : The Joint Committee voted to 
inform the Local Records Commission of Cook County that it is required to 
promulgate rules pursuant to the Illinois Administrative Procedure Act. 

Agency Response: Failure to Respond. 

SECRETARY OF STATE 

Local Records Commission (44 III. Adm. Code 4000.60(b), 4000.60(c)) 

The basis for this review is the RECORDS AND MANAGEMENT Five Year 
Review Report which was discussed at the Joint Committee meeting of January 
17, 1985. This action was published in the Illinois Register , February 8, 
1985 (9 III. Reg. 1942). 

Objection 1 : The Joint Committee objected to Section 4000.60(b) of the rules 
of the Eocal Records Commission because this Section incorporates by 
reference the specifications of the American National Standards Institute in 
contravention of the requirements of Section 6.02 of the Illinois Administrative 
Procedure Act. 

Objection 2 : The Joint Committee objected to Section 4000.60(c) of the rules 
of the Local Records Commission because this section does not incorporate by 
reference the standards of the American National Standards Institute in the 
form required by Section 6.02 of the Illinois Administrative Procedure Act. 

Agency Response: Agreement to modify. 

Published as Adopted: Amendment proposed July 12, 1985 (9 III. Reg. 
10635), but not yet adopted. 

State Records Commission (14 III. Adm. Code 4100.10(f), 4100.60(b), and 
41 00 .60(c)) 

The basis for this review is the RECORDS AND INFORMATION MANAGEMENT 
Five Year Review Report which was discussed at the Joint Committee meeting 
of January 17, 1985. This action was published in the Illinois Register , 
February 8, 1985 (9 III. Reg. 1946). 

Objection 1 : The Joint Committee objected to Section 4100.10(f) of the 
Regulations of the State Records Commission because the Section is vague and 
fails to set forth the standards used by the Commission in determining 
whether to review, modify or revoke an approved records disposal schedule, 
as required by Section 4.02 of the Illinois Administrative Procedure Act. 

Objection 2 : The Joint Committee objected to Section 4100.60(b) of the rules 
of the STate Records Commission because this section incorporates by 
reference the American National Standards Institute film standards in 
contravention of the requirements of Section 6.02 of the Illinois Administrative 
Procedure Act. 



161 



Objection 3 : The Joint Committee objected to Section 4100.60(c) of the rules 
of the STate Records Commission because this section incorporates by 
reference certain material in contravention of the "specified date" 
requirements of Section 6.02 of the Illinois Administrative Procedure Act. 

Agency Response: Agreement to modify. 

Published as Adopted: Amendment proposed July 26, 1965 (9 III. Reg. 
11578), but not yet adopted. 



- 162 - 



163 - 



164 



1985 OBJECTIONS AND RECOMMENDATIONS TO EXISTING RULES 



COMMERCE COMMISSION, ILLINOIS 

Pol e Attachment Agreements Between CATV Companies and Public Utilities (83 
TUT Adm. Code 315.20) ' 

Proposal Originally Published in Illinois Register , February 24, 1984 (8 III. 
Reg. 2328). This Joint Committee action from the meeting of March 19, 1985 
was published in the Illinois Register , April 12, 1985 (9 III. Reg. 4885). 
Rules published as adopted February 22, 1985 (9 III. Reg. 2471), effective 
February 13, 1985. 

Objection to Existing Rule : The Joint Committee objected to Section 315.20 of 
the existing rule of the Illinois Commerce Commission entitled "Pole Attachment 
Agreements Between CATV Companies and Public Utilities" because the rule 
was substantively changed after the commencement of the second notice 
period, in violation of Section 5.01(b) of the Illinois Administrative Procedure 
Act. 

Agency Response: Refusal to Modify or Withdraw, not published. Response 
received by the Joint Committee May 28, 1985. 

Joint Committee Response: July 25, 1985, no further action. 

Rules of Practice (83 III. Adm. Code 200.90 and 200.580(d)) 

Proposal Originally Published in Illinois Register , April 13, 1984 (8 III. Reg. 
4728). This Joint Committee action at the meeting of April 16, 1985 was 
published in the Illinois Register , May 3, 1985 (9 III. Reg. 6438). Rules 
published as adopted April 26, 1985 (9 III. Reg. 5621), effective April 15, 
1985. 

Objection 1 to Existing Rules : The Joint Committee objected to Section 200.90 
of the rules of the Illinois Commerce Commission entitled "Rules of Practice" 
(83 III. Adm Code 200) because that rule permits the unauthorized practice ot 
law, in violation of "An Act to revise the laws in relation to attorneys and 
counselors." (III. Rev. Stat. 1983, ch. 13, par. 1). 

O bjection 2 to Existing Rules : The Joint Committee objected to Section 200.90 
of" the rules of the Illinois Commerce Commission entitled "Rules of Practice" 
(89 III. Adm. Code 200.90) because that rule fails to provide the standards 
used by the Commission to determine whether or not to allow attorneys 
admitted to practice in states other than Illinois to appear and practice before 
the Commission, in violation of Section 4.02 of the Illinois Administrative 
Procedure Act. 

Objection 3 to Existing Rules : The Joint Committee objected to Section 
200.580(d) of the rules of the Illinois Commerce Commission entitled "Rules of 
Practice" (89 III. Adm. Code 200.580(d)) because the rules fail to provide the 
standards used by the Commission to determine whether corrections will be 



- 165 - 



made to transcripts in Commission hearings, in violation of Sectior. 4.02 of the 
Illinois Administrative Procedure Act. 

Recommendation to Existing Rules : The Joint Committee recommended to the 
Illinois Commerce Commission that it initiate rulemaking within 60 days to 
amend Part 200 of the Commission's rules entitled "Rules of Practice" (80 III. 
Adm. Code 200) in order to implement the agreements the Commission has 
made to provide standards for the exercise of its discretion. 

Agency Response to Objections: Refusal to Modify or Withdraw (Objection 1), 
Agreement to Modify (Objection 2), and Agreement to promulgate rules 
(Objection 3). Response received by the Joint Committee September 19, 1985. 

Agency Response to Recommendation: Failure to Respond. 

Joint Committee Response: October 16, 1985, recommendation to request 
timetable to monitor rulemaking. 

COMMUNITY COLLEGE BOARD, ILLINOIS 

Administration of the Illinois Public Community College Act (23 III. Adm. Code 
T50TT " " ~~ 

Proposal Originally Published in Illinois Register , November 30, 1984 (8 III. 
Reg. 23110). This Joint Committee action from the meeting of April 16, 1985 
was published in the Illinois Register , May 3 1985 (9 III. Reg. 6447). Rules 
published as adopted June 21 , 1985 (9 III. Reg. 9470). 

Objection to Existing Rule : The Joint Committee objected to Part 1501 of the 
existing rules of the Illinois Community College Board because, contrary to 
Section 2-17 of the Illinois Public Community College Act, the Board is 
without rules to establish the standards by which Business Assistance Grants 
shall be awarded. 

Agency Response: Failure to Respond. 

Joint Committee Response: Pending. 

ENVIRONMENTAL PROTECTION AGENCY 

This Joint Committee action from the meeting of September 19, 1985 was 
published in the October 4, 1985 Illinois Register (9 III. Reg. 15121 and 
15124). 

Objection to Complaint Revi ew: The joint Committee objected to the 
Environmental Protection Agency's use of its draft rules entitled "Procedures 
To Be Followed In The Performance Of Annual Inspections Of Motor Vehicle 
Exhaust Emissions" because the draft rules relied upon by the contractor 
were subject to change by the Agency thus preventing the contractor from 
knowing the exact conditions which must be met in the performance of the 
contract. 



16G 



Rec ommendation 1 to Complaint Review : The Joint Committee suggested to the 
Environmental Protection Agency that it initiate rulemaking to promulgate its 
"Procedures To Be Followed In The Performance Of Annual Inspections Of 
Motor Vehicle Exhaust Emissions" pursuant to Section 5.01 of the Illinois 
Administrative Procedure Act in order to ensure that the public is given 
notice and an opportunity to comment upon these rules. 

C omplaint Review Recommendation 2 : The Joint Committee suggested to the 
Environmental Protection Agency that it initiate rulemaking to promulgate the 
Agency's policies concerning the grievance and notice of non-compliance 
procedures to be used by the Agency in implementing the vehicle emission 
testing program pursuant to the Illinois Administrative Procedure Act in order 
to ensure that the public is given notice and an opportunity to comment. 

Agency Response: Failure to Respond. 

Joint Committee Response: Pending. 

LABOR RELATIONS BOARD, ILLINOIS EDUCATIONAL 

Hearing Procedures (80 III. Adm. Code 1105) 

Proposal Originally Published in the Illinois Register , January 18, 1985 (9 III. 
Reg. 603). This Joint Committee action from the meeting of July 25, 1985 was 
published in the Illinois Register , August 9, 1985 (9 III. Reg. 12435). Rules 
published as adopted June 21, 1985 (9 III. Reg. 9491), effective June 11, 
1985. 

Objection to Existing Rule : The joint Committee objected to Sections 1105.40 
and 1105.150 of the Illinois Educational Labor Relations Board's existing rules 
entitled "Hearing Procedures" because, during its promulgation, these rules 
were substantively changed after the commencement of the second notice 
period, in violation of Section 5.01(b) of the Illinois Administrative Procedure 
Act. 

Agency Response: Failure to respond. 

Joint Committee Response: December 11, 1985, no further action. 

Representation Proceedings (80 ill. Adm. Code 1110) 

Proposal Originally Published in Illinois Register , May 25, 1984 (8 111. Reg. 
7152). This Joint Committee action from the meeting of January 17, 1985 was 
published in the Illinois Register , February 1, 1S85 (9 III. Reg. 1488). Rules 
published as adopted September 7, 1984 (8 III. Reg. 16300), effective August 
27, 1984. 

Objection to Existing Rule : The Joint Committee objected to the existing 
rules of the Illinois Educational Labor Relations Board entitled "Representation 
Proceedings" because the Board's adopted rules included substantive changes 
made after the commencement of the second notice period which were not made 



167 



in accordance with the requirements of Sections 5.01(b) and 7.06(d) of the 
Illinois Administrative Procedure Act. 

Agency Response: Refusal to Modify or Withdraw, published May 10, 1985 (9 
III. Reg. 6876). Response received by the Joint Committee April 26, 1985. 

Joint Committee Response: May 14, 1985, no further action. 



LABOR RELATIONS BOARD, ILLINOIS LOCAL 
LABOR RELATIONS BOARD, ILLINOIS STATE 

General Procedures (80 III. Adm. Code 1200) 

Proposal Originally Published in Illinois Register , September 21, 1984 (8 III. 
Reg. 17212). This Joint Committee action from the meeting of February 27, 
1985 was published in the Illinois Register , March 15, 1985 (9 III. Reg. 3406). 
Rules published as adopted , February 1 , 1985 (9 III. Reg. 1846), effective 
January 25, 1985. 

Objection 1 to Existing Rules : The Joint Committee objected to Section 
1200.30(d) of the Illinois State and Local Labor Relations Boards' rules 
entitled "Genera! Procedures" (80 III. Adm. Code 1200.30(d)) because the 
"good cause" standard used by the hearing officer or the Boards in 
determining whether extensions of time will be granted is not stated "as 
precisely and clearly as practicable under the conditions" in order to inform 
those persons affected, in violation of Section 4.02 of the Illinois 
Administrative Procedure Act. 

Objection 2 to Existing Rules : The Joint Committee objected to Section 
1200.50 of the rules of the Illinois State and Local Labor Relations Boards 
entitled "General Procedures" (80 III. Adm. Code 1200.50) because the rule 
fails to reflect the Boards' actual policy regarding orders for the 
transcription of hearing records. 

Objection 3 to Existing Rules : The Joint Committee objected to Section 
1200.70 of the rules of the Illinois State and Local Labor Relations Boards 
entitled "General Procedures" (80 III. Adm. Code 1200) because that rule 
permits the unauthorized practice of law, in violation of "An Act to revise the 
laws in relation to attorneys and counselors." 

Objection 4 to Existing Rules : The Joint Committee objected to Section 
1200.90(e) of the rules of the Illinois State and Local Labor Relations Boards 
entitled "General Procedures" (80 III. Adm. Code 1200.90(e) because this rule 
fails to reflect the Boards' actual policy regarding the appearance of Board 
employees at Board proceedings. 

Objection 5 to Existing Rules : The Joint Committee objected to Sections 
1200.120 and 1200.140 of the rules of the Illinois State and Local Labor 
Relations Boards entitled "General Procedures" (80 III. Adm. Code 1200.120, 
1200.140) because the adoption of these rules circumvented the public notice 
and comment provisions of Section 5.01 of the Illinois Administrative 
Procedure Act. 



168 



Objection 6 to Existing Rules : The Joint Committee objected to the existing 
rules of the Illinois State Local Labor Relations Boards entitled "General 
Procedures" (80 111. Adm. Code 1200) because the Boards violated Section 
100.530 of the Secretary of State's rules in that the Notice of Adopted Rules 
published in the February 8, 1985 issue of the Illinois Register did not 
include a list of all of the changes between the proposed and adopted 
versions of the rules. 

Objection 7 to Existing Rules : The Joint Committee objected to the existing 
rules of the Illinois State and Local Labor Relations Boards entitled "General 
Procedures" (80 III. Adm. Code 1200) because the rules were adopted in 
violation of Section 5.01 of the Illinois Administrative Procedure Act. 

Agency Response: Refusal to Modify or Withdraw, published May 3, 1985 (9 
III. Reg. 6345). Response received by the Joint Committee April 24, 1985. 

Joint Committee Response: June 19, 1985, no further action. 

Impasse Resolution (80 III. Adm. Code 1230) 

Proposal Originally Published in Illinois Register , September 21, 1984 (8 III. 
Reg. 17214). This Joint Committee action from the meeting of February 27, 
1985 was published in the Illinois Register , March 15, 1985 (9 III. Reg. 3419). 
Rules published as adopted, February 8, 1985 (9 III. Reg. 1857), effective 
January 25, 1985. 

Objection 1 to Existing Rules : The Joint Committee objected to Section 
1230.70(d) of the rules of the Illinois State and Local Labor Relations Boards 
entitled "Impasse Resolution" because that provision conflicts with Section 13 
of the Illinois Public Labor Relations Act. 

Objection 2 to Existing Rules: The Joint Committee objected to the existing 
rules of the Illinois State and Local Labor Relations Boards entitled "Impasse 
Resolution" because the Boards violated Section 100.530 of the Secretary of 
State's rules in that the Notice of Adopted Rules published in the February 
8, 1985 issue of the Illinois Register did not include a list of all of the 
changes between the proposed and adopted versions of the rules. 

Objection 3 to Existing Rules : The Joint Committee objected to the existing 
rules of the Illinois State and Local Labor Relations Boards entitled "Impasse 
Resolution" (80 Mi. Adm. Code 1230) because the rules were adopted in 
violation of Section 5. 01 of the Illinois Administrative Procedure Act. 

Recommendation 1 to Existing Rules : The Joint Committee suggested that the 
Illinois State and Local Labor Relations Boards seek legislation to amend the 
Illinois Public Labor Relations Act to grant it the authority to require all 
employers to file copies of collective bargaining agreements with the Boards. 

Recommendation 2 to Existing Rules : The Joint Committee suggested that the 
Illinois State and Local Labor Relations Boards seek legislation to amend 
Section 13 of the Illinois Public Labor Relations Act to delete or change the 
statutory deadline for issuance of a written report by a fact-finder. 



169 



Agency Response to Objection: Refusal to Modify or Withdraw, published May 
31, 1985 (9 III. Reg. 6363). Response received by the Joint Committee April 
24, 1S85. 

Agency Response to Recommendation: Failure to Respond. 

Joint Committee Response: June 19, 1985, no further action. 

Representation Proceedings (80 III. Adm. Code 1210.100(f)) 

Proposal Originally Published in Illinois Register , August 31, 1984 (8 III. 
Reg. 15994). This Joint Committee action from the meeting of February 21, 
1985 was published in the Ill inois Register , March 8, 1985 (9 III. Reg. 3012). 
Rules published as adopted, February 8, 1985 (9 III. Reg. 1870), effective 
January 25, 1985. 

Objection 1 to Existing Rules : The Joint Committee objected to Section 
1210.100(f) of the rules of the Illinois State and Local Labor Relations Boards 
entitled "Representation Proceedings" (80 III. Adm. Code 1210 because that 
rule fails to include the standards used by the hearing officer in determining 
whether prehearing conferences or statements of position will "expedite the 
procedure," and therefore will be scheduled or requested by the hearing 
officer, in violation of Section 4.02 of the Illinois Administrative Procedure 
Act. 

Objection 2 to Existing Rules : The Joint Committee objected to the existing 
rules oT the Illinois State and Local Labor Relations Boards entitled 
"Representation Proceedings" (80 III. Adm. Code 1210) because the Boards 
violated Section 100.530 of the Secretary of State's rules in that the Notice of 
Adopted Rules published in the February 8, 1985 issue of the Illinois Register 
did not include a list of all the changes between the proposed and adopted 
versions of the rules. 

Objection 3 to Existing Rules : The Joint Committee objected to the existing 
rules of the Illinois State and Local Labor Relations Boards entitled 
"Representation Proceedings" (80 III. Adm. Code 1210) because the rules were 
adopted in violation of Section 5.01 of the Illinois Administrative Procedure 
Act. 

Agency Response: Refusal to Modify or V/ithdraw, published May 3, 1985 (9 
III. Reg. 6373). Response received by the Joint Committee April 24, 1985. 

Joint Committee Response: June 19, 1985, no further action. 

Unfair Labor Practice Proceedings (80 III. Adm. Code 1220) 

Proposal Originally Published in Illinois Register , August 31, 1984 (8 III. 
Reg. 15996). This Joint Committee action from the meeting of February 27, 
1985 was published in the Illinois Register , March 15, 1985 (9 III. Reg. 3433). 
Rules published as adopted, February 8, 1985 (9 III. Reg. 1898), effective 
January 25, 1985. 



170 



Objection 1 to Existing Rules : The Joint Committee objected to Section 
1220.40(b)(2) of the rules of the Illinois State and Local Labor Relations 
Boards entitled "Unfair Labor Practice Proceedings" (80 III. Adm. Code 
1220.40(b)(2) because the rule does not include the standards to be used by 
the Board or its designated representative in determining whether certain 
evidence must be submitted by a respondent, in violation of Sections 3.09 and 
4.02 of the Illinois Administrative Procedure Act. 

Objection 2 to Existing Rules : The Joint Committee objected to the existing 
rules of the Illinois State and Local Labor Relations Boards entitled "Unfair 
Labor Practice Proceedings" (80 III. Adm. Code 1220) because the Boards 
violated Section 100.530 of the Secretary of State's rules in that the Notice of 
Adopted Rules published in the February 8, 1985 issue of the Illinois Register 
did not include a list of all of the changes between the proposed and adopted 
versions of the rule. 

Objection 3 to Existing Rules : The Joint Committee objected to the existing 
rules of the Illinois State and Local Labor Relations Boards entitled "Unfair 
Labor Practice Proceedings" (80 III. Adm. Code 1220) because the rules were 
adopted in violation of Section 5.01 of the Illinois Administrative Procedure 
Act. 

Agency Response: Refusal to Modify or Withdraw, published May 3, 1985 (9 
III. Reg. 6384). Response received by the Joint Committee April 24, 1985. 

Joint Committee Response: June 19, 1985, no further action. 



MENTAL HEALTH AND DEVELOPMENTAL DISABILITIES, DEPARTMENT OF 

R ecipient Rights (59 III. Adm. Code 111) 

Proposal Originally Published in Illinois Register , March 9, 1984 (8 III. Reg. 
2798). This Joint Committee action at the meeting of January 17, 1985 was 
published in the Illinois Register , February 1, 1985 (9 III. Reg. 1469). Rules 
published as adopted November 9, 1984 (8 III. Reg. 22086), effective 
November 1 , 1984. 

Recommendation to Existing Rule : The Joint Committee suggested that the 
Department of Mental Health and Developmental Disabilities develop and 
promulgate as rules the standards which govern the discretion of the regional 
administrator to provide and alternative treatment/habilitation program to a 
recipient. 



Agency Response: Failure to Respond. 
Joint Committee Response: Pending. 



- 171 - 



172 - 



SECTON THREE 
LEGISLATIVE PACKAGE FOR 1986 



Each year the Joint Committee presents its legislative agenda to the General 
Assembly for its consideration. In addition to its other oversight functions, 
the Committee develops and introduces its own legislation as well as 
suggesting legislation to agencies or standing committees of the General 
Assembly. These bills are the result of problems with specific rules or 
policies encountered by the Committee, which it has determined will best be 
remedied through legislation. The legislative activities of the Joint Committee 
enhance the oversight process by including not only its members but those of 
the full body of the General Assembly. 



Bills Developed for Consideration During 1986 

The Joint Committee's agenda for 1986 contains 33 proposed pieces of 
legislation. Each bill is the result of action taken by the Committee during 
the last calendar year. For your convenience, the proposed bills for 1986 
have been numbered and divided into three general categories: 

(1) I A PA bill - This bill amends the Illinois Administrative Procedure 
Act by further clarifying the rulemaking process. 

(2) Legislative concepts expected to be supported by agencies - 
Included in this category are bill which the Committee anticipates 
will have agency support. As was the case in 1985, it is 
anticipated that these bills will be included in one or more omnibus 
Joint Committee bill. (Bills #1 - #21) 

(3) Mandated requirements - Bills included in this category will provide 
a legislative mandate requiring agencies to adopt rules or 
standards. It is anticipated that these bills will be included in an 
omnibus Joint Committee bill. (Bills #22 - #26) 

(4) Other substantive bills - Bills included in this category have Joint 
Committee support, but the Committee anticipates agency opposition. 
(Bills #27 - #32) 



173 



17'l 



IAPA BILL 



Background 

The Joint Committee on Administrative Rules is required by law to act on 
proposed rules within 45 days after the State agency submits notice to the 
Committee. In many cases, due to the scheduling of Joint Committee 
meetings, this leads to a situation where less than one week is available for 
the review of the rules. Because many rulemakings which the Joint Committee 
reviews are complex, and often result in a great deal of public comment and 
controversy, more time is sometimes necessary for a complete review. 
Currently, this is done by agreement between the agency and the, Joint 
Committee. This bill will formalize the practice and allow the agency and the 
Joint Committee to extend the review period to 90 days, which will allow 
sufficient time for an adequate review of all proposed rules. 

Summary 

Amends Section 5.01 and Section 7.06 of the Illinois Administrative Procedure 
Act (III. Rev. Stat 1983, ch. 127, par. 1001 et seq., as amended) to provide 
for the extension of the 45 day second notice period for a period not to 
exceed an additional 45 days. Extension shall be based upon the mutual 
agreement of the Joint Committee on Administrative Rules and the agency 
proposing rules. Effective immediately. 



175 



176 



Legislative Drafting Request 



Summary 



Amends Section 5.01 and Section 7.06 of the Illinois Administrative Procedure 
Act (III. Rev. Stat 1983, ch. 127, par. 1001 et seq., as amended) to provide 
for the extension of the 45 day second notice period for a period not to 
exceed an additional 45 days. Extension shall be based upon the mutual 
agreement of the Joint Committee on Administrative Rules and the agency 
proposing rules. Effective immediately. 

Drafting Notes : 

Section 1. Amend Section 5.01 as follows: 

(ch. 127, par. 1005.01) 

***** 

(b) provide u-p— t-o— 45— days additional notice of the proposed rulemaking 
to the Joint Committee on Administrative Rule s, such notice period to be 
called the second notice period . The second notice period shall commence on 
the day written notice is received by the Joint Committee, and shall expire 45 
days thereafter unless prior to that time the agency and the Joint Committee 
have agreed to extend the second notice period beyond 45 days. Tor a period 
not to exceed an additional 45 days; or, the agency has sha+l--h-ave received a 
statement of objection from the Joint Committee, or notification from the Joint 
Committee that no objection will be issued. The written notice to the Joint 
Committee shall include: (1) the text and location of any changes made to the 
proposed rulemaking during the first notice period; (2) for all proposed rules 
and proposed amendments to rules, a final regulatory flexibility analysis, 
which shall contain a summary of issues raised by small businesses during the 
first notice period; and a description of actions taken on any alternatives to 
the proposed rule suggested by small businesses during the first notice 
period, including reasons for rejecting any alternatives not utilized; and (3) 
if written request has been made by the Joint Committee within 30 days after 
initial notice appears in the Illinois Register pursuant to Paragraph (1) of 
this Section, an analysis of the economic and budgetary effects of the 
proposed rulemaking. After commencement of the second notice period, no 
substantive change may be made to a proposed rulemaking unless it is made 
in response to an objection or suggestion of the Joint Committee. The agency 
shall also send a copy of the final regulatory flexibility analysis to each of 
the small businesses which have presented views or comments on the proposed 
rulemaking during the first notice period and to any interested person who 
requests a copy during the first notice period. The agency may charge a 
reasonable fee for providing such copies to cover postage and handling costs. 

(c) after the expiration of 45— days, the second notice period, after 
notification from the Joint Committee that no objection will be issued, or after 
response by the agency to a statement of objections issued by the Joint 
Committee, which ever is applicable, the agency shall file, pursuant to 
Section 6 of this Act, a certified copy of each rule, modification, or repeal of 



- I? - 



any rule adopted by it, which shall be published in the Illinois Register. 
Each rule hereafter adopted under this Section is effective upon filing, unless 
a later effective date is required by statute or is specified in the rule. 



Section 2. Amend Section 7.06 as follows: 

(ch. 127, par. 1007.06) 

***** 

(c) If within 45 — day-s-, the second notice period, af-tei"— rvotiee — of 
proposed- — fti4eme4df>g~ has — been — r e c eh^ed---by--the-->&hrrt--€-Of T ]mittee- > the Joint 
Committee certifies its objections to the issuing agency then that agency shall 
within 90 days of receipt of the statement of objection: 



Section 3. This Act shall take effect upon becoming a law, 



999:ldraft 



BILL 1 



Background 

During the review of the Department of Children and Family Services' rules 
regarding the Child Care Act of 1969 (89 111. Adm. Code 377) by the Joint 
Committee on Administrative Rules, is was discovered that the Department was 
not enforcing a statutory requirement regarding the release of children from 
child day care facilities. Section 7.01 of the Act requires child care facilities 
to retain a list which designates the names of persons to whom the facility 
can expect to usually release custody of the child (the primary list) and 
person to whom the facility can expect to occasionally release custody of the 
child (the contingency list). Section 7.1 of the Act requires that both the 
primary and contingency lists specify the manner in which children were to 
be released to persons on each list. Because the Department, contends that 
requiring that the primary list contain this information places an unnecessary 
administrative burden on child care facilities due to the fact that the primary 
list contains the names of persons to whom the facility can usually expect to 
release custody of the child, such as the parent or grandparent, the rules do 
not include this requirement. The contingency list, however, contains the 
names of persons to whom the facility can expect to occasionally release 
custody of the child and therefore, the Department's rules include this 
requirement for that list. 

On May 14, 1985, the Joint Committee recommended that the Department of 
Children and Family Services amend the Child Care Act to delete the 
requirement that a child care facility have on file records designating the 
manner in which children are to be released from its primary list. This 
proposal amend Section 7.1 of the Act to relieve child care facilities of the 
requirement that the primary list delineate the manner in which children may 
be released to those on that list. This requirement remains on the 
contingency list which stipulates that the facility records contain both the 
identity of the person to whom the child was released and the manner in 
which the child was released. 



Summar 



Amend Section 7.1 of the Child Care Act (III. Rev. Stat. 1983, ch. 23, par. 
2211 et seq.) to delete the requirement that a child care facility have on file 
records designating the manner in which children are to be released to 
persons on the primary release list. Effective immediately. 



038 



- 179 - 



- 180 - 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Ch. 23, par. 2217.1) 

Amends the Child Care Act. Changes the 
information required of a guardian in relation to the release 
of custody of a child by a child care facility. Effective 
immediately. 



LR384075723DJ5 



A BILL FOR 



181 



LRB84075723DJS 

1 AN ACT to amend Section 7.1 of the "Child Care Act of 49 

2 1969", approved May 15, 1969, as amended. 51 

3 Be it enacted by the People of the State of Illinois, 55 

4 represented in the General Assembly: 

5 Section 1. Section 7.1 of the "Child Care Act of 1969", 57 

6 approved May 15, 1969, as amended, is amended to read as 58 

7 follows: 

(Ch. 23, par. 2217.1) 50 

3 Sec. 7.1. (a) (1) A facility described in Section 2.09, 62 

9 2.10, or 2.18 shall retain on file a list provided by the 63 

10 legal guardian of each child under its care, designating 65 

11 f-it persons to whom it may release custody of such child, 

12 including 

13 (A) a primary list containing the names of persons co 67 

14 whom the facility can expect to usually release cuscody of 58 

15 the chiid, and 

16 (3) a contingency list containing the names of persons 70 

17 to whom the facility can expect to occasionally release 71 

18 custody of the childr and setting forth the manner in which 72 

19 such child may leave the facility in the cus-cdy of anv such 73 

20 person. 

21 fiit — •fehe-aanner — rn — whien — 9-2e-~-s«ii2---e7 — ^ea*re — ahe 75 

22 §aeiiia7-aa-ahe-end-as-ahe-?eriae-af-The-de7-daring-whieh-a:*.e 7 5 

23 ehiid-is-anaer-the— ;aei=i^7 x 9-«areT 

24 (2) No such facility shall release custody of any child 78 

25 under its care in any manner not authorized by the child's 79 

26 guardian, or to any person who is not known co the operators 30 

27 of the facility as, or cannot present sufficient 31 

28 identification proving himself to be, an individual lisced by 

29 the child's guardian as one to whom custody of the child may 32 

30 be released. 

31 (b) Zach such facility shall keep a daily departure 84 

32 record for each child under its care who leaves the facility 35 

- 182 - 



-2- LRB84075723DJ3 

1 with a person included on the contingency list, and record 86 

2 thereon the times the child leaves the facility, the manner 

3 of departure and the persons with whom such child leaves. 88 

4 Section 2. This Act shall take effect upon becoming Law. 90 



- 183 



184 



BILL 2 

Background 

At its August 28, 1985 meeting, the Joint Committee on Administrative Rules 
recommended that legislation be drafted to amend "An Act creating the 
Department of Children and Family Services, codifying its powers and duties, 
and repealing certain Acts and Sections herein named" (III. Rev. Stat. 1983, 
ch. 23, par. 5001 et seq.) to provide specific statutory authorization for the 
Governor's Youth Services Initiative. 

The Governor's Youth Services Initiative is a program that is cooperatively 
sponsored by DCFS, the Department of Corrections, the Department of Mental 
Health and Developmental Disabilities and the State Board of Education. The 
actual program is carried out by DCFS. The Initiative developed from a 
Cook County pilot project originally proposed by the Governor's Office in 
1979. In 1981, a consent decree in the case of David B. et al. legally bound 
the three agencies to continue to support and participate in the Initiative., 
Since that time, the program has been expanded beyond Cook County and 
now services downstate Illinois. The expansion was made possible through 
the use of DCFS regional staff. 

When asked to cite its statutory authority for the Initiative, DCFS revealed 
that there had been no authorizing legislation or Executive Orders. 
Basically, the Department was relying on the consent decree in David B. et 
al. as sufficient support for the program and for its expansion without the 
need for legislation. 

The consent decree in the case of David B. et al. does not, in the view of 
the Joint Committee, provide adequate authority for the Initiative, and 
provides no authority to the Department to extend the function or program of 
the Initiative beyond that which was in existence at the time of the decree. 
Additionally, the consent decree specifically mandates the cooperation of 
DCFS, DMHDD and SBE in maintaining the initiative in Cook County, the 
discussion on the part of those agencies to extend the program into downstate 
Illinois as a result of the consent decree is without statutory basis. 

Therefore, the Joint Committee believes that since the Department of Children 
and Family Services has always and is currently implementing the Governor's 
Youth Services Initiative, the statue should be amended to provide the 
Department with the authority to carry out the Initiative Program. The 
amendment to the statute shall also reflect that the Department of 
Corrections, the Department of Mental Health and Developmental Disabilities 
and the State Board of Education shall work in cooperation with DCFS to 
maintain the Initiative Program. Effective immediately. 

Summary 

Creates Section 17a-11 of "An Act creating the Department of Children and 
Family Services, codifying its powers and duties, and repealing certain Acts 
and Sections herein named" (111. Rev. Stat. 1983, ch. 23, par. 5001 et seq.) 
to provide specific authorization for the Governor's Youth Services Initiative. 
Effective immediately. 

- 185 - 



- 186 - 



Legislative Drafting Request 



Summary 



Creates Section 17a-11 of "An Act creating the Department of Children 
and Family Services, codifying its powers and duties, and repealing certain 
Acts and Sections herein named" (III. Rev. Stat. 1983, ch. 23, par. 5001 et 
seq.) to provide specific authorization for the Governor's Youth Services 
initiative. Effective immediately. 



Drafting Notes 

Section 1. Create Section 17a-11 as follows: 
(ch. 23, new par. 5017a-11) 

Section 17a-11. In cooperation with the Department of Corrections, the 
Department of Mental Health and Developmental Disabilities and Illinois State 
Board of Education, the Department of Children and Family Services shall 
establish the Covernor's~Youth Services Initiative. This program shall otter 
assistance to multi-problem youth whose difficulties are not the clear 
responsibility of any~one stateagency, and who are referred to the program 
by the juvenile court. "* 

A Folicy Board shall be established as the decision-making body of the 
Governor's Youth Services Initiative. The Board shall be composed of state 
agency liaisons appointed by the Directors ot the Department of Children and 
Family Services, the Department of Corrections, the Department of Mental 
h ealth and Developmental Disabilities ana the State Superintendent of the 
Illinois State Board of Education. The Board shall meet at least quarterly. 

The Department of Children and Family Services in consultation with the 
aforementioned sponsors of the program shall promulgate rules and regulations 
pursuant to the Illinois Administrative Frocedure Act, for the cevelopment of 
a full continuum of in-state programs necessary to meet the needs of 
multi-problem youth. 

Section 2. This Act shall take effect upon becoming a law. 



BPJ:ss:144:ldraft 



187 - 



188 



BILL 3 



Background 

An objection by the Joint Committee on Administrative Rules to the 
Department of Children and Family Services' rules entitled "Licensing 
Standards for Child Care Institutions and Maternity Centers" (89 II!. Adm. 
Code *iG4), has resulted in this proposal. The objection was based upon the 
lack of statutory authority on the part of the Department to provide, by 
rule, for the care of certain persons over the age of 18 in child care 
facilities. 

The Joint Committee recommended that legislation be drafted to require chile 
care institutions and maternity centers to provide services to persons age 18 
and older who have net completed a public school secondary education or who 
have been referred by a parent or guardian. The Department contends, and 
the Joint Committee agrees, that it must provide for the care of persons age 
eighteen or older in child care facilities because the Department sometimes has 
custody of persons between the ages eighteen to twenty-one under the 
Juvenile Court Act and the Act creating the Department of Children and 
Family Services (III. Rev. Stat. 1983, ch. 23, par. 5001 et seq.). The 
Department also has rules governing "Service Termination". These rules 
provide for a grace period of 90 days for termination of service to persons 
"who achieve self-sufficiency as specified in the service plan" and a provision 
for continued care until age twenty-one for persons who have disabilities and 
who will be transferred to adult care. These provisions are found in the Act 
creating the Department of Children and Family Services. The Department is 
applying this statutory language to its rules promulgated under the Child 
Care Act. The proposed amendment will eliminate the conflict between the 
Child Care Act and the Department's enacting legislation to give the 
Department the authority, in certain instances, to care for persons until they 
reach 21 years of age. 

Summary 

Amend the Child Care Act of 1969 (III. Rev. Stat. 1983, ch. 23, par. 2211 et 
seq.) to authorize the Department of Children and Family Services' current 
practice of admitting persons 18 years of age and older to child care 
institutions and maternity centers under certain circumstances. Effective 
immediately. 



b c - 



- 190 - 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Ch. 23, par. 2212.01) 

Amends the Child Care Act. Authorizes 
admitting persons over 18, and under 21, under certain 
circumstances. Effective immediately. 



LRB3407580BDJS 



A BILL FOR 



LRB8407530BDJS 

1 AN ACT to amend Section 2.01 of the "Child Care Act of 47 

2 1969", approved May 15, 1969, as amended. 49 

3 3e it enacted by the People of the State of Illinois, 53 

4 represented in the General Assembly: 

5 Section 1. Section 2.01 of the "Child Care Act of 1969", 55 

6 approved May 15, 1969, as amended, is amended to read as 56 

7 follows: 

(Ch. 23, par. 2212.01) 58 

8 Sec. 2.01. "Child" means any person under 18 years of 61 

9 age. For purposes of admission to and residence in child care 62 

10 institutions and maternity centers, the term also means any 63 

11 person under 21 years of ace who is referred by a parent or 64 

12 guardian, including an agency having legal responsibility for 65 

13 the person pursuant to Section 5-7 of the Juvenile Court Act. 66 

14 Termination of care for such persons under 21 years of age 

15 shall occur no later than 90 days following completion of a 67 

16 public school secondary education program or the individual's 68 

17 eligibility for such a program. 69 

18 Section 2. This Act shall take effect upon becoming law. 71 



192 



BILL 4 



Background 

This proposal is based upon a lack of statutory authority on the part of the 
Department of Commerce and Community Affairs to impose certification 
requirements on local tourism and convention bureaus, including the 
requirement that a bureau have at least one full-time person and to provide 
dollar-for-dollar matching funds, by ruie (14 III. Adm. Code 55C). The need 
for such requirements, according to the Department, reflects the original 
legislative intent of the grants earmarked by the General Assembly for 
tourism and convention bureaus. The Joint Committee on Administrative Rules 
recommended that the Department initiate legislation to statutorily provide for 
these requirements. Part of this recommendation was addressee in Public Act 
84-993, which specifically provides for the implementation of the certification 
and staffing requirements. Not addressed, however, was the matching fund 
requirement which was deleted from the bill at the conference committee 
stage. It would appear that the provision was deleted in order to avoid 
dollar-for-dollar matching funds to be used for the World's Fair. The World's 
Fair is no longer a timely topic, having been defeated during the past 
substantive session. Therefore, this legislative proposal puts the matching 
grant language back in the Act. 

Summary 

To amend Section 46.6a of the Civil Administrative Code of Illinois (III. Rev. 
Stat. 1983, ch. 127, par. 46.6a, as amended by P. A. 84-993) to provide the 
Department of Commerce and Community Affairs the authority to require a 
dollar-for-dollar match for the grant program for iocai tourism and convention 
bureaus. Effective immediately. 



583 



19: 



194 - 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Ch. 127, par. 46.6a) 

Amends The Civil Administrative Code of 
Illinois concerning grants by the Department of Commerce and 
Community Affairs for local tourism and convention bureaus. 
Requires a bureau to verify to the Department its ability to 
provide a dollar for dollar match for all funds allocated co 
it by the Department. Effective immediately. 



LRB8407587CMtC 



A BILL FOR 



LRB8407587CMtC 

1 AN ACT to amend Section 46.6a of "The Civil 49 

2 Administrative Code of Illinois", approved March 7, 1917, as 50 

3 amended. 51 

4 3e it enacted by the People of the State of Illinois, 55 

5 represented in the General Assembly: 

6 Section 1. Section 46.6a of "The Civil Administrative 57 

7 Code of Illinois", approved March 7, 1917, as amended, is 58 

8 amended to read as follows: 

(Ch. 127, par. 46.6a) 60 

9 Sec. 46.6a. (1) To establish a grant program for local 62 

10 tourism and convention bureaus. The Department will develop 63 

11 and implement a program for the use of funds, as authorized 64 

12 under this Act, by local tourism and convention bureaus. For 65 

13 the purposes of this Act, bureaus eligible to receive funds 56 

14 are defined as those bureaus in legal existence as of January 

15 1, 1985, which are either a unit of local government or 67 

16 incorporated as a not-for-profit organization, are affiliated 58 

17 with one or more municipality or county, and employ one full 69 

18 time staff person whose purpose is to promote tourism. Each 70 

19 bureau receiving funds under this Act will be certified by 71 

20 the Department as the designated recipient to serve an area 

21 of the State. A bureau shall verify to the Department: its 72 

22 ability to provide a dollar for dollar match for all funds 7 3 

23 allocated to it by the Department. These funds may not be 74 

24 used in support of the Chicago Worlds ?air. 

25 (2) To distribute grants to local tourism and convention 76 

26 bureaus from appropriations made from the Convention and 77 

27 Local Tourism Bureau Account in the Build Illinois Fund for 78 

28 that purpose. Of the amounts appropriated annually to the 79 

29 Department for expenditure under this Section, 1/3 of such 80 

30 monies shall be U3ed for grants to convention and tourism 81 

31 bureaus in cities with a population greater than 500,000. The 

32 remaining 2/3 of the annual appropriation shall be used for 32 

- 196 - 



-2- LRB8407587CMtc 

1 grants to 3uch bureaus in the remainder of the State, in 83 

2 accordance with a formula based upon the population served. 84 

3 The Department may reserve up to 10% of such remaining 2/3 of 85 

4 the funds appropriated to conduct audits of grants, to 86 

5 provide incentive funds to those bureaus which will conduct 

6 promotional activities designed to further the Department's 87 

7 statewide advertising campaign, and to fund promotional 88 

8 activities which support an increased use of the State's 89 

9 parks. 90 
10 Section 2. This Act takes effect upon its becoming a law. 92 



19: 



- 198 



EILL 5 



Background 

This proposal is based upon a recommendation issued by the Joint Committee 
on Administrative Rules to draft legislation which would grant the Department 
of Commerce and Community Affairs the authority to require that recipients of 
grants under the Technology Commercialization Crant-in-Aid Program hold the 
State of Illinois harmless from any and all claims and actions based upon or 
arising out cf any services proviaed by themselves or their associates and 
employers. 

According to the Depatment, it is involved with research and innovation 
through the Technology Crant-in-Aid Program, in which issues of patent 
rights may arise. It is also making decisions as to which projects should 
receive funding. For these reasons, the Department felt, and the Joint 
Committee has concurred, that such protection from liability is prudent on the 
part of the Department. The Department's rules to implement this Program 
include a hold-harmless clause (17 III. Adm. Code 540.70(w)). The 
Department has conceded, however, that there is no statutory authority for 
such a regulatory provision. The Department agrees with the Joint Committee 
in its recommendation to seek legislation to hold the State of Illinois harmless 
from any and all claims, demands, and actions based upon or arising out of 
services performed by recipients or their associates and employers under the 
grant program. 

Summary 

Amend Section 46.19a of the Civil Administrative Code (III. Rev. Stat.- 1983, 
ch. 127, par. 1 et seq., as amended) to grant the Department of Commerce 
and Community Affairs the specific statutory authority to require recipients of 
grants under the Technology Commercialization Crants-in-Aid Program to hold 
the State of Illinois harmless from any and all claims and actions based upon 
or arising out of any services provided by themselves or their associates and 
employers. Effective immediately. 



:12 



- 200 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Ch. 127, par. 46.19a) 

Amends the Civil Administrative Code. Provides 
that recipients of grants under the Technology 
Commercialization Grant-in-Aid program shall hold the State 
harmless from certain claims and actions. Effective 
immediately. 



LRB8407704JMcs 



A BILL FOR 



- 201 - 



LRB8407704JMCS 

1 AN ACT to amend Section 46.19a of "The Civil 48 

2 Administrative Code of Illinois", approved March 7, 1917, as 49 

3 amended. 50 

4 Be it enacted by the People of the State of Illinois, 54 

5 represented in the General Assembly: 

6 Section 1. Section 46.19a of "The Civil Administrative 56 

7 Code of Illinois", approved »March 7, 1917, as amended, is 57 

8 amended to read as follows: 

(Ch. 127, par. 46.19a) 59 

9 Sec. 46.19a. (1) To facilitate and fund upon request to 61 

10 the Director, job-training programs with new or expanding 62 

11 industrial firms and to facilitate and fund job-training 63 

12 programs between new or expanding industrial firms and public 64 

13 or proprietary institutions of higher or secondary education, 

14 provided that the State's contribution shall not exceed 66 65 

15 2/3% of the direct costs of all approved programs, except for 66 

16 such programs in which at least 50% of the participants are 67 

17 selected from individuals who at the time of their selection 68 

18 are either (a) determined by the Department of Employment 69 

19 Security to be unemployed or (b) determined by the Department 

20 of Public Aid to be receiving State welfare benefits or (c) 70 

21 determined by the Department of Rehabilitation Services to be 71 

22 receiving training for the handicapped, in which case the 72 

23 State contribution shall constitute not more than 100% of all 73 

24 direct cost3 of approved programs. Recipients of grants 74 

25 under the Technology Commercialization Grant-in-Aid program 75 

26 3hall hold the State of Illinois harmless £rom any and all 

27 claims and actions based upon and arising out of any services 76 
28- performed under the grant by the recipient or the recipient's 77 

29 associates and employers. 

30 The Director shall have the following duties and 79 

31 responsibilities in regard to such programs: 80 

32 (a) He shall review and may grant requests from 82 



- 202 



LRB8407704JMCS 



1 • reputable industrial firms for job-training programs designed 83 

2 to aid in the relocation or expansion of such firms; 84 

3 (b) He may after coordinating and utilizing all * 86 

4 available federal job training monies, supplement such funds 87 

5 with State monies annually appropriated to the Department 88 

6 hereunder for such purposes; 

7 (c) He may rent, purchase, or lease such equipment or 90 

8 machinery necessary to equip such job-training programs or 91 

9 make grants to any higher or secondary education institution 92 

10 for such purposes; 

11 (d) He shall work with local developmental authorities, 94 

12 local Employment Services offices, local labor organizations, 95 

13 the Department of Rehabilitation Services, the Department of 96 

14 Public Aid or other appropriate agencies in developing such 97 

15 job-training programs. 

16 (2) To establish a program of grants to universities, 99 

17 community colleges, research institutions, research 100 

18 consortiums, other not-for-profit entities, and Illinois 101 

19 businesses for the purpose of fostering research and 102 

20 development in the high technology and the service sector 

21 leading to the development of new products and services that 103 

22 can be marketed by Illinois businesses. All grant awards 104 

23 shall include a contract which may provide for payment of 105 

24 negotiated royalties to the Department if the product or 

25 service to be developed by the grantee is subsequently 106 

26 licensed for production. 

27 (a) Grants may be awarded to universities and research 108 

28 institutions to assist them in making their faculties and 109 

29 facilities available to Illinois businesses. Such grants may 110 

30 be used by a university or research institution for, 111 

31 including but not limited to the following purposes: (i) to 

32 establish or enhance computerized cataloging of all research 112 

33 labs and university staff and make such catalogues available 113 

34 to Illinois businesses; (ii) to market products developed by 114 

35 the university to Illinois businesses; (iii) to review 115 



703 



-3- LRB8407704JMCS 

1 publications in order to identify, catalog, and inform 116 

2 Illinois businesses of new practices in areas such as 117 

3 robotics, biotechnology; (iv) to build an on-line, 

4 information and technology system that relies on other 118 

5 computerized networks in the United States; (v) to assist in 119 

6 securing temporary replacement for faculty who are granted a 120 

7 leave of absence from their teaching duties for the purpose 

8 of working full-time for an Illinois business to assist that 121 

9 business with technology transfer. 122 

10 (b) Grants may be awarded to universities and research 124 

11 institutions, research consortiums and other not-for-profit 125 

12 entities for the purpose of identifying and supporting 126 

13 Illinois businesses engaged in high technology and service 127 

14 sector enterprises. Such Illinois businesses identified and 

15 funded shall include recipients of Small Business Innovation 128 

16 Research Program funds under subsections (e) through (k) of 129, 

17 Section 9 of the Small Business Act. (Title 15 United States 130 
13 Codes, subsections 638(e)-638(k) ) . Entities receiving grants 131 

19 under this paragraph (b) shall be known as commercialization 132 

20 centers and shall engage in one or more of the following 133 

21 activities: 

22 (i) directing research assistance for new venture 135 

23 creations; 

24 (ii) general feasibility studies of new venture ideas; 137 

25 (iii) furthering the technical and intellectual skills 139 

26 of the managers and owners of Illinois 3mall businesses; 140 

27 (iv) commercialization of technology and research; 142 

28 (v) development of prototypes and testing new produces; 144 

29 (vi) identify and assist in securing financing; 146 

30 (vii) marketing assistance; and 148 

31 (viii) assisting Illinois inventors in finding Illinois 150 

32 manufacturers to produce and market their inventions. 151 

33 A commercialization center may charge a nominal fee for 153 

34 conducting feasibility studies and other services. 154 

35 (c) Grants may be awarded by the Department to Illinois 156 



- 204 



-4- LRB8407704JMCS 

1 businesses to fund research and consultation arrangements 157 

2 between businesses and universities, community colleges, 158 

3 research institutions, research consortiums and other 159 

4 not-for-profit entities within this State. 

5 The Department shall give priority to Illinois small 161 

6 businesses in awarding grants. Each grant awarded under this 162 

7 paragraph (c) shall provide funding for up to 50% of the cost 163 

8 of the research or consultation arrangements, not to exceed 164 

9 $100,000; provided that the grant recipient utilizes Illinois 

10 not for profit research and academic institutions to perform 165 

11 the research and development function for which grant funds 166 

12 were requested. 

13 (d) Grants may be awarded to research consortium and 168 

14 other qualified applicants, in conjunction with private 169 

15 sector or federal funding, for other creative systems that 170 

16 bridge university resources and business, technological, 171 

17 production and development concerns. 

18 (e) For the purposes of subsection (2), (i) "Illinois 173 

19 business" means a "small business concern" as defined in 174 

20 Title 15 Dnited States Code, Section 632, which primarily 175 

21 conducts it3 business in Illinois; (ii) "high technology" 176 

22 means any area of research or development designed to foster 177 

23 greater knowledge or understanding in fields such as computer 

24 science, electronics, physics, chemistry or biology for the 178 

25 purpose of producing designing, developing or improving 179 

26 prototypes and new processes; (iii) "private sector" shall 18Q 

27 have the meaning ascribed to it in Title 29 United States 181 

28 Code, Section 1503; (iv) "University" means either a degree 

29 granting institution located in Illinois as defined in 182 

30 Section 2 of "An Act to regulate the granting of academic 183 

31 degrees, diplomas and certificates by certain educational 184 

32 institutions, to provide penalties for the violation thereof 185 

33 and to make an appropriation therefor", approved August 14, 

34 1961, as amended, or a State-supported institution of higher 186 

35 learning administered by the Board of Trustees of the 187 



205 



-5- LRB8407704JMCS 

1 University of Illinois, the Board of Trustees of Southern 188 

2 Illinois University, the 3oard of Regents of Regency 189 

3 Universities, the Board of Governors of State Colleges and 

4 Universities or the Illinois Community College Board; (v) 190 

5 "venture" means any Illinois business engaged in research and 191 

6 development to create new products or services with high 192 

7 growth potential; (vi) Illinois research institutions refers 193 

8 to not-for-profit entities, which include federally-funded 

9 research laboratories, that conduct research and development 194 

10 activities for the purpose of producing, designing, 195 

11 developing, or improving prototypes and new processes; and 196 

12 (vii) other not-for-profit entities means non-profit 197 

13 organizations based in Illinois that are primarily devoted to 

14 new enterprise or product development. 198 

15 {3} There is created within the Department, a Technology 200 

16 Innovation and Commercialization Grants-in-Aid Council which 201, 

17 shall consist of 2 representatives of the Department of 202 

18 Commerce and Community Affairs appointed by the Department; 203 

19 one representative of the Illinois Board of Higher Education, 204 

20 appointed by the Board; one representative of science or 

21 engineering appointed by the Governor; two representatives of 205 

22 business, appointed by the Governor; and one representative 206 

23 of small business, appointed by the Governor. The Director of 207 

24 Commerce and Community Affairs shall appoint one of the 208 

25 Department's representatives to serve as chairman of the 

26 Council. The Council members shall receive no compensation 209 

27 for their services but 3hall be reimbursed for their expenses 210 

28 actually incurred by them in the performance of their duties 211 

29 under this subsection. The Department shall provide staff 212 

30 services to the Council. The Council shall provide for review 213 

31 and evaluation of all applications received by the Department 

32 under subsection (2) of this Section and make recommendations 214 

33 on those projects to be funded. The Council shall also assist 215 

34 the Department in monitoring the projects and in evaluating 216 

35 the impact of the program on technological innovation and 217 



- 206 



-6- LRB8407704JMCS 

1 business development within the State. 217 

2 (4) There is hereby created a special fund in the State 219 

3 Treasury to be known as the Technology Innovation and 220 

4 Commercialization Fund. The moneys in such Fund may be used, 221 

5 subject to appropriation, only for making grants pursuant to 222 

6 subsection (2) of this Section. All royalties received by the 

7 Department shall be deposited in such Fund. 224 

8 Section 2. This Act takes effect upon becoming law. 226 



?07 - 



208 



BILL 6 



Background 

During the review of the Department of Conservation's rules regarding field 
trials (17 III. Adm. Cede 930), it was learned that the Department waives the 
Illinois hunting license requirement for non-resident participants and official 
gunners when the non-resident resides in a state which permits Illinois 
residents to participate in field trials in that state. The Department stated 
that provisions such as the courtesy non-resident license is a necessary part 
of Illinois' public relations with participants from other states since the same 
privilege is extended to Illinois participants in events held outside Illinois. 
The Joint Committee on Administrative Rules has recommended, based upon 
the rationale of the Department's rules, that the non-resident hunting license 
requirement should be waived for such non-resident participants and gunners 
at field trials. 



Amends Section 3.1 of the Wildlife Code of 1971 (III. Rev. Stat. 1983, ch. 61, 
par. 3.1) to allow the Department of Conservation to waive the Illinois 
hunting license requirement for non-resident participants and official gunners 
at field trials if they reside in a state that reciprocates by allowing Illinois 
residents to participate in field trials in that state without obtaining a 
hunting license in that State. Effective immediately. 



191 



- 209 - 



- 21 G 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Ch. 61, par. 3.1) 

Amends the Wildlife Code to provide that a 
courtesy non-resident license for taking game may be issued 
to non-resident participants and official gunners at field 
trials who reside in a state which extends the same privilege 
to residents of Illinois. Effective immediately. 



LR384075743Mmr 



A BILL FOR 



- ?11 - 



LR38407574aMmr 

1 AN ACT to amend Section 3.1 of the "Wildlife Code", 47 

2 approved December 10, 1971, as amended. 49 

3 3e it enacted by the People of the State of Illinois, 5 3 

4 represented in the General Assembly; 

5 Section 1. Section 3 . 1 of the "Wildlife Code", approved 55 

6 December 10, 1971, as amended, is amended to read as follows: 56 

(Ch. 61, par. 3.1) 58 

7 Sec. 3.1. Before any person shall take or attempt to 60 

8 take any of the species protected by Section 2.2 for which an 61 

9 open season is established under this Act, he shall first 6 2 

10 have procured and possess a valid hunting license. 53 

11 Before any person 16 years of age or older shall take or 65 

12 attempt to take any bird of the species defined as migratory 55 

13 waterfowl by Section 2.2, he shall first have procured a 

14 State Migratory Waterfowl Stamp. 

15 A hunting license shall not be issued to any person under 59 

16 the age of 16 years without the written consent of the 70 

17 father, mother or legally constituted guardian of such 71 

18 person. 

19 3efore any person who is a non-residenc of the State of 7 3 

20 Illinois shall take or attempt to take any of the 3pecies 74 

21 protected by Section 2.2, for which an open season is 75 

22 established under this Act, he shall, unless specifically 75 

23 exempted by law, first procure a non-residenc license as 

24 provided by this Act for the taking of any wild game. 

25 The owners residing on, or bona fide tenants of, farm 79 

26 lands and their children, parents,. brothers, and sisters 80 

27 actually permanently residing on such lands, shail have the 81 

28 right to hunt any of the species protected by Section 2.2, 82 

29 upon such land3 and waters thereon, without procuring hunting 83 

30 licenses; but 3uch hunting shall be done only during such 84 

31 periods of time and with such devices and by such methods as 55 

32 are permitted by this Act. Any person on active duty with 86 

- 212 - 



-2- LRB84075743Mmr 

1 the Armed Forces of the United States who is now and who was 86 

2 at the time of entering the Armed Forces, a resident of 87 

3 Illinois and who entered such Armed Forces from this State, 88 

4 and who is presently on ordinary leave from the Armed Forces, 89 

5 and any resident of Illinois who is disabled, or 65 years of 90 

6 age or more, may hunt any of the species protected by Section 91 

7 2.2 without procuring a hunting license, but such hunting 92 

8 shall be done only during such periods of time and with such 93 

9 devices and by such methods as are permitted by this Act. 

10 For the purpose of this Section a person is disabled when 94 

11 that person has a Type 1 or Type 4, Class 2 disability as 95 

12 defined in Section 4A of The Illinois Identification Card 96 

13 Act. For purposes of this Section, an Illinois Disabled 97 

14 Person Identification Card issued pursuant to The Illinois 98 

15 Identification Card Act indicating that the person thereon 

16 named has a Type 1 or Type 4, Class 2 disability shall be 99 

17 adequate documentation of such a disability. 100 
13 A courtesy non-resident license for taking game may be 102 

19 issued at the discretion of the Director, without fee, to any 103 

20 person officially employed in the game and fish or 104 

21 conservation department of another state or of the United 105 

22 States who is within the State to assist or consult or 106 

23 cooperate with the Director; or to the officials of other 107 

24 states, the United States, foreign countries, or officers or 

25 representatives of conservation organizations or publications 108 

26 while in the State 33 guests of the Governor or Director ; or 109 

27 to non-resident participants and official gunners at field 110 

28 trials who reside in a state which extends the same privilege 111 

29 to residents of Illinois . 

30 State Migratory Waterfowl Stamps shall be required for 113 

31 the same persons who intend to hunt migratory waterfowl and 114 

32 under the same conditions as hunting licenses of the various 115 

33 types authorized and required by this Section. 117 

34 Section 2. This Act takes effect upon its becoming a law. 119 



213 



- 21 i| 



BILL 7 



Background 

This proposal clarifies within the Wildlife Cede a discrepancy which occurred 
during a Joint Committee or. Administrative Rules review of the Department of 
Conservation's rules entitled "Cock Pheasant, Hungarian Partridge, Bobwhite 
Quail, Rabbit and Crow hunting Regulations." 

In order to control participation at Department-owned or managed sites during 
the controlled pheasant hunting season and Youth Pheasant Hunt, The 
Department of Conservation requires hunters to deposit their hunting license 
or Firearm Owners Identification Card when they check into the site. The 
licenses and the l.D. cards are returned when the hunters check out. 
Section 3.2 of the Wildlife Code, however, states that a hunter must always 
have a hunting license on his person . Further consultation with the 
Department revealed that hunters are required to deposit their licenses every 
time they enter a Department-owned or managed site, not just for these 
particular hunts. Based upon this information, the Joint Committee 
recommended, and the Department supports, amending the Wildlife Code as 
well as "An Act relating to the acquisition, possession and transfer of 
firearms and firearm ammunition" to provide the Department with the authority 
to retain hunting licenses and Firearm Owners Identification Cards while 
hunters are hunting on Department-owned and managed sites. This provision 
does not delete the language requiring hunters to have licenses on their 
person and available upon demand. Rather it simply aeds an exception to 
that requirement for hunting while on Department of Conservation owned and 
managed sites. 

Summary 

Amend Section 3.2 of the Wildlife Code of 1971 (III. Rev. Stat. 1983, ch. 61 
par. 3.2 and Section 2 of "An Act relating to the acquisition, possession and 
transfer of firearms and firearm ammunition" (111. Rev. Stat. 1983, ch. 38, 
par. 83-2 as amended by P. A. 84-25, effective July 18, 1985), to provide the 
Department of Conservation with the authority to retain a hunter's license, 
permit or Firearm Owner's Identification Card while he or she is hunting on a 
Department owned or managed site. Effective immediately. 



274 



215 



216 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS:' (Ch. 38, par. 83-2; Ch. 61, par. 3.2) 

Amends an Act relating to the possession of 
firearms and the Wildlife Code. Exempts hunters from the 
requirement that a license, permit or a Firearm Owner's 
Identification Card necessary to hunt shall be in their 
possession at all times when required to deposit such items 
at a check station upon entering hunting areas owned or 
managed by the Department of Conservation. Provides that 
under 3uch circumstances, failure to possess a Firearm 
Owner" 3 Identification Card shall not be a criminal 
violation. Effective immediately. 



LRB8407706SFtc 



A BILL FOR 



217 



LRB8407706SFtc 

1 AN ACT in relation to firearm permits, licenses and 56 

2 identification cards. 57 

3 3e it enacted by the People of the State of Illinois, 61 

4 represented in the General Assembly: 

5 Section 1, Section 2 of "An Act relating to the 63 

6 acquisition, possession and transfer of firearms and firearm 64 

7 ammunition, to provide a penalty for the violation thereof 65 

8 and to make an appropriation in connection therewith, 65 

9 approved August 3, 1967, as amended, is amended to read as 

10 follows: 

(Ch. 38, par. 83-2) 68 

11 Sec. 2. (a) No person may acquire or possess any firearm 70 

12 or any firearm ammunition within this State without having in 71 

13 his possession a Firearm Owner's Identification Card 72 

14 previously issued in his name by the Department of State 73 

15 Police under the provisions of this Act. 

16 (b) The provisions of this Section regarding the 75 

17 possession of firearms and firearm ammunition do not apply 76 

18 to: 

19 (1) United State's Marshals, while engaged in the 73 

20 operation of their official duties; 79 

21 (2) Members of the Armed Forces of the United States or 81 

22 the National Guard, while engaged in the operation of their 82 

23 official duties; 

24 (3) Federal officials required to carry firearms, while 34 

25 engaged in the operation of their official duties; 85 

26 (4) Members of bona fide veterans organizations which 87 

27 receive firearms directly from the armed forces of the United 88 

28 States, while using 3uch firearms for ceremonial purposes 89 

29 with blank ammunition; 

30 (5) Nonresident hunters curing hunting season, with 91 

31 valid nonresident hunting licenses and while in an area where 92 

32 hunting is permitted; however, at all other times and in all 93 

- 218 - 



-2- LRB8407706SFtc 

1 other places such persons must have their firearms unloaded 94 

2 and enclosed in a case; 

3 (6) Those hunters exempt from obtaining a hunting 96 

4 license who are required to submit their Firearm Owner's 97 

5 Identification Card when hunting on Department of 98 

6 Conservation owned or managed sites; 99 

7 (7) f5f Nonresidents while on a firing or shooting range 

8 recognized by the Department of State Police; however, such 100 

9 persons must at all other times and in all other places have 102 

10 their firearms unloaded and enclosed in a case; 103 

11 (8) f?t Nonresidents, while at a firearm showing or 105 

12 display recognized by the Department of State Police; 106 

13 however, at all other times and in all other places such 108 

14 persons must have their firearms unloaded and enclosed in a 109 

15 case; 

16 (9) f8f Nonresidents, whose firearms are unloaded and 111 

17 enclosed in a case; 

18 (10 f9f Nonresidents, who are currently licensed or 113 

19 registered to possess a firearm in their resident state; 114 

20 (11) fiBf Onemancipated minors while in the custody and 116 

21 immediate control of their parent or legal guardian or ocher 117 

22 person in loco parentis to such minor if that such parent or 118 

23 legal guardian or other person in loco parentis to such minor 119 

24 has a currently valid Firearm Owner's Identification Card; 120 

25 and 

26 (12) fiif Color guards of bona fide veterans 122 

27 organizations or members of bona fide American Legion bands 123 

28 while using firearms for ceremonial purposes with blank 124 

29 ammunition. 

30 (c) The provisions of this Section regarding the 126 

31 acquisition and possession of firearms and firearm ammunition 127 

32 do not apply to law enforcement officials of this or any 123 

33 other jurisdiction, while engaged in the operation of their 

34 official duties. 130 

35 Section 2. Section 3.2 of the "Wildlife Code", approved 132 

- 219 - 



-3- LRB840770SSFtc 

1 December 10, 1971, as amended, is amended to read as follows: 

(Ch. 61, .par. 3.2) 

2 Sec. 3.2. Before the Department or any county, city, 

3 village, township, incorporated town clerk or his duly 

4 designated agent or any other person authorized or designated 

5 by the Department to issue hunting licenses shall issue a 

6 hunting license to any person, the person shall file his 

7 application with the Department or other party authorized to 

8 issue licenses on a form provided by the Department and 143 

9 further give definite proof of identity and place of legal 144 

10 residence. Each clerk designating agents to issue licenses 145 

11 and stamps shall furnish the Department, within 10 days 146 

12 following the appointment, the names and mailing addresses of 147 

13 the agents. Each clerk or his duly designated agent shall be 148 

14 authorized to sell licenses and Migratory Waterfowl stamps 149 

15 only within the territorial area for which he was elected or 150 

16 appointed. No duly designated agent is authorized to furnish 151. 

17 licenses or stamps for issuance by any other person or 152 

18 business establishment. Each application shall be executed 15 3 

19 and sworn to and shall set forth the name and description of 15<? 

20 the applicant and place of residence. 

21 Beginning July 1, 1976, no hunting license shall be 156 

22 issued to any person under 16 years of age unless he presents 157 

23 the person authorized to issue such license either (a) 158 

24 evidence that he has held a hunting license issued by the 159 

25 State of Illinois or another state in a prior year, or (b) a 160 

26 certificate of competency as provided in thi3 Section. 

27 The Department of Conservation shall authorize personnel 162 

28 of the Department or certified volunteer instructors to 163 

29 conduct courses in firearms and hunter safety, which may 164 

30 include training in bow and arrow safety, at regularly 165 

31 specified intervals throughout the State of not les3 than 8 156 

32 hours in length. Persons successfully completing the course 

33 shall receive a certificate of competency. The Department of 167 

34 Conservation shall further cooperate with any reputable 158 

- 220 - 



-4- LRB8407706SPtc 

1 association or organization in establishing courses if the 169 

2 organization has as one of its objectives the promotion of 170 

3 safety in the handling of firearms or bow and arrow. 171 

4 The Department of Conservation may designate any person 173 

5 found by it to be competent to give instruction in the 174 

6 handling of firearms, hunter safety and bow and arrow. The 175 

7 persons so appointed shall give the course of instruction and 176 

8 upon the successful completion thereof shall issue to the 177 

9 person instructed a certificate of competency in the safe 178 

10 handling of firearms, hunter safety and bow and arrow. No 

11 charge shall be made for any course of instruction except for 179 

12 materials or ammunition consumed. The Department of 180 

13 Conservation shall furnish information on the requirements of 181 

14 hunter safety education programs to be distributed free of 182 

15 charge to applicants for hunting licenses by the persons 183 

16 appointed and authorized to issue licenses. Funds for the 

17 conducting of firearms and hunter safety courses shall be 184 

18 taken from the fee charged for the Firearm Owners 185 

19 Identification Card. 

20 The fee for a hunting license to hunt all species for a 187 

21 resident of Illinois is $7. 188 

22 Upon submitting suitable evidence of legal residence in 190 

23 any other state, non-residents shall be charged the same fee 191 

24 for a hunting license to hunt as that charged residents of 192 

25 Illinois by the State in which the applicant resides, except 193 
25 that in no case shall such fee be less than $15 and if the 194 

27 state of the applicant's residence does not provide for a 195 

28 non-resident hunting license to hunt all species, then the 

29 fee shall be the minimum provided for in this paragraph. The 196 

30 license fee for a person not a resident of the United States 197 

31 to take wildlife except deer is $15. 198 

32 Upon submitcing suitable evidence of legal residence in 200 

33 any other state, non-residents may be issued a non-resident 201 

34 hunting license for a period not to exceed 10 consecutive 20 2 

35 days' hunting in the state and shall be charged a fee of $10; 203 

- 221 - 



-5- LaB8407706SFtc 

1 however, no such license shall be issued to non-residents 204 

2 from states that do not extend the same privilege to 205 

3 residents of Illinois. 

4 A special non-resident hunting license authorizing a 207 

5 non-resident to take game birds by shooting on a game 208 

6 breeding and shooting preserve area only, established under 209 

7 Section 3.27, shall be issued upon proper application being 210 

8 made and payment of a fee of $5. The expiration date of this 211 

9 license shall be March 31 of each year. 

10 Notwithstanding any other provision in this Section, 213 

11 non-residents who are 65 years of age or more shall not be 214 

12 required to obtain any hunting license in Illinois if 215 

13 Illinois residents of that age are granted the same privilege 216 

14 by the State in which the non-resident resides. If an 217 

15 Illinois resident of age 65 or more is required to obtain a 218 

16 hunting license by the State in which a non-resident 

17 applicant of age 65 or more resides, such non-resident shall 219 

18 be required to obtain a license to hunt in Illinois and the 220 

19 fee shall be the same as that charged Illinois residents of 221 

20 the 3ame age by the State in which the non-resident applicant 222 

21 resides. The requirements with respect to minimum fees in 223 

22 this Section shall not apply to non-resident applicants of 224 

23 age 55 or more. 

24 2ach applicant for a State Migratory Waterfowl Stamp, 226 

25 regardless of his residence or other condition, shall pay a 227 

26 fee of $5, and shall receive therefor a stamp, which shall be 228 

27 affixed to his license or permit in a space designated by the 229 

28 Department for that purpose. 

29 The Department shall furnish the holders of hunting 231 

30 licenses and Migratory Waterfowl Stamps with such insignia as 232 

31 evidence of possession of license, or license and stamp, as 233 

32 the Department may consider advisable, and such insignia 234 

33 shall be exhibited and used as the Department may order. 235 

34 All other hunting licenses and all migratory waterfowl 237 

35 stanps shall expire upon March 31 of each year. 238 

- 222 - 



-6- LRB8407706SFtc 

1 Every person holding any license, permit or stamp issued 240 

2 under the provisions hereof shall have it in his possession 241 

3 for immediate presentation for inspection to the officers and 242 

4 authorized employees of the Department, any sheriff, deputy 243 

5 sheriff or any other peace officer making a demand for it. 245 

6 This provision shall not apply to Department owned or managed 

7 sites where it is required that all hunters deposit their 246 

8 license, permit or Firearm Owner's Identification Card at the 247 

9 check station upon entering the hunting areas. 248 

10 Section 3. This Act shall take effect upon becoming a 250 

11 law. 



73 



- 224 - 



BILL 8 

Background 

The Department of Conservation promulgated rules regulating the 
transportation and possession of certain species of aquatic life within the 
State of Illinois. In proposing its rules, the Department stated that it was 
primarily concerned with controlling the population of grass carp in the State. 
The Department's authority to regulate the introduction of species not 
indigeneous to Illinois is found in Section 3.20 of the Fish Code. That 
Section states, "[i]t shall be unlawful to release any aquatic life into waters 
of the State without first seeking the permission ot the Department to do 
so...." 

The Department was asked to explain its statutory authority to make it 
unlawful to possess, transport or ship these species. The Department stated 
that it regulated the shipping and transportation of fish previously through 
Section 5.12 of the Fish Code because that section requires anyone who ships 
aquatic life to have a fish dealer's license. The Department responded that 
possession was a condition of both shipping and releasing. 

While Section 5.12 of the Fish Code allows the Department to require one who 
sells or ships aquatic life to obtain a fish dealer's license, it does not state 
that shipping certain species is unlawful without special permission from the 
Department. Furthermore, the statute does not make unlawful the conditions 
necessary to ship or release aquatic life. The Department by adopting these 
rules and regulations is exceeding its limitations and clearly stated statutory 
authority. The Department no doubt is taking such action because it feels 
that the biological balance of the aquatic population of the State is at stake. 
However, the necessity of regulation does not allow the Department to 
promulgate rules beyond its present authority. Therefore, the Joint 
Committee on Administrative Rules has recommended that the Fish Code be 
amended to provide the Department of Conservation with the specific authority 
to regulate the transportation and possession of aquatic life within the State 
of Illinois. 



Summary 

Amends Section 3.20 of the Fish Code (111. Rev. Stat. 1983, ch. 56, par. 
3.20) to provide the Department of Conservation with the authority to 
regulate the transportation and possession of aquatic life. Effective 
immediately. 



320 



225 



726 



Legislative Drafting Request 



Summary 



Amends Section 3.20 of the Fish Code (III. Rev. Stat. 1983, ch. 56, par. 
3.20) to provide the Department of Conservation with the authority to 
regulate the transportation and possession of aquatic life. Effective 
immediately. 

Section 1. Amend Section 3.20 as follows: 

(III. Rev. Stat 1983, ch. 56, par. 3.20) 

Section 3.20. It shall be unlawful to release any fish into waters of this 
State without first seeking permission of the Department to do so, except that 
owner of a body of water may release fish that are indigenous to the State of 
Illinois. The Department shall have the authority to promulgate as necessary 
rules and regulations, pursuant to the Illinois Administrative Procedure Act, 
regulating the possession, transportation and shipping of aquatic life hot 
indigenous to the State of Illinois. All fish may be released into waters from 
which they were taken. 

Section 2. This Act shall take effect upon becoming a law. 



BPJ:ss:320:ldraft 



227 



228 



BILL 9 



Background 

During the review of a Department of Employment Security rule (56 III. Adm. 
Code 2730), the Joint Committee on Administrative Rules discovered a conflict 
between the Department's rules and the Unemployment insurance Act. The 
Act provides that employers shall notify each employee of his right to report 
as wages the amount of gratuities received in the course of his work, to the 
employer, for the purpose of determining benefits and taxes under the Act. 
The Department's rules, however, state that employers shall notify employees 
of the duty to report gratuities as wages. Under federal law, it is an 
employee 1 ^ duty to report such gratuities as wages. The Joint Committee 
recommended that the Department seek legislation amending Section 234 of the 
Unemployment Insurance Act to make it consistent with federal law. 

Summary 

Amends Section 234 of the Unemployment Insurance Act (III. Rev. Stat. 1983, 
ch. 48, par. 344) to provide that employers must notify employees that they 
have the duty rather than the right to report to the employer gratuities 
received during the course of employment. Effective immediately . 



:46 



229 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Ch. 48, par. 344) 

Amends The Unemployment Insurance Act. 
Specifies an employer must notify each employee of the 
employee's "duty," rather than his "right," to report to the 
employer gratuities received by the employee and* required to 
be treated as wages. Effective immediately. 



LRB8407577CMtc 



A BILL FOR 



- 231 - 



LRB8407577CMtc 

1 AN ACT to amend Section 234 of "The Unemployment 53 

2 Insurance Act", approved June 30, 1937, as amended. 55 

3 Be it enacted by the People of the State of Illinois, 59 

4 represented in the General Assembly; 

5 Section 1. Section 234 of "The Unemployment Insurance 61 

6 Act", approved June 30, 1937, as amended, is amended to read 62 

7 as follows: 

(Ch. 48, par. 344) 64 

8 Sec. 234. Subject to the provisions of Sections 235 and 66 

9 245 C, "wages" means every form of remuneration for personal 67 

10 services, including salaries, commissions, bonuses, and the 63 

11 reasonable money value of all remuneration in any medium 69 

12 other than cash. The reasonable money value of remuneration 

13 in any medium other than cash shall be estimated and 70 

14 determined in accordance with rules prescribed by the 71 

15 Director. Such rules shall be based upon the reasonable past 72 

16 experience of the workers and the employing units concerned 

17 therewith. 73 

18 Where gratuities are customarily received by an 75 

19 individual in the course of his work from persons other than 76 

20 his employer, such gratuities shall, subject to the 77 

21 provisions of this paragraph, be treated as wages received 78 

22 from his employer. Each such employer shall notify each such 

23 individual of his duty right to report currently the amount 79 

24 of such gratuities to such employer and the Director shall, 80 

25 by regulation, prescribe the manner of notification and of 81 

26 reporting. The amount of gratuities so reported shall 82 

27 constitute a conclusive determination of the amount received 

28 unless the employer, within the time prescribed by 83 

29 regulation, notifies the Director of his disagreement 84 

30 therewith. Gratuities not so reported to the employer in the 85 

31 manner prescribed by such regulations of che Director shall 

32 not be wages for any of the purposes of this Act. 88 

- 232 - 



-2- LRB8407577CMtc 
1 Section 2. This Act takes effect upon its becoming a law. 90 



233 



231 



BILL 10 



Background 

The Joint Committee on Administrative Rules suggested, after a review of the 
Department of Financial Institutions' rules implementing the Illinois Credit 
Union Act (38 III. Adm. Code 190), that legislation be drafted to explicitly 
permit the Department to require credit unions to provide fidelity bonds and 
insurance coverage for the unlawful acts of third persons and credit union 
officials as well as officers and employees of the credit union having custody 
of or handling funds. The Department's rules include such a provision. 

Public Act 83-1347, effective September 8, 1984, amended the Credit Union 
Act to make it a duty of a credit union's Board of Directors to "Provide 
adequate fidelity bond coverage for officers and employees having custody of 
or handling funds subject to the rules and regulations promulgated by the 
Directors." 

The Department explained that the changes to the Act made by P. A. 83-1347, 
were prepared on behalf of the Illinois Credit Union League, and were 
intended to make the Illinois legislation "parallel" the federal regulations, 
which use broad language to authorize coverage. The Department's 
explanations and the legislative history of P. A. 83-1347 indicate that the 
General Assembly intended to permit the Department to parallel the 
regulations for federal credit unions. The changes made to Section 30 of the 
Illinois Credit Union Act by P. A. 83-1347 do not clearly evidence that intent. 
The language of that legislation acted to replace a requirement for a bond to 
protect against listed unlawful acts of officers, employees, Directors, agents, 
etc. , with a more general requirement for bond coverage of officers and 
employees that handle funds. Nothing in the Act indicates that the 
Department of Financial Institutions has the authority to require bond 
coverage for losses caused by the unlawful acts of third parties or 
"directors" and "committee members." "Officials," which would indicate 
directors and committee members, are explicitly named as permissible insureds 
under the federal rules but not, explicitly, in the Illinois state statute. This 
legislation would make the feaeral and state regulations consistent in this 
regard. 

Summary 

Amends Section 30 of the Credit Union Act (III. Rev. Stat. 19S4 Supp., ch. 
17, par. 4431) to permit the Department of Financial Institutions to require 
credit unions to provide fidelity bond and insurance coverage for the unlawful 
acts of third persons and credit union officials in addition to officers and 
employees of the credit union having custody of or handling funas, in order 
to be consistent with Federal regulations. Effective immediately. 

042 



- 235 - 



236 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Ch. 17, par. 4431) 

Amends The Credit Union Act. Requires the 
Board of Directors of any credit union subject to that Act to 
provide general insurance coverage for the unlawful acts of 
third persons and changes from "officers and employees having 
custody of or handling funds" to "officials and employees", 
those persons for whom the Board must provide adequate 
fidelity bond coverage. Effective immediately. 



LRB8407889SFtc 



A BILL FOR 



237 



LRB8407889SFtc 

1 AN ACT to amend Section 30 of "The Illinois Credit Union 53 

2 Act", approved August 30, 1979, as amended. 55 

3 Be it enacted by the People of the State of Illinois, 59 

4 represented in the General Assembly: 

5 Section 1. Section 30 of "The Illinois Credit Union 61 
5 Act", approved August 30, 1979, as amended, is amended to 62 

7 read as follows: 

(Ch. 17, par. 4431) 64 

8 Sec. 30. Duties of Directors. It shall be the duty of 66 

9 the Directors to: 

10 (1) Review the Membership Committee's actions on 68 

11 applications for membership. A record of the Membership 69 

12 Committee's approval or denial of membership shall be 70 

13 available to the Board of Directors for inspection. A person 71 

14 denied membership by the Membership Committee may appeal the 72 

15 denial to the Board; 

16 (2) Provide adequate fidelity bond coverage for 74 

17 officials officers and employees of credit unions, and 75 

18 general insurance coverage for the unlawful acts of third 7 6 

19 persons , having-essatody-of-off-handling-fands subject to rules 

20 and regulations promulgated by the Director; 

21 (3) Determine from time to time the interest rates, noc 79 

22 in excess of that allowed under this Act, which shall be 80 

23 charged on loans to members and to authorize interest 81 

24 refunds, if any, to members from income earned and received 

25 in proportion to the interest paid by them on such classes of 82 

26 loans and under such conditions as the Board prescribes. The 83 

27 Directors may establish different interest rates to be 84 

28 charged on different classes of loans; 

29 (4) Within any limitations set forth in the credit 86 

30 union's bylaws, fix the maximum amount which may be loaned 87 

31 with and without security to a member; 

32 (5) Declare dividends on various classes of shares in 39 

- 238 - 



-2- LRB8407889SFtc 

1 the manner and form as provided in the bylaws; 90 

2 (6) Limit the number of shares which may be owned by a 9 2 

3 member; such limitations to apply alike to all members; 93 

4 (7) Have charge of the investment of funds, except that 95 

5 the Board of Directors may designate an Investment Committee 96 

6 or any qualified individual or entity to have charge of 97 

7 making investments under policies established by the Board of 98 

8 Directors; 

9 (8) Authorize the employment of or contracting with such 100 

10 persons or organizations as may be necessary to carry on the 101 

11 operations of the credit union; and fix the compensation, if 102 

12 any, of the officers and provide for compensation for other 103 

13 employees within policies established by the Board of 

14 Directors; 

15 (9) Authorize the conveyance of property; 105 

16 (10) Borrow or lend money consistent with the provisions 107 

17 of this Act; 

18 (11) Designate a depository or depositories for the 109 

19 funds of the credit union and supervise the investment of 110 

20 funds; 

21 (12) Suspend or remove, or both, for cause, any or all 112 

22 officers or any or all members of the Membership, Credit, 113 

23 Supervisory or other committees for failure to perform their 114 

24 duties; 

25 (13) Appoint any special committees deemed necessary; 116 

26 and, 

27 (14) Perform such other duties as the members may 118 

28 direct, and perform or authorize any action not inconsistent 119 

29 with this Act and not specifically reserved by the bylaws to 120 

30 the members. 121 

31 Section 2. This Act takes effect upon its becoming a law. 123 



239 



240 



BILL n 

Background 

During the review of the Department of Financial Institutions' emergency rules 
entitled "Illinois Credit Union Act" (III. Rev. Stat. 1983, ch. 17, par. 
4409(2)], the Joint Committee on Administrative Rules found that the 
Department lacked the statutory authority to require that credit unions seek 
prior approval by the Department before contracting with credit union service 
organizations. The Credit Union Act as it currently reads clearly places the 
hiring of service organizations under the discretionary authority of the 
Director of a credit union. 

The Department indicated that, this authority was necessary in order to 
adequately regulate credit unions. The Department stated that service 
organizations may provide a way for credit unions to hide records of their 
financial actions because the Department cannot examine the records of the 
service organizations. In addition, the Department noted that service 
organizations are a new development in the industry, and the approval 
process will provide the Department with a way of studying these 
organizations. Because the Joint Committee agreed with the Department's 
need to regulate service organizations, it has recommended that legislation be 
drafted to provide the Department with the authority to require prior 
approval. 

Summary 

Amends Section 4431 of the Illinois Credit Union Act (111. Rev. Stat. 1984 
Supp., ch. 17, par. 4431) to require a credit union to obtain approval from 
the Department prior to loaning to, investing in, or participating in credit 
union service organizations. Effective immediately. 



044E 



241 



242 



Legislative Drafting Request 



Summary 



Amends Section 4431 of the Illinois Credit Union Act (III. Rev. Stat. 1984 
Supp., ch. 17, par. 4431) to require a credit union to obtain approval from 
the Department prior to loaning to, investing in, or participating in credit 
union service organizations. Effective immediately. 



Drafting Notes 

Section 1. Amend Section 30 as follows: 

(111. Rev. Stat., 1984 Supp., ch. 17, par. 4431) 

Section 30. Duties of Directors. It shall be the duty of the Directors 
to: 

(1) Review the Membership Committee's actions on applications for 
membership. A record of the Membership Committee's approval or denial of 
membership shall be available to the Eoard of Directors for inspection. A 
person denied membership by the Membership Committee may appeal the denial 
to the Board; 

(2) Provide adequate fidelity bond coverage for officers and employees 
having custody of or handling funds subject to rules ana regulations 
promulgated by the Director; 

(3) Determine from time to time the interest rates, not in excess of that 
allowed under this Act, which shall be charged on leans to members and to 
authorize interest refunds, if any, to members from income earned and 
received in proportion to the interest paid by them on such classes of loans 
and under such conditions as the Board prescribes. The Directors may 
establish different interest rates to be charged on different classes of loans; 

(4) V/ithin any limitations set forth in the credit union's bylaws, fix the 
maximum amount which may be loaned with and without security to a member; 

(5) Declare dividends on various classes of shares in the manner and 
form as provided in the bylaws; 

(6) Limit the number of shares which may be owned by a member; such 
limitations to apply alike to all members; 

(7) Have charge of the investment of funds, except that the Board of 
Directors may designate an Investment Committee or any cualified individual 
or entity to have charge of making investments under policies established by 
the Board of Directors; 

(8) Authorize the employment of or contracting with such persons or 
organizations as may be necessary to carry on the operations of the credit 
union^ provided that prior approval for loaning to, investing in or 



participating in credit union service organizations is received trorr. the 
Department ; and fix the compensation, if any, of the officers and provide for 
compensation for other employees withir. policies established by the Board of 
Directors: 

(9) Authorize the conveyance of property; 

(10) Borrow or lend money consistent with the provisions of this Act; 

(11) Designate a depository or depositories for the funds of the credit 
union and supervise the investment of funds; 

(12) Suspend or remove, or both, for cause, any or all officers or any 
or all members of the Membership, Credit, Supervisory or other committees 
for failure to perform their duties; 

(13) Appoint any special committees deemed necessary; and 

(14) Perform such other duties as the members may direct, and perform 
or authorize any action not inconsistent with this Act and not specifically 
reserved by the bylaws to the members. 

Section 2. This Act shall take effect upon becoming a law. 



044E:ldraft 



- 244 



DILL 12 



Background 

During its review of two Department of Public Aid rules regarding State 
residency requirements for the Aid to the Aged, Blind, and Disabled and 
Medical Assistance programs (89 III. Adm. Code 113 and 120), the Joint 
Committee on Administrative Rules discovered that these requirements were 
not consistent with federal residency requirements for the programs. The 
Public Aid Code (III. Rev. Stat. 1983, ch. 23, par. 2-10) requires that 
an individual must have established a permanent home in the State, and must 
be employed, engaged in other self-support activities, or maintained by 
relatives or by other sources or means of support, in order to be a resident. 
Federal rules require that the state of residence of a recipient be the state 
where the recipient is living and that the recipient have a job commitment or 
be seeking employment (whether or not currently employed). Because of the 
inconsistency between State and federal residency requirements, the Joint 
Committee recommended that the Department seek legislation to amend the 
State's residency requirements for various programs. 

Summary 

Amends Section 2-10 of the Public Aid Code (III. Rev. Stat. 1983, ch. 23, 
par. 2-10) to bring residency requirements contained in this Section into 
compliance with federal residency requirements for all public aid programs 
which do not have more specific residency requirements. Effective 
immediately. 



263/264 



245 - 



!*I6 - 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Ch. 23, par.' 2-10) 

Amends the Public Aid Code. Permits residence 
to be established by seeking employment in this State. 
Effective immediately. 



L»B840 7 579DAmr 



Fiscal Note Act 
may be applicable 



A BILL FOR 



2^7 - 



LRB8407579DAmr 

1 AN ACT to amend Section 2-10 of "The Illinois Public Aid 43 

2 Code", approved April 11, 1967, as amended. 45 

3 3e it enacted by the People off the State of Illinois, 49 

4 represented in the General Assembly; 

5 Section 1. Section 2-10 of "The Illinois Public Aid 51 
S Code", approved April 11, 1967, as amended, is amended to 52 

7 read as follows: 

(Ch. 23, par. 2-10) 54 

8 Sec. 2-10. "Residence": The establishment of a permanent 56 

9 home within this State. 

10 A person is deemed to have established his permanent home 58 

11 within this State if he has acquired by purchase, rental, or 59 

12 other arrangement housing facilities which he uses as his 60 

13 home; has located his household equipment, furnishings and 61 

14 personal belongings therein; and is or has been employed, is_ 62 

15 seeking employment, or is_ engaged in other self-support 63 

16 activity, in the community in which he lives or within a 64 

17 distance reasonably proximate thereto, within or without the 65 

18 State, which i3 accessible to his home by public or private 66 

19 transportation facilities and to which he regularly commutes, 67 

20 or, if he cannot engage in employment or other self-support 

21 activity, is maintained in such home by relatives responsible 68 

22 for his support or by other sources or means of maintenance 69 

23 and support. However, a recipient who moves from this State 70 

24 for the purpose of obtaining employment or other means of 71 

25 support or care shall retain his residence eligibility for a 72 

26 period of 12 months, provided he has not acquired residence 73 

27 eligibility for public aid under the laws of any State to 74 

28 which he has moved. 

29 The residence of a married woman shall be that of her 75 

30 husband unless they are living separate and apart, in which 77 

31 case she may acquire a separate residence. 78 

32 Minor children shall have the residence of their father 30 

- 248 - 



-2- LRB8407579DAmr 

1 if they reside with him; if they reside with their mother 81 

2 they shall have her residence. 82 

3 A minor, neither of whose parents has acquired a 84 

4 residence, may acquire a residence as if he or she were a 85 

5 person of full age. 

6 Every minor upon marriage may acquire a residence as if 87 

7 he or she were a person of full age. 88 

8 Applicants for or recipients of public aid shall meet 90 

9 such durational requirements as to residence as may be 91 

10 specified in the Article governing the category under which 9 2 

11 they are applying for or receiving aid. 93 

12 Temporary absence from the State, absence while in the 95 

13 service of the State or Nation, or entry into a hospital or 96 

14 other medical care institution outside the State for medical 97 

15 treatment, shall not affect a person's residence. 98 

16 A recipient of aid under Article III, IV or VI who, for 100 

17 any reason, has remained outside the State for a continuous 101 

18 period of more than 12 months shall prima facie be presumed 102 

19 to have lost his residence and shall receive no further aid 103 

20 unless and until he submits evidence sufficient to prove he 104 

21 has retained his residence. If the evidence proves that the 105 

22 absence was without intention to change his residence, the 106 

23 recipient shall be deemed to have maintained his residence 107 

24 eligibility and the grant of aid shall be continued or 

25 resumed. 108 
25 Section 2. This Act takes effect upon its becoming a law. 110 



249 



BILL 13 



Background 

At its November 14, 1985 meeting, the Joint Committee on Administrative 
Rules directed staff to develop legislation to amend the Hospice Program 
Licensing Act. Specifically, this legislative proposal explicitly grants the 
Department of Public Health the authority to issue licenses to substandard 
hospice programs based upon an acceptable plan of correction for the facilities 
not in compliance with the Hospice Program Licensing Act and the 
Department's rules governing hospice programs (77 III. Adm. Code 280). 
Section 7 of the Hospice Licensing Act requires that the Department of Public 
Health shall issue a license if it finds "the applicant is in compliance with this 
Act and the minimum standards established pursuant to the Act . . . ." The 
Act makes no reference to issuing a license to a substandard program based 
upon a plan of correction. 

The Department responded to the Joint Committee's concerns by stating that 
it encourages the orderly development of hospice programs and that the intent 
of the Act is to ensure that persons requiring hospice services receive the 
best quality care. The Department also stated that "no program is in 
compliance with every requirement of the Act and regulations at all times," 
and that without the ability to issue licenses based on corrective action plans 
for proper enforcement of the rules, would result in the Department 
constantly having each hospice in administrative hearings aimed at the 
withdrawal of licensing. 

For these reasons, the Joint Committee has directed that legislation be 
proposed to grant the Department of Public Health the authority to renew a 
hospice program which is not in compliance with the Hospice Program 
Licensing Act and the Department's rules governing hospice programs based 
upon the submission of an acceptable plan of correction by the hospice. 

Summary 

Amend Section 7 of the Hospice Program Licensing Act (III. Rev. Stat. 1983 
ch. 11U, par. 6107) to grant the Department of Public Health the authority 
to renew a hospice license to a hospice program which is not in compliance 
with the Hospice Program Licensing Act and the Department's rules governing 
hospice programs based upon submission of an acceptable plan of correction 
by the hospice. Effective immediately. 



225 



- 251 - 



252 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: --(Ch. Ill 1/2, par. 6107) 

Amends The Hospice Program Licensing Act. 
Establishes as an alternative licensing requirement that an 
applicant submit to the Illinois Department of Public Health 
an acceptable plan for the correction of deficiencies 
discovered as the" result of an inspection. Requires the 
Department to establish standards by which plans to correct 
such deficiencies will be acceptable. Effective immediately. 



LR384Q7705SFtc 



A BILL FOR 



:53 - 



LRB8407705SFtc 

1 AN ACT to amend Section 7 of "The Hospice Program 5 5 

2 Licensing Act" , approved September 17, 1983, as amended. '57 

3 Be it enacted by the People of the State of Illinois, 61 

4 represented in the General Assembly; 

5 Section 1. Section 7 of "The Hospice Program Licensing 63 

6 Act", approved September 17, 1983, as amended, is amended to 64 

7 read as follows: 

(Ch. Ill 1/2, par. 6107) 66 

8 Sec. 7. Issuance of License - Renewal. Upon receipt of 68 

9 a completed application for license or renewal the Department 69 

10 shall issue a license if the Department finds: 

11 (1) The applicant is in compliance with this Act and the 71 

12 minimum standards established pursuant to this Act as shown 72 

13 by the inspection performed pursuant to Section 6; or 73 

14 (2) The applicant submits to the Department an 75 

15 acceptable plan for the correction of deficiencies discovered 76 

16 by the Department during the inspection performed pursuant to 77 

17 Section 6. The Department shall establish, by rule, the 78 

18 standards it uses to determine whether such a plan is 79 

19 acceptable; and 

20 ( 3) f-2f The affiliated agency has maintained compliance 81 

21 with the standards established pursuant to its applicable 82 

22 licensing Act, if any. 83 

23 Section 2. This Act takes effect upon its becoming a law. 85 



254 - 



RILL TJ 



Background 

On September 19, 1985, the Joint Committee on Administrative Rules issued a 
recommendation for legislation pertaining to the Illinois Income Tax Act. The 
legislation specifically authorizes the reduction of the add-back provision in 
an amount which the taxpayer would otherwise be entitled to take as a 
charitable deduction, which has been implemented by the Department of 
Revenue, by rule, in an attempt to clarify deductions by certain taxpayers of 
money which was a capital gain but also permanently set aside for charitable 
purposes. 

Generally, federal income tax applies to the taxable income of estates or any 
kind of property held in trust. However, Section 643(c)(2) of the Internal 
Revenue Code allows certain estates and trusts a deduction for money which 
is "permanently set aside" for charitable purposes. Section 1202(a) of the 
Code allows certain taxpayers a 60% deduction from gross income of the 
amount of net capital gain. In order to prevent a double deduction in the 
instance where an estate or trust earns capital gain income which is 
permanently set aside for charitable purposes. Section 643(c)(4) of the Code 
provides that capital gain income permanently set aside for charitable 
purposes must be adjusted pursuant to any capital gain deduction taken 
under Section 1202. 

Illinois tax law imposes a tax on "base income." Estate or Trust base income 
under Illinois law is defined as the taxable income under the Internal Revenue 
Code except modified by the section in question (2-203(c)). This section 
provides that the base income is modified in an amount equal to the capital 
gain deduction allowable under Section 1202 of the Interna! Revenue Code. 
The result is that any capita! gain deduction allowable under Section 1202 of 
the Code would be added back to the taxable income leaving the taxpayer 
with a charitable deduction which has already been reduced by the amount of 
capital gains pursuant to Section 643(c)(4) of the Code. 

The Department's interpretation of these provisions was recently challenged 
by a taxpayer who refused to add-back the capital gain deduction which as 
taken in computing federal tax on amounts permanently set aside for charity. 
The result of this dispute was the proposal of the Department's rules which 
would allow the taxpayer to reduce the amount required to be added back by 
Section 2-203(c)(2) by the amount thereof which relates to capital gain income 
set aside for charitable purposes pursuant to Section 652(c) thus allowing the 
taxpayer to get full charitable deduction. 

The Department's approach through its rulemaking proposal seemed to solve 
the problem of double deduction, while still allowing the taxpayer his full 
charitable deduction. The Department's rulemaking is however, without 
statutory authority. The Joint Committee has therefore recommended that the 
Illinois Income Tax Act be amended to specifically authorize the reduction of 
the add-back provision of Section 2-203(c) (2) (B) in an amount which the 
taxpayer would otherwise be entitled to take as a charitable deduction. 



255 



Summary 

Amends Section 2-203(c) (2) (B) of the Illinois Income Tax Act (III. Rev. Stat. 
1985 Supp., ch. 120, par. 2-203) to specifically authorize the reduction of 
the add-back provision of 2-203 (c) (2) (B) in an amount which the taxpayer 
woula otherwise be entitled to take as a charitable deduction. Effective 
immediately. 



16: 



256 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Ch. 120, par. 2-203) 

Amends the Illinois Income Tax Act. Specifies 
that amounts of capital gain income for which a trust or 
estate is entitled to a charitable deduction for federal 
income tax purposes shall not be added to taxable income for 
Illinois Income Tax purposes. Effective immediately. 



LRB8407710RLks 



HSCAL NOTE ACT 
MAYB£APHJCAB1£ 



A BILL FOR 



- 257 



LRB8407710RLl<s 

1 AN ACT to amend Section 203 of the "Illinois Income Tax 51 

2 Act", approved July 1, 1969, as amended. 53 

3 Be it enacted by the People of the State of Illinois, 57 

4 represented in the General Assembly: 

5 Section 1. Section 203 of the "Illinois Income Tax Act", 60 

6 approved July 1, 1969, as amended, is amended to read as 61 

7 follows: 

(Ch. 120, par. 2-203) 63 

8 Sec. 203. Base income defined, (a) Individuals. 65 

9 (1) In general. In the case of an individual, base 67 

10 income means an amount equal to the taxpayer's adjusted gross 68 

11 income for the taxable year as modified by paragraph (2). 69 

12 (2) Modifications. The adjusted gross income referred 71 

13 to in paragraph (1) shall be modified by adding thereto the 72 

14 sum of the following amounts: 73 

15 (A) An amount equal to all amounts paid or accrued to 75 

16 the taxpayer as interest or dividends during the taxable year 76 

17 to the extent excluded from gross income in the computation 77 

18 of adjusted gross income, except stock dividends of qualified 78 

19 public utilities described in Section 305(e) of the Internal 79 

20 Revenue Code; 

21 (B) An amount equal to the amount of the deduction 81 

22 allowable under Section 1202 of the Internal Revenue Code, to 82 

23 the extent deducted from gross income in the computation of 83 

24 adjusted gross income; 

25 (C) An amount equal to the amount of tax imposed by this 85 

26 Act to the extent deducted from gross income in the 86 

27 computation of adjusted gross income for the taxable year; 87 

28 and 

29 (D) An amount equal to the amount received during the 89 

30 taxable year as a recovery or refund of real property taxes 90 

31 paid with respect to the taxpayer's principal residence under 91 

32 the Revenue Act of 1939 and for which a deduction was 92 

- 258 - 



-2- LRB8407710RLks 

1 previously taken under subparagraph (K) of this paragraph 93 

2 (2). In the case of multi-unit or multi-use structures and 

3 farm dwellings, the taxes on the taxpayer's principal 94 

4 residence shall be that portion of the total taxes for the 95 

5 entire property which is attributable to such principal 96 

6 residence; 

7 and by deducting from the total so obtained the sum of 98 

8 the following amounts^ r 

9 (E) Any amount included in such total in respect of any 100 

10 compensation (including but not limited to any compensation 101 

11 paid or accrued to a serviceman while a prisoner of war or 102 

12 missing in action) paid to a resident by reason of being on 103 

13 active duty in the Armed Forces of the United States and in 104 

14 respect of any compensation paid or accrued to a resident who 105 

15 as a governmental employee was a prisoner of war or missing 

16 in action, and in respect of any compensation paid to a 106 

17 resident in 1971 or thereafter for annual training performed 107 

18 pursuant to Sections 502 and 503, Title 32, United States 108 

19 Code as a member of the Illinois National Guard; 109 

20 (F) An amount equal to all amounts included in such 111 

21 total pursuant to the provisions of Sections 402(a), 402(c), 112 

22 402(d), 403(a), 403(b), 405(d), 406(a), 407(a), 408 and 409 113 

23 of the Internal Revenue Code, or included in such total as 114 

24 distributions under the provisions of any retirement or 115 

25 disability plan for employees of any governmental agency or 116 

26 unit, or retirement payments to retired partners, which 

27 payments are excluded in computing net earnings from self 117 

28 employment by Section 1402 of the Internal Revenue Code and 118 

29 regulations adopted pursuant thereto; 

30 (G) The valuation limitation amount; 120 

31 (H) An amount equal to the amount of any tax imposed by 122 

32 this Act which was refunded to the taxpayer and included in 123 

33 such total for the taxable year; 124 

34 ( I ) An amount equal to all amounts included in such 126 

35 total pursuant to the provisions of Section 111 of the 127 

- 259 - 



-3- LRB8407710RLks 

1 Internal Revenue Code as a recovery of items previously 128 

2 deducted from adjusted gross income in the computation of 129 

3 taxable income; 

4 (J) An amount equal to those dividends included in such 131 

5 total which were paid by a corporation which conducts 132 

6 business operations in an Enterprise Zone or zones created 133 

7 under the Illinois Enterprise Zone Act, and conducts 134 

8 substantially all of its operations in an Enterprise Zone or 

9 zones; 

10 (J-l) An amount equal to those dividends included in 136 

11 such total that were paid by a corporation that conducts 137 

12 business operations in a federally designated Foreign Trade 138 

13 Zone or Zones and that is designated a High Impact Business 139 

14 located in Illinois; provided that dividends eligible for the 

15 deduction provided in subparagraph (J) of paragraph (2) of 140 

16 this subsection shall not be eligible for the deduction 141 

17 provided under this subparagraph (J-l)£ t 

18 (K) An amount equal to the amount of real property taxes 143 

19 imposed and paid during the taxable year under the Revenue 144 

20 Act of 1939 on a taxpayer's principal residence to be called 145 

21 the "Homeowner's Property Tax Relief Deduction". In the case 146 

22 of multi-unit or multi-use structures and farm dwellings, the 147 

23 taxes on the taxpayer's principal residence shall be that 148 

24 portion of the total taxes which is attributable to such 

25 principal residence; 

26 (L) For taxable years ending after December 31, 1983, an 150 

27 amount equal to all social security benefits and railroad 151 

28 retirement benefits included in such total pursuant to 152 

29 Sections 72(r) and 86 of the Internal Revenue Code; 

30 (M) An amount equal to the sum of all amounts disallowed 154 

31 as deductions by Sections 171(a), (2), and 265(2) of the 155 

32 Internal Revenue Code of 1954, as now or hereafter amended, 156 

33 and all amounts of expenses allocable to interest and 157 

34 disallowed as deductions by Section 265(1) of the Internal 158 

35 Revenue Code of 1954, as now or hereafter amended; 

- 260 - 



-4- LRB8407710RLks 

1 fNt 160 

2 (N) fPf f9t An amount equal to 25% 25-pereente of all 162 

3 amounts paid or accrued on behalf of employees for 164 

4 educational or vocational training courses in semi-technical 

5 or technical fields or semi-skilled or skilled vocational 165 

6 fields and which were deducted from gross income in the 167 

7 computation of adjusted gross income; 168 

8 f?t 170 

9 (0) fQf An amount equal to all amounts included in such 172 

10 total which are exempt from taxation by this State either by 173 

11 reason of its Constitution or by reason of the Constitution, 174 

12 treaties or statutes of the United States; and 175 

13 (P) An amount equal to any contribution made to a job 177 

14 training project established pursuant to the "Real Property 178 

15 Tax Increment Allocation Redevelopment Act", certified 179 

16 January 10, 1977, as amended ; and r 

17 (Q) fR-)- An amount equal to the cost of any contribution 181 

18 made to a community-based organization pursuant to "An Act to 182 

19 award income tax deductions to businesses which contribute 183 

20 money or resources to community groups, amending certain Acts 184 

21 therein named". 

22 (b) Corporations. 186 

23 (1) In general. In the case of a corporation, base 188 

24 income means an amount equal to the taxpayer's taxable income 189 

25 for the taxable year as modified by paragraph (2). 190 

26 (2) Modifications. The taxable income referred to in 192 

27 paragraph (1) shall be modified by adding thereto the sum of 193 

28 the following amounts: 

29 (A) An amount equal to all amounts paid or accrued to 195 

30 the taxpayer as interest during the taxable year to the 196 

31 extent excluded from gross income in the computation of 197 

32 taxable income; 

33 (B) An amount equal to the amount of tax imposed by this 199 

34 Act to the extent deducted from gross income in the 200 

35 computation of taxable income for the taxable year; 201 

- 261 - 



-5- LRB8407710RLks 

1 (C) In the case of a regulated investment company or 203 

2 real estate investment trust, an amount equal to the excess 204 

3 of (i) the net long-term capital gain for the taxable year, 205 

4 over (ii) the amount of the capital gain dividends 206 

5 attributable to the taxable year; 

6 (D) In the case of a Western Hemisphere trade 208 

7 corporation, China Trade Act corporation, or possessions 209 

8 company described in Section 931(a) of the Internal Revenue 210 

9 Code, an amount equal to the amount deducted or excluded from 211 

10 gross income in the computation of taxable income for the 212 

11 taxable year on account of the special deductions and 213 

12 exclusions (but in the case of a possessions company, net of 

13 the deductions allocable thereto) allowed such corporations 214 

14 under the Internal Revenue Code; 215 

15 (E) The amount of any net operating loss deduction taken 217 

16 in arriving at taxable income, other than a net operating 218 

17 loss carried forward from a taxable year ending prior to 219 

18 December 31, 1986; and 

19 (F) For taxable years in which a net operating loss 221 

20 carryback or carryforward from a taxable year ending prior to 222 

21 December 31, 1986 is an element of taxable income under 223 

22 paragraph (1) of subsection (e) or subparagraph (E) of 

23 paragraph (2) of subsection (e), the amount by which addition 224 

24 modifications other than those provided by this subparagraph 225 

25 (F) exceeded subtraction modifications in such earlier 226 

26 taxable year, with the following limitations applied in the 227 

27 order that they are listed: 

28 (i) the addition modification relating to the net 229 

29 operating loss carried back or forward to the taxable year 230 

30 from any taxable year ending prior to December 31, 1986 shall 231 

31 be reduced by the amount of addition modification under this 233 

32 subparagraph (F) which related to that net operating loss and 

33 which was taken into account in calculating the base income 234 

34 of an earlier taxable year, and 235 

35 (ii) the addition modification relating to the net 237 

- 262 - 



-6- LRB8407710RLks 

1 operating loss carried back or forward to the taxable year 238 

2 from any taxable year ending prior to December 31, 1986 shall 239 

3 not exceed the amount of such carryback or carryforward; 240 

4 For taxable years in which there is a net operating loss 242 

5 carryback or carryforward from more than one other taxable 243 

6 year ending prior to December 31, 1986, the addition 244 

7 modification provided in this subparagraph (F) shall be the 245 

8 sum of the amounts computed independently under the preceding 246 

9 provisions of this subparagraph (F) for each such taxable 247 

10 year, 

11 and by deducting from the total so obtained the sum of 249 

12 the following amounts: 250 

13 (G) An amount equal to the amount of any tax imposed by 252 

14 - this Act which was refunded to the taxpayer and included in 253 

15 such total for the taxable year; 254 

16 (H) An amount equal to any amount included in such total 256 

17 under Section 78 of the Internal Revenue Code; 257 

18 (I) In the case of a regulated investment company, an 259 

19 amount equal to the amount of exempt interest dividends as 260 

20 defined in subsection (b) (5) of Section 852 of the Internal 261 

21 Revenue Code, paid to shareholders for the taxable year; 262 

22 (J) An amount equal to the sum of all amounts disallowed 264 

23 as deductions by Sections 171(a), (2), and 265(2) and amounts 265 

24 disallowed as interest expense by Section 291(a)(3) of the 266 

25 Internal Revenue Code of 1954, as now or hereafter amended, 267 

26 and all amounts of expenses allocable to interest and 268 

27 disallowed as deductions by Section 265(1) of the Internal 269 

28 Revenue Code of 1954, as now or hereafter amended; 

29 (K) An amount equal to all amounts included in such 271 

30 total which are exempt from taxation by this State either by 272 

31 reason of its Constitution or by reason of the Constitution, 273 

32 treaties or statutes of the United States; 

33 (L) An amount equal to those dividends included in such 275 

34 total which were paid by a corporation which conducts 277 

35 business operations in an Enterprise Zone or zones created 

- 263 - 



-7- LRB8407710RLks 

1 under the Illinois Enterprise Zone Act, conducts 278 

2 substantially all of its operations in an Enterprise Zone or 279 

3 zones; 

4 (L-l), An amount equal to those dividends included in 281 

5 such total that were paid by a corporation that conducts 282 

6 business operations in a federally designated Foreign Trade 283 

7 Zone or Zones and that is designated a High Impact Business 284 

8 located in Illinois; provided that dividends eligible for the 

9 deduction provided in subparagraph (L) of paragraph 2 of this 285 

10 subsection shall not be eligible for the deduction provided 286 

11 under this subparagraph (L-l)^_ t 

12 (M) For any taxpayer that is a financial organization 288 

13 within the meaning of Section 304(c) of this Act, an amount 289 

14 included in such total as interest income from a loan or 290 

15 loans made by such taxpayer to a borrower, to the extent that 291 

16 such a loan is secured by property which is eligible for the 292 

17 Enterprise Zone Investment Credit. To determine the portion 293 

18 of a loan or loans that is secured by property eligible for a 294 

19 Section 201(h) investment credit to the borrower, the entire 295 

20 principal amount of the loan or loans between the taxpayer 296 

21 and the borrower should be divided into the basis of the 297 

22 Section 201(h) investment credit property which secures the 298 

23 loan or loans, using for this purpose the original basis of 299 

24 such property on the date that it was placed in service in 

25 the Enterprise Zone. The subtraction modification available 300 

26 to taxpayer in any year under this subsection shall be that 301 

27 portion of the total interest paid by the borrower with 302 

28 respect to such loan attributable to the eligible property as 

29 calculated under the previous sentence; 303 

30 (M-l) For any taxpayer that is a financial organization 305 

31 within the meaning of Section 304(c) of this Act, an amount 306 

32 included in such total as interest income from a lean or 307 

33 loans made by such taxpayer to a borrower, to the extent that 308 

34 such a loan is secured by property wh.ch is eligible for the 309 

35 High Impact Business Investment Credic. To determine the 

- 264 - 



-8- LRB8407710RLks 

1 portion of a loan or loans that is secured by property 310 

2, eligible for a Section 201(i) investment credit to the 311 

3 borrower, the entire principal amount of the loan or loans 312 

4 between the taxpayer and the borrower should be divided into 

5 the basis of the Section 201(i) investment credit property 313 

6 which secures the loan or loans, using for this purpose the 314 

7 original basis of such property on the date that it was 315 

8 placed in service in a federally designated Foreign Trade 316 

9 Zone or Zones located in Illinois. No taxpayer that is 

10 eligible for the deduction provided in subparagraph (M) of 317 

11 paragraph (2) of this subsection shall be eligible for the 318 

12 deduction provided under this subparagraph (M-l). The 319 

13 subtraction modification available to taxpayers in any year 320 

14 under this subsection shall be that portion of the total 

15 interest paid by the borrower with respect to such loan 321 

16 attributable to the eligible property as calculated under the 323 

17 previous sentence; 

18 (N) Two times any contribution made during the taxable 325 

19 year to a designated zone organization to the extent that the 326 

20 contribution (i) qualifies as a charitable contribution under 327 

21 subsection (c) of Section 170 of the Internal Revenue Code 328 

22 and (ii) must, by its terms, be used for a project approved 329 

23 by the Department of Commerce and Community Affairs under 330 

24 Section 11 of the Illinois Enterprise Zone Act; 

25 (0) An amount equal to: (i) 85% of the amount by which 332 

26 dividends included in taxable income and received from a 333 

27 corporation that is not created or organized under the laws 334 

28 of the United States or any state or political subdivision 335 

29 thereof exceed the amount of the modification provided under 

30 subparagraph (H) of paragraph (2) of this subsection (b) 336 

31 which is related to such dividends; plus (ii) 100% of the 337 

32 amount by which dividends, included in taxable income and 338 

33 received from any such corporation specified in clause (i) 339 

34 that would but for the provisions of Section 1504 (b) (3) of 

35 the Internal Revenue Code be treated as a member of the ' 340 

- 265 - 



-9- LRB8407710RLks 

1 affiliated group which includes the dividend recipient, 341 

2 exceed the amount of the modification provided under 342 

3 subparagraph (H) of paragraph (2) of this subsection (b) 

4 which is related to such dividends; t 343 

5 (P) An amount equal to 25% 25-percent of all amounts paid 345 

6 or accrued on behalf of employees for educational or 347 

7 vocational training courses in semi-technical or technical 348 

8 fields or semi-skilled or skilled vocational fields and which 349 

9 were deducted from gross income in the computation of taxable 

10 income; and 350 

11 (Q) An amount equal to any contribution made to a job 352 

12 training project established pursuant to the "Real Property 353 

13 Tax Increment Allocation Redevelopment Act", certified 354 

14 January 10, 1977, as amended ; and t 

15 (R) An amount equal to the cost of any contribution made 356 

16 to a community-based organization pursuant to "An Act to 357 

17 award income tax deductions to businesses which contribute 358 

18 money or resources to community groups, amending certain Acts 359 

19 therein named". 

20 (3) Special rule. For purposes of paragraph (2) (A), 361 

21 "gross income" in the case of a life insurance company shall 362 

22 mean the company's share of the gross investment income for 363 

23 the taxable year. 

24 (c) Trusts and estates. 365 

25 (1) In general. In the case of a trust or estate, base 367 

26 income means an amount equal to the taxpayer's taxable income 368 

27 for the taxable year as modified by paragraph (2). 369 

28 (2) Modifications. Subject to the provisions of 371 

29 paragraph (3), the taxable income referred to in paragraph 372 

30 (1) shall be modified by adding thereto the sum of the 373 

31 following amounts: 

32 (A) An amount equal to all amounts paid or accrued to 375 

33 the taxpayer as interest or dividends during the taxable year 376 

34 to the extent excluded from gross income in the computation 377 

35 of taxable income; 

- 266 - 



-10- LRB8407710RLks 

1 (B) An amount equal to the amount of the deduction 379 

2 allowable under Section 1202 of the Internal Revenue Code, to 381 

3 the extent deducted from gross income in the computation of 382 

4 taxable income , provided the amount of any deduction 383 

5 allowable under Section 1202 of the Internal Revenue Code 

6 which would otherwise be required to be added to the taxable 38 4 

7 income of a trust or estate pursuant to this paragraph (B) 38 5 

8 shall be reduced by the amount thereof which relates to 386 

9 capital gain income for which the trust or estate is entitled 387 

10 to a charitable deduction under Section 642(c) of the 

11 Internal Revenue Code ; 

12 (C) In the case of (i) an estate, $600; (ii) a trust 389 

13 which, under its governing instrument, is required to 390 

14 distribute all of its income currently, $300; and (iii) any 391 

15 other trust, $100, but in each such case, only to the extent 392 

16 such amount was deducted in the computation of taxable 393 

17 income; 

18 (D) An amount equal to the amount of tax imposed by this 395 

19 Act to the extent deducted from gross income in the 396 

20 computation of taxable income for the taxable year; 397 

21 (E) The amount of any net operating loss deduction taken 399 

22 in arriving at taxable income, other than a net operating 400 

23 loss carried forward from a taxable year ending prior to 401 

24 December 31, 1986; and 

25 (F) For taxable years in which a net operating loss 403 

26 carryback or carryforward from a taxable year ending prior to 404 

27 December 31, 1986 is an element of taxable income under 405 

28 paragraph (1) of subsection (e) or subparagraph (E) of 

29 paragraph (2) of subsection (e), the amount by which addition 406 

30 modifications other than those provided by this subparagraph 407 

31 (F) exceeded subtraction modifications in such taxable year, 408 

32 with the following limitations applied in the order that they 409 

33 are listed: 

34 (i) the addition modification relating to the net 411 

35 operating loss carried back or forward to the taxable year 412 

- 267 - 



-11- LRB8407710RLks 

1 from any taxable year ending prior to December 31, 1986 shall 413 

2 be reduced by the amount of addition modification under this 415 

3 subparagraph (F) which related to that net operating loss and 

4 which was. taken into account in calculating the base income 416 

5 of an earlier taxable year, and 417 

6 (ii) the addition modification relating to the net 419 

7 operating loss carried back or forward to the taxable year 420 

8 from any taxable year ending prior to December 31, 1986 shall 421 

9 not exceed the amount of such carryback or carryforward; 422 

10 For taxable years in which there is a net operating loss 424 

11 carryback or carryforward from more than one other taxable 425 

12 year ending prior to December 31, 1986, the addition 426 

13 modification provided in this subparagraph (F) shall be the 427 

14 sum of the amounts computed independently under the preceding 428 

15 provisions of this subparagraph (F) for each such taxable 430 

16 year, 

17 and by deducting from the total so obtained the sum of 432 

18 the following amounts: 433 

19 (G) An amount equal to all amounts included in such 435 

20 total pursuant to the provisions of Sections 402(a), 402(c), 436 

21 402(d), 403(a), 403(b), 405(d), 406(a), 407(a), 408 and 409 437 

22 of the Internal Revenue Code or included in such total as 438 

23 distributions under the provisions of any retirement or 439 

24 disability plan for employees of any governmental agency or 440 

25 unit, or retirement payments to retired partners, which 

26 payments are excluded in computing net earnings from self 441 

27 employment by Section 1402 of the Internal Revenue Code and 442 

28 regulations adopted pursuant thereto; 

29 (H) The valuation limitation amount; 444 

30 ( I ) An amount equal to the amount of any tax imposed by 446 

31 this Act which was refunded to the taxpayer and included in 447 

32 such total for the taxable year; 448 

33 (J) An amount equal to ail amounts included ir. taxable 450 

34 income as modified by subparagraphs (A), (3), (C), (D), (E) 451 

35 and (F) which are exempt from taxation by this State either 452 

- 268 - 



-12- LRB8407710RLks 

1 by reason of its Constitution or by reason of the 453 

2 Constitution, treaties or statutes of the United States; 

3 (K) An amount equal to the sum of all amounts disallowed 455 

4 as deductions by Sections 171(a), (2) and 265(2) and amounts 456 

5 disallowed as interest by Section 291(a)(3) of the Internal 457 

6 Revenue Code of 1954, as now or hereafter amended, and all 458 

7 amounts of expenses allocable to interest and disallowed as 459 

8 deductions by Section 265(1) of the Internal Revenue Code of 460 

9 1954, as now or hereafter amended; 

10 (L) An amount equal to those dividends included in such 462 

11 total which were paid by a corporation which conducts 464 

12 business operations in an Enterprise Zone or zones created 

13 under the Illinois Enterprise Zone Act, conducts 465 

14 substantially all of its operations in an Enterprise Zone or 466 

15 Zones; and 

16 (M) An amount equal to any contribution made to a job 468 

17 training project established pursuant to the "Real Property 469 

18 Tax Increment Allocation Redevelopment Act", certified 470 

19 January 10, 1977, as amended^. - 

20 (N) fMf An amount equal to the cost of any contribution 472 

21 made to a community-based organization pursuant to "An Act to 473 

22 award income tax deductions to businesses which contribute 474 

23 money or resources to community groups, amending certain Acts- 475 

24 therein named" ; and t 

25 (0) fMf An amount equal to those dividends included in 477 

26 such total that were paid by a corporation tnat conducts 478 

27 business operations in a federally designated foreign Trade 479 

28 Zone or Zones and that is designated a High Impact Business 480 

29 located in Illinois; provided that dividends eligible for the 481 

30 deduction provided in subparagraph (L) of paragraph (2) of 

31 this subsection shall not be eligible for the deduction 482 

32 provided under this subparagraph (0) fMf. 483 

33 (3) Limitation. The amount of any modification 485 

34 otherwise required under this subsection shall, under 486 

35 regulations prescribed by the Department, be adjusted by any 487 

- 269 - 



-13- LRB8407710RLks 

1 amounts included therein which were properly paid, credited, 488 

2 or required to be distributed for the taxable year. 

3 (d) Partnerships. 490 

4 (1) In general. In the case of a partnership, base 492 

5 income means an amount equal to the taxpayer's taxable income 493 

6 for the taxable year as modified by paragraph (2). 494 

7 (2) Modifications. The taxable income referred to in 496 

8 paragraph (1) shall be modified by adding thereto the sum of 497 

9 the following amounts: 

10 (A) An amount equal to all amounts paid or accrued to 499 

11 the taxpayer as interest or dividends during the taxable year 500 

12 to the extent excluded from gross income in the computation 501 

13 of taxable income; 

14 (B) An amount equal to the amount of the deduction 503 

15 allowed under Section 1202 of the Internal Revenue Code, to 504 

16 the extent deducted from gross income in the computation of 505 

17 taxable income; 

18 (C) An amount equal to the amount of tax imposed by this 507 

19 Act to the extent deducted from gross income for the taxable 508 

20 year; and 

21 (D) The amount of deductions allowed to the partnership 510 

22 pursuant to Section 707 (c) of the Internal Revenue Code in 511 

23 calculating its taxable income; 

24 and by deducting from the total so obtained the following 513 

25 amounts: 

26 (E) The valuation limitation amount; 515 

27 (F) An amount equal to the amount of any tax imposed by 517 

28 this Act which was refunded to the taxpayer and included in 518 

29 such total for the taxable year; 

30 (G) An amount equal to all amounts included in taxable 520 

31 income as modified by subparagraphs (A), (B), (C) and (D) 521 

32 which are exempt from taxation by chis Stace either by reason 522 

33 of its Constitution or by reason of the Constitution, 523 

34 treaties or statutes of the United States; 

35 (H) Any income of the partnership which constitutes 525 



270 



-14- LRB8407710RLks 

1 personal service income as defined in Section 1348 (b) (1) of 526 

2 the Internal Revenue Code (as in effect December 31, 1981) or 527 

3 a reasonable allowance for compensation paid or accrued for 528 

4 services rendered by partners to the partnership, whichever 529 

5 is greater; 

6 (I) An amount equal to all amounts of income 531 

7 distributable to an entity subject to the Personal Property 532 

8 Tax Replacement Income Tax imposed by subsections (c) and (d) 533 

9 of Section 201 of this Act; 

10 (J) An amount equal to the sum of all amounts disallowed 535 

11 as deductions by Sections 171(a), (2), and 265(2) of the 536 

12 Internal Revenue Code of 1954, as now or hereafter amended, 537 

13 and all amounts of expenses allocable to interest and 538 

14 disallowed as deductions by Section 265(1) of the Internal 539 

15 Revenue Code of 1954, as now or hereafter amended; 

16 (K) An amount equal to those dividends included in such 541 

17 total which were paid by a corporation which conducts 542 

18 business operations in an Enterprise Zone or zones created 543 

19 under the Illinois Enterprise Zone Act, enacted by the 82nd 544 

20 General Assembly, and which does not conduct such operations 545 

21 other than in an Enterprise Zone or Zones; and 546 

22 (L) An amount equal to any contribution made to a job 548 

23 training project established pursuant to the "Real Property 549 

24 Tax Increment Allocation Redevelopment Act", certified 550 

25 January 10, 1977, as amendedj_ t 

26 (M) f&t An amount equal to the cost of any contribution 552 

27 made to a community-based organization pursuant to "An Act to 553 

28 award income tax deductions to businesses which contribute 554 

29 money or resources to community groups, amending certain Acts 555 

30 therein named" ; and - 

31 (N) fhj An amount equal to those dividends included in 557 

32 such total that were paid by a corporation that conducts 558 

33 business operations in a federally designated Foreign Trade 559 

34 Zone or Zones and that is designated a High Impact Business 560 

35 located in Illinois; provided that dividends eligible for the 561 

- 271 - 



-15- LRB8407710RLks 

1 deduction provided in subparagraph (K) of paragraph (2) of 561 

2 this subsection shall not be eligible for the deduction 562 

3 provided under this subparagraph (N) f&f. 563 

4 (e) .Gross income; adjusted gross income; taxable income. 565 

5 (1) In general. Subject to the provisions of paragraph 567 

6 (2) and subsection (b) (3), for purposes of this Section and 568 

7 Section 802(b), a taxpayer's gross income, adjusted gross 569 

8 income, or taxable income for the taxable year shall mean the 570 

9 amount of gross income, adjusted gross income or taxable 571 

10 income properly reportable for federal income tax purposes 572 

11 for the taxable year under the provisions of the Internal 573 

12 Revenue Code. Taxable income may be less than zero. For 574 

13 taxable years ending prior to December 31, 1986, taxable 575 

14 income may never be an amount in excess of the net operating 576 

15 loss for the taxable year as defined in subsections (c) and 577 

16 (d) of Section 172 of the Internal Revenue Code, provided 578 

17 that when taxable income of a corporation (other than a 580 

18 Subchapter S corporation), trust, or estate is less than zero 582 

19 and addition modifications, other than those provided by 

20 subparagraph (F) of paragraph (2) of subsection (b) for 583 

21 corporations or subparagraph (F) of paragraph (2) of 584 

22 subsection (c) for trusts and estates, exceed subtraction 585 

23 modifications, an addition modification must be made under 

24 those subparagraphs for any other taxable year to which the 586 

25 taxable income less than zero (net operating loss) is applied 587 

26 under Section 172 of the Internal Revenue Code or under 588 

27 subparagraph (E) of paragraph (2) of this subsection (e) 

28 applied in conjunction with Section 172 of the Internal 589 

29 Revenue Code. 

30 (2) Special rule. For purposes of paragraph (1) of this 591 

31 subsection, the taxable income properly reportable for 592 

32 federal income tax purposes shall mean: 593 

33 (A) Certain life insurance companies. In the case of a 595 

34 life insurance company subject to the cax imposed by Section 596 

35 801 of the Internal Revenue Code, life insurance company 597 

- 272 - 



-16- LRB8407710RLks 

1 taxable income; 597 

2 (B) Certain mutual insurance companies. In the case of 599 

3 a mutual insurance company subject to the tax imposed by 600 

4 Section 821(a) or (c) of the Internal Revenue Code, mutual 501 

5 insurance company taxable income or taxable investment 602 

6 income, as the case may be; 

7 (C) Regulated investment companies. In the case of a 604 

8 regulated investment company subject to the tax imposed by 605 

9 * Section 852 of the Internal Revenue Code, investment company 606 

10 taxable income; 

11 (D) Real estate investment trusts. In the case of a 608 

12 real estate investment trust subject to the tax imposed by 609 

13 Section 857 of the Internal Revenue Code, real estate 610 

14 investment trust taxable income; 

15 (E) Consolidated corporations. In the case of a 612 

16 corporation which is a member of an affiliated group of 613 

17 corporations filing a consolidated income tax return for the 614 

18 taxable year for federal income tax purposes, taxable income 615 

19 determined as if such corporation had filed a separate return 616 

20 for federal income tax purposes for the taxable year and each 

21 preceding taxable year for which it was a member of an 617 

22 affiliated group. For purposes of this subparagraph, the 618 

23 taxpayer's separate taxable income shall be determined as if 619 

24 the election provided by Section 243(b) (2) of the Internal 620 

25 Revenue Code had been in effect for all such years; 621 

26 (F) Cooperatives. In the case of a cooperative 623 

27 corporation or association, the taxable income of such 624 

28 organization determined in accordance with the provisions of 625 

29 Section 1381 through 1388 of the Internal Revenue Code; 626 

30 (G) Subchapter S corporations. In the case of: (i) a 628 

31 Subchapter S corporation for which there is in effect an 529 

32 election for the taxable year under Section 1362 of the 630 

33 Internal Revenue Code, the taxable income of such corporacion 631 

34 determined in accordance with Section 1363(b) of the Internal 

35 Revenue Code, except that taxable income shall take into 633 



- 273 



-17- LRB8407710RLks 

1 account those items which are required by Section 1363(b)(1) 633 

2 of the Internal Revenue Code to be separately stated; and 634 

3 (ii) a Subchapter S corporation for which there is in effect 635 

4 a federal election to opt out of the provisions of the 636 

5 Subchapter S Revision Act of 1982 and have applied instead 637 

6 the prior federal Subchapter S rules as in effect on July 1, 

7 1982, the taxable income of such corporation determined in 638 

8 accordance with the federal Subchapter S rules as in effect 639 

9 on July 1, 1982; and 

10 (H) Partnerships. In the case of a partnership, taxable 641 

11 income determined in accordance with Section 703 of the 642 

12 Internal Revenue Code, except that taxable income shall take 643 

13 into account those items which are required by Section 644 

14 703(a)(1) to be separately stated but which would be taken 

15 into account by an individual in calculating his taxable 645 

16 income. 

17 (f) Valuation limitation amount. 647 

18 (1) In general. The valuation limitation amount 649 

19 referred to in subsections (a) (2) (G) and (c) (2) (H) is an 650 

20 amount equal to: 

21 (A) The sum of the pre-August 1, 1969 appreciation 652 

22 amounts (to the extent consisting of gain reportable under 653 

23 the provisions of Section 1245 or 1250 of the Internal 654 

24 Revenue Code) for all property in. respect of which such gain 655 

25 was reported for the taxable year; plus 

26 (B) The lesser of (i) the sum of the pre-August 1, 1969 657 

27 appreciation amounts (to the extent consisting of capital 658 

28 gain) for all property in respect of which such gain was 659 

29 reported for federal income tax purposes for the taxable 660 

30 year, or (ii) the net capital gain for the taxable year, 661 

31 reduced in either case by any amount of such gain included in 

32 the amount determined under subsection (a) (2) (F) or (c) (2) 662 

33 (G). 

34 (2) Pre-August 1, 1969 appreciation amount. 664 

35 (A) If the fair market value of property referred to in 656 

- 274 - 



-18- LRB8407710RLks 

1 paragraph (1) was readily ascertainable on August 1, 1959, 667 

2 the pre-August 1, 1969 appreciation amount for such property 668 

3 is the lesser of (i) the excess of such fair market value 569 

4 ever the taxpayer's basis (for determining gain) for such 670 

5 property on that date (determined under the Internal Revenue 

6 Code as in effect on that date), or (ii) the total gain 671 

7 realized and reportable for federal income tax purposes in 672 

8 respect of the sale, exchange or other disposition of such 673 

9 property. 

10 (B) If the fair market value of property referred to in 675 

11 paragraph (1) was not readily ascertainable, on August 1, 676 

12 1969, the pre-August 1, 1969 appreciation amount for such 677 

13 property is that amount which bears the same ratio to the 678 

14 total gain reported in respect of the property for federal 679 

15 income tax purposes for. the taxable year, as the number of 

16 full calendar months in that part of the taxpayer's holding 580 

17 period for the property ending July 31, 1969 bears to the 681 

18 number of full calendar months in the taxpayer's 682 

19 entire-holding period for the property. 

20 (C) The Department shall prescribe such regulations as 684 

21 may be necessary to carry out the purposes of this paragraph. 685 

22 (g) Double deductions. Nothing in this Section shall 687 

23 permit the same item to be deducted more than once. 688 

24 (h) Legislative intention. Except as expressly provided 690 

25 by this Section, there shall be no modifications or 691 

26 limitations on the amounts of income, gain, loss or deduction 692 

27 taken into account in determining gross income, adjusted 693 

28 gross income or taxable income for federal income tax 694 

29 purposes for the taxable year, or in the amount of such items 

30 entering into the computation of base income and net income 695 

31 under this Act for such taxable year, whether in respect of 696 

32 property values as of August 1, 1969 or otherwise. 598 

33 Section 2. This Act shall take effect upon becoming a 700 

34 law and shall apply to all taxable years ending on or after 701 

35 its effective date. 



275 - 



- 276 



BILL 15 



Background 

The Joint Committee on Administrative Rules objected to a Secretary of State 
rule (92 III. Adm. Code 1010) which, commencing with the 1986 registration 
year, entitled the spouses, widows, and widowers of claimants eligible under 
Section 3-806.3 of the Illinois Vehicle Code (III. Rev. Stat. 1984 Supp., ch. 
95£, par. 3-806.3) to a 50% reduction in vehicle registration fees. The 
Committee objected because the Secretary lacks any statutory authority to 
grant such a discount. Section 3-806.3 of the Code explicitly states that the 
reduced fee is available to any vehicle owner who is eligible to claim a grant. 
The Joint Committee developed this legislation which will authorize the 
Secretary of State to allow a vehicle registration discount for the spouses, 
widows, and widowers of qualified claimants for one year. 

Summary 

Amends Section 3-806.3 of the Illinois Vehicle Code (III. Rev. Stat. 1984 
Supp., ch. 95i, par. 3-806.3, as amended by P. A. 84-832, effective 
September 23, 1985), to allow a vehicle registration discount for the spouses, 
widows, and widowers of claimants eligible under this section for one year. 
Effective immediately. 



196 



- 277 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Ch. 95 1/2, par. 3-806.3) 

Amends The Illinois Vehicle Code. Permits a 
50% reduction in registration fees for certain vehicles for 
the spouses, widows and widowers of persons eligible to claim 
a grant under the Senior Citizens and Disabled Persons 
Property Tax Relief and Pharmaceutical Assistance Act. 
Provides that no more than one reduced registration fee shall 
be allowed during any 12 month period based on the primary 
eligibility of any individual, whether such reduced 
registration fee is allowed to the individual or to the 
spouse, widow or widower of such individual. Effective 
immediately. 



LRB8407575SFtC 



Fiscal Note Act 
may be applicable 



A BILL FOR 



LRB8407575SFtC 

1 AN ACT to amend Section 3-806.3 of "The Illinois Vehicle 63 

2 Code", approved September 29, 1969, as amended. 65 

3 Be it enacted by the People of the State of Illinois, 6 9 

4 represented in the General Assembly: 

5 Section 1. Section 3-806.3 of "The Illinois Vehicle 71 

6 Code", approved September 29, 1969, as amended, is amended to 72 

7 read as follows: 

(Ch. 95 1/2, par. 3-806.3) 74 

8 Sec. 3-806.3. Commencing with the 1986 registration 76 

9 year, the registration fee paid by any vehicle owner who is 77 

10 eligible to claim a grant under the "Senior Citizens and 78 

11 Disabled Persons Property Tax Relief and Pharmaceutical 79 

12 Assistance Act" or who is the spouse of a person so eligible 

13 shall be reduced by 50% for passenger cars displaying 81 

14 standard multi-year registration plates issued under Section 82 

15 3-414.1, motor vehicles displaying special registration 83 

16 plates issued under Section 3-616, motor vehicles registered 84 

17 at 8,000 pounds or less under Section 3-815(a) and 85 

18 recreational vehicles registered at 8,000 pounds or less 

19 under Section 3-815(b). Widows and widowers of claimants 86 

20 shall also be entitled to the reduced registration rate for 87 

21 the registration year in which the claimant was eligible. 

22 No vehiele-owner-shail — be — entitled — to more than one 90 

23 reduced registration fee under this Section shall be allowed 91 

24 during any 12 month period based on the primary eligibility 92 

25 of any individual, whether such reduced registration fee is 9 3 

26 allowed to the individual or to the spouse, widow or widower 9 4 

27 of such individual . The reduction shall not apply to the fee 96 

28 paid in addition to the registration fee for motor vehicles 97 

29 displaying personalized license plates under Section 3-806.1. 

30 Section 2. This Act takes effect upon its becoming a law. 10( 



280 



RILL 16 



Background 



In 1984, the Joint Committee on Administrative Rules issued a number of 
objections to the Department of Labor's proposed rules entitled "Toxic 
Substances Disclosure to Employees." Specifically, the Joint Committee 
objected to the Department's lack of statutory authority to: (1) exempt 
employers from the labeling requirements of Section 8 of the Toxic Substances 
Disclosure to Employees Act (Act) if the employer has made a "good faith 
effort" to obtain a label; (2) and (3) exempt small businesses and certain 
products from the labeling requirements of Section 8 of the Act; (4) exempt 
sealed packages containing toxic materials from the labeling provisions of 
Section 8 of the Act; (5) place substances included in Material Safety Data 
Sheets in a "Proposed Revised Toxic Substance Disclosure to Employees List" 
and not on the "Toxic Substances List" as required by Section 5 of the Act; 
(6) establish a Technical Advisory Panel to recommend additions to or 
deletions from the Toxic Substance List; (7) establish the hearing procedures 
contained in its rules. 

The remaining objection was issued to the Department's rules because they 
failed to provide standards for the exercise of agency discretion as required 
by Section 4.02 of the Illinois Administrative Procedure Act in determining 
what common names will be accepted by the Department in identifying toxic 
substances for labeling purposes. In each instance, the Joint Committee 
recommended that legislation be initiated to provide the Department of Labor 
with the authority it needs to carry out the Toxic Substance Disclosure to 
Employees Act. In addition, in 1985, the Joint Committee issued a second 
recommendation regarding the Department's hearing procedures. 

The Joint Committee has also recommended that legislation be drafted to 
authorize the Department to implement the Act as its rules provide. 

Summary 

Amends Sections 4, 5, and 8 of the Toxic Substances Disclosure to Employees 
Act (III. Rev. Stat. 1983, ch. 48, par. 1401 et seq., as amended) to provide 
the Department of Labor with the statutory authority necessary to: (1) 
exempt employers from certain labeling requirements of the "Toxic Substances 
Disclosure to Employees Act"; (2) provide hearing procedures for additions to 
and deletions from the Toxic Substances List; and (3) establish a Technical 
Advisory Panel for the purpose of recommending additions to or deletions from 
the Toxic Substances List. Effective immediately. 



2.47 



281 



82 



Legislative Drafting Request 



Summary 



Amend Sections 4, 5, and 8 of the Toxic Substances Disclosure to 
Employees Act (III. Rev. Stat. 1983, ch. 48, par. 1401 et seq., as amended) 
to provide the Department of Labor with the statutory authority necessary to: 
(1) exempt employers from certain labeling requirements of the "Toxic 
Substances Disclosure to Employees Act"; (2) provide hearing procedures for 
additions to and deletions from the Toxic Substances List; and (3) establish a 
Technical Advisory Panel for the purpose of recommending additions to or 
deletions from the Toxic Substances List. 



Drafting Notes 

Section 1. Amend Sections 4, 5 and 8 as follows: 

(ch. 48, pars. 1404, 1405 and 1408) 

Section 4. (a) The Director shall establish a list of toxic substances 
promulgated by regulation after holding a public hearing. The Director shall 
hold at least one sueh preliminary hearing and one final hearing per year 
prior to amending the Toxic Substances List . 

(b) Any employer, employee, or employee representative may petition the 
Director to add any substance to the list of toxic substances or to delete a 
toxic substance from the list. The Director shall promulgate rules to 
establish an orderly procedure for presenting such a petition. 

(c) The Director may establish a Technical Advisory Panel for the 
purpose of recommending additions to, and deletions from, the Toxic 
Substance List. The panel shall be comprised of representatives from 
manufacturing and labor who shall serve without compensation but will be 
reimbursed for their expenses . 

(d) fe} The Director shall publish notice in the Illinois Register of any 
preliminary hearing held under this Section at least 30 days prior to such 
hearing . The Director shall publish notice of any— sueh the final hearing in 
the Illinois Register at least 90 days before the hearing date. 

(e) feB At the heartng hearings , the Director shall hear testimony and 
take documentary evidence concerning the addition of substances to the list. 
Any person may testify and present evidence. The Director shall take all 
testimony and evidence into consideration. If the Director determines that a 
substance poses a significant risk to human health when used in the 
workplace he shall add the substance to the list of toxic substances. 
Otherwise, the substance shall not be added. At the same h«er+Rg hearings , 
the Director shall hear testimony and take evidence concerning the deletion of 
substances from the list. If the Director determines that a substance does 
not pose any significant risk to human health when used in the workplace, he 
shall delete the substance form from the list of toxic substances. 



- 283 - 



(f) fe} The Director shall, within 30 days of the effective date of this 
Act, pttbits-hed publish in the Illinois Register, pursuant to Section 5.01 of 
the Illinois Administrative Procedure Act, the names of all substances, 
compounds or mixtures which are defined as "toxic substances" under Section 
3ff-)im_Hi), 3fh) JjrOCii) and 3f h) (m) (iii) . Whenever the Director adds or 
deletes substances from the list of toxic substances promulgated by 
regulation, he shall, within 30 days of making such additions or deletions, 
pt*fcH4s-hed publish in the Illinois Register, pursuant to Section 5.01 of the 
Illinois Administrative Procedure Act, the names of all substances defined as 
toxic substances under Section 3ff) (m) (i) , 3ff) (m) (ii) , 3 ft-) (m) (iii) and 
3ft-) (m) (iv). The Director shall mail a copy of the current list of toxic 
substances to any employer, employee or employee representative upon 
request. The Director may charge a reasonable fee to cover the costs of 
reproduction and mailing of the list. 

(g) ff) The provisions of this Act shall become effective with respect to 
any substance, compound or mixture defined as a toxic substance under 
Section 3ff) (m)(i) , 3ff)(m)(ii), 3ff)(m)(iii) and 3ff)(m)(iv), upon filing 
unless a later effective date is specified in the rule, pursuant to Section 
4(e). 

Section 5. (a) Every employer shall submit to the Director, within 6 
months of the effective date of this Act and annually thereafter, an 
alphabetized list of substances, compounds or mixtures for which the employer 
has acquired material safety data sheets. All substances listed on the 
material safety data sheets submitted to the Director which are not listed on 
the Toxic Substances List shall be placed on a Proposed Revised Toxic 
Substances List and subject to the hearing procedures established by the 
Director for such additions, pursuant to Section 4 of this Act . 

(b) Every manufacturer, importer or supplier of substances, compounds 
or mixtures shall submit to the Director, within 6 months of the effective date 
of this Act and annually thereafter, every Material Safety Data Sheet that it 
has compiled or acquired, along with an alphabetized list of such material 
safety data sheets. All substances listed on such material safety data sheets 
submitted to the Director which are not listed on the Toxic Substances List 
shall be placed on the Proposed Revised Toxic Substances List and subject~to 
the hearing procedures established by the Director for such additiohsT 
pursuant to Section 4 of this Act . 

(c) The Director shall publish a list of all substances described in 
Material Safety Data Sheets submitted by an employer, manufacturer, importer 
or supplier under this Section. The Director shall publish this list, 
hereinafter referred to as an "MSDS list", in the Illinois Register at least 90 
days before a the final hearing held pursuant to Section 4 above. The 
publication shall state that any substance identified in an MSDS list will be 
automatically added to the H-s-t—of— to*ie — substances Proposed Revised Toxic 
Substances List promulgated by the Director under Section 4. 

Section 8. (a) Except as otherwise provided by this Section, the 
employer shall label with the chemical name and appropriate hazard warnings 
each container of a toxic substance in the workplace. An employer shall be 
deemed to have made a good faith effort to label each container of a toxic 

- 284 - 



substance if the manufacturer importer, or supplier of the substance fails to 
provide the employer with labels within 30 days of a request, in accordance 
with Section 11(a) of this Act and if the employer has filed a complaint with 
the Department in accordance with Section 17(a) of this Act. The employer is 
not required to tabel any container of ten gallons or less in volume into which 
a toxic substance or mixture is transferred by the employee form from 
labelled containers and which is intended only for the immediate use of the 
employee who performs the transfer. No employer shall be required to label 
any container which is sealed when it arrives at the workplace if it remains 
sealed until it is sold or transferred . 

(b) The employer may post signs, placards or operating instructions to 
convey the required information as specified in Section 8(a) rather than 
affixing labels to each fixed container. For purposes of this paragraph, 
"fixed container" shall mean a pipe, piping system, reaction vessel or storage 
tank. All containers which are not fixed containers must individually 
labelled. The employer shall provide at least one sign, placard or set of 
operating instructions readily accessible to each employee in the employee's 
work area. 

(c) The employer shall ensure that each label, sign, placard or set of 
operating instructions required by this Section is prominently affixed and 
displayed in such a manner that employees can easily identify the toxic 
substances present. 

(d) The employer need not affix new labels if existing labels already 
convey the necessary information required by this Section. 

(e) This Section shall not apply to containers into which products 
registered pursuant to the Federal Insecticide, Fungicide and Rodenticide 
Act, as amended, are transferred to form use-dilutions at a mixing/loading 
site for use within a 12 hour period. All labeling information required for 
such products by the Federal Insecticide, Fungicide and Rodenticide Act must 
be posted in a prominent location at the mixing/loading site. 

(f) "Small businesses" as defined by Section 3.10 of the Illinois 
Administrative Procedure Act shall be exempt from the labeling requirements 
of this Act if the employer has requested from the manufacturer, importer "or 
supplier by certified mail a label for a substance purchased after June 30, 
1984 if a copy of the request is submitted to the Illinois Department of Labor 
and the label is not received . 

(g) The Department may exempt, by rule, certain substances from the 
requirements of this Section . 

(h) ff) This Section shall become effective with respect to any toxic 
substance upon filing, unless a later effective date is specified in the rule, 
pursuant to Section 4(e) of this Act. 

Section 2. This Act shall take effect upon becoming law. 



BPJ:ss:247:ldraft 



285 



?36 - 



RILL 17 



Background 

This proposal has been drafted in response to a Joint Committee on 
Administrative Rules recommendation that a clarification of the relationship 
between Section 9.1(c) of the Environmental Protection Act and the Illinois 
Administrative Procedure Act is needed. 

Pursuant to Section 9.1(c) of the Environmental Protection Act, the Pollution 
Control Board is required to adopt rules which are identical in substance to 
federal regulations promulgated by the United States Environmental Protection 
Agency, implementing Sections 111 and 112 of the United States Clean Air 
Act. According to Section 9.1(c), these rules must be adopted by the 
Pollution Control Board at the "next scheduled Board meeting following the 
promulgation of the corresponding federal regulations and filed with the 
Secretary of State in accordance with the Illinois Administrative Procedure Act 
therein 60 days thereafter." 

It has been the practice of the Board to comply with this Section by 
incorporating by reference all amendments and corrections that the United 
States Environmental Protection Agency promulgates in regard to the rules 
which implement the Clean Air Act. The Board submitted these incorporations 
by reference to the Secretary of State through the peremptory rulemaking 
procedure of Section 5.03 of the Illinois Administrative Procedure Act. 
However, these rulemakings do not strictly comply with the literal 
requirements of Section 5.03 of the Act, and by virtue of the 60 day 
requirement, are precluded from complying with Section 5.02 of the Illinois 
Administrative Procedure Act (Emergency rulemaking). Therefore, the Joint 
Committee, in consultation with the Pollution Control Board, agreed that the 
Environmental Protection Act should be amended to allow the Board to adopt 
rules identical to federal regulations under Section 111 and 112 of the federal 
Clean Air Act. This legislative proposal also deletes the provisions relating 
to rules regarding pollution sources in non-attainment areas. 

Summary 

Amends Section 9.1, 39 and 40 of the Environmental Protection Act (III. Rev. 
Stat. 1983, ch. 111| par. 1009.1, 1039, and 1040) to delete provisions 
requiring the Pollution Control Board to adopt rules identical to federal 
regulations under Sections 111 and 112 of the federal Clean Air Act and 
to delete provisions relating to rules regarding pollution sources in 
non-attainment areas. Effective immediately. 



022p 



287 



288 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Os. Ill 1/2 , pars. 1009.1, 1039 and 1040) 

Amends the Environmental Protection Act to 
delete provisions requiring the Pollution Control Board to 
adopt rules identical to federal regulations under Sections 
111 and 112 of the federal Clean Air Act; deletes provisions 
relating to rules regarding pollution sources in 
nonattainment areas. Effective immediately. 



LRB8407896EGl<s 



A BILL FOR 



28? - 



LRB8407896EGks 

1 AN ACT to amend Sections 9.1, 39 and 40 of the 52 

2 "Environmental Protection Act", approved June 29, 1970, as 53 

3 amended. 54 

4 Be it enacted by the People of the State of Illinois, 58 

5 represented in the General Assembly: 

6 Section 1. Sections 9.1, 39 and 40 of the "Environmental 61 

7 Protection Act", approved June 29, 1970, as amended, are 62 

8 amended to read as follows: 

(Ch. Ill 1/2, par. 1009.1) 64 

9 Sec. 9.1. (a) The General Assembly finds that the 66 

10 federal Clean Air Act, as amended, and regulations adopted 67 

11 pursuant thereto establish complex and detailed provisions 68 

12 for State-federal cooperation in the field of air pollution 69 

13 control, provide for a Prevention of Significant 

14 Deterioration program to regulate the issuance of 70 

15 preconstruction permits to insure that economic growth will 71 

16 occur in a manner consistent with the preservation of 72 

17 existing clean air resources, and also provide for plan 

18 requirements for nonattainment areas to regulate the 73 

19 construction, modification and operation of sources of air 74 

20 pollution to insure that economic growth will occur in a 75 

21 manner consistent with the goal of achieving the national 

22 ambient air quality standards, and that the General Assembly 76 

23 cannot conveniently or advantageously set forth in this Act 77 

24 all the requirements of such federal Act or all regulations 78 

25 which may be established thereunder. 

26 It is the purpose of this Section to avoid the existence 80 

27 of duplicative, overlapping or conflicting State and federal 81 

28 regulatory systems. 82 

29 (b) The provisions of Section 111 of the federal Clean 84 

30 Air Act (42 OSC 7411) relating to standards of performance 85 

31 for new stationary sources, and Section 112 of the federal 86 

32 Clean Air Act (42 CSC 7412) relating to the establishment of 87 

- 29G - 



-2- LRB8407896EGks 

1 national emission standards for hazardous air pollutants are 88 

2 applicable in this State and are enforceable under this Act. 89 

3 Any such enforcement shall be stayed consistent with any stay 90 

4 granted in any federal judicial action to review such 91 

5 standards. Enforcement shall be consistent with the results 

6 of any such judicial review. 92 

7 fcf — ■ l 5he-Beard-ahaii-adopt-raiea-whiea-are — in — aabatanee 94 

8 identieai- with — -federai — r egaiationa — pr omaigarad — by — the 9 5 

9 Admisiatrater-ef -the-Bnited-5 tat ea — Bnviranmentai — Protect ion 9 6 

10 Ageney-to-impiement-Seetiena-iii-and-iir-ef-the-federai-eiean 97 

11 Air — AetT — -Each— aeeh — Board — reie-aha£i-be-adepted-by-3eard 98 

12 reaexatien-at-the — neset— aehedeied— 3eard — meeting— raiiawing 99 

13 promeigatien — of— the— corresponding — federai— regaiatien-and 

14 fi£ed-with-the-Seeretary-of- — State — in— aeeordanee — with — ?he 100 

15 fiiinois- — Administrative Preeedare Act— within — 68 — datf3 101 

16 thereafter— ?he~previ3ieaa-aRd-reqeirements-©f- l 5itie-¥5x— of 102 

17 thia — Aet-shasx-net-appiy-to-rases— -adepted-ander-Sabseetiena 103 

18 fbf-and-fet-of-tnis-SeetienT 

19 l£X "^t The Board may ahaii adopt regulations 106 

20 establishing permit programs meeting the requirements of 107 

21 Sections 165 and 173 of the Clean Air Act (42 OSC 7475 and 42 108 

22 USC 7503) as amended. The Agency may shaii adopt procedures 

23 for the administration of such programs, 9n-er-before-6etober 110 

24 iT-i98i7-the-Board-ahaii-aa©pt-the-regaiationa-aatabiiahing-a 111 

25 permit— program— meeting — the-reqairementa-of-Seetion— i?3-f42 112 

26 5Se-?5Q3t-r 

27 fef — Prera-the-date-ef-their — -adoption — -antii— 6eraber — xt 11 4 
23 =98x7 or — the — eefeetive — date — of— the — Beard — regaiaeiona 115 

29 impiementing-Seetien-i?3-ef-the-€iean-Air-Aet-t42-HSe — ?583fT 116 

30 whichever — ia — eariierr— or— if — -the — Beard^a-regeiatiena-are 117 

31 stayed-by-a-eeart-af-eompetent-jar radiation — then — antii — the 

32 termination — of — rhe-atay-r- rhe-^Reiea-ior— raaaanee-of-Permita 118 

33 to — Hew — or — Modified Air Poiietien Seareea Aff eering 119 

34 Henattainraent-Areaa^-premttigarea-by-rne-Agency-and-aa-amenaed 120 

35 from — time — to — timer — aheii — be-in-e£f eetr-arovidea-that-the 

- 791 - 



-3- LRB8407896EGks 

1 Ageney-aay-not — impose — any — condition — or — requirement" — more 

2 stringent — than — required — by — the-eieen-Air-AetT- aa-amendedr 

3 thia-Aee-7— ©r-the-regeiationa-of — the — Boardr — 5he — berden — of 

4 eatabiishing-that-any-eendition-or-reqtsirement-imposed-by-the 

5 Ageney — in — or-rer-the-iaaeanee-of-a-perait-is-aore-atringene 

6 than-reqttired-by-the-€iean-Air-AetT-aa-amendedT-ahaii-be-spon 125 

7 the-perait-appiieant-r 

8 (d± f*f No person shall: 127 

9 (1) Violate any provisions of Sections 111, 112, 165 or 129 

10 173 of the Clean Air Act or federal regulations adopted 130 

11 pursuant thereto; or 

12 (2) Construct, install, modify or operate any equipment, 132 

13 building, facility, source or installation which is subject 133 

14 to regulation under Sections 111, 112, 165 or 173 of the 135 

15 Clean Air Act except in compliance with the requirements of 136 

16 such Sections and federal regulations adopted pursuant 137 

17 thereto, and no such action shall be undertaken without a 

18 permit granted by the Agency or in violation of any 138 

19 conditions imposed by such permit. Any denial of such a 139 

20 permit or any conditions imposed in such a permit shall be 140 

21 reviewable by the Board in accordance with Section 40 of this 

22 Act. 142 

(Ch. Ill 1/2, par. 1039) 144 

23 Sec. 39. (a) When the Board has by regulation required a 146 

24 permit for the construction, installation, or operation of 147 

25 any type of facility, equipment, vehicle, vessel, or 148 

26 aircraft, the applicant shall apply to the Agency for such 149 

27 permit and it shall be the duty of the Agency to issue such a 150 

28 permit upon proof by the applicant that the facility, 151 

29 equipment, vehicle, vessel, or aircraft will not cause a 

30 violation of this Act or of regulations hereunder. The 152 

31 Agency shall adopt such procedures as are necessary to carry 153 

32 out its duties under this Section. In granting permits the 154 

33 Agency may impose such conditions as may be necessary to 155 

34 accomplish the purposes of this Act, and as are not 155 

- 292 - 



-4- LRB8407896EGks 

1 inconsistent with the regulations promulgated by the Board 156 

2 hereunder. Except as otherwise provided in this Act, a bond 158 

3 or other security shall not be required as a condition for 

4 the issuance of a permit. If the Agency denies any permit 159 

5 under this Section, the Agency shall transmit to the 160 

6 applicant within the time limitations of this Section 161 

7 specific, detailed statements as to the reasons the permit 162 

8 application was denied. Such statements shall include, but 153 

9 not be limited to the following: 

10 (i) the Sections of this Act which may be violated if 165 

11 the permit were granted; 166 

12 (ii) the provision of the regulations, promulgated under 168 

13 this Act, which may be violated if the permit were granted; 169 

14 (iii) the specific type of information, if any, which 171 

15 the Agency deems the applicant did not provide the Agency; 172 

16 and 

17 (iv) a statement of specific reasons why the Act and the 174 

18 regulations might not be met if the permit were granted. 175 

19 If there is no final action by the Agency within 90 days 177 

20 after the filing of the application for permit, the applicant 178 

21 may deem the permit issued; except that this time period 179 

22 shall be extended to 180 days when (1) notice and opportunity 180 

23 for public hearing are required by State or federal law or 181 

24 regulation, or (2) the application which was filed is for any 182 

25 permit to develop a landfill subject to issuance pursuant to 

26 this subsection. 

27 (b) The Agency may issue NPDES permits exclusively under 184 

28 this subsection for the discharge of contaminants from point 185 

29 sources into navigable waters, all as defined in the Federal 186 

30 Water Pollution Control Act Amendments of 1972 (P. L. 187 

31 92-500), within the jurisdiction of the State, or into any 138 

32 well. 

33 All NPDES permits shall contain those terms and 190 

34 conditions, including but not limited to schedules of 191 

35 compliance, which may be required to accomplish the purposes 192 

- 293 - 



-5- LRB8407896EGks 

1 and provisions of this Act. 192 

2 The Agency may issue general NPDES permits for discharges 194 

3 from categories of point sources which are subject to the 195 

4 same permit limitations and conditions. Such general permits 196 

5 may be issued without individual applications and shall 197 

6 conform to regulations promulgated under Section 402 of the 198 

7 Clean Water Act (?.L. 95-217). 

3 The Agency may include, among such conditions, effluent 200 

9 limitations and other requirements established under this 201 

10 Act, Board regulations, the Federal Water Pollution Control 202 

11 Act Amendments of 1972 and regulations pursuant thereto, and 203 

12 schedules for achieving compliance therewith at the earliest 204 

13 reasonable date. 

14 The Agency shall adopt filing requirements and procedures 206 

15 which are necessary and appropriate for the issuance of NPDES 207 

16 permits, and which are consistent with the Act or regulations 208 

17 adopted by the Board, and with the Federal Water Pollution 209 

18 Control Act Amendments of 1972 (P. L. 92-500) and regulations 210 

19 pursuant thereto. 

20 The Agency, subject to any conditions which may be 212 

21 prescribed by Board regulations, may issue NPDES permits to 213 

22 allow discharges beyond deadlines established by this Act or 214 

23 by regulations of the Board without the requirement of a 215 

24 variance, subject to the Federal Wacer Pollution Control Act 215 

25 Amendments of 1972 (P. L. 92-500) and regulations pursuant 217 

26 thereto. 

27 (c) Except for those facilities owned or operated by 219 

28 sanitary districts organized under "An Act to create sanitary 220 

29 districts and to remove obstructions in the Des Plaines and 221 

30 Illinois rivers", approved May 29, 1889, as now or hereafter 222 

31 amended, no permit for the development or construction of a 

32 new regional pollution control facility may be granted by the 223 

33 Agency unless the applicant submits proof to the Agency that 224 

34 the location of 3aid facility has been approved by the County 225 

35 3oard of the county if in an unincorporated area, or the 225 

- 29^ - 



-6- LRB8407896EGks 

1 governing body of the municipality when in an incorporated 227 

2 area, in which the facility is to be located in accordance 

3 with Section 39.2 of this Act. 223 

4 Except for those facilities owned or operated by sanitary 230 

5 districts organized under "An Ace to create sanitary 231 

6 districts and to remove obstructions in the Des Plaines and 232 

7 Illinois rivers" , approved May 29, 1889, as now or hereafter 233 

8 amended, and except for new regional pollution control 234 

9 facilities governed by Section 39.2, and except for fossil 

10 fuel mining facilities, the granting of a permit under this 235 

11 Act shall not relieve the applicant from meeting and securing 236 

12 all necessary zoning approvals from the unit of government 237 

13 having zoning jurisdiction over the proposed facility. 238 

14 Before beginning construction on any new sewage treatment 240 

15 plant or sludge drying site to be owned or operated by a 242 

16 sanitary district organized under "An Act to create sanitary 

17 districts and to remove obstructions in the Des Plaines and 243 

18 Illinois rivers", approved May 29, 1889, as amended, for 244 

19 which a new permit (rather than the renewal or amendment of 245 

20 an existing permit) is required, such sanitary district shall 246 

21 hold a public hearing within the municipality within which 247 

22 the proposed facility is to be located, or within the nearesc 

23 community if the proposed facility is to be located within an 248 

24 unincorporated area, at which information concerning the 249 

25 proposed facility shall be made available to the public, and 250 

26 members of the public shall be given the opportunity to 251 

27 express their views concerning the proposed facility. 

28 (d) The Agency may issue RCHA permits exclusively under 253 

29 this subsection to persons owning or operating a facility for 254 

30 the treatment, storage, or disposal of hazardous waste as 255 

31 defined under this Act. 

32 All RCHA permits shall contain those terms and 257 

33 conditions, including buc not limited to schedules of 253 

34 compliance, which may be required to accomplish the purposes 259 

35 and provisions of this Act. The Agency may include among such 

- ?95 - 



-7- LRB8407896EGks 

1 conditions standards and other requirements established under 

2 this Act, Board regulations, the Resource Conservation and 

3 Recovery Act of 1976 (P.L. 94-580), as amended, and 

4 regulations pursuant thereto, and may include schedules for 

5 achieving compliance therewith as soon as possible. The 

6 Agency shall require that a performance bond or other 

7 security be provided as a condition for the issuance of a 

8 RCRA permit. 

9 The Agency shall adopt filing requirements and procedures 

10 which are necessary and appropriate for the issuance of RCRA 

11 permits, and which are consistent with the Act or regulations 

12 adopted by the Board, and with the Resource Conservation and 

13 Recovery Act of 1976 (P.L. 94-580), as amended, and 

14 regulations pursuant thereto. 

15 The applicant shall make available to the public for 

16 inspection all documents submitted by the applicant to the 

17 Agency in furtherance of an application, with the exception 

18 of trade secret3, at the office of the county board or 

19 governing body of the municipality. Such documents may be 

20 copied upon payment of the actual cost of reproduction during 

21 regular business hours of the local office. The Agency shall 

22 issue a written statement concurrent with its granc or denial 

23 of the permit explaining the basis for its decision. 

24 (e) The Agency may issue OIC permits exclusively under 282 

25 this subsection to persons owning or operating a facility for 233 

26 the underground injection of contaminants as defined under 284 

27 this Act. 

28 All OIC permits shall concain chose terms and conditions, 286 

29 including but not limited to schedules of compliance, which 287 

30 may be required to accomplish the purposes and provisions of 288 

31 this Act. The Agency may include among such conditions 289 

32 standards and other requirements established under this Act, 

33 3oard regulations, the Safe Drinking Water Act {?.!. 93-523), 290 

34 as amended, and regulations pursuant thereto, and may include 291 

35 schedules for achieving compliance therewith. The Agency 292 

- 296 - 



-8- LRB8407896EGks 

1 shall require that a performance bond or other security be 29 3 

2 provided as a condition for the issuance of a QIC permit. 

3 The Agency shall adopt filing requirements and procedures 295 

4 which are necessary and appropriate for the issuance of UIC 296 

5 permits, and which are consistent with the Act or regulations 297 
S adopted by the Board, and with the Safe Drinking Water Act 298 

7 (P.L. 93-523), as amended, and regulations pursuant thereto. 

8 The applicant shall make available to the public for 300 

9 inspection, all documents submitted by the applicant to the 301 

10 Agency in furtherance of an application, with the exception 302 

11 of trade secrets, at the office of the county board or 303 

12 governing body of the municipality. Such documents may be 304 

13 copied upon payment of the actual cost of reproduction during 305 

14 regular business hours of the local office. The Agency shall 306 

15 issue a written statement concurrent with its grant or denial 307 

16 of the permit explaining the basis for its decision. 

17 (f) In making any determination under regulations 309 

18 established pursuant to subsection (c) fdf-e*-fet of Section 310 

19 9.1 of this Act: 

20 (1) The Agency shall have authority to make the 312 

21 determination of any question required to be determined by 313 

22 the Clean Air Act, this Act, or the regulations of -he Board, 314 

23 including the determination of the Lowest Achievable Emission 315 

24 Rate or Best Available Control Technology, consistent with 316 

25 the Board's regulations. 

26 (2) The Agency shall, after conferring with the 318 

27 applicant, give written notice to the applicant of its 319 

28 proposed decision on the application including the terms and 320 

29 conditions of the permit to be issued and the facts, conduct 

30 or other basis upon which the Agency will rely to support its 321 

31 proposed action. 

32 (3) Following such notice, the Agency shall give the 323 

33 applicant an opportunity for a hearing in accordance with the 324 

34 provisions of Sections 10 through 15 of "The Illinois 325 

35 Administrative Procedure Act", approved September 22, 1975, 326 

- 297 - 



-9- LRB8407896EGks 

1 as amended. 3 26 

2 (g) The Agency shall include as conditions upon all 328 

3 permits issued for hazardous waste disposal sites such 329 

4 restrictions upon the future use of such 3ites as are 330 

5 reasonably necessary to protect public health and the 331 

6 environment, including permanent prohibition of the use of 

7 such sites for purposes which may create an unreasonable risk 332 

8 of injury to human health or to the environment. After 333 

9 administrative and judicial challenges to such restrictions 334 

10 have been exhausted, the Agency shall file such restrictions 335 

11 of record in the Office of the Recorder of the county in 

12 which the hazardous waste disposal site is located. 336 

13 (h) Commencing January 1, 1987, a hazardous waste stream 338 

14 may not be deposited in a permitted hazardous waste site 339 

15 unless specific authorization is obtained from the Agency by 340 

16 the generator and the disposal site owner and operator for 341 

17 the deposit of that specific hazardous waste stream. The 342 

18 Agency may grant specific authorization for disposal of 

19 hazardous waste streams only after the generator has 343 

20 reasonably demonstrated that, considering technological 344 

21 feasibility and economic reasonableness, the hazardous waste 

22 cannot be reasonably recycled for reuse, nor incinerated or 345 

23 chemically, physically or biologically treated so as to 346 

24 neutralize the hazardous waste and render it nonhazardous. 347 

25 In granting authorization under this Section, the Agency may 343 
25 impose such conditions as may be necessary to accomplish the 349 

27 purposes of the Act and are consistent with this Act and 

28 regulations promulgated by the 3oard hereunder. If the 350 

29 Agency refuses to grant authorization under thi3 Section, the 351 

30 applicant may appeal as if the Agency refused to grant a 352 

31 permit, pursuant to the provisions of subsection (a) of 353 

32 Section 40 of this Act. 

33 (i) Before issuing any RCRA permit or any permit fcr the 355 

34 conduct of any waste-cransportation or wasts-dispcsal 355 

35 operation, the Agency snail conduct an evaluation of the 357 



298 



-10- LRB8407896EGks 

1 prospective operator's prior experience in waste management 358 

2 operations. The Agency may deny such a permit if the 3 59 

3 prospective operator or any employee or officer of the 

4 prospective operator has a history of: 360 

5 (1) repeated violations of federal, State, or local 362 

6 laws, regulations, standards, or ordinances in the operation 363 

7 of refuse disposal facilities or sites; or 

8 (2) conviction in this or another State of any crime 365 

9 which is a felony under the laws of this State, or conviction 366 

10 of a felony in a federal court; or 

11 (3) proof of gross carelessness or incompetence in 368 

12 handling, storing, processing, transporting or disposing of 369 

13 any hazardous waste. 

14 (j) The issuance under this Act of a permit to engage in 371 

15 the surface mining of any resources other than fossil fuels 372 

16 shall not relieve the permittee from its duty to comply with 373 

17 any applicable local law regulating the commencement, 374 

18 location or operation of surface mining facilities. 

19 (k) A development permit issued under subsection (a) of 376 

20 Section 39 for any facility or site which is required to have 377 

21 a permit under subsection (d) of Section 21 shall expire at 373 

22 the end of 2 calendar years from the date upon which it was 379 

23 issued, unless within that period the applicant: has taken 

24 action to develop the facility or the site. In the event that 380 

25 review of the conditions of the development permit is sought 381 

26 pursuant to Sections 40 or 41, or permittee is prevented from 382 

27 commencing development of the facility or site by any other 383 

28 litigation beyond the permittee's control, such two-year 384 

29 period shall be deemed to begin on the date upon which such 

30 review process or litigation is concluded. 386 

(Ch. Ill 1/2, par. 1040) 388 

31 Sec. 40. (a)(1) If the Agency refuses to grant or grants 390 

32 with conditions a permit under Section 39 of this Act, the 392 

33 applicant may, within 35 days, petition for a hearing before 393 

34 the Board to contest the decision of the Agency. The 3oard 394 

- 29? - 



-11- LRB8407896EGks 

1 shall give 21 day notice to any person in the county where is 

2 located the facility in issue who has requested notice of 

3 enforcement proceedings and to each member of the General 

4 Assembly in whose legislative district that installation or 

5 property is located; and shall publish that 21 day notice in 

6 a newspaper of general circulation in that county. The Agency 

7 shall appear as respondent in such hearing. At such hearing 

8 the rules prescribed in Sections 32 and 33(a) of this Act 

9 shall apply, and the burden of proof shall be on the 

10 petitioner. 

11 (2) Except as provided in paragraph (a)(3), if there is 

12 no final action by the Board within 90 days, petitioner may 

13 deem the permit issued under this Act, provided, however, 

14 that that period of 90 days shall not run for any period of 

15 time, not to exceed 30 days, during which the Board is 

16 without sufficient membership to constitute the quorum 

17 required by subsection (a) of Section 5 of this Act, and 

18 provided further that such 90 day period shall not be stayed 409 

19 for lack of quorum beyond 30 days regardless of whether the 410, 

20 lack of quorum exists at the beginning of such 90 day period 411 

21 or occurs during the running of such 90 day period. 412 

22 (3) Paragraph (a)(2) shall not apply to any permit which 414 

23 is subject to subsection (b), (d) or (e) of Section 39. If 416 

24 there is no final action by the Board within 120 days, the 

25 petitioner shall be entitled to an Appellate Court order 417 

26 pursuant to Section 41(d) of this Act. 

27 (b) If the Agency grants a RCRA permit for a hazardous 419 

28 waste disposal site, a third party, other than the permit 420 

29 applicant or Agency, may petition the Board within 35 days 421 

30 for a hearing to contest the issuance of the permit. Unless 422 

31 the 3oard determines thac such petition is duplicitous cr 423 

32 frivolous, or that the petitioner is so located as co not be 424 

33 affected by che permitted facility, the 3oard shall hear the 

34 petition in accordance with the terms of subsection (a) of 425 

35 this Section and its procedural rules governing denial 426 



300 



-12- LRB8407896EGks 

1 appeals, such hearing to be based exclusively on the record 427 

2 before the Agency. The burden of proof shall be on the 428 

3 petitioner. The Agency and the permit applicant shall be 429 

4 named co-respondents. 

5 The provisions of this subsection do not apply to the 431 

6 granting of permits issued for the disposal or utilization of 432 

7 sludge from publicly-owned sewage works. 433 

8 (c) Any party to an Agency proceeding conducted pursuant 435 

9 to Section 39.3 of this Act may petition as of right to the 436 

10 Board for review of the Agency's decision within 35 days from 437 

11 the date of issuance of the Agency's decision, provided that 438 

12 such appeal is not duplicitous or frivolous. The decision of 439 

13 the Board shall be based exclusively on the record compiled 

14 in the Agency proceeding. In other respects the 3oard's 440 

15 review shall be conducted in accordance with subsection (a) 441 
IS of this Section and the Board's procedural rules governing 442 

17 permit denial appeals. 

18 (d) In reviewing the denial or any condition of a permit 444 

19 issued by the Agency pursuant to rules and regulations 445 

20 adopted under subsection (c) fdf-oe-fet of Section 9.1 of 446 

21 this Act, the decision of the Board shall be based 447 

22 exclusively on the record before the Agency including the 448 

23 record of the hearing, if any, held pursuant to paragraph 449 

24 (f)(3) of Section 39 unless the parties agree to supplement 450 

25 the record. The Board shall, if it finds the Agency is in 451 

26 error, make a final determination as to the substantive 

27 limitations of the permit including a final determination of 452 

28 Lowest Achievable Emission Rate or Best Available Control 453 

29 Technology. 454 

30 Section 2. This Act shall take effect upon becoming law. 456 



301 



- 302 



RILL 18 



Background 

After reviewing the Pollution Control Board's rules entitled "Solid Waste" (35 
III. Adm. Code 807), the Joint Committee on Administrative Rules discovered 
that the Board lacked the statutory authority to require a waste disposal 
operator to post security to cover the cost of closure and post-closure care of 
waste treatment and waste storage operations. The Board's rules require a 
waste operator to prepare closure and post-closure care plans for the entire 
site on which their disposal activities occurred. However, Section 21.1(b) of 
the Environmental Protection Act states that the amount of the performance 
bond or other security for the purpose of insuring closure shall be directly 
related to the design and volume of a waste disposal facility . 

As defined in the Board's rules, a site may include one or more units that 
are used for the storage, treatment, or disposal of waste. In addition, the 
definition of a site in Section 3(dd) of the Act indicates that a facility is a 
component of a site. Therefore, the Board's attempt to equate a facility and 
a site, so that amounts of bonds for closure of waste disposal facilities 
include waste treatment and storage facilities which happen to be located at a 
site with a disposal facility, is contrary to specific statutory provisions. The 
Joint Committee recommended that legislation be developed to clarify the 
Board's policy with respect to the posting of security for the cost of closure 
and post-closure care of waste treatment and waste storage operations. 

Summary 

Amends Section 21.1(a) of the Environmental Protection Act (III. Rev. Stat. 
1983, ch. 111i, par. 1021.1(a)) to clarify the Pollution Control Board's policy 
to require that the closure performance bond be directly related to the design 
and volume of the entire waste disposal site, rather than a particular facility 
at the site. Effective immediately. 



374 



- 303 - 



304 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 v 



INTRODUCED , BY 



SYNOPSIS: (Ch. Ill 1/2, par. 1021.1) 

Amends the Environmental Protection Act to 
require that the closure performance bond be directly related 
to the design and volume of the entire waste disposal site, 
rather than a particular facility at the site. Effective 
immediately. 



LRB8407895EGks 



A BILL FOR 



- 305 - 



LRB8407895EGks 

1 AN ACT to amend Section 21.1 of the "Environmental 51 

2 Protection Act", approved June 29, 1970, as amended. 53 

3 Be it enacted by the People of the State of Illinois, 57 

4 represented in the General Assembly; 

5 Section 1. Section 21.1 of the "Environmental Protection 60 

6 Act", approved June 29, 1970, as amended, is amended to read 61 

7 as follows: 

(Ch. Ill 1/2, par. 1021.1) 63 

8 Sec. 21.1. (a) No person other than the State of 65 

9 Illinois, its agencies and institutions, or a unit of local 66 

10 government shall conduct any waste disposal operation on or 68 

11 after March 1, 1985, which requires a permit under subsection 

12 (d) of Section 21 of this Act, unless such person has posted 69 

13 with the Agency a performance bond or other security for the 70 

14 purpose of insuring closure of the site and post-closure care 71 

15 in accordance with this Act and regulations adopted 72 

16 thereunder. 

17 (b) On or before January 1, 1985, the Board shall adopt 74 

18 regulations to promote the purposes of this Section. Without 75 

19 limiting the generality of this authority, such regulations 76 

20 may, among other things, prescribe the type and amount of the 77 

21 performance bonds or other securities required under 73 

22 subsection (a) of this Section, and the condicions under 

23 which the State is entitled to collect monies from such 79 

24 performance bonds or other securities. The bond amount shall 80 

25 be directly related to the design and volume of the site 81 

26 wesfee-di3B09ai--saei=ifey. 

27 (c) There is hereby created within the State Treasury a 83 

28 special fund to be known as the "Landfill Closure and 34 

29 Post-Closure Fund". Any monies forfeited to the State of 85 

30 Illinois from any performance bond or other security required 

31 under this Section shall be placed in the "Landfili Closure 86 

32 and Post-Closure Fund" and shall, upon approval by the 87 

- 306 - 



-2- LRB8407895EGks 

1 Governor and the Director, be used by and under the direction 88 

2 of the Agency for the purposes for which such performance 89 

3 bond or other security was issued. 90 

4 (d) The Agency is authorized to enter into such 92 

5 contracts and agreements as it may deem necessary co carry 93 

6 out the purposes of this Section. Neither the State, nor the 94 

7 Director, nor any State employee shall be liable for any 9 5 

8 damages or injuries arising out of or resulting from any 

9 action taken under this Section. 96 

10 (e) The Agency shall have the authority to approve or 98 

11 disapprove any performance bond or other security posted 99 

12 pursuant to subsection (a) of this Section. Any person whose 100 

13 performance bond or other security is disapproved by the 101 

14 Agency may contest the disapproval as a permit denial appeal 

15 pursuant to Section 40 of this Act. 102 
IS (f) The Agency may establish such procedures as it may 104 

17 deem necessary for the purpose of implementing and executing 105 

18 its responsibilities under this Section. 

19 (g) Nothing in this Section shall bar a cause of action 107 

20 by the State for any other penalty or relief provided by this 108 

21 Act or any other law. 109 

22 Section 2. This Act takes effect upon becoming law. Ill 



- 307 - 



308 - 



PILL 19 

Background 

The Illinois State Scholarship Commission promulgated rules which required 
recipients of the Correctional Officer's Survivor Grant Program grants to 
maintain satisfactory academic progress. During its review of these rules, 
the Joint Committee on Administrative Rules determined that the Commission 
lacked the statutory authority to impose such requirements. 

The ISSC explained that it has always been ISSC policy to require 
satisfactory academic progress of grant recipients in all programs administered 
by the ISSC. Section 30-15. 8(b) of the Higher Education Student Assistance 
Law (III. Rev. Stat. 1983, ch. 122, par. 3015 et seq.), requires that 
students receiving grants or scholarships under the Law to be students "in 
good standing." The ISSC explained that it uses "satisfactory academic 
progress" instead of "in good standing" in the rules because the former term 
is used in federal regulations. The ISSC further explained that because the 
Correctional Officer's Survivor Grant Program is part of the Higher Education 
Student Assistance Law, recipients must comply with the provisions thereof. 
An examination of the Higher Education Student Assistance Law revealed that 
Section 30-1 5. 8(b) is not applicable to the Correctional Officer's Survivor 
Grant Program. Section 30-15 of the School Code states: "Sections 30-15.1 
through 30-15.13 shall be known and may be cited as the Higher Education 
Student Assistance Law." The Correctional Officer's Survivor Grant Program 
is set forth in Section 30-14.4 of the School Code, and is not included in the 
above quoted Section. 

Because the Commission lacks the authority to impose a requirement of 
satisfactory academic progress upon recipients of grants under this program, 
the Joint Committee suggested that legislation be drafted to impose this 
requirement. 

Summary 

Amends Section 30-14.4 of the School Code (III. Rev. Stat. 1983, ch. 122, 
par. 30-14.4) to allow the Illinois State Scholarship Commission to require that 
recipients of the Correctional Officer's Survivor Grant Program maintain 
satisfactory academic progress. Effective immediately. 



335 



309 - 



310 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Ch. 122, par. 30-14.4) 

Amends The School Code to allow the Illinois 
State Scholarship Commission to require that recipients of 
correctional employee dependent survivor scholarships 
maintain satisfactory academic progress. Effective 
immediately. 



LRB8408155THJS 



A BILL FOR 



- 311 



LRB8408155THJS 

1 AN ACT to amend Section 30-14.4 of "The School Code", 51 

2 approved March 18, 1961, as amended. 53 

3 Be it enacted by the People of the State of Illinois, 57 

4 represented in the General Assembly: 

5 Section 1. Section 30-14.4 of "The School Code", 59 

6 approved March 18, 1961, as amended, is amended to read as 60 

7 follows: 

(Ch. 122, par. 30-14.4) 62 

8 Sec. 30-14.4. Scholarships for dependents of Department 64 

9 of Corrections employees killed or permanently disabled in 65 

10 the line of duty. 

11 Any spouse, natural child, legally adopced child or child 67 

12 in the legal custody of an employee of the Department of 68 

13 Corrections who is assigned to a security position with the 69 

14 Department with responsibility for inmates of any 70 

15 correctional institution under the jurisdiction of the 71 

16 Department and who is killed or permanently disabled with 90% 

17 to 100% disability in the line of duty is enticled to 8 72 

18 semesters or 12 quarters of full payment of tuition and 73 

19 mandatory fees at any State-supported Illinois institution of 74 

20 higher learning for either full or part-time study, or 8 75 

21 semesters or 12 quarters of payment of tuition and mandatory 76 

22 fees at the rate established by the Illinois State 

23 Scholarship Commission for private institutions in the State 

24 of Illinois , provided the recipient is maintaining 78 

25 satisfactory academic progress . The benefits of this Section 79 

26 shall be administered by and paid out of funds available to 80 

27 the Illinois State Scholarship Commission and shall accrue to 81 

28 the bona fide applicant without the requirement of 82 

29 demonstrating financial need to qualify for such benefits. 83 

30 Section 2. This Act shall take effect upon becoming law. 85 



312 



RILL 20 

Background 

At its meeting on June 12, 1984, the Joint Committee suggested that the 
Illinois Guardianship and Advocacy Commission promulgate rules concerning 
the Legal Advocacy Service and seek legislation to amend Section 5(i) of the 
Guardianship and Advocacy (III. Rev. Stat. 1983, ch. 9U, par. 701 et seq.) 
Act if it believes that it should be allowed to waive payment of fees in certain 
cases where the eligible recipient of legal services is able to pay. 

In addition, because the Commission had not made legal referrals "to the 
extent practicable" as required by Section 11 of the Guardianship and 
Advocacy Act (III. Rev. Stat. 1983, ch. 91*, par. 711), the Joint Committee 
at its June 12, 1984 meeting directed staff to draft legislation requiring the 
Guardianship and Advocacy Commission to make referrals of a potential client 
to the extent practicable without regard to a request by the client. The 
Committee has recommended that the Commission's rules contain standards for 
determining the number of referrals that will be made based on the 
availability of private attorneys. 

Further, the Joint Committee objected to Section 350.1105 of the Guardianship 
and Advocacy Commission's Legal Advocacy Services rules. The objection was 
issued on the basis that the definition of "income" contained in the 
Commission's rules exceeds its statutory authority under the Act by 
considering the financial resources of the client's entire family unit in 
determining the client's ability to pay for legal services. The Committee 
therefore suggested that the Commission seek legislation to amend Section 11 
of the Act. This bill clarifies whose resources may be considered as those of 
the person or ward by requiring that the rules of the Commission evaluate an 
eligible person's or ward's ability to pay based on the number of family unit 
members who are dependent upon the client as determined during the time the 
client is legally responsible. 

Summary 

Amends Sections 5 and 11 of the Guardianship and Advocacy Act to require 
the Guardianship and Advocacy Commission to set forth in its rules the 
procedures by which the fee eligible persons must pay for legal services is 
determined, and the procedures by which it will attempt to secure private 
counsel for eligible persons. The amendment also requires the Legal 
Advocacy Service to make a good faith effort to obtain private counsel for 
eligible persons, and adds a new provision stating that the Commission's rules 
are subject to the requirements of the Illinois Administrative Procedure Act. 
Effective immediately. 



Idr 



313 



311 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: • (Ch. 91 1/2, pars. 705, 711; new par. 737) 

Amends the Guardianship and Advocacy Act. 
Establishes specific criteria for the Guardianship and 
Advocacy Commission to use in determining eligibility for 
legal or guardianship services. Requires the Commission to 
establish, by rule and regulation, procedures by which it 
will attempt to assist eligible persons to engage private 
counsel and procedures by which clients eligible to receive 
legal services may appeal the termination or suspension of 
such services prior to termination or suspension. Effective 
immediately. 



LRB8407589SFtc 



A BILL FOR 



315 



LRB8407589SFtc 

1 AN ACT to amend Sections 5 and 11 of and to add Section 59 

2 37 to the "Guardianship and Advocacy Act", approved January 61 

3 8, 1979, as amended. 62 

4 Be it enacted by the People of the State of Illinois, 66 

5 represented in the General Assembly: 

6 Section 1. Sections 5 and 11 of the "Guardianship and 68 

7 Advocacy Act", approved January 8, 1979, as amended, is 69 

8 amended, and Section 37 is added thereto, the added and 70 

9 amended Sections to read as follows: 

(Ch. 91 1/2, par. 705) 72 

10 Sec. 5. (a) The Commission shall establish throughout 74 

11 the State such regions as it considers appropriate to 75 

12 effectuate the purposes of the Authority under this Act, 76 

13 taking into account the requirements of State and federal 77 

14 statutes; population; civic, health and social service 

15 boundaries; and other pertinent factors. 78 

16 (b) The Commission shall act through its divisions as 80 

17 provided in this Act. 

18 (c) The Commission shall establish general policy 82 

19 guidelines for the operation of the Legal Advocacy Service, 83 

20 Authority and State Guardian in furtherance of this Act. Any 84 

21 action taken by a regional authority is subject to the review 85 

22 and approval of the Commission. The Commission may 

23 disapprove any action of a regional authority, in which case 36 

24 the regional authority shall cease such action. 87 

25 (d) The Commission shall hire a Director and staff to 89 

26 carry out the powers and duties of the Commission and its 90 

27 divisions pursuant to this Act and the rules and regulations 91 

28 promulgated by the Commission. All staff other than the 92 

29 Director shall be subject to the "Personnel Code", as now or 

30 hereafter amended. 

31 (e) The Commission shall review and evaluate the 94 

32 operations of the divisions. 



- 316 



-2- LRB8407589SFtc 

1 (f) The Commission shall operate subject to the 98 

2 provisions of "The Illinois Purchasing Act", approved July 99 

3 11, 1957, as now or hereafter amended. 

4 (g) The Commission shall prepare its budget. 101 

5 (h) The Commission shall prepare an annual report on its 103 

6 operations and submit the report to the Governor and the 104 

7 General Assembly. 

8 The requirement for reporting to the General Assembly 106 

9 shall be satisfied by filing copies of the report with the 107 

10 Speaker, the Minority Leader and the Clerk of the House of 108 

11 Representatives and the President, the Minority Leader and 109 

12 the Secretary of the Senate and the Legislative Research Unit 110 

13 eoaneii, as required by Section 3.1 of "An Act to revise the 111 

14 law in relation to the General Assembly", approved February 112 

15 25, 1874, as amended, and filing such additional copies with 113 

16 the State Government Report Distribution Center for the 

17 General Assembly as is required under paragraph (t) of 114 

18 Section 7 of the State Library Act. 

19 (i) The Commission shall establish rules and regulations 116 

20 for the conduct of the work of its divisions, including rules 117 

21 and regulations for the Legal Advocacy Service and the State 118 

22 Guardian in evaluating an eligible person's or ward's 119 

23 financial resources for the purpose of determining whether 

24 the eligible person or ward has the ability to pay for legal 121 

25 or guardianship services received. The determination of the 122 

26 eligible person's financial ability to pay for legal services 123 

27 shall be based upon the number of dependents in the eligible 

28 person's family unit and the income, liquid assets and 124 

29 necessary expenses, as prescribed by rule of the Commission 125 

30 of: (1) the eligible person; (2) the eligible person's 126 

31 spouse; and (3) the parents of miner eligible persons. The 127 

32 determination of a ward's ability to pay for guardianship 

33 services shall be based upon the ward's estate. An eligible 129 

34 person or ward found to have sufficient financial resources 130 

35 shall be required to pay the Commission in accordance with 131 



317 - 



-3- LR38407589SFtc 

1 standards established by the Commission. No fees may be 132 

2 charged for legal or guardianship services given unless the 

3 eligible person or ward is given notice at the start of such 133 

4 services that such fees might be charged. All fees 134 

5 collected shall be deposited with the State Treasurer and 135 

6 placed in the General Revenue Fund. The Commission shall 136 

7 establish rules and regulations regarding the procedures of 137 

8 appeal for clients prior to termination or suspension of 138 

9 legal services. Such rules and regulations shall include, 

10 but not be limited to, client notification procedures prior 139 

11 to the actual termination, the scope of issues subject to 140 

12 appeal, and procedures specifying when a final administrative 141 

13 decision is made. 

14 (j) The Commission shall take such actions as it deems 143 

15 necessary and appropriate to receive private, federal and 144 

16 other public funds to help support the divisions. 

17 (k) The Commission may expend funds under the State's 146 

18 plan to protect and advocate the rights of developmentally 147 

19 disabled persons established under the federal "Developmental 148 

20 Disabilities Services and Facilities Construction Act." 149 

21 (Public Law 94-103, Title II), as now or hereafter amended. 

22 If the Governor designates the Commission to be the 150 

23 organization or agency to provide the services called for in 151 

24 the State plan, the Commission shall make these protection 152 

25 and advocacy services available to developmentally disabled 

26 persons by referral or by contracting for these services to 153 

27 the extent practicable. If the Commission is unable to so 154 

28 make available such protection and advocacy services, it 155 

29 shall provide them through persons in its own employ. 156 

(Ch. 91 1/2, par. 711) 158 

30 Sec. 11. The Legal Advocacy Service shall make available 160 

31 counsel for eligible persons by referral or by contracting 162 

32 for legal services to the extent practicable. The Legal 

33 Advocacy Service shall make a good faith effort to assist 163 

34 eligible persons to engage private counsel, and to contact 164 



HP 



-4- LRB8407589SFtc 

1 private counsel for eligible persons whose disabilities limit 163 

2 their capacity to independently contact private counsel. If 164 

3 the Legal Advocacy Service is unable to so make available 165 

4 counsel, it shall provide attorneys in its own employ. 167 

5 Taking into consideration the availability of private counsel 

6 in the eligible person's local area, the Commission shall 168 

7 establish, by rule, the standards and procedures by which it 169 

8 will attempt to assist eligible persons to engage private 170 

9 counsel. 171 

{Ch. 91 1/2, new par. 737) 173 

10 Sec. 37. Rules and regulations adopted by the Commission 175 

11 pursuant to authority granted under this Act shall be subject 176 

12 to the provisions of the Illinois Administrative Procedure 177 

13 Act. 

14 Section 2. This Act shall take effect upon its becoming a 179 

15 law. 



319 



- 320 



RILL 21 

Background 

During its review of the Department of Public Aid's rules concerning work 
incentive demonstration participation, the Joint Committee issued on objection 
to the Department's rulemaking. The objection was issued because the 
Department failed to adequately set forth the standards it used in sanctioning 
registrants under the program. The Department has refused to modify or 
withdraw the rulemaking in response to the objection. Upon review of the 
Department's response, the Joint Committee directed staff to draft legislation 
to require the Department to set standards for the sanctioning of registrants 
under the work incentive program. 

Summary 

Amends Section 4-1.10 of the Public Aid Code (III. Rev. Stat. 1983, ch. 23, 
par. 4-1.10) to require the Department of Public Aid to include within its 
rules standards used to determine when registrants shall be sanctioned under 
the Work Demonstration Program. 



Idr 032 



321 - 



222 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: <Ch. 23, par. 4-1.10) 

Amends the Public Aid Code. Provides for 
certain rules governing sanctions of participants in the Work 
Demonstration Program. Effective immediately. 



LRB8407590BDJS 



A BILL FOR 



3?3 



LRB8407590BDJS 

1 AN ACT to amend Section 4-1.10 of "The Illinois Public 47 

2 Aid Code"-, approved April '11, 1967, as amended. 49 

3 Be it .enacted by the Peoole of the State of Illinois, 53 

4 represented in the General Assembly: 

5 Section 1. Section 4-1.10 of "The Illinois Public Aid 55 

6 Code", approved April 11, 1967, as amended, is amended to 56 

7 read as follows: 

(Ch. 23, par. 4-1.10) 58 

8 Sec. 4-1.10. Acceptance of Assignment to Job Search, 60 

9 Training and Work Programs. An individual for whom the job 61 

10 search, training and work programs established under Section 62 

11 9-6 of Article IX are applicable must accept assignment to 63 

12 such programs. This Section shall be operative only to the 64 

13 extent that it does not conflict with the Federal Social 

14 Security Act, or any other federal law or federal regulation 65 

15 governing the receipt of federal grants for aid provided 66 

16 under this Article. The Illinois Department and the local 67 

17 governmental unit shall determine, pursuant to rules and 

18 regulations, sanctions for persons failing to comply with the 68 

19 requirements under this Section. The Illinois Department's 69 

20 rules governing the sanctioning of registrants under the Work 70 

21 Demonstration Program shall include, without limitation, 71 

22 specific descriptions and examples of the types of conduct 7 2 

23 which will be deemed a serious disruption of the Program and 

24 the standards for the sanctioning of registrants under the 73 

25 Program. Sanctions may include the loss of eligibility to 74 

26 receive aid under this Article for up to 3 months for the 75 

27 first occurrence and for up to 6 months for the second and 76 

28 subsequent occurrences. If the sanctioned individual is not 77 

29 the principal earner as defined by Federal law in an 78 

30 assistance unit receiving aid under this Article, only that 

31 individual is ineligible for public assistance during the 79 

32 sanction period. If the sanctioned individual is the 80 

- 324 - 



-2- LRB8407590BDJ3 

1 principal earner in an assistance unit receiving aid under 81 

2 this Article, the entire assistance unit is ineligible for 82 

3 public assistance during the sanction period. 

4 Section 2. This Act shall take effect upon becoming law. 84 



325 



- 3?6 



BILL 22 



Background 

During the review of the Department of Alcoholism and Substance Abuse's 
rules implementing the Alcoholism and Substance Abuse Act (77 III. Adm. 
Code 2030), the Joint Committee on Administrative Rules voted to recommend 
that legislation be drafted to require the Department to promulgate rules 
delineating the standards used in making various determinations, as required 
by Section 1.02 of the Illinois Administrative Procedure Act. 

Specifically, the Joint Committee objected to the Department's lack of 
standards regarding funding priorities, extensions for revenue/expense 
reporting requirements, and exemptions from the rules. 

Summary 

Amends Section 6 of the Alcoholism and Substance Abuse Act (III. Rev. Stat. 
1984 Supp., ch. 111?, par. 6306) to require the Department of Alcoholism and 
Substance Abuse to promulgate rules which delineate the standards used by 
the Department in determining whether to grant extensions of time to 
providers in submitting revenue expense reporting information required by 
the Department. 



340 



327 



328 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Ch. Ill 1/2, par. 6306) 

Amends the Alcoholism and Substance Abuse Act 
to require the Department of Alcoholism and Substance Abuse 
to include in its rules the funding priorities of the 
Department, the standards used by the Department in 
determining whether to allow exemptions from the 
revenue/expense reporting requirements and the standards used 
in determining whether to allow exemptions to the rules. 



LRB8408154GLsb 



A B!LL FOR 



329 



LR38408154GLsb 

1 AN ACT to amend Section 6 of the "Alcoholism and 55 

2 Substance Abuse Act", certified December 2, 1983, as amended. 55 

3 Be it enacted by the People of the State of Illinois, 61 

4 represented in the General Assembly: 

5 Section 1. Section 6 of the "Alcoholism and Substance 63 

6 Abuse Act", certified December 2, 1983, as amended, is 64 

7 amended to read as follows: 

(Ch. Ill 1/2, par. 6306) 66 

8 Sec. 6. In addition to the powers, duties and functions 69 

9 vested in it by other provisions of this Act, or by other 70 

10 laws of this State, the Department shall have the powers, 

11 duties and functions enumerated below: 71 

12 (a) To establish comprehensive and coordinated programs 74 

13 and activities for the provision of early intervention, 

14 treatment, rehabilitation, prevention, and education 75 

15 services, including education of the elderly, directed at 75 

16 alleviating alcoholism, alcohol abuse and misuse, drug 77 

17 addiction, and other drug abuse and misuse, including abuse 78 

18 and misuse of prescription drugs. The Director shall divide 79 

19 the State into not less than 4 regions and establish regional 80 

20 offices to review, monitor, and assist the programs and 

21 provide standards for the development cf programs on the 81 

22 regional level. In establishing the regions, consideration 82 

23 shall be given to city, town and county lines; population 83 

24 concentrations, and regional boundaries established by other 84 

25 State agencies and local organizations. Regional boundaries 85 

26 shall not be used to deny or limit referral or delivery of 86 

27 services at the nearest and most appropriate location. 

28 (b) To develop an annual comprehensive State plan for 88 

29 the provision of early intervention, treatment, 89 

30 rehabilitation, prevention, education, including education of 90 

31 the elderly, and other services and activities to alleviate 91 

32 alcoholism, alcohol abuse and misuse, drug addiction, and 92 



330 



-2- LRS3 40815 4GL,sb 

1 other drug abuse and misuse, including abuse and misuse of 93 

2 prescription drugs. The plan shall include a statement of 94 

3 problems, needs, priorities, services and other pertinent 95 

4 information for the entire State and each region of the 

5 State. Such plan shall also include a statement of the needs 96 
5 of minorities and other specific populations. In the 97 

7 development of the plan, input shall be sought from 98 

8 providers, parent groups, associations, and interested 99 

9 citizens including the Illinois Advisory Council on 100 

10 Alcoholism and Substance Abuse. 

11 (c) To establish a clearinghouse and central repository 102 

12 for the development and maintenance of a centralized alcohol 103 

13 and drug abuse data collection and dissemination system and a 104 

14 management information system for all alcohol and drug abuse 

15 functions, in accordance with the confidentiality safeguards 105 

16 under this Act. 

17 (d) To prepare a comprehensive plan for treatment of 107 

18 alcoholics, addicts, drug abusers and intoxicated persons for 108 

19 inclusion in the State comprehensive health plan. 109 

20 (e) To review all State health, welfare and treatment 111 

21 plans to be submitted for Federal funding under Federal 112 

22 legislation that include provisions relating to alcoholism, 113 

23 addiction, drug abuse and intoxicated persons. 

24 (f) To develop, encourage, and foster statewide, 115 

25 regional, and local plans and programs for the prevention of 116 

26 alcoholism and drug abuse and treatment of alcoholics and 117 

27 addicts in cooperation with public and private agencies, 118 

28 organizations, schools and individuals and provide technical 

29 assistance and consultation services for these purposes. 119 

30 (g) To specify uniform methods for keeping statistical 121 

31 information by agencies, organizations and individuals and to 122 

32 collect and make available statistical information, including 123 

33 number of persons treated, frequency of admission and 124 

34 readmission and frequency and duration of treatment. 

35 (h) To receive data and assistance from federal, State 126 



331 



-3- LR38408154GLsb 

1 and local governmental agencies and to obtain copies of 127 

2 identification and arrest data from all federal, State and 128 

3 local law enforcement agencies for use in treatment, 129 

4 research, evaluation, licensing, regulation and monitoring. 

5 Information so obtained shall remain confidential. 130 

6 (i) To coordinate the funding of alcoholism and drug 132 

7 abuse functions, to accept gifts or grants and to act as the 134 

8 sole state agency to accept, receive and expend funds, grants 135 

9 and services from the Federal Government or its agents for 136 

10 the purposes set forth in Federal statutes relative to drug 137 

11 abuse and alcoholism and to deposit such federal funds into 

12 the Alcoholism and Substance Abuse Fund in the State Treasury 138 

13 which is hereby created, except funds received under the 139 

14 federal Alcohol, Drug Abuse and Mental Health Block Grant, 140 

15 which shall be deposited as elsewhere provided. Obligation 142 

16 and expenditure of public funds in the Fund may be made by 143 

17 the Department subject to appropriations by the General 144 

18 Assembly. 

19 ( j ) To make such . agreements, grants-in-aid and 146 

20 purchase-care arrangements with any other Department, 147 

21 authority or Commission of this State, of any other state or 149 

22 of the federal government, with any State or private 150 

23 university or with any public or private agency, including 

24 the furnishing of staff and disbursement of funds, as are 151 

25 appropriate to effectuate the purposes of this Act. 152 

26 (k) To designate and maintain medical examination and 154 

27 other facilities for alleged addicts or alcoholics for the 155 

28 purpose of determining whether such persons are addicts or 156 

29 alcoholics. 

30 (1) To designate, coordinate and assist rehabilitation 158 

31 centers and other necessary facilities for the supervision 159 

32 and treatment of addicts, alcoholics and abusers of alcohol 160 

33 or drugs. 

34 (m) To assign or transfer any addict placed under the 162 

35 treatment supervision of the Department pursuant to this Act 163 



- 332 



-4- LRB8408154GLsb 

1 to any person, association or corporation providing 164 

2 facilities or services approved by the Department pursuant to 

3 procedures and policies adopted by the Department, and agreed 165 

4 to by the person, association, or corporation to whom such 165 

5 addict is to be assigned or transferred; provided, however, 167 

6 that any addict sc transferred shall nevertheless continue to 168 

7 be under the treatment supervision of the Department. 

8 (n) To coordinate the efforts and enlist the assistance 170 

9 of all public and private agencies, organizations, and 171 

10 individuals interested in prevention of alcoholism and drug 172 

11 abuse. 

12 (o) To cooperate with the Department of Corrections in 174 

13 establishing and conducting programs to provide treatment for 175 

14 alcoholics and addicts in or on parole from penal 176 

15 institutions. 

16 (p) To cooperate with the State Superintendent of 178 

17 Education, boards of education, schools, police departments, 179 

18 courts, and other public and private agencies, organizations 180 

19 and individuals in establishing programs for the prevention 181 

20 of alcoholism and drug abuse and treatment of alcoholics and 

21 addicts, and preparing curriculum materials thereon for use 182 

22 at all levels of education, and to establish alcohol and 183 

23 substance abuse education and prevention programs in all 184 

24 Educational Service Regions in the State and to enter into 185 

25 agreements with the State Board Superintendent of Education 

26 to establish such education and prevention programs. 186 

27 (q) To prepare, publish, evaluate, and disseminate 188 

28 educational material dealing with the nature and effects of 199 

29 alcohol and dangerous drugs. 

30 (r) To develop and implement, as an integral part of 191 

31 treatment programs, an educational program for use in the 192 

32 treatment of alcoholics and addicts, which program shall 193 

33 include the dissemination of information concerning the 194 

34 nature and effects of alcohol and drugs. 

35 (s) To develop and coordinate, with regional and local 196 



- 333 - 



-5- LR38408154GLsb 

1 agencies, education and training programs for all persons 198 

2 engaged in treatment and detoxification of alcoholics and 199 

3 intoxicated persons, and in the rehabilitation of addicts. 

4 (t) To assist in the development of, and cooperate with, 201 

5 alcohol and drug education and treatment programs for 203 

6 employees of State and local governments and businesses and 204 

7 industries in the State. 

8 (u) To utilize the support and assistance of interested 206 

9 persons in the community, particularly recovered addicts and 207 

10 alcoholics, to encourage clients voluntarily to undergo 208 

11 treatment. 

12 (v) To promote and encourage general hospitals and other 210 

13 appropriate health facilities to admit without discrimination 211 

14 alcoholics, addicts, drug abusers and intoxicated persons and 212 

15 to provide them with adequate and appropriate treatment. 213 

16 (w) To encourage all health and disability insurance 215 

17 programs to include alcoholism and substance abuse as a 217 

18 covered illness. 

19 (x) To promote, conduct, assist and sponsor basic, 219 

20 clinical, epidemiological and statistical research in 220 

21 alcoholism and substance abuse either individually or in 222 

22 conjunction with any public or private agency. 

23 (y) To explore the feasibility of drafting a "Uniform 224 

24 Drug Arrest Form" to be used by all law enforcement agencies 225 

25 in this State. This form would be completed in all arrests 226 

26 involving the violation of law in relation to dangerous drugs 227 

27 and alcohol. The information contained in the completed form 228 

28 would include all data traditionally included in police forms 229 

29 as well as such specialized facts as may be of relevance to 230 

30 the Department in drafting its annual report. 

31 (z) To disseminate information relating to available 232 

32 services for addicts and abusers of dangerous drugs, 233 

33 alcoholics and intoxicated persons including an annual list 234 

34 of all public and private treatment facilities. 

35 (aa) To promulgate such rules and regulations as are 236 



334 



-6- LRB8408154GLsb 

1 necessary to the exercise of the Department's powers and 237 

2 duties under this Act. Such rules shall include: (i) the 233 

3 funding priorities of the Department; (ii) the standards used 2 39 

4 in determining whether to allow exemptions from the 240 

5 revenue/expense reporting requirements: and (iii) the 

6 standards used in determining whether to allow any exemptions 241 

7 to the rules. 

8 (bb) To encourage and promote the assessment and 243 

9 collection of fees for services provided by alcohol and drug 244 

10 abuse treatment programs and service providers who receive 245 

11 financial assistance in any form, directly or indirectly from 

12 the State or any of its departments or agencies; provided 246 

13 however, that no person shall be denied services by any 247 

14 program or facility approved or assisted under this Act 248 

15 because of inability to pay. 

16 (cc) To cooperate with the Department of Public Aid in 250 

17 the development and provision of services offered to 251 

18 recipients of public assistance for the treatment and 252 

19 prevention of alcoholism and substance abuse. 253 



335 - 



336 - 



BILL 23 



Background 

Following a review of the Department of Employment Security's rules (56 III. 
Adm. Code 2720), the Joint Committee on Administrative Rules issued an 
objection based upon the Department's failure to include within its rules the 
standards used by the Department to determine whether a claimant is "able to 
work, available for work, and actively seeking work." The Department 
responded to the Committee's objection by stating that these terms have 
significance as applied to an individual's experience, skills, physical and 
mental condition. Any attempt, however, to itemize these factors per 
individual, according to the Department, is neither feasible nor is it 
desirable, and therefore the Department refused to amend the rules. In 
refusing to modify its rules, the Department fails to recognize that pursuant 
to Section 4.02 of the Illinois Administrative Procedure Act, standards are 
required in order to fully inform those persons affected by the rules so that 
those persons will not be forced to resort to courts of law for case-by-case 
determinations regarding the ability, availability, and adequacy of the work 
search. The Department had detailed explanations of these terms in its 
Precedent Manuals and Policy Bulletins which have evolved over an extended 
period of time which presented much more detailed standards than those 
proposed by the Department, and currently uses a Digest of Opinions in 
making such determinations. 

Because the Department made no attempt to amend its rules to include the 
standards to determine whether a claimant is able, available, and actively 
seeking work, the Joint Committee recommended that the Unemployment 
Insurance Act be amended to require the Department to include within its 
rules the standards it uses. 



Amend Section 500 of the Unemployment Insurance Act (III. Rev. Stat. 1984 
Supp., ch. 48, par. 420) to require the Department of Employment Security 
to adopt rules, within one year of the effective date of this Act, which 
delineate the standards the Department uses in determining whether a claimant 
for unemployment insurance benefits is able to work, available to work and 
actively seeking work. Effective immediately. 



062 



337 



338 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Ch. 48, par. 420) 

Amends The Unemployment Insurance Act to 
require the Department of Employment Security to adopt within 
one year after the effective date of this amendacory Act 
standards used by the Department in determining whether a 
claimant for unemployment compensation is able to work, 
available for work and actively seeking work. Specifies the 
standards chat may be used by the Department in making such 
determination. Effective immediately. 



LRB8407707RCml 



A BILL FOR 



- 339 - 



LR38407707RCml 

1 AN ACT to amend Section 500 of "The Unemployment 59 

2 Insurance Act", approved June 30, 1937, as amended. 61 

3 Be it enacted by the People of the State of Illinois, 65 

4 represented in the General Assembly; 

5 Section 1. Section 500 of "The Unemployment Insurance 67 

6 Act", approved June 30, 1937, as amended, is amended to read 68 

7 as follows: 

(Ch. 48, par. 420) 70 

8 Sec. 500. Eligibility for benefits. An unemployed 72 

9 individual shall be eligible to receive benefits with respect 73 

10 to any week only if the Director finds that: 74 

11 A. He has registered for work at and thereafter has 76 

12 continued to report at an employment office in accordance 77 

13 with such regulations as the Director may prescribe, except 78 

14 that the Director may, by regulation, waive or alter either 79 

15 or both of the requirements of this subsection as to 80 

16 individuals attached to regular jobs, and as to such other 

17 types of cases or situations with respect to which he finds 81 

18 that compliance with 3uch requirements would be oppressive or 82 

19 inconsistent with the purposes of this Act, provided that no 83 

20 such regulation shall conflict with Section 400 of this Act. 84 

21 B. He has made a claim for benefits with respect co such 86 

22 week in accordance with such regulations as the Director may 87 

23 prescribe. 

24 C. He is able to work, and is available for work; 89 

25 provided that during the period in question he was actively 90 

26 seeking work and he has certified such on a form provided by 91 

27 the Department listing the places at which he has sought 9 2 

28 work; however, nothing in this subsection shall limit the 93 

29 Director's approval of alternate methods of demonstrating an 

30 active search for work based on regular reporting to a trace 94 

31 union office. 

32 I. If an otherwise eligible individual is unable to worx 96 



- 340 



-2- LRB8407707RCml 

1 or is unavailable for work on any normal workday of the week, 97 

2 he shall be eligible to receive benefits with respect to such . 98 

3 week reduced by one-fifth of his weekly benefit amount for 99 

4 each day of such inability to work or unavailability for 100 

5 work. For the purposes of this paragraph, an individual who 101 

6 reports on a day subsequent to his designated report day 102 

7 shall be deemed unavailable for work on his report day if his 

8 failure to report on that day is without good cause, and on 103 

9 each intervening day, if any, on which his failure to report 104 

10 is without good cause. As used in the preceding sentence, 105 

11 "report day" means the day which has been designated for the 106 

12 individual to report to file his claim for benefits with 107 

13 respect to any week. This paragraph shall not be construed 

14 so as to effect any change in the 3tatus of part-time workers 108 

15 as defined in Section 407. 109 

16 2. An individual shall be considered to be unavailable 111 

17 for work on days listed as whole holidays in "An Act to 112 

18 revise the law in relation to promissory notes, bonds, due 113 

19 bills and other instruments in writing," approved March 18, 114 

20 1874, as amended; on days which are holidays in his religion 115 

21 or faith, and on days which are holidays according to the 116 

22 custom of his trade or occupation, if his failure to work on 

23 such day is a result of the holiday. In determining the 117 

24 claimant's eligibility for benefits and the amount to be paid 118 

25 him, with respect to the week in which such holiday occurs, 119 

26 he shall have attributed to him as additional earnings for 120 

27 ' that week an amount equal to one-fifth of his weekly benefit 121 

28 amount for each normal work day on which he does not work 122 

29 because of a holiday of the type above enumerated. 

30 3. An individual shall be deemed unavailable for work 12 4 

31 if, after his separation from his most recent employing unit, 125 

32 he has removed himself to and remains in a locality where 126 

33 opportunities for work are substantially less favorable than 127 

34 those in the locality he has left. 

35 4. An individual shall be deemed unavailable for work 129 



341 



-3- LRB8407707RCml 

1 with respect to any week which occur3 in a period when his 130 

2 principal occupation is that of a student in attendance at, 131 

3 or on vacation from, a public or private school. 132 

4 5. Notwithstanding any other provisions of this Act, an 134 

5 individual shall not be deemed unavailable for work or to 135 

6 have failed actively to seek work, nor shall he be ineligible 136 

7 for benefits by reason of the application of the provisions 137 

8 of Section 603, with respect to any week, because he is 138 

9 enrolled in and is in regular attendance at a training course 139 

10 approved for him by the Director: (a) but only if, with 

11 respect to that week, the individual presents to the claims 140 

12 adjudicator referred to in Section 702 a statement executed 141 

13 by a responsible person connected with the training course, 142 

14 certifying that the individual was in full-time attendance at 143 
13 such course during the week. The Director may approve such 14 4 

16 course for an individual only if he finds that (1) reasonable 145 

17 work opportunities for which the individual is fitted by 146 

18 training and experience do not exist in his locality; (2) the 

19 training course relates to an occupation or skill for which 147 

20 there are, or are expected to be in the immediate future, 148 

21 reasonable work opportunities in his locality; (3) the 149 

22 training course is offered by a competent and reliable 150 

23 agency, educational institution, or employing unit; (4) the 151 

24 individual has the required qualifications and apcicudes to 

25 complete the course successfully; and (5) the individual is 152 

26 not receiving and is not eligible (other than because he has 153 

27 claimed benefits under this Act) for subsistence payments or 154 

28 similar assistance under any public or private retraining 155 

29 program: Provided, that the Director shall not disapprove 155 

30 such course solely by reason of clause (5) if the subsistence 

31 payment or similar assistance is subject to reduction by an 157 

32 amount equal to any benefits payable to the individual under 158 

33 this Act in the absence of the clause. In the event that an 159 

34 individual's weekly unemployment compensation benefit i3 less 160 

35 than his certified training allowance, that person shall be 161 



- 3H2 



-4- LRB8407707RCml 

1 eligible to receive his entire unemployment compensation 162 

2 benefits, plus such supplemental training allowances that 

3 would make an applicant's total weekly benefit identical to 163 

4 the original certified training allowance. 164 

5 (b) The Director shall have the authority to grant 166 

6 approval pursuant to subparagraph (a) above prior to an 167 

7 individual's formal admission into a training course. 168 

8 Requests for approval shall not be made more than 30 days 169 

9 prior to the actual starting date of such course. Requests 

10 shall be made at the appropriate unemployment office. 170 

11 (c) The Director shall for purposes of paragraph C have 172 

12 the authority to issue a blanket approval of training 173 

13 programs implemented pursuant to the Comprehensive Employment 174 

14 and Training Act and the Job Training Partnership Act if both 175 

15 the training program and the criteria for an individual's 

16 participation in such training meet the requirements of this 176 

17 paragraph C. 

18 6. Notwithstanding any other provisions of this Act, an 178 

19 individual shall not be deemed unavailable for work or to 179 

20 have failed actively to seek work, nor shall he be ineligible 180 

21 for benefits, by reason of the application of the provisions 181 

22 of Section 603 with respect to any week because he is in 182 

23 training approved under Section 236 (a)(1) of the federal 

24 Trade Act of 1974, nor shall an individual be ineligible for 183 

25 benefits under the provisions of Section 601 by reason of 184 

26 . leaving work voluntarily to enter such training if the work 185 

27 left is not of a substantially equal or higher skill level 

28 than the individual's past: adversely affected employment as 186 

29 defined under the federal Trade Act of 1974 and the wages for 187 

30 such work are less than 80% of his average weekly wage as 188 

31 determined under the federal Trade Act of 1974. 

32 D. The Department shall adoot, within one year of the 190 

33 effective date of this amendatory Act of 1986, rules which 191 

34 prescribe the standards used by the Department in determining 192 

35 whether a claimant is able to work, available for work and 193 



-5- LRB8407707RCal 

1 actively seeking work. 193 

2 1. The standards used in determining whether a claimant 19 5 

3 is able to work may include, but shall not be limited to, the 196 

4 extent to which types of physical or mental conditions (such 197 

5 as age, contagious disease, loss of hearing, speech, vision, 198 
5 loss of use of limb, illness or injury, intoxication or 199 

7 pregnancy) render the claimant unable to work. 

8 2. The standards used in determining whether a claimant 201 

9 is available for work may include, but shall not be limited 20 2 

10 to, what is considered by the Department to be suitable work 203 

11 in terms of experience and training, the types of work which 204 

12 will be considered by the Department to be outside the 205 

13 claimant's customary occupation, the types of working 

14 conditions which will be considered by the Department to 206 

15 constitute a risk to the health and safety of the claimant, 207 

16 and the types of personal circumstances which will be 208 

17 considered by the Department in determining whether a 

18 claimant is available for work, such as the distance to work, 209 

19 care of children, household duties, illness, or death of 210 

20 others, voluntary leaving, incarceration, and public service. 211 

21 In addition, the standards shall include an explanation of 212 

22 the Department's consideration of claimant imposed 213 

23 restrictions on the types of work he or she will accept, such 

24 as religious and moral objections, contractual obligations, 214 

25 physical restrictions, travel restrictions and wage 215 

26 restrictions. 

27 3. The standards used in determining whether a claimant 217 

28 is actively seeking work may include, but shall not be 218 

29 limited to, the type and amount of work search effort 219 

30 required, negative attitudes or behavior or other evidence 220 

31 indicative of an insincere work search, any methods which 

32 must be utilized in seeking employment, the relevance of the 221 

33 failure to take advantage of a job opportunity and the 222 

34 failure to apply for work as directed by an employer, 223 

35 appearance in relation to the type o£ employment sought, and 224 



344 - 



-6- LRB8407707RCml 

1 any consideration to be given to existing labor market 22 4 

2 conditions. 

3 E. Bv If his benefit year begins prior to July 6, 1975 226 

4 or subsequent to January 2, 1982, he has been unemployed for 228 

5 a waiting' period of 1 week during such benefit year. If his 229 

6 benefit year begins on or after July 6, 1975, but prior to 

7 January 3, 1982, and his unemployment continues for more than 231 

8 three weeks during such benefit year, he shall be eligible 232 

9 for benefits with respect to each week of such unemployment, 

10 including the first week thereof. An individual shall be 233 

11 deemed to be unemployed within the meaning of this subsection 234 

12 while receiving public assistance as remuneration for 235 

13 services performed on work projects financed from funds made 236 

14 available to governmental agencies for such purpose. No week 237 

15 shall be counted as a week of unemployment for the purposes 238 

16 of this subsection: 

17 1. Unless it occurs within the benefit year which 240 

18 includes the week with respect to which he claims payment of 241 

19 benefits, provided that, for benefit years beginning prior to 242 

20 January 3, 1982, this requirement shall not interrupt' the 243 

21 payment of benefits for consecutive weeks of unemployment; 244 

22 and provided further that the week immediately preceding a 245 

23 benefit year, if part of one uninterrupted period of 245 

24 unemployment which continues into such benefit year, shall be 

25 deemed (for the purpose of this subsection only and with 2 47 

26 respect to benefit years beginning prior to January 3, 1982, 248 

27 only) to be within such benefit year, as well as within the 249 

28 preceding benefit year, if the unemployed individual would, 250 

29 except for the provisions of the first paragraph and 251 

30 paragraph 1 of this subsection and of Section 605, be 

31 eligible for and entitled to benefits for such week. 252 

32 2. If benefits have been paid with respect thereto. 254 

33 3. Unless the individual was eligible for benefits with 255 

34 respect thereto except for the requirements of this 257 

35 subsection and of Section 605. 258 



345 



-7- LRB8407707RCml 

1 |\_ St With respect to any benefit year beginning prior 260 

2 to January 3, 1982, he has been paid during his base period 261 

3 wages for insured work not less than the amount specified in 262 

4 this paragraph Seetion — 588E — ©f-tehis— Ae* as amended and in 264 

5 effect en October 5, 1980. With respect to any benefit year 265 

6 beginning on or after January 3, 1982, he has been paid 266 

7 during his base period wages for insured work equal to not 267 

8 less than $1,600, provided that he has been paid wages for 

9 insured work equal to at least S440 during that part of his 268 

10 base period which does not include the calendar quarter in 269 

11 which the wages paid to him were highest. 270 

12 Section 2. This Act takes effect upon becoming law. 272 



- .146 



PILL 24 



Background 

At its September 20, 1984 meeting, the Joint Committee on Administrative 
Rules issued a recommendation for rulemaking to the Department of 
Rehabilitation Services regarding Homemaker Services contracts (89 III. Adm. 
Code 712). The Joint Committee recommended that the Department promulgate 
rules which would set forth the criteria it employs when awarding homemaker 
services contracts. The Department failed to respond to the Joint Committee's 
rulemaking recommendation resulting in this legislative proposal. 

In awarding homemaker services contracts, the Department exercises a 
significant discretionary power. The standards by which this discretion is 
exercised must be in rules pursuant to Section 4.02 of the Illinois 
Administrative Procedure Act. The discretionary power to award contracts is 
one which can have significant economic impact upon the persons or agencies 
applying for such contracts. Without standards for the exercise of discretion 
in this area, the potential for arbitrary and capricious action is great, 
therefore this legislation is necessary in order to require the Department to 
promulgate rules which include such standards. 

Summary 

Amends Section 3(g) of "An Act in relation to the rehabilitation of disabled 
persons" (III. Rev. Stat. 1984 Supp., ch. 23, par. 3434, as amended) to 
require the Department of Rehabilitation Services to promulgate as rules its 
standards for awarding homemaker services contracts. Effective immediately. 



532 



- 347 



348 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Ch. 23, par. 3434) 

Amends an Act in relation to rehabilitation of 
disabled persons. Requires that the Department of 
Rehabilitation Services establish by rule its standards for 
awarding homemaker services contracts. Effective 
immediately. 



LRB8407585JMCS 



A BILL FOR 



349 



LR38407585JMcs 

1 AN ACT to amend Section 3 of "An Act in relation to 47 

2 rehabilitation of disabled persons", approved June 28, 1921, 48 

3 as amended. 49 

4 Be it enacted by the People of the State of Illinois, 5 3 

5 represented in the General Assembly: 

6 Section 1. Section 3 of "An Act in relation to 55 

7 rehabilitation of disabled persons", approved June 28, 1921, 56 

8 as amended, is amended to read as follows: 

(Ch. 23, par. 3434) 58 

9 Sec. 3. The Departmenc shall have the powers and duties 60 

10 enumerated herein: 61 

11 (a) To co-operate with the federal government in the 63 

12 administration of the provisions of the Federal 64 

13 Rehabilitation Act of 1973, as amended, and of the Federal 65 

14 Social Security Act to the extent and in the manner provided 66 

15 in these acts; 

15 (b) To prescribe and supervise such courses of 68 

17 vocational training and provide such other services as may be 59 

18 necessary for the habilitation and rehabilitation of disabled 70 

19 persons, including the administrative activities under 71 

20 subsection (f) of this Section, and to co-cperate with s-.are 72 

21 and local school authorities and other recognized agencies 

22 engaged in habilitation, rehabilitation and comprehensive 73 

23 rehabilitation services; and to cooperate with the Departmenc 75 

24 of Children and Family Services regarding the care and 76 

25 education of handicapped children; 

26 (c) To make such reports and submit such plans to the 78 

27 federal government as are required by the provisions of the 79 

28 Federal Rehabilitation Act of 1973, as amended, and by the 80 

29 rules and regulations of the federal agency or agencies 81 

30 administer ing the Federal Rehabilitation Act of 1973, as 82 

31 amended, and the Federal Social Security Act; 83 

32 (d) To report in writing, to the Governor, annually on 85 

- 350 - 



-2- LRB8407585JMCS 

L or before the first day of December, and at such other times 86 

2 and in such manner and upon such subjects as the Governor may 87 

3 require. The annual report shall contain (1) a statement of 88 

4 the existing condition of comprehensive rehabilitation 89 

5 services, habilitation and rehabilitation in the State; (2) a 90 

6 statement of suggestions and recommendations with reference 

7 to the development of comprehensive rehabilitation services, 91 

8 habilitation and rehabilitation in the State; and (3) an 92 

9 itemized statement of the amounts of money received from 93 

10 Federal, Stace and other sources, and of the objects and 94 

11 purposes to which the respective items of these several 95 

12 amounts have been devoted; 

13 (e) To furnish financial assistance to deserving blind 97 

14 or deaf residents of Illinois who are regularly enrolled 98 

15 students, pursuing a course of study in a university, 99 

16 college, conservatory of music or a normal, professional or 100 

17 vocational school. The amount of aid to any student shall 101 

18 not, under ordinary circumstances exceed $400 per annum, but 102 

19 where the Department may consider that added assistance is 103 

20 necessary, the amount may be increased to $1000 per annum. 

21 Money so furnished shall be expended under the direction and 104 

22 supervision of the Department. Upon presentation of proper 105 

23 vouchers certified and approved by the Director, the State . 106 

24 Comptroller shall draw his warrants therefor upon the State 107 

25 Treasurer; and 

26 (f) To exercise, pursuant to Section 13 of this Act, 109 

27 executive and administrative supervision over all 110 

28 institutions, divisions, programs and services now existing 111 

29 or hereafter acquired or created under the jurisdiction of 

30 the Department, including, but not limited to, the following: 113 

31 The Illinois School for the Visually Impaired at 115 

32 Jacksonville, as provided under Section 10 of this Act, 116 

33 The Illinois School for the Deaf at Jacksonville, as 118 

34 provided under Section 10 of this Act, 119 

35 The Illinois Children's School and Rehabilitation Center 121 

- 351 - 



-3- LRB8407585JMCS 

1 at Chicago, as provided under Section 11 of this Act, and 123 

2 The Illinois Visually Handicapped Institute, as provided 125 

3 under Section 12 of this Act. 126 

4 The 'Department shall assume all property, records, 129 

5 personnel and funds relating to these institutions from the 130 

6 Department of Children and Family Services on the effective 131 

7 date of this amendatory Act of 1979. 

3 The transfer to the Department of employees of the 134 

9 Department of Children and Family Services who are employed 

10 by the transferred institutions, facilities and services does 135 

11 not affect the status of such employees under the provisions 136 

12 of the "Personnel Cede" or other laws relating to State 137 

13 employees, nor shall any admissions or obligations of such 138 

14 institutions, facilities and services be affected thereby. 139 

15 (g) To establish a program of services to prevent 142 
15 unnecessary institutionalization of persons with Alzheimer's 

17 disease and related disorders, persons in need of long term 143 

18 care who are established as blind or disabled as defined by 144 

19 the Social Security Act o*-who-a?e-eafeabiiahed-aa-pe?aona-who 145 

2 suffer — from — Aiaheiaer-'-s-diseaae-er-a-reiated-iaiaore e?-aneer 145 

21 fehe-Aiaheimer-'-a-Biaeeae-Aaaiateanee-AefcT— anaeied-by — the — 84 th 147 

22 Genera* — Asaembiy, thereby enabling them to remain in their 148 

23 own homes or other living arrangements. Such preventive 149 

24 services may include, but are not .limited to, any or all of 150 

25 the following: 

26 (1) home health services; 152 

27 (2) home nursing services; 154 

28 (3) homemaker services; 156 

29 (4) chore and housekeeping services; 158 

3 (5) day care services; 150 

31 (5) home-delivered meals; 162 

32 (7) education in self-care; 164 

33 (8) personal care services; 156 

34 (9) adult day health services; 158 

35 (10) ha bilitaticn services; 170 

- 352 - 



-4- LR38407585JMCS 

1 (11) respite care; or 172 

2 (12) other nonmedical social services that may enable 174 

3 the person to become self-supporting. 175 

4 The Department shall establish eligibility standards for 178 

5 such services taking into consideration the unique economic 179 

6 and social needs of the target population for whom they are 

7 to be provided. Such eligibility standards may be based on 180 

8 the recipient's ability to pay for services; provided, 181 

9 however, that in determining the amount and nature of 182 

10 services for which a person may qualify, consideration shall 183 

11 not be giver, to the value of cash, property or other assets 

12 held in the name of the person's spouse pursuant to a written 184 

13 agreement dividing marital property into equal but separate 185 

14 shares or pursuant to a transfer of the person's interest in 186 

15 a home to his spouse, provided that the spouse's share of the 187 

16 marital property is not made available to the person seeking 188 

17 such services. The target population identified for the 189 

18 purposes of this paragraph (g) are persons with an identified 190 

19 need for rehabilitation services. Priority shall be given to 191 

20 those who are at imminent risk of institutionalization. The 192 

21 services shall be provided to eligible persons to the extent 193 

22 that the cost of the services together with the other 194 

23 personal maintenance expenses of the persons are reasonably 

24 related to the standards established for care in a group 195 

25 facility appropriate to the person's condition. These 196 

26 non-institutional services, pilot projects or experimental 197 

27 facilities may be provided as part of or in addition to those 198 

28 authorized by federal law or those funded and administered by 199 

29 the Illinois Department on Aging. 

30 The Department shall execute, relative to the nursing 201 

31 home prescreening project, written inter-agency agreements 202 

32 with the Department on Aging and the Department of Public 203 

33 Aid, to effect the following: (i) intake procedures and 204 

34 common eligibility criteria for those persons who are 

35 receiving non-institutional services; and (ii) the 205 

- 353 - 



-5- LR38407585JMCS 

1 establishment and development of non-institutional services 206 

2 in areas of the State where they are not currently available 

3 or are undeveloped. 207 

4 The Department is authorized to charge and collect fees 209 

5 for services provided under this Section, such fees to be 210 

6 based upon the recipient's ability to pay for services, but 211 

7 in no case to exceed the actual cost of the services 212 

8 provided. By January 1, 1987, the Department shall 213 

9 promulgate rules setting forth its standards for the award of 214 

10 homemaker services contracts. 

11 The Department and the Department on Aging shall 216 

12 cooperate in the development and submission of an annual 217 

13 report on programs and services provided under this Section. 218 

14 Such joint report shall be filed with the Governor and the 219 

15 General Assembly on or before September 30 each year. 220 

16 The requirement for reporting to the General Assembly 222 

17 shall be satisfied by filing copies of the report with the 223 

18 Speaker, the Minority Leader and the Clerk of the House of 224 

19 Representatives and the President, the Minority Leader and 225 

20 the Secretary of the Senate and the Legislative Research 226 

21 Unit, as required by Section 3.1 of "An Act to revise the law 227 

22 in relation to the General Assembly", approved February 25, 228 

23 1874, as amended, and filing such additional copies with the 229 

24 State Government Report Distribution Center for the General 

25 Assembly as is required under paragraph (t) of Section 7 of 230 

26 the State Library Act. 

27 (h) To establish such subdivisions of the Department as 233 

28 shall be desirable and assign to the various subdivisions the 

29 responsibilities and duties placed upon the Department by 234 

30 law. 

31 (i) To cooperate and enter into any necessary agreements 236 

32 with the Department of Employment Security for the provision 237 

33 of job placement and job referral services to clients of the 238 

34 Department, including job service registration of such 239 

35 clients with Illinois Employment Security offices and making 240 

- 354 - 



-6- LRB8407585JMCS 

1 job listings maintained by the Department of Employment 241 

2 Security available to such clients. 

3 ( j ) To possess all powers reasonable and necessary for 243 

4 the exercise and administration of the powers, duties and 245 

5 responsibilities of the Department which are provided for by 

6 law. 246 

7 Section 2. This Act shall take effect upon becoming law. 248 



- 355 - 



356 



RILL 25 

Background 

After reviewing the Law Enforcement Merit Board's rules entitled "Procedures 
of the Department of Law Enforcement Merit Board" (80 III. Adm. Code 
150.680(a)), the Joint Committee on Administrative Rules discovered that 
Section 150.680(a) of the Board's rules was in violation of Section 4.02 of the 
Illinois Administrative Procedure Act, which provides that each rule which 
implements a discretionary power to be exercised by an agency must include 
the standards by which the agency shall exercise that power. The Board's 
rules did not include the standards used by the Board to determine whether 
an officer who is found not guilty or has served a greater period of 
suspension than prescribed by the Board shall receive compensation. The 
Joint Committee recommended that legislation be developed to require that the 
Board include within its rules the standards used by the Board to determine 
whether an officer will receive compensation under the previously mentioned 
circumstances. 



Summary 

Amends "An Act in relation to the State Police" (II!. Rev. Stat. 1984 Supp., 
ch. 121, par. 307.13, as amended by P. A. 84-25, effective July 18, 1985) to 
require the Department of State Police Merit Board to include within its rule 
the standards it uses to determine whether compensation will be awarded to a 
police officer who is found not guilty or has served a greater period of 
suspension than prescribed by the Board. Effective immediately. 



248 



357 



- 358 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Ch. 121, par. 307.13) 

Amends an Act in relation to the State Police. 
Requires that the State Police Merit Board establish by rule 
the standards used in determining whether to compensate 
officers found not guilty of rules violations or suspended 
for a period longer than prescribed by the Board. Effective 
immediately. 



LHB8407578JMCS 



A BILL FOR 



3f>9 - 



LRB8407578JMCS 

1 AN ACT to amend Section 13 of "An Act in relation to the 50 

2 State Police", approved July 20, 1949, as amended. 52 

3 Be it enacted by the People of the State of Illinois, 56 

4 represented in the General Assembly: 

5 Section 1. Section 13 of "An Act in relation to the 58 

6 State Police", approved July 20, 1949, as amended, is amended 59 

7 to read as follows: 

(Ch. 121, par. 307.13) 61 

8 Sec. 13. Disciplinary measures prescribed by the 3oard 63 

9 for Department of Law Enforcement officers may be taken by 64 

10 the Director, Superintendent or the Deputy Director of the 65 

11 Division to which the person is assigned, for the punishment 66 

12 of infractions of the rules and regulations of the respective 

13 divisions as promulgated by the Department. Such disciplinary 67 

14 measures may include suspension of any such officer for a 68 

15 reasonable period, not exceeding 30 days. 

16 Any officer so suspended, within 10 days after 70 

17 suspension, may petition the 3oard in writing to review the 71 

18 suspension, and upon the filing of such petition with the 72 

19 Board, the Board shall within a reasonable amount of time, 73 

20 but no later than 30 days after the dace of request for 

21 review set the written petition for hearing before the Board 74 

22 upon not less than 10 days' notice at a place co be 75 

23 designated by the chairman thereof. The 3card may sustain 76 

24 the action of the Director, Superintendent or Deputy 77 

25 Director, reverse it with instructions that the officer 

26 receive his pay for the period involved, or reduce the length 78 

27 of suspension with instructions that the officer's pay be 79 

28 adjusted accordingly. No later than July 1, 1987, the Board 80 

29 shall promulgate rules which include the standards to be used 31 

30 in determining when compensation will be awarded to an 8 2 

31 officer who is found not guilty or has served a greater 3 3 

32 period of suspension than prescribed by the Board. The Board 34 

- 360 - 



-2- LRB8407578JMCS 

1 may not increase the length of suspension imposed by the 85 

2 Director, Superintendent or the Deputy Director. The Board 86 

3 may, by unanimous decision, dismiss the petition if it has 87 

4 determined that there i3 no substantial basis for its review 

5 of the suspension. In all other respects, the hearing shall 88 

6 be conducted in the manner provided for in Section 14 hereof. 89 

7 The provisions of the "Administrative Review Law" and the 90 

8 rules adopted pursuant thereto shall apply to and govern all 91 

9 proceedings for the judicial review of any order of the board 

10 rendered pursuant to the provisions of this Section. 93 

11 Section 2. This Act takes effect upon becoming law. 95 



361 - 



362 



RILL 26 



Background 

On January 17, 1985, the Joint Committee on Administrative Rules voted to 
object to the Illinois Community College Board's rules entitled "Administration 
of the Illinois Public Community College Act" (23 III. Adm. Code 1501). The 
Joint Committee's review of these rules revealed that they were incomplete 
because they did not specify the information that the Board requires of 
community college districts when they apply for approval of new colleges and 
branches, when they apply to extend courses into non-district territory and 
when they apply for approval of new programs. 

The Board has indicated that the requisite information is specified on forms 
provided by the Board which must be completed by the district. The 
information required meets the definition of "rule" included in the Illinois 
Administrative Procedure Act, and therefore should be promulgated as such. 
The Board has refused to modify its rules. The Joint Committee believes that 
the Board's refusal to modify its rules to include the requisite information 
leaves it open to the threat of litigation. It is logical for community college 
districts and community colleges to contend that the Board's requirements 
contained in its application forms are not enforceable against any person due 
to the fact that those requirements have not been promulgated as rules. 
Therefore, the Joint Committee has directed that legislation be drafted 
requiring the Illinois Community College Board to promulgate as rules the 
information it requires of community college districts when they apply for 
approval of new colleges and branches, as well as when they apply to extend 
courses into non-district territory, and when they apply for approval of new 
programs. 

Summary 

Amends the Illinois Public Community College Act (III. Rev. Stat. 1983, ch. 
122, par. 102-4) to require the Illinois Community College Board to 
promulgate as rules the information it requires of community college districts 
when they apply for approval of new colleges and branches, when they apply 
to extend courses with non-district territory, and when they apply for 
approval of new programs. Effective immediately. 



484 



363 



364 



84th GENERAL ASSEMBLY 
State cf Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Ch. 122, par. 102-4) 

Amends the Public Community College Act to 
require the State Board to promulgate as rules che 
information it requires of community college districts when 
they apply for approval of new colleges and branches, when 
they apply to extend courses into non-cistricc terricory, and 
when they apply for approval of new programs. Effective 
immediately. 



LH38407891TEJ3 



A BILL FOR 



;65 



LR38407891THJS 

1 AN ACT to amend Section 2-4 of the "Public Community 55 

2 College Act", approved July 15, 1365, as amended. 57 

3 3e it enacted by the People of the State of Illinois, 61 

4 represented in the General Assembly: 

5 Section 1. Section 2-4 of the "Public Community College 63 

6 Act", approved July 15, 1965, as amended, is amended to read 54 

7 as follows: 

(Ch. 122, par. 102-4) 65 

8 Sec. 2-4. The State 3oard shall have the power to make 68 

9 and provide rules and regulations not inconsistent with the 59 

10 provisions of this Act fi©*-fe3»e-strape*-adBii»is*saeian-©;-«ia 70 

11 het. The rules shall include, but shall not be limited to: 71 

12 (a) the information which the State Board racuires of 7 2 

13 community college districts when applying for approval cf new 

14 colleges and branches, including (i) the name, district 73 

15 number, and college number of the collece applying for 74 

16 approval of a new branch, (ii) the name, location, and 7 5 

17 address of the proposed branch, and ( iii 1 the proposed date 

13 of implementation of the application: (b) the information 75 

19 which the State Board requires of community collece districts 77 

20 when applying for approval to extend courses into 73 

21 non-district territory,- including- (i) the name, district 7 9 

22 number, and college number of the college submitting the 

23 application to the State Board, (ii) each location to which 80 

24 the college intends to extend existing courses, (_iii| the 81 
2 5 course prefix, number and title, the term the course is to be 3 2 

26 offered, and the expected midterm enrollment for each course, 3 3 

27 (iv) the name of the orcanization or group requesting the 8 4 

28 course extension, and (v) a description of financial sucoort 

2 9 for the extension of courses; and (ci the information which 3 5 

30 the State 3oard requires or community collece districts when 8 6 

31 applying for approval cf new programs, including (i) the 37 

32 community collece district name and number, (ii) the name, 88 

- 366 - 



-2- LR38407891THJS 
1 location, and address of the proposed college, and (iii) the 



proposed date of implementation of the application. The 
State Board aav not recuire information other than that 



specified 



:e rules. Such rules and regulations and 



changes therein shall be filed and shall become effective as 
provided by "The Illinois Administrative Procedure Act", 
approved September 22, 1975 u ftn-Ae--esReerni!;g-aeair.'r9-ratife 
?a=eaT u -a=o?ove«-sttrte-i4T-r95i, as now or hereafter amended. 



Section 2. This Act takes effect upon becoming law. 



96 



3G? 



- 368 



DILL 27 



Background 

The Joint Committee on Administrative Rules issued two objections to the 
Department of Public Aid's rules entitled "Medical Payment, Clients with 
Exceptional Nursing Care Needs" (89 III. Adm. Code 140.569) based upon a 
lack of statutory authority on the part of the Department. 

The first objection cites the Department's lack of authority to impose upon 
group care facilities, as a precondition for the receipt of a special rate of 
payment for services provided to clients with exceptional nursing care needs, 
physical requirements and requirements as to the qualifications of personnel. 
The General Assembly has specifically delegated the authority to determine 
minimum standards for patient or client care in, and, licensure of, nursing 
home facilities to the Illinois Department of Public Health . The Department of 
Public Health's "Minimum Standards for Licensure of Skilled Nursing and 
Intermediate Care Facilities" include rules concerning the staffing, emergency 
procedures, and necessary equipment in skilled nursing care facilities. 

The Department also lacks the authority to review whether a nursing home 
facility has met the licensure and certification standards for skilled nursing 
care and exceptional skilled nursing care of the Department of Public Health. 
The Public Aid Code does not authorize the Department of Public Aid to 
delineate the physical plant and staffing requirements of a nursing home 
facility. The General Assembly has specifically delegated the authority to 
determine the minimum standards for patient or client care in, and the 
licensure of, nursing home facilities to the Department of Public Health. 

For these reasons, the Joint Committee has directed that the Public Aid Code 
be amended to clarify that all skilled nursing care facilities receiving payment 
for exceptional care needs must meet the licensure and certification 
requirements as may be established by the Department of Public Health. This 
proposal also clarifies that the Department of Public Aid may only make 
payments for exceptional care to those nursing facilities which meet all of the 
Department of Public Health's requirements. 

Summary 

Amends Section 5-5. 8a of the Public Aid Code (P. A. 84-922, effective January 
1, 1986) to require skilled nursing facilities receiving payment for exceptional 
care needs to meet licensure and certification requirements as well as any 
other special conditions for providing such care as may be established by the 
Department of Public Health. Effective immediately. 



259 



- 369 



370 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Ch. 23, par. 5-5. 8a) 

Amends The Illinois Public Aid Code. Specifies 
only the Department of Public Health is responsible for 
determining whether licensure and certification requirements 
for skilled nursing care facilities have been met. Provides 
the Department of Public Aid may make exceptional medical 
care payments only to skilled nursing facilities which meet 
the Department of Public Health's licensure and certification 
requirements and any other special conditions imposed by the 
Department of Public Health for the provision of "exceptional 
medical care. Effective immediately. 



LHB8407890CMtc 



A BILL FOR 



37' 



LRB8407890CMtc 

1 AN ACT to amend Section 5-5. 3a of "The Illinois Public 52 

2 Aid Code", approved April 11, 1967, as amended. 54 

3 3e it enacted by the People of the State of Illinois, 53 

4 represented in the General Assembly: 

5 Section 1. Section 5-5. 8a of "The Illinois Public Aid 60 

6 Code", approved April 11, 1967, as amended, is amended to 61 

7 read as follows: 

(Ch. 23, par. 5-5. 8a) 63 

8 Sec. 5-5. 8a. Payment for Exceptional Care. For the 65 

9 provision of exceptional medical care, the Illinois 66 

10 Department of Public Aid may make payments only to indiviaaai 67 

11 skilled nursing facilities which meet such licensure and 68 

12 certification requirements, and other special conditions for 69 

13 providing such care, as may be prescribed by the Department 70 

14 of Public Health for— the—provision — of — •xeeptionai—medieai 71 

15 ease. Only the Department of Public Health shall be 72 
15 responsible for determining whether licensure and 73 

17 certification requirements for skilled nursing care 

18 facilities have been met. The rate of payment shall be 75 

19 negotiated with the facilities offering to provide the 

20 exceptional medical care. A facility's costs of providing 76 

21 exceptional care shall not be considered in determining the 77 

22 rate of payment to skilled nursing facilities pursuant to 73 

23 Sections 5-5.3 through 5-5.5. Payment for exceptional 79 

24 medical care shall not exceed the rate wnich the Illinois 80 

25 Department would be required to pay under the Medical 31 

26 Assistance Program for the same care in a hospital. 32 

27 Section 2. This Act takes effect upon its becoming a law. 84 



- 372 - 



CILL 28 



Background 

During its review of the Department of Registration and Education's rules 
governing the Pharmacy Practice Act (68 III. Adm. Code 330), the Joint 
Committee on Administrative Rules discovered that the rules exceeded the 
Department's statutory authority in two respects. First, the rules prohibited 
the transfer of prescriptions between pharmacies more than one time, even if 
the the prescription was refillable. Second, the rules required that a 
pharmacy licensed in more than one division (retail, institutional, etc.) 
designate a different pharmacist-in-charge for each division. The Committee 
voted to develop legislation amending the Pharmacy Practice Act to require 
"prescriber authorizations" (allowing the transfer of a prescription beyond the 
one-time limit per a phone call from the pharmacist to the doctor prescribing 
the medication) as a method by which prescriptions may be transferred 
beyond the one transfer limitation. 

The legislative proposal also clarifies that a pharmacy licensed in more than 
one division need not designate a different pharmacist-in-charge for each 
division. The Department contended that the unique duties and 
responsibilities associated with each pharmacy division warrants a different 
pharmacist-in-charge for each division of a pharmacy that is licensed in more 
than one division. The Department's contention is not supported by the 
language of the Pharmacy Practice Act which requires each pharmacy to 
designate a pharmacist-in-charge but does not require a pharmacy licensed in 
more than one division to designate a different pharmacist-in-charge for each 
division. The Joint Committee believes that had the legislature intended for 
each division to have a pharmacist-in-charge, that requirement would have 
been included in the enacting language creating the pharmacy division. 

Summary 

Amends Sections 8 and 10 of the Pharmacy Practice Act (III. Rev. Stat. 1983, 
ch. 111, par. 4028 and 4031) to clarify that pharmacies licensed in more than 
one division need not designate a different pharmacist-in-charge for each 
division. In addition, the Act is being amended to require "prescriber 
authorizations" (allowing for the transfer of a prescription beyond the 
one-time limit per a phone call from the pharmacist to the prescriber) as a 
method by which prescriptions may be transferred beyond the established one 
transfer limitation currently imposed. Effective immediately. 



153 



- 373 - 



374 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Ch. HI, para. 4028 and 4031) 

Amends the Pharmacy Practice Act. Specifies a 
prescription may be transferred only once between pharmacies, 
but provides additional transfers may be made at the request 
of the patient through a "prescriber authorization." Further 
specifies a registered pharmacy may be licensed in more "than 
one division, but shall have only one pharmacist in charge to 
oversee all divisions. Effective immediately. 



LRB8407892CMtc 



A BILL FOR 



LRB8407392CMtc 

1 AN ACT to amend Sections 8 and 10 of the "Pharmacy 50 

2 Practice Act", approved July 11, 1955, as amended. 52 

3 Be it enacted by the People of the State o£ Illinois, 56 

4 represented in the General Assembly; 

5 Section 1. Sections 8 and 10 of the "Pharmacy Practice 58 

6 Act", approved July 11, 1955, as amended, are amended to read 59 

7 as follows: 

(Ch. Ill, par. 4028) 61 

8 Sec. 8. It shall be unlawful for the owner of any 63 

9 drugstore, shop or other place in this State, defined in this 64 

10 Act as "a pharmacy" or as "a drug store", to operate or 65 

11 conduct the same, or to allow the same to be operated or 66 

12 conducted, unless: 

13 (a) It has a Registered Pharmacist or an Assistant 68 

14 Registered Pharmacist, authorized to practice pharmacy in 69 

15 this State under the provisions of this Act, on duty whenever 70 

16 the pharmacy within the establishment is open to the public; 

17 (b) Security provisions for all drugs and devices, as 72 

18 determined by the Board, are provided during the absence from 73 

19 the Registered Pharmacy of all Registered Pharmacists or 74 

20 Assistant Registered Pharmacists. Maintenance of security 75 

21 provisions is the responsibility of. the Registered Pharmacist 

22 in charge; and 76 

23 (c) The pharmacy is registered under this Act to do 73 

24 business. 

25 The Department, upon the recommendation of the 3oard, 80 

26 shall establish divisions of pharmacy licenses by which 81 

27 practice i3 authorized. A Registered Pharmacy may be 8 2 

28 licensed in more than one division, and the Registered 3 3 

29 Pharmacist in charge shall oversee each division. Mo nore 

30 than one Pharmacist-in-charae shall be designated oer 84 

31 pharmacy. The Department shall and provide requirements for 85 

32 each division by rule as follows: 

- 376 - 



-2- LRB8407892CMtc 

1 Division I. Retail licenses for pharmacies which are 87 

2 open to, or offer pharmacy services to, the general public. 88 

3 Division II. Institutional licenses for pharmacies 90 

4 located in hospitals, extended care facilities, sanitariums, 92 

5 nursing homes, ambulatory care facilities, schools of 93 

6 veterinary medicine and surgery, or any other such 

7 institution or facility which offer pharmacy services only to 95 

8 the general public on an "outpatient" basis. 96 

9 Division III. Institutional licenses for pharmacies 98 

10 located in institutions listed in Division II or pharmacies 100 

11 whose entire pharmacy service is offered to such 101 

12 institutions, and which offer pharmacy services only to 

13 "inpatients", employees, prescribers and students of the 102 

14 institution and which may offer single-time pharmacy services 103 

15 to former "inpatients" and emergency room patients at the 104 

16 time of discharge, but does not otherwise provide pharmacy 105 

17 services to the general public on an "outpatient" basis. 

18 Division IV. Licenses for pharmacies which provide or 107 

19 offer for sale radioactive materials. 108 

20 The Director may waive the requirement for a pharmacist 110 

21 to be on duty at all times for State facilities not treating 111 

22 human ailments. 

23 It shall be unlawful for any place of business, which is 113 

24 not a Registered Pharmacy or Health Care Facility under this 114 

25 Act, to purport to be such or to use in name, title, or sign 115 

26 designating, or in connection with that place of business, 116 

27 any of the words: "pharmacy", "pharmacist", "apothecary", 

28 "druggist" , "drug", "drugs", "medicines", "medicine store", 117 

29 "drug sundries", "prescriptions filled", or any list of words 113 

30 indicating that drugs are compounded or sold to the lay 119 

31 public, or prescriptions are dispensed therein. Each day 

32 during which, or during a part of which, such representation 120 

33 is made or appears or such a sign is allowed to remain upon 121 

34 or in such a place of business shall constitute a separate 122 

35 offense under this Act. 123 

- ?77 - 



-3- LRB8407892CMtc 

(Ch. Ill, par. 4031) 125 

1 Sec. 10. Except only in the case of a drug, medicine or 127 

2 poison which is lawfully sold or dispensed, at retail, in the 128 

3 original and unbroken package of the manufacturer, packer, or 129 

4 distributor thereof, and which package bears the original 130 

5 label thereon showing the name and address of the 131 

6 manufacturer, packer, or distributor thereof, and the name of 

7 the drug, medicine, or poison therein contained, and the 132 

8 directions for its use, no person shall sell or dispense, at 133 

9 retail, any drug, medicine, or poison, without affixing to 134 

10 the box, bottle, vessel, or package containing the same, a 135 

11 label bearing the name of the article distinctly shown, and 136 

12 the directions for its use, with the name and address of the 

13 drug store or pharmacy wherein the same is sold or dispensed. 137 

14 However, in the case of a drug, medicine or poison which is 138 

15 sold or dispensed pursuant to a prescription of a licensed 139 

16 physician, licensed dentist, licensed veterinarian or other 140 

17 licensed allied practitioner, the label affixed to the box, 141 

18 bottle, vessel, or package containing the same shall show: 142 

19 (a) The name and address of the drug store or pharmacy 

20 wherein the same is sold or dispensed; (b) The name or 143 

21 initials of the person, authorised to practice pharmacy under 144 

22 the provisions of this Act, selling or dispensing the same, 145 

23 (c) the date on which such prescription was filled; (d) the 146 

24 name of the patient; (e) the serial number of such 147 

25 prescription as filed in the prescription files; (f) the last 148 

26 name of the practitioner who prescribed such prescriptions; 149 

27 and (g) the directions for use thereof as contained in such 150 

28 prescription; and (h) the proprietary name or names or the 151 

29 established name or names of the drugs, the dosage and 

30 quantity, except as otherwise authorized by regulation of the 152 

31 Department of Registration and Education. A prescription mav 153 

32 be transferred only once between pharmacies. Additional 154 

33 transfers may, at the request of the patient, be made via a 155 

34 "prescriber authorization," which shall be accomplished by a 156 



37H 



-4- LRB8 40789 2CMtc 

1 phone call from the new pharmacist to the prescriber. Any 157 

2 person who sells or dispenses any drug, medicine or poison 158 

3 shall sell or dispense such drug, medicine or poison in good 159 

4 faith. "Good faith", for purposes of this Section, has the 160 

5 meaning ascribed to it in subsection (v) of Section 102 of 

6 this "Illinois Controlled Substances Act", approved August 161 

7 16, 1971, as amended. 162 

8 Section 2. This Act takes effect upon its becoming a 164 

9 law. 



- 380 



BILL 29 



Background 

On four occasions in 1985, the Illinois Environmental Protection Agency has 
adopted rules which authorize specific procedures for measuring emissions of 
particulate matter from stationary sources, as well as for operating during 
period of excess emissions, and in each instance the Joint Committee on 
Administrative Rules questioned the Agency's authority to promulgate such 
rules in light of the fact that Section 10 of the Environmental Protection Act 
delegates the authority for such rules to the Pollution Control Board. The 
Agency responded by stating that Section 4(b) and (h) of the Environmental 
Protection Act authorize the Agency to administer the permit programs 
established by the Board, to acquire data and ascertain the amount of 
discharge from the sources of contaminants, and to require reports on actual 
or potential violations of the Act and applicable regulations. The Department 
cited Sections 4 and 39 of the Act as its authority for operating under 
periods of excess emissions. 

The explicit authority to promulgate rules prescribing requirements and 
standards for procedures for operating during periods of excess emissions 
and for monitoring contaminant discharges at their sources and the collection, 
reporting and retention of data resulting from such monitoring is that of the 
Pollution Control Board as provided in Sections 10(c) and 10(g) of the Act. 
The general provisions of Section 4 of the Act do not vitiate the Board's 
duty. 

At this time, the Board has promulgated virtually no substantive requirements 
regarding operation during periods of excess emissions, or for monitoring, 
testing and reports for contaminants discharges. Through the rulemakings in 
question, the Agency has established its own substantive requirements, 
beyond the power granted it by the Act. If the Agency prescribes emission 
monitoring rules, rather than the Board, the rulemaking will have evaded the 
special procedural safeguards which Sections 27 and 28 of the Environmental 
Protection Act impose on Board rulemakings. Of particular importance to 
these rules is the requirement of Section 27 of the Act that the Board 
conduct a hearing on the economic impact of the rules and have prepared an 
economic impact study. The Agency and the Board have effectively bypassed 
these procedural safeguards by shifting the rulemaking responsibility to the 
Agency. 

Therefore, the Joint Committee has recommended that the Environmental 
Protection Act be amended to clarify the Environmental Protection Agency's 
lack of authority to promulgate rules concerning procedures for operating 
during periods of excess emissions and for monitoring contaminant discharges 
of samples of air pollution and collection of samples for such monitoring. 
This proposal stipulates that such rules shall be promulgated exclusively by 
the Pollution Control Board while voiding the Agency rules currently in 
effect. 



381 



Summary 

Amends Section 10 of the Environmental Protection Act (Supp. to III. Rev. 
Stat. 1984, ch. 11 U, par. 1010) to clarify the Environmental Protection 
Agency's lack of authority to promulgate rules concerning procedures for 
monitoring contaminant discharges of sources of air pollution and collection of 
samples for such monitoring. Effective immediately. 



';o? 



382 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Ch. Ill 1/2, par. 1010) 

Amends the Environmental Protection Act to 
declare void certain Agency rules concerning operating during 
periods of excess emissions, and procedures for monitoring 
contaminant discharges of stationary sources of air pollution 
and the collection of samples for such monitoring; vests the 
power to adopt such rules exclusively in the Pollution 
Control Board. Effective immediately. 



LaB8408150EGch 



A BILL FOR 



383 



LR38408150EGch 

1 AN ACT to amend Section 10 of the "Environmental 50 

2 Protection Act", approved June 29, 1970, as amended. 52 

3 Be it enacted by the People of the State of Illinois, 5 6 

4 represented in the General Assembly; 

5 Section L.- Section 10 of the "Environmental Protection 59 

6 Act", approved June 29, 1970, as amended, is amended to read 60 

7 as follows: 

(Ch. Ill 1/2, par. 1010) 62 

8 Sec. 10. The Board, pursuant to procedures prescribed in 64 

9 Title VII of this Act, may adopt regulations to promote the 65 

10 purposes of this Title. Without limiting the generality of 66 

11 this authority, such regulations may among other things 67 

12 prescribe: 

13 (a) Ambient air quality standards specifying the maximum 69 

14 permissible short-term and long-term concentrations of 70 

15 various contaminants in the atmosphere; 

16 (b) Emission standards specifying the maximum amounts or 72 

17 concentrations of various contaminants that may be discharged 73 

18 into the atmosphere; 

19 (c) Standards for the issuance of permits for 75 

20 construction, installation, or operation of any equipment, 76 

21 facility, vehicle, vessel, or aircraft capable of causing or 

22 contributing to air pollution or designed to prevent air 78 

23 pollution . Such standards shall be promulgated exclusively 

24 by the Board pursuant to The Illinois Administrative 7 9 
2 5 Procedure Act, and the Agency is expressly prohibited from 8 

26 adopting rules and regulations governing the issuance of 81 

27 permits for the operation of a facility capable of causing 
2 8 air pollution ; 

29 (d) Standards and conditions regarding the sale, offer, 83 

30 or use of any fuel, vehicle, or other article determined by 84 

31 the Board to constitute an air-pollution hazard; 85 

32 (e) Alert and abatement standards relative to 87 

- 384 - 



-2- LRB8408150EGch 

1 air-pollution episodes or emergencies constituting an acute 88 

2 danger to health or to the environment; 

3 (f) Requirements and procedures for the inspection of 90 

4 any equipment, facility, vehicle, vessel, or aircraft that 91 

5 may cause or contribute to air pollution; 

6 (g) Requirements and standards for equipment and 93 

7 procedures for monitoring contaminant discharges at their 94 

8 sources, the collection of samples^ and the collection, 95 

9 reporting and retention of data resulting from such 

10 monitoring , which shall be promulgated exclusively by the 96 

11 Board pursuant to The Illinois Administrative Procedure Act. 97 

12 The Agency is expressly prohibited from adopting rules and 98 

13 regulations governing procedures for monitoring contaminant 99 

14 discharges of sources of air pollution and the collection of 

15 samples from such sources . 100 

16 The Board shall adopt sulfur dioxide regulations and 102 

17 emission standards for existing fuel combustion stationary 103 

18 emission sources located in all areas of the State of 104 

19 Illinois, except the Chicago, St. Louis (Illinois) and Peoria 105 

20 major metropolitan areas, in accordance with the following 

21 requirements: 

22 (1) Such regulations shall not be more restrictive than 107 

23 necessary to attain and maintain the "Primary National 108 

24 Ambient Air Quality Standards for Sulfur Dioxide" and within 109 

25 a reasonable time attain and maintain the "Secondary National 110 

26 Ambient Air Quality Standards for Sulfur Dioxide." 

27 (2) Such regulations shall be based upon ambient air 112 

28 quality monitoring data insofar as possible, consistent with 113 

29 regulations of the United States Environmental Protection 114 

30 Agency. To the extent that air quality modeling techniques 115 

31 are used for setting standards, such techniques shall be 

32 fully described and documented in the record of the Board '3 116 

33 rulemaking proceeding. 

34 (3) Such regulations shall provide a mechanism for the 118 

35 establishment of emission standards applicable to a specific 119 

- 385 - 



-3- LRB8408150EGch 

1 site as an alternative to a more restrictive general emission 120 

2 standard. The Board shall delegate authority to the Agency 121 

3 to determine such specific site emission standards, pursuant 

4 to regulations adopted by the Board. 122 

5 (4) Such regulations and standards shall allow all 124 

6 available alternative air quality control methods consistent 125 

7 with federal law and regulations. 

8 The Board may not adopt any regulation banning the 127 

9 burning of landscape waste throughout the State generally. 128 

10 The Board may, by regulation, restrict or prohibit the 129 

11 burning of landscape waste within any geographical area of 130 

12 the State if it determines based on medical and biological 131 

13 evidence generally accepted by the scientific community that 

14 such burning . will produce in the atmosphere of that 132 

15 geographical area contaminants in sufficient quantities and 133 

16 of such characteristics and duration as to be injurious to 134 

17 humans, plant, or animal life, or health. 

18 The Board shall not adopt any regulation requiring the 136 

19 use of a Phase-II Vapor Recovery System at gasoline 137 

20 dispensing facilities until the U.S. Environmental Protection 138 

21 Agency has determined that the use of such system is required 139 

22 for compliance with the federal Clean Air Act. 

23 Sections 260.202, 260.203 and 260.205 of the rules 141 

24 adopted by the Environmental Protection Agency entitled 142 

25 "Policy for Granting Permission to Operate During Periods of 143 

26 Excess Emissions", effective November 15, 1985, and Parts 144 

27 263, 277 and 283 of the rules adopted by the Environmental 145 

28 Protection Agency entitled "Procedures for Measuring 

29 Emissions of Particulate Matter from Stationary Sources" (35 146 

30 111. Adm. Code 263), "Procedures for Measuring Emissions of 147 

31 Carbon Monoxide" (35 111. Adm. Cede 277), and "General 148 

32 Procedures for Stack Testing" (35 111. Adm. Code 283), 149 
3 3 effective September 13, 1985, shall be void as of the 

34 effective date of this amendatory Act of 1986. 150 

35 Section 2. This Act shall take effect upon becoming law. 152 

- 386 - 



TILL 30 



Background 

The Joint Committee on Administrative PxUles objected to the Environmental 
Protection Agency's rules entitled "Design, Operation and Maintenance 
Criteria" (35 III. Adm. Code 653 ) because the Environmental Protection Act 
does not provide the Agency with the statutory authority to require that 
cross-connection control devices be inspected by a person approved by the 
Agency, nor does it give the Agency the authority to grant approval to 
persons to inspect cross-connection control devices. Cross-connection control 
programs ensure the protection of community water supplies and the 
consumers. In addition, the Joint Committee directed staff to draft legislation 
clarifying that the procedures for ensuring safe cross-connections shall be 
promulgated exclusively by the Pollution Control Board. The Environmental 
Protection Agency is expressly prohibited from adopting cross-connector rules 
and regulations. This proposal repeals the Agency's rules entitled "Design, 
Operation and Maintenance Criteria" Parts 653.801 - 653.805, and directs the 
Pollution Control Board to promulgate such rules. 

Summary 

Amends Section 17 of the Environmental Protection Act (III. Rev. Stat. 1983, 
ch. 111?, par. 1017) to clarify the Environmental Protection Agency's lack of 
statutory authority to promulgate rules concerning procedures for the 
inspection by the Agency of cross-connection control devices by a person 
approved by the Agency. Effective immediately. 



106 



- 387 - 



- 386 - 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Ch. ill 1/2, par. 1017) 

Amends the Environmental Protection Act to 
declare void the Agency's rules concerning procedures for the 
inspection of cross-connection control devices in community 
public water supplies; vests authority to make such rules in 
the Pollution Control -Board. Effective immediately. 



LRB8407893EGch 



A BILL FOR 



389 



LRB8407893EGch 

1 AN ACT to amend Section 17 of the "Environmental 49 

2 Protection Act", approved June 29, 1970, as amended. 51 

3 3e it enacted by the People of the State of Illinois, 55 

4 represented in the General Assembly: 

5 Section 1. Section 17 of the "Environmental Protection 57 

6 Act", approved June 29, 1970, as amended, is amended to read 58 

7 as follows: 

(Ch. Ill 1/2, par. 1017) 60 

8 Sec. 17. (a) The Board may adopt regulations governing 63 

9 the location, design, construction, and continuous operation 64 

10 and maintenance of public water 3upply installations, changes 65 

11 or additions which may affect the continuous sanitary 66 

12 quality, mineral quality, or adequacy of the public water 

13 supply, pursuant to Title VII of this Act. Such regulations 68 

14 shall include, but not be limted to, the approval, use and 69 

15 inspection of cross-connection control devices as part of the 

15 routine operation of community public water supplies. These 70 

17 regulations shall be promulgated exclusively by the Board 71 

18 pursuant to The Illinois Administrative Procedure Act. The 72 

19 Agency is expressly prohibited from adopting rules and 7 3 

20 regulations governing procedures for approval, use and 7 4 

21 inspection of cross-connection control devices. 

22 (b) The Agency shall exempt from any mandatory 76 

23 chlorination requirement of the Board any community wacer 77 

24 supply which meet3 all of the following conditions: 

25 (1) The population of the community served is not more 79 

26 than 5,000; 

27 (2) Has as its only source of raw water one or more 31 

28 properly constructed veils into confined geologic formations 82 

29 not subject to contamination; 

30 (3) Has no history of persistent or recurring 84 

31 contamination, as indicated by sampling results which shew 85 

32 violations of finished water quality requirements, for the 86 

- 390 - 



-2- LRB8407893EGch 

1 most recant five-year period; 86 

2 (4) Does not provide any raw water treatment other than 88 

3 fluoridation; 

4 (5) Has an active program approved by the Agency to 90 

5 educate water supply consumers on preventing the entry of 91 

6 contaminants into the water system; 

7 (6) Has a certified operator of the proper class, or if 93 

8 it is an exempt community public water supply, has a 94 

9 registered person responsible in charge of operation of the 96 

10 public water supply; 

11 (7) Submits samples for microbiological analysis at 98 

12 twice the frequency specified in the Board regulations; and 99 

13 (8) A unit of local government seeking to exempt its 101 

14 public water supply from the chlorination requirement under 102 

15 this subsection (b) on or after the effective date of this 103 

16 amendatory Act of 1983 shall be required to receive the 104 

17 approval of the voters of such local government. The 

18 proposition to exempt the community water supply from the 105 

19 mandatory chlorination requirement shall be placed on the 106 

20 ballot if the governing body of the local government adopts 107 

21 an ordinance or resolution directing the clerk of the local 

22 government to place such question on the ballot. The clerk 108 

23 shall cause the election officials to place the proposition 109 

24 on the ballot at the next election at which such proposition 110 

25 may be voted upon if a certified copy of the adopted 111 

26 ordinance or resolution is filed in his office at least 90 

27 days before such election. The proposition shall also be 112 

28 placed on the ballot if a petition containing the signatures 113 

29 of at least 10% of the eligible voters residing in the local 

30 government is filed with the clerk at least 90 days before 114 

31 the next election at which the proposition may be voted upon. 116 

32 The proposition shall be in substantially the following form: 

3 3 ___ . ,_ -_ ___ — L1 a 

34 Shall the community 119 

35 water supply of ..... (specify Y2S 120 

- 391 - 



-3- LR38407893EGch 

1 the unit of local government) 121 

2 be exempt from the mandatory 122 

3 chlorination requirement NO 123 

4 of the State of Illinois? 124 

5 125 

6 If the majority of the voters of the local government 127 

7 voting therein vote in favor of the proposition, the 128 

8 community water supply of that local government shall be 129 

9 exempt from the mandatory chlorination requirement, provided 130 

10 that the other requirements under this subsection (b) are 

11 met. If the majority of the vote is against such 131 

12 proposition, the community water supply may not be exempt 132 

13 from the mandatory chlorination requirement. 

14 Agency decisions regarding exemptions under this 134 

15 subsection may be appealed to the Board pursuant to the 135 

16 provisions of Section 40(a) of this Act. 

17 (c) Any supply showing contamination in its distribution 137 
13 system (including finished water storage) may be required to 138 

19 chlorinate until the Agency has determined that the source of 139 

20 contamination has been removed and all traces of 140 

21 contamination in the distribution system have been 

22 eliminated. Standby chlorination equipment may be required 141 

23 by the Agency if a supply otherwise exempt from chlorination 142 

24 shows' frequent or gross episodes of contamination. 

25 (d) Parts 653.801, 653.802, 653.803, 653.804 and 653.805 144 

26 of the rules adopted by the Environmental Protection Agency 145 

27 entitled "Design, Operation and Maintenance Criteria" (35 145 

28 111. Adm. Code 653), effective October 23, 1985, shall be 147 

29 void as of the effective date of this amendatory Act of 1986. 

30 Section 2. This Act shall take effect upon becoming law. 149 



192 



PILL 31 

Background 

After reviewing the Illinois Industrial Commission's rules (50 III. Adm. Code 
7020.80) pertaining to the procedure by which an employee may file an 
emergency petition for medical benefits in situations where the employee was 
injured and there is a disputed claim, the Joint Committee on Administrative 
Rules discovered that the Commission lacked the statutory authority to allow 
such petitions to be amended pursuant to Section 19(b-l) of the Workers' 
Compensation Act (III. Rev. Stat. 1984 Supp. , ch. 48, par. 138.19 (b-1)). 
The Commission's rules provide that an employer may file a challenge to the 
sufficiency of a Section 19(b-1) petition, and that the petition is found to be 
insufficient, the arbitrator will allow the petitioner 5 business days to amend 
the petition. Section 19(b-1) of the Act provides that the arbitrator must 
rule on an objection to the sufficiency of a petition within 2 working days 
after hearing the objection. 

Requiring such rulings within a short time frame is consistent with the 
legislative intent of this section, which is to provide an expedited procedure 
for the filing of emergency medical claims under. In addition, by not 
allowing the amendment of petitions by the petitioner and by specifically 
setting forth what must be contained in a petition filed under this Section, 
the procedure is further expedited. The Joint Committee's objection, the 
Joint Committee recommended that legislation be developed to specify that the 
amendment of Section 19(b-1) petitions is prohibited and to clarify that all 
objections to such petitions must be ruled upon by the arbitrator within 2 
working days. 

Summary 

Amends Section 19(b-1) of the Workers Compensation Act (III. Rev. Stat. 1984 
Supp., ch. 48, par. 1 38 . 19 (b-1 ) to clarify the petition procedures by 
prohibiting the amendment of Section 19(b-1) petitions and emphasizing that 
all objections to such petitions must be ruled upon by the arbitrator within 2 
working days. Effective immediately. 



201 



393 



39'i 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Ciu 48, pars. 138.19 and 172.54) 

Amends the Workers' Compensation and Workers' 
Occupational Diseases Acts. Provides petitions for emergency 
hearings , once filed with the Industrial Commission, may not 
be amended. Effective immediately. 



LHB8407703CMtC 



A BILL FOR 



LR38407703CMtc 

1 AN AC? to amend the law concerning work-related injuries, 47 

2 ' diseases and disabilities. 48 

3 3e it enacted by the People of the State of Illinois, 5 2 

4 reprasented in the General Assembly: 

5 Section 1. Section 19 of the "Workers' Compensation 54 

6 Act", approved July 9, 1951, as amended, is amended to read 55 

7 as follows: 

(Ch. 48, par. 138.19) 57 

8 Sec. 19. Any disputed questions of law or fact shall be 59 

9 determined as herein provided. SO 

10 (a) It shall be the duty of the Commission upon 52 

11 notification that the parties have failed to reach an 63 

12 agreement, to designate an Arbitrator. 

13 1. Whenever any claimant misconceives his remedy and 65 

14 files an application for adjustment of claim under this Act 66 

15 and it is subsequently discovered, at any time before final 67 

16 disposition of such cause, that the claim for disability or 68 

17 death which was the basis for such application should 59 
13 properly have been made under the Workers' Occupational 70 

19 Diseases Act, then the provisions of Section 19, paragraph 71 

20 (a-1) of the Workers* Occupational Diseases Act having 

21 reference to such application shall apply. 72 

22 2. Whenever any claimant misconceives his remedy and 74 

23 files an application for adjustment of claim under the 75 

24 Workers' Occupational Diseases Act and it i3 subsequently 76 

25 discovered, at any time before final disposition of such 77 

26 cause chat the claim for injury or deach which was the basis 73 

27 for such application should properly have been made under 

28 this Ace, then the application so filed under the Workers' 79 

29 Occupational Diseases Act nay be amended in form, substance 30 

30 cr both to assert claim for such disability or death under 31 

31 this Act and it shall be deemed to have been so filed as 32 

32 amended on the date of the original filing thereof, and such 33 



\ 



396 - 



-2- LRB8407703CMtc 

1 compensation may be awarded as is warranted by the whole 34 

2 evidence pursuant to this Act. When such amendment is 

3 submitted, further or additional evidence may be heard by the 35 

4 Arbitrator or Commission when deemed necessary. Nothing in 86 

5 this Section contained shall be construed to be or permit a 87 
S waiver of any provisions of this Act with reference to notice 88 

7 but notice if given shall be deemed to be a notice under the 89 

8 provisions of this Act if given within the time required 90 

9 herein. 

10 (b) The Arbitrator shall make such inquiries and 93 

11 investigations as he or they shall deem necessary and may 94 

12 examine and inspect all books, papers, records, places, or 

13 premises relating to the questions in dispute and hear such 95 

14 proper evidence as the parties may submit. 96 

15 The hearings before the Arbitrator shall be held in the 99 
IS vicinity where the injury occurred after 10 days' notice of 100 

17 the time and place of such hearing shall have been given to 

18 each of the parties or their attorneys of record. 101 

19 The Arbitrator may find that the disabling condition is 104 

20 temporary and has not yet reached a permanent condition and 105 

21 may order the payment of compensation up to the date of the 106 

22 hearing, which award shall be reviewable and enforceable in 

23 the same manner as other awards, and in no instance be a bar 107 

24 to a further hearing and determination of a further amount of 108 

25 temporary total compensation or of compensation for permanent 109 

26 disability, but shall be conclusive as to all other questions 110 

27 except the nature and extent of 3aid disability. 

23 The decision of the Arbitrator shall be filed with the 113 

29 Commission which Commission shall immediately send to each 114 

30 party or his attorney a copy of 3uch decision, together with 

31 a notification of the time when it was filed. Beginning 115 

32 January 1, 1981, all decisions of the Arbitrator 3hali 3et LIS 

33 forth in writing findings of fact and conclusions of law, 117 

34 separately stated. 0nlas3 a petition for review is filed by 119 

35 either party within 15 days after the receipt by such ?ar-y 120 

- 397 - 



-3- LaS8407703CMtc 

1 of the copy of the decision and notification of time when 120 

2 filed, and unless such party petitioning for a review shall 121 

3 within 20 days after the receipt by him of the copy of the 122 

4 decision, file with the Commission either an agreed statement 123 

5 of the facts appearing upon the hearing before the 124 

6 Arbitrator, or if such party shall so elect a correct 125 

7 transcript of evidence of the proceedings at 3uch hearings, 12S 
3 then the decision shall become the decision of the Commission 127 
9 and in the absence of fraud shall be conclusive. The 128 

10 Commission, or any member thereof, may grant further time not 

11 exceeding 30 days, in which to file such agreed statement or 129 

12 transcript of evidence. Such agreed statement of fact3 or 130 

13 correct transcript of evidence, as the case may be, shall be 131 

14 authenticated by the signatures of the parties or their 132 

15 attorneys, and in the event they do not agree as to • the 133 
16. correctness of the transcript of evidence it shall be 

17 authenticated by the signature of the Arbitrator designated 134 

18 by the Commission. 

19 (b-1) If the employee is not receiving medical, surgical 

20 or hospital services as provided in paragraph (a) of Section 

21 8 or compensation as provided in paragraph (b) of Section 8, 

22 the employee, in accordance with Commission Rules, may file a 139 

23 petition Cor an emergency hearing by an Arbitrator en the 140 

24 issue of whether or not he is entitled to receive payment of 141 

25 such compensation or services as provided therein. Such 142 
25 petition shall have priority over all other petitions and^ 143 
27 once filed, may at no time be amended by the petitioner. The 144 
23 petition shall be heard by the Arbitrator and Ccmmission with 145 

29 all convenient speed. 

30 Such petition shall contain the fallowing information and 147 

31 shall be served on the employer at least 15 days before it is 143 

32 filed: 

33 (i) the date and approximate time of accident; 150 

34 (ii) the approximate location of the accident; 152 

35 (iii) a description of the accident,; 154 

- 398 - 



-4- LR38407703CMtC 

1 (iv) the nature of the injury incurred by the employee; 155 

2 (v) the identity of the person, if known, to whom the 158 

3 accident was reported and the date on which it was reported; 159 

4 (vi) the name and title of the person, if known, 151 

5 representing the employer with whom the employee conferred in 162 

6 any effort to obtain compensation pursuant to paragraph (b) 163 

7 of Section 3 of this Act or medical, surgical or hospital 164 

8 services pursuant to paragraph (a) of Section 3 of this Act 165 

9 and the date of such conference; 

10 (vii) a statement that the employer has refused to pay 157 

11 compensation pursuant to paragraph (b) of Section 8 of this 153 

12 Act or for medical, surgical or hospital services pursuant to 169 

13 paragraph (a) of Section 8 of this Act; 

14 (viii) the name and address, if known, of each witness 171 

15 to the accident and of each other person upon whom the 172 

16 employee will rely to support his allegations; ■ 173 

17 (Lx) the dates of treatment related to the accident by 176 

18 medical practitioners, and the names and addresses of such 177 

19 practitioners, including the dates of treatment related to 178 

20 the accident at any hospitals and the names and addresses of 179 

21 such hospitals, and a signed authorisation permitting the 130 

22 employer to examine all medical records of all practitioners 

23 and hospitals named pursuant to this paragraph; 181 

24 (x) a copy of a signed report by a medical practitioner, 183 

25 relating to the employee's current inability to return to 184 

26 work because of the injuries incurred as a result of the 185 

27 accident or such other documents or affidavits which show 135 

28 that the employee is entitled to receive compensation 

29 pursuant to paragraph (b) of Section 8 of this Act or 137 

30 medical, surgical or hospital services pursuant to paragraph 138 

31 (a) of Section 8 of this Act. Such reports, documents or 139 

32 affidavits shall state, if possible, the history of the 190 

33 accident given by the employee, and describe the injury and 

34 medical diagnosis, the medical services for 3uch injury which 191 

35 the employee has received and is receiving, the physical 192 

- 399 - 



-5- LRB8407703CMtC 

1 activities which the employee cannot currently perform as a 193 

2 result of any impairment or disability due to such injury, 194 

3 and the prognosis for recovery; 

4 (xi) complete copies of any reports, records, documents 196 

5 and affidavits in the possession of the employee on which the 197 
5 employee will rely to support his allegations, provided that 198 
7 the employer shall pay the reasonable cost of reproduction 199 
3 thereof; 

9 (xii) a list of any reports, records, documents and 201 

10 affidavits which the employee has demanded by subpoena and on 202 

11 which he intends to rely to support his allegations; 203 

12 (xiii) a certification signed by the employee or his 205 

13 representative that the employer has received the petition 206 

14 with the required information 15 days before filing. 207 

15 Fifteen days after receipt by the employer of the 209 

16 petition with the required information the employee may file 210 

17 said petition and required information and shall serve notice 211 
13 of the filing upon the employer. The employer may file a 212 

19 motion addressed to the sufficiency of the petition. If an 213 

20 abjection has been filed to the sufficiency of the petition, 

21 the arbitrator shall rule on the objection within 2 working 214 

22 days. If such an objection is filed, the time for filing the 215 

23 final decision of the Commission as provided in this 215 

24 paragraph shall be tolled until the arbitrator has determined 217 

25 that the petition is sufficient. The petitioner may not 213 

26 amend a petition that has been ruled to be insufficient by 219 

27 the arbitrator, but aav file a new petition pursuant to this 220 

28 Section. 

29 The employer shall, within IS days after receipt of the 222 

30 notice that such petition is filed, file with the Commission 223 

31 and 3erve on the employee or his representative a written 225 

32 response to each claim set forth in the petition, including 

3 3 the legal and factual basi3 for each disputed allegation and 226 

34 the following information: (i) complete copies of any 227 

35 reports, records, documents and affidavits in the possession 223 

- 4C0 - 



-6- LaB8407703CMtc 

1 of the employer on which the employer intends to rely in 229 

2 support of his response, (ii) a list of any reports, records, 

3 documents and affidavits which the employer has demanded by 230 

4 subpoena and on which the employer intends to rely in support 231 

5 of his response, (iii) the name and address of each witness 232 

6 on whom the employer will rely to support his response, and 233 

7 (iv) the names and addresses of any medical practitioners 234 

8 selected by the employer pursuant to Section 12 of this Act 

9 and the time and place of any examination scheduled to be 235 

10 made pursuant to such Section. 

11 Any employer who does not timely file and serve a written 237 

12 response without good cause may not introduce any evidence to 238 

13 dispute any claim of the employee but may cross examine the 239 

14 employee or any witness brought by the employee and otherwise 240 

15 be heard. 

IS No document or other evidence not previously identified 242 

17 by either party with the petition or written response, or by 243 

18 any other means before the hearing, may be introduced into 244 

19 evidence without good cause. If, at the hearing, material 245 

20 information is discovered which was not previously disclosed , 246 

21 the Arbitrator may extend the time for closing proof on the 247 

22 motion of a party for a reasonable period of time which may 

23 be more than 30 days. No evidence may be introduced pursuant 248 

24 to this paragraph as to permanent disability. So award may 249 

25 be entered for permanent disability pursuant to this 250 

26 paragraph. Sither party may introduce into evidence the 251 

27 testimony taken by deposition of any medical practitioner. 

28 The Commission shall adopt rules, regulations and 253 

29 procedures whereby the final decision of the Commission is 254 

30 filed not later than 90 days from the date the petition for 255 

31 review is filed but in no event later than 180 days from the 256 

32 date the petition for an emergency hearing i3 filed with the 

33 Industrial Commission. 

34 All service required pursuant to this paragraph (b-1) 259 

35 must be by personal service or by certified mail and with 260 

- 401 - 



-7- LaS8407703CMtC 

1 evidence of receipt. In addition for the purposes of this 260 

2 paragraph, all service on the employer must be at the 2S1 

3 premises where the accident occurred if the premises are 252 

4 owned or operated by the employer. Otherwise service aust be 253 

5 at the employee's principal place of employment by the 

6 employer. If service on the employer is not possible at 254 

7 either of the above, then service shall be at the employer's 265 

8 principal place of business. After initial service in each 265 

9 case, service shall be made on the employer's attorney or 267 

10 designated representative. 

11 (c) (1) At a reasonable time in advance of and in 269 

12 connection with the hearing under Section 19(e) or 19(h), the 270 

13 Commission may on its own motion order an impartial physical 271 

14 or mental examination of a petitioner whose mental or 272 

15 physical condition is in issue, when in the Commission's 

16 discretion it appears that such an examination will 273 

17 materially aid in the just determination of the case. The 274 

18 examination shall be made by a member or members of a panel 

19 of physicians chosen for their special qualifications by the 275 
2£ Illinois State Medical Society. The Commission shall 275 

21 establish procedures by which a physician shall be selected 277 

22 from such list. 

23 (2) Should the Commission at any time during the hearing 279 

24 find that compelling considerations make it advisable to have 280 

25 an examination and report at that time, the commission may in 231 
25 its discretion so order. 

27 (3) A copy of the report of examination snail be given 233 

28 to the Commission and to the attorneys for the parties. 284 

29 (4) Sither party or the Commission may call the 286 

30 examining physician or physicians to testify. Any physician 237 

31 so called shall be subject to cross-examination. 

32 (5) The examination shall be made, and the physician or 289 

33 physicians, if called, shall testify, without cost to the 290 

34 parties. The Commission shall determine the compensation and 29 L 

35 the pay of the physician or physicians. The compensation for 292 

- 402 - 



-8- LRB8407703CMtC 

1 this service shall not exceed the usual and customary amount 292 

2 for such service. 293 

3 (6) The fees and payment thereof of all attorneys and 295 

4 physicians for services authorized by the Commission under 29 6 

5 this Act shall, upon request of either the employer or the 297 

6 employee or the beneficiary affected, be subject to the 298 

7 review and decision of the Commission. 

3 (d) If any employee shall persist in insanitary or 300 

9 injurious practices which tend to either imperil or retard 301 

10 his recovery or shall refuse to submit to such medical, 302 

11 surgical, or hospital treatment as is reasonably essential to 303 

12 promote his recovery, the Commission may, in its discretion, 304 

13 reduce or suspend the compensation of any such injured 30 5 

14 employee. However, when an employer and employee so agree in 

15 writing, the foregoing provision shall not be construed to 306 

16 authorize the reduction or suspension of compensation of an 307 

17 employee who is relying in good faith, on treatment by prayer 308 

18 or spiritual means alone, in accordance with the tenets and 309 

19 practice of a recognized church or religious denomination, by 310 

20 a duly accredited practitioner thereof. 

21 (e) This paragraph shall apply to all hearings before 312 

22 the Commission, including those brought under petitions for 313 

23 emergency hearings as provided in paragraph (b-1), except to 314 

24 the extent the limitations of time and the talcing of 315 

25 additional evidence set forth in paragraph (b-1) are 316 

26 inconsistent with the provisions of this paragraph. If a 317 

27 petition for review and agreed statement of facts or 313 

28 transcript of evidence is filed, as provided herein, the 

29 Commission shall promptly review the decision of the 319 

30 Arbitrator and all questions of law or fact which appear from 320 

31 the statement of facts or transcript of evidence. Additional 321 

32 evidence may be adduced where such evidence (1) relates to 322 

33 the condition of the employee since the time of the 323 

34 arbitration hearing, (2) relates to matters that occurred or 

35 conditions that developed after the arbitration hearing, or 324 

- 1*03 - 



-9- LR38407703CMtC 

1 (3) was, for good cause, not introduced at the arbitration 325 

-v 

2 hearing. In reviewing decisions of an arbitrator the 325 

3 Commission shall award such temporary compensation, 'permanent 327 

4 compensation and other payments as are due under thi3 Act. 328 

5 After such hearing upon review, the Commission shall file in 329 

6 its office its decision thereon, and shall immediately send 330 

7 to each party or his attorney a copy of such <deci3ion and a 331 
3 notification of the time when it was filed. After January 1, 332 
9 1986, decisions shall be filed within SO days after a hearing 333 

10 on review or oral argument whichever is later. 

11 Such review and hearing may be held in its office or 335 

12 elsewhere as the Commission may deem advisable. The taking 336 

13 of testimony on such hearing may be had before any member of 337 

14 the Commission. In the event either party requests oral 338 

15 argument, such argument shall be had before a panel of three 339 

16 members of the Commission (or before all available members 340 

17 pursuant to the determination of 5 members of the Commission 341 

18 that such argument be held before all available members of 342 

19 the Commission) pursuant to the rules and regulations of the 343 

20 Commission. A panel of three members, which shall be 344 

21 comprised of not more than one representative citizen of the 

22 employing clas3 and not more than one representative citizen 346 

23 of the employee class, shall hear the argument; provided that 347 

24 if all the issues in dispute are solely the nature and extent 343 

25 of the permanent partial disability, if any, a majority of 349 

26 the panel may deny the request for such argument and 3uch 350 

27 argument 3hall not be held; and provided further that 5 

28 members of the Commission may determine that the argument be 2 51 

29 held before all available members of the Commission. 353 

30 Notwithstanding any other provisions of thi3 Section, the 354 

31 Chairman may not regularly serve on any panel of 3 members of 

32 the Commission as described in this Section, buc may 355 

33 substitute for any member who is unavailable. A decision of 356 

34 the Commission 3hall be approved by a majority of 357 

35 Commissioners present at such hearing if any; provided, if za 

- 4C4 - 



-10- LR38407703CMtC 

1 such hearing is held, a decision of the Commission shall be 353 

2 approved by a majority of a panel of 3 members of the 359 

3 Commission as described in this Section. The Commission 360 

4 shall give 10 days' notice to the parties or their attorneys 361 

5 of the time and place of 3uch taking of testimony and of such 362 

6 argument. 

7 In any case the Commission in its decision may find 364 
a specially upon any question or questions of law or fact which 365 
9 shall be submitted in writing by either party whether 365 

10 ultimate or otherwise; provided that on issues other than 367 

11 nature and extent of the disability, if any, the Commission 368 

12 in its decision shall find specially upon any question or 369 

13 questions of law or fact, whether ultimate or otherwise, 370 

14 which are submitted in writing by either party; provided 

15 further that not more than 5 such questions may be submitted 371 

16 by either party. Any party may, within 20 days after receipt 372 

17 of notice of the Commission's decision, or within such 373 

18 further time, not exceeding 30 days, as the Commission may 374 

19 grant, file with the Commission either an agreed statement of 375 

20 the facts appearing upon the hearing, or, if such party shall 376 

21 so elect, a correct transcript of evidence of the additional 

22 proceedings presented before the Commission, in which report 377 

23 the party may embody a correct statement of such other 378 

24 proceedings in the case as such party may desire to have 379 

25 reviewed, such statement of facts or transcript of evidence 380 

26 to be authenticated by the signature of the parties or their 381 

27 attorneys, and in the event that they do not agree, then the 382 

28 authentication of such transcript of evidence shall be by the 

29 signature of any member of the Commission. 383 

30 If a reporter does not for any reason furnish a 385 
21 transcript of the proceedings before the Arbitrator in any 336 

32 case for use on a hearing for review before the Commission, 337 

33 within the limitations of time as fixed in this Section, the 338 

34 Commission may, in its discretion, order a trial de novo 339 

35 before the Commission in such case upon application of either 

- 405 - 



-11- LRS8407703G4tc 

1 party. The applications for adjustment of claim and other 390 

2 documents in the nature of pleadings filed by either party, 391 

3 together with the decisions of the Arbitrator and of the 392 

4 Commission and the statement of facts or transcript of 39 3 

5 evidence hereinbefore provided for in paragraphs (b) and (c) 394 

6 shall be the record of the proceedings of the Commission, and 395 

7 shall be subject to review as hereinafter provided. 

3 At the request of either party or on its own motion, the 397 

9 Commission shall set forth in writing the reasons for the 398 

10 decision, including findings of fact and conclusions of law 399 

11 separately stated. The Commission shall by rule adopt a 400 

12 format for written decisions for the Commission and 401 

13 arbitrators. The written decisions shall be concise and shall 402 

14 succinctly state the facts and reasons for the decision. The 403 

15 Commission may adopt in whole or in part, the decision of the 404 
15 arbitrator as the decision of the Commission. When the 405 

17 Commission does so adopt the decision of the arbitrator, it 406 

18 shall do so by order. Whenever the Commission adopt3 part of 

19 the arbitrator's decision, but not all, it shall include in 407 

20 the order the reasons for not adopting all of the 408 

21 arbitrator's decision. When a majority of a panel, after 409 

22 deliberation, ha3 arrived at its decision, the decision shall 410 

23 be filed as provided in this Section withcuc unnecessary 

24 delay, and without regard to the fact that a aember of the 411 

25 panel has expressed an intention to di3senc. Any aember of 412 

26 the panel may file a dissent. Any dissent shall be filed no 413 

27 later than 10 days after the decision of the majority has 41-1 

28 been filed. 

29 Decisions rendered by the Commission and dissents, if 415 

30 any, shall be published together by the Commission. The 417 

31 conclusions of law set out in such decisions shall be 413 

32 regarded as precedents by arbitrators for the purpose of 420 

33 achieving a more uniform administration of this Act. 

34 (f) The decision of the Commission acting within its 422 

35 powers, according to the provisions of paragraph (e) of this 423 

- 406 - 



-12- LHB8407703CMtc 

1 Section shall, in the absence of fraud, be conclusive unless 424 

2 reviewed a3 in this paragraph hereinafter provided. However, 425 

3 the Arbitrator or the Commission may on his or its own 426 

4 motion, or on the motion of either party, correct any 427 

5 clerical error or errors in computation within 15 days after 

6 the date of receipt of any award by such Arbitrator or any 428 

7 decision on review of the Commission and shall have the power 429 

8 to recall the original award on arbitration or decision on 430 

9 review, and issue in lieu thereof 3uch corrected award or 431 

10 decision. Where such correction is made the time for review 432 

11 herein specified shall begin to run from the date of the 433 

12 receipt of the corrected award or decision. 

13 (1) Sxcept in cases of claims against the State of 435 

14 Illinois, in which case the decision of the Commission shall 436 

15 not be subject to judicial review, the Circuit Court of the 437 

16 county where any of the parties defendant may be found, or if 438 

17 none of the parties defendant can be found in this State then 439 

18 the Circuit Court of the county where the accident occurred, 440 

19 shall by summons to the Commission have power to review all 441 

20 questions of law and fact presented by such record. 

21 A proceeding for review shall be commenced within 20 days 442 

22 of the receipt of notice of the decision of the Commission. 444 

23 The summons shall be issued by the cleric of such court upon 445 

24 written request returnable on a designated return day, not 445 

25 less than 10 or more than 60 days from the data of issuance 447 

26 thereof, and the written request shall contain she last known 443 

27 address of other parties in interest and their actorneys of 449 

28 record who are to be served by summons. Service upon any 4 30 

29 member of the Commission or the Secretary or the Assistant 451 

30 Secretary thereof shall be service upon the Commission, and 452 

31 service upon other parties in interest and their attorneys of 

32 record shall be by summons, and such service shall be made 453 

33 upon the Commission and ocher parties in interest by sailing 4=4 

34 notices of the commencement of the proceedings and the return 45 5 

35 day of the summons to the office of the Commission and to the 456 



-13- LaB8407703CMtc 

1 last known place of residence of other parties in interest or 457 

2 their attorney or attorneys of record. The clerk of the 458 

3 court issuing the summons shall on the day of issue mail 459 

4 notice of the commencement of the proceedings which shall be 460 

5 done by mailing a copy of the summons to the office of the 461 
5 Commission, and a copy of the summons to the other parties in 46 2 

7 interest or their attorney or attorneys of record and the 463 

8 clerk of the court shall make certificate that he has so sent 464 

9 said notices in pursuance of this Section, which shall be 465 

10 evidence of service on the Commission and other parties in 466 

11 interest. 

12 The Commission 3hall not be required to certify the 468 

13 record of their proceedings to the Circuit Court, unless the 459 

14 party commencing the proceedings for review in the Circuit 470 
13 Court as above provided, shall pay to the Commission the sum 471 

15 of 80* per page of testimony taken before the Commission, and 472 
U 35c per page of all other matters contained in 3uch record, 47 3 
13 except as otherwise provided by Section 20 of this Act. 

19 Payment for photostatic copies of exhibit shall be extra. It 474 

20 shall be the "duty of the Commission upon 3uch payment, or 47 5 

21 failure to pay as permitted under Section 20 of this Act, to 476 

22 prepare a true and correct typewritten copy of such testimony 477 

23 and a true and correct copy of all other matters contained in 473 

24 such record and certified to by the Secretary or Assistant 479 

25 Secretary thereof. 

26 In its decision on review the Commission shall determine 481 

27 in each particular case the amount of the probable cost of 43 2 

28 the record to be filed as a part of the summons in that case 48 3 

29 and no request for a summons may be filed and no summons 434 

30 shall issue unless the party seeking to review the decision 485 
31. of the Commission shall exhibit to the clerk of che Circuit 435 

32 Court proof of payment by filing a receipt showing payment or 437 

33 an affidavit of the attorney setting forth that payment has 438 

34 been made of the 3ums so determined to -he Secretary or 439 

35 Assistant Secretary of the Commission, except as otherwise -iOQ 

- 408 - 



-14- L3B8407703CMtc 

1 provided by Section 20 of this Act. 491 

2 (2) No such summons shall issue unless the one against 493 

3 whom the Commission shall have rendered an award for the 494 

4 payment of money shall upon the filing of his written requesc 495 
5^ for such summons file with the clerk of the court a bond 496 

6 conditioned that if he shall not successfully prosecute the 497 

7 review, he will pay the award and the costs of the 498 
a proceedings in the court3. The amount of the bond shall be 

9 fixed by any member of the Commission and the surety or 499 

10 sureties of the bond shall be approved by the cleric of the 500 

11 court. The acceptance of the bond by the clerk of the court 501 

12 shall constitute evidence of his approval of the bond. 

13 Every county/ city, town, township, incorporated village, 503 

14 school district, body politic or municipal corporation 504 

15 against whom the Commission shall have rendered an award for 505 

16 the payment of money shall not be required to file a bond to 506 

17 secure the payment of the award and the costs of the 507 

18 proceedings in the court to authorize the court to issue such 508 

19 summons. 

20 The court may confirm or set aside the decision of the 510 

21 Commission. If the decision is set aside and the facts found 511 

22 in the proceedings before the Commission are sufficient, the 512 

23 court may enter such decision as is justified by law, or may 513 

24 remand the cause to the Commission for further proceedings 514 

25 and may state the questions requiring further hearing, and 515 

26 give such other instructions as nay be proper. Appeals shall 

27 be taken to the Supreme Court in accordance with Supreme 315 

28 Court Rule 302 (a) . 

29 It shall be the duty of the clerk of any court rendering 513 

30 a decision affecting or affirming an award of the Commission 519 

31 to promptly furnish the Commission with a copy of such 5 20 

32 decision, without charge. 

33 The decision of a majority of the members of the panel of =22 

34 the Commission, shall be considered the decision of the 523 

35 Commission. 

- 409 - 



-15- LaS8407703CMtc 

1 (g) Except in the case of a claim against the State of 525 

2 Illinois, either party may present a certified copy of the 525 

3 award of the Arbitrator, or a certified copy of the decision 527 

4 of the Commission when the same has become final, when no 523 

5 proceedings for review are pending, providing for the payment 529 
5 of compensation according to this Act, to the Circuit Court 530 

7 of the county in which such accident occurred or either of 531 

8 the parties are residents, whereupon the court shall enter a 

9 judgment in accordance therewith. In a case where the 532 
1'Q employer refuses to pay compensation according to such final 533 

11 award or such final decision upon which such judgment is 534 

12 entered the court shall in entering judgment thereon, tax as 535 

13 costs against him the reasonable costs and attorney fees in 536 

14 the arbitration proceedings and in the court entering the 

15 judgment for the person in whose favor the judgment is 537 
15 entered, which judgment and costs taxed as therein provided 538 
17 shall, until and unless set aside, have the same effect as 539 
IB though duly entered in an action duly tried and determined by 540 
13 the court, and shall with like effect, be entered and 541 
20. docketed. The Circuit Court shall have power at any time 

21 upon application to make any such judgment conform to any 542 

22 modification required by any subsequent decision of the 543 

23 Supreme Court upon appeal, or as the result of any subsequent 544 

24 proceedings for review, as provided in this Act. 545 

25 Judgment shall not be entered until 15 days' notice of 547 

26 the time and place of the application for the entry of 548 

27 judgment 3hali be served upon the employer by filing sucn 549 
23 notice with the Commission, which Commission shall, in case 550 
29 it has on file the address of the employer or the name and 551 
ID address of its agent upon whom notices may be served, 

31 immediately send a copy of the notice to the employer cr sucn 552 

32 designated agent. 

33 (h) An agreement or award under =hi3 Act providing for 554 
J4 compensation in installments, may ac any time within 13 55 5 
35 monchs after such agreement or award be reviewed by the 555 

- 410 - 



-16- LRB8407703CMtC 

1 Commission at the request of either the employer or the 557 

2 employee, on the ground that the disability of the employee 553 

3 has subsequently recurred, increased, diminished or ended. 

4 Eowever, as to accidents occurring subsequent to July 1, 560 

5 1955, which are covered by any agreement or award under this 561 

6 Act providing for compensation in installments made as a 562 

7 result of 3uch accident, such agreement or award may at any 563 

8 time within 30 months after such agreement or award be 564 

9 reviewed by the Commission at the request of either the 565 

10 employer or the employee on the ground that the disability of 

11 the employee has subsequently recurred, increased, diminished 556 

12 or ended. 

13 On such review, compensation payments may be 568 

14 re-established, increased, diminished or ended. The 569 

15 Commission shall give 15 days' notice to the parties of the 570 

16 hearing for review. Any employee, upon any petition for such 571 

17 review being filed by the employer, shall be entitled to 1 572 

18 day's notice for each 100 miles necessary to be traveled by 

19 him in attending the hearing of the Commission upon the 573 

20 petition, and 3 days in addition thereto. Such employee 574 

21 shall, at the discretion of the Commission, also be entitled 575 s 

22 to 5 cents per mile necessarily traveled by him within the 575 

23 State of Illinois in attending such hearing, not to exceed a 577 

24 distance of 300 miles, to be taxed by the Commission as costs 

25 and deposited with the petition of the employer. 573 

26 When compensation which is payable in accordance with an 580 

27 award or settlement contract approved by the Commission, is 531 

28 ordered paid in a lump sum by the Commission, no review shall 582 

29 be had as in this paragraph mentioned. 533 

30 (i) Each party, upon taking any proceedings or seeps 585 

31 whatsoever before any Arbitrator, Commission or court, shall =37 

32 file with the Commission his address, or the name and address 

33 of any agent upon whom all notices to be given to such party 533 

34 shall be served, either personally or by registered mail, 589 

35 addressed to 3uch party or agent at the last address so filed 590 



-17- LR38407703CMtC 

1 with the Commission. In the event such party has not filed 591 

2 his address , or the name and address of an agent as above 592 

3 provided, service of any notice may be had by filing such 593 

4 notice with the Commission. 

5 (j) Whenever in any proceeding testimony has been taken 595 
5 or a final decision has been rendered and after the taking of 596 
7 3uch testimony or after such decision has become final, the 597 
3 injured employee dies, then in any subsequent proceedings 598 
9 brought by the personal representative or beneficiaries of 599 

10 the deceased employee, such testimony in the former 500 

11 proceeding may be introduced with the same force and effect 

12 as though the witness having so testified were present in 601 

13 person in such subsequent proceedings and suen final 502 

14 decision, if any, 3hall be taken as final adjudication of any 603 

15 of the issues which are the same in both proceedings. 604 
15 (k) In case where there has been any unreasonable or 506 

17 vexatious delay of payment or intentional underpayment of 607 

18 compensation, or proceedings have been instituted or carried 608 

19 on by the one liable to pay the compensation, which do not 509 

20 present a real controversy, but are merely frivolous or for 510 

21 delay, then the Commission may award compensation additional 511 

22 to that otherwise payable under this Act equal to 50% of the 

23 amount payable at the time of 3uch award. Failure to pay 612 

24 compensation in accordance with the provisions of Section 8, 513 

25 paragraph (b) of this Act, shall be considered unreasonable 514 
25 delay. 

27 (1) In case the employer or his insurance carrier shall 515 

28 without good and just cause fail, neglect, refuse or 517 

29 unreasonably delay the payment of weekly compensation 518 

30 benefits due to an injured employee during the period of 619 

31 temporary total disability the arbitrator or the Commission 

32 shall allow to the employee additional compensation in the 5 20 

33 sum of S10 per day for each day thac a weekly compensation 521 

34 payment has been so withheld or refused, provided that such 522 

35 additional compensation shall not exceed the sum of S2,500. 523 

- 112 - 



-13- LR38407703CMtC 

1 A delay in payment of 14 days or more shall create a 624 

2 rebuttable presumption of unreasonable delay. 

3 (m) If the commission find3 that an accidental injury 626 

4 was directly and proximately caused by the employer's wilful 6 27 

5 violation' of a health and safety standard under the "Health 628 

6 and Safety Act", approved March 16, 1336, as now or hereafter 629 

7 amended, in force at the time of the accident, the arbitrator 630 

8 or the Commission shall allow to the injured employee cr his 531 

9 dependents, as the case may be, additional compensation equal 632 

10 to 25% of the amount which otherwise would be payable under 

11 the provisions of this Act exclusive of this paragraph. The 633 

12 additional compensation herein provided shall be allowed by 634 

13 an appropriate increase in the applicable weekly compensation 535 

14 rate. 

15 (n) After June 30, 1984, decisions of the Industrial 637 

16 Commission reviewing an award of an arbitrator" of the 539 

17 Commission shall draw interest at a rate equal to the yield 

13 on indebtedness issued by the United States Government with a 640 

19 26-week maturity next previously auctioned on the day on 541 

20 which the decision is filed. Said rate of interest shall be 642 

21 set forth in the Arbitrator's Decision. Interest shall be 643 

22 drawn from the date of the arbitrator's award on all accrued 

23 compensation due the employee through the day prior to the 544 

24 date of payments. However, when an employee appeals an award 543 

25 of an Arbitrator or the Commission, and the appeal results in 646 

26 no change or a decrease in the award, interest shall not 647 

27 further accrue from the date of such appeal. 

28 The employer or his insurance carrier may tender the 549 

29 payments due under the award to stop the further accrual of 650 

30 interest on such award notwithstanding the prosecution by 551 

31 either party of review, certiorari, appeal to the Supreme 652 

32 Court or other 3teps to reverse, vacate or modify the award. 

33 (o) By the 15th day of each month each insurer providing 654 

34 coverage for losses under this Act shall notify each insured 55 5 

35 employer of any compensable claim incurred during the 656 

- ill 3 - 



-19- LR38407703CMtc 

1 preceding month and the amounts paid or reserved on the claim 657 

2 including a summary of the claim and a brief statement of the 

3 reasons for compensability. A cumulative report of all 633 

4 claims incurred during a calendar year or continued from the 659 

5 previous year shall be furnished to the insured employer by 650 

6 the insurer within 30 days after the end of that calendar 651 

7 year. 

3 The insured employer may challenge, in proceeding before 55 3 

9 the Commission, payments made by the insurer without 564 

10 arbitration and payments made after a case is determined to 665 

11 be noncompensable. If the Commission finds that the case was 655 

12 not compensable, the insurer shall purge its records as to 667 

13 that employer of any ics3 or expense associated with the 

14 claim, reimburse the employer for attorneys' fees arising 663 

15 from the challenge and for any payment required of the 669 
15 employer to the Rate Adjustment Fund or the Second Injury 570 
17 Fund, and may not reflect the loss or expense for rate making 

13 purposes. The employee shall not be required to refund the 571- 

19 challenged payment. The decision of the Commission may be 672 

20 reviewed in the same manner as in arbitrated cases. No 573 

21 challenge may be initiated under this paragraph more than 3 67 4 

22 years after the payment is made. An employer may waive the 

23 right of challenge under this paragraph on a case by case 675 

24 basis. 675 

25 Section 2. Section 19 of the "Workers' Occupational 573 
25 Diseases Act", approved July 9, 1951, as amended, is amended 579 

27 to read as follows: 

(Ch. 48, par. 172.54) 581 

28 Sec. 19. Any disputed questions of law or fact shall be 583 

29 determined as herein provided. 584 

30 (a) It 3hali be the duty of the Commission upon 635 

31 notification that the parties bave failed to reach an 537 

32 agreement to designate an Arbitrator. 538 

33 (1) The application for adjustment of claim filed with 590 

34 the Commission shall state: 591 

- m<i - 



-20- LRB8407703CMtC 

1 A. The approximate date of the last day of the last 593 

2 exposure and the approximate date of the disablement. 594 

3 3. The general nature and character of the illness or 595 

4 disease claimed. 597 

5 C. The name and address of the employer by whom employed 699 

6 on the last day of the last exposure and if employed by any 700 

7 other employer after such last exposure and before 701 
3 disablement the name and address of such other employer or 70 2 
9 employers . 

10 D. In case of death, the date and place of death. 704 

11 S. Amendments to applications for adjustment of claim 706 

12 which relate to the same disablement or disablement resulting 707 

13 in death originally claimed upon may be allowed by the 708 

14 Commissioner or an Arbitrator thereof, in their discretion, 709 

15 and in the exercise of such discretion, they may in proper 710 

16 cases order a trial de novo; such amendment shall relate back 711 

17 to the date of the filing of the original application so 712 
IS amended. 

19 F. Whenever any claimant misconceives his remedy and 714 

20 files an application for adjustment of claim under this Act 715 

21 and it is subsequently discovered, at any time before final 715 

22 disposition of such cause, that the claim for disability or 717 

23 death which was the basis for such application 3hould 713 

24 properly have been made under the Workers' Compensation Act,- 719 

25 then the provisions of Section 19 paragraph (a-1) of the 720 
25 Workers' Compensation Act having reference to such 

27 application shall apply. 721 

28 Whenever any claimant misconceives his remedy and files 723 

29 an application for adjustment of claim under the Workers' 724 

30 Compensation Act and it is subsequently discovered, at any 72 5 

31 time before final disposition of such cause that the claim 725 

32 for injury or death which was the basis for such application 727 

33 should properly have been made under this Ac^, then the 723 

34 application so filed under the Workers' Compensacion Act may 

35 be amended in form, substance or both to assert claia for 729 

- 415 - 



-21- LHB8407703O4tC 

1 such disability or death under this Act and it shall be 730 

2 deemed to have been so filed as amended on the date of the 731 

3 original filing thereof, and such compensation may be awarded 732 

4 as is warranted by the whole evidence pursuant to the 

5 provisions of this Act, When such amendment is submitted, 733 

6 further or additional evidence may be heard by the Arbitrator 734 

7 or Commission when deemed necessary; provided, that nothing 735 
3 in this Section contained shall be construed to be or permit 736 
9 a waiver of any provisions of this Act with reference to 737 

10 notice, but notice if given shall be deemed to be a notice 738 

11 under the provisions of this Act if given within the time 

12 required herein. 

13 (b) The Arbitrator shall make such inquiries and 

14 investigations as he shall deem necessary and may examine and 743 

15 inspect all books, papers, records, places, or premises 744 
IS relating to the questions in dispute and hear such proper 

17 evidence as the parties may submit. 745 

18 The hearings before the Arbitrator shall be held in the 743 

19 vicinity where the last exposure occurred, after 10 days' 749 

20 notice of the time and place of such hearing shall have been 

21 given to each of the parties or their attorneys of record. 750 

22 The Arbitrator may find that the disabling condition is 753 

23 temporary and has not yet reached a permanent condition and 7 54 

24 may order the payment of compensation up to the date of the 755 

25 hearing, which award shall be reviewable and enforceable in 

25 the same manner as other awards, and in no instance be a bar 756 

27 to a further hearing and determination of a further amount of 757 

28 temporary total compensation or of compensation for permanent 753 

29 disability, but shall be conclusive as to all other questions 759 

30 except the nature and extent of such disability. 

31 The decision of the Arbitrator shall be filed with the 752 

32 Commission which Commission shall immediately 3end to each 753 

33 party or his attorney a copy of 3uch decision, together with 

34 a notification of the time when it wa3 filed. Beginning 764 

35 January 1, 1981, all decisions of the Arbitrator shall set 765 

- 416 - 



-22- LRB8407703CMtC 

1 forth in writing findings of fact and conclusions of law, 766 

2 separately stated. Unless a petition for review is filed by 763 

3 either party within IS days after the receipt by such party 

4 of the copy of the decision and notification of time when 769 

5 ' filed, and unless such party petitioning for a review shall 770 

6 within 20 days after the receipt by him of the copy of the 771 

7 decision, file with the Commission either an agreed statement 772 

8 of the facts appearing upon the hearing before the 773 

9 Arbitrator, or if such party shall so elect a correct 774 

10 transcript of evidence of the proceedings at such hearings, 775 

11 then the decision shall become the decision of the Commission 776 

12 and in the absence of fraud shall be conclusive. The 777 

13 Commission, or any member thereof, may grant further time not 

14 exceeding 30 days, in which to file such agreed statement or 778 
L5 transcript of evidence. Such agreed statement of facts or 779 

15 correct transcript of evidence, as the case may be, shall be 780 

17 authenticated by the signatures of the parties or their 781 

18 attorneys, and in the event they do not agree as to the 782 

19 correctness of the transcript of evidence it shall be 783 

20 authenticated by the signature of the Arbitrator designated 

21 by the Commission. 784 

22 (b-1) If the employee is not receiving, pursuant to 787 

23 Section 7, medical, surgical or hospital services of the type 788 

24 provided for in paragraph (a) of Section 8 of the Workers' 789 

25 Compensation Act or compensation of the type provided for in 790 
25 paragraph (b) of Section 8 of the Workers' Compensation Act, 

27 the employee, in accordance with Commission Rules, may file a 791 

28 petition for an emergency hearing ay an Arbitrator en the 793 

29 issue of whether or not he is entitled to receive payment of 794 

30 such compensation or services as provided therein. Such 795 

31 petition shall have priority over all other petitions and^ 796 

32 once filed, may at no time be amended bv the petitioner. The 797 

33 petition shall be heard by the Arbitrator and Commission with 793 

34 ail convenient speed. 

35 Such petition shall contain the following information and 801 

- 417 - 



-23- LRB8407703CMtc 

1 shall be served on the employer at least 15 days before it is 801 

2 filed: 

3 (i) the date and approximate time of the last exposure; 803 

4 (ii) the approximate location of the last exposure; 805 

5 (iii) a description of the last exposure; 807 

6 (iv) the nature of the disability incurred by the 809 

7 employee ; 

8 (v) the identity of the person, if known, to whom the 311 

9 disability was reported and the date on which it was 812 

10 reported; 

11 (vi) the name and title of the person, if known, 814 

12 representing the employer with whom the employee conferred in 815 

13 any effort to obtain pursuant to Section 7 compensation of 815 

14 the type provided for in paragraph (b) of Section 3 of the 317 

15 Workers' Compensation Act or medical, surgical or hospital 318 
IS services of the type provided for in paragraph (a) of Section 

17 8 of the Workers' Compensation Act and the date of such 819 

18 conference; 

19 (vii) a statement that the employer has refused to pay 321 

20 compensation pursuant to Section 7 of the type provided for 322 

21 in paragraph (b) of Section 8 of the Workers' Compensation 823 

22 Act or for medical, surgical or hospital services pursuant: co 824 

23 Section 7 of the type provided for in paragraph (a) of 825 

24 Section 8 of the Workers' Compensacion Act. 

25 (viii) the name and address, if known, of each witness 827 
25 to the last exposure and of each other person upon whom zhe 323 
27 employee will rely to support his allegations; 829 
23 (ix) the dates of treatment related to the disability by 332 

29 medical practitioners, and the names and addresses of such 333 

30 practitioners, including the dates of treatment related to 834 

31 the disability at any hospitals and the names and addresses 835 

32 of such hospitals, and a 3igned authorization permitting the 

33 employer to examine all aedical records of all practitioners 335 

34 and hospitals named pursuant to this paragraph; 337 

35 (x) a copy of a signed report by a aedical practitioner, 839 

- ma - 



-24- LH38407703CMtc 

1 relating to the employee's current inability to return to 841 

2 work because of the disability incurred as a result .of the 842 

3 exposure or such other documents or affidavits which show 843 

4 that the employee is entitled to receive pursuant to Section 

5 7 compensation of the type provided for in paragraph (b) of 844 

6 Section 8 of the Workers' Compensation Act or medical, 845 

7 surgical or hospital services of the type provided for in 847 

8 paragraph (a) of Section 8 of the Workers' Compensation Act. 

9 Such reports, documents or affidavits shall stace, if 348 

10 possible, the history of the exposure given by the employee, 849 

11 and describe the disability and medical diagnosis, the 850 

12 medical services for such disability which the employee has 851 

13 received and is receiving, the physical activities which the 853 

14 employee cannot currently perform as a result of such 854 

15 disability, and the prognosis for recovery; 

16 (xi) complete copies of any reports, records, documents 35S 

17 and .affidavits in the possession of the employee on which the 858 

18 employee will rely to support his allegations, provided that 859 

19 the employer shall pay the reasonable cose of reproduction 

20 thereof? 

21 (six) a list of any reports, records, documents and 861 

22 affidavits which the employee has demanded by subpoena and on 862 

23 which he intends to rely to support his allegations; 363 

24 (sill) a certification signed by the employee or his 865 

25 representative that the employer has received the petition 865 

26 with the required information 15 days before filing. 867 

27 Fifteen days after receipt by the employer of the 369 

28 petition with the required information the employee may file 870 

29 said petition and required information and shall serve notice 371 

30 of the filing upon the employer. The employer may file a 872 

31 motion addressed to the sufficiency of the petition. If an 373 

32 objection has been filed to the sufficiency of the petition, 

33 the arbitrator shall rule on the objection within 2 working 874 

34 days. If such an objection is filed, the time for filing the 375 

35 final decision of the Commission as provided in this 375 



-25- LSB8407703CMtC 

1 paragraph shall be tolled until the arbitrator has determined 877 

2 that the petition is sufficient. The petitioner may not 878 

3 amend a petition that has been ruled insufficient by the 879 

4 arbitrator, but may file a new petition pursuant to this 

5 Section. ' 

6 The employer shall, within 15 days after receipt of the 381 

7 notice that such petition is filed, file with the Commission 383 

8 and serve on the employee or his representative a written 884 

9 response to each claim set forth in the petition, including 885 
Id the legal and factual basis for each disputed allegation and 386 

11 the following information: (i) complete copies of any 387 

12 reports, records, documents and affidavits in the possession 388 

13 of the employer on which the employer intends to rely in 889 

14 support of his response, (ii) a list of any reports, records, 

15 documents and affidavits which the employer has demanded by 890 
IS subpoena and on which the employer intends to rely in support 891 
17 of his response, (iii) the name and address of each witness 892 
13 on whom the employer will rely to support his response, and 393 

19 (iv) the names and addresses of any medical practitioners 394 

20 selected by the employer pursuant to Section 12 of this Act 

21 . and the time and place of any examination scheduled to be 895 

22 . made pursuant to such Section. 

23 Any employer who does not timely file and serve a written 898 

24 response without good cause may not introduce any evidence to 399 

25 dispute any claim of the employee but may cros3 examine the 900 

26 employee or any witness brought by the employee and otherwise 

27 be heard. 

28 No document or other evidence not previously identified 90 2 

29 by either party with the petition or written response, or by 904 

30 any other means before the hearing, may be introduced into 905 

31 evidence without good cause. If, at the hearing, material 906 

32 information is discovered which was not previously disclosed, 90 7 

33 the Arbitrator may extend the time for closing proof on the 908 
3 4 motion of a party for a reasonable period of cine which may 

35 be more than 30 days. No evidence may be introduced pursuant 910 

- 420 - 



-26- LRB8407703CMtC 



911 



1 to this paragraph as to permanent disability. No award may 

2 be entered for permanent disability pursuant to this 912 

3 paragraph. Either party may introduce into evidence the 913 

4 testimony taken by deposition of any medical practitioner. 

5 The ' Commission shall adopt rules, regulations and 915 

6 procedures whereby the final decision of the Commission is 915 

7 filed not later than 90 days from the date the petition for 917 
3 review is filed but in no event later than 130 days from the 913 
9 date the petition for an emergency hearing is filed with the 

10 Industrial Commission. 

11 All service required pursuant to this paragraph (b-1) 9 21 

12 must be by personal service or by certified mail and with 922 

13 evidence of receipt. In addition for the purposes of this 

14 paragraph, all service on the employer must be at the 923 

15 premises where the accident occurred if the premises are 924 
15 owned or operated by the employer. Otherwise service must be 925 
17 at the employee's principal place of employment by the 

13 employer. If service on the employer is not possible at 926 

19 either ofi the above, then service shall be ac the employer's 927 

20 principal place of business. After initial service in each 928 

21 case, service shall be made on the employer's attorney or 9 29 

22 designated representative. 

23 (c) (1) At a reasonable time in advance of and in 931 

24 connection with the hearing under Section 19(e) or 19(h), the 932 

25 Commission may on its own motion order an impartial physical 933 

26 or mental examination of a petitioner whose aental or 934 

27 physical condition is in issue, when in the Commission's 

28 discretion it appears that such an examination will 935 

29 materially aid in the just determination of the case. The 936 

30 examination shall be made by a member or members of a panel 

21 of physicians chosen for their special qualifications by the 9 37 

32 Illinois State Medical Society. The Commission shall 938 

33 establish procedures by which a physician shall be selected 9 39 

34 from such list. 

35 (2) Should the Commission at any time during the hearing 941 

- Zl?1 - 



-27- LH38407703CMtc 

1 find that compelling considerations make it advisable to have 942 

2 an examination and report at that time, the commission may in 943 

3 its discretion so order. 

4 (3) A copy of the report of examination shall be given 945 

5 to the Commission and to the attorneys for the parties. 946 

6 (4) Zither party or the Commission may call the 948 

7 examining physician or physicians to testify. Any physician 949 
.8 so called shall be subject to cross-examination. 

9 (5) The examination shall be made, and the physician or 951 

10 physicians, if called, shall testify, without co3t to the 952 

11 parties. The Commission shall determine the compensation and 953 

12 the pay of the physician or physicians. The compensation for 954 

13 this service shall not exceed the usual and customary amount 

14 for such service. 955 

15 The fees and payment thereof of all attorneys and 957 
IS physicians for services authorized by the Commission under 958 

17 this Act shall, upon request of either the employer or the 959 

18 employee or the beneficiary affected, be subject to the 960 

19 review and decision of the Commission. 

23 (d) If any employee shall persist in insanicary or 962 

21 injurious practices which tend to either imperil or retard 963 

22 hi3 recovery or shall refuse to 3ubmit to such medical, 964 

23 surgical, or hospital treatment as is reasonably essential to 965 

24 promote hi3 recovery, the Commission may, in its discretion, 966 

25 reduce or suspend the compensation of any such employee; 967 
25 provided, that when an employer and employee so agree in 

27 writing, the foregoing provision shall not be construed to 968 

23 authorize the reduction or suspension of compensation of an 969 

29 employee who is relying in good faith, on treatment by prayer 970 

30 or spiritual means alone, in accordance with' the tenets and 971 

31 practice of a recognized church or religious denomination, by 

32 a duly accredited practitioner thereof. 972 

33 (e) This paragraph shall apply to ail hearings before 975 

34 the Commission, including those brought under petitions for 976 

35 emergency hearings as provided in paragraph (b-1), except to 377 

- 422 - 



-28- LaB8407703CMtC 

1 the extent the limitations of time and the taking of 973 

2 additional evidence set forth in paragraph (b-1) are 979 

3 inconsistent with the provisions of this paragraph. If a 980 

4 petition for review and agreed statement of facts or 981 

5 transcript of evidence is filed, as provided herein, the 

6 Commission shall promptly review the decision of the 982 

7 Arbitrator and all questions of law or fact which appear from 983 

8 the statement of facts or transcripts of evidence. 985 

9 Additional evidence may be adduced where such evidence (!) 986 

10 relates to the condition of the employee since the time of 987 

11 the arbitration hearing, (2) relates to matters that occurred 

12 or conditions that developed after the arbitration hearing , 988 

13 ©r (3) was, for good cause, act introduced at the arbitration 989 

14 hearing. After such hearing upon review, the Commission 991 
U shall file in its office its decision thereon, and shall 992 

15 immediately send to each party or his attorney a copy of such 

17 decision and a notification of the time when it was filed. 994 

18 After January 1, 1986, decisions shall be filed within 60 

19 days after a hearing on review or oral argument whichever is 995 

20 later. 

21 Such review and hearing may be held in its office or 997 

22 elsewhere as the Commission may deem advisable. The taking of 998 

23 testimony on such hearings may be had before any member of 999 

24 the Commission. In the event either party requests oral 1000 

25 argument, such argument shall be had before a panel of thrae 1001 

26 members of the Commission (or before all available members 1002 

27 pursuant to the determination of 5 members of the Commission 1003 

28 that such argument be held before ail available members of 1Q04 

29 the Commission) pursuant to the rules and regulations of the 100 5 

30 • Commission. A panel of three members, which shall be 1006 

31 comprised of not more than one representative citizen of the 

32 employing cias3 and not more than one representative citizen 1003 

33 of the employee class, shall hear the argument; provided thac 1010 

34 if all the issues in dispute are solely the nature and extent 1011 
25 of the permanent partial disability, if any, a majority of 1012 



-29- LSB8407703CMtc 

1 the panel nay deny the request for such argument and such 1013 

2 argument shall not be held; and provided further that 5 1014 

3 members of the Commission may determine that the argument be 1015 

4 held before all available members cf the Commission. 1017 

5 Notwithstanding any other provisions of this Section, the 1018 

6 Chairman may not regularly serve on any panel of 3 members of 

7 the Commission as described in this Section, but may 1019 
3 substitute for any member who is unavailable. A decision of 1021 
9 the Commission shall be approved by a majority of 1022 

10 Commissioners present at such hearing if any; provided, if no 

11 such hearing is held, a decision of the Commission shall be 1023 

12 approved by a majority of a panel of 3 members of the 1024 

13 Commission as described in this Section. The Commission 1026 

14 shall give 10 days' notice to the parties or their attorneys 1027 

15 of the time and place of such taking of testimony and of such 1028 

16 argument. 

17 In any case the Commission in its decision may in its 1030 

18 discretion find specially upon any question or questions of 1031 

19 law or facta which shall be submitted in writing by either 1032 

20 party whether ultimate or otherwise; provided that on issues 1033 

21 other than nature and extent of the disablement, if any, the 1034 

22 Commission in its decision shall find specially upon any 10 35 

23 question or questions of law or fact, whether ultimate or 

24 otherwise, which are submitted in writing by either party; 1036 

25 provided further that not mora than 5 such questions may be 10 37 
25 submitted by either party. Any party may, within 20 days 1033 

27 after receipc of notice of the Commission's decision, or 1039 

28 within 3uch further time, not exceeding 30 days, as the 10 40 

29 Commission may grant, file with the Commission either an 

30 agreed statement of the facts appearing upon the hearing, or, 10 41 

31 if such party shall 30 elect, a correct transcript of 1042 

32 evidence of the additional proceedings presented before the 1043 

33 Commission in which report the party may embody a correc- 1044 

34 statement of 3uch other proceedings in the case as such party 1045 

35 may desire to have reviewed, such 3tatemenc of facts or 1046 

- mn - 



-30- LR38407703CMtC 

1 transcript of evidence to be authenticated by the signature '1045 

2 of the parties or their attorneys, and in the event that they 1047 

3 do not agree, then the authentication of such transcript of 1048 

4 evidence shall be by the signature of any member of the 1049 

5 Commission. 

6 If a reporter does not for any reason furnish a 1051 

7 transcript of the proceedings before the Arbitrator in any 1052 

8 case for use on a hearing for review before the Commission, 1053 

9 within the limitations of time as fixed in this Section, the 1054 

10 Commission may, in its discretion, order a trial de novo 1055 

11 before the Commission in such case upon application of either 

12 party. The applications for adjustment of claim and other 1055 

13 documents in the nature of pleadings filed by either party, 1057 

14 together with the decisions of the Arbitrator and of the 1053 

15 Commission and the statement of facts or transcript of 1059 

16 evidence hereinbefore provided for in paragraphs (b) and (c) 1060 

17 shall be the record of the proceedings of the Commission, and 1061 

18 shall be subject to review as hereinafter provided. 

19 At the request of either party or on its own motion, the 1063 

20 Commission shall set forth in writing the reasons for the 1064 

21 decision, including findings of fact and conclusions of law, 1055 

22 separately stated. The Commission shall by rule adopt a 1066 

23 format for written decisions for the Commission and 1067 

24 arbitrators. The written decisions 3hall be concise and shall 1063 

25 succinctly state the fact3 and reasons for the decision. The 1069 

26 Commission may adopt in whole or in part, the decision of che 1070 

27 arbitrator as the decision of the Commission. When the 1071 

28 Commission does so adopt the decision of the arbitrator, it 1072 

29 shall do so by order. Whenever the Commission adopts part of 

30 the arbitrator's decision, but not all, it shall include in 1073 

31 the order the reasons for not adopting ail of the 1074 

32 arbitrator's decision. When a majority of a panel, after 1075 

33 deliberation, has arrived at its decision, the decision shall 1075 

34 be filed as provided in this Section without unnecessary 

35 delay, and without regard to the fact that a member of the 1077 

- 425 - 



-31- LHB8407703CMtC 

1 panel has expressed an intention to dissent. Any member of 1079 

2 the panel may file a dissent. Any dissent shall be filed no 

3 later than 10 day3 after the decision of the majority has 1080 

4 _ been filed. 

5 Decisions rendered by the Commission after the effective 1082 
5 date of this amendatory Act of 1980 and dissents, if any, 1083 

7 shall be published together by the Commission. The 1084 

8 conclusions of law set out in such decisions shall be 108S 

9 regarded as precedents by arbitrators, for the purpose of 1085 

10 achieving a more uniform administration of this Act. 1087 

11 (f) The decision of the Commission acting within its 1089 

12 powers, according to the provisions of paragraph (e) of this 1090 

13 Section shall, in the absence of fraud, be conclusive unless 1091 

14 reviewed as in this paragraph hereinafter provided. However, 109 2 

15 the Arbitrator or the Commission may on his or its own 1093 

16 motion, or on the motion of either party, correct any 1094 

17 clerical error or errors in computation within 15 days after 

18 the date of receipt of any award by such Arbitrator or any 1095 

19 decision on review of the Commission, and shall have the 1096 

20 power to recall the original award on arbitration or decision 1097 

21 on review, and issue in lieu thereof such corrected award or 1098 

22 decision. Where such correction is made the time for review 1099 

23 herein specified shall begin co run from the date of the 1100 

24 receipt of the corrected award or decision. 

25 (1) Except in cases of claims against the State of 110 2 

26 Illinois, in which case the decision of the Commission shall 1103 

27 not be subject to judicial review, the Circuit Court of the 1104 
23 county where any of the parties defendant may be found, or if 1105 

29 none of the parties defendant be found in thi3 State then the 1106 

30 Circuit Court of the county where any of the exposure 1107 

31 occurred, shall by summons to the Commission have power co 1108 

32 review all questions of law and fact presented by such 11Q9 

33 record. 

34 A proceeding for review 3hail be commenced within 20 days 1112 

35 of the receipt of notice of the decision of the Commission. 1113 

- H?.f> - 



-32- LRB8407703CMtc 

1 The s ummo ns shall be issued by the cleric of such court upon 1115 

2 written request . returnable on a designated return day, not 1116 

3 less than 10 or more than 60 days from the date of issuance 1117 

4 thereof, and the written request shall contain the last known 1118 

5 address of other parties in interest and their attorneys of 1120 

6 record who are to be served by summons. Service upon any 1121 

7 member of the Commission or the Secretary or the Assistant 1122 
3 Secretary thereof shall be service upon the Commission, and 1123 
9 service upon other parties in interest and their attorneys of 

10 record shall be by summons, and such service shall be made 1124 

11 upon the Commission and other parties in interest by mailing 1125 

12 notices of the commencement of the proceedings and the return 1126 

13 day of the summons to the office of the Commission and to the 1127 

14 last known place of residence of other parties in interest or 1128 

15 their attorney or attorneys of record. The clerk of the court 1129 

16 issuing the summons shall on the day of issue mail notice of 1130 

17 the commencement of the proceedings which shall be done by 1131 

18 mailing a copy of the summons to the office of the 1132 

19 Commission, and a copy of the summons to the other parties in 1133 

20 interest or their attorney or attorneys of record and the 1134 

21 clerk of the court shall make certificate chat he has so sent 1135 

22 such notices in pursuance of this Section, which shall be 1136 

23 evidence of service on the Commission and other parties in 1137 

24 interest. 

25 The Commission shall not be required to certify the 1139 

26 record of their proceedings in the Circuit Court unless che 1140 

27 party commencing the proceedings for review in che Circuit 1141 

28 Court as above provided, shall pay to the Commission the sua 114 2 

29 of 80 cents per page of testimony taken before the 1143 

30 Co mmi ssion, and 35 cenc3 per page of ail other matters 

31 contained in such record, except as otherwise provided by 1144 

32 Section 20 of this Act. Payment for photostatic copies of 1145 

33 exhibit shall be extra. It shall be the duty of the 1146 

34 Commission upon such payment, or failure to pay as permitted 1147 

35 under Section 20 of this Act, to prepare a true and correct 



-33- La38407703CMtc 

1 typewritten copy of such testimony and a true and correct 1148 

2 copy of all other matters contained in such record and 1149 

3 certified to by the Secretary or Assistant Secretary thereof. 1150 

4 In its decision on review the Commission shall determine 1152 

5 in each particular case the amount of the probable cost of 1153 
5 the record to be filed as a return to the summons in that 1154 
7 case and no request for a summons may be filed and no summons 1156 
3 shall issue unless the party seeking to review the decision 1157 
9 of the Commission shall exhibit to the clerk of the Circuit 1158 

10 Court proof of payment by filing a receipt showing payment or 1159 

11 an affidavit of the attorney setting forth that payment has 1150 

12 been made of the sums so determined to the Secretary or 1161 

13 Assistant Secretary of the Commission. 1162 

14 ' (2) Ho such summons shall issue unless the one against 1164 

15 whom the Commission shall have rendered an award for the 1165 

16 payment of money shall upon the filing of his written request 1166 

17 for such summons file with the clerk of the court a bond 1168 
13 conditioned that if he shall not successfully prosecute the 1159 

19 review, he will pay the award and the costs of the 1170 

20 proceedings in the court. The amount of the bond shall be 

21 fixed by any member of the Commission and the surety or 1171 

22 sureties of the bond shall be approved by che clerk of the 1172 

23 court. The acceptance of the bond by the clerk of the court 1173 

24 shall constitute evidence of hi3 approval of the bond. 1174 

25 Every county, city, town, township, incorporated village, 1176 

26 school district, body politic or municipal corporation having 1177 

27 a population of 500,000 or more against whom the Commission 1173 

28 shall have rendered an award for the payment of aoney shall 1179 

29 not be required to file a bond to secure the payment of the 1130 

30 award and the costs of the proceedings in the court to 1131 

31 authorize the court to issue such summons. 

32 The court may confirm or 3et aside the decision of the 1133 

33 Commission. If the decision is set aside and the facts found 1134 

34 in the proceedings before the Commission are sufficient, the 1135 

35 court may enter such decision as is justified by law, or may 1136 

- 428 - 



-34- LR38407703O4tc 

1 remand the cause to the Commission for further proceedings 1137 

2 and may state the questions requiring further hearing, and 1138 

3 give such other instructions as may be proper. Appeals shall 

4 be taken to the Supreme Court in accordance with Supreme 1139 

5 Court Rule 302(a). 

6 It shall be the duty of the cleric of any court rendering 1191 

7 a decision affecting or affirming an award of the Commission 1192 

8 to promptly furnish the Commission with a copy of such 119 2 

9 decision, without charge. 

10 The decision of a majority of the members of the panel of 1195 

11 the Commission, shall be considered the decision of the 1197 

12 Commission. 

13 (g) Except in the case of a claim against the State of 1199 

14 Illinois, either party may present a certified copy of the 1200 

15 award of the Arbitrator, or a certified copy of the decision 1201 

16 of the Commission when the same has become final, when no 1202 

17 proceedings for review are pending, providing for the payment 1203 

18 of compensation according to this Act, to the Circuit Court 1204 

19 of the county in which such exposure occurred or either of 1205 

20 the parties are residents, whereupon the court shall enter a 

21 judgment in accordance therewith. In case where the employer 1205 

22 refuses to pay compensation according to such final award or 1207 

23 rsuch final decision upon which such judgment is entered, the 1208 

24 court shall in entering judgment thereon, tax as costs 1209 

25 against him the reasonable costs and attorney fees in the 1210 
25 arbitration proceedings and in the court entering the 

27 judgment for the person in whose favor the judgment is 1211 

23 entered, which judgment and costs taxed as herein provided 1212 

29 shall, until and unless set aside, have the 3ame effect as 1213 

30 though duly entered in an action duly tried and determined by 1214 

31 the court, and shall with like effect, be entered and 1215 

32 docketed. The Circuit Court shall have power ac any time upon 

23 application to make any such judgment conform so any 1215 

34 modification required by any subsequent decision of the 1217 

35 Supreme Court upon appeal, or as the result of any subsequent 1213 

- 429 - 



-35- L2B8407703CMtc 

1 proceedings for review, as provided in this Act. 1219 

2 ' Judgment shall not be entered until IS days' notice of 1221 

3 the time and place of the application for the entry of 122 2 

4 judgment shall be served upon the employer by filing such 1223 

5 notice with the Commission, which Commission shall, in case 1224 

6 it has on file the address of the employer or the name and 1225 

7 address of its agent upon whom notices may be served, 

8 immediately send a copy of the notice to the employer or such 122S 

9 designated agent. 

10 (h) An agreement or award under this Act providing for 1228 

11 compensation in installments, may at any time within 18 1229 

12 months after 3uch agreement or award be reviewed by the 1230 

13 Commission at the request of either the employer or the 1231 

14 employee on the ground that the disability of the employee 1232 

15 has subsequently recurred, increased, diminished or ended. 

16 However, as to disablements occurring subsequently to 1234 

17 July 1, 1955, which are covered by any agreement or award 1235 
13 under this Act providing for compensation in installments 1236 

19 made as a result of such disablement, such agreement or award 1237 

20 may at any time within 30 months after such agreement or 1233 

21 award be reviewed by the Commission at the request of either 

22 the employer or the employee on the ground that the 1239 

23 disability of the employee has subsequently recurred, 1240 

24 increased, diminished or ended. 

25 On such review compensation payments may be 1242 

26 re-established, increased, diminished or ended. The 1243 

27 Commission shall give 15 days' r.ctice to the parties cf the 1244 

28 hearing for review. Any employee, upon any petition for sucii 1245 

29 review being filed by the employer, shall be entitled to 1 1245 

30 day's notice for each 100 miles necessary to be traveled by 

31 him in attending the hearing of the Commission upon the 12 47 

32 petition, and 3 days in addition thereto. Such employee 1243 

33 shall, at the discretion of the Commission, also be entitled 1249 

34 to 5 cents per mile necessarily traveled by him within the 1250 

35 State of Illinois in attending such hearing, not to exceed a 1251 

- 130 - 



-36- LaB8407703CMtc 

1 distance of 300 miles, to be taxed by the Commission as costs 1251 

2 and deposited with the petition of the employer. 1252 

3 When compensation which is payable in accordance with an 125-1 

4 award or settlement contract approved by the Commission, is 1255 

5 ordered paid in a lump sum by the Commission, no review shall 1256 

6 be had as in this paragraph mentioned. 1257 

7 (i) Each party, upon taking any proceedings or steps 1259 

8 whatsoever before any Arbitrator, Commission or court, shall 1261 

9 file with the Commission his address, or the name and address 

10 of any agent upon whom all notices to be given to such party 1262 

11 shall be served, either personally or by registered mail, 1263 

12 addressed to such party or agent at the last address so filed 1264 

13 with the Commission. In the event such party has not filed 1265 

14 his address, or the name and address of an agent as above 1266 

15 provided, service of any notice may be had by filing such 1267 

16 notice with the Commission. 

17 (j) Whenever in any proceeding testimony has been taken 1269 

18 or a final decision has been rendered, and after the taking 1270 

19 of such testimony or after such decision has become final, 1271 

20 the employee dies, then in any subsequent proceeding brought 1272 

21 by the personal representative or beneficiaries of the 1273 

22 deceased employee, such testimony in the former proceeding 1274 

23 may be introduced with the same force and effect as though 1275 

24 the witness having so testified were present in person in 

25 such subsequent proceedings and such final decision, if any, 1276 

26 shall be taken as final adjudication of any of the issues 1277 

27 which are the same in both proceedings. 1273 

28 (k) In any case where there has been any unreasonable or 1280 

29 vexatious delay of paymenc or intentional underpayment of 1281 

30 compensation, or proceedings have been instituted or carried 1282 

31 on by one liable to pay the compensation, which do not 1233 

32 present a real controversy, but are merely frivolous or for 1234 

33 delay, then the Commission may award compensacion additional 1285 
24 to that otherwise payable under this Act equal to 50% of the 

35 amount payable at the time of 3uch award. Failure to cay 1235 

- 431 - 



-37- LRB8407703CMtc 

1 compensation in accordance with the provisions of Section 8, 1287 

2 paragraph (b) of this Act, shall be considered unreasonable 1238 

3 delay. 

4 (1) 3y the 15th day of each month each insurer providing 1290 

5 coverage for losses under this Act shall notify each insured 1291 

6 employer of any compensable claim incurred during the 1292 

7 preceding month and the amounts paid or reserved on the claim 1293 

8 including a summary of the claim and a brief statement of the 

9 reasons for compensability. A cumulative report of all 1294 

10 claims incurred during a calendar year or continued from the 1296 

11 previous year shall be furnished to the insured employer by 

12 the insurer within 30 day3 after the end of that calendar 1297 

13 year. 

14 The insured employer may challenge, in proceeding before 1299 

15 the Commission, payments made by the insurer without 1300 

16 arbitration and payments made after a case is determined to 1301 

17 be noncompensable . If the Commission finds that the case was 1302 

18 not compensable, the insurer shall purge its records as to 1303 

19 that employer of any loss or expense associated with the 

20 claim, reimburse the employer for attorneys fee arising from 1304 

21 the challenge and for any payment required of the employer to 130 5 

22 the Rata Adjustment Fund or the Second Injury Fund, and may 1306 

23 not effect the los3 or expense for rate making purposes. The 1307 

24 employee shall not be required to refund the challenged 

25 payment. The decision of the Commission may be reviewed in 1308 

26 the same manner as in arbitrated cases. Mo challenge may be 1309 

27 initiated under thi3 paragraph more rhan 3 years after the 1310 

28 payment is made. An employer may waive the right cf 1311 

29 challenge under this paragraph on a case by case basis. 1312 

30 Section 3. This Act takes effect upon its becoming a 1314 

31 law. 



<!32 



BILL 32 



Background 

After reviewing the Illinois State and Local Labor Relations Boards' rules 
concerning the length of time allowed a fact-finder to issue a written report 
following a hearing (80 III. Adm. Code 1230), the Joint Committee on 
Administrative Rules found that the Boards' rules conflict with Section 13 of 
the Illinois Public Labor Relations Act. The Boards' rules require that the 
fact-finder issue a written report as soon after the hearing as practicable, 
while the Act requires a report of facts and recommendations to be issued 
upon completion of the hearing, but no later than 45 days from the date of 
the fact-finder's appointment. The Boards' interpretation of the statutory 
provision is that the 45 day limitation in Section 13 is directory rather than 
mandatory meaning that the fact-finder shall, if possible, issue a written 
report within 45 days after the appointment. The 45 day limitation on 
fact-finders' reports contained in Section 13 is unambiguous. Therefore, the 
Joint Committee recommended that legislation be developed to amend Section 13 
of the Illinois Public Labor Relations Act to clarify the mandatory nature of 
the statutory deadline for issuance of a written report by a fact-finder. 

Summary 

Amends Section 13 of the Illinois Public Labor Relations Act (III. Rev. Stat. 
1984 Supp., ch. 48, par. 1613) to make it clear that fact-finders must make 
written findings of fact and recommendations for resolution of labor disputes 
and serve such findings on the public employer and labor organization 
involved as well as publicizing all such findings no later than forty-five days 
from the date of the fact-finders' appointment. Effective immediately. 



416 



433 



- 43'; - 



84th GENERAL ASSEMBLY 
State of Illinois 
1985 and 1986 



INTRODUCED , BY 



SYNOPSIS: (Ch. 48, par. 1613) 

Amends the Illinois Public Labor Relations Act 
relating to fact-finding. Provides that if the fact-finder 
does not make written findings of facts and recommendations 
for the resolution of the labor dispute and serve and 
publicize his findings within 45 days of the date of 
appointment of the fact-finder, the parties may resume 
negotiations. Effective immediately. 



LRE8407583RCT.I 



A SILL FOR 



LRB8407583RCml 

1 AN ACT to amend Section 13 of the "Illinois Public Labor 57 

2 Relations Act", certified December 27, 1983, -as amended. 59 

3 Be it enacted by the People of the State of Illinois, 5 3 

4 represented in the General Assembly; 

5 Section 1. Section 13 of the "Illinois Public Labor 65 

6 Relations Act", certified December 27, 1983, as amended, is 56 

7 amended to read as follows: 

(Ch. 48, par. 1613) 68 

8 Sec. 13. Fact-finding. (a) If, after a reasonable 70 

9 period of negotiation over the terms of the agreement, or 71 

10 upon expiration of an existing collective bargaining 72 

11 agreement and the parties have not been able to mutually 

12 resolve the dispute, the parties may, by mutual consent 7 3 

13 initiate a fact-finding. 

14 (b) Within three days of such request the Board must 75 

15 submit to the parties a panel of 7 qualified, disinterested 76 

16 persons from the Illinois Public Employees Mediation Roster 77 

17 to serve as a fact-finder. The parties to the dispute shall 78 

18 designate one of the 7 persons to serve as fact-finder. The 

19 fact-finder must act independently of the Board and may be 79 

20 the same person who participated in the mediation of the 80 

21 labo^dispute if both parties consent. The person selected 81 

22 or appointed as fact-finder shall immediately establish the 82 

23 dates and place of hearings. Upon request, the 3oard shall 

24 issue subpoenas for hearings conducted by the fact-finder. 83 

25 The fact-finder may administer oaths. The fact-finder shall 34 
25 initially determine what issues are in dispute and therefore 85 

27 properly before the fact-finder. Upon completion of the 

28 hearings, but no later than 45 days from the date of 36 

29 appointment, the fact-finder must make written findings of 37 

30 facts and recommendations for resolution of the dispute, must 88 

31 serve findings on the public employer and the Labor 

32 organization involved, and must publicize such findings by 89 

- 436 - 



-2- LRB8407583RCml 

1 mailing them to all newspapers of general circulation in the 90 

2 community. The fact-Cinder's findings shall be advisory only 91 

3 and shall not be binding upon the parties. If the parties do 92 

4 not accept the recommendations of the fact-finder as the 93 

5 basis for settlement, or if the fact-finder does not make 

6 written findings of facts and recommendations for the 94 

7 resolution of the dispute and serve and publicize such 95 

8 findings within 45 days of the date of appointment, the 96 

9 parties fehey may resume negotiations. 

10 (c) The public employer and the labor organization which 98 

11 is certified as exclusive representative or which is 99 

12 recognized as exclusive representative in any particular 100 

13 bargaining unit by the state or political subdivision are the 101 

14 only proper parties to the fact-finding proceedings. 102 

15 Section 2. This Act takes effect upon becoming law. 104 



437 - 



438 



1985 LEGISLATIVE ACTIVITY 



The 1985 recommendations for legislation issued by the Joint Committee on 
Administrative Rules were overwhelmingly endorsed by the Genera! Assembly 
as evidenced by the number of Committee drafted .and sponsored bills passed 
during the 1985 Spring Session. In addition, several public acts sponsored 
by Joint Committee members produced changes in the Illinois Administrative 
Procedure Act. The following is a summation of those public acts. 

Public Act 84-0022 . Public Act 84-0022 (House Bill 394, sponsored by 
Representatives Barnes and Vinson and Senators Carroll and Topinka), 
effective July 18, 1S85, amends the Medical Assistance Article of the Public 
Aid Code to require the Department of Public Aid to adopt additions to and 
deletions from the Drug Manual as emergency rules. The Act also amends 
Section 5.02 of the Illinois Administrative Procedure Act to exempt such 
additions and deletions from the prohibition against filing more than one 
emergency rulemaking with substantially the same purpose and affect in a 
twenty-four month period. 

Public Act 84-0123 . Public Act 84-0123 (Senate Bill 588, sponsored by 
Senators Karpiel ana Eierman and Representatives Panayotovich and Mays), 
effective July 30, 1985, amends the Illinois Educational Labor Relations Act to 
allow an individual to file an unfair labor practice charge with the Illinois 
Educational Labor Relations Board. The Act originally allowed only employers 
and labor unions to file such charges. 

Public Act £4-0423 . Public Act 84-0423 (Senate Bill 489, sponsored by 
Senators Netsch and Etheredge and Representatives Levin anci Currie) , 
effective January 1, 1986, provides that the Department of Conservation is 
authorized to grant tax incentives to rehabilitate the interior, as well as the 
exterior, of historic buildings. 

P ublic Act 84-0424 . Public Act 84-0424 (Senate Bill 501, sponsored by 
Senator <^upp and Representative Hartke) , effective January 1, 1986, 
provides that sureties for public construction projects can be suspended by 
the State Department of Transportation or the local governmental entity 
involved. The legislation was drafted after consultation with the Departments 
of Transportation and Insurance. This legislation correcteu a- statutory 
problem which was discovered during a review 'of the Department of 
Transportation's rules governing highway construction. Under the existing 
statute, the Department of Insurance, not the .Department of Transportation, 
had the authority to suspend sureties. 

Public .Act 84-0427 . Public Act 84-0427 (Senate ^Bill 729, sponsored by 
Senators Berman and Bloom and Representative Olson), effective January 1, 



1986, was drafted by the Joint Committee in response to recommendations for 
legislation to clarify and specifically authorize by statute programs currently 
being implemented by agencies through administrative rulemaking. 

Specifically, Public Act 84-0427 does the following: 

Section 1 amends the Horse Racing Act to authorize the Illinois Racing 
Board to require appellants to bear the costs of the production of hearing 
transcripts. 

Section 2 amends the Illinois Election Code to authorize the State Board 
of Elections to determine by rule what organizations qualify as bona fide state 
civic organizations under the Code. The Board currently certifies such 
organizations by rule, however, the Code authorizes county clerks to make 
such determinations. 

Section 3 amends the Insurance Code to provide that the Department of 
Insurance snTill approve statistical plans, and that such plans be made 
available for public inspection. Additionally, it provides that the Department 
shall not require, by rule, that an insurer record or report loss experience 
according to a statistical plan which differs from that used in the ordinary 
course of the insurer's business. 

Section 4 amends the Certified Shorthand Reporters Act of 1984 to 
authorize the Department of Registration and Education to restore certificates 
issued under the Act without filing proof of fitness if such certificate was 
expired for less than 5 years. The Department's rules currently allow such 
restoration. 

Section 5 amends "An Act in relation to the prevention of developmental 
disabilities" to require the Department of Mental Health and Developmental 
Disabilities to establish standards requiring perinatal care facilities to submit 
plans or enter into agreements which adequately address the requirements of 
the Act. 

Se ction 6 amends the Hospice Licensing Act to delete the statutory 
requirement that the Department of Public Health structure hospice licensing 
standards so that the size of the hospice program is taken into account. The 
Department's rules currently reflect this policy. 

Section 7 repeals a provision of the Illinois Horse Racing Act which 
requires that 90% of the Illinois Racing Board's employees be residents of the 
State of Illinois for at least 2 years prior to their employment. 

Public Act 84-0469 . Public Act 84-0469 (House Bill 1044, sponsored by 
Representatives Vinson and Flinn and Senator Lechowicz), effective January 
1, 198C, amends Section 2 of the Illinois Administrative Procedure Act to 
permit the Department of Central Management Services to amend or repeal pay 
rates using the peremptory rulemaking process of Section 5.03 of the Act 
within 30 days after a change in the rates is necessary due to a collective 
bargaining agreement. Under current law, such rates must be promulgated 
as emergency rules, and the Department must also propose the changes using 



- 440 



the general rulemaking process. This legislation will save the Department and 
the Joint Committee a great deal of administrative time and duplicative effort. 

Public Act 34-0510 . Public Act 84-051C (Senate Bill 378, sponsored by 
Senators Bloom and Nedza and Representative Tuerk), effective January 1, 
198b, amends the Illinois Vehicle Code to permit the Office of the Secretary of 
State to issue a probationary drivers license to an individual whose driving 
privileges have been suspended or revoked. The Secretary has been issuing 
such licenses for a number of years, however the Vehicle Code did not 
authorize the practice. The bill, which was drafted in conjunction with the 
Office of the Secretary of State and the Department of Transportation, 
authorizes the current practice. 

Public Act 84-0575 . Public Act 84-0575 (House Bill 992, sponsored by 
Representative Kirkland and Senator Bloom) became effective on September 
19, 1985. Public Act 84-0575 was the result of the Joint Committee's review 
of the State Board of Education's rules concerning the certification of 
teachers and administrators. It provides a procedure by which the State 
Board of Education can establish, by rule, requirements for administrative 
certificates which exceed the statutory requirements. 

Public Act 84-0576 . Public Act 84-0576 (House Bill 1042, sponsored by 
Representative Levin and Senator Bloom), effective January 1, 1986, amends 
the Illinois Administrative Procedure Act to specifically state that the 
peremptory rulemaking procedures of Section 5.03 of the Act cannot be used 
to implement consent decrees or other court orders adopting settlements 
negotiated by an agency. Instead, the emergency rulemaking procedures of 
the Act can be used to implement such orders or decrees. This amendment to 
the Act will ensure that the public is given adequate notice and an 
opportunity to comment upon rules implementing such decrees and orders 
before they become effective on a permanent basis. 

Public Act 84-0737 . Public Act 84-0737 (house Bill 1045, sponsored by 
Representatives Flinn and Vinson and Senator Lechowicz), effective January 
1, 1986, amends the Illinois Environmental Protection Act to allow the Pollution 
Control Board to amend its rules in response to an objection or suggestion of 
the Joint Committee on Administrative Rules without holding an additional 
public hearing or allowing an additional opportunity for public notice and 
comment on the changes recommended by the Joint Committee, under certain 
circumstances. 



Public Act 84-0772 . Public Act 84-0772 (Senate Bill 379, sponsored by 
Senators Nedza and Bloom and Representative Kulas), effective January 1, 
1986, amends the Illinois Vehicle Code to provide that the conviction of a 
driving offense on a military base may serve as cause for the Office of the 
Secretary of State to revoke or suspend a driving license or permit. This 
practice has been endorsed by the commanders of several military bases in 
Illinois and codifies the Secretary's present rules regarding this issue. The 



- 441 - 



Office of the Secretary of State and the Department of Transportation worked 
with the Joint Committee to draft this legislation. 

Public Act 84-0784 . Public Act 84-0784 (Senate Bill 612, sponsored by 
Senators Bloom and Berman and Representatives Levin and Vinson), effective 
January 1, 1986, amends the Illinois Administrative Procedure Act to allow an 
agency to incorporate by reference in its rules the standards or guidelines of 
an agency of the United States, if the standards or guidelines are available 
for public inspection and copying at the agency's principal office and the 
incorporation is approved by the Joint Committee. Currently, agencies are 
permitted to incorporate by reference standards, guidelines, rules and 
regulations of nationally recognized organizations or associations, and rules or 
regulations of federal agencies. Federal agencies also publish guidelines and 
standards such as OMB circulars, and these cannot presently be incorporated 
by reference. This provision will permit such incorporations. 

Public Act 84-0793 . Public Act 84-0793 (Senate Bill 728, sponsored by 
Senators Berman and Bloom and Representatives Vinson and Flinn), effective 
January 1, 1986, was drafted by the Joint Committee to direct various state 
agencies to promulgate rules delineating standards used by the agencies in 
making administrative decisions, as required by Section 4.02 of the Illinois 
Administrative Procedure Act. 

Specifically, Public Act 84-0793 does the following: 

Section 1 amends the Toxic Substances Disclosure to Employees Act to 
require the Department of Labor to promulgate rules prescribing the 
standards used by the Department in determining whether a laboratory is 
under the direct supervision of a technically qualified individual. 

Section 2 amends the Illinois Vehicle Code to authorize the Office of the 
Secretary of State to issue a probationary license to a person whose driving 
privileges have been suspended or revoked and requires the Secretary to 
promulgate rules setting forth the conditions and criteria for the issuance and 
cancellation of probationary licenses. The Joint Committee on Administrative 
Rules worked with the Office of the Secretary of State and the Department of 
Transportation to draft this section of this bill. 

Section 3 amends the Illinois Occupational Therapy Practice Act to 
authorize the Department of Registration and Education to restore certificates 
issued under this Act without filing proof of fitness if the certificate has 
been expired for less than five years. The Department's rules currently 
allow this practice. 

Section 4 amends the School Code to require that the State Board of 
Education prescribe specific rules and regulations concerning eligibility 
criteria, including the criteria used to determine the financial need for 
fellowship and traineeship grants. It also requires that the State Board of 
Education establish rules and regulations governing the conditions under 
which it will require grantees to refund all or part of the grant monies 
awarded, and requires that the Board develop specific standards for the 
recognition of teacher education institutions with regard to education in 

- Ml?. •• 



working with culturally distinctive students if the Board requires this 
component in the teachers' education programs. 

Se ction 5 amends the Secretary of State Merit Employment Code to 
requi7e~the Office of the Secretary of State's Merit Commission to place within 
its rules the standards and criteria the Commission and the Commission's 
hearing officers use in making discretionary determinations during hearing 
procedures, as required by Section 4.02 of the Illinois Administrative 
Procedure Act. 



Public Act 84-0834 . Public Act 84-083^ (House Bill 1059, sponsored by 
"Representatives Olson and Flinn and Senator Bloom) , effective January 1 , 
1986, was drafted by the Joint Committee on Administrative Rules in order to 
resolve statutory authority issues which arose during the Joint Committee's 
review of the rules of several State agencies. The bill was amended by 
Senator Welch and Senator Bloom at the request of the Illinois Retail 
Merchants Association to establish the Space Heating Safety Act. 

Specifically, Public Act 84-0834 does the following: 

Sections 1-11 establish the Space Heating Safety Act. 

Section 12 amends the Liquor Control Act of 1934 to authorize holders of 
a railroad license to import alcoholic liquors to be served in its dining cars. 
Currently, the Act authorizes holders of airline licenses to import liquor, and 
the Liquor Control Commission allows such importation of alcohol, by rule, by 
railroads. 

Section 13 amends the Child Labor Law to grant the Department of Labor 
authority to regulate reasonable conditions of employment for minors employed 
as models or performers on radio or television. The statute currently 
provides the Department with the authority to regulate the employment of 
minors in theatrical productions but does not address models or actors. 

Section 14 amends "An Act in relation to State forests, operation of 
forest nurseries, and providing penalties in connection therewith" to provide 
authority to the Department of Conservation to sell trees and shrubs for 
Arbor Day and for other commemorative plantings to the general public. The 
Department's rules currently provide for such sales, but the statute did not 
allow such sales. 

Section 15 amends "An Act relating to the planning, acquisition and 
development of outdoor recreation resources and facilities, and authorizing the 
participation by the State of Illinois and its political subdivisions and qualified 
participants in programs of Federal assistance relating thereto" by creating a 
new section which authorizes the Department of Conservation to adopt rules in 
order to implement the provisions of the Act. The Department currently has 
rules to implement this Act, but does not have general rulemaking authority 
under the Act. 

Section 16 amends the Timber Buyers Licensing Act to provide the 
Department of Conservation with the specific authority to establish a 
voluntary arbitration program when the value of timber utilized is in dispute. 

- 443 - 



The Department currently provides for such a program by rule, but it is not 
statutorily authorized. 

Section 17 amends the Medical Practice Act to repeal the provisions 
concerning the Board of Higher Education's responsibility to adopt guidelines 
for the purpose of funding supervised clinical training because this paragraph 
is obsolete due to the fact no funds are available for the program. 

Section 18 amends "An Act prescribing the color arid label for gasoline 
or benzol receptacles" to authorize the Office of the State Fire Marshal to 
provide by rule the specific labeling requirements for all receptacles 
containing benzol or gasoline. The Fire Marshal currently prescribes such 
requirements by rule. 

Section 19 amends "An Act to regulate the storage, transportation, sale 
and use of gasoline and volatile oils" to authorize the Office of the State Fire 
Marshal to promulgate rules permitting the operation of self-service stations in 
Illinois. The Fire Marsha! currently provides for the issuance of such 
permits by rule. 

Section 2Q amends the Financial Assistance Act for Nonpublic Institutions 
of Higher Learning to require that, as a condition of eligibility for grants 
awarded under the Act, a nonpublic institution of higher learning must submit 
to an external audit of its enrollment records and nonsectarian use of funds. 



Pu blic Act 84-0954 . Public Act 84-0954 (.House Bill 1285, sponsored by 
representatives Olson, Klemm and Deuchler and Senator Weaver), effective 
July 1, 1986, amends the Illinois Administrative Procedure Act to add Section 
5a. This section will permit (but does not require) a State agency to submit 
to the Illinois Register , for publication, an agenda of rules it is considering 
proposing in order to elicit public comment. 



001 :ar85 



444 



Wj - 



- 44G 



APPENDIX A 

HISTORY OF THE JOINT COMMITTEE ON ADMINISTRATIVE RULES 

AND THE ILLINOIS ADMINISTRATIVE PROCEDURE ACT 

By the mid-1970's Illinois had 65 major agencies and nearly 250 smaller boards 
and commissions. The courts had ruled that administrative rules have the 
effect of law, and decisions rendered by those bodies conceivably affected the 
lives of more Illinois citizens than any other in government. Yet, observers 
of the scene found that organization among these agencies was complex, 
duplicative and chaotic, indeed, at the time, no single source could produce 
a complete organization chart or even a listing of all Illinois agencies, boards 
and commissions. The goals of good government had been clear for 
generations. Government is accountable to the people for the effective, 
efficient and economic delivery of services. Towara this end, the federal 
government had enacted the federal Administrative Procedure Act thirty years 
before Illinois, and in September 1975, the Governor signed Public Act 
79-1083, effective September 22, 1975, creating the Illinois Administrative 
Procedure Act. 

The Illinois Administrative Procedure Act established four categories of 
administrative proceedings, rules, contested cases, licenses and rate-making. 
The Governor's message accompanying the signing of the Public Act pointed 
out that this legislation formalized some common procedures, such as public 
hearings on proposed rules. The message also called the public petition 
procedures innovative and endorsed the establishment of rulemaking 
requirements. However, it soon became apparent that the establishment of 
rulemaking requirements would conflict with Section 2 of the Act that 
exempted agencies from compliance with any part of the Act except as 
expressly stated in the law which created or conferred power upon that 
agency. 

In 1977, Section 2 was amended by Public Act 80-1035 (House Bill 14, 
effective September 27, 1977) to make the Act applicable to every agency, 
except as specified. Agencies have continued to claim an exemption because 
they are not an "agency," as defined in the Act, or to excuse lack of rules 
for on-going programs because legislation creating the program failed to 



specify that rulemaking was required. Most agencies, however, have 
cooperated in the rulemaking process. This has been particularly true since 
Illinois regulations were codified by the Office of the Secretary of State in 
January 1985, and the rulemaking procedures standardized. As a result, 
rulemaking is now more widely understood by both professionals and the 
affected public. 

The Joint Committee on Administrative Rules was created by the General 
Assembly in 1977 through the passage of House Bill 14 (Public Act 80-1035, 
effective September 27, 1977), a comprehensive amendment to the Illinois 
Administrative Procedure Act. The functions of the Joint Committee under 
the amended Administrative Procedure Act can be broadly classified in two 
categories, an on-going review and comment function in relation to newly 
proposed rulemaking actions of State agencies, and a longer-term, more 
in-depth examination of groups of existing rules including a 5 year program 
to review each agencies' rules and rulemaking process. For too long, said 
the first Chairperson of the Joint Committee, Representative Harry Yourell, 
the legislature had been content to pass legislation without systematically 
ensuring that agencies charged with the task of implementing that legislation 
were properly interpreting and complying with the intent of the legislation. 
In addition to making the Act's rulemaking and hearing provisions applicable 
to all state agencies and the creation of the Joint Committee on Administrative 
Rules, Public Act 80-1035 made several other changes in the Act, including 
creation of the Illinois Register , a weekly publication of the Secretary of 
State which informs the public of all rulemaking activity by State agencies. 

The minutes of the monthly meetings during the first year show that the Joint 
Committee dealt with issues commonly facing a new organization, such as 
staffing and office space, as well as substantive issues about rulemaking and 
interpretations of The Illinois Administrative Procedures Act. For example, 
within the first few months the Joint Committee had reviewed its powers and 
duties and, based on the separation of powers clause in the 1970 Illinois 
Constitution, found them to be advisory only. The Joint Committee sent 
guidelines to all State agencies to assist them in complying with provisions of 
the Act and prepared an amendment to clarify that all boards of State 
institutions of higher education were affected by the Act. By the third 



448 



meeting in January 1978, the Joint Committee was reviewing proposed rules 
published in the Illinois Register . Objections were issued to several of the 
rules. At this time, all negotiations between the Joint Committee and a 
rulemaking agency took place at the monthly meeting, a practice that on 
occasion resulted in very long meetings. The question of court ordered rule 
changes was first considered by the Joint Committee in February, 1978. A 
court had ordered an amendment to the Illinois Department of Public Aid's 
rule on physician services for medically necessary abortions for a public aid 
recipient. Legislation was drafted and presented to the March 23, 1978 
meeting to establish a new category of peremptory rulemaking for rules 
required by court order or federal rules and regulations. But it was not 
until a year and a half later that the Act was amended by Public Act 81-1044 
(effective October 1, 1979) to authorize this category of rulemaking. 

By March 1978, the Joint Committee had established July 1, 1980 as the 
deadline for agencies to prepare and submit a compilation of all their rules. 
In addition, legislation was drafted to require that rules must contain specific 
standards and criteria to permit the affected public to understand the basis 
on which agency discretion was to be used. This standards and criteria 
amendment did not become effective July 1, 1980 (Public Act 81-1129). In 
March 1978, the Joint Committee also discussed amending the Illinois 
Administrative Procedure Act to place the burden of proof upon agencies 
asserting the validity of contested rules in court cases involving rules which 
have been objected to by the Joint Committee, whenever such agencies have 
refused to remedy Joint Committee objections. This concept is yet to be 
enacted. 

By the end of its first full year, the Joint Committee had reviewed nearly 500 
rulemakings (TABLE 14) and prepared a legislative package that contained 23 
recommended bills. 

In its second year of operation, 1979, the Joint Committee examined over 525 
rulemakings, issued 65 statements of objection and implemented the five-year 
rules review program. Agency rulemaking increased in 1980 during which 
time the Joint Committee reviewed nearly 700 proposed, emergency and 
peremptory rulemakings and completed 9 detailed reviews of 28 sets of 



- 44S - 



existing rules. Agency rulemaking has generally continued to increase during 
the eights years that the Joint Committee has compiled data. The tables 
which show a comparison of general, emergency, and peremptory rulemaking 
from 1978 through 1985 (TABLES 14, 15, and 16) illustrate the rulemaking 
activity of state agencies during that time. 

TABLE 17 shows the total number of objections issued by the Joint Committee 
compared with the total number of agency responses during the history of the 
Committee. The "Withdrawn or Repeal" category consists of two categories of 
agency responses. These are the instances when an agency withdrew the 
section of a proposed rule in response to an objection issued by the Joint 
Committee, and instances when a proposed rule has been automatically 
withdrawn due to the failure of the agency to respond within 90 days as 
required by Section 7.06(f) of the Illinois Administrative Procedure Act (III. 
Rev. Stat. 1983, ch. 127, par. 1007.06(f)). For the year 1985, two of the 
rules that received Statements of Objection were withdrawn by the agency, 
but there were no cases of automatic withdrawal due to the failure of a timely 
response by an agency. 

For the year 1985, agencies agreed to modify or amena rules 30 times in 
response to Joint Committee objections. This response accounts for 17% of the 
number of objections and continues the downward trend away from agreement 
to modify rules to which objections are issued. 

"Refusal," as found in TABLE 17 means the agency has responded to the 
objection by refusing to modify or withdraw the proposed rule. In addition, 
if an agency fails to respond to a Joint Committee objection to an emergency 
rule or a peremptory rule, this is counted as a refusal to modify or withdraw 
the rule, pursuant to Section 7.07(g) of the Illinois Administrative Procedure 
Act. (III. Rev. Stat. 1983, ch. 127, par. 1007.07(g)). Agency refusal to 
modify or withdraw a rulemaking in response to an objection has continued to 
increase since 1982. 

The Illinois Administrative Procedure Act has been continually evolving since 
1977. In addition to the creation of the Joint Committee on Administrative 
Rules as an oversight body, which became a Legislative Support Services 



- 450 - 



agency in 19&4, the Act has been amended to deal with numerous problems 
which have arisen. One of the most significant has been the implementation 
of the snail business flexibility requirements imposed pursuant to Sections 
3.10, 4.03, 5.01, and 7.06 of the Act. These Sections require agencies to 
consider the impact of rules upon small businesses and, if feasible, suggest 
alternatives to those rules. The Act will continue to evolve as problems 
concerning administrative rulemaking arise. 



009-.AR85 



- 452 



co in in cm f— i en o 



i cm I o r- m 



III *M I (N 



cm r^ t- co 



I t-t- i =r=r i m * 10 rom^o 



I oo «— r- sr I co in i 



CO cm i i co cm r^ 



1^ i— tfllfl I I «— I I I r-r-(SM I rO I W t- B * i- | | N N I IT) I 00 I CO 

t— f OM 



I CM I CT> i— 



^ in 

LU 

-DO 



in I I r— r^ I «— mm r- I cm i i i 



in ^r l co r-- cm cm 



Z CO 

LU r- 
O w 



c J2 
o*. E 
<u o | 

— (U 

2 E £ 
s -- 3 

.E Q E 

'o ,0) 
~"> w "o 

« u o 



o> > a. 

/3 w en 
c£ co c 

<u <u c 

$55 



to ro 



</) </> 



ro 
C C 0> 

EE a\ 

"O "O Cn 
<<< 



3 

o 

^ £ (/> 

*J 4- .Q 

C TO 3 

r a-o 

3. J" 

S- c 

a 3 J 

.£ 'il o 
cn cn.2 
<<< 



C a> 
03 c 
(J <u 

» u 

O i. 

c o 
o^ 

<< 



.£ t: 

p ro 

i 8- 

.2 -a u 

c 1. > 

ffl 5 L 

a ^ « 

£ CQ 00 

</> e £ 

3 Q. a> 

l o ai 



£<-> 



0) _ 
U TO 

>■- r- 

J- u c 

<u ■■= o 

"> §« 

^ S E^ 

ESLSI 



« a 

l/> l_ 

§ > £ 

0) < 



— c/> 



>== 



a> 



ro 



„ c 
■o a> « 
CqIs 
ro _ 

w ro 2 

c a c 
ro to a> 

muu 



TO Ol O 

u- J2 O 

"CI ^> 0) 

05 -a > 

c c »- 

s^ 

'£ S > 
uuu 



c 

if 

_ i/> o 
2 co 



Irt 



E 
T3 E 
a) a> c ° 
u u re U 

£ ? <u a 

q5 ai fcf if 

co co a, 53 

E E 

> > E E 

uuuu 



O 

u 



ft 5 

Q a) 



E 
E 
o 



= HI 

E o 

.0 c 



o — 
c o 

= c 

o 

>;° 

.ti c 

s_ O 

o ^ 

r to 

II 



Q E 



c c 
o 

"■M 0) 
TO u 

e-S 






— >> 



.2 E 



o 
01 cn . 

3 3 ,n 



>> a> 



E 

3 

.t: = c 
§Se 

E a-§ 
EEc 
000 
UUU 



C »^TOtn--QQ 

m o r: 3 ,h 

TO O 0- ^_ 

C s- 3 3 
OOOO 
UUUU 



trt co — 1 

3 3 

2^ 

Q> OJ CO 
CO Dlj. 

S £ « 

to ro ro 
Q Q LU 



0) » 

&£ 

w X fc 

cn o 
a> ^- -C 

cj-o< 

-M o 

3 » 

E c c 

E .2 .2 

o '43 +^ 

1 1 to ro 

w u u 

3 3 
■D -O 
LU LU 



O 
2 W m 

o a) 2 

03 5 m 

■m U <u 
5 to "S 

» ro 

SI 8 

TO TO .2 

U U *■> 

? 3 % 

LU LU LU 



453 



°o| I en co I o »- 



00 r- CO o 



LT> I I r- t^ <T> I CO CO «— 



i i tNmiflt-t- i i icNicors»— i— Nin I in* ^ 3" I tf | i 



I It— MfOr- CN I I I I I MN 






ct>icnt-co i i I r- i r^ I «N I i i it-ir-^rirom 



I I I i- rs i i i 



CNr-lt— It— mi- rsroir^i I I 



LU 

u 
< 

CO 

o 
<£ 

,0.£ 



o 
en! 



3< 
UJ r^ 

u ^2 

LL 

o 

O 
— 

< 

O 

u 



i I I tor-iNis i i i imr-i i imr^ 



I I r- (N I CO I 



cm I i m l o cm u> 



CN r- i- I I I I r- J CUD I I I I CM I I I 



r^ I i cn I »- t- *- i i =r m I I I i i isrmim 



>- 

u 

c 

OJ 
CTI4- 

< o 

*! 






03 



> c 

U 0) 

p 

en o 
<d q. 
E E 

UJ UJ 



U £ 

2gs.fi 

o " c = 
<" E 2 u -n 
* E ? H I 

s_ O ro CQ 

3 d) i- D1 

H uQ. L VI 

(0 l O ® 

roll- g 

cn OJ L\ 

i_ i_ — 

a> <u > 

c c c 



c « 

1° 

TO. 



UJ UJ UJ LU 



o w 

•5 « 

< U 
£ S 

Sa- 
le 

a> 

> >- 

1 o 
Q a 

£ UJ 

8. is 

X CB 



— CO, 

— « ■£ 

— E iS 

L <n -l 



c t: t 

Cl'~ 

o 



in 

c ro 

C; — JC 

> _ w 

w fo b, 
Q — ro 

lie 

LL LL LL 



C 

° — 

"in u 

w C 



■D 

a> in 



•- 5 1 



ro <5 

a 

03 



CT 3 

.£< 



8 u 

U LL 



(T3 — 

O S- 

CQ O 

c £*3 



c 

a. 3 
< 

a; a) 



o +j 



§■« 



o o 

■£ w 

c c 0) 

o g «J 

in j5 w 

m l 3 

c m, L 

| ah 

E <u 

9Q^ 



ro 
c 
o 

"•5 

ro 

o 75 
£ u 

13 O 
LU _J 



CQ 
O ^ 



i.-Di:i:j:i:r.h 



3 <3J 

O X 



ro ro 
<jj a> 

X_X 



E 
C Q. ?.?£§_ 

£ c c 
HI 



wi +-> 



V a> O 3 3 — 



XXXXX = — — 



4- "OTI 

O «- I- 

.!2 4- o o 

o c cq ca 
c <u 

~ E tn in 

x r c c 

|- o o 

| ct: ct: 

oJ (. U L. 

OJ o o o 

> .O J2 JD 

c ro ro ro 



o -a 

C n »- 

— o ro 

in CQ 

ro o o 

o (J 2 

CQ 



: e 



E w 
^3 in 

ro| 
a E 

0) o 



c c 

a; a; 

E E 

0) <v 

u u 

I- (. 

o o 



c c 

i. LJ LU 

o 

ro ro ro 



lo .2 t2 P 

c m ro g 

•2 e t « 

« E<^ 

E ° +-- +-> 

<d a> 
"t o E E 
h <- c c 

aj C a) a; 

> rS > > 
— U o o 

« l OU 

in O 

•- 3 ro ro 

01 rr U U 

OJ ._ o o 



- 454 



M I Ifl I I t-fO I IOOI llCr-0)|mmr-lt->-r-rMr- 
PM CO CI r- CN ,— en 



OI 

Oil 



Irti-M I (Nr-Oim | I lO*ONini-M I I in N r- lO IN 



CM I I I ^Mr- 



< 00 

IXI _, 

JjO.E 



I I I r- I 



i sr i i i i i 



I »NO I f I N I It— CO I in I I I (NM I 



LU r" £ 



U en 






to 

■o.!2 

M 



E 


— 


o 




c 








i- 




C 


r 


o 




o 




S'2 U 


U 


u 


o 


> 


75 


15 
u 


oa 


0> 


V 







o 


<D 



a 
a; 

5 Q 

ro +j ro 

fa -m c 

■S io * 

a- > 

_ <u C 

c £ 

2 2 



5 u © 

fO >» ^_i 

Q. CD •— 

<U 5 </> 

Q ^ C 

» CD 

viQ. * 

— oi 



C ° 

1*1 

U a, o 

>>2 



■S oi 

— 3; 

c a 

10 '&« 
= J2to 



© <u 



> CO 



£32 

Bui: 

CO 3 D 



O 

Sea 

i_ _ 

ro o 
<u 4-. 

g c 
c.2 

i_ ~ 

<D O 

a. a. 



ro 

O 

■U* 

1- _ 
ro ro 
O fl) 

dq a 
a 

B< 

a; 

> £ 

U > 
•■t 

° a 
.S£ o 

Ok-CL 



oi 

L. 

u 
_ fo 

01 <D 

o o oi 

4_, a'o 
c v E£ 

0) o LU — 

+-> -m a ~" 
i_ C +-• *+- 

ro <u f o 

S-Sco s 

°*oi*3' 
. Q.£(n 
c © o 

n — sz 



e ro 



tj ro 

<x 



J2 XI 

a_ a. 



o 

E h- 
z: o 

"" "a 

» l. 

L. o 
ro 03 
O 

QQ « 

ui 

en " 

c 



01 ' 

© *- 4- 

y o o 
> 



c 

U CD 
ro <l> 

a: en 



- E £ 

c «/J To 0) 
ro >> > 
c |c/></} 

o *.£ +-• ■*-> 

ro .ti <u <u 
h=EE 
"£ xi <u <u 



.- ro s- k 
D) £ £3 '43 

O D O O 

a: a: d^ oi 



C 4-i 

O ro 



u » 

o c 

oi o 
oi •- 

< 8 

si 

Is' 

ro £ 
O1_ro 

.£ o 
> x: 
ro u 
CO t-0 i 



OS 

u 

c 

0) 

en 
< 



3 
01 

c 
o 



s- c 

a; q; 

oi | E 

ro O u 

<u »t- u 

a— ' o 

Q.u_ **- 

<C O c 

^ w LU 



O C 5 

0> _ 2J ro 

a pEJ 

4-< L. +J 

*-" ro i- 14- 

E >. o i-o o 

O m in n c 



c 
c 

ro 

u 

"D 
LU 

15 ^ 
+■> £ 

c ai 
<u — 

El 



^ 



ro tj 

a i_ 

<U ro 

a o 
m 



° ^^ lis 

^_, < ro d," ■<-> *4-. -m 
c . 'U S L m C 



■o 8 

ro ro o 9" 

ll;>o.£ 

4) 0) 0) 



u _ 

— ro ro ro 

QJ +J +J 4-> 

10 CO CO if) 



c 
o 

o^> 
a_ 
oi a> 
c > 

ro ro 

r- H 



455 - 



> 
u 

-z. 

LU 

u 
< 

> 

CO 

U 

■z. 

^ IT) 



* -" X -o 

- 3u S 

LU*3 3 

JjO.£ 
5 oe F ° 

H lu I- U 

LU S 

(J cn 





0) 


^_ o 




> 






o *± 


> 


4-> 

to 


3 


u 


"in 


C +3 


z 


OJ c/> 


III 


01 


E c 


u 


QJ 


l. 


< 




to <y 



Qw 



ra 



o 

b ^ x 

C < LU 

O l- _ 

u « m "O 

5; c c 

u 3 £ ro 

> to a) +-" 

tO QJ -M "J7 

t- i_ o> .- 
HH>> 



0) 


to 


0) 


c a> 


QJ 


QJ 




QJ 




c 


E 




(0 
1_ 
to 

a 
a) 

in 

ro 
0) 

E 
ro 
u 

QJ 


.2 ■ c 


JC 


JC 




JC 






to 

c 

QJ 

x: 

"D 

C 

TO 


E 
to 
u 

QJ 

X) 

c 
o 


ro 

fO 4^ • 

9- to <u 
"? c w 
ro <"., 


■>-> 

SL 

cn 

3 
O 
s- 

10 


£ 

cn 

3 
O 

L. 

JZ 




■M 

JZ 
D 
3 

L. 
JZ 




c 

QJ 

E 

L. 
ro 

a. 

0) 
"O 


CN 

CO 


in 
t/i 

E 




3 


QJ 

3 




_QJ 

3 




o 

4-1 

ro 


en 


E 
o 


£ 


fO > U3 

cn s 


fv| 


0) 




(m 




ro 


C 


U 

cn 

L. 

Q 




t: i- 




C 




=r 




a 


O 


o ; ^ 


"0 

QJ 

to 
01 

3 

E 
o 


o 




-o 




QJ 
in 


13 

C 


£ 
ro 

_J 


_ CO 
tO CT> * 


"0 

QJ 

ro 




o 
ro 
Ol 




ro 
QJ 

E 
ro 
U 


!5 

E 


3 


■4- 
O 




o» 

3 




3 

E 
o 




c 
u 


O 


._, 


•Coo • 


a 


E 






QJ 
£ 


qj 


0) 


c 


a*. u 









a 






cn 


QJ 


x w , 


> 


a 








* 


(U 


c 


E 


LU 3 . 


■(-> 






qj 




Q) 

3 
C 
0) 
> 
QJ 
Qi 


5 
in 
y 
"> 


ro 
Q 

a; 
£ 


+-> 

L. 

ro 

a 

QJ 

Q 


cn q. 
a; 3 a 

£< 3 
+- 1 CO 


c 
o 

■o 


> 

+-> 
c 




c 

'o 




s. 

QJ 
CO 


c 


QJ 
£ 


CO > CO 


ro 
O 
fJQ 


c 
o 




ro 
O 

ca 




O 


0) 


c 
.2 




in v^: . 

CO <4- +J 


cn 


'w 




in 




4-> 

c 


> 

+3 . 

(0 (/) 

i: « 

C Q> 

I" 


'Si 
> 

'■5 

CO 

a» 
u 

c 


c 
*JZ 

i 

ro 
V 


CT) 0) (0 

"" w co 
c sr . 
'" f"- > 

+-> CO • 


C 

"E 

c 

ro 

a. 
.2 

4- 1 


E 
E 
o 
U 

in 
+-> 

£ 
cn 




C 

o 

to 

o 

(- 

o 




QJ 

£ 

+-< 
S- 

ro 
C 
QJ 

Q 

QJ 

£ 




o 


3 
£ 


?u 5 


o 
ro 
LL 


£ 




JZ! 

^3 




° E 

OJ (0 

11 

to 

8-g 

c 


QJ 

in 


ro 


E < *J 


c 

ro 
E 

3 








O 


3 
£ 
< 


U 

c 


< 

JT •- tn 


XL 
"ro 




75 

u 

o 

_1 




c 


o 


o 


■■Is 


QJ 

X 


0) 




4J 




> 


c 


» 




JZ 




JZ 




"O 


to 


>- 


M- (U 


a» 


+^ 












O CJ 


JZ 










ro 


tn 

JO 


L. 




■D 

c 

ro 




■D 




QJ 


<L> 0) 

£<J 


3 


3 
U 
QJ 




"0 

c . 




c 

ro 




U 

c 
o 

73 


•D O 

c 
ro •£ 


73 
C 
ra 


c 


to .=r 

CO 

JZ cn 


in 

JZ 
CJi 


CO 


l_ 
ro 
O 

03 


co 
cn 


c 
— qj 

c e 


E . 


0) 

E 


ro 3 C 
cna J5 


"to (- 
QJ .£ 


2 


C 


C 


ro 
O 


.12 =r 

— CO 


> 

o 


1^ a 




c 


U1 


in 


in 


CO 


C s- 


O cn 


E 1? w 




ro 


U1 


C 


in 





o to 


JZ i- 


a 


o 2 c 


E 

3 
O 

c 
E 

L. 

to 
a 
o 


QJ 





(U 


ro 


W Q. 
i- <u 

£q 

°£ 

qj 
E-a 

*- QJ 

■ C 

&| 

Q o 


o 
u c 

< ^ 

o a> 

*"• -M 

C t. 

qj to 
E Q- 

-M OJ 
m "° 

to 

CI QJ 


E 

LU 
^ • 

o ^r 

CO 

4_, cn 

C *~ 
a r 
1" 

to c 
a <u 

o e 


u ra ra 

u. \— 

*■> u 
ro C 

CHa, C 
ra J- 0) 

, 3 E 


U 

Q. a 

Hz 


U 

O 
L. 

a 

cn 
C 

ro 
E 

s 

3 


_to 

QJ 

o 

JZ3 

to 

_1 
0) 

to 


U 

o 

1^ 

c 

cn. 

c 

ro 
E 
o> 

3 
Li 


0) 

a 
a 
< 

X 

ro 
H 

>- 

(. 
o 

a 

o 


Q m 


o t 


5 -o -r 


Q ra 


a 


i 


CO 


15 

L. 


o> wi 


3 8. 


• LI 


0) 

QJ c 





QJ 

C 


QJ 


QJ 

C 




£ to 


£ sr 


■c <y 


5- X 


£ QJ 


£ 


0) 


£ 


a> 


h- 5 


H S) 


h- -o 


< a. lu 


1- cn 


H 


cn 


H 


CD 


£ 


cn 


ro 


=r 


ITJ 


«o 




r^ 




CO 



456 - 



- 457 



>- 




u 




z 


CO 


Lil 


<?\ 


u 


,— 


< 




> 




L2 




O 


,_ 


z. 


CO 






^ 


*"* 


<C LD 




2 » 




LU <^ 




_1 *" 




nD X 


O 

CO 


-oia 


u - ^ 


c/> 




■"" 








QC o 




LU OO 




S O* 




LU *~ 





CO 4 ">l I r- 



i- I CN I 



I CN I CO St 



i- i nn I i 



i— rs ro I 



3 

o 
<1) 



+- u .a 

C ro 3 
a) Curt 
E <" 
•POT) 



c ° 2 

£ E Q. 
Q. Q- - 



a 



5^ 



ifi 



OJ 

c 
re 

a 
£ 

G 
CJ 

ro en 

M 

CD r- 

-. >- C 

•^ .:j -r ro 



•1.1 



> > 



~'j 



ZE? 



E 

E 



Q. <U 

a) i- 
Q 3 



■m +-> > 

c c - 

a; a t£ o 

£ E ro u 

Q. a» ll 

O Ol "D 
oj <5 "D c 

> 5 c ro 

cj ^ ro 

Q2,g 



c 

0) 
X3 

c 

0) 

a 
aj 

C 



ro 
* O 

.2^ 
in en 
E * 
E o 
o U 

oj£-2 



Mi 

E oj £ 

Q- ro .= 
oj a 
Q a; a 
.Q .2 

C » </> 

O in 3 

"•♦-> C -> 

o 



I" 1 



£ 'Z o 
cn^-2 
< << 



+-. ro 

< ea 



it: +3 "o t= 
a c — E 

ro cj x: o 
UUUUUUU 



c 

3 J3 

E a 

E E 

o o 



o > ■? -js o .2 c 

h i- u r- r. -m +-■ 



C — 
O u ~~ 
0) » 

- -■&£■ 

E x o 
Oo- 

ai -o < 

3 ro c 
u o ro 
a CO o 

in * 

3 C C 
O O C 



CO 

> 

U 

c 

0) 

< o 

t. £ 

J2 E 

ro -t-j 



5 SL 

??ro . 



c 
c 

u S in 
Sgg 



a™ 



O O U 
D U U 



i> ro ro 

C u o 

C 3 3 

ro -d "D 

Q LU LU. 



ro 

o ro w £• 

CD ° OJ •- 

ca u s - 

*S o > u 

■m ro <u uo 
lh -^ LO 

^* . > c 

C .n <J <" 

.2 c c £ 

o 2, > 



U -M ! 

3 u c; a 

■0.2 E £ 

.LU LU LU LU 



^- in — 

II' 

lei 

o ro cQ 

s- en 

a. i- ui 

_ O « 

2-3 

c ^2 "O 

2^ S 
£ 2 o 

C E i- 
O T lX 



O 
«*- CD 

I" > 

= eS^ 

m 0) 0) 

x: ' 



5 - 

OJ — 



.- a 

o ° 5* ro 

3 * °-0 

< r 0) « 

S U ^ 

_ o .2 ro 

° c ro 

oj — .c wi 

> _ ^"l. 

a) ro 

a 



> Cl 
C X 
LU LU 



._ ro 

p ro cj 
« C s- 

ro — — 



» s_ o o 

3 3 0J cj 
O < £ tn 

° ^ t: 3 

^ ro «- 

oi S ah- 

c 2 oj 
•- L (•> ^- 

fill 

§Q.?CQ 
U ^^ 

j=.£ c.J£ 

^ ^ ro o 

ro 3 E C 

cj o 3 • ~ 

X X X = 



T3 O 



C 

E 

^ ro 
ra Q. 

■*-> OJ 

LO Q 



W Irt l/] » 

CT '5 "5 O T3 

w c c c Js 

~ ~ ~ ro 

"o — — — CD 





c *_ -o "o -a •- 


a 


o o L >■ L « 
c ia ro ro cj 

= ^ o o o 2 


(0 


i/i 


t. C CQ CQ CQ 


E 


ro oj +; 

a e ^ « i" ?, 


r 


o^ccc^ 
q j- o o o E 









* Q-ro ro ro " 




2 n oj cj cj o 
^ u q:q:q:^ 


- 


u 


in 


£ J u u u LU 


-) 


3 O O O O _ 
vi A J2 X) XJ $ 


TJ 


c 


(- ro ro ro ro ro 



458 



I fO U)(N (N 1 



> 

U 

-z. 

LU 

U 

< 

> 

CO 

U 

< in 

2 °° 

LU * 

_1 "" ^ 
m D X ^c 
«~ £X O <U 

Sal 



l in cn cm 



in I m oi 



<5 = 

OS o 
LU oo 

is cn 



o 
in 

CD S_ 

CU 0) 

> c 

o o 



c 
cu 
E 

CU 

eg 

-t-> '+- 

in c 
>LU 
LO 

cl 

O _l 

!I 

II 

P 

— ro 

ITI U 
d) o 
_l _l 



cu o 



> Q 
Q 

* co +-* 
"° • « "° 

CO U- m 

o_a 
DQ S Q in 
C g 



0) M- 

£ o 

O C£fl 

•J" a) +■• 
<u Q g 

M- O 

to «U 

TO C ~ 

cu o if 

! 2 = 

3 o o 

ZC. Q. 



O C 
CU 

si* 
!U 

i; cu — 
a G- 
cu 

■6% S 

<x m 



C 4- 

O 1 

■M +-' 

s_ C 
ro cu 

8-1 « 

Q ro 

» CL. 

!«; 

LU > 



Ifl 



-n O 



0! 



CO 

o 

co o += 



c 
c o 



cn ro o 
> a- 1 
CO cu _ M 

to 



u u 



01 
_ C 
13 X) y 

: : ro 

0. Q. 01 



cu .- ro 

ai aix: 
a» a; cu 



c . 

cu cu 

£ 3 S 

<u c £ 

^ cu E 

'£ > '> 

0) CU ro 

al OSLrO 



in 

£° 

< c 

CU 



.— "U ro 

in s- Q. 

in ro cu 

c «°Q 

•= ■£ CD 

E 

,9 i/> «« c 

o 

co 

+-> L. 
U CU 

S «- 

in m 

c ro 

x: u ro ro w 

CO LO CO I- H 



( ) 




•V 




••<- 




a 


o 


'O 


c 


> 


C 


in 




ilj 


i_ 


ro 




ra 








CL' 





£ 
£ 
o 
U 

ai 

Q 



O 0) 

£ 
■*- +-> 
c i_ 
a ro 
E a 
+-- cu 

ro 

Q. cu 
cu +- 1 



ro 




C 


<•■:, 


cu 


cu 


-C 




+ -' 




'O 


ro 


c 




ro 


a« 




- 




ro 


fN! 


O 


CO 


'.'' 


cr> 


a 


r 




r 


« 








r 


T3 


c> 


cu 


ro 


c 


_J 



c 

I 

'-„ 
0) 

a 

C.J 



O ^ 

c ° 

a; -' 
£tj 
f w 
ro » 

&| 

x: ro 
I- 5 



I- £ 

i_ +-> 
ro C 

a cu 
« £ 

s: <u 
H 1) 



5 




CU 

(J 


i 


ro 


ro 


c 


"> 
a 


3 


CL. 


•-LJ 
U 

c 


£ 

X) 




L. 
O 


o 


< 


I- 1 


3 


XI 








.Q 


ro 






d s 




^ 


cu 
to 


o 




ro 






b 




CJ 


ro 
u 


< 


£ 


c 




_J 






(0 


.::• 




•J ' 




^5 




cy 


r: 


o 





* 


£ - 




CU 

Q 

0) 


rv. 


> 




in 


c 
f'i) 




•o . 




U 


u 


ro co 
cn 




'D 

C 


c 


to 


ro .— 


ro 


ro 


-:— ■ 


c 


O 


£ . 


_«. 


-' 


cu 


CQ |A 


O ai 


cu 

'._ 
c 




> 

o 


CU 
in (j 
c o 


x: r- 


c 


ro 


a 


O 4. 


o 
u c 


I. 

1. 


o 
03 


E 

HI 


5; a 

ra 



o E 

.Q CU 

32 

cu >. 

■M (J 

^ c 

to <" 

^- £ co 

I— CU s- 



459 



I s 



2: oo 

LU <T> 
_J r- 

.-hi 

.-O-l- 

LU «- 

C_ 

LL 
O 



? 



> 
( ) 


wJ£ 


z 

LU 


<u o 


< 


> — 




C « 1/5 • 




o E £ 




4-> > O 




+-» *- — '77 




Sal-* 




EJPl? E 




n ."O o 




a aj c o 



E 

E 
oi aix: c 
<<uucjuulu 



g\y-c 



r e Jo 

CD r> 

C .CO 

O t/i 

4- C _* 

: ro c £ 

• > -^ .2 

, S_ (J 4- 

a) a; ra 

L </> i_ u 

: C t- 3 

i O O "O 



.-^ 






CD 


r- 






>- 









a 
E 

LU 


«4- 








a 






4-J 


.•_• 






ra 


c 






+-- 






co 


artm 
(1) 

ion 









Q_ l/l 




■+- 


c.E 


<U W 




C 


Q g 


~U 


4-J 

c 

c 
4- 1 


<d = 
E- 

4-" ., 

&E 


ity, 

t of 

Com 


(0 

c 

DQ 


Secur 
artmen 
serves 




■_ 


O 




Q 2 


l_ 


0) 


in 


4-" 

O 


Q 




oyment 
r, Dep 
re Pre; 


u 

c 


4J 


2 

< 

u 


O CD 


7; 3 


3 




2-.Q -m 


— 


-Q 


£i +3 


E (c "3 


O 


D 


D O 


LU _J Z 


Li. 


0. 


a. a: 



3 




u 




(U 




V) 




4J 




c 




a> 




E 




> 













a 




F 




uu 




*. 


-r 





.0 




CT1 






L. 




JJ 


r 


r 




+-> 


■M 


m 


L 


Q 


^) 


cd 


b 


O 


l_ 


CD 


ra 
Q 


-i- 


<u 



460 





CN 


cn 




CO 


cr> 




en 




^in 


-1 




111 oo 






CO CD 






z «- 






Ot 

85 1 




CN 


o: o 


co 


U2 


tt 


o-. 




^i 


*~ ' 




r.OH 






T" Z 






LU °° 






LLI . ^ r- 
_l U en 






ffi<- 






< LL 00 


° 1 

r.c- 


in 

in 


O 


t— [ 




z — 






oh 






Lou 






— LU 






a:-> 






< CQ 






QlC 


^ 1 


in 


2 „ 


h- 


i© 


oc 


O) 




ui- 


r-| 





«-. 




cr 


«- o 


in 


o 






10 


co 


=r 


1q 








U~> 


CN 














<y 
c 
o 


,__ 


U3 


, , 


<£> ,— , 


o 


D 


OP 


O^ 


CA° 


in cap 






CO 




O 


v O 




TJ 


(0 




CN 


CN 




c 


5— 




ro 


in 




o 












0. 


, , 


fSI 


, , 


o> <— « 


o 


> 


CAP 


r- 


OP 


r^ \o 




ro 
S 


CO 




CN 


<£> 




in 




U3 


o 




> 






SJ- 


LO 




L; 












c 
ro 


,_, 


CN 


,— , 


r^ ^-v 


o 


•u 


oiiP 


VO c*P 


rsi o\° 




£ 






10 


ro 




■*-j 


o 




r-i 


IV 






S— 




VO 


c-i 




W 




» — ' 


•— ' 




if) 






















;:■, 












c 












:. 


I 1 


t— 


r—l 


•— ' — ■ 


o 


i*; 


o\o 


n 


o\o 


CN o\° 




■/. 


*"". 




o 


en 






<■.£.' 




o 


oo 






T— 




U1 


ro 




>s 












U 

c 

U) 
ro 




St 




10 ^ 


o 




o\o 


rs cA° 


CN cAO 




ff; 


•^ 




-/, 


en 




C 









c 








ro 


O r-N 


CO -— - 


o 


,r 


ro o\o 


po c*P 






CN 


CO 




i/» 


O 


o 




■s> 


£1" 


LO 




<L> 



00 














z 














o 






"D 








h" 




00 


a 


"0 






u 




LU 


ro 


<v 






LU 
—1 




00 

z 


a 


T3 

C 






CD 




O 


q: 


0) 

e 






Q 




a. 












00 


i_ 


< 






LL 




LU 


o 








o 




Q. 


c; 


L. 
O 






cm 

LU 


Q 


>- 

U 


5 

ro 




ro 


c 




LU 
ID 
00 
00 


z 

LU 

a 




T3 
O 


3 


T5 

C 


Z 


< 


§ 


2 


o: 


% 



':-, 




"i 




1/1 








C 

r 


>■ 






u 


a» 

C 
o 


o 


c 




ro 




r 


o 




i_ 


0) 


<u 


i_ 


X) 


o 


t: 


E 


13 




Z 


c 



461 



- 46: 



January 1 , 1986 

THE ILLINOIS ADMINISTRATIVE PROCEDURE ACT 

(Codified by V«/est Publishing Company in Illinois Revised Statutes 
at chapter 127, paragraphs 1001-1021 .) 

AN ACT in relation to acministrative rules ana procedures, and to 
amend an Act therein named and in connection therewith. (PA 79-1063, 
approved and effective September 22, 1975) 

Section 1. SHORT TITLE) This Act shall be known and may be 
cited as "The Illinois Administrative Procedure Act." (PA 79-1083) 

Section 2. APPLICABILITY) This Act applies to every agency as 
defined herein. Beginning January 1, 1978 in case of conflict between 
the provisions of this Act and the Act creating or conferring power on 
an agency, this Act shall control. However if an agency has existing 
procedures on July 1, 1977 specifically for contested cases or licensing 
those existing provisions control, except that this exception respecting 
contested cases end licensing does not apply if the Act creating or 
conferring power on the agency adopts by express reference the 
provision of this Act. Where the Act creating or conferring power on 
an agency establishes administrative procedures not covered by this 
Act, such procedures shall remain in effect. 

The provisions of this Act shall not apply to (1) preliminary 
hearings, investigations or practices where no final determinations 
affecting State funding are made by the State Board of Education, (2) 
legal opinions issued under Section 2-3.7 of The School Code, (3) as to 
State colleges and universities, their disciplinary and grievance 
proceedings, academic irregularity and capricious grading proceedings, 
and admission standards and procedures, and (4) the class 
specifications for positions and individual position descriptions prepared 
and maintained pursuant to the "Personnel Code"; however such 
specifications shall be made reasonably available to the public for 
inspection and copying. Neither shall the provisions of this Act apply 
to hearings under Section 20 of the "Uniform Disposition of Unclaimed 
Property Act." 

Pay rates established pursuant to Section 8a of the Personnel Code 
shall be amended or repealed pursuant to the process set forth in 
Section 5.03 within 30 days after it becomes necessary to do so due to 
a conflict between the rates and the terms of a collective bargaining 
agreement covering the compensation of an employee subject to that 
Code. (PA 79-1083; Amended by PA 80-1035, effective September 27, 
1977; Amended by PA 80-1457, effective January 1, 1979; Amended by 
PA 81-1514, effective January 1, 1981; Amended by PA 83-0891, 
effective November 2, 1983; Amended by PA 84-22, effective July 18, 
1985; Amended by PA 84-469, effective January 1, 1986) 

Section 3. DEFINITIONS) As used in this Act, unless the 
context otherwise requires, the terms specified in Section 3.01 through 
3.10 have the meanings ascribed to them in those Sections. (PA 
79-1083; Amended by PA 82-0783, effective July 13, 1982) 



Section 3. CI. AGENCY) "Agency" means each officer, board, 
commission and agency created by the Constitution, whether in the 
executive, legislative, or judicial branch of State government, but other 
than the circuit court; each officer, department, board, commission, 
agency, institution, authority, university, body politic and corporate of 
the State; and each administrative unit or corporate outgrowth of the 
State government which is created by or pursuant to statute, other 
than units of local government and their officers, school districts and 
boards of election commissioners; each administrative unit or corporate 
outgrowth of the above and as may be created by executive order of 
the Governor. However, "agency" does not include: 

(a) the House of Representatives and Senate, and their respective 
standing and service committees; 

(b) the Governor; and 

(c) the justices and judges of the Supreme and Appellate Courts. 

No entity shall be considered an "agency" for the purposes of this 
Act unless authorized by law to make rules or to determine contested 
cases. (PA 79-1083; Amended by PA 80-1457, effective January 1, 
1 979 ) 

Section 3.02. CONTESTED CASE) "Contested case" means an 
adjudicatory proceeding, not including rate-making, rulemaking, 
quasi-legislative, informational or similar proceedings, in which the 
individual legal rights, duties or privileges of a party are required by 
law to be determined by an agency only after an opportunity for 
hearing. (PA 79-1083; Amended by PA 80-1035, effective September 
27, 1977) 

Section 3.03. HEARING EXAMINER) ''Hearing examiner" means 
the presiding officer or officers at the initial hearing before each 
agency and each continuation thereof. (PA 79-1083) 

Section 3.04. LICENSE) "License" includes the whole or part of 
any agency permit, certificate, approval, registration, charter, or 
similar form of permission required by law, but it does not incluae a 
license required solely for revenue purposes. (PA 79-1083) 

Section 3.05. LICENSING) "Licensing" includes the agency 
process respecting the grant, denial, renewal, revocation, suspension, 
annulment, withdrawal or amendment of a license. (PA 79-1083) 

Section 3.06. PARTY) "Party" means each person or agency 
named or admitted as a party, or properly seeking and entitled as of 
right to be admitted as a party. (PA 79-1083) 

Section 3.07. PERSON) "Person" means any individual, 

partnership, corporation, association, governmental subdivision, or 

public or private organization of any character other than an agency. 
(PA 79-1083) 

Section 3.08. RATE-MAKING OR RATE-MAKING ACTIVITIES) 
"Rate-making" or "Rate-making activities" means the establishment or 
review of or other exercise of control over the rates or charges for the 



464 - 



products or services of any person, firm or corporation operating or 
transacting any business in this State. (PA 79-1063) 

Section 3.09. RULE) "Rule" means each agency statement of 
genera! applicability that implements, applies, interprets, or prescribes 
law or policy, but does not include (a) statements concerning only the 
internal management of an agency and not affecting private rights or 
procedures available to persons or entities outside the agency, (b) 
informal advisory rulings issued pursuant to Section 9, (c) intra-agency 
memoranda or (d) the prescription of standardized forms. (PA 79-1083; 
Amended by PA 80-1035, effective September 27, 1977) 

Section 3.10. SMALL BUSINESS) For the purpose of this Act, 
"small business" means a concern, including its affiliates, which is 
independently owned and operated, not dominant in its field and which 
employs fewer than 50 full-time employees or which has gross annual 
sales of less than $4 million. For purposes of a specific rule, an 
agency may define small business to include more persons if it finds 
that such a definition is necessary to adapt the rule to the needs and 
problems of small businesses and organizations. (Added by PA 82-492, 
effective January 1, 1982) 

Section 4. ADOPTION OF RULES: PUBLIC INFORMATION, 
AVAILABILITY OF RULES) (a) In addition to other rulemaking 
requirements imposed by law, each agency shall: 

1 . adopt rules of practice setting forth the nature and 
requirements of all formal hearings; 

2. make available for public inspection al! rules adopted by the 
agency in the discharge of its functions. 

(b) Each agency shall make available for public inspection all final 
orders, decisions and opinions, except those deemed confidential by 
state or federal statute and any trade secrets, 

(c) No agency rule is valid or effective against any person or 
party, nor may it be invoked by the agency for any purpose, until it 
has been made available for public inspection and filed with the 
Secretary of State as required by this Act. However, no Agency shall 
assert the invalidity of a rule which it has adopted pursuant to this Act 
when an opposing party has relied upon such rule. (Amended by P. A. 
83-1387, effective January 1, 1985; Amended by P. A. 83-1453, effective 
January 1 , 1985) 

(d) Rulemaking which creates or expands a State mandate on 
units of local government, school districts, or community college 
districts is subject to the State Mandates Act. The required Statement 
of Statewide Policy Objectives shall be published in the Illinois Register 
at the same time that the first notice under Section 5.01 is published or 
when the rule is published under Section 5.02 or 5.03. (PA 79-1083; 
Amended by PA 80-1035, effective September 27, 1977; Amended by PA 
81-1562, effective January 16, 1981) 

Section 4.01 REQUIRED RULES) (a) Each agency shall maintain as 
rules the following: 



465 - 



1 . a current description of the agency's organization with 
necessary charts depicting same; 

2. the current procedures on hov; the public can obtain 
information or make submissions or requests on subjects, 
programs, and activities of the agency; 

3. tables of contents, indices, reference tables, and other 
materials to aid users in finding and using the agency's collection 
of rules currently in force; and 

4. a current description of the agency's rulemaking procedures 
with necessary flow charts depicting same. 

(b) The rules required to be filed by this Section may be 
adopted, amended, or repealed and filed as provided in this Section in 
lieu of any other provisions or requirements of this Act. 

The rules required by this Section may be adopted, amended, or 
repealed by filing a certified copy with the Secretary of State as 
provided by paragraphs (a) and (b) of Section 6, and may become 
effective immediately. (Added by PA 80-1035, effective September 27, 
1977; Amended by PA 81-1044, effective October 1, 1979) 

Section 4.02. RULES IMPLEMENTING DISCRETIONARY POWERS: 
STANDARDS) Each rule which implements a discretionary power to be 
exercised by an agency shall include the standards by which the 
agency shall exercise the power. Such standards shall be stated as 
precisely and clearly as practicable under the conditions, to inform 
fully those persons affected. (Added by PA 81-1129, effective July 1, 
1980) 

Section 4.03. SMALL BUSINESS FLEXIBILITY) When an agency 
proposes a new rule, or an amendment to an existing rule, which may 
have an impact on small businesses, the agency shall do each of the 
following: (a) The agency shall consider each of the following methods 
for reducing the impact of the rulemaking on small businesses. The 
agency shall reduce the impact by utilizing one or more of the following 
methods, if it finds that the methods are legal and feasible in meeting 
the statutory objectives which are the basis of the proposed 
rulemaking. 

1. Establish less stringent compliance or reporting requirements 
in the rule for small businesses. 

2. Establish less stringent schedules or deadlines in the rule for 
compliance or reporting requirements for small businesses. 

3. Consolidate or simplify the rule's compliance or reporting 
requirements for small businesses. 

4. Establish performance standards to replace design or 
operational standards in the rule for small businesses. 

5. Exempt small businesses from any or all requirements of the 
rule. 

(b) Prior to or during the notice period required unaer Section 
5.01(a) of this Act, the agency shall provide an opportunity for small 
businesses to participate in the rulemaking process. The Agency shall 
utilize one or more of the following techniques. These techniques are 



46fi 



in addition to other rulemaking requirements imposed by this Act or by 
any other Act. 

1 . The inclusion in any advance notice of possible rulemaking of 
a statement that the rule may have an impact on small businesses. 

2. The publication of a notice of rulemaking in publications likely 
to be obtained by small businesses. 

3. The direct notification of interested small businesses. 

4. The conduct of public hearings concerning the impact of the 
rule on small businesses. 

5. The use cf special hearing or comment procedures to reduce 
the cost or complexity of participation in the rulemaking by small 
businesses. 

(c) Prior to the notice period required under Section 5.01(a) cf 
this Act, the agency shall notify the Business Assistance Office of the 
Department of Commerce and Community Affairs when rules affect 
businesses. The Business Assistance Office shall prepare an impact 
analysis of the rule describing its effect on small businesses. The 
impact analysis shall be completed within the notice period as described 
in subsection (a) of Section 5.01. Upon completion of the analysis the 
Business Assistance Office shall submit this analysis to both the Joint 
Committee on Administrative Rules and to the agency proposing the 
rule. The impact analysis shall contain the following: 

1. A summary of the projected reporting, recordkeeping and 
other compliance requirements of the proposed rule. 

2. A description of the types and an estimate of the number of 
small businesses to which the proposed rule will apply. 

3. An estimate of the economic impact which the regulation will 
have on the various types of small businesses affected by the 
rulemaking. 

4. A description of or a listing of alternatives to the proposed 
rule which would minimize the economic impact of the rule. Such 
alternative must be consistent with the stated objectives of the 
applicable statutes and regulations. 

(Added by PA 82-492, effective January 1, 1982; Amended by PA 
83-1341, effective September 7, 1984) 

Section 5. PROCEDURE FOR RULEMAKING) (a) Prior to the 
adoption, amendment or repeal of any rule, each agency shall 
accomplish the actions required by Sections 5.01, 5.02 or 5.03, 
whichever is applicable. 

(b) No action by any agency to adopt, amend or repeal a rule 
after this Act has become applicable to the agency shall be valid unless 
taken in compliance with this Section. A proceeding to contest any rule 
on the ground of non-compliance with the procedural requirements of 
this Section must be commenced within 2 years from the effective date 
of the rule. 

(c) The notice and publication requirements of this Section do not 
apply to a matter relating solely to agency management, personnel 
practices, or to public property, loans or contracts. (PA 79-1083; 



Amended by PA 81-1035, effective September 27, 1977; Amended by PA 
81-1044, effective October 1, 1979) 

Section 5s. REGULATORY AGENDA) An agency may submit for 
publication in the Illinois Register a regulatory agenda to elicit public 
comments concerning any rule which the agency is considering 
proposing but for which no notice or proposed rulemaking activity has 
been submitted to the Illinois Register. A regulatory agenda shall 
consist of summaries of such rules. Each summary shall, in less than 
2,000 words contain insofar as practicable: 

(a) a description of the rule; 

(b) the statutory authority the agency is exercising; 

(c) a schedule of the dates for any hearings, meetings or other 
opportunities for public participation in the development of the rule; 

(d) the date the agency anticipates submitting a notice of 
proposed rulemaking activity, if known; 

(e) the name, address and telephone number of the agency 
representative, knowledgeable on such rule, from whom any information 
may be obtained and to whom written comments may be submitted 
concerning such rule; 

(f) a statement as to whether the rule will affect small businesses 
as defined in this Act; and 

(g) any other information which may serve the public interest. 

Nothing in this Section shall preclude an agency from adopting a 
rule which has not been summarized in a regulatory agenda or from 
adopting a rule different than one summarized in a regulatory agenda; 
nothing in this Section shall require an agency to adopt a rule 
summarized in a regulatory agenda. The Secretary of State shall adopt 
rules necessary for the publication of a regulatory agenda, including 
but not limited to standard submission forms ana deadlines. (Added by 
PA 84-954, effective July 1, 1986) 

Section 5.0I. GENERAL RULEMAKING) In all rulemaking to which 
Sections 5.02 and 5.03 do not apply, each agency shall: 

(a) give at least 45 days' notice of its intended action to the 
general public. This first notice period shall commence on the first day 
the notice appears in the Illinois Register. The first notice shall 
include: 

1. The text of the proposed rule, or the old and new materials 
of a proposed amendment, or the text of the provision to be 
repealed; 

2. The specific statutory citation upon which the proposed rule, 
the proposed amendment to a rule or the proposed repeal of a rule 
is based and is authorized; 

3. A complete description of the subjects and issues involved; 

4. For all proposed rules and proposed amendments to rules, an 
initial regulatory flexibility analysis, which shall contain a 
description of the types of small businesses subject to the rule; a 
brief description of the proposed reporting, bookkeeping, and 
other procedures required for compliance with the rule; and a 



- 468 - 



description of the types of professional skills necessary for 
compliance; and 

5. The time, place and manner in which interested persons may 
present their views and comments concerning the proposed 
rulemaking . 

During the first notice period, the agency shall provide all 
interested persons who submit a request to comment within the first 14 
days of the notice period reasonable opportunity to submit data, views, 
arguments or comments, which may, in the discretion of the agency, be 
submitted either orally or in writing or both. The notice published in 
the Illinois Register shall indicate the manner selected by the agency 
for such submissions. The agency shall consider all submissions 
received. 

The agency shall hold a public hearing on the proposed 
rulemaking, during the first notice period, in the following cases: (1) 
the agency finds that a public hearing would facilitate the submission of 
views and comments which might not otherwise be submitted; (2) the 
agency receives a request for a public hearing, within the first 14 days 
after publication of the notice of proposed rulemaking in the Illinois 
Register, from 25 interested persons, an association representing at 
least 100 interested persons, the Governor, the Joint Committee on 
Administrative Rules, or a unit of local government which may be 
affected. At the public hearing, the agency shall allow interested 
persons to present views and comments on the proposed rulemaking. 
Such a public hearing in response to a request for a hearing may not 
be held less than 20 days after the publication of the notice of 
proposed rulemaking in the Illinois Register, unless notice of the 
public hearing is included in the notice of proposed rulemaking. A 
public hearing on proposed rulemaking may not be held less than 10 
days before submission of the notice required under paragraph (b) of 
this Section to the Joint Committee on Administrative Rules. Each 
agency may prescribe reasonable rules for the conduct of public 
hearings on proposed rulemaking to prevent undue repetition at such 
hearings. Such hearings must be open to the public and recorded by 
stenographic or mechanical means. 

(b) provide up to 45 days additional notice of the proposed 
rulemaking to the Joint Committee on Administrative Rules. The second 
notice period shall commence on the day written notice is received by 
the Joint Committee, and shall expire 45 days thereafter unless prior to 
that time the agency shall have received a statement of objection from 
the Joint Committee, or notification from the Joint Committee that no 
objection will be issued. The written notice to the Joint Committee shall 
include: (1) the text and location of any changes made to the proposed 
rulemaking during the first notice period; (2) for all proposed rules 
and proposed amendments to rules, a final regulatory flexibility 
analysis, which shall contain a summary of issues raised by small 
businesses during the first notice period; and a description of actions 
taken on any alternatives to the proposed rule suggested by small 
businesses during the first notice period, including reasons for 
rejecting any alternatives not utilized; and (3) if written request has 
been made by the Joint Committee within 30 cays after initial notice 
appears in the Illinois Register pursuant to Paragraph (a) of this 



- i^9 - 



Section, an analysis of the economic and budgetary effects of the 
proposed rulemaking. After commencement of the second notice period, 
no substantive change may be made to a proposed rulemaking unless it 
is made in response to an objection or suggestion of the Joint 
Committee. The agency shall also send a copy of the final regulatory 
flexibility analysis to each of the small businesses which have presented 
views or comments on the proposed rulemaking during the first notice 
period and to any interested person who requests a copy during the 
first notice period. The agency may charge a reasonable fee for 
providing such copies to cover postage and handling costs. 

(c) after the expiration of 45 days, after notification from the 
Joint Committee that no objection will be issued, or after response by 
the agency to a statement of objections issued by the Joint Committee, 
whichever is applicable, the agency shall file, pursuant to Section 6 of 
this Act, a certified copy of each rule, modification, or repeal of any 
rule adopted by it, which shall be published in the Illinois Register. 
Each rule hereafter adopted under this Section is effective upon filing, 
unless a later effective date is required by statute or is specified in 
the rule. 

(d) no rule or modification or repeal of any rule may be adopted, 
or filed with the Secretary of State, more than one year after the date 
the first notice period for the rulemaking under paragraph (a) 
commenced. Any period during which the rulemaking is prohibited from 
being filed under Section 7.06a shall not be considered in calculating 
this one-year time period. In addition, no rule or modification which 
contains an incorporation by reference under subsection (b) of Section 
6.02 may be adopted and filed with the Secretary of State pursuant to 
paragraph (c) of Section 5.01 and Section 6 of this Act unless the 
agency adopting and filing the rule is in receipt of written approval 
from the Joint Committee on Administrative Rules. This paragraph (d) 
applies to any rule or modification or repeal of any rule which has not 
been filed with the Secretary of State prior to the effective date of this 
amendatory Act of 1981. (Added by PA 81-1044, effective October 1, 
1979; Amended by PA 82-242, effective January 1, 1982; Amended by 
PA 82-492, effective January 1, 1982; Amended by PA 82-783, effective 
July 13, 1982; Amended by PA 84-784, effective January 1, 1986) 

Section 5.02. EMERGENCY RULEMAKING) "Emergency" means the 
existence of any situation which any agency finds reasonably constitutes 
a threat to the public interest, safety or welfare. Where any agency 
finds that an emergency exists which requires adoption of a rule upon 
fewer days than is required by Section 5.01, and states in writing its 
reasons for that finding, the agency may adopt an emergency rule 
without prior notice or hearing, upon filing a notice of emergency 
rulemaking with the Secretary of State pursuant to Section 6.01 of this 
Act. Such notice shall include the text of the emergency rule and shall 
be published in the Illinois Register. Consent orders or other court 
orders adopting settlements negotiated by an agency may be adopted 
pursuant to this Section. Subject to applicable constitutional or 
statutory provisions, an emergency rule becomes effective immediately 
upon filing pursuant to Section 6, or at a stated date less than 10 days 
thereafter. The agency's finding and a statement of the specific 
reasons therefor shall be filed with the rule. The agency shall take 



U70 



reasonable and appropriate measures to make emergency rules known to 
the persons who may be affected by them. 

An emergency rule may be effective for a period of not longer 
than 150 days, but the agency's authority to adopt an identical rule 
under Section 5.01 of this Act is not precluded. No emergency rule 
may be adopted more than once in any 24 month period, except that 
this limitation on the number of emergency rules which may be adopted 
in a 24 month period does not apply to emergency rules which make 
additions to and deletions from the Drug Manual pursuant to Section 
5-5.16 of The Illinois Public Aid Code. Two or more emergency rules 
having substantially the same purpose and effect shall be deemed to be 
a single rule for purposes of this Section. (Added by PA 81-1044, 
effective October 1, 1979; Amended by PA 84-22, effective July 18, 
1985; Amended by PA 84-576, effective January 1, 1986) 

Section 5.03. PEREMPTORY RULEMAKING) "Peremptory 

rulemaking" means any rulemaking which is required as a result of 
federal law, federal rules and regulations, or an order of a court, 
under conditions which preclude compliance with general rulemaking 
requirements imposed by Section 5.01 and which preclude the exercise 
of discretion by the agency as to the content of the rule it is required 
to adopt. Peremptory rulemaking shall not be used to implement 
consent orders or other court orders adopting settlements negotiated by 
the agency. Where any agency finds that peremptory rulemaking is 
necessary and states in writing its reasons for that finding, the agency 
may adopt peremptory rulemaking upon filing a notice of rulemaking 
with the Secretary of State pursuant to Section 6.01 of this Act. Such 
notice shall be published in the Illinois Register. A rule adopted under 
the peremptory rulemaking provisions of this Section becomes effective 
immediately upon filing with the Secretary of State ana in the agency's 
principal office, or at a date required or authorized by the relevant 
federal lav;, federal rules ana regulations, or court order, as stated in 
the notice of rulemaking. Notice of rulemaking under this Section shall 
be published in the Illinois Register, and shall specifically refer to the 
appropriate state or federal court order or federal lav;, rules and 
regulations, and shall be in such form as the Secretary of State may 
reasonably prescribe by rule. The agency shall file the notice of 
peremptory rulemaking within 30 days after a change in rules is 
required. (Added by PA 81-1044, effective October 1, 1979; Amended 
by PA 84-576, effective January 1, 1986; Amended by PA-784, effective 
January 1 , 1986) 

Section 5.04. AUTOMATIC REPEAL OF RULES. A rule may 
provide for its automatic repeal on a date specified in the rule. The 
repeal shall be effective on the date specified, provided that notice of 
the repeal is published in the Illinois Register not less than 30 nor 
more than 60 days prior to the effective date of the repeal. This 
section shall not apply to any rules filed pursuant to Section 5.02 of 
this Act. (Added by P. A. 83-1387, effective January 1, 1985) 

Section 6. FILING OF RULES) (a) Each agency shall file in the 
office of the Secretary of State and in the agency's principal office e 
certified copy of each rule and modification or repeal of any rule 
adopted by it. The Secretary of State and the agency shall each keep 
a permanent register of the rules open tc public inspection. 

- ii 7 1 - 



(b) Concurrent with the filing of any rule pursuant to this 
Section, the filing agency shall submit to the Secretary of State for 
publication in the next available issue of the Illinois Register a notice of 
adopted rules. Such notice shall include: 

1. The text of the adopted rule, which shall include: if the 
material is a new rule, the full text of the new rule; or if the 
material is an amendment to a rule or rules, the full text of the 
rule or rules as amended; or if the material is a repealer, such 
notice of repeal. 

2. The name, address and telephone number of an individual who 
will be available to answer questions and provide information to the 
public concerning the adopted rules. 

3. Such other information as the Secretary of State may by rule 
require in the interest of informing the public. (PA 79-1083; 
Amended by PA 80-1035, effective September 27, 1979; Amended 
by PA 81-1044, effective October 1, 1979; Amended by FA 82-298, 
effective January 1, 1982) 

Section 6.01. FORM AND PUBLICATION OF NOTICES) The 
Secretary of State may prescribe reasonable rules concerning the form 
of documents to be filed with him, and may refuse to accept for filing 
such certified copies as are not in compliance with such rules. In 
addition, the Secretary of State shall publish and maintain the Illinois 
Register and may prescribe reasonable rules setting forth the manner in 
which agencies shall submit notices required by this Act for publication 
in the Illinois Register. The Illinois Register shall be published at 
least once each week on the same day unless such day is an official 
State holiday in which case the Illinois Register shall be published on 
the next following business day and sent to subscribers who subscribe 
for the publication with the Secretary of State. The Secretary of State 
may charge a subscription price to subscribers that covers mailing and 
publication costs. (Added by PA 81-1044, effective October 1, 1979; 
Amended by PA 82-689, effective July 1, 1982; Amended by PA 83-638, 
effective September 21, 1983) 

Section 6.02. INCORPORATION BY REFERENCE) (a) An agency 
may incorporate by reference, in its rules adopted in accordance with 
Section 5 of this Act, rules and regulations of an agency of the United 
States or rules, regulations, standards and guidelines of a nationally 
recognized organization or association without publishing the 
incorporated material in full. The reference in the agency rules must 
fully identify the incorporated matter by location and date, and must 
state that the rule, regulation, standard or guideline does not include 
any later amendments or editions. The agency adopting the rule, 
regulation, standard or guideline shall maintain a copy of the 
referenced rule, regulation, standard or guideline and shall make it 
available to the public upon request for inspection and copying at no 
mere than cost. An agency may also at its discretion file a copy of 
referenced rule, regulation, standard or guideline with the State 
Library. An agency may incorporate by reference such matters in its 
rules only if the agency, organization or association originally issuing 
the matter makes copies readily available to the public. This section 
shall not apply to any agency internal manual. 



m; 



(b) As provided by this subsection, an agency may incorporate 
by reference in its rules adopted in accordance with Section 5.01 of 
this Act guidelines or standards of an agency of the United States, 
without publishing the incorporated material in full, provided that the 
incorporated material is readily available to the public. The reference 
in the agency rules must fully identify the incorporated matter by 
location and date, and must state that the guideline or standard does 
not induce any later amendments or editions. An agency may 
incorporate by reference such matters in its rules only if the agency of 
the United States issuing or distributing the matter, or the 
organization, association or other entity acting on behalf of the agency 
of the United States makes copies readily available to the public. The 
agency adopting the rule shall maintain a copy of the referenced 
guideline or standard and shall make it available to the public upon 
request ior inspection and copying at no more than cost. An agency 
may also at its discretion file a copy of referenced guidelines or 
standards with the State Library. Use of the incorporation by 
reference procedure under this subsection (b) must be approved by the 
Joint Committee on Administrative Rules prior to the submission of the 
written notice required pursuant to paragraph (b) of Section 5.01 of 
this Act. An agency seeking to adopt a rule containing incorporation 
by reference under this subsection (b) shall submit a written request 
to the Joint Committee on Administrative Rules. In determining whether 
to approve an incorporation by reference, the Joint Committee shall use 
the following standard: whether or not the material sought to be 
incorporated is readily available for public inspection. No rule which 
contains an incorporation by reference pursuant to this subsection (b) 
may be accepted by the Secretary of State for adoption and filing 
pursuant to paragraph (c) of Section 5.01 and Section 6 of this Act, 
unless the agency is in receipt of written approval from the Joint 
Committee on Administrative Rules. (Added by PA 83-638, effective 
September 21, 1983; Amended by PA 84-784, effective January 1, 1986) 

Section 7. CODIFICATION OF RULES - PUBLICATION (a) The 
Secretary of State shall, by rule, prescribe a uniform system for the 
codification of rules on or before July 1, 1980. The Secretary of State 
shall also, by rule, establish a schedule for compliance with the uniform 
codification system on or before October 1, 1980. Such schedule may 
be by sections of the codification system and shall require 
approximately one-fourth of the rules to be converted to the codification 
system by each October 1, starting in 1981 and ending in 1984. All 
rules on file with the Secretary of State and in effect on October 1 , 
1984, shall be in compliance with the uniform system for the codification 
of rules. Rules not so codified as of October 1, 1984, are void, shall 
be withdrawn by the Secretary of State from the permanent register of 
the rules, and shall not be published by the Secretary of State in 
either the Illinois Administrative Code or in the Illinois Register. The 
Secretary of State shall not adopt any codification system or schedule 
under this subsection without the approval of the Joint Committee on 
Administrative Rules. Approval by the Joint Committee shall be 
conditioned solely upon establishing that the proposed codification 
system and schedule are compatible with existing electronic data 
processing equipment and programs maintained by and for the General 
Assembly. Nothing in this Section shall prohibit an agency from 



- 473 - 



adopting rules in compliance with the codification system earlier than 
specified in the schedule. 

(b) If no substantive changes are made by the agency in 
amending existing rules to comply with the codification system, such 
codified rules may be adopted until October 1, 1984, without requiring 
notice or publication of the text of rules pursuant to Section 5. In 
such a case, the publication requirement shall be satisfied by the 
publication in the Illinois Register of a notice stating that the agency 
has adopted the rules to comply with the codification system, that no 
substantive changes have been made in the rules and that the State 
Library has reviewed and approved the codification of the rules. The 
notice shall include the current names and numbers of the rules being 
codified, an outline of the headings of the sections of the rules as 
codified and may also include a table indicating the relationship between 
any rule numbers previously used by the agency and the numbering 
system of the codified rules. The agency shall provide the text of 
such rules as codified to the State Library for review and necessary 
changes and recommendations at least 30 days prior to the publication 
of such notice. Whenever the codification of an emergency or 
peremptory rule is changed subsequent to its publication as adopted in 
the Illinois Register, a notice of such change, in the manner set forth 
in this subsection, shall be published in the next available issue of the 
Illinois Register. Such a change in the rule's codification shall not 
affect its validity or the date upon which it became effective. 

(c) Each rule proposed in compliance with the codification system 
shall be reviewed by the State Library under the Secretary of State 
prior to the expiration of the public notice period provided by Section 
5.G1 (a) of this Act or prior to the publication of the notice required 
under subsection (b) of this section. The State Library shall cooperate 
with agencies in its review to insure that the purposes of the 
codification system are accomplished. The State Library shall have the 
authority to make changes in the numbering and location of the rule in 
the codification scheme, providing such changes do not affect the 
meaning of the rules. The State Library may recommend changes in the 
sectioning and headings proposed by the agency and suggest gram- 
matical and technical changes to correct errors. The State Library may 
add notes concerning the statutory authority, dates proposed and 
adopted and other similar notes to the text of the rules, if such notes 
are not supplied by the agency. This review by the State Library 
shall be for the purpose of insuring the uniformity of and compliance 
with the codification system. The State Library shall prepare indexes 
by agency, subject matter, and statutory authority and any other 
necessary indexes, tables and other aids for locating rules to assist the 
public in the use of the Code. 

(d) The State Library shall make available to the agency and the 
Joint Committee on Administrative Rules copies of the changes in the 
numbering and location of the rule in the codification scheme, the 
recommended changes in the sectioning and headings, and the 
suggestions made concerning the correction of grammatical and technical 
errors or other suggested changes. The agency shall in the notice 
required by Section 5.01(b) of this Act, or if such notice is not 
required, at least 10 days prior to the publication of the notice 



itfi\ 



required under subsection (b) of this Section, provide to the Joint 
Committee a response to the recommendations of the State Library 
including any reasons for not adopting the recommendations. 

(e) In the case of reorganization of agencies, transfer of 
functions between agencies, or abolishment of agencies by executive 
order or law, which affects rules on file with the Secretary of State, 
the State Library shall notify the Governor, the Attorney General, and 
the agencies involved of the effects upon such rules on file. If the 
Governor or the agencies involved do not respond to the State Library's 
notice within 45 days by instructing the State Library to delete or 
transfer the rules, the State Library may delete or place such rules 
under the appropriate agency for the purpose of insuring the 
consistency of the codification scheme and shall notify the Governor, 
the Attorney General and the agencies involved. 

(f) The Secretary of State shall publish an Illinois Administrative 
Code as effective January 1, 1985. The code shall be published on or 
before June 1, 1985, and the Secretary of State shall update each 
section of the Code at least annually thereafter. Such Code shall 
contain the complete text of all rules of all State agencies filed with his 
office and effective on October 1, 1984, or later and the inaexes, 
tables, and other aids for locating rules prepared by the State Library. 
The Secretary of State shall design the Illinois Register to supplement 
such Code. The Secretary of State shall make copies of the Code 
available generally at a price covering publication and mailing costs. 

(g) The publication of a rule in the Code or in the Illinois 
Register as an adopted rule shall establish a rebuttable presumption 
that the rule was duly filed and that the text of the rule as published 
in the Code is the text of the rule as adopted. Publication of the text 
of a rule in any other location whether by the agency or some other 
person shall not be taken as establishing such presumption. Judicial 
notice shall be taken of the text of each rule published in the Code or 
Register. 

(h) The codification system, the indexes, tables, and other aids 
for locating rules prepared by the State Library, notes and other 
materials developed under this Section in connection with the publication 
Of the Illinois Administrative Code shall be the property of the State. 
No person may attempt to copyright or publish for sale such materials 
except the Secretary of State as provided in this Section. (PA 
79-1083; Amended by PA 80-1035, effective September 27, 1977; 
Amended by PA 80-1457, effective January 1, 1979; Amended by PA 
81-1348, effective July 16, 1980; Amended by PA 83-555, effective 
January 1, 1984; Amended by PA 83-556, effective January 1, 1984; 
Amended by PA 83-1362, effective September 11, 1984) 

Section 7.0I. CERTIFICATION OF RULES FILED WITH THE 
SECRETARY OF STATE) (a) Beginning January 1, 1978, whenever a 
rule, or modification or repeal of any rule, is filed with the Secretary 
of State, the Secretary of State within three working days after such 
filing shall send a certified copy of such rule, modification or repeal to 
the Joint Committee on Administrative Rules established in Section 7.02. 



475 - 



(b) Any rule on file with the Secretary of State on January 1 , 
1978 shall be void 60 days after that date unless within such 60 day 
period the issuing agency certifies to the Secretary of State that the 
rule is currently in effect. 

Within 45 days after the receipt of any certification pursuant to 
this sub-section (b), the Secretary of State shall send to the Joint 
Committee on Administrative Rules established in Section 7.02 a copy of 
each agency's certification so received along with a copy of the rules 
covered by the certification. (Added by PA 80-1035, effective 
September 27, 1977) 

Section 7.02. ESTABLISHMENT AS LEGISLATIVE SUPPORT 
SERVICES AGENCY - AGENDA - PUBLICATION OF INFORMATION - 
FEES) The joint Committee on Administrative Rules is established as a 
legislative support services agency subject to the Legislative Commission 
Reorganization Act of 1984. 

When feasible the agenda of each meeting of the Joint Committee shall 
be submitted to the Secretary of State to be published at least 5 days 
prior to the meeting in the Illinois Register. The Joint Committee may 
also weekly, or as often as necessary, submit for publication in the 
Illinois Register lists of the dates on which notices under Section 5.01 
of this Act were received and the dates on which the proposed 
rulemakings will be considered. The provisions of this subsection shall 
not prohibit the Joint Committee from acting upon an item that was not 
contained in the published agenda. 

The Joint Committee may charge reasonable fees for copies of 
documents or publications to cover the cost of copying or printing, 
however, the Joint Committee shall provide copies of documents or 
publications without cost to agencies which are directly affected by 
recommendations or findings included in such documents or publications. 
(Added by PA 80-1 C35, effective September 27, 1977; Amended by PA 
80-1457, effective January 1, 1979; Amended by PA 82-372, effective 
September 2, 1981; Amended by PA 83-638, effective September 21, 
1983; Amended by PA 83-1257, effective August 15, 1984) 

Section 7.03. ADMINISTRATION OF OATHS OR AFFIRMATIONS - 
AFFIDAVITS OR DEPOSITIONS - SUBPOENA) (a) The Executive 
Director of the Joint Committee or any person designated by him may 
administer oaths or affirmations, take affidavits or depositions of any 
person. 

(b) The Executive Director, upon approval of a majority vote of 
the Joint Committee, or the presiding officers may subpoena and compel 
the attendance before the Joint Committee and examine under oath any 
person, or the production for the Joint Committee of any records, 
books, papers, contracts or other documents. 

If any person fails to obey a subpoena issued under this Section, 
the Joint Committee may apply to any circuit court to secure compliance 
with the subpoena. The failure to comply with the order of the court 
issued in response thereto shall be punished as a contempt. (Aoaed by 
PA 80-1035, effective September 27, 1977) 



476 - 



Section 7.04. POWERS OF JOINT COMMITTEE) The Joint 
Committee shall have the following powers under this Act: 

1 . The function of the Joint Committee shall be the promotion of 
adequate and proper ruies by agencies and an understanding on the 
part of the public respecting such rules. Such function shall be 
advisory only, except as provided in Sections 7.06a and 7.07a. 

2. The Joint Committee may undertake studies and investigations 
concerning rulemaking and agency rules. 

3. The Joint Committee shall monitor and investigate compliance 
of agencies with the provisions of this Act, make periodic investigations 
of the rulemaking activities of all agencies, and evaluate and report on 
all rules in terms of their propriety, legal adequacy, relation to 
statutory authorization, economic and budgetary effects and public 
policy. 

4. hearings and investigations conducted by the Joint Committee 
under this Act may be held at such times and places within the State as 
such Committee deems necessary. 

5. The Joint Committee shall have the authority to request from 
any agency an analysis of the: 

a. effect of a new rule, amendment or repealer, including any 
direct economic effect on the persons regulated by the rule; any 
anticipated effect on the proposing agency's budget and the 
budgets of other State agencies; and any anticipated effects on 
State revenues; 

b. agency's evaluation of the submissions presented to the 
agency pursuant to Section 5.01 of this Act; 

c. a description of any modifications from the initially published 
proposal made in the finally accepted version of the intended rule, 
amendment or repealer; 

d. agency's justification and rationale for the intended rule, 
amendment or repealer. 

6. Failure of the Joint Committee to object to any proposed rule, 
amendment, or repealer or any existing rule shall not be construed as 
implying direct or indirect approval of the rule or proposed rule, 
amendment, or repealer by the Joint Committee or the General 
Assembly. (Added by PA 80-1035, effective September 27, 1977; 
Amended by PA 80-1044, effective October 1, 1978; Amended by FA 
81-1035, effective January 1, 198C; Amended by PA 81-1514, effective 
January 1 , 1981 ) 

Section 7.05. RESPONSIBILITIES OF JOINT COMMITTEE) The Joint 
Committee shall have the following responsibilities under this Act: 

1. The Joint Committee shall conduct a systematic and continuing 
study of the rules and rulemaking process of all state agencies, 
including those agencies not covered in Section 3.01 of this Act, for 
the purpose of improving the rulemaking process, reducing the number 
and bulk of rules, removing redundancies and unnecessary repetitions 
and correcting grammatical, typographical and like errors not affecting 



- 477 - 



the construction or meaning of the rules, and it shall make 
recommendations to the appropriate affected agency. 

2. The joint Committee shall review the statutory authority on 
which any administrative rule is based. 

3. The Joint Committee shall maintain a review program, to study 
the impact of legislative changes, court rulings and administrative 
action on agency rules and rulemaking. 

4. The Joint Committee shall suggest rulemaking of an agency 
whenever the Joint Committee, in the course of its review of the 
agency's rules under this Act, determines that the agency's rules are 
incomplete, inconsistent or otherwise deficient. (Added by PA 80-1035, 
effective September 27, 1977; Amended by PA 81-1044, effective October 
1 , 1979) 

Section 7.06. EXAMINATION OF PROPOSED RULE, AMENDMENT OR 
REPEAL OF RULE BY ThE JOINT COMMITTEE - DETERMINATIONS - 
EVALUATION OF STATE FORMS) (a) The Joint Committee may examine 
any proposed rule, amendment to a rule, anc repeal of a rule for the 
purpose of determining whether the proposed rule, amendment to a 
rule, or repeal of a rule is within the statutory authority upon which it 
is based, whether the rule, amendment to a rule or repeal of a rule is 
in proper form and whether the notice was given prior to its adoption, 
amendment, or repeal and was sufficient to give adequate notice of the 
purpose and effect of the rule, amendment or repeal. In addition, the 
Joint Committee may consider whether the agency has considered 
alternatives to the rule which are consistent with the stated objectives 
of both the applicable statutes and regulations, and whether the rule is 
designed to minimize economic impact on small businesses. 

(b) If the Joint Committee objects to a proposed rule, amendment 
to a rule, or repeal of a rule, it shall certify the fact to the issuing 
agency and include with the certification a statement of its specific 
objections. 

(c) If within *J5 days after notice of proposed rulemaking has 
been received by the Joint Committee, the Joint Committee certifies its 
objections to the issuing agency then that agency shall within 90 days 
of receipt of the statement of objection: 

1. modify the proposed rule, amendment or repealer to meet the 
Joint Committee's objections; 

2. withdraw the proposed rule, amendment, or repealer in its 
entirety, or; 

3. refuse to modify or withdraw the proposed rule, amendment 
or repealer. 

(d) If an agency elects to modify a proposed rule, amendment or 
repealer to meet the Joint Committee's objections, it shall make such 
modifications as are necessary to meet the objections and shall resubmit 
the rule, amendment or repealer to the Joint Committee. In addition, 
the agency shall submit a notice of its election to modify the proposed 
rule, amendment or repealer to meet the Joint Committee's objections to 
the Secretary of State, which notice shall be published in the first 
available issue of the Illinois Register, but the agency shall not be 
required to conduct a public hearing. If the Joint Committee 



47 8 



determines that the modifications do not remedy the Joint Committee's 
objections, it shall so notify the agency in writing and shall submit a 
copy of such notification to the Secretary of State for publication in the 
next available issue of the Illinois Register. In addition, the Joint 
Committee may recommend legislative action as provided in subsection 
(g) for agency refusals. 

(e) If an agency elects to withdraw a proposed rule, amendment 
or repealer as a result of the Joint Committee's objections, it shall 
notify the Joint Committee, in writing, of its election and shall submit a 
notice of the withdrawal to the Secretary of State which shall be 
publisheo in the next available issue of the Illinois Register. 

(f) Failure of an agency to respond to the Joint Committee's 
objections to a proposed rule, amendment or repealer, within the time 
prescribed in subsection (c) shall constitute withdrawal of the proposed 
rule, amendment or repealer in its entirety. The Joint Committee shall 
submit a notice to that effect to the Secretary of State which shall be 
published in the next available issue of the Illinois Register and the 
Secretary of State shall refuse to accept for filing a certified copy of 
such proposed rule, amendment or repealer under the provisions of 
Section 6. 

(g) If an agency refuses to modify or withdraw the proposed 
rule, amendment or repealer so as to remedy an objection stated by the 
Joint Committee, it shall notify the Joint Committee in writing of its 
refusal and shall submit a notice of refusal to the Secretary of State 
which shall be published in the next available issue of the Illinois 
Register. If the Joint Committee decides to recommend legislative action 
in response to an agency refusal, then the Joint Committee shall have 
drafted and have introduced into either house of the General Assembly 
appropriate legislation to implement the recommendations of the Joint 
Committee. 

(h) No rule, amendment or repeal of a rule shall be accepted by 
the Secretary of State for filing under Section 6, if such rulemaking is 
subject to this Section, until after the agency has responded to the 
objections of the Joint Committee as provided in this Section. 

(i) The joint Committee shall evaluate and analyze all State forms 
which have been developed or revised after the effective date of this 
amendatory Act of 1984 to ascertain the burden, if any, of complying 
with such forms by small businesses. Such evaluation and analysis 
shall occur during the Joint Committee's review conducted pursuant to 
Section 7.08 of this Act. In the event the Joint Committee determines 
that any such form is unduly burdensome to small businesses the Joint 
Committee may object to such form or make specific recommendations for 
change in such form. Objections to such forms shall be made in the 
manner prescribed in Section 7.07 of this Act. For the purposes of 
this subsection the terms "state form" ana "form" shall mean any 
document or piece of paper used by a state agency requesting or 
transmitting information, printed or reproduced by whatever means, 
usually with blank spaces for the entry of additional information to be 
used in any transaction between the State of Illinois and private sector 
businesses. These include but are not limited to grant applications, 



licensing applications, permit applications, and request for proposal 
applications, but do not include books, pamphlets, newsletters and 
intra-agency forms which do not affect the rights of or procedures 
available to persons or entities outside the State agency. (Added by 
PA 80-1035, effective September 27, 1977; Amended by PA 81-1044, 
effective October 1, 1579; Amended by PA 83-1341, effective September 
7, 1984) 

Section 7.06a. JOINT COMMITTEE STATEMENT ON PROPOSED 
RULE, AMENDMENT OR REPEALER OBJECTIONABLE UNDER 
COMMITTEE'S REVIEW STANDARDS) (a) If the Joint Committee 
determines that adoption and effectiveness of a proposed rule, 
amendment or repealer or portion of a proposed rule, amendment or 
repealer by an agency would be objectionable under any of the 
standards for the Joint Committee's review specified in Sections 7.04, 
7.05, 7.06, 7.07 or 7.08 of this Act and would constitute a serious 
threat to the public interest, safety or welfare, the Joint Committee may 
at any time prior to the taking effect of such proposed rule, amendment 
or repealer issue a statement to that effect. Such statement may be 
issued by the Joint Committee only upon the affirmative vote of 
three-fifths of the members appointed to the Joint Committee. A 
certified copy of such statement shall be transmitted to the proposing 
agency and to the Secretary of State for publication in the next 
available issue of the Illinois Register. 

(b) The proposed rule, amendment or repealer or the portion of 
the proposed rule, amendment or repealer to which the Joint Committee 
has issued a statement under subsection (a) shall not be accepted for 
filing by the Secretary of State nor take effect for at least 180 days 
from receipt of the statement by the Secretary of State. The agency 
may not enforce or invoke for any reason a proposed rule, amendment 
or repealer or any portion thereof which is prohibited from being filed 
by this subsection during this 180 day period. 

(c) The Joint Committee shall, as soon as practicable after the 
issuance of a statement under subsection (a), introduce in either house 
of the General Assembly a Joint resolution stating that the General 
Assembly desires to continue the prohibition of the proposed rule, 
amendment or repealer or the portion thereof to which the statement 
was issued from being filed and taking effect. The joint resolution 
shall immediately following its first reading be placed on the calendar 
for consideration in each house of the General Assembly without 
reference to a standing committee. If such a joint resolution is passed 
by both houses of the General Assembly within the 180 day period 
provided in subsection (b), the agency shall be prohibited from filing 
the proposed rule, amendment or repealer or the portion thereof and 
the proposed rule, amendment or repealer or the portion thereof shall 
not take effect. The Secretary of State shall not accept for tiling the 
proposed rule, amendment or repealer or the portion thereof which the 
General Assembly has prohibited the agency from filing as provided in 
this subsection. If the 180 day period provided in subsection (b) 
expires prior to passage of the joint resolution, the agency may file the 
proposed rule, amendment or repealer or the portion thereof as aaopted 
and it shall take effect. (Added by PA 81-1514, effective January 1, 
1981; Amended by PA 82-372, effective September 2, 1981) 



480 



Section 7.07. EXAMINATION OF RULE BY THE JOINT COMMITTEE 
- DETERMINATION) (a) The Joint Committee may examine any rule for 
the purpose of determining whether the rule is within the statutory 
authority upon which it is baseo, and whether the rule is in proper 
form . 

(b) If the Joint Committee objects to a rule, it shall, within 5 
days of the objection, certify the fact to the adopting agency and 
include within the certification a statement of its specific objections. 

(c) Within 90 days of receipt of the certification, the agency 
shall: 

1 . Notify the Joint Committee that it has elected to amend the 
rule to meet the Joint Committee's objection; 

2. Notify the Joint Committee that it has elected to repeal the 
rule, or; 

3. Notify the Joint Committee that it refuses to amend or repeal 
the rule. 

(d) If the agency elects to amend a rule to meet the Joint 
Committee's objections, it shall notify the Joint Committee in writing and 
shall initiate rulemaking procedures for that purpose by giving notice 
as required by Section 5 of this Act. The Joint Committee shall give 
priority to rules so amended when setting its agenda. 

(e) If the agency elects to repeal a rule as a result of the Joint 
Committee objections, it shall notify the Joint Committee, in writing, of 
its election and shall initiate rulemaking procedures for that purpose by 
giving notice as required by Section 5 of this Act. 

(f) If the agency elects to amend or repeal a rule as a result of 
the Joint Committee objections, it shall complete the process within 180 
days after giving notice in the Illinois Register. 

(g) Failure of the agency to respond to the Joint Committee's 
objections to a rule within the time prescribed in subsection (c) shall 
constitute a refusal to amend or repeal the rule. 

(h) If an agency refuses to amend or repeal a rule so as to 
remedy an objection stated by the Joint Committee, it shall notify the 
Joint Committee in writing of its refusal and shall submit a notice of 
refusal to the Secretary of State which shall be published in the next 
available issue of the Illinois Register. If the Joint Committee, in 
response to an agency refusal, decides to recommend legislative action, 
then the Joint Committee shall have drafted and have introduced into 
either house of the General Assembly appropriate legislation to 
implement the recommendations of the Joint Committee. (Added by PA 
80-1035, effective September 27, 1977; Amended by PA 81-1044, 
effective October 1, 1979) 

Section 7.07a. JOINT COMMITTEE STATEMENT ON RULE ADOPTED 
UNDER SECTIONS 5.02 OR 5.03 AND DEEMED OBJECTIONABLE UNDER 
COMMITTEE'S REVIEW STANDARDS) (a) if the Joint Committee 
determines that a rule or portion of a rule adopted under Sections 5.02 



- 481 



or 5.03 of this Act is objectionable under any of the standards for the 
Joint Committee's review specified in Sections 7.04, 7.05, 7.06, 7.07, or 
7.08 of this Act and constitutes a serious threat to the public interest, 
safety or welfare, the Joint Committee may issue a statement to that 
effect. Such statement may be issued by the Joint Committee only upon 
the affirmative vote of three-fifths of the members appointed to the 
Joint Committee. A certified copy of such statement shall be 
transmitted to the affected agency and to the Secretary ol State for 
publication in the next available issue of the Illinois Register. 

(b) The effectiveness of the rule or the portion of a rule shall be 
suspended immediately for at least 180 days upon receipt of the 
certified statement by the Secretary of State. The Secretary of State 
shall indicate such suspension prominently and clearly on the face of 
the affected rule or the portion of a rule filed in the Office of the 
Secretary of State. Rules or portions of rules suspended in accordance 
with this subsection shall become effective again upon the expiration of 
180 aays from receipt of the statement by the Secretary of State if the 
General Assembly does not continue the suspension as provided in 
subsection (c). The agency may not enforce, nor invoke for any 
reason, a rule or portion of a rule which has been suspended in 
accordance with this subsection. During the 180 day period, the 
agency may not file, nor may the Secretary of State accept for filing, 
any rule having substantially the same purpose and effect as rules or 
portions of rules suspended in accordance with this subsection. 

(c) The Joint Committee shall, as soon as practicable after 
issuance of a statement under subsection (a), cause to be introduced in 
either house of the General Assembly a joint resolution stating that the 
General Assembly desires to continue the suspension of effectiveness of 
a rule or the portion of the rule to which the statement was issued. 
The joint resolution shall immediately following its first reading be 
placed on the calendar for consideration in each house of the General 
Assembly without reference to a standing committee. If such a joint 
resolution is passed by both houses of the General Assembly within the 
180 day period provided in subsection (b), the rule or the portion of 
the rule shall be considered repealed ana the Secretary of State shall 
immediately remove such rule or portion of a rule from the collection of 
effective rules. (Added by PA 81-1514, effective January 1, 1981; 
Amended by PA 82-372, effective September 2, 1S81) 

Section 7.08. PERIODIC EVALUATION OF RULES BY JOINT 
COMMITTEE - CATEGORIES) (a) The Joint Committee shall evaluate 
the rules of each agency at least once every 5 years. The Joint 
Committee, by rule shall develop a schedule for this periodic evaluation. 
In developing this schedule, the Joint Committee shall group rules by 
specified areas to assure the evaluation of similar rules at the same 
time. Such schedule shall include at least the following categories: 

1. human resources; 

2. law enforcement; 

3. energy; 

4. environment; 

5. natural resources; 

6. transportation; 



- 482 - 



7. public utilities; 

8. consumer protection; 

9. licensing laws; 

10. regulation of occupations; 

11 . labor laws; 

12. business regulation; 

13. financial institutions; and 

14. government purchasing. 

(b) Whenever evaluating any rules as required by this Section the 
Joint Committee's review shall include an examination of: 

1. organizational, structural and procedural reforms which effect 
rules or rulemaking; 

2. merger, modification, establishment or abolition of regulations; 

3. eliminating or phasing out outdated, overlapping or conflicting 
regulatory jurisdictions or requirements of general applicability; 
and 

4. economic and budgetary effects. (Added by PA 80-1035, 
effective September 27, 1977; Amended by PA 81-1035, effective 
October 1, 1979) 

Section 7.09. ADMINISTRATION OF ACT) The Joint Committee 
shall have the authority to adopt rules to administer the provisions of 
this Act relating to the Joint Committee's responsibilities, powers and 
duties. (Added by PA 80-1035, effective September 27, 1977) 

Section 7.10. REPORT OF FINDINGS, CONCLUSIONS AND 
RECOMMENDATIONS BY THE JOINT COMMITTEE) The Joint Committee 
shall report its findings, conclusions and recommendations including 
suggested legislation to the General Assembly by February 1, of each 
year. 

The requirement for reporting to the General Assembly shall be 
satisfied by filing copies of the report with the Speaker, the Minority 
Leader and the Clerk of the House of Representatives and the 
President, the Minority Leader and the Secretary of the Senate and the 
Legislative Council, as required by Section 3.1 of "An Act to revise the 
law in relation to the General Assembly", approved February 25, 1874, 
as amended, and filing such additional copies with the State Government 
Report Distribution Center for the General Assembly as is required 
under paragraph (t) of Section 7 of the State Library Act. (Added by 
PA 80-1035, effective September 27, 1977; Amended by PA 83-784, 
effective January 1, 1984) 

Section 8. PETITION FOR ADOPTION OF RULES) (a) An agency 
shall, in accordance with Section 5, adopt rules which implement 
recently enacted legislation of the General Assembly in a timely and 
expeditious manner. 

(b) Any interested person may petition an agency requesting the 
promulgation, amendment or repeal of a rule. Each agency shall 
prescribe by rule the form for petitions and the procedure for their 
submission, consideration and disposition. If, within 30 days after 
submission of a petition, the agency has not initiated rulemaking 



483 - 



proceedings In accordance with Section 5 of this Act, the petition shall 
be deemed to have been denied. (FA 79-1083; Amended by PA 83-529, 
effective January 1, 1 98^ ) 

Section 9. DECLARATORY RULINGS BY AGENCIES) Each agency 
may in its discretion provide by rule for the filing and prompt 
disposition of petitions or requests for declaratory rulings as to the 
applicability to the person presenting the petition or request of any 
statutory provision enforced by the agency or of any rule of the 
agency. Declaratory rulings shall not be appealable. The agency shall 
maintain as a public record in the agency's principal office and make 
available for public inspection and copying any such rulings. The 
agency shall delete trade secrets or other confidential information from 
the ruling prior to making it available. (PA 79-1083; Amended by PA 
82-727, effective November 12, 1981) 

Section 10. CONTESTED CASES - NOTICE - HEARING) (a) In a 
contested case, all parties shall be afforded an opportunity for hearing 
after reasonable notice. Such notice shall be served personally or by 
certified or registered mail upon such parties or their agents appointed 
to receive service of process and shall include: 

1. a statement of the time, place and nature of the hearing; 

2. a statement of the legal authority and jurisdiction under 
which the hearing is to be held; 

3. a reference to the particular Sections of the statutes and 
rules involved; and 

4. except where a more detailed statement is otherwise provided 
for by law, a short and plain statement of the matters asserted. 

(b) Opportunity shall be afforded all parties to be represented by 
legal counsel, and to respond and present evidence and argument. 

(c) Unless precluded by law, disposition may be made of any 
contested case by stipulation, agreed settlement, consent order or 
default. (PA 79-1083) 

Section 11. RECORD IN CONTESTED CASES) ia) The record in 
a contested case shall include: 

1. all pleadings (including all notices and responses thereto), 
motions and rulings; 

2. evidence received; 

3. a statement of matters officially noticed; 

4. offers of proof, objections ana rulings thereon; 

5. proposed findings and exceptions; 

6. any decision, opinion or report by the hearing examiner; 

7. all staff memoranda or data submitted to the hearing examiner 
or members of the agency in connection with their consideration of 
the case; and 

8. any communication prohibited by Section 15 of this Act, but 
such communications shall not form the basis for any finding of 
fact. 



484 



(b) Oral proceedings or any part thereof shall be recorded 
stenographically or by such other means as to adequately insure the 
preservation of such testimony or oral proceedings and shall be 
transcribed on request of any party. 

ic) Findings of fact shall be based exclusively on the evidence 
and on matters officially noticed. (PA 79-1083; Amended by PA 82-783, 
effective July 13, 1982) 

Section 12. RULES OF EVIDENCE - OFFICIAL NOTICE) In 
contested cases: (a) Irrelevant, immaterial or unduly repetitious 
evidence shall be excluded. The rules of evidence and privilege as 
applied in civil cases in the Circuit Courts of this State shall be 
followed. However, evidence not admissible under such rules of 
evidence may be admitted (except where precluded by statute) if it is 
of a type commonly relied upon by reasonably prudent men in the 
conduct of their affairs. Objections to evidentiary offers may be made 
and shall be noted in the record. Subject to these requirements, when 
a hearing will be expedited and the interests of the parties will not be 
prejudiced, any part of the evidence may be received in written form. 

(b) Subject to the evidentiary requirements of subsection (a) of 
this Section, a party may conduct cross-examination required for a full 
and fair disclosure of the facts. 

(c) Notice may be taken of matters of which the Circuit Courts of 
this State may take judicial notice. In addition, notice may be taken of 
generally recognized technical or scientific facts within the agency's 
specialized knowledge. Parties shall be notified either before or during 
the hearing, or by reference in preliminary reports or otherwise, of the 
material noticed, including any staff memoranda or data, and they shall 
be afforded an opportunity to contest the material so noticed. The 
agency's experience, technical competence and specialized knowledge 
may be utilized in the evaluation of the evidence. (PA 79-1083) 

Section 13. PROPOSAL FOR DECISION) Except where otherwise 
expressly provided by lav;, when in a contested case a majority of the 
officials of the agency who are to render the fine! decision has not 
heard the case or read the record, the decision, if adverse to a party 
to the proceeding other than the agency, shall not be made until a 
proposal for decision is served upon the parties, and an opportunity is 
afforded to each party adversely affected to file exceptions and to 
present a brief and, if the agency so permits, oral argument, to the 
agency officials who are to render the decision. The proposal for 
decision shall contain a statement of the reasons therefor and of each 
issue of fact or law necessary to the proposed decision, prepared by 
the persons who conducted the hearing or one who has read the 
record. (PA 79-1 C83) 

Section 14. DECISIONS AND ORDERS) A final decision or order 
adverse to a party (other than the agency) in a contested case shall be 
in writing or stated in the record. A final decision shall include 
findings of fact and conclusions of law, separately stated. Findings of 
fact, if set forth in statutory language, shall be accompanied by a 
concise and explicit statement of the underlying facts supporting the 



- 48! 



findings. If, in accordance with agency rules, a party submitted 
proposed findings of fact, the decision shall include a ruling upon each 
proposed finding. Parties or their agents appointed to receive service 
of process shall be notified either personally or by registered or 
certified mail of any decision or order. Upon request, a copy of the 
decision or order shall be delivered or mailed forthwith to each party 
and to his attorney of record. 

A decision by any agency in a contested case under this Act shall 
be void unless the proceedings are conducted in compliance with the 
provisions of this Act relating to contested cases except to the extent 
such provisions are waived pursuant to Section 18 of this Act and 
except to the extent the agency has adopted its own rules for contested 
cases as authorized in Section 2 of this Act. I PA 79-1083; Amended by 
PA 80-1035, effective September 27, 1977) 

Section 14.1 EXPENSES - ATTORNEY FEES) (a) In any 
contested case initiated by any agency which does not proceed to court 
for judicial review and on any issue where a court does not have 
jurisdiction to make an award of litigation expenses under Section 
42.611 of the Civil Practice Law, any allegation made by the agency 
without reasonable cause and found to be untrue shall subject the 
agency making such allegation to the payment of the reasonable 
expenses, including reasonable attorney's fees, actually incurred in 
defending against that allegation by the party against whom the case 
was initiated. 

The claimant shall make his demand for such expenses to the 
agency. If the claimant is dissatisfied because of the agency's failure 
to make any award or because of the insufficiency of the agency's 
award, the claimant may petition the Court of Claims for the amount 
deemed owed. If allowed any recovery by the Court of Claims, the 
claimant shall also be entitled to reasonable attorney's fees and the 
reasonable expenses incurred in making his claim for the expenses 
incurred in the administrative action. 

lb) In any case in which a party has any administrative rule 
invalidated by a court for any reason, including but not limited to the 
agency's exceeding its statutory authority or the agency's failure to 
follow statutory procedures in the adoption of the rule, the court shall 
award the party bringing the action the reasonable expenses of the 
litigation, including reasonable attorney's fees. (Added by PA 82-670, 
effective January 1, 1982; Amended by PA 82-1057, effective February 
11 , 1983) 

Section 15. EX PARTE CONSULTATIONS) Except in the 
disposition of matters which they are authorized by lav; to entertain or 
dispose of on an ex parte basis, neither agency members, employees 
nor hearing examiners shall, after notice of hearing in a contested case 
or licensing to which the procedures of a contested case apply under 
this Act, communicate, directly or indirectly, in connection with any 
issue of fact, with any person or party, or in connection with any 
other issue with any party or his representative, except upon notice 
and opportunity for all parties to participate. However, an agency 
member may communicate with other members of the agency, and an 



- 486 - 



agency member or hearing examiner may have the aid and advice of one 
or more personal assistants. (PA 79-1083; Amended by PA 80-1035, 
effective September 27, 1977) 

Section 16. LICENSES) (a) V.'hen any licensing is required by 
law to be preceded by notice and opportunity for hearing, the 
provisions of this Act concerning contested cases shall apply. 

(b) When a licensee has made timely and sufficient application for 
the renewal of a license or a new license with reference to any activity 
of a continuing nature, the existing license shall continue in full force 
and effect until the final agency decision on the application has been 
made unless a later date is fixed by order of a reviewing court. 

(c) No agency shall revoke, suspend, annul, withdraw, amend 
materially, or refuse to renew any valid license without first giving 
written notice to the licensee of the facts or conduct upon which the 
agency will rely to support its proposed action, and an opportunity for 
hearing in accordance with the provisions of this Act concerning 
contested cases. At any such hearing, the licensee shall have the 
right to show compliance with all lawful requirements for the retention, 
or continuation or renewal of the license. If, however, the agency 
finds that the public interest, safety or welfare imperatively requires 
emergency action, and if the agency incorporates a finding to that 
effect in its order, summary suspension of a license may be ordered 
pending proceedings for revocation or other action which proceedings 
shall be promptly instituted and determined. 

Any application for renewal of a license which contains required 
and relevant information, data, material or circumstances which were 
not contained in an application for the existing license, shall be subject 
to the provisions of Section 16(a) of this Act. (PA 79-1083; Amended 
by PA 80-1035, effective September 27, 1977) 

Section 17. RATE-MAKING) Every agency which is empowered by 
law to engage in rate-making activities shall establish by rule, not 
inconsistent with the provisions of law establishing such rate-making 
jurisdiction, the practice and procedure to be followed in rate-making 
activities before such agency. (PA 79-1083) 

Section 18. WAIVER) Compliance with any or all of the provisions 
of this Act concerning contested cases may be waived by written 
stipulation of all parties. (PA 79-1083) 

Section 19. (PA 79-1083; Repealed as of January 1, 1978, by PA 
80-1035, effective September 27, 1977) 

Section 20. SEVERABILITY) If any provision of this Act or the 
application thereof to any person or circumstance is held invalid, the 
invalidity shall not affect other provisions or applications of the Act 
which can be given effect without the invalid provision or application, 
and for this purpose the provisions of this Act are severable. (PA 
79-1C83) 



487 - 



Section 21. EFFECTIVE DATEJ This Act takes effect upon Its 
becoming a law. (PA 79-1083, effective September 22, 1975) 



The ActrAct 



Printed by authority of the State of Illinois 
Legislative Printing Unit Order 2123 
# qo • ..Q.p iU A P rl1 1986 - 200 copies 

5-07 
CC _ i|88 - 



*CM'