(navigation image)
Home American Libraries | Canadian Libraries | Universal Library | Community Texts | Project Gutenberg | Biodiversity Heritage Library | Children's Library | Additional Collections
Search: Advanced Search
Anonymous User (login or join us)
Upload
See other formats

Full text of "The Biological bulletin"

. 



February 2004 



THE 



Volume 206 Number 1 



BIOLOGICAL 
BULLETIN 










Marine Biological Laboratory 



iolbull.org 




THE BIOLOGICAL BULLETIN 



ONLINE 



The Marine Biological Laboratory is pleased beginning with the October 1976 issue 

to announce that the full text of The Biological (Volume 151, Number 2), and some Tables of 

Bulletin is available online at Contents are online beginning with the 

October 1965 issue (Volume 129, Number 2). 



http://www.biolbull.org 

The Biological Bulletin publishes outstanding 
experimental research on the lull range 
of biological topics and organisms, from the 
fields of Neurobiology, Behavior, Physiology, 
Ecology, Evolution, Development and 
Reproduction, Cell Biology, Biomechanics, 
Symbiosis, and Systematic^. 

Published since 1897 by the Marine 
Biological Laboratory (MBL) in Woods Hole, 
Massachusetts, The Biological Bulletin is one 
of America's oldest peer-reviewed scientific 
journals. 

The journal is aimed at a general readership, 
and especially invites articles about those 
novel phenomena and contexts characteristic 
of intersecting fields. 

The Biological Bulletin Online contains the 
lull content of each issue of the journal, 
including all figures and tables, beginning 
with i he February 2001 issue (Volume 200, 
Number 1 ). The lull text is scan liable by 
keyword, and the died references include 
hyperlinks to Medline. PDF files are available 
beginning in February I 990 (Volume 178, 
Number I ), some abstracts are available 



Each issue will be placed online 
approximately on the date it is mailed to 
subscribers; therefore the online site will be 
available prior to receipt of your paper copy. 
Online readers may want to sign up for the 
eTOC (electronic Table of Contents) service, 
which will deliver each new issue's, table of 
contents via e-mail. The web site also 
provides access to information about the 
journal (such as Instructions to Authors, the 
Editorial Board, and subscription 
information), as well as access to the Marine 
Biological Laboratory's web site and other 
Biological Bulletin electronic publications. 

The free trial period for access to The 
Biological Bulletin online has ended. 
Individuals and institutions who are 
subscribers to the journal in print or are 
members of the Marine Biological 
Laboratory Corporation may now activate 
their online subscriptions. All other access 
(e.g., to Abstracts, eTOCs, searching, 
Instructions to Authors) remains freely 
available. Online access is included in the 
print subscription price. 

For more information about subscribing or 
activating your online subscription, visit 
<www.biolbull.org/subscriptions>. 



http://www.biolbull.org 



THING 




ELECTROPHYSIOLOGY 

RESEARCH 

MICROSCOPE. 



like the Olympus 8X5 1WI. 

The results are superb 

orecence and DIG 

pabilities under the 
challenging conditions of 
thick brain slice observation. 

'lympus offers the most 
emarkable line of water 
immersion objectives. With the 
XLUMPFL 20x objective 
/NA 0.95 and WD 2.0mm) 

id a magnification changer, 



low and high magnifications. 

Highly efficient wide-field 
fluorescence is at hand with the 
low-power XLFLUOR 4x/NA 
0.28 or 2x/NA 0. 1 4 objectives. 
Those objectives make GFP 
imaging of large fields easy 
and effective. 

Olympus also offers 
an extensive line of dipping 
objectives that feature long 
working distances and large 
approach angles of over 40 
for manipulator access. 

The BX5 1 Wl provides excellent 
working conditions for in vivo 
brain slice IR-DIC application 
with an optical system tailored 
h-contrast, high-resolution 



ROCKET SCIENCE". 










OLYMPI 



Cover 



Most echinoderms are dioecious, but the sexes are 
usually indistinguishable on the basis of external 
structure. A very few species of brittle stars are. 
however, strikingly dimorphic, with a dwarf male 
clinging to a much larger female, usually mouth-to- 
mouth. Although this romantic posture suggests a 
role in reproduction, spawning has not previously 
been observed in these species. However, in this 
issue of The Biological Bulletin (p. 25) Hideyuki 
Tominaga and his colleagues describe the reproduc- 
tion and development from spawning to metamor- 
phosis of a dimorphic brittle star, Ophiodaphne 
formula. And they report further that these brittle 
stars, both couples and singles, have adopted a close 
living arrangement with sand dollars. 

The upper portion of the cover shows an enlarged 
image of two brittle stars, coupled, and with their 
oral surfaces appressed. Her central disk is about 5 
mm in diameter, his only 1 mm; and his arms are 
interdigitated with hers. At a much lower magnifi- 
cation (bottom left panel), we see this couple re- 
clining on a host sand dollar, close to one of its five 
lunules. The female's aboral surface is fixed to the 
spiny oral surface of the sand dollar, and two of her 
arms are hooked over the edge of the lunule. A 
specimen of the host sand dollar from this study 
(/l.v/nV/y/x'M.s nuiiini: diameter, about 14 cm) is 
shown in the lower right corner of the cover. But <). 
joniiata is not host-specilic: two other species of 
sand dollars have been reported to accommodate 
this brittle star. Notice also that the figured speci- 



men of A. nuiniii bears two unpaired female brittle 
stars on its oral surface near the lunules at 10 and 
12 o'clock; thus, all O. fornuitci are found on sand 
dollars, but only about half of the brittle stars are 
paired. 

The sand dollars live in relatively shallow waters, 
partially buried in the sandy bottom. Thus, they 
provide the brittle stars with a ready, stable site of 
attachment on a shifting substrate: and the lunule 
protects against abrasion by the sand, which is the 
source of food for both organisms. At spawning, the 
gametes of brittle stars are released from bursal slits 
on the oral surface of the disk. The mouth-to-mouth 
posture brings those openings of the coupled male 
and female close together, maximizing the effi- 
ciency of fertilization. This is critical, because the 
population of brittle stars is sparse (only one of ten 
sand dollars is inhabited), and because these small 
animals produce a limited number of eggs. These 
relatively small eggs develop indirectly; but the 
time in development to metamorphosis is rapid, 
which minimizes transport of the brittle star larvae 
away from the habitat of the host sand dollars. 
Thus, Tominaga and colleagues suggest that the 
sexual dimorphism, the coupling behavior, and the 
characteristics of development all seem to be adap- 
tations enabling a sparse population of brittle stars 
to survive on the sandy bottom of shallow seas. 

The photographs on the cover were taken by 
Hideyuki Tominaga (Toyama University), and the 
cover was designed by Beth Liles (Marine Biolog- 
ical Laboratory. Woods Hole. Massachusetts). 



THE 



BIOLOGICAL BULLETIN 

FEBRUARY 2004 



Editor 
Associate Editors 



Section Editor 
Online Editors 



Editorial Board 



Editorial Office 



MICHAEL J. GREENBERG 

Louis E. BURNETT 
R. ANDREW CAMERON 
CHARLES D. DERBY 
MICHAEL LABARBERA 



The Whitney Laboratory, University of Florida 

Grice Marine Laboratory, College of Charleston 
California Institute of Technology 
Georgia State University 
University of Chicago 



SHINYA INOUE, Imaging and Microscopv Marine Biological Laboratory 

ENSR Marine & Coastal Center. Woods Hole 
Hunter College. City University of New York 



JAMES A. BLAKE, Keys to Marine 
Invertebrates of the Woods Hole 
WILLIAM D. COHEN, Marine Models 
Electronic Record and Compendia 



PETER B. ARMSTRONG 
JOAN CERDA 
ERNEST S. CHANG 
THOMAS H. DIETZ 
RICHARD B. EMLET 
DAVID EPEL 

KENNETH M. HALANYCH 
GREGORY HINKLE 
NANCY KNOWLTON 
MAKOTO KOBAYASHI 
ESTHER M. LEISE 
DONAL T. MANAHAN 
MARGARET McFALL-NcAi 
MARK W. MILLER 
TATSUO MOTOKAWA 
YOSHITAKA NAGAHAMA 
SHERRY D. PAINTER 
J. HERBERT WAITE 
PHIL YUND 
RICHARD K. ZIMMER 

PAMELA CLAPP HINKLE 
VICTORIA R. GIBSON 
CAROL SCHACHINGER 
WENDY CHILD 



University of California, Davis 

Center of Aquaculture-IRTA, Spain 

Bodega Marine Lab., University of California, Davis 

Louisiana State University 

Oregon Institute of Marine Biology, Univ. of Oregon 

Hopkins Marine Station, Stanford University 

Auburn University. Alabama 

Dana Farber Cancer Institute, Boston 

Scripps Inst. Oceanography & Smithsonian Tropical Res. Inst. 

Hiroshima University of Economics, Japan 

University of North Carolina Greensboro 

University of Southern California 

Kewalo Marine Laboratory. University of Hawaii 

Institute of Neurobiology, University of Puerto Rico 

Tokyo Institute of Technology. Japan 

National Institute for Basic Biology, Japan 

Marine Biomed. Inst., Univ. of Texas Medical Branch 

University of California, Santa Barbara 

University of New England, Biddeford, ME 

University of California. Los Angeles 

Managing Editor 

Staff Editor 

Editorial Associate 

Subscription & Advertising Administrator 



Published by 

MARINE BIOLOGICAL LABORATORY 
WOODS HOLE, MASSACHUSETTS 



http://www.biolbull.org 





V/ood; Hole On 

FEB 2 3 2004 






CONTENTS 



VOLUMH 206. No. 1: FEBRUARY 2004 



RESEARCH NOTE 

Buresch, Kendra C., Jean G. Boal, Gregg T. Nagle, 
Jamie Knowles, Robert Nobuhara, Kate Sweeney, and 
Roger T. Hanlon 

Experimental evidence that ovarv and oviducal gland 
extracts influence male agonistic behavior in squids. 

PHYSIOLOGY AND BIOMECHANICS 

Motokawa, Tatsuo, Osamu Shintani, and Riidiger Bi- 
renheide 

Contraction and stiffness changes in collagenous aim 
ligaments of the stalked crinoid Melanin in niliiinlns 
(Echinodermata) 

NEUROBIOLOGY AND BEHAVIOR 

Biggers, William J.. and Hans Laufer 

Identification <>t juvenile hormone-active alkvlphe- 
nols in the lobster Homarus ameiicaniis and in marine 
sediments 



13 



DEVELOPMENT AND REPRODUCTION 

Tominaga, Hideyuki, Shogo Nakamura, and Mieko 
Komatsu 

Reproduction and development ol the conspicuously 
dimorphic brittle star O/iliiiifln/iline formata (Ophiu- 

roidea) 25 

Temkin, M. H., and S. B. Bortolami 

Waveform dvnamics ol spcrmatozeugmata during 
the transfer from paternal to maternal individuals of 
Membranipora iiiniilntii/iiii'fi 35 



ECOLOGY AND EVOLUTION 

Wang, Yongping, Zhe Xu, and Ximing Guo 

Differences in the rDNA-bearing chromosome divide 
the Asian-Pacific and Atlantic species of Crassostrea 

(Bivalvia, Mollusca) -K> 

Maruyama, Yoshihiko K. 

Occurrence in the field of a long-term, year-round, 
stable population of placozoans 55 



THE BIOLOGICAL BULLETIN 

Tm: BIOLOGICAL Bi LLETIN is published six times a year by the Marine Biological Laboratory, 7 MBL Street, 
Woods Hole. Massachusetts 02543. 

Subscriptions and similar matter should be addressed to Subscription Administrator. THH BIOLOGICAL 
BULLETIN. Marine Biological Laboratory. 7 MBL Street. Woods Hole. Massachusetts 02543. Subscription 
includes both print and online journals. Subscription per year (six issues, two volumes): $325 for libraries; $120 
for individuals. Subscription per volume (three issues): $165 for libraries: $70 for individuals. Back and single 
issues (subject to availability I: S75 for libraries: $25 for individuals. 

Communications relative to manuscripts should he sent to Michael J. Greenberg. Editor-in-Chief, or Pamela 
Clapp Hinkle. Managing Editor, at the Marine Biological Laboratory. 7 MBL Street. Woods Hole. Massachusetts 
02543. Telephone: (50S) 2S9-7I49. FAX: 50X-289-7922. E-mail: pclapp@mbl.edu. 



http://www.biolbull.org 

THE BIOLOGICAL BULLETIN is indexed in bibliographic services including Index Medicus and MED- 
LINE, Chemical Abstracts, Current Contents. Elsevier BIOBASE/Current Awareness in Biological 
Sciences, and Geo Abstracts. 

Printed on acid free paper, 
effective with Volume 180, Issue 1, 1991. 



POSTMASTER: Send address changes to THE BIOLOGICAL BULLETIN, Marine Biological Laboratory, 

7 MBL Street, Woods Hole, MA 02543. 

Copyright 2004, by the Marine Biological Laboratory 

Periodicals postage paid at Woods Hole, MA, and additional mailing offices. 

ISSN 0006-3185 



INSTRUCTIONS TO AUTHORS 



The Biological Bulletin accepts outstanding original research 
reports of general interest to biologists throughout the world. 
Papers are usually of intermediate length (10 K) manuscript 
pages). A limited number of solicited review papers may be 
accepted after formal re\iev\. A paper will usually appear within 
four months after its acceptance. 

Very short, especially topical papers (less than 4 manuscript 
pages including tables, ligures. and bibliography) will he published 
in a separate section entitled "Research Notes." A Research Note 
in Tlif Hiolnffieiil Bulletin follows the format of similar notes in 
Nature. It should open with a summary paragraph of 1 5(1 to 200 
words comprising the introduction and the conclusions. The rest of 
the text should continue on without subheadings, and there should 
be no more than 30 references. References should be referred to in 
(he text by number, and listed in the Literature Cited section in the 
order that they appear in the text. Unlike references in Nature. 
lelercnces in the Research Notes section should conform in 
punctu.iih'ii ,in.l arrangement to the st\le of recent issues of The 
Hiolnifienl liulletin. Materials and Methods should be incorpo- 
rated into appropriate ligure legends See the article by Lee 
(October 2003. Vol. 2115: 99 I'll) for sample Style. AReseaich 
Note will usually appear w ithin two months after its acceptance. 

The Editorial Board requests that regular manuscripts con- 
form to the requirements set below; those manuscripts that do 
nut conform will he returned to authors lor correction before 
te\ lew 



1. Manuscripts. Manuscripts, including figures, should be 
submitted in quadruplicate, with the originals clearly marked. 
(Xerox copies of photographs are not acceptable for review pur- 
poses.) Please include an electronic copy of the text of the manu- 
script. Label the disk w ith the name of the first author and the name 
and \ersion of the wordprocessing software used to create the hie. 
If the file was not created in some version of Microsoft Word, save 
the text in rich text format (rtf). The submission letter accompa- 
nying the manuscript should include a telephone number, a FAX 
number, and (if possible) an E-mail address for the corresponding 
author. The original manuscript must be typed in no smaller than 
12 pitch or 10 point, using double spacing (inclialini; figure leg- 
ends, footnotes, bibliography, etc.) on one side of Id- or 20-lb. 
bond paper. 8 by 11 inches. Please, no right justification. Manu- 
scripts should be proofread carefully and errors corrected legibly 
in black ink. Pages should he numbered consecutively. Margins on 
all sales should be at least I inch (2.5 cm). Manuscripts should 
conform to the Council <>/ Bioli>i;\ Editors St\le Manual. 5th 
Edition (Council of Biology Editors. 198.3) and to American spell- 
ing. Unusual abbreviations should be kept to a minimum and 
should be spelled out on lirst reference as well as defined in a 
footnote on the title page. Manuscripts should he divided into the 
following components: Title page. Abstract (of no more than 200 
words I. Introduction. Materials and Methods, Results. Discussion. 
Acknowledgments. Literature Cited. Tables, and Figure Legends. 
In addition, authors should supply a list of words and phrases 
under which the article should be indexed. 



2. Title pane. The title page consists of a condensed title or 
running head of no more than 35 letters and spaces, the manuscript 
title, authors' names and appropriate addresses, and footnotes 
listing present addresses, acknowledgments or contribution num- 
bers, and explanation of unusual abbreviations. 

3. Figures. The dimensions of the printed page, 7 by 9 
inches, should be kept in mind in preparing figures for publication. 
We recommend that figures be about 1 times the linear dimensions 
of the final printing desired, and that the ratio of the largest to the 
smallest letter or number and of the thickest to the thinnest line not 
exceed 1:1.5. Explanatory matter generally should be included in 
legends, although axes should always be identified on the illustra- 
tion itself. Figures should be prepared for reproduction as either 
line cuts or halftones. Figures to be reproduced us line cuts should 
be unmounted glossy photographic reproductions or drawn in 
black ink on white paper, good-quality tracing cloth or plastic, or 
blue-lined coordinate paper. Those to be reproduced as halftones 
should be mounted on board, with both designating numbers or 
letters and scale bars affixed directly to the figures. All figures 
should be numbered in consecutive order, with no distinction 
between text and plate figures and cited, in order, in the text. The 
author's name and an arrow indicating orientation should appear 
on the reverse side of all figures. 

Digital an: The Biological Bulletin will accept figures sub- 
mitted in electronic form; however, digital art must conform to the 
following guidelines. Authors who create digital images are 
wholly responsible for the quality of their material, including color 
and halftone accuracy. 

Format. Acceptable graphic formats are TIFF and EPS. Color 
submissions must be in EPS format, saved in CMKY mode. 

Software. Preferred software is Adobe Illustrator or Adobe 
Photoshop for the Mac and Adobe Photoshop for Windows. Spe- 
cific instructions for artwork created with various software pro- 
grams are available on the Web at the Digital Art Information Site 
maintained by Cadmus Professional Communications at http:// 
cpc.cadmus.com/da/ 

Resolution. The minimum requirements for resolution are 
1200 DPI for line art and 300 lor halftones. 

Size. All digital artwork must be submitted at its actual 
printed size so that no scaling is necessary. 

Multipanel figures. Figures consisting of individual parts 
(e.g.. panels A. B. C) must be assembled into final format and 
submitted as one file. 

Hani cop\: Files must be accompanied by hard copy for use 
in case the electronic version is unusable. 

Disk identification. Disks must be clearly labeled with the 
following information: author name and manuscript number; for- 
mat (PC or Macintosh I: name and version of software used. 

Color: The Biological Bulletin will publish color figures and 
plates, but must bill authors for the actual additional cost of 
printing in color. The process is expensive, so authors with more 
than one color image should consistent with editorial concerns, 
especially citation of figures in order combine them into a single 
plate to reduce the expense. On request, when supplied with a copy 
of a color illustration, the editorial staff will provide a pre-publi- 
cation estimate of the printing cost. 

4. Tables, footnotes, figure legends, etc. Authors should 
follow the style in a recent issue of The Biological Bulletin in 



preparing table headings, figure legends, and the like. Because ol 
the high cost of setting tabular material in type, authors are asked 
to limit such material as much as possible. Tables, with their 
headings and footnotes, should be typed on separate sheets, num- 
bered with consecutive Arabic numerals, and placed after the 
Literature Cited. Figure legends should contain enough informa- 
tion to make the figure intelligible separate from the text. Legends 
should be typed double spaced, with consecutive Arabic numbers, 
on a separate sheet at the end of the paper. Footnotes should be 
limited to authors' current addresses, acknowledgments or contri- 
bution numbers, and explanation of unusual abbreviations. All 
such footnotes should appear on the title page. Footnotes are not 
normally permitted in the body of the text. 

5. Literature cited. In the text, literature should be cited by 
the Harvard system, with papers by more than two authors cited as 
Jones et al.. 1980. Personal communications and material in prep- 
aration or in press should be cited in the text only, with author's 
initials and institutions, unless the material has been formally 
accepted and a volume number can be supplied. The list of 
references following the text should be headed Literature Cited, 
and must be typed double spaced on separate pages, conforming in 
punctuation and arrangement to the style of recent issues of The 
Biological Bulletin. Citations should include complete titles and 
inclusive pagination. Journal abbreviations should normally follow 
those of the U. S. A. Standards Institute (USASI). as adopted by 
BIOLOGICAL ABSTRACTS and CHEMICAL ABSTRACTS, with the minor 
differences set out below. The most generally useful list of bio- 
logical journal titles is that published each year by BIOLOGICAL 
ABSTRACTS (BIOSIS List of Serials: the most recent issue). Foreign 
authors, and others who are accustomed to using THE WORLD LIST 
OF SCIENTIFIC PERIODICALS, may find a booklet published by the 
Biological Council of the U.K. (obtainable from the Institute of 
Biology. 41 Queen's Gate, London. S.W.7. England. U.K.) useful, 
since it sets out the WORLD LIST abbreviations for most biological 
journals with notes of the USASI abbreviations where these differ. 
CHEMICAL ABSTRACTS publishes quarterly supplements of addi- 
tional abbreviations. The following points of reference style for 
Tin. BIOLOGICAL BULLETIN differ from USASI (or modified WORLD 
LIST) usage: 

A. Journal abbreviations, and book titles, all underlined (for 
italics) 

B. All components of abbreviations with initial capitals (not 
as European usage in WORLD LIST e.g.. J. Cell. Coinp. Physio/. 
NOT J. cell. comp. Physiol. ) 

C. All abbreviated components must be followed by a period, 
whole word components must not (i.e.. J. Cancer Res.) 

D. Space between all components (e.g.. J. Cell. Comp. 
Ph\siol.. not J.Cell.Comp.Physiol.) 

E. LInusual words in journal titles should be spelled out in 
full, rather than employing new abbreviations invented bv the 
author. For example, use Rn \'i^iihlalic/iig\ l^lcntlinga without 
abbreviation. 

F. All single word journal titles in lull (e.g.. \'eliger. /.>/- 
og\; Brain). 



G. The order of abbreviated components should be the same 
as the word order of the complete title (i.e.. Proc. and Trans. 
placed where they appear, not transposed as in some BIOLOGICAL 
ABSTRACTS listings). 

H. A few well-known international journals in their preferred 
forms rather than WORLD LIST or USAS1 usage (e.g.. Nature, 
Science, Evolution NOT Nature, Lmiil., Science. N.Y.: Evolution, 
Lancaster, I'n. I 

6. Sequences. By the time a paper is sent to the press, all 
nucleotide or amino acid sequences and associated alignments 
should have been deposited in a generally accessible database 



(e.g.. GenBank. EMBL, SwissProt). and the sequence accession 
number should be provided. 

7. Reprint*, page proofs, and charges. Authors may pur- 
chase reprints in lots of 100. Forms for placing reprint orders are 
sent with page proofs. Reprints normally will be delivered about 2 
to 3 months after the issue date. Authors w ill receive page proofs 
of articles shortly before publication. They will be charged the 
current cost of printers' time for corrections to these (other than 
corrections of printers' or editors' errors ). Other than these charges 
for authors' alterations. The Biological Bulletin does not have 
page charges. 



Reference: B/W. Bull. 206: 1-3. (February 20(14) 
2004 Marine Biological Laboratory 



Experimental Evidence That Ovary and Oviducal 
Gland Extracts Influence Male Agonistic Behavior 

in Squids 



KENDRA C. BURESCH 1 . JEAN G. BOAL 2 . GREGG T. NAGLE\ JAMIE KNOWLES 1 . 
ROBERT NOBUHARA', KATE SWEENEY 1 , AND ROGER T. HANLON 1 * 

1 Marine Resources Center, Marine Biological Laboratory, Woods Hole, Massachusetts 02543-1015: 
Department of ' Biolog\, Millersville University of Pennsylvania, Millersville, Pennsylvania 17551-0302: 
and 3 Marine Biomedia.il Institute and Department of Anatomy ami Neurosciences, University of Texas 

Medical Branch. Galveston, Texas 77555- 1 t*6V 



Recent investigations of sensory and behavioral cites that 
initiate sexual selection processes in the squid Loligo pealeii 
have determined that egg capsules deposited on the sub- 
strate provide a strong visual and chemotactile stimulus to 
males, even in the absence of females fl. 2. 3>. The visual 
stimulus of egg capsules attracts males to the eggs, and 
when the males touch the eggs, thev encounter a chemical 
stimulus that leads to highly aggressive fighting behavior. 
We have recently demonstrated that egg capsule extracts 
implanted in artificial egg capsides elicit this aggressive 
behavior 14). In this communication, we present evidence 
that the salient chemical factor originates in the ovary and 
perhaps the oviducal gland of the female reproductive tract. 

Cephalopods are highly visual animals, yet recent re- 
search has shown that chemical communication plays an 
important role in regulating some behaviors (5). It has long 
been known (6) that Loligo pealeii is attracted visually to 
egg capsules (each translucent egg capsule is about 4 cm 
long and contains 100-300 eggs) and that females fre- 
quently lay egg capsules adjacent to existing egg capsules 
(7. 8). A fortuitous field observation indicated that males are 
visually attracted by egg capsules, but that touching the eggs 
was essential to evoke the intra-male competition for mates 
( 1 ). Thus it appears that both visual and chemical commu- 
nication play a role in triggering a change from shoaling 
behavior to mating behavior when L. pealeii migrates in- 
shore to spawn in spring. Our ultimate goal is to identify and 



Received X August 2003: accepted 25 November 2(103. 
* To whom correspondence should be addressed. E-mail: rhanlon 
mbl.edu 



characterize the compound (or compounds) that elicits this 
highly aggressive behavior in male squids. 

Behavioral responses to natural eggs were compared with 
responses to artificial egg capsules coated with extracts (4) 
from one of four female reproductive organs or glands: 
ovary, oviducal gland, nidamental gland, or accessory nida- 
mental gland. With the exception of ovary (see below), the 
equivalent of one-fifth of each gland was used to coat the 
artificial egg capsules. Six behaviors were selected to assess 
the level of aggression because they were conspicuous, easy 
to score, and reliable between observers. The general se- 
quence of increased aggression in loliginid squids (9. 10), as 
shown by five of these behaviors, can be depicted as fol- 
lows: 

Raised arm > Fin-beating Chase 

> Forward Lunge Grab (FLG) > Grapple 

The sixth behavior. Splayed arms, is associated with de- 
fense of eggs or females and was also recorded. The fre- 
quency of any one of these six discrete behaviors was 
relatively low; consequently, the variable Total Aggression 
was computed as the sum of all occurrences of any of the six 
behaviors. 

All experiments were conducted between May and Au- 
gust 2002. Squids were caught in Vineyard Sound (Fal- 
mouth. MA) using trawls or jigs. Reproductive organs were 
collected from 16 females. Each whole organ (except ovary, 
which was subsampled due to its large size) was indixidu- 
ally extracted, centrifuged, and purified using separate CIS 
Sep-Pak cartridges (Waters Corp., Milford. MA) as do 



K C. BURESCH ET AL 

Table 1 

Mean nninhi'i <>/ hi-liavim s rei unU'J Juniix the Ill-inin rritil />crii>J for ctich c'.v.i; Minni/us 







Egg 


Raised 


Fin- 


# 






Splayed 


Total 


Egg stimulus 


;;, 


touch 


arm 


beating 


Chases 


FLO** 


Grapple 


arms 


aggr.t 


Natural 


7 


2.71 


3.24 


1 1)0 


12.24 


9.X6 


(.29 


3.86 


31 57 


Ovarj 


10 


3.30 


2.20 


0.70 


5.70 


0.60 


0.60 


3.40 


13.20 


( hidncal 


11 


5.18 


0.27 


0.55 


7.64 


2.91 


0.18 


1.27 


12.82 


Nidamental accessm) 


10 


1.90 


0.30 


0.10 


1.30 


0.70 


0.00 


O.SO 


3.20 


Nidamental 


10 


3.00 


0.30 


0.10 


1.30 


050 


0.20 


1.10 


3.50 



:: n [n is the number of squid pairs tested. 

I I.G is the behavior Forward-Lunge-Grah. 
v Total Aggression is the sum of all instances of Raised arm. Fin-beating. Chase. FLG, Grapple, ami Splayed arms. 



scribed previously (4); CIS Sep-Paks bind small molecules, 
peptidcs. aod small proteins. 

Behavioral trials were conducted in round tanks with 
aerated, flow-through natural seawater. Trials were con- 
ducted according to the following protocol. A pair of squids 
was placed in the trial tank and allowed 30 min to reach 
baseline behavior (i.e., agonistic interactions resulted in one 
squid becoming dominant and occupying the center of the 
tank, and both squids being calm and showing normal 
coloration). In the pre-test. a bundle of 16-20 natural egg 
capsules was added to the tank. Data collection began when 
one of the squids touched the egg capsules. Previous exper- 
iments demonstrated that uncoated artificial eggs elicited 
significantly fewer egg touches than either coated artificial 
eggs or natural eggs (Friedman two-way ANOVA by ranks; 
F, -- 7.43. n = 14: P < 0.05). Not all squids were 
attracted to natural eggs; pairs in which neither squid 
touched the eggs were removed from the experiment. In- 
stances of five of the six discrete behaviors (Raised arm. 
Fin-beating. Forward-Lunge-Grab (FLG), Grapple, Splayed 
arms) were recorded continuously for 10 min. Chase was 
frequent and continuous; consequently it was recorded at 
1 5-s intervals. Squids that did not respond aggressively (i.e., 
touched eggs but stayed at baseline behavior resting or 
calm swimming) during the pre-test were excluded from 
further experiments. After a minimum of I h to regain 
baseline behavior, experimental trials commenced. The 
mean time to return to baseline behavior after being exposed 
lu an egg stimulus was determined previously to be 7.9 min 
(range 1-40 min; n = II). The egg stimulus (natural egg 
capsules or artificial egg capsules) was added lo the tank 
and behaviors were scored as before. 

\\'c expected to examine the differences in responses of 
squills (experimental trial response minus pre-test response) 
lo control for variation in u-spoiises between squids; how- 
ever, the variances in the calculated differences were higher 
than the variances of responses lor either pre-test trials or 
experimental trials (c.,i;.. the variances for total aggression 
with real eggs were pre-tesl. i')S; experimental trials. }(>'); 



differences. 692; H = : 7). Consequently, only data from 
experimental trials were analyzed further. A Kruskal-Wallis 
analysis of variance by ranks (data were unitless and not 
normally distributed) was performed to determine which 
female reproductive organ elicited an agonistic response 
comparable to natural eggs. Multiple comparisons of treat- 
ments with the control were then performed. Note that 
statistical significance indicates that a treatment was not as 
effective as real eggs. 

A total of 54 Raised arms. 22 Fin-beatings. 253 Chases. 
1 19 FLGs, 19 Grapples, and 94 Splayed arms were recorded 
throughout the experiment (n = 48 pairs; means are listed 
in Table I ). Aggressive behavior ("Total Aggression" in 
Table 1 ) differed significantly between egg stimuli l^ 2 
15.5. df = 4. P < 0.01 ). Squids responded with the most 
aggression in response to natural eggs and with the least 
aggression in response to extracts from nidamental and 
accessory nidamental glands. Comparisons (11) of treat- 
ments versus the control (i.e.. natural eggs) revealed that 
aggressive responses to extracts from nidamental and ac- 
cessory nidamental glands were significantly lower than 
responses to natural eggs. If we assume that more egg 
touches provide a greater stimulus for aggression, then it is 
reasonable to consider the aggression observed per egg 
touch. In this case, aggressive behavior again differed sig- 
nificantly between egg stimuli (,Y 2 - 12.72. df == 4. P < 
0.05); however, comparisons (11) of treatments versus the 
control (i.e., natural eggs) show that only extracts from 
ovaries elicited aggression statistically indistinguishable 
from that of real eggs (Fig. 1 ). 

These results indicate (hat a chemical factor that induces 
agonistic interactions is produced in the ovary, and perhaps 
also in the oviducal gland, but not in the nidamental or 
accessory nidamental glands. The reversible binding of the 
chemical to CIS Sep-l'ak cartridges suggests strongly that it 
is a soluble factor. Eggs are produced in the ovary and are 
transported into the oviducal gland, which is a specialized 
segment of the oviduct that is involved with secretion (12). 
The oviducal gland produces the inner jelly of the egg mass 



INTRASPECIF1C CHEMICAL STIMULI IN SQUID EGG 



30 



u 

3 
O 
H 
O) 



20 



Total Aggression pe 

O 








T T * 






T rt i 


03 CT 03 03 ^ _03 
^5 03 " "c O C 
^ ^* OJ (/} CD 

03 O ^ E w E 

^ /-\ 03 o 03 

^ -o o -o 
Z < Z 



Figure 1. The median numbers of aggressive behaviors per egg touch 
(error bars indicate first and third quartiles) of squids alter (.-(intact with 
natural eggs or contact with extracts from female reproductive glands ( n = 
48 pairs). An asterisk indicates that responses were significantly different 
from responses to natural eggs (r = 12.72. df = 4. P < 0.05). 



of L. pealeil (6). In contrast, the nidamental gland produces 
the outer coating of the egg capsule (12). and the accessory 
nidamental gland is responsible for coating the eggs with 
bacteria that may deter pathogens or reduce predation (13). 
There may be several chemical factors responsible for in- 
ducing agonistic behavior for example, chemicals in the 
eggs themselves and perhaps in the inner jelly of the egg 
capsule secreted by the oviducal gland. If the chemical is 
indeed produced in the ovary, as suggested by these results, 
there must be some mechanism (e.g., diffusion) by which 
the compound reaches the outer jelly coats of the egg 
capsule so that male squids can detect the compound when 
they touch the eggs. 

Pheromones are key mediators of reproductive behaviors, 
and an understanding of their roles is essential to under- 
standing the ecology and evolution of populations and spe- 
cies (14). Aquatic pheromones are particularly difficult to 
characterize because they are rapidly degraded (15): conse- 
quently, few invertebrate pheromones have been character- 
ized in aquatic animals. However, a family of structurally 
related peptide pheromonal attractants ("attractins") has re- 
cently been characterized in five species of the opistho- 
branch Aplysiti (16. 17), and the three-dimensional NMR 
solution structure of A. californica attractin has been deter- 
mined (18). These peptide pheromones are secreted by the 
albumen gland, a large exocrine gland that packages the 
eggs into a cordon. Our results with squids suggest that the 
ovary and oviducal gland should be tested further, and that 



chemical factors in those organs should be chemically and 
behaviorally characterized. Clearly, more research is re- 
quired to understand the mechanisms and functions of mul- 
tiple sensory cues that play a critical role in initiating the 
sexual selection processes in Loligo pcalcii. 

Literature Cited 

1. Hanlon, R. T. 1996. Evolutionary games that squids play: fighting, 
courting, sneaking, and mating behaviors used fur sexual selection in 
Lolif!i> net/lei. Biul. Hull. 191: 304-310. 

2. King, A. J.. S. A. Adamo, and R. T. Hanlon. 1999. Contact with 
squid egg capsules increases agonistic behavior in male squid (Loligo 
iwtileil Biul. Hull. 197: 256. 

3. King, A. J., S. A. Adamo, and R. T. Hanlon. 2003. Agonistic 
behavior between male squid: squid egg mops provide sensory cues tor 
swift conflict escalation. Aniiii. Heluiv. 66: 44-58. 

4 Buresch, K. C., J. G. Boal, J. Knowles, J. Debose, A. Nichols. A. 
Erwin, S. D. Painter, G. T. Nagle, and R. T. Hanlon. 2003. Con- 
tact chemosensory cues in egg handles elicit male-male agonistic 
conflicts in the squid l.oli^o pealeii (Mollusca: Cephalopoda). 
J. Chcm. Eci'l. 29: 524-542. 

5. Hanlon, R. T., and N. Shashar. 2002. Aspects of the sensory 
ecology of cephalopods. Pp. 266-282 in SeiiMirv Processing in the 
Aquatic Environment. S. P. Collin and N. J. Marshall, eds. Springer 
Verlag, New York. 446 pp. 

6. Drew, G. A. 1911. Sexual activities of the squid, Loligo pealii (Les.). 
I. Copulation, egg-laying and fertili/ation. ./. Morphol. 22: 327-359. 

7. Arnold, J. M. 1962. Mating behavior and social structure in Loligo 
I'ciilii. Biul. Bull. 123: 53-57. 

8. Griswold, C. A., and J. Prezioso. 1981. In situ observations on 
reproductive behavior of the long-tinned squid. Loli^o peulei. Fish. 
Bull. 78: 445-447. 

4. Hanlon. R. T., M. R. Maxwell, N. Shashar. E. R. Loew, and K.-L. 
Boyle. 1999. An ethogram of body patterning behavior in the bio- 
medically and commercially valuable squid Liilif!" pcalei off Cape 
Cod. Massachusetts. Biul. Bull 197: 44-62. 

10. DiMarco. F. P., and K. T. Hanlon. 1997. Agonistic behavior in the 
squid Lilian p/ci (Loliginidae. Teuthoidea): fighting tactics and the 
effects of size and resource value. Ethology 103: 84-108. 

1 1. Siegel, S., and N. J. Castellan, Jr. 1988. Nonptiniiiielric Statistics 
tor the Behavioral Sciences. McGraw-Hill. New York. 344 pp. 

12. Lum-Kong, A. 1992. A hislological study of the accessory repro- 
ductive organs of female L< iligi i foiiu :si (Cephalopoda: Loliginidae). ./. 
Znol. (Loml.l 226: 464-440. 

13. Barhieri. E.. K. Barry, A. Child, and N. Wainvvright. 1997. Anti- 
microbial activity in the microhial community of the accessory nida- 
mental gland and egg cases ot l.oli\;o /iculei (Cephalopoda: Loli- 
ginidae). Biol. Bull. 193: 275-276. 

14. Zinimer, R. K., and C. A. Butman. 2000. Chemical signaling 
processes in the marine environment. Biol. Bull. 198: 168-187. 

15. Shimuzu. V. 1985. Bioaclive marine natural products with emphasis 
on handling of water-soluble compounds. J. Nut. Prod. 48: 223-235 

16 Painter. S. D.. B. dough, R. W. Garden, J. V. Sweedler, and G. T. 
Nagle. 1998. Characterization of Anlysiu attractin. the first water- 
borne peplide pheromone in invertebrates. Biol. Bull. 194: 120-131. 

17 Painter, S. D., D.-B. G. Akalal, B. dough, A. .1. Susswein. M. Levy, 
and G. T. Nagle. 2000. Characterization of tour new members of the 
attractin family of peptide pheromones in .4/>/y.vm. Soe. Neurnsci. 
Abstr. 26: I 166. 

18. Garimella, R., V. Xu. C. H. Schein, K. Rajarathnam, G. T. Nagle, 
S. I). Painter, and W. Braun. 2003. NMR solution sliuclure of 
atlractin. a water-borne prolcin pheromone from the mollusk A/'lvsni 
ciilifornica. tiiochciiustrv 42: 4470-4474. 



Kelercnce: Bio/. Bull. 206: 4-12. iFebruan 2lU> 
2004 Marine Biological Lahoraton. 



Contraction and Stiffness Changes in Collagenous 

Arm Ligaments of the Stalked Crinoid Metacrinus 

rotundus (Echinodermata) 

TATSUO MOTOKAWA*, OSAMU SHINTANI. AND RUDIGER BIRENHEIDE 

Depurtnicnt of Biological Sciences. Graduate School of Bioscience and Biotechnology, 
Tok\o Institute of Technology, Meguro, Tokyo, /x?-cS'5.5/ Japan 



Abstract. Shortening and stiffness were measured simul- 
taneously in the aboral ligament of arms of sea lilies. Arm 
pieces were used from which oral tissues (including mus- 
cles) were removed, leaving only collagenous ligaments 
connecting arm ossicles. Chemical stimulation by means of 
artificial seawater with an elevated concentration of potas- 
sium caused both a bending movement and stiffness 
changes (either softening or stiffening I. The movement 
lasted for 1.5-10 min. and bent posture was maintained. The 
observation that contraction was not necessarily associated 
with softening provided evidence against the hypothesis that 
the shortening of the aboral ligaments was driven by the 
elastic components that had been charged by the oral mus- 
cles and released their strain energy at the softening of the 
aboral ligaments. The speed of ligamental shortening was 
slower by at least one order of magnitude than that of 
muscles. Acetylcholine (10 5 -10 3 M) caused both con- 
traction and softening. We conclude that the aboral ligament 
shows two mechanical activities based on different mecha- 
nisms: one is active contraction and the other is connective 
tissue catch in which passive mechanical properties show 
mutability. We suggest thai there is neural coordination 
between the two mechanisms. 

Introduction 

Echinoderms are unique in possessing mechanically ac- 
tive collagenous connective lissues. The best-known exam- 
ple is catch connective tissue (mutable connective tissue). 
which changes its passive mi ..hauical properties under ner- 



KeCL-i\L-d I') June 2(l(lv atvi 
* To whom iom-sp<mcK-ncc 
bio.titech.ac.jp 



l JdO.V 



bi 



. F.-mail: lmoioka\\<" 



vous control (Motokawa, 1984: Wilkie. 1996). Catch con- 
nective tissues are found in various anatomical locations in 
all the classes of echinoderms. and they have been regarded 
as one of the major features that characterize the phylum 
Echinodermata (Motokawa. 1988). The catch connective 
tissue stiffens or softens. Such changes in passive mechan- 
ical properties become apparent only when an external force 
is applied and the reaction of the tissue to this force is 
measured. 

Another kind of mechanically active connective tissue 
was recently found in echinoderms (Birenheide and Mo- 
tokawa. 1996. 1998: Birenheide ct a!.. 2000). The collage- 
nous ligaments in the arms and cirri of crinoids contract in 
response to chemical stimuli such as cholinergic agents and 
seawater with an elevated concentration of potassium. Al- 
though the mechanism of contraction has yet to be eluci- 
dated, it is evident thai muscles are not directly involved in 
the contraction because no muscle cells were found in these 
ligaments (Birenheide and Motokawa. 1994; Birenheide ct 
iiL 2000). 

There remains the possibility that muscles are indirectly 
involved in the contraction of connective tissues. The aboral 
ligaments of crinoid amis are disposed in an antagonistic 
position to the muscles in arm articulations (Fig. la). Cri- 
noid arms consist of a row of ossicles connected by liga- 
ments and muscles (F ; ig. Ih). The lace of each ossicle bears 
a fulcrum that corresponds to the fulcrum of the adjacent 
ossicle. Muscles arc found onlv on the oral (upper) side ot 
the fulcrum, whereas collagenous ligaments arc found both 
orally and aborally. When muscles on the oral side of the 
fulcrum contract, the arm bends in the oral direction. The 
arm also shows ahoral bending. Because the aboral liga- 
ments are the only mechanically strong element on the 
aboral side of the fulcrum, they are no doubt responsible for 



CONTRACTILE CONNECTIVE TISSUE 



aboral bending. The conventional explanation has invoked 
elastic recoil (Birenheide and Motokawa. 1994). According 
to this view, elastic energy is stored in the aboral ligaments 
by passive stretch when oral bending is produced by the 
muscles. This strain energy is then released when the mus- 
cles relax, and the aboral ligaments shorten to cause aboral 
bending of the arm. This explanation regards the abora! 
ligament as being an antagonizing spring to the oral muscle. 

The aboral ligaments are not. however, a simple spring. 
Arm preparations from which all the oral muscles have been 
removed keep a rather straight posture and show aboral 
bending upon chemical stimulation (Birenheide and Mo- 
tokawa, 1996). Some locking mechanism for keeping the 
straight posture and thus the charged state of the spring 
would seem to be necessary, otherwise the aboral ligaments 
would spring back at the moment when the antagonizing 
muscles are removed. A possibility is that the ligament 
stores strain energy as an expanded spring by stiffening the 
tissue and releases it by softening, which results in short- 
ening of the ligament. The "spring-with-a-lock" hypothesis 
for the contraction of crinoid arm ligaments seems to be a 
reasonable one because the arm ligaments contain fibrillin- 
like, and thus possibly elastic, microfibrils (Birenheide and 
Motokawa, 1994) and show mutability of stiffness (Biren- 
heide and Motokawa, 1998). The hypothesis is also parsi- 
monious because otherwise some unknown actively con- 
tractile machinery would have to be postulated. 

The present study was designed to test the spring-with- 
a-lock hypothesis. We measured shortening and stiffness of 
the aboral ligaments simultaneously. The hypothesis pre- 
dicts that softening should precede shortening. The results 
we obtained were contrary to the prediction and thus sup- 
port our previous suggestion that the ligaments actively 
contract without the help of muscles (Birenheide and Mo- 
tokawa, 1998; Birenheide et /., 2000). 

Materials and Methods 

Specimens of the stalked crinoid Metacriiuts rotundus 
Carpenter, 1882. were dredged from depths of 100-150 m 
in Suruga Bay off Numazu, Japan. Collected specimens 
were transported to our laboratory in Tokyo, where they 
were held in a tank containing recirculating seawater. The 
tank was kept dark and the water temperature was main- 
tained at 14 C. Nineteen individuals were used for exper- 
iments. They were used within 2 months after capture. 

The arm of Metacrinns rotundus consists of a series of 
ossicles that are connected by ligaments and muscles. The 
skeletal joint of the ossicles is a transverse ridge that acts as 
a fulcrum. The muscles are found only on the oral side of 
the fulcrum, while ligaments are found on both sides (Fig. 
la). The aboral ligament was used in the present study. The 
aboral ligament consists of two parts, the main ligament and 
the much smaller ligament housed in a fossa. The results 




Figure 1. The articulation surface ol an ossicle of Metacrinns rntnih/in 
(a), and the side view of an excised arm piece (b). Oral direction is to the 
top in a and to the bottom in b. (a) A transverse ridge (arrows) that acts as 
a fulcrum is arranged at an angle of about 60 to the oral-aboral plane. The 
ridges on the distal and the proximal side of each ossicle are arranged at 
angles of 60 and 60, respectively. The central hole houses a brachial 
nerve. On the oral joint surface, two muscle bundles (M) and two bundles 
of oral ligaments (OL) insert into the ossicle. On the aboral joint surface, 
aboral ligaments (densely hatched area), which consists of a main aboral 
ligament (AL) and a small fossa ligament, insert into the ossicle. No 
muscles are found on the aboral side of the fulcrum, (b) An arm piece with 
six ossicles that are connected with each other by ligaments and muscles. 
The oral side, including muscle bundles, was removed from the arm piece 
with a razor blade, and the remaining oral tissues between the ossicles 
(arrows) were cut up to the fulcrum. 

reported here refer to the combined properties of the two 
ligaments. An arm piece (length ca. 6 mm) containing five 
to seven ossicles was dissected from a sea lily. The oral 
side, containing coelomic canals, muscles, and most of the 
oral ligaments, was removed using a razor blade (Fig. Ib). 
The remaining oral tissue between ossicles was cut up to the 
fulcrum. The adjacent ossicles were thus connected by a 
mechanically strong aboral ligament and by a mechanically 
weak epidermis overlying the ligament, and also by a me- 
chanically weak brachial nerve housed in a hole in the 
center of the ossicle. 

The experimental setup is shown in Figure 2. The prox- 
imal end of the arm piece was firmly fixed to a holder by 
both cyanoacrylate glue and mechanical clamping. The dou- 
ble fixing ensured that there would be no slippage between 
the sample and the holder when the sample was subjected to 
a push. The arm piece was held horizontally with the aboral 
side upward. A small L-shaped stainless steel plate weigh- 
ing 140 mg was glued to the free end of the arm. and 
seawater was introduced to a trough. The position of the 
plate, and thus that of the arm tip. was recorded by an eddy 
current sensor (E2CA-AN4E. Omron. Japan) located in the 
floor of the trough. In this setup, any active contraction ot 



T. MOTOKAWA ET AL. 



the aboral ligaments results in an upward bending of the arm 
piece against the force of gravity; large softening of the 
ligaments would cause the arm piece to bend downward 
under gravity. 

We constructed a device that allowed us to measure the 
stiffness of the ligament without restraining the free move- 
ment of the sample (Fig. 2). The device consisted of a force 
gauge (KSP-2-120-E-4, Kyowa, Japan) to which a probe of 
1 mm diameter was attached. The gauge was fixed to a 
linear motion actuator (c-sx-30, THK, Japan) controlled by 
a microcomputer. The actuator produced vertical motion 
that allowed positioning of the probe in increments of 10 
jLim. The movements were controlled via a computer pro- 
gram written in BASIC. The program took data provided 
from the movement sensor and positioned the probe so that 
it was always 2 mm above the stainless steel plate attached 
to the arm piece. Any movement of the arm was followed by 
an immediate corresponding movement of the probe so that 
the distance between the probe tip and the specimen re- 
mained constant. At intervals determined by the experi- 
menter, the probe was lowered until it touched the stainless 
steel plate. From this point the probe was lowered further 
for 0.2 mm. which caused downward displacement of the 
arm tip by the same amount. The force resulting from this 
downward displacement was recorded. The probe was then 
retracted to its position above the specimen. The speed of 
the probe was 4.2 mm/s, which was 100 times faster than 
the fastest arm-tip movement observed. The probe touched 
the arm for less than 91 ins. The bending stiffness was 
calculated as the peak force divided by the maximum ex- 
cursion of the arm tip during the push, expressed as the 




Figure 2. Si. Ik-malic drawing ol the experimental setup. An arm piece 
(a), whose si/e is di.iwn exaggerated, is held hori/onialK .mil ahoral side 
up in a Irough. A IOKC gautv III, in which a prohe (p) is attached, is 
mounted on the nio\m<j head n ol a lineal motion aeul.iloi driven hy a 
stepping motor (ml. I he \eriie.il p. iMtmn ol the mining head and thus that 

nl llie prohe lip is picciscK ci ! he position ol the 1. shaped metal 

plale glued to Ihe distal end ol the ai piece is monitored In a displace- 
ment sensoi id I. Holh (nice and displ.u , i mil signals are led to a compulei 
i In on "h an analog-lo dig Hal eon \eilei board I VIM I ecilliack signals hum 
the computer au- gi\en to llie molor viti a motoi eonirollci (c). 



percentage of the control value. The device thus enabled us 
to record stiffness changes and arm movement simulta- 
neously. 

The sample was left in a trough for 10 min. and two 
successive downward pushes, separated by an interval of 
about 100 s, were applied to check that the stiffness and the 
baseline position of the arm tip were maintained. The stiff- 
ness at the second push was taken as the control value S . 
The stiffness change AS, expressed as a percentage, was 
calculated as follows: AS = 100 X (S, - S,,)/S (I , where 
S, is the stiffness after stimulation. A stiffness decrease was 
thus shown as a negative value. Chemicals for stimulation 
were introduced within I min after the second push. The 
speed of elevation of the arm tip was designated as the 
bending speed. The peak bending speed was the maximum 
speed of the upward bending of the arm tip. The average 
bending speed in artificial seawater with an elevated potas- 
sium concentration was calculated as follows. The peak 
height of the bending of the arm tip from the baseline was 
taken as 100%. The average bending speed was defined as 
80% of the maximum excursion divided by the time needed 
to bend from 10% to 90% of the peak height. The reaction 
time for contraction was the time that elapsed from the 
application of chemical to the beginning of bending. 

Artificial seawater (ASW) in the trough was constantly 
circulated via a pump through a water bath to keep the 
temperature at 14 C. The composition of ASW was as 
follows (in mmol/l): NaCl. 433.7; KC1. 10.0: CaCK. 10.1: 
MgCU 52.5; NaHCO,, 2.5. The pH of all the solutions was 
adjusted to 8.2. ASW whose potassium concentration was 
raised to 100 mA/ (KASW) was prepared by reducing the 
sodium concentration so as to keep osmolarity constant. 
Acetylcholine solution (ACh) was prepared by diluting ace- 
tylcholine chloride (Nacalai Tesque, Japan) to the desired 
concentration in ASW. To rinse out the trough, both KASW 
and ACh were exchanged with ASW using the circulation 
pump. 



Results 



Control experiments 



We performed control experiments to ensure that our 
experimental setup did not influence the movement or stiff- 
ness of the arm. When an arm piece glued to the stainless 
steel plate was left in seawater, the plate was kept in the 
same position for at least 30 min in most cases. After the 
10-min resting period, a little drift of the position was 
observed in some samples; such samples were not used for 
experiments. Repeated stiffness measurements without 
chemical stimulation were performed. A typical result is 
given in Figure 3a, in which the upper trace is for the 
position of the arm tip, and the lower trace is for the force. 
The vertical bars in the upper trace show the downward 
deflection of (he arm pushed by a probe. The upward 



CONTRACTILE CONNECTIVE TISSUE 



K + 
I 



10 mm 











I 



102 
mm 



2 

mN 



0.2 

mm 



I 2 



10 min 




mN 



0.2 

mm 



ImN 



20 min 

Figure 3. Control experiments. Upper traces show dispUii.x-nn.-nt. and 
lower traces show force. The vertical bars in the upper trace denote the 
passive downward movement of the arm when pushed, and the correspond- 
ing vertical bars in the lower trace denote the passive force exerted by the 
ligament in response to the push, (a) An example demonstrating that 
repeated pushes did not cause contraction or changes in stillness, (b and c) 
Responses to chemical stimulation with artificial seawater with an elevated 
concentration of potassium (KASW) of a previously frozen arm piece (b) 
and a fresh arm piece (c). The arm pieces in b and c were cut from the same 
arm. The frozen sample did not respond, while the fresh one responded 
with contraction and stiffness decrease. In this and the following Figures, a 
down-pointing arrow shows the introduction of a chemical, and an up- 
pointing arrow indicates a wash with artificial seawater. 



deflections, corresponding to the downward bars, are the 
reaction forces to the pushes. The upper trace remained 
horizontal, which shows that the position of the arm tip 
remained the same after repeated pushes. The similar height 
of the upward vertical deflections shows that the stillness 
remained almost the same after repeated pushes. When the 
first push was taken as the control, the stiffness change 
measured at the second push, applied 100 s after the first, 
was 0.63% 4.16% (average SD, n = 18). The range 
was 8% to +8%. The average was not statistically differ- 
ent from 0%. which implied no changes in stiffness (one- 



sample f-test, P > 0.05). After being pushed, the arm tip in 
most samples sprang back to almost the same position it 
held before the push. In some samples, however, small 
plastic deformations remained. Thus the averaged position 
after a push was a little lower than that before the push. It 
was -10.2 24.9 /urn (average SD. n = 18) when the 
initial position was taken as and downward shift was 
expressed as negative, although the average value was not 
statistically different from (one-sample /-test. P > 0.05). 
The range was 70 to +25 /J,m. The quick downward 
bending and release of the arm piece necessary for stiffness 
measurement thus did not provoke any active contractions 
or any subsequent stiffness changes. Based on the results 
above, the response to chemical stimulation was classified 
as "no contraction" when the upward excursion of the arm 
tip was less than +25 /urn and as "no change in stiffness" 
when it was less than 8%. 

For each arm that was dissected, two pieces were re- 
moved: one piece was used soon after dissection, and the 
other was frozen at 20 C overnight. The frozen sample 
was thawed and tested. The once-frozen, and thus no longer 
alive, samples did not respond to KASW. The stiffness and 
the position of the arm tip remained constant after repeated 
pushes (Fig. 3b). The fresh, unfrozen samples responded to 
KASW (Fig. 3c). 

Responses to high-potassium acuwciter 

Stimulation with KASW provoked two responses simul- 
taneously. One was stiffness change, and the other was 
aboral bending due to the shortening of the ligament against 
the force of gravity. The combination of contraction and the 
direction of changes in stiffness was variable. The most 
frequent response was one in which both aboral bending and 
softening were observed (Fig. 3c and Fig. 4). In Figure 5. 
the relation between the maximal excursion of the contrac- 
tion and the maximal stiffness change in a response was 
plotted for 20 samples stimulated by KASW. Most dots 
were found in the upper left quadrant, which corresponds to 
contraction with softening. Contraction was observed in 16 
samples. 12 of which also showed softening. Although this 
seems to support the "spring-with-a-lock" hypothesis, there 
were marked exceptions. In three cases, contraction was 
associated not with softening but with stiffening (upper 
right quadrant in Fig. 5). In the case shown in Figure 6a and 
in the other two cases, the stiffness increased during con- 
traction and remained so after the wash with seawater. The 
stiffness never fell below its value before stimulation, al- 
though some fluctuations were observed. Figure 6b shows 
an exceptional response. KASW caused contraction that 
started 1 min after stimulation. The stiffness measured at 
that time showed a small increase of 4%. which was clas- 
sified as no change in stiffness according to our criterion. 
The contraction appeared to have almost reached a plateau 



T. MOTOKAWA ET AL. 



J 

(B 

I 6 

f 3- 




s, - 

-20- 


w ~ 




JC 






o 






-40- 


""-.^ 




O 

c _- 


* 


* 


fc 


1 1 1 1 1 1 1 1 1 


[ i 


t/5 


02468 


10 




Time, mm 





Figure 4. Typical response to artificial seawater with an elevated 
concentration of potassium (KASW). The upper trace is upward displace- 
ment of the arm tip, the middle trace is speed of upward bending of the arm 
tip. and the lower trace is softening. Both contraction and stiffness decrease 
were observed. 



when KASW was washed out. The wash was followed by a 
further contraction accompanied by marked stiffening. This 
response is a clear demonstration that contraction was not 
associated with tissue softening. The contraction at wash 
was, however, not observed in other samples. Four arm 
pieces did not show contraction but did show stiffness 
changes. Figure 6c is such an example in which the stiffness 
almost doubled. Figure 6d is an example of tissue softening 
without contraction. In this example, the arm piece showed, 
instead of upward contraction, a little downward movement 
about 1 min after KASW stimulation. This arm piece did not 
fully spring back after a push by the probe but showed a 
persistent plastic deformation. Both the downward move- 
ment and the plastic deformation were probably produced 
by flow of the softened tissue due to gravity and to pushes 
with the probe. All the results above strongly suggested that 
the contraction and stiffness changes were separate re- 
sponses, both independently activated by KASW. All (Im- 
possible combinations contraction with softening, con- 
traction with stiffening, contraction with no stiffness 
changes, stiffening with no contraction, and softening with 
no contraction -were observed. 

The most frequent response to KSW was contraction 
associated with softening, which was observed in 60% of 
the samples, ("lose inspection of the time courses of the 
contractile response and the softening response in these 
samples also supported the conclusion that these were in- 
dependent of one another. In figure 7. the maximum con- 
traction height was taken as I Oil', and the maximum soft- 
ening was taken as -1007, in a response to KASW. In 
general, the extent of the softening increased as contraction 



proceeded. The two were, however, not tightly coupled. In 
the sample marked by crosses in Figure 7. the first plot 
showed an evident contraction with a small stiffness in- 
crease of 6.7%. though this value was regarded as no 
stiffness change according to our criterion. This example ot 
contraction preceding softening was contrary to the expec- 
tation of the spring-with-a-lock hypothesis. In most re- 
sponses, softening continued after the contraction had 
ceased. 

The contraction by KASW became evident in about 30 s 
after the application of stimuli. The average reaction time 
for contraction was 31.5 7.8 s (SD. n == 13). The 
contraction curve was S-shaped. The upward bending 
movement continued for 1.5-10 min. and the raised arm 
position was maintained after movement stopped. The arm 
remained raised even after the wash with seawater for more 
than 1 h (Fig. 3c). The distance the arm tip moved was 
40-1 140 /LLin. The average was 384 70 ju,m (mean SD. 
n = 16). which corresponded to an average of about 60 jim 
of elevation per joint. The bending speed reached a peak 
value in the middle of contraction (Fig. 4). The peak bend- 
ing speed was quite variable, at 0.35-43.52 /J.ITL/S (6.47 
10.18 jLim/s. mean SD. n == 17). The average bending 
speed ranged from 0.12 to 5.26 /am/s; the mean was 1.35 
1.28 jum/s (SD. ;; = : 16). which was about 0.2 /LUTI/S 
elevation per joint. 

Softening of the ligament was observed in 70% of the 
samples. In a typical example (Fig. 4). stiffness was halved 
during contraction and remained so after the movement 
ceased. The stiffness decrease was -35.8% 17.8% 



1.2- 







1,0- 






| 08: 






<_- 


o 




1 

04- 


8 8 


o 


n 

Q. : 

.!5 0.2- 
Q 




o 


o 




Q- 




o 


~ O ~ ~ "O~ " 


r o - 




1 T T 1 T i i 1 r i i i 1 1 1 



-100 



-50 



50 



100 



150 



Stiffness change, % 



Figure 5. Relation between the maximum stiffness change and the 
maximum upward displacement of the arm tip in a response to artificial 
seawater with an elevated concentration of potassium I KASW I. The former 
was plotted on the v-axis and the latter on the v-axis. Positive values of 
silliness change denote stillemng. and negative values denote softening: 
posin\e values ol displacement denote contraction, and negative values 
denote downward movement due to gi.i\it>. 



io.2n ^ 



0) 

I 0.1- 

o 

to 



CONTRACTILE CONNECTIVE TISSUE 



0.8 



S J -> 



#30- 

0)20- 



=g 



3 min 



K" 
ou C I 



-oP 

1001 



50- 



J - 



3 mm 



J 
60 

30 
0- 



-0.1 



-20 



-40 J 




r 



..-....-- 

d f 



3 min 



3 mm 



Figure 6. Responses to artificial seawater with an elevated concentration of potassium (KASW). The upper 
trace shows upward displacement of the arm tip, and the lower trace shows stiffness changes. Various 
combinations of contractile response and stiffness changes were observed, (a) Contraction associated with 
stiffening: (b) contraction without stiffness change in KASW. and contraction with stiffening when KASW was 
washed out: (c) no contraction, but marked stiffening: (d) no contraction, but sottening. 



(mean SD. n == 14). The stiffness remained decreased 
long after the KASW was washed out (Fig. 3c). 

Responses to ticetylcholine 

We treated arm pieces with 10 5 -10 3 M solutions of 
acetylcholine in seawater. ACh 1(T 4 M and 10~ 3 M had 
similar effects, and ICT^ M provoked weaker responses. 
The typical response was contraction associated with soft- 
ening (Fig. 8a, b). As in KASW, however, various combi- 
nations of contraction and stiffness changes were observed. 
Among 34 samples tested with 10~ 3 M ACh. 23 showed 
contraction with softening. 7 showed contraction without 
stiffness changes, and 4 showed softening without contrac- 
tion. In 1CT 4 M ACh. 3 samples out of 8 showed contraction 
and softening. 2 showed contraction without stillness 
changes, 2 showed no contraction but softening, and 1 
neither contracted nor changed stiffness. Here again, con- 
traction was not necessarily associated with tissue soften- 
ing. It should be noted that the stiffness change was always 
softening; no stiffening was observed in ACh. 

Contraction initiated by 10~ 3 M ACh became evident in 



0- 



0) 

O) 

c 

CO 


o 

</> 

</) c; (-)_ 
CD - ) u 



( 



-100- 1 




20 40 60 80 100 

% Contraction 

Figure 7. The relative degree of softening plotted against the relative 
degree of contraction in the samples that showed both sottening and 
contraction to artificial seawater with an floated concentration of potas- 
sium (KASW). Twelve samples showed both sottening and contraction, 
hut five examples are given here: the rest show ctines similar to one ol the 
curves shown in this figure. The final amount ol contraction was taken as 
100%. and the final amount of softening was taken as - 100', The time 
course of softening did not parallel that ot contraction. 




<n - 
<u 

p ; 

OT 


" - - _ U " 


- ^ 


1 1 1 1 1 1 1 | | I I I 

10 20 30 10 20 

Time (min) Time (min) 



Figure 8. Typical responses to acetylcholine at concentrations of 10 ' M (a) and 10 4 M (b). The upper 
trace shows upward displacement of the arm tip. the middle trace shows speed of upward bending of the arm 
tip. and the lower trace shows softening. Both contraction and decrease in stiffness were observed. 



about 30 s after the application of stimuli. The reaction time 
for contraction was 28.4 3.4 s (average SD, n = 7). 
The bending speed peaked at the beginning, and then the 
contraction continued with ever-decreasing speed (Fig. 8b). 
The upward movement continued for more than 15 min. The 
arm remained raised even after ACh was washed out. After 
the peak in bending speed, contraction with a steady bend- 
ing speed was observed for 10-20 min in some cases (see 
Fig. 8a). The peak bending speed in 10~ 3 M ACh was 0.72 
ju,m/s on average (SD = 0.42, ;; = 7. range 0.16-1.23), and 
the distance moved in 15 min was 259 228 ju,m (mean 
SD, n -- 8). The peak bending speed was one order of 
magnitude less than in KASW (statistically significant dif- 
ference by Mest. P < 0.01 ). Although contraction in ACh 
was slower than in KASW, it lasted longer, so the distance 
moved in 15 min reached a value similar to that found in 
KASW. The peak bending speed occurred at the beginning 
of contraction in ACh, but in the middle of contraction in 
KASW. The reaction time to the two chemicals was similar. 
Softening of the ligament was observed in 79.4% of the 
samples treated with 10 'A/ ACh and in 62. 5'! of the 
samples treated with 10 4 A/ ACh. The stiffness decrease 
due to 10"' M ACh was -28.6% 11.7', (mean SD. 
n = 6). 

Discussion 

The simultaneous measurement of isotonic contraction 
and tissue stiffness revealed that the arm of a stalked crinoid 
I mm which arm muscles had been removed simultaneously 
shortened and changed in stiffness in response to chemical 
stimulation. Ligaments arc undoubtedly responsible for 
these two mechanical activities, because other soft tissues 



connecting ossicles, such as nerves and covering thin epi- 
dermis, are mechanically quite weak. The mechanical re- 
sponses are active ones in which living cells are involved, 
because arm preparations that had been frozen and rethawed 
never responded. The effectiveness of ACh in evoking these 
responses suggests the involvement of neural elements. 
Seawater with an elevated potassium concentration 
(KASW) possibly exerted its effects through cellular depo- 
larization of neural elements and of some effector cells that 
are involved in the mechanical responses. 

Evidence against the " spring-with-a-lock" livpothcsis 

The most frequent response was shortening of the arm in 
association with tissue softening. This result may well be 
taken as evidence for the "spring-with-a-lock" hypothesis in 
which the source of contraction is attributed to an extended 
spring that, after being stretched by the antagonizing mus- 
cles, then releases the strain energy stored in the stiffened 
tissue so that tissue softening causes shortening of the 
ligaments. This hypothesis predicts that softening must pre- 
cede shortening. We obtained, however, examples contra- 
dicting this prediction. Some arm pieces showed shortening 
without stiffness changes, and some showed shortening 
associated with tissue stiffening. The latter was quite con- 
ttarv to expectations based upon the hypothesis. Even 
among the examples of shortening with softening, inspec- 
tion of the time course of the response revealed that short- 
ening sometimes became evident before stiffness decreased. 
These results clearly showed that contraction did not nec- 
essarily require a foregoing softening, thus providing defin- 
itive evidence against the spring-with-a-lock hypothesis. 

The time course of the shortening speed also suggested 



CONTRACTILE CONNECTIVE TISSUE 



II 



that the contraction was not simple elastic recoil. Although 
the maximum speed occurred in the middle of a contraction 
in KASW but at the start of contraction in ACh. no changes 
in stiffness corresponded to this difference. The ACh caused 
an initial fast contraction followed by a long slow contrac- 
tion. The speed of the slow contraction was sometimes 
rather constant, although stiffness changes were observed 
during this period. This also suggested the independence of 
contraction and stiffness changes. 

The spring-with-a-lock hypothesis was premised on the 
tight coupling between shortening and decrease in stiffness. 
Our observations, however, showed that shortening and 
changes in stiffness are separable. All the possible combi- 
nations of the two responses were encountered. The variety 
of responses, especially the shortening without stiffness 
changes and the stiffness changes without shortening, pro- 
vides good evidence that contraction and stiffness changes 
are separable. The variety of responses also suggests that 
these two depend on different mechanisms. 

Contraction and stiffness changes involve scpiirntc 
mechanisms 

The present results are best explained by the presence of 
some active contractile machinery inside the ligaments. 
Stiffness control and active shortening may well depend on 
the same mechanism, as in most animals in which muscles 
are responsible for posture control, which involves both 
movement and stiffness changes. Active shortening implies 
force production, which would increase the resistance to 
stretch, causing an increase in stiffness during contraction. 
In the present study, however, most of the responses were 
contraction with a decrease in stiffness. Therefore, it is 
unlikely that contraction and stiffness changes share a com- 
mon mechanism in these arm ligaments. 

In a study of the stress-relaxation behavior of the cirral 
ligament of Metacriinis rontndus. we found that the collag- 
enous ligament showed both stiffness changes and contrac- 
tion (Birenheide ft til.. 2000). The two responses were 
separable, although both were under cholinergic control. In 
the present study, we suggest that the same two responses 
are also under cholinergic control in arm ligaments. 

Our present report provides the first measurement of 
stiffness changes in the arm ligaments of stalked crinoids. 
Such changes have already been reported in stalkless cri- 
noids (Birenheide and Motokawa, 1998). The ability to 
change their passive mechanical properties seems to be a 
common character of the collagenous ligaments at the ar- 
ticulations of crinoids, since stiffness changes have also 
been reported in the ligaments of cirri (Wilkie, 1983; 
Birenheide el ai. 2000) and of stalks (Wilkie el nl.. 1993, 
1994). Stiffness changes serve to maintain body posture. 
They very likely share a common mechanism connective 
tissue catch which is found widely throughout the phylum 



Echinodermata (Motokawa. 1984; Wilkie. 1996). Although 
the mutability of the mechanical properties of collagenous 
connective tissues has been established and the importance 
of these properties in the supportive function is well appre- 
ciated (Motokawa. 1988). the molecular mechanism under- 
lying connective tissue catch is incompletely understood. It 
seems, however, to involve the cellular secretion of proteins 
that directly affect the mechanical properties of the extra- 
cellular matrix (Tipper ft til.. 2003). 

We have reported shortening and force development in 
arm joints from which the muscles have been removed in 
the stalked crinoid Metticnnns rotiimlnx and also in the 
stalkless crinoid Oxycomanthus juponica (Birenheide and 
Motokawa, 1996. 1998). The present study showed that 
such contractions derive from active contraction of collag- 
enous ligaments. Non-muscular contractions in crinoids are 
not restricted to the arm joints. In spite of a thorough 
ultrastructural investigation, we found no muscle cells in the 
cirral joints, and yet we observed bending movements of 
these joints of M. rotiimlus in response to cholinergic ago- 
nists (Birenheide et ul.. 2000). The spring-with-a-lock hy- 
pothesis is not applicable to cirri if antagonizing muscle 
bundles are supposed to be the force-producing engine. The 
coelomic canal has been proposed as a possible source of 
force production in crinoid arms and cirri (Holland and 
Grimmer. 1981: Candia Carnevali and Saita. 1985). This 
idea is not applicable to the present arm preparation from 
which the coelomic canal has been removed. Because of 
their mechanical weakness, other soft tissues connecting 
ossicles, such as the epidermis and brachial nerves, are 
unlikely to generate contractile forces. Therefore, we con- 
clude that, both in arms and in cirri, the ligaments are 
responsible for the contraction and probably possess a com- 
mon mechanism for active force production. 

The present study shows that contraction is often associ- 
ated with softening. Although we employed atypical exam- 
ples of this as evidence against the tight coupling between 
contraction and tissue softening, the observation that the 
most frequent response was contraction associated with 
softening suggests that there is some coordination between 
contraction and stiffness changes. The association of con- 
traction with softening is reasonable because softening 
probably facilitates shortening; otherwise, kinks would be 
produced. The stiffness of the aboral ligaments is probabh 
also coordinated with contraction of the oral muscles. This 
may be one reason that the observed responses were vari- 
able. The variety of the responses suggests the presence of 
sophisticated control. A cholinergic system seems to be 
involved in the coordination between the contraction and 
the stiffness changes of ligaments. 

The largest bending speed observed was 43.5 /am/s. A 
rough calculation from this value suggests that the maxi- 
mum shortening speed of the ligament itself is 0.05 /,,/s. 
where / n is the length of the ahoral ligament when the arm 



12 



T. MOTOKAWA KT AL 



is straight. This is slower by one order of magnitude than 
reported for echinoderm muscles (Tsuchiya, 1985). The 
multi-joint structure of the arms, however, compensates for 
the slowness, because the speed of arm tip movement pos- 
sibly increases in proportion to the number of joints. 

The present study establishes that the collagenous liga- 
ments of stalked crinoids show active contraction under 
nervous control. Among the animal kingdom, only crinoids 
have been documented to have such connective tissue con- 
tractions. The force-producing mechanism has yet to be 
elucidated. 

Acknowledgments 

This research was supported by a grant-in-aid for scien- 
tific research on priority area (A) "Molecular synchroniza- 
tion for design of new materials system" of the Ministry of 
Education, Science. Sports, and Culture of Japan. 

Literature Cited 

Birenheide, R., and T. Motokaua. 1994. Morphological basis and 
mechanics of ami movement in the stalked crinoid Melacrinu\ rotnn- 
ilus (Echinodermata. Crinoidea). Mar. Bin/. 121: 273-283. 

Birenheide, R., and T. Motokaua. 1996. Contractile connective tissue 
in crinoids. Biol. Hull. 191: 1-4. 

Birenheide. R., and T. Motokaua. 1998. Crinoid ligaments: catch and 
contractility. Pp. 139-144 in Echinodcnn: Sun Fnincisco. R. Mooi and 
M. Telford. eds. A. A. Balkema. Rotterdam. 

Birenheide. R., K. Yokoyama, and T. Motokaua. 20(10. Cirri of the 
stalked crinoid Metacrinus rotundus: neimil elements and the eftecl ot 



cholinergic agonists on mechanical properties. Proc. R. Soc. Loiul. B 
267: 7-16. 

Candia Carnevali, M. D., and A. Saita. 1985. Muscle system organi- 
/ation in echmoderms: II. Microscopic anatomy and functional signif- 
icance of the muscle-ligament-skeleton system in the arm of comatulids 
(Antedon inctlirerrwieiD. ./. Morphol. 185: 59-74. 

Holland, N. D., and .). Grimmer. 1981. Fine structure of the cirri and a 
possible mechanism for their motility in stalkless crinoids (Echinoder- 
mata). Cell Tissue Res. 214: 207-217. 

Motokaua. T. 1984. Connective tissue catch in echinoderms. Biol. Rev. 
59: 255-270. 

Motokawa, T. 1988. Catch connective tissue: a key character for echi- 
noderms' success. Pp. 39-54 in Echinoderm Biology. R. D. Burke. 
P. V. Mladenov, P. Lambert, and R. L. Parsley, eds. A. A. Balkema. 
Rotterdam. 

Tipper, J. P., G. Lyons-Levy, M. A. L. Atkinson, and A. Trotter. 2003. 
Purification, characterization and cloning of tensilin. the collagen-h'bril 
binding and tissue-stiffening tactor from Cucutnaria [roiiJoMi dermis. 
Matrix Biol. 21: 625-635. 

Tsuchiya, T. 1985. The maximum shortening velocity of holothurian 
muscle and effects of tonicity change on it. G/'- Biochem. Phvsiol. A 
81: 347-4(11. 

Wilkie, I. C. 1983. Nervously mediated change in the mechanical prop- 
erties of the cirral ligaments of a crinoid. Mm: Behav. Plmiol. 9: 
229-248. 

Wilkie, I. C. 1996. Mutable collagenous tissue: extracellular matrix as 
mechano-effector. Pp. fil-102 in EchinoJerm Studio,. Vol. 5. M. 
Jangoux and J. M. Lawrence, eds. A. A. Balkema. Rotterdam. 

Wilkie. I. C., R. H. Emson. and C. M. Young. 1993. Smart collagen in 
sea lilies. Nature 366: 519-520. 

Wilkie, I. C., R. H. Emson, and C. M. Young. 1994. Variable tensility 
of the ligaments in the stalk of a sea-liliy. Comp. Biochem. Ph\xiol. A 
109: 633-641. 



Reference: Bin/. Bull. 206: 13-24. (February 2(104) 
2004 Marine Biological Laboratory 



Identification of Juvenile Hormone-Active 

Alkylphenols in the Lobster Homarus americanus 

and in Marine Sediments 

WILLIAM J. DIGGERS' AND HANS LAUFER 2 * 

1 Department of Biology, Wilkes University. Wilkes-Barre. Pennsylvania 18766: and 2 Department of 

Molecular and Cell Biology, University of Connecticut, Storrs, Connecticut 06269, ami the Marine 

Biological Laboratory, Woods Hole, Massachusetts 02543 



Abstract. We have identified, by gas chromatography/ 
mass spectrometry, four alkylphenols that are present in the 
hemolymph and tissues of the American lobster Homarus 
americanus and in marine sediments. These alkylphenols 
are used industrially in antioxidant formulations for plastic 
and rubber polymer manufacturing, and are similar in struc- 
ture to a known endocrine disruptor. bisphenol A. The 
compound 2-f-butyl-4-(dimethylbenzyl)phenol was present 
at concentrations of 0.02 to 1.15 /u.g/ml in hemolymph and 
8.95 to 21.58 Mg/g in sediments. A second compound. 
2.4-bis-(dimethylbenzyl)phenol. was present at concentra- 
tions between 0.07 and 19.78 jug/ml in hemolymph and 
138.94 to 224.89 jug/g in sediment, while a third compound. 
2, 6-bis-(f-butyl)-4-(dimethylbenzyl (phenol, was found at 
concentrations between 0.01 and 13.00 /j,g/ml in hemo- 
lymph, 2.55 and 6.11 |u.g/g in hepatopancreas. and 47.85 
and 74.66 /xg/g in sediment. A fourth compound. 2.4-bis- 
(dimethylbenzyl)-6-/-butylphenol, was found at concentra- 
tions of 0.20 to 70.71 jug/ml in hemolymph, 23.56 to 26.89 
/xg/g in hepatopancreas. and 90.68 to 125.58 /u,g/g in sedi- 
ment. These compounds, along with bisphenol A. 4-di- 
methylbenzylphenol. and nonylphenol, display high juve- 
nile hormone activity in bioassays. Alkylphenols at high 
concentrations are toxic to crustaceans and may contribute 
significantly to lobster mortality; at lower concentrations, 
they are likely to have endocrine-disrupting effects. 



Received 2 July 2003; accepted 17 November 201)3 
* To whom correspondence should be addressed. 
laufer@uconn.edu 



E-mail: 



Introduction 

The lobster population in western Long Island Sound has 
been decimated in recent years, and a variety of factors have 
been implicated, including elevated temperatures, anoxia, 
paramoeba infestation, and exposure to pesticides and other 
chemicals entering the marine environment (Long Island 
Sound Lobster Health Symposium, 2003). Since crustacean 
reproduction, development, and metamorphosis are known 
to be partly regulated by a juvenile hormone, methyl farne- 
soate (MF) (reviewed by Laufer and Biggers. 2001). we 
have joined these investigations, asking whether lobsters 
and marine sediments contain exogenous chemicals with 
juvenile-hormone activity (JH activity) that may affect the 
health of these crustaceans and act as endocrine disruptors. 

MF is a sesquiterpenoid hormone that is similar in struc- 
ture to insect juvenile hormones and is secreted by the 
mandibular organ. Previous investigations in our laboratory 
indicated that extracts of marine organisms and sediments 
display JH activity in insect cuticle bioassays (Biggers and 
Laufer. 1992; Biggers. 1994). Here we report the identifi- 
cation of four alkylphenols that are similar in structure to 
the endocrine disruptor bisphenol A and are present in 
sediment samples. We found these alkylphenols to possess 
high JH activity, and one of them was initially developed as 
a mosquito insecticide. We also report finding these lour 
alkylphenols in lobster hemolymph and two alkylphenols in 
hepatopancreas tissue. These results suggest that these 
chemicals, like bisphenol A and other alkylphenols. may 
have widespread distribution in the marine environment 
where, at low concentrations, they may be acting as endo- 
crine disruptors in the lobster, and at higher concentrations, 



14 



W. J. BIGGERS AND H. LAUFER 



they may contribute to the high mortalities of lobsters in 
Long Island Sound and elsewhere. 



Materials and Methods 



Animals 



Mature male and female lobsters, ranging in weight be- 
tween 300 and 450 g (shorts) were collected from Long 
Island Sound and from Vineyard Sound. Massachusetts. 
Long Island Sound animals were kept in recirculating tanks 
at Storrs, Connecticut, and animals from Vineyard Sound 
were maintained in running seawater at the Marine Biolog- 
ical Laboratory, Woods Hole, Massachusetts. The animals 
were fed squid ad lihiniiu. Immediately upon arrival, the 
animals were bled with 5-cc plastic syringes and 23-gauge 
needles. 

Chemicals 

The following chemicals were purchased from Sigma- 
Aldrich: 4-cumylphenol [also known as 4-dimethylbenzyl- 
phenol); 2.4-bis-(dimethylbenzyl (phenol; bisphenol A (also 
known as 2,2-bis(4-hydroxyphenyl (propane j; nonylphenol- 
( mixed isomers); the juvenile hormones JH III and JH I; 
lutein; cholesterol; arachidonic acid; stearic acid; and far- 
nesol. Pyriproxyfen was kindly provided by Dr. William 
Bowers (University of Arizona), and 2-f-butyl-4-(dimethyl- 
benzyl (phenol. 2.6-bis-(r-butyl)-4-(dimethylbenzyl)phenol, 
2,4-bis-(dimethylbenzyl)-6-/-buty I phenol, and trans-trans 
methyl farnesoate were synthesized in the laboratory. Ace- 
tonitrile, acetone, and hexane used for extractions and in 
HPLC analysis were purchased from Fisher Chemical and 
were of HPLC grade. 

Extraction of marine sediments 

Samples were taken from the top 6-12 in. of marine sedi- 
ment in the inteitidal zones of Vineyard Sound, Massachusetts, 
and Great Bay, New Jersey. The sediments were tillered 
through a 1 -mm wire sieve to remove large debris, then kept 
frozen at -20 C. A 25-g portion (wet weight) of each sedi- 
ment sample was extracted with 50 ml of acetone, and the 
yellowish acetone extract was filtered through Whatman #1 
filter paper to remove particulates. Five milliliters of the ace- 
tone filtrate was evaporated to dryness under nitrogen in glass 
vials and resuspended in 200 /xl of hexane. The resuspended 
extract (200 JJL\) was applied to the top of a PrepSep silica 
solid-phase extraction column (Fisher Scientific) that had been 
pre-equilibratcd with 10 ml of hexane. The columns were 
eluted sec|iientially with solvents of increasing polarits: 3 ml 
hexane; 3 ml hexane/20' ,; ethyl ether; and finally, 3 ml 100% 
cih\l ether. The 100' < cllrsl cilia eluale. which was yellow 
and showed high JH activity, was stored at -20 C. For 
GC7MS analysis. 1 ml of the ethyl ether eluale was evaporated 
to dryness under nitrogen, then resuspended in 200 fji\ of 



hexane in small amber vials that were stored at 20 C before 
analysis. By this method, using chemical standards, extrac- 
tion and recovery efficiencies for the four phenols were 95% 
for 2-f-butyl-4-(dimethylbenzyl (phenol and 2,6-bis-( /-butyl )- 
4-(dimelhylbenzyl (phenol, 47% for 2,4-bis-(dimethylbenzyl)- 
phenol, and 50% for2,4-bis-(dimethylbenzyl)-6-/-butylphenol. 

Extraction of hemolymph and hepatopancreas 

For each hemolymph sample. 2 ml was added into Pyrex 
culture tubes (prebaked at 250 C before use) containing 2 
ml of cold 4% NaCl and 2 ml of acetonitrile, and then kept 
frozen at 20 C. Samples were extracted with 2 ml of 
hexane by vortexing for 5 min. The tubes were centrifuged 
at 600 X g for 30 min. and 1.5 ml of the hexane phase was 
pipetted off and evaporated with a stream of nitrogen to 150 
jul in amber glass vials. Before analysis by GC/MS, the 
hexane extracts were stored at -20 C. 

Hepatopancreas from two lobsters was rinsed in 4% NaCl 
and weighed; 2 g of the tissue was homogenized in 4 ml of 
cold acetonitrile and extracled with 4 ml of 4% NaCl and 2 
ml of hexane. The hexane phases were then processed as 
described for the hemolymph samples before analysis by 
GC/MS. By this method, using standards, extraction and 
recovery efficiencies for the four phenols were 90% for 
2-/-butyl-4-(dimethylbenzyl)phenol and 2,6-bis-U-butyl)-4- 
(dimethylbenzyl)phenol, and 45% for 2,443is-(dimethylben- 
zyl (phenol and 2,4-bis-(dimethylbenzyl)-6-;-butylphenol. 

Gas chromatography/mass spectrometr\ anal\sis 

The lobsler extracts and marine sediments were analyzed 
by gas chromatography/mass spectrometry using a Hewlett- 
Packard HP 5890 GC/5970 MSD GC/MS equipped with a 
12.5-m. 0.20-mm-diameter column of cross-linked dimeth- 
ylsilicone with film thickness of 0.33 /im. The operating 
conditions for GC were an initial temperature of 35 C for 
2 min, followed by a 15 C/min ramp to 270 'C, then a 10-min 
hold at 270 C, for a total run time of 27.67 min. Operating 
conditions tor MS analysis were set to detect ion masses ol 
50 to 500 MW, by electron impact ionization using the scan 
mode. Individual compounds were identified by comparing 
their mass spectra with published library spectra. Identifi- 
cation of the four phenolic compounds and diisooctylphthal- 
ate was confirmed by comparison of mass spectra and 
retention times with those of chemical standards that were 
either purchased, as were 2.4-bis-(dimethylbenzyl (phenol 
and diisooct\ Iphthalate. or synthesi/ed in the laboratory, as 
was 2-/-butyl-4-(dimethylben/yllphenol, 2.6-bis-U4^utyl(- 
4-(dimethylben/\ I (phenol, and 2.4-bis-(dimeth\ lbenzylt-6-/- 
bulylphenol described below. The phenols were quantified 
by integration of peaks and comparison of peak areas with 
known amounts of authentic standards. 



JH-ACTIVE ALKYLPHENOLS IN LOBSTERS AND MARINE SEDIMENTS 



15 



Chemical synthesis 

The compounds 2-/-butyl-4-(dimethylbenzyl (phenol and 
2,6-bis-U-butyl)-4-(dimethylbenzyl (phenol were prepared 
by a Friedel-Crafts alkylation reaction. For synthesis, 15 g 
of 4-cumylphenol was dissolved in 75 ml of f-butylchloride 
in a 125-ml Ehrlenmeyer flask containing a stir bar. The 
reaction was started by addition of 100 ing of FeCl,-5H,0 as 
catalyst with constant stirring at room temperature. The 
reaction was carried out in a fume hood to vent the evolved 
HC1 gas. After 24 h, the reaction was stopped by transfer- 
ring the reaction mixture to a 500-ml Ehrlenmeyer flask and 
adding 200 ml of distilled water. The phenols were ex- 
tracted with 100 ml of hexane, and isolated and purified to 
99% purity (determined by GC/MS) from the reaction mix- 
ture by normal-phase HPLC using a silica column (Varian 
microsorb, 250 mm. 100 A) and hexane/6% acetone as 
running solvent. 

The monophenol 2,4-bis-(dimethylbenzyl)-6-/-butylphe- 
nol was prepared using a Friedel-Crafts alkylation reaction, 
in the same way as were the other phenols, except that 1 5 g 
of 2,4-bis-(dimethylbenzyl)phenol was used as the starting 
material for synthesis, and the phenol product was purified 
by normal-phase HPLC using a running solvent of hex- 
ane/ 1% ethyl ether. 



Bioiissuy for juvenile hormone nctivity 

The phenolic compounds were assessed for JH activity 
using a rapid and sensitive assay based on their effects on 
the settlement and metamorphosis of larvae of the 
polychaete Capitella (Biggers and Laufer. 1996). The re- 
sults of this bioassay are comparable to those of the GallerUi 
JH bioassay: in both bioassays the test chemicals showed 
similar patterns of variation in JH activity. In this bioassay, 
no false positives or false negatives have been found for the 
compounds tested. Test chemicals were dissolved in 100% 
ethanol to give stock solutions of 0.1, I, 10, and 100 [i.M, 
and aliquots of up to 100 /id of the stock solutions were 
added to 60-mm glass petri dishes each containing 10 ml of 
artificial seawater (Utikem, Co.), salinity 30 ppt, and 10 
swimming 2-day-old metatrochophore larvae. Controls re- 
ceived up to 100 /j.1 of ethanol. Dishes were swirled to 
disperse the test chemicals. Each concentration was tested in 
triplicate for every bioassay, and two bioassays were run 
(total dishes = 6, total number of larvae = 60) for each 
concentration tested. Settlement and metamorphosis of lar- 
vae was monitored using a stereobinocular microscope. 
After 1 h, the number of larvae that had settled and meta- 
morphosed was recorded. Data are reported as EC 5(I values 
for each chemical, at the final concentration that induces 
50% of the larvae to settle and metamorphose in 1 h. 



Results 

Alkylphenoh in lobster hemolymph and hepatopancreas 

The analysis of the hexane extracts of 14 samples of 
lobster hemolymph by GC/MS indicated the presence of 
four alkylphenols: 2-/-butyl-4-(dimethylbenzyl)phenol (mo- 
lecular weight 268); 2,6-bis-U-butyl)-4-(dimethylbenzyl)- 
phenol (molecular weight 324, CAS no. 34624-81-2), also 
named 2,6-<//-fm-butyl-4-cumylphenol; 2,4-bis-( dimethyl- 
benzyl (phenol (molecular weight 330, CAS no. 2772-45-4). 
also named 2,4-dicumylphenol; and 2,4-bis-(dimethylben- 
zyl)-6-r-butylphenol (molecular weight 386). The mass 
spectra for these chemicals matched those of the published 
library (Wiley) mass spectral database with a quality fit of 
more than 90%. Further continuing the identity of these 
compounds, the retention times of purchased or chemically 
synthesized standards also gave the same retention times 
and mass spectra as those of the compounds identified in the 
hemolymph (Figs. 1. 2. 3). 

The levels of these four alkylphenols varied between 
lobsters. The compound 2-/-butyl-4-(dimethylbenzyl (phe- 
nol was found in 13 of the 14 lobsters analyzed, at concen- 
trations ranging from 0.02 to 1.15 /J-g/ml of hemolymph, 
giving an average of 0.46 0.1 1 /xg/ml (mean standard 
error of the mean). The compound 2.6-bis-(f-butyl)-4-(di- 
methylbenzyl (phenol was present in the hemolymph of 11 
of the 14 lobsters, at concentrations ranging from 0.01 to 
1 3.00 /Mg/ml of hemolymph, with an average of 1 .89 1.14 
jug/ml. The compound 2.4-bis-(dimethylbenzyl (phenol was 
detected in the hemolymph of all 14 lobsters analyzed, at 
concentrations ranging from 0.07 to 19.78 /ng/ml of hemo- 
lymph, giving an average of 4.03 1.52 /ig/ml. The com- 
pound 2.4-bis-(dimethylbenzyl)-6-/-butylphenol was found 
in the hemolymph of 1 1 of the 14 lobsters, at concentrations 
ranging from 0.20 to 70.71 /J.g/ml of hemolymph, giving an 
average of 10.98 6.414 jug/rnl. 

The relative amounts of these four phenols varied greatly 
between the two localities from which the lobsters were 
taken (Table 1 ). Lobsters from Long Island Sound showed 
much higher average concentrations of 2,6-bis-(?-butyl)- 
4-(dimethylbenzyl)phenol. 2.4-bis-(dimethylbenzyl)phenol. and 
2,4-bis-(dimethylbenzyl)-6-f-butylphenol than those from 
Vineyard Sound, whereas lobsters from Vineyard Sound 
had much higher average concentrations of 2-f-butyl-4- 
(dimethylbenzyl (phenol. Interestingly, the phthalate ester 
diisooctylphthalate was also identified in lobster hemo- 
lymph. but only in the seven lobsters analyzed from Vine- 
yard Sound, with concentrations ranging from 0.04 to 0.39 
jug/ml of hemolymph. 

Two of the phenols were also found in extracts made 
from the hepatopancreas of two additional lobsters. The 
concentrations of 2, 6-bis-( /-butyl )-4-(dimethylbenzyl (phe- 
nol in the two hepatopancreas samples were found to be 
2.55 and 6.1 1 /ag/g of tissue, and concentrations of 2,4-bis- 



16 



W J BIGGERS AND H. LAUFER 



Abundance 


1 


3 




160000 - 








140000 - 








120000 - 








100000 - 








80000 - 








60000 - 






4 5 


40000 






1 


20000 - 


1 


, 
III 




0- 
Time-->13 


L . l\ 


L A . JLt ,IV.AJU .A. LM. 


m . A 


p~*-f r i "Tr"i r* i * 1 *~1 p^ 1 r i j iti i | 11 i i | 11-1 i j i i i i j 

.00 14.00 15.00 16.00 17.00 18.00 19.00 



Figure 1. Gas chromatogram of a lobster hemolyniph sample from Martha's Vineyard showing relative 
retention times of 2-f-butyl-4-(dimethylbenzyl)phenol. MW 26X (peak I ); 2,6-bis-(r-butyl)-4-(dimethylbenzyl)- 
phenol. MW 324 (peak 2); 2,4-bis-(dimethylbenzyl (phenol. MW 330 (peak 3); 2,4-his(dimethylbenzyl)-6-/- 
hutylphenol, MW 3X6 (peak 4): and diisooctylphthalate, MW 390 (peak 5). 



(dimethylbenzyl)-6-?-butylphenol were 23.56 and 26.89 



tration from 49.47 to 77.89 jug/g: and with 2-/-butyl-4- 
(dimethylbenzyl (phenol being the lowest at 8.95 to 21.58 



Alkylphenols in imirine sediments 

Analysis by GC/MS of ethyl ether fractions from silica 
columns, derived from a Vineyard Sound sediment sample 
and a Great Bay sediment sample, both of which showed 
high JH activity in the Capitella bioassays (data not shown), 
indicated the presence of the same four alkylphenols found 
in the lobster: 2-/-butyl-4-(dimethylbenzyl)phenol; 2,6-bis- 
(f-butyl)-4-(dimethylbenzyl)phenol, 2,4-bis-(dimethylben- 
zyl (phenol, and 2,4-bis-(dimethylbenzyl)-6-f-buty Iphenol 
(molecular weight 386). 

The concentrations determined for these alkylphenols 
differed between the two sediment samples analy/.ed (Table 
2). Concentrations of all four phenols were higher in the 
sediment sample from Great Bay, New Jersey (range from 
21.58 to 2? 1.01 /Ag/g of sediment) than in the sediment 
sample from Vineyard Sound, Massachusetts (range be- 
tween 8.95 and 181.20 /ug/g of sediment). Of considerable 
interest is the finding that both samples showed the same 
relaliu- profiles, with 2,4-bis-(dimethylbenzyl)-6-/-butyl- 
phenol being found in the highest concentration of the four 
phenols, at 181.20 to 251.01 /ug/g of sediment; followed by 
2, 4-bis-(dimethylhen/vl (phenol at concentrations ranging 
from 138.94 to 224.89 jzg/g of sediment; followed by 2,6- 
bis-(f-butyl)-4-(dimethylbenzyl)pheno] ranging in concen- 



JH acti\'il\ of alk\lphenols 

One of the phenols identified. 2,6-bis-(/-butyl)-4-(di- 
methylben/yl (phenol, was previously developed as a ju- 
venile-hormone mimic and mosquito insecticide (MON- 
0585) by the Monsanto Chemical Corporation (Sacher, 
1971; Jakob and School", 1972). so it was of great interest 
to examine these phenols for juvenile-hormone activity. 
Results of the Capitella bioassay showed that the MON- 
0585 compound had very high JH activity (EC 3( , at 0.5 
;uA/) compared with MF, JH I, JH III, and the JH analog 
pyriproxyfen, which was also developed as an insecticide 
(Table 3). The other three alkylphenols identified also 
exhibited very high JH activity. Since these compounds 
share a high structural homology with the known xe- 
noestrogens bisphenol A and 4-cumy Iphenol (Fig. 4), 
these latter chemicals were also tested for JH activity. 
Bisphenol A showed very high JH activity (EC 50 of 0.05 
/J.M), whereas 4-cumy Iphenol showed high activity (EC 5n 
of 3 /J.M). Mixed isomers of nonylphenol, a well-known 
alkylphenol, also showed high JH activity (HC 5I > of 1 
,uA/) ('fable 3). 



JH-ACTIVE ALKYLPHENOLS IN LOBSTERS AND MARINE SEDIMENTS 



17 



Abundance 


Scan 1067 


(15.154 mini i L173PBB.D () 
2! 


3 


8000 - 








6000- 








4000 














268 


2000 


m/z--> 


57 91 

77 1 5 1: 


9 
152 165 191 225237 

1 f ' n" '' ' \' ' 




40 60 80 100 I! 


.0 140 160 180 200 220 240 260 


Abundance 


637458: 2-t-Butyl-4- (dimethylbenzyl) phenol (*) 
/\ 2! 


3 


8000 




V 

o* c w, 




6000- 




CjX_ 




4000 














268 


2000- 

0- 
m/z--> 


41 " l f 

77 J 
. .,. . L. .... J. L 


.9 
131 152165 191 203 225237 




40 60 80 100 1 


20 140 160 180 200 220 240 260 



A. 



Abundance 








Scan 


1097 


(15.501 min) : L6SBB.D (*) 

31 


9 


8000 


















6000 


















4000 


















2000 



m/z- -> 




5 


7 
9 


1 119 
103 1 133 


165178 203 221 2 * 7 267 293 


324 


40 60 80 


ioo 'ii 


140 


160 180 200 220 240 260 280 300 320 


Abundance 


#195907: 


2,6-Bls(t-butyl)-4-(dimethylbenzyl)phenol ( 

3i 

f"N 


) 
9 


8000 - 














V 




6000- 














r^l 

wfl^^V^a"* 




4000- 




5 


7 








CM 


324 


2000 
0- 


4 


1 


9 

.. li. 


i 1: 

103 

. V,'.V 


9 

i: 

|f, 


3 


165178 203215 2 *, 7 267 2 ?3 


1 


4 


WWjTTTTp 

60 80 


100 1 


!0 


140 


160 180 200 220 240 260 280 300 320 



B. 



Figure 2. (A) 2-f-Butyl-4-(dimethylbenzyl)phenol. Mass spectra from lobster hemolymph (upper) and from 
reference library database, along with structure (lower) of 2-r-butyl-4-(dimethylben/yl)phenol (molecular weight 
286). (B) 2,6-Bis-(f-butyl)-4-(dimethylbenzyl)phenol. Mass spectra from lobster hemolymph (upper) and from 
reference library database, along with structure (lower) of 2,h-bis-( /-butyl 1-4-1 dimelhylben/y I (phenol (molecular 
weight 324). 



18 



W J. B1GGERS AND H. LAUFER 



Abundance 




Scan 1355 


(18.033 mln) : L64BB.D (*) 
3 


5 


8000 - 














6000 - 














4000 




9 


i 


1. 


.9 






330 


2000 




57 


103 
I 




2. 


17 






0- 
m/z--> 




jjilk 


i 


U, 


150 lg c 


|265 299 






50 100 150 200 


"1f-f 1 f , y -1 L i r- , 

250 300 


Abundance 


846982: 2 , 4-Bis (ditnethylbenzyl ) phenol () 

r^i 3 


5 


8000- 








X, 






6000 








"V^N/* 

T /Si^S 




330 










* \J 








4000 - 




91 


















103 119 1( 


237 






2000 - 


4 


1 
















- 




u 6 , 5 i 


.1. 


LiL 




t 16 L 5 yi _202 


L 1 265 299 






m/z--> 50 100 150 200 


250 300 



A. 



B. 



Abundance 


Scan 1355 (18.200 rain): L65BB.D (*) 












3 1 


1 


8000 - 




57 










6000 - 
















4000 - 












293 


31 


6 










85 












2000 - 




1 




119 

1 








0- 




L 


ll 


JU 


1 


8 
203 231 267 


309 

i 








so 


100 


ISO 


200 250 300 350 ' 


Abundance 


#52799: 2 


4 -bis (dimethylbenzyl) -6- t-butylphenol 

i^S 3 


1 


8000 - 










.X. 














I**! 


386 


6000 - 










J%JL/" 












1] 


9 


"' IJ 293 






4000 - 






91 
















57 
















2000 - 


4 


1 








178 








- 
m/z- -> 




J ^..i 




, 


L 


139 165 

IX L.. ^ L 


203 231 265 

r v i' 1 ' r t~-t r .. r i J 


309 
1 329 








SO 


1 ^' n *" 
100 


1 1 1 [ 1 1 

150 


T^ T^ | 1 1 1 1 J 1 1 1 1 1 

200 250 300 350 



Figure 3. (A) 2,4-Bis-(dimethylbenzyl)phenol. Mass spectra from lobster hemolymph (upper) and from 
ii'k'ivnce lihrars datahase. along with structure (limen ol 2,4-bis-(dimethylbenzyl)pheno] (molecular weight 
i ; ()i (Bi 2,4-Bis-(dimethylbenzyl)-6-f-butylphenol. Mass spectia from lohstet hcnml\inpli (upper) and from 
reference library database, along \\iih structure (lower) of 2,4-bis-(dimethylbenzyl)-6-/-butylphenol (molecular 

wciL'hl 



JH-ACTIVE ALKYLPHENOLS IN LOBSTERS AND MARINE SEDIMENTS 

Table 1 
Relative concentrations of alk\lpljenols in heniol\mph from lobsters collected from Long Isltind Sound fLIS) ami Vine\ard S(tttnil (\'St 



19 



Alkylphenol 




Average hemolymph concentration (/^g/ml) SEM 




LIS 


VS 


Combined 
(LIS + VS) 


2-;-butyl-4-(dimethylbenzyl (phenol 
2,6-bis-(r-butvl)-4-(dimethylbenzyl (phenol 
2. 4-bis-(dimethvlbenzyl (phenol 
2,4-bis-(dimethylbenzyl)-6-r-but\lphenol 


0.10 0.06 
3.76 2.11 
5.1 7 3.05 
21.50 11.89 


0.83 0.07 
0.03 0.01 
2.90 0.55 
0.45 0.09 


0.46 0.11 
1.89 1.14 
4.03 1 .52 
10.98 6.41 



SEM: standard error of the mean. 

n = l for each mean for LIS and VS; n = 14 for combined animals. 



Discussion 

Our analyses by GC/MS indicate the presence of alkyl- 
phenols in 14 samples of lobster hemolymph, 2 samples of 
hepatopancreas tissue, and two samples of marine sediment. 
Alkylphenols are used primarily in the production of alkyl- 
phenol ethoxylates (APEs). which are found in industrial 
and household detergents, surfactants, paints, and wetting 
agents, and which have applications in wood pulping, textile 
manufacture, plastics manufacture, and petroleum recovery, 
among other uses (Nay lor et ul.. 1992). Besides their use to 
produce APEs, alkylphenols are also used in the production 
of phenolic resins, as antioxidant stabilizers for plastics and 
polymers, and as curing agents (Ying et al., 2002). 

An estimated 500 million pounds of alkylphenols are 
used annually (Zintek et ul.. 2003). and an estimated 
500.000 tons of APEs are produced annually (Naylor et til.. 
1992; Ying et /., 2002). Environmental contamination by 
these chemicals and their breakdown products in rivers, 
oceans, and sediments is well known and widespread (Hale 
et ul.. 2000). Of the 500,000 tons of APEs produced, about 
60 percent are estimated to end up in the aquatic environ- 
ment, as these chemicals and their breakdown products 
(which are alkylphenols) are released from wastewater out- 
falls or directly into the environment (Renner, 1997; Ying et 



Table 2 

Relative concentrations of alkylphenols in murine sediments from 
Vineyard Sound. Massachusetts (VS) and Great Buy. Ne\t : Jersey (GBI 



Alkylphenol 


Concentration 
(fig/gm sediment) 


VS GB 


2-r-butyl-4-(dimethylbenzyl (phenol 
2, 6-bis-(r-butyl)-4-(dimethylbenzyl (phenol 
2.4-bis-(dimethylbenzyl)phenol 
2,4-bis-(dimethylhenzyl)-6-/-butylphenol 


8.95 21.58 
49.47 77.89 
138.94 224.89 
181.20 251.05 



til.. 2002). Alkylphenols have been detected in the water, in 
sediments, and in fish tissues (Lye et ul.. 1999; van Heemst 
c/ <//., 1999); in sediments, levels have been reported to be 
as high as 70 jug/g in the United States (Ying et al., 2002). 
The alkylphenols identified in this report are similar in 
structure to bisphenol A (BPA). a well-known endocrine 
disrupter (Fig. 4). BPA is utilized primarily in the produc- 
tion of polycarbonate plastics. It is also a major antioxidant 
component of the epoxy resins used to line food cans and 
pipes, and is used in dental sealants (Staples et al.. 1998). 
Over 200,000 tons of BPA are produced annually by Japan 

Table 3 

Juvenile hormone activity of alkylphenols compared with activity of 
known juvenile hormones, using a Capitella -.cit/cnicnt and 
metamorphosis hioasxay 



Chemical tested 



EC 5( , 



Juvenile hormones 
JH I 
JH III 
tran\, trans-melhy\ farnesoate 

(crustacean juvenile hormone) 
pyriproxyfen (JH-mimicl 

Alkylphenols 

2-/-buty 1-4-1 dimethylbenzyl (phenol 

2.4-bis-(dimethylbenzyl)phenol 

2,6-bis-(f-butyl)-4-(dimethylbenzyl)phenoI 

UH-mimic MON-0585) 
2.4-bis-(dimethylbenzyl(-6-r-butylphenol 
4-cumylphenol 
hisphenol A 
nonylphenol (mixed isomersi 

Other chemicals tested 
farnesol 

arachidonic acid 
stearic acid 
cholesterol 
lutein 



25 
3 

1 



1 
2 

0.5 

1 
3 

0.05 
I 



40 
70 

410 
NA 
NA 



Data shown is for one sediment sample from VS and one from GB. 



NA: not active at highest concentration tested ( 1000 / 



20 



\V J RIGGERS AND H. LAUFER 



(H S C) 3 C 




C(CH 3 ), 





A. 2,6-bis-(t-butyl)-4- 
(dimethylbenzyl) phenol 
(MON-0585) 



B. 4-cumylphenol 



C. Bisphenol A 



Figure 4. Comparison of chemical structures of 2,(vbis-(/-butyl)-4-(dimethylbenzyl)phenol. 4-dimethylben- 
zylphenol. and bisphenol A. (A) Chemical structure of the juvenile hormone mimic and mosquito insecticide 
MON-05S5 (same as 2,fi-bis-(/-butyl)-4-(dimethylben/yl)phenol). (B) Chemical structure of 4-cumylphenol. (C) 
Chemical structure of the known endocrine disrupter bisphenol A. 



alone (Kumiunt et ul.. 1997). and environmental contami- 
nation hy this chemical has in recent years been of major 
public concern. The endocrine-disrupting effects of BPA 
have been demonstrated to alter the reproductive physiology 
and development of mammals (Stoker et ai. 1999; Takao et 
al, 1999), fish, and invertebrates including molting of the 
insect Clunmonnis /V/W/H.V (Watts ct al.. 2001: Segner ct 
ul.. 2003). BPA can leach from food cans and plastic bottles 
into foods and beverages and from there into the human 
digestive system: it subsequently travels through sewage 
treatment plants and eventually into river systems and 
oceans (Staples ct al.. 1998; From me ct ul., 2002). Further- 
more, the plastic-particle waste that is prevalent in the 
oceans can also directly leach BPA into the environment 
(Sajiki and Yonekubo, 2003). BPA contamination in sedi- 
ments is widespread: for example, levels have been reported 
as 0.05 )u,g/g dry weight in Ulsan Bay. Korea (Khim ct ul., 
2001), in Onsan Bay, Korea: as 0.20 /ug/g dry weight (Koh 
<7 (//.. 2002): and as 0.19 jug/g in Germany (Fromme ct ul.. 
2002). 

The four alkylphenols we have identified in lobsters and 
marine sediments are used together in antioxidanl blend 
formulations tor manufacturing rubber and plastic poly- 
mers. A patent by Russell ct ul. (2002) states thai these 
phenols are found in ihe Wingstay C and Polystay C anli- 
oxiil.inl formulations used in lire manufacturing by the 
(ioodyear Tire and Rubber Co. Similarly, a paleni by 
Messina </ ul. ( 1982) slates thai these phenols are added as 
slabili/ers for organic polymers including rubbers and plas- 



tics. Other antio.xidant applications include their use in 
pesticide formulations and in therapeutics (Smith. 2002). 
These phenolic antioxidants therefore appear to be widely 
employed in a fashion similar to BPA. 

2,4-bis-(dimethylbenzyl)phenol 

One alkylphenol we found in lobster hemolymph and 
marine sediments. 2.4-bis-(dimethylbenzyl (phenol, is sold 
under the tradename 2.4-dicumylphenol. or 2.4-DCP. This 
reagent is used in antioxidant mixtures (Messina et ul.. 
1982: Russell ct ul.. 2002) as previously mentioned, and 
appears to also have a use in surfactant formulations. This 
chemical is also released into the environment upon hydro- 
lysis of the antioxidant plastici/er bis-(2,4-dicumylphe- 
nyllpentaerythritol diphosphiie. The use of this plastici/er 
in food containers is regulated by the food industry (Scien- 
tific Committee on Food. 2001 ). The 2.4-DCP compound is 
close in structure to that of 4-cumylphenol. another indus- 
trial alkylphenol (Fig. 4). Hale ct ul. (2000) reported levels 
of 4-cumylphenol as high as 70 jug/g of sediment in sedi- 
ments near waste-water outfalls in the United States. To our 
knowledge, pollution by 2.4-bis-(dimethylbenzyl (phenol in 
sediments or aquatic life has not been reported. However, 
we found this phenol in sediments from Vineyard Sound at 
a concentration of 138.94 /ug/g (wet weight) and at higher 
concentrations in Great Bay. New Jersey, at 224.89 jug/g, 
which is close to the concentration reported for 4-cumyl- 
phenol by Hale ct ul. (2000). 



JH-ACTIVE ALKYLPHENOLS IN LOBSTERS AND MARINE SEDIMENTS 



21 



2,6-bis-(t-butyl)-4-(dimethylbenzyl)phenol 

Concentrations of 2,6-bis-(f-butyl)-4-(dimethylbenzyl)- 
phenol were higher in lobsters taken from Long Island 
Sound than in those from Vineyard Sound, and this phenol 
was also found in sediment samples from the two locations. 
As previously mentioned, Monsanto developed this com- 
pound as a juvenile hormone mimic, named MON-0585, for 
application as a mosquito insecticide (Sacher, 1971; Jakob 
and School". 1972); however, it was supposedly never 
brought to commercial use (Schaefer et <//.. 1474). Like 
other alkylphenols and BPA. this one has also gained in- 
dustrial use as an antioxidant in polymer manufacture 
(Hanauye et uL. 1476; Messina et ai. 1982; Russell et til.. 
2002). Environmental contamination by this chemical has 
presumably not been documented before; however, it has 
been found in propolis, which is produced by bees and 
derived from the resins of tree bark and leaves (Hegazi and 
El Hady, 2002). 

2-t-butyl-4-(dimethylbenzyl)phenol and 2,4-his- 
(dimethylbenzyl)-6-t-butylphenol 

The compounds 2-f-butyl-4-(dimethylbenzyl (phenol and 
2.4-bis-(dimethylbenzyl)-6-/-butylphenol were both found 
in lobster hemolymph and marine sediments, and are used 
industrially in antioxidant blends for the manufacturing of 
rubber and other polymers (Messina et til.. 19S2; Russell ft 
nl.. 2002). Interestingly, these phenols, along with 2,4-bis- 
(dimethylbenzyl (phenol, were found to be cyclooxgenase 
inhibitors that occur naturally in peat (Russell et al.. 2002). 
Under the tradename isobutylenated methylstyrenated phe- 
nol, the 2.4-bis-(dimethylbenzyl)-6-?-butylphenol com- 
pound is listed as having a high production volume ( more 
than a million pounds produced per year) by the U.S. 
Environmental Protection Agency in its High Production 
Volume Challenge Program, which encourages manufactur- 
ers to investigate the toxicity of these chemicals (U.S. EPA. 
2002). This compound has also been reported in sediments 
contaminated with coal tar sediments (Zeng and Hong. 
2002). The 2-?-butyl-4-(diniethylbenzyl)phenol compound, 
however, has not been reported as a contaminant until now. 

Probable sources of the alklphenols and likelihood of the 
presence of other phenols 

Given that these identified alkylphenols are used in in- 
dustrial antioxidant formulations similar to those of BPA. 
and that alkylphenol and BPA contamination is well known 
and widespread, it is likely that the source of these identified 
phenols is alkylphenol contamination originating from 
wastewater outfalls or released directly into the environ- 
ment; these are the sources that have been identified for 
other alkylphenols and BPA (Ying et ai. 2002). Surface 
runoff from heavily traveled roadways containing tire resi- 



due may be a contributing source of these chemicals. It is to 
be noted, however, that three of these compounds were also 
found naturally in peat bog material (Russell et til.. 2002). 
indicating that they may be residues derived from break- 
down of plant material. More research is needed to deter- 
mine the sources of these chemicals. It should also be 
emphasized that the nonpolar extraction method employed, 
using hexane. may not be suitable for the extraction of some 
of the more polar phenols, such as BPA and 4-dimethyl- 
benzylphenol, which may therefore also be present. 

In support of the view that environmental contamination 
is a source for alkylphenols, the plasticizer diisooctylphtha- 
late was also found in fairly high concentrations in the 
hemolymph of 7 of the 14 lobsters examined, indicating 
these lobsters indeed had exposure to plasticizers. Control 
experiments done in our laboratory showed that the phenols 
and diisooctylphthalate found were not derived from labo- 
ratory contamination by soap, glassware, pipettes, or sy- 
ringes, and were not from the GC columns since control 
extractions did not produce these chemicals. It therefore 
appears that these alkylphenols. like other alkylphenols and 
BPA, result from environmental contamination. The relative 
levels of these phenols in the lobsters and sediments dif- 
fered at different locations, and this presumably reflects 
different amounts and different formulations of alkylphe- 
nols used in different geographic areas. Alkylphenols may 
also have originated from nonlocal sources and been carried 
by currents. 

Effects of alkylphenols on crustaceans 

What effect these compounds have on lobsters is cur- 
rently being investigated in our laboratory. Given that these 
phenols are similar in structure to BPA and show high JH 
activity in bioassays, it is likely that they have serious toxic 
and endocrine-disrupting effects. The high toxicity of alky- 
phenols to aquatic life has recently been documented by the 
U.S. Environmental Protection Agency, as has the fact that 
these chemicals persist in the environment, including sedi- 
ments (U.S. EPA. 2003). Indeed, toxicity studies with 2,6- 
bis-U-buty I )-4-(dimethylben/yl (phenol (MON-0585) have 
shown that this compound does affect nontarget crustaceans 
(reviewed by Williams and Duke. 1979). In experiments by 
Costlow (1977). megalopa larvae of the blue crab Calli- 
nectcs SL/pidus were all killed in water containing 10 ppm 
MON-0585. and 6()7r were killed in 1 ppm MON-0585. 
Sublethal behavioral effects of MON-0585 on the swim- 
ming speed and phototaxis of larvae of the crab Rhithro- 
lianoiieus luirrisii have also been reported (Forward and 
Costlow. 1976) and attributed to the effects of JH mimics on 
increased respiration (Slama and Kryspin. 1979). Thus lob- 
ster larval development and metamorphosis are likely to be 
affected by this compound at critical concentrations. The 
other three phenols found probably also have effects on 



22 



\V J. B1GGERS AND H LAUFER 



lobster, since they also exhibit high JH activity and are 
structurally related to MON-0585 and BPA. For example. 
4-nonylphenol is acutely toxic to lobsters, with an LC 5I , in 
seawater reported as 0.2 ppm (0.2 jug/ml) (Cox. 1996). and 
has been found to affect the development of other crusta- 
ceans, including barnacles, in which it inhibits settlement 
and induces synthesis of vitellin-like proteins (Billinghurst 
ct ul., 1998, 2000). In our quantitative determinations, we 
found levels of 2,6-bis-U-butyl)-4-(dimethylbenzyl)phenol 
(MON-0585) in the hemolymph of lobsters as high as 13 
ppm. which Costlow (1977) found to be a lethal external 
concentration for crab larvae. The evidence thus indicates 
that these phenols may be contributing significantly to the 
lobster deaths seen in Long Island Sound, particularly under 
stressful environmental conditions such as high tempera- 
tures and hypoxia. Since JH mimics such as MON-0585 can 
increase respiration in insects (Slama and Kryspin. 1979) 
and possibly crustaceans (Forward and Costlow. 1976). 
these phenols may make the lobsters more susceptible to 
stress at low levels of oxygen. Furthermore, MON-0585 has 
been found to inhibit cuticle arylation and hardening in 
mosquitoes (Zomer and Lipke. 1981; Semensi and Sugu- 
maran, 1986). We speculate that this compound may also 
interfere with cuticle formation and hardening in lobsters, 
making them more susceptible to chitinolytic microorgan- 
isms and shell disease. This disease has become increas- 
ingly prevalent in lobsters in recent years (Castro and An- 
gell, 2000). 

Because MON-0585 was developed as a juvenile hor- 
mone mimic, it is not surprising that other structurally 
related alkylphenols also possess JH activity: all four al- 
kylphenols exhibited such activity in the Cupitellu bioassay 
when tested at concentrations found in the hemolymph 
(Tables 2, 3), raising the possibility that these alkylphenols 
may have JH-like effects on the lobster. Because reproduc- 
tion, development, and metamorphosis in crustaceans are 
partly regulated by methyl farnesoate. a compound with 
juvenile hormone activity, the alkylphenols we investigated 
may function as endocrine disruptors in the lobster at low 
concentrations. Exogenous application of JH analogs can 
perturb normal metamorphosis and molting (reviewed by 
Laufer and Biggers, 2001). Like JH and its analogs, the 
JH-active alkylphenols may act through membrane-bound, 
intracellular, and nuclear receptors to bring about changes in 
morphogenesis and stimulation of vitellogenesis through 
vitellogenin gene induction and increased vitellogenin up- 
take (Engelmann. 1983; Sehnal. 1983: Wyatt. 1991; Davey 
and Gordon, 1996; Jones and Sharp. 1997). As evidence for 
this mechanism of action, both 4-nonylphenol and BPA 
have been found to induce vitellogenesis in vertebrates 
(Jones a ni. 2000). 

To our knowledge, our results are the first to demonstrate 
that \enoestrogens such as BPA and nom Iphenol have JH 
activity, indicating a possible relationship between estroge- 



nicity and juvenile hormone activity, and the further possi- 
bility that estrogens and juvenile hormones share similar 
mechanisms of action. 

Possible bioaccumulation and health effects of the 
identified alkylphenols 

The presence of phenolic compounds in marine sedi- 
ments suggests that lobsters may acquire them through the 
food chain as found for other polyaromatic hydrocarbons 
(Pruell et ai, 2000). Interestingly, in the report by Hale el 
ul. (2000). levels of 4-cumylphenol in sediments was found 
to be much higher than those of 4-nonylphenol (70.000 
ju.g/kg compared with 1 1,000 /ig/kg). even though 80% of 
the alkylphenols used in formulations are nonylphenol 
ethoxylates (Ying et ul.. 2002). This suggests that polyaro- 
matic alkylphenols are more recalcitrant to biodegradation, 
as would be expected. It is therefore likely that, due to their 
polyaromatic structure, the alkylphenols we identified in the 
sediments are also more resistant to degradation and may 
accumulate in sediments and benthic invertebrates. These 
alkylphenols were also found in lobster hepatopancreas, and 
may be bioaccumulated there, as other polyaromatic hydro- 
carbons are known to be (McLeese and Metcalfe, 1979: 
James et ul.. 1995). Bioaccumulation in seafoods has been 
documented for 4-nonylphenol (Ekelund et ul.. 1990; Fer- 
rara et ul.. 2001). This raises concern for human health. 
Since 1995. the European community has placed a volun- 
tary ban on the use of alkylphenol ethoxylates (APEs) due 
to the toxicity and endocrine-disrupter activity of the break- 
down products (including 4-nonylphenol and 4-cumylphe- 
nol); use of these products has not been banned in the 
United States (Renner, 1997). This has sparked considerable 
debate among researchers and regulators. The potentially 
endocrine-disrupting effects of BPA have raised particular 
health concerns, especially since these are viewed as being 
potentially carcinogenic to humans (reviewed by Cox, 1996. 
and Lathers. 2002). Since the compounds identified are 
similar in structure to BPA, the presence of these com- 
pounds in lobsters may also warrant health concerns. 

Acknowledgments 

We acknowledge the help of Dr. Mike Syslo of the 
Massachusetts Division of Marine Fisheries lobster hatch- 
ery on Martha's Vineyard and Mrs. Penny Howell of the 
Connecticut Department of Environmental Protection for 
kindly supplying lobsters for (his study. We also acknowl- 
edge Dr. Judith Grassle, Rutgers University, for kindly 
supplying marine sediment samples and Capitella stocks, 
and Dr. William Bowers. University of Arizona, for kindly 
supplying pyriproxyfen. In addition, we are grateful to 
Professor James M. Bobbin. Professor James D. Stuart, and 
Mi. Christopher P. Capulong. of the Department of Chem- 
istry, University of Connecticut, for helpful discussions on 



JH-ACTIVE ALKYLPHENOLS IN LOBSTERS AND MARINE SEDIMENTS 



23 



chemical synthesis and analysis. We also acknowledge the 
help and expertise of Mr. Marvin Thompson, manager of 
the mass spectrometry laboratory and the Department of 
Chemistry. University of Connecticut, for use of the GC/MS 
facilities. We gratefully acknowledge the Sea Grant College 
Program, NOAA, and the Connecticut Department of En- 
vironmental Protection for providing financial support for 
this research. 

Literature Cited 

Biggers, W. J. 1994. Effects of juvenile hormone-active compounds on 
larval settlement and metamorphosis of the polychaete annelid G//J/- 
tella Sp. I. Ph.D. dissertation. University of Connecticut. 

Biggers, W. J., and H. Laufer. 1992. Chemical induction of settlement 
and metamorphosis of Capriella capitata sp. I. (Polychaetea) larvae by 
juvenile hormone-active compounds. Invertehr. Reproil. Dev. 22: 39- 
46. 

Biggers, W. J., and H. Laufer. 1996. Detection of juvenile hormone- 
active compounds by larvae of the marine annelid Capitella sp. I. Arch. 
Insect Biochem. Physiol. 32: 475-484. 

Billinghurst, Z., A. S. Clare, T. Fileman, J. McEvoy, J. Readman, and 
M. H. Depledge. 1998. Inhibition of barnacle settlement by the 
environmental oestrogen 4-nonylphenol and the natural oestrogen 17/3- 
oestradiol. Mar. Pollut. Bull. 36: 833-839. 

Billinghurst, Z., A. S. Clare, K. Matsumura, and M. H. Depledge. 2000. 
Induction of cypris major protein in barnacle larvae by exposure to 
4-n-nonylphenol and 17/3-oestradiol. Aquat. Tiuicol. 47: 203-212. 

Castro, K. M., and T. E. Angell. 2000. Prevalence and progression of 
shell disease in American lobster. Homurus amencuniis. from Rhode 
Island waters and the offshore canyons. J. Shellfish Res. 19: 691-700. 

Costlow, J. D. 1977. The effect of juvenile hormone mimics on devel- 
opment of the mud crab Rhilhropanopeus harrisii (Gould). Pp. 439- 
457 in Physiological Responses of Marine Biota to Pollutants. F. J. 
Vernberg, A. Calabrese, F. P. Thurberg. and W. B. Vernberg, eds. 
Academic Press. New York. 

Cox, C. 1996. Nonylphenol and related chemicals. J. Pest. Reform [On- 
line] 16: 15-20. Available: http://www.pesticide.org/nonyl.pdf [2003. 
29 September]. 

Davey, K. G., and D. R. B. Gordon. 1996. Fenoxycarb and thyroid 
hormones have JH-like effects on follicle cells of Locusta migrutoriu in 
vitro. Arch. Insect Bioclu-iu. Plivsiol. 613-622. 

Ekelund, R., A. Bergman, A. Granmo, and M. Berggren. 1990. Bio- 
accumulation of 4-nonylphenol in marine animals: a re-evaluation. 
Em-iron. Pollut. 64: 107-120. 

Engelmann, F. 1983. Vitellogenesis controlled by juvenile hormone. Pp. 
259-270 in Invertebrate Endocrinology. Vol. I, Endocrinology of 
Insects. R. G. H. Downer and H. Laufer, eds. A. R. Liss. New York. 

Ferrara, F., F. Fabietti, M. Delise, A. P. Bocca, and E. Funari. 2001. 
Alkylphenolic compounds in edible molluscs of the Adriatic Sea (It- 
aly). Environ. Sci. Technol. 35: 3109-3112. 

Forward, R. B.. Jr., and J. D. Costlow, Jr. 1976. Crustacean larval 
behavior as an indicator of sublethal effects of an insect juvenile 
hormone mimic. Pp. 279-289 in Esmurine Processes. Vol. I. Uses, 
Stresses and Adaptation to the Estuary. M. Wiley, ed. Academic Press, 
New York. 

Fromme, H., T. Kuechler, T. Otto, K. Pilz, J. Mueller, and A. Wenzel. 
2002. Occurrence of phthalates and bisphenol A and F in the envi- 
ronment. Water Res. 36: 1429-1438. 

Hale, R. C., C. L. Smith, P. DeFur, E. Harvey, E. Bush, M. J. La- 
Guardia, and G. G. Vadas. 2000. Nonylphenols in sediments and 
effluents associated with diverse wastewater outfalls. Environ. To\icol 
Chem. 19: 946-952. 



Hanauye, K., T. Takase, M. Iwasa, and M. Ito. 1976. Method for 

producing 2,6-di-tert.-butyl-4-cumyl phenol. United States Patent No. 

3.933.928. [Online] Available: www.uspto.gov [2003, September 29|. 

Hegazi, A. G., and F. K. A. El Hady. 2002. Egyptian propolis: 3. 

Antioxidant. antimicrobial activities and chemical composition of 

propolis from reclaimed lands. Z. Natiirforsch. Sect. C 57: 395-402. 

Jakob, VV. L., and H. F. Schoof. 1972. Mosquito larvicide studies with 

MON 585. a juvenile hormone mimic. Mosq. News 32: 6-10. 
James. M. O., A. H. Altman, C. L. J. Li, and J. D. Schell. 1995. 
Biotransformation. hepatopancreas DNA binding and pharmacokinet- 
ics of benzo(a)pyrene after oral and parenteral administration to the 
American lobster. Homarus amcricanus. Clicm-Biol. Interact. 95: 141- 
160, 

Jones, G., and P. A. Sharp. 1997. Ultraspiracle: an invertebrate nuclear 
receptor for juvenile hormones. Proc. Null. Acad. Sci. USA 94: 13499- 
13503. 

Jones, P. D., W. M. DeCoen. L. Tremblay, and J. P. Giesy. 2000. 
Vitellogenin as a biomarker for environmental estrogens. Water Sci. 
Technol. 42: 1-14. 
Kamiura. T., V. Tajima, and T. Nakahara. 1997. Determination of 

bisphenol A in mr. ./. Environ. Chem. 7: 275-279. 
Khim, J. S., K. T. Lee, K. Kannan, I). L. Villeneuve, J. P. Giesy, and 
C. H. Koh. 2001. Trace organic contaminants in sediment and water 
from Ulsan Bay and its vicinity. Korea. Arch. Em-iron. Contain. To\i- 
col. 40: 141-150. 

Koh, C. H., J. S. Khim, D. L. Villeneuve, K. Kannan, and J. P. Giesy. 
2002. Analysis of trace organic contaminants in sediment, pore water, 
and water samples from Onsan Bay, Korea: instrumental analysis and 
in vitro gene expression assay. Em-iron. Toxicol. Chem. 21: 1796- 
1803. 

Lathers, C. M. 2002. Endocrine disrupters: a new scientific role for 
clinical pharmacologists? Impact on human health, wildlife, and the 
environment. ./. Clin. Phannacol. 42: 7-23. 

Laufer, H., and VV. J. Biggers. 2001. Unifying concepts learned from 
methyl farnesoate for invertebrate reproduction and post-embryonic 
development. Am. Zool. 41: 442-457. 

Long Island Sound Lobster Health Symposium. 2003. S\mposium of 
the Lont; Island Sound Lobster Research Initiative and Connecticut 
Department of Environmental Protection. CT-SG-03-03, N. C. Bal- 
com, ed. Connecticut Sea Grant College Program. NOAA. 
Lye, C. M., C. L. J. Frid, M. E. Gill, D. W. Cooper, and D. M. Jones. 
1999. Estrogenic alkylphenols in fish tissues, sediments, and waters 
from the U.K. Tyne and Tees estuaries. Environ. Sci. Technol. 33: 
1009-1014 

McLeese, D. W., and C. D. Metcall'e. 1979. Toxicity of creosote to 
larval and adult lobsters Homarus amcricanus and Cram;on \eptem- 
spinosa and its accumulation in lobster hepatopancreas. Bull. Environ. 
Contain. Toxicol. 22: 796-799. 

Messina, G., L. Lorenzoni, and A. Fadda. 1982. Phenolic antioxidant 
compositions for organic polymers. United States Patent No. 
4.439.570. [Online] Available: www.uspto.gov [2003, September 29|. 
Naylor, C. G., J. P. Mieure, VV. J. Adams, J. A. Weeks, F. J. Castaldi, 
L. D. Ogle, and R. R. Romano. 1992. Alkylphenol etlum lates in 
the environment. /. Am. Oil Client. Soc. 69: 695-703. 
Pruell, R. J., B. K. Taplin, D. G. McGovern, R. McKinnev. and S. B. 
Norton. 2000. Organic contaminant distributions in sediments, 
polychaetes (Nereis virenx) and American lobster (Homarus amcrica- 
nus) from a laboratory food chain experiment. Mar. Environ. Res. 49: 
1 9 -36. 

Renner. R. 1997. European bans on surfactant trigger transatlantic de- 
hate. Environ. Sci. Technol. 31: 3I6A-320A. [Online] July 1997. 
Available: http://pubs.acs.org/hotartcl/est/97/iul/euro.html [2003. Sep- 
tember 29 1 . 
Russell, B. A., J. I). Miller. J. R. (.'ashman, and S. A. VVeeraarna. 



24 



BIGGERS AND H. LAUFER 



2(102. Naturally occurring compounds and their derivatives as cyclo- 
oxygenase 2 and/or 5-lipoxygenase inhibitors. United Stales Patent No. 
6.365,634. [Online] Available: www.uspto.gov [2003. September 29]. 

Sacher, R. 1971. A mosquito larvicide with favorable environmental 
properties. Mosq. News 31: 513-516. 

Sajiki. J.. and J. Vonekubo. 2003. Leaching of bisphenol A (BPA) to 
seawater from polycarbonate plastic and its degradation by reactive 
oxygen species. Chemospherej 51: 55-62. 

Schaefer, C. H., T. Miura, F. S. Mulligan, III, and R. M. Takahashi. 
1974. Insect development inhibitors: biological activity of RE 17656. 
RE17937, and RE18286 against mosquitoes (Diptera:Culicidae). Proc. 
Pap. Ann. Conf. Calif. Mosq. Control Assoc. 42: 147-151. 

Scientific Committee on Food. 2001. Opinion of the Scientific Com- 
mittee on Food on the 12th additional list of monomers and additives 
for food contact materials. Report CS/PM/GEN/M84. European Com- 
mission, Health and Consumer Protection Directorate-General. Brus- 
sels. [Online] Available: http://europa.eu.inl/comm/food/fs/sc/scf/ 
out84_en.pdf [2003, October 20]. 

Segner, H., K. Caroll. M. Fenske, C. R. Janssen, G. Maack, D. Pascoe, 
C. Schafers. G. F. \ andenbergh, M. Watts, and A. Wenzel. 2003. 
Identification of endocrine disrupting effects in aquatic vertebrates and 
invertebrates: report from the European IDEA project. Ecotoxicol. 
Em-iron. Saf. 54: 302-314. 

Sehnal, F. 1983. Juvenile hormone analogues. Pp. 657-672 in Inverte- 
brate Endocrinology, Vol. I. Endocrinology of Insects. R. G. H. 
Downer and H. Laufer, eds. A. R. Liss, New York. 

Semensi, V., and M. Sugumaran. 1986. Effect of MON-0585 on scle- 
rotization of Aedes aegypti cuticle. Peslic. Biochem. Physiol, 26: 220- 
230. 

Slama, K., and S. I. Kryspin. 1979. Hypermetabolic response induced 
by juvenile hormone analogs in an insect. Z. Naturforsch. Biosci. 34: 
599-607. 

Smith, J. B. 2002. Zinc containing compositions for anti-viral use. 
United States Patent No. 6.475,526. [Online] Available: www.uspto. 
gov [2003, September 29]. 

Staples, C. A., P. B. Dom. G. M. Klecka, S. T. O'Block, and L. R. 
Harris. 1998. A review of the environmental fate, effects, and expo- 
sures of bisphenol A. Clu'/nospliere 36: 2149-2173. 
Stoker, T. E., C. L. Robinettt, B. H. Britt, S. C. Laws, and R. L. 
Cooper. 1999. Prepubertal exposure to compounds that increase pro- 
lactin secretion in the male rat: effects on the adult prostate. Bio/. 
Reprod. 61: 1636-1643. 
Takao, T., W. Nanamiya, 1. Nagano. K. Asaba, K. Kawabata, and K. 



Hashimoto. 1999. Exposure with the environmental estrogen bisphe- 
nol A disrupts the male reproductive tract in young mice. Life Sciences 
65: 2351-2357. 

U.S. EPA (U.S. Environmental Protection Agency). 2002. High Pro- 
duction Volume (HPV) Challenge Program. Robust summaries and test 
plans: hindered phenols. EPA comments. American Chemistry Coun- 
cil. [Online] Available: http://www. epa.gov/chemrtk/hndrdphn/ 
cl3382tc.htm [2003. September 29]. 

U.S. EPA (U.S. Environmental Protection Agency). 2003. Design for 
the Environment. Key characteristics of laundry detergent ingredients. 
[Online] Available: http://www.epa.gov/dfe/pubs/laundry/techfact/ 
keychar.htm [2003, September 29], 

van Heemst, J. D. H., P. F. van Bergen, B. A. Stankiewicz, and J. VV. 
de Leeuw. 1999. Multiple sources of alkylphenols produced upon 
pyrolysis of DOM. POM and recent sediments. J. Anal. Appl. Pyrolysis 
52: 239-256. 

Watts. M. W., D. Pascoe, and K. Carroll. 2001. Chronic exposure to 
17-alpha-ethinylestradiol and bisphenol A-effects on development and 
reproduction in the freshwater invertebrate Chironomus riparius 
(Diptera: Chironomidae). Aquat. Toxicol. 55: 113-124. 
Williams, A. B., and T. W. Duke. 1979. Crabs (Arthropoda: Crustacea: 
Decapoda: Brachyura). Pp. 171-233 in Pollution Ecology of Esmarine 
Invertebrates. C. W. Hart and L. H. Samuel, eds. Academic Press, New 
York. 
Wyatt, G. R. 1991. Gene regulation in insect reproduction. Invertebr. 

Reprod. De\: 20: 1-35. 

Ying, G.-G., B. Williams, and R. Kookana. 2002. Environmental fate 
of alkylphenols and alkylphenol ethoxylates a review. Environ. Int. 
28: 215-226. 

Zeng, Y., and P. K. A. Hong. 2002. Slurry-phase ozonation for reme- 
diation of sediments contaminated by polycyclic aromatic hydrocar- 
bons. J. Air Waste Manag. Assoc. 52: 58-68. 

Zintek. L., D. Wesolowski, B. Paruchuri, P. Howe, A. Alwan, G. 
Azevedo, D. Hopkins, and J. Dorkin. 2003. Methods for determi- 
nation of selected alkylphenols and bisphenol A in sediments and 
water. EPA Conference on Analysis of Pollutants in the Environment. 
26th annual conference, Chicago. IL. U.S. Environmental Protection 
Agency, Office of Water. Office of Science and Technology, Engineer- 
ing and Analysis Division. Washington, DC. 

Zomer, E.. and H. Lipke. 1981. Tyrosme metabolism in Aedes ae^pti 
II. Arrest of sclerotization by MON 0585 and diflubenzuron. Pestic. 
Biochem. Phvsiol. 16: 28-37. 



Reference: Bio/. Bull. 206: 25-34. (February 2(104) 
2004 Marine Biological Laboratory 



Reproduction and Development of the Conspicuously 
Dimorphic Brittle Star Ophiodaphne formata 

(Ophiuroidea) 

HIDEYUKI TOMINAGA 1 *, SHOGO NAKAMURA 2 . AND MIEKO KOMATSU 1 

' Department of Biologv. Facultv of Science and 2 Department of Environmental Biology and Chemistry. 
Faculty of Science, Toyama University. Toyama. 930-8555, Japan 



Abstract. Ophiodaphne formata is a conspicuously di- 
morphic ophiuroid; the disk diameters are approximately 1 
mm for males and 5 mm for females. The dwarf male clings 
to the larger female, with the oral surfaces and bursae of the 
paired ophiuroids closely appressed. Moreover, the female 
of each pair adheres aborally to the oral surface of a host 
sand dollar, Astriclypeits manni. Spawning and external 
fertilization occur in August, at Tsuruga Bay, Sea of Japan. 
Development of the dimorphic brittle star O. format/./ is 
described for the first time, from spawning through meta- 
morphosis, with special attention to the formation of the 
skeletal system and the external morphology of early juve- 
niles. Fertilized eggs are about 90 /urn in diameter, pale 
pink, and negatively buoyant. The embryos undergo equal, 
total, and radial cleavage, and the larval skeleton first forms 
as a pair of tetraradiate spicules. Larval development pro- 
ceeds to an 8-armed planktotrophic ophiopluteus, with skel- 
etal elements that consist of a body rod and two recurrent 
rods. Three weeks after fertilization, all the pluteal arms, 
except for the postero-lateral arms, are absorbed, and the 
metamorphosing larvae sink to the bottom. Metamorphosis 
is completed 21.5 days after fertilization, and the resulting 
juvenile is pentagonal and approximately 270 /urn in diam- 
eter. The smallest specimen (480 /urn in disk diameter) 
collected by field sampling exhibited male features on the 
skeletal plates of the jaw and disk. Sexual dimorphism, the 
peculiar pairing behavior, and the close relationship with the 
host sand dollar may have evolved as distinct reproductive 
characteristics in this ophiuroid with its typical ophiopluteus 
larvae. 



Received 13 January 2003; accepted 23 September 2003. 
* To whom correspondence should he addressed. E-mail: hide- 
tom@bb.cocone.jp 



Introduction 

The biology of reproduction has been reported in various 
echinoderms, and they are mostly dioecious (Hyman, 1955; 
Delavault, 1966; Lawrence, 1987). Sexual dimorphism is 
not common, but some species show external morphologi- 
cal differences in size, genital papillae, genital pores, and 
arm spines (Hyman. 1955; Delavault, 1966; Tyler and 
Tyler. 1966; Lawrence. 1987; O'Loughlin, 2001; Stohr, 
2001). In a few ophiuroids Ophiosphaera insignis, Am- 
phinra scripta, and Astrochlamys bruneits the difference 
in size between males and females is very large (Brock. 
1888; Koehler. 1404; Mortensen, 1933, 1936). In O. insig- 
nis and A. scripta. a dwarf male pairs with a much larger 
female, clinched mouth to mouth; and in A. bnmeiis. a 
smaller male attaches to the dorsal surface of a larger 
female. However, no spawning has been observed in these 
ophiuroids. Therefore, the pairing of a male and a female in 
these dimorphic species has not been demonstrated as a 
distinct reproductive behavior. Ophiuroid reproduction and 
development has been reviewed by Hyman (1955). Strath- 
maiin and Rumrill ( 1987), Hendler ( 1995). and Byrne and 
Selvakumaraswamy (2002). but neither the larva nor the 
metamorphosis of a dimorphic species has been described. 

We have been studying an unusual sexually dimorphic 
ophiuroid. Ophiodaphne formata. which has two novel 
characteristics. First, the dwarf male and the larger female 
are coupled mouth to mouth, and we have observed this 
pairing throughout the year, even in the nonbreeding season. 
Second, these paired ophiuroids are only found firmly at- 
tached to the oral surface of a host sand dollar, Astriclypeus 
manni. The ophiuroid O. formata ranges from the Arabian 
coast to Indonesia (Koehler. 1905; Guille, 1981) and was 
recorded from off Minabe. Wakavama Prefecture (Honshu). 



2 s ! 



26 



HIDEYUKI TOMINAGA ET AL. 



Japan, by Irimura (1981). who identified it, at first, as 
Ophioiltiphnc malt-rim. He also reported that a large speci- 
men and a smaller one supposedly female and male, re- 
spectively were found on the oral side of a sand dollar. 
Clypeaster reticiiltitits. clinched together mouth to mouth. 
However, the sex of the larger and smaller specimens was 
not verified in this very brief report. Later, Irimura and his 
coauthors (2001) classified specimens of this ophiuroid. 
which were collected at depths of 25.5-40 m, as O.fonmitti. 
In view of the unusual natural history of O. formata, the 
present study was initiated to confirm that pairing in this 
species is a reproductive behavior. Pairs of O. formula 
comprising a dwarf male and a much larger female were 
removed together from the oral side of the host sand dollar. 
A. manni, and kept in glass beakers. We observed spawning: 
then external fertilization occurred; and the fertilized eggs 
developed into 8-armed ophioplutei, which metamorphosed 
into juveniles. Thus, the developmental mode of the sexu- 
ally dimorphic O. formula has now been defined. 

Materials and Methods 

In the summers of 1999 to 2001. adult sand dollars 
(Astricl\i>en.\ manni} were collected from depths of 5 m by 
scuba diving on the sandy bottom of Tsuruga Bay, Fukui 
Prefecture (central Japan. 35 44' N. 136 03' E). The sand 
dollars were examined for samples of paired and unpaired, 
young and adult Ophiodaphnc formula. The ophiuroids 
(n == 245) were found on only about 1 out of 10 sand 
dollars, and 467r of them were paired (n == 112). When 
pairs were found, they were carefully removed from the 
sand dollars with fine forceps and placed into glass beakers 
containing filtered seawater. In 2002. about 20 individuals 
of O. formata were collected every 2 months for histological 
study of gonadal development. 

A few days after the collection in August 2000, spawning 
occurred naturally, with no artificial stimuli, and the fertil- 
ized eggs were removed from the glass vessels and reared in 
5-1 glass beakers; density was maintained at one larva per 
10 ml of filtered seawater. The water temperature was about 
26 C, approximately that at the collection site. Larval 
cultures were agitated with a plastic propeller rotating at 60 
rpm. Seawater used for culture was obtained from the open 
sea and was filtered many times and renewed every 3 days. 
A small quantity (3 ml/1) of larval food in the form of a 
mixture of unicellular algae DunaliclUi ti-rrioU'cta. ho- 
r//nw'\ wilhaiia. anil Chacloci-ros i>racilifi was added to 
the culture when the seawater was changed. 

The development of embryos and larvae, including skel- 
etal formation. \\as observed by both light microscopy and 
polarized light microscopy. Mcasuicments of living em- 
bryos and larvae were made with an ocular micrometer. For 
scanning electron microscopy, metamorphosing larvae ami 
juveniles were fixed for 1 h in 2' i OsO, in a 50 m.W 



Na-cacodylate buffer (pH 7.4); the osmolarity of the fixative 
was adjusted by adding sucrose (final concentration 0.6 M), 
according to Komatsu et al. (1990). The fixed materials 
were dehydrated in an ethanol series, dried with a critical- 
point dryer (Hitachi. HCP-2), coated with gold-palladium 
(Hitachi, E101 Ion Sputter), and examined with a Hitachi 
S-2000 scanning electron microscope. 

Histological observations of the reproductive organs were 
made to confirm their sex and maturity. Fresh specimens 
were measured, dissected, and fixed in Allen-Bouin's solu- 
tion, followed by decalcification with 5% trichloroacetic 
acid for one week at 4 C. These prepared gonadal tissues 
were serially sectioned at 4 /xm by a routine paraffin method 
and stained with Delafield's hematoxylin and eosin. 

Results 

Pairing, symbiosis, and scxitul dimorphism 

Adult individuals of Ophiodaphne formata are diecious. 
and the disk diameter of mature specimens is about 1 mm in 
males and 5 mm in females. The oral surface of the dwarf 
male is pressed against the oral surface of the larger female, 
and the arms of the male cling to the female at the interra- 
dius position (Fig. 1A). Mature specimens, paired and un- 
paired, were situated next to a lunule on the oral side of the 
burrowing sand dollar Astriclvpeus manni. which is consid- 
ered to be their host (Fig. IB. C). The female reaches 
upward to hook the terminal half of two arms over the edge 
of the lunule. She firmly fixes her aboral surface to the oral 
surface of the sand dollar by attaching her aboral skeletal 
elements to the oral spines of the host. Two of the tips of the 
male's arms are just visible protruding from under the 
female's disk (Fig. ID). Most ophiuroids. whether paired or 
unpaired, were located at the lunule of the sand dollar as an 
attachment site, from which a radial food track leads away 
food particles to the sand dollar's mouth. However, some 
single young females and males were not located at the 
lunule. but on the oral plate of the sand dollar, closer to its 
mouth and anus. 

In addition to the size dimorphism, external morpholog- 
ical differences between males and females are evident in 
such skeletal characteristics as the shape of the jaw. the 
number and size of disk scales, the number of arm spines, 
the presence or absence of parallel grooves on the radial 
shields and disk scales of the aboral disk, and tentacle scales 
on the oral side of the arm. The jaws of both males and 
females, present at each interradius. consist of one tooth, 
one oral shield, two adoral shields, two oral plates with 
mliadental papillae, and two buccal scales. The jaw ossicles 
of females are stouter than those of males, and the oral 
plates and teeth are more apparent in the female (Fig. 2 A. 
B). The aboral side of the smaller disk of the male is 
covered with scales that are less reduced in size and number 
than those of the female (Fig. 2C). The lateral arm plates of 



DEVELOPMENT OF A DIMORPHIC OPHIUROID 



27 




Figure 1. Male and female of Ophiodaphne formula and their host, Astriclypeits mamu. (A) Magnified view 
of the female paired with a much smaller male of O. fonnata. both detached from the host shown in C. Note the 
dwarf male (short arrow), with his oral surface against that of the larger female (long arrow I, and his arms 
(arrowheads) alternating with hers. Views of the female and male are oral and aboral, respectively. (B) Aboral 
view of a sand dollar, A. manni. Arrow indicates a lunule. (C) Female specimen of O.fonnata carrying a dwarf 
male close to the lunule on the oral side of A. manni. Note her position, with two arms (arrows) hooked over 
the edge of the lunule. (D) Aboral view of the female. The body of the male is hidden by the female, but the 
tips of two of his arms (arrowheads) are visible. (E) Horizontal section of a male specimen of O. fonnata with 
mature sperm (arrows) in a pair of testes situated at the interradius. The space above the testes is a body cavity 
(BC) near the stomach (S). (F) Compressed ovary rilled with ova (OO) with germinal vesicle (arrows). Scale 
bars: 3 cm (B), 3 mm (C. D), 1 mm (A), and 100 ^im (E. F). 



males have 4 spines, whereas those of females have 8. 
Females possess grooves on their radial shields and disk 
scales of the disk (Fig. 2D, E) and tentacle scales on the oral 
side of the arm, while males do not (Fig. 2F, G). 



In contrast to the sexual dimorphism in adults, recently 
metamorphosed juveniles, whose disks are about 400 /urn in 
diameter, do not vary morphologically among individuals. 
However, the smallest specimen collected on a sand dollar 



28 



Mini.yi'KI I'OMIN A(i.\ /./ M. 



J;^--aVTS;'-s! * > - 
-v^v -J.. ! iM.-:;^;:.-^ i 




Figure 2. Skeletal structures of Ophimhiplmc fiirimitn. A-K are scanning electron micrographs. (A) Adult 
female jaw in an interradius; oral view. Components: an oral shield (OS), two udoral shields (AS), two oral plates 
(OP), and a loolh (T). BS. buccal scale. (B) Adult male jaw in an inlerradius; oral view. Components of the jaw 
are the same as in female, hut compare structures. IP. inlradenlal papilla; other abbreviations as in (A). (C) 
Aboral skeletal system of an adult male detached Irnm the host. Note that the disk is covered with scales: a 
central plate (arrowhead), live radial plates (short arrows), live pairs of radial shields (long arrows), and others. 
(D) Aboral view nl grooves (arrow heads I on the radial shields (RS) of a female. (E) Grooves on the radial shields 
(RS) and the disk scale ( asterisk! ol a teniale at high magnilication. I F) Oral view of tentacle scales (arrowheads i 
mi the arm ol a lemale. (G) Oral view ot the arm of a male Note absence ol tentacle scales. (H) Aboral skeletal 
system ol a \oiing male brittle star detached from the host. Note ihe cenlral plate (arrowhead) and five radial 
plates (aiiowsi on Ins disk ill Oral view of metamorphosing ophiopluteus wuh juvenile mouth formation and 
postero-laieral arm (PI. A). Oral tube feet (arrowheads! are visible around the mouth, and tube feet (arrows) are 
more distal. (Jl Central plate (CPl and Ihe radial plates (RP) of a newly metamorphosed juvenile. Ahoral view, 
i K) ( lial \iew ol |.iws consisting ol oral plates (OP), dental plates (DP), and tooth (T). BS indicates buccal scale. 
Same siage as in .1. Scale bais: 50(1 M m (11. !), 200 /im Ui). Mill /jm (A, C. I.. H). and 30 ;um (B. I-K) 



DEVELOPMENT OF A DIMORPHIC OPHIUROID 



29 



from the field (disk diameter 480 jam) exhibited male char- 
acteristics in the ossicle of the jaw and skeletal elements of 
the disk (Fig. 2H). The disk diameter of the smallest female 
specimen collected from the field was already 1.0 mm. 
These observations suggest that size differences corre- 
sponding to sexual dimorphism first appear in individuals 
with disk diameters of about 500 /urn (males) and 1 mm 
(females). 

Gonadal development and spawning 

Sex in O. formata is distinguished by the color of the 
gonads upon dissection; the testes are creamy white, and the 
ovaries are pale pink. The gonads of both males and females 
were largest in specimens collected in August. Sections of 
gonad show that the testes are occupied, in early August, 
with numerous mature sperm (Fig. IE), while the ovaries 
contain numerous oocytes, many of them fully grown and 
with a germinal vesicle (Fig. IF). Later in August, after 
spawning, the ovaries are still large, but they contain no 
fully grown oocytes, and the center of the organ is occupied 
by a wide cavity, indicating degeneration. In October and 
December, the ovaries are smaller than in August. Though 
ovaries examined from January to May remain small, they 
are rilled with developing oogonia and a few oocytes. 
Spawning in the laboratory begins when a paired female 
raises her disk from the bottom of the glass vessel to assume 
a shedding posture. The eggs and sperm are shed into each 
bursa, and are released outside through the genital slits at 
the base of the arms. The release is immediately followed by 
external fertilization. 

We did not attempt to observe spawning in the field. 
However, our histological study of gonadal development 
and our observation that eggs fertilized in August (but not in 
June, July or October) completed metamorphosis and de- 
veloped into juveniles all suggest that, in Tsuruga Bay, the 
breeding season for O. formula occurs during August. 

Development 

Earl\ development. Fertilized eggs are spherical, about 
90 /LUII in diameter, pale pink, and negatively buoyant (Fig. 
3 A). They have a transparent, nonsticky fertilization enve- 
lope, and a translucent, thick (10 /am) hyaline layer. A 
chronology of development, from fertilized egg to juvenile, 
is presented in Table 1. The cleavage is total, equal, and 
radial. At about 26 C, the first division occurs at 2 h after 
fertilization, and as divisions continue (Fig. 3B), the em- 
bryos develop into blastulae (Fig. 3C). These blastulae are 
not wrinkled, unlike those of two other ophiuroids (Ophio- 
tliri.\ oerstedi and Ophionereis schayeri) and members of 
other echinoderm classes (Mladenov, 1979; Henry et <//., 
1991; Chia et al., 1993; Selvakumaraswamy and Byrne, 
2000; Komatsu et ai. 2000). Nine hours after fertilization, 
the blastula hatches from the fertilization envelope (Fig. 



3D), and primary mesenchyme cells in the vegetal pole wall 
are set free into the blastocoel (Fig. 3E). At this stage, 
blastulae in culture swim actively just beneath the water's 
surface. They become oval (180 /urn long and 120 jam 
wide); and 12 h after fertilization, gastrulation occurs by 
invagination at the vegetal pole. During gastrulation, the 
embryo flattens dorso-ventrally (Fig. 3F). 

Ophiophtteiis singe. Twenty hours after fertilization, in 
the gastrula stage, the larval spicules begin to take a tetra- 
radiate form (Fig. 3G, H). Then a pair of right and left 
coelomic pouches is formed on both sides of the tip of the 
archenteron. Figure 31 shows an early 2-armed ophioplu- 
teus, 35 h after fertilization, taking the shape of a helmet as 
the postero-lateral arms appear. The antero-lateral arm buds 
are evident 60 h after fertilization (Fig. 3J). In this early 
4-armed ophiopluteus. the archenteron has differentiated 
into a functional digestive tract; esophagus and stomach 
(Fig. 3J). 

From the 2-armed to the 4-armed stage, two pair of 
recurrent rods arise successively, running parallel to the 
body rods (Fig. 3K). These recurrent rods extend to the 
center of the larval basket-like structure from paired points 
of divergence, and the body rods also arise from these points 
(DP in Fig. 3K). Thus, these recurrent rods, together with 
the body rods and transverse rods, constitute a bilateral, 
threefold skeletal structure. Immediately after the postero- 
lateral, antero-lateral, and body rods form, the post-oral rods 
also appear, and the postero-lateral rods extend horizontally 
and support the postero-lateral arms. 

Four and a half days after fertilization, the post-oral arms 
are formed, and the ophioplutei develop to the 6-armed 
stage (Fig. 4A). Six and a half days after fertilization, they 
become 8-armed ophioplutei, bearing a 4th pair of arms, the 
postero-dorsal arms (Fig. 4C). At this stage, both the right 
and left coelomic pouches, the latter of which is further 
developed than the former, are divided into anterior and 
posterior sections on each side (Fig. 3L). 

The body, the postero-lateral, the antero-lateral, the post- 
oral, and the postero-dorsal rods are not fenestrated and 
have no thorns. The length of the postero-lateral arm in the 
largest 8-armed ophiopluteus larvae is about 700 /am, and 
the postero-lateral rod is a spiral structure in the middle of 
this arm (Fig. 4C). These larval arm rods serve as flotation 
devices, and are absorbed as metamorphosis proceeds. Late 
8-armed ophioplutei have neither ciliary epaulets nor vibra- 
tile lobes. The left posterior coelomic pouch is divided into 
a hydrocoel and somatocoel, and the former expands for- 
ward, gradually, along the stomach and esophagus, produc- 
ing a 5-lobed hydrocoel (Fig. 3M, N and 4B). A hydrocoel 
lobe forms, passes through the left posterior coelomic 
pouch, and migrates around the esophagus of the 8-armed 
ophiopluteus larva just before the beginning of metamor- 
phosis. After migrating and surrounding the esophagus for 
about a day, the 5-lobed hydrocoel develops into the water 



30 



HIDEYUKI TOMINAGA ET AL 




H 



VT I 




N 

Figure 3. Early development of Ophiodaphne formula. (A-N and P are light micrographs; O is a polarized 
light micrograph.! (A) Fertilized egg surrounded by the fertilization envelope (FE) and hyaline layer (HLl. (B) 
Four-cell stage. 2.5 h after fertilization. (Cl Bhistula with hlastocoel (BC). 6.2 h after fertilization. (D) Hatching 
hlastula. 9 h after fertilization. Note fertilization envelope (FE). (E) Swimming blastula. (F) Gastrula. 21 h after 
fertilization. Arrow indicates the archenteron. (G) Tetraradiate spicule (arrow) in gastrula at high magnification. 
(H) A pair of tetraradiate spicules (arrows) in a compressed gastrula; later stage than that shown in G. (1) Early 
2-armed ophiopluleus. 1.5 d after fertilization. (J) Early 4-armed ophiopluteus with the antero-lateral arm buds 
(arrowheads), esophagus (E), and stomach (S). 2.5 d after fertilization. (K) Magnified view of skeletal structure 
ot late 4-armed ophiopluteus. Two pairs of recurrent rods (RR| run parallel to the body rod (BR). and 
perpendicular to the transverse rods (TR). from the diverging points (DP). The postero-lateral rod (PLR) and 
antero lateral rod (ALR) also arise from the diverging points. (L) Magnified view ot esophagus (E) and stomach 
(Si in an 8-armed ophiopluteus. The right and left, anterior (RA. LA) and posterior (RP. LP) coelomic pouches 
are indicated. Oral view. (M) Late S-armed ophiopluteus with hydrocoel (HC) along the stomach (S) and 
esophagus lE). Orange structures are antero-lateral rod (ALR) and postero-dorsal rod (PDRl. Ahoral view. (N) 
S-armed ophiopluteus, more advanced than that shown in (Ml, with live-lohed hydrocoel (arrowheads) beside 



DEVELOPMENT OF A DIMORPHIC OPHIUROID 



31 



Table 1 

Chronnlng\ of development <>/ Ophiodaphne formata (26 O 



Time after 
fertilization 



Stage 



2 h 2-ceII stage 
2.5 h 4-celI stage 

3 h 8-cell stage 
3.5 h Id-cell stage 

5 h Morula 

6.2 h Blastula with blastocoel 

') h Hatching 

21 h Gastrula. 140 /jm long and 120 juni wide 

1.5J 2-armed ophiopluteus 

2.5 d 4-armed ophiopluteus 

4.5 d 6-arnied ophiopluteus 

6.5 d 8-armed ophiopluteus with posterior coelom 

13.5 d Hydrocoel formation 

15.5 d Lett hydrocoel 5-lobed 

18.5 d Rudiments of adult skeleton appear as spicules 

20.5 d Metamorphic climax begins, larval arm degenerates 

rapidly 

21.5 d Completion of metamorphosis with absorption of 
larval arms 



vascular system. The 6-armed and 8-armed ophioplutei 
have a mass of pigment cells including pigment granules, 
brownish and deep reddish, at the tips of the postero-Iateral 
arms. 

Metamorphosis. Eighteen and a half days after fertiliza- 
tion, the adult plates begin to form as fine spicules (Fig. 3O). 
These spicules correspond to the rudiments of the five 
terminal plates and large radial plates with a dorso-central 
plate. At this stage, the stomach and intestine are greenish. 
In the 8-armed ophiopluteus. 20 days after fertilization, the 
tip of the postero-Iateral arms begin to swell, and the antero- 
lateral arms cross (Fig. 4C). Absorption of the post-oral and 
postero-dorsal arms begins 21 days after fertilization (Fig. 
4D). Absorption of the left antero-lateral arm occurs and is 
followed by a decrease in the size of the right antero-lateral 
arm. Toward the end of metamorphosis, the left antero- 
lateral arm becomes much shorter than the right (Fig. 4E). 
The disk consists of small spicules that develop as a skeletal 
network (Fig. 3P). The spicules that will differentiate to 
become terminal and radial plates will migrate and will be 
situated at the tip of the arm and the margin of the disk. The 
metamorphosing larva is furnished by the rudimentary 
ophiuroid with a mouth, paired oral tube feet and tube feet; 
and it frequently creeps along the bottom (Fig. 21). 



Twenty-one and a half days after fertilization, metamor- 
phosis is complete, and the left postero-Iateral arm is ab- 
sorbed, followed by the right (Table 1. Fig. 4F). Immedi- 
ately after metamorphosis, the juveniles are pentagonal with 
short arms and spines (Fig. 4G). These paired short spines 
between the arms disappear as the juveniles grow (Fig. 1 D. 
2C). Newly metamorphosed juveniles are about 270 ;u,m in 
disk diameter. They bear a terminal tentacle in the tip of 
each arm. On their aboral side, a central plate is situated in 
the center of the disk, surrounded by five radial plates (Fig. 
2J). On the oral side, rudiments of five jaws begin to form 
(Fig. 2K). At this stage, the external morphology of skeletal 
elements does not vary among specimens. 

After a period of 45 days (post-fertilization), the juveniles 
grow to approximately 400 ju.m in disk diameter, and are 
brown. They have five arms, each 130 /am long, consisting 
of one segment and a terminal plate (Fig. 4H). Although 
more than 200 juveniles survived in the laboratory for about 
2 months after fertilization, they did not differentiate further 
and eventually died. One specimen collected from the nat- 
ural habitat on 14 January 2002 was 480 /urn in disk diam- 
eter (Fig. 2H). It possessed about 1 1 segments in each of its 
arms, which were approximately 1.6 mm long. We estimate 
that this field specimen was about 5 months old. 

Discussion 

We have described here, for the first time, the develop- 
ment from spawning and fertilization through metamor- 
phosis of the sexually dimorphic ophiuroid Ophiodaphne 
formata. The pattern of development in O. formata is in- 
fluenced by four characteristics. The egg is small, which is 
consistent with the observed indirect development through a 
planktotrophic ophiopluteus. However, the formation of tet- 
raradiate larval spicules and the absence of a secondary 
vitellaria larva are features that tend to reduce the time to 
metamorphosis. Finally, the ciliated postero-Iateral arms are 
retained, which may provide the juvenile brittle star with 
mobility for a brief presettlement exploration of the sub- 
strate. This suite of developmental characteristics is in ac- 
cord with the novel natural history of O. formata. in which 
a dwarf male and a female are coupled and attached to the 
oral surface of the sand dollar Astriclypeus manni. mostly 
adjacent to the lunule. 

Methods of inducing spawning in ophiuroids except for 
a sudden change in water temperature reported for Ani- 
phiplwlis kochii by Yamashita ( 1985) are not as precise or 



esophagus (E) and upper part of stomach (S). 15.5 d after fertilization. Aboral view. (O) Skeletal system of late 
8-armed ophiopluteus (polarized light micrograph). Postero-Iateral rods (long arrows): riidimental radial plates 
(short arrows); terminal plates (arrowheads). Aboral view. (P) A pair of postero-Iateral rods I arrows) of a 
metamorphosing ophiopluteus, compressed. Note the skeletal network for the resulting juvenile. Oral view. Scale 
bars: 100 /am (N. O. P). 50 /urn (J. L). and 30 /urn (A-I. K. M). 



32 



HIDEYUKI TOMINAGA ET AL 




Figure 4. Development of Oplumlapluu- luriiiutti. (A) Early 6-armed ophiopluteus. 4.5 d after fertilization. 
Long arrows indicate the postern-lateral amis, and short arrows, the post-oral arms. Oral view. (B) Histological 
longitudinal section (4 /j,m) of an S-armed ophiopluteus showing the hydrocoel (HC) and somatocoel (SC). Same 
stage as shown in Figure 3N. Aboral view. (C) Metamorphosing ophiopluteus; oral view. Note the swollen tip 
of the postero-luteral arms (PLA), the crossed antero- lateral arms (ALA), and the spiral construction of the 
pnstero-lateral rods (arrowheads! ill I ) Successne stages of resorption of the larval arms. (D) Magnified aboral 
view of the oplmmiid rudiment, showing luhe feet (arrowheads). The rudiment is within the metamorphosing 
ophiopluteus. which has a pair of posiero-lateral arms (PLA) and reduced post-oral and postern-dorsal arms 
(allows) (Ei Metamorphosing nplnopluleus with a right anlero-lateral arm (ALA) and other reduced larval arms 
(arrows) hanging on pnslern-lateral aims iPl.A). Ahnral \ lew nl the rudiment. (F) Metamorphosing ophiopluteus 
wilh a shorter lell postero-lateral arm (arrow) than right. 20.5 d alter fertilization. Ahoral view. (G) Juvenile just 
.ill. i Mictainoiphosis with terminal plates (long arrows), spines (short arrows), and tube leet I. mow heads), 21.5 d 
after teitih/alion Aboral view. (H) Juvenile with arm segments (arrows). Arrowheads indicate terminal plates. 
Aboral view. Scale hais: 1(10 jjin (C. F.. F. II). and 50 /urn (A. B. D, G). 



DEVELOPMENT OF A DIMORPHIC OPHIUROID 



33 



reliable as those known for echinoids or asteroids (Strath- 
mann and Runirill, 1987). Fortunately, however, O. formula 
spawns spontaneously in the laboratory, so the entire pro- 
cess of development, from fertilized eggs to juveniles, has 
been observed in this study. The entire process has been 
observed in several other species: Ophiothrix frugilis, 
Ophiocoma nigra. Ophiop/iolis acidcuta, Ophiocomu 
pnmila, and A. kochii (MacBride, 1907; Narasimhamurti, 
1933; Olsen, 1942; Mladenov, 1985; Yamashita, 1985), but 
none of these is a sexually dimorphic species. This study, 
therefore, is the first demonstration of a sexually dimorphic 
ophiuroid, developing through a typical ophiopluteus stage, 
and then into an 8-armed planktotrophic larva. 

The mature ova of O. formula are 90 jum in diameter, 
similar in size to those of O. fragilis, O. nigm, and A, kochii 
(MacBride. 1907; Narasimhamurti, 1933; Yamashita. 
1985). Mladenov (1979) summarized the quantitative char- 
acteristics of developmental patterns in ophiuroids and 
noted that species with small eggs (70-200 /urn in diameter) 
undergo planktotrophic development and require 12-40 
days to reach metamorphic competence. In the present 
study, O, formata completed metamorphosis within 21.5 
days at 26 C and thus fits the categorization of Mladenov 
(1979), as do O. fragilis, O. nigm, and A. kochii. Of these 
species, O. frugilis and O. nigra occur in relatively deep 
waters, whereas A. kochii is found under stones in the 
intertidal zone, along the Pacific coast of northern Japan, 
and O. formata inhabits the sandy bottom, 5 m deep, at 
Tsuruga Bay. A rapid metamorphosis should be advanta- 
geous to the shallow-water brittle stars, O. formula and A. 
kochii, for it would prevent dispersal to less advantageous 
deep habitats. In the case of the reproductive pairs of O. 
formata, which always live on a host sand dollar on the 
shallow sandy bottom, the requirement for rapid metamor- 
phosis may be especially important. 

Hyman (1955) generalized that an early ophiopluteus is 
furnished with a three-rayed skeletal rod, and Olsen ( 1942) 
and Strathmann and Rumrill (1987) reported this condition 
in Amphipholis si/iiamata and O. aculcata, respectively. 
However, the present study reveals that the initial shape of 
the larval spicules in O. formata is tetraradiate, as in Am- 
phiura chiajci, Amphioplus ahditus, A. kochii, and O. schay- 
eri (Fenaux, 1963; Hendler. 1978; Yamashita. 1985: Selva- 
kumaraswamy and Byrne, 2000). Therefore, the rudiments 
of the skeletal rods in the ophiopluteus can form in two 
ways: triradiate or tetraradiate. The accelerated formation of 
tetraradiate spicules in the gastrula stage may reduce the 
time to metamorphosis and thus contribute to the rapid 
embryonic development in O. formata. 

At settlement, ophioplutei generally release their postero- 
lateral arms (Olsen, 1942; Byrne and Selvakumaraswamy, 
2002). In O. formata, however, the four pairs of larval arms 
are not discarded, but rather absorbed first the post-oral 
and postero-dorsal arms, and then the antero-lateral and 



postero-lateral arms. Thus, the report of Balser ( 1998). that 
the released arms of an ophiopluteus can regenerate all the 
structures typical of the primary ophiopluteus, and that 
asexual reproduction of larval arms may be highly adaptive 
for life in the open ocean, does not apply to O. formula. 

Ophiuroids live in all seas, in all types of sediment, and 
at all depths from the intertidal zone to the abyssal region. 
Among these species, only O. formata is found on sand 
dollars, such as A. nninni (Tominaga, 2001, and present 
materials), Clvpeaster rcticnlatns (Irimura, 1981), and C. 
japonicus (Tominaga. unpubl.); and these host organisms 
are always in shallow waters, partially buried in the sandy 
bottom. In this study, the ophiuroids were never found on 
the sandy bottom; rather, the much larger female, carrying a 
dwarf male in a mouth-to-mouth position, is herself at- 
tached, by her aboral side, to the oral surface of the host A. 
nianni. The lunule of the host may serve the female ophiu- 
roid as a convenient site for attachment, or the concave 
shape of the lunule may provide protection from abrasion by 
the sand. Although we might suggest that a radial food track 
of the sand dollar, located close to the edge of the lunule 
(Fig. 1C), provides nutriment for the paired ophiuroids. this 
seems unlikely, because paired and unpaired females on the 
oral side of the sand dollar always turn their mouths to the 
sandy bottom to feed, not to a radial food track. Probably 
the association between the male and female and their 
morphological specializations have evolved as an adapta- 
tion to ensure mating success on this mobile and infaunal 
host. Although the pairing in O. formata is observed 
throughout the year, including in the nonbreeding season, 
this pairing behavior is probably essential to their reproduc- 
tion, because spawning occurs while pairing. 

Males and females of O. formata have a bursa on the oral 
surface which provides an opening for the gonad. Conse- 
quently, the most efficient posture for the male is to inter- 
digitate his arms with the larger female, mouth to mouth, 
while he sheds sperm from his bursal slits. The posture is 
important because the low density of O. formula is in 
contrast to that of the more common shallow-water ophiu- 
roids (Fujita. 1992). Thus, fertilization efficiency would 
probably be low if males and females of O. formata 
spawned separately on the sand and did not pair on their 
host. Probably O. formata selects A. manni as a host that 
provides a breeding site and thus raises the level of fertil- 
ization success, as suggested by Hendler ( 1991 ). 



Acknowledgments 

The authors wish to express their cordial thanks to Mr. T. 
Hashimoto and Mrs. Y. Hashimoto for their assistance with 
field sampling. Thanks are also extended to Miss H. Ya- 
manishi for her cooperation in the developmental observa- 
tions. They are grateful to Dr. S. Irimura for the identilica- 



34 



HIDEYUKI TOMINAGA ET AL 



tion of and to Dr. G. Henciler for information and 
suggestions on Ophiodaphne fonnata. 

Literature Cited 

Balser, E. J. 1998. Cloning by ophiuroid echinoderm larvae. Biol. Bull. 

194: 187-143 
Brock, J. 1888. Die Ophiuriden fauna des indischen Archipels. Z. Wiss. 

Zool. 47: 525-527. 
Byrne, M., and P. Selvakumaraswamy. 2002. Phylum Echinodermata: 

Ophiuroidea. Pp. 483-498 in Atlas of Marine Invertebrate Lan-ae. 

C. M. Young, ed. Academic Press, London. 
Chia, F. S., C. Oguro, and M. Komatsu. 1993. Sea-star (Asteroid) 

development. Oceanogr. Mar. Biol. Amni. Rev. 31: 223-257. 
Delavault, R. 1966. Determinism of sex. Pp. 615-638 in Physiology of 

Echinodermata, R. A. Boolootian. ed. Wiley-Interscience. New York. 
Fenaux, L. 1963. Note preliminaire sur le development larvaire de 

Amphiiira chiajei (Forbes). Vie Milieu 14: 91-96. 
Fujita, T. 1992. Dense beds of ophiuroids from the Paleozoic to the 

recent: the significance of bathyul populations. Otsuchi Mar. Research 

Center Report 18: 25-2 1 . 
Guille, A. 1981. Echinoderms: Ophiurides. Pp. 435-439 in Resulrats des 

Campagnes MUSORSTOM. Vol. 1. Museum national d'histoire na- 

turelle, Paris. 

Hendler, G. 1978. Development of /Am/'/""/ 1 ''" abditus (Verrill) (Echi- 
nodermata: Ophiuroidea). II. Description and discussion of ophiuroid 

skeletal ontogeny and homologies. Biol. Bull. 154: 79-95. 
Hendler, G. 1991. Echinodermata: Ophiuroidea. Pp. 356-51 1 in Repro- 
duction of Marine Invertebrates, Vol. 6. A. C. Giese. J. S. Pearse, and 

V. B. Pearse, eds. The Boxwood Press. Pacific Grove. CA. 
Hendler, G. 1995. Class Ophiuroidea. Pp. 89-195 in Sea Stars, Sea 

Urchins and Allies. G. Hendler. J. E. Miller. D. L. Pawson, and P. M. 

Kier, eds. Smithsonian Institute Press. Washington DC. 
Henry, J. J., G. A. Wray, and R. A. RalT. 1991. Mechanism of an 

alternate type of echinoderm blastula formation: the wrinkled blastula 

of the sea urchin Heliocidaris erythrogramma. Dev. Growth Differ. 33: 

317-328. 
Hyman, h. H. 1955. Ecltinodermata: The Invertebrates, Vol. 4. 

McGraw-Hill. New York. 763 pp. 
Irimura, S. 1981. Ophiurans from Tanabe Bay and its vicinity, with the 

description of a new species of Ophiocentrus. Puhl. Seta Mar. Rial. 

Lab. 26: 15-44. 
Irimura, S., T. Fujita, and R. tlrshiinu. 20(11. Preliminary report on the 

ophiuroids (Echinodermatu) on the shelf off Shimoda, south of Izu 

Peninsula, central Japan (in Japanese with English summary). Mem. 

Nail. Sci. Mus. (Tokyo) 37: 31 1-315. 
Koehler, R. 1904. Ophiures nouvelles ou pen omnues. Mem. Soc. Zool 

I ,. 17: 70-71. 



Kothler. R. 1905. Ophiures littorales. Siboga Exped. Monogr. 45(b): 
1-142. 

Komatsu. M., Y. T. Kano, and C. Oguro. 1990. Development of a true 
ovoviviparous sea star, Asterina pseudoexigua pacifica Hayashi. Biol. 
Hull. 179: 254-263. 

Komatsu, M., M. Sewell, S. F. Carson, and Fu-Shiang Chia. 2000. 
Larval development and metamorphosis of the sea star Luidea lln>lata 
(Echinodermata: Asteroidea). Species Diversity 5: 155-162. 

Lawrence, J. M. 1987. A Functional Biology of Echinoderms, Croom 
Helm, London, 340 pp. 

MacBride, E. W. 1907. The development of Ophiotliri\ fraxilis. Q. J. 
Microsc. Sci. 51: 557-606. 

Mladenov, P. V. 1979. Unusual lecithotrophic development of the Ca- 
ribbean brittle star Ophiolhrix oerstedi. Mar. Biol. 55: 55-62. 

Mladenov, P. V. 1985. Development and metamorphosis of the brittle 
star Ophiocoma pumila: evolutionary and ecological implications. Biol. 
Hull. 168: 285-295. 

Mortensen, T. 1933. Papers from Dr. Th. Mortensen's Pacific Expedi- 
tion 1414-16. LXIII. Biological observations on ophiuroids. with de- 
scriptions of two new genera and four new species. Vidensk. Medd. 
Dan. Naturhist. Foren. 93: 171-144. 

Mortensen. T. 1936. Echmoidea and Ophiuroidea. Discov. Rep. 12: 
199-348. 

Narasimhamurti, N. 1933. The development of Ophiocoma nigra. Q. J. 
Microsc. Sci. 76: 63-88. 

O'LoughlJn, P. M. 2001. The occurrence and role of a digitate genital 
papilla in holothurian. Pp. 363-368 in Echinoderms 20Ot>. M. Barker, 
ed. Swet/ and Zeitlinger, Lisse, The Netherlands. 

Olsen, H. 1942. Development of the brittle-star Ophiopholis aculeata 
(O. Fr. Miiller) with a short report on the outer hyaline layer. Bergens 
Mus. Arbok. Naturvid. 6: 1-107. 

Selvakumaraswamy, P., and M. Byrne. 2000. Vestigial ophiopluteal 
structures in the lecithotrophic larvae of Ophionereis schayeri (Ophiu- 
roidea). Biol. Bull. 198: 379-386. 

Stohr, S. 2001. Amphipholis linopneusti n. sp., a sexually dimorphic 
amphiurid brittle star (Echinodermata: Ophiuroidea). epizoic on a spa- 
tangoid sea urchin. Pp. 317-322 in Echinoderms 2000, M. Barker, ed. 
Swets and Zeitlinger, Lisse, The Netherlands. 

Strathmann, R. R.. and S. S. Rumrill. 1987. Phylum Echinodermala. 
class Ophiuroidea. Pp. 556-573 in Reproduction and Development of 
Marine Invertebrates of the Northern Pacific Coast, M. F. Strathmann. 
ed. University of Washington Press. Seattle. 

Tominagu. H. 2001. The early development of the brittle star. 
Ofihiotlaplinc lormuta (Koehler). P. 327 in Ecliiiiodcrms 2000. M. 
Barker, ed. Swets and Zeitlinger. Lisse. The Netherlands. 

Tyler, A., and B. S. Tyler. 1966. The gametes: some procedures and 
properties. P. 642 in Physiology of Echinodermala. R. A. Boolootian, 
ed. Interscience Publishers. New York. 

Yamashita, M. 1985. Embryonic development of the brittle-star Am- 
phipholis kocltii in laboratory culture. Biol. Hull. 169: 131 142 



Reference: Biol Bull 206: 35-45. (February 2004) 
2004 Marine Biological Laboratory 



Waveform Dynamics of Spermatozeugmata During the 

Transfer From Paternal to Maternal Individuals of 

Membranipora membranacea 

M. H. TEMKIN' * AND S. B. BORTOLAMI 2 

1 Biologv Department, St. Lawrence University, Canton, New York 13617; and 2 Ashton Graybiel Spatial 
Orientation Laboratorv, Braiuleis Unirerxitv, Wait/lain, Massachusetts 02254 



Abstract. Analysis of standard (60 frames/s) and high- 
speed (200 frames/s) video records revealed that unencap- 
sulated sperm aggregates (spermatozeugmata) of the 
gymnolaemate bryozoan Membranipora membranacea 
spontaneously generate at least three types of waveforms: 
small amplitude, large amplitude, and reverse. All three 
waveforms significantly differed from one another in am- 
plitude. Additionally, small- and large-amplitude wave- 
forms propagated from the base to the tip of axonemes, 
whereas the reverse waveform propagated from the tip to 
the base of axonemes. Small-amplitude waveforms, which 
were generated most frequently by spermatozeugmata in the 
paternal perivisceral coelom and in the water column after 
spawning, produced almost no curvature of the axoneme. 
Large-amplitude waveforms were produced by spermato- 
zeugmata in the water column and within lophophores. Re- 
verse waveforms were produced while spermatozeugmata 
moved tail-end forward through the paternal tentacles dur- 
ing spawning and after spermatozeugmata had contacted the 
intertentacular organ (ITO), a tubular structure that sperma- 
tozeugmata pass through to enter the maternal coelom and 
that eggs pass through to enter the seawater. The production 
of reverse waveforms by spermatozeugmata after reaching 
the ITO may be evidence for a behavioral response of 
bryozoan sperm to conspecific maternal individuals. 

Introduction 

Fertilization success for many benthic marine inverte- 
brates is dependent on the transfer of sperm or an aggregate 

Received 12 September 2003; accepted 3 November 2003. 
* To whom correspondence should be addressed. E-mail: mtemkinft" 
stlawu.edu 

Abbreviation: ITO, intertentacular organ. 



of sperm from males to females through the water column 
(see Franzen, 1956, 1998; Ryland and Bishop, 1993). Sperm 
aggregates may be either encapsulated (spermatophores) or 
unencapsulated (spermatozeugmata). The transfer of sperm, 
spermatophores, or spermatozeugmata from male to female 
conspecific benthic marine invertebrates may be influenced 
by numerous physical and biological factors. For example, 
water flow, population density, spawning synchrony, sperm 
chemoattractants, gamete longevity, and sperm motility are 
all factors that have been reported to increase or decrease 
fertilization success by altering the probability that sperm 
will find maternal individuals (see Ryland and Bishop, 
1993; Levitan. 1995). 

In species that transfer sperm from males to females 
through the water column, fertilization success may ulti- 
mately depend on sperm motility and behavior once a 
conspecific female has been approached or contacted. For 
example, sperm become attached to external maternal struc- 
tures where they wait for eggs to be spawned, as in some 
sabellid polychaetes (e.g., Daly and Golding, 1977; Rouse, 
1996) and some bivalves (e.g., 6 Foighil, 1985, 1989). In 
other species, sperm enter maternal individuals to fuse with 
eggs internally, as in some hydroids (see Miller, 1983), the 
sea cucumber Leptosynapta clarki (Sewell and Chia. 1994), 
the colonial ascidian Diplosoma lixterianuin (Bishop and 
Ryland, 1991; Burighel and Martinucci, 1994a, b), pho- 
ronids (see Zimmer, 1991 ), and the gymnolaemate bryozoan 
Membranipora membranacea (Temkin, 1994). Yet few ob- 
servations have been made on how sperm attach to or enter 
conspecific females, or on how sperm locate eggs prior to 
fertilization. 

Among gymnolaemate bryozoans, one of the most de- 
tailed descriptions of sperm transfer has been reported for 
Membranipora membranacea (Temkin, 1994). Zooids of 



35 



36 



M. H. TEMK1N AND S. B. BORTOLAMI 



M. nieiiibriimicen colonies typically are functionally simul- 
taneous hermaphrodites, and sperm in spermatozeugmata 
are transferred from paternal to maternal zooids through the 
water column (Temkin, 1994). Like those of other gymno- 
laemate bryozoans. the spermatogonia of M. membranacea 
migrate into the perivisceral coelom from the peritoneum of 
the body wall, or funiculus (a network of strand-like ele- 
ments of the circulatory system), and form syncytial masses 
of spermatocytes around cytoplasmic masses or cytophores 
(see Reed, 1991; Franzen, 1998). Cells of a cytophore 
disassociate at the end of spermiogenesis in most gymno- 
laemates, but in species such as M. membranacea. sperm 
remain together, adhering to one another to form a sperma- 
tozeugma. 

Gymnolaemate spermatozeugmata are aggregates of 32 
or 64 euspermatozoa in which the cells are arranged parallel 
to one another in a hexagonal array, with all the heads at one 
end of the aggregate and all of the tails at the other (Bon- 
nevie, 1907; Franzen, 1956. 1998; Zimmer and Woollacott, 
1974) (Fig. 1). Spermatozeugmata of gymnolaemate bryo- 
zoans are held together by viscomechanical forces that 
tightly adhere sperm to one another along the head region, 
the tail-end half of the midpiece region, and almost all of the 
tail region (see Franzen, 1956, 1998; Temkin, 1994). The 




AMTR 






TT 



- I. Diltcrcnlial inlcrlerenci- contrast image of u partial!) disas- 
.1. i.H.'d spennatozcugnw adhcimg in a glass slide. The head-end hall ot 
the spermato/eugnia consists ol the elongate head regions (H) thai are 
adhering to one another and the iionadhcring portions of the midpiece 
regions (NAMR|. The tail-end hall 'consists ol the adhering portions ol the 
midpiece and tail regions I AMTR) and the tips ol the kills (TT). Sperm that 
ha\c become partially disassociated Irom Ihe aggicgalc gcnciale a variety 
ol waxclortns. Scale bar \2 ;uin 



two regions of a spermatozeugma where sperm do not 
adhere to each other are the head-end half of the midpiece 
and the tip of the tail (Fig. 1 ). 

Sperm of M. membranacea within spermatozeugmata 
generate waveforms, and movements of the midpiece re- 
nions may produce some of the motive forces required for 
both spawning and entry into maternal individuals (Temkin. 
1994). Spermatozeugmata of M. membranacea are motile in 
the paternal coelom, like sperm of other gymnolaemate 
bryozoans (Marcus, 1938; Silen, 1966; Zimmer and Wool- 
lacott, 1974; Temkin, 1994). Prior to spawning, spermato- 
zeugmata of M. membranacea become positioned in the 
perivisceral coelom between the body wall and the disto- 
medial side of the pharynx, so that their tail ends are 
oriented toward the pore leading into the lophophoral coe- 
lom of the two distomedial tentacles (Temkin. 1994). Cilia 
located near the pore may help spermatozeugmata enter the 
lophophoral coelom of the distomedial tentacles (R. Zim- 
mer, University of Southern California, pers. comm.). Sper- 
matozeugmata move through the two distomedial tentacles. 
emerging tail-end first into the exhalant feeding currents of 
colonies. During their passage through the tentacle lumen, 
spermatozeugmata appeared to be pushed by waveforms 
produced in the midpiece region (Temkin, 1994). 

In the laboratory, spermatozeugmata become quiescent 
after they are spawned, until they are drawn into the loph- 
ophores of conspecifks by colony feeding currents 
(Temkin. 1994). Spermatozeugmata retained within the 
lophophores of conspecifics often produce strong undula- 
tory movements in the midpiece region (Temkin. 1994). 
While in the lophophore, spermatozeugmata may move 
headfirst into maternal individuals through the intertentacu- 
lar organ (1TO). The ITO is a tubular secondary sex struc- 
ture formed by the basal fusion of the two distomedial 
tentacles (see Silen. 1966; Reed, 1991 ). The ITO serves not 
only as the entry organ for spermatozeugmata. but also as 
the spawning organ for eggs (e.g., Silen, 1966; Temkin. 
1994). Temkin (1994) reported that spermatozeugmata that 
entered the distal pore of the ITO appeared to stop their 
undulatory movements and were drawn into the ITO. After 
entering maternal individuals, sperm of a spermatozeugma 
disassociate and migrate to the surface of the ovary, al- 
though the exact sequence of these two events is uncertain. 
In M. membranncca. sperm-egg fusion occurs during or 
shortly after ovulation and is monospermic (Temkin, 1994). 

In this paper, we compare the waveforms generated by 
sperniato/eusinuita of A/, membranacea within the paternal 
cocloms (perix isceral and lophophoral). in seawater alter 
spawning, and within the lophophores of conspecifics. We 
describe three types of waveforms (small amplitude, large 
amplitude, and reverse) that are spontaneously generated by 
spermalo/eugmala of M. membranacea during the transfer 
of aggregates from paternal to maternal /ooids. In addition. 



SPERMATOZEUGMATA WAVEFORM DYNAMICS 



37 



we relate the functional significance of the waveforms to the 
structure of spermatozeugmata and to sperm transfer. 

Materials and Methods 

Colonies of Membranipora membranacea Linnaeus, 
1767, were collected from waters near the Friday Harbor 
Laboratories (FHL), San Juan Island, Washington, and 
the Darling Marine Center (DMC). Walpole. Maine (for a 
phylogeographic analysis of these populations, see 
Schwaninger, 1999). The movements of spermatozeugmata 
within paternal coeloms, in seawater after spawning, and 
within the tentacle crown of maternal lophophores were 
videorecorded. Videorecordings were made using Pana- 
sonic cameras (60 frame/s) mounted on either Zeiss (FHL) 
or Olympus (DMC) research compound microscopes. Some 
M. membranacea colonies collected at the DMC were trans- 
ported to Harvard University, where videorecordings were 
made using an NAC HSV-200 video camera (200 frames/s) 
mounted on a Zeiss Photo III compound microscope. To 
view spermatozeugmata within paternal coeloms and ma- 
ternal lophophores, we examined "one-zooid-row" prepara- 
tions that were placed on their sides in small petri dishes 
(Temkin, 1994). To make recordings of spermatozeugmata 
outside of the paternal coelom (seawater), individual sper- 
matozeugma that had been recently spawned were removed 
from dishes containing one-zooid-row preparations and 
placed in depression slides containing 50 to 100 /^l ot 
0.2-/j,m-filtered seawater (FSW) at room temperature. 

Recorded sequences were viewed frame by frame to 
analyze the waveforms produced by spermatozeugmata dur- 
ing each trial. Waveforms produced by spermatozeugmata 
were distinguished based on waveform amplitude and di- 
rection of waveform propagation. The amplitudes of 10 waves 
for each of the three recognized waveforms were deter- 
mined using the computer program Image Tool ver. 3.00 
(University of Texas, http://ddsdx.uthscsa.edu/dig/itdesc. 
html), calibrated with an image of a stage micrometer, to 
measure digitized images of high-speed video frames. Sys- 
tat 6 was used to calculate an analysis of variance 
(ANOVA). and Bonferroni adjusted pairwise comparisons 
were made to determine statistical differences among wave- 
form amplitudes. The frequency of wave generation was 
measured in 25 reverse-waveform events for spermatozeug- 
mata within the paternal coelom and calculated as the num- 
ber of waves per second. In addition, waveform patterns 
generated by DMC spermatozeugmata in the paternal vis- 
ceral coelom (/? = 10) and in seawater after spawning (n = 
10) were compared by determining the frequency and du- 
ration of reverse-waveform events. To be included in the 
comparison, spermatozeugmata had to have a video record 
of at least 20 s. Event frequencies were calculated as the 
number of waveform events per minute. Durations of re- 
verse-waveform events during an individual trial were av- 



eraged. Two-sample ; tests were calculated using Systat 6 to 
compare the frequencies and durations of reverse-wavelorm 
events between spermatozeugmata in the paternal coelom 
and water column. 



Results 



Waveform tvpes 



Spermatozeugmata of Membranipora membranacea 
from both the DMC and FHL generated three types of 
waveforms: small amplitude, large amplitude, and reverse. 
The amplitudes of these waveforms were greatest in the 
nonadhering portions of the midpiece regions of spermato- 
zeugmata. The adhering portions of the midpiece and tail 
regions showed no apparent curvature during the generation 
of any of the three waveforms (Figs. 2, 3, and 4). An 
ANOVA and pairwise comparisons of means revealed that 
the amplitudes of the three waveforms significantly differed 
from one another (Table 1 ). Small-amplitude waveforms 
consisted of waves with amplitudes of 1.9 1.6 /im 
(mean standard deviation, /; = 10) that were generated 
from the base to the tip of axonemes (i.e.. head to tail). 
Sperm within a spermatozeugma typically produced small- 
amplitude waveforms asynchronously. Consequently, 
small-amplitude waveforms were difficult to observe unless 
sperm in an aggregate produced this type of waveform 
synchronously (Fig. 2). Small-amplitude waveforms pro- 
duced almost no curvature in spermatozeugmata as waves 
moved along axonemes. Large-amplitude waveforms also 
propagated from the base to the tip of axonemes (Fig. 3), 
with amplitudes of 11.1 3.0 jam (n == 10). During the 
generation of large-amplitude waveforms, spermatozeug- 
mata undulated and rotated around their long axis. Reverse 
waveforms had amplitudes of 7.0 2.4 /urn (n = 10) and 
propagated from the tip to the base of axonemes (i.e., tail to 
head) (Figs. 4 and 5); that is. reverse waveforms were 
propagated along the axoneme in a direction opposite to that 
of small- and large-amplitude waveforms. During reverse- 
waveform events in the paternal visceral coelom, waves 
were generated with a frequency of 1 1 .0 0.5 waves/s 
(// = 25). The generation of reverse waveforms was dis- 
tinguished by the development of prominent bends near the 
junctions of (1) the heads and midpieces and (2) the non- 
adhering and adhering portions of midpieces (Figs. 4 and 5 ). 
The curvature in the anterior portions of a spermatozeugma 
during a reverse-waveform event causes the aggregate to 
bend over, giving a spermatozeugma the distinctive appear- 
ance of a question mark. 

Location-specific waveform generation 

Spermatozeugmata generated different patterns of waves 
depending on whether they were located in the paternal 
coeloms (visceral and lophophoral), water column, or ma- 



38 



M. H. TEMKIN AND S. B. BORTOLAMI 




Figure 2. Synchronous production of a type I waveform by Membra- 
ni/j/iru ini'inhniiuifca spermalo/eugma in seawater after spawning, (a) 
Asynchronous waveform production, (b-fl Propagation of wave (arrow) 
from the base lo lip of axonemes. (g) Wave enters region of midpiece in 
which sperm are lightly adherent to each other and is no longer visible. 
Images are 10 ms apart. Dots indicate the propagation of the wave along 
the aggregate. The lirsl dot in each series marks the position of the wave 
in (b). Scale bar = 30 fim. 

ternal lophophore. In the paternal visceral coelom and water 
column, spermato/eugmata generated predominantly the 
small-amplitude waveform, with periodic reverse-wave- 




I 



Kigure 3. Generation ot a type II waveform by Membranipora mem- 
hranacea spermatozeugma in seawater after spawning, (a) A wave (arrow) 
forming just posterior to the heads, (b-e) The wave (arrow) propagating 
toward the tail end of the aggregate, (f, g) Generation of a second wave 
(arrowhead) after the first wave is no longer visible. Dots indicate the 
propagation of first wave along the aggregate. Images are 10 ms apart. 
Scale bar = 30 fim. 



form events. Spermatozeugmata in the water column also 
sporadically generated a short series of large-amplitude 
waveforms. Two-sample t tests revealed significant differ- 



SPERMATOZEUGMATA WAVEFORM DYNAMICS 



39 




Figure 4. Variation in the conformation of a Membranipora inemhra- 
nacea spermatozeugma within paternal coelom during a 1750-ms reverse- 
waveform event. Values in lower right-hand corner of each image show 
elapsed time, from to 1750 ms. (a, b) During the initiation of a reverse- 
waveform event, the spermatozeugma develops strong curvature near the 
junction of the heads and midpieces (black bracket) and near the junction 
ot the nonadhering and adhering portions of the midpieces (white bracket). 
(c-j) Production of reverse waveforms bends the spermatozeugma into the 
shape of a cane or question mark, (k, 1) Spermatozeugma returns to 
generating type 1 waveforms and a nearly linear conformation. Scale bar = 
25 f^rn. 



ences in the event frequencies (df = 18, t = 3.04, P < 
0.001) and durations (df = 18, t = -2.1 1, P < 0.05) of 
reverse-waveform events between spermatozeugmata in the 
paternal visceral coelom and ones in the water column (Fig. 
6). The reverse waveform was produced almost twice as 
often by spermatozeugmata in the paternal visceral coelom 
(n = 10, 9.4 0.7 events/m) as by spermatozeugmata in 
the water column (n =- 10, 5.6 1.0 events/min). In 
addition, reverse-waveform events lasted about 1.5 times 
longer for spermatozeugmata in the paternal visceral coe- 
lom (n = 10, 0.94 0.10 s) than for those in the water 
column (M = 10, 0.64 0.1 1 s). During the production of 



reverse waveforms in the paternal perivisceral coelom and 
in seawater after spawning, spermatozeugmata were not 
observed to move in either a head-forward or a tail-forward 
direction. 

Spermatozeugmata spent about 2.0 s in the lophophoral 
coelom during spawning. While traveling through the two 
distomedial tentacles into the external seawater, they gen- 
erated reverse waveforms (Fig. 7). One sperm aggregate 
stopped producing the reverse waveform as it emerged from 
the tentacle and remained with its head end within the 
lophophoral coelom of the tentacle for about 10 s until 
reverse waveforms were generated again. With resumption 
of reverse-waveform production, the spermatozeugma 
pushed itself out of the tentacle. 

Spawned spermatozeugmata were commonly swept into 
the lophophores of conspecifics by feeding currents. Most 
spermatozeugmata passed quickly through the lophophores 
without altering their waveform dynamics. However, when 
spermatozeugmata remained within the lophophores, they 
typically produced large-amplitude or reverse waveforms 
either continuously or periodically. Many of the spermato- 
zeugmata generating large-amplitude waveforms escaped 
from the lophophores into the exhalant current of colonies. 
Spermatozeugmata generating large-amplitude waveforms 
were able either to swim directly out of the lophophores or 
to enter into the exhalant current stream of the lophophores. 
In one case, a spermatozeugma generating large-amplitude 
waveforms moved from the pharynx of a zooid, out through 
the mouth, and back into the lophophore. In other cases, 
spermatozeugmata within lophophores became positioned 
with their head ends at the distal pore of the ITO. Once their 
head ends contacted the distal surface of the ITOs, the 



Table I 

Siinunan- of statistical tests In determine differences among waveform 
amplitudes 

Analysis ot variance 



Source 



Mean- 
Sum-ot-squares df square F-ratio 



Waveform type 399.29 2 199.64 34.60 0.000 
Error I55.S2 27 5.77 

Matrix of pairwise mean differences (below diagonal! and probabilities 
(above the diagonal)* 



Waveform type 



Small 



Large 



KCM.-I si- 




Small 
Large 
Revers 



0.000 
0.003 



* Mean differences calculated using a mean squared error (MSE) model 
of 5.77 with 27 degrees of freedom; probabilities calculated using a 
Bonterroni adjustment. 



40 



M. H TEMKIN AND S. B. BORTOLAMI 




Figure 5. Propagation of reverse waveforms along the axonemes from 
the tips to the bases in a Membranipora membranacea spermatozeugma 
within the paternal coelom. Images are 10 ms apart, (a-j) The movement 
of a reverse waveform (arrow) from the midpoint of the nonadhering 
midpiece region toward the head end of the spermatozeugma. The white 
bracket and * in (a) indicate the curvature of the spermatozeugma occur- 
ring near the junction of the nonadhering and adhering portions of the 
midpieces and posterior to the heads, respectively, (h-j) A second wave 
(black arrowhead) becomes apparent and propagates toward the head end 
of the aggregate. The first dm of each tracking line indicates the original 
position of the first wave in (a). Scale bar = 20 fiin. 



spermatozeugmata altered their waveform dynamics to gen- 
erate reverse waveforms within about 100 ms and attempted 
to enter the ITOs. The production of reverse waveforms 
bent the head ends of (he spermalo/eugmata toward the 
distal pore of the ITO (Fig. 8). Spermatozeugmata could not 
be observed after they entered ITOs because of cilia that 
line the lumen of the ITO. Consequently, we could not 
determine the \\..\clorms produced by spermatozeugmata 
inside of ITOs. 

To determine if the change from small-amplitude or 
large-amplitude \\ avel' >i m to reverse waveform alter a sper- 
mato/eugma contacted an ITO was simply a touch response, 
the waveform dynamics of 25 spermatozeugmata were ob- 
served before and after they contacted a glass surface. In IS 
cases, spermato/eugmata were producing a small-amplitude 



waveform when they contacted the substrate. Seventy-eight 
percent (14 of 18) of these spermatozeugmata continued to 
generate a small-amplitude waveform or a small-amplitude 
waveform with periodic reverse-waveform events. The re- 
maining 22% (4 of 18) initially continued to produce a 
small-amplitude waveform, but later changed to reverse 
waveforms. Seven spermatozeugmata contacted the sub- 
strate during a reverse-waveform event, and all of them 
continued to generate reverse waveforms. Consequently, the 
change in waveform does not seem to be simply a touch 
response. 

Discussion 

Spermatozeugmata develop in a group of animals that is 
diverse in phylogeny and reproductive biology. For exam- 
ple, in addition to occurring in bryozoans, spermatozeug- 
mata have been reported in marine and freshwater oli- 
gochaetes (see Ferraguti. 1983), gastropods (see Buckland- 
Nicks et /., 1999, 2000), marine and freshwater bivalves 
(e.g., 6 Foighil, 1985. 1989; Lynn, 1994; Jespersen et <;/.. 
2001, 2002), insects (e.g., Sahara and Kawamura, 2002). 
and fish (see Jamieson, 1991; Hayakawa et ai, 2002a). 
Marine and freshwater bivalves and some fish are similar to 
gymnolaemate bryozoans in that they spawn their sperma- 
tozeugmata into the water column. Gastropods, insects, and 
most fish transfer their spermatozeugmata directly from the 
male into the female reproductive tract using a form of 
copulation. Oligochaetes use a mechanism of pseudocopu- 



12 




10 




T 


a 


1 


6 








T 




1 


4 












2 













Coelom Seawater 


1 2 

1 




T 


b 


1 


08 
06 








T 




1 


04 












02 

r\ r\ 













Coelom Seawater 

Location of Spermatozeugmata 

Kiniire 6. Kvcnt frequency (a) and duration (b) of reverse wavetoims 
produced by Mfi>ihrnni[><>ra incnihnnnucti spermatozeugma within the 
paternal coelom (n = 10) and seawater (n = 10). Two sample t tests 
demonstrate that spermatozeugmata within the paternal coelom produce 
sigmticamly more (df - IS. I -3.04. P < 0.001 ) and longer (dl = IS, 
f = -2.1 I, P < 0.05) reverse waveform events than spermauv.eugmala 
in seawater. 



SPKRMATOZEUGMATA WAVEFORM DYNAMICS 



41 




Figure 7. Spermatozeugma of Membranipora iin-inhniiuici'ii crawling out of a paternal tentacle tail-end 
forward by producing a reverse waveform. Images are 20 ms apart. Arrows indicate the position of the wave 
along the aggregate. Scale bar = 20 /um. 



lation to deliver spermatozeugmata to the spermatheca of 
mating partners. The spermatozeugmata produced by many 
species of marine and freshwater oligochaetes, marine bi- 
valves, gastropods, insects, and fish differ from the sperm 
aggregates of Menthmniporu membranacea in that they 
consist of dimorphic sperm (e.g., Ferraguti cl ai, 1989; 
Healy and Jamieson. 1993: Buckland-Nicks et til., 2000; 
Jespersen et ai, 2001 . 2002; Hayakawa ct <//.. 2()()2a: Sahara 
and Kawamura, 2002). One type of sperm, euspermatozoa, 
fertilizes eggs; the other type, paraspermato/.oa, does not 
fuse with eggs, but instead is thought to enhance the fertil- 
ization success of euspermatozoa through a variety of mech- 
anisms, including preventing sperm from other conspecih'c 
males from fertilizing eggs (see Buckland-Nicks ct i/l., 
1999; Hayakawa et <;/., 2002b; Sahara and Kawamura, 
2002). 

The production of spermatozeugmata by M. nienihriiiui- 
cea may increase fertilization success in three ways. First, 
"packaging" sperm together may reduce the loss of sperm 
during the transfer from paternal to maternal individuals 
(e.g., Braidotti and Ferraguti. 1982; 6 Foighil. 1989; Lynn, 



1994; Jespersen and Lutzen, 2001; Hayakawa etui.. 2002b). 
Among gymnolaemate bryozoans, M. inciiihruiuicea has an 
uncommon reproductive biology (see Reed, 1991; Temkin 
and Zimmer, 2002). In most gymnolaemate bryozoans, the 
maternal zooids produce only one or a few eggs during each 
reproductive period; these are spawned to an external brood 
site, where they develop into lecithotrophic larvae, either 
coronate or pseudocyphonautes. In contrast, maternal zoo- 
ids in species of Membranipora and Electro, as well as 
some species of Alcyoiiiditini, Furellu. and Hy/wphorellti, 
produce many small, yolk-poor oocytes that are spawned 
into the water column, where they develop into planktotro- 
phic cyphonautes. In M. membranacea, the synchronous 
development of groups of oocytes may result in the pres- 
ence of as many as 25 ovulated primary oocytes in the 
perivisceral coeloni at one time (Hageman, 1983). Conse- 
quently, the maternal zooids of M. membranacea likely 
need to acquire more sperm than most gymnolaemate bryo- 
zoans to fertilize their eggs. By transferring aggregates of 
sperm, the entry of one spermato/eugma into a maternal 
zooid delivers 64 sperm cells. In other gymnolaemate spe- 



42 



M. H. TEMKIN AND S. B. BORTOLAMI 




Figure 8. Spermatozeugma of Membranipora membranacea generat- 
ing reverse waveforms after contacting the distal surface of an interten- 
tacular organ (ITO) of a maternal individual. The anterior portion of the 
spermatozeugma (arrow) is projecting out of the lophophore between the 
two distomedial tentacles. The head end of the aggregate is in contact with 
the distal surface of the ITO. The anterior end of the spermatozeugma is 
strongly curved (bracket) due to the generation of reverse waveforms. As 
a result of the bend in the anterior portion of the aggregate, the spenna- 
tozeugma is able to enter the distal pore of the ITO. Scale bar = 50 ^im. 

cies that may face similar pressures to fertilize their eggs, 
spermatozeugmata occur in species of Electra, hut have not 
yet been reported for species of Alcyonuliuni. Fare/la, and 
Hypophorella. 

Second, the formation of spermatozeugmata has been 
suggested to increase fertilization success by increasing 
sperm longevity (Lynn, 1994). Currently, there are few data 
with which to assess the importance of spermatozeugmata 
on the longevity of bryozoan sperm after spawning. Man- 
rfquez et al. (2001) reported that the fertile half life of 
spawned Celleporella hyiilina sperm at a concentration of 
10 to 10 2 cells ml ' was about 1.2 h. In another study, 
spermatozeugmata of M. membranacea were observed to 
remain motile for 36 h, although the ability of these sperm 
to fertilize eggs was not determined (Temkin, 1991). 

Third, in some species, the formation of spermatozeug- 
mata facilitates fertilization success by enhancing sperm 
molility. In organisms with dimorphic sperm, motile para- 
spermatozoa may transport euspermatozoa to sites of fertil- 
ization in oligochaetes and some gastropods (Ferraguti el 
ul.. 1988; see Buckland-Nicks et al., 2000). In contrast, the 
llagcllar beat of euspermatozoa generates the molility asso- 
ciated with the spherical spermatozeugmata of the bivalve 
Anodonia grandix (Lynn, 1994). The movements of eusper- 
matozoa contained within spermatozeugmata of M. meni- 
branacea are restricted because cells are bound together 
along most of their lengths by viscomechanical forces. The 



adherence of sperm to one another within a spermato- 
zeugma of M. membranacea establishes a structural and 
functional division of the aggregate into head and tail 
halves. The head-end half consists of the head regions that 
are tightly adherent to each other and the nonadhering 
portions of the midpiece region. The head-end half is the 
region of a spermatozeugma in which waveforms achieve 
their greatest amplitude and where the aggregate undergoes 
conformational changes that create a strong curvature dur- 
ing the production of waveforms generated from the tip to 
the base of axonemes (e.g.. during reverse- waveform 
events). The tail-end half of a spermatozeugma forms a 
stiffened, rodlike region consisting of the adhering portions 
of the midpiece and tail regions. In fact, no discernible 
curvature was observed during the generation of any wave- 
form in the tail-end half of spermatozeugmata during this 
study. Consequently, the forces that move spermatozeug- 
mata of M. membranacea appear to be generated in the 
head-end half of the aggregates rather than along the entire 
length of the midpiece and tail regions. 

Sperm in spermatozeugmata of M. membranipora may 
generate at least four types of waveforms. Here, we ob- 
served the spontaneous generation of three waveforms: 
small amplitude, large amplitude, and reverse. A fourth 
waveform type, in which the head-end halves of sperma- 
tozeugmata produce an effective stroke-recovery stroke 
movement similar to that of a cilium, can be induced by 
placing spermatozeugmata in seawater containing elevated 
levels of either Ca 2+ or K + (Temkin. 2002). During small- 
and large-amplitude waveform events, waveforms are gen- 
erated from the base to the tip of axonemes. In contrast, 
during reverse and cilium-like movements, waveforms are 
generated from the tip to the base of axonemes. 

Modulating the direction of waveform propagation along 
the axoneme is a rare phenomenon among animal sperm 
(Afzelius, 1982; Baccetti et al.. 1989). The ability to naturally 
reverse the direction of waveform propagation has been 
reported for the sperm of the polyclad turbellarians Noto- 
plana atomata. Polyposthia similis. and Leptoplana tremel- 
lari.s (Hendelberg, 1965, 1983). the parasitic polychaete 
Myzostomum cirrifenim (Afzelius, 1982. 1983). and the 
tephritid flies Ceretitix capitals, Daciis oleae. and /). dor- 
xalix (Baccetti et al.. 1989). Among these organisms, mod- 
ulating the direction of waveform propagation is not specific 
to any one organization of the axoneme or mode of sperm 
transfer. The sperm of M. membranacea have a 9 + 2 
axoneme (Zimmer and Woollacott, 1974) and are trans- 
ferred to maternal individuals through the water column 
aggregated into spermatozeugmata. The threadlike sperm of 
N. alamata. P. siinili\. and L. trcmellaris contain two 9 + 1 
axonemes and are copulated directly into the reproductive 
tract of females (Hendelberg, 1965, 1983). In M. cirrijcnun, 
sperm have a 9 + axoneme and are packaged into sper- 
matophores that are reciprocally transferred to the epidermis 



SPERMATOZEUGMATA WAVEFORM DYNAMICS 



43 



of hermaphroditic partners (Afzelius, 1983). The sperm of 
tephritid flies have a 9 + 9 + 2 axoneme and are directly 
copulated into the female reproductive tract as spermatodes- 
mata, aggregates partially encapsulated around the head 
ends of the sperm (Baccetti el al., 1989). 

In M. membranacea, the motility of a spermatozeugma is 
dependent on the synchronous generation of waveforms by 
most sperm of the aggregate. At spawning, spermatozeug- 
mata move through the paternal tentacles tail-end first, 
generating reverse waveforms that are translated along ax- 
onemes from tip to base. To explain how spermatozeugmata 
move through tentacles during spawning, we propose a 
crawling model. While in the tentacle lumen, spermato- 
zeugmata generate reverse waveforms that push against the 
internal walls of the tentacles (Fig. 9). As reverse wave- 
forms are generated from the tip to the base of the axoneme, 
spermatozeugmata move in a tail-forward direction. Since 
the generation of reverse waveforms did not seem to move 
spermatozeugmata in the paternal perivisceral coelom or in 
seawater, contact with a surface may be important for the 
effectiveness of reverse waveforms in moving spermato- 
zeugmata. In contrast, generation of large-amplitude wave- 
forms and cilium-like movements propels spermatozeug- 
mata with the head-end forward without needing to push 
against a surface (Temkin, 2002). It seems likely that the 
generation of either large-amplitude waveforms or cilium- 
like movements pulls spermatozeugmata into ITOs. During 
this process, the adhering portions of the midpiece and tail 
appear rigid, which may have caused Temkin (1994) to 
report that the undulatory movements of spermatozeugmata 
stop after the head ends enter the ITO. The actual wave- 
forms used by M. membranacea spermatozeugmata after 
entering ITOs remain to be determined, because the view of 
spermatozeugmata inside an ITO is obscured by the cilia 
that line the lumen of the organ. 

The waveform patterns generated by sperm of M. mem- 
branacea in spermatozeugmata change after spawning into 
seawater. Temkin (1994) reported that spermatozeugmata 
seemed to become quiescent shortly after spawning. Unlike 
the quiescence of sea urchin (Gibbons, 1980), tunicate (Bro- 



Tentaclo 



Direction of Waveform Propagation 




Direction of Movement 

Figure 9. Model of spermatozeugma crawling tail-end forward 
through paternal tentacle during spawning. In the diagram, a spermato- 
zeugma is moving from left to right. Reverse waveforms are being gener- 
ated from the tip to the base of axonemes. Reverse waveforms push against 
the inner walls of the tentacle (arrowheads) and move the spermatozeugma 
tail-end forward. 



kaw, 1984), and polychaete (Pacey et al., 1994) sperm, in 
which the beat of the flagellum ceases, the apparent quies- 
cence in M. membranacea spermatozeugmata is caused by 
the decrease in the frequency and duration of reverse wave- 
forms after spermatozeugmata enter the water column. Ev- 
idence for a similar change in waveform dynamics for 
spermatozeugmata of Electro pilosa may be contained in a 
paper by Marcus ( 1926). Marcus ( 1926) reported that sperm 
of E. pilosa became immobile and died shortly after being 
transferred into seawater. Decreasing the frequency and 
duration of reverse-waveform events after spawning may 
allow spermatozeugmata to conserve energy and may in- 
crease the longevity of sperm in the water column. Ho and 
Suarez (2003) have shown that increases in wave amplitude 
in bull sperm require increases in ATP consumption. Since 
small-amplitude waveforms produce almost no curvature of 
the axoneme compared to large-amplitude and reverse 
waveforms, small-amplitude waveforms may require less 
energy to produce than the other waveforms. In M. mem- 
branacea, the actual consumption of ATP by spermato- 
zeugmata inside and outside of the paternal visceral coelom 
remains to be determined. 

In M. membranacea, spermatozeugmata also generate 
reverse waveforms after contacting an ITO. The ITO is 
oriented with its distal pore directed away from the funnel 
of the lophophore. Consequently, spermatozeugmata within 
lophophores cannot be oriented to enter maternal individu- 
als unless they develop a bend. A spermatozeugma under- 
going a reverse-waveform event develops a strong confor- 
mational change that curves the head end of an aggregate 
relative to its long axis. This conformation change bends the 
spermatozeugma toward the distal pore of the ITO. Once the 
head end of a sperm aggregate is inside an ITO, the sper- 
matozeugma likely changes its waveform dynamics to gen- 
erate a waveform that pulls it forward. 

The generation of reverse waveforms by a spermato- 
zeugma of M membranacea after contacting an ITO may be 
a response to a substance either on the distal surface or 
emanating from the pores of the ITO that acts as a sperm 
chemoattractant. To date, no sperm chemoattractants have 
been identified for gymnolaemate bryozoans (see Reed, 
1991). Nevertheless, the change in waveform dynamics at 
the ITO may be evidence for a behavioral response of 
gymnolaemate bryozoan sperm to contacting maternal tis- 
sue of conspecifics. Although external fertilization has been 
reported among gymnolaemate bryozoans (e.g., Silen, 
1966), all studies that have actually confirmed the presence 
of a sperm or male pronucleus in oocytes indicate that 
sperm-egg fusion occurs before or during ovulation (see 
Ryland and Bishop, 1993; Temkin, 1994, 1996). 

Internal fertilization in gymnolaemate bryozoans proba- 
bly involves the entry of spawned sperm into the maternal 
coelom, and is not the result of eggs and sperm being 
produced in the same perivisceral coelom by hermaphto- 



44 



M. H TEMKIN AND S. B. BORTOLAMI 



ditic zooids (see Ryland and Bishop, 1993; Temkin, 1994, 
1996). Consequently, it is essential for spawned sperm to 
recognize the entryway into the maternal coelom, such as 
the 1TO in M. membranacea. The presence of a sperm 
chemoattractant was also suggested by Silen ( 1966), based 
on his observations that sperm of Electro posidoniae at- 
tached to the abfrontal sides of tentacles began to produce 
"violent jerks" to move to the distal opening of the ITO at 
the time of egg spawning. ITOs have been reported to 
develop in species of seven gymnolaemate genera: Mem- 
hronipora, Electro, Alcyonidium, Conopeum, Farella, Vic- 
torella, and Bulbellci. Among these species, sperm entry 
through the ITO has been confirmed only for M. membra- 
nacea (Temkin, 1994). Silen (1966) reported that sperm 
entered the ITO of Electro crustulena, but he did not de- 
termine where sperm-egg fusion occurred. In species with- 
out ITOs, the supraneural pore, which represents the prox- 
imal pore of the ITO, has been hypothesized to serve as the 
entryway for sperm into the maternal coelom (see Silen, 
1966). However, sperm entry through the supraneural pore 
has yet to be documented for any species. 

Since spermatozeugmata are only known to occur in the 
gymnolaemate genera of Membnmipora and Electro, the 
waveforms so far described for M. membranacea sperma- 
tozeugmata may not necessarily be produced by sperm of 
other gymnolaemate species. In fact, the waveforms pro- 
duced by spermatozeugmata of Electro remain to be deter- 
mined. However, some initial data on the waveforms gen- 
erated by sperm of Thalamoporella floridanci suggest that 
the waveforms observed for M. membranacea spermato- 
zeugmata, including reverse waveforms, do occur in other 
gymnolaemate bryozoan sperm (Temkin, 2001). To under- 
stand the significance and evolution of spermatozeugmata 
and the waveform dynamics of gymnolaemate bryozoan 
sperm, further studies are required to determine how sperm 
locate, identify, and enter maternal individuals in gymno- 
laemate species that do not spawn spermatozeugmata or do 
not form ITOs. 

Acknowledgments 

We thank the following people for providing M. H. 
Temkin with laboratory space and facilities: Kevin Eckel- 
barger and Tim Miller at the Darling Marine Center in 
Maine, Mary Rice at the Smithsonian Marine Station at Fort 
Pierce, Dennis Willows and Richard Strathmann at the 
Friday Harbor Laboratories, and Robert Woollacott at Har- 
vard University. Karel Liem generously allowed us to use 
his high-speed video equipment. We thank Brad Baldwin. 
Joe Erliehman. Marianne DiMarco-Temkin, Russel Zim- 
mer, Michael LaBarbera. and an anonymous reviewer tor 
reading and suggesting changes that improved the manu- 
script. This paper is dedicated to the memory of Dr. Larry R. 
McLdward. 



Literature Cited 

Afzelius, B. 1982. The flagellar apparatus of marine spermatozoa. Pp. 
495-519 in Prokaryoric and Eukaryolic Flagella. W. Amos and J. 
Duckett, eds. Cambridge University Press. Cambridge. 
Afzelius, B. A. 1983. The spermatozoon of Myzostomum cirrifernin 

(Annelida, Myzostomida). J. Ultraxtruct. Res. 83: 58-68. 
Baccetti, B. H., B. H. Gibbons, and I. R. Gibbons. 1989. Bidirectional 
swimming in spermatozoa of Tephritid flies. J. Submicrosc. Cytol. 
Patlwl. 21: 619-625. 

Bishop, J. D. I)., and J. S. Ryland. 1991. Storage of exogenous sperm 
by the compound ascidian Diplosomu listerianum. Mar. Biol. 108: 
1 11-1 IX. 

Bonnevie, K. 19(17. Untersuchungen iiber Keimzellen. H. Physiologische 
Polyspermie bei Bryozoen. Jenaische Zeitschreift fur Naturwissen- 
schaften 42: 567-598. 

Braidotti, P., and M. Ferraguti. 1982. Two sperm types in the sper- 
matozeugmata of Tubifex tubifex (Annelida, Oligochaeta). J. Morphol. 
171: 123-136. 
Brokaw, C. J. 1984. Cyclic AMP-dependent activation of sea urchin and 

tunicate sperm motility. Ann. N Y Acad. Sci. 438: 132-141 
Buckland-Nicks, J.. I. Bryson, L. Hart, and V. Partridge. 1999. Sex 
and a snail's sperm: on the transport, storage, and fate of dimorphic 
sperm in Littorinidae. Invertebr. Reprod. De\. 36: 145-152. 
Buckland-Nicks, J. A., J. M. Healy, B. G. M. Jamieson, and S. 
O'I.eary. 2(1(10. Paraspermatogenesis in Littoraria (Palustorina) ar- 
liciilute, with reference to other Littorinidae (Littorinoidea, Caenogas- 
tropoda). Invertehr. Biol. 119: 254-264. 

Burighel, P., and G. B. Martinucci. 1994a. Sexual reproduction in the 
compound ascidiun Oip/oxoma listerianum (Tunicatu). 1. Metamorpho- 
sis, storage and phagocytosis of sperm in female duct. Mar. Hint. 1 18: 
489-498. 

Burighel. P., and G. B. Martinucci. 1994b. Sexual reproduction in the 
compound ascidiun Diplosoma listerianum (Tunicata). II. Sperm pen- 
etration through ovary wall and evidence of internal fertilization. Mar. 
Biol. 118: 499-510. 

Daly, J. M., and I). W. Golding. 1977. A description of the spermatheca 
of Spirorbis spirorbis (L.) (Polychaeta: Serpulidae) and evidence for a 
novel mode of sperm transmission. J. Mar. Biol. Assoc. UK 57: 
219-227. 

Ferraguti, M. 1983. Annelida Clitellata. Pp. 343-376 in Reproductive 
Biolotfv i>f Invertebrates. Volume 11. SperiiititoKi-ncxix and Sperm Func- 
tion. G. K. Adiyodi and R. G. Adiyodi, eds. John \Vile>. New York. 
Ferraguti, M. G., G. Bernadini, G. Melone. and R. Dallai. 1488. 
Structure and function of the metachronal wave in /';!/>;/< i inhife\ 
spermato/eugmata (Annelida, Oligochaeta). J. Ullruxtriict. Mol. Struct. 
Rex. 99: 79-95. 
Ferraguti, M., G. Grassi, and C. Erseus. 1989. niffercnl models of 

tuhificid spermalo/.eugmata. Hydrobioloxia '80: 73-82. 
Franzen, A. 1956. On spermiogenesis. morphology of the spermulo/oan. 
and biology of fertilization among invertebrates. Zoo/. Bii/r. Uppx. 31: 
355-482 

Franzen, A. 19M8. Spermiogcnesis. sperm structure and spermato/eug 
mala in the gymnolaematous bryozoan Eleclra piloiui (Bryo/oa. Gym- 
nolacmutu). Invertehr. Reprod. l)e\: 34: 55-63. 
Gihhons. B. H. 198(1. Iiuermillenl swimming in live sea urchin sperm 

J. Cell Biol. 84: 1-12. 

Hagfinan, G. S. 1983. A tine structural analysis of ovarian morphology. 
oo;.'cncsis. and ovulation in the marine bryozoan Meinhraiiipora xer- 
rilainella (Cheilostomata, Anasca). Ph.D. dissertation. Universily of 
Souihern California. I.os Angeles. CA. 4X7 pp. 

Hayakawa, V.. R. Aki\:inia. H. Munehara, and A. Komaru. 2002a. 
Dimorphic sperm inlluence semen distribution in a non-copulatory 
sculpin Hi'inilepiilotnx xilberti. Environ. Biol. Fixhcx 65: 31 1-317. 
Hayakawa, V.. H. Munehara, and A. Komaru. 20021). Obstructive 



SPERMATOZEUGMATA WAVEFORM DYNAMICS 



45 



role of the dimorphic sperm in a non-copulatory marine sculpin, Hemi- 
lepidotus gilberii, to prevent other males' eusperm from fertilization. 
Environ. Biol. Fishes 64: 419-427. 

Healy, J. M., and It. (.'. M. Jamieson. 1993. Euspennatozoa. parasper- 
matozoa and spermato/eugmata of Littoraria (Palustorina) articii/ala 
(Prosobranchia: Caenogastropoda) with special reference to the 
pseudotrich. Ada Zool. 74: 321-330. 

Hendelherg. J. 1965. On different types of spermatozoa in Polycladida, 
Turbellaria. Ark. Zool. 18: 267-304. 

Hendelberg, J. 1983. Platyhelminthes Turbellaria. Pp. 75-104 in Re- 
productive Biology of Invertebrates, Volume II. Spermatogenesis and 
Sperm Function, G. K. Adiyodi and R. G. Adiyodi. eds. John Wiley. 
New York. 

Ho, H. C., and S. S. Suarez. 20(13. Characterization of the intracellular 
calcium store at the base of the sperm flagellum that regulates hyper- 
activated motility. Biol. Reprod. 68: 1590-1596. 

Jamieson, B. G. M. 1991. Fish Evolution and Systematic.*: Evidence 
from Spermatozoa. Cambridge University Press, Cambridge. 319 pp. 

Jespersen, A., and J. Liitzen. 2001. Ultrastructure of the seminal re- 
ceptacle and the dimorphic sperm in the commensal bivalve Myse/la 
bidentata ( Veneroida; Galeommatoidea; Montacutidae). Actu Zonl. 82: 
107-115. 

Jespersen, A., T. Kosuge, and J. Liitzen. 2001. Sperm dimorphism and 
spermato/.eugmata in the commensal bivalve Pseudopythina macro- 
phthalmcnsis (Galeommatoidea. Kelliidae). Zoomorphology 120: 177- 
189. 

Jespersen, A., J. I lil/i-n, and B. Morton. 2002. Ultrastructure of di- 
morphic sperm and seminal receptacle in the hermaphrodites Burrimy- 
sia siphonosomae and Pseudopythina ochetostomae (Bivalvia. Gale- 
ommatoidea). Zoomorphology 121: 159-172. 

Levitan, I). R. 1995. The ecology of fertilization in free-spawning in- 
vertebrates. Pp. 123-156 in Ecology of Marine Invertebrate Lan'ae, 
L. R. McEdward, ed. CRC Press. New York. 

Lynn, J. VV. 1994. The Ultrastructure of the sperm and motile sperma- 
tozeugmata released from the freshwater mussel AnoJonta gram/is 
(Mollusca. Bivalvia, Unionidae). Can. J. Zool. 72: 1452-1461 

Manriquez, P. H., R. N. Hughes, and J. D. D. Bishop. 2001. Age- 
dependent loss of fertility in water-borne sperm of the bryozoan Ce/le- 
porcllu Inalina. Mar. Ecol. Prog. Set: 224: 87-92. 

Marcus, E. 1926. Beobachtungen und Versuche an lebenden Meeres- 
bryozoen. Zool. Jaltrh. Abt. Syst. 52: 1-102. 

Marcus, E. 1938. Bryozoarios marinhos brasilieros 11. Univ. Sao Paulo 
Fin-. Fi/o.v. dent. Let. Bol. Zool. 2: 1-196. 

Miller, R. L. 1983. Cnidaria. Pp. 23-73 in Reproductive Biology of 
Invertebrates. Volume II, Spermatogenesis and Sperm Function, G. K. 
Adiyodi and R. G. Adiyodi. eds. John Wiley. New York. 

O Foighil, D. 1985. Sperm transfer and storage in the brooding bivalve 
A/V.VI'//II ninmla. Biol. Hull. 169: 602-614. 

O Foighil, I). 1989. Role of spermatozeugmata in the spawning ecology 
of the brood oyster Oslrea edit/is. Gamete Res. 24: 219-228. 



Pacey, A. A., J. C. Cossun, and M. G. Bentley. 1994. Intermittent 
swimming in the spermatozoa of the lugworm Arenicola marina (L.) 
(Annelida: Polychaeta). Cell Motil. Cytoskelet. 29: 186-194. 

Reed, C. G. 1991. Bryo/oa. Pp. 85-245 in Reproduction of Marine 
Invertebrates. Volume VI, Echinoderins and Lophophorates. A. C. 
Giese. J. S. Pearse, and V. B. Pearse. eds. Boxwood Press. Pacific 
Grove, CA. 

Rouse, G. W. 1996. Variability of sperm storage by females in the 
Sabellidae and Serpulidae (Polychaeta, Sabellida). Zoomorpliolog\ 
116: 179-193. 

Rvland, J. S., and J. D. Bishop. 1993. Internal fertilization in hermaph- 
roditic colonial invertebrates. Oceanogr. Mar. Biol. Annu. Rev. 31: 
445-477. 

Sahara, K., and N. Kauumura. 2002. Double copulation of a female 
with sterile diploid and polyploid males recovers fertility in Bomhvx 
mori. Zygote 10: 23-29. 

Schwaninger, H. R. 1999. Population structure of the widely dispersing 
marine bryozoan Membrunipora membranacea (Cheilostomata): im- 
plications for population history, biogeography. and taxonomy. Mar. 
Biol. 135: 411-423. 

Sewell, M. A., and F.-S. Chia. 1994. Reproduction of the intraovarian 
brooding apodid Leptosynapta clarki (Echinodermata: Holothuroidea) 
in British Columbia. Mar. Biol. 121: 285-300. 

Silen. L. 1966. On the fertili/ation problem in the gymnolaematous 
Bryozoa. Ophelia 3: I 13-140. 

Temkin, M. H. 1991. Fertilization in the gymnolaemate Bryozoa. Ph.D. 
dissertation. University of Southern California, Los Angeles, CA. 139 

PP 

Temkin, M. H. 1994. Gamete spawning and fertilization in the gymno- 
laemate bryozoan Memhranipora membranacea, Biol. Bull. 187: 143 
155. 

Temkin, M. H. 1996. Comparative fertilization biology of gymnolae- 
mate bryozoans. Mar. Biol. 127: 329-339. 

Temkin, M. H. 2001. A comparison of gymnolaemate bryozoan sperm 
waveform dynamics. .4m. Zool. 41: 1604. 

Temkin, M. H. 2002. The effects of increased external Ca ++ and K + 
concentrations on the waveform dynamics of bryozoan spermatozeug- 
mata. Pp. 3 1 5-320 in Bryo~oan Studies 2001. P. N. Wyse Jackson. C. J. 
Buttler. and M. E. Spenser Jones, eds. Swets and Zeitlinger, Lisse, The 
Netherlands. 

Temkin, M. H., and R. L. Zimmer. 2002. Phylum Bryozoa. Pp. 411- 
427 in Atlas of Marine Invertebrate Larvae, C. Young, ed. Academic 
Press, San Diego, CA. 

Zimnier, R. L. 1991. Phoronida. Pp. 1-45 in Reproduction of Marine 
Invertebrates. Volume VI, Echinoderms and Lophophorates. A. C. 
Giese, J. S. Pearse, and V. B. Pearse, eds. Boxwood Press, Pacific 
Grove, CA. 

/.immer, R. L., and R. M. VVoollacott. 1974. Morphology and bio- 
chemical modifications of the spermatozoan mitochondria of Membra- 
nipora (Bryozoa). J. Cell Biol. 63: 385a. 



Reference: Biol. Hull. 206: 46-54. (February 2004) 
2004 Marine Biological Laboratory 



Differences in the rDNA-Bearing Chromosome Divide 
the Asian-Pacific and Atlantic Species of Crassostrea 

(Bivalvia, Mollusca) 

YONGPING WANG 1 2 , ZHE XU 1 , AND XIMING GUO 1 * 

Huskin Shellfish Research Laboratory, Institute of Marine and Coastal Sciences, Rutgers University, 
6959 Miller Avenue, Port Norris, New Jersev 08349; and ~ Experimental Marine Biologv Laboratory, 
Institute of Oceanology. Chinese Academy of Sciences, 7 Nanhai Road. 
Qingdao, Shandong 266071, PRC 



Abstract. Karyotype and chromosomal location of the 
major ribosomal RNA genes (rDNA) were studied using 
fluorescence in situ hybridization (FISH) in five species of 
Crassostrea: three Asian-Pacific species (C. gigas, C. pli- 
catula, and C. ariakensis) and two Atlantic species (C. 
virginica and C. rhizophorae). FISH probes were made by 
PCR amplification of the intergenic transcribed spacer be- 
tween the 18S and 5.8S rRNA genes, and labeled with 
digoxigenin-1 1-dUTP. All five species had a haploid num- 
ber of 10 chromosomes. The Atlantic species had 1-2 
submetacentric chromosomes, while the three Pacific spe- 
cies had none. FISH with metaphase chromosomes detected 
a single telomeric locus for rDNA in all five species without 
any variation. In all three Pacific species, rDNA was located 
on the long arm of Chromosome 10 (lOq) the smallest 
chromosome. In the two Atlantic species, rDNA was lo- 
cated on the short arm of Chromosome 2 (2p) the second 
longest chromosome. A review of other studies reveals the 
same distribution of NOR sites (putative rDNA loci) in 
three other species: on lOq in C. sikainea and C. angulata 
from the Pacific Ocean and on 2p in C. gasar from the 
western Atlantic. All data support the conclusion that dif- 
ferences in si/.e and shape of the rDNA-bearing chromo- 
some represent a major divide between Asian-Pacific and 
Atlantic species of Crassostrea. This finding suggests that 
chromosomal divergence can occur under seemingly con- 



Received 17 June 200V accepted 21 October 200.V 

* To whom correspondence should he addressed. E-mail: 
xguo@hsrl.rutgers.edu 

.\hl>n'\-uitiii\: CI. centromeric index; 1 ; ISH. lluorescence in siin hybnd- 
i/ution: NOR. nucleolar organi/er region. 



served karyotypes and may play a role in reproductive 
isolation and speciation. 

Introduction 

Classification and phylogenetic analysis of oysters are 
problematic because oysters have few informative morpho- 
logical characteristics. Shell coloration and morphology in 
oysters are highly variable and sensitive to environmental 
influence. Anatomy of soft tissue is difficult and provides 
only limited information. Phylogenetic analyses of oysters 
may have to rely on a multidiscipline approach using mor- 
phological, molecular, and cytogenetic characteristics. Mo- 
lecular data have been used for phylogenetic analysis of 
oysters and have shown great promise (Banks el ai. 1993; 
Littlewood, 1994; 6 Foighil et ai, 1995, 1998; 6 Foighil 
and Taylor, 2000; Lapegue et cil.. 2002). Cytogenetic anal- 
ysis may provide additional characteristics for phylogenetic 
comparisons and insight about major genomic changes at 
chromosome levels. Chromosomal rearrangement and dif- 
ferentiation are important mechanisms for reproductive iso- 
lation and speciation in some taxa (White, 1978; King. 
1993). 

Most of the cytogenetic studies in oysters so far have 
focused on karyotyping, chromosome banding, and NOR 
(nucleolar organizer regions) staining in Ostrea species 
(Insua and Thiriot-Quievreux, 1991; Li and Havenhand. 
1997). Studies in Crassostrea are scarce and provide little 
interspecific comparison (Ladron De Guevara et <//., 1996; 
Leitao et ai. 1999a, b). Although oysters have a low haploid 
number of 10 chromosomes (Nakamura, 1985). oyster chro- 
mosomes are small and similar in arm ratios, which makes 



46 



rDNA-BEARING CHROMOSOME IN CRASSOSTREA OYSTERS 



47 



karyotypic analysis inherently difficult. Probably due to the 
small chromosome size and the lack of cell lines required 
for making elongated chromosomes, chromosome banding 
in oysters is difficult to obtain and reproduce. C- and G- 
banding patterns have been produced in three Crassostrea 
species (Rodriguez-Romero et ai, 1979; Leitao et <//.. 
1999a), but offered little help in the reliable identification of 
oyster chromosomes. Ag-NOR staining is also variable and 
often shows intraspecific variations in number and location, 
which poses problems for interspecific comparisons 
(Thiriot-Quievreux and Insua, 1992; Ladron De Guevara et 
ai. 1994). 

Fluorescence in situ hybridization (FISH) is a relatively 
new technology and now widely used for chromosome 
identification, gene mapping, localization of gene expres- 
sion, and studies on chromosome rearrangement in a variety 
of organisms (Swiger and Tucker. 1996; Nath and Johnson. 
1999). By direct DNA base pair hybridization. FISH pro- 
vides specific and reproducible localization of genes and 
DNA sequences on chromosomes. Repetitive DNA se- 
quences and genes that are present in high copy numbers 
and tandem repeats are ideal for use as FISH probes because 
of their large target size. Unique sequences longer than 80 
kb. such as PI and BAG clones, can be readily mapped to 
chromosomes by FISH and used as chromosome-specific 
probes (Jiang et til., 1995). Unique sequences shorter than I 
kb are generally difficult to assign by FISH, although not 
impossible (Schriml et til., 1999). Chromosome paint 
probes have been developed to label specific chromosomes 
or chromosome regions in some organisms (Rabbitts et ai, 
1995; Shi et ai, 1997). The unambiguous labeling and 
identification of chromosomes by FISH has made it possible 
to study chromosome rearrangements in cancer cells and at 
evolutionary scale. 

FISH may provide a solution to the reliable identification 
of oyster chromosomes, which has not been possible 
through traditional karyotyping, and permit cross-species 
comparisons. The technique has recently been used to study 
oyster chromosomes and shows considerable advantages 
over traditional methods. Using FISH, a repetitive element 
has been mapped to centromeric regions of several chromo- 
somes in the Pacific oyster Crassostrea gigas (Clabby et ai, 
1996; Wang et ai, 2001), and the vertebrate telomere se- 
quence (TAAGGG)n has been mapped to telomeres of three 
species of Crassostrea (Guo and Allen, 1997; Wang and 
Guo, 2001 ). Nine PI clones have been assigned to specific 
chromosomes in C. virginica (Wang, 2001). 

The major ribosomal RNA genes (rDNA), which corre- 
spond to NORs, have also been mapped by FISH in three 
species of Crassostrea (Zhang et at., 1999; Xu et ai, 2001 ; 
Cross et ai, 2003). FISH analysis of rDNA provided vali- 
dation for Ag-NOR staining and eliminated any uncertainty 
and intraspecific variations. Interestingly, Xu et ai (2001) 
found that the two species of Crassostrea studied, one 



Pacific and one Atlantic species, differ in the size and shape 
of the rDNA-bearing chromosome. In a species with an 
Asian-Pacific origin, C. angulata, the rDNA-beanng chro- 
mosome is the same size and shape as in the Pacific species, 
but differs from that in the Atlantic species (Cross et ai, 
2003). To determine if the difference is shared by other 
species of Crassostrea, we used FISH to study the chromo- 
somal location of rDNA in five Crassostrea species that are 
available to us, including the two species studied by Xu et 
ai (2001) but with different populations, two additional 
Asian-Pacific species (C. plicatida and C. ariakensis). and 
one additional Atlantic species (C. rhizophorae). Our results 
plus existing NOR data suggest that differences in the 
rDNA-bearing chromosome represent a major divide be- 
tween Asian-Pacific and Atlantic species of Crassostrea. 

Materials and Methods 

Species studied 

Five species of Crassostrea were included in this study: 
three Asian-Pacific species (C. gigas (Thunberg, 1793), C. 
plicatida (Gmelin, 1791), and C. ariakensis (Fujita, 1913)), 
and two Atlantic species (C. virginica (Gmelin, 1791) and 
C. rhizophorae (Guilding, 1828)). C. gigas was obtained 
from a hatchery in Penglai, Shandong, northern China. The 
C. gigas studied by Xu et ai (2001) was from a Rutgers 
stock originated from Washington State. The use of differ- 
ent stocks was intended to detect possible variation among 
populations. C. plicatida was collected from Qingdao. 
Shandong, northern China. C. ariakensis was collected from 
Yangjiang, Guangdong, southern China. C. virginica was 
from two sources: wild oysters from Delaware Bay and 
hybrids between Delaware Bay wild and a hatchery stock 
(NEH. the same stock used by Xu et ai, 2001 ) maintained 
at the Haskin Shellfish Research Laboratory (HSRL), Rut- 
gers University, New Jersey. The hatchery stock, which 
originated from Long Island Sound, has been maintained at 
HSRL for over 10 generations (selected for disease-resis- 
tance). C. rhi~ophorae was the first-generation progeny of a 
Caribbean population produced and maintained at the Har- 
bor Branch Oceanographic Institute, Ft. Pierce. Florida. 

Chromosome preparation 

For C. plicatida and C. ariakensis, chromosome met- 
aphases were prepared from gill tissue. Oysters were incu- 
bated in 0.005% colchicine in seawater for 8-10 h. Gill 
tissues from five oysters of each species were dissected and 
treated with the hypotonic solution 0.075 M KC1 for 30 min 
before being fixed in freshly prepared Carnoy's fixative (3:1 
methanol/acetic acid. v:v). The fixative was changed twice, 
and fixed samples were stored at 4 C. Metaphases of C. 
gigas, C. virginica, and C. rhizophorae were made from 
early embryos according to the protocol described by Xu et 



48 



Y. WANG ET AL 



a/. (2001 ). For embryo production, 3 females and 2 males of 
C. gigas, 4 females and 4 males of C. virginica. and 6 
females and 3 males of C. rhizophorae were used. 

Slides were prepared using an air-drying technique. Gill 
tissues were chopped into fine pieces and resuspended in 
freshly made fixative. Two or three drops of cell (from gills) 
or embryo suspension were loaded onto a clean slide and 
flooded with two drops of 1:1 methanol/acetic acid. Slides 
were air-dried and stored at 20 C until FISH analysis. 

Probe construction 

Oyster genornic DNA was prepared from adductor mus- 
cle of C. gigas and C. virginica according to Doyle and 
Doyle (1987). Intergenic transcribed spacers between the 
18S and 5.8S RNA genes (ITS1 ) were amplified, labeled by 
PCR incorporation of digoxigenin-l 1-dUTP, and used as 
FISH probes. Primers, 5'-GGTTTCTGTAGGTGAAC- 
CTGC and 5'-CTGCGTTCTTCATCGACCC, were de- 
signed using conserved sequences flanking the ITS 1 . ITS 1 
was used as the FISH probe so that the primer sequences 
were conserved and could allow universal amplification, 
while the internal sequences were variable and might permit 
species-specific detection. PCR amplification was con- 
ducted in 25 ju,l of a PCR mixture containing PCR buffer 
with 1 .5 mM of MgCK. 0.4 ing/ml of BSA, 0.2 mM each of 
dATP, dCTP, and dGTP, 0.13 mM of dTTP, 0.07 mM of 
digoxigenin-l 1-dUTP, 0.5 LI of Taq DNA polymera.se. 1 
IJLM of each primer, and I ;u,g of oyster genomic DNA. 
Digoxigenin-l 1-dUTP and other PCR reagents were pur- 
chased from Roche (Indianapolis. IN). PCR was performed 
in a DeltaCycler II system thermal cycler (ERICOMP Inc.. 
San Diego, CA) with 30 cycles of 1 min of denaturing at 
95 C, 1 min of annealing at 50 C. and I min of extension 
at 72 C. and final extension at 72 "C for 5 min. PCR 
products were verified on 2 c /r agarose gels. DIG-labeled 
PCR products were purified using G-50 columns (Roche) 
before being used as FISH probes. 

Fluorescence in situ hyhridization 

Separate ITS I probes were made for C. gigas and C. 
virginica, using their respective genomic DNA as templates. 
Both probes were tested for FISH in all five species. FISH 
was conducted according to protocols described by Xu el nl. 
(2001). Before FISH, slides were stained with Leishman's 
stain for 3-5 min and screened for metaphases. Negative 
controls in which the FISH probe was replaced with dis- 
lilled water were included lo delect possible nonspecific 
hybridi/ation. FISH signals were observed under a Nikon 
epi-fluorescence microscope equipped with a CCD camera 
and imaging system. 

Chromosomes were measured for the calculation of rel- 
alive length (Rl.) and centromeric index (CM), and classified 
accordiim to criteria defined bv Levan (1964). Ten meta- 



phases were measured for each species. The CI of each 
chromosome represents the mean and standard deviation of 
the 10 metaphases. When the CI of a chromosome plus and 
minus the standard deviation overlapped two chromosome 
categories, the chromosome was designated with labels for 
two categories. Chromosomes were paired by length and 
arm ratio, and named 1 to 10 from the longest to the 
shortest. 

Results 

A diploid number. 2n = 20. was found in all five oysters 
studied. Each karyotype consisted of 10 pairs of metacentric 
and sometimes submetacentric chromosomes. Karyotype 
analysis showed that all five species shared a similar karyo- 
type (Table 1 ). The only noticeable difference between the 
three Pacific and two Atlantic species was that C. virginica 
and C. rhizophorae had 1-2 chromosomes that were clearly 
submetacentric. while the three Pacific species had no chro- 
mosomes that could be unquestionably defined as submeta- 
centric. There were chromosomes in both Pacific and At- 
lantic species whose centromeric indexes overlapped ranges 
for metacentric (0.500-0.375) and submetacentric (0.374- 
0.250) chromosomes. These were classified as metacentric/ 
submetacentric (ni/sm in Table 1) chromosomes and not 
treated as submetacentric chromosomes. One chromosome 
in C. virginica and two chromosomes in C. rhizophorae 
were clearly submetacentric. 

PCR amplification of ITS1 in C. gigas generated a single 
fragment of approximately 520 bp in length. Incorporation 
of digoxigenin-l 1-dUTP shifted the size of the PCR product 
to about 670 bp. The PCR product of the same primer pair 
in C. virginica was about 500 bp, slightly shorter than that 
from C. gigas. Both C. gigas (Cg) and C. virginica (Cv) 
probes were used for FISH analysis. 

FISH with both Cg and Cv probes produced positive 
signals in all five species (Fig. 1 ). Two bright signals were 
delected in all metaphases analyzed in all five species with- 
out any variation (Table 2). The FISH signals were re- 
stricted to one locus (one pair ot chromosomes) with no or 
little background signal elsewhere on the chromosomes. For 
interpliase nuclei, the number of FISH signals varied be- 
tween one and two. About 50% 68% of nuclei clearly had 
two FISH signals, while others had one or overlapping 
signals. In all five species studied. Cg and Cv probes pro- 
duced identical results in the number and location of signals, 
bul signal strength differed. In Pacific species, the signals 
produced by Cg probes were generally stronger than those 
produced by Cv probes; conversely, in Atlantic species. Cv 
probes usually produced stronger signals. Only FISH results 
with the Cg probe for Pacific species and the Cv probe for 
Atlantic species are presented in Figure I. No FISH signal 
was observed in the negative controls. 

Karyotype analysis of FISH signals showed that, in all 



rDNA-BEARING CHROMOSOME IN CRASSOSTREA OYSTERS 



49 



Table 1 

Ktinvtype analysis of 10 metaphases in five Crassostrea .V/XT/CA 



Species 
chromosome 


Relative length 
(mean SD) 


Centromeric index 
(mean SD) 


Classification' 


C. 


gigas 


















1 


12.43 





0.25 


0.41 





0.01 


m 




2 


11.86 


4- 


0.55 


0.46 





0.02 


m 




3 


10.97 





0.40 


0.45 


4- 


0.02 


m 




4 


10.50 


-f 


0.16 


0.43 


4- 


0.01 


m 




5 


10.28 





0.42 


0.38 


4- 


0.03 


m/sm 




6 


9.88 


4- 


0.14 


0.41 


-t 


0.01 


m 




7 


9.43 





0.22 


0.45 





0.02 


m 




S 


9.29 





0.25 


0.40 


4- 


0.03 


m/sm 




9 


8.66 


4- 


0.22 


0.41 





0.03 


m 




10 


7.61 





0.53 


0.42 





0.02 


m 


c. 


plicatiila 


















1 


12.87 


4- 


0.37 


0.46 





0.01 


m 




2 


11.10 


4- 


0.27 


0.41 





0.02 


m 




3 


10.83 


4- 


0.31 


0.46 





0.02 


m 




4 


10.35 


+ 


0.29 


0.41 


( 


0.01 


m 




5 


10.14 


4- 


0.49 


0.45 





0.02 


m 




6 


9.62 


+ 


0.05 


0.45 


4- 


0.02 


m 




7 


9.59 


H- 


0.24 


0.39 





0.02 


m/sm 




8 


9.09 


4- 


0.36 


0.39 





0.02 


m/sm 




9 


8.45 


4 


0.38 


0.39 


4- 


0.01 


m 




II) 


7.79 


4- 


0.28 


0.40 


-+- 


0.02 


in 


C. 


ariakensis 


















\ 


12.03 


4- 


0.47 


0.38 


+ 


0.02 


m/sm 




2 


11.53 


4- 


0.39 


0.46 





0.01 


m 




3 


10.95 





0.59 


0.40 





0.01 


m 




4 


10.51 


4- 


0.37 


0.41 





0.02 


m 




5 


9.90 


it 


0.81 


0.45 





0.03 


m 




6 


9.77 





0.35 


0.46 


4- 


0.01 


m 




7 


9.31 


4- 


0.44 


0.42 





0.01 


m 




8 


9.05 





0.22 


0.40 


4- 


0.02 


m 




9 


8.89 


* 


0.32 


0.44 


it 


0.02 


m 




II) 


8.13 





0.56 


0.39 





0.01 


m 


c. 


virginica 


















1 


12.51 





0.37 


0.47 





0.01 


m 




2 


11.64 





0.26 


0.38 


4- 


0.01 


m/sm 




3 


10.96 


t 


0.29 


0.41 


4- 


0.01 


m 




4 


10.81 


4- 


0.23 


0.47 


4- 


0,01 


m 




5 


10.20 


4- 


0.31 


0.40 





0.02 


in 




6 


9.68 


4- 


0.30 


0.47 





O.I 


m 




7 


9.41 


4- 


0.25 


0.40 





0.02 


m 




8 


8.91 


+ 


0.22 


0.41 





0.01 


m 




9 


8.28 


+ 


0.21 


0.35 





0.02 


sm 




II) 


7.61 


4- 


0.38 


0.47 





0.01 


m 


c. 


rhizophorae 


















1 


12.23 





0.59 


0.46 


+ 


0.02 


in 




2 


12.22 


4- 


0.42 


0.38 





0.01 


m/sm 




3 


11.22 


t 


0.39 


0.40 


4- 


0.02 


m 




4 


10.90 


4- 


0.16 


0.46 


i 


0.02 


m 




5 


10.09 


4- 


0.49 


0.32 


4- 


0.04 


sm 




6 


9.96 


4- 


0.53 


0.40 


4- 


0.01 


m 




7 


9.45 


4- 


0.57 


0.46 


+ 


0.01 


in 




8 


8.70 


t 


0.28 


0.47 


4- 


0.02 


in 




9 


7.83 





0.40 


0.30 


4- 


0.03 


sm 




II) 


7.38 





0.65 


0.46 





0.01 


m 



1 m = metacentric chromosomes; sm = submetacentric chromosomes; 
m/sm = metacentric or submetacentric, centromeric indexes overlapping 
two categories. 



three Pacific species (C. gigas. C. plicatula, and C. 
kensis), the FISH signals occurred on the long arms of 
Chromosome 10 ( lOq. Fig. 1. Table 2). The assignment was 
unambiguous because Chromosome 10 was clearly the 
smallest chromosome in all three species. In all three Pacific 
species, the signals were found at telomeric regions of the 
long arm. In the two Atlantic species (C. virginica and C. 
rhizophorae), however. FISH signals were found on the 
short arms of Chromosome 2 (2p, Fig. 1, Table 2). Chro- 
mosome 2 was the second longest chromosome in both 
species and was clearly distinguishable from Chromosome 
1 and 3 by its centromeric index. Chromosome 2 in both 
Atlantic species had a centromeric index of 0.38 (m/sm), 
compared with 0.46-0.47 for Chromosome 1 and 0.40- 
0.41 for Chromosome 3 (Table 1 ). As in the Pacific species, 
FISH signals were restricted to telomere regions. Karyo- 
typic alignments of the five Crassostrea species are pre- 
sented in Figure IF. 

For both C. gigax and C. virginica, there was no intraspe- 
cific variation in the number and chromosomal location of 
the rDNA locus among oysters collected from different 
populations, as demonstrated by results from this study and 
Xu et al. (20011. 

Discussion 

Fluorescence in situ hybridization validates nitcleolar 
organizer regions, hut not always 

This study provides unambiguous chromosomal assign- 
ment of rDNA in five species of Crassostrea. including 
different populations of two previously studied species, C. 
gigcis and C. virginica. The number and location of the 
rDNA locus revealed by FISH are clear and without any 
variation. Despite the use of oysters from different popula- 
tions. FISH results from this study agree with previous 
FISH analyses in both C. gigas and C. virginica (Zhang et 
al.. 1999; Xu et al.. 2001). FISH results presented here 
confirm that rDNA or the major rRNA genes are located at 
the NOR sites previously reported for C. gigas (Thiriot- 
Quievreux and Insua, 1992). For C. rhizophorae, Lapegue 
et al. (2002) observed one NOR on the short arms of 
Chromosome 3. which corresponds to the rDNA loci we 
found on Chromosome 2. Chromosome 3 in Lapegue et al. 
(2002) appeared to be the second longest in the karyotype 
and had a centromeric index close to that of Chromosome 2 
in our study. 

For C. virginica and C ariakensis. however. FISH results 
are in conflict with results from Ag-NOR staining. Leitao et 
al. ( 1999b) reported two NOR sites for C. virginicu (Chro- 
mosomes 1 and 5) and C. ariakensis (Chromosomes 9 and 
10) with considerable variation, while FISH in this study 
detected only one rDNA locus in the two species. Our FISH 
results are clear, consistent, and supported by early studies 
in C. virginica (Zhang et al.. 1949; Xu et al.. 2001). The 



Y. WANG ET AL 





Cg 



Cp 



Ca 



Cr 



Cv 





1C 




JfKU 

it n x K K r< u 

li M if 11 it ur 
)C II II II U I) H 

7( )f If It M H U If 



Figure 1. Fluorescence in situ hybndi/ation (FISH) signals and chromosomal location of the major rRNA 
genes in live species of Crassostmi, (A) C. gigas rDNA probe on C. gigas chromosomes; (B) C. gigas probe 
on C filicatulu; (C) C. gigas probe on C. ariakfiisis: (D) C. virginica probe on C. rhi~ophorae; (E) C. virginica 
probe on C. virginica: (F) chromosome alignment of live species. Arrows show FISH signals. 



discrepancy between the FISH and NOR data may be 
caused by either false-positive Ag-NOR staining or by a 
lack of correspondence between NORs and the major rRNA 
genes. Ag-NOR staining targets transcriptionally active 
NOR sites and is known to produce variable and inconsis- 
tent results in the number and sometimes the location of 
NORs within the same species (Insua and Thiriot- 
guievrcux. 1 W; Li and Havenhand. I W). Also. Ag-NOR 
staining may not be able to separate major ( 18S-5.8S-28S) 
from minor (5S) rDNA and other actively transcribed genes. 
One of the two signals described by Leitao </ ul. ( 1999b) 
seems to correspond to the major rDNA Incus m our studs, 
hul the nature of the other site is unknown. Based on 
preliminary FISH data (Wang and Guo. unpubl.). the extra 
NOR site in C. rir^inicu is not the site ol 5S rDNA. Clearly. 
Ag-NOK staining can accurately detect major rRNA genes 
sometimes as shown by results from C. ,t,'/,i,'</.v, C. rhizo- 
I'horiic. and C. nn^iilaui (Thiriot-Quievreux and Insua. 
IW2; Lapeguc </ ul., 2002; Cross cl ul.. 2003). hut not 
always as exemplified in C. virxinica and C. uritiki'ii.si\. 



Table- 2 

Fluorescence in situ hyhridi-ation wiili C. gigas and C. virginica rDNA 
prohes nn inlerphase nuclei and inetaphasi' chromosomes in five \/><v/o 
of Crassoslrea 

% Nuclei with <7r Metaphases v\ ith Chromosomal 
Probe/species 2 signals (n) 2 signals (/i) location' 



C. H/XIIS probe 








C. gixas 


60(25) 


100(28) 


lOq 


( '. plutintla 


60(25) 


101) ( ID) 


lOq 


C. ariakensis 


64(14) 


101)1 III) 


10q 


C. virxinieti 


6(1 (15) 


100(10) 


2p 


C. rhi:o/>liorae 


67(24) 


100(10) 


-P 


C. virginiea probe 








C. xina\ 


51)114) 


100(14) 


lOq 


< I'llllltlllll 


55(18) 


100(10) 


lOq 


C. ariakensis 


52(15) 


100(13) 


lOq 


('. viixinitti 


65(27) 


100(16) 


2p 


C. rhi;i>phoi\ic 


68(40) 


100(19) 


-P 



All ItK'iitions arc telommc. 



rDNA-BEARING CHROMOSOME IN CRASSOSTREA OYSTERS 



51 



Confirmation of NOR results by FISH is necessary. NOR 
sites, often two per genome, have been reported in several 
species of Ostrea (Insua and Thiriot-Quievreux. 1991, 
1993; Thiriot-Quievreux and Insua, 1992; Li and Haven- 
hand, 1997). It would be interesting to know if the NOR 
sites correspond to the major rRNA gene locus in the Ostrea 
species. 

This study provides the first report on the karyotype of C. 
plicatula, whose taxonomic status is uncertain at this time. 
C. plicatula (formerly Ostrea plicatula) is commonly used 
to refer to a type of small oyster found in intertidal areas 
along most of China's coast (Wang et ai. 19931. Some 
believe that C. plicatula is the same species as C. gigas (Li 
and Qi, 1994; Yang et al., 2000); others suggest that it is 
closely related to C. ariakensis (Yu et ai, 2003); and still 
others consider it an unresolved Crassostrea species and use 
the name of Crassostrea sp. instead (Xu, 1997). C. plicatula 
seems to be a different species from Alectiyonella plicatula 
found in southern China (Li and Qi. 1994). 



Differences between Pacific and Atlantic species 

Results of this study clearly demonstrate that the major 
rDNA is located on the long arms of Chromosome 10 (the 
smallest) in all three Asian-Pacific species and on the short 
arms of Chromosome 2 (the second longest) in the two 
Atlantic species. A critical examination of NOR data indi- 
cates that the same pattern holds true in two other species: 
NORs (or the major rRNA genes, pending verification by 
FISH) are located on the long arms of Chromosome 10 in 
the Asian-Pacific species C. sikamea and on the short arms 
of Chromosome 2 in the eastern Atlantic (African) species 



C. gasar (Leitao et al., 1999b; Lapegue et al.. 2002: Table 
3). The Portuguese oyster C. angulata provides a unique 
and interesting case, adding support to the observed pattern. 
Both Ag-NOR staining and FISH have indicated that rDNA 
is located on the long arm of Chromosome 10. the same as 
in Pacific species (Leitao et al., 1999b; Cross et al., 2003). 
C. angulata is found along the northeastern coasts of the 
Atlantic and has been assumed to be native there. However, 
there are conflicting views on the taxonomic status and 
origin of this species. Some, on the basis of morphological 
and allozyme data, have suggested that C. angulata is the 
same species as the Pacific oyster C. gigas (Menzel, 1974; 
Buroker et al., 1979). The prevailing view is that C. angu- 
lata is an Asian species that was introduced to Europe from 
Japan, although it is possible that C. gigas is an Atlantic 
species that was introduced to Japan from Portugal (Menzel, 
1974). More recent analyses using mtDNA sequence data 
suggest that C. angulata is of Asian origin (likely from 
Taiwan), and that it is closely related, but not identical, to C. 
gigas from Japan (Boudry ct al., 1998; 6 Foighil et al. 
1998). Whether C. angulata is the same species as C. gigas 
requires further study, but it is clear from molecular data 
that C. angulata is an Asian-Pacific species. 

Another karyotypic difference between Asian-Pacific and 
Atlantic members of Crassostrcn is the number of SM 
chromosomes. In this study, we observed one in C. vir- 
ginica, two in C. rlu'-opliortie. and none in the three Pacific 
species. Despite some variation, other studies also found 
more SM chromosomes in Atlantic than in Pacific species 
(Leitao et al., 1999b; Lapegue et al., 2002: Cross ct a I., 
2003). The karyotypic differences between all three Atlantic 
and five Pacific Crassostrea species studied so far are 



Table 3 

Summary of karyotypic differences in the rDNA-heurinx chromiumm- mid llic number nf subinctaccutric (SM) chnniiiudincx between Asian-Pacific mid 
Atlantic species o/ Crassostrea 









Number of SM chromosomes 






rDNA 


This 


Leitao cl al. Lapegue et al. Cross ct al. 




Species 


location 


study 


(19Wb) (2002) (2003) 


Average 


Pacific species 










C. gigas 


I0q 


ii 








C. ariakensis 


lOq 





1 


0.5 


C. plicatula 


lOq 










C. sikaniea 


lOq 2 










C. angulata 


LOq 




1 


0.5 


Atlantic species 










C. virginica 


2p 


1 


2 


1.5 


C. rhizophorae 


2p 


2 


4 


3.0 


C. gtisur 


V 




4 4 


4.0 



1 Only chromosomes with a centromeric index + SD less than 0.37? were considered to be submetacentric tor standardi/ed comparisons. 

2 Based on Ag-NOR staining (Leitao et al.. 1999b; Lapegue et til.. 2002). pending verification by FISH. 
' C. angulata is considered to be an Asian-Pacific species (6 Foighil et ai. 1998; Boudry el al.. I99S). 



52 



Y. WANG ET AL 



summarized in Table 3. Differences in the rDNA-bearing 
chromosome and the number of SM chromosomes represent 
a major divide between Pacific and Atlantic members of the 
genus. Oysters are thought to have highly conserved karyo- 
types. All Crassostrea studied so far (about 13 species) have 
a haploid number of 10 chromosomes and similar karyo- 
types (Nakamura. 1985). The size and shape of the rDNA- 
bearing chromosome and the number of SM chromosomes 
are the first two clearly recognizable chromosomal diver- 
gences among species of Crassostrea. 

There are likely other karyotypic differences between the 
Pacific and Atlantic species, and between this and other 
studies for the same species. We did not attempt to match 
individual chromosomes across species and studies. Chro- 
mosome identification in oysters is difficult because oyster 
chromosomes are similar in size and arm ratio. The accu- 
racy of chromosome measurements varies considerably de- 
pending on the degree of chromosomal condensation, the 
quality of metaphases, and the staining methods used. Chro- 
mosome pairing, classification, and naming are prone to 
errors. In the absence of chromosome-specific FISH probes, 
chromosome alignment across species is not reliable in 
oysters and must be viewed with caution. However, diffi- 
culties in chromosome identification do not affect the con- 
clusions of this study. The rDNA-bearing chromosomes in 
the Pacific and Atlantic species are strikingly and consis- 
tently different, and the difference in the number of SM 
chromosomes is independent of chromosome identity and 
supported by other studies. 

The findings of this study suggest that chromosomal 
divergence among Crassostrea species is possible under a 
seemingly conserved karyotype. The divergence in karyo- 
type is not surprising, and phylogenetic analysis using mo- 
lecular data has shown that Pacific and Atlantic species of 
Crassostrea form two clades on phylogenetic trees (Little- 
wood, 1994; 6 Foighil et cil., 1998; 6 Foighil and Taylor, 
2000; Lapegue ct ai, 2002). Compared with molecular data, 
the rDNA-bearing chromosome provides a clear and simple 
divide between the two species groups, which may represent 
a single event of macroevolution at the chromosome level or 
accumulation of chromosome changes over time. 

Divergence in karyotype can arise from chromosomal 
deletion, duplication, translocalion. inversion, fission, fu- 
sion, and aneuploidy (White. 1978; King. 19931. In our 
case, the only recogni/able difference so far is the si/e and 
shape of the rDNA-bearing chromosomes. It is not clear 
whether Chromosome 10 of the Pacific species is homolo- 
gous to Chromosome 2 of the Atlantic species. It it is. the 
divergence may be caused by chromosomal duplications or 
deletions. If the two chromosomes have little homology 
oilier than in the rDNA regions, translocation would likely 
be responsible. 



Chromosomal divergence and hybridization barrier 

Major chromosomal divergence can cause reproductive 
isolation and speciation, by altering normal gene expression 
and regulation or causing problems for meiosis and fertility 
in hybrids (White, 1978; King, 1993; Noor et ai, 2001; 
Rieseberg, 2001). Biologically, there is a well-documented 
postzygotic hybridization barrier between Asian-Pacific and 
Atlantic species of Crassostrea (see review in Gaffney and 
Allen, 1993). Hybridization within the two geographic spe- 
cies groups produces viable offspring (Wang and Liu. 1959; 
Zhou et at., 1982;Menzel. 1987; Allen and Gaffney. 1993). 
Hybridization between C. virginica and C. gigas or C. 
ariakensis results in high levels of fertilization and appar- 
ently normal larval development, but all hybrid larvae die 
within 2 weeks and before metamorphosis (Allen et ai, 
1993). By demonstrating significant chromosomal diver- 
gence across the hybridization barrier, we raise the possi- 
bility that the chromosomal divergence may contribute to 
the formation of the barrier. Geographic isolation and genie 
mutations may have played important roles in the speciation 
of oysters. We present the chromosomal divergence hypoth- 
esis as a possible explanation for the postzygotic hybridiza- 
tion barrier between Atlantic and Asian-Pacific species of 
Crassostrea, while recognizing that the barrier may as well 
be genie. Additional data are needed to discriminate be- 
tween the two hypotheses. There are about 15 extant mem- 
bers of Crassostrea, and most of them live in the Asian- 
Pacific region (Carriker and Gaffney. 1996). A survey of all 
species in the genus may reveal karyotypic variation within 
the geographic ranges. Species from the eastern Pacific and 
Indian Oceans would be most interesting. Similar studies in 
the oyster genera Ostrea and Saccostrea may provide in- 
sight into the phylogenetic relationships among the three 
major groups of Ostreidae. 

Finally, this study provides the first chromosomal assign- 
ment by FISH of the major rRNA genes in C. plicatiila. C. 
ariakensis, and C. rhi-ophomc. The unambiguous mapping 
of rDNA by FISH made it possible to identify major karyo- 
typic differences between Asian-Pacific and Atlantic spe- 
cies of Crtissostreit. Results of this study show that FISH is 
a powerful tool for cytogenetic analysis, especially in spe- 
cies where chromosome identification by traditional meth- 
ods is challenging. Cytogenetic analysis in most marine 
invertebrates has been limited primarily due to difficulties 
of chromosome identification. The application of FISH 
techniques and development of chromosome-specific 
probes may enable chromosome identification and phyloge- 
netic comparisons of molluscs and other marine inverte- 
brates. 

Acknowledgments 

The authors thank Dr. John Scarpa for providing man- 
grove o\sters and Prof. Fusui Zhang for helping with iden- 



rDNA-BEARING CHROMOSOME IN CRASSOSTREA OYSTERS 



53 



tifying Cruasostreci filicatulu. This study was conducted at 
Rutgers University and supported by grants from the Na- 
tional Sea Grant Marine Biotechnology Program (Grant 
B/T-9801). USDA NR1 (Award No. 96-35205-3854). and 
the New Jersey Commission on Science and Technology 
(02-2042-007-11). Yongping Wang is partly supported by 
grants from China's Natural Science Foundation (No 
39825121). the 863 program (Award 2001AA628150). and 
Chinese Academy of Sciences. This is Publication IMCS- 
2004-01 and NJSG-04-553. 



Literature Cited 

Allen, S. K., Jr., and P. M. Gaffney. 1993. Genetic amrirmatinn i>t 
hybridization between Crassostrea gigas (Thunberg) and Crussostrea 
rmilaris (Gould). Aauaculiurc 113: 291-300. 

Allen, S. K., Jr., P. M. Gaffney. J. Scarpa, and D. Bushek. 1993. 
Inviable hybrids of Crassostrea virginica (Gmelin) with C. rivularis 
(Gould) and C ,t;/,i;<n (Thunberg). Aquaciiltiire 113: 269-2S9. 

Banks, M. A.. D. Hedgecock. and C. Waters. 1993. Discrimination 
between closely related Pacific oyster species (Crassostrea) via mito- 
chondria! DNA sequences coding for large subunit rRNA. Mol. Mar. 
Biol. Biotcchnol. 2: 129-136. 

Boudry, P., S. Heurtehise, B. Collet, F. Cornette, and A. Gerard. 1998. 
Differentiation between populations of the Portuguese oyster. Cras- 
sostrea angulata (Lamark) and the Pacific oyster, Crassostrea gigas 
(Thunberg), revealed by mtDNA RFLP analysis. J. Exp. Mar. Binl. 
Ecol. 226: 279-291. 

Buroker, N. E., W. K. Hershberger. and K. K. Chew. 1979. Popula- 
tion genetics of the family Ostreidae. I. Intraspecilic studies of Crav- 
sostrea gigas and Saecostrea commemalis. Mar. Binl. 54: 157-169. 

Carriker, M. R.. and P. M. Gaffnev. 1996. A catalogue of selected 
species of living oysters (Ostreacea) of the world. Pp. 1-1? in The 
Eastern Ovster Crassostrea virginica. V. S. Kennedy. R. I. E. Newell, 
and A. F. Eble. eds. Maryland Sea Grant College. College Park. 

Clabby, C.. II. Goswami, F. Flavin, N. P. \\ilkins, J. A. Houghton, and 
R. Powell. 1996. Cloning, characterization and chromosomal loca- 
tion of a satellite DNA from the Pacific oyster. Crassostrea gigas. Gene 
168: 205-209. 

Cross, I., L. Vega, and I.. Rebordinos. 2(103. Nucleolar organizing 
regions in Crassostrea angidata: chromosomal location and polymor- 
phism. Geneiicii 119: 65-74. 

Doyle, J. J., and J. L. Doyle. 1987. A rapid DNA isolation procedure for 
small quantities of fresh leaf tissue. Phytochem. Bull. 19: 11-15. 

Gaffnev. P. M., and S. K. Allen, Jr. 1993. Hybridization among Cras- 
sostrea species: a review. Aquaciilture 116: 1-13. 

Guo, X., and S. K. Allen, Jr. 1997. Fluorescence in situ hybridization of 
the vertebrate telomere sequence to chromosome ends ot the Pacific 
oyster, Crassostrea gigas Thunberg. J. Shellfish Rex. 16: 87-89. 

Insua, A., and C. Thiriot-Quievreux. 1991. The characterization of 
Ostrea denselamellosa (Mollusca, Bivalvia) chromosomes: karyotype. 
constitutive heterochromatin and nucleolus organizer regions. Aqua- 
culture 97: 317-325. 

Insua, A., and C. Thiriot-Quievreux. 1993. Karyotype and nucleolus 
organizer regions in Ostrea /nielehana (Bivalvia: Ostreidae). Veligei- 
36: 215-219. 

Jiang, J., B. S. Gill, G. L. Wang, P. C. Ronald, and D. C. Ward. 1995. 
Metaphase and mterphase fluorescence in situ hybridization mapping 
of the rice genome with bacterial artificial chromosomes. Proc. Null. 
Acacl. Sci. USA 92: 4487-4491. 

King, M. 1993. Species Evolution: The Role of Chromosome Change. 
Cambridge University Press. Cambridge. 



Ladron De Guevara, B., F. Winkler, and C. Palma. 1994. Karyotype 

description and the position of the nucleolar organizer region (NOR) in 

the Chilean oyster Tiostrea chilensis (Philippi) Chanley and Dinamam. 

Pp. 390-405 in Genetics ami Evolution of Aquatic Organisms. A. R. 

Beaumont, ed. Chapman and Hall, London. 
I.adron De Guevara, B., F. Winkler, F. Rodriguez-Romero, and C. 

Palma-Rojas. 1996. Comparative karyology of four American oyster 

species. Veliger 39: 260-266. 
Lapegue, S., I. Boutet, A. Leitao, S. Heurtebise, P. Garcia, C. Thiriol- 

Quievreux, and P. Boudry. 2002. Trans- Atlantic distribution of a 

mangrove oyster species revealed by I6S mtDNA and karyological 

analysis. Biol. Bull. 202: 232-242. 
Leitao, A., C. Thiriot-Quievreux, P. Boudry, and I. Malheiro. 1999a. 

A 'G' chromosome banding study of three eupped oyster species: 

Crassostrea gigas. Crassostrea angulata and Crassostrea virginica 

(Mollusca: Bivalvia). Genet. Sel. Evol. 31: 519-527. 
Leitao. A., P. Boudry, J. Labat, and C. Thiriot-Quievreux. 1999b. 

Comparative karyological study of cupped oyster species. Malacologia 

41: 175-186. 
Levan, A., D. Fredga, and A. A. Sandherg. 1964. Nomenclature for 

centromeric position on chromosomes. Hereditas 52: 201-220. 
Li, X., and J. N. Havenhand. 1997. Karyotype, nucleolus organiser 

regions and constitutive heterochromatin in Ostrea angasi (Mollusca: 

Bivalvia): evidence of taxonomic relationships within the Ostreidae. 

Mar. Biol. 127: 443-44S. 
Li, X., and Z. Qi. 1994. Studies on the comparative anatomy, systematic 

classification and evolution of Chinese oysters. Studia Marina Sinica 

35: 143-178. (In Chinese). 
Littlewood, D. T. J. 1994. Molecular phylogenetics of cupped oysters 

based on partial 28S rRNA gene sequences. Mol. Phylogenet. Evol. 3: 

221-229. 
Menzel, R. W. 1974. Portuguese and Japanese oysters are the same 

species. J. Fish. Res. Board Can. 31: 453 156. 
Menzel, W. 1987. Hybridization of oysters and clams. Pp. 47-59 in 

Hvbridi-ation and Genetic Engineering in Aquacullure, K. Tiews. ed. 

Heenemann. Berlin. 
Nakamura. H. K. 1985. A review of molluscan cytogenetic information 

based on the CISMOCH-computerized index system for molluscan 

chromosomes. Bivalvia. Polvplacophora and Cephalopoda. Venus Jpn. 

J. Malacol. 44: 193-226. 
Nath, J., and K. L. Johnson. 1999. A review of fluorescence in situ 

hybridization (FISH): current status and future prospects, Biotech. 

Histochem. 75: 54-78. 
Noor, M. A. F., K. L. Grams, L. A. Bertucci, and J. Reiland. 2001. 

Chromosomal inversions and the reproductive isolation of species. 

Proc. Natl. Acad. Sci. USA 98: 12.084-12.088. 
6 Foighil, D., and D. J. Taylor. 2000. Evolution of parental care and 

ovulation behavior in oysters. Mol. P/iv/ogenet. Evol. 15: 301-313. 
6 Foighil, D., P. M. Gaffnev, and T. J. Hilbish. 1995. Differences in 

mitochondria! 16S ribosomal gene sequences allow discrimination 

among American (Crassostreu virginica} and Asian (C. gigas. C. 

ariakensis-} oyster species. J. Ex/>. Mar. Biol. Ecol. 192: 21 1-220. 
6 Foighil, D., P. M. Gaffnev, A. E. Wilbur, and T. J. Hilbish. 1998. 

Mitochondrial cytochrome oxidase I gene sequences support an Asian 

origin for the Portuguese oyster Crassostreu angulata. Mar. Biol. 131: 

497-503. 
RabhiUs, P., H. Impey, A. Heppell-Parlon, C. Langford, C. Tease, N. 

Lowe, D. Bailey, M. Ferguson-Smith, and N. Carter. 1995. Chro- 
mosome specific painls from a high resolution flow karyotype of the 
mouse. Nat. Genet. 9: 369-375. 
Rieseberg, L. H. 2001. Chromosomal rearrangements and specialmn 

Trends Ecol. Evol. 16: 351-358. 
Rodriguez-Romero. F., A. Laguarda-Figueras, M. Uribe-Alcocer, and 



54 



Y. WANG ET AL. 



M. L. Rojas-Lara. 1979. Distribution ot "G" hands in the karyotype 
of Crassusireti virginica. Venus Jpn. J. Malacol. 38: 180-184. 

Schrinil, L. M., H. M. Padilla-Nash. A. Coleman, P. Moen, W. G. Nash, 
J. Mtnninger, G. Jones, T. Ried, and M. Dean. 1999. Tyramide 
signal amplification (TSA)-FISH applied to mapping PCR labeled 
probes less than 1 kb in size. Biotechniques 27: 608-613. 

Shi, G., H. J. Weh, and D. K. Hossfeld. 1997. Reinterprelation of 
G-banded complex karyotypes by fluorescence in situ hybridization 
with chromosome-specific DNA painting probes and alpha-satellite 
centromere-specific DNA probes in malignant hematological disorders. 
Am. J. Hcinutol. 55: 69-76. 

Swiger. R. R., and ,|. D. Tucker. 1996. Fluorescence in situ hybridiza- 
tion: a brief review. Environ. Mai. Miilagen. 27: 245-254. 

Thiriot-Quievreux, C., and A. Insua. 1992. Nucleolar organizer region 
\ at lation in the chromosomes of three oyster species. J. Exp. Mar. Bid. 
Ecol. 157: 33-40. 

Wang, D., and H. Liu. 1959. Preliminary studies on artificial hybrid- 
ization of oysters. ACTA Zool. Sinica 11: 2X3-295. (In Chinese with 
French abstract). 

Wang, R., Z. Wang, and J. Zhang. 1993. Marine Mollitscan Culture, 
Qingdao Ocean University Press. Qingdao, China. (In Chinese). 

Wang, Y. 2001. Molecular Biological Characterization of Oyster Chro- 
mosomes. Ph.D. dissertation. Institute of Oceanology. Chinese Acad- 
emy of Sciences. Qingdao. China. (In Chinese). 

Wang, Y., and X. Guo. 2001. Chromosomal mapping of the vertebrate 



telomeric sequence (TTAGGG)n in four bivalve molluscs by fluores- 
cence in situ hyhndi/ation. J. Shellfish Res. 20: 1 187-1 190. 

Wang, Y., Z. Xu, and X. Guo. 2001. A centromeric satellite sequence in 
the Pacific oyster (Crassostrea gigas Thunberg) identified by fluores- 
cence in situ hybridization. Mar. Biotechnal. 3: 486-492. 

White, M. J. D. 1978. Modes of Speciation. W. H. Freeman. San 
Francisco. 

Xu, F. 1997. Bivalve Mol/uscu of China. Science Press. Beijing. China. 
(In Chinese). 

Xu, Z., X. Guo, P. M. Gaffney, and J. C. Pierce. 2001. Chromosomal 
location of the major ribosomal RNA genes in Crassostrea virginica 
and Crassostrea gigas. Veliger 44: 79-83. 

Yang, R., Z. Yu, Z. Chen, X. Kong, and J. Dai. 2000. Allozyme 
variation within Crassostrea plicatula and Crassostrea gigas from 
Shandong coastal waters. J. Fish. China 24: 130-133. (In Chinese with 
English abstract). 

Yu, Z., X. Kong, L. Zhang, X. Guo, and J. Xiang. 2003. Taxonomic 
status of four Crassostrea oysters from China as inferred from mito- 
chondria! DNA sequences. J. Shellfish Res. 22: 31-38. 

Zhang, Q. Y., G. Yu, R. K. Cooper, and T. R. Tiersch. 1999. Chro- 
mosomal location by fluorescence in situ hybridization of the 28S 
ribosomal RNA gene of the eastern oyster. J. Shellfish Res. 18: 431- 
435. 

Zhou, M., Y. Gao, and R. Wu. 1982. Preliminary studies on hybridiza- 
tion of Crassostrea gigas with Ostrea rivularis and O.strea plicatula. J. 
Fish. China 6: 235-241. (In Chinese with English abstract). 



Reference: Bint. Bull 206: 55-60. (February 2004) 
2004 Marine Biological Laboratory 



Occurrence in the Field of a Long-Term, Year-Round, 
Stable Population of Placozoans 



YOSHIHIKO K. MARUYAMA 

Section of Marine Biological Science. Education anil Research Center for Biological Resources. 
Facultv of Life and Environmental Science. Shiniane Unirersitv, 194 Kama. Sai^o. Oki. 

Sliimane 685-0024, Japan 



Abstract. Long-term field studies on placozoans 
(Trichoplax adliaerens), including both substrate sampling 
and slide sampling, were earned out at a subtidal site near 
Shirahama, Japan. Samples of natural substrate materials 
from the field, such as stones, shells, or fragments of coral, 
were particularly useful for obtaining placozoans. Results 
from the substrate sampling indicate that placozoans are 
present year-round at the study site. Large intermittent 
peaks in the number of animals collected at the study site 
occurred roughly once a year, between late summer and the 
beginning of winter. Placozoans were present every year 
from 1989 through 2000. A seawater aquarium was also 
studied and provided a considerable number of placozoans 
for more than 1 year. 

Introduction 

The placozoan Trichoplax udluierens F. E. Schulze is a 
ciliated microscopic marine animal with a platelike mor- 
phology (Schulze, 1883; Grell, 1971, 1982; Miller, 1 97 la. 
b; Pearse et al.. 1987; Margulis and Schwartz, 1988; Grell 
and Ruthmann, 1991; Conn, 2000; Brusca and Brusca, 
2003). The thin body consists only of an epithelium and an 
internal mesenchyme. The epithelium has two regions: an 
upper free, or dorsal, epithelium of cover cells and a lower 
attached, or ventral, epithelium of cylinder and gland cells 
(Grell and Benwitz, 1971; Pearse et al.. 1987; Grell and 
Ruthmann, 1991 ). Some differences between the central and 
marginal areas in the body have also been reported 
(Schwartz, 1984; Schuchert, 1993; Pearse et al.. 1994). 
When the densely ciliated ventral epithelium is in contact 



Received 19 April 2000; accepted 17 November 2003. 
E-mail: maruyama@life.shimane-u.ac.jp 



with the substrate, the animals display a gliding (or creep- 
ing) locomotion (Grell and Ruthmann, 1991). When the 
animal is fed, its shape changes periodically (Ueda et al.. 
1999). For example, in addition to the gliding amoeboid 
platelike form, other forms (swarmers) (Thiemann and 
Ruthmann. 1991) have been described. Further, a swim- 
ming form has been reported (cited in Margulis and 
Schwartz, 1988; also see Levin and Bridges, 1995). 
Trichoplax adliaerens is considered to be the sole species in 
the phylum Placozoa (Grell. 1982; Grell and Ruthmann. 
1991; Brusca and Brusca, 2003). 

Placozoans have been found in seawater aquaria 
(Schulze, 1883; Miller. 1971a. b; Pearse et al.. 1987; Mar- 
gulis and Schwartz, 1988; Grell and Ruthmann, 1991). as 
well as in various warm coastal areas (Grell and Benwitz, 
1971; Sudzuki, 1977; Grell and Lopez-Ochoterena, 1987; 
Pearse, 1989; Uehara et al., 1989; Pearse et al., 1994; V. B. 
Pearse, pers. comm.). Nevertheless, the biology of this 
microscopic animal under natural conditions is little known 
(Grell and Ruthmann, 1991 i. 

In this study, which is based on long-term sampling of 
both glass slides and natural substrates, the occurrence of 
placozoans was examined at a subtidal site as well as in a 
seawater aquarium at the Seto Marine Biological Labora- 
tory in Shirahama, Japan. Results of this study indicate that, 
in addition to their abundance in the seawater aquarium, 
placozoans are present at the study site year-round. 

Materials and Methods 

Sampling in the field 

The study site was located at the east side of Tanjiriku- 
zurenohana on the southern coast of Tanabe Bav. near the 



56 



Y. K. MARUYAMA 



Seto Marine Biological Laboratory of Kyoto University at 
Shirahama (Wakayama Prefecture, Japan). It was situated in 
the upper portion of the subtidal zone, about 1 m below the 
datum line in the tide table for Shirahama (tide tables issued 
by the Japan Meteorological Agency. Tokyo). Water tem- 
peratures were recorded (Fig. 1 ). 

Slide sampling. Following Pearse (1989). specimens of 
placozoans were collected on glass slides (76 mm X 26 
mm). Typically, seven clean slides were placed in a stain- 
less steel slide rack (72 mm X 66 mm X 31 mm; ordinarily 
used in histology), and four sets of racks thus prepared were 
placed on the substrate at the study site. Later (19 to 68 
days; 35 days on average), each of the racks was put 
separately into a plastic container filled with ambient sea- 
water collected at the site and returned to the laboratory for 
observation. Sometimes, individual clean slides, not in 
racks, were placed at the site, and individual slides were 
also examined if the racks holding them disappeared unac- 
countably. On the day of retrieval, or the day after, new sets 
of slides were placed for the next observation. 

Substrate sampling. Placozoans were also collected from 
samples of natural substrate materials ranging in size from 
pebble to cobble (according to the particle grade scale of 
Wentworth; e.g.. Lincoln et til.. 1998); for example, those of 
4-8 cm in length are within this range. Stones, shells of 
molluscs (dead or alive), fragments of skeleton of hard 
corals (dead or alive), or mixtures thereof, were collected by 
hand at the study site and placed separately into containers 
of ambient seawater. These samples were brought to the 
laboratory for observation. The sampling was carried out at 
intervals of 12-68 days. 35 days on average. 

Laboratory observations of placozoans from the field. In 
the slide sampling, each slide was quickly transferred into a 
plastic dish (90 mm in diameter) containing seawater from 



30 -i 



20 



10 




M A M J 
90 



JASON 



D J F 
91 



M A M J J A S 



Kiyure 1. A profile ol changes ..Her temperature at the studs sue 
and in the seawaler aquarium Absciss;, nonths from March 1WO through 
September 1991. Ordinate. teni|vi.itui. i '.) lor the study site (squares. ) 
and tor the seawater aquannm leiuli 



the field. Both surfaces of each slide were examined under 
a dissecting microscope. In the substrate sampling, each 
sample container was typically treated as follows. It was 
shaken for several seconds, and the resultant suspension was 
decanted into plastic dishes (90 mm in diameter). A few- 
hours later, these dishes were observed under a dissecting 
microscope for placozoans, and within a few days (mostly, 
the day after), they were observed again. Placozoans could 
be seen; they were attached to and gliding along the bottom 
of the plastic dishes. 

When placozoans were found in these samples or on 
slides from the field (Fig. 2), they were transferred, with a 
mouth-controlled micropipette. to an observation chamber 
and further observed with a light microscope equipped with 
Nomarski optics. The thin platelike body form attached to 
the substrate on its ventral surface, its gliding ciliary move- 
ment, and the presence of shining spheres in the dorsal 
epithelium served to identify these animals as placozoans 
(Grell and Benwitz. 1971; Miller. 197 la; Grell and Ruth- 
mann. 1991). Furthermore, the occurrence of birefringent 
granules in the subperipheral region (Miller. 197 la; Pearse 
et ai. 1994) usually served for identification. 

Measurement of size in placozoans 

Because the shape of placozoans continuously changes, 
determinations of size are only valid at the moment of 
measurement. Furthermore, only placozoans that were at- 
tached to either a glass or plastic substrate were measured. 
Under those circumstances, the lengths along the longest 
and shortest axes were measured with an ocular scale under 
a dissecting microscope, and the average of the two values 
was taken as the size of the individual. 

Source of placozoans collected from stones 

Samples of stones were collected at the study site and 
another subtidal site in Tanabe Bay (see a later section) and 
transported to the laboratory. Each sample consisted of a 
stone (4-8 cm in length) and an aliquot (typically, 30-70 
ml ) of the ambient seawater in a container. The stone in the 
container was transferred by hand into an aliquot (typically, 
30-40 ml) of artificial seawater (ASW; Jamarin U. Jamarin 
Laboratory, Osaka) in a separate container; the ambient 
seawater (SW) was retained. Both containers one with the 
ASW and the stone, and the other with the retained SW 
were shaken similarly, and the fluids were then examined 
individually for placozoans, as described above; meanwhile 
the stone was discarded. The relative difference in the 
proportion of placozoans in the ASW and in the SW was 
calculated according to the expression [(A - B)/( A + B)] 
X 100, where .4 is the number of placozoans in the ASW, 
and H is the number in the SW. The differences were 



FIELD STUDIES ON PLACOZOANS 



57 





Figure 2. A placozoan on a slide from the study site. Bar, 100 j 



statistically tested with a Student's t test, after arcsine trans- 
formation (Sokal and Rohlf, 1995) (Table 1). 

Sampling at a seawater aquarium 

Placozoans were also collected from the Kyoto Univer- 
sity Aquarium at the Seto Marine Biological Laboratory. In 
a seawater aquarium in this facility, a square plastic basket 
was suspended; many hard corals were reared in the basket, 
and running seawater was continuously supplied from 
above. Water temperatures were recorded (Fig. 1 ). 

Individual clean glass slides (76 mm X 26 mm), not in 
racks, were used here for sampling placozoans (slide sam- 
pling). About 10 slides were placed on the bottom of the 
basket with the corals. Later (19 to 44 days, 31 days on 
average), the slides were transferred to a container rilled 
with seawater taken from the seawater supply system and 
were returned to the laboratory for observation under a 
dissecting microscope, as described above. When slides 
were removed, a new set of clean slides was placed for the 
next observation. 

Results 

Slide sampling at the subtidal study site 

Slide samplings at the study site were carried out at 
intervals of 1 month on average for about 3 years, from 
November 1989 through December 1992. The samples 
yielded a total of 230 placozoans, which appeared in 13 of 
33 (39%) samplings on 63 of 818 (7.7%) retrieved slides. 

The number of placozoans changed with time, with large 
intermittent peaks in November 1990, September 1991. and 



August 1992 (arrows in Fig. 3). The percentage of slides 
with placozoans (placozoan-positive slides, or positive 
slides) was also higher in these months (Fig. 3). In addition, 
the number of racks containing slides with placozoans was 
also high in these months: 4 out of 4 in November 1990. 4 
out of 4 in September 1991, and 3 out of 4 in August 1992. 
The placozoans ranged in size from about 100 jam to 
1200 /urn (394 179 /u,m, the mean SD of 227 individ- 
uals). All exhibited the platelike morphology (Fig. 2); but 
two placozoans obtained in November 1990 had a transpar- 
ent balloonlike protrusion on the dorsal side, and two pla- 
cozoans collected in September 1991 had a small protru- 
sion. 

Substrate sampling at the study site 

Placozoans were found on all kinds of the substrate 
materials tested (stones, molluscan shells, corals), suggest- 
ing no specificity of placozoans for these particular sub- 
strates. 

When samples of these materials were examined after 
collection at intervals of about 1 month (12-68 days, 35 
days on average), for 2'/z years, from July 1990 through 
December 1992, placozoans were found on all but two 
occasions (92%, 24 out of 26) (Fig. 4). Thus, placozoans 
were present virtually throughout the year at the study site. 

A total of 199 placozoans were obtained from 39 out of 
the 114 (34%) samples. A large number of placozoans were 
obtained in November 1990 and August 1992 (Fig. 4). The 
percentage of positive samples varied with time, with peaks 



Table 1 

Source of placozoans collected from field samples of stones and ambient 
seawater 



Numbers of placozoans j 



Experiments 



ASW + stone 



SW 



Difference 1 ^ 



1 


6 





100 


-) 


5 


2 


43 


3 


2 


(1 


100 


4 


1 





100 


5 


1 


I) 


100 



J The stone from each sample was transferred to artificial seawater 
(ASW), the stone and ASW were shaken, and the ASW was then examined 
for placozoans, as was the retained ambient seawater (SW) (see protocol in 
Materials and Methods). Only results from placozoan-positive samples are 
shown. 

h % Difference, the relative value of the difference in number was 
calculated according to the equation [(A - B)/(A + B}] x 100. where 
A and B represent the number of placozoans from ASW ( + stone) and SW. 
respectively. 

L The % difference is significantly greater than OVc (P < 0.05); / test 
(see Materials and Methods). 



58 



Y. K. MARUYAMA 



r 100 



135 - 



a 



M 
V 



40 - 




20 - 



- 20 



NDJFMAMJJASONDJFMAMJJASONDJFMAMJJASOND 

89 90 91 92 



t 



Figure 3. Slide sampling at the study site. Abscissa, months from November 1989 through December 1992. 
Ordmate (left), number of placozoans obtained from slides at each sampling (squares, ); ordinate (right), 
percentage of placozoan-positive slides (circles. O). Slides ( 10-34, 2? on average) that had been placed at the 
study site for about 1 month (19-68 days, 35 days on average) were used for the observations. Filled arrows 
indicate the timing of large intermittent peaks (November 1990, September 1991, and August 1992). The peak 
in November 1989 was also probably in this class (open arrow). 



I 

M 



W 

9 



H 
I/I 


(X 



appearing in October 1990 to January 1991. September 
1991, and August 1992 (see Fig. 4). 

The placozoans obtained from substrate materials were, 
however, small. The animals collected from some samples 
ranged from 100 /xm to 400 /urn ( 1 32 77 /am. mean SD 
of 52 individuals), and were frequently damaged at the 
periphery. Thus many of these placozoans had probably 
been fragmented during the sampling procedure. All, how- 
ever, exhibited a platelike morphology. 

Field sampling from 1993 throii^li 2/1/1(1 

More recently. (August 1993-November 2000), sam- 
plings lor placo/.oans, on either slides or natural substrates. 
were continued at the study site at a frequency of 1-3 times 
per year. Placozoans were present in every year. Moreover, 
placozoans were also present at other sites in this area of 
Shirahama, including a suhtidal site and a tidal pool in 
Tanabe Bay as well as in Kanayama Bay. 



with the substrate or with the ambient seawater. Field sam- 
ples of stones in containers of ambient seawater were used 
for this purpose (n = 19). The stone from each sample was 
individually transferred to artificial seawater (ASW + 
stone), the combination was shaken, and the ASW and the 
retained ambient seawater (SW) were examined for placo- 
zoans. Only two placozoans (mean size 94 /urn) were found 
in the SW from 1 out of 19 samples, but 15 placozoans 
(85 28 jam) were collected in the ASW from 5 out of 19 
samples. 

As shown in Table 1. in all these positive samples, 
placozoans were obtained from the ASW, and the placozo- 
ans were not equally distributed in the ASW and the SW ( 15 
in the ASW and 2 in the SW; P < 0.05 ): and the proportion 
of placozoans in the ASW was enriched compared with that 
in the SW (Table 1). An association of some placozoans 
with the substrate (or other substrate material on it) rather 
than with the ambient seawater was suggested. 



of the />ltieo.o,ui\ < I'llcetedjroni Jielil v/;/>/o o/ Siimplin^ in the xeiiwuter 



stones 



Experiments were carried OIH to determine whether the 
placozoans obtained by substrate sampling were associated 



In earlier years, from November 1989 through August 
1991. a seawater aquarium was also examined for placozo- 
ans. The slide sampling, carried out at intervals of 1 month 



FIELD STUDIES ON PLACOZOANS 



59 



80 -, 



60 - 



40 - 



20 - 




JASONDJFMAMJJASONDJFMAMJJASOND 

90 91 .92 



Figure 4. Substrate sampling at the study site. Abscissa, months from July 1990 through December 1992. 
Ordinate (left), number of placozoans obtained from samples of substrates at each sampling (squares, ); 
ordinate (right), percentage of placozoan-positive samples (circles, O). Samples of natural substrates were 
collected at intervals of about 1 month ( 12-68 days, 35 days on average). The number of samples was variable 
(1-13, 4 on average); 1-2 from July 1990 through January 1991, 3-7 from February 1991 through December 
1991, 7-13 from January 1992 through July 1992, and 3-6 from August 1992 through December 1992. Arrows 
indicate peaks (October 1990 to January 1991. September 1991, and August 1992). The timing of the peaks is 
matched with that of the large intermittent peaks in Fig. 3. 



on average for 1 '/> years, yielded a total of 1 144 placozoans 
from the seawater aquarium (Fig. 5). The animals were 
obtained on most occasions (19 out of 22. or 86%) and 
inhabited 98 of 218 (45%) retrieved slides. 

Both the number of placozoans at each sampling and the 
percentage of slides with placozoans (positive slides) varied 



with time (Fig. 5). Many placozoans were obtained in 
January, March, and April 1990, and August 1991. The 
percentage of positive slides was also high in these months. 
All of the placozoans exhibited a platelike morphology. 
In one sampling, they ranged in size from about 100 jum to 
300 jLtm (257 59 jam, the mean SD of 8 individuals). 




L J.UU 

i 


i 


I 


i 


I 


o 


- 80 


i 




i 




W 


- 60 


8 




H 




in 


- 40 




f 


<a 


/ 


rl 


- 20 


-P 
H 




H 







-- 


ft 



NDJFMAMJJASONDJFMAMJJA 

89 90 91 

Figure 5. Slide sampling in the seawater aquarium. Abscissa, months from November 19S9 through August 
1991. Ordinate (left), number of placozoans obtained from slides at each sampling (squares. ); ordinate (right), 
percentage of placozoan-positive slides (circles, O). Slides (3-15, 10 on average) that had been placed in the 
seawater aquarium for about 1 month (19-44 days, 31 days on average) were observed. Note that the scale of 
the left ordinate is much larger than those in Figs. 3 and 4. 



60 



Y. K. MARUYAMA 



Discussion 

This study, carried out from November 1989 to Novem- 
ber 2000. at a study site in the subtidal waters in Shirahama, 
showed that placozoans were present year-round and in 
every year. Moreover, placozoans were also observed in 
July 1989 at and near To Island in Tanabe Bay (V. B. 
Pearse. pers. comm.). Further, a seawater aquarium used to 
hold transient stocks of local marine animals also yielded, 
over 1 year, a large number of placozoans. Thus, these 
animals have been observed for more than 1 1 years in the 
Shirahama area, and therefore, the population of placozoans 
can be considered to be stable. 

Unexpectedly, the number of placozoans collected at the 
subtidal study site showed large, intermittent peaks that 
occurred roughly once a year, between late summer and the 
beginning of winter. Although the habitat of the seawater 
aquarium was quite different from that in the field, a peak 
also appeared in the aquarium samples. But this peak was 
shifted from that observed in the field samples. The signif- 
icance of these fluctuations is unresolved. 

Substrate sampling in this study was more direct and 
more productive for obtaining placozoans in the field than 
the slide sampling. But the number of organisms collected 
from substrate material is not certain, because some placo- 
zoans are apparently detached from this material during 
transport, before the sampling procedure in the laboratory 
(see Table 1 ). Another disadvantage of substrate sampling is 
that the fragile body may occasionally be damaged by 
excess shaking. Slide sampling seems to avoid this problem, 
providing placozoans without damage. The growth and re- 
productive patterns of placozoans on such slides with var- 
ious other (mixed) organisms have been reported (Pearse, 
1989). Slide sampling in this study also provided slides that 
could be used for rearing placozoans (data not shown). 
Therefore, a combination of both substrate and slide sam- 
pling seems to be the most effective way to study these 
microscopic animals from a local site. 

Acknowledgments 

This study was carried out at the Seto Marine Biological 
Laboratory during my stay there, and I thank the staff of the 
laboratory. I would like to express thanks to Dr. E. Harada 
for suggestions and encouragement during the study. I also 
thank Dr. V. H. IV.irse for valuable comments anil critical 
reading of the manuscript, and for kindly allowing me to 
reler to her data on placozoan sampling as a personal 
communication. 

I, id >iire C'ik'd 

Brusca. R. ('.. and G. .1. Brnsi .1 : un. Invertehrales. 2nd ed. Smaller 
Associates, Sunderland, M\ '.'< p| 



Conn, I). B. 2000. Atlas of Invertebrate Reproduction and Development. 
2nd ed. Wiley-Liss. New York. 300 pp. 

Grell, K. G. 1971. Trichoplay tulliaereiis F. E. Schulze und die Entste- 
hung der Metazoen. Mmu'.vs. Runasch. 24: 160-161. 

Grell, K. G. 1982. Plucozou. Page 639 in Synopsis and Classification of 
Living Organism*. Vol. 1. S. P. Parker, ed. McGraw-Hill. New York. 

Grell, K. G., and G. Benwitz. 1971. Die Ultrastruktur von Triclwplax 
adhaerens F. E. Schulze. Cvtohio/ogie 4: 216-240. 

Grell, K. G., and E. Lopez-Ochoterena. 1987. A new record of 
Trichoplax adhaerens F. E. Schulze (Phylum Placozoa) in the Mexican 
Caribbean sea. Annies del Instituto ile Ciencias del Mar \ Lnnnologia. 
Universidad National Autonoma tie Mexno 14(2): 255-256. 

Grell, K. G.. and A. Ruthmann. 1991. Placuzoa. Pp. 13-27 in Micro- 
scopic Anatomy of Invertebrates, Vol. 2. Placo-ou, Porifera, Cnidana. 
and Ctenopliora. F. W. Harrison and J. A. Westfall. eds. Wiley-Liss, 
New York. 

Levin, L. A., and T. S. Bridges. 1995. Pattern and diversity in repro- 
duction and development. Pp. 1-48 in Ecolog\ of Marine Invertebrate 
Larvae. L. McEdward. ed. CRC Press, Boca Raton. FL. 

Lincoln, R.. G. Boxshall. and P. Clark. 1998. Appendix 14: Sediment 
particle size categories. Page 340 in A Dictionary tij > Ecology. Evolution 
mill Systematics. 2nd ed. Cambridge University Press. Cambridge. 

Margulis, L., and K. V. Schwartz. 1988. Five Kingdoms: An Illustrated 
Guide to the Phyla of Life on Earth, 2nd ed. W. H. Freeman. New 
York. 376 pp. 

Miller, R. L. I971a. Observations on Trichoplax adhaerens Schulze. 
1883. Am. Zool. 11: 698-699. 

Miller, R. L. 1971b. Tricliopla.\ adhaerens Schulze. 1883: return of an 
enigma. Biol. Bull. 141: 374. 

Pearse. V. B. 1989. Growth and behas ior ot I H, hoplax adhaerens: first 
record of the phylum Placozoa in Hawaii. Pac. Set. 43: 117-121. 

Pearse, V., J. Pearse, M. Buchsbaum. and R. Buchsbaum. 1987. Liv- 
ing Invertebrates. Blackwell Scientific Publications and The Boxwood 
Press. Pacific Grove. CA. 848 pp. 

Pearse, V. B., T. Uehara. and R. I.. Miller. 1994. Birefringent granules 
in placozoans (Trichoplax adhaerens). Trans. Am. Micro.sc. Sue. 113: 
385-389. 

Schuchert, P. 1993. Trichoplax adhaerens (Phylum Placozoa I has cells 
that react with antibodies against the neuropeptidc RFamide. Ada Zoo/. 
74: 115-117. 

Schulze. F. E. 1883. Trichoplax adhaerens, no\ . gen.. no\ . spec. Zool. 
An-. 6: 92-97. 

Schwartz, V. 1984. The radial polar pattern ot differentiation in Tricho- 
plax adhaerens F. E. Schulze I Placozoa). Z. Naturforsch. Sect. ('39: 
818-832. 

Sokal, R. R., and K. J. Rohlf. 1995. Hiomelrv I'/ic Prim ;/>/o and 
Practice of Statistics in Biological Research. 3d ed. W. H. Freeman. 
New York. 887 pp. 

Sudzuki, M. 1977. Microscopical marine animals scarcely known from 
Jap. in, II. Occurrence of Trichoplax I Placozoa) in Shmioda. I' roe. Jpn. 
Sue. Svst. Zool. 13: 1-4, 

Thiemann. M.. and \. Riithiiiaiin. 1991. \liernali\e modes ot .iscxu.il 
reproduction in Trichopla\ ailhaerens (Placozoal. Zoomorpholog\ 
11(1: 1 65- 174. 

Ueda. T.. S. Kova, and \. K. Marinama. 1999. Dynamic patterns in 
the locomotion and feeding beha\ lors In the placozoan Trichoplax 
adhaerens Itiossstcms 54: 65-70. 

I'ehara, T.. V. B. Pearse, and K. Yamazato. 1989. Bncfrmgent parti- 
cles observed in Trichopla* adhaerens ( Placozoa i. the simplest meta- 
zoan. /ool. Sei. 6: 1209. 



ARINE IXESOURCES CENTER 



MARINE BIOLOGICAL LABORATORY WOODS HOLE. MA 02543 
WWW.MBL.EDU/SERVICES/MRC/1NDEX.HTML 



(508)289-7700 







Animal and Tissue Supply for 
Education & Research 

150 aQuatic species available for shipment via 
online catalog: <http://www.mbl.edu/animals/ 
index.html>; phone: (508)289-7375; or 
e-mail: specimens@mbl.edu 

zebrafish colony containing limited mutant strains 

custom dissection and furnishing of specific organ 
and tissue samples 



zebrafish facilities 



MRC Services Available 

basic water Quality analysis 

veterinary services (clinical, histopathologic, 
microbial services, health certificates, etc.) 

aojjatic systems design (mechanical, biological, 
engineering, etc.) 

educational tours and collecting trips aboard 
the R/V Gemma 



Using the MRC for Your Research 

capability for advanced animal husbandry (temperature, light control, etc. 

availability of year-round, developmental life stages 

adaptability of tank system design for live marine animal experimentation 






MBL 

Marine Biological Laboratory Woods Hole MA 

2004 Computational 
Neuroscience Courses 



Contact: Carol Hamel 
Admissions Coordinator 

(508) 289-7401 
admissions@mbl edu 

Applications are encouraged from 

women and members of 
underrepresented minorities. 

The MBL is an Equal Opportunity/ 
Affirmative Action Employer. 



Generous financial 
assistance is available! 



www.mbl.edu/education 



Methods in Computational Neuroscience 

August 1 - August 29, 2004 

Animals interact with a complex world, encountering a variety of 
challenges This course introduces students to the computational 
and mathematical techniques that are used to address how the 
brain solves these problems at levels of neural organization 
ranging from single membrane channels to operations of the entire 
brain Application Deadline March 5, 2004 

Neuroinformatics August 14 - 29, 2004 

The ability to digitally acquire, store and analyze large volumes of 
multichannel data in the neurosciences, ranging from multiple 
spike trains to brain images, has given rise to a new and growing 
body of research This two-week course is structured around the 
related issues, and will contain both pedagogical lectures on basic 
statistical techniques as well as focussed mini-workshops on 
specific neuroscience topics where applications of these 
techniques are critical Application Deadline March 16, 2004. 




MBL 



Marine Biological Laboratory Woods Hole MA 



2004 Microscopy Course 

Optical Microscopy & Imaging in the 
Biomedical Sciences 



October 5 - October 14, 2004 

This course will enable the participant to obtain and 

interpret microscope images of high quality to perform 

quantitative optical measurements and to produce video 

and digital records for documentation and analysis. 

Application Deadline: June 21, 2004 

Contact: Carol Hamel, Admissions Coordinator, 
(508)289-7401 , admissions@mbl.edu 

Women and minorities encouraged to apply. 
The MBL is an EEO/Affirmative Action Institution 

www.mbl.edu/education 



THE 

BIOLOGICAL 
BULLETIN 

2004 Subscription Rates 
Volumes 206-207 

*Paid Subscriptions include both print and electronic subscriptions at: www.biolbull.org 

Institutional* Individual* 



One year subscription (6 issues - 


2 volumes) 


$325.00 


$120.00 


Single volume (3 issues) 


$165.00 


$70.00 


Single Issues 


$ 75.00 


$25.00 



*Surface delivery included in above prices. 
For prompt delivery, we encourage subscribers outside the U.S. to request airmail service. 

Airmail Delivery Charge 

U.S. and Canada: $ 45.00 

Mexico: $ 60.00 

All other locations: $100.00 

Orders Must Be Prepaid in U.S. Dollars, Check Payable to The Marine Biological Laboratory 

About The Biological Bulletin 

ISSN: 0006-3185 

Frequency: Bimonthly 

Number of issues per year: 6 

Months of Publication: February, April, June, August, October, December 

Subscriptions entered for calendar year 

Volume indexes contained in June and December issues 

Annual report of the Marine Biological Laboratory contained in August issue 

Most back issues available 

Claims handled upon receipt 

No agency discounts 

Internet: 
www.biolbull.org 

Please address orders to: 

Wendy Child 

Subscriptions 

The Biological Bulletin 

Marine Biological Laboratory 

7 MBL Street 

Woods Hole, MA 02543- 101 5 U.S.A. 
Fax: 508-289-7922 Tel: 508-289-7402 Email: wchild@mbl.edu 

Published by the Marine Biological Laboratory 
Woods Hole, Massachusetts, 02543 U.S.A. 



THE BIOLOGICAL BULLETIN 

(www.biolbull.org) 

2004 SUBSCRIPTION FORM 

(VOLUMES 206-207, 6 ISSUES) 



(please print) 
NAME: 



INSTITUTION: 
ADDRESS: 



CITY: STATE:. 

POSTAL CODE: COUNTRY:. 

TELEPHONE: FAX:. 

E-MAIL ADDRESS 



All subscriptions run on the calendar year; price includes both print and online journals 

G Please send me a 2004 subscription to The Biological Bulletin at the rate indicated below: 

O Individual: $120.00 (6 ISSUES) O Institutional : $325.00 (6 ISSUES) 

O Individual: $70.00(3 ISSUES) O Institutional : $165.00 (3 ISSUES) 

Check one: G February April June or G August October December 

G Please send me the following back issue(s): 

O Individual: at $25.00 (PER ISSUE) O Institutional : at $75.00 (PER ISSUE) 

Delivery Options 

Surface Delivery (Surface delivery is included in the subscription price.) 

Air delivery (Please add the correct amount to your payment.) 



O U.S. and Canada: $46.00 O Mexico: $60.00 O All other locations: $100.00 
Payment Options 

Enclosed is my check or U.S. money order for $ payable to The Marine Biological Laboratory 

Please charge my O VISA, G MasterCard G Discover Card $ 

Please send me an invoice. (Note: Payment must be received before subscription commences.) 



Account No.: Exp. Date: 

Signature: Date: 



Return this form with your check or credit information to: 

Marine Biological Laboratory 

Subscription Office 4 The Biological Bulletin +7 MBL Street + Woods Hole, MA 02543-1015 




POSITION ANNOUNCEMENT 

Editor-in-Chief 
The Biological Bulletin 

Start Date: January 2005 
Term: Five years, renewable 



The Editor-in-Chief is responsible for the overall editorial direction of the Biological Bulletin. The Editor-in-Chief 
appoints Associate Editors and members of the Editorial Board, decides which manuscripts are published, mediates 
editorial disputes, and sets policy for the journal. 

The Editor-in-Chief is an independent contractor who reports to the Director and CEO of the Marine Biological 
Laboratory. Stipend for the position is $10,000 annually. The Bulletin 's editorial offices are based in Woods Hole, but 
the Editor-in-Chief may work from his/her home institution. The Editor-in-Chief is expected to spend some part of the 
summer months in Woods Hole. Housing for up to one month will be provided in Woods Hole. 



The successful candidate for this 

position will meet the following 

requirements: 



A broad understanding of biology, and a manifest interest in its 
diversity and comparative and integrative aspects 

A track-record of publishing in peer-reviewed journals 

Experience reviewing papers for scientific journals 

Proven skill as a substantive editor 

Ability to make tough decisions and willingness to work with other editors 
to reach a decision on difficult papers 

Demonstrated experience with the editorial process {e.g. , serving as an 
Editor or Associate Editor for a journal similar to the Biological Bulletin) 

The willingness and ability to commit the time required, approximately 
one day per week, to fulfill the duties outlined here for five years. 



Job description: 



Nomination packets must include 
the following: 

1. Letter of intent 

2. Current CV 

3. Vision Statement for the journal 

Send nominations to: 

Pamela Clapp Hinkle 

Managing Editor, Biological Bulletin 

Marine Biological Laboratory 

7 MBL Street 

Woods Hole, MA 02543 

pclapp@mbl.edu 



The Editor-in-Chief devotes a minimum of six hours per week to the 
operation of the Biological Bulletin. The Editor's ongoing activities include 

1) assigning submitted papers to the appropriate Associate Editor; 

2) reading reviews and manuscripts to ensure fairness and technical 
accuracy; 3) writing editorial decision letters based on the reviews; 

4) fielding telephone and e-mail queries on a daily basis from authors 
deciding whether to submit their work to the Biological Bulletin, authors 
who are unhappy about an editorial decision, and Associate Editors 
requesting guidance on such matters as the identity, availability, 

and number of reviewers, and editorial decisions and disputes; 

5) communicating regularly (by telephone or e-mail) with the Managing 
Editor and other editorial staff members to plan future issues, to arrange the 
table of contents, to develop the issue cover, and to discuss organizational 
issues; 6) editing accepted manuscripts as necessary for substance, 
accuracy, and clarity; 7) selecting cover photos and writing associated 
legends; 8) informing editorial staff of noteworthy articles for the media; 

9) as the deadline for each issue approaches, deciding which manuscripts 
will be published. 



Marine Biological Laboratory Woods Hole Massachusetts 






The Bar Has Been Raised 

Axioplan 2 Research Microscope. 








A digital microscope designed 
for the future, Zeiss Axioplan 2 
Imaging is a marvel of modern 
engineering. With new optics of 
high light transmission, precision 
of its innovative components 
and infinite flexibility, Axioplan 2 
is a reliable partner that meets 



the latest demanding requirements 
today and for the years to come. 
No wonder the Axioplan 2 Imaging 
has become the best selling 
research microscope in America! 

For information about Zeiss 
products please call 800-233-2343 
or visit us online: zeiss.com/micro. 



ZEISS 



We make it visible. 



Carl Zeiss Microlmaging, Inc. Thornwood, NY 10594 micro@zeiss.com 



April 2004 



THE 



Volume 206 Number 2 



BIOLOGICAL 
BULLETIN 








Published by the Marine Biological Laboratory 
Woods Hole, Massachusetts 




THE BIOLOGICAL BULLETIN 



ONLINE 



The Marine Biological Laboratory is pleased beginning with the October 1976 issue 

to announce that the full text of The Biological (Volume 151, Number 2), and some Tables of 

Bulletin is available online at Contents are online beginning with the 

October 1965 issue (Volume 129, Number 2). 



http://www.biolbull.org 

The Biological Bulletin publishes outstanding 
experimental research on the full range 
of biological topics and organisms, from the 
fields of Neurobiology, Behavior, Physiology, 
Ecology, Evolution, Development and 
Reproduction, Cell Biology, Biomechanics, 
Symbiosis, and Systematics. 

Published since 1897 by the Marine 
Biological Laboratory (MBL) in Woods Hole, 
Massachusetts, The Biological Bulletin is one 
of America's oldest peer-reviewed scientific 
journals. 

The journal is aimed at a general readership, 
and especially invites articles about those 
novel phenomena and contexts characteristic 
of intersecting fields. 

The Biological Bui/elm Online contains the 
full content of each issue of the journal, 
including all figures and tables, beginning 
with the February 2001 issue (Volume 200, 
Number 1). The full text is searchable by- 
keyword, and the cited references include 
hyperlinks to Medline. PDF files are available 
beginning in February 1990 (Volume 178, 
Number 1), some abstracts are available 



Each issue will be placed online 
approximately on the date it is mailed to 
subscribers; therefore the online site will be 
available prior to receipt of your paper copy. 
Online readers may want to sign up for the 
eTOC (electronic Table of Contents) service, 
which will deliver each new issue's, table of 
contents via e-mail. The web site also 
provides access to information about the 
journal (such as Instructions to Authors, the 
Editorial Board, and subscription 
information), as well as access to the Marine 
Biological Laboratory's web site and other 
Biological Bulletin electronic publications. 

The free trial period for access to The 
Biological Bulletin online has ended. 
Individuals and institutions who are 
subscribers to the journal in print or are 
members of the Marine Biological 
Laboratory Corporation may now activate 
their online subscriptions. All other access 
(e.g., to Abstracts, eTOCs, searching, 
Instructions to Authors) remains freely 
available. Online access is included in the 
print subscription price. 

For more information about subscribing or 
activating your online subscription, visit 
<www.biolbull.org/subscriptions>. 



http://www.biolbull.org 



CIENCE 



mmr 



EHICLE. 




MOTORIZED 

INVERTED 

MICROSCOPE. 



icroscope will position 

research lab at the very 
juard of multi-wavelength 
advanced fluorescence, DIG 
and deconvolution techniques. 

It is totally motorized from 
the built-in Z-Drive, 
6-position nosepiece, 
6-position condenser, 
6-position fluorescence filter 
turret, and transmitted and 



Nine access ports allow you 
to keep dedicated cameras 
and lasers in place and still 
have plenty of ports available 
for new devices. 

The 1X81 demonstrates 
Olympus' leadership in 
Total Internal Reflection 
Fluorescence Microscopy 
(TIRFM) with exceptional ease 
of operation and features 
such as the fully integrated 
TIRFM illuminator, a 1 .45 NA 
TIRFM objective and the 
exclusive 1 .65 NA objective. 

The Olympus 1X81 provides 
extraordinary system 
flexibility that will satisfy 
the most demanding 
research applications. 



OLYMPUS 



ROCKET SCIENCE M . 



800-455-8236 




"' 2003 OLYMPUS AMERICA INC 



OLYMPUS 



Cover 



The animals shown on the cover are dona intesti- 
nalis, an ascidian (here attached to a mussel), and 
Muggiaea kochi, a siphonophore. Fertilization in 
these marine organisms, as in many others, is ex- 
ternal. But sperm survive only briefly in seawater, 
so they would be more effective if they could locate 
the eggs rapidly. More than 50 years ago, Jean Dan 
reported, in this journal, a specific attraction be- 
tween the sperm and eggs of a hydromedusa ( 1 ). 
Since then, attractive substances that affect sperm 
motility and behavior have been widely detected in 
eggs and related structures and, in a few species, 
have been chemically identified. 

The effect of a sperm-attracting factor, partially puri- 
fied from the eggs of dona intestinalis (2). is illus- 
trated in a video image on the cover (upper left). A 
pipette is filled with agar impregnated with attractant. 
and its tip (diameter, 30 jam) is immersed in a drop 
of dona sperm suspension. In response to the gradi- 
ent of factor, sperm swim in spiral paths with a con- 
stant radius and with a straight trajectory aimed to- 
ward the pipette tip the source of attractant. Note 
that this characteristic behavior (chemotaxis) is un- 
changed as the sperm approaches the attractant and. 
therefore, as the local concentration of attractant in- 
creases. The chemotaxis of siphonophore sperm dif- 
fers from that of dona: both the radius of the spiral 
and the direction of the trajectory change markedly as 
the sperm approaches the source of attractant. Thus, in 
their evolution, these two species have acquired dif- 
ferent strategies for sperm chemotaxis. 

As an approach to this phenomenon and, more 
generally, to the mechanisms underlying sperm che- 
motaxis, Makiko Ishikawa. Hidekazu Tsutsui. and 
their colleagues propose, in this issue of The Bio- 
logical Bulletin (p. 95). two models of sperm 
chemolaxis one for ascidians (e.g., dona intes- 
tiniilis). and one for siphonophores (e.g., Muggiaea 
kuclii). Both models are based on prior experimen- 
tal evidence, and they share a common assumption: 
that the radius of the spiral path is inversely depen- 
dent upon the intracellular calcium ion concentra- 
tion ([Ca 2 ' I,). Modeling the ascidian chemotaxis re- 
quired one additional assumption: that the [Ca ' 2 |,. in 
turn, depend on the change in attractant concentration 



with time. The siphonophore model in addition to 
the common assumption requires also that [Ca +2 ]j 
depend on the local concentration of attractant. and 
that the enzymatic efflux of Ca +2 be substantially 
slower than its influx, raising the [Ca +2 ],. 

On the cover, the two sets of calculated data are 
plotted on graphs representing (in the - axis) the 
profile of an attractant soon after it begins diffusing 
from a point source centered in a small area (4 
mm 2 ). Note that this concentration gradient is small 
until very near the source of attractant, when it 
spikes. The ascidian model (top plot) is a spiral path 
that changes little until the sperm reaches the steep 
portion of the attraction gradient, very close to the 
source. In contrast, the siphonophore model is a wide 
spiral path that narrows markedly and curves tightly 
toward the source as the sperm approaches it (lower 
plot). Both models approximate experimental results. 

This study suggests that only a small number of crit- 
ical parameters are required to model sperm chemo- 
taxis. Presumably these parameters reflect mecha- 
nisms underlying the behavior, and they may be 
amenable to experimentation, eventually explaining 
species differences and their adaptive significance. 

The video image was provided by Makiko Ishi- 
kawa, and the plots of the ascidian and siphono- 
phore model trajectories by Hidekazu Tsutsui 
(Misaki Marine Biological Station. Tokyo Univer- 
sity). The drawing of dona intestinalis is from 
Millar. 1970 (3), and that of Muggiaea kochi is 
from Chun. 1882 (4). Stalwarts in the search for 
illustrations were George Mackie (University of 
Victoria. Canada), Claudia Mills (University of 
Washington). Phil Pugh (Southampton Oceanogra- 
phy Centre), Casey Dunn (Yale University and 
1'Observatoire Oceanologique de Villefranche-sur- 
Mer), Gretchen Lambert (Seattle). Patricia Mather 
(Queensland Museum. Australia), and Nancy Staf- 
ford and Eleanor Uhlinger (MBLAVHOI Library. 
Woods Hole). The cover was designed by Beth 
Liles (Marine Biological Laboratory, Woods Hole). 

I Dun. .1. f. I95D. Hi,-/. Hull W:4I2-4I5. 

2. Yoshida cl til.. 1<W. /)<>. Growth />///</. 36:.W)-:W. 

.V Millar. R. tl. l'*70. ISiin^h .-Uiv'i/H/ii.v. Academic Press. London. 

4, I'hun. C. 1XN2. Sit:uu K ->hcr. I'rcms. ALiJ Hnv 52:1155-1172. 



THE 



BIOLOGICAL BULLETIN 

APRIL 2004 



Editor 



Associate Editors 



Section Editor 



Online Editors 



Editorial Board 



Editorial Office 



MICHAEL J. GREENBERG 

Loins E. BURNETT 
R. ANDREW CAMERON 
CHARLES D. DERBY 
MICHAEL LABARBERA 



The Whitney Laboratory, University of Florida 

Grice Marine Laboratory, College of Charleston 
California Institute of Technology 
Georgia State University 
University of Chicago 



SHINYA INDUE, Imaging and Microscop\ Marine Biological Laboratory 



JAMES A. BLAKE, Keys to Marine 
Invertehnites of the Woods Hole Region 
WILLIAM D. COHEN, Marine Models 
Electronic Record and Compendia 

PETER B. ARMSTRONG 
JOAN CERDA 
ERNEST S. CHANG 
THOMAS H. DIETZ 
RICHARD B. EMLET 
DAVID EPEL 

KENNETH M. HALANYCH 
GREGORY HINKLE 
NANCY KNOWLTON 
MAKOTO KOBAYASHI 
ESTHER M. LEISE 
DONAL T. MANAHAN 
MARGARET McFALL-NcAi 
MARK W. MILLER 
TATSUO MOTOKAWA 
YOSHITAKA NAGAHAMA 
SHERRY D. PAINTER 
J. HERBERT WAITE 
PHIL YUND 
RICHARD K. ZIMMER 

PAMELA CLAPP HINKLE 
VICTORIA R. GIBSON 
CAROL SCHACHINGER 
WENDY CHILD 



ENSR Marine & Coastal Center, Woods Hole 
Hunter College. City University of New York 



University of California, Davis 

Center of Aquaculture-IRTA, Spain 

Bodega Marine Lab.. University of California, Davis 

Louisiana State University 

Oregon Institute of Marine Biology, Univ. of Oregon 

Hopkins Marine Station, Stanford University 

Auburn University, Alabama 

Dana Farber Cancer Institute, Boston 

Scripps Inst. Oceanography & Smithsonian Tropical Res. Insl. 

Hiroshima University of Economics, Japan 

University of North Carolina Greensboro 

University of Southern California 

Kevvalo Marine Laboratory, University of Hawaii 

Institute of Neurobiology, University of Puerto Rico 

Tokyo Institute of Technology, Japan 

National Institute for Basic Biology. Japan 

Marine Biomed. Inst.. Univ. of Texas Medical Branch 

University of California, Santa Barbara 

University of New England, Biddeford. ME 

University of California, Los Angeles 

Managing Editor 

Staff Editor 

Editorial Associate 

Subscription & Advertising Administrator 



Published by 

MARINE BIOLOGICAL LABORATORY 
Woons HOLE, MASSACHUSETTS 



http://www.biolbull.org 



CONTENTS 



VOLUME 206, No. 2: APRIL 2004 



RESEARCH NOTE 



Edmunds, Peter J., and Ruth D. Gates 

Size-dependent differences in the photophysiology 
of the reef coral Parties astreoides 



NEUROBIOLOGY AND BEHAVIOR 

Lindsay, Sara M., Timothy J. Riordan, Jr., and D. Forest 

Identification and activity-dependent labeling of 
peripheral sensory structures on a spionid 
polychaete 65 



PHYSIOLOGY AND BIOMECHANICS 

Harper, S. L., and C. L. Reiber 

Physiological development of the embryonic and lar- 
val crayfish heart 78 



Ehlinger, Gretchen S., and Richard A. Tankersley 

Survival and development of horseshoe crab (Limn/us 
pobiphemus) embryos and larvae in hypersaline condi- 
tions 87 

CELL BIOLOGY 

Ishikawa, Makiko, Hidekazu Tsutsui, Jacky Cosson, 
Yoshitaka Oka, and Masaaki Morisawa 

Strategies for sperm chemotaxis in die siphonophores 

and ascidians: a numerical simulation study 95 

ECOLOGY AND EVOLUTION 

Last, Kim S., and Peter J. W. Olive 

Interaction between photoperiod and an endoge- 
nous seasonal factor in influencing the diel loco- 
motor activity of the benthic polychaete Nereis vi- 
rens Sars 103 

Greenwood, Paul G., Kyle Garry, April Hunter, and 

Miranda Jennings 

Adaptable defense: a nudibianch mucus inhibits 
nematocyst discharge and changes with prey type ... 113 



THE BIOLOGICAL BULLETIN 

THE BIOLOGICAL BULLETIN is published six times a year by the Marine Biological Laboratory, 7 MBL Street, 
Woods Hole. Massachusetts 02543. 

Subscriptions and similar matter should be addressed to Subscription Administrator, THE BIOLOGICAL 
BULLETIN. Marine Biological Laboratory. 7 MBL Street. Woods Hole. Massachusetts 02543. Subscription 
includes bolh print and online journals. Subscription per year (six issues, two volumes): $325 for libraries: $120 
for individuals. Subscription per volume (three issues): $165 for libraries: $70 for individuals. Back and single 
issues (subject to availability): $75 for libraries; $25 for individuals. 

Communications relative to manuscripts should be sent to Michael J. Greenherg. Editor-in-Chief, or Pamela 
Clapp Hmkle. Managing Editor, at the Marine Biological Laboratory. 7 MBL Street. Woods Hole. Massachusetts 
02543. Telephone: (508) 284-7149. FAX: 50X-2S9-7922. E-mail: pclapptffmbl.edu. 



http://www.biolbull.org 

THE BIOLOGICAL BULLETIN is indexed in bibliographic services including Index Medicus and MED- 
LINE, Chemical Abstracts. Current Contents, Elsevier BIOBASE/Current Awareness in Biological 
Sciences, and Geo Abstracts. 

Printed on acid free paper, 
effective with Volume 180, Issue 1. 1991. 



POSTMASTER: Send address changes to THE BIOLOGICAL BULLETIN, Marine Biological Laboratory, 

7 MBL Street, Woods Hole, MA 02543. 

Copyright 2004, by the Marine Biological Laboratory 

Periodicals postage paid at Woods Hole, MA, and additional mailing offices. 

ISSN 0006-3185 



INSTRUCTIONS TO AUTHORS 



The Biological Bulletin accepts outstanding original research 
reports of general interest to biologists throughout the world. 
Papers are usually of intermediate length (10-40 manuscript 
pages). A limited number of solicited review papers may be 
accepted after formal review. A paper will usually appear within 
four months after its acceptance. 

Very short, especially topical papers (less than 9 manuscript 
pages including tables, figures, and bibliography) will be published 
in a separate section entitled 'Research Notes." A Research Note 
in The Biological Bulletin follows the format of similar notes in 
Nature. It should open with a summary paragraph of 1 50 to 200 
words comprising the introduction and the conclusions. The rest of 
the text should continue on without subheadings, and there should 
be no more than 30 references. References should be referred lo in 
the text by number, and listed in the Literature filed section in the 
order that they appear in the Icxt. Unlike references in Nature, 
references in the Research Notes section should conlorm in 
punclualion and arrangement lo the style of recent issues of /'//< 
Biological liiilli'lin. Materials and Methods should he incorpo- 
rated into appropriate ligure legends. See the article In I ec 
(October 20I>:>. Vol. 205: W-IOI I for sample style. A Research 
Note will usually appear within Iwo months alter its acceptance. 

The Editorial Board requests that regular manuscripts con- 
form lo the requirements set below; those manuscripts that do 
not conform \vill be relumed lo authors tor correction before 
rev ie\v . 



I. Manuscripts. Manuscripts, including figures, should be 
submitted in quadruplicate, with the originals clearly marked. 
(Xerox copies of photographs are not acceptable for review pur- 
poses.) Please include an electronic copy of the text of the manu- 
script. Label the disk with the name of the first author and the name 
and version of the wordprocessing software used to create the file. 
If the file was not created in some version of Microsoft Word, save 
the text in rich text format (rtf). The submission letter accompa- 
nying the manuscript should include a telephone number, a FAX 
number, and (if possible) an E-mail address for the corresponding 
author. The original manuscript must be typed in no smaller than 
12 pitch or 10 point, using double spacing (iuchuliiig tigtire leg- 
ends, footnotes, bibliography, etc.) on one side of 16- or 20-lb. 
bond paper. 8 by 11 inches. Please, no right justification. Manu- 
scripts should be proofread carefully and errors corrected legibly 
in black ink. Pages should be numbered consecutively. Margins on 
all sides should be at least 1 inch (2.5 cm). Manuscripts should 
conlorm to the Council of Biology Editor* Slv/e Manual. 5th 
I'dition (f onncil of Biology Editors. I9S3) and to American spell- 
ing. Unusual abbreviations should be kept to a minimum and 
should be spelled out on first reference as well as defined in a 
footnote on the title page. Manuscripts should be divided into the 
following components: Title page. Abstract (of no more than 200 
words). Introduction, Materials and Methods. Results. Discussion. 
Acknowledgments, Literature filed. Tables, and Figure Legends. 
In addition, authors should supply a list of words and phrases 
under which the article should he indexed. 



2. Title page. The title page consists of a condensed title or 
running head of no more than 35 letters and spaces, the manuscript 
title, authors' names and appropriate addresses, and footnotes 
listing present addresses, acknowledgments or contribution num- 
bers, and explanation of unusual abbreviations. 

3. Figures. The dimensions of the printed page, 7 by 9 
inches, should be kept in mind in preparing figures for publication. 
We recommend that figures be about 1 times the linear dimensions 
of the final printing desired, and that the ratio of the largest to the 
smallest letter or number and of the thickest to the thinnest line not 
exceed 1:1.5. Explanatory matter generally should be included in 
legends, although axes should always be identified on the illustra- 
tion itself. Figures should be prepared for reproduction as either 
line cuts or halftones. Figures to be reproduced as line cuts should 
he unmounted glossy photographic reproductions or drawn in 
black ink on white paper, good-quality tracing cloth or plastic, or 
blue-lined coordinate paper. Those to be reproduced as halftones 
should be mounted on board, with both designating numbers or 
letters and scale bars affixed directly to the figures. All figures 
should he numbered in consecutive order, with no distinction 
between text and plate figures and cited, in order, in the text. The 
author's name and an arrow indicating orientation should appear 
on the reverse side of all figures. 

Digital art: The Biological Bulletin will accept figures sub- 
mitted in electronic form; however, digital art must conform to the 
following guidelines. Authors who create digital images are 
wholly responsible for the quality of their material, including color 
and halftone accuracy. 

Format. Acceptable graphic formats are TIFF and EPS. Color 
submissions must be in EPS format, saved in CMKY mode. 

Sofnvare. Preferred software is Adobe Illustrator or Adobe 
Photoshop for the Mac and Adobe Photoshop for Windows. Spe- 
cific instructions for artwork created with various software pro- 
grams are available on the Web at the Digital Art Information Site 
maintained by Cadmus Professional Communications at http:// 
cpc.cadmus.com/da/ 

Resolution. The minimum requirements for resolution are 
1200 DPI for line art and 300 for halftones. 

Size. All digital artwork must be submitted at its actual 
printed size so that no scaling is necessary. 

Multipancl figures. Figures consisting of individual parts 
(e.g.. panels A, B, C) must be assembled into final format and 
submitted as one file. 

Hard copy. Files must be accompanied by hard copy for use 
in case the electronic version is unusable. 

Disk identification. Disks must be clearly labeled with the 
following information: author name and manuscript number; for- 
mat (PC or Macintosh); name and version of software used. 

Color: The Biological Bulletin will publish color figures and 
plates, but must bill authors for the actual additional cost of 
printing in color. The process is expensive, so authors with more 
than one color image should consistent with editorial concerns, 
especially citation of figures in order combine them into a single 
plate to reduce the expense. On request, when supplied with a copy 
of a color illustration, the editorial staff will provide a pre-publi- 
cation estimate of the printing cost. 

4. Tables, footnotes, figure legends, etc. Authors should 
follow the style in a recent issue of The Biological Bulletin in 



preparing table headings, figure legends, and the like. Because of 
the high cost of setting tabular material in type, authors are asked 
to limit such material as much as possible. Tables, with their 
headings and footnotes, should be typed on separate sheets, num- 
bered with consecutive Arabic numerals, and placed after the 
Literature Cited. Figure legends should contain enough informa- 
tion to make the figure intelligible separate from the text. Legends 
should be typed double spaced, with consecutive Arabic numbers, 
on a separate sheet at the end of the paper. Footnotes should he 
limited to authors' current addresses, acknowledgments or contri- 
bution numbers, and explanation of unusual abbreviations. All 
such footnotes should appear on the title page. Footnotes are not 
normally permitted in the body of the text. 

5. Literature cited. In the text, literature should be cited by 
the Harvard system, with papers by more than two authors cited as 
Jones eta/.. 1980. Personal communications and material in prep- 
aration or in press should be cited in the text only, with author's 
initials and institutions, unless the material has been formally 
accepted and a volume number can be supplied. The list of 
references following the text should be headed Literature Cited, 
and must be typed double spaced on separate pages, conforming in 
punctuation and arrangement to the style of recent issues of The 
Biological Bulletin. Citations should include complete titles and 
inclusive pagination. Journal abbreviations should normally follow 
those of the U. S. A. Standards Institute (LISASI), as adopted by 
BIOLOGICAL ABSTRACTS and CHEMICAL ABSTRACTS, with the minor 
differences set out below. The most generally useful list of bio- 
logical journal titles is that published each year by BIOLOGICAL 
ABSTRACTS (BIOSIS List of Serials; the most recent issue). Foreign 
authors, and others who are accustomed to using THE-: WORLD LIST 
OF SCIENTIFIC PERIODICALS, may find a booklet published by the 
Biological Council of the U.K. (obtainable from the Institute of 
Biology, 41 Queen's Gate, London, S.W.7. England. U.K.) useful, 
since it sets out the WORLD LIST abbreviations for most biological 
journals with notes of the USASI abbreviations where these differ. 
CHEMICAL ABSTRACTS publishes quarterly supplements of addi- 
tional abbreviations. The following points of reference style for 
THE BIOLOGICAL BULLETIN differ from USASI (or modified WORLD 
LIST) usage: 

A. Journal abbreviations, and book titles, all underlined (for 
italics) 

B. All components of abbreviations with initial capitals (not 
as European usage in WORLD LIST e.g.. J. Cell. Comp. Ph\siol. 
NOT J. cell, comp. Phyxiol. I 

C. All abbreviated components must be followed by a period, 
whole word components 11111x1 not (i.e.. J. Cancer Res.) 

D. Space between all components (e.g.. J. Cell. Comp. 
Phyxiol.. not J.Cell.Comp.Phyxiol.) 

E. Unusual words in journal titles should be spelled out in 
lull, rather than employing new abbreviations invented by the 
author. For example, use Kit Visindajjelags lx/e>nli/igu without 
abbreviation. 

F. All single word journal titles in full (e.g.. \'eliger. Ecol- 
og\. Brain). 



G. The order of abbreviated components should be the same 
as the word order of the complete title (i.e.. Proc. and Trans. 
placed where they appear, not transposed as in some BIOLOGICAL 
ABSTRACTS listings). 

H A few well-known international journals in their preferred 
forms rather than WORLD LIST or USASI usage (e.g., Nature. 
Science, Evolution NOT Nature. Ltmd., Science. N.Y.; Evolution. 
Lancaster. Pa. ) 

6. Sequences. By the time a paper is sent to the press, all 
nucleotide or amino acid sequences and associated alignments 
should have been deposited in a generally accessible database 



(e.g., GenBank, EMBL, SwissProt), and the sequence accession 
number should be provided. 

7. Reprints, page proofs, and cliarges. Authors may pur- 
chase reprints in lots of 100. Forms for placing reprint orders are 
sent with page proofs. Reprints normally will be delivered about 2 
to 3 months after the issue date. Authors will receive page proofs 
of articles shortly before publication. They will be charged the 
current cost of printers' time for corrections to these (other than 
corrections of printers' or editors' errors ). Other than these charges 
for authors' alterations. The Biological Bulletin does not have 
page charges. 



Reference: Bio/. Bull. 206: 61-64. (April 2004) 
2004 Marine Biological Laboratory 



Size-Dependent Differences in the Photophysiology of 
the Reef Coral Porites astreoides 

PETER J. EDMUNDS' * AND RUTH D. GATES 2 

1 Department of Biology, California State University, 181 1 1 Nordhoff Street, Northridge, 
California 91330-8303: and 2 The Hawai'i Institute of Marine Biology. University of Hawaii Manoa. 

P.O. Box 1346. Kaneohe. Hawai'i 96744 



The recruitment and sun'ival of juvenile corals is central 
to tire maintenance of coral reef communities ami the re- 
population of denuded reef substrata. Although it is widelv 
accepted that the mortality of scleractinians is inversely 
proportional to size, the biotic and abiotic factors that drive 
this trend remain unclear. Here we measure the mortality of 
corals on the reefs of St. John (U.S. Virgin Islands > to 
demonstrate that small corals are more likely to die than 
their larger counterparts, and we explore whether the pho- 
tophysiological performance of juveniles in two size classes 
can provide some insight into why smaller corals are so 
vulnerable. To evaluate photophysiological performance, 
we examined chlorophyll fluorescence in r\vo size classes 
(mean diameters 15 mm and 45 mm) of juvenile colonies of 
Porites astreoides exposed for short periods to ambient and 
elevated temperatures. Our results show that the photo- 
physiology of these size classes differs under ambient con- 
ditions, with dark-adapted i/iiantnm yield (F,./F,,,) being 
significantly higher in smaller compared to higgcr juve- 
niles. As expected, the photophysiology of both size classes 
is negatively impacted by thermal stress, and although 
size-related trends are evident in our data, the interaction 
benveen size and temperature is not statistically significant. 
Thus, while there is size dependency in the photophysiologi- 
cal perfonnance of juvenile colonies of P. astreoides, the 
link between this aspect of scleractinian biology and the 
higher mortality of small juvenile corals in the face of high 
thermal stress remains unclear. 

As a context for this study, we draw on mortality data for 
different size classes of corals at five sites on the shallow 
reefs of St. John. Between 1996 and 2002, the annual 



Received 10 October 2003: accepted 12 January 2004. 
*To whom correspondence should be addressed. E-mail: peter. edmunds(fl' 
csun.edu 



mortality of all juvenile corals <20 mm in diameter was 
2-fold higher than for corals of 21-40 mm in diameter (Fig. 
1 ), and in genera such as Porites, the smallest juveniles 
experienced a 4.3-fold higher mortality rate than their larger 
counterparts (Fig. 1). Using these data as a rationale, we 
compared the photophysiology of two size classes of juve- 
nile colonies of Porites astreoides in January 2003. Corals 
were collected from 6-8 m depth on the west fore reef at 
Discovery Bay, Jamaica, to represent two significantly dif- 
ferent size classes (t = 17.960, df = 26. P < 0.001 ) with 
mean diameters of 15 2 mm and 45 6 mm, hereafter 
described as sizes I and II, respectively. These corals were 
exposed to ambient (=27 C) and elevated temperatures 
(3 1 .6 C) for 6 h in the light followed by 2 h in the dark, and 
the impact of these environmental conditions was evaluated 
by using pulse amplitude modulation (PAM) fluorometry to 
measure each coral's photophysiological performance at the 
end of the 8-h incubation (Fig. 2). The duration of these 
experiments reflects previously published studies that show 
an 8-h exposure to high temperature to be sufficient to elicit 
a photophysiological response in reef corals ( 1 , 2 ). 
Throughout the incubations the corals were inspected for 
signs of stress, such as the production of mucus or the loss 
of color, but no such responses were observed. 

The analysis of the photosynthetic performance of P. 
astreoides by means of PAM fluorometry revealed that the 
dark-adapted (maximal) quantum yield of photosystem (PS) 
II (calculated as F,,/F,,, which is defined in Fig. 2), differed 
significantly between size classes and treatments, but that 
the interaction between size and treatment was not signifi- 
cant (Table 1, Fig. 2). At ambient temperatures. F../F,,, was 
3% to 6% higher in size I versus size II juvenile corals, and 
exposure to the elevated temperature reduced F,./F,,, by 
10% in size I and 12% in size II juveniles. Because F, //-', 



61 



62 




P. J. EDMUNDS AND R. D. GATES 

0.60 



<20 21-40 <20 21-40 

Size Class (mm) 

Figure 1. The mortality of juvenile corals at 5-6 m depth along the 
south coast of St. John. U.S. Virgin Islands. Juvenile corals at five sites 
were identified to genus, sized (diameter), and tagged. To determine 
mortality, each coral was relocated a year later and scored as dead or alive 
1 12). Sample sizes and taxonomic composition of the corals varied each 
year, but mosl belonged to the genera Porites, Agaricia. Sideraslrea. and 
Favia. Mortality was calculated for Porites spp. (including P. ustreoiiles) 
and for juveniles pooled by taxon (11 genera), and was determined sepa- 
rately for corals 20 mm in diameter (small) and between 21 and 40 mm 
in diameter (big). Mean annual percentage mortality is displayed (SE: 
n = 6 years), and differed significantly between small and big juveniles tor 
both Porites (1 = 2.306. df = 10. P = 0.0441 and the pooled taxa (t = 
3.076. df = 10, P = 0.012; statistical analyses were carried out with 
arcsine-transformed percentage mortality). Porites mortality was calcu- 
lated using 58 corals between 1996 and 1997. 46 between 1997 and 1998. 
28 between 1998 and 1999. 5 between 1999 and 2000. 17 between 2000 
and 2001. and 37 between 2001 and 2002: the sample sizes for all juvenile 
corals were 395. 1X7. 105. 28. 57. and 92. respectively. 

measures the efficiency of exciting electrons with light 
energy in PSI1, a decline in F../F,,, reflects a reduction in the 
efficiency of the photochemical pathways culminating in 
carbon fixation (3). Thus, our results show that for P. 
asireoides. the photochemical pathways of smaller juveniles 
are slightly more efficient than those in their larger coun- 
terparts, but that their photophysiology is equally impaired 
by short exposures to elevated temperatures, at least in 
corals collected and analyzed in the winter. 

To explore these size-dependent differences in photo- 
physiology in more detail, we examined nonphotosynthetic 
quenching in the same corals by qualitatively comparing 
rapid light curves. Nonphotosynthetic quenching (</ N ) is a 
measure of excess light energy absorbed by the PS11 an- 
tenna system and dissipated as heat through photoprotective 
mechanisms such as xanthophyll cycling (3, 4); </, v is cal- 
culated from the relationship q N = (F,,, - F,,,.)/(F,,, - 
F,,). where /", and F,, are defined in Figure 2, and F,,,. is the 
maximal fluorescence in the light. We selected </ N because 
it is more sensitive to thermal stress than variable fluores- 
cence [ F,, (5)|. and therefore is likely to display more subtle 
responses to high temperature than F, II-',,,. As expected. </\ 




0.48 



Size I 



Size II 



Figure 2. A comparison of the photophysiology of two size classes of 
imcnile colonies of Purites astreoijes. Temperature treatments were es- 
tablished in 10- 1 tanks placed in an air-conditioned room where they 
received sunlight from an adjacent window [119 5 u.mo\ photons s ' 
m~" (mean SD, n = 2). recorded with a spherical Li-Cor sensor at 
noon]. The tanks were aerated and filled with fresh seawater daily, and 
maintained at 26.1 0.4 C (mean SE. n = 6. ambient treatment: on 
reef = 27 C) and 31.6 0.3 C (mean SE. H = 6. elevated treatment). 
A randomized block experimental design was used to test for the effects ot 
size and temperature, where each block corresponded to one day of 
experiments with one coral of each size class allocated to each treatment. 
Incubations began at noon, and after 6 h the tanks were covered and the 
corals dark-adapted for at least 2 h prior to assessing their photophysiology. 
A pulse amplitude modulation fluoronieter (PAM-210. Walz GmbH) was 
used to quantify chlorophyll fluorescence in the dark-adapted state and at 
each of 1 1 standard light levels. Fluorescence measurements were obtained 
by positioning the sensor just above the tissue on the upper surface of a 
coral colony sitting in seawater at the appropriate incubation temperature. 
Two sets of recordings were obtained from different positions on each 
coral, and the average was used as a statistical replicate. Minimal and 
maximal fluorescences for dark-adapted corals (F,, and F,,,. respectncK i 
were measured, and the results displayed as PSI1 quantum yield | F, IF,,, = 
(F m - F,.)/F,,,: mean SE shown (n = 7)]. F, IF,,, differed significantly 
between size classes and treatments, but there was no statistical interaction 
between the two (Table 1 ). 



appears sensitive to a number of factors; however, most 
relevant to the current discussion are the differences in 
response of q N for sizes 1 and II juvenile corals under the 

Table 1 

Results ol a three-was ranilomi:ed block A,\'OVA eom/Hiriitf; ilark- 
<H/ai>teJ quantum \ielil ot I'SII (F,/F : ,,,l between si:e < Uusei f /.'./ /<" tor 
It ami treatments tt>\e<l tailor lit. \\irlt the block hein.v lite ilas that the 
ei/'enmenl Has eomi'leteil 



Source 


SS 


df 


MS 


F 


P 


Size class 


0.0033 


1 


0.0033 


5.5303 


0.030 


Treatment 


0.0241 


1 


0.0241 


40.6022 


<0.001 


Block 


0.0031 


h 


0.0005 


O.S657 


0.538 


Size class X Treatment 


0.0002 


1 


0.0002 


0.3210 


0.578 


Error 


(1(1107 


IS 


0.0006 







SIZE-DEPENDENT CORAL PHOTOPHYSIOLOGY 



63 



same light and temperature conditions (Fig. 3). For exam- 
ple, when corals are exposed to elevated temperature at 



<120 jLimol photons s 



m 



q N is more severely 



depressed in size I corals than in their larger counterparts 
(size II). Interestingly, at higher light intensities of >367 
ju,mol photons s~ ' m~~, this trend is reversed and the size 
II juveniles incubated at the higher temperature exhibit a 
greater depression in q N than do size I corals. Although 
qualitative, the nuances in our results provide some evi- 
dence that the photophysiology of two size classes of juve- 
niles of P. astreoides respond differently to the combination 
of light and temperature used in our experiments. The most 
parsimonious conclusion is that the two size classes are 
functionally different in photophysiology (as described by 
F V IF HI and q N ); it remains to be demonstrated whether 
these differences are reflected in their tolerance to thermal 
stress and in their inverse size-dependent mortality. Perhaps 
the smallest corals die faster than the bigger corals simply 
because they are so easily overwhelmed (and killed com- 
pletely) by sources of mortality other than thermal stress, for 
example sedimentation or predation (6). 

The size-dependent differences in dark-adapted yield 
(Fig. 2) under ambient conditions likely reflect the func- 
tional implications of other well-known aspects of coral 
biology. For example, conspecifics belonging to different 
size classes may harbor distinct "types" of symbiotic zoo- 
xanthellae (7). each with the physiological characteristics 
and functional limits most suited to the ontogenetic rigors 
facing corals of a particular size. Alternatively, the symbi- 
onts harbored by size I and size II juvenile corals might be 
identical, but the communication between the symbiotic 
partners might be tailored to meet the unique demands of 



their specific developmental stage, such as the rapid growth 
necessary for small juveniles to escape the risks of over- 
growth and predation (8). Or perhaps allometric scaling of 
biological traits (9) mediates the differences in photophysi- 
ology. For example, size-dependent changes in coral tissue 
biomass and thickness (9) could create variable shading of 
zooxanthellae through behavioral responses (10), and rapid 
protein metabolism in fast-growing small corals could re- 
duce the nitrogen limitation of the symbiotic algae, thereby 
enhancing the efficiency of photochemical conversion (II) 
Regardless of the mechanisms underlying our results, we 
believe that further investigation of size-dependent variation 
in juvenile corals is likely to be valuable in understanding 
the environmental thresholds and biology of these complex 
symbiotic organisms. 



Acknowledgments 

This research was facilitated by S. Genovese and the 
East/West Marine Biology Program of Northeastern Uni- 
versity, and is dedicated to Mr. Brown, whose tireless spirit 
and hard work has done much to support our research in 
Jamaica for the last two decades. We thank R. C. Carpenter 
and J. Kiibler for comments that improved earlier drafts of 
this paper. Funding was provided in part by the Sea Grant 
Program of the University of Puerto Rico (grant #R-101-2- 
02) and the Reef Assessment Program of the Virgin Islands 
National Park (both to PJE). This is contribution number 
119 of the CSUN Marine Biology Program. 677 of the 
Discovery Bay Marine Laboratory and 1 176 of the Hawai'i 
Institute of Marine Biology. 



CD 
O 

c 

CD 
O 
(f) 
CD 



CD 

> 



CD 

oc 



1.00 



0.75 - 



0.50 - 



0.25 H 



0.00 



Size I 



200 



400 



Size 





600 



200 



400 



600 



PFD (/vmol photons-s^nr 2 ) 



Figure 3. Quenching analyses for size I and size II juvenile corals exposed to ambient and elevated 
temperature treatments. Measurements were obtained using chlorophyll fluorescence after exposure to each of 
1 1 irradiances tor 1 min in the software-driven protocol supplied by the manufacturer (Run 9. Walz GmbH). 
Results are displayed for nonphotosynthetic quenching (q N ) (mean SE. n = 1 for each datum) and allow for 
a qualitative comparison of relative photosynthetic performance between size classes and treatments. One 
important limitation of this analysis is that photosynthetic equilibrium is probably not achieved within the I -min 
irradiance exposures employed. 



64 



P. J. EDMUNDS AND R. D. GATES 



Literature Cited 

1. Jones, R. J., O. Hoegh-Guldberg, A. W. D. Larkum, and U. 

Shreiber. 1998. Temperature-induced bleaching of corals begins 
with impairment of the CCK fixation mechanism in zooxanthellae. 
Plant Ct'll Em-ironment 21: 1219-1230. 

2 Warner, M. E., W. K. Fitt, and G. W. Schmidt. 1999. Damage to 
photosystem II in symbiotic dinoflagellates: a determinant of coral 
bleaching. Proc. Null. Acml. Sci. USA 96: 8007-S012. 

3. Maxwell, K., and G. N. Johnson. 2000. Chlorophyll fluores- 
cence a practical guide. J. Ev/>. Botuny 51: 659-668. 

4 Brown, B. E., I. Ambarsari, M. E. Warner, W. K. Fitt, R. P. 
Dunne, S. W. Gibbs, and I). G. Cunmiings. 1999. Diurnal changes 
in photochemical efficiency and xanthophylls concentrations in shal- 
low water reef corals: evidence of photoinhibition and photoprotec- 
tion. Coral Reefs 18: 99-105. 

5. Shreiber, LI., II. Schliwa, and W. Bilger. 1986. Continuous record- 
ing of photochemical and non-photochemical chlorophyll fluorescence 
quenching with a new type of modulation fluorometer. Photosynthesis 
Research 10: 51-62. 



d. Hughes, T. P., and J. B. (_'. Jackson. 1985. Population dynamics 

and life histories of foliaceous corals. Ecol. Monogr. 55: 141-166. 
7. Coffroth, M. A., S. R. Santos, and T. L. Goulet. 2001. Early 

ontogenetic expression of specificity in a cnidarian-alga] symbiosis. 

Mar. Ecol. Prog. Ser. 222: 85-96. 
S. Jackson, J. B. C. 1977. Competition on marine hard substrata: the 

adaptive significance of solitary and colonial strategies. Am. Nut. 980: 

743-767. 
4 Vollmer, S. V., and P. J. Edmunds. 2000. Allometric scaling in 

small colonies of the scleractinian coral Siderastrea siderea (Ellis and 

Solander). Biol. Bull. 199: 21-28. 

10. Brown, B. E., C. A. Downs, R. P. Dunne, and S. W. Gihb. 2002. 
Preliminary evidence for tissue retraction as a factor in pholoprotection 
of corals incapable of xanthophyll cycling. J. Exri. Mar. Biol. Ecol. 
277: 129-144. 

11. Falkowski, P. G., Z. Duhinsky, L. Muscatine, and L. McCloskey. 
1993. Population control in symbiotic corals. Binscience 43: 606-61 1. 

12. Edmunds, P. J. 2000. Patterns m the distribution of juvenile corals 
and coral reef community structure in St. John. US Virgin Islands. 
Mar. Ecol. Prog. Ser. 202: 113-124. 



Reference: Biol. Bull. 206: 65-77. (April 20041 
2004 Marine Biological Laboratory 



Identification and Activity-Dependent Labeling of 
Peripheral Sensory Structures on a Spionid Polychaete 

SARA M. LINDSAY*. TIMOTHY J. RIORDAN. JR.. AND D. FOREST 

School of Marine Sciences, 575 J Murray Hall, University of Maine, Orono, Maine 04469 



Abstract. In marine sedimentary habitats, chemorecep- 
tion is thought to coordinate feeding in many deposit- 
feeding invertebrates such as polychaetes. snails, and clams. 
Relatively little is known, however, about the chemosensory 
structures and mechanism of signal transduction in deposit 
feeders. Using electron microscopy, confocal laser scanning 
microscopy (CLSM), and immunohistochemistry, we inves- 
tigated the structure and function of putative chemosensory 
cells on the feeding appendages of a deposit-feeding 
polychaete species. Dipolydora quadrilobata. Tufts of pu- 
tative sensory cilia were distributed over the prostomium 
and feeding palps and typically occurred next to pores. 
Examination of these regions with transmission electron 
microscopy revealed multiciliated cells with adjacent glan- 
dular cells beneath the pores. The sensory cells of prosto- 
mium and palps were similar, displaying an abundance of 
apical mitochondria and relatively short ciliary rootlets. 
Staining with antiserum against acetylated a-tubulin was 
examined by CLSM, and revealed axonal processes from 
putative sensory tufts on the palp surface to palp nerves, as 
well as many free nerve endings. Activity-dependent cell 
labeling experiments were used to test the sensitivity of 
putative sensory cells on the palps to an amino acid mixture 
that elicited feeding in previous behavioral experiments. In 
static exposures, the number of lateral and abfrontal cells 
labeled in response to the amino acid mixture was signifi- 
cantly greater than in the controls. Ultrastructural. posi- 
tional, and now physiological evidence strongly suggests 
that spionid feeding palps are equipped with sensory cells, 
at least some of which function as chemoreceptors. 



Received 17 September 2002; accepted 4 February 2004. 
* To whom correspondence should be addressed. E-mail: slmdsay(s> 
rnaiue.edu 



Introduction 

In marine sedimentary habitats, deposit-feeding inverte- 
brates such as polychaetes, bivalves, gastropods, crusta- 
ceans, holothurians, and hemichordates are abundant mem- 
bers of the tnacrofauna. These organisms ingest large 
volumes of sediment with typically low food value, often 
processing one or more body weights of sediment each day 
(reviewed in Lopez and Levinton, 1987). They also disturb 
the sediment as they burrow or build tubes. As bioturbators. 
deposit feeders have a profound influence on the biological, 
chemical, geological, and even physical properties of their 
habitat. Deposit feeders affect sediment transport and dis- 
tribution (e.g., Nittrouer and Sternberg, 1981; Suchanek. 
1983; Shull, 2001). sediment geochemistry (Marinelli, 
1992; Aller, 1994), sediment microbial communities (Find- 
lay et al., 1990; Grossman and Reichardt, 1991; Plante and 
Mayer, 1994), nutrient cycling (Widbom and Frithsen, 
1995; Christensen et al.. 2000), and fate of pollutants 
(Mayer et al.. 1996; Weston ct al., 2000). Sediment distur- 
bance by deposit feeders mediates competitive interactions 
(e.g.. Rhoads and Young. 1970; Woodin. 1976; Wilson, 
1981; Brenchley, 1981). and influences animal distribution 
patterns and dispersal (Wilson, 1981; Gunther, 1992; Brey. 
1991), as well as recruitment (Williams, 1980; Posey, 1986: 
Luckenbach, 1987; Mines et al.. 1989; Olafsson. 1989: 
Flach, 1992). In addition, deposit feeders can influence 
recruitment directly by ingesting larvae and juveniles (Wil- 
son. 1980; Tamaki. 1985; Miliekovsky. 1974: Elmgren et 
nl.. 1986; Albertsson and Leonardsson. 2001 ). 

Rates of sediment mobilization by deposit feeders depend 
on food supply. In the last two decades, behavioral, physi- 
ological, and mathematical modeling approaches have been 
applied to the question of what makes some sediments 
better food than others (e.i;.. review by Jumars, 1993). 
Largely absent from this body of research, however, are 
studies that investigate the cues that initiate ingestion and 
modulate feeding rates in deposit feeders. Jumars (1993) 



66 



S. M. LINDSAY ET AL 



suggested several stimuli that could operate to regulate 
ingestion rate: smell, taste, distension of the gut, and inter- 
nal detection of the absorbed products in body fluids. The 
physiological and molecular mechanisms for detecting these 
stimuli remain poorly understood for most deposit feeders. 

Chemoreception is implicated in the coordination of feed- 
ing by a variety of deposit feeders. For example, fresh fecal 
material depresses feeding rate in the snail Hvdrohiti tnin- 
cata (Forbes and Lopez. 1986) and the spionid polychaete 
Pseudopolydora kempi japonica (Miller and Jumars, 1986). 
Phagostimulants are implicated as well. When given a 
choice, the common deposit-feeding polychaete Streblospio 
benedicti fed preferentially on organically enriched sedi- 
ments rather than on unaltered sediments (Kihslinger and 
Woodin, 2000). Feeding rate in a deposit-feeding hemichor- 
date was strongly correlated with sediment chlorophyll n 
concentrations (Karrh and Miller. 1994). Robertson et <//. 
(1980) found that fiddler crabs, Ucu pii^ilutor, fed selec- 
tively in diatom-enriched patches of sediment and could 
resolve patches at the millimeter scale by probing with 
sensory setae on their legs. Fiddler crabs have also been the 
focus of several studies that explicitly tested the effects of 
chemical compounds on deposit feeders. A variety of amino 
acids, peptides, and sugars appear to stimulate feeding 
(Robertson et ai, 1981; Rittschof and Buswell, 1989; 
Weissburg and Zimmer-Faust, 1991; Weissburg. 1993). 
Similarly, Ferner and Jumars (1999) found that dissolved 
cues (amino acids and complex mixtures) influenced the 
feeding behavior of several spionid polychaetes. We re- 
cently extended this work to show that particle-bound 
amino acids and sugars influence feeding in the spionid 
polychaete Dipulyihira quadrilobata (Riordan and Lindsay, 
2002). 

Although chemical mediation of deposit feeding seems 
likely, relatively little is known about the chemosensory 
structures and mechanism of signal transduction in deposit 
feeders. One exception is tiddler crabs. Weissburg and 
colleagues have identified gender-specific differences in 
tiddler crab feeding behavior in response to chemical cues, 
and these are linked to differences in the number and 
sensitivity of chemoreceptor neurons (Weissburg, 1993. 
1999; Weisshurg and Derby. 1995; Weissburg i-t ai. 1996). 
Recent work (Weissburg. 2001) suggests the adenylate- 
cyclase-cAMP second messenger cascade mediates inhibi- 
tion of chemosensory neurons, and that gender-specific dif- 
ferences in this pathway contribute to the physiological and 
behavioral differences in fiddler crab chemosensitivity. 

Among the polychaetes, nuchal organs are presumed to 
he involved in Chemoreception based on histological. ultra- 
structural, and positional criteria (Storch and Schlotzer- 
Schrehardt. 19X8; Purschke. 1997). Several authors have 
speculated that nuchal organs may be involved in food 
selection (Rullier. 1951 ; Rhode. 1940; No/ais </ til.. 1997) 
or reproduction (Schlot/er-Schrehaidt. 19X7). although 



they may also be involved in osmoregulation (Fewou and 
Dhainaut-Courtois. 1995). Nuchal organs typically are 
paired epidermal structures found on the dorsal side of the 
prostomium or peristomium (/.<., the anterior presegmental 
region). Some spionid polychaetes (not Dipolydora t/iuidri- 
lohatii) also have metameric nuchal organs on their bodies 
(Jelsing, 2002). Cephalic nuchal organs are typically com- 
posed of ciliated supporting cells, bipolar primary sensory 
cells with cilia, unmodified epidermal cells, and retractor 
muscle cells in those species in which nuchal organs can be 
retracted (reviewed by Purschke, 1997). 

Other presumed chemosensory structures have been de- 
scribed from polychaetes, including epidermal papillae of 
the deposit-feeding lugworm Arenicohi nuirinti (Jouin ct til.. 
1985). compound sensory organs on the prostomial cirri and 
palps of Nereis diversicolor (Dorsett and Hyde. 1969). and 
the parapodial cirri of nereidid polychaetes (Boilly-Marer. 
1972). In Plan-nereis dinner! ii. the receptors of the parapo- 
dial cirri function in perception of sexual pheromones 
(Boilly-Marer. 1968. 1974). Peripheral sensory structures 
have also been observed on the feeding palps, prostomia. 
and peristomia of several spionid polychaete species 
(Dauer. 1984. 1987. 1991. 1997: Worsaee, 2001). With the 
exception of the nereidid pheromone receptors, studies 
demonstrating functions of these putative polychaete che- 
moreceptors are largely absent. The goals of this study were 
to ( 1 ) describe the distribution and ultrastructure of periph- 
eral sensory cells of the spionid polychaete Dipolydont 
quadrilobata, and (2) assign a functional role to these struc- 
tures by using an immunohistochemical approach that la- 
beled cells responding to chemical cues that elicited behav- 
ioral responses in D. quadrilobata (Riordan and Lindsay. 
2002). 

Materials and Methods 
Collection and maintenance of animals 

Individuals of Dipolydoru t/iuulrilohtitit (Jacobi 1883) 
were sieved (0.5 mm) out of cores collected from the 
mudflats of Lowe's Cove at the University of Maine's 
Darling Marine Laboratory (Walpole. ME. USA) on several 
days in September and October of 2000. and March. April, 
and May of 2001. Animals and natural sediments were 
transported to the University of Maine in Orono and 
maintained in aquaria inside an environmental chamber ( 14 
C:10 C, 12 h light:dark cycle). Individual worms that 
measured 10-20 mm in length and showed no signs of 
gametogenesis. loss of segments, or other bodily damage 
were used in the experiments. 

Electron microscopy 

For scanning electron microscopy (SEM). intact worms 
were relaxed in chilled 37'i magnesium chloride, fixed in 



SPIONID PERIPHERAL SENSORY CELLS 



67 



3% glutaraldehyde in 0.1 M phosphate buffer with 10% 
sucrose, post-fixed in 1% osmium tetroxide in O.I A7 phos- 
phate buffer, and dehydrated in an ethanol series. Samples 
were then critical-point-dried with liquid CO : , mounted on 
stubs, and coated with gold palladium in a Conductavac I 
(SpeeVac. Inc.) sputter coaler. Samples were viewed with 
an AMRay AMR1000A scanning electron microscope op- 
erating at 5 kV. Negatives were scanned at 800 dpi with an 
HP ScanJet 7400C flatbed scanner equipped with an HP 
ScanJet XPA attachment, and the images were saved as 
TIFF files. 

For transmission electron microscopy (TEM), worms 
were relaxed in chilled 37% magnesium chloride, fixed in 
3% glutaraldehyde in phosphate buffer with 10% sucrose, 
post-fixed in 1% osmium tetroxide in 0.1 M phosphate 
buffer, dehydrated in an acetone series, and embedded in 
Spurr's resin. Ultrathin sections were collected onto slot 
grids, then stained with 0.5% lead citrate and 2% uranyl 
acetate. Samples were viewed with a Phillips CM 10 trans- 
mission electron microscope operating at 80 kV. Negatives 
were scanned at 800 dpi with an HP ScanJet 7400C flatbed 
scanner equipped with a HP ScanJet XPA attachment, and 
the images were saved as TIFF files. 

Confocal laser scanning microscopy 

Worms were relaxed in a 37% MgCK solution for 5 min, 
then fixed overnight at 4 C in a solution of 4% formalde- 
hyde in artificial seawater (ASW, 32%c, pH 7.4. Forty 
Fathoms Crystal Sea Marine Mix. Marine Enterprises In- 
ternational. Baltimore, MD). After three 10-niin rinses in 
ASW, worms were soaked for 5 h in a blocking solution 
containing 0.5% Triton-X 100 and 0.5% bovine serum 
albumin (BSA). The primary antibody ( 1" Ab), monoclonal 
mouse anti-acetylated -tubulin (Sigma, St. Louis; clone 
6-11B-1), was diluted 1:100 with 0.5% Triton X-IOO in 
ASW and applied overnight (about 18 h). Specimens were 
then rinsed in ASW and incubated for 5 h with FITC- 
conjugated goat anti-mouse secondary antibodies (Sigma: 
Fc specific IgG) diluted 1:100 in 0.5%' Triton X-100/ASW. 
After a final series of ASW rinses, worms were mounted on 
glass slides in Fluoromount-G (Southern Biotechnology As- 
sociates, Birmingham, AL). Preparations were imaged with 
a Leica TCS SP2 confocal laser scanning microscope. Neg- 
ative controls to test for the specificity of primary antibodies 
were prepared by treating specimens as described, but omit- 
ting the 1 Ab. Repeated incubations were performed, and at 
least 10 worms were used to test for reproducibility. 

Activity-dependent cell labeling 

We adapted the method used by Michel et til. ( 1999) to 
label activated olfactory neurons in zebrafish and spiny 
lobsters. This method exploits the ability of cationic guani- 
dinium analogs to enter into stimulated neurons and meta- 



bolically active cells ( Dwyer el <//.. 1 980: Picco and Menini. 
1993). These analogs enter active neurons through nonspe- 
cific cation channels activated and opened by the binding of 
a ligand with its receptor protein. Sequestration of the 
analogs in these cells allows for the activity-dependent 
labeling of individual receptor neurons. 

For example, the guanidinium analog, l-amino-4-gua- 
nidobutane (= agmatine), has been shown to enter into 
receptor neurons through such open cation channels (Yo- 
shikami, 1981 ). When coupled with known stimulatory cues 
in solution and perfused over olfactory organs, agmatine 
accumulates in activated odorant receptor neurons (Michel 
ft nI.. 1999: Steullet et til., 2000). Cells stimulated by a cue 
accumulate agmatine and can be identified using an anti- 
agmatine IgG antibody followed by silver intensification 
labeling (Marc. 1995, 1999a. b). We presented agmatine 
plus a mixture of amino acids known to elicit behavioral 
responses to individual specimens of Dipolydora c/uadrilo- 
biitu in both flow-through and static experiments. 

Flow trials. Individual worms were immersed in artificial 
seawater (ASW, in mM: 423 NaCl. 9 KC1. 13 CaCU, 23 
MgCU, 26 MgSO 4 (Cavanaugh, 1975) pH adjusted to 7.2) 
inside a small coverslip perfusion chamber (Warner Instru- 
ments, Model #RC 21 B). Odorant stimuli were added to the 
ASW perfusion fluid in 5-s pulses every 60 s for 60 min. 
The ASW and the odorant stimuli solutions were held in 
60-rnl syringes connected to the perfusion chamber through 
rubber tubing and a manifold. Fluid flow from the syringes 
was by gravity feed, and flow rates (0.5 cm s ') were 
controlled by stopcock valves; fluid flow was turned on and 
off by electronically activated pinch valves (Warner Instru- 
ments, model VC-6). Stimuli included 20 mM agmatine 
sulfate (AGB) in ASW (control, n = 4 worms) and 20 mM 
AGB plus a mixture of amino acids ( I mM each of proline. 
alanine, threonine. valine. taurine. and glycine) in ASW 
(treatment, n = 5 worms). Following the 60-min stimula- 
tion period. ASW was perfused over the worms for 5 min to 
remove residual AGB. Worms were then immersed in fresh 
ASW and relaxed by placing them in a freezer ( -20 C) for 
10 min prior to fixing. Whole worms were placed in fixative 
(1% paraformaldehyde. 2% glutaraldehyde in 0.2 M phos- 
phate buffer with 10% sucrose (w/v), pH 7.2) from over- 
night to several days. 

No ftw (static) trials. Individual worms were immersed in 
10 ml ASW inside a small petri dish, and 10 ml of either 40 
mM AGB in ASW (control, n = 6 worms) or 40 mM AGB 
plus the mixture of amino acids in ASW (treatment, n = 6 
worms) was slowly added by pipette. Worms were exposed 
to the treatments for 60 min, during which time they were 
relatively quiescent in the dishes, immersed in fresh ASW 
for 5 min to remove residual AGB, and relaxed by placing 
them in a freezer ( - 20 C) for 1 min prior to fixing. Whole 



68 



S. M. LINDSAY ET AL. 



worms were placed in fixative ( 1% paraformaldehyde, 2% 
glutaraldehyde in 0.2 M phosphate buffer with 10% sucrose 
(w/v), pH 7.2) from overnight to several days. 

Tissue processing, immunolabeling, and visualization 

Fixed worms were rinsed in a phosphate buffer (PB: 
1.76 g NaH 2 PO 4 H : O + 7.67 g Na : HPO 4 in 1 1 of 
deionized water), dehydrated through a graded series of 
absolute ethanol and acetone, embedded in Epon 812 resin, 
cured, and sectioned using a microtome and glass knives. 
An average of 156 sections were processed for each indi- 
vidual. Semi-thick sections (2 jum) were placed in 7-mm 
wells of a Teflon-coated spot slide (Erie Scientific), deplas- 
ticized in a 1:5 v/v solution of mature sodium ethoxide in 
anhydrous ethanol. and subsequently washed in three 
changes of anhydrous ethanol. The slides were rinsed in 
deionized water, air-dried, and then incubated overnight in 
a 1:100 dilution of a polyclonal rabbit anti-AGB IgG anti- 
body (Signature Immunologies and courtesy of R. Marc. 
University of Utah School of Medicine). The slides were 
then rinsed in PB. washed in \7t goat serum in PB plus 
0.05% thimerosal ( 1% GSPBT) for 10 min. and incubated in 
a 1:50 dilution of a 1-nm gold conjugated anti-rabbit IgG 
antibody for 60 min. After a final PB wash and air-drying. 
labeled cells were visualized using silver intensification 
(Marc, 1999a, b). The silver nitrate solution for silver in- 
tensification was prepared by mixing three solutions: 5 ml 
of solution A ( 1 14 mg citric acid + 342 ing sodium citrate 
in 6 ml of deionized water). I ml of solution B (0.5 g 
hydroquinone in 15 ml of deionized water), and 1 ml of 1% 
aqueous silver nitrate. Following a dip in 5% acetic acid to 
stop the intensification reaction, the slides were washed in 
deionized water for 10 min. air-dried, and mounted in 
Permount (Fisher) for viewing on a light microscope. 



digitization and analysis 

Images of the sections were captured digitally using a 
Javelin JE12HMV video camera mounted on an Olympus 
BX60 light microscope. Video signals were passed to a 
frame grabber board (Scion LG 3) in a Dell Optiplex 
GX110 computer. The images were analyzed using the 
Scion ImagePC software. Beta ver. 4.02 (Scion Corpora- 
tion, Frederick, MD). Cells labeled with agmatine were 
identified by quantifying the pixel intensity inside a cell ol 
interest in the digiti/ed images and comparing it to the pixel 
intensity of an unlaheled region adjacent to the cell d'.v,. 
Michel et al.. 1999). The mean and standard deviation of the 
pixel intensity inside cells of interest was used to calculate 
a 95% confidence interval; cells were counted as labeled if 
the lower limit of this interval was higher than the upper 
limit of the unlabeled region. Two strategies were used to 
avoid double-counting of labeled cells. First, cells were 
counted only if the distal processes and apical cilia were 



present in the same plane as the labeled cell body; these 
processes typically were not coplanar in more than one 
adjacent section. Second, the locations of labeled cells in a 
single section were compared to labeled cells in adjacent 
sections to avoid counting the same cell twice. 

Labeled cells were grouped by type according to their 
location within the sections (Fig. 1). Abfrontal cells were 
located behind a straight line drawn across the sections and 
tangent to the back of the food groove. Lateral cells were 
found between the food groove and the abfrontal cilia. Cells 
immediately adjacent to the frontal ciliated food groove 
were called laterofrontal cells. And cells located within the 
frontal ciliated food groove were called frontal cells. Be- 
cause different numbers of sections were analyzed for each 
worm, we calculated the number of labeled cells per 100 
/j.m palp length, based on the total number of sections 
analyzed per individual. The resulting data were compared 
among treatments using a nonparametric Kruskal-Wallis 
analysis of variance (SAS version 9, SAS Institute, Inc.). 
Data from flow experiments and static experiments were 
analyzed separately. 

To estimate the total number of each cell type in any 
length of palp, serial sections made from the palps (middle 
portion) of four worms were stained with a toluidene blue 
stain. Toluidene blue stains acidic cell parts (i.e., nucleus) 
and allows the different types of cells to be identified and 
counted. Individual cells were traced through the sections to 
avoid double-counting. On average, about 121 /uni of palp 
tissue was sectioned for each of these worms, representing 
about 5% of the average length of the palps of D. i/mulri- 
lobaia. 



Results 

Distribution of peripheral sensory cells 

Scanning electron microscopy revealed tufts of cilia (/'.'., 
cirri, \cnxii Worsaae, 2001) distributed on the palps and 
prostomiiim of Dif>ol\dnru qmidrilobata (Fig. 2). Tufts of 
putative sensory cilia were found on all surfaces of the 
prostomium (Fig. 2B) and were typically adjacent to pores 
(Fig. 2B). The cilia of the prostomial tufts were nonmotile 
and relatively short; they numbered about 13-20 cilia per 
tuft (Fig. 2C). On the palps, we observed motile cilia 
arra\ed in a row immediately adjacent to each side of the 
food groove (laterofrontal, Fig. 3 A, B), and tufts of motile 
cilia arrayed in a second lateral row and on the abfrontal 
surface (Fig. 3 A, B). Laterofrontal, lateral, and abfrontal 
cilia occurred with similar frequency along the length of the 
palp (Fig. 3C). The putative sensory tufts of cilia on the 
abfrontal surface seemed regularly dispersed; and. interest- 
ingly, we observed fewer adjacent pores than on the pros- 
tomium. The cilia of the abfrontal surfaces were longer than 



SPIONID PERIPHERAL SENSORY CELLS 



69 



Single cross-section (2 jam) 
through the palp 




, 



B 



Abfrontal Cell 
Location 



Lateral 

Cell 
Location 



Latero- 
Frontal Cell 
Location 




Frontal Cilia and Frontal Cell Location 



Figure 1. (A) Gross palp morphology and section placement for cell labeling studies in Dipohdora 
quadrilobata. (B) Cell type location within sections. Cells along the food groove and within the frontal cilia were 
designated frontal cells. Cells immediately adjacent to the frontal cilia were designated laterofrontal cells. Cells 
behind a line drawn across the back end of the food groove were designated abfrontal cells. Cells in front of that 
line and lateral to the frontal surface were designated lateral cells. 



those of the prostomium, and there were fewer cilia per tuft 
(7-14) (Fig. 3C. inset). 

Season' cell ultrastructure 

Palp and prostomial sensory cells shared similar ultra- 
structural characteristics. All were multiciliated and con- 
tained many apical mitochondria (Figs. 4, 5). Laterofrontal 
cells on the palp were typically adjacent to glandular cells 
(Fig. 4) associated with pores on the surface. Gland cells 
contained either globules of very electron-dense material 
(Fig. 4C) or less dense material that appeared to be mucus 
(not shown). Abfrontal cells of the palp were restricted by 



the muscle layers below, and cell bodies often projected 
laterally (Fig. 5). Ciliary rootlets of both palp and prosto- 
mial cells, when observed, were short relative to the length 
of the cell body (Fig. 5A). All cilia were readily distinguish- 
able from the microvillar cuticle (Figs. 4, 5) and displayed 
a characteristic 9X2 + 2 microtubular arrangement in 
cross-section. 

Confocal laser scanning microscopy 

The antibody for acetylated a-tubulin targets nerve axons 
and cilia axoneme microtubules. Cilia of the food groove. 



70 



S. M. LINDSAY ET AL. 




sensory tufts to the palp nerves (Fig. 6B). There are also 
many nerves with apparent free endings on the palp surface 
(i.e., not associated with ciliated cells). A more detailed 



Figure 2. Peripheral sensoiy cells on ihe prostomiimi of l)i/>i>lydoru 
i/utulrilohiitu. (A) Anterior prolilc. shim ing pulps (pa) and piosionmini 
(pro); scale 10(1 /.nil Insel slum's entire worm. (Hi Ciliated struelures arc 
ilislnhuteil on the entire surface of the prostoniium (anowsi; palps wcic 
ieino\cd. leaving a scar ipsi; scale 1(10 /mi. (Cl I'oies ipo) are found 
ud|accnl lo the sensory sliuelures on the prosiominm; scale = 10 /Mill Inset 
shows the sensory cilia of the piostomium; inset scale - 2.5 juin. 



lateral and abl'ronlul surfaces of palp, as well as (he main 
palp nerve and several smaller palp nerves projecting to the 
central nervous system showed aeetylaled a-tubulin reac- 
tivity (Fig. 6A). Our initial observations clearly show axons 
that project from the cilia of putative lateral and ahfrontal 




mwfif^^^^ &fSJNP 

?TS v-;syX j V c " * *S v J*r.' -."^ '^s^L^^sr-'.,- 
i* .i? /" -. it . ^t.*i ' >*/!fldBMl3Ht^Hp' ~ '^ jd^^H^^l 





i^A. - '?>'" .o 

3. Peripheral sensoiy cells on Ihe palp of Di/'olyilni'ii i/utulri- 
lohulii. (A) Lateral view of the middle portion of a feeding palp, showing 
frontal food groove (I'gl. lalerolionlal cilia (111. and lulls of nonmolile 
scnsor\ cilia (sll on the lalcial and ahlronlal snrtaces of the palp; scale = 
so /mi. (Hi Middle portion of the feeding palp showing laterolrontal (II) 
cilia adjacent to ihe frontal food groove (fg). as well as laterally distributed 
sensotv lulls isii. scale II) /jM. (Ci Hislal portion of feeding palp 
showing the loud gioo\c ilgl. lalerolionlal (111 cilia, and sensory (lifts isl); 
scale = 10 /jiii. Inset palp sensoiy tufts appear to he similar lo those on 
the piosioiiiiuni; inset scale = I jim. 



SPIONID PERIPHERAL SENSORY CELLS 



71 




Figure 4. Ultrastructure of Dipolydora quadrilobata palp laterofrontal cells. (A) Semi-oblique section 
through palp food groove showing dense field of frontal cilia (fc) and adjacent laterofrontal cell (If); scale = 2 
/jm. (B) Same laterofrontal cell showing numerous cilia (c) and many apical mitochondria (mt); scale = 2 fj,m; 
the basal portion of the cell projects out of the plane of section. (C) Another semi-oblique section of the palp 
reveals the laterofrontal cell and adjacent glandular cell (gc) with pore (po); scale = 2 /j,m. 



examination of the innervation of these peripheral sensory 
cells, as well as their reactivity to anti-serotonin and anti- 
FMRFamide, is in progress. 

Activity-dependent labeling 

Four types of putative sensory cells were labeled by 
exposing the palps of D. quadrilobata to agmatine and the 
amino acid mixture: frontal, laterofrontal, lateral, and ab- 
frontal cells (Fig. 7). These four cell types all have cellular 
processes extending through the epidermis to the surface of 
the palp (Fig. 7), many with visible cilia extending from the 
surface of the palp. Frontal and laterofrontal cells were 
generally found as groups of several cells close to one 
another at the periphery of the food groove, and often most 
of these cells were labeled. In contrast, labeled lateral and 
abfrontal cells were always found in isolation. 

The occurrence of labeled cells in the flow-through per- 
fusion experiment was quite variable (Fig. 8 A). Pooling all 
cell types, there was no significant effect of amino acids 
(cue) on cell labeling (Kruskal-Wallis f = 0.74, d.f. = 1, 
P = 0.39, n = 27). There was a non-significant trend 
toward greater labeling in the controls for laterofrontal and 
frontal cells (e.g., Kruskal-Wallis test of the difference 
between the number of frontal cells labeled in the presence 
of amino acids compared to controls: x 2 = 2.7655, d.f. = 1, 
P = 0.09, n = 9). Relatively fewer cells were labeled in 
the static experiments (Fig. 8B, note axis scale). In contrast 
to the flow experiment, however, addition of amino acids 
significantly increased cell labeling with agmatine com- 



pared to controls in all cell types pooled (Kruskal-Wallis, 
X 2 = 9.88, d.f. = 1, P = 0.002, n = 36). We observed the 
greatest amount of labeling in lateral and abfrontal cells 
(Fig. 8B). 

Based on counts from the serial sections stained with 
toluidine blue, frontal cells and laterofrontal cells occur at 
about the same frequency, averaging 27 frontal cells and 28 
laterofrontal cells per 100 jam of palp. Lateral and abfrontal 
cells occur less frequently, at a combined average rate of 1 1 
cells per 100 /urn of palp. Given an average palp length of 
2.55 mm for D. quadrilobata, and assuming no changes in 
distribution along the length of the palp, we can then expect 
approximately 688 frontal cells, 714 laterofrontal cells, and 
a total of 280 lateral and abfrontal cells to occur on a single 
palp. Based on the occurrence of labeling that we observed 
in static trials only, we conservatively estimate that 14% of 
the total number of lateral and abfrontal cells, 47c of the 
total number of laterofrontal cells, and 3% of the total 
number of frontal cells were labeled by agmatine in the 
presence of amino acids. 

Discussion 

The diversity of chemosensory organs among marine 
organisms is great, from crustacean aesthetasc sensilla to 
molluscan osphradium, rhinophores. and oral tentacles, to 
polychaete nuchal organs (Laverack, 1968; Emery, 1992). 
Despite this diversity, the transduction of externally de- 
tected signals to the brain follows a similar pathway, be- 
ginning with the activation of a chemoreceptor cell that 



72 



S. M. LINDSAY ET AL. 









leads to the central nervous system. The structural common 
denominator for all chemosensory cells is the presence of 
ciliary or microvillar extensions into the environment. The 
peripheral cells of the spionid palps and prostomium clearly 
meet this requirement (Figs. 2, 3). 

Dauer (1984, 1987. 1991, 1997) and Worsaee (2001) 
observed nonmotile cilia on palps and prostomia of several 
spionid species, including Dipolydora quadrilobata, and 
classified them as sensory on the basis of scanning electron 
microscopy data and positional criteria. Our initial TEM 
observations (Figs. 4, 5) support these classifications, and 
suggest that these peripheral sensory cells have features 
similar to the caudal chemoreceptors that Jouin el ai. 
(1985) described in Arenicola marina namely an abun- 
dance of apical mitochondria and short ciliary rootlets. 
Confocal laser scanning microscopy further reveals axonal 
processes to palp nerves from the lateral and abfrontal 
sensory tufts (Fig. 6), as well as many free nerve endings 
projecting to the lateral and abfrontal surfaces of the palps. 

Assigning function to cells based solely on morphologi- 
cal criteria can be difficult, however. For example, it ap- 
pears that no single morphological character defines che- 
moreceptor cilia: on the crustacean aesthetasc, olfactory 
cilia can have "significant" ciliary rootlets and motile cilia 
(Griinert and Ache, 1988). We used the activity-dependent 
labeling experiments to explore the possible function of the 
palp sensory cells. Although we designed the experiment to 
assay for cell activity in the presence or absence of chemical 
cues (amino acids), it is important to note that this method 
of labeling active sensory cells does not discriminate be- 
tween types of receptors. It simply identifies cells that have 
accumulated agmatine, regardless of the stimulus source. 
Thus, the labeled cells may include a variety of sensory cell 
types. The initial stimulation of a mechanoreceptor (i.e.. 
stretching or bending of the cell membrane or a protruding 
cilium) in at least one invertebrate (the crayfish) opens a 
stretch-activated ion channel that appears to be permeable to 
divalent cations (Edwards et ai. 1981). Chemoreceptor 
transduction proceeds similarly, with the binding of a ligand 
to the receptor in the membrane causing the activation and 
opening of ion channels. In both cases, such cation-perme- 
able channels should be permeable to agmatine, and there- 
fore both mechanoreceptors and chemoreceptors could be 
labeled using this technique. 

Spionid palps are probably equipped with mechanosen- 



. . 5. Ultrastructure of DipolyJuni iimulriluhiitii palp abfrontal 

cell and prostomial sensory cells. (A) Constrained by a muscle layer below. 
Ihis ahtrontal palp sensory cell projects laterally. Cilia (c) are readily 
distinguished from the microvilli (mv) of the cuticle; ciliary rootlets (cr) 
appear relatively short; scale = 0.5 /J.m. (B) Prostomial sensory cells have 
a similar structure, with cilia (c) projecting through the microvillar (mv) 
cuticle, numerous mitochondria (nit), and a bilobed nucleus (nu); scale = 
_ /urn. (C) Higher magnification of the same cell, showing apical mito- 
chondria (nit); scale = 0.7 /im. 



SPIONID PERIPHERAL SENSORY CELLS 
*, 



73 




Figure 6. Fluorescence of anti-acetylated a-tubulin in Dipol\dora qiiadrilnhata palps examined with 
confocal laser scanning microscopy reveals (A) palp nerves (pn), and cilia of the frontal food groove (scale bar 
40 juin) as well as (B) cilia of the abfrontal putative sensory tufts (st), their axons (ax), and their proximity to 
the palp nerves (pn); scale = 25 /AMI). 



sory cells. Many spionids (including D. i/uculrilobatd; T. 
Riordan, pers. obs.) switch from deposit feeding to suspen- 
sion feeding in the presence of higher flow rates (Taghon et 
al., 1980; Dauer et al. 1981). This switch is probably 
mediated by mechanosensory detection of flow rates. In 
addition, when suspension feeding, spionids collect sus- 
pended particles that directly intercept the palps. Cilia lining 
the edge of the frontal food groove (i.e., laterofrontal cilia) 
and inside the food groove (i.e., frontal cilia) move such 
particles toward the mouth (Dauer. 1984. 1985, 1987). and 
may be mechanosensitive. For example, the laterofrontal 
cilia of one spionid, Paraprionospio pinnatu, beat only 
when contacted by a suspended particle (Dauer, 1985). 
suggesting a mechanosensory influence on activity. 

The experiments we conducted did not explicitly isolate 
mechanical stimulation as a factor affecting cell labeling; 
thus we cannot make any conclusions about a possible 
mechanosensory function for the palp sensory cells. How- 
ever, the trend toward increased labeling of the laterofrontal 
and frontal cells in the flow-through controls (Fig. 8A) is 
intriguing, and the possibility that these cells function as 
mechanoreceptors should be further examined using elec- 
trophysiological approaches. It is also possible that the 
increased labeling in controls was due to the presence of 
agmatine, which itself is a potent chemical cue in zebrafish 
(Michel et til.. 1999). In the static trials, significantly more 
cells were labeled in the presence of amino acids and 
agmatine than in agmatine alone (Fig. 8B); increased label- 
ing was especially pronounced in the lateral and abfrontal 



cells. There was virtually no labeling in the agmatine con- 
trols. These results suggest that the lateral and abfrontal 
cells are chemosensory, although it is possible that the cells 
were stimulated by a response triggered elsewhere on the 
body. We believe that body movement was an unlikely 
stimulus, however, because the worms were quiescent dur- 
ing the static trials. 

If we accept that the lateral and abfrontal ciliated tufts are 
chemosensory. then the question arises whether the cells 
function as distance or contact chemoreceptors. When spio- 
nid polychaetes are deposit feeding, they typically probe the 
sediment surface with the distal portion of the palps (Dauer 
et al., 1981 ; Lindsay, pers. obs.), using the abfrontal surface 
to contact the sediment surface. Previously, we showed that 
D. (/uadrilobata increased active feeding, including sedi- 
ment probing, when presented with particle-bound amino 
acids and sugars (Riordan and Lindsay, 2002). Because a 
waterborne cue was minimal or nonexistent, we concluded 
that the palps mediated the response. In addition. Ferner and 
Jumars (1999) reported repeated "pore-water-sniffing" be- 
havior by Boccardia proboscidea in which the palps were 
raised into the water column, sank passively onto the sedi- 
ment, and then quickly returned to an upright position. 
Again, it was the abfrontal palp surface that contacted the 
sediment. Given such behaviors, we speculate that the ab- 
frontal cells act as contact chemoreceptors. Yet spionids 
also use their palps to "monitor" the water column (Dauer et 
til.. 1981; Ferner and Jumars, 1999), and the lateral and 



74 



S. M. LINDSAY ET AL 



Labeled 
laterofrontal cells 

Labeled I . 
frontal cell V 

* 



. 

,Vv 



*' 

ft 

n 



25 |Jtn 



Y '#'" - 

, :..- ' , 



Labeled 
abfrontal cell 






;* 






Labeled 
lateral cell 



\ 



B 






"Unlabeled 
abfrontal cell 



D 



Figure 7. Labeling of Dipolydnni qiuulrilobata palp cells by agmatine in the presence and absence of the 
amino acid mixture. (A) Semi-thin section from palp exposed to agmatine + amino acids showing labeled 
laterofrontal and frontal cells; scale = 25 ju,m. Inset shows the same cells at higher magnification; scale = 5 /xm. 
( B ) Semi-thin section from palp exposed to agmatine + amino acids showing labeled lateral cell; scale = 25 fj.ni. 
Inset shows the same cell at higher magnification; scale = 5 ;um. (C) Semi-thin section from palp exposed to 
agmatine + amino acids showing labeled abfrontal cell; scale = 25 /xm. Inset shows the same cell at higher 
magnification; scale = 5 /xm. (D) Semi-thin section from palp exposed to agmatine without amino acids 
(control), showing unlabeled ahfrontul cell and its cilia projecting from the cuticle; scale = 25 fxm. Inset shows 
the same cell at higher magnification; scale = 5 /xm. 



abfrontal sensory cells might also function as distance che- 
moreceptors. 

Among invertebrates, preliminary studies suggest that 
gustatory ("taste." or contact chemosensitive) and olfactory 
("smell," or distance chemosensitive) sensory neurons show 
a considerable amount of structural similarity (Dionne and 
Dubin, 1994). For example, two populations of sensory 
cells are distributed on the sensory tentacles of the nudi- 
branch Plicstilla sihoi>(ie. The intraepithelial sensory cells 
(contact or short-distance chemoreceptors) and subepithelial 
sensory cells (olfaction) have distinct spatial distributions, 
axonal organizations, and sensitivity to chemical cues, yet 
have very similar electrophysiological and pharmacological 
characteristics (Boudko ct til.. 1997, 1999). Our experi- 
ments with D. c/UMirilo/xitii demonstrate ihat the lateral and 
abfrontal sensory cells of the palps recogni/e both dissolved 



(i.e., lacking contact, this paper) and adsorbed (i.e., contact 
necessary. Riordan and Lindsay. 2002) cues. The initial 
ultrastructural information reveals no significant differences 
among the groups of palp sensory cells (laterofrontal, lat- 
eral, and abfrontal). Characteri/ation of the innervation pat- 
terns and immunoreactivity to serotonin and FMRFamide is 
ongoing. 

Conclusion 

Previous research established that selection of particles of 
certain sizes by spionid palps can he influenced by mucus 
adhesion strength and particle "stickiness" (Jumars et /.. 
19X2: Taghon. 19X2: Dauer. 1985). Qian and Chia (1997) 
have speculated about a possible sensory role the palps may 
play in selective feeding, and putative sensory structures 



SPIONID PERIPHERAL SENSORY CELLS 



75 



10 , FLOW 




1 I'- 


DCue 
D Control 






o 

o 6 

i 5 ' 

nj 3 

1 1 - 
0- 


I 


I 






a, 






1 





Frontal 


Laterofrontal Lateral and 




Abfrontal 



B 



STATIC 



E 2 ' 5 " 


U ^-'UC 

D Control 








o 
o 2 - 










Cells Labeled/ 

o -^ 
D bi -> bi 


r 




> 






" 















Frontal 



Laterofrontal 



Lateral and 
Abfrontal 



Figure 8. Number of cells per 100 /im of palp of Dipo/ydora quadri- 
lobata that were labeled by agmatine in the presence (cue) and absence 
(control) of the amino acid mixture. (A) Results from the flow experiment 
using 20 mM agmatine. Numerous sections were collected from each of 
four control individuals and five treatment (cue) individuals: medians are 
presented, and error bars indicate the 75th and 25th percentile values. ">" 
indicates the value of the mean. (B) Results from the static experiment 
using 40 mM agmatine. Numerous sections were collected from each of six 
control individuals and six treatment (cue) individuals; medians are pre- 
sented and error bars indicate the 75th and 25th percentile values. ": 
indicates the value of the mean. 



have been identified on the palps (Dauer. 1984, 1987, 1991. 
1997; Worsaee, 2001). but direct evidence linking sensory 
cells to selective behavior was lacking. This study presents 
the first physiological evidence that the peripheral sensory 
receptors on spionid polychaete palps detect chemical stim- 
uli that elicit a selective feeding response. The percentage of 
peripheral cells that were labeled in the presence of amino 
acids varied by cell type (3% to 14%). and was greatest for 
the cells located on the lateral and abfrontal surfaces of the 
palps. This rate of labeling is similar to that observed for 
olfactory neurons in spiny lobster aesthetascs (0.5% to 
4.6%, Steullet et ai, 2000). For spionid polychaetes, ultra- 
structural, positional, and now physiological evidence 
strongly suggests that the feeding palps are equipped with 
lateral and abfrontal sensory cells that function as chemo- 
receptors. Electrophysiological experiments will be re- 



quired to determine whether these cells and the laterofrontal 
cells might also function as mechanoreceptors. 

Acknowledgments 

We thank Kelly Edwards for his valuable technical as- 
sistance in the EM lab and Jennifer Jackson for her help 
collecting and sorting worms. Brad Galloway and Geoff 
Daniels of Leica Microsystems, Inc., assisted in obtaining 
the image shown in Figure 6A during the Analytical and 
Quantitative Light Microscopy course at the Marine Bio- 
logical Laboratory. May 2003. Robert Marc. University of 
Utah School of Medicine, kindly provided anti-agmatine 
antibody. Comments from Charles Derby and two anony- 
mous reviewers significantly improved the manuscript and 
we are grateful. TJR was supported in part by the Maine Sea 
Grant Program and the School of Marine Sciences at the 
University of Maine. This research was supported by NSF 
grants OCE-9973327 and OCE-0221229 to SML and by the 
Office of the Vice President for Research at the University 
of Maine. 

Literature Cited 

Albertsson, J., and K. Leonardsson. 2001. Deposit-feeding amphipods 
(Monoporeia affinis] reduce the recruitment of copepod nauplii from 
benthic resting eggs in the northern Baltic Sea. Mar. Biol. 138: 793- 
801. 

Aller, R. C. 1994. Bioturbation and remineralization of sedimentary 
organic matter: effects of redox oscillation. Chem. Geol. 114: 331-345. 

Boilly-Marer, Y. 1968. Sur le role chimiorecepteur des cirris parapodi- 
aux heteronereidiens de Plarynereis dumerilii Aud. et M. Edwards. 
C. R. Acad. Sci. fParis) Ser. D 266: 1538-1585. 

Boilly-Marer, Y. 1972. Etude ultrastructurale des cirres parapodiaux 
de Nereidiens atoques (Annelides. Polychetes). Z. Zellforsch. 131: 
309-327. 

Boilly-Marer, Y'. 1974. Etude experimental du comportement nuptiale 
de Platynereis dumerilii (Annelida, Polychaeta): chemorception. 
emission des produits genitaux. Mar. Biol. 24: 167-179. 

Boudko, D. Y., M. Switzer-Dunlap, and M. G. Hadfield. 1997. Mor- 
phology, electrophysiology and pharmacology of anterior sensory path- 
ways in the nudibranch mollusc. Phestilla sibogae. Soc. Neurosci. 
Abstr. 23: 1787. 

Boudko, D. Y., M. Switzer-Dunlap, and M. G. Hadfield. 1999. Cel- 
lular and subcellular structure of anterior sensory pathways in Phestilla 
sibogae (Gastropoda. Nudibrachia). J. Comp. Neural. 403: 39-52. 

Brenchley. G. A. 1981. Disturbance and community structure: an exper- 
imental study of bioturbation in marine soft-bottom environments. J. 
Mar. Res. 39: 767-790. 

Brey, T. 1991. The relative significance of biological and physical dis- 
turbance: an example from intertidal and subtidal sandy bottom com- 
munities. Esniar. Cod.tr. Shelf Sci. 33: 339-360. 

Cavanaugh, G. M. 1975. Formulae and Methods VI. The Marine Bio- 
logical Laboratory. Woods Hole, MA. 

Christensen, B., A. Vedel. and K. Kristensen. 2000. Carbon and nitro- 
gen fluxes in sediment inhabited by suspension-feeding (Nereis diver- 
\icnlor) and non-suspension-feeding (Nereis virens) polychaetes. Mar. 
Ecol. Prog. Ser. 192: 203-217. 

Dauer, D. M. 1984. Functional morphology and feeding behavior of 
Streblospio benedicti (Polychaeta: Spionidae). Pp. 418-429 in Pro- 
ceedings of the First International Polychaete Conference. Sydney, 



76 



S. M. LINDSAY ET AL. 



P. A. Mulchings, eel. The Linnean Sociely of New Soulh Wales. 
Sydney. 

Dauer, D. M. 1985. Functional morphology and feeding behavior of 
Paraprionospio pinnata (Polychaeia: Spionidae). Mar. Bioi 85: 143- 
151. 
Dauer, D. M. 1987. Systematic significance ol the morphology of spio- 

nid polychaete palps. Bull. Biol. Sue. Wash. 7: 41 15. 
Duller, D. M. 1991. Funclional morphology and feeding behavior of 
Polyilma commensalii (Polychaeia: Spionidae). Ophelia Snppl. 5: 
607-614. 
Dauer, D. M. 1997. Functional morphology and feeding behavior of 

Marenzelleria vii-idis (Polychaeia: Spionidae). Bull. Mai: Sci. 60: 512- 

516. 
Dauer, D. M., C. A. Maybury, and R. M. Ewing. 1981. Feeding 

behavior and general ecology of several spionid polychaeles from the 

Chesapeake Bay. J. v/>. Mar. Biol. Ecol. 54: 21-38. 
Dionne, V. E., and A. E. Dubin. 1994. Transduclion diversity in olfac- 

tion. ./. Exp. Biol. 194: 1-21. 
Dorsell, D. A., and R. Hyde. 1969. The hue structure of the compound 

sense organs on the cirri of Nereis i/ncrsicoloi: Z. Zellforsch. 97: 

512-527. 
Dwyer, T. M., D. J. Adams, and B. Hille. 1980. The permeability of the 

endplate channel to organic cations in frog muscle. J. Gen. Physiol. 75: 

469-492. 
Edwards, C., D. Otloson, B. Rydqvisl, and C. Swerup. 1981. The 

permeability of the transducer membrane of the crayfish stretch recep- 
tor to calcium and other divalent cations. Nenroscience 6: 1455-1460. 
Elmgren, R., S. Ankar, B. Marteleur, and G. Ejdung. 1986. Adult 

interference with postlarvae in soft-sediments: the Pon/opoieia-Ma- 

cuma example. Ecology 67: 827- 836. 
Emery, D. J. 1992. Fine structure of olfactory epithelia of gastropod 

molluscs. Micm.<:c. Res. Tech. 22: 307-324 
Ferner, M. C., and P. A. Jumars. 1999. Responses of deposit-feeding 

spionid polychaeles to dissohed chemical cues. J. Exp. Mar. Biol. 

Ecol. 236: 89-106. 
Fewou, J., and N. Dhainaut-Cnurtois. 1995. Research on polychaete 

annelid osmoregulatory peptide(s) by immunocytochemical and phys- 
iological approaches. Computer reconstruction of the brain and evi- 
dence for a role of angiotensin-like molecules in Nereis (Hcihsic) 

Jiversicolor OF Muller. Biol. Cell. 85: 21-33. 
Kindla), R. H., M. B. Trexlcr, and D. C. White. 1990. Response of a 

benthic microbial community to biotic disturbance. Mar. Ecol. Prog. 

Ser. 62: 135-148. 
Klach, E. C. 1992. Disturbance of benlhic infauna by sedimenl-rework- 

ing activities of the lugworm Areniiola marina. Nelli. J. Sen Rrv 30: 

81-89. 
Forbes, V. E., and G. R. Lopez. 1986. Changes in feeding and crawling 

rates ot Hydrohia irnnenia (Prosohranchia: Hydrohndael in response to 

sedimentary chlorophyll-a and recently egcsicd sediment. Mai: Ecol. 

Prog. Ser. 33: 287-244. 
Grossman, S., and \V. Reichardl. 1991. Impact ofArenicola marina on 

bacteria in intcrlidal sediments Mar l,nl Prog. Sei: 77: 85-93. 
Griinert. V., and B. W. Ache. 1988. infrastructure of the acsthctasc 

(ollador) I sensilla ol ihe spun lohsici. Punulinis ttigiis. Cell Tissue 

AYs 251: 'is HIV 
(.nntlii i C.-P. 1992. Dispersal of mtcrlidal inverlehralcs: a slralegy to 

react to disturbances ol different scales'" Nelli I Sen AV\. 30: 45-56. 
Mines, A. II., M. II. Pose), and P. .1. lladdon. 1989. Cllccls ol adnll 

suspension and dcpoMi lecdim 1 hiuilvcs on recruitment ol csluaiine 

mlauna. Veligci 32: 10') I I') 
Jelsiiig, J. 2002. I'lliasiiiiclinal investigations on llic cephalic .ind 

mi-lameiic nuchal oigans ol .S/.;,- , I /,/ ,,*, ( I'oKchacla. Spionidae). 

/oomoipliologv 121: 213 220 
Jouin, (.,C. TdicrninoU/eff. M. I . Handier, and A. Tonlniond. 1985. 

Fine slinctiiic ol probable mechano- and clicinoicceplors in the caudal 



epidermis of the lugworm Arenieolu marina (Annelida. Polychaetal 
Zoomorphology 105: 76-82. 

Jumars, P. A. 1993. Gourmands of mud: diet selection in marine deposit 
feeders. Pp. 124-156 in Diet Selection: An Interilisciplinan- Approai It 
lo Foraging Behaviour. R. N. Hughes, ed. Blackwell Scientific Publi- 
cations. Oxford. 

Jumars, P. A., R. F. L. Sell, and A. R. M. Nowell. 1982. Mechanics of 
particle selection by tentaculate deposit feeders. ./. Exp. Mar. Biol. 
Ecol. 64: 47-70. 

Karrh, R. R., and D. C. Miller. 1994. Functional response of a surface- 
deposit feeder, Saccoglossus kowalevskii. Linmol. Oceanogr. 39: 
1455-1464. 

Kihslinger. R. L., and S. A. Woodin. 2000. Food patches and a surface 
deposit feeding spionid polychaete. Mar. Ecol. Prog. Ser. 201: 233- 
239. 

Laverack, M. S. 1968. On the receptors of marine invertebrates. Oeeun- 
ogr. Mai: Biol. Anna. Ke\: 6: 249-324. 

Lopez, G. R., and J. S. Levinton. 1987. Ecology of deposit-feeding 
animals in marine sediments. Q. Rev. Biol. 62: 235-260. 

Luckenbach, M. W. 1987. Effects of adult infauna on new recruits: 
implications for the role of biogenic refuges. J. Exp. Mai: Biol. Ecol. 
105: 197-206. 

Marc, R. E. 1995. Visualization of glulamale-galed channel permeation: 
high resolution mapping of neuronal subpopulations. Soc. Neurasci. 
Ahsn: 21: 781-786. 

Marc, R. E. 1999a. Kainate activation of horizontal, bipolar, amacrine, 
and ganglion cells in the rabbit retina. ./. Coinp. Neurol. 407: 65-76. 

Marc, R. E. 1999b. Mapping glutamatergic drive in the vertebrate retina 
with a channel-permeant organic cation. ./. Comp. Neurol. 407: 47-64. 

Marinelli, R. L. 1992. Effects of polychaeles on silicate dynamics and 
fluxes in sediments: importance of species, animal activity and 
polychaete effects on benthic diatoms. ./. Mar. Res. 50: 745-779. 

Mayer, L. M., Z. Chen, R. H. Findlay. R. H. Fang, S. Sampson, R. F. L. 
Self, P. A. Jumars, C. Quetel, and O. F. X. Donard. 1996. Bio 
availability of sedimentary contaminants subject lo deposit-feeder in- 
gestion. Environ. Sci. Technol 30: 2641-2645. 

Michel, W. C., P. Steullel, H. S. Gate, C. J. Burns, A. B. Zhainazarnv. 
and C. D. Derby. 1999. High-resolution functional labeling of ver- 
tebrate and invertebrate olfactory receptor neurons using agmatme. a 
channel-permeant cation. ./. Nenrosci. Metli. 90: 143-156. 

Mileikovsky, S. A. 1974. On predation of pelagic larvae and early 
juveniles of marine bottom invertebrates by adult benthic invertebrates 
and their passing alive through then predators. \hu. liiol. 26: 303-3 1 1 . 

Miller, I). I'., and P. A. .liiniars. 1986. Pellet accumulation, sediment 
supply, and clouding as determinants of surface deposit-feeding rate in 
Pseudopolydora kempi japonica Imajima and Hartman (PoKchaeta: 
Spionidae). ./. Exp. M.a Iliol. Ecol. 99: 1-17. 

Nillrouer, C'. A., and R. \V. Sternherg. 1981. The formation of sedi- 
menlai) strata in an allochlhonous shell environment: the \\aslnnglon 
continental shell Mai: (icol 42: 201 232. 

Nozais, C., .1. C. Duchene. and M. Bliaiul. 1997. Control of posinon in 
the water column by the larvae ot I'oci ilocliaetics \,-r/ien.\ (PoKchaeta): 
the importance of mucus secretion. ./. E\p. Mar. liiol. Ecol 210: 
')] 106. 

Olal'sson, E. B. 1989. Contrasting influences ot suspension-feeding and 
deposit-feeding populations ol .\lucoina haltliica on mlaunal recruit- 
ment M,n- Ecol. Prog. Ser. 55: 171-179. 

Picco, C., and A. Menini. 1993. Ihe peimeahilily of the cCIMP-.icti- 
valcd channel to organic cations in retinal rods of the tiger salamander. 
./. Pln-siol. 460: 741-758. 

Plante, C. J., and L. M. M:i\er. 1994. Distnlnition and eflicienc) of 
baclenoKsis in the gut ol Arcnicola marina and three additional 
deposit leeders Mai Ecol Piog. Ser. 109: 193 !')-) 
Pose). M. II. l')8(>. Changes in a benlhic community associated with 



SPIONID PERIPHERAL SENSORY CELLS 



77 



dense beds of a burrowing deposit feeder. Calliumisaa californiensis. 
Mar. Ecol. Prog. Ser. 31: 15-22. 

Purschke, G. 1997. Ultrastructure of nuchal organs in polychaetes (An- 
nelida) new results and review. Acta Zool. 78: 123-143. 

Qian, P., and F. Chia. 1997. Structure of feeding palps and feeding 
behavior of the spionid polychaete Polydora polybranchia. Bull. Mar. 
Sci. 60: 502-5 1 1 . 

Rhoads, D. C., and D. K. Young. 1970. The influence of deposit- 
feeding organisms on sediment stability and community trophic struc- 
ture. J. Mai: Res. 28: 150-174. 

Rhode, B. 1990. Ultrastructure of nuchal organs in some marine 
polychaetes. J. Morphot. 206: 95-107. 

Riordan, T. J., Jr., and S. M. Lindsay. 2002. Feeding responses in 
particle-bound cues by a deposit-feeding spionid polychaete. Dipolv- 
ilora quadrilobata (Jacobi 1883). J. E\p. Mar. Biol. Ecol. 277: 79-95. 

Rittschof, D., and C. U. Buswell. 1989. Stimulation of feeding behavior 
in three species of tiddler crabs by hexose sugars. Chem. Sensc\ 14: 
121-130. 

Robertson, J. R., K. Bancroft, G. Vermeer, and K. Plaisier. 1980. 
Experimental studies on the foraging behavior of the sand tiddler crab 
Uca pugilutor (Emc 1X02). ./. E\p. Mar. Biol. Ecol. 44: 67-X3. 

Robertson, J. R., J. A. Fudge, and G. K. Vermeer. 1981. Chemical and 
live feeding stimulants of the sand fiddler crab Uca pugilatar (Bosc). J. 
Exp. Mar. Biol. Ecol. 53: 47-64. 

Rullier, F. 1951. Etude morphologique, histologique. et physiologique 
de 1'organe nuchal chez annelids polychaetes sedentaires. Ann. lust. 
Oceanogr. Monaco 25: 207-341. 

Schlotzer-Schrehardt, LI. 1987. Ultrastructural investigations of the nu- 
chal organs of Pygospio elegans (Polychaeta). II. Adult nuchal and 
dorsal organs. Zoomorphology 107: 169-179. 

Shull, D. H. 2001. Transition-matrix model of bioturbation and radionu- 
clide diagenesis. Limnol. Oceanogr. 46: 905-916. 

Steullet, P., H. S. Gate, W. C. Michel, and C. D. Derby. 2000. Func- 
tional units of a compound nose: aesthetasc sensilla house similar 
populations of olfactory receptor neurons on the crustacean antennule. 
J. Comp. Neural. 418: 270-280. 

Storch, V., and U. Schlotzer-Schrehardt. 1988. Sensory structures. Pp. 
121-133 in The Ultrastructure of Polvchaeta. Microfauna Miiiina, 
Vol. 4. W. Westheide, and C. O. Hermans, eds. Gustav Fischer Verlag, 
New York. 

Suchanek, T. H. 1983. Control of seagrass communities and sediment 
distribution by Callianassa (Crustacea, Thalassinidea) bioturbation. / 
Mar. Res. 41: 281-298. 

Taghon, G. L. 1982. Optimal foraging by deposit-feeding invertebrates: 
roles of particle size and organic coating. Oecologia 52: 295-304. 



Taghon, G. L.. A. R. M. Nowell, and P. A. Jumars. 1980. Induction of 
suspension feeding in spionid polychaetes by high particle fluxes. 
Science 210: 562-564. 

Tamaki, A. 1985. inhibition of larval recruitment of Armandia sp. 
(Polychaeta: Opheliidae) by established adults of Pseudopolydora 
paucibranchiata (Okuda) (Polychaeta: Spionidae) on an intertidal sand 
flat. J. E\/>. Mar. Biol. Ecol. 87: 67- 82. 

Weissburg, M. J. 1993. Sex and the single forager: gender-specific 
energy maximizing strategies in the fiddler crab Uca pugnax. Ecology 
74: 279-291. 

Weissburg, M. ,). 1999. Sex-specific tuning and dose-response functions 
in male fiddler crabs. Uca pugnax. J. Comp. Physiol. A. 353: 787-804. 

Weissburg, M. J. 2001. Sex. sensitivity, and second messengers: differ- 
ential effect of cyclic nucleotide mediated inhibition in the chemosen- 
sory system of fiddler crabs. J. Comp. Physiol. A 187: 489-498. 

Weissburg, M. J., and C. D. Derby. 1995. Regulation of sex-specific 
behavior in fiddler crabs: physiological properties of chemoreceptor 
neurons in claws and legs of males and females. J. Comp. Physiol. A 
176: 513-526. 

Weissburg, M. J., and R. K. Zimmer-Faust. 1991. Ontogeny versus 
phylogeny in determining patterns of chemoreception: initial studies 
with fiddler crabs. Biol. Bull. 181: 205-215. 

Weissburg, M. J., J. Pearce, C. K. Govind, and C. D. Derby. 1996. 
Sexually dimorphic patterns of neural organization in the feeding 
appendages of fiddler crabs. Cell Tissue Res. 286: 155-166. 

Weston, D. P., D. L. Penry, and L. K. Gulmann. 2000. The role of 
ingestion as a route of contaminant bioaccumulation in a deposit- 
feeding polychaete. Arch. Environ. Contain. Toxicol. 38: 446-454. 

Widbom, B., and J. B. Frithsen. 1995. Structuring factors in a marine 
soft-bottom community during eutrophication an experiment with 
radio-labeled phytodetritus. Oecologia 101: 156-168. 

Williams, J. G. 1980. The influence of adults on settlement of spat of the 
clam. Tapes japonica, J. Mar. Res. 38: 729-741. 

Wilson, W. H., Jr. 1980. A laboratory investigation of the effect of a 
terebellid polychaete on the survivorship of Nereid polychaete larvae. 
J. Exp. Mar. Biol. Ecol. 46: 73-80. 

Wilson, W. H., Jr. 1981. Sediment-mediated interactions in a densely 
populated infaunul assemblage: the effects of the polychaete Abareni- 
cola pacifica. J. Mar. Res. 39: 735-748. 

Woodin, S. A. 1976. Adult-larval interactions in dense infaunal assem- 
blages: patterns of abundance. J. Mar. Res. 34: 25-41. 

Worsaae. K. 2001. The systematic significance of palp morphology in 
the Pnlydora complex (Polychaeta: Spionidae). Zool. Anz. 240: 47-59. 

Yoshikami, D. 1981. Transmitter sensitivity of neurons assayed by au- 
toradiography. Science. 212: 929-930. 



Reference: Biol. Bull. 206: 7S-86. (April 2004) 
2004 Marine Biological Laboratory 



Physiological Development of the Embryonic and 
Larval Crayfish Heart 



S. L. HARPER 1 AND C. L. REIBER- :i 

1 U.S. Environmental Protection Agency, Environmental Sciences Division/ORD. P.O. Bo.\ 93478, 

Las Vegas, Nevada 89193-3478: and ' Department of Biology, 4505 Maryland Parfovay, 

Box 454004, University of Nevada, Las Vegas, Nevada 89154-4004 



Abstract. The cardiovascular system is the first system to 
become functional in a developing animal and must perform 
key physiological functions even as it develops and grows. 
The ontogeny of cardiac physiology was studied throughout 
embryonic and larval developmental stages in the red 
swamp crayfish Procambarus clarkii using videomicro- 
scopic dimensional analysis. The heart begins to contract by 
day 13 of development (at 25 C, 20 kPa O 2 ). Cardiac 
output is primarily regulated by changes in heart rate be- 
cause stroke volume remains relatively constant throughout 
embryogenesis. Prior to eclosion, heart rate and cardiac 
output decreased significantly. Previous data suggest that 
the decrease in cardiac parameters prior to hatching may be 
due to an oxygen limitation to the embryo. Throughout 
development, metabolizing mass and embryonic oxygen 
consumption increased, while egg surface area remained 
constant. The surface area of the egg membrane is a con- 
straint on gas exchange; this limitation, in combination with 
the increasing oxygen demand of the embryo, results in an 
inadequate diffusive supply of oxygen to developing tis- 
sues. To determine if the decrease in cardiac function was 
the result of an internal hypoxia experienced during late 
embryonic development, early and late-stage embryos were 
exposed to hyperoxic water (Pn 2 = 40 kPa O 2 ). Heart rate 
in late-stage embryos exposed to hyperoxic water increased 
significantly over control values, which suggests that the 
suppression in cardiac function observed in late-stage em- 
bryos is due to a limited oxygen supply. 



Received 22 October 2001: accepted i K'bmaix 20114 
* To whom correspondence should lie addressed I. mail: Reiberfri' 
ccinail.nevada.edu 



Introduction 

Crustaceans exhibit a diverse array of metabolic and 
physiological responses to aquatic hypoxia (Reiber. 1995). 
Typically, hypoxic exposure results in a decreased heart rate 
(bradycardia) in decapod crustaceans (McMahon and Bur- 
nett. 1990; Wilkens, 1993; McGaw et ai. 1994; Reiber, 
1995; Reiber and McMahon, 1998). This hypoxia-induced 
bradycardia has been well documented in adult red swamp 
crayfish (Procamhants clarkii} (Reiber, 1995. 1997; Chap- 
man and Reiber. 1998; Reiber and McMahon, 1998). How- 
ever, an examination of heart rate alone does not provide a 
complete picture of cardiac performance. Cardiac output 
and stroke volume are broader measures of cardiac perfor- 
mance that can vary over wide ranges with little or no 
variation in heart rate (Orlando and Finder. 1995). Further- 
more, heart rate and stroke volume can vary independently 
of each other in decapods (McMahon and Burnett. 1990). 
Therefore, the cardiovascular response of decapods to a 
given perturbation can be understood only by evaluating 
heart rate, stroke volume, and cardiac output rather than just 
heart rate. 

Cardiac performance in adult red swamp crayfish is al- 
tered when the animals are exposed to levels of oxygen 
below the critical level needed to maintain aerobic metab- 
olism (P rRII ) (approximately 5 kPa O 2 at 25 C) (Reiber, 
1995). Reiber ( 1995) found a decrease in heart rate and an 
increase in stroke volume in adult red swamp crayfish 
exposed to hypoxic conditions. The increase in stroke vol- 
ume and maintenance of cardiac output is likely due to 
increased pericardia! sinus pressure coupled with increased 
filling pressure, an increase in diastolic filling time, and an 
increased end diastolic volume (Reiber, 1995). 

Information on cardiac function and hypoxic responses in 
embryonic and larval crustaceans is limited (Spicer, 1994; 



7S 



CRAYFISH HEART PHYSIOLOGICAL DEVELOPMENT 



79 



Spicer and Morritt, 1996: Reiber, 1997). Cardiac functions 
in embryos and larvae can be quite different from those of 
adults because centers of metabolic activity shift during 
development (Reiber. 1997). Additionally, embryonic cray- 
fish cannot escape hypoxic waters: the embryos are attached 
to the female's pleopods. and the brooding female typically 
remains sequestered within the burrow where the water can 
become oxygen-depleted due to both crayfish and microbial 
respiration (Payette and McGaw. 2003). To survive, the 
embryonic and larval crayfish must possess physiological 
mechanisms for dealing with hypoxia, and these may differ 
from adult responses. Fluid convection on either side of the 
egg membrane would allow for greater oxygen extraction 
from the environment by eliminating boundary layers and 
maintaining a diffusional gradient. The embryo itself does 
not move around within the egg to aid convective processes, 
so cardiac development is critical to embryonic viability 
because it provides the only source of internal convection to 
facilitate gas movement within the egg (Seymour and Brad- 
ford, 1995). 

In late-stage crayfish embryos, E-Stage XVI, cardiac ac- 
tivity is not significantly responsive to hypoxic exposure, 
whereas in E-Stage XIV, the heart rate decreases signifi- 
cantly when water Po 2 is dropped to 5 kPa (an adult-like 
response) (Reiber, 1995; refer to table 1 for staging). Reiber 
(1995) attributed the lack of response in the late-stage 
embryos to the possibility that they are already internally 
hypoxic (experiencing levels of oxygen below their meta- 
bolic demands). This hypothesis was supported by the find- 
ing that the heart rates for animals at E-Stage XVI were the 
same as those for E-Stage XIV embryos during hypoxic 
exposure (2 kPa) (Reiber. 1995). 

The current study evaluates cardiac physiology and met- 
abolic function throughout early development of the red 
swamp crayfish. To determine whether embryos are expe- 
riencing an internal hypoxia just prior to hatching, oxygen 
consumption was measured along with metabolizing mass 
and exchange surface area throughout development. Subse- 
quently, early and late-stage embryos were exposed to 
acutely hyperoxic conditions. It was expected that cardiac 
function in late stage embryos would be impaired due to an 
internal hypoxia caused by an increase in metabolizing mass 
and the limits in the surface area for gas exchange. Such 
physiological cardiovascular impairment would result in a 
decrease in cardiac parameters that would be alleviated by 
exposure to hyperoxic water. 

Materials and Methods 

Cravftsh breeding 

Adult male and female crayfish (Procambams cUirkii 
[Girard, 1852) were purchased from the Atchafalaya Bio- 
logical Supply Co., Inc. Animals were maintained in the 
laboratory in 35-1 aquaria (5-6 animals to an aquarium) 



filled with dechlorinated tap water (25 C, pH = 7.0. 
conductivity == 150-300 jitS) and fed twice a week (ro- 
maine lettuce and liver). Mature females were separated 
from other animals and placed into individual 2-1 containers 
(25 C and 10: 14 dark/light cycle), where they were held for 
3-4 days, after which a sexually mature male was placed in 
the container and the pair was observed for mating behavior. 
If mating did not ensue within 20 min. the male was 
replaced with another male and again observed for copula- 
tory behavior. If copulation occurred, the animals were left 
together for 5 h and then separated to prevent cannibalism. 
After mating, females were placed into a nursery aquarium 
(25 C) and observed daily until eggs were laid. 

Experimental apparatus 

Crayfish embryos or larvae were removed from females, 
staged according to Harper and Reiber (2001). and then 
attached to an applicator stick using cyanoacrylate gel glue. 
A minimal amount of gel glue was applied to the flattened 
end of the applicator stick and pressed against the egg or 
larva. Care was taken to minimize obstruction of the egg's 
respiratory surface area yet provide a firm holdfast for 
attachment. Animals were then placed into a flow-through 
experimental chamber (Harper and Reiber. 1999) where 
they were held for 30 min. Larval crayfish were not ob- 
served to struggle or show swimming behaviors during the 
experimental period. Water (25 C, pH == 7.0, Po^ = 20 
kPa) was pumped ( 12 ml min~') through the experimental 
chamber and then over a Clark-type polarographic oxygen 
electrode to determine Po 2 . The Po 2 and temperature of the 
reservoir water were established and maintained using a gas 
mixing system (Cameron Instrument Company. GF-3/MP) 
and a circulating water bath (VWR Scientific. 1160). 
Changes in heart shape were monitored using a microscope 
(Leica MZ 12.5) equipped with a video camera (Mintron, 
05-70D), super VMS video recording system (Panasonic, 
PV-4661), and Horita time code generator (VG-50). 

Ontogeny of heart rate, stroke volume, and cardiac oiit/uit 

Seven crayfish from each of seven developmental stages 
were used: embryonic stages E-Stage XIII, E-Stage XIV, 
E-Stage XV. and E-Stage XVI, and larval stages L-Stage I. 
L-Stage II. and L-Stage III (see Reiber. 1995: and Reiber 
and Harper, 2001. for details on the correlation between 
days of development at 25 C and developmental stage for 
these stages). Heart rate and stroke volume were obtained 
using frame-by-frame (60 Hz sampling speed) analysis of 
the videotape on an editing tape player (Panasonic, AG- 
DS550). Heart rate for each animal is presented as the mean 
number of beats per minute calculated from three 30-s 
intervals. To determine cardiac volumes (end diastolic vol- 
ume and end systolic volume), embryonic and larval cray- 
fish hearts were modeled as a prolate spheroid (cardiac 



80 



S. L. HARPER AND C. L. REIBER 



volume = 4/3 mib~), where u and b are half of the mea- 
sured long and short axes of the heart, respectively (Keller 
etui, 1991, 1994;Tabere?fl/., 1992; Schwerte and Pelster, 
2000; and Harper and Reiber, 2001). In early embryos 
(Stage XIII). the length of both the long and short axes of 
the heart were averaged over a minimum of 10 cardiac 
cycles to account for peristaltic-like contractions when the 
heartbeat is initiated. The geometric equation used to model 
the heart takes into account cardiac growth with develop- 
ment (i.e., the increasing length and width of the heart as 
measured within each developmental stage). In later devel- 
opmental stages (embryonic and larval) the heart remains a 
prolate spheroid; it changes only in its ratio of length to 
width. The equation for a prolate spheroid can be applied 
even if the changes are somewhat disproportional (i.e., a 
longer thinner prolate spheroid models mathematically the 
same as a shorter thicker prolate spheroid). The basic ge- 
ometry of the heart remains the same throughout develop- 
ment, with changes occurring primarily in the long and short 
axes. Stroke volume was calculated from the difference 
between end diastolic volume (EDV) and end systolic vol- 
ume (ESV). Cardiac output was calculated as the product of 
stroke volume and heart rate. Heart rate, stroke volume, and 
cardiac output were determined for each developmental 
stage. 



Ox\gen consumption 

Closed-system respirometry was used to determine em- 
bryonic oxygen consumption. Six animals were placed in a 
50-ml syringe filled with aerated water and placed on an 
oscillating plate at 25 C. A 5-ml water sample was injected 
into a chamber holding a Clark-type polarographic oxygen 
electrode after 30, 60, and 90 min. Three replicates were run 
for each of the following stages: E-Stage II. E-Stage XIII. 
E-Stage XV, E-Stage XVI, L-Stage I, and L-Stage III. Two 
syringes lacking animals were run to account for bacterial 
respiration, which was found to be negligible. Fluid volume 
and water Po 2 in the experimental chamber were decreased 
by a total of 15 ml and 6.6 kPa O-, (minimum) over the 
90-min course of the experiments. This change in volume 
was adjusted for when calculating oxygen consumption. 
Rates of oxygen consumption over the experimental period 
were consistent, indicating that the small reduction in oxy- 
gen availability did not adversely affect the animals. Mass- 
specific oxygen consumption is reported as microliters of 
O 2 per milligram (\\el mass) per hour. Oxygen consumption 
rate was calculated according to the formula Vo-, = (V, X 
A/\vr>2 x /3\v<>2^A' x W; where Vo 2 is oxygen consump- 
tion. V, is the volume of water in the respirometer, AP wrP 
is the change in water /'<>_,. J3 W02 is the capacitance of 
oxygen in water. A? is the duration in minutes, and W is the 
wet weight of the animal. 



Lipid and metabolizing mass 

Embryonic crayfish were collected from gravid females 
at E-Stage II. E-Stage XIII. E-Stage XV, and E-Stage XVI, 
and larval crayfish were collected at L-Stage I and L-Stage 
III. Egg diameter and larval length were measured (n = 7 
per stage). Egg surface area was calculated using the for- 
mula for a sphere (surface area (mm 2 ) == 4-nr 2 ). Surface 
area was calculated only for embryos. Each embryo and 
larva was dried with a Kimwipe for 10 s prior to weighing 
and placed on a clean, preweighed coverslip. To determine 
the metabolically active mass (tissue) of the embryo or 
larva, the nonmetabolic (lipid) portion of the body was first 
removed by puncturing the wall of the animal and isolating 
the lipid onto the coverslip. The lipid-free animal was then 
weighed. The egg membrane and exoskeleton were not 
separated from the active metabolizing mass but were as- 
sumed to contribute little to mass error because they con- 
stitute only a small proportion of overall mass. Furthermore, 
errors in this estimate were likely similar among stages of 
development. Non-lipid mass was calculated as the differ- 
ence in animal mass before and after removal of lipids. 

H\peroxic exposure 

Animals at E-Stage XIV (n -- 13) and E-Stage XVI 
(n = 13) were held individually under experimental cham- 
ber conditions for 30 min followed by heart rate measure- 
ments to determine control values. Control and experimen- 
tal Po 2 values were established and maintained using a gas 
mixing system (Cameron Instrument Company, GF-3/MP). 
Embryos were exposed to normoxic (20 kPa O 2 ) and hy- 
peroxic (40 kPa O 2 ) water for 30 min. Heart rate was 
determined as previously described for both control and 
experimental conditions at E-Stage XIV and E-Stage XVI. 

Statistical analysis 

Means and standard errors were calculated for each stage 
(n = 7) for data on egg surface area, lipid mass, metabo- 
lizing mass, and oxygen consumption rate. An analysis of 
variance was used to determine overall effects of develop- 
ment on the dependent variables (SigmaStat. ver. 2.03). A 
Bonferroni /-test was used for pairwise multiple compari- 
sons where a significance of P ^ 0.05 was found. Lipid/ 
metabolizing mass ratios failed normality tests, thus an 
analysis of variance based on ranks and a Tukey test were 
used. Baseline cardiac parameters were established by pool- 
ing values obtained for each stage (n = 7) and calculating 
a mean and standard error. The effects of developmental 
stage on cardiac parameters were assessed using a one-way 
analysis of variance (SigmaStat. ver. 2.03). Where develop- 
mental effects were shown to be significant (P < 0.05), 
group means were compared using the Newman-Keuls mul- 
tiple range test. A Student's /-test was used to compare 



CRAYFISH HEART PHYSIOLOGICAL DEVELOPMENT 



81 



embryonic response to normoxic and hyperoxic exposure 
with significance at the level of P = 0.05. Embryos within 
a developmental stage (n = 13) were used for comparison. 

Results 

Ontogeny of heart rate, stroke volume, anil cardiac output 

Uncoordinated cardiac contractions began in embryonic 
crayfish by E-Stage XIII of development, with a mean heart 
rate of 160 3 (SEM) beats min~ ' (bpm). At the onset of 
cardiac contractions heart rate was irregular, characterized 
by short bursts of activity (e.g., 300 bpm), very long peri- 
staltic-like contractions (e.g., 48 bpm). and intermittent 
periods of cardiac arrest (maximum of 11 s). Therefore, 
heart rate was determined by averaging over the six 30-s 
time periods. Heart rate varied significantly with develop- 
ment (P = 0.05, F -- 7.29). Mean heart rate remained 
unchanged (163 2 bpm) through E-Stage XIV, after 
which it increased significantly (P = 0.05, F = 3.64) to 
192 6 bpm at E-Stage XV. At E-Stage XVI. heart rate 
decreased significantly (P = 0.05, F = 3.01 ) to 149 3 
bpm and remained at this rate until eclosion. Upon hatching, 
heart rate increased significantly (P = 0.05, F = 5. 1 I ) to 
255 9 bpm and remained at this level through all three 
larval stages (Fig. la). 

Both stroke volume and cardiac output showed little 
variation throughout embryonic development (Fig. Ib, c). 
However, after hatching (L-Stage I), stroke volume in- 
creased significantly (P = 0.05, F = 42.17) from 3.8 
0.9 (SEM) nl/beat to 12.4 1.8 nl/beat. and cardiac output 
increased significantly (P == 0.05. F - 281.55) from 
178 96 (SEM) nl min~' pre-hatching (E-Stage XVI) to 
3130 46 nl min~' at the first larval stage. Stroke volume 
decreased significantly (P < 0.001. F = 21.64) from the 
first larval stage ( 1 2.4 1 .8 nl beat" ' ) to the second larval 
stage (6.07 1.9 nl beat" 1 ), with no significant change 
occurring from the second to third larval stages. During 
larval development, cardiac output followed stroke volume, 
decreasing significantly (P = 0.05, F = 77. 1 7) at L-Stage 
II and then remaining stable into L-Stage III (1660 43 to 
1747 47 nl inin"'). 

The effects of cardiac differentiation and elongation on 
the ontogeny of cardiac physiology can be assessed using 
the data relating the length and width of the heart at end 
diastole to days of development (Fig. 2). The pattern of 
cardiac development reveals that the heart grows in length 
from 8.3 0.3 (SEM) to 1 1.0 0.4 ju,m (32.5% increase) 
as compared to width from 5.9 0.2 (SEM) to 8.4 0.3 
/urn (42.4% increase), through embryonic development. 
There is a greater absolute increase in the length as opposed 
to the width of the heart during development, which results 
in a dramatic increase in the length-to-width ratio after 
eclosion. 




XIII 



XV 



XVI 



Embryonic Development 
(E-Stage) 



III 



Larval Development 

(L-Stage) 



Developmental Stage 

Figure 1. Ontogeny of (a) heart rate, (b) stroke volume, and (c) cardiac 
output in the red swamp crayfish Procambarus clarkii. * indicates signif- 
icant difference from the previous stage at the level of P = 0.05. Shaded 
area indicates when hatching occurs. Values are shown as means 
standard error, n a 7 at each stage. Embryonic and larval stages corre- 
spond to the following days of development at 25 C: E-Stage XIII = 
12-14 days. E-Stage XIV = 14-17 days, E-Stage XV = 17-19 days, 
E-Stage XVI = 19-21 days. L-Stage I = 21-23 days, L-Stage II = 23-25 
days, and L-Stage III = 25-27 days. 

Oxygen consumption 

Oxygen consumption increased significantly between E- 
Stage IV (4.03 0.50 (SEM) /nl O, mg~' h~') and 
E-Stage XIII (7 1.33 5.19 jul O 2 mg~ ] -h -1 )(P = 0.05. 
t -- 4.05) and between E-Stage XIII and E-Stage XV 
(148.14 13.61 /nlO 2 -mg~' -h~ ')(/> = 0.05, t = 5.21) 
(Fig. 3). Just before hatching, E-Stage XVI, metabolic ox- 
ygen consumption did not increase significantly from the 
previous stage. Larval stages showed a significant increase 
in oxygen consumption (L-Stage I, P < 0.001, t = 7.597 
and L-Stage III, P < 0.001, t = 16.953). 



Lipid/metabolizing mass 

Embryo diameter (used to calculate membrane area) did 
not change significantly through embryonic development. 



82 



S. L. HARPER AND C. L. REIBER 



length 




XIII 



XIV 



XV 



XVI 



Embryonic Development 
(E-Stage) 



I II III 

Larval Development 
(L-Stage) 



Developmental Stage 

Figure 2. Length and width measurements of the heart with develop- 
ment. Solid circles represent length, open circles represent width, and solid 
squares represent length/width ratio. * indicates significant difference from 
the previous stage at the level of P = 0.05. Values are shown as means 
standard error, n a 7 at each stage. Error bars fall within symbols. See 
legend to Figure 1 for correspondence between stage and length of devel- 
opment. 



After eclosion, larval length increased significantly from the 
first (2.61 0.03 (SEM) mm) to the third larval instar 
(3.38 0.02 mm) (P = 0.001, / == 5.61) (Fig. 4a). 
Calculated surface area of the egg membrane decreased 
significantly just prior to eclosion (P = 0.05, t = 3.17) 
(Fig. 4b). Animal mass also decreased significantly just 




XIII 

Embryonic Development 
(E-Stage) 



XV 



XVI I III 

Larval Development 
(L-Stage) 



Developmental Stage 

Figure 3. Oxygen consumption for embryonic and larval crayfish. 
* indicates significant dilierence from the previous stage at the level of 
P = 0.05. Shaded area indicates when hatching occurs. Values are shown 
as means slaiulaul error, n : 1 at each stage. Embryonic and larval 
stages correspond to (he lolloping days of development at 25 C: E-Stage 
II = 2-4 days. E-Stage XIII - 12-14 Jays. E-Stage XV = 17-19 days, 
E-Stage XVI = 19-21 days. L-Stage I = 21-23 days, and L-Stage III = 
25-27 days. 



fr 

I 




5.0 



O 4.0 
t 






-t- 



H I r- 



E 

3.0 



C 

u 

2.5 - 



XIII XV XVI I III 

Developmental Stage 

Figure 4. (a) Diameter of embryo or length of larval crayfish at various 
stages throughout development, (b) Surface area calculated from diameter 
measurements on embryonic crayfish. Surface area measurements not 
applicable to larvae, (c) Mass of developing crayfish. * indicates significant 
difference from the previous stage at the level of P = 0.05. Shaded area 
indicates when hatching occurs. Values are shown as means standard 
error, n a 7 at each stage. See Figure 3 for correspondence between stage 
and length of development. 



prior to hatching (4.31 0.07 (SEM) mg to 3.78 0.10 
mg) (P < 0.001, / = 4.65) but increased significantly by 
the first larval stage (3.78 0.10 mg to 4.95 0.03 mg) 
(P < 0.001. / = 10.31) (Fig. 40. 

Lipid content of the egg decreased significantly from 
E-Stage XIII (2.41 0.06 (SEM) mg) to E-Stage XV 
(1.85 0.20 mg) (P = 0.05, t = 3.52) and from L-Stage 
I (1.64 0.06 mg) to L-Stage III (0.64 0.02 mg) (P < 
0.001, i = 6.32) (Fig. 5a). As lipid content decreased, 
metabolizing mass increased significantly between E-Stage 
XIII (1.93 0.08 mg) and E-Stage XV (2.46 0.17 mg) 
(P --'- 0.05, / -- 3.92) (Fig. 5b). Metabolizing mass 
increased throughout embryonic development, although egg 
membrane surface area did not change significantly. The 
metabolizing mass of the first larval stage (3.31 0.04 mg) 



CRAYFISH HEART PHYSIOLOGICAL DEVELOPMENT 



83 



o i.s -I 
U 

TS 

'5. i.o 






XIII XV XVI 

Developmental Stage 

Figure 5. (a) Lipid content of developing crayfish, (h) Metabolizing 
mass of developing crayfish, (c) Ratio of lipid content to metabolizing mass 
in the developing crayfish. * indicates significant difference from the 
previous stage at the level of P = 0.05. Shaded area indicates when 
hatching occurs. Values are shown as means standard error, H a 7 at 
each stage. See Figure 3 for correspondence between stage and length of 
development. 



(P < 0.001, / = 6.35) increased significantly by the third 
larval stage (5.01 0.07 mg) (P < 0.001, t = 12.598). 
The ratio of lipid to metabolizing mass declined signifi- 
cantly (P = 0.001, q = 7.040) over the embryonic and 
larval development period from 1.43 0.10 (SEM) at 
E-Stage IV to 0.12 0.01 at L-Stage III but did not change 
significantly from one stage to the next (Fig. 5c). 

Hyperoxic exposure 

E-Stage XIV and E-Stage XVI embryos were selected to 
represent animals thought to be under internally normoxic 
and hypoxic conditions, respectively. If embryonic cardiac- 
function is depressed in late-stage embryos because they are 
oxygen-deficient, then an increase in the oxygen diffusion 
gradient should partially restore oxygen delivery and thus 
allow heart rate to increase. No significant change was 



observed in E-Stage XIV animals when exposed to hyper- 
oxic water (Fig. 6). However, heart rate increased signifi- 
cantly in E-Stage XVI animals (P < 0.001, F = 21.73) 
(from 138 6 to 159 6 bpm) when exposed to hyperoxic 
water (40 kPa O : ). 

Discussion 

The mechanisms by which embryonic cardiac contrac- 
tions are initiated in crayfish are not clearly understood. 
Cardiac contractions, which result in the movement of he- 
molymph within the embryo, appear to facilitate gas trans- 
port in developing crustaceans (Reiber, 1997). Burggren 
and Territo (1995) have suggested that these early cardiac 
contractions may serve an angiogenic function in lower 
vertebrates. Early in development, the fundamental driving 
forces that influence developing physiological systems 
are often similar, even among taxa from diverse animal 
groups. All organisms must balance immediate environ- 
mental needs against long-term physiological require- 
ments. Crayfish, like other animals, rely on diffusion for 
both exchange and internal delivery of respiratory gases 
during early embryonic development (Burggren and Finder, 
1991; Reiber, 1997). Eventually, however, they attain a 
mass at which diffusion alone can no longer adequately 
meet gas exchange demands; at this point the active move- 
ment of fluids (hemolymph) as a result of cardiac pumping 
is initiated. The heart rate in most animals changes as 
development proceeds from embryo through immature or 
larval stages to adult, yet the patterns of change are not 
consistent among species in lower vertebrates (Burggren 
and Finder, 1991; Farrell, 1991; Hou and Burggren, 1995; 
Icardo. 1996) or invertebrates (Cooke, 1988; Spicer and 
Morritt, 1996). 

Spicer and Morritt (1996) have shown that the timing of 



180 - 



I no - 




E-Slage XIV 



E-S(age XVI 



Developmental Stage 

Figure 6. Heart rate of two stages of embryonic crayfish exposed to 
hyperoxic water (40 kPa). * indicates significant difference from control 
(P = 0.05). E-Stage XIV correlates to 14-17 days of development at 25 
C and E-Stage XVI to 19-21 days. 



84 



S. L. HARPER AND C. L. REIBER 



key developmental events, such as the initiation of cardiac 
contractions, is not consistent among aquatic crustaceans. 
However, some generalizations can be made about the on- 
togeny of cardiac physiology and function from the first 
appearance of cardiac contractions to maturity. Whether 
segmentation in an animal occurs pre- or post-hatch appears 
to be linked with the onset of beating of the heart because 
segmentation of the thoracic cavity precedes initiation of the 
heartbeat (Spicer, 1994; Spicer and Morritt, 1996). The 
relationship between body mass and heart rate does not 
conform to a single power curve model; rather it depends on 
the organogenesis of the heart itself. In the crayfish Pro- 
ciunhiinis clarkii. the heart grew proportionally in width 
and length throughout embryonic development; yet just 
after hatching, the length of the heart increased in slightly 
greater proportion than width, resulting in a large and rapid 
increase in the length-to-width ratio. As suggested by Spicer 
and Morritt ( 1996), this probably represents the switch from 
differentiation of cardiac tissue to the elongation phase of 
cardiac development. After hatching, larval mass increased 
significantly while heart rate remained fairly constant. This 
developmental pattern a decrease in heart rate with in- 
creasing body size after cardiac development is complete 
and elongation has commenced was described by Spicer 
and Morritt (1996) in the water flea Daphnia magna, the 
amphipod Gammarus duebeni, the lobster Nephrops norve- 
gicus, and the brine shrimp Anemia franciscana. 

Many adult crustaceans adjust stroke volume rather than 
heart rate to modulate cardiac output (Reviewed by McMa- 
hon and Burnett, 1990; McGaw et ai, 1994; Reiber, 1995; 
Reiber and McMahon, 1998). However, stroke volume does 
not appear to be as tightly regulated as heart rate during the 
embryonic development of crayfish. Embryonic crayfish 
apparently use heart rate as a primary mechanism to regu- 
late cardiac output, as stroke volume remains constant 
throughout embryogenesis. We present three explanations 
for the lack of change in stroke volume during embryonic 
development. The first explanation is that the increased 
dimensions of the heart are offset by a reduction in contrac- 
tility with development. The dimensions of the heart mea- 
sured in diastole increased throughout embryonic develop- 
ment. Systolic measurements also increased throughout 
development, implying that the heart was contracting to a 
lesser degree. The reduced force of contraction ultimately 
decreases the ejection fraction of the ventricle and leads to 
an increased residual volume of the heart such that, although 
the heart is growing in size, the volume of blood pumped 
per beat remains the same. A second explanation for the 
maintenance of stroke volume with development is the 
thickening of the heart walls. Measurements for stroke 
volume were obtained using the outer diameter of the heart, 
which may not account for thickening of the myocardium 
with development. After hatching, elongation of the heart 
and a decrease in systolic volume contribute to the signifi- 



rise in stroke volume observed in the larval crayfish. It 
is the maintenance of stroke volume throughout embryo- 
genesis that dictates that cardiac output is driven by heart 
rate alone early in development. A third possibility is that 
the maintenance of stroke volume may be due to increased 
afterload as a result of increased vascular pressure devel- 
oped during angiogenesis, as is the case with zebrafish 
embryos (Pelster and Burggren. 1996). 

Reiber (1997) postulated that cardiac parameters decline 
just prior to hatching because internal convective processes 
are insufficient to facilitate adequate gas exchange in the 
face of a limited gas exchange area. Throughout embryonic 
development in the red swamp crayfish, the metabolizing 
portion of the embryo increased in mass as it utilized the 
lipid-rich yolk as metabolic fuel. Embryonic crayfish appear 
to rely on oxidative phosphorylation throughout embryo- 
genesis; however, they can switch to anaerobic metabolism 
when exposed to decreased oxygen concentrations (Chiba 
and Chichibu, 1993). Metabolic rates increased throughout 
development as metabolizing mass increased and as orga- 
nogenesis and differentiation gave way to functional sys- 
tems. We observed a significant increase in oxygen con- 
sumption at E-Stage XIII, when the heart starts beating. 
After eclosion, another significant increase is observed in 
each larval stage; these changes could be associated with 
increases in the animal's activity (DeSilva et ai, 1986). 
Increased metabolic rates have significant consequences for 
the oxygen supply system since the supply of oxygen must 
be matched with the metabolic demands of the embryo. We 
observed an increase in the oxygen consumption of the 
crayfish throughout embryonic and larval development, ex- 
cept at the point prior to hatching when the embryos are 
thought to be internally hypoxic and could be relying on 
anaerobic metabolic pathways. 

Embryonic aerobic metabolism cannot be sustained under 
severe hypoxic conditions. Myocardial anaerobic capabili- 
ties are typically limited or nonexistent, which makes this 
tissue particularly sensitive to hypoxia; thus, if the embryo 
can no longer maintain aerobic metabolism, the heart should 
already be failing. Cardiac function declined during embry- 
onic development in the crayfish, most likely due to an 
internal hypoxia resulting from the embryo's oxygen re- 
quirements exceeding the diffusive capacity of its outer egg 
membranes. Prior to hatching, an internal hypoxia could 
result in direct inhibition of cardiac metabolism and cardiac 
function, as is observed in larval frogs (Fritsche and Burg- 
gren. 1996). In the crayfish, eclosion removes the physical 
limitation to gas exchange (the egg membrane) and active 
respiratory mechanisms (gill ventilation) are initiated. Car- 
diac functions can then increase after hatching, as the ani- 
mal becomes more active and organ systems mature. 

To determine whether the diminution in cardiac function 
observed in late-stage embryos was due to an internal hyp- 
oxia. the diffusional gradient of oxygen was increased by 



CRAYFISH HEART PHYSIOLOGICAL DEVELOPMENT 



85 



exposing the embryo to hyperoxic water. The rinding that 
this exposure increased the heart rate in late-stage crayfish 
embryos but not in early embryos suggests that oxygen 
limitation is at least one factor responsible for reducing the 
heart rate in late-stage embryos. However, the increase in 
heart rate observed in late-stage embryos exposed to hyper- 
oxia could also be explained by changes in the oxygen 
conductance of the egg membrane. In amphibian eggs, the 
oxygen conductance of the egg membrane is related to the 
stage of the embryo and is not directly influenced by envi- 
ronmental factors (Seymour and Bradford, 1995). If the 
same is true for crayfish, the early stages might not respond 
to an increase in Po 2 because the conductance of the mem- 
brane limits the oxygen diffusion across the membrane. 
However, this would not account for the reduction in heart 
rate observed in late-stage embryos. It is far more likely that 
these embryos are experiencing an internal hypoxia that 
decreases cardiac parameters and is alleviated by exposure 
to high ambient Po 2 . An alternative explanation for de- 
pressed cardiac function in late-stage embryos is a shift in 
the oxygen sensitivity of the embryos throughout develop- 
ment. It is possible that late-stage embryos are less sensitive 
to water Po 2 than earlier stages. However, if this were the 
reason for the depression of cardiac function, then increas- 
ing water Po 2 would not have had the observed effect on 
cardiac parameters in the late-stage embryos. 

Other mechanisms that could underlie the observed pat- 
terns of cardiac function during development include ( 1 ) 
intrinsic changes in membrane permeability and in myocyte 
characteristics such as the ion channels, and (2) the devel- 
opment of, or changes in. extrinsic controls (Fritsche, 1997). 
The decreases observed in egg surface area and animal mass 
may contribute to the decreases observed in cardiac param- 
eters just prior to hatching. Lastly, it should be noted that 
the shifts in heart rate and stroke volume could coincide 
with the pacemaker of the heart switching from a myogenic 
to a neurogenic mechanism of cardiac regulation (Yama- 
gishi, 1990; Yamagishi and Hirose, 1992: Chapman and 
Reiber, 1998; Harper and Reiber, 2000). Previous data on 
the extrinsic regulatory mechanisms of the embryonic cray- 
fish cardiovascular system have been difficult to interpret. 
Embryonic crayfish hearts appear to be initially myogenic 
and to become neurogenic later in development (Chapman 
and Reiber, 1998; Harper and Reiber, 2000). The timing of 
this event could correspond with the shifts in cardiac func- 
tion observed during embryonic development in the cray- 
fish. 



Acknowledgments 

This research was supported by NSF grant IBN- 
98874534 (C.L.R.) and the University of Nevada Las Vegas 
Graduate Student Association erant (S.L.H.). 



Literature Cited 

Burggren, W. W., and A. W. Finder. 1991. Ontogeny of cardiovascular 
and respiratory physiology in lower vertebrates. Aimu. Rev. Phvsiol. 
53: 107-135. 

Burggren, W. W., and P. R. Territo. 1995. Early development of blood 
oxygen transport. Pp. 45-56 in Hypoxiu and Bruin. S. Jouston and J. 
Coates. eds.. Queen City Printer. Burlington. VT. 

C'hiha, A., and S. Chichibu. 1993. Phosphorylation in crayfish (Pro- 
cambarus clurkii) eggs during hatching. Comp. Biochem. Physio/. B 
106: 433-436. 

Chapman, S. L., and C. L. Reiber. 1998. Ontogeny of cardiac regula- 
tion in the crayfish. Am. Zoo/. 37: 42A. 

Cooke, I. M. 1988. Studies on the crustacean cardiac ganglion. Comp. 
Biochem. Physiol. C 91: 205-218. 

DeSilva. C. D., S. Premawansa, and C. N. Keemiyahetty. 1986. Ox- 
ygen consumption in Oreochromis mi/oricus (L.) in relation to devel- 
opment, salinity, temperature, and time of day. J. Fish Binl. 29: 
267-277. 

Farrell, A. P. 1991. From hagfish to tuna: a perspective on cardiac 
function in fish. Physiol. Zool. 64: 1137-1164. 

Fritsche, R. 1997. Ontogeny of cardiovascular control in amphibians. 
Am. Zool. 37: 23-30. 

Fritsche, R., and W. Burggren. 1996. Development of cardiovascular 
responses to hypoxia in larvae of the frog Xenopus luevis. Am. J. 
Physiol. 40: R912-R917. 

Harper, S. L., and C. L. Reiber. 1999. Influence of hypoxia on cardiac 
functions in the grass shrimp (Palaemonetes pitifio Holthuis). Comp. 
Biochem. Pln'xiol. A 124: 569-573. 

Harper, S. L., and C. L. Reiber. 2000. Developmental cardiac response 
to GABA in the red swamp crayfish Procambarus c/arkii and the 
relevance to crayfish burrow ecology. J. Ari-.-Nev. Acad. Sci. 32: 
158-163. 

Harper, S. L., and C. L. Reiber. 2001. Ontogeny of neurohormonal 
regulation of the cardiovascular system in the crayfish Procambarus 
clurkii. J. Comp. Physiol. K. 171: 577-583. 

Hou, P.-C. L., and W. W. Burggren. 1995. Blood pressure and heart 
rate during larval development in the anuran amphibian Xenopus laevis. 
Am. J. Physio/. 269: R1120-R1125. 

h .M (In. J. M. 1996. Developmental biology of the early vertebrate heart. 
J. E.\p. Zool. 275: 144-161. 

Keller, B. B., N. Hu. P. J. Serrino, and E. B. Clark. 1991. Ventricular 
pressure-area loop characteristics in the stage 16 to 24 chick embryo. 
Circ. Res. 68(1): 226-230. 

Keller, B. B.. J. P. Tinney, and N. Hu. 1994. Embryonic ventricular 
diastolic and systolic pressure-volume relations. Cardiol. Young 4: 
19-27. 

McGaw, I. J., C. N. Airriess, and B. R. McMahon. 1994. Patterns of 
haemolymph-flow variation in decapod crustaceans. Mar. Bio/. 121: 
53-60. 

McMahon, B. R., and L. F. Burnett. 1990. The crustacean open cir- 
culatory system: a re-examination. Physiol. Zool. 63: 35-71. 

Orlando. K.. and A. W. Finder. 1995. Larval cardiorespiratory ontog- 
eny and allometry in Xenopus laevis. Physiol. Zool. 68: 63-75. 

Payette, A. L., and I. J. McGaw. 2003. Thermoregulatory behavior of 
the crayfish Procambarus clurkii in a burrow environment. Comp. 
Biochem. Physiol. A. 136: 539-556. 

Pelster, B.. and W. W. Burggren. 1996. Disruption of hemoglobin 
oxygen transport does not impact oxygen-dependent physiological pro- 
cesses in developing embryos of zebra fish (Danio rerio). Circ. Res. 79: 
358-362. 

Reiber, C. L. 1995. Physiological adaptations of crayfish to the hypoxic 
environment. ,4/. Zool. 35: 1-11. 

Reiber, C. L. 1997. Ontogeny of cardiac and ventilatory function in the 
crayfish Proctinihurus clurkii. Am. Zoo/. 37: 82-91. 



86 



S. L. HARPER AND C. L REIBER 



Reiber. C. L., and S. L. Harper. 2001. Perspectives on cardiac physi- 
ological ontogeny in crustaceans. (Zoologische Jahrbucher) (Zoology: 
Analysis of complex systems): Zoology of Complex Systems. 104( 1 ): 
103-113. 

Reiber, C. L., and B. R. McMahon. 1998. The effects of progressive 
hypoxia on the crustacean cardiovascular system: a comparison of the 
freshwater crayfish. (Procambams clarkii), and the lobster (Homarus 
americanus). J. Comp. Physiol. B 168: 168-176. 

Schwerte, T., and B. Pelster. 2000. Digital motion analysis as a tool for 
analyzing the shape and performance of the circulatory system in 
transparent animals. J. Exp. Biol. 203: 1659-1669. 

Seymour, R. S., and D. F. Bradford. 1995. Respiration of amphibian 
eggs. Physiol. Zoo/. 68: 1-25. 

Spicer. J. I. 1994. Ontogeny of cardiac function in the brine shrimp 



Arternia franciscana Kellogg 1906 (Branchiopoda: Anostraca). / Exp. 

Zoo/. 270: 508-516. 
Spicer. J. I., and D. Morritt. 1996. Ontogenic changes in cardiac 

function in crustaceans. Comp. Biochem. Physiol. A 114: 81-89. 
Taber. L. A., B. B. Keller, and E. B. Clark. 1992. Cardiac mechanism 

in the stage 16 chick embryo. J. Biomech. Eng. 114: 427-434. 
Wilkens, J. L. 1993. Re-evaluation of the stretch sensitivity hypothesis 

of crustacean hearts: Hypoxia, not lack of stretch, causes reduction in 

heart rate of isolated hearts. J. Exp. Biol. 176: 223-232. 
Yamagishi, H. 1990. Physiological change of the heart beat in juvenile 

stage of the isopod crustacean. Ligia exotica. Zoo/. Sci. 7: 1037-1042. 
Yamagishi, H., and E. Hirose. 1992. Nervous regulation of the myo- 

genic heart in early juveniles of the isopod crustacean. Ligia exotica. 

Comp. Physiol. 11: 141-148. 



Reference: Biol. Bull. 206: X7-94. (April 2004) 
2004 Marine Biological Laboratory 



Survival and Development of Horseshoe Crab 

(Limulus polyphemus) Embryos and Larvae in 

Hypersaline Conditions 

GRETCHEN S. EHLINGER* AND RICHARD A. TANKERSLEY 

Florida Institute of Technologv, Department of Biological Sciences, 150 W. University Blvd.. Melbourne. 

Florida 32901 



Abstract. The horseshoe crab Limulus polyphemus 
spawns in the mid- to upper intertidal zone where females 
deposit eggs in nests below the sediment surface. Although 
adult crabs generally inhabit subtidal regions of estuaries 
with salinities from 5 to 34 ppt, developing embryos and 
larvae within nests are often exposed to more extreme 
conditions of salinity and temperature during summer 
spawning periods. To test whether these conditions have a 
negative impact on early development and survival, we 
determined development time, survival, and molt cycle du- 
ration for L. polyphemus embryos and larvae raised at 20 
combinations of salinity (range: 30-60 ppt) and tempera- 
ture (range: 25-40 C). Additionally, the effect of hyper- 
osmotic and hypoosmotic shock on the osmolarity of the 
perivitelline fluid of embryos was determined at salinities 
between 5 and 90 ppt. The embryos completed their devel- 
opment and molted at salinities below 60 ppt, yet failed to 
develop at temperatures of 35 C or higher. Larval survival 
was high at salinities of 10-70 ppt but declined significantly 
at more extreme salinities (i.e.. 5, 80. and 90 ppt). Peri- 
vitelline fluid remained nearly isoosmotic over the range of 
salinities tested. Results indicate that temperature and sa- 
linity influence the rate of crab development, but only the 
extremes of these conditions have an effect on survival. 

Introduction 

Estuaries are physiologically challenging habitats for or- 
ganisms because of the temporal and spatial variation in 



Received 4 August 2003; accepted 13 January 2004. 

* To whom correspondence should be addressed. Current address: Flor- 
ida Fish and Wildlife Conservation Commission, Jacksonville Field Lab- 
oratory, 6134 Authority Ave, Jacksonville. FL 32221. E-mail: 
Gretchen.Ehlinger@fwc.state.fi. us 



environmental conditions. Among environmental variables, 
salinity and temperature are two factors that especially 
influence the survival and growth of marine invertebrates 
(Kinne, 1970, 1971 ). Salinity influences many physiological 
functions and is therefore important in regulating the distri- 
bution of estuarine and marine organisms. Estuarine species 
are generally euryhaline and eurythermal and, therefore, 
more tolerant of widely ranging temperatures and salinities 
than marine species (Costlow et ai, 1966; Laughlin and 
French. 1989; Goncalves et ai. 1995). Because the range of 
conditions that an organism can survive may change 
throughout development (Kinne, 1970, 1971; Charmantier 
et ai. 1988), ontogenetic differences in temperature and 
salinity tolerance often enable larvae, juveniles, and adults 
to inhabit different habitats or regions of estuaries (Char- 
mantier et ai, 1988). 

The American horseshoe crab Limulus polyphemus (L.) 
occurs in estuaries along the east coast of North America, 
where the general salinity range is 5 to 34 ppt. Although its 
densities are highest in portions of the estuary with higher 
and variable salinities, the species also inhabits regions with 
lower salinities (Shuster, 1982). The adults and juveniles 
live in subtidal benthic habitats, but embryonic and early 
larval development occurs in intertidal areas. Females dig 
nests near the waterline in the mid- to upper intertidal zone 
and deposit up to 20,000 eggs per clutch 10-25 cm below 
the sediment surface (Shuster and Botton, 1985; Brock- 
mann, 1990; Penn and Brockmann, 1994). Peak spawning 
occurs in the late spring to early summer (Cohen and 
Brockmann, 1983; Barlow et ai. 1986). generally near the 
time of high tide during new and full moons (Rudloe. 1980; 
Cohen and Brockmann, 1983; Barlow et ai, 1986). Eggs are 
laid in sandy areas that are regularly inundated in tidal 
systems and have variable frequencies and periods of inun- 



S7 



88 



G. S. EHLINGER AND R. A. TANKERSLEY 



dation in nontidal areas (Rudloe, 1985; Penn and Brock- 
mann, 1994). Because the nests are located on the beach, the 
embryos and larvae may be exposed to fluctuations in 
temperature and salinity that are greater than those experi- 
enced by adults in subtidal areas. During low tide, nests may 
be exposed to freshwater during rainfall and to rapid 
changes in temperature when the beach is heated by the sun. 
Thus, developing embryos might be expected to tolerate 
rapid and wide fluctuations in temperature and salinity. 
Alternatively, they may be protected from changes in ex- 
ternal conditions by the perivitelline fluid, the fluid inside 
the inner egg membrane, which may buffer embryos from 
changes in external conditions, especially salinity. 

Adult horseshoe crabs also inhabit lagoons and coastal 
embay ments with a much broader salinity range (5-55 ppt) 
due to shallow conditions and relatively high rates of evapo- 
ration and freshwater input (Pritchard, 1967; Robertson, 
1970; Shuster, 1982; Botton et al., 1988; Ehlinger et al.. 
2003). One such habitat is the Indian River Lagoon (IRL) 
located along the east coast of Florida, USA. The IRL 
consists of three shallow (1-3 m) sub-basins, the Indian 
River, Banana River, and Mosquito Lagoon, that extend 
about 250 km parallel to the Atlantic coast (Smith, 1987; De 
Freese, 1991). Although appreciable tidal changes occur in 
the immediate vicinity of the five inlets that link the IRL to 
the ocean, most of the system is virtually tideless (tidal 
amplitudes < 5 cm; Smith, 1993). Despite the presence of 
spawning adults, densities of L polyphemus larvae in the 
IRL are low compared to levels in tidally dominated habi- 
tats such as Delaware Bay and the Gulf coast of Florida 
(Rudloe, 1979; Ehlinger et al.. 2003; M. L. Botton, Ford- 
ham University, pers. comm.). One possible cause of this 
low larval abundance is physiological stress. A recent study 
of the spawning and reproductive behavior of horseshoe 
crabs inhabiting the IRL indicates that water temperatures 
and salinities during the spawning season reach levels as 
high as 45 C and 55 ppt, which may surpass the tolerance 
limits of the embryos or prevent larval development and 
hatching (Ehlinger, 2002). 

In estuarine habitats of New England and the mid- Atlan- 
tic region, low salinities caused by snow melt and freshwa- 
ter runoff are more common than high salinities. Therefore, 
most studies on the effect of salinity on embryonic devel- 
opment have focused on hypoosmotic stress and tolerance 
to low salinities. Previous studies indicate that the optimal 
salinity for the development of horseshoe crab embryos is 
between 20 and 30 ppt (Jegla and Costlow. 1982; Laughlin. 
1983; Sugita, 1988. Temperature also affects the rate of 
embryonic development and the duration of posthatch in- 
termolt stages, with the optimal temperature for develop- 
ment ranging from 25 C to 30 C (Jegla and Costlow. 
1982). Laughlin (1983) concluded that the effect of salinity 
is secondary to that of temperature, since the duration of 



larval development was similar among salinity treatments 
but differed significantly among temperature treatments. 

No published studies have examined the tolerance of L. 
polyphemus embryos to salinities higher than 40 ppt. The 
objectives of this study were to determine the effect of high 
temperatures and salinities on embryonic and larval devel- 
opment and to determine the salinity tolerance of L. 
polyphemus larvae. The effect of hyperosmotic shock on the 
osmotic concentration of the perivitelline fluid within the 
eggs was also examined. The results indicate that L. 
polyphemus embryos and larvae can tolerate a wide range of 
salinities (30-60 ppt), but they are more sensitive to high 
temperatures (S:35 C). 

Materials and Methods 

Adult specimens of Limuhis polyphemus were collected 
by hand during the spawning season (February-May 2002) 
from the Indian River Lagoon, Florida. Crabs were obtained 
from two sites: ( 1 ) Pineda Causeway, Banana River 
(2812'33"N, 8038'12"W) and (2) Peacock Pocket. Indian 
River (2839'41"N, 8043'45"W). The crabs were main- 
tained in the laboratory in a recirculating fiberglass tank (2.7 
m X 1.7 m X 1m) containing natural seawater (temperature 
20-23 C; salinity 30 ppt). For all experiments, eggs were 
fertilized by artificial insemination, and the embryos were 
cultured in the laboratory according to standard procedures 
(Brown and Clapper. 1981; Sekiguchi. 1988). Sperm col- 
lected from males by manual stimulation of the genital 
operculum were diluted with filtered seawater to make a 
I07c (vol/vol) sperm solution. Eggs collected from females 
by direct extraction from the ovaries were washed several 
times with 5-ju.m filtered seawater. placed in petri dishes 
(diameter 8.5 cm; height 1.4 cm) containing 50 ml of 
filtered seawater. and fertilized with 1 ml of the sperm 
solution. The eggs were incubated with sperm for 1 h and 
then rinsed with filtered seawater to remove excess sperm. 
To determine whether fertilization was successful, a subset 
of the eggs was stained with a solution of 0. 1 7c neutral red 
and observed under a dissecting microscope for signs of 
cleavage and gastrulation (Sekiguchi. 1988). The develop- 
mental stage of the embryos was determined using the 
classification scheme of Sekiguchi (1988). 

Effect of high temperature and salinity on embryonic and 
lan'til development 

To determine whether high temperature and salinity in- 
fluence the rate and success of embryonic development and 
the duration of the larval stage following hatching, fertilized 
eggs were reared under one of 20 combinations of salinity 
and temperature (salinities: 30, 40. 50. 60 ppt: temperature: 
25, 30. 33, 35. 40 C). Thirty eggs were placed in individual 
wells (1.5 cm diameter X 1.5 cm depth) of a multiwell 
tissue culture dish containing 3 ml of filtered natural sea- 



LIMULUS SURVIVAL AND DEVELOPMENT AT HIGH SALINITY 



89 



water at each temperature-salinity combination. For each 
combination, 10 dishes were placed in a thermostatically 
controlled incubator (Precision Scientific, Winchester, VA) 
to maintain a constant temperature. To avoid temperature 
and osmotic shock, all eggs were fertilized at 25 C and 30 
ppt, and the temperature and salinity were increased by 5 C 
and 5 ppt each day until the target treatment combination 
was reached. Seawater was changed every other day, and 
dishes were checked daily for the presence of newly hatched 
larvae and juveniles. Eggs that showed no sign of develop- 
ment after 75 days were excluded from the analysis. The 
effects of temperature and salinity on the time to hatching 
and molting to the first juvenile instar were determined 
using a two-factor analysis of variance ( ANOVA; SYSTAT 
10.0. SPSS Inc.). If the overall analysis indicated significant 
treatment effects, comparisons among treatment levels were 
conducted using Tukey pairwise comparisons (SYSTAT 
10.0). 

Salinitv tolerance of lan'ae 

To determine the salinity tolerance of L. pohphemus 
larvae, embryos were reared at 30 C and 30 ppt until they 
hatched to the trilobite larva stage. Within 24 h of hatching, 
24 larvae were placed in individual wells (1.5 cm diame- 
ter X 1.5 cm depth) of a multiwell culture dish containing 
3 ml of filtered seawater at salinities of 5, 1 0, 20, 30, 40, 50, 
60, 70, 80. and 90 ppt. Larval survival was monitored daily 
for 30 days. Larvae were considered dead when they were 
inactive (no leg or book-gill movement) and unresponsive 
to mechanical stimulation. Time to death (in days) or time 
of molting to the first juvenile instar (in days) was recorded. 
Survivorship curves for larvae in each of the salinity treat- 
ments were constructed using the product-limit method 
(Kaplan-Meier method: Muenchow, 1986; Kleinbaum, 
1996). Survival functions were compared among treatments 
using the Mantel log-rank test (\~ approximation, SYSTAT 
10.0, SPSS Inc.). The same analysis was used to compare 
the duration of the larval stage, with time to molting as the 
dependent variable. Larvae that were alive but had not 
molted after 30 days of exposure were treated as right- 
censored observations in the analysis. 

Osmotic concentration of the perivitelline fluid 

To determine the effect of changes in external salinity on 
the osmotic concentration of the perivitelline fluid surround- 
ing developing embryos, L. polyphemus eggs reared at 25 
C and 30 ppt were transferred, after the fourth embryonic 
molt, to one of 10 test salinities (5, 10, 20. 30. 40. 50. 60, 70, 
80. and 90 ppt). The osmotic concentration of the peri- 
vitelline fluid of a subset of randomly selected eggs (n = 
10) from each salinity treatment was determined at 0, 0.5, 
1,2,4, and 6 h following exposure. Thus, a total of 60 eggs 
(10 eggs X 6 time exposures) were tested at each combi- 



nation of salinity and temperature. Perivitelline fluid within 
the egg was collected by using the tip of a micropipette to 
carefully tear the egg's outer membrane and then to draw up 
10 /nl of perivitelline fluid. Osmolarity was determined with 
a vapor pressure osmometer (Vapro model 5520, Westcor 
Inc.. Logan, Utah) calibrated with standards of 290 and 
1000 mmol kg" 1 . The effect of the salinity of the external 
medium on the osmolarity of the fluid over time was deter- 
mined using a two-factor analysis of variance (salinity and 
time as factors; SYSTAT 10.0, SPSS Inc.). Comparisons 
between experimental treatments and the control (i.e., 30 
ppt) were conducted using a priori directed contrasts (SYS- 
TAT 10.0). 

Results 

Effect of high temperature and salinity on embrvonic and 
larval development 

Both high temperatures and salinities significantly af- 
fected the success of embryonic development in Liimilus 
polyphemus. At 35 C, eggs developed to embryonic stage 
20, where the embryo is enclosed by a clear membrane and 
the legs and gills are visible (Sekiguchi, 1988); but at all 
salinities, these embryos failed to hatch to trilobite larvae 
after 75 days. At 40 C, eggs showed no signs of develop- 
ment after 75 days at all salinities. Development and hatch- 
ing were normal at all other temperatures. Temperature and 
salinity also had a significant effect on time to hatching (Fig. 
1, F = 52.02, df = 6, 202, P < 0.001 ). At all test salin- 
ities, embryonic development took longer at 25 C than at 
30 and 33 C (Tukey pairwise comparisons. Fig. 1, Table 1 ). 
At 25 C, time to hatching increased significantly as the 
salinity increased (Fig. 1, Table 1). Embryos maintained at 
30 C and 33 C and 30 and 40 ppt had similar hatching 



35 



ffi 
o 



20 - 




30 



40 50 

Salinity (ppt) 



60 



Figure 1. Mean (SE) number of days from fertilization to hatching 
of Limitlus polyphemus embryos at 25 C, 30 C, and 33 "C and at 30. 40, 
50. and 60 ppt. No hatching occurred in any of the test salinities at 35 C 
and 40 C. n = 30 for each trial. 



90 G. S. EHLINGER AND R. A. TANKERSLEY 

Table 1 

Matrix of painrise comparison probabilities (Tiikey test) for days to hatching for Limulus polyphemus embryos 

T/S 



T/S 


25/30 


25/40 


25/50 


25/60 


30/30 


30/40 


30/50 


30/60 


33/30 


33/40 33/50 33/60 


n 


27 


29 


30 


26 


26 


27 


25 


28 


27 


29 27 25 


25/30 


1.00 




















25/40 


<0.01 


1.00 


















25/50 


<0.01 


<0.01 


1.00 
















25/60 


<0.01 


<0.01 


<0.01 


1.00 














30/30 


<0.01 


<0.01 


<0.01 


<0.01 


1.00 












30/40 


<0.01 


<0.01 


<0.01 


<0.01 


0.97 


1.00 










30/50 


<0.01 


<0.01 


<0.01 


<0.01 


<0.01 


<0.01 


1.00 








30/60 


0.03 


<0.01 


<0.01 


<0.01 


<0.01 


<0.01 


0.01 


1.00 






33/30 


<0.01 


<0.01 


<0.01 


<0.01 


0.86 


1.00 


<0.01 


<0.01 


1.00 




33/40 


<0.01 


<0.01 


<0.01 


<0.01 


0.46 


1.00 


<0.01 


<0.01 


1.00 


1.00 


33/50 


<0.01 


<0.01 


<0.01 


<0.01 


<0.01 


<0.01 


<0.01 


<0.01 


<0.01 


<0.01 1.00 


33/60 


<0.01 


<0.0! 


<0.01 


<0.01 


<0.01 


<0.01 


0.01 


<0.01 


<0.01 


<0.01 <0.01 1.00 



T = temperature (C); S = salinity (ppt); n = sample size. Bold type indicates pairwise comparisons that are not statistically significant. 



rates (Table 1). but hatching was delayed significantly in 
more hypersaline conditions (50 and 60 ppt. Fig. 1 ). Opti- 
mal temperature and salinity conditions for development to 
stage 21 were 30-33 C and 30-40 ppt. 

The duration of the trilobite larva stage (time from hatch- 
ing to molting to the first juvenile instar) decreased signifi- 
cantly with increasing temperature (F = 3.79, df = 6, 202, 
P < 0.001, Fig. 2), yet was similar for all salinity treat- 
ments (F = 0.22, df = 6, 202, P = 0.64). Larval stage 
duration was shortest at 30-33 C and was significantly 
longer at 25 C (Tukey test. Fig. 2, Table 2). Development 
times were similar for larvae maintained at 30 C and 33 C 
(Fig. 2, Table 2). 



80 



60 - 



o 
2 

1 
P 



40 



20 




30 



40 



50 



60 



Salinity (ppt) 



Figure 2. Mean (SE) time to molting to the first juvenile stage (in 
days) of Limulus polyphemus at 25 C, 30 C, and 33 C and 30, 40. 50, 
and 60 ppt. Sample sizes are provided in Table 2. 



Scilinir\' tolerance of lar\>ae 

All L. polyphemus trilobite larvae survived for 30 days at 
salinities ranging from 10 to 70 ppt; they died only in the 
extreme salinities of 5, 80, and 90 ppt (Fig. 3). Comparisons 
of the survival curves among salinity treatments indicated 
that survival was significantly reduced relative to control 
levels only when larvae were maintained at 90 ppt (^ = 
33.0, df = 2. P < 0.01, Fig. 3). The time to 50% mortality 
(TM 50 ) was =16.0 days in 90 ppt. Salinity also had a 
significant effect on molting rate of larvae to the first juve- 
nile instar (^ = 12.1, df = 4, P < 0.01. Fig. 4). Larval 
stage duration increased at salinities above and below 30 ppt 
(Fig. 4). Molting did not occur after 30 days at the most 
extreme salinities tested (^10 ppt or >70 ppt). 

Osmotic concentration of the perivitelline fluid 

Salinity significantly affected the osmotic concentration 
of the perivitelline fluid of L. polyphemus eggs (Fig. 5. F = 
176.81,df = 9, 45, P < 0.01). When developing embryos 
were placed in hypoosmotic solutions (5, 10, and 20 ppt). 
the osmolarity of the perivitelline fluid decreased signifi- 
cantly within 0.5 h of exposure (Fig. 5). After the first hour, 
fluid osmolarity leveled off and remained relatively constant 
for the remainder of the experiment (Fig. 5). At 30 ppt. the 
osmolarity of the perivitelline fluid did not change signifi- 
cantly throughout the exposure period (F = 0.098. df = 9. 
45. P = 0.925. Fig. 5). When embryos were exposed to 
more hyperosmotic conditions (>30 ppt), the fluid osmo- 
larity increased significantly within the first 0.5 hour and 
initially reached levels that were slightly above that of the 
bathing medium (Fig. 5). However, the osmolarity de- 



LIMULUS SURVIVAL AND DEVELOPMENT AT HIGH SALINITY 91 

Table 2 
Matrix ofpainvise comparison probabilities (Tukey lest) for time to hatching to the first juvenile instar for Limulus polyphemus larvae 

T/S 



T/S 


25/30 


25/40 


25/50 


25/60 


30/30 


30/40 


30/50 


30/60 


33/30 


33/40 33/50 33/60 


n = 


26 


27 


26 


23 


24 


25 


TO 


25 


24 


27 24 24 


25/30 


1.00 




















25/40 


1.00 


1 .00 


















25/50 


0.68 


0.12 


LOO 
















25/60 


0.98 


0.38 


1.00 


LOO 














30/30 


0.04 


0.04 


<0.01 


<0.01 


1.00 












30/40 


0.01 


0.01 


<0.01 


0.01 


1.00 


LOO 










30/50 


0.02 


0.02 


0.01 


<0.01 


0.97 


1.00 


1.00 








30/60 


0.03 


0.01 


0.04 


<0.01 


0.08 


0.39 


0.73 


1.00 






33/30 


<0.01 


<0.01 


<0.01 


<0.01 


0.06 


0.09 


0.39 


0.05 


1.00 




33/40 


<O.OI 


<0.01 


<0.01 


<0.01 


0.08 


0.13 


0.06 


0.07 


0.77 


1.00 


33/50 


<O.OI 


<0.01 


<0.01 


<0.01 


0.49 


0.10 


0.10 


0.09 


0.08 


0.86 1.00 


33/60 


<0.01 


<0.01 


<0.01 


<0.0l 


0.49 


0.93 


1.00 


1.00 


0.11 


0.25 1.00 1.00 



T = temperature (C); S = salinity (ppt); H = sample si/e. Bold type indicates pairwise comparisons that are not statistically significant. 



creased after 1 h and remained at levels slightly above that 
of the bathing medium (Fig. 5). Similar changes in the 
osmotic concentration of the perivitelline fluid occurred 
when eggs were exposed to salinities above 40 ppt. Yet the 
magnitude of the change and its duration increased with 
increasing hyperosmotic shock (Fig. 5). After 6 h, the peri- 
vitelline Huid of all embryos was nearly isoosmotic with the 
bathing medium (Fig. 6). 

Discussion 

In estuaries, Limulus polyphemus is exposed to rapid 
fluctuations in salinity, particularly in intertidal areas where 
embryos and larvae undergo development. The results of the 



current study support earlier reports that L. polyphemus 
embryos and larvae are remarkably hardy and able to with- 
stand the fluctuating and often harsh environmental condi- 
tions of intertidal areas (Jegla and Costlow, 1982; Palumbi 
and Johnson, 1982; Sugita. 1988; Botton et ai, 1988). 
Although both embryos and larvae completed development 
in hypersaline conditions, time to hatching and metamor- 
phosis was delayed at salinities above 40 ppt (Fig. 1 ). 
Posthatching development was not affected by salinity (Fig. 
2). Optimal salinities for development were between 30 and 
40 ppt, which differs slightly from previous reports of 
optimal values between 20 and 30 ppt (Jegla and Costlow, 
1982; Laughlin, 1983; Sugita, 1988). This difference may 



100 



80 - 



60 



20 - 





^ 0\a 

^^M+t**** 



10 15 20 

Time(d) 



25 



Figure 3. Kaplan-Meier survival curves for Limulus polvphemux lar- 
vae subjected to salinities ranging from 5 to 90 ppt for 30 days. All larvae 
survived in salinities from 10 to 70 ppt. n = 24 for each trial. 




Figure 4. Kaplan-Meier curves for time until molting for Limulus 
/>/V/>/II';HH.V larvae subjected to salinities ranging from 5 to QO ppt for 30 
days, n = 24 for each trial. 



92 



G. S. EHLINGER AND R. A. TANKERSLEY 




5ppt 

lOppt 

20ppt 

30ppt 

40ppt 

50ppt 

60ppt 

70ppt 

SOppt 

90ppt 



Figure 5 

exposure to 



Time (h) 

Mean (SE) osmotic concentration of the perivitelline fluid at 0, 0.5. 1. 2. 4. and 6 h after 
salinities ranging from 5 to 90 ppt. 



be the result of acclimation by the adults to the extreme 
salinity conditions found in the IRL compared to other 
estuaries because it is a nontidal, shallow lagoon. 

The results of the current study indicate that eggs and 
embryos of L. polyphemus are more sensitive to high tem- 
peratures than to high salinities (Figs. 1 and 2). Optimal 
temperatures for development were 30-33 C, yet temper- 
atures 35 C and above were lethal to embryos and ad- 
versely affected larval growth and development. This dif- 



fers slightly from previous studies in which lower 
temperatures produced optimal development (25-30 C: 
Jegla and Costlow, 1982; Laughlin, 1983; Sugita, 1988). 
Another difference is that hatching did not occur at temper- 
atures above 33 C in our study, whereas other researchers 
reported hatching at temperatures up to 35 C (Jegla and 
Costlow, 1982; Laughlin. 1983). 

Temperature tolerance in L. polyphemus varies with life- 
history stage: older stages are better able to withstand ex- 



00 

"o 



o 



o 

r_ 



3000 



2500 - 



20(10 - 



1500 - 



500 - 



500 



1000 



1500 



2000 



2500 



3000 



Medium Osmolarity (mmol kg" ) 



Figure 6. \ .irmiums in the perivitelline osmolarity of Limulus polyphemus eggs as a function of the bathing 
medium following 6 h of exposure. Values are means (SE). The dashed line is the isoosmotic line. 



LIMULUS SURVIVAL AND DEVELOPMENT AT HIGH SALINITY 



93 



treme temperatures (Fraenkel, I960; Jegla and Costlow. 
1982; Laughlin, 1983). In the current study, embryos could 
not tolerate temperatures above 33 C (Fig. 1). Reynolds 
and Casterlin (1979) found that juveniles were tolerant of 
temperatures from 15 C to 40 C. The lethal temperature 
for 1-h exposure is 44 C for adults, although they can 
survive more than 72 h at 40 C (Fraenkel. 1960). Thus, 
adults are more tolerant than embryos to high temperatures 
since embryos failed to develop and hatch at temperatures 
of 35 C. 

Salinity tolerance also varies with life-history stage. Em- 
bryos developed, hatched, and molted to the first juvenile 
instar at 60 ppt (Figs. 1 and 2), and larvae survived at 
salinities from 10 to 70 ppt (Fig. 3). Juveniles (12th instar) 
are able to withstand salinities of 12 ppt for several days, but 
as salinity decreases, mortality increases, and survival time 
decreases (Reynolds and Casterlin, 1979). Adults can with- 
stand direct transfer from 25 ppt to 13 ppt with no adverse 
effects, but transfer to 6 ppt causes swelling of the limb 
joints and gills (Robertson. 1970). Our results indicate that 
larvae are more tolerant of sudden hyposalinity shock than 
adults and juveniles. This may be due to ontogenetic dif- 
ferences that enable embryos and larvae to tolerate the rapid 
fluctuations in salinity that typically occur in intertidal nest- 
ing areas. These results are consistent with studies of other 
estuarine and marine arthropod species that found that tol- 
erance to a wide range of salinities is greater in the larval 
stage than in the adult. For example, the larvae of the coastal 
crabs Armases ricordi and A. roberti are tolerant of a wider 
range of salinities than the adult stages and. as a conse- 
quence, have different habitats (Diesel and Schuh, 1998). 
The larvae of the Chinese mitten crab Eriocheir sinensis 
also has a much wider salinity tolerance than the juveniles 
and adults (Anger. 1991 ). 

Temperature and salinity have been found to affect the 
physiology and growth of L. polyphennis (Jegla and Cost- 
low, 1982). Temperatures and salinities are higher in the 
IRL than in the northern portion of the range for the species. 
Therefore, the IRL population of horseshoe crabs may be 
able to withstand higher temperatures and salinities as a 
result of acclimatization, leading to the slightly higher op- 
timal ranges for development and growth found in this 
study. Temperature may also have an effect on size and 
growth, leading to geographic differences in size. Adults 
tend to be larger in temperate regions, with the smaller 
adults occurring in the warm tropical waters of Yucatan and 
the cold waters north of Cape Cod. Massachusetts (Shuster. 
1979; Reynolds and Casterlin, 1979). Shuster (1979) also 
found significantly smaller adults that matured one or two 
molts earlier at locations with salinities below 1 8 ppt. 

When exposed to hyperosmotic and hypoosmotic stress, 
the perivitelline fluid contained within the outer membrane 
of L. polyphemus embryos changed rapidly and became 
nearly isoosmotic to the surrounding medium (Figs. 5 and 



6). Since the osmotic concentration of the perivitelline fluid 
changes with the surrounding medium, the perivitelline 
fluid does not buffer developing embryos from changes in 
external salinity. Partial regulation of perivitelline fluid os- 
molarity may be a common trait among members of the 
Xiphosura. since Sugita (1988) reported similar results for 
embryos of Tachypleus tridentatus. the Japanese horseshoe 
crab. Sekiguchi ( 1988) found that the osmotic concentration 
of the perivitelline fluid of L. pol\phenuis and T. tridentatus 
embryos bathed in high-salinity waters changed during the 
exposure period, attaining a slightly higher value than the 
surrounding medium. Sekiguchi (1988) also found that in- 
organic ions pass freely through the inner egg membrane. 
Thus, osmoactive substances secreted by the embryo, but 
which cannot pass through the inner egg membrane, are 
most likely responsible for the slightly higher osmolarity of 
the perivitelline fluid relative to the outer medium. Since the 
perivitelline fluid of the eggs conforms osmotically to the 
surrounding medium, one would expect the egg volume to 
change initially, and then return to its original level once the 
egg has reached the osmolarity of the surrounding medium. 
Ehlinger (2002) found that the volume of eggs exposed to 
salinities from 5 to 90 ppt changed over a 6-h exposure 
period: in general, volume decreased in hyperosmotic solu- 
tions and increased in hypoosmotic solutions. These results 
differ from those reported by Jegla and Costlow (1982), 
who found that egg volume did not change conspicuously 
when exposed to salinities of 10 and 40 ppt. 

The wide salinity tolerance of embryos and larvae of L. 
polyphemus is an important adaptation to the extreme con- 
ditions in the intertidal nursery habitat. Such variability in 
tolerance may be an advantage in species that live in a 
highly variable, unpredictable environment (Anger. 1991). 
Embryos and larvae of L. polyphemus are exposed to and 
can tolerate a much wider range of salinities than juveniles 
and adults. This enables the embryos to survive and hatch in 
shallow lagoons and embayments with rapidly fluctuating 
salinities. Larvae are able to tolerate salinities from 20 to 70 
ppt. which they experience in intertidal areas where they 
develop and molt to larger stages before they migrate farther 
offshore (Rudloe, 1979). This tolerance for extreme tem- 
peratures and salinities is particularly important in nontidal 
estuarine systems and lagoons, such as the IRL. Although 
embryos and larvae of L. polyphemus are able to withstand 
the high salinities experienced in the IRL. temperatures 
during summer spawning and development periods may 
exceed tolerance limits, thus leading to the lower abundance 
of embryos and larvae in the IRL. 

Acknowledgments 

Research supported by National Park Service Grant No. 
CA5 18099049. We thank Canaveral National Seashore. 
Merritt Island National Wildlife Refuse, and NASA/ 



94 



G. S. EHLINGER AND R. A. TANKERSLEY 



Kennedy Space Center for access to the collection sites. We 
thank Drs. M. Botton. M. Bush, E. Irlandi, and J. Lin for 
their comments on an early version of this manuscript. We 
are grateful to M. Mota, E. Reyier, and D. Scheldt for their 
assistance in collecting adult crabs. A. Brenner and K. 
Smolarek for their assistance in the lab. and Dr. J. Grim- 
wade for use of laboratory equipment. We thank two anony- 
mous reviewers for their critical review of this manuscript. 

Literature Cited 

Anger. K. 1991. Effects of temperature and sahmtv on the larval devel- 
opment of the Chinese mitten crab Erioelieir sinensis (Decapoda: 
Grapsidae). Mar. Ecol. Prog. Set: 72: 103-1 10. 

Barlow, R. B., Jr., M. K. Powers. H. Howard, and L. Kass. 1986. 
Migration of Limulus for mating: relation to lunar phase, tide height, 
and sunlight. Biol. Hull. 171: 310-329. 

Botton, M. L., R. E. Loveland, and T. R. Jacobsen. 1988. Beach 
erosion and geochemical factors: influence on spawning success ol 
horseshoe crabs (Limulus />i>l\/>heinn.s] in Delaware Bay. Mar. Biol. 99: 
325-332. 

Brockmann. H. J. 199(1. Mating beha\ior ol horseshoe crab. Limuliix 
polvphemus. Behtn-itir 114: 206-220. 

Brown, G. G., and I). I.. Clapper. 1981. Procedures for maintaining 
adults, collecting gametes, and culturing embryos and juveniles of the 
horseshoe crab. Limulus polvplu'inus L. Pp. 26S-290 in Laborntorv 
Animal Management: Marine Invei lebi -tiles. Committee on Marine 
Invertebrates. National Academy Press, Washington. DC. 

Charmantier, G., M. Charmantier-Daures, N. Bouaricha. P. Thuet. 
D. E. Aiken, and J.-P. Trilles. 1988. Ontogeny of osmoregulation 
and salinity tolerance in two decapod crustaceans: Hoinaru.s aincr- 
icanus and Penaeus japonicus. Riot. Hull. 175: 102-110. 

Cohen, J. A., and H. J. Krockmann. 1983. Breeding activity and male 
selection in the horseshoe crab. Limulus polyphernus. Bull. Mar. Set. 
33: 274-2S1. 

Costlow, J. D., C. G. Bookhout. and R. J. Monroe. 1966. Studies on 
the larval development of the crab. Rhithropanopeus luirnxii (Gould). 
I. The effect of salinity and temperature on larval development. 
Phs-xiol. Zonl. 39: SI- 1 1)0 

De Ereese, D. E. 1991. Threats to biological diversity in marine and 
estuarine ecosystems of Florida. Cuuxl. Manage. 19: 73-101. 

Diesel, R.. and M. Schuh. 1998. Effects ol salinity and starvation on 
larval development of the crabs Arnnises rii or.li and 1 roberti (Deca- 
poda: Grapsidae) Irom Jamaica, with notes on the biology and ecology 
ol adnlls ./. C/usiai. Kin/. 18: 423-436. 

Ehlinger, (;. S. 2002. Spawning behavior and larval biology ol the 
American horseshoe crab. Limulus /</\/>//rm/<\. in a microtidal co.isi.il 
lagoon. Ph.D. dissertation. Florida Inslitute ol Tcclinolo-jy. Melbourne. 
FL. I 33 pp. 

Ehlinger, (;. S., R. A. Tankersley, and M. B. Bush. 20(13. Spatial and 
temporal patterns ol spawning and larval hatching by ihe horseshoe 
crab. 1. illinium pols'imemus. in a microlidal coastal lagoon / \uinnt s 26: 
631-640 

Fraenkel, (i. I960. Lethal high temperature lor three marine mvertc- 
hrates: Limulus pnlspliemus. Litloiuia littorea aiul I'agiinix longiear- 
1'iix. Oikos 11:171 IS2. 

Goncahes. E., K. Rilu-iro. and A. M. V. M. Snares. 1995. Laboratory 
stud) ol ellecls ol k-mi'.Tature and salinity on sur\i\al and larval 
ilevelopinenl ol ., |iopnl.iiioii ol Kluihrop,inoi<eus lianisn from the 
Mondego River estuary, Portugal Mar. Biol 121:6*9 64 s 
ila. T. C., and .1. I). Costl.m. I'lfO. Teinperalniv and salimlv elfecls 
on developmental and eail\ posihatch stages of l.iiiiiilnx. Pp. 103-1 13 



in Physiology and Biology of Horseshoe Crabs: Studies on Normal and 
Environmentally Stressed Animals. J. Bonaventura. C. Bonaventura. 
and S. Tesh. eds. Alan R. Liss. New York. 

Kinne, O. 1970. Temperature. Pp. 321-514 in Marine Ecologv. Vol. I. 
Pan I. O. Kinne. ed. Wiley-Interscience. New York. 

Kinne, O. 1971. Salinity. Pp. 683-995 in Marine Ecology: Vol. 1. Part 2. 
O. Kinne, ed. Wiley-Interscience. New York. 

Kliinl, .mm. D. G. 1996. Survival Analysis: A Self-Learning Text. 
Springer. New York. 

I .iiiL'liliii. R. 1983. The effects of temperature and salinity on larval 
growth of the horseshoe crab Limuliix /lo/vp/iemns. Biol. Bull. 164: 
93-103. 

Laughlin, R. B., and W. French. 1989. Differences in responses to 
factorial combinations of temperature and salinity by zoeae from two 
geographically isolated populations of the mud crab Rhiiliropanopcus 
hurrisii. Mar. Bio/. 102: 387-395. 

Muenchow. G. 1986. Ecological use of failure time analysis. Ecologv 
67: 246-250. 

Palumbi. S. R.. and B. A. Johnson. 1982. A note on the influence of 
hle-historv stage on metabolic adaptation: the responses ol Limuliix 
eggs and larvae to hypoxia. Pp. 1 15-124 in Ph\xiolng\ and fi/o/o.ifv of 
Horxcxliof Crtibx: Stud/ex on Normal and Environmentally Sn-< : \x<\l 
,-\nini,il\. .1. Bonaventura. C. Bonaventura. and S. Tesh. eds. Alan R. 
Liss, New York. 

Penn. D.. and H. J. Brockmann. 1994. Nest-site selection in the horse- 
shoe crab. Limuliix />ol\/ihoiuix. Biol. Bull. 187: 373-3S4. 

Pritchard. D. \V. 1967. What is an estuary: physical viewpoint. Pp. 
1-157 in Exinurii's, G. H. Lauff. ed. American Association for the 
Advancement of Science. Washington. DC. 

Reynolds, \V. VV., and M. E. Casterlin. 1979. Thermoregulatory be- 
havior and diel activity of Liiitnlnx /Wv/)/u<m.s. Pp. 47-59 in Binnicil- 
ical Applications of the Horseshoe Crab (Limulidae), E. Cohen, ed. 
Alan R. Liss. New York. 

Robertson. J. I). 1970. Osmotic and ionic regulation in the horseshoe 
crab Limulus polyphemus (Lmneaus). Biol. Bull. 138: 157-183. 

Riidloe, A. 1979. Locomotor and light responses of larvae of the horse- 
shoe crab. Limulus poly/theiiiiix (L.). Riot. Bull. 157: 494-505. 

Riidloe, A. E. 1980. The breeding behavior and patterns of movement of 
horseshoe crabs. Liniulns pol\plitnni\. in the \icinitv of breedina 
beaches in Apalachee Bay. Florida. Estuaries 3: 177-183. 

Riidloe. A. E. 1985. Variation in the expression of lunar and tidal 
behavior rhythms in the horseshoe crab. Limulus /Wv/>/irm.v. Bull. 
Mm Si i 36: 3SS-395. 

SekiKiichi. K. 1988. Biology of lloiscshoc Crabs. Science House. To- 
kyo. 

Shuster. C. N. 1979. Distribution of the American horseshoe "crab," 
Limulus [Hily/thfiiinx (L.). Pp. 3-26 in Rioint.lt, ,,l .\/>i>li,-alioiis of the 
Horseshoe Crab (Lnnuli.Lu'). E. Cohen, ed. Alan R. Liss. New York. 

Sinister. C. N. 1982. A pictorial re\ lew of the natural history and 
ecology of Ihe horseshoe crab. Ldmulus polyphernus, with reference to 
other I.imulidae. Pp. 1-52 in Plnsio/ogv and Hiolng\ ol Hoises/ioc 
Crabs. Siinlifs on \onnal tinil Environmentally Sncssetl Animals. 
J. Bonaventura, ( Kon.nenluia. and S. Tesh. eds. Alan R. Liss. New 
York. 

Sinister. C. N., Jr., and M. I,. Botton. 1985. A contribution lo the 
population biology of horseshoe crabs, l.iimilns />olv/'li,-miis in Dela- 
wara Hav. l:stu,in,'s 8: 363-372. 
Smith. N. P. 1987. An introduction to the tides of Florida's Indian River 

I agoon. I. \Vatei levels 1'hi .S. /. 50: 49-61. 

Smith, N. P. 1993. Tidal and wind-driven transport between Indian River 
and Mosqiiiio Lagoon. Florida. //. .S'c/. 56: 235-246. 
ita. II. 1988. F'liMionmenl.il adaptations ol emhrvos. Pp 195-224 in 
gv ol Horseshoe Crabs. K. Sekiguchi. ed. Science House. Tokvo 



Reference: Biol. Bull. 206: 95-102. (April 2004) 
2004 Marine Biological Laboratory 



Strategies for Sperm Chemotaxis in the Siphonophores 
and Ascidians: A Numerical Simulation Study 



MAKIKO ISHIKAWA 1 '*, HIDEKAZU TSUTSUI 1 t. JACKY COSSON 2 , YOSHITAKA OKA 1 , 

AND MASAAKI MORISAWA 1 

1 Misaki Marine Biological Station, Graduate School of Science, The University of Tokyo, Japan: and 
2 Obsen-atoire Oceanologique de Villefrance-sur-Mer, CNRS, France 



Abstract. Chemotactic swimming behaviors of spermato- 
zoa toward an egg have been reported in various species. 
The strategies underlying these behaviors, however, are 
poorly understood. We focused on two types of chemotaxis, 
one in the siphonophores and the second in the ascidians, 
and then proposed two models based on experimental data. 
Both models assumed that the radius of the path curvature 
of a swimming spermatozoon depends on [Ca ];, the in- 
tracellular calcium concentration. The chemotaxis in the 
siphonophores could be simulated in a model that assumes 
that [Ca 2 + ] j depends on the local concentration of the at- 
tractant in the vicinity of the spermatozoon and that a 
substantial time period is required for the clearance of 
transient high [Ca 2+ ],. In the case of ascidians, trajectories 
similar to those in experiments could be adequately simu- 
lated by a variant of this model that assumes that [Ca : + ], 
depends on the time derivative of the attractant concentra- 
tion. The properties of these strategies and future problems 
are discussed in relation to these models. 

Introduction 

After the first discovery of the chemotactic behavior of 
spermatozoa toward an egg by Dan (1950). sperm chemo- 
taxis has been reported in various animal species (Miller, 
1977; Eisenbach, 1999). and chemoattractants that mediate 
such behaviors have been identified in a few cases (Ward ct 



Received 8 July 2003; accepted 4 February 2004. 

* Present address: Department of Geology. National Science Museum. 
Japan. 

t Author to whom correspondence should be addressed. Present address: 
Laboratory for Cell Function Dynamics. Brain Science Institute. RIKEN. 
Hirosawa 2-1. Saitama 351-0198. Japan. E-mail: tsutsui@brain.riken.go.jp 

j Present address: Department of Biological Sciences, Graduate School 
of Science, The University of Tokyo. Japan. 



til., 1985: Coll et ai, 1994; Olson et til.. 2001; Yoshida et 
al., 2002). Furthermore, recent cell biological studies re- 
vealed some of the intracellular enzymatic signaling cas- 
cade evoked by the attractant stimulations (Yoshida ft al.. 
2003; Kaupp et al.. 2003). However, a major question that 
anyone who observed this phenomenon has to bear in mind 
remains poorly answered: How does such a tiny spermato- 
zoon succeed in finding an attractant source? 

What makes this question both more mysterious and 
more interesting is the fact that distinct swimming trajecto- 
ries have been observed for spermatozoa of different spe- 
cies, which implies that different strategies for chemotaxis 
may underlie these behaviors. For example, the chemotactic 
behavior in the siphonophores has been described as follows 
(Cosson et al.. 1984): spermatozoa show trajectories of 
large diameter (700-1000 /j,m) while swimming far from 
the "cupule." which in these species is an extracellular 
structure of the egg and serves as an attractant source, and 
trajectories of smaller diameter (200 jum) in the vicinity of 
the cupule; the transition between the two modes is progres- 
sive. In the ascidians. on the other hand, spermatozoa ex- 
hibit characteristic "chemotactic turns" during chemotaxis, 
but the curvature of the trajectories has no noticeable de- 
pendence on the distance to the attractant source (Yoshida ct 
al.. 1993. 2002: Ishikawa, 2000). The behavior of sea urchin 
spermatozoa seems to be a little more complicated but still 
exhibits unambiguous chemotaxis (Ward ct al.. 1985). 
Thus, it appears that spermatozoa in different species often 
respond to the attractant differently, although the goal is the 
same in all cases to find an egg and facilitate fertilization. 

One approach to revealing the underlying strategies for 
sperm chemotaxis may be to build a model based on the 
experimental observations and then study how the model 
works. In the present paper, we propose two models, one 



95 



96 



M. ISHIKAWA ET AL 



applied to ihe siphonophores and the second to the ascid- 
ians. We focused on these two taxa because their swimming 
behaviors are simple but clearly distinct, and also because 
substantial experimental data are available in the literature 
(see Results for details). These experimental results were 
simplified, as summarized in Figure 1. and incorporated into 
the models, which required only a few simple and reason- 
able assumptions. We show that numerical calculations of 
sperm trajectory using the two models result in trajectories 
very similar to those observed experimentally. 

Materials and Methods 

General remarks on the models 

It has been suggested that spermatozoa swim with three- 
dimensional beating waves whose characteristics confine 
them to a two-dimensional space when they are confronted 
with the interfaces between two media such as water/air or 
glass/water (Cosson et ai, 2003). For this reason as well as 
to simplify the observation of sperm trajectories under a 
microscope, our experiments have been restricted mainly to 



spermatozoa located at the glass/water interface of the lab- 
oratory chambers. Since experimental background is neces- 
sary to test the validity of a model, the models we used were 
also limited to two dimensions. At the interface, most sper- 
matozoa of siphonophores and ascidians show circular 
movement, usually in one preferred direction. A reasonable 
explanation is that the movement in the three-dimensional 
free environment is helical and that some of the initially 
homogeneously suspended spermatozoa were going upward 
and tended to be confined to the air/water interface, while 
others were going downward, to the water/glass interface, as 
was shown for sea urchin spermatozoa (see Cosson et ai, 
2003). Sperm confined to the glass surface still exhibit 
unambiguous chemotaxis as reported thus far, and this be- 
havior is our topic in the present study. 

In our model, a spermatozoon is treated as a mathematical 
point. This point circulates in the .\-y plane in one direction 
(clockwise for the ascidian spermatozoa observed in the 
vicinity of the glass slide surface, and counterclockwise for 
the siphonophore spermatozoa), with a radius of curvature 
that changes depending on the attractant concentration and 



Siphonophore 



B 



Ascidian 



ASW 



/'" N 

1 ASW ) 



I ASW 

\ 
\ 



Low 



I 

i ASW 



Attractant cone. 



High 



/ x / x 

I CFSW I ' CFSW I 

\ / \ / 



Low 



Attractant cone. 




CFSW 



Under attractant gradient 



Figure 1. A summai) . based on previous reports, of spermato/oa behavior in the presence of the attractant 
:i iv.o species of siphonophore (Miti;t>icicti kuclti. Clifli>/>lii'\i:\ oppendiculata) and one species ol ascidian 
'('ii'iin iiit<",tiinili\). (A) In the siphonophoics. the curvature is negatively dependent on the attrncUml concen- 
tration in artificial seawater (ASW. In/'), but the dependence is lost in C;r * -tree seawater (CFSW. hotttim). (B) 
In t'i. ' hans. no such dependence is observed, even in ASW (//, but a rapid modulation of the curvature 
leadi .1 turning behavior occurs in the presence of the attractant gradient (hniium Icfn. Arrows indicate 

ditccin i ' i il : aiiiaclani source. The curvature is larger when swimming tow aid the source and smaller when 
swimming IM il.r opposite direction. A short delay in the response has been often observed in this correlation 
llshikaw.'. 000 "i .',l m I,, , i ,//.. 2002). In CFSW. no such modulation in the curvature is observed, even under 
the altractant gradient (bottom It in 



HOW A SPERM CLIMBS A HILL 



97 



on time. Let us define some parameters: r, time; p(O, 
position of sperm at /; v(/) = v{cos (</>(/)), sin (<(/))). 
velocity vector of sperm: r(D. curvature; and c(p), attract- 
ant concentration sensed by the sperm at position p (Fig. 
2 A). Since no significant changes in the swimming velocity 
were found during the chemotactic behavior in these species 
(Cosson etui, 1984; Ishikawa, 2000; Yoshida etui., 2002), 
let us assume the amplitude of the velocity vector as con- 
stant (=v). Numerical integration of sperm movement was 
evaluated as follows with a time step (A/) of 1.0 ms: 



pit + A/) = p(t) + AM/) 



</>(/ + A/) = 



\tr/rit) 



(Eq. 1) 
(Eq. 2) 



Updating the angular component of velocity, but not the 
vector itself, as in the equation (2), moderates the accumu- 




B 




Figure 2. (A) A schematic drawing that shows the four parameters 
used in the calculation of sperm trajectory. O, the origin; p, position at t 
(vector); v, velocity (vector); (j>, angular component of v (scalar); r, radius 
of curvature (scalar). (B) A computed snapshot of the chemoattractant 
gradient used in the present study. The attractant concentration profile in 
the square area of I mm of the .v-y plane is plotted in the z-axis. The peak 
(hilltop) corresponds to the chemoattractant source located at the origin 
(.v = v = 0). 



lation of error during the integrations for a long time period. 
All the calculations and graphical outputs were done by 
using the Mathematica 3.0 program (Wolfram Research). 

Attractant profile 

For most observations of chemotaxis, the following ex- 
perimental design was adopted: a glass pipette filled with 
chemoattractant or any fluid (within agar-gel in many cases) 
to be tested was placed in a drop of water containing 
dispersed sperm cells. This allows a spatial gradient of 
attractant concentration to be established rapidly: sperm 
located in the vicinity of an attractant source usually ap- 
proach it within no more than tens of seconds. Since mol- 
ecules such as an organic compound or a small protein 
normally have diffusion coefficients in water of -10"'" 
nr/s or smaller, it is an acceptable approximation that the 
attractant profile does not change much during the approach 
of the spermatozoon. In our model, therefore, we simply 
used a computed snapshot of a solution of a diffusion 
equation as an attractant profile (Fig. 2B). Moreover, the 
drop is largely spread on the slide but is much thinner in the 
;-axis, so variation of attractant concentration along the 
c-axis should be small. Therefore, we consider the attractant 
gradient field with a two-dimensional diffusion equation 
with a coefficient of D: 



8c/8t = D(8 2 c/8.\ 2 + 8 2 c/8\ 2 ) 



(Eq. 3) 



In the polar coordinates of p. H( .v = p cos id), v = 
p sin (0)), equation (3) can be expressed 



as 



8c/8t = Di8 2 c/8p 2 + 1/pScVSp + \/p 2 8 2 c/86 2 ) (Eq. 4) 

Since we assume a situation of spatial symmetry, the last 
term of equation (4) can be regarded to be zero. 

8c/8t = D(8v/8p : + \/p8c/8p) (Eq. 5) 

As a boundary condition, we assumed that the concentration 
at the origin (i.e., the tip of a pipette) is always kept at a high 
level (r(0) = 1 ). We set D as 2.0 X 10"'" nr/s and used 
a numerical solution of equation i5) at t = 60 s as the 
profile for subsequent trajectory calculations (Fig. 2B). We 
also tried some other static attractant profile models (expo- 
nential, parabolic, solution of the diffusion equation at dif- 
ferent times, etc.) and found that most definitions resulted in 
qualitatively similar responses to what we show next. 

Results 

The siphonophore model 

Some properties of sperm-swimming in siphonophores 
are summarized in Figure I A. This summary is based on 
observations of Mnxgiueii kochi and Chelopheyes appen- 
diculata (Cosson et til.. 1984). In artificial seawater ( ASW). 
the spermatozoa show trajectories of larger diameter (700- 



98 



M. ISHIKAWA ET AL. 



400 

350 
300 



3 200 
ro 

150 
=3 
O 100 

50 



0.2 0.4 0.6 0. 

Attractant cone, [a.u.] 




1000 ju,m) while they are far from the attractant source (~5 
mm), and smaller trajectories (-200 jum) near the attractant 
source (0.2 mm). However, this dependence on distance 
from the attractant was lost in the absence of external Ca 2 + , 
which suggests that Ca 2 + influx is involved in the modula- 
tion of the curvature of trajectories. We incorporated these 
findings into the assumptions set in the model as follows: 

(a) Curvature decreases as intracellular Ca 2+ concentra- 
tion, ([Ca 2 * ],), increases (i.e.. a negative correlation). 

(b) [Ca 2+ ], positively correlates with c(p), the attractant 
concentration which is sensed by the sperm. 

Assumption (a) also agrees with the evidence that sper- 
matozoa treated with a Ca 2+ ionophore showed a curvature 
of 200 /am. which increased up to -800 /am at lower 
Ca 24 " concentration. Since any quantitative relationship 
among these factors in real spermatozoa is not yet available, 
we set some trial functions and studied the behavior. We 
first tried a simple linear correlation between [Ca 2+ ], and 
c(p), and a cubic function for [Ca 2 + ], and r(t) (Fig. 3A): 

[Ca : + ], = dp) (0 < c < 1; [arbitral unit (a.u.)]) (Eq. 6) 



,-(,) = 400(1 - [Ca ;T ],)- [jam] (0 < 



< 1; [a.u.]) 
(Eq. 7) 



This now allows us to study how spermatozoa swim under 
these conditions. The results show that the trajectories gen- 
erated by such conditions are far from chemotactic behav- 
ior. Spermatozoa do circle around the attractant source but 
never finally approach the egg (Fig. 3B). This result is not 
surprising because our present system is fully symmetric in 
terms of time and space components. When using functions 
other than those of equations (6 and 7), no chemotaxis is 
observed at all. However, a remarkable change occurs if we 
incorporate an additional condition: 

(c) |Ca 2 ' |, has different rates of increase and decrease 
(slow to decrease). 

This condition is not unlikely, because pumping of the 
cytosolic Ca 2 f out of the cell or into the intracellular store 
against the electrochemical gradient across the membrane is 
an enzymatic process, which is energy-consuming, whereas 
Ca 2+ influx generally occurs rapidly. Therefore, we then 
incorporated this additional condition as follows: 



A[Ca : ' ],/A; = - l/T([Ca : *], - dp)) 

when [Ca : *], 



(Eq. 6') 



Figure 3. Simulations ol t'n i| h in s'lu'ic model. (A) A cubic func- 
linii as one of the examples ol a luiKtion that negatively correlates 
attraetanl concentration to cunaUirc ol Ihe li;i|ectory. (B) A trajectory 



simulated with the function shown in (A). Time to lower |Ca : '|, is not 
considered. The sperm started at position ( .v. y) = ( - 800 jim, -800 fj.ni) 
with an initial angle ol O.I radian and a constant speed of 500 /j.m/s 
(arrow). The trajectory during the initial 40 s is shown. (C) A trajectory 
simulated under the same conditions as in (B). except that T of 0.5 s is 
incorporated as a decay-lime constant to lower [Ca" ],. 



HOW A SPERM CLIMBS A HILL 



99 



AC/At [a.u./ms] 



B 




Figure 4. Simulations of the ascidian model. (A) A sigmoid function 
as one of the examples of a function that positively correlates time-derived 



where T is the decay time constant. This condition was 
applied only when [Ca 2 + ]j > c(p): otherwise, equation (6) 
was applied as before. When trajectories were calculated 
with these new sets of conditions (6, 6', 7), we found that 
the incorporation of a time component for the Ca 2 + decay 
results in chemotactic trajectories (Fig. 3C) that are not 
unlike those obtained in the experimental observations. 
Likewise, chemotactic trajectories were reconstructed for 
a wide range of arbitrarily selected functions that relate 
'c(p)' to l [Ca 2 + ],' positively instead of by equation (6). 
and relate '[Ca 21 ],' lo ';(/)' negatively instead of by 
equation (7). even though some of them, of course, showed 
heavily distorted trajectories of approach toward the 
attractant source and unusually long or short times of 
approach. 



The ascidian model 

The behavior of ascidian sperm is quite different from 
that in the siphonophore sperm. The behavior illustrated 
in Figure IB is based on observations of Cioini intesti- 
imlix by Ishikawa (2000) and Yoshida et cil. (1993). In the 
presence of an attractant without a gradient, the curvature 
of the sperm trajectory is independent of the concentra- 
tion of the attractant. and is close to that in the absence 
of the attractant (Fig. IB). Under the gradient of attract- 
ant concentration, however, spermatozoa show rapid 
changes in their track diameters, so-called chemotactic 
turns. Since this turning behavior is lost in the calcium- 
free seawater (CFSW) or in the presence of Ca 2+ channel 
inhibitors, it has been suggested that rapid changes of 
diameter are dependent on [Ca 2 + ],. Therefore, we again 
incorporated condition (a), as we did in the siphonophore 
model. Next, we need to infer the relationship between 
[Ca~ + ], and c(p), the attractant concentration that the 
spermatozoan senses. Since modulation of diameter oc- 
curs only in the presence of an attractant gradient, we 
assumed that [Ca 2 + ], depends on the temporal changes of 
c(p) but not on the "absolute" concentration itself. Thus, 
we assume a second condition: 

(d) [Ca 2+ ], negatively correlates to the time derivative of 
the attractant concentration. 

With conditions (a) and (d). it follows that r(t) positively 
con-elates to &c(p(D)/&t. the time derivative of the attract - 



attractant concentration to the curvature of the trajectory. (B) A trajectory 
simulated with the function shown in (A). The sperm started at position ( .v, 
v) = ( -750 jum. -750 jxm) with an initial angle of 0.8 radian and a 
constant speed of 250 |iini/s (arrow). The trajectory during the initial 40 s 
is shown. (C) A trajectory simulated under the same conditions as in (B). 
except that a delay of 150 ms in the response of curvature to the time- 
dcrned attractant concentration is incorporated. 



100 



M. ISHIKAWA ET AL. 



ant concentration. This assumption was incorporated in the 
ascidian model as follows: 



/(M = F(Ac(p(r))/Af) 



(Eq. 8) 



Where F is the function that positively correlates 8c/8t with 
r(M. We studied sperm behavior with a sigmoid function for 
F (Fig. 4A) and found that this condition alone is sufficient 
to show chemotactic trajectories with successive turns when 
approaching the attractant source (Fig. 4B). We further 
incorporated a delay in the sperm response of r(t) to 
Ar(/(/))/Af with a time range of tens of milliseconds, 
because such a delay has been found in the analysis of the 
trajectory of real sperm (Ishikawa, 2000; Yoshida et til.. 
2002). This resulted in similar trajectories, but with a twist 
(Fig. 4C), which is often observed in real chemotaxis in the 
ascidian. Thus, we find that the delay of sperm response is 
not an absolute necessity for chemotactic behavior in the 
case of the ascidian model, but this parameter results in 
trajectories that are somewhat more realistic. 

Discussion 

In the present study, we proposed two comprehensive 
models for strategies of sperm chemotaxis in the siphono- 
phores and the ascidians. With these models, chemotactic 
trajectories similar to those observed for real spermatozoa 
could be reconstructed. We found that there are at least two 
ways to identify the location of the "hilltop" the source of 
the chemoattractant without looking around for it. The 
siphonophore's way is to "walk" circularly, with large- 
diameter curvatures at low altitude and smaller ones at 
higher altitude. This alone is not enough for success; how- 
ever, success can be achieved if any increase in curvature is 
followed by a time lag. In the ascidian's way, one needs to 
sense the steepness (gradient) but not the height (absolute 
concentration): the curvature is large when climbing steeply 
uphill, medium when the slope is gentle, and small when 



going downhill. The time-delay condition is not always 
necessary, but such a delay introduces twists into the tra- 
jectory. 

Even though these models employ some conditions based 
on experimental results, these conditions may seem to be 
oversimplified. However, the goal of the present modeling 
study is not to simulate the natural behavior of the sperma- 
tozoa perfectly but to find out what elements are needed to 
reconstruct the phenomenon of interest. For this purpose, it 
is necessary to focus on a small number of important pa- 
rameters. 

Nonetheless, some lines of evidence in addition to those 
mentioned earlier, support our simplification of the condi- 
tions. First, it has been shown that asymmetrical bending 
waves are induced when a high concentration of Ca 2+ is 
applied to the flagella of demembranated sea urchin sperm 
(Brokaw, 1979). This may support our condition (a). Next, 
it was recently suggested that a store-operated Ca 2 + channel 
(SOC) regulates chemotaxis in the ascidian (Yoshida et ai, 
2002). Involvement of such a SOC may account for the time 
delay in the curvature response to the temporal changes in 
the attractant concentration: this feature was often observed 
in the experiments and is introduced into the ascidian model 
(Fig. 4C), since activation of the SOC requires depletion of 
internal Ca 2 + stores evoked by the releasing signals such as 
inositol 1,4.5-phosphate. 

Quantitative comparison of the model outputs with ex- 
perimental results is very important for validation of the 
models. Unfortunately, we are not ready to do such a study 
because the models currently have high degrees of freedom. 
The two functions, one that relates attractant stimulus with 
[Ca 2 + ]| and the other that relates [Ca 2 + ], with curvature, 
cannot yet be quantitatively defined. Of course, one desir- 
able experiment might be to experimentally define these 
functions and then to carry out a quantitative comparison. 
But this requires many very difficult technical break- 



Siphonophore 




B 



Ascidian 




Figure 5. Changes in |Ca : * ], during chemotaxis. I A) Plot of (Ca'* ], as a IUIKIIOII ot lime in the modeled 
chemotaxis lor siplmnophores (Fig. 3Cl. (Bl Plot of |Ca : *], versus time in the modeled chemotaxis for the 
asculian if-'ig. 4Bi li is assumed that [Ca ; ' |, is proportional to the inverse of the radius of curvature. 



HOW A SPERM CLIMBS A HILL 



101 







B 






Figure 6. A difference in the sensitivity to a local attractant peak 
between the siphonophore and ascidian strategies. (A) A secondary source 
with one-fourth the attractant concentration of the main one is added at the 
position (x. v) = ( -500 /xm. -500 /urn). (B) Sperm trajectory with the 
siphonophore model under the dual peak profile in (A). The trajectory is 
superimposed upon the attractant profile. Note that the spermatozoa found 
the main peak. The initial condition is same as that in Fig. 3B. (C) Sperm 
trajectory simulated with the ascidian model. Note that the spermatozoa 
now found the local peak instead of the main peak. The initial condition is 
the same as that in Fig. 4B. Arrows in (B) and (C) indicate the initial 
positions and directions. 



throughs such as quantification of local attractant concen- 
tration, application of an attractant stimulus varying with 
time, and so on. Another indirect but more practical exper- 



iment would be to measure [Ca 2 + ]j during chemotaxis. Our 
models predict that there will be a temporal [Ca 2 + ], pattern 
during chemotaxis specific to each model: [Ca 2 + ], oscillates 
in both models, and the base level elevates in the siphono- 
phores but not in the ascidians (Fig. 5). Even though mea- 
surement of [Ca 2 + ]j in swimming spermatozoa is still tech- 
nically challenging, mainly due to the small volume of 
cytoplasm and fast movements of the sperm, we hope that 
recent innovations in Ca~ + indicators and image sensors 
will make it possible in the future. 

What is the significance of the difference in the two 
strategies? Since temporal change of the attractant concen- 
tration is the critical parameter for the modulation of cur- 
vature in the ascidian model, we expect that the ascidian 
spermatozoon is more sensitive to local change of concen- 
tration than the siphonophore spermatozoon, in which the 
absolute concentration value is the most critical. Simulation 
under two attractant sources, one of high concentration and 
the other of low concentration, led to the expected results: 
the ascidian spermatozoa found the lower peak of attractant 
in the vicinity, and the siphonophore spermatozoa reached 
the higher peak (Fig. 6). Thus, an interesting future problem 
would be to test this prediction in biological experiments. 
One may also be interested in possible relationships be- 
tween such characteristics of sperm strategy and the envi- 
ronment that the species are facing. However, such a ques- 
tion cannot be addressed currently. Most of our knowledge 
has been limited to sperm in two-dimensional laboratory 
conditions, even though the goal should be to reach a deep 
understanding of strategy in the three-dimensional natural 
environment. Since theoretical treatments suggests that drag 
forces near the interface have substantial effects on the 
flagellar motion of sperm (Katz, 1974), we should avoid 
applying knowledge gained in two dimensions thought- 
lessly in building three-dimensional models. One needs to 
know how parameters that describe three-dimensional heli- 
cal motions are affected by the attractant gradient. To ac- 
complish this goal, we hope that techniques to measure 
sperm trajectories in the three-dimensional environment, as 
pioneered by Crenshaw el ul. (2000). will soon be more 
accessible. 



Acknowledgments 

We thank Dr. M. Yoshida and Dr. K. Yoshimura of the 
University of Tokyo for helpful discussions, and the staff of 
MMBS for encouragement. The CNRS, JSPS, and MEXT 
are acknowledged for support of J. Cosson at the occasion 
of several stays in Japan. This work was supported by 
grants-in-aid from the Ministry of Education, Culture. 
Sports, Science and Technology of Japan to M.M. 



102 



M. ISHIKAWA ET AL. 



Literature Cited 

Brokaw. ('. J. 1979. Calcium-induced asymmetrical heating of Triton- 
demembranated sea urchin sperm flagella. J. Ct'll Biul. 82: 401-41 I 

Coll, J. C., B. F. Bowden, G. V. Meehan, G. M. Kiinig, A. R. Carroll, 
D. M. Tapiolas, P. M. Alino, A. Heaton, R. De Nys, P. A. Leone, 
M. Maida, T. L. Acetet, R. H. Willis, R. C. Babcock, B. L. Willis, 
Z. Florian, M. N. Clayton, and R. L. Miller. 1994. Chemical 
aspects of mass spawning in corals. I. Sperm-attractant molecules in the 
eggs of the scleractinian coral Mimlipora digitata. Mar. Biol. 118: 
177-182. 

Cosson, M. P., D. Carre, and J. Cosson. 1984. Sperm chemuiaxis in 
siphonophores. II. Calcium-dependent asymmetrical movement of 
spermatozoa induced by the attractant. J. Cell Sci. 68: 163-181. 

Cosson, J., P. Huitorel. and C. Gagnon. 2003. How spermatozoa come 
to be confined to surfaces. Cell Motil. Cytiiskclcl. 54: 56-63. 

Crenshaw, H. C., C. N. Ciampaglio, and M. McHenry. 2000. Analysis 
of the three-dimensional trajectories of organisms: estimates of veloc- 
ity, curvature and torsion from positional information. / .v/>. Biol. 
203: 961-982. 

Dan, J. C. 1950. Fertilization in the medusan Spirucodim saltarix. Biul. 
Bull. 99: 4 12-4 1. V 

Eisenbach, M. 1999. Sperm chemotaxis. Rev. Reprod. 4: 56-66. 

Ishikawa, M. 2000. Strategy and regulation of sperm chemotactic be- 
havior in the ascidian. Cifnui intestinalis. M.S. thesis. University ot 
Tokyo. (In Japanese). 



Katz, D. K. 1974. On the propulsion of micro-organisms near solid 

boundaries. J. Fluid Mccli. 64: 33-49. 
Kaupp. I . B., J. Solzin, E. Hildebrand, J. E. Brown, A. Helbig, V. 

Hagen, M. Beyermann, F. Pampaloni, and I. Weyand. 2003. The 

signal flow and motor response controlling chemotaxis of sea urchin 
sperm. Nat. Cell Biol. 5: 109-1 17. 

Miller, R. L. 1977. Distribution of sperm chemotaxis in the animal 
kingdom. Pp. 99-199 in Advances in Invertebrate Reproduction. Vol. 
1. K. G. Adiyogi and R. G. Adiyogi, eds. Peralam Kenoth. Kerala. 
India. 

Olson. J. H., X. Xiang, T. Ziegert, A. Kittelson, A. Rawls, A. L. Biener, 
and I). E. Chandler. 2001. Allurin. a 21-kDa sperm chemoattractant 
from Xeimpits egg jelly, is related to mammalian sperm-binding pro- 
teins. Prm: Nail. Acad. Sci. USA 98: 11.205-11.210. 

Ward, G. E., C. J. Brokaw, D. L. Garbers, and V. D. Vacquier. 1985. 
Chemotaxis of Arbacia pimctulata spermatozoa to resact, a peptide 
from the egg jelly layer. ./. Cell Biol. 101: 2324-2329. 

Yoshida, M., K. Inaba, and M. Morisawa. 1993. Sperm chemotaxis 
during the process of fertilization in the ascidians Cinna M/w'vmv and 
Ciomi intcslinalis. Dev. Biol. 157: 497-506. 

Yoshida, M., M. Murata. K. Inaba. and M. Morisawa. 2002. A 
chemoattractant for ascidian spermatozoa is a sulfated steroid. Prm: 
Nat/. Acad. Sci. USA 99: 14.831-14.836. 

Yoshida, M., M. Ishikawa. H. Izumi, R. De Santis, and M. Morisawa. 
2003. Store-operated calcium channel regulates the chemotactic be- 
havior of ascidian sperm. Prm: Natl. Acad. Sci. USA 100: 149-154. 



Reference: Bio/. Bull. 206: 103-1 12. (April 2004) 
2004 Marine Biological Laboratory 



Interaction Between Photoperiod and an Endogenous 

Seasonal Factor in Influencing the Diel Locomotor 

Activity of the Benthic Polychaete Nereis virens Sars 



KIM S. LAST* AND PETER J. W. OLIVE 

School of Marine Sciences and Technology, Ridley Building, University of Newcastle upon Tyne, NE1 7RU, 

United Kingdom 



Abstract. The locomotor activity of Nereis virens Sars 
associated with food prospecting was investigated in re- 
sponse to photoperiod and season using an actograph. Ex- 
perimental animals which had been reared under natural 
photoperiods were exposed to two constant photoperiodic 
treatments, LD 16:8 and LD 8:16, in both the autumn and 
winter and in the absence of tidal entrainment. Autocorre- 
lation analysis of rhythmicity showed that during the au- 
tumn, animals under the LD 16:8 photoperiod displayed a 
strong nocturnal rhythm of activity, whereas animals under 
the LD 8:16 photoperiod showed only a weak nocturnal 
activity rhythm. This is believed to represent an autumn 
feeding cessation that is triggered when the animals pass 
through a critical photoperiod LD^,, <12:>12. Later in the 
winter, however, animals exposed to both photoperiodic 
treatments showed strong rhythms of foraging activity irre- 
spective of the imposed photoperiod. It is suggested that the 
autumn cessation may maximize the fitness of N. virens, a 
spring-breeding semelparous organism, by reducing risk 
during gamete maturation, while spontaneous resurgence of 
activity after the winter solstice permits animals that are not 
physiologically competent to spawn to accrue further met- 
abolic reserves. This response is believed to be initiated by 
a seasonal (possibly circannuul) endogenous oscillator or 
interval timer. 

Introduction 

Nereis virens Sars, one of the largest marine annelids, has 
proven to be an interesting model for studies of semelparous 



Received 23 September 2003; accepted 25 February 2004. 
* To whom correspondence should be addressed. E-mail: k.s.last@ 
ncl.ac.uk 



life histories with mixed age at maturity (Olive et al., 1997, 
2000, 2001 ). While age at maturity varies between 1 and 7 
or more years, any one worm can breed only once, where- 
upon spawning is followed by death. A key transition in this 
life history occurs during the autumn preceding eventual 
breeding when the final stages of gametogenesis are initi- 
ated, culminating in individuals becoming gravid and 
spawning during the following spring. The profound influ- 
ence of the photoperiod on the behavior and physiology of 
N. virens has already been demonstrated. Transition through 
the critical photoperiod (LD cril <12:>12) at the end of 
September (Last et al.. 1999) initiates sexual maturation and 
gamete development, which may culminate in sexual repro- 
duction and death in any particular year (Olive et al., 1997). 
When semiquantitative methods were used to determine the 
prospecting behavior of this polychaete. it was shown (Last 
and Olive. 1999) that the frequency at which animals 
emerged from their burrows in the autumn was much higher 
under a photoperiod of LD (light/dark) 16:8 than under LD 
8:16. In a potentially long-lived but strictly semelparous 
organism such as N. virens. there is strong selection for the 
avoidance of risk during the final stages of sexual matura- 
tion when accumulated reserves are being converted to 
gametogenic tissues (Olive et al.. 2001). It is reasonable, 
therefore, to interpret the level of foraging activity as indi- 
cating the onset of a physiological state, responsive to 
relative daylength, during which sexual maturation occurs. 
Observations made during the late spring and summer, 
however (Last and Olive, 1999), showed that the differences 
in foraging activity between LD 16:8 and LD 8:16 were not 
as marked, but were still significantly different. It was 
therefore suggested that a covert temporal rhythm must 
underlie the overt activity of emergence in N. virens. and 
that the emergent patterns also involve expression of a 



103 



104 



K. S. LAST AND P. J. W. OLIVE 



response to a seasonal (or circannual) clock, since exposure 
to a constant LD 8:16 photoperiod does not induce the same 
physiological response at all times of the year. 

Photoperiodism in marine animals is less intensively 
studied than in terrestrial organisms, but "photoperiod-like" 
phenomena have been documented in several marine spe- 
cies, including the echinoderm Pieaster ochrucens (Pearse 
and Eernisse, 1982), the copepod Labidoceni cwstmi (Mar- 
cus. 1986), and the polychaetes Neanihes limnicola (Fong 
and Pearce, 1992a, b) and Harmothoe imbicata (Garwood 
and Olive, 1982). The difference between the environmental 
and the evolutionary history in marine organisms requires 
that these processes be investigated to understand environ- 
mental signal transduction in the control of life-history 
events and to determine whether these observations are 
likely to be the consequence of a common clock mecha- 
nism. Confirmation that they are such a consequence would 
have important implications for our understanding of the 
evolution of clock-based processes. 

To test the suggestion that an endogenous long-term 
rhythm moderates responses to fixed photoperiodic inputs in 
N. virens, we used an actographic procedure (Last, 2003) to 
monitor its emergence (foraging) behavior and examined 
the spontaneous diel activity patterns of individual animals 
maintained under fixed LD cycles for several months. 

Materials and Methods 

Two experiments were conducted using the polychaete 
Nereis virens. Short-term assays of activity were earned out 
in the autumn and winter to assess the strength of diel 
"out-of-burrow" activity both within and between seasons 
under rectilinear photoperiods (that is, light and dark peri- 
ods without simulated dawn and dusk). Concurrently, a 
long-term experiment was used to determine any spontane- 
ous changes in activity under constant rectilinear photo- 
periods with time. 

Two time periods were used for the short-term assay: six 
days in September in the autumn of 1998 (A98) and six days 
in February in the winter of 1999 (W99). Both A98 and 
W99 animals had been born from the same broodstock ( 16 
March 1998), and as a consequence, the experimental ani- 
mals for W99 were 5 months older than those used for A98. 
To prevent any size- or maturation-related bias in feeding 
rates, all animals chosen were of about the same weight, 
2.5 0.1 g. with all coelomic oocytes having a diameter 
<120 /am. All a.iimals ( // -- 16) were collected from a 
commercial supplier (Seabait Ltd.) a week prior to the 
experiments, whici' ''.ok place under controlled conditions 
in (he laboratory. S:, !nrth. animals had been maintained 
outside under natural pholoperiods. so the natural photo- 
period at the time of colkrtion was LD 13:1 I tor A98 and 
LD 11:13 for W99. Aftei ace 1 1 mat i /at ion, animals were 
introduced into (he allographs (see below) and maintained 



under one of two photoperiods, LD 16:8 or LD 8:16, that 
approximated the photoperiodic extremes between midsum- 
mer and midwinter at a latitude of 55 north (where the 
animals were collected). 

Data obtained from the actographic recording were ana- 
lyzed for two factors: (1) variability in the diel activity of 
individuals both between photoperiodic treatments and sea- 
sons, and (2) overall changes in "strength" of rhythm. 
Variability in diel activity was visually represented using 
actograms, while the strength of rhythm was characterized 
with autocorrelation analysis (Dowse and Ringo, 1989; 
Palmer et ul.. 1994: Dutilleul, 1995). This statistic provides 
a measure of the strength to the rhythm that is not affected 
by the overall level of activity: the less noisy the data 
between cycles and the higher the signal, the stronger the 
rhythm. Since the autocorrelation output is normally distrib- 
uted around the lag time that most closely matches the 
period of that particular rhythm, robust parametric statistics 
can be applied. 

The concurrent long-term experiment was carried out for 
9 months under constant LD 16:8 and LD 8:16 photoperi- 
ods, using animals from the same broodstock that were born 
naturally at Seabait Ltd. on 16 March 1998 and reared 
continuously outside under natural photoperiods until the 
start of these investigations. As with experiments A98 and 
W99, the animals chosen had about the same weight (2.5 
0. 1 g) and sexual maturity (oocyte diameter <120 /j.m). All 
stock animals (n - 100) for this experiment were main- 
tained continuously under photoperiods of LD 16:8 or LD 
8:16. Such continuous rectilinear photoperiods have previ- 
ously been used to detect circannual rhythms (Randall et al.. 
1998; Nisimura and Numata. 2001) without the possibly 
detrimental effects of inducing a free-running state by using 
continuous light or darkness. Each month between Septem- 
ber 1998 and June 1999, four animals were selected at 
random from stock aquaria in the laboratory and placed into 
the artificial burrows of the aetograph. Their activity was 
then recorded for 6 to 7 days under the two photoperiodic 
treatments, LD 16:8 and LD 8:16. At other times, the 
animals were maintained under the respective photoperiodic 
treatments LD 16:8 and LD 8:16 in stock aquaria. Hourly 
aetograph data were summed into 48-h epochs and parti- 
tioned into mean monthly actograms. The mean data points 
were plotted against maximum overall activity that normal- 
ized the amplitude between treatments and made direct 
comparisons possible. 

To prevent transient behavioral activity for both short 
(A98 and W99) and long-term assays, animals were always 
aeclimati/ed for 7 days under their new photoregimes. 

The aetograph consisted of two aquaria housed in light- 
tight photoperiodicalh controlled chambers. Artificial bur- 
rows consisting of lengths of PVC tubing were inserted 
through the bottoms of these experimental aquaria and 
connected lo infra-red optocouplers that were broken as 



SEASONAL RHYTHMS IN N. VIKENS SARS 



105 



soon as any animal emerged. Out-of-burrow activity for all 
animals was monitored using a data logger. A complete 
description of the actographic procedures has been pub- 
lished in Last (2003). The aquaria were supplied with re- 
circulating seawater, salinity 34 to 36 ( 4f. that had been 
biologically trickle-filtered and sterilized with UV light; 
temperatures in the aquaria were maintained constant at 
= 16 C. Every 2 days during the middle of the photophase 
(the light portion of the cycle) the experimental animals 
were fed coarse trout pellets to and above the maximum that 
they would consume. 

Results 

Analysis of locomotor activity in N. virens: Autumn {A98) 

Actograms. The mean hourly activity (beam breaks) of all 
animals over 7 days in the autumn when maintained under 
LD 16:8 and LD 8:16 photoperiods is shown in Figure 1. 
Note that these animals are from natural photoperiods of LD 
13:11. The main onset of activity under both treatments 
occurred at 0000 (midnight) GMT immediately after the 
lights-off signal. All activity was much reduced during the 
photophase. Thus the type of activity under both treatments 
can be described as a nocturnal diel pattern of foraging 
behavior. Under LD 16:8 (Fig. la), activity was consistently 
high for each successive scotophase (the dark portion of the 
cycle) but with substantial within-treatment variability be- 
tween individuals, as shown by the standard deviation bars. 
Under LD 8:16. however (Fig. Ib). the distinction between 
onset and cessation of activity was less marked except for 
days 1 and 2. All animals were similarly inactive except 
during the first scotophase, which showed raised activity 
levels comparable with those animals under LD 16:8. The 
mean number of emergence events for animals under LD 
16:8 was significantly greater (Student's t test: t = 3.23. 
P < 0.05) for each consecutive 24-h period than for 
animals under LD 8:16. 

Strength-of-rhythm analysis of activity data. Autocorre- 
lation analysis showed that animals maintained under LD 
8:16 in the autumn have a significantly weaker rhythm of 
activity than those under LD 16:8 (t test: t = 2.54. P < 
0.05). This demonstrates that strength of rhythm in the 
autumn is dependent on the imposed photoperiodic treat- 
ment. 

Analvsis of locomotor activity ofN. virens: Winter (W99) 

Actograms. The mean hourly activity (beam breaks) of all 
animals over 6 days in the winter when maintained under 
LD 16:8 and LD 8:16 photoperiods is shown in Figure 2. 
Note that these animals are from natural photoperiods of LD 
11:13. Under both photoperiods, activity was consistently 
high for each successive scotophase despite the relatively 
high within-treatment variability between individuals, as 



shown by the standard deviation bars. There was no signif- 
icant difference (/ test: / = 2.09, P > 0.05) in the number 
of emergence events for animals under LD 16:8 and animals 
under LD 8:16 for each consecutive 24-h period. This is in 
striking contrast to the results recorded 5 months earlier 
under the same photoperiodic treatments. 

Strength-of-rhvthm analysis of activity- data. The strength 
of the activity rhythm of animals maintained under LD 1 6:8 
was not significantly different (t test: t = 0.65, P > 0.1 ) 
from those maintained under LD 8:16. This demonstrates 
that strength of rhythm in the winter is independent of the 
imposed photoperiodic treatment. 

Comparative analysis in strength of rhythm: Autumn and 
winter 

Autocorrelation analysis of rhythm strength is not af- 
fected by overall amplitude of activity, and hence a com- 
parative analysis of activity between treatments (LD 16:8 
and LD 8:16) and between seasons (A98 and W99) was 
possible even though overall activity in A98 was higher 
than in W99. The strength of rhythm of animals maintained 
under LD 16:8 in the autumn was significantly (t test: / = 
2.54. P < 0.05) stronger than that of animals under LD 
8:16 at this time. No significant difference (t test: t = 0.27, 
P > 0.1) was observed in strength of rhythm in animals 
maintained under a photoperiod of LD 16:8 in the autumn 
compared to animals maintained under the same photo- 
period in the winter. Similarly, no significant difference (t 
test: t -- 0.65, P > 0.1) was observed in strength of 
rhythm in animals maintained under LD 16:8 or LD 8:16 
photoperiods in the winter. Finally the strength of rhythm of 
animals maintained under the LD 8:16 photoperiod in the 
winter was significantly (t test: t =-- 3.29. P < 0.01) 
stronger than that of animals under the LD 8: 16 photoperiod 
in the autumn. In the autumn, the most noticeable between- 
treatment variation was the much reduced overall activity 
and strength of rhythm under LD 8:16 compared to LD 
16:8. In the winter, no such differences in strength were 
observed since the strength of rhythm was high in all 
animals irrespective of photoperiod. 

Analysis of long-term locomotor activity o/'N. virens 

The results from each experimental treatment (LD 16:8 
and LD 8:16) were pooled to plot a three-dimensional (3D) 
topographical graph of activity (j-axis) over time (.Y-axis) 
and month (secondary .Y-axis) (Fig. 3a, b). Dashed rectan- 
gles beneath the .Y-axis represent the times of the imposed 
scotophase. The surface topography represents the mean 
hourly activity of four animals over the duration of 6 to 8 
days every month for 9 months. (Note: these results do not 
include data from the short-term A98 and W99 experi- 
ments). 

Figure 3a shows the pattern of locomotor activity under 



106 



K. S. LAST AND P. J. W. OLIVE 



3 300 




ooooooooooooooooooooo 
ooooooooooooooooooooo 



T- r~ oo m T- r*- 

"- T- (N O T- T- 



co ID 

CM O 



'-CSIO'-'- 



Time(G.M T.) 




ooooooooooooooooooooooo 
ooooooooooooooooooooooo 



Time (G.M.T.; 



Kigure 1. The mean beam breaks/hour (+SD) representative of foraging excursions under different 
photoperiods in the autumn (A4X) for Nereix vireiia. where the black rectangles represent times of artificial 
scotophase. (a) LD IftiX. n = 4; (h) LD S:I6, n =4. 



LD 16:S over the duration ot the experiment. Most of the 
activity was restricu-.l to the scotophase. except transiently 
in September and March, when late photophase activity was 
also observed. Little dillm-nce was seen between mean 
activities over each successive 4S-h period for the duration 



of 9 months. Activity was typically initiated around the time 
of the lights-off signal (steep topographical relief) and con- 
tinued to be high throughout all scotophases. 

Figure 3b shows the pattern of locomotor activity under 
LD 8:16. Between September and December there was no 



SEASONAL RHYTHMS IN N. VIKENS SARS 



107 



3 300 




ooooooooooooooooooooo 
ooooooooooooooooooooo 



CO 
CM 



O - T- 



CO IT) i- 
CM O i- 



o o 

o o 

r^ ro 

*- CM 



Time(G.M.T) 




Time (G.M.T.; 



Kigure 2. The mean beam breaks/hour (+SD| representative of foraging excursions under different 
photoperiods in the winter (W99| for Nereis virens, where the black rectangles represent times of artificial 
scotophase. (a) LD 16:8. n = 4; <h) LD S:I6, n = 4. 



activity in either the photophase or the scotophase. Noctur- 
nal activity increased dramatically after December, and then 
continued until termination of the experiment in June. This 
elevated activity occurred spontaneously and independently 
of any environmental signal. The major peak of activity was 
generally seen directly after lights-off, with raised activity 



during the rest of the scotophase. Activity during the pho- 
tophase was low. A perturbation was observed in March, 
when activity dropped significantly for the duration of the 
month. This is represented by the trough running the length 
of the graph from left to right. 

The results from the topographical data for LD 16:8 and 



108 



K. S. LAST AND P. J. W. OLIVE 



a 





Figure 3. Three-dimensional plot showing the topography of mean monthly activity (September to June) in 
Nereis vireits under different static photopenods. Dashed rectangles beneath the v-a\is represent times of the 
scotophase. Data points constituting surface topography number about 7(100 la) II) lo:X. /; = 4: Nearly all 
activity is confined to the scotophase excepi lor perturbations in September. October, and March, (b) LD 8:16. 
n = 4: Note the cessation of activity between September and the middle of December. At the beginning of 
January, a spontaneous resurgence of activity during the scolophase occurs, which is continuous for the rest of 
the experiment except for a decline in activity in March. 



LD 8:16 are summari/ed schematically in relation to the 
natural photoperiod in Figure 4. At the start of the experi- 
ment in September, the natural photoperiod was LD 13:1 |. 



All animals placed under the LD 16:8 photoperiod (Fig. 4a) 
showed strong, nocturnal activity that continued until 
March, when the natural photoperiod was once again LD 



SEASONAL RHYTHMS IN N. VIRENS SARS 



109 



High activity 



uuu im 




1998 



Date (day/month) 



1999 




Figure 4. Schematic summaries of the results for the static rectilinear 
9-month experiment under LD 16:8 (a) and LD 8:16 (h). Ambient day 
length (sunrise to sunset) is shown over time at latitude 55 N, giving the 
temporal position of the rectilinear photoperiodic treatments and type of 
activity in relation to the ambient photoperiods outside the laboratory. 
Solid arrows indicate where activity in Nereis \'irens is high; dotted arrows 
indicate where activity is low. 



12:12. At this time, additional activity was noted during the 
later part of the photophase. After March, activity was once 
again restricted solely to the scotophase. Animals placed 
under the LD 8:16 photoperiod, however, displayed a quite 
different activity pattern (Fig. 4b). In these animals, all 
activity was relatively low for 3 months, during the time 
when natural photophases are diminishing in the natural 
habitat (LD <12:>12). By the middle of December, the 
time when the natural scotophase is at its longest at this 
latitude ( 17 h), a spontaneous recovery of activity during the 
scotophase was observed. This pattern of elevated nocturnal 
activity continued in the laboratory at a time when the 
nights in the natural environment were gradually shorten- 



ing. At the spring equinox in March, when natural photo- 
periods were once again LD 12: 12. overall activity dropped 
substantially. From April to June, however, activity was 
once again elevated. 

Discussion 

The results presented here demonstrate that the pattern of 
locomotor activity expressed by Nereis virens is influenced 
by both the photoperiod to which the animals are subjected 
and the time of year in which the behavioral assay is 
conducted. Photoperiod and time of year appear to interact 
and modulate overall activity patterns, giving rise to vari- 
ability in the daily nocturnal activity patterns and in the 
overall strength of the rhythm associated with foraging 
activity. 

Our results also show that the activity of this polychaete 
is predominantly nocturnal under all photoperiods, irrespec- 
tive of season. The photophase suppressed activity in ani- 
mals under both photoperiodic treatments, and we believe 
that spurious beam breaks during the photophase constitute 
primarily "within-burrow" rather than "out-of-burrow" ac- 
(ivity (Last, 2003). We hypothesize that the conserved na- 
ture of this nocturnal response reflects a strong selective 
advantage as a predator-avoidance mechanism, since feed- 
ing excursions for N. virens are associated with predation 
risk from shorebirds and pleuronectenoid fish, which are all 
well-known diurnal, visual feeders (Thijssen et til., 1974: 
Carter a nl., 1991; Wilson, 1991 ). and such risk is reduced 
under cover of darkness. 

ActirilY in the autumn 

Under the LD 16:8 photoperiod in the autumn, the acto- 
gram showed a high level of nocturnal activity (Fig. la), 
which is synonymous with a high feeding rate (Last. 2003). 
In contrast, those animals under LD 8:16 displayed rela- 
tively reduced overall activity (Fig. Ib) signifying a low 
feeding rate. These findings are similar to those of Last and 
Olive (1999) using semiquantitative, manual methods to 
assess the degree of foraging activity at a similar time of 
year. 

Photoperiodism necessitates the presence of an underly- 
ing endogenous clock. The results of experiment A98 sup- 
port the presence of such an oscillator in N. virens. During 
the first scotophase, animals under LD 8:16 ceased activity 
at between 1000 and 1 100 GMT (Fig. Ib). 10-11 h after the 
onset of activity. This was surprising since the lights-on 
signal for these animals was at 1600 GMT, and inactivity 
was thus not expected for a further 7-8 h. The animals used 
in the A98 experiment would have been experiencing nat- 
ural photoregimes of LD 12:12. suggesting that the ob- 
served time of activity cessation was due to the entrainment 
of past photoperiodic regimes. We hypothesize that the 
nocturnal activity cessation under LD 8:16 may reflect a 



K. S. LAST AND P. J. W. OLIVE 



proactive response to the anticipated time of sunrise, there- 
fore providing indirect evidence for an endogenous timer. 
This response is surprising since these animals had been 
acclimatized to this photoperiod for a week. 

Activity in subsequent scotophases rapidly became bi- 
modal (Fig. Ib) with activity peaks in both early and late 
scotophases. Similar daily changes in activity under various 
photoperiods have been recorded for the locomotory activ- 
ity patterns of the onion fly Delia antiqita (Watari and Arai, 
1997). When this diurnal fly was subjected to photoperiods 
in which LD >8:<16. two peaks of activity were always 
observed. The first occurred in the early photophase and the 
second in the late photophase. Under short photoperiods 
(where LD <8:>16), the activity peaks fused as the "win- 
dow" of diurnal activity became smaller. For this species, it 
was suggested that the main, late-photophase activity peak 
was due to a predictive circudiun oscillator, whereas the 
early-photophase peak was solely due to a reactive lights-on 
response. For the experiment described here using N. virens, 
the response is interpreted as being an adjustment to the new 
photoperiodic cue, or Zeitgeber. where the observed inac- 
tivity at the expected dawn is evidence for transient behav- 
ior prior to attaining a steady state in the following scoto- 
phases. 

Coupling between the environmental Zeitgeber and the 
endogenous oscillator occurs through entrainment ( Aschoff. 
1965). The results illustrate that the process of entrainment 
of an activity rhythm in the autumn experiment depends on 
the photoperiodic regime. Subjecting animals to a photo- 
period of LD 8:16 considerably reduced the strength of the 
rhythm. We believe that this represents the initial stages of 
the autumn feeding cessation, which is triggered when the 
animals pass through a critical photoperiod LD cnl <12:>12 
(Last et ai. 1999). a characteristic physiological response at 
this time of year. This photoperiodically mediated change in 
activity provides an interesting result. At a time when the 
nights were becoming longer and hence, for these nocturnal 
animals, the "potential" for nocturnal feeding was gradually 
increasing, all activity became much reduced. It has been 
demonstrated elsewhere (Last and Olive, 1999) that under a 
photoperiod of LD 8:16, rates of somatic growth, segmen- 
tation, and regeneration all become much reduced and en- 
ergy is channeled into future reproductive growth through 
chani'cs in \itellogenesis or vitellin incorporation into the 
developing oocytes (Rees and Olive, 1999). We regard this 
as the initiation of a switch from somatic to reproductive 
growth. The photoperiodic transition therefore appears to 
trigger a change in physiological stale (McNamara and 
Houston. l l )9(,i hum one in which essentially somatic 
growth processes predominate to one in which acquired 
resources arc rolepln ed to sexual development. It seems at 
first surprising that this change in physiological state is not 
restricted hi annuals that will breed in the following spring, 
bul occurs in all individuals regardless of aue or state of 



maturity. A fitness model based on the life history of N. 
virens suggests, however, that when either or both net 
foraging risk and net foraging gain vary seasonally, a sub- 
stantial fitness benefit accrues when all members of a 
mixed-age population respond to environmental signals and 
reduce foraging at times of maximum risk or minimum 
benefit (Olive et ai, 2000, 2001 ). 

Parallels can be drawn with the Salmonidae, in which 
temperature and daylength alone do not dictate physiolog- 
ical changes. Bimodality in wild fish will separate animals 
destined to smolt in the following spring from those that are 
not (Thorpe et <//.. 1980; Skilbrei, 1991), a mechanism that 
has long been known to be photoperiodically induced (Vil- 
larreal et ul.. 1988). In S. stilar, the advancement of smol- 
titication through photoperiodic manipulation has been 
shown (Duston and Saunders, 1995) to largely reduce the 
effects of bimodality and has provided evidence that, in the 
salmonids at least, a coupling between threshold length, 
photoperiod (and the circadian clock), and time of year (the 
seasonal/circannual clock) determines bimodal segregation 
of individuals and maturational development. 

Activitv in the winter 

The seasonal modulation of activity in N. virens was 
further exemplified when the same experiments were re- 
peated in the winter. Whereas in the autumn there had been 
a nearly complete cessation of foraging activity under LD 
8:16 (Figs. Ib and 3b). by the winter the amplitude of 
activity under LD 8:16 (Fig. 2b) had dramatically increased 
and was high compared to activity in the autumn or under 
LD 16:8 (Fig. 2a). In addition, the results of autocorrelation 
analysis showed no significant between-treatment differ- 
ence in mean strength of rhythm between winter LD 8:16 
and LD 16:8. We postulate that, for animals that have not 
reached some critical state of sexual maturity, the optimum 
strategy must change as the optimum time for breeding 
approaches. In these animals, renewed foraging increases 
the probability that sufficient energy reserves will be ac- 
crued for reproduction one year later. Since out-of-burrow 
foraging by N. virens is inevitably associated with predation 
risk, increased nocturnal activity at this time will maximize 
exploitation of the feeding time and minimize the risk of 
predation from diurnal predators. Animals that have reached 
a critical state of maturity become susceptible to a feedback 
response from the maturing gametes (Porchet and Cardon, 
1976; Golding and Yuwono. 1994). This seasonally medi- 
ated change in activity under LD 8:16 occurred indepen- 
dently of photoperiodic treatment, which is suggestive of an 
endogenous seasonal (and possibly circannual) rhythm of 
activity or the operation of some long-term interval timer. 

Interestingly, the mean peak activity during the lirst two 
nights occurred around midnight (Fig. 2b). which cannot 
readily be explained at this stage. We hypothesize that, as in 



SEASONAL RHYTHMS IN N. V/RENS SARS 



III 



the A98 experiment (Fig. Ih). activity onset may have been 
due to a "memory" of past photoperiodic regimes. The 
7-day acclimatization period imposed on these animals un- 
der their new photoregime may not have been long enough 
to prevent transient activity before a new steady state had 
been reached. The observed "snapshot" of activity under the 
autumn and winter photoperiodic treatments may be influ- 
enced by the photoperiodic history of the animals. In view 
of these results, a long-term assay under constant photope- 
riods was deemed the only suitable method for establishing 
true endogenous behavior without transient manifestations. 
Under those conditions, any spontaneous changes in activity 
would imply the effects of a purely endogenous, rather than 
exogenous, response to an innate underlying seasonal oscil- 
lator or interval timer. 

Long-term activity patterns in N. virens 

The results shown in Figure 3b demonstrate that a long- 
term regulator of activity does indeed exist in the polychaete 
N. virens. This endogenous modulation is revealed under a 
constant LD 8:16 photoperiod, 3 months after the transition 
through the critical photoperiod LD cnI <12:>12 previously 
described by Last et al. ( 1999). The resurgence of activity 
under this photoperiod was spontaneous and, irrespective of 
the experimental photoperiod, occurred around the time of 
the winter solstice. Subjecting animals to a photoperiod of 
LD 16:8 will result in the negative masking (Aschoff, 1960) 
of any long-term endogenous oscillators. 

Proactive anticipation of the spring equinox has been 
suggested previously for other nereid polychaetes (Olive 
and Garwood. 1983; Fong and Pearse, 1992a, b), and the 
results presented here provide further evidence for the ex- 
pression of an overt endogenous seasonal clock in the 
Nereidae. Perturbations in the activity patterns of N. virens 
were observed under both photoperiodic treatments in 
March. Under LD 16:8, a late photophase peak was ob- 
served prior to the scotophase (Figs. 3a and 4a). and under 
LD 8:16 a marked drop in activity was observed in both the 
photophase and the scotophase (Figs. 3b and 4b). These 
perturbations occurred when the animals would, under nat- 
ural photoperiods, pass through the spring critical photo- 
period (where LD crlt >12:<12). The significance of these 
perturbations is not yet clear, but may indicate a change in 
the sensitivity of the endogenous pacemaker to the external 
photoperiod around the time of the spring equinox. 

Seasonally overt changes in physiological state and be- 
havior of this long-lived polychaete do not occur solely as a 
direct response to changes in proximate factors such as 
temperature and, particularly, daylength. We believe that 
while seasonally changing daylengths will actively drive 
changes in physiological state through photoperiodism at 
certain times of the year, at other times, photoperiod acts as 
a Zeitgeber to entrain an endogenous seasonal rhythm. Such 



a mechanism has also been implicated in another marine 
invertebrate, Pisaster ochruceus. In this sea star, gameto- 
genesis can be shifted by maintaining the animals on a 
seasonally changing photoperiod regime out-of-phase with 
ambient photoperiods (Pearse el al.. 19X6). Like our results, 
this finding is suggestive of an endogenous annual calendar. 
To infer that these results are evidence for a circunnual 
rhythm in N. virens would be premature since the observed 
response could have also been caused by an interval timer 
measuring a time period of approximately 90 days. Work is 
in progress to examine the endogenous modulation of ac- 
tivity patterns over the duration of years instead of months. 
We provide here evidence of a long-term modulation of 
activity in N. virens under fixed photoperiods. This mech- 
anism modulates the response of individuals to the natural 
photoperiod according to real time and may be an essential 
adaptive component of the photoperiodically adjusted sea- 
sonal cycle of growth and reproduction. 

Acknowledgments 

This work was supported by the award of a NERC 
Industrial Case Studentship to K.S.L. and the DEMA the- 
matic award GST/02/2164, NERC/T/S/200/00273 tit 
P.J.W.O. Current funding to P.J.W.O. is from the NERC 
Environmental Genomics Programme NERC/T/S/2001/ 
0273. We wish to acknowledge the additional financial 
support of the Industrial Sponsors Seabait Ltd., Ashington 
Village, Northumberland, NE63 9NW, for the supply of the 
experimental material as well as for allowing us to use 
procedures subject to patent. Thanks finally to the construc- 
tive comments of the anonymous referees and C. D. Derby. 

Literature Cited 

Asrhoff, ,1. 1960. Exogenous and endogenous components in arcadian 
rhythms. Cold Sprint; Harbor S\mp. 25: 1 I-2X. 

Aschoff, J. 1965. Orcadian rhythms in man. Science 148: 1427-1432. 

Carter, C. G., D. J. Grove, and D. M. Carter. 1991. Trophic resource 
partitioning between two coexisting flatfish species off the north coast 
of Anglesey, North Wales. Neth. J. Sen Ke\. 23: 325-335. 

Dowse, H. B., and J. M. Ringo. 1989. The search for hidden period- 
icities in biological time-series revisited. J. Theor. Biol. 139: 487-515. 

I >u , I, >u. ,)., and R. L. Saunders. 1995. Advancing smoking to autumn in 
age 0+ Atlantic salmon by photoperiod, and long-term performance in 
sea water. At/nudi/mrc 135: 295-309. 

Dniillc nl, P. 1995. Rhythms and autocorrelation analysis. Biol. R/nihni 
Rex. 26: 173-143. 

Fong, P. P., and J. S. Pearse. 1992a. Evidence for a programmed 
circannual life cycle modulated by increasing daylengths in Nciintlic* 
Iniiiiiciilti (Polychaeta: Nereidae) from central California. Biol. Hull. 
182: 289-297. 

Fong, P. P., and J. S. Pearse. 1992h. Photoperiodic regulation of 
parturition in the selt tertilising viviparous polychaete Neiiinlii : \ lim- 
nictilti from central California. Mm: Biol. 112: 81-89. 

Garwood, P. R., and P. J. \V. Olive. 1982. The influence ol phoiop,-i HH] 
on oocyte growth and its role in the control of the reproductive cycle ol 
ihe polychaete Harmothoe iinhricutn ([.). Int. ./. Invertebi: Rcpind. 5: 
161-165. 



112 



K. S. LAST AND P. J. W. OLIVE 



(ioldim>. I). \V., and K. Yuwono. 1994. Latent capacities for gameto- 
genic cycling in the semelparous invertebrate Nereis. Proc. Natl. Acad. 
Sci. USA 91: 11777-11781. 

Last, K. S. 2003. An actograph and its use in the study of foraging 
behaviour in the benthic polychaete. Nereis virens Sars. J. Exp. Mar. 
Biol. Ecoi 287: 237-24S. 

Last, K. S., and P. J. W. Olive. 1999. Photoperiodic control of growth 
and segment proliferation by Nereis (Neantlies) virens Sars in relation 
to real time and state of maturity. Mar. Bid. 134: 191-199. 

Last, K. S., P. J. W. Olive, and A. Edwards. 1999. An actographic 
study of diel activity in the semelparous polychaete Nereis (Neanthes) 
virens Sars in relation to the annual cycle of growth. Invertebr. Reprod. 
Dev. 35: 141-145. 

Marcus, N. H. 1986. Population dynamics of marine copepods: the 
importance of photoperiodism. Am. Zool. 26: 469-477. 

McNamara, J. M., and A. I. Houston. 1996. State-dependent lite- 
histories. Nature 380: 215-221. 

Nisimura. T., and H. Numata. 2001. Endogenous timing mechanism 
controlling the circannual pupation rhythm of the varied carpet beetle 
Anlhrenus verbose i. J. Comp. Physiul. A 187: 433-440. 

Olive, P. J. VV., and P. R. Garwood. 1983. The importance of long term 
endogenous rhythms in the maintenance of reproductive cycles of 
marine invertebrates a reappraisal. Int. J. Invertebr. Reprod. 6: 339- 
347. 

Olive, P. J. W., J. Fletcher. S. Rees, and G. Desrosiers. 1997. Inter- 
actions of environmental temperature with photoperiod in determining 
age at maturity in a semelparous polychaete Nereis (Neaitthes) vircn* 
Sars. J. Therm. Biol. 22: 489-497. 

Olive, P. J. W., C. Lewis, and V. Beardall. 2000. Fitness components 
of seasonal reproduction: an analysis using Nereis virens as a lite 
history model. Oceanol. Acta 23: 377-389. 

Olive, P. J. W., C. Lewis, V. Beardall, K. Last, and M. G. Bentley. 
2001. Fitness consequences of seasonal reproduction: experiments on 
the polychaete Nereis virens Sars. Pp. 321-341 in Environment unJ 
Animal Development. D. Atkinson and M. Thorndyke, eds. Bios Sci- 
entific Publishers, Oxford. 

Palmer, J. D., B. G. Williams, and H. B. Dowse. 1994. The statistical 
analysis of tidal rhythms: tests of the relative effectiveness of five 



methods using model simulations and actual data. Mar. Behav. Pliysiol. 
24: 165-183. 

Pearse, J. S., and D. J. Eernisse. 1982. Photoperiodic regulation of 
gametogenesis and gonadal growth in the sea star Pisaster ochraceus. 
Mar. Biol. 67: 121-125. 

Pearse, J. S., D. J. Eernisse, V. B. Pearse, and K. A. Beauchamp. 1986. 
Photoperiodic regulation of gametogenesis in sea stars, with evidence 
for an annual calendar independent of fixed daylength. Am. Zool. 26: 
417-431. 

Porchet, M., and C. Cardon. 1976. The inhibitory feed-back mecha- 
nism coming from oocyte and acting on brain endocrine activity in 
Nereidae. Gen. Comp. Endocrinol. 30: 378390. 

Randall. C. F., N. R. Bromage, J. Duston, and J. Symes. 1998. Pho- 
toperiod induced phase shifts of the endogenous clock controlling 
reproduction in the rainbow trout: a circannual phase response curve. J. 
Reprod. Ft-rtil. 112: 399-405. 

Rees, S. W., and P. J. W. Olive. 1999. Photoperiodic changes influence 
the incorporation of vitellin yolk protein by oocytes of the semelparous 
polychaete Nereis (Neanthes) virens. Comp. Biochem. Pliysiol. A 123: 
213-220. 

Skilbrei, O. T. 1991. Importance of threshold length and photoperiod for 
the development of bimodal length frequency distribution in Atlantic 
salmon (Salmo \alar). Can. J. F'ixh. Ai/iiut. Sci. 48: 2163-2172. 

Thijssen, R., A. J. Lever, and J. Lever. 1974. Food composition and 
feeding periodicity of 0-group plaice (Pleuronectcs platessa) in the 
tidal area of a sandy beach. Neth. J. Sea Res. 8: 369-377 

Thorpe, J. E., C. Talbot, and C. A. Villarreal. 1980. Bimodality in 
growth and smelting in Atlantic salmon. Salmo salar L. Aquaculture 
28: 123-132. 

Villarreal, C. A., J. E. Thorpe, and M. S. Miles. 1988. Influence of 
photoperiod on growth changes in juvenile Atlantic salmon. Salmo 
salar L. J. Fish Biol. 33: 15-30. 

Watari, V'., and T. Arai. 1997. Effects of photoperiod and aging on 
locomotor activity rhythms in the onion fly. Delia antif/iia. J. Insect 
Physiol. 43: 567-576. 

Wilson, W. H. 1991. The importance of epibenthic predation and ice 
disturbance in a Bay of Fundy mudflat. Ophelia 5: 507-514. 



Reference: Biol. Bull. 206: 1 13-120. (April 2004) 
2004 Marine Biological Laboratory 



Adaptable Defense: A Nudibranch Mucus Inhibits 
Nematocyst Discharge and Changes With Prey Type 

PAUL G. GREENWOOD*. KYLE GARRY, APRIL HUNTER, AND MIRANDA JENNINGS 
Colby College, Department of Biology. 5732 Mayflower Hill. Ware n'i lie. Maine 04901 



Abstract. Nudibranchs that feed on cnidarians must de- 
fend themselves from the prey's nematocysts or risk their 
own injury or death. While a nudibranch's mucus has been 
thought to protect the animal from nematocyst discharge, an 
inhibition of discharge by nudibranch mucus has never been 
shown. The current study investigated whether mucus from 
the aeolid nudibranch Aeolidia papillosa would inhibit 
nematocyst discharge from four species of sea anemone 
prey. Sea anemone tentacles were contacted with mucus- 
coated gelatin probes, and nematocyst discharge was quan- 
tified and compared with control probes of gelatin only. 
Mucus from A. papillosa inhibited the discharge of nema- 
tocysts from sea anemone tentacles. This inhibition was 
specifically limited to the anemone species on which the 
nudibranch had been feeding. When the prey species was 
changed, the mucus changed within 2 weeks to inhibit the 
nematocyst discharge of the new prey species. The nudi- 
branchs apparently produce the inhibitory mucus rather than 
simply becoming coated in anemone mucus during feeding. 
Because of the intimate association between most aeolid 
nudibranchs and their prey, an adaptable mucus protection 
could have a significant impact on the behavior, distribu- 
tion, and life history of the nudibranchs. 

Introduction 

All predators must overcome their prey's defenses to 
feed. In the case of nudibranchs that feed on cnidarians, the 
predator must defend itself from the prey's nematocysts or 
risk its own injury or death (Harris, 1973; Conklin and 
Mariscal, 1977). Nematocysts from non-prey cnidarians can 
kill the nudibranch (Grosvenor, 1903); even the prey species 
can be dangerous if the individual is large enough (Harris, 



Received 2 July 2002; accepted 21 January 2004. 
* To whom correspondence should he addressed. 
pggreenw@colby.edu 



E-mail: 



1973. 1986; Conklin and Mariscal. 1977). Defenses that 
might protect aeolids from nematocysts include behaviors 
that limit contact of the nudibranch with the prey (Grosve- 
nor. 1903). morphological adaptations such as ellipsoid 
vacuolate cells of the epithelium (Graham. 1938; Porter and 
Rivera, 1980; Martin and Walther. 2003) or a cuticle that 
lines the mouth region of the nudibranch (Edmunds. 1966), 
and copious mucous secretions (Graham, 1938; Russell, 
1942; Edmunds, 1966). 

It has been hypothesized for over a century that the 
nudibranch's mucus serves as a protective barrier against 
nematocysts (Boutan, 1898). Grosvenor (1903) suggested 
that there might be some acclimatization to nematocysts as 
part of the mucous defense, because copious mucus was not 
enough to protect nudibranchs from different cnidarian spe- 
cies. However, Salvini-Plawen (1972) hypothesized that 
"hyper-viscous" mucous secretions would inhibit nemato- 
cyst discharge generally and that it would be unnecessary to 
adapt the protective nature of mucus to specific prey. Conk- 
lin and Mariscal (1977) noted that the aeolid nudibranch 
Spurilla neapolitana was apparently stung by its prey anem- 
ones during the first few minutes of feeding but the nudi- 
branchs' behavior indicated that nematocyst discharge then 
ceased. These authors hypothesized that aeolids might pro- 
duce or acquire (from the prey) a substance that prevented 
nematocyst discharge. Recently Mauch and Elliott (1997) 
found that mucus from the aeolid nudibranch Aeolidia pap- 
illosa caused fewer nematocysts to discharge from its po- 
tential prey, the sea anemone Anthopleiira elegantissima. 
than mucus from other gastropods did. Mauch and Elliott 
( 1997) hypothesized that the nudibranchs might adapt their 
mucus as protection from their cnidarian prey, but the 
nudibranch mucus was tested on only one species of cni- 
darian. 

While a few nudibranchs are highly specialized and feed 
exclusively on one prey species, most nudibranch species 



114 



P. G. GREENWOOD ET AL 



can feed on several different prey species (Thompson, 1976; 
Todd el ni, 2001). Monophagous species might have de- 
fensive mucus that works well against the nematocysts of a 
single prey species, but the more generalist feeders need an 
effective defense against a number of cnidarian species 
(with different nematocyst types). Such nudibranchs might 
require defensive mucus that changes properties depending 
upon which prey is being consumed. 

The current study investigated whether mucus from the 
aeolid nudibranch Aeolidia papiltoxa inhibited nematocyst 
discharge from different sea anemone species, and whether 
the inhibitory nature of the mucus changed when the prey 
species was changed. Individuals of A. papillosa feed al- 
most exclusively on sea anemones (Hall and Todd, 1986). 
In its New England subtidal habitat. A. papillosa is fre- 
quently found among populations of the sea anemone 
Metridiiun .senile, but is also found associated with a variety 
of other sea anemone species (Harris, 1973; Reidy, 1996). 
Individuals of A. papillosa have been induced to change 
prey species in the laboratory (Hall et ai, 1982; Hall and 
Todd, 1984, 1986), but in the field a single prey species may 
dominate a large area. Concentrated prey distribution and 
low nudibranch mobility means that individual nudibranchs 
might spend most of their lives closely associated with just 
one prey species (Harris, 1973, 1987; Todd, 1983). Because 
of this intimate association between A. papillosa and its 
prey, protection from the prey's nematocysts has a signifi- 
cant impact on the behavior, distribution, and life history of 
the nudibranch. 

We used mucus-coated gelatin probes in a highly repro- 
ducible method (Watson and Hudson. 1994) to investigate 
the effects of A. pctpillosa mucus on nematocyst discharge. 
When gelatin probes are touched to sea anemone tentacles, 
nematocysts that discharge into the gelatin remain attached 
to the probe and are easily counted (Watson and Hessinger, 
1989; Watson ct til.. 1999). In this study, mucus-coated 
gelatin probes were used to mimic the contact of a nudi- 
branch to the sea anemones. We also probed sea anemones 
in the presence of N-acetylneuraminic acid (NAN A). 
NANA, which mimics the complex molecules containing 
N-acetylated sugars commonly found on the sea anemones' 
normal prey (Thorington and Hessinger. 1988). has been 
found ID increase the sensitivity of sea anemone nemato- 
c\tes in mechanical stimulation (Thorington and Hessinger. 
1988. 1990. 1998; Watson and Hessinger. 1994). With 
NANA. we can therefore determine whether nudibranch 
mucus actually inhibits nematocyst discharge or simply 
provides no stimulus for discharge. 

Materials and Methods 

Aniiiiiil collection and maintenance 

Individuals of the nudibranch Aeolidia pupillnxii and the 
sea anemone Mciriilimn senile were collected from a float - 



ing commercial fishing dock in Portsmouth, New Hamp- 
shire. Individuals of A. papillosa and the sea anemones 
Urticina feliiui and Aiilnctinici stella were collected midway 
through the littoral zone on bedrock at west Quoddy Head in 
Lubec, Maine (courtesy of C. Sisson). Twelve individuals 
of A. papillosa, living among individuals of the sea anem- 
one Anthopleura ele^antissima, were collected from the low 
intertidal zone on the coast of California (supplied by Pa- 
cific Biomarine Supply, Venice, CA). Individuals of A. 
ele^iintissiimi were collected from the low intertidal zone of 
San Juan Island. Washington (courtesy of D. Duggins). All 
animals were kept in refrigerated aquaria with recirculating 
and refiltered seawater (1 1 C, 319rr salinity, pH 8.2) col- 
lected at the Darling Laboratory, University of Maine, Wai- 
pole, Maine. Anemones were kept in separate plastic or 
glass containers within the aquaria, and the nudibranchs 
were placed in separate acrylic plastic containers, segre- 
gated according to the sea anemone species on which they 
were feeding. Sea anemones were fed frozen brine shrimp 
every 2 days, and the nudibranchs were fed sea anemones 
ad libidinn. The sea anemones that were used as prey all had 
pedal disk diameters less than 3 cm. and the nudibranchs 
ranged in length from 1 cm to 7 cm. Individuals of M. senile 
were held for no more than 2 months before being replaced 
with other animals; the other species of sea anemones were 
held for less than a month. 

Control probes, mucus-coated probes, and general 
probing of sea anemone tentacles 

We used gelatin probes to quantify nematocyst discharge 
from tentacles of sea anemones. Each probe was made by 
coating one end of a 6-cm length of monofilament fishing 
line (Stren. 6-lb-test or 17-lb-test) with 25 r /c (weight/vol- 
ume) gelatin in E-pure deionized water (modified slightly 
from Watson and Hudson, 1994). Occasionally, the gelatin 
did not adhere well to the probe, and such probes were 
discarded. The gelatin adhered better to the 1 7-lb-test line 
than to the 6-lb-test line, so the number of probes discarded 
was smaller when the heavier line was used, as it indeed 
was. in later experiments. Probes that were coated with only 
gelatin served as controls. 

To prepare an experimental mucus-coated probe, a nudi- 
branch was removed from the water and a gelatin probe was 
gently wiped across its dorsal surface (from anterior to 
posterior) four times. Three mucus-coated probes were 
made from each nudibranch. Anemones that had not been 
fed for between 24 and 36 hs were placed into separate glass 
dishes that contained a probing solution of cither filtered 
seawater alone, or filtered seawater and NANA. Ten min- 
utes after the anemones were placed into the probing solu- 
tion, each dish was placed under an Olympus SC30 ste- 
reomicroscope. and probing began with the edge ot the 
probe tip being lightly touched to one tentacle about 5 mm 



SEA SLUG MUCUS INHIBITS NEMATOCYSTS 



115 



proximal to the tentacle tip. Three control probes and three 
experimental probes, all prepared from the same nudi- 
branch, were used to probe each anemone. Used probes 
were fixed in 2.5% glutaraldehyde in filtered seawater for at 
least 30 s and then placed into 3 drops of deionized water on 
a microscope slide. Individual nematocysts that had dis- 
charged into the gelatin were counted, using an Olympus 
CK2 inverted phase contrast microscope equipped with a 
40 X objective lens. In early experiments with probes made 
from 6-Ib-test monofilament line, we counted nematocyst 
capsules from at least three fields of view, and the mean was 
calculated for each probe. In later experiments, when we 
used probes made from 17-lb-test line, the nematocyst cap- 
sules from one central field of view were counted. Using 
these techniques, between 75% and 100%' of the discharged 
nematocysts on each probe were counted, and both types of 
probes yielded highly reproducible results. 

Does a midibrunch 's mucus inhibit the nematocyst 
discharge from the tentacles of its prey species? 

Probes were coated with mucus from 12 individuals of 
Aeolidia papillosa of mixed sizes that had been feeding on 
the sea anemone Metridium senile and with mucus from 6 
individuals of A. papillosa of mixed sizes that had been 
feeding on the sea anemone Urticina felina. These mucus- 
coated probes were then used to probe feeding tentacles 
from the sea anemones M. senile, U. felina, and Aiilactinia 
Stella. In each experiment, one anemone was always tested 
with three control probes and then, immediately afterwards. 
with three experimental (mucus-coated) probes; the exper- 
imental probes were coated with mucus from an individual 
nudibranch. The mean number of discharged nematocysts in 
the three probes was used to calculate a grand mean of 
nematocyst discharge in response to mucus from each nudi- 
branch. These grand means were tested for normality and 
equal variances and then analyzed using Student's / tests (or 
the Mann-Whitney U test when variances were unequal) to 
compare nematocyst discharge into mucus-coated probes 
with discharge into control probes for each species. To 
minimize the effects of captivity on nematocyst discharge, 
each species of anemone was tested within 2 weeks of its 
collection. 

//" the prey species is changed, will the effect of the 
nudibranch mucus on nematoc\st discharge also change? 

Seven specimens of A. papillosa were collected from 
several New England localities and were fed U. felina for 16 
days in the laboratory. During that period, mucus-coated 
probes were used to test nematocyst discharge from the 
tentacles of U. felina and M. senile. The nudibranchs' prey 
was then switched from U. felina to M. senile and. over a 
2-week interval, mucus-coated probes were used periodi- 
cally to test nematocyst discharge from both sea anemone 



species. Because the baseline number of nematocysts dif- 
fered between the two sea anemone species, these data were 
converted to relative values, where a relative value of 1.0 
represents the average number of nematocysts discharged 
into control probes. Data collected from mucus-coated 
probes for each day were converted to an average relative 
discharge based on controls for that day from the same 
anemones. Results from tests on each sea anemone species 
were analyzed by ANOVA and with Scheffe's test for 
pairwise comparisons. 

If a second prey species is offered, will the effect of the 
mtdihranch mucus on neiuatoc\st discharge change? 

Four individuals ot A. papillosa were fed the sea anem- 
one M. senile for 21 days. Mucus-coated probes were used 
to test nematocyst discharge from feeding tentacles of M. 
senile and the sea anemone Anthopleura elegantissima. The 
nudibranchs were then offered both M. senile and Antho- 
pleura elegantissima. Anthopleura elegantissima is not 
found on the coast of New England, so the experimental 
nudibranchs could not have encountered this prey species 
before. Fourteen days later, mucus-coated probes were used 
to test nematocyst discharge from the tentacles of both 
species of prey anemone. Data were converted to relative 
discharge values as described for the previous experiment 
and analyzed using Student's t tests. 

Does the nudibranch produce its own inhibitory mucus or 
simplv become covered in the prev's mucus? 

Any inhibitory effect of the nudibranch's mucus coating 
could be a result of the nudibranch being coated in the 
mucus of the prey species during feeding. To test this 
possibility, we compared the inhibitory effectiveness of 
mucus removed from a particular region of a nudibranch 
with mucus removed from that same region 45 min after 
wiping that area clean. Probes were coated with mucus from 
eight individuals of A. papillosa of mixed sizes that had 
been feeding on the sea anemone M. senile. The probes 
were coated with mucus from the dorsal surface of the 
nudibranch immediately behind the heart. Each nudibranch 
was then transferred to fresh filtered seawater. Sterile cotton 
swabs were used to wipe the mucus from the dorsal surface 
of the nudibranch and from the surrounding cerata. Six 
additional swabs were used to wipe the nudibranch a total of 
seven times, and the nudibranch was again transferred to 
fresh filtered seawater. After the nudibranch was allowed to 
recover from this treatment for 45 min, additional probes 
were coated with mucus from its dorsal surface immediately 
behind the heart. The mucus-coated probes were then all 
used to probe feeding tentacles of M. .senile. Three probes 
were coated with mucus from each nudibranch for each 
treatment (unswabbed and swabbed). Counting of all probes 
was done blind. The mean number of discharged nemato- 



116 



P. G. GREENWOOD ET AL. 



3 50- 



Control probes 
Mucus-coated probes 



(6) 




FSW 



FSW + NANA 



Figure 1. Number of nematocysts discharged into control probes or 
into probes coated with mucus from individuals of Aeolulia papillosa that 
had been feeding on Metridit/ni xcnile. Mucus-coated probes were used to 
probe tentacles of the sea anemone M. senile in both filtered seawater 
(FSW) and FSW containing 1CT 7 M N-acetylneuraminic acid (FSW + 
NANA), and compared against control probes of gelatin only. The numbers 
in parentheses are the numbers of anemones used (control probes) or the 
numbers of nudibranchs used (mucus-coated probes) per test. 



cysts into mucus-coated probes from unswabbed nudi- 
branchs was compared to nematocyst discharge into mucus- 
coated probes from swabbed nudibranchs and into control 
probes. Analysis was done by ANOVA and with Scheffe's 
test for pairwise comparisons. 

We also investigated whether the mucus of M. senile 
individuals inhibited discharge from other individuals of M. 
senile held in separate containers. Individual sea anemones 
were transferred to filtered seawater. allowed to recover for 
10 min, transferred to fresh filtered seawater again, allowed 
to recover for 10 mm. and finally transferred to a dry, clean 
glass dish. The sea anemone secreted mucus for 10 min and 
was removed from the dish. The mucus was removed from 
the dish and stored in sterile microcentrifuge tubes. Gelatin 
probes were placed into the mucus for 2 min and used to 
probe different individuals of M. .senile. Three probes were 
coated with mucus from each of tour anemones. The mean 
number of discharged nematocysts in the mucus-coated 
probes was compared to that number in control probes with 
no mucus. Data were analy/ed using Student's / tests as 
described above. 

Results 

Does a luulihraneli's nu/ens inliihit the neinaloeyst 
t!i-,< Inline ti'din the lentaeles of its prey species'.' 

When tentacles of the sea anemone Metruliiim senile 
were probed with control probes in seawater, a baseline 
discharge response \\.is observed (Fig. 1 ). The nematocysts 
that discharged into the gelatin were mostly basitrichous 
isorhi/us along with some microhasic p-masligophores. 



Gelatin probes coated with mucus from the nudibranch 
Aeoliiliu papillosa that had been feeding on M. senile elic- 
ited 51% fewer nematocysts to discharge from M. senile 
than control probes did (Student's / test, t g = 5.1. P - 
0.0006) (Fig. 1). When probing was done in seawater 
containing 1()~ 7 M NANA. the number of nematocysts that 
discharged into mucus-coated probes was almost 657r less 
than the number that discharged into control probes (Stu- 
dent's nest, /,,, = 9.1. P < 0.0001) (Fig. 1 ), but the mean 
number of discharges into control probes was higher than 
when NANA was omitted (Student's t test, t L> = 4.1. P < 
0.003). For each anemone species, probing in 10~ 7 M 
NANA elicited a greater number of discharged nematocysts 
than probing in seawater alone (Fig. 2). Statistical results 
were as follows: for M. senile. Student's ; test. t, t = 4.1. 
P < 0.003: for Aulactinia stella. Student's / test. f 2 = 4.5. 
P < 0.05: for Anthopleura elegantissima. Student's / test. 
t 4 = 5.0. P = 0.008. Because it increased the response, 
KF 7 M NANA was used for all subsequent experiments. 

When probes coated with mucus from A. papillosa that 
had been feeding on M. senile were used to probe the sea 
anemones Unicina felina and Aulactinia stella. there was a 
small but nonsignificant increase in nematocyst discharge 
over controls (for U. felina. Student's / test, ?,,, = 0.344, 
p = o.7(); for Aitlaetinia stella. Student's t test, / 2f) = 
0.76. P = 0.46) (Fig. 3). As before, significantly fewer 
nematocysts discharged into mucus-coated probes from ten- 
tacles of M. senile than into control probes (Student's ; test, 
r s == 9.0. P < 0.0001) (Fig. 3). Nematocysts from U. 
felina were mostly microbasic p-mastigophores and some 
basitrichous isorhizas. Nematocysts from Aulactinia stella 
were basitrichous isorhizas and microbasic p-mastigophores 
in about equal numbers. The mucus effectiveness was sim- 



z 

a 

U 

00 



Q 

V- 

o 

I 




10- 



M. senile 



A. stellu A. elegantissima 



I i^uri' 2. Number ol nenutocxsts discharged into control piobes. 
Tentacles ol ihe sea anemones Mctruliuin .vci/f, Aulactinia ^Iclla. and 
Aniliii/ilriirn clt\(;iiiiii\.\iimi were probed in filtered seawater (FSW) and 
tentacles ol other individuals of each species were probed in FSW con- 
laining Id ' A/ N-acel\lneuraminic acid (FSW + NANA). The numbers in 
parentheses are the numbers of anemones used per test. 



SEA SLUG MUCUS INHIBITS NEMATOCYSTS 



17 



z 
8 
I 



Q 
o 

U 

1 

3 

Z 



Control probes 
Mucus-coaled probes 




M. senile 



A. Stella 



U. felina 



Figure 3. Number of nematocysts discharged into control probes or 
into probes coated with mucus from individuals of Aeolulia papillosa that 
had been feeding on Metridium senile (SD). Mucus-coated probes were 
used to probe tentacles of the sea anemones M. senile, Aulactiniu xtclla. 
and Urticina fell/in (in 10~ 7 M N-acetylneurammic acid) and were com- 
pared against control probes of gelatin only. The numbers in parentheses 
are the numbers of anemones used (control probes) or the numbers of 
nudibranchs used (mucus-coated probes) per test. 



ilar among individual nudibranchs regardless of their size 
(ANOVA, F h4S = 0.76, P = 0.61). 

When gelatin probes coated with mucus from individuals 
of A. papillosa that had been feeding upon U. felina were 
tested on the tentacles of U. felina, nematocyst discharge 
was 67% less than discharge into the control probes ( Mann- 
Whitney U test, t/ 4]6 = 24, P = 0.01) (Fig. 4). When 
probes coated with mucus from A. papillosa that had been 
feeding on U. felina were used to probe the sea anemones 
M. senile and Aulactinia stella, nematocyst discharge was 



60- 



I 



Q 

'-4 

O 

I 



Control probes 
Mucus-coated probes 



(4) 




M. senile A. stella 



U. felina 



Figure 4. Number of nematocysts discharged into control probes or 
into probes coated with mucus from individuals of AealiJia papillosa that 
had been feeding on Urticina felina (SD). Mucus-coated probes were 
used to probe tentacles of the sea anemones Metridium senile, Aulactiniu 
stella, and U. felina (in 1C)" 7 M N-acetylneuraminic acid) and were 
compared against control probes of gelatin only. The numbers in paren- 
theses are the numbers of anemones used (control probes) or the numbers 
ot nudibranchs used (mucus-coated probes) per test. 



no different than in controls (for M. senile. Student's / test. 
t b = 1 . 10. P = 0.3 1 ; \\irAulactinia stella. Student's t test, 
? h = 1.96. P = 0.098) (Fig. 4). 

If the prey species is changed, will the effect of the 
nudibranch mucus on nenuiiocyst discharge also change? 

Seven individuals of A. papillosa that had been collected 
from several different New England localities were fed U. 
felina for 16 days in the laboratory. As before, nematocyst 
discharge into mucus-coated probes was 50% less than 
nematocyst discharge into control probes for U. felina, but 
not for M. senile (Fig. 5). The nudibranchs' prey was then 
switched from U. felina to M. senile, and over a period of 2 
weeks, the mucus from the nudibranchs was tested period- 
ically against both sea anemone species. Over the course of 
the experiment, the number of nematocysts that discharged 
into mucus-coated probes increased when M. senile was 
probed (ANOVA, F 4 2I == 8.20, P = 0.0004) and de- 
creased when U. felina was probed (ANOVA, F 3 19 = 
23.12, P < 0.0001). Within 10 days after the prey switch, 
touching M. senile tentacles with mucus-coated probes elic- 
ited the discharge of 75% fewer nematocysts than control 
probes did (Scheffe's test, P = 0.0067) (Fig. 5). By the end 
of the experiment, touching U. felina tentacles with mucus- 
coated probes again resulted in a small but nonsignificant 



I 



'-4-H 

O 



Oi 



1.75- 

1.5- 

1.25- 

1 

0.75 - 
0.5- 

0.25 - 




(7) 




10 



15 



Days 

Figure 5. The effect of Aeolidia papillosa mucus on the relative 
number of discharged nematocysts following prey switch from the sea 
anemone Urticina felina to the sea anemone Metridium senile (SD). 
Mucus-coated probes were used to probe tentacles of the sea anemones U. 
felina and M. senile (in 10 7 A/ N-acetylneuraminic acid), and were 
compared against controls for each species for a period of 2 weeks. A 
relative value of 1 .0 corresponds to the number of nematocysts discharged 
into control probes on Day for each sea anemone species. Data obtained 
from mucus-coated probes for each day were normalized against controls 
tor that day and for each species of sea anemone. The numbers in paren- 
theses are the numbers of nudibranchs used per test. 



118 



P. G. GREENWOOD ET AL 



1 



1.25 



1- 



0.75- 



0.5- 



0.25- 



(4) 



-O A. elegantissima 
O- - M. sem/f 




(3) 



i 
10 



15 



Days 

Figure 6. The effect of Aeolidia pupillosa mucus on the relative 
number of discharged nematocysts following prey switch from the sea 
anemone Metridium senile only to horh M. senile and the sea anemone 
Anthopleura elegantissima. Mucus-coated probes were used to probe ten- 
tacles of the sea anemones M. senile and A. elegantissima (in 10~ 7 M 
N-acetylneuraminic acid), and were compared against controls for each 
species after 2 weeks. A relative value of 1 .0 corresponds to the number of 
nematocysts discharged into control probes on Day for each sea anemone 
species. Data obtained from mucus-coated probes for each day were 
normalized against controls for that day and for each species of sea 
anemone. The numbers in parentheses are the numbers of nudibranchs used 
per test. 



increase in nematocyst discharge over that into control 
probes (Scheffe's test, P = 0.072) (Fig. 5). 



//' a second prey species is offered, will the effect of the 
inidihriinch mucus on nemtitocvst discharge change? 

Four individuals of A. pcipillosu were fed M. senile for at 
least 21 days, and tentacles of both M. senile and Antho- 
pleura elegantissima were tested with mucus-coated probes. 
M. senile nematocyst discharge was 56% lower into mucus- 
coated probes than into control probes (Student's ; test, / = 
9.6, P < 0.0001); Aiithopleuni ele^nnti.ssinui nemato- 
cyst discharge into mucus-coated probes was not different 
from discharge into control probes (Student's / test. r ( , = 
0.545. P = 0.61 ) (Fig. 6). Nematocysts from Anthopleum 
elegcintissimu were all basitrichous isorhizas. The nudi- 
branchs were then offered both M. senile and Anthopleum 
eleg(iHti<i<iii>ui. After the nudihranchs had been feeding on 
both prey species for 14 days, testing with mucus-coated 
probes showed nematocyst discharges 34% lower than con- 
trol probes for M. senile (Student's / test. t 4 = 2.78, P = 
0.05) and 64% lower than control probes for Anthopleum 
ek'xuntisaimti (Student's ; lest, t 4 = 17.06, P < 0.0001 ) 
(Fig. 6). 



Does the nudihrancli produce its own inhibitory mucus or 
simplv become covered in the prey's mucus'.' 

Mucus was wiped away from the dorsal surface of eight 
individuals of A. papiltosa that had been feeding on the sea 
anemone M. senile. Forty-five min later, gelatin probes 
coated with new mucus from those same nudibranchs were 
used to probe tentacles of M. senile. Nematocyst discharge 
into those probes was no different from nematocyst dis- 
charge into probes coated with mucus from the same eight 
individuals of A. papillosa before wiping the mucus away 
(Scheffe's test, P = 0.60) (Fig. 7). Nematocyst discharge 
into both groups of mucus-coated probes was well under 
half the number that discharged into control probes 
(ANOVA, F 2 . lh = 10.54, P = 0.001) (Fig. 7). 

When probes coated with M. senile mucus were used to 
probe tentacles of other individuals of M. senile, nemato- 
cysts discharged into the probes in numbers no ditterent 
than into control probes (Student's t test. f 6 = 1 . 14. P = 
0.30) (Fig. 8). 

Discussion 

The present study shows, for the first time, that the mucus 
from a nudibranch specifically inhibits the discharge of 
nematocysts from sea anemone tentacles. This inhibition of 
nematocyst discharge is limited to the anemone species on 
which the nudibranch has been feeding. Moreover, the 
nudibranch mucus changes to inhibit the nematocyst dis- 
charge of a different sea anemone species if the nudibranch 



<u 



Q 
O 



411 -i 


(4) 








EH unswabbed nudibranchs 


30- 

















(7) 








(8) 1 










T 




10- 






i 1 


I 



Control probes 



Mucus-coated probes 



Figure 7. The number of nematocysts discharged into control probes 
or into nrorvs coaled with mucus from individuals of Aenlulin pupillnsn 
that had been feeding on MeiriJium senile. Probing ol A/, senile tentacles 
was done in 10 7 M N-acetylneuraminic acid. Mucus-coaled probes were 
prepared both he-lore the original mucous coaling was removed from the 
nudihrancli (unswabbed nudibranchs) and 45 min alter mucus removal 
(swabbed midihianchs). The numbers in parentheses are the numbers ol 
anemones used (control probes) or the numbers of nudibranchs used 
(mucus-coated probes) per test. 



SEA SLUG MUCUS INHIBITS NEMATOCYSTS 



119 



Number of Discharged Nematocysts 

i j <. 

- O O C 




(4) 
T 


(4) 

T 




1 


i 



Control probes Probes coated 

w/anemone mucus 

Figure 8. The number of nematocysts discharged into control probes 
or into probes coated with mucus from individuals of (he sea anemone 
Metridium srnili: Probing of M. senile tentacles was done in 10~ 7 M 
N-acetylneuraminic acid. The numbers in parentheses ure the numbers of 
anemones used per test. 



begins to feed on that new species. If nudibranchs are fed 
two different species of sea anemone, their mucus inhibits 
nematocyst discharge from both prey species. Nudibranchs 
produce their own inhibitory mucus and do not simply 
mimic sea anemones by becoming covered with anemone 
mucus during feeding. 

Mucus from nudibranchs that had been fed the sea anem- 
one Metridiinn senile greatly inhibited nematocyst dis- 
charge from M. senile, but not from Urticinu feliiui or 
Aulactinia stella (Fig. 3). Likewise, mucus from nudi- 
branchs that had been fed U. felina inhibited nematocyst 
discharge from U. felina. but not from M. senile or Anlac- 
rinia stellu (Fig. 4). Within 10 days after the prey of A. 
papillosa was changed from U. felina to M. senile, the 
mucus of A. ptipillosa no longer inhibited nematocyst dis- 
charge from U. felina. but did inhibit nematocyst discharge 
from M. senile (Fig. 5). In another experiment, A. papillosa 
was fed both M. senile and Anihopleura elegantissima. 
After 2 weeks, the mucus of the nudibranch inhibited nema- 
tocyst discharge from both M. senile and Anihopleura el- 
egantissima (Fig. 6). Overall, A. papillosa mucus reduced 
nematocyst discharge from all prey anemones by 60% be- 
low control levels (60.3% 4.1%). 

Mucus from nudibranchs that had been freshly swabbed 
of their previous mucous coating inhibited nematocyst dis- 
charge from anemone prey (Fig. 7), indicating that the 
nudibranchs do not simply become covered with anemone 
mucus. Mucus from nudibranchs held in the same aquarium 
with sea anemones did not inhibit nematocyst discharge 
from that species. This suggests that the nudibranch mucus 
is altered only after feeding. Whether the mucus of A. 
papillosa is altered by the nudibranch itself or if compounds 
acquired from the prey are subsequently incorporated into 
the mucus is not yet known. Nudibranchs acquire numerous 



prey compounds and use them for their own defense from 
predators (Avila et ai, 1991: McClintock et al.. 1994). but 
some nudibranchs also synthesize their own chemical de- 
fenses (Cimino et ai. 1983; Faulkner, 1992). Because sea 
anemones do not sting themselves or clonemates. there 
might be compounds that prevent nematocyst discharge on 
or within the sea anemone (Pantin, 1942; Ertman and Dav- 
enport, 1981). but so far such compounds have not been 
identified in any cnidarians. In addition, we found in this 
study that mucus from individuals of one color morph of M. 
senile did not inhibit nematocyst discharge from another 
color morph of M. senile (Fig. 8), indicating that a prey 
species' mucus is not necessarily inhibitory to other mem- 
bers of that species. Therefore, the nudibranchs are not 
relying solely on compounds acquired from the prey's mu- 
cus. Aeolid nudibranchs secrete mucus and other secretions 
from gland cells found in various locations on their bodies 
(Edmunds, 1966). Histochemical evidence suggests that 
most species (including A. papillosa) have acidic nuico- 
polysaccharides as at least part of the mucus (Edmunds. 
1966; Porter and Rivera, 1983). but other components, 
which are not well characterized, may be secreted from 
gland cells and mix with the mucus on the surface of the 
nudibranch (Edmunds, 1966). The mucous secretion we 
used to coat the gelatin probes probably includes compo- 
nents from any or all of these gland cells. 

Most of our studies were done in the presence of N- 
acetylneuraminic acid (NANA), which increased the base- 
line number of nematocysts that discharged into the gelatin 
probes (Fig. 2). Because the nudibranch mucus inhibited 
nematocyst discharge in the presence of NANA (Fig. 1 ), the 
mucus must either reduce the mechanical stimulation 
caused by the nudibranch while feeding or inhibit the signal 
pathway leading to nematocyst discharge. When nudibranch 
mucus was tested against non-prey sea anemones, nemato- 
cyst discharge actually increased by a modest, but consis- 
tent, number over controls (11.8% 4.5%). Therefore 
nudibranch mucus may actually promote nematocyst dis- 
charge in species that are not the current prey. Aeolidia 
papillosa shows a strong preference for its most recent prey 
species (Hall et ai. 1982). Because the mucus of A. papil- 
losa inhibits nematocyst discharge from current prey spe- 
cies but not from other potential prey species, one might 
expect the current prey species to remain the preferred prey 
of the nudibranch. 



Acknowledgments 

We thank J. Elliott. C. Sisson, W. H. Wilson, and three 
anonymous reviewers for many helpful comments on the 
manuscript and for suggestions of additional experiments. 
This research was partially supported by the Merck Chari- 
table Foundation and by NSF Grant STI-9602639. 



120 



P. G. GREENWOOD ET AL. 



Literature Cited 

Avila, C., G. Cimino, A. Fontana, M. Gavagnin, J. Ortea, and E. 
Trivellone. 1991. Defensive strategy of two Hypse/odoris nudi- 
hranchs from Italian and Spanish coasts. J. Chem. Ecol. 17: 625-636. 

Boutan, L. 1898. Moeurs de I'Eoli.s papillosa Linne. Arch. Zoo/. Exp. 
Gen. 6: 37-42. 

Cimino. G., S. De Rosa, S. De Stefano, G. Sodano, and G. Villani. 1983. 
Dorid nudibranch elaborates its own chemical defense. Science 219: 
1237-1238. 

Conklin, E. J.. and R. N. Mariscal. 1977. Feeding behavior, ceras 
structure, and nematocyst storage in the aeolid nudibranch. Spiinlla 
neapolitana (Mollusea). Bull. Mar. Sci. 21: 658-667. 

Edmunds, M. 1966. Protective mechanisms in the Eolidacea (Mollusea: 
Nudibranchia). J. Linn. Sec. Land. Zoo/. 46: 27-71. 

Ertman, S. C., and D. Davenport. 1981. Tentacular nematocyte dis- 
charge and "self-recognition" in Ant/iopleiira elegantissima Brandt. 
Bio/. Bull. 161: 366-370. 

Faulkner, D. J. 1992. Chemical defenses of marine molluscs. Pp. 119- 
163 in Ecological Roles of Marine Natural Products, V. J. Paul. ed. 
Constock Publishing. Ithaca. NY. 

Graham, A. 1938. The structure and function of the alimentary canal of 
aeolid molluscs, with a discussion on their nematocysts. Trans. R. Soc. 
Edinb. 59: 267-307. 

Grosvenor, G. H. 1903. On the nematocysts of aeolids. Proc. R. Soc. 
Loud. 72: 462-486. 

Hall, S. J., and C. D. Todd. 1984. Prey-species selection by the anem- 
one predator Aeolidia papi/lof.u (L.): the influence of ingestive condi- 
tioning and previous dietary history, and a test for switching behaviour. 
J. Exp. Mar. Siol. Ecol. 82: 1 1-33. 

Hall, S. J., and C. D. Todd. 1986. Growth and reproduction in the aeolid 
nudibranch Aeoltdia papillosa (L). / Molluscan Stud. 52: 193-205. 

Hall. S. J., C. D. Todd, and A. D. Gordon. 1982. The influence of 
ingestive conditioning on the prey species selection in Aeolidia papil- 
losa (Mollusea: Nudibranchia). J. Anim. Ecol. 51: 907-921. 

Harris, L. G. 1973. Nudibranch associations. Pp. 213-315 in Current 
Topics in Comparative Pathobiology, Vol. 2, T. C. Cheng, ed. Aca- 
demic Press. New York. 

Harris, L. G. 1986. Size-selective predation in a sea anemone, nudi- 
hranch, and fish food chain. Veliger 29: 38-47. 

Harris, E. G. 1987. Aeolid nudibranchs as predators and prey. Am. 
Malacol. Bull. 5: 287-292. 

Martin, R., and P. Walther. 2003. Protective mechanisms against the 
action of nematocysts in the epidermis of Cratcna peregrimi and 
r'labellina affinis (Gastropoda, Nudibranchia). Zi>innorpliolog\ 122: 
25-35. 

\IaiH-h. S.. and J. Elliott. 1997. Protection of the nudibranch Aeolidia 
papillosa from nematocyst discharge of the sea anemone Anlhoplcuru 
i-lfgantissuna. Veligei 40: 148-151. 

McClintotk. J. B., B. J. Baker. M. Slattery, J. N. Heine, P. J. Bryan, W. 
Yoshida, M. T. Davies-Coleman, and D. J. Faulkner. 1994. Chem- 



ical defense of the common Antarctic shallow water nudibranch Tri- 
toniella belli Eliot (Mollusea: Tritonidae) and its prey. Clavularia 
frankliniana Rouel (Cnidaria: Octocorallia). J. Chem. Ecol. 20: 3361- 
3372. 

Pantin, C. F. A. 1942. The excitation of nematocysts. J. Exp. Biol. 19: 
294-310. 

Porter, K. J., and E. R. Rivera. 1980. The Golgi apparatus in epidermal 
mucoid and ellipsoid-vacuolale cells of Aeolidia papillosa and Corv- 
pltel/a rtifibranchialis (Nudibranchia). Protoplasma 102: 217-233. 

Porter, K. J., and E. R. Rivera. 1983. Light and electron microscopic 
cytochemistry of the epidermal mucoid cells of Aeolidia papillosa and 
Coryphellii rufihranchia/i.s (Mollusea, Nudibranchia). Protoplasma 
114: 14-22. 

Reidy, S. E. 1996. A comparison of settlement, growth and mortality in 
the nudibranch Aeolidia papillosa when offered the anemones 
Metridium senile and Urticina crassicorm.s. Am. Zoo/. 36: 106A. 

Russell, H. D. 1942. Observations on the feeding of Aeolidia papillosa 
L.. with notes on the hatching of the veligers of Cuthona amoena A. 
and H. Nautilus 55: 80-82. 

Salvini-Plawen, L. v. 1972. Cnidaria as food sources for marine inver- 
tebrates. Cah. Biol. Mar. 13: 385-400. 

Thompson, T. E. 1976. Biology of Opistholiranch Molluscs. Vol. I. Ray 
Society, London. 207 pp. 

Thorington, G. U., and D. A. Hessinger. 1988. Control of cnida dis- 
charge: I. Evidence for two classes of chemoreceptor. Biol. Bull. 174: 
163-171. 

Thorington, G. U., and D. A. Hessinger. 1990. Control of cnida dis- 
charge: III. Spirocysts are regulated by three classes of chemoreceptors. 
Biol. Bull. 178: 74-83. 

Thorington, G. I'., and D. A. Hessinger. 1998. Efferent mechanisms of 
discharging cnidae: II. A nematocyst release response in the sea anem- 
one tentacle. Biol. Bull. 195: 145-155. 

Todd, C. D. 1983. Reproductive and trophic ecology of nudibranch 
molluscs. Pp. 225-259 in The Mollusea. Vol. 6. Ecology. W. D. 
Russell-Hunter, ed. Academic Press, Orlando. FL. 

Todd, C. D., \V. J. Lambert, and J. Davies. 2001. Some perspectives 
on the biology and ecology of nudibranch molluscs: generalisations and 
variations on the theme that prove the rule. Bo/I. Malacol. 37: 105-120. 

Watson, G. M., and D. A. Hessinger. 1989. Cnidocyte mechanorecep- 
tors are tuned to the movements of swimming prey by chemoreceptors. 
Science 243: 1589-1591. 

Watson, G. M., and D. A. Hessinger. 1994. Antagonistic frequency 
tuning of hair bundles by different chemoreceptors regulates nemato- 
cyst discharge. J. E.\p. Biol. 187: 57-73. 

Watson, G. M.. and R. R. Hudson. 1994. Frequency and amplitude 
lulling of nematocyst discharge by proline. ,/. Ev/>. Zoo/. 268: 177-185. 

Watson, G. M., S. Venable, R. R. Hudson, and J. J. Repass. 1999. 
ATP enhances repair of hair bundles in sea anemones. Hear. Res. 136: 
1-12. 



THE 

BIOLOGICAL 
BULLETIN 

2004 Subscription Rates 
Volumes 206-207 

*Paid Subscriptions include both print and electronic subscriptions at: www.biolbull.org 

Institutional* Individual* 



One year subscription (6 issues - 


2 volumes) 


$325.00 


$120.00 


Single volume (3 issues) 


$165.00 


$70.00 


Single Issues 


$ 75.00 


$25.00 



*Surface delivery included in above prices. 
For prompt delivery, we encourage subscribers outside the U.S. to request airmail service. 

Airmail Delivery Charge 

U.S. and Canada: $ 45.00 

Mexico: $ 60.00 

All other locations: $ 1 00.00 

Orders Must Be Prepaid in U.S. Dollars, Check Payable to The Marine Biological Laboratory 

About The Biological Bulletin 

ISSN: 0006-3185 

Frequency: Bimonthly 

Number of issues per year: 6 

Months of Publication: February, April, June, August, October, December 

Subscriptions entered for calendar year 

Volume indexes contained in June and December issues 

Annual report of the Marine Biological Laboratory contained in August issue 

Most back issues available 

Claims handled upon receipt 

No agency discounts 

Internet: 
www.biolbull.org 

Please address orders to: 

Wendy Child 

Subscriptions 

The Biological Bulletin 

Marine Biological Laboratory 

7 MBL Street 

Woods Hole, MA 02543-1015 U.S.A. 
Fax: 508-289-7922 Tel: 508-289-7402 Email: wchild@mbl.edu 

Published by the Marine Biological Laboratory 
Woods Hole, Massachusetts, 02543 U.S.A. 



THE BIOLOGICAL BULLETIN 

( www.biolbull.org) 

2004 SUBSCRIPTION FORM 

(VOLUMES 206-207, 6 ISSUES) 



(please print) 
NAME: 



INSTITUTION: 
ADDRESS: 



CITY: STATE:. 

POSTAL CODE: COUNTRY:. 

TELEPHONE: FAX:. 

E-MAIL ADDRESS 



All subscriptions run on the calendar year; price includes both print and online journals 

G Please send me a 2004 subscription to The Biological Bulletin at the rate indicated below: 

O Individual: $120.00 (6 ISSUES) O Institutional : $325.00 (6 ISSUES) 

O Individual: $70.00(3 ISSUES) O Institutional : $165.00 (3 ISSUES) 

Check one: G February April June or G August October December 

G Please send me the following back issue(s): 

O Individual: at $25.00 (PER ISSUE) O Institutional : at $75.00 (PER ISSUE) 

Delivery Options 

Surface Delivery (Surface delivery is included in the subscription price.) 

Air delivery (Please add the correct amount to your payment.) 



O U.S. and Canada: $46.00 O Mexico: $60.00 O All other locations: $100.00 
Payment Options 

Enclosed is my check or U.S. money order for $ payable to The Marine Biological Laboratory 

Please charge my G VISA, G MasterCard G Discover Card $ 

Please send me an invoice. (Note: Payment must be received before subscription commences.) 



Account No.: Exp. Date: 

Signature:_ Date: 



Return this form with your check or credit information to: 

Marine Biological Laboratory 

Subscription Office + The Biological Bulletin 47 MBL Street * Woods Hole, MA 02543-1015 



ARINE IXESOURCES CENTER 



MARINE BIOLOGICAL LABORATORY WOODS HOLE, MA 02543 (508)289-7700 
WWW.MBL.EDU/SERVICES/MRC/INDEX.HTML 




Animal and Tissue Supply for 
Education & Research 

150 aquatic species available for shipment via 
online catalog: <http://www.mbl.edu/animals/ 
index.htmb; phone: (508)289-7375; or 
e-mail: specimens@mbl.edu 

zebrafish colony containing limited mutant strains 

custom dissection and furnishing of specific organ 
and tissue samples 



zebrafish facilities 



MRC Services Available 

basic water quality analysis 

veterinary services (clinical, histopathologic, 
microbial services, health certificates, etc.) 

aquatic systems design (mechanical, biological, 
engineering, etc.) 

educational tours and collecting trips aboard 
the R/V Gemma 



Using the MRC for Your Research 

capability for advanced animal husbandry (temperature, light control, etc.) 

availability of year-round, developmental life stages 

adaptability of tank system design for live marine animal experimentation 





OGL- OCEAN GENOME 
LEGACY 

M EXECUTIVE DIRECTOR 

A new not-for-profic foundation devoted to the 
preservation, distribution and evolutionary genomics of 
DNA from marine organisms is seeking an 
EXECUTIVE DIRECTOR. 

The successful candidate will have a Ph.D. in cell or 
molecular biology, 4+ years' experience in molecular 
biology, and be highly motivated to work at the bench. 
Responsibilities will include the assembly of a small team 
of scientists for the long-term preservation of marine 
organism DNA, development of tissue culture 
techniques for marine invertebrare cells, construction of 
genome libraries, and evolutionary genomics of special 
marine transition groups. 

The OGL laboratory will be temporarily located at New 
England Biolabs, Inc., Beverly, MA unril a new facility is 
constructed in Ipswitch, MA. 

Applicants should fend a resume and three references to: 
Carol Ann Zapustas, New England Biolabs, Inc., 
32 Tozer Road, Beverly, MA 01915. 

OCEAN GENOME LEGACY 



An Equal Opportunity Employer. 




MBL 



Marine Biological Laboratory Woods Hole MA 



Advances in Genome Technology 
and Bioinformatics 

October 5 - November 3, 2004 

A comprehensive, four-week course in genome science that 
will integrate bioinformatics with the latest laboratory 
techniques for genome sequencing, genome analysis, and 
high throughput gene expression. 

Application Deadline: June 16, 2004 

Contact: Carol Hamel, Admissions Coordinator, (508) 289-7401, 

admissions@mbl.edu; 7 MBL Street, Woods Hole, MA 02543 

Applications are encouraged from women and members of underrepresented 

minorities. The MBL is an Equal Opportunity/Affirmative Action Employer. 

www.mbl.edu/education 




POSITION ANNOUNCEMENT 

Editor-in-Chief 
The Biological Bulletin 

Start Date: January 2005 
Term: Five years, renewable 



The Editor-in-Chief is responsible for the overall editorial direction of the Biological Bulletin. The Editor-in-Chief 
appoints Associate Editors and members of the Editorial Board, decides which manuscripts are published, mediates 
editorial disputes, and sets policy for the journal. 

The Editor-in-Chief is an independent contractor who reports to the Director and CEO of the Marine Biological 
Laboratory. Stipend for the position is $10,000 annually. The Bulletin 's editorial offices are based in Woods Hole, but 
the Editor-in-Chief may work from his/her home institution. The Editor-in-Chief is expected to spend some part of the 
summer months in Woods Hole. Housing for up to one month will be provided in Woods Hole. 



The successful candidate for this 

position will meet the following 

requirements: 



Abroad understanding of biology, and a manifest interest in its 

diversity and comparative and integrative aspects 

A track-record of publishing in peer-reviewed journals 

Experience reviewing papers for scientific journals 

Proven skill as a substantive editor 

Ability to make tough decisions and willingness to work with other editors 

to reach a decision on difficult papers 

Demonstrated experience with the editorial process (e.g., serving as an 

Editor or Associate Editor for a journal similar to the Biological Bulletin) 

The willingness and ability to commit the time required, approximately 

one day per week, to fulfill the duties outlined here for five years. 



Job description: 



Nomination packets must include 
the following: 

1. Letter of intent 

2. Current CV 

3. Vision Statement for the journal 

Send nominations to: 

Pamela Clapp Hinkle 

Managing Editor, Biological Bulletin 

Marine Biological Laboratory 

7 MBL Street 

Woods Hole, MA 02543 

pclapp@mbl.edu 



The Editor-in-Chief devotes a minimum of six hours per week to the 
operation of the Biological Bulletin. The Editor's ongoing activities include 

1) assigning submitted papers to the appropriate Associate Editor; 

2) reading reviews and manuscripts to ensure fairness and technical 
accuracy; 3) writing editorial decision letters based on the reviews; 

4) fielding telephone and e-mail queries on a daily basis from authors 
deciding whether to submit their work to the Biological Bulletin, authors 
who are unhappy about an editorial decision, and Associate Editors 
requesting guidance on such matters as the identity, availability, 

and number of reviewers, and editorial decisions and disputes; 

5) communicating regularly (by telephone or e-mail) with the Managing 
Editor and other editorial staff members to plan future issues, to arrange the 
table of contents, to develop the issue cover, and to discuss organizational 
issues; 6) editing accepted manuscripts as necessary for substance, 
accuracy, and clarity; 7) selecting cover photos and writing associated 
legends; 8) informing editorial staff of noteworthy articles for the media; 
9) as the deadline for each issue approaches, deciding which manuscripts 
will be published. 



Marine Biological Laboratory Woods Hole Massachusetts 









-.-. 

Inverted Microscopy 

At Its Best! 



. 





v - 




Built with extraordinary 

Zeiss expertise, the Axiovert 200 

is all you'll ever want in an 



precisely, more rapidly and more 
successfully than before. And this 
is just the beginning! 



Outstanding ICS infinity optics, ........... '"" 

innovative condensers & optimized microscope into a sophisticated 

fluorescence, stability & reliability, ima 9 e handli "9 workstation 

unique ergonomic design, for observation & documentation 

& an unusuall wide scoe of Iivin 9 cells with a " of the 



unique ergonomic design, or oservaon 

& an unusually wide scope of Iivin 9 cells wit 

of sophisticated documentation. components super 

by Zeiss for outst 
But the Axiovert 200 is much 

more. It is a powerful tool that For more informat 

will carry out your research more call 800-233-2343 



components superbly matched 
by Zeiss for outstanding results. 

For more information 



Carl Zeiss Microlmaging, Inc. Thornwood, NY 10594 micro@zeiss.com 



ZEISS 



We make it visible. 



Volume 206 Number 3 



BIOLOGICAL 
BULLETIN 




Published by the Marine Biological Laboratory 



Woods Hole, Massachusetts , 




THE BIOLOGICAL BULLETIN 



ONLINE 



The Marine Biological Laboratory is pleased beginning with the October 1976 issue 

to announce that the lull text of The Biological (Volume 151, Number 2), and some Tables of 

Bulletin is available online at Contents are online beginning with the 

October 1965 issue (Volume 129, Number 2). 



http://www.biolbull.org 

The Biological Bulletin publishes outstanding 
experimental research on the full range 
of biological topics and organisms, from the 
fields of Neurobiology, Behavior, Physiology, 
Ecology, Evolution, Development and 
Reproduction, Cell Biology, Biomechanics, 
Symbiosis, and Systematics. 

Published since 1897 by the Marine 
Biological Laboratory (MBL) in Woods Hole, 
Massachusetts, The Biological Bulletin is one 
of America's oldest peer-reviewed scientific 
journals. 

The journal is aimed at a general readership, 
and especially invites articles about those 
novel phenomena and contexts characteristic 
of intersecting fields. 

I 'lie li/ii/figintl Bulletin Online contains the 
full content of each issue of the journal, 
including all figures and tables, beginning 
with the February 2001 issue (Volume 200, 
Number 1). The full text is searchable by 
keyword, and the cited references include 
hyperlinks to Meclline. PDF files are available 
beginning in February 1990 (Volume 178, 
Number 1), some abstracts are available 



Each issue will be placed online 
approximately on the elate it is mailed to 
subscribers; therefore the online site will be 
available prior to receipt of your paper copy. 
Online readers may want to sign up for the 
eTOC (electronic Table of Contents) service, 
which will deliver each new issue's, table of 
contents via e-mail. The web site also 
provides access to information about the 
journal (such as Instructions to Authors, the 
Editorial Board, and subscription 
information), as well as access to the Marine 
Biological Laboratory's web site and other 
Biological Bulletin electronic publications. 

The free trial period for access to The 
Biological Bulletin online has ended. 
Individuals and institutions who are 
subscribers to the journal in print or are 
members of the Marine Biological 
Laboratory Corporation may now activate 
their online subscriptions. All other access 
(e.g., to Abstracts, eTOCs, searching, 
Instructions to Authors) remains freely 
available. Online access is included in the 
print subscription price. 

For more information about subscribing or 
activating your online subscription, visit 
<www.biolbull.org/subscriptions>. 



http://www.biolbull.org 



THE BRAIN 
REPAIR 




A TRON-generation kid with a computer-monitor tan liberated by confocal technology. 
A tennis jock from Sweden who traded her racket for a FluoView 300 and a stethoscope. 
A criminalist from the LAPD now in hot pursuit of outlaw cells. Unique talents brought 
together by Principal Investigator Dan Peterson to chase down the Big Answer: 
How to harness endogenous brain stem cells that con repair, and send them to other 
places in the brain that need repair. "Our bread and butter is confocal microscopy," Peterson says. "We're like portrait photographers. 
We light, compose, direct, position - all to get the cell ready for its close-up." 
And to improve the human condition at the end of the day. 

OLYMPUS MICROSCOPES ROCKET SCIENCE . a *, - p 8 " 8 ' 



, us microscopes a 



I more about 



Christopher Vega, Ph D. Research /Associate 
Anno Hallbergson - M.D /Ph D Student 
Dame/ A Peferson, Ph D - lob Director 
Christine Sanders Research A: . 
Department of Neuroscience 
Rosalind Franklin University 
of Medicine and Science 







ti 



> 



T 



' 

* '-?'. ': 



/our Vision, Our Future 



CONTENTS 



VOLUME 206, No. 3: JUNE 2004 



RESEARCH NOTE 

Li, Natasha K., and Mark W. Denny 

Limits to phenotypic plasticity: flow effects on barna- 
cle feeding appendages 121 

SEA MONSTERS 

Pierce, Sidney K., Steven E. Massey, Nicholas E. Curtis, 
Gerald N. Smith, Jr., Carlos Olavarna, and Timothy K. 
Mangel 

Microscopic, biochemical, and molecular character- 
istics of the Chilean Blob and a comparison with the 
remains of other sea monsters: nothing but whales. . . 125 



Phillippi, Aimee, Ellen Hamann, and Philip O. Yund 

Fertilization in an egg-brooding colonial ascidian 
does not vary with population density 152 

Swanson, Rebecca L., Jane E. Williamson, Rocky De 

Nys, Naresh Kumar, Martin P. Bucknall, and Peter D. 

Steinberg 

Induction of settlement of larvae of the sea urchin 
Holopneustes purpumscens by histamine from a host 
alga Itil 

Terrell, David L. 

Fitness consequences of allorecognition-mediated 
agonistic interactions in the colonial hydroid Hfdnii- 
tinifi [GM] 17., 

INNATE IMMUNITY 



ECOLOGY AND EVOLUTION 

Diaz, Eliecer R., and Martin Thiel 

Chemical and visual communication during mate 

searching in rock shrimp 134 

Johnson, Sheri L., and Philip O. Yund 

Remarkable longevity of dilute sperm in a free- 
spawning colonial ascidian 144 



Holman, Jeremy D., Karen G. Burnett, and Louis E. 
Burnett 

Effects of hypercapnic hvpoxi.i on the clearance of 
Vibrio camphellii in the Atlantic blue crab, Cal/inectes 
sapidus Rathbun 18.S 

* * * 
Index for Volume 206 197 



THE BIOLOGICAL BULLETIN 

THE BIOLOGICAL BULLETIN is published M\ times a year by the Marine Biological Laboratory, 7 MBL Street. 
Woods Hole. Massachusetts 02543. 

Subscriptions and similar matter should be addressed to Subscription Administrator. THE BIOLOGICAL 
BULLETIN, Marine Biological Laboratory. 7 MBL Street. Woods Hole. Massachusetts 02543. Subscription 
includes both print und online journals. Subscription per year (six issues, two volumes): $325 for libraries; $120 
for individuals. Subscription per volume (three issues): $165 for libraries: $70 for individuals. Back and single 
issues (subject to availability): $75 tor libraries; $25 for individuals. 

Communications relative to manuscripts should be sent to Michael J. Greenberg. Editor-in-Chief, or Pamela 
Clapp Hinkle. Managing Editor, at the Marine Biological Laboratory. 7 MBL Street, Woods Hole, Massachusetts 
02543. Telephone: (508) 289-7149. FAX: 508-289-7922. E-mail: pclapp@mbl.edu. 



http://www.biolbull.org 

THE BIOLOGICAL BULLETIN is indexed in bibliographic services including Index Medicus and MED- 
LINE, Chemical Abstracts, Current Contents, Elsevier BIOBASE/Current Awareness in Biological 
Sciences, and Geo Abstracts. 

Printed on acid free paper, 
effective with Volume 180, Issue 1, 1991. 



POSTMASTER: Send address changes to THE BIOLOGICAL BULLETIN, Marine Biological Laboratory. 

7 MBL Street. Woods Hole, MA 02543. 

Copyright 2004, by the Marine Biological Laboratory 

Periodicals postage paid at Woods Hole, MA, and additional mailing offices. 

ISSN 0006-3185 



INSTRUCTIONS TO AUTHORS 



7/ii' Biological Bulletin accepts outstanding original research 
reports of general interest to biologists throughout the world. 
Papers are usually of intermediate length (10-40 manuscript 
pages). A limited number of solicited review papers may be 
accepted after formal review. A paper will usually appear within 
four months after its acceptance. 

Very short, especially topical papers (less than 9 manuscript 
pages including tables, figures, and bibliography) will be published 
in a separate section entitled "Research Notes." A Research Note 
in The Biological Bulletin follows the format of similar notes in 
Nature. It should open with a summary paragraph of 150 to 200 
words comprising the introduction and the conclusions. The rest of 
the text should continue on without subheadings, and there should 
be no more than 30 references. References should be referred to in 
the text by number, and listed in the Literature Cited section in the 
order that they appear in the text. Unlike references in Nature. 
references in the Research Notes section should conform in 
punctuation and arrangement to the style of recent issues of The 
Biological Hnlli'iiii. Materials and Methods should be incorpo- 
rated into appropriate figure legends. See the article by Lee 
(October 2003. Vol. 205: 99-101 ) for sample style. A Research 
Note will usually appear within two months after its acceptance. 

The Hdilonal Board requests that regular manuscripts con- 
form to the requirements set below; those manuscripts that do 
not conform will be returned to authors lor correction before 
ie\ icw 



1 . Manuscripts. Manuscripts, including figures, should be 
submitted in quadruplicate, with the originals clearly marked. 
(Xerox copies of photographs are not acceptable for review pur- 
poses.) Please include an electronic copy of the text of the manu- 
script. Label the disk with the name of the first author and the name 
and version of the wordprocessing software used to create the tile. 
If the file was not created in some version of Microsoft Word, save 
the text in rich text format (rtf). The submission letter accompa- 
nying the manuscript should include a telephone number, a FAX 
number, and (if possible) an E-mail address for the corresponding 
author. The original manuscript must be typed in no smaller than 
12 pitch or 10 point, using double spacing (including figure leg- 
ends, footnotes, bibliography, etc.) on one side of 16- or 20-lh. 
bond paper, 8 by 11 inches. Please, no right justification. Manu- 
scripts should be proofread carefully and errors corrected legibly 
in black ink. Pages should be numbered consecutively. Margins on 
all sides should he at least 1 inch (2.5 cm). Manuscripts should 
conform to the Council of Biolog\ Editors Style Manual. 5th 
Edition (Council of Biology Editors. 1983) and to American spell- 
ing. Unusual abbreviations should be kept to a minimum and 
should he spelled out on tirst reference as well as defined in a 
footnote on the title page. Manuscripts should be divided into the 
following components: Title page. Abstract (of no more than 200 
\\oids). Introduction. Materials and Methods, Results, Discussion. 
Acknowledgments, Literature Cited, Tables, and Figure Legends. 
In addition, authors should supply a list of words and phrases 
under which the article should he indexed. 



2. Title page. The title page consists of a condensed title or 
running head of no more than 35 letters and spaces, the manuscript 
title, authors' names and appropriate addresses, and footnotes 
listing present addresses, acknowledgments or contribution num- 
bers, and explanation of unusual abbreviations. 

3. Figures. The dimensions of the printed page, 7 by 9 
inches, should be kept in mind in preparing figures for publication. 
We recommend that figures be about 1 times the linear dimensions 
of the final printing desired, and that the ratio of the largest to the 
smallest letter or number and of the thickest to the thinnest line not 
exceed 1:1.5. Explanatory matter generally should be included in 
legends, although axes should always be identified on the illustra- 
tion itself. Figures should be prepared for reproduction as either 
line cuts or halftones. Figures to be reproduced as line cuts should 
be unmounted glossy photographic reproductions or drawn in 
black ink on white paper, good-quality tracing cloth or plastic, or 
blue-lined coordinate paper. Those to be reproduced as halftones 
should be mounted on board, with both designating numbers or 
letters and scale bars affixed directly to the figures. All figures 
should he numbered in consecutive order, with no distinction 
between text and plate figures and cited, in order, in the text. The 
author's name and an arrow indicating orientation should appear 
on the reverse side of all figures. 

Digital an: The Biological Bulletin will accept figures sub- 
mitted in electronic form; however, digital art must conform to the 
following guidelines. Authors who create digital images are 
wholly responsible for the quality of their material, including color 
and halftone accuracy. 

Format. Acceptable graphic formats are TIFF and EPS. Color 
submissions must be in EPS format, saved in CMKY mode. 

Software. Preferred software is Adobe Illustrator or Adobe 
Photoshop for the Mac and Adobe Photoshop for Windows. Spe- 
cific instructions for artwork created with various software pro- 
grams are available on the Web at the Digital Art Information Site 
maintained by Cadmus Professional Communications at http:// 
cpc.cadmus.com/da/ 

Resolution. The minimum requirements for resolution are 
1200 DPI for line art and 300 for halftones. 

Size. All digital artwork must be submitted at its actual 
printed size so that no scaling is necessary. 

Multipanel figures. Figures consisting of individual parts 
(e.g., panels A, B, C) must be assembled into final format and 
submitted as one file. 

Hani copv. Files must be accompanied by hard copy for use 
in case the electronic version is unusable. 

Disk identification. Disks must be clearly labeled with the 
following information: author name and manuscript number; for- 
mat (PC or Macintosh); name and version of software used. 

Color: The Biological Bulletin will publish color figures and 
plates, but must bill authors for the actual additional cost of 
printing in color. The process is expensive, so authors with more 
than one color image should consistent with editorial concerns, 
especially citation of figures in order combine them into a single 
plate to reduce the expense. On request, when supplied with a copy 
of a color illustration, the editorial staff will provide a pre-publi- 
cation estimate of the printing cost. 

4. Tables, footnotes, figure legends, etc. Authors should 
follow the style in a recent issue of The Biological Bulletin in 



preparing table headings, figure legends, and the like. Because of 
the high cost of setting tabular material in type, authors are asked 
to limit such material as much as possible. Tables, with their 
headings and footnotes, should be typed on separate sheets, num- 
bered with consecutive Arabic numerals, and placed after the 
Literature Cited. Figure legends should contain enough informa- 
tion to make the figure intelligible separate from the text. Legends 
should be typed double spaced, with consecutive Arabic numbers, 
on a separate sheet at the end of the paper. Footnotes should be 
limited to authors' current addresses, acknowledgments or contri- 
bution numbers, and explanation of unusual abbreviations. All 
such footnotes should appear on the title page. Footnotes are not 
normally permitted in the body of the text. 

5. Literature cited. In the text, literature should be cited by 
the Harvard system, with papers by more than two authors cited as 
Jones et al.. 1980. Personal communications and material in prep- 
aration or in press should be cited in the text only, with author's 
initials and institutions, unless the material has been formally 
accepted and a volume number can be supplied. The list of 
references following the text should be headed Literature Cited, 
and must be typed double spaced on separate pages, conforming in 
punctuation and arrangement to the style of recent issues of The 
Biological Bulletin. Citations should include complete titles and 
inclusive pagination. Journal abbreviations should normally follow 
those of the U. S. A. Standards Institute (USASI). as adopted by 
BIOLOGICAL ABSTRACTS and CHEMICAL ABSTRACTS, with the minor 
differences set out below. The most generally useful list of bio- 
logical journal titles is that published each year by BIOLOGICAL 
ABSTRACTS (BIOSIS List of Serials; the most recent issue). Foreign 
authors, and others who are accustomed to using THE WORLD LIST 
OF SCIENTIFIC PERIODICALS, may find a booklet published by the 
Biological Council of the U.K. (obtainable from the Institute of 
Biology. 41 Queen's Gate, London. S.W.7. England, U.K.) useful, 
since it sets out the WORLD LIST abbreviations for most biological 
journals with notes of the USASI abbreviations where these differ. 
CHEMICAL ABSTRACTS publishes quarterly supplements of addi- 
tional abbreviations. The following points of reference style for 
THE BIOLOGICAL BULLETIN differ from USASI (or modified WORLD 
LIST) usage: 

A. Journal abbreviations, and book titles, all underlined (for 
italics ) 

B. All components of abbreviations with initial capitals (not 
as European usage in WORLD LIST e.g.. J. Cell. Comp. Physiol. 
NOT J. cell. comp. Physiol. ) 

C. All abbreviated components must be followed by a period, 
whole word components must not (i.e., J. Cancer Res.) 

D. Space between all components (e.g., J. Cell. Com/'. 
Physio/., not J.Cell.Comp.Physiol.) 

E. Unusual words in journal titles should be spelled out in 
full, rather than employing new abbreviations invented by the 
author. For example, use Rit Vtsindafjelags Islcmlingn without 
abbreviation. 

F. All single word journal titles in full (e.g., Veliger, Ecol- 
ogy, Brain). 



G. The order of abbreviated components should be the same 
as the word order of the complete title (i.e., Proc. and Trans. 
placed where they appear, not transposed as in some BIOLOGICAL 
ABSTRACTS listings). 

H. A few well-known international journals in their preferred 
forms rather than WORLD LIST or USASI usage (e.g.. Nature. 
Science. Evolution NOT Nature. Loud.. Science. N.Y.: Evolution. 
Lancaster. Pa. ) 

6. Sequences. By the time a paper is sent to the press, all 
nucleotide or amino acid sequences and associated alignments 
should have been deposited in a generally accessible database 



(e.g., GenBank. EMBL. SwissProt). and the sequence accession 
number should be provided. 

7. Reprints, page proofs, and charges. Authors may pur- 
chase reprints in lots of 100. Forms for placing reprint orders are 
sent with page proofs. Reprints normally will be delivered about 2 
to 3 months after the issue date. Authors will receive page proofs 
of articles shortly before publication. They will be charged the 
current cost of printers' time for corrections to these (other than 
corrections of printers' or editors' errors). Other than these charges 
for authors' alterations. The Biological Bulletin does not have 
page charges. 



CONTENTS 

for Volume 206 

No. 1 : FEBRUARY 2004 



RESEARCH NOTE 



DEVELOPMENT AND REPRODUCTION 



Buresch, Kendra C., Jean G. Boal, Gregg T. Nagle, 
Jamie Kiiowles, Robert Nobuhara, Kate Sweeney, and 
Roger T. Hanlon 

Experimental evidence that ovary and oviducal gland 
extracts influence male agonistic behavior in squids 1 

PHYSIOLOGY AND BIOMECHANICS 

Motokawa, Tatsuo, Osamu Shintani, and Riidiger Bi- 
renheide 

Contraction and stiffness changes in collagenous arm 
ligaments of the stalked crinoid tMf/r/ii/in<\ ><>luii<lu\ 
(Echinodermata) 4 

NEUROBIOLOGY AND BEHAVIOR 

Biggers, William J., and Hans Laufer 

Identification of juvenile hormone-active alkylphe- 
nols in the lobster Homants ainericanus and in marine 
sediments. . 13 



Tominaga, Hideyuki, Shogo Nakamura, and Mieko 
Komatsu 

Reproduction and development of the conspicuously 
dimorphic brittle star Ophiodaphne fnnnata (Ophiu- 

roidea) 25 

Temkin, M. H., and S. B. Bortolami 

Waveform dvnamics of spermato/eugmata during 
the transfer from paternal to maternal individuals of 
Menibranipora membranacea 35 



ECOLOGY AND EVOLUTION 

Wang, Yongping, Zhe Xu, and Ximing Guo 

Differences in the i DNA-bearing chromosome divide 
the Asian-Pacific and Atlantic species of Crassostrea 

(Bivalvia, Mollusca) 4(i 

Maruyama, Yoshihiko K. 

Occurrence in the field of a long-term, year-round, 
stable population of placo/oans 55 



No. 2: APRIL 2004 



RESEARCH NOTE 



CELL BIOLOGY 



Edmunds, Peter J., and Ruth D. Gates 

Size-dependent differences in the photophysiology 
of the reef coral Porites astreoides . . 



NEUROBIOLOGY AND BEHAVIOR 



Ishikawa, Makiko, Hidekazu Tsutsui, Jacky Cosson, 
(i| Yoshitaka Oka, and Masaaki Morisawa 

Strategies for sperm chemolaxis in the siphonophores 

and ascidians: a numerical simulation study 95 



Lindsay, Sara M., Timothy J. Riordan, Jr.. and D. Forest 

Identification and activity-dependent labeling ol 
peripheral sensory structures on a spionid 
polvchaete 65 



ECOLOGY AND EVOLUTION 



PHYSIOLOGY AND BIOMECHANICS 

Harper, S. L., and C. L. Reiber 

Physiological development of the embryonic and l.n- 

val crayfish heart 7S 

Ehlinger, Gretchen S., and Richard A. Tankersley 
Survival and development of horseshoe crab (I./i/iu/n\ 
polyphemus) embryos and larvae in hypersaline condi- 
tions. . 87 



Last. Kim S., and Peter J. W. Olive 

Interaction between photoperiod and an endoge- 
nous seasonal factor in influencing the diel loco- 
motor activity of the benthic polvchaete Nereis vi- 
ii'i/'i Sars 103 

Greenwood, Paul G., Kyle Garry, April Hunter, and 

Miranda Jennings 

Adaptable defense: a ntidibranch mucus inhibits 
nematocyst discharge and changes with prey type ... 113 



CONTENTS: VOLUME 206 
No. 3: JUNE 2004 



RESEARCH NOTE 

Li, Natasha K., and Mark W. Denny 

Limits to phenotypic plasticity: flow effects on barna- 
cle feeding appendages 121 

SEA MONSTERS 

Pierce, Sidney K., Steven E. Massey, Nicholas E. Curtis, 
Gerald N. Smith, Jr., Carlos Olavarria, and Timothy K. 
Mangel 

Microscopic, biochemical, and molecular character- 
istics of the Chilean Blob and a comparison with the 
remains of other sea monsters: nothing but whales. . . 125 

ECOLOGY AND EVOLUTION 

Diaz, Eliecer R., and Martin Thiel 

Chemical and visual communication during mate 

searching in rock shrimp 134 

Johnson, Sheri L., and Philip O. Yund 

Remarkable longevity of dilute sperm in a free- 
spawning colonial ascidian 144 



Phillippi, Aimee, Ellen Hamann. and Philip O. Yund 

Fertilization in an egg-brooding colonial ascidian 
does not van- with population density 152 

Swanson, Rebecca L., Jane E. Williamson, Rocky De 

Nys, Naresh Kumar. Martin P. Bucknall, and Peter D. 

Steinberg 

Induction of settlement of larvae of the sea urchin 
Holupneiistes purpumscfim bv histamine from a host 
alga 161 

Fen-ell, David L. 

Fitness consequences of allorecognition-mediated 
agonistic interactions in the colonial hvdroid Hyilrac- 
tmia IGM] 1 73 

INNATE IMMUNITY 

Holman, Jeremy D., Karen G. Burnett, and Louis E. 
Burnett 

Effects of liypercapnic hypoxia on the clearance of 
\'il>r/ii campbeUii in the Atlantic blue crab, Callinectes 
sapidus Rathbun 188 

* * * 
Index for Volume 206 197 



Reference: Biol. Bull. 206: 121-124. (June 2004) 
2004 Marine Biological Laboratory 



Limits to Phenotypic Plasticity: Flow Effects on 
Barnacle Feeding Appendages 

NATASHA K. LI* AND MARK W. DENNY 
Hopkins Marine Station, Stanford University; Pacific Grove. California 93950 



Phenotypic plasticity, the capacity of a given genotype to 
produce differing morphologies in response to the environ- 
ment, is widespread among marine organisms (II For 
example, acorn barnacles feed by extending specialised 
appendages {the cirral legs) into flow, and the length of the 
cirri is plastic: the higher the velocity, the shorter the 
feeding legs (2, 3). However, this effect has been explored 
onl\ for flows less than 4.6 m/s. slow compared to typical 
flows measured at sites on wave-exposed shores. What 
happens at faster speeds? Leg lengths o/Balanus glandula 
Danvin, 1854. an acorn barnacle, were measured at 15 
sites in Monterey; California, across flows ranging from 0.5 
to 14.0 m/s. Similar to previous findings, a plastic response 
in leg length was noted for the four sites with water veloc- 
ities less than 3 m/s. However, no plastic response was 
present at the 11 sites exposed to faster velocities, despite a 
4-fold variation in speed. We conclude that the velocity at 
which the plastic response occurs has an upper limit of 2-4 
m/s. a velocity commonly exceeded within the tvpical Inih- 
itat of this species. 

Acorn barnacles provide an excellent opportunity for 
examining plastic response because they are sessile (and 
therefore cannot move in response to the environment), 
molt their exoskeleton (providing periodic opportunity for 
morphological change), and occur across a wide range of 
flow conditions. Helmuth and Denny (4) measured maximal 
wave-induced water velocities at 222 sites along the rocky 
intertidal shore at Hopkins Marine Station (HMS) in Pacific 
Grove, California (3636'N, 12153'W), and the variation 



Received 5 February 2004; accepted 31 March 2004. 

* To whom correspondence should be addressed. Present address: 
American Institute of Mathematics. 360 Portage Ave, Palo Alto. CA 
94305. E-mail: nkli@stanfordalumni.org 

Abbreviations: ADM, average daily maximum; ANCOVA. analysis of 
covariance; HMS. Hopkins Marine Station; MLLW. mean lower low 
water; OM. overall maximum. 



in velocity at each site was expressed as a function of 
offshore significant wave height (the average height of the 
highest one-third of waves). These measurements allowed 
us to select sites exposed to a range of wave-induced water 
velocities. Eleven sites, each 1.5 m above the mean lower 
low water (MLLW), were selected for collection of B. 
glandula. Because of the exposure of this shore, all HMS 
sites except one are subjected to water velocities greater 
than those encountered in previous studies on B. glandula 
(2, 3). Therefore, four additional sites were selected at the 
Monterey Wharf in Monterey, California (~2 km from 
HMS), where barnacles are subjected to a range of slower 
flows. At each site. 10 barnacles were collected, and the 
length of each cirrus was measured. 

Offshore significant wave height was measured four 
times per day for 30 days prior to the barnacle collections, 
and the largest significant wave height occurring when the 
tidal height was greater than 1 .5 m above MLLW was noted 
for each day. These data, in conjunction with the relation- 
ships measured by Helmuth and Denny (4), allowed us to 
estimate the daily maximal water velocities imposed at each 
collection site. Marchinko (3) found that transplanted spec- 
imens of B. glandula begin modifying their cirral length in 
response to their new environment somewhere between 7 
and 18 days after first exposure. There was no evidence of 
alteration at day 7 and significant alteration by day 18, 
continuing through day 30. To incorporate this lag in re- 
sponse time, we used the water velocities recorded 10-30 
days prior to sampling as an index of the flows to which the 
barnacles could have responded. Previous studies have ex- 
amined only the relationship between cirrus length and 
average daily maximum velocity, although the barnacles 
could be responding to maximum velocity, average veloc- 
ity, or some other aspect of flow. We employ both the 
average daily maximum (ADM) velocity and overall max- 
imum (OM) velocity. 



122 



N. K. LI AND M. W. DENNY 




-04 -0-2 



02 04 06 0.8 

Log(ADM Water Velocity) (m/s) 



I I 2 




All cirral legs (legs 4, 5, and 6) were significantly longer 
at the protected Monterey Wharf sites than at the exposed 
HMS sites. For example, the average length of leg 6 at the 
two wharf sites with ADM velocities less than 0.6 m/s was 
2.56 mm, nearly 1.8 times that at HMS (avg. length = 1.42 
mm), where ADM velocities exceeded 2.4 m/s. On the basis 
of evidence from previous studies (2. 3). we assume that this 
difference is due to a plastic response to flow. In contrast. 
the differences among the HMS sites were not significant, 
despite a range of velocities from 2.4 to 14.0 m/s. Further- 
more, among the Monterey Wharf sites, there was a signif- 
icant difference between the sites with lower velocities 
(0.48 and 0.58 m/s ADM) and higher velocities (1.19 and 
1.38 m/s ADM). 

Among the HMS sites, there was no significant correla- 
tion between leg length and either measure of water velocity 
(P > 0.05). In contrast, at the Monterey Wharf sites, leg 
length and water velocity were significantly correlated, and 
we explored this correlation using reduced major axis re- 
gressions for the logarithm of leg lengths versus the loga- 
rithm of either ADM or OM velocity (Fig. 1 and Table 1 ). 
We employed reduced major axis regression because the 



02 04 0,6 0.8 

Log( ADM Water Velocity) (m/s) 




-0-4 .0.2 



0.2 04 1) 08 

Log(ADM Water Velocity) (m/s) 



Figure 1. Average length of three feeding legs of Bulunm\ xUuultila 
from 15 sites of differing wave exposure in Monterey Bay, California. 
Wave exposure was calculated as the average of daily maximum velocities 
encountered for 10-30 days prior to collection. Legs 4. 5, and 6 refer to the 
fourth, fifth, and posterior-most (sixth) pair of thoracic legs of these 
baUmomorph barnacles. Leg lengths (n = 10 per site) were standardized to 
a common prosoma wet mass of 0.0079 g by ANCOVA. Reduced major 
axis regression lines are shown for the low-How Wharf data. Lines repre- 
senting the mean and 95 f , confidence intervals are shown for the HMS 
sites. (A) Average log,,, length of leg 4. (B) Average log,,, length of leg 5. 
((') Avciagc log,,, length of leg 6. Reduced major axis regression statistics 
are given in Table 1. Error bars are standard errors of the log-transformed 
dal.i. calculated by ANCOVA (Table 2). 

Water velocities during high tide .11 the Monterey Wharf sites were 
measured using a Marsh-McBimey 511 electromagnetic flow meter. The 
probe was placed about 0.5 in seaward of the collection points, and the 
velocity was sampled cvciv 30 s lor 20 inin at each site. The nia\imnin 
velocity encountered was then used in conjunction with the co-occurring 
oil shore wave height as a means of estimating maximal velocity. We 
assume that the velocity can be modeled using solitary wave theory 1 10). f ' - 
kfxht'^ (where / is velocily. i; is the acceleration ol gravitv. and h is offshore 



significant wave height), and the constant of proportionality, k, was cal- 
culated for each site. Velocities could then be calculated for days 10-30 
prior to barnacle collection from average daily maximum offshore wave 
significant height measurements. Note that in the summer of 2002 (when 
barnacles were collected), wave heights in Monterey Bay were consistently 
small, and variation among days was minimal. 

We collected 10 solitary, uncrowded specimens of Hiilunn.\ ghimlnlu 
from rock surfaces within 6 cm of each dynamometer for 1 1 sites along 
HMS on 5 and 6 May 2002. At the Monterey Wharf, barnacles were 
collected from rocks at four sites with differing wave exposures on 20 July 
2002. The staggered collection dales may have allowed seasonal variation 
in barnacle morphology, but we assume that any such variation is unlikely 
to account for the extreme differences in cirral lengths found between the 
sites. At each site, barnacles of various si/es were collected. All barnacles 
were dissected on the day of collection. The prosoma (the fleshy part of the 
body without the shell) was extracted, blotted with a paper towel, and 
weighed to the nearest (I.I mg as a measure of wet body mass The 
posterior three cirri (legs 4, 5, and 6) were then dissected from the lelt side 
of the prosoma. Both the e.xopodite and the endopodite of each leg were 
placed together on a microscope slide in a drop of saltwater. The slides 
were viewed and legs traced onto paper with the use of a camera lucida 
attached to the microscope. A calibration length measurement was taken 
using a stage micrometer. The traced length of each leg was then measured 
to the nearest micrometer by using a piece of cotton string placed against 
the tracing. The legs were measured from the base of the ramus to each tip. 
excluding the propodite segments. 

Analysis of covanance was conducted using SVSTAT (Systat Software 
Inc., ver. 6.0 for Macintosh). All sites exhibited a common slope of mass 
ivcwn leg length. Separate ANCOVA tests were done on each leg (4, 5, 
and 6). Least-square means of barnacle leg length for a standard body mass 
were computed by ANCOVA. A Tukev MSI) lest was performed to delect 
diltcicnccs between velocities and least-square mean leg lengths. Reduced 
ma|oi avis [egressions weie calculated using the least squares sUmdauli/cd 
means (5). All regression and ANCOVA analyses were performed on 
logni-log,,, transformed data, as per Arsenaull cl til. (3l. 



EFFECT OF FLOW ON BARNACLE LEG LENGTH 



123 



variables involved have different scales and are subject to 
measurement errors that are not easily specified (5). (Note 
that leg measurements were standardized to a common 
prosomal wet weight; see Table 2.) Among the Monterey 
Wharf sites, leg length is significantly negatively correlated 
with How velocity, with slopes varying from 0.28 to 
0.36 depending on the cirrus. The relationship using 
ADM velocities is shown in Figure I. The intersection of 
the Wharf regression and HMS mean (with 95% confidence 
interval) using ADM velocity occurred between 2.0 and 3.1 
m/s (average of intersection with the mean: 2.6 m/s) de- 
pending on the cirrus (Fig. 1 ). The intersection using OM 
velocity (not shown) occurred between 3.0 and 4.6 m/s 
(average of intersection with mean: 3.6 m/s). Because of the 
small number of data points (/; = 4), we could not calculate 
confidence bands for the reduced major axis regressions. 

The morphology of the cirri of B. glumlnlii is likely to 
affect their ability to act as effective filters. The longer the 
legs, the more area they can subtend and the farther they can 
extend into the water flow, and therefore the more water 
they can potentially filter. However, if the legs grow too 
long, hydrodynamic forces could cause them to buckle or 
bend, and thereby to lose their functionality. The ability to 
vary leg lengths appropriately in response to different water 
velocities would therefore appear to be advantageous. In- 
deed, barnacles seem capable of adjusting leg lengths within 
one or two molts of exposure to different wave velocities 
(3). and Arsenault et <//. (2) suggest that this "tuning" results 
in a precise power relationship between leg length and water 
velocity. Our results suggest, however, that there is a thresh- 
old water velocity ( 2.6 m/s using ADM velocity, 3.6 
m/s using OM velocity) above which barnacles cease re- 
sponding plastically to flow. Above this velocity, the large 

Table 1 

Reduced major axis linear regression equations for the average 

/(',(,'; '' ( 'V length) (mm] of Balanus glandula ax a function of the urc/vajr 

l8/it "/ '"'" measures of miter velocity (m/s) under breaking waves 



Table 2 

Analysis of covariance results for measurements of Balanus glandula 



Regression statistics 



Trait 



slope 



intercept 



A. Average 


daily maximum 


water velocity 


(ADM) 




leg 4 


-0.279 


0.198 


0.9 148 


<0.001 


leg 5 


-0.362 


0.271 


0.9l4d 


<0.001 


leg 6 


-0.354 


0.310 


0.901 


<0.0()1 


B. Overall maximum water 


velocity (OM) 






lea 4 


-0.279 


0.245 


0.9I4S 


< 0.001 


leg 5 


-0.362 


0.332 


0.9146 


<0.001 


leg 6 


-0.354 


0.370 


0.901 


< 0.001 



Regressions for ADM and OM velocity have identical slopes because 
(for our method of estimating velocity at these sites) OM velocity is a 
constant multiple of ADM velocity. Data are shown only for the Monterey 
Wharf sites. No significant correlations were found among the sites at 
Hopkins Marine Station (P > 0.05). Sample size (/;) for each leg is 4. 



Source of variation 



df Mean-square 



Log(ramus length of fourth 

thoracic leg) 

Field site 14 0.052 22.876 <0.001 

Covariate(log(prosoma wet 

mass)) I 0.392 172.237 <0.001 

Residual 134 0.002 

Loglramus length of fifth 

thoracic leg) 

Field site 14 0.069 31.817 <0.001 

Covariatedoglprosoma wet 

mass)) I 0.359 166.552 <0.001 

Residual 134 0.002 

Loglramus length of sixth 

thoracic leg) 

Field site 14 0.082 40.281 <0.001 

Covanatedoglprosoma wet 

mass)) I 0.369 180.598 <0.001 

Residual 134 0.002 



drag forces experienced might not allow legs of any prac- 
tical length to act as effective filters, and a plastic response 
would lose its advantage. Previous studies have reported 
that acorn barnacles adjust their feeding behavior across a 
range of low water velocities (0-0.15 m/s [6, 7]) and 
maintain their feeding activity at water velocities of at least 
0.25 m/s (8, 9), but we know of no direct observations at 
greater velocities. Our results suggest that acorn barnacles 
on wave-exposed shores may be able to feed only during the 
relatively slow backwash as waves recede. 

Arsenault et ul. (2) propose that the tight relationship 
between leg length and water velocity might allow bar- 
nacles to be used to measure local wave exposure. Our 
results suggest that barnacle leg length can, indeed, be a 
reliable indicator of wave exposure, but only for sites at 
which the ADM water velocity is less than about 3 m/s. 
Note also that the exponents of the power relationship 
found by Arsenault ct til. (2) (-0.32 to -0.43) are 
slightly different from those found here (0.28 to 
0.36). This disparity could be an artifact of the small 
number of data points (;; = 6, Arsenault et ul. [2]: /; = 4, 
this study), but also could possibly be accounted for by 
differences in mean barnacle size (0.0219 g, Arsenault et 
ul. [2]; 0.0079 g. this study), method used to estimate 
water velocity, or substantial latitudinal difference in 
collection site. Therefore, local calibration might be nec- 
essary if barnacles are to be used as "exposure meters." 

Studies to date have examined only the ultimate relation- 
ship between maximum velocities and cirral length. As with 
any correlation, further research is needed to elucidate the 
mechanisms that account for the relationship. 



124 



N. K. LI AND M. W. DENNY 



Acknowledgments 

We thank J. Watanabe for his invaluable statistical help, 
even while traveling the globe. 

Literature Cited 

1 . Pigliucci, M. 2001. Phenotypic Plasticity: Beyond Nature and Nur- 
ture. Johns Hopkins University Press. Baltimore, MD. 

2. Arstnault, D., K. B. Marchinko, and A. R. Palmer. 2001. Precise 
tuning of barnacle leg length to coastal wave action. Pmc. K. Soc. 
Loml. B 268: 2149-2154. 

3. Marchinko, K. B. 2003. Dramatic phenotypic plasticity in barnacle 
legs (Balanus glandula Darwin): magnitude, age dependence, and 
speed of response. Evolution 57: 1281-1290. 

4 1 1. 1 mi i ih. B., and M. \V. Denn\. 2003. Predicting wave exposure in 
the rocky intertidal zone: Do bigger waves always lead to larger 
forces? Liinnol. Oceanogr. 48: 1338-1345. 



5. Sokal, R., and F. J. Rohlf. 2000. Biometry: the Principles ami 
Practice of Statistics in Biological Research. 3rd ed. W. H. Freeman. 
New York. Pp. 541-548. 

n. Trager, G. C., J.-S. Hwang, and J. R. Strickler. 1990. Barnacle 
suspension feeding in variable flow. Mar. Bin/. 105: I 17-127. 

7. Trager, G. C., D. Coughlin, A. Genin, Y. Achituv, and A. Gango- 
padhyay. 1992. Foraging to the rhythm of ocean waves: porcelain 
crabs and barnacles synchronize feeding with flow oscillations. J. Exp. 
Mar. Biol. Ecol. 164: 73-86. 

8. I . 1,111,111. J. E., and D. O. Duggins. 1993. Effects of flow speed on 
growth of benthic suspension feeders. Bi>>/. Bull. 185: 28 H. 

9 Sanford, E., D. Bermudez, M. I). Bertness, and S. D. Gaines. 1994. 
Flow, flood supply and acorn barnacle population dynamics. Mar. 
Ecol. Prog. Ser. 104: 49-62. 

10. Gaylord, B. 1999. Detailing agents of physical disturbance: wave- 
induced velocities and accelerations of a rocky shore. J. Exp. Mar. 
Bio/. Ecol. 239: 85-124. 



Reference: Biol. Bull. 206: 125-133. (June 2004) 
2004 Marine Biological Laboratory 



Microscopic, Biochemical, and Molecular 

Characteristics of the Chilean Blob and a Comparison 

With the Remains of Other Sea Monsters: 

Nothing but Whales 



SIDNEY K. PIERCE 1 -*, STEVEN E. MASSEY 1 . NICHOLAS E. CURTIS'. 
GERALD N. SMITH, JR. 2 , CARLOS OLAVARJRIA 3 , AND TIMOTHY K. MAUGEL 4 

1 Department of Biology. University of South Florida, Tampa. Florida 33620: ~ Department of 

Medicine. Division of Rheumatology, Indiana University School of Medicine. Indianapolis. Indiana 

46202; ~ Centra de Estudios del Cuaternario Fue go-Patagonia y Antdrtica Pimta Arenas. Chile, and 

School of Biological Sciences. University of Auckland. Private Bag 92019. Auckland. New Zealand: and 

4 Department of Biology. University of Maryland, College Park. Man-land 20742 



Abstract. We have employed electron microscopic, bio- 
chemical, and molecular techniques to clarify the species of 
origin of the "Chilean Blob." the remains of a large sea 
creature that beached on the Chilean coast in July 2003. 
Electron microscopy revealed that the remains are largely 
composed of an acellular. fibrous network reminiscent of 
the collagen fiber network in whale blubber. Amino acid 
analyses of an acid hydrolysate indicated that the fibers are 
composed of 31% glycine residues and also contain hy- 
droxyproline and hydroxylysine, all diagnostic of collagen. 
Using primers designed to the mitochondria! gene ntid2. an 
800-bp product of the polymerase chain reaction (PCR) was 
amplified from DNA that had been purified from the car- 
cass. The DNA sequence of the PCR product was 100% 
identical to nad2 of sperm whale (Physeter catadori). These 
results unequivocally demonstrate that the Chilean Blob is 
the almost completely decomposed remains of the blubber 
layer of a sperm whale. This identification is the same as 
those we have obtained before from other relics such as the 
so-called giant octopus of St. Augustine (Florida), the Tas- 
manian West Coast Monster, two Bermuda Blobs, and the 
Nantucket Blob. It is clear now that all of these blobs of 
popular and cryptozoological interest are. in fact, the de- 
composed remains of large cetaceans. 



Received 13 February 2004; accepted 5 April 2004. 
* To whom correspondence should be addressed. E-mail: pierced 1 
cas.usf.edu 



Introduction 

Sea monsters have been reported since ancient times. For 
instance. Homer described the sea monsters Scylla and 
Charybdis", the Bible spoke of Leviathan; and St. Brendan 
encountered the beast Jasconius. Later on, world-roving 
mariners such as Columbus, Magellan, and Cook described 
encounters with sea monsters. Many of these accounts have 
been variously attributed to early descriptions of cetaceans 
or other large aquatic mammals, to misidentification of 
natural phenomena, or simply to overactive imaginations. 
Because the deep sea is still difficult to explore, tales of 
large marine creatures, new to science, are rarely substan- 
tiated through direct field observations. However, a few 
monsters, like the Nordic tale of the Kraken a large and 
ferocious squid-like animal may have a basis in reality, as 
shown by the recovery last year of an intact colossal squid 
Mesonyclwteiithis hamilttmi ( http://news.nationalgeographic. 
com/news/2003/04/0423_030423_seamonsters.html), com- 
plete with hooklike tentacles and eyes the size of dinner 
plates. 

For over a century the amorphous, decomposed remains 
of large animals have washed onto beaches around the 
world. Lacking a skeleton, or other identifiable morphology, 
a positive identification of the remains is problematic, es- 
pecially by untrained observers. Wild claims, especially in 
the nonscientific literature, are regularly made that the blobs 
are the remains of sea monsters. For example, the Tasma- 
nian West Coast Monster is still referred to as a monster. 



125 



126 



S. K. PIERCE ET AL 



although an Australian scientific team, led by W. Bryden. 
visited the carcass 2 years after it beached and identified it 
as a whale (Wall. 1981). Other relics such as the St. Au- 
gustine (Florida) Sea Monster and the Bermuda Blob are 
still described by some as the remains of a gigantic octopus 
(Octopus gig(intens). even though A. E. Verrill who 
named the St. Augustine specimen sight unseen recanted 
his identification in favor of whale remains (Verrill. 1897a. 
b. c). and in spite of microscopic and biochemical analyses 
showing that they were nothing more than the collagenous 
matrix of whale blubber (Pierce et til.. 1995) 

Last summer another blob washed ashore, this time on a 
beach in Chile (Fig. 1 ). The Chilean Blob rapidly generated 
a large amount of media interest around the world, and 
several immediate, and varied, identifications were made 
(including O. gigantem). almost all by novices with no 
more evidence than images of the carcass on the beach 
displayed on the Internet. Yet Chilean scientists, including 
G. P. Sanino of the Centre for Marine Mammals Research 
Leviathan in Santiago, had visited the grounding site and 
had identified the remains as that of a whale (pers. comm.). 

To augment the gross anatomical observations of the 
carcass, we have obtained samples of the Chilean relic and 
have used a variety of techniques including polymerase 
chain reaction (PCR) on recovered DNA to establish its 
true identity. In addition, we have compared the results with 
those we have obtained from several other blobs, including 



some that have previously been reported (Pierce el ul.. 
1995). 

Materials and Methods 

Samples of carcasses 

All of the carcasses were sampled by others and sent to us 
in a variety of states of preservation. The Chilean Blob (Fig. 
1 ) was sampled from its location on Pinuno Beach. Los 
Muermos. Chile, within a few days after it was discovered 
on 26 July 2003. by Elsa Cabrera of the Chilean Centro de 
Conservacion Cetacea. Some of the tissue was preserved in 
ethanol. and some was fresh frozen. The material was 
shipped to Tampa by overnight express, and the frozen 
tissue had thawed by the time it reached us. The St. Augus- 
tine carcass was originally sampled by Dewitt Webb. M.D.. 
in 1896. Apparently it was initially preserved in formalin, 
which solution it was in when given to us by Professor 
Eugenie Clark in 1995 (Pierce et at.. 1995). Bermuda Blob 
1. also provided by Professor Clark, washed onto Bermuda 
in 1995 and was also preserved in formalin when it was 
sampled (Pierce et ul.. 1995). Bermuda Blob 2 beached in 
January 1997. Professor Wolfgang Sterrer of the Bermuda 
Biological Laboratory provided us with both formalin-fixed 
and fresh-frozen samples. The Tasmanian West Coast mon- 
ster arrived on the beach in northwestern Tasmania in 1960, 
where it sat. mostly buried in sand, until it was sampled in 




Figure I. The Chilean carcass as it was found on Pinuno Beach Pholo b> Klsu Cabrera i> E. Cabrera. 
2003) 



CHILEAN BLOB IDENTIFICATION 



127 



1962. After the existence of the monster was called to our 
attention by Leonard Wall a member of the scientific party 
that sampled it Curator A. P. Andrews of the Tasmanian 
Museum and Art Gallery in Hobart provided us with a 
sample in an unknown fixative which, by its odor, contained 
ethanol. Finally, the Nantucket Blob washed onto Nantucket 
Island. Massachusetts, sometime during November 1996. A 
sample was collected, frozen, and sent to us by personnel in 
the Nantucket Shellfish Warden's office. 

Microscopy 

The original conditions of preservation of the relics were 
unsatisfactory for electron microscopy. So, small pieces 
were cut off of each and soaked, at least overnight, in 
several changes of filtered (0.2 ;um) artificial seawater. They 
were then placed into 2% glutaraldehyde and taken through 
the same fixation, embedding, and sectioning procedures 
that were described previously for the St. Augustine and 
Bermuda Blob 1 carcasses (Pierce et al.. 1995). The sections 
were viewed and photographed with a transmission electron 
microscope (Zeiss EM 10 or Phillips Morgagni). 

Hydrolysis 

Preliminary examination of the samples prepared for mi- 
croscopy suggested strongly that all of the remains were 
almost exclusively composed of collagen fibers, as we had 
found before with the St. Augustine and Bermuda Blob 1 
carcasses (Pierce et al., 1995). To confirm the collagen 
identification, the amino acid compositions of hydrolysates 
of the carcass samples was determined as follows. Small 
pieces were cut off and soaked in seawater as above. Each 
piece was placed into 5N HC1 and heated overnight at 100 
C. The hydrolysate was neutralized with concentrated 
NaOH. mixed 1 : 1 with ethanol, brought to a boil, and finally 
centrifuged at 20,000 X g for 20 min. The supernatant was 
lyophilized, and the residue was taken up in an appropriate 
volume of lithium citrate buffer. The amino acid composi- 
tion of this solution was determined with a ninhydrin-based, 
HPLC analysis (Pierce et al., 1995). Amino acid composi- 
tion was calculated as residues/1000 amino acids. 

Molecular until vsis 

The Chilean carcass was subjected to two independent 
molecular analyses. First, in Tampa (done by authors SEM 
and NEC). DNA was obtained from the frozen-thawed, 
unfixed tissue by phenol/chloroform extraction, followed by 
ethanol precipitation. The DNA was amplified in PCR using 
the temperature profile described previously (Carr et til.. 
2002). The sequence of the universal primers corresponded 
to the vertebrate mitochondrial nad2 gene the same se- 
quence used to identify Physeter catadon ( niacrocepha- 
lus) (sperm whale) as the source of the Newfoundland Blob 



(Carr et al.. 2002). A single. 800-bp PCR product was 
obtained, then cloned into the pPCR-Script Amp SK ( + ) 
plasmid (Stratagene) and sequenced (model CEQ 8000. 
Beckman-Coulter) using the CEQ DTCS Quick Start Kit 
(Beckman-Coulter) and T3 sequencing primer. 

The second independent analysis of the Chilean Blob was 
carried out in Auckland, New Zealand (by author CO). 
Genomic DNA was extracted with phenol/chloroform from 
three subsamples taken from an original 10-g, ethanol- 
preserved piece of tissue which was shipped to New Zea- 
land by Ms. Cabrera. An 800-bp portion of the mtDNA 
control region, proximal to the Pro-tRNA gene, was ampli- 
fied by PCR from two of the subsamples. using primer 
sequences Dip- 1.5 (Dalebout ct til.. 1998) and Dlp-8G 
(Lento c; til.. 1998; Pichler ct til.. 2001). The temperature 
profile consisted of a 2-min preliminary denaturing period at 
94 C, followed by 35 cycles of 30-s denaturing at 94 C, 
40 s of annealing at 54 C, and 40 s extension at 72 C. 
Amplification and subsequent cycle sequencing were im- 
proved by the addition of an M13 tag to the 5' end of the 
Dip- 1.5 primer. The PCR products were sequenced (model 
ABI3100. Applied Biosystems) in both directions, using the 
BigDye cycle sequencing kit, with M13Dlp-l.5 and Dlp-8G 
as the sequencing primers. 

In addition to the Chilean Blob, we attempted, in Tampa, 
to extract DNA from samples of all the other remains. 
However, either because the samples of the other blobs were 
too small or because their preservation was wrong, only the 
Nantucket Blob yielded amplifiable DNA. A single. 800-bp 
PCR product was obtained from the Nantucket Blob, using 
the temperature profile of Carr et al. (2002) and the se- 
quencing procedure that we described above. Subsequently, 
primers designed to the D-loop region of whale mitochon- 
drial DNA (Wada et al.. 2003) were also used to amplify a 
single 1100-bp PCR product from the Nantucket Blob, 
which was sequenced as described above using T3 and T7 
primers. The amplification conditions were an initial 90-s 
denaturation at 94 C, 30 cycles of a 30-s denaturation at 94 
C, a 30-s annealing at 55 C, and a 45-s extension at 72 C. 
followed by a final 240-s extension at 72 C. 



Results 



Fine structure 



The microscopic anatomy of all the carcasses, including 
the Chilean Blob, is virtually identical (Figs. 2, 3). These 
large masses consist almost entirely of pure collagen fibers 
arranged in cross-hatched layers, often perpendicular to 
each other. This arrangement is exactly that of the collagen 
fiber infrastructure of freshly preserved humpback whale 
blubber (Fig. 2) (see also Pierce et al.. 1995) and is totally 
unlike the fine structure of octopus or squid mantle, 
which consists mostly of muscle fibers with only a few 
collasen fibers (Pierce et al.. 1995). Furthermore, al- 



128 



S. K. PIERCE ET AL. 




Figure 2. Electron micrographs of sections oftissue from various monsters. (A) St. Augustine carcass (from 
Pierce et al., 1995); scale bar = 5 /xm. (B) Bermuda Blob I (from Pierce ct <//.. 1995); scale har = 5 xim. -'> 
Tasmaiiian \\ est ('oust Monstei; scale har = 2 /xm. (D) Bermuda Blob 2: scale har = 5 /xm. (E) Nantucket Bloh; 
scale har = 5 /xm. (F) Humpback whale blubber (from Pierce ct nl.. 1995); scale bar = 2 /am. In all cases, the 
(issues are composed entirely ol collagen libers arranged in layers of perpendicularly running liber bundles. No 
cellular elements were found. Bacteria were often present amidst the libers in the carcasses and can he seen in 
A, C, and I) lanowsi. 



though the fiber layers in the blobs are much thicker than 
those in vertebrate skin, the arrangement of the collagen 
libers in the two sites are similar (See Discussion). Vir- 



tually no cellular remnants, other than bacteria and bac- 
terial cysts, were found in any of the carcasses, reflecting 
their advanced state of decay. 



CHILEAN BLOB IDENTIFICATION 



129 




Figure 3. Electron micrographs of tissue sections from the Chilean Blob. (A) Lower magnification. Scale 
bar = 2 jam. (B) The banding pattern on the tibers is evident. As with the other carcasses, no cellular structures 
were present, but bacteria (bottom center of A) were often seen. Scale bar = 1 /j,m. 



Aiiiino uciil composition 

The amino acid compositions of the hydrolysates of all 
the carcasses were very similar, and they were also 
diagnostic of collagen. The amino acids in each blob 
hydrolysate consisted of about 3Q c /c glycine residues, and 
all contained residues of hydroxyproline and hydroxy- 
lysine (Table 1). 



DNA sequences 

The 587-bp consensus sequence (Genbank accession 
number AY582746) obtained from four sequencing runs on 
the DNA extracted in Tampa from the Chilean carcass was 
100% identical to the mitochondrial naJ2 gene sequence of 
P. artadon (Genbank accession numbers AJ277029, 
AF414121) (Fig. 4). Sequencing of the PCR product ob- 



Table 1 
Comparative iiiiiino </</</ t_i>nipit\i!ions of ihe hlnh ii\\iie samples following uciti /n<//'c/Y.w.v frtilut'\ ure uniino uciil residues/1000 i 



Amino acid 


Chilean 


St Augustine' 1 


Bermuda 1 J 


Bermuda 2 


Tasmuniun 


Nantucket 


Asp 


28 


50 


52 


42 


31 


45 


Thr 


22 


28 


27 


19 


l l > 


23 


Ser 


40 


45 


47 


36 


50 


35 


OH-Pro 


90 


54 


74 


113 


84 


146 


Pro 


213 


169 


88 


182 


92 


136 


Glu 


63 


82 


83 


62 


78 


63 


Gly 


314 


33(1 


339 


298 


363 


280 


Ala 


96 


106 


113 


94 


133 


94 


Val 


13 


18 


25 


21 


22 


22 


Cys 




















Met 


4 








3 


1 


3 


He 


8 


11 


14 


10 


11 


11 


Leu 


25 


28 


32 


23 


30 


25 


Tyr 


3 














6 


Phe 


12 


14 


Id 


12 


15 


14 


OH-Lys 


11 


15 


13 


26 


7 


20 


Lys 


21 


0.4 


10 


18 


12 


25 


His 


6 


4 


6 








X 


Arg 


29 


48 


55 


42 


51 


45 



J Data taken from Pierce et al., 1995. 



130 



S. K. PIERCE ET AL 



1 60 

Physeter catadon TAATACTAACTATATCCCTACTCTCCATTCTCATCGGGGGTTGAGGAGGACTAAACCAGA 
Chilean Blob TAATACTAACTATATCCCTACTCTCCATTCTCATCGGGGGTTGAGGAGGACTAAACCAGA 

61 120 

Physeter catadon CTCAACTCCGAAAAATTATAGCTTACTCATCAATCGCCCACATAGGATGAATAACCACAA 
Chilean Blob CTCAACTCCGAAAAATTATAGCTTACTCATCAATCGCCCACATAGGATGAATAACCACAA 

121 180 

Physeter catadon TCCTACCCTACAATACAACCATAACCCTACTAAACCTACTAATCTATGTCACAATAACCT 
Chilean Blob TCCTACCCTACAATACAACCATAACCCTACTAAACCTACTAATCTATGTCACAATAACCT 

181 240 

Physeter catadon TCACCATATTCATACTATTTATCCAAAACTCAACCAl^ACCACACTATCTCTGTCCCAGA 
Chilean Blob TCACCATATTCATACTATTTATCCAAAACTCAACCACAACCACACTATCTCTGTCCCAGA 

241 300 

Physeter catadon CATGAAACAAAACACCCATTACCACAACCCTTACCATACTTACCCTACTTTCCATAGGGG 
Chilean Blob CATGAAACAAAACACCCATTACCACAACCCTTACCATACTTACCCTACTTTCCATAGGGG 

301 360 

Physeter catadon GCCTCCCACCACTCTCGGGCTTTATCCCCAAATGAATAATTATTCAAGAACTAACAAAAA 
Chilean Blob GCCTCCCACCACTCTCGGGCTTTATCCCCAAATGAATAATTATTCAAGAACTAACAAAAA 

361 420 

Physeter catadon ACGAAACCCTCATCATACCAACCTTCATAGCCACCACAGCATTACTCAACCTCTACTTCT 
Chilean Blob ACGAAACCCTCATCATACCAACCTTCATAGCCACCACAGCATTACTCAACCTCTACTTCT 

421 480 

Physeter catadon ATATACGCCTCACCTACTCAACAGCACTAACCCTATTCCCCTCCACAAATAACATAAAAA 
Chilean Blob ATATACGCCTCACCTACTCAACAGCACTAACCCTATTCCCCTCCACAAATAACATAAAAA 

481 540 

Physeter catadon TAAAATGACAATTCTACCCCACAAAACGAATAACCCTCCTGCCAACAGCAATTGTAATAT 
Chilean Blob TAAAATGACAATTCTACCCCACAAAACGAATAACCCTCCTGCCAACAGCAATTGTAATAT 

541 587 

Physeter catadon CAACAATACTCCTACCCCTTACACCAATACTCTCCACCCTATTATAG 
Chilean Blob CAACAATACTCCTACCCCTTACACCAATACTCTCCACCCTATTATAG 

Figure 4. Alignment of sperm whale niul2 micleolide sequence with that of the PCR product from the 
Chilean Blob DNA. The sequences are identical. 



tuined from the Chilean Blob in the Auckland extraction had 
a .xS2-bp consensus sequence (Genbank accession number 
AY 582747] that was 99% identical to the mitochondria! 
control region sequence of P. dilution (Genbank accession 
numbers AJ277029. X72203, M93I54). The sequence ob- 
tained in Auckland for the Chilean Blob differed by a single 
nucleotide from the three P. ctilatlon sequences in the da- 
tabase (Fig. 5). The tirst 429-bp consensus sequence ob- 
tained from the Nantucket Blob DNA was 99% identical 
with the mitochondria] nutl2 gene sec|uence of Balaenoptera 
l>liy.\tiln.\ (linback whale) (Genbank accession number 
\dll45): onl\ a single micleotiile was different (data not 
show in I he subsequent 1 055-bp consensus sequence (Gen- 
bank accession number AY58748) obtained from 2 -4 se- 
quencing runs on the Nantucket Blob DNA was 99% iden- 
tical to the control region of li. />/;V.SY//I/.V mitochondria! 
DNA (Genbank accession number X6I145). with oiilv six 
nucleotide differences (F-'ig. 6). 



Discussion 

The molecular results reported here provide irrefutable 
evidence that the Chilean carcass was the highly decom- 
posed remains of a sperm whale. The nearly 100' < match 
between the two gene sequences obtained in our PCR ex- 
periments and the Phyxi-tcr dilution gene sequences leaves 
no other possibility. The match between the Nantucket Blob 
DNA and the control region mitochondria] DNA ot ' Huliifn- 
optcru I'/ivsdlii.s is equally robust, leaving no doubt about 
the specific identity of that relic. The six nucleolide differ- 
ences observed were consistent with \ariation within the fin 
whale species and may indicate a different subpopulation 
from the previously published sequence (Arnason </ <//.. 
1991). although even if this is case, both sequences were 
from specimens of North Atlantic origin. UnfortunateU . our 
attempts to extract usable DNA from the other monsters 
were not successful, due most likelv to some combination of 



CHILEAN BLOB IDENTIFICATION 



131 



Physeter catadon 
Chilean Blob 



1 60 

CATCATAGATAAATACAAACCCACAGTGCTATGTCAGTATTAAAAATAACCCACCCAATT 
CATCATAGATAAATACAAACCCACAGTGCTATGTCAGTATTAAAAATAACTCACCCAATT 



Physeter catadon 
Chilean Blob 



61 120 

ACATCTTTCCTACTCCCGACCATACCAATGCCCCCATGCCAATATTCAGCGTTCTCCCTG 
ACATCTTTCCTACTCCCGACCATACCAATGCCCCCATGCCAATATTCAGCGTTCTCCCTG 



Physeter catadon 
Chilean Blob 



121 180 

TAAATGTATACATGTACACGCTATGTATAATAGTGrATTCAATTATTTTCACTACGATCA 
TAAATGTATACATGTACACGCTATGTATAATAGTGCATTCAATTATTTTCACTACGATCA 



Physeter catadon 
Chilean Blob 



181 240 

GTGAAAGCTCGTATTAAATCTTATTAATTTTACATATTACATAAAATTATGGATCGTACA 
GTGAAAGCTCGTATTAAATCTTATTAATTTTACATATTACATAAAATTATGGATCGTACA 



Physeter catadon 
Chilean Blob 



241 300 

TAGGACATATCCTTAAATCAACTCCAGTCCCCTGAAATTATGAGCTCTCGGATCAGACCA 
TAGGACATATCCTTAAATCAACTCCAGTCCCCTGAAGTTATGAGCTCTCGGATCAGACCA 



Physeter catadon 
Chilean Blob 



301 360 

CGAGCTTGATCACCATGCCGCGTGAAACCAGCAACCCGCTTGGCAGGGACTCACTATTAT 
CGAGCTTGATCACCATGCCGCGTGAAACCAGCAACCCGCTTGGCAGGGACTCACTATTAT 



Physeter catadon 
Chilean Blob 



361 420 

TGTATCTCAGGCCCATTCCTCGAAAGCCGTGCTACTCCGTGGTTTTTCCAAGGCCTCTAG 
TGTATCTCAGGCCCATTCCTCGAAAGCCGTGCTACTCCGTGGTTTTTCCAAGGCCTCTAG 



Physeter catadon 
Chilean Blob 



421 480 

TTGCAATTCTCAGGGTCATAACTCGAGGCACCTGCGCTAGTTCCAGCTTTTTCCAAGGCC 
TTGCAATTCTCAGGGTCATAACTCGAGGCACCTGCGCTAGTTCCAGCTTTTTCCAAGGCC 



Physeter catadon 
Chilean Blob 



481 540 

TCGGCTTGGACCTGAGAGCAGGAGCCTCCACCCTATTAATCACTCACGGGGGGAGTTATA 
TCGGCTTGGACCTGAGAGCAGGAGCCTCCACCCTATTAATCACTCACGGGGGGAGTTATA 



541 

Physeter catadon GGCATCTGGTCG 
Chilean Blob GGCATCTGGTCG 

Figure 5. Alignment of sperm whale mtDNA control region nucleotide sequence with that of the PCR 
product from the Chilean Blob DNA. Nucleotide differences are indicated in boldface and underlined. 



method of preservation, small sample size, or advanced 
stage of decomposition. However, when the microscopic 
anatomy and biochemical composition of the Chilean and 
Nantucket Blobs are compared with those of the other 
remains, similarities are manifest. Thus, there is no doubt 
that they are all derived from the same type of organism. 

The amino acid composition of the hydrolysates of all the 
blobs consists of about 30% glycine residues along with some 
hydroxyproline and hydroxylysine residues. Only collagen has 
such an amino acid composition (Eastoe, 1955; Kimura et al, 
19691. While there are some differences among the amino acid 
compositions of the blob hydrolysates likely resulting from 
differences in preservation as well as species the results 
indicate that all the blobs, including the Chilean and Nantucket, 
are large masses of collagen. 

The collagenous matrix of the blobs is confirmed by their 
fine structure. They are all composed of bundles of long, 
banded fibers that are similar in their dimensions, not only 



to each other, but also to the collagen fibers in rat tail tendon 
(see Pierce et til., 1995). The bundles of fibers are arranged 
parallel to each other in layers, and each layer is sandwiched 
between perpendicularly oriented layers of other fiber bun- 
dles. The fiber layering pattern is similar to the arrangement 
of collagen fibers in vertebrate dermis (Moss, 1972), and 
identical to the collagen fiber pattern in humpback whale 
blubber and in all the other blobs. In addition, the unimodal 
fiber diameter and the tight packaging of the fibers in the 
Chilean Blob and the others is characteristic of mammalian 
dermis, including pygmy sperm whale blubber (Craig et a!.. 
1987) and our humpback blubber control. Collagen is much 
less abundant in octopus and squid mantle, which are com- 
posed primarily of muscle; and the few collagen fibers 
present in these molluscan species are not arranged in the 
network (Pierce et til., 1995) so obvious in the Chilean Blob 
and the other blob tissue samples. Thus, both the biochem- 
ical and microscopic analyses show clearly that the Chilean 



132 S. K. PIERCE ET AL. 

1 60 

Balaenoptera physalus CCTCCCTAAGACTCAAGGAAGAAGTATTACACTCCACCATCAGCACCCAAAGCTGAAGTT 
Nantucket Blob CCTCCCTAAGACTCAAGGAAGAAGTATTACACTCCACCATCAGCACCCAAAGCTGAAGTT 

61 120 

Balaenoptera physalus CTACATAAACTATTCCCTGAAAAAGTATATTGTACAATAACCACAGGACCACAGTACTAT 
Nantucket Blob CTACATAAACTATTCCCTGAAAAAGTATATTGTACAATAACCACAGGACCACAGTACTAT 

121 180 

Balaenoptera physalus GTCCGTATTGAAAATAACTTGCCTTATTAGATATTATTATGTAACTCGTGCATGCATGTA 
Nantucket Blob GTCCGTATTGAAAATAACTTGCCTTATTAGATATTATTATGTAACTCGTGCATGTATGTA 

181 240 

Balaenoptera physalus CTTCCACATAATTAATAGCGTCTTTCCATGGGTATGAACAGATATACATGCTATGTATAA 
Nantucket Blob CTTCCACATAATTAATAGCGTCTTTCCATGGGTATGAACAGATATACATGCTATGTATAA 

241 300 

Balaenoptera physalus TTGTGCATTCAATTATTTTCACCACGAGCAGTTGAAGCTCGTATTAAATTTTATTAATTT 
Nantucket Blob TTGTGCATTCAATTATTTTCACCACGAGCAGTTGAAGCTCGTATTAAATTTTATTAATTT 

301 360 

Balaenoptera physalus TACATATTACATAATATGTATTAATAGTACAATAGCGCATO'i TCTTATGCATCCCCAGAT 
Nantucket Blob TACATATTACATAATATGTATTAATAGTACAATAGCGCATGTTCTTATGCATCCCCAGGT 

361 420 

Balaenoptera physalus CTATTTAAATCAAATGATTCCTATGGCCGCTCCATTAGATCACGAGCTTAGTCAGCATGC 
Nantucket Blob TTATTTAAATCAAATGATTCTTATGGCCGCTCCATTAGATCACGAGCTTAGTCAGCATGC 

421 480 

Balaenoptera physalus CGCGTGAAACCAGCAACCCGCTTGGCAGGGATCCCTCTTCTCGCACCGGGCCCATCACTC 
Nantucket Blob CGCGTGAAACCAGCAACCCGCTTGGCAGGGATCCCTCTTCTCGCACCGGGCCCATTAATC 

481 540 

Balaenoptera physa 1 us GTGGGGGTAGCTATTTAATGATCTTTATAAGACATCTGGTTCTTACTTCAGGACCATATT 
Nantucket Blob GTGGGGGTAGCTATTTAATGATCTTTATAAGACATCTGGTTCTTACTTCAGGACCATATT 

541 600 

Ba laenoptera physa lus AACTTAAAATCGCCCACTCGTTCCCCTTAAATAAGACATCTCGATGGGTTAATTACTAAT 
Nantucket Blob AACTTAAAATCGCCCACTCGTTCCCCTTAAATAAGACATCTCGATGGGTTAATTACTAAT 

601 660 

Balaenoptera physalus CAGCCCATGATCATAACATAACTGAGGTTTCATACATTTGGTATTTTTTTATTTTTTTTG 
Nantucket Blob CAGCCCATGATCATAACATAACTGAGGTTTCATACATTTGGTATTTTTTTATTTTTTTTG 

661 720 

Balaenoptera physalus GGGGGCTTGCACGGACTCCCCTATGACCCTAAAGGGTCTCGTCGCAGTCAGATAAATTGT 
Nantucket Blob GGGGGCTTGCACGGACTCCCCTATGACCCTAAAGGGTCTCGTCGCAGTCAGATAAATTGT 

721 780 

Balaenoptera physalus AGCTGGGCCTGGATGTATTTGTTATTTGACTAGCACAACCAACATGTGCAGTTAAATTAA 
Nantucket Blob AGCTGGGCCTGGATGTATTTGTTATTTGACTAGCACAACCAACATGTGCAGTTAAATTAA 

781 840 

Balaenoptera physalus TGGTTACAGGACATAGTACTCCACTATTCCCCCCGGGCTCAAAAAACTGTATGTCTTAGA 
Nantucket Blob TGGTTACAGGACATAGTACTCCACTATTCCCCCCGGGCTCAAAAAACTGTATGTCTTAGA 

841 900 

Balaenoptera physalus GGACCAAACCCCCCTCCTTCCATACAATACTAACCCTCTGCTTAGATATTCACCACCCCC 
Nantucket Blob GGACCAAACCCCCCTCCTTCCATACAATACTAACCCTCTGCTTAGATATTCACCACCCCC 

901 960 

Balaenoptera physalus CTAGACAGGCTCGTCCCTAGATTTAAAAGCCATTTTATTTATAAATCAATACTAAATCTG 
Nantucket Blob CTAGACAGGCTCGTCCCTAGATTTAAAAGCCATTTTATTTATAAATCAATACTAAATCTG 

961 1020 

Ba laenoptera physa lus ACACAAGCCCAATAATGAAAATACATGAACGrCATCCCTATCCAATACGTTGATGTAGCT 
Nantucket Blob ACACAAGCCCAATAATGAAAATACATGAACGCCATCCCTATCCAATACGTTGATGTAGCT 

1021 1055 

Balaenoptera physalus TAAACACTTACAAAGCAAGACACTGAAAATGTCTA 
Nantucket Blob TAAACACTTACAAAGCAAGACACTGAAAATGTCTA 

Figure 6. Alignment of tin whale mitochondria! control region nucleotide sequence with that of the PCR 
product from the Nantucket Bloh DNA. Nucleotide differences are indicated in boldface and underlined. 



CHILEAN BLOB IDENTIFICATION 



133 



Blob has the characteristics of all the other blobs and is the 
remains of the collagen matrix of whale blubber as are 
they all. 

The results, taken together, leave no doubt that all of the 
blobs examined here St. Augustine, Bermuda 1. Bermuda 
2, Tasmanian West Coast, Nantucket, and Chilean repre- 
sent the decomposed remains of great whales of varying 
species. Once again, to our disappointment, we have not 
found any evidence that any of the blobs are the remains of 
gigantic octopods, or sea monsters of unknown species. 

Acknowledgments 

This study was supported by resources from the Depart- 
ment of Biology at the University of South Florida. We 
thank Dr. Charles Potter of the Smithsonian Museum of 
Natural History. Washington, DC, for kindly providing the 
sample of humpback whale blubber from a specimen in the 
Museum's collection. We also thank Dr. Shiro Wada of the 
National Institute of Fisheries Science, Yokohama. Japan, 
for advice on the PCR conditions for the Nantucket Blob. 

Literature Cited 

Arnason, U., A. Gullherg, and B. Widegren. 1991. The complete 
nucleotide sequence of the mitochondria! DNA of the fin whale. Bal- 
iii'iioptera physalux. J. Mol. Evol. 33: 556-568. 

Carr, S. M., H. D. Marshall, K. A. Johnstone, L. M. Pynn, and G. B. 
Stenson. 2002. How to tell a sea monster: molecular discrimination 
of large marine animals of the North Atlantic. Bin/. Bull. 202: 1-5. 



Craig, A. S., E. F. Eikenberry, and D. A. D. Parry. 1987. Ultrastruc- 
tural organization of skin: classification on the basis of mechanical role. 
Connect. Tissue Res. 16: 212-223. 

Dalebout, M., A. Van Helden, K. Van Waerebeek, and C. S. Baker. 
1998. Molecular genetic identification of southern hemisphere 
beaked whales (Cetacea: Ziphiidae). Mol. Ecu/. 7: 687-695. 

Eastoe, J. E. 1955. The amino acid composition of mammalian collagen 
and gelatin. Biochem. J. 61: 589-600. 

Kimura, S., Y. Nagoka, and M. Kubota. 1969. Studies on marine 
invertebrate collagens. I. Some collagens from crustaceans and mol- 
luscs. Bull. Jpn. Sue. Sci. Fish. 35: 743-748. 

Lento, G. M., M. J. Dalebout, and C. S. Baker. 1998. Species and 
individual identification of whale and dolphin products for sale in Japan 
by mtDNA sequences and nuclear microsatellite profiles. Report (SC/ 
50/O8) to the Scientific Committee of the International Whaling Com- 
mission. Oman. 

Moss, M.L. 1972. The vertebrate dermis and the integumental skeleton. 
Am. Zool. 12: 27-34. 

Pichler, F. B., D. Robineau. R. N. P. Goodall, M. A. Meyer, C. 
Olavarria, and C. S. Baker. 2001. Origin and radiation of Southern 
Hemisphere coastal dolphins (genus Cephalurhynchus). Mol. Ecol. 10: 
2215-2223. 

Pierce, S. K., G. N. Smith, Jr., T. K. Maugel, and E. Clark. 1995. On 
the giant octopus (Octopus giganteus) and the Bermuda Blob: homage 
to A. E. Yen-ill. Bil. Bull. 188: 214-230. 

Verrill, A. E. 1897a. The supposed great Octopus of Florida: certainly 
not a cephalopod. Am. J. Sci. 4th series, 3: 355. 

Verrill, A. E. 1897b. The Florida monster. Science 5(114): 392. 

Verrill, A. E. 1897c. The Florida sea monster. Science 5(116): 476. 

Wada, S., M. Oishi, and T. K. Yaniada. 2003. A newly discovered 
species of living baleen whale. Nature 426: 278-281. 

Wall, L. E. 1981. The west coast monster. 1962. Tasmanian Naturalist 
103: 2-6. 



Reference: Biol. Bull. 2(16: 134-143. (June 2004) 
2004 Marine Biological Laboratory 



Chemical and Visual Communication During Mate 
Searching in Rock Shrimp 

ELIECER R. DIAZ 1 AND MARTIN THIEL 1 ' 2 '* 

1 Universidad Catolica del None, Facnltad de Ciencias del Mar, Larrondo 1281, Coquimbo, Chile: and 
~ Centra de Estudios Avan-ados en Zonas Aridas (CEAZA), Coquimbo, Chile 



Abstract. Mate searching in crustaceans depends on dif- 
ferent communicational cues, of which chemical and visual 
cues are most important. Herein we examined the role of 
chemical and visual communication during mate searching 
and assessment in the rock shrimp Rhynchocinetes typus. 
Adult male rock shrimp experience major ontogenetic 
changes. The terminal molt stages (named "robustus") are 
dominant and capable of monopolizing females during the 
mating process. Previous studies had shown that most fe- 
males preferably mate with robustus males, but how these 
dominant males and receptive females find each other is 
uncertain, and is the question we examined herein. In a 
Y-maze designed to test for the importance of waterborne 
chemical cues, we observed that females approached the 
robustus male significantly more often than the typus male. 
Robustus males, however, were unable to locate receptive 
females via chemical signals. Using an experimental set-up 
that allowed testing for the importance of visual cues, we 
demonstrated that receptive females do not use visual cues 
to select robustus males, but robustus males use visual cues 
to find receptive females. Visual cues used by the robustus 
males were the tumults created by agitated aggregations of 
subordinate typus males around the receptive females. 
These results indicate a strong link between sexual commu- 
nication and the mating system of rock shrimp in which 
dominant males monopolize receptive females. We found 
that females and males use different (sex-specific) commu- 
nicational cues during mate searching and assessment, and 
that the sexual communication of rock shrimp is similar to 
that of the American lobster, where females are first at- 
tracted to the dominant males by chemical cues emitted bv 



Received 15 December -IKI.V accepted 15 March 2004. 

1 To whom correspondence should he addressed. R mail: ihicK" iicn.cl 



these males. A brief comparison between these two species 
shows that female behaviors during sexual communication 
contribute strongly to the outcome of mate searching and 
assessment. 

Introduction 

Mating systems are expressions of the strategies that both 
sexes use to find each other and mate (Shuster and Wade. 
2003). These strategies, mediated by population demogra- 
phy and ecological variables, depend on specific communi- 
cation systems between the sexes, which facilitate mate 
finding and subsequently aid in regulating the mating pro- 
cess (Salmon, 1983). In crustaceans, sexual communication 
is based on visual, chemical, and acoustic cues (Salmon, 
1983; Hughes, 1996; Bushmann, 1999). but chemical sig- 
nals are of major importance in most aquatic species 
(Atema, 1995). In many species, individuals are dispersed 
over variable distances, and mating partners need to locate 
each other during the searching phase. To better understand 
the mating system of a species, it is particularly important to 
know which sex is searching for the other and to identify the 
communicational cues used during mate searching and as- 
sessment. 

Chemical communication in aquatic crustaceans may act 
(I) over distance via waterborne odors or (2) by direct 
contact via chemo-tactile signals (Salmon, 1983). Odors 
may be emitted by either sex to attract potential mates over 
variable distances (e.g., Dunham. 1978; Atema and Cobb. 
1980: Bamber and Naylor, 1996; Bushmann and Atema. 
1997). For example, in Homanis americanus (Cowan, 
1991) and Callim-ctes sapidiix (Bushmann. 1999), the fe- 
male is guided towards the male by a pheromone in the 
male's urine. In contrast, in Chionoecetes opilio, the male is 
guided h\ an ecdysteroid from pubescent and multiparous 



134 



SEXUAL COMMUNICATION IN ROCK SHRIMP 



135 



females (Bouchard et a/.. 1996). Similarly, in Curciinis 
maenas, waterborne signals from the premolt female evoke 
searching in males (Bamber and Naylor, 1996). Contact 
chemoreception, which usually occurs when males and fe- 
males touch each other during assessment and mating (see 
Salmon, 1983), has been reported for many crustaceans 
(Borowsky, 1991; Kelly and Snell, 1998; Correa and Thiel, 
2003a). 

Visual sexual communication involves cues such as 
color, shape, and size of morphological structures or re- 
sources (e.g.. shelters), often in connection with elaborate 
courtship behaviors (e.g., Latruffe et al, 1999; Christy et 
ul.. 2003). Visual signals are reported mostly for crusta- 
ceans from terrestrial environments (Salmon, 1983; Burg- 
gren and McMahon. 1988; Backwell et al.. 1998; Pope, 
2000), but also occur in some species from shallow aquatic 
environments (Hatziolos and Caldwell. 1983; Hughes, 
1996; Acquistapace et al.. 2002). When visual signals are 
used in the aquatic environment, they are often accompa- 
nied by chemical cues (see review by Salmon, 1983). Com- 
bined visual and chemical signals have been reported in the 
snapping shrimp Alpheus heterochaelis (Hughes, 1996), in 
smasher stomatopods (Christy and Salmon, 1991; Marshall 
et ul.. 1999), and in freshwater crayfish (Acquistapace et til., 
2002). 

Most studies examining sexual communication in crusta- 
ceans focus on signal perception in only one sex, either the 
males or females (Salmon, 1983; Christy and Salmon, 1991; 
Bamber and Naylor, 1996; Bouchard et al., 1996; Kamio et 
al.. 2002). Similarly, many studies focus exclusively on 
either visual cues (e.g., Marshall et al., 1999) or chemical 
cues (e.g.. Cowan, 1991), these being the two most impor- 
tant ones in aquatic crustaceans. Several studies, though, 
have demonstrated that both sexes are involved in signal 
exchange (Atema and Voigt, 1995; Bushmann. 1999) and 
that often more than one sense is employed during crusta- 
cean communication (Hughes, 1996). In particular, when 
individuals assess each other, they may base their decision 
on multiple signals (Sneddon et al.. 2003). This should be 
expected primarily during sexual communication in those 
species where members of one or both sexes show strong 
preferences for specific individuals of the opposite sex. 

The rock shrimp Rhynchocinetes typus Milne Edwards 
1837, which is abundant on shallow subtidal hard bottoms 
along the coasts of the southeastern Pacific (e.g.. Caillaux 
and Stotz, 2003). presents a mating system described as 
"neighborhood of dominance" (Correa and Thiel. 2003a). 
Male rock shrimp reach sexual maturity in the female-like 
typus stage, and during growth they pass through several 
intermedius stages before reaching the terminal molt stage. 
named robustus. The robustus males feature highly devel- 
oped 1 st pereopods and 3rd maxillipeds. and they are dom- 
inant over the ontogenetically younger stages. Robustus 



males have high resource-holding potential and can defend 
females during the entire mating process (Correa et al., 
2003). and they also have larger sperm supplies than sub- 
ordinate typus males (Hinojosa and Thiel, 2003). Receptive 
females prefer to mate with robustus males (Diaz and Thiel, 
2003; Thiel and Hinojosa, 2003) even though these are 
comparatively rare in natural populations (Correa and Thiel. 
2003b). Consequently, it can be expected that both robustus 
males and receptive females have developed efficient sexual 
communication to find each other. Receptive females might 
utilize visual signals such as the distinct morphological 
characteristics of robustus males to identify them. The ro- 
bustus males might in turn use visual cues such as tumults 
developing around receptive females to identify and locate 
them. Tumults are agitated aggregations of several typus 
males that attempt to gain access to the receptive female. 
These tumults are visible over distances of several shrimp 
body lengths, and it is possible that robustus males perceive 
these tumults and approach the receptive female. However, 
since visual cues might be of minor importance in coastal 
habitats with limited visibility, chemical cues might also be 
important during sexual communication of rock shrimp. 

In the present study, we examined whether receptive 
females and robustus males of the rock shrimp utilize chem- 
ical cues, visual cues, or both to locate and assess a potential 
mating partner. 

Materials and Methods 

Experiments were conducted during austral summer 
(February to April, water temperatures: 14.8-18.9 C) and 
spring (September to October, 13.0-15.2 "C) of 2002 in a 
flowing seawater laboratory located near Bahi'a La Herra- 
dura. Coquimbo, Chile (2959'S, 7921'W). Shrimp were 
collected from the field by using a diver-operated suction 
sampler and were maintained in the laboratory in tanks with 
flowing and aerated seawater. They were fed fish and mol- 
luscs ad libitum. Females and males were held in separate 
tanks each containing up to 30 shrimp. Every morning the 
tanks with the females were examined to identify recently 
molted females, which are receptive 24 h after molting. The 
molted females were individually held in containers (sur- 
face area 20 cm x 20 cm and height 15 cm) with flowing 
seawater until the following day. when they were used in the 
experiments (for further details, see Correa et al.. 2003: 
Hinojosa and Thiel. 2003). After each replicate, the recep- 
tivity of the female was confirmed by allowing it to mate 
with a robustus male if the female did not mate during this 
opportunity, the replicate was eliminated. The males used 
for the experiments were either in the terminal molt stage 
(robustus males) or in the intermolt phase (typus males). All 
individuals were used only once in these experiments, ex- 
cept where noted otherwise. 



136 



E. R. DIAZ AND MARTIN THIEL 



Chemical communication experiments 

We used a Y-maze (Fig. 1A) to examine whether water- 
borne chemical cues play a role during mate searching in 
receptive females and robustus males. Seawater entered the 
Y-maze through two small branches, which converged in 
the choice chamber. The flow speed in the two branches was 
- 1cm s~ '. In the upstream part of each branch was a shelter 
for the shrimp designated as a potential sender of chemical 
cues; shrimp were randomly assigned to one of the two 
branches. The shelter was separated from the branches by a 
barrier of multiple layers of black mesh that prevented 
mechanical and visual contact, but allowed water to pass. 
The shrimp to be tested was placed downstream in the 
choice chamber under a plastic bell with holes allowing 
contact with the surrounding water. The acclimation period 
was 30 min for females and 60 min for males: preliminary 
experiments had shown that robustus males require more 
time to calm down after handling than females. Following 
release, the tested shrimp was observed for 30 min, and after 



141 cm 




Choice chamber 



B 



Lateral 
area 


Central area 


Lateral 
area 



Figure 1. The experimental set-up. (A) The Y-maze used to study the 
importance of chemical cues that receptive females and dominant robustus 
males employ to locate potential mating partners. The tested individual was 
released downstream in the choice chamber; from there it could select one 
of the upstream branches leading to the shelter of a target individual from 
the opposite sex. (B) The seawater tank used to study the importance of 
visual cues employed by receptive females and dominant robustus males to 
locate their respective potential mating partners. The tested individual was 
released in the central compartment, while the target individuals from the 
opposite sex were placed in the lateral compartments. The central com- 
partment was hermetically separated from the lateral compartments by a 
sealed glass window. 



each experiment the tank was washed three times with fresh 
water. 

Receptive females: Are receptive females guided by chem- 
ical cues in locating robustus males? One typus male was 
placed in the upstream shelter in one branch of the Y-maze, 
and one robustus male was placed in the upstream shelter of 
the other branch. After releasing a receptive female, we 
observed it for a maximum of 30 min. If the female spent 10 
continuous minutes in one branch of the Y-maze, the male 
in the corresponding shelter was considered to be the chosen 
male. If the receptive female did not show a preference for 
either branch during the 30 min of observation, the replicate 
was considered as a no-choice. We conducted 12 replicates 
and used a \ 2 goodness-of-fit test to determine whether 
females chose robustus males more frequently than they 
chose typus males. 

Robustus males: Are robustus males guided b\ chemical 
cues in locating receptive females? This experiment was 
divided into two parts, which differed by the absence or 
presence of typus males with the females. In part 1, a 
receptive female and a nonreceptive female were separately 
placed in the shelters at the upstream part of each branch of 
the Y-maze. After releasing the robustus male, we observed 
it for a maximum of 30 min. If the male stayed in one 
branch of the Y-maze for a continuous 10-min period, the 
female in the corresponding shelter was considered to be the 
chosen female. At the conclusion of part 1, the robustus 
male was again placed at the end of the choice chamber, 
where it was re-acclimated for 15 min. During this time, two 
typus males were added to the shelter of each female to 
induce mating interactions with the receptive female. Fol- 
lowing release of the robustus male, observations were 
conducted as in part 1. In both parts (n = 18 replicates for 
part 1, n = 17 for part 2). we used a ^ goodness-of-fit test 
to determine whether robustus males oriented to the recep- 
tive female more often than to the nonreceptive female. In 
addition, we used a two-tailed Student's Mest for indepen- 
dent samples to compare the reaction times (start of exper- 
iment until the robustus male chooses a female). 



Visual 



communication experiments 



The visual cues used during mate searching were exam- 
ined by providing visual signals to the receptive female and 
the dominant robustus male. The experiments were con- 
ducted in a large indoor tank (surface area 141 cm X 65 cm 
and height 30 cm) filled to a water level of 20 cm. This tank 
was divided into three compartments separated from each 
other by hermetically sealed glass windows (Fig. IB). The 
observations were conducted during daylight hours ( 1 100 to 
1600). The tested shrimp (receptive female or robustus 



SEXUAL COMMUNICATION IN ROCK SHRIMP 



137 



male) was placed in the central compartment where it was 
acclimated behind a glass fence (allowing it to see in all 
directions). The lateral compartments contained the shrimp 
that were used to generate visual signals (see below). The 
duration of the observation differed between the sexes (60 
min for robustus males, 90 min for females) since previous 
studies had shown that robustus males usually seize recep- 
tive females within 60 min (Correa et al., 2000), but females 
may delay mate choice for more than 60 min (Diaz and 
Thiel. 2003). 

Receptive females: Can receptive females distinguish be- 
nveen ty/nts ami robustus males via visual cues? Each 
experiment used two males a robustus and a typus and 
randomly assigned one to each lateral compartment, where 
they were tethered to the bottom of the experimental tank. 
Tethering prohibited the males from actively courting the 
female behind the glass window and limited the visual 
signal to the morphological characteristics of the male. 
During the experiment, some males attempted to move once 
the female approached their glass window, but they were 
kept in place by the tether. Males were tethered 24 h before 
the start of the experiment, which was sufficient for them to 
acclimatize. 

Following an acclimation period of 30 min, the receptive 
female was released in the central compartment of the tank, 
and her behavior was registered for 90 min. We quantified 
the following variables: (a) time of first visit to each male, 
(b) duration and frequency of individual visits to each male, 
and (c) male attended by the female at the end of the 
experiment. We use the term visit to refer to the female 
touching the glass window of the respective male. Finally, 
we tested the null hypothesis that the frequencies of the first 
visit and the last visit to either male were similar by using 
a x 2 goodness-of-fit test. We also tested whether the total 
duration of visits by the female to each male differed 
between typus and robustus males by using the two-tailed 
Student's Mest for dependent samples. 

Robustus males: How important are visual cues fur the 
robustus male'.' We examined this question using tumults 
generated by typus males around a receptive female. These 
tumults are visible over distances of several shrimp body 
lengths, and we hypothesized that they could indicate the 
presence of a receptive female to robustus males. We used 
different numbers of typus males together with a receptive 
female to test whether (1) tumults were produced, (2) the 
frequency of visual cues increased with increasing numbers 
of typus males, and (3) robustus males reacted to these 
visual cues. 

Different numbers (2, 3, 4, 8, and 12) of typus males were 
placed in each lateral compartment 24 h before the start of 
the experiment. For a given treatment, the same number of 



typus males were always put in each lateral compartment. 
At the end of the acclimation period of the males, a recep- 
tive female was introduced into one lateral compartment, 
while a nonreceptive female was introduced into the other 
lateral compartment. Females were assigned randomly to 
each lateral compartment, where they were acclimated un- 
der a transparent plastic bell (made from the upper part of a 
plastic bottle) for 15 min before the start of the experiment. 
Because of a shortage of receptive females, replication of 
the different treatments (number of typus males) was un- 
equal, ranging from /; = 8 (two typus males) to n = 5 (two 
treatments, with four and eight typus males, respectively). 
The experiment lasted for 60 min after release of the fe- 
males. 

To assess whether the number and intensity of visual 
signals depended on the number of typus males, we counted 
the number of tumults per treatment and determined the 
total mating time of the receptive female with different 
numbers of typus males. Two Kruskal-Wallis tests (both 
two-tailed) were conducted to test for significant differences 
in these variables. While the robustus male was being ac- 
climated for 15 min behind a glass fence in the central 
compartment, the females were introduced to the lateral 
compartments. After release of the male, we observed its 
behavior for 60 min and counted the number and duration of 
its visits to each of the two lateral compartments. Using a x 2 
goodness-of-fit test, we compared the number of males 
visiting the receptive and the nonreceptive female during 
the first and last visits. To examine whether the robustus 
male used visual signals to locate the receptive female, we 
calculated the total duration of visits to each female. Three 
independent parametric tests were run: (a) a one-way 
ANOVA to compare the total visit duration by the robustus 
male to the receptive female between the different typus 
treatments, (b) a parallel one-way ANOVA to compare the 
total visit duration by the robustus male to the nonreceptive 
female between the different typus treatments, and (c) a 
one-tailed Student's /-test for dependent samples to deter- 
mine whether the total visit duration by the robustus male 
(pooling all typus treatments) was longer for the receptive 
than for the nonreceptive females (Zar, 1999). 

Statistical analysis 

To assess frequencies of choices made by either robustus 
males or receptive females in the different experiments, we 
conducted ^ 2 goodness-of-fit tests. All other data were 
tested for homogeneity of variances using the Cochran 
C-test. If the original data failed the normality test, they 
were ln(.v + 1) transformed. A Student's Mest was used 
when variances were homogeneous. One-way ANOVAs 
were used to test for significant difference between treat- 
ments, followed by a post hoc Tukey test. If variances were 



138 



E. R. DIAZ AND MARTIN THIEL 



not homogeneous after transformation, we conducted non- 
parametric Kruskal-Wallis tests, followed by a post hoc 
Dunn test. All tests were carried out with a significance 
level of a = 0.05. 

Results 

Chemical communication 

Receptive females: Are receptive females guided by chem- 
ical cues in locating robustus males? Following release, 
most females (10 of 12) chose the branch with the robustus 
male. When the plastic acclimation bell was removed, these 
ten females went directly to the robustus male (mean SD: 
1.22 2.14 min). Only one female remained for 30 min in 
the choice chamber. The female that chose the typus male 
entered and left the typus branch twice before finally staying 
with the typus. The difference between the females choos- 
ing the robustus male and those choosing other options was 
significant (r = 13.5, r 00 5.: = 5.991, P = 0.001). 



Robustus males: Are robustus males guided by chemical 
cues in locating receptive females? Following release, most 
robustus males in part 1 (female without typus males) failed 
to make a choice for the receptive female (x 2 = 4, ^0.05.2 = 
5.991, P = 0.135). Of the 18 animals tested, 4 chose the 
receptive female, 4 chose the nonreceptive female, and 10 
made no choice. The robustus males that selected the branch 
with the receptive female were not faster to react (mean 
SD: 4.33 2.75 min) than the robustus males that selected 
the nonreceptive female (mean SD: 6.85 5.63 min) 
(r-test: / = -0.805, t OOSl2t6 = 2.447, P = 0.452); the other 
males reacted late or never left the choice chamber during 
the 30-min observation period. After the introduction of two 
typus males to the female shelters (part 2), more robustus 
males chose the branch with the receptive female, but dif- 
ferences were not significant (x 2 2.24, ^"005.2 = 5.991, 
P = 0.329). Of the 17 animals tested, 8 chose the receptive 
female, 3 chose the nonreceptive female, and 6 made no 
choice. Also during the second part, robustus males that 
selected receptive females were not faster to react (mean 
SD: 6.69 5.37 min) than those that selected nonreceptive 
females (mean SD: 3.06 3.43 min) (/-test: t = 1.062, 
'o.os(2).8 = 2.306, P = 0.319). 



Receptive female: Can receptive females distinguish be- 
tween typus and robustus males via visual cues? Following 
their release, receptive females started to move continu- 
ously without staying for long near the lateral compartments 
of the aquarium. There was no clear pattern of choice in 
favor of either of the two male forms (typus or robustus). 
When comparing the number of visits to the two males. 



there was no significant preference for either male, neither 
during the first visit (x 2 = 0.0769, ^o.os.i = 3-841, P = 
0.78 after Yates correction) nor during the last visit (x~ = 
2.48, ro.os.2 = 5.991, P = 0.28) (Table 1). Similarly, there 
were no significant differences in the total duration of visits 
to either male (Mest: t = -0.432, / 005(2)J , = 2.179, P = 
0.674). Females spent on average less than 10 min near the 
compartment of either male (mean SD: robustus 8.3 
24.4 min; typus 6.3 1 1.6 min). 

Robustus males: How important are visual cues for the 
robustus male? As predicted, tumults were generated by the 
typus males around the receptive female, but no tumults 
were observed near the nonreceptive female. Each tumult 
lasted only a few seconds, and generally the larger typus 
male succeeded in mating with the female. The frequency of 
tumults increased positively in relation to the number of 
typus males in the different treatments. Significant differ- 
ences in the number of tumults were found between treat- 
ments with 2 and 8 typus males (Kruskal-Wallis H = 
12.602, df = 4, n = 30, P = 0.013) (Fig. 2 A). Another 
possible visual signal for the robustus male might be gen- 
erated by mating of the receptive female with one of the 
typus males. Matings were observed in all treatments, and 
there were no significant differences in the total mating time 
between treatments (Kruskal-Wallis H = 6.301, df = 4, n = 
30, P = 0.178) (Fig. 2B). In summary, many visual signals 
potentially attractive for the robustus males were generated 
in the lateral compartment with the receptive female. 

When comparing the number of visits between the two 
females, there was no significant preference for either fe- 
male, neither during the first visit (see Table 2) nor the last 
visit (see Table 3). The total duration of visits by the 
robustus males to the receptive female was not significantly 
affected by the numbers of typus males in each treatment 
(one-way ANOVA F 42 , = 1.962. P = 0.131) (Fig. 3A). 
The visit duration of robustus males to the receptive female 
reached lowest values in the treatment with the highest 
densities of typus males, but there were no significant dif- 
ferences to the other treatments (the absence of significant 



Table 1 

Visual communication experiment: choices made by receptive females 
when presented with a robustus male and u r\ l pus nuilc 



Choice 



First visit 



Last visit 



Robustus male 
Typus male 
No choice 



Presented are the first visit and the last visit to one of the lateral 
compartments with a male behind the glass window. 



SEXUAL COMMUNICATION IN ROCK SHRIMP 



139 



| J6 



2 



a ab ab 



ab 



P<0.05 



234 8 

Density of ty pus males 



12 



80 P>0.05 B 

kill! 



12 



Density of typus males 



Figure 2. (A) Number of tumults produced in I h; different letters 
indicate treatments with significant differences (post hoc test. Dunn q = 
3.073. P < 0.05); (B) Total mating time (mean + SD) of the receptive 
female with typus males in the respective treatments; note that occasionally 
a female mated with more than one male. 



differences should be interpreted cautiously since the power 
of the statistical test is very low; P = 0.253). The total 
duration of visits by robustus male to the nonreceptive 
female also was not affected by the typus treatments (one- 



Table 2 

Visual communication experiment: number of robustus males that chose, 
in the first visit, either a receptive or a nonreceptive female when llic 
females were presented in the presence of various numbers of typus 
unties 

Female 





Treatment 












(# 


of typus males) 


Receptive 


Nonreceptive 


,v : 


df 


P 




2 


3(3.5) 


4(3.5) 


01 


1 


0.705 




3 


2(3) 


4(3) 


0.6 


I 


0.414 




4 


3(2.5) 


2(2.5) 


0.2 


1 


0.654 




8 


4(2.5) 


1 (2.5) 


1.8 


I 


0.179 




12 


5(3) 


1 (3) 


2.6 


1 


0.102 








TOTAL x 2 


= 5.4 


5 




r 


grouped 


17(14.5) 


12(14.5) 


0.8 


1 


0.353 


Heterogeneity x 2 


4.6 


4.6 


4 


>0.05 



In parentheses are the expected frequencies of first visit. The P value 
corresponding to heterogeneity >0.05 means that treatments are homoge- 
neous and can be analyzed as a whole. In the treatment with 2 typus males, 
one robustus male did not make any choice for either female during the 
observation time, and consequently was not included in this analysis. 



Table 3 

Visual communication experiment: number of robustus males that chose, 
in the last visit, either a receptive or a nonreceptive female when the 
females were presented in the presence of various numbers of typus 
males 



Female 


Treatment 








(# of typus males) 


Receptive 


Nonreceptive 


X 2 df P 


2 


3(3.5) 


4(3.5) 


0.14 


0.705 


3 


4(3) 


2(3) 


0.67 


0.414 


4 


4(2.5) 


1 (2.5) 


1.8 


0.179 


8 


4(2.5) 


1 (2.5) 


1.8 


0.179 


12 


4(3) 


2(3) 


0.67 


0.414 






TOTAL ,r 


= 5.08 5 


X 2 grouped 


19(14.5) 


10(14.5) 


2.79 1 0.094 


Heterogeneity x 1 






2.29 4 >0.05 



In parentheses are the expected frequencies of last visit. The P value 
corresponding to heterogeneity >0.05 means that treatments are homoge- 
neous and can be analyzed as a whole. In the treatment with 2 typus males, 
one robustus male did not make any choice for either female during the 
observation time, and consequently was not included in this analysis. 



way ANOVA F 4 23 = 0.089, P = 0.984) (Fig. 3B). Since no 
differences between typus treatments were found, we 
pooled all replicates and calculated the total visit duration of 
the robustus males to each lateral compartment (with recep- 
tive female and nonreceptive female, respectively) (Fig. 
3C). The total visit duration to the receptive female glass 
window was on average twice as long as to the nonreceptive 
female u-test: t = -2.039, r ( ,. 05( , ,. 2y = 1-699, P = 0.025). 

Discussion 

Our results show that receptive females and robustus 
males use different cues during sexual communication. Re- 
ceptive females locate their potential mating partners by 
using chemical cues, whereas robustus males find females 
mostly by using visual cues. The results suggest that fe- 
males and males adopt sex-specific roles during the search- 
ing and assessment phase. Thus Rhynchocinetes typus, like 
the lobster Homarus americanus (Bushmann and Atema, 
2000), is a crustacean species in which females locate 
dominant males via chemical signals. In both species, fe- 
males preferentially mate with dominant males, which de- 
fend females during the mating process. This suggests that 
sexual communication in R. typus (and H. americanus) is 
closely linked to their mating system, as will be discussed in 
the following section. 

Chemical communication 

Chemical cues are used by a variety of crustaceans during 
sexual communication. In many species such as the shore 



140 



E. R. DIAZ AND MARTIN THIEL 



20 



C 



^ 80 
w 

> 

* 60 



^40 




12 



Density of typus males 



P>0.05 
B 



ro 



20 \ 


40 
30 
20 
10 




348 
Density of typus males 



12 




Receptive female Q Non-receptive female 



Figure 3. Total visit duration (mean + SD) of robustus males to the 
(A) receptive female and (B) nonreceptive female in respective treatments; 
P > 0.05 indicates no significant differences between treatments. (C) Total 
visit duration (mean + SD) of robustus males to the respective females 
after pooling among all treatments; P < 0.05 indicates significant differ- 
ences between visits to respective females. 



crab Carcinus maenas, snow crab Chionoecetes opilio, and 
helmet crab Telmessus cheiragonus, females advertise their 
reproductive status and attract males via waterborne chem- 
ical signals (Bamber and Nay lor, 1996: Bouchard el ai, 
1996; Kamio et ai. 2002). This does not appear to be the 
case in Rhynchocinetes typus, where males do not locate 
receptive females via chemical cues. Most crustacean spe- 
cies possess highly efficient chemoreceptive capabilities 
that allow them to evaluate their environment (Derby and 
Steullet. 2001 ). We believe that this is also true for R. typus. 
and that males would be able to perceive the presence of a 
receptive female if appropriate chemical signals were avail- 
able. Since males of this species apparently cannot identify 
a receptive female via waterborne chemical cues, it appears 
that receptive females do not release waterborne chemicals 
advertising their reproductive status. When typus males 
were together with females, there was a slight tendency for 
robustus males to approach the receptive females, but the 



experimental set-up did not allow distinguishing whether 
this was in response to chemicals released by the females or 
by typus males attending them. Rock shrimp typically live 
at high densities (Caillaux and Stotz. 2003). and there are 
usually many males for each receptive female (Correa and 
Thiel, 2003b). Female rock shrimp might have no problem 
in obtaining a mating partner, and thus the adaptive advan- 
tage in attracting males via waterborne chemical signals 
would be slight. It is also possible that R. typus. which 
inhabits complex and wave-exposed rocky shore environ- 
ments, lives in a habitat where communication via chemical 
cues is complicated by turbulent flow. However, the fact 
that female rock shrimp locate males via waterborne chem- 
ical cues suggests that chemical communication in the hab- 
itat of R. npus is not negatively influenced by the hydro- 
dynamic regime. 

In some crustacean species, males advertise their pres- 
ence to females. For example, in the lobster Hoiiuims 
americaiuis, females are attracted to dominant males via 
chemical signals (Bushmann and Atema, 1997, 2000). Sim- 
ilarly, in the blue crab Callinectes sapidus, females appear 
to key in on chemical signals from males (Gleeson, 1991: 
Bushmann, 1999). Males of these crustacean species typi- 
cally advertise their status to other individuals via chemical 
signals released in the urine (e.g.. Breithaupt and Atema, 
2000; Zulandt Schneider et al, 2001; Breithaupt and Eger, 
2002). These signals often are used during agonistic en- 
counters to establish dominance status, and females might 
exploit these signals to locate dominant males. This could 
explain why and how females of R. npus find dominant 
robustus males via chemical signals. Robustus males occa- 
sionally engage in agonistic interactions (Correa et al.. 
2003), and during these encounters they may employ chem- 
ical signals similar to those of male lobsters and crayfish. 
During the searching phase, female rock shrimp may utilize 
these chemical signals to locate robustus males, which they 
prefer as mates (Diaz and Thiel, 2003; Thiel and Hinojosa, 
2003). 

Visual communication 

Since robustus males feature distinct morphological char- 
acteristics, it could have been expected that receptive fe- 
males would use visual cues to distinguish between males. 
Females of some other decapod crustaceans choose males 
on the basis of visual cues such as size of body structures or 
shelter, which are reliable indicators of the fitness of an 
individual (Atema and Cobb. 1980: Christy, 1987). The 
results of the current study suggest that females do not 
approach the robustus males on the basis of visual signals. 
In general, visual signals are uncommon during sexual 
communication of aquatic crustaceans (see Salmon. 1983). 
Only in particular groups of stomatopods (Hatziolos and 



SEXUAL COMMUNICATION IN ROCK SHRIMP 



141 



Caldwell. 1983; Christy and Salmon, 1991; Marshall et ai. 
1999) and in the snapping shrimp Alpheus heterochaelis 
(Hughes, 1996) are visual signals known to play an impor- 
tant role during intersexual communication, probably be- 
cause both species live in tropical waters where visibility 
usually is high. Similarly, females of terrestrial crustaceans 
use visual signals to find males (Christy and Salmon. 1991; 
Pope, 2000). The importance of visual signals for sexual 
communication in terrestrial and clear-water environments 
appears to be related to the better light conditions and 
visibility. The apparent inability of female rock shrimp to 
select robustus males via visual cues in our study does not 
prove that females do not use visual cues to recognize 
robustus males. Female rock shrimp that received both 
chemical and visual cues avoided robustus males initially 
(see Diaz and Thiel, 2003). The experiments with the ro- 
bustus males demonstrated that visual cues also play a role 
during intersexual communication in R. typiis. Robustus 
males are guided visually to the tumults or matings devel- 
oping around receptive females. A similar phenomenon has 
been reported for the horseshoe crab Linnihis polyphemus, 
where additional males are attracted to satellite males 
around the receptive female apparently by visual cues (Bar- 
low et ai, 1982), but this occurs in shallow waters and is 
aided by chemical signals (Hassler and Brockmann, 2001 ). 
These observations suggest that in the marine environment, 
once crustaceans are close to potential mating partners, that 
is, during the assessment phase, visual cues (often accom- 
panied by chemical cues) may gain in importance. 

Visual cues are important for judging the size of an 
opponent during agonistic encounters (e.g.. Caldwell and 
Dingle. 1979; Atema and Cobb, 1980). This occurs when 
individuals are within a few body lengths of each other. In 
addition to chemical signals (Breithaupt and Atema, 2000) 
and moderate agonistic interactions (Karavanich and 
Atema, 1998), visual signals may also serve to establish and 
maintain dominance status. In rock shrimp, visual commu- 
nication occurs during agonistic encounters when robustus 
males appear to gauge the size of their opponents (e.g., 
Correa et ai. 2003). This might explain why male lobsters 
and shrimps have evolved visual skills to distinguish con- 
specifics (opponents and receptive females). 

Sexual communication and mating system of rock shrimp 

The mating system of rock shrimp has been characterized 
as "neighborhoods of dominance" (Correa and Thiel, 
2003a) in which dominant males monopolize a receptive 
female and defend it against subordinate males (Correa et 
<//. . 2003). In Rhynchocinetes typus, females have a strong 
preference for these dominant males (Diaz and Thiel. 2003; 
Thiel and Hinojosa, 2003). The mating system of R. tvpus 
thus shows strong similarities to that of Honninis amcri- 



canus. In this species, dominant males that inhabit shelters 
also form neighborhoods of dominance (e.g.. Karnofsky et 
a!.. 1989), and reproductive females exhibit preferences for 
dominant males (Atema et ai. 1979; Atema. 1986; Bush- 
mann and Atema. 2000). even leading to female molt- 
staggering (Cowan and Atema. 1990). 

In contrast to many other decapod species, female rock 
shrimp and lobsters do not attract males via waterborne 
chemical signals. In both species, harassment from subor- 
dinate males may represent a high cost for females (e.g.. 
Cowan, 1991; Thiel and Hinojosa, 2003). To avoid ap- 
proaches and rambunctious harassment from subordinate 
males, female rock shrimp and lobsters may thus hide their 
reproductive status (they remain "chemically quiet" sensu 
Atema, 1995) until they reach the vicinity of a dominant 
male. Male lobsters are residents in shelters and accept only 
mature females into their shelter (Cowan, 1991). The same 
might be true for rock shrimp, where one or several robustus 
males often occupy large spaces in open shelters (pers. 
obs.). These dominant males usually are dispersed and 
difficult to locate visually in their shelters. Consequently, 
receptive females are attracted to these areas by chemical 
cues, as shown herein for rock shrimp and by Bushmann 
and Atema (1997) for H. cimericaniis. Once in the vicinity 
of a dominant male, females may no longer hide their 
reproductive status but rather permit assessment by that 
male. In lobsters, this appears to occur via chemical cues 
(Atema and Cowan, 1986), which reduce male aggression 
and later facilitate successful mating (Bushmann and 
Atema. 1997). Waterborne chemical signals most likely 
play only a minor role during mate assessment in R. ftpus, 
since they would attract large numbers of subordinate 
males. Visual cues arising from activities developing 
around the receptive female are apparently sufficient to 
attract a dominant male within a short period of time and 
induce it to monopolize the female. Thus the assessment 
phase seems to be brief and simple in rock shrimp, even 
though in other crustaceans it involves sophisticated signals 
and requires substantial time (Christy, 1987; Cowan, 1991; 
Bushmann, 1999). For rock shrimp, we propose a hypothet- 
ical mating scenario in which females molt at night and 
subsequently (or before molting) approach areas with dom- 
inant males. Females then become receptive during the day, 
when visual cues can be used by the robustus males to 
locate and monopolize receptive females in their vicinity. 

In summary, this comparison of sexual communication in 
rock shrimp and lobster further underlines the important 
role of female behavior during mate searching and assess- 
ment. Females may significantly influence the outcome of 
the mating process by hiding their reproductive status be- 
fore reaching the neiuhhorhood of dominant males. 



142 



E. R DIAZ AND MARTIN THIEL 



Acknowledgments 

We are grateful to I. Hinojosa and T. Chr. van Son for 
help in collecting shrimp. Our special thanks go to W. Stotz 
and D. Lancellotti for their unconditional support during 
this study. Helpful comments from A. Baeza and from two 
anonymous reviewers helped to improve the original manu- 
script. 

Literature Cited 

Acquistapace, P., L. Aquiloni, B. A. Hazlett, and F. Gherardi. 2002. 

Multimodal communication in crayfish: sex recognition during mate 
search by male Austropotamobius pal/ipes. Can J. Zoo/. 80: 2041- 
2(14?. 

Alema, J. 1986. Review of sexual selection and chemical communica- 
tion in the lobster. Homarus americanus. Can. J. Fish. Aqttat. Sci. 43: 
2283-2290. 

Atema, J. 1995. Chemical signals in the marine environment: dispersal, 
detection, and temporal signal analysis. Proc. Natl. Acad. Sci. USA 92: 
62-66. 

Atema, J.. and J. S. Cobb. 1980. Social behavior. Pp. 409-450 in The 
Biology and Management of Lobsters. J. S. Cobb and B. F. Phillips, 
eds. Academic Press, NY. 

Atema. J., and D. F. Cowan. 1986. Sex-identifying urine and molt 
signals in lobster Homarus americanus. J. Chem. Ecol. 12: 2065-2080. 

Atema, J., and R. Voigt. 1995. Behavior and sensory biology. Pp. 
313-348 in The Biology of the Lobster, Homarus americanus, J. R. 
Factor, ed. Academic Press, New York. 

Atema. J., S. Jacobsen, E. Karnofsky, S. Oleszko-Szuts, and L. Stein. 
1979. Pair formation in the lobster, Homarus americanus: behavioral 
development, pheromones and mating. Mar. Behav. Phvsiol. 6: 277- 
296. 

Backwell, P., M. Jennions, N. Passmore, and J. Christy. 1998. Syn- 
chronized courtship in fiddler crabs. Nature 391: 31-32. 

Bamber, S. D., and E. Naylor. 1996. Chemical communication and 
behavioural interaction between sexually mature male and female shore 
crabs (Carcinus maenas). J. Mar. Biol. Assoc. UK 76: 691-699. 

Barlow, R. B., L. C. Ireland, and L. Kass. 1982. Vision has a role in 
Limulus mating behavior. Nature 296: 65-66. 

Borowsky, B. 1991. Patterns of reproduction of some amphipod crusta- 
ceans and insights into the nature of their stimuli. Pp. 33-49 in 
Crustacean Sexual Biology, R. T. Bauer and J. W. Martin, eds. Co- 
lumbia University Press. New York. 

Bouchard, S., B. Sainte-Marie, and J. N. McNeil. 1996. Indirect evi- 
dence indicates female semiochemicals release male precopulatory 
behaviour in the snow crab, Chionoecetes opilio (Brachyura: Majidae). 
Chemoecologv 7: 39-44. 

Breithaupt, T., and J. Atema. 2000. The timing of chemical signaling 
in dominance fights of male lobsters (Homarus americanus). Behav. 
Ecol. Sociobiol. 49: 67-78. 

Breithaupt, T., and P. Eger. 2002. Urine makes the difference: chem- 
ical communication in fighting crayfish made visible. /. Exp. Biol. 205: 
1221-1231. 

Burggren, W. W., and B. R. McMahon. 1988. Biologv of the Lund 
Crabs. Cambridge University Press, Cambridge. 

Bushmann, P. J. 1999. Concurrent signals and behavioral plasticity in 
blue crab (Cullinectes sapidus Rathbun) courtship. Biol. Bull. 197: 
63-7 1 . 

Bushmann, P. J., and J. Atema. 1997. Shelter sharing and chemical 
courtship signals in the lobster Homarus americanus. Can. J. Fish. 
Aquat. Sci. 54: 647-654. 



Bushmann. P. J., and J. Atema. 2000. Chemically mediated mate 
location and evaluation in the lobster. Homarus americanus. J. Chem. 
Ecol. 26: 883-899. 

Caillaux, L. M.. and W. Stotz. 2003. Distribution and abundance of 
Rhynchocinetes typus Milne Edwards (Crustacea: Decapoda: Rhyncho- 
cinetidae) in different benthic community structures in northern Chile. 
J. Mar. Biol. Assoc. UK 83: 143-150. 

Caldwell, R. L., and H. Dingle. 1979. The influence of size differential 
on agonistic encounters in the mantis shrimp, Gonodactylus viridis. 
Behaviour 69: 255-264. 

Christy, J. H. 1987. Competitive mating, mate choice and mating asso- 
ciations of brachyuran crabs. Bull Mar. Sci. 41: 177-191. 

Christy, J. H., and M. Salmon. 1991. Comparative studies of reproduc- 
tive behavior in mantis shrimps and fiddler crabs. Am. Zoo/. 31: 
329-337. 

Christy. J. H.. P. R. Y. Backwell. and U. Schober. 2003. Interspe- 
cific attractiveness of structures built by courting male fiddler crabs: 
experimental evidence of a sensory trap. Behav. Ecol. Sociobiol. 53: 
84-41. 

Correa, C., and M. Thiel. 2003a. Mating systems in caridean shrimp 
(Decapoda: Caridea) and their evolutionary consequences for sexual 
dimorphism and reproductive biology. Rev. Chil. Hist. Nat. 76: 187- 
203. 

Correa, C., and M. Thiel. 2003b. Population structure and operational 
sex ratio in the rock shrimp Rhvnchocinetes typus (Decapoda: Candea). 
J. Crustac. Biol. 23: 849-861. 

Correa, C., J. A. Baeza, E. Dupre, I. A. Hinojosa, and M. Thiel. 2000. 
Mating behavior and fertilization success of three ontogenetic stages of 
male rock shrimp Rhynchocinetes typus (Decapoda: Caridea). J. Crus- 
tac. Biol 20: 628-640. 

Correa, C., J. A. Baeza, I. A. Hinojosa, and M. Thiel. 2003. Male 
dominance hierarchy and mating tactics in the rock shrimp Rhvncho- 
cinetes typus (Decapoda: Caridea). J. Crustac. Biol. 23: 33-45. 

Cowan, D. F. 1991. The role of olfaction in courtship behavior of the 
American lobster Homarus americanus. Biol. Bull. 181: 402-407. 

Cowan, D. F., and J. Atema. 1990. Moult staggering and serial monog- 
amy in American lobsters, Homarus americanus. Anim. Behav. 39: 
1199-1206. 

Derby, C. D., and P. Steullet. 2001. Why do animals have so many 
receptors? The role of multiple chemosensors in animal perception. 
Biol Bull. 200: 211-215. 

Diaz, E. R., and M. Thiel. 2003. Female rock shrimp prefer dominant 
males. / Mar. Biol. Assoc. UK 83: 941-942. 

Dunham, P. J. 1978. Sex pheromones in Crustacea. Biol Rev. 53: 
555-583. 

Gleeson, R. A. 1991. Intrinsic factors mediating pheromone communi- 
cation in the blue crab. Callinectes sapidits. Pp. 1 7-32 in Crustacean 
Sexual Biology, R. T. Bauer and J. W. Martin, eds. Columbia Univer- 
sity Press. New York. 

Hassler, C., and H. J. Brockmann. 2001. Evidence for use of chemical 
cues by male horseshoe crabs when locating nesting females (Limulus 
polyphemus). J. Chem. Ecol. 27: 2319-2335. 

Hatziolos, M. E. and R. L. Caldwell. 1983. Role reversal in courtship 
in the stomatopod Pseudosqui/la ci/iata (Crustacea). Anim. Behav. 31: 
1077-1087. 

Hinojosa, I. A., and M. Thiel. 2003. Somatic and gametic resources in 
male rock shrimp, Rhynchocinetes typus: effect of mating potential and 
ontogenetic male stage. Anim. Behav. 66: 449 158. 

Hughes, M. 19%. The function of concurrent signals: visual and chem- 
ical communication in snapping shrimp. Anim. Behav. 52: 247-257. 

Kamio, M., S. Matsunaga. and N. Fusetani. 2002. Copulation phero- 
mone in the crab Telmessus cheiragonus (Brachyura: Decapoda). Mar. 
Ecol. Prog. Ser. 234: 183-190. 



SEXUAL COMMUNICATION IN ROCK SHRIMP 



143 



Karavanich, C., and J. Atenia. 1998. Individual recognition and mem- 
ory in lobster dominance. Anim. Beliav. 56: 1553-1560. 

Karnofsky, E. B., J. Atema, and R. H. Elgin. 1989. Field observations 
of social behavior, shelter use. and foraging in the lobster, Homann: 
americanus. Bwi Bull. 176: 239-246. 

Kelly, L. S., and T. W. Snell. 1998. Role of surface glycoproteins in 
mate-guarding of the marine harpacticoid Tigriopus jupunicits. Mar. 
Bio/. 130: 605-612. 

Latruffe, C., P. K. McGregor, and R. F. Oliveira. 1999. Visual sig- 
nalling and sexual selection in male fiddler crabs Uca tan/jfri. Mar. 
Eco/. Prog. Set: 189: 233-240. 

Marshall, J., T. W. Cronin, N. Shashar, and M. Land. 1999. Behav- 
ioural evidence for polarisation vision in stomatopods reveals a poten- 
tial channel for communication. Curr. Bio/. 9: 755-758. 

Pope, D. S. 2000. Testing function of tiddler crab claw waving by 
manipulating social context. Beliav. Eco/. Sociobiol. 6: 432 137. 

Salmon, M. 1983. Courtship, mating systems; and sexual selection in 
decapods. Pp. 143-169 in Studies in Adaptation: The Behavior of 



Higher Crnsiaeeans, S. Rebach and D. Dunham, eds. John Wiley & 
Sons. New York. 

Shuster. S. M., and M. J. Wade. 20(13. Mating Systems and Slratcf.:ii-\ 
Princeton University Press. Princeton. NJ. 

Sneddon. L. U., F. A. Huntingford, A. C. Taylor, and A. S. Clare. 20(13. 
Female sex pheromone-mediated effects on behavior and consequences 
of male competition in the shore crab (Carciiuix maenast. J. Client. 
Ecol. 29: 55-7(1. 

Thiel, M.. and I. Hinojosa. 2003. Mating behavior of female rock 
shrimp Rhynchticinctes typns (Decapoda: Caridea) indication for con- 
venience polyandry and cryptic female choice. Behav. Eeol. Sociobiol. 
55: 113-121. 

Zar, J. H. 1999. Biastatistical Analysis. 4th ed. Prentice Hall. Upper 
Saddle River. NJ. 

Zulundt Schneider, R. A., R. Huber, and P. A. Moore. 2001. In- 
dividual and status recognition in the crayfish, Orcunectes rusticus: 
(he effects of urine release on fight dynamics. Behaviour 138: 
137-153. 



Reference: Biol. Bull. 206: 144-151. (June 2004) 
2004 Marine Biological Laboratory 



Remarkable Longevity of Dilute Sperm in a 
Free-Spawning Colonial Ascidian 



SHERI L. JOHNSON 1 * AND PHILIP O. YUND- 

1 School of Marine Sciences. Darling Marine Center, University of Maine. Walpole. Maine 04573: ami 
2 Marine Sciences Center. University of New England. Biddeford. Maine 04005 



Abstract. Many benthic marine invertebrates reproduce 
by releasing sperm into the sea (free-spawning), but the 
amount of time that sperm are viable after spawning may 
have different consequences for fertilization, depending on 
the type of free-spawner. In egg-broadcasting marine organ- 
isms, gamete age is usually assumed to be irrelevant be- 
cause of the low probability of contact between dilute sperm 
and egg. However, direct dilution effects might be reduced 
in egg-brooding free-spawners that filter dilute sperm out of 
the water column, and sperm longevity may play a role in 
facilitating fertilization in these taxa. We investigated the 
effects of time, temperature, and mixing on the viability of 
naturally released sperm of the colonial ascidian Botrylliu 
schlii.ixeri. Our data indicate that B. schlosseri sperm have a 
functional life span that is considerably longer than those of 
the sperm of many other marine invertebrate taxa (half-life 
of ~ 16 to 26 h). are able to fertilize eggs at extremely low 
external sperm concentrations (cu. 10 1 sperm ml '), and 
have a longevity that varies with temperature. It is possible 
that such prolonged sperm longevity may be achieved by 
reductions in motility, reactivation of quiescent sperm by 
chemical cues, or intermittent swimming. 

Introduction 

Sperm longevity in free-spawning marine invertebrates 
(organisms that release sperm into the environment; Giese 
and Kanatani, 1987; Levitan. 1998) that broadcast their eggs 
is typically assumed to be irrelevant to field fertilization 
because hvdrodynamic processes may rapidly dilute ga- 
metes after release (Vogel et ai. 1982: Pennington. 1985; 
Denny, 1988. Dennv and Shibata, 1989; Levitan, 1991. 



Received 1.1 January 21)04. accepted 14 April 20(14. 
* To whom correspondence should he addressed. 
inaine.edu 



I in. ill shrill'" 1 



1995; Levitan and Peterson, 1995). However, dilution also 
has an indirect effect on fertilization by controlling sperm 
longevity (Levitan et a!.. 1991 ). Longevity is generally high 
when sperm are concentrated (on the order of many hours), 
but longevity decreases considerably after dilution (to a 
functional life span of only tens of minutes: Pennington. 
1985; Levitan et al.. 1991: Powell et ai. 2001; Baker and 
Tyler, 2001). The mechanism underlying this phenomenon 
is termed the "respiratory dilution effect": the amount of 
energy consumed by sperm is a function of motility, and 
concentrated sperm can maintain a lower metabolic state 
than dilute sperm (reviewed by Chia and Bickell. 1983). 
However, sperm are generally assumed to be diluted below 
effective concentrations well before the viable life of the 
gamete has expired (i.e., the direct effects of dilution over- 
whelm indirect effects; Pennington. 1985; Levitan et al.. 
1991; Levitan. 1995; but see Williams and Bentley. 2002). 

In contrast to egg-broadcasters, many free-spawners that 
retain eggs for internal fertilization (i.e., egg-brooders) may 
use filter-feeding or suspension-feeding mechanisms to con- 
centrate dilute sperm from the water throughout a prolonged 
period of egg viability (Yund, 2000: Pemberton et ai. 
2003b). If females can overcome direct dilution effects and 
obtain sperm from distant males, adaptations that increase 
sperm longevity (e.g.. inactivity, intermittent swimming, 
and activation by chemical cues) may be important in fer- 
tilization in the field. Sperm longevity is thought to enhance 
fertilization in some internally fertilizing ascidians (Bishop. 
1998; Pemberton et al., 2003b) and bryozoans (Mann'quez 
et til.. 2001). 

Because many marine invertebrates spawn under a wide 
range of temperatures (Andronikov. 1975). thermal effects 
may have important consequences for gamete longevity. A 
few studies have examined the effects of temperature on 
sperm viability (Andronikov. 1975; Greenwood and Ben- 



144 



SI'1-KM I.ONC.I -Yin IN A BROODl K 



145 



nett, 1981; Mann'quez et at., 2001 ), but effects on longevity 
have received little attention. Temperature has a direct ef- 
fect on all metabolic processes (Hochachka and Somero. 
1984); hence higher temperatures might be expected to 
reduce longevity (Greenwood and Bennett. 1981). How- 
ever, increased temperature also decreases water viscosity 
(Dorsey, 1968; Jumars et al., 1993), which can profoundly 
affect the energy requirements of small organisms (such is 
sperm) that swim in a low Reynolds number environment 
(Denny, 1993; Podolsky and Emlet. 1993; Fuiman and 
Batty, 1997; Hunt von Herbing, 2002). If sperm are subject 
to both direct metabolic effects and viscosity effects, the 
overall thermal effects on longevity and fertilization may be 
complex. 

In this study, we use the colonial ascidian Botiyllus 
schlosseri (Pallas. 1766) as a model system to experimen- 
tally investigate the effects of time, temperature, and mixing 
on the viability of naturally released sperm. Physical dis- 
turbance created by mixing might alter longevity patterns by 
inducing or suppressing swimming or by physically dam- 
aging gametes (Mead and Denny. 1995; Denny etui.. 2002). 
Botiyllus schlosseri has been the subject of several labora- 
tory and field fertilization studies (e.g.. Grosberg. 1991; 
Yund and McCartney, 1994; Yund. 1995, 1998; Stewart- 
Savage et al., 2001). Released sperm exit the colony 
through the exhalent siphon and rapidly disperse into the 
surrounding seawater (Milkman, 1967). Sperm are then 
acquired by another colony, and fertilization takes place 
internally. Botiyllus schlosseri is a geographically wide- 
spread species (Grosberg, 1988), so colonies experience a 
wide range of temperature regimes during the reproductive 
season (e.g., Yund and Stires. 2002). 

Materials and Methods 

Study organism and culture 

Botiyllus schlosseri is a sessile colonial ascidian that 
inhabits shallow waters and harbors throughout New En- 
gland and other temperate regions of the world (Van Name, 
1945). Colonies are cyclical hermaphrodites with alternat- 
ing female and male phases occurring in repetitive sexual 
cycles (Milkman, 1967; Grosberg, 1988). This sexual cycle 
is linked to a zooid-replacement cycle. Over a 7-10 day 
period (length depends on temperature; Grosberg, 1982), a 
new generation of zooids (buds) grow and expand and then 
assume the function of the older zooids, which are quickly 
resorbed. Eggs are fertilized as the new sexual generation of 
zooids replaces the old generation (hereafter referred to as 
takeover. Milkman, 1967); once fertilized, the eggs develop 
into embryos that are released as tadpole larvae at the end of 
the cycle (Grosberg, 1991). Sperm release commences 
about 16 h after the start of a cycle and continues for several 
days, so colonies are functionally male throughout most of 
the reproductive cycle (Stewart-Savage and Yund. 1997). 



Colonies neither self-fertilize nor store sperm (Stewart- 
Savage et al.. 2001). 

Colonies of B. schlosseri were collected from the Dama- 
riscotta River, Maine. Animals were grown on glass micro- 
scope slides (7.6 x 5.1 cm) in the flowing seawater system 
at the University of Maine's Darling Marine Center and 
monitored. When colonies with at least 20 eggs were ap- 
proaching takeover (late stage 5 through early stage 6; 
Milkman, 1 967 1. they were isolated (at least 12 h before 
siphon opening) in 50 ml of unfiltered sperm-free seawater 
(aged at least 7 days in the dark at 15 C) at 15 C and fed 
phytoplankton (Isochrysis or Tetraselmis sp.) at densities of 
approximately 10 s cells ml" 1 . Water and food were 
changed daily. Colonies were determined to have completed 
siphon opening when phytoplankton were present in the 
digestive tract, indicating that eggs had been ovulated, and 
these colonies were subsequently treated as virgin females 
for the experiment. 

Sperm collection and aging 

For each experimental trial, naturally spawned sperm 
were obtained by isolating 24 colonies in 200 ml of sperm- 
free seawater (see above) for 4 h during peak sperm release 
(Stewart-Savage and Yund, 1997). A 15-ml sample of the 
undiluted solution was collected to determine the sperm 
concentration. Sperm were then quickly diluted 100-fold: 
160 ml of mixed sperm suspension were added to 16. 1 of 
aged seawater (15 C) and mixed. We immediately col- 
lected a sample and used it to obtain an initial fertilization 
level. The remaining suspension was then aliquotted into 
four glass containers, each containing 3.8 1. The aliquots 
were then aged under experimental conditions, consisting of 
all combinations of two temperatures (15 C and 22 C) and 
two mixture treatments (mixed and unmixed). Mixed sus- 
pensions were constantly stirred with a magnetic mixer. The 
15 C and 22 C temperatures were selected to represent the 
range under which spawning normally occurs in the Dama- 
riscotta River estuary (Yund and Stires, 2002). Each con- 
tainer was sampled at 8, 24, 48, and 72 h. We sampled two 
areas of the unmixed container. One sample was removed 
from the top, and then a second sample was carefully 
pipetted off the bottom while minimizing disturbance to the 
solution. By contrast, the sample from the mixed solution 
integrated different heights within the container. This sam- 
pling scheme yielded three experimental treatments: top and 
bottom of the unmixed solution, and the mixed solution. 
Differences between the top and bottom treatments might 
reveal aspects of sperm behavior (e.g.. buoyant or upward- 
swimming sperm v.s. immotile sinking or downward-swim- 
ming sperm), while the mixed treatment tests the effects of 
physical disturbance and aeration on sperm viability. 

Sperm counts were determined by concentrating a fresh 
aliquot ( 13.5 ml) of the undiluted sperm suspension by two 



146 



S. L. JOHNSON AND P. O. YUND 



orders of magnitude through centrifugation. Polyvinyl alco- 
hol (Sigma- Aldrich; 1.5 ml of a 1 g ml ' solution) was 
added to the sperm solution before centrifugation to prevent 
sperm from adhering to container surfaces. The concen- 
trated suspension (150 ju.1) obtained by centrifugation was 
fixed with 25% gluteraldehyde and subsequently counted on 
a hemacytometer (three samples, two counts each). Raw 
hemacytometer counts were multiplied by a dilution factor 
to obtain the concentration of the aging and fertilization 
solution. Because of the low concentration of B. schlosseri 
sperm, all 25 squares of the hemacytometer had to be scored 
to obtain non-zero counts. Consequently, our values are 
probably accurate only to the nearest order of magnitude. 

Fertilization assays 

All fertilization assays were conducted in 50-ml cham- 
bers with virgin female colonies. At each time point, 40 ml 
of each experimental solution was transferred into the 
chambers along with 5 ml (10 cells ml ') of algae. The 
fertilization assays were then incubated at the relevant ex- 
perimental temperature for 4 h. At the end of the incubation, 
colonies were rinsed with aged seawater to terminate the 
collection of sperm and were returned to isolation. All 
colonies were maintained at a constant temperature to stan- 
dardize development times. After 16-20 h. an incision was 
made in each zooid. and the unfertilized eggs and develop- 
ing embryos were counted with the aid of a stereomicro- 
scope. Results are expressed as percent fertilization. A total 
of 14 trials were conducted over two reproductive seasons. 
Sperm-free controls were not included, because colonies 
were isolated in sperm-free seawater well in advance of 
siphon opening. In addition, stage of embryo development 
was assessed as a control for the timing of fertilization, to 
ensure that fertilizations were the product of the sperm we 
added. Some of the embryos in six female colonies were too 
far along in development (i.e., >24 h), and so must have 
been the product of fertilization by contaminating sperm 
prior to our experiment. Data from these individuals were 
excluded from the analysis. 

Statistical unalvsis 

All percent fertilization data were arcsine transformed to 
meet normality assumptions. A few fertilization assays were 
omitted during the experiment, due either to the death of 
experimental animals or to a shortage of virgin females at 
appropriate time points. Consequently, fertilization data 
were analyzed with a software package that accommodates 
an unbalanced design (Proc GLM ver. 6.07. SAS Institute. 
Cary. North Carolina). A repeated-measures ANOVA with 
trial nested within treatment and temperature was con- 
ducted. The effects of temperature and treatment were tested 
against the nested term, and all effects involving time were 
tested against the residual error. Type III sums of squares 



are reported for all sources of variation. Significance was 
determined at the 5% level. An additional multi-way 
ANOVA assessed whether egg number differed among 
times, temperatures, and treatments to test whether effects 
in the main analysis could have been an artifact of variation 
in egg number. 

Sperm half-life 

Two sperm half-life estimates were generated by treating 
time as a continuous variable. For each temperature, a 
logarithmic regression of mean percent fertilization (not 
transformed), averaging across all treatments, was con- 
ducted with time as the dependent variable. Sperm half-lives 
were calculated from these equations by solving for the time 
at which fertilization dropped to half of the initial (Oh) 
value. Estimates obtained from our data were compared to 
previously published half-lives of other free-spawning ma- 
rine invertebrates. We used data previously reviewed by 
Manriquez et al. (2001 ), but included published values for 
other egg-brooding taxa. 

Results 

Effects on sperm viability 

The analysis of variance results indicate a highly signif- 
icant overall effect of time, with a decrease in percent 
fertilization with increasing sperm age for Botryllits schlns- 
seri (Table 1 ). Fertilization of eggs was still possible using 
naturally spawned sperm that had been aged 72 h. At an 
average sperm concentration of approximately 1.38 X 
10' 0.13 X 10' (SE) sperm ml' 1 , initial fertilization was 
about 61%. and after 72 h decreased only to about 25% of 
the starting level (Fig. 1 ). Temperature also had a significant 
effect (Table 1). with fertilization generally higher when 
sperm were aged at 15 C than at 22 C (Fig. 1 ). 

We were unable to detect anv significant effect of treat- 



Table I 

Results of repeated-measures nested ANOVA on percent fertilization 



Source 


df 


SS III 


F ratio 


P 


Time 


3 


8.77 


14.32 


(1.0(101 


Time*Temp 
TimeTreat 


3 
6 


0.47 
0.79 


0.77 
0.08 


0.5134 

0.9195 


Time*Temp*Treat 
Error a: Residual' 


6 
159 


0.74 
32.48 


0.60 


0.7265 


Temp 
Treat 


1 
2 


1.03 
0.16 


5.21 
0.40 


0.0252 

0.6698 


Temp*Treal 
Error b: Trial(Temp*Treat)~ 


2 
78 


0.03 
15.40 


0.09 


0.9169 



' Error a: used to test all effects involving time. 

: Error h: used to test treatment and temperature effects. 



SPERM LONGEVITY IN A BROODER 



147 



80 



60 



20 - 




80 



60 



i<H 



^20- 



A) Top 




Li 



B) Bottom 

I T 




80 



60 
.o 

1 

iH 



C) Mixed 
I 



24 48 

Time (h) 



72 



Figure 1. Viability of Botryllus schlosseri sperm measured as fertili- 
zation (%) of eggs over time (A) at the top (unmixed suspension). (B) at the 
bottom (unmixed suspension), and (C) in the mixed treatment. Data are 
means (SE) of all trials. The h sample (indicated by the gray bar) 
represents the fertilization potential of the sperm solution prior to manip- 
ulation, and so is identical for all temperatures and treatments. Average 
working sperm concentration was 1.38 x 10' sperm ml" 1 . 



ment, nor were any of the interaction effects significant 
(Table 1). Average egg numbers were 50.2 0.8 (SE) and 
did not vary significantly with time, temperature, or treat- 
ment (F 9251 = 0.92. P = 0.45). 

Sperm half-lives 

Logarithmic regressions of fertilization with time were 
highly significant for both temperatures (15 C, r = 0.967. 
P < 0.01; 22 C, r = 0.790, P < 0.05). Sperm half-lives 
(the time at which fertilization drops to 50% of its initial 
level) were estimated at both temperatures, using the fol- 
lowing logarithmic regression equations: 15 C, % fertil- 
ization = -29.369 log (time) + 72.291; 22 C. % fertil- 
ization = -31.375 log (time) + 68.456. The resulting 
half-lives were 26.3 h at 15 C and 16.1 h at 22 C (Fig. 2). 



Comparison with data from several other free-spawners. 
including two egg-brooders and multiple egg-broadcasters, 
reveals that dilute B. schluxseri sperm have substantially 
greater longevity than dilute sperm of most other free- 
spawners (Fig. 3). Similar sperm half-lives in egg-broad- 
casters have been documented only at sperm concentrations 
many orders of magnitude greater than those used in our 
experiment (e.g., Williams and Bentley. 2002). As a group, 
the three egg-brooders in our comparison have greater 
sperm half-lives at low concentrations than all of the egg- 
broadcasters (Fig. 3). 

Discussion 
Sperm longevity in free-spawning invertebrates 

The functional life span reported here for Botryllus 
schlosseri sperm is considerably longer than previously 
reported for the dilute sperm of any other free-spawning 
marine invertebrate, and orders of magnitude greater than 
the qualitative estimate for this species (based in part on 
motility) previously reported by Grosberg (1987). A sub- 
stantial number of fertilizations still occurred with 48- and 
72-h-old sperm. In the few trials in which fertilization did 
not drop to zero by 72 h, sperm suspensions were aged and 
retested after an additional 24 h (i.e., at 96 h). These 
samples also resulted in a low level of fertilization (13.8%; 
unpubl. data). 

Williams and Bentley (2002) reported similar sperm lon- 
gevity in a free-spawner (the polychaete Arenicola), but 
only at a sperm concentration four orders of magnitude 
higher than the 10 1 sperm mP 1 reported here. High lon- 
gevity of concentrated sperm is predicted by the respiratory 




Figure 2. Viability of Bony/his schlosseri sperm measured as a func- 
tion of mean ( SE) fertilization ( % ) of eggs over time at 1 5 C and 22 C. 
The value for each point is the grand mean of the top. bottom, and mixed 
treatments averaged across all trials. Best-fit logarithmic regression lines 
used to estimate sperm half-lives are plotted for each temperature: 15 C 
(solid line) and 22 C (dashed line). Half-lives were calculated as the time 
needed for fertilization to decrease to 50% of the initial value, as indicated 
by the dotted lines. 



148 



S. L. JOHNSON AND P. O. YUND 



50 
40 



1 



30- 



|r 20 

"ro 
X 



D 



A 




D Botryllus schlosseri (15C) 
A Botryllus schlosseri (22 C) 
V Diplosoma lister anutn 
O Cellaporella hyalina 

Haliotis tuberculata 
A Arenicola marina 

Asterias rubens 
T Nereis wrens 
+ C/'ona intestinalis 

Ascidella aspersa 
-* Acanthaster planci 
Strongylocentrotus 

droebachiensis 



0123456 

Log (sperm ml' 1 ) 

Figure 3. Sperm half-life (h) measured as a function of sperm concentration (log sperm ml ') in a variety 
of free-spawning marine invertebrates (sensu Manriquez et ai. 2001 . with additional values from this study and 
the literature). Botryllus schlosseri, this paper; D. listemnum. Bishop, 1998; C. hyalina. Manriquez et al.. 2001; 
H. tnhcniilata, Powell et al.. 2001; A. marina. N. virens, and A. nibens, Williams and Bentley. 2002; C. 
intestinalis and A. aspera, Bolton and Havenhand. 1996; A. planci, Benzie and Dixon, 1994; 5. droebachiensis, 
Levitan. 1993). Lines connect different values reported for individual species at multiple sperm concentrations. 
The four open symbols represent brooders; the remaining closed symbols are broadcasters. 



dilution effect (Chia and Bickell, 1983), but the combina- 
tion of high longevity and very low concentration has not 
previously been reported. In addition, Arenicola is an egg- 
broadcasting species that retains its eggs in a burrow and 
pumps sperm-laden water past them (Williams et al.. 1997). 
Consequently, it appears to function much like an egg- 
brooder (Williams and Bentley. 2002). Prolonged motility 
has been observed in two species of deep-sea echinothuriid 
sea urchins, Araeosoma fenestratum and Sperosoma antil- 
lense (Young. 1994); but sperm concentrations were not 
reported and fertilization was not assayed. The presence of 
lipid stores attached to the mitochondria of these sperm may 
enable the sperm to swim for prolonged times (Eckelbarger 
ct nl.. 19S9; Young, 1994). However, the role of lipid stores 
in swimming has been questioned (Eckelbarger. 1994). 

The only free-spawners known to have comparable sperm 
longevity at low concentration (Fig. 3) are another brooding 
uscidian. Diplosonia listerannin (Bishop, 1998). with an 
estimated sperm half-life of 8 h at H) 1 sperm ml ', and a 
brooding bryo/oan. Cellaporclla hyalina. with an estimated 
sperm half-life of I h at Kl'-lO" sperm ml ' (Manrfque/. et 
ill.. 2001). This pattern suggests that sperm longevity may- 
be consistently higher in egg-brooding invertebrates than in 
egg-broadcasters. However, this relationship may break 
down when more taxa are studied. Some brooders lack any 
apparent mechanism to efficiently collect dilute sperm from 



distant males via a filter-feeding or suspension-feeding 
mechanism (e.g.. brooding corals). 

Although the other two brooding taxa have dilute sperm 
longevities greater than those of the broadcasting species, 
the longevities of D. Hsteraniim and C. hyulinu are never- 
theless somewhat lower than in B. schlosseri. In contrast to 
these two species, B. schlosseri lacks the ability to store 
sperm (Stewart-Savage et ai, 2001 ). D. listeranuin and C. 
hyalina can both store sperm for several months (Bishop 
and Ryland. 1991; Bishop and Sommerfeldt. 1996) and 
weeks (Mann'quez, 1999), respectively. In the absence of a 
mechanism to store sperm, extended sperm longevity in B. 
schlosseri may represent an alternative adaptation to further 
enhance fertilization. 

The high longevity of sperm in active filter-feeding or 
suspension-feeding brooders raises the question of how very 
dilute sperm can remain viable for such an extended period 
of time. A sperm's life span is based on its consumption of 
energy reserves (usually phospholipids; Harumi ci al.. 
I WO), which is a function of the amount of energy con- 
sumed for motility. If K. schlosseri sperm are taken up 
passively through tiller-feeding mechanisms, sperm may 
need to swim only short distances (i.e.. within the maternal 
/ooid) to reach an egg. Consequently, longevity would be 
prolonged if sperm were relatively inactive while in the 
water column, and then activated within the maternal zooid. 



SPERM LONGEVITY IN A BROODER 



149 



The activation of dilute, inactive sperm by egg exudates has 
been reported in some broadcast-spawning solitary ascid- 
ians (Miller, 1974; Bolton and Havenhand, 1996; Jantzen et 
al., 2001) and in abalone (Riffell et al. 2002). Similarly, 
packets of bryozoan sperm alter their flagellar waveforms 
when released, thus probably saving energy and enhancing 
longevity, but increase the generation of waveforms to enter 
the maternal zooids (Temkin and Bortolami, 2004). R. 
schlosseri sperm might also conserve energy through inter- 
mittent swimming after release, as suggested for another 
colonial ascidian (Bishop, 1998). The continued presence of 
sperm in our top sample (Fig. 1 A) after many hours supports 
this interpretation, but might also have been due to convec- 
tion currents within the sperm-aging containers. We have 
never observed much activity in B. schlosseri sperm ob- 
tained from testes macerates, but it is possible that sperm are 
activated prior to natural release. Mixing had no effect on 
longevity (Table 1 ), so physical disturbance apparently does 
not activate sperm. 

Temperature effects 

This study suggests that temperature has a small but 
significant influence on longevity. The estimated half-life 
for sperm aged at 15 C was 10 h longer than for those kept 
at 22 C. B. schlosseri is found as far north as Newfound- 
land and south to North Carolina, and so experiences a wide 
range of temperature regimes (Pollock, 1998). Within the 
Damariscotta River estuary, water temperatures during 
spawning season can be as high as 22 C at landward sites 
and as low as 13 C in seaward sites (Yund and Stires, 
2002). 

Temperature directly controls metabolic activity in all 
cells, which influences energy consumption and survival 
(Hochachka and Somero, 1984). Due to temperature com- 
pensation, changes in sperm viability are expected to be 
minimal in eurythermal species that routinely spawn over a 
wide range of temperatures (Andronikov, 1975; Manriquez 
et al,, 2001). However, actual fertilization levels have been 
shown to decrease with increased temperature, due to me- 
chanical damage or exhaustion of energy reserves (in a 
temperate sea urchin; Greenwood and Bennett, 1981). But 
any strictly metabolic approach to understanding tempera- 
ture effects on sperm may be overly simplistic. Recent work 
on other small organisms has indicated that temperature 
effects may overestimate direct metabolic expenditures 
(Podolsky and Emlet, 1993; Fuiman and Batty. 1997; Hunt 
von Herbing, 2002). Water viscosity decreases with increas- 
ing temperature (Dorsey, 1968; Vogel, 1984; Denny, 1993; 
Jumars et al., 1993), thus altering the energetic requirements 
of swimming. For example, Podolsky and Emlet (1993) 
demonstrated that an increase in temperature from 12 C to 
22 C increased swimming speed in sand dollar larvae, and 
that about 40% of the speed increase and 67% of the Q w 



could be attributed to the effect of reduced viscosity. This 
viscosity effect should be even more pronounced in smaller 
organisms (like sperm) that inhabit lower Reynolds number 
environments (Vogel, 1984). and most evident at lower 
temperatures where changes in viscosity are most pro- 
nounced (Jumars et al., 1993). However, viscosity effects 
will only be relevant during times when sperm are actually 
swimming, or if viscosity stimulates swimming behavior. 

It is also possible that temperature did not have a direct 
effect on sperm longevity per se, but rather an indirect effect 
via fertilization. The fertilization assays were conducted at 
the same temperatures used for aging the sperm suspen- 
sions. The clearance rates of some filter-feeders increase 
with temperature (Riisgard and Manriquez, 1997; Lisbjerg 
and Peterson, 2001; Turker et al.. 2003), but the ramifica- 
tions for sperm capture in brooders have not yet been 
explored. Consequently, we cannot exclude the possibility 
that temperature affected the rate at which sperm were 
removed from the suspensions, as well as the viability of 
sperm. 

Potential evolutionary implications 

Because there is a trade-off between sperm velocity and 
longevity, it has been suggested that fast sperm are advan- 
tageous under conditions of sperm competition, and long- 
lived sperm are advantageous under conditions of sperm 
limitation (Levitan. 1993, 2000). Although B. schlosseri 
possesses extremely long-lived sperm, this species does not 
experience sperm limitation in nature (fertilization levels in 
nature are generally >85%; Phillippi et al., 2004), and 
male-phase colonies in experimental populations compete 
for access to eggs (Yund and McCartney, 1994: Yund. 
1995. 1998). Similarly, other brooding free-spawners with 
high sperm longevity are not thought to be sperm-limited, 
and they exhibit reproductive traits (e.g., sperm storage, 
female choice) that are typically associated with sperm 
competition (Bishop, 1996. 1998; Bishop et al., 2000; Pem- 
berton et a!., 2003a). Hence the trade-off between velocity 
and longevity may not apply to brooders, but only to egg- 
broadcasting free-spawners. 

Overall, Botiyllits schlosseri appears to promote fertili- 
zation through the longevity of water-born sperm and 
through the ability to concentrate dilute sperm from the 
water column. The substantial longevity of dilute sperm 
reported here potentially allows viable sperm to disperse a 
great distance from a source population. In the field, most 
eggs are fertilized by sperm from nearby sources (Grosberg. 
1987; Yund. 1995, 1998), but eggs in isolated colonies can 
be fertilized from distances of 40 m or more (Yund and 
McCartney, 1994). Given the often high density of B. 
schlosseri colonies in nature (>1000 colonies m~ 2 at some 
sites; Grosberg. 1982) and the fact that colonies continu- 
ously dribble sperm over a period of 4-5 days (Stewart- 



150 



S. L. JOHNSON AND P. O. YUND 



Savage and Yund. 1997). more sperm are probably released 
than are utilized locally. This surplus is likely to be advected 
away by currents and could contribute greatly to gene flow 
between populations if sperm remain viable during their 
journey. Sperm dispersal could be of particular importance 
to gene flow in an organism like B. schlosseri that has a very 
short-lived larval stage (Grosberg, 1987; Yund. 1995). 

Acknowledgments 

A. Phillippi, K. Murdock. B. Cole, B. Gensheimer. and J. 
Stewart-Savage assisted with animal culture. W. Hatleman 
provided statistical advice. We thank A. Phillippi, J. 
Grabowski, C. Young, and an anonymous reviewer for 
reading and suggesting changes that improved the manu- 
script. Financial support was provided by the National Sci- 
ence Foundation (OCE-01- 17623) and the Gulf of Maine 
Foundation. This is contribution number 393 from the Dar- 
ling Marine Center. 

Literature Cited 

Andronikov, V. B. 1975. Heat resistance of gametes of marine inverte- 
brates in relation to temperature conditions under which the species 
exist. Mar. Biol. 30: l-ll. 

Baker, M. C., and P. A. Tyler. 2001. Fertilisation success in the 
commercial gastropod Haliotis tubcrcnlata. Mar. Ecol. Prog. Ser. 211: 
205-213. 

Benzie, J., and P. Dixon. 1994. The effects of sperm concentration. 
sperm:egg ratio, and gamete age on fertilization success in crown-of- 
thorns starfish (Acanthaster planci) in the laboratory. Biol. Bull. 186: 
134-152. 

Bishop, J. D. 1). 1996. Female control of paternity in the mteniallv 
fertilizing compound ascidian Diplosoma listeranum. I. Autoradio- 
graphic investigation of sperm movements in the female reproductive 
tract. Proc. R. Sac. Lond. B 263: 369-376. 

Bishop, J. D. D. 1998. Fertilization in the sea: are the hazards of 
broadcast spawning avoided when free-spawned sperm fertilize re- 
tained eggs 1 ' Proc. R. Sue. Lond. B 265: 725-731. 

Bishop, J. I). 1)., and J. S. Kvland. 1991. Storage of exogenous sperm 
by the compound ascidian Diplosoma listeranum. Mar. Biol. 108: 
111-118. 

Bishop, J. D. I)., and A. I). Sonimerfeldt. 1996. Autoradiographic 
investigation of uptake and storage of exogenous sperm by the ovary of 
the compound ascidian Diplosoma listeranum. Mar. Biol. 125: 663- 
67(1. 

Bishop, J. D. D., A. J. Pemberton, and L. R. Noble. 2000. Sperm 
precedence in a novel context: mating in a sessile marine invertebrate 
with dispersing sperm. Proc. R. Soc. Lond. B 267: I 107-1 I 13. 

Bollon, T. F., and J. N. Havenhand. 1996. Chemical mediation ol 
sperm activity and longevity in the solitary ascidians dona intesimalis 
and AM idiclla aspcni, Biol. Bull. 190: 320-335. 

Chia, F.-.S.. and I.. R. Bickell. 1983. Hchinodermata. F>p. 545-621) in 
Kepio,lu,tive Hiolo\t\ of Invi itchi, itc\. K G.. and R G. Adiyodi. eds 
John Wiley. New York. 

Denny, M. W. 1988. Hi,>lo K y ami Mechanic', of ilic Hmr-.Miv/x / m i 
ronincnl. Princelon I'imcrsity Press. Princeton. NJ. 

Denny. M. W. 1993. ,\,,- ,,//,/ \\',ner. Princeton University Press. Prince- 
ton. NJ. 

Denny, M. \V., and M. F. Sbibata. 1989. Consequences ol surf'-sone 



turbulence for settlement and external fertilization. Am. Nut. 134: 
859-889. 

Denny, M. W., E. K. Nelson, and K. S. Mead. 2002. Re\ ised estimates 
of the effects of turbulence on fertilization in the purple sea urchin. 
Strongylocentrotus purpuratus. Biol. Bull. 203: 275-277. 

Dorsey, N. E. 1968. Properties of Ordinary Water-Substance in All Its 
Phases: Water-Vapor. Water, ana 1 All the Ices. Hafner. New York. 

Eckelbarger. K. J. 1994. Ultrastructural features of gonads and gametes 
in deep-sea invertebrates. Pp. 137-1 57 in Reproduction. Larcal Biologv 
and Recruitment in the Deep-Sea Benthos. C. M. Young and K. J. 
Eckelbarger. eds. Columbia University Press. New York. 

Eckelbarger, K. J., C. M. Young, and J. L. Cameron. 1989. Modified 
sperm ultrastructure in four species of soft-bodied echinoids (Echino- 
dermata: Echinothuriidae) from the bathyal zone of the deep sea. Biol. 
Bull 177: 230-236. 

I mm. in L. A., and R. S. Batty. 1997. What a drag it is getting cold: 
partitioning the physical and physiological effects of temperature on 
fish swimming. / .v/>. Biol. 200: 1745-1755. 

Giese, A. C., and H. Kanatani. 1987. Maturation and spawning. Pp. 
251-329 in Reproductive Biology of Invertebrates. Vol. 9. A. C. Giese. 
J. S. Pearse. and V. B. Pearse. eds. Boxwood Press. Pacific Grove, CA. 

Greenwood, P. ,(., and T. Bennett. 1981. Some effects of temperature- 
salinity combinations on the early development of the sea urchin 
Paicchinus aiigulostn, (Leske). Fertilization. J. E.xp. Mar. Biol. Ecol. 
51: 119-131. 

Grosberg, R. K. 1982. Ecological, genetical. and developmental factors 
regulating life history variation within a population of the colonial 
ascidian Botryllus schlosseri (Pallas) Savigny. Ph.D. dissertation. Yale 
University, New Haven, CT. 

Grosberg, R. K. 1987. Limited dispersal and proximity-dependent mat- 
ing success in the colonial ascidian Botnllus schlosseri. Evolution 41: 
372-3X4. 

Grosberg, R. K. 1988. Life-history variation within a population of the 
colonial ascidian Botryllus schlosseri. I. The genetic and environmental 
control of seasonal variation. Evolution 42: 900-920. 

Grosberg, R. K. 1991. Sperm-mediated gene flow and the genetic struc- 
ture of a population of the colonial ascidian Botryllus schlosseri. 
Evolution 45: 130-142. 

1 1. ii nun T., R. De Santis. M. R. Pinto, and N. Suzuki. 1990. Phos- 
pholipid utilization in ascidian Ciona intcstinulis spermatozoa during 
swimming. Comp. Biochem. Phv.siol. 96A: 263-265. 

Hochaohka. P. W., and G. N. Somero. 1984. Biochemical Adaptation. 
Princeton University Press, Princeton, NJ. 

Hunt von Herbing. I. 2002. Effects of temperature on larval fish sw im- 
ming performance: the importance of physics to physiology. J. Fish. 
Biol. 61: 865-876. 

Jantzen. T. M., R. de Nys. and J. N. Havenhand. 2001. Fertilization 
success and the effects of sperm chemoattractants on effective egg size 
in marine invertebrates. Mar. Biol. 138: 1153-1 161 

Jumars, P. A., J. \V. Deming, P. S. Hill, L. Karp-Boss, P. L. Yager, and 
\V. B. Dade. 1993. Physical constraints on marine osmotrophy in an 
optimal foraging context. Mar. Mierob. Food Webs 7: 121-159. 

I i MI. in. D. R. 1991. Influence of body si/e and population density on 
fertilization success and reproductive output in a free-spawning inver- 
tebrate. Biol. Bull. 181: 261-268. 

Levitan, I). R. 1993. The importance of sperm limitation to the evolution 
of egg si/e in marine invertebrates. Am. .'V;. 141: 517-536. 

I.evitan, I). R. 1995. The ecolog\ of fertilisation in free-spawning in- 
vertebrates. Pp. 123-156 in lieoloify of Marine Invertebrate Lan'ae, L. 
McEdvvard. ed. CRC Press. Boca Raton, FL. 

I cvitan. 1). R. 1998. Sperm limitation, gamete competition, and sexual 
selection in external lertih/ers. Pp. 175-217 in Sperm Competition and 
Sexual Selection. T. R. Birkhead and A. P. Moller. eds. Academic 
IV-ss. San Diego. CA. 



SPERM LONGEVITY IN A BROODER 



151 



Levitan, D. R. 2000. Sperm velocity and longevity trade oft' each other 
and influence fertilization in the sea urchin Lytci-li!nin viiricgnlu.\. 
Pmc. R. Soc. Lond. B 267: 531-534. 

Levitan, D. R.. and C. Petersen. 1995. Sperm limitation in the sea. 
Trends Ecol. fro/. 10: 22S-231. 

Levitan, D. R., M. A. Sewell, and F.-S. Chia. 1991. Kinetics of fertil- 
ization in the sea urchin Strongylocentrotus franciscanus: interaction of 
gamete dilution, age. and contact time. Biol. Bull 181: 371-378. 

Lisbjerg, D.. and J. K. Petersen. 2001. Feeding activity, retention 
efficiency, and effects of temperature and particle concentration on 
clearance rate in the marine bryozoan Electro crusiulcnta. Mar. Ecol. 
Prog. Ser. 215: 133-141. 

Manriquez, P. H. 1999. Mate choice and reproductive investment in the 
cheilostome bryozoan Celloporella hvalina (L.). Ph.D. thesis. Univer- 
sity of Wales, Bangor, UK. 

Manriquez, P. H., R. N. Hughes, and J. D. D. Bishop. 2001. Age- 
dependent loss of fertility in water-borne sperm of the bryozoan Celle- 
porella hyalina. Mar. Ecol. Prog. Ser. 224: 87-92. 

Mead, K. S., and M. W. Denny. 1995. The effects of hydrodynamic 
shear stress on fertilization and early development of the purple sea 
urchin Strongylocentrotus purpuratus. Biol. Bull. 188: 46-56. 

Milkman. R. 1967. Genetic and developmental studies on Botry/hts 
schlosseri. Biol. Bull. 132: 229-243. 

Miller, R. L. 1974. Sperm behavior close to Hydractinia and dona eggs. 
Am. Zool. 14: 1250. 

Pemberton, A. J., L. R. Noble, and J. D. D. Bishop. 2003a. Frequency 
dependence in matings with water-borne sperm. J. Exp. Biol. 16: 
289-301. 

Pemberton, A. J., R. N. Hughes, P. H. Manriquez, and J. D. Bishop. 
2003b. Efficient utilization of very dilute sperm: sperm competition 
may be more likely than sperm limitation when eggs are retained. Proc. 
R. Soc. Lond. B 270: 223-226. 

Pennington, J. T. 1985. The ecology of fertilization of echinoid eggs: 
the consequences of sperm dilution, adult aggregation, and synchro- 
nous spawning. Biol. Bull. 169: 417-430. 

Phillippi, A., E. Hannan, and P. O. Yund. 2004. Fertilization in an 
egg-brooding colonial ascidian does not vary with population density. 
Biol. Bull. 206: 152-160. 

Podolsky, R. D., and R. B. Emlet. 1993. Separating the effects of 
temperature and viscosity on swimming and water movement by sand 
dollar larvae (Dendraster excentricus). J. Exp. Biol. 176: 207-221. 

Pollock, L. W. 1998. A Practical Guide to the Marine Animals of 
Northeastern North America. Rutgers University Press, New Bruns- 
wick, NJ. 

Powell, D. K., P. A. Tyler, and L. S. Peck. 2001. Effect of sperm 
concentration and sperm ageing on fertilization success in the Antarctic 
soft-shelled clam Laternula elliptica and the Antarctic limpet Nacella 
concinna. Mar. Ecol. Prog. Ser. 215: 191-200. 



RiHVII, J. A.. P. J. Krug, and R. K. /inimer. 2002. Fertilization in the 
sea: the chemical identity of an abalone sperm attractunt. ./. Exp. Biol. 
205: 1439-1450. 

Riisgard, H. II.. and P. Manriquez. 1997. Filter-feeding in fifteen 
marine ectoprocts (Bryozoa): particle capture and water pumping. Mar. 
Ecol. Prog. Ser. 154: 223-239. 

Stewart-Savage, J., and P. (). Yund. 1997. Temporal pattern of sperm 
release from the colonial ascidian. Botryllus schlosseri. J. Exp. Biol. 
279: 620-625. 

Stewart-Savage, J., A. Phillippi, and P. O. Yund. 2001. Delayed 
insemination results in embryo mortality in a brooding ascidian. Biol. 
Bull. 201: 52-58. 

Temkin, M. H., and S. B. Bortolami. 2004. Waveform dynamics of 
spermatozeugmata during the transfer from paternal to maternal indi- 
viduals of Membranipora membranacea. Biol. Bull. 206: 35-45. 

Turker, H., A. G. Eversole, and D. E. Brune. 2003. Effect of temper- 
ature and phytoplankton concentration on Nile tilapia Oreochromis 
niloriciis (L.) filtration rate. Aquae. Res. 34: 453-459. 

Van Name, W. G. 1945. The North and South American ascidians. Bull. 
Am. Mus. Nat. Hist. 84: 1-476. 

Vogel, H., G. Czihak, P. Chang, and W. Wolf. 1982. Fertilization 
kinetics of sea urchin eggs. Math. Biosci. 58: 189-216. 

Vogel, S. 1984. Life in Moving Fluids. Princeton University Press, 
Princeton. NJ. 

Williams, M. E., and M. G. Bentley. 2002. Fertilization success in 
marine invertebrates: the influence of gamete age. Biol. Bull. 202: 
34-42. 

Williams, M. E., M. G. Bentley, and J. D. Hardege. 1997. Assessment 
of field fertilization success in the infaunal polychaete Arenico/a ma- 
rina (L.). Im-enebr. Reprod. Dev. 31: 189-197. 

Young, C. M. 1994. The biology of external fertilization in deep-sea 
echinoderms. Pp. 179-200 in Reproduction. Lan-al Biology and Re- 
cruitment in the Deep-Sea Benthos. C. M. Young and K. J. Eckel- 
barger, eds. Columbia University Press, New York. 

Yund, P. O. 1995. Gene flow via the dispersal of fertilizing sperm in a 
colonial ascidian (Botryllus schlosseri): the effect of male density. Mar. 
Biol. 122: 649-654. 

Yund, P. O. 1998. The effect of sperm competition on male gain curves 
in a colonial marine invertebrate. Ecology 79: 328-339. 

Yund, P. O. 2000. How severe is sperm limitation in natural populations 
of marine free-spawners? Trends Ecol. fro/. 15: 10-13. 

Yund, P. O., and M. A. McCartney. 1994. Male reproductive success 
in sessile invertebrates: competition for fertilizations. Ecology 75: 
2151-2167. 

Yund, P. O., and A. Stires. 2002. Spatial variation in population dy- 
namics in a colonial ascidian (Botryllus schlosseri). Mar. Biol. 141: 
955-963. 



Reference: Biol. Bull. 206: 152-160. (June 2004) 
2004 Marine Biological Laboratory 



Fertilization in an Egg-Brooding Colonial Ascidian 
Does Not Vary With Population Density 



AIMEE PHILLIPPI 1 -*, ELLEN HAMANN", AND PHILIP O. YUND 1 t 

1 School of Marine Sciences, Darling Marine Center, University of Maine, Walpole, Maine 04573; and 
2 Biologv Department, Augustana College. Sioux Falls. South Dakota 57197 



Abstract. The possibility that free-spawning marine or- 
ganisms may be subject to fertilization failure at low pop- 
ulation density (due to the effects of sperm dilution) has 
sparked much interest, but these effects have been demon- 
strated only in a few species that broadcast their eggs. Some 
egg-brooding species may overcome dilution effects by 
filtering low concentrations of sperm from seawater and 
fertilizing eggs throughout an extended period of time. We 
examined the effects of population density and size on 
fertilization in Bolryllus schlosseri, a hermaphroditic colo- 
nial ascidian that free-spawns sperm, but broods eggs. We 
experimentally manipulated the size and density of mating 
groups and surveyed fertilization levels in natural popula- 
tions that varied in density. Fertilization was not affected by 
variation in population size or density in either the experi- 
mental or natural populations. Near the end of the repro- 
ductive season, some eggs may have been fertilized too late 
to complete development, suggesting a temporal form of 
sperm limitation that has not been considered in other 
systems. We also detected greater variability in fertilization 
levels at lower population density. Nevertheless, these re- 
sults suggest that caution must be used in extrapolating 
reported density effects on fertilization to all taxa of free- 
spawners; density effects may be reduced in brooders that 
have efficient sperm collection mechanisms. 

Introduction 

Population growth is often limited by the recruitment of 
new individuals. Because most marine organisms produce 



Received .1 December 200.1; accepted 16 March 2004. 

* To whom correspondence should he addressed. E-mail: auneepfe" 
maine.edu 

t Current Address: Marine Science Center, University of New England. 
Biddelord, ME 04005, 



orders of magnitude more gametes than offspring that suc- 
cessfully recruit (Morgan, 1995), sources of reproductive 
loss have received much recent attention. Larval mortality 
may be the biggest bottleneck for many species (Thorson. 
1950; Strathmann, 1985; Roughgarden et al, 1988). How- 
ever, in free-spawning marine taxa (i.e., those that release 
sperm into the surrounding seawater). fertilization has also 
attracted attention as a possible stage of significant repro- 
ductive loss (Pennington, 1985; Oliver and Babcock, 1992; 
Sewell. 1994; Levitan and Petersen. 1995; Lasker et al., 
1996; Coma and Lasker, 1997a). 

Fertilization will not be successful if the distance between 
spawning individuals is too great. Experimental studies 
have documented decreasing fertilization with distance 
from a sperm source in diverse taxa of marine free-spawners 
(Pennington. 1985; Yund. 1990, 1995; Levitan. 1991: Levi- 
tan etui.. 1991. 1 992 ; Brazeau and Lasker, 1992; Oliver and 
Babcock. 1992: Babcock et al.. 1994; Benzie and Dixon. 
1994; Benzie et al.. 1994; Yund and McCartney. 1994: 
Levitan and Young, 1995: Lasker et al., 1996; Coma and 
Lasker. 1997a. b; Meidel and Yund. 2001; Metaxas et al.. 
2002). As a logical consequence of these distance effects. 
reproduction in low-density populations may be limited by 
fertilization when individuals are separated by distances 
greater than the dispersal distance of fertilizing sperm. Fer- 
tilization failure at low population density (a form of neg- 
ative density-dependent population dynamics known as an 
Allee effect; Levitan et al.. 1992) has been investigated in 
commercially harvested species and considered in the de- 
velopment of management programs (Jamieson. 1993; 
Quinn<7<//.. 1993; Myers et al., 1995; Ptister and Bradbury. 
1996: Liermann and Hilborn. 1997: Levitan and Sewell. 
1998; Shelton and Healey. 1999; Frank and Brickman, 
2000). Models, coupled with laboratory experiments on the 
effects of variation in sperm concentration on fertilization. 



152 



FERTILIZATION * F( DENSITY) 



153 



have predicted declining fertilization levels with decreasing 
population size or density for free-spawners that broadcast 
their eggs (Levitan, 1991; Levitan and Young. 1995; 
Claereboudt, 1999; Metaxas el ai, 2002). Field experiments 
with three egg-broadcasting species of sea urchins have 
supported the predicted trend (Levitan, 1991 ; Levitan et ai. 
1992; Wahle and Peckham, 1999). Density has also been 
predicted to have a greater effect on fertilization when 
populations are small (Levitan and Young, 1995). suggest- 
ing the need to simultaneously evaluate the effects of pop- 
ulation size and density (Levitan et ai, 1992). 

To date, research on how the density and size of a 
population affects fertilization has focused on organisms 
that broadcast eggs, but variation in density may have very 
different consequences for free-spawners that fertilize eggs 
internally (brooders). In external fertilizers, both gametes 
are subject to dilution; in brooders, only sperm are diluted. 
If brooders are able to capture or concentrate dilute sperm, 
fertilization levels may be high even when individuals are 
far apart and few in number (Yund. 2000). 

We examined the effects of population density on fertil- 
ization in Botryllus schlosseri (Pallas. 1766), a sessile, her- 
maphroditic, free-spawning colonial ascidian with internal 
fertilization. Sperm limitation has been demonstrated under 
experimental conditions in the field (Yund and McCartney, 
1994; Yund, 1995), and populations are characterized by 
substantial spatial and temporal variation in population den- 
sity (Yund and Stires, 2002). However, fertilization levels in 
natural spawns have not previously been reported, nor have 
density effects on fertilization been rigorously evaluated. 
Past manipulations (designed to test for sperm competition) 
have manipulated male density but not total population 
density (Yund and McCartney, 1994; Yund, 1995. 1998). 
We conducted a mix of manipulative field experiments and 
surveys of spawning in natural populations in the Damar- 
iscotta River estuary (Maine) during the summers of 1999 
and 2000. Population size and density were manipulated in 
experimental populations to independently test the effects of 
these two factors. Density effects were also assessed in 
natural spawns by deploying laboratory-cultured colonies in 
populations that varied in density in space and time. 

Materials and Methods 

Study organism and culture 

Botiyllits schlosseri is a colonial ascidian with a sexual 
cycle coupled to an asexual zooid replacement cycle, which 
is synchronous throughout the colony. Asexually produced 
buds form and develop along the sides of the functioning 
generation of zooids that are brooding embryos and releas- 
ing sperm. Concurrent with or shortly after the release of 
fully developed embryos as larvae, the old generation of 
zooids is resorbed and the new zooids (formerly buds) start 
to feed and begin the next cycle (Milkman, 1967). Eggs are 



viable to be fertilized as soon as the siphons of the new 
zooids open, but it fertilized more than 24 h after siphon 
opening, they are unlikely to complete development before 
the end of the asexual cycle (Stewart-Savage et nl., 2001a). 
Sperm release occurs over a period of several days, and does 
not peak until a few days after siphon opening (Stewart- 
Savage and Yund. 1997). The duration of the sexual-asexual 
cycle is temperature dependent (Grosberg. 1982). Colonies 
are not able to aggregate, spawn synchronously (Stewart- 
Savage and Yund. 1997), self-fertilize (Stewart-Savage et 
ai, 200 la), or store sperm (Stewart-Savage et ai, 200 la). 
Although eggs are generally fertilized by neighbors when 
other colonies are nearby (Yund and McCartney, 1994; 
Yund 1995), spatially isolated colonies can be fertilized by 
sperm from more than 40 m away (Yund, 1998). 

Colonies of B. schlosseri on rocks and shells were col- 
lected from the Damariscotta River estuary, Maine, by 
divers and transported to the laboratory. Fragments of each 
colony were explanted onto microscope slides and main- 
tained in a flowing seawater system at the University of 
Maine's Darling Marine Center (Walpole, Maine). Animals 
cultured on glass can be examined under a microscope to 
assess egg production and stage in the reproductive cycle. 
Colonies for the manipulative experiment and the field 
survey were selected on the basis of sexual stage. Male- 
phase colonies (those releasing sperm) were deployed at 
about stage three (by the criteria of Milkman. 1967). Fe- 
male-phase colonies (those with eggs ready to be fertilized) 
were deployed at late stage four or early stage five (Milk- 
man, 1967). just prior to takeover by the new asexual 
generation of zooids. Females were recovered between 
stages 3 and 4 in the subsequent cycle (total cycle duration 
ranged from 7-10 days), prior to the release of brooded 
larvae. All embryos were then surgically removed from the 
zooids for enumeration. The percent of eggs fertilized was 
calculated as the number of larvae brooded upon return 
from the field divided by the number of eggs brooded prior 
to deployment, multiplied by 100. Data from colonies that 
were unhealthy, damaged, or dead upon return from the 
field were excluded. 

Population size and density manipulation 

We examined the potentially independent effects of pop- 
ulation size and density on fertilization during the summer 
of 2000 by manipulating population size and colony spacing 
in experimental populations. Our experimental design em- 
ployed four combinations of two population size treatments 
(4 and 16 colonies: Fig. 1) and two density treatments 
(equivalent to 13 and 157 colonies per square meter, calcu- 
lated on the basis of the separation distances between the 
centers of the colonies). Population sizes in this experiment 
were smaller than many natural populations, but compara- 
ble to colony numbers on isolated pieces of hard substratum. 



154 



A. PHILLIPPI ET AL. 



A. Large size, High density 



B. Large size, Low density 



9cf9cf 



?cf?cf 
cf?cf? 



$ 


cf 


? cf 


cf 


! 


cf ? 


9 


cf 


? cf 


cf 


i 


cf $ 



C. Small size, High density 



D Small size, Low density 



?cf 



? cf 
cf ? 



Figure I. Design of mating arrays used in the four experimental 
treatments to assess the effects of population size and density on fertiliza- 
tion levels of Boti-\llu.\ xchlosseri. Symbols indicate the functional gender 
of a colony during an experiment; all colonies are actually hermaphrodites. 
Colony positions in the two high-density arrays are not quite to scale 
(colonies were closer together than the size of the symbols permits; 5 cm 
apart on center). Populations consisted of either 4 or 16 colonies, while 
density corresponded to 1.1 rv 157 colonies m 2 . 



Density treatments spanned most of the reported range for 
natural variation in this estuary (about 5 to 170 colonies per 
square meter: Yund and Stires. 2002), though for logistical 
reasons we were unable to explore the very lowest densities 
observed in nature. Experimental populations were assem- 
bled by mounting laboratory-cultured colonies growing on 
2.5 X 7.6 cm glass microscope slides on 1 .21-m 2 sheets of 
0.6-cm-thick marine plywood that were in turn mounted on 
top of flat concrete patio blocks weighing 40 kg. Colonies 
were arranged so that male and female phases alternated as 
nearest neighbors (Fig. 1). Female colonies brooded an 
average of 59 eggs (2.5 SE). 

Assembled arrays were deployed in a 4-m-deep (at mean 
low water) channel in the Damariscotta River between an 
island (Carlisle Island) and the mainland. The substratum in 
this channel is soft sediment, so B. schlosseri does not occur 
naturally. Past experiments in this location have indicated 
only minor contamination from natural sperm as long as 
local experimental males are present (Yund. I99X). Currents 
are dominated by tidal exchange, are largely bidirectional, 
and are non-zero 95'/; of the time (Yund and McCartney, 
1994). The arrays were lowered from the surface by means 
ol lines, so i he orientation of the colonies with respect to 



tidal currents was not known. Each array was separated 
from its nearest neighbor by at least 30 m. 

Four replicate trials were conducted of all four treatment 
combinations, with one replicate of each treatment per- 
formed simultaneously. Because each 16-colony (large pop- 
ulation) array potentially yielded fertilization levels for four 
times as many females as the 4-colony (small population) 
arrays (8 vs. 2 females per trial), we conducted two extra 
trials of the small population size treatments to produce 
more equitable replication across treatments. Owing to the 
loss of data on some females that did not survive through 
their deployment, we obtained an average of 5.5 fertilization 
values per replicate trial for the large population size treat- 
ments, and 1 .7 for the small population size treatments. The 
percent of eggs fertilized was arcsin-transformed to meet 
ANOVA assumptions, and then this dependent variable was 
analyzed by an ANOVA package that accommodates an 
unbalanced design (Statistica '99, Statsoft, Inc.) with pop- 
ulation size, population density, and trial as the three main 
effects. The data were initially analyzed with interaction 
effects included in the model. No interactions between any 
of the main effects were significant, so the analysis was 
repeated excluding interaction effects to maximize power 
for the main effects. We also performed a power analysis to 
assess our ability to detect differences among treatments. 

Natural spawning populations 

To assess fertilization levels in natural spawns, we de- 
ployed laboratory-cultured female-phase colonies in two 
field populations in the Damariscotta River during the sum- 
mer of 1999. The two populations were located adjacent to 
the shores of small islands in the river. The seaward site was 
located at Carlisle Island (hereafter CI), while the landward 
site (DM) was at Glidden Ledge (see Yund and Stires, 2002. 
for a map and additional site information). The DM site 
experiences warmer temperatures during the summer, 
\\hich decreases the duration of each reproductive cycle 
(Yund and Stires. 2002). Egg production is much higher at 
DM, apparently because of greater food availability (Stew- 
art-Savage et til.. 200 1 b). Both sites exhibit seasonal vari- 
ation in population density, with peak densities occurring in 
August, but peak density is typically about seven times 
greater at DM than at CI (Yund and Stires. 2002). 

To assess fertilization levels in the tield, female-phase 
colonies growing on 2.5 X 7.6 cm microscope slides were 
placed individually in open-sided plastic slide boxes that 
were attached to a cinderbloek-weighted rope supported by 
a surface buoy. Colonies were oriented upside down to 
reduce the effects of sedimentation, and were located ap- 
proximately 0.5 in above the substratum. Three to eight 
(mean = 5.5 0.3 SE) colonies were deployed at each site 
approximately weekly from early June to mid-August, and 
at site CI through the end of September. Colonies were 



FERTILIZATION * F(DENSITY) 



155 



positioned along a transect oriented parallel to the shore. 
and spaced about 7 m from their nearest neighbor. 

Egg counts prior to deployment averaged 105 per colony 
( 12 SE). All colonies remained in the Held through the 
beginning of the next asexual generation (hereafter termed 
takeover) and the full period of egg viability, so that eggs 
were fertilized by naturally available sperm. Fertilization 
levels were determined as described above. Throughout 
most of the season, all embryos within a colony were at the 
same developmental stage. The presence of a mixture of 
developmental stages indicated that embryos lagging in 
development were fertilized later than the others (Meidel 
and Yund, 2001). Typically, all embryos surgically re- 
moved from a colony were at about stage four, and pos- 
sessed a tail that wrapped completely around the embryo 
(Milkman, 1967). Embryos at a tail-bud stage or earlier (by 
the criteria of Milkman, 1967) were at least 24 h behind in 
development and therefore were reported as unlikely to 
complete development (Stewart-Savage et at. 200 la). 

Throughout the reproductive season, we surveyed the 
density of B. schlosseri colonies at both sites monthly. 
Density surveys, made with the aid of scuba, involved 
counting all of the colonies present in eight randomly de- 
ployed 0,64-m 2 quadrats. We did not measure the size 
distribution, reproductive status, or reproductive output of 
the colonies because past work (Stewart-Savage et u/., 
200 Ib; Yund and Stires, 2002) permits reasonable inference 
about variation in these variables between sites. A subset of 
the field fertilization data was used to assess the possible 
relationship with population density. Fertilization values 
obtained during three week-long intervals (including the 
weeks immediately before, during, and after the week of a 
population survey) were paired with the associated popula- 
tion density survey for analysis. Fertilization values ob- 
tained outside of these intervals could not be reliably asso- 
ciated with a density and so were excluded from this portion 
of the analysis. The possible relationship between fertiliza- 
tion and population density was assessed by regression. We 
also calculated the variance in fertilization at each density 
and used a variety of nonlinear regressions to explore pos- 
sible relationships between variance in fertilization and pop- 
ulation density. 

Results 

Population si:.c mul ilesit\ manipulation 

Fertilization levels were consistently high (>80%) in all 
four combinations of population size and density treatments 
(Fig. 2). The effect of trial was significant, but neither 
population size nor density affected fertilization levels in 
experimental populations (Table 1 ). Results from the power 
analysis indicated that replication was sufficient to detect 
differences between treatments as small as 7.5% for density 
effects and 8.7% for population size effects at a = 0.05. 




Large Population Size Small Population Size 

Figure 2. Mean field fertilization levels of Botryllits schlosseri colo- 
nies in the four population si/e and density treatments. Error bars represent 
one standard error. 



Natural spawning populations 

As reported for 1996 and 1997 (Yund and Stires. 2002), 
population density increased at the landward site (DM) 
throughout the summer and declined after September (Fig. 
3). However, peak density at DM was substantially lower 
than recorded in both earlier years (65 vs. ~ 170 colonies 
m" 2 ; Yund and Stires, 2002). Nevertheless, peak density 
was more than an order of magnitude higher than density 
early in the season. Densities at the seaward site (CI) were 
generally lower than at DM and exhibited less variation 
during the season (Fig. 3). 

Mean fertilization levels at both sites were greater than 
70% throughout the season, with only two exceptions (Fig. 
3). The mean fertilization at DM in week 24 was slightly 
lower owing to the almost complete fertilization failure of 
one female colony (note the very high variance for this 
mean in Fig. 3). Towards the very end of the reproductive 
season the seaward site showed a slight trend toward de- 
clining fertilization (90% to 66% in weeks 37 to 40; Fig. 3). 

Beginning at week 38, embryos removed from colonies 
that had been deployed at site Cl varied greatly in develop- 
mental staging (in contrast to all earlier weeks when the 
embryos within a colony were all at the same developmental 
stage). Embryos at earlier developmental stages would have 
had insufficient time to complete development before the 
colony began a new asexual generation and the old zooids 
were resorbed (Stewart-Savage et <//., 200 1 a). By week 40, 
although 66% of eggs were fertilized, we estimate that only 
39% of eggs would have resulted in fully developed larvae 
(Fig. 3). 

There was no relationship between fertilization level and 
natural population density (Fig. 4A); the regression of per- 
cent of eggs fertilized on the log of density was not signif- 



156 



A. PHILLIPPI ET AL. 



Table 1 

Analysis of variance results for effects of population size and density on 
fertilization in the manipulative experiment 



Effect 


df 


MS 


SS 


F-ratio 


P 


Size 


1 


2.699 


2.699 


0.031 


0.862 


Density 


1 


63.378 


63.378 


0.718 


0.401 


Trial 


5 


229.251 


1146.254 


2.596 


0.035 


Error 


55 


88.300 


4856.505 







icant (P = 0.250, r = 0.016). The power analysis indicated 
that a slope estimate of double the value obtained would 
have been necessary for significance at a = 0.05. In contrast 
to the absence of a pattern in overall fertilization level, a 
nonlinear (exponentially declining) relationship did exist 
between the variance in fertilization and colony density 
(r = 0.71 15. 0.010 <P < 0.025; Fig. 4B). 

Discussion 

Effects of population size and density on fertilization 

Population density did not significantly affect fertilization 
in either experimental or natural populations of Botryllus 
schlosseri (Figs. 2. 3, 4; Table 1), although density varied 
across more than an order of magnitude and spanned most 
of the range relevant to local populations (Yund and Stires, 
2002). Mean fertilization levels were generally very high 
(Figs. 2, 3). In the experimental manipulation, population 
size also had no effect on fertilization (Fig. 2: Table 1 ). This 
result contrasts with previous work on a species that broad- 
casts its eggs (the red sea urchin Strongylocentrotus fran- 
ciscanus), in which population size was found to have an 
interactive effect (with density) on fertilization levels (Levi- 
tan et til., 1992). 



24 26 26 30 32 34 36 38 40 4 




Week 

Figure 3. Percent of eggs fertili/ed (circles I. embryos completing 
development (squares), and population density estimates (bars) for two 
natural populations ot H<iir\llu\ \.7i/ov'n. Open bars and circles represent 
population DM; solid bars, circles, and squares represent population Cl. 
Error bars represent one standard error. 






I 80 

OJ 

N 

1 60 



40 



20 




1000 



c 
o 

S 800 

E 

OJ 

!i 600 \ 

0) 

o 

Q. 400 - 

c 

8 



20 1 



CD 



B 



0.0 05 10 15 

Log [Colonies m' 2 ] 



2.0 



Figure 4. (A) Effect of colony density of natural populations on 
overall fertilization levels of Botryllus schlosseri. The plotted linear re- 
gression line is not significant. (B) Effect of colony density on variance in 
fertilization. The plotted exponential regression is significant at P < 0.01. 



While overall fertilization levels did not change signifi- 
cantly with population density (Fig. 4A). the variance in 
fertilization in natural populations did increase at lower 
density (Fig. 4B). indicating that reduced population density 
may result in greater variation in fertilization among differ- 
ent individuals. The very high variance in fertilization at the 
lowest population density was heavily influenced by a sin- 
gle colony that exhibited exceptionally low fertilization 
(8.8%). However, such individual effects may be relevant to 
natural populations and should not be dismissed as outliers. 

Because B. schlosseri is a colonial species, population 
density alone is an imperfect predictor of population-wide 
reproductive output. Juvenile colonies delay sexual repro- 
duction until they achieve a minimum size (Boyd et ai, 
1986; Chadwick-Furman and Weissman, 1995). Reproduc- 
tive output in sexually mature colonies is highly variable 
and subject to both genetic (Grosberg, 1988; Yund et al., 
1997) and environmental (Newlon et til.. 2003) influences. 
Nevertheless, temporal variation in density is a reasonable 
first approximation of average gamete production at the 



FERTILIZATION * F(DENSITY) 



157 



population level, because it indicates times of population 
growth and contraction. Unlike many other colonial inver- 
tebrates, B. schlosseri rarely exhibits fragmentation (Gros- 
berg, 1982). Consequently, recruitment of sexually pro- 
duced larvae is essential for population growth (Yund and 
Stires, 2002). 

In surveys, sperm appeared to become somewhat more 
limiting at the very end of the sample period. At that time, 
the annual reproductive season was ending and populations 
were shrinking (Fig. 3; Yund and Stires, 2002), so any 
marginal fertilization effect is best viewed as a minor com- 
ponent of a larger trend in population dynamics. Overall 
fertilization values exhibited only a slight downward trend, 
but the timing of fertilization varied more substantially (Fig. 
3). The presence of embryos at various developmental 
stages indicated that fertilization within each brood oc- 
curred over a wider time span than during the rest of the 
reproductive season. Embryos at an earlier developmental 
stage at the conclusion of our sample intervals would prob- 
ably not have had sufficient time to complete development 
before the adult zooids were resorbed and the next asexual 
generation began (Stewart-Savage et til., 200 la). Therefore, 
delayed fertilizations are unlikely to have produced viable 
progeny, and so may represent a form of temporal sperm 
limitation. Sperm availability may have been reduced at this 
time of year from decreases in both population density and 
energy allocated to sperm production (Stewart-Savage et 
dl., 2001 a). A crash in the local phytoplankton population 
each autumn (Incze et ai, 1980) is consistently associated 
with smaller testes and lower egg production in B. schlos- 
seri (unpubl. data). 

Comparison with results from other ta\a 

The effects of population size and density on fertilization 
have been investigated in other free-spawning marine in- 
vertebrates. Field experiments with three species of sea 
urchins used eggs retained in Nitex mesh bags and either 
induced males to spawn or used sperm-filled syringes to 
simulate males. Increasing the number or density of spawn- 
ing individuals increased fertilization in all three species 
(Levitan, 1991; Levitan et ai. 1992: Wahle and Peckham, 
1999). Ultimately, the differing consequences of population 
size and density for fertilization in sea urchins and ascidians 
can probably be explained by the different spawning strat- 
egies of these taxa. Sea urchins broadcast both sperm and 
eggs, so rapid gamete dilution may have a greater impact on 
sperm-egg encounters than in brooders, where egg retention 
prevents the dilution of female gametes. However, all three 
of the sea urchin studies cited above manipulated gametes 
so that eggs were held at fixed concentrations in sperm- 
permeable containers. Consequently, though egg dilution 
may be important in natural spawns, it played no role in the 
experimental results reported in these papers. Hence the 



proximate explanation for the difference between our results 
and those of the sea urchin studies must involve a process 
other than egg dilution. 

As part of a reproductive strategy that involves retaining 
eggs internally, brooders usually possess some mechanism 
for capturing sperm. The method by which sperm enter a 
female-phase B. schlosseri colony is not known, but all 
indications are that this organism is exceedingly efficient at 
acquiring dilute, long-lived sperm from the water (Johnson 
and Yund, 2004). Additionally, fertilization in B. schlosseri 
is a time-integrated process with eggs viable to be fertilized 
for 24 h (Stewart-Savage et ai, 2001a). Consequently, it 
seems probable that sperm are filtered out of the water as a 
by-product of feeding activity, which is likely to involve the 
processing of a relatively large volume of water. If so, 
sperm would in effect be concentrated, limiting the impact 
of sperm dilution. Thus increased efficiency of sperm col- 
lection coupled with time-integrated fertilization, rather 
than reduced egg dilution, may explain the absence of 
density effects on fertilization in B. schlosseri. 

Density effects on fertilization have also been explored in 
the internally fertilizing Queen conch, Strombus gigas, 
which does not free-spawn, but instead transfers sperm by 
copulation. At very low adult densities (<100/ha or <0.01/ 
m 2 ), reproductive success was found to be density depen- 
dent in S. gigas (Stoner and Ray-Culp, 2000). However, 
above a critical density, evidence for Alice effects in S. 
gigas dissipated as the frequency of observed reproductive 
behavior plateaued. By analogy, sperm limitation is to be 
expected in B. schlosseri at some very low population 
density. However, that density condition does not appear to 
occur in the Damariscotta River estuary. 

Although previous studies of fertilization in egg-brooding 
free-spawners have not directly addressed the effects of 
population density, a comparison of reported efficiencies of 
sperm capture is nonetheless illuminating. Both the colonial 
ascidian Diplosoma listerianum and the bryozoan Celle- 
porella hyalina achieve maximum fertilization at sperm 
concentrations on the order of 10 2 ml" 1 , in contrast to the 
I0 4 -10 S ml~ ' concentrations required for fertilization in sea 
urchins (Pemberton et ai. 2003). When sperm from a single 
male-phase D. listerianum colony were diluted in a 3840-1 
tank, the male was nevertheless able to sire abundant prog- 
eny with 20 female-phase colonies (Bishop, 1998). Conse- 
quently, these two brooding species appear likely to have 
ecological fertilization dynamics similar to those of B. 
schlosseri. In marked contrast to these results, female col- 
onies of the brooding octocoral Briareum asbestinum were 
severely sperm limited when placed only 5 m away from a 
male, and reproductive success was positively correlated 
with male density (Brazeau and Lasker. 1992). Though 
based on a very limited number of brooding species, the 
comparison between the octocoral and the bryozoans and 
asidians hints at another general principle. Bryozoans, like 



158 



A. PHILLIPPI ET AL 



ascidians, are active suspension feeders who use feeding 
structures to filter sperm or sperm packets from the seawater 
(Temkin. 1994. 1996), whereas octocorals are passive sus- 
pension feeders. Although the mechanism by which sperm 
gain access to brooded eggs is unknown in octocorals, this 
taxon lacks a feeding mechanism that could be co-opted for 
sperm capture. So while active suspension-feeding brooders 
may be largely immune to sperm limitation in nature, pas- 
sive suspension-feeding brooders may be among the most 
sperm-limited of marine invertebrates (Yund, 2000). 

Comparison with previous results for B. schlosseri 

It is useful to view our results within the context of past 
fertilization studies on B. schlosseri. A series of papers on 
sperm competition focused on relative male reproductive 
success, but also incidentally quantified levels of egg fer- 
tilization. While Atkinson and Yund (1996) found no sig- 
nificant difference in the proportion of eggs fertilized in 
combinations of high and low population density and size, 
three other studies (Yund and McCartney, 1994; Yund 
1995, 1998) did report increased fertilizations with in- 
creased male density. If male density (past studies) has more 
of an effect than total population density (this study) on 
fertilization, fertilization in B. schlosseri may be more sen- 
sitive to the male:female ratio than to absolute density. At 
the level of individual gametes (i.e., the cellular level), this 
pattern in turn suggests that fertilization levels may be 
dictated more by sperm:egg ratios than by the absolute 
sperm concentration. Yund (1998) also used a rare biochem- 
ical marker for paternity determination and showed that 
nearby males monopolize fertilizations as long as the quan- 
tity of sperm they produce is greater than some threshold 
level. When local sperm production is below that threshold, 
eggs are fertilized nevertheless, but the sperm come from 
more distant sources. This result helps explain how eggs can 
be fertilized under a broad range of density conditions. 

Maximum field fertilization levels 

Fertilization levels for B. schlosseri were generally quite 
high, but even in the most dense conditions still averaged 
less than 100%. Fertilization levels in colonies placed in 
natural populations averaged 85.6% throughout the entire 
sampling season (Fig. 3); levels in the experimental popu- 
lations were also very close to 85% (Fig. 1). Although it is 
tempting to interpret these data as evidence of a low level of 
sperm limitation, another explanation is more likely. Repro- 
ductive success below 100% may have been the result not of 
unsuccessful fertilization, but of unsuccessful development 
of embryos because of outbreeding depression (Grosberg, 
1987). Due to the philopatric dispersal of larvae (that is, 
dispersal that keeps the larvae near their site of origin). B. 
schlosseri colonies typically live in kin groups (Grosberg, 
1987. 1991; Yund and O'Neil. 2()00). and consequently 



mate with relatives (Grosberg, 1987, 1991). Because the 
normal mating system involves inbreeding, this species may 
be subject to outbreeding depression (Grosberg, 1987). Our 
experimental manipulation assembled populations that 
lacked genetic structure, and our survey introduced ran- 
domly selected genotypes into natural populations. Thus, all 
fertilizations were the product of out-crossed matings. Gros- 
berg (1987) has previously reported that outcrossing re- 
duces the success of both fertilization and subsequent em- 
bryo development. The cumulative effect of outbreeding 
depression (through larval hatching) that he predicted is 
consistent with the 15% failure that we observed. Because 
we assayed fertilization by successful development, our 
approach would not have distinguished early developmental 
failures from fertilizations that did not occur. 

Alternatively, recent ecological work on the occurrence 
of polyspermy in marine invertebrates (e.g., Franke et at., 
2002) suggests a different explanation for our observed 85% 
fertilization maximum. All of the eggs in our colonies may 
have been fertilized, but some may have been fertilized by 
more than one sperm. Because embryos resulting from 
polyspermic fertilization would have failed to develop, and 
we assayed fertilization in terms of successful development, 
our results could also have incorporated the effects of 
polyspermy. Although we are convinced that polyspermy 
plays an important role in the fertilization dynamics of 
many marine free-spawners (Yund, 2000), we are skeptical 
of this explanation for our own results. All evidence sug- 
gests that successful fertilization in B. schlosseri tends to be 
a time-integrated process in which dilute sperm are slowly 
acquired from the water. If this scenario is valid, then eggs 
are unlikely to be subject to the high short-term sperm 
concentrations necessary to cause polyspermy. Further- 
more, effective polyspermy blocks are present in ascidians 
(e.g., Lambert et ai, 1997). Even when eggs of B. schlosseri 
are subjected in laboratory experiments to sperm concen- 
trations much higher than those found in nature, we see no 
evidence of polyspermy (unpubl. data). In addition, if 
polyspermy had been an important factor in our experi- 
ments, fertilization levels (as assayed by development) 
should have declined at higher population densities. 

Acknowledgments 

Cheryl Wapnick, Lisa Onaga, and Basma Mohammad 
assisted with animal culture, and Sheri Johnson provided 
helpful comments on an earlier version of the manuscript. 
Funding was provided by the National Science Foundation 
(OCE-97-30354. OCE-01-22031, and OCE-01-17623). 

Literature Cited 

Atkinson, O. S., and P. (). Yund. 1996. The effect of variation in 
population density on male fertilization success in a colonial ascidian. 
./ l-\t>. Mar. Biol. Ecu!. 195: 111-123. 



FERTILIZATION * F( DENSITY I 



159 



Babcock, R. C., C. N. Mundy, and D. \\hitehead. 1994. Sperm 
diffusion models and in situ confirmation of long-distance fertilization 
in the free-spawning asteroid Acanthaster planci. Biol. Bull. 186: 
17-28. 

Benzie. J. A. H., and P. Dixun. 1994. The effects of sperm concentra- 
tion. sperm:egg ratio, and gamete age on fertilization success in crown- 
of-thorns starfish (Acanthaster planci) in the laboratory. Biol. Bull. 
186: 139-152. 

Benzie, J. A. H., K. P. Black, P. J. Moran, and P. Dixon. 1994. 
Small-scale dispersion of eggs and sperm of the crown-of-thorns star- 
fish (Acanthaster planci) in a shallow coral reef habitat. Biol. Bull. 186: 
153-167. 

Bishop, J. D. D. 1998. Fertilization in the sea: are the hazards of 
broadcast spawning avoided when free-spawned sperm fertilize re- 
tained eggs? Proc. R. Soc. Land. B 265: 725-73 1 . 

Boyd, H. C., S. K. Brown, J. A. Harp, and I. L. VVeissman. 1986. 
Growth and sexual maturation of laboratory-cultured Monterey Botryl- 
lus schlosseri. Biol. Bull. 170: 91-109. 

Brazeau, D. A., and H. R. Lasker. 1992. Reproductive success in the 
Caribbean octocoral Briareum asbesrinum. Mar. Binl. 114: 157-163. 

Chadwick-Furman, N. E., and I. L. Weissman. 1995. Life histories 
and senescence of Botiylhis schlosseri (Chordata. Ascidiacea) in 
Monterey Bay. Biol. Bull. 189: 36-41. 

Claereboudt. M. 1999. Fertilization success in spatially distributed 
populations of benthic free-spawners: a simulation model. Ecol. Model. 
121: 221-233. 

Coma, R., and H. R. Lasker. 1997a. Small-scale heterogeneity of 
fertilization success in a broadcast spawning octocoral. J. Exp. Mar. 
Biol. Ecol. 214: 107-120. 

Coma, R., and H. R. Lasker. 1997b. Effects of spatial distribution and 
reproductive biology on in situ fertilization rates of a broadcast-spawn- 
ing invertebrate. Biol. Bull. 193: 20-29. 

Frank, K. T., and D. Brickman. 2000. Allee effects and compensatory 
population dynamics within a stock complex. Can. J. Fish. Aquat. Sci. 
57: 513-517. 

Franke, E. S., R. C. Babcock, and C. A. Styan. 2002. Sexual conflict 
and polyspermy under sperm-limited conditions: in \itii evidence from 
field simulations with the free-spawning marine echinoid Evecliinus 
chtororicus. Am. Nat. 160: 485-496. 

Grosberg, R. K. 1982. Ecological, genetical. and developmental factors 
regulating life history variation within a population of the colonial 
ascidian Botiy/his schlosseri (Pallas) Savigny. Ph.D. dissertation. Yale 
University, New Haven. CT. 

Grosberg, R. K. 1987. Limited dispersal and proximity-dependent 
mating success in the colonial ascidian Botryllus xchloxxeri. Evolution 
41: 372-3X4. 

Grosberg, R. K. 1988. Life-history variation within a population of the 
colonial ascidian Botiylhis schlosseri. 1. The genetic and environmental 
control of seasonal variation. Evolution 42: 900-920. 

Grosberg, R. K. 1991. Sperm-mediated gene flow and the genetic 
structure of a population of the colonial ascidian Botryllus schlosseri. 
Evolution 45: 130-142. 

Incze L. S., R. A. Lutz, and L. Waiting. 1980. Relationship between 
effects of environmental temperature and seston on growth and mor- 
tality of Mytilus edtilis in a temperate northern estuary. Mar. Biol. 57: 
147-156. 

Jamieson, G. S. 1993. Marine invertebrate conservation: evaluation of 
fisheries over-exploitation concerns. Am. Zoo/. 33: 551-567. 

Johnson, S. L., and P. O. Y'und. 2004. Remarkable longevity of dilute 
sperm in a free-spawning colonial ascidian. Biol. Bull. 206: 144-151. 

Lambert C., H. Goudeau, C. Franchet, G. Lambert, and M. Goudeau. 
1997. Ascidian eggs block polyspermy by two independent mecha- 
nisms: one at the egg plasma membrane, the other involving the follicle 
cells. Mot. Reprod. Dev. 48: 137-143. 



Lasker, H. R., D. A. Brazeau. J. Calderon, M. A. Coffroth, R. Coma, 
and K. Kim. 1996. In situ rates of fertilization among broadcast 
spawning gorgonian corals. Biol. Bull. 190: 45-55. 

Levitan, D. R. 1991. Influence of body size and population density on 
fertilization success and reproductive output in a free-spawning inver- 
tebrate. Binl. Bull. 181: 261-26X. 

Levitan, D. R., and C. Petersen. 1995. Sperm limitation in the sea. 
Trends Ecol. Evnl. 10: 22X-231. 

Levitan, D. R., and M. A. Sewell. 1998. Fertilization success in 
free-spawning marine invertebrates: review of the evidence and fish- 
eries implications. Can. Spec. Puhl. Fish. Ai/uat. Sci. 125: 159-164. 

Levitan, D. R., and C. M. Young. 1995. Reproductive success in large 
populations: empirical measures and theoretical predictions of fertili- 
zation in the sea biscuit Clypeaster rosaceus. J. Exp. Mar. Biol. Ecol. 
190: 221-241. 

Levitan, D. R., M. A. Sewell, and F.-S. Chia. 1991. Kinetics of 
fertilization in the sea urchin Strongylocentrotus franciscanus: interac- 
tion of gamete dilution, age. and contact time. Biol. Bull. 181: 371-378. 

Levitan. D. R., M. A. Sewell, and F.-S. Chia. 1992. How distribution 
and abundance influences fertilization success in the sea urchin 
Strongylocentrotus franciscanus. Ecology 73: 248-254. 

Liermann, M.. and R. Hilborn. 1997. Depensation in fish stocks: a 
hierarchic Bayesian meta-analysis. Can. J. Fish. Aquat. Sci. 54: 1976- 
1984. 

Meidel. S. K., and P. O. Yund. 2001. Egg longevity and time-inte- 
grated fertilization in a temperate sea urchin (Strongylocentrotus droe- 
bachiensis). Biol. Bull. 201: X4-94. 

Metaxas, A., R. E. Scheibling, and C. M. Young. 2002. Estimating 
fertilization success in marine benthic invertebrates: a case study with 
the tropical sea star Oreaster reticnlatiis. Mar. Ecol. Prog. Ser. 226: 
87-101. 

Milkman, R. 1967. Genetic and developmental studies on Botryllus 
schlosseri. Biol. Bull. 132: 229-243. 

Morgan, S. G. 1995. Life and death in the plankton: larval mortality and 
adaptation. Pp. 279-321 in Marine Invertebrate Larvae. L. McEdward. 
ed. CRC Press. New York. 

Myers, R. A., N. J. Barrowman. J. A. Mulchings, and A. A. Rosenberg. 
1995. Population dynamics of exploited fish stocks at low population 
levels. Science 269: 1106-1108. 

Newlon, A. \V. Ill, P. O. Yund, and J. Stewart-Savage. 2003. Phe- 
notypic plasticity of male, female, and asexual reproduction in a 
colonial ascidian. Botiylhis schlosseri. J. Exp. Zoo/. 297A: 180-188. 

Oliver, J., and R. Babcock. 1992. Aspects of the fertilization ecology 
of broadcast spawning corals: sperm dilution effects and in situ mea- 
surements of fertilization. Biol. Bull. 183: 409-417. 

Pemberton, A. J., R. N. Hughes, P. H. Manriquez, and J. D. D. Bishop. 
2003. Efficient utilization of very dilute sperm: sperm competition 
may be more likely than sperm limitation when eggs are retained. Proc. 
R. Soc. Loud. B (Suppl.l 270: S223-S226. 

Pennington, J. T. 1985. The ecology of fertilization of echinoid eggs: 
the consequences of sperm dilution, adult aggregation, and synchro- 
nous spawning. Binl. Bull. 169: 417-430. 

Pfister, C. A., and A. Bradbury. 1996. Harvesting red sea urchins: 
recent effects and future predictions. Ecol. Appl. 6: 298-310. 

Quinn, J. F., S. R. Wing, and L. W. Botsford. 1993. Harvest refugia 
in marine invertebrate fisheries: models and applications to the red sea 
urchin Strongylocentrotus franciscanus. Am. Zool. 33: 537-550. 

Roughgarden, J., S. Gaines, and H. Possingham. 1988. Recruitment 
dynamics in complex life cycles. Science 241: 1460-1466. 

Sewell, M. A. 1994. Small size, brooding, and protandry in the apodid 
sea cucumber Leptosynapta chirki. Biol. Bull. 187: 1 12-123. 

Shelton, P. A., and B. P. Healey. 1999. Should depensation be dis- 
missed as a possible explanation for the lack of recovery of the northern 
cod (Gadns mnrhua) stock? Can. J. Fish. Aquat. Sci. 56: 1521-1524. 



160 



A PHILLIPPI ET AL. 



Stewart-Savage, J., and P. O. Vund. 1997. Temporal pattern of sperm 

release from the colonial ascidian, Bolryllus schlosseri. J. Exp. Zoo/. 

279: 620-625. 
Stewart-Savage, J., A. Phillippi, and P. O. Vund. 200 la. Delayed 

insemination results in embryo mortality in a brooding ascidian. Bin/. 

Hull. 201: 52-58. 
Stewart-Savage. J., A. Stires, and P. O. Vund. 200 Ib. Environmental 

effect on the reproductive output of Botryllus schlosseri. Pp. 311-314 

in Biology ofAscidians, H. Sawada, H. Yokosama, and C.C. Lambert, 

eds. Springer- Verlag, Tokyo. 
Stoner, A. W., and M. Ray-Culp. 2000. Evidence for Allee effects in 

an over-harvested marine gastropod: density-dependent mating and egg 

production. Mar. Ecol. Prog. Ser. 202: 297-302. 
Strathmann. R. R. 1985. Feeding and non-feeding larval development 

and life-history evolution in marine invertebrates. Annii. Rev. Ecol. 

Syst. 16: 339-361. 
Temkin. M. H. 1994. Gamete spawning and fertilization in the gym- 

nolaemate bryozoan Membranipora membranacea. Bio!. Bull. 187: 

143-155. 
Temkin, M. H. 1996. Comparative fertilization biology of gymnolae- 

rnate bryozoans. Mar. Biol. 127: 329-339. 
Thorson, G. 1950. Reproductive and larval ecology of marine bottom 

invertebrates. Biol. Rev. 25: 1-45. 
\\ahle, R. A., and S. H. Peckham. 1999. Density-related reproductive 



trade-offs in the green sea urchin. Strongylocentrotus droebachiensis. 

Mar. Biol. 134: 127-137. 
Vund, P. O. 1990. An in situ measurement of sperm dispersal in a 

colonial marine hydroid. J. Exp. Zool. 253: 102-106. 
Vund, P. O. 1995. Gene flow via the dispersal of fertilizing sperm in a 

colonial ascidian (Botryllus schlosseri}: the effect of male density. Mar. 

Biol. 122: 649-654. 
Vund, P. O. 1998. The effect of sperm competition on male gain curves 

in a colonial marine invertebrate. Ecology 79: 328-339. 
Vund, P. O. 2000. How severe is sperm limitation in natural populations 

of marine free-spawners? Trends Ecol. Evol. 15: 10-13. 
Vund, P. O., and M. A. McCartney. 1994. Male reproductive success 

in colonial invertebrates: competition for fertilizations. Ecology 75: 

2151-2167. 

Yund, P. O., and P. G. O'Neil. 2000. Microgeographic genetic differ- 
entiation in a colonial ascidian (Bom/Ins schlosseri) population. Mar. 

Biol. 137: 583-588. 
Vund, P. O., and A. Stires. 2002. Spatial variation in population 

dynamics in a colonial ascidian (Butryllus schlosseri}. Mar. Biol. 141: 

955-963. 
Vund, P. O., \. Marcum, and J. Stewart-Savage. 1997. Life-history 

variation in a colonial ascidian: broad-sense heritabilities and tradeoffs 

in allocation to asexual growth and male and female reproduction. Biol. 

Bull. 192: 290-299. 



Reference: Biol. Bull. 206: 161-172. (June 2004) 
2004 Marine Biological Laboratory 



Induction of Settlement of Larvae of the Sea Urchin 

Holopneustes purpurascens by Histamine 

From a Host Alga 



REBECCA L. SWANSON 14 *, JANE E. WILLIAMSON, 1 4 t. ROCKY DE NYS K4 t 
NARESH KUMAR 24 . MARTIN P. BUCKNALL 1 , AND PETER D. STEINBERG 14 

1 School of Biological, Eartli & Environmental Sciences, ~ School of Chemical Sciences, 

' Bioanalytical Mass Spectrometry Facilit\, Center for Marine Biofouling & Bio-Innovation, 

University' of New South Wales, Svdnev 2052, Australia 



Abstract. Larvae of the Australian sea urchin Holopneu- 
stes purpurascens are induced to settle and metamorphose 
(termed settlement herein) by a water-soluble compound 
produced by the red alga Delisea pulchra, the main host 
plant of new recruits. The settlement cue for H. purpura- 
scens had previously been identified as a floridoside-isethio- 
nic acid complex, and this paper presents new evidence 
correcting that finding. The actual settlement cue produced 
by D. pulchra was isolated from the polar extract by cation- 
exchange chromatography and identified as histamine, us- 
ing one- and two-dimensional nuclear magnetic resonance 
spectrometry. The chemical identity of the cue was con- 
firmed by gas chromatography-mass spectrometry (GC- 
MS) and matrix-assisted laser desorption/ionization-time- 
of-flight mass spectrometry. Synthetic histamine and 
histamine at 4.5 /nM isolated from D. pulchra both induced 
rapid settlement in 80%-100% of the larvae of H. purpura- 
scens. Lower concentrations of histamine (0.9-2.3 /u,A/) 
induced larval settlement, but this response varied from 
0%-90%. The histamine content of two host plants of H. 



Received 24 October 2003: accepted 8 April 2004. 

* To whom correspondence should be addressed. E-mail: 
r. swan son @ unsw.edu.au 

t Current address: Department of Biological Sciences. Maequarie Uni- 
versity. NSW 2109 Australia. 

+ Current address: School of Marine Biology & Aquaculture, James 
Cook University, QLD 4811 Australia. 

Abbreviations; CX, cation-exchange; F-I. floridoside-isethiomc acid; 
GC-MS. gas chromatography-mass spectrometry; HPLC, high-perfor- 
mance liquid chromatography; ISTD, internal standard; MALD1-TOF MS, 
matrix-assisted laser desorption/ionization-time-of-rlight mass spectrome- 
try; NMR. nuclear magnetic resonance; SSW, sterile seawater. 



purpurascens D. pulchra and Ecklonia radiata and of 
four other common species was quantified using GC-MS. D. 
pulchra had the highest histamine content, which is consis- 
tent with H. purpurascens recruiting to this species. Hista- 
mine was also detected in the seawater surrounding these 
host algae. This is the first time that a settlement cue has 
been quantified in the habitat of a marine organism. 

Introduction 

Most marine invertebrates have complex life histories in 
which a dispersive larval phase alternates with benthic 
juvenile and adult phases. The demography of such species 
is highly dependent on larval recruitment to a favorable 
habitat (Pawlik, 1992; Underwood and Keough, 2000). and 
the question of how planktonic larvae locate an appropriate 
benthic habitat in which to settle has long been a focus for 
marine biologists. The current view is that hydrodynamic 
processes dominate at large spatial scales (meters, kilome- 
ters), with active habitat selection becoming progressively 
more important at smaller spatial scales (centimeters, mil- 
limeters, micrometers) (Keough and Downes, 1982; Mul- 
lineaux and Butman, 1991; Harvey and Bourget, 1997; 
Zimmer and Butman, 2000). 

Active habitat selection requires that larvae discriminate 
among potential settlement sites, which is possible through 
the detection of habitat-specific cues. Many laboratory ex- 
periments have confirmed that larvae from a diverse range 
of phyla respond both behaviorally (settlement sinking to 
the bottom for substrate exploration) and morphologically 
(metamorphosis ontogenesis into the benthic form) to 
such physical factors of a habitat as light (Maida et al.. 



161 



162 



R. L. SWANSON ET AL 



1994). surface orientation (Raimondi and Morse, 2000). 
flow conditions (Mullineaux and Butman. 1991), crevices 
(Keough and Dowries, 1982), and surface texture (Bernts- 
son et al., 2000). Larvae can also be induced to settle and 
metamorphose (collectively termed settlement in this paper) 
by surface-bound or waterborne chemical cues, which are 
thought to indicate a suitable habitat for the benthic stage 
(Hadfield and Paul. 2001). The source of such chemical 
cues (inducers) may be conspecifics (Burke. 1986), host 
organisms (Williamson et al., 2000). prey (Hadfield and 
Scheuer, 1985), or biofilms (Wieczorek and Todd. 1998). 

The chemical cues for larval settlement that have been 
isolated from natural sources within the habitat appear to be 
diverse; however, most have been only partially character- 
ized. These include small peptides (the sand dollar Den- 
draster excentricus Burke. 1984; the oyster Crassostrea 
virginica Zimmer-Faust and Tamburri, 1994; the jellyfish 
Cassiopea xamachana Fleck and Fitt, 1999). uncharacter- 
ized low-molecular-weight water-soluble compounds (the 
nudibranch Phestilla xibogae Hadfield and Pennington. 
1990; the cephalaspidean Haminaea callidegenita Gibson 
and Chia, 1994), carbohydrates (the coral Agaricia humi- 
lis Morse and Morse, 1996; the ascoglossan Alderia mod- 
esta Krug and Manzi. 1999). and glycoproteins (the bar- 
nacle Balanus amphitrite Clare and Matsumura, 2000). 

In contrast to the numerous partially characterized induc- 
ers, there are only a few examples in which the chemical 
structure of a settlement cue isolated from a natural source 
has been determined. Delta-tocopherols from Sargassuin 
tortile induced settlement of the hydroid Coyne uchidai 
(Kato et al., 1975), jacarone isolated from the red alga 
Delesseria sanguined induced settlement of the scallop 
Pecten maximum (Yvin et al., 1985), narains and antho- 
samines A and B isolated from marine sponges induced 
settlement of ascidian larvae (Tsukamoto et al.. 1994, 
1995). and lumichrome isolated from conspecifics induced 
settlement of larvae of the ascidian Halocynthia roretzi 
(Tsukamoto et al., 1999). In most cases, the ecological 
relevance of these compounds in situ is not clear, either 
because the source of the settlement cue is not necessarily 
related to the recruitment patterns of the organism (Yvin et 
til.. 1985; Tsukamoto et al.. 1994. 1995). or because the 
availability of the cue to settling larvae has not been dem- 
onstrated (Tsukamoto et al.. 1999). 

A naturally occurring characterized settlement cue that 
appears to strongly affect the demography of the sea urchin 
Holopneustes purpurascens Agassiz 1872 (Temnopluridae: 
Echinodermata) was recently reported by Williamson et al. 
(2000). //. purpurascens is an endemic Australian echinoid 
that lives in shallow subtidal habitats in the canopy of 
macroalgae. particularly Deli.sea pulchra Greville (Mon- 
tagne) 1844 and Ecklimia nuliata (C. Agardh) J. Agardh 
1898 at Bare Island, Sydney (Williamson et al., 2000. 
2004). Although abundant on both host plants, the smaller 



size classes of H. purpurascens were most abundant on D. 
pulchra. with the smallest size class (test diameter 5 mm) 
found only on that species. This suggested that D. pulchra 
might produce a settlement cue for larval H. purpurascens 
(Williamson et al., 2000). Fresh pieces of D. pulchra (but 
not E. radiata) and seawater collected in situ near D. pul- 
chra plants induced settlement in larvae of H. purpurascens. 
The water-soluble cue was subsequently isolated and char- 
acterized as a complex between the sugar floridoside and 
isethionic acid (F-I complex; Williamson et al.. 2000). 

During further research on this system, we obtained in- 
ductive fractions that contained isethionic acid but not flori- 
doside. and we were also unable to reproduce a synthetic F-I 
complex that induced settlement of larval H. purpurascens. 
Subsequently, we hypothesized that the F-I complex was 
not a natural settlement cue for this urchin. This paper 
identifies the true nature of this chemical cue from D. 
pulchra for settlement of H. purpurascens larvae, correcting 
the previous finding of Williamson et al., (2000). In addi- 
tion, we quantify the settlement cue in host and non-host 
algae of H. purpurascens the first time that a natural 
settlement cue has been quantified in the habitat of a marine 
organism. 



Materials and Methods 



Stud\ site 



All animals and algae used in this study were collected 
from sublittoral habitats ( 1-3 m depth) at Bare Island (33 
59' 38" S. 151 14' 00" E) at the north head of Botany Bay, 
Sydney, Australia. At this site individuals of Holopneustes 
purpurascens are primarily found wrapped in the laminae of 
the brown kelp Ecklimia radiata (Laminariales: Phaeo- 
phyta) or in the fronds of the red foliose alga Delisea 
pulchra (Bonnemaisonales: Rhodophyta). A more detailed 
description of this habitat and the ecology of this system are 
found in Wright and Steinberg (2001 ) and Williamson el al. 
(2004). 

Preparation of the polar extract (/Delisea pulchra 

The results of Williamson el al. (2000) indicated that any 
settlement cues were contained within the polar fraction of 
the crude extract of D. pulchra. A polar extract of D. 
pulchra was thus prepared from 1 .0 kg (wet weight) of algae 
collected from Bare Island. Epibiota were removed, the 
plants blotted dry, and the thallus exhaustively extracted in 
methanol (OmniSolv. EM Science). The methanol extract 
was filtered (Whatman #1 ). dried by rotary evaporation ;';; 
vnciio at 40 C. and partitioned between dichloromethane 
(OmniSolv) and Milli-Q water. The Milli-Q phase was 
filtered (Whatman #1) and dried in racuo at 40 C. The 
dried crude polar extract was dissolved in absolute ethanol 



SETTLEMENT INDUCTION BY HISTAMINE 



163 



three times, pooling each extract, and dried in menu at 40 
C to yield the polar extract. 

Isolation of the settlement cue in Delisea pulchra by 
bioassay- guided fractionation 

High-performance liquid chromatography. The polar ex- 
tract of D. pulchra was fractionated using reversed-phase 
high-performance liquid chromatography (HPLC Adsor- 
bosil CIS column, 5-ju.m particle size, 250 mm X 4.6 mm, 
Waters R410 Rl-detector) (100% Milli-Q water at 1 
ml min ' ). The polar extract was dissolved in Milli-Q 
water (50 mg-ml" 1 ), filtered (0.22 /u,m). and manually 
injected (20 /u,l). HPLC resolved two major peaks, peak 1 
with a retention time (rt) of 2.7 min, and peak 2 with rt = 
3.4 min (Fig. 1A). Each peak fraction was collected from 
multiple injections and dried by rotary evaporation in vacua 
at 40 C. Peak fractions were tested for bioactivity in 



A - HPLC Polar extract 

50 rng-ml" 1 (MQ) 



Adsorbosll C18 column 
FR - 1 ml-min 1 (MQ) 



Peak 1 Peak 2 

(rt-2.7 min) (rt-3.4 min) 

I I 

NMR spectroscopy analysis & settlement assays 



B - CX Chromatography 



Polar extract 



200-40Q 

AG50W-X2 resin 
FR - 2 ml-min 1 (MQ) 



mg-mr(MQ) 



MQ 


MO 


MQ 


NH 3 


NH 3 






pH-10 


3% 


30% 


F1 F2 F3 F4 F5 


I 


I 





NMR spectroscopy analysis & settlement assays 

Figure 1. Diagram of the bioassay-guided fractionation of the polar 
extract of Delisea pulchra, using either reversed-phase HPLC (A) or 
cation-exchange (CX) chromatography (B). MQ = Milli-Q water, FR = 
flow rate, rt = retention lime, F = fraction. 



settlement assays and analyzed by 'H- and l3 C-nuclear 
magnetic resonance (NMR) spectroscopy (Bruker DMX 
500). 

Cation-exchange chromatography. The settlement cue 
could not be isolated as a pure fraction using HPLC, so an 
alternative procedure, cation-exchange (CX) chromatogra- 
phy, was used to fractionate the polar extract of D. pulchra. 
CX resin (AG50W-X2 [H+ form], BioRad) in Milli-Q 
water was poured into a 50-ml burette, taking care to 
exclude air bubbles. The resin (25-ml bed volume) was 
equilibrated with Milli-Q water at 2 ml-min" 1 until the 
eluant was pH 5-6. The polar extract of D. pulchra (1-2 g) 
was dissolved in 5 ml of Milli-Q water, filtered (0.22 ju,m), 
and gently loaded onto the column. Unbound compounds 
were collected in 100 ml of Milli-Q water (fraction 1) and 
another 100 ml of Milli-Q water (fraction 2). Retained 
compounds were eluted using a series of basic solutions: 30 
ml of dilute NH, in Milli-Q water (pH 10; fraction 3), 30 ml 
of 3%-NH 4 OH w/w (fraction 4), and 30 ml of 30%-NH 4 OH 
w/w (fraction 5, Fig. IB). Fractions 1-5 were collected as 
controls, using the same method but without loading any D. 
pulchra extract on the column; none of these fractions had 
any subsequent activity. CX-fractions were dried in a cen- 
trifuge in vacua (speed- vac SVC200, Savant), tested for 
bioactivity in settlement assays, and analyzed by 'H-NMR 
spectroscopy. 

Identification of isolated settlement cue 

Nuclear magnetic resonance spectroscopy. Bioassay- 
guided fractionation of the polar extract of D. pulchra by 
cation-exchange chromatography yielded one active frac- 
tion (CX-fraction 5, F5). The inducing compound in F5 was 
identified by 'H and I3 C-NMR experiments (D 2 O), and a 
high-field two-dimensional 'H-' ? N HMBC NMR experi- 
ment (d 4 MeOH, Bruker DMX 500). To confirm the puta- 
tive structure of F5 as histamine, 3 mg of F5 was dissolved 
in D,O and analysed by 'H-NMR spectroscopy. Synthetic 
histamine (3 mg) was added to F5 and the sample re- 
analysed. The 'H-NMR spectra of the unspiked F5 sample 
and the spiked F5 sample were then compared. 

Gas chromatography-mass spectrometry. NMR spectros- 
copy analyses identified the isolated settlement cue as his- 
tamine, and this was confirmed by gas chromatography- 
mass spectrometry (GC-MS). Putative (naturally isolated) 
histamine (1 mg) and synthetic histamine (1 mg) were 
derivatized with heptafluorobutyric anhydride (Aldrich) and 
then acetic anhydride (Aldrich), using the method of Baran- 
cin et al. (1998). Derivatized samples were diluted 100-fold 
in ethyl acetate before analysis. A Zebron ZB-5 column (15 
in. 0.25 /o,m X 0.25 mm ID; Phenomenex) was used on a 



164 



R. L. SWANSON ET AL. 



Hewlett Packard (HP) 5980 series II gas chromatograph 
equipped with an HP5971A or HP5972 mass selective de- 
tector. Injections (2 jul) were in the splitless mode with an 
inlet pressure of 170 kPa. The injection port was held as 290 
C and the interface at 300 C. The gas chromatograph was 
held at 90 C for 2 min and ramped at 10 C min~ ' to 200 
C, then at 50 C min" ' to 3 10 C and held for 2 min (17.2 
min per run). Helium was used as the carrier gas. The mass 
selective detector was operated in scan mode (ni/- 50-550). 
The average retention times of derivatized putative hista- 
mine and derivatized synthetic histamine were recorded 
from five injections of each sample (mean SD, n = 5). 
The electron impact ion-spectra of derivatized putative his- 
tamine and derivatized synthetic histamine were compared. 

Matrix-assisted laser desorption/ionization-time-of- flight 
mass spectrometry. The elemental formula of putative his- 
tamine was determined by matrix-assisted laser desorption/ 
ionization-time-of-flight mass spectrometry (MALDI-TOF 
MS) (Bucknall et al., 2002). A Perseptive Voyager DE STR 
(Perseptive Biosystems, Framingham, MA) MALDI-TOF 
MS was operated in both positive-ion linear delayed-extrac- 
tion mode and reflector delayed-extraction mode for accu- 
rate mass analysis. The test samples were prepared in ace- 
tonitrile/Milli-Q water (50:50) and contained either 100 
ng'/Lil" 1 of putative histamine or synthetic histamine. 
a-Cyano-4-hydroxycinnamic acid (5 mg ml" ' ) prepared in 
acetonitrile/Milli-Q/trifluoroacetic acid (80:20:0.02) was 
used as the matrix. Glycine (500 ng jaP 1 ) and [sarcosine- 
l5 N-methyl-d-,]creatinine HC1 (5 ng /uF '. Cambridge 
Isotope Laboratories #DNLM-2171 ) were added as internal 
mass calibrants for accurate mass determinations. An accu- 
rate mass for the putative protonated histamine molecular 
ion [M + H] + was determined by 10 repeat analyses of each 
sample. The mean molecular weight was calculated for 
these mass spectra and compared with both the theoretical 
molecular weight for histamine and the molecular weight 
measured for synthetic histamine using the same analytical 
technique. The standard deviation for these mass measure- 
ments was taken as an estimate of the mass measurement 
error. 

Settlement assa\s 

H. inirpitrascens larvae were cultured as previously de- 
scribed (Williamson ct al., 2000). Larvae reached compe- 
tency (i.e., become developmentally ready for settlement) 
within 6 days, as recognized by the presence of five well- 
developed tube feet. All settlement assays were done at l e J 
"C with a 12-h-light/12-h-dark regime, in 40-mni petri 
dishes and 5 ml of sterile seawater (SSW). Replicates were 
randomly assigned among treatments, with 10-15 replicates 
per treatment and one 6-day larva per replicate dish. We 
were unable to use multiple larvae per dish in these assays 



because this species is a "dribble" spawner and generally 
yields low numbers of larvae (settlement is not gregarious; 
Williamson et al., 2000). Larvae were added once all petri 
dishes were prepared, and percent settlement (i.e., percent 
metamorphosed) was recorded at set time intervals. 

HPLC peak fractions. Peak 1 and peak 2 fractions were 
tested against larvae to determine the presence of a settle- 
ment cue. Peak fractions were dissolved in Milli-Q water 
(10 ing -ml" 1 stock solution) and aliquots of each stock 
solution were added to assigned petri dishes for final test 
concentrations of 25 ju,g ml~' of peak 1 and 51 jug ml ' 
of peak 2. A floridoside-isethionic complex sample ("F-I 
complex") from the previous study (Williamson et al.. 
2000) was also tested in the assay at a final concentration of 
76 /tig-mi" 1 . Pieces of fresh D. pulchra ( 10 mg) were 
used as a positive control, and Milli-Q water and SSW were 
used as the negative controls. Percent settlement was scored 
after 18 h (/; = 12 replicates per treatment). 

Cation-exchange fractions. Each CX-fraction (F) was tested 
against larvae to determine the presence of a settlement cue. 
Fl. F2, F3, F4 and the polar extract of D. pulchra (used as 
a positive control) were dissolved in Milli-Q water at 5 
mg ml" 1 . Aliquots of the appropriate fraction were added 
to the petri dish to give final test concentrations of 50 
jitg-ml" 1 for each treatment. F5 was dissolved in Milli-Q 
water at 100 /xg ml~ ', and aliquots were added to assigned 
petri dishes for final test concentrations of 0.1-1.0 
jLig-ml ' (much lower concentrations of F5 were tested 
because of a low yield in F5). Initial settlement assays 
showed that only F5 induced settlement: therefore, CX- 
control-fraction 5 (CF5) was tested in future settlement 
assays as the procedural control. CF5 was dissolved in 
Milli-Q water at 100 jug ml ' and tested at 1.0 ^ig ' ml" 1 . 
Milli-Q water and SSW were used as the negative controls. 
Percent settlement was scored after 1 h (n - 10 replicates 
per treatment). 

Natural versus synthetic histamine. Settlement assays were 
used to compare the responses of larvae to (i) natural 
histamine isolated using CX chromatography. (ii) synthetic 
histamine, and (iii) synthetic histamine run through the 
same procedure used to isolate natural histamine. Stock 
solutions of 900 /LtM of each histamine treatment were 
prepared in Milli-Q water, and aliquots of the appropriate 
stock solution added to assigned petri dishes for final test 
concentrations of 0.9-9.0 /nM. Pieces of fresh D. pulchra 
( -- 10 mg) and 50 jug ml ' of the polar extract D. pulchra 
were used as the positive controls, and Milli-Q water and 
SSW were used as the negative controls. Percent settlement 
was scored after 1 h (;; = 12 replicates per treatment I. 



SETTLEMENT INDUCTION BY HISTAMINE 



165 



Delisea pulchra treated with antibacterial agents. Because 
some marine bacteria produce histamine (Fujii et al., 1997). 
the identification of histamine as the settlement cue (see 
Results) raises the possibility that the bacterial biofilm on 
the surface of D. pulchra may be the source of the cue. To 
test this, the ability of D. pulchra to induce settlement after 
various antibacterial treatments was examined in a settle- 
ment assay. Antibacterial treatments were adapted from 
previous studies in which treatments were shown to be 
effective in reducing surface bacteria (Xue-Wu and Gordon, 
1987; Aguirre-Lipperheide and Evans, 1993; Johnson and 
Sutton, 1994). Seven plants of D. pulchra were collected 
from Bare Island and brought back to the laboratory, where 
portions of each plant were allocated to each of seven 
treatments. There were six antibacterial treatments and a 
procedural control. All antibacterial treatments included a 
5-min soak in a 10% betadine-SSW solution, followed by 
three rinses in SSW and a 24-h treatment in either ( 1 ) SSW 
(the "soak" treatment); (2) SSW containing 20 mg 1~ ' 
streptomycin (Aldrich), 10 mg-F 1 penicillin G (Aldrich), 
and 10 mg -I" 1 kanamycin (Aldrich; "SPK" treatment); (3) 
SSW containing 10 mg-l~' ciprofloxacin (Bayer, "cipro- 
floxacin" treatment); (4) SSW after pieces of D. pulchra 
were gently wiped across an agar plate, before and after the 
24-h soak, to physically remove bacteria ("wipe" treat- 
ment); and the combination treatments (5) "wipe + SPK". 
and (6) "wipe + ciprofloxacin." The procedural control was 
a 24-h soak in SSW without the initial betadine soak ("soak 
control" treatment). The next day. subsections of several D. 
pulchra plants were collected as a "fresh control" treatment 
and used in the settlement assay on that day. Pieces of D. 
pulchra ( 10 mg) from each treatment were added to 
assigned sterile petri dishes, and percent settlement was 
scored after 20 h (n = 15 replicates per treatment). 

Quantitative analysis of histamine in various algae 

If histamine is a natural settlement cue for this urchin, we 
would expect D. pulchra, the primary host plant of new 
recruits of H. purpurascens, to have higher levels of hista- 
mine than other algae in the habitat. To test this, we quan- 
tified the histamine content of six species of algae from the 
habitat of//, purpurascens. The two primary host plants (D. 
pulchra and E. radiata) and four other prominent species of 
algae (Amphiroa anceps, Corallina officinulis. Homeostri- 
chus olsenii, and Sargassum vestitum) were collected from 
Bare Island in January 2003. Five replicates of each alga 
were analyzed, with each replicate consisting of three small 
sections taken from different parts of one thallus, which 
were then pooled into a single sample for analysis (2-4 g 
wet-weight). A polar extract of each algal sample was 
prepared as described above. Polar extracts were dissolved 
in Milli-Q water (200 /id) and acidified with 50 /id of glacial 
acetic acid, [a, a, J3, j3-d 4 ]Histamine 2HCI (1 jug. Cam- 



bridge Isotope Laboratories. #DLM 2911) was added to 
each sample as the internal standard (ISTD). Strong cation- 
exchange solid-phase extraction cartridges (50 mg, Alltech) 
were equilibrated with Milli-Q water (5 ml) at a flow rate of 
1 ml min" 1 , and the sample was loaded. Unbound com- 
pounds were eluted in 2 ml of Milli-Q water (fraction 1 ) and 
another 2 ml of Milli-Q water (fraction 2). All retained 
compounds were eluted in 1 ml of 30% NH 4 OH w/w 
(fraction 3) and dried in a speed vac. Standards that con- 
tained l-jug ISTD and cither O.I, 0.5, 1.0, 5.0, or 10 jug of 
synthetic histamine were prepared. Standards and fraction 3 
samples were derivatized with heptafluorobutyric anhydride 
and acetic anhydride using the method of Barancin et al. 
(1998). 

A DB-5MS column (15 m. 0.25 /im < 0.25 mm ID, J & 
W Scientific) and a packed liner (3% SP-2250, Supelco; 
Smythe et al.. 2002) were installed on the GC-MS instru- 
ment previously described, and the same run conditions 
were used. The mass selective detector was operated in 
selected ion monitoring mode using ions characteristic of 
the analyte (derivatized histamine in/- 94, 307, 349) and 
the ISTD (HI/- 97. 311. 353). Extracted ion chromatograms 
were used to manually integrate the area under each ion 
peak (which is proportional to the amount of analyte in the 
sample). For each standard and sample, the areas of the 
analyte ions (in/z 94, 307, 349) were added together and the 
areas of the ISTD ions (in/:. 97, 311. 353) were added 
together. The ratio of the combined areas of analyte:ISTD in 
standards was used to generate a standard curve. The his- 
tamine content of the samples was calculated by reference 
to the standard curve and expressed in terms of micrograms 
per gram (wet weight) of algal tissue (jttg g : ). 

After checking that the data met the assumptions of the 
test, the histamine content of different algae was trans- 
formed [ln(.v + 1 )] and compared by using a one-factor 
analysis of variance. We excluded A. anceps and C. offici- 
nalis from the analysis because no histamine was detected 
in these species. Bonferroni's post hoc test was used to 
determine which species differed in their histamine contents 
(SYSTAT ver. 7.0). We were concerned that one high value 
for D. pulchra might be unduly influencing our analysis, but 
the outcome was unchanged when we repeated the analysis 
with this value omitted. Therefore, we report the results of 
the initial analysis. 

Reanalvsis of samples from Williamson et al. (2000) 

Samples remaining from the study published in William- 
son et al. (2000) were analyzed by GC-MS for the presence 
of histamine. Any histamine in the old samples was isolated 
using cation-exchange solid phase extraction cartridges, as 
outlined previously tor isolating algal histamine. and then 
derivatized with heptafluorobutyric anhydride and acetic 
anhydride, using the method of Barancin et til. ( 1998) for 
quantitative GC-MS analysis. 



166 



R. L. SWANSON ET AL. 



Results 

Isolation of the settlement cue in Delisea pulchra by 
bioassay- guided fractionation 

HPLC fractions NMR spectroscopy analysis and settle- 
ment assays. The polar extract of Delisea pulchra was 
separated into two fractions using HPLC (peak 1 and peak 
2, Fig. 1A). These were analyzed by NMR spectroscopy 
(1-min 'H- and 30-min 13 C-NMR experiments) and tested 
in settlement assays. Peak 1 displayed the pattern of isethio- 
nic acid (Barrow et al.. 1993), as determined by 'H- and 
13 C-NMR spectroscopy, as well as some additional signals 
that were not characteristic of floridoside (see next section). 
The 13 C-NMR spectrum of peak 2 corresponded to previ- 
ously published data for floridoside [cv-D-galactopyranosyl- 
( l-2)-glycerol] (Karsten et al., 1993). Therefore, the isethio- 
nic acid and floridoside components of the F-I complex 
eluted separately, in peak 1 and peak 2, respectively. Peak 
1 induced settlement of Holopneustes purpurascens larvae 
in settlement assays, but peak 2 did not (Fig. 2). Four 
batches of peak 1 (25 jug ml" 1 ) induced 80%-100% set- 
tlement in five assays, whereas neither of two batches of 
peak 2 (51 jug-mi"') induced settlement in two assays 
(representative data shown in Fig. 2). These data suggested 
that the F-I complex is not a settlement cue for H. purpura- 
scens and that peak 1 (which lacked rloridoside) contained 
the settlement cue. 

Isethionic acid and taurine were the major compounds in 
peak 1. as determined by 'H- and I3 C-NMR spectroscopy 



100-i 



c 75- 



50- 




25- 



treatment 

Figure 2. The settlement (%) of larvae of Holopneustes purpurascens 
after 1 8 h incubation with fresh Delisea pulchra (~ 10 mg) or HPLC peak 
fractions of the polar extract of the alga. Peak 1 (batch A or B) was tested 
at 25 jig -ml"', peak 2 was tested at 51 /ig-mP 1 . and a floridoside- 
iselhionie acid complex sample ("F-I complex") from Williamson a ul. 
i2ii()(ii \\;is tested at 76 ng-ml"'. Milli-Q water and sterile seawater 
(SSW) were included as the nesiatne controls i/j = 10). 



and comparison with synthetic samples. When isethionic 
acid (1-25 jug-mi" 1 ), sodium isethionate (15-30 
jug-mF 1 ), and taurine (1-13 /xg-mP 1 ) were tested in 
settlement assays with H. purpurascens larvae, none of 
these compounds induced settlement (data not shown). Dif- 
ferent combinations of these compounds were tested to- 
gether (e.g., 15 jug ml" 1 of isethionic acid and taurine) in 
case two cues were required for settlement of H. purpura- 
scens. There was no settlement in the combination treat- 
ments (data not shown). Following these results, we hypoth- 
esized that one or more trace compounds in peak 1, not yet 
detected by NMR analysis, were inducing settlement. To 
test this, a larger amount of peak 1 was collected and a much 
longer (24-h) 13 C-NMR experiment run on the sample. The 
I3 C-NMR spectrum showed about 20 additional carbon 
signals not detected previously by NMR spectroscopy. in- 
dicating that additional compounds were present in peak 1 
in trace amounts. The rinding that peak 1 induced settlement 
of larvae of H. purpurascens but the identified major com- 
ponents (isethionic acid, taurine) in peak 1 did not implied 
that one of the compounds present in trace amounts was the 
settlement cue. 

Cation-exchange fractions settlement assav. The settle- 
ment cue could not be isolated as a pure fraction using 
HPLC, so the polar extract of D. pulchra was fractionated 
using CX chromatography (Fig. IB). Five CX-fractions (F) 
were obtained and tested in settlement assays; only F5 
induced settlement of larvae of H. purpurascens (Fig. 3). F5 
at a concentration of 1.0 jug -ml" 1 induced 100% settle- 
ment in larvae after 1 h, 0.5 jug mF ' induced 70% settle- 
ment, and 0.1-0.25 jug -ml"' did not induce settlement. 
There was no settlement in the control fraction CF5 ( 1 .0 
jug ml" 1 ) and SSW treatments (Fig. 3). 

Identification of the settlement cue for Holopneustes 
purpurascens 

Nuclear magnetic resonance spectroscopy. The 'H-NMR 
(D,O) spectrum of F5 showed proton signals at 8 2.76 (2H, 
t, J 7.0 Hz, H2). 3.03 (2H, t, J 8.2 Hz, HI). 6.86(1 H. s 2H, 
imida/.ole H), and 7.57 (s. 1H, imidazole H). The I3 C-NMR 
(D 2 O) and DEPT spectra of F5 showed carbon signals at 8 
25.9, 39.5 (CH : ); 1 16.4, 136.5 (CH) and 134.0 (quaternary 
C). These signals supported the assignment of F5 as hista- 
mine (2-[ l//-imidazol-4-yl]-ethylamine, MW 1 I 1.15). The 
structure of F5 was further confirmed by a high-field two- 
dimensional ! H- 15 N HMBC NMR experiment in which the 
methylene triplet at 2.76 ppm showed two three-bond cor- 
relations to the ethylamine NH^ group and the imidazole 
nitrogen. The identity of F5 was further confirmed by a 
spiking experiment. All F5 signals increased in intensity 
and no additional signals were detected, confirming the 
identity of F5 as histamine. 



SETTLEMENT INDUCTION BY HISTAMINH 



167 



100 -i 



c 75- 



50- 



8. 25- 




o o o o o o in 



p* o 



treatment 

Figure 3. The settlement (%) of larvae of Holopneustes fiiirpiinisci'm, 
after I h incubation with the polar extract of Delisea pulchra (PE) and 
cation-exchange fractions (F) of the PE. The different test concentrations of 
each treatment are shown in brackets (/xg mP 1 ): note the lower concen- 
trations for F5 and the procedural control (CF5). Sterile seawater (SSW) 
was used as the negative control (n = 10). 



Gas chromatographymass spectrometry. The identity of 
putative histamine (F5) isolated from D. pulchra was con- 
firmed using GC-MS. The retention times (rt) of the hep- 
tafluorobutyrlacyl derivative of putative histamine (rt = 
9.728 0.0045. mean SD. /; = 5) and synthetic hista- 
mine (rt = 9.732 0.0045. mean SD. n = 5) were nearly 
identical, suggesting that they were the same compound. 
The electron-impact ion spectra of both derivatized com- 
pounds displayed the same major fragment ions (m/- 54. 
69. 81, 94. 138. 169. 226. 307. 349) and overall fragmen- 
tation pattern, confirming that they were the same com- 
pound. The electron-impact ion spectra for derivatized his- 
tamine matched that reported in the literature (Barancin ct 
a!.. 1998). 

Matrix-assisted laser desorptlon/ionizationtime-of-flight 

mass spectnunetry. The elemental formula of putative his- 
tamine isolated from D. pulchra was confirmed by accurate 
mass measurements using MALDI-TOF MS. The measured 
accurate mass of the putative protonated histamine molec- 
ular ion [M + H] + was 112.08878 0.0026 (n = 10, mean 
SD), and the measured mass for synthetic histamine was 
1 12.08853 0.0025 (n = 10. mean SD). The measured 
masses of the two samples were different by only 2.2 ppm. 
These values were different from the calculated monoiso- 
topic mass for protonated histamine (112.08692 elemen- 
tal formula C_ S H H) N 3 ) by only 15 ppm for synthetic proton- 
ated histamine and 17 ppm for putative protonated 
histamine. This is most likely due to measurement bias 
introduced by the very different chemical properties of 
histamine, glycine, and creatinine (the internal calibrants). 
An elemental calculator was used to generate all possible 



elemental formulas with a mass of approximately 
112.08878. The nearest other candidate was C 6 H, NO at 
1 12.07569 with a difference of 1 17 ppm from the measured 
mass of putative protonated histamine. This difference was 
much higher than 17 ppm (difference of measured mass for 
putative histamine relative to calculated mass for C 5 H] N 3 ), 
confirming that the putative protonated histamine had the 
elemental formula of C 5 H|,,N V 

The response of Holopneustes purpurascens lamie to 
natural and synthetic histamine 

Natural histamine isolated from D. pulchra by using CX 
chromatography. synthetic histamine, and synthetic hista- 
mine eluted from CX resin all resulted in very similar 
responses in larvae when assayed concurrently (Fig. 4). 
More than 80% of the H. purpurascens larvae settled within 
an hour of incubation in 4.5 and 9 \iM natural and synthetic 
histamine. The lowest test concentration of synthetic hista- 
mine that consistently induced rapid settlement of all larvae 
was 4.5 \jM (in 10 separate assays). Larvae exhibited a 
more variable response to 0.9 and 2.3 juA/ histamine, both 
within and across different batches (Fig. 4). Up to 80% of 
larvae settled in response to 0.09-0.45 juM synthetic hista- 
mine. but only after long incubation times (up to 96 h) or as 
larval age increased to 13-21 days (data not shown). 

Response of lan'ae to Delisea pulchra after antibacterial 
treatments 

In response to D. pulchra that had received antibacterial 
treatments, larvae of H. purpurascens settled at levels 
equivalent to (or greater than) those in response to control 



0) 
_0) 

e 
o 



100 -i 


-i 


-i 


i n 


- - 








n 






75- 












50- 1 














25- 


i|. 






, 

~ 


j 




-^ 
O 


~^ 
LU O> CO 


in 


-* i 

o c 


D CO U 


1 ^ T 

t O O) CO 


I 1 

no > 


^- o cvi * ci ooi^oi ocvi^oi (/) 


(/> 


Nat (u/W) Syn (u/M) Syn-CX (n/W) 


treatment 



Figure 4. The settlement (%} of larvae of Holopneustes purpurascens 
after 1 h incubation with fresh Delisea pulchra (~ 10 mg). its polar extract 
(50 /ig-ml" 1 ) and 0.9-9.0 /j,Af of natural histamine isolated from D. 
pulchra (Nat), synthetic histamine (Syn). or synthetic histamine eluted 
from cation-exchange resin (Syn-CX). Sterile seawater (SSW) was used as 
a negative control. Data from two experiments using different batches of 
larvae are shown (black and white bars). * Indicates no settlement in 
treatment (n = 12). 



168 



R. L. SWANSON ET AL. 



Table 1 

The histamine content of six algal species was significantly different 
(ANOVA. F,. M = 9.903. P = 0.0006) 



Species 



Histamine (/ig g ' [ww]) 
mean SE. n 5 



Delisea pulchra 
Ecklonia radiata 
Sargassitm vestintin 
Homeostrichus olsenii 
Coral/ina officinalis 
Amplnroa anceps 



11.82 6.56 
1.28 1.01* 
0.35 0.32* 
0.25 0.09* 

nd 

nd 



D. pulchra treatments (Fig. 5). SSW did not induce settle- 
ment. 

Quantitative analvsis of histamine content in algae 

The histamine content of six algal species was deter- 
mined by GC-MS (Table 1). D. pulchra, the alga on which 
new recruits of H. purpurascens are found (Williamson et 
ai. 2000), had the highest histamine content of all algae 
surveyed. Histamine was not detected in any samples of 
Amphiroa anceps or Corallina officinalis. The histamine 
content of D. pulchra. Ecklonia radiata. Homeostrichus 
olsenii, and Sargassum vestitum differed significantly from 
each other (F 3 16 = 9.903, P = 0.0006). Pairwise compar- 
isons showed that the histamine content of D. pulchra 
(11.82 6.56 /itg-g" 1 ) was significantly higher than the 
histamine content of E. radiata (1.28 1.01 jug g" 1 , P = 
0.0092), S. vestitum (0.35 0.32 jug-g"', P = 0.0016), 
and H. olsenii (0.25 0.09 /u.g-g~', P = 0.0015). The 
amount of histamine in different D. pulchra plants was 
highly variable, ranging from 1.88-34.22 fig-g" 1 wet 
weight of algal tissue. The variability in histamine levels of 

E. radiata was also high, with no histamine detected in two 

samples, yet another contained 4.73 jug g"' wet weight of Reanalysis of samples from Williamson et al. (2000) 



* Indicates species in which histamine content differs significantly from 
D. pulchra (pairwise comparisons, P < 0.0092); nd, not detected; ww, wet 
weight. 



of the S. vestitum samples analyzed, but another contained 
1.48 ju.g-g~' wet weight of algal tissue. The H. olsenii 
plants analyzed showed consistently low levels of hista- 
mine, ranging from 0.05-0.46 /ng-g" 1 (wet weight) of 

algal tissue. 



algal tissue. Likewise, histamine was not detected in three 



100 n 



E 75- 



r 50- 




25- 



QO-S 

CCSlLaTjSQ. 



Q. '= 

o s 



treatment 



Figure 5. The settlement C7t ) of larvae of HolopneuMc-, purpiinm. I'm 
after 20 h incubation with Delixea pulchra subjected to antibacterial 
treatments. All antibacterial treatments included a 5-min soak in a 10'i 
betadme solution, followed by 3 rinses in sterile seawater (SSW) and a 
24-h treatment in either SSW ("soak"); SSW containing streptomycin (20 
mg- 1 '). penicillin G ( 10 mg 1~ ') and kanamycin I 10 mg 1~', "SPK"); 
or SSW containing ciprotloxacm (10 mg'l ', "ciprorloxacin"). Other 
treatments involved wiping pieces of D. pulchra across an agar plate 
gently, to physically remove bacteria, before and after a 24-h soak in SSW 
("wipe"), SSW containing SPK ("wipe + SPK"). or SSW containing 
ciprorloxacin ( 10 mg 1~ '. "wipe + cipro"). D. pnlt hid soaked in SSW for 
24 h (without betadine soak) uas the procedural control ("soak control"), 
fresh D. pulchra was used as a posttiu- control rtiesh control"), and SSW 
was used as a negative control (n = 15). 



Several samples remaining from the previous study were 
analyzed by GC-MS for the presence of histamine. Hista- 
mine was detected in F-I complex fractions from D. pulchra 
(1.5-46 ^ig mg [sample]"') in a synthetic F-I complex 
sample (0.35 jug mg [sample]"'), and in a batch of flori- 
doside used to make the synthetic complexes (0.45 jug mg 
[sample]"'). 



Discussion 

Habitat-specific cues play an important role in the settle- 
ment of many benthic marine invertebrates (Pawlik, 1992; 
Hadfield and Paul, 2001). Larvae presumably maximize 
their chances of post-settlement survival by responding to 
habitat-specific cues, as settlement in a preferred habitat 
should provide shelter and food to the vulnerable juvenile 
life-history phase (Gosselin and Qian, 1997). Chemical cues 
for larval settlement are derived from conspecifics (Burke. 
1986), host organisms (Williamson et ai. 2000). prey (Had- 
field and Scheuer, 1985), or biotilms (Wieczorek and Todd. 
1998); they include a diverse range of compounds from 
small peptides (Zimmer-Faust and Tamburri. 1994) to com- 
plex macromolecules (Clare and Matsumura. 2000). The 
complete characterization of chemical settlement cues has, 
however, proved difficult because of the low endogenous or 
environmental levels of such compounds and the rapid 
dilution of water-soluble cues. Few studies have definitively 
characterized settlement cues (reviewed by Hadfield and 
Paul. 2001; Steinberg et al.. 2001 ). 

Williamson et al. (2000) reported on one such putative 



SETTLEMENT INDUCTION BY HISTAMINE 



169 



characterized cue, a metabolite complex isolated from the 
red algal host Delisea pulchra that induced settlement in 
larvae of the sea urchin Holopneustes purpurascens. At 
Bare Island (Sydney, Australia). H. purpurascens is found 
primarily on two algal hosts, D. pulchra and Ecklonia 
radiata. with the smallest size class (test diameter s 5 mm) 
only found on D. pulchra. Larvae metamorphosed in re- 
sponse to pieces of D. pulchra and the polar extract, but not 
to pieces or extracts of E. radiata (Williamson et til., 2000). 
A water-soluble cue was implicated when seawater col- 
lected near D. pulchra plants in situ also induced settlement 
of larvae. The settlement cue in D. pulchra was isolated and 
characterized as the floridoside-isethionic acid (F-I) com- 
plex (Williamson et ai, 2000). 

New evidence presented in this paper shows that hista- 
mine, not the F-I complex, is a natural inducer of settlement 
in H. purpurascens. The settlement cue was isolated from 
the polar extract of D. pulchra by using bioassay-guided 
fractionation by cation-exchange chromatography. The iso- 
lated compound at 0.5 jug mP ' induced settlement in 
80%- 100% of larvae within an hour. The settlement cue 
was identified as histamine using NMR spectroscopy. and 
this was confirmed by GC-MS and MALDI-TOF MS. The 
response of larvae to synthetic histamine in settlement as- 
says mirrored their response to natural histamine isolated 
from D. pulchra. D. pulchra, the primary plant on which 
new recruits of H. purpurascens are found, had the highest 
average histamine content (11.82 6.56 /Ag-g~' wet 
weight), approximately an order of magnitude higher than 
other algae surveyed. Seawater collected near D. pulchra 
plants in the study by Williamson et al. (2000) induced 
rapid settlement of larval H. purpurascens; however, those 
samples were used completely in bioassays and are there- 
fore not available for histamine analysis. We have since 
detected histamine in seawater surrounding D. pulchra and 
E. radiata (at concentrations ranging from 20 to 70 nM), but 
not in samples 2 m away from the macroalgae. A compre- 
hensive analysis of histamine levels in seawater will be 
reported in another manuscript. Although the histamine 
concentrations measured in seawater do not induce rapid 
settlement in larvae that have just attained competence, this 
concentration can induce settlement of H. purpurascens 
larvae over longer time periods and in older larvae (data not 
shown). In addition, the natural habitat may contain other 
settlement cues that if detected in conjunction with hista- 
mine. may lower the threshold concentration of histamine 
required for rapid induction of settlement. These findings 
support our proposal that histamine released from macroal- 
gae is a natural settlement cue for H. purpurascens. 

Reanalysis of samples from the study by Williamson el 
al. (2000) provides an explanation for the incorrect conclu- 
sion that the F-I complex is a settlement cue for larvae of H. 
purpurascens. The F-I complex was isolated from the polar 
extract of D. pulchra, using reversed-phase HPLC and 



methanol as the mobile phase, and eluted as a single peak 
(Williamson et al.. 2000). I3 C-NMR spectroscopy analysis 
of this peak showed only l3 C-signals for floridoside and 
isethionic acid (Williamson et al., 2000). However, trace 
amounts of histamine were also present but not detected, 
because their levels were below the limit of detection for 
I3 C-NMR spectroscopy. Histamine elutes in the first peak 
from reversed-phase (C18) columns regardless of the mo- 
bile phase, so any histamine in the polar extracts of D. 
pulchra used by Williamson et al. (2000) would have co- 
eluted with the F-I complex fraction. Consequently, the "F-I 
complex" samples contained histamine, detected here using 
GC-MS, and induced settlement of H. purpurascens larvae. 
Although a synthetic F-I complex induced rapid settlement 
in H. purpurascens larvae in the previous study (William- 
son et al., 2000), not all batches induced settlement (R. de 
Nys. pers. obs.). The synthetic F-I complexes were made 
using natural floridoside isolated from D. pulchra and syn- 
thetic isethionic acid. The floridoside used to make the 
synthetic F-I complex was contaminated by histamine and 
thus induced settlement. Confirming this, histamine was 
detected by GC-MS in a floridoside sample (used for prep- 
aration of the synthetic complex) and a synthetic F-I com- 
plex sample prepared by Williamson et al. (2000). In sum- 
mary, histamine was present in trace amounts in the "F-I 
complex" samples that induced settlement of larval H. pur- 
purascens in the previous study, and histamine was the 
inductive compound in the "F-I complex" samples. 

The finding that histamine is a natural settlement cue for 
H. purpurascens is of considerable interest in the context of 
linking ecological patterns with physiological mechanisms. 
Histamine is a biogenic amine produced by the decarbox- 
ylation of the amino acid histidine. It is one of five primary 
biogenic amines in invertebrates, along with serotonin, oc- 
topamine, dopamine, and tyramine (Blenau and Baumann, 
2001). Biogenic amines, all decarboxylation products of 
amino acids, play critical roles in initiating and controlling 
behavior, and in the physiology of invertebrates, by acting 
as classical neurotransmitters, neuromodulators, and neuro- 
hormones (Katz, 1995: Beltz, 1999). For example, dopa- 
mine activates hunting behavior in an opisthobranch mol- 
lusc (Norekyan and Satterlie, 1993), and serotonin controls 
aggressive behavior in crustaceans (Huber et al.. 1997). The 
photoreceptors in all classes of arthropod eyes are histamin- 
ergic; that is, they synthesize histamine and use it as their 
neurotransmitter (Stuart. 1999). Also, histamine is thought 
to be an inhibitory neurotransmitter in the stomatogastric 
and cardiac ganglia and the sensory system of lobsters 
(Claiborne and Selverston, 1984; Bayer et al., 1989; 
Hashemzadeh-Gargari and Freschi, 1992). Importantly, in 
the context of this study, histamine directly gates a chloride 
channel in the receptor cells of the olfactory pathway of 
lobsters (McClintock and Ache, 1989). Fast neurotransmit- 
ters directly gate ion channels, which leads to fast behav- 



170 



R. L SWANSON ET AL. 



ioral and physiological outcomes. We have observed that 
the settlement response of H. purpurascens to histamine is 
rapid, with complete metamorphosis within half an hour. 
This fast response is consistent with the notion that the 
larvae of H. purpurascens have specific receptors that bind 
histamine and act directly on ion channels, leading to rapid 
settlement. 

Neurotransmitters, or their precursors, have been sug- 
gested to mimic the function of natural settlement cues 
(Morse, 1985; Bonar et ai, 1990). The best-known example 
is the gamma-aminobutyric acid (GABA)-mimetic peptide 
(or peptides). present on the surface of crustose coralline 
algae, which Morse and colleagues proposed as a settlement 
cue for abalone (Morse et a!., 1979, 1984). Another exam- 
ple comes from oyster larvae, where L-3, 4-dihydroxyphe- 
nylalanine (L-DOPA) induced stereotypical searching be- 
havior, while epinephrine and norepinephrine induced 
metamorphosis (Coon et ai, 1985). Endogenous levels of 
neurotransmitters, and their precursors, also appear to mod- 
ulate the behavioral and physiological processes accompa- 
nying settlement (Coon and Bonar, 1987; Pires et ai. 2000). 
Our findings show that a naturally produced neurotransmit- 
ter is in fact a settlement cue for larvae, a phenomenon that 
may be widespread in the marine environment. 

The finding that histamine, rather than the F-I complex, is 
a settlement cue for H. purpurascens potentially compli- 
cates the previous interpretations of the relationship be- 
tween settlement cues and the demography of this sea 
urchin (Williamson et ai, 2000, 2004). Histamine, a simple 
breakdown product of the amino acid histidine, may be 
broadly distributed across the natural habitat of H. purpura- 
scens; for example, in algal and animal tissue, and in 
bacterial communities living on their surfaces. For hista- 
mine to be an ecologically relevant settlement cue, its dis- 
tribution in the natural habitat must relate to the recruitment 
patterns of H. purpurascens. This was in fact the case. The 
histamine content of the algae surveyed was consistent with 
the recruitment patterns of the organism, with much higher 
levels of histamine measured in D. pulchra, the primary 
plant on which we find new recruits. 

I), pulchra had the highest average histamine content 
(11.82 6.56 ju.g-g~' wet weight), ranging from 1.88 to 
34.22 ng.g [ wet weight. Similarly, levels of histamine 
varied for E. radiata, with concentrations ranging from to 
4.73 jug.g ' wet weight. Since only subsections of plants 
(not whole plants) were extracted, these results may reflect 
within-planl variation, within-species variation, or both. Fu- 
ture histamine analyses will extract whole plants, as well as 
specific regions of thalli, to directly test these possibilities. 
The low (or absent) levels of histamine typically measured 
in E. nuliiitci samples may explain why pieces and extracts 
of E. radiata did not induce settlement in the study by 
Williamson et ai (2000). However, we have observed that 
some pieces of E. radiata do induce settlement of H. pur- 



purascens, which is consistent with the variation we mea- 
sured in levels of histamine in the alga. Given this, and the 
large biomass of E. radiata kelp beds in the natural habitat 
of H. purpurascens. E. radiata may contribute to environ- 
mental levels of histamine, inducing the settlement of larvae 
in this habitat. Histamine was not detected in the turfing 
coralline algae Corallina officinalis and Ampliiroa anceps, 
although they induce settlement of larvae of H. purpura- 
scens (Williamson et ai, 2000; R. Swanson, pers. obs.) and 
provide a habitat for new recruits (R. Swanson, pers. obs.). 
Larger samples of A. anceps (up to 180 g wet weight) were 
extracted and no histamine was detected. The coralline 
algae may produce a different settlement cue for H. pur- 
purascens, or histamine may only be produced and released 
in situ for example, by surface-associated bacteria. 

Finally, the two possible sources of histamine in D. 
pulchra are the host alga or the surface-associated bacterial 
community (or both). D. pulchra treated with various anti- 
bacterial agents still induced high levels of settlement in H. 
purpurascens, suggesting that the host alga produces the 
histamine. A bacterial source of histamine is, however, 
possible, as a known histamine-producing bacterium. Plw- 
tobacterium phosphoreum (Fujii et ai. 1997) is a constitu- 
ent of the microbial community on local algal species (M. 
Watson, UNSW Australia; pers. comm.). If histamine-pro- 
ducing bacteria are colonizing algal surfaces within the 
habitat, then it is possible that they produce and release 
histamine to seawater, which could lead to the induction of 
settlement of H. purpurascens. 

Conclusion 

Many larval species have the ability to respond to low- 
molecular-weight, water-soluble settlement cues (Hadfield 
and Scheuer. 1985; Zimmer-Faust and Tamburri, 1994; 
Boettcher and Targett. 1996; Lambert et ai. 1997; Fleck 
and Fitt. 1999). This paper has presented evidence that 
histamine is a natural settlement cue for the sea urchin. H. 
purpurascens, correcting the previous study of Williamson 
et ai (2000). Histamine at 4.5 juA/ induces settlement (meta- 
morphosis) in 807r-100% of//, purpurascens larvae within 
half an hour, fulfilling two essential criteria for an effective 
water-soluble settlement cue: ( 1 ) larvae must perceive low 
concentrations of inducer. and (2) larvae must respond 
rapidly to the inducer. D. pulchra had the highest histamine 
content of all the species surveyed, consistent with the 
recruitment patterns of H. purpurascens. In a preliminary 
analysis, we detected histamine in seawater near D. pulchra 
and E. radiata plants, hut not in seawater collected 2 m 
away, supporting our proposal that histamine leaches from 
algae that produce this settlement cue. This hypothesis is 
consistent with the finding of Williamson et ai (2000) that 
seawater collected very near to D. pulchra induced settle- 
ment in larvae of H. purpurascens. We have shown that 



SETTLEMENT INDUCTION BY HISTAMINE 



171 



histamine, an invertebrate neurotransmitter, is also a natural 
settlement cue for larvae of H. purpurasccns, linking the 
physiology and ecology of the organism. 

Acknowledgments 

This research was supported by an Australian Postgrad- 
uate Award to RLS, an ARC Research Fellowship to RdN, 
an ARC Large Grant to PDS and RdN. and the Center for 
Marine Biofouling and Bio-Innovation. We thank the Bio- 
analytical Mass Spectrometry Facility at UNSW for access 
to equipment, and Dr. Dustin Marshall for advice on statis- 
tical analysis. We especially thank Dr. Tim Charlton for his 
invaluable assistance with analytical methods. 

Literature Cited 

Aguirre-Lipperheide, ,\1.. and L. V. Evans. 1993. A sterilization pro- 
tocol for the Dictyotales (Phaeophyceae). J. Pin-col. 29: 243-251. 

Barancin. C. E., J. C. Smoot, R.H. Kindla.v, and L. A. Actis. 1998. 
Plasmid-mediated histamine biosynthesis in the bacterial tish pathogen 
Vibrio angiti/lanim. PUismiil 39: 235-244. 

Barrow. K. D., U. Karsten, and R. J. King. 1993. Isethionic acid from 
the marine red alga Ceramium flaccidum. Phytochemislry 35: 1429- 
1430. 

Bayer, T. A., T. S. McClintock, U. Grunert, and B. W. Ache. 1989. 
Histamine-induced modulation of olfactory receptor neurons in two 
species of lobster, Panulirus argnx and Homanix amcricannx. J. Exp. 
Biol. 145: 133-146. 

Beltz, B. S. 1999. Distribution and functional anatomy of amine-contain- 
ing neurons in decapod crustaceans. Microsc. Res. Tech. 44: 105-120. 

Berntsson, K. M., P. R. Jonsson, M. Lejhall. and P. Gatenholm. 20(10. 
Analysis of behavioral rejection of micro-textured surfaces and impli- 
cations for recruitment by the barnacle Balanux improvixiix. J. Exp. 
Mar. Biol EC,,/. 251: 59-83. 

Blenau. W., and A. Baumann. 2001. Molecular and pharmacological 
properties of insect biogenic amine receptors: lessons from Drosophilu 
melangoster and Apis melliferu. Arch. Insect Biochem. Phvsiol. 48: 
13-38. 

Boettcher, A. A., and N. M. Target!. 1996. Induction of metamorphosis 
in queen conch, Strombus gigas Linnaeus, larvae by cues associated 
with red algae from their nursery grounds. J. Exp. Mar. Biol. Ecol. 196: 
29-52. 

Bonar, D. B.. S. L. Coon. M. \Valch, R. M. Weiner, and W. Fitt. 1990. 
Control of oyster settlement and metamorphosis by endogenous and 
exogenous chemical cues. Bull. Mar. Sci. 46: 484-498. 

Bucknall, M., K. Y. C. Yung, and M. W. Duncan. 2002. Practical 
quantitative biomedical applications of MALDI-TOF mass spectrom- 
etry. J. Am. Soc. Mass Spectrum. 13: 1015-1027. 

Burke, R. D. 1984. Pheromonal control of metamorphosis in the Pacific 
sand dollar. Denilraster excentriciix. Science 225: 440-441. 

Burke, R. I). 1986. Pheromones and the gregarious settlement of marine 
invertebrate larvae. Bull. Mar. Sci. 39: 323-331. 

Claiborne, B. J., and A. I. Selverston. 1984. Histamine as a neurotrans- 
mitter in the stomatogastric nervous system of the spiny lobster. J. Neu- 
rosci. 4: 708-721. 

Clare, A. S., and K. Matsumura. 2000. Nature and perception of 
barnacle settlement pheromones. Biofoiiling 15: 57-71. 

Coon, S. L., and D. B. Bonar. 1987. Pharmacological evidence that 
alpha- 1 adrenoceptors mediate metamorphosis of the Pacific oyster 
Crassostmi gigas. Neiiroscience 23: 1 169-1 174. 

Coon, S.L., D. B. Bonar, and R. M. Weiner. 1985. Induction of 



settlement and metamorphosis of the Pacific oyster Crasuixtrea gigax 
(Thunberg) by i.-DOPA and catecholamines. J. Exp. Mar. Biol. /.>/. 
94: 211-221. 

Fleck, J., and W. K. Fit!. 1999. Degrading mangrove leaves of Rlu;o- 
I'hora mangle Linne provide a natural cue for settlement and metamor- 
phosis of the upside down jellyfish Cuxxitipea \amacliana Bigelow. J. 
Exp. Mar. Biol. Ecol. 234: 83-94. 

Fujii, T., A. Hiraishi, T. Kohayashi. R. Yoguchi, and M. Okimimi. 
1997. Identification of the psychrophilic histamine-producing marine 
bacteria previously referred to as the N-group bacteria. Fish, Sci. 63(5): 
807-810. 

Gibson. G. D., and F.-S. Chia. 1994. A metamorphic inducer in the 
opisthobranch Hatninaca callidegenita: partial purification and biolog- 
ical activity. Bint. Hull. 187: 133-142. 

Gosselin, L. A., and P. Y. Qian. 1997. Can bacterivory alone sustain 
larval development in the polychaete Hydriodes elegans and the bar- 
nacle Baliunix anipliitritel Mar. Ecol. Prog. Ser. 161: 93-101. 

Hadfield. M. G.. and V. J. Paul. 2001. Natural chemical cues tor 
settlement and metamorphosis of marine invertebrate larvae. Pp. 431- 
461 in Marine Chemical Ecology. }. B. McClintock and B. J. Baker, 
cds. CRC Press, Boca Raton, FL. 

I hicllh Id. M. G., and J. T. Pennington. 1990. Nature of the metamor- 
phic signal and its internal iransduction in larvae of the nudihranch 
Pht-xtilla siboKiu: Bull. Mar. Sci. 46: 455-464. 

Hadh'eld, M. G., and D. Scheuer. 1985. Evidence for a soluble meta- 
morphic inducer in Phestilla sibogae: ecological, chemical and biolog- 
ical data. Bull. Mar. Sci. 37: 556-566. 

Harvey, M., and E. Bourget. 1997. Recruitment of marine invertebrates 
onto arborescent epibenthic structures: active and passive processes 
acting at different spatial scales. Mar. Ecol. Prog. Ser. 153: 203-215. 

Hashemzadeh-Gargari, R. M., and J. E. Freschi. 1992. Histamine 
activates a chloride conductance in motor neurons of the lobster cardiac 
ganglion. J. Neiirophvsiol. 68: 9-15. 

Huber, R., K. Smith, A. Delago, K. Isaksson. and E. A. Kravitz. 1997. 
Serotonin and aggressive motivation in crustaceans: altering the deci- 
sion to retreat. Proc. Nat/. Acini. Sci. LISA 94: 5939-5942. 

Johnson, C. R., and I). C. Sutton. 1994. Bacteria on the surface of 
crustose coralline algae induce metamorphosis of the crown-of-thorns 
starfish Acantluixter planci. Mar. Biol. 120: 305-310. 

Karsten, U.. K. D. Barrow, and R. J. King. 1993. Flondoside. 1 
isofloridoside. and D-isofloridoside in the red alga Porplivra colninhina. 
Plant Plnsiol. Biochem. 103: 485-491. 

Kato, T.. A. S. Kumanireng, I. Ichinose. Y. Kitahara, Y. Kakinuma. M. 
Nishihira, and M. Kato. 1975. Active components of Siirguxxiim 
tortile effecting the settlement of swimming larvae of Coryne iichiclai. 
Experientia 31: 433-434. 

Katz. P. S. 1995. Intrinsic and extrinsic neuromodulation of motor 
circuits. Curr. Opiii. Neurohiol. 5: 799-808. 

Keough, M. J., and B. J. Downes. 1982. Recruitment of marine inver- 
tebrates: the role of active larval choices and early motility. Oecologia 
54: 348-352. 

Krug, P. J., and A. E. Manzi. 1999. Waterborne and surface-associated 
carbohydrates as settlement cues for larvae of the specialist marine 
herbivore Akleria moilexta. Biol. Bull. 197: 94-103. 

Lambert, \V. J.. C. D. Todd. and J. D. Hardege. 1997. Partial char- 
acterization and biological activity of a metamorphic inducer of the 
dorid nudibranch AJalaria proxima (Gastropoda: Nudihranchia). In- 
vertebr. Biol. 116: 71-81. 

Maida, M., J. C. Coll, and P. W. Sanimami. 1994. Shedding new light 
on scleractinian coral recruitment. J. Exp. Mar. Biol. Ecol. 180: 189- 
202. 

McClintock, T. S., and B. W. Ache. 1989. Histamine directly gates a 
chloride channel in lobster olfactory receptor neurons. Pruc. Nat/. 
AcaJ. Sci. USA 86: 8137-8141. 



172 



R. L. SWANSON ET AL. 



Morse, A. N. C., and D. E. Morse. 1996. Flypapers for coral and other 
planktonic larvae. Bioscience 46(4): 254-262. 

Morse, A. N. C., C. A. Froyd, and D. E. Morse. 1984. Molecules from 
cyanobacteria and red algae that induce larval settlement and metamor- 
phosis in the mollusc Haliotis rufescens. Mar. Biol. 81: 293-298. 

Morse, D. E. 1985. Neurotransmitter-mimetic inducers of larval settle- 
ment and metamorphosis. Bull. Mar. Sci. 37: 697-706. 

Morse, D. E., N. Hooker. H. Duncan, and L. Jensen. 1979. Gamma- 
aminobutyric acid, a neurotransmitter. induces planktonic abalone lar- 
vae to settle and begin metamorphosis. Science 204: 407-410. 

Mullineaux. L. S., and C. A. Butman. 1991. Initial contact, exploration 
and attachment of barnacle (Balanus amphitrite) cyprids settling in 
flow. Mar. Biol. 110: 93-103. 

Norekyan, T. P., and R. Satterlie. 1993. Neuronal analysis of hunting 
behavior of the pteropod mollusc Clione limacina. Neurosci. Behav. 
Physiol. 23: 11-23. 

Pawlik. J. R. 1992. Chemical ecology of the settlement of benthic 
marine invertebrates. Oceanogr. Mar. Biol. Annu. Rev. 30: 273-335. 

Pires, A., R. P. Croll, and M. G. Hadfield. 2000. Catecholamines 
modulate metamorphosis in the opisthobranch gastropod Phestilla si- 
bogae. Biol. Bull. 198: 319-331. 

Raimondi, P. T., and A. N. C. Morse. 2000. The consequences of 
complex larval behavior in a coral. Ecology 81: 3193-321 1. 

Smythe, G. A., O. Braga, B. J. Brew, R. S. Grant, G. J. Guillemin, S. J. 
Kerr, and D. VV. Walker. 2002. Concurrent quantification of quin- 
olic. picolinic, and nicotinic acids using electron-capture negative-ion 
gas chromatography-mass spectrometry. Anal. Biochem. 301: 21-26. 

Steinberg, P. D., R. de Nys, and S. Kjelleberg. 2001. Chemical medi- 
ation of surface colonization. Pp. 335-387 in Marine Chemical Ecol- 
ogy, J. B. McClmtock and B. J. Baker, eds. CRC Press, Boca Raton. 
FL. 

Stuart, A. E. 1999. From fruit flies to barnacles, histamine is the neu- 
rotransmitter of arthropod photoreceptors. Neuron 22: 431-433. 

Tsukamoto, S., H. Kato, H. Hirota, and N. Fusetani. 1994. Narains: 
AW-dimethylguanidinium styryl sulfates, metamorphosis inducers of 
ascidian larvae from a marine sponge Jaspis sp. Tetrahedron Lett. 35: 
5873-5874. 



Tsukamoto. S., H. Kato, H. Hirota. and N. Fusetani. 1995. Pipecolate 
derivatives, anthosamines A and B. inducers of larval metamorphosis 
in ascidians. from a marine sponge Anthosigmella off. raromicrosc/era. 
Tetrahedron 51: 6687-6694. 

Tsukamoto, S., H. Kato, H. Hirota, and N. Fusetani. 1999. Lumi- 
chrome a larval metamorphosis-inducing substance in the ascidian 
Halocynthia roretzi. Ear. J. Biochem. 264: 785-789. 

Underwood, A. J., and M. J. Keough. 2000. Supply-side ecology: the 
nature and consequences of variations in recruitment of intertidal 
organisms. Pp. 183-200 in Marine Community Ecology, M. D. Bert- 
ness. S. D. Gaines. and M. E. Hay. eds. Sinauer Associates, Sunder- 
land. MA. 

Wieczorek, S. K., and C. D. Todd. 1998. Inhibition and facilitation of 
settlement of epifaunal marine invertebrate larvae by microbial biofilm 
cues. Biofouling 12: 81-118. 

Williamson, J. E., R. de Nys, N. Kumar, D. G. Carson, and P. D. 
Steinberg. 2000. Induction of metamorphosis in the sea urchin Ho- 
lopneustes purpurascens by a metabolite complex from the algal host 
Delisea pulchra. Biol. Bull. 198: 332-345. 

Williamson, J. E., D. G. Carson, R. de Nys, and P. D. Steinberg. 2004. 
Demographic consequences of an ontogenetic shift by a sea urchin in 
response to host plant chemistry. Ecology 85: 1355-1371. 

Wright, J. T.. and P. D. Steinberg. 2001. Effect of variable recruitment 
and post-recruitment herbivory on local abundance of a marine alga. 
Ecology K: 2200-2215. 

Xue-wu, L., and M. E. Gordon. 1987. Tissue and cell culture of the 
New Zealand Pterocladia and Porphyra species. Hydrobiologia 151: 
147-154. 

Yvin, J. C., L. Chevolet, A. M. Chevolet-Maguer, and J. C. Cochard. 
1985. First isolation of jacarone from an alga, Delesseria sanguinea: 
a metamorphosis inducer of Pecten larvae. J. Nat. Prod. 48: 814-816. 

Zimmer, R. K., and C. A. Butman. 2000. Chemical signaling processes 
in the marine environment. Biol. Bull. 198: 168-187. 

Zimmer-Faust, R. K., and M. N. Tamburri. 1994. Chemical identity 
and ecological implications of a waterborne. larval settlement cue. 
Limnol. Oceanogr. 39: 1075-1087. 



Reference: Bio/. Bull. 206: 173-187. (June 2004) 
2004 Marine Biological Laboratory 



Fitness Consequences of Allorecognition-Mediated 
Agonistic Interactions in the Colonial Hydroid 

Hydractinia [GM]* 

DAVID L. FERRELL 
Department of Biological Science. Florida State University, Tallahassee, Florida 32306-1 100 



Abstract. In sessile and sedentary organisms, competition 
for space may have fitness consequences that depend 
strongly on ecological context. Colonial hydroids in the 
genus H\dractinia use an inducible defense when encoun- 
tering conspecifics, and intraspecific competition is com- 
mon in natural populations, often resulting in complete 
overgrowth of subordinate competitors. My goal in this 
study was to quantify the impacts of agonistic interactions 
in Hydractinia [GM] (an undescribed species from the Gulf 
of Mexico) in terms of three primary fitness components: 
colony survival, growth rate, and immature gonozooid pro- 
duction. The results demonstrate that the fitness conse- 
quences of intraspecific competition depend on the size at 
which competitive encounters are initiated and the growth 
form (an indicator of competitive ability) of the competi- 
tors. Moreover, some competing colonies consistently pro- 
duced more immature gonozooids than the controls without 
competition, and they exhibited extremely low mortality 
even after 90 days of growth. These results have several 
ramifications. First, agonistic interactions do not always 
proceed to competitive elimination. Second, the increase in 
production of immature gonozooids an investment in fu- 
ture reproduction in response to intraspecific competition 
supports the hypothesis that indeterminately growing organ- 
isms increase sexual reproductive effort when growth be- 
comes limiting. Lastly, in light of known ontogenetic vari- 
ation in the ability of Hydractinia to differentiate among 



Received 20 August 2002; accepted 2 April 2004. 

* [GM] is the designation given by Cunningham ct al. (19911 to a 
species of Hydractinia that is found in the Gulf of Mexico hut has not been 
formally described. Reference: C. W. Cunningham. L. W. Buss, and C. 
Anderson. 1991. Molecular and geological evidence of shared history 
between hermit crabs and the symbiotic genus Hyilnu-liniti. Evolution 45: 
1301-1316. 

E-mail: ferrell@bio.fsu.edu 



genetically related colonies, strongly size-dependent fitness 
consequences are consistent with an adaptive, kin-discrim- 
inating allorecognition system. 

Introduction 

Competition for space often imposes limitations on the 
fitness of sessile and sedentary organisms when a scarcity of 
hard substrata limits survival, growth, and reproduction 
(Buss, 1986). Much effort has been dedicated to discerning 
the effects of spatial competition on these fitness compo- 
nents (reviewed in Jackson, 1977, 1985: Buss. 1986. 1990: 
Sebens, 1986). Direct competition for space can result in 
overgrowth (reviewed in Buss and Jackson, 1979) in both 
heterospecific and conspecific interactions. However, com- 
petitive exclusion through overgrowth (or other processes) 
is not inevitable; competitors may be restricted spatially but 
coexist, even on densely colonized surfaces (Francis, 1973; 
Purcell. 1977: Karlson. 1980; Yund et al., 1987). 

Spatially restricted coexistence ultimately limits the size 
of colonial invertebrates that might otherwise exhibit inde- 
terminate growth (Harvell and Grosberg, 1988). Because 
reproductive potential usually increases with colony size, 
size limits have the potential to impose reproductive costs. 
Consequently, many authors (Abrahamson. 1975: Hughes 
and Cancino, 1985; Harvell and Grosberg. 1988) have hy- 
pothesized that indeterminately growing clonal organisms 
should maximize fitness by increasing sexual allocation 
when extrinsic factors limit growth. This prediction has 
been supported by empirical data on diverse invertebrate 
taxa (Hauenschild, 1954; Braverman, 1974: Yamaguchi, 
1975; Stebbing. 1980: Harvell and Grosberg, 1988). 

In many colonial marine invertebrates (including 
sponges, cnidarians, bryozoans, and ascidians), conspecific 
interactions are mediated by allorecognition systems that 



173 



174 



D. L. FERRELL 



restrict somatic fusion to self or close kin, thereby limiting 
spatial competition and spatially restricted coexistence to 
unrelated individuals (Buss, 1987. 1990: Grosberg. 1988). 
For taxa in which encounters between relatives are common 
(often because of limited dispersal of sexually produced 
progeny), allorecognition may serve as an adaptive mecha- 
nism of kin recognition (Grosberg and Quinn. 1986; Hart 
and Grosberg, 1999). If intraspecific competition is associ- 
ated with extremely high costs, such as the energetic cost of 
agonistic behavior and the risk of injury or competitive 
exclusion (Buss el ai, 1984), then intergenotypic fusion 
may be favorable despite the potentially severe fitness costs 
associated with it (Buss, 1982, 1987; Rinkevich and Loya, 
1983; Barki et al.. 2002; Rinkevich. 2002). Conversely, if 
low costs accompany non-fusion, then fusion may be too 
costly an alternative. Thus, the fitness consequences of 
intraspecitic competitive encounters provide insight into 
whether the evolution of allorecognition systems is adap- 
tive. 

Colonial hydroids in the genus Hydractinia inhabit shells 
occupied by hermit crabs, where they often encounter con- 
specifics (Yund et ai, 1987; Buss and Yund. 1988; Yund 
and Parker, 1989; Hart and Grosberg, 1999; Ferrell, 2004). 
A genetically coded allorecognition system determines 
whether contacting colonies will fuse (Grosberg et ai, 
1996: Mokady and Buss, 1996) or attempt to overgrow one 
another (Ivker, 1972: Buss et ai, 1984). Here I present the 
results of laboratory experiments demonstrating that the 
fitness consequences of agonistic interactions between col- 
onies of the undescribed species Hydractinia [CM] depend 
on the size at which competitive encounters are initiated and 
the growth form of the colonies involved. The context- 
dependent nature of competitive outcomes affects the pro- 
duction of immature reproductive zooids an investment in 
future reproduction and permits an assessment of whether 
allorecognition in Hydractinia is adaptive. 

Materials and Methods 

Hydractinia [GM], study species 

Cunningham et al. ( 1991 ) constructed a phylogeny of the 
genus Hydractinia that consists of two distinct clades. One 
clade includes H. symbiolongicarpus and H. [GM], which 
do not overlap in their geographic distribution. H. svmbi- 
olongicarpus has a northwestern Atlantic distribution, but 
H. IGM] is found only in the Gulf of Mexico. Mating 
experiments reveal nearly complete infertility between col- 
onies collected in the Gull and the northwestern Atlantic, 
indicating that //. [GMj is a new. undescribed species (pers. 
comm., C.W. Cunningham. Duke University). 

Hydractinia /GM /, as well as many Atlantic Hydractinia 
species (Yund a ai, 1987; Buss and Yund, 1988. 1989; 
Frank et ai, 2001 ). encrusts the surface of gastropod shells 
occupied by pagurid hermit crabs. Colonies are gonocho- 



ristic and polymorphic, possessing specialized reproductive 
polyps, or gonozooids, on which the gametes are produced. 
Sexual reproduction occurs during broadcast-spawning 
events in which gametes are released in response to light 
cues (Bunting, 1894; Ballard, 1942; Levitan and Grosberg, 
1993). The crawling planula larva of Hydractinia attaches 
itself to a gastropod shell inhabited by a passing hermit crab 
(Yund et ai. 1987). Metamorphosis subsequently occurs on 
the shell surface. When two or more colonies recruit to the 
same shell, the colonies usually grow into contact. The 
resulting competitive interactions occur commonly in nature 
(\undetal., 1987: Buss and Yund. 1988: Yund and Parker. 
1989; Hart and Grosberg, 1999; Ferrell. 2004). 

Allorecognition and agonistic interactions in Hydractinia 

The adaptive significance of kin fusion to the allorecog- 
nition system of Hydractinia is uncertain (Feldgarden and 
Yund. 1992: Yund and Feldgarden. 1992; Grosberg, 1992). 
In laboratory assays, the probability of fusion remains high 
between full siblings or between parent and offspring, but it 
drops precipitously between colonies of lesser relatedness 
(Hauenschild, 1954, 1956; Mullen 1964: Ivker. 1972; Gros- 
berg et al.. 1996). If kin interactions are rare in the field, 
however, discrimination between kin and non-kin may sim- 
ply reflect imperfect discrimination of self from non-self 
(Feldgarden and Yund, 1992; Yund and Feldgarden, 1992). 
Although kin interactions may be common in natural pop- 
ulations of H. symbiolongicarpus (Hart and Grosberg, 
1999), adaptive kin/non-kin discrimination should persist 
only if kin fusion results in a net increase in a genotype's 
fitness relative to non-fusion. 

Upon contact with genetically unrelated conspecific tis- 
sue, Hydractinia colonies do not fuse but instead usually 
mount a well-characterized agonistic response (Ivker, 1972; 
Buss et al., 1984). The ability to mount an agonistic attack, 
or competitive ability, has a strong genetic basis and de- 
pends directly on colony growth form (Buss and Grosberg, 
1990). (See Fig. 1 for an illustration of growth forms.) Some 
individuals grow solely by expansion of continuous, un- 
branching tissue ("mat" phenotypes). whereas others grow 
primarily by proliferating thin branches of tissue, or stolons 
("stoloniferous" phenotypes). Colonies exhibit continuous 
variation between these two morphological extremes ("in- 
termediate" phenotypes). In agonistic interactions, existing 
stolons swell due to the recruitment of nematocytes (cells 
bearing the nematocysts) and discharge of nematocysts 
(highly specialized stinging organelles) (Buss et al.. 1984). 
These "hyperplastic stolons" (Ivker, 1972) discharge nema- 
tocysts in an attempt to competitively exclude the opposing 
colony by tissue destruction and subsequent overgrowth 
(Buss and Grosberg, 1990). Thus, colonies with greater 
stolon proliferation (stoloniferous phenotypes) have an in- 
creased capacity to mount an agonistic response and com- 



FITNESS CONSEQUENCES OF AGGRESSION 



175 



petitively exclude others in laboratory competitive interac- 
tions between small colonies (Buss and Grosberg, 1990). 

Multiple Hydmctinia colonies may recruit to near or 
distant sites on a gastropod shell depending on shell mor- 
phology (Yund et al.. 1987: Buss and Yund. 1988: Yund 
and Parker. 1989) and size (Buss and Yund, 1988). As a 
result, conspecific encounters in Hydnictiniu may occur 
between small or large colonies, because colonies grow ro 
different extents before contact. Previous studies have em- 
phasized the importance of intraspecitic competition be- 
tween small, juvenile colonies (Buss and Yund. 1988; Buss 
and Grosberg, 1990), but agonistic interactions between 
large colonies have been documented in modern and his- 
torical populations (Buss and Yund, 1988). and are not 
uncommon in H. [CM] (Ferrell. 2004). Yund et ul. (1987) 
used a single pair of competing genotypes to document 
competitive reversals and prolonged agonistic contests (pos- 
sibly standoffs) between relatively large colonies. However, 
the generality of size-dependent competitive outcomes 
among conspecifics and the effect of growth form in com- 
petitive encounters between larger colonies remain largely 
unexplored. 

Laboratory studies 

In July 2000. I hand-collected five large, well-estab- 
lished, sexually mature colonies (designated colonies I-V 
hereafter) of H. [CM] from shallow water ( 1-1 .5 m deep) in 
St. Joseph's Bay. Florida, located in the northeastern Gulf of 
Mexico. Each colony occupied an individual gastropod 
shell (Fasciolaria lilium hunteria, F. titlipa, Polinices du- 
plicatns. or Phvllonotns pomitm) inhabited by the hermit 
crab Pagunts pollicaris. In the laboratory, small pieces of 
tissue, or explants. including four or five gastrozooids were 
excised with a scalpel and transferred with watchmaker's 
forceps to plain glass microscope slides (7.64 cm X 3.82 
cm. 1.1-1.3 mm thick). These tissue explants were held in 
the desired position using a single monofilament thread 
(8-lb. test) and kept in artificial seawater (Instant Ocean Sea 
Salt, 1994: temperature = 24 C, salinity = 32 ppt) in a 
single aquarium. Tissue explants attached to the glass sub- 
strate within a few days. This technique was used to estab- 
lish all experimental replicates (described in detail below). 

Two factors were manipulated in this experiment: ( 1 ) 
inter-competitor spacing and (2) relative competitive ability 
of competing colonies. Two competitive treatments were 
established by placing tissue explants from two different 
field-collected colonies on glass slides at 4-mm or 12-mm 
apart, resulting in interactions between small and large 
colonies, respectively, after subsequent colony growth. 
Such competitive interactions were established between all 
10 pairwise combinations of the five experimental colonies. 
As a control, I also established each experimental colony 
singly on separate glass slides. All competing pairs and 



controls were replicated five times, yielding 125 experimen- 
tal units [(10 pairs X 2 distances X 5 replicates) + (5 
controls X 5 replicates) =- 125 units]. Glass slides were 
mounted vertically on one of three acrylic plastic racks lined 
with nine plastic columns for attachment. Five slides could 
be mounted in each plastic column, generating five rows of 
slides on each rack. All slide positions were assigned ran- 
domly with respect to rack, column, and row. The three 
racks, including all glass slides, were maintained in artificial 
seawater in a single aquarium, as described above. Two 
underwater pumps ensured adequate circulation. Colonies 
were fed daily (3 \ h) to repletion with 2-day-old brine 
shrimp nauplii (Ocean Star International, Inc., Pro 100). 

At 15. 30. 60. 80, and 90 days, each experimental unit 
was examined under a dissection microscope. Survival, 
colony width and length (omitted at the 80-d interval), and 
the number of immature gonozooids were recorded. The 
colonized surface area, defined here as the area covered by 
connecting stolon tips with straight lines or tracing the edge 
of mat tissue, was estimated by measuring colony width and 
length and then calculating the ellipsoid area [= TT X 
(length/2) x (width/2)]. The surface-area growth rate of 
colonies was then calculated (= ellipsoid area/time). Digital 
computer images were obtained from 53 additional labora- 
tory-cultured H. [GM] colonies established from clonal 
explants, and linear regression was performed to evaluate 
the appropriateness of estimated ellipsoid area as an indi- 
cator of colonized surface area, which was calculated using 
SigmaScan Pro 4 software. Additionally, the presence or 
absence of contact between competitors was noted to esti- 
mate the time in contact for all replicates. For example, after 
90 d of growth, the estimated time in contact for conspe- 
cifics in contact after only 15 d would be 75 d. 

After 65 d of growth, all control replicates of each of the 
five experimental colonies were analyzed morphometrically 
to determine colony growth form (i.e., relative allocation to 
mat and stolonal tissue). In the absence of substrate limita- 
tion, mat and stolon growth rates remain constant through- 
out ontogeny (McFadden et <//.. 1984; Blackstone and 
Yund, 1989). Consequently, morphological assessment at 
this time can be considered to represent conditions through- 
out the experiment (0-90 d). 

I used a Nikon camera (60-mm lens) interfaced to a 
computer to obtain and store black-and-white images of the 
colonies. After tracing all tissue (stolonal or mat) of each 
replicate (see Fig. 1 for examples), I used SigmaScan Pro 4 
software to perform the morphometric measurements 
needed to calculate the shape metric developed by Black- 
stone and Buss ( 1991 ). The unitless shape metric [= perim- 
eter/(area) 05 ] is a reliable quantitative indicator of growth 
form in Hydractinia and other organisms that have similar 
colony development. Higher values correspond to increas- 
ingly stoloniferous phenotypes. The biomass surface area 
covered by mat tissue and individual stolons was also de- 



176 



D. L. FERRELL 



termined by using SigmaScan Pro 4 software. Note that the 
biomass surface area determined from these images of con- 
trol-treatment colonies was calculated differently than the 
estimated ellipsoid surface area used to evaluate growth rate 
in all experimental units. Calculations of the shape metric 
and biomass growth rate allowed a posteriori assessment of 
the competitive ability of the five experimental colonies 
used in this study. The competitive-dominance hierarchy 
constructed using biomass growth rate and shape metric 
determinants was then compared to the actual competitive 
hierarchy based on the outcomes (in terms of colony sur- 
vival) of the pairwise competitive encounters between all 
colonies. 

Statistical analysis 

I used Contingency \ 2 tests of independence to evaluate 
whether colony survival was associated with ( 1 ) intercolony 
spacing, (2) colony identity, and (3) competitor identity. In 
cases in which expected values were sufficiently small 
(^5), Fisher's exact test of independence was used instead. 

Initially, three-way analyses of variance (ANOVA) were 
used to explore the effects of slide position on the two 
continuous response variables (surface-area growth rate and 
number of immature gonozooids) after 90 days of growth. 
The main effects of rack (3). column (9), and row (5) were 
examined, as well as all possible interactions (JMP, ver. 
3.2.6). Then, mixed-model, two-way ANOVAs were used 
to analyze the surface-area growth rate and the number of 
immature gonozooids after 90 days of growth. Separate 
ANOVA models were employed for each of the five exper- 
imental colonies to meet model assumptions of indepen- 
dence. The main effects of distance between competing 
colonies (fixed; 4 vs. 12 mm) and competitor identity (ran- 
dom; genotype of competitor) were explored, as well as the 
interactions between these two main factors. For each dis- 
tance treatment group, contrasts comparing colony perfor- 
mance against each competitor were performed (12 total 
contrasts, family level a = 0.05. Bonferroni adjusted a = 
0.0042; Sokal and Rohlf, 1995). Differences from control 
colonies in growth and reproductive variables were exam- 
ined separately for the 4-mm and 12-mm treatments with 
one-way ANOVAs; contrasts comparing control versus 
competitive treatment colonies were performed (4 total con- 
trasts, family level a = 0.05. Bonferroni adjusted o = 
0.0125; Sokal and Rohlf. 1995). In addition, the relationship 
between immature gonozooid production and quantitative 
estimates u! colony growth form (i.e., shape metric) was 
examined using simple linear regression analysis for the 
4-mm and 1 2-mm treatments. Natural logarithmic and 
square root data transformations were used when necessary 
to meet model assumptions of normality and homoscedas- 
ticity. 

One-way ANOVAs were used to compare the mean 



biomass growth rate and mean shape metric of control 
replicates of the five experimental colonies. All pairwise 
comparisons were performed (10 total contrasts, family 
level a = 0.05. Bonferroni adjusted a = 0.005; Sokal and 
Rohlf, 1995). 



Results 



Effects of slide position 



For both surface-area growth rate and number of immature 
gonozooids, two ANOVA models were explored for the ef- 
fects of slide position. The first included all possible interac- 
tions as factors in the model [rack (3), column (9). row (5), 
rack*column, rack*row, column*row, rack*column*row|. 
However, in the absence of statistically significant interactions, 
data were pooled and reanalyzed including only the main 
effects of rack, column, and row. Neither of these statistical 
models identified significant effects of slide position with re- 
gard to surface-area growth rate or number of immature gono- 
zooids. Consequently, slide position was ignored in all subse- 
quent analyses. 

Morphological assessment 

Growth forms of experimental colonies included those 
that were entirely mat and those that were highly stolonif- 
erous as well as intermediate types (Fig. 1). For ease of 
interpretation, I assigned Roman numerals I-V to colonies 
according to the extent of stolon proliferation. After 65 d of 
growth, none of the control replicates (established in the 
absence of competition) of colony I possessed any periph- 
eral stolons branching out from the central ectodermal mat. 
In contrast, control replicates of colony V were highly 
stoloniferous, with most growth occurring via stolon rather 
than as mat tissue. Control replicates of colonies II, III, and 
IV displayed intermediate growth forms with various pro- 
portions of mat and stolon tissue. 

Figure 1 compares quantitative estimates of growth form 
and growth rate of the experimental colonies. The growth 
rate, in terms of biomass area covered after 65 d of growth, 
was similar among experimental colonies, except colony V. 
Although ANOVA results indicated a difference in the 
mean biomass area of the colonies (F 42 o = 6.76. P ~ 
0.001). Bonferroni pairwise comparisons (adjusted a - 
0.005) suggested that this is attributable solely to colony V, 
which produced biomass coverage at a rate greater than the 
others. The clear differences in growth form of colonies I, 
II, III, and IV (Fig. 1 ) did not result in significant differences 
in biomass production. Thus, morphological variation in //. 
[CM] does not necessarily reflect differences in the rate of 
biomass production. In contrast to biomass growth rate, the 
shape metric reveals a relationship between morphology 
and the growth differences between experimental colonies. 
As with biomass growth rate, ANOVA showed overall 



FITNESS CONSEQUENCES OF AGGRESSION 



177 





0.6 


/^'V 


Q} 






CO 


0.5 - 


1 , 1 


5 

o 


04 




CD 
CD 


0.3 


m % 


CD 

(/) 
</) 
CD 

E 
o 


02 
0.1 - 


1 * 


1 

1 , 1 




DO 








n 






V "I [ 1 I I 

50 100 150 200 




Shape metric 



Figure 1. Variation in growth rate and colony morphology among Hydmctinia JGMI experimental colonies. 
Roman numerals I-V were assigned to colonies according to the extent of stolonal proliferation for ease of 
interpretation. The colony outlines illustrate mat (I), highly stoloniferous (V), and intermediate growth mor- 
phologies (II. Ill, IV). These are representative tracings of images obtained from control replicates (;i = 5) of 
experimental colonies I-V after 65 d of growth. Colonies are not drawn to scale. The biomass growth rate 
(mnr/day) reflects the total area covered by both stolonal and mat tissue encrusting the surface of a glass slide 
after 65 d of growth. The shape metric (= perimeter/Urea)" 5 ), developed by Blackstone and Buss (1991). is a 
unitless indicator of colony growth morphology calculated using the total perimeter and area covered by stolonal 
and mat tissue combined. 



highly significant differences in the mean shape metric 
(F 42{> = 24.78, P < 0.001). However, Bonferroni pairwise 
comparisons indicated that the mean shape metric of colo- 
nies IV and V both differ significantly from all other colo- 
nies. The colonies can be ranked in order of decreasing 
allocation to stolon growth: V > IV > III = II = I. The 
"equal" ( = ) symbol denotes no statistical difference. 

None of the five control replicates of colony I exhibited 
any stolon growth. This attribute reflects a qualitative mor- 
phological distinction between colony I and the other four 
colonies. Thus, while morphometric analysis did not indi- 
cate significant quantitative differences in stolon production 
between colony I and colonies II and III, an important 
qualitative difference was observed. Noting the absence of 
stolons in colony I, the experimental colonies can be ranked 
in order of decreasing stolon production as follows: V > 
IV > III = II > I. 

Survival 

Colony survival differed markedly as a function of inter- 
colony spacing. After only 30 d of growth, competing 
colonies that had been established 4-mm apart experienced 
reduced survival compared to those established 12-mm 

apart or in the absence of competition (^ a!c = 27.3, ^ n s 

= 3.8, df = 1. P < 0.001 ). and these differences in survival 



remained significant for the duration of the experiment. 
For example, after 60 d of growth, survival of 4-mm 
colonies dropped to 55% and was significantly lower than 
the 85% survival seen in 12-mm colonies after 90 d (xl a \c 
= 42.7, xln. 005 = 3.8, df = 1. P < 0.001 ). After 90 d. 
colonies in the 4-mm treatment showed less than half the 
survival rate of those in the 12-mm treatment (42% 
compared to 85%: ^ : al , - 39.9, ^ 2 rll , O .os = 3.8, df = 1, 
P < 0.001; Fig. 2). Thus, competitive encounters between 
smaller colonies incur greater (or at least earlier) mortality 
than encounters between larger colonies. By contrast, all 
control colonies had 100% survival, suggesting that in- 
traspecific competition caused the observed mortality. 

Although mortality costs from competition were most 
intense in small-colony encounters (4-mm treatment), the 
five experimental colonies differed in all cases with respect 
to the onset of significant mortality. Differences in mortality 
between 4-mm and 12-mm treatments were statistically 
significant (Fisher's exact test, P < 0.01 ) only after 90 d in 
colony V. the most stoloniferous colony. In contrast, sig- 
nificant mortality differences between these treatments were 
evident much earlier in other colonies (30 d in colonies I, 
III, and IV; 60 d in colony II). Colonies in the 4-mm 
treatment did not exhibit significantly different mortality 
when pooled over all competitors (i.e., data pooled within 



178 



D. L. FERRELL 



Colony V 



D 4 mm 
12mm 



05 

'5 

3 
C/5 



o 

Q. 




Colony I 



1 

0.8 
0.6 

0.4 
0.2 



rlrlrl 



Ctl 




Competitor 

Figure 2. Colony survival as a function of competitor identity and intercolony spacing (4-mm or l2-mm>. 
The proportion of colonies surviving after 90 d in competition with each of four competitors is illustrated for 
4-mm and 12-mm treatments. The performance of control replicates is included for reference. Colonies are not 
drawn to scale. ND = no data. 



each colony row in Fig. 2: ^ alc = 1.7, ^ rit _ nns = 9.5. df = 
4, P 0.05). Although 4-mm clones experienced some 
mortality in all competitive pairings (Fig. 2), some 4-mm 
competitors imposed greater overall mortality than others 
(i.e.. data pooled within each competitor column in Fig. 2; 
*i? alc = 12.2. v; M , 0.05 = 9-5. df = 4, P < 0.05). Colonies 
were least likely to survive competition with colony V and 
most likely to survive competition with colony I. 

Survival after 90 d in 12-mm treatments was not signif- 
icantly different among colonies when pooled over all com- 
petitors (i.e., data pooled within each colony row in Fig. 2; 



A alc = 8.63. fa*. 005 = 9.5. df = 4. P > 0.05). Most of the 
observed mortality occurred among replicates of colonies I 
and IV, however. Mortality in all other colonies (II, III. and 
V) was nearly negligible, as survival was 90% or higher. As 
in 4-mm treatments, some 12-mm competitors imposed 
greater overall mortality than others (i.e.. data pooled within 
each competitor column in Fig. 2; Xc^ = '5.7, \cm oos = 
9.5. df = 4, P < 0.01 ). In 12-mm competitive encounters in 
which mortality occurred (Fig. 2), colonies were killed by 
competitors IV and V almost exclusively. 

Overall, colonies V and I were the superior and inferior 



FITNESS CONSEQUENCES OF AGGRESSION 



179 



competitors, respectively. Competitive relationships be- 
tween intermediate competitors were less distinct, with the 
genotypes that exhibited the more stoloniferous growth 
forms generally dominating (Fig. 2). 



Growth rate 

Estimates of ellipsoid area were highly correlated with 
measurements of colonized surface area (R 2 = 94.9%, 
n = 53), and were therefore used as an indicator of 
surface-area growth rate for experimental colonies. Col- 
onies established 4 mm apart often suffered marked re- 
ductions in growth rate relative to controls; Bonferroni 
comparisons indicated that all competitor treatments (ex- 
cept one) were significantly different from controls for 
colonies IV and V, but not significantly different for 
colonies I, II. and III (Table 1, Fig. 3). In contrast, the 
growth rate of those in the 12-mm treatment was most 
often similar to controls; Bonferroni comparisons indi- 
cated that no competitor treatments were significantly 
different from controls, with two exceptions in colony V 
(Table 1, Fig. 3). Differences in growth rate after 90 d 
between 4-mm and 12-mm treatments were statistically 
significant for colonies II, IV, and V (Table 2). 

Some competitors inflicted greater costs in growth rate 
than others did. After 90 d, differences in growth rate 



depending on competitor identity were significant for all 
colonies except for the two most mat-like phenotypes, 
colonies I and II (Table 2, Fig. 3). Instead, the effect of 
competitor identity was not statistically significant for 
colonies I (P = 0.604) and II (P = 0.406), indicating a 
uniform cost in terms of growth rate regardless of the 
degree of attack presented by a competitor. For those 
colonies (III, IV, and V) in which growth rate varied 
significantly between competitors, Bonferroni compari- 
sons were generally unable to differentiate statistically 
which competitors imposed greater growth rate costs than 
others. The two exceptions were colony III in the 4-mm 
treatment, which exhibited a significantly greater growth 
rate in competition with colony I than with colony II (Fig. 
3); and colony IV in the 12-mm treatment, which showed 
a significantly greater growth rate in competition with 
colony I than with colony V (Fig. 3). In both cases, 
colony I imposed less reduction in growth rate during 
intraspecific competition. After 90 d of growth, in no case 
was the interaction between competitive treatment (4-mm 
and 12-mm) and competitor identity significant (Table 2). 
Thus, the relative ability of competitors to impose 
growth-rate costs did not vary between the two treat- 
ments. In other words, the severity of the growth reduc- 
tion imposed by competitors did not depend on whether 
the competing colonies were large or small. 



Table 1 

Summary of one-way ANOVAs examining differences bet\veen control and competing colonies (t = 90 d) in 4-mm and 12-mm treatments 



Variable Focal colony Treatment 


'4,20 


Significant Bonferroni comparisons 


Surface-area growth rate 
I 4 mm 
12 mm 
11 4 mm 
12mm 


0.86 
0.31 
1.32 
1.18 







III 4 mm 


2.79 







12 mm 


3.78* 







IV 4 mm 


6.41** 


control 


vs. II, III. V 


1 2 mm 


4.59** 







V 4 mm 


8.46*** 


control 


vs. I, II, III. IV 


1 2 mm 


3.83* 


control 


vs. III. IV 


Number of immature gonozoids 








I 4 mm 


0.91 







12 mm 


0.93 







II 4 mm 


13.29*** 


control 


vs. I, III, IV. V 


12 mm 


5.73** 


control 


vs. Ill ( + ) 


III 4 mm 


1.39 







1 2 mm 


8.82*** 


control 


vs. I ( + ). II ( + ) 


IV 4 mm 


3.45* 


control 


vs. Ill, V 


1 2 mm 


0.34 







V 4 mm 


2.86 


control 


vs. II 


12 mm 


1.17 








Note: Bonferroni comparisons indicate lower values than controls except where indicated with a plus symbol ( + ).* = P < 0.05. ** = P < 0.01, *** = 
P < 0.001. 



180 



D. L. FERRELL 



Colony V 



2 
o 



Colony I 



NO 



ai 







D4 mm 
12 mm 





Competitor 

Figure 3. Surface-area growth rate as a function of competitor identity and intercolony spacing (4-mm or 
12-mm). The mean ( SE) surface-area growth rate (mirr/d) after 90 d in competition with each of four 
competitors is illustrated for 4-mm and 12-mm treatments. The performance of control replicates is included for 
reference. Bonferroni pairwise comparisons (adjusted a = 0.0042) indicated no significant differences in means, 
with the following exceptions: colony III. 4-mm; colony IV. 12-mm. Significantly different means arc indicated 
by different lowercase letters. Colonies are not drawn to scale. ND = no data. 



Production <>j immature gonozooids 

The number of immature gonozooids differed remarkably 
as a function ot intercolony spacing for four out of five 
experimental colonies. Whereas 4-mm colonies invested 
very little or no energy into immature gonozooids (Fig. 4). 
12-mm colonies exhibited immature gono/ooid investment 
that was similar to control colonies initially (up to 30 d>. and 
then in some cases greater than controls for the remainder of 
the experiment (see analysis below). 



After 90 d. differences in immature gonozooid produc- 
tion between 4-mm and 12-mm treatments were highly 
significant for all colonies except colony I (Table 3. Fig. 4). 
All 4-mm competitive treatments exhibited immature gono- 
/ooid production similar to or less than controls (Table 1, 
Fig. 4). In contrast. 12-mm competitive treatments exhibited 
immature gonozooid production similar to or greater than 
controls (Table I. Fig. 4). 

All instances of augmented production of immature 



FITNESS CONSEQUENCES OF AGGRESSION 



181 



Table 2 

Summon,' of two-way ANOVAs examining the effects of intercolonv 
distance and competitor genotype on surface-area growth rate ft = 
90 d) 



Focal colony 


Source 


df 


MS 


F-ratio 


I 


Distance 


1 


0.136 


0.441 




Competitor 


3 


0.192 


0.625 




Interaction 


3 


0.113 


0.366 




Error 


32 


0.308 




II 


Distance 


1 


2.138 


15.063*** 




Competitor 


3 


0.142 


1.000 




Interaction 


3 


0.087 


0.612 




Error 


32 


0.142 




III 


Distance 


1 


0.001 


0.002 




Competitor 


3 


1.999 


3.975* 




Interaction 


3 


1.223 


2.433 




Error 


32 


0.503 




IV 


Distance 


1 


5.184 


20.843*** 




Competitor 


3 


2.057 


8.271*** 




Interaction 


3 


0.278 


1.116 




Error 


32 


0.249 




V 


Distance 


1 


5.247 


6.490* 




Competitor 


3 


3.409 


4.220* 




Interaction 


3 


0.347 


0.429 




Error 


32 


0.808 





Note: Results of individual ANOVAs are given for focal colonies I. II, 
III. IV. and V. * = P < 0.05, *** = P < 0.001. 



gonozooids involved poor competitors (I, II, III) exhibiting 
mat or mat-like (intermediate) growth forms (Fig. 4). By 
summing the shape metrics of each competing pair, the 
interactions can be ranked according to the morphological 
attributes of the encounter. Mat-mat encounters have the 
lowest sums; stoloniferous-stoloniferous encounters have 
the greatest. Simple linear regression analysis revealed a 
highly significant, negative relationship between production 
of immature gonozooids and the sum of the shape metrics 
(F U8 = 26.0, P < 0.0001 ), accounting for a majority (R 2 = 
60.1%) of the variation in immature gonozooid production 
in 12-mm colonies (Fig. 5). This relationship was not de- 
tected in 4-mm colonies (F LI8 = 1.3, P = 0.26). which 
showed much less variability in immature gonozooid pro- 
duction (Fig. 4). 

Discussion 

Competitive dynamics in Hydractinia [GM] clearly de- 
pend on the ecological context in which intraspecific com- 
petition transpires. The size of colonies upon encountering 
conspecifics and the growth form, or competitive ability, of 
competitors both strongly influenced the fitness conse- 
quences of agonistic interactions. Interactions between 



small colonies generally imposed greater costs in colony 
survival, growth rate, and investment in future reproduction. 
Superior competitors typically eliminated their opponents in 
small-colony encounters, but only the most dominant colo- 
nies competitively excluded others in larger-colony interac- 
tions. In certain conditions, competing colonies consistently 
increased their investment in future reproduction (relative to 
controls without competition) and exhibited zero mortality, 
although reduced growth was often evident. These findings 
indicate that ( 1 ) agonistic interactions do not always result 
in the elimination of inferior competitors, (2) colonies may 
increase production of immature gonozooids an invest- 
ment in future reproduction as a result of growth limita- 
tion by conspecifics, and (3) ontogenetic changes in al- 
lorecognition-mediated fusibility may be due in part to 
heavily size-dependent fitness consequences of non-fusion. 

Competitive outcomes 

The fitness consequences of intraspecific competition in 
H. [GM] were heavily size-dependent. Not only may the 
duration of encounters between larger colonies be pro- 
longed, but also the outcome may be entirely different. 
Whereas encounters at small size usually result in compet- 
itive exclusion (Ivker. 1972; Buss et al., 1984; Yund et al., 
1987; Buss and Grosberg, 1990; this study), this may not 
always be true for the encounters of larger colonies. Indeed, 
when given a distinct size advantage over its superior in- 
terspecific competitor, the colonial hydroid Podocoryne 
carnea, Hydractinia colonies often survived interspecific 
contests and formed intercolony boundaries stable for 2-3 
months (McFadden, 1986). Work with other spatial com- 
petitors of Hydractinia on artificial substrata similarly sug- 
gests that colonies may persist by inhibiting the growth of 
adjacent competitors rather than by attempting overgrowth 
(Karlson, 1978). In the present study, mat and mat-like 
Hydractinia phenotypes accrued zero mortality in intraspe- 
cific competitive interactions initiated between larger colo- 
nies. 

Yund et al. (1987) also report coexistence, rather than 
overgrowth, of two competing Hydractinia genotypes es- 
tablished at distant recruitment sites after 9.5 weeks of 
growth. Even after 18 weeks, only four of eight replicates 
had resulted in exclusion of one of the two genotypes, 
despite significant differences in growth rate (and presum- 
ably competitive ability) between them. Had such interac- 
tions been investigated between genotypes with relatively 
low and similar growth rates (as in the present study), Yund 
et al. (1987) might have observed even less or no over- 
growth in large-colony competitive interactions. Yund et al. 
(1987) proposed that the costs of non-fusion are actually 
much greater in interactions between large colonies. This 
conclusion implies that complete overgrowth, albeit pro- 
longed, will proceed in all competitive encounters. If this 



182 



D. L. FERRELL 



Colony V 




Colony IV 




Ctl 



cn 


CO 

E 



Colony III 




Colony II 



Ctl 



Colony I 



30 

25 

20 
15 
10 
5 



3 i f 

I I 

JL_ J 1 



30 

25 

20 

15 
10 - 
5 





30 i 






25 






20 






15 




: 


10 




J 


5 






ND 



O4 mm 
12mm 







Competitor 

Figure 4. Immature gonozooid production as a function of competitor identity and intercolony spacing 
1 4- mm or 12-mm). The mean ( SE) number of gonozooids per colony after 90 d in competition with each of 
four competitors is illustrated for 4-mm and 12-mm treatments. The performance of control replicates is included 
for reference. Bonferroni pairwise comparisons (adjusted a = 0.0042 1 indicated no significant differences in 
means, with the following exceptions: colony III, 12-mm; colony V. 12-mm. Significantly different means are 
indicated hy different lowercase letters. Colonies are not drawn to scale. ND = no data. 



were the case, fitness costs indeed would be more severe, 
because even the "winner" laces the immense energetic 
costs of such a prolonged struggle. My results are consistent 
with this interpretation in that highly stoloniferous colonies 
showed evidence of overgrowth regardless of intercolony 
spacing; however, in the absence of highly stoloniferous 
phenot\ pes. this does not appear to be the case. Overgrowth, 
while likely predominating in many Hydmctinia popula- 



tions as a result of recruitment patterns and available gas- 
tropod substrata (Buss and Yund. 1988; Yund and Parker. 
1989). may not be the inevitable product of intraspecific 
competition in H. [CM]. 

Differences in the outcome of competitive encounters 
based on colony size are important ecologically and evolu- 
tionarily only if the frequency of encounters between small 
and large colonies varies predictably in natural populations. 



FITNESS CONSEQUENCES OF AGGRESSION 



183 



Table 3 



Summary of rnw-H-ay ANOVAs examining the effects of intercolony 
distance and competitor genotype on the number of immature 
gonozooids ft = 90 d) 



Focal Colony 


Source 


df 


MS 


F-ratio 


I 


Distance 


1 


4.589 


3.603 




Competitor 


3 


3.238 


2.542 




Interaction 


3 


0.899 


0.706 




Error 


32 


1.274 




II 


Distance 


1 


32.876 


71.472*** 




Competitor 


3 


3.390 


7.369*** 




Interaction 


3 


3.660 


7.958*** 




Error 


32 


0.460 




III 


Distance 


1 


13.850 


22.761*** 




Competitor 


3 


4.546 


7.471*** 




Interaction 


3 


6.002 


9.864*** 




Error 


32 


0.608 




IV 


Distance 


1 


17.125 


22.011*** 




Competitor 


3 


1.384 


1.779 




Interaction 


3 


0.200 


0.257 




Error 


32 


0.778 




V 


Distance 


1 


6.750 


8.456** 




Competitor 


3 


0.098 


0.123 




Interaction 


3 


1.387 


1.737 




Error 


32 


0.798 





Note: Results of individual ANOVAs are given for focal colonies I. II, 
III, IV, and V. ** = P < 0.01, *** = P < 0.001. 



Field surveys indicate that competitive interactions between 
large colonies occur regularly in some H. [CM] populations 
with a frequency that varies predictably with the availability 
of different sizes and types of gastropod shells (Ferrell, 
2004). Shell size and morphology affect the likelihood that 
multiple larvae will recruit to distant positions on a shell 
(Buss and Yund, 1988; Yund and Parker, 1989). Yund and 
Parker (1989) acknowledge that a sizeable portion of inter- 
actions may occur between large colonies in certain Hy- 
dractinia species. However, the mean shell length ( 42 
mm) of encrusted gastropod shells in some H. [CM] pop- 
ulations (Ferrell, 2004) greatly exceeds even the maximum 
shell length (-25 mm) utilized in many northwestern At- 
lantic Hydractinia populations (as reported in Buss and 
Yund, 1988). On bigger shells, the spacing between colo- 
nies can be greater; thus competitive interactions between 
extremely large colonies, in which overgrowth seems in- 
creasingly improbable, occur in H. [CM] (pers. obs.). As in 
other marine cnidarians (e.g.. Francis, 1973; Karlson, 1980; 
Purcell. 1977), agonistic behavior may result in territorial 
defense of spatial resources rather than competitive exclu- 
sion. 



Production of immature gonozooids- 
fiitnre reproduction 



-an investment in 



Not only were instances of overgrowth attributable to 
colony morphology, but immature gonozooid production 
(and growth rate to a lesser degree) also varied as a function 
of the morphology of the competitors. When growth rate 
differed significantly among opponents, the less stolonifer- 
ous competitor experienced the greater in growth rate and 
produced few immature gonozooids, or none at all. These 
results are consistent with expectations of the intensity of 
aggression based on colony growth form. 

Although production of immature gonozooids was higher 
in colonies encountering less formidable opponents (i.e.. 
mat or mat-like intermediate growth forms), production in 
some cases was even higher than in the controls. This effect 
was not apparent in small-colony interactions, in which 
overgrowth proceeded much more rapidly. Even Hydrac- 
tinici colonies with as few as two feeding polyps are capable 
of producing mature gonozooids (Hauenschild, 1954; Miil- 
ler. 1964); nevertheless, their extreme vulnerability to over- 
growth and the scarcity of tissue not directly involved in 
colony defense most likely kept the small colonies from 
producing many gonozooids. Only colonies of mat and 
mat-like intermediate morphologies increased their produc- 
tion of immature gonozooids. Hauenschild (1954) made 
several observations of Hydractinia that shed light on this 
trend: ( 1 ) the formation of mat tissue is a precondition for 
the production of gonozooids, (2) gonozooids form much 
earlier in mat colonies. (3) entirely mat phenotypes produce 
gonozooids naturally, even when occupying an unlimited 
substrate. (4) intermediate phenotypes do not develop gono- 
zooids unless confronted with growth limitations, and (5) 
stoloniferous colonies require full colonization of surface 
before gonozooids arise. Thus, the greater production of 
immature gonozooids observed in mat and mat-like inter- 
mediates is simply a by-product of their larger supply of mat 
tissue upon which to form gonozooids, coupled with an 
earlier onset of sexual reproduction. If Hauenschild' s 
(1954) third observation is true, it may explain why the 
entirely mat phenotype. unlike the mat-like intermediate 
phenotypes. did not increase production of immature gono- 
zooids substantially above control levels. (Table 1, Fig. 4). 
That is. with no growth limitations (as in the control treat- 
ment), the entirely mat phenotype would still exhibit sig- 
nificant immature gonozooid production, whereas the inter- 
mediate phenotypes, which react in this manner only in 
growth-limiting conditions, would not. 

I explored two alternate explanations for the observed 
patterns in immature gonozooid production. First, perhaps 
the interacting pairs benefiting from positive effects on 
immature gonozooid production were relatives. None of the 
interacting colonies exhibited the fusion one might expect if 
they were genetically related. However, about 50% of Hy- 



184 



D. L. FERRELL 



0) 
01 



2 -I 
1.5 - 

1 
0.5 



i 
O 

cn 
! 





35 

I -0.5 H 



-1 

-1.5 - 

-2 
-2.5 



4 5 



55 





Sum of shapes (colony + competitor) 

Figure 5. Simple linear regression analysis of immature gonozooid production vs. the sum of shape metrics 
of competing colonies established 12-mm apart. The mean percent change in the number of immature 
gonozooids per colony (relative to controls) in each competitive pair after 90 d is plotted with respect to the sum 
of the shape metrics of both colonies in a given competitive encounter. By summing the shape metrics of each 
competing pair, the interactions can be ranked according to the morphological attributes of the encounter. 
Mat-mat encounters have the lowest sums; stoloniferous-stoloniferous encounters have the greatest. Data 
represent the mean immature gonozooid production of each colony in each of 10 competitive pairs. Both axes 
have been In-transformed. The negative relationship is highly significant (P < 0.0001 ) and explains 60.1'* (R 2 ) 
of the variation in immature gonozooid production. See "Materials and Methods" section for explanation of 
shape metric. 



dnictinia full siblings do not fuse upon contact (Grosberg et 
nl.. 1996), and nun-fusing kin could conceivably exhibit 
reduced aggression accompanied by reduced fitness costs. 
On the other hand, the probability of finding close relatives 
of H. [GM] on separate shells is extremely low (as indicated 
by extremely low rates of fusion between such colonies in 
laboratory assays; D.L. Ferrell. unpubl. data), and this ex- 
planation requires that three of the five experimental colo- 
nies (I. II, and III) be closely related. Consequently, this first 
possibility is unlikely. A second explanation could be found 
in the gender of the competitors. It is conceivable that only 
male-female (M-F) interactions result in increased produc- 
tion of immature gono/ooids. In this experiment, only col- 
on\ 1 \\as female. Unfortunately, only two of the four clear 
instances ot augmented immature gonozooid production 
involved M-F pairs, suggesting these data may be inconclu- 



sive with regard to this explanation. There are six other M-F 
interactions, however, and only one (I v.v. II) of these shows 
any evidence of increased production. Because the majority 
of M-F interactions contradict this hypothesis, the second 
explanation also appears unlikely. In contrast, the growth 
form of the interacting colonies explains much of the vari- 
ation in immature gonozooid production (Fig. 5). 

Because the rate at which H. [GMj extends across a 
substratum increases with stolon proliferation, mat and mat- 
like phenotypes grow more slowly. Although dissimilar 
morphologies may not differ in the rate of tissue production 
( v-axis of Fig. 1 ). they differ considerably in the rate at 
which a colony expands from its initial site of establish- 
ment. The surface-area growth rate measurement used in 
this study reflected this rate of expansion. ANOVA com- 
paring the mean surface-area growth rate of control colonies 



FITNESS CONSEQUENCES OF AGGRESSION 



185 



revealed significant differences between the five experimen- 
tal colonies (F 4:o = 17.9, P < 0.001; Fig. 3). Bonferroni 
comparisons (adjusted a = 0.008) further indicated that the 
surface-area growth rates of colonies IV and V are both 
greater than those of colonies I, II, and III. but not signifi- 
cantly different from one another. Thus, colonies IV and V 
extended outward (via stolons) more quickly than colonies 
I, II, and III. As a result, competitive encounters involving 
colonies IV and V most likely initiated contact with com- 
peting conspecifics sooner than others did. 

The greater production of immature gonozooids observed 
in some encounters in the 12-mm treatment might be attrib- 
utable to the timing of contact between competitors such 
that more recently contacting colonies showed less reduc- 
tion in production. Indeed, greater immature gonozooid 
production was observed in more slowly extending mat and 
mat-like phenotypes (i.e., colonies I, II, III). However, these 
competitive encounters yielded greater immature gonozooid 
production not only relative to other competing colony 
pairs, but also relative to control replicates, suggesting that 
the increases were not attributable solely to the timing of 
contact between conspecifics. Moreover, when the multiple 
regression model for immature gonozooid production 
(12-mm treatment) included the estimated time in contact as 
an independent variable, the result indicated negligible ex- 
planatory power for this added variable. The growth phe- 
notypes of competitors (i.e., sum of shape metrics) remained 
significantly correlated with immature gonozooid produc- 
tion even after the time in contact between competitors was 
accounted for (Table 4). Interestingly, time in contact was 
not statistically significant in this model (Table 4). After a 
second independent variable (time in contact) was added to 
the model, the R 2 increased only slightly, from 60.1% to 
62.9% (Table 4). indicating that time in contact explained 
very little of the variation in immature gonozooid produc- 
tion. 

Recent experiments have shown that the number of im- 
mature gonozooids is a strong, statistically significant indi- 

Table 4 

Summary of multiple regression analysis of the effects of growth form 
and duration of contact between competitors on immature gonozooid 
production in colonies established 12-mm apart ft = 90 d) 



Coefficient 



P-value 



Constant 

Sum of shape metrics 

Time in contact 



+ 5.183 
-0.487 
-0.594 



0.001 
0.002 
0.203 



Note: The sum of the shape metrics of both colonies in a competitive 
pair, an indicator of growth form of the interacting colonies (see Fig. 5), 
and the length of time that the competing colonies had been in contact were 
included as explanatory variables of the mean percent change in the 
number of immature gonozooids possessed by each colony. The overall R 2 
for this regression model was 62.9%. 



cator of the number of mature gonozooids borne by a colony 
upon sexual maturation (D. L. Ferrell, unpubl. data). These 
data, together with the findings reported here and the ob- 
servations of Hauenschild (1954). support pre-existing ideas 
about reproductive allocation in clonal organisms. Because 
reproductive potential typically increases with growth, in- 
determinately growing clonal organisms should be expected 
to postpone sexual reproductive effort until growth becomes 
limiting (Abrahamson. 1975; Hughes and Cancino, 1985; 
Harvell and Grosberg, 1988). A variety of growth-limiting 
factors have been shown to accelerate the onset of sexual 
maturity or increase sexual reproductive investment in 
clonal plants (reviewed in Abrahamson, 1980) and animals 
(Braverman. 1974; Yamaguchi, 1975; Stebbing, 1980; Har- 
vell and Grosberg, 1988). Abrahamson (1975) and Harvell 
and Grosberg (1988) identified intraspecific competition in 
particular as a growth-limiting factor that triggers increased 
reproductive allocation. In many cnidarian agonistic inter- 
actions, competitors may experience reductions in growth 
or reproductive investment, or even be overgrown entirely 
(reviewed in Grosberg, 1988). However, when the agonistic 
assault is unlikely to result in overgrowth, it appears that H. 
[GM] increases reproductive allocation in response to in- 
traspecific competition. 

Adaptive allorecognition and costs of competition 

An adaptive allorecognition system is molded evolution- 
arily by the fitness consequences of the behavioral alterna- 
tives it mediates. Extremely high costs associated with 
non-fusion increase the likelihood that intercolony fusion 
will optimize colony fitness in intraspecific competitive 
interactions. Despite potentially severe costs of fusion be- 
tween genetically distinct but closely related colonies (Buss, 
1982, 1987; Rinkevich and Loya. 1983; Barki el al., 2002; 
Rinkevich, 2002), fusion may still increase fitness. On the 
other hand, if the costs of non-fusion and fusion are com- 
parable, allorecognition systems may be nonadaptive or 
linked to other adaptive processes (Chadwick-Furman and 
Weissman, 2003). The current paper demonstrates that non- 
fusion entails significantly different fitness costs depending 
on the size and competitive ability of competitors. Thus, 
fusion behavior is likely to be adaptive in some ecological 
scenarios, but not others. As a consequence, complexities 
should be expected in the allorecognition system of H\drac - 
tiniu if it functions adaptively in governing intergenotypic 
fusion. 

The immediate costs of rejection were clearly greater in 
interactions between small colonies than between larger 
colonies. Small colonies experienced significantly greater 
fitness costs in terms of colony survival, growth rate, and 
immature gonozooid production. Competitively inferior 
colonies suffer higher rates of mortality (by definition) and 
are typically eliminated, whereas dominant colonies gener- 



186 



D. L. FERRELL 



ally survive but suffer significant setbacks in growth and 
reproduction. 

Because the size of the competitors affects the fitness 
consequences in conspecific interactions, it probably also 
affects the selective pressures that influence allorecognition 
(assuming its adaptive kin-discriminatory role) in Hydnic- 
tinia. Interestingly, the allorecognition system of Hydrac- 
tinia exhibits ontogenetic variation in full-sibling fusibility, 
or the tendency to fuse (Shenk and Buss, 1991; R.K. Gros- 
berg, Univ. of California, Davis, pers. comm.). Shenk and 
Buss ( 1991 ) claim that fusibility declines with ontogeny and 
that some colonies disengage from fusion behavior with the 
onset of sexual maturity, suggesting that the costs of fusion 
are greater at this time. On the other hand, while noting 
some sort of ontogenetic effect, others have been unable to 
corroborate the decreased fusibility with colony ontogeny 
and the coupling of sexual maturity with the onset of rejec- 
tion (Gild et nl.. 2003; R.K. Grosberg, pers. comm.). More- 
over, the costs of intergenotypic fusion may be greatest 
early in ontogeny (R.K. Grosberg, pers. comm.) and are 
probably not averted by delayed rejection (Gild et ai, 
2003). That is, subsequent colony separation may provide 
little protection from somatic cell parasitism, the primary 
cost thought to accompany fusion, in which one genotype in 
a chimera contributes very little to somatic growth while 
contributing greatly to gamete production (Buss, 1982). 
Unfortunately, these conflicting reports make it difficult to 
incorporate the size-dependent variability in the costs of 
non-fusion reported in this study into a discussion of the 
possible adaptive significance of changes in fusibility with 
colony ontogeny. 

My findings have a straightforward interpretation if the 
fitness costs of fusion truly increase with ontogeny and, 
hence, colony size. In this scenario, low costs of non-fusion 
would be accompanied by increased costs of fusion later in 
ontogeny. Thus, fusion would not be favorable in compet- 
itive interactions between large colonies, and decreased 
fusibility with ontogeny (Shenk and Buss, 1991 ) would be 
expected. Initially, it would seem that this expectation 
would be valid even if the costs of fusion actually were 
heavily skewed in favor of intense costs early in ontogeny. 
However, given intensified costs of early ontogenetic fu- 
sion, the costs of fusion late in ontogeny could be even 
lower than the low, but measurable, costs of non-fusion I 
have reported here. An opposite trend in fusibility then 
would be expected. Of course, ridding ourselves of such 
speculative deliberations depends on identifying and quan- 
tifying the fitness consequences of fusion in Hydractinia 
and understanding whether these consequences vary with 
colony ontogeny. Nevertheless, recognizing that the costs of 
non-fusion vary ontogenetically (Yund <7 nl.. 1987. this 
study), the presence of ontogenetic variation in fusibility is 
consistent with an adaptive allorecognition system intended 
to distinguish kin from non-kin. 



Several avenues for future research remain unexplored. 
Long-term monitoring of prolonged encounters is needed to 
verify the nature of their dynamics and eventual outcome 
(overgrowth or coexistence). In particular, estimates of life- 
time reproductive output, although difficult to obtain, would 
be most helpful. This study reveals that, in some circum- 
stances, reproductive allocation may be modified in the 
presence of conspecifics. even in species that exhibit ago- 
nistic behavior. Similar effects may have been previously 
overlooked in other cnidarians with analogous inducible 
defenses. Lastly, close examination and quantification of the 
costs of fusion is needed to better evaluate the adaptiveness 
of kin fusion in Hydractinia. 

Acknowledgments 

R. Mariscal provided guidance and the necessary equip- 
ment to design and execute these experiments. W. Herrn- 
kind, L. Keller. D. Levitan. R. Mariscal, and three anony- 
mous reviewers provided many helpful comments on earlier 
versions of this manuscript. 

Literature Cited 

Abrahamson, W. G. 1975. Reproductive strategies in dewberries. Ecol- 

<i.V.v 56: 72l-75(i. 
Abrahamson, VV. G. 198(1. Demography and vegetative reproduction. 

Pp. 89-106 in Demography and Evolution in Plant Populations. O. T. 

Solbrig. ed. University of California Press. Berkeley. CA. 
Mallard, W. W. 1942. The mechanism for synchronous spawning in 

HyJnii-tiiiiii and Pfiimina. Riol. Bull. 82: 329-339. 
Barki, Y., D. Gateno, D. Graur, and B. Rinkevich. 2002. Soft-coral 

natural chimerism: a window in ontogeny allows the creation of entities 

comprised of incongruous parts. Mar. Ecol. Prog. Ser. 231: 91-99. 
Blackstone, N. VV 1 ., and L. VV. Buss. 1991. Shape variation in hydrac- 

tiniid hydroids. Biol. Bull. 180: 394-405. 
Blackstone. N. W., and P. O. Vund. 1989. Morphological variation in 

a colonial marine hydroid: a comparison of size-based and age-based 

heterochrony. Palcf>hii>li>ny 15: 1-10. 
Braverman, M. 1974. The cellular bases of morphogenesis and mor- 

phosiasis in hydroids. Oceunogr. Mar. Biol. 12: 129-221 
Bunting. M. 1894. The origin of sex cells in H\dractinia and Podo- 

corvnc and the development of H\dractinia. J. Mor/'liol. 9: 203-246. 
Buss, L. VV. 1982. Somatic cell parasitism and the evolution of somatic 

tissue compatibility. Proc. Natl. Acad. Sci. USA 79: 5337-5341. 
Buss, L. W. 1986. Competition and community organization on hard 

surfaces in the sea. Pp. 517-536 in Community Ecology. T. Case and J. 

Diamond, eds. Harper and Row. New York. 
Buss, I,. \V. 1987. Tlw Evolution <>/ 'Individuality. Princeton University 

Press. Princeton. NJ. 

Buss, L. VV. 1990. Competition within and between encrusting inverte- 
brates. Trend', /;,<>/. Evol. 5: 352-356. 
Buss, I,. W., and R. K. Grosberg. 1990. Morphogenetic basis for 

phenotypic differences in hydroid competitive behavior. Nature 343: 

63- (id 

Buss, L. VV., and J. B. C. Jackson. 1979. Competitive networks: non- 
transitive competitive relationships m cryptic coral reef environments. 

,4m. ,V<;/. 113: 223-234. 
Buss, I.. VV., and P. O. Yund. 1988. A comparison of recent and 

historical populations of the colonial hydroid Hydraclinia. Eculu^y 

69(3): 646-654. 



FITNESS CONSEQUENCES OF AGGRESSION 



187 



Buss, L. W., and P. (). Vund. 1989. A sibling species of Hydractinia in 
the northeastern United States. J. Mar. Biol. Assoc. UK 69: 857-874. 

Buss, L. W., C. S. McFadden. and D. R. Keene. 1984. Biology of 
Hydractiniid hydroids. 2. Histocompatibility effector system/competi- 
tive mechanism mediated by nematocyst discharge. Biol. Bull. 167: 
139-158. 

Chadvtick-Furman, N. E., and I. L. Weissman. 2003. Effects of allo- 
geneic contact on life-history traits of the colonial ascidian Botryllus 
schlosseri in Monterey Bay. Biol. Bull. 205: 133-143 

Cunningham, C. W., L. W. Buss, and C. Anderson. 1991. Molecular 
and geologic evidence of shared history between hermit crabs and the 
symbiotic genus Hydractinia. Evolution 45(6): 1301-1316. 

Feldgarden, M., and P. O. Yund. 1992. Allorecognition in colonial 
marine invertebrates: does selection favor fusion with kin or fusion 
with self?B/<>/. Bull. 182: 155-158. 

Ferrell, D. L. 2004. Gastropod shell size and morphology influence 
conspecific interactions in an encrusting hydroid. Mar. Ecol. Prog. Ser. 
(In press). 

Francis, L. 1973. Clone specific segregation in the sea anemone Antho- 
pleura e/egantissima. Biol Bull. 144: 64-72. 

Frank, U., T. Leitz, and W. A. Miiller. 2001. The hydroid Hydractinia: 
a versatile, informative cnidarian representative. Bioessays 23: 963- 
971. 

Gild, S., U. Frank, and O. Mokady. 2003. Allogeneic interactions in 
Hydractinia*: is the transitory chimera beneficial? Int. J. Dev. Biol. 47: 
433-438. 

Grosberg, R. K. 1988. The evolution of allorecognition specificity in 
clonal invertebrates. Q. Rev. Biol. 63: 377-412. 

Grosberg, R. K. 1992. To thine own self be true? An addendum to 
Feldgarden and Yund's report on fusion and the evolution of allorecog- 
nition in colonial marine invertebrates. Biol. Bull. 182: 454-457. 

Grosberg, R. K., and J. F. Quinn. 1986. The genetic control and 
consequences of kin recognition by the larvae of a colonial ascidian. 
Nature 322: 456-459. 

Grosberg, R. K., D. R. Levitan, and B. B. Cameron. 1996. Evolution- 
ary genetics of allorecognition specificity in the colonial hydroid Hy- 
dractinia symbiolongicarpus. Evolution 50: 2221-2240. 

Hart, M. W., and R. K. Grosberg. 1999. Km interactions in a colonial 
hydrozoan (Hydractinia symbiolongicarpus): population structure on a 
mobile landscape. Evolution 53: 793-805. 

Harvell, C. D., and R. K. Grosberg. 1988. The timing of sexual 
maturity in clonal animals. Ecology 69(6): 1855-1864. 

Hauenschild, C. von. 1954. Genetische und Entwicklungphysiologische 
Untersuchungen uber Intersexualitat und Gewebebevertralichkeit bei 
Hydractinia echiiuira Flem. Wilhelm Roux's Arch. Entwicklungsmech. 
Org. 147: 1-41. 

Hauenschild, C. von. 1956. Uber die Vererbung einer Gewebebever- 
tralichkeits bei dem Hydroiclpolypen Hydractinia echinata. Z. 
Natiirforsch. 116: 132-138. 

Hughes, T. P., and J. M. C'ancino. 1985. An ecological overview of 
cloning in Metazoa. Pp. 153-186 in Population Biology and Evolution 
of Clonal Organisms. J. B. C. Jackson, L. W. Buss, and R. E. Cook, 
eds. Yale University Press, New Haven. 

Ivker, F. B. 1972. A hierarchy of histo-compatibility in Hydractinia 
echinata. Biol. Bull 143: 162-174. 

Jackson, J. B. C. 1977. Competition on marine hard substrata: the 
adaptive significance of solitary and colonial strategies. Am. Nat. Ill: 
743-767. 



Jackson, J. B. C. 1985. Distribution and ecology of clonal and aclonal 
benthic invertebrates. Pp. 297-355 in Population Biologv and Evolu- 
tion of Clonal Organisms, i. B. C. Jackson, L. W. Buss, and R. E. 
Cook. eds. Yale University Press. New Haven. 

Karlson, R. H. 1978. Predation and space utilization patterns in a marine 
epifaunal community. J. E\p. Mar. Biol. Ecol. 31: 225-239. 

Karlson, R. H. 1980. Alternative competitive strategies in a periodically 
disturbed habitat. Bull. Mar. Sci. 30: 894-900. 

Levitan, D. L., and R. K. Grosberg. 1993. The analysis of paternity and 
maternity in the marine hydrozoan Hydractinia symbiolongicarpus 
using randomly amplified polymorphic DNA (RAPD) markers. Mol. 
Ecol. 2: 315-326. 

McFadden, C. S. 1986. Laboratory evidence for a size refuge in com- 
petitive interactions between the hydroids Hydractinia echinata (Flem- 
ming) and Podocoryne camea (Sars). Biol. Bull. 171: 161-174. 

McFadden, C. S., M. J. McFarland, and L. W. Buss. 1984. Biology of 
hydractmiid hydroids. 1. Colony ontogeny in Hvdractinia echinata. 
Biol. Bull. 166: 54-67. 

Mokady, O., and L. W. Buss. 1996. Transmission genetics of allorecog- 
nition in Hydractinia symbiolongicarpus (Cnidaria: Hydrozoa). Genet- 
ics 143: 823-827. 

Miiller, W. 1964. Experimented Untersuchungen uber Stockentwick- 
lung, Polypdifferenzierung und Sexualchimaren bei Hydractinia echi- 
nata. Wilhelm Roux's Arch. Entwicklungsmech. 155: 181-268. 

Purcell, J. E. 1977. Aggressive function and induced development of 
catch tentacles in the sea anemone Metridium senile (Coelenterata, 
Actiniaria). Biol. Bull. 153: 355-368. 

Rinkevich, B. 2002. Germ cell parasitism as an ecological and evolu- 
tionary puzzle: hitchhiking with positively selected genotypes. Oikos 
96: 25-30. 

Rinkevich, B., and Y. Loya. 1983. Oriented translocation of energy in 
grafted corals. Coral Reef* 1: 243-247. 

Rinkevich, B., and Y. Loya. 1985. Intraspecific competition in a reef 
coral: effects on growth and reproduction. Oecologia 66: 100-105. 

Sebens, K. P. 1986. Spatial relationships among encrusting marine or- 
ganisms in the New England subtidal zone. Ecol. Monogr. 56: 73-96. 

Shenk, M. A., and L. W. Buss. 1991. Ontogenetic changes in fusibility 
in the colonial hydroid Hydractinia symbiolongicarpus. J. E.\p. Zool. 
257: 80-86. 

Sokal, R. R., and F. J. Rohlf. 1995. Biometry. 3 rd ed W H Freeman. 
New York. 

Stebbing, A. R. D. 1980. Increase in gonozooid frequency as an adaptive 
response to stress in Campanularia //rwi\<i. Pp. 27-32 in Develop- 
mental and Cellular Biology of Coelenterates, P. Tardent and R. 
Tardent. eds. Elsevier, New York. 

Yamaguchi, M. 1975. Growth and reproductive cycles of the marine 
touling ascidians Cionu intestinalis, Stvcln plicata, Botrylloides viola- 
ceous, and Leptoc/inum mitsukurii at Aburatsubo-Moroiso Inlet (cen- 
tral Japan). Mar. Biol. 29: 253-259. 

Yund, P. O., and M. Feldgarden. 1992. To thine own self be true? Yes! 
Thou canst not then be false to any other. A reply to Grosberg. Biol. 
Bull. 182: 458-459. 

Yund, P. O., and H. M. Parker. 1989. Population structure of the 
colonial hydroid Hydractinia sp. nov. C in the Gulf of Maine. J. Exp. 
Mar. Biol. Ecol. 125: 63-82. 

Yund, P. O., C. W. Cunningham, and L. W. Buss. 1987. Recruitment 
and postrecruitment interactions in a colonial hydroid. Ecology 68: 
971-982. 



Reference: Biol. Bull. 206: IS.X-196, (June 20041 
2004 Marine Biological Laboratory 



Effects of Hypercapnic Hypoxia on the Clearance of 

Vibrio campbellii in the Atlantic Blue Crab, 

Callinectes sapidus Rathbun 

JEREMY D. HOLMAN, KAREN G. BURNETT. AND LOUIS E. BURNETT* 
Grice Marine Laboratory, College of Charleston, 205 Fort Johnson, Charleston, South Carolina 29412 



Abstract. Callinectes sapidus, the Atlantic blue crab, en- 
counters hypoxia, hypercapnia (elevated CO-,), and bacterial 
pathogens in its natural environment. We tested the hypoth- 
esis that acute exposure to hypercapnic hypoxia (HH) alters 
the crab's ability to clear a pathogenic bacterium. Vibrio 
campbellii 90-69B3, from the hemolymph. Adult male 
crabs were held in normoxia (well-aerated seawater) or HH 
(seawater with Po-, = 4 kPa: Pco, = 1.8 kPa; and pH = 
6.7-7. 1 ) and were injected with 2.5 X 10 4 Vibrio g~ ' body 
weight. The animals were held in normoxia or in HH for 45, 
75. or 210-240 min before being injected with Vibrio, and 
were maintained in their respective treatment conditions for 
the 120-min duration of the experiment. Vibrio colony- 
forming units (CPU) ml ' hemolymph were quantified be- 
fore injection, and at 10. 20. and 40 min afterward. Total 
hemocytes (THC) ml ' of hemolymph were counted 24 h 
before ( 24 h). and at 10 and 120 min after injection. Sham 
injections of saline produced no change in the bacterial or 
hemocyte counts in any treatment group. Among the groups 
that received bacterial injections. Vibrio was almost com- 
pletely cleared within 1 h, but at 10-min postinjection, 
Vibrio CPU ml ' hemolymph was significantly higher in 
animals held in HH for 75 and 210-240 min than in those 
held in normoxia. Within 10 min after crabs were injected 
with bacteria. THC ml ' significantly decreased in control 
and HH45 treatments, hut not in the HH75 and HH2 10-240 
treatments. By 120 min after injection of bacteria, hemocyte 
counts decreased in all but the HH45 group. These data 
demonstrate that HH significantly impairs the ability of blue 



Received 2 Dccemher 20113; accepted X April 2004. 

I'o whom tuiivs|>omK e should he addressed. E-mail: hurnettlts 1 
cotc.edu 

Abbreviations: ('Ft', colony toimm;j unit: HH, hypercapnic hypoxia; 
PPO. prophenoloudase: THC. lotal hemocyte count. 



crabs to clear Vibrio from the hemolymph. These results 
also suggest that HH alters the normal role of circulating 
hemocytes in the removal of an invading pathogen. 

Introduction 

Where they occur naturally in coastal waters, hypoxia 
(low oxygen) and hypercapnia (high carbon dioxide) are 
believed to contribute to outbreaks of infectious disease, 
such as mycobacteriosis in fish (Rhodes et ai, 2001) and 
infections with a protozoan parasite in oysters (Anderson et 
nl.. 1998). The effects of hypoxia and hypercapnic hypoxia 
(HH) on disease susceptibility are likely to be multiple and 
complex, changing not only respiration and circulation, but 
also immune defense (Burnett, 1997). In laboratory-based 
studies, we and others have shown that hypoxia and HH can 
increase the rate of mortality in penaeid or palaemonid 
shrimp injected with live bacterial pathogens (Le Moullac et 
til.. 1998; Mikulski et ai. 2000). Here we asked whether 
levels of dissolved d and CO^ that increase mortality rates 
in shrimp also reduce the rate at which live bacteria are 
removed from the hemolymph of another crustacean spe- 
cies, Callinectes sapidus Rathbun, 1896. the Atlantic blue 
crab. 

Crustaceans employ a broad spectrum of soluble (hu- 
moral) factors in immune defense, including non-self rec- 
ognition proteins, immediate defense molecules such as 
clotting proteins and prophenoloxidase, and antimicrobial 
peptides (reviewed by Bachere 1998, 2000). Many of these 
humoral factors are produced, stored, and released from 
hemocytes the major cellular components of the crusta- 
cean immune system. In addition, hemocytes can adhere to 
a pathogen, triggering phagocytosis and production of 
highly toxic reactive oxygen species (Song and Hsieh. 
1994; Gargioni and Barracco. 1998; Munoz el til.. 2000). 



18X 



CLEARANCE OF BACTERIA IN BLUE CRABS 



189 



In well-aerated normoxic water, crustaceans rapidly re- 
move bacteria or other large particles from the hemolymph. 
with a coordinate drop in the total hemocyte count per 
milliliter of hemolymph (THC ml" 1 ) (White and Ratcliffe, 
1982; Martin et ol.. 1993). Smith and Ratcliffe (1980) and 
Martin et al. (1993, 1998) have suggested that hemocytes 
aggregate with injected particles to form nodules that be- 
come trapped in small capillary beds of well-vascularized 
tissues such as the gill and the hepatopancreas. This aggre- 
gation is believed to involve non-self recognition proteins, 
prophenoloxidase (PPO), and antimicrobial peptides. In 
contrast, van de Braak et al. (2002) presented evidence that 
hemocytes become fixed in peripheral organs before taking 
up bacteria by phagocytosis. 

After shrimp received an injection of pathogenic bacteria, 
those held in hypoxia (Le Moullac et al.. 1998) or HH 
(Mikulski et al., 2000) had higher rates of mortality than 
animals held under normoxic conditions. Several mecha- 
nisms underlie the effects of dissolved gasses on the sus- 
ceptibility of organisms to a pathogen. Hypoxia and hyper- 
capnia can suppress several key components of the 
invertebrate immune system that are responsible for killing 
and clearing bacterial pathogens from tissues. In penaeid 
shrimp, both hypoxia (Le Moullac et al.. 1998) and HH 
(Mikulski et al., 2000) induced significant decreases in THC 
mP 1 hemolymph while also decreasing resistance to bac- 
terial pathogens. Low O 2 and low pH (induced by high 
CO 2 ) independently and additively suppressed /;; vitro pro- 
duction of reactive oxygen species by oyster hemocytes 
(Boyd and Burnett, 1999). and hypoxia suppressed phago- 
cytosis in the blue shrimp Litopenaeus stylirostris (Le 
Moullac et al., 1998). However, the complexity of the 
immune responses in the whole organism makes it difficult 
to attribute changes in disease outcome to any specific 
defense mechanism. 

As an alternative approach to understanding the effects of 
dissolved O 2 and CO 2 on susceptibility to microbial patho- 
gens in crustaceans, we tested whether hypoxia and hyper- 
capnia can suppress the ability of the blue crab to eliminate 
live bacteria from its hemolymph. We chose blue crabs 
because they are hearty organisms that are abundant in 
estuaries where levels of oxygen and carbon dioxide fluc- 
tuate, and they can easily tolerate experimental manipula- 
tions such as a bacterial injection and multiple samplings of 
hemolymph. Animals with prior exposure to HH for 0, 45. 
75, or 210-240 min were injected with live Vibrio cainp- 
bellii or saline and were maintained in HH. For control 
groups, crabs were held in normoxia before and after injec- 
tion with the same dose of live bacteria or saline. One day 
before injection (-24 h) and at 10, 20, and 40 min after 
injection, we monitored the number of colony-forming units 
(CPU) of bacteria ml" 1 hemolymph. We also monitored 
THC mP 1 of all experimental animals at -24 h, 10 min. 



and 120 min postinjection and compared the responses of 
their circulating hemocytes to bacterial challenge. 

Materials and Methods 

Male blue crabs were trapped in the creeks of Charleston 
Harbor, Charleston, South Carolina and transported to the 
Grice Marine Laboratory where they were held in recircu- 
lating seawater at 25 ppt salinity and 24-26 C. The crabs 
weighed between 92 and 236 g and were held for a mini- 
mum of 3 days prior to experimentation, but no longer than 
10 days. The animals were fed frozen fish or shrimp each 
day, but food was withheld for at least 24 h before the 
experiments began. 

Preparation of the crabs for treatment 

A 1-mm hole was drilled in the carapace directly over the 
heart, creating a port through which saline alone, or saline 
containing bacteria, was injected directly into the ventricle. 
The bacteria injected into the heart would then be rapidly 
distributed throughout the circulatory system. Two similar 
holes were drilled over the pericardium adjacent to the heart 
through which hemolymph was withdrawn from the peri- 
cardium. Two holes were drilled in case we could not easily 
withdraw hemolymph from one hole. A thin layer of latex 
rubber was glued over each hole with cyanoacrylate glue. A 
needle could be inserted into each hole through the rubber 
diaphragm and withdrawn easily without causing bleeding. 
These procedures were performed 2 days prior to experi- 
mentation. 

Intracardiac (postbranchial) injection of bacteria 

The postbranchial point of injection used in the present 
study is distinct from that used by others who injected 
pathogens into muscle tissues (Alday-Sanz et al., 2002) or 
sinuses downstream from the heart (Smith and Ratcliffe, 
1980; Martin et al.. 1993. van de Braak et a!., 2002). 
Injecting bacteria directly into the single-chambered heart 
ensures that the bacteria will be rapidly and evenly distrib- 
uted throughout the circulatory system. The heart of the blue 
crab distributes hemolymph through seven major arteries 
(McGaw and Reiber. 2002), and the high cardiac output 
typical of crabs (McMahon and Burnett, 1990) ensures a 
uniform distribution throughout the crab's circulatory sys- 
tem, as shown by studies using thermal dilution techniques 
(Burnett et al., 1981 ). 

The effects of acute exposure to HH on the cardiac output 
of C. sapidus are unknown, but acute hypoxia causes a 
reduction in heart rate of about 25% (deFur and Mangum. 
1979). Cardiac output in crustaceans is often strongly influ- 
enced by changes in cardiac stroke volume rather than heart 
rate, but even with a 25% reduction in cardiac output, 
mixing and circulation of bacteria injected into the ventricle 



190 



J. D. HOLMAN ET AL 



would still he rapid. Injection of bacteria into the heart 
avoids the localization of pathogens that can occur for 
reasons not specifically associated with normal routes of 
clearance by the whole organism. For example, injecting 
pathogens into the infrabranchial sinus, which supplies he- 
molymph to one or more gills, may bias the observed role of 
the gill in pathogen clearance. In the present study, sam- 
pling hemolymph from the pericardia! sinus, which is im- 
mediately downstream from the gill, ensured that the bac- 
teria sampled had made a complete circuit through the 
circulatory system. 

Preparation of the pathogen 

The bacterial pathogen used in these studies was Vibrio 
campbellii 90-69B3, which was originally isolated from 
diseased shrimp by D. Lightner and L. Mahone (University 
of Arizona). The 16S rRNA sequence of this strain places it 
in the V. parahaemolyticus/V, hcin'eyi family with 99% 
identity to V. campbellii (unpubl. data, Eric Stabb, Univer- 
sity of Georgia). For each assay, V. campbellii 90-69B3 
(hereafter referred to as V. campbellii) was thawed from 
frozen aliquots. streaked onto tryptic soy agar (TSA) + 
2.5% NaCl, and incubated overnight at 25 C. A separate 
aliquot was used for each assay. A wooden applicator stick 
was used to transfer the bacteria from the culture plate to 
sterile 2.5% NaCl buffered with 10 mmol l~ ] HEPES 
adjusted to pH 7.6 (HEPES saline). The concentration til I'. 
caniphcllii was adjusted to an optical density of 0.1 at 540 
nm (OD 54(lnm ). This OD 540nm had previously been deter- 
mined to equal 1.0X 1 s CPU ml' 1 (Mikulski etui.. 2000). 
The bacterial suspension was then diluted with HEPES 
saline to obtain the desired dose for injection. 

Assexsmcnt of baseline conditions 

One day (i.e., -24 h) before each bacterial challenge 
experiment, two 100-ju.l samples of hemolymph were with- 
drawn through the pericardia! sampling port. One sample 
was used to determine whether the crab had detectable 
levels of live, culturable bacteria in the hemolymph. as 
measured in the CFU assay. The other sample was used to 
determine the THC ml ' in the hemolymph. To measure 
CFU ml" ', one part of hemolymph was diluted with 9 parts 
HEPES saline. A 150-jul sample of this mixture was sus- 
pended in marine agar and plated over TSA and TCBS 
(thiosulfate citrate bile sucrose) agar plates. TSA supports 
the growth of a wide range of bacteria: TCBS agar is more 
selective, and supports the growth of a few species of 
l:\clicricliiu anil Vibrio, including V. campbellii. Plates 
were incubated at 25 "C for 24 h, at which time the number 
of bacterial colonies \\as counted and recorded. For each 
hemolymph sample, bacterial colonies on three replicate 
plates were counted and averaged. CFU ml" 1 was calcu- 
lated according to the formula CFU plate"' X 10 dilution 



factor/0.15 ml, where CFU is the average number of bac- 
terial colonies counted on three replicate TCBS plates for 
each 0. 15-ml hemolymph sample diluted 10-fold in saline 
prior to plating. Only crabs whose hemolymph had no CFU 
on TSA or TCBS plates at the 24 h time point were used 
in these experiments. The frequency with which CFU are 
detected in the hemolymph of crabs collected from the Held 
varies considerably with the season. During early to mid- 
summer, when these experiments were performed, about 
10% to 15% were positive for CFU in the hemolymph at 
24 h and were rejected for experimental use. The same 
assay was used to determine CFU ml"' in hemolymph 
samples taken from crabs after injection of V. campbellii or 
saline, except that the marine agar containing the diluted 
hemolymph sample was plated only on TCBS plates. This 
provided a measure of assurance that the bacterial colonies 
being counted in the hemolymph arose from the injected 
bacteria. 

The THC ml ' in a hemolymph sample was determined 
as follows. Hemolymph (100 /u,l) was drawn into a syringe 
containing 900 /u.1 of ice-cold 10% neutral buffered formalin 
(Mix and Sparks, 1980). After mixing, an aliquot of the 
hemocyte suspension was transferred to a hemocytometer 
for direct counting. Hemocytes were counted in three sep- 
arate aliquots of each hemolymph sample and averaged for 
each crab at each time point in these experiments. 



Experimental protocol 

In a typical experiment (Fig. 1 ), a crab was transferred to 
a 17-1 glass aquarium in which oxygen and carbon dioxide 
levels were regulated (Mikulski </ <//.. 2000). For all exper- 
iments, the seawater was at first aerated vigorously; and for 
treatments in normoxia, crabs were held in this well-aerated 
water (20.7 kPa />o, and <0.()6 kPa /Vo,) throughout the 
experiment. At the start of all HH treatments, the oxygen 
and the carbon dioxide pressures of the water were regu- 
lated (Mikulski et al.. 2000) to achieve values of 4 kPa Po 2 
and 1 .8 kPa Pco-> within 20 to 30 min. The crabs were held 
in HH for one of three durations prior to injection of 
bacteria (45, 75, and between 210 and 240 min), and they 
remained in these HH conditions throughout the experiment 
(Fig. 1). The crabs were injected with V. campbellii sus- 
pended in HEPES saline. The bacterial suspension (between 
40 ju.1 and 140 jiil. depending on the size of the crab) was 
injected directly into the ventricle. Control animals from the 
normoxia treatment were injected with the same dose of 
bacteria. 

Crabs were injected with 2.5 X 10 4 bacteria g"' body 
weight, to achieve a circulating dose of 1.0 X K)" 1 V. 
campbellii ml ' of hemolymph. assuming a hemolymph 
volume of 25 ml 100 g~ ' body weight (Gleeson and 
Zubkoff. 1977). The dose is slightly below the LD 50 for 



CLEARANCE OF BACTERIA IN BLUE CRABS 



191 



Well aerated 



HH210-240 



HH75 



HH45 



I- 08 , 



_ 


E 


E 


SOD 


3 







U. 


I 


K O 


O 





-240 -120 10 20 40 60 

Time (min) 



120 



Figure 1. An illustration of the experimental design, indicating the 
timing of exposure to hypercapnic hypoxia (HH), bacterial injection, and 
hemolymph withdrawal along with subsequent analyses. Crabs were placed 
in experimental tanks and HH treatments were initiated at different times 
prior to the injection of bacteria, which is indicated at time = 0. For 
example, in the HH210-240 treatment, HH was initiated between 210 and 
240 minutes before injection and maintained until 120 min after injection. 
The normoxia group was held in well-aerated water before and after the 
injection of bacteria. For the sham injection treatment, crabs were held in 
one of the HH treatments or in normoxia, then were injected with HEPES- 
saline at time = 0, and maintained in the same treatment condition for 120 
min after injection. Hemolymph samples were taken from animals in all 
treatment groups at the same time points and for the same assays as 
illustrated. 

juveniles of the penaeid shrimp Litopenaeus vannamei 
(Mikulski el /., 2000). 

After the bacteria were injected, animals in HH treat- 
ments were maintained in HH and those in normoxic treat- 
ments were held in normoxia. Hemolymph was sampled 
from the pericardium of each crab at 10, 20, 40, and 120 
min. Preliminary experiments indicated that these time 
points would be optimal for discerning the impacts of HH 
on hemocyte counts and bacterial clearance. At the 10-min 
time point, two hemolymph samples were withdrawn from 
the pericardium. One unfixed sample was used to quantify 
the Vibrio CPU ml" 1 remaining in the hemolymph, as 
described above. The other sample was fixed in formalin 
and used to quantify THC ml" 1 hemolymph, as described 
above. At the 20-min and 40-min time points, hemolymph 
was sampled, and the number of CPU ml" ' was determined 
again. Finally, a sample of hemolymph taken at 120 min 
was fixed in formalin to monitor THC ml" '. The crab was 
then removed from the aquarium, frozen, and ultimately 
autoclaved and discarded. 

To control for the effects of injection and hemolymph 
sampling, sham experiments were performed for each treat- 
ment (normoxia, HH45, HH75, and HH2 10-240) by inject- 



ing a sterile solution of HEPES saline into the ventricle as 
described above. Hemolymph was sampled at the time 
points indicated above (Fig. 1), and V. campbellii and he- 
mocytes were quantified. During all injections and sam- 
plings, the animals remained submerged in the aquarium, 
either in normoxic or HH water, with minimal disturbance. 
The crab was near the top of the 17-1 aquarium on a plastic 
platform, where it was completely immersed and free to 
move. To inject bacteria or sample hemolymph, the crab 
remained immersed but was lifted so that the injection or 
sampling ports on its carapace were raised to the surface of 
the water. 

Aseptic techniques were used when working with the 
bacteria, and all waste material was autoclaved or disin- 
fected with 2% chlorine bleach. Experimental tanks were 
rinsed with 2% bleach daily, and the filtration systems were 
rinsed with fresh water daily. 

Data analysis 

SigmaStat 3.0 software was used to perform all statistical 
analyses. To determine whether the amount of bacteria in 
the hemolymph changed as a function of time after injec- 
tion, a one-way ANOVA was performed on the V. camp- 
bellii CPU ml ' hemolymph at 10, 20, and 40 min within 
each treatment group. All tests for normality (Kolmogorov- 
Smirnov test) failed; therefore, a Kruskal-Wallis ANOVA 
on ranks test was used. When differences within a treatment 
group were detected, the Student-Newman-Keuls method 
was used for multiple comparisons between individual time 
points. 

To determine whether there were differences at individ- 
ual times among treatment groups, a one-way ANOVA was 
performed on CPU ml " ' data at 1 0, 20, and 40 min across 
all treatment groups (normoxia, HH45, HH75, and HH210- 
240). As above, all tests for normality (Kolmogorov-Smir- 
nov test) failed, so a Kruskal-Wallis ANOVA on ranks test 
was used. When the test indicated a significant effect of 
treatment within a time, a Dunn's test was used, because of 
unequal sample sizes, to compare HH treatments with the 
normoxic value. 

To determine whether there were differences in THC 
ml" ' at one day prior to the initiation of the experiments, a 
one-way ANOVA was performed for the crabs across all 
normoxic and HH treatments. For subsequent analysis, THC 
ml" ' data at 10 and 120 min were normalized to the 24 h 
counts for an individual crab. A one-way ANOVA was 
performed on normalized THC ml " ' for each normoxic and 
HH treatment group as a function of time after sham and 
bacterial injections. All tests for normality (Kolmogorov- 
Smirnov test) or equal variances failed and, therefore, a 
Kruskal-Wallis ANOVA on ranks test was used. When a 
significant effect of time within a treatment group was 
indicated, a comparison of 10-min and 1 20-min counts with 



192 



J. D. HOLMAN ET AL 



-24 h counts was performed using Dunnett's test (equal 
sample sizes). 

Results 

Clearance of bacteria from the hemolymph 

The theoretical maximum Vibrio CPU mP 1 hemolymph 
after injection is 1 X 10 5 ml" 1 . This value is based on the 
known number of bacteria injected and assumes a homoge- 
neous distribution of bacteria in the hemolymph as well as 
a hemolymph volume of 25 ml per 100-g crab (Gleeson and 
Zubkoff, 1977). Patterns of bacterial clearance were similar 
in all treatment groups: when the crabs were injected with 
bacteria. V. campbellii CPU ml" 1 hemolymph declined 
precipitously to very low levels within 10 min after injec- 
tion and became almost undetectable after 40 min (Table 1, 
Fig. 2). Even though most of the bacterial clearance oc- 
curred before the 10-min measurement, the decrease be- 
tween the CPU ml" ' at 10 min and the value at 40 min was 
significant in all treatment groups. Comparisons between 10 
and 20 min and between 20 and 40 min revealed significant 
differences in some, but not all. cases (Table 1. Fig. 2). 

Comparisons of different treatments at single time points 
after injection of V. campbellii revealed significant differ- 
ences in CPU ml" 1 at 10 min between the normoxic treat- 
ment and the HH75 treatment and between the normoxic 
treatment and the HH210-240 treatment (Kruskal-Wallis 
ANOVA on ranks and Dunn's multiple comparison proce- 
dure. P = 0.002): but there were no differences between the 
normoxic and the HH45 treatments (Fig. 2). With treatment 
as a variable, differences were detected 20-min postinjec- 
tion (Kruskal-Wallis ANOVA on ranks. P = 0.027). but no 
differences among the individual treatments were found 



Table 1 

Statistical analysis of the cnlony-fi>rminx units (CFUl ml~' of Vibrio 
campbellii in the hemnlymph nfcrnhs at different times following 
injection 

P value: Pairwise 

comparisons using Student- 

Newman-Keuls method 







P value: 












Kruskal-Wallis 


10 and 


10 and 


20 and 


Treatment 


n 


ANOVA 


20 min 


40 min 


40 min 


Normoxia 


8 


0.005 


NS 


<0.05 


NS 


HH45 


4 


0.005 


NS 


<0.05 


<0.05 


HH75 


7 


< 0.001 


0.05 


<0.05 


<0.05 


HH2 10-240 





().()( IX 


(Ills 


<0.05 


NS 





4000 - 


- 






* 


^ 

E 


3000 - 


HH75 Q 

"\ 


LL 

o_ 


2000 - 


HH21 0-240 % \ 
\\ 


o 




A 


k. 
.0 


1000 - 


HH45 Jl ^- L 






Normoxia ~^>^?~ ~- __ 




- 


5 



10 20 30 

Time (min) 



40 



Tests for normality failed on one-way ANOVA: therefore, data within a 
treatment group were tested for differences usinn a Kruskal-Wallis 
ANOVA on ranks. Values at different time intervals within a treatment 
were compared pairwise usini.' the Student-Newman-Keuls method. HH. 
hypercapnic hypoxia: NS. nonsignificant. 



Figure 2. Colony-forming units (CPU) ml ' of Vibrio campbellii 
circulating in the hemolymph at different times after injection plotted as a 
function of treatment in well-aerated normoxic water or in hypercapnic 
hypoxia water (Pco, = 1.8 kPa. Po 2 = 4 kPa). Crabs were exposed to 
normoxia or to hypercapnic hypoxia (HH) for different times (given in 
minutes), then injected with bacteria at time = 0. and for the subsequent 
duration of the experiments were held in well-aerated (normoxia) or HH 
water. At time = 0. crabs were injected with 2.5 x 10 4 V. campbellii g~' 
body weight to achieve a theoretical circulating concentration of 100 X 10 3 
CPU (colony-forming units) mr 1 hemolymph. Levels of bacteria in he- 
molymph (CPU ml" 1 ) are shown at 10. 20. and 40 min after injection. 
Mean values standard error are shown. Significant differences between 
the normoxic treatment and the HH treatment occurred only at 10 min after 
injection and are indicated by an asterisk (*). 



using Dunn's multiple comparison procedure. No differ- 
ences were detected among treatments at 40-min postinjec- 
tion when treatment was used as a variable (Kruskal-Wallis 
ANOVA on ranks. P = 0.131 ). No bacterial colonies were 
detected at any time in the hemolymph samples from ani- 
mals that received sham injections of saline (data not 
shown). 

Hemocyte counts 

The THC ml ' in hemolymph of crabs prior to treatment 
( -24 h) was the same across all treatment groups (ANOVA, 
P = 0.557: Figs. 3 and 4). No treatment group that received 
a sham injection (H = 17) showed a significant difference in 
circulating hemocyte counts at any time (Kruskal-Wallis 
ANOVA on ranks. P > 0.155. Fig. 3). THC ml ' of 
animals held in normoxia (well-aerated conditions) declined 
significantly 10 and 120 min after injection with V. camp- 
hcllii (Table 2; Fig. 4). Circulating hemocyte counts de- 
clined in the HH 45 (hypercapnic hypoxia 45-min) treat- 
ment group 10 min after injection of V. campbellii, but at 
120 min. the count was not detectably different from the 
baseline count at -24 h (Table 2. Fig. 4). When crabs were 
held in HH lor 75 min and then injected with V. campbellii. 
there was no change in THC ml~ ' after 10 min, but the 
hemocyte concentration declined significantly after 120 



CLEARANCE OF BACTERIA IN BLUE CRABS 



193 



120x10 6 



Saline Sham Treatments 



100x10 6 - 



80x1 O 6 - 
CO 



?, 60x1 O 6 - 

u 

o 

I 40x1 O 6 - 

X 

20x1 O 6 - 



"~ 


| Normoxia 




3 HH45 








1-fJ 

fj HH75 




I 






IK HH210-240 
" 








I 










i 


i 






/ 




X 

X 
X 
X 

x 

X 

X 

x 




1 




'//////////////A 






T 




1 xy 


i i 1 i i 





-24 hours 



60 



120 



Time (min) 



Figure 3. Total hemocyte counts (THC) ml ' of hemolymph in crabs 
one day prior to treatment (-24 h) and 10 and 120 min after injection of 
saline in four treatment groups. Normoxia = crabs in well-aerated water, 
HH treatments = hypercapnic hypoxia (Po 2 = 4 kPa, Pco 2 = 1.8 kPa) 
administered for 45. 75, and 210-240 min before the saline injection at 
time = 0. No significant differences were detected within any treatment 
between pre-injection ( 24 h) THC ml~' and postinjection values at 10 
and 120 min. Mean values + standard error are shown. 



min. The same pattern of response occurred when crabs 
were incubated in HH for 210-240 min and then injected 
with V. campbellii (Table 2; Fig. 4). 

Discussion 

Minutes after being injected with Vibrio campbellii. blue 
crabs rapidly remove the bacteria from their hemolymph. 

Vibrio Treatments 







| Normoxia 


100x10 6 - 


HH45 


"E 80x1 6 - 

in 

0) 
Ix 60x10 6 - 




1 


I 


| 


D HH75 

g HH21 0-240 


u 
o 




^ 




^ 


I 


E 40x1 O 6 - 

X 




^ 




X 

X 






T * .. 


20x10 6 - 




' 




X 

s 


| T 




N K I 










X 


X 














X; 


Bv 














x 


v 














x 


H/ 










/ 











v ^B^ loj 




SS |! ' ' i ' ' 



-24 hours 



60 

Time (min) 



120 



Figure 4. Total hemocyte counts (THC) ml ' of hemolymph in crabs 
before treatment ( 24 h) and 10 and 120 min after injection of Vibrio 
campbellii in four treatment groups. Normoxia = crabs in well-aerated 
water, HH treatments = hypercapnic hypoxia (Po 2 = 4 kPa, Pco 2 = 1.8 
kPa) administered for 45, 75, and 210-240 min before the injection of 
bacteria. Significant differences within a treatment between pre-injection 
(-24 h) THC mP 1 and postinjected values at 10 and 120 min are indicated 
by an asterisk (*). Mean values + standard error are shown. 



Table 2 

Statistical analysis of total hemocyte counts ml 
injection of Vibrio campbellii 



(THC ml' 1 1 following 









P value: 








Comparison with 








pretreatment using 








Dunnett'x method 






P value: Kruskal-Wallis 




Treatment 


n 


ANOVA 


10 min 120 min 


Normoxia 


8 


0.002 


<0.05 <0.05 


HH45 


4 


- 0.001 


<0.05 NS 


HH75 


7 


0(101 


NS <0.05 


HH2 10-240 


9 


0.044 


NS <0.05 



Data were normalized to pretreatment ( 24 h) THC ml ' and compared 
as a function of time. Tests for normality or equal variances failed on 
one-way ANOVA: therefore, data within a treatment group were tested for 
differences using a Kruskal-Wallis ANOVA on ranks. THC mP ' at 10 and 
120 min after injection were then compared to pretreatment numbers using 
Dunnett's method. HH, hypercapnic hypoxia: NS. nonsignificant. 

For animals held in well-aerated water, this rapid clearance 
of bacteria is associated with a significant decline in the 
concentration of circulating hemocytes. The present study 
demonstrates that bacterial clearance from the hemolymph 
of blue crabs is reduced when the animals are held in water 
that is hypercapnic and hypoxic. Moreover, this reduced 
ability to clear bacteria is associated with a slower decline in 
circulating hemocytes after injection of bacteria. Taken 
together, these findings suggest that the low-oxygen and 
acidic internal milieu of a blue crab exposed to hypercapnic 
hypoxia may impair the mechanisms responsible for clear- 
ing pathogens from its hemolymph. 

The rapid removal of bacteria from the hemolymph of the 
blue crabs in the present study confirms findings in other 
crustacean species (Merrill ct ai. 1979; Smith and Ratcliffe, 
1980; White and Ratcliffe, 1982; Martin et al., 1993; van de 
Braak et at., 2002). The efficiency and the rate of clearance 
vary with the particular pairing of host and bacterial species. 
For example, Martin ct til. (1993) found that the gram- 
positive bacteria Bacillus ccrcus. B. subtilis, and Aerococ- 
CHS viridans were cleared to undetectable levels from the 
hemolymph of the penaeid shrimp Sycionia ingentis within 
10 min of injection. The gram-negative bacteria Pseudomo- 
nas fluorescens and Vibrio alginolyticus were reduced, but 
not eliminated: 7.8% and 23%, respectively, of the bacteria 
were still free in the hemolymph one hour after injection. 
The different rates at which bacteria are cleared may reflect 
the binding specificity of hemolymph components such as 
lectins ( Vargas- Albores ct til., 1993, 1997), anti-microbial 
peptides (Schnapp ct u/., 1996; Destoumieux et al.. 1997; 
Khoo et al., 1999; Bartlett ct ai, 2002), the prophenoloxi- 
dase (PPO) cascade (Aspan ct ai, 1995), and hemocytes 
(Gargioni and Barracco. 1998). 

The present study demonstrates that the rate of bacterial 



194 



J. D. HOLMAN ET AL 



clearance from the hemolymph of blue crabs is reduced 
when the animals are held in water that is hypercapnic and 
hypoxic. The systemic respiratory responses of blue crabs to 
hypoxia are well-documented and are typical of brachyuran 
crabs (Burnett, 1992, 1997). A quiescent blue crab in well- 
aerated water has the high postbranchial oxygen pressures 
(Po, = 13 kPa) typical of many water-breathers (deFur et 
al.. 1990). Hemolymph passes through the tissues, where 
oxygen is consumed, and returns to the infrabranchial sinus 
just before it passes through the gills, where it is oxygen- 
ated. Oxygen pressures of prebranchial hemolymph are as 
low as 1 kPa (Booth et al. 1982). Thus, a hemocyte circu- 
lating freely in the hemolymph is exposed to a wide range 
of oxygen pressures. During hypoxia, oxygen pressures in 
the hemolymph fall to levels that, depending on the severity 
of the ambient Po 2 . may be very low. deFur et al. (1990) 
reported oxygen pressures of 2.4 kPa in the postbranchial 
hemolymph when the ambient Po, of the water was 6.7 kPa. 
The ambient Po 2 used in the present study was lower (4 
kPa). forcing the hemolymph oxygen pressures to fall below 
2.4 kPa. The main point is that the mechanisms associated 
with the clearance of bacteria must operate in a very low- 
oxygen environment within the crab when the animal is 
exposed to hypoxic water. 

In the present study, at 10 min after bacterial injection, 
crabs in the HH75 and HH2 10-240 treatments had signif- 
icantly greater numbers of V. campbellii in the hemolymph 
than the control crabs had (Fig. 2). Thus, the process of 
bacterial clearance is somehow inhibited by hypercapnic 
hypoxia. The bacteria are ultimately cleared in all treat- 
ments, but it is the rate of clearance that is compromised. 
These data support the idea that rapid clearance of live 
bacteria, whether by bactericidal mechanisms in the hemo- 
lymph or by physical trapping and removal to peripheral 
sites, contributes to disease resistance in crustaceans by 
limiting the spread of free pathogens to other tissues. The 
effects of hypoxia on bacterial clearance in crustaceans have 
received limited attention. Penaeus monodon exposed to 
hypoxia (1.8-2.0 mg 1 ~ '. Po, = 5.4-6.4 kPa) cleared live 
V. han-eyi more slowly from the hemolymph than did 
control animals (Direkbusarakom and Danayadol, 1998). 
However, results from the treatment groups were highly 
variable, and the authors questioned the health of some of 
the animals. The ability of the freshwater prawn Macrohra- 
chinnt rosenbergii to clear live Enterococcus was signifi- 
cantly decreased by exposure to hypoxia (Po 2 = 4.4 and 7.0 
kPa) for 12 h (Cheng et ai. 2002). Neither study (Direk- 
busarakom and Danayadol, 1998: Cheng et ai. 2002) re- 
ported the absolute numbers of bacteria in the hemolymph. 
Since bacteria arc generally cleared from crustacean hemo- 
lymph within minutes to hours following injection, the 
results of these two studies are difficult to compare with the 
present work. 

The impacts of hypercapnia alone or in combination with 



hypoxia on bacterial clearance in crustaceans have been 
largely neglected. Mikulski et al. (2000) reported that hy- 
percapnic hypoxia at 4 kPa CK, 2 kPa CO,, and a pH range 
of 6.8 to 7.0 decreased survival following bacterial chal- 
lenge in both Litopeneaus vannamei and the grass shrimp 
Palaemonetes pitgio. 

The decline in circulating hemocytes that accompanies 
the clearance of injected bacteria in crabs from the nor- 
moxia treatment is consistent with the role of this cell type 
in immune defense in crustaceans. This effect mirrors sim- 
ilar declines in the hemocyte counts of crustaceans that have 
been injected with foreign substances including lipopoly- 
saccharide, /3-1.3 glucan (laminaran). or bacteria (Smith and 
Soderhall, 1983; Persson et ai, 1987; Martin et ai. 1993: 
van de Braak et ai. 2002). although this decline is not 
universally observed (Destoumieux et ai. 2000; Cheng and 
Chen, 2001). Following injection of foreign matter into 
crustacean tissues, hemocytes move into the injection site to 
seal the wound and to trap and kill invading bacteria by 
mechanisms such as melanization (Fontaine and Lightner. 
1974; van de Braak et ai. 2002). Several studies using in 
vitro and in vivo measurements have shown that hemocytes. 
in the presence of foreign particles, rapidly associate with 
each other to form aggregates, or nodules (Smith et al.. 
1984; Martin et al.. 1998). Aggregate formation may be 
mediated by lectins such as LPS-binding protein and |3-glu- 
can-binding proteins ( Vargas- Albores et al.. 1993. 1997). 
by components of the prophenoloxidase cascade (Aspan et 
ai. 1995), or by other unidentified receptors on hemocytes. 
Martin et al. (1998) presented evidence that these aggre- 
gates grow in size by the adhesion of hemocytes until they 
become trapped in the narrowest diameter vessels of the 
body. The extensive capillary network of the gill that sup- 
ports respiration and osmotic regulation appears to play an 
important role in the trapping and removal of these nodules 
(Fontaine and Lightner, 1974; Johnson. 1976: Smith and 
Ratcliffe, 1980), although this is not observed in all cases 
(van de Braak et al.. 2002). Aggregates of hemocytes with 
or without associated bacteria have also been reported to 
accumulate in the heart, the hepatopancreas, and the con- 
nective tissues of crabs (Smith and Ratcliffe. 1980) and 
lobsters (Factor and Beekman. 1990) and in the lymphoid 
organ of penaeid shrimp (van de Braak et ai. 2002). 

No significant changes in the concentration of hemocytes 
occurred in the hemolymph of crabs in the HH75 and 
HH21 0-240 treatments at 10 min after injection of bacteria 
(Fig. 4). It is possible that low pH and low O, inhibited 
aggregate formation by slowing or blocking the interactions 
of hemocytes with bacteria or with each other. An alterna- 
tive possibility is that hypercapnic hypoxia may have in- 
duced changes in the process by which aggregates were 
removed from circulation. Several important components of 
the innate immune system involve oxygen, including respi- 
ratory burst reactions that generate toxic reactive oxygen 



CLEARANCE OF BACTERIA IN BLUE CRABS 



195 



species and reactive nitrogen species as well as phenoloxi- 
dase, the terminal enzyme of the PPO cascade. Inhibition of 
the production of reactive oxygen species was observed in 
Crassostrea virginica. the Eastern oyster, and was related 
specifically to low levels of oxygen and pH. which occur 
naturally in the tissues of oysters exposed to hypercapnic 
hypoxia (Boyd and Burnett. 1999). Phagocytic activity 
(Direkbusarakom and Danayadol, 1998) and respiratory 
burst activity (Le Moullac el al.. 1998) were decreased in 
hemocytes of Penaeus monodon exposed to hypoxia (25%- 
30% and 15% air saturation, respectively) as compared to 
controls in air-saturated water. The latter study also reported 
an increase in PPO activity associated with low CK condi- 
tions. Hemocyte phagocytosis, respiratory burst, and PPO 
activity were significantly reduced in Macrobrachium 
rosenbergii exposed for 24 h to hypoxia (35% air saturation: 
Cheng et til., 2002). Note that these tests of immune func- 
tion in P. monodon and M. rosenbergii were conducted in 
vitro under air-saturated conditions and. therefore, do not 
necessarily reflect changes in the /;; vivo activity of the 
enzymes involved. 

In the present study, pre-exposure to hypercapnic hyp- 
oxia for 75 or 210-240 min significantly reduced the rate at 
which blue crabs removed bacteria from their hemolymph. 
These results support the concept that oxygen-dependent 
mechanisms play an important role in the physical removal 
and killing of bacterial pathogens. The accumulation of 
hemocytes and bacteria in the gill that has been observed by 
others (Smith el al.. 1984; Martin et ai, 1998) may be an 
efficient means to assure optimal Po 2 for immune reactions 
such as the respiratory burst and the PPO cascade. A po- 
tential liability of this accumulation in the gill is that ag- 
gregates of hemocytes or hemocytes and bacteria might 
impede hemolymph flow in the microvasculature of the gill 
lamellae, reducing hemolymph oxygenation and pH. This 
line of reasoning leads to the suggestion that tissues of the 
blue crab, and other crustaceans, may become hypoxic as a 
consequence of mounting an immune defense against a new 
pathogen or during an active infection. Prior exposure of the 
animal to hypercapnic hypoxia may reduce the rate of 
aggregate formation, minimize occlusion of capillaries in 
the gill, and help to maintain oxygenation of internal tissues, 
while increasing exposure of internal tissues to bacterial 
pathogens circulating in the hemolymph. In this study we 
did not directly test the interplay of respiration, acid-base 
balance, and immune defense, but these results do provide a 
framework for testing and understanding how hypercapnic 
hypoxia may contribute to the outbreaks of infectious dis- 
ease in coastal waters. 

Acknowledgments 

This material is based upon work supported by the Na- 
tional Science Foundation under Grant No. IBN-02 12921 



and REU 99-35204-8555 to KGB and LEB. JDH was sup- 
ported by the University of North Texas Ronald E. McNair 
Program. We wish to acknowledge Austin Dantzler and Joe 
Burgents for technical assistance. Contribution 263 to the 
Grice Marine Laboratory. 

Literature Cited 

Alday-Sanz, V., A. Roque, and J. F. Turnhull. 2002. Clearance mech- 
anisms of Vibrio vulnificus biotype I in the black tiger shrimp, Penaeus 
monodon. Dis. Ai/iuit. Org. 48: 91-99. 

Anderson, R. S.. L. L. Brubaclier, I,. R. C'alvo, M. A. Unger, and E. M. 
Burreson. 1998. Effects of tributyltin and hypoxia on the progression 
of Perkin.iu.i nuirinitm infections and host defence mechanisms in 
oyster. Crassostrea virginicu (Gmelin). J. Fish Dis. 21: 371-379. 

Aspan, A., T. S. Huang, L. Cerenius, and K. Soderhall. 1995. cDNA 
cloning of prophenoloxidase from the freshwater crayfish Pacifastacus 
Icniitscitlus and its activation. Pn>c. Nail. Acad. Sci. USA 92: 939-943. 

Bachere, E. 1998. Shrimp immunity and disease control: an integrated 
approach. Pp. 129-134 in Advances in Shrimp Biotechnology. T. W. 
Flegel, ed. National Center for Genetic Engineering and Biotechnol- 
ogy. Bankok. 

Bachere. E. 2000. Penaeidms, antimicrobial peptides of shrimp: a com- 
parison with other effectors of innate immunity. Aquaculture 191: 
71-88. 

Bartlett. T. C., B. J. Cuthbertson, E. F. Shepard, R. W. Chapman, P. S. 
Gross, and G. W. Warr. 2002. Crustins, homologues of an 1 1.5-kDa 
antibacterial peptide. from two species of penaeid shrimp. Litopenaeus 
Yiinnunit'i and Litopenaeus setiferns. Mar. Bioteclinol. 4: 278-293. 

Booth, C. E., B. R. McMahon, and A. W. Pinder. 1982. Oxygen uptake 
and the potentiating effect of increased hemolymph lactate on oxygen 
transport during exercise in the blue crab, Callinectes sapidus. J. Comp. 
Physiol. 148: 111-121. 

Boyd, J. N.. and L. E. Burnett. 1999. Reactive oxygen intermediate 
production by oyster hemocytes exposed to hypoxia. J. Exp. Bioi 202: 



Burnett, L. E. 1992. Integrated function of respiratory pigments (Corn- 

pleat Crab Symposium I. Am. Zoo/. 32: 438 M-6. 
Burnett, L. E. 1997. The challenges of living in hypoxic and hypercap- 

nic aquatic environments. Am. Zool. 37: 633-640. 
Burnett, L. E., P. I,. deFur, and I). 1). Jorgensen. 1981. Application of 

the thermodilution technique for measuring cardiac output and assess- 

ing cardiac stroke volume in crabs. J. E.\p. Zool. 218: 165-173. 
Cheng, W., and J. C. Chen. 2001. Effects of intrinsic and extrinsic 

factors on the haemocyte profile of the prawn. Macrobrachium rosen- 

bergii. Fish Shellfish Immunol. 11: 53-63. 
Cheng, W., C.-H. Liu. J.-P. Hsu, and J.-C. Chen. 2002. Effect of 

hypoxia on the immune response of giant freshwater prawn Macrobra- 

chium rosenbergii and its susceptibility to pathogen Enterococcus. Fish 

Shellfish Immunol. 13: 351-365. 
deFur, P. L., and C. P. Mangum. 1979. The effects ot environmental 

variables on the heart rates of invertebrates. Comp. Biochem. Ph\siol. 

62A: 283-294. 
deFur, P. L.. C. P. Mangum. and J. E. Reese. 1990. Respiratory 

responses of the blue crab Ctillinci r t ^ \upidns to long-term hypoxia. 

Biol. Bull. 178: 46-54. 
Destoumieux, I)., P. Bullet, I). Loew, A. Van Dorsselaer, J. Rodriguez. 

and E. Bachere. 1997. Penaeidins. a new family of antimicrobial 

peptides isolated from the shrimp Penucus vunmunei (Decapoda). 

J. Biol. Client. 272: 2.S39S-2S406 
Destoumieux, D., M. Munoz, C. Cosseau, J. Rodriguez, P. Bulet, M. 

Comps, and E. Bachere. 2000. Penaeidins. antimicrobial peptides 

with chitin-binding activity, are produced and stored in shrimp granu- 



196 



J. D. HOLMAN ET AL. 



locytes and released after microbial challenge. J. Cell Sci. 113: 461- 
469. 

Direkbusarakom, S., and V. Danayadol. 1998. Effect of oxygen de- 
pletion on some parameters of the immune system in black tiger shrimp 
(Penaeus munodon}. Pp. 147-149 in Advances in Shrimp Bioteclmol- 
ogv. T. W. Flegel. ed. National Center for Genetic Engineering and 
Biotechnology. Bangkok. 

Factor, J. R.. and J. Beekman. 1990. The digestive system of the 
lobster. Humanis americanus. III. Removal of foreign particles from 
the blood by fixed phagocytes of the digestive gland. J. Morphoi. 2(16: 
293-302. 

Fontaine, C. T., and D. V. Lightner. 1974. Observations on the phago- 
cytosis and elimination of carmine particles injected into the abdominal 
musculature of the white shrimp, Penaeus seliferus. J. Invertebr. 
Pathol. 24: 141-148. 

Gargioni, R., and M. A. Barracco. 1998. Hemocytes of the palae- 
monids Macrobrachium rosenbergii and M. acanthurus, and of the 
penaeid Penaeus paulensis. J. Morphoi. 236: 209-221. 

Gleeson, R. A., and P. K. Zubkoff. 1977. The determination of hemo- 
lymph volume in the blue crab, Callinectes sapidus. utilizing 14C- 
thiocyanate. Comp. Biochem. Physio/. 56A: 41 1-413. 

Johnson, P. T. 1976. Bacterial infection in the blue crab. Callinectes 
sapidus: course of infection and histopathology. J. Invcrtebr. Pathol. 
28: 25-36. 

Khoo, L., D. W. Robinette, and E. J. Noga. 1999. Callinectin. an 
antibacterial peptide from blue crab. Cal/inectes sapidus. hemocytes. 
Mar. Biotechnol. 1: 44-51. 

Le Moullac, G., C. Soyez, D. Saulnier, D. Ansquer, J. C. Avarre, and 
P. Levy. 1998. Effect of hypoxic stress on the immune response and 
the resistance to vibriosis of the shrimp, Penaeus xtylirostris. Fish 
Shellfish Innniinol. 8: 621-629. 

Martin, G. G., D. Poole, C. Poole, J. E. Hose, M. Arias, L. Reynolds, N. 
McKrell, and A. Whang. 1993. Clearance of bacteria injected into 
the hemolymph of the penaeid shrimp. Sicyonia ingeutis. J. Invertebr. 
Pathol. 62: 308-315. 

Martin, G. G., K. Kay, D. Poole, and C. Poole. 1998. In vitro nodule 
formation in the ridgeback prawn. Sicyonia ingeniis. and the American 
lobster, Homarus americanus. Invertebr. Biol. 117: 155-168. 

McGaw, I. J., and C. L. Reiner. 2002. Cardiovascular system of the 
blue crab Callinectes sapidits. J. Mnrphnl. 251: 1-21. 

McMahon, B. R., and L. E. Burnett. 1990. The crustacean open cir- 
culatory system: a reexamination. Physiol. Znnl. 63: 35-71. 

Merrill, D. P., S. A. Mongeon, and S. Fisher. 1979. Distribution of 
fluorescent latex particles following clearance from the hemolymph of 
the freshwater crayfish Orconeclcs vinlis (Hagen). J. Comp. Plnsiol. 
132: 363-368. 

Mikulski, C. M., I,. E. Burnett, and K. G. Burnett. 2000. The effects 
of hypercapnic hypoxia on the survival of shrimp challenged with 
Vihnn pin ahacmolytii -us. J. Shellfish Res. 19: 301-311. 

Mix, M. C'., and A. K. Sparks. 1980. Tanner crab Chionoecetex Iviirdi 



Rathbun haemocyte classification and an evaluation of using differen- 
tial counts to measure infection with a fungal disease. J. Fish Dis. 3: 
285-293. 

Munoz, M., R. Cedeno, J. Rodriguez, VV. P. \V. van der Knaap. E. 
Mialhe, and E. Bachere. 2000. Measurement of reactive oxygen 
intermediate production in haemocytes of the penaeid shrimp. Penaeus 
vannamei. Aauacultitre 191: 89107. 

Persson, M., L. Cerenius, and K. Soderhall. 1987. The influence of 
haemocyte number on the resistance of the freshwater crayfish Paci- 
fastacus leniiiscu/us Dana, to the parasitic fungus. Aphanomyces astaci. 
J. Fish Dis. 10: 471-477. 

Rhodes, M. W., H. Kator, S. Kotob, P. van Berkum, I. Kaattari, W. 
Vogelbein, M. M. Floyd, W. R. Butler, F. D. Quinn, C. Ottinger, 
and E. Shotts, E. 2001. A unique mycobacterium species isolated 
from an epizootic of striped bass (Morone saxatilis). Emerg. Infect. 
Dis. 7: 896-899. 

Schnapp, D., G. D. Kemp, and V. J. Smith. 1996. Purification and 
characterization of a proline-rich antibacterial peptide. with sequence 
similarity to bactenecin-7, from the haemocytes of the shore crab, 
Carcinus maenas. Eur. J. Biochem. 240: 532-539. 

Smith, V. J., and N. A. Ratcliffe. 1980. Host defence reactions of the 
shore crab, Carcinus maenas (L.): clearance and distribution of injected 
test particles. J. Mar. Biol. Assoc. UK 60: 89-102. 

Smith. V. J., and K. Soderhall. 1983. /3-1.3 glucan activation of crus- 
tacean hemocytes in vitro and in vivo. Biol. Bull. 164: 299-314. 

Smith. V. J.. K. Soderhall, and M. Hamilton. 1984. /3-1.3-glucan 
induced cellular defense reaction in the shore crab, Carcinus maenas. 
Comp. Biochem. Physiol. 77A: 635-639. 

Song, V. L., and Y. T. Hsieh. 1994. Immunostimulation of tiger shrimp 
(Penaeus monodon) hemocytes for generation of microbicidal sub- 
stances: analysis of reactive oxygen species. Dev. Comp. linnninol. 18: 
201-209. 

van de Braak, C. B. T., M. H. A. Botterblom, N. Taverne, W. B. Van 
Muisuinkel, J. H. Rombout. and W. P. VV. Van der Knaap. 2002. 
The roles of haemocytes and the lymphoid organ in the clearance of 
injected Vibrio bacteria in Penaeus monodon shrimp. Fish Shellfish 
Immunol. 13: 293-309. 

Vargas-Albores, F., A. Guzman-Murillo, and J. L. Ochna. 1993. A 
lipopolysaccharide-binding agglutinin isolated from brown shrimp 
(Penaeus califomiensis Holmes) haemolymph. Comp. Biochem. 
Physiol. 104A: 407-413. 

Vargas-Albores, F., F. Jimenez-Vega, and G. Yepiz-Plascenda. 1997. 
Purification and comparison of (3-1.3-glucan binding protein from the 
white shrimp (Penaeus vannamei). Comp. Biochem. Phvsiol. 116B: 
453-458. 

White, K. H., and N. A. Ratcliffe. 1982. The segregation and elimina- 
tion of radio- and fluorescent-labelled marine bacteria from the hae- 
molymph of the shore crab, Carcinus maenas. J. Mar. Biol. Assoc. UK 
62: 819-833. 



INDEX 



Actograph. 103 

Adaptable defense: a nudibranch mucu; 

changes with prey type, 1 13 
Aggression. 173 
Alkylphenols, 13 
Antioxidants, 13 
Ascidian, 95. 144, 152 



inhibits nematocyst discharge and 



pliciitula. 46 
rhizophorae, 46 
virginica, 46 

Crayfish, 78 
Crustacea, 134 
Cue 

chemical, 134 

visual, I 34 
CURTIS, NICHOLAS E., see Sidney K. Pierce, 125 



B 

Bacterial clearance, 188 

Barnacle, 121 

Behavior, 134 

BIGGERS, WILLIAM J., AND HANS LAUFER, Identification of juvenile hor- 
mone-active alkylphenols in the lobster Homarus americanus and in 
marine sediments, 13 

Biological rhythm, 103 

BIRENHEIDE, RuDiOER, see Tatsuo Motokawa, 4 

Bisphenol A. 13 

Blubber, 125 

BOAL, JEAN G., see Kendra C. Buresch, 1 

BORTOLAMI, S. B., see M. H. Temkin. 35 

Botni/iis sclilosse ri, 144, 152 

Brittle star, 25 

Brooder. 144 

Bryozoa, 35 

BUCKNALL, MARTIN P., see Rebecca L. Swanson, Ifil 

BURESCH, KENDRA C., JEAN G. BOAL, GREGG T. NAGLE, JAMIE KNOWLES, 
ROBERT NOBUHARA, KATE SWEENEY, AND ROGER T. HANLON, Exper- 
imental evidence that ovary and oviducal gland extracts influence 
male agonistic behavior in squids, 1 

BURNETT, KAREN G., see Jeremy D. Holman, 188 

BURNETT, Louts E., see Jeremy D. Holman, 188 



Callinec tes sapidus, 188 

Chemical and visual communication during mate searching in rock shrimp 

134 
Chemical 

cues, 134 

sensing, 1 

Chemoreception, 65 
Chemotaxis, 95 
Chilean Blob, 125 
Chlorophyll fluorescence, 61 
Chromosomal rearrangement, 46 
Collagen, 125 
Communication, 134 
Competition, 173 
Conflict chemoreception, 1 
Confocal microscopy, 65 
Contractile connective tissue, 4 
Contraction and stiffness changes in collagenous arm ligaments of the 

stalked crinoid Metacrinus rotundus (Echinodermata), 4 
Coral, 61 

COSSON, JACKY, see Makiko Ishikawa, 95 
Crassostrea 

gigas, 46 



D 

DE NYS, ROCKY, see Rebecca L. Swanson. 1M 

Defense. 1 1 3 

DENNY, MARK W., see Natasha K. Li. 121 

Density effects. 152 

Deposit feeding. 65 

Development, 25. 78 

larval. 87 
DI'AZ, ELIECER R.. AND MARTIN THIEL. Chemical and visual communication 

during mate searching in rock shrimp, 134 
Differences in the rDNA-bearing chromosome divide the Asian-Pacific and 

Atlantic species of Crassoslrea (Bivalvia. Mollusca), 46 



Echinoderm. 4 

EDMUNDS. PETER J.. AND RUTH D. GATES, Size-dependent differences in the 

photophysiology of the reef coral Porites astreoides. 61 
Effects of hypercapnic hypoxia on the clearance of Vibrio camphellii in the 

Atlantic blue crab, Callinectes sapidus Rathbun, 188 
EHLINGER, GRETCHEN S.. AND RICHARD A. TANKERSLEY, Survival and 

development of horseshoe crab (Linmlus pol\phemits) embryos and 

larvae in hypersaline conditions. 87 
Evolution. 134 
Experimental evidence that ovary and oviducal gland extracts influence 

male agonistic behavior in squids. 1 



FERRELL. DAVID L.. Fitness consequences of allorecognition-mediated ag- 
onistic interactions in the colonial hydroid Hydractinia. 173 

Fertilization. 35. 144. 152 

Fertilization in an egg-brooding colonial ascidian does not vary with 
population density. 152 

Field studies. 55 

Fitness, 103 

Fitness consequences of allorecognition-mediated agonistic interactions in 
the colonial hydroid H\dractinia. 173 

Floridoside-isethionic acid complex. 161 

FOREST, D., see Sara M. Lindsay. 65 

Free-spawning invertebrate. 144 



G 

GARRY, KYLE, see Paul G. Greenwood. 1 13 

GATES, RUTH D., see Peter J. Edmunds, 61 

GREENWOOD, PAUL G.. KYLE GARRY, APRIL HUNTER. AND MIRANDA JEN- 
NINGS, Adaptable defense: a nudibranch mucus inhibits nemalOLW 
discharge and changes with prey type. I 13 



197 



198 



INDEX TO VOLUME 206 



Growth rate. 173 
Gulf of Mexico, 173 



Liiiiuliis polv/iheiniis. 87 
Lobster. 13 



H 

HAMANN. ELLEN, see Aimee Phillippi. 152 

HANLON. ROGER T.. see Kendra C. Buresch. 1 

HARPER. S. L.. AND C L. REIBER. Physiological development of the 
embryonic and larval crayfish heart, 78 

Hemocyte. 188 

Histamine. 161 

HOLMAN, JEREMY D.. KAREN G. BURNETT. AND Louis E. BURNETT. Effects 
of hypercapnic hypoxia on the clearance of Vibrio campbellii in the 
Atlantic blue crab, Callinectes su/iulus Rathbun. 188 

Homarus americanus, 1 3 

Horseshoe crab, 87 

HUNTER. APRIL, see Paul G. Greenwood. 1 1 3 

Hybridization barrier. 46 

Hydrodynamics, 121 

Hypercapnia. 188 

Hypersalinity. 87 

Hypoxia. 78. 188 



I 

Identification and activity-dependent labeling of peripheral sensory struc- 
tures on a spionid polychaete, 65 

Identification of juvenile hormone-active alkylphenols in the lobster Ho- 
marus americanus and in marine sediments. 13 

Immunohistochemistry, 65 

Indian River Lagoon. 87 

Induction of settlement of larvae of the sea urchin Holopneustes purpura- 
scens by histamine from a host alga. 161 

Innate immunity, 188 

Interaction between photoperiod and an endogenous seasonal factor in 
influencing the diel locomotor activity of the benthic polychaete 
Nereis virens Sars, 103 

Invertebrate. 173 

ISHIKAWA, MAKIKO, HIDEKAZU TSUTSUI, JACKY COSSON. YOSHITAKA OKA, 
AND MASAAKI MORISAWA. Strategies for sperm chemotaxis in the 
siphonophores and ascidians: a numerical simulation study. 95 



JENNINGS. MIRANDA, see Paul G. Greenwood. 1 1 3 

JOHNSON. SHERI L.. AND PHILIP O. YUND. Remarkable longevity of dilute 

sperm in a free-spawning colonial ascidian. 144 
Juvenile hormone activity, 13 



M 

Marine 

invertebrate. 121 
sediments. 13 

MARLIYAMA. YOSHIHIKO K.. Occurrence in the field of a long-term, year- 
round, stable population of placozoans. 55 

MASSEY. STEVEN E., see Sidney K. Pierce, 125 

Mating systems, 134 

MAUGEL, TIMOTHY K.. see Sidney K. Pierce. 125 

Metamorphosis, 161 

Methylfarnesoate, 13 

Microscopic, biochemical, and molecular characteristics of the Chilean 
Blob and a comparison with the remains of other sea monsters: 
nothing but whales. 125 

Model. 95 

Molt cycle duration. 87 

MORISAWA, MASAAKI, see Makiko Ishikawa. 95 

Morphology. 1 - 1 

MOTOKAWA. TATSUO, OSAMU SHINTANI, AND RUDIGER BIRENHEIDE. Con- 
traction and stiffness changes in collagenous arm ligaments of the 
stalked crinoid Metacrinus rotundits (Echinodermata), 4 

Mucus. 113 

Mutable connective tissue. 4 



N 

NAOLE. GREGG T., see Kendra C. Buresch. 1 
NAKAMURA. SHOGA. see Hideyuki Tominaga, 25 
Nematocyst, 1 13 
Nereis virens. 103 

Nudibranch. 1 13 



O 

Occurrence in the field of a long-term, year-round, stable population of 

placozoans. 55 

OKA, YOSHITAKA. see Makiko Ishikawa. 95 
OLAVARRI'A. CARLOS, see Sidney K. Pierce. 1 25 
OLIVE. PETER J. W.. see Kim S. Last. 103 
Ontogeny. 78 
Osmoregulation. 87 
Oxygen consumption. 78 



K 

KNOWLES, JAMIE, see Kendra C. Buresch. 1 
KOMATSU, MIEKO, see Hideyuki Tominaga, 25 
KUMAR, NARESH. see Rebecca L. Swanson. 161 



Larva. 161 

development of, 87 

LAST. KIM S.. AND PETER J. W. OLIVE. Interaction between photoperiod and 
an endogenous seasonal factor in influencing the diel locomotor 
activity of the henthic polychaele Nereis virens Sars. 103 

L vi 1 1 K. H \NV see William J. Biggers. I 3 

Li. NATASHA K., AND MARK W. DENNY, Limits to phenotypic plasiicitv: 
Mow effects on barnacle feeding appendages. 121 

Life history. 103 

Limits to phenotypic plasticity: How el'lecls on h.irnacle Iccding append- 
ages, 121 

LINDSAY, SARA M., TIMOTHY .1. RIORUXN. JR.. \M> D. FOREST. Identification 
and activity-dependent labeling of peripheral sensory structures on a 
spionid polychaete. 65 



Phenotypic plasticity. 121 

Pheromones. 1 

Pun i ii'i'i. AIMI;K, ELI .EN HAMANN, AND PHILIP O. YUND, Fertili/ation in an 
egg-brooding colonial ascidian does not vary with population density. 
152 

Photophysiology, 61 

Physiological development ol the embryonic and larval crayfish heart, 78 

Pn'kci . SIDMI K.. STKVEN E. MASSEY. NICHOLAS E. CURTIS. GERALD N. 
SMITH. JR.. CARLOS OLAVARRI'A. AND TIMOTHY K. MAUGEL. Micro- 
scopic, biochemical, and molecular characteristics of the Chilean Blob 
and a comparison with the remains ol other sea monsters: nothing but 
whales. 125 

Placozoa, 55 

Polvchaeta. 103 



R 

Ri mi K, C. L., sec S. L. Harper. 78 

Remarkable longevity ol dilute sperm in a free-spawning colonial ascidian. 

144 
Reproduction. 25. I 34 



INDEX TO VOLUME 206 



199 



Reproduction and development of the conspicuously dimorphic brittle star 

Ophiodaphne formula (Ophiuroidea), 25 
Rhynchocinetes, 1 34 
Ribosomal RNA genes, 46 
RIORDAN, TIMOTHY J.. JR., see Sara M Lindsay. 6? 



SWANSON, REBECCA L., JANE E. WILLIAMSON. ROCKY DE NYS. NARESH 
KUMAR. MARTIN P. BUCKNALL. AND PETER D. STEINBERG. Induction of 
settlement of larvae of the sea urchin Holopneustes purpurascens by 
histamine from a host alga. Id I 

SWEENEY. KATE, see Kendra C. Buresch. I 



Salinity tolerance, 87 
Sampling 

slide. 55 

substrate, 55 
Sea 

anemone. 1 1 3 

lily. 4 

monster, 125 

urchin, 161 
Sensory ecology, 65 
Settlement, 161 
Sexual dimorphism. 25 
SHINTANI, OSAMU. see Tatsuo Motokawa. 4 
Shrimp. 134 
Simulation. 95 
Siphonophore, 95 
Size mortality. 61 
Size-dependent differences in the photophysiology of the reef coral Porites 

astreoides, 61 

SMITH. GERALD N.. JR.. see Sidney K. Pierce. 125 
Sperm. 35 

half-lite. 144 

longevity, 144 
Spermatozeugmata, 35 
Spionidae. 65 
Stalked crinoid. 4 

STEINBERG, PETER D.. see Rebecca L. Swanson. 161 
Strategies for sperm chemotaxis in the siphonophores and ascidians: a 

numerical simulation study. 95 
Survival. 87. 173 

Survival and development of horseshoe crab (Limulus polyphemits) em- 
bryos and larvae in hypersaline conditions, 87 



TANKERSLEY, RICHARD A., see Gretchen S. Ehlinger. 87 

TEMKIN. M. H., AND S. B. BORTOLAMI. Waveform dynamics of sperma- 

tozeugmata during the transfer from paternal to maternal individuals 

of Membranipora membranacea, 35 
Temperature tolerance. X7 
Thermal stress, 61 
THIEL. MARTIN, see Eliecer R. Dm/., 134 

TOMINAGA, HlDEYUKI, SHOGO NAKAMURA, AND MlEKO KOMATSU, Repro- 
duction and development of the conspicuously dimorphic brittle star 
Ophiodaphne formata (Ophiuroidea). 25 

TrichopliLx adhaerens, 55 

TSUTSUI, HIDEKAZU, see Makiko Ishikawa. 95 



Vibrio campbellii, 188 
Visual cues, 134 



w 



WANG, YONGPING, ZHE Xu, AND XIMING Guo. Differences in the rDNA- 
bearing chromosome divide the Asian-Pacific and Atlantic species of 
Crassostrea (Bivalvia, Mollusca), 46 

Wave exposure, 1 2 1 

Waveform dynamics of spermatozeugmata during the transfer from pater- 
nal to maternal individuals ot Mcniht'iiniptn'ii nieinhi'nnucea. 35 

Whale. 125 

WILLIAMSON. JANE E.. see Rebecca L. Swanson. 161 



YUND, PHILIP O.. see Aimee Phillippi. 152; Sheri L. Johnson. 144 



THF 

BIOLOGICAL 
BULLETIN 

2004 Subscription Rates 
Volumes 206-207 

*Paid Subscriptions include both print and electronic subscriptions at: www.biolbull.org 

Institutional* Individual* 



One year subscription (6 issues 


- 2 volumes) 


$325.00 


$120.00 


Single volume (3 issues) 




$165.00 


$70.00 


Single Issues 


$ 75.00 


$25.00 



*Surface delivery included in above prices. 
For prompt delivery, we encourage subscribers outside the U.S. to request airmail service. 

Airmail Delivery Charge 

U.S. and Canada: $ 45.00 

Mexico: $ 60.00 

All other locations: $100.00 

Orders Must Be Prepaid in U.S. Dollars, Check Payable to The Marine Biological Laboratory 

About The Biological Bulletin 

ISSN: 0006-3185 

Frequency: Bimonthly 

Number of issues per year: 6 

Months of Publication: February, April, June, August, October, December 

Subscriptions entered for calendar year 

Volume indexes contained in June and December issues 

Annual report of the Marine Biological Laboratory contained in August issue 

Most back issues available 

Claims handled upon receipt 

No agency discounts 

Internet: 
www.biolbull.org 

Please address orders to: 

Wendy Child 

Subscriptions 

The Biological Bulletin 

Marine Biological Laboratory 

7 MBL Street 

Woods Hole, MA 02543-1015 U.S.A. 
Fax: 508-289-7922 Tel: 508-289-7402 Email: wchild@mbl.edu 

Published by the Marine Biological Laboratory 
Woods Hole, Massachusetts, 02543 U.S.A. 



THE BIOLOGICAL BULLETIN 

(www.biolbull.org) 

2004 SUBSCRIPTION FORM 

(VOLUMES 206-207, 6 ISSUES) 



(please print) 

NAME: 



INSTITUTION: 
ADDRESS: 



CITY: STATE:. 

POSTAL CODE: COUNTRY:. 

TELEPHONE: FAX:. 

E-MAIL ADDRESS 



All subscriptions run on the calendar year; price includes both print and online journals 

G Please send me a 2004 subscription to The Biological Bulletin at the rate indicated below: 

a Individual: $120.00 (6 ISSUES) O Institutional : $325.00 (6 ISSUES) 

O Individual: $70.00 (3 ISSUES) O Institutional : $165.00 (3 ISSUES) 

Check one: G February April June or G August October December 

G Please send me the following back issue(s): 

O Individual: at $25.00 (PER ISSUE) O Institutional : at $75.00 (PER ISSUE) 

Delivery Options 

Surface Delivery (Surface delivery is included in the subscription price.) 

Air delivery (Please add the correct amount to your payment.) 



O U.S. and Canada: $46.00 O Mexico: $60.00 O All other locations: $100.00 
Payment Options 

Enclosed is my check or U.S. money order for $ payable to The Marine Biological Laboratory 

Please charge my D VISA, G MasterCard G Discover Card $ 

Please send me an invoice. (Note: Payment must be received before subscription commences.) 



Account No.: Exp. Date: 

Signature: Date: 



Return this form with your check or credit information to: 

Marine Biological Laboratory 

Subscription Office + The Biological Bulletin +7 MBL Street 4- Woods Hole, MA 02543-1015 



OGL- OCEAN GENOME 
LEGACY 

m EXECUTIVE DIRECTOR 

A new not-for-profit foundation devoted to the 
preservation, distribution and evolutionary genomics of 
DNA from marine organisms is seeking an 
EXECUTIVE DIRECTOR. 

The successful candidate will have a Ph.D. in cell or 
molecular biology, 4+ years' experience in molecular 
biology, and be highly motivated to work at the bench. 
Responsibilities will include the assembly of a small team 
of scientists for the long-term preservation of marine 
organism DNA, development of tissue culture 
techniques for marine invertebrate cells, construction of 
genome libraries, and evolutionary genomics of special 
marine transition groups. 

The OGL laboratory will be temporarily located at New 
England Biolabs, Inc., Beverly, MA until a new facility is 
constructed in Ipswich, MA. 

Applicants should send a resume and three references to: 
Carol Ann Zapttstas, New England Biolabs, Inc., 
32 Tozer Road, Beverly, MA 01915. 

OCEAN GENOME LEGACY 

An Equal Opportunity Employer. 




POSITION ANNOUNCEMENT 

Editor-in-Chief 
The Biological Bulletin 

Start Date: January 2005 
Term: Five years, renewable 



The Editor-in-Chief is responsible for the overall editorial direction of the Biological Bulletin. The Editor-in-Chief 
appoints Associate Editors and members of the Editorial Board, decides which manuscripts are published, mediates 
editorial disputes, and sets policy for the journal. 

The Editor-in-Chief is an independent contractor who reports to the Director and CEO of the Marine Biological 
Laboratory. Stipend for the position is $10,000 annually. The Bulletin 's editorial offices are based in Woods Hole, but 
the Editor-in-Chief may work from his/her home institution. The Editor-in-Chief is expected to spend some part of the 
summer months in Woods Hole. Housing for up to one month will be provided in Woods Hole. 



The successful candidate for this 

position will meet the following 

requirements: 



A broad understanding of biology, and a manifest interest in its 

diversity and comparative and integrative aspects 

A track-record of publishing in peer-reviewed journals 

Experience reviewing papers for scientific journals 

Proven skill as a substantive editor 

Ability to make tough decisions and willingness to work with other editors 

to reach a decision on difficult papers 

Demonstrated experience with the editorial process (e.g., serving as an 

Editor or Associate Editor for a journal similar to the Biological Bulletin) 

The willingness and ability to commit the time required, approximately 

one day per week, to fulfill the duties outlined here for five years. 



Job description: 



Nomination packets must include 
the following: 

1. Letter of intent 

2. Current CV 

3. Vision Statement for the journal 

Send nominations to: 

Pamela Clapp Hinkle 

Managing Editor, Biological Bulletin 

Marine Biological Laboratory 

7 MBL Street 

Woods Hole, MA 02543 

pclapp@mbl.edu 



The Editor-in-Chief devotes a minimum of six hours per week to the 
operation of the Biological Bulletin. The Editor's ongoing activities include 

1) assigning submitted papers to the appropriate Associate Editor; 

2) reading reviews and manuscripts to ensure fairness and technical 
accuracy; 3) writing editorial decision letters based on the reviews; 

4) fielding telephone and e-mail queries on a daily basis from authors 
deciding whether to submit their work to the Biological Bulletin, authors 
who are unhappy about an editorial decision, and Associate Editors 
requesting guidance on such matters as the identity, availability, 

and number of reviewers, and editorial decisions and disputes; 

5) communicating regularly (by telephone or e-mail) with the Managing 
Editor and other editorial staff members to plan future issues, to arrange the 
table of contents, to develop the issue cover, and to discuss organizational 
issues; 6) editing accepted manuscripts as necessary for substance, 
accuracy, and clarity; 7) selecting cover photos and writing associated 
legends; 8) informing editorial staff of noteworthy articles for the media; 
9) as the deadline for each issue approaches, deciding which manuscripts 
will be published. 






Marine Biological Laboratory Woods Hole Massachusetts 









Invented 

i 



At Its Best! 






m 









. 



> 



.. 









Built with extraordinary 
Zeiss expertise, the Axiovert 200 
is all you'll ever want in an 
inverted research microscope. 
Outstanding ICS infinity optics, 
innovative condensers & optimized 
fluorescence, stability & reliability, 
unique ergonomic design, 
& an unusually wide scope 
of sophisticated documentation. 

But the Axiovert 200 is much 
more. It is a powerful tool that 
will carry out your research more 



precisely, more rapidly and more 
successfully than before. And this 
is just the beginning! 

You can transform your , 

microscope into a sophisticated 
image handling workstation 
for observation & documentation 
of living cells with all of the 
components superbly matched 
by Zeiss for outstanding results. 

For more information 
call 800-233-2343. 



ZEISS 



Carl Zeiss Microlmaging, Inc. Thornwood, NY 10594 micro@zeiss.com 



We make it visible. 



MBL WHOI LIBRARY 



UH 1ART U