Skip to main content

Full text of "The Biological bulletin"

See other formats 


. 


February  2004 


THE 


Volume  206  •  Number  1 


BIOLOGICAL 
BULLETIN 


Marine  Biological  Laboratory 


iolbull.org 


THE  BIOLOGICAL  BULLETIN 


ONLINE 


The  Marine  Biological  Laboratory  is  pleased       beginning  with  the  October  1976  issue 

to  announce  that  the  full  text  of  The  Biological      (Volume  151,  Number  2),  and  some  Tables  of 

Bulletin  is  available  online  at  Contents  are  online  beginning  with  the 

October  1965  issue  (Volume  129,  Number  2). 


http://www.biolbull.org 

The  Biological  Bulletin  publishes  outstanding 
experimental  research  on  the  lull  range 
of  biological  topics  and  organisms,  from  the 
fields  of  Neurobiology,  Behavior,  Physiology, 
Ecology,  Evolution,  Development  and 
Reproduction,  Cell  Biology,  Biomechanics, 
Symbiosis,  and  Systematic^. 

Published  since  1897  by  the  Marine 
Biological  Laboratory  (MBL)  in  Woods  Hole, 
Massachusetts,  The  Biological  Bulletin  is  one 
of  America's  oldest  peer-reviewed  scientific 
journals. 

The  journal  is  aimed  at  a  general  readership, 
and  especially  invites  articles  about  those 
novel  phenomena  and  contexts  characteristic 
of  intersecting  fields. 

The  Biological  Bulletin  Online  contains  the 
lull  content  of  each  issue  of  the  journal, 
including  all  figures  and  tables,  beginning 
with  i he  February  2001  issue  (Volume  200, 
Number  1 ).  The  lull  text  is  scan  liable  by 
keyword,  and  the  died  references  include 
hyperlinks  to  Medline.  PDF  files  are  available 
beginning  in  February  I  990  (Volume  178, 
Number  I  ),  some  abstracts  are  available 


Each  issue  will  be  placed  online 
approximately  on  the  date  it  is  mailed  to 
subscribers;  therefore  the  online  site  will  be 
available  prior  to  receipt  of  your  paper  copy. 
Online  readers  may  want  to  sign  up  for  the 
eTOC  (electronic  Table  of  Contents)  service, 
which  will  deliver  each  new  issue's,  table  of 
contents  via  e-mail.  The  web  site  also 
provides  access  to  information  about  the 
journal  (such  as  Instructions  to  Authors,  the 
Editorial  Board,  and  subscription 
information),  as  well  as  access  to  the  Marine 
Biological  Laboratory's  web  site  and  other 
Biological  Bulletin  electronic  publications. 

The  free  trial  period  for  access  to  The 
Biological  Bulletin  online  has  ended. 
Individuals  and  institutions  who  are 
subscribers  to  the  journal  in  print  or  are 
members  of  the  Marine  Biological 
Laboratory  Corporation  may  now  activate 
their  online  subscriptions.  All  other  access 
(e.g.,  to  Abstracts,  eTOCs,  searching, 
Instructions  to  Authors)  remains  freely 
available.  Online  access  is  included  in  the 
print  subscription  price. 

For  more  information  about  subscribing  or 
activating  your  online  subscription,  visit 
<www.biolbull.org/subscriptions>. 


http://www.biolbull.org 


THING 


ELECTROPHYSIOLOGY 

RESEARCH 

MICROSCOPE. 


like  the  Olympus  8X5 1WI. 

The  results  are  superb 

orecence  and  DIG 

pabilities  under  the 
challenging  conditions  of 
thick  brain  slice  observation. 

'lympus  offers  the  most 
emarkable  line  of  water 
immersion  objectives.  With  the 
XLUMPFL  20x  objective 
/NA  0.95  and  WD  2.0mm) 

id  a  magnification  changer, 


low  and  high  magnifications. 

Highly  efficient  wide-field 
fluorescence  is  at  hand  with  the 
low-power  XLFLUOR  4x/NA 
0.28  or  2x/NA  0. 1 4  objectives. 
Those  objectives  make  GFP 
imaging  of  large  fields  easy 
and  effective. 

Olympus  also  offers 
an  extensive  line  of  dipping 
objectives  that  feature  long 
working  distances  and  large 
approach  angles  of  over  40° 
for  manipulator  access. 

The  BX5 1  Wl  provides  excellent 
working  conditions  for  in  vivo 
brain  slice  IR-DIC  application 
with  an  optical  system  tailored 
h-contrast,  high-resolution 


ROCKET  SCIENCE". 


OLYMPI 


Cover 


Most  echinoderms  are  dioecious,  but  the  sexes  are 
usually  indistinguishable  on  the  basis  of  external 
structure.  A  very  few  species  of  brittle  stars  are. 
however,  strikingly  dimorphic,  with  a  dwarf  male 
clinging  to  a  much  larger  female,  usually  mouth-to- 
mouth.  Although  this  romantic  posture  suggests  a 
role  in  reproduction,  spawning  has  not  previously 
been  observed  in  these  species.  However,  in  this 
issue  of  The  Biological  Bulletin  (p.  25)  Hideyuki 
Tominaga  and  his  colleagues  describe  the  reproduc- 
tion and  development — from  spawning  to  metamor- 
phosis—  of  a  dimorphic  brittle  star,  Ophiodaphne 
formula.  And  they  report  further  that  these  brittle 
stars,  both  couples  and  singles,  have  adopted  a  close 
living  arrangement  with  sand  dollars. 

The  upper  portion  of  the  cover  shows  an  enlarged 
image  of  two  brittle  stars,  coupled,  and  with  their 
oral  surfaces  appressed.  Her  central  disk  is  about  5 
mm  in  diameter,  his  only  1  mm;  and  his  arms  are 
interdigitated  with  hers.  At  a  much  lower  magnifi- 
cation (bottom  left  panel),  we  see  this  couple  re- 
clining on  a  host  sand  dollar,  close  to  one  of  its  five 
lunules.  The  female's  aboral  surface  is  fixed  to  the 
spiny  oral  surface  of  the  sand  dollar,  and  two  of  her 
arms  are  hooked  over  the  edge  of  the  lunule.  A 
specimen  of  the  host  sand  dollar  from  this  study 
(/l.v/nV/y/x'M.s  nuiiini:  diameter,  about  14  cm)  is 
shown  in  the  lower  right  corner  of  the  cover.  But  <). 
joniiata  is  not  host-specilic:  two  other  species  of 
sand  dollars  have  been  reported  to  accommodate 
this  brittle  star.  Notice  also  that  the  figured  speci- 


men of  A.  nuiniii  bears  two  unpaired  female  brittle 
stars  on  its  oral  surface — near  the  lunules  at  10  and 
12  o'clock;  thus,  all  O.  fornuitci  are  found  on  sand 
dollars,  but  only  about  half  of  the  brittle  stars  are 
paired. 

The  sand  dollars  live  in  relatively  shallow  waters, 
partially  buried  in  the  sandy  bottom.  Thus,  they 
provide  the  brittle  stars  with  a  ready,  stable  site  of 
attachment  on  a  shifting  substrate:  and  the  lunule 
protects  against  abrasion  by  the  sand,  which  is  the 
source  of  food  for  both  organisms.  At  spawning,  the 
gametes  of  brittle  stars  are  released  from  bursal  slits 
on  the  oral  surface  of  the  disk.  The  mouth-to-mouth 
posture  brings  those  openings  of  the  coupled  male 
and  female  close  together,  maximizing  the  effi- 
ciency of  fertilization.  This  is  critical,  because  the 
population  of  brittle  stars  is  sparse  (only  one  of  ten 
sand  dollars  is  inhabited),  and  because  these  small 
animals  produce  a  limited  number  of  eggs.  These 
relatively  small  eggs  develop  indirectly;  but  the 
time  in  development  to  metamorphosis  is  rapid, 
which  minimizes  transport  of  the  brittle  star  larvae 
away  from  the  habitat  of  the  host  sand  dollars. 
Thus,  Tominaga  and  colleagues  suggest  that  the 
sexual  dimorphism,  the  coupling  behavior,  and  the 
characteristics  of  development  all  seem  to  be  adap- 
tations enabling  a  sparse  population  of  brittle  stars 
to  survive  on  the  sandy  bottom  of  shallow  seas. 

The  photographs  on  the  cover  were  taken  by 
Hideyuki  Tominaga  (Toyama  University),  and  the 
cover  was  designed  by  Beth  Liles  (Marine  Biolog- 
ical Laboratory.  Woods  Hole.  Massachusetts). 


THE 


BIOLOGICAL  BULLETIN 

FEBRUARY  2004 


Editor 
Associate  Editors 


Section  Editor 
Online  Editors 


Editorial  Board 


Editorial  Office 


MICHAEL  J.  GREENBERG 

Louis  E.  BURNETT 
R.  ANDREW  CAMERON 
CHARLES  D.  DERBY 
MICHAEL  LABARBERA 


The  Whitney  Laboratory,  University  of  Florida 

Grice  Marine  Laboratory,  College  of  Charleston 
California  Institute  of  Technology 
Georgia  State  University 
University  of  Chicago 


SHINYA  INOUE,  Imaging  and  Microscopv      Marine  Biological  Laboratory 

ENSR  Marine  &  Coastal  Center.  Woods  Hole 
Hunter  College.  City  University  of  New  York 


JAMES  A.  BLAKE,  Keys  to  Marine 
Invertebrates  of  the  Woods  Hole 
WILLIAM  D.  COHEN,  Marine  Models 
Electronic  Record  and  Compendia 


PETER  B.  ARMSTRONG 
JOAN  CERDA 
ERNEST  S.  CHANG 
THOMAS  H.  DIETZ 
RICHARD  B.  EMLET 
DAVID  EPEL 

KENNETH  M.  HALANYCH 
GREGORY  HINKLE 
NANCY  KNOWLTON 
MAKOTO  KOBAYASHI 
ESTHER  M.  LEISE 
DONAL  T.  MANAHAN 
MARGARET  McFALL-NcAi 
MARK  W.  MILLER 
TATSUO  MOTOKAWA 
YOSHITAKA  NAGAHAMA 
SHERRY  D.  PAINTER 
J.  HERBERT  WAITE 
PHIL  YUND 
RICHARD  K.  ZIMMER 

PAMELA  CLAPP  HINKLE 
VICTORIA  R.  GIBSON 
CAROL  SCHACHINGER 
WENDY  CHILD 


University  of  California,  Davis 

Center  of  Aquaculture-IRTA,  Spain 

Bodega  Marine  Lab.,  University  of  California,  Davis 

Louisiana  State  University 

Oregon  Institute  of  Marine  Biology,  Univ.  of  Oregon 

Hopkins  Marine  Station,  Stanford  University 

Auburn  University.  Alabama 

Dana  Farber  Cancer  Institute,  Boston 

Scripps  Inst.  Oceanography  &  Smithsonian  Tropical  Res.  Inst. 

Hiroshima  University  of  Economics,  Japan 

University  of  North  Carolina  Greensboro 

University  of  Southern  California 

Kewalo  Marine  Laboratory.  University  of  Hawaii 

Institute  of  Neurobiology,  University  of  Puerto  Rico 

Tokyo  Institute  of  Technology.  Japan 

National  Institute  for  Basic  Biology,  Japan 

Marine  Biomed.  Inst.,  Univ.  of  Texas  Medical  Branch 

University  of  California,  Santa  Barbara 

University  of  New  England,  Biddeford,  ME 

University  of  California.  Los  Angeles 

Managing  Editor 

Staff  Editor 

Editorial  Associate 

Subscription  &  Advertising  Administrator 


Published  by 

MARINE  BIOLOGICAL  LABORATORY 
WOODS  HOLE,  MASSACHUSETTS 


http://www.biolbull.org 


• 

V/ood;  Hole  On 

FEB  2  3  2004 


CONTENTS 


VOLUMH  206.  No.  1:  FEBRUARY  2004 


RESEARCH  NOTE 

Buresch,  Kendra  C.,  Jean  G.  Boal,  Gregg  T.  Nagle, 
Jamie  Knowles,  Robert  Nobuhara,  Kate  Sweeney,  and 
Roger  T.  Hanlon 

Experimental  evidence  that  ovarv  and  oviducal  gland 
extracts  influence  male  agonistic  behavior  in  squids. 

PHYSIOLOGY  AND  BIOMECHANICS 

Motokawa,  Tatsuo,  Osamu  Shintani,  and  Riidiger  Bi- 
renheide 

Contraction  and  stiffness  changes  in  collagenous  aim 
ligaments  of  the  stalked  crinoid  Melanin  in  niliiinlns 
(Echinodermata) 

NEUROBIOLOGY  AND  BEHAVIOR 

Biggers,  William  J..  and  Hans  Laufer 

Identification  <>t  juvenile  hormone-active  alkvlphe- 
nols  in  the  lobster  Homarus  ameiicaniis  and  in  marine 
sediments 


13 


DEVELOPMENT  AND  REPRODUCTION 

Tominaga,    Hideyuki,    Shogo    Nakamura,    and    Mieko 
Komatsu 

Reproduction  and  development  ol  the  conspicuously 
dimorphic  brittle  star  O/iliiiifln/iline  formata  (Ophiu- 

roidea)    25 

Temkin,  M.  H.,  and  S.  B.  Bortolami 

Waveform  dvnamics  ol  spcrmatozeugmata  during 
the  transfer  from  paternal  to  maternal  individuals  of 
Membranipora  iiiniilntii/iiii'fi 35 


ECOLOGY  AND  EVOLUTION 

Wang,  Yongping,  Zhe  Xu,  and  Ximing  Guo 

Differences  in  the  rDNA-bearing  chromosome  divide 
the  Asian-Pacific  and  Atlantic  species  of  Crassostrea 

(Bivalvia,  Mollusca) -K> 

Maruyama,  Yoshihiko  K. 

Occurrence  in  the  field  of  a  long-term,  year-round, 
stable  population  of  placozoans 55 


THE  BIOLOGICAL  BULLETIN 

Tm:  BIOLOGICAL  Bi LLETIN  is  published  six  times  a  year  by  the  Marine  Biological  Laboratory,  7  MBL  Street, 
Woods  Hole.  Massachusetts  02543. 

Subscriptions  and  similar  matter  should  be  addressed  to  Subscription  Administrator.  THH  BIOLOGICAL 
BULLETIN.  Marine  Biological  Laboratory.  7  MBL  Street.  Woods  Hole.  Massachusetts  02543.  Subscription 
includes  both  print  and  online  journals.  Subscription  per  year  (six  issues,  two  volumes):  $325  for  libraries;  $120 
for  individuals.  Subscription  per  volume  (three  issues):  $165  for  libraries:  $70  for  individuals.  Back  and  single 
issues  (subject  to  availability  I:  S75  for  libraries:  $25  for  individuals. 

Communications  relative  to  manuscripts  should  he  sent  to  Michael  J.  Greenberg.  Editor-in-Chief,  or  Pamela 
Clapp  Hinkle.  Managing  Editor,  at  the  Marine  Biological  Laboratory.  7  MBL  Street.  Woods  Hole.  Massachusetts 
02543.  Telephone:  (50S)  2S9-7I49.  FAX:  50X-289-7922.  E-mail:  pclapp@mbl.edu. 


http://www.biolbull.org 

THE  BIOLOGICAL  BULLETIN  is  indexed  in  bibliographic  services  including  Index  Medicus  and  MED- 
LINE,  Chemical  Abstracts,  Current  Contents.  Elsevier  BIOBASE/Current  Awareness  in  Biological 
Sciences,  and  Geo  Abstracts. 

Printed  on  acid  free  paper, 
effective  with  Volume  180,  Issue  1,  1991. 


POSTMASTER:  Send  address  changes  to  THE  BIOLOGICAL  BULLETIN,  Marine  Biological  Laboratory, 

7  MBL  Street,  Woods  Hole,  MA  02543. 

Copyright  ©  2004,  by  the  Marine  Biological  Laboratory 

Periodicals  postage  paid  at  Woods  Hole,  MA,  and  additional  mailing  offices. 

ISSN  0006-3185 


INSTRUCTIONS  TO  AUTHORS 


The  Biological  Bulletin  accepts  outstanding  original  research 
reports  of  general  interest  to  biologists  throughout  the  world. 
Papers  are  usually  of  intermediate  length  (10 — K)  manuscript 
pages).  A  limited  number  of  solicited  review  papers  may  be 
accepted  after  formal  re\iev\.  A  paper  will  usually  appear  within 
four  months  after  its  acceptance. 

Very  short,  especially  topical  papers  (less  than  4  manuscript 
pages  including  tables,  ligures.  and  bibliography)  will  he  published 
in  a  separate  section  entitled  "Research  Notes."  A  Research  Note 
in  Tlif  Hiolnffieiil  Bulletin  follows  the  format  of  similar  notes  in 
Nature.  It  should  open  with  a  summary  paragraph  of  1 5(1  to  200 
words  comprising  the  introduction  and  the  conclusions.  The  rest  of 
the  text  should  continue  on  without  subheadings,  and  there  should 
be  no  more  than  30  references.  References  should  be  referred  to  in 
(he  text  by  number,  and  listed  in  the  Literature  Cited  section  in  the 
order  that  they  appear  in  the  text.  Unlike  references  in  Nature. 
lelercnces  in  the  Research  Notes  section  should  conform  in 
punctu.iih'ii  ,in.l  arrangement  to  the  st\le  of  recent  issues  of  The 
Hiolnifienl  liulletin.  Materials  and  Methods  should  be  incorpo- 
rated into  appropriate  ligure  legends  See  the  article  by  Lee 
(October  2003.  Vol.  2115:  99  I'll)  for  sample  Style.  AReseaich 
Note  will  usually  appear  w  ithin  two  months  after  its  acceptance. 

The  Editorial  Board  requests  that  regular  manuscripts  con- 
form to  the  requirements  set  below;  those  manuscripts  that  do 
nut  conform  will  he  returned  to  authors  lor  correction  before 
te\  lew 


1.  Manuscripts.  Manuscripts,  including  figures,  should  be 
submitted  in  quadruplicate,  with  the  originals  clearly  marked. 
(Xerox  copies  of  photographs  are  not  acceptable  for  review  pur- 
poses.) Please  include  an  electronic  copy  of  the  text  of  the  manu- 
script. Label  the  disk  w  ith  the  name  of  the  first  author  and  the  name 
and  \ersion  of  the  wordprocessing  software  used  to  create  the  hie. 
If  the  file  was  not  created  in  some  version  of  Microsoft  Word,  save 
the  text  in  rich  text  format  (rtf).  The  submission  letter  accompa- 
nying the  manuscript  should  include  a  telephone  number,  a  FAX 
number,  and  (if  possible)  an  E-mail  address  for  the  corresponding 
author.  The  original  manuscript  must  be  typed  in  no  smaller  than 
12  pitch  or  10  point,  using  double  spacing  (inclialini;  figure  leg- 
ends, footnotes,  bibliography,  etc.)  on  one  side  of  Id-  or  20-lb. 
bond  paper.  8  by  11  inches.  Please,  no  right  justification.  Manu- 
scripts should  be  proofread  carefully  and  errors  corrected  legibly 
in  black  ink.  Pages  should  he  numbered  consecutively.  Margins  on 
all  sales  should  be  at  least  I  inch  (2.5  cm).  Manuscripts  should 
conform  to  the  Council  <>/  Bioli>i;\  Editors  St\le  Manual.  5th 
Edition  (Council  of  Biology  Editors.  198.3)  and  to  American  spell- 
ing. Unusual  abbreviations  should  be  kept  to  a  minimum  and 
should  be  spelled  out  on  lirst  reference  as  well  as  defined  in  a 
footnote  on  the  title  page.  Manuscripts  should  he  divided  into  the 
following  components:  Title  page.  Abstract  (of  no  more  than  200 
words  I.  Introduction.  Materials  and  Methods,  Results.  Discussion. 
Acknowledgments.  Literature  Cited.  Tables,  and  Figure  Legends. 
In  addition,  authors  should  supply  a  list  of  words  and  phrases 
under  which  the  article  should  be  indexed. 


2.  Title  pane.     The  title  page  consists  of  a  condensed  title  or 
running  head  of  no  more  than  35  letters  and  spaces,  the  manuscript 
title,  authors'   names  and  appropriate  addresses,   and   footnotes 
listing  present  addresses,  acknowledgments  or  contribution  num- 
bers, and  explanation  of  unusual  abbreviations. 

3.  Figures.     The  dimensions  of  the  printed  page,  7  by  9 
inches,  should  be  kept  in  mind  in  preparing  figures  for  publication. 
We  recommend  that  figures  be  about  1  times  the  linear  dimensions 
of  the  final  printing  desired,  and  that  the  ratio  of  the  largest  to  the 
smallest  letter  or  number  and  of  the  thickest  to  the  thinnest  line  not 
exceed  1:1.5.  Explanatory  matter  generally  should  be  included  in 
legends,  although  axes  should  always  be  identified  on  the  illustra- 
tion itself.  Figures  should  be  prepared  for  reproduction  as  either 
line  cuts  or  halftones.  Figures  to  be  reproduced  us  line  cuts  should 
be  unmounted  glossy  photographic  reproductions  or  drawn   in 
black  ink  on  white  paper,  good-quality  tracing  cloth  or  plastic,  or 
blue-lined  coordinate  paper.  Those  to  be  reproduced  as  halftones 
should  be  mounted  on  board,  with  both  designating  numbers  or 
letters  and  scale  bars  affixed  directly  to  the  figures.  All  figures 
should  be  numbered  in  consecutive  order,  with  no  distinction 
between  text  and  plate  figures  and  cited,  in  order,  in  the  text.  The 
author's  name  and  an  arrow  indicating  orientation  should  appear 
on  the  reverse  side  of  all  figures. 

Digital  an:  The  Biological  Bulletin  will  accept  figures  sub- 
mitted in  electronic  form;  however,  digital  art  must  conform  to  the 
following  guidelines.  Authors  who  create  digital  images  are 
wholly  responsible  for  the  quality  of  their  material,  including  color 
and  halftone  accuracy. 

Format.  Acceptable  graphic  formats  are  TIFF  and  EPS.  Color 
submissions  must  be  in  EPS  format,  saved  in  CMKY  mode. 

Software.  Preferred  software  is  Adobe  Illustrator  or  Adobe 
Photoshop  for  the  Mac  and  Adobe  Photoshop  for  Windows.  Spe- 
cific instructions  for  artwork  created  with  various  software  pro- 
grams are  available  on  the  Web  at  the  Digital  Art  Information  Site 
maintained  by  Cadmus  Professional  Communications  at  http:// 
cpc.cadmus.com/da/ 

Resolution.  The  minimum  requirements  for  resolution  are 
1200  DPI  for  line  art  and  300  lor  halftones. 

Size.  All  digital  artwork  must  be  submitted  at  its  actual 
printed  size  so  that  no  scaling  is  necessary. 

Multipanel  figures.  Figures  consisting  of  individual  parts 
(e.g..  panels  A.  B.  C)  must  be  assembled  into  final  format  and 
submitted  as  one  file. 

Hani  cop\:  Files  must  be  accompanied  by  hard  copy  for  use 
in  case  the  electronic  version  is  unusable. 

Disk  identification.  Disks  must  be  clearly  labeled  with  the 
following  information:  author  name  and  manuscript  number;  for- 
mat (PC  or  Macintosh  I:  name  and  version  of  software  used. 

Color:  The  Biological  Bulletin  will  publish  color  figures  and 
plates,  but  must  bill  authors  for  the  actual  additional  cost  of 
printing  in  color.  The  process  is  expensive,  so  authors  with  more 
than  one  color  image  should — consistent  with  editorial  concerns, 
especially  citation  of  figures  in  order — combine  them  into  a  single 
plate  to  reduce  the  expense.  On  request,  when  supplied  with  a  copy 
of  a  color  illustration,  the  editorial  staff  will  provide  a  pre-publi- 
cation  estimate  of  the  printing  cost. 

4.  Tables,  footnotes,  figure  legends,  etc.     Authors  should 
follow  the  style  in  a  recent  issue  of  The  Biological  Bulletin  in 


preparing  table  headings,  figure  legends,  and  the  like.  Because  ol 
the  high  cost  of  setting  tabular  material  in  type,  authors  are  asked 
to  limit  such  material  as  much  as  possible.  Tables,  with  their 
headings  and  footnotes,  should  be  typed  on  separate  sheets,  num- 
bered with  consecutive  Arabic  numerals,  and  placed  after  the 
Literature  Cited.  Figure  legends  should  contain  enough  informa- 
tion to  make  the  figure  intelligible  separate  from  the  text.  Legends 
should  be  typed  double  spaced,  with  consecutive  Arabic  numbers, 
on  a  separate  sheet  at  the  end  of  the  paper.  Footnotes  should  be 
limited  to  authors'  current  addresses,  acknowledgments  or  contri- 
bution numbers,  and  explanation  of  unusual  abbreviations.  All 
such  footnotes  should  appear  on  the  title  page.  Footnotes  are  not 
normally  permitted  in  the  body  of  the  text. 

5.  Literature  cited.  In  the  text,  literature  should  be  cited  by 
the  Harvard  system,  with  papers  by  more  than  two  authors  cited  as 
Jones  et  al..  1980.  Personal  communications  and  material  in  prep- 
aration or  in  press  should  be  cited  in  the  text  only,  with  author's 
initials  and  institutions,  unless  the  material  has  been  formally 
accepted  and  a  volume  number  can  be  supplied.  The  list  of 
references  following  the  text  should  be  headed  Literature  Cited, 
and  must  be  typed  double  spaced  on  separate  pages,  conforming  in 
punctuation  and  arrangement  to  the  style  of  recent  issues  of  The 
Biological  Bulletin.  Citations  should  include  complete  titles  and 
inclusive  pagination.  Journal  abbreviations  should  normally  follow 
those  of  the  U.  S.  A.  Standards  Institute  (USASI).  as  adopted  by 
BIOLOGICAL  ABSTRACTS  and  CHEMICAL  ABSTRACTS,  with  the  minor 
differences  set  out  below.  The  most  generally  useful  list  of  bio- 
logical journal  titles  is  that  published  each  year  by  BIOLOGICAL 
ABSTRACTS  (BIOSIS  List  of  Serials:  the  most  recent  issue).  Foreign 
authors,  and  others  who  are  accustomed  to  using  THE  WORLD  LIST 
OF  SCIENTIFIC  PERIODICALS,  may  find  a  booklet  published  by  the 
Biological  Council  of  the  U.K.  (obtainable  from  the  Institute  of 
Biology.  41  Queen's  Gate,  London.  S.W.7.  England.  U.K.)  useful, 
since  it  sets  out  the  WORLD  LIST  abbreviations  for  most  biological 
journals  with  notes  of  the  USASI  abbreviations  where  these  differ. 
CHEMICAL  ABSTRACTS  publishes  quarterly  supplements  of  addi- 
tional abbreviations.  The  following  points  of  reference  style  for 
Tin.  BIOLOGICAL  BULLETIN  differ  from  USASI  (or  modified  WORLD 
LIST)  usage: 

A.  Journal  abbreviations,  and  book  titles,  all  underlined  (for 
italics) 

B.  All  components  of  abbreviations  with  initial  capitals  (not 
as  European  usage  in  WORLD  LIST  e.g..  J.  Cell.  Coinp.  Physio/. 
NOT  J.  cell.  comp.  Physiol. ) 

C.  All  abbreviated  components  must  be  followed  by  a  period, 
whole  word  components  must  not  (i.e..  J.  Cancer  Res.) 

D.  Space   between   all   components   (e.g..   J.    Cell.    Comp. 
Ph\siol..  not  J.Cell.Comp.Physiol.) 

E.  LInusual  words  in  journal  titles  should  be  spelled  out  in 
full,  rather  than  employing  new    abbreviations  invented  bv    the 
author.  For  example,  use  Rn   \'i^iihlalic/iig\   l^lcntlinga  without 
abbreviation. 

F.  All  single  word  journal  titles  in  lull  (e.g..   \'eliger.  /•.«>/- 
og\;  Brain). 


G.  The  order  of  abbreviated  components  should  be  the  same 
as  the  word  order  of  the  complete  title  (i.e..  Proc.  and  Trans. 
placed  where  they  appear,  not  transposed  as  in  some  BIOLOGICAL 
ABSTRACTS  listings). 

H.  A  few  well-known  international  journals  in  their  preferred 
forms  rather  than  WORLD  LIST  or  USAS1  usage  (e.g..  Nature, 
Science,  Evolution  NOT  Nature,  Lmiil.,  Science.  N.Y.:  Evolution, 
Lancaster,  I'n.  I 

6.  Sequences.  By  the  time  a  paper  is  sent  to  the  press,  all 
nucleotide  or  amino  acid  sequences  and  associated  alignments 
should  have  been  deposited  in  a  generally  accessible  database 


(e.g..  GenBank.  EMBL,  SwissProt).  and  the  sequence  accession 
number  should  be  provided. 

7.  Reprint*,  page  proofs,  and  charges.  Authors  may  pur- 
chase reprints  in  lots  of  100.  Forms  for  placing  reprint  orders  are 
sent  with  page  proofs.  Reprints  normally  will  be  delivered  about  2 
to  3  months  after  the  issue  date.  Authors  w  ill  receive  page  proofs 
of  articles  shortly  before  publication.  They  will  be  charged  the 
current  cost  of  printers'  time  for  corrections  to  these  (other  than 
corrections  of  printers'  or  editors'  errors ).  Other  than  these  charges 
for  authors'  alterations.  The  Biological  Bulletin  does  not  have 
page  charges. 


Reference:  B/W.  Bull.  206:  1-3.  (February  20(14) 
©  2004  Marine  Biological  Laboratory 


Experimental  Evidence  That  Ovary  and  Oviducal 
Gland  Extracts  Influence  Male  Agonistic  Behavior 

in  Squids 


KENDRA  C.   BURESCH1.  JEAN  G.  BOAL2.  GREGG  T.  NAGLE\  JAMIE  KNOWLES1. 
ROBERT  NOBUHARA',  KATE  SWEENEY1,  AND  ROGER  T.  HANLON1  * 

1  Marine  Resources  Center,  Marine  Biological  Laboratory,  Woods  Hole,  Massachusetts  02543-1015: 
Department  of '  Biolog\,  Millersville  University  of  Pennsylvania,  Millersville,  Pennsylvania  17551-0302: 
and  3  Marine  Biomedia.il  Institute  and  Department  of  Anatomy  ami  Neurosciences,  University  of  Texas 

Medical  Branch.  Galveston,  Texas  77555- 1  t*6V 


Recent  investigations  of  sensory  and  behavioral  cites  that 
initiate  sexual  selection  processes  in  the  squid  Loligo  pealeii 
have  determined  that  egg  capsules  deposited  on  the  sub- 
strate provide  a  strong  visual  and  chemotactile  stimulus  to 
males,  even  in  the  absence  of  females  fl.  2.  3>.  The  visual 
stimulus  of  egg  capsules  attracts  males  to  the  eggs,  and 
when  the  males  touch  the  eggs,  thev  encounter  a  chemical 
stimulus  that  leads  to  highly  aggressive  fighting  behavior. 
We  have  recently  demonstrated  that  egg  capsule  extracts 
implanted  in  artificial  egg  capsides  elicit  this  aggressive 
behavior  14).  In  this  communication,  we  present  evidence 
that  the  salient  chemical  factor  originates  in  the  ovary  and 
perhaps  the  oviducal  gland  of  the  female  reproductive  tract. 

Cephalopods  are  highly  visual  animals,  yet  recent  re- 
search has  shown  that  chemical  communication  plays  an 
important  role  in  regulating  some  behaviors  (5).  It  has  long 
been  known  (6)  that  Loligo  pealeii  is  attracted  visually  to 
egg  capsules  (each  translucent  egg  capsule  is  about  4  cm 
long  and  contains  100-300  eggs)  and  that  females  fre- 
quently lay  egg  capsules  adjacent  to  existing  egg  capsules 
(7.  8).  A  fortuitous  field  observation  indicated  that  males  are 
visually  attracted  by  egg  capsules,  but  that  touching  the  eggs 
was  essential  to  evoke  the  intra-male  competition  for  mates 
( 1 ).  Thus  it  appears  that  both  visual  and  chemical  commu- 
nication play  a  role  in  triggering  a  change  from  shoaling 
behavior  to  mating  behavior  when  L.  pealeii  migrates  in- 
shore to  spawn  in  spring.  Our  ultimate  goal  is  to  identify  and 


Received  X  August  2003:  accepted  25  November  2(103. 
*  To  whom  correspondence  should  be  addressed.  E-mail:  rhanlon® 
mbl.edu 


characterize  the  compound  (or  compounds)  that  elicits  this 
highly  aggressive  behavior  in  male  squids. 

Behavioral  responses  to  natural  eggs  were  compared  with 
responses  to  artificial  egg  capsules  coated  with  extracts  (4) 
from  one  of  four  female  reproductive  organs  or  glands: 
ovary,  oviducal  gland,  nidamental  gland,  or  accessory  nida- 
mental  gland.  With  the  exception  of  ovary  (see  below),  the 
equivalent  of  one-fifth  of  each  gland  was  used  to  coat  the 
artificial  egg  capsules.  Six  behaviors  were  selected  to  assess 
the  level  of  aggression  because  they  were  conspicuous,  easy 
to  score,  and  reliable  between  observers.  The  general  se- 
quence of  increased  aggression  in  loliginid  squids  (9.  10),  as 
shown  by  five  of  these  behaviors,  can  be  depicted  as  fol- 
lows: 

Raised  arm  — >  Fin-beating  — » Chase 

— >  Forward  Lunge  Grab  (FLG)  — >  Grapple 

The  sixth  behavior.  Splayed  arms,  is  associated  with  de- 
fense of  eggs  or  females  and  was  also  recorded.  The  fre- 
quency of  any  one  of  these  six  discrete  behaviors  was 
relatively  low;  consequently,  the  variable  Total  Aggression 
was  computed  as  the  sum  of  all  occurrences  of  any  of  the  six 
behaviors. 

All  experiments  were  conducted  between  May  and  Au- 
gust 2002.  Squids  were  caught  in  Vineyard  Sound  (Fal- 
mouth.  MA)  using  trawls  or  jigs.  Reproductive  organs  were 
collected  from  16  females.  Each  whole  organ  (except  ovary, 
which  was  subsampled  due  to  its  large  size)  was  indixidu- 
ally  extracted,  centrifuged,  and  purified  using  separate  CIS 
Sep-Pak  cartridges  (Waters  Corp.,  Milford.  MA)  as  do 


K    C.   BURESCH  ET  AL 

Table  1 

Mean  nninhi'i  <>/  hi-liavim  s  rei  unU'J  Juniix  the  Ill-inin  rritil  />crii>J  for  ctich  c'.v.i;  Minni/us 


Egg 

Raised 

Fin- 

# 

Splayed 

Total 

Egg  stimulus 

»;;, 

touch 

arm 

beating 

Chases 

FLO** 

Grapple 

arms 

aggr.t 

Natural 

7 

2.71 

3.24 

1  1)0 

12.24 

9.X6 

(.29 

3.86 

31  57 

Ovarj 

10 

3.30 

2.20 

0.70 

5.70 

0.60 

0.60 

3.40 

13.20 

(  hidncal 

11 

5.18 

0.27 

0.55 

7.64 

2.91 

0.18 

1.27 

12.82 

Nidamental  accessm) 

10 

1.90 

0.30 

0.10 

1.30 

0.70 

0.00 

O.SO 

3.20 

Nidamental 

10 

3.00 

0.30 

0.10 

1.30 

050 

0.20 

1.10 

3.50 

::  n[n  is  the  number  of  squid  pairs  tested. 

I  I.G  is  the  behavior  Forward-Lunge-Grah. 
v  Total  Aggression  is  the  sum  of  all  instances  of  Raised  arm.  Fin-beating.  Chase.  FLG,  Grapple,  ami  Splayed  arms. 


scribed  previously  (4);  CIS  Sep-Paks  bind  small  molecules, 
peptidcs.  aod  small  proteins. 

Behavioral  trials  were  conducted  in  round  tanks  with 
aerated,  flow-through  natural  seawater.  Trials  were  con- 
ducted according  to  the  following  protocol.  A  pair  of  squids 
was  placed  in  the  trial  tank  and  allowed  30  min  to  reach 
baseline  behavior  (i.e.,  agonistic  interactions  resulted  in  one 
squid  becoming  dominant  and  occupying  the  center  of  the 
tank,  and  both  squids  being  calm  and  showing  normal 
coloration).  In  the  pre-test.  a  bundle  of  16-20  natural  egg 
capsules  was  added  to  the  tank.  Data  collection  began  when 
one  of  the  squids  touched  the  egg  capsules.  Previous  exper- 
iments demonstrated  that  uncoated  artificial  eggs  elicited 
significantly  fewer  egg  touches  than  either  coated  artificial 
eggs  or  natural  eggs  (Friedman  two-way  ANOVA  by  ranks; 
F,  --••  7.43.  n  =  14:  P  <  0.05).  Not  all  squids  were 
attracted  to  natural  eggs;  pairs  in  which  neither  squid 
touched  the  eggs  were  removed  from  the  experiment.  In- 
stances of  five  of  the  six  discrete  behaviors  (Raised  arm. 
Fin-beating.  Forward-Lunge-Grab  (FLG),  Grapple,  Splayed 
arms)  were  recorded  continuously  for  10  min.  Chase  was 
frequent  and  continuous;  consequently  it  was  recorded  at 
1 5-s  intervals.  Squids  that  did  not  respond  aggressively  (i.e., 
touched  eggs  but  stayed  at  baseline  behavior — resting  or 
calm  swimming)  during  the  pre-test  were  excluded  from 
further  experiments.  After  a  minimum  of  I  h  to  regain 
baseline  behavior,  experimental  trials  commenced.  The 
mean  time  to  return  to  baseline  behavior  after  being  exposed 
lu  an  egg  stimulus  was  determined  previously  to  be  7.9  min 
(range  1-40  min;  n  =  II).  The  egg  stimulus  (natural  egg 
capsules  or  artificial  egg  capsules)  was  added  lo  the  tank 
and  behaviors  were  scored  as  before. 

\\'c  expected  to  examine  the  differences  in  responses  of 
squills  (experimental  trial  response  minus  pre-test  response) 
lo  control  for  variation  in  u-spoiises  between  squids;  how- 
ever, the  variances  in  the  calculated  differences  were  higher 
than  the  variances  of  responses  lor  either  pre-test  trials  or 
experimental  trials  (c.,i;..  the  variances  for  total  aggression 
with  real  eggs  were  pre-tesl.  i')S;  experimental  trials.  }(>'); 


differences.  692;  H  =:  7).  Consequently,  only  data  from 
experimental  trials  were  analyzed  further.  A  Kruskal-Wallis 
analysis  of  variance  by  ranks  (data  were  unitless  and  not 
normally  distributed)  was  performed  to  determine  which 
female  reproductive  organ  elicited  an  agonistic  response 
comparable  to  natural  eggs.  Multiple  comparisons  of  treat- 
ments with  the  control  were  then  performed.  Note  that 
statistical  significance  indicates  that  a  treatment  was  not  as 
effective  as  real  eggs. 

A  total  of  54  Raised  arms.  22  Fin-beatings.  253  Chases. 
1 19  FLGs,  19  Grapples,  and  94  Splayed  arms  were  recorded 
throughout  the  experiment  (n  =  48  pairs;  means  are  listed 
in  Table  I ).  Aggressive  behavior  ("Total  Aggression"  in 
Table  1 )  differed  significantly  between  egg  stimuli  l^2 
15.5.  df  =  4.  P  <  0.01 ).  Squids  responded  with  the  most 
aggression  in  response  to  natural  eggs  and  with  the  least 
aggression  in  response  to  extracts  from  nidamental  and 
accessory  nidamental  glands.  Comparisons  (11)  of  treat- 
ments versus  the  control  (i.e..  natural  eggs)  revealed  that 
aggressive  responses  to  extracts  from  nidamental  and  ac- 
cessory nidamental  glands  were  significantly  lower  than 
responses  to  natural  eggs.  If  we  assume  that  more  egg 
touches  provide  a  greater  stimulus  for  aggression,  then  it  is 
reasonable  to  consider  the  aggression  observed  per  egg 
touch.  In  this  case,  aggressive  behavior  again  differed  sig- 
nificantly between  egg  stimuli  (,Y2  -  12.72.  df  ==  4.  P  < 
0.05);  however,  comparisons  (11)  of  treatments  versus  the 
control  (i.e.,  natural  eggs)  show  that  only  extracts  from 
ovaries  elicited  aggression  statistically  indistinguishable 
from  that  of  real  eggs  (Fig.  1  ). 

These  results  indicate  (hat  a  chemical  factor  that  induces 
agonistic  interactions  is  produced  in  the  ovary,  and  perhaps 
also  in  the  oviducal  gland,  but  not  in  the  nidamental  or 
accessory  nidamental  glands.  The  reversible  binding  of  the 
chemical  to  CIS  Sep-l'ak  cartridges  suggests  strongly  that  it 
is  a  soluble  factor.  Eggs  are  produced  in  the  ovary  and  are 
transported  into  the  oviducal  gland,  which  is  a  specialized 
segment  of  the  oviduct  that  is  involved  with  secretion  (12). 
The  oviducal  gland  produces  the  inner  jelly  of  the  egg  mass 


INTRASPECIF1C  CHEMICAL  STIMULI   IN   SQUID  EGG 


30 


u 

3 
O 
H 
O) 


20 


Total  Aggression  pe 

0  O 

T                 T                                  * 

T                  rt      i 

03                     CT                   03                     03                 £^  _03 
^5                     03                     "                   "c                 O    C 
^                     ^*                                            OJ                 (/}    CD 

03             O             ^              E           w  E 

^                                           /-\                    03                 o    03 

^              -o            o  -o 
Z             <  Z 

Figure  1.  The  median  numbers  of  aggressive  behaviors  per  egg  touch 
(error  bars  indicate  first  and  third  quartiles)  of  squids  alter  (.-(intact  with 
natural  eggs  or  contact  with  extracts  from  female  reproductive  glands  ( n  = 
48  pairs).  An  asterisk  indicates  that  responses  were  significantly  different 
from  responses  to  natural  eggs  (r  =  12.72.  df  =  4.  P  <  0.05). 


of  L.  pealeil  (6).  In  contrast,  the  nidamental  gland  produces 
the  outer  coating  of  the  egg  capsule  (12).  and  the  accessory 
nidamental  gland  is  responsible  for  coating  the  eggs  with 
bacteria  that  may  deter  pathogens  or  reduce  predation  (13). 
There  may  be  several  chemical  factors  responsible  for  in- 
ducing agonistic  behavior — for  example,  chemicals  in  the 
eggs  themselves  and  perhaps  in  the  inner  jelly  of  the  egg 
capsule  secreted  by  the  oviducal  gland.  If  the  chemical  is 
indeed  produced  in  the  ovary,  as  suggested  by  these  results, 
there  must  be  some  mechanism  (e.g.,  diffusion)  by  which 
the  compound  reaches  the  outer  jelly  coats  of  the  egg 
capsule  so  that  male  squids  can  detect  the  compound  when 
they  touch  the  eggs. 

Pheromones  are  key  mediators  of  reproductive  behaviors, 
and  an  understanding  of  their  roles  is  essential  to  under- 
standing the  ecology  and  evolution  of  populations  and  spe- 
cies (14).  Aquatic  pheromones  are  particularly  difficult  to 
characterize  because  they  are  rapidly  degraded  (15):  conse- 
quently, few  invertebrate  pheromones  have  been  character- 
ized in  aquatic  animals.  However,  a  family  of  structurally 
related  peptide  pheromonal  attractants  ("attractins")  has  re- 
cently been  characterized  in  five  species  of  the  opistho- 
branch  Aplysiti  (16.  17),  and  the  three-dimensional  NMR 
solution  structure  of  A.  californica  attractin  has  been  deter- 
mined (18).  These  peptide  pheromones  are  secreted  by  the 
albumen  gland,  a  large  exocrine  gland  that  packages  the 
eggs  into  a  cordon.  Our  results  with  squids  suggest  that  the 
ovary  and  oviducal  gland  should  be  tested  further,  and  that 


chemical  factors  in  those  organs  should  be  chemically  and 
behaviorally  characterized.  Clearly,  more  research  is  re- 
quired to  understand  the  mechanisms  and  functions  of  mul- 
tiple sensory  cues  that  play  a  critical  role  in  initiating  the 
sexual  selection  processes  in  Loligo  pcalcii. 

Literature  Cited 

1.  Hanlon,  R.  T.  1996.     Evolutionary  games  that  squids  play:  fighting, 
courting,  sneaking,  and  mating  behaviors  used  fur  sexual  selection  in 
Lolif!i>  net/lei.  Biul.  Hull.   191:  304-310. 

2.  King,  A.  J..  S.  A.  Adamo,  and  R.  T.  Hanlon.  1999.     Contact  with 
squid  egg  capsules  increases  agonistic  behavior  in  male  squid  (Loligo 
iwtileil  Biul.  Hull.  197:  256. 

3.  King,  A.  J.,  S.  A.  Adamo,  and  R.  T.  Hanlon.  2003.     Agonistic 
behavior  between  male  squid:  squid  egg  mops  provide  sensory  cues  tor 
swift  conflict  escalation.  Aniiii.  Heluiv.  66:  44-58. 

4  Buresch,  K.  C.,  J.  G.  Boal,  J.  Knowles,  J.  Debose,  A.  Nichols.  A. 
Erwin,  S.  D.  Painter,  G.  T.  Nagle,  and  R.  T.  Hanlon.  2003.  Con- 
tact chemosensory  cues  in  egg  handles  elicit  male-male  agonistic 
conflicts  in  the  squid  l.oli^o  pealeii  (Mollusca:  Cephalopoda). 
J.  Chcm.  Eci'l.  29:  524-542. 

5.  Hanlon,  R.  T.,  and  N.  Shashar.  2002.     Aspects  of  the  sensory 
ecology  of  cephalopods.  Pp.  266-282  in  SeiiMirv  Processing  in  the 
Aquatic  Environment.  S.  P.  Collin  and  N.  J.  Marshall,  eds.  Springer 
Verlag,  New  York.  446  pp. 

6.  Drew,  G.  A.  1911.     Sexual  activities  of  the  squid,  Loligo pealii  (Les.). 
I.  Copulation,  egg-laying  and  fertili/ation.  ./.  Morphol.  22:  327-359. 

7.  Arnold,  J.  M.  1962.     Mating  behavior  and  social  structure  in  Loligo 
I'ciilii.  Biul.  Bull.  123:  53-57. 

8.  Griswold,  C.  A.,  and  J.  Prezioso.  1981.     In  situ  observations  on 
reproductive  behavior  of  the  long-tinned  squid.  Loli^o  peulei.  Fish. 
Bull.  78:  445-447. 

4.  Hanlon.  R.  T.,  M.  R.  Maxwell,  N.  Shashar.  E.  R.  Loew,  and  K.-L. 
Boyle.  1999.     An  ethogram  of  body  patterning  behavior  in  the  bio- 
medically  and  commercially  valuable  squid  Liilif!"  pcalei  off  Cape 
Cod.  Massachusetts.  Biul.  Bull  197:  44-62. 

10.  DiMarco.  F.  P.,  and  K.  T.  Hanlon.  1997.     Agonistic  behavior  in  the 
squid  Lilian  p/ci  (Loliginidae.  Teuthoidea):  fighting  tactics  and  the 
effects  of  size  and  resource  value.  Ethology  103:  84-108. 

1 1.  Siegel,  S.,  and  N.  J.  Castellan,  Jr.  1988.     Nonptiniiiielric  Statistics 
tor  the  Behavioral  Sciences.  McGraw-Hill.  New  York.  344  pp. 

12.  Lum-Kong,  A.  1992.     A  hislological  study  of  the  accessory  repro- 
ductive organs  of  female  L< iligi i  foiiu :si  (Cephalopoda:  Loliginidae). ./. 
Znol.  (Loml.l  226:  464-440. 

13.  Barhieri.  E..  K.  Barry,  A.  Child,  and  N.  Wainvvright.  1997.     Anti- 
microbial activity  in  the  microhial  community  of  the  accessory  nida- 
mental  gland  and  egg  cases  ot   l.oli\;o  /iculei  (Cephalopoda:  Loli- 
ginidae). Biol.  Bull.  193:  275-276. 

14.  Zinimer,   R.   K.,  and   C.   A.   Butman.   2000.     Chemical   signaling 
processes  in  the  marine  environment.  Biol.  Bull.  198:  168-187. 

15.  Shimuzu.  V.  1985.     Bioaclive  marine  natural  products  with  emphasis 
on  handling  of  water-soluble  compounds.  J.  Nut.  Prod.  48:  223-235 

16  Painter.  S.  D..  B.  dough,  R.  W.  Garden,  J.  V.  Sweedler,  and  G.  T. 
Nagle.  1998.     Characterization  of  Anlysiu  attractin.  the  first  water- 
borne  peplide  pheromone  in  invertebrates.  Biol.  Bull.  194:  120-131. 

17  Painter,  S.  D.,  D.-B.  G.  Akalal,  B.  dough,  A.  .1.  Susswein.  M.  Levy, 
and  G.  T.  Nagle.  2000.     Characterization  of  tour  new  members  of  the 
attractin  family  of  peptide   pheromones   in  .4/>/y.vm.   Soe.  Neurnsci. 
Abstr.  26:  I  166. 

18.  Garimella,  R.,  V.  Xu.  C.  H.  Schein,  K.  Rajarathnam,  G.  T.  Nagle, 
S.  I).  Painter,  and  W.  Braun.  2003.  NMR  solution  sliuclure  of 
atlractin.  a  water-borne  prolcin  pheromone  from  the  mollusk  A/'lvsni 
ciilifornica.  tiiochciiustrv  42:  4470-4474. 


Kelercnce:  Bio/.  Bull.  206:  4-12.  iFebruan  2l«U> 
©  2004  Marine  Biological  Lahoraton. 


Contraction  and  Stiffness  Changes  in  Collagenous 

Arm  Ligaments  of  the  Stalked  Crinoid  Metacrinus 

rotundus  (Echinodermata) 

TATSUO  MOTOKAWA*,  OSAMU  SHINTANI.  AND  RUDIGER  BIRENHEIDE 

Depurtnicnt  of Biological  Sciences.  Graduate  School  of  Bioscience  and  Biotechnology, 
Tok\o  Institute  of  Technology,  Meguro,  Tokyo,  /x?-cS'5.5/  Japan 


Abstract.  Shortening  and  stiffness  were  measured  simul- 
taneously in  the  aboral  ligament  of  arms  of  sea  lilies.  Arm 
pieces  were  used  from  which  oral  tissues  (including  mus- 
cles) were  removed,  leaving  only  collagenous  ligaments 
connecting  arm  ossicles.  Chemical  stimulation  by  means  of 
artificial  seawater  with  an  elevated  concentration  of  potas- 
sium caused  both  a  bending  movement  and  stiffness 
changes  (either  softening  or  stiffening  I.  The  movement 
lasted  for  1.5-10  min.  and  bent  posture  was  maintained.  The 
observation  that  contraction  was  not  necessarily  associated 
with  softening  provided  evidence  against  the  hypothesis  that 
the  shortening  of  the  aboral  ligaments  was  driven  by  the 
elastic  components  that  had  been  charged  by  the  oral  mus- 
cles and  released  their  strain  energy  at  the  softening  of  the 
aboral  ligaments.  The  speed  of  ligamental  shortening  was 
slower  by  at  least  one  order  of  magnitude  than  that  of 
muscles.  Acetylcholine  (10  5-10  3  M)  caused  both  con- 
traction and  softening.  We  conclude  that  the  aboral  ligament 
shows  two  mechanical  activities  based  on  different  mecha- 
nisms: one  is  active  contraction  and  the  other  is  connective 
tissue  catch  in  which  passive  mechanical  properties  show 
mutability.  We  suggest  thai  there  is  neural  coordination 
between  the  two  mechanisms. 

Introduction 

Echinoderms  are  unique  in  possessing  mechanically  ac- 
tive collagenous  connective  lissues.  The  best-known  exam- 
ple is  catch  connective  tissue  (mutable  connective  tissue). 
which  changes  its  passive  mi  ..hauical  properties  under  ner- 


KeCL-i\L-d   I')  June  2(l(lv  atvi 
*  To  whom  iom-sp<mcK-ncc 
bio.titech.ac.jp 


l  JdO.V 


bi 


.  F.-mail:  lmoioka\\<" 


vous  control  (Motokawa,  1984:  Wilkie.  1996).  Catch  con- 
nective tissues  are  found  in  various  anatomical  locations  in 
all  the  classes  of  echinoderms.  and  they  have  been  regarded 
as  one  of  the  major  features  that  characterize  the  phylum 
Echinodermata  (Motokawa.  1988).  The  catch  connective 
tissue  stiffens  or  softens.  Such  changes  in  passive  mechan- 
ical properties  become  apparent  only  when  an  external  force 
is  applied  and  the  reaction  of  the  tissue  to  this  force  is 
measured. 

Another  kind  of  mechanically  active  connective  tissue 
was  recently  found  in  echinoderms  (Birenheide  and  Mo- 
tokawa. 1996.  1998:  Birenheide  ct  a!..  2000).  The  collage- 
nous  ligaments  in  the  arms  and  cirri  of  crinoids  contract  in 
response  to  chemical  stimuli  such  as  cholinergic  agents  and 
seawater  with  an  elevated  concentration  of  potassium.  Al- 
though the  mechanism  of  contraction  has  yet  to  be  eluci- 
dated, it  is  evident  thai  muscles  are  not  directly  involved  in 
the  contraction  because  no  muscle  cells  were  found  in  these 
ligaments  (Birenheide  and  Motokawa.  1994;  Birenheide  ct 
iiL  2000). 

There  remains  the  possibility  that  muscles  are  indirectly 
involved  in  the  contraction  of  connective  tissues.  The  aboral 
ligaments  of  crinoid  amis  are  disposed  in  an  antagonistic 
position  to  the  muscles  in  arm  articulations  (Fig.  la).  Cri- 
noid arms  consist  of  a  row  of  ossicles  connected  by  liga- 
ments and  muscles  (F;ig.  Ih).  The  lace  of  each  ossicle  bears 
a  fulcrum  that  corresponds  to  the  fulcrum  of  the  adjacent 
ossicle.  Muscles  arc  found  onlv  on  the  oral  (upper)  side  ot 
the  fulcrum,  whereas  collagenous  ligaments  arc  found  both 
orally  and  aborally.  When  muscles  on  the  oral  side  of  the 
fulcrum  contract,  the  arm  bends  in  the  oral  direction.  The 
arm  also  shows  ahoral  bending.  Because  the  aboral  liga- 
ments are  the  only  mechanically  strong  element  on  the 
aboral  side  of  the  fulcrum,  they  are  no  doubt  responsible  for 


CONTRACTILE  CONNECTIVE  TISSUE 


aboral  bending.  The  conventional  explanation  has  invoked 
elastic  recoil  (Birenheide  and  Motokawa.  1994).  According 
to  this  view,  elastic  energy  is  stored  in  the  aboral  ligaments 
by  passive  stretch  when  oral  bending  is  produced  by  the 
muscles.  This  strain  energy  is  then  released  when  the  mus- 
cles relax,  and  the  aboral  ligaments  shorten  to  cause  aboral 
bending  of  the  arm.  This  explanation  regards  the  abora! 
ligament  as  being  an  antagonizing  spring  to  the  oral  muscle. 

The  aboral  ligaments  are  not.  however,  a  simple  spring. 
Arm  preparations  from  which  all  the  oral  muscles  have  been 
removed  keep  a  rather  straight  posture  and  show  aboral 
bending  upon  chemical  stimulation  (Birenheide  and  Mo- 
tokawa, 1996).  Some  locking  mechanism  for  keeping  the 
straight  posture — and  thus  the  charged  state  of  the  spring — 
would  seem  to  be  necessary,  otherwise  the  aboral  ligaments 
would  spring  back  at  the  moment  when  the  antagonizing 
muscles  are  removed.  A  possibility  is  that  the  ligament 
stores  strain  energy  as  an  expanded  spring  by  stiffening  the 
tissue  and  releases  it  by  softening,  which  results  in  short- 
ening of  the  ligament.  The  "spring-with-a-lock"  hypothesis 
for  the  contraction  of  crinoid  arm  ligaments  seems  to  be  a 
reasonable  one  because  the  arm  ligaments  contain  fibrillin- 
like,  and  thus  possibly  elastic,  microfibrils  (Birenheide  and 
Motokawa,  1994)  and  show  mutability  of  stiffness  (Biren- 
heide and  Motokawa,  1998).  The  hypothesis  is  also  parsi- 
monious because  otherwise  some  unknown  actively  con- 
tractile machinery  would  have  to  be  postulated. 

The  present  study  was  designed  to  test  the  spring-with- 
a-lock  hypothesis.  We  measured  shortening  and  stiffness  of 
the  aboral  ligaments  simultaneously.  The  hypothesis  pre- 
dicts that  softening  should  precede  shortening.  The  results 
we  obtained  were  contrary  to  the  prediction  and  thus  sup- 
port our  previous  suggestion  that  the  ligaments  actively 
contract  without  the  help  of  muscles  (Birenheide  and  Mo- 
tokawa, 1998;  Birenheide  et  «/.,  2000). 

Materials  and  Methods 

Specimens  of  the  stalked  crinoid  Metacriiuts  rotundus 
Carpenter,  1882.  were  dredged  from  depths  of  100-150  m 
in  Suruga  Bay  off  Numazu,  Japan.  Collected  specimens 
were  transported  to  our  laboratory  in  Tokyo,  where  they 
were  held  in  a  tank  containing  recirculating  seawater.  The 
tank  was  kept  dark  and  the  water  temperature  was  main- 
tained at  14  °C.  Nineteen  individuals  were  used  for  exper- 
iments. They  were  used  within  2  months  after  capture. 

The  arm  of  Metacrinns  rotundus  consists  of  a  series  of 
ossicles  that  are  connected  by  ligaments  and  muscles.  The 
skeletal  joint  of  the  ossicles  is  a  transverse  ridge  that  acts  as 
a  fulcrum.  The  muscles  are  found  only  on  the  oral  side  of 
the  fulcrum,  while  ligaments  are  found  on  both  sides  (Fig. 
la).  The  aboral  ligament  was  used  in  the  present  study.  The 
aboral  ligament  consists  of  two  parts,  the  main  ligament  and 
the  much  smaller  ligament  housed  in  a  fossa.  The  results 


Figure  1.  The  articulation  surface  ol  an  ossicle  of  Metacrinns  rntnih/in 
(a),  and  the  side  view  of  an  excised  arm  piece  (b).  Oral  direction  is  to  the 
top  in  a  and  to  the  bottom  in  b.  (a)  A  transverse  ridge  (arrows)  that  acts  as 
a  fulcrum  is  arranged  at  an  angle  of  about  60°  to  the  oral-aboral  plane.  The 
ridges  on  the  distal  and  the  proximal  side  of  each  ossicle  are  arranged  at 
angles  of  60°  and  —60°,  respectively.  The  central  hole  houses  a  brachial 
nerve.  On  the  oral  joint  surface,  two  muscle  bundles  (M)  and  two  bundles 
of  oral  ligaments  (OL)  insert  into  the  ossicle.  On  the  aboral  joint  surface, 
aboral  ligaments  (densely  hatched  area),  which  consists  of  a  main  aboral 
ligament  (AL)  and  a  small  fossa  ligament,  insert  into  the  ossicle.  No 
muscles  are  found  on  the  aboral  side  of  the  fulcrum,  (b)  An  arm  piece  with 
six  ossicles  that  are  connected  with  each  other  by  ligaments  and  muscles. 
The  oral  side,  including  muscle  bundles,  was  removed  from  the  arm  piece 
with  a  razor  blade,  and  the  remaining  oral  tissues  between  the  ossicles 
(arrows)  were  cut  up  to  the  fulcrum. 

reported  here  refer  to  the  combined  properties  of  the  two 
ligaments.  An  arm  piece  (length  ca.  6  mm)  containing  five 
to  seven  ossicles  was  dissected  from  a  sea  lily.  The  oral 
side,  containing  coelomic  canals,  muscles,  and  most  of  the 
oral  ligaments,  was  removed  using  a  razor  blade  (Fig.  Ib). 
The  remaining  oral  tissue  between  ossicles  was  cut  up  to  the 
fulcrum.  The  adjacent  ossicles  were  thus  connected  by  a 
mechanically  strong  aboral  ligament  and  by  a  mechanically 
weak  epidermis  overlying  the  ligament,  and  also  by  a  me- 
chanically weak  brachial  nerve  housed  in  a  hole  in  the 
center  of  the  ossicle. 

The  experimental  setup  is  shown  in  Figure  2.  The  prox- 
imal end  of  the  arm  piece  was  firmly  fixed  to  a  holder  by 
both  cyanoacrylate  glue  and  mechanical  clamping.  The  dou- 
ble fixing  ensured  that  there  would  be  no  slippage  between 
the  sample  and  the  holder  when  the  sample  was  subjected  to 
a  push.  The  arm  piece  was  held  horizontally  with  the  aboral 
side  upward.  A  small  L-shaped  stainless  steel  plate  weigh- 
ing 140  mg  was  glued  to  the  free  end  of  the  arm.  and 
seawater  was  introduced  to  a  trough.  The  position  of  the 
plate,  and  thus  that  of  the  arm  tip.  was  recorded  by  an  eddy 
current  sensor  (E2CA-AN4E.  Omron.  Japan)  located  in  the 
floor  of  the  trough.  In  this  setup,  any  active  contraction  ot 


T.   MOTOKAWA  ET  AL. 


the  aboral  ligaments  results  in  an  upward  bending  of  the  arm 
piece  against  the  force  of  gravity;  large  softening  of  the 
ligaments  would  cause  the  arm  piece  to  bend  downward 
under  gravity. 

We  constructed  a  device  that  allowed  us  to  measure  the 
stiffness  of  the  ligament  without  restraining  the  free  move- 
ment of  the  sample  (Fig.  2).  The  device  consisted  of  a  force 
gauge  (KSP-2-120-E-4,  Kyowa,  Japan)  to  which  a  probe  of 
1  mm  diameter  was  attached.  The  gauge  was  fixed  to  a 
linear  motion  actuator  (c-sx-30,  THK,  Japan)  controlled  by 
a  microcomputer.  The  actuator  produced  vertical  motion 
that  allowed  positioning  of  the  probe  in  increments  of  10 
jLim.  The  movements  were  controlled  via  a  computer  pro- 
gram written  in  BASIC.  The  program  took  data  provided 
from  the  movement  sensor  and  positioned  the  probe  so  that 
it  was  always  2  mm  above  the  stainless  steel  plate  attached 
to  the  arm  piece.  Any  movement  of  the  arm  was  followed  by 
an  immediate  corresponding  movement  of  the  probe  so  that 
the  distance  between  the  probe  tip  and  the  specimen  re- 
mained constant.  At  intervals  determined  by  the  experi- 
menter, the  probe  was  lowered  until  it  touched  the  stainless 
steel  plate.  From  this  point  the  probe  was  lowered  further 
for  0.2  mm.  which  caused  downward  displacement  of  the 
arm  tip  by  the  same  amount.  The  force  resulting  from  this 
downward  displacement  was  recorded.  The  probe  was  then 
retracted  to  its  position  above  the  specimen.  The  speed  of 
the  probe  was  4.2  mm/s,  which  was  100  times  faster  than 
the  fastest  arm-tip  movement  observed.  The  probe  touched 
the  arm  for  less  than  91  ins.  The  bending  stiffness  was 
calculated  as  the  peak  force  divided  by  the  maximum  ex- 
cursion of  the  arm  tip  during  the  push,  expressed  as  the 


Figure  2.  Si. Ik-malic  drawing  ol  the  experimental  setup.  An  arm  piece 
(a),  whose  si/e  is  di.iwn  exaggerated,  is  held  hori/onialK  .mil  ahoral  side 
up  in  a  Irough.  A  IOKC  gautv  III,  in  which  a  prohe  (p)  is  attached,  is 
mounted  on  the  nio\m<j  head  n  ol  a  lineal  motion  aeul.iloi  driven  hy  a 
stepping  motor  (ml.  I  he  \eriie.il  p.  iMtmn  ol  the  mining  head  and  thus  that 

nl  llie  prohe  lip  is  picciscK  ci !  he  position  ol  the  1.  shaped  metal 

plale  glued  to  Ihe  distal  end  ol  the  ai  piece  is  monitored  In  a  displace- 
ment sensoi  id  I.  Holh  (nice  and  displ.u  ,  i  mil  signals  are  led  to  a  compulei 
i  In  on  "h  an  analog-lo  dig  Hal  eon  \eilei  board  I  VIM  I  ecilliack  signals  hum 
the  computer  au-  gi\en  to  llie  molor  viti  a  motoi  eonirollci  (c). 


percentage  of  the  control  value.  The  device  thus  enabled  us 
to  record  stiffness  changes  and  arm  movement  simulta- 
neously. 

The  sample  was  left  in  a  trough  for  10  min.  and  two 
successive  downward  pushes,  separated  by  an  interval  of 
about  100  s,  were  applied  to  check  that  the  stiffness  and  the 
baseline  position  of  the  arm  tip  were  maintained.  The  stiff- 
ness at  the  second  push  was  taken  as  the  control  value  S0. 
The  stiffness  change  AS,  expressed  as  a  percentage,  was 
calculated  as  follows:  AS  =  100  X  (S,  -  S,,)/S(I,  where 
S,  is  the  stiffness  after  stimulation.  A  stiffness  decrease  was 
thus  shown  as  a  negative  value.  Chemicals  for  stimulation 
were  introduced  within  I  min  after  the  second  push.  The 
speed  of  elevation  of  the  arm  tip  was  designated  as  the 
bending  speed.  The  peak  bending  speed  was  the  maximum 
speed  of  the  upward  bending  of  the  arm  tip.  The  average 
bending  speed  in  artificial  seawater  with  an  elevated  potas- 
sium concentration  was  calculated  as  follows.  The  peak 
height  of  the  bending  of  the  arm  tip  from  the  baseline  was 
taken  as  100%.  The  average  bending  speed  was  defined  as 
80%  of  the  maximum  excursion  divided  by  the  time  needed 
to  bend  from  10%  to  90%  of  the  peak  height.  The  reaction 
time  for  contraction  was  the  time  that  elapsed  from  the 
application  of  chemical  to  the  beginning  of  bending. 

Artificial  seawater  (ASW)  in  the  trough  was  constantly 
circulated  via  a  pump  through  a  water  bath  to  keep  the 
temperature  at  14  °C.  The  composition  of  ASW  was  as 
follows  (in  mmol/l):  NaCl.  433.7;  KC1.  10.0:  CaCK.  10.1: 
MgCU  52.5;  NaHCO,,  2.5.  The  pH  of  all  the  solutions  was 
adjusted  to  8.2.  ASW  whose  potassium  concentration  was 
raised  to  100  mA/  (KASW)  was  prepared  by  reducing  the 
sodium  concentration  so  as  to  keep  osmolarity  constant. 
Acetylcholine  solution  (ACh)  was  prepared  by  diluting  ace- 
tylcholine  chloride  (Nacalai  Tesque,  Japan)  to  the  desired 
concentration  in  ASW.  To  rinse  out  the  trough,  both  KASW 
and  ACh  were  exchanged  with  ASW  using  the  circulation 
pump. 


Results 


Control  experiments 


We  performed  control  experiments  to  ensure  that  our 
experimental  setup  did  not  influence  the  movement  or  stiff- 
ness of  the  arm.  When  an  arm  piece  glued  to  the  stainless 
steel  plate  was  left  in  seawater,  the  plate  was  kept  in  the 
same  position  for  at  least  30  min  in  most  cases.  After  the 
10-min  resting  period,  a  little  drift  of  the  position  was 
observed  in  some  samples;  such  samples  were  not  used  for 
experiments.  Repeated  stiffness  measurements  without 
chemical  stimulation  were  performed.  A  typical  result  is 
given  in  Figure  3a,  in  which  the  upper  trace  is  for  the 
position  of  the  arm  tip,  and  the  lower  trace  is  for  the  force. 
The  vertical  bars  in  the  upper  trace  show  the  downward 
deflection  of  (he  arm  pushed  by  a  probe.  The  upward 


CONTRACTILE  CONNECTIVE  TISSUE 


K+ 
I 


10  mm 


I 

102 
mm 


2 

mN 


0.2 

mm 


I2 


10  min 


mN 


0.2 

mm 


ImN 


20  min 

Figure  3.  Control  experiments.  Upper  traces  show  dispUii.x-nn.-nt.  and 
lower  traces  show  force.  The  vertical  bars  in  the  upper  trace  denote  the 
passive  downward  movement  of  the  arm  when  pushed,  and  the  correspond- 
ing vertical  bars  in  the  lower  trace  denote  the  passive  force  exerted  by  the 
ligament  in  response  to  the  push,  (a)  An  example  demonstrating  that 
repeated  pushes  did  not  cause  contraction  or  changes  in  stillness,  (b  and  c) 
Responses  to  chemical  stimulation  with  artificial  seawater  with  an  elevated 
concentration  of  potassium  (KASW)  of  a  previously  frozen  arm  piece  (b) 
and  a  fresh  arm  piece  (c).  The  arm  pieces  in  b  and  c  were  cut  from  the  same 
arm.  The  frozen  sample  did  not  respond,  while  the  fresh  one  responded 
with  contraction  and  stiffness  decrease.  In  this  and  the  following  Figures,  a 
down-pointing  arrow  shows  the  introduction  of  a  chemical,  and  an  up- 
pointing  arrow  indicates  a  wash  with  artificial  seawater. 


deflections,  corresponding  to  the  downward  bars,  are  the 
reaction  forces  to  the  pushes.  The  upper  trace  remained 
horizontal,  which  shows  that  the  position  of  the  arm  tip 
remained  the  same  after  repeated  pushes.  The  similar  height 
of  the  upward  vertical  deflections  shows  that  the  stillness 
remained  almost  the  same  after  repeated  pushes.  When  the 
first  push  was  taken  as  the  control,  the  stiffness  change 
measured  at  the  second  push,  applied  100  s  after  the  first, 
was  0.63%  ±  4.16%  (average  ±  SD,  n  =  18).  The  range 
was  —8%  to  +8%.  The  average  was  not  statistically  differ- 
ent from  0%.  which  implied  no  changes  in  stiffness  (one- 


sample  f-test,  P  >  0.05).  After  being  pushed,  the  arm  tip  in 
most  samples  sprang  back  to  almost  the  same  position  it 
held  before  the  push.  In  some  samples,  however,  small 
plastic  deformations  remained.  Thus  the  averaged  position 
after  a  push  was  a  little  lower  than  that  before  the  push.  It 
was  -10.2  ±  24.9  /urn  (average  ±  SD.  n  =  18)  when  the 
initial  position  was  taken  as  0  and  downward  shift  was 
expressed  as  negative,  although  the  average  value  was  not 
statistically  different  from  0  (one-sample  /-test.  P  >  0.05). 
The  range  was  —70  to  +25  /J,m.  The  quick  downward 
bending  and  release  of  the  arm  piece  necessary  for  stiffness 
measurement  thus  did  not  provoke  any  active  contractions 
or  any  subsequent  stiffness  changes.  Based  on  the  results 
above,  the  response  to  chemical  stimulation  was  classified 
as  "no  contraction"  when  the  upward  excursion  of  the  arm 
tip  was  less  than  +25  /urn  and  as  "no  change  in  stiffness" 
when  it  was  less  than  ±8%. 

For  each  arm  that  was  dissected,  two  pieces  were  re- 
moved: one  piece  was  used  soon  after  dissection,  and  the 
other  was  frozen  at  —20  °C  overnight.  The  frozen  sample 
was  thawed  and  tested.  The  once-frozen,  and  thus  no  longer 
alive,  samples  did  not  respond  to  KASW.  The  stiffness  and 
the  position  of  the  arm  tip  remained  constant  after  repeated 
pushes  (Fig.  3b).  The  fresh,  unfrozen  samples  responded  to 
KASW  (Fig.  3c). 

Responses  to  high-potassium  acuwciter 

Stimulation  with  KASW  provoked  two  responses  simul- 
taneously. One  was  stiffness  change,  and  the  other  was 
aboral  bending  due  to  the  shortening  of  the  ligament  against 
the  force  of  gravity.  The  combination  of  contraction  and  the 
direction  of  changes  in  stiffness  was  variable.  The  most 
frequent  response  was  one  in  which  both  aboral  bending  and 
softening  were  observed  (Fig.  3c  and  Fig.  4).  In  Figure  5. 
the  relation  between  the  maximal  excursion  of  the  contrac- 
tion and  the  maximal  stiffness  change  in  a  response  was 
plotted  for  20  samples  stimulated  by  KASW.  Most  dots 
were  found  in  the  upper  left  quadrant,  which  corresponds  to 
contraction  with  softening.  Contraction  was  observed  in  16 
samples.  12  of  which  also  showed  softening.  Although  this 
seems  to  support  the  "spring-with-a-lock"  hypothesis,  there 
were  marked  exceptions.  In  three  cases,  contraction  was 
associated  not  with  softening  but  with  stiffening  (upper 
right  quadrant  in  Fig.  5).  In  the  case  shown  in  Figure  6a  and 
in  the  other  two  cases,  the  stiffness  increased  during  con- 
traction and  remained  so  after  the  wash  with  seawater.  The 
stiffness  never  fell  below  its  value  before  stimulation,  al- 
though some  fluctuations  were  observed.  Figure  6b  shows 
an  exceptional  response.  KASW  caused  contraction  that 
started  1  min  after  stimulation.  The  stiffness  measured  at 
that  time  showed  a  small  increase  of  4%.  which  was  clas- 
sified as  no  change  in  stiffness  according  to  our  criterion. 
The  contraction  appeared  to  have  almost  reached  a  plateau 


T.  MOTOKAWA  ET  AL. 


0J 

(B 

I    6 

f    3- 


s,     - 

§-20- 

w    ~              —   —    —      0 

JC 

o 

£-40- 

""-••.^ 

O 

c          _- 

* 

* 

fc 

1             1             1             1             1             1             1             1             1 

[        i 

t/5 

02468 

10 

Time,  mm 

Figure  4.  Typical  response  to  artificial  seawater  with  an  elevated 
concentration  of  potassium  (KASW).  The  upper  trace  is  upward  displace- 
ment of  the  arm  tip,  the  middle  trace  is  speed  of  upward  bending  of  the  arm 
tip.  and  the  lower  trace  is  softening.  Both  contraction  and  stiffness  decrease 
were  observed. 


when  KASW  was  washed  out.  The  wash  was  followed  by  a 
further  contraction  accompanied  by  marked  stiffening.  This 
response  is  a  clear  demonstration  that  contraction  was  not 
associated  with  tissue  softening.  The  contraction  at  wash 
was,  however,  not  observed  in  other  samples.  Four  arm 
pieces  did  not  show  contraction  but  did  show  stiffness 
changes.  Figure  6c  is  such  an  example  in  which  the  stiffness 
almost  doubled.  Figure  6d  is  an  example  of  tissue  softening 
without  contraction.  In  this  example,  the  arm  piece  showed, 
instead  of  upward  contraction,  a  little  downward  movement 
about  1  min  after  KASW  stimulation.  This  arm  piece  did  not 
fully  spring  back  after  a  push  by  the  probe  but  showed  a 
persistent  plastic  deformation.  Both  the  downward  move- 
ment and  the  plastic  deformation  were  probably  produced 
by  flow  of  the  softened  tissue  due  to  gravity  and  to  pushes 
with  the  probe.  All  the  results  above  strongly  suggested  that 
the  contraction  and  stiffness  changes  were  separate  re- 
sponses, both  independently  activated  by  KASW.  All  (Im- 
possible combinations — contraction  with  softening,  con- 
traction with  stiffening,  contraction  with  no  stiffness 
changes,  stiffening  with  no  contraction,  and  softening  with 
no  contraction  -were  observed. 

The  most  frequent  response  to  KSW  was  contraction 
associated  with  softening,  which  was  observed  in  60%  of 
the  samples,  ("lose  inspection  of  the  time  courses  of  the 
contractile  response  and  the  softening  response  in  these 
samples  also  supported  the  conclusion  that  these  were  in- 
dependent of  one  another.  In  figure  7.  the  maximum  con- 
traction height  was  taken  as  I  Oil',  and  the  maximum  soft- 
ening was  taken  as  -1007,  in  a  response  to  KASW.  In 
general,  the  extent  of  the  softening  increased  as  contraction 


proceeded.  The  two  were,  however,  not  tightly  coupled.  In 
the  sample  marked  by  crosses  in  Figure  7.  the  first  plot 
showed  an  evident  contraction  with  a  small  stiffness  in- 
crease of  6.7%.  though  this  value  was  regarded  as  no 
stiffness  change  according  to  our  criterion.  This  example  ot 
contraction  preceding  softening  was  contrary  to  the  expec- 
tation of  the  spring-with-a-lock  hypothesis.  In  most  re- 
sponses, softening  continued  after  the  contraction  had 
ceased. 

The  contraction  by  KASW  became  evident  in  about  30  s 
after  the  application  of  stimuli.  The  average  reaction  time 
for  contraction  was  31.5  ±  7.8  s  (±SD.  n  ==  13).  The 
contraction  curve  was  S-shaped.  The  upward  bending 
movement  continued  for  1.5-10  min.  and  the  raised  arm 
position  was  maintained  after  movement  stopped.  The  arm 
remained  raised  even  after  the  wash  with  seawater  for  more 
than  1  h  (Fig.  3c).  The  distance  the  arm  tip  moved  was 
40-1 140  /LLin.  The  average  was  384  ±  70  ju,m  (mean  ±  SD. 
n  =  16).  which  corresponded  to  an  average  of  about  60  jim 
of  elevation  per  joint.  The  bending  speed  reached  a  peak 
value  in  the  middle  of  contraction  (Fig.  4).  The  peak  bend- 
ing speed  was  quite  variable,  at  0.35-43.52  /J.ITL/S  (6.47  ± 
10.18  jLim/s.  mean  ±  SD.  n  ==  17).  The  average  bending 
speed  ranged  from  0.12  to  5.26  /am/s;  the  mean  was  1.35  ± 
1.28  jum/s  (±SD.  ;;  =:  16).  which  was  about  0.2  /LUTI/S 
elevation  per  joint. 

Softening  of  the  ligament  was  observed  in  70%  of  the 
samples.  In  a  typical  example  (Fig.  4).  stiffness  was  halved 
during  contraction  and  remained  so  after  the  movement 
ceased.  The  stiffness  decrease  was  -35.8%  ±  17.8% 


1.2- 

0 

1,0- 

|  08: 

<_- 

o 

1 

0  04- 

°88 

o 

n 

Q.      : 

.!5  0.2- 
Q 

0                   0 

o 

o 

0 

Q- 

0 

o 

~  O  ~       ~  "O~  " 

r»  o  - 

1        T       T  1  T       i        i  1  r       i       i        i  1  1  1 

-100 


-50 


50 


100 


150 


Stiffness  change,  % 


Figure  5.  Relation  between  the  maximum  stiffness  change  and  the 
maximum  upward  displacement  of  the  arm  tip  in  a  response  to  artificial 
seawater  with  an  elevated  concentration  of  potassium  I  KASW  I.  The  former 
was  plotted  on  the  v-axis  and  the  latter  on  the  v-axis.  Positive  values  of 
silliness  change  denote  stillemng.  and  negative  values  denote  softening: 
posin\e  values  ol  displacement  denote  contraction,  and  negative  values 
denote  downward  movement  due  to  gi.i\it>. 


io.2n    ^ 


0) 

I  0.1- 

o 

to 


CONTRACTILE  CONNECTIVE  TISSUE 


0.8  • 


S     °J  -> 


#30- 

0)20- 


=g 


3  min 


K" 
ou  C    I 


-oP 

1001 


50- 


0J- 


3  mm 


0  J 
60 

30 
0- 


-0.1 


-20 


-40J 


•— r 


..-.«...-•- 

d      f 


3  min 


3  mm 


Figure  6.  Responses  to  artificial  seawater  with  an  elevated  concentration  of  potassium  (KASW).  The  upper 
trace  shows  upward  displacement  of  the  arm  tip,  and  the  lower  trace  shows  stiffness  changes.  Various 
combinations  of  contractile  response  and  stiffness  changes  were  observed,  (a)  Contraction  associated  with 
stiffening:  (b)  contraction  without  stiffness  change  in  KASW.  and  contraction  with  stiffening  when  KASW  was 
washed  out:  (c)  no  contraction,  but  marked  stiffening:  (d)  no  contraction,  but  sottening. 


(mean  ±  SD.  n  ==   14).  The  stiffness  remained  decreased 
long  after  the  KASW  was  washed  out  (Fig.  3c). 

Responses  to  ticetylcholine 

We  treated  arm  pieces  with  10  5-10  3  M  solutions  of 
acetylcholine  in  seawater.  ACh  1(T4  M  and  10~3  M  had 
similar  effects,  and  ICT^  M  provoked  weaker  responses. 
The  typical  response  was  contraction  associated  with  soft- 
ening (Fig.  8a,  b).  As  in  KASW,  however,  various  combi- 
nations of  contraction  and  stiffness  changes  were  observed. 
Among  34  samples  tested  with  10~3  M  ACh.  23  showed 
contraction  with  softening.  7  showed  contraction  without 
stiffness  changes,  and  4  showed  softening  without  contrac- 
tion. In  1CT4  M  ACh.  3  samples  out  of  8  showed  contraction 
and  softening.  2  showed  contraction  without  stillness 
changes,  2  showed  no  contraction  but  softening,  and  1 
neither  contracted  nor  changed  stiffness.  Here  again,  con- 
traction was  not  necessarily  associated  with  tissue  soften- 
ing. It  should  be  noted  that  the  stiffness  change  was  always 
softening;  no  stiffening  was  observed  in  ACh. 

Contraction  initiated  by  10~3  M  ACh  became  evident  in 


0- 


0) 

O) 

c 

CO 

£ 
o 

</> 

</)      c;  (-)_ 
CD    ••-)  u 


( 


-100-1 


0  20         40          60          80         100 

%  Contraction 

Figure  7.  The  relative  degree  of  softening  plotted  against  the  relative 
degree  of  contraction  in  the  samples  that  showed  both  sottening  and 
contraction  to  artificial  seawater  with  an  floated  concentration  of  potas- 
sium (KASW).  Twelve  samples  showed  both  sottening  and  contraction, 
hut  five  examples  are  given  here:  the  rest  show  ctines  similar  to  one  ol  the 
curves  shown  in  this  figure.  The  final  amount  ol  contraction  was  taken  as 
100%.  and  the  final  amount  of  softening  was  taken  as  -  100',  The  time 
course  of  softening  did  not  parallel  that  ot  contraction. 


<n     0  - 
<u 

p  ; 

OT 

•"  -  -  _                                                                                                           U" 

-                     ^ 

1                  1                  1                  1                  1                  1                  1                           |                         |                         I                          I                         I 

0                           10                         20                          30                   0                                     10                                    20 

Time  (min)                                                         Time  (min) 

Figure  8.  Typical  responses  to  acetylcholine  at  concentrations  of  10  '  M  (a)  and  10  4  M  (b).  The  upper 
trace  shows  upward  displacement  of  the  arm  tip.  the  middle  trace  shows  speed  of  upward  bending  of  the  arm 
tip.  and  the  lower  trace  shows  softening.  Both  contraction  and  decrease  in  stiffness  were  observed. 


about  30  s  after  the  application  of  stimuli.  The  reaction  time 
for  contraction  was  28.4  ±  3.4  s  (average  ±  SD,  n  =  7). 
The  bending  speed  peaked  at  the  beginning,  and  then  the 
contraction  continued  with  ever-decreasing  speed  (Fig.  8b). 
The  upward  movement  continued  for  more  than  15  min.  The 
arm  remained  raised  even  after  ACh  was  washed  out.  After 
the  peak  in  bending  speed,  contraction  with  a  steady  bend- 
ing speed  was  observed  for  10-20  min  in  some  cases  (see 
Fig.  8a).  The  peak  bending  speed  in  10~3  M  ACh  was  0.72 
ju,m/s  on  average  (SD  =  0.42, ;;  =  7.  range  0.16-1.23),  and 
the  distance  moved  in  15  min  was  259  ±  228  ju,m  (mean  ± 
SD,  n  --  8).  The  peak  bending  speed  was  one  order  of 
magnitude  less  than  in  KASW  (statistically  significant  dif- 
ference by  Mest.  P  <  0.01  ).  Although  contraction  in  ACh 
was  slower  than  in  KASW,  it  lasted  longer,  so  the  distance 
moved  in  15  min  reached  a  value  similar  to  that  found  in 
KASW.  The  peak  bending  speed  occurred  at  the  beginning 
of  contraction  in  ACh,  but  in  the  middle  of  contraction  in 
KASW.  The  reaction  time  to  the  two  chemicals  was  similar. 
Softening  of  the  ligament  was  observed  in  79.4%  of  the 
samples  treated  with  10  'A/  ACh  and  in  62. 5'!  of  the 
samples  treated  with  10  4  A/  ACh.  The  stiffness  decrease 
due  to  10"'  M  ACh  was  -28.6%  ±  11.7',  (mean  ±  SD. 
n  =  6). 

Discussion 

The  simultaneous  measurement  of  isotonic  contraction 
and  tissue  stiffness  revealed  that  the  arm  of  a  stalked  crinoid 
I  mm  which  arm  muscles  had  been  removed  simultaneously 
shortened  and  changed  in  stiffness  in  response  to  chemical 
stimulation.  Ligaments  arc  undoubtedly  responsible  for 
these  two  mechanical  activities,  because  other  soft  tissues 


connecting  ossicles,  such  as  nerves  and  covering  thin  epi- 
dermis, are  mechanically  quite  weak.  The  mechanical  re- 
sponses are  active  ones  in  which  living  cells  are  involved, 
because  arm  preparations  that  had  been  frozen  and  rethawed 
never  responded.  The  effectiveness  of  ACh  in  evoking  these 
responses  suggests  the  involvement  of  neural  elements. 
Seawater  with  an  elevated  potassium  concentration 
(KASW)  possibly  exerted  its  effects  through  cellular  depo- 
larization of  neural  elements  and  of  some  effector  cells  that 
are  involved  in  the  mechanical  responses. 

Evidence  against  the  " spring-with-a-lock"  livpothcsis 

The  most  frequent  response  was  shortening  of  the  arm  in 
association  with  tissue  softening.  This  result  may  well  be 
taken  as  evidence  for  the  "spring-with-a-lock"  hypothesis  in 
which  the  source  of  contraction  is  attributed  to  an  extended 
spring  that,  after  being  stretched  by  the  antagonizing  mus- 
cles, then  releases  the  strain  energy  stored  in  the  stiffened 
tissue  so  that  tissue  softening  causes  shortening  of  the 
ligaments.  This  hypothesis  predicts  that  softening  must  pre- 
cede shortening.  We  obtained,  however,  examples  contra- 
dicting this  prediction.  Some  arm  pieces  showed  shortening 
without  stiffness  changes,  and  some  showed  shortening 
associated  with  tissue  stiffening.  The  latter  was  quite  con- 
ttarv  to  expectations  based  upon  the  hypothesis.  Even 
among  the  examples  of  shortening  with  softening,  inspec- 
tion of  the  time  course  of  the  response  revealed  that  short- 
ening sometimes  became  evident  before  stiffness  decreased. 
These  results  clearly  showed  that  contraction  did  not  nec- 
essarily require  a  foregoing  softening,  thus  providing  defin- 
itive evidence  against  the  spring-with-a-lock  hypothesis. 

The  time  course  of  the  shortening  speed  also  suggested 


CONTRACTILE  CONNECTIVE  TISSUE 


II 


that  the  contraction  was  not  simple  elastic  recoil.  Although 
the  maximum  speed  occurred  in  the  middle  of  a  contraction 
in  KASW  but  at  the  start  of  contraction  in  ACh.  no  changes 
in  stiffness  corresponded  to  this  difference.  The  ACh  caused 
an  initial  fast  contraction  followed  by  a  long  slow  contrac- 
tion. The  speed  of  the  slow  contraction  was  sometimes 
rather  constant,  although  stiffness  changes  were  observed 
during  this  period.  This  also  suggested  the  independence  of 
contraction  and  stiffness  changes. 

The  spring-with-a-lock  hypothesis  was  premised  on  the 
tight  coupling  between  shortening  and  decrease  in  stiffness. 
Our  observations,  however,  showed  that  shortening  and 
changes  in  stiffness  are  separable.  All  the  possible  combi- 
nations of  the  two  responses  were  encountered.  The  variety 
of  responses,  especially  the  shortening  without  stiffness 
changes  and  the  stiffness  changes  without  shortening,  pro- 
vides good  evidence  that  contraction  and  stiffness  changes 
are  separable.  The  variety  of  responses  also  suggests  that 
these  two  depend  on  different  mechanisms. 

Contraction  and  stiffness  changes  involve  scpiirntc 
mechanisms 

The  present  results  are  best  explained  by  the  presence  of 
some  active  contractile  machinery  inside  the  ligaments. 
Stiffness  control  and  active  shortening  may  well  depend  on 
the  same  mechanism,  as  in  most  animals  in  which  muscles 
are  responsible  for  posture  control,  which  involves  both 
movement  and  stiffness  changes.  Active  shortening  implies 
force  production,  which  would  increase  the  resistance  to 
stretch,  causing  an  increase  in  stiffness  during  contraction. 
In  the  present  study,  however,  most  of  the  responses  were 
contraction  with  a  decrease  in  stiffness.  Therefore,  it  is 
unlikely  that  contraction  and  stiffness  changes  share  a  com- 
mon mechanism  in  these  arm  ligaments. 

In  a  study  of  the  stress-relaxation  behavior  of  the  cirral 
ligament  of  Metacriinis  rontndus.  we  found  that  the  collag- 
enous  ligament  showed  both  stiffness  changes  and  contrac- 
tion (Birenheide  ft  til..  2000).  The  two  responses  were 
separable,  although  both  were  under  cholinergic  control.  In 
the  present  study,  we  suggest  that  the  same  two  responses 
are  also  under  cholinergic  control  in  arm  ligaments. 

Our  present  report  provides  the  first  measurement  of 
stiffness  changes  in  the  arm  ligaments  of  stalked  crinoids. 
Such  changes  have  already  been  reported  in  stalkless  cri- 
noids (Birenheide  and  Motokawa,  1998).  The  ability  to 
change  their  passive  mechanical  properties  seems  to  be  a 
common  character  of  the  collagenous  ligaments  at  the  ar- 
ticulations of  crinoids,  since  stiffness  changes  have  also 
been  reported  in  the  ligaments  of  cirri  (Wilkie,  1983; 
Birenheide  el  ai.  2000)  and  of  stalks  (Wilkie  el  nl..  1993, 
1994).  Stiffness  changes  serve  to  maintain  body  posture. 
They  very  likely  share  a  common  mechanism — connective 
tissue  catch — which  is  found  widely  throughout  the  phylum 


Echinodermata  (Motokawa.  1984;  Wilkie.  1996).  Although 
the  mutability  of  the  mechanical  properties  of  collagenous 
connective  tissues  has  been  established  and  the  importance 
of  these  properties  in  the  supportive  function  is  well  appre- 
ciated (Motokawa.  1988).  the  molecular  mechanism  under- 
lying connective  tissue  catch  is  incompletely  understood.  It 
seems,  however,  to  involve  the  cellular  secretion  of  proteins 
that  directly  affect  the  mechanical  properties  of  the  extra- 
cellular matrix  (Tipper  ft  til..  2003). 

We  have  reported  shortening  and  force  development  in 
arm  joints  from  which  the  muscles  have  been  removed  in 
the  stalked  crinoid  Metticnnns  rotiimlnx  and  also  in  the 
stalkless  crinoid  Oxycomanthus  juponica  (Birenheide  and 
Motokawa,  1996.  1998).  The  present  study  showed  that 
such  contractions  derive  from  active  contraction  of  collag- 
enous ligaments.  Non-muscular  contractions  in  crinoids  are 
not  restricted  to  the  arm  joints.  In  spite  of  a  thorough 
ultrastructural  investigation,  we  found  no  muscle  cells  in  the 
cirral  joints,  and  yet  we  observed  bending  movements  of 
these  joints  of  M.  rotiimlus  in  response  to  cholinergic  ago- 
nists (Birenheide  et  ul..  2000).  The  spring-with-a-lock  hy- 
pothesis is  not  applicable  to  cirri  if  antagonizing  muscle 
bundles  are  supposed  to  be  the  force-producing  engine.  The 
coelomic  canal  has  been  proposed  as  a  possible  source  of 
force  production  in  crinoid  arms  and  cirri  (Holland  and 
Grimmer.  1981:  Candia  Carnevali  and  Saita.  1985).  This 
idea  is  not  applicable  to  the  present  arm  preparation  from 
which  the  coelomic  canal  has  been  removed.  Because  of 
their  mechanical  weakness,  other  soft  tissues  connecting 
ossicles,  such  as  the  epidermis  and  brachial  nerves,  are 
unlikely  to  generate  contractile  forces.  Therefore,  we  con- 
clude that,  both  in  arms  and  in  cirri,  the  ligaments  are 
responsible  for  the  contraction  and  probably  possess  a  com- 
mon mechanism  for  active  force  production. 

The  present  study  shows  that  contraction  is  often  associ- 
ated with  softening.  Although  we  employed  atypical  exam- 
ples of  this  as  evidence  against  the  tight  coupling  between 
contraction  and  tissue  softening,  the  observation  that  the 
most  frequent  response  was  contraction  associated  with 
softening  suggests  that  there  is  some  coordination  between 
contraction  and  stiffness  changes.  The  association  of  con- 
traction with  softening  is  reasonable  because  softening 
probably  facilitates  shortening;  otherwise,  kinks  would  be 
produced.  The  stiffness  of  the  aboral  ligaments  is  probabh 
also  coordinated  with  contraction  of  the  oral  muscles.  This 
may  be  one  reason  that  the  observed  responses  were  vari- 
able. The  variety  of  the  responses  suggests  the  presence  of 
sophisticated  control.  A  cholinergic  system  seems  to  be 
involved  in  the  coordination  between  the  contraction  and 
the  stiffness  changes  of  ligaments. 

The  largest  bending  speed  observed  was  43.5  /am/s.  A 
rough  calculation  from  this  value  suggests  that  the  maxi- 
mum shortening  speed  of  the  ligament  itself  is  0.05  /,,/s. 
where  /n  is  the  length  of  the  ahoral  ligament  when  the  arm 


12 


T.  MOTOKAWA  KT  AL 


is  straight.  This  is  slower  by  one  order  of  magnitude  than 
reported  for  echinoderm  muscles  (Tsuchiya,  1985).  The 
multi-joint  structure  of  the  arms,  however,  compensates  for 
the  slowness,  because  the  speed  of  arm  tip  movement  pos- 
sibly increases  in  proportion  to  the  number  of  joints. 

The  present  study  establishes  that  the  collagenous  liga- 
ments of  stalked  crinoids  show  active  contraction  under 
nervous  control.  Among  the  animal  kingdom,  only  crinoids 
have  been  documented  to  have  such  connective  tissue  con- 
tractions. The  force-producing  mechanism  has  yet  to  be 
elucidated. 

Acknowledgments 

This  research  was  supported  by  a  grant-in-aid  for  scien- 
tific research  on  priority  area  (A)  "Molecular  synchroniza- 
tion for  design  of  new  materials  system"  of  the  Ministry  of 
Education,  Science.  Sports,  and  Culture  of  Japan. 

Literature  Cited 

Birenheide,  R.,  and  T.  Motokaua.  1994.  Morphological  basis  and 
mechanics  of  ami  movement  in  the  stalked  crinoid  Melacrinu\  rotnn- 
ilus  (Echinodermata.  Crinoidea).  Mar.  Bin/.  121:  273-283. 

Birenheide,  R.,  and  T.  Motokaua.  1996.  Contractile  connective  tissue 
in  crinoids.  Biol.  Hull.  191:  1-4. 

Birenheide.  R.,  and  T.  Motokaua.  1998.  Crinoid  ligaments:  catch  and 
contractility.  Pp.  139-144  in  Echinodcnn:  Sun  Fnincisco.  R.  Mooi  and 
M.  Telford.  eds.  A.  A.  Balkema.  Rotterdam. 

Birenheide.  R.,  K.  Yokoyama,  and  T.  Motokaua.  20(10.  Cirri  of  the 
stalked  crinoid  Metacrinus  rotundus:  neimil  elements  and  the  eftecl  ot 


cholinergic  agonists  on  mechanical  properties.  Proc.  R.  Soc.  Loiul.  B 
267:  7-16. 

Candia  Carnevali,  M.  D.,  and  A.  Saita.  1985.  Muscle  system  organi- 
/ation  in  echmoderms:  II.  Microscopic  anatomy  and  functional  signif- 
icance of  the  muscle-ligament-skeleton  system  in  the  arm  of  comatulids 
(Antedon  inctlirerrwieiD.  ./.  Morphol.  185:  59-74. 

Holland,  N.  D.,  and  .).  Grimmer.  1981.  Fine  structure  of  the  cirri  and  a 
possible  mechanism  for  their  motility  in  stalkless  crinoids  (Echinoder- 
mata). Cell  Tissue  Res.  214:  207-217. 

Motokaua.  T.  1984.  Connective  tissue  catch  in  echinoderms.  Biol.  Rev. 
59:  255-270. 

Motokawa,  T.  1988.  Catch  connective  tissue:  a  key  character  for  echi- 
noderms' success.  Pp.  39-54  in  Echinoderm  Biology.  R.  D.  Burke. 
P.  V.  Mladenov,  P.  Lambert,  and  R.  L.  Parsley,  eds.  A.  A.  Balkema. 
Rotterdam. 

Tipper,  J.  P.,  G.  Lyons-Levy,  M.  A.  L.  Atkinson,  and  A.  Trotter.  2003. 
Purification,  characterization  and  cloning  of  tensilin.  the  collagen-h'bril 
binding  and  tissue-stiffening  tactor  from  Cucutnaria  [roiiJoMi  dermis. 
Matrix  Biol.  21:  625-635. 

Tsuchiya,  T.  1985.  The  maximum  shortening  velocity  of  holothurian 
muscle  and  effects  of  tonicity  change  on  it.  G™/'-  Biochem.  Phvsiol.  A 
81:  347-4(11. 

Wilkie,  I.  C.  1983.  Nervously  mediated  change  in  the  mechanical  prop- 
erties of  the  cirral  ligaments  of  a  crinoid.  Mm:  Behav.  Plmiol.  9: 
229-248. 

Wilkie,  I.  C.  1996.  Mutable  collagenous  tissue:  extracellular  matrix  as 
mechano-effector.  Pp.  fil-102  in  EchinoJerm  Studio,.  Vol.  5.  M. 
Jangoux  and  J.  M.  Lawrence,  eds.  A.  A.  Balkema.  Rotterdam. 

Wilkie.  I.  C.,  R.  H.  Emson.  and  C.  M.  Young.  1993.  Smart  collagen  in 
sea  lilies.  Nature  366:  519-520. 

Wilkie,  I.  C.,  R.  H.  Emson,  and  C.  M.  Young.  1994.  Variable  tensility 
of  the  ligaments  in  the  stalk  of  a  sea-liliy.  Comp.  Biochem.  Ph\xiol.  A 
109:  633-641. 


Reference:  Bin/.  Bull.  206:  13-24.  (February  2(104) 
©  2004  Marine  Biological  Laboratory 


Identification  of  Juvenile  Hormone-Active 

Alkylphenols  in  the  Lobster  Homarus  americanus 

and  in  Marine  Sediments 

WILLIAM  J.   DIGGERS'   AND  HANS  LAUFER2* 

1  Department  of  Biology,  Wilkes  University.  Wilkes-Barre.  Pennsylvania  18766:  and  2  Department  of 

Molecular  and  Cell  Biology,  University  of  Connecticut,  Storrs,  Connecticut  06269,  ami  the  Marine 

Biological  Laboratory,  Woods  Hole,  Massachusetts  02543 


Abstract.  We  have  identified,  by  gas  chromatography/ 
mass  spectrometry,  four  alkylphenols  that  are  present  in  the 
hemolymph  and  tissues  of  the  American  lobster  Homarus 
americanus  and  in  marine  sediments.  These  alkylphenols 
are  used  industrially  in  antioxidant  formulations  for  plastic 
and  rubber  polymer  manufacturing,  and  are  similar  in  struc- 
ture to  a  known  endocrine  disruptor.  bisphenol  A.  The 
compound  2-f-butyl-4-(dimethylbenzyl)phenol  was  present 
at  concentrations  of  0.02  to  1.15  /u.g/ml  in  hemolymph  and 
8.95  to  21.58  Mg/g  in  sediments.  A  second  compound. 
2.4-bis-(dimethylbenzyl)phenol.  was  present  at  concentra- 
tions between  0.07  and  19.78  jug/ml  in  hemolymph  and 
138.94  to  224.89  jug/g  in  sediment,  while  a  third  compound. 
2, 6-bis-(f-butyl)-4-(dimethylbenzyl (phenol,  was  found  at 
concentrations  between  0.01  and  13.00  /j,g/ml  in  hemo- 
lymph, 2.55  and  6.11  |u.g/g  in  hepatopancreas.  and  47.85 
and  74.66  /xg/g  in  sediment.  A  fourth  compound.  2.4-bis- 
(dimethylbenzyl)-6-/-butylphenol,  was  found  at  concentra- 
tions of  0.20  to  70.71  jug/ml  in  hemolymph,  23.56  to  26.89 
/xg/g  in  hepatopancreas.  and  90.68  to  125.58  /u,g/g  in  sedi- 
ment. These  compounds,  along  with  bisphenol  A.  4-di- 
methylbenzylphenol.  and  nonylphenol,  display  high  juve- 
nile hormone  activity  in  bioassays.  Alkylphenols  at  high 
concentrations  are  toxic  to  crustaceans  and  may  contribute 
significantly  to  lobster  mortality;  at  lower  concentrations, 
they  are  likely  to  have  endocrine-disrupting  effects. 


Received  2  July  2003;  accepted  17  November  201)3 
*  To      whom      correspondence      should      be      addressed. 
laufer@uconn.edu 


E-mail: 


Introduction 

The  lobster  population  in  western  Long  Island  Sound  has 
been  decimated  in  recent  years,  and  a  variety  of  factors  have 
been  implicated,  including  elevated  temperatures,  anoxia, 
paramoeba  infestation,  and  exposure  to  pesticides  and  other 
chemicals  entering  the  marine  environment  (Long  Island 
Sound  Lobster  Health  Symposium,  2003).  Since  crustacean 
reproduction,  development,  and  metamorphosis  are  known 
to  be  partly  regulated  by  a  juvenile  hormone,  methyl  farne- 
soate  (MF)  (reviewed  by  Laufer  and  Biggers.  2001).  we 
have  joined  these  investigations,  asking  whether  lobsters 
and  marine  sediments  contain  exogenous  chemicals  with 
juvenile-hormone  activity  (JH  activity)  that  may  affect  the 
health  of  these  crustaceans  and  act  as  endocrine  disruptors. 

MF  is  a  sesquiterpenoid  hormone  that  is  similar  in  struc- 
ture to  insect  juvenile  hormones  and  is  secreted  by  the 
mandibular  organ.  Previous  investigations  in  our  laboratory 
indicated  that  extracts  of  marine  organisms  and  sediments 
display  JH  activity  in  insect  cuticle  bioassays  (Biggers  and 
Laufer.  1992;  Biggers.  1994).  Here  we  report  the  identifi- 
cation of  four  alkylphenols  that  are  similar  in  structure  to 
the  endocrine  disruptor  bisphenol  A  and  are  present  in 
sediment  samples.  We  found  these  alkylphenols  to  possess 
high  JH  activity,  and  one  of  them  was  initially  developed  as 
a  mosquito  insecticide.  We  also  report  finding  these  lour 
alkylphenols  in  lobster  hemolymph  and  two  alkylphenols  in 
hepatopancreas  tissue.  These  results  suggest  that  these 
chemicals,  like  bisphenol  A  and  other  alkylphenols.  may 
have  widespread  distribution  in  the  marine  environment 
where,  at  low  concentrations,  they  may  be  acting  as  endo- 
crine disruptors  in  the  lobster,  and  at  higher  concentrations, 


14 


W.  J.  BIGGERS  AND  H.  LAUFER 


they  may  contribute  to  the  high  mortalities  of  lobsters  in 
Long  Island  Sound  and  elsewhere. 


Materials  and  Methods 


Animals 


Mature  male  and  female  lobsters,  ranging  in  weight  be- 
tween 300  and  450  g  (shorts)  were  collected  from  Long 
Island  Sound  and  from  Vineyard  Sound.  Massachusetts. 
Long  Island  Sound  animals  were  kept  in  recirculating  tanks 
at  Storrs,  Connecticut,  and  animals  from  Vineyard  Sound 
were  maintained  in  running  seawater  at  the  Marine  Biolog- 
ical Laboratory,  Woods  Hole,  Massachusetts.  The  animals 
were  fed  squid  ad  lihiniiu.  Immediately  upon  arrival,  the 
animals  were  bled  with  5-cc  plastic  syringes  and  23-gauge 
needles. 

Chemicals 

The  following  chemicals  were  purchased  from  Sigma- 
Aldrich:  4-cumylphenol  [also  known  as  4-dimethylbenzyl- 
phenol);  2.4-bis-(dimethylbenzyl (phenol;  bisphenol  A  (also 
known  as  2,2-bis(4-hydroxyphenyl (propane j;  nonylphenol- 
( mixed  isomers);  the  juvenile  hormones  JH  III  and  JH  I; 
lutein;  cholesterol;  arachidonic  acid;  stearic  acid;  and  far- 
nesol.  Pyriproxyfen  was  kindly  provided  by  Dr.  William 
Bowers  (University  of  Arizona),  and  2-f-butyl-4-(dimethyl- 
benzyl  (phenol.  2.6-bis-(r-butyl)-4-(dimethylbenzyl)phenol, 
2,4-bis-(dimethylbenzyl)-6-/-buty  I  phenol,  and  trans-trans 
methyl  farnesoate  were  synthesized  in  the  laboratory.  Ace- 
tonitrile,  acetone,  and  hexane  used  for  extractions  and  in 
HPLC  analysis  were  purchased  from  Fisher  Chemical  and 
were  of  HPLC  grade. 

Extraction  of  marine  sediments 

Samples  were  taken  from  the  top  6-12  in.  of  marine  sedi- 
ment in  the  inteitidal  zones  of  Vineyard  Sound,  Massachusetts, 
and  Great  Bay,  New  Jersey.  The  sediments  were  tillered 
through  a  1  -mm  wire  sieve  to  remove  large  debris,  then  kept 
frozen  at  -20  °C.  A  25-g  portion  (wet  weight)  of  each  sedi- 
ment sample  was  extracted  with  50  ml  of  acetone,  and  the 
yellowish  acetone  extract  was  filtered  through  Whatman  #1 
filter  paper  to  remove  particulates.  Five  milliliters  of  the  ace- 
tone filtrate  was  evaporated  to  dryness  under  nitrogen  in  glass 
vials  and  resuspended  in  200  /xl  of  hexane.  The  resuspended 
extract  (200  JJL\)  was  applied  to  the  top  of  a  PrepSep  silica 
solid-phase  extraction  column  (Fisher  Scientific)  that  had  been 
pre-equilibratcd  with  10  ml  of  hexane.  The  columns  were 
eluted  sec|iientially  with  solvents  of  increasing  polarits:  3  ml 
hexane;  3  ml  hexane/20' ,;  ethyl  ether;  and  finally,  3  ml  100% 
cih\l  ether.  The  100' <  cllrsl  cilia  eluale.  which  was  yellow 
and  showed  high  JH  activity,  was  stored  at  -20  °C.  For 
GC7MS  analysis.  1  ml  of  the  ethyl  ether  eluale  was  evaporated 
to  dryness  under  nitrogen,  then  resuspended  in  200  fji\  of 


hexane  in  small  amber  vials  that  were  stored  at  —20  °C  before 
analysis.  By  this  method,  using  chemical  standards,  extrac- 
tion and  recovery  efficiencies  for  the  four  phenols  were  95% 
for  2-f-butyl-4-(dimethylbenzyl  (phenol  and  2,6-bis-( /-butyl )- 
4-(dimelhylbenzyl (phenol,  47%  for  2,4-bis-(dimethylbenzyl)- 
phenol,  and  50%  for2,4-bis-(dimethylbenzyl)-6-/-butylphenol. 

Extraction  of  hemolymph  and  hepatopancreas 

For  each  hemolymph  sample.  2  ml  was  added  into  Pyrex 
culture  tubes  (prebaked  at  250  °C  before  use)  containing  2 
ml  of  cold  4%  NaCl  and  2  ml  of  acetonitrile,  and  then  kept 
frozen  at  —20  °C.  Samples  were  extracted  with  2  ml  of 
hexane  by  vortexing  for  5  min.  The  tubes  were  centrifuged 
at  600  X  g  for  30  min.  and  1.5  ml  of  the  hexane  phase  was 
pipetted  off  and  evaporated  with  a  stream  of  nitrogen  to  150 
jul  in  amber  glass  vials.  Before  analysis  by  GC/MS,  the 
hexane  extracts  were  stored  at  -20  °C. 

Hepatopancreas  from  two  lobsters  was  rinsed  in  4%  NaCl 
and  weighed;  2  g  of  the  tissue  was  homogenized  in  4  ml  of 
cold  acetonitrile  and  extracled  with  4  ml  of  4%  NaCl  and  2 
ml  of  hexane.  The  hexane  phases  were  then  processed  as 
described  for  the  hemolymph  samples  before  analysis  by 
GC/MS.  By  this  method,  using  standards,  extraction  and 
recovery  efficiencies  for  the  four  phenols  were  90%  for 
2-/-butyl-4-(dimethylbenzyl)phenol  and  2,6-bis-U-butyl)-4- 
(dimethylbenzyl)phenol,  and  45%  for  2,443is-(dimethylben- 
zyl (phenol  and  2,4-bis-(dimethylbenzyl)-6-;-butylphenol. 

Gas  chromatography/mass  spectrometr\  anal\sis 

The  lobsler  extracts  and  marine  sediments  were  analyzed 
by  gas  chromatography/mass  spectrometry  using  a  Hewlett- 
Packard  HP  5890  GC/5970  MSD  GC/MS  equipped  with  a 
12.5-m.  0.20-mm-diameter  column  of  cross-linked  dimeth- 
ylsilicone  with  film  thickness  of  0.33  /im.  The  operating 
conditions  for  GC  were  an  initial  temperature  of  35  °C  for 
2  min,  followed  by  a  15  °C/min  ramp  to  270  'C,  then  a  10-min 
hold  at  270  °C,  for  a  total  run  time  of  27.67  min.  Operating 
conditions  tor  MS  analysis  were  set  to  detect  ion  masses  ol 
50  to  500  MW,  by  electron  impact  ionization  using  the  scan 
mode.  Individual  compounds  were  identified  by  comparing 
their  mass  spectra  with  published  library  spectra.  Identifi- 
cation of  the  four  phenolic  compounds  and  diisooctylphthal- 
ate  was  confirmed  by  comparison  of  mass  spectra  and 
retention  times  with  those  of  chemical  standards  that  were 
either  purchased,  as  were  2.4-bis-(dimethylbenzyl (phenol 
and  diisooct\  Iphthalate.  or  synthesi/ed  in  the  laboratory,  as 
was  2-/-butyl-4-(dimethylben/yllphenol,  2.6-bis-U4^utyl(- 
4-(dimethylben/\  I  (phenol,  and  2.4-bis-(dimeth\  lbenzylt-6-/- 
bulylphenol  described  below.  The  phenols  were  quantified 
by  integration  of  peaks  and  comparison  of  peak  areas  with 
known  amounts  of  authentic  standards. 


JH-ACTIVE  ALKYLPHENOLS  IN  LOBSTERS  AND  MARINE  SEDIMENTS 


15 


Chemical  synthesis 

The  compounds  2-/-butyl-4-(dimethylbenzyl  (phenol  and 
2,6-bis-U-butyl)-4-(dimethylbenzyl  (phenol  were  prepared 
by  a  Friedel-Crafts  alkylation  reaction.  For  synthesis,  15  g 
of  4-cumylphenol  was  dissolved  in  75  ml  of  f-butylchloride 
in  a  125-ml  Ehrlenmeyer  flask  containing  a  stir  bar.  The 
reaction  was  started  by  addition  of  100  ing  of  FeCl,-5H,0  as 
catalyst  with  constant  stirring  at  room  temperature.  The 
reaction  was  carried  out  in  a  fume  hood  to  vent  the  evolved 
HC1  gas.  After  24  h,  the  reaction  was  stopped  by  transfer- 
ring the  reaction  mixture  to  a  500-ml  Ehrlenmeyer  flask  and 
adding  200  ml  of  distilled  water.  The  phenols  were  ex- 
tracted with  100  ml  of  hexane,  and  isolated  and  purified  to 
99%  purity  (determined  by  GC/MS)  from  the  reaction  mix- 
ture by  normal-phase  HPLC  using  a  silica  column  (Varian 
microsorb,  250  mm.  100  A°)  and  hexane/6%  acetone  as 
running  solvent. 

The  monophenol  2,4-bis-(dimethylbenzyl)-6-/-butylphe- 
nol  was  prepared  using  a  Friedel-Crafts  alkylation  reaction, 
in  the  same  way  as  were  the  other  phenols,  except  that  1 5  g 
of  2,4-bis-(dimethylbenzyl)phenol  was  used  as  the  starting 
material  for  synthesis,  and  the  phenol  product  was  purified 
by  normal-phase  HPLC  using  a  running  solvent  of  hex- 
ane/1%  ethyl  ether. 


Bioiissuy  for  juvenile  hormone  nctivity 

The  phenolic  compounds  were  assessed  for  JH  activity 
using  a  rapid  and  sensitive  assay  based  on  their  effects  on 
the  settlement  and  metamorphosis  of  larvae  of  the 
polychaete  Capitella  (Biggers  and  Laufer.  1996).  The  re- 
sults of  this  bioassay  are  comparable  to  those  of  the  GallerUi 
JH  bioassay:  in  both  bioassays  the  test  chemicals  showed 
similar  patterns  of  variation  in  JH  activity.  In  this  bioassay, 
no  false  positives  or  false  negatives  have  been  found  for  the 
compounds  tested.  Test  chemicals  were  dissolved  in  100% 
ethanol  to  give  stock  solutions  of  0.1,  I,  10,  and  100  [i.M, 
and  aliquots  of  up  to  100  /id  of  the  stock  solutions  were 
added  to  60-mm  glass  petri  dishes  each  containing  10  ml  of 
artificial  seawater  (Utikem,  Co.),  salinity  30  ppt,  and  10 
swimming  2-day-old  metatrochophore  larvae.  Controls  re- 
ceived up  to  100  /j.1  of  ethanol.  Dishes  were  swirled  to 
disperse  the  test  chemicals.  Each  concentration  was  tested  in 
triplicate  for  every  bioassay,  and  two  bioassays  were  run 
(total  dishes  =  6,  total  number  of  larvae  =  60)  for  each 
concentration  tested.  Settlement  and  metamorphosis  of  lar- 
vae was  monitored  using  a  stereobinocular  microscope. 
After  1  h,  the  number  of  larvae  that  had  settled  and  meta- 
morphosed was  recorded.  Data  are  reported  as  EC5(I  values 
for  each  chemical,  at  the  final  concentration  that  induces 
50%  of  the  larvae  to  settle  and  metamorphose  in  1  h. 


Results 

Alkylphenoh  in  lobster  hemolymph  and  hepatopancreas 

The  analysis  of  the  hexane  extracts  of  14  samples  of 
lobster  hemolymph  by  GC/MS  indicated  the  presence  of 
four  alkylphenols:  2-/-butyl-4-(dimethylbenzyl)phenol  (mo- 
lecular weight  268);  2,6-bis-U-butyl)-4-(dimethylbenzyl)- 
phenol  (molecular  weight  324,  CAS  no.  34624-81-2),  also 
named  2,6-<//-fm-butyl-4-cumylphenol;  2,4-bis-( dimethyl- 
benzyl  (phenol  (molecular  weight  330,  CAS  no.  2772-45-4). 
also  named  2,4-dicumylphenol;  and  2,4-bis-(dimethylben- 
zyl)-6-r-butylphenol  (molecular  weight  386).  The  mass 
spectra  for  these  chemicals  matched  those  of  the  published 
library  (Wiley)  mass  spectral  database  with  a  quality  fit  of 
more  than  90%.  Further  continuing  the  identity  of  these 
compounds,  the  retention  times  of  purchased  or  chemically 
synthesized  standards  also  gave  the  same  retention  times 
and  mass  spectra  as  those  of  the  compounds  identified  in  the 
hemolymph  (Figs.  1.  2.  3). 

The  levels  of  these  four  alkylphenols  varied  between 
lobsters.  The  compound  2-/-butyl-4-(dimethylbenzyl (phe- 
nol was  found  in  13  of  the  14  lobsters  analyzed,  at  concen- 
trations ranging  from  0.02  to  1.15  /J-g/ml  of  hemolymph, 
giving  an  average  of  0.46  ±  0.1  1  /xg/ml  (mean  ±  standard 
error  of  the  mean).  The  compound  2.6-bis-(f-butyl)-4-(di- 
methylbenzyl  (phenol  was  present  in  the  hemolymph  of  11 
of  the  14  lobsters,  at  concentrations  ranging  from  0.01  to 
1 3.00  /Mg/ml  of  hemolymph,  with  an  average  of  1 .89  ±  1.14 
jug/ml.  The  compound  2.4-bis-(dimethylbenzyl  (phenol  was 
detected  in  the  hemolymph  of  all  14  lobsters  analyzed,  at 
concentrations  ranging  from  0.07  to  19.78  /ng/ml  of  hemo- 
lymph, giving  an  average  of  4.03  ±  1.52  /ig/ml.  The  com- 
pound 2.4-bis-(dimethylbenzyl)-6-/-butylphenol  was  found 
in  the  hemolymph  of  1 1  of  the  14  lobsters,  at  concentrations 
ranging  from  0.20  to  70.71  /J.g/ml  of  hemolymph,  giving  an 
average  of  10.98  ±  6.414  jug/rnl. 

The  relative  amounts  of  these  four  phenols  varied  greatly 
between  the  two  localities  from  which  the  lobsters  were 
taken  (Table  1 ).  Lobsters  from  Long  Island  Sound  showed 
much  higher  average  concentrations  of  2,6-bis-(?-butyl)- 
4-(dimethylbenzyl)phenol.  2.4-bis-(dimethylbenzyl)phenol.  and 
2,4-bis-(dimethylbenzyl)-6-f-butylphenol  than  those  from 
Vineyard  Sound,  whereas  lobsters  from  Vineyard  Sound 
had  much  higher  average  concentrations  of  2-f-butyl-4- 
(dimethylbenzyl (phenol.  Interestingly,  the  phthalate  ester 
diisooctylphthalate  was  also  identified  in  lobster  hemo- 
lymph. but  only  in  the  seven  lobsters  analyzed  from  Vine- 
yard Sound,  with  concentrations  ranging  from  0.04  to  0.39 
jug/ml  of  hemolymph. 

Two  of  the  phenols  were  also  found  in  extracts  made 
from  the  hepatopancreas  of  two  additional  lobsters.  The 
concentrations  of  2, 6-bis-( /-butyl  )-4-(dimethylbenzyl  (phe- 
nol in  the  two  hepatopancreas  samples  were  found  to  be 
2.55  and  6.1  1  /ag/g  of  tissue,  and  concentrations  of  2,4-bis- 


16 


W    J    BIGGERS  AND  H.  LAUFER 


Abundance 

1 

3 

160000  - 

140000  - 

120000  - 

100000  - 

80000  - 

60000  - 

45 

40000  • 

1 

20000  - 

1 

, 
III 

0- 
Time-->13 

L           .„          l\ 

L  A   .  JLt     ,«IV.AJU    .A.  LM. 

m       .         A 

•p~*-f       r       i  —  "Tr"i  r*  i  *  1  —  *~1  p^  1  r      i       j       iti       i       |       11       i       i       |       11-1       i       j       i        i        i        i        j 

.00           14.00           15.00           16.00          17.00          18.00           19.00 

Figure  1.  Gas  chromatogram  of  a  lobster  hemolyniph  sample  from  Martha's  Vineyard  showing  relative 
retention  times  of  2-f-butyl-4-(dimethylbenzyl)phenol.  MW  26X  (peak  I );  2,6-bis-(r-butyl)-4-(dimethylbenzyl)- 
phenol.  MW  324  (peak  2);  2,4-bis-(dimethylbenzyl (phenol.  MW  330  (peak  3);  2,4-his(dimethylbenzyl)-6-/- 
hutylphenol,  MW  3X6  (peak  4):  and  diisooctylphthalate,  MW  390  (peak  5). 


(dimethylbenzyl)-6-?-butylphenol    were    23.56    and    26.89 


tration  from  49.47  to  77.89  jug/g:  and  with  2-/-butyl-4- 
(dimethylbenzyl  (phenol  being  the  lowest  at  8.95  to  21.58 


Alkylphenols  in  imirine  sediments 

Analysis  by  GC/MS  of  ethyl  ether  fractions  from  silica 
columns,  derived  from  a  Vineyard  Sound  sediment  sample 
and  a  Great  Bay  sediment  sample,  both  of  which  showed 
high  JH  activity  in  the  Capitella  bioassays  (data  not  shown), 
indicated  the  presence  of  the  same  four  alkylphenols  found 
in  the  lobster:  2-/-butyl-4-(dimethylbenzyl)phenol;  2,6-bis- 
(f-butyl)-4-(dimethylbenzyl)phenol,  2,4-bis-(dimethylben- 
zyl  (phenol,  and  2,4-bis-(dimethylbenzyl)-6-f-buty  Iphenol 
(molecular  weight  386). 

The  concentrations  determined  for  these  alkylphenols 
differed  between  the  two  sediment  samples  analy/.ed  (Table 
2).  Concentrations  of  all  four  phenols  were  higher  in  the 
sediment  sample  from  Great  Bay,  New  Jersey  (range  from 
21.58  to  2?  1.01  /Ag/g  of  sediment)  than  in  the  sediment 
sample  from  Vineyard  Sound,  Massachusetts  (range  be- 
tween 8.95  and  181.20  /ug/g  of  sediment).  Of  considerable 
interest  is  the  finding  that  both  samples  showed  the  same 
relaliu-  profiles,  with  2,4-bis-(dimethylbenzyl)-6-/-butyl- 
phenol  being  found  in  the  highest  concentration  of  the  four 
phenols,  at  181.20  to  251.01  /ug/g  of  sediment;  followed  by 
2,  4-bis-(dimethylhen/vl  (phenol  at  concentrations  ranging 
from  138.94  to  224.89  jzg/g  of  sediment;  followed  by  2,6- 
bis-(f-butyl)-4-(dimethylbenzyl)pheno]  ranging  in  concen- 


JH acti\'il\  of  alk\lphenols 

One  of  the  phenols  identified.  2,6-bis-(/-butyl)-4-(di- 
methylben/yl  (phenol,  was  previously  developed  as  a  ju- 
venile-hormone mimic  and  mosquito  insecticide  (MON- 
0585)  by  the  Monsanto  Chemical  Corporation  (Sacher, 
1971;  Jakob  and  School",  1972).  so  it  was  of  great  interest 
to  examine  these  phenols  for  juvenile-hormone  activity. 
Results  of  the  Capitella  bioassay  showed  that  the  MON- 
0585  compound  had  very  high  JH  activity  (EC3(,  at  0.5 
;uA/)  compared  with  MF,  JH  I,  JH  III,  and  the  JH  analog 
pyriproxyfen,  which  was  also  developed  as  an  insecticide 
(Table  3).  The  other  three  alkylphenols  identified  also 
exhibited  very  high  JH  activity.  Since  these  compounds 
share  a  high  structural  homology  with  the  known  xe- 
noestrogens  bisphenol  A  and  4-cumy Iphenol  (Fig.  4), 
these  latter  chemicals  were  also  tested  for  JH  activity. 
Bisphenol  A  showed  very  high  JH  activity  (EC50  of  0.05 
/J.M),  whereas  4-cumy  Iphenol  showed  high  activity  (EC5n 
of  3  /J.M).  Mixed  isomers  of  nonylphenol,  a  well-known 
alkylphenol,  also  showed  high  JH  activity  (HC5I>  of  1 
,uA/)  ('fable  3). 


JH-ACTIVE  ALKYLPHENOLS   IN  LOBSTERS  AND  MARINE  SEDIMENTS 


17 


Abundance 

Scan  1067 

(15.154  mini  i  L173PBB.D  (•) 
2! 

3 

8000  - 

6000- 

4000  • 

268 

2000 

0 
m/z--> 

57       91 

77     1°5  1: 

9 
152165    191      225237 

1       f    '  n"  ''  '        \'    ' 

40    60    80   100   I! 

.0   140   160   180   200   220   240   260 

Abundance 

637458:  2-t-Butyl-4-  (dimethylbenzyl)  phenol  (*) 
/\                     2! 

3 

8000 

V 

o*  —  c  —  w, 

6000- 

CjX_ 

4000 

268 

2000- 

0- 
m/z--> 

41  "  »lf» 

77      J 
.  .,.   .   L.  ....  J.  L 

.9 
131   152165    191203   225237 

40    60    80   100   1 

20   140   160   180   200   220   240   260 

A. 


Abundance 

Scan 

1097 

(15.501  min)  :  L6SBB.D  (*) 

31 

9 

8000  • 

6000 

4000 

2000 

0 

m/z-  -> 

5 

7 
9 

1   119 
103  1  133 

165178   203  221   2*7  267   293 

324 

40   60   80 

ioo  'ii 

0  140 

160  180  200  220  240  260  280  300  320 

Abundance 

#195907: 

2,6-Bls(t-butyl)-4-(dimethylbenzyl)phenol  (« 

3i 

f"N 

) 
9 

8000  - 

V 

6000- 

r^l 

wfl^^V^a"* 

4000- 

5 

7 

CM 

324 

2000 
0- 

4 

1 

9 

..  li. 

i   1: 

103 

.  V,'.V 

9 

i: 

|f, 

3 

165178   203215    2*,7  267   2?3 

1 

4 

WWjTTTTp 

0   60   80 

100  1 

!0 

140 

160  180  200  220  240  260  280  300  320 

B. 


Figure  2.  (A)  2-f-Butyl-4-(dimethylbenzyl)phenol.  Mass  spectra  from  lobster  hemolymph  (upper)  and  from 
reference  library  database,  along  with  structure  (lower)  of  2-r-butyl-4-(dimethylben/yl)phenol  (molecular  weight 
286).  (B)  2,6-Bis-(f-butyl)-4-(dimethylbenzyl)phenol.  Mass  spectra  from  lobster  hemolymph  (upper)  and  from 
reference  library  database,  along  with  structure  (lower)  of  2,h-bis-( /-butyl  1-4-1  dimelhylben/y I  (phenol  (molecular 
weight  324). 


18 


W    J.  B1GGERS  AND  H.  LAUFER 


Abundance 

Scan  1355 

(18.033  mln)  :   L64BB.D    (*) 
3 

5 

8000  - 

6000  - 

4000  • 

9 

i 

1. 

.9 

330 

2000  • 

57 

103 
I 

2. 

17 

0- 
m/z--> 

jjilk 

i 

U, 

150lgc 

|265          299 

50                   100                 150                 200 

"1—f-f  1  •  f  ,  y  -1   Li  r-—  ,  — 

250                  300 

Abundance 

846982:    2  ,  4-Bis  (ditnethylbenzyl  )  phenol    (•) 

r^i                                       3 

5 

8000- 

X, 

6000  • 

"V^N/* 

T  /Si^S 

330 

*  \J 

4000  - 

91 

103  119         1( 

237 

2000  - 

4 

1 

0  - 

u  6,5  i 

.1. 

LiL 

t  16L5yi  _202 

L      1  265           299 

m/z-->               50                   100                 150                 200 

250                   300 

A. 


B. 


Abundance 

Scan  1355  (18.200  rain):  L65BB.D  (*) 

31 

1 

8000  - 

57 

6000  - 

4000  - 

293 

31 

6 

85 

2000  - 

1 

119 

1 

0- 

L 

ll 

JU 

1 

8 
203   231    267 

309 

i 

so 

100 

ISO 

200      250      300      350        ' 

Abundance 

#52799:  2 

4  -bis  (dimethylbenzyl)  -6-  t-butylphenol 

i^S           3 

1 

8000  - 

.X. 

I**! 

386 

6000  - 

J%JL/°" 

1] 

9 

"'   IJ       293 

4000  - 

91 

57 

2000  - 

4 

1 

178 

0  - 
m/z-  -> 

J  ^..i 

, 

L 

139  165 

IX  L..  ^   L 

203  231   265 

r  —  v  i'1  »  '  r  —  t~-t  —  r  .•••.  ri  J 

309 
1  329 

SO 

1  ^'  »  n  *" 
100 

1   1   1   [   1   1 

150 

T^    T^   |  1  1  1  1  J  1  1  1  1  1 

200       250       300       350 

Figure  3.  (A)  2,4-Bis-(dimethylbenzyl)phenol.  Mass  spectra  from  lobster  hemolymph  (upper)  and  from 
ii'k'ivnce  lihrars  datahase.  along  with  structure  (limen  ol  2,4-bis-(dimethylbenzyl)pheno]  (molecular  weight 
i;()i  (Bi  2,4-Bis-(dimethylbenzyl)-6-f-butylphenol.  Mass  spectia  from  lohstet  hcnml\inpli  (upper)  and  from 
reference  library  database,  along  \\iih  structure  (lower)  of  2,4-bis-(dimethylbenzyl)-6-/-butylphenol  (molecular 

wciL'hl 


JH-ACTIVE  ALKYLPHENOLS  IN  LOBSTERS  AND  MARINE  SEDIMENTS 

Table  1 
Relative  concentrations  of  alk\lpljenols  in  heniol\mph  from  lobsters  collected  from  Long  Isltind  Sound  fLIS)  ami  Vine\ard  S(tttnil  (\'St 


19 


Alkylphenol 

Average  hemolymph  concentration  (/^g/ml)  ±  SEM 

LIS 

VS 

Combined 
(LIS  +  VS) 

2-;-butyl-4-(dimethylbenzyl  (phenol 
2,6-bis-(r-butvl)-4-(dimethylbenzyl  (phenol 
2.  4-bis-(dimethvlbenzyl  (phenol 
2,4-bis-(dimethylbenzyl)-6-r-but\lphenol 

0.10±    0.06 
3.76  ±    2.11 
5.1  7  ±    3.05 
21.50  ±  11.89 

0.83  ±  0.07 
0.03  ±  0.01 
2.90  ±  0.55 
0.45  ±  0.09 

0.46  ±0.11 
1.89  ±  1.14 
4.03  ±  1  .52 
10.98  ±  6.41 

SEM:  standard  error  of  the  mean. 

n  =  l  for  each  mean  for  LIS  and  VS;  n  =   14  for  combined  animals. 


Discussion 

Our  analyses  by  GC/MS  indicate  the  presence  of  alkyl- 
phenols  in  14  samples  of  lobster  hemolymph,  2  samples  of 
hepatopancreas  tissue,  and  two  samples  of  marine  sediment. 
Alkylphenols  are  used  primarily  in  the  production  of  alkyl- 
phenol  ethoxylates  (APEs).  which  are  found  in  industrial 
and  household  detergents,  surfactants,  paints,  and  wetting 
agents,  and  which  have  applications  in  wood  pulping,  textile 
manufacture,  plastics  manufacture,  and  petroleum  recovery, 
among  other  uses  (Nay lor  et  ul..  1992).  Besides  their  use  to 
produce  APEs,  alkylphenols  are  also  used  in  the  production 
of  phenolic  resins,  as  antioxidant  stabilizers  for  plastics  and 
polymers,  and  as  curing  agents  (Ying  et  al.,  2002). 

An  estimated  500  million  pounds  of  alkylphenols  are 
used  annually  (Zintek  et  ul..  2003).  and  an  estimated 
500.000  tons  of  APEs  are  produced  annually  (Naylor  et  til.. 
1992;  Ying  et  «/.,  2002).  Environmental  contamination  by 
these  chemicals  and  their  breakdown  products  in  rivers, 
oceans,  and  sediments  is  well  known  and  widespread  (Hale 
et  ul..  2000).  Of  the  500,000  tons  of  APEs  produced,  about 
60  percent  are  estimated  to  end  up  in  the  aquatic  environ- 
ment, as  these  chemicals  and  their  breakdown  products 
(which  are  alkylphenols)  are  released  from  wastewater  out- 
falls or  directly  into  the  environment  (Renner,  1997;  Ying  et 


Table  2 

Relative  concentrations  of  alkylphenols  in  murine  sediments  from 
Vineyard  Sound.  Massachusetts  (VS)  and  Great  Buy.  Ne\t:  Jersey  (GBI 


Alkylphenol 

Concentration 
(fig/gm  sediment) 

VS                    GB 

2-r-butyl-4-(dimethylbenzyl  (phenol 
2,  6-bis-(r-butyl)-4-(dimethylbenzyl  (phenol 
2.4-bis-(dimethylbenzyl)phenol 
2,4-bis-(dimethylhenzyl)-6-/-butylphenol 

8.95                  21.58 
49.47                  77.89 
138.94                224.89 
181.20                251.05 

til..  2002).  Alkylphenols  have  been  detected  in  the  water,  in 
sediments,  and  in  fish  tissues  (Lye  et  ul..  1999;  van  Heemst 
c/  <//.,  1999);  in  sediments,  levels  have  been  reported  to  be 
as  high  as  70  jug/g  in  the  United  States  (Ying  et  al.,  2002). 
The  alkylphenols  identified  in  this  report  are  similar  in 
structure  to  bisphenol  A  (BPA).  a  well-known  endocrine 
disrupter  (Fig.  4).  BPA  is  utilized  primarily  in  the  produc- 
tion of  polycarbonate  plastics.  It  is  also  a  major  antioxidant 
component  of  the  epoxy  resins  used  to  line  food  cans  and 
pipes,  and  is  used  in  dental  sealants  (Staples  et  al..  1998). 
Over  200,000  tons  of  BPA  are  produced  annually  by  Japan 

Table  3 

Juvenile  hormone  activity  of  alkylphenols  compared  with  activity  of 
known  juvenile  hormones,  using  a  Capitella  -.cit/cnicnt  and 
metamorphosis  hioasxay 


Chemical  tested 


EC5(, 


Juvenile  hormones 
JH  I 
JH  III 
tran\,  trans-melhy\  farnesoate 

(crustacean  juvenile  hormone) 
pyriproxyfen  (JH-mimicl 

Alkylphenols 

2-/-buty  1-4-1  dimethylbenzyl  (phenol 

2.4-bis-(dimethylbenzyl)phenol 

2,6-bis-(f-butyl)-4-(dimethylbenzyl)phenoI 

UH-mimic  MON-0585) 
2.4-bis-(dimethylbenzyl(-6-r-butylphenol 
4-cumylphenol 
hisphenol  A 
nonylphenol  (mixed  isomersi 

Other  chemicals  tested 
farnesol 

arachidonic  acid 
stearic  acid 
cholesterol 
lutein 


25 
3 

1 


1 
2 

0.5 

1 
3 

0.05 
I 


40 
70 

410 
NA 
NA 


Data  shown  is  for  one  sediment  sample  from  VS  and  one  from  GB. 


NA:  not  active  at  highest  concentration  tested  ( 1000  / 


20 


\V    J    RIGGERS  AND  H.  LAUFER 


(HSC)3C 


C(CH3), 


A.  2,6-bis-(t-butyl)-4- 
(dimethylbenzyl)  phenol 
(MON-0585) 


B.  4-cumylphenol 


C.  Bisphenol  A 


Figure  4.  Comparison  of  chemical  structures  of  2,(vbis-(/-butyl)-4-(dimethylbenzyl)phenol.  4-dimethylben- 
zylphenol.  and  bisphenol  A.  (A)  Chemical  structure  of  the  juvenile  hormone  mimic  and  mosquito  insecticide 
MON-05S5  (same  as  2,fi-bis-(/-butyl)-4-(dimethylben/yl)phenol).  (B)  Chemical  structure  of  4-cumylphenol.  (C) 
Chemical  structure  of  the  known  endocrine  disrupter  bisphenol  A. 


alone  (Kumiunt  et  ul..  1997).  and  environmental  contami- 
nation hy  this  chemical  has  in  recent  years  been  of  major 
public  concern.  The  endocrine-disrupting  effects  of  BPA 
have  been  demonstrated  to  alter  the  reproductive  physiology 
and  development  of  mammals  (Stoker  et  ai.  1999;  Takao  et 
al,  1999),  fish,  and  invertebrates — including  molting  of  the 
insect  Clunmonnis  /V/W/H.V  (Watts  ct  al..  2001:  Segner  ct 
ul..  2003).  BPA  can  leach  from  food  cans  and  plastic  bottles 
into  foods  and  beverages  and  from  there  into  the  human 
digestive  system:  it  subsequently  travels  through  sewage 
treatment  plants  and  eventually  into  river  systems  and 
oceans  (Staples  ct  al..  1998;  From  me  ct  ul.,  2002).  Further- 
more, the  plastic-particle  waste  that  is  prevalent  in  the 
oceans  can  also  directly  leach  BPA  into  the  environment 
(Sajiki  and  Yonekubo,  2003).  BPA  contamination  in  sedi- 
ments is  widespread:  for  example,  levels  have  been  reported 
as  0.05  )u,g/g  dry  weight  in  Ulsan  Bay.  Korea  (Khim  ct  ul., 
2001),  in  Onsan  Bay,  Korea:  as  0.20  /ug/g  dry  weight  (Koh 
<7  (//..  2002):  and  as  0.19  jug/g  in  Germany  (Fromme  ct  ul.. 
2002). 

The  four  alkylphenols  we  have  identified  in  lobsters  and 
marine  sediments  are  used  together  in  antioxidanl  blend 
formulations  tor  manufacturing  rubber  and  plastic  poly- 
mers. A  patent  by  Russell  ct  ul.  (2002)  states  thai  these 
phenols  are  found  in  ihe  Wingstay  C  and  Polystay  C  anli- 
oxiil.inl  formulations  used  in  lire  manufacturing  by  the 
(ioodyear  Tire  and  Rubber  Co.  Similarly,  a  paleni  by 
Messina  <•/  ul.  (  1982)  slates  thai  these  phenols  are  added  as 
slabili/ers  for  organic  polymers  including  rubbers  and  plas- 


tics. Other  antio.xidant  applications  include  their  use  in 
pesticide  formulations  and  in  therapeutics  (Smith.  2002). 
These  phenolic  antioxidants  therefore  appear  to  be  widely 
employed  in  a  fashion  similar  to  BPA. 

2,4-bis-(dimethylbenzyl)phenol 

One  alkylphenol  we  found  in  lobster  hemolymph  and 
marine  sediments.  2.4-bis-(dimethylbenzyl  (phenol,  is  sold 
under  the  tradename  2.4-dicumylphenol.  or  2.4-DCP.  This 
reagent  is  used  in  antioxidant  mixtures  (Messina  et  ul.. 
1982:  Russell  ct  ul..  2002)  as  previously  mentioned,  and 
appears  to  also  have  a  use  in  surfactant  formulations.  This 
chemical  is  also  released  into  the  environment  upon  hydro- 
lysis of  the  antioxidant  plastici/er  bis-(2,4-dicumylphe- 
nyllpentaerythritol  diphosphiie.  The  use  of  this  plastici/er 
in  food  containers  is  regulated  by  the  food  industry  (Scien- 
tific Committee  on  Food.  2001 ).  The  2.4-DCP  compound  is 
close  in  structure  to  that  of  4-cumylphenol.  another  indus- 
trial alkylphenol  (Fig.  4).  Hale  ct  ul.  (2000)  reported  levels 
of  4-cumylphenol  as  high  as  70  jug/g  of  sediment  in  sedi- 
ments near  waste-water  outfalls  in  the  United  States.  To  our 
knowledge,  pollution  by  2.4-bis-(dimethylbenzyl  (phenol  in 
sediments  or  aquatic  life  has  not  been  reported.  However, 
we  found  this  phenol  in  sediments  from  Vineyard  Sound  at 
a  concentration  of  138.94  /ug/g  (wet  weight)  and  at  higher 
concentrations  in  Great  Bay.  New  Jersey,  at  224.89  jug/g, 
which  is  close  to  the  concentration  reported  for  4-cumyl- 
phenol by  Hale  ct  ul.  (2000). 


JH-ACTIVE  ALKYLPHENOLS   IN  LOBSTERS  AND  MARINE  SEDIMENTS 


21 


2,6-bis-(t-butyl)-4-(dimethylbenzyl)phenol 

Concentrations  of  2,6-bis-(f-butyl)-4-(dimethylbenzyl)- 
phenol  were  higher  in  lobsters  taken  from  Long  Island 
Sound  than  in  those  from  Vineyard  Sound,  and  this  phenol 
was  also  found  in  sediment  samples  from  the  two  locations. 
As  previously  mentioned,  Monsanto  developed  this  com- 
pound as  a  juvenile  hormone  mimic,  named  MON-0585,  for 
application  as  a  mosquito  insecticide  (Sacher,  1971;  Jakob 
and  School".  1972);  however,  it  was  supposedly  never 
brought  to  commercial  use  (Schaefer  et  <//..  1474).  Like 
other  alkylphenols  and  BPA.  this  one  has  also  gained  in- 
dustrial use  as  an  antioxidant  in  polymer  manufacture 
(Hanauye  et  uL.  1476;  Messina  et  ai.  1982;  Russell  et  til.. 
2002).  Environmental  contamination  by  this  chemical  has 
presumably  not  been  documented  before;  however,  it  has 
been  found  in  propolis,  which  is  produced  by  bees  and 
derived  from  the  resins  of  tree  bark  and  leaves  (Hegazi  and 
El  Hady,  2002). 

2-t-butyl-4-(dimethylbenzyl)phenol  and  2,4-his- 
(dimethylbenzyl)-6-t-butylphenol 

The  compounds  2-f-butyl-4-(dimethylbenzyl  (phenol  and 
2.4-bis-(dimethylbenzyl)-6-/-butylphenol  were  both  found 
in  lobster  hemolymph  and  marine  sediments,  and  are  used 
industrially  in  antioxidant  blends  for  the  manufacturing  of 
rubber  and  other  polymers  (Messina  et  til..  19S2;  Russell  ft 
nl..  2002).  Interestingly,  these  phenols,  along  with  2,4-bis- 
(dimethylbenzyl (phenol,  were  found  to  be  cyclooxgenase 
inhibitors  that  occur  naturally  in  peat  (Russell  et  al..  2002). 
Under  the  tradename  isobutylenated  methylstyrenated  phe- 
nol, the  2.4-bis-(dimethylbenzyl)-6-?-butylphenol  com- 
pound is  listed  as  having  a  high  production  volume  ( more 
than  a  million  pounds  produced  per  year)  by  the  U.S. 
Environmental  Protection  Agency  in  its  High  Production 
Volume  Challenge  Program,  which  encourages  manufactur- 
ers to  investigate  the  toxicity  of  these  chemicals  (U.S.  EPA. 
2002).  This  compound  has  also  been  reported  in  sediments 
contaminated  with  coal  tar  sediments  (Zeng  and  Hong. 
2002).  The  2-?-butyl-4-(diniethylbenzyl)phenol  compound, 
however,  has  not  been  reported  as  a  contaminant  until  now. 

Probable  sources  of  the  alklphenols  and  likelihood  of  the 
presence  of  other  phenols 

Given  that  these  identified  alkylphenols  are  used  in  in- 
dustrial antioxidant  formulations  similar  to  those  of  BPA. 
and  that  alkylphenol  and  BPA  contamination  is  well  known 
and  widespread,  it  is  likely  that  the  source  of  these  identified 
phenols  is  alkylphenol  contamination  originating  from 
wastewater  outfalls  or  released  directly  into  the  environ- 
ment; these  are  the  sources  that  have  been  identified  for 
other  alkylphenols  and  BPA  (Ying  et  ai.  2002).  Surface 
runoff  from  heavily  traveled  roadways  containing  tire  resi- 


due may  be  a  contributing  source  of  these  chemicals.  It  is  to 
be  noted,  however,  that  three  of  these  compounds  were  also 
found  naturally  in  peat  bog  material  (Russell  et  til..  2002). 
indicating  that  they  may  be  residues  derived  from  break- 
down of  plant  material.  More  research  is  needed  to  deter- 
mine the  sources  of  these  chemicals.  It  should  also  be 
emphasized  that  the  nonpolar  extraction  method  employed, 
using  hexane.  may  not  be  suitable  for  the  extraction  of  some 
of  the  more  polar  phenols,  such  as  BPA  and  4-dimethyl- 
benzylphenol,  which  may  therefore  also  be  present. 

In  support  of  the  view  that  environmental  contamination 
is  a  source  for  alkylphenols,  the  plasticizer  diisooctylphtha- 
late  was  also  found  in  fairly  high  concentrations  in  the 
hemolymph  of  7  of  the  14  lobsters  examined,  indicating 
these  lobsters  indeed  had  exposure  to  plasticizers.  Control 
experiments  done  in  our  laboratory  showed  that  the  phenols 
and  diisooctylphthalate  found  were  not  derived  from  labo- 
ratory contamination  by  soap,  glassware,  pipettes,  or  sy- 
ringes, and  were  not  from  the  GC  columns  since  control 
extractions  did  not  produce  these  chemicals.  It  therefore 
appears  that  these  alkylphenols.  like  other  alkylphenols  and 
BPA,  result  from  environmental  contamination.  The  relative 
levels  of  these  phenols  in  the  lobsters  and  sediments  dif- 
fered at  different  locations,  and  this  presumably  reflects 
different  amounts  and  different  formulations  of  alkylphe- 
nols used  in  different  geographic  areas.  Alkylphenols  may 
also  have  originated  from  nonlocal  sources  and  been  carried 
by  currents. 

Effects  of  alkylphenols  on  crustaceans 

What  effect  these  compounds  have  on  lobsters  is  cur- 
rently being  investigated  in  our  laboratory.  Given  that  these 
phenols  are  similar  in  structure  to  BPA  and  show  high  JH 
activity  in  bioassays,  it  is  likely  that  they  have  serious  toxic 
and  endocrine-disrupting  effects.  The  high  toxicity  of  alky- 
phenols  to  aquatic  life  has  recently  been  documented  by  the 
U.S.  Environmental  Protection  Agency,  as  has  the  fact  that 
these  chemicals  persist  in  the  environment,  including  sedi- 
ments (U.S.  EPA.  2003).  Indeed,  toxicity  studies  with  2,6- 
bis-U-buty I  )-4-(dimethylben/yl  (phenol  (MON-0585)  have 
shown  that  this  compound  does  affect  nontarget  crustaceans 
(reviewed  by  Williams  and  Duke.  1979).  In  experiments  by 
Costlow  (1977).  megalopa  larvae  of  the  blue  crab  Calli- 
nectcs  SL/pidus  were  all  killed  in  water  containing  10  ppm 
MON-0585.  and  6()7r  were  killed  in  1  ppm  MON-0585. 
Sublethal  behavioral  effects  of  MON-0585  on  the  swim- 
ming speed  and  phototaxis  of  larvae  of  the  crab  Rhithro- 
lianoiieus  luirrisii  have  also  been  reported  (Forward  and 
Costlow.  1976)  and  attributed  to  the  effects  of  JH  mimics  on 
increased  respiration  (Slama  and  Kryspin.  1979).  Thus  lob- 
ster larval  development  and  metamorphosis  are  likely  to  be 
affected  by  this  compound  at  critical  concentrations.  The 
other  three  phenols  found  probably  also  have  effects  on 


22 


\V    J.   B1GGERS   AND  H    LAUFER 


lobster,  since  they  also  exhibit  high  JH  activity  and  are 
structurally  related  to  MON-0585  and  BPA.  For  example. 
4-nonylphenol  is  acutely  toxic  to  lobsters,  with  an  LC5I,  in 
seawater  reported  as  0.2  ppm  (0.2  jug/ml)  (Cox.  1996).  and 
has  been  found  to  affect  the  development  of  other  crusta- 
ceans, including  barnacles,  in  which  it  inhibits  settlement 
and  induces  synthesis  of  vitellin-like  proteins  (Billinghurst 
ct  ul.,  1998,  2000).  In  our  quantitative  determinations,  we 
found  levels  of  2,6-bis-U-butyl)-4-(dimethylbenzyl)phenol 
(MON-0585)  in  the  hemolymph  of  lobsters  as  high  as  13 
ppm.  which  Costlow  (1977)  found  to  be  a  lethal  external 
concentration  for  crab  larvae.  The  evidence  thus  indicates 
that  these  phenols  may  be  contributing  significantly  to  the 
lobster  deaths  seen  in  Long  Island  Sound,  particularly  under 
stressful  environmental  conditions  such  as  high  tempera- 
tures and  hypoxia.  Since  JH  mimics  such  as  MON-0585  can 
increase  respiration  in  insects  (Slama  and  Kryspin.  1979) 
and  possibly  crustaceans  (Forward  and  Costlow.  1976). 
these  phenols  may  make  the  lobsters  more  susceptible  to 
stress  at  low  levels  of  oxygen.  Furthermore,  MON-0585  has 
been  found  to  inhibit  cuticle  arylation  and  hardening  in 
mosquitoes  (Zomer  and  Lipke.  1981;  Semensi  and  Sugu- 
maran,  1986).  We  speculate  that  this  compound  may  also 
interfere  with  cuticle  formation  and  hardening  in  lobsters, 
making  them  more  susceptible  to  chitinolytic  microorgan- 
isms and  shell  disease.  This  disease  has  become  increas- 
ingly prevalent  in  lobsters  in  recent  years  (Castro  and  An- 
gell,  2000). 

Because  MON-0585  was  developed  as  a  juvenile  hor- 
mone mimic,  it  is  not  surprising  that  other  structurally 
related  alkylphenols  also  possess  JH  activity:  all  four  al- 
kylphenols  exhibited  such  activity  in  the  Cupitellu  bioassay 
when  tested  at  concentrations  found  in  the  hemolymph 
(Tables  2,  3),  raising  the  possibility  that  these  alkylphenols 
may  have  JH-like  effects  on  the  lobster.  Because  reproduc- 
tion, development,  and  metamorphosis  in  crustaceans  are 
partly  regulated  by  methyl  farnesoate.  a  compound  with 
juvenile  hormone  activity,  the  alkylphenols  we  investigated 
may  function  as  endocrine  disruptors  in  the  lobster  at  low 
concentrations.  Exogenous  application  of  JH  analogs  can 
perturb  normal  metamorphosis  and  molting  (reviewed  by 
Laufer  and  Biggers,  2001).  Like  JH  and  its  analogs,  the 
JH-active  alkylphenols  may  act  through  membrane-bound, 
intracellular,  and  nuclear  receptors  to  bring  about  changes  in 
morphogenesis  and  stimulation  of  vitellogenesis  through 
vitellogenin  gene  induction  and  increased  vitellogenin  up- 
take (Engelmann.  1983;  Sehnal.  1983:  Wyatt.  1991;  Davey 
and  Gordon,  1996;  Jones  and  Sharp.  1997).  As  evidence  for 
this  mechanism  of  action,  both  4-nonylphenol  and  BPA 
have  been  found  to  induce  vitellogenesis  in  vertebrates 
(Jones  a  ni.  2000). 

To  our  knowledge,  our  results  are  the  first  to  demonstrate 
that  \enoestrogens  such  as  BPA  and  nom  Iphenol  have  JH 
activity,  indicating  a  possible  relationship  between  estroge- 


nicity  and  juvenile  hormone  activity,  and  the  further  possi- 
bility that  estrogens  and  juvenile  hormones  share  similar 
mechanisms  of  action. 

Possible  bioaccumulation  and  health  effects  of  the 
identified  alkylphenols 

The  presence  of  phenolic  compounds  in  marine  sedi- 
ments suggests  that  lobsters  may  acquire  them  through  the 
food  chain  as  found  for  other  polyaromatic  hydrocarbons 
(Pruell  et  ai,  2000).  Interestingly,  in  the  report  by  Hale  el 
ul.  (2000).  levels  of  4-cumylphenol  in  sediments  was  found 
to  be  much  higher  than  those  of  4-nonylphenol  (70.000 
ju.g/kg  compared  with  1 1,000  /ig/kg).  even  though  80%  of 
the  alkylphenols  used  in  formulations  are  nonylphenol 
ethoxylates  (Ying  et  ul..  2002).  This  suggests  that  polyaro- 
matic alkylphenols  are  more  recalcitrant  to  biodegradation, 
as  would  be  expected.  It  is  therefore  likely  that,  due  to  their 
polyaromatic  structure,  the  alkylphenols  we  identified  in  the 
sediments  are  also  more  resistant  to  degradation  and  may 
accumulate  in  sediments  and  benthic  invertebrates.  These 
alkylphenols  were  also  found  in  lobster  hepatopancreas,  and 
may  be  bioaccumulated  there,  as  other  polyaromatic  hydro- 
carbons are  known  to  be  (McLeese  and  Metcalfe,  1979: 
James  et  ul..  1995).  Bioaccumulation  in  seafoods  has  been 
documented  for  4-nonylphenol  (Ekelund  et  ul..  1990;  Fer- 
rara  et  ul..  2001).  This  raises  concern  for  human  health. 
Since  1995.  the  European  community  has  placed  a  volun- 
tary ban  on  the  use  of  alkylphenol  ethoxylates  (APEs)  due 
to  the  toxicity  and  endocrine-disrupter  activity  of  the  break- 
down products  (including  4-nonylphenol  and  4-cumylphe- 
nol); use  of  these  products  has  not  been  banned  in  the 
United  States  (Renner,  1997).  This  has  sparked  considerable 
debate  among  researchers  and  regulators.  The  potentially 
endocrine-disrupting  effects  of  BPA  have  raised  particular 
health  concerns,  especially  since  these  are  viewed  as  being 
potentially  carcinogenic  to  humans  (reviewed  by  Cox,  1996. 
and  Lathers.  2002).  Since  the  compounds  identified  are 
similar  in  structure  to  BPA,  the  presence  of  these  com- 
pounds in  lobsters  may  also  warrant  health  concerns. 

Acknowledgments 

We  acknowledge  the  help  of  Dr.  Mike  Syslo  of  the 
Massachusetts  Division  of  Marine  Fisheries  lobster  hatch- 
ery on  Martha's  Vineyard  and  Mrs.  Penny  Howell  of  the 
Connecticut  Department  of  Environmental  Protection  for 
kindly  supplying  lobsters  for  (his  study.  We  also  acknowl- 
edge Dr.  Judith  Grassle,  Rutgers  University,  for  kindly 
supplying  marine  sediment  samples  and  Capitella  stocks, 
and  Dr.  William  Bowers.  University  of  Arizona,  for  kindly 
supplying  pyriproxyfen.  In  addition,  we  are  grateful  to 
Professor  James  M.  Bobbin.  Professor  James  D.  Stuart,  and 
Mi.  Christopher  P.  Capulong.  of  the  Department  of  Chem- 
istry, University  of  Connecticut,  for  helpful  discussions  on 


JH-ACTIVE  ALKYLPHENOLS  IN  LOBSTERS  AND  MARINE  SEDIMENTS 


23 


chemical  synthesis  and  analysis.  We  also  acknowledge  the 
help  and  expertise  of  Mr.  Marvin  Thompson,  manager  of 
the  mass  spectrometry  laboratory  and  the  Department  of 
Chemistry.  University  of  Connecticut,  for  use  of  the  GC/MS 
facilities.  We  gratefully  acknowledge  the  Sea  Grant  College 
Program,  NOAA,  and  the  Connecticut  Department  of  En- 
vironmental Protection  for  providing  financial  support  for 
this  research. 

Literature  Cited 

Biggers,  W.  J.  1994.  Effects  of  juvenile  hormone-active  compounds  on 
larval  settlement  and  metamorphosis  of  the  polychaete  annelid  G//J/- 
tella  Sp.  I.  Ph.D.  dissertation.  University  of  Connecticut. 

Biggers,  W.  J.,  and  H.  Laufer.  1992.  Chemical  induction  of  settlement 
and  metamorphosis  of  Capriella  capitata  sp.  I.  (Polychaetea)  larvae  by 
juvenile  hormone-active  compounds.  Invertehr.  Reproil.  Dev.  22:  39- 
46. 

Biggers,  W.  J.,  and  H.  Laufer.  1996.  Detection  of  juvenile  hormone- 
active  compounds  by  larvae  of  the  marine  annelid  Capitella  sp.  I.  Arch. 
Insect  Biochem.  Physiol.  32:  475-484. 

Billinghurst,  Z.,  A.  S.  Clare,  T.  Fileman,  J.  McEvoy,  J.  Readman,  and 
M.  H.  Depledge.  1998.  Inhibition  of  barnacle  settlement  by  the 
environmental  oestrogen  4-nonylphenol  and  the  natural  oestrogen  17/3- 
oestradiol.  Mar.  Pollut.  Bull.  36:  833-839. 

Billinghurst,  Z.,  A.  S.  Clare,  K.  Matsumura,  and  M.  H.  Depledge.  2000. 
Induction  of  cypris  major  protein  in  barnacle  larvae  by  exposure  to 
4-n-nonylphenol  and  17/3-oestradiol.  Aquat.  Tiuicol.  47:  203-212. 

Castro,  K.  M.,  and  T.  E.  Angell.  2000.  Prevalence  and  progression  of 
shell  disease  in  American  lobster.  Homurus  amencuniis.  from  Rhode 
Island  waters  and  the  offshore  canyons.  J.  Shellfish  Res.  19:  691-700. 

Costlow,  J.  D.  1977.  The  effect  of  juvenile  hormone  mimics  on  devel- 
opment of  the  mud  crab  Rhilhropanopeus  harrisii  (Gould).  Pp.  439- 
457  in  Physiological  Responses  of  Marine  Biota  to  Pollutants.  F.  J. 
Vernberg,  A.  Calabrese,  F.  P.  Thurberg.  and  W.  B.  Vernberg,  eds. 
Academic  Press.  New  York. 

Cox,  C.  1996.  Nonylphenol  and  related  chemicals.  J.  Pest.  Reform  [On- 
line] 16:  15-20.  Available:  http://www.pesticide.org/nonyl.pdf  [2003. 
29  September]. 

Davey,  K.  G.,  and  D.  R.  B.  Gordon.  1996.  Fenoxycarb  and  thyroid 
hormones  have  JH-like  effects  on  follicle  cells  of  Locusta  migrutoriu  in 
vitro.  Arch.  Insect  Bioclu-iu.  Plivsiol.  613-622. 

Ekelund,  R.,  A.  Bergman,  A.  Granmo,  and  M.  Berggren.  1990.  Bio- 
accumulation  of  4-nonylphenol  in  marine  animals:  a  re-evaluation. 
Em-iron.  Pollut.  64:  107-120. 

Engelmann,  F.  1983.  Vitellogenesis  controlled  by  juvenile  hormone.  Pp. 
259-270  in  Invertebrate  Endocrinology.  Vol.  I,  Endocrinology  of 
Insects.  R.  G.  H.  Downer  and  H.  Laufer,  eds.  A.  R.  Liss.  New  York. 

Ferrara,  F.,  F.  Fabietti,  M.  Delise,  A.  P.  Bocca,  and  E.  Funari.  2001. 
Alkylphenolic  compounds  in  edible  molluscs  of  the  Adriatic  Sea  (It- 
aly). Environ.  Sci.  Technol.  35:  3109-3112. 

Forward,  R.  B..  Jr.,  and  J.  D.  Costlow,  Jr.  1976.  Crustacean  larval 
behavior  as  an  indicator  of  sublethal  effects  of  an  insect  juvenile 
hormone  mimic.  Pp.  279-289  in  Esmurine  Processes.  Vol.  I.  Uses, 
Stresses  and  Adaptation  to  the  Estuary.  M.  Wiley,  ed.  Academic  Press, 
New  York. 

Fromme,  H.,  T.  Kuechler,  T.  Otto,  K.  Pilz,  J.  Mueller,  and  A.  Wenzel. 
2002.  Occurrence  of  phthalates  and  bisphenol  A  and  F  in  the  envi- 
ronment. Water  Res.  36:  1429-1438. 

Hale,  R.  C.,  C.  L.  Smith,  P.  DeFur,  E.  Harvey,  E.  Bush,  M.  J.  La- 
Guardia,  and  G.  G.  Vadas.  2000.  Nonylphenols  in  sediments  and 
effluents  associated  with  diverse  wastewater  outfalls.  Environ.  To\icol 
Chem.  19:  946-952. 


Hanauye,  K.,  T.  Takase,  M.  Iwasa,  and  M.  Ito.  1976.     Method  for 

producing  2,6-di-tert.-butyl-4-cumyl  phenol.  United  States  Patent  No. 

3.933.928.  [Online]  Available:  www.uspto.gov  [2003,  September  29|. 

Hegazi,  A.  G.,  and  F.  K.  A.  El  Hady.  2002.     Egyptian  propolis:  3. 

Antioxidant.    antimicrobial   activities   and   chemical   composition   of 

propolis  from  reclaimed  lands.  Z.  Natiirforsch.  Sect.  C  57:  395-402. 

Jakob,  VV.  L.,  and  H.  F.  Schoof.  1972.     Mosquito  larvicide  studies  with 

MON  585.  a  juvenile  hormone  mimic.  Mosq.  News  32:  6-10. 
James.  M.  O.,  A.  H.  Altman,  C.  L.  J.  Li,  and  J.  D.  Schell.  1995. 
Biotransformation.  hepatopancreas  DNA  binding  and  pharmacokinet- 
ics  of  benzo(a)pyrene  after  oral  and  parenteral  administration  to  the 
American  lobster.  Homarus  amcricanus.  Clicm-Biol.  Interact.  95:  141- 
160, 

Jones,  G.,  and  P.  A.  Sharp.  1997.  Ultraspiracle:  an  invertebrate  nuclear 
receptor  for  juvenile  hormones.  Proc.  Null.  Acad.  Sci.  USA  94:  13499- 
13503. 

Jones,  P.  D.,  W.  M.  DeCoen.  L.  Tremblay,  and  J.  P.  Giesy.  2000. 
Vitellogenin  as  a  biomarker  for  environmental  estrogens.  Water  Sci. 
Technol.  42:  1-14. 
Kamiura.  T.,  V.  Tajima,  and  T.  Nakahara.  1997.     Determination  of 

bisphenol  A  in  mr.  ./.  Environ.  Chem.  7:  275-279. 
Khim,  J.  S.,  K.  T.  Lee,  K.  Kannan,  I).  L.  Villeneuve,  J.  P.  Giesy,  and 
C.  H.  Koh.  2001.     Trace  organic  contaminants  in  sediment  and  water 
from  Ulsan  Bay  and  its  vicinity.  Korea.  Arch.  Em-iron.  Contain.  To\i- 
col.  40:  141-150. 

Koh,  C.  H.,  J.  S.  Khim,  D.  L.  Villeneuve,  K.  Kannan,  and  J.  P.  Giesy. 
2002.  Analysis  of  trace  organic  contaminants  in  sediment,  pore  water, 
and  water  samples  from  Onsan  Bay,  Korea:  instrumental  analysis  and 
in  vitro  gene  expression  assay.  Em-iron.  Toxicol.  Chem.  21:  1796- 
1803. 

Lathers,  C.  M.  2002.  Endocrine  disrupters:  a  new  scientific  role  for 
clinical  pharmacologists?  Impact  on  human  health,  wildlife,  and  the 
environment.  ./.  Clin.  Phannacol.  42:  7-23. 

Laufer,  H.,  and  VV.  J.  Biggers.  2001.  Unifying  concepts  learned  from 
methyl  farnesoate  for  invertebrate  reproduction  and  post-embryonic 
development.  Am.  Zool.  41:  442-457. 

Long  Island  Sound  Lobster  Health  Symposium.  2003.  S\mposium  of 
the  Lont;  Island  Sound  Lobster  Research  Initiative  and  Connecticut 
Department  of  Environmental  Protection.  CT-SG-03-03,  N.  C.  Bal- 
com,  ed.  Connecticut  Sea  Grant  College  Program.  NOAA. 
Lye,  C.  M.,  C.  L.  J.  Frid,  M.  E.  Gill,  D.  W.  Cooper,  and  D.  M.  Jones. 
1999.  Estrogenic  alkylphenols  in  fish  tissues,  sediments,  and  waters 
from  the  U.K.  Tyne  and  Tees  estuaries.  Environ.  Sci.  Technol.  33: 
1009-1014 

McLeese,  D.  W.,  and  C.  D.  Metcall'e.  1979.  Toxicity  of  creosote  to 
larval  and  adult  lobsters  Homarus  amcricanus  and  Cram;on  \eptem- 
spinosa  and  its  accumulation  in  lobster  hepatopancreas.  Bull.  Environ. 
Contain.  Toxicol.  22:  796-799. 

Messina,  G.,  L.  Lorenzoni,  and  A.  Fadda.  1982.  Phenolic  antioxidant 
compositions  for  organic  polymers.  United  States  Patent  No. 
4.439.570.  [Online]  Available:  www.uspto.gov  [2003,  September  29|. 
Naylor,  C.  G.,  J.  P.  Mieure,  VV.  J.  Adams,  J.  A.  Weeks,  F.  J.  Castaldi, 
L.  D.  Ogle,  and  R.  R.  Romano.  1992.  Alkylphenol  etlum  lates  in 
the  environment.  /.  Am.  Oil  Client.  Soc.  69:  695-703. 
Pruell,  R.  J.,  B.  K.  Taplin,  D.  G.  McGovern,  R.  McKinnev.  and  S.  B. 
Norton.  2000.  Organic  contaminant  distributions  in  sediments, 
polychaetes  (Nereis  virenx)  and  American  lobster  (Homarus  amcrica- 
nus) from  a  laboratory  food  chain  experiment.  Mar.  Environ.  Res.  49: 
1 9  -36. 

Renner.  R.  1997.     European  bans  on  surfactant  trigger  transatlantic  de- 
hate.   Environ.   Sci.    Technol.   31:   3I6A-320A.   [Online]   July    1997. 
Available:  http://pubs.acs.org/hotartcl/est/97/iul/euro.html  [2003.  Sep- 
tember 29 1 . 
Russell,  B.  A.,  J.  I).  Miller.  J.  R.  (.'ashman,  and  S.  A.  VVeera«arna. 


24 


BIGGERS  AND  H.   LAUFER 


2(102.  Naturally  occurring  compounds  and  their  derivatives  as  cyclo- 
oxygenase  2  and/or  5-lipoxygenase  inhibitors.  United  Stales  Patent  No. 
6.365,634.  [Online]  Available:  www.uspto.gov  [2003.  September  29]. 

Sacher,  R.  1971.  A  mosquito  larvicide  with  favorable  environmental 
properties.  Mosq.  News  31:  513-516. 

Sajiki.  J..  and  J.  Vonekubo.  2003.  Leaching  of  bisphenol  A  (BPA)  to 
seawater  from  polycarbonate  plastic  and  its  degradation  by  reactive 
oxygen  species.  Chemospherej  51:  55-62. 

Schaefer,  C.  H.,  T.  Miura,  F.  S.  Mulligan,  III,  and  R.  M.  Takahashi. 
1974.  Insect  development  inhibitors:  biological  activity  of  RE  17656. 
RE17937,  and  RE18286  against  mosquitoes  (Diptera:Culicidae).  Proc. 
Pap.  Ann.  Conf.  Calif.  Mosq.  Control  Assoc.  42:  147-151. 

Scientific  Committee  on  Food.  2001.  Opinion  of  the  Scientific  Com- 
mittee on  Food  on  the  12th  additional  list  of  monomers  and  additives 
for  food  contact  materials.  Report  CS/PM/GEN/M84.  European  Com- 
mission, Health  and  Consumer  Protection  Directorate-General.  Brus- 
sels. [Online]  Available:  http://europa.eu.inl/comm/food/fs/sc/scf/ 
out84_en.pdf  [2003,  October  20]. 

Segner,  H.,  K.  Caroll.  M.  Fenske,  C.  R.  Janssen,  G.  Maack,  D.  Pascoe, 
C.  Schafers.  G.  F.  \  andenbergh,  M.  Watts,  and  A.  Wenzel.  2003. 
Identification  of  endocrine  disrupting  effects  in  aquatic  vertebrates  and 
invertebrates:  report  from  the  European  IDEA  project.  Ecotoxicol. 
Em-iron.  Saf.  54:  302-314. 

Sehnal,  F.  1983.  Juvenile  hormone  analogues.  Pp.  657-672  in  Inverte- 
brate Endocrinology,  Vol.  I.  Endocrinology  of  Insects.  R.  G.  H. 
Downer  and  H.  Laufer,  eds.  A.  R.  Liss,  New  York. 

Semensi,  V.,  and  M.  Sugumaran.  1986.  Effect  of  MON-0585  on  scle- 
rotization  of  Aedes  aegypti  cuticle.  Peslic.  Biochem.  Physiol,  26:  220- 
230. 

Slama,  K.,  and  S.  I.  Kryspin.  1979.  Hypermetabolic  response  induced 
by  juvenile  hormone  analogs  in  an  insect.  Z.  Naturforsch.  Biosci.  34: 
599-607. 

Smith,  J.  B.  2002.  Zinc  containing  compositions  for  anti-viral  use. 
United  States  Patent  No.  6.475,526.  [Online]  Available:  www.uspto. 
gov  [2003,  September  29]. 

Staples,  C.  A.,  P.  B.  Dom.  G.  M.  Klecka,  S.  T.  O'Block,  and  L.  R. 
Harris.  1998.     A  review  of  the  environmental  fate,  effects,  and  expo- 
sures of  bisphenol  A.  Clu'/nospliere  36:  2149-2173. 
Stoker,  T.  E.,  C.  L.  Robinettt,  B.  H.  Britt,  S.  C.  Laws,  and  R.  L. 
Cooper.  1999.     Prepubertal  exposure  to  compounds  that  increase  pro- 
lactin  secretion  in  the  male  rat:  effects  on  the  adult  prostate.  Bio/. 
Reprod.  61:  1636-1643. 
Takao,  T.,  W.  Nanamiya,  1.  Nagano.  K.  Asaba,  K.  Kawabata,  and  K. 


Hashimoto.  1999.  Exposure  with  the  environmental  estrogen  bisphe- 
nol A  disrupts  the  male  reproductive  tract  in  young  mice.  Life  Sciences 
65:  2351-2357. 

U.S.  EPA  (U.S.  Environmental  Protection  Agency).  2002.  High  Pro- 
duction Volume  (HPV)  Challenge  Program.  Robust  summaries  and  test 
plans:  hindered  phenols.  EPA  comments.  American  Chemistry  Coun- 
cil. [Online]  Available:  http://www.  epa.gov/chemrtk/hndrdphn/ 
cl3382tc.htm  [2003.  September  29]. 

U.S.  EPA  (U.S.  Environmental  Protection  Agency).  2003.  Design  for 
the  Environment.  Key  characteristics  of  laundry  detergent  ingredients. 
[Online]  Available:  http://www.epa.gov/dfe/pubs/laundry/techfact/ 
keychar.htm  [2003,  September  29], 

van  Heemst,  J.  D.  H.,  P.  F.  van  Bergen,  B.  A.  Stankiewicz,  and  J.  VV. 
de  Leeuw.  1999.  Multiple  sources  of  alkylphenols  produced  upon 
pyrolysis  of  DOM.  POM  and  recent  sediments.  J.  Anal.  Appl.  Pyrolysis 
52:  239-256. 

Watts.  M.  W.,  D.  Pascoe,  and  K.  Carroll.  2001.     Chronic  exposure  to 
17-alpha-ethinylestradiol  and  bisphenol  A-effects  on  development  and 
reproduction    in    the    freshwater    invertebrate    Chironomus    riparius 
(Diptera:  Chironomidae).  Aquat.  Toxicol.  55:  113-124. 
Williams,  A.  B.,  and  T.  W.  Duke.  1979.     Crabs  (Arthropoda:  Crustacea: 
Decapoda:  Brachyura).  Pp.  171-233  in  Pollution  Ecology  of  Esmarine 
Invertebrates.  C.  W.  Hart  and  L.  H.  Samuel,  eds.  Academic  Press,  New 
York. 
Wyatt,  G.  R.  1991.     Gene  regulation  in  insect  reproduction.  Invertebr. 

Reprod.  De\:  20:  1-35. 

Ying,  G.-G.,  B.  Williams,  and  R.  Kookana.  2002.  Environmental  fate 
of  alkylphenols  and  alkylphenol  ethoxylates — a  review.  Environ.  Int. 
28:  215-226. 

Zeng,  Y.,  and  P.  K.  A.  Hong.  2002.  Slurry-phase  ozonation  for  reme- 
diation of  sediments  contaminated  by  polycyclic  aromatic  hydrocar- 
bons. J.  Air  Waste  Manag.  Assoc.  52:  58-68. 

Zintek.  L.,  D.  Wesolowski,  B.  Paruchuri,  P.  Howe,  A.  Alwan,  G. 
Azevedo,  D.  Hopkins,  and  J.  Dorkin.  2003.  Methods  for  determi- 
nation of  selected  alkylphenols  and  bisphenol  A  in  sediments  and 
water.  EPA  Conference  on  Analysis  of  Pollutants  in  the  Environment. 
26th  annual  conference,  Chicago.  IL.  U.S.  Environmental  Protection 
Agency,  Office  of  Water.  Office  of  Science  and  Technology,  Engineer- 
ing and  Analysis  Division.  Washington,  DC. 

Zomer,  E..  and  H.  Lipke.  1981.  Tyrosme  metabolism  in  Aedes  ae^pti 
II.  Arrest  of  sclerotization  by  MON  0585  and  diflubenzuron.  Pestic. 
Biochem.  Phvsiol.  16:  28-37. 


Reference:  Bio/.  Bull.  206:  25-34.  (February  2(104) 
©  2004  Marine  Biological  Laboratory 


Reproduction  and  Development  of  the  Conspicuously 
Dimorphic  Brittle  Star  Ophiodaphne  formata 

(Ophiuroidea) 

HIDEYUKI  TOMINAGA1  *,  SHOGO  NAKAMURA2.  AND  MIEKO  KOMATSU1 

'  Department  of  Biologv.  Facultv  of  Science  and  2  Department  of  Environmental  Biology  and  Chemistry. 
Faculty  of  Science,  Toyama  University.  Toyama.  930-8555,  Japan 


Abstract.  Ophiodaphne  formata  is  a  conspicuously  di- 
morphic ophiuroid;  the  disk  diameters  are  approximately  1 
mm  for  males  and  5  mm  for  females.  The  dwarf  male  clings 
to  the  larger  female,  with  the  oral  surfaces  and  bursae  of  the 
paired  ophiuroids  closely  appressed.  Moreover,  the  female 
of  each  pair  adheres  aborally  to  the  oral  surface  of  a  host 
sand  dollar,  Astriclypeits  manni.  Spawning  and  external 
fertilization  occur  in  August,  at  Tsuruga  Bay,  Sea  of  Japan. 
Development  of  the  dimorphic  brittle  star  O.  format/./  is 
described  for  the  first  time,  from  spawning  through  meta- 
morphosis, with  special  attention  to  the  formation  of  the 
skeletal  system  and  the  external  morphology  of  early  juve- 
niles. Fertilized  eggs  are  about  90  /urn  in  diameter,  pale 
pink,  and  negatively  buoyant.  The  embryos  undergo  equal, 
total,  and  radial  cleavage,  and  the  larval  skeleton  first  forms 
as  a  pair  of  tetraradiate  spicules.  Larval  development  pro- 
ceeds to  an  8-armed  planktotrophic  ophiopluteus,  with  skel- 
etal elements  that  consist  of  a  body  rod  and  two  recurrent 
rods.  Three  weeks  after  fertilization,  all  the  pluteal  arms, 
except  for  the  postero-lateral  arms,  are  absorbed,  and  the 
metamorphosing  larvae  sink  to  the  bottom.  Metamorphosis 
is  completed  21.5  days  after  fertilization,  and  the  resulting 
juvenile  is  pentagonal  and  approximately  270  /urn  in  diam- 
eter. The  smallest  specimen  (480  /urn  in  disk  diameter) 
collected  by  field  sampling  exhibited  male  features  on  the 
skeletal  plates  of  the  jaw  and  disk.  Sexual  dimorphism,  the 
peculiar  pairing  behavior,  and  the  close  relationship  with  the 
host  sand  dollar  may  have  evolved  as  distinct  reproductive 
characteristics  in  this  ophiuroid  with  its  typical  ophiopluteus 
larvae. 


Received  13  January  2003;  accepted  23  September  2003. 
*  To    whom    correspondence    should    he    addressed.    E-mail:    hide- 
tom@bb.cocone.jp 


Introduction 

The  biology  of  reproduction  has  been  reported  in  various 
echinoderms,  and  they  are  mostly  dioecious  (Hyman,  1955; 
Delavault,  1966;  Lawrence,  1987).  Sexual  dimorphism  is 
not  common,  but  some  species  show  external  morphologi- 
cal differences  in  size,  genital  papillae,  genital  pores,  and 
arm  spines  (Hyman.  1955;  Delavault,  1966;  Tyler  and 
Tyler.  1966;  Lawrence.  1987;  O'Loughlin,  2001;  Stohr, 
2001).  In  a  few  ophiuroids — Ophiosphaera  insignis,  Am- 
phinra  scripta,  and  Astrochlamys  bruneits — the  difference 
in  size  between  males  and  females  is  very  large  (Brock. 
1888;  Koehler.  1404;  Mortensen,  1933,  1936).  In  O.  insig- 
nis and  A.  scripta.  a  dwarf  male  pairs  with  a  much  larger 
female,  clinched  mouth  to  mouth;  and  in  A.  bnmeiis.  a 
smaller  male  attaches  to  the  dorsal  surface  of  a  larger 
female.  However,  no  spawning  has  been  observed  in  these 
ophiuroids.  Therefore,  the  pairing  of  a  male  and  a  female  in 
these  dimorphic  species  has  not  been  demonstrated  as  a 
distinct  reproductive  behavior.  Ophiuroid  reproduction  and 
development  has  been  reviewed  by  Hyman  (1955).  Strath- 
maiin  and  Rumrill  ( 1987),  Hendler  ( 1995).  and  Byrne  and 
Selvakumaraswamy  (2002).  but  neither  the  larva  nor  the 
metamorphosis  of  a  dimorphic  species  has  been  described. 

We  have  been  studying  an  unusual  sexually  dimorphic 
ophiuroid.  Ophiodaphne  formata.  which  has  two  novel 
characteristics.  First,  the  dwarf  male  and  the  larger  female 
are  coupled  mouth  to  mouth,  and  we  have  observed  this 
pairing  throughout  the  year,  even  in  the  nonbreeding  season. 
Second,  these  paired  ophiuroids  are  only  found  firmly  at- 
tached to  the  oral  surface  of  a  host  sand  dollar,  Astriclypeus 
manni.  The  ophiuroid  O.  formata  ranges  from  the  Arabian 
coast  to  Indonesia  (Koehler.  1905;  Guille,  1981)  and  was 
recorded  from  off  Minabe.  Wakavama  Prefecture  (Honshu). 


2s! 


26 


HIDEYUKI  TOMINAGA  ET  AL. 


Japan,  by  Irimura  (1981).  who  identified  it,  at  first,  as 
Ophioiltiphnc  malt-rim.  He  also  reported  that  a  large  speci- 
men and  a  smaller  one — supposedly  female  and  male,  re- 
spectively— were  found  on  the  oral  side  of  a  sand  dollar. 
Clypeaster  reticiiltitits.  clinched  together  mouth  to  mouth. 
However,  the  sex  of  the  larger  and  smaller  specimens  was 
not  verified  in  this  very  brief  report.  Later,  Irimura  and  his 
coauthors  (2001)  classified  specimens  of  this  ophiuroid. 
which  were  collected  at  depths  of  25.5-40  m,  as  O.fonmitti. 
In  view  of  the  unusual  natural  history  of  O.  formata,  the 
present  study  was  initiated  to  confirm  that  pairing  in  this 
species  is  a  reproductive  behavior.  Pairs  of  O.  formula 
comprising  a  dwarf  male  and  a  much  larger  female  were 
removed  together  from  the  oral  side  of  the  host  sand  dollar. 
A.  manni,  and  kept  in  glass  beakers.  We  observed  spawning: 
then  external  fertilization  occurred;  and  the  fertilized  eggs 
developed  into  8-armed  ophioplutei,  which  metamorphosed 
into  juveniles.  Thus,  the  developmental  mode  of  the  sexu- 
ally dimorphic  O.  formula  has  now  been  defined. 

Materials  and  Methods 

In  the  summers  of  1999  to  2001.  adult  sand  dollars 
(Astricl\i>en.\  manni}  were  collected  from  depths  of  5  m  by 
scuba  diving  on  the  sandy  bottom  of  Tsuruga  Bay,  Fukui 
Prefecture  (central  Japan.  35°  44'  N.  136°  03'  E).  The  sand 
dollars  were  examined  for  samples  of  paired  and  unpaired, 
young  and  adult  Ophiodaphnc  formula.  The  ophiuroids 
(n  ==  245)  were  found  on  only  about  1  out  of  10  sand 
dollars,  and  467r  of  them  were  paired  (n  ==  112).  When 
pairs  were  found,  they  were  carefully  removed  from  the 
sand  dollars  with  fine  forceps  and  placed  into  glass  beakers 
containing  filtered  seawater.  In  2002.  about  20  individuals 
of  O.  formata  were  collected  every  2  months  for  histological 
study  of  gonadal  development. 

A  few  days  after  the  collection  in  August  2000,  spawning 
occurred  naturally,  with  no  artificial  stimuli,  and  the  fertil- 
ized eggs  were  removed  from  the  glass  vessels  and  reared  in 
5-1  glass  beakers;  density  was  maintained  at  one  larva  per 
10  ml  of  filtered  seawater.  The  water  temperature  was  about 
26  °C,  approximately  that  at  the  collection  site.  Larval 
cultures  were  agitated  with  a  plastic  propeller  rotating  at  60 
rpm.  Seawater  used  for  culture  was  obtained  from  the  open 
sea  and  was  filtered  many  times  and  renewed  every  3  days. 
A  small  quantity  (3  ml/1)  of  larval  food  in  the  form  of  a 
mixture  of  unicellular  algae — DunaliclUi  ti-rrioU'cta.  ho- 
r//nw'\  wilhaiia.  anil  Chacloci-ros  i>racilifi — was  added  to 
the  culture  when  the  seawater  was  changed. 

The  development  of  embryos  and  larvae,  including  skel- 
etal formation.  \\as  observed  by  both  light  microscopy  and 
polarized  light  microscopy.  Mcasuicments  of  living  em- 
bryos and  larvae  were  made  with  an  ocular  micrometer.  For 
scanning  electron  microscopy,  metamorphosing  larvae  ami 
juveniles  were  fixed  for  1  h  in  2' i  OsO,  in  a  50  m.W 


Na-cacodylate  buffer  (pH  7.4);  the  osmolarity  of  the  fixative 
was  adjusted  by  adding  sucrose  (final  concentration  0.6  M), 
according  to  Komatsu  et  al.  (1990).  The  fixed  materials 
were  dehydrated  in  an  ethanol  series,  dried  with  a  critical- 
point  dryer  (Hitachi.  HCP-2),  coated  with  gold-palladium 
(Hitachi,  E101  Ion  Sputter),  and  examined  with  a  Hitachi 
S-2000  scanning  electron  microscope. 

Histological  observations  of  the  reproductive  organs  were 
made  to  confirm  their  sex  and  maturity.  Fresh  specimens 
were  measured,  dissected,  and  fixed  in  Allen-Bouin's  solu- 
tion, followed  by  decalcification  with  5%  trichloroacetic 
acid  for  one  week  at  4  °C.  These  prepared  gonadal  tissues 
were  serially  sectioned  at  4  /xm  by  a  routine  paraffin  method 
and  stained  with  Delafield's  hematoxylin  and  eosin. 

Results 

Pairing,  symbiosis,  and  scxitul  dimorphism 

Adult  individuals  of  Ophiodaphne  formata  are  diecious. 
and  the  disk  diameter  of  mature  specimens  is  about  1  mm  in 
males  and  5  mm  in  females.  The  oral  surface  of  the  dwarf 
male  is  pressed  against  the  oral  surface  of  the  larger  female, 
and  the  arms  of  the  male  cling  to  the  female  at  the  interra- 
dius  position  (Fig.  1A).  Mature  specimens,  paired  and  un- 
paired, were  situated  next  to  a  lunule  on  the  oral  side  of  the 
burrowing  sand  dollar  Astriclvpeus  manni.  which  is  consid- 
ered to  be  their  host  (Fig.  IB.  C).  The  female  reaches 
upward  to  hook  the  terminal  half  of  two  arms  over  the  edge 
of  the  lunule.  She  firmly  fixes  her  aboral  surface  to  the  oral 
surface  of  the  sand  dollar  by  attaching  her  aboral  skeletal 
elements  to  the  oral  spines  of  the  host.  Two  of  the  tips  of  the 
male's  arms  are  just  visible  protruding  from  under  the 
female's  disk  (Fig.  ID).  Most  ophiuroids.  whether  paired  or 
unpaired,  were  located  at  the  lunule  of  the  sand  dollar  as  an 
attachment  site,  from  which  a  radial  food  track  leads  away 
food  particles  to  the  sand  dollar's  mouth.  However,  some 
single  young  females  and  males  were  not  located  at  the 
lunule.  but  on  the  oral  plate  of  the  sand  dollar,  closer  to  its 
mouth  and  anus. 

In  addition  to  the  size  dimorphism,  external  morpholog- 
ical differences  between  males  and  females  are  evident  in 
such  skeletal  characteristics  as  the  shape  of  the  jaw.  the 
number  and  size  of  disk  scales,  the  number  of  arm  spines, 
the  presence  or  absence  of  parallel  grooves  on  the  radial 
shields  and  disk  scales  of  the  aboral  disk,  and  tentacle  scales 
on  the  oral  side  of  the  arm.  The  jaws  of  both  males  and 
females,  present  at  each  interradius.  consist  of  one  tooth, 
one  oral  shield,  two  adoral  shields,  two  oral  plates  with 
mliadental  papillae,  and  two  buccal  scales.  The  jaw  ossicles 
of  females  are  stouter  than  those  of  males,  and  the  oral 
plates  and  teeth  are  more  apparent  in  the  female  (Fig.  2 A. 
B).  The  aboral  side  of  the  smaller  disk  of  the  male  is 
covered  with  scales  that  are  less  reduced  in  size  and  number 
than  those  of  the  female  (Fig.  2C).  The  lateral  arm  plates  of 


DEVELOPMENT  OF  A  DIMORPHIC  OPHIUROID 


27 


Figure  1.  Male  and  female  of  Ophiodaphne  formula  and  their  host,  Astriclypeits  mamu.  (A)  Magnified  view 
of  the  female  paired  with  a  much  smaller  male  of  O.  fonnata.  both  detached  from  the  host  shown  in  C.  Note  the 
dwarf  male  (short  arrow),  with  his  oral  surface  against  that  of  the  larger  female  (long  arrow  I,  and  his  arms 
(arrowheads)  alternating  with  hers.  Views  of  the  female  and  male  are  oral  and  aboral,  respectively.  (B)  Aboral 
view  of  a  sand  dollar,  A.  manni.  Arrow  indicates  a  lunule.  (C)  Female  specimen  of  O.fonnata  carrying  a  dwarf 
male  close  to  the  lunule  on  the  oral  side  of  A.  manni.  Note  her  position,  with  two  arms  (arrows)  hooked  over 
the  edge  of  the  lunule.  (D)  Aboral  view  of  the  female.  The  body  of  the  male  is  hidden  by  the  female,  but  the 
tips  of  two  of  his  arms  (arrowheads)  are  visible.  (E)  Horizontal  section  of  a  male  specimen  of  O.  fonnata  with 
mature  sperm  (arrows)  in  a  pair  of  testes  situated  at  the  interradius.  The  space  above  the  testes  is  a  body  cavity 
(BC)  near  the  stomach  (S).  (F)  Compressed  ovary  rilled  with  ova  (OO)  with  germinal  vesicle  (arrows).  Scale 
bars:  3  cm  (B),  3  mm  (C.  D),  1  mm  (A),  and  100  ^im  (E.  F). 


males  have  4  spines,  whereas  those  of  females  have  8. 
Females  possess  grooves  on  their  radial  shields  and  disk 
scales  of  the  disk  (Fig.  2D,  E)  and  tentacle  scales  on  the  oral 
side  of  the  arm,  while  males  do  not  (Fig.  2F,  G). 


In  contrast  to  the  sexual  dimorphism  in  adults,  recently 
metamorphosed  juveniles,  whose  disks  are  about  400  /urn  in 
diameter,  do  not  vary  morphologically  among  individuals. 
However,  the  smallest  specimen  collected  on  a  sand  dollar 


28 


Mini.yi'KI    I'OMIN  A(i.\    /./    M. 


J;^--aVTS;»'-s«!  *  >  •- 
-v^v  -••J..!iM.-:«;^;:.-^  i 


Figure  2.  Skeletal  structures  of  Ophimhiplmc  fiirimitn.  A-K  are  scanning  electron  micrographs.  (A)  Adult 
female  jaw  in  an  interradius;  oral  view.  Components:  an  oral  shield  (OS),  two  udoral  shields  (AS),  two  oral  plates 
(OP),  and  a  loolh  (T).  BS.  buccal  scale.  (B)  Adult  male  jaw  in  an  inlerradius;  oral  view.  Components  of  the  jaw 
are  the  same  as  in  female,  hut  compare  structures.  IP.  inlradenlal  papilla;  other  abbreviations  as  in  (A).  (C) 
Aboral  skeletal  system  of  an  adult  male  detached  Irnm  the  host.  Note  that  the  disk  is  covered  with  scales:  a 
central  plate  (arrowhead),  live  radial  plates  (short  arrows),  live  pairs  of  radial  shields  (long  arrows),  and  others. 
(D)  Aboral  view  nl  grooves  (arrow  heads  I  on  the  radial  shields  (RS)  of  a  female.  (E)  Grooves  on  the  radial  shields 
(RS)  and  the  disk  scale  ( asterisk!  ol  a  teniale  at  high  magnilication.  I F)  Oral  view  of  tentacle  scales  (arrowheads  i 
mi  the  arm  ol  a  lemale.  (G)  Oral  view  ot  the  arm  of  a  male  Note  absence  ol  tentacle  scales.  (H)  Aboral  skeletal 
system  ol  a  \oiing  male  brittle  star  detached  from  the  host.  Note  ihe  cenlral  plate  (arrowhead)  and  five  radial 
plates  (aiiowsi  on  Ins  disk  ill  Oral  view  of  metamorphosing  ophiopluteus  wuh  juvenile  mouth  formation  and 
postero-laieral  arm  (PI. A).  Oral  tube  feet  (arrowheads!  are  visible  around  the  mouth,  and  tube  feet  (arrows)  are 
more  distal.  (Jl  Central  plate  (CPl  and  Ihe  radial  plates  (RP)  of  a  newly  metamorphosed  juvenile.  Ahoral  view, 
i  K)  ( lial  \iew  ol  |.iws  consisting  ol  oral  plates  (OP),  dental  plates  (DP),  and  tooth  (T).  BS  indicates  buccal  scale. 
Same  siage  as  in  .1.  Scale  bais:  50(1  Mm  (11.  !•),  200  /im  Ui).  Mill  /jm  (A,  C.  I..  H).  and  30  ;um  (B.  I-K) 


DEVELOPMENT  OF  A  DIMORPHIC  OPHIUROID 


29 


from  the  field  (disk  diameter  480  jam)  exhibited  male  char- 
acteristics in  the  ossicle  of  the  jaw  and  skeletal  elements  of 
the  disk  (Fig.  2H).  The  disk  diameter  of  the  smallest  female 
specimen  collected  from  the  field  was  already  1.0  mm. 
These  observations  suggest  that  size  differences  corre- 
sponding to  sexual  dimorphism  first  appear  in  individuals 
with  disk  diameters  of  about  500  /urn  (males)  and  1  mm 
(females). 

Gonadal  development  and  spawning 

Sex  in  O.  formata  is  distinguished  by  the  color  of  the 
gonads  upon  dissection;  the  testes  are  creamy  white,  and  the 
ovaries  are  pale  pink.  The  gonads  of  both  males  and  females 
were  largest  in  specimens  collected  in  August.  Sections  of 
gonad  show  that  the  testes  are  occupied,  in  early  August, 
with  numerous  mature  sperm  (Fig.  IE),  while  the  ovaries 
contain  numerous  oocytes,  many  of  them  fully  grown  and 
with  a  germinal  vesicle  (Fig.  IF).  Later  in  August,  after 
spawning,  the  ovaries  are  still  large,  but  they  contain  no 
fully  grown  oocytes,  and  the  center  of  the  organ  is  occupied 
by  a  wide  cavity,  indicating  degeneration.  In  October  and 
December,  the  ovaries  are  smaller  than  in  August.  Though 
ovaries  examined  from  January  to  May  remain  small,  they 
are  rilled  with  developing  oogonia  and  a  few  oocytes. 
Spawning  in  the  laboratory  begins  when  a  paired  female 
raises  her  disk  from  the  bottom  of  the  glass  vessel  to  assume 
a  shedding  posture.  The  eggs  and  sperm  are  shed  into  each 
bursa,  and  are  released  outside  through  the  genital  slits  at 
the  base  of  the  arms.  The  release  is  immediately  followed  by 
external  fertilization. 

We  did  not  attempt  to  observe  spawning  in  the  field. 
However,  our  histological  study  of  gonadal  development — 
and  our  observation  that  eggs  fertilized  in  August  (but  not  in 
June,  July  or  October)  completed  metamorphosis  and  de- 
veloped into  juveniles — all  suggest  that,  in  Tsuruga  Bay,  the 
breeding  season  for  O.  formula  occurs  during  August. 

Development 

Earl\  development.  Fertilized  eggs  are  spherical,  about 
90  /LUII  in  diameter,  pale  pink,  and  negatively  buoyant  (Fig. 
3 A).  They  have  a  transparent,  nonsticky  fertilization  enve- 
lope, and  a  translucent,  thick  (10  /am)  hyaline  layer.  A 
chronology  of  development,  from  fertilized  egg  to  juvenile, 
is  presented  in  Table  1.  The  cleavage  is  total,  equal,  and 
radial.  At  about  26  °C,  the  first  division  occurs  at  2  h  after 
fertilization,  and  as  divisions  continue  (Fig.  3B),  the  em- 
bryos develop  into  blastulae  (Fig.  3C).  These  blastulae  are 
not  wrinkled,  unlike  those  of  two  other  ophiuroids  (Ophio- 
tliri.\  oerstedi  and  Ophionereis  schayeri)  and  members  of 
other  echinoderm  classes  (Mladenov,  1979;  Henry  et  <//., 
1991;  Chia  et  al.,  1993;  Selvakumaraswamy  and  Byrne, 
2000;  Komatsu  et  ai.  2000).  Nine  hours  after  fertilization, 
the  blastula  hatches  from  the  fertilization  envelope  (Fig. 


3D),  and  primary  mesenchyme  cells  in  the  vegetal  pole  wall 
are  set  free  into  the  blastocoel  (Fig.  3E).  At  this  stage, 
blastulae  in  culture  swim  actively  just  beneath  the  water's 
surface.  They  become  oval  (180  /urn  long  and  120  jam 
wide);  and  12  h  after  fertilization,  gastrulation  occurs  by 
invagination  at  the  vegetal  pole.  During  gastrulation,  the 
embryo  flattens  dorso-ventrally  (Fig.  3F). 

Ophiophtteiis  singe.  Twenty  hours  after  fertilization,  in 
the  gastrula  stage,  the  larval  spicules  begin  to  take  a  tetra- 
radiate  form  (Fig.  3G,  H).  Then  a  pair  of  right  and  left 
coelomic  pouches  is  formed  on  both  sides  of  the  tip  of  the 
archenteron.  Figure  31  shows  an  early  2-armed  ophioplu- 
teus,  35  h  after  fertilization,  taking  the  shape  of  a  helmet  as 
the  postero-lateral  arms  appear.  The  antero-lateral  arm  buds 
are  evident  60  h  after  fertilization  (Fig.  3J).  In  this  early 
4-armed  ophiopluteus.  the  archenteron  has  differentiated 
into  a  functional  digestive  tract;  esophagus  and  stomach 
(Fig.  3J). 

From  the  2-armed  to  the  4-armed  stage,  two  pair  of 
recurrent  rods  arise  successively,  running  parallel  to  the 
body  rods  (Fig.  3K).  These  recurrent  rods  extend  to  the 
center  of  the  larval  basket-like  structure  from  paired  points 
of  divergence,  and  the  body  rods  also  arise  from  these  points 
(DP  in  Fig.  3K).  Thus,  these  recurrent  rods,  together  with 
the  body  rods  and  transverse  rods,  constitute  a  bilateral, 
threefold  skeletal  structure.  Immediately  after  the  postero- 
lateral,  antero-lateral,  and  body  rods  form,  the  post-oral  rods 
also  appear,  and  the  postero-lateral  rods  extend  horizontally 
and  support  the  postero-lateral  arms. 

Four  and  a  half  days  after  fertilization,  the  post-oral  arms 
are  formed,  and  the  ophioplutei  develop  to  the  6-armed 
stage  (Fig.  4A).  Six  and  a  half  days  after  fertilization,  they 
become  8-armed  ophioplutei,  bearing  a  4th  pair  of  arms,  the 
postero-dorsal  arms  (Fig.  4C).  At  this  stage,  both  the  right 
and  left  coelomic  pouches,  the  latter  of  which  is  further 
developed  than  the  former,  are  divided  into  anterior  and 
posterior  sections  on  each  side  (Fig.  3L). 

The  body,  the  postero-lateral,  the  antero-lateral,  the  post- 
oral,  and  the  postero-dorsal  rods  are  not  fenestrated  and 
have  no  thorns.  The  length  of  the  postero-lateral  arm  in  the 
largest  8-armed  ophiopluteus  larvae  is  about  700  /am,  and 
the  postero-lateral  rod  is  a  spiral  structure  in  the  middle  of 
this  arm  (Fig.  4C).  These  larval  arm  rods  serve  as  flotation 
devices,  and  are  absorbed  as  metamorphosis  proceeds.  Late 
8-armed  ophioplutei  have  neither  ciliary  epaulets  nor  vibra- 
tile  lobes.  The  left  posterior  coelomic  pouch  is  divided  into 
a  hydrocoel  and  somatocoel,  and  the  former  expands  for- 
ward, gradually,  along  the  stomach  and  esophagus,  produc- 
ing a  5-lobed  hydrocoel  (Fig.  3M,  N  and  4B).  A  hydrocoel 
lobe  forms,  passes  through  the  left  posterior  coelomic 
pouch,  and  migrates  around  the  esophagus  of  the  8-armed 
ophiopluteus  larva  just  before  the  beginning  of  metamor- 
phosis. After  migrating  and  surrounding  the  esophagus  for 
about  a  day,  the  5-lobed  hydrocoel  develops  into  the  water 


30 


HIDEYUKI  TOMINAGA  ET  AL 


H 


VT  I 


N 

Figure  3.  Early  development  of  Ophiodaphne  formula.  (A-N  and  P  are  light  micrographs;  O  is  a  polarized 
light  micrograph.!  (A)  Fertilized  egg  surrounded  by  the  fertilization  envelope  (FE)  and  hyaline  layer  (HLl.  (B) 
Four-cell  stage.  2.5  h  after  fertilization.  (Cl  Bhistula  with  hlastocoel  (BC).  6.2  h  after  fertilization.  (D)  Hatching 
hlastula.  9  h  after  fertilization.  Note  fertilization  envelope  (FE).  (E)  Swimming  blastula.  (F)  Gastrula.  21  h  after 
fertilization.  Arrow  indicates  the  archenteron.  (G)  Tetraradiate  spicule  (arrow)  in  gastrula  at  high  magnification. 
(H)  A  pair  of  tetraradiate  spicules  (arrows)  in  a  compressed  gastrula;  later  stage  than  that  shown  in  G.  (1)  Early 
2-armed  ophiopluleus.  1.5  d  after  fertilization.  (J)  Early  4-armed  ophiopluteus  with  the  antero-lateral  arm  buds 
(arrowheads),  esophagus  (E),  and  stomach  (S).  2.5  d  after  fertilization.  (K)  Magnified  view  of  skeletal  structure 
ot  late  4-armed  ophiopluteus.  Two  pairs  of  recurrent  rods  (RR|  run  parallel  to  the  body  rod  (BR).  and 
perpendicular  to  the  transverse  rods  (TR).  from  the  diverging  points  (DP).  The  postero-lateral  rod  (PLR)  and 
antero  lateral  rod  (ALR)  also  arise  from  the  diverging  points.  (L)  Magnified  view  ot  esophagus  (E)  and  stomach 
(Si  in  an  8-armed  ophiopluteus.  The  right  and  left,  anterior  (RA.  LA)  and  posterior  (RP.  LP)  coelomic  pouches 
are  indicated.  Oral  view.  (M)  Late  S-armed  ophiopluteus  with  hydrocoel  (HC)  along  the  stomach  (S)  and 
esophagus  lE).  Orange  structures  are  antero-lateral  rod  (ALR)  and  postero-dorsal  rod  (PDRl.  Ahoral  view.  (N) 
S-armed  ophiopluteus,  more  advanced  than  that  shown  in  (Ml,  with  live-lohed  hydrocoel  (arrowheads)  beside 


DEVELOPMENT  OF  A  DIMORPHIC  OPHIUROID 


31 


Table  1 

Chronnlng\  of  development  <>/  Ophiodaphne  formata  (26    O 


Time  after 
fertilization 


Stage 


2  h  2-ceII  stage 
2.5  h  4-celI  stage 

3  h  8-cell  stage 
3.5  h  Id-cell  stage 

5  h  Morula 

6.2  h  Blastula  with  blastocoel 

')  h  Hatching 

21  h  Gastrula.  140  /jm  long  and  120  juni  wide 

1.5J  2-armed  ophiopluteus 

2.5  d  4-armed  ophiopluteus 

4.5  d  6-arnied  ophiopluteus 

6.5  d  8-armed  ophiopluteus  with  posterior  coelom 

13.5  d  Hydrocoel  formation 

15.5  d  Lett  hydrocoel  5-lobed 

18.5  d  Rudiments  of  adult  skeleton  appear  as  spicules 

20.5  d  Metamorphic  climax  begins,  larval  arm  degenerates 

rapidly 

21.5  d  Completion  of  metamorphosis  with  absorption  of 
larval  arms 


vascular  system.  The  6-armed  and  8-armed  ophioplutei 
have  a  mass  of  pigment  cells  including  pigment  granules, 
brownish  and  deep  reddish,  at  the  tips  of  the  postero-Iateral 
arms. 

Metamorphosis.  Eighteen  and  a  half  days  after  fertiliza- 
tion, the  adult  plates  begin  to  form  as  fine  spicules  (Fig.  3O). 
These  spicules  correspond  to  the  rudiments  of  the  five 
terminal  plates  and  large  radial  plates  with  a  dorso-central 
plate.  At  this  stage,  the  stomach  and  intestine  are  greenish. 
In  the  8-armed  ophiopluteus.  20  days  after  fertilization,  the 
tip  of  the  postero-Iateral  arms  begin  to  swell,  and  the  antero- 
lateral  arms  cross  (Fig.  4C).  Absorption  of  the  post-oral  and 
postero-dorsal  arms  begins  21  days  after  fertilization  (Fig. 
4D).  Absorption  of  the  left  antero-lateral  arm  occurs  and  is 
followed  by  a  decrease  in  the  size  of  the  right  antero-lateral 
arm.  Toward  the  end  of  metamorphosis,  the  left  antero- 
lateral  arm  becomes  much  shorter  than  the  right  (Fig.  4E). 
The  disk  consists  of  small  spicules  that  develop  as  a  skeletal 
network  (Fig.  3P).  The  spicules  that  will  differentiate  to 
become  terminal  and  radial  plates  will  migrate  and  will  be 
situated  at  the  tip  of  the  arm  and  the  margin  of  the  disk.  The 
metamorphosing  larva  is  furnished  by  the  rudimentary 
ophiuroid  with  a  mouth,  paired  oral  tube  feet  and  tube  feet; 
and  it  frequently  creeps  along  the  bottom  (Fig.  21). 


Twenty-one  and  a  half  days  after  fertilization,  metamor- 
phosis is  complete,  and  the  left  postero-Iateral  arm  is  ab- 
sorbed, followed  by  the  right  (Table  1.  Fig.  4F).  Immedi- 
ately after  metamorphosis,  the  juveniles  are  pentagonal  with 
short  arms  and  spines  (Fig.  4G).  These  paired  short  spines 
between  the  arms  disappear  as  the  juveniles  grow  (Fig.  1  D. 
2C).  Newly  metamorphosed  juveniles  are  about  270  ;u,m  in 
disk  diameter.  They  bear  a  terminal  tentacle  in  the  tip  of 
each  arm.  On  their  aboral  side,  a  central  plate  is  situated  in 
the  center  of  the  disk,  surrounded  by  five  radial  plates  (Fig. 
2J).  On  the  oral  side,  rudiments  of  five  jaws  begin  to  form 
(Fig.  2K).  At  this  stage,  the  external  morphology  of  skeletal 
elements  does  not  vary  among  specimens. 

After  a  period  of  45  days  (post-fertilization),  the  juveniles 
grow  to  approximately  400  ju.m  in  disk  diameter,  and  are 
brown.  They  have  five  arms,  each  130  /am  long,  consisting 
of  one  segment  and  a  terminal  plate  (Fig.  4H).  Although 
more  than  200  juveniles  survived  in  the  laboratory  for  about 
2  months  after  fertilization,  they  did  not  differentiate  further 
and  eventually  died.  One  specimen  collected  from  the  nat- 
ural habitat  on  14  January  2002  was  480  /urn  in  disk  diam- 
eter (Fig.  2H).  It  possessed  about  1 1  segments  in  each  of  its 
arms,  which  were  approximately  1.6  mm  long.  We  estimate 
that  this  field  specimen  was  about  5  months  old. 

Discussion 

We  have  described  here,  for  the  first  time,  the  develop- 
ment— from  spawning  and  fertilization  through  metamor- 
phosis— of  the  sexually  dimorphic  ophiuroid  Ophiodaphne 
formata.  The  pattern  of  development  in  O.  formata  is  in- 
fluenced by  four  characteristics.  The  egg  is  small,  which  is 
consistent  with  the  observed  indirect  development  through  a 
planktotrophic  ophiopluteus.  However,  the  formation  of  tet- 
raradiate  larval  spicules  and  the  absence  of  a  secondary 
vitellaria  larva  are  features  that  tend  to  reduce  the  time  to 
metamorphosis.  Finally,  the  ciliated  postero-Iateral  arms  are 
retained,  which  may  provide  the  juvenile  brittle  star  with 
mobility  for  a  brief  presettlement  exploration  of  the  sub- 
strate. This  suite  of  developmental  characteristics  is  in  ac- 
cord with  the  novel  natural  history  of  O.  formata.  in  which 
a  dwarf  male  and  a  female  are  coupled  and  attached  to  the 
oral  surface  of  the  sand  dollar  Astriclypeus  manni.  mostly 
adjacent  to  the  lunule. 

Methods  of  inducing  spawning  in  ophiuroids — except  for 
a  sudden  change  in  water  temperature  reported  for  Ani- 
phiplwlis  kochii  by  Yamashita  ( 1985) — are  not  as  precise  or 


esophagus  (E)  and  upper  part  of  stomach  (S).  15.5  d  after  fertilization.  Aboral  view.  (O)  Skeletal  system  of  late 
8-armed  ophiopluteus  (polarized  light  micrograph).  Postero-Iateral  rods  (long  arrows):  riidimental  radial  plates 
(short  arrows);  terminal  plates  (arrowheads).  Aboral  view.  (P)  A  pair  of  postero-Iateral  rods  I  arrows)  of  a 
metamorphosing  ophiopluteus,  compressed.  Note  the  skeletal  network  for  the  resulting  juvenile.  Oral  view.  Scale 
bars:  100  /am  (N.  O.  P).  50  /urn  (J.  L).  and  30  /urn  (A-I.  K.  M). 


32 


HIDEYUKI  TOMINAGA  ET  AL 


Figure  4.  Development  of  Oplumlapluu-  luriiiutti.  (A)  Early  6-armed  ophiopluteus.  4.5  d  after  fertilization. 
Long  arrows  indicate  the  postern-lateral  amis,  and  short  arrows,  the  post-oral  arms.  Oral  view.  (B)  Histological 
longitudinal  section  (4  /j,m)  of  an  S-armed  ophiopluteus  showing  the  hydrocoel  (HC)  and  somatocoel  (SC).  Same 
stage  as  shown  in  Figure  3N.  Aboral  view.  (C)  Metamorphosing  ophiopluteus;  oral  view.  Note  the  swollen  tip 
of  the  postero-luteral  arms  (PLA),  the  crossed  antero- lateral  arms  (ALA),  and  the  spiral  construction  of  the 
pnstero-lateral  rods  (arrowheads!  ill  I  )  Successne  stages  of  resorption  of  the  larval  arms.  (D)  Magnified  aboral 
view  of  the  oplmmiid  rudiment,  showing  luhe  feet  (arrowheads).  The  rudiment  is  within  the  metamorphosing 
ophiopluteus.  which  has  a  pair  of  posiero-lateral  arms  (PLA)  and  reduced  post-oral  and  postern-dorsal  arms 
(allows)  (Ei  Metamorphosing  nplnopluleus  with  a  right  anlero-lateral  arm  (ALA)  and  other  reduced  larval  arms 
(arrows)  hanging  on  pnslern-lateral  aims  iPl.A).  Ahnral  \  lew  nl  the  rudiment.  (F)  Metamorphosing  ophiopluteus 
wilh  a  shorter  lell  postero-lateral  arm  (arrow)  than  right.  20.5  d  alter  fertilization.  Ahoral  view.  (G)  Juvenile  just 
.ill.  i  Mictainoiphosis  with  terminal  plates  (long  arrows),  spines  (short  arrows),  and  tube  leet  I. mow  heads),  21.5  d 
after  teitih/alion  Aboral  view.  (H)  Juvenile  with  arm  segments  (arrows).  Arrowheads  indicate  terminal  plates. 
Aboral  view.  Scale  hais:  1(10  jjin  (C.  F..  F.  II).  and  50  /urn  (A.  B.  D,  G). 


DEVELOPMENT  OF  A  DIMORPHIC  OPHIUROID 


33 


reliable  as  those  known  for  echinoids  or  asteroids  (Strath- 
mann  and  Runirill,  1987).  Fortunately,  however,  O.  formula 
spawns  spontaneously  in  the  laboratory,  so  the  entire  pro- 
cess of  development,  from  fertilized  eggs  to  juveniles,  has 
been  observed  in  this  study.  The  entire  process  has  been 
observed  in  several  other  species:  Ophiothrix  frugilis, 
Ophiocoma  nigra.  Ophiop/iolis  acidcuta,  Ophiocomu 
pnmila,  and  A.  kochii  (MacBride,  1907;  Narasimhamurti, 
1933;  Olsen,  1942;  Mladenov,  1985;  Yamashita,  1985),  but 
none  of  these  is  a  sexually  dimorphic  species.  This  study, 
therefore,  is  the  first  demonstration  of  a  sexually  dimorphic 
ophiuroid,  developing  through  a  typical  ophiopluteus  stage, 
and  then  into  an  8-armed  planktotrophic  larva. 

The  mature  ova  of  O.  formula  are  90  jum  in  diameter, 
similar  in  size  to  those  of  O.  fragilis,  O.  nigm,  and  A,  kochii 
(MacBride.  1907;  Narasimhamurti,  1933;  Yamashita. 
1985).  Mladenov  (1979)  summarized  the  quantitative  char- 
acteristics of  developmental  patterns  in  ophiuroids  and 
noted  that  species  with  small  eggs  (70-200  /urn  in  diameter) 
undergo  planktotrophic  development  and  require  12-40 
days  to  reach  metamorphic  competence.  In  the  present 
study,  O,  formata  completed  metamorphosis  within  21.5 
days  at  26  °C  and  thus  fits  the  categorization  of  Mladenov 
(1979),  as  do  O.  fragilis,  O.  nigm,  and  A.  kochii.  Of  these 
species,  O.  frugilis  and  O.  nigra  occur  in  relatively  deep 
waters,  whereas  A.  kochii  is  found  under  stones  in  the 
intertidal  zone,  along  the  Pacific  coast  of  northern  Japan, 
and  O.  formata  inhabits  the  sandy  bottom,  5  m  deep,  at 
Tsuruga  Bay.  A  rapid  metamorphosis  should  be  advanta- 
geous to  the  shallow-water  brittle  stars,  O.  formula  and  A. 
kochii,  for  it  would  prevent  dispersal  to  less  advantageous 
deep  habitats.  In  the  case  of  the  reproductive  pairs  of  O. 
formata,  which  always  live  on  a  host  sand  dollar  on  the 
shallow  sandy  bottom,  the  requirement  for  rapid  metamor- 
phosis may  be  especially  important. 

Hyman  (1955)  generalized  that  an  early  ophiopluteus  is 
furnished  with  a  three-rayed  skeletal  rod,  and  Olsen  ( 1942) 
and  Strathmann  and  Rumrill  (1987)  reported  this  condition 
in  Amphipholis  si/iiamata  and  O.  aculcata,  respectively. 
However,  the  present  study  reveals  that  the  initial  shape  of 
the  larval  spicules  in  O.  formata  is  tetraradiate,  as  in  Am- 
phiura  chiajci,  Amphioplus  ahditus,  A.  kochii,  and  O.  schay- 
eri  (Fenaux,  1963;  Hendler.  1978;  Yamashita.  1985:  Selva- 
kumaraswamy  and  Byrne,  2000).  Therefore,  the  rudiments 
of  the  skeletal  rods  in  the  ophiopluteus  can  form  in  two 
ways:  triradiate  or  tetraradiate.  The  accelerated  formation  of 
tetraradiate  spicules  in  the  gastrula  stage  may  reduce  the 
time  to  metamorphosis  and  thus  contribute  to  the  rapid 
embryonic  development  in  O.  formata. 

At  settlement,  ophioplutei  generally  release  their  postero- 
lateral  arms  (Olsen,  1942;  Byrne  and  Selvakumaraswamy, 
2002).  In  O.  formata,  however,  the  four  pairs  of  larval  arms 
are  not  discarded,  but  rather  absorbed — first  the  post-oral 
and  postero-dorsal  arms,  and  then  the  antero-lateral  and 


postero-lateral  arms.  Thus,  the  report  of  Balser  ( 1998).  that 
the  released  arms  of  an  ophiopluteus  can  regenerate  all  the 
structures  typical  of  the  primary  ophiopluteus,  and  that 
asexual  reproduction  of  larval  arms  may  be  highly  adaptive 
for  life  in  the  open  ocean,  does  not  apply  to  O.  formula. 

Ophiuroids  live  in  all  seas,  in  all  types  of  sediment,  and 
at  all  depths — from  the  intertidal  zone  to  the  abyssal  region. 
Among  these  species,  only  O.  formata  is  found  on  sand 
dollars,  such  as  A.  nninni  (Tominaga,  2001,  and  present 
materials),  Clvpeaster  rcticnlatns  (Irimura,  1981),  and  C. 
japonicus  (Tominaga.  unpubl.);  and  these  host  organisms 
are  always  in  shallow  waters,  partially  buried  in  the  sandy 
bottom.  In  this  study,  the  ophiuroids  were  never  found  on 
the  sandy  bottom;  rather,  the  much  larger  female,  carrying  a 
dwarf  male  in  a  mouth-to-mouth  position,  is  herself  at- 
tached, by  her  aboral  side,  to  the  oral  surface  of  the  host  A. 
nianni.  The  lunule  of  the  host  may  serve  the  female  ophiu- 
roid as  a  convenient  site  for  attachment,  or  the  concave 
shape  of  the  lunule  may  provide  protection  from  abrasion  by 
the  sand.  Although  we  might  suggest  that  a  radial  food  track 
of  the  sand  dollar,  located  close  to  the  edge  of  the  lunule 
(Fig.  1C),  provides  nutriment  for  the  paired  ophiuroids.  this 
seems  unlikely,  because  paired  and  unpaired  females  on  the 
oral  side  of  the  sand  dollar  always  turn  their  mouths  to  the 
sandy  bottom  to  feed,  not  to  a  radial  food  track.  Probably 
the  association  between  the  male  and  female  and  their 
morphological  specializations  have  evolved  as  an  adapta- 
tion to  ensure  mating  success  on  this  mobile  and  infaunal 
host.  Although  the  pairing  in  O.  formata  is  observed 
throughout  the  year,  including  in  the  nonbreeding  season, 
this  pairing  behavior  is  probably  essential  to  their  reproduc- 
tion, because  spawning  occurs  while  pairing. 

Males  and  females  of  O.  formata  have  a  bursa  on  the  oral 
surface  which  provides  an  opening  for  the  gonad.  Conse- 
quently, the  most  efficient  posture  for  the  male  is  to  inter- 
digitate  his  arms  with  the  larger  female,  mouth  to  mouth, 
while  he  sheds  sperm  from  his  bursal  slits.  The  posture  is 
important  because  the  low  density  of  O.  formula  is  in 
contrast  to  that  of  the  more  common  shallow-water  ophiu- 
roids (Fujita.  1992).  Thus,  fertilization  efficiency  would 
probably  be  low  if  males  and  females  of  O.  formata 
spawned  separately  on  the  sand  and  did  not  pair  on  their 
host.  Probably  O.  formata  selects  A.  manni  as  a  host  that 
provides  a  breeding  site  and  thus  raises  the  level  of  fertil- 
ization success,  as  suggested  by  Hendler  ( 1991 ). 


Acknowledgments 

The  authors  wish  to  express  their  cordial  thanks  to  Mr.  T. 
Hashimoto  and  Mrs.  Y.  Hashimoto  for  their  assistance  with 
field  sampling.  Thanks  are  also  extended  to  Miss  H.  Ya- 
manishi  for  her  cooperation  in  the  developmental  observa- 
tions. They  are  grateful  to  Dr.  S.  Irimura  for  the  identilica- 


34 


HIDEYUKI  TOMINAGA  ET  AL 


tion    of   and    to    Dr.    G.    Henciler    for    information    and 
suggestions  on  Ophiodaphne  fonnata. 

Literature  Cited 

Balser,  E.  J.  1998.     Cloning  by  ophiuroid  echinoderm  larvae.  Biol.  Bull. 

194:  187-143 
Brock,  J.  1888.     Die  Ophiuriden  fauna  des  indischen  Archipels.  Z.  Wiss. 

Zool.  47:  525-527. 
Byrne,  M.,  and  P.  Selvakumaraswamy.  2002.     Phylum  Echinodermata: 

Ophiuroidea.  Pp.  483-498  in  Atlas  of  Marine  Invertebrate  Lan-ae. 

C.  M.  Young,  ed.  Academic  Press,  London. 
Chia,  F.  S.,  C.  Oguro,  and  M.  Komatsu.  1993.     Sea-star  (Asteroid) 

development.  Oceanogr.  Mar.  Biol.  Amni.  Rev.  31:  223-257. 
Delavault,  R.  1966.     Determinism  of  sex.  Pp.  615-638  in  Physiology  of 

Echinodermata,  R.  A.  Boolootian.  ed.  Wiley-Interscience.  New  York. 
Fenaux,   L.   1963.     Note   preliminaire   sur   le  development  larvaire  de 

Amphiiira  chiajei  (Forbes).  Vie  Milieu  14:  91-96. 
Fujita,  T.  1992.     Dense  beds  of  ophiuroids  from  the  Paleozoic  to  the 

recent:  the  significance  of  bathyul  populations.  Otsuchi  Mar.  Research 

Center  Report  18:  25-2 1 . 
Guille,  A.  1981.     Echinoderms:  Ophiurides.  Pp.  435-439  in  Resulrats  des 

Campagnes  MUSORSTOM.  Vol.   1.  Museum  national  d'histoire  na- 

turelle,  Paris. 

Hendler,  G.  1978.     Development  of  /Am/'/""/1''"  abditus  (Verrill)  (Echi- 
nodermata: Ophiuroidea).  II.  Description  and  discussion  of  ophiuroid 

skeletal  ontogeny  and  homologies.  Biol.  Bull.  154:  79-95. 
Hendler,  G.  1991.     Echinodermata:  Ophiuroidea.  Pp.  356-51 1  in  Repro- 
duction of  Marine  Invertebrates,  Vol.  6.  A.  C.  Giese.  J.  S.  Pearse,  and 

V.  B.  Pearse,  eds.  The  Boxwood  Press.  Pacific  Grove.  CA. 
Hendler,  G.  1995.     Class  Ophiuroidea.  Pp.  89-195  in  Sea  Stars,  Sea 

Urchins  and  Allies.  G.  Hendler.  J.  E.  Miller.  D.  L.  Pawson,  and  P.  M. 

Kier,  eds.  Smithsonian  Institute  Press.  Washington  DC. 
Henry,  J.  J.,  G.  A.  Wray,  and  R.  A.  RalT.  1991.     Mechanism  of  an 

alternate  type  of  echinoderm  blastula  formation:  the  wrinkled  blastula 

of  the  sea  urchin  Heliocidaris  erythrogramma.  Dev.  Growth  Differ.  33: 

317-328. 
Hyman,    h.    H.    1955.     Ecltinodermata:    The    Invertebrates,    Vol.    4. 

McGraw-Hill.  New  York.  763  pp. 
Irimura,  S.  1981.     Ophiurans  from  Tanabe  Bay  and  its  vicinity,  with  the 

description  of  a  new  species  of  Ophiocentrus.  Puhl.  Seta  Mar.  Rial. 

Lab.  26:  15-44. 
Irimura,  S.,  T.  Fujita,  and  R.  tlrshiinu.  20(11.     Preliminary  report  on  the 

ophiuroids  (Echinodermatu)  on  the  shelf  off  Shimoda,  south  of  Izu 

Peninsula,  central  Japan  (in  Japanese  with  English  summary).  Mem. 

Nail.  Sci.  Mus.  (Tokyo)  37:  31  1-315. 
Koehler,  R.  1904.     Ophiures  nouvelles  ou  pen  omnues.  Mem.  Soc.  Zool 

I ,.  17:  70-71. 


Kothler.  R.  1905.  Ophiures  littorales.  Siboga  Exped.  Monogr.  45(b): 
1-142. 

Komatsu.  M.,  Y.  T.  Kano,  and  C.  Oguro.  1990.  Development  of  a  true 
ovoviviparous  sea  star,  Asterina  pseudoexigua  pacifica  Hayashi.  Biol. 
Hull.  179:  254-263. 

Komatsu,  M.,  M.  Sewell,  S.  F.  Carson,  and  Fu-Shiang  Chia.  2000. 
Larval  development  and  metamorphosis  of  the  sea  star  Luidea  l»ln>lata 
(Echinodermata:  Asteroidea).  Species  Diversity  5:  155-162. 

Lawrence,  J.  M.  1987.  A  Functional  Biology  of  Echinoderms,  Croom 
Helm,  London,  340  pp. 

MacBride,  E.  W.  1907.  The  development  of  Ophiotliri\  fraxilis.  Q.  J. 
Microsc.  Sci.  51:  557-606. 

Mladenov,  P.  V.  1979.  Unusual  lecithotrophic  development  of  the  Ca- 
ribbean brittle  star  Ophiolhrix  oerstedi.  Mar.  Biol.  55:  55-62. 

Mladenov,  P.  V.  1985.  Development  and  metamorphosis  of  the  brittle 
star  Ophiocoma pumila:  evolutionary  and  ecological  implications.  Biol. 
Hull.  168:  285-295. 

Mortensen,  T.  1933.  Papers  from  Dr.  Th.  Mortensen's  Pacific  Expedi- 
tion 1414-16.  LXIII.  Biological  observations  on  ophiuroids.  with  de- 
scriptions of  two  new  genera  and  four  new  species.  Vidensk.  Medd. 
Dan.  Naturhist.  Foren.  93:  171-144. 

Mortensen.  T.  1936.  Echmoidea  and  Ophiuroidea.  Discov.  Rep.  12: 
199-348. 

Narasimhamurti,  N.  1933.  The  development  of  Ophiocoma  nigra.  Q.  J. 
Microsc.  Sci.  76:  63-88. 

O'LoughlJn,  P.  M.  2001.  The  occurrence  and  role  of  a  digitate  genital 
papilla  in  holothurian.  Pp.  363-368  in  Echinoderms  20Ot>.  M.  Barker, 
ed.  Swet/  and  Zeitlinger,  Lisse,  The  Netherlands. 

Olsen,  H.  1942.  Development  of  the  brittle-star  Ophiopholis  aculeata 
(O.  Fr.  Miiller)  with  a  short  report  on  the  outer  hyaline  layer.  Bergens 
Mus.  Arbok.  Naturvid.  6:  1-107. 

Selvakumaraswamy,  P.,  and  M.  Byrne.  2000.  Vestigial  ophiopluteal 
structures  in  the  lecithotrophic  larvae  of  Ophionereis  schayeri  (Ophiu- 
roidea). Biol.  Bull.  198:  379-386. 

Stohr,  S.  2001.  Amphipholis  linopneusti  n.  sp.,  a  sexually  dimorphic 
amphiurid  brittle  star  (Echinodermata:  Ophiuroidea).  epizoic  on  a  spa- 
tangoid  sea  urchin.  Pp.  317-322  in  Echinoderms  2000,  M.  Barker,  ed. 
Swets  and  Zeitlinger,  Lisse,  The  Netherlands. 

Strathmann,  R.  R..  and  S.  S.  Rumrill.  1987.  Phylum  Echinodermala. 
class  Ophiuroidea.  Pp.  556-573  in  Reproduction  and  Development  of 
Marine  Invertebrates  of  the  Northern  Pacific  Coast,  M.  F.  Strathmann. 
ed.  University  of  Washington  Press.  Seattle. 

Tominagu.  H.  2001.  The  early  development  of  the  brittle  star. 
Ofihiotlaplinc  lormuta  (Koehler).  P.  327  in  Ecliiiiodcrms  2000.  M. 
Barker,  ed.  Swets  and  Zeitlinger.  Lisse.  The  Netherlands. 

Tyler,  A.,  and  B.  S.  Tyler.  1966.  The  gametes:  some  procedures  and 
properties.  P.  642  in  Physiology  of  Echinodermala.  R.  A.  Boolootian, 
ed.  Interscience  Publishers.  New  York. 

Yamashita,  M.  1985.  Embryonic  development  of  the  brittle-star  Am- 
phipholis kocltii  in  laboratory  culture.  Biol.  Hull.  169:  131  142 


Reference:  Biol  Bull  206:  35-45.  (February  2004) 
©  2004  Marine  Biological  Laboratory 


Waveform  Dynamics  of  Spermatozeugmata  During  the 

Transfer  From  Paternal  to  Maternal  Individuals  of 

Membranipora  membranacea 

M.  H.  TEMKIN'  *  AND  S.  B.  BORTOLAMI2 

1  Biologv  Department,  St.  Lawrence  University,  Canton,  New  York  13617;  and  2  Ashton  Graybiel  Spatial 
Orientation  Laboratorv,  Braiuleis  Unirerxitv,  Wait/lain,  Massachusetts  02254 


Abstract.  Analysis  of  standard  (60  frames/s)  and  high- 
speed (200  frames/s)  video  records  revealed  that  unencap- 
sulated  sperm  aggregates  (spermatozeugmata)  of  the 
gymnolaemate  bryozoan  Membranipora  membranacea 
spontaneously  generate  at  least  three  types  of  waveforms: 
small  amplitude,  large  amplitude,  and  reverse.  All  three 
waveforms  significantly  differed  from  one  another  in  am- 
plitude. Additionally,  small-  and  large-amplitude  wave- 
forms propagated  from  the  base  to  the  tip  of  axonemes, 
whereas  the  reverse  waveform  propagated  from  the  tip  to 
the  base  of  axonemes.  Small-amplitude  waveforms,  which 
were  generated  most  frequently  by  spermatozeugmata  in  the 
paternal  perivisceral  coelom  and  in  the  water  column  after 
spawning,  produced  almost  no  curvature  of  the  axoneme. 
Large-amplitude  waveforms  were  produced  by  spermato- 
zeugmata in  the  water  column  and  within  lophophores.  Re- 
verse waveforms  were  produced  while  spermatozeugmata 
moved  tail-end  forward  through  the  paternal  tentacles  dur- 
ing spawning  and  after  spermatozeugmata  had  contacted  the 
intertentacular  organ  (ITO),  a  tubular  structure  that  sperma- 
tozeugmata pass  through  to  enter  the  maternal  coelom  and 
that  eggs  pass  through  to  enter  the  seawater.  The  production 
of  reverse  waveforms  by  spermatozeugmata  after  reaching 
the  ITO  may  be  evidence  for  a  behavioral  response  of 
bryozoan  sperm  to  conspecific  maternal  individuals. 

Introduction 

Fertilization  success  for  many  benthic  marine  inverte- 
brates is  dependent  on  the  transfer  of  sperm  or  an  aggregate 

Received  12  September  2003;  accepted  3  November  2003. 
*  To  whom  correspondence  should  be  addressed.  E-mail:  mtemkinft" 
stlawu.edu 

Abbreviation:  ITO,  intertentacular  organ. 


of  sperm  from  males  to  females  through  the  water  column 
(see  Franzen,  1956,  1998;  Ryland  and  Bishop,  1993).  Sperm 
aggregates  may  be  either  encapsulated  (spermatophores)  or 
unencapsulated  (spermatozeugmata).  The  transfer  of  sperm, 
spermatophores,  or  spermatozeugmata  from  male  to  female 
conspecific  benthic  marine  invertebrates  may  be  influenced 
by  numerous  physical  and  biological  factors.  For  example, 
water  flow,  population  density,  spawning  synchrony,  sperm 
chemoattractants,  gamete  longevity,  and  sperm  motility  are 
all  factors  that  have  been  reported  to  increase  or  decrease 
fertilization  success  by  altering  the  probability  that  sperm 
will  find  maternal  individuals  (see  Ryland  and  Bishop, 
1993;  Levitan.  1995). 

In  species  that  transfer  sperm  from  males  to  females 
through  the  water  column,  fertilization  success  may  ulti- 
mately depend  on  sperm  motility  and  behavior  once  a 
conspecific  female  has  been  approached  or  contacted.  For 
example,  sperm  become  attached  to  external  maternal  struc- 
tures where  they  wait  for  eggs  to  be  spawned,  as  in  some 
sabellid  polychaetes  (e.g.,  Daly  and  Golding,  1977;  Rouse, 
1996)  and  some  bivalves  (e.g.,  6  Foighil,  1985,  1989).  In 
other  species,  sperm  enter  maternal  individuals  to  fuse  with 
eggs  internally,  as  in  some  hydroids  (see  Miller,  1983),  the 
sea  cucumber  Leptosynapta  clarki  (Sewell  and  Chia.  1994), 
the  colonial  ascidian  Diplosoma  lixterianuin  (Bishop  and 
Ryland,  1991;  Burighel  and  Martinucci,  1994a,  b),  pho- 
ronids  (see  Zimmer,  1991 ),  and  the  gymnolaemate  bryozoan 
Membranipora  membranacea  (Temkin,  1994).  Yet  few  ob- 
servations have  been  made  on  how  sperm  attach  to  or  enter 
conspecific  females,  or  on  how  sperm  locate  eggs  prior  to 
fertilization. 

Among  gymnolaemate  bryozoans,  one  of  the  most  de- 
tailed descriptions  of  sperm  transfer  has  been  reported  for 
Membranipora  membranacea  (Temkin,  1994).  Zooids  of 


35 


36 


M.   H.  TEMK1N   AND  S.   B.   BORTOLAMI 


M.  nieiiibriimicen  colonies  typically  are  functionally  simul- 
taneous hermaphrodites,  and  sperm  in  spermatozeugmata 
are  transferred  from  paternal  to  maternal  zooids  through  the 
water  column  (Temkin,  1994).  Like  those  of  other  gymno- 
laemate  bryozoans.  the  spermatogonia  of  M.  membranacea 
migrate  into  the  perivisceral  coelom  from  the  peritoneum  of 
the  body  wall,  or  funiculus  (a  network  of  strand-like  ele- 
ments of  the  circulatory  system),  and  form  syncytial  masses 
of  spermatocytes  around  cytoplasmic  masses  or  cytophores 
(see  Reed,  1991;  Franzen,  1998).  Cells  of  a  cytophore 
disassociate  at  the  end  of  spermiogenesis  in  most  gymno- 
laemates,  but  in  species  such  as  M.  membranacea.  sperm 
remain  together,  adhering  to  one  another  to  form  a  sperma- 
tozeugma. 

Gymnolaemate  spermatozeugmata  are  aggregates  of  32 
or  64  euspermatozoa  in  which  the  cells  are  arranged  parallel 
to  one  another  in  a  hexagonal  array,  with  all  the  heads  at  one 
end  of  the  aggregate  and  all  of  the  tails  at  the  other  (Bon- 
nevie,  1907;  Franzen,  1956.  1998;  Zimmer  and  Woollacott, 
1974)  (Fig.  1).  Spermatozeugmata  of  gymnolaemate  bryo- 
zoans are  held  together  by  viscomechanical  forces  that 
tightly  adhere  sperm  to  one  another  along  the  head  region, 
the  tail-end  half  of  the  midpiece  region,  and  almost  all  of  the 
tail  region  (see  Franzen,  1956,  1998;  Temkin,  1994).  The 


AMTR 


TT 


-  I.  Diltcrcnlial  inlcrlerenci-  contrast  image  of  u  partial!)  disas- 
.1.  i.H.'d  spennatozcugnw  adhcimg  in  a  glass  slide.  The  head-end  hall  ot 
the  spermato/eugnia  consists  ol  the  elongate  head  regions  (H)  thai  are 
adhering  to  one  another  and  the  iionadhcring  portions  of  the  midpiece 
regions  (NAMR|.  The  tail-end  hall  'consists  ol  the  adhering  portions  ol  the 
midpiece  and  tail  regions  I  AMTR)  and  the  tips  ol  the  kills  (TT).  Sperm  that 
ha\c  become  partially  disassociated  Irom  Ihe  aggicgalc  gcnciale  a  variety 
ol  waxclortns.  Scale  bar  \2  ;uin 


two  regions  of  a  spermatozeugma  where  sperm  do  not 
adhere  to  each  other  are  the  head-end  half  of  the  midpiece 
and  the  tip  of  the  tail  (Fig.  1 ). 

Sperm  of  M.  membranacea  within  spermatozeugmata 
generate  waveforms,  and  movements  of  the  midpiece  re- 
nions  may  produce  some  of  the  motive  forces  required  for 
both  spawning  and  entry  into  maternal  individuals  (Temkin. 
1994).  Spermatozeugmata  of  M.  membranacea  are  motile  in 
the  paternal  coelom,  like  sperm  of  other  gymnolaemate 
bryozoans  (Marcus,  1938;  Silen,  1966;  Zimmer  and  Wool- 
lacott, 1974;  Temkin,  1994).  Prior  to  spawning,  spermato- 
zeugmata of  M.  membranacea  become  positioned  in  the 
perivisceral  coelom  between  the  body  wall  and  the  disto- 
medial  side  of  the  pharynx,  so  that  their  tail  ends  are 
oriented  toward  the  pore  leading  into  the  lophophoral  coe- 
lom of  the  two  distomedial  tentacles  (Temkin.  1994).  Cilia 
located  near  the  pore  may  help  spermatozeugmata  enter  the 
lophophoral  coelom  of  the  distomedial  tentacles  (R.  Zim- 
mer, University  of  Southern  California,  pers.  comm.).  Sper- 
matozeugmata move  through  the  two  distomedial  tentacles. 
emerging  tail-end  first  into  the  exhalant  feeding  currents  of 
colonies.  During  their  passage  through  the  tentacle  lumen, 
spermatozeugmata  appeared  to  be  pushed  by  waveforms 
produced  in  the  midpiece  region  (Temkin,  1994). 

In  the  laboratory,  spermatozeugmata  become  quiescent 
after  they  are  spawned,  until  they  are  drawn  into  the  loph- 
ophores  of  conspecifks  by  colony  feeding  currents 
(Temkin.  1994).  Spermatozeugmata  retained  within  the 
lophophores  of  conspecifics  often  produce  strong  undula- 
tory  movements  in  the  midpiece  region  (Temkin.  1994). 
While  in  the  lophophore,  spermatozeugmata  may  move 
headfirst  into  maternal  individuals  through  the  intertentacu- 
lar  organ  (1TO).  The  ITO  is  a  tubular  secondary  sex  struc- 
ture formed  by  the  basal  fusion  of  the  two  distomedial 
tentacles  (see  Silen.  1966;  Reed,  1991 ).  The  ITO  serves  not 
only  as  the  entry  organ  for  spermatozeugmata.  but  also  as 
the  spawning  organ  for  eggs  (e.g.,  Silen,  1966;  Temkin. 
1994).  Temkin  (1994)  reported  that  spermatozeugmata  that 
entered  the  distal  pore  of  the  ITO  appeared  to  stop  their 
undulatory  movements  and  were  drawn  into  the  ITO.  After 
entering  maternal  individuals,  sperm  of  a  spermatozeugma 
disassociate  and  migrate  to  the  surface  of  the  ovary,  al- 
though the  exact  sequence  of  these  two  events  is  uncertain. 
In  M.  membranncca.  sperm-egg  fusion  occurs  during  or 
shortly  after  ovulation  and  is  monospermic  (Temkin,  1994). 

In  this  paper,  we  compare  the  waveforms  generated  by 
sperniato/eusinuita  of  A/,  membranacea  within  the  paternal 
cocloms  (perix  isceral  and  lophophoral).  in  seawater  alter 
spawning,  and  within  the  lophophores  of  conspecifics.  We 
describe  three  types  of  waveforms  (small  amplitude,  large 
amplitude,  and  reverse)  that  are  spontaneously  generated  by 
spermalo/eugmala  of  M.  membranacea  during  the  transfer 
of  aggregates  from  paternal  to  maternal  /ooids.  In  addition. 


SPERMATOZEUGMATA  WAVEFORM   DYNAMICS 


37 


we  relate  the  functional  significance  of  the  waveforms  to  the 
structure  of  spermatozeugmata  and  to  sperm  transfer. 

Materials  and  Methods 

Colonies  of  Membranipora  membranacea  Linnaeus, 
1767,  were  collected  from  waters  near  the  Friday  Harbor 
Laboratories  (FHL),  San  Juan  Island,  Washington,  and 
the  Darling  Marine  Center  (DMC).  Walpole.  Maine  (for  a 
phylogeographic  analysis  of  these  populations,  see 
Schwaninger,  1999).  The  movements  of  spermatozeugmata 
within  paternal  coeloms,  in  seawater  after  spawning,  and 
within  the  tentacle  crown  of  maternal  lophophores  were 
videorecorded.  Videorecordings  were  made  using  Pana- 
sonic cameras  (60  frame/s)  mounted  on  either  Zeiss  (FHL) 
or  Olympus  (DMC)  research  compound  microscopes.  Some 
M.  membranacea  colonies  collected  at  the  DMC  were  trans- 
ported to  Harvard  University,  where  videorecordings  were 
made  using  an  NAC  HSV-200  video  camera  (200  frames/s) 
mounted  on  a  Zeiss  Photo  III  compound  microscope.  To 
view  spermatozeugmata  within  paternal  coeloms  and  ma- 
ternal lophophores,  we  examined  "one-zooid-row"  prepara- 
tions that  were  placed  on  their  sides  in  small  petri  dishes 
(Temkin,  1994).  To  make  recordings  of  spermatozeugmata 
outside  of  the  paternal  coelom  (seawater),  individual  sper- 
matozeugma  that  had  been  recently  spawned  were  removed 
from  dishes  containing  one-zooid-row  preparations  and 
placed  in  depression  slides  containing  50  to  100  /^l  ot 
0.2-/j,m-filtered  seawater  (FSW)  at  room  temperature. 

Recorded  sequences  were  viewed  frame  by  frame  to 
analyze  the  waveforms  produced  by  spermatozeugmata  dur- 
ing each  trial.  Waveforms  produced  by  spermatozeugmata 
were  distinguished  based  on  waveform  amplitude  and  di- 
rection of  waveform  propagation.  The  amplitudes  of  10  waves 
for  each  of  the  three  recognized  waveforms  were  deter- 
mined using  the  computer  program  Image  Tool  ver.  3.00 
(University  of  Texas,  http://ddsdx.uthscsa.edu/dig/itdesc. 
html),  calibrated  with  an  image  of  a  stage  micrometer,  to 
measure  digitized  images  of  high-speed  video  frames.  Sys- 
tat  6  was  used  to  calculate  an  analysis  of  variance 
(ANOVA).  and  Bonferroni  adjusted  pairwise  comparisons 
were  made  to  determine  statistical  differences  among  wave- 
form amplitudes.  The  frequency  of  wave  generation  was 
measured  in  25  reverse-waveform  events  for  spermatozeug- 
mata within  the  paternal  coelom  and  calculated  as  the  num- 
ber of  waves  per  second.  In  addition,  waveform  patterns 
generated  by  DMC  spermatozeugmata  in  the  paternal  vis- 
ceral coelom  (/?  =  10)  and  in  seawater  after  spawning  (n  = 
10)  were  compared  by  determining  the  frequency  and  du- 
ration of  reverse-waveform  events.  To  be  included  in  the 
comparison,  spermatozeugmata  had  to  have  a  video  record 
of  at  least  20  s.  Event  frequencies  were  calculated  as  the 
number  of  waveform  events  per  minute.  Durations  of  re- 
verse-waveform events  during  an  individual  trial  were  av- 


eraged. Two-sample  ;  tests  were  calculated  using  Systat  6  to 
compare  the  frequencies  and  durations  of  reverse-wavelorm 
events  between  spermatozeugmata  in  the  paternal  coelom 
and  water  column. 


Results 


Waveform  tvpes 


Spermatozeugmata  of  Membranipora  membranacea 
from  both  the  DMC  and  FHL  generated  three  types  of 
waveforms:  small  amplitude,  large  amplitude,  and  reverse. 
The  amplitudes  of  these  waveforms  were  greatest  in  the 
nonadhering  portions  of  the  midpiece  regions  of  spermato- 
zeugmata. The  adhering  portions  of  the  midpiece  and  tail 
regions  showed  no  apparent  curvature  during  the  generation 
of  any  of  the  three  waveforms  (Figs.  2,  3,  and  4).  An 
ANOVA  and  pairwise  comparisons  of  means  revealed  that 
the  amplitudes  of  the  three  waveforms  significantly  differed 
from  one  another  (Table  1 ).  Small-amplitude  waveforms 
consisted  of  waves  with  amplitudes  of  1.9  ±  1.6  /im 
(mean  ±  standard  deviation,  /;  =  10)  that  were  generated 
from  the  base  to  the  tip  of  axonemes  (i.e..  head  to  tail). 
Sperm  within  a  spermatozeugma  typically  produced  small- 
amplitude  waveforms  asynchronously.  Consequently, 
small-amplitude  waveforms  were  difficult  to  observe  unless 
sperm  in  an  aggregate  produced  this  type  of  waveform 
synchronously  (Fig.  2).  Small-amplitude  waveforms  pro- 
duced almost  no  curvature  in  spermatozeugmata  as  waves 
moved  along  axonemes.  Large-amplitude  waveforms  also 
propagated  from  the  base  to  the  tip  of  axonemes  (Fig.  3), 
with  amplitudes  of  11.1  ±  3.0  jam  (n  ==  10).  During  the 
generation  of  large-amplitude  waveforms,  spermatozeug- 
mata undulated  and  rotated  around  their  long  axis.  Reverse 
waveforms  had  amplitudes  of  7.0  ±  2.4  /urn  (n  =  10)  and 
propagated  from  the  tip  to  the  base  of  axonemes  (i.e.,  tail  to 
head)  (Figs.  4  and  5);  that  is.  reverse  waveforms  were 
propagated  along  the  axoneme  in  a  direction  opposite  to  that 
of  small-  and  large-amplitude  waveforms.  During  reverse- 
waveform  events  in  the  paternal  visceral  coelom,  waves 
were  generated  with  a  frequency  of  1 1 .0  ±  0.5  waves/s 
(//  =  25).  The  generation  of  reverse  waveforms  was  dis- 
tinguished by  the  development  of  prominent  bends  near  the 
junctions  of  (1)  the  heads  and  midpieces  and  (2)  the  non- 
adhering  and  adhering  portions  of  midpieces  (Figs.  4  and  5 ). 
The  curvature  in  the  anterior  portions  of  a  spermatozeugma 
during  a  reverse-waveform  event  causes  the  aggregate  to 
bend  over,  giving  a  spermatozeugma  the  distinctive  appear- 
ance of  a  question  mark. 

Location-specific  waveform  generation 

Spermatozeugmata  generated  different  patterns  of  waves 
depending  on  whether  they  were  located  in  the  paternal 
coeloms  (visceral  and  lophophoral),  water  column,  or  ma- 


38 


M.   H.  TEMKIN   AND  S.   B.   BORTOLAMI 


Figure  2.  Synchronous  production  of  a  type  I  waveform  by  Membra- 
ni/j/iru  ini'inhniiuifca  spermalo/eugma  in  seawater  after  spawning,  (a) 
Asynchronous  waveform  production,  (b-fl  Propagation  of  wave  (arrow) 
from  the  base  lo  lip  of  axonemes.  (g)  Wave  enters  region  of  midpiece  in 
which  sperm  are  lightly  adherent  to  each  other  and  is  no  longer  visible. 
Images  are  10  ms  apart.  Dots  indicate  the  propagation  of  the  wave  along 
the  aggregate.  The  lirsl  dot  in  each  series  marks  the  position  of  the  wave 
in  (b).  Scale  bar  =  30  fim. 

ternal  lophophore.  In  the  paternal  visceral  coelom  and  water 
column,  spermato/eugmata  generated  predominantly  the 
small-amplitude  waveform,  with  periodic  reverse-wave- 


I 


Kigure  3.  Generation  ot  a  type  II  waveform  by  Membranipora  mem- 
hranacea  spermatozeugma  in  seawater  after  spawning,  (a)  A  wave  (arrow) 
forming  just  posterior  to  the  heads,  (b-e)  The  wave  (arrow)  propagating 
toward  the  tail  end  of  the  aggregate,  (f,  g)  Generation  of  a  second  wave 
(arrowhead)  after  the  first  wave  is  no  longer  visible.  Dots  indicate  the 
propagation  of  first  wave  along  the  aggregate.  Images  are  10  ms  apart. 
Scale  bar  =  30  fim. 


form  events.  Spermatozeugmata  in  the  water  column  also 
sporadically  generated  a  short  series  of  large-amplitude 
waveforms.  Two-sample  t  tests  revealed  significant  differ- 


SPERMATOZEUGMATA  WAVEFORM   DYNAMICS 


39 


Figure  4.  Variation  in  the  conformation  of  a  Membranipora  inemhra- 
nacea  spermatozeugma  within  paternal  coelom  during  a  1750-ms  reverse- 
waveform  event.  Values  in  lower  right-hand  corner  of  each  image  show 
elapsed  time,  from  0  to  1750  ms.  (a,  b)  During  the  initiation  of  a  reverse- 
waveform  event,  the  spermatozeugma  develops  strong  curvature  near  the 
junction  of  the  heads  and  midpieces  (black  bracket)  and  near  the  junction 
ot  the  nonadhering  and  adhering  portions  of  the  midpieces  (white  bracket). 
(c-j)  Production  of  reverse  waveforms  bends  the  spermatozeugma  into  the 
shape  of  a  cane  or  question  mark,  (k,  1)  Spermatozeugma  returns  to 
generating  type  1  waveforms  and  a  nearly  linear  conformation.  Scale  bar  = 
25  f^rn. 


ences  in  the  event  frequencies  (df  =  18,  t  =  —3.04,  P  < 
0.001)  and  durations  (df  =  18,  t  =  -2.1  1,  P  <  0.05)  of 
reverse-waveform  events  between  spermatozeugmata  in  the 
paternal  visceral  coelom  and  ones  in  the  water  column  (Fig. 
6).  The  reverse  waveform  was  produced  almost  twice  as 
often  by  spermatozeugmata  in  the  paternal  visceral  coelom 
(n  =  10,  9.4  ±  0.7  events/m)  as  by  spermatozeugmata  in 
the  water  column  (n  =-  10,  5.6  ±  1.0  events/min).  In 
addition,  reverse-waveform  events  lasted  about  1.5  times 
longer  for  spermatozeugmata  in  the  paternal  visceral  coe- 
lom (n  =  10,  0.94  ±  0.10  s)  than  for  those  in  the  water 
column  (M  =  10,  0.64  ±  0.1  1  s).  During  the  production  of 


reverse  waveforms  in  the  paternal  perivisceral  coelom  and 
in  seawater  after  spawning,  spermatozeugmata  were  not 
observed  to  move  in  either  a  head-forward  or  a  tail-forward 
direction. 

Spermatozeugmata  spent  about  2.0  s  in  the  lophophoral 
coelom  during  spawning.  While  traveling  through  the  two 
distomedial  tentacles  into  the  external  seawater,  they  gen- 
erated reverse  waveforms  (Fig.  7).  One  sperm  aggregate 
stopped  producing  the  reverse  waveform  as  it  emerged  from 
the  tentacle  and  remained  with  its  head  end  within  the 
lophophoral  coelom  of  the  tentacle  for  about  10  s  until 
reverse  waveforms  were  generated  again.  With  resumption 
of  reverse-waveform  production,  the  spermatozeugma 
pushed  itself  out  of  the  tentacle. 

Spawned  spermatozeugmata  were  commonly  swept  into 
the  lophophores  of  conspecifics  by  feeding  currents.  Most 
spermatozeugmata  passed  quickly  through  the  lophophores 
without  altering  their  waveform  dynamics.  However,  when 
spermatozeugmata  remained  within  the  lophophores,  they 
typically  produced  large-amplitude  or  reverse  waveforms 
either  continuously  or  periodically.  Many  of  the  spermato- 
zeugmata generating  large-amplitude  waveforms  escaped 
from  the  lophophores  into  the  exhalant  current  of  colonies. 
Spermatozeugmata  generating  large-amplitude  waveforms 
were  able  either  to  swim  directly  out  of  the  lophophores  or 
to  enter  into  the  exhalant  current  stream  of  the  lophophores. 
In  one  case,  a  spermatozeugma  generating  large-amplitude 
waveforms  moved  from  the  pharynx  of  a  zooid,  out  through 
the  mouth,  and  back  into  the  lophophore.  In  other  cases, 
spermatozeugmata  within  lophophores  became  positioned 
with  their  head  ends  at  the  distal  pore  of  the  ITO.  Once  their 
head  ends  contacted  the  distal  surface  of  the  ITOs,  the 


Table  I 

Siinunan-  of  statistical  tests  In  determine  differences  among  waveform 
amplitudes 

Analysis  ot  variance 


Source 


Mean- 
Sum-ot-squares        df        square        F-ratio 


Waveform  type                399.29                 2        199.64         34.60         0.000 
Error I55.S2 27  5.77 

Matrix  of  pairwise  mean  differences  (below  diagonal!  and  probabilities 
(above  the  diagonal)* 


Waveform  type 


Small 


Large 


KCM.-I  si- 


Small 
Large 
Revers 


0.000 
0.003 


*  Mean  differences  calculated  using  a  mean  squared  error  (MSE)  model 
of  5.77  with  27  degrees  of  freedom;  probabilities  calculated  using  a 
Bonterroni  adjustment. 


40 


M.   H    TEMKIN   AND  S.   B.   BORTOLAMI 


Figure  5.  Propagation  of  reverse  waveforms  along  the  axonemes  from 
the  tips  to  the  bases  in  a  Membranipora  membranacea  spermatozeugma 
within  the  paternal  coelom.  Images  are  10  ms  apart,  (a-j)  The  movement 
of  a  reverse  waveform  (arrow)  from  the  midpoint  of  the  nonadhering 
midpiece  region  toward  the  head  end  of  the  spermatozeugma.  The  white 
bracket  and  *  in  (a)  indicate  the  curvature  of  the  spermatozeugma  occur- 
ring near  the  junction  of  the  nonadhering  and  adhering  portions  of  the 
midpieces  and  posterior  to  the  heads,  respectively,  (h-j)  A  second  wave 
(black  arrowhead)  becomes  apparent  and  propagates  toward  the  head  end 
of  the  aggregate.  The  first  dm  of  each  tracking  line  indicates  the  original 
position  of  the  first  wave  in  (a).  Scale  bar  =  20  fiin. 


spermatozeugmata  altered  their  waveform  dynamics  to  gen- 
erate reverse  waveforms  within  about  100  ms  and  attempted 
to  enter  the  ITOs.  The  production  of  reverse  waveforms 
bent  the  head  ends  of  (he  spermalo/eugmata  toward  the 
distal  pore  of  the  ITO  (Fig.  8).  Spermatozeugmata  could  not 
be  observed  after  they  entered  ITOs  because  of  cilia  that 
line  the  lumen  of  the  ITO.  Consequently,  we  could  not 
determine  the  \\..\clorms  produced  by  spermatozeugmata 
inside  of  ITOs. 

To  determine  if  the  change  from  small-amplitude  or 
large-amplitude  \\  avel'  >i  m  to  reverse  waveform  alter  a  sper- 
mato/eugma  contacted  an  ITO  was  simply  a  touch  response, 
the  waveform  dynamics  of  25  spermatozeugmata  were  ob- 
served before  and  after  they  contacted  a  glass  surface.  In  IS 
cases,  spermato/eugmata  were  producing  a  small-amplitude 


waveform  when  they  contacted  the  substrate.  Seventy-eight 
percent  (14  of  18)  of  these  spermatozeugmata  continued  to 
generate  a  small-amplitude  waveform  or  a  small-amplitude 
waveform  with  periodic  reverse-waveform  events.  The  re- 
maining 22%  (4  of  18)  initially  continued  to  produce  a 
small-amplitude  waveform,  but  later  changed  to  reverse 
waveforms.  Seven  spermatozeugmata  contacted  the  sub- 
strate during  a  reverse-waveform  event,  and  all  of  them 
continued  to  generate  reverse  waveforms.  Consequently,  the 
change  in  waveform  does  not  seem  to  be  simply  a  touch 
response. 

Discussion 

Spermatozeugmata  develop  in  a  group  of  animals  that  is 
diverse  in  phylogeny  and  reproductive  biology.  For  exam- 
ple, in  addition  to  occurring  in  bryozoans,  spermatozeug- 
mata have  been  reported  in  marine  and  freshwater  oli- 
gochaetes  (see  Ferraguti.  1983),  gastropods  (see  Buckland- 
Nicks  et  «/.,  1999,  2000),  marine  and  freshwater  bivalves 
(e.g.,  6  Foighil,  1985.  1989;  Lynn,  1994;  Jespersen  et  <;/.. 
2001,  2002),  insects  (e.g.,  Sahara  and  Kawamura,  2002). 
and  fish  (see  Jamieson,  1991;  Hayakawa  et  ai,  2002a). 
Marine  and  freshwater  bivalves  and  some  fish  are  similar  to 
gymnolaemate  bryozoans  in  that  they  spawn  their  sperma- 
tozeugmata into  the  water  column.  Gastropods,  insects,  and 
most  fish  transfer  their  spermatozeugmata  directly  from  the 
male  into  the  female  reproductive  tract  using  a  form  of 
copulation.  Oligochaetes  use  a  mechanism  of  pseudocopu- 


12 

10 

T 

a 

1 

6 

T 

1 

4 

2 

0 
Coelom                    Seawater 

1  2 

1  0 

T 

b 

1 

08 
06 

T 

1 

04 

02 

r\  r\ 

Coelom  Seawater 

Location  of  Spermatozeugmata 

Kiniire  6.  Kvcnt  frequency  (a)  and  duration  (b)  of  reverse  wavetoims 
produced  by  Mfi>ihrnni[><>ra  incnihnnnucti  spermatozeugma  within  the 
paternal  coelom  (n  =  10)  and  seawater  (n  =  10).  Two  sample  t  tests 
demonstrate  that  spermatozeugmata  within  the  paternal  coelom  produce 
sigmticamly  more  (df  -  IS.  I  -3.04.  P  <  0.001  )  and  longer  (dl  =  IS, 
f  =  -2.1  I,  P  <  0.05)  reverse  waveform  events  than  spermauv.eugmala 
in  seawater. 


SPKRMATOZEUGMATA  WAVEFORM  DYNAMICS 


41 


Figure  7.  Spermatozeugma  of  Membranipora  iin-inhniiuici'ii  crawling  out  of  a  paternal  tentacle  tail-end 
forward  by  producing  a  reverse  waveform.  Images  are  20  ms  apart.  Arrows  indicate  the  position  of  the  wave 
along  the  aggregate.  Scale  bar  =  20  /um. 


lation  to  deliver  spermatozeugmata  to  the  spermatheca  of 
mating  partners.  The  spermatozeugmata  produced  by  many 
species  of  marine  and  freshwater  oligochaetes,  marine  bi- 
valves, gastropods,  insects,  and  fish  differ  from  the  sperm 
aggregates  of  Menthmniporu  membranacea  in  that  they 
consist  of  dimorphic  sperm  (e.g.,  Ferraguti  cl  ai,  1989; 
Healy  and  Jamieson.  1993:  Buckland-Nicks  et  til.,  2000; 
Jespersen  et  ai,  2001 .  2002;  Hayakawa  ct  <//..  2()()2a:  Sahara 
and  Kawamura,  2002).  One  type  of  sperm,  euspermatozoa, 
fertilizes  eggs;  the  other  type,  paraspermato/.oa,  does  not 
fuse  with  eggs,  but  instead  is  thought  to  enhance  the  fertil- 
ization success  of  euspermatozoa  through  a  variety  of  mech- 
anisms, including  preventing  sperm  from  other  conspecih'c 
males  from  fertilizing  eggs  (see  Buckland-Nicks  ct  i/l., 
1999;  Hayakawa  et  <;/.,  2002b;  Sahara  and  Kawamura, 
2002). 

The  production  of  spermatozeugmata  by  M.  nienihriiiui- 
cea  may  increase  fertilization  success  in  three  ways.  First, 
"packaging"  sperm  together  may  reduce  the  loss  of  sperm 
during  the  transfer  from  paternal  to  maternal  individuals 
(e.g.,  Braidotti  and  Ferraguti.  1982;  6  Foighil.  1989;  Lynn, 


1994;  Jespersen  and  Lutzen,  2001;  Hayakawa  etui..  2002b). 
Among  gymnolaemate  bryozoans,  M.  inciiihruiuicea  has  an 
uncommon  reproductive  biology  (see  Reed,  1991;  Temkin 
and  Zimmer,  2002).  In  most  gymnolaemate  bryozoans,  the 
maternal  zooids  produce  only  one  or  a  few  eggs  during  each 
reproductive  period;  these  are  spawned  to  an  external  brood 
site,  where  they  develop  into  lecithotrophic  larvae,  either 
coronate  or  pseudocyphonautes.  In  contrast,  maternal  zoo- 
ids  in  species  of  Membranipora  and  Electro,  as  well  as 
some  species  of  Alcyoiiiditini,  Furellu.  and  Hy/wphorellti, 
produce  many  small,  yolk-poor  oocytes  that  are  spawned 
into  the  water  column,  where  they  develop  into  planktotro- 
phic  cyphonautes.  In  M.  membranacea,  the  synchronous 
development  of  groups  of  oocytes  may  result  in  the  pres- 
ence of  as  many  as  25  ovulated  primary  oocytes  in  the 
perivisceral  coeloni  at  one  time  (Hageman,  1983).  Conse- 
quently, the  maternal  zooids  of  M.  membranacea  likely 
need  to  acquire  more  sperm  than  most  gymnolaemate  bryo- 
zoans to  fertilize  their  eggs.  By  transferring  aggregates  of 
sperm,  the  entry  of  one  spermato/eugma  into  a  maternal 
zooid  delivers  64  sperm  cells.  In  other  gymnolaemate  spe- 


42 


M.  H.  TEMKIN  AND  S.  B.  BORTOLAMI 


Figure  8.  Spermatozeugma  of  Membranipora  membranacea  generat- 
ing reverse  waveforms  after  contacting  the  distal  surface  of  an  interten- 
tacular  organ  (ITO)  of  a  maternal  individual.  The  anterior  portion  of  the 
spermatozeugma  (arrow)  is  projecting  out  of  the  lophophore  between  the 
two  distomedial  tentacles.  The  head  end  of  the  aggregate  is  in  contact  with 
the  distal  surface  of  the  ITO.  The  anterior  end  of  the  spermatozeugma  is 
strongly  curved  (bracket)  due  to  the  generation  of  reverse  waveforms.  As 
a  result  of  the  bend  in  the  anterior  portion  of  the  aggregate,  the  spenna- 
tozeugma  is  able  to  enter  the  distal  pore  of  the  ITO.  Scale  bar  =  50  ^im. 

cies  that  may  face  similar  pressures  to  fertilize  their  eggs, 
spermatozeugmata  occur  in  species  of  Electra,  hut  have  not 
yet  been  reported  for  species  of  Alcyonuliuni.  Fare/la,  and 
Hypophorella. 

Second,  the  formation  of  spermatozeugmata  has  been 
suggested  to  increase  fertilization  success  by  increasing 
sperm  longevity  (Lynn,  1994).  Currently,  there  are  few  data 
with  which  to  assess  the  importance  of  spermatozeugmata 
on  the  longevity  of  bryozoan  sperm  after  spawning.  Man- 
rfquez  et  al.  (2001)  reported  that  the  fertile  half  life  of 
spawned  Celleporella  hyiilina  sperm  at  a  concentration  of 
10  to  102  cells  ml  '  was  about  1.2  h.  In  another  study, 
spermatozeugmata  of  M.  membranacea  were  observed  to 
remain  motile  for  36  h,  although  the  ability  of  these  sperm 
to  fertilize  eggs  was  not  determined  (Temkin,  1991). 

Third,  in  some  species,  the  formation  of  spermatozeug- 
mata  facilitates  fertilization  success  by  enhancing  sperm 
molility.  In  organisms  with  dimorphic  sperm,  motile  para- 
spermatozoa  may  transport  euspermatozoa  to  sites  of  fertil- 
ization in  oligochaetes  and  some  gastropods  (Ferraguti  el 
ul..  1988;  see  Buckland-Nicks  et  al.,  2000).  In  contrast,  the 
llagcllar  beat  of  euspermatozoa  generates  the  molility  asso- 
ciated with  the  spherical  spermatozeugmata  of  the  bivalve 
Anodonia  grandix  (Lynn,  1994).  The  movements  of  eusper- 
matozoa contained  within  spermatozeugmata  of  M.  meni- 
branacea  are  restricted  because  cells  are  bound  together 
along  most  of  their  lengths  by  viscomechanical  forces.  The 


adherence  of  sperm  to  one  another  within  a  spermato- 
zeugma of  M.  membranacea  establishes  a  structural  and 
functional  division  of  the  aggregate  into  head  and  tail 
halves.  The  head-end  half  consists  of  the  head  regions  that 
are  tightly  adherent  to  each  other  and  the  nonadhering 
portions  of  the  midpiece  region.  The  head-end  half  is  the 
region  of  a  spermatozeugma  in  which  waveforms  achieve 
their  greatest  amplitude  and  where  the  aggregate  undergoes 
conformational  changes  that  create  a  strong  curvature  dur- 
ing the  production  of  waveforms  generated  from  the  tip  to 
the  base  of  axonemes  (e.g..  during  reverse- waveform 
events).  The  tail-end  half  of  a  spermatozeugma  forms  a 
stiffened,  rodlike  region  consisting  of  the  adhering  portions 
of  the  midpiece  and  tail  regions.  In  fact,  no  discernible 
curvature  was  observed  during  the  generation  of  any  wave- 
form in  the  tail-end  half  of  spermatozeugmata  during  this 
study.  Consequently,  the  forces  that  move  spermatozeug- 
mata of  M.  membranacea  appear  to  be  generated  in  the 
head-end  half  of  the  aggregates  rather  than  along  the  entire 
length  of  the  midpiece  and  tail  regions. 

Sperm  in  spermatozeugmata  of  M.  membranipora  may 
generate  at  least  four  types  of  waveforms.  Here,  we  ob- 
served the  spontaneous  generation  of  three  waveforms: 
small  amplitude,  large  amplitude,  and  reverse.  A  fourth 
waveform  type,  in  which  the  head-end  halves  of  sperma- 
tozeugmata produce  an  effective  stroke-recovery  stroke 
movement  similar  to  that  of  a  cilium,  can  be  induced  by 
placing  spermatozeugmata  in  seawater  containing  elevated 
levels  of  either  Ca2+  or  K+  (Temkin.  2002).  During  small- 
and  large-amplitude  waveform  events,  waveforms  are  gen- 
erated from  the  base  to  the  tip  of  axonemes.  In  contrast, 
during  reverse  and  cilium-like  movements,  waveforms  are 
generated  from  the  tip  to  the  base  of  axonemes. 

Modulating  the  direction  of  waveform  propagation  along 
the  axoneme  is  a  rare  phenomenon  among  animal  sperm 
(Afzelius,  1982;  Baccetti  et  al..  1989).  The  ability  to  naturally 
reverse  the  direction  of  waveform  propagation  has  been 
reported  for  the  sperm  of  the  polyclad  turbellarians  Noto- 
plana  atomata.  Polyposthia  similis.  and  Leptoplana  tremel- 
lari.s  (Hendelberg,  1965,  1983).  the  parasitic  polychaete 
Myzostomum  cirrifenim  (Afzelius,  1982.  1983).  and  the 
tephritid  flies  Ceretitix  capitals,  Daciis  oleae.  and  /).  dor- 
xalix  (Baccetti  et  al..  1989).  Among  these  organisms,  mod- 
ulating the  direction  of  waveform  propagation  is  not  specific 
to  any  one  organization  of  the  axoneme  or  mode  of  sperm 
transfer.  The  sperm  of  M.  membranacea  have  a  9  +  2 
axoneme  (Zimmer  and  Woollacott,  1974)  and  are  trans- 
ferred to  maternal  individuals  through  the  water  column 
aggregated  into  spermatozeugmata.  The  threadlike  sperm  of 
N.  alamata.  P.  siinili\.  and  L.  trcmellaris  contain  two  9  +  1 
axonemes  and  are  copulated  directly  into  the  reproductive 
tract  of  females  (Hendelberg,  1965,  1983).  In  M.  cirrijcnun, 
sperm  have  a  9  +  0  axoneme  and  are  packaged  into  sper- 
matophores  that  are  reciprocally  transferred  to  the  epidermis 


SPERMATOZEUGMATA  WAVEFORM   DYNAMICS 


43 


of  hermaphroditic  partners  (Afzelius,  1983).  The  sperm  of 
tephritid  flies  have  a  9  +  9  +  2  axoneme  and  are  directly 
copulated  into  the  female  reproductive  tract  as  spermatodes- 
mata,  aggregates  partially  encapsulated  around  the  head 
ends  of  the  sperm  (Baccetti  el  al.,  1989). 

In  M.  membranacea,  the  motility  of  a  spermatozeugma  is 
dependent  on  the  synchronous  generation  of  waveforms  by 
most  sperm  of  the  aggregate.  At  spawning,  spermatozeug- 
mata  move  through  the  paternal  tentacles  tail-end  first, 
generating  reverse  waveforms  that  are  translated  along  ax- 
onemes  from  tip  to  base.  To  explain  how  spermatozeugmata 
move  through  tentacles  during  spawning,  we  propose  a 
crawling  model.  While  in  the  tentacle  lumen,  spermato- 
zeugmata generate  reverse  waveforms  that  push  against  the 
internal  walls  of  the  tentacles  (Fig.  9).  As  reverse  wave- 
forms are  generated  from  the  tip  to  the  base  of  the  axoneme, 
spermatozeugmata  move  in  a  tail-forward  direction.  Since 
the  generation  of  reverse  waveforms  did  not  seem  to  move 
spermatozeugmata  in  the  paternal  perivisceral  coelom  or  in 
seawater,  contact  with  a  surface  may  be  important  for  the 
effectiveness  of  reverse  waveforms  in  moving  spermato- 
zeugmata. In  contrast,  generation  of  large-amplitude  wave- 
forms and  cilium-like  movements  propels  spermatozeug- 
mata with  the  head-end  forward  without  needing  to  push 
against  a  surface  (Temkin,  2002).  It  seems  likely  that  the 
generation  of  either  large-amplitude  waveforms  or  cilium- 
like  movements  pulls  spermatozeugmata  into  ITOs.  During 
this  process,  the  adhering  portions  of  the  midpiece  and  tail 
appear  rigid,  which  may  have  caused  Temkin  (1994)  to 
report  that  the  undulatory  movements  of  spermatozeugmata 
stop  after  the  head  ends  enter  the  ITO.  The  actual  wave- 
forms used  by  M.  membranacea  spermatozeugmata  after 
entering  ITOs  remain  to  be  determined,  because  the  view  of 
spermatozeugmata  inside  an  ITO  is  obscured  by  the  cilia 
that  line  the  lumen  of  the  organ. 

The  waveform  patterns  generated  by  sperm  of  M.  mem- 
branacea in  spermatozeugmata  change  after  spawning  into 
seawater.  Temkin  (1994)  reported  that  spermatozeugmata 
seemed  to  become  quiescent  shortly  after  spawning.  Unlike 
the  quiescence  of  sea  urchin  (Gibbons,  1980),  tunicate  (Bro- 


Tentaclo 


Direction  of  Waveform  Propagation 


Direction  of  Movement 

Figure  9.  Model  of  spermatozeugma  crawling  tail-end  forward 
through  paternal  tentacle  during  spawning.  In  the  diagram,  a  spermato- 
zeugma is  moving  from  left  to  right.  Reverse  waveforms  are  being  gener- 
ated from  the  tip  to  the  base  of  axonemes.  Reverse  waveforms  push  against 
the  inner  walls  of  the  tentacle  (arrowheads)  and  move  the  spermatozeugma 
tail-end  forward. 


kaw,  1984),  and  polychaete  (Pacey  et  al.,  1994)  sperm,  in 
which  the  beat  of  the  flagellum  ceases,  the  apparent  quies- 
cence in  M.  membranacea  spermatozeugmata  is  caused  by 
the  decrease  in  the  frequency  and  duration  of  reverse  wave- 
forms after  spermatozeugmata  enter  the  water  column.  Ev- 
idence for  a  similar  change  in  waveform  dynamics  for 
spermatozeugmata  of  Electro  pilosa  may  be  contained  in  a 
paper  by  Marcus  ( 1926).  Marcus  ( 1926)  reported  that  sperm 
of  E.  pilosa  became  immobile  and  died  shortly  after  being 
transferred  into  seawater.  Decreasing  the  frequency  and 
duration  of  reverse-waveform  events  after  spawning  may 
allow  spermatozeugmata  to  conserve  energy  and  may  in- 
crease the  longevity  of  sperm  in  the  water  column.  Ho  and 
Suarez  (2003)  have  shown  that  increases  in  wave  amplitude 
in  bull  sperm  require  increases  in  ATP  consumption.  Since 
small-amplitude  waveforms  produce  almost  no  curvature  of 
the  axoneme  compared  to  large-amplitude  and  reverse 
waveforms,  small-amplitude  waveforms  may  require  less 
energy  to  produce  than  the  other  waveforms.  In  M.  mem- 
branacea, the  actual  consumption  of  ATP  by  spermato- 
zeugmata inside  and  outside  of  the  paternal  visceral  coelom 
remains  to  be  determined. 

In  M.  membranacea,  spermatozeugmata  also  generate 
reverse  waveforms  after  contacting  an  ITO.  The  ITO  is 
oriented  with  its  distal  pore  directed  away  from  the  funnel 
of  the  lophophore.  Consequently,  spermatozeugmata  within 
lophophores  cannot  be  oriented  to  enter  maternal  individu- 
als unless  they  develop  a  bend.  A  spermatozeugma  under- 
going a  reverse-waveform  event  develops  a  strong  confor- 
mational  change  that  curves  the  head  end  of  an  aggregate 
relative  to  its  long  axis.  This  conformation  change  bends  the 
spermatozeugma  toward  the  distal  pore  of  the  ITO.  Once  the 
head  end  of  a  sperm  aggregate  is  inside  an  ITO,  the  sper- 
matozeugma likely  changes  its  waveform  dynamics  to  gen- 
erate a  waveform  that  pulls  it  forward. 

The  generation  of  reverse  waveforms  by  a  spermato- 
zeugma of  M  membranacea  after  contacting  an  ITO  may  be 
a  response  to  a  substance  either  on  the  distal  surface  or 
emanating  from  the  pores  of  the  ITO  that  acts  as  a  sperm 
chemoattractant.  To  date,  no  sperm  chemoattractants  have 
been  identified  for  gymnolaemate  bryozoans  (see  Reed, 
1991).  Nevertheless,  the  change  in  waveform  dynamics  at 
the  ITO  may  be  evidence  for  a  behavioral  response  of 
gymnolaemate  bryozoan  sperm  to  contacting  maternal  tis- 
sue of  conspecifics.  Although  external  fertilization  has  been 
reported  among  gymnolaemate  bryozoans  (e.g.,  Silen, 
1966),  all  studies  that  have  actually  confirmed  the  presence 
of  a  sperm  or  male  pronucleus  in  oocytes  indicate  that 
sperm-egg  fusion  occurs  before  or  during  ovulation  (see 
Ryland  and  Bishop,  1993;  Temkin,  1994,  1996). 

Internal  fertilization  in  gymnolaemate  bryozoans  proba- 
bly involves  the  entry  of  spawned  sperm  into  the  maternal 
coelom,  and  is  not  the  result  of  eggs  and  sperm  being 
produced  in  the  same  perivisceral  coelom  by  hermaphto- 


44 


M.   H    TEMKIN  AND  S.   B.   BORTOLAMI 


ditic  zooids  (see  Ryland  and  Bishop,  1993;  Temkin,  1994, 
1996).  Consequently,  it  is  essential  for  spawned  sperm  to 
recognize  the  entryway  into  the  maternal  coelom,  such  as 
the  1TO  in  M.  membranacea.  The  presence  of  a  sperm 
chemoattractant  was  also  suggested  by  Silen  ( 1966),  based 
on  his  observations  that  sperm  of  Electro  posidoniae  at- 
tached to  the  abfrontal  sides  of  tentacles  began  to  produce 
"violent  jerks"  to  move  to  the  distal  opening  of  the  ITO  at 
the  time  of  egg  spawning.  ITOs  have  been  reported  to 
develop  in  species  of  seven  gymnolaemate  genera:  Mem- 
hronipora,  Electro,  Alcyonidium,  Conopeum,  Farella,  Vic- 
torella,  and  Bulbellci.  Among  these  species,  sperm  entry 
through  the  ITO  has  been  confirmed  only  for  M.  membra- 
nacea (Temkin,  1994).  Silen  (1966)  reported  that  sperm 
entered  the  ITO  of  Electro  crustulena,  but  he  did  not  de- 
termine where  sperm-egg  fusion  occurred.  In  species  with- 
out ITOs,  the  supraneural  pore,  which  represents  the  prox- 
imal pore  of  the  ITO,  has  been  hypothesized  to  serve  as  the 
entryway  for  sperm  into  the  maternal  coelom  (see  Silen, 
1966).  However,  sperm  entry  through  the  supraneural  pore 
has  yet  to  be  documented  for  any  species. 

Since  spermatozeugmata  are  only  known  to  occur  in  the 
gymnolaemate  genera  of  Membnmipora  and  Electro,  the 
waveforms  so  far  described  for  M.  membranacea  sperma- 
tozeugmata may  not  necessarily  be  produced  by  sperm  of 
other  gymnolaemate  species.  In  fact,  the  waveforms  pro- 
duced by  spermatozeugmata  of  Electro  remain  to  be  deter- 
mined. However,  some  initial  data  on  the  waveforms  gen- 
erated by  sperm  of  Thalamoporella  floridanci  suggest  that 
the  waveforms  observed  for  M.  membranacea  spermato- 
zeugmata, including  reverse  waveforms,  do  occur  in  other 
gymnolaemate  bryozoan  sperm  (Temkin,  2001).  To  under- 
stand the  significance  and  evolution  of  spermatozeugmata 
and  the  waveform  dynamics  of  gymnolaemate  bryozoan 
sperm,  further  studies  are  required  to  determine  how  sperm 
locate,  identify,  and  enter  maternal  individuals  in  gymno- 
laemate species  that  do  not  spawn  spermatozeugmata  or  do 
not  form  ITOs. 

Acknowledgments 

We  thank  the  following  people  for  providing  M.  H. 
Temkin  with  laboratory  space  and  facilities:  Kevin  Eckel- 
barger  and  Tim  Miller  at  the  Darling  Marine  Center  in 
Maine,  Mary  Rice  at  the  Smithsonian  Marine  Station  at  Fort 
Pierce,  Dennis  Willows  and  Richard  Strathmann  at  the 
Friday  Harbor  Laboratories,  and  Robert  Woollacott  at  Har- 
vard University.  Karel  Liem  generously  allowed  us  to  use 
his  high-speed  video  equipment.  We  thank  Brad  Baldwin. 
Joe  Erliehman.  Marianne  DiMarco-Temkin,  Russel  Zim- 
mer,  Michael  LaBarbera.  and  an  anonymous  reviewer  tor 
reading  and  suggesting  changes  that  improved  the  manu- 
script. This  paper  is  dedicated  to  the  memory  of  Dr.  Larry  R. 
McLdward. 


Literature  Cited 

Afzelius,  B.  1982.     The  flagellar  apparatus  of  marine  spermatozoa.  Pp. 
495-519  in  Prokaryoric  and  Eukaryolic  Flagella.  W.  Amos  and  J. 
Duckett,  eds.  Cambridge  University  Press.  Cambridge. 
Afzelius,  B.  A.   1983.     The  spermatozoon  of  Myzostomum  cirrifernin 

(Annelida,  Myzostomida).  J.  Ultraxtruct.  Res.  83:  58-68. 
Baccetti,  B.  H.,  B.  H.  Gibbons,  and  I.  R.  Gibbons.  1989.     Bidirectional 
swimming  in  spermatozoa  of  Tephritid  flies.  J.  Submicrosc.  Cytol. 
Patlwl.  21:  619-625. 

Bishop,  J.  D.  I).,  and  J.  S.  Ryland.  1991.  Storage  of  exogenous  sperm 
by  the  compound  ascidian  Diplosomu  listerianum.  Mar.  Biol.  108: 
1  11-1  IX. 

Bonnevie,  K.  19(17.  Untersuchungen  iiber  Keimzellen.  H.  Physiologische 
Polyspermie  bei  Bryozoen.  Jenaische  Zeitschreift  fur  Naturwissen- 
schaften  42:  567-598. 

Braidotti,  P.,  and  M.  Ferraguti.  1982.     Two  sperm  types  in  the  sper- 
matozeugmata of  Tubifex  tubifex  (Annelida,  Oligochaeta).  J.  Morphol. 
171:  123-136. 
Brokaw,  C.  J.  1984.     Cyclic  AMP-dependent  activation  of  sea  urchin  and 

tunicate  sperm  motility.  Ann.  N  Y  Acad.  Sci.  438:  132-141 
Buckland-Nicks,  J..  I.  Bryson,  L.  Hart,  and  V.  Partridge.  1999.     Sex 
and  a  snail's  sperm:  on  the  transport,  storage,  and  fate  of  dimorphic 
sperm  in  Littorinidae.  Invertebr.  Reprod.  De\.  36:  145-152. 
Buckland-Nicks,  J.  A.,  J.  M.  Healy,  B.  G.  M.  Jamieson,  and  S. 
O'I.eary.  2(1(10.     Paraspermatogenesis  in  Littoraria  (Palustorina)  ar- 
liciilute,  with  reference  to  other  Littorinidae  (Littorinoidea,  Caenogas- 
tropoda).  Invertehr.  Biol.  119:  254-264. 

Burighel,  P.,  and  G.  B.  Martinucci.  1994a.  Sexual  reproduction  in  the 
compound  ascidiun  Oip/oxoma  listerianum  (Tunicatu).  1.  Metamorpho- 
sis, storage  and  phagocytosis  of  sperm  in  female  duct.  Mar.  Hint.  1 18: 
489-498. 

Burighel.  P.,  and  G.  B.  Martinucci.  1994b.  Sexual  reproduction  in  the 
compound  ascidiun  Diplosoma  listerianum  (Tunicata).  II.  Sperm  pen- 
etration through  ovary  wall  and  evidence  of  internal  fertilization.  Mar. 
Biol.  118:  499-510. 

Daly,  J.  M.,  and  I).  W.  Golding.  1977.  A  description  of  the  spermatheca 
of  Spirorbis  spirorbis  (L.)  (Polychaeta:  Serpulidae)  and  evidence  for  a 
novel  mode  of  sperm  transmission.  J.  Mar.  Biol.  Assoc.  UK  57: 
219-227. 

Ferraguti,  M.  1983.     Annelida  Clitellata.  Pp.  343-376  in  Reproductive 
Biolotfv  i>f  Invertebrates.  Volume  11.  SperiiititoKi-ncxix  and  Sperm  Func- 
tion. G.  K.  Adiyodi  and  R.  G.  Adiyodi,  eds.  John  \Vile>.  New  York. 
Ferraguti,  M.  G.,  G.  Bernadini,  G.  Melone.  and   R.  Dallai.   1488. 
Structure  and  function  of  the  metachronal  wave  in   /';!/>;/<•  i   inhife\ 
spermato/eugmata  (Annelida,  Oligochaeta).  J.  Ullruxtriict.  Mol.  Struct. 
Rex.  99:  79-95. 
Ferraguti,  M.,  G.  Grassi,  and  C.  Erseus.  1989.     niffercnl  models  of 

tuhificid  spermalo/.eugmata.  Hydrobioloxia  '80:  73-82. 
Franzen,  A.  1956.     On  spermiogenesis.  morphology  of  the  spermulo/oan. 
and  biology  of  fertilization  among  invertebrates.  Zoo/.  Bii/r.  Uppx.  31: 
355-482 

Franzen,  A.  19M8.     Spermiogcnesis.  sperm  structure  and  spermato/eug 
mala  in  the  gymnolaematous  bryozoan  Eleclra  piloiui  (Bryo/oa.  Gym- 
nolacmutu).  Invertehr.  Reprod.  l)e\:  34:  55-63. 
Gihhons.  B.  H.  198(1.     Iiuermillenl  swimming  in  live  sea  urchin  sperm 

J.  Cell  Biol.  84:   1-12. 

Hagfinan,  G.  S.  1983.  A  tine  structural  analysis  of  ovarian  morphology. 
oo;.'cncsis.  and  ovulation  in  the  marine  bryozoan  Meinhraiiipora  xer- 
rilainella  (Cheilostomata,  Anasca).  Ph.D.  dissertation.  Universily  of 
Souihern  California.  I.os  Angeles.  CA.  4X7  pp. 

Hayakawa,  V..  R.  Aki\:inia.  H.  Munehara,  and  A.  Komaru.  2002a. 
Dimorphic  sperm  inlluence  semen  distribution  in  a  non-copulatory 
sculpin  Hi'inilepiilotnx  xilberti.  Environ.  Biol.  Fixhcx  65:  31  1-317. 
Hayakawa,  V..  H.  Munehara,  and  A.  Komaru.  20021).     Obstructive 


SPERMATOZEUGMATA  WAVEFORM   DYNAMICS 


45 


role  of  the  dimorphic  sperm  in  a  non-copulatory  marine  sculpin,  Hemi- 
lepidotus  gilberii,  to  prevent  other  males'  eusperm  from  fertilization. 
Environ.  Biol.  Fishes  64:  419-427. 

Healy,  J.  M.,  and  It.  (.'•.  M.  Jamieson.  1993.  Euspennatozoa.  parasper- 
matozoa  and  spermato/eugmata  of  Littoraria  (Palustorina)  articii/ala 
(Prosobranchia:  Caenogastropoda)  with  special  reference  to  the 
pseudotrich.  Ada  Zool.  74:  321-330. 

Hendelherg.  J.  1965.  On  different  types  of  spermatozoa  in  Polycladida, 
Turbellaria.  Ark.  Zool.  18:  267-304. 

Hendelberg,  J.  1983.  Platyhelminthes— Turbellaria.  Pp.  75-104  in  Re- 
productive Biology  of  Invertebrates,  Volume  II.  Spermatogenesis  and 
Sperm  Function,  G.  K.  Adiyodi  and  R.  G.  Adiyodi.  eds.  John  Wiley. 
New  York. 

Ho,  H.  C.,  and  S.  S.  Suarez.  20(13.  Characterization  of  the  intracellular 
calcium  store  at  the  base  of  the  sperm  flagellum  that  regulates  hyper- 
activated  motility.  Biol.  Reprod.  68:  1590-1596. 

Jamieson,  B.  G.  M.  1991.  Fish  Evolution  and  Systematic.*:  Evidence 
from  Spermatozoa.  Cambridge  University  Press,  Cambridge.  319  pp. 

Jespersen,  A.,  and  J.  Liitzen.  2001.  Ultrastructure  of  the  seminal  re- 
ceptacle and  the  dimorphic  sperm  in  the  commensal  bivalve  Myse/la 
bidentata  ( Veneroida;  Galeommatoidea;  Montacutidae).  Actu  Zonl.  82: 
107-115. 

Jespersen,  A.,  T.  Kosuge,  and  J.  Liitzen.  2001.  Sperm  dimorphism  and 
spermato/.eugmata  in  the  commensal  bivalve  Pseudopythina  macro- 
phthalmcnsis  (Galeommatoidea.  Kelliidae).  Zoomorphology  120:  177- 
189. 

Jespersen,  A.,  J.  I  lil/i-n,  and  B.  Morton.  2002.  Ultrastructure  of  di- 
morphic sperm  and  seminal  receptacle  in  the  hermaphrodites  Burrimy- 
sia  siphonosomae  and  Pseudopythina  ochetostomae  (Bivalvia.  Gale- 
ommatoidea). Zoomorphology  121:  159-172. 

Levitan,  I).  R.  1995.  The  ecology  of  fertilization  in  free-spawning  in- 
vertebrates. Pp.  123-156  in  Ecology  of  Marine  Invertebrate  Lan'ae, 
L.  R.  McEdward,  ed.  CRC  Press.  New  York. 

Lynn,  J.  VV.  1994.  The  Ultrastructure  of  the  sperm  and  motile  sperma- 
tozeugmata  released  from  the  freshwater  mussel  AnoJonta  gram/is 
(Mollusca.  Bivalvia,  Unionidae).  Can.  J.  Zool.  72:  1452-1461 

Manriquez,  P.  H.,  R.  N.  Hughes,  and  J.  D.  D.  Bishop.  2001.  Age- 
dependent  loss  of  fertility  in  water-borne  sperm  of  the  bryozoan  Ce/le- 
porcllu  Inalina.  Mar.  Ecol.  Prog.  Set:  224:  87-92. 

Marcus,  E.  1926.  Beobachtungen  und  Versuche  an  lebenden  Meeres- 
bryozoen.  Zool.  Jaltrh.  Abt.  Syst.  52:  1-102. 

Marcus,  E.  1938.  Bryozoarios  marinhos  brasilieros  11.  Univ.  Sao  Paulo 
Fin-.  Fi/o.v.  dent.  Let.  Bol.  Zool.  2:  1-196. 

Miller,  R.  L.  1983.  Cnidaria.  Pp.  23-73  in  Reproductive  Biology  of 
Invertebrates.  Volume  II,  Spermatogenesis  and  Sperm  Function,  G.  K. 
Adiyodi  and  R.  G.  Adiyodi.  eds.  John  Wiley.  New  York. 

O  Foighil,  D.  1985.  Sperm  transfer  and  storage  in  the  brooding  bivalve 
A/V.VI'//II  ninmla.  Biol.  Hull.  169:  602-614. 

O  Foighil,  I).  1989.  Role  of  spermatozeugmata  in  the  spawning  ecology 
of  the  brood  oyster  Oslrea  edit/is.  Gamete  Res.  24:  219-228. 


Pacey,  A.  A.,  J.  C.  Cossun,  and  M.  G.  Bentley.  1994.  Intermittent 
swimming  in  the  spermatozoa  of  the  lugworm  Arenicola  marina  (L.) 
(Annelida:  Polychaeta).  Cell  Motil.  Cytoskelet.  29:  186-194. 

Reed,  C.  G.  1991.  Bryo/oa.  Pp.  85-245  in  Reproduction  of  Marine 
Invertebrates.  Volume  VI,  Echinoderins  and  Lophophorates.  A.  C. 
Giese.  J.  S.  Pearse,  and  V.  B.  Pearse.  eds.  Boxwood  Press.  Pacific 
Grove,  CA. 

Rouse,  G.  W.  1996.  Variability  of  sperm  storage  by  females  in  the 
Sabellidae  and  Serpulidae  (Polychaeta,  Sabellida).  Zoomorpliolog\ 
116:  179-193. 

Rvland,  J.  S.,  and  J.  D.  Bishop.  1993.  Internal  fertilization  in  hermaph- 
roditic colonial  invertebrates.  Oceanogr.  Mar.  Biol.  Annu.  Rev.  31: 
445-477. 

Sahara,  K.,  and  N.  Kauumura.  2002.  Double  copulation  of  a  female 
with  sterile  diploid  and  polyploid  males  recovers  fertility  in  Bomhvx 
mori.  Zygote  10:  23-29. 

Schwaninger,  H.  R.  1999.  Population  structure  of  the  widely  dispersing 
marine  bryozoan  Membrunipora  membranacea  (Cheilostomata):  im- 
plications for  population  history,  biogeography.  and  taxonomy.  Mar. 
Biol.  135:  411-423. 

Sewell,  M.  A.,  and  F.-S.  Chia.  1994.  Reproduction  of  the  intraovarian 
brooding  apodid  Leptosynapta  clarki  (Echinodermata:  Holothuroidea) 
in  British  Columbia.  Mar.  Biol.  121:  285-300. 

Silen.  L.  1966.  On  the  fertili/ation  problem  in  the  gymnolaematous 
Bryozoa.  Ophelia  3:  I  13-140. 

Temkin,  M.  H.  1991.  Fertilization  in  the  gymnolaemate  Bryozoa.  Ph.D. 
dissertation.  University  of  Southern  California,  Los  Angeles,  CA.  139 

PP 

Temkin,  M.  H.  1994.  Gamete  spawning  and  fertilization  in  the  gymno- 
laemate bryozoan  Memhranipora  membranacea,  Biol.  Bull.  187:  143— 
155. 

Temkin,  M.  H.  1996.  Comparative  fertilization  biology  of  gymnolae- 
mate bryozoans.  Mar.  Biol.  127:  329-339. 

Temkin,  M.  H.  2001.  A  comparison  of  gymnolaemate  bryozoan  sperm 
waveform  dynamics.  .4m.  Zool.  41:  1604. 

Temkin,  M.  H.  2002.  The  effects  of  increased  external  Ca++  and  K+ 
concentrations  on  the  waveform  dynamics  of  bryozoan  spermatozeug- 
mata. Pp.  3 1 5-320  in  Bryo~oan  Studies  2001.  P.  N.  Wyse  Jackson.  C.  J. 
Buttler.  and  M.  E.  Spenser  Jones,  eds.  Swets  and  Zeitlinger,  Lisse,  The 
Netherlands. 

Temkin,  M.  H.,  and  R.  L.  Zimmer.  2002.  Phylum  Bryozoa.  Pp.  411- 
427  in  Atlas  of  Marine  Invertebrate  Larvae,  C.  Young,  ed.  Academic 
Press,  San  Diego,  CA. 

Zimnier,  R.  L.  1991.  Phoronida.  Pp.  1-45  in  Reproduction  of  Marine 
Invertebrates.  Volume  VI,  Echinoderms  and  Lophophorates.  A.  C. 
Giese,  J.  S.  Pearse,  and  V.  B.  Pearse,  eds.  Boxwood  Press,  Pacific 
Grove,  CA. 

/.immer,  R.  L.,  and  R.  M.  VVoollacott.  1974.  Morphology  and  bio- 
chemical modifications  of  the  spermatozoan  mitochondria  of  Membra- 
nipora  (Bryozoa).  J.  Cell  Biol.  63:  385a. 


Reference:  Biol.  Hull.  206:  46-54.  (February  2004) 
©  2004  Marine  Biological  Laboratory 


Differences  in  the  rDNA-Bearing  Chromosome  Divide 
the  Asian-Pacific  and  Atlantic  Species  of  Crassostrea 

(Bivalvia,  Mollusca) 

YONGPING  WANG1  2,  ZHE  XU1,  AND  XIMING  GUO1  * 

Huskin  Shellfish  Research  Laboratory,  Institute  of  Marine  and  Coastal  Sciences,  Rutgers  University, 
6959  Miller  Avenue,  Port  Norris,  New  Jersev  08349;  and  ~  Experimental  Marine  Biologv  Laboratory, 
Institute  of  Oceanology.  Chinese  Academy  of  Sciences,  7  Nanhai  Road. 
Qingdao,  Shandong  266071,  PRC 


Abstract.  Karyotype  and  chromosomal  location  of  the 
major  ribosomal  RNA  genes  (rDNA)  were  studied  using 
fluorescence  in  situ  hybridization  (FISH)  in  five  species  of 
Crassostrea:  three  Asian-Pacific  species  (C.  gigas,  C.  pli- 
catula,  and  C.  ariakensis)  and  two  Atlantic  species  (C. 
virginica  and  C.  rhizophorae).  FISH  probes  were  made  by 
PCR  amplification  of  the  intergenic  transcribed  spacer  be- 
tween the  18S  and  5.8S  rRNA  genes,  and  labeled  with 
digoxigenin-1 1-dUTP.  All  five  species  had  a  haploid  num- 
ber of  10  chromosomes.  The  Atlantic  species  had  1-2 
submetacentric  chromosomes,  while  the  three  Pacific  spe- 
cies had  none.  FISH  with  metaphase  chromosomes  detected 
a  single  telomeric  locus  for  rDNA  in  all  five  species  without 
any  variation.  In  all  three  Pacific  species,  rDNA  was  located 
on  the  long  arm  of  Chromosome  10  (lOq) — the  smallest 
chromosome.  In  the  two  Atlantic  species,  rDNA  was  lo- 
cated on  the  short  arm  of  Chromosome  2  (2p) — the  second 
longest  chromosome.  A  review  of  other  studies  reveals  the 
same  distribution  of  NOR  sites  (putative  rDNA  loci)  in 
three  other  species:  on  lOq  in  C.  sikainea  and  C.  angulata 
from  the  Pacific  Ocean  and  on  2p  in  C.  gasar  from  the 
western  Atlantic.  All  data  support  the  conclusion  that  dif- 
ferences in  si/.e  and  shape  of  the  rDNA-bearing  chromo- 
some represent  a  major  divide  between  Asian-Pacific  and 
Atlantic  species  of  Crassostrea.  This  finding  suggests  that 
chromosomal  divergence  can  occur  under  seemingly  con- 


Received  17  June  200V  accepted  21  October  200.V 

*  To  whom  correspondence  should  he  addressed.  E-mail: 
xguo@hsrl.rutgers.edu 

.•\hl>n'\-uiti«ii\:  CI.  centromeric  index;  1;ISH.  lluorescence  in  siin  hybnd- 
i/ution:  NOR.  nucleolar  organi/er  region. 


served  karyotypes  and  may  play  a  role  in  reproductive 
isolation  and  speciation. 

Introduction 

Classification  and  phylogenetic  analysis  of  oysters  are 
problematic  because  oysters  have  few  informative  morpho- 
logical characteristics.  Shell  coloration  and  morphology  in 
oysters  are  highly  variable  and  sensitive  to  environmental 
influence.  Anatomy  of  soft  tissue  is  difficult  and  provides 
only  limited  information.  Phylogenetic  analyses  of  oysters 
may  have  to  rely  on  a  multidiscipline  approach  using  mor- 
phological, molecular,  and  cytogenetic  characteristics.  Mo- 
lecular data  have  been  used  for  phylogenetic  analysis  of 
oysters  and  have  shown  great  promise  (Banks  el  ai.  1993; 
Littlewood,  1994;  6  Foighil  et  ai,  1995,  1998;  6  Foighil 
and  Taylor,  2000;  Lapegue  et  cil..  2002).  Cytogenetic  anal- 
ysis may  provide  additional  characteristics  for  phylogenetic 
comparisons  and  insight  about  major  genomic  changes  at 
chromosome  levels.  Chromosomal  rearrangement  and  dif- 
ferentiation are  important  mechanisms  for  reproductive  iso- 
lation and  speciation  in  some  taxa  (White,  1978;  King. 
1993). 

Most  of  the  cytogenetic  studies  in  oysters  so  far  have 
focused  on  karyotyping,  chromosome  banding,  and  NOR 
(nucleolar  organizer  regions)  staining  in  Ostrea  species 
(Insua  and  Thiriot-Quievreux,  1991;  Li  and  Havenhand. 
1997).  Studies  in  Crassostrea  are  scarce  and  provide  little 
interspecific  comparison  (Ladron  De  Guevara  et  <//.,  1996; 
Leitao  et  ai.  1999a,  b).  Although  oysters  have  a  low  haploid 
number  of  10  chromosomes  (Nakamura,  1985).  oyster  chro- 
mosomes are  small  and  similar  in  arm  ratios,  which  makes 


46 


rDNA-BEARING  CHROMOSOME  IN  CRASSOSTREA  OYSTERS 


47 


karyotypic  analysis  inherently  difficult.  Probably  due  to  the 
small  chromosome  size  and  the  lack  of  cell  lines  required 
for  making  elongated  chromosomes,  chromosome  banding 
in  oysters  is  difficult  to  obtain  and  reproduce.  C-  and  G- 
banding  patterns  have  been  produced  in  three  Crassostrea 
species  (Rodriguez-Romero  et  ai,  1979;  Leitao  et  <//.. 
1999a),  but  offered  little  help  in  the  reliable  identification  of 
oyster  chromosomes.  Ag-NOR  staining  is  also  variable  and 
often  shows  intraspecific  variations  in  number  and  location, 
which  poses  problems  for  interspecific  comparisons 
(Thiriot-Quievreux  and  Insua,  1992;  Ladron  De  Guevara  et 
ai.  1994). 

Fluorescence  in  situ  hybridization  (FISH)  is  a  relatively 
new  technology  and  now  widely  used  for  chromosome 
identification,  gene  mapping,  localization  of  gene  expres- 
sion, and  studies  on  chromosome  rearrangement  in  a  variety 
of  organisms  (Swiger  and  Tucker.  1996;  Nath  and  Johnson. 
1999).  By  direct  DNA  base  pair  hybridization.  FISH  pro- 
vides specific  and  reproducible  localization  of  genes  and 
DNA  sequences  on  chromosomes.  Repetitive  DNA  se- 
quences and  genes  that  are  present  in  high  copy  numbers 
and  tandem  repeats  are  ideal  for  use  as  FISH  probes  because 
of  their  large  target  size.  Unique  sequences  longer  than  80 
kb.  such  as  PI  and  BAG  clones,  can  be  readily  mapped  to 
chromosomes  by  FISH  and  used  as  chromosome-specific 
probes  (Jiang  et  til.,  1995).  Unique  sequences  shorter  than  I 
kb  are  generally  difficult  to  assign  by  FISH,  although  not 
impossible  (Schriml  et  til.,  1999).  Chromosome  paint 
probes  have  been  developed  to  label  specific  chromosomes 
or  chromosome  regions  in  some  organisms  (Rabbitts  et  ai, 
1995;  Shi  et  ai,  1997).  The  unambiguous  labeling  and 
identification  of  chromosomes  by  FISH  has  made  it  possible 
to  study  chromosome  rearrangements  in  cancer  cells  and  at 
evolutionary  scale. 

FISH  may  provide  a  solution  to  the  reliable  identification 
of  oyster  chromosomes,  which  has  not  been  possible 
through  traditional  karyotyping,  and  permit  cross-species 
comparisons.  The  technique  has  recently  been  used  to  study 
oyster  chromosomes  and  shows  considerable  advantages 
over  traditional  methods.  Using  FISH,  a  repetitive  element 
has  been  mapped  to  centromeric  regions  of  several  chromo- 
somes in  the  Pacific  oyster  Crassostrea  gigas  (Clabby  et  ai, 
1996;  Wang  et  ai,  2001),  and  the  vertebrate  telomere  se- 
quence (TAAGGG)n  has  been  mapped  to  telomeres  of  three 
species  of  Crassostrea  (Guo  and  Allen,  1997;  Wang  and 
Guo,  2001 ).  Nine  PI  clones  have  been  assigned  to  specific 
chromosomes  in  C.  virginica  (Wang,  2001). 

The  major  ribosomal  RNA  genes  (rDNA),  which  corre- 
spond to  NORs,  have  also  been  mapped  by  FISH  in  three 
species  of  Crassostrea  (Zhang  et  at.,  1999;  Xu  et  ai,  2001 ; 
Cross  et  ai,  2003).  FISH  analysis  of  rDNA  provided  vali- 
dation for  Ag-NOR  staining  and  eliminated  any  uncertainty 
and  intraspecific  variations.  Interestingly,  Xu  et  ai  (2001) 
found  that  the  two  species  of  Crassostrea  studied,  one 


Pacific  and  one  Atlantic  species,  differ  in  the  size  and  shape 
of  the  rDNA-bearing  chromosome.  In  a  species  with  an 
Asian-Pacific  origin,  C.  angulata,  the  rDNA-beanng  chro- 
mosome is  the  same  size  and  shape  as  in  the  Pacific  species, 
but  differs  from  that  in  the  Atlantic  species  (Cross  et  ai, 
2003).  To  determine  if  the  difference  is  shared  by  other 
species  of  Crassostrea,  we  used  FISH  to  study  the  chromo- 
somal location  of  rDNA  in  five  Crassostrea  species  that  are 
available  to  us,  including  the  two  species  studied  by  Xu  et 
ai  (2001)  but  with  different  populations,  two  additional 
Asian-Pacific  species  (C.  plicatida  and  C.  ariakensis).  and 
one  additional  Atlantic  species  (C.  rhizophorae).  Our  results 
plus  existing  NOR  data  suggest  that  differences  in  the 
rDNA-bearing  chromosome  represent  a  major  divide  be- 
tween Asian-Pacific  and  Atlantic  species  of  Crassostrea. 

Materials  and  Methods 

Species  studied 

Five  species  of  Crassostrea  were  included  in  this  study: 
three  Asian-Pacific  species  (C.  gigas  (Thunberg,  1793),  C. 
plicatida  (Gmelin,  1791),  and  C.  ariakensis  (Fujita,  1913)), 
and  two  Atlantic  species  (C.  virginica  (Gmelin,  1791)  and 
C.  rhizophorae  (Guilding,  1828)).  C.  gigas  was  obtained 
from  a  hatchery  in  Penglai,  Shandong,  northern  China.  The 
C.  gigas  studied  by  Xu  et  ai  (2001)  was  from  a  Rutgers 
stock  originated  from  Washington  State.  The  use  of  differ- 
ent stocks  was  intended  to  detect  possible  variation  among 
populations.  C.  plicatida  was  collected  from  Qingdao. 
Shandong,  northern  China.  C.  ariakensis  was  collected  from 
Yangjiang,  Guangdong,  southern  China.  C.  virginica  was 
from  two  sources:  wild  oysters  from  Delaware  Bay  and 
hybrids  between  Delaware  Bay  wild  and  a  hatchery  stock 
(NEH.  the  same  stock  used  by  Xu  et  ai,  2001 )  maintained 
at  the  Haskin  Shellfish  Research  Laboratory  (HSRL),  Rut- 
gers University,  New  Jersey.  The  hatchery  stock,  which 
originated  from  Long  Island  Sound,  has  been  maintained  at 
HSRL  for  over  10  generations  (selected  for  disease-resis- 
tance). C.  rhi~ophorae  was  the  first-generation  progeny  of  a 
Caribbean  population  produced  and  maintained  at  the  Har- 
bor Branch  Oceanographic  Institute,  Ft.  Pierce.  Florida. 

Chromosome  preparation 

For  C.  plicatida  and  C.  ariakensis,  chromosome  met- 
aphases  were  prepared  from  gill  tissue.  Oysters  were  incu- 
bated in  0.005%  colchicine  in  seawater  for  8-10  h.  Gill 
tissues  from  five  oysters  of  each  species  were  dissected  and 
treated  with  the  hypotonic  solution  0.075  M  KC1  for  30  min 
before  being  fixed  in  freshly  prepared  Carnoy's  fixative  (3:1 
methanol/acetic  acid.  v:v).  The  fixative  was  changed  twice, 
and  fixed  samples  were  stored  at  4  °C.  Metaphases  of  C. 
gigas,  C.  virginica,  and  C.  rhizophorae  were  made  from 
early  embryos  according  to  the  protocol  described  by  Xu  et 


48 


Y.  WANG  ET  AL 


a/.  (2001 ).  For  embryo  production,  3  females  and  2  males  of 
C.  gigas,  4  females  and  4  males  of  C.  virginica.  and  6 
females  and  3  males  of  C.  rhizophorae  were  used. 

Slides  were  prepared  using  an  air-drying  technique.  Gill 
tissues  were  chopped  into  fine  pieces  and  resuspended  in 
freshly  made  fixative.  Two  or  three  drops  of  cell  (from  gills) 
or  embryo  suspension  were  loaded  onto  a  clean  slide  and 
flooded  with  two  drops  of  1:1  methanol/acetic  acid.  Slides 
were  air-dried  and  stored  at  —20  °C  until  FISH  analysis. 

Probe  construction 

Oyster  genornic  DNA  was  prepared  from  adductor  mus- 
cle of  C.  gigas  and  C.  virginica  according  to  Doyle  and 
Doyle  (1987).  Intergenic  transcribed  spacers  between  the 
18S  and  5.8S  RNA  genes  (ITS1 )  were  amplified,  labeled  by 
PCR  incorporation  of  digoxigenin-l  1-dUTP,  and  used  as 
FISH  probes.  Primers,  5'-GGTTTCTGTAGGTGAAC- 
CTGC  and  5'-CTGCGTTCTTCATCGACCC,  were  de- 
signed using  conserved  sequences  flanking  the  ITS  1 .  ITS  1 
was  used  as  the  FISH  probe  so  that  the  primer  sequences 
were  conserved  and  could  allow  universal  amplification, 
while  the  internal  sequences  were  variable  and  might  permit 
species-specific  detection.  PCR  amplification  was  con- 
ducted in  25  ju,l  of  a  PCR  mixture  containing  PCR  buffer 
with  1 .5  mM  of  MgCK.  0.4  ing/ml  of  BSA,  0.2  mM  each  of 
dATP,  dCTP,  and  dGTP,  0.13  mM  of  dTTP,  0.07  mM  of 
digoxigenin-l  1-dUTP,  0.5  LI  of  Taq  DNA  polymera.se.  1 
IJLM  of  each  primer,  and  I  ;u,g  of  oyster  genomic  DNA. 
Digoxigenin-l  1-dUTP  and  other  PCR  reagents  were  pur- 
chased from  Roche  (Indianapolis.  IN).  PCR  was  performed 
in  a  DeltaCycler  II  system  thermal  cycler  (ERICOMP  Inc.. 
San  Diego,  CA)  with  30  cycles  of  1  min  of  denaturing  at 
95  °C,  1  min  of  annealing  at  50  °C.  and  I  min  of  extension 
at  72  °C.  and  final  extension  at  72  "C  for  5  min.  PCR 
products  were  verified  on  2c/r  agarose  gels.  DIG-labeled 
PCR  products  were  purified  using  G-50  columns  (Roche) 
before  being  used  as  FISH  probes. 

Fluorescence  in  situ  hyhridization 

Separate  ITS  I  probes  were  made  for  C.  gigas  and  C. 
virginica,  using  their  respective  genomic  DNA  as  templates. 
Both  probes  were  tested  for  FISH  in  all  five  species.  FISH 
was  conducted  according  to  protocols  described  by  Xu  el  nl. 
(2001).  Before  FISH,  slides  were  stained  with  Leishman's 
stain  for  3-5  min  and  screened  for  metaphases.  Negative 
controls  in  which  the  FISH  probe  was  replaced  with  dis- 
lilled  water  were  included  lo  delect  possible  nonspecific 
hybridi/ation.  FISH  signals  were  observed  under  a  Nikon 
epi-fluorescence  microscope  equipped  with  a  CCD  camera 
and  imaging  system. 

Chromosomes  were  measured  for  the  calculation  of  rel- 
alive  length  (Rl.)  and  centromeric  index  (CM),  and  classified 
accordiim  to  criteria  defined  bv  Levan  (1964).  Ten  meta- 


phases were  measured  for  each  species.  The  CI  of  each 
chromosome  represents  the  mean  and  standard  deviation  of 
the  10  metaphases.  When  the  CI  of  a  chromosome  plus  and 
minus  the  standard  deviation  overlapped  two  chromosome 
categories,  the  chromosome  was  designated  with  labels  for 
two  categories.  Chromosomes  were  paired  by  length  and 
arm  ratio,  and  named  1  to  10  from  the  longest  to  the 
shortest. 

Results 

A  diploid  number.  2n  =  20.  was  found  in  all  five  oysters 
studied.  Each  karyotype  consisted  of  10  pairs  of  metacentric 
and  sometimes  submetacentric  chromosomes.  Karyotype 
analysis  showed  that  all  five  species  shared  a  similar  karyo- 
type (Table  1 ).  The  only  noticeable  difference  between  the 
three  Pacific  and  two  Atlantic  species  was  that  C.  virginica 
and  C.  rhizophorae  had  1-2  chromosomes  that  were  clearly 
submetacentric.  while  the  three  Pacific  species  had  no  chro- 
mosomes that  could  be  unquestionably  defined  as  submeta- 
centric. There  were  chromosomes  in  both  Pacific  and  At- 
lantic species  whose  centromeric  indexes  overlapped  ranges 
for  metacentric  (0.500-0.375)  and  submetacentric  (0.374- 
0.250)  chromosomes.  These  were  classified  as  metacentric/ 
submetacentric  (ni/sm  in  Table  1)  chromosomes  and  not 
treated  as  submetacentric  chromosomes.  One  chromosome 
in  C.  virginica  and  two  chromosomes  in  C.  rhizophorae 
were  clearly  submetacentric. 

PCR  amplification  of  ITS1  in  C.  gigas  generated  a  single 
fragment  of  approximately  520  bp  in  length.  Incorporation 
of  digoxigenin-l  1-dUTP  shifted  the  size  of  the  PCR  product 
to  about  670  bp.  The  PCR  product  of  the  same  primer  pair 
in  C.  virginica  was  about  500  bp,  slightly  shorter  than  that 
from  C.  gigas.  Both  C.  gigas  (Cg)  and  C.  virginica  (Cv) 
probes  were  used  for  FISH  analysis. 

FISH  with  both  Cg  and  Cv  probes  produced  positive 
signals  in  all  five  species  (Fig.  1 ).  Two  bright  signals  were 
delected  in  all  metaphases  analyzed  in  all  five  species  with- 
out any  variation  (Table  2).  The  FISH  signals  were  re- 
stricted to  one  locus  (one  pair  ot  chromosomes)  with  no  or 
little  background  signal  elsewhere  on  the  chromosomes.  For 
interpliase  nuclei,  the  number  of  FISH  signals  varied  be- 
tween one  and  two.  About  50%— 68%  of  nuclei  clearly  had 
two  FISH  signals,  while  others  had  one  or  overlapping 
signals.  In  all  five  species  studied.  Cg  and  Cv  probes  pro- 
duced identical  results  in  the  number  and  location  of  signals, 
bul  signal  strength  differed.  In  Pacific  species,  the  signals 
produced  by  Cg  probes  were  generally  stronger  than  those 
produced  by  Cv  probes;  conversely,  in  Atlantic  species.  Cv 
probes  usually  produced  stronger  signals.  Only  FISH  results 
with  the  Cg  probe  for  Pacific  species  and  the  Cv  probe  for 
Atlantic  species  are  presented  in  Figure  I.  No  FISH  signal 
was  observed  in  the  negative  controls. 

Karyotype  analysis  of  FISH  signals  showed  that,  in  all 


rDNA-BEARING  CHROMOSOME  IN  CRASSOSTREA  OYSTERS 


49 


Table  1 

Ktinvtype  analysis  of  10  metaphases  in  five  Crassostrea  .V/XT/CA 


Species 
chromosome 

Relative  length 
(mean  ±  SD) 

Centromeric  index 
(mean  ±  SD) 

Classification' 

C. 

gigas 

1 

12.43 

± 

0.25 

0.41 

± 

0.01 

m 

2 

11.86 

4- 

0.55 

0.46 

± 

0.02 

m 

3 

10.97 

± 

0.40 

0.45 

4- 

0.02 

m 

4 

10.50 

-f 

0.16 

0.43 

4- 

0.01 

m 

5 

10.28 

± 

0.42 

0.38 

4- 

0.03 

m/sm 

6 

9.88 

4- 

0.14 

0.41 

-t 

0.01 

m 

7 

9.43 

± 

0.22 

0.45 

± 

0.02 

m 

S 

9.29 

± 

0.25 

0.40 

4- 

0.03 

m/sm 

9 

8.66 

4- 

0.22 

0.41 

± 

0.03 

m 

10 

7.61 

± 

0.53 

0.42 

± 

0.02 

m 

c. 

plicatiila 

1 

12.87 

4- 

0.37 

0.46 

± 

0.01 

m 

2 

11.10 

4- 

0.27 

0.41 

± 

0.02 

m 

3 

10.83 

4- 

0.31 

0.46 

± 

0.02 

m 

4 

10.35 

+ 

0.29 

0.41 

( 

0.01 

m 

5 

10.14 

4- 

0.49 

0.45 

± 

0.02 

m 

6 

9.62 

+ 

0.05 

0.45 

4- 

0.02 

m 

7 

9.59 

H- 

0.24 

0.39 

± 

0.02 

m/sm 

8 

9.09 

4- 

0.36 

0.39 

± 

0.02 

m/sm 

9 

8.45 

4 

0.38 

0.39 

4- 

0.01 

m 

II) 

7.79 

4- 

0.28 

0.40 

-+- 

0.02 

in 

C. 

ariakensis 

\ 

12.03 

4- 

0.47 

0.38 

+ 

0.02 

m/sm 

2 

11.53 

4- 

0.39 

0.46 

± 

0.01 

m 

3 

10.95 

± 

0.59 

0.40 

± 

0.01 

m 

4 

10.51 

4- 

0.37 

0.41 

± 

0.02 

m 

5 

9.90 

it 

0.81 

0.45 

± 

0.03 

m 

6 

9.77 

± 

0.35 

0.46 

4- 

0.01 

m 

7 

9.31 

4- 

0.44 

0.42 

± 

0.01 

m 

8 

9.05 

± 

0.22 

0.40 

4- 

0.02 

m 

9 

8.89 

* 

0.32 

0.44 

it 

0.02 

m 

II) 

8.13 

± 

0.56 

0.39 

± 

0.01 

m 

c. 

virginica 

1 

12.51 

± 

0.37 

0.47 

± 

0.01 

m 

2 

11.64 

± 

0.26 

0.38 

4- 

0.01 

m/sm 

3 

10.96 

t 

0.29 

0.41 

4- 

0.01 

m 

4 

10.81 

4- 

0.23 

0.47 

4- 

0,01 

m 

5 

10.20 

4- 

0.31 

0.40 

± 

0.02 

in 

6 

9.68 

4- 

0.30 

0.47 

± 

O.I 

m 

7 

9.41 

4- 

0.25 

0.40 

± 

0.02 

m 

8 

8.91 

+ 

0.22 

0.41 

± 

0.01 

m 

9 

8.28 

+ 

0.21 

0.35 

± 

0.02 

sm 

II) 

7.61 

4- 

0.38 

0.47 

± 

0.01 

m 

c. 

rhizophorae 

1 

12.23 

± 

0.59 

0.46 

+ 

0.02 

in 

2 

12.22 

4- 

0.42 

0.38 

± 

0.01 

m/sm 

3 

11.22 

t 

0.39 

0.40 

4- 

0.02 

m 

4 

10.90 

4- 

0.16 

0.46 

i 

0.02 

m 

5 

10.09 

4- 

0.49 

0.32 

4- 

0.04 

sm 

6 

9.96 

4- 

0.53 

0.40 

4- 

0.01 

m 

7 

9.45 

4- 

0.57 

0.46 

+ 

0.01 

in 

8 

8.70 

t 

0.28 

0.47 

4- 

0.02 

in 

9 

7.83 

± 

0.40 

0.30 

4- 

0.03 

sm 

II) 

7.38 

± 

0.65 

0.46 

± 

0.01 

m 

1  m  =  metacentric  chromosomes;  sm  =  submetacentric  chromosomes; 
m/sm  =  metacentric  or  submetacentric,  centromeric  indexes  overlapping 
two  categories. 


three  Pacific  species  (C.  gigas.  C.  plicatula,  and  C. 
kensis),  the  FISH  signals  occurred  on  the  long  arms  of 
Chromosome  10  ( lOq.  Fig.  1.  Table  2).  The  assignment  was 
unambiguous  because  Chromosome  10  was  clearly  the 
smallest  chromosome  in  all  three  species.  In  all  three  Pacific 
species,  the  signals  were  found  at  telomeric  regions  of  the 
long  arm.  In  the  two  Atlantic  species  (C.  virginica  and  C. 
rhizophorae),  however.  FISH  signals  were  found  on  the 
short  arms  of  Chromosome  2  (2p,  Fig.  1,  Table  2).  Chro- 
mosome 2  was  the  second  longest  chromosome  in  both 
species  and  was  clearly  distinguishable  from  Chromosome 
1  and  3  by  its  centromeric  index.  Chromosome  2  in  both 
Atlantic  species  had  a  centromeric  index  of  0.38  (m/sm), 
compared  with  0.46-0.47  for  Chromosome  1  and  0.40- 
0.41  for  Chromosome  3  (Table  1 ).  As  in  the  Pacific  species, 
FISH  signals  were  restricted  to  telomere  regions.  Karyo- 
typic  alignments  of  the  five  Crassostrea  species  are  pre- 
sented in  Figure  IF. 

For  both  C.  gigax  and  C.  virginica,  there  was  no  intraspe- 
cific  variation  in  the  number  and  chromosomal  location  of 
the  rDNA  locus  among  oysters  collected  from  different 
populations,  as  demonstrated  by  results  from  this  study  and 
Xu  et  al.  (20011. 

Discussion 

Fluorescence  in  situ  hybridization  validates  nitcleolar 
organizer  regions,  hut  not  always 

This  study  provides  unambiguous  chromosomal  assign- 
ment of  rDNA  in  five  species  of  Crassostrea.  including 
different  populations  of  two  previously  studied  species,  C. 
gigcis  and  C.  virginica.  The  number  and  location  of  the 
rDNA  locus  revealed  by  FISH  are  clear  and  without  any 
variation.  Despite  the  use  of  oysters  from  different  popula- 
tions. FISH  results  from  this  study  agree  with  previous 
FISH  analyses  in  both  C.  gigas  and  C.  virginica  (Zhang  et 
al..  1999;  Xu  et  al..  2001).  FISH  results  presented  here 
confirm  that  rDNA  or  the  major  rRNA  genes  are  located  at 
the  NOR  sites  previously  reported  for  C.  gigas  (Thiriot- 
Quievreux  and  Insua,  1992).  For  C.  rhizophorae,  Lapegue 
et  al.  (2002)  observed  one  NOR  on  the  short  arms  of 
Chromosome  3.  which  corresponds  to  the  rDNA  loci  we 
found  on  Chromosome  2.  Chromosome  3  in  Lapegue  et  al. 
(2002)  appeared  to  be  the  second  longest  in  the  karyotype 
and  had  a  centromeric  index  close  to  that  of  Chromosome  2 
in  our  study. 

For  C.  virginica  and  C  ariakensis.  however.  FISH  results 
are  in  conflict  with  results  from  Ag-NOR  staining.  Leitao  et 
al.  ( 1999b)  reported  two  NOR  sites  for  C.  virginicu  (Chro- 
mosomes 1  and  5)  and  C.  ariakensis  (Chromosomes  9  and 
10)  with  considerable  variation,  while  FISH  in  this  study 
detected  only  one  rDNA  locus  in  the  two  species.  Our  FISH 
results  are  clear,  consistent,  and  supported  by  early  studies 
in  C.  virginica  (Zhang  et  al..  1949;  Xu  et  al..  2001).  The 


Y.  WANG  ET  AL 


Cg 


Cp 


Ca 


Cr 


Cv 


1C 


JfKU 

it  n  x  K  K  r<  u 

li  M  if  11  it  ur 
)C  II  II  II  U  I)  H 

7(  )f  If  It  M  H  U  If 


Figure  1.  Fluorescence  in  situ  hybndi/ation  (FISH)  signals  and  chromosomal  location  of  the  major  rRNA 
genes  in  live  species  of  Crassostmi,  (A)  C.  gigas  rDNA  probe  on  C.  gigas  chromosomes;  (B)  C.  gigas  probe 
on  C  filicatulu;  (C)  C.  gigas  probe  on  C.  ariakfiisis:  (D)  C.  virginica  probe  on  C.  rhi~ophorae;  (E)  C.  virginica 
probe  on  C.  virginica:  (F)  chromosome  alignment  of  live  species.  Arrows  show  FISH  signals. 


discrepancy  between  the  FISH  and  NOR  data  may  be 
caused  by  either  false-positive  Ag-NOR  staining  or  by  a 
lack  of  correspondence  between  NORs  and  the  major  rRNA 
genes.  Ag-NOR  staining  targets  transcriptionally  active 
NOR  sites  and  is  known  to  produce  variable  and  inconsis- 
tent results  in  the  number  and  sometimes  the  location  of 
NORs  within  the  same  species  (Insua  and  Thiriot- 
guievrcux.  1 W;  Li  and  Havenhand.  I W).  Also.  Ag-NOR 
staining  may  not  be  able  to  separate  major  ( 18S-5.8S-28S) 
from  minor  (5S)  rDNA  and  other  actively  transcribed  genes. 
One  of  the  two  signals  described  by  Leitao  <•/  ul.  ( 1999b) 
seems  to  correspond  to  the  major  rDNA  Incus  m  our  studs, 
hul  the  nature  of  the  other  site  is  unknown.  Based  on 
preliminary  FISH  data  (Wang  and  Guo.  unpubl.).  the  extra 
NOR  site  in  C.  rir^inicu  is  not  the  site  ol  5S  rDNA.  Clearly. 
Ag-NOK  staining  can  accurately  detect  major  rRNA  genes 
sometimes — as  shown  by  results  from  C.  ,t,'/,i,'</.v,  C.  rhizo- 
I'horiic.  and  C.  nn^iilaui  (Thiriot-Quievreux  and  Insua. 
IW2;  Lapeguc  <•/  ul.,  2002;  Cross  cl  ul..  2003).  hut  not 
always — as  exemplified  in  C.  virxinica  and  C.  uritiki'ii.si\. 


Table-  2 

Fluorescence  in  situ  hyhridi-ation  wiili  C.  gigas  and  C.  virginica  rDNA 
prohes  nn  inlerphase  nuclei  and  inetaphasi'  chromosomes  in  five  \/><v/o 
of  Crassoslrea 

%  Nuclei  with     <7r  Metaphases  v\ ith     Chromosomal 
Probe/species          2  signals  (n)  2  signals  (/i)  location' 


C.  H/XIIS  probe 

C.  gixas 

60(25) 

100(28) 

lOq 

(  '.  plutintla 

60(25) 

101)  (  ID) 

lOq 

C.  ariakensis 

64(14) 

101)1  III) 

10q 

C.  virxinieti 

6(1  (15) 

100(10) 

2p 

C.  rhi:o/>liorae 

67(24) 

100(10) 

-P 

C.  virginiea  probe 

C.  xina\ 

51)114) 

100(14) 

lOq 

<       I'llllltlllll 

55(18) 

100(10) 

lOq 

C.  ariakensis 

52(15) 

100(13) 

lOq 

('.  viixinitti 

65(27) 

100(16) 

2p 

C.  rhi;i>phoi\ic 

68(40) 

100(19) 

-P 

All  ItK'iitions  arc  telommc. 


rDNA-BEARING  CHROMOSOME  IN   CRASSOSTREA  OYSTERS 


51 


Confirmation  of  NOR  results  by  FISH  is  necessary.  NOR 
sites,  often  two  per  genome,  have  been  reported  in  several 
species  of  Ostrea  (Insua  and  Thiriot-Quievreux.  1991, 
1993;  Thiriot-Quievreux  and  Insua,  1992;  Li  and  Haven- 
hand,  1997).  It  would  be  interesting  to  know  if  the  NOR 
sites  correspond  to  the  major  rRNA  gene  locus  in  the  Ostrea 
species. 

This  study  provides  the  first  report  on  the  karyotype  of  C. 
plicatula,  whose  taxonomic  status  is  uncertain  at  this  time. 
C.  plicatula  (formerly  Ostrea  plicatula)  is  commonly  used 
to  refer  to  a  type  of  small  oyster  found  in  intertidal  areas 
along  most  of  China's  coast  (Wang  et  ai.  19931.  Some 
believe  that  C.  plicatula  is  the  same  species  as  C.  gigas  (Li 
and  Qi,  1994;  Yang  et  al.,  2000);  others  suggest  that  it  is 
closely  related  to  C.  ariakensis  (Yu  et  ai,  2003);  and  still 
others  consider  it  an  unresolved  Crassostrea  species  and  use 
the  name  of  Crassostrea  sp.  instead  (Xu,  1997).  C.  plicatula 
seems  to  be  a  different  species  from  Alectiyonella  plicatula 
found  in  southern  China  (Li  and  Qi.  1994). 


Differences  between  Pacific  and  Atlantic  species 

Results  of  this  study  clearly  demonstrate  that  the  major 
rDNA  is  located  on  the  long  arms  of  Chromosome  10  (the 
smallest)  in  all  three  Asian-Pacific  species  and  on  the  short 
arms  of  Chromosome  2  (the  second  longest)  in  the  two 
Atlantic  species.  A  critical  examination  of  NOR  data  indi- 
cates that  the  same  pattern  holds  true  in  two  other  species: 
NORs  (or  the  major  rRNA  genes,  pending  verification  by 
FISH)  are  located  on  the  long  arms  of  Chromosome  10  in 
the  Asian-Pacific  species  C.  sikamea  and  on  the  short  arms 
of  Chromosome  2  in  the  eastern  Atlantic  (African)  species 


C.  gasar  (Leitao  et  al.,  1999b;  Lapegue  et  al..  2002:  Table 
3).  The  Portuguese  oyster  C.  angulata  provides  a  unique 
and  interesting  case,  adding  support  to  the  observed  pattern. 
Both  Ag-NOR  staining  and  FISH  have  indicated  that  rDNA 
is  located  on  the  long  arm  of  Chromosome  10.  the  same  as 
in  Pacific  species  (Leitao  et  al.,  1999b;  Cross  et  al.,  2003). 
C.  angulata  is  found  along  the  northeastern  coasts  of  the 
Atlantic  and  has  been  assumed  to  be  native  there.  However, 
there  are  conflicting  views  on  the  taxonomic  status  and 
origin  of  this  species.  Some,  on  the  basis  of  morphological 
and  allozyme  data,  have  suggested  that  C.  angulata  is  the 
same  species  as  the  Pacific  oyster  C.  gigas  (Menzel,  1974; 
Buroker  et  al.,  1979).  The  prevailing  view  is  that  C.  angu- 
lata is  an  Asian  species  that  was  introduced  to  Europe  from 
Japan,  although  it  is  possible  that  C.  gigas  is  an  Atlantic 
species  that  was  introduced  to  Japan  from  Portugal  (Menzel, 
1974).  More  recent  analyses  using  mtDNA  sequence  data 
suggest  that  C.  angulata  is  of  Asian  origin  (likely  from 
Taiwan),  and  that  it  is  closely  related,  but  not  identical,  to  C. 
gigas  from  Japan  (Boudry  ct  al.,  1998;  6  Foighil  et  al. 
1998).  Whether  C.  angulata  is  the  same  species  as  C.  gigas 
requires  further  study,  but  it  is  clear  from  molecular  data 
that  C.  angulata  is  an  Asian-Pacific  species. 

Another  karyotypic  difference  between  Asian-Pacific  and 
Atlantic  members  of  Crassostrcn  is  the  number  of  SM 
chromosomes.  In  this  study,  we  observed  one  in  C.  vir- 
ginica,  two  in  C.  rlu'-opliortie.  and  none  in  the  three  Pacific 
species.  Despite  some  variation,  other  studies  also  found 
more  SM  chromosomes  in  Atlantic  than  in  Pacific  species 
(Leitao  et  al.,  1999b;  Lapegue  et  al.,  2002:  Cross  ct  a  I., 
2003).  The  karyotypic  differences  between  all  three  Atlantic 
and  five  Pacific  Crassostrea  species  studied  so  far  are 


Table  3 

Summary  of  karyotypic  differences  in  the  rDNA-heurinx  chromiumm-  mid  llic  number  nf  subinctaccutric  (SM)  chnniiiudincx  between  Asian-Pacific  mid 
Atlantic  species  o/ Crassostrea 


Number  of  SM  chromosomes 

rDNA 

This 

Leitao  cl  al.                        Lapegue  et  al.                       Cross  ct  al. 

Species 

location 

study 

(19Wb)                                (2002)                                 (2003) 

Average 

Pacific  species 

C.  gigas 

I0q 

ii 

0 

0 

C.  ariakensis 

lOq 

0 

1 

0.5 

C.  plicatula 

lOq 

0 

0 

C.  sikaniea 

lOq2 

0 

0 

C.  angulata 

LOq 

1                                                                                           0 

0.5 

Atlantic  species 

C.  virginica 

2p 

1 

2 

1.5 

C.  rhizophorae 

2p 

2 

4 

3.0 

C.  gtisur 

V 

4                                             4 

4.0 

1  Only  chromosomes  with  a  centromeric  index  +  SD  less  than  0.37?  were  considered  to  be  submetacentric  tor  standardi/ed  comparisons. 

2  Based  on  Ag-NOR  staining  (Leitao  et  al..  1999b;  Lapegue  et  til..  2002).  pending  verification  by  FISH. 
'  C.  angulata  is  considered  to  be  an  Asian-Pacific  species  (6  Foighil  et  ai.  1998;  Boudry  el  al..  I99S). 


52 


Y.  WANG  ET  AL 


summarized  in  Table  3.  Differences  in  the  rDNA-bearing 
chromosome  and  the  number  of  SM  chromosomes  represent 
a  major  divide  between  Pacific  and  Atlantic  members  of  the 
genus.  Oysters  are  thought  to  have  highly  conserved  karyo- 
types.  All  Crassostrea  studied  so  far  (about  13  species)  have 
a  haploid  number  of  10  chromosomes  and  similar  karyo- 
types  (Nakamura.  1985).  The  size  and  shape  of  the  rDNA- 
bearing  chromosome  and  the  number  of  SM  chromosomes 
are  the  first  two  clearly  recognizable  chromosomal  diver- 
gences among  species  of  Crassostrea. 

There  are  likely  other  karyotypic  differences  between  the 
Pacific  and  Atlantic  species,  and  between  this  and  other 
studies  for  the  same  species.  We  did  not  attempt  to  match 
individual  chromosomes  across  species  and  studies.  Chro- 
mosome identification  in  oysters  is  difficult  because  oyster 
chromosomes  are  similar  in  size  and  arm  ratio.  The  accu- 
racy of  chromosome  measurements  varies  considerably  de- 
pending on  the  degree  of  chromosomal  condensation,  the 
quality  of  metaphases,  and  the  staining  methods  used.  Chro- 
mosome pairing,  classification,  and  naming  are  prone  to 
errors.  In  the  absence  of  chromosome-specific  FISH  probes, 
chromosome  alignment  across  species  is  not  reliable  in 
oysters  and  must  be  viewed  with  caution.  However,  diffi- 
culties in  chromosome  identification  do  not  affect  the  con- 
clusions of  this  study.  The  rDNA-bearing  chromosomes  in 
the  Pacific  and  Atlantic  species  are  strikingly  and  consis- 
tently different,  and  the  difference  in  the  number  of  SM 
chromosomes  is  independent  of  chromosome  identity  and 
supported  by  other  studies. 

The  findings  of  this  study  suggest  that  chromosomal 
divergence  among  Crassostrea  species  is  possible  under  a 
seemingly  conserved  karyotype.  The  divergence  in  karyo- 
type  is  not  surprising,  and  phylogenetic  analysis  using  mo- 
lecular data  has  shown  that  Pacific  and  Atlantic  species  of 
Crassostrea  form  two  clades  on  phylogenetic  trees  (Little- 
wood,  1994;  6  Foighil  et  cil.,  1998;  6  Foighil  and  Taylor, 
2000;  Lapegue  ct  ai,  2002).  Compared  with  molecular  data, 
the  rDNA-bearing  chromosome  provides  a  clear  and  simple 
divide  between  the  two  species  groups,  which  may  represent 
a  single  event  of  macroevolution  at  the  chromosome  level  or 
accumulation  of  chromosome  changes  over  time. 

Divergence  in  karyotype  can  arise  from  chromosomal 
deletion,  duplication,  translocalion.  inversion,  fission,  fu- 
sion, and  aneuploidy  (White.  1978;  King.  19931.  In  our 
case,  the  only  recogni/able  difference  so  far  is  the  si/e  and 
shape  of  the  rDNA-bearing  chromosomes.  It  is  not  clear 
whether  Chromosome  10  of  the  Pacific  species  is  homolo- 
gous to  Chromosome  2  of  the  Atlantic  species.  It  it  is.  the 
divergence  may  be  caused  by  chromosomal  duplications  or 
deletions.  If  the  two  chromosomes  have  little  homology 
oilier  than  in  the  rDNA  regions,  translocation  would  likely 
be  responsible. 


Chromosomal  divergence  and  hybridization  barrier 

Major  chromosomal  divergence  can  cause  reproductive 
isolation  and  speciation,  by  altering  normal  gene  expression 
and  regulation  or  causing  problems  for  meiosis  and  fertility 
in  hybrids  (White,  1978;  King,  1993;  Noor  et  ai,  2001; 
Rieseberg,  2001).  Biologically,  there  is  a  well-documented 
postzygotic  hybridization  barrier  between  Asian-Pacific  and 
Atlantic  species  of  Crassostrea  (see  review  in  Gaffney  and 
Allen,  1993).  Hybridization  within  the  two  geographic  spe- 
cies groups  produces  viable  offspring  (Wang  and  Liu.  1959; 
Zhou  et  at.,  1982;Menzel.  1987;  Allen  and  Gaffney.  1993). 
Hybridization  between  C.  virginica  and  C.  gigas  or  C. 
ariakensis  results  in  high  levels  of  fertilization  and  appar- 
ently normal  larval  development,  but  all  hybrid  larvae  die 
within  2  weeks  and  before  metamorphosis  (Allen  et  ai, 
1993).  By  demonstrating  significant  chromosomal  diver- 
gence across  the  hybridization  barrier,  we  raise  the  possi- 
bility that  the  chromosomal  divergence  may  contribute  to 
the  formation  of  the  barrier.  Geographic  isolation  and  genie 
mutations  may  have  played  important  roles  in  the  speciation 
of  oysters.  We  present  the  chromosomal  divergence  hypoth- 
esis as  a  possible  explanation  for  the  postzygotic  hybridiza- 
tion barrier  between  Atlantic  and  Asian-Pacific  species  of 
Crassostrea,  while  recognizing  that  the  barrier  may  as  well 
be  genie.  Additional  data  are  needed  to  discriminate  be- 
tween the  two  hypotheses.  There  are  about  15  extant  mem- 
bers of  Crassostrea,  and  most  of  them  live  in  the  Asian- 
Pacific  region  (Carriker  and  Gaffney.  1996).  A  survey  of  all 
species  in  the  genus  may  reveal  karyotypic  variation  within 
the  geographic  ranges.  Species  from  the  eastern  Pacific  and 
Indian  Oceans  would  be  most  interesting.  Similar  studies  in 
the  oyster  genera  Ostrea  and  Saccostrea  may  provide  in- 
sight into  the  phylogenetic  relationships  among  the  three 
major  groups  of  Ostreidae. 

Finally,  this  study  provides  the  first  chromosomal  assign- 
ment by  FISH  of  the  major  rRNA  genes  in  C.  plicatiila.  C. 
ariakensis,  and  C.  rhi-ophomc.  The  unambiguous  mapping 
of  rDNA  by  FISH  made  it  possible  to  identify  major  karyo- 
typic differences  between  Asian-Pacific  and  Atlantic  spe- 
cies of  Crtissostreit.  Results  of  this  study  show  that  FISH  is 
a  powerful  tool  for  cytogenetic  analysis,  especially  in  spe- 
cies where  chromosome  identification  by  traditional  meth- 
ods is  challenging.  Cytogenetic  analysis  in  most  marine 
invertebrates  has  been  limited  primarily  due  to  difficulties 
of  chromosome  identification.  The  application  of  FISH 
techniques  and  development  of  chromosome-specific 
probes  may  enable  chromosome  identification  and  phyloge- 
netic comparisons  of  molluscs  and  other  marine  inverte- 
brates. 

Acknowledgments 

The  authors  thank  Dr.  John  Scarpa  for  providing  man- 
grove o\sters  and  Prof.  Fusui  Zhang  for  helping  with  iden- 


rDNA-BEARING  CHROMOSOME  IN  CRASSOSTREA  OYSTERS 


53 


tifying  Cruasostreci  filicatulu.  This  study  was  conducted  at 
Rutgers  University  and  supported  by  grants  from  the  Na- 
tional Sea  Grant  Marine  Biotechnology  Program  (Grant 
B/T-9801).  USDA  NR1  (Award  No.  96-35205-3854).  and 
the  New  Jersey  Commission  on  Science  and  Technology 
(02-2042-007-11).  Yongping  Wang  is  partly  supported  by 
grants  from  China's  Natural  Science  Foundation  (No 
39825121).  the  863  program  (Award  2001AA628150).  and 
Chinese  Academy  of  Sciences.  This  is  Publication  IMCS- 
2004-01  and  NJSG-04-553. 


Literature  Cited 

Allen,  S.  K.,  Jr.,  and  P.  M.  Gaffney.  1993.  Genetic  amrirmatinn  i>t 
hybridization  between  Crassostrea  gigas  (Thunberg)  and  Crussostrea 
rmilaris  (Gould).  Aauaculiurc  113:  291-300. 

Allen,  S.  K.,  Jr.,  P.  M.  Gaffney.  J.  Scarpa,  and  D.  Bushek.  1993. 
Inviable  hybrids  of  Crassostrea  virginica  (Gmelin)  with  C.  rivularis 
(Gould)  and  C  ,t;/,i;<n  (Thunberg).  Aquaciiltiire  113:  269-2S9. 

Banks,  M.  A..  D.  Hedgecock.  and  C.  Waters.  1993.  Discrimination 
between  closely  related  Pacific  oyster  species  (Crassostrea)  via  mito- 
chondria! DNA  sequences  coding  for  large  subunit  rRNA.  Mol.  Mar. 
Biol.  Biotcchnol.  2:  129-136. 

Boudry,  P.,  S.  Heurtehise,  B.  Collet,  F.  Cornette,  and  A.  Gerard.  1998. 
Differentiation  between  populations  of  the  Portuguese  oyster.  Cras- 
sostrea angulata  (Lamark)  and  the  Pacific  oyster,  Crassostrea  gigas 
(Thunberg),  revealed  by  mtDNA  RFLP  analysis.  J.  Exp.  Mar.  Binl. 
Ecol.  226:  279-291. 

Buroker,  N.  E.,  W.  K.  Hershberger.  and  K.  K.  Chew.  1979.  Popula- 
tion genetics  of  the  family  Ostreidae.  I.  Intraspecilic  studies  of  Crav- 
sostrea  gigas  and  Saecostrea  commemalis.  Mar.  Binl.  54:  157-169. 

Carriker,  M.  R..  and  P.  M.  Gaffnev.  1996.  A  catalogue  of  selected 
species  of  living  oysters  (Ostreacea)  of  the  world.  Pp.  1-1?  in  The 
Eastern  Ovster  Crassostrea  virginica.  V.  S.  Kennedy.  R.  I.  E.  Newell, 
and  A.  F.  Eble.  eds.  Maryland  Sea  Grant  College.  College  Park. 

Clabby,  C..  II.  Goswami,  F.  Flavin,  N.  P.  \\ilkins,  J.  A.  Houghton,  and 
R.  Powell.  1996.  Cloning,  characterization  and  chromosomal  loca- 
tion of  a  satellite  DNA  from  the  Pacific  oyster.  Crassostrea  gigas.  Gene 
168:  205-209. 

Cross,  I.,  L.  Vega,  and  I..  Rebordinos.  2(103.  Nucleolar  organizing 
regions  in  Crassostrea  angidata:  chromosomal  location  and  polymor- 
phism. Geneiicii  119:  65-74. 

Doyle,  J.  J.,  and  J.  L.  Doyle.  1987.  A  rapid  DNA  isolation  procedure  for 
small  quantities  of  fresh  leaf  tissue.  Phytochem.  Bull.  19:  11-15. 

Gaffnev.  P.  M.,  and  S.  K.  Allen,  Jr.  1993.  Hybridization  among  Cras- 
sostrea species:  a  review.  Aquaciilture  116:  1-13. 

Guo,  X.,  and  S.  K.  Allen,  Jr.  1997.  Fluorescence  in  situ  hybridization  of 
the  vertebrate  telomere  sequence  to  chromosome  ends  ot  the  Pacific 
oyster,  Crassostrea  gigas  Thunberg.  J.  Shellfish  Rex.  16:  87-89. 

Insua,  A.,  and  C.  Thiriot-Quievreux.  1991.  The  characterization  of 
Ostrea  denselamellosa  (Mollusca,  Bivalvia)  chromosomes:  karyotype. 
constitutive  heterochromatin  and  nucleolus  organizer  regions.  Aqua- 
culture  97:  317-325. 

Insua,  A.,  and  C.  Thiriot-Quievreux.  1993.  Karyotype  and  nucleolus 
organizer  regions  in  Ostrea  /nielehana  (Bivalvia:  Ostreidae).  Veligei- 
36:  215-219. 

Jiang,  J.,  B.  S.  Gill,  G.  L.  Wang,  P.  C.  Ronald,  and  D.  C.  Ward.  1995. 
Metaphase  and  mterphase  fluorescence  in  situ  hybridization  mapping 
of  the  rice  genome  with  bacterial  artificial  chromosomes.  Proc.  Null. 
Acacl.  Sci.  USA  92:  4487-4491. 

King,  M.  1993.  Species  Evolution:  The  Role  of  Chromosome  Change. 
Cambridge  University  Press.  Cambridge. 


Ladron  De  Guevara,  B.,  F.  Winkler,  and  C.  Palma.  1994.     Karyotype 

description  and  the  position  of  the  nucleolar  organizer  region  (NOR)  in 

the  Chilean  oyster  Tiostrea  chilensis  (Philippi)  Chanley  and  Dinamam. 

Pp.  390-405  in  Genetics  ami  Evolution  of  Aquatic  Organisms.  A.  R. 

Beaumont,  ed.  Chapman  and  Hall,  London. 
I.adron  De  Guevara,  B.,  F.  Winkler,  F.  Rodriguez-Romero,  and  C. 

Palma-Rojas.  1996.     Comparative  karyology  of  four  American  oyster 

species.  Veliger  39:  260-266. 
Lapegue,  S.,  I.  Boutet,  A.  Leitao,  S.  Heurtebise,  P.  Garcia,  C.  Thiriol- 

Quievreux,  and  P.  Boudry.  2002.     Trans- Atlantic  distribution  of  a 

mangrove  oyster  species  revealed  by   I6S  mtDNA  and  karyological 

analysis.  Biol.  Bull.  202:  232-242. 
Leitao,  A.,  C.  Thiriot-Quievreux,  P.  Boudry,  and  I.  Malheiro.  1999a. 

A   'G'  chromosome  banding  study  of  three  eupped  oyster  species: 

Crassostrea  gigas.   Crassostrea  angulata  and  Crassostrea  virginica 

(Mollusca:  Bivalvia).  Genet.  Sel.  Evol.  31:  519-527. 
Leitao.  A.,  P.  Boudry,  J.  Labat,  and  C.  Thiriot-Quievreux.  1999b. 

Comparative  karyological  study  of  cupped  oyster  species.  Malacologia 

41:  175-186. 
Levan,  A.,  D.  Fredga,  and  A.  A.  Sandherg.  1964.     Nomenclature  for 

centromeric  position  on  chromosomes.  Hereditas  52:  201-220. 
Li,  X.,  and  J.  N.  Havenhand.  1997.     Karyotype,  nucleolus  organiser 

regions  and  constitutive  heterochromatin  in  Ostrea  angasi  (Mollusca: 

Bivalvia):  evidence  of  taxonomic  relationships  within  the  Ostreidae. 

Mar.  Biol.  127:  443-44S. 
Li,  X.,  and  Z.  Qi.  1994.     Studies  on  the  comparative  anatomy,  systematic 

classification  and  evolution  of  Chinese  oysters.  Studia  Marina  Sinica 

35:  143-178.  (In  Chinese). 
Littlewood,  D.  T.  J.  1994.     Molecular  phylogenetics  of  cupped  oysters 

based  on  partial  28S  rRNA  gene  sequences.  Mol.  Phylogenet.  Evol.  3: 

221-229. 
Menzel,  R.  W.   1974.     Portuguese  and  Japanese  oysters  are  the  same 

species.  J.  Fish.  Res.  Board  Can.  31:  453 — 156. 
Menzel,  W.   1987.     Hybridization  of  oysters  and  clams.  Pp.  47-59  in 

Hvbridi-ation  and  Genetic  Engineering  in  Aquacullure,  K.  Tiews.  ed. 

Heenemann.  Berlin. 
Nakamura.  H.  K.  1985.     A  review  of  molluscan  cytogenetic  information 

based  on  the  CISMOCH-computerized  index  system  for  molluscan 

chromosomes.  Bivalvia.  Polvplacophora  and  Cephalopoda.  Venus  Jpn. 

J.  Malacol.  44:  193-226. 
Nath,  J.,  and  K.  L.  Johnson.  1999.     A  review  of  fluorescence  in  situ 

hybridization   (FISH):   current   status   and   future   prospects,   Biotech. 

Histochem.  75:  54-78. 
Noor,  M.  A.  F.,  K.  L.  Grams,  L.  A.  Bertucci,  and  J.  Reiland.  2001. 

Chromosomal  inversions  and  the  reproductive  isolation  of  species. 

Proc.  Natl.  Acad.  Sci.  USA  98:  12.084-12.088. 
6  Foighil,  D.,  and  D.  J.  Taylor.  2000.     Evolution  of  parental  care  and 

ovulation  behavior  in  oysters.  Mol.  P/iv/ogenet.  Evol.  15:  301-313. 
6  Foighil,  D.,  P.  M.  Gaffnev,  and  T.  J.  Hilbish.  1995.     Differences  in 

mitochondria!    16S   ribosomal   gene   sequences   allow   discrimination 

among   American   (Crassostreu   virginica}  and   Asian  (C.   gigas.    C. 

ariakensis-}  oyster  species.  J.  Ex/>.  Mar.  Biol.  Ecol.  192:  21 1-220. 
6  Foighil,  D.,  P.  M.  Gaffnev,  A.  E.  Wilbur,  and  T.  J.  Hilbish.  1998. 

Mitochondrial  cytochrome  oxidase  I  gene  sequences  support  an  Asian 

origin  for  the  Portuguese  oyster  Crassostreu  angulata.  Mar.  Biol.  131: 

497-503. 
RabhiUs,  P.,  H.  Impey,  A.  Heppell-Parlon,  C.  Langford,  C.  Tease,  N. 

Lowe,  D.  Bailey,  M.  Ferguson-Smith,  and  N.  Carter.  1995.     Chro- 
mosome specific  painls  from  a  high  resolution  flow  karyotype  of  the 
mouse.  Nat.  Genet.  9:  369-375. 
Rieseberg,  L.  H.  2001.     Chromosomal  rearrangements  and  specialmn 

Trends  Ecol.  Evol.  16:  351-358. 
Rodriguez-Romero.  F.,  A.  Laguarda-Figueras,  M.  Uribe-Alcocer,  and 


54 


Y.  WANG  ET  AL. 


M.  L.  Rojas-Lara.  1979.  Distribution  ot  "G"  hands  in  the  karyotype 
of  Crassusireti  virginica.  Venus  Jpn.  J.  Malacol.  38:  180-184. 

Schrinil,  L.  M.,  H.  M.  Padilla-Nash.  A.  Coleman,  P.  Moen,  W.  G.  Nash, 
J.  Mtnninger,  G.  Jones,  T.  Ried,  and  M.  Dean.  1999.  Tyramide 
signal  amplification  (TSA)-FISH  applied  to  mapping  PCR  labeled 
probes  less  than  1  kb  in  size.  Biotechniques  27:  608-613. 

Shi,  G.,  H.  J.  Weh,  and  D.  K.  Hossfeld.  1997.  Reinterprelation  of 
G-banded  complex  karyotypes  by  fluorescence  in  situ  hybridization 
with  chromosome-specific  DNA  painting  probes  and  alpha-satellite 
centromere-specific  DNA  probes  in  malignant  hematological  disorders. 
Am.  J.  Hcinutol.  55:  69-76. 

Swiger.  R.  R.,  and  ,|.  D.  Tucker.  1996.  Fluorescence  in  situ  hybridiza- 
tion: a  brief  review.  Environ.  Mai.  Miilagen.  27:  245-254. 

Thiriot-Quievreux,  C.,  and  A.  Insua.  1992.  Nucleolar  organizer  region 
\  at  lation  in  the  chromosomes  of  three  oyster  species.  J.  Exp.  Mar.  Bid. 
Ecol.  157:  33-40. 

Wang,  D.,  and  H.  Liu.  1959.  Preliminary  studies  on  artificial  hybrid- 
ization of  oysters.  ACTA  Zool.  Sinica  11:  2X3-295.  (In  Chinese  with 
French  abstract). 

Wang,  R.,  Z.  Wang,  and  J.  Zhang.  1993.  Marine  Mollitscan  Culture, 
Qingdao  Ocean  University  Press.  Qingdao,  China.  (In  Chinese). 

Wang,  Y.  2001.  Molecular  Biological  Characterization  of  Oyster  Chro- 
mosomes. Ph.D.  dissertation.  Institute  of  Oceanology.  Chinese  Acad- 
emy of  Sciences.  Qingdao.  China.  (In  Chinese). 

Wang,  Y.,  and  X.  Guo.  2001.     Chromosomal  mapping  of  the  vertebrate 


telomeric  sequence  (TTAGGG)n  in  four  bivalve  molluscs  by  fluores- 
cence in  situ  hyhndi/ation.  J.  Shellfish  Res.  20:  1 187-1 190. 

Wang,  Y.,  Z.  Xu,  and  X.  Guo.  2001.  A  centromeric  satellite  sequence  in 
the  Pacific  oyster  (Crassostrea  gigas  Thunberg)  identified  by  fluores- 
cence in  situ  hybridization.  Mar.  Biotechnal.  3:  486-492. 

White,  M.  J.  D.  1978.  Modes  of  Speciation.  W.  H.  Freeman.  San 
Francisco. 

Xu,  F.  1997.  Bivalve  Mol/uscu  of  China.  Science  Press.  Beijing.  China. 
(In  Chinese). 

Xu,  Z.,  X.  Guo,  P.  M.  Gaffney,  and  J.  C.  Pierce.  2001.  Chromosomal 
location  of  the  major  ribosomal  RNA  genes  in  Crassostrea  virginica 
and  Crassostrea  gigas.  Veliger  44:  79-83. 

Yang,  R.,  Z.  Yu,  Z.  Chen,  X.  Kong,  and  J.  Dai.  2000.  Allozyme 
variation  within  Crassostrea  plicatula  and  Crassostrea  gigas  from 
Shandong  coastal  waters.  J.  Fish.  China  24:  130-133.  (In  Chinese  with 
English  abstract). 

Yu,  Z.,  X.  Kong,  L.  Zhang,  X.  Guo,  and  J.  Xiang.  2003.  Taxonomic 
status  of  four  Crassostrea  oysters  from  China  as  inferred  from  mito- 
chondria! DNA  sequences.  J.  Shellfish  Res.  22:  31-38. 

Zhang,  Q.  Y.,  G.  Yu,  R.  K.  Cooper,  and  T.  R.  Tiersch.  1999.  Chro- 
mosomal location  by  fluorescence  in  situ  hybridization  of  the  28S 
ribosomal  RNA  gene  of  the  eastern  oyster.  J.  Shellfish  Res.  18:  431- 
435. 

Zhou,  M.,  Y.  Gao,  and  R.  Wu.  1982.  Preliminary  studies  on  hybridiza- 
tion of  Crassostrea  gigas  with  Ostrea  rivularis  and  O.strea  plicatula.  J. 
Fish.  China  6:  235-241.  (In  Chinese  with  English  abstract). 


Reference:  Bint.  Bull  206:  55-60.  (February  2004) 
©  2004  Marine  Biological  Laboratory 


Occurrence  in  the  Field  of  a  Long-Term,  Year-Round, 
Stable  Population  of  Placozoans 


YOSHIHIKO  K.  MARUYAMA 

Section  of  Marine  Biological  Science.  Education  anil  Research  Center  for  Biological  Resources. 
Facultv  of  Life  and  Environmental  Science.  Shiniane  Unirersitv,  194  Kama.  Sai^o.  Oki. 

Sliimane  685-0024,  Japan 


Abstract.  Long-term  field  studies  on  placozoans 
(Trichoplax  adliaerens),  including  both  substrate  sampling 
and  slide  sampling,  were  earned  out  at  a  subtidal  site  near 
Shirahama,  Japan.  Samples  of  natural  substrate  materials 
from  the  field,  such  as  stones,  shells,  or  fragments  of  coral, 
were  particularly  useful  for  obtaining  placozoans.  Results 
from  the  substrate  sampling  indicate  that  placozoans  are 
present  year-round  at  the  study  site.  Large  intermittent 
peaks  in  the  number  of  animals  collected  at  the  study  site 
occurred  roughly  once  a  year,  between  late  summer  and  the 
beginning  of  winter.  Placozoans  were  present  every  year 
from  1989  through  2000.  A  seawater  aquarium  was  also 
studied  and  provided  a  considerable  number  of  placozoans 
for  more  than  1  year. 

Introduction 

The  placozoan  Trichoplax  udluierens  F.  E.  Schulze  is  a 
ciliated  microscopic  marine  animal  with  a  platelike  mor- 
phology (Schulze,  1883;  Grell,  1971,  1982;  Miller,  1 97 la. 
b;  Pearse  et  al..  1987;  Margulis  and  Schwartz,  1988;  Grell 
and  Ruthmann,  1991;  Conn,  2000;  Brusca  and  Brusca, 
2003).  The  thin  body  consists  only  of  an  epithelium  and  an 
internal  mesenchyme.  The  epithelium  has  two  regions:  an 
upper  free,  or  dorsal,  epithelium  of  cover  cells  and  a  lower 
attached,  or  ventral,  epithelium  of  cylinder  and  gland  cells 
(Grell  and  Benwitz,  1971;  Pearse  et  al..  1987;  Grell  and 
Ruthmann,  1991 ).  Some  differences  between  the  central  and 
marginal  areas  in  the  body  have  also  been  reported 
(Schwartz,  1984;  Schuchert,  1993;  Pearse  et  al..  1994). 
When  the  densely  ciliated  ventral  epithelium  is  in  contact 


Received  19  April  2000;  accepted  17  November  2003. 
E-mail:  maruyama@life.shimane-u.ac.jp 


with  the  substrate,  the  animals  display  a  gliding  (or  creep- 
ing) locomotion  (Grell  and  Ruthmann,  1991).  When  the 
animal  is  fed,  its  shape  changes  periodically  (Ueda  et  al.. 
1999).  For  example,  in  addition  to  the  gliding  amoeboid 
platelike  form,  other  forms  (swarmers)  (Thiemann  and 
Ruthmann.  1991)  have  been  described.  Further,  a  swim- 
ming form  has  been  reported  (cited  in  Margulis  and 
Schwartz,  1988;  also  see  Levin  and  Bridges,  1995). 
Trichoplax  adliaerens  is  considered  to  be  the  sole  species  in 
the  phylum  Placozoa  (Grell.  1982;  Grell  and  Ruthmann. 
1991;  Brusca  and  Brusca,  2003). 

Placozoans  have  been  found  in  seawater  aquaria 
(Schulze,  1883;  Miller.  1971a.  b;  Pearse  et  al..  1987;  Mar- 
gulis and  Schwartz,  1988;  Grell  and  Ruthmann,  1991).  as 
well  as  in  various  warm  coastal  areas  (Grell  and  Benwitz, 
1971;  Sudzuki,  1977;  Grell  and  Lopez-Ochoterena,  1987; 
Pearse,  1989;  Uehara  et  al.,  1989;  Pearse  et  al.,  1994;  V.  B. 
Pearse,  pers.  comm.).  Nevertheless,  the  biology  of  this 
microscopic  animal  under  natural  conditions  is  little  known 
(Grell  and  Ruthmann,  1991  i. 

In  this  study,  which  is  based  on  long-term  sampling  of 
both  glass  slides  and  natural  substrates,  the  occurrence  of 
placozoans  was  examined  at  a  subtidal  site  as  well  as  in  a 
seawater  aquarium  at  the  Seto  Marine  Biological  Labora- 
tory in  Shirahama,  Japan.  Results  of  this  study  indicate  that, 
in  addition  to  their  abundance  in  the  seawater  aquarium, 
placozoans  are  present  at  the  study  site  year-round. 

Materials  and  Methods 

Sampling  in  the  field 

The  study  site  was  located  at  the  east  side  of  Tanjiriku- 
zurenohana  on  the  southern  coast  of  Tanabe  Bav.  near  the 


56 


Y.   K.  MARUYAMA 


Seto  Marine  Biological  Laboratory  of  Kyoto  University  at 
Shirahama  (Wakayama  Prefecture,  Japan).  It  was  situated  in 
the  upper  portion  of  the  subtidal  zone,  about  1  m  below  the 
datum  line  in  the  tide  table  for  Shirahama  (tide  tables  issued 
by  the  Japan  Meteorological  Agency.  Tokyo).  Water  tem- 
peratures were  recorded  (Fig.  1 ). 

Slide  sampling.  Following  Pearse  (1989).  specimens  of 
placozoans  were  collected  on  glass  slides  (76  mm  X  26 
mm).  Typically,  seven  clean  slides  were  placed  in  a  stain- 
less steel  slide  rack  (72  mm  X  66  mm  X  31  mm;  ordinarily 
used  in  histology),  and  four  sets  of  racks  thus  prepared  were 
placed  on  the  substrate  at  the  study  site.  Later  (19  to  68 
days;  35  days  on  average),  each  of  the  racks  was  put 
separately  into  a  plastic  container  filled  with  ambient  sea- 
water  collected  at  the  site  and  returned  to  the  laboratory  for 
observation.  Sometimes,  individual  clean  slides,  not  in 
racks,  were  placed  at  the  site,  and  individual  slides  were 
also  examined  if  the  racks  holding  them  disappeared  unac- 
countably. On  the  day  of  retrieval,  or  the  day  after,  new  sets 
of  slides  were  placed  for  the  next  observation. 

Substrate  sampling.  Placozoans  were  also  collected  from 
samples  of  natural  substrate  materials  ranging  in  size  from 
pebble  to  cobble  (according  to  the  particle  grade  scale  of 
Wentworth;  e.g..  Lincoln  et  til..  1998);  for  example,  those  of 
4-8  cm  in  length  are  within  this  range.  Stones,  shells  of 
molluscs  (dead  or  alive),  fragments  of  skeleton  of  hard 
corals  (dead  or  alive),  or  mixtures  thereof,  were  collected  by 
hand  at  the  study  site  and  placed  separately  into  containers 
of  ambient  seawater.  These  samples  were  brought  to  the 
laboratory  for  observation.  The  sampling  was  carried  out  at 
intervals  of  12-68  days.  35  days  on  average. 

Laboratory  observations  of  placozoans  from  the  field.  In 
the  slide  sampling,  each  slide  was  quickly  transferred  into  a 
plastic  dish  (90  mm  in  diameter)  containing  seawater  from 


30    -i 


20 


10 


M     A    M     J 
90 


JASON 


D     J     F 
91 


M     A     M     J     J     A     S 


Kiyure  1.  A  profile  ol  changes  ..Her  temperature  at  the  studs  sue 
and  in  the  seawaler  aquarium  Absciss;,  nonths  from  March  1WO  through 
September  1991.  Ordinate.  teni|vi.itui.  i  '.)  lor  the  study  site  (squares.  •) 
and  tor  the  seawater  aquannm  leiuli 


the  field.  Both  surfaces  of  each  slide  were  examined  under 
a  dissecting  microscope.  In  the  substrate  sampling,  each 
sample  container  was  typically  treated  as  follows.  It  was 
shaken  for  several  seconds,  and  the  resultant  suspension  was 
decanted  into  plastic  dishes  (90  mm  in  diameter).  A  few- 
hours  later,  these  dishes  were  observed  under  a  dissecting 
microscope  for  placozoans,  and  within  a  few  days  (mostly, 
the  day  after),  they  were  observed  again.  Placozoans  could 
be  seen;  they  were  attached  to  and  gliding  along  the  bottom 
of  the  plastic  dishes. 

When  placozoans  were  found  in  these  samples  or  on 
slides  from  the  field  (Fig.  2),  they  were  transferred,  with  a 
mouth-controlled  micropipette.  to  an  observation  chamber 
and  further  observed  with  a  light  microscope  equipped  with 
Nomarski  optics.  The  thin  platelike  body  form  attached  to 
the  substrate  on  its  ventral  surface,  its  gliding  ciliary  move- 
ment, and  the  presence  of  shining  spheres  in  the  dorsal 
epithelium  served  to  identify  these  animals  as  placozoans 
(Grell  and  Benwitz.  1971;  Miller.  197 la;  Grell  and  Ruth- 
mann.  1991).  Furthermore,  the  occurrence  of  birefringent 
granules  in  the  subperipheral  region  (Miller.  197 la;  Pearse 
et  ai.  1994)  usually  served  for  identification. 

Measurement  of  size  in  placozoans 

Because  the  shape  of  placozoans  continuously  changes, 
determinations  of  size  are  only  valid  at  the  moment  of 
measurement.  Furthermore,  only  placozoans  that  were  at- 
tached to  either  a  glass  or  plastic  substrate  were  measured. 
Under  those  circumstances,  the  lengths  along  the  longest 
and  shortest  axes  were  measured  with  an  ocular  scale  under 
a  dissecting  microscope,  and  the  average  of  the  two  values 
was  taken  as  the  size  of  the  individual. 

Source  of  placozoans  collected  from  stones 

Samples  of  stones  were  collected  at  the  study  site  and 
another  subtidal  site  in  Tanabe  Bay  (see  a  later  section)  and 
transported  to  the  laboratory.  Each  sample  consisted  of  a 
stone  (4-8  cm  in  length)  and  an  aliquot  (typically,  30-70 
ml )  of  the  ambient  seawater  in  a  container.  The  stone  in  the 
container  was  transferred  by  hand  into  an  aliquot  (typically, 
30-40  ml)  of  artificial  seawater  (ASW;  Jamarin  U.  Jamarin 
Laboratory,  Osaka)  in  a  separate  container;  the  ambient 
seawater  (SW)  was  retained.  Both  containers — one  with  the 
ASW  and  the  stone,  and  the  other  with  the  retained  SW— 
were  shaken  similarly,  and  the  fluids  were  then  examined 
individually  for  placozoans,  as  described  above;  meanwhile 
the  stone  was  discarded.  The  relative  difference  in  the 
proportion  of  placozoans  in  the  ASW  and  in  the  SW  was 
calculated  according  to  the  expression  [(A  -  B)/(  A  +  B)] 
X  100,  where  .4  is  the  number  of  placozoans  in  the  ASW, 
and  H  is  the  number  in  the  SW.  The  differences  were 


FIELD  STUDIES  ON   PLACOZOANS 


57 


Figure  2.     A  placozoan  on  a  slide  from  the  study  site.  Bar,  100  j 


statistically  tested  with  a  Student's  t  test,  after  arcsine  trans- 
formation (Sokal  and  Rohlf,  1995)  (Table  1). 

Sampling  at  a  seawater  aquarium 

Placozoans  were  also  collected  from  the  Kyoto  Univer- 
sity Aquarium  at  the  Seto  Marine  Biological  Laboratory.  In 
a  seawater  aquarium  in  this  facility,  a  square  plastic  basket 
was  suspended;  many  hard  corals  were  reared  in  the  basket, 
and  running  seawater  was  continuously  supplied  from 
above.  Water  temperatures  were  recorded  (Fig.  1 ). 

Individual  clean  glass  slides  (76  mm  X  26  mm),  not  in 
racks,  were  used  here  for  sampling  placozoans  (slide  sam- 
pling). About  10  slides  were  placed  on  the  bottom  of  the 
basket  with  the  corals.  Later  (19  to  44  days,  31  days  on 
average),  the  slides  were  transferred  to  a  container  rilled 
with  seawater  taken  from  the  seawater  supply  system  and 
were  returned  to  the  laboratory  for  observation  under  a 
dissecting  microscope,  as  described  above.  When  slides 
were  removed,  a  new  set  of  clean  slides  was  placed  for  the 
next  observation. 

Results 

Slide  sampling  at  the  subtidal  study  site 

Slide  samplings  at  the  study  site  were  carried  out  at 
intervals  of  1  month  on  average  for  about  3  years,  from 
November  1989  through  December  1992.  The  samples 
yielded  a  total  of  230  placozoans,  which  appeared  in  13  of 
33  (39%)  samplings  on  63  of  818  (7.7%)  retrieved  slides. 

The  number  of  placozoans  changed  with  time,  with  large 
intermittent  peaks  in  November  1990,  September  1991.  and 


August  1992  (arrows  in  Fig.  3).  The  percentage  of  slides 
with  placozoans  (placozoan-positive  slides,  or  positive 
slides)  was  also  higher  in  these  months  (Fig.  3).  In  addition, 
the  number  of  racks  containing  slides  with  placozoans  was 
also  high  in  these  months:  4  out  of  4  in  November  1990.  4 
out  of  4  in  September  1991,  and  3  out  of  4  in  August  1992. 
The  placozoans  ranged  in  size  from  about  100  jam  to 
1200  /urn  (394  ±  179  /u,m,  the  mean  ±  SD  of  227  individ- 
uals). All  exhibited  the  platelike  morphology  (Fig.  2);  but 
two  placozoans  obtained  in  November  1990  had  a  transpar- 
ent balloonlike  protrusion  on  the  dorsal  side,  and  two  pla- 
cozoans collected  in  September  1991  had  a  small  protru- 
sion. 

Substrate  sampling  at  the  study  site 

Placozoans  were  found  on  all  kinds  of  the  substrate 
materials  tested  (stones,  molluscan  shells,  corals),  suggest- 
ing no  specificity  of  placozoans  for  these  particular  sub- 
strates. 

When  samples  of  these  materials  were  examined  after 
collection  at  intervals  of  about  1  month  (12-68  days,  35 
days  on  average),  for  2'/z  years,  from  July  1990  through 
December  1992,  placozoans  were  found  on  all  but  two 
occasions  (92%,  24  out  of  26)  (Fig.  4).  Thus,  placozoans 
were  present  virtually  throughout  the  year  at  the  study  site. 

A  total  of  199  placozoans  were  obtained  from  39  out  of 
the  114  (34%)  samples.  A  large  number  of  placozoans  were 
obtained  in  November  1990  and  August  1992  (Fig.  4).  The 
percentage  of  positive  samples  varied  with  time,  with  peaks 


Table  1 

Source  of  placozoans  collected  from  field  samples  of  stones  and  ambient 
seawater 


Numbers  of  placozoansj 


Experiments 


ASW  +  stone 


SW 


Difference1^ 


1 

6 

0 

100 

-) 

5 

2 

43 

3 

2 

(1 

100 

4 

1 

0 

100 

5 

1 

I) 

100 

J  The  stone  from  each  sample  was  transferred  to  artificial  seawater 
(ASW),  the  stone  and  ASW  were  shaken,  and  the  ASW  was  then  examined 
for  placozoans,  as  was  the  retained  ambient  seawater  (SW)  (see  protocol  in 
Materials  and  Methods).  Only  results  from  placozoan-positive  samples  are 
shown. 

h  %  Difference,  the  relative  value  of  the  difference  in  number  was 
calculated  according  to  the  equation  [(A  -  B)/(A  +  B}]  x  100.  where 
A  and  B  represent  the  number  of  placozoans  from  ASW  (  +  stone)  and  SW. 
respectively. 

L  The  %  difference  is  significantly  greater  than  OVc  (P  <  0.05);  /  test 
(see  Materials  and  Methods). 


58 


Y.   K.  MARUYAMA 


r    100 


135  - 


a 


M 
V 


40  - 


20  - 


-  20 


NDJFMAMJJASONDJFMAMJJASONDJFMAMJJASOND 

89       90  91  92 


t 


Figure  3.  Slide  sampling  at  the  study  site.  Abscissa,  months  from  November  1989  through  December  1992. 
Ordmate  (left),  number  of  placozoans  obtained  from  slides  at  each  sampling  (squares,  •);  ordinate  (right), 
percentage  of  placozoan-positive  slides  (circles.  O).  Slides  ( 10-34,  2?  on  average)  that  had  been  placed  at  the 
study  site  for  about  1  month  (19-68  days,  35  days  on  average)  were  used  for  the  observations.  Filled  arrows 
indicate  the  timing  of  large  intermittent  peaks  (November  1990,  September  1991,  and  August  1992).  The  peak 
in  November  1989  was  also  probably  in  this  class  (open  arrow). 


I 

M 


W 

9 


H 
I/I 
0 

(X 


appearing  in  October   1990  to  January    1991.  September 
1991,  and  August  1992  (see  Fig.  4). 

The  placozoans  obtained  from  substrate  materials  were, 
however,  small.  The  animals  collected  from  some  samples 
ranged  from  100  /xm  to  400  /urn  (  1  32  ±  77  /am.  mean  ±  SD 
of  52  individuals),  and  were  frequently  damaged  at  the 
periphery.  Thus  many  of  these  placozoans  had  probably 
been  fragmented  during  the  sampling  procedure.  All,  how- 
ever, exhibited  a  platelike  morphology. 

Field  sampling  from  1993  throii^li  2/1/1(1 

More  recently.  (August  1993-November  2000),  sam- 
plings lor  placo/.oans,  on  either  slides  or  natural  substrates. 
were  continued  at  the  study  site  at  a  frequency  of  1-3  times 
per  year.  Placozoans  were  present  in  every  year.  Moreover, 
placozoans  were  also  present  at  other  sites  in  this  area  of 
Shirahama,  including  a  suhtidal  site  and  a  tidal  pool  in 
Tanabe  Bay  as  well  as  in  Kanayama  Bay. 


with  the  substrate  or  with  the  ambient  seawater.  Field  sam- 
ples of  stones  in  containers  of  ambient  seawater  were  used 
for  this  purpose  (n  =  19).  The  stone  from  each  sample  was 
individually  transferred  to  artificial  seawater  (ASW  + 
stone),  the  combination  was  shaken,  and  the  ASW  and  the 
retained  ambient  seawater  (SW)  were  examined  for  placo- 
zoans. Only  two  placozoans  (mean  size  94  /urn)  were  found 
in  the  SW  from  1  out  of  19  samples,  but  15  placozoans 
(85  ±  28  jam)  were  collected  in  the  ASW  from  5  out  of  19 
samples. 

As  shown  in  Table  1.  in  all  these  positive  samples, 
placozoans  were  obtained  from  the  ASW,  and  the  placozo- 
ans were  not  equally  distributed  in  the  ASW  and  the  SW  (  15 
in  the  ASW  and  2  in  the  SW;  P  <  0.05  ):  and  the  proportion 
of  placozoans  in  the  ASW  was  enriched  compared  with  that 
in  the  SW  (Table  1).  An  association  of  some  placozoans 
with  the  substrate  (or  other  substrate  material  on  it)  rather 
than  with  the  ambient  seawater  was  suggested. 


of  the  />ltieo.o,ui\  <  I'llcetedjroni  Jielil  v/»;/>/o  o/  Siimplin^  in  the  xeiiwuter 


stones 


Experiments  were  carried  OIH  to  determine  whether  the 
placozoans  obtained  by  substrate  sampling  were  associated 


In  earlier  years,  from  November  1989  through  August 
1991.  a  seawater  aquarium  was  also  examined  for  placozo- 
ans. The  slide  sampling,  carried  out  at  intervals  of  1  month 


FIELD  STUDIES  ON   PLACOZOANS 


59 


80  -, 


60  - 


40  - 


20  - 


JASONDJFMAMJJASONDJFMAMJJASOND 

90  91  .92 


Figure  4.  Substrate  sampling  at  the  study  site.  Abscissa,  months  from  July  1990  through  December  1992. 
Ordinate  (left),  number  of  placozoans  obtained  from  samples  of  substrates  at  each  sampling  (squares,  •); 
ordinate  (right),  percentage  of  placozoan-positive  samples  (circles,  O).  Samples  of  natural  substrates  were 
collected  at  intervals  of  about  1  month  ( 12-68  days,  35  days  on  average).  The  number  of  samples  was  variable 
(1-13,  4  on  average);  1-2  from  July  1990  through  January  1991,  3-7  from  February  1991  through  December 
1991,  7-13  from  January  1992  through  July  1992,  and  3-6  from  August  1992  through  December  1992.  Arrows 
indicate  peaks  (October  1990  to  January  1991.  September  1991,  and  August  1992).  The  timing  of  the  peaks  is 
matched  with  that  of  the  large  intermittent  peaks  in  Fig.  3. 


on  average  for  1  '/>  years,  yielded  a  total  of  1 144  placozoans 
from  the  seawater  aquarium  (Fig.  5).  The  animals  were 
obtained  on  most  occasions  (19  out  of  22.  or  86%)  and 
inhabited  98  of  218  (45%)  retrieved  slides. 

Both  the  number  of  placozoans  at  each  sampling  and  the 
percentage  of  slides  with  placozoans  (positive  slides)  varied 


with  time  (Fig.  5).  Many  placozoans  were  obtained  in 
January,  March,  and  April  1990,  and  August  1991.  The 
percentage  of  positive  slides  was  also  high  in  these  months. 
All  of  the  placozoans  exhibited  a  platelike  morphology. 
In  one  sampling,  they  ranged  in  size  from  about  100  jum  to 
300  jLtm  (257  ±  59  jam,  the  mean  ±  SD  of  8  individuals). 


L  •     J.UU 

i 

i 

I 

i 

I 

o 

-  80 

i 

i 

W 

-  60 

•8 

•H 

in 

-  40 

f 

<a 

/ 

•rl 

-  20 

-P 
•H 

H 

0 

--  0 

ft 

NDJFMAMJJASONDJFMAMJJA 

89      90  91 

Figure  5.  Slide  sampling  in  the  seawater  aquarium.  Abscissa,  months  from  November  19S9  through  August 
1991.  Ordinate  (left),  number  of  placozoans  obtained  from  slides  at  each  sampling  (squares.  •);  ordinate  (right), 
percentage  of  placozoan-positive  slides  (circles,  O).  Slides  (3-15,  10  on  average)  that  had  been  placed  in  the 
seawater  aquarium  for  about  1  month  (19-44  days,  31  days  on  average)  were  observed.  Note  that  the  scale  of 
the  left  ordinate  is  much  larger  than  those  in  Figs.  3  and  4. 


60 


Y.  K.  MARUYAMA 


Discussion 

This  study,  carried  out  from  November  1989  to  Novem- 
ber 2000.  at  a  study  site  in  the  subtidal  waters  in  Shirahama, 
showed  that  placozoans  were  present  year-round  and  in 
every  year.  Moreover,  placozoans  were  also  observed  in 
July  1989  at  and  near  To  Island  in  Tanabe  Bay  (V.  B. 
Pearse.  pers.  comm.).  Further,  a  seawater  aquarium  used  to 
hold  transient  stocks  of  local  marine  animals  also  yielded, 
over  1  year,  a  large  number  of  placozoans.  Thus,  these 
animals  have  been  observed  for  more  than  1 1  years  in  the 
Shirahama  area,  and  therefore,  the  population  of  placozoans 
can  be  considered  to  be  stable. 

Unexpectedly,  the  number  of  placozoans  collected  at  the 
subtidal  study  site  showed  large,  intermittent  peaks  that 
occurred  roughly  once  a  year,  between  late  summer  and  the 
beginning  of  winter.  Although  the  habitat  of  the  seawater 
aquarium  was  quite  different  from  that  in  the  field,  a  peak 
also  appeared  in  the  aquarium  samples.  But  this  peak  was 
shifted  from  that  observed  in  the  field  samples.  The  signif- 
icance of  these  fluctuations  is  unresolved. 

Substrate  sampling  in  this  study  was  more  direct  and 
more  productive  for  obtaining  placozoans  in  the  field  than 
the  slide  sampling.  But  the  number  of  organisms  collected 
from  substrate  material  is  not  certain,  because  some  placo- 
zoans are  apparently  detached  from  this  material  during 
transport,  before  the  sampling  procedure  in  the  laboratory 
(see  Table  1 ).  Another  disadvantage  of  substrate  sampling  is 
that  the  fragile  body  may  occasionally  be  damaged  by 
excess  shaking.  Slide  sampling  seems  to  avoid  this  problem, 
providing  placozoans  without  damage.  The  growth  and  re- 
productive patterns  of  placozoans  on  such  slides  with  var- 
ious other  (mixed)  organisms  have  been  reported  (Pearse, 
1989).  Slide  sampling  in  this  study  also  provided  slides  that 
could  be  used  for  rearing  placozoans  (data  not  shown). 
Therefore,  a  combination  of  both  substrate  and  slide  sam- 
pling seems  to  be  the  most  effective  way  to  study  these 
microscopic  animals  from  a  local  site. 

Acknowledgments 

This  study  was  carried  out  at  the  Seto  Marine  Biological 
Laboratory  during  my  stay  there,  and  I  thank  the  staff  of  the 
laboratory.  I  would  like  to  express  thanks  to  Dr.  E.  Harada 
for  suggestions  and  encouragement  during  the  study.  I  also 
thank  Dr.  V.  H.  IV.irse  for  valuable  comments  anil  critical 
reading  of  the  manuscript,  and  for  kindly  allowing  me  to 
reler  to  her  data  on  placozoan  sampling  as  a  personal 
communication. 

I, id      >iire  C'ik'd 

Brusca.  R.  ('..  and  G.  .1.  Brnsi  .1     :  un.      Invertehrales.  2nd  ed.  Smaller 
Associates,  Sunderland,  M\  '.'<    p| 


Conn,  I).  B.  2000.  Atlas  of  Invertebrate  Reproduction  and  Development. 
2nd  ed.  Wiley-Liss.  New  York.  300  pp. 

Grell,  K.  G.  1971.  Trichoplay  tulliaereiis  F.  E.  Schulze  und  die  Entste- 
hung  der  Metazoen.  Mmu'.vs.  Runasch.  24:  160-161. 

Grell,  K.  G.  1982.  Plucozou.  Page  639  in  Synopsis  and  Classification  of 
Living  Organism*.  Vol.  1.  S.  P.  Parker,  ed.  McGraw-Hill.  New  York. 

Grell,  K.  G.,  and  G.  Benwitz.  1971.  Die  Ultrastruktur  von  Triclwplax 
adhaerens  F.  E.  Schulze.  Cvtohio/ogie  4:  216-240. 

Grell,  K.  G.,  and  E.  Lopez-Ochoterena.  1987.  A  new  record  of 
Trichoplax  adhaerens  F.  E.  Schulze  (Phylum  Placozoa)  in  the  Mexican 
Caribbean  sea.  Annies  del  Instituto  ile  Ciencias  del  Mar  \  Lnnnologia. 
Universidad  National  Autonoma  tie  Mexno  14(2):  255-256. 

Grell,  K.  G..  and  A.  Ruthmann.  1991.  Placuzoa.  Pp.  13-27  in  Micro- 
scopic Anatomy  of  Invertebrates,  Vol.  2.  Placo-ou,  Porifera,  Cnidana. 
and  Ctenopliora.  F.  W.  Harrison  and  J.  A.  Westfall.  eds.  Wiley-Liss, 
New  York. 

Levin,  L.  A.,  and  T.  S.  Bridges.  1995.  Pattern  and  diversity  in  repro- 
duction and  development.  Pp.  1-48  in  Ecolog\  of  Marine  Invertebrate 
Larvae.  L.  McEdward.  ed.  CRC  Press,  Boca  Raton.  FL. 

Lincoln,  R..  G.  Boxshall.  and  P.  Clark.  1998.  Appendix  14:  Sediment 
particle  size  categories.  Page  340  in  A  Dictionary  tij >  Ecology.  Evolution 
mill  Systematics.  2nd  ed.  Cambridge  University  Press.  Cambridge. 

Margulis,  L.,  and  K.  V.  Schwartz.  1988.  Five  Kingdoms:  An  Illustrated 
Guide  to  the  Phyla  of  Life  on  Earth,  2nd  ed.  W.  H.  Freeman.  New 
York.  376  pp. 

Miller,  R.  L.  I971a.  Observations  on  Trichoplax  adhaerens  Schulze. 
1883.  Am.  Zool.  11:  698-699. 

Miller,  R.  L.  1971b.  Tricliopla.\  adhaerens  Schulze.  1883:  return  of  an 
enigma.  Biol.  Bull.  141:  374. 

Pearse.  V.  B.  1989.  Growth  and  behas  ior  ot  I  H,  hoplax  adhaerens:  first 
record  of  the  phylum  Placozoa  in  Hawaii.  Pac.  Set.  43:  117-121. 

Pearse,  V.,  J.  Pearse,  M.  Buchsbaum.  and  R.  Buchsbaum.  1987.  Liv- 
ing Invertebrates.  Blackwell  Scientific  Publications  and  The  Boxwood 
Press.  Pacific  Grove.  CA.  848  pp. 

Pearse,  V.  B.,  T.  Uehara.  and  R.  I..  Miller.  1994.  Birefringent  granules 
in  placozoans  (Trichoplax  adhaerens).  Trans.  Am.  Micro.sc.  Sue.  113: 
385-389. 

Schuchert,  P.  1993.  Trichoplax  adhaerens  (Phylum  Placozoa  I  has  cells 
that  react  with  antibodies  against  the  neuropeptidc  RFamide.  Ada  Zoo/. 
74:  115-117. 

Schulze.  F.  E.  1883.  Trichoplax  adhaerens,  no\ .  gen..  no\ .  spec.  Zool. 
An-.  6:  92-97. 

Schwartz,  V.  1984.  The  radial  polar  pattern  ot  differentiation  in  Tricho- 
plax adhaerens  F.  E.  Schulze  I  Placozoa).  Z.  Naturforsch.  Sect.  ('39: 
818-832. 

Sokal,  R.  R.,  and  K.  J.  Rohlf.  1995.  Hiomelrv  I'/ic  Prim  ;/>/o  and 
Practice  of  Statistics  in  Biological  Research.  3d  ed.  W.  H.  Freeman. 
New  York.  887  pp. 

Sudzuki,  M.  1977.  Microscopical  marine  animals  scarcely  known  from 
Jap. in,  II.  Occurrence  of  Trichoplax  I  Placozoa)  in  Shmioda.  I' roe.  Jpn. 
Sue.  Svst.  Zool.  13:  1-4, 

Thiemann.  M..  and  \.  Riithiiiaiin.  1991.  \liernali\e  modes  ot  .iscxu.il 
reproduction  in  Trichopla\  ailhaerens  (Placozoal.  Zoomorpholog\ 
11(1:  1 65- 174. 

Ueda.  T..  S.  Kova,  and  \.  K.  Marinama.  1999.  Dynamic  patterns  in 
the  locomotion  and  feeding  beha\  lors  In  the  placozoan  Trichoplax 
adhaerens  Itiossstcms  54:  65-70. 

I'ehara,  T..  V.  B.  Pearse,  and  K.  Yamazato.  1989.  Bncfrmgent  parti- 
cles observed  in  Trichopla*  adhaerens  ( Placozoa  i.  the  simplest  meta- 
zoan.  /ool.  Sei.  6:  1209. 


ARINE  IXESOURCES  CENTER 


MARINE  BIOLOGICAL  LABORATORY  •  WOODS  HOLE.  MA  02543 
WWW.MBL.EDU/SERVICES/MRC/1NDEX.HTML 


(508)289-7700 


Animal  and  Tissue  Supply  for 
Education  &  Research 

•  150  aQuatic  species  available  for  shipment  via 
online  catalog:  <http://www.mbl.edu/animals/ 
index.html>;  phone:  (508)289-7375;  or 
e-mail:  specimens@mbl.edu 

•  zebrafish  colony  containing  limited  mutant  strains 

•  custom  dissection  and  furnishing  of  specific  organ 
and  tissue  samples 


zebrafish  facilities 


MRC  Services  Available 

•  basic  water  Quality  analysis 

•  veterinary  services  (clinical,  histopathologic, 
microbial  services,  health  certificates,  etc.) 

•  aojjatic  systems  design  (mechanical,  biological, 
engineering,  etc.) 

•  educational  tours  and  collecting  trips  aboard 
the  R/V  Gemma 


Using  the  MRC  for  Your  Research 

•  capability  for  advanced  animal  husbandry  (temperature,  light  control,  etc. 

•  availability  of  year-round,  developmental  life  stages 

•  adaptability  of  tank  system  design  for  live  marine  animal  experimentation 


MBL 

Marine  Biological  Laboratory  •  Woods  Hole  •  MA 

2004  Computational 
Neuroscience  Courses 


Contact:  Carol  Hamel 
Admissions  Coordinator 

(508)  289-7401 
admissions@mbl  edu 

Applications  are  encouraged  from 

women  and  members  of 
underrepresented  minorities. 

The  MBL  is  an  Equal  Opportunity/ 
Affirmative  Action  Employer. 


Generous  financial 
assistance  is  available! 


www.mbl.edu/education 


•  Methods  in  Computational  Neuroscience 

August  1  -  August  29,  2004 

Animals  interact  with  a  complex  world,  encountering  a  variety  of 
challenges  This  course  introduces  students  to  the  computational 
and  mathematical  techniques  that  are  used  to  address  how  the 
brain  solves  these  problems  at  levels  of  neural  organization 
ranging  from  single  membrane  channels  to  operations  of  the  entire 
brain  Application  Deadline  March  5,  2004 

•  Neuroinformatics      August  14  -  29,  2004 

The  ability  to  digitally  acquire,  store  and  analyze  large  volumes  of 
multichannel  data  in  the  neurosciences,  ranging  from  multiple 
spike  trains  to  brain  images,  has  given  rise  to  a  new  and  growing 
body  of  research  This  two-week  course  is  structured  around  the 
related  issues,  and  will  contain  both  pedagogical  lectures  on  basic 
statistical  techniques  as  well  as  focussed  mini-workshops  on 
specific  neuroscience  topics  where  applications  of  these 
techniques  are  critical   Application  Deadline  March  16,  2004. 


MBL 


Marine  Biological  Laboratory  •  Woods  Hole  •  MA 


2004  Microscopy  Course 

Optical  Microscopy  &  Imaging  in  the 
Biomedical  Sciences 


October  5  -  October  14,  2004 

This  course  will  enable  the  participant  to  obtain  and 

interpret  microscope  images  of  high  quality  to  perform 

quantitative  optical  measurements  and  to  produce  video 

and  digital  records  for  documentation  and  analysis. 

Application  Deadline:  June  21,  2004 

Contact:  Carol  Hamel,  Admissions  Coordinator, 
(508)289-7401 ,  admissions@mbl.edu 

Women  and  minorities  encouraged  to  apply. 
The  MBL  is  an  EEO/Affirmative  Action  Institution 

www.mbl.edu/education 


THE 

BIOLOGICAL 
BULLETIN 

2004  Subscription  Rates 
Volumes  206-207 

*Paid  Subscriptions  include  both  print  and  electronic  subscriptions  at:  www.biolbull.org 

Institutional*     Individual* 


One  year  subscription  (6  issues  - 

2  volumes) 

$325.00 

$120.00 

Single  volume   (3  issues) 

$165.00 

$70.00 

Single  Issues 

$  75.00 

$25.00 

*Surface  delivery  included  in  above  prices. 
For  prompt  delivery,  we  encourage  subscribers  outside  the  U.S.  to  request  airmail  service. 

Airmail  Delivery  Charge 

U.S.  and  Canada:  $  45.00 

Mexico:  $  60.00 

All  other  locations:  $100.00 

Orders  Must  Be  Prepaid  in  U.S.  Dollars,  Check  Payable  to  The  Marine  Biological  Laboratory 

About  The  Biological  Bulletin 

ISSN:  0006-3185 

Frequency:  Bimonthly 

Number  of  issues  per  year:  6 

Months  of  Publication:   February,  April,  June,  August,  October,  December 

Subscriptions  entered  for  calendar  year 

Volume  indexes  contained  in  June  and  December  issues 

Annual  report  of  the  Marine  Biological  Laboratory  contained  in  August  issue 

Most  back  issues  available 

Claims  handled  upon  receipt 

No  agency  discounts 

Internet: 
www.biolbull.org 

Please  address  orders  to: 

Wendy  Child 

Subscriptions 

The  Biological  Bulletin 

Marine  Biological  Laboratory 

7  MBL  Street 

Woods  Hole,  MA  02543- 101 5    U.S.A. 
Fax:  508-289-7922  Tel:  508-289-7402  Email:  wchild@mbl.edu 

Published  by  the  Marine  Biological  Laboratory 
Woods  Hole,  Massachusetts,  02543  U.S.A. 


THE  BIOLOGICAL  BULLETIN 

(www.biolbull.org) 

2004  SUBSCRIPTION  FORM 

(VOLUMES  206-207,  6  ISSUES) 


(please  print) 
NAME: 


INSTITUTION: 
ADDRESS: 


CITY: STATE:. 

POSTAL  CODE: COUNTRY:. 

TELEPHONE:  FAX:. 

E-MAIL  ADDRESS 


All  subscriptions  run  on  the  calendar  year;  price  includes  both  print  and  online  journals 

G  Please  send  me  a  2004  subscription  to  The  Biological  Bulletin  at  the  rate  indicated  below: 

O  Individual:  $120.00  (6  ISSUES)  O  Institutional  :  $325.00  (6  ISSUES) 

O  Individual:  $70.00(3  ISSUES)  O  Institutional  :  $165.00  (3  ISSUES) 

Check  one:  G  February  April  June     or     G  August  October  December 

G  Please  send  me  the  following  back  issue(s): 

O  Individual:  at  $25.00  (PER  ISSUE)    O  Institutional  :  at  $75.00  (PER  ISSUE) 

Delivery  Options 

Surface  Delivery  (Surface  delivery  is  included  in  the  subscription  price.) 

Air  delivery  (Please  add  the  correct  amount  to  your  payment.) 


O  U.S.  and  Canada:  $46.00  O  Mexico:  $60.00  O  All  other  locations:  $100.00 
Payment  Options 

Enclosed  is  my  check  or  U.S.  money  order  for  $ payable  to  The  Marine  Biological  Laboratory 

Please  charge  my  O  VISA,  G  MasterCard  G  Discover  Card  $ 

Please  send  me  an  invoice.  (Note:  Payment  must  be  received  before  subscription  commences.) 


Account  No.: Exp.  Date: 

Signature: Date:  


Return  this  form  with  your  check  or  credit  information  to: 

Marine  Biological  Laboratory 

Subscription  Office  4  The  Biological  Bulletin  +7  MBL  Street  +  Woods  Hole,  MA  02543-1015 


POSITION  ANNOUNCEMENT 

Editor-in-Chief 
The  Biological  Bulletin 

Start  Date:  January  2005 
Term:  Five  years,  renewable 


The  Editor-in-Chief  is  responsible  for  the  overall  editorial  direction  of  the  Biological  Bulletin.  The  Editor-in-Chief 
appoints  Associate  Editors  and  members  of  the  Editorial  Board,  decides  which  manuscripts  are  published,  mediates 
editorial  disputes,  and  sets  policy  for  the  journal. 

The  Editor-in-Chief  is  an  independent  contractor  who  reports  to  the  Director  and  CEO  of  the  Marine  Biological 
Laboratory.  Stipend  for  the  position  is  $10,000  annually.  The  Bulletin 's  editorial  offices  are  based  in  Woods  Hole,  but 
the  Editor-in-Chief  may  work  from  his/her  home  institution.  The  Editor-in-Chief  is  expected  to  spend  some  part  of  the 
summer  months  in  Woods  Hole.  Housing  for  up  to  one  month  will  be  provided  in  Woods  Hole. 


The  successful  candidate  for  this 

position  will  meet  the  following 

requirements: 


•  A  broad  understanding  of  biology,  and  a  manifest  interest  in  its 
diversity  and  comparative  and  integrative  aspects 

•  A  track-record  of  publishing  in  peer-reviewed  journals 

•  Experience  reviewing  papers  for  scientific  journals 

•  Proven  skill  as  a  substantive  editor 

•  Ability  to  make  tough  decisions  and  willingness  to  work  with  other  editors 
to  reach  a  decision  on  difficult  papers 

•  Demonstrated  experience  with  the  editorial  process  {e.g. ,  serving  as  an 
Editor  or  Associate  Editor  for  a  journal  similar  to  the  Biological  Bulletin) 

•  The  willingness  and  ability  to  commit  the  time  required,  approximately 
one  day  per  week,  to  fulfill  the  duties  outlined  here  for  five  years. 


Job  description: 


Nomination  packets  must  include 
the  following: 

1.  Letter  of  intent 

2.  Current  CV 

3.  Vision  Statement  for  the  journal 

Send  nominations  to: 

Pamela  Clapp  Hinkle 

Managing  Editor,  Biological  Bulletin 

Marine  Biological  Laboratory 

7  MBL  Street 

Woods  Hole,  MA  02543 

pclapp@mbl.edu 


The  Editor-in-Chief  devotes  a  minimum  of  six  hours  per  week  to  the 
operation  of  the  Biological  Bulletin.  The  Editor's  ongoing  activities  include 

1)  assigning  submitted  papers  to  the  appropriate  Associate  Editor; 

2)  reading  reviews  and  manuscripts  to  ensure  fairness  and  technical 
accuracy;  3)  writing  editorial  decision  letters  based  on  the  reviews; 

4)  fielding  telephone  and  e-mail  queries  on  a  daily  basis  from  authors 
deciding  whether  to  submit  their  work  to  the  Biological  Bulletin,  authors 
who  are  unhappy  about  an  editorial  decision,  and  Associate  Editors 
requesting  guidance  on  such  matters  as  the  identity,  availability, 

and  number  of  reviewers,  and  editorial  decisions  and  disputes; 

5)  communicating  regularly  (by  telephone  or  e-mail)  with  the  Managing 
Editor  and  other  editorial  staff  members  to  plan  future  issues,  to  arrange  the 
table  of  contents,  to  develop  the  issue  cover,  and  to  discuss  organizational 
issues;  6)  editing  accepted  manuscripts  as  necessary  for  substance, 
accuracy,  and  clarity;  7)  selecting  cover  photos  and  writing  associated 
legends;  8)  informing  editorial  staff  of  noteworthy  articles  for  the  media; 

9)  as  the  deadline  for  each  issue  approaches,  deciding  which  manuscripts 
will  be  published. 


Marine  Biological  Laboratory  •  Woods  Hole  •  Massachusetts 


The   Bar  Has  Been   Raised 

Axioplan  2   Research   Microscope. 


A  digital  microscope  designed 
for  the  future,  Zeiss  Axioplan  2 
Imaging  is  a  marvel  of  modern 
engineering.  With  new  optics  of 
high  light  transmission,  precision 
of  its  innovative  components 
and  infinite  flexibility,  Axioplan  2 
is  a  reliable  partner  that  meets 


the  latest  demanding  requirements 
today  and  for  the  years  to  come. 
No  wonder  the  Axioplan  2  Imaging 
has  become  the  best  selling 
research  microscope  in  America! 

For  information  about  Zeiss 
products  please  call  800-233-2343 
or  visit  us  online:  zeiss.com/micro. 


ZEISS 


We  make  it  visible. 


Carl  Zeiss  Microlmaging,  Inc.  •  Thornwood,  NY  10594  •  micro@zeiss.com 


April  2004 


THE 


Volume  206  •  Number  2 


BIOLOGICAL 
BULLETIN 


Published  by  the  Marine  Biological  Laboratory 
Woods  Hole,  Massachusetts 


THE  BIOLOGICAL  BULLETIN 


ONLINE 


The  Marine  Biological  Laboratory  is  pleased       beginning  with  the  October  1976  issue 

to  announce  that  the  full  text  of  The  Biological      (Volume  151,  Number  2),  and  some  Tables  of 

Bulletin  is  available  online  at  Contents  are  online  beginning  with  the 

October  1965  issue  (Volume  129,  Number  2). 


http://www.biolbull.org 

The  Biological  Bulletin  publishes  outstanding 
experimental  research  on  the  full  range 
of  biological  topics  and  organisms,  from  the 
fields  of  Neurobiology,  Behavior,  Physiology, 
Ecology,  Evolution,  Development  and 
Reproduction,  Cell  Biology,  Biomechanics, 
Symbiosis,  and  Systematics. 

Published  since  1897  by  the  Marine 
Biological  Laboratory  (MBL)  in  Woods  Hole, 
Massachusetts,  The  Biological  Bulletin  is  one 
of  America's  oldest  peer-reviewed  scientific 
journals. 

The  journal  is  aimed  at  a  general  readership, 
and  especially  invites  articles  about  those 
novel  phenomena  and  contexts  characteristic 
of  intersecting  fields. 

The  Biological  Bui/elm  Online  contains  the 
full  content  of  each  issue  of  the  journal, 
including  all  figures  and  tables,  beginning 
with  the  February  2001  issue  (Volume  200, 
Number  1).  The  full  text  is  searchable  by- 
keyword,  and  the  cited  references  include 
hyperlinks  to  Medline.  PDF  files  are  available 
beginning  in  February  1990  (Volume  178, 
Number  1),  some  abstracts  are  available 


Each  issue  will  be  placed  online 
approximately  on  the  date  it  is  mailed  to 
subscribers;  therefore  the  online  site  will  be 
available  prior  to  receipt  of  your  paper  copy. 
Online  readers  may  want  to  sign  up  for  the 
eTOC  (electronic  Table  of  Contents)  service, 
which  will  deliver  each  new  issue's,  table  of 
contents  via  e-mail.  The  web  site  also 
provides  access  to  information  about  the 
journal  (such  as  Instructions  to  Authors,  the 
Editorial  Board,  and  subscription 
information),  as  well  as  access  to  the  Marine 
Biological  Laboratory's  web  site  and  other 
Biological  Bulletin  electronic  publications. 

The  free  trial  period  for  access  to  The 
Biological  Bulletin  online  has  ended. 
Individuals  and  institutions  who  are 
subscribers  to  the  journal  in  print  or  are 
members  of  the  Marine  Biological 
Laboratory  Corporation  may  now  activate 
their  online  subscriptions.  All  other  access 
(e.g.,  to  Abstracts,  eTOCs,  searching, 
Instructions  to  Authors)  remains  freely 
available.  Online  access  is  included  in  the 
print  subscription  price. 

For  more  information  about  subscribing  or 
activating  your  online  subscription,  visit 
<www.biolbull.org/subscriptions>. 


http://www.biolbull.org 


CIENCE 


mmr 


EHICLE. 


MOTORIZED 

INVERTED 

MICROSCOPE. 


icroscope  will  position 

research  lab  at  the  very 
juard  of  multi-wavelength 
advanced  fluorescence,  DIG 
and  deconvolution  techniques. 

It  is  totally  motorized  from 
the  built-in  Z-Drive, 
6-position  nosepiece, 
6-position  condenser, 
6-position  fluorescence  filter 
turret,  and  transmitted  and 


Nine  access  ports  allow  you 
to  keep  dedicated  cameras 
and  lasers  in  place  and  still 
have  plenty  of  ports  available 
for  new  devices. 

The  1X81  demonstrates 
Olympus'  leadership  in 
Total  Internal  Reflection 
Fluorescence  Microscopy 
(TIRFM)  with  exceptional  ease 
of  operation  and  features 
such  as  the  fully  integrated 
TIRFM  illuminator,  a  1 .45  NA 
TIRFM  objective  and  the 
exclusive  1 .65  NA  objective. 

The  Olympus  1X81  provides 
extraordinary  system 
flexibility  that  will  satisfy 
the  most  demanding 
research  applications. 


OLYMPUS 


ROCKET  SCIENCE  M. 


800-455-8236 


"'•  2003  OLYMPUS  AMERICA  INC 


OLYMPUS 


Cover 


The  animals  shown  on  the  cover  are  dona  intesti- 
nalis, an  ascidian  (here  attached  to  a  mussel),  and 
Muggiaea  kochi,  a  siphonophore.  Fertilization  in 
these  marine  organisms,  as  in  many  others,  is  ex- 
ternal. But  sperm  survive  only  briefly  in  seawater, 
so  they  would  be  more  effective  if  they  could  locate 
the  eggs  rapidly.  More  than  50  years  ago,  Jean  Dan 
reported,  in  this  journal,  a  specific  attraction  be- 
tween the  sperm  and  eggs  of  a  hydromedusa  ( 1 ). 
Since  then,  attractive  substances  that  affect  sperm 
motility  and  behavior  have  been  widely  detected  in 
eggs  and  related  structures  and,  in  a  few  species, 
have  been  chemically  identified. 

The  effect  of  a  sperm-attracting  factor,  partially  puri- 
fied from  the  eggs  of  dona  intestinalis  (2).  is  illus- 
trated in  a  video  image  on  the  cover  (upper  left).  A 
pipette  is  filled  with  agar  impregnated  with  attractant. 
and  its  tip  (diameter,  —30  jam)  is  immersed  in  a  drop 
of  dona  sperm  suspension.  In  response  to  the  gradi- 
ent of  factor,  sperm  swim  in  spiral  paths  with  a  con- 
stant radius  and  with  a  straight  trajectory  aimed  to- 
ward the  pipette  tip — the  source  of  attractant.  Note 
that  this  characteristic  behavior  (chemotaxis)  is  un- 
changed as  the  sperm  approaches  the  attractant  and. 
therefore,  as  the  local  concentration  of  attractant  in- 
creases. The  chemotaxis  of  siphonophore  sperm  dif- 
fers from  that  of  dona:  both  the  radius  of  the  spiral 
and  the  direction  of  the  trajectory  change  markedly  as 
the  sperm  approaches  the  source  of  attractant.  Thus,  in 
their  evolution,  these  two  species  have  acquired  dif- 
ferent strategies  for  sperm  chemotaxis. 

As  an  approach  to  this  phenomenon  and,  more 
generally,  to  the  mechanisms  underlying  sperm  che- 
motaxis, Makiko  Ishikawa.  Hidekazu  Tsutsui.  and 
their  colleagues  propose,  in  this  issue  of  The  Bio- 
logical Bulletin  (p.  95).  two  models  of  sperm 
chemolaxis — one  for  ascidians  (e.g.,  dona  intes- 
tiniilis).  and  one  for  siphonophores  (e.g.,  Muggiaea 
kuclii).  Both  models  are  based  on  prior  experimen- 
tal evidence,  and  they  share  a  common  assumption: 
that  the  radius  of  the  spiral  path  is  inversely  depen- 
dent upon  the  intracellular  calcium  ion  concentra- 
tion ([Ca2'  I,).  Modeling  the  ascidian  chemotaxis  re- 
quired one  additional  assumption:  that  the  [Ca '  2|,.  in 
turn,  depend  on  the  change  in  attractant  concentration 


with  time.  The  siphonophore  model — in  addition  to 
the  common  assumption — requires  also  that  [Ca+2]j 
depend  on  the  local  concentration  of  attractant.  and 
that  the  enzymatic  efflux  of  Ca+2  be  substantially 
slower  than  its  influx,  raising  the  [Ca+2],. 

On  the  cover,  the  two  sets  of  calculated  data  are 
plotted  on  graphs  representing  (in  the  -  axis)  the 
profile  of  an  attractant  soon  after  it  begins  diffusing 
from  a  point  source  centered  in  a  small  area  (4 
mm2).  Note  that  this  concentration  gradient  is  small 
until  very  near  the  source  of  attractant,  when  it 
spikes.  The  ascidian  model  (top  plot)  is  a  spiral  path 
that  changes  little  until  the  sperm  reaches  the  steep 
portion  of  the  attraction  gradient,  very  close  to  the 
source.  In  contrast,  the  siphonophore  model  is  a  wide 
spiral  path  that  narrows  markedly  and  curves  tightly 
toward  the  source  as  the  sperm  approaches  it  (lower 
plot).  Both  models  approximate  experimental  results. 

This  study  suggests  that  only  a  small  number  of  crit- 
ical parameters  are  required  to  model  sperm  chemo- 
taxis. Presumably  these  parameters  reflect  mecha- 
nisms underlying  the  behavior,  and  they  may  be 
amenable  to  experimentation,  eventually  explaining 
species  differences  and  their  adaptive  significance. 

The  video  image  was  provided  by  Makiko  Ishi- 
kawa, and  the  plots  of  the  ascidian  and  siphono- 
phore model  trajectories  by  Hidekazu  Tsutsui 
(Misaki  Marine  Biological  Station.  Tokyo  Univer- 
sity). The  drawing  of  dona  intestinalis  is  from 
Millar.  1970  (3),  and  that  of  Muggiaea  kochi  is 
from  Chun.  1882  (4).  Stalwarts  in  the  search  for 
illustrations  were  George  Mackie  (University  of 
Victoria.  Canada),  Claudia  Mills  (University  of 
Washington).  Phil  Pugh  (Southampton  Oceanogra- 
phy Centre),  Casey  Dunn  (Yale  University  and 
1'Observatoire  Oceanologique  de  Villefranche-sur- 
Mer),  Gretchen  Lambert  (Seattle).  Patricia  Mather 
(Queensland  Museum.  Australia),  and  Nancy  Staf- 
ford and  Eleanor  Uhlinger  (MBLAVHOI  Library. 
Woods  Hole).  The  cover  was  designed  by  Beth 
Liles  (Marine  Biological  Laboratory,  Woods  Hole). 

I  Dun.  .1.  f.  I95D.     Hi,-/.  Hull  «W:4I2-4I5. 

2.  Yoshida  cl  til..  1<W.     /)<•>•.  Growth  />///<•/•.  36:.W)-:W. 

.V  Millar.  R.  tl.  l'*70.     ISiin^h  .-Uiv'i/H/ii.v.  Academic  Press.  London. 

4,  I'hun.  C.  1XN2.     Sit:uuK->hcr.  I'rcms.  ALiJ   Hnv  52:1155-1172. 


THE 


BIOLOGICAL  BULLETIN 

APRIL  2004 


Editor 


Associate  Editors 


Section  Editor 


Online  Editors 


Editorial  Board 


Editorial  Office 


MICHAEL  J.  GREENBERG 

Loins  E.  BURNETT 
R.  ANDREW  CAMERON 
CHARLES  D.  DERBY 
MICHAEL  LABARBERA 


The  Whitney  Laboratory,  University  of  Florida 

Grice  Marine  Laboratory,  College  of  Charleston 
California  Institute  of  Technology 
Georgia  State  University 
University  of  Chicago 


SHINYA  INDUE,  Imaging  and  Microscop\      Marine  Biological  Laboratory 


JAMES  A.  BLAKE,  Keys  to  Marine 
Invertehnites  of  the  Woods  Hole  Region 
WILLIAM  D.  COHEN,  Marine  Models 
Electronic  Record  and  Compendia 

PETER  B.  ARMSTRONG 
JOAN  CERDA 
ERNEST  S.  CHANG 
THOMAS  H.  DIETZ 
RICHARD  B.  EMLET 
DAVID  EPEL 

KENNETH  M.  HALANYCH 
GREGORY  HINKLE 
NANCY  KNOWLTON 
MAKOTO  KOBAYASHI 
ESTHER  M.  LEISE 
DONAL  T.  MANAHAN 
MARGARET  McFALL-NcAi 
MARK  W.  MILLER 
TATSUO  MOTOKAWA 
YOSHITAKA  NAGAHAMA 
SHERRY  D.  PAINTER 
J.  HERBERT  WAITE 
PHIL  YUND 
RICHARD  K.  ZIMMER 

PAMELA  CLAPP  HINKLE 
VICTORIA  R.  GIBSON 
CAROL  SCHACHINGER 
WENDY  CHILD 


ENSR  Marine  &  Coastal  Center,  Woods  Hole 
Hunter  College.  City  University  of  New  York 


University  of  California,  Davis 

Center  of  Aquaculture-IRTA,  Spain 

Bodega  Marine  Lab..  University  of  California,  Davis 

Louisiana  State  University 

Oregon  Institute  of  Marine  Biology,  Univ.  of  Oregon 

Hopkins  Marine  Station,  Stanford  University 

Auburn  University,  Alabama 

Dana  Farber  Cancer  Institute,  Boston 

Scripps  Inst.  Oceanography  &  Smithsonian  Tropical  Res.  Insl. 

Hiroshima  University  of  Economics,  Japan 

University  of  North  Carolina  Greensboro 

University  of  Southern  California 

Kevvalo  Marine  Laboratory,  University  of  Hawaii 

Institute  of  Neurobiology,  University  of  Puerto  Rico 

Tokyo  Institute  of  Technology,  Japan 

National  Institute  for  Basic  Biology.  Japan 

Marine  Biomed.  Inst..  Univ.  of  Texas  Medical  Branch 

University  of  California,  Santa  Barbara 

University  of  New  England,  Biddeford.  ME 

University  of  California,  Los  Angeles 

Managing  Editor 

Staff  Editor 

Editorial  Associate 

Subscription  &  Advertising  Administrator 


Published  by 

MARINE  BIOLOGICAL  LABORATORY 
Woons  HOLE,  MASSACHUSETTS 


http://www.biolbull.org 


CONTENTS 


VOLUME  206,  No.  2:  APRIL  2004 


RESEARCH  NOTE 


Edmunds,  Peter  J.,  and  Ruth  D.  Gates 

Size-dependent  differences  in  the  photophysiology 
of  the  reef  coral  Parties  astreoides 


NEUROBIOLOGY  AND  BEHAVIOR 

Lindsay,  Sara  M.,  Timothy  J.  Riordan,  Jr.,  and  D.  Forest 

Identification  and  activity-dependent  labeling  of 
peripheral  sensory  structures  on  a  spionid 
polychaete 65 


PHYSIOLOGY  AND  BIOMECHANICS 

Harper,  S.  L.,  and  C.  L.  Reiber 

Physiological  development  of  the  embryonic  and  lar- 
val crayfish  heart 78 


Ehlinger,  Gretchen  S.,  and  Richard  A.  Tankersley 

Survival  and  development  of  horseshoe  crab  (Limn/us 
pobiphemus)  embryos  and  larvae  in  hypersaline  condi- 
tions   87 

CELL  BIOLOGY 

Ishikawa,    Makiko,    Hidekazu   Tsutsui,  Jacky   Cosson, 
Yoshitaka  Oka,  and  Masaaki  Morisawa 

Strategies  for  sperm  chemotaxis  in  die  siphonophores 

and  ascidians:  a  numerical  simulation  study 95 

ECOLOGY  AND  EVOLUTION 

Last,  Kim  S.,  and  Peter  J.  W.  Olive 

Interaction  between  photoperiod  and  an  endoge- 
nous seasonal  factor  in  influencing  the  diel  loco- 
motor  activity  of  the  benthic  polychaete  Nereis  vi- 
rens  Sars 103 

Greenwood,  Paul  G.,  Kyle  Garry,  April  Hunter,  and 

Miranda  Jennings 

Adaptable  defense:  a  nudibianch  mucus  inhibits 
nematocyst  discharge  and  changes  with  prey  type  ...  113 


THE  BIOLOGICAL  BULLETIN 

THE  BIOLOGICAL  BULLETIN  is  published  six  times  a  year  by  the  Marine  Biological  Laboratory,  7  MBL  Street, 
Woods  Hole.  Massachusetts  02543. 

Subscriptions  and  similar  matter  should  be  addressed  to  Subscription  Administrator,  THE  BIOLOGICAL 
BULLETIN.  Marine  Biological  Laboratory.  7  MBL  Street.  Woods  Hole.  Massachusetts  02543.  Subscription 
includes  bolh  print  and  online  journals.  Subscription  per  year  (six  issues,  two  volumes):  $325  for  libraries:  $120 
for  individuals.  Subscription  per  volume  (three  issues):  $165  for  libraries:  $70  for  individuals.  Back  and  single 
issues  (subject  to  availability):  $75  for  libraries;  $25  for  individuals. 

Communications  relative  to  manuscripts  should  be  sent  to  Michael  J.  Greenherg.  Editor-in-Chief,  or  Pamela 
Clapp  Hmkle.  Managing  Editor,  at  the  Marine  Biological  Laboratory.  7  MBL  Street.  Woods  Hole.  Massachusetts 
02543.  Telephone:  (508)  284-7149.  FAX:  50X-2S9-7922.  E-mail:  pclapptffmbl.edu. 


http://www.biolbull.org 

THE  BIOLOGICAL  BULLETIN  is  indexed  in  bibliographic  services  including  Index  Medicus  and  MED- 
LINE,  Chemical  Abstracts.  Current  Contents,  Elsevier  BIOBASE/Current  Awareness  in  Biological 
Sciences,  and  Geo  Abstracts. 

Printed  on  acid  free  paper, 
effective  with  Volume  180,  Issue  1.  1991. 


POSTMASTER:  Send  address  changes  to  THE  BIOLOGICAL  BULLETIN,  Marine  Biological  Laboratory, 

7  MBL  Street,  Woods  Hole,  MA  02543. 

Copyright  ©  2004,  by  the  Marine  Biological  Laboratory 

Periodicals  postage  paid  at  Woods  Hole,  MA,  and  additional  mailing  offices. 

ISSN  0006-3185 


INSTRUCTIONS  TO  AUTHORS 


The  Biological  Bulletin  accepts  outstanding  original  research 
reports  of  general  interest  to  biologists  throughout  the  world. 
Papers  are  usually  of  intermediate  length  (10-40  manuscript 
pages).  A  limited  number  of  solicited  review  papers  may  be 
accepted  after  formal  review.  A  paper  will  usually  appear  within 
four  months  after  its  acceptance. 

Very  short,  especially  topical  papers  (less  than  9  manuscript 
pages  including  tables,  figures,  and  bibliography)  will  be  published 
in  a  separate  section  entitled  '•Research  Notes."  A  Research  Note 
in  The  Biological  Bulletin  follows  the  format  of  similar  notes  in 
Nature.  It  should  open  with  a  summary  paragraph  of  1 50  to  200 
words  comprising  the  introduction  and  the  conclusions.  The  rest  of 
the  text  should  continue  on  without  subheadings,  and  there  should 
be  no  more  than  30  references.  References  should  be  referred  lo  in 
the  text  by  number,  and  listed  in  the  Literature  filed  section  in  the 
order  that  they  appear  in  the  Icxt.  Unlike  references  in  Nature, 
references  in  the  Research  Notes  section  should  conlorm  in 
punclualion  and  arrangement  lo  the  style  of  recent  issues  of  /'//<• 
Biological  liiilli'lin.  Materials  and  Methods  should  he  incorpo- 
rated into  appropriate  ligure  legends.  See  the  article  In  I  ec 
(October  20I>:>.  Vol.  205:  W-IOI  I  for  sample  style.  A  Research 
Note  will  usually  appear  within  Iwo  months  alter  its  acceptance. 

The  Editorial  Board  requests  that  regular  manuscripts  con- 
form lo  the  requirements  set  below;  those  manuscripts  that  do 
not  conform  \vill  be  relumed  lo  authors  tor  correction  before 
rev  ie\v . 


I.  Manuscripts.  Manuscripts,  including  figures,  should  be 
submitted  in  quadruplicate,  with  the  originals  clearly  marked. 
(Xerox  copies  of  photographs  are  not  acceptable  for  review  pur- 
poses.) Please  include  an  electronic  copy  of  the  text  of  the  manu- 
script. Label  the  disk  with  the  name  of  the  first  author  and  the  name 
and  version  of  the  wordprocessing  software  used  to  create  the  file. 
If  the  file  was  not  created  in  some  version  of  Microsoft  Word,  save 
the  text  in  rich  text  format  (rtf).  The  submission  letter  accompa- 
nying the  manuscript  should  include  a  telephone  number,  a  FAX 
number,  and  (if  possible)  an  E-mail  address  for  the  corresponding 
author.  The  original  manuscript  must  be  typed  in  no  smaller  than 
12  pitch  or  10  point,  using  double  spacing  (iuchuliiig  tigtire  leg- 
ends, footnotes,  bibliography,  etc.)  on  one  side  of  16-  or  20-lb. 
bond  paper.  8  by  11  inches.  Please,  no  right  justification.  Manu- 
scripts should  be  proofread  carefully  and  errors  corrected  legibly 
in  black  ink.  Pages  should  be  numbered  consecutively.  Margins  on 
all  sides  should  be  at  least  1  inch  (2.5  cm).  Manuscripts  should 
conlorm  to  the  Council  of  Biology  Editor*  Slv/e  Manual.  5th 
I'dition  (f  onncil  of  Biology  Editors.  I9S3)  and  to  American  spell- 
ing. Unusual  abbreviations  should  be  kept  to  a  minimum  and 
should  be  spelled  out  on  first  reference  as  well  as  defined  in  a 
footnote  on  the  title  page.  Manuscripts  should  be  divided  into  the 
following  components:  Title  page.  Abstract  (of  no  more  than  200 
words).  Introduction,  Materials  and  Methods.  Results.  Discussion. 
Acknowledgments,  Literature  filed.  Tables,  and  Figure  Legends. 
In  addition,  authors  should  supply  a  list  of  words  and  phrases 
under  which  the  article  should  he  indexed. 


2.  Title  page.     The  title  page  consists  of  a  condensed  title  or 
running  head  of  no  more  than  35  letters  and  spaces,  the  manuscript 
title,  authors'   names  and  appropriate  addresses,  and  footnotes 
listing  present  addresses,  acknowledgments  or  contribution  num- 
bers, and  explanation  of  unusual  abbreviations. 

3.  Figures.     The  dimensions  of  the  printed  page,  7  by  9 
inches,  should  be  kept  in  mind  in  preparing  figures  for  publication. 
We  recommend  that  figures  be  about  1  times  the  linear  dimensions 
of  the  final  printing  desired,  and  that  the  ratio  of  the  largest  to  the 
smallest  letter  or  number  and  of  the  thickest  to  the  thinnest  line  not 
exceed  1:1.5.  Explanatory  matter  generally  should  be  included  in 
legends,  although  axes  should  always  be  identified  on  the  illustra- 
tion itself.  Figures  should  be  prepared  for  reproduction  as  either 
line  cuts  or  halftones.  Figures  to  be  reproduced  as  line  cuts  should 
he   unmounted  glossy   photographic  reproductions  or  drawn   in 
black  ink  on  white  paper,  good-quality  tracing  cloth  or  plastic,  or 
blue-lined  coordinate  paper.  Those  to  be  reproduced  as  halftones 
should  be  mounted  on  board,  with  both  designating  numbers  or 
letters  and  scale  bars  affixed  directly  to  the  figures.  All  figures 
should  he  numbered  in  consecutive  order,  with  no  distinction 
between  text  and  plate  figures  and  cited,  in  order,  in  the  text.  The 
author's  name  and  an  arrow  indicating  orientation  should  appear 
on  the  reverse  side  of  all  figures. 

Digital  art:  The  Biological  Bulletin  will  accept  figures  sub- 
mitted in  electronic  form;  however,  digital  art  must  conform  to  the 
following  guidelines.  Authors  who  create  digital  images  are 
wholly  responsible  for  the  quality  of  their  material,  including  color 
and  halftone  accuracy. 

Format.  Acceptable  graphic  formats  are  TIFF  and  EPS.  Color 
submissions  must  be  in  EPS  format,  saved  in  CMKY  mode. 

Sofnvare.  Preferred  software  is  Adobe  Illustrator  or  Adobe 
Photoshop  for  the  Mac  and  Adobe  Photoshop  for  Windows.  Spe- 
cific instructions  for  artwork  created  with  various  software  pro- 
grams are  available  on  the  Web  at  the  Digital  Art  Information  Site 
maintained  by  Cadmus  Professional  Communications  at  http:// 
cpc.cadmus.com/da/ 

Resolution.  The  minimum  requirements  for  resolution  are 
1200  DPI  for  line  art  and  300  for  halftones. 

Size.  All  digital  artwork  must  be  submitted  at  its  actual 
printed  size  so  that  no  scaling  is  necessary. 

Multipancl  figures.  Figures  consisting  of  individual  parts 
(e.g..  panels  A,  B,  C)  must  be  assembled  into  final  format  and 
submitted  as  one  file. 

Hard  copy.  Files  must  be  accompanied  by  hard  copy  for  use 
in  case  the  electronic  version  is  unusable. 

Disk  identification.  Disks  must  be  clearly  labeled  with  the 
following  information:  author  name  and  manuscript  number;  for- 
mat (PC  or  Macintosh);  name  and  version  of  software  used. 

Color:  The  Biological  Bulletin  will  publish  color  figures  and 
plates,  but  must  bill  authors  for  the  actual  additional  cost  of 
printing  in  color.  The  process  is  expensive,  so  authors  with  more 
than  one  color  image  should — consistent  with  editorial  concerns, 
especially  citation  of  figures  in  order — combine  them  into  a  single 
plate  to  reduce  the  expense.  On  request,  when  supplied  with  a  copy 
of  a  color  illustration,  the  editorial  staff  will  provide  a  pre-publi- 
cation  estimate  of  the  printing  cost. 

4.  Tables,  footnotes,  figure  legends,  etc.     Authors  should 
follow  the  style  in  a  recent  issue  of  The  Biological  Bulletin  in 


preparing  table  headings,  figure  legends,  and  the  like.  Because  of 
the  high  cost  of  setting  tabular  material  in  type,  authors  are  asked 
to  limit  such  material  as  much  as  possible.  Tables,  with  their 
headings  and  footnotes,  should  be  typed  on  separate  sheets,  num- 
bered with  consecutive  Arabic  numerals,  and  placed  after  the 
Literature  Cited.  Figure  legends  should  contain  enough  informa- 
tion to  make  the  figure  intelligible  separate  from  the  text.  Legends 
should  be  typed  double  spaced,  with  consecutive  Arabic  numbers, 
on  a  separate  sheet  at  the  end  of  the  paper.  Footnotes  should  he 
limited  to  authors'  current  addresses,  acknowledgments  or  contri- 
bution numbers,  and  explanation  of  unusual  abbreviations.  All 
such  footnotes  should  appear  on  the  title  page.  Footnotes  are  not 
normally  permitted  in  the  body  of  the  text. 

5.  Literature  cited.  In  the  text,  literature  should  be  cited  by 
the  Harvard  system,  with  papers  by  more  than  two  authors  cited  as 
Jones  eta/..  1980.  Personal  communications  and  material  in  prep- 
aration or  in  press  should  be  cited  in  the  text  only,  with  author's 
initials  and  institutions,  unless  the  material  has  been  formally 
accepted  and  a  volume  number  can  be  supplied.  The  list  of 
references  following  the  text  should  be  headed  Literature  Cited, 
and  must  be  typed  double  spaced  on  separate  pages,  conforming  in 
punctuation  and  arrangement  to  the  style  of  recent  issues  of  The 
Biological  Bulletin.  Citations  should  include  complete  titles  and 
inclusive  pagination.  Journal  abbreviations  should  normally  follow 
those  of  the  U.  S.  A.  Standards  Institute  (LISASI),  as  adopted  by 
BIOLOGICAL  ABSTRACTS  and  CHEMICAL  ABSTRACTS,  with  the  minor 
differences  set  out  below.  The  most  generally  useful  list  of  bio- 
logical journal  titles  is  that  published  each  year  by  BIOLOGICAL 
ABSTRACTS  (BIOSIS  List  of  Serials;  the  most  recent  issue).  Foreign 
authors,  and  others  who  are  accustomed  to  using  THE-:  WORLD  LIST 
OF  SCIENTIFIC  PERIODICALS,  may  find  a  booklet  published  by  the 
Biological  Council  of  the  U.K.  (obtainable  from  the  Institute  of 
Biology,  41  Queen's  Gate,  London,  S.W.7.  England.  U.K.)  useful, 
since  it  sets  out  the  WORLD  LIST  abbreviations  for  most  biological 
journals  with  notes  of  the  USASI  abbreviations  where  these  differ. 
CHEMICAL  ABSTRACTS  publishes  quarterly  supplements  of  addi- 
tional abbreviations.  The  following  points  of  reference  style  for 
THE  BIOLOGICAL  BULLETIN  differ  from  USASI  (or  modified  WORLD 
LIST)  usage: 

A.  Journal  abbreviations,  and  book  titles,  all  underlined  (for 
italics) 

B.  All  components  of  abbreviations  with  initial  capitals  (not 
as  European  usage  in  WORLD  LIST  e.g..  J.  Cell.  Comp.  Ph\siol. 
NOT  J.  cell,  comp.  Phyxiol.  I 

C.  All  abbreviated  components  must  be  followed  by  a  period, 
whole  word  components  11111x1  not  (i.e..  J.  Cancer  Res.) 

D.  Space   between   all   components   (e.g..   J.    Cell.    Comp. 
Phyxiol..  not  J.Cell.Comp.Phyxiol.) 

E.  Unusual  words  in  journal  titles  should  be  spelled  out  in 
lull,  rather  than  employing  new  abbreviations  invented  by  the 
author.  For  example,  use  Kit  Visindajjelags  lx/e>nli/igu  without 
abbreviation. 

F.  All  single  word  journal  titles  in  full  (e.g..  \'eliger.  Ecol- 
og\.  Brain). 


G.  The  order  of  abbreviated  components  should  be  the  same 
as  the  word  order  of  the  complete  title  (i.e..  Proc.  and  Trans. 
placed  where  they  appear,  not  transposed  as  in  some  BIOLOGICAL 
ABSTRACTS  listings). 

H  A  few  well-known  international  journals  in  their  preferred 
forms  rather  than  WORLD  LIST  or  USASI  usage  (e.g.,  Nature. 
Science,  Evolution  NOT  Nature.  Ltmd.,  Science.  N.Y.;  Evolution. 
Lancaster.  Pa. ) 

6.  Sequences.  By  the  time  a  paper  is  sent  to  the  press,  all 
nucleotide  or  amino  acid  sequences  and  associated  alignments 
should  have  been  deposited  in  a  generally  accessible  database 


(e.g.,  GenBank,  EMBL,  SwissProt),  and  the  sequence  accession 
number  should  be  provided. 

7.  Reprints,  page  proofs,  and  cliarges.  Authors  may  pur- 
chase reprints  in  lots  of  100.  Forms  for  placing  reprint  orders  are 
sent  with  page  proofs.  Reprints  normally  will  be  delivered  about  2 
to  3  months  after  the  issue  date.  Authors  will  receive  page  proofs 
of  articles  shortly  before  publication.  They  will  be  charged  the 
current  cost  of  printers'  time  for  corrections  to  these  (other  than 
corrections  of  printers'  or  editors'  errors ).  Other  than  these  charges 
for  authors'  alterations.  The  Biological  Bulletin  does  not  have 
page  charges. 


Reference:  Bio/.  Bull.  206:  61-64.  (April  2004) 
©  2004  Marine  Biological  Laboratory 


Size-Dependent  Differences  in  the  Photophysiology  of 
the  Reef  Coral  Porites  astreoides 

PETER  J.  EDMUNDS'  *  AND  RUTH  D.  GATES2 

1  Department  of  Biology,  California  State  University,  181 1 1  Nordhoff  Street,  Northridge, 
California  91330-8303:  and  2  The  Hawai'i  Institute  of  Marine  Biology.  University  of  Hawaii  Manoa. 

P.O.  Box  1346.  Kaneohe.  Hawai'i  96744 


The  recruitment  and  sun'ival  of  juvenile  corals  is  central 
to  tire  maintenance  of  coral  reef  communities  ami  the  re- 
population  of  denuded  reef  substrata.  Although  it  is  widelv 
accepted  that  the  mortality  of  scleractinians  is  inversely 
proportional  to  size,  the  biotic  and  abiotic  factors  that  drive 
this  trend  remain  unclear.  Here  we  measure  the  mortality  of 
corals  on  the  reefs  of  St.  John  (U.S.  Virgin  Islands  >  to 
demonstrate  that  small  corals  are  more  likely  to  die  than 
their  larger  counterparts,  and  we  explore  whether  the  pho- 
tophysiological  performance  of  juveniles  in  two  size  classes 
can  provide  some  insight  into  why  smaller  corals  are  so 
vulnerable.  To  evaluate  photophysiological  performance, 
we  examined  chlorophyll  fluorescence  in  r\vo  size  classes 
(mean  diameters  15  mm  and  45  mm)  of  juvenile  colonies  of 
Porites  astreoides  exposed  for  short  periods  to  ambient  and 
elevated  temperatures.  Our  results  show  that  the  photo- 
physiology  of  these  size  classes  differs  under  ambient  con- 
ditions, with  dark-adapted  i/iiantnm  yield  (F,./F,,,)  being 
significantly  higher  in  smaller  compared  to  higgcr  juve- 
niles. As  expected,  the  photophysiology  of  both  size  classes 
is  negatively  impacted  by  thermal  stress,  and  although 
size-related  trends  are  evident  in  our  data,  the  interaction 
benveen  size  and  temperature  is  not  statistically  significant. 
Thus,  while  there  is  size  dependency  in  the  photophysiologi- 
cal perfonnance  of  juvenile  colonies  of  P.  astreoides,  the 
link  between  this  aspect  of  scleractinian  biology  and  the 
higher  mortality  of  small  juvenile  corals  in  the  face  of  high 
thermal  stress  remains  unclear. 

As  a  context  for  this  study,  we  draw  on  mortality  data  for 
different  size  classes  of  corals  at  five  sites  on  the  shallow 
reefs  of  St.  John.  Between  1996  and  2002,  the  annual 


Received  10  October  2003:  accepted  12  January  2004. 
*To  whom  correspondence  should  be  addressed.  E-mail:  peter. edmunds(fl' 
csun.edu 


mortality  of  all  juvenile  corals  <20  mm  in  diameter  was 
2-fold  higher  than  for  corals  of  21-40  mm  in  diameter  (Fig. 
1 ),  and  in  genera  such  as  Porites,  the  smallest  juveniles 
experienced  a  4.3-fold  higher  mortality  rate  than  their  larger 
counterparts  (Fig.  1).  Using  these  data  as  a  rationale,  we 
compared  the  photophysiology  of  two  size  classes  of  juve- 
nile colonies  of  Porites  astreoides  in  January  2003.  Corals 
were  collected  from  6-8  m  depth  on  the  west  fore  reef  at 
Discovery  Bay,  Jamaica,  to  represent  two  significantly  dif- 
ferent size  classes  (t  =  17.960,  df  =  26.  P  <  0.001 )  with 
mean  diameters  of  15  ±  2  mm  and  45  ±  6  mm,  hereafter 
described  as  sizes  I  and  II,  respectively.  These  corals  were 
exposed  to  ambient  (=27  °C)  and  elevated  temperatures 
(3 1 .6  °C)  for  6  h  in  the  light  followed  by  2  h  in  the  dark,  and 
the  impact  of  these  environmental  conditions  was  evaluated 
by  using  pulse  amplitude  modulation  (PAM)  fluorometry  to 
measure  each  coral's  photophysiological  performance  at  the 
end  of  the  8-h  incubation  (Fig.  2).  The  duration  of  these 
experiments  reflects  previously  published  studies  that  show 
an  8-h  exposure  to  high  temperature  to  be  sufficient  to  elicit 
a  photophysiological  response  in  reef  corals  ( 1 ,  2 ). 
Throughout  the  incubations  the  corals  were  inspected  for 
signs  of  stress,  such  as  the  production  of  mucus  or  the  loss 
of  color,  but  no  such  responses  were  observed. 

The  analysis  of  the  photosynthetic  performance  of  P. 
astreoides  by  means  of  PAM  fluorometry  revealed  that  the 
dark-adapted  (maximal)  quantum  yield  of  photosystem  (PS) 
II  (calculated  as  F,,/F,,,  which  is  defined  in  Fig.  2),  differed 
significantly  between  size  classes  and  treatments,  but  that 
the  interaction  between  size  and  treatment  was  not  signifi- 
cant (Table  1,  Fig.  2).  At  ambient  temperatures.  F../F,,,  was 
3%  to  6%  higher  in  size  I  versus  size  II  juvenile  corals,  and 
exposure  to  the  elevated  temperature  reduced  F,./F,,,  by 
10%  in  size  I  and  12%  in  size  II  juveniles.  Because  F,  //-',„ 


61 


62 


P.  J.  EDMUNDS  AND  R.   D.  GATES 

0.60 


<20       21-40       <20       21-40 

Size  Class  (mm) 

Figure  1.  The  mortality  of  juvenile  corals  at  5-6  m  depth  along  the 
south  coast  of  St.  John.  U.S.  Virgin  Islands.  Juvenile  corals  at  five  sites 
were  identified  to  genus,  sized  (diameter),  and  tagged.  To  determine 
mortality,  each  coral  was  relocated  a  year  later  and  scored  as  dead  or  alive 
1 12).  Sample  sizes  and  taxonomic  composition  of  the  corals  varied  each 
year,  but  mosl  belonged  to  the  genera  Porites,  Agaricia.  Sideraslrea.  and 
Favia.  Mortality  was  calculated  for  Porites  spp.  (including  P.  ustreoiiles) 
and  for  juveniles  pooled  by  taxon  (11  genera),  and  was  determined  sepa- 
rately for  corals  £  20  mm  in  diameter  (small)  and  between  21  and  40  mm 
in  diameter  (big).  Mean  annual  percentage  mortality  is  displayed  (±SE: 
n  =  6  years),  and  differed  significantly  between  small  and  big  juveniles  tor 
both  Porites  (1  =  2.306.  df  =  10.  P  =  0.0441  and  the  pooled  taxa  (t  = 
3.076.  df  =  10,  P  =  0.012;  statistical  analyses  were  carried  out  with 
arcsine-transformed  percentage  mortality).  Porites  mortality  was  calcu- 
lated using  58  corals  between  1996  and  1997.  46  between  1997  and  1998. 
28  between  1998  and  1999.  5  between  1999  and  2000.  17  between  2000 
and  2001.  and  37  between  2001  and  2002:  the  sample  sizes  for  all  juvenile 
corals  were  395.  1X7.  105.  28.  57.  and  92.  respectively. 

measures  the  efficiency  of  exciting  electrons  with  light 
energy  in  PSI1,  a  decline  in  F../F,,,  reflects  a  reduction  in  the 
efficiency  of  the  photochemical  pathways  culminating  in 
carbon  fixation  (3).  Thus,  our  results  show  that  for  P. 
asireoides.  the  photochemical  pathways  of  smaller  juveniles 
are  slightly  more  efficient  than  those  in  their  larger  coun- 
terparts, but  that  their  photophysiology  is  equally  impaired 
by  short  exposures  to  elevated  temperatures,  at  least  in 
corals  collected  and  analyzed  in  the  winter. 

To  explore  these  size-dependent  differences  in  photo- 
physiology  in  more  detail,  we  examined  nonphotosynthetic 
quenching  in  the  same  corals  by  qualitatively  comparing 
rapid  light  curves.  Nonphotosynthetic  quenching  (</N)  is  a 
measure  of  excess  light  energy  absorbed  by  the  PS11  an- 
tenna system  and  dissipated  as  heat  through  photoprotective 
mechanisms  such  as  xanthophyll  cycling  (3,  4);  </,v  is  cal- 
culated from  the  relationship  qN  =  (F,,,  -  F,,,.)/(F,,,  - 
F,,).  where  /•",„  and  F,,  are  defined  in  Figure  2,  and  F,,,.  is  the 
maximal  fluorescence  in  the  light.  We  selected  </N  because 
it  is  more  sensitive  to  thermal  stress  than  variable  fluores- 
cence [  F,,  (5)|.  and  therefore  is  likely  to  display  more  subtle 
responses  to  high  temperature  than  F,  II-',,,.  As  expected.  </\ 


0.48 


Size  I 


Size  II 


Figure  2.  A  comparison  of  the  photophysiology  of  two  size  classes  of 
imcnile  colonies  of  Purites  astreoijes.  Temperature  treatments  were  es- 
tablished in  10- 1  tanks  placed  in  an  air-conditioned  room  where  they 
received  sunlight  from  an  adjacent  window  [119  ±  5  u.mo\  photons  •  s  '  • 
m~"  (mean  ±  SD,  n  =  2).  recorded  with  a  spherical  Li-Cor  sensor  at 
noon].  The  tanks  were  aerated  and  filled  with  fresh  seawater  daily,  and 
maintained  at  26.1  ±  0.4  °C  (mean  ±  SE.  n  =  6.  ambient  treatment:  on 
reef  =  27  °C)  and  31.6  ±  0.3  C  (mean  ±  SE.  H  =  6.  elevated  treatment). 
A  randomized  block  experimental  design  was  used  to  test  for  the  effects  ot 
size  and  temperature,  where  each  block  corresponded  to  one  day  of 
experiments  with  one  coral  of  each  size  class  allocated  to  each  treatment. 
Incubations  began  at  noon,  and  after  6  h  the  tanks  were  covered  and  the 
corals  dark-adapted  for  at  least  2  h  prior  to  assessing  their  photophysiology. 
A  pulse  amplitude  modulation  fluoronieter  (PAM-210.  Walz  GmbH)  was 
used  to  quantify  chlorophyll  fluorescence  in  the  dark-adapted  state  and  at 
each  of  1 1  standard  light  levels.  Fluorescence  measurements  were  obtained 
by  positioning  the  sensor  just  above  the  tissue  on  the  upper  surface  of  a 
coral  colony  sitting  in  seawater  at  the  appropriate  incubation  temperature. 
Two  sets  of  recordings  were  obtained  from  different  positions  on  each 
coral,  and  the  average  was  used  as  a  statistical  replicate.  Minimal  and 
maximal  fluorescences  for  dark-adapted  corals  (F,,  and  F,,,.  respectncK  i 
were  measured,  and  the  results  displayed  as  PSI1  quantum  yield  |  F,  IF,,,  = 
(Fm  -  F,.)/F,,,:  mean  ±  SE  shown  (n  =  7)].  F,  IF,,,  differed  significantly 
between  size  classes  and  treatments,  but  there  was  no  statistical  interaction 
between  the  two  (Table  1 ). 


appears  sensitive  to  a  number  of  factors;  however,  most 
relevant  to  the  current  discussion  are  the  differences  in 
response  of  qN  for  sizes  1  and  II  juvenile  corals  under  the 

Table  1 

Results  ol  a  three-was  ranilomi:ed  block  A,\'OVA  eom/Hiriitf;  ilark- 
<H/ai>teJ  quantum  \ielil  ot  I'SII  (F,/F:,,,l  between  si:e  <  Uusei  f /«.'./  /<"  tor 
It  ami  treatments  tt>\e<l  tailor  lit.  \\irlt  the  block  hein.v  lite  ilas  that  the 
ei/'enmenl  Has  eomi'leteil 


Source 

SS 

df 

MS 

F 

P 

Size  class 

0.0033 

1 

0.0033 

5.5303 

0.030 

Treatment 

0.0241 

1 

0.0241 

40.6022 

<0.001 

Block 

0.0031 

h 

0.0005 

O.S657 

0.538 

Size  class  X  Treatment 

0.0002 

1 

0.0002 

0.3210 

0.578 

Error 

(1(1107 

IS 

0.0006 

SIZE-DEPENDENT  CORAL  PHOTOPHYSIOLOGY 


63 


same  light  and  temperature  conditions  (Fig.  3).  For  exam- 
ple, when  corals  are  exposed  to  elevated  temperature  at 


<120  jLimol  photons  •  s 


m 


qN  is  more  severely 


depressed  in  size  I  corals  than  in  their  larger  counterparts 
(size  II).  Interestingly,  at  higher  light  intensities  of  >367 
ju,mol  photons  •  s~  '  •  m~~,  this  trend  is  reversed  and  the  size 
II  juveniles  incubated  at  the  higher  temperature  exhibit  a 
greater  depression  in  qN  than  do  size  I  corals.  Although 
qualitative,  the  nuances  in  our  results  provide  some  evi- 
dence that  the  photophysiology  of  two  size  classes  of  juve- 
niles of  P.  astreoides  respond  differently  to  the  combination 
of  light  and  temperature  used  in  our  experiments.  The  most 
parsimonious  conclusion  is  that  the  two  size  classes  are 
functionally  different  in  photophysiology  (as  described  by 
FVIFHI  and  qN);  it  remains  to  be  demonstrated  whether 
these  differences  are  reflected  in  their  tolerance  to  thermal 
stress  and  in  their  inverse  size-dependent  mortality.  Perhaps 
the  smallest  corals  die  faster  than  the  bigger  corals  simply 
because  they  are  so  easily  overwhelmed  (and  killed  com- 
pletely) by  sources  of  mortality  other  than  thermal  stress,  for 
example  sedimentation  or  predation  (6). 

The  size-dependent  differences  in  dark-adapted  yield 
(Fig.  2)  under  ambient  conditions  likely  reflect  the  func- 
tional implications  of  other  well-known  aspects  of  coral 
biology.  For  example,  conspecifics  belonging  to  different 
size  classes  may  harbor  distinct  "types"  of  symbiotic  zoo- 
xanthellae  (7).  each  with  the  physiological  characteristics 
and  functional  limits  most  suited  to  the  ontogenetic  rigors 
facing  corals  of  a  particular  size.  Alternatively,  the  symbi- 
onts  harbored  by  size  I  and  size  II  juvenile  corals  might  be 
identical,  but  the  communication  between  the  symbiotic 
partners  might  be  tailored  to  meet  the  unique  demands  of 


their  specific  developmental  stage,  such  as  the  rapid  growth 
necessary  for  small  juveniles  to  escape  the  risks  of  over- 
growth and  predation  (8).  Or  perhaps  allometric  scaling  of 
biological  traits  (9)  mediates  the  differences  in  photophysi- 
ology. For  example,  size-dependent  changes  in  coral  tissue 
biomass  and  thickness  (9)  could  create  variable  shading  of 
zooxanthellae  through  behavioral  responses  (10),  and  rapid 
protein  metabolism  in  fast-growing  small  corals  could  re- 
duce the  nitrogen  limitation  of  the  symbiotic  algae,  thereby 
enhancing  the  efficiency  of  photochemical  conversion  (II) 
Regardless  of  the  mechanisms  underlying  our  results,  we 
believe  that  further  investigation  of  size-dependent  variation 
in  juvenile  corals  is  likely  to  be  valuable  in  understanding 
the  environmental  thresholds  and  biology  of  these  complex 
symbiotic  organisms. 


Acknowledgments 

This  research  was  facilitated  by  S.  Genovese  and  the 
East/West  Marine  Biology  Program  of  Northeastern  Uni- 
versity, and  is  dedicated  to  Mr.  Brown,  whose  tireless  spirit 
and  hard  work  has  done  much  to  support  our  research  in 
Jamaica  for  the  last  two  decades.  We  thank  R.  C.  Carpenter 
and  J.  Kiibler  for  comments  that  improved  earlier  drafts  of 
this  paper.  Funding  was  provided  in  part  by  the  Sea  Grant 
Program  of  the  University  of  Puerto  Rico  (grant  #R-101-2- 
02)  and  the  Reef  Assessment  Program  of  the  Virgin  Islands 
National  Park  (both  to  PJE).  This  is  contribution  number 
119  of  the  CSUN  Marine  Biology  Program.  677  of  the 
Discovery  Bay  Marine  Laboratory  and  1 176  of  the  Hawai'i 
Institute  of  Marine  Biology. 


CD 
O 

c 

CD 
O 
(f) 
CD 


CD 

> 


CD 

oc 


1.00 


0.75  - 


0.50    - 


0.25  H 


0.00 


Size  I 


200 


400 


Size 


600  0 


200 


400 


600 


PFD  (/vmol  photons-s^nr2) 


Figure  3.  Quenching  analyses  for  size  I  and  size  II  juvenile  corals  exposed  to  ambient  and  elevated 
temperature  treatments.  Measurements  were  obtained  using  chlorophyll  fluorescence  after  exposure  to  each  of 
1  1  irradiances  tor  1  min  in  the  software-driven  protocol  supplied  by  the  manufacturer  (Run  9.  Walz  GmbH). 
Results  are  displayed  for  nonphotosynthetic  quenching  (qN)  (mean  ±  SE.  n  =  1  for  each  datum)  and  allow  for 
a  qualitative  comparison  of  relative  photosynthetic  performance  between  size  classes  and  treatments.  One 
important  limitation  of  this  analysis  is  that  photosynthetic  equilibrium  is  probably  not  achieved  within  the  I -min 
irradiance  exposures  employed. 


64 


P.   J.   EDMUNDS  AND  R.   D.  GATES 


Literature  Cited 

1.  Jones,  R.  J.,  O.   Hoegh-Guldberg,  A.  W.  D.   Larkum,  and   U. 

Shreiber.  1998.  Temperature-induced  bleaching  of  corals  begins 
with  impairment  of  the  CCK  fixation  mechanism  in  zooxanthellae. 
Plant  Ct'll  Em-ironment  21:  1219-1230. 

2  Warner,  M.  E.,  W.  K.  Fitt,  and  G.  W.  Schmidt.  1999.  Damage  to 
photosystem  II  in  symbiotic  dinoflagellates:  a  determinant  of  coral 
bleaching.  Proc.  Null.  Acml.  Sci.  USA  96:  8007-S012. 

3.  Maxwell,  K.,  and  G.  N.  Johnson.  2000.  Chlorophyll  fluores- 
cence— a  practical  guide.  J.  Ev/>.  Botuny  51:  659-668. 

4  Brown,  B.  E.,  I.  Ambarsari,  M.  E.  Warner,  W.  K.  Fitt,  R.  P. 
Dunne,  S.  W.  Gibbs,  and  I).  G.  Cunmiings.  1999.  Diurnal  changes 
in  photochemical  efficiency  and  xanthophylls  concentrations  in  shal- 
low water  reef  corals:  evidence  of  photoinhibition  and  photoprotec- 
tion.  Coral  Reefs  18:  99-105. 

5.  Shreiber,  LI.,  II.  Schliwa,  and  W.  Bilger.  1986.  Continuous  record- 
ing of  photochemical  and  non-photochemical  chlorophyll  fluorescence 
quenching  with  a  new  type  of  modulation  fluorometer.  Photosynthesis 
Research  10:  51-62. 


d.   Hughes,  T.  P.,  and  J.  B.  (_'.  Jackson.  1985.     Population  dynamics 

and  life  histories  of  foliaceous  corals.  Ecol.  Monogr.  55:  141-166. 
7.  Coffroth,  M.  A.,  S.  R.  Santos,  and  T.  L.  Goulet.  2001.     Early 

ontogenetic  expression  of  specificity  in  a  cnidarian-alga]  symbiosis. 

Mar.  Ecol.  Prog.  Ser.  222:  85-96. 
S.  Jackson,  J.  B.  C.  1977.     Competition  on  marine  hard  substrata:  the 

adaptive  significance  of  solitary  and  colonial  strategies.  Am.  Nut.  980: 

743-767. 
4    Vollmer,  S.  V.,  and  P.  J.  Edmunds.  2000.     Allometric  scaling  in 

small  colonies  of  the  scleractinian  coral  Siderastrea  siderea  (Ellis  and 

Solander).  Biol.  Bull.  199:  21-28. 

10.  Brown,  B.  E.,  C.  A.  Downs,  R.  P.  Dunne,  and  S.  W.  Gihb.  2002. 
Preliminary  evidence  for  tissue  retraction  as  a  factor  in  pholoprotection 
of  corals  incapable  of  xanthophyll  cycling.  J.  Exri.  Mar.  Biol.  Ecol. 
277:  129-144. 

11.  Falkowski,  P.  G.,  Z.  Duhinsky,  L.  Muscatine,  and  L.  McCloskey. 
1993.     Population  control  in  symbiotic  corals.  Binscience  43:  606-61 1. 

12.  Edmunds,  P.  J.  2000.     Patterns  m  the  distribution  of  juvenile  corals 
and  coral  reef  community  structure  in  St.  John.  US  Virgin  Islands. 
Mar.  Ecol.  Prog.  Ser.  202:  113-124. 


Reference:  Biol.  Bull.  206:  65-77.  (April  20041 
©  2004  Marine  Biological  Laboratory 


Identification  and  Activity-Dependent  Labeling  of 
Peripheral  Sensory  Structures  on  a  Spionid  Polychaete 

SARA  M.  LINDSAY*.  TIMOTHY  J.  RIORDAN.  JR..  AND  D.  FOREST 

School  of  Marine  Sciences,  575  J  Murray  Hall,  University  of  Maine,  Orono,  Maine  04469 


Abstract.  In  marine  sedimentary  habitats,  chemorecep- 
tion  is  thought  to  coordinate  feeding  in  many  deposit- 
feeding  invertebrates  such  as  polychaetes.  snails,  and  clams. 
Relatively  little  is  known,  however,  about  the  chemosensory 
structures  and  mechanism  of  signal  transduction  in  deposit 
feeders.  Using  electron  microscopy,  confocal  laser  scanning 
microscopy  (CLSM),  and  immunohistochemistry,  we  inves- 
tigated the  structure  and  function  of  putative  chemosensory 
cells  on  the  feeding  appendages  of  a  deposit-feeding 
polychaete  species.  Dipolydora  quadrilobata.  Tufts  of  pu- 
tative sensory  cilia  were  distributed  over  the  prostomium 
and  feeding  palps  and  typically  occurred  next  to  pores. 
Examination  of  these  regions  with  transmission  electron 
microscopy  revealed  multiciliated  cells  with  adjacent  glan- 
dular cells  beneath  the  pores.  The  sensory  cells  of  prosto- 
mium and  palps  were  similar,  displaying  an  abundance  of 
apical  mitochondria  and  relatively  short  ciliary  rootlets. 
Staining  with  antiserum  against  acetylated  a-tubulin  was 
examined  by  CLSM,  and  revealed  axonal  processes  from 
putative  sensory  tufts  on  the  palp  surface  to  palp  nerves,  as 
well  as  many  free  nerve  endings.  Activity-dependent  cell 
labeling  experiments  were  used  to  test  the  sensitivity  of 
putative  sensory  cells  on  the  palps  to  an  amino  acid  mixture 
that  elicited  feeding  in  previous  behavioral  experiments.  In 
static  exposures,  the  number  of  lateral  and  abfrontal  cells 
labeled  in  response  to  the  amino  acid  mixture  was  signifi- 
cantly greater  than  in  the  controls.  Ultrastructural.  posi- 
tional, and  now  physiological  evidence  strongly  suggests 
that  spionid  feeding  palps  are  equipped  with  sensory  cells, 
at  least  some  of  which  function  as  chemoreceptors. 


Received  17  September  2002;  accepted  4  February  2004. 
*  To  whom  correspondence  should  be  addressed.  E-mail:   slmdsay(s> 
rnaiue.edu 


Introduction 

In  marine  sedimentary  habitats,  deposit-feeding  inverte- 
brates such  as  polychaetes,  bivalves,  gastropods,  crusta- 
ceans, holothurians,  and  hemichordates  are  abundant  mem- 
bers of  the  tnacrofauna.  These  organisms  ingest  large 
volumes  of  sediment  with  typically  low  food  value,  often 
processing  one  or  more  body  weights  of  sediment  each  day 
(reviewed  in  Lopez  and  Levinton,  1987).  They  also  disturb 
the  sediment  as  they  burrow  or  build  tubes.  As  bioturbators. 
deposit  feeders  have  a  profound  influence  on  the  biological, 
chemical,  geological,  and  even  physical  properties  of  their 
habitat.  Deposit  feeders  affect  sediment  transport  and  dis- 
tribution (e.g.,  Nittrouer  and  Sternberg,  1981;  Suchanek. 
1983;  Shull,  2001).  sediment  geochemistry  (Marinelli, 
1992;  Aller,  1994),  sediment  microbial  communities  (Find- 
lay  et  al.,  1990;  Grossman  and  Reichardt,  1991;  Plante  and 
Mayer,  1994),  nutrient  cycling  (Widbom  and  Frithsen, 
1995;  Christensen  et  al..  2000),  and  fate  of  pollutants 
(Mayer  et  al..  1996;  Weston  ct  al.,  2000).  Sediment  distur- 
bance by  deposit  feeders  mediates  competitive  interactions 
(e.g..  Rhoads  and  Young.  1970;  Woodin.  1976;  Wilson, 
1981;  Brenchley,  1981).  and  influences  animal  distribution 
patterns  and  dispersal  (Wilson,  1981;  Gunther,  1992;  Brey. 
1991),  as  well  as  recruitment  (Williams,  1980;  Posey,  1986: 
Luckenbach,  1987;  Mines  et  al..  1989;  Olafsson.  1989: 
Flach,  1992).  In  addition,  deposit  feeders  can  influence 
recruitment  directly  by  ingesting  larvae  and  juveniles  (Wil- 
son. 1980;  Tamaki.  1985;  Miliekovsky.  1974:  Elmgren  et 
nl..  1986;  Albertsson  and  Leonardsson.  2001  ). 

Rates  of  sediment  mobilization  by  deposit  feeders  depend 
on  food  supply.  In  the  last  two  decades,  behavioral,  physi- 
ological, and  mathematical  modeling  approaches  have  been 
applied  to  the  question  of  what  makes  some  sediments 
better  food  than  others  (e.i;..  review  by  Jumars,  1993). 
Largely  absent  from  this  body  of  research,  however,  are 
studies  that  investigate  the  cues  that  initiate  ingestion  and 
modulate  feeding  rates  in  deposit  feeders.  Jumars  (1993) 


66 


S.  M.  LINDSAY  ET  AL 


suggested  several  stimuli  that  could  operate  to  regulate 
ingestion  rate:  smell,  taste,  distension  of  the  gut,  and  inter- 
nal detection  of  the  absorbed  products  in  body  fluids.  The 
physiological  and  molecular  mechanisms  for  detecting  these 
stimuli  remain  poorly  understood  for  most  deposit  feeders. 

Chemoreception  is  implicated  in  the  coordination  of  feed- 
ing by  a  variety  of  deposit  feeders.  For  example,  fresh  fecal 
material  depresses  feeding  rate  in  the  snail  Hvdrohiti  tnin- 
cata  (Forbes  and  Lopez.  1986)  and  the  spionid  polychaete 
Pseudopolydora  kempi  japonica  (Miller  and  Jumars,  1986). 
Phagostimulants  are  implicated  as  well.  When  given  a 
choice,  the  common  deposit-feeding  polychaete  Streblospio 
benedicti  fed  preferentially  on  organically  enriched  sedi- 
ments rather  than  on  unaltered  sediments  (Kihslinger  and 
Woodin,  2000).  Feeding  rate  in  a  deposit-feeding  hemichor- 
date  was  strongly  correlated  with  sediment  chlorophyll  n 
concentrations  (Karrh  and  Miller.  1994).  Robertson  et  <//. 
(1980)  found  that  fiddler  crabs,  Ucu  pii^ilutor,  fed  selec- 
tively in  diatom-enriched  patches  of  sediment  and  could 
resolve  patches  at  the  millimeter  scale  by  probing  with 
sensory  setae  on  their  legs.  Fiddler  crabs  have  also  been  the 
focus  of  several  studies  that  explicitly  tested  the  effects  of 
chemical  compounds  on  deposit  feeders.  A  variety  of  amino 
acids,  peptides,  and  sugars  appear  to  stimulate  feeding 
(Robertson  et  ai,  1981;  Rittschof  and  Buswell,  1989; 
Weissburg  and  Zimmer-Faust,  1991;  Weissburg.  1993). 
Similarly,  Ferner  and  Jumars  (1999)  found  that  dissolved 
cues  (amino  acids  and  complex  mixtures)  influenced  the 
feeding  behavior  of  several  spionid  polychaetes.  We  re- 
cently extended  this  work  to  show  that  particle-bound 
amino  acids  and  sugars  influence  feeding  in  the  spionid 
polychaete  Dipulyihira  quadrilobata  (Riordan  and  Lindsay, 
2002). 

Although  chemical  mediation  of  deposit  feeding  seems 
likely,  relatively  little  is  known  about  the  chemosensory 
structures  and  mechanism  of  signal  transduction  in  deposit 
feeders.  One  exception  is  tiddler  crabs.  Weissburg  and 
colleagues  have  identified  gender-specific  differences  in 
tiddler  crab  feeding  behavior  in  response  to  chemical  cues, 
and  these  are  linked  to  differences  in  the  number  and 
sensitivity  of  chemoreceptor  neurons  (Weissburg,  1993. 
1999;  Weisshurg  and  Derby.  1995;  Weissburg  i-t  ai.  1996). 
Recent  work  (Weissburg.  2001)  suggests  the  adenylate- 
cyclase-cAMP  second  messenger  cascade  mediates  inhibi- 
tion of  chemosensory  neurons,  and  that  gender-specific  dif- 
ferences in  this  pathway  contribute  to  the  physiological  and 
behavioral  differences  in  fiddler  crab  chemosensitivity. 

Among  the  polychaetes,  nuchal  organs  are  presumed  to 
he  involved  in  Chemoreception  based  on  histological.  ultra- 
structural,  and  positional  criteria  (Storch  and  Schlotzer- 
Schrehardt.  19X8;  Purschke.  1997).  Several  authors  have 
speculated  that  nuchal  organs  may  be  involved  in  food 
selection  (Rullier.  1951 ;  Rhode.  1940;  No/ais  <•/  til..  1997) 
or  reproduction  (Schlot/er-Schrehaidt.  19X7).  although 


they  may  also  be  involved  in  osmoregulation  (Fewou  and 
Dhainaut-Courtois.  1995).  Nuchal  organs  typically  are 
paired  epidermal  structures  found  on  the  dorsal  side  of  the 
prostomium  or  peristomium  (/.<•.,  the  anterior  presegmental 
region).  Some  spionid  polychaetes  (not  Dipolydora  t/iuidri- 
lohatii)  also  have  metameric  nuchal  organs  on  their  bodies 
(Jelsing,  2002).  Cephalic  nuchal  organs  are  typically  com- 
posed of  ciliated  supporting  cells,  bipolar  primary  sensory 
cells  with  cilia,  unmodified  epidermal  cells,  and  retractor 
muscle  cells  in  those  species  in  which  nuchal  organs  can  be 
retracted  (reviewed  by  Purschke,  1997). 

Other  presumed  chemosensory  structures  have  been  de- 
scribed from  polychaetes,  including  epidermal  papillae  of 
the  deposit-feeding  lugworm  Arenicohi  nuirinti  (Jouin  ct  til.. 
1985).  compound  sensory  organs  on  the  prostomial  cirri  and 
palps  of  Nereis  diversicolor  (Dorsett  and  Hyde.  1969).  and 
the  parapodial  cirri  of  nereidid  polychaetes  (Boilly-Marer. 
1972).  In  Plan-nereis  dinner! ii.  the  receptors  of  the  parapo- 
dial cirri  function  in  perception  of  sexual  pheromones 
(Boilly-Marer.  1968.  1974).  Peripheral  sensory  structures 
have  also  been  observed  on  the  feeding  palps,  prostomia. 
and  peristomia  of  several  spionid  polychaete  species 
(Dauer.  1984.  1987.  1991.  1997:  Worsaee,  2001).  With  the 
exception  of  the  nereidid  pheromone  receptors,  studies 
demonstrating  functions  of  these  putative  polychaete  che- 
moreceptors  are  largely  absent.  The  goals  of  this  study  were 
to  ( 1 )  describe  the  distribution  and  ultrastructure  of  periph- 
eral sensory  cells  of  the  spionid  polychaete  Dipolydont 
quadrilobata,  and  (2)  assign  a  functional  role  to  these  struc- 
tures by  using  an  immunohistochemical  approach  that  la- 
beled cells  responding  to  chemical  cues  that  elicited  behav- 
ioral responses  in  D.  quadrilobata  (Riordan  and  Lindsay. 
2002). 

Materials  and  Methods 
Collection  and  maintenance  of  animals 

Individuals  of  Dipolydoru  t/iuulrilohtitit  (Jacobi  1883) 
were  sieved  (0.5  mm)  out  of  cores  collected  from  the 
mudflats  of  Lowe's  Cove  at  the  University  of  Maine's 
Darling  Marine  Laboratory  (Walpole.  ME.  USA)  on  several 
days  in  September  and  October  of  2000.  and  March.  April, 
and  May  of  2001.  Animals  and  natural  sediments  were 
transported  to  the  University  of  Maine  in  Orono  and 
maintained  in  aquaria  inside  an  environmental  chamber  ( 14 
°C:10  C,  12  h  light:dark  cycle).  Individual  worms  that 
measured  10-20  mm  in  length  and  showed  no  signs  of 
gametogenesis.  loss  of  segments,  or  other  bodily  damage 
were  used  in  the  experiments. 

Electron  microscopy 

For  scanning  electron  microscopy  (SEM).  intact  worms 
were  relaxed  in  chilled  37'i  magnesium  chloride,  fixed  in 


SPIONID  PERIPHERAL  SENSORY  CELLS 


67 


3%  glutaraldehyde  in  0.1  M  phosphate  buffer  with  10% 
sucrose,  post-fixed  in  1%  osmium  tetroxide  in  O.I  A7  phos- 
phate buffer,  and  dehydrated  in  an  ethanol  series.  Samples 
were  then  critical-point-dried  with  liquid  CO:,  mounted  on 
stubs,  and  coated  with  gold  palladium  in  a  Conductavac  I 
(SpeeVac.  Inc.)  sputter  coaler.  Samples  were  viewed  with 
an  AMRay  AMR1000A  scanning  electron  microscope  op- 
erating at  5  kV.  Negatives  were  scanned  at  800  dpi  with  an 
HP  ScanJet  7400C  flatbed  scanner  equipped  with  an  HP 
ScanJet  XPA  attachment,  and  the  images  were  saved  as 
TIFF  files. 

For  transmission  electron  microscopy  (TEM),  worms 
were  relaxed  in  chilled  37%  magnesium  chloride,  fixed  in 
3%  glutaraldehyde  in  phosphate  buffer  with  10%  sucrose, 
post-fixed  in  1%  osmium  tetroxide  in  0.1  M  phosphate 
buffer,  dehydrated  in  an  acetone  series,  and  embedded  in 
Spurr's  resin.  Ultrathin  sections  were  collected  onto  slot 
grids,  then  stained  with  0.5%  lead  citrate  and  2%  uranyl 
acetate.  Samples  were  viewed  with  a  Phillips  CM  10  trans- 
mission electron  microscope  operating  at  80  kV.  Negatives 
were  scanned  at  800  dpi  with  an  HP  ScanJet  7400C  flatbed 
scanner  equipped  with  a  HP  ScanJet  XPA  attachment,  and 
the  images  were  saved  as  TIFF  files. 

Confocal  laser  scanning  microscopy 

Worms  were  relaxed  in  a  37%  MgCK  solution  for  5  min, 
then  fixed  overnight  at  4  °C  in  a  solution  of  4%  formalde- 
hyde in  artificial  seawater  (ASW,  32%c,  pH  7.4.  Forty 
Fathoms  Crystal  Sea  Marine  Mix.  Marine  Enterprises  In- 
ternational. Baltimore,  MD).  After  three  10-niin  rinses  in 
ASW,  worms  were  soaked  for  5  h  in  a  blocking  solution 
containing  0.5%  Triton-X  100  and  0.5%  bovine  serum 
albumin  (BSA).  The  primary  antibody  ( 1"  Ab),  monoclonal 
mouse  anti-acetylated  «-tubulin  (Sigma,  St.  Louis;  clone 
6-11B-1),  was  diluted  1:100  with  0.5%  Triton  X-IOO  in 
ASW  and  applied  overnight  (about  18  h).  Specimens  were 
then  rinsed  in  ASW  and  incubated  for  5  h  with  FITC- 
conjugated  goat  anti-mouse  secondary  antibodies  (Sigma: 
Fc  specific  IgG)  diluted  1:100  in  0.5%'  Triton  X-100/ASW. 
After  a  final  series  of  ASW  rinses,  worms  were  mounted  on 
glass  slides  in  Fluoromount-G  (Southern  Biotechnology  As- 
sociates, Birmingham,  AL).  Preparations  were  imaged  with 
a  Leica  TCS  SP2  confocal  laser  scanning  microscope.  Neg- 
ative controls  to  test  for  the  specificity  of  primary  antibodies 
were  prepared  by  treating  specimens  as  described,  but  omit- 
ting the  1°  Ab.  Repeated  incubations  were  performed,  and  at 
least  10  worms  were  used  to  test  for  reproducibility. 

Activity-dependent  cell  labeling 

We  adapted  the  method  used  by  Michel  et  til.  ( 1999)  to 
label  activated  olfactory  neurons  in  zebrafish  and  spiny 
lobsters.  This  method  exploits  the  ability  of  cationic  guani- 
dinium  analogs  to  enter  into  stimulated  neurons  and  meta- 


bolically  active  cells  ( Dwyer  el  <//..  1 980:  Picco  and  Menini. 
1993).  These  analogs  enter  active  neurons  through  nonspe- 
cific cation  channels  activated  and  opened  by  the  binding  of 
a  ligand  with  its  receptor  protein.  Sequestration  of  the 
analogs  in  these  cells  allows  for  the  activity-dependent 
labeling  of  individual  receptor  neurons. 

For  example,  the  guanidinium  analog,  l-amino-4-gua- 
nidobutane  (=  agmatine),  has  been  shown  to  enter  into 
receptor  neurons  through  such  open  cation  channels  (Yo- 
shikami,  1981 ).  When  coupled  with  known  stimulatory  cues 
in  solution  and  perfused  over  olfactory  organs,  agmatine 
accumulates  in  activated  odorant  receptor  neurons  (Michel 
ft  nI..  1999:  Steullet  et  til.,  2000).  Cells  stimulated  by  a  cue 
accumulate  agmatine  and  can  be  identified  using  an  anti- 
agmatine  IgG  antibody  followed  by  silver  intensification 
labeling  (Marc.  1995,  1999a.  b).  We  presented  agmatine 
plus  a  mixture  of  amino  acids  known  to  elicit  behavioral 
responses  to  individual  specimens  of  Dipolydora  c/uadrilo- 
biitu  in  both  flow-through  and  static  experiments. 

Flow  trials.  Individual  worms  were  immersed  in  artificial 
seawater  (ASW,  in  mM:  423  NaCl.  9  KC1.  13  CaCU,  23 
MgCU,  26  MgSO4  (Cavanaugh,  1975)  pH  adjusted  to  7.2) 
inside  a  small  coverslip  perfusion  chamber  (Warner  Instru- 
ments, Model  #RC  21  B).  Odorant  stimuli  were  added  to  the 
ASW  perfusion  fluid  in  5-s  pulses  every  60  s  for  60  min. 
The  ASW  and  the  odorant  stimuli  solutions  were  held  in 
60-rnl  syringes  connected  to  the  perfusion  chamber  through 
rubber  tubing  and  a  manifold.  Fluid  flow  from  the  syringes 
was  by  gravity  feed,  and  flow  rates  (0.5  cm  s  ')  were 
controlled  by  stopcock  valves;  fluid  flow  was  turned  on  and 
off  by  electronically  activated  pinch  valves  (Warner  Instru- 
ments, model  VC-6).  Stimuli  included  20  mM  agmatine 
sulfate  (AGB)  in  ASW  (control,  n  =  4  worms)  and  20  mM 
AGB  plus  a  mixture  of  amino  acids  ( I  mM  each  of  proline. 
alanine,  threonine.  valine.  taurine.  and  glycine)  in  ASW 
(treatment,  n  =  5  worms).  Following  the  60-min  stimula- 
tion period.  ASW  was  perfused  over  the  worms  for  5  min  to 
remove  residual  AGB.  Worms  were  then  immersed  in  fresh 
ASW  and  relaxed  by  placing  them  in  a  freezer  (  -20  °C)  for 
10  min  prior  to  fixing.  Whole  worms  were  placed  in  fixative 
(1%  paraformaldehyde.  2%  glutaraldehyde  in  0.2  M  phos- 
phate buffer  with  10%  sucrose  (w/v),  pH  7.2)  from  over- 
night to  several  days. 

No  ft«w  (static)  trials.  Individual  worms  were  immersed  in 
10  ml  ASW  inside  a  small  petri  dish,  and  10  ml  of  either  40 
mM  AGB  in  ASW  (control,  n  =  6  worms)  or  40  mM  AGB 
plus  the  mixture  of  amino  acids  in  ASW  (treatment,  n  =  6 
worms)  was  slowly  added  by  pipette.  Worms  were  exposed 
to  the  treatments  for  60  min,  during  which  time  they  were 
relatively  quiescent  in  the  dishes,  immersed  in  fresh  ASW 
for  5  min  to  remove  residual  AGB,  and  relaxed  by  placing 
them  in  a  freezer  ( -  20  °C)  for  1 0  min  prior  to  fixing.  Whole 


68 


S.  M.  LINDSAY  ET  AL. 


worms  were  placed  in  fixative  (  1%  paraformaldehyde,  2% 
glutaraldehyde  in  0.2  M  phosphate  buffer  with  10%  sucrose 
(w/v),  pH  7.2)  from  overnight  to  several  days. 

Tissue  processing,  immunolabeling,  and  visualization 

Fixed  worms  were  rinsed  in  a  phosphate  buffer  (PB: 
1.76  g  NaH2PO4  •  H:O  +  7.67  g  Na:HPO4  in  1  1  of 
deionized  water),  dehydrated  through  a  graded  series  of 
absolute  ethanol  and  acetone,  embedded  in  Epon  812  resin, 
cured,  and  sectioned  using  a  microtome  and  glass  knives. 
An  average  of  156  sections  were  processed  for  each  indi- 
vidual. Semi-thick  sections  (2  jum)  were  placed  in  7-mm 
wells  of  a  Teflon-coated  spot  slide  (Erie  Scientific),  deplas- 
ticized  in  a  1:5  v/v  solution  of  mature  sodium  ethoxide  in 
anhydrous  ethanol.  and  subsequently  washed  in  three 
changes  of  anhydrous  ethanol.  The  slides  were  rinsed  in 
deionized  water,  air-dried,  and  then  incubated  overnight  in 
a  1:100  dilution  of  a  polyclonal  rabbit  anti-AGB  IgG  anti- 
body (Signature  Immunologies  and  courtesy  of  R.  Marc. 
University  of  Utah  School  of  Medicine).  The  slides  were 
then  rinsed  in  PB.  washed  in  \7t  goat  serum  in  PB  plus 
0.05%  thimerosal  (  1%  GSPBT)  for  10  min.  and  incubated  in 
a  1:50  dilution  of  a  1-nm  gold  conjugated  anti-rabbit  IgG 
antibody  for  60  min.  After  a  final  PB  wash  and  air-drying. 
labeled  cells  were  visualized  using  silver  intensification 
(Marc,  1999a,  b).  The  silver  nitrate  solution  for  silver  in- 
tensification was  prepared  by  mixing  three  solutions:  5  ml 
of  solution  A  (  1  14  mg  citric  acid  +  342  ing  sodium  citrate 
in  6  ml  of  deionized  water).  I  ml  of  solution  B  (0.5  g 
hydroquinone  in  15  ml  of  deionized  water),  and  1  ml  of  1% 
aqueous  silver  nitrate.  Following  a  dip  in  5%  acetic  acid  to 
stop  the  intensification  reaction,  the  slides  were  washed  in 
deionized  water  for  10  min.  air-dried,  and  mounted  in 
Permount  (Fisher)  for  viewing  on  a  light  microscope. 


digitization  and  analysis 

Images  of  the  sections  were  captured  digitally  using  a 
Javelin  JE12HMV  video  camera  mounted  on  an  Olympus 
BX60  light  microscope.  Video  signals  were  passed  to  a 
frame  grabber  board  (Scion  LG  3)  in  a  Dell  Optiplex 
GX110  computer.  The  images  were  analyzed  using  the 
Scion  ImagePC  software.  Beta  ver.  4.02  (Scion  Corpora- 
tion, Frederick,  MD).  Cells  labeled  with  agmatine  were 
identified  by  quantifying  the  pixel  intensity  inside  a  cell  ol 
interest  in  the  digiti/ed  images  and  comparing  it  to  the  pixel 
intensity  of  an  unlaheled  region  adjacent  to  the  cell  d'.v,. 
Michel  et  al..  1999).  The  mean  and  standard  deviation  of  the 
pixel  intensity  inside  cells  of  interest  was  used  to  calculate 
a  95%  confidence  interval;  cells  were  counted  as  labeled  if 
the  lower  limit  of  this  interval  was  higher  than  the  upper 
limit  of  the  unlabeled  region.  Two  strategies  were  used  to 
avoid  double-counting  of  labeled  cells.  First,  cells  were 
counted  only  if  the  distal  processes  and  apical  cilia  were 


present  in  the  same  plane  as  the  labeled  cell  body;  these 
processes  typically  were  not  coplanar  in  more  than  one 
adjacent  section.  Second,  the  locations  of  labeled  cells  in  a 
single  section  were  compared  to  labeled  cells  in  adjacent 
sections  to  avoid  counting  the  same  cell  twice. 

Labeled  cells  were  grouped  by  type  according  to  their 
location  within  the  sections  (Fig.  1).  Abfrontal  cells  were 
located  behind  a  straight  line  drawn  across  the  sections  and 
tangent  to  the  back  of  the  food  groove.  Lateral  cells  were 
found  between  the  food  groove  and  the  abfrontal  cilia.  Cells 
immediately  adjacent  to  the  frontal  ciliated  food  groove 
were  called  laterofrontal  cells.  And  cells  located  within  the 
frontal  ciliated  food  groove  were  called  frontal  cells.  Be- 
cause different  numbers  of  sections  were  analyzed  for  each 
worm,  we  calculated  the  number  of  labeled  cells  per  100 
/j.m  palp  length,  based  on  the  total  number  of  sections 
analyzed  per  individual.  The  resulting  data  were  compared 
among  treatments  using  a  nonparametric  Kruskal-Wallis 
analysis  of  variance  (SAS  version  9,  SAS  Institute,  Inc.). 
Data  from  flow  experiments  and  static  experiments  were 
analyzed  separately. 

To  estimate  the  total  number  of  each  cell  type  in  any 
length  of  palp,  serial  sections  made  from  the  palps  (middle 
portion)  of  four  worms  were  stained  with  a  toluidene  blue 
stain.  Toluidene  blue  stains  acidic  cell  parts  (i.e.,  nucleus) 
and  allows  the  different  types  of  cells  to  be  identified  and 
counted.  Individual  cells  were  traced  through  the  sections  to 
avoid  double-counting.  On  average,  about  121  /uni  of  palp 
tissue  was  sectioned  for  each  of  these  worms,  representing 
about  5%  of  the  average  length  of  the  palps  of  D.  i/mulri- 
lobaia. 


Results 

Distribution  of  peripheral  sensory  cells 

Scanning  electron  microscopy  revealed  tufts  of  cilia  (/'.£'., 
cirri,  \cnxii  Worsaae,  2001)  distributed  on  the  palps  and 
prostomiiim  of  Dif>ol\dnru  qmidrilobata  (Fig.  2).  Tufts  of 
putative  sensory  cilia  were  found  on  all  surfaces  of  the 
prostomium  (Fig.  2B)  and  were  typically  adjacent  to  pores 
(Fig.  2B).  The  cilia  of  the  prostomial  tufts  were  nonmotile 
and  relatively  short;  they  numbered  about  13-20  cilia  per 
tuft  (Fig.  2C).  On  the  palps,  we  observed  motile  cilia 
arra\ed  in  a  row  immediately  adjacent  to  each  side  of  the 
food  groove  (laterofrontal,  Fig.  3 A,  B),  and  tufts  of  motile 
cilia  arrayed  in  a  second  lateral  row  and  on  the  abfrontal 
surface  (Fig.  3 A,  B).  Laterofrontal,  lateral,  and  abfrontal 
cilia  occurred  with  similar  frequency  along  the  length  of  the 
palp  (Fig.  3C).  The  putative  sensory  tufts  of  cilia  on  the 
abfrontal  surface  seemed  regularly  dispersed;  and.  interest- 
ingly, we  observed  fewer  adjacent  pores  than  on  the  pros- 
tomium. The  cilia  of  the  abfrontal  surfaces  were  longer  than 


SPIONID  PERIPHERAL  SENSORY  CELLS 


69 


Single  cross-section  (2  jam) 
through  the  palp 


, 


B 


Abfrontal  Cell 
Location 


Lateral 

Cell 
Location 


Latero- 
Frontal  Cell 
Location 


Frontal  Cilia  and  Frontal  Cell  Location 


Figure  1.  (A)  Gross  palp  morphology  and  section  placement  for  cell  labeling  studies  in  Dipohdora 
quadrilobata.  (B)  Cell  type  location  within  sections.  Cells  along  the  food  groove  and  within  the  frontal  cilia  were 
designated  frontal  cells.  Cells  immediately  adjacent  to  the  frontal  cilia  were  designated  laterofrontal  cells.  Cells 
behind  a  line  drawn  across  the  back  end  of  the  food  groove  were  designated  abfrontal  cells.  Cells  in  front  of  that 
line  and  lateral  to  the  frontal  surface  were  designated  lateral  cells. 


those  of  the  prostomium,  and  there  were  fewer  cilia  per  tuft 
(7-14)  (Fig.  3C.  inset). 

Season'  cell  ultrastructure 

Palp  and  prostomial  sensory  cells  shared  similar  ultra- 
structural  characteristics.  All  were  multiciliated  and  con- 
tained many  apical  mitochondria  (Figs.  4,  5).  Laterofrontal 
cells  on  the  palp  were  typically  adjacent  to  glandular  cells 
(Fig.  4)  associated  with  pores  on  the  surface.  Gland  cells 
contained  either  globules  of  very  electron-dense  material 
(Fig.  4C)  or  less  dense  material  that  appeared  to  be  mucus 
(not  shown).  Abfrontal  cells  of  the  palp  were  restricted  by 


the  muscle  layers  below,  and  cell  bodies  often  projected 
laterally  (Fig.  5).  Ciliary  rootlets  of  both  palp  and  prosto- 
mial cells,  when  observed,  were  short  relative  to  the  length 
of  the  cell  body  (Fig.  5A).  All  cilia  were  readily  distinguish- 
able from  the  microvillar  cuticle  (Figs.  4,  5)  and  displayed 
a  characteristic  9X2  +  2  microtubular  arrangement  in 
cross-section. 

Confocal  laser  scanning  microscopy 

The  antibody  for  acetylated  a-tubulin  targets  nerve  axons 
and  cilia  axoneme  microtubules.  Cilia  of  the  food  groove. 


70 


S.   M.   LINDSAY  ET  AL. 


sensory  tufts  to  the  palp  nerves  (Fig.  6B).  There  are  also 
many  nerves  with  apparent  free  endings  on  the  palp  surface 
(i.e.,  not  associated  with  ciliated  cells).  A  more  detailed 


Figure  2.  Peripheral  sensoiy  cells  on  ihe  prostomiimi  of  l)i/>i>lydoru 
i/utulrilohiitu.  (A)  Anterior  prolilc.  shim  ing  pulps  (pa)  and  piosionmini 
(pro);  scale  10(1  /.nil  Insel  slum's  entire  worm.  (Hi  Ciliated  struelures  arc 
ilislnhuteil  on  the  entire  surface  of  the  prostoniium  (anowsi;  palps  wcic 
ieino\cd.  leaving  a  scar  ipsi;  scale  1(10  /mi.  (Cl  I'oies  ipo)  are  found 
ud|accnl  lo  the  sensory  sliuelures  on  the  prosiominm;  scale  =  10  /Mill  Inset 
shows  the  sensory  cilia  of  the  piostomium;  inset  scale  -  2.5  juin. 


lateral  and  abl'ronlul  surfaces  of  palp,  as  well  as  (he  main 
palp  nerve  and  several  smaller  palp  nerves  projecting  to  the 
central  nervous  system  showed  aeetylaled  a-tubulin  reac- 
tivity (Fig.  6A).  Our  initial  observations  clearly  show  axons 
that  project  from  the  cilia  of  putative  lateral  and  ahfrontal 


mwfif^^^^  &fSJNP 

?TS     v-;syXj  V  •  c "  *  *S      v  J*r.'  -."^   '^s^L^^sr-'.,- 
«»i*  .i?  /"•  •-.  it .  •^«t.*i   '  >*/!fldBMl3Ht^Hp'        ~  '^  jd^^H^^l 


i^A.  -  '?>'•"  .o 

3.  Peripheral  sensoiy  cells  on  Ihe  palp  of  Di/'olyilni'ii  i/utulri- 
lohulii.  (A)  Lateral  view  of  the  middle  portion  of  a  feeding  palp,  showing 
frontal  food  groove  (I'gl.  lalerolionlal  cilia  (111.  and  lulls  of  nonmolile 
scnsor\  cilia  (sll  on  the  lalcial  and  ahlronlal  snrtaces  of  the  palp;  scale  = 
so  /mi.  (Hi  Middle  portion  of  the  feeding  palp  showing  laterolrontal  (II) 
cilia  adjacent  to  ihe  frontal  food  groove  (fg).  as  well  as  laterally  distributed 
sensotv  lulls  isii.  scale  II)  /jM.  (Ci  Hislal  portion  of  feeding  palp 
showing  the  loud  gioo\c  ilgl.  lalerolionlal  (111  cilia,  and  sensory  (lifts  isl); 
scale  =  10  /jiii.  Inset  palp  sensoiy  tufts  appear  to  he  similar  lo  those  on 
the  piosioiiiiuni;  inset  scale  =  I  jim. 


SPIONID  PERIPHERAL  SENSORY  CELLS 


71 


Figure  4.  Ultrastructure  of  Dipolydora  quadrilobata  palp  laterofrontal  cells.  (A)  Semi-oblique  section 
through  palp  food  groove  showing  dense  field  of  frontal  cilia  (fc)  and  adjacent  laterofrontal  cell  (If);  scale  =  2 
/jm.  (B)  Same  laterofrontal  cell  showing  numerous  cilia  (c)  and  many  apical  mitochondria  (mt);  scale  =  2  fj,m; 
the  basal  portion  of  the  cell  projects  out  of  the  plane  of  section.  (C)  Another  semi-oblique  section  of  the  palp 
reveals  the  laterofrontal  cell  and  adjacent  glandular  cell  (gc)  with  pore  (po);  scale  =  2  /j,m. 


examination  of  the  innervation  of  these  peripheral  sensory 
cells,  as  well  as  their  reactivity  to  anti-serotonin  and  anti- 
FMRFamide,  is  in  progress. 

Activity-dependent  labeling 

Four  types  of  putative  sensory  cells  were  labeled  by 
exposing  the  palps  of  D.  quadrilobata  to  agmatine  and  the 
amino  acid  mixture:  frontal,  laterofrontal,  lateral,  and  ab- 
frontal  cells  (Fig.  7).  These  four  cell  types  all  have  cellular 
processes  extending  through  the  epidermis  to  the  surface  of 
the  palp  (Fig.  7),  many  with  visible  cilia  extending  from  the 
surface  of  the  palp.  Frontal  and  laterofrontal  cells  were 
generally  found  as  groups  of  several  cells  close  to  one 
another  at  the  periphery  of  the  food  groove,  and  often  most 
of  these  cells  were  labeled.  In  contrast,  labeled  lateral  and 
abfrontal  cells  were  always  found  in  isolation. 

The  occurrence  of  labeled  cells  in  the  flow-through  per- 
fusion  experiment  was  quite  variable  (Fig.  8 A).  Pooling  all 
cell  types,  there  was  no  significant  effect  of  amino  acids 
(cue)  on  cell  labeling  (Kruskal-Wallis  f  =  0.74,  d.f.  =  1, 
P  =  0.39,  n  =  27).  There  was  a  non-significant  trend 
toward  greater  labeling  in  the  controls  for  laterofrontal  and 
frontal  cells  (e.g.,  Kruskal-Wallis  test  of  the  difference 
between  the  number  of  frontal  cells  labeled  in  the  presence 
of  amino  acids  compared  to  controls:  x2  =  2.7655,  d.f.  =  1, 
P  =  0.09,  n  =  9).  Relatively  fewer  cells  were  labeled  in 
the  static  experiments  (Fig.  8B,  note  axis  scale).  In  contrast 
to  the  flow  experiment,  however,  addition  of  amino  acids 
significantly  increased  cell  labeling  with  agmatine  com- 


pared to  controls  in  all  cell  types  pooled  (Kruskal-Wallis, 
X2  =  9.88,  d.f.  =  1,  P  =  0.002,  n  =  36).  We  observed  the 
greatest  amount  of  labeling  in  lateral  and  abfrontal  cells 
(Fig.  8B). 

Based  on  counts  from  the  serial  sections  stained  with 
toluidine  blue,  frontal  cells  and  laterofrontal  cells  occur  at 
about  the  same  frequency,  averaging  27  frontal  cells  and  28 
laterofrontal  cells  per  100  jam  of  palp.  Lateral  and  abfrontal 
cells  occur  less  frequently,  at  a  combined  average  rate  of  1 1 
cells  per  100  /urn  of  palp.  Given  an  average  palp  length  of 
2.55  mm  for  D.  quadrilobata,  and  assuming  no  changes  in 
distribution  along  the  length  of  the  palp,  we  can  then  expect 
approximately  688  frontal  cells,  714  laterofrontal  cells,  and 
a  total  of  280  lateral  and  abfrontal  cells  to  occur  on  a  single 
palp.  Based  on  the  occurrence  of  labeling  that  we  observed 
in  static  trials  only,  we  conservatively  estimate  that  14%  of 
the  total  number  of  lateral  and  abfrontal  cells,  47c  of  the 
total  number  of  laterofrontal  cells,  and  3%  of  the  total 
number  of  frontal  cells  were  labeled  by  agmatine  in  the 
presence  of  amino  acids. 

Discussion 

The  diversity  of  chemosensory  organs  among  marine 
organisms  is  great,  from  crustacean  aesthetasc  sensilla  to 
molluscan  osphradium,  rhinophores.  and  oral  tentacles,  to 
polychaete  nuchal  organs  (Laverack,  1968;  Emery,  1992). 
Despite  this  diversity,  the  transduction  of  externally  de- 
tected signals  to  the  brain  follows  a  similar  pathway,  be- 
ginning with  the  activation  of  a  chemoreceptor  cell  that 


72 


S.  M.  LINDSAY  ET  AL. 


leads  to  the  central  nervous  system.  The  structural  common 
denominator  for  all  chemosensory  cells  is  the  presence  of 
ciliary  or  microvillar  extensions  into  the  environment.  The 
peripheral  cells  of  the  spionid  palps  and  prostomium  clearly 
meet  this  requirement  (Figs.  2,  3). 

Dauer  (1984,  1987.  1991,  1997)  and  Worsaee  (2001) 
observed  nonmotile  cilia  on  palps  and  prostomia  of  several 
spionid  species,  including  Dipolydora  quadrilobata,  and 
classified  them  as  sensory  on  the  basis  of  scanning  electron 
microscopy  data  and  positional  criteria.  Our  initial  TEM 
observations  (Figs.  4,  5)  support  these  classifications,  and 
suggest  that  these  peripheral  sensory  cells  have  features 
similar  to  the  caudal  chemoreceptors  that  Jouin  el  ai. 
(1985)  described  in  Arenicola  marina — namely  an  abun- 
dance of  apical  mitochondria  and  short  ciliary  rootlets. 
Confocal  laser  scanning  microscopy  further  reveals  axonal 
processes  to  palp  nerves  from  the  lateral  and  abfrontal 
sensory  tufts  (Fig.  6),  as  well  as  many  free  nerve  endings 
projecting  to  the  lateral  and  abfrontal  surfaces  of  the  palps. 

Assigning  function  to  cells  based  solely  on  morphologi- 
cal criteria  can  be  difficult,  however.  For  example,  it  ap- 
pears that  no  single  morphological  character  defines  che- 
moreceptor  cilia:  on  the  crustacean  aesthetasc,  olfactory 
cilia  can  have  "significant"  ciliary  rootlets  and  motile  cilia 
(Griinert  and  Ache,  1988).  We  used  the  activity-dependent 
labeling  experiments  to  explore  the  possible  function  of  the 
palp  sensory  cells.  Although  we  designed  the  experiment  to 
assay  for  cell  activity  in  the  presence  or  absence  of  chemical 
cues  (amino  acids),  it  is  important  to  note  that  this  method 
of  labeling  active  sensory  cells  does  not  discriminate  be- 
tween types  of  receptors.  It  simply  identifies  cells  that  have 
accumulated  agmatine,  regardless  of  the  stimulus  source. 
Thus,  the  labeled  cells  may  include  a  variety  of  sensory  cell 
types.  The  initial  stimulation  of  a  mechanoreceptor  (i.e.. 
stretching  or  bending  of  the  cell  membrane  or  a  protruding 
cilium)  in  at  least  one  invertebrate  (the  crayfish)  opens  a 
stretch-activated  ion  channel  that  appears  to  be  permeable  to 
divalent  cations  (Edwards  et  ai.  1981).  Chemoreceptor 
transduction  proceeds  similarly,  with  the  binding  of  a  ligand 
to  the  receptor  in  the  membrane  causing  the  activation  and 
opening  of  ion  channels.  In  both  cases,  such  cation-perme- 
able channels  should  be  permeable  to  agmatine,  and  there- 
fore both  mechanoreceptors  and  chemoreceptors  could  be 
labeled  using  this  technique. 

Spionid  palps  are  probably  equipped  with  mechanosen- 


.  .„ 5.     Ultrastructure  of  DipolyJuni  iimulriluhiitii  palp  abfrontal 

cell  and  prostomial  sensory  cells.  (A)  Constrained  by  a  muscle  layer  below. 
Ihis  ahtrontal  palp  sensory  cell  projects  laterally.  Cilia  (c)  are  readily 
distinguished  from  the  microvilli  (mv)  of  the  cuticle;  ciliary  rootlets  (cr) 
appear  relatively  short;  scale  =  0.5  /J.m.  (B)  Prostomial  sensory  cells  have 
a  similar  structure,  with  cilia  (c)  projecting  through  the  microvillar  (mv) 
cuticle,  numerous  mitochondria  (nit),  and  a  bilobed  nucleus  (nu);  scale  = 
_  /urn.  (C)  Higher  magnification  of  the  same  cell,  showing  apical  mito- 
chondria (nit);  scale  =  0.7  /im. 


SPIONID  PERIPHERAL  SENSORY  CELLS 
•        *, 


73 


Figure  6.  Fluorescence  of  anti-acetylated  a-tubulin  in  Dipol\dora  qiiadrilnhata  palps  examined  with 
confocal  laser  scanning  microscopy  reveals  (A)  palp  nerves  (pn),  and  cilia  of  the  frontal  food  groove  (scale  bar 
40  juin)  as  well  as  (B)  cilia  of  the  abfrontal  putative  sensory  tufts  (st),  their  axons  (ax),  and  their  proximity  to 
the  palp  nerves  (pn);  scale  =  25  /AMI). 


sory  cells.  Many  spionids  (including  D.  i/uculrilobatd;  T. 
Riordan,  pers.  obs.)  switch  from  deposit  feeding  to  suspen- 
sion feeding  in  the  presence  of  higher  flow  rates  (Taghon  et 
al.,  1980;  Dauer  et  al.  1981).  This  switch  is  probably 
mediated  by  mechanosensory  detection  of  flow  rates.  In 
addition,  when  suspension  feeding,  spionids  collect  sus- 
pended particles  that  directly  intercept  the  palps.  Cilia  lining 
the  edge  of  the  frontal  food  groove  (i.e.,  laterofrontal  cilia) 
and  inside  the  food  groove  (i.e.,  frontal  cilia)  move  such 
particles  toward  the  mouth  (Dauer.  1984.  1985,  1987).  and 
may  be  mechanosensitive.  For  example,  the  laterofrontal 
cilia  of  one  spionid,  Paraprionospio  pinnatu,  beat  only 
when  contacted  by  a  suspended  particle  (Dauer,  1985). 
suggesting  a  mechanosensory  influence  on  activity. 

The  experiments  we  conducted  did  not  explicitly  isolate 
mechanical  stimulation  as  a  factor  affecting  cell  labeling; 
thus  we  cannot  make  any  conclusions  about  a  possible 
mechanosensory  function  for  the  palp  sensory  cells.  How- 
ever, the  trend  toward  increased  labeling  of  the  laterofrontal 
and  frontal  cells  in  the  flow-through  controls  (Fig.  8A)  is 
intriguing,  and  the  possibility  that  these  cells  function  as 
mechanoreceptors  should  be  further  examined  using  elec- 
trophysiological  approaches.  It  is  also  possible  that  the 
increased  labeling  in  controls  was  due  to  the  presence  of 
agmatine,  which  itself  is  a  potent  chemical  cue  in  zebrafish 
(Michel  et  til..  1999).  In  the  static  trials,  significantly  more 
cells  were  labeled  in  the  presence  of  amino  acids  and 
agmatine  than  in  agmatine  alone  (Fig.  8B);  increased  label- 
ing was  especially  pronounced  in  the  lateral  and  abfrontal 


cells.  There  was  virtually  no  labeling  in  the  agmatine  con- 
trols. These  results  suggest  that  the  lateral  and  abfrontal 
cells  are  chemosensory,  although  it  is  possible  that  the  cells 
were  stimulated  by  a  response  triggered  elsewhere  on  the 
body.  We  believe  that  body  movement  was  an  unlikely 
stimulus,  however,  because  the  worms  were  quiescent  dur- 
ing the  static  trials. 

If  we  accept  that  the  lateral  and  abfrontal  ciliated  tufts  are 
chemosensory.  then  the  question  arises  whether  the  cells 
function  as  distance  or  contact  chemoreceptors.  When  spio- 
nid polychaetes  are  deposit  feeding,  they  typically  probe  the 
sediment  surface  with  the  distal  portion  of  the  palps  (Dauer 
et  al.,  1981 ;  Lindsay,  pers.  obs.),  using  the  abfrontal  surface 
to  contact  the  sediment  surface.  Previously,  we  showed  that 
D.  (/uadrilobata  increased  active  feeding,  including  sedi- 
ment probing,  when  presented  with  particle-bound  amino 
acids  and  sugars  (Riordan  and  Lindsay,  2002).  Because  a 
waterborne  cue  was  minimal  or  nonexistent,  we  concluded 
that  the  palps  mediated  the  response.  In  addition.  Ferner  and 
Jumars  (1999)  reported  repeated  "pore-water-sniffing"  be- 
havior by  Boccardia  proboscidea  in  which  the  palps  were 
raised  into  the  water  column,  sank  passively  onto  the  sedi- 
ment, and  then  quickly  returned  to  an  upright  position. 
Again,  it  was  the  abfrontal  palp  surface  that  contacted  the 
sediment.  Given  such  behaviors,  we  speculate  that  the  ab- 
frontal cells  act  as  contact  chemoreceptors.  Yet  spionids 
also  use  their  palps  to  "monitor"  the  water  column  (Dauer  et 
til..  1981;  Ferner  and  Jumars,  1999),  and  the  lateral  and 


74 


S.  M.  LINDSAY  ET  AL 


Labeled 
laterofrontal  cells 

Labeled         I      •. 
frontal  cell      V 

* 


. 

,Vv 


*'• 

ft 

n 


25  |Jtn 


Y '#•'"   - 

,  •  :•..-• '  , 


Labeled 
abfrontal  cell 


;* 


Labeled 
lateral  cell 


\ 


B 


"Unlabeled 
abfrontal  cell 


D 


Figure  7.  Labeling  of  Dipolydnni  qiuulrilobata  palp  cells  by  agmatine  in  the  presence  and  absence  of  the 
amino  acid  mixture.  (A)  Semi-thin  section  from  palp  exposed  to  agmatine  +  amino  acids  showing  labeled 
laterofrontal  and  frontal  cells;  scale  =  25  ju,m.  Inset  shows  the  same  cells  at  higher  magnification;  scale  =  5  /xm. 
( B )  Semi-thin  section  from  palp  exposed  to  agmatine  +  amino  acids  showing  labeled  lateral  cell;  scale  =  25  fj.ni. 
Inset  shows  the  same  cell  at  higher  magnification;  scale  =  5  ;um.  (C)  Semi-thin  section  from  palp  exposed  to 
agmatine  +  amino  acids  showing  labeled  abfrontal  cell;  scale  =  25  /xm.  Inset  shows  the  same  cell  at  higher 
magnification;  scale  =  5  /xm.  (D)  Semi-thin  section  from  palp  exposed  to  agmatine  without  amino  acids 
(control),  showing  unlabeled  ahfrontul  cell  and  its  cilia  projecting  from  the  cuticle;  scale  =  25  fxm.  Inset  shows 
the  same  cell  at  higher  magnification;  scale  =  5  /xm. 


abfrontal  sensory  cells  might  also  function  as  distance  che- 
moreceptors. 

Among  invertebrates,  preliminary  studies  suggest  that 
gustatory  ("taste."  or  contact  chemosensitive)  and  olfactory 
("smell,"  or  distance  chemosensitive)  sensory  neurons  show 
a  considerable  amount  of  structural  similarity  (Dionne  and 
Dubin,  1994).  For  example,  two  populations  of  sensory 
cells  are  distributed  on  the  sensory  tentacles  of  the  nudi- 
branch  Plicstilla  sihoi>(ie.  The  intraepithelial  sensory  cells 
(contact  or  short-distance  chemoreceptors)  and  subepithelial 
sensory  cells  (olfaction)  have  distinct  spatial  distributions, 
axonal  organizations,  and  sensitivity  to  chemical  cues,  yet 
have  very  similar  electrophysiological  and  pharmacological 
characteristics  (Boudko  ct  til..  1997,  1999).  Our  experi- 
ments with  D.  c/UMirilo/xitii  demonstrate  ihat  the  lateral  and 
abfrontal  sensory  cells  of  the  palps  recogni/e  both  dissolved 


(i.e.,  lacking  contact,  this  paper)  and  adsorbed  (i.e.,  contact 
necessary.  Riordan  and  Lindsay.  2002)  cues.  The  initial 
ultrastructural  information  reveals  no  significant  differences 
among  the  groups  of  palp  sensory  cells  (laterofrontal,  lat- 
eral, and  abfrontal).  Characteri/ation  of  the  innervation  pat- 
terns and  immunoreactivity  to  serotonin  and  FMRFamide  is 
ongoing. 

Conclusion 

Previous  research  established  that  selection  of  particles  of 
certain  sizes  by  spionid  palps  can  he  influenced  by  mucus 
adhesion  strength  and  particle  "stickiness"  (Jumars  et  «/.. 
19X2:  Taghon.  19X2:  Dauer.  1985).  Qian  and  Chia  (1997) 
have  speculated  about  a  possible  sensory  role  the  palps  may 
play  in  selective  feeding,  and  putative  sensory  structures 


SPIONID  PERIPHERAL  SENSORY  CELLS 


75 


10  ,  FLOW 

1     I'- 

DCue 
D  Control 

o 

o      6  • 

i  5' 

nj      3  • 

1      1  - 
°      0- 

I 

I 

a, 

1 

± 

Frontal 

Laterofrontal               Lateral  and 

Abfrontal 

B 


STATIC 


E  2'5  " 

U  ^-'UC 

D  Control 

o      0 
o     2  - 

Cells  Labeled/ 

o  -^ 
D  bi  ->•  bi 

r 

> 

" 

Frontal 


Laterofrontal 


Lateral  and 
Abfrontal 


Figure  8.  Number  of  cells  per  100  /im  of  palp  of  Dipo/ydora  quadri- 
lobata  that  were  labeled  by  agmatine  in  the  presence  (cue)  and  absence 
(control)  of  the  amino  acid  mixture.  (A)  Results  from  the  flow  experiment 
using  20  mM  agmatine.  Numerous  sections  were  collected  from  each  of 
four  control  individuals  and  five  treatment  (cue)  individuals:  medians  are 
presented,  and  error  bars  indicate  the  75th  and  25th  percentile  values.  ">" 
indicates  the  value  of  the  mean.  (B)  Results  from  the  static  experiment 
using  40  mM  agmatine.  Numerous  sections  were  collected  from  each  of  six 
control  individuals  and  six  treatment  (cue)  individuals;  medians  are  pre- 
sented and  error  bars  indicate  the  75th  and  25th  percentile  values.  ": 
indicates  the  value  of  the  mean. 


have  been  identified  on  the  palps  (Dauer.  1984,  1987,  1991. 
1997;  Worsaee,  2001).  but  direct  evidence  linking  sensory 
cells  to  selective  behavior  was  lacking.  This  study  presents 
the  first  physiological  evidence  that  the  peripheral  sensory 
receptors  on  spionid  polychaete  palps  detect  chemical  stim- 
uli that  elicit  a  selective  feeding  response.  The  percentage  of 
peripheral  cells  that  were  labeled  in  the  presence  of  amino 
acids  varied  by  cell  type  (3%  to  14%).  and  was  greatest  for 
the  cells  located  on  the  lateral  and  abfrontal  surfaces  of  the 
palps.  This  rate  of  labeling  is  similar  to  that  observed  for 
olfactory  neurons  in  spiny  lobster  aesthetascs  (0.5%  to 
4.6%,  Steullet  et  ai,  2000).  For  spionid  polychaetes,  ultra- 
structural,  positional,  and  now  physiological  evidence 
strongly  suggests  that  the  feeding  palps  are  equipped  with 
lateral  and  abfrontal  sensory  cells  that  function  as  chemo- 
receptors.  Electrophysiological  experiments  will  be  re- 


quired to  determine  whether  these  cells  and  the  laterofrontal 
cells  might  also  function  as  mechanoreceptors. 

Acknowledgments 

We  thank  Kelly  Edwards  for  his  valuable  technical  as- 
sistance in  the  EM  lab  and  Jennifer  Jackson  for  her  help 
collecting  and  sorting  worms.  Brad  Galloway  and  Geoff 
Daniels  of  Leica  Microsystems,  Inc.,  assisted  in  obtaining 
the  image  shown  in  Figure  6A  during  the  Analytical  and 
Quantitative  Light  Microscopy  course  at  the  Marine  Bio- 
logical Laboratory.  May  2003.  Robert  Marc.  University  of 
Utah  School  of  Medicine,  kindly  provided  anti-agmatine 
antibody.  Comments  from  Charles  Derby  and  two  anony- 
mous reviewers  significantly  improved  the  manuscript  and 
we  are  grateful.  TJR  was  supported  in  part  by  the  Maine  Sea 
Grant  Program  and  the  School  of  Marine  Sciences  at  the 
University  of  Maine.  This  research  was  supported  by  NSF 
grants  OCE-9973327  and  OCE-0221229  to  SML  and  by  the 
Office  of  the  Vice  President  for  Research  at  the  University 
of  Maine. 

Literature  Cited 

Albertsson,  J.,  and  K.  Leonardsson.  2001.  Deposit-feeding  amphipods 
(Monoporeia  affinis]  reduce  the  recruitment  of  copepod  nauplii  from 
benthic  resting  eggs  in  the  northern  Baltic  Sea.  Mar.  Biol.  138:  793- 
801. 

Aller,  R.  C.  1994.  Bioturbation  and  remineralization  of  sedimentary 
organic  matter:  effects  of  redox  oscillation.  Chem.  Geol.  114:  331-345. 

Boilly-Marer,  Y.  1968.  Sur  le  role  chimiorecepteur  des  cirris  parapodi- 
aux  heteronereidiens  de  Plarynereis  dumerilii  Aud.  et  M.  Edwards. 
C.  R.  Acad.  Sci.  fParis)  Ser.  D  266:  1538-1585. 

Boilly-Marer,  Y.  1972.  Etude  ultrastructurale  des  cirres  parapodiaux 
de  Nereidiens  atoques  (Annelides.  Polychetes).  Z.  Zellforsch.  131: 
309-327. 

Boilly-Marer,  Y'.  1974.  Etude  experimental  du  comportement  nuptiale 
de  Platynereis  dumerilii  (Annelida,  Polychaeta):  chemor£ception. 
emission  des  produits  genitaux.  Mar.  Biol.  24:  167-179. 

Boudko,  D.  Y.,  M.  Switzer-Dunlap,  and  M.  G.  Hadfield.  1997.  Mor- 
phology, electrophysiology  and  pharmacology  of  anterior  sensory  path- 
ways in  the  nudibranch  mollusc.  Phestilla  sibogae.  Soc.  Neurosci. 
Abstr.  23:  1787. 

Boudko,  D.  Y.,  M.  Switzer-Dunlap,  and  M.  G.  Hadfield.  1999.  Cel- 
lular and  subcellular  structure  of  anterior  sensory  pathways  in  Phestilla 
sibogae  (Gastropoda.  Nudibrachia).  J.  Comp.  Neural.  403:  39-52. 

Brenchley.  G.  A.  1981.  Disturbance  and  community  structure:  an  exper- 
imental study  of  bioturbation  in  marine  soft-bottom  environments.  J. 
Mar.  Res.  39:  767-790. 

Brey,  T.  1991.  The  relative  significance  of  biological  and  physical  dis- 
turbance: an  example  from  intertidal  and  subtidal  sandy  bottom  com- 
munities. Esniar.  Cod.tr.  Shelf  Sci.  33:  339-360. 

Cavanaugh,  G.  M.  1975.  Formulae  and  Methods  VI.  The  Marine  Bio- 
logical Laboratory.  Woods  Hole,  MA. 

Christensen,  B.,  A.  Vedel.  and  K.  Kristensen.  2000.  Carbon  and  nitro- 
gen fluxes  in  sediment  inhabited  by  suspension-feeding  (Nereis  diver- 
\icnlor)  and  non-suspension-feeding  (Nereis  virens)  polychaetes.  Mar. 
Ecol.  Prog.  Ser.  192:  203-217. 

Dauer,  D.  M.  1984.  Functional  morphology  and  feeding  behavior  of 
Streblospio  benedicti  (Polychaeta:  Spionidae).  Pp.  418-429  in  Pro- 
ceedings of  the  First  International  Polychaete  Conference.  Sydney, 


76 


S.  M.  LINDSAY  ET  AL. 


P.  A.  Mulchings,  eel.  The  Linnean  Sociely  of  New  Soulh  Wales. 
Sydney. 

Dauer,  D.  M.   1985.     Functional  morphology  and  feeding  behavior  of 
Paraprionospio  pinnata  (Polychaeia:  Spionidae).  Mar.  Bioi  85:  143- 
151. 
Dauer,  D.  M.  1987.     Systematic  significance  ol  the  morphology  of  spio- 

nid  polychaete  palps.  Bull.  Biol.  Sue.  Wash.  7:  41 — 15. 
Duller,  D.  M.  1991.     Funclional  morphology  and  feeding  behavior  of 
Polyilma  commensalii   (Polychaeia:   Spionidae).   Ophelia  Snppl.   5: 
607-614. 
Dauer,  D.  M.   1997.     Functional  morphology  and  feeding  behavior  of 

Marenzelleria  vii-idis  (Polychaeia:  Spionidae).  Bull.  Mai:  Sci.  60:  512- 

516. 
Dauer,  D.  M.,  C.  A.  Maybury,  and  R.  M.  Ewing.   1981.     Feeding 

behavior  and  general  ecology  of  several  spionid  polychaeles  from  the 

Chesapeake  Bay.  J.  £v/>.  Mar.  Biol.  Ecol.  54:  21-38. 
Dionne,  V.  E.,  and  A.  E.  Dubin.  1994.     Transduclion  diversity  in  olfac- 

tion.  ./.  Exp.  Biol.  194:  1-21. 
Dorsell,  D.  A.,  and  R.  Hyde.  1969.     The  hue  structure  of  the  compound 

sense  organs  on  the  cirri  of  Nereis  i/ncrsicoloi:  Z.   Zellforsch.  97: 

512-527. 
Dwyer,  T.  M.,  D.  J.  Adams,  and  B.  Hille.  1980.     The  permeability  of  the 

endplate  channel  to  organic  cations  in  frog  muscle.  J.  Gen.  Physiol.  75: 

469-492. 
Edwards,  C.,  D.  Otloson,  B.  Rydqvisl,  and  C.  Swerup.  1981.     The 

permeability  of  the  transducer  membrane  of  the  crayfish  stretch  recep- 
tor to  calcium  and  other  divalent  cations.  Nenroscience  6:  1455-1460. 
Elmgren,  R.,  S.  Ankar,  B.  Marteleur,  and  G.  Ejdung.  1986.     Adult 

interference  with  postlarvae  in  soft-sediments:  the  Pon/opoieia-Ma- 

cuma  example.  Ecology  67:  827-  836. 
Emery,  D.  J.  1992.     Fine  structure  of  olfactory  epithelia  of  gastropod 

molluscs.  Micm.<:c.  Res.  Tech.  22:  307-324 
Ferner,  M.  C.,  and  P.  A.  Jumars.  1999.     Responses  of  deposit-feeding 

spionid  polychaeles  to  dissohed  chemical  cues.  J.  Exp.  Mar.  Biol. 

Ecol.  236:  89-106. 
Fewou,  J.,  and  N.  Dhainaut-Cnurtois.  1995.     Research  on  polychaete 

annelid  osmoregulatory  peptide(s)  by  immunocytochemical  and  phys- 
iological approaches.  Computer  reconstruction  of  the  brain  and  evi- 
dence for  a  role  of  angiotensin-like  molecules  in  Nereis  (Hcihsic) 

Jiversicolor  OF  Muller.  Biol.  Cell.  85:  21-33. 
Kindla),  R.  H.,  M.  B.  Trexlcr,  and  D.  C.  White.  1990.     Response  of  a 

benthic  microbial  community  to  biotic  disturbance.  Mar.  Ecol.  Prog. 

Ser.  62:  135-148. 
Klach,  E.  C.  1992.     Disturbance  of  benlhic  infauna  by  sedimenl-rework- 

ing  activities  of  the  lugworm  Areniiola  marina.  Nelli.  J.  Sen  Rrv  30: 

81-89. 
Forbes,  V.  E.,  and  G.  R.  Lopez.  1986.     Changes  in  feeding  and  crawling 

rates  ot  Hydrohia  irnnenia  (Prosohranchia:  Hydrohndael  in  response  to 

sedimentary  chlorophyll-a  and  recently  egcsicd  sediment.  Mai:  Ecol. 

Prog.  Ser.  33:  287-244. 
Grossman,  S.,  and  \V.  Reichardl.  1991.     Impact  ofArenicola  marina  on 

bacteria  in  intcrlidal  sediments    Mar   l,nl   Prog.  Sei:  77:  85-93. 
Griinert.  V.,  and  B.  W.  Ache.  1988.     infrastructure  of  the  acsthctasc 

(ollador)  I  sensilla  ol  ihe  spun    lohsici.  Punulinis  ttigiis.  Cell  Tissue 

AYs    251:  'is    HIV 
(.nntlii  i    C.-P.  1992.      Dispersal  of  mtcrlidal  inverlehralcs:  a  slralegy  to 

react  to  disturbances  ol  different  scales'"  Nelli    I   Sen  AV\.  30:  45-56. 
Mines,  A.  II.,  M.  II.  Pose),  and  P.  .1.  lladdon.  1989.     Cllccls  ol  adnll 

suspension    and  dcpoMi  lecdim1  hiuilvcs  on  recruitment  ol  csluaiine 

mlauna.  Veligci  32:   10')    I  I') 
Jelsiiig,    J.    2002.      I'lliasiiiiclinal    investigations    on    llic    cephalic    .ind 

mi-lameiic  nuchal  oigans  ol  .S/.;,-  ,  I    /,/„  ,„,„*,  (  I'oKchacla.  Spionidae). 

/oomoipliologv  121:  213   220 
Jouin,  (.,C.  TdicrninoU/eff.  M.  I  .  Handier,  and  A.  Tonlniond.  1985. 

Fine  slinctiiic  ol  probable  mechano-  and  clicinoicceplors  in  the  caudal 


epidermis  of  the  lugworm  Arenieolu  marina  (Annelida.  Polychaetal 
Zoomorphology  105:  76-82. 

Jumars,  P.  A.  1993.  Gourmands  of  mud:  diet  selection  in  marine  deposit 
feeders.  Pp.  124-156  in  Diet  Selection:  An  Interilisciplinan-  Approai  It 
lo  Foraging  Behaviour.  R.  N.  Hughes,  ed.  Blackwell  Scientific  Publi- 
cations. Oxford. 

Jumars,  P.  A.,  R.  F.  L.  Sell,  and  A.  R.  M.  Nowell.  1982.  Mechanics  of 
particle  selection  by  tentaculate  deposit  feeders.  ./.  Exp.  Mar.  Biol. 
Ecol.  64:  47-70. 

Karrh,  R.  R.,  and  D.  C.  Miller.  1994.  Functional  response  of  a  surface- 
deposit  feeder,  Saccoglossus  kowalevskii.  Linmol.  Oceanogr.  39: 
1455-1464. 

Kihslinger.  R.  L.,  and  S.  A.  Woodin.  2000.  Food  patches  and  a  surface 
deposit  feeding  spionid  polychaete.  Mar.  Ecol.  Prog.  Ser.  201:  233- 
239. 

Laverack,  M.  S.  1968.  On  the  receptors  of  marine  invertebrates.  Oeeun- 
ogr.  Mai:  Biol.  Anna.  Ke\:  6:  249-324. 

Lopez,  G.  R.,  and  J.  S.  Levinton.  1987.  Ecology  of  deposit-feeding 
animals  in  marine  sediments.  Q.  Rev.  Biol.  62:  235-260. 

Luckenbach,  M.  W.  1987.  Effects  of  adult  infauna  on  new  recruits: 
implications  for  the  role  of  biogenic  refuges.  J.  Exp.  Mai:  Biol.  Ecol. 
105:  197-206. 

Marc,  R.  E.  1995.  Visualization  of  glulamale-galed  channel  permeation: 
high  resolution  mapping  of  neuronal  subpopulations.  Soc.  Neurasci. 
Ahsn:  21:  781-786. 

Marc,  R.  E.  1999a.  Kainate  activation  of  horizontal,  bipolar,  amacrine, 
and  ganglion  cells  in  the  rabbit  retina.  ./.  Coinp.  Neurol.  407:  65-76. 

Marc,  R.  E.  1999b.  Mapping  glutamatergic  drive  in  the  vertebrate  retina 
with  a  channel-permeant  organic  cation. ./.  Comp.  Neurol.  407:  47-64. 

Marinelli,  R.  L.  1992.  Effects  of  polychaeles  on  silicate  dynamics  and 
fluxes  in  sediments:  importance  of  species,  animal  activity  and 
polychaete  effects  on  benthic  diatoms.  ./.  Mar.  Res.  50:  745-779. 

Mayer,  L.  M.,  Z.  Chen,  R.  H.  Findlay.  R.  H.  Fang,  S.  Sampson,  R.  F.  L. 
Self,  P.  A.  Jumars,  C.  Quetel,  and  O.  F.  X.  Donard.  1996.  Bio 
availability  of  sedimentary  contaminants  subject  lo  deposit-feeder  in- 
gestion.  Environ.  Sci.  Technol  30:  2641-2645. 

Michel,  W.  C.,  P.  Steullel,  H.  S.  Gate,  C.  J.  Burns,  A.  B.  Zhainazarnv. 
and  C.  D.  Derby.  1999.  High-resolution  functional  labeling  of  ver- 
tebrate and  invertebrate  olfactory  receptor  neurons  using  agmatme.  a 
channel-permeant  cation.  ./.  Nenrosci.  Metli.  90:  143-156. 

Mileikovsky,  S.  A.  1974.  On  predation  of  pelagic  larvae  and  early 
juveniles  of  marine  bottom  invertebrates  by  adult  benthic  invertebrates 
and  their  passing  alive  through  then  predators.  \hu.  liiol.  26:  303-3 1  1 . 

Miller,  I).  I'.,  and  P.  A.  .liiniars.  1986.  Pellet  accumulation,  sediment 
supply,  and  clouding  as  determinants  of  surface  deposit-feeding  rate  in 
Pseudopolydora  kempi  japonica  Imajima  and  Hartman  (PoKchaeta: 
Spionidae).  ./.  Exp.  M.a  Iliol.  Ecol.  99:  1-17. 

Nillrouer,  C'.  A.,  and  R.  \V.  Sternherg.  1981.  The  formation  of  sedi- 
menlai)  strata  in  an  allochlhonous  shell  environment:  the  \\aslnnglon 
continental  shell  Mai:  (icol  42:  201  232. 

Nozais,  C.,  .1.  C.  Duchene.  and  M.  Bliaiul.  1997.  Control  of  posinon  in 
the  water  column  by  the  larvae  ot  I'oci  ilocliaetics  \,-r/ien.\  (PoKchaeta): 
the  importance  of  mucus  secretion.  ./.  E\p.  Mar.  liiol.  Ecol  210: 
')]  106. 

Olal'sson,  E.  B.  1989.  Contrasting  influences  ot  suspension-feeding  and 
deposit-feeding  populations  ol  .\lucoina  haltliica  on  mlaunal  recruit- 
ment M,n-  Ecol.  Prog.  Ser.  55:  171-179. 

Picco,  C.,  and  A.  Menini.  1993.  Ihe  peimeahilily  of  the  cCIMP-.icti- 
valcd  channel  to  organic  cations  in  retinal  rods  of  the  tiger  salamander. 
./.  Pln-siol.  460:  741-758. 

Plante,  C.  J.,  and  L.  M.  M:i\er.  1994.     Distnlnition  and  eflicienc)  of 
baclenoKsis    in    the   gut   ol    Arcnicola   marina   and    three   additional 
deposit  leeders    Mai    Ecol    Piog.  Ser.  109:  193    !')-) 
Pose).  M.  II.    l')8(>.     Changes  in  a  benlhic  community  associated  with 


SPIONID  PERIPHERAL  SENSORY  CELLS 


77 


dense  beds  of  a  burrowing  deposit  feeder.  Calliumisaa  californiensis. 
Mar.  Ecol.  Prog.  Ser.  31:  15-22. 

Purschke,  G.  1997.  Ultrastructure  of  nuchal  organs  in  polychaetes  (An- 
nelida)— new  results  and  review.  Acta  Zool.  78:  123-143. 

Qian,  P.,  and  F.  Chia.  1997.  Structure  of  feeding  palps  and  feeding 
behavior  of  the  spionid  polychaete  Polydora  polybranchia.  Bull.  Mar. 
Sci.  60:  502-5  1 1 . 

Rhoads,  D.  C.,  and  D.  K.  Young.  1970.  The  influence  of  deposit- 
feeding  organisms  on  sediment  stability  and  community  trophic  struc- 
ture. J.  Mai:  Res.  28:  150-174. 

Rhode,  B.  1990.  Ultrastructure  of  nuchal  organs  in  some  marine 
polychaetes.  J.  Morphot.  206:  95-107. 

Riordan,  T.  J.,  Jr.,  and  S.  M.  Lindsay.  2002.  Feeding  responses  in 
particle-bound  cues  by  a  deposit-feeding  spionid  polychaete.  Dipolv- 
ilora  quadrilobata  (Jacobi  1883).  J.  E\p.  Mar.  Biol.  Ecol.  277:  79-95. 

Rittschof,  D.,  and  C.  U.  Buswell.  1989.  Stimulation  of  feeding  behavior 
in  three  species  of  tiddler  crabs  by  hexose  sugars.  Chem.  Sensc\  14: 
121-130. 

Robertson,  J.  R.,  K.  Bancroft,  G.  Vermeer,  and  K.  Plaisier.  1980. 
Experimental  studies  on  the  foraging  behavior  of  the  sand  tiddler  crab 
Uca  pugilutor  (Emc  1X02).  ./.  E\p.  Mar.  Biol.  Ecol.  44:  67-X3. 

Robertson,  J.  R.,  J.  A.  Fudge,  and  G.  K.  Vermeer.  1981.  Chemical  and 
live  feeding  stimulants  of  the  sand  fiddler  crab  Uca  pugilatar  (Bosc).  J. 
Exp.  Mar.  Biol.  Ecol.  53:  47-64. 

Rullier,  F.  1951.  Etude  morphologique,  histologique.  et  physiologique 
de  1'organe  nuchal  chez  annelids  polychaetes  sedentaires.  Ann.  lust. 
Oceanogr.  Monaco  25:  207-341. 

Schlotzer-Schrehardt,  LI.  1987.  Ultrastructural  investigations  of  the  nu- 
chal organs  of  Pygospio  elegans  (Polychaeta).  II.  Adult  nuchal  and 
dorsal  organs.  Zoomorphology  107:  169-179. 

Shull,  D.  H.  2001.  Transition-matrix  model  of  bioturbation  and  radionu- 
clide  diagenesis.  Limnol.  Oceanogr.  46:  905-916. 

Steullet,  P.,  H.  S.  Gate,  W.  C.  Michel,  and  C.  D.  Derby.  2000.  Func- 
tional units  of  a  compound  nose:  aesthetasc  sensilla  house  similar 
populations  of  olfactory  receptor  neurons  on  the  crustacean  antennule. 
J.  Comp.  Neural.  418:  270-280. 

Storch,  V.,  and  U.  Schlotzer-Schrehardt.  1988.  Sensory  structures.  Pp. 
121-133  in  The  Ultrastructure  of  Polvchaeta.  Microfauna  Miiiina, 
Vol.  4.  W.  Westheide,  and  C.  O.  Hermans,  eds.  Gustav  Fischer  Verlag, 
New  York. 

Suchanek,  T.  H.  1983.  Control  of  seagrass  communities  and  sediment 
distribution  by  Callianassa  (Crustacea,  Thalassinidea)  bioturbation.  / 
Mar.  Res.  41:  281-298. 

Taghon,  G.  L.  1982.  Optimal  foraging  by  deposit-feeding  invertebrates: 
roles  of  particle  size  and  organic  coating.  Oecologia  52:  295-304. 


Taghon,  G.  L..  A.  R.  M.  Nowell,  and  P.  A.  Jumars.  1980.  Induction  of 
suspension  feeding  in  spionid  polychaetes  by  high  particle  fluxes. 
Science  210:  562-564. 

Tamaki,  A.  1985.  inhibition  of  larval  recruitment  of  Armandia  sp. 
(Polychaeta:  Opheliidae)  by  established  adults  of  Pseudopolydora 
paucibranchiata  (Okuda)  (Polychaeta:  Spionidae)  on  an  intertidal  sand 
flat.  J.  E\/>.  Mar.  Biol.  Ecol.  87:  67-  82. 

Weissburg,  M.  J.  1993.  Sex  and  the  single  forager:  gender-specific 
energy  maximizing  strategies  in  the  fiddler  crab  Uca  pugnax.  Ecology 
74:  279-291. 

Weissburg,  M. ,).  1999.  Sex-specific  tuning  and  dose-response  functions 
in  male  fiddler  crabs.  Uca  pugnax.  J.  Comp.  Physiol.  A.  353:  787-804. 

Weissburg,  M.  J.  2001.  Sex.  sensitivity,  and  second  messengers:  differ- 
ential effect  of  cyclic  nucleotide  mediated  inhibition  in  the  chemosen- 
sory  system  of  fiddler  crabs.  J.  Comp.  Physiol.  A  187:  489-498. 

Weissburg,  M.  J.,  and  C.  D.  Derby.  1995.  Regulation  of  sex-specific 
behavior  in  fiddler  crabs:  physiological  properties  of  chemoreceptor 
neurons  in  claws  and  legs  of  males  and  females.  J.  Comp.  Physiol.  A 
176:  513-526. 

Weissburg,  M.  J.,  and  R.  K.  Zimmer-Faust.  1991.  Ontogeny  versus 
phylogeny  in  determining  patterns  of  chemoreception:  initial  studies 
with  fiddler  crabs.  Biol.  Bull.  181:  205-215. 

Weissburg,  M.  J.,  J.  Pearce,  C.  K.  Govind,  and  C.  D.  Derby.  1996. 
Sexually  dimorphic  patterns  of  neural  organization  in  the  feeding 
appendages  of  fiddler  crabs.  Cell  Tissue  Res.  286:  155-166. 

Weston,  D.  P.,  D.  L.  Penry,  and  L.  K.  Gulmann.  2000.  The  role  of 
ingestion  as  a  route  of  contaminant  bioaccumulation  in  a  deposit- 
feeding  polychaete.  Arch.  Environ.  Contain.  Toxicol.  38:  446-454. 

Widbom,  B.,  and  J.  B.  Frithsen.  1995.  Structuring  factors  in  a  marine 
soft-bottom  community  during  eutrophication — an  experiment  with 
radio-labeled  phytodetritus.  Oecologia  101:  156-168. 

Williams,  J.  G.  1980.  The  influence  of  adults  on  settlement  of  spat  of  the 
clam.  Tapes  japonica,  J.  Mar.  Res.  38:  729-741. 

Wilson,  W.  H.,  Jr.  1980.  A  laboratory  investigation  of  the  effect  of  a 
terebellid  polychaete  on  the  survivorship  of  Nereid  polychaete  larvae. 
J.  Exp.  Mar.  Biol.  Ecol.  46:  73-80. 

Wilson,  W.  H.,  Jr.  1981.  Sediment-mediated  interactions  in  a  densely 
populated  infaunul  assemblage:  the  effects  of  the  polychaete  Abareni- 
cola  pacifica.  J.  Mar.  Res.  39:  735-748. 

Woodin,  S.  A.  1976.  Adult-larval  interactions  in  dense  infaunal  assem- 
blages: patterns  of  abundance.  J.  Mar.  Res.  34:  25-41. 

Worsaae.  K.  2001.  The  systematic  significance  of  palp  morphology  in 
the  Pnlydora  complex  (Polychaeta:  Spionidae).  Zool.  Anz.  240:  47-59. 

Yoshikami,  D.  1981.  Transmitter  sensitivity  of  neurons  assayed  by  au- 
toradiography.  Science.  212:  929-930. 


Reference:  Biol.  Bull.  206:  7S-86.  (April  2004) 
©  2004  Marine  Biological  Laboratory 


Physiological  Development  of  the  Embryonic  and 
Larval  Crayfish  Heart 


S.  L.  HARPER1   AND  C.  L.  REIBER- :i 

1  U.S.  Environmental  Protection  Agency,  Environmental  Sciences  Division/ORD.  P.O.  Bo.\  93478, 

Las  Vegas,  Nevada  89193-3478:  and  '  Department  of  Biology,  4505  Maryland  Parfovay, 

Box  454004,  University  of  Nevada,  Las  Vegas,  Nevada  89154-4004 


Abstract.  The  cardiovascular  system  is  the  first  system  to 
become  functional  in  a  developing  animal  and  must  perform 
key  physiological  functions  even  as  it  develops  and  grows. 
The  ontogeny  of  cardiac  physiology  was  studied  throughout 
embryonic  and  larval  developmental  stages  in  the  red 
swamp  crayfish  Procambarus  clarkii  using  videomicro- 
scopic  dimensional  analysis.  The  heart  begins  to  contract  by 
day  13  of  development  (at  25  °C,  20  kPa  O2).  Cardiac 
output  is  primarily  regulated  by  changes  in  heart  rate  be- 
cause stroke  volume  remains  relatively  constant  throughout 
embryogenesis.  Prior  to  eclosion,  heart  rate  and  cardiac 
output  decreased  significantly.  Previous  data  suggest  that 
the  decrease  in  cardiac  parameters  prior  to  hatching  may  be 
due  to  an  oxygen  limitation  to  the  embryo.  Throughout 
development,  metabolizing  mass  and  embryonic  oxygen 
consumption  increased,  while  egg  surface  area  remained 
constant.  The  surface  area  of  the  egg  membrane  is  a  con- 
straint on  gas  exchange;  this  limitation,  in  combination  with 
the  increasing  oxygen  demand  of  the  embryo,  results  in  an 
inadequate  diffusive  supply  of  oxygen  to  developing  tis- 
sues. To  determine  if  the  decrease  in  cardiac  function  was 
the  result  of  an  internal  hypoxia  experienced  during  late 
embryonic  development,  early  and  late-stage  embryos  were 
exposed  to  hyperoxic  water  (Pn2  =  40  kPa  O2).  Heart  rate 
in  late-stage  embryos  exposed  to  hyperoxic  water  increased 
significantly  over  control  values,  which  suggests  that  the 
suppression  in  cardiac  function  observed  in  late-stage  em- 
bryos is  due  to  a  limited  oxygen  supply. 


Received  22  October  2001:  accepted  i  K'bmaix   20114 
*  To  whom   correspondence   should   lie   addressed    I.  mail:   Reiberfri' 
ccinail.nevada.edu 


Introduction 

Crustaceans  exhibit  a  diverse  array  of  metabolic  and 
physiological  responses  to  aquatic  hypoxia  (Reiber.  1995). 
Typically,  hypoxic  exposure  results  in  a  decreased  heart  rate 
(bradycardia)  in  decapod  crustaceans  (McMahon  and  Bur- 
nett. 1990;  Wilkens,  1993;  McGaw  et  ai.  1994;  Reiber, 
1995;  Reiber  and  McMahon,  1998).  This  hypoxia-induced 
bradycardia  has  been  well  documented  in  adult  red  swamp 
crayfish  (Procamhants  clarkii}  (Reiber,  1995.  1997;  Chap- 
man and  Reiber.  1998;  Reiber  and  McMahon,  1998).  How- 
ever, an  examination  of  heart  rate  alone  does  not  provide  a 
complete  picture  of  cardiac  performance.  Cardiac  output 
and  stroke  volume  are  broader  measures  of  cardiac  perfor- 
mance that  can  vary  over  wide  ranges  with  little  or  no 
variation  in  heart  rate  (Orlando  and  Finder.  1995).  Further- 
more, heart  rate  and  stroke  volume  can  vary  independently 
of  each  other  in  decapods  (McMahon  and  Burnett.  1990). 
Therefore,  the  cardiovascular  response  of  decapods  to  a 
given  perturbation  can  be  understood  only  by  evaluating 
heart  rate,  stroke  volume,  and  cardiac  output  rather  than  just 
heart  rate. 

Cardiac  performance  in  adult  red  swamp  crayfish  is  al- 
tered when  the  animals  are  exposed  to  levels  of  oxygen 
below  the  critical  level  needed  to  maintain  aerobic  metab- 
olism (PrRII )  (approximately  5  kPa  O2  at  25  °C)  (Reiber, 
1995).  Reiber  ( 1995)  found  a  decrease  in  heart  rate  and  an 
increase  in  stroke  volume  in  adult  red  swamp  crayfish 
exposed  to  hypoxic  conditions.  The  increase  in  stroke  vol- 
ume and  maintenance  of  cardiac  output  is  likely  due  to 
increased  pericardia!  sinus  pressure  coupled  with  increased 
filling  pressure,  an  increase  in  diastolic  filling  time,  and  an 
increased  end  diastolic  volume  (Reiber,  1995). 

Information  on  cardiac  function  and  hypoxic  responses  in 
embryonic  and  larval  crustaceans  is  limited  (Spicer,  1994; 


7S 


CRAYFISH   HEART  PHYSIOLOGICAL  DEVELOPMENT 


79 


Spicer  and  Morritt,  1996:  Reiber,  1997).  Cardiac  functions 
in  embryos  and  larvae  can  be  quite  different  from  those  of 
adults  because  centers  of  metabolic  activity  shift  during 
development  (Reiber.  1997).  Additionally,  embryonic  cray- 
fish cannot  escape  hypoxic  waters:  the  embryos  are  attached 
to  the  female's  pleopods.  and  the  brooding  female  typically 
remains  sequestered  within  the  burrow  where  the  water  can 
become  oxygen-depleted  due  to  both  crayfish  and  microbial 
respiration  (Payette  and  McGaw.  2003).  To  survive,  the 
embryonic  and  larval  crayfish  must  possess  physiological 
mechanisms  for  dealing  with  hypoxia,  and  these  may  differ 
from  adult  responses.  Fluid  convection  on  either  side  of  the 
egg  membrane  would  allow  for  greater  oxygen  extraction 
from  the  environment  by  eliminating  boundary  layers  and 
maintaining  a  diffusional  gradient.  The  embryo  itself  does 
not  move  around  within  the  egg  to  aid  convective  processes, 
so  cardiac  development  is  critical  to  embryonic  viability 
because  it  provides  the  only  source  of  internal  convection  to 
facilitate  gas  movement  within  the  egg  (Seymour  and  Brad- 
ford, 1995). 

In  late-stage  crayfish  embryos,  E-Stage  XVI,  cardiac  ac- 
tivity is  not  significantly  responsive  to  hypoxic  exposure, 
whereas  in  E-Stage  XIV,  the  heart  rate  decreases  signifi- 
cantly when  water  Po2  is  dropped  to  5  kPa  (an  adult-like 
response)  (Reiber,  1995;  refer  to  table  1  for  staging).  Reiber 
(1995)  attributed  the  lack  of  response  in  the  late-stage 
embryos  to  the  possibility  that  they  are  already  internally 
hypoxic  (experiencing  levels  of  oxygen  below  their  meta- 
bolic demands).  This  hypothesis  was  supported  by  the  find- 
ing that  the  heart  rates  for  animals  at  E-Stage  XVI  were  the 
same  as  those  for  E-Stage  XIV  embryos  during  hypoxic 
exposure  (2  kPa)  (Reiber.  1995). 

The  current  study  evaluates  cardiac  physiology  and  met- 
abolic function  throughout  early  development  of  the  red 
swamp  crayfish.  To  determine  whether  embryos  are  expe- 
riencing an  internal  hypoxia  just  prior  to  hatching,  oxygen 
consumption  was  measured  along  with  metabolizing  mass 
and  exchange  surface  area  throughout  development.  Subse- 
quently, early  and  late-stage  embryos  were  exposed  to 
acutely  hyperoxic  conditions.  It  was  expected  that  cardiac 
function  in  late  stage  embryos  would  be  impaired  due  to  an 
internal  hypoxia  caused  by  an  increase  in  metabolizing  mass 
and  the  limits  in  the  surface  area  for  gas  exchange.  Such 
physiological  cardiovascular  impairment  would  result  in  a 
decrease  in  cardiac  parameters  that  would  be  alleviated  by 
exposure  to  hyperoxic  water. 

Materials  and  Methods 

Cravftsh  breeding 

Adult  male  and  female  crayfish  (Procambams  cUirkii 
[Girard,  1852)  were  purchased  from  the  Atchafalaya  Bio- 
logical Supply  Co.,  Inc.  Animals  were  maintained  in  the 
laboratory  in  35-1  aquaria  (5-6  animals  to  an  aquarium) 


filled  with  dechlorinated  tap  water  (25  °C,  pH  =  7.0. 
conductivity  ==  150-300  jitS)  and  fed  twice  a  week  (ro- 
maine  lettuce  and  liver).  Mature  females  were  separated 
from  other  animals  and  placed  into  individual  2-1  containers 
(25  °C  and  10: 14  dark/light  cycle),  where  they  were  held  for 
3-4  days,  after  which  a  sexually  mature  male  was  placed  in 
the  container  and  the  pair  was  observed  for  mating  behavior. 
If  mating  did  not  ensue  within  20  min.  the  male  was 
replaced  with  another  male  and  again  observed  for  copula- 
tory  behavior.  If  copulation  occurred,  the  animals  were  left 
together  for  5  h  and  then  separated  to  prevent  cannibalism. 
After  mating,  females  were  placed  into  a  nursery  aquarium 
(25  °C)  and  observed  daily  until  eggs  were  laid. 

Experimental  apparatus 

Crayfish  embryos  or  larvae  were  removed  from  females, 
staged  according  to  Harper  and  Reiber  (2001).  and  then 
attached  to  an  applicator  stick  using  cyanoacrylate  gel  glue. 
A  minimal  amount  of  gel  glue  was  applied  to  the  flattened 
end  of  the  applicator  stick  and  pressed  against  the  egg  or 
larva.  Care  was  taken  to  minimize  obstruction  of  the  egg's 
respiratory  surface  area  yet  provide  a  firm  holdfast  for 
attachment.  Animals  were  then  placed  into  a  flow-through 
experimental  chamber  (Harper  and  Reiber.  1999)  where 
they  were  held  for  30  min.  Larval  crayfish  were  not  ob- 
served to  struggle  or  show  swimming  behaviors  during  the 
experimental  period.  Water  (25  °C,  pH  ==  7.0,  Po^  =  20 
kPa)  was  pumped  ( 12  ml  •  min~')  through  the  experimental 
chamber  and  then  over  a  Clark-type  polarographic  oxygen 
electrode  to  determine  Po2.  The  Po2  and  temperature  of  the 
reservoir  water  were  established  and  maintained  using  a  gas 
mixing  system  (Cameron  Instrument  Company.  GF-3/MP) 
and  a  circulating  water  bath  (VWR  Scientific.  1160). 
Changes  in  heart  shape  were  monitored  using  a  microscope 
(Leica  MZ  12.5)  equipped  with  a  video  camera  (Mintron, 
05-70D),  super  VMS  video  recording  system  (Panasonic, 
PV-4661),  and  Horita  time  code  generator  (VG-50). 

Ontogeny  of  heart  rate,  stroke  volume,  and  cardiac  oiit/uit 

Seven  crayfish  from  each  of  seven  developmental  stages 
were  used:  embryonic  stages  E-Stage  XIII,  E-Stage  XIV, 
E-Stage  XV.  and  E-Stage  XVI,  and  larval  stages  L-Stage  I. 
L-Stage  II.  and  L-Stage  III  (see  Reiber.  1995:  and  Reiber 
and  Harper,  2001.  for  details  on  the  correlation  between 
days  of  development  at  25  °C  and  developmental  stage  for 
these  stages).  Heart  rate  and  stroke  volume  were  obtained 
using  frame-by-frame  (60  Hz  sampling  speed)  analysis  of 
the  videotape  on  an  editing  tape  player  (Panasonic,  AG- 
DS550).  Heart  rate  for  each  animal  is  presented  as  the  mean 
number  of  beats  per  minute  calculated  from  three  30-s 
intervals.  To  determine  cardiac  volumes  (end  diastolic  vol- 
ume and  end  systolic  volume),  embryonic  and  larval  cray- 
fish hearts  were  modeled  as  a  prolate  spheroid  (cardiac 


80 


S.  L.  HARPER  AND  C.  L.  REIBER 


volume  =  4/3 mib~),  where  u  and  b  are  half  of  the  mea- 
sured long  and  short  axes  of  the  heart,  respectively  (Keller 
etui,  1991,  1994;Tabere?fl/.,  1992;  Schwerte  and  Pelster, 
2000;  and  Harper  and  Reiber,  2001).  In  early  embryos 
(Stage  XIII).  the  length  of  both  the  long  and  short  axes  of 
the  heart  were  averaged  over  a  minimum  of  10  cardiac 
cycles  to  account  for  peristaltic-like  contractions  when  the 
heartbeat  is  initiated.  The  geometric  equation  used  to  model 
the  heart  takes  into  account  cardiac  growth  with  develop- 
ment (i.e.,  the  increasing  length  and  width  of  the  heart  as 
measured  within  each  developmental  stage).  In  later  devel- 
opmental stages  (embryonic  and  larval)  the  heart  remains  a 
prolate  spheroid;  it  changes  only  in  its  ratio  of  length  to 
width.  The  equation  for  a  prolate  spheroid  can  be  applied 
even  if  the  changes  are  somewhat  disproportional  (i.e.,  a 
longer  thinner  prolate  spheroid  models  mathematically  the 
same  as  a  shorter  thicker  prolate  spheroid).  The  basic  ge- 
ometry of  the  heart  remains  the  same  throughout  develop- 
ment, with  changes  occurring  primarily  in  the  long  and  short 
axes.  Stroke  volume  was  calculated  from  the  difference 
between  end  diastolic  volume  (EDV)  and  end  systolic  vol- 
ume (ESV).  Cardiac  output  was  calculated  as  the  product  of 
stroke  volume  and  heart  rate.  Heart  rate,  stroke  volume,  and 
cardiac  output  were  determined  for  each  developmental 
stage. 


Ox\gen  consumption 

Closed-system  respirometry  was  used  to  determine  em- 
bryonic oxygen  consumption.  Six  animals  were  placed  in  a 
50-ml  syringe  filled  with  aerated  water  and  placed  on  an 
oscillating  plate  at  25  °C.  A  5-ml  water  sample  was  injected 
into  a  chamber  holding  a  Clark-type  polarographic  oxygen 
electrode  after  30,  60,  and  90  min.  Three  replicates  were  run 
for  each  of  the  following  stages:  E-Stage  II.  E-Stage  XIII. 
E-Stage  XV,  E-Stage  XVI,  L-Stage  I,  and  L-Stage  III.  Two 
syringes  lacking  animals  were  run  to  account  for  bacterial 
respiration,  which  was  found  to  be  negligible.  Fluid  volume 
and  water  Po2  in  the  experimental  chamber  were  decreased 
by  a  total  of  15  ml  and  6.6  kPa  O-,  (minimum)  over  the 
90-min  course  of  the  experiments.  This  change  in  volume 
was  adjusted  for  when  calculating  oxygen  consumption. 
Rates  of  oxygen  consumption  over  the  experimental  period 
were  consistent,  indicating  that  the  small  reduction  in  oxy- 
gen availability  did  not  adversely  affect  the  animals.  Mass- 
specific  oxygen  consumption  is  reported  as  microliters  of 
O2  per  milligram  (\\el  mass)  per  hour.  Oxygen  consumption 
rate  was  calculated  according  to  the  formula  Vo-,  =  (V,  X 
A/\vr>2  x  /3\v<>2^A'  x  W;  where  Vo2  is  oxygen  consump- 
tion. V,  is  the  volume  of  water  in  the  respirometer,  APwrP 
is  the  change  in  water  /'<>_,.  J3W02  is  the  capacitance  of 
oxygen  in  water.  A?  is  the  duration  in  minutes,  and  W  is  the 
wet  weight  of  the  animal. 


Lipid  and  metabolizing  mass 

Embryonic  crayfish  were  collected  from  gravid  females 
at  E-Stage  II.  E-Stage  XIII.  E-Stage  XV,  and  E-Stage  XVI, 
and  larval  crayfish  were  collected  at  L-Stage  I  and  L-Stage 
III.  Egg  diameter  and  larval  length  were  measured  (n  =  7 
per  stage).  Egg  surface  area  was  calculated  using  the  for- 
mula for  a  sphere  (surface  area  (mm2)  ==  4-nr2).  Surface 
area  was  calculated  only  for  embryos.  Each  embryo  and 
larva  was  dried  with  a  Kimwipe  for  10  s  prior  to  weighing 
and  placed  on  a  clean,  preweighed  coverslip.  To  determine 
the  metabolically  active  mass  (tissue)  of  the  embryo  or 
larva,  the  nonmetabolic  (lipid)  portion  of  the  body  was  first 
removed  by  puncturing  the  wall  of  the  animal  and  isolating 
the  lipid  onto  the  coverslip.  The  lipid-free  animal  was  then 
weighed.  The  egg  membrane  and  exoskeleton  were  not 
separated  from  the  active  metabolizing  mass  but  were  as- 
sumed to  contribute  little  to  mass  error  because  they  con- 
stitute only  a  small  proportion  of  overall  mass.  Furthermore, 
errors  in  this  estimate  were  likely  similar  among  stages  of 
development.  Non-lipid  mass  was  calculated  as  the  differ- 
ence in  animal  mass  before  and  after  removal  of  lipids. 

H\peroxic  exposure 

Animals  at  E-Stage  XIV  (n  --••  13)  and  E-Stage  XVI 
(n  =  13)  were  held  individually  under  experimental  cham- 
ber conditions  for  30  min  followed  by  heart  rate  measure- 
ments to  determine  control  values.  Control  and  experimen- 
tal Po2  values  were  established  and  maintained  using  a  gas 
mixing  system  (Cameron  Instrument  Company,  GF-3/MP). 
Embryos  were  exposed  to  normoxic  (20  kPa  O2)  and  hy- 
peroxic  (40  kPa  O2)  water  for  30  min.  Heart  rate  was 
determined  as  previously  described  for  both  control  and 
experimental  conditions  at  E-Stage  XIV  and  E-Stage  XVI. 

Statistical  analysis 

Means  and  standard  errors  were  calculated  for  each  stage 
(n  =  7)  for  data  on  egg  surface  area,  lipid  mass,  metabo- 
lizing mass,  and  oxygen  consumption  rate.  An  analysis  of 
variance  was  used  to  determine  overall  effects  of  develop- 
ment on  the  dependent  variables  (SigmaStat.  ver.  2.03).  A 
Bonferroni  /-test  was  used  for  pairwise  multiple  compari- 
sons where  a  significance  of  P  ^  0.05  was  found.  Lipid/ 
metabolizing  mass  ratios  failed  normality  tests,  thus  an 
analysis  of  variance  based  on  ranks  and  a  Tukey  test  were 
used.  Baseline  cardiac  parameters  were  established  by  pool- 
ing values  obtained  for  each  stage  (n  =  7)  and  calculating 
a  mean  and  standard  error.  The  effects  of  developmental 
stage  on  cardiac  parameters  were  assessed  using  a  one-way 
analysis  of  variance  (SigmaStat.  ver.  2.03).  Where  develop- 
mental effects  were  shown  to  be  significant  (P  <  0.05), 
group  means  were  compared  using  the  Newman-Keuls  mul- 
tiple range  test.  A  Student's  /-test  was  used  to  compare 


CRAYFISH   HEART  PHYSIOLOGICAL  DEVELOPMENT 


81 


embryonic  response  to  normoxic  and  hyperoxic  exposure 
with  significance  at  the  level  of  P  =  0.05.  Embryos  within 
a  developmental  stage  (n  =  13)  were  used  for  comparison. 

Results 

Ontogeny  of  heart  rate,  stroke  volume,  anil  cardiac  output 

Uncoordinated  cardiac  contractions  began  in  embryonic 
crayfish  by  E-Stage  XIII  of  development,  with  a  mean  heart 
rate  of  160  ±  3  (SEM)  beats  •  min~ '  (bpm).  At  the  onset  of 
cardiac  contractions  heart  rate  was  irregular,  characterized 
by  short  bursts  of  activity  (e.g.,  300  bpm),  very  long  peri- 
staltic-like  contractions  (e.g.,  48  bpm).  and  intermittent 
periods  of  cardiac  arrest  (maximum  of  11  s).  Therefore, 
heart  rate  was  determined  by  averaging  over  the  six  30-s 
time  periods.  Heart  rate  varied  significantly  with  develop- 
ment (P  =  0.05,  F  --•  7.29).  Mean  heart  rate  remained 
unchanged  (163  ±  2  bpm)  through  E-Stage  XIV,  after 
which  it  increased  significantly  (P  =  0.05,  F  =  3.64)  to 
192  ±  6  bpm  at  E-Stage  XV.  At  E-Stage  XVI.  heart  rate 
decreased  significantly  (P  =  0.05,  F  =  3.01 )  to  149  ±  3 
bpm  and  remained  at  this  rate  until  eclosion.  Upon  hatching, 
heart  rate  increased  significantly  (P  =  0.05,  F  =  5. 1  I  )  to 
255  ±  9  bpm  and  remained  at  this  level  through  all  three 
larval  stages  (Fig.  la). 

Both  stroke  volume  and  cardiac  output  showed  little 
variation  throughout  embryonic  development  (Fig.  Ib,  c). 
However,  after  hatching  (L-Stage  I),  stroke  volume  in- 
creased significantly  (P  =  0.05,  F  =  42.17)  from  3.8  ± 
0.9  (SEM)  nl/beat  to  12.4  ±  1.8  nl/beat.  and  cardiac  output 
increased  significantly  (P  ==  0.05.  F  •  •-  281.55)  from 
178  ±  96  (SEM)  nl  •  min~'  pre-hatching  (E-Stage  XVI)  to 
3130  ±  46  nl  •  min~'  at  the  first  larval  stage.  Stroke  volume 
decreased  significantly  (P  <  0.001.  F  =  21.64)  from  the 
first  larval  stage  ( 1 2.4  ±  1 .8  nl  •  beat" ' )  to  the  second  larval 
stage  (6.07  ±  1.9  nl  •  beat"1),  with  no  significant  change 
occurring  from  the  second  to  third  larval  stages.  During 
larval  development,  cardiac  output  followed  stroke  volume, 
decreasing  significantly  (P  =  0.05,  F  =  77. 1  7)  at  L-Stage 
II  and  then  remaining  stable  into  L-Stage  III  (1660  ±  43  to 
1747  ±  47  nl  •  inin"'). 

The  effects  of  cardiac  differentiation  and  elongation  on 
the  ontogeny  of  cardiac  physiology  can  be  assessed  using 
the  data  relating  the  length  and  width  of  the  heart  at  end 
diastole  to  days  of  development  (Fig.  2).  The  pattern  of 
cardiac  development  reveals  that  the  heart  grows  in  length 
from  8.3  ±  0.3  (SEM)  to  1 1.0  ±  0.4  ju,m  (32.5%  increase) 
as  compared  to  width  from  5.9  ±  0.2  (SEM)  to  8.4  ±  0.3 
/urn  (42.4%  increase),  through  embryonic  development. 
There  is  a  greater  absolute  increase  in  the  length  as  opposed 
to  the  width  of  the  heart  during  development,  which  results 
in  a  dramatic  increase  in  the  length-to-width  ratio  after 
eclosion. 


XIII 


XV 


XVI 


Embryonic  Development 
(E-Stage) 


III 


Larval  Development 

(L-Stage) 


Developmental  Stage 

Figure  1.  Ontogeny  of  (a)  heart  rate,  (b)  stroke  volume,  and  (c)  cardiac 
output  in  the  red  swamp  crayfish  Procambarus  clarkii.  *  indicates  signif- 
icant difference  from  the  previous  stage  at  the  level  of  P  =  0.05.  Shaded 
area  indicates  when  hatching  occurs.  Values  are  shown  as  means  ± 
standard  error,  n  a  7  at  each  stage.  Embryonic  and  larval  stages  corre- 
spond to  the  following  days  of  development  at  25  °C:  E-Stage  XIII  = 
12-14  days.  E-Stage  XIV  =  14-17  days,  E-Stage  XV  =  17-19  days, 
E-Stage  XVI  =  19-21  days.  L-Stage  I  =  21-23  days,  L-Stage  II  =  23-25 
days,  and  L-Stage  III  =  25-27  days. 

Oxygen  consumption 

Oxygen  consumption  increased  significantly  between  E- 
Stage  IV  (4.03  ±  0.50  (SEM)  /nl  O,  •  mg~'  •  h~')  and 
E-Stage  XIII  (7 1.33  ±  5.19  jul O2 •  mg~]  -h-1)(P  =  0.05. 
t  --  4.05)  and  between  E-Stage  XIII  and  E-Stage  XV 
(148.14  ±  13.61  /nlO2-mg~'  -h~ ')(/>  =  0.05,  t  =  5.21) 
(Fig.  3).  Just  before  hatching,  E-Stage  XVI,  metabolic  ox- 
ygen consumption  did  not  increase  significantly  from  the 
previous  stage.  Larval  stages  showed  a  significant  increase 
in  oxygen  consumption  (L-Stage  I,  P  <  0.001,  t  =  7.597 
and  L-Stage  III,  P  <  0.001,  t  =  16.953). 


Lipid/metabolizing  mass 

Embryo  diameter  (used  to  calculate  membrane  area)  did 
not  change  significantly  through  embryonic  development. 


82 


S.  L.  HARPER  AND  C.   L.  REIBER 


length 


XIII 


XIV 


XV 


XVI 


Embryonic  Development 
(E-Stage) 


I         II         III 

Larval  Development 
(L-Stage) 


Developmental  Stage 

Figure  2.  Length  and  width  measurements  of  the  heart  with  develop- 
ment. Solid  circles  represent  length,  open  circles  represent  width,  and  solid 
squares  represent  length/width  ratio.  *  indicates  significant  difference  from 
the  previous  stage  at  the  level  of  P  =  0.05.  Values  are  shown  as  means  ± 
standard  error,  n  a  7  at  each  stage.  Error  bars  fall  within  symbols.  See 
legend  to  Figure  1  for  correspondence  between  stage  and  length  of  devel- 
opment. 


After  eclosion,  larval  length  increased  significantly  from  the 
first  (2.61  ±  0.03  (SEM)  mm)  to  the  third  larval  instar 
(3.38  ±  0.02  mm)  (P  =  0.001,  /  ==  5.61)  (Fig.  4a). 
Calculated  surface  area  of  the  egg  membrane  decreased 
significantly  just  prior  to  eclosion  (P  =  0.05,  t  =  3.17) 
(Fig.  4b).  Animal  mass  also  decreased  significantly  just 


XIII 

Embryonic  Development 
(E-Stage) 


XV 


XVI   I  III 

Larval  Development 
(L-Stage) 


Developmental  Stage 

Figure  3.  Oxygen  consumption  for  embryonic  and  larval  crayfish. 
*  indicates  significant  dilierence  from  the  previous  stage  at  the  level  of 
P  =  0.05.  Shaded  area  indicates  when  hatching  occurs.  Values  are  shown 
as  means  ±  slaiulaul  error,  n  :  1  at  each  stage.  Embryonic  and  larval 
stages  correspond  to  (he  lolloping  days  of  development  at  25  °C:  E-Stage 
II  =  2-4  days.  E-Stage  XIII  -  12-14  Jays.  E-Stage  XV  =  17-19  days, 
E-Stage  XVI  =  19-21  days.  L-Stage  I  =  21-23  days,  and  L-Stage  III  = 
25-27  days. 


fr 

I 
— 


—      5.0 


O      4.0 
t 


-t- 


H — I — r- 


E 

3.0    £ 


C 

u 

2.5    - 


XIII  XV  XVI      I  III 

Developmental  Stage 

Figure  4.  (a)  Diameter  of  embryo  or  length  of  larval  crayfish  at  various 
stages  throughout  development,  (b)  Surface  area  calculated  from  diameter 
measurements  on  embryonic  crayfish.  Surface  area  measurements  not 
applicable  to  larvae,  (c)  Mass  of  developing  crayfish.  *  indicates  significant 
difference  from  the  previous  stage  at  the  level  of  P  =  0.05.  Shaded  area 
indicates  when  hatching  occurs.  Values  are  shown  as  means  ±  standard 
error,  n  a  7  at  each  stage.  See  Figure  3  for  correspondence  between  stage 
and  length  of  development. 


prior  to  hatching  (4.31  ±  0.07  (SEM)  mg  to  3.78  ±  0.10 
mg)  (P  <  0.001,  /  =  4.65)  but  increased  significantly  by 
the  first  larval  stage  (3.78  ±  0.10  mg  to  4.95  ±  0.03  mg) 
(P  <  0.001.  /  =  10.31)  (Fig.  40. 

Lipid  content  of  the  egg  decreased  significantly  from 
E-Stage  XIII  (2.41  ±  0.06  (SEM)  mg)  to  E-Stage  XV 
(1.85  ±  0.20  mg)  (P  =  0.05,  t  =  3.52)  and  from  L-Stage 
I  (1.64  ±  0.06  mg)  to  L-Stage  III  (0.64  ±  0.02  mg)  (P  < 
0.001,  i  =  6.32)  (Fig.  5a).  As  lipid  content  decreased, 
metabolizing  mass  increased  significantly  between  E-Stage 
XIII  (1.93  ±  0.08  mg)  and  E-Stage  XV  (2.46  ±0.17  mg) 
(P  --'-  0.05,  /  --••  3.92)  (Fig.  5b).  Metabolizing  mass 
increased  throughout  embryonic  development,  although  egg 
membrane  surface  area  did  not  change  significantly.  The 
metabolizing  mass  of  the  first  larval  stage  (3.31  ±  0.04  mg) 


CRAYFISH   HEART  PHYSIOLOGICAL  DEVELOPMENT 


83 


o    i.s  -I 
U 

TS 

'5.   i.o 


XIII  XV  XVI 

Developmental  Stage 

Figure  5.  (a)  Lipid  content  of  developing  crayfish,  (h)  Metabolizing 
mass  of  developing  crayfish,  (c)  Ratio  of  lipid  content  to  metabolizing  mass 
in  the  developing  crayfish.  *  indicates  significant  difference  from  the 
previous  stage  at  the  level  of  P  =  0.05.  Shaded  area  indicates  when 
hatching  occurs.  Values  are  shown  as  means  ±  standard  error,  H  a  7  at 
each  stage.  See  Figure  3  for  correspondence  between  stage  and  length  of 
development. 


(P  <  0.001,  /  =  6.35)  increased  significantly  by  the  third 
larval  stage  (5.01  ±  0.07  mg)  (P  <  0.001,  t  =  12.598). 
The  ratio  of  lipid  to  metabolizing  mass  declined  signifi- 
cantly (P  =  0.001,  q  =  7.040)  over  the  embryonic  and 
larval  development  period  from  1.43  ±  0.10  (SEM)  at 
E-Stage  IV  to  0.12  ±  0.01  at  L-Stage  III  but  did  not  change 
significantly  from  one  stage  to  the  next  (Fig.  5c). 

Hyperoxic  exposure 

E-Stage  XIV  and  E-Stage  XVI  embryos  were  selected  to 
represent  animals  thought  to  be  under  internally  normoxic 
and  hypoxic  conditions,  respectively.  If  embryonic  cardiac- 
function  is  depressed  in  late-stage  embryos  because  they  are 
oxygen-deficient,  then  an  increase  in  the  oxygen  diffusion 
gradient  should  partially  restore  oxygen  delivery  and  thus 
allow  heart  rate  to  increase.  No  significant  change  was 


observed  in  E-Stage  XIV  animals  when  exposed  to  hyper- 
oxic  water  (Fig.  6).  However,  heart  rate  increased  signifi- 
cantly in  E-Stage  XVI  animals  (P  <  0.001,  F  =  21.73) 
(from  138  ±  6  to  159  ±  6  bpm)  when  exposed  to  hyperoxic 
water  (40  kPa  O:). 

Discussion 

The  mechanisms  by  which  embryonic  cardiac  contrac- 
tions are  initiated  in  crayfish  are  not  clearly  understood. 
Cardiac  contractions,  which  result  in  the  movement  of  he- 
molymph  within  the  embryo,  appear  to  facilitate  gas  trans- 
port in  developing  crustaceans  (Reiber,  1997).  Burggren 
and  Territo  (1995)  have  suggested  that  these  early  cardiac 
contractions  may  serve  an  angiogenic  function  in  lower 
vertebrates.  Early  in  development,  the  fundamental  driving 
forces  that  influence  developing  physiological  systems 
are  often  similar,  even  among  taxa  from  diverse  animal 
groups.  All  organisms  must  balance  immediate  environ- 
mental needs  against  long-term  physiological  require- 
ments. Crayfish,  like  other  animals,  rely  on  diffusion  for 
both  exchange  and  internal  delivery  of  respiratory  gases 
during  early  embryonic  development  (Burggren  and  Finder, 
1991;  Reiber,  1997).  Eventually,  however,  they  attain  a 
mass  at  which  diffusion  alone  can  no  longer  adequately 
meet  gas  exchange  demands;  at  this  point  the  active  move- 
ment of  fluids  (hemolymph)  as  a  result  of  cardiac  pumping 
is  initiated.  The  heart  rate  in  most  animals  changes  as 
development  proceeds  from  embryo  through  immature  or 
larval  stages  to  adult,  yet  the  patterns  of  change  are  not 
consistent  among  species  in  lower  vertebrates  (Burggren 
and  Finder,  1991;  Farrell,  1991;  Hou  and  Burggren,  1995; 
Icardo.  1996)  or  invertebrates  (Cooke,  1988;  Spicer  and 
Morritt,  1996). 

Spicer  and  Morritt  (1996)  have  shown  that  the  timing  of 


180  - 


•I    no  - 


E-Slage  XIV 


E-S(age  XVI 


Developmental  Stage 

Figure  6.  Heart  rate  of  two  stages  of  embryonic  crayfish  exposed  to 
hyperoxic  water  (40  kPa).  *  indicates  significant  difference  from  control 
(P  =  0.05).  E-Stage  XIV  correlates  to  14-17  days  of  development  at  25 
°C  and  E-Stage  XVI  to  19-21  days. 


84 


S.  L.  HARPER  AND  C.  L.  REIBER 


key  developmental  events,  such  as  the  initiation  of  cardiac 
contractions,  is  not  consistent  among  aquatic  crustaceans. 
However,  some  generalizations  can  be  made  about  the  on- 
togeny of  cardiac  physiology  and  function  from  the  first 
appearance  of  cardiac  contractions  to  maturity.  Whether 
segmentation  in  an  animal  occurs  pre-  or  post-hatch  appears 
to  be  linked  with  the  onset  of  beating  of  the  heart  because 
segmentation  of  the  thoracic  cavity  precedes  initiation  of  the 
heartbeat  (Spicer,  1994;  Spicer  and  Morritt,  1996).  The 
relationship  between  body  mass  and  heart  rate  does  not 
conform  to  a  single  power  curve  model;  rather  it  depends  on 
the  organogenesis  of  the  heart  itself.  In  the  crayfish  Pro- 
ciunhiinis  clarkii.  the  heart  grew  proportionally  in  width 
and  length  throughout  embryonic  development;  yet  just 
after  hatching,  the  length  of  the  heart  increased  in  slightly 
greater  proportion  than  width,  resulting  in  a  large  and  rapid 
increase  in  the  length-to-width  ratio.  As  suggested  by  Spicer 
and  Morritt  ( 1996),  this  probably  represents  the  switch  from 
differentiation  of  cardiac  tissue  to  the  elongation  phase  of 
cardiac  development.  After  hatching,  larval  mass  increased 
significantly  while  heart  rate  remained  fairly  constant.  This 
developmental  pattern — a  decrease  in  heart  rate  with  in- 
creasing body  size  after  cardiac  development  is  complete 
and  elongation  has  commenced — was  described  by  Spicer 
and  Morritt  (1996)  in  the  water  flea  Daphnia  magna,  the 
amphipod  Gammarus  duebeni,  the  lobster  Nephrops  norve- 
gicus,  and  the  brine  shrimp  Anemia  franciscana. 

Many  adult  crustaceans  adjust  stroke  volume  rather  than 
heart  rate  to  modulate  cardiac  output  (Reviewed  by  McMa- 
hon  and  Burnett,  1990;  McGaw  et  ai,  1994;  Reiber,  1995; 
Reiber  and  McMahon,  1998).  However,  stroke  volume  does 
not  appear  to  be  as  tightly  regulated  as  heart  rate  during  the 
embryonic  development  of  crayfish.  Embryonic  crayfish 
apparently  use  heart  rate  as  a  primary  mechanism  to  regu- 
late cardiac  output,  as  stroke  volume  remains  constant 
throughout  embryogenesis.  We  present  three  explanations 
for  the  lack  of  change  in  stroke  volume  during  embryonic 
development.  The  first  explanation  is  that  the  increased 
dimensions  of  the  heart  are  offset  by  a  reduction  in  contrac- 
tility with  development.  The  dimensions  of  the  heart  mea- 
sured in  diastole  increased  throughout  embryonic  develop- 
ment. Systolic  measurements  also  increased  throughout 
development,  implying  that  the  heart  was  contracting  to  a 
lesser  degree.  The  reduced  force  of  contraction  ultimately 
decreases  the  ejection  fraction  of  the  ventricle  and  leads  to 
an  increased  residual  volume  of  the  heart  such  that,  although 
the  heart  is  growing  in  size,  the  volume  of  blood  pumped 
per  beat  remains  the  same.  A  second  explanation  for  the 
maintenance  of  stroke  volume  with  development  is  the 
thickening  of  the  heart  walls.  Measurements  for  stroke 
volume  were  obtained  using  the  outer  diameter  of  the  heart, 
which  may  not  account  for  thickening  of  the  myocardium 
with  development.  After  hatching,  elongation  of  the  heart 
and  a  decrease  in  systolic  volume  contribute  to  the  signifi- 


rise in  stroke  volume  observed  in  the  larval  crayfish.  It 
is  the  maintenance  of  stroke  volume  throughout  embryo- 
genesis  that  dictates  that  cardiac  output  is  driven  by  heart 
rate  alone  early  in  development.  A  third  possibility  is  that 
the  maintenance  of  stroke  volume  may  be  due  to  increased 
afterload  as  a  result  of  increased  vascular  pressure  devel- 
oped during  angiogenesis,  as  is  the  case  with  zebrafish 
embryos  (Pelster  and  Burggren.  1996). 

Reiber  (1997)  postulated  that  cardiac  parameters  decline 
just  prior  to  hatching  because  internal  convective  processes 
are  insufficient  to  facilitate  adequate  gas  exchange  in  the 
face  of  a  limited  gas  exchange  area.  Throughout  embryonic 
development  in  the  red  swamp  crayfish,  the  metabolizing 
portion  of  the  embryo  increased  in  mass  as  it  utilized  the 
lipid-rich  yolk  as  metabolic  fuel.  Embryonic  crayfish  appear 
to  rely  on  oxidative  phosphorylation  throughout  embryo- 
genesis;  however,  they  can  switch  to  anaerobic  metabolism 
when  exposed  to  decreased  oxygen  concentrations  (Chiba 
and  Chichibu,  1993).  Metabolic  rates  increased  throughout 
development  as  metabolizing  mass  increased  and  as  orga- 
nogenesis and  differentiation  gave  way  to  functional  sys- 
tems. We  observed  a  significant  increase  in  oxygen  con- 
sumption at  E-Stage  XIII,  when  the  heart  starts  beating. 
After  eclosion,  another  significant  increase  is  observed  in 
each  larval  stage;  these  changes  could  be  associated  with 
increases  in  the  animal's  activity  (DeSilva  et  ai,  1986). 
Increased  metabolic  rates  have  significant  consequences  for 
the  oxygen  supply  system  since  the  supply  of  oxygen  must 
be  matched  with  the  metabolic  demands  of  the  embryo.  We 
observed  an  increase  in  the  oxygen  consumption  of  the 
crayfish  throughout  embryonic  and  larval  development,  ex- 
cept at  the  point  prior  to  hatching  when  the  embryos  are 
thought  to  be  internally  hypoxic  and  could  be  relying  on 
anaerobic  metabolic  pathways. 

Embryonic  aerobic  metabolism  cannot  be  sustained  under 
severe  hypoxic  conditions.  Myocardial  anaerobic  capabili- 
ties are  typically  limited  or  nonexistent,  which  makes  this 
tissue  particularly  sensitive  to  hypoxia;  thus,  if  the  embryo 
can  no  longer  maintain  aerobic  metabolism,  the  heart  should 
already  be  failing.  Cardiac  function  declined  during  embry- 
onic development  in  the  crayfish,  most  likely  due  to  an 
internal  hypoxia  resulting  from  the  embryo's  oxygen  re- 
quirements exceeding  the  diffusive  capacity  of  its  outer  egg 
membranes.  Prior  to  hatching,  an  internal  hypoxia  could 
result  in  direct  inhibition  of  cardiac  metabolism  and  cardiac 
function,  as  is  observed  in  larval  frogs  (Fritsche  and  Burg- 
gren. 1996).  In  the  crayfish,  eclosion  removes  the  physical 
limitation  to  gas  exchange  (the  egg  membrane)  and  active 
respiratory  mechanisms  (gill  ventilation)  are  initiated.  Car- 
diac functions  can  then  increase  after  hatching,  as  the  ani- 
mal becomes  more  active  and  organ  systems  mature. 

To  determine  whether  the  diminution  in  cardiac  function 
observed  in  late-stage  embryos  was  due  to  an  internal  hyp- 
oxia. the  diffusional  gradient  of  oxygen  was  increased  by 


CRAYFISH   HEART  PHYSIOLOGICAL  DEVELOPMENT 


85 


exposing  the  embryo  to  hyperoxic  water.  The  rinding  that 
this  exposure  increased  the  heart  rate  in  late-stage  crayfish 
embryos  but  not  in  early  embryos  suggests  that  oxygen 
limitation  is  at  least  one  factor  responsible  for  reducing  the 
heart  rate  in  late-stage  embryos.  However,  the  increase  in 
heart  rate  observed  in  late-stage  embryos  exposed  to  hyper- 
oxia  could  also  be  explained  by  changes  in  the  oxygen 
conductance  of  the  egg  membrane.  In  amphibian  eggs,  the 
oxygen  conductance  of  the  egg  membrane  is  related  to  the 
stage  of  the  embryo  and  is  not  directly  influenced  by  envi- 
ronmental factors  (Seymour  and  Bradford,  1995).  If  the 
same  is  true  for  crayfish,  the  early  stages  might  not  respond 
to  an  increase  in  Po2  because  the  conductance  of  the  mem- 
brane limits  the  oxygen  diffusion  across  the  membrane. 
However,  this  would  not  account  for  the  reduction  in  heart 
rate  observed  in  late-stage  embryos.  It  is  far  more  likely  that 
these  embryos  are  experiencing  an  internal  hypoxia  that 
decreases  cardiac  parameters  and  is  alleviated  by  exposure 
to  high  ambient  Po2.  An  alternative  explanation  for  de- 
pressed cardiac  function  in  late-stage  embryos  is  a  shift  in 
the  oxygen  sensitivity  of  the  embryos  throughout  develop- 
ment. It  is  possible  that  late-stage  embryos  are  less  sensitive 
to  water  Po2  than  earlier  stages.  However,  if  this  were  the 
reason  for  the  depression  of  cardiac  function,  then  increas- 
ing water  Po2  would  not  have  had  the  observed  effect  on 
cardiac  parameters  in  the  late-stage  embryos. 

Other  mechanisms  that  could  underlie  the  observed  pat- 
terns of  cardiac  function  during  development  include  ( 1 ) 
intrinsic  changes  in  membrane  permeability  and  in  myocyte 
characteristics  such  as  the  ion  channels,  and  (2)  the  devel- 
opment of,  or  changes  in.  extrinsic  controls  (Fritsche,  1997). 
The  decreases  observed  in  egg  surface  area  and  animal  mass 
may  contribute  to  the  decreases  observed  in  cardiac  param- 
eters just  prior  to  hatching.  Lastly,  it  should  be  noted  that 
the  shifts  in  heart  rate  and  stroke  volume  could  coincide 
with  the  pacemaker  of  the  heart  switching  from  a  myogenic 
to  a  neurogenic  mechanism  of  cardiac  regulation  (Yama- 
gishi,  1990;  Yamagishi  and  Hirose,  1992:  Chapman  and 
Reiber,  1998;  Harper  and  Reiber,  2000).  Previous  data  on 
the  extrinsic  regulatory  mechanisms  of  the  embryonic  cray- 
fish cardiovascular  system  have  been  difficult  to  interpret. 
Embryonic  crayfish  hearts  appear  to  be  initially  myogenic 
and  to  become  neurogenic  later  in  development  (Chapman 
and  Reiber,  1998;  Harper  and  Reiber,  2000).  The  timing  of 
this  event  could  correspond  with  the  shifts  in  cardiac  func- 
tion observed  during  embryonic  development  in  the  cray- 
fish. 


Acknowledgments 

This  research  was  supported  by  NSF  grant  IBN- 
98874534  (C.L.R.)  and  the  University  of  Nevada  Las  Vegas 
Graduate  Student  Association  erant  (S.L.H.). 


Literature  Cited 

Burggren,  W.  W.,  and  A.  W.  Finder.  1991.  Ontogeny  of  cardiovascular 
and  respiratory  physiology  in  lower  vertebrates.  Aimu.  Rev.  Phvsiol. 
53:  107-135. 

Burggren,  W.  W.,  and  P.  R.  Territo.  1995.  Early  development  of  blood 
oxygen  transport.  Pp.  45-56  in  Hypoxiu  and  Bruin.  S.  Jouston  and  J. 
Coates.  eds..  Queen  City  Printer.  Burlington.  VT. 

C'hiha,  A.,  and  S.  Chichibu.  1993.  Phosphorylation  in  crayfish  (Pro- 
cambarus  clurkii)  eggs  during  hatching.  Comp.  Biochem.  Physio/.  B 
106:  433-436. 

Chapman,  S.  L.,  and  C.  L.  Reiber.  1998.  Ontogeny  of  cardiac  regula- 
tion in  the  crayfish.  Am.  Zoo/.  37:  42A. 

Cooke,  I.  M.  1988.  Studies  on  the  crustacean  cardiac  ganglion.  Comp. 
Biochem.  Physiol.  C  91:  205-218. 

DeSilva.  C.  D.,  S.  Premawansa,  and  C.  N.  Keemiyahetty.  1986.  Ox- 
ygen consumption  in  Oreochromis  mi/oricus  (L.)  in  relation  to  devel- 
opment, salinity,  temperature,  and  time  of  day.  J.  Fish  Binl.  29: 
267-277. 

Farrell,  A.  P.  1991.  From  hagfish  to  tuna:  a  perspective  on  cardiac 
function  in  fish.  Physiol.  Zool.  64:  1137-1164. 

Fritsche,  R.  1997.  Ontogeny  of  cardiovascular  control  in  amphibians. 
Am.  Zool.  37:  23-30. 

Fritsche,  R.,  and  W.  Burggren.  1996.  Development  of  cardiovascular 
responses  to  hypoxia  in  larvae  of  the  frog  Xenopus  luevis.  Am.  J. 
Physiol.  40:  R912-R917. 

Harper,  S.  L.,  and  C.  L.  Reiber.  1999.  Influence  of  hypoxia  on  cardiac 
functions  in  the  grass  shrimp  (Palaemonetes  pitifio  Holthuis).  Comp. 
Biochem.  Pln'xiol.  A  124:  569-573. 

Harper,  S.  L.,  and  C.  L.  Reiber.  2000.  Developmental  cardiac  response 
to  GABA  in  the  red  swamp  crayfish  Procambarus  c/arkii  and  the 
relevance  to  crayfish  burrow  ecology.  J.  Ari-.-Nev.  Acad.  Sci.  32: 
158-163. 

Harper,  S.  L.,  and  C.  L.  Reiber.  2001.  Ontogeny  of  neurohormonal 
regulation  of  the  cardiovascular  system  in  the  crayfish  Procambarus 
clurkii.  J.  Comp.  Physiol.  K.  171:  577-583. 

Hou,  P.-C.  L.,  and  W.  W.  Burggren.  1995.  Blood  pressure  and  heart 
rate  during  larval  development  in  the  anuran  amphibian  Xenopus  laevis. 
Am.  J.  Physio/.  269:  R1120-R1125. 

h  .M (In.  J.  M.  1996.  Developmental  biology  of  the  early  vertebrate  heart. 
J.  E.\p.  Zool.  275:  144-161. 

Keller,  B.  B.,  N.  Hu.  P.  J.  Serrino,  and  E.  B.  Clark.  1991.  Ventricular 
pressure-area  loop  characteristics  in  the  stage  16  to  24  chick  embryo. 
Circ.  Res.  68(1):  226-230. 

Keller,  B.  B..  J.  P.  Tinney,  and  N.  Hu.  1994.  Embryonic  ventricular 
diastolic  and  systolic  pressure-volume  relations.  Cardiol.  Young  4: 
19-27. 

McGaw,  I.  J.,  C.  N.  Airriess,  and  B.  R.  McMahon.  1994.  Patterns  of 
haemolymph-flow  variation  in  decapod  crustaceans.  Mar.  Bio/.  121: 
53-60. 

McMahon,  B.  R.,  and  L.  F.  Burnett.  1990.  The  crustacean  open  cir- 
culatory system:  a  re-examination.  Physiol.  Zool.  63:  35-71. 

Orlando.  K..  and  A.  W.  Finder.  1995.  Larval  cardiorespiratory  ontog- 
eny and  allometry  in  Xenopus  laevis.  Physiol.  Zool.  68:  63-75. 

Payette,  A.  L.,  and  I.  J.  McGaw.  2003.  Thermoregulatory  behavior  of 
the  crayfish  Procambarus  clurkii  in  a  burrow  environment.  Comp. 
Biochem.  Physiol.  A.  136:  539-556. 

Pelster,  B..  and  W.  W.  Burggren.  1996.  Disruption  of  hemoglobin 
oxygen  transport  does  not  impact  oxygen-dependent  physiological  pro- 
cesses in  developing  embryos  of  zebra  fish  (Danio  rerio).  Circ.  Res.  79: 
358-362. 

Reiber,  C.  L.  1995.  Physiological  adaptations  of  crayfish  to  the  hypoxic 
environment.  ,4/».  Zool.  35:  1-11. 

Reiber,  C.  L.  1997.  Ontogeny  of  cardiac  and  ventilatory  function  in  the 
crayfish  Proctinihurus  clurkii.  Am.  Zoo/.  37:  82-91. 


86 


S.  L.  HARPER  AND  C.  L    REIBER 


Reiber.  C.  L.,  and  S.  L.  Harper.  2001.  Perspectives  on  cardiac  physi- 
ological ontogeny  in  crustaceans.  (Zoologische  Jahrbucher)  (Zoology: 
Analysis  of  complex  systems):  Zoology  of  Complex  Systems.  104(  1 ): 
103-113. 

Reiber,  C.  L.,  and  B.  R.  McMahon.  1998.  The  effects  of  progressive 
hypoxia  on  the  crustacean  cardiovascular  system:  a  comparison  of  the 
freshwater  crayfish.  (Procambams  clarkii),  and  the  lobster  (Homarus 
americanus).  J.  Comp.  Physiol.  B  168:  168-176. 

Schwerte,  T.,  and  B.  Pelster.  2000.  Digital  motion  analysis  as  a  tool  for 
analyzing  the  shape  and  performance  of  the  circulatory  system  in 
transparent  animals.  J.  Exp.  Biol.  203:  1659-1669. 

Seymour,  R.  S.,  and  D.  F.  Bradford.  1995.  Respiration  of  amphibian 
eggs.  Physiol.  Zoo/.  68:  1-25. 

Spicer.  J.  I.  1994.     Ontogeny  of  cardiac  function  in  the  brine  shrimp 


Arternia  franciscana  Kellogg  1906  (Branchiopoda:  Anostraca).  /  Exp. 

Zoo/.  270:  508-516. 
Spicer.  J.   I.,  and   D.   Morritt.   1996.     Ontogenic  changes  in  cardiac 

function  in  crustaceans.  Comp.  Biochem.  Physiol.  A  114:  81-89. 
Taber.  L.  A.,  B.  B.  Keller,  and  E.  B.  Clark.  1992.     Cardiac  mechanism 

in  the  stage  16  chick  embryo.  J.  Biomech.  Eng.  114:  427-434. 
Wilkens,  J.  L.  1993.     Re-evaluation  of  the  stretch  sensitivity  hypothesis 

of  crustacean  hearts:  Hypoxia,  not  lack  of  stretch,  causes  reduction  in 

heart  rate  of  isolated  hearts.  J.  Exp.  Biol.  176:  223-232. 
Yamagishi,  H.  1990.     Physiological  change  of  the  heart  beat  in  juvenile 

stage  of  the  isopod  crustacean.  Ligia  exotica.  Zoo/.  Sci.  7:  1037-1042. 
Yamagishi,  H.,  and  E.  Hirose.  1992.     Nervous  regulation  of  the  myo- 

genic  heart  in  early  juveniles  of  the  isopod  crustacean.  Ligia  exotica. 

Comp.  Physiol.  11:  141-148. 


Reference:  Biol.  Bull.  206:  X7-94.  (April  2004) 
©  2004  Marine  Biological  Laboratory 


Survival  and  Development  of  Horseshoe  Crab 

(Limulus  polyphemus)  Embryos  and  Larvae  in 

Hypersaline  Conditions 

GRETCHEN  S.  EHLINGER*  AND  RICHARD  A.  TANKERSLEY 

Florida  Institute  of  Technologv,  Department  of  Biological  Sciences,  150  W.  University  Blvd..  Melbourne. 

Florida  32901 


Abstract.  The  horseshoe  crab  Limulus  polyphemus 
spawns  in  the  mid-  to  upper  intertidal  zone  where  females 
deposit  eggs  in  nests  below  the  sediment  surface.  Although 
adult  crabs  generally  inhabit  subtidal  regions  of  estuaries 
with  salinities  from  5  to  34  ppt,  developing  embryos  and 
larvae  within  nests  are  often  exposed  to  more  extreme 
conditions  of  salinity  and  temperature  during  summer 
spawning  periods.  To  test  whether  these  conditions  have  a 
negative  impact  on  early  development  and  survival,  we 
determined  development  time,  survival,  and  molt  cycle  du- 
ration for  L.  polyphemus  embryos  and  larvae  raised  at  20 
combinations  of  salinity  (range:  30-60  ppt)  and  tempera- 
ture (range:  25-40  °C).  Additionally,  the  effect  of  hyper- 
osmotic  and  hypoosmotic  shock  on  the  osmolarity  of  the 
perivitelline  fluid  of  embryos  was  determined  at  salinities 
between  5  and  90  ppt.  The  embryos  completed  their  devel- 
opment and  molted  at  salinities  below  60  ppt,  yet  failed  to 
develop  at  temperatures  of  35  °C  or  higher.  Larval  survival 
was  high  at  salinities  of  10-70  ppt  but  declined  significantly 
at  more  extreme  salinities  (i.e..  5,  80.  and  90  ppt).  Peri- 
vitelline fluid  remained  nearly  isoosmotic  over  the  range  of 
salinities  tested.  Results  indicate  that  temperature  and  sa- 
linity influence  the  rate  of  crab  development,  but  only  the 
extremes  of  these  conditions  have  an  effect  on  survival. 

Introduction 

Estuaries  are  physiologically  challenging  habitats  for  or- 
ganisms because  of  the  temporal  and  spatial  variation  in 


Received  4  August  2003;  accepted  13  January  2004. 

*  To  whom  correspondence  should  be  addressed.  Current  address:  Flor- 
ida Fish  and  Wildlife  Conservation  Commission,  Jacksonville  Field  Lab- 
oratory, 6134  Authority  Ave,  Jacksonville.  FL  32221.  E-mail: 
Gretchen.Ehlinger@fwc.state.fi. us 


environmental  conditions.  Among  environmental  variables, 
salinity  and  temperature  are  two  factors  that  especially 
influence  the  survival  and  growth  of  marine  invertebrates 
(Kinne,  1970,  1971 ).  Salinity  influences  many  physiological 
functions  and  is  therefore  important  in  regulating  the  distri- 
bution of  estuarine  and  marine  organisms.  Estuarine  species 
are  generally  euryhaline  and  eurythermal  and,  therefore, 
more  tolerant  of  widely  ranging  temperatures  and  salinities 
than  marine  species  (Costlow  et  ai,  1966;  Laughlin  and 
French.  1989;  Goncalves  et  ai.  1995).  Because  the  range  of 
conditions  that  an  organism  can  survive  may  change 
throughout  development  (Kinne,  1970,  1971;  Charmantier 
et  ai.  1988),  ontogenetic  differences  in  temperature  and 
salinity  tolerance  often  enable  larvae,  juveniles,  and  adults 
to  inhabit  different  habitats  or  regions  of  estuaries  (Char- 
mantier et  ai,  1988). 

The  American  horseshoe  crab  Limulus  polyphemus  (L.) 
occurs  in  estuaries  along  the  east  coast  of  North  America, 
where  the  general  salinity  range  is  5  to  34  ppt.  Although  its 
densities  are  highest  in  portions  of  the  estuary  with  higher 
and  variable  salinities,  the  species  also  inhabits  regions  with 
lower  salinities  (Shuster,  1982).  The  adults  and  juveniles 
live  in  subtidal  benthic  habitats,  but  embryonic  and  early 
larval  development  occurs  in  intertidal  areas.  Females  dig 
nests  near  the  waterline  in  the  mid-  to  upper  intertidal  zone 
and  deposit  up  to  20,000  eggs  per  clutch  10-25  cm  below 
the  sediment  surface  (Shuster  and  Botton,  1985;  Brock- 
mann,  1990;  Penn  and  Brockmann,  1994).  Peak  spawning 
occurs  in  the  late  spring  to  early  summer  (Cohen  and 
Brockmann,  1983;  Barlow  et  ai.  1986).  generally  near  the 
time  of  high  tide  during  new  and  full  moons  (Rudloe.  1980; 
Cohen  and  Brockmann,  1983;  Barlow  et  ai,  1986).  Eggs  are 
laid  in  sandy  areas  that  are  regularly  inundated  in  tidal 
systems  and  have  variable  frequencies  and  periods  of  inun- 


S7 


88 


G.  S.  EHLINGER  AND  R.  A.  TANKERSLEY 


dation  in  nontidal  areas  (Rudloe,  1985;  Penn  and  Brock- 
mann,  1994).  Because  the  nests  are  located  on  the  beach,  the 
embryos  and  larvae  may  be  exposed  to  fluctuations  in 
temperature  and  salinity  that  are  greater  than  those  experi- 
enced by  adults  in  subtidal  areas.  During  low  tide,  nests  may 
be  exposed  to  freshwater  during  rainfall  and  to  rapid 
changes  in  temperature  when  the  beach  is  heated  by  the  sun. 
Thus,  developing  embryos  might  be  expected  to  tolerate 
rapid  and  wide  fluctuations  in  temperature  and  salinity. 
Alternatively,  they  may  be  protected  from  changes  in  ex- 
ternal conditions  by  the  perivitelline  fluid,  the  fluid  inside 
the  inner  egg  membrane,  which  may  buffer  embryos  from 
changes  in  external  conditions,  especially  salinity. 

Adult  horseshoe  crabs  also  inhabit  lagoons  and  coastal 
embay ments  with  a  much  broader  salinity  range  (5-55  ppt) 
due  to  shallow  conditions  and  relatively  high  rates  of  evapo- 
ration and  freshwater  input  (Pritchard,  1967;  Robertson, 
1970;  Shuster,  1982;  Botton  et  al.,  1988;  Ehlinger  et  al.. 
2003).  One  such  habitat  is  the  Indian  River  Lagoon  (IRL) 
located  along  the  east  coast  of  Florida,  USA.  The  IRL 
consists  of  three  shallow  (1-3  m)  sub-basins,  the  Indian 
River,  Banana  River,  and  Mosquito  Lagoon,  that  extend 
about  250  km  parallel  to  the  Atlantic  coast  (Smith,  1987;  De 
Freese,  1991).  Although  appreciable  tidal  changes  occur  in 
the  immediate  vicinity  of  the  five  inlets  that  link  the  IRL  to 
the  ocean,  most  of  the  system  is  virtually  tideless  (tidal 
amplitudes  <  5  cm;  Smith,  1993).  Despite  the  presence  of 
spawning  adults,  densities  of  L  polyphemus  larvae  in  the 
IRL  are  low  compared  to  levels  in  tidally  dominated  habi- 
tats such  as  Delaware  Bay  and  the  Gulf  coast  of  Florida 
(Rudloe,  1979;  Ehlinger  et  al..  2003;  M.  L.  Botton,  Ford- 
ham  University,  pers.  comm.).  One  possible  cause  of  this 
low  larval  abundance  is  physiological  stress.  A  recent  study 
of  the  spawning  and  reproductive  behavior  of  horseshoe 
crabs  inhabiting  the  IRL  indicates  that  water  temperatures 
and  salinities  during  the  spawning  season  reach  levels  as 
high  as  45  °C  and  55  ppt,  which  may  surpass  the  tolerance 
limits  of  the  embryos  or  prevent  larval  development  and 
hatching  (Ehlinger,  2002). 

In  estuarine  habitats  of  New  England  and  the  mid- Atlan- 
tic region,  low  salinities  caused  by  snow  melt  and  freshwa- 
ter runoff  are  more  common  than  high  salinities.  Therefore, 
most  studies  on  the  effect  of  salinity  on  embryonic  devel- 
opment have  focused  on  hypoosmotic  stress  and  tolerance 
to  low  salinities.  Previous  studies  indicate  that  the  optimal 
salinity  for  the  development  of  horseshoe  crab  embryos  is 
between  20  and  30  ppt  (Jegla  and  Costlow.  1982;  Laughlin. 
1983;  Sugita,  1988».  Temperature  also  affects  the  rate  of 
embryonic  development  and  the  duration  of  posthatch  in- 
termolt  stages,  with  the  optimal  temperature  for  develop- 
ment ranging  from  25  C  to  30  °C  (Jegla  and  Costlow. 
1982).  Laughlin  (1983)  concluded  that  the  effect  of  salinity 
is  secondary  to  that  of  temperature,  since  the  duration  of 


larval  development  was  similar  among  salinity  treatments 
but  differed  significantly  among  temperature  treatments. 

No  published  studies  have  examined  the  tolerance  of  L. 
polyphemus  embryos  to  salinities  higher  than  40  ppt.  The 
objectives  of  this  study  were  to  determine  the  effect  of  high 
temperatures  and  salinities  on  embryonic  and  larval  devel- 
opment and  to  determine  the  salinity  tolerance  of  L. 
polyphemus  larvae.  The  effect  of  hyperosmotic  shock  on  the 
osmotic  concentration  of  the  perivitelline  fluid  within  the 
eggs  was  also  examined.  The  results  indicate  that  L. 
polyphemus  embryos  and  larvae  can  tolerate  a  wide  range  of 
salinities  (30-60  ppt),  but  they  are  more  sensitive  to  high 
temperatures  (S:35  °C). 

Materials  and  Methods 

Adult  specimens  of  Limuhis  polyphemus  were  collected 
by  hand  during  the  spawning  season  (February-May  2002) 
from  the  Indian  River  Lagoon,  Florida.  Crabs  were  obtained 
from  two  sites:  ( 1 )  Pineda  Causeway,  Banana  River 
(28°12'33"N,  80°38'12"W)  and  (2)  Peacock  Pocket.  Indian 
River  (28°39'41"N,  80°43'45"W).  The  crabs  were  main- 
tained in  the  laboratory  in  a  recirculating  fiberglass  tank  (2.7 
m  X  1.7  m  X  1m)  containing  natural  seawater  (temperature 
20-23  °C;  salinity  30  ppt).  For  all  experiments,  eggs  were 
fertilized  by  artificial  insemination,  and  the  embryos  were 
cultured  in  the  laboratory  according  to  standard  procedures 
(Brown  and  Clapper.  1981;  Sekiguchi.  1988).  Sperm  col- 
lected from  males  by  manual  stimulation  of  the  genital 
operculum  were  diluted  with  filtered  seawater  to  make  a 
I07c  (vol/vol)  sperm  solution.  Eggs  collected  from  females 
by  direct  extraction  from  the  ovaries  were  washed  several 
times  with  5-ju.m  filtered  seawater.  placed  in  petri  dishes 
(diameter  8.5  cm;  height  1.4  cm)  containing  50  ml  of 
filtered  seawater.  and  fertilized  with  1  ml  of  the  sperm 
solution.  The  eggs  were  incubated  with  sperm  for  1  h  and 
then  rinsed  with  filtered  seawater  to  remove  excess  sperm. 
To  determine  whether  fertilization  was  successful,  a  subset 
of  the  eggs  was  stained  with  a  solution  of  0. 1 7c  neutral  red 
and  observed  under  a  dissecting  microscope  for  signs  of 
cleavage  and  gastrulation  (Sekiguchi.  1988).  The  develop- 
mental stage  of  the  embryos  was  determined  using  the 
classification  scheme  of  Sekiguchi  (1988). 

Effect  of  high  temperature  and  salinity  on  embryonic  and 
lan'til  development 

To  determine  whether  high  temperature  and  salinity  in- 
fluence the  rate  and  success  of  embryonic  development  and 
the  duration  of  the  larval  stage  following  hatching,  fertilized 
eggs  were  reared  under  one  of  20  combinations  of  salinity 
and  temperature  (salinities:  30,  40.  50.  60  ppt:  temperature: 
25,  30.  33,  35.  40  °C).  Thirty  eggs  were  placed  in  individual 
wells  (1.5  cm  diameter  X  1.5  cm  depth)  of  a  multiwell 
tissue  culture  dish  containing  3  ml  of  filtered  natural  sea- 


LIMULUS  SURVIVAL  AND  DEVELOPMENT  AT  HIGH  SALINITY 


89 


water  at  each  temperature-salinity  combination.  For  each 
combination,  10  dishes  were  placed  in  a  thermostatically 
controlled  incubator  (Precision  Scientific,  Winchester,  VA) 
to  maintain  a  constant  temperature.  To  avoid  temperature 
and  osmotic  shock,  all  eggs  were  fertilized  at  25  °C  and  30 
ppt,  and  the  temperature  and  salinity  were  increased  by  5  °C 
and  5  ppt  each  day  until  the  target  treatment  combination 
was  reached.  Seawater  was  changed  every  other  day,  and 
dishes  were  checked  daily  for  the  presence  of  newly  hatched 
larvae  and  juveniles.  Eggs  that  showed  no  sign  of  develop- 
ment after  75  days  were  excluded  from  the  analysis.  The 
effects  of  temperature  and  salinity  on  the  time  to  hatching 
and  molting  to  the  first  juvenile  instar  were  determined 
using  a  two-factor  analysis  of  variance  ( ANOVA;  SYSTAT 
10.0.  SPSS  Inc.).  If  the  overall  analysis  indicated  significant 
treatment  effects,  comparisons  among  treatment  levels  were 
conducted  using  Tukey  pairwise  comparisons  (SYSTAT 
10.0). 

Salinitv  tolerance  of  lan'ae 

To  determine  the  salinity  tolerance  of  L.  pohphemus 
larvae,  embryos  were  reared  at  30  °C  and  30  ppt  until  they 
hatched  to  the  trilobite  larva  stage.  Within  24  h  of  hatching, 
24  larvae  were  placed  in  individual  wells  (1.5  cm  diame- 
ter X  1.5  cm  depth)  of  a  multiwell  culture  dish  containing 
3  ml  of  filtered  seawater  at  salinities  of  5,  1 0,  20,  30,  40,  50, 
60,  70,  80.  and  90  ppt.  Larval  survival  was  monitored  daily 
for  30  days.  Larvae  were  considered  dead  when  they  were 
inactive  (no  leg  or  book-gill  movement)  and  unresponsive 
to  mechanical  stimulation.  Time  to  death  (in  days)  or  time 
of  molting  to  the  first  juvenile  instar  (in  days)  was  recorded. 
Survivorship  curves  for  larvae  in  each  of  the  salinity  treat- 
ments were  constructed  using  the  product-limit  method 
(Kaplan-Meier  method:  Muenchow,  1986;  Kleinbaum, 
1996).  Survival  functions  were  compared  among  treatments 
using  the  Mantel  log-rank  test  (\~  approximation,  SYSTAT 
10.0,  SPSS  Inc.).  The  same  analysis  was  used  to  compare 
the  duration  of  the  larval  stage,  with  time  to  molting  as  the 
dependent  variable.  Larvae  that  were  alive  but  had  not 
molted  after  30  days  of  exposure  were  treated  as  right- 
censored  observations  in  the  analysis. 

Osmotic  concentration  of  the  perivitelline  fluid 

To  determine  the  effect  of  changes  in  external  salinity  on 
the  osmotic  concentration  of  the  perivitelline  fluid  surround- 
ing developing  embryos,  L.  polyphemus  eggs  reared  at  25 
°C  and  30  ppt  were  transferred,  after  the  fourth  embryonic 
molt,  to  one  of  10  test  salinities  (5,  10,  20.  30. 40.  50.  60,  70, 
80.  and  90  ppt).  The  osmotic  concentration  of  the  peri- 
vitelline fluid  of  a  subset  of  randomly  selected  eggs  (n  = 
10)  from  each  salinity  treatment  was  determined  at  0,  0.5, 
1,2,4,  and  6  h  following  exposure.  Thus,  a  total  of  60  eggs 
(10  eggs  X  6  time  exposures)  were  tested  at  each  combi- 


nation of  salinity  and  temperature.  Perivitelline  fluid  within 
the  egg  was  collected  by  using  the  tip  of  a  micropipette  to 
carefully  tear  the  egg's  outer  membrane  and  then  to  draw  up 
10  /nl  of  perivitelline  fluid.  Osmolarity  was  determined  with 
a  vapor  pressure  osmometer  (Vapro  model  5520,  Westcor 
Inc..  Logan,  Utah)  calibrated  with  standards  of  290  and 
1000  mmol  kg"1.  The  effect  of  the  salinity  of  the  external 
medium  on  the  osmolarity  of  the  fluid  over  time  was  deter- 
mined using  a  two-factor  analysis  of  variance  (salinity  and 
time  as  factors;  SYSTAT  10.0,  SPSS  Inc.).  Comparisons 
between  experimental  treatments  and  the  control  (i.e.,  30 
ppt)  were  conducted  using  a  priori  directed  contrasts  (SYS- 
TAT 10.0). 

Results 

Effect  of  high  temperature  and  salinity  on  embrvonic  and 
larval  development 

Both  high  temperatures  and  salinities  significantly  af- 
fected the  success  of  embryonic  development  in  Liimilus 
polyphemus.  At  35  °C,  eggs  developed  to  embryonic  stage 
20,  where  the  embryo  is  enclosed  by  a  clear  membrane  and 
the  legs  and  gills  are  visible  (Sekiguchi,  1988);  but  at  all 
salinities,  these  embryos  failed  to  hatch  to  trilobite  larvae 
after  75  days.  At  40  °C,  eggs  showed  no  signs  of  develop- 
ment after  75  days  at  all  salinities.  Development  and  hatch- 
ing were  normal  at  all  other  temperatures.  Temperature  and 
salinity  also  had  a  significant  effect  on  time  to  hatching  (Fig. 
1,  F  =  52.02,  df  =  6,  202,  P  <  0.001 ).  At  all  test  salin- 
ities, embryonic  development  took  longer  at  25  °C  than  at 
30  and  33  °C  (Tukey  pairwise  comparisons.  Fig.  1,  Table  1 ). 
At  25  °C,  time  to  hatching  increased  significantly  as  the 
salinity  increased  (Fig.  1,  Table  1).  Embryos  maintained  at 
30  °C  and  33  °C  and  30  and  40  ppt  had  similar  hatching 


35 


ffi 
o 


20  - 


30 


40  50 

Salinity  (ppt) 


60 


Figure  1.  Mean  (±SE)  number  of  days  from  fertilization  to  hatching 
of  Limitlus  polyphemus  embryos  at  25  °C,  30  °C,  and  33  "C  and  at  30.  40, 
50.  and  60  ppt.  No  hatching  occurred  in  any  of  the  test  salinities  at  35  °C 
and  40  °C.  n  =  30  for  each  trial. 


90  G.  S.  EHLINGER  AND  R.  A.  TANKERSLEY 

Table  1 

Matrix  of  painrise  comparison  probabilities  (Tiikey  test)  for  days  to  hatching  for  Limulus  polyphemus  embryos 

T/S 


T/S 

25/30 

25/40 

25/50 

25/60 

30/30 

30/40 

30/50 

30/60 

33/30 

33/40           33/50          33/60 

n  — 

27 

29 

30 

26 

26 

27 

25 

28 

27 

29                27               25 

25/30 

1.00 

25/40 

<0.01 

1.00 

25/50 

<0.01 

<0.01 

1.00 

25/60 

<0.01 

<0.01 

<0.01 

1.00 

30/30 

<0.01 

<0.01 

<0.01 

<0.01 

1.00 

30/40 

<0.01 

<0.01 

<0.01 

<0.01 

0.97 

1.00 

30/50 

<0.01 

<0.01 

<0.01 

<0.01 

<0.01 

<0.01 

1.00 

30/60 

0.03 

<0.01 

<0.01 

<0.01 

<0.01 

<0.01 

0.01 

1.00 

33/30 

<0.01 

<0.01 

<0.01 

<0.01 

0.86 

1.00 

<0.01 

<0.01 

1.00 

33/40 

<0.01 

<0.01 

<0.01 

<0.01 

0.46 

1.00 

<0.01 

<0.01 

1.00 

1.00 

33/50 

<0.01 

<0.01 

<0.01 

<0.01 

<0.01 

<0.01 

<0.01 

<0.01 

<0.01 

<0.01              1.00 

33/60 

<0.01 

<0.0! 

<0.01 

<0.01 

<0.01 

<0.01 

0.01 

<0.01 

<0.01 

<0.01          <0.01            1.00 

T  =  temperature  (°C);  S  =  salinity  (ppt);  n  =  sample  size.  Bold  type  indicates  pairwise  comparisons  that  are  not  statistically  significant. 


rates  (Table  1).  but  hatching  was  delayed  significantly  in 
more  hypersaline  conditions  (50  and  60  ppt.  Fig.  1 ).  Opti- 
mal temperature  and  salinity  conditions  for  development  to 
stage  21  were  30-33  °C  and  30-40  ppt. 

The  duration  of  the  trilobite  larva  stage  (time  from  hatch- 
ing to  molting  to  the  first  juvenile  instar)  decreased  signifi- 
cantly with  increasing  temperature  (F  =  3.79,  df  =  6,  202, 
P  <  0.001,  Fig.  2),  yet  was  similar  for  all  salinity  treat- 
ments (F  =  0.22,  df  =  6,  202,  P  =  0.64).  Larval  stage 
duration  was  shortest  at  30-33  °C  and  was  significantly 
longer  at  25  °C  (Tukey  test.  Fig.  2,  Table  2).  Development 
times  were  similar  for  larvae  maintained  at  30  °C  and  33  °C 
(Fig.  2,  Table  2). 


80 


60  - 


o 
2 

1 
P 


40  • 


20  • 


30 


40 


50 


60 


Salinity  (ppt) 


Figure  2.  Mean  (±SE)  time  to  molting  to  the  first  juvenile  stage  (in 
days)  of  Limulus  polyphemus  at  25  °C,  30  °C,  and  33  °C  and  30,  40.  50, 
and  60  ppt.  Sample  sizes  are  provided  in  Table  2. 


Scilinir\'  tolerance  of  lar\>ae 

All  L.  polyphemus  trilobite  larvae  survived  for  30  days  at 
salinities  ranging  from  10  to  70  ppt;  they  died  only  in  the 
extreme  salinities  of  5,  80,  and  90  ppt  (Fig.  3).  Comparisons 
of  the  survival  curves  among  salinity  treatments  indicated 
that  survival  was  significantly  reduced  relative  to  control 
levels  only  when  larvae  were  maintained  at  90  ppt  (^  = 
33.0,  df  =  2.  P  <  0.01,  Fig.  3).  The  time  to  50%  mortality 
(TM50)  was  «=16.0  days  in  90  ppt.  Salinity  also  had  a 
significant  effect  on  molting  rate  of  larvae  to  the  first  juve- 
nile instar  (^  =  12.1,  df  =  4,  P  <  0.01.  Fig.  4).  Larval 
stage  duration  increased  at  salinities  above  and  below  30  ppt 
(Fig.  4).  Molting  did  not  occur  after  30  days  at  the  most 
extreme  salinities  tested  (^10  ppt  or  >70  ppt). 

Osmotic  concentration  of  the  perivitelline  fluid 

Salinity  significantly  affected  the  osmotic  concentration 
of  the  perivitelline  fluid  of  L.  polyphemus  eggs  (Fig.  5.  F  = 
176.81,df  =  9,  45,  P  <  0.01).  When  developing  embryos 
were  placed  in  hypoosmotic  solutions  (5,  10,  and  20  ppt). 
the  osmolarity  of  the  perivitelline  fluid  decreased  signifi- 
cantly within  0.5  h  of  exposure  (Fig.  5).  After  the  first  hour, 
fluid  osmolarity  leveled  off  and  remained  relatively  constant 
for  the  remainder  of  the  experiment  (Fig.  5).  At  30  ppt.  the 
osmolarity  of  the  perivitelline  fluid  did  not  change  signifi- 
cantly throughout  the  exposure  period  (F  =  0.098.  df  =  9. 
45.  P  =  0.925.  Fig.  5).  When  embryos  were  exposed  to 
more  hyperosmotic  conditions  (>30  ppt),  the  fluid  osmo- 
larity increased  significantly  within  the  first  0.5  hour  and 
initially  reached  levels  that  were  slightly  above  that  of  the 
bathing  medium  (Fig.  5).  However,  the  osmolarity  de- 


LIMULUS  SURVIVAL  AND  DEVELOPMENT  AT  HIGH  SALINITY  91 

Table  2 
Matrix  ofpainvise  comparison  probabilities  (Tukey  lest)  for  time  to  hatching  to  the  first  juvenile  instar  for  Limulus  polyphemus  larvae 

T/S 


T/S 

25/30 

25/40 

25/50 

25/60 

30/30 

30/40 

30/50 

30/60 

33/30 

33/40          33/50          33/60 

n  = 

26 

27 

26 

23 

24 

25 

TO 

25 

24 

27                24                 24 

25/30 

1.00 

25/40 

1.00 

1  .00 

25/50 

0.68 

0.12 

LOO 

25/60 

0.98 

0.38 

1.00 

LOO 

30/30 

0.04 

0.04 

<0.01 

<0.01 

1.00 

30/40 

0.01 

0.01 

<0.01 

0.01 

1.00 

LOO 

30/50 

0.02 

0.02 

0.01 

<0.01 

0.97 

1.00 

1.00 

30/60 

0.03 

0.01 

0.04 

<0.01 

0.08 

0.39 

0.73 

1.00 

33/30 

<0.01 

<0.01 

<0.01 

<0.01 

0.06 

0.09 

0.39 

0.05 

1.00 

33/40 

<O.OI 

<0.01 

<0.01 

<0.01 

0.08 

0.13 

0.06 

0.07 

0.77 

1.00 

33/50 

<O.OI 

<0.01 

<0.01 

<0.01 

0.49 

0.10 

0.10 

0.09 

0.08 

0.86             1.00 

33/60 

<0.01 

<0.01 

<0.01 

<0.0l 

0.49 

0.93 

1.00 

1.00 

0.11 

0.25             1.00             1.00 

T  =  temperature  (°C);  S  =  salinity  (ppt);  H  =  sample  si/e.  Bold  type  indicates  pairwise  comparisons  that  are  not  statistically  significant. 


creased  after  1  h  and  remained  at  levels  slightly  above  that 
of  the  bathing  medium  (Fig.  5).  Similar  changes  in  the 
osmotic  concentration  of  the  perivitelline  fluid  occurred 
when  eggs  were  exposed  to  salinities  above  40  ppt.  Yet  the 
magnitude  of  the  change  and  its  duration  increased  with 
increasing  hyperosmotic  shock  (Fig.  5).  After  6  h,  the  peri- 
vitelline Huid  of  all  embryos  was  nearly  isoosmotic  with  the 
bathing  medium  (Fig.  6). 

Discussion 

In  estuaries,  Limulus  polyphemus  is  exposed  to  rapid 
fluctuations  in  salinity,  particularly  in  intertidal  areas  where 
embryos  and  larvae  undergo  development.  The  results  of  the 


current  study  support  earlier  reports  that  L.  polyphemus 
embryos  and  larvae  are  remarkably  hardy  and  able  to  with- 
stand the  fluctuating  and  often  harsh  environmental  condi- 
tions of  intertidal  areas  (Jegla  and  Costlow,  1982;  Palumbi 
and  Johnson,  1982;  Sugita.  1988;  Botton  et  ai,  1988). 
Although  both  embryos  and  larvae  completed  development 
in  hypersaline  conditions,  time  to  hatching  and  metamor- 
phosis was  delayed  at  salinities  above  40  ppt  (Fig.  1 ). 
Posthatching  development  was  not  affected  by  salinity  (Fig. 
2).  Optimal  salinities  for  development  were  between  30  and 
40  ppt,  which  differs  slightly  from  previous  reports  of 
optimal  values  between  20  and  30  ppt  (Jegla  and  Costlow, 
1982;  Laughlin,  1983;  Sugita,  1988).  This  difference  may 


100 


80  - 


60  • 


20  - 


^    0\a    •    • 

^^M+t**** 


10  15  20 

Time(d) 


25 


Figure  3.  Kaplan-Meier  survival  curves  for  Limulus  polvphemux  lar- 
vae subjected  to  salinities  ranging  from  5  to  90  ppt  for  30  days.  All  larvae 
survived  in  salinities  from  10  to  70  ppt.  n  =  24  for  each  trial. 


Figure  4.  Kaplan-Meier  curves  for  time  until  molting  for  Limulus 
/>«/V/>/II';HH.V  larvae  subjected  to  salinities  ranging  from  5  to  QO  ppt  for  30 
days,  n  =  24  for  each  trial. 


92 


G.  S.  EHLINGER  AND  R.  A.  TANKERSLEY 


5ppt 

lOppt 

20ppt 

30ppt 

40ppt 

50ppt 

60ppt 

70ppt 

SOppt 

90ppt 


Figure  5 

exposure  to 


Time  (h) 

Mean  (±SE)  osmotic  concentration  of  the  perivitelline  fluid  at  0,  0.5.  1.  2.  4.  and  6  h  after 
salinities  ranging  from  5  to  90  ppt. 


be  the  result  of  acclimation  by  the  adults  to  the  extreme 
salinity  conditions  found  in  the  IRL  compared  to  other 
estuaries  because  it  is  a  nontidal,  shallow  lagoon. 

The  results  of  the  current  study  indicate  that  eggs  and 
embryos  of  L.  polyphemus  are  more  sensitive  to  high  tem- 
peratures than  to  high  salinities  (Figs.  1  and  2).  Optimal 
temperatures  for  development  were  30-33  °C,  yet  temper- 
atures 35  °C  and  above  were  lethal  to  embryos  and  ad- 
versely affected  larval  growth  and  development.  This  dif- 


fers slightly  from  previous  studies  in  which  lower 
temperatures  produced  optimal  development  (25-30  °C: 
Jegla  and  Costlow,  1982;  Laughlin,  1983;  Sugita,  1988). 
Another  difference  is  that  hatching  did  not  occur  at  temper- 
atures above  33  °C  in  our  study,  whereas  other  researchers 
reported  hatching  at  temperatures  up  to  35  °C  (Jegla  and 
Costlow,  1982;  Laughlin.  1983). 

Temperature  tolerance  in  L.  polyphemus  varies  with  life- 
history  stage:  older  stages  are  better  able  to  withstand  ex- 


00 

"o 


o 


o 

r_ 


3000 


2500  - 


20(10  - 


1500  - 


500  - 


500 


1000 


1500 


2000 


2500 


3000 


Medium  Osmolarity  (mmol  kg"  ) 


Figure  6.     \  .irmiums  in  the  perivitelline  osmolarity  of  Limulus  polyphemus  eggs  as  a  function  of  the  bathing 
medium  following  6  h  of  exposure.  Values  are  means  (±SE).  The  dashed  line  is  the  isoosmotic  line. 


LIMULUS  SURVIVAL  AND  DEVELOPMENT  AT  HIGH  SALINITY 


93 


treme  temperatures  (Fraenkel,  I960;  Jegla  and  Costlow. 
1982;  Laughlin,  1983).  In  the  current  study,  embryos  could 
not  tolerate  temperatures  above  33  °C  (Fig.  1).  Reynolds 
and  Casterlin  (1979)  found  that  juveniles  were  tolerant  of 
temperatures  from  15  °C  to  40  °C.  The  lethal  temperature 
for  1-h  exposure  is  44  °C  for  adults,  although  they  can 
survive  more  than  72  h  at  40  °C  (Fraenkel.  1960).  Thus, 
adults  are  more  tolerant  than  embryos  to  high  temperatures 
since  embryos  failed  to  develop  and  hatch  at  temperatures 
of  35  °C. 

Salinity  tolerance  also  varies  with  life-history  stage.  Em- 
bryos developed,  hatched,  and  molted  to  the  first  juvenile 
instar  at  60  ppt  (Figs.  1  and  2),  and  larvae  survived  at 
salinities  from  10  to  70  ppt  (Fig.  3).  Juveniles  (12th  instar) 
are  able  to  withstand  salinities  of  12  ppt  for  several  days,  but 
as  salinity  decreases,  mortality  increases,  and  survival  time 
decreases  (Reynolds  and  Casterlin,  1979).  Adults  can  with- 
stand direct  transfer  from  25  ppt  to  13  ppt  with  no  adverse 
effects,  but  transfer  to  6  ppt  causes  swelling  of  the  limb 
joints  and  gills  (Robertson.  1970).  Our  results  indicate  that 
larvae  are  more  tolerant  of  sudden  hyposalinity  shock  than 
adults  and  juveniles.  This  may  be  due  to  ontogenetic  dif- 
ferences that  enable  embryos  and  larvae  to  tolerate  the  rapid 
fluctuations  in  salinity  that  typically  occur  in  intertidal  nest- 
ing areas.  These  results  are  consistent  with  studies  of  other 
estuarine  and  marine  arthropod  species  that  found  that  tol- 
erance to  a  wide  range  of  salinities  is  greater  in  the  larval 
stage  than  in  the  adult.  For  example,  the  larvae  of  the  coastal 
crabs  Armases  ricordi  and  A.  roberti  are  tolerant  of  a  wider 
range  of  salinities  than  the  adult  stages  and.  as  a  conse- 
quence, have  different  habitats  (Diesel  and  Schuh,  1998). 
The  larvae  of  the  Chinese  mitten  crab  Eriocheir  sinensis 
also  has  a  much  wider  salinity  tolerance  than  the  juveniles 
and  adults  (Anger.  1991 ). 

Temperature  and  salinity  have  been  found  to  affect  the 
physiology  and  growth  of  L.  polyphennis  (Jegla  and  Cost- 
low,  1982).  Temperatures  and  salinities  are  higher  in  the 
IRL  than  in  the  northern  portion  of  the  range  for  the  species. 
Therefore,  the  IRL  population  of  horseshoe  crabs  may  be 
able  to  withstand  higher  temperatures  and  salinities  as  a 
result  of  acclimatization,  leading  to  the  slightly  higher  op- 
timal ranges  for  development  and  growth  found  in  this 
study.  Temperature  may  also  have  an  effect  on  size  and 
growth,  leading  to  geographic  differences  in  size.  Adults 
tend  to  be  larger  in  temperate  regions,  with  the  smaller 
adults  occurring  in  the  warm  tropical  waters  of  Yucatan  and 
the  cold  waters  north  of  Cape  Cod.  Massachusetts  (Shuster. 
1979;  Reynolds  and  Casterlin,  1979).  Shuster  (1979)  also 
found  significantly  smaller  adults  that  matured  one  or  two 
molts  earlier  at  locations  with  salinities  below  1 8  ppt. 

When  exposed  to  hyperosmotic  and  hypoosmotic  stress, 
the  perivitelline  fluid  contained  within  the  outer  membrane 
of  L.  polyphemus  embryos  changed  rapidly  and  became 
nearly  isoosmotic  to  the  surrounding  medium  (Figs.  5  and 


6).  Since  the  osmotic  concentration  of  the  perivitelline  fluid 
changes  with  the  surrounding  medium,  the  perivitelline 
fluid  does  not  buffer  developing  embryos  from  changes  in 
external  salinity.  Partial  regulation  of  perivitelline  fluid  os- 
molarity  may  be  a  common  trait  among  members  of  the 
Xiphosura.  since  Sugita  (1988)  reported  similar  results  for 
embryos  of  Tachypleus  tridentatus.  the  Japanese  horseshoe 
crab.  Sekiguchi  ( 1988)  found  that  the  osmotic  concentration 
of  the  perivitelline  fluid  of  L.  pol\phenuis  and  T.  tridentatus 
embryos  bathed  in  high-salinity  waters  changed  during  the 
exposure  period,  attaining  a  slightly  higher  value  than  the 
surrounding  medium.  Sekiguchi  (1988)  also  found  that  in- 
organic ions  pass  freely  through  the  inner  egg  membrane. 
Thus,  osmoactive  substances  secreted  by  the  embryo,  but 
which  cannot  pass  through  the  inner  egg  membrane,  are 
most  likely  responsible  for  the  slightly  higher  osmolarity  of 
the  perivitelline  fluid  relative  to  the  outer  medium.  Since  the 
perivitelline  fluid  of  the  eggs  conforms  osmotically  to  the 
surrounding  medium,  one  would  expect  the  egg  volume  to 
change  initially,  and  then  return  to  its  original  level  once  the 
egg  has  reached  the  osmolarity  of  the  surrounding  medium. 
Ehlinger  (2002)  found  that  the  volume  of  eggs  exposed  to 
salinities  from  5  to  90  ppt  changed  over  a  6-h  exposure 
period:  in  general,  volume  decreased  in  hyperosmotic  solu- 
tions and  increased  in  hypoosmotic  solutions.  These  results 
differ  from  those  reported  by  Jegla  and  Costlow  (1982), 
who  found  that  egg  volume  did  not  change  conspicuously 
when  exposed  to  salinities  of  10  and  40  ppt. 

The  wide  salinity  tolerance  of  embryos  and  larvae  of  L. 
polyphemus  is  an  important  adaptation  to  the  extreme  con- 
ditions in  the  intertidal  nursery  habitat.  Such  variability  in 
tolerance  may  be  an  advantage  in  species  that  live  in  a 
highly  variable,  unpredictable  environment  (Anger.  1991). 
Embryos  and  larvae  of  L.  polyphemus  are  exposed  to  and 
can  tolerate  a  much  wider  range  of  salinities  than  juveniles 
and  adults.  This  enables  the  embryos  to  survive  and  hatch  in 
shallow  lagoons  and  embayments  with  rapidly  fluctuating 
salinities.  Larvae  are  able  to  tolerate  salinities  from  20  to  70 
ppt.  which  they  experience  in  intertidal  areas  where  they 
develop  and  molt  to  larger  stages  before  they  migrate  farther 
offshore  (Rudloe,  1979).  This  tolerance  for  extreme  tem- 
peratures and  salinities  is  particularly  important  in  nontidal 
estuarine  systems  and  lagoons,  such  as  the  IRL.  Although 
embryos  and  larvae  of  L.  polyphemus  are  able  to  withstand 
the  high  salinities  experienced  in  the  IRL.  temperatures 
during  summer  spawning  and  development  periods  may 
exceed  tolerance  limits,  thus  leading  to  the  lower  abundance 
of  embryos  and  larvae  in  the  IRL. 

Acknowledgments 

Research  supported  by  National  Park  Service  Grant  No. 
CA5 18099049.  We  thank  Canaveral  National  Seashore. 
Merritt  Island  National  Wildlife  Refuse,  and  NASA/ 


94 


G.   S.   EHLINGER  AND  R.  A.  TANKERSLEY 


Kennedy  Space  Center  for  access  to  the  collection  sites.  We 
thank  Drs.  M.  Botton.  M.  Bush,  E.  Irlandi,  and  J.  Lin  for 
their  comments  on  an  early  version  of  this  manuscript.  We 
are  grateful  to  M.  Mota,  E.  Reyier,  and  D.  Scheldt  for  their 
assistance  in  collecting  adult  crabs.  A.  Brenner  and  K. 
Smolarek  for  their  assistance  in  the  lab.  and  Dr.  J.  Grim- 
wade  for  use  of  laboratory  equipment.  We  thank  two  anony- 
mous reviewers  for  their  critical  review  of  this  manuscript. 

Literature  Cited 

Anger.  K.  1991.  Effects  of  temperature  and  sahmtv  on  the  larval  devel- 
opment  of  the  Chinese  mitten  crab  Erioelieir  sinensis  (Decapoda: 
Grapsidae).  Mar.  Ecol.  Prog.  Set:  72:  103-1  10. 

Barlow,  R.  B.,  Jr.,  M.  K.  Powers.  H.  Howard,  and  L.  Kass.  1986. 
Migration  of  Limulus  for  mating:  relation  to  lunar  phase,  tide  height, 
and  sunlight.  Biol.  Hull.  171:  310-329. 

Botton,  M.  L.,  R.  E.  Loveland,  and  T.  R.  Jacobsen.  1988.  Beach 
erosion  and  geochemical  factors:  influence  on  spawning  success  ol 
horseshoe  crabs  (Limulus  />i>l\/>heinn.s]  in  Delaware  Bay.  Mar.  Biol.  99: 
325-332. 

Brockmann.  H.  J.  199(1.  Mating  beha\ior  ol  horseshoe  crab.  Limuliix 
polvphemus.  Behtn-itir  114:  206-220. 

Brown,  G.  G.,  and  I).  I..  Clapper.  1981.  Procedures  for  maintaining 
adults,  collecting  gametes,  and  culturing  embryos  and  juveniles  of  the 
horseshoe  crab.  Limulus  polvplu'inus  L.  Pp.  26S-290  in  Laborntorv 
Animal  Management:  Marine  Invei lebi -tiles.  Committee  on  Marine 
Invertebrates.  National  Academy  Press,  Washington.  DC. 

Charmantier,  G.,  M.  Charmantier-Daures,  N.  Bouaricha.  P.  Thuet. 
D.  E.  Aiken,  and  J.-P.  Trilles.  1988.  Ontogeny  of  osmoregulation 
and  salinity  tolerance  in  two  decapod  crustaceans:  Hoinaru.s  aincr- 
icanus  and  Penaeus  japonicus.  Riot.  Hull.  175:  102-110. 

Cohen,  J.  A.,  and  H.  J.  Krockmann.  1983.  Breeding  activity  and  male 
selection  in  the  horseshoe  crab.  Limulus  polyphernus.  Bull.  Mar.  Set. 
33:  274-2S1. 

Costlow,  J.  D.,  C.  G.  Bookhout.  and  R.  J.  Monroe.  1966.  Studies  on 
the  larval  development  of  the  crab.  Rhithropanopeus  luirnxii  (Gould). 
I.  The  effect  of  salinity  and  temperature  on  larval  development. 
Phs-xiol.  Zonl.  39:  SI- 1 1)0 

De  Ereese,  D.  E.  1991.  Threats  to  biological  diversity  in  marine  and 
estuarine  ecosystems  of  Florida.  Cuuxl.  Manage.  19:  73-101. 

Diesel,  R..  and  M.  Schuh.  1998.  Effects  ol  salinity  and  starvation  on 
larval  development  of  the  crabs  Arnnises  rii  or.li  and  1  roberti  (Deca- 
poda:  Grapsidae)  Irom  Jamaica,  with  notes  on  the  biology  and  ecology 
ol  adnlls  ./.  C/usiai.  Kin/.  18:  423-436. 

Ehlinger,  (;.  S.  2002.  Spawning  behavior  and  larval  biology  ol  the 
American  horseshoe  crab.  Limulus  /<«/\/>//rm/<\.  in  a  microtidal  co.isi.il 
lagoon.  Ph.D.  dissertation.  Florida  Inslitute  ol  Tcclinolo-jy.  Melbourne. 
FL.  I  33  pp. 

Ehlinger,  (;.  S.,  R.  A.  Tankersley,  and  M.  B.  Bush.  20(13.  Spatial  and 
temporal  patterns  ol  spawning  and  larval  hatching  by  ihe  horseshoe 
crab.  1. illinium  pols'imemus.  in  a  microlidal  coastal  lagoon  /  \uinnt  s  26: 
631-640 

Fraenkel,  (i.  I960.  Lethal  high  temperature  lor  three  marine  mvertc- 
hrates:  Limulus  pnlspliemus.  Litloiuia  littorea  aiul  I'agiinix  longiear- 
1'iix.  Oikos  11:171  IS2. 

Goncahes.  E.,  K.  Rilu-iro.  and  A.  M.  V.  M.  Snares.  1995.  Laboratory 
stud)  ol  ellecls  ol  k-mi'.Tature  and  salinity  on  sur\i\al  and  larval 
ilevelopinenl  ol  .,  |iopnl.iiioii  ol  Kluihrop,inoi<eus  lianisn  from  the 
Mondego  River  estuary,  Portugal  Mar.  Biol  121:6*9  64 s 
ila.  T.  C.,  and  .1.  I).  Costl.m.  I'lfO.  Teinperalniv  and  salimlv  elfecls 
on  developmental  and  eail\  posihatch  stages  of  l.iiiiiilnx.  Pp.  103-1  13 


in  Physiology  and  Biology  of  Horseshoe  Crabs:  Studies  on  Normal  and 
Environmentally  Stressed  Animals.  J.  Bonaventura.  C.  Bonaventura. 
and  S.  Tesh.  eds.  Alan  R.  Liss.  New  York. 

Kinne,  O.  1970.  Temperature.  Pp.  321-514  in  Marine  Ecologv.  Vol.  I. 
Pan  I.  O.  Kinne.  ed.  Wiley-Interscience.  New  York. 

Kinne,  O.  1971.  Salinity.  Pp.  683-995  in  Marine  Ecology:  Vol.  1.  Part  2. 
O.  Kinne,  ed.  Wiley-Interscience.  New  York. 

Kliinl, .mm.  D.  G.  1996.  Survival  Analysis:  A  Self-Learning  Text. 
Springer.  New  York. 

I  .iiiL'liliii.  R.  1983.  The  effects  of  temperature  and  salinity  on  larval 
growth  of  the  horseshoe  crab  Limuliix  /lo/vp/iemns.  Biol.  Bull.  164: 
93-103. 

Laughlin,  R.  B.,  and  W.  French.  1989.  Differences  in  responses  to 
factorial  combinations  of  temperature  and  salinity  by  zoeae  from  two 
geographically  isolated  populations  of  the  mud  crab  Rhiiliropanopcus 
hurrisii.  Mar.  Bio/.  102:  387-395. 

Muenchow.  G.  1986.  Ecological  use  of  failure  time  analysis.  Ecologv 
67:  246-250. 

Palumbi.  S.  R..  and  B.  A.  Johnson.  1982.  A  note  on  the  influence  of 
hle-historv  stage  on  metabolic  adaptation:  the  responses  ol  Limuliix 
eggs  and  larvae  to  hypoxia.  Pp.  1 15-124  in  Ph\xiolng\  and  fi/o/o.ifv  of 
Horxcxliof  Crtibx:  Stud/ex  on  Normal  and  Environmentally  Sn-<:\x<\l 
,-\nini,il\.  .1.  Bonaventura.  C.  Bonaventura.  and  S.  Tesh.  eds.  Alan  R. 
Liss,  New  York. 

Penn.  D..  and  H.  J.  Brockmann.  1994.  Nest-site  selection  in  the  horse- 
shoe crab.  Limuliix  />ol\/ihoiuix.  Biol.  Bull.  187:  373-3S4. 

Pritchard.  D.  \V.  1967.  What  is  an  estuary:  physical  viewpoint.  Pp. 
1-157  in  Exinurii's,  G.  H.  Lauff.  ed.  American  Association  for  the 
Advancement  of  Science.  Washington.  DC. 

Reynolds,  \V.  VV.,  and  M.  E.  Casterlin.  1979.  Thermoregulatory  be- 
havior and  diel  activity  of  Liiitnlnx  /Wv/)/u<»m.s.  Pp.  47-59  in  Binnicil- 
ical  Applications  of  the  Horseshoe  Crab  (Limulidae),  E.  Cohen,  ed. 
Alan  R.  Liss.  New  York. 

Robertson.  J.  I).  1970.  Osmotic  and  ionic  regulation  in  the  horseshoe 
crab  Limulus polyphemus  (Lmneaus).  Biol.  Bull.  138:  157-183. 

Riidloe,  A.  1979.  Locomotor  and  light  responses  of  larvae  of  the  horse- 
shoe crab.  Limulus  poly/theiiiiix  (L.).  Riot.  Bull.  157:  494-505. 

Riidloe,  A.  E.  1980.  The  breeding  behavior  and  patterns  of  movement  of 
horseshoe  crabs.  Liniulns  pol\plitnni\.  in  the  \icinitv  of  breedina 
beaches  in  Apalachee  Bay.  Florida.  Estuaries  3:  177-183. 

Riidloe.  A.  E.  1985.  Variation  in  the  expression  of  lunar  and  tidal 
behavior  rhythms  in  the  horseshoe  crab.  Limulus  /Wv/>/ir»m.v.  Bull. 
Mm  Si  i  36:  3SS-395. 

SekiKiichi.  K.  1988.  Biology  of  lloiscshoc  Crabs.  Science  House.  To- 
kyo. 

Shuster.  C.  N.  1979.  Distribution  of  the  American  horseshoe  "crab," 
Limulus  [Hily/thfiiinx  (L.).  Pp.  3-26  in  Rioint.lt,  ,,l  .\/>i>li,-alioiis  of  the 
Horseshoe  Crab  (Lnnuli.Lu').  E.  Cohen,  ed.  Alan  R.  Liss.  New  York. 

Sinister.  C.  N.  1982.  A  pictorial  re\  lew  of  the  natural  history  and 
ecology  of  Ihe  horseshoe  crab.  Ldmulus polyphernus,  with  reference  to 
other  I.imulidae.  Pp.  1-52  in  Plnsio/ogv  and  Hiolng\  ol  Hoises/ioc 
Crabs.  Siinlifs  on  \onnal  tinil  Environmentally  Sncssetl  Animals. 
J.  Bonaventura,  (  Kon.nenluia.  and  S.  Tesh.  eds.  Alan  R.  Liss.  New 
York. 

Sinister.  C.  N.,  Jr.,  and  M.  I,.  Botton.   1985.     A  contribution  lo  the 
population  biology  of  horseshoe  crabs,  l.iimilns  />olv/'li,-miis  in  Dela- 
wara  Hav.  l:stu,in,'s  8:  363-372. 
Smith.  N.  P.  1987.      An  introduction  to  the  tides  of  Florida's  Indian  River 

I  agoon.  I.  \Vatei  levels    1'hi   .S. /.  50:  49-61. 

Smith,  N.  P.  1993.      Tidal  and  wind-driven  transport  between  Indian  River 
and  Mosqiiiio  Lagoon.  Florida.  /•/«.  .S'c/.  56:  235-246. 
ita.  II.  1988.     F'liMionmenl.il  adaptations  ol  emhrvos.  Pp    195-224  in 
gv  ol  Horseshoe  Crabs.  K.  Sekiguchi.  ed.  Science  House.  Tokvo 


Reference:  Biol.  Bull.  206:  95-102.  (April  2004) 
©  2004  Marine  Biological  Laboratory 


Strategies  for  Sperm  Chemotaxis  in  the  Siphonophores 
and  Ascidians:  A  Numerical  Simulation  Study 


MAKIKO  ISHIKAWA1'*,  HIDEKAZU  TSUTSUI1  t.  JACKY  COSSON2,  YOSHITAKA  OKA1  ±, 

AND  MASAAKI  MORISAWA1 

1  Misaki  Marine  Biological  Station,  Graduate  School  of  Science,  The  University  of  Tokyo,  Japan:  and 
2  Obsen-atoire  Oceanologique  de  Villefrance-sur-Mer,  CNRS,  France 


Abstract.  Chemotactic  swimming  behaviors  of  spermato- 
zoa toward  an  egg  have  been  reported  in  various  species. 
The  strategies  underlying  these  behaviors,  however,  are 
poorly  understood.  We  focused  on  two  types  of  chemotaxis, 
one  in  the  siphonophores  and  the  second  in  the  ascidians, 
and  then  proposed  two  models  based  on  experimental  data. 
Both  models  assumed  that  the  radius  of  the  path  curvature 
of  a  swimming  spermatozoon  depends  on  [Ca  ];,  the  in- 
tracellular  calcium  concentration.  The  chemotaxis  in  the 
siphonophores  could  be  simulated  in  a  model  that  assumes 
that  [Ca2  +  ]j  depends  on  the  local  concentration  of  the  at- 
tractant  in  the  vicinity  of  the  spermatozoon  and  that  a 
substantial  time  period  is  required  for  the  clearance  of 
transient  high  [Ca2+],.  In  the  case  of  ascidians,  trajectories 
similar  to  those  in  experiments  could  be  adequately  simu- 
lated by  a  variant  of  this  model  that  assumes  that  [Ca:  +  ], 
depends  on  the  time  derivative  of  the  attractant  concentra- 
tion. The  properties  of  these  strategies  and  future  problems 
are  discussed  in  relation  to  these  models. 

Introduction 

After  the  first  discovery  of  the  chemotactic  behavior  of 
spermatozoa  toward  an  egg  by  Dan  (1950).  sperm  chemo- 
taxis has  been  reported  in  various  animal  species  (Miller, 
1977;  Eisenbach,  1999).  and  chemoattractants  that  mediate 
such  behaviors  have  been  identified  in  a  few  cases  (Ward  ct 


Received  8  July  2003;  accepted  4  February  2004. 

*  Present  address:  Department  of  Geology.  National  Science  Museum. 
Japan. 

t  Author  to  whom  correspondence  should  be  addressed.  Present  address: 
Laboratory  for  Cell  Function  Dynamics.  Brain  Science  Institute.  RIKEN. 
Hirosawa  2-1.  Saitama  351-0198.  Japan.  E-mail:  tsutsui@brain.riken.go.jp 

j  Present  address:  Department  of  Biological  Sciences,  Graduate  School 
of  Science,  The  University  of  Tokyo.  Japan. 


til.,  1985:  Coll  et  ai,  1994;  Olson  et  til..  2001;  Yoshida  et 
al.,  2002).  Furthermore,  recent  cell  biological  studies  re- 
vealed some  of  the  intracellular  enzymatic  signaling  cas- 
cade evoked  by  the  attractant  stimulations  (Yoshida  ft  al.. 
2003;  Kaupp  et  al..  2003).  However,  a  major  question  that 
anyone  who  observed  this  phenomenon  has  to  bear  in  mind 
remains  poorly  answered:  How  does  such  a  tiny  spermato- 
zoon succeed  in  finding  an  attractant  source? 

What  makes  this  question  both  more  mysterious  and 
more  interesting  is  the  fact  that  distinct  swimming  trajecto- 
ries have  been  observed  for  spermatozoa  of  different  spe- 
cies, which  implies  that  different  strategies  for  chemotaxis 
may  underlie  these  behaviors.  For  example,  the  chemotactic 
behavior  in  the  siphonophores  has  been  described  as  follows 
(Cosson  et  al..  1984):  spermatozoa  show  trajectories  of 
large  diameter  (700-1000  /j,m)  while  swimming  far  from 
the  "cupule."  which  in  these  species  is  an  extracellular 
structure  of  the  egg  and  serves  as  an  attractant  source,  and 
trajectories  of  smaller  diameter  (200  jum)  in  the  vicinity  of 
the  cupule;  the  transition  between  the  two  modes  is  progres- 
sive. In  the  ascidians.  on  the  other  hand,  spermatozoa  ex- 
hibit characteristic  "chemotactic  turns"  during  chemotaxis, 
but  the  curvature  of  the  trajectories  has  no  noticeable  de- 
pendence on  the  distance  to  the  attractant  source  (Yoshida  ct 
al..  1993.  2002:  Ishikawa,  2000).  The  behavior  of  sea  urchin 
spermatozoa  seems  to  be  a  little  more  complicated  but  still 
exhibits  unambiguous  chemotaxis  (Ward  ct  al..  1985). 
Thus,  it  appears  that  spermatozoa  in  different  species  often 
respond  to  the  attractant  differently,  although  the  goal  is  the 
same  in  all  cases — to  find  an  egg  and  facilitate  fertilization. 

One  approach  to  revealing  the  underlying  strategies  for 
sperm  chemotaxis  may  be  to  build  a  model  based  on  the 
experimental  observations  and  then  study  how  the  model 
works.  In  the  present  paper,  we  propose  two  models,  one 


95 


96 


M.  ISHIKAWA  ET  AL 


applied  to  ihe  siphonophores  and  the  second  to  the  ascid- 
ians.  We  focused  on  these  two  taxa  because  their  swimming 
behaviors  are  simple  but  clearly  distinct,  and  also  because 
substantial  experimental  data  are  available  in  the  literature 
(see  Results  for  details).  These  experimental  results  were 
simplified,  as  summarized  in  Figure  1.  and  incorporated  into 
the  models,  which  required  only  a  few  simple  and  reason- 
able assumptions.  We  show  that  numerical  calculations  of 
sperm  trajectory  using  the  two  models  result  in  trajectories 
very  similar  to  those  observed  experimentally. 

Materials  and  Methods 

General  remarks  on  the  models 

It  has  been  suggested  that  spermatozoa  swim  with  three- 
dimensional  beating  waves  whose  characteristics  confine 
them  to  a  two-dimensional  space  when  they  are  confronted 
with  the  interfaces  between  two  media  such  as  water/air  or 
glass/water  (Cosson  et  ai,  2003).  For  this  reason  as  well  as 
to  simplify  the  observation  of  sperm  trajectories  under  a 
microscope,  our  experiments  have  been  restricted  mainly  to 


spermatozoa  located  at  the  glass/water  interface  of  the  lab- 
oratory chambers.  Since  experimental  background  is  neces- 
sary to  test  the  validity  of  a  model,  the  models  we  used  were 
also  limited  to  two  dimensions.  At  the  interface,  most  sper- 
matozoa of  siphonophores  and  ascidians  show  circular 
movement,  usually  in  one  preferred  direction.  A  reasonable 
explanation  is  that  the  movement  in  the  three-dimensional 
free  environment  is  helical  and  that  some  of  the  initially 
homogeneously  suspended  spermatozoa  were  going  upward 
and  tended  to  be  confined  to  the  air/water  interface,  while 
others  were  going  downward,  to  the  water/glass  interface,  as 
was  shown  for  sea  urchin  spermatozoa  (see  Cosson  et  ai, 
2003).  Sperm  confined  to  the  glass  surface  still  exhibit 
unambiguous  chemotaxis  as  reported  thus  far,  and  this  be- 
havior is  our  topic  in  the  present  study. 

In  our  model,  a  spermatozoon  is  treated  as  a  mathematical 
point.  This  point  circulates  in  the  .\-y  plane  in  one  direction 
(clockwise  for  the  ascidian  spermatozoa  observed  in  the 
vicinity  of  the  glass  slide  surface,  and  counterclockwise  for 
the  siphonophore  spermatozoa),  with  a  radius  of  curvature 
that  changes  depending  on  the  attractant  concentration  and 


Siphonophore 


B 


Ascidian 


ASW 


/'"    N 

1   ASW      ) 


I          ASW 

\ 
\ 


Low 


I 

i          ASW 


Attractant  cone. 


High 


/  x  /  x 

I  CFSW  I         '  CFSW          I 

\  /  \  / 


Low 


Attractant  cone. 


CFSW 


Under  attractant  gradient 


Figure  1.  A  summai) .  based  on  previous  reports,  of  spermato/oa  behavior  in  the  presence  of  the  attractant 
:i  iv.o  species  of  siphonophore  (Miti;t>icicti  kuclti.  Clifli>/>lii'\i:\  oppendiculata)  and  one  species  ol  ascidian 
'('ii'iin  iiit<",tiinili\).  (A)  In  the  siphonophoics.  the  curvature  is  negatively  dependent  on  the  attrncUml  concen- 
tration in  artificial  seawater  (ASW.  In/'),  but  the  dependence  is  lost  in  C;r  *  -tree  seawater  (CFSW.  hotttim).  (B) 
In  t'i.  '  hans.  no  such  dependence  is  observed,  even  in  ASW  (/»/»,  but  a  rapid  modulation  of  the  curvature 
leadi  .1  turning  behavior  occurs  in  the  presence  of  the  attractant  gradient  (hniium  Icfn.  Arrows  indicate 

ditccin  i  '  i  il:  aiiiaclani  source.  The  curvature  is  larger  when  swimming  tow  aid  the  source  and  smaller  when 
swimming  IM  il.r  opposite  direction.  A  short  delay  in  the  response  has  been  often  observed  in  this  correlation 
llshikaw.'.  000  "i  .',lm I,,  ,  i ,//..  2002).  In  CFSW.  no  such  modulation  in  the  curvature  is  observed,  even  under 
the  altractant  gradient  (bottom  It  in 


HOW  A  SPERM  CLIMBS  A   HILL 


97 


on  time.  Let  us  define  some  parameters:  r,  time;  p(O, 
position  of  sperm  at  /;  v(/)  =  v{cos  (</>(/)),  sin  (<£(/))). 
velocity  vector  of  sperm:  r(D.  curvature;  and  c(p),  attract- 
ant  concentration  sensed  by  the  sperm  at  position  p  (Fig. 
2  A).  Since  no  significant  changes  in  the  swimming  velocity 
were  found  during  the  chemotactic  behavior  in  these  species 
(Cosson  etui,  1984;  Ishikawa,  2000;  Yoshida  etui.,  2002), 
let  us  assume  the  amplitude  of  the  velocity  vector  as  con- 
stant (=v).  Numerical  integration  of  sperm  movement  was 
evaluated  as  follows  with  a  time  step  (A/)  of  1.0  ms: 


pit  +  A/)  =  p(t)  +  AM/) 


</>(/  +  A/)  = 


\tr/rit) 


(Eq.  1) 
(Eq.  2) 


Updating  the  angular  component  of  velocity,  but  not  the 
vector  itself,  as  in  the  equation  (2),  moderates  the  accumu- 


B 


Figure  2.  (A)  A  schematic  drawing  that  shows  the  four  parameters 
used  in  the  calculation  of  sperm  trajectory.  O,  the  origin;  p,  position  at  t 
(vector);  v,  velocity  (vector);  (j>,  angular  component  of  v  (scalar);  r,  radius 
of  curvature  (scalar).  (B)  A  computed  snapshot  of  the  chemoattractant 
gradient  used  in  the  present  study.  The  attractant  concentration  profile  in 
the  square  area  of  ±  I  mm  of  the  .v-y  plane  is  plotted  in  the  z-axis.  The  peak 
(hilltop)  corresponds  to  the  chemoattractant  source  located  at  the  origin 
(.v  =  v  =  0). 


lation  of  error  during  the  integrations  for  a  long  time  period. 
All  the  calculations  and  graphical  outputs  were  done  by 
using  the  Mathematica  3.0  program  (Wolfram  Research). 

Attractant  profile 

For  most  observations  of  chemotaxis,  the  following  ex- 
perimental design  was  adopted:  a  glass  pipette  filled  with 
chemoattractant  or  any  fluid  (within  agar-gel  in  many  cases) 
to  be  tested  was  placed  in  a  drop  of  water  containing 
dispersed  sperm  cells.  This  allows  a  spatial  gradient  of 
attractant  concentration  to  be  established  rapidly:  sperm 
located  in  the  vicinity  of  an  attractant  source  usually  ap- 
proach it  within  no  more  than  tens  of  seconds.  Since  mol- 
ecules such  as  an  organic  compound  or  a  small  protein 
normally  have  diffusion  coefficients  in  water  of  -10"'" 
nr/s  or  smaller,  it  is  an  acceptable  approximation  that  the 
attractant  profile  does  not  change  much  during  the  approach 
of  the  spermatozoon.  In  our  model,  therefore,  we  simply 
used  a  computed  snapshot  of  a  solution  of  a  diffusion 
equation  as  an  attractant  profile  (Fig.  2B).  Moreover,  the 
drop  is  largely  spread  on  the  slide  but  is  much  thinner  in  the 
;-axis,  so  variation  of  attractant  concentration  along  the 
c-axis  should  be  small.  Therefore,  we  consider  the  attractant 
gradient  field  with  a  two-dimensional  diffusion  equation 
with  a  coefficient  of  D: 


8c/8t  =  D(82c/8.\2  +  82c/8\2) 


(Eq.  3) 


In  the  polar  coordinates  of  p.   H(  .v   =   p  cos  id),  v   = 
p  sin  (0)),  equation  (3)  can  be  expressed 


as 


8c/8t  =  Di82c/8p2  +  1/pScVSp  +  \/p282c/862)     (Eq.  4) 

Since  we  assume  a  situation  of  spatial  symmetry,  the  last 
term  of  equation  (4)  can  be  regarded  to  be  zero. 

8c/8t  =  D(8v/8p:  +  \/p8c/8p)  (Eq.  5) 

As  a  boundary  condition,  we  assumed  that  the  concentration 
at  the  origin  (i.e.,  the  tip  of  a  pipette)  is  always  kept  at  a  high 
level  (r(0)  =  1  ).  We  set  D  as  2.0  X  10"'"  nr/s  and  used 
a  numerical  solution  of  equation  i5)  at  t  =  60  s  as  the 
profile  for  subsequent  trajectory  calculations  (Fig.  2B).  We 
also  tried  some  other  static  attractant  profile  models  (expo- 
nential, parabolic,  solution  of  the  diffusion  equation  at  dif- 
ferent times,  etc.)  and  found  that  most  definitions  resulted  in 
qualitatively  similar  responses  to  what  we  show  next. 

Results 

The  siphonophore  model 

Some  properties  of  sperm-swimming  in  siphonophores 
are  summarized  in  Figure  I  A.  This  summary  is  based  on 
observations  of  Mnxgiueii  kochi  and  Chelopheyes  appen- 
diculata  (Cosson  et  til..  1984).  In  artificial  seawater  ( ASW). 
the  spermatozoa  show  trajectories  of  larger  diameter  (700- 


98 


M.   ISHIKAWA  ET  AL. 


400 

350 
300 


3  200 
ro 

£    150 
=3 
O    100 

50 


0.2  0.4  0.6  0. 

Attractant  cone,  [a.u.] 


1000  ju,m)  while  they  are  far  from  the  attractant  source  (~5 
mm),  and  smaller  trajectories  (-200  jum)  near  the  attractant 
source  (—0.2  mm).  However,  this  dependence  on  distance 
from  the  attractant  was  lost  in  the  absence  of  external  Ca2  +  , 
which  suggests  that  Ca2  +  influx  is  involved  in  the  modula- 
tion of  the  curvature  of  trajectories.  We  incorporated  these 
findings  into  the  assumptions  set  in  the  model  as  follows: 

(a)  Curvature  decreases  as  intracellular  Ca2+  concentra- 
tion, ([Ca2*  ],),  increases  (i.e..  a  negative  correlation). 

(b)  [Ca2+],  positively  correlates  with  c(p),  the  attractant 
concentration  which  is  sensed  by  the  sperm. 

Assumption  (a)  also  agrees  with  the  evidence  that  sper- 
matozoa treated  with  a  Ca2+  ionophore  showed  a  curvature 
of  —200  /am.  which  increased  up  to  -800  /am  at  lower 
Ca24"  concentration.  Since  any  quantitative  relationship 
among  these  factors  in  real  spermatozoa  is  not  yet  available, 
we  set  some  trial  functions  and  studied  the  behavior.  We 
first  tried  a  simple  linear  correlation  between  [Ca2+],  and 
c(p),  and  a  cubic  function  for  [Ca2  +  ],  and  r(t)  (Fig.  3A): 

[Ca:  +  ],  =  dp)     (0  <  c  <  1;  [arbitral  unit  (a.u.)])     (Eq.  6) 


,-(,)  =  400(1  -  [Ca;T],)-  [jam]     (0  < 


<  1;  [a.u.]) 
(Eq.  7) 


This  now  allows  us  to  study  how  spermatozoa  swim  under 
these  conditions.  The  results  show  that  the  trajectories  gen- 
erated by  such  conditions  are  far  from  chemotactic  behav- 
ior. Spermatozoa  do  circle  around  the  attractant  source  but 
never  finally  approach  the  egg  (Fig.  3B).  This  result  is  not 
surprising  because  our  present  system  is  fully  symmetric  in 
terms  of  time  and  space  components.  When  using  functions 
other  than  those  of  equations  (6  and  7),  no  chemotaxis  is 
observed  at  all.  However,  a  remarkable  change  occurs  if  we 
incorporate  an  additional  condition: 

(c)  |Ca2'  |,  has  different  rates  of  increase  and  decrease 
(slow  to  decrease). 

This  condition  is  not  unlikely,  because  pumping  of  the 
cytosolic  Ca2  f  out  of  the  cell  or  into  the  intracellular  store 
against  the  electrochemical  gradient  across  the  membrane  is 
an  enzymatic  process,  which  is  energy-consuming,  whereas 
Ca2+  influx  generally  occurs  rapidly.  Therefore,  we  then 
incorporated  this  additional  condition  as  follows: 


A[Ca:  '  ],/A;  =  -  l/T([Ca:*],  -  dp)) 

when     [Ca:*], 


(Eq.  6') 


Figure  3.  Simulations  ol  t'n  i|  h  in  s'lu'ic  model.  (A)  A  cubic  func- 
linii  as  one  of  the  examples  ol  a  luiKtion  that  negatively  correlates 
attraetanl  concentration  to  cunaUirc  ol  Ihe  li;i|ectory.  (B)  A  trajectory 


simulated  with  the  function  shown  in  (A).  Time  to  lower  |Ca:'|,  is  not 
considered.  The  sperm  started  at  position  ( .v.  y)  =  (  -  800  jim,  -800  fj.ni) 
with  an  initial  angle  ol  O.I  radian  and  a  constant  speed  of  500  /j.m/s 
(arrow).  The  trajectory  during  the  initial  40  s  is  shown.  (C)  A  trajectory 
simulated  under  the  same  conditions  as  in  (B).  except  that  T  of  0.5  s  is 
incorporated  as  a  decay-lime  constant  to  lower  [Ca"  ],. 


HOW  A  SPERM  CLIMBS  A   HILL 


99 


AC/At  [a.u./ms] 


B 


Figure  4.     Simulations  of  the  ascidian  model.  (A)  A  sigmoid  function 
as  one  of  the  examples  of  a  function  that  positively  correlates  time-derived 


where  T  is  the  decay  time  constant.  This  condition  was 
applied  only  when  [Ca2  +  ]j  >  c(p):  otherwise,  equation  (6) 
was  applied  as  before.  When  trajectories  were  calculated 
with  these  new  sets  of  conditions  (6,  6',  7),  we  found  that 
the  incorporation  of  a  time  component  for  the  Ca2  +  decay 
results  in  chemotactic  trajectories  (Fig.  3C)  that  are  not 
unlike  those  obtained  in  the  experimental  observations. 
Likewise,  chemotactic  trajectories  were  reconstructed  for 
a  wide  range  of  arbitrarily  selected  functions  that  relate 
'c(p)'  to  l[Ca2  +  ],'  positively  instead  of  by  equation  (6). 
and  relate  '[Ca21],'  lo  ';•(/)'  negatively  instead  of  by 
equation  (7).  even  though  some  of  them,  of  course,  showed 
heavily  distorted  trajectories  of  approach  toward  the 
attractant  source  and  unusually  long  or  short  times  of 
approach. 


The  ascidian  model 

The  behavior  of  ascidian  sperm  is  quite  different  from 
that  in  the  siphonophore  sperm.  The  behavior  illustrated 
in  Figure  IB  is  based  on  observations  of  Cioini  intesti- 
imlix  by  Ishikawa  (2000)  and  Yoshida  et  cil.  (1993).  In  the 
presence  of  an  attractant  without  a  gradient,  the  curvature 
of  the  sperm  trajectory  is  independent  of  the  concentra- 
tion of  the  attractant.  and  is  close  to  that  in  the  absence 
of  the  attractant  (Fig.  IB).  Under  the  gradient  of  attract- 
ant concentration,  however,  spermatozoa  show  rapid 
changes  in  their  track  diameters,  so-called  chemotactic 
turns.  Since  this  turning  behavior  is  lost  in  the  calcium- 
free  seawater  (CFSW)  or  in  the  presence  of  Ca2+  channel 
inhibitors,  it  has  been  suggested  that  rapid  changes  of 
diameter  are  dependent  on  [Ca2  +  ],.  Therefore,  we  again 
incorporated  condition  (a),  as  we  did  in  the  siphonophore 
model.  Next,  we  need  to  infer  the  relationship  between 
[Ca~  +  ],  and  c(p),  the  attractant  concentration  that  the 
spermatozoan  senses.  Since  modulation  of  diameter  oc- 
curs only  in  the  presence  of  an  attractant  gradient,  we 
assumed  that  [Ca2  +  ],  depends  on  the  temporal  changes  of 
c(p)  but  not  on  the  "absolute"  concentration  itself.  Thus, 
we  assume  a  second  condition: 

(d)  [Ca2+],  negatively  correlates  to  the  time  derivative  of 
the  attractant  concentration. 

With  conditions  (a)  and  (d).  it  follows  that  r(t)  positively 
con-elates  to  &c(p(D)/&t.  the  time  derivative  of  the  attract - 


attractant  concentration  to  the  curvature  of  the  trajectory.  (B)  A  trajectory 
simulated  with  the  function  shown  in  (A).  The  sperm  started  at  position  ( .v, 
v)  =  (  -750  jum.  -750  jxm)  with  an  initial  angle  of  0.8  radian  and  a 
constant  speed  of  250  |iini/s  (arrow).  The  trajectory  during  the  initial  40  s 
is  shown.  (C)  A  trajectory  simulated  under  the  same  conditions  as  in  (B). 
except  that  a  delay  of  150  ms  in  the  response  of  curvature  to  the  time- 
dcrned  attractant  concentration  is  incorporated. 


100 


M.   ISHIKAWA  ET  AL. 


ant  concentration.  This  assumption  was  incorporated  in  the 
ascidian  model  as  follows: 


/•(M  =  F(Ac(p(r))/Af) 


(Eq.  8) 


Where  F  is  the  function  that  positively  correlates  8c/8t  with 
r(M.  We  studied  sperm  behavior  with  a  sigmoid  function  for 
F  (Fig.  4A)  and  found  that  this  condition  alone  is  sufficient 
to  show  chemotactic  trajectories  with  successive  turns  when 
approaching  the  attractant  source  (Fig.  4B).  We  further 
incorporated  a  delay  in  the  sperm  response  of  r(t)  to 
Ar(/»(/))/Af  with  a  time  range  of  tens  of  milliseconds, 
because  such  a  delay  has  been  found  in  the  analysis  of  the 
trajectory  of  real  sperm  (Ishikawa,  2000;  Yoshida  et  til.. 
2002).  This  resulted  in  similar  trajectories,  but  with  a  twist 
(Fig.  4C),  which  is  often  observed  in  real  chemotaxis  in  the 
ascidian.  Thus,  we  find  that  the  delay  of  sperm  response  is 
not  an  absolute  necessity  for  chemotactic  behavior  in  the 
case  of  the  ascidian  model,  but  this  parameter  results  in 
trajectories  that  are  somewhat  more  realistic. 

Discussion 

In  the  present  study,  we  proposed  two  comprehensive 
models  for  strategies  of  sperm  chemotaxis  in  the  siphono- 
phores  and  the  ascidians.  With  these  models,  chemotactic 
trajectories  similar  to  those  observed  for  real  spermatozoa 
could  be  reconstructed.  We  found  that  there  are  at  least  two 
ways  to  identify  the  location  of  the  "hilltop" — the  source  of 
the  chemoattractant — without  looking  around  for  it.  The 
siphonophore's  way  is  to  "walk"  circularly,  with  large- 
diameter  curvatures  at  low  altitude  and  smaller  ones  at 
higher  altitude.  This  alone  is  not  enough  for  success;  how- 
ever, success  can  be  achieved  if  any  increase  in  curvature  is 
followed  by  a  time  lag.  In  the  ascidian's  way,  one  needs  to 
sense  the  steepness  (gradient)  but  not  the  height  (absolute 
concentration):  the  curvature  is  large  when  climbing  steeply 
uphill,  medium  when  the  slope  is  gentle,  and  small  when 


going  downhill.  The  time-delay  condition  is  not  always 
necessary,  but  such  a  delay  introduces  twists  into  the  tra- 
jectory. 

Even  though  these  models  employ  some  conditions  based 
on  experimental  results,  these  conditions  may  seem  to  be 
oversimplified.  However,  the  goal  of  the  present  modeling 
study  is  not  to  simulate  the  natural  behavior  of  the  sperma- 
tozoa perfectly  but  to  find  out  what  elements  are  needed  to 
reconstruct  the  phenomenon  of  interest.  For  this  purpose,  it 
is  necessary  to  focus  on  a  small  number  of  important  pa- 
rameters. 

Nonetheless,  some  lines  of  evidence  in  addition  to  those 
mentioned  earlier,  support  our  simplification  of  the  condi- 
tions. First,  it  has  been  shown  that  asymmetrical  bending 
waves  are  induced  when  a  high  concentration  of  Ca2+  is 
applied  to  the  flagella  of  demembranated  sea  urchin  sperm 
(Brokaw,  1979).  This  may  support  our  condition  (a).  Next, 
it  was  recently  suggested  that  a  store-operated  Ca2  +  channel 
(SOC)  regulates  chemotaxis  in  the  ascidian  (Yoshida  et  ai, 
2002).  Involvement  of  such  a  SOC  may  account  for  the  time 
delay  in  the  curvature  response  to  the  temporal  changes  in 
the  attractant  concentration:  this  feature  was  often  observed 
in  the  experiments  and  is  introduced  into  the  ascidian  model 
(Fig.  4C),  since  activation  of  the  SOC  requires  depletion  of 
internal  Ca2  +  stores  evoked  by  the  releasing  signals  such  as 
inositol  1,4.5-phosphate. 

Quantitative  comparison  of  the  model  outputs  with  ex- 
perimental results  is  very  important  for  validation  of  the 
models.  Unfortunately,  we  are  not  ready  to  do  such  a  study 
because  the  models  currently  have  high  degrees  of  freedom. 
The  two  functions,  one  that  relates  attractant  stimulus  with 
[Ca2  +  ]|  and  the  other  that  relates  [Ca2  +  ],  with  curvature, 
cannot  yet  be  quantitatively  defined.  Of  course,  one  desir- 
able experiment  might  be  to  experimentally  define  these 
functions  and  then  to  carry  out  a  quantitative  comparison. 
But  this  requires  many  very  difficult  technical  break- 


Siphonophore 


B 


Ascidian 


Figure  5.  Changes  in  |Ca:*  ],  during  chemotaxis.  I  A)  Plot  of  (Ca'*  ],  as  a  IUIKIIOII  ot  lime  in  the  modeled 
chemotaxis  lor  siplmnophores  (Fig.  3Cl.  (Bl  Plot  of  |Ca:*],  versus  time  in  the  modeled  chemotaxis  for  the 
asculian  if-'ig.  4Bi  li  is  assumed  that  [Ca; '  |,  is  proportional  to  the  inverse  of  the  radius  of  curvature. 


HOW  A  SPERM  CLIMBS  A   HILL 


101 


B 


Figure  6.  A  difference  in  the  sensitivity  to  a  local  attractant  peak 
between  the  siphonophore  and  ascidian  strategies.  (A)  A  secondary  source 
with  one-fourth  the  attractant  concentration  of  the  main  one  is  added  at  the 
position  (x.  v)  =  (  -500  /xm.  -500  /urn).  (B)  Sperm  trajectory  with  the 
siphonophore  model  under  the  dual  peak  profile  in  (A).  The  trajectory  is 
superimposed  upon  the  attractant  profile.  Note  that  the  spermatozoa  found 
the  main  peak.  The  initial  condition  is  same  as  that  in  Fig.  3B.  (C)  Sperm 
trajectory  simulated  with  the  ascidian  model.  Note  that  the  spermatozoa 
now  found  the  local  peak  instead  of  the  main  peak.  The  initial  condition  is 
the  same  as  that  in  Fig.  4B.  Arrows  in  (B)  and  (C)  indicate  the  initial 
positions  and  directions. 


throughs  such  as  quantification  of  local  attractant  concen- 
tration, application  of  an  attractant  stimulus  varying  with 
time,  and  so  on.  Another  indirect  but  more  practical  exper- 


iment would  be  to  measure  [Ca2  +  ]j  during  chemotaxis.  Our 
models  predict  that  there  will  be  a  temporal  [Ca2  +  ],  pattern 
during  chemotaxis  specific  to  each  model:  [Ca2  +  ],  oscillates 
in  both  models,  and  the  base  level  elevates  in  the  siphono- 
phores  but  not  in  the  ascidians  (Fig.  5).  Even  though  mea- 
surement of  [Ca2  +  ]j  in  swimming  spermatozoa  is  still  tech- 
nically challenging,  mainly  due  to  the  small  volume  of 
cytoplasm  and  fast  movements  of  the  sperm,  we  hope  that 
recent  innovations  in  Ca~+  indicators  and  image  sensors 
will  make  it  possible  in  the  future. 

What  is  the  significance  of  the  difference  in  the  two 
strategies?  Since  temporal  change  of  the  attractant  concen- 
tration is  the  critical  parameter  for  the  modulation  of  cur- 
vature in  the  ascidian  model,  we  expect  that  the  ascidian 
spermatozoon  is  more  sensitive  to  local  change  of  concen- 
tration than  the  siphonophore  spermatozoon,  in  which  the 
absolute  concentration  value  is  the  most  critical.  Simulation 
under  two  attractant  sources,  one  of  high  concentration  and 
the  other  of  low  concentration,  led  to  the  expected  results: 
the  ascidian  spermatozoa  found  the  lower  peak  of  attractant 
in  the  vicinity,  and  the  siphonophore  spermatozoa  reached 
the  higher  peak  (Fig.  6).  Thus,  an  interesting  future  problem 
would  be  to  test  this  prediction  in  biological  experiments. 
One  may  also  be  interested  in  possible  relationships  be- 
tween such  characteristics  of  sperm  strategy  and  the  envi- 
ronment that  the  species  are  facing.  However,  such  a  ques- 
tion cannot  be  addressed  currently.  Most  of  our  knowledge 
has  been  limited  to  sperm  in  two-dimensional  laboratory 
conditions,  even  though  the  goal  should  be  to  reach  a  deep 
understanding  of  strategy  in  the  three-dimensional  natural 
environment.  Since  theoretical  treatments  suggests  that  drag 
forces  near  the  interface  have  substantial  effects  on  the 
flagellar  motion  of  sperm  (Katz,  1974),  we  should  avoid 
applying  knowledge  gained  in  two  dimensions  thought- 
lessly in  building  three-dimensional  models.  One  needs  to 
know  how  parameters  that  describe  three-dimensional  heli- 
cal motions  are  affected  by  the  attractant  gradient.  To  ac- 
complish this  goal,  we  hope  that  techniques  to  measure 
sperm  trajectories  in  the  three-dimensional  environment,  as 
pioneered  by  Crenshaw  el  ul.  (2000).  will  soon  be  more 
accessible. 


Acknowledgments 

We  thank  Dr.  M.  Yoshida  and  Dr.  K.  Yoshimura  of  the 
University  of  Tokyo  for  helpful  discussions,  and  the  staff  of 
MMBS  for  encouragement.  The  CNRS,  JSPS,  and  MEXT 
are  acknowledged  for  support  of  J.  Cosson  at  the  occasion 
of  several  stays  in  Japan.  This  work  was  supported  by 
grants-in-aid  from  the  Ministry  of  Education,  Culture. 
Sports,  Science  and  Technology  of  Japan  to  M.M. 


102 


M.   ISHIKAWA  ET  AL. 


Literature  Cited 

Brokaw.  ('.  J.  1979.  Calcium-induced  asymmetrical  heating  of  Triton- 
demembranated  sea  urchin  sperm  flagella.  J.  Ct'll  Biul.  82:  401-41  I 

Coll,  J.  C.,  B.  F.  Bowden,  G.  V.  Meehan,  G.  M.  Kiinig,  A.  R.  Carroll, 
D.  M.  Tapiolas,  P.  M.  Alino,  A.  Heaton,  R.  De  Nys,  P.  A.  Leone, 
M.  Maida,  T.  L.  Acetet,  R.  H.  Willis,  R.  C.  Babcock,  B.  L.  Willis, 
Z.  Florian,  M.  N.  Clayton,  and  R.  L.  Miller.  1994.  Chemical 
aspects  of  mass  spawning  in  corals.  I.  Sperm-attractant  molecules  in  the 
eggs  of  the  scleractinian  coral  Mimlipora  digitata.  Mar.  Biol.  118: 
177-182. 

Cosson,  M.  P.,  D.  Carre,  and  J.  Cosson.  1984.  Sperm  chemuiaxis  in 
siphonophores.  II.  Calcium-dependent  asymmetrical  movement  of 
spermatozoa  induced  by  the  attractant.  J.  Cell  Sci.  68:  163-181. 

Cosson,  J.,  P.  Huitorel.  and  C.  Gagnon.  2003.  How  spermatozoa  come 
to  be  confined  to  surfaces.  Cell  Motil.  Cytiiskclcl.  54:  56-63. 

Crenshaw,  H.  C.,  C.  N.  Ciampaglio,  and  M.  McHenry.  2000.  Analysis 
of  the  three-dimensional  trajectories  of  organisms:  estimates  of  veloc- 
ity, curvature  and  torsion  from  positional  information.  /  £.v/>.  Biol. 
203:  961-982. 

Dan,  J.  C.  1950.  Fertilization  in  the  medusan  Spirucodim  saltarix.  Biul. 
Bull.  99:  4 12-4 1. V 

Eisenbach,  M.  1999.     Sperm  chemotaxis.  Rev.  Reprod.  4:  56-66. 

Ishikawa,  M.  2000.  Strategy  and  regulation  of  sperm  chemotactic  be- 
havior in  the  ascidian.  Cifnui  intestinalis.  M.S.  thesis.  University  ot 
Tokyo.  (In  Japanese). 


Katz,  D.  K.    1974.     On   the  propulsion  of  micro-organisms  near  solid 

boundaries.  J.  Fluid  Mccli.  64:  33-49. 
Kaupp.  I .  B.,  J.  Solzin,  E.  Hildebrand,  J.  E.  Brown,  A.  Helbig,  V. 

Hagen,  M.  Beyermann,  F.  Pampaloni,  and  I.  Weyand.  2003.     The 

signal  flow  and  motor  response  controlling  chemotaxis  of  sea  urchin 
sperm.  Nat.  Cell  Biol.  5:  109-1 17. 

Miller,  R.  L.  1977.  Distribution  of  sperm  chemotaxis  in  the  animal 
kingdom.  Pp.  99-199  in  Advances  in  Invertebrate  Reproduction.  Vol. 
1.  K.  G.  Adiyogi  and  R.  G.  Adiyogi,  eds.  Peralam  Kenoth.  Kerala. 
India. 

Olson.  J.  H.,  X.  Xiang,  T.  Ziegert,  A.  Kittelson,  A.  Rawls,  A.  L.  Biener, 
and  I).  E.  Chandler.  2001.  Allurin.  a  21-kDa  sperm  chemoattractant 
from  Xeimpits  egg  jelly,  is  related  to  mammalian  sperm-binding  pro- 
teins. Prm:  Nail.  Acad.  Sci.  USA  98:  11.205-11.210. 

Ward,  G.  E.,  C.  J.  Brokaw,  D.  L.  Garbers,  and  V.  D.  Vacquier.  1985. 
Chemotaxis  of  Arbacia  pimctulata  spermatozoa  to  resact,  a  peptide 
from  the  egg  jelly  layer.  ./.  Cell  Biol.  101:  2324-2329. 

Yoshida,  M.,  K.  Inaba,  and  M.  Morisawa.  1993.  Sperm  chemotaxis 
during  the  process  of  fertilization  in  the  ascidians  Cinna  M/w'vmv  and 
Ciomi  intcslinalis.  Dev.  Biol.  157:  497-506. 

Yoshida,  M.,  M.  Murata.  K.  Inaba.  and  M.  Morisawa.  2002.  A 
chemoattractant  for  ascidian  spermatozoa  is  a  sulfated  steroid.  Prm: 
Nat/.  Acad.  Sci.  USA  99:  14.831-14.836. 

Yoshida,  M.,  M.  Ishikawa.  H.  Izumi,  R.  De  Santis,  and  M.  Morisawa. 
2003.  Store-operated  calcium  channel  regulates  the  chemotactic  be- 
havior of  ascidian  sperm.  Prm:  Natl.  Acad.  Sci.  USA  100:  149-154. 


Reference:  Bio/.  Bull.  206:  103-1 12.  (April  2004) 
©  2004  Marine  Biological  Laboratory 


Interaction  Between  Photoperiod  and  an  Endogenous 

Seasonal  Factor  in  Influencing  the  Diel  Locomotor 

Activity  of  the  Benthic  Polychaete  Nereis  virens  Sars 


KIM  S.  LAST*  AND  PETER  J.  W.  OLIVE 

School  of  Marine  Sciences  and  Technology,  Ridley  Building,  University  of  Newcastle  upon  Tyne,  NE1  7RU, 

United  Kingdom 


Abstract.  The  locomotor  activity  of  Nereis  virens  Sars 
associated  with  food  prospecting  was  investigated  in  re- 
sponse to  photoperiod  and  season  using  an  actograph.  Ex- 
perimental animals  which  had  been  reared  under  natural 
photoperiods  were  exposed  to  two  constant  photoperiodic 
treatments,  LD  16:8  and  LD  8:16,  in  both  the  autumn  and 
winter  and  in  the  absence  of  tidal  entrainment.  Autocorre- 
lation analysis  of  rhythmicity  showed  that  during  the  au- 
tumn, animals  under  the  LD  16:8  photoperiod  displayed  a 
strong  nocturnal  rhythm  of  activity,  whereas  animals  under 
the  LD  8:16  photoperiod  showed  only  a  weak  nocturnal 
activity  rhythm.  This  is  believed  to  represent  an  autumn 
feeding  cessation  that  is  triggered  when  the  animals  pass 
through  a  critical  photoperiod  LD^,,  <12:>12.  Later  in  the 
winter,  however,  animals  exposed  to  both  photoperiodic 
treatments  showed  strong  rhythms  of  foraging  activity  irre- 
spective of  the  imposed  photoperiod.  It  is  suggested  that  the 
autumn  cessation  may  maximize  the  fitness  of  N.  virens,  a 
spring-breeding  semelparous  organism,  by  reducing  risk 
during  gamete  maturation,  while  spontaneous  resurgence  of 
activity  after  the  winter  solstice  permits  animals  that  are  not 
physiologically  competent  to  spawn  to  accrue  further  met- 
abolic reserves.  This  response  is  believed  to  be  initiated  by 
a  seasonal  (possibly  circannuul)  endogenous  oscillator  or 
interval  timer. 

Introduction 

Nereis  virens  Sars,  one  of  the  largest  marine  annelids,  has 
proven  to  be  an  interesting  model  for  studies  of  semelparous 


Received  23  September  2003;  accepted  25  February  2004. 
*  To  whom  correspondence  should  be   addressed.   E-mail:   k.s.last@ 
ncl.ac.uk 


life  histories  with  mixed  age  at  maturity  (Olive  et  al.,  1997, 
2000,  2001 ).  While  age  at  maturity  varies  between  1  and  7 
or  more  years,  any  one  worm  can  breed  only  once,  where- 
upon spawning  is  followed  by  death.  A  key  transition  in  this 
life  history  occurs  during  the  autumn  preceding  eventual 
breeding  when  the  final  stages  of  gametogenesis  are  initi- 
ated, culminating  in  individuals  becoming  gravid  and 
spawning  during  the  following  spring.  The  profound  influ- 
ence of  the  photoperiod  on  the  behavior  and  physiology  of 
N.  virens  has  already  been  demonstrated.  Transition  through 
the  critical  photoperiod  (LDcril  <12:>12)  at  the  end  of 
September  (Last  et  al..  1999)  initiates  sexual  maturation  and 
gamete  development,  which  may  culminate  in  sexual  repro- 
duction and  death  in  any  particular  year  (Olive  et  al.,  1997). 
When  semiquantitative  methods  were  used  to  determine  the 
prospecting  behavior  of  this  polychaete.  it  was  shown  (Last 
and  Olive.  1999)  that  the  frequency  at  which  animals 
emerged  from  their  burrows  in  the  autumn  was  much  higher 
under  a  photoperiod  of  LD  (light/dark)  16:8  than  under  LD 
8:16.  In  a  potentially  long-lived  but  strictly  semelparous 
organism  such  as  N.  virens.  there  is  strong  selection  for  the 
avoidance  of  risk  during  the  final  stages  of  sexual  matura- 
tion when  accumulated  reserves  are  being  converted  to 
gametogenic  tissues  (Olive  et  al..  2001).  It  is  reasonable, 
therefore,  to  interpret  the  level  of  foraging  activity  as  indi- 
cating the  onset  of  a  physiological  state,  responsive  to 
relative  daylength,  during  which  sexual  maturation  occurs. 
Observations  made  during  the  late  spring  and  summer, 
however  (Last  and  Olive,  1999),  showed  that  the  differences 
in  foraging  activity  between  LD  16:8  and  LD  8:16  were  not 
as  marked,  but  were  still  significantly  different.  It  was 
therefore  suggested  that  a  covert  temporal  rhythm  must 
underlie  the  overt  activity  of  emergence  in  N.  virens.  and 
that  the  emergent  patterns  also  involve  expression  of  a 


103 


104 


K.  S.  LAST  AND  P.  J.  W.  OLIVE 


response  to  a  seasonal  (or  circannual)  clock,  since  exposure 
to  a  constant  LD  8:16  photoperiod  does  not  induce  the  same 
physiological  response  at  all  times  of  the  year. 

Photoperiodism  in  marine  animals  is  less  intensively 
studied  than  in  terrestrial  organisms,  but  "photoperiod-like" 
phenomena  have  been  documented  in  several  marine  spe- 
cies, including  the  echinoderm  Pieaster  ochrucens  (Pearse 
and  Eernisse,  1982),  the  copepod  Labidoceni  cwstmi  (Mar- 
cus. 1986),  and  the  polychaetes  Neanihes  limnicola  (Fong 
and  Pearce,  1992a,  b)  and  Harmothoe  imbicata  (Garwood 
and  Olive,  1982).  The  difference  between  the  environmental 
and  the  evolutionary  history  in  marine  organisms  requires 
that  these  processes  be  investigated  to  understand  environ- 
mental signal  transduction  in  the  control  of  life-history 
events  and  to  determine  whether  these  observations  are 
likely  to  be  the  consequence  of  a  common  clock  mecha- 
nism. Confirmation  that  they  are  such  a  consequence  would 
have  important  implications  for  our  understanding  of  the 
evolution  of  clock-based  processes. 

To  test  the  suggestion  that  an  endogenous  long-term 
rhythm  moderates  responses  to  fixed  photoperiodic  inputs  in 
N.  virens,  we  used  an  actographic  procedure  (Last,  2003)  to 
monitor  its  emergence  (foraging)  behavior  and  examined 
the  spontaneous  diel  activity  patterns  of  individual  animals 
maintained  under  fixed  LD  cycles  for  several  months. 

Materials  and  Methods 

Two  experiments  were  conducted  using  the  polychaete 
Nereis  virens.  Short-term  assays  of  activity  were  earned  out 
in  the  autumn  and  winter  to  assess  the  strength  of  diel 
"out-of-burrow"  activity  both  within  and  between  seasons 
under  rectilinear  photoperiods  (that  is,  light  and  dark  peri- 
ods without  simulated  dawn  and  dusk).  Concurrently,  a 
long-term  experiment  was  used  to  determine  any  spontane- 
ous changes  in  activity  under  constant  rectilinear  photo- 
periods  with  time. 

Two  time  periods  were  used  for  the  short-term  assay:  six 
days  in  September  in  the  autumn  of  1998  (A98)  and  six  days 
in  February  in  the  winter  of  1999  (W99).  Both  A98  and 
W99  animals  had  been  born  from  the  same  broodstock  ( 16 
March  1998),  and  as  a  consequence,  the  experimental  ani- 
mals for  W99  were  5  months  older  than  those  used  for  A98. 
To  prevent  any  size-  or  maturation-related  bias  in  feeding 
rates,  all  animals  chosen  were  of  about  the  same  weight, 
2.5  ±  0.1  g.  with  all  coelomic  oocytes  having  a  diameter 
<120  /am.  All  a.iimals  ( //  --  16)  were  collected  from  a 
commercial  supplier  (Seabait  Ltd.)  a  week  prior  to  the 
experiments,  whici'  ''.ok  place  under  controlled  conditions 
in  (he  laboratory.  S:,  !nrth.  animals  had  been  maintained 
outside  under  natural  pholoperiods.  so  the  natural  photo- 
period  at  the  time  of  colkrtion  was  LD  13:1  I  tor  A98  and 
LD  11:13  for  W99.  Aftei  ace  1 1 mat i /at ion,  animals  were 
introduced  into  (he  allographs  (see  below)  and  maintained 


under  one  of  two  photoperiods,  LD  16:8  or  LD  8:16,  that 
approximated  the  photoperiodic  extremes  between  midsum- 
mer and  midwinter  at  a  latitude  of  55°  north  (where  the 
animals  were  collected). 

Data  obtained  from  the  actographic  recording  were  ana- 
lyzed for  two  factors:  (1)  variability  in  the  diel  activity  of 
individuals  both  between  photoperiodic  treatments  and  sea- 
sons, and  (2)  overall  changes  in  "strength"  of  rhythm. 
Variability  in  diel  activity  was  visually  represented  using 
actograms,  while  the  strength  of  rhythm  was  characterized 
with  autocorrelation  analysis  (Dowse  and  Ringo,  1989; 
Palmer  et  ul..  1994:  Dutilleul,  1995).  This  statistic  provides 
a  measure  of  the  strength  to  the  rhythm  that  is  not  affected 
by  the  overall  level  of  activity:  the  less  noisy  the  data 
between  cycles  and  the  higher  the  signal,  the  stronger  the 
rhythm.  Since  the  autocorrelation  output  is  normally  distrib- 
uted around  the  lag  time  that  most  closely  matches  the 
period  of  that  particular  rhythm,  robust  parametric  statistics 
can  be  applied. 

The  concurrent  long-term  experiment  was  carried  out  for 
9  months  under  constant  LD  16:8  and  LD  8:16  photoperi- 
ods, using  animals  from  the  same  broodstock  that  were  born 
naturally  at  Seabait  Ltd.  on  16  March  1998  and  reared 
continuously  outside  under  natural  photoperiods  until  the 
start  of  these  investigations.  As  with  experiments  A98  and 
W99,  the  animals  chosen  had  about  the  same  weight  (2.5  ± 
0. 1  g)  and  sexual  maturity  (oocyte  diameter  <120  /j.m).  All 
stock  animals  (n  -•  100)  for  this  experiment  were  main- 
tained continuously  under  photoperiods  of  LD  16:8  or  LD 
8:16.  Such  continuous  rectilinear  photoperiods  have  previ- 
ously been  used  to  detect  circannual  rhythms  (Randall  et  al.. 
1998;  Nisimura  and  Numata.  2001)  without  the  possibly 
detrimental  effects  of  inducing  a  free-running  state  by  using 
continuous  light  or  darkness.  Each  month  between  Septem- 
ber 1998  and  June  1999,  four  animals  were  selected  at 
random  from  stock  aquaria  in  the  laboratory  and  placed  into 
the  artificial  burrows  of  the  aetograph.  Their  activity  was 
then  recorded  for  6  to  7  days  under  the  two  photoperiodic 
treatments,  LD  16:8  and  LD  8:16.  At  other  times,  the 
animals  were  maintained  under  the  respective  photoperiodic 
treatments  LD  16:8  and  LD  8:16  in  stock  aquaria.  Hourly 
aetograph  data  were  summed  into  48-h  epochs  and  parti- 
tioned into  mean  monthly  actograms.  The  mean  data  points 
were  plotted  against  maximum  overall  activity  that  normal- 
ized the  amplitude  between  treatments  and  made  direct 
comparisons  possible. 

To  prevent  transient  behavioral  activity  for  both  short 
(A98  and  W99)  and  long-term  assays,  animals  were  always 
aeclimati/ed  for  7  days  under  their  new  photoregimes. 

The  aetograph  consisted  of  two  aquaria  housed  in  light- 
tight  photoperiodicalh  controlled  chambers.  Artificial  bur- 
rows consisting  of  lengths  of  PVC  tubing  were  inserted 
through  the  bottoms  of  these  experimental  aquaria  and 
connected  lo  infra-red  optocouplers  that  were  broken  as 


SEASONAL  RHYTHMS  IN  N.    VIKENS  SARS 


105 


soon  as  any  animal  emerged.  Out-of-burrow  activity  for  all 
animals  was  monitored  using  a  data  logger.  A  complete 
description  of  the  actographic  procedures  has  been  pub- 
lished in  Last  (2003).  The  aquaria  were  supplied  with  re- 
circulating  seawater,  salinity  34  to  36(4f.  that  had  been 
biologically  trickle-filtered  and  sterilized  with  UV  light; 
temperatures  in  the  aquaria  were  maintained  constant  at 
=  16  °C.  Every  2  days  during  the  middle  of  the  photophase 
(the  light  portion  of  the  cycle)  the  experimental  animals 
were  fed  coarse  trout  pellets  to  and  above  the  maximum  that 
they  would  consume. 

Results 

Analysis  of  locomotor  activity  in  N.  virens:  Autumn  {A98) 

Actograms.  The  mean  hourly  activity  (beam  breaks)  of  all 
animals  over  7  days  in  the  autumn  when  maintained  under 
LD  16:8  and  LD  8:16  photoperiods  is  shown  in  Figure  1. 
Note  that  these  animals  are  from  natural  photoperiods  of  LD 
13:11.  The  main  onset  of  activity  under  both  treatments 
occurred  at  0000  (midnight)  GMT  immediately  after  the 
lights-off  signal.  All  activity  was  much  reduced  during  the 
photophase.  Thus  the  type  of  activity  under  both  treatments 
can  be  described  as  a  nocturnal  diel  pattern  of  foraging 
behavior.  Under  LD  16:8  (Fig.  la),  activity  was  consistently 
high  for  each  successive  scotophase  (the  dark  portion  of  the 
cycle)  but  with  substantial  within-treatment  variability  be- 
tween individuals,  as  shown  by  the  standard  deviation  bars. 
Under  LD  8:16.  however  (Fig.  Ib).  the  distinction  between 
onset  and  cessation  of  activity  was  less  marked  except  for 
days  1  and  2.  All  animals  were  similarly  inactive  except 
during  the  first  scotophase,  which  showed  raised  activity 
levels  comparable  with  those  animals  under  LD  16:8.  The 
mean  number  of  emergence  events  for  animals  under  LD 
16:8  was  significantly  greater  (Student's  t  test:  t  =  3.23. 
P  <  0.05)  for  each  consecutive  24-h  period  than  for 
animals  under  LD  8:16. 

Strength-of-rhythm  analysis  of  activity  data.  Autocorre- 
lation analysis  showed  that  animals  maintained  under  LD 
8:16  in  the  autumn  have  a  significantly  weaker  rhythm  of 
activity  than  those  under  LD  16:8  (t  test:  t  =  2.54.  P  < 
0.05).  This  demonstrates  that  strength  of  rhythm  in  the 
autumn  is  dependent  on  the  imposed  photoperiodic  treat- 
ment. 

Analvsis  of  locomotor  activity  ofN.  virens:  Winter  (W99) 

Actograms.  The  mean  hourly  activity  (beam  breaks)  of  all 
animals  over  6  days  in  the  winter  when  maintained  under 
LD  16:8  and  LD  8:16  photoperiods  is  shown  in  Figure  2. 
Note  that  these  animals  are  from  natural  photoperiods  of  LD 
11:13.  Under  both  photoperiods,  activity  was  consistently 
high  for  each  successive  scotophase  despite  the  relatively 
high  within-treatment  variability  between  individuals,  as 


shown  by  the  standard  deviation  bars.  There  was  no  signif- 
icant difference  (/  test:  /  =  2.09,  P  >  0.05)  in  the  number 
of  emergence  events  for  animals  under  LD  16:8  and  animals 
under  LD  8:16  for  each  consecutive  24-h  period.  This  is  in 
striking  contrast  to  the  results  recorded  5  months  earlier 
under  the  same  photoperiodic  treatments. 

Strength-of-rhvthm  analysis  of  activity-  data.  The  strength 
of  the  activity  rhythm  of  animals  maintained  under  LD  1 6:8 
was  not  significantly  different  (t  test:  t  =  0.65,  P  >  0.1 ) 
from  those  maintained  under  LD  8:16.  This  demonstrates 
that  strength  of  rhythm  in  the  winter  is  independent  of  the 
imposed  photoperiodic  treatment. 

Comparative  analysis  in  strength  of  rhythm:  Autumn  and 
winter 

Autocorrelation  analysis  of  rhythm  strength  is  not  af- 
fected by  overall  amplitude  of  activity,  and  hence  a  com- 
parative analysis  of  activity  between  treatments  (LD  16:8 
and  LD  8:16)  and  between  seasons  (A98  and  W99)  was 
possible  even  though  overall  activity  in  A98  was  higher 
than  in  W99.  The  strength  of  rhythm  of  animals  maintained 
under  LD  16:8  in  the  autumn  was  significantly  (t  test:  /  = 
2.54.  P  <  0.05)  stronger  than  that  of  animals  under  LD 
8:16  at  this  time.  No  significant  difference  (t  test:  t  =  0.27, 
P  >  0.1)  was  observed  in  strength  of  rhythm  in  animals 
maintained  under  a  photoperiod  of  LD  16:8  in  the  autumn 
compared  to  animals  maintained  under  the  same  photo- 
period  in  the  winter.  Similarly,  no  significant  difference  (t 
test:  t  --  0.65,  P  >  0.1)  was  observed  in  strength  of 
rhythm  in  animals  maintained  under  LD  16:8  or  LD  8:16 
photoperiods  in  the  winter.  Finally  the  strength  of  rhythm  of 
animals  maintained  under  the  LD  8:16  photoperiod  in  the 
winter  was  significantly  (t  test:  t  =--  3.29.  P  <  0.01) 
stronger  than  that  of  animals  under  the  LD  8: 16  photoperiod 
in  the  autumn.  In  the  autumn,  the  most  noticeable  between- 
treatment  variation  was  the  much  reduced  overall  activity 
and  strength  of  rhythm  under  LD  8:16  compared  to  LD 
16:8.  In  the  winter,  no  such  differences  in  strength  were 
observed  since  the  strength  of  rhythm  was  high  in  all 
animals  irrespective  of  photoperiod. 

Analysis  of  long-term  locomotor  activity  o/'N.  virens 

The  results  from  each  experimental  treatment  (LD  16:8 
and  LD  8:16)  were  pooled  to  plot  a  three-dimensional  (3D) 
topographical  graph  of  activity  (j-axis)  over  time  (.Y-axis) 
and  month  (secondary  .Y-axis)  (Fig.  3a,  b).  Dashed  rectan- 
gles beneath  the  .Y-axis  represent  the  times  of  the  imposed 
scotophase.  The  surface  topography  represents  the  mean 
hourly  activity  of  four  animals  over  the  duration  of  6  to  8 
days  every  month  for  9  months.  (Note:  these  results  do  not 
include  data  from  the  short-term  A98  and  W99  experi- 
ments). 

Figure  3a  shows  the  pattern  of  locomotor  activity  under 


106 


K.  S.  LAST  AND  P.  J.  W.  OLIVE 


3    300 


ooooooooooooooooooooo 
ooooooooooooooooooooo 


T-     r~     oo     m     T-     r*- 

"-  T-  (N  O  T-  T- 


co   ID 

CM   O 


'-CSIO'-'- 


Time(G.M  T.) 


ooooooooooooooooooooooo 
ooooooooooooooooooooooo 


Time  (G.M.T.; 


Kigure  1.  The  mean  beam  breaks/hour  (+SD)  representative  of  foraging  excursions  under  different 
photoperiods  in  the  autumn  (A4X)  for  Nereix  vireiia.  where  the  black  rectangles  represent  times  of  artificial 
scotophase.  (a)  LD  IftiX.  n  =  4;  (h)  LD  S:I6,  n  =4. 


LD  16:S  over  the  duration  ot  the  experiment.  Most  of  the 
activity  was  restricu-.l  to  the  scotophase.  except  transiently 
in  September  and  March,  when  late  photophase  activity  was 
also  observed.  Little  dillm-nce  was  seen  between  mean 
activities  over  each  successive  4S-h  period  for  the  duration 


of  9  months.  Activity  was  typically  initiated  around  the  time 
of  the  lights-off  signal  (steep  topographical  relief)  and  con- 
tinued to  be  high  throughout  all  scotophases. 

Figure  3b  shows  the  pattern  of  locomotor  activity  under 
LD  8:16.  Between  September  and  December  there  was  no 


SEASONAL  RHYTHMS   IN  N.    VIKENS  SARS 


107 


3  300 


ooooooooooooooooooooo 
ooooooooooooooooooooo 


CO 
CM 


O        «-        T- 


CO        IT)        i- 
CM        O        i- 


o  o 

o  o 

r^  ro 

*-  CM 


Time(G.M.T) 


Time  (G.M.T.; 


Kigure  2.  The  mean  beam  breaks/hour  (+SD|  representative  of  foraging  excursions  under  different 
photoperiods  in  the  winter  (W99|  for  Nereis  virens,  where  the  black  rectangles  represent  times  of  artificial 
scotophase.  (a)  LD  16:8.  n  =  4;  <h)  LD  S:I6,  n  =  4. 


activity  in  either  the  photophase  or  the  scotophase.  Noctur- 
nal activity  increased  dramatically  after  December,  and  then 
continued  until  termination  of  the  experiment  in  June.  This 
elevated  activity  occurred  spontaneously  and  independently 
of  any  environmental  signal.  The  major  peak  of  activity  was 
generally  seen  directly  after  lights-off,  with  raised  activity 


during  the  rest  of  the  scotophase.  Activity  during  the  pho- 
tophase was  low.  A  perturbation  was  observed  in  March, 
when  activity  dropped  significantly  for  the  duration  of  the 
month.  This  is  represented  by  the  trough  running  the  length 
of  the  graph  from  left  to  right. 

The  results  from  the  topographical  data  for  LD  16:8  and 


108 


K.  S.  LAST  AND  P.  J.  W.  OLIVE 


a 


Figure  3.  Three-dimensional  plot  showing  the  topography  of  mean  monthly  activity  (September  to  June)  in 
Nereis  vireits  under  different  static  photopenods.  Dashed  rectangles  beneath  the  v-a\is  represent  times  of  the 
scotophase.  Data  points  constituting  surface  topography  number  about  7(100  la)  II)  lo:X.  /;  =  4:  Nearly  all 
activity  is  confined  to  the  scotophase  excepi  lor  perturbations  in  September.  October,  and  March,  (b)  LD  8:16. 
n  =  4:  Note  the  cessation  of  activity  between  September  and  the  middle  of  December.  At  the  beginning  of 
January,  a  spontaneous  resurgence  of  activity  during  the  scolophase  occurs,  which  is  continuous  for  the  rest  of 
the  experiment  except  for  a  decline  in  activity  in  March. 


LD  8:16  are  summari/ed  schematically  in  relation  to  the 
natural  photoperiod  in  Figure  4.  At  the  start  of  the  experi- 
ment in  September,  the  natural  photoperiod  was  LD  13:1  |. 


All  animals  placed  under  the  LD  16:8  photoperiod  (Fig.  4a) 
showed  strong,  nocturnal  activity  that  continued  until 
March,  when  the  natural  photoperiod  was  once  again  LD 


SEASONAL  RHYTHMS   IN  N.    VIRENS  SARS 


109 


High  activity 


uuu  im 


1998 


Date  (day/month) 


1999 


Figure  4.  Schematic  summaries  of  the  results  for  the  static  rectilinear 
9-month  experiment  under  LD  16:8  (a)  and  LD  8:16  (h).  Ambient  day 
length  (sunrise  to  sunset)  is  shown  over  time  at  latitude  55°  N,  giving  the 
temporal  position  of  the  rectilinear  photoperiodic  treatments  and  type  of 
activity  in  relation  to  the  ambient  photoperiods  outside  the  laboratory. 
Solid  arrows  indicate  where  activity  in  Nereis  \'irens  is  high;  dotted  arrows 
indicate  where  activity  is  low. 


12:12.  At  this  time,  additional  activity  was  noted  during  the 
later  part  of  the  photophase.  After  March,  activity  was  once 
again  restricted  solely  to  the  scotophase.  Animals  placed 
under  the  LD  8:16  photoperiod,  however,  displayed  a  quite 
different  activity  pattern  (Fig.  4b).  In  these  animals,  all 
activity  was  relatively  low  for  3  months,  during  the  time 
when  natural  photophases  are  diminishing  in  the  natural 
habitat  (LD  <12:>12).  By  the  middle  of  December,  the 
time  when  the  natural  scotophase  is  at  its  longest  at  this 
latitude  ( 17  h),  a  spontaneous  recovery  of  activity  during  the 
scotophase  was  observed.  This  pattern  of  elevated  nocturnal 
activity  continued  in  the  laboratory  at  a  time  when  the 
nights  in  the  natural  environment  were  gradually  shorten- 


ing. At  the  spring  equinox  in  March,  when  natural  photo- 
periods  were  once  again  LD  12: 12.  overall  activity  dropped 
substantially.  From  April  to  June,  however,  activity  was 
once  again  elevated. 

Discussion 

The  results  presented  here  demonstrate  that  the  pattern  of 
locomotor  activity  expressed  by  Nereis  virens  is  influenced 
by  both  the  photoperiod  to  which  the  animals  are  subjected 
and  the  time  of  year  in  which  the  behavioral  assay  is 
conducted.  Photoperiod  and  time  of  year  appear  to  interact 
and  modulate  overall  activity  patterns,  giving  rise  to  vari- 
ability in  the  daily  nocturnal  activity  patterns  and  in  the 
overall  strength  of  the  rhythm  associated  with  foraging 
activity. 

Our  results  also  show  that  the  activity  of  this  polychaete 
is  predominantly  nocturnal  under  all  photoperiods,  irrespec- 
tive of  season.  The  photophase  suppressed  activity  in  ani- 
mals under  both  photoperiodic  treatments,  and  we  believe 
that  spurious  beam  breaks  during  the  photophase  constitute 
primarily  "within-burrow"  rather  than  "out-of-burrow"  ac- 
(ivity  (Last,  2003).  We  hypothesize  that  the  conserved  na- 
ture of  this  nocturnal  response  reflects  a  strong  selective 
advantage  as  a  predator-avoidance  mechanism,  since  feed- 
ing excursions  for  N.  virens  are  associated  with  predation 
risk  from  shorebirds  and  pleuronectenoid  fish,  which  are  all 
well-known  diurnal,  visual  feeders  (Thijssen  et  til.,  1974: 
Carter  a  nl.,  1991;  Wilson,  1991 ).  and  such  risk  is  reduced 
under  cover  of  darkness. 

ActirilY  in  the  autumn 

Under  the  LD  16:8  photoperiod  in  the  autumn,  the  acto- 
gram  showed  a  high  level  of  nocturnal  activity  (Fig.  la), 
which  is  synonymous  with  a  high  feeding  rate  (Last.  2003). 
In  contrast,  those  animals  under  LD  8:16  displayed  rela- 
tively reduced  overall  activity  (Fig.  Ib)  signifying  a  low 
feeding  rate.  These  findings  are  similar  to  those  of  Last  and 
Olive  (1999)  using  semiquantitative,  manual  methods  to 
assess  the  degree  of  foraging  activity  at  a  similar  time  of 
year. 

Photoperiodism  necessitates  the  presence  of  an  underly- 
ing endogenous  clock.  The  results  of  experiment  A98  sup- 
port the  presence  of  such  an  oscillator  in  N.  virens.  During 
the  first  scotophase,  animals  under  LD  8:16  ceased  activity 
at  between  1000  and  1  100  GMT  (Fig.  Ib).  10-11  h  after  the 
onset  of  activity.  This  was  surprising  since  the  lights-on 
signal  for  these  animals  was  at  1600  GMT,  and  inactivity 
was  thus  not  expected  for  a  further  7-8  h.  The  animals  used 
in  the  A98  experiment  would  have  been  experiencing  nat- 
ural photoregimes  of  LD  12:12.  suggesting  that  the  ob- 
served time  of  activity  cessation  was  due  to  the  entrainment 
of  past  photoperiodic  regimes.  We  hypothesize  that  the 
nocturnal  activity  cessation  under  LD  8:16  may  reflect  a 


K.  S.  LAST  AND  P.  J.  W.  OLIVE 


proactive  response  to  the  anticipated  time  of  sunrise,  there- 
fore providing  indirect  evidence  for  an  endogenous  timer. 
This  response  is  surprising  since  these  animals  had  been 
acclimatized  to  this  photoperiod  for  a  week. 

Activity  in  subsequent  scotophases  rapidly  became  bi- 
modal  (Fig.  Ib)  with  activity  peaks  in  both  early  and  late 
scotophases.  Similar  daily  changes  in  activity  under  various 
photoperiods  have  been  recorded  for  the  locomotory  activ- 
ity patterns  of  the  onion  fly  Delia  antiqita  (Watari  and  Arai, 
1997).  When  this  diurnal  fly  was  subjected  to  photoperiods 
in  which  LD  >8:<16.  two  peaks  of  activity  were  always 
observed.  The  first  occurred  in  the  early  photophase  and  the 
second  in  the  late  photophase.  Under  short  photoperiods 
(where  LD  <8:>16),  the  activity  peaks  fused  as  the  "win- 
dow" of  diurnal  activity  became  smaller.  For  this  species,  it 
was  suggested  that  the  main,  late-photophase  activity  peak 
was  due  to  a  predictive  circudiun  oscillator,  whereas  the 
early-photophase  peak  was  solely  due  to  a  reactive  lights-on 
response.  For  the  experiment  described  here  using  N.  virens, 
the  response  is  interpreted  as  being  an  adjustment  to  the  new 
photoperiodic  cue,  or  Zeitgeber.  where  the  observed  inac- 
tivity at  the  expected  dawn  is  evidence  for  transient  behav- 
ior prior  to  attaining  a  steady  state  in  the  following  scoto- 
phases. 

Coupling  between  the  environmental  Zeitgeber  and  the 
endogenous  oscillator  occurs  through  entrainment  ( Aschoff. 
1965).  The  results  illustrate  that  the  process  of  entrainment 
of  an  activity  rhythm  in  the  autumn  experiment  depends  on 
the  photoperiodic  regime.  Subjecting  animals  to  a  photo- 
period  of  LD  8:16  considerably  reduced  the  strength  of  the 
rhythm.  We  believe  that  this  represents  the  initial  stages  of 
the  autumn  feeding  cessation,  which  is  triggered  when  the 
animals  pass  through  a  critical  photoperiod  LDcnl  <12:>12 
(Last  et  ai.  1999).  a  characteristic  physiological  response  at 
this  time  of  year.  This  photoperiodically  mediated  change  in 
activity  provides  an  interesting  result.  At  a  time  when  the 
nights  were  becoming  longer  and  hence,  for  these  nocturnal 
animals,  the  "potential"  for  nocturnal  feeding  was  gradually 
increasing,  all  activity  became  much  reduced.  It  has  been 
demonstrated  elsewhere  (Last  and  Olive,  1999)  that  under  a 
photoperiod  of  LD  8:16,  rates  of  somatic  growth,  segmen- 
tation, and  regeneration  all  become  much  reduced  and  en- 
ergy is  channeled  into  future  reproductive  growth  through 
chani'cs  in  \itellogenesis  or  vitellin  incorporation  into  the 
developing  oocytes  (Rees  and  Olive,  1999).  We  regard  this 
as  the  initiation  of  a  switch  from  somatic  to  reproductive 
growth.  The  photoperiodic  transition  therefore  appears  to 
trigger  a  change  in  physiological  stale  (McNamara  and 
Houston.  ll)9(,i  hum  one  in  which  essentially  somatic 
growth  processes  predominate  to  one  in  which  acquired 
resources  arc  rolepln  ed  to  sexual  development.  It  seems  at 
first  surprising  that  this  change  in  physiological  state  is  not 
restricted  hi  annuals  that  will  breed  in  the  following  spring, 
bul  occurs  in  all  individuals  regardless  of  aue  or  state  of 


maturity.  A  fitness  model  based  on  the  life  history  of  N. 
virens  suggests,  however,  that  when  either  or  both  net 
foraging  risk  and  net  foraging  gain  vary  seasonally,  a  sub- 
stantial fitness  benefit  accrues  when  all  members  of  a 
mixed-age  population  respond  to  environmental  signals  and 
reduce  foraging  at  times  of  maximum  risk  or  minimum 
benefit  (Olive  et  ai,  2000,  2001 ). 

Parallels  can  be  drawn  with  the  Salmonidae,  in  which 
temperature  and  daylength  alone  do  not  dictate  physiolog- 
ical changes.  Bimodality  in  wild  fish  will  separate  animals 
destined  to  smolt  in  the  following  spring  from  those  that  are 
not  (Thorpe  et  <//..  1980;  Skilbrei,  1991),  a  mechanism  that 
has  long  been  known  to  be  photoperiodically  induced  (Vil- 
larreal  et  ul..  1988).  In  S.  stilar,  the  advancement  of  smol- 
titication  through  photoperiodic  manipulation  has  been 
shown  (Duston  and  Saunders,  1995)  to  largely  reduce  the 
effects  of  bimodality  and  has  provided  evidence  that,  in  the 
salmonids  at  least,  a  coupling  between  threshold  length, 
photoperiod  (and  the  circadian  clock),  and  time  of  year  (the 
seasonal/circannual  clock)  determines  bimodal  segregation 
of  individuals  and  maturational  development. 

Activitv  in  the  winter 

The  seasonal  modulation  of  activity  in  N.  virens  was 
further  exemplified  when  the  same  experiments  were  re- 
peated in  the  winter.  Whereas  in  the  autumn  there  had  been 
a  nearly  complete  cessation  of  foraging  activity  under  LD 
8:16  (Figs.  Ib  and  3b).  by  the  winter  the  amplitude  of 
activity  under  LD  8:16  (Fig.  2b)  had  dramatically  increased 
and  was  high  compared  to  activity  in  the  autumn  or  under 
LD  16:8  (Fig.  2a).  In  addition,  the  results  of  autocorrelation 
analysis  showed  no  significant  between-treatment  differ- 
ence in  mean  strength  of  rhythm  between  winter  LD  8:16 
and  LD  16:8.  We  postulate  that,  for  animals  that  have  not 
reached  some  critical  state  of  sexual  maturity,  the  optimum 
strategy  must  change  as  the  optimum  time  for  breeding 
approaches.  In  these  animals,  renewed  foraging  increases 
the  probability  that  sufficient  energy  reserves  will  be  ac- 
crued for  reproduction  one  year  later.  Since  out-of-burrow 
foraging  by  N.  virens  is  inevitably  associated  with  predation 
risk,  increased  nocturnal  activity  at  this  time  will  maximize 
exploitation  of  the  feeding  time  and  minimize  the  risk  of 
predation  from  diurnal  predators.  Animals  that  have  reached 
a  critical  state  of  maturity  become  susceptible  to  a  feedback 
response  from  the  maturing  gametes  (Porchet  and  Cardon, 
1976;  Golding  and  Yuwono.  1994).  This  seasonally  medi- 
ated change  in  activity  under  LD  8:16  occurred  indepen- 
dently of  photoperiodic  treatment,  which  is  suggestive  of  an 
endogenous  seasonal  (and  possibly  circannual)  rhythm  of 
activity  or  the  operation  of  some  long-term  interval  timer. 

Interestingly,  the  mean  peak  activity  during  the  lirst  two 
nights  occurred  around  midnight  (Fig.  2b).  which  cannot 
readily  be  explained  at  this  stage.  We  hypothesize  that,  as  in 


SEASONAL  RHYTHMS   IN  N.    V/RENS  SARS 


III 


the  A98  experiment  (Fig.  Ih).  activity  onset  may  have  been 
due  to  a  "memory"  of  past  photoperiodic  regimes.  The 
7-day  acclimatization  period  imposed  on  these  animals  un- 
der their  new  photoregime  may  not  have  been  long  enough 
to  prevent  transient  activity  before  a  new  steady  state  had 
been  reached.  The  observed  "snapshot"  of  activity  under  the 
autumn  and  winter  photoperiodic  treatments  may  be  influ- 
enced by  the  photoperiodic  history  of  the  animals.  In  view 
of  these  results,  a  long-term  assay  under  constant  photope- 
riods  was  deemed  the  only  suitable  method  for  establishing 
true  endogenous  behavior  without  transient  manifestations. 
Under  those  conditions,  any  spontaneous  changes  in  activity 
would  imply  the  effects  of  a  purely  endogenous,  rather  than 
exogenous,  response  to  an  innate  underlying  seasonal  oscil- 
lator or  interval  timer. 

Long-term  activity  patterns  in  N.  virens 

The  results  shown  in  Figure  3b  demonstrate  that  a  long- 
term  regulator  of  activity  does  indeed  exist  in  the  polychaete 
N.  virens.  This  endogenous  modulation  is  revealed  under  a 
constant  LD  8:16  photoperiod,  3  months  after  the  transition 
through  the  critical  photoperiod  LDcnI  <12:>12  previously 
described  by  Last  et  al.  ( 1999).  The  resurgence  of  activity 
under  this  photoperiod  was  spontaneous  and,  irrespective  of 
the  experimental  photoperiod,  occurred  around  the  time  of 
the  winter  solstice.  Subjecting  animals  to  a  photoperiod  of 
LD  16:8  will  result  in  the  negative  masking  (Aschoff,  1960) 
of  any  long-term  endogenous  oscillators. 

Proactive  anticipation  of  the  spring  equinox  has  been 
suggested  previously  for  other  nereid  polychaetes  (Olive 
and  Garwood.  1983;  Fong  and  Pearse,  1992a,  b),  and  the 
results  presented  here  provide  further  evidence  for  the  ex- 
pression of  an  overt  endogenous  seasonal  clock  in  the 
Nereidae.  Perturbations  in  the  activity  patterns  of  N.  virens 
were  observed  under  both  photoperiodic  treatments  in 
March.  Under  LD  16:8,  a  late  photophase  peak  was  ob- 
served prior  to  the  scotophase  (Figs.  3a  and  4a).  and  under 
LD  8:16  a  marked  drop  in  activity  was  observed  in  both  the 
photophase  and  the  scotophase  (Figs.  3b  and  4b).  These 
perturbations  occurred  when  the  animals  would,  under  nat- 
ural photoperiods,  pass  through  the  spring  critical  photo- 
period  (where  LDcrlt  >12:<12).  The  significance  of  these 
perturbations  is  not  yet  clear,  but  may  indicate  a  change  in 
the  sensitivity  of  the  endogenous  pacemaker  to  the  external 
photoperiod  around  the  time  of  the  spring  equinox. 

Seasonally  overt  changes  in  physiological  state  and  be- 
havior of  this  long-lived  polychaete  do  not  occur  solely  as  a 
direct  response  to  changes  in  proximate  factors  such  as 
temperature  and,  particularly,  daylength.  We  believe  that 
while  seasonally  changing  daylengths  will  actively  drive 
changes  in  physiological  state  through  photoperiodism  at 
certain  times  of  the  year,  at  other  times,  photoperiod  acts  as 
a  Zeitgeber  to  entrain  an  endogenous  seasonal  rhythm.  Such 


a  mechanism  has  also  been  implicated  in  another  marine 
invertebrate,  Pisaster  ochruceus.  In  this  sea  star,  gameto- 
genesis  can  be  shifted  by  maintaining  the  animals  on  a 
seasonally  changing  photoperiod  regime  out-of-phase  with 
ambient  photoperiods  (Pearse  el  al..  19X6).  Like  our  results, 
this  finding  is  suggestive  of  an  endogenous  annual  calendar. 
To  infer  that  these  results  are  evidence  for  a  circunnual 
rhythm  in  N.  virens  would  be  premature  since  the  observed 
response  could  have  also  been  caused  by  an  interval  timer 
measuring  a  time  period  of  approximately  90  days.  Work  is 
in  progress  to  examine  the  endogenous  modulation  of  ac- 
tivity patterns  over  the  duration  of  years  instead  of  months. 
We  provide  here  evidence  of  a  long-term  modulation  of 
activity  in  N.  virens  under  fixed  photoperiods.  This  mech- 
anism modulates  the  response  of  individuals  to  the  natural 
photoperiod  according  to  real  time  and  may  be  an  essential 
adaptive  component  of  the  photoperiodically  adjusted  sea- 
sonal cycle  of  growth  and  reproduction. 

Acknowledgments 

This  work  was  supported  by  the  award  of  a  NERC 
Industrial  Case  Studentship  to  K.S.L.  and  the  DEMA  the- 
matic award  GST/02/2164,  NERC/T/S/200/00273  tit 
P.J.W.O.  Current  funding  to  P.J.W.O.  is  from  the  NERC 
Environmental  Genomics  Programme  NERC/T/S/2001/ 
0273.  We  wish  to  acknowledge  the  additional  financial 
support  of  the  Industrial  Sponsors  Seabait  Ltd.,  Ashington 
Village,  Northumberland,  NE63  9NW,  for  the  supply  of  the 
experimental  material  as  well  as  for  allowing  us  to  use 
procedures  subject  to  patent.  Thanks  finally  to  the  construc- 
tive comments  of  the  anonymous  referees  and  C.  D.  Derby. 

Literature  Cited 

Asrhoff,  ,1.  1960.  Exogenous  and  endogenous  components  in  arcadian 
rhythms.  Cold  Sprint;  Harbor  S\mp.  25:  1  I-2X. 

Aschoff,  J.  1965.     Orcadian  rhythms  in  man.  Science  148:  1427-1432. 

Carter,  C.  G.,  D.  J.  Grove,  and  D.  M.  Carter.  1991.  Trophic  resource 
partitioning  between  two  coexisting  flatfish  species  off  the  north  coast 
of  Anglesey,  North  Wales.  Neth.  J.  Sen  Ke\.  23:  325-335. 

Dowse,  H.  B.,  and  J.  M.  Ringo.  1989.  The  search  for  hidden  period- 
icities in  biological  time-series  revisited.  J.  Theor.  Biol.  139:  487-515. 

I  >u , I, >u. ,).,  and  R.  L.  Saunders.  1995.  Advancing  smoking  to  autumn  in 
age  0+  Atlantic  salmon  by  photoperiod,  and  long-term  performance  in 
sea  water.  At/nudi/mrc  135:  295-309. 

Dniillc  nl,  P.  1995.  Rhythms  and  autocorrelation  analysis.  Biol.  R/nihni 
Rex.  26:  173-143. 

Fong,  P.  P.,  and  J.  S.  Pearse.  1992a.  Evidence  for  a  programmed 
circannual  life  cycle  modulated  by  increasing  daylengths  in  Nciintlic* 
Iniiiiiciilti  (Polychaeta:  Nereidae)  from  central  California.  Biol.  Hull. 
182:  289-297. 

Fong,  P.  P.,  and  J.  S.  Pearse.  1992h.  Photoperiodic  regulation  of 
parturition  in  the  selt  tertilising  viviparous  polychaete  Neiiinlii:\  lim- 
nictilti  from  central  California.  Mm:  Biol.  112:  81-89. 

Garwood,  P.  R.,  and  P.  J.  \V.  Olive.  1982.  The  influence  ol  phoiop,-i  HH] 
on  oocyte  growth  and  its  role  in  the  control  of  the  reproductive  cycle  ol 
ihe  polychaete  Harmothoe  iinhricutn  ([.).  Int.  ./.  Invertebi:  Rcpind.  5: 
161-165. 


112 


K.   S.   LAST  AND  P.  J.  W.  OLIVE 


(ioldim>.  I).  \V.,  and  K.  Yuwono.  1994.  Latent  capacities  for  gameto- 
genic  cycling  in  the  semelparous  invertebrate  Nereis.  Proc.  Natl.  Acad. 
Sci.  USA  91:  11777-11781. 

Last,  K.  S.  2003.  An  actograph  and  its  use  in  the  study  of  foraging 
behaviour  in  the  benthic  polychaete.  Nereis  virens  Sars.  J.  Exp.  Mar. 
Biol.  Ecoi  287:  237-24S. 

Last,  K.  S.,  and  P.  J.  W.  Olive.  1999.  Photoperiodic  control  of  growth 
and  segment  proliferation  by  Nereis  (Neantlies)  virens  Sars  in  relation 
to  real  time  and  state  of  maturity.  Mar.  Bid.  134:  191-199. 

Last,  K.  S.,  P.  J.  W.  Olive,  and  A.  Edwards.  1999.  An  actographic 
study  of  diel  activity  in  the  semelparous  polychaete  Nereis  (Neanthes) 
virens  Sars  in  relation  to  the  annual  cycle  of  growth.  Invertebr.  Reprod. 
Dev.  35:  141-145. 

Marcus,  N.  H.  1986.  Population  dynamics  of  marine  copepods:  the 
importance  of  photoperiodism.  Am.  Zool.  26:  469-477. 

McNamara,  J.  M.,  and  A.  I.  Houston.  1996.  State-dependent  lite- 
histories.  Nature  380:  215-221. 

Nisimura.  T.,  and  H.  Numata.  2001.  Endogenous  timing  mechanism 
controlling  the  circannual  pupation  rhythm  of  the  varied  carpet  beetle 
Anlhrenus  verbose  i.  J.  Comp.  Physiul.  A  187:  433-440. 

Olive,  P.  J.  VV.,  and  P.  R.  Garwood.  1983.  The  importance  of  long  term 
endogenous  rhythms  in  the  maintenance  of  reproductive  cycles  of 
marine  invertebrates — a  reappraisal.  Int.  J.  Invertebr.  Reprod.  6:  339- 
347. 

Olive,  P.  J.  W.,  J.  Fletcher.  S.  Rees,  and  G.  Desrosiers.  1997.  Inter- 
actions of  environmental  temperature  with  photoperiod  in  determining 
age  at  maturity  in  a  semelparous  polychaete  Nereis  (Neaitthes)  vircn* 
Sars.  J.  Therm.  Biol.  22:  489-497. 

Olive,  P.  J.  W.,  C.  Lewis,  and  V.  Beardall.  2000.  Fitness  components 
of  seasonal  reproduction:  an  analysis  using  Nereis  virens  as  a  lite 
history  model.  Oceanol.  Acta  23:  377-389. 

Olive,  P.  J.  W.,  C.  Lewis,  V.  Beardall,  K.  Last,  and  M.  G.  Bentley. 
2001.  Fitness  consequences  of  seasonal  reproduction:  experiments  on 
the  polychaete  Nereis  virens  Sars.  Pp.  321-341  in  Environment  unJ 
Animal  Development.  D.  Atkinson  and  M.  Thorndyke,  eds.  Bios  Sci- 
entific Publishers,  Oxford. 

Palmer,  J.  D.,  B.  G.  Williams,  and  H.  B.  Dowse.  1994.  The  statistical 
analysis  of  tidal  rhythms:  tests  of  the  relative  effectiveness  of  five 


methods  using  model  simulations  and  actual  data.  Mar.  Behav.  Pliysiol. 
24:  165-183. 

Pearse,  J.  S.,  and  D.  J.  Eernisse.  1982.  Photoperiodic  regulation  of 
gametogenesis  and  gonadal  growth  in  the  sea  star  Pisaster  ochraceus. 
Mar.  Biol.  67:  121-125. 

Pearse,  J.  S.,  D.  J.  Eernisse,  V.  B.  Pearse,  and  K.  A.  Beauchamp.  1986. 
Photoperiodic  regulation  of  gametogenesis  in  sea  stars,  with  evidence 
for  an  annual  calendar  independent  of  fixed  daylength.  Am.  Zool.  26: 
417-431. 

Porchet,  M.,  and  C.  Cardon.  1976.  The  inhibitory  feed-back  mecha- 
nism coming  from  oocyte  and  acting  on  brain  endocrine  activity  in 
Nereidae.  Gen.  Comp.  Endocrinol.  30:  378—390. 

Randall.  C.  F.,  N.  R.  Bromage,  J.  Duston,  and  J.  Symes.  1998.  Pho- 
toperiod induced  phase  shifts  of  the  endogenous  clock  controlling 
reproduction  in  the  rainbow  trout:  a  circannual  phase  response  curve.  J. 
Reprod.  Ft-rtil.  112:  399-405. 

Rees,  S.  W.,  and  P.  J.  W.  Olive.  1999.  Photoperiodic  changes  influence 
the  incorporation  of  vitellin  yolk  protein  by  oocytes  of  the  semelparous 
polychaete  Nereis  (Neanthes)  virens.  Comp.  Biochem.  Pliysiol.  A  123: 
213-220. 

Skilbrei,  O.  T.  1991.  Importance  of  threshold  length  and  photoperiod  for 
the  development  of  bimodal  length  frequency  distribution  in  Atlantic 
salmon  (Salmo  \alar).  Can.  J.  F'ixh.  Ai/iiut.  Sci.  48:  2163-2172. 

Thijssen,  R.,  A.  J.  Lever,  and  J.  Lever.  1974.  Food  composition  and 
feeding  periodicity  of  0-group  plaice  (Pleuronectcs  platessa)  in  the 
tidal  area  of  a  sandy  beach.  Neth.  J.  Sea  Res.  8:  369-377 

Thorpe,  J.  E.,  C.  Talbot,  and  C.  A.  Villarreal.  1980.  Bimodality  in 
growth  and  smelting  in  Atlantic  salmon.  Salmo  salar  L.  Aquaculture 
28:  123-132. 

Villarreal,  C.  A.,  J.  E.  Thorpe,  and  M.  S.  Miles.  1988.  Influence  of 
photoperiod  on  growth  changes  in  juvenile  Atlantic  salmon.  Salmo 
salar  L.  J.  Fish  Biol.  33:  15-30. 

Watari,  V'.,  and  T.  Arai.  1997.  Effects  of  photoperiod  and  aging  on 
locomotor  activity  rhythms  in  the  onion  fly.  Delia  antif/iia.  J.  Insect 
Physiol.  43:  567-576. 

Wilson,  W.  H.  1991.  The  importance  of  epibenthic  predation  and  ice 
disturbance  in  a  Bay  of  Fundy  mudflat.  Ophelia  5:  507-514. 


Reference:  Biol.  Bull.  206:  1 13-120.  (April  2004) 
©  2004  Marine  Biological  Laboratory 


Adaptable  Defense:  A  Nudibranch  Mucus  Inhibits 
Nematocyst  Discharge  and  Changes  With  Prey  Type 

PAUL  G.  GREENWOOD*.  KYLE  GARRY,  APRIL  HUNTER,  AND  MIRANDA  JENNINGS 
Colby  College,  Department  of  Biology.  5732  Mayflower  Hill.  Ware  n'i  lie.  Maine  04901 


Abstract.  Nudibranchs  that  feed  on  cnidarians  must  de- 
fend themselves  from  the  prey's  nematocysts  or  risk  their 
own  injury  or  death.  While  a  nudibranch's  mucus  has  been 
thought  to  protect  the  animal  from  nematocyst  discharge,  an 
inhibition  of  discharge  by  nudibranch  mucus  has  never  been 
shown.  The  current  study  investigated  whether  mucus  from 
the  aeolid  nudibranch  Aeolidia  papillosa  would  inhibit 
nematocyst  discharge  from  four  species  of  sea  anemone 
prey.  Sea  anemone  tentacles  were  contacted  with  mucus- 
coated  gelatin  probes,  and  nematocyst  discharge  was  quan- 
tified and  compared  with  control  probes  of  gelatin  only. 
Mucus  from  A.  papillosa  inhibited  the  discharge  of  nema- 
tocysts from  sea  anemone  tentacles.  This  inhibition  was 
specifically  limited  to  the  anemone  species  on  which  the 
nudibranch  had  been  feeding.  When  the  prey  species  was 
changed,  the  mucus  changed  within  2  weeks  to  inhibit  the 
nematocyst  discharge  of  the  new  prey  species.  The  nudi- 
branchs  apparently  produce  the  inhibitory  mucus  rather  than 
simply  becoming  coated  in  anemone  mucus  during  feeding. 
Because  of  the  intimate  association  between  most  aeolid 
nudibranchs  and  their  prey,  an  adaptable  mucus  protection 
could  have  a  significant  impact  on  the  behavior,  distribu- 
tion, and  life  history  of  the  nudibranchs. 

Introduction 

All  predators  must  overcome  their  prey's  defenses  to 
feed.  In  the  case  of  nudibranchs  that  feed  on  cnidarians,  the 
predator  must  defend  itself  from  the  prey's  nematocysts  or 
risk  its  own  injury  or  death  (Harris,  1973;  Conklin  and 
Mariscal,  1977).  Nematocysts  from  non-prey  cnidarians  can 
kill  the  nudibranch  (Grosvenor,  1903);  even  the  prey  species 
can  be  dangerous  if  the  individual  is  large  enough  (Harris, 


Received  2  July  2002;  accepted  21  January  2004. 
*  To      whom      correspondence      should      he      addressed. 
pggreenw@colby.edu 


E-mail: 


1973.  1986;  Conklin  and  Mariscal.  1977).  Defenses  that 
might  protect  aeolids  from  nematocysts  include  behaviors 
that  limit  contact  of  the  nudibranch  with  the  prey  (Grosve- 
nor. 1903).  morphological  adaptations  such  as  ellipsoid 
vacuolate  cells  of  the  epithelium  (Graham.  1938;  Porter  and 
Rivera,  1980;  Martin  and  Walther.  2003)  or  a  cuticle  that 
lines  the  mouth  region  of  the  nudibranch  (Edmunds.  1966), 
and  copious  mucous  secretions  (Graham,  1938;  Russell, 
1942;  Edmunds,  1966). 

It  has  been  hypothesized  for  over  a  century  that  the 
nudibranch's  mucus  serves  as  a  protective  barrier  against 
nematocysts  (Boutan,  1898).  Grosvenor  (1903)  suggested 
that  there  might  be  some  acclimatization  to  nematocysts  as 
part  of  the  mucous  defense,  because  copious  mucus  was  not 
enough  to  protect  nudibranchs  from  different  cnidarian  spe- 
cies. However,  Salvini-Plawen  (1972)  hypothesized  that 
"hyper-viscous"  mucous  secretions  would  inhibit  nemato- 
cyst discharge  generally  and  that  it  would  be  unnecessary  to 
adapt  the  protective  nature  of  mucus  to  specific  prey.  Conk- 
lin and  Mariscal  (1977)  noted  that  the  aeolid  nudibranch 
Spurilla  neapolitana  was  apparently  stung  by  its  prey  anem- 
ones during  the  first  few  minutes  of  feeding  but  the  nudi- 
branchs' behavior  indicated  that  nematocyst  discharge  then 
ceased.  These  authors  hypothesized  that  aeolids  might  pro- 
duce or  acquire  (from  the  prey)  a  substance  that  prevented 
nematocyst  discharge.  Recently  Mauch  and  Elliott  (1997) 
found  that  mucus  from  the  aeolid  nudibranch  Aeolidia  pap- 
illosa caused  fewer  nematocysts  to  discharge  from  its  po- 
tential prey,  the  sea  anemone  Anthopleiira  elegantissima. 
than  mucus  from  other  gastropods  did.  Mauch  and  Elliott 
( 1997)  hypothesized  that  the  nudibranchs  might  adapt  their 
mucus  as  protection  from  their  cnidarian  prey,  but  the 
nudibranch  mucus  was  tested  on  only  one  species  of  cni- 
darian. 

While  a  few  nudibranchs  are  highly  specialized  and  feed 
exclusively  on  one  prey  species,  most  nudibranch  species 


114 


P.  G.  GREENWOOD  ET  AL 


can  feed  on  several  different  prey  species  (Thompson,  1976; 
Todd  el  ni,  2001).  Monophagous  species  might  have  de- 
fensive mucus  that  works  well  against  the  nematocysts  of  a 
single  prey  species,  but  the  more  generalist  feeders  need  an 
effective  defense  against  a  number  of  cnidarian  species 
(with  different  nematocyst  types).  Such  nudibranchs  might 
require  defensive  mucus  that  changes  properties  depending 
upon  which  prey  is  being  consumed. 

The  current  study  investigated  whether  mucus  from  the 
aeolid  nudibranch  Aeolidia  papiltoxa  inhibited  nematocyst 
discharge  from  different  sea  anemone  species,  and  whether 
the  inhibitory  nature  of  the  mucus  changed  when  the  prey 
species  was  changed.  Individuals  of  A.  papillosa  feed  al- 
most exclusively  on  sea  anemones  (Hall  and  Todd,  1986). 
In  its  New  England  subtidal  habitat.  A.  papillosa  is  fre- 
quently found  among  populations  of  the  sea  anemone 
Metridiiun  .senile,  but  is  also  found  associated  with  a  variety 
of  other  sea  anemone  species  (Harris,  1973;  Reidy,  1996). 
Individuals  of  A.  papillosa  have  been  induced  to  change 
prey  species  in  the  laboratory  (Hall  et  ai,  1982;  Hall  and 
Todd,  1984,  1986),  but  in  the  field  a  single  prey  species  may 
dominate  a  large  area.  Concentrated  prey  distribution  and 
low  nudibranch  mobility  means  that  individual  nudibranchs 
might  spend  most  of  their  lives  closely  associated  with  just 
one  prey  species  (Harris,  1973,  1987;  Todd,  1983).  Because 
of  this  intimate  association  between  A.  papillosa  and  its 
prey,  protection  from  the  prey's  nematocysts  has  a  signifi- 
cant impact  on  the  behavior,  distribution,  and  life  history  of 
the  nudibranch. 

We  used  mucus-coated  gelatin  probes  in  a  highly  repro- 
ducible method  (Watson  and  Hudson.  1994)  to  investigate 
the  effects  of  A.  pctpillosa  mucus  on  nematocyst  discharge. 
When  gelatin  probes  are  touched  to  sea  anemone  tentacles, 
nematocysts  that  discharge  into  the  gelatin  remain  attached 
to  the  probe  and  are  easily  counted  (Watson  and  Hessinger, 
1989;  Watson  ct  til..  1999).  In  this  study,  mucus-coated 
gelatin  probes  were  used  to  mimic  the  contact  of  a  nudi- 
branch to  the  sea  anemones.  We  also  probed  sea  anemones 
in  the  presence  of  N-acetylneuraminic  acid  (NAN A). 
NANA,  which  mimics  the  complex  molecules  containing 
N-acetylated  sugars  commonly  found  on  the  sea  anemones' 
normal  prey  (Thorington  and  Hessinger.  1988).  has  been 
found  ID  increase  the  sensitivity  of  sea  anemone  nemato- 
c\tes  in  mechanical  stimulation  (Thorington  and  Hessinger. 
1988.  1990.  1998;  Watson  and  Hessinger.  1994).  With 
NANA.  we  can  therefore  determine  whether  nudibranch 
mucus  actually  inhibits  nematocyst  discharge  or  simply 
provides  no  stimulus  for  discharge. 

Materials  and  Methods 

Aniiiiiil  collection  and  maintenance 

Individuals  of  the  nudibranch  Aeolidia  pupillnxii  and  the 
sea  anemone  Mciriilimn  senile  were  collected  from  a  float  - 


ing  commercial  fishing  dock  in  Portsmouth,  New  Hamp- 
shire. Individuals  of  A.  papillosa  and  the  sea  anemones 
Urticina  feliiui  and  Aiilnctinici  stella  were  collected  midway 
through  the  littoral  zone  on  bedrock  at  west  Quoddy  Head  in 
Lubec,  Maine  (courtesy  of  C.  Sisson).  Twelve  individuals 
of  A.  papillosa,  living  among  individuals  of  the  sea  anem- 
one Anthopleura  ele^antissima,  were  collected  from  the  low 
intertidal  zone  on  the  coast  of  California  (supplied  by  Pa- 
cific Biomarine  Supply,  Venice,  CA).  Individuals  of  A. 
ele^iintissiimi  were  collected  from  the  low  intertidal  zone  of 
San  Juan  Island.  Washington  (courtesy  of  D.  Duggins).  All 
animals  were  kept  in  refrigerated  aquaria  with  recirculating 
and  refiltered  seawater  (1 1  C,  319rr  salinity,  pH  8.2)  col- 
lected at  the  Darling  Laboratory,  University  of  Maine,  Wai- 
pole,  Maine.  Anemones  were  kept  in  separate  plastic  or 
glass  containers  within  the  aquaria,  and  the  nudibranchs 
were  placed  in  separate  acrylic  plastic  containers,  segre- 
gated according  to  the  sea  anemone  species  on  which  they 
were  feeding.  Sea  anemones  were  fed  frozen  brine  shrimp 
every  2  days,  and  the  nudibranchs  were  fed  sea  anemones 
ad  libidinn.  The  sea  anemones  that  were  used  as  prey  all  had 
pedal  disk  diameters  less  than  3  cm.  and  the  nudibranchs 
ranged  in  length  from  1  cm  to  7  cm.  Individuals  of  M.  senile 
were  held  for  no  more  than  2  months  before  being  replaced 
with  other  animals;  the  other  species  of  sea  anemones  were 
held  for  less  than  a  month. 

Control  probes,  mucus-coated  probes,  and  general 
probing  of  sea  anemone  tentacles 

We  used  gelatin  probes  to  quantify  nematocyst  discharge 
from  tentacles  of  sea  anemones.  Each  probe  was  made  by 
coating  one  end  of  a  6-cm  length  of  monofilament  fishing 
line  (Stren.  6-lb-test  or  17-lb-test)  with  25r/c  (weight/vol- 
ume) gelatin  in  E-pure  deionized  water  (modified  slightly 
from  Watson  and  Hudson,  1994).  Occasionally,  the  gelatin 
did  not  adhere  well  to  the  probe,  and  such  probes  were 
discarded.  The  gelatin  adhered  better  to  the  1 7-lb-test  line 
than  to  the  6-lb-test  line,  so  the  number  of  probes  discarded 
was  smaller  when  the  heavier  line  was  used,  as  it  indeed 
was.  in  later  experiments.  Probes  that  were  coated  with  only 
gelatin  served  as  controls. 

To  prepare  an  experimental  mucus-coated  probe,  a  nudi- 
branch was  removed  from  the  water  and  a  gelatin  probe  was 
gently  wiped  across  its  dorsal  surface  (from  anterior  to 
posterior)  four  times.  Three  mucus-coated  probes  were 
made  from  each  nudibranch.  Anemones  that  had  not  been 
fed  for  between  24  and  36  hs  were  placed  into  separate  glass 
dishes  that  contained  a  probing  solution  of  cither  filtered 
seawater  alone,  or  filtered  seawater  and  NANA.  Ten  min- 
utes after  the  anemones  were  placed  into  the  probing  solu- 
tion, each  dish  was  placed  under  an  Olympus  SC30  ste- 
reomicroscope.  and  probing  began  with  the  edge  ot  the 
probe  tip  being  lightly  touched  to  one  tentacle  about  5  mm 


SEA  SLUG   MUCUS   INHIBITS  NEMATOCYSTS 


115 


proximal  to  the  tentacle  tip.  Three  control  probes  and  three 
experimental  probes,  all  prepared  from  the  same  nudi- 
branch,  were  used  to  probe  each  anemone.  Used  probes 
were  fixed  in  2.5%  glutaraldehyde  in  filtered  seawater  for  at 
least  30  s  and  then  placed  into  3  drops  of  deionized  water  on 
a  microscope  slide.  Individual  nematocysts  that  had  dis- 
charged into  the  gelatin  were  counted,  using  an  Olympus 
CK2  inverted  phase  contrast  microscope  equipped  with  a 
40  X  objective  lens.  In  early  experiments  with  probes  made 
from  6-Ib-test  monofilament  line,  we  counted  nematocyst 
capsules  from  at  least  three  fields  of  view,  and  the  mean  was 
calculated  for  each  probe.  In  later  experiments,  when  we 
used  probes  made  from  17-lb-test  line,  the  nematocyst  cap- 
sules from  one  central  field  of  view  were  counted.  Using 
these  techniques,  between  75%  and  100%'  of  the  discharged 
nematocysts  on  each  probe  were  counted,  and  both  types  of 
probes  yielded  highly  reproducible  results. 

Does  a  midibrunch  's  mucus  inhibit  the  nematocyst 
discharge  from  the  tentacles  of  its  prey  species? 

Probes  were  coated  with  mucus  from  12  individuals  of 
Aeolidia  papillosa  of  mixed  sizes  that  had  been  feeding  on 
the  sea  anemone  Metridium  senile  and  with  mucus  from  6 
individuals  of  A.  papillosa  of  mixed  sizes  that  had  been 
feeding  on  the  sea  anemone  Urticina  felina.  These  mucus- 
coated  probes  were  then  used  to  probe  feeding  tentacles 
from  the  sea  anemones  M.  senile,  U.  felina,  and  Aiilactinia 
Stella.  In  each  experiment,  one  anemone  was  always  tested 
with  three  control  probes  and  then,  immediately  afterwards. 
with  three  experimental  (mucus-coated)  probes;  the  exper- 
imental probes  were  coated  with  mucus  from  an  individual 
nudibranch.  The  mean  number  of  discharged  nematocysts  in 
the  three  probes  was  used  to  calculate  a  grand  mean  of 
nematocyst  discharge  in  response  to  mucus  from  each  nudi- 
branch. These  grand  means  were  tested  for  normality  and 
equal  variances  and  then  analyzed  using  Student's  /  tests  (or 
the  Mann-Whitney  U  test  when  variances  were  unequal)  to 
compare  nematocyst  discharge  into  mucus-coated  probes 
with  discharge  into  control  probes  for  each  species.  To 
minimize  the  effects  of  captivity  on  nematocyst  discharge, 
each  species  of  anemone  was  tested  within  2  weeks  of  its 
collection. 

//"  the  prey  species  is  changed,  will  the  effect  of  the 
nudibranch  mucus  on  nematoc\st  discharge  also  change? 

Seven  specimens  of  A.  papillosa  were  collected  from 
several  New  England  localities  and  were  fed  U.  felina  for  16 
days  in  the  laboratory.  During  that  period,  mucus-coated 
probes  were  used  to  test  nematocyst  discharge  from  the 
tentacles  of  U.  felina  and  M.  senile.  The  nudibranchs'  prey 
was  then  switched  from  U.  felina  to  M.  senile  and.  over  a 
2-week  interval,  mucus-coated  probes  were  used  periodi- 
cally to  test  nematocyst  discharge  from  both  sea  anemone 


species.  Because  the  baseline  number  of  nematocysts  dif- 
fered between  the  two  sea  anemone  species,  these  data  were 
converted  to  relative  values,  where  a  relative  value  of  1.0 
represents  the  average  number  of  nematocysts  discharged 
into  control  probes.  Data  collected  from  mucus-coated 
probes  for  each  day  were  converted  to  an  average  relative 
discharge  based  on  controls  for  that  day  from  the  same 
anemones.  Results  from  tests  on  each  sea  anemone  species 
were  analyzed  by  ANOVA  and  with  Scheffe's  test  for 
pairwise  comparisons. 

If  a  second  prey  species  is  offered,  will  the  effect  of  the 
mtdihranch  mucus  on  neiuatoc\st  discharge  change? 

Four  individuals  ot  A.  papillosa  were  fed  the  sea  anem- 
one M.  senile  for  21  days.  Mucus-coated  probes  were  used 
to  test  nematocyst  discharge  from  feeding  tentacles  of  M. 
senile  and  the  sea  anemone  Anthopleura  elegantissima.  The 
nudibranchs  were  then  offered  both  M.  senile  and  Antho- 
pleura elegantissima.  Anthopleura  elegantissima  is  not 
found  on  the  coast  of  New  England,  so  the  experimental 
nudibranchs  could  not  have  encountered  this  prey  species 
before.  Fourteen  days  later,  mucus-coated  probes  were  used 
to  test  nematocyst  discharge  from  the  tentacles  of  both 
species  of  prey  anemone.  Data  were  converted  to  relative 
discharge  values  as  described  for  the  previous  experiment 
and  analyzed  using  Student's  t  tests. 

Does  the  nudibranch  produce  its  own  inhibitory  mucus  or 
simplv  become  covered  in  the  prev's  mucus? 

Any  inhibitory  effect  of  the  nudibranch's  mucus  coating 
could  be  a  result  of  the  nudibranch  being  coated  in  the 
mucus  of  the  prey  species  during  feeding.  To  test  this 
possibility,  we  compared  the  inhibitory  effectiveness  of 
mucus  removed  from  a  particular  region  of  a  nudibranch 
with  mucus  removed  from  that  same  region  45  min  after 
wiping  that  area  clean.  Probes  were  coated  with  mucus  from 
eight  individuals  of  A.  papillosa  of  mixed  sizes  that  had 
been  feeding  on  the  sea  anemone  M.  senile.  The  probes 
were  coated  with  mucus  from  the  dorsal  surface  of  the 
nudibranch  immediately  behind  the  heart.  Each  nudibranch 
was  then  transferred  to  fresh  filtered  seawater.  Sterile  cotton 
swabs  were  used  to  wipe  the  mucus  from  the  dorsal  surface 
of  the  nudibranch  and  from  the  surrounding  cerata.  Six 
additional  swabs  were  used  to  wipe  the  nudibranch  a  total  of 
seven  times,  and  the  nudibranch  was  again  transferred  to 
fresh  filtered  seawater.  After  the  nudibranch  was  allowed  to 
recover  from  this  treatment  for  45  min,  additional  probes 
were  coated  with  mucus  from  its  dorsal  surface  immediately 
behind  the  heart.  The  mucus-coated  probes  were  then  all 
used  to  probe  feeding  tentacles  of  M.  .senile.  Three  probes 
were  coated  with  mucus  from  each  nudibranch  for  each 
treatment  (unswabbed  and  swabbed).  Counting  of  all  probes 
was  done  blind.  The  mean  number  of  discharged  nemato- 


116 


P.  G.  GREENWOOD  ET  AL. 


3      50- 


Control  probes 
Mucus-coated  probes 


(6) 


FSW 


FSW  +  NANA 


Figure  1.  Number  of  nematocysts  discharged  into  control  probes  or 
into  probes  coated  with  mucus  from  individuals  of  Aeolulia  papillosa  that 
had  been  feeding  on  Metridit/ni  xcnile.  Mucus-coated  probes  were  used  to 
probe  tentacles  of  the  sea  anemone  M.  senile  in  both  filtered  seawater 
(FSW)  and  FSW  containing  1CT7  M  N-acetylneuraminic  acid  (FSW  + 
NANA),  and  compared  against  control  probes  of  gelatin  only.  The  numbers 
in  parentheses  are  the  numbers  of  anemones  used  (control  probes)  or  the 
numbers  of  nudibranchs  used  (mucus-coated  probes)  per  test. 


cysts  into  mucus-coated  probes  from  unswabbed  nudi- 
branchs was  compared  to  nematocyst  discharge  into  mucus- 
coated  probes  from  swabbed  nudibranchs  and  into  control 
probes.  Analysis  was  done  by  ANOVA  and  with  Scheffe's 
test  for  pairwise  comparisons. 

We  also  investigated  whether  the  mucus  of  M.  senile 
individuals  inhibited  discharge  from  other  individuals  of  M. 
senile  held  in  separate  containers.  Individual  sea  anemones 
were  transferred  to  filtered  seawater.  allowed  to  recover  for 
10  min,  transferred  to  fresh  filtered  seawater  again,  allowed 
to  recover  for  10  mm.  and  finally  transferred  to  a  dry,  clean 
glass  dish.  The  sea  anemone  secreted  mucus  for  10  min  and 
was  removed  from  the  dish.  The  mucus  was  removed  from 
the  dish  and  stored  in  sterile  microcentrifuge  tubes.  Gelatin 
probes  were  placed  into  the  mucus  for  2  min  and  used  to 
probe  different  individuals  of  M.  .senile.  Three  probes  were 
coated  with  mucus  from  each  of  tour  anemones.  The  mean 
number  of  discharged  nematocysts  in  the  mucus-coated 
probes  was  compared  to  that  number  in  control  probes  with 
no  mucus.  Data  were  analy/ed  using  Student's  /  tests  as 
described  above. 

Results 

Does  a  luulihraneli's  nu/ens  inliihit  the  neinaloeyst 
t!i-,<  Inline  ti'din  the  lentaeles  of  its  prey  species'.' 

When  tentacles  of  the  sea  anemone  Metruliiim  senile 
were  probed  with  control  probes  in  seawater,  a  baseline 
discharge  response  \\.is  observed  (Fig.  1  ).  The  nematocysts 
that  discharged  into  the  gelatin  were  mostly  basitrichous 
isorhi/us  along  with  some  microhasic  p-masligophores. 


Gelatin  probes  coated  with  mucus  from  the  nudibranch 
Aeoliiliu  papillosa  that  had  been  feeding  on  M.  senile  elic- 
ited 51%  fewer  nematocysts  to  discharge  from  M.  senile 
than  control  probes  did  (Student's  /  test,  tg  =  5.1.  P  - 
0.0006)  (Fig.  1).  When  probing  was  done  in  seawater 
containing  1()~7  M  NANA.  the  number  of  nematocysts  that 
discharged  into  mucus-coated  probes  was  almost  657r  less 
than  the  number  that  discharged  into  control  probes  (Stu- 
dent's nest,  /,,,  =  9.1.  P  <  0.0001)  (Fig.  1 ),  but  the  mean 
number  of  discharges  into  control  probes  was  higher  than 
when  NANA  was  omitted  (Student's  t  test,  tL>  =  4.1.  P  < 
0.003).  For  each  anemone  species,  probing  in  10~7  M 
NANA  elicited  a  greater  number  of  discharged  nematocysts 
than  probing  in  seawater  alone  (Fig.  2).  Statistical  results 
were  as  follows:  for  M.  senile.  Student's  ;  test.  t,t  =  4.1. 
P  <  0.003:  for  Aulactinia  stella.  Student's  /  test.  f2  =  4.5. 
P  <  0.05:  for  Anthopleura  elegantissima.  Student's  /  test. 
t4  =  5.0.  P  =  0.008.  Because  it  increased  the  response, 
KF7  M  NANA  was  used  for  all  subsequent  experiments. 

When  probes  coated  with  mucus  from  A.  papillosa  that 
had  been  feeding  on  M.  senile  were  used  to  probe  the  sea 
anemones  Unicina  felina  and  Aulactinia  stella.  there  was  a 
small  but  nonsignificant  increase  in  nematocyst  discharge 
over  controls  (for  U.  felina.  Student's  /  test,  ?,,,  =  0.344, 
p  =  o.7();  for  Aitlaetinia  stella.  Student's  t  test,  /2f)  = 
0.76.  P  =  0.46)  (Fig.  3).  As  before,  significantly  fewer 
nematocysts  discharged  into  mucus-coated  probes  from  ten- 
tacles of  M.  senile  than  into  control  probes  (Student's  ;  test, 
rs  ==  9.0.  P  <  0.0001)  (Fig.  3).  Nematocysts  from  U. 
felina  were  mostly  microbasic  p-mastigophores  and  some 
basitrichous  isorhizas.  Nematocysts  from  Aulactinia  stella 
were  basitrichous  isorhizas  and  microbasic  p-mastigophores 
in  about  equal  numbers.  The  mucus  effectiveness  was  sim- 


z 

•a 

U 

00 


Q 

V- 

o 

I 


10- 


M.  senile 


A.  stellu  A.  elegantissima 


I  i^uri'  2.  Number  ol  nenutocxsts  discharged  into  control  piobes. 
Tentacles  ol  ihe  sea  anemones  Mctruliuin  .vc»i/f,  Aulactinia  ^Iclla.  and 
Aniliii/ilriirn  clt\(;iiiiii\.\iimi  were  probed  in  filtered  seawater  (FSW)  and 
tentacles  ol  other  individuals  of  each  species  were  probed  in  FSW  con- 
laining  Id  '  A/  N-acel\lneuraminic  acid  (FSW  +  NANA).  The  numbers  in 
parentheses  are  the  numbers  of  anemones  used  per  test. 


SEA  SLUG  MUCUS  INHIBITS  NEMATOCYSTS 


17 


z 
•8 
I 


Q 
o 

U 

1 

3 

Z 


Control  probes 
Mucus-coaled  probes 


M.  senile 


A.  Stella 


U.  felina 


Figure  3.  Number  of  nematocysts  discharged  into  control  probes  or 
into  probes  coated  with  mucus  from  individuals  of  Aeolulia  papillosa  that 
had  been  feeding  on  Metridium  senile  (±SD).  Mucus-coated  probes  were 
used  to  probe  tentacles  of  the  sea  anemones  M.  senile,  Aulactiniu  xtclla. 
and  Urticina  fell/in  (in  10~7  M  N-acetylneurammic  acid)  and  were  com- 
pared against  control  probes  of  gelatin  only.  The  numbers  in  parentheses 
are  the  numbers  of  anemones  used  (control  probes)  or  the  numbers  of 
nudibranchs  used  (mucus-coated  probes)  per  test. 


ilar  among  individual  nudibranchs  regardless  of  their  size 
(ANOVA,  Fh4S  =  0.76,  P  =  0.61). 

When  gelatin  probes  coated  with  mucus  from  individuals 
of  A.  papillosa  that  had  been  feeding  upon  U.  felina  were 
tested  on  the  tentacles  of  U.  felina,  nematocyst  discharge 
was  67%  less  than  discharge  into  the  control  probes  ( Mann- 
Whitney  U  test,  t/4]6  =  24,  P  =  0.01)  (Fig.  4).  When 
probes  coated  with  mucus  from  A.  papillosa  that  had  been 
feeding  on  U.  felina  were  used  to  probe  the  sea  anemones 
M.  senile  and  Aulactinia  stella,  nematocyst  discharge  was 


60- 


I 


Q 

'-4— 

O 

I 


Control  probes 
Mucus-coated  probes 


(4) 


M.  senile  A.  stella 


U.  felina 


Figure  4.  Number  of  nematocysts  discharged  into  control  probes  or 
into  probes  coated  with  mucus  from  individuals  of  AealiJia  papillosa  that 
had  been  feeding  on  Urticina  felina  (±SD).  Mucus-coated  probes  were 
used  to  probe  tentacles  of  the  sea  anemones  Metridium  senile,  Aulactiniu 
stella,  and  U.  felina  (in  1C)"7  M  N-acetylneuraminic  acid)  and  were 
compared  against  control  probes  of  gelatin  only.  The  numbers  in  paren- 
theses are  the  numbers  of  anemones  used  (control  probes)  or  the  numbers 
ot  nudibranchs  used  (mucus-coated  probes)  per  test. 


no  different  than  in  controls  (for  M.  senile.  Student's  /  test. 
tb  =  1 . 10.  P  =  0.3  1 ;  \\irAulactinia  stella.  Student's  t  test, 
?h  =  1.96.  P  =  0.098)  (Fig.  4). 

If  the  prey  species  is  changed,  will  the  effect  of  the 
nudibranch  mucus  on  nenuiiocyst  discharge  also  change? 

Seven  individuals  of  A.  papillosa  that  had  been  collected 
from  several  different  New  England  localities  were  fed  U. 
felina  for  16  days  in  the  laboratory.  As  before,  nematocyst 
discharge  into  mucus-coated  probes  was  50%  less  than 
nematocyst  discharge  into  control  probes  for  U.  felina,  but 
not  for  M.  senile  (Fig.  5).  The  nudibranchs'  prey  was  then 
switched  from  U.  felina  to  M.  senile,  and  over  a  period  of  2 
weeks,  the  mucus  from  the  nudibranchs  was  tested  period- 
ically against  both  sea  anemone  species.  Over  the  course  of 
the  experiment,  the  number  of  nematocysts  that  discharged 
into  mucus-coated  probes  increased  when  M.  senile  was 
probed  (ANOVA,  F4  2I  ==  8.20,  P  =  0.0004)  and  de- 
creased when  U.  felina  was  probed  (ANOVA,  F3  19  = 
23.12,  P  <  0.0001).  Within  10  days  after  the  prey  switch, 
touching  M.  senile  tentacles  with  mucus-coated  probes  elic- 
ited the  discharge  of  75%  fewer  nematocysts  than  control 
probes  did  (Scheffe's  test,  P  =  0.0067)  (Fig.  5).  By  the  end 
of  the  experiment,  touching  U.  felina  tentacles  with  mucus- 
coated  probes  again  resulted  in  a  small  but  nonsignificant 


I 


'-4-H 

O 


Oi 


1.75- 

1.5- 

1.25- 

1 

0.75  - 
0.5- 

0.25  - 
0 


(7) 


10 


15 


Days 

Figure  5.  The  effect  of  Aeolidia  papillosa  mucus  on  the  relative 
number  of  discharged  nematocysts  following  prey  switch  from  the  sea 
anemone  Urticina  felina  to  the  sea  anemone  Metridium  senile  (±SD). 
Mucus-coated  probes  were  used  to  probe  tentacles  of  the  sea  anemones  U. 
felina  and  M.  senile  (in  10  7  A/  N-acetylneuraminic  acid),  and  were 
compared  against  controls  for  each  species  for  a  period  of  2  weeks.  A 
relative  value  of  1 .0  corresponds  to  the  number  of  nematocysts  discharged 
into  control  probes  on  Day  0  for  each  sea  anemone  species.  Data  obtained 
from  mucus-coated  probes  for  each  day  were  normalized  against  controls 
tor  that  day  and  for  each  species  of  sea  anemone.  The  numbers  in  paren- 
theses are  the  numbers  of  nudibranchs  used  per  test. 


118 


P.  G.  GREENWOOD  ET  AL 


1 


1.25 


1- 


0.75- 


0.5- 


0.25- 


(4) 


-O —    A.  elegantissima 
•  O-  -      M.  sem/f 


(3) 


— i — 
10 


15 


Days 

Figure  6.  The  effect  of  Aeolidia  pupillosa  mucus  on  the  relative 
number  of  discharged  nematocysts  following  prey  switch  from  the  sea 
anemone  Metridium  senile  only  to  horh  M.  senile  and  the  sea  anemone 
Anthopleura  elegantissima.  Mucus-coated  probes  were  used  to  probe  ten- 
tacles of  the  sea  anemones  M.  senile  and  A.  elegantissima  (in  10~7  M 
N-acetylneuraminic  acid),  and  were  compared  against  controls  for  each 
species  after  2  weeks.  A  relative  value  of  1 .0  corresponds  to  the  number  of 
nematocysts  discharged  into  control  probes  on  Day  0  for  each  sea  anemone 
species.  Data  obtained  from  mucus-coated  probes  for  each  day  were 
normalized  against  controls  for  that  day  and  for  each  species  of  sea 
anemone.  The  numbers  in  parentheses  are  the  numbers  of  nudibranchs  used 
per  test. 


increase  in   nematocyst  discharge  over  that   into  control 
probes  (Scheffe's  test,  P  =  0.072)  (Fig.  5). 


//'  a  second  prey  species  is  offered,  will  the  effect  of  the 
inidihriinch  mucus  on  nemtitocvst  discharge  change? 

Four  individuals  of  A.  pcipillosu  were  fed  M.  senile  for  at 
least  21  days,  and  tentacles  of  both  M.  senile  and  Antho- 
pleura  elegantissima  were  tested  with  mucus-coated  probes. 
M.  senile  nematocyst  discharge  was  56%  lower  into  mucus- 
coated  probes  than  into  control  probes  (Student's  ;  test,  /„  = 
9.6,  P  <  0.0001);  Aiithopleuni  ele^nnti.ssinui  nemato- 
cyst discharge  into  mucus-coated  probes  was  not  different 
from  discharge  into  control  probes  (Student's  /  test.  r(,  = 
0.545.  P  =  0.61 )  (Fig.  6).  Nematocysts  from  Anthopleum 
elegcintissimu  were  all  basitrichous  isorhizas.  The  nudi- 
branchs were  then  offered  both  M.  senile  and  Anthopleum 
eleg(iHti<i<iii>ui.  After  the  nudihranchs  had  been  feeding  on 
both  prey  species  for  14  days,  testing  with  mucus-coated 
probes  showed  nematocyst  discharges  34%  lower  than  con- 
trol probes  for  M.  senile  (Student's  /  test.  t4  =  2.78,  P  = 
0.05)  and  64%  lower  than  control  probes  for  Anthopleum 
ek'xuntisaimti  (Student's  ;  lest,  t4  =  17.06,  P  <  0.0001  ) 
(Fig.  6). 


Does  the  nudihrancli  produce  its  own  inhibitory  mucus  or 
simplv  become  covered  in  the  prey's  mucus'.' 

Mucus  was  wiped  away  from  the  dorsal  surface  of  eight 
individuals  of  A.  papiltosa  that  had  been  feeding  on  the  sea 
anemone  M.  senile.  Forty-five  min  later,  gelatin  probes 
coated  with  new  mucus  from  those  same  nudibranchs  were 
used  to  probe  tentacles  of  M.  senile.  Nematocyst  discharge 
into  those  probes  was  no  different  from  nematocyst  dis- 
charge into  probes  coated  with  mucus  from  the  same  eight 
individuals  of  A.  papillosa  before  wiping  the  mucus  away 
(Scheffe's  test,  P  =  0.60)  (Fig.  7).  Nematocyst  discharge 
into  both  groups  of  mucus-coated  probes  was  well  under 
half  the  number  that  discharged  into  control  probes 
(ANOVA,  F2.lh  =  10.54,  P  =  0.001)  (Fig.  7). 

When  probes  coated  with  M.  senile  mucus  were  used  to 
probe  tentacles  of  other  individuals  of  M.  senile,  nemato- 
cysts discharged  into  the  probes  in  numbers  no  ditterent 
than  into  control  probes  (Student's  t  test.  f6  =  1 . 14.  P  = 
0.30)  (Fig.  8). 

Discussion 

The  present  study  shows,  for  the  first  time,  that  the  mucus 
from  a  nudibranch  specifically  inhibits  the  discharge  of 
nematocysts  from  sea  anemone  tentacles.  This  inhibition  of 
nematocyst  discharge  is  limited  to  the  anemone  species  on 
which  the  nudibranch  has  been  feeding.  Moreover,  the 
nudibranch  mucus  changes  to  inhibit  the  nematocyst  dis- 
charge of  a  different  sea  anemone  species  if  the  nudibranch 


<u 


Q 
O 


411  -i 

(4) 

EH     unswabbed  nudibranchs 

30- 

— 

(7) 

(8)               1 

T 

10- 

i        1 

I 

Control  probes 


Mucus-coated  probes 


Figure  7.  The  number  of  nematocysts  discharged  into  control  probes 
or  into  nrorvs  coaled  with  mucus  from  individuals  of  Aenlulin  pupillnsn 
that  had  been  feeding  on  MeiriJium  senile.  Probing  ol  A/,  senile  tentacles 
was  done  in  10  7  M  N-acetylneuraminic  acid.  Mucus-coaled  probes  were 
prepared  both  he-lore  the  original  mucous  coaling  was  removed  from  the 
nudihrancli  (unswabbed  nudibranchs)  and  45  min  alter  mucus  removal 
(swabbed  midihianchs).  The  numbers  in  parentheses  are  the  numbers  ol 
anemones  used  (control  probes)  or  the  numbers  of  nudibranchs  used 
(mucus-coated  probes)  per  test. 


SEA  SLUG  MUCUS   INHIBITS   NEMATOCYSTS 


119 


Number  of  Discharged  Nematocysts 

—  i  j  <. 

-  O  O  C 

(4) 
T 

(4) 

T 

1 

i 

Control  probes        Probes  coated 

w/anemone  mucus 

Figure  8.  The  number  of  nematocysts  discharged  into  control  probes 
or  into  probes  coated  with  mucus  from  individuals  of  (he  sea  anemone 
Metridium  srnili:  Probing  of  M.  senile  tentacles  was  done  in  10~7  M 
N-acetylneuraminic  acid.  The  numbers  in  parentheses  ure  the  numbers  of 
anemones  used  per  test. 


begins  to  feed  on  that  new  species.  If  nudibranchs  are  fed 
two  different  species  of  sea  anemone,  their  mucus  inhibits 
nematocyst  discharge  from  both  prey  species.  Nudibranchs 
produce  their  own  inhibitory  mucus  and  do  not  simply 
mimic  sea  anemones  by  becoming  covered  with  anemone 
mucus  during  feeding. 

Mucus  from  nudibranchs  that  had  been  fed  the  sea  anem- 
one Metridiinn  senile  greatly  inhibited  nematocyst  dis- 
charge from  M.  senile,  but  not  from  Urticinu  feliiui  or 
Aulactinia  stella  (Fig.  3).  Likewise,  mucus  from  nudi- 
branchs that  had  been  fed  U.  felina  inhibited  nematocyst 
discharge  from  U.  felina.  but  not  from  M.  senile  or  Anlac- 
rinia  stellu  (Fig.  4).  Within  10  days  after  the  prey  of  A. 
papillosa  was  changed  from  U.  felina  to  M.  senile,  the 
mucus  of  A.  ptipillosa  no  longer  inhibited  nematocyst  dis- 
charge from  U.  felina.  but  did  inhibit  nematocyst  discharge 
from  M.  senile  (Fig.  5).  In  another  experiment,  A.  papillosa 
was  fed  both  M.  senile  and  Anihopleura  elegantissima. 
After  2  weeks,  the  mucus  of  the  nudibranch  inhibited  nema- 
tocyst discharge  from  both  M.  senile  and  Anihopleura  el- 
egantissima (Fig.  6).  Overall,  A.  papillosa  mucus  reduced 
nematocyst  discharge  from  all  prey  anemones  by  60%  be- 
low control  levels  (60.3%  ±  4.1%). 

Mucus  from  nudibranchs  that  had  been  freshly  swabbed 
of  their  previous  mucous  coating  inhibited  nematocyst  dis- 
charge from  anemone  prey  (Fig.  7),  indicating  that  the 
nudibranchs  do  not  simply  become  covered  with  anemone 
mucus.  Mucus  from  nudibranchs  held  in  the  same  aquarium 
with  sea  anemones  did  not  inhibit  nematocyst  discharge 
from  that  species.  This  suggests  that  the  nudibranch  mucus 
is  altered  only  after  feeding.  Whether  the  mucus  of  A. 
papillosa  is  altered  by  the  nudibranch  itself  or  if  compounds 
acquired  from  the  prey  are  subsequently  incorporated  into 
the  mucus  is  not  yet  known.  Nudibranchs  acquire  numerous 


prey  compounds  and  use  them  for  their  own  defense  from 
predators  (Avila  et  ai,  1991:  McClintock  et  al..  1994).  but 
some  nudibranchs  also  synthesize  their  own  chemical  de- 
fenses (Cimino  et  ai.  1983;  Faulkner,  1992).  Because  sea 
anemones  do  not  sting  themselves  or  clonemates.  there 
might  be  compounds  that  prevent  nematocyst  discharge  on 
or  within  the  sea  anemone  (Pantin,  1942;  Ertman  and  Dav- 
enport, 1981).  but  so  far  such  compounds  have  not  been 
identified  in  any  cnidarians.  In  addition,  we  found  in  this 
study  that  mucus  from  individuals  of  one  color  morph  of  M. 
senile  did  not  inhibit  nematocyst  discharge  from  another 
color  morph  of  M.  senile  (Fig.  8),  indicating  that  a  prey 
species'  mucus  is  not  necessarily  inhibitory  to  other  mem- 
bers of  that  species.  Therefore,  the  nudibranchs  are  not 
relying  solely  on  compounds  acquired  from  the  prey's  mu- 
cus. Aeolid  nudibranchs  secrete  mucus  and  other  secretions 
from  gland  cells  found  in  various  locations  on  their  bodies 
(Edmunds,  1966).  Histochemical  evidence  suggests  that 
most  species  (including  A.  papillosa)  have  acidic  nuico- 
polysaccharides  as  at  least  part  of  the  mucus  (Edmunds. 
1966;  Porter  and  Rivera,  1983).  but  other  components, 
which  are  not  well  characterized,  may  be  secreted  from 
gland  cells  and  mix  with  the  mucus  on  the  surface  of  the 
nudibranch  (Edmunds,  1966).  The  mucous  secretion  we 
used  to  coat  the  gelatin  probes  probably  includes  compo- 
nents from  any  or  all  of  these  gland  cells. 

Most  of  our  studies  were  done  in  the  presence  of  N- 
acetylneuraminic  acid  (NANA),  which  increased  the  base- 
line number  of  nematocysts  that  discharged  into  the  gelatin 
probes  (Fig.  2).  Because  the  nudibranch  mucus  inhibited 
nematocyst  discharge  in  the  presence  of  NANA  (Fig.  1 ),  the 
mucus  must  either  reduce  the  mechanical  stimulation 
caused  by  the  nudibranch  while  feeding  or  inhibit  the  signal 
pathway  leading  to  nematocyst  discharge.  When  nudibranch 
mucus  was  tested  against  non-prey  sea  anemones,  nemato- 
cyst discharge  actually  increased  by  a  modest,  but  consis- 
tent, number  over  controls  (11.8%  ±  4.5%).  Therefore 
nudibranch  mucus  may  actually  promote  nematocyst  dis- 
charge in  species  that  are  not  the  current  prey.  Aeolidia 
papillosa  shows  a  strong  preference  for  its  most  recent  prey 
species  (Hall  et  ai.  1982).  Because  the  mucus  of  A.  papil- 
losa inhibits  nematocyst  discharge  from  current  prey  spe- 
cies but  not  from  other  potential  prey  species,  one  might 
expect  the  current  prey  species  to  remain  the  preferred  prey 
of  the  nudibranch. 


Acknowledgments 

We  thank  J.  Elliott.  C.  Sisson,  W.  H.  Wilson,  and  three 
anonymous  reviewers  for  many  helpful  comments  on  the 
manuscript  and  for  suggestions  of  additional  experiments. 
This  research  was  partially  supported  by  the  Merck  Chari- 
table Foundation  and  by  NSF  Grant  STI-9602639. 


120 


P.  G.  GREENWOOD  ET  AL. 


Literature  Cited 

Avila,  C.,  G.  Cimino,  A.  Fontana,  M.  Gavagnin,  J.  Ortea,  and  E. 
Trivellone.  1991.  Defensive  strategy  of  two  Hypse/odoris  nudi- 
hranchs  from  Italian  and  Spanish  coasts.  J.  Chem.  Ecol.  17:  625-636. 

Boutan,  L.  1898.  Moeurs  de  I'Eoli.s  papillosa  Linne.  Arch.  Zoo/.  Exp. 
Gen.  6:  37-42. 

Cimino.  G.,  S.  De  Rosa,  S.  De  Stefano,  G.  Sodano,  and  G.  Villani.  1983. 
Dorid  nudibranch  elaborates  its  own  chemical  defense.  Science  219: 
1237-1238. 

Conklin,  E.  J..  and  R.  N.  Mariscal.  1977.  Feeding  behavior,  ceras 
structure,  and  nematocyst  storage  in  the  aeolid  nudibranch.  Spiinlla 
neapolitana  (Mollusea).  Bull.  Mar.  Sci.  21:  658-667. 

Edmunds,  M.  1966.  Protective  mechanisms  in  the  Eolidacea  (Mollusea: 
Nudibranchia).  J.  Linn.  Sec.  Land.  Zoo/.  46:  27-71. 

Ertman,  S.  C.,  and  D.  Davenport.  1981.  Tentacular  nematocyte  dis- 
charge and  "self-recognition"  in  Ant/iopleiira  elegantissima  Brandt. 
Bio/.  Bull.  161:  366-370. 

Faulkner,  D.  J.  1992.  Chemical  defenses  of  marine  molluscs.  Pp.  119- 
163  in  Ecological  Roles  of  Marine  Natural  Products,  V.  J.  Paul.  ed. 
Constock  Publishing.  Ithaca.  NY. 

Graham,  A.  1938.  The  structure  and  function  of  the  alimentary  canal  of 
aeolid  molluscs,  with  a  discussion  on  their  nematocysts.  Trans.  R.  Soc. 
Edinb.  59:  267-307. 

Grosvenor,  G.  H.  1903.  On  the  nematocysts  of  aeolids.  Proc.  R.  Soc. 
Loud.  72:  462-486. 

Hall,  S.  J.,  and  C.  D.  Todd.  1984.  Prey-species  selection  by  the  anem- 
one predator  Aeolidia  papi/lof.u  (L.):  the  influence  of  ingestive  condi- 
tioning and  previous  dietary  history,  and  a  test  for  switching  behaviour. 
J.  Exp.  Mar.  Siol.  Ecol.  82:  1  1-33. 

Hall,  S.  J.,  and  C.  D.  Todd.  1986.  Growth  and  reproduction  in  the  aeolid 
nudibranch  Aeoltdia  papillosa  (L).  /  Molluscan  Stud.  52:  193-205. 

Hall.  S.  J.,  C.  D.  Todd,  and  A.  D.  Gordon.  1982.  The  influence  of 
ingestive  conditioning  on  the  prey  species  selection  in  Aeolidia  papil- 
losa (Mollusea:  Nudibranchia).  J.  Anim.  Ecol.  51:  907-921. 

Harris,  L.  G.  1973.  Nudibranch  associations.  Pp.  213-315  in  Current 
Topics  in  Comparative  Pathobiology,  Vol.  2,  T.  C.  Cheng,  ed.  Aca- 
demic Press.  New  York. 

Harris,  L.  G.  1986.  Size-selective  predation  in  a  sea  anemone,  nudi- 
hranch,  and  fish  food  chain.  Veliger  29:  38-47. 

Harris,  E.  G.  1987.  Aeolid  nudibranchs  as  predators  and  prey.  Am. 
Malacol.  Bull.  5:  287-292. 

Martin,  R.,  and  P.  Walther.  2003.  Protective  mechanisms  against  the 
action  of  nematocysts  in  the  epidermis  of  Cratcna  peregrimi  and 
r'labellina  affinis  (Gastropoda,  Nudibranchia).  Zi>innorpliolog\  122: 
25-35. 

\IaiH-h.  S..  and  J.  Elliott.  1997.  Protection  of  the  nudibranch  Aeolidia 
papillosa  from  nematocyst  discharge  of  the  sea  anemone  Anlhoplcuru 
i-lfgantissuna.  Veligei  40:  148-151. 

McClintotk.  J.  B.,  B.  J.  Baker.  M.  Slattery,  J.  N.  Heine,  P.  J.  Bryan,  W. 
Yoshida,  M.  T.  Davies-Coleman,  and  D.  J.  Faulkner.  1994.  Chem- 


ical defense  of  the  common  Antarctic  shallow  water  nudibranch  Tri- 
toniella  belli  Eliot  (Mollusea:  Tritonidae)  and  its  prey.  Clavularia 
frankliniana  Rouel  (Cnidaria:  Octocorallia).  J.  Chem.  Ecol.  20:  3361- 
3372. 

Pantin,  C.  F.  A.  1942.  The  excitation  of  nematocysts.  J.  Exp.  Biol.  19: 
294-310. 

Porter,  K.  J.,  and  E.  R.  Rivera.  1980.  The  Golgi  apparatus  in  epidermal 
mucoid  and  ellipsoid-vacuolale  cells  of  Aeolidia  papillosa  and  Corv- 
pltel/a  rtifibranchialis  (Nudibranchia).  Protoplasma  102:  217-233. 

Porter,  K.  J.,  and  E.  R.  Rivera.  1983.  Light  and  electron  microscopic 
cytochemistry  of  the  epidermal  mucoid  cells  of  Aeolidia  papillosa  and 
Coryphellii  rufihranchia/i.s  (Mollusea,  Nudibranchia).  Protoplasma 
114:  14-22. 

Reidy,  S.  E.  1996.  A  comparison  of  settlement,  growth  and  mortality  in 
the  nudibranch  Aeolidia  papillosa  when  offered  the  anemones 
Metridium  senile  and  Urticina  crassicorm.s.  Am.  Zoo/.  36:  106A. 

Russell,  H.  D.  1942.  Observations  on  the  feeding  of  Aeolidia  papillosa 
L..  with  notes  on  the  hatching  of  the  veligers  of  Cuthona  amoena  A. 
and  H.  Nautilus  55:  80-82. 

Salvini-Plawen,  L.  v.  1972.  Cnidaria  as  food  sources  for  marine  inver- 
tebrates. Cah.  Biol.  Mar.  13:  385-400. 

Thompson,  T.  E.  1976.  Biology  of  Opistholiranch  Molluscs.  Vol.  I.  Ray 
Society,  London.  207  pp. 

Thorington,  G.  U.,  and  D.  A.  Hessinger.  1988.  Control  of  cnida  dis- 
charge: I.  Evidence  for  two  classes  of  chemoreceptor.  Biol.  Bull.  174: 
163-171. 

Thorington,  G.  U.,  and  D.  A.  Hessinger.  1990.  Control  of  cnida  dis- 
charge: III.  Spirocysts  are  regulated  by  three  classes  of  chemoreceptors. 
Biol.  Bull.  178:  74-83. 

Thorington,  G.  I'.,  and  D.  A.  Hessinger.  1998.  Efferent  mechanisms  of 
discharging  cnidae:  II.  A  nematocyst  release  response  in  the  sea  anem- 
one tentacle.  Biol.  Bull.  195:  145-155. 

Todd,  C.  D.  1983.  Reproductive  and  trophic  ecology  of  nudibranch 
molluscs.  Pp.  225-259  in  The  Mollusea.  Vol.  6.  Ecology.  W.  D. 
Russell-Hunter,  ed.  Academic  Press,  Orlando.  FL. 

Todd,  C.  D.,  \V.  J.  Lambert,  and  J.  Davies.  2001.  Some  perspectives 
on  the  biology  and  ecology  of  nudibranch  molluscs:  generalisations  and 
variations  on  the  theme  that  prove  the  rule.  Bo/I.  Malacol.  37:  105-120. 

Watson,  G.  M.,  and  D.  A.  Hessinger.  1989.  Cnidocyte  mechanorecep- 
tors  are  tuned  to  the  movements  of  swimming  prey  by  chemoreceptors. 
Science  243:  1589-1591. 

Watson,  G.  M.,  and  D.  A.  Hessinger.  1994.  Antagonistic  frequency 
tuning  of  hair  bundles  by  different  chemoreceptors  regulates  nemato- 
cyst discharge.  J.  E.\p.  Biol.  187:  57-73. 

Watson,  G.  M..  and  R.  R.  Hudson.  1994.  Frequency  and  amplitude 
lulling  of  nematocyst  discharge  by  proline. ,/.  Ev/>.  Zoo/.  268:  177-185. 

Watson,  G.  M.,  S.  Venable,  R.  R.  Hudson,  and  J.  J.  Repass.  1999. 
ATP  enhances  repair  of  hair  bundles  in  sea  anemones.  Hear.  Res.  136: 
1-12. 


THE 

BIOLOGICAL 
BULLETIN 

2004  Subscription  Rates 
Volumes  206-207 

*Paid  Subscriptions  include  both  print  and  electronic  subscriptions  at:  www.biolbull.org 

Institutional*     Individual* 


One  year  subscription  (6  issues  - 

2  volumes) 

$325.00 

$120.00 

Single  volume   (3  issues) 

$165.00 

$70.00 

Single  Issues 

$  75.00 

$25.00 

*Surface  delivery  included  in  above  prices. 
For  prompt  delivery,  we  encourage  subscribers  outside  the  U.S.  to  request  airmail  service. 

Airmail  Delivery  Charge 

U.S.  and  Canada:  $  45.00 

Mexico:  $  60.00 

All  other  locations:  $  1 00.00 

Orders  Must  Be  Prepaid  in  U.S.  Dollars,  Check  Payable  to  The  Marine  Biological  Laboratory 

About  The  Biological  Bulletin 

ISSN:  0006-3185 

Frequency:  Bimonthly 

Number  of  issues  per  year:  6 

Months  of  Publication:   February,  April,  June,  August,  October,  December 

Subscriptions  entered  for  calendar  year 

Volume  indexes  contained  in  June  and  December  issues 

Annual  report  of  the  Marine  Biological  Laboratory  contained  in  August  issue 

Most  back  issues  available 

Claims  handled  upon  receipt 

No  agency  discounts 

Internet: 
www.biolbull.org 

Please  address  orders  to: 

Wendy  Child 

Subscriptions 

The  Biological  Bulletin 

Marine  Biological  Laboratory 

7  MBL  Street 

Woods  Hole,  MA  02543-1015    U.S.A. 
Fax:  508-289-7922  Tel:  508-289-7402  Email:  wchild@mbl.edu 

Published  by  the  Marine  Biological  Laboratory 
Woods  Hole,  Massachusetts,  02543  U.S.A. 


THE  BIOLOGICAL  BULLETIN 

( www.biolbull.org) 

2004  SUBSCRIPTION  FORM 

(VOLUMES  206-207,  6  ISSUES) 


(please  print) 
NAME: 


INSTITUTION: 
ADDRESS: 


CITY: STATE:. 

POSTAL  CODE: COUNTRY:. 

TELEPHONE:  FAX:. 

E-MAIL  ADDRESS 


All  subscriptions  run  on  the  calendar  year;  price  includes  both  print  and  online  journals 

G  Please  send  me  a  2004  subscription  to  The  Biological  Bulletin  at  the  rate  indicated  below: 

O  Individual:  $120.00  (6  ISSUES)  O  Institutional  :  $325.00  (6  ISSUES) 

O  Individual:  $70.00(3  ISSUES)  O  Institutional  :  $165.00  (3  ISSUES) 

Check  one:  G  February  April  June     or     G  August  October  December 

G  Please  send  me  the  following  back  issue(s): 

O  Individual:  at  $25.00  (PER  ISSUE)     O  Institutional  :  at  $75.00  (PER  ISSUE) 

Delivery  Options 

Surface  Delivery  (Surface  delivery  is  included  in  the  subscription  price.) 

Air  delivery  (Please  add  the  correct  amount  to  your  payment.) 


O  U.S.  and  Canada:  $46.00  O  Mexico:  $60.00  O  All  other  locations:  $100.00 
Payment  Options 

Enclosed  is  my  check  or  U.S.  money  order  for  $ payable  to  The  Marine  Biological  Laboratory 

Please  charge  my  G  VISA,  G  MasterCard  G  Discover  Card  $ 

Please  send  me  an  invoice.  (Note:  Payment  must  be  received  before  subscription  commences.) 


Account  No.: Exp.  Date: 

Signature:_  Date:  


Return  this  form  with  your  check  or  credit  information  to: 

Marine  Biological  Laboratory 

Subscription  Office  +  The  Biological  Bulletin  47  MBL  Street  *  Woods  Hole,  MA  02543-1015 


ARINE  IXESOURCES  CENTER 


MARINE  BIOLOGICAL  LABORATORY  •  WOODS  HOLE,  MA  02543  •  (508)289-7700 
WWW.MBL.EDU/SERVICES/MRC/INDEX.HTML 


Animal  and  Tissue  Supply  for 
Education  &  Research 

•  150  aquatic  species  available  for  shipment  via 
online  catalog:  <http://www.mbl.edu/animals/ 
index.htmb;  phone:  (508)289-7375;  or 
e-mail:  specimens@mbl.edu 

•  zebrafish  colony  containing  limited  mutant  strains 

•  custom  dissection  and  furnishing  of  specific  organ 
and  tissue  samples 


zebrafish  facilities 


MRC  Services  Available 

•  basic  water  quality  analysis 

•  veterinary  services  (clinical,  histopathologic, 
microbial  services,  health  certificates,  etc.) 

•  aquatic  systems  design  (mechanical,  biological, 
engineering,  etc.) 

•  educational  tours  and  collecting  trips  aboard 
the  R/V  Gemma 


Using  the  MRC  for  Your  Research 

•  capability  for  advanced  animal  husbandry  (temperature,  light  control,  etc.) 

•  availability  of  year-round,  developmental  life  stages 

•  adaptability  of  tank  system  design  for  live  marine  animal  experimentation 


OGL-  OCEAN  GENOME 
LEGACY 

M  EXECUTIVE  DIRECTOR 

A  new  not-for-profic  foundation  devoted  to  the 
preservation,  distribution  and  evolutionary  genomics  of 
DNA  from  marine  organisms  is  seeking  an 
EXECUTIVE  DIRECTOR. 

The  successful  candidate  will  have  a  Ph.D.  in  cell  or 
molecular  biology,  4+  years'  experience  in  molecular 
biology,  and  be  highly  motivated  to  work  at  the  bench. 
Responsibilities  will  include  the  assembly  of  a  small  team 
of  scientists  for  the  long-term  preservation  of  marine 
organism  DNA,  development  of  tissue  culture 
techniques  for  marine  invertebrare  cells,  construction  of 
genome  libraries,  and  evolutionary  genomics  of  special 
marine  transition  groups. 

The  OGL  laboratory  will  be  temporarily  located  at  New 
England  Biolabs,  Inc.,  Beverly,  MA  unril  a  new  facility  is 
constructed  in  Ipswitch,  MA. 

Applicants  should  fend  a  resume  and  three  references  to: 
Carol  Ann  Zapustas,  New  England  Biolabs,  Inc., 
32  Tozer  Road,  Beverly,  MA  01915. 

OCEAN  GENOME  LEGACY 


An  Equal  Opportunity  Employer. 


MBL 


Marine  Biological  Laboratory  •  Woods  Hole  •  MA 


Advances  in  Genome  Technology 
and  Bioinformatics 

October  5  -  November  3,  2004 

A  comprehensive,  four-week  course  in  genome  science  that 
will  integrate  bioinformatics  with  the  latest  laboratory 
techniques  for  genome  sequencing,  genome  analysis,  and 
high  throughput  gene  expression. 

Application  Deadline:  June  16,  2004 

Contact:  Carol  Hamel,  Admissions  Coordinator,  (508)  289-7401, 

admissions@mbl.edu;  7  MBL  Street,  Woods  Hole,  MA  02543 

Applications  are  encouraged  from  women  and  members  of  underrepresented 

minorities.  The  MBL  is  an  Equal  Opportunity/Affirmative  Action  Employer. 

www.mbl.edu/education 


POSITION  ANNOUNCEMENT 

Editor-in-Chief 
The  Biological  Bulletin 

Start  Date:  January  2005 
Term:  Five  years,  renewable 


The  Editor-in-Chief  is  responsible  for  the  overall  editorial  direction  of  the  Biological  Bulletin.  The  Editor-in-Chief 
appoints  Associate  Editors  and  members  of  the  Editorial  Board,  decides  which  manuscripts  are  published,  mediates 
editorial  disputes,  and  sets  policy  for  the  journal. 

The  Editor-in-Chief  is  an  independent  contractor  who  reports  to  the  Director  and  CEO  of  the  Marine  Biological 
Laboratory.  Stipend  for  the  position  is  $10,000  annually.  The  Bulletin 's  editorial  offices  are  based  in  Woods  Hole,  but 
the  Editor-in-Chief  may  work  from  his/her  home  institution.  The  Editor-in-Chief  is  expected  to  spend  some  part  of  the 
summer  months  in  Woods  Hole.  Housing  for  up  to  one  month  will  be  provided  in  Woods  Hole. 


The  successful  candidate  for  this 

position  will  meet  the  following 

requirements: 


Abroad  understanding  of  biology,  and  a  manifest  interest  in  its 

diversity  and  comparative  and  integrative  aspects 

A  track-record  of  publishing  in  peer-reviewed  journals 

Experience  reviewing  papers  for  scientific  journals 

Proven  skill  as  a  substantive  editor 

Ability  to  make  tough  decisions  and  willingness  to  work  with  other  editors 

to  reach  a  decision  on  difficult  papers 

Demonstrated  experience  with  the  editorial  process  (e.g.,  serving  as  an 

Editor  or  Associate  Editor  for  a  journal  similar  to  the  Biological  Bulletin) 

The  willingness  and  ability  to  commit  the  time  required,  approximately 

one  day  per  week,  to  fulfill  the  duties  outlined  here  for  five  years. 


Job  description: 


Nomination  packets  must  include 
the  following: 

1.  Letter  of  intent 

2.  Current  CV 

3.  Vision  Statement  for  the  journal 

Send  nominations  to: 

Pamela  Clapp  Hinkle 

Managing  Editor,  Biological  Bulletin 

Marine  Biological  Laboratory 

7  MBL  Street 

Woods  Hole,  MA  02543 

pclapp@mbl.edu 


The  Editor-in-Chief  devotes  a  minimum  of  six  hours  per  week  to  the 
operation  of  the  Biological  Bulletin.  The  Editor's  ongoing  activities  include 

1)  assigning  submitted  papers  to  the  appropriate  Associate  Editor; 

2)  reading  reviews  and  manuscripts  to  ensure  fairness  and  technical 
accuracy;  3)  writing  editorial  decision  letters  based  on  the  reviews; 

4)  fielding  telephone  and  e-mail  queries  on  a  daily  basis  from  authors 
deciding  whether  to  submit  their  work  to  the  Biological  Bulletin,  authors 
who  are  unhappy  about  an  editorial  decision,  and  Associate  Editors 
requesting  guidance  on  such  matters  as  the  identity,  availability, 

and  number  of  reviewers,  and  editorial  decisions  and  disputes; 

5)  communicating  regularly  (by  telephone  or  e-mail)  with  the  Managing 
Editor  and  other  editorial  staff  members  to  plan  future  issues,  to  arrange  the 
table  of  contents,  to  develop  the  issue  cover,  and  to  discuss  organizational 
issues;  6)  editing  accepted  manuscripts  as  necessary  for  substance, 
accuracy,  and  clarity;  7)  selecting  cover  photos  and  writing  associated 
legends;  8)  informing  editorial  staff  of  noteworthy  articles  for  the  media; 
9)  as  the  deadline  for  each  issue  approaches,  deciding  which  manuscripts 
will  be  published. 


Marine  Biological  Laboratory  •  Woods  Hole  •  Massachusetts 


••-.-. 

Inverted   Microscopy 

At   Its   Best! 


. 


• 

v  ••  - 


Built  with  extraordinary 

Zeiss  expertise,  the  Axiovert  200 

is  all  you'll  ever  want  in  an 


precisely,  more  rapidly  and  more 
successfully  than  before.  And  this 
is  just  the  beginning! 


Outstanding  ICS  infinity  optics,  ...........  '"" 

innovative  condensers  &  optimized  microscope  into  a  sophisticated 

fluorescence,  stability  &  reliability,  ima9e  handli"9  workstation 

unique  ergonomic  design,  for  observation  &  documentation 

&  an  unusuall   wide  scoe  of  Iivin9  cells  with  a"  of  the 


unique  ergonomic  design,  or  oservaon 

&  an  unusually  wide  scope  of  Iivin9  cells  wit 

of  sophisticated  documentation.  components  super 

by  Zeiss  for  outst 
But  the  Axiovert  200  is  much 

more.  It  is  a  powerful  tool  that  For  more  informat 

will  carry  out  your  research  more  call  800-233-2343 


components  superbly  matched 
by  Zeiss  for  outstanding  results. 

For  more  information 


Carl  Zeiss  Microlmaging,  Inc.  •  Thornwood,  NY  10594  •  micro@zeiss.com 


ZEISS 


We  make  it  visible. 


Volume  206  •  Number  3 


BIOLOGICAL 
BULLETIN 


Published  by  the  Marine  Biological  Laboratory 


Woods  Hole,  Massachusetts  ,   • 


THE  BIOLOGICAL  BULLETIN 


ONLINE 


The  Marine  Biological  Laboratory  is  pleased       beginning  with  the  October  1976  issue 

to  announce  that  the  lull  text  of  The  Biological      (Volume  151,  Number  2),  and  some  Tables  of 

Bulletin  is  available  online  at  Contents  are  online  beginning  with  the 

October  1965  issue  (Volume  129,  Number  2). 


http://www.biolbull.org 

The  Biological  Bulletin  publishes  outstanding 
experimental  research  on  the  full  range 
of  biological  topics  and  organisms,  from  the 
fields  of  Neurobiology,  Behavior,  Physiology, 
Ecology,  Evolution,  Development  and 
Reproduction,  Cell  Biology,  Biomechanics, 
Symbiosis,  and  Systematics. 

Published  since  1897  by  the  Marine 
Biological  Laboratory  (MBL)  in  Woods  Hole, 
Massachusetts,  The  Biological  Bulletin  is  one 
of  America's  oldest  peer-reviewed  scientific 
journals. 

The  journal  is  aimed  at  a  general  readership, 
and  especially  invites  articles  about  those 
novel  phenomena  and  contexts  characteristic 
of  intersecting  fields. 

I 'lie  li/ii/figintl  Bulletin  Online  contains  the 
full  content  of  each  issue  of  the  journal, 
including  all  figures  and  tables,  beginning 
with  the  February  2001  issue  (Volume  200, 
Number  1).  The  full  text  is  searchable  by 
keyword,  and  the  cited  references  include 
hyperlinks  to  Meclline.  PDF  files  are  available 
beginning  in  February  1990  (Volume  178, 
Number  1),  some  abstracts  are  available 


Each  issue  will  be  placed  online 
approximately  on  the  elate  it  is  mailed  to 
subscribers;  therefore  the  online  site  will  be 
available  prior  to  receipt  of  your  paper  copy. 
Online  readers  may  want  to  sign  up  for  the 
eTOC  (electronic  Table  of  Contents)  service, 
which  will  deliver  each  new  issue's,  table  of 
contents  via  e-mail.  The  web  site  also 
provides  access  to  information  about  the 
journal  (such  as  Instructions  to  Authors,  the 
Editorial  Board,  and  subscription 
information),  as  well  as  access  to  the  Marine 
Biological  Laboratory's  web  site  and  other 
Biological  Bulletin  electronic  publications. 

The  free  trial  period  for  access  to  The 
Biological  Bulletin  online  has  ended. 
Individuals  and  institutions  who  are 
subscribers  to  the  journal  in  print  or  are 
members  of  the  Marine  Biological 
Laboratory  Corporation  may  now  activate 
their  online  subscriptions.  All  other  access 
(e.g.,  to  Abstracts,  eTOCs,  searching, 
Instructions  to  Authors)  remains  freely 
available.  Online  access  is  included  in  the 
print  subscription  price. 

For  more  information  about  subscribing  or 
activating  your  online  subscription,  visit 
<www.biolbull.org/subscriptions>. 


http://www.biolbull.org 


THE  BRAIN 
REPAIR 


A  TRON-generation  kid  with  a  computer-monitor  tan  liberated  by  confocal  technology. 
A  tennis  jock  from  Sweden  who  traded  her  racket  for  a  FluoView™  300  and  a  stethoscope. 
A  criminalist  from  the  LAPD  now  in  hot  pursuit  of  outlaw  cells.  Unique  talents  brought 
together  by  Principal  Investigator  Dan  Peterson  to  chase  down  the  Big  Answer: 
How  to  harness  endogenous  brain  stem  cells  that  con  repair,  and  send  them  to  other 
places  in  the  brain  that  need  repair.  "Our  bread  and  butter  is  confocal  microscopy,"  Peterson  says.  "We're  like  portrait  photographers. 
We  light,  compose,  direct,  position  -  all  to  get  the  cell  ready  for  its  close-up." 
And  to  improve  the  human  condition  at  the  end  of  the  day. 

OLYMPUS  MICROSCOPES  ROCKET  SCIENCE  ™.  a  *,  -     p   8°°"  8  ' 


,us  microscopes  a 


I  more  about 


Christopher  Vega,  Ph  D.     Research  /Associate 
Anno  Hallbergson  -  M.D  /Ph  D  Student 
Dame/  A    Peferson,  Ph  D   -  lob  Director 
Christine  Sanders  •  Research  A:  .• 
Department  of  Neuroscience 
Rosalind  Franklin  University 
of  Medicine  and  Science 


ti 


> 


T 


' 

*•   '-?'.  ': 


/our  Vision,  Our  Future 


CONTENTS 


VOLUME  206,  No.  3:  JUNE  2004 


RESEARCH  NOTE 

Li,  Natasha  K.,  and  Mark  W.  Denny 

Limits  to  phenotypic  plasticity:  flow  effects  on  barna- 
cle feeding  appendages 121 

SEA  MONSTERS 

Pierce,  Sidney  K.,  Steven  E.  Massey,  Nicholas  E.  Curtis, 
Gerald  N.  Smith,  Jr.,  Carlos  Olavarna,  and  Timothy  K. 
Mangel 

Microscopic,  biochemical,  and  molecular  character- 
istics of  the  Chilean  Blob  and  a  comparison  with  the 
remains  of  other  sea  monsters:  nothing  but  whales.  .  .  125 


Phillippi,  Aimee,  Ellen  Hamann,  and  Philip  O.  Yund 

Fertilization  in  an  egg-brooding  colonial  ascidian 
does  not  vary  with  population  density 152 

Swanson,  Rebecca  L.,  Jane  E.  Williamson,  Rocky  De 

Nys,  Naresh  Kumar,  Martin  P.  Bucknall,  and  Peter  D. 

Steinberg 

Induction  of  settlement  of  larvae  of  the  sea  urchin 
Holopneustes  purpumscens  by  histamine  from  a  host 
alga Itil 

Terrell,  David  L. 

Fitness  consequences  of  allorecognition-mediated 
agonistic  interactions  in  the  colonial  hydroid  Hfdnii- 
tinifi  [GM] 17.°, 

INNATE  IMMUNITY 


ECOLOGY  AND  EVOLUTION 

Diaz,  Eliecer  R.,  and  Martin  Thiel 

Chemical   and  visual   communication   during  mate 

searching  in  rock  shrimp 134 

Johnson,  Sheri  L.,  and  Philip  O.  Yund 

Remarkable    longevity   of  dilute   sperm    in    a   free- 
spawning  colonial  ascidian 144 


Holman,  Jeremy  D.,  Karen  G.  Burnett,  and  Louis  E. 
Burnett 

Effects  of  hypercapnic  hvpoxi.i  on  the  clearance  of 
Vibrio  camphellii  in  the  Atlantic  blue  crab,  Cal/inectes 
sapidus  Rathbun 18.S 

*  *  * 
Index  for  Volume  206  197 


THE  BIOLOGICAL  BULLETIN 

THE  BIOLOGICAL  BULLETIN  is  published  M\  times  a  year  by  the  Marine  Biological  Laboratory,  7  MBL  Street. 
Woods  Hole.  Massachusetts  02543. 

Subscriptions  and  similar  matter  should  be  addressed  to  Subscription  Administrator.  THE  BIOLOGICAL 
BULLETIN,  Marine  Biological  Laboratory.  7  MBL  Street.  Woods  Hole.  Massachusetts  02543.  Subscription 
includes  both  print  und  online  journals.  Subscription  per  year  (six  issues,  two  volumes):  $325  for  libraries;  $120 
for  individuals.  Subscription  per  volume  (three  issues):  $165  for  libraries:  $70  for  individuals.  Back  and  single 
issues  (subject  to  availability):  $75  tor  libraries;  $25  for  individuals. 

Communications  relative  to  manuscripts  should  be  sent  to  Michael  J.  Greenberg.  Editor-in-Chief,  or  Pamela 
Clapp  Hinkle.  Managing  Editor,  at  the  Marine  Biological  Laboratory.  7  MBL  Street,  Woods  Hole,  Massachusetts 
02543.  Telephone:  (508)  289-7149.  FAX:  508-289-7922.  E-mail:  pclapp@mbl.edu. 


http://www.biolbull.org 

THE  BIOLOGICAL  BULLETIN  is  indexed  in  bibliographic  services  including  Index  Medicus  and  MED- 
LINE,  Chemical  Abstracts,  Current  Contents,  Elsevier  BIOBASE/Current  Awareness  in  Biological 
Sciences,  and  Geo  Abstracts. 

Printed  on  acid  free  paper, 
effective  with  Volume  180,  Issue  1,  1991. 


POSTMASTER:  Send  address  changes  to  THE  BIOLOGICAL  BULLETIN,  Marine  Biological  Laboratory. 

7  MBL  Street.  Woods  Hole,  MA  02543. 

Copyright  ©  2004,  by  the  Marine  Biological  Laboratory 

Periodicals  postage  paid  at  Woods  Hole,  MA,  and  additional  mailing  offices. 

ISSN  0006-3185 


INSTRUCTIONS  TO  AUTHORS 


7/ii'  Biological  Bulletin  accepts  outstanding  original  research 
reports  of  general  interest  to  biologists  throughout  the  world. 
Papers  are  usually  of  intermediate  length  (10-40  manuscript 
pages).  A  limited  number  of  solicited  review  papers  may  be 
accepted  after  formal  review.  A  paper  will  usually  appear  within 
four  months  after  its  acceptance. 

Very  short,  especially  topical  papers  (less  than  9  manuscript 
pages  including  tables,  figures,  and  bibliography)  will  be  published 
in  a  separate  section  entitled  "Research  Notes."  A  Research  Note 
in  The  Biological  Bulletin  follows  the  format  of  similar  notes  in 
Nature.  It  should  open  with  a  summary  paragraph  of  150  to  200 
words  comprising  the  introduction  and  the  conclusions.  The  rest  of 
the  text  should  continue  on  without  subheadings,  and  there  should 
be  no  more  than  30  references.  References  should  be  referred  to  in 
the  text  by  number,  and  listed  in  the  Literature  Cited  section  in  the 
order  that  they  appear  in  the  text.  Unlike  references  in  Nature. 
references  in  the  Research  Notes  section  should  conform  in 
punctuation  and  arrangement  to  the  style  of  recent  issues  of  The 
Biological  Hnlli'iiii.  Materials  and  Methods  should  be  incorpo- 
rated into  appropriate  figure  legends.  See  the  article  by  Lee 
(October  2003.  Vol.  205:  99-101  )  for  sample  style.  A  Research 
Note  will  usually  appear  within  two  months  after  its  acceptance. 

The  Hdilonal  Board  requests  that  regular  manuscripts  con- 
form to  the  requirements  set  below;  those  manuscripts  that  do 
not  conform  will  be  returned  to  authors  lor  correction  before 
ie\  icw 


1 .  Manuscripts.  Manuscripts,  including  figures,  should  be 
submitted  in  quadruplicate,  with  the  originals  clearly  marked. 
(Xerox  copies  of  photographs  are  not  acceptable  for  review  pur- 
poses.) Please  include  an  electronic  copy  of  the  text  of  the  manu- 
script. Label  the  disk  with  the  name  of  the  first  author  and  the  name 
and  version  of  the  wordprocessing  software  used  to  create  the  tile. 
If  the  file  was  not  created  in  some  version  of  Microsoft  Word,  save 
the  text  in  rich  text  format  (rtf).  The  submission  letter  accompa- 
nying the  manuscript  should  include  a  telephone  number,  a  FAX 
number,  and  (if  possible)  an  E-mail  address  for  the  corresponding 
author.  The  original  manuscript  must  be  typed  in  no  smaller  than 
12  pitch  or  10  point,  using  double  spacing  (including  figure  leg- 
ends, footnotes,  bibliography,  etc.)  on  one  side  of  16-  or  20-lh. 
bond  paper,  8  by  11  inches.  Please,  no  right  justification.  Manu- 
scripts should  be  proofread  carefully  and  errors  corrected  legibly 
in  black  ink.  Pages  should  be  numbered  consecutively.  Margins  on 
all  sides  should  he  at  least  1  inch  (2.5  cm).  Manuscripts  should 
conform  to  the  Council  of  Biolog\  Editors  Style  Manual.  5th 
Edition  (Council  of  Biology  Editors.  1983)  and  to  American  spell- 
ing. Unusual  abbreviations  should  be  kept  to  a  minimum  and 
should  he  spelled  out  on  tirst  reference  as  well  as  defined  in  a 
footnote  on  the  title  page.  Manuscripts  should  be  divided  into  the 
following  components:  Title  page.  Abstract  (of  no  more  than  200 
\\oids).  Introduction.  Materials  and  Methods,  Results,  Discussion. 
Acknowledgments,  Literature  Cited,  Tables,  and  Figure  Legends. 
In  addition,  authors  should  supply  a  list  of  words  and  phrases 
under  which  the  article  should  he  indexed. 


2.  Title  page.     The  title  page  consists  of  a  condensed  title  or 
running  head  of  no  more  than  35  letters  and  spaces,  the  manuscript 
title,  authors'   names  and  appropriate  addresses,  and  footnotes 
listing  present  addresses,  acknowledgments  or  contribution  num- 
bers, and  explanation  of  unusual  abbreviations. 

3.  Figures.     The  dimensions  of  the  printed  page,  7  by  9 
inches,  should  be  kept  in  mind  in  preparing  figures  for  publication. 
We  recommend  that  figures  be  about  1  times  the  linear  dimensions 
of  the  final  printing  desired,  and  that  the  ratio  of  the  largest  to  the 
smallest  letter  or  number  and  of  the  thickest  to  the  thinnest  line  not 
exceed  1:1.5.  Explanatory  matter  generally  should  be  included  in 
legends,  although  axes  should  always  be  identified  on  the  illustra- 
tion itself.  Figures  should  be  prepared  for  reproduction  as  either 
line  cuts  or  halftones.  Figures  to  be  reproduced  as  line  cuts  should 
be   unmounted  glossy  photographic  reproductions  or  drawn   in 
black  ink  on  white  paper,  good-quality  tracing  cloth  or  plastic,  or 
blue-lined  coordinate  paper.  Those  to  be  reproduced  as  halftones 
should  be  mounted  on  board,  with  both  designating  numbers  or 
letters  and  scale  bars  affixed  directly  to  the  figures.  All  figures 
should  he   numbered  in  consecutive  order,  with  no  distinction 
between  text  and  plate  figures  and  cited,  in  order,  in  the  text.  The 
author's  name  and  an  arrow  indicating  orientation  should  appear 
on  the  reverse  side  of  all  figures. 

Digital  an:  The  Biological  Bulletin  will  accept  figures  sub- 
mitted in  electronic  form;  however,  digital  art  must  conform  to  the 
following  guidelines.  Authors  who  create  digital  images  are 
wholly  responsible  for  the  quality  of  their  material,  including  color 
and  halftone  accuracy. 

Format.  Acceptable  graphic  formats  are  TIFF  and  EPS.  Color 
submissions  must  be  in  EPS  format,  saved  in  CMKY  mode. 

Software.  Preferred  software  is  Adobe  Illustrator  or  Adobe 
Photoshop  for  the  Mac  and  Adobe  Photoshop  for  Windows.  Spe- 
cific instructions  for  artwork  created  with  various  software  pro- 
grams are  available  on  the  Web  at  the  Digital  Art  Information  Site 
maintained  by  Cadmus  Professional  Communications  at  http:// 
cpc.cadmus.com/da/ 

Resolution.  The  minimum  requirements  for  resolution  are 
1200  DPI  for  line  art  and  300  for  halftones. 

Size.  All  digital  artwork  must  be  submitted  at  its  actual 
printed  size  so  that  no  scaling  is  necessary. 

Multipanel  figures.  Figures  consisting  of  individual  parts 
(e.g.,  panels  A,  B,  C)  must  be  assembled  into  final  format  and 
submitted  as  one  file. 

Hani  copv.  Files  must  be  accompanied  by  hard  copy  for  use 
in  case  the  electronic  version  is  unusable. 

Disk  identification.  Disks  must  be  clearly  labeled  with  the 
following  information:  author  name  and  manuscript  number;  for- 
mat (PC  or  Macintosh);  name  and  version  of  software  used. 

Color:  The  Biological  Bulletin  will  publish  color  figures  and 
plates,  but  must  bill  authors  for  the  actual  additional  cost  of 
printing  in  color.  The  process  is  expensive,  so  authors  with  more 
than  one  color  image  should — consistent  with  editorial  concerns, 
especially  citation  of  figures  in  order — combine  them  into  a  single 
plate  to  reduce  the  expense.  On  request,  when  supplied  with  a  copy 
of  a  color  illustration,  the  editorial  staff  will  provide  a  pre-publi- 
cation  estimate  of  the  printing  cost. 

4.  Tables,  footnotes,  figure  legends,  etc.     Authors  should 
follow  the  style  in  a  recent  issue  of  The  Biological  Bulletin  in 


preparing  table  headings,  figure  legends,  and  the  like.  Because  of 
the  high  cost  of  setting  tabular  material  in  type,  authors  are  asked 
to  limit  such  material  as  much  as  possible.  Tables,  with  their 
headings  and  footnotes,  should  be  typed  on  separate  sheets,  num- 
bered with  consecutive  Arabic  numerals,  and  placed  after  the 
Literature  Cited.  Figure  legends  should  contain  enough  informa- 
tion to  make  the  figure  intelligible  separate  from  the  text.  Legends 
should  be  typed  double  spaced,  with  consecutive  Arabic  numbers, 
on  a  separate  sheet  at  the  end  of  the  paper.  Footnotes  should  be 
limited  to  authors'  current  addresses,  acknowledgments  or  contri- 
bution numbers,  and  explanation  of  unusual  abbreviations.  All 
such  footnotes  should  appear  on  the  title  page.  Footnotes  are  not 
normally  permitted  in  the  body  of  the  text. 

5.  Literature  cited.  In  the  text,  literature  should  be  cited  by 
the  Harvard  system,  with  papers  by  more  than  two  authors  cited  as 
Jones  et  al..  1980.  Personal  communications  and  material  in  prep- 
aration or  in  press  should  be  cited  in  the  text  only,  with  author's 
initials  and  institutions,  unless  the  material  has  been  formally 
accepted  and  a  volume  number  can  be  supplied.  The  list  of 
references  following  the  text  should  be  headed  Literature  Cited, 
and  must  be  typed  double  spaced  on  separate  pages,  conforming  in 
punctuation  and  arrangement  to  the  style  of  recent  issues  of  The 
Biological  Bulletin.  Citations  should  include  complete  titles  and 
inclusive  pagination.  Journal  abbreviations  should  normally  follow 
those  of  the  U.  S.  A.  Standards  Institute  (USASI).  as  adopted  by 
BIOLOGICAL  ABSTRACTS  and  CHEMICAL  ABSTRACTS,  with  the  minor 
differences  set  out  below.  The  most  generally  useful  list  of  bio- 
logical journal  titles  is  that  published  each  year  by  BIOLOGICAL 
ABSTRACTS  (BIOSIS  List  of  Serials;  the  most  recent  issue).  Foreign 
authors,  and  others  who  are  accustomed  to  using  THE  WORLD  LIST 
OF  SCIENTIFIC  PERIODICALS,  may  find  a  booklet  published  by  the 
Biological  Council  of  the  U.K.  (obtainable  from  the  Institute  of 
Biology.  41  Queen's  Gate,  London.  S.W.7.  England,  U.K.)  useful, 
since  it  sets  out  the  WORLD  LIST  abbreviations  for  most  biological 
journals  with  notes  of  the  USASI  abbreviations  where  these  differ. 
CHEMICAL  ABSTRACTS  publishes  quarterly  supplements  of  addi- 
tional abbreviations.  The  following  points  of  reference  style  for 
THE  BIOLOGICAL  BULLETIN  differ  from  USASI  (or  modified  WORLD 
LIST)  usage: 

A.  Journal  abbreviations,  and  book  titles,  all  underlined  (for 
italics ) 

B.  All  components  of  abbreviations  with  initial  capitals  (not 
as  European  usage  in  WORLD  LIST  e.g..  J.  Cell.  Comp.  Physiol. 
NOT  J.  cell.  comp.  Physiol. ) 

C.  All  abbreviated  components  must  be  followed  by  a  period, 
whole  word  components  must  not  (i.e.,  J.  Cancer  Res.) 

D.  Space   between   all    components   (e.g.,   J.    Cell.    Com/'. 
Physio/.,  not  J.Cell.Comp.Physiol.) 

E.  Unusual  words  in  journal  titles  should  be  spelled  out  in 
full,  rather  than  employing  new  abbreviations  invented  by  the 
author.  For  example,  use  Rit  Vtsindafjelags  Islcmlingn  without 
abbreviation. 

F.  All  single  word  journal  titles  in  full  (e.g.,  Veliger,  Ecol- 
ogy, Brain). 


G.  The  order  of  abbreviated  components  should  be  the  same 
as  the  word  order  of  the  complete  title  (i.e.,  Proc.  and  Trans. 
placed  where  they  appear,  not  transposed  as  in  some  BIOLOGICAL 
ABSTRACTS  listings). 

H.  A  few  well-known  international  journals  in  their  preferred 
forms  rather  than  WORLD  LIST  or  USASI  usage  (e.g..  Nature. 
Science.  Evolution  NOT  Nature.  Loud..  Science.  N.Y.:  Evolution. 
Lancaster.  Pa. ) 

6.  Sequences.  By  the  time  a  paper  is  sent  to  the  press,  all 
nucleotide  or  amino  acid  sequences  and  associated  alignments 
should  have  been  deposited  in  a  generally  accessible  database 


(e.g.,  GenBank.  EMBL.  SwissProt).  and  the  sequence  accession 
number  should  be  provided. 

7.  Reprints,  page  proofs,  and  charges.  Authors  may  pur- 
chase reprints  in  lots  of  100.  Forms  for  placing  reprint  orders  are 
sent  with  page  proofs.  Reprints  normally  will  be  delivered  about  2 
to  3  months  after  the  issue  date.  Authors  will  receive  page  proofs 
of  articles  shortly  before  publication.  They  will  be  charged  the 
current  cost  of  printers'  time  for  corrections  to  these  (other  than 
corrections  of  printers'  or  editors'  errors).  Other  than  these  charges 
for  authors'  alterations.  The  Biological  Bulletin  does  not  have 
page  charges. 


CONTENTS 

for  Volume  206 

No.  1 :  FEBRUARY  2004 


RESEARCH  NOTE 


DEVELOPMENT  AND  REPRODUCTION 


Buresch,  Kendra  C.,  Jean  G.  Boal,  Gregg  T.  Nagle, 
Jamie  Kiiowles,  Robert  Nobuhara,  Kate  Sweeney,  and 
Roger  T.  Hanlon 

Experimental  evidence  that  ovary  and  oviducal  gland 
extracts  influence  male  agonistic  behavior  in  squids  1 

PHYSIOLOGY  AND  BIOMECHANICS 

Motokawa,  Tatsuo,  Osamu  Shintani,  and  Riidiger  Bi- 
renheide 

Contraction  and  stiffness  changes  in  collagenous  arm 
ligaments  of  the  stalked  crinoid  tMf/r/ii/in<\  ><>luii<lu\ 
(Echinodermata) 4 

NEUROBIOLOGY  AND  BEHAVIOR 

Biggers,  William  J.,  and  Hans  Laufer 

Identification  of  juvenile  hormone-active  alkylphe- 
nols  in  the  lobster  Homants  ainericanus  and  in  marine 
sediments.  .  13 


Tominaga,    Hideyuki,    Shogo    Nakamura,    and    Mieko 
Komatsu 

Reproduction  and  development  of  the  conspicuously 
dimorphic  brittle  star  Ophiodaphne  fnnnata  (Ophiu- 

roidea)    25 

Temkin,  M.  H.,  and  S.  B.  Bortolami 

Waveform  dvnamics  of  spermato/eugmata  during 
the  transfer  from  paternal  to  maternal  individuals  of 
Menibranipora  membranacea 35 


ECOLOGY  AND  EVOLUTION 

Wang,  Yongping,  Zhe  Xu,  and  Ximing  Guo 

Differences  in  the  i  DNA-bearing  chromosome  divide 
the  Asian-Pacific  and  Atlantic  species  of  Crassostrea 

(Bivalvia,  Mollusca) 4(i 

Maruyama,  Yoshihiko  K. 

Occurrence  in  the  field  of  a  long-term,  year-round, 
stable  population  of  placo/oans 55 


No.  2:  APRIL  2004 


RESEARCH  NOTE 


CELL  BIOLOGY 


Edmunds,  Peter  J.,  and  Ruth  D.  Gates 

Size-dependent  differences  in   the  photophysiology 
of  the  reef  coral  Porites  astreoides  .  . 


NEUROBIOLOGY  AND  BEHAVIOR 


Ishikawa,   Makiko,   Hidekazu   Tsutsui,  Jacky   Cosson, 
(i|          Yoshitaka  Oka,  and  Masaaki  Morisawa 

Strategies  for  sperm  chemolaxis  in  the  siphonophores 

and  ascidians:  a  numerical  simulation  study 95 


Lindsay,  Sara  M.,  Timothy  J.  Riordan,  Jr..  and  D.  Forest 

Identification  and  activity-dependent  labeling  ol 
peripheral  sensory  structures  on  a  spionid 
polvchaete 65 


ECOLOGY  AND  EVOLUTION 


PHYSIOLOGY  AND  BIOMECHANICS 

Harper,  S.  L.,  and  C.  L.  Reiber 

Physiological  development  of  the  embryonic  and  l.n- 

val  crayfish  heart 7S 

Ehlinger,  Gretchen  S.,  and  Richard  A.  Tankersley 
Survival  and  development  of  horseshoe  crab  (I./i/iu/n\ 
polyphemus)  embryos  and  larvae  in  hypersaline  condi- 
tions. .  87 


Last.  Kim  S.,  and  Peter  J.  W.  Olive 

Interaction  between  photoperiod  and  an  endoge- 
nous seasonal  factor  in  influencing  the  diel  loco- 
motor  activity  of  the  benthic  polvchaete  Nereis  vi- 
ii'i/'i  Sars 103 

Greenwood,  Paul   G.,   Kyle   Garry,  April   Hunter,  and 

Miranda  Jennings 

Adaptable  defense:  a  ntidibranch  mucus  inhibits 
nematocyst  discharge  and  changes  with  prey  type  ...  113 


CONTENTS:  VOLUME  206 
No.  3:  JUNE  2004 


RESEARCH  NOTE 

Li,  Natasha  K.,  and  Mark  W.  Denny 

Limits  to  phenotypic  plasticity:  flow  effects  on  barna- 
cle feeding  appendages 121 

SEA  MONSTERS 

Pierce,  Sidney  K.,  Steven  E.  Massey,  Nicholas  E.  Curtis, 
Gerald  N.  Smith,  Jr.,  Carlos  Olavarria,  and  Timothy  K. 
Mangel 

Microscopic,  biochemical,  and  molecular  character- 
istics of  the  Chilean  Blob  and  a  comparison  with  the 
remains  of  other  sea  monsters:  nothing  but  whales.  .  .  125 

ECOLOGY  AND  EVOLUTION 

Diaz,  Eliecer  R.,  and  Martin  Thiel 

Chemical   and  visual   communication   during  mate 

searching  in  rock  shrimp 134 

Johnson,  Sheri  L.,  and  Philip  O.  Yund 

Remarkable  longevity  of  dilute  sperm  in  a  free- 
spawning  colonial  ascidian 144 


Phillippi,  Aimee,  Ellen  Hamann.  and  Philip  O.  Yund 

Fertilization  in  an  egg-brooding  colonial  ascidian 
does  not  van-  with  population  density 152 

Swanson,  Rebecca  L.,  Jane  E.  Williamson,  Rocky  De 

Nys,  Naresh  Kumar.  Martin  P.  Bucknall,  and  Peter  D. 

Steinberg 

Induction  of  settlement  of  larvae  of  the  sea  urchin 
Holupneiistes  purpumscfim  bv  histamine  from  a  host 
alga 161 

Fen-ell,  David  L. 

Fitness  consequences  of  allorecognition-mediated 
agonistic  interactions  in  the  colonial  hvdroid  Hyilrac- 
tmia  IGM] 1 73 

INNATE  IMMUNITY 

Holman,  Jeremy  D.,  Karen  G.  Burnett,  and  Louis  E. 
Burnett 

Effects  of  liypercapnic  hypoxia  on  the  clearance  of 
\'il>r/ii  campbeUii  in  the  Atlantic  blue  crab,  Callinectes 
sapidus  Rathbun 188 

*  *  * 
Index  for  Volume  206  197 


Reference:  Biol.  Bull.  206:  121-124.  (June  2004) 
©  2004  Marine  Biological  Laboratory 


Limits  to  Phenotypic  Plasticity:  Flow  Effects  on 
Barnacle  Feeding  Appendages 

NATASHA  K.   LI*  AND  MARK  W.  DENNY 
Hopkins  Marine  Station,  Stanford  University;  Pacific  Grove.  California  93950 


Phenotypic  plasticity,  the  capacity  of  a  given  genotype  to 
produce  differing  morphologies  in  response  to  the  environ- 
ment, is  widespread  among  marine  organisms  (II  For 
example,  acorn  barnacles  feed  by  extending  specialised 
appendages  {the  cirral  legs)  into  flow,  and  the  length  of  the 
cirri  is  plastic:  the  higher  the  velocity,  the  shorter  the 
feeding  legs  (2,  3).  However,  this  effect  has  been  explored 
onl\  for  flows  less  than  4.6  m/s.  slow  compared  to  typical 
flows  measured  at  sites  on  wave-exposed  shores.  What 
happens  at  faster  speeds?  Leg  lengths  o/Balanus  glandula 
Danvin,  1854.  an  acorn  barnacle,  were  measured  at  15 
sites  in  Monterey;  California,  across  flows  ranging  from  0.5 
to  14.0  m/s.  Similar  to  previous  findings,  a  plastic  response 
in  leg  length  was  noted  for  the  four  sites  with  water  veloc- 
ities less  than  3  m/s.  However,  no  plastic  response  was 
present  at  the  11  sites  exposed  to  faster  velocities,  despite  a 
4-fold  variation  in  speed.  We  conclude  that  the  velocity  at 
which  the  plastic  response  occurs  has  an  upper  limit  of  2-4 
m/s.  a  velocity  commonly  exceeded  within  the  tvpical  Inih- 
itat  of  this  species. 

Acorn  barnacles  provide  an  excellent  opportunity  for 
examining  plastic  response  because  they  are  sessile  (and 
therefore  cannot  move  in  response  to  the  environment), 
molt  their  exoskeleton  (providing  periodic  opportunity  for 
morphological  change),  and  occur  across  a  wide  range  of 
flow  conditions.  Helmuth  and  Denny  (4)  measured  maximal 
wave-induced  water  velocities  at  222  sites  along  the  rocky 
intertidal  shore  at  Hopkins  Marine  Station  (HMS)  in  Pacific 
Grove,  California  (36°36'N,  121°53'W),  and  the  variation 


Received  5  February  2004;  accepted  31  March  2004. 

*  To  whom  correspondence  should  be  addressed.  Present  address: 
American  Institute  of  Mathematics.  360  Portage  Ave,  Palo  Alto.  CA 
94305.  E-mail:  nkli@stanfordalumni.org 

Abbreviations:  ADM,  average  daily  maximum;  ANCOVA.  analysis  of 
covariance;  HMS.  Hopkins  Marine  Station;  MLLW.  mean  lower  low 
water;  OM.  overall  maximum. 


in  velocity  at  each  site  was  expressed  as  a  function  of 
offshore  significant  wave  height  (the  average  height  of  the 
highest  one-third  of  waves).  These  measurements  allowed 
us  to  select  sites  exposed  to  a  range  of  wave-induced  water 
velocities.  Eleven  sites,  each  1.5  m  above  the  mean  lower 
low  water  (MLLW),  were  selected  for  collection  of  B. 
glandula.  Because  of  the  exposure  of  this  shore,  all  HMS 
sites  except  one  are  subjected  to  water  velocities  greater 
than  those  encountered  in  previous  studies  on  B.  glandula 
(2,  3).  Therefore,  four  additional  sites  were  selected  at  the 
Monterey  Wharf  in  Monterey,  California  (~2  km  from 
HMS),  where  barnacles  are  subjected  to  a  range  of  slower 
flows.  At  each  site.  10  barnacles  were  collected,  and  the 
length  of  each  cirrus  was  measured. 

Offshore  significant  wave  height  was  measured  four 
times  per  day  for  30  days  prior  to  the  barnacle  collections, 
and  the  largest  significant  wave  height  occurring  when  the 
tidal  height  was  greater  than  1 .5  m  above  MLLW  was  noted 
for  each  day.  These  data,  in  conjunction  with  the  relation- 
ships measured  by  Helmuth  and  Denny  (4),  allowed  us  to 
estimate  the  daily  maximal  water  velocities  imposed  at  each 
collection  site.  Marchinko  (3)  found  that  transplanted  spec- 
imens of  B.  glandula  begin  modifying  their  cirral  length  in 
response  to  their  new  environment  somewhere  between  7 
and  18  days  after  first  exposure.  There  was  no  evidence  of 
alteration  at  day  7  and  significant  alteration  by  day  18, 
continuing  through  day  30.  To  incorporate  this  lag  in  re- 
sponse time,  we  used  the  water  velocities  recorded  10-30 
days  prior  to  sampling  as  an  index  of  the  flows  to  which  the 
barnacles  could  have  responded.  Previous  studies  have  ex- 
amined only  the  relationship  between  cirrus  length  and 
average  daily  maximum  velocity,  although  the  barnacles 
could  be  responding  to  maximum  velocity,  average  veloc- 
ity, or  some  other  aspect  of  flow.  We  employ  both  the 
average  daily  maximum  (ADM)  velocity  and  overall  max- 
imum (OM)  velocity. 


122 


N.  K.  LI  AND  M.  W.  DENNY 


-04  -0-2 


0  02  04  06  0.8 

Log(ADM  Water  Velocity)  (m/s) 


I  I  2 


All  cirral  legs  (legs  4,  5,  and  6)  were  significantly  longer 
at  the  protected  Monterey  Wharf  sites  than  at  the  exposed 
HMS  sites.  For  example,  the  average  length  of  leg  6  at  the 
two  wharf  sites  with  ADM  velocities  less  than  0.6  m/s  was 
2.56  mm,  nearly  1.8  times  that  at  HMS  (avg.  length  =  1.42 
mm),  where  ADM  velocities  exceeded  2.4  m/s.  On  the  basis 
of  evidence  from  previous  studies  (2.  3).  we  assume  that  this 
difference  is  due  to  a  plastic  response  to  flow.  In  contrast. 
the  differences  among  the  HMS  sites  were  not  significant, 
despite  a  range  of  velocities  from  2.4  to  14.0  m/s.  Further- 
more, among  the  Monterey  Wharf  sites,  there  was  a  signif- 
icant difference  between  the  sites  with  lower  velocities 
(0.48  and  0.58  m/s  ADM)  and  higher  velocities  (1.19  and 
1.38  m/s  ADM). 

Among  the  HMS  sites,  there  was  no  significant  correla- 
tion between  leg  length  and  either  measure  of  water  velocity 
(P  >  0.05).  In  contrast,  at  the  Monterey  Wharf  sites,  leg 
length  and  water  velocity  were  significantly  correlated,  and 
we  explored  this  correlation  using  reduced  major  axis  re- 
gressions for  the  logarithm  of  leg  lengths  versus  the  loga- 
rithm of  either  ADM  or  OM  velocity  (Fig.  1  and  Table  1 ). 
We  employed  reduced  major  axis  regression  because  the 


02  04  0,6  0.8 

Log(  ADM  Water  Velocity)  (m/s) 


-0-4  .0.2 


0  0.2  04  0 1)  08 

Log(ADM  Water  Velocity)  (m/s) 


Figure  1.  Average  length  of  three  feeding  legs  of  Bulunm\  xUuultila 
from  15  sites  of  differing  wave  exposure  in  Monterey  Bay,  California. 
Wave  exposure  was  calculated  as  the  average  of  daily  maximum  velocities 
encountered  for  10-30  days  prior  to  collection.  Legs  4.  5,  and  6  refer  to  the 
fourth,  fifth,  and  posterior-most  (sixth)  pair  of  thoracic  legs  of  these 
baUmomorph  barnacles.  Leg  lengths  (n  =  10  per  site)  were  standardized  to 
a  common  prosoma  wet  mass  of  0.0079  g  by  ANCOVA.  Reduced  major 
axis  regression  lines  are  shown  for  the  low-How  Wharf  data.  Lines  repre- 
senting the  mean  and  95f,»  confidence  intervals  are  shown  for  the  HMS 
sites.  (A)  Average  log,,,  length  of  leg  4.  (B)  Average  log,,,  length  of  leg  5. 
((')  Avciagc  log,,,  length  of  leg  6.  Reduced  major  axis  regression  statistics 
are  given  in  Table  1.  Error  bars  are  standard  errors  of  the  log-transformed 
dal.i.  calculated  by  ANCOVA  (Table  2). 

Water  velocities  during  high  tide  .11  the  Monterey  Wharf  sites  were 
measured  using  a  Marsh-McBimey  511  electromagnetic  flow  meter.  The 
probe  was  placed  about  0.5  in  seaward  of  the  collection  points,  and  the 
velocity  was  sampled  cvciv  30  s  lor  20  inin  at  each  site.  The  nia\imnin 
velocity  encountered  was  then  used  in  conjunction  with  the  co-occurring 
oil  shore  wave  height  as  a  means  of  estimating  maximal  velocity.  We 
assume  that  the  velocity  can  be  modeled  using  solitary  wave  theory  1 10).  f '  - 
kfxht'^  (where  /  is  velocily.  i;  is  the  acceleration  ol  gravitv.  and  h  is  offshore 


significant  wave  height),  and  the  constant  of  proportionality,  k,  was  cal- 
culated for  each  site.  Velocities  could  then  be  calculated  for  days  10-30 
prior  to  barnacle  collection  from  average  daily  maximum  offshore  wave 
significant  height  measurements.  Note  that  in  the  summer  of  2002  (when 
barnacles  were  collected),  wave  heights  in  Monterey  Bay  were  consistently 
small,  and  variation  among  days  was  minimal. 

We  collected  10  solitary,  uncrowded  specimens  of  Hiilunn.\  ghimlnlu 
from  rock  surfaces  within  6  cm  of  each  dynamometer  for  1 1  sites  along 
HMS  on  5  and  6  May  2002.  At  the  Monterey  Wharf,  barnacles  were 
collected  from  rocks  at  four  sites  with  differing  wave  exposures  on  20  July 
2002.  The  staggered  collection  dales  may  have  allowed  seasonal  variation 
in  barnacle  morphology,  but  we  assume  that  any  such  variation  is  unlikely 
to  account  for  the  extreme  differences  in  cirral  lengths  found  between  the 
sites.  At  each  site,  barnacles  of  various  si/es  were  collected.  All  barnacles 
were  dissected  on  the  day  of  collection.  The  prosoma  (the  fleshy  part  of  the 
body  without  the  shell)  was  extracted,  blotted  with  a  paper  towel,  and 
weighed  to  the  nearest  (I.I  mg  as  a  measure  of  wet  body  mass  The 
posterior  three  cirri  (legs  4,  5,  and  6)  were  then  dissected  from  the  lelt  side 
of  the  prosoma.  Both  the  e.xopodite  and  the  endopodite  of  each  leg  were 
placed  together  on  a  microscope  slide  in  a  drop  of  saltwater.  The  slides 
were  viewed  and  legs  traced  onto  paper  with  the  use  of  a  camera  lucida 
attached  to  the  microscope.  A  calibration  length  measurement  was  taken 
using  a  stage  micrometer.  The  traced  length  of  each  leg  was  then  measured 
to  the  nearest  micrometer  by  using  a  piece  of  cotton  string  placed  against 
the  tracing.  The  legs  were  measured  from  the  base  of  the  ramus  to  each  tip. 
excluding  the  propodite  segments. 

Analysis  of  covanance  was  conducted  using  SVSTAT  (Systat  Software 
Inc.,  ver.  6.0  for  Macintosh).  All  sites  exhibited  a  common  slope  of  mass 
ivcwn  leg  length.  Separate  ANCOVA  tests  were  done  on  each  leg  (4,  5, 
and  6).  Least-square  means  of  barnacle  leg  length  for  a  standard  body  mass 
were  computed  by  ANCOVA.  A  Tukev  MSI)  lest  was  performed  to  delect 
diltcicnccs  between  velocities  and  least-square  mean  leg  lengths.  Reduced 
ma|oi  avis  [egressions  weie  calculated  using  the  least  squares  sUmdauli/cd 
means  (5).  All  regression  and  ANCOVA  analyses  were  performed  on 
logni-log,,,  transformed  data,  as  per  Arsenaull  cl  til.  (3l. 


EFFECT  OF  FLOW  ON  BARNACLE  LEG  LENGTH 


123 


variables  involved  have  different  scales  and  are  subject  to 
measurement  errors  that  are  not  easily  specified  (5).  (Note 
that  leg  measurements  were  standardized  to  a  common 
prosomal  wet  weight;  see  Table  2.)  Among  the  Monterey 
Wharf  sites,  leg  length  is  significantly  negatively  correlated 
with  How  velocity,  with  slopes  varying  from  —0.28  to 
—  0.36  depending  on  the  cirrus.  The  relationship  using 
ADM  velocities  is  shown  in  Figure  I.  The  intersection  of 
the  Wharf  regression  and  HMS  mean  (with  95%  confidence 
interval)  using  ADM  velocity  occurred  between  2.0  and  3.1 
m/s  (average  of  intersection  with  the  mean:  2.6  m/s)  de- 
pending on  the  cirrus  (Fig.  1 ).  The  intersection  using  OM 
velocity  (not  shown)  occurred  between  3.0  and  4.6  m/s 
(average  of  intersection  with  mean:  3.6  m/s).  Because  of  the 
small  number  of  data  points  (/;  =  4),  we  could  not  calculate 
confidence  bands  for  the  reduced  major  axis  regressions. 

The  morphology  of  the  cirri  of  B.  glumlnlii  is  likely  to 
affect  their  ability  to  act  as  effective  filters.  The  longer  the 
legs,  the  more  area  they  can  subtend  and  the  farther  they  can 
extend  into  the  water  flow,  and  therefore  the  more  water 
they  can  potentially  filter.  However,  if  the  legs  grow  too 
long,  hydrodynamic  forces  could  cause  them  to  buckle  or 
bend,  and  thereby  to  lose  their  functionality.  The  ability  to 
vary  leg  lengths  appropriately  in  response  to  different  water 
velocities  would  therefore  appear  to  be  advantageous.  In- 
deed, barnacles  seem  capable  of  adjusting  leg  lengths  within 
one  or  two  molts  of  exposure  to  different  wave  velocities 
(3).  and  Arsenault  et  <//.  (2)  suggest  that  this  "tuning"  results 
in  a  precise  power  relationship  between  leg  length  and  water 
velocity.  Our  results  suggest,  however,  that  there  is  a  thresh- 
old water  velocity  (  —  2.6  m/s  using  ADM  velocity,  —3.6 
m/s  using  OM  velocity)  above  which  barnacles  cease  re- 
sponding plastically  to  flow.  Above  this  velocity,  the  large 

Table  1 

Reduced  major  axis  linear  regression  equations  for  the  average 

/(',(,';» ''('V  length)  (mm]  of  Balanus  glandula  ax  a  function  of  the  urc/vajr 

l°8/it  "/  '"'"  measures  of  miter  velocity  (m/s)  under  breaking  waves 


Table  2 

Analysis  of  covariance  results  for  measurements  of  Balanus  glandula 


Regression  statistics 


Trait 


slope 


intercept 


A.  Average 

daily  maximum 

water  velocity 

(ADM) 

leg  4 

-0.279 

0.198 

0.9  148 

<0.001 

leg  5 

-0.362 

0.271 

0.9l4d 

<0.001 

leg  6 

-0.354 

0.310 

0.901 

<0.0()1 

B.  Overall  maximum  water 

velocity  (OM) 

lea  4 

-0.279 

0.245 

0.9I4S 

<  0.001 

leg  5 

-0.362 

0.332 

0.9146 

<0.001 

leg  6 

-0.354 

0.370 

0.901 

<  0.001 

Regressions  for  ADM  and  OM  velocity  have  identical  slopes  because 
(for  our  method  of  estimating  velocity  at  these  sites)  OM  velocity  is  a 
constant  multiple  of  ADM  velocity.  Data  are  shown  only  for  the  Monterey 
Wharf  sites.  No  significant  correlations  were  found  among  the  sites  at 
Hopkins  Marine  Station  (P  >  0.05).  Sample  size  (/;)  for  each  leg  is  4. 


Source  of  variation 


df       Mean-square 


Log(ramus  length  of  fourth 

thoracic  leg) 

Field  site  14  0.052  22.876     <0.001 

Covariate(log(prosoma  wet 

mass))  I  0.392  172.237      <0.001 

Residual  134  0.002 

Loglramus  length  of  fifth 

thoracic  leg) 

Field  site  14  0.069  31.817      <0.001 

Covariatedoglprosoma  wet 

mass))  I  0.359  166.552      <0.001 

Residual  134  0.002 

Loglramus  length  of  sixth 

thoracic  leg) 

Field  site  14  0.082  40.281      <0.001 

Covanatedoglprosoma  wet 

mass))  I  0.369  180.598      <0.001 

Residual  134  0.002 


drag  forces  experienced  might  not  allow  legs  of  any  prac- 
tical length  to  act  as  effective  filters,  and  a  plastic  response 
would  lose  its  advantage.  Previous  studies  have  reported 
that  acorn  barnacles  adjust  their  feeding  behavior  across  a 
range  of  low  water  velocities  (0-0.15  m/s  [6,  7])  and 
maintain  their  feeding  activity  at  water  velocities  of  at  least 
0.25  m/s  (8,  9),  but  we  know  of  no  direct  observations  at 
greater  velocities.  Our  results  suggest  that  acorn  barnacles 
on  wave-exposed  shores  may  be  able  to  feed  only  during  the 
relatively  slow  backwash  as  waves  recede. 

Arsenault  et  ul.  (2)  propose  that  the  tight  relationship 
between  leg  length  and  water  velocity  might  allow  bar- 
nacles to  be  used  to  measure  local  wave  exposure.  Our 
results  suggest  that  barnacle  leg  length  can,  indeed,  be  a 
reliable  indicator  of  wave  exposure,  but  only  for  sites  at 
which  the  ADM  water  velocity  is  less  than  about  3  m/s. 
Note  also  that  the  exponents  of  the  power  relationship 
found  by  Arsenault  ct  til.  (2)  (-0.32  to  -0.43)  are 
slightly  different  from  those  found  here  (—0.28  to 
—  0.36).  This  disparity  could  be  an  artifact  of  the  small 
number  of  data  points  (;;  =  6,  Arsenault  et  ul.  [2]:  /;  =  4, 
this  study),  but  also  could  possibly  be  accounted  for  by 
differences  in  mean  barnacle  size  (0.0219  g,  Arsenault  et 
ul.  [2];  0.0079  g.  this  study),  method  used  to  estimate 
water  velocity,  or  substantial  latitudinal  difference  in 
collection  site.  Therefore,  local  calibration  might  be  nec- 
essary if  barnacles  are  to  be  used  as  "exposure  meters." 

Studies  to  date  have  examined  only  the  ultimate  relation- 
ship between  maximum  velocities  and  cirral  length.  As  with 
any  correlation,  further  research  is  needed  to  elucidate  the 
mechanisms  that  account  for  the  relationship. 


124 


N.  K.  LI  AND  M.  W.  DENNY 


Acknowledgments 

We  thank  J.  Watanabe  for  his  invaluable  statistical  help, 
even  while  traveling  the  globe. 

Literature  Cited 

1 .  Pigliucci,  M.  2001.     Phenotypic  Plasticity:  Beyond  Nature  and  Nur- 
ture. Johns  Hopkins  University  Press.  Baltimore,  MD. 

2.  Arstnault,  D.,  K.  B.  Marchinko,  and  A.  R.  Palmer.  2001.     Precise 
tuning  of  barnacle  leg  length  to  coastal  wave  action.  Pmc.  K.  Soc. 
Loml.  B  268:  2149-2154. 

3.  Marchinko,  K.  B.  2003.     Dramatic  phenotypic  plasticity  in  barnacle 
legs  (Balanus  glandula  Darwin):   magnitude,  age  dependence,  and 
speed  of  response.  Evolution  57:  1281-1290. 

4  1 1. 1  mi  i  ih.  B.,  and  M.  \V.  Denn\.  2003.  Predicting  wave  exposure  in 
the  rocky  intertidal  zone:  Do  bigger  waves  always  lead  to  larger 
forces?  Liinnol.  Oceanogr.  48:  1338-1345. 


5.  Sokal,  R.,  and  F.  J.  Rohlf.  2000.  Biometry:  the  Principles  ami 
Practice  of  Statistics  in  Biological  Research.  3rd  ed.  W.  H.  Freeman. 
New  York.  Pp.  541-548. 

n.  Trager,  G.  C.,  J.-S.  Hwang,  and  J.  R.  Strickler.  1990.  Barnacle 
suspension  feeding  in  variable  flow.  Mar.  Bin/.  105:  I  17-127. 

7.  Trager,  G.  C.,  D.  Coughlin,  A.  Genin,  Y.  Achituv,  and  A.  Gango- 
padhyay.  1992.     Foraging  to  the  rhythm  of  ocean  waves:  porcelain 
crabs  and  barnacles  synchronize  feeding  with  flow  oscillations.  J.  Exp. 
Mar.  Biol.  Ecol.  164:  73-86. 

8.  I  .  1,111,111.  J.  E.,  and  D.  O.  Duggins.  1993.     Effects  of  flow  speed  on 
growth  of  benthic  suspension  feeders.  Bi>>/.  Bull.  185:  28 — H. 

9  Sanford,  E.,  D.  Bermudez,  M.  I).  Bertness,  and  S.  D.  Gaines.  1994. 
Flow,  flood  supply  and  acorn  barnacle  population  dynamics.  Mar. 
Ecol.  Prog.  Ser.  104:  49-62. 

10.  Gaylord,  B.  1999.  Detailing  agents  of  physical  disturbance:  wave- 
induced  velocities  and  accelerations  of  a  rocky  shore.  J.  Exp.  Mar. 
Bio/.  Ecol.  239:  85-124. 


Reference:  Biol.  Bull.  206:  125-133.  (June  2004) 
©  2004  Marine  Biological  Laboratory 


Microscopic,  Biochemical,  and  Molecular 

Characteristics  of  the  Chilean  Blob  and  a  Comparison 

With  the  Remains  of  Other  Sea  Monsters: 

Nothing  but  Whales 


SIDNEY  K.  PIERCE1-*,  STEVEN  E.  MASSEY1.  NICHOLAS  E.  CURTIS'. 
GERALD  N.  SMITH,  JR.2,  CARLOS  OLAVARJRIA3,  AND  TIMOTHY  K.  MAUGEL4 

1  Department  of  Biology.  University  of  South  Florida,  Tampa.  Florida  33620:  ~  Department  of 

Medicine.  Division  of  Rheumatology,  Indiana  University  School  of  Medicine.  Indianapolis.  Indiana 

46202;  ~  Centra  de  Estudios  del  Cuaternario  Fue go-Patagonia  y  Antdrtica  Pimta  Arenas.  Chile,  and 

School  of  Biological  Sciences.  University  of  Auckland.  Private  Bag  92019.  Auckland.  New  Zealand:  and 

4  Department  of  Biology.  University  of  Maryland,  College  Park.  Man-land  20742 


Abstract.  We  have  employed  electron  microscopic,  bio- 
chemical, and  molecular  techniques  to  clarify  the  species  of 
origin  of  the  "Chilean  Blob."  the  remains  of  a  large  sea 
creature  that  beached  on  the  Chilean  coast  in  July  2003. 
Electron  microscopy  revealed  that  the  remains  are  largely 
composed  of  an  acellular.  fibrous  network  reminiscent  of 
the  collagen  fiber  network  in  whale  blubber.  Amino  acid 
analyses  of  an  acid  hydrolysate  indicated  that  the  fibers  are 
composed  of  31%  glycine  residues  and  also  contain  hy- 
droxyproline  and  hydroxylysine,  all  diagnostic  of  collagen. 
Using  primers  designed  to  the  mitochondria!  gene  ntid2.  an 
800-bp  product  of  the  polymerase  chain  reaction  (PCR)  was 
amplified  from  DNA  that  had  been  purified  from  the  car- 
cass. The  DNA  sequence  of  the  PCR  product  was  100% 
identical  to  nad2  of  sperm  whale  (Physeter  catadori).  These 
results  unequivocally  demonstrate  that  the  Chilean  Blob  is 
the  almost  completely  decomposed  remains  of  the  blubber 
layer  of  a  sperm  whale.  This  identification  is  the  same  as 
those  we  have  obtained  before  from  other  relics  such  as  the 
so-called  giant  octopus  of  St.  Augustine  (Florida),  the  Tas- 
manian  West  Coast  Monster,  two  Bermuda  Blobs,  and  the 
Nantucket  Blob.  It  is  clear  now  that  all  of  these  blobs  of 
popular  and  cryptozoological  interest  are.  in  fact,  the  de- 
composed remains  of  large  cetaceans. 


Received  13  February  2004;  accepted  5  April  2004. 
*  To   whom   correspondence   should   be   addressed.    E-mail:    pierced1 
cas.usf.edu 


Introduction 

Sea  monsters  have  been  reported  since  ancient  times.  For 
instance.  Homer  described  the  sea  monsters  Scylla  and 
Charybdis",  the  Bible  spoke  of  Leviathan;  and  St.  Brendan 
encountered  the  beast  Jasconius.  Later  on,  world-roving 
mariners  such  as  Columbus,  Magellan,  and  Cook  described 
encounters  with  sea  monsters.  Many  of  these  accounts  have 
been  variously  attributed  to  early  descriptions  of  cetaceans 
or  other  large  aquatic  mammals,  to  misidentification  of 
natural  phenomena,  or  simply  to  overactive  imaginations. 
Because  the  deep  sea  is  still  difficult  to  explore,  tales  of 
large  marine  creatures,  new  to  science,  are  rarely  substan- 
tiated through  direct  field  observations.  However,  a  few 
monsters,  like  the  Nordic  tale  of  the  Kraken — a  large  and 
ferocious  squid-like  animal — may  have  a  basis  in  reality,  as 
shown  by  the  recovery  last  year  of  an  intact  colossal  squid 
Mesonyclwteiithis  hamilttmi  ( http://news.nationalgeographic. 
com/news/2003/04/0423_030423_seamonsters.html),  com- 
plete with  hooklike  tentacles  and  eyes  the  size  of  dinner 
plates. 

For  over  a  century  the  amorphous,  decomposed  remains 
of  large  animals  have  washed  onto  beaches  around  the 
world.  Lacking  a  skeleton,  or  other  identifiable  morphology, 
a  positive  identification  of  the  remains  is  problematic,  es- 
pecially by  untrained  observers.  Wild  claims,  especially  in 
the  nonscientific  literature,  are  regularly  made  that  the  blobs 
are  the  remains  of  sea  monsters.  For  example,  the  Tasma- 
nian  West  Coast  Monster  is  still  referred  to  as  a  monster. 


125 


126 


S.   K.  PIERCE  ET  AL 


although  an  Australian  scientific  team,  led  by  W.  Bryden. 
visited  the  carcass  2  years  after  it  beached  and  identified  it 
as  a  whale  (Wall.  1981).  Other  relics  such  as  the  St.  Au- 
gustine (Florida)  Sea  Monster  and  the  Bermuda  Blob  are 
still  described  by  some  as  the  remains  of  a  gigantic  octopus 
(Octopus  gig(intens).  even  though  A.  E.  Verrill — who 
named  the  St.  Augustine  specimen  sight  unseen — recanted 
his  identification  in  favor  of  whale  remains  (Verrill.  1897a. 
b.  c).  and  in  spite  of  microscopic  and  biochemical  analyses 
showing  that  they  were  nothing  more  than  the  collagenous 
matrix  of  whale  blubber  (Pierce  et  til..  1995) 

Last  summer  another  blob  washed  ashore,  this  time  on  a 
beach  in  Chile  (Fig.  1 ).  The  Chilean  Blob  rapidly  generated 
a  large  amount  of  media  interest  around  the  world,  and 
several  immediate,  and  varied,  identifications  were  made 
(including  O.  gigantem).  almost  all  by  novices  with  no 
more  evidence  than  images  of  the  carcass  on  the  beach 
displayed  on  the  Internet.  Yet  Chilean  scientists,  including 
G.  P.  Sanino  of  the  Centre  for  Marine  Mammals  Research 
Leviathan  in  Santiago,  had  visited  the  grounding  site  and 
had  identified  the  remains  as  that  of  a  whale  (pers.  comm.). 

To  augment  the  gross  anatomical  observations  of  the 
carcass,  we  have  obtained  samples  of  the  Chilean  relic  and 
have  used  a  variety  of  techniques — including  polymerase 
chain  reaction  (PCR)  on  recovered  DNA — to  establish  its 
true  identity.  In  addition,  we  have  compared  the  results  with 
those  we  have  obtained  from  several  other  blobs,  including 


some  that  have  previously  been  reported  (Pierce  el  ul.. 
1995). 

Materials  and  Methods 

Samples  of  carcasses 

All  of  the  carcasses  were  sampled  by  others  and  sent  to  us 
in  a  variety  of  states  of  preservation.  The  Chilean  Blob  (Fig. 
1 )  was  sampled  from  its  location  on  Pinuno  Beach.  Los 
Muermos.  Chile,  within  a  few  days  after  it  was  discovered 
on  26  July  2003.  by  Elsa  Cabrera  of  the  Chilean  Centro  de 
Conservacion  Cetacea.  Some  of  the  tissue  was  preserved  in 
ethanol.  and  some  was  fresh  frozen.  The  material  was 
shipped  to  Tampa  by  overnight  express,  and  the  frozen 
tissue  had  thawed  by  the  time  it  reached  us.  The  St.  Augus- 
tine carcass  was  originally  sampled  by  Dewitt  Webb.  M.D.. 
in  1896.  Apparently  it  was  initially  preserved  in  formalin, 
which  solution  it  was  in  when  given  to  us  by  Professor 
Eugenie  Clark  in  1995  (Pierce  et  at..  1995).  Bermuda  Blob 
1.  also  provided  by  Professor  Clark,  washed  onto  Bermuda 
in  1995  and  was  also  preserved  in  formalin  when  it  was 
sampled  (Pierce  et  ul..  1995).  Bermuda  Blob  2  beached  in 
January  1997.  Professor  Wolfgang  Sterrer  of  the  Bermuda 
Biological  Laboratory  provided  us  with  both  formalin-fixed 
and  fresh-frozen  samples.  The  Tasmanian  West  Coast  mon- 
ster arrived  on  the  beach  in  northwestern  Tasmania  in  1960, 
where  it  sat.  mostly  buried  in  sand,  until  it  was  sampled  in 


Figure  I.     The  Chilean  carcass  as  it  was  found  on  Pinuno  Beach    Pholo  b>   Klsu  Cabrera  i»>  E.  Cabrera. 
2003) 


CHILEAN  BLOB   IDENTIFICATION 


127 


1962.  After  the  existence  of  the  monster  was  called  to  our 
attention  by  Leonard  Wall — a  member  of  the  scientific  party 
that  sampled  it — Curator  A.  P.  Andrews  of  the  Tasmanian 
Museum  and  Art  Gallery  in  Hobart  provided  us  with  a 
sample  in  an  unknown  fixative  which,  by  its  odor,  contained 
ethanol.  Finally,  the  Nantucket  Blob  washed  onto  Nantucket 
Island.  Massachusetts,  sometime  during  November  1996.  A 
sample  was  collected,  frozen,  and  sent  to  us  by  personnel  in 
the  Nantucket  Shellfish  Warden's  office. 

Microscopy 

The  original  conditions  of  preservation  of  the  relics  were 
unsatisfactory  for  electron  microscopy.  So,  small  pieces 
were  cut  off  of  each  and  soaked,  at  least  overnight,  in 
several  changes  of  filtered  (0.2  ;um)  artificial  seawater.  They 
were  then  placed  into  2%  glutaraldehyde  and  taken  through 
the  same  fixation,  embedding,  and  sectioning  procedures 
that  were  described  previously  for  the  St.  Augustine  and 
Bermuda  Blob  1  carcasses  (Pierce  et  al..  1995).  The  sections 
were  viewed  and  photographed  with  a  transmission  electron 
microscope  (Zeiss  EM  10  or  Phillips  Morgagni). 

Hydrolysis 

Preliminary  examination  of  the  samples  prepared  for  mi- 
croscopy suggested  strongly  that  all  of  the  remains  were 
almost  exclusively  composed  of  collagen  fibers,  as  we  had 
found  before  with  the  St.  Augustine  and  Bermuda  Blob  1 
carcasses  (Pierce  et  al.,  1995).  To  confirm  the  collagen 
identification,  the  amino  acid  compositions  of  hydrolysates 
of  the  carcass  samples  was  determined  as  follows.  Small 
pieces  were  cut  off  and  soaked  in  seawater  as  above.  Each 
piece  was  placed  into  5N  HC1  and  heated  overnight  at  100 
°C.  The  hydrolysate  was  neutralized  with  concentrated 
NaOH.  mixed  1 : 1  with  ethanol,  brought  to  a  boil,  and  finally 
centrifuged  at  20,000  X  g  for  20  min.  The  supernatant  was 
lyophilized,  and  the  residue  was  taken  up  in  an  appropriate 
volume  of  lithium  citrate  buffer.  The  amino  acid  composi- 
tion of  this  solution  was  determined  with  a  ninhydrin-based, 
HPLC  analysis  (Pierce  et  al.,  1995).  Amino  acid  composi- 
tion was  calculated  as  residues/1000  amino  acids. 

Molecular  until  vsis 

The  Chilean  carcass  was  subjected  to  two  independent 
molecular  analyses.  First,  in  Tampa  (done  by  authors  SEM 
and  NEC).  DNA  was  obtained  from  the  frozen-thawed, 
unfixed  tissue  by  phenol/chloroform  extraction,  followed  by 
ethanol  precipitation.  The  DNA  was  amplified  in  PCR  using 
the  temperature  profile  described  previously  (Carr  et  til.. 
2002).  The  sequence  of  the  universal  primers  corresponded 
to  the  vertebrate  mitochondrial  nad2  gene — the  same  se- 
quence used  to  identify  Physeter  catadon  ( —  niacrocepha- 
lus)  (sperm  whale)  as  the  source  of  the  Newfoundland  Blob 


(Carr  et  al..  2002).  A  single.  800-bp  PCR  product  was 
obtained,  then  cloned  into  the  pPCR-Script  Amp  SK  (  +  ) 
plasmid  (Stratagene)  and  sequenced  (model  CEQ  8000. 
Beckman-Coulter)  using  the  CEQ  DTCS  Quick  Start  Kit 
(Beckman-Coulter)  and  T3  sequencing  primer. 

The  second  independent  analysis  of  the  Chilean  Blob  was 
carried  out  in  Auckland,  New  Zealand  (by  author  CO). 
Genomic  DNA  was  extracted  with  phenol/chloroform  from 
three  subsamples  taken  from  an  original  10-g,  ethanol- 
preserved  piece  of  tissue  which  was  shipped  to  New  Zea- 
land by  Ms.  Cabrera.  An  800-bp  portion  of  the  mtDNA 
control  region,  proximal  to  the  Pro-tRNA  gene,  was  ampli- 
fied by  PCR  from  two  of  the  subsamples.  using  primer 
sequences  Dip- 1.5  (Dalebout  ct  til..  1998)  and  Dlp-8G 
(Lento  c;  til..  1998;  Pichler  ct  til..  2001).  The  temperature 
profile  consisted  of  a  2-min  preliminary  denaturing  period  at 
94  °C,  followed  by  35  cycles  of  30-s  denaturing  at  94  °C, 
40  s  of  annealing  at  54  °C,  and  40  s  extension  at  72  °C. 
Amplification  and  subsequent  cycle  sequencing  were  im- 
proved by  the  addition  of  an  M13  tag  to  the  5'  end  of  the 
Dip- 1.5  primer.  The  PCR  products  were  sequenced  (model 
ABI3100.  Applied  Biosystems)  in  both  directions,  using  the 
BigDye  cycle  sequencing  kit,  with  M13Dlp-l.5  and  Dlp-8G 
as  the  sequencing  primers. 

In  addition  to  the  Chilean  Blob,  we  attempted,  in  Tampa, 
to  extract  DNA  from  samples  of  all  the  other  remains. 
However,  either  because  the  samples  of  the  other  blobs  were 
too  small  or  because  their  preservation  was  wrong,  only  the 
Nantucket  Blob  yielded  amplifiable  DNA.  A  single.  800-bp 
PCR  product  was  obtained  from  the  Nantucket  Blob,  using 
the  temperature  profile  of  Carr  et  al.  (2002)  and  the  se- 
quencing procedure  that  we  described  above.  Subsequently, 
primers  designed  to  the  D-loop  region  of  whale  mitochon- 
drial DNA  (Wada  et  al..  2003)  were  also  used  to  amplify  a 
single  1100-bp  PCR  product  from  the  Nantucket  Blob, 
which  was  sequenced  as  described  above  using  T3  and  T7 
primers.  The  amplification  conditions  were  an  initial  90-s 
denaturation  at  94  °C,  30  cycles  of  a  30-s  denaturation  at  94 
°C,  a  30-s  annealing  at  55  °C,  and  a  45-s  extension  at  72  °C. 
followed  by  a  final  240-s  extension  at  72  °C. 


Results 


Fine  structure 


The  microscopic  anatomy  of  all  the  carcasses,  including 
the  Chilean  Blob,  is  virtually  identical  (Figs.  2,  3).  These 
large  masses  consist  almost  entirely  of  pure  collagen  fibers 
arranged  in  cross-hatched  layers,  often  perpendicular  to 
each  other.  This  arrangement  is  exactly  that  of  the  collagen 
fiber  infrastructure  of  freshly  preserved  humpback  whale 
blubber  (Fig.  2)  (see  also  Pierce  et  al..  1995)  and  is  totally 
unlike  the  fine  structure  of  octopus  or  squid  mantle, 
which  consists  mostly  of  muscle  fibers  with  only  a  few 
collasen  fibers  (Pierce  et  al..  1995).  Furthermore,  al- 


128 


S.  K.  PIERCE  ET  AL. 


Figure  2.  Electron  micrographs  of  sections  oftissue  from  various  monsters.  (A)  St.  Augustine  carcass  (from 
Pierce  et  al.,  1995);  scale  bar  =  5  /xm.  (B)  Bermuda  Blob  I  (from  Pierce  ct  <//..  1995);  scale  har  =  5  xim.  «-'> 
Tasmaiiian  \\  est  ('oust  Monstei;  scale  har  =  2  /xm.  (D)  Bermuda  Blob  2:  scale  har  =  5  /xm.  (E)  Nantucket  Bloh; 
scale  har  =  5  /xm.  (F)  Humpback  whale  blubber  (from  Pierce  ct  nl..  1995);  scale  bar  =  2  /am.  In  all  cases,  the 
(issues  are  composed  entirely  ol  collagen  libers  arranged  in  layers  of  perpendicularly  running  liber  bundles.  No 
cellular  elements  were  found.  Bacteria  were  often  present  amidst  the  libers  in  the  carcasses  and  can  he  seen  in 
A,  C,  and  I)  lanowsi. 


though  the  fiber  layers  in  the  blobs  are  much  thicker  than 
those  in  vertebrate  skin,  the  arrangement  of  the  collagen 
libers  in  the  two  sites  are  similar  (See  Discussion).  Vir- 


tually no  cellular  remnants,  other  than  bacteria  and  bac- 
terial cysts,  were  found  in  any  of  the  carcasses,  reflecting 
their  advanced  state  of  decay. 


CHILEAN  BLOB   IDENTIFICATION 


129 


Figure  3.  Electron  micrographs  of  tissue  sections  from  the  Chilean  Blob.  (A)  Lower  magnification.  Scale 
bar  =  2  jam.  (B)  The  banding  pattern  on  the  tibers  is  evident.  As  with  the  other  carcasses,  no  cellular  structures 
were  present,  but  bacteria  (bottom  center  of  A)  were  often  seen.  Scale  bar  =  1  /j,m. 


Aiiiino  uciil  composition 

The  amino  acid  compositions  of  the  hydrolysates  of  all 
the  carcasses  were  very  similar,  and  they  were  also 
diagnostic  of  collagen.  The  amino  acids  in  each  blob 
hydrolysate  consisted  of  about  3Qc/c  glycine  residues,  and 
all  contained  residues  of  hydroxyproline  and  hydroxy- 
lysine  (Table  1). 


DNA  sequences 

The  587-bp  consensus  sequence  (Genbank  accession 
number  AY582746)  obtained  from  four  sequencing  runs  on 
the  DNA  extracted  in  Tampa  from  the  Chilean  carcass  was 
100%  identical  to  the  mitochondrial  naJ2  gene  sequence  of 
P.  artadon  (Genbank  accession  numbers  AJ277029, 
AF414121)  (Fig.  4).  Sequencing  of  the  PCR  product  ob- 


Table  1 
Comparative  iiiiiino  </</</  t_i>nipit\i!ions  of  ihe  hlnh  ii\\iie  samples  following  uciti  /n<//'c/Y.w.v  frtilut'\  ure  uniino  uciil  residues/1000  i 


Amino  acid 

Chilean 

St  Augustine'1 

Bermuda  1J 

Bermuda  2 

Tasmuniun 

Nantucket 

Asp 

28 

50 

52 

42 

31 

45 

Thr 

22 

28 

27 

19 

ll> 

23 

Ser 

40 

45 

47 

36 

50 

35 

OH-Pro 

90 

54 

74 

113 

84 

146 

Pro 

213 

169 

88 

182 

92 

136 

Glu 

63 

82 

83 

62 

78 

63 

Gly 

314 

33(1 

339 

298 

363 

280 

Ala 

96 

106 

113 

94 

133 

94 

Val 

13 

18 

25 

21 

22 

22 

Cys 

0 

0 

0 

0 

0 

0 

Met 

4 

0 

0 

3 

1 

3 

He 

8 

11 

14 

10 

11 

11 

Leu 

25 

28 

32 

23 

30 

25 

Tyr 

3 

0 

0 

0 

0 

6 

Phe 

12 

14 

Id 

12 

15 

14 

OH-Lys 

11 

15 

13 

26 

7 

20 

Lys 

21 

0.4 

10 

18 

12 

25 

His 

6 

4 

6 

0 

0 

X 

Arg 

29 

48 

55 

42 

51 

45 

J  Data  taken  from  Pierce  et  al.,  1995. 


130 


S.   K.  PIERCE  ET  AL 


1  60 

Physeter  catadon   TAATACTAACTATATCCCTACTCTCCATTCTCATCGGGGGTTGAGGAGGACTAAACCAGA 
Chilean  Blob       TAATACTAACTATATCCCTACTCTCCATTCTCATCGGGGGTTGAGGAGGACTAAACCAGA 

61  120 

Physeter  catadon   CTCAACTCCGAAAAATTATAGCTTACTCATCAATCGCCCACATAGGATGAATAACCACAA 
Chilean  Blob       CTCAACTCCGAAAAATTATAGCTTACTCATCAATCGCCCACATAGGATGAATAACCACAA 

121  180 

Physeter  catadon   TCCTACCCTACAATACAACCATAACCCTACTAAACCTACTAATCTATGTCACAATAACCT 
Chilean  Blob       TCCTACCCTACAATACAACCATAACCCTACTAAACCTACTAATCTATGTCACAATAACCT 

181  240 

Physeter  catadon   TCACCATATTCATACTATTTATCCAAAACTCAACCAl^ACCACACTATCTCTGTCCCAGA 
Chilean  Blob       TCACCATATTCATACTATTTATCCAAAACTCAACCACAACCACACTATCTCTGTCCCAGA 

241  300 

Physeter  catadon   CATGAAACAAAACACCCATTACCACAACCCTTACCATACTTACCCTACTTTCCATAGGGG 
Chilean  Blob       CATGAAACAAAACACCCATTACCACAACCCTTACCATACTTACCCTACTTTCCATAGGGG 

301  360 

Physeter  catadon   GCCTCCCACCACTCTCGGGCTTTATCCCCAAATGAATAATTATTCAAGAACTAACAAAAA 
Chilean  Blob       GCCTCCCACCACTCTCGGGCTTTATCCCCAAATGAATAATTATTCAAGAACTAACAAAAA 

361  420 

Physeter  catadon   ACGAAACCCTCATCATACCAACCTTCATAGCCACCACAGCATTACTCAACCTCTACTTCT 
Chilean  Blob       ACGAAACCCTCATCATACCAACCTTCATAGCCACCACAGCATTACTCAACCTCTACTTCT 

421  480 

Physeter  catadon   ATATACGCCTCACCTACTCAACAGCACTAACCCTATTCCCCTCCACAAATAACATAAAAA 
Chilean  Blob       ATATACGCCTCACCTACTCAACAGCACTAACCCTATTCCCCTCCACAAATAACATAAAAA 

481  540 

Physeter  catadon   TAAAATGACAATTCTACCCCACAAAACGAATAACCCTCCTGCCAACAGCAATTGTAATAT 
Chilean  Blob       TAAAATGACAATTCTACCCCACAAAACGAATAACCCTCCTGCCAACAGCAATTGTAATAT 

541  587 

Physeter  catadon   CAACAATACTCCTACCCCTTACACCAATACTCTCCACCCTATTATAG 
Chilean  Blob       CAACAATACTCCTACCCCTTACACCAATACTCTCCACCCTATTATAG 

Figure  4.     Alignment  of  sperm  whale  niul2  micleolide  sequence  with  that  of  the  PCR  product  from  the 
Chilean  Blob  DNA.  The  sequences  are  identical. 


tuined  from  the  Chilean  Blob  in  the  Auckland  extraction  had 
a  .xS2-bp  consensus  sequence  (Genbank  accession  number 
AY  582747]  that  was  99%  identical  to  the  mitochondria! 
control  region  sequence  of  P.  dilution  (Genbank  accession 
numbers  AJ277029.  X72203,  M93I54).  The  sequence  ob- 
tained in  Auckland  for  the  Chilean  Blob  differed  by  a  single 
nucleotide  from  the  three  P.  ctilatlon  sequences  in  the  da- 
tabase (Fig.  5).  The  tirst  429-bp  consensus  sequence  ob- 
tained from  the  Nantucket  Blob  DNA  was  99%  identical 
with  the  mitochondria]  nutl2  gene  sec|uence  of  Balaenoptera 
l>liy.\tiln.\  (linback  whale)  (Genbank  accession  number 
\dll45):  onl\  a  single  micleotiile  was  different  (data  not 
show  in  I  he  subsequent  1 055-bp  consensus  sequence  (Gen- 
bank accession  number  AY58748)  obtained  from  2  -4  se- 
quencing runs  on  the  Nantucket  Blob  DNA  was  99%  iden- 
tical to  the  control  region  of  li.  />/;V.SY//I/.V  mitochondria! 
DNA  (Genbank  accession  number  X6I145).  with  oiilv  six 
nucleotide  differences  (F-'ig.  6). 


Discussion 

The  molecular  results  reported  here  provide  irrefutable 
evidence  that  the  Chilean  carcass  was  the  highly  decom- 
posed remains  of  a  sperm  whale.  The  nearly  100' <  match 
between  the  two  gene  sequences  obtained  in  our  PCR  ex- 
periments and  the  Phyxi-tcr  dilution  gene  sequences  leaves 
no  other  possibility.  The  match  between  the  Nantucket  Blob 
DNA  and  the  control  region  mitochondria]  DNA  ot '  Huliifn- 
optcru  I'/ivsdlii.s  is  equally  robust,  leaving  no  doubt  about 
the  specific  identity  of  that  relic.  The  six  nucleolide  differ- 
ences observed  were  consistent  with  \ariation  within  the  fin 
whale  species  and  may  indicate  a  different  subpopulation 
from  the  previously  published  sequence  (Arnason  <•/  <//.. 
1991).  although  even  if  this  is  case,  both  sequences  were 
from  specimens  of  North  Atlantic  origin.  UnfortunateU  .  our 
attempts  to  extract  usable  DNA  from  the  other  monsters 
were  not  successful,  due  most  likelv  to  some  combination  of 


CHILEAN   BLOB   IDENTIFICATION 


131 


Physeter  catadon 
Chilean  Blob 


1  60 

CATCATAGATAAATACAAACCCACAGTGCTATGTCAGTATTAAAAATAACCCACCCAATT 
CATCATAGATAAATACAAACCCACAGTGCTATGTCAGTATTAAAAATAACTCACCCAATT 


Physeter  catadon 
Chilean  Blob 


61  120 

ACATCTTTCCTACTCCCGACCATACCAATGCCCCCATGCCAATATTCAGCGTTCTCCCTG 
ACATCTTTCCTACTCCCGACCATACCAATGCCCCCATGCCAATATTCAGCGTTCTCCCTG 


Physeter  catadon 
Chilean  Blob 


121  180 

TAAATGTATACATGTACACGCTATGTATAATAGTGrATTCAATTATTTTCACTACGATCA 
TAAATGTATACATGTACACGCTATGTATAATAGTGCATTCAATTATTTTCACTACGATCA 


Physeter  catadon 
Chilean  Blob 


181  240 

GTGAAAGCTCGTATTAAATCTTATTAATTTTACATATTACATAAAATTATGGATCGTACA 
GTGAAAGCTCGTATTAAATCTTATTAATTTTACATATTACATAAAATTATGGATCGTACA 


Physeter  catadon 
Chilean  Blob 


241  300 

TAGGACATATCCTTAAATCAACTCCAGTCCCCTGAAATTATGAGCTCTCGGATCAGACCA 
TAGGACATATCCTTAAATCAACTCCAGTCCCCTGAAGTTATGAGCTCTCGGATCAGACCA 


Physeter  catadon 
Chilean  Blob 


301  360 

CGAGCTTGATCACCATGCCGCGTGAAACCAGCAACCCGCTTGGCAGGGACTCACTATTAT 
CGAGCTTGATCACCATGCCGCGTGAAACCAGCAACCCGCTTGGCAGGGACTCACTATTAT 


Physeter  catadon 
Chilean  Blob 


361  420 

TGTATCTCAGGCCCATTCCTCGAAAGCCGTGCTACTCCGTGGTTTTTCCAAGGCCTCTAG 
TGTATCTCAGGCCCATTCCTCGAAAGCCGTGCTACTCCGTGGTTTTTCCAAGGCCTCTAG 


Physeter  catadon 
Chilean  Blob 


421  480 

TTGCAATTCTCAGGGTCATAACTCGAGGCACCTGCGCTAGTTCCAGCTTTTTCCAAGGCC 
TTGCAATTCTCAGGGTCATAACTCGAGGCACCTGCGCTAGTTCCAGCTTTTTCCAAGGCC 


Physeter  catadon 
Chilean  Blob 


481  540 

TCGGCTTGGACCTGAGAGCAGGAGCCTCCACCCTATTAATCACTCACGGGGGGAGTTATA 
TCGGCTTGGACCTGAGAGCAGGAGCCTCCACCCTATTAATCACTCACGGGGGGAGTTATA 


541 

Physeter   catadon      GGCATCTGGTCG 
Chilean    Blob  GGCATCTGGTCG 

Figure  5.     Alignment  of  sperm  whale  mtDNA  control  region  nucleotide  sequence  with  that  of  the  PCR 
product  from  the  Chilean  Blob  DNA.  Nucleotide  differences  are  indicated  in  boldface  and  underlined. 


method  of  preservation,  small  sample  size,  or  advanced 
stage  of  decomposition.  However,  when  the  microscopic 
anatomy  and  biochemical  composition  of  the  Chilean  and 
Nantucket  Blobs  are  compared  with  those  of  the  other 
remains,  similarities  are  manifest.  Thus,  there  is  no  doubt 
that  they  are  all  derived  from  the  same  type  of  organism. 

The  amino  acid  composition  of  the  hydrolysates  of  all  the 
blobs  consists  of  about  30%  glycine  residues  along  with  some 
hydroxyproline  and  hydroxylysine  residues.  Only  collagen  has 
such  an  amino  acid  composition  (Eastoe,  1955;  Kimura  et  al, 
19691.  While  there  are  some  differences  among  the  amino  acid 
compositions  of  the  blob  hydrolysates — likely  resulting  from 
differences  in  preservation  as  well  as  species — the  results 
indicate  that  all  the  blobs,  including  the  Chilean  and  Nantucket, 
are  large  masses  of  collagen. 

The  collagenous  matrix  of  the  blobs  is  confirmed  by  their 
fine  structure.  They  are  all  composed  of  bundles  of  long, 
banded  fibers  that  are  similar  in  their  dimensions,  not  only 


to  each  other,  but  also  to  the  collagen  fibers  in  rat  tail  tendon 
(see  Pierce  et  til.,  1995).  The  bundles  of  fibers  are  arranged 
parallel  to  each  other  in  layers,  and  each  layer  is  sandwiched 
between  perpendicularly  oriented  layers  of  other  fiber  bun- 
dles. The  fiber  layering  pattern  is  similar  to  the  arrangement 
of  collagen  fibers  in  vertebrate  dermis  (Moss,  1972),  and 
identical  to  the  collagen  fiber  pattern  in  humpback  whale 
blubber  and  in  all  the  other  blobs.  In  addition,  the  unimodal 
fiber  diameter  and  the  tight  packaging  of  the  fibers  in  the 
Chilean  Blob  and  the  others  is  characteristic  of  mammalian 
dermis,  including  pygmy  sperm  whale  blubber  (Craig  et  a!.. 
1987)  and  our  humpback  blubber  control.  Collagen  is  much 
less  abundant  in  octopus  and  squid  mantle,  which  are  com- 
posed primarily  of  muscle;  and  the  few  collagen  fibers 
present  in  these  molluscan  species  are  not  arranged  in  the 
network  (Pierce  et  til.,  1995)  so  obvious  in  the  Chilean  Blob 
and  the  other  blob  tissue  samples.  Thus,  both  the  biochem- 
ical and  microscopic  analyses  show  clearly  that  the  Chilean 


132  S.  K.  PIERCE  ET  AL. 

1  60 

Balaenoptera  physalus  CCTCCCTAAGACTCAAGGAAGAAGTATTACACTCCACCATCAGCACCCAAAGCTGAAGTT 
Nantucket  Blob        CCTCCCTAAGACTCAAGGAAGAAGTATTACACTCCACCATCAGCACCCAAAGCTGAAGTT 

61  120 

Balaenoptera  physalus  CTACATAAACTATTCCCTGAAAAAGTATATTGTACAATAACCACAGGACCACAGTACTAT 
Nantucket  Blob         CTACATAAACTATTCCCTGAAAAAGTATATTGTACAATAACCACAGGACCACAGTACTAT 

121  180 

Balaenoptera  physalus  GTCCGTATTGAAAATAACTTGCCTTATTAGATATTATTATGTAACTCGTGCATGCATGTA 
Nantucket  Blob         GTCCGTATTGAAAATAACTTGCCTTATTAGATATTATTATGTAACTCGTGCATGTATGTA 

181  240 

Balaenoptera  physalus  CTTCCACATAATTAATAGCGTCTTTCCATGGGTATGAACAGATATACATGCTATGTATAA 
Nantucket  Blob        CTTCCACATAATTAATAGCGTCTTTCCATGGGTATGAACAGATATACATGCTATGTATAA 

241  300 

Balaenoptera  physalus  TTGTGCATTCAATTATTTTCACCACGAGCAGTTGAAGCTCGTATTAAATTTTATTAATTT 
Nantucket  Blob         TTGTGCATTCAATTATTTTCACCACGAGCAGTTGAAGCTCGTATTAAATTTTATTAATTT 

301  360 

Balaenoptera  physalus  TACATATTACATAATATGTATTAATAGTACAATAGCGCATO'i  TCTTATGCATCCCCAGAT 
Nantucket  Blob         TACATATTACATAATATGTATTAATAGTACAATAGCGCATGTTCTTATGCATCCCCAGGT 

361  420 

Balaenoptera  physalus  CTATTTAAATCAAATGATTCCTATGGCCGCTCCATTAGATCACGAGCTTAGTCAGCATGC 
Nantucket  Blob         TTATTTAAATCAAATGATTCTTATGGCCGCTCCATTAGATCACGAGCTTAGTCAGCATGC 

421  480 

Balaenoptera  physalus  CGCGTGAAACCAGCAACCCGCTTGGCAGGGATCCCTCTTCTCGCACCGGGCCCATCACTC 
Nantucket  Blob         CGCGTGAAACCAGCAACCCGCTTGGCAGGGATCCCTCTTCTCGCACCGGGCCCATTAATC 

481  540 

Balaenoptera  physa 1  us  GTGGGGGTAGCTATTTAATGATCTTTATAAGACATCTGGTTCTTACTTCAGGACCATATT 
Nantucket  Blob         GTGGGGGTAGCTATTTAATGATCTTTATAAGACATCTGGTTCTTACTTCAGGACCATATT 

541  600 

Ba laenoptera  physa lus  AACTTAAAATCGCCCACTCGTTCCCCTTAAATAAGACATCTCGATGGGTTAATTACTAAT 
Nantucket  Blob        AACTTAAAATCGCCCACTCGTTCCCCTTAAATAAGACATCTCGATGGGTTAATTACTAAT 

601  660 

Balaenoptera  physalus  CAGCCCATGATCATAACATAACTGAGGTTTCATACATTTGGTATTTTTTTATTTTTTTTG 
Nantucket  Blob         CAGCCCATGATCATAACATAACTGAGGTTTCATACATTTGGTATTTTTTTATTTTTTTTG 

661  720 

Balaenoptera  physalus  GGGGGCTTGCACGGACTCCCCTATGACCCTAAAGGGTCTCGTCGCAGTCAGATAAATTGT 
Nantucket  Blob         GGGGGCTTGCACGGACTCCCCTATGACCCTAAAGGGTCTCGTCGCAGTCAGATAAATTGT 

721  780 

Balaenoptera  physalus  AGCTGGGCCTGGATGTATTTGTTATTTGACTAGCACAACCAACATGTGCAGTTAAATTAA 
Nantucket  Blob         AGCTGGGCCTGGATGTATTTGTTATTTGACTAGCACAACCAACATGTGCAGTTAAATTAA 

781  840 

Balaenoptera  physalus  TGGTTACAGGACATAGTACTCCACTATTCCCCCCGGGCTCAAAAAACTGTATGTCTTAGA 
Nantucket  Blob         TGGTTACAGGACATAGTACTCCACTATTCCCCCCGGGCTCAAAAAACTGTATGTCTTAGA 

841  900 

Balaenoptera  physalus  GGACCAAACCCCCCTCCTTCCATACAATACTAACCCTCTGCTTAGATATTCACCACCCCC 
Nantucket  Blob         GGACCAAACCCCCCTCCTTCCATACAATACTAACCCTCTGCTTAGATATTCACCACCCCC 

901  960 

Balaenoptera  physalus  CTAGACAGGCTCGTCCCTAGATTTAAAAGCCATTTTATTTATAAATCAATACTAAATCTG 
Nantucket  Blob         CTAGACAGGCTCGTCCCTAGATTTAAAAGCCATTTTATTTATAAATCAATACTAAATCTG 

961  1020 

Ba laenoptera  physa lus  ACACAAGCCCAATAATGAAAATACATGAACGrCATCCCTATCCAATACGTTGATGTAGCT 
Nantucket  Blob        ACACAAGCCCAATAATGAAAATACATGAACGCCATCCCTATCCAATACGTTGATGTAGCT 

1021  1055 

Balaenoptera  physalus  TAAACACTTACAAAGCAAGACACTGAAAATGTCTA 
Nantucket  Blob         TAAACACTTACAAAGCAAGACACTGAAAATGTCTA 

Figure  6.     Alignment  of  tin  whale  mitochondria!  control  region  nucleotide  sequence  with  that  of  the  PCR 
product  from  the  Nantucket  Bloh  DNA.  Nucleotide  differences  are  indicated  in  boldface  and  underlined. 


CHILEAN   BLOB   IDENTIFICATION 


133 


Blob  has  the  characteristics  of  all  the  other  blobs  and  is  the 
remains  of  the  collagen  matrix  of  whale  blubber — as  are 
they  all. 

The  results,  taken  together,  leave  no  doubt  that  all  of  the 
blobs  examined  here — St.  Augustine,  Bermuda  1.  Bermuda 
2,  Tasmanian  West  Coast,  Nantucket,  and  Chilean — repre- 
sent the  decomposed  remains  of  great  whales  of  varying 
species.  Once  again,  to  our  disappointment,  we  have  not 
found  any  evidence  that  any  of  the  blobs  are  the  remains  of 
gigantic  octopods,  or  sea  monsters  of  unknown  species. 

Acknowledgments 

This  study  was  supported  by  resources  from  the  Depart- 
ment of  Biology  at  the  University  of  South  Florida.  We 
thank  Dr.  Charles  Potter  of  the  Smithsonian  Museum  of 
Natural  History.  Washington,  DC,  for  kindly  providing  the 
sample  of  humpback  whale  blubber  from  a  specimen  in  the 
Museum's  collection.  We  also  thank  Dr.  Shiro  Wada  of  the 
National  Institute  of  Fisheries  Science,  Yokohama.  Japan, 
for  advice  on  the  PCR  conditions  for  the  Nantucket  Blob. 

Literature  Cited 

Arnason,  U.,  A.  Gullherg,  and  B.  Widegren.  1991.  The  complete 
nucleotide  sequence  of  the  mitochondria!  DNA  of  the  fin  whale.  Bal- 
iii'iioptera  physalux.  J.  Mol.  Evol.  33:  556-568. 

Carr,  S.  M.,  H.  D.  Marshall,  K.  A.  Johnstone,  L.  M.  Pynn,  and  G.  B. 
Stenson.  2002.  How  to  tell  a  sea  monster:  molecular  discrimination 
of  large  marine  animals  of  the  North  Atlantic.  Bin/.  Bull.  202:  1-5. 


Craig,  A.  S.,  E.  F.  Eikenberry,  and  D.  A.  D.  Parry.  1987.  Ultrastruc- 
tural  organization  of  skin:  classification  on  the  basis  of  mechanical  role. 
Connect.  Tissue  Res.  16:  212-223. 

Dalebout,  M.,  A.  Van  Helden,  K.  Van  Waerebeek,  and  C.  S.  Baker. 
1998.  Molecular  genetic  identification  of  southern  hemisphere 
beaked  whales  (Cetacea:  Ziphiidae).  Mol.  Ecu/.  7:  687-695. 

Eastoe,  J.  E.  1955.  The  amino  acid  composition  of  mammalian  collagen 
and  gelatin.  Biochem.  J.  61:  589-600. 

Kimura,  S.,  Y.  Nagoka,  and  M.  Kubota.  1969.  Studies  on  marine 
invertebrate  collagens.  I.  Some  collagens  from  crustaceans  and  mol- 
luscs. Bull.  Jpn.  Sue.  Sci.  Fish.  35:  743-748. 

Lento,  G.  M.,  M.  J.  Dalebout,  and  C.  S.  Baker.  1998.  Species  and 
individual  identification  of  whale  and  dolphin  products  for  sale  in  Japan 
by  mtDNA  sequences  and  nuclear  microsatellite  profiles.  Report  (SC/ 
50/O8)  to  the  Scientific  Committee  of  the  International  Whaling  Com- 
mission. Oman. 

Moss,  M.L.  1972.  The  vertebrate  dermis  and  the  integumental  skeleton. 
Am.  Zool.  12:  27-34. 

Pichler,  F.  B.,  D.  Robineau.  R.  N.  P.  Goodall,  M.  A.  Meyer,  C. 
Olavarria,  and  C.  S.  Baker.  2001.  Origin  and  radiation  of  Southern 
Hemisphere  coastal  dolphins  (genus  Cephalurhynchus).  Mol.  Ecol.  10: 
2215-2223. 

Pierce,  S.  K.,  G.  N.  Smith,  Jr.,  T.  K.  Maugel,  and  E.  Clark.  1995.  On 
the  giant  octopus  (Octopus  giganteus)  and  the  Bermuda  Blob:  homage 
to  A.  E.  Yen-ill.  Bi»l.  Bull.  188:  214-230. 

Verrill,  A.  E.  1897a.  The  supposed  great  Octopus  of  Florida:  certainly 
not  a  cephalopod.  Am.  J.  Sci.  4th  series,  3:  355. 

Verrill,  A.  E.  1897b.     The  Florida  monster.  Science  5(114):  392. 

Verrill,  A.  E.  1897c.     The  Florida  sea  monster.  Science  5(116):  476. 

Wada,  S.,  M.  Oishi,  and  T.  K.  Yaniada.  2003.  A  newly  discovered 
species  of  living  baleen  whale.  Nature  426:  278-281. 

Wall,  L.  E.  1981.  The  west  coast  monster.  1962.  Tasmanian  Naturalist 
103:  2-6. 


Reference:  Biol.  Bull.  2(16:  134-143.  (June  2004) 
©  2004  Marine  Biological  Laboratory 


Chemical  and  Visual  Communication  During  Mate 
Searching  in  Rock  Shrimp 

ELIECER  R.  DIAZ1   AND  MARTIN  THIEL1'2'* 

1  Universidad  Catolica  del  None,  Facnltad  de  Ciencias  del  Mar,  Larrondo  1281,  Coquimbo,  Chile:  and 
~  Centra  de  Estudios  Avan-ados  en  Zonas  Aridas  (CEAZA),  Coquimbo,  Chile 


Abstract.  Mate  searching  in  crustaceans  depends  on  dif- 
ferent communicational  cues,  of  which  chemical  and  visual 
cues  are  most  important.  Herein  we  examined  the  role  of 
chemical  and  visual  communication  during  mate  searching 
and  assessment  in  the  rock  shrimp  Rhynchocinetes  typus. 
Adult  male  rock  shrimp  experience  major  ontogenetic 
changes.  The  terminal  molt  stages  (named  "robustus")  are 
dominant  and  capable  of  monopolizing  females  during  the 
mating  process.  Previous  studies  had  shown  that  most  fe- 
males preferably  mate  with  robustus  males,  but  how  these 
dominant  males  and  receptive  females  find  each  other  is 
uncertain,  and  is  the  question  we  examined  herein.  In  a 
Y-maze  designed  to  test  for  the  importance  of  waterborne 
chemical  cues,  we  observed  that  females  approached  the 
robustus  male  significantly  more  often  than  the  typus  male. 
Robustus  males,  however,  were  unable  to  locate  receptive 
females  via  chemical  signals.  Using  an  experimental  set-up 
that  allowed  testing  for  the  importance  of  visual  cues,  we 
demonstrated  that  receptive  females  do  not  use  visual  cues 
to  select  robustus  males,  but  robustus  males  use  visual  cues 
to  find  receptive  females.  Visual  cues  used  by  the  robustus 
males  were  the  tumults  created  by  agitated  aggregations  of 
subordinate  typus  males  around  the  receptive  females. 
These  results  indicate  a  strong  link  between  sexual  commu- 
nication and  the  mating  system  of  rock  shrimp  in  which 
dominant  males  monopolize  receptive  females.  We  found 
that  females  and  males  use  different  (sex-specific)  commu- 
nicational  cues  during  mate  searching  and  assessment,  and 
that  the  sexual  communication  of  rock  shrimp  is  similar  to 
that  of  the  American  lobster,  where  females  are  first  at- 
tracted to  the  dominant  males  by  chemical  cues  emitted  bv 


Received  15  December  -IKI.V  accepted  15  March  2004. 

1  To  whom  correspondence  should  he  addressed.  R  mail:  ihicK"  iicn.cl 


these  males.  A  brief  comparison  between  these  two  species 
shows  that  female  behaviors  during  sexual  communication 
contribute  strongly  to  the  outcome  of  mate  searching  and 
assessment. 

Introduction 

Mating  systems  are  expressions  of  the  strategies  that  both 
sexes  use  to  find  each  other  and  mate  (Shuster  and  Wade. 
2003).  These  strategies,  mediated  by  population  demogra- 
phy and  ecological  variables,  depend  on  specific  communi- 
cation systems  between  the  sexes,  which  facilitate  mate 
finding  and  subsequently  aid  in  regulating  the  mating  pro- 
cess (Salmon,  1983).  In  crustaceans,  sexual  communication 
is  based  on  visual,  chemical,  and  acoustic  cues  (Salmon, 
1983;  Hughes,  1996;  Bushmann,  1999).  but  chemical  sig- 
nals are  of  major  importance  in  most  aquatic  species 
(Atema,  1995).  In  many  species,  individuals  are  dispersed 
over  variable  distances,  and  mating  partners  need  to  locate 
each  other  during  the  searching  phase.  To  better  understand 
the  mating  system  of  a  species,  it  is  particularly  important  to 
know  which  sex  is  searching  for  the  other  and  to  identify  the 
communicational  cues  used  during  mate  searching  and  as- 
sessment. 

Chemical  communication  in  aquatic  crustaceans  may  act 
(I)  over  distance  via  waterborne  odors  or  (2)  by  direct 
contact  via  chemo-tactile  signals  (Salmon,  1983).  Odors 
may  be  emitted  by  either  sex  to  attract  potential  mates  over 
variable  distances  (e.g.,  Dunham.  1978;  Atema  and  Cobb. 
1980:  Bamber  and  Naylor,  1996;  Bushmann  and  Atema. 
1997).  For  example,  in  Homanis  americanus  (Cowan, 
1991)  and  Callim-ctes  sapidiix  (Bushmann.  1999),  the  fe- 
male is  guided  towards  the  male  by  a  pheromone  in  the 
male's  urine.  In  contrast,  in  Chionoecetes  opilio,  the  male  is 
guided  h\  an  ecdysteroid  from  pubescent  and  multiparous 


134 


SEXUAL  COMMUNICATION  IN  ROCK  SHRIMP 


135 


females  (Bouchard  et  a/..  1996).  Similarly,  in  Curciinis 
maenas,  waterborne  signals  from  the  premolt  female  evoke 
searching  in  males  (Bamber  and  Naylor,  1996).  Contact 
chemoreception,  which  usually  occurs  when  males  and  fe- 
males touch  each  other  during  assessment  and  mating  (see 
Salmon,  1983),  has  been  reported  for  many  crustaceans 
(Borowsky,  1991;  Kelly  and  Snell,  1998;  Correa  and  Thiel, 
2003a). 

Visual  sexual  communication  involves  cues  such  as 
color,  shape,  and  size  of  morphological  structures  or  re- 
sources (e.g..  shelters),  often  in  connection  with  elaborate 
courtship  behaviors  (e.g.,  Latruffe  et  al,  1999;  Christy  et 
ul..  2003).  Visual  signals  are  reported  mostly  for  crusta- 
ceans from  terrestrial  environments  (Salmon,  1983;  Burg- 
gren  and  McMahon.  1988;  Backwell  et  al..  1998;  Pope, 
2000),  but  also  occur  in  some  species  from  shallow  aquatic 
environments  (Hatziolos  and  Caldwell.  1983;  Hughes, 
1996;  Acquistapace  et  al..  2002).  When  visual  signals  are 
used  in  the  aquatic  environment,  they  are  often  accompa- 
nied by  chemical  cues  (see  review  by  Salmon,  1983).  Com- 
bined visual  and  chemical  signals  have  been  reported  in  the 
snapping  shrimp  Alpheus  heterochaelis  (Hughes,  1996),  in 
smasher  stomatopods  (Christy  and  Salmon,  1991;  Marshall 
et  ul..  1999),  and  in  freshwater  crayfish  (Acquistapace  et  til., 
2002). 

Most  studies  examining  sexual  communication  in  crusta- 
ceans focus  on  signal  perception  in  only  one  sex,  either  the 
males  or  females  (Salmon,  1983;  Christy  and  Salmon,  1991; 
Bamber  and  Naylor,  1996;  Bouchard  et  al.,  1996;  Kamio  et 
al..  2002).  Similarly,  many  studies  focus  exclusively  on 
either  visual  cues  (e.g.,  Marshall  et  al.,  1999)  or  chemical 
cues  (e.g..  Cowan,  1991),  these  being  the  two  most  impor- 
tant ones  in  aquatic  crustaceans.  Several  studies,  though, 
have  demonstrated  that  both  sexes  are  involved  in  signal 
exchange  (Atema  and  Voigt,  1995;  Bushmann.  1999)  and 
that  often  more  than  one  sense  is  employed  during  crusta- 
cean communication  (Hughes,  1996).  In  particular,  when 
individuals  assess  each  other,  they  may  base  their  decision 
on  multiple  signals  (Sneddon  et  al..  2003).  This  should  be 
expected  primarily  during  sexual  communication  in  those 
species  where  members  of  one  or  both  sexes  show  strong 
preferences  for  specific  individuals  of  the  opposite  sex. 

The  rock  shrimp  Rhynchocinetes  typus  Milne  Edwards 
1837,  which  is  abundant  on  shallow  subtidal  hard  bottoms 
along  the  coasts  of  the  southeastern  Pacific  (e.g..  Caillaux 
and  Stotz,  2003).  presents  a  mating  system  described  as 
"neighborhood  of  dominance"  (Correa  and  Thiel.  2003a). 
Male  rock  shrimp  reach  sexual  maturity  in  the  female-like 
typus  stage,  and  during  growth  they  pass  through  several 
intermedius  stages  before  reaching  the  terminal  molt  stage. 
named  robustus.  The  robustus  males  feature  highly  devel- 
oped 1  st  pereopods  and  3rd  maxillipeds.  and  they  are  dom- 
inant over  the  ontogenetically  younger  stages.  Robustus 


males  have  high  resource-holding  potential  and  can  defend 
females  during  the  entire  mating  process  (Correa  et  al., 
2003).  and  they  also  have  larger  sperm  supplies  than  sub- 
ordinate typus  males  (Hinojosa  and  Thiel,  2003).  Receptive 
females  prefer  to  mate  with  robustus  males  (Diaz  and  Thiel, 
2003;  Thiel  and  Hinojosa,  2003)  even  though  these  are 
comparatively  rare  in  natural  populations  (Correa  and  Thiel. 
2003b).  Consequently,  it  can  be  expected  that  both  robustus 
males  and  receptive  females  have  developed  efficient  sexual 
communication  to  find  each  other.  Receptive  females  might 
utilize  visual  signals  such  as  the  distinct  morphological 
characteristics  of  robustus  males  to  identify  them.  The  ro- 
bustus males  might  in  turn  use  visual  cues  such  as  tumults 
developing  around  receptive  females  to  identify  and  locate 
them.  Tumults  are  agitated  aggregations  of  several  typus 
males  that  attempt  to  gain  access  to  the  receptive  female. 
These  tumults  are  visible  over  distances  of  several  shrimp 
body  lengths,  and  it  is  possible  that  robustus  males  perceive 
these  tumults  and  approach  the  receptive  female.  However, 
since  visual  cues  might  be  of  minor  importance  in  coastal 
habitats  with  limited  visibility,  chemical  cues  might  also  be 
important  during  sexual  communication  of  rock  shrimp. 

In  the  present  study,  we  examined  whether  receptive 
females  and  robustus  males  of  the  rock  shrimp  utilize  chem- 
ical cues,  visual  cues,  or  both  to  locate  and  assess  a  potential 
mating  partner. 

Materials  and  Methods 

Experiments  were  conducted  during  austral  summer 
(February  to  April,  water  temperatures:  14.8-18.9  °C)  and 
spring  (September  to  October,  13.0-15.2  "C)  of  2002  in  a 
flowing  seawater  laboratory  located  near  Bahi'a  La  Herra- 
dura.  Coquimbo,  Chile  (29°59'S,  79°21'W).  Shrimp  were 
collected  from  the  field  by  using  a  diver-operated  suction 
sampler  and  were  maintained  in  the  laboratory  in  tanks  with 
flowing  and  aerated  seawater.  They  were  fed  fish  and  mol- 
luscs ad  libitum.  Females  and  males  were  held  in  separate 
tanks  each  containing  up  to  30  shrimp.  Every  morning  the 
tanks  with  the  females  were  examined  to  identify  recently 
molted  females,  which  are  receptive  24  h  after  molting.  The 
molted  females  were  individually  held  in  containers  (sur- 
face area  20  cm  x  20  cm  and  height  15  cm)  with  flowing 
seawater  until  the  following  day.  when  they  were  used  in  the 
experiments  (for  further  details,  see  Correa  et  al..  2003: 
Hinojosa  and  Thiel.  2003).  After  each  replicate,  the  recep- 
tivity of  the  female  was  confirmed  by  allowing  it  to  mate 
with  a  robustus  male — if  the  female  did  not  mate  during  this 
opportunity,  the  replicate  was  eliminated.  The  males  used 
for  the  experiments  were  either  in  the  terminal  molt  stage 
(robustus  males)  or  in  the  intermolt  phase  (typus  males).  All 
individuals  were  used  only  once  in  these  experiments,  ex- 
cept where  noted  otherwise. 


136 


E.  R.  DIAZ  AND  MARTIN  THIEL 


Chemical  communication  experiments 

We  used  a  Y-maze  (Fig.  1A)  to  examine  whether  water- 
borne  chemical  cues  play  a  role  during  mate  searching  in 
receptive  females  and  robustus  males.  Seawater  entered  the 
Y-maze  through  two  small  branches,  which  converged  in 
the  choice  chamber.  The  flow  speed  in  the  two  branches  was 
-  1cm  s~  '.  In  the  upstream  part  of  each  branch  was  a  shelter 
for  the  shrimp  designated  as  a  potential  sender  of  chemical 
cues;  shrimp  were  randomly  assigned  to  one  of  the  two 
branches.  The  shelter  was  separated  from  the  branches  by  a 
barrier  of  multiple  layers  of  black  mesh  that  prevented 
mechanical  and  visual  contact,  but  allowed  water  to  pass. 
The  shrimp  to  be  tested  was  placed  downstream  in  the 
choice  chamber  under  a  plastic  bell  with  holes  allowing 
contact  with  the  surrounding  water.  The  acclimation  period 
was  30  min  for  females  and  60  min  for  males:  preliminary 
experiments  had  shown  that  robustus  males  require  more 
time  to  calm  down  after  handling  than  females.  Following 
release,  the  tested  shrimp  was  observed  for  30  min,  and  after 


141  cm 


Choice  chamber 


B 


Lateral 
area 

Central  area 

Lateral 
area 

Figure  1.  The  experimental  set-up.  (A)  The  Y-maze  used  to  study  the 
importance  of  chemical  cues  that  receptive  females  and  dominant  robustus 
males  employ  to  locate  potential  mating  partners.  The  tested  individual  was 
released  downstream  in  the  choice  chamber;  from  there  it  could  select  one 
of  the  upstream  branches  leading  to  the  shelter  of  a  target  individual  from 
the  opposite  sex.  (B)  The  seawater  tank  used  to  study  the  importance  of 
visual  cues  employed  by  receptive  females  and  dominant  robustus  males  to 
locate  their  respective  potential  mating  partners.  The  tested  individual  was 
released  in  the  central  compartment,  while  the  target  individuals  from  the 
opposite  sex  were  placed  in  the  lateral  compartments.  The  central  com- 
partment was  hermetically  separated  from  the  lateral  compartments  by  a 
sealed  glass  window. 


each  experiment  the  tank  was  washed  three  times  with  fresh 
water. 

Receptive  females:  Are  receptive  females  guided  by  chem- 
ical cues  in  locating  robustus  males?  One  typus  male  was 
placed  in  the  upstream  shelter  in  one  branch  of  the  Y-maze, 
and  one  robustus  male  was  placed  in  the  upstream  shelter  of 
the  other  branch.  After  releasing  a  receptive  female,  we 
observed  it  for  a  maximum  of  30  min.  If  the  female  spent  10 
continuous  minutes  in  one  branch  of  the  Y-maze,  the  male 
in  the  corresponding  shelter  was  considered  to  be  the  chosen 
male.  If  the  receptive  female  did  not  show  a  preference  for 
either  branch  during  the  30  min  of  observation,  the  replicate 
was  considered  as  a  no-choice.  We  conducted  12  replicates 
and  used  a  \2  goodness-of-fit  test  to  determine  whether 
females  chose  robustus  males  more  frequently  than  they 
chose  typus  males. 

Robustus  males:  Are  robustus  males  guided  b\  chemical 
cues  in  locating  receptive  females?  This  experiment  was 
divided  into  two  parts,  which  differed  by  the  absence  or 
presence  of  typus  males  with  the  females.  In  part  1,  a 
receptive  female  and  a  nonreceptive  female  were  separately 
placed  in  the  shelters  at  the  upstream  part  of  each  branch  of 
the  Y-maze.  After  releasing  the  robustus  male,  we  observed 
it  for  a  maximum  of  30  min.  If  the  male  stayed  in  one 
branch  of  the  Y-maze  for  a  continuous  10-min  period,  the 
female  in  the  corresponding  shelter  was  considered  to  be  the 
chosen  female.  At  the  conclusion  of  part  1,  the  robustus 
male  was  again  placed  at  the  end  of  the  choice  chamber, 
where  it  was  re-acclimated  for  15  min.  During  this  time,  two 
typus  males  were  added  to  the  shelter  of  each  female  to 
induce  mating  interactions  with  the  receptive  female.  Fol- 
lowing release  of  the  robustus  male,  observations  were 
conducted  as  in  part  1.  In  both  parts  (n  =  18  replicates  for 
part  1,  n  =  17  for  part  2).  we  used  a  ^  goodness-of-fit  test 
to  determine  whether  robustus  males  oriented  to  the  recep- 
tive female  more  often  than  to  the  nonreceptive  female.  In 
addition,  we  used  a  two-tailed  Student's  Mest  for  indepen- 
dent samples  to  compare  the  reaction  times  (start  of  exper- 
iment until  the  robustus  male  chooses  a  female). 


Visual 


communication  experiments 


The  visual  cues  used  during  mate  searching  were  exam- 
ined by  providing  visual  signals  to  the  receptive  female  and 
the  dominant  robustus  male.  The  experiments  were  con- 
ducted in  a  large  indoor  tank  (surface  area  141  cm  X  65  cm 
and  height  30  cm)  filled  to  a  water  level  of  20  cm.  This  tank 
was  divided  into  three  compartments  separated  from  each 
other  by  hermetically  sealed  glass  windows  (Fig.  IB).  The 
observations  were  conducted  during  daylight  hours  ( 1 100  to 
1600).  The  tested  shrimp  (receptive  female  or  robustus 


SEXUAL  COMMUNICATION   IN  ROCK  SHRIMP 


137 


male)  was  placed  in  the  central  compartment  where  it  was 
acclimated  behind  a  glass  fence  (allowing  it  to  see  in  all 
directions).  The  lateral  compartments  contained  the  shrimp 
that  were  used  to  generate  visual  signals  (see  below).  The 
duration  of  the  observation  differed  between  the  sexes  (60 
min  for  robustus  males,  90  min  for  females)  since  previous 
studies  had  shown  that  robustus  males  usually  seize  recep- 
tive females  within  60  min  (Correa  et  al.,  2000),  but  females 
may  delay  mate  choice  for  more  than  60  min  (Diaz  and 
Thiel.  2003). 

Receptive  females:  Can  receptive  females  distinguish  be- 
nveen  ty/nts  ami  robustus  males  via  visual  cues?  Each 
experiment  used  two  males — a  robustus  and  a  typus — and 
randomly  assigned  one  to  each  lateral  compartment,  where 
they  were  tethered  to  the  bottom  of  the  experimental  tank. 
Tethering  prohibited  the  males  from  actively  courting  the 
female  behind  the  glass  window  and  limited  the  visual 
signal  to  the  morphological  characteristics  of  the  male. 
During  the  experiment,  some  males  attempted  to  move  once 
the  female  approached  their  glass  window,  but  they  were 
kept  in  place  by  the  tether.  Males  were  tethered  24  h  before 
the  start  of  the  experiment,  which  was  sufficient  for  them  to 
acclimatize. 

Following  an  acclimation  period  of  30  min,  the  receptive 
female  was  released  in  the  central  compartment  of  the  tank, 
and  her  behavior  was  registered  for  90  min.  We  quantified 
the  following  variables:  (a)  time  of  first  visit  to  each  male, 
(b)  duration  and  frequency  of  individual  visits  to  each  male, 
and  (c)  male  attended  by  the  female  at  the  end  of  the 
experiment.  We  use  the  term  visit  to  refer  to  the  female 
touching  the  glass  window  of  the  respective  male.  Finally, 
we  tested  the  null  hypothesis  that  the  frequencies  of  the  first 
visit  and  the  last  visit  to  either  male  were  similar  by  using 
a  x2  goodness-of-fit  test.  We  also  tested  whether  the  total 
duration  of  visits  by  the  female  to  each  male  differed 
between  typus  and  robustus  males  by  using  the  two-tailed 
Student's  Mest  for  dependent  samples. 

Robustus  males:  How  important  are  visual  cues  fur  the 
robustus  male'.'  We  examined  this  question  using  tumults 
generated  by  typus  males  around  a  receptive  female.  These 
tumults  are  visible  over  distances  of  several  shrimp  body 
lengths,  and  we  hypothesized  that  they  could  indicate  the 
presence  of  a  receptive  female  to  robustus  males.  We  used 
different  numbers  of  typus  males  together  with  a  receptive 
female  to  test  whether  (1)  tumults  were  produced,  (2)  the 
frequency  of  visual  cues  increased  with  increasing  numbers 
of  typus  males,  and  (3)  robustus  males  reacted  to  these 
visual  cues. 

Different  numbers  (2,  3,  4,  8,  and  12)  of  typus  males  were 
placed  in  each  lateral  compartment  24  h  before  the  start  of 
the  experiment.  For  a  given  treatment,  the  same  number  of 


typus  males  were  always  put  in  each  lateral  compartment. 
At  the  end  of  the  acclimation  period  of  the  males,  a  recep- 
tive female  was  introduced  into  one  lateral  compartment, 
while  a  nonreceptive  female  was  introduced  into  the  other 
lateral  compartment.  Females  were  assigned  randomly  to 
each  lateral  compartment,  where  they  were  acclimated  un- 
der a  transparent  plastic  bell  (made  from  the  upper  part  of  a 
plastic  bottle)  for  15  min  before  the  start  of  the  experiment. 
Because  of  a  shortage  of  receptive  females,  replication  of 
the  different  treatments  (number  of  typus  males)  was  un- 
equal, ranging  from  /;  =  8  (two  typus  males)  to  n  =  5  (two 
treatments,  with  four  and  eight  typus  males,  respectively). 
The  experiment  lasted  for  60  min  after  release  of  the  fe- 
males. 

To  assess  whether  the  number  and  intensity  of  visual 
signals  depended  on  the  number  of  typus  males,  we  counted 
the  number  of  tumults  per  treatment  and  determined  the 
total  mating  time  of  the  receptive  female  with  different 
numbers  of  typus  males.  Two  Kruskal-Wallis  tests  (both 
two-tailed)  were  conducted  to  test  for  significant  differences 
in  these  variables.  While  the  robustus  male  was  being  ac- 
climated for  15  min  behind  a  glass  fence  in  the  central 
compartment,  the  females  were  introduced  to  the  lateral 
compartments.  After  release  of  the  male,  we  observed  its 
behavior  for  60  min  and  counted  the  number  and  duration  of 
its  visits  to  each  of  the  two  lateral  compartments.  Using  a  x2 
goodness-of-fit  test,  we  compared  the  number  of  males 
visiting  the  receptive  and  the  nonreceptive  female  during 
the  first  and  last  visits.  To  examine  whether  the  robustus 
male  used  visual  signals  to  locate  the  receptive  female,  we 
calculated  the  total  duration  of  visits  to  each  female.  Three 
independent  parametric  tests  were  run:  (a)  a  one-way 
ANOVA  to  compare  the  total  visit  duration  by  the  robustus 
male  to  the  receptive  female  between  the  different  typus 
treatments,  (b)  a  parallel  one-way  ANOVA  to  compare  the 
total  visit  duration  by  the  robustus  male  to  the  nonreceptive 
female  between  the  different  typus  treatments,  and  (c)  a 
one-tailed  Student's  /-test  for  dependent  samples  to  deter- 
mine whether  the  total  visit  duration  by  the  robustus  male 
(pooling  all  typus  treatments)  was  longer  for  the  receptive 
than  for  the  nonreceptive  females  (Zar,  1999). 

Statistical  analysis 

To  assess  frequencies  of  choices  made  by  either  robustus 
males  or  receptive  females  in  the  different  experiments,  we 
conducted  ^2  goodness-of-fit  tests.  All  other  data  were 
tested  for  homogeneity  of  variances  using  the  Cochran 
C-test.  If  the  original  data  failed  the  normality  test,  they 
were  ln(.v  +  1)  transformed.  A  Student's  Mest  was  used 
when  variances  were  homogeneous.  One-way  ANOVAs 
were  used  to  test  for  significant  difference  between  treat- 
ments, followed  by  a  post  hoc  Tukey  test.  If  variances  were 


138 


E.  R.  DIAZ  AND  MARTIN  THIEL 


not  homogeneous  after  transformation,  we  conducted  non- 
parametric  Kruskal-Wallis  tests,  followed  by  a  post  hoc 
Dunn  test.  All  tests  were  carried  out  with  a  significance 
level  of  a  =  0.05. 

Results 

Chemical  communication 

Receptive  females:  Are  receptive  females  guided  by  chem- 
ical cues  in  locating  robustus  males?  Following  release, 
most  females  (10  of  12)  chose  the  branch  with  the  robustus 
male.  When  the  plastic  acclimation  bell  was  removed,  these 
ten  females  went  directly  to  the  robustus  male  (mean  ±  SD: 
1.22  ±  2.14  min).  Only  one  female  remained  for  30  min  in 
the  choice  chamber.  The  female  that  chose  the  typus  male 
entered  and  left  the  typus  branch  twice  before  finally  staying 
with  the  typus.  The  difference  between  the  females  choos- 
ing the  robustus  male  and  those  choosing  other  options  was 
significant  (r  =  13.5,  r005.:  =  5.991,  P  =  0.001). 


Robustus  males:  Are  robustus  males  guided  by  chemical 
cues  in  locating  receptive  females?  Following  release,  most 
robustus  males  in  part  1  (female  without  typus  males)  failed 
to  make  a  choice  for  the  receptive  female  (x2  =  4,  ^0.05.2  = 
5.991,  P  =  0.135).  Of  the  18  animals  tested,  4  chose  the 
receptive  female,  4  chose  the  nonreceptive  female,  and  10 
made  no  choice.  The  robustus  males  that  selected  the  branch 
with  the  receptive  female  were  not  faster  to  react  (mean  ± 
SD:  4.33  ±  2.75  min)  than  the  robustus  males  that  selected 
the  nonreceptive  female  (mean  ±  SD:  6.85  ±  5.63  min) 
(r-test:  /  =  -0.805,  tOOSl2t6  =  2.447,  P  =  0.452);  the  other 
males  reacted  late  or  never  left  the  choice  chamber  during 
the  30-min  observation  period.  After  the  introduction  of  two 
typus  males  to  the  female  shelters  (part  2),  more  robustus 
males  chose  the  branch  with  the  receptive  female,  but  dif- 
ferences were  not  significant  (x2  —  2.24,  ^"005.2  =  5.991, 
P  =  0.329).  Of  the  17  animals  tested,  8  chose  the  receptive 
female,  3  chose  the  nonreceptive  female,  and  6  made  no 
choice.  Also  during  the  second  part,  robustus  males  that 
selected  receptive  females  were  not  faster  to  react  (mean  ± 
SD:  6.69  ±  5.37  min)  than  those  that  selected  nonreceptive 
females  (mean  ±  SD:  3.06  ±  3.43  min)  (/-test:  t  =  1.062, 
'o.os(2).8  =  2.306,  P  =  0.319). 


Receptive  female:  Can  receptive  females  distinguish  be- 
tween typus  and  robustus  males  via  visual  cues?  Following 
their  release,  receptive  females  started  to  move  continu- 
ously without  staying  for  long  near  the  lateral  compartments 
of  the  aquarium.  There  was  no  clear  pattern  of  choice  in 
favor  of  either  of  the  two  male  forms  (typus  or  robustus). 
When  comparing  the  number  of  visits  to  the  two  males. 


there  was  no  significant  preference  for  either  male,  neither 
during  the  first  visit  (x2  =  0.0769,  ^o.os.i  =  3-841,  P  = 
0.78  after  Yates  correction)  nor  during  the  last  visit  (x~  = 
2.48,  ro.os.2  =  5.991,  P  =  0.28)  (Table  1).  Similarly,  there 
were  no  significant  differences  in  the  total  duration  of  visits 
to  either  male  (Mest:  t  =  -0.432,  /005(2)J,  =  2.179,  P  = 
0.674).  Females  spent  on  average  less  than  10  min  near  the 
compartment  of  either  male  (mean  ±  SD:  robustus  8.3  ± 
24.4  min;  typus  6.3  ±  1 1.6  min). 

Robustus  males:  How  important  are  visual  cues  for  the 
robustus  male?  As  predicted,  tumults  were  generated  by  the 
typus  males  around  the  receptive  female,  but  no  tumults 
were  observed  near  the  nonreceptive  female.  Each  tumult 
lasted  only  a  few  seconds,  and  generally  the  larger  typus 
male  succeeded  in  mating  with  the  female.  The  frequency  of 
tumults  increased  positively  in  relation  to  the  number  of 
typus  males  in  the  different  treatments.  Significant  differ- 
ences in  the  number  of  tumults  were  found  between  treat- 
ments with  2  and  8  typus  males  (Kruskal-Wallis  H  = 
12.602,  df  =  4,  n  =  30,  P  =  0.013)  (Fig.  2 A).  Another 
possible  visual  signal  for  the  robustus  male  might  be  gen- 
erated by  mating  of  the  receptive  female  with  one  of  the 
typus  males.  Matings  were  observed  in  all  treatments,  and 
there  were  no  significant  differences  in  the  total  mating  time 
between  treatments  (Kruskal-Wallis  H  =  6.301,  df  =  4,  n  = 
30,  P  =  0.178)  (Fig.  2B).  In  summary,  many  visual  signals 
potentially  attractive  for  the  robustus  males  were  generated 
in  the  lateral  compartment  with  the  receptive  female. 

When  comparing  the  number  of  visits  between  the  two 
females,  there  was  no  significant  preference  for  either  fe- 
male, neither  during  the  first  visit  (see  Table  2)  nor  the  last 
visit  (see  Table  3).  The  total  duration  of  visits  by  the 
robustus  males  to  the  receptive  female  was  not  significantly 
affected  by  the  numbers  of  typus  males  in  each  treatment 
(one-way  ANOVA  F42,  =  1.962.  P  =  0.131)  (Fig.  3A). 
The  visit  duration  of  robustus  males  to  the  receptive  female 
reached  lowest  values  in  the  treatment  with  the  highest 
densities  of  typus  males,  but  there  were  no  significant  dif- 
ferences to  the  other  treatments  (the  absence  of  significant 


Table  1 

Visual  communication  experiment:  choices  made  by  receptive  females 
when  presented  with  a  robustus  male  and  u  r\lpus  nuilc 


Choice 


First  visit 


Last  visit 


Robustus  male 
Typus  male 
No  choice 


Presented  are  the  first  visit  and  the  last  visit  to  one  of  the  lateral 
compartments  with  a  male  behind  the  glass  window. 


SEXUAL  COMMUNICATION  IN  ROCK  SHRIMP 


139 


|J6 


2 


a    ab    ab 


ab 


P<0.05 


234  8 

Density  of  ty  pus  males 


12 


80  P>0.05          B 

kill! 


12 


Density  of  typus  males 


Figure  2.  (A)  Number  of  tumults  produced  in  I  h;  different  letters 
indicate  treatments  with  significant  differences  (post  hoc  test.  Dunn  q  = 
3.073.  P  <  0.05);  (B)  Total  mating  time  (mean  +  SD)  of  the  receptive 
female  with  typus  males  in  the  respective  treatments;  note  that  occasionally 
a  female  mated  with  more  than  one  male. 


differences  should  be  interpreted  cautiously  since  the  power 
of  the  statistical  test  is  very  low;  P  =  0.253).  The  total 
duration  of  visits  by  robustus  male  to  the  nonreceptive 
female  also  was  not  affected  by  the  typus  treatments  (one- 


Table  2 

Visual  communication  experiment:  number  of  robustus  males  that  chose, 
in  the  first  visit,  either  a  receptive  or  a  nonreceptive  female  when  llic 
females  were  presented  in  the  presence  of  various  numbers  of  typus 
unties 

Female 


Treatment 

(# 

of  typus  males) 

Receptive 

Nonreceptive 

,v: 

df 

P 

2 

3(3.5) 

4(3.5) 

01 

1 

0.705 

3 

2(3) 

4(3) 

0.6 

I 

0.414 

4 

3(2.5) 

2(2.5) 

0.2 

1 

0.654 

8 

4(2.5) 

1  (2.5) 

1.8 

I 

0.179 

12 

5(3) 

1  (3) 

2.6 

1 

0.102 

TOTAL  x2 

=  5.4 

5 

r 

grouped 

17(14.5) 

12(14.5) 

0.8 

1 

0.353 

Heterogeneity  x2 

4.6 

4.6 

4 

>0.05 

In  parentheses  are  the  expected  frequencies  of  first  visit.  The  P  value 
corresponding  to  heterogeneity  >0.05  means  that  treatments  are  homoge- 
neous and  can  be  analyzed  as  a  whole.  In  the  treatment  with  2  typus  males, 
one  robustus  male  did  not  make  any  choice  for  either  female  during  the 
observation  time,  and  consequently  was  not  included  in  this  analysis. 


Table  3 

Visual  communication  experiment:  number  of  robustus  males  that  chose, 
in  the  last  visit,  either  a  receptive  or  a  nonreceptive  female  when  the 
females  were  presented  in  the  presence  of  various  numbers  of  typus 
males 


Female 

Treatment 

(#  of  typus  males) 

Receptive 

Nonreceptive 

X2         df           P 

2 

3(3.5) 

4(3.5) 

0.14 

0.705 

3 

4(3) 

2(3) 

0.67 

0.414 

4 

4(2.5) 

1  (2.5) 

1.8 

0.179 

8 

4(2.5) 

1  (2.5) 

1.8 

0.179 

12 

4(3) 

2(3) 

0.67 

0.414 

TOTAL  ,r 

=  5.08       5 

X2  grouped 

19(14.5) 

10(14.5) 

2.79        1          0.094 

Heterogeneity  x1 

2.29        4      >0.05 

In  parentheses  are  the  expected  frequencies  of  last  visit.  The  P  value 
corresponding  to  heterogeneity  >0.05  means  that  treatments  are  homoge- 
neous and  can  be  analyzed  as  a  whole.  In  the  treatment  with  2  typus  males, 
one  robustus  male  did  not  make  any  choice  for  either  female  during  the 
observation  time,  and  consequently  was  not  included  in  this  analysis. 


way  ANOVA  F4  23  =  0.089,  P  =  0.984)  (Fig.  3B).  Since  no 
differences  between  typus  treatments  were  found,  we 
pooled  all  replicates  and  calculated  the  total  visit  duration  of 
the  robustus  males  to  each  lateral  compartment  (with  recep- 
tive female  and  nonreceptive  female,  respectively)  (Fig. 
3C).  The  total  visit  duration  to  the  receptive  female  glass 
window  was  on  average  twice  as  long  as  to  the  nonreceptive 
female  u-test:  t  =  -2.039,  r(,.05( ,  ,.2y  =  1-699,  P  =  0.025). 

Discussion 

Our  results  show  that  receptive  females  and  robustus 
males  use  different  cues  during  sexual  communication.  Re- 
ceptive females  locate  their  potential  mating  partners  by 
using  chemical  cues,  whereas  robustus  males  find  females 
mostly  by  using  visual  cues.  The  results  suggest  that  fe- 
males and  males  adopt  sex-specific  roles  during  the  search- 
ing and  assessment  phase.  Thus  Rhynchocinetes  typus,  like 
the  lobster  Homarus  americanus  (Bushmann  and  Atema, 
2000),  is  a  crustacean  species  in  which  females  locate 
dominant  males  via  chemical  signals.  In  both  species,  fe- 
males preferentially  mate  with  dominant  males,  which  de- 
fend females  during  the  mating  process.  This  suggests  that 
sexual  communication  in  R.  typus  (and  H.  americanus)  is 
closely  linked  to  their  mating  system,  as  will  be  discussed  in 
the  following  section. 

Chemical  communication 

Chemical  cues  are  used  by  a  variety  of  crustaceans  during 
sexual  communication.  In  many  species  such  as  the  shore 


140 


E.  R.  DIAZ  AND  MARTIN  THIEL 


20 


C     0 


^  80 
w 

> 

•*  60 


^40 


12 


Density  of  typus  males 


P>0.05 
B 


ro 


20  \ 
0 

40 
30 
20 
10 


348 
Density  of  typus  males 


12 


Receptive  female  Q  Non-receptive  female 


Figure  3.  Total  visit  duration  (mean  +  SD)  of  robustus  males  to  the 
(A)  receptive  female  and  (B)  nonreceptive  female  in  respective  treatments; 
P  >  0.05  indicates  no  significant  differences  between  treatments.  (C)  Total 
visit  duration  (mean  +  SD)  of  robustus  males  to  the  respective  females 
after  pooling  among  all  treatments;  P  <  0.05  indicates  significant  differ- 
ences between  visits  to  respective  females. 


crab  Carcinus  maenas,  snow  crab  Chionoecetes  opilio,  and 
helmet  crab  Telmessus  cheiragonus,  females  advertise  their 
reproductive  status  and  attract  males  via  waterborne  chem- 
ical signals  (Bamber  and  Nay  lor,  1996:  Bouchard  el  ai, 
1996;  Kamio  et  ai.  2002).  This  does  not  appear  to  be  the 
case  in  Rhynchocinetes  typus,  where  males  do  not  locate 
receptive  females  via  chemical  cues.  Most  crustacean  spe- 
cies possess  highly  efficient  chemoreceptive  capabilities 
that  allow  them  to  evaluate  their  environment  (Derby  and 
Steullet.  2001 ).  We  believe  that  this  is  also  true  for  R.  typus. 
and  that  males  would  be  able  to  perceive  the  presence  of  a 
receptive  female  if  appropriate  chemical  signals  were  avail- 
able. Since  males  of  this  species  apparently  cannot  identify 
a  receptive  female  via  waterborne  chemical  cues,  it  appears 
that  receptive  females  do  not  release  waterborne  chemicals 
advertising  their  reproductive  status.  When  typus  males 
were  together  with  females,  there  was  a  slight  tendency  for 
robustus  males  to  approach  the  receptive  females,  but  the 


experimental  set-up  did  not  allow  distinguishing  whether 
this  was  in  response  to  chemicals  released  by  the  females  or 
by  typus  males  attending  them.  Rock  shrimp  typically  live 
at  high  densities  (Caillaux  and  Stotz.  2003).  and  there  are 
usually  many  males  for  each  receptive  female  (Correa  and 
Thiel,  2003b).  Female  rock  shrimp  might  have  no  problem 
in  obtaining  a  mating  partner,  and  thus  the  adaptive  advan- 
tage in  attracting  males  via  waterborne  chemical  signals 
would  be  slight.  It  is  also  possible  that  R.  typus.  which 
inhabits  complex  and  wave-exposed  rocky  shore  environ- 
ments, lives  in  a  habitat  where  communication  via  chemical 
cues  is  complicated  by  turbulent  flow.  However,  the  fact 
that  female  rock  shrimp  locate  males  via  waterborne  chem- 
ical cues  suggests  that  chemical  communication  in  the  hab- 
itat of  R.  npus  is  not  negatively  influenced  by  the  hydro- 
dynamic  regime. 

In  some  crustacean  species,  males  advertise  their  pres- 
ence to  females.  For  example,  in  the  lobster  Hoiiuims 
americaiuis,  females  are  attracted  to  dominant  males  via 
chemical  signals  (Bushmann  and  Atema,  1997,  2000).  Sim- 
ilarly, in  the  blue  crab  Callinectes  sapidus,  females  appear 
to  key  in  on  chemical  signals  from  males  (Gleeson,  1991: 
Bushmann,  1999).  Males  of  these  crustacean  species  typi- 
cally advertise  their  status  to  other  individuals  via  chemical 
signals  released  in  the  urine  (e.g..  Breithaupt  and  Atema, 
2000;  Zulandt  Schneider  et  al,  2001;  Breithaupt  and  Eger, 
2002).  These  signals  often  are  used  during  agonistic  en- 
counters to  establish  dominance  status,  and  females  might 
exploit  these  signals  to  locate  dominant  males.  This  could 
explain  why  and  how  females  of  R.  npus  find  dominant 
robustus  males  via  chemical  signals.  Robustus  males  occa- 
sionally engage  in  agonistic  interactions  (Correa  et  al.. 
2003),  and  during  these  encounters  they  may  employ  chem- 
ical signals  similar  to  those  of  male  lobsters  and  crayfish. 
During  the  searching  phase,  female  rock  shrimp  may  utilize 
these  chemical  signals  to  locate  robustus  males,  which  they 
prefer  as  mates  (Diaz  and  Thiel,  2003;  Thiel  and  Hinojosa, 
2003). 

Visual  communication 

Since  robustus  males  feature  distinct  morphological  char- 
acteristics, it  could  have  been  expected  that  receptive  fe- 
males would  use  visual  cues  to  distinguish  between  males. 
Females  of  some  other  decapod  crustaceans  choose  males 
on  the  basis  of  visual  cues  such  as  size  of  body  structures  or 
shelter,  which  are  reliable  indicators  of  the  fitness  of  an 
individual  (Atema  and  Cobb.  1980:  Christy,  1987).  The 
results  of  the  current  study  suggest  that  females  do  not 
approach  the  robustus  males  on  the  basis  of  visual  signals. 
In  general,  visual  signals  are  uncommon  during  sexual 
communication  of  aquatic  crustaceans  (see  Salmon.  1983). 
Only  in  particular  groups  of  stomatopods  (Hatziolos  and 


SEXUAL  COMMUNICATION   IN   ROCK  SHRIMP 


141 


Caldwell.  1983;  Christy  and  Salmon,  1991;  Marshall  et  ai. 
1999)  and  in  the  snapping  shrimp  Alpheus  heterochaelis 
(Hughes,  1996)  are  visual  signals  known  to  play  an  impor- 
tant role  during  intersexual  communication,  probably  be- 
cause both  species  live  in  tropical  waters  where  visibility 
usually  is  high.  Similarly,  females  of  terrestrial  crustaceans 
use  visual  signals  to  find  males  (Christy  and  Salmon.  1991; 
Pope,  2000).  The  importance  of  visual  signals  for  sexual 
communication  in  terrestrial  and  clear-water  environments 
appears  to  be  related  to  the  better  light  conditions  and 
visibility.  The  apparent  inability  of  female  rock  shrimp  to 
select  robustus  males  via  visual  cues  in  our  study  does  not 
prove  that  females  do  not  use  visual  cues  to  recognize 
robustus  males.  Female  rock  shrimp  that  received  both 
chemical  and  visual  cues  avoided  robustus  males  initially 
(see  Diaz  and  Thiel,  2003).  The  experiments  with  the  ro- 
bustus males  demonstrated  that  visual  cues  also  play  a  role 
during  intersexual  communication  in  R.  typiis.  Robustus 
males  are  guided  visually  to  the  tumults  or  matings  devel- 
oping around  receptive  females.  A  similar  phenomenon  has 
been  reported  for  the  horseshoe  crab  Linnihis  polyphemus, 
where  additional  males  are  attracted  to  satellite  males 
around  the  receptive  female  apparently  by  visual  cues  (Bar- 
low et  ai,  1982),  but  this  occurs  in  shallow  waters  and  is 
aided  by  chemical  signals  (Hassler  and  Brockmann,  2001 ). 
These  observations  suggest  that  in  the  marine  environment, 
once  crustaceans  are  close  to  potential  mating  partners,  that 
is,  during  the  assessment  phase,  visual  cues  (often  accom- 
panied by  chemical  cues)  may  gain  in  importance. 

Visual  cues  are  important  for  judging  the  size  of  an 
opponent  during  agonistic  encounters  (e.g..  Caldwell  and 
Dingle.  1979;  Atema  and  Cobb,  1980).  This  occurs  when 
individuals  are  within  a  few  body  lengths  of  each  other.  In 
addition  to  chemical  signals  (Breithaupt  and  Atema,  2000) 
and  moderate  agonistic  interactions  (Karavanich  and 
Atema,  1998),  visual  signals  may  also  serve  to  establish  and 
maintain  dominance  status.  In  rock  shrimp,  visual  commu- 
nication occurs  during  agonistic  encounters  when  robustus 
males  appear  to  gauge  the  size  of  their  opponents  (e.g., 
Correa  et  ai.  2003).  This  might  explain  why  male  lobsters 
and  shrimps  have  evolved  visual  skills  to  distinguish  con- 
specifics  (opponents  and  receptive  females). 

Sexual  communication  and  mating  system  of  rock  shrimp 

The  mating  system  of  rock  shrimp  has  been  characterized 
as  "neighborhoods  of  dominance"  (Correa  and  Thiel, 
2003a)  in  which  dominant  males  monopolize  a  receptive 
female  and  defend  it  against  subordinate  males  (Correa  et 
<//. .  2003).  In  Rhynchocinetes  typus,  females  have  a  strong 
preference  for  these  dominant  males  (Diaz  and  Thiel.  2003; 
Thiel  and  Hinojosa,  2003).  The  mating  system  of  R.  tvpus 
thus  shows  strong  similarities  to  that  of  Honninis  amcri- 


canus.  In  this  species,  dominant  males  that  inhabit  shelters 
also  form  neighborhoods  of  dominance  (e.g..  Karnofsky  et 
a!..  1989),  and  reproductive  females  exhibit  preferences  for 
dominant  males  (Atema  et  ai.  1979;  Atema.  1986;  Bush- 
mann  and  Atema.  2000).  even  leading  to  female  molt- 
staggering  (Cowan  and  Atema.  1990). 

In  contrast  to  many  other  decapod  species,  female  rock 
shrimp  and  lobsters  do  not  attract  males  via  waterborne 
chemical  signals.  In  both  species,  harassment  from  subor- 
dinate males  may  represent  a  high  cost  for  females  (e.g.. 
Cowan,  1991;  Thiel  and  Hinojosa,  2003).  To  avoid  ap- 
proaches and  rambunctious  harassment  from  subordinate 
males,  female  rock  shrimp  and  lobsters  may  thus  hide  their 
reproductive  status  (they  remain  "chemically  quiet"  sensu 
Atema,  1995)  until  they  reach  the  vicinity  of  a  dominant 
male.  Male  lobsters  are  residents  in  shelters  and  accept  only 
mature  females  into  their  shelter  (Cowan,  1991).  The  same 
might  be  true  for  rock  shrimp,  where  one  or  several  robustus 
males  often  occupy  large  spaces  in  open  shelters  (pers. 
obs.).  These  dominant  males  usually  are  dispersed  and 
difficult  to  locate  visually  in  their  shelters.  Consequently, 
receptive  females  are  attracted  to  these  areas  by  chemical 
cues,  as  shown  herein  for  rock  shrimp  and  by  Bushmann 
and  Atema  (1997)  for  H.  cimericaniis.  Once  in  the  vicinity 
of  a  dominant  male,  females  may  no  longer  hide  their 
reproductive  status  but  rather  permit  assessment  by  that 
male.  In  lobsters,  this  appears  to  occur  via  chemical  cues 
(Atema  and  Cowan,  1986),  which  reduce  male  aggression 
and  later  facilitate  successful  mating  (Bushmann  and 
Atema.  1997).  Waterborne  chemical  signals  most  likely 
play  only  a  minor  role  during  mate  assessment  in  R.  ftpus, 
since  they  would  attract  large  numbers  of  subordinate 
males.  Visual  cues  arising  from  activities  developing 
around  the  receptive  female  are  apparently  sufficient  to 
attract  a  dominant  male  within  a  short  period  of  time  and 
induce  it  to  monopolize  the  female.  Thus  the  assessment 
phase  seems  to  be  brief  and  simple  in  rock  shrimp,  even 
though  in  other  crustaceans  it  involves  sophisticated  signals 
and  requires  substantial  time  (Christy,  1987;  Cowan,  1991; 
Bushmann,  1999).  For  rock  shrimp,  we  propose  a  hypothet- 
ical mating  scenario  in  which  females  molt  at  night  and 
subsequently  (or  before  molting)  approach  areas  with  dom- 
inant males.  Females  then  become  receptive  during  the  day, 
when  visual  cues  can  be  used  by  the  robustus  males  to 
locate  and  monopolize  receptive  females  in  their  vicinity. 

In  summary,  this  comparison  of  sexual  communication  in 
rock  shrimp  and  lobster  further  underlines  the  important 
role  of  female  behavior  during  mate  searching  and  assess- 
ment. Females  may  significantly  influence  the  outcome  of 
the  mating  process  by  hiding  their  reproductive  status  be- 
fore reaching  the  neiuhhorhood  of  dominant  males. 


142 


E.  R    DIAZ  AND  MARTIN  THIEL 


Acknowledgments 

We  are  grateful  to  I.  Hinojosa  and  T.  Chr.  van  Son  for 
help  in  collecting  shrimp.  Our  special  thanks  go  to  W.  Stotz 
and  D.  Lancellotti  for  their  unconditional  support  during 
this  study.  Helpful  comments  from  A.  Baeza  and  from  two 
anonymous  reviewers  helped  to  improve  the  original  manu- 
script. 

Literature  Cited 

Acquistapace,  P.,  L.  Aquiloni,  B.  A.  Hazlett,  and  F.  Gherardi.  2002. 

Multimodal  communication  in  crayfish:  sex  recognition  during  mate 
search  by  male  Austropotamobius  pal/ipes.  Can  J.  Zoo/.  80:  2041- 
2(14?. 

Alema,  J.  1986.  Review  of  sexual  selection  and  chemical  communica- 
tion in  the  lobster.  Homarus  americanus.  Can.  J.  Fish.  Aqttat.  Sci.  43: 
2283-2290. 

Atema,  J.  1995.  Chemical  signals  in  the  marine  environment:  dispersal, 
detection,  and  temporal  signal  analysis.  Proc.  Natl.  Acad.  Sci.  USA  92: 
62-66. 

Atema,  J..  and  J.  S.  Cobb.  1980.  Social  behavior.  Pp.  409-450  in  The 
Biology  and  Management  of  Lobsters.  J.  S.  Cobb  and  B.  F.  Phillips, 
eds.  Academic  Press,  NY. 

Atema.  J.,  and  D.  F.  Cowan.  1986.  Sex-identifying  urine  and  molt 
signals  in  lobster  Homarus  americanus.  J.  Chem.  Ecol.  12:  2065-2080. 

Atema,  J.,  and  R.  Voigt.  1995.  Behavior  and  sensory  biology.  Pp. 
313-348  in  The  Biology  of  the  Lobster,  Homarus  americanus,  J.  R. 
Factor,  ed.  Academic  Press,  New  York. 

Atema.  J.,  S.  Jacobsen,  E.  Karnofsky,  S.  Oleszko-Szuts,  and  L.  Stein. 
1979.  Pair  formation  in  the  lobster,  Homarus  americanus:  behavioral 
development,  pheromones  and  mating.  Mar.  Behav.  Phvsiol.  6:  277- 
296. 

Backwell,  P.,  M.  Jennions,  N.  Passmore,  and  J.  Christy.  1998.  Syn- 
chronized courtship  in  fiddler  crabs.  Nature  391:  31-32. 

Bamber,  S.  D.,  and  E.  Naylor.  1996.  Chemical  communication  and 
behavioural  interaction  between  sexually  mature  male  and  female  shore 
crabs  (Carcinus  maenas).  J.  Mar.  Biol.  Assoc.  UK  76:  691-699. 

Barlow,  R.  B.,  L.  C.  Ireland,  and  L.  Kass.  1982.  Vision  has  a  role  in 
Limulus  mating  behavior.  Nature  296:  65-66. 

Borowsky,  B.  1991.  Patterns  of  reproduction  of  some  amphipod  crusta- 
ceans and  insights  into  the  nature  of  their  stimuli.  Pp.  33-49  in 
Crustacean  Sexual  Biology,  R.  T.  Bauer  and  J.  W.  Martin,  eds.  Co- 
lumbia University  Press.  New  York. 

Bouchard,  S.,  B.  Sainte-Marie,  and  J.  N.  McNeil.  1996.  Indirect  evi- 
dence indicates  female  semiochemicals  release  male  precopulatory 
behaviour  in  the  snow  crab,  Chionoecetes  opilio  (Brachyura:  Majidae). 
Chemoecologv  7:  39-44. 

Breithaupt,  T.,  and  J.  Atema.  2000.  The  timing  of  chemical  signaling 
in  dominance  fights  of  male  lobsters  (Homarus  americanus).  Behav. 
Ecol.  Sociobiol.  49:  67-78. 

Breithaupt,  T.,  and  P.  Eger.  2002.  Urine  makes  the  difference:  chem- 
ical communication  in  fighting  crayfish  made  visible.  /.  Exp.  Biol.  205: 
1221-1231. 

Burggren,  W.  W.,  and  B.  R.  McMahon.  1988.  Biologv  of  the  Lund 
Crabs.  Cambridge  University  Press,  Cambridge. 

Bushmann,  P.  J.  1999.  Concurrent  signals  and  behavioral  plasticity  in 
blue  crab  (Cullinectes  sapidus  Rathbun)  courtship.  Biol.  Bull.  197: 
63-7 1 . 

Bushmann,  P.  J.,  and  J.  Atema.  1997.  Shelter  sharing  and  chemical 
courtship  signals  in  the  lobster  Homarus  americanus.  Can.  J.  Fish. 
Aquat.  Sci.  54:  647-654. 


Bushmann.  P.  J.,  and  J.  Atema.  2000.  Chemically  mediated  mate 
location  and  evaluation  in  the  lobster.  Homarus  americanus.  J.  Chem. 
Ecol.  26:  883-899. 

Caillaux,  L.  M..  and  W.  Stotz.  2003.  Distribution  and  abundance  of 
Rhynchocinetes  typus  Milne  Edwards  (Crustacea:  Decapoda:  Rhyncho- 
cinetidae)  in  different  benthic  community  structures  in  northern  Chile. 
J.  Mar.  Biol.  Assoc.  UK  83:  143-150. 

Caldwell,  R.  L.,  and  H.  Dingle.  1979.  The  influence  of  size  differential 
on  agonistic  encounters  in  the  mantis  shrimp,  Gonodactylus  viridis. 
Behaviour  69:  255-264. 

Christy,  J.  H.  1987.  Competitive  mating,  mate  choice  and  mating  asso- 
ciations of  brachyuran  crabs.  Bull  Mar.  Sci.  41:  177-191. 

Christy,  J.  H.,  and  M.  Salmon.  1991.  Comparative  studies  of  reproduc- 
tive behavior  in  mantis  shrimps  and  fiddler  crabs.  Am.  Zoo/.  31: 
329-337. 

Christy.  J.  H..  P.  R.  Y.  Backwell.  and  U.  Schober.  2003.  Interspe- 
cific attractiveness  of  structures  built  by  courting  male  fiddler  crabs: 
experimental  evidence  of  a  sensory  trap.  Behav.  Ecol.  Sociobiol.  53: 
84-41. 

Correa,  C.,  and  M.  Thiel.  2003a.  Mating  systems  in  caridean  shrimp 
(Decapoda:  Caridea)  and  their  evolutionary  consequences  for  sexual 
dimorphism  and  reproductive  biology.  Rev.  Chil.  Hist.  Nat.  76:  187- 
203. 

Correa,  C.,  and  M.  Thiel.  2003b.  Population  structure  and  operational 
sex  ratio  in  the  rock  shrimp  Rhvnchocinetes  typus  (Decapoda:  Candea). 
J.  Crustac.  Biol.  23:  849-861. 

Correa,  C.,  J.  A.  Baeza,  E.  Dupre,  I.  A.  Hinojosa,  and  M.  Thiel.  2000. 
Mating  behavior  and  fertilization  success  of  three  ontogenetic  stages  of 
male  rock  shrimp  Rhynchocinetes  typus  (Decapoda:  Caridea).  J.  Crus- 
tac. Biol  20:  628-640. 

Correa,  C.,  J.  A.  Baeza,  I.  A.  Hinojosa,  and  M.  Thiel.  2003.  Male 
dominance  hierarchy  and  mating  tactics  in  the  rock  shrimp  Rhvncho- 
cinetes typus  (Decapoda:  Caridea).  J.  Crustac.  Biol.  23:  33-45. 

Cowan,  D.  F.  1991.  The  role  of  olfaction  in  courtship  behavior  of  the 
American  lobster  Homarus  americanus.  Biol.  Bull.  181:  402-407. 

Cowan,  D.  F.,  and  J.  Atema.  1990.  Moult  staggering  and  serial  monog- 
amy in  American  lobsters,  Homarus  americanus.  Anim.  Behav.  39: 
1199-1206. 

Derby,  C.  D.,  and  P.  Steullet.  2001.  Why  do  animals  have  so  many 
receptors?  The  role  of  multiple  chemosensors  in  animal  perception. 
Biol  Bull.  200:  211-215. 

Diaz,  E.  R.,  and  M.  Thiel.  2003.  Female  rock  shrimp  prefer  dominant 
males.  /  Mar.  Biol.  Assoc.  UK  83:  941-942. 

Dunham,  P.  J.  1978.  Sex  pheromones  in  Crustacea.  Biol  Rev.  53: 
555-583. 

Gleeson,  R.  A.  1991.  Intrinsic  factors  mediating  pheromone  communi- 
cation in  the  blue  crab.  Callinectes  sapidits.  Pp.  1 7-32  in  Crustacean 
Sexual  Biology,  R.  T.  Bauer  and  J.  W.  Martin,  eds.  Columbia  Univer- 
sity Press.  New  York. 

Hassler,  C.,  and  H.  J.  Brockmann.  2001.  Evidence  for  use  of  chemical 
cues  by  male  horseshoe  crabs  when  locating  nesting  females  (Limulus 
polyphemus).  J.  Chem.  Ecol.  27:  2319-2335. 

Hatziolos,  M.  E.  and  R.  L.  Caldwell.  1983.  Role  reversal  in  courtship 
in  the  stomatopod  Pseudosqui/la  ci/iata  (Crustacea).  Anim.  Behav.  31: 
1077-1087. 

Hinojosa,  I.  A.,  and  M.  Thiel.  2003.  Somatic  and  gametic  resources  in 
male  rock  shrimp,  Rhynchocinetes  typus:  effect  of  mating  potential  and 
ontogenetic  male  stage.  Anim.  Behav.  66:  449 — 158. 

Hughes,  M.  19%.  The  function  of  concurrent  signals:  visual  and  chem- 
ical communication  in  snapping  shrimp.  Anim.  Behav.  52:  247-257. 

Kamio,  M.,  S.  Matsunaga.  and  N.  Fusetani.  2002.  Copulation  phero- 
mone in  the  crab  Telmessus  cheiragonus  (Brachyura:  Decapoda).  Mar. 
Ecol.  Prog.  Ser.  234:  183-190. 


SEXUAL  COMMUNICATION   IN  ROCK  SHRIMP 


143 


Karavanich,  C.,  and  J.  Atenia.  1998.  Individual  recognition  and  mem- 
ory in  lobster  dominance.  Anim.  Beliav.  56:  1553-1560. 

Karnofsky,  E.  B.,  J.  Atema,  and  R.  H.  Elgin.  1989.  Field  observations 
of  social  behavior,  shelter  use.  and  foraging  in  the  lobster,  Homann: 
americanus.  Bwi  Bull.  176:  239-246. 

Kelly,  L.  S.,  and  T.  W.  Snell.  1998.  Role  of  surface  glycoproteins  in 
mate-guarding  of  the  marine  harpacticoid  Tigriopus  jupunicits.  Mar. 
Bio/.  130:  605-612. 

Latruffe,  C.,  P.  K.  McGregor,  and  R.  F.  Oliveira.  1999.  Visual  sig- 
nalling and  sexual  selection  in  male  fiddler  crabs  Uca  tan/jfri.  Mar. 
Eco/.  Prog.  Set:  189:  233-240. 

Marshall,  J.,  T.  W.  Cronin,  N.  Shashar,  and  M.  Land.  1999.  Behav- 
ioural evidence  for  polarisation  vision  in  stomatopods  reveals  a  poten- 
tial channel  for  communication.  Curr.  Bio/.  9:  755-758. 

Pope,  D.  S.  2000.  Testing  function  of  tiddler  crab  claw  waving  by 
manipulating  social  context.  Beliav.  Eco/.  Sociobiol.  6:  432 — 137. 

Salmon,  M.  1983.  Courtship,  mating  systems;  and  sexual  selection  in 
decapods.  Pp.  143-169  in  Studies  in  Adaptation:  The  Behavior  of 


Higher  Crnsiaeeans,  S.  Rebach  and  D.  Dunham,  eds.  John  Wiley  & 
Sons.  New  York. 

Shuster.  S.  M.,  and  M.  J.  Wade.  20(13.  Mating  Systems  and  Slratcf.:ii-\ 
Princeton  University  Press.  Princeton.  NJ. 

Sneddon.  L.  U.,  F.  A.  Huntingford,  A.  C.  Taylor,  and  A.  S.  Clare.  20(13. 
Female  sex  pheromone-mediated  effects  on  behavior  and  consequences 
of  male  competition  in  the  shore  crab  (Carciiuix  maenast.  J.  Client. 
Ecol.  29:  55-7(1. 

Thiel,  M..  and  I.  Hinojosa.  2003.  Mating  behavior  of  female  rock 
shrimp  Rhynchticinctes  typns  (Decapoda:  Caridea) — indication  for  con- 
venience polyandry  and  cryptic  female  choice.  Behav.  Eeol.  Sociobiol. 
55:  113-121. 

Zar,  J.  H.  1999.  Biastatistical  Analysis.  4th  ed.  Prentice  Hall.  Upper 
Saddle  River.  NJ. 

Zulundt  Schneider,  R.  A.,  R.  Huber,  and  P.  A.  Moore.  2001.  In- 
dividual and  status  recognition  in  the  crayfish,  Orcunectes  rusticus: 
(he  effects  of  urine  release  on  fight  dynamics.  Behaviour  138: 
137-153. 


Reference:  Biol.  Bull.  206:  144-151.  (June  2004) 
©  2004  Marine  Biological  Laboratory 


Remarkable  Longevity  of  Dilute  Sperm  in  a 
Free-Spawning  Colonial  Ascidian 


SHERI  L.  JOHNSON1  *  AND  PHILIP  O.  YUND- 

1  School  of  Marine  Sciences.  Darling  Marine  Center,  University  of  Maine.  Walpole.  Maine  04573:  ami 
2  Marine  Sciences  Center.  University  of  New  England.  Biddeford.  Maine  04005 


Abstract.  Many  benthic  marine  invertebrates  reproduce 
by  releasing  sperm  into  the  sea  (free-spawning),  but  the 
amount  of  time  that  sperm  are  viable  after  spawning  may 
have  different  consequences  for  fertilization,  depending  on 
the  type  of  free-spawner.  In  egg-broadcasting  marine  organ- 
isms, gamete  age  is  usually  assumed  to  be  irrelevant  be- 
cause of  the  low  probability  of  contact  between  dilute  sperm 
and  egg.  However,  direct  dilution  effects  might  be  reduced 
in  egg-brooding  free-spawners  that  filter  dilute  sperm  out  of 
the  water  column,  and  sperm  longevity  may  play  a  role  in 
facilitating  fertilization  in  these  taxa.  We  investigated  the 
effects  of  time,  temperature,  and  mixing  on  the  viability  of 
naturally  released  sperm  of  the  colonial  ascidian  Botrylliu 
schlii.ixeri.  Our  data  indicate  that  B.  schlosseri  sperm  have  a 
functional  life  span  that  is  considerably  longer  than  those  of 
the  sperm  of  many  other  marine  invertebrate  taxa  (half-life 
of  ~  16  to  26  h).  are  able  to  fertilize  eggs  at  extremely  low 
external  sperm  concentrations  (cu.  101  sperm  ml  '),  and 
have  a  longevity  that  varies  with  temperature.  It  is  possible 
that  such  prolonged  sperm  longevity  may  be  achieved  by 
reductions  in  motility,  reactivation  of  quiescent  sperm  by 
chemical  cues,  or  intermittent  swimming. 

Introduction 

Sperm  longevity  in  free-spawning  marine  invertebrates 
(organisms  that  release  sperm  into  the  environment;  Giese 
and  Kanatani,  1987;  Levitan.  1998)  that  broadcast  their  eggs 
is  typically  assumed  to  be  irrelevant  to  field  fertilization 
because  hvdrodynamic  processes  may  rapidly  dilute  ga- 
metes after  release  (Vogel  et  ai.  1982:  Pennington.  1985; 
Denny,  1988.  Dennv  and  Shibata,  1989;  Levitan,  1991. 


Received  1.1  January  21)04.  accepted  14  April  20(14. 
*  To   whom   correspondence    should    he   addressed. 
inaine.edu 


I    in. ill      shrill'"1 


1995;  Levitan  and  Peterson,  1995).  However,  dilution  also 
has  an  indirect  effect  on  fertilization  by  controlling  sperm 
longevity  (Levitan  et  a!..  1991 ).  Longevity  is  generally  high 
when  sperm  are  concentrated  (on  the  order  of  many  hours), 
but  longevity  decreases  considerably  after  dilution  (to  a 
functional  life  span  of  only  tens  of  minutes:  Pennington. 
1985;  Levitan  et  al..  1991:  Powell  et  ai.  2001;  Baker  and 
Tyler,  2001).  The  mechanism  underlying  this  phenomenon 
is  termed  the  "respiratory  dilution  effect":  the  amount  of 
energy  consumed  by  sperm  is  a  function  of  motility,  and 
concentrated  sperm  can  maintain  a  lower  metabolic  state 
than  dilute  sperm  (reviewed  by  Chia  and  Bickell.  1983). 
However,  sperm  are  generally  assumed  to  be  diluted  below 
effective  concentrations  well  before  the  viable  life  of  the 
gamete  has  expired  (i.e.,  the  direct  effects  of  dilution  over- 
whelm indirect  effects;  Pennington.  1985;  Levitan  et  al.. 
1991;  Levitan.  1995;  but  see  Williams  and  Bentley.  2002). 

In  contrast  to  egg-broadcasters,  many  free-spawners  that 
retain  eggs  for  internal  fertilization  (i.e.,  egg-brooders)  may 
use  filter-feeding  or  suspension-feeding  mechanisms  to  con- 
centrate dilute  sperm  from  the  water  throughout  a  prolonged 
period  of  egg  viability  (Yund,  2000:  Pemberton  et  ai. 
2003b).  If  females  can  overcome  direct  dilution  effects  and 
obtain  sperm  from  distant  males,  adaptations  that  increase 
sperm  longevity  (e.g..  inactivity,  intermittent  swimming, 
and  activation  by  chemical  cues)  may  be  important  in  fer- 
tilization in  the  field.  Sperm  longevity  is  thought  to  enhance 
fertilization  in  some  internally  fertilizing  ascidians  (Bishop. 
1998;  Pemberton  et  al.,  2003b)  and  bryozoans  (Mann'quez 
et  til..  2001). 

Because  many  marine  invertebrates  spawn  under  a  wide 
range  of  temperatures  (Andronikov.  1975).  thermal  effects 
may  have  important  consequences  for  gamete  longevity.  A 
few  studies  have  examined  the  effects  of  temperature  on 
sperm  viability  (Andronikov.  1975;  Greenwood  and  Ben- 


144 


SI'1-KM    I.ONC.I  -Yin     IN    A    BROODl  K 


145 


nett,  1981;  Mann'quez  et  at.,  2001 ),  but  effects  on  longevity 
have  received  little  attention.  Temperature  has  a  direct  ef- 
fect on  all  metabolic  processes  (Hochachka  and  Somero. 
1984);  hence  higher  temperatures  might  be  expected  to 
reduce  longevity  (Greenwood  and  Bennett.  1981).  How- 
ever, increased  temperature  also  decreases  water  viscosity 
(Dorsey,  1968;  Jumars  et  al.,  1993),  which  can  profoundly 
affect  the  energy  requirements  of  small  organisms  (such  is 
sperm)  that  swim  in  a  low  Reynolds  number  environment 
(Denny,  1993;  Podolsky  and  Emlet.  1993;  Fuiman  and 
Batty,  1997;  Hunt  von  Herbing,  2002).  If  sperm  are  subject 
to  both  direct  metabolic  effects  and  viscosity  effects,  the 
overall  thermal  effects  on  longevity  and  fertilization  may  be 
complex. 

In  this  study,  we  use  the  colonial  ascidian  Botiyllus 
schlosseri  (Pallas.  1766)  as  a  model  system  to  experimen- 
tally investigate  the  effects  of  time,  temperature,  and  mixing 
on  the  viability  of  naturally  released  sperm.  Physical  dis- 
turbance created  by  mixing  might  alter  longevity  patterns  by 
inducing  or  suppressing  swimming  or  by  physically  dam- 
aging gametes  (Mead  and  Denny.  1995;  Denny  etui..  2002). 
Botiyllus  schlosseri  has  been  the  subject  of  several  labora- 
tory and  field  fertilization  studies  (e.g..  Grosberg.  1991; 
Yund  and  McCartney,  1994;  Yund.  1995,  1998;  Stewart- 
Savage  et  al.,  2001).  Released  sperm  exit  the  colony 
through  the  exhalent  siphon  and  rapidly  disperse  into  the 
surrounding  seawater  (Milkman,  1967).  Sperm  are  then 
acquired  by  another  colony,  and  fertilization  takes  place 
internally.  Botiyllus  schlosseri  is  a  geographically  wide- 
spread species  (Grosberg,  1988),  so  colonies  experience  a 
wide  range  of  temperature  regimes  during  the  reproductive 
season  (e.g.,  Yund  and  Stires.  2002). 

Materials  and  Methods 

Study  organism  and  culture 

Botiyllus  schlosseri  is  a  sessile  colonial  ascidian  that 
inhabits  shallow  waters  and  harbors  throughout  New  En- 
gland and  other  temperate  regions  of  the  world  (Van  Name, 
1945).  Colonies  are  cyclical  hermaphrodites  with  alternat- 
ing female  and  male  phases  occurring  in  repetitive  sexual 
cycles  (Milkman,  1967;  Grosberg,  1988).  This  sexual  cycle 
is  linked  to  a  zooid-replacement  cycle.  Over  a  7-10  day 
period  (length  depends  on  temperature;  Grosberg,  1982),  a 
new  generation  of  zooids  (buds)  grow  and  expand  and  then 
assume  the  function  of  the  older  zooids,  which  are  quickly 
resorbed.  Eggs  are  fertilized  as  the  new  sexual  generation  of 
zooids  replaces  the  old  generation  (hereafter  referred  to  as 
takeover.  Milkman,  1967);  once  fertilized,  the  eggs  develop 
into  embryos  that  are  released  as  tadpole  larvae  at  the  end  of 
the  cycle  (Grosberg,  1991).  Sperm  release  commences 
about  16  h  after  the  start  of  a  cycle  and  continues  for  several 
days,  so  colonies  are  functionally  male  throughout  most  of 
the  reproductive  cycle  (Stewart-Savage  and  Yund.  1997). 


Colonies   neither  self-fertilize   nor  store  sperm   (Stewart- 
Savage  et  al..  2001). 

Colonies  of  B.  schlosseri  were  collected  from  the  Dama- 
riscotta  River,  Maine.  Animals  were  grown  on  glass  micro- 
scope slides  (7.6  x  5.1  cm)  in  the  flowing  seawater  system 
at  the  University  of  Maine's  Darling  Marine  Center  and 
monitored.  When  colonies  with  at  least  20  eggs  were  ap- 
proaching takeover  (late  stage  5  through  early  stage  6; 
Milkman,  1 967 1.  they  were  isolated  (at  least  12  h  before 
siphon  opening)  in  50  ml  of  unfiltered  sperm-free  seawater 
(aged  at  least  7  days  in  the  dark  at  15  °C)  at  15  °C  and  fed 
phytoplankton  (Isochrysis  or  Tetraselmis  sp.)  at  densities  of 
approximately  10s  cells  ml"1.  Water  and  food  were 
changed  daily.  Colonies  were  determined  to  have  completed 
siphon  opening  when  phytoplankton  were  present  in  the 
digestive  tract,  indicating  that  eggs  had  been  ovulated,  and 
these  colonies  were  subsequently  treated  as  virgin  females 
for  the  experiment. 

Sperm  collection  and  aging 

For  each  experimental  trial,  naturally  spawned  sperm 
were  obtained  by  isolating  24  colonies  in  200  ml  of  sperm- 
free  seawater  (see  above)  for  4  h  during  peak  sperm  release 
(Stewart-Savage  and  Yund,  1997).  A  15-ml  sample  of  the 
undiluted  solution  was  collected  to  determine  the  sperm 
concentration.  Sperm  were  then  quickly  diluted  100-fold: 
160  ml  of  mixed  sperm  suspension  were  added  to  16.  1  of 
aged  seawater  (15  °C)  and  mixed.  We  immediately  col- 
lected a  sample  and  used  it  to  obtain  an  initial  fertilization 
level.  The  remaining  suspension  was  then  aliquotted  into 
four  glass  containers,  each  containing  3.8  1.  The  aliquots 
were  then  aged  under  experimental  conditions,  consisting  of 
all  combinations  of  two  temperatures  (15  °C  and  22  °C)  and 
two  mixture  treatments  (mixed  and  unmixed).  Mixed  sus- 
pensions were  constantly  stirred  with  a  magnetic  mixer.  The 
15  °C  and  22  °C  temperatures  were  selected  to  represent  the 
range  under  which  spawning  normally  occurs  in  the  Dama- 
riscotta  River  estuary  (Yund  and  Stires,  2002).  Each  con- 
tainer was  sampled  at  8,  24,  48,  and  72  h.  We  sampled  two 
areas  of  the  unmixed  container.  One  sample  was  removed 
from  the  top,  and  then  a  second  sample  was  carefully 
pipetted  off  the  bottom  while  minimizing  disturbance  to  the 
solution.  By  contrast,  the  sample  from  the  mixed  solution 
integrated  different  heights  within  the  container.  This  sam- 
pling scheme  yielded  three  experimental  treatments:  top  and 
bottom  of  the  unmixed  solution,  and  the  mixed  solution. 
Differences  between  the  top  and  bottom  treatments  might 
reveal  aspects  of  sperm  behavior  (e.g..  buoyant  or  upward- 
swimming  sperm  v.s.  immotile  sinking  or  downward-swim- 
ming sperm),  while  the  mixed  treatment  tests  the  effects  of 
physical  disturbance  and  aeration  on  sperm  viability. 

Sperm  counts  were  determined  by  concentrating  a  fresh 
aliquot  ( 13.5  ml)  of  the  undiluted  sperm  suspension  by  two 


146 


S.  L.  JOHNSON  AND  P.  O.  YUND 


orders  of  magnitude  through  centrifugation.  Polyvinyl  alco- 
hol (Sigma- Aldrich;  1.5  ml  of  a  1  g  ml  '  solution)  was 
added  to  the  sperm  solution  before  centrifugation  to  prevent 
sperm  from  adhering  to  container  surfaces.  The  concen- 
trated suspension  (150  ju.1)  obtained  by  centrifugation  was 
fixed  with  25%  gluteraldehyde  and  subsequently  counted  on 
a  hemacytometer  (three  samples,  two  counts  each).  Raw 
hemacytometer  counts  were  multiplied  by  a  dilution  factor 
to  obtain  the  concentration  of  the  aging  and  fertilization 
solution.  Because  of  the  low  concentration  of  B.  schlosseri 
sperm,  all  25  squares  of  the  hemacytometer  had  to  be  scored 
to  obtain  non-zero  counts.  Consequently,  our  values  are 
probably  accurate  only  to  the  nearest  order  of  magnitude. 

Fertilization  assays 

All  fertilization  assays  were  conducted  in  50-ml  cham- 
bers with  virgin  female  colonies.  At  each  time  point,  40  ml 
of  each  experimental  solution  was  transferred  into  the 
chambers  along  with  5  ml  (10  cells  ml  ')  of  algae.  The 
fertilization  assays  were  then  incubated  at  the  relevant  ex- 
perimental temperature  for  4  h.  At  the  end  of  the  incubation, 
colonies  were  rinsed  with  aged  seawater  to  terminate  the 
collection  of  sperm  and  were  returned  to  isolation.  All 
colonies  were  maintained  at  a  constant  temperature  to  stan- 
dardize development  times.  After  16-20  h.  an  incision  was 
made  in  each  zooid.  and  the  unfertilized  eggs  and  develop- 
ing embryos  were  counted  with  the  aid  of  a  stereomicro- 
scope.  Results  are  expressed  as  percent  fertilization.  A  total 
of  14  trials  were  conducted  over  two  reproductive  seasons. 
Sperm-free  controls  were  not  included,  because  colonies 
were  isolated  in  sperm-free  seawater  well  in  advance  of 
siphon  opening.  In  addition,  stage  of  embryo  development 
was  assessed  as  a  control  for  the  timing  of  fertilization,  to 
ensure  that  fertilizations  were  the  product  of  the  sperm  we 
added.  Some  of  the  embryos  in  six  female  colonies  were  too 
far  along  in  development  (i.e.,  >24  h),  and  so  must  have 
been  the  product  of  fertilization  by  contaminating  sperm 
prior  to  our  experiment.  Data  from  these  individuals  were 
excluded  from  the  analysis. 

Statistical  unalvsis 

All  percent  fertilization  data  were  arcsine  transformed  to 
meet  normality  assumptions.  A  few  fertilization  assays  were 
omitted  during  the  experiment,  due  either  to  the  death  of 
experimental  animals  or  to  a  shortage  of  virgin  females  at 
appropriate  time  points.  Consequently,  fertilization  data 
were  analyzed  with  a  software  package  that  accommodates 
an  unbalanced  design  (Proc  GLM  ver.  6.07.  SAS  Institute. 
Cary.  North  Carolina).  A  repeated-measures  ANOVA  with 
trial  nested  within  treatment  and  temperature  was  con- 
ducted. The  effects  of  temperature  and  treatment  were  tested 
against  the  nested  term,  and  all  effects  involving  time  were 
tested  against  the  residual  error.  Type  III  sums  of  squares 


are  reported  for  all  sources  of  variation.  Significance  was 
determined  at  the  5%  level.  An  additional  multi-way 
ANOVA  assessed  whether  egg  number  differed  among 
times,  temperatures,  and  treatments  to  test  whether  effects 
in  the  main  analysis  could  have  been  an  artifact  of  variation 
in  egg  number. 

Sperm  half-life 

Two  sperm  half-life  estimates  were  generated  by  treating 
time  as  a  continuous  variable.  For  each  temperature,  a 
logarithmic  regression  of  mean  percent  fertilization  (not 
transformed),  averaging  across  all  treatments,  was  con- 
ducted with  time  as  the  dependent  variable.  Sperm  half-lives 
were  calculated  from  these  equations  by  solving  for  the  time 
at  which  fertilization  dropped  to  half  of  the  initial  (Oh) 
value.  Estimates  obtained  from  our  data  were  compared  to 
previously  published  half-lives  of  other  free-spawning  ma- 
rine invertebrates.  We  used  data  previously  reviewed  by 
Manriquez  et  al.  (2001 ),  but  included  published  values  for 
other  egg-brooding  taxa. 

Results 

Effects  on  sperm  viability 

The  analysis  of  variance  results  indicate  a  highly  signif- 
icant overall  effect  of  time,  with  a  decrease  in  percent 
fertilization  with  increasing  sperm  age  for  Botryllits  schlns- 
seri  (Table  1 ).  Fertilization  of  eggs  was  still  possible  using 
naturally  spawned  sperm  that  had  been  aged  72  h.  At  an 
average  sperm  concentration  of  approximately  1.38  X 
10'  ±  0.13  X  10'  (SE)  sperm  ml'1,  initial  fertilization  was 
about  61%.  and  after  72  h  decreased  only  to  about  25%  of 
the  starting  level  (Fig.  1 ).  Temperature  also  had  a  significant 
effect  (Table  1).  with  fertilization  generally  higher  when 
sperm  were  aged  at  15  °C  than  at  22  °C  (Fig.  1 ). 

We  were  unable  to  detect  anv  significant  effect  of  treat- 


Table  I 

Results  of  repeated-measures  nested  ANOVA  on  percent  fertilization 


Source 

df 

SS  III 

F  ratio 

P 

Time 

3 

8.77 

14.32 

(1.0(101 

Time*Temp 
TimeTreat 

3 
6 

0.47 
0.79 

0.77 
0.08 

0.5134 

0.9195 

Time*Temp*Treat 
Error  a:  Residual' 

6 
159 

0.74 
32.48 

0.60 

0.7265 

Temp 
Treat 

1 
2 

1.03 
0.16 

5.21 
0.40 

0.0252 

0.6698 

Temp*Treal 
Error  b:  Trial(Temp*Treat)~ 

2 
78 

0.03 
15.40 

0.09 

0.9169 

'  Error  a:  used  to  test  all  effects  involving  time. 

:  Error  h:  used  to  test  treatment  and  temperature  effects. 


SPERM   LONGEVITY  IN  A  BROODER 


147 


80 


60 


20  - 


0 
80 


60 


i<«H 


^20- 


A)  Top 


Li 


B)  Bottom 

I      T 


0 
80 


60 
.o 

1 

i«H 


C)  Mixed 
I 


24  48 

Time  (h) 


72 


Figure  1.  Viability  of  Botryllus  schlosseri  sperm  measured  as  fertili- 
zation (%)  of  eggs  over  time  (A)  at  the  top  (unmixed  suspension).  (B)  at  the 
bottom  (unmixed  suspension),  and  (C)  in  the  mixed  treatment.  Data  are 
means  (±SE)  of  all  trials.  The  0  h  sample  (indicated  by  the  gray  bar) 
represents  the  fertilization  potential  of  the  sperm  solution  prior  to  manip- 
ulation, and  so  is  identical  for  all  temperatures  and  treatments.  Average 
working  sperm  concentration  was  1.38  x  10'  sperm  ml"1. 


ment,  nor  were  any  of  the  interaction  effects  significant 
(Table  1).  Average  egg  numbers  were  50.2  ±  0.8  (SE)  and 
did  not  vary  significantly  with  time,  temperature,  or  treat- 
ment (F9251  =  0.92.  P  =  0.45). 

Sperm  half-lives 

Logarithmic  regressions  of  fertilization  with  time  were 
highly  significant  for  both  temperatures  (15  °C,  r  =  0.967. 
P  <  0.01;  22  °C,  r  =  0.790,  P  <  0.05).  Sperm  half-lives 
(the  time  at  which  fertilization  drops  to  50%  of  its  initial 
level)  were  estimated  at  both  temperatures,  using  the  fol- 
lowing logarithmic  regression  equations:  15  °C,  %  fertil- 
ization =  -29.369  log  (time)  +  72.291;  22  °C.  %  fertil- 
ization =  -31.375  log  (time)  +  68.456.  The  resulting 
half-lives  were  26.3  h  at  15  °C  and  16.1  h  at  22  °C  (Fig.  2). 


Comparison  with  data  from  several  other  free-spawners. 
including  two  egg-brooders  and  multiple  egg-broadcasters, 
reveals  that  dilute  B.  schluxseri  sperm  have  substantially 
greater  longevity  than  dilute  sperm  of  most  other  free- 
spawners  (Fig.  3).  Similar  sperm  half-lives  in  egg-broad- 
casters have  been  documented  only  at  sperm  concentrations 
many  orders  of  magnitude  greater  than  those  used  in  our 
experiment  (e.g.,  Williams  and  Bentley.  2002).  As  a  group, 
the  three  egg-brooders  in  our  comparison  have  greater 
sperm  half-lives  at  low  concentrations  than  all  of  the  egg- 
broadcasters  (Fig.  3). 

Discussion 
Sperm  longevity  in  free-spawning  invertebrates 

The  functional  life  span  reported  here  for  Botryllus 
schlosseri  sperm  is  considerably  longer  than  previously 
reported  for  the  dilute  sperm  of  any  other  free-spawning 
marine  invertebrate,  and  orders  of  magnitude  greater  than 
the  qualitative  estimate  for  this  species  (based  in  part  on 
motility)  previously  reported  by  Grosberg  (1987).  A  sub- 
stantial number  of  fertilizations  still  occurred  with  48-  and 
72-h-old  sperm.  In  the  few  trials  in  which  fertilization  did 
not  drop  to  zero  by  72  h,  sperm  suspensions  were  aged  and 
retested  after  an  additional  24  h  (i.e.,  at  96  h).  These 
samples  also  resulted  in  a  low  level  of  fertilization  (13.8%; 
unpubl.  data). 

Williams  and  Bentley  (2002)  reported  similar  sperm  lon- 
gevity in  a  free-spawner  (the  polychaete  Arenicola),  but 
only  at  a  sperm  concentration  four  orders  of  magnitude 
higher  than  the  101  sperm  mP1  reported  here.  High  lon- 
gevity of  concentrated  sperm  is  predicted  by  the  respiratory 


Figure  2.  Viability  of  Bony/his  schlosseri  sperm  measured  as  a  func- 
tion of  mean  ( ±  SE)  fertilization  ( % )  of  eggs  over  time  at  1 5  °C  and  22  °C. 
The  value  for  each  point  is  the  grand  mean  of  the  top.  bottom,  and  mixed 
treatments  averaged  across  all  trials.  Best-fit  logarithmic  regression  lines 
used  to  estimate  sperm  half-lives  are  plotted  for  each  temperature:  15  °C 
(solid  line)  and  22  °C  (dashed  line).  Half-lives  were  calculated  as  the  time 
needed  for  fertilization  to  decrease  to  50%  of  the  initial  value,  as  indicated 
by  the  dotted  lines. 


148 


S.  L.  JOHNSON  AND  P.  O.  YUND 


50 
40 


1 


30- 


|r    20 

"ro 
X 


D 


A 


D    Botryllus  schlosseri  (15°C) 
A    Botryllus  schlosseri  (22  °  C) 
V    Diplosoma  lister anutn 
O    Cellaporella  hyalina 

•  Haliotis  tuberculata 
A    Arenicola  marina 

»    Asterias  rubens 
T    Nereis  wrens 
+    C/'ona  intestinalis 

•  Ascidella  aspersa 
-*—  Acanthaster  planci 
• Strongylocentrotus 

droebachiensis 


0123456 

Log  (sperm  ml'1) 

Figure  3.  Sperm  half-life  (h)  measured  as  a  function  of  sperm  concentration  (log  sperm  ml  ')  in  a  variety 
of  free-spawning  marine  invertebrates  (sensu  Manriquez  et  ai.  2001 .  with  additional  values  from  this  study  and 
the  literature).  Botryllus  schlosseri,  this  paper;  D.  listemnum.  Bishop,  1998;  C.  hyalina.  Manriquez  et  al..  2001; 
H.  tnhcniilata,  Powell  et  al..  2001;  A.  marina.  N.  virens,  and  A.  nibens,  Williams  and  Bentley.  2002;  C. 
intestinalis  and  A.  aspera,  Bolton  and  Havenhand.  1996;  A.  planci,  Benzie  and  Dixon,  1994;  5.  droebachiensis, 
Levitan.  1993).  Lines  connect  different  values  reported  for  individual  species  at  multiple  sperm  concentrations. 
The  four  open  symbols  represent  brooders;  the  remaining  closed  symbols  are  broadcasters. 


dilution  effect  (Chia  and  Bickell,  1983),  but  the  combina- 
tion of  high  longevity  and  very  low  concentration  has  not 
previously  been  reported.  In  addition,  Arenicola  is  an  egg- 
broadcasting  species  that  retains  its  eggs  in  a  burrow  and 
pumps  sperm-laden  water  past  them  (Williams  et  al..  1997). 
Consequently,  it  appears  to  function  much  like  an  egg- 
brooder  (Williams  and  Bentley.  2002).  Prolonged  motility 
has  been  observed  in  two  species  of  deep-sea  echinothuriid 
sea  urchins,  Araeosoma  fenestratum  and  Sperosoma  antil- 
lense  (Young.  1994);  but  sperm  concentrations  were  not 
reported  and  fertilization  was  not  assayed.  The  presence  of 
lipid  stores  attached  to  the  mitochondria  of  these  sperm  may 
enable  the  sperm  to  swim  for  prolonged  times  (Eckelbarger 
ct  nl..  19S9;  Young,  1994).  However,  the  role  of  lipid  stores 
in  swimming  has  been  questioned  (Eckelbarger.  1994). 

The  only  free-spawners  known  to  have  comparable  sperm 
longevity  at  low  concentration  (Fig.  3)  are  another  brooding 
uscidian.  Diplosonia  listerannin  (Bishop,  1998).  with  an 
estimated  sperm  half-life  of  8  h  at  H)1  sperm  ml  ',  and  a 
brooding  bryo/oan.  Cellaporclla  hyalina.  with  an  estimated 
sperm  half-life  of  I  h  at  Kl'-lO"  sperm  ml  '  (Manrfque/.  et 
ill..  2001).  This  pattern  suggests  that  sperm  longevity  may- 
be consistently  higher  in  egg-brooding  invertebrates  than  in 
egg-broadcasters.  However,  this  relationship  may  break 
down  when  more  taxa  are  studied.  Some  brooders  lack  any 
apparent  mechanism  to  efficiently  collect  dilute  sperm  from 


distant  males  via  a  filter-feeding  or  suspension-feeding 
mechanism  (e.g..  brooding  corals). 

Although  the  other  two  brooding  taxa  have  dilute  sperm 
longevities  greater  than  those  of  the  broadcasting  species, 
the  longevities  of  D.  Hsteraniim  and  C.  hyulinu  are  never- 
theless somewhat  lower  than  in  B.  schlosseri.  In  contrast  to 
these  two  species,  B.  schlosseri  lacks  the  ability  to  store 
sperm  (Stewart-Savage  et  ai,  2001 ).  D.  listeranuin  and  C. 
hyalina  can  both  store  sperm  for  several  months  (Bishop 
and  Ryland.  1991;  Bishop  and  Sommerfeldt.  1996)  and 
weeks  (Mann'quez,  1999),  respectively.  In  the  absence  of  a 
mechanism  to  store  sperm,  extended  sperm  longevity  in  B. 
schlosseri  may  represent  an  alternative  adaptation  to  further 
enhance  fertilization. 

The  high  longevity  of  sperm  in  active  filter-feeding  or 
suspension-feeding  brooders  raises  the  question  of  how  very 
dilute  sperm  can  remain  viable  for  such  an  extended  period 
of  time.  A  sperm's  life  span  is  based  on  its  consumption  of 
energy  reserves  (usually  phospholipids;  Harumi  ci  al.. 
I  WO),  which  is  a  function  of  the  amount  of  energy  con- 
sumed for  motility.  If  K.  schlosseri  sperm  are  taken  up 
passively  through  tiller-feeding  mechanisms,  sperm  may 
need  to  swim  only  short  distances  (i.e..  within  the  maternal 
/ooid)  to  reach  an  egg.  Consequently,  longevity  would  be 
prolonged  if  sperm  were  relatively  inactive  while  in  the 
water  column,  and  then  activated  within  the  maternal  zooid. 


SPERM  LONGEVITY  IN  A  BROODER 


149 


The  activation  of  dilute,  inactive  sperm  by  egg  exudates  has 
been  reported  in  some  broadcast-spawning  solitary  ascid- 
ians  (Miller,  1974;  Bolton  and  Havenhand,  1996;  Jantzen  et 
al.,  2001)  and  in  abalone  (Riffell  et  al.  2002).  Similarly, 
packets  of  bryozoan  sperm  alter  their  flagellar  waveforms 
when  released,  thus  probably  saving  energy  and  enhancing 
longevity,  but  increase  the  generation  of  waveforms  to  enter 
the  maternal  zooids  (Temkin  and  Bortolami,  2004).  R. 
schlosseri  sperm  might  also  conserve  energy  through  inter- 
mittent swimming  after  release,  as  suggested  for  another 
colonial  ascidian  (Bishop,  1998).  The  continued  presence  of 
sperm  in  our  top  sample  (Fig.  1  A)  after  many  hours  supports 
this  interpretation,  but  might  also  have  been  due  to  convec- 
tion currents  within  the  sperm-aging  containers.  We  have 
never  observed  much  activity  in  B.  schlosseri  sperm  ob- 
tained from  testes  macerates,  but  it  is  possible  that  sperm  are 
activated  prior  to  natural  release.  Mixing  had  no  effect  on 
longevity  (Table  1 ),  so  physical  disturbance  apparently  does 
not  activate  sperm. 

Temperature  effects 

This  study  suggests  that  temperature  has  a  small  but 
significant  influence  on  longevity.  The  estimated  half-life 
for  sperm  aged  at  15  °C  was  10  h  longer  than  for  those  kept 
at  22  °C.  B.  schlosseri  is  found  as  far  north  as  Newfound- 
land and  south  to  North  Carolina,  and  so  experiences  a  wide 
range  of  temperature  regimes  (Pollock,  1998).  Within  the 
Damariscotta  River  estuary,  water  temperatures  during 
spawning  season  can  be  as  high  as  22  °C  at  landward  sites 
and  as  low  as  13  °C  in  seaward  sites  (Yund  and  Stires, 
2002). 

Temperature  directly  controls  metabolic  activity  in  all 
cells,  which  influences  energy  consumption  and  survival 
(Hochachka  and  Somero,  1984).  Due  to  temperature  com- 
pensation, changes  in  sperm  viability  are  expected  to  be 
minimal  in  eurythermal  species  that  routinely  spawn  over  a 
wide  range  of  temperatures  (Andronikov,  1975;  Manriquez 
et  al,,  2001).  However,  actual  fertilization  levels  have  been 
shown  to  decrease  with  increased  temperature,  due  to  me- 
chanical damage  or  exhaustion  of  energy  reserves  (in  a 
temperate  sea  urchin;  Greenwood  and  Bennett,  1981).  But 
any  strictly  metabolic  approach  to  understanding  tempera- 
ture effects  on  sperm  may  be  overly  simplistic.  Recent  work 
on  other  small  organisms  has  indicated  that  temperature 
effects  may  overestimate  direct  metabolic  expenditures 
(Podolsky  and  Emlet,  1993;  Fuiman  and  Batty.  1997;  Hunt 
von  Herbing,  2002).  Water  viscosity  decreases  with  increas- 
ing temperature  (Dorsey,  1968;  Vogel,  1984;  Denny,  1993; 
Jumars  et  al.,  1993),  thus  altering  the  energetic  requirements 
of  swimming.  For  example,  Podolsky  and  Emlet  (1993) 
demonstrated  that  an  increase  in  temperature  from  12  °C  to 
22  °C  increased  swimming  speed  in  sand  dollar  larvae,  and 
that  about  40%  of  the  speed  increase  and  67%  of  the  Qw 


could  be  attributed  to  the  effect  of  reduced  viscosity.  This 
viscosity  effect  should  be  even  more  pronounced  in  smaller 
organisms  (like  sperm)  that  inhabit  lower  Reynolds  number 
environments  (Vogel,  1984).  and  most  evident  at  lower 
temperatures  where  changes  in  viscosity  are  most  pro- 
nounced (Jumars  et  al.,  1993).  However,  viscosity  effects 
will  only  be  relevant  during  times  when  sperm  are  actually 
swimming,  or  if  viscosity  stimulates  swimming  behavior. 

It  is  also  possible  that  temperature  did  not  have  a  direct 
effect  on  sperm  longevity  per  se,  but  rather  an  indirect  effect 
via  fertilization.  The  fertilization  assays  were  conducted  at 
the  same  temperatures  used  for  aging  the  sperm  suspen- 
sions. The  clearance  rates  of  some  filter-feeders  increase 
with  temperature  (Riisgard  and  Manriquez,  1997;  Lisbjerg 
and  Peterson,  2001;  Turker  et  al..  2003),  but  the  ramifica- 
tions for  sperm  capture  in  brooders  have  not  yet  been 
explored.  Consequently,  we  cannot  exclude  the  possibility 
that  temperature  affected  the  rate  at  which  sperm  were 
removed  from  the  suspensions,  as  well  as  the  viability  of 
sperm. 

Potential  evolutionary  implications 

Because  there  is  a  trade-off  between  sperm  velocity  and 
longevity,  it  has  been  suggested  that  fast  sperm  are  advan- 
tageous under  conditions  of  sperm  competition,  and  long- 
lived  sperm  are  advantageous  under  conditions  of  sperm 
limitation  (Levitan.  1993,  2000).  Although  B.  schlosseri 
possesses  extremely  long-lived  sperm,  this  species  does  not 
experience  sperm  limitation  in  nature  (fertilization  levels  in 
nature  are  generally  >85%;  Phillippi  et  al.,  2004),  and 
male-phase  colonies  in  experimental  populations  compete 
for  access  to  eggs  (Yund  and  McCartney,  1994:  Yund. 
1995.  1998).  Similarly,  other  brooding  free-spawners  with 
high  sperm  longevity  are  not  thought  to  be  sperm-limited, 
and  they  exhibit  reproductive  traits  (e.g.,  sperm  storage, 
female  choice)  that  are  typically  associated  with  sperm 
competition  (Bishop,  1996.  1998;  Bishop  et  al.,  2000;  Pem- 
berton  et  a!.,  2003a).  Hence  the  trade-off  between  velocity 
and  longevity  may  not  apply  to  brooders,  but  only  to  egg- 
broadcasting  free-spawners. 

Overall,  Botiyllits  schlosseri  appears  to  promote  fertili- 
zation through  the  longevity  of  water-born  sperm  and 
through  the  ability  to  concentrate  dilute  sperm  from  the 
water  column.  The  substantial  longevity  of  dilute  sperm 
reported  here  potentially  allows  viable  sperm  to  disperse  a 
great  distance  from  a  source  population.  In  the  field,  most 
eggs  are  fertilized  by  sperm  from  nearby  sources  (Grosberg. 
1987;  Yund.  1995,  1998),  but  eggs  in  isolated  colonies  can 
be  fertilized  from  distances  of  40  m  or  more  (Yund  and 
McCartney,  1994).  Given  the  often  high  density  of  B. 
schlosseri  colonies  in  nature  (>1000  colonies  m~2  at  some 
sites;  Grosberg.  1982)  and  the  fact  that  colonies  continu- 
ously dribble  sperm  over  a  period  of  4-5  days  (Stewart- 


150 


S.  L.  JOHNSON  AND  P.  O.  YUND 


Savage  and  Yund.  1997).  more  sperm  are  probably  released 
than  are  utilized  locally.  This  surplus  is  likely  to  be  advected 
away  by  currents  and  could  contribute  greatly  to  gene  flow 
between  populations  if  sperm  remain  viable  during  their 
journey.  Sperm  dispersal  could  be  of  particular  importance 
to  gene  flow  in  an  organism  like  B.  schlosseri  that  has  a  very 
short-lived  larval  stage  (Grosberg,  1987;  Yund.  1995). 

Acknowledgments 

A.  Phillippi,  K.  Murdock.  B.  Cole,  B.  Gensheimer.  and  J. 
Stewart-Savage  assisted  with  animal  culture.  W.  Hatleman 
provided  statistical  advice.  We  thank  A.  Phillippi,  J. 
Grabowski,  C.  Young,  and  an  anonymous  reviewer  for 
reading  and  suggesting  changes  that  improved  the  manu- 
script. Financial  support  was  provided  by  the  National  Sci- 
ence Foundation  (OCE-01- 17623)  and  the  Gulf  of  Maine 
Foundation.  This  is  contribution  number  393  from  the  Dar- 
ling Marine  Center. 

Literature  Cited 

Andronikov,  V.  B.  1975.  Heat  resistance  of  gametes  of  marine  inverte- 
brates in  relation  to  temperature  conditions  under  which  the  species 
exist.  Mar.  Biol.  30:  l-ll. 

Baker,  M.  C.,  and  P.  A.  Tyler.  2001.  Fertilisation  success  in  the 
commercial  gastropod  Haliotis  tubcrcnlata.  Mar.  Ecol.  Prog.  Ser.  211: 
205-213. 

Benzie,  J.,  and  P.  Dixon.  1994.  The  effects  of  sperm  concentration. 
sperm:egg  ratio,  and  gamete  age  on  fertilization  success  in  crown-of- 
thorns  starfish  (Acanthaster planci)  in  the  laboratory.  Biol.  Bull.  186: 
134-152. 

Bishop,  J.  D.  1).  1996.  Female  control  of  paternity  in  the  mteniallv 
fertilizing  compound  ascidian  Diplosoma  listeranum.  I.  Autoradio- 
graphic  investigation  of  sperm  movements  in  the  female  reproductive 
tract.  Proc.  R.  Sac.  Lond.  B  263:  369-376. 

Bishop,  J.  D.  D.  1998.  Fertilization  in  the  sea:  are  the  hazards  of 
broadcast  spawning  avoided  when  free-spawned  sperm  fertilize  re- 
tained eggs1'  Proc.  R.  Sue.  Lond.  B  265:  725-731. 

Bishop,  J.  I).  1).,  and  J.  S.  Kvland.  1991.  Storage  of  exogenous  sperm 
by  the  compound  ascidian  Diplosoma  listeranum.  Mar.  Biol.  108: 
111-118. 

Bishop,  J.  D.  I).,  and  A.  I).  Sonimerfeldt.  1996.  Autoradiographic 
investigation  of  uptake  and  storage  of  exogenous  sperm  by  the  ovary  of 
the  compound  ascidian  Diplosoma  listeranum.  Mar.  Biol.  125:  663- 
67(1. 

Bishop,  J.  D.  D.,  A.  J.  Pemberton,  and  L.  R.  Noble.  2000.  Sperm 
precedence  in  a  novel  context:  mating  in  a  sessile  marine  invertebrate 
with  dispersing  sperm.  Proc.  R.  Soc.  Lond.  B  267:  I  107-1  I  13. 

Bollon,  T.  F.,  and  J.  N.  Havenhand.  1996.  Chemical  mediation  ol 
sperm  activity  and  longevity  in  the  solitary  ascidians  dona  intesimalis 
and  AM  idiclla  aspcni,  Biol.  Bull.  190:  320-335. 

Chia,  F.-.S..  and  I..  R.  Bickell.  1983.  Hchinodermata.  F>p.  545-621)  in 
Kepio,lu,tive  Hiolo\t\  of  Invi  itchi, itc\.  K  G..  and  R  G.  Adiyodi.  eds 
John  Wiley.  New  York. 

Denny,  M.  W.  1988.     Hi,>loKy  ami  Mechanic',  of  ilic  Hmr-.Miv/x  /  m  i 
ronincnl.  Princelon  I'imcrsity  Press.  Princeton.  NJ. 

Denny.  M.  W.  1993.  ,\,,- ,,//,/  \\',ner.  Princeton  University  Press.  Prince- 
ton. NJ. 

Denny,  M.  \V.,  and  M.  F.  Sbibata.  1989.     Consequences  ol  surf'-sone 


turbulence  for  settlement  and  external  fertilization.  Am.  Nut.    134: 
859-889. 

Denny,  M.  W.,  E.  K.  Nelson,  and  K.  S.  Mead.  2002.  Re\  ised  estimates 
of  the  effects  of  turbulence  on  fertilization  in  the  purple  sea  urchin. 
Strongylocentrotus  purpuratus.  Biol.  Bull.  203:  275-277. 

Dorsey,  N.  E.  1968.  Properties  of  Ordinary  Water-Substance  in  All  Its 
Phases:  Water-Vapor.  Water,  ana1  All  the  Ices.  Hafner.  New  York. 

Eckelbarger.  K.  J.  1994.  Ultrastructural  features  of  gonads  and  gametes 
in  deep-sea  invertebrates.  Pp.  137-1 57  in  Reproduction.  Larcal  Biologv 
and  Recruitment  in  the  Deep-Sea  Benthos.  C.  M.  Young  and  K.  J. 
Eckelbarger.  eds.  Columbia  University  Press.  New  York. 

Eckelbarger,  K.  J.,  C.  M.  Young,  and  J.  L.  Cameron.  1989.  Modified 
sperm  ultrastructure  in  four  species  of  soft-bodied  echinoids  (Echino- 
dermata:  Echinothuriidae)  from  the  bathyal  zone  of  the  deep  sea.  Biol. 
Bull  177:  230-236. 

I  mm. in  L.  A.,  and  R.  S.  Batty.  1997.  What  a  drag  it  is  getting  cold: 
partitioning  the  physical  and  physiological  effects  of  temperature  on 
fish  swimming.  /  £.v/>.  Biol.  200:  1745-1755. 

Giese,  A.  C.,  and  H.  Kanatani.  1987.  Maturation  and  spawning.  Pp. 
251-329  in  Reproductive  Biology  of  Invertebrates.  Vol.  9.  A.  C.  Giese. 
J.  S.  Pearse.  and  V.  B.  Pearse.  eds.  Boxwood  Press.  Pacific  Grove,  CA. 

Greenwood,  P. ,(.,  and  T.  Bennett.  1981.  Some  effects  of  temperature- 
salinity  combinations  on  the  early  development  of  the  sea  urchin 
Paicchinus  aiigulostn,  (Leske).  Fertilization.  J.  E.xp.  Mar.  Biol.  Ecol. 
51:  119-131. 

Grosberg,  R.  K.  1982.  Ecological,  genetical.  and  developmental  factors 
regulating  life  history  variation  within  a  population  of  the  colonial 
ascidian  Botryllus  schlosseri  (Pallas)  Savigny.  Ph.D.  dissertation.  Yale 
University,  New  Haven,  CT. 

Grosberg,  R.  K.  1987.  Limited  dispersal  and  proximity-dependent  mat- 
ing success  in  the  colonial  ascidian  Botnllus  schlosseri.  Evolution  41: 
372-3X4. 

Grosberg,  R.  K.  1988.  Life-history  variation  within  a  population  of  the 
colonial  ascidian  Botryllus  schlosseri.  I.  The  genetic  and  environmental 
control  of  seasonal  variation.  Evolution  42:  900-920. 

Grosberg,  R.  K.  1991.  Sperm-mediated  gene  flow  and  the  genetic  struc- 
ture of  a  population  of  the  colonial  ascidian  Botryllus  schlosseri. 
Evolution  45:  130-142. 

1 1. ii  nun  T.,  R.  De  Santis.  M.  R.  Pinto,  and  N.  Suzuki.  1990.  Phos- 
pholipid  utilization  in  ascidian  Ciona  intcstinulis  spermatozoa  during 
swimming.  Comp.  Biochem.  Phv.siol.  96A:  263-265. 

Hochaohka.  P.  W.,  and  G.  N.  Somero.  1984.  Biochemical  Adaptation. 
Princeton  University  Press,  Princeton,  NJ. 

Hunt  von  Herbing.  I.  2002.  Effects  of  temperature  on  larval  fish  sw  im- 
ming  performance:  the  importance  of  physics  to  physiology.  J.  Fish. 
Biol.  61:  865-876. 

Jantzen.  T.  M.,  R.  de  Nys.  and  J.  N.  Havenhand.  2001.  Fertilization 
success  and  the  effects  of  sperm  chemoattractants  on  effective  egg  size 
in  marine  invertebrates.  Mar.  Biol.  138:  1153-1  161 

Jumars,  P.  A.,  J.  \V.  Deming,  P.  S.  Hill,  L.  Karp-Boss,  P.  L.  Yager,  and 
\V.  B.  Dade.  1993.  Physical  constraints  on  marine  osmotrophy  in  an 
optimal  foraging  context.  Mar.  Mierob.  Food  Webs  7:  121-159. 

I  i  MI. in.  D.  R.  1991.  Influence  of  body  si/e  and  population  density  on 
fertilization  success  and  reproductive  output  in  a  free-spawning  inver- 
tebrate. Biol.  Bull.  181:  261-268. 

Levitan,  I).  R.  1993.  The  importance  of  sperm  limitation  to  the  evolution 
of  egg  si/e  in  marine  invertebrates.  Am.  .'V«;.  141:  517-536. 

I.evitan,  I).  R.  1995.  The  ecolog\  of  fertilisation  in  free-spawning  in- 
vertebrates. Pp.  123-156  in  lieoloify  of  Marine  Invertebrate  Lan'ae,  L. 
McEdvvard.  ed.  CRC  Press.  Boca  Raton,  FL. 

I  cvitan.  1).  R.  1998.  Sperm  limitation,  gamete  competition,  and  sexual 
selection  in  external  lertih/ers.  Pp.  175-217  in  Sperm  Competition  and 
Sexual  Selection.  T.  R.  Birkhead  and  A.  P.  Moller.  eds.  Academic 
IV-ss.  San  Diego.  CA. 


SPERM   LONGEVITY   IN  A  BROODER 


151 


Levitan,  D.  R.  2000.  Sperm  velocity  and  longevity  trade  oft'  each  other 
and  influence  fertilization  in  the  sea  urchin  Lytci-li!nin  viiricgnlu.\. 
Pmc.  R.  Soc.  Lond.  B  267:  531-534. 

Levitan,  D.  R..  and  C.  Petersen.  1995.  Sperm  limitation  in  the  sea. 
Trends  Ecol.  fro/.  10:  22S-231. 

Levitan,  D.  R.,  M.  A.  Sewell,  and  F.-S.  Chia.  1991.  Kinetics  of  fertil- 
ization in  the  sea  urchin  Strongylocentrotus  franciscanus:  interaction  of 
gamete  dilution,  age.  and  contact  time.  Biol.  Bull  181:  371-378. 

Lisbjerg,  D..  and  J.  K.  Petersen.  2001.  Feeding  activity,  retention 
efficiency,  and  effects  of  temperature  and  particle  concentration  on 
clearance  rate  in  the  marine  bryozoan  Electro  crusiulcnta.  Mar.  Ecol. 
Prog.  Ser.  215:  133-141. 

Manriquez,  P.  H.  1999.  Mate  choice  and  reproductive  investment  in  the 
cheilostome  bryozoan  Celloporella  hvalina  (L.).  Ph.D.  thesis.  Univer- 
sity of  Wales,  Bangor,  UK. 

Manriquez,  P.  H.,  R.  N.  Hughes,  and  J.  D.  D.  Bishop.  2001.  Age- 
dependent  loss  of  fertility  in  water-borne  sperm  of  the  bryozoan  Celle- 
porella  hyalina.  Mar.  Ecol.  Prog.  Ser.  224:  87-92. 

Mead,  K.  S.,  and  M.  W.  Denny.  1995.  The  effects  of  hydrodynamic 
shear  stress  on  fertilization  and  early  development  of  the  purple  sea 
urchin  Strongylocentrotus purpuratus.  Biol.  Bull.  188:  46-56. 

Milkman.  R.  1967.  Genetic  and  developmental  studies  on  Botry/hts 
schlosseri.  Biol.  Bull.  132:  229-243. 

Miller,  R.  L.  1974.  Sperm  behavior  close  to  Hydractinia  and  dona  eggs. 
Am.  Zool.  14:  1250. 

Pemberton,  A.  J.,  L.  R.  Noble,  and  J.  D.  D.  Bishop.  2003a.  Frequency 
dependence  in  matings  with  water-borne  sperm.  J.  Exp.  Biol.  16: 
289-301. 

Pemberton,  A.  J.,  R.  N.  Hughes,  P.  H.  Manriquez,  and  J.  D.  Bishop. 
2003b.  Efficient  utilization  of  very  dilute  sperm:  sperm  competition 
may  be  more  likely  than  sperm  limitation  when  eggs  are  retained.  Proc. 
R.  Soc.  Lond.  B  270:  223-226. 

Pennington,  J.  T.  1985.  The  ecology  of  fertilization  of  echinoid  eggs: 
the  consequences  of  sperm  dilution,  adult  aggregation,  and  synchro- 
nous spawning.  Biol.  Bull.  169:  417-430. 

Phillippi,  A.,  E.  Hannan,  and  P.  O.  Yund.  2004.  Fertilization  in  an 
egg-brooding  colonial  ascidian  does  not  vary  with  population  density. 
Biol.  Bull.  206:  152-160. 

Podolsky,  R.  D.,  and  R.  B.  Emlet.  1993.  Separating  the  effects  of 
temperature  and  viscosity  on  swimming  and  water  movement  by  sand 
dollar  larvae  (Dendraster  excentricus).  J.  Exp.  Biol.  176:  207-221. 

Pollock,  L.  W.  1998.  A  Practical  Guide  to  the  Marine  Animals  of 
Northeastern  North  America.  Rutgers  University  Press,  New  Bruns- 
wick, NJ. 

Powell,  D.  K.,  P.  A.  Tyler,  and  L.  S.  Peck.  2001.  Effect  of  sperm 
concentration  and  sperm  ageing  on  fertilization  success  in  the  Antarctic 
soft-shelled  clam  Laternula  elliptica  and  the  Antarctic  limpet  Nacella 
concinna.  Mar.  Ecol.  Prog.  Ser.  215:  191-200. 


RiHVII,  J.  A..  P.  J.  Krug,  and  R.  K.  /inimer.  2002.  Fertilization  in  the 
sea:  the  chemical  identity  of  an  abalone  sperm  attractunt.  ./.  Exp.  Biol. 
205:  1439-1450. 

Riisgard,  H.  II..  and  P.  Manriquez.  1997.  Filter-feeding  in  fifteen 
marine  ectoprocts  (Bryozoa):  particle  capture  and  water  pumping.  Mar. 
Ecol.  Prog.  Ser.  154:  223-239. 

Stewart-Savage,  J.,  and  P.  ().  Yund.  1997.  Temporal  pattern  of  sperm 
release  from  the  colonial  ascidian.  Botryllus  schlosseri.  J.  Exp.  Biol. 
279:  620-625. 

Stewart-Savage,  J.,  A.  Phillippi,  and  P.  O.  Yund.  2001.  Delayed 
insemination  results  in  embryo  mortality  in  a  brooding  ascidian.  Biol. 
Bull.  201:  52-58. 

Temkin,  M.  H.,  and  S.  B.  Bortolami.  2004.  Waveform  dynamics  of 
spermatozeugmata  during  the  transfer  from  paternal  to  maternal  indi- 
viduals of  Membranipora  membranacea.  Biol.  Bull.  206:  35-45. 

Turker,  H.,  A.  G.  Eversole,  and  D.  E.  Brune.  2003.  Effect  of  temper- 
ature and  phytoplankton  concentration  on  Nile  tilapia  Oreochromis 
niloriciis  (L.)  filtration  rate.  Aquae.  Res.  34:  453-459. 

Van  Name,  W.  G.  1945.  The  North  and  South  American  ascidians.  Bull. 
Am.  Mus.  Nat.  Hist.  84:  1-476. 

Vogel,  H.,  G.  Czihak,  P.  Chang,  and  W.  Wolf.  1982.  Fertilization 
kinetics  of  sea  urchin  eggs.  Math.  Biosci.  58:  189-216. 

Vogel,  S.  1984.  Life  in  Moving  Fluids.  Princeton  University  Press, 
Princeton.  NJ. 

Williams,  M.  E.,  and  M.  G.  Bentley.  2002.  Fertilization  success  in 
marine  invertebrates:  the  influence  of  gamete  age.  Biol.  Bull.  202: 
34-42. 

Williams,  M.  E.,  M.  G.  Bentley,  and  J.  D.  Hardege.  1997.  Assessment 
of  field  fertilization  success  in  the  infaunal  polychaete  Arenico/a  ma- 
rina (L.).  Im-enebr.  Reprod.  Dev.  31:  189-197. 

Young,  C.  M.  1994.  The  biology  of  external  fertilization  in  deep-sea 
echinoderms.  Pp.  179-200  in  Reproduction.  Lan-al  Biology  and  Re- 
cruitment in  the  Deep-Sea  Benthos.  C.  M.  Young  and  K.  J.  Eckel- 
barger,  eds.  Columbia  University  Press,  New  York. 

Yund,  P.  O.  1995.  Gene  flow  via  the  dispersal  of  fertilizing  sperm  in  a 
colonial  ascidian  (Botryllus  schlosseri):  the  effect  of  male  density.  Mar. 
Biol.  122:  649-654. 

Yund,  P.  O.  1998.  The  effect  of  sperm  competition  on  male  gain  curves 
in  a  colonial  marine  invertebrate.  Ecology  79:  328-339. 

Yund,  P.  O.  2000.  How  severe  is  sperm  limitation  in  natural  populations 
of  marine  free-spawners?  Trends  Ecol.  fro/.  15:  10-13. 

Yund,  P.  O.,  and  M.  A.  McCartney.  1994.  Male  reproductive  success 
in  sessile  invertebrates:  competition  for  fertilizations.  Ecology  75: 
2151-2167. 

Yund,  P.  O.,  and  A.  Stires.  2002.  Spatial  variation  in  population  dy- 
namics in  a  colonial  ascidian  (Botryllus  schlosseri).  Mar.  Biol.  141: 
955-963. 


Reference:  Biol.  Bull.  206:  152-160.  (June  2004) 
©  2004  Marine  Biological  Laboratory 


Fertilization  in  an  Egg-Brooding  Colonial  Ascidian 
Does  Not  Vary  With  Population  Density 


AIMEE  PHILLIPPI1-*,  ELLEN  HAMANN",  AND  PHILIP  O.  YUND1  t 

1  School  of  Marine  Sciences,  Darling  Marine  Center,  University  of  Maine,  Walpole,  Maine  04573;  and 
2  Biologv  Department,  Augustana  College.  Sioux  Falls.  South  Dakota  57197 


Abstract.  The  possibility  that  free-spawning  marine  or- 
ganisms may  be  subject  to  fertilization  failure  at  low  pop- 
ulation density  (due  to  the  effects  of  sperm  dilution)  has 
sparked  much  interest,  but  these  effects  have  been  demon- 
strated only  in  a  few  species  that  broadcast  their  eggs.  Some 
egg-brooding  species  may  overcome  dilution  effects  by 
filtering  low  concentrations  of  sperm  from  seawater  and 
fertilizing  eggs  throughout  an  extended  period  of  time.  We 
examined  the  effects  of  population  density  and  size  on 
fertilization  in  Bolryllus  schlosseri,  a  hermaphroditic  colo- 
nial ascidian  that  free-spawns  sperm,  but  broods  eggs.  We 
experimentally  manipulated  the  size  and  density  of  mating 
groups  and  surveyed  fertilization  levels  in  natural  popula- 
tions that  varied  in  density.  Fertilization  was  not  affected  by 
variation  in  population  size  or  density  in  either  the  experi- 
mental or  natural  populations.  Near  the  end  of  the  repro- 
ductive season,  some  eggs  may  have  been  fertilized  too  late 
to  complete  development,  suggesting  a  temporal  form  of 
sperm  limitation  that  has  not  been  considered  in  other 
systems.  We  also  detected  greater  variability  in  fertilization 
levels  at  lower  population  density.  Nevertheless,  these  re- 
sults suggest  that  caution  must  be  used  in  extrapolating 
reported  density  effects  on  fertilization  to  all  taxa  of  free- 
spawners;  density  effects  may  be  reduced  in  brooders  that 
have  efficient  sperm  collection  mechanisms. 

Introduction 

Population  growth  is  often  limited  by  the  recruitment  of 
new  individuals.  Because  most  marine  organisms  produce 


Received  .1  December  200.1;  accepted  16  March  2004. 

*  To  whom  correspondence  should  he  addressed.  E-mail:  auneepfe" 
maine.edu 

t  Current  Address:  Marine  Science  Center,  University  of  New  England. 
Biddelord,  ME  04005, 


orders  of  magnitude  more  gametes  than  offspring  that  suc- 
cessfully recruit  (Morgan,  1995),  sources  of  reproductive 
loss  have  received  much  recent  attention.  Larval  mortality 
may  be  the  biggest  bottleneck  for  many  species  (Thorson. 
1950;  Strathmann,  1985;  Roughgarden  et  al,  1988).  How- 
ever, in  free-spawning  marine  taxa  (i.e.,  those  that  release 
sperm  into  the  surrounding  seawater).  fertilization  has  also 
attracted  attention  as  a  possible  stage  of  significant  repro- 
ductive loss  (Pennington,  1985;  Oliver  and  Babcock,  1992; 
Sewell.  1994;  Levitan  and  Petersen.  1995;  Lasker  et  al., 
1996;  Coma  and  Lasker,  1997a). 

Fertilization  will  not  be  successful  if  the  distance  between 
spawning  individuals  is  too  great.  Experimental  studies 
have  documented  decreasing  fertilization  with  distance 
from  a  sperm  source  in  diverse  taxa  of  marine  free-spawners 
(Pennington.  1985;  Yund.  1990,  1995;  Levitan.  1991:  Levi- 
tan etui..  1991.  1 992 ;  Brazeau  and  Lasker,  1992;  Oliver  and 
Babcock.  1992:  Babcock  et  al..  1994;  Benzie  and  Dixon. 
1994;  Benzie  et  al..  1994;  Yund  and  McCartney.  1994: 
Levitan  and  Young,  1995:  Lasker  et  al.,  1996;  Coma  and 
Lasker.  1997a.  b;  Meidel  and  Yund.  2001;  Metaxas  et  al.. 
2002).  As  a  logical  consequence  of  these  distance  effects. 
reproduction  in  low-density  populations  may  be  limited  by 
fertilization  when  individuals  are  separated  by  distances 
greater  than  the  dispersal  distance  of  fertilizing  sperm.  Fer- 
tilization failure  at  low  population  density  (a  form  of  neg- 
ative density-dependent  population  dynamics  known  as  an 
Allee  effect;  Levitan  et  al..  1992)  has  been  investigated  in 
commercially  harvested  species  and  considered  in  the  de- 
velopment of  management  programs  (Jamieson.  1993; 
Quinn<7<//..  1993;  Myers  et  al.,  1995;  Ptister  and  Bradbury. 
1996:  Liermann  and  Hilborn.  1997:  Levitan  and  Sewell. 
1998;  Shelton  and  Healey.  1999;  Frank  and  Brickman, 
2000).  Models,  coupled  with  laboratory  experiments  on  the 
effects  of  variation  in  sperm  concentration  on  fertilization. 


152 


FERTILIZATION  *  F( DENSITY) 


153 


have  predicted  declining  fertilization  levels  with  decreasing 
population  size  or  density  for  free-spawners  that  broadcast 
their  eggs  (Levitan,  1991;  Levitan  and  Young.  1995; 
Claereboudt,  1999;  Metaxas  el  ai,  2002).  Field  experiments 
with  three  egg-broadcasting  species  of  sea  urchins  have 
supported  the  predicted  trend  (Levitan,  1991 ;  Levitan  et  ai. 
1992;  Wahle  and  Peckham,  1999).  Density  has  also  been 
predicted  to  have  a  greater  effect  on  fertilization  when 
populations  are  small  (Levitan  and  Young,  1995).  suggest- 
ing the  need  to  simultaneously  evaluate  the  effects  of  pop- 
ulation size  and  density  (Levitan  et  ai,  1992). 

To  date,  research  on  how  the  density  and  size  of  a 
population  affects  fertilization  has  focused  on  organisms 
that  broadcast  eggs,  but  variation  in  density  may  have  very 
different  consequences  for  free-spawners  that  fertilize  eggs 
internally  (brooders).  In  external  fertilizers,  both  gametes 
are  subject  to  dilution;  in  brooders,  only  sperm  are  diluted. 
If  brooders  are  able  to  capture  or  concentrate  dilute  sperm, 
fertilization  levels  may  be  high  even  when  individuals  are 
far  apart  and  few  in  number  (Yund.  2000). 

We  examined  the  effects  of  population  density  on  fertil- 
ization in  Botryllus  schlosseri  (Pallas.  1766),  a  sessile,  her- 
maphroditic, free-spawning  colonial  ascidian  with  internal 
fertilization.  Sperm  limitation  has  been  demonstrated  under 
experimental  conditions  in  the  field  (Yund  and  McCartney, 
1994;  Yund,  1995),  and  populations  are  characterized  by 
substantial  spatial  and  temporal  variation  in  population  den- 
sity (Yund  and  Stires,  2002).  However,  fertilization  levels  in 
natural  spawns  have  not  previously  been  reported,  nor  have 
density  effects  on  fertilization  been  rigorously  evaluated. 
Past  manipulations  (designed  to  test  for  sperm  competition) 
have  manipulated  male  density  but  not  total  population 
density  (Yund  and  McCartney,  1994;  Yund,  1995.  1998). 
We  conducted  a  mix  of  manipulative  field  experiments  and 
surveys  of  spawning  in  natural  populations  in  the  Damar- 
iscotta  River  estuary  (Maine)  during  the  summers  of  1999 
and  2000.  Population  size  and  density  were  manipulated  in 
experimental  populations  to  independently  test  the  effects  of 
these  two  factors.  Density  effects  were  also  assessed  in 
natural  spawns  by  deploying  laboratory-cultured  colonies  in 
populations  that  varied  in  density  in  space  and  time. 

Materials  and  Methods 

Study  organism  and  culture 

Botiyllits  schlosseri  is  a  colonial  ascidian  with  a  sexual 
cycle  coupled  to  an  asexual  zooid  replacement  cycle,  which 
is  synchronous  throughout  the  colony.  Asexually  produced 
buds  form  and  develop  along  the  sides  of  the  functioning 
generation  of  zooids  that  are  brooding  embryos  and  releas- 
ing sperm.  Concurrent  with  or  shortly  after  the  release  of 
fully  developed  embryos  as  larvae,  the  old  generation  of 
zooids  is  resorbed  and  the  new  zooids  (formerly  buds)  start 
to  feed  and  begin  the  next  cycle  (Milkman,  1967).  Eggs  are 


viable  to  be  fertilized  as  soon  as  the  siphons  of  the  new 
zooids  open,  but  it  fertilized  more  than  24  h  after  siphon 
opening,  they  are  unlikely  to  complete  development  before 
the  end  of  the  asexual  cycle  (Stewart-Savage  et  nl.,  2001a). 
Sperm  release  occurs  over  a  period  of  several  days,  and  does 
not  peak  until  a  few  days  after  siphon  opening  (Stewart- 
Savage  and  Yund.  1997).  The  duration  of  the  sexual-asexual 
cycle  is  temperature  dependent  (Grosberg.  1982).  Colonies 
are  not  able  to  aggregate,  spawn  synchronously  (Stewart- 
Savage  and  Yund.  1997),  self-fertilize  (Stewart-Savage  et 
ai,  200 la),  or  store  sperm  (Stewart-Savage  et  ai,  200 la). 
Although  eggs  are  generally  fertilized  by  neighbors  when 
other  colonies  are  nearby  (Yund  and  McCartney,  1994; 
Yund  1995),  spatially  isolated  colonies  can  be  fertilized  by 
sperm  from  more  than  40  m  away  (Yund,  1998). 

Colonies  of  B.  schlosseri  on  rocks  and  shells  were  col- 
lected from  the  Damariscotta  River  estuary,  Maine,  by 
divers  and  transported  to  the  laboratory.  Fragments  of  each 
colony  were  explanted  onto  microscope  slides  and  main- 
tained in  a  flowing  seawater  system  at  the  University  of 
Maine's  Darling  Marine  Center  (Walpole,  Maine).  Animals 
cultured  on  glass  can  be  examined  under  a  microscope  to 
assess  egg  production  and  stage  in  the  reproductive  cycle. 
Colonies  for  the  manipulative  experiment  and  the  field 
survey  were  selected  on  the  basis  of  sexual  stage.  Male- 
phase  colonies  (those  releasing  sperm)  were  deployed  at 
about  stage  three  (by  the  criteria  of  Milkman.  1967).  Fe- 
male-phase colonies  (those  with  eggs  ready  to  be  fertilized) 
were  deployed  at  late  stage  four  or  early  stage  five  (Milk- 
man, 1967).  just  prior  to  takeover  by  the  new  asexual 
generation  of  zooids.  Females  were  recovered  between 
stages  3  and  4  in  the  subsequent  cycle  (total  cycle  duration 
ranged  from  7-10  days),  prior  to  the  release  of  brooded 
larvae.  All  embryos  were  then  surgically  removed  from  the 
zooids  for  enumeration.  The  percent  of  eggs  fertilized  was 
calculated  as  the  number  of  larvae  brooded  upon  return 
from  the  field  divided  by  the  number  of  eggs  brooded  prior 
to  deployment,  multiplied  by  100.  Data  from  colonies  that 
were  unhealthy,  damaged,  or  dead  upon  return  from  the 
field  were  excluded. 

Population  size  and  density  manipulation 

We  examined  the  potentially  independent  effects  of  pop- 
ulation size  and  density  on  fertilization  during  the  summer 
of  2000  by  manipulating  population  size  and  colony  spacing 
in  experimental  populations.  Our  experimental  design  em- 
ployed four  combinations  of  two  population  size  treatments 
(4  and  16  colonies:  Fig.  1)  and  two  density  treatments 
(equivalent  to  13  and  157  colonies  per  square  meter,  calcu- 
lated on  the  basis  of  the  separation  distances  between  the 
centers  of  the  colonies).  Population  sizes  in  this  experiment 
were  smaller  than  many  natural  populations,  but  compara- 
ble to  colony  numbers  on  isolated  pieces  of  hard  substratum. 


154 


A.   PHILLIPPI  ET  AL. 


A.  Large  size,  High  density 


B.  Large  size,  Low  density 


9cf9cf 


?cf?cf 
cf?cf? 


$ 

cf 

?          cf 

cf 

! 

cf         ? 

9 

cf 

?           cf 

cf 

i 

cf         $ 

C.  Small  size,  High  density 


D    Small  size,  Low  density 


?cf 


?          cf 
cf         ? 


Figure  I.  Design  of  mating  arrays  used  in  the  four  experimental 
treatments  to  assess  the  effects  of  population  size  and  density  on  fertiliza- 
tion levels  of  Boti-\llu.\  xchlosseri.  Symbols  indicate  the  functional  gender 
of  a  colony  during  an  experiment;  all  colonies  are  actually  hermaphrodites. 
Colony  positions  in  the  two  high-density  arrays  are  not  quite  to  scale 
(colonies  were  closer  together  than  the  size  of  the  symbols  permits;  5  cm 
apart  on  center).  Populations  consisted  of  either  4  or  16  colonies,  while 
density  corresponded  to  1.1  rv  157  colonies  m  2. 


Density  treatments  spanned  most  of  the  reported  range  for 
natural  variation  in  this  estuary  (about  5  to  170  colonies  per 
square  meter:  Yund  and  Stires.  2002),  though  for  logistical 
reasons  we  were  unable  to  explore  the  very  lowest  densities 
observed  in  nature.  Experimental  populations  were  assem- 
bled by  mounting  laboratory-cultured  colonies  growing  on 
2.5  X  7.6  cm  glass  microscope  slides  on  1 .21-m  2  sheets  of 
0.6-cm-thick  marine  plywood  that  were  in  turn  mounted  on 
top  of  flat  concrete  patio  blocks  weighing  40  kg.  Colonies 
were  arranged  so  that  male  and  female  phases  alternated  as 
nearest  neighbors  (Fig.  1).  Female  colonies  brooded  an 
average  of  59  eggs  (±2.5  SE). 

Assembled  arrays  were  deployed  in  a  4-m-deep  (at  mean 
low  water)  channel  in  the  Damariscotta  River  between  an 
island  (Carlisle  Island)  and  the  mainland.  The  substratum  in 
this  channel  is  soft  sediment,  so  B.  schlosseri  does  not  occur 
naturally.  Past  experiments  in  this  location  have  indicated 
only  minor  contamination  from  natural  sperm  as  long  as 
local  experimental  males  are  present  (Yund.  I99X).  Currents 
are  dominated  by  tidal  exchange,  are  largely  bidirectional, 
and  are  non-zero  95'/;  of  the  time  (Yund  and  McCartney, 
1994).  The  arrays  were  lowered  from  the  surface  by  means 
ol  lines,  so  i  he  orientation  of  the  colonies  with  respect  to 


tidal  currents  was  not  known.  Each  array  was  separated 
from  its  nearest  neighbor  by  at  least  30  m. 

Four  replicate  trials  were  conducted  of  all  four  treatment 
combinations,  with  one  replicate  of  each  treatment  per- 
formed simultaneously.  Because  each  16-colony  (large  pop- 
ulation) array  potentially  yielded  fertilization  levels  for  four 
times  as  many  females  as  the  4-colony  (small  population) 
arrays  (8  vs.  2  females  per  trial),  we  conducted  two  extra 
trials  of  the  small  population  size  treatments  to  produce 
more  equitable  replication  across  treatments.  Owing  to  the 
loss  of  data  on  some  females  that  did  not  survive  through 
their  deployment,  we  obtained  an  average  of  5.5  fertilization 
values  per  replicate  trial  for  the  large  population  size  treat- 
ments, and  1 .7  for  the  small  population  size  treatments.  The 
percent  of  eggs  fertilized  was  arcsin-transformed  to  meet 
ANOVA  assumptions,  and  then  this  dependent  variable  was 
analyzed  by  an  ANOVA  package  that  accommodates  an 
unbalanced  design  (Statistica  '99,  Statsoft,  Inc.)  with  pop- 
ulation size,  population  density,  and  trial  as  the  three  main 
effects.  The  data  were  initially  analyzed  with  interaction 
effects  included  in  the  model.  No  interactions  between  any 
of  the  main  effects  were  significant,  so  the  analysis  was 
repeated  excluding  interaction  effects  to  maximize  power 
for  the  main  effects.  We  also  performed  a  power  analysis  to 
assess  our  ability  to  detect  differences  among  treatments. 

Natural  spawning  populations 

To  assess  fertilization  levels  in  natural  spawns,  we  de- 
ployed laboratory-cultured  female-phase  colonies  in  two 
field  populations  in  the  Damariscotta  River  during  the  sum- 
mer of  1999.  The  two  populations  were  located  adjacent  to 
the  shores  of  small  islands  in  the  river.  The  seaward  site  was 
located  at  Carlisle  Island  (hereafter  CI),  while  the  landward 
site  (DM)  was  at  Glidden  Ledge  (see  Yund  and  Stires,  2002. 
for  a  map  and  additional  site  information).  The  DM  site 
experiences  warmer  temperatures  during  the  summer, 
\\hich  decreases  the  duration  of  each  reproductive  cycle 
(Yund  and  Stires.  2002).  Egg  production  is  much  higher  at 
DM,  apparently  because  of  greater  food  availability  (Stew- 
art-Savage et  til..  200 1 b).  Both  sites  exhibit  seasonal  vari- 
ation in  population  density,  with  peak  densities  occurring  in 
August,  but  peak  density  is  typically  about  seven  times 
greater  at  DM  than  at  CI  (Yund  and  Stires.  2002). 

To  assess  fertilization  levels  in  the  tield,  female-phase 
colonies  growing  on  2.5  X  7.6  cm  microscope  slides  were 
placed  individually  in  open-sided  plastic  slide  boxes  that 
were  attached  to  a  cinderbloek-weighted  rope  supported  by 
a  surface  buoy.  Colonies  were  oriented  upside  down  to 
reduce  the  effects  of  sedimentation,  and  were  located  ap- 
proximately 0.5  in  above  the  substratum.  Three  to  eight 
(mean  =  5.5  ±  0.3  SE)  colonies  were  deployed  at  each  site 
approximately  weekly  from  early  June  to  mid-August,  and 
at  site  CI  through  the  end  of  September.  Colonies  were 


FERTILIZATION   *   F(DENSITY) 


155 


positioned  along  a  transect  oriented  parallel  to  the  shore. 
and  spaced  about  7  m  from  their  nearest  neighbor. 

Egg  counts  prior  to  deployment  averaged  105  per  colony 
(±  12  SE).  All  colonies  remained  in  the  Held  through  the 
beginning  of  the  next  asexual  generation  (hereafter  termed 
takeover)  and  the  full  period  of  egg  viability,  so  that  eggs 
were  fertilized  by  naturally  available  sperm.  Fertilization 
levels  were  determined  as  described  above.  Throughout 
most  of  the  season,  all  embryos  within  a  colony  were  at  the 
same  developmental  stage.  The  presence  of  a  mixture  of 
developmental  stages  indicated  that  embryos  lagging  in 
development  were  fertilized  later  than  the  others  (Meidel 
and  Yund,  2001).  Typically,  all  embryos  surgically  re- 
moved from  a  colony  were  at  about  stage  four,  and  pos- 
sessed a  tail  that  wrapped  completely  around  the  embryo 
(Milkman,  1967).  Embryos  at  a  tail-bud  stage  or  earlier  (by 
the  criteria  of  Milkman,  1967)  were  at  least  24  h  behind  in 
development  and  therefore  were  reported  as  unlikely  to 
complete  development  (Stewart-Savage  et  at.  200 la). 

Throughout  the  reproductive  season,  we  surveyed  the 
density  of  B.  schlosseri  colonies  at  both  sites  monthly. 
Density  surveys,  made  with  the  aid  of  scuba,  involved 
counting  all  of  the  colonies  present  in  eight  randomly  de- 
ployed 0,64-m  2  quadrats.  We  did  not  measure  the  size 
distribution,  reproductive  status,  or  reproductive  output  of 
the  colonies  because  past  work  (Stewart-Savage  et  u/., 
200  Ib;  Yund  and  Stires,  2002)  permits  reasonable  inference 
about  variation  in  these  variables  between  sites.  A  subset  of 
the  field  fertilization  data  was  used  to  assess  the  possible 
relationship  with  population  density.  Fertilization  values 
obtained  during  three  week-long  intervals  (including  the 
weeks  immediately  before,  during,  and  after  the  week  of  a 
population  survey)  were  paired  with  the  associated  popula- 
tion density  survey  for  analysis.  Fertilization  values  ob- 
tained outside  of  these  intervals  could  not  be  reliably  asso- 
ciated with  a  density  and  so  were  excluded  from  this  portion 
of  the  analysis.  The  possible  relationship  between  fertiliza- 
tion and  population  density  was  assessed  by  regression.  We 
also  calculated  the  variance  in  fertilization  at  each  density 
and  used  a  variety  of  nonlinear  regressions  to  explore  pos- 
sible relationships  between  variance  in  fertilization  and  pop- 
ulation density. 

Results 

Population  si:.c  mul  ile»sit\  manipulation 

Fertilization  levels  were  consistently  high  (>80%)  in  all 
four  combinations  of  population  size  and  density  treatments 
(Fig.  2).  The  effect  of  trial  was  significant,  but  neither 
population  size  nor  density  affected  fertilization  levels  in 
experimental  populations  (Table  1 ).  Results  from  the  power 
analysis  indicated  that  replication  was  sufficient  to  detect 
differences  between  treatments  as  small  as  7.5%  for  density 
effects  and  8.7%  for  population  size  effects  at  a  =  0.05. 


Large  Population  Size    Small  Population  Size 

Figure  2.  Mean  field  fertilization  levels  of  Botryllits  schlosseri  colo- 
nies in  the  four  population  si/e  and  density  treatments.  Error  bars  represent 
one  standard  error. 


Natural  spawning  populations 

As  reported  for  1996  and  1997  (Yund  and  Stires.  2002), 
population  density  increased  at  the  landward  site  (DM) 
throughout  the  summer  and  declined  after  September  (Fig. 
3).  However,  peak  density  at  DM  was  substantially  lower 
than  recorded  in  both  earlier  years  (65  vs.  ~  170  colonies 
m"2;  Yund  and  Stires,  2002).  Nevertheless,  peak  density 
was  more  than  an  order  of  magnitude  higher  than  density 
early  in  the  season.  Densities  at  the  seaward  site  (CI)  were 
generally  lower  than  at  DM  and  exhibited  less  variation 
during  the  season  (Fig.  3). 

Mean  fertilization  levels  at  both  sites  were  greater  than 
70%  throughout  the  season,  with  only  two  exceptions  (Fig. 
3).  The  mean  fertilization  at  DM  in  week  24  was  slightly 
lower  owing  to  the  almost  complete  fertilization  failure  of 
one  female  colony  (note  the  very  high  variance  for  this 
mean  in  Fig.  3).  Towards  the  very  end  of  the  reproductive 
season  the  seaward  site  showed  a  slight  trend  toward  de- 
clining fertilization  (90%  to  66%  in  weeks  37  to  40;  Fig.  3). 

Beginning  at  week  38,  embryos  removed  from  colonies 
that  had  been  deployed  at  site  Cl  varied  greatly  in  develop- 
mental staging  (in  contrast  to  all  earlier  weeks  when  the 
embryos  within  a  colony  were  all  at  the  same  developmental 
stage).  Embryos  at  earlier  developmental  stages  would  have 
had  insufficient  time  to  complete  development  before  the 
colony  began  a  new  asexual  generation  and  the  old  zooids 
were  resorbed  (Stewart-Savage  et  <//.,  200 1  a).  By  week  40, 
although  66%  of  eggs  were  fertilized,  we  estimate  that  only 
39%  of  eggs  would  have  resulted  in  fully  developed  larvae 
(Fig.  3). 

There  was  no  relationship  between  fertilization  level  and 
natural  population  density  (Fig.  4A);  the  regression  of  per- 
cent of  eggs  fertilized  on  the  log  of  density  was  not  signif- 


156 


A.  PHILLIPPI  ET  AL. 


Table  1 

Analysis  of  variance  results  for  effects  of  population  size  and  density  on 
fertilization  in  the  manipulative  experiment 


Effect 

df 

MS 

SS 

F-ratio 

P 

Size 

1 

2.699 

2.699 

0.031 

0.862 

Density 

1 

63.378 

63.378 

0.718 

0.401 

Trial 

5 

229.251 

1146.254 

2.596 

0.035 

Error 

55 

88.300 

4856.505 

icant  (P  =  0.250,  r  =  0.016).  The  power  analysis  indicated 
that  a  slope  estimate  of  double  the  value  obtained  would 
have  been  necessary  for  significance  at  a  =  0.05.  In  contrast 
to  the  absence  of  a  pattern  in  overall  fertilization  level,  a 
nonlinear  (exponentially  declining)  relationship  did  exist 
between  the  variance  in  fertilization  and  colony  density 
(r  =  0.71 15.  0.010  <P  <  0.025;  Fig.  4B). 

Discussion 

Effects  of  population  size  and  density  on  fertilization 

Population  density  did  not  significantly  affect  fertilization 
in  either  experimental  or  natural  populations  of  Botryllus 
schlosseri  (Figs.  2.  3,  4;  Table  1),  although  density  varied 
across  more  than  an  order  of  magnitude  and  spanned  most 
of  the  range  relevant  to  local  populations  (Yund  and  Stires, 
2002).  Mean  fertilization  levels  were  generally  very  high 
(Figs.  2,  3).  In  the  experimental  manipulation,  population 
size  also  had  no  effect  on  fertilization  (Fig.  2:  Table  1 ).  This 
result  contrasts  with  previous  work  on  a  species  that  broad- 
casts its  eggs  (the  red  sea  urchin  Strongylocentrotus  fran- 
ciscanus),  in  which  population  size  was  found  to  have  an 
interactive  effect  (with  density)  on  fertilization  levels  (Levi- 
tan  et  til.,  1992). 


24         26         26         30         32         34         36         38         40         4 


Week 

Figure  3.  Percent  of  eggs  fertili/ed  (circles I.  embryos  completing 
development  (squares),  and  population  density  estimates  (bars)  for  two 
natural  populations  ot  H<iir\llu\  \.7i/ov«'n.  Open  bars  and  circles  represent 
population  DM;  solid  bars,  circles,  and  squares  represent  population  Cl. 
Error  bars  represent  one  standard  error. 


I     80 

OJ 

N 

1      60  • 


§      40 


20 


1000 


c 
o 

S   800 

•E 

OJ 

!i   600  \ 

0) 

o 

Q.    400  - 

c 

8 


20°  1 


CD 


B 


0.0  05  10  15 

Log  [Colonies  m'2] 


2.0 


Figure  4.  (A)  Effect  of  colony  density  of  natural  populations  on 
overall  fertilization  levels  of  Botryllus  schlosseri.  The  plotted  linear  re- 
gression line  is  not  significant.  (B)  Effect  of  colony  density  on  variance  in 
fertilization.  The  plotted  exponential  regression  is  significant  at  P  <  0.01. 


While  overall  fertilization  levels  did  not  change  signifi- 
cantly with  population  density  (Fig.  4A).  the  variance  in 
fertilization  in  natural  populations  did  increase  at  lower 
density  (Fig.  4B).  indicating  that  reduced  population  density 
may  result  in  greater  variation  in  fertilization  among  differ- 
ent individuals.  The  very  high  variance  in  fertilization  at  the 
lowest  population  density  was  heavily  influenced  by  a  sin- 
gle colony  that  exhibited  exceptionally  low  fertilization 
(8.8%).  However,  such  individual  effects  may  be  relevant  to 
natural  populations  and  should  not  be  dismissed  as  outliers. 

Because  B.  schlosseri  is  a  colonial  species,  population 
density  alone  is  an  imperfect  predictor  of  population-wide 
reproductive  output.  Juvenile  colonies  delay  sexual  repro- 
duction until  they  achieve  a  minimum  size  (Boyd  et  ai, 
1986;  Chadwick-Furman  and  Weissman,  1995).  Reproduc- 
tive output  in  sexually  mature  colonies  is  highly  variable 
and  subject  to  both  genetic  (Grosberg,  1988;  Yund  et  al., 
1997)  and  environmental  (Newlon  et  til..  2003)  influences. 
Nevertheless,  temporal  variation  in  density  is  a  reasonable 
first  approximation  of  average  gamete  production  at  the 


FERTILIZATION   *   F(DENSITY) 


157 


population  level,  because  it  indicates  times  of  population 
growth  and  contraction.  Unlike  many  other  colonial  inver- 
tebrates, B.  schlosseri  rarely  exhibits  fragmentation  (Gros- 
berg,  1982).  Consequently,  recruitment  of  sexually  pro- 
duced larvae  is  essential  for  population  growth  (Yund  and 
Stires,  2002). 

In  surveys,  sperm  appeared  to  become  somewhat  more 
limiting  at  the  very  end  of  the  sample  period.  At  that  time, 
the  annual  reproductive  season  was  ending  and  populations 
were  shrinking  (Fig.  3;  Yund  and  Stires,  2002),  so  any 
marginal  fertilization  effect  is  best  viewed  as  a  minor  com- 
ponent of  a  larger  trend  in  population  dynamics.  Overall 
fertilization  values  exhibited  only  a  slight  downward  trend, 
but  the  timing  of  fertilization  varied  more  substantially  (Fig. 
3).  The  presence  of  embryos  at  various  developmental 
stages  indicated  that  fertilization  within  each  brood  oc- 
curred over  a  wider  time  span  than  during  the  rest  of  the 
reproductive  season.  Embryos  at  an  earlier  developmental 
stage  at  the  conclusion  of  our  sample  intervals  would  prob- 
ably not  have  had  sufficient  time  to  complete  development 
before  the  adult  zooids  were  resorbed  and  the  next  asexual 
generation  began  (Stewart-Savage  et  til.,  200 la).  Therefore, 
delayed  fertilizations  are  unlikely  to  have  produced  viable 
progeny,  and  so  may  represent  a  form  of  temporal  sperm 
limitation.  Sperm  availability  may  have  been  reduced  at  this 
time  of  year  from  decreases  in  both  population  density  and 
energy  allocated  to  sperm  production  (Stewart-Savage  et 
dl.,  2001  a).  A  crash  in  the  local  phytoplankton  population 
each  autumn  (Incze  et  ai,  1980)  is  consistently  associated 
with  smaller  testes  and  lower  egg  production  in  B.  schlos- 
seri  (unpubl.  data). 

Comparison  with  results  from  other  ta\a 

The  effects  of  population  size  and  density  on  fertilization 
have  been  investigated  in  other  free-spawning  marine  in- 
vertebrates. Field  experiments  with  three  species  of  sea 
urchins  used  eggs  retained  in  Nitex  mesh  bags  and  either 
induced  males  to  spawn  or  used  sperm-filled  syringes  to 
simulate  males.  Increasing  the  number  or  density  of  spawn- 
ing individuals  increased  fertilization  in  all  three  species 
(Levitan,  1991;  Levitan  et  ai.  1992:  Wahle  and  Peckham, 
1999).  Ultimately,  the  differing  consequences  of  population 
size  and  density  for  fertilization  in  sea  urchins  and  ascidians 
can  probably  be  explained  by  the  different  spawning  strat- 
egies of  these  taxa.  Sea  urchins  broadcast  both  sperm  and 
eggs,  so  rapid  gamete  dilution  may  have  a  greater  impact  on 
sperm-egg  encounters  than  in  brooders,  where  egg  retention 
prevents  the  dilution  of  female  gametes.  However,  all  three 
of  the  sea  urchin  studies  cited  above  manipulated  gametes 
so  that  eggs  were  held  at  fixed  concentrations  in  sperm- 
permeable  containers.  Consequently,  though  egg  dilution 
may  be  important  in  natural  spawns,  it  played  no  role  in  the 
experimental  results  reported  in  these  papers.  Hence  the 


proximate  explanation  for  the  difference  between  our  results 
and  those  of  the  sea  urchin  studies  must  involve  a  process 
other  than  egg  dilution. 

As  part  of  a  reproductive  strategy  that  involves  retaining 
eggs  internally,  brooders  usually  possess  some  mechanism 
for  capturing  sperm.  The  method  by  which  sperm  enter  a 
female-phase  B.  schlosseri  colony  is  not  known,  but  all 
indications  are  that  this  organism  is  exceedingly  efficient  at 
acquiring  dilute,  long-lived  sperm  from  the  water  (Johnson 
and  Yund,  2004).  Additionally,  fertilization  in  B.  schlosseri 
is  a  time-integrated  process  with  eggs  viable  to  be  fertilized 
for  24  h  (Stewart-Savage  et  ai,  2001a).  Consequently,  it 
seems  probable  that  sperm  are  filtered  out  of  the  water  as  a 
by-product  of  feeding  activity,  which  is  likely  to  involve  the 
processing  of  a  relatively  large  volume  of  water.  If  so, 
sperm  would  in  effect  be  concentrated,  limiting  the  impact 
of  sperm  dilution.  Thus  increased  efficiency  of  sperm  col- 
lection coupled  with  time-integrated  fertilization,  rather 
than  reduced  egg  dilution,  may  explain  the  absence  of 
density  effects  on  fertilization  in  B.  schlosseri. 

Density  effects  on  fertilization  have  also  been  explored  in 
the  internally  fertilizing  Queen  conch,  Strombus  gigas, 
which  does  not  free-spawn,  but  instead  transfers  sperm  by 
copulation.  At  very  low  adult  densities  (<100/ha  or  <0.01/ 
m2),  reproductive  success  was  found  to  be  density  depen- 
dent in  S.  gigas  (Stoner  and  Ray-Culp,  2000).  However, 
above  a  critical  density,  evidence  for  Alice  effects  in  S. 
gigas  dissipated  as  the  frequency  of  observed  reproductive 
behavior  plateaued.  By  analogy,  sperm  limitation  is  to  be 
expected  in  B.  schlosseri  at  some  very  low  population 
density.  However,  that  density  condition  does  not  appear  to 
occur  in  the  Damariscotta  River  estuary. 

Although  previous  studies  of  fertilization  in  egg-brooding 
free-spawners  have  not  directly  addressed  the  effects  of 
population  density,  a  comparison  of  reported  efficiencies  of 
sperm  capture  is  nonetheless  illuminating.  Both  the  colonial 
ascidian  Diplosoma  listerianum  and  the  bryozoan  Celle- 
porella  hyalina  achieve  maximum  fertilization  at  sperm 
concentrations  on  the  order  of  102  ml"1,  in  contrast  to  the 
I04-10S  ml~ '  concentrations  required  for  fertilization  in  sea 
urchins  (Pemberton  et  ai.  2003).  When  sperm  from  a  single 
male-phase  D.  listerianum  colony  were  diluted  in  a  3840-1 
tank,  the  male  was  nevertheless  able  to  sire  abundant  prog- 
eny with  20  female-phase  colonies  (Bishop,  1998).  Conse- 
quently, these  two  brooding  species  appear  likely  to  have 
ecological  fertilization  dynamics  similar  to  those  of  B. 
schlosseri.  In  marked  contrast  to  these  results,  female  col- 
onies of  the  brooding  octocoral  Briareum  asbestinum  were 
severely  sperm  limited  when  placed  only  5  m  away  from  a 
male,  and  reproductive  success  was  positively  correlated 
with  male  density  (Brazeau  and  Lasker.  1992).  Though 
based  on  a  very  limited  number  of  brooding  species,  the 
comparison  between  the  octocoral  and  the  bryozoans  and 
asidians  hints  at  another  general  principle.  Bryozoans,  like 


158 


A.  PHILLIPPI  ET  AL 


ascidians,  are  active  suspension  feeders  who  use  feeding 
structures  to  filter  sperm  or  sperm  packets  from  the  seawater 
(Temkin.  1994.  1996),  whereas  octocorals  are  passive  sus- 
pension feeders.  Although  the  mechanism  by  which  sperm 
gain  access  to  brooded  eggs  is  unknown  in  octocorals,  this 
taxon  lacks  a  feeding  mechanism  that  could  be  co-opted  for 
sperm  capture.  So  while  active  suspension-feeding  brooders 
may  be  largely  immune  to  sperm  limitation  in  nature,  pas- 
sive suspension-feeding  brooders  may  be  among  the  most 
sperm-limited  of  marine  invertebrates  (Yund,  2000). 

Comparison  with  previous  results  for  B.  schlosseri 

It  is  useful  to  view  our  results  within  the  context  of  past 
fertilization  studies  on  B.  schlosseri.  A  series  of  papers  on 
sperm  competition  focused  on  relative  male  reproductive 
success,  but  also  incidentally  quantified  levels  of  egg  fer- 
tilization. While  Atkinson  and  Yund  (1996)  found  no  sig- 
nificant difference  in  the  proportion  of  eggs  fertilized  in 
combinations  of  high  and  low  population  density  and  size, 
three  other  studies  (Yund  and  McCartney,  1994;  Yund 
1995,  1998)  did  report  increased  fertilizations  with  in- 
creased male  density.  If  male  density  (past  studies)  has  more 
of  an  effect  than  total  population  density  (this  study)  on 
fertilization,  fertilization  in  B.  schlosseri  may  be  more  sen- 
sitive to  the  male:female  ratio  than  to  absolute  density.  At 
the  level  of  individual  gametes  (i.e.,  the  cellular  level),  this 
pattern  in  turn  suggests  that  fertilization  levels  may  be 
dictated  more  by  sperm:egg  ratios  than  by  the  absolute 
sperm  concentration.  Yund  (1998)  also  used  a  rare  biochem- 
ical marker  for  paternity  determination  and  showed  that 
nearby  males  monopolize  fertilizations  as  long  as  the  quan- 
tity of  sperm  they  produce  is  greater  than  some  threshold 
level.  When  local  sperm  production  is  below  that  threshold, 
eggs  are  fertilized  nevertheless,  but  the  sperm  come  from 
more  distant  sources.  This  result  helps  explain  how  eggs  can 
be  fertilized  under  a  broad  range  of  density  conditions. 

Maximum  field  fertilization  levels 

Fertilization  levels  for  B.  schlosseri  were  generally  quite 
high,  but  even  in  the  most  dense  conditions  still  averaged 
less  than  100%.  Fertilization  levels  in  colonies  placed  in 
natural  populations  averaged  85.6%  throughout  the  entire 
sampling  season  (Fig.  3);  levels  in  the  experimental  popu- 
lations were  also  very  close  to  85%  (Fig.  1).  Although  it  is 
tempting  to  interpret  these  data  as  evidence  of  a  low  level  of 
sperm  limitation,  another  explanation  is  more  likely.  Repro- 
ductive success  below  100%  may  have  been  the  result  not  of 
unsuccessful  fertilization,  but  of  unsuccessful  development 
of  embryos  because  of  outbreeding  depression  (Grosberg, 
1987).  Due  to  the  philopatric  dispersal  of  larvae  (that  is, 
dispersal  that  keeps  the  larvae  near  their  site  of  origin).  B. 
schlosseri  colonies  typically  live  in  kin  groups  (Grosberg, 
1987.  1991;  Yund  and  O'Neil.  2()00).  and  consequently 


mate  with  relatives  (Grosberg,  1987,  1991).  Because  the 
normal  mating  system  involves  inbreeding,  this  species  may 
be  subject  to  outbreeding  depression  (Grosberg,  1987).  Our 
experimental  manipulation  assembled  populations  that 
lacked  genetic  structure,  and  our  survey  introduced  ran- 
domly selected  genotypes  into  natural  populations.  Thus,  all 
fertilizations  were  the  product  of  out-crossed  matings.  Gros- 
berg (1987)  has  previously  reported  that  outcrossing  re- 
duces the  success  of  both  fertilization  and  subsequent  em- 
bryo development.  The  cumulative  effect  of  outbreeding 
depression  (through  larval  hatching)  that  he  predicted  is 
consistent  with  the  15%  failure  that  we  observed.  Because 
we  assayed  fertilization  by  successful  development,  our 
approach  would  not  have  distinguished  early  developmental 
failures  from  fertilizations  that  did  not  occur. 

Alternatively,  recent  ecological  work  on  the  occurrence 
of  polyspermy  in  marine  invertebrates  (e.g.,  Franke  et  at., 
2002)  suggests  a  different  explanation  for  our  observed  85% 
fertilization  maximum.  All  of  the  eggs  in  our  colonies  may 
have  been  fertilized,  but  some  may  have  been  fertilized  by 
more  than  one  sperm.  Because  embryos  resulting  from 
polyspermic  fertilization  would  have  failed  to  develop,  and 
we  assayed  fertilization  in  terms  of  successful  development, 
our  results  could  also  have  incorporated  the  effects  of 
polyspermy.  Although  we  are  convinced  that  polyspermy 
plays  an  important  role  in  the  fertilization  dynamics  of 
many  marine  free-spawners  (Yund,  2000),  we  are  skeptical 
of  this  explanation  for  our  own  results.  All  evidence  sug- 
gests that  successful  fertilization  in  B.  schlosseri  tends  to  be 
a  time-integrated  process  in  which  dilute  sperm  are  slowly 
acquired  from  the  water.  If  this  scenario  is  valid,  then  eggs 
are  unlikely  to  be  subject  to  the  high  short-term  sperm 
concentrations  necessary  to  cause  polyspermy.  Further- 
more, effective  polyspermy  blocks  are  present  in  ascidians 
(e.g.,  Lambert  et  ai,  1997).  Even  when  eggs  of  B.  schlosseri 
are  subjected  in  laboratory  experiments  to  sperm  concen- 
trations much  higher  than  those  found  in  nature,  we  see  no 
evidence  of  polyspermy  (unpubl.  data).  In  addition,  if 
polyspermy  had  been  an  important  factor  in  our  experi- 
ments, fertilization  levels  (as  assayed  by  development) 
should  have  declined  at  higher  population  densities. 

Acknowledgments 

Cheryl  Wapnick,  Lisa  Onaga,  and  Basma  Mohammad 
assisted  with  animal  culture,  and  Sheri  Johnson  provided 
helpful  comments  on  an  earlier  version  of  the  manuscript. 
Funding  was  provided  by  the  National  Science  Foundation 
(OCE-97-30354.  OCE-01-22031,  and  OCE-01-17623). 

Literature  Cited 

Atkinson,  O.  S.,  and  P.  ().  Yund.  1996.  The  effect  of  variation  in 
population  density  on  male  fertilization  success  in  a  colonial  ascidian. 
./  l-\t>.  Mar.  Biol.  Ecu!.  195:  111-123. 


FERTILIZATION   *   F(  DENSITY  I 


159 


Babcock,  R.  C.,  C.  N.  Mundy,  and  D.  \\hitehead.  1994.  Sperm 
diffusion  models  and  in  situ  confirmation  of  long-distance  fertilization 
in  the  free-spawning  asteroid  Acanthaster  planci.  Biol.  Bull.  186: 
17-28. 

Benzie.  J.  A.  H.,  and  P.  Dixun.  1994.  The  effects  of  sperm  concentra- 
tion. sperm:egg  ratio,  and  gamete  age  on  fertilization  success  in  crown- 
of-thorns  starfish  (Acanthaster  planci)  in  the  laboratory.  Biol.  Bull. 
186:  139-152. 

Benzie,  J.  A.  H.,  K.  P.  Black,  P.  J.  Moran,  and  P.  Dixon.  1994. 
Small-scale  dispersion  of  eggs  and  sperm  of  the  crown-of-thorns  star- 
fish (Acanthaster planci)  in  a  shallow  coral  reef  habitat.  Biol.  Bull.  186: 
153-167. 

Bishop,  J.  D.  D.  1998.  Fertilization  in  the  sea:  are  the  hazards  of 
broadcast  spawning  avoided  when  free-spawned  sperm  fertilize  re- 
tained eggs?  Proc.  R.  Soc.  Land.  B  265:  725-73 1 . 

Boyd,  H.  C.,  S.  K.  Brown,  J.  A.  Harp,  and  I.  L.  VVeissman.  1986. 
Growth  and  sexual  maturation  of  laboratory-cultured  Monterey  Botryl- 
lus  schlosseri.  Biol.  Bull.  170:  91-109. 

Brazeau,  D.  A.,  and  H.  R.  Lasker.  1992.  Reproductive  success  in  the 
Caribbean  octocoral  Briareum  asbesrinum.  Mar.  Binl.  114:  157-163. 

Chadwick-Furman,  N.  E.,  and  I.  L.  Weissman.  1995.  Life  histories 
and  senescence  of  Botiylhis  schlosseri  (Chordata.  Ascidiacea)  in 
Monterey  Bay.  Biol.  Bull.  189:  36-41. 

Claereboudt.  M.  1999.  Fertilization  success  in  spatially  distributed 
populations  of  benthic  free-spawners:  a  simulation  model.  Ecol.  Model. 
121:  221-233. 

Coma,  R.,  and  H.  R.  Lasker.  1997a.  Small-scale  heterogeneity  of 
fertilization  success  in  a  broadcast  spawning  octocoral.  J.  Exp.  Mar. 
Biol.  Ecol.  214:  107-120. 

Coma,  R.,  and  H.  R.  Lasker.  1997b.  Effects  of  spatial  distribution  and 
reproductive  biology  on  in  situ  fertilization  rates  of  a  broadcast-spawn- 
ing invertebrate.  Biol.  Bull.  193:  20-29. 

Frank,  K.  T.,  and  D.  Brickman.  2000.  Allee  effects  and  compensatory 
population  dynamics  within  a  stock  complex.  Can.  J.  Fish.  Aquat.  Sci. 
57:  513-517. 

Franke,  E.  S.,  R.  C.  Babcock,  and  C.  A.  Styan.  2002.  Sexual  conflict 
and  polyspermy  under  sperm-limited  conditions:  in  \itii  evidence  from 
field  simulations  with  the  free-spawning  marine  echinoid  Evecliinus 
chtororicus.  Am.  Nat.  160:  485-496. 

Grosberg,  R.  K.  1982.  Ecological,  genetical.  and  developmental  factors 
regulating  life  history  variation  within  a  population  of  the  colonial 
ascidian  Botiy/his  schlosseri  (Pallas)  Savigny.  Ph.D.  dissertation.  Yale 
University,  New  Haven.  CT. 

Grosberg,  R.  K.  1987.  Limited  dispersal  and  proximity-dependent 
mating  success  in  the  colonial  ascidian  Botryllus  xchloxxeri.  Evolution 
41:  372-3X4. 

Grosberg,  R.  K.  1988.  Life-history  variation  within  a  population  of  the 
colonial  ascidian  Botiylhis  schlosseri.  1.  The  genetic  and  environmental 
control  of  seasonal  variation.  Evolution  42:  900-920. 

Grosberg,  R.  K.  1991.  Sperm-mediated  gene  flow  and  the  genetic 
structure  of  a  population  of  the  colonial  ascidian  Botryllus  schlosseri. 
Evolution  45:  130-142. 

Incze  L.  S.,  R.  A.  Lutz,  and  L.  Waiting.  1980.  Relationship  between 
effects  of  environmental  temperature  and  seston  on  growth  and  mor- 
tality of  Mytilus  edtilis  in  a  temperate  northern  estuary.  Mar.  Biol.  57: 
147-156. 

Jamieson,  G.  S.  1993.  Marine  invertebrate  conservation:  evaluation  of 
fisheries  over-exploitation  concerns.  Am.  Zoo/.  33:  551-567. 

Johnson,  S.  L.,  and  P.  O.  Y'und.  2004.  Remarkable  longevity  of  dilute 
sperm  in  a  free-spawning  colonial  ascidian.  Biol.  Bull.  206:  144-151. 

Lambert  C.,  H.  Goudeau,  C.  Franchet,  G.  Lambert,  and  M.  Goudeau. 
1997.  Ascidian  eggs  block  polyspermy  by  two  independent  mecha- 
nisms: one  at  the  egg  plasma  membrane,  the  other  involving  the  follicle 
cells.  Mot.  Reprod.  Dev.  48:  137-143. 


Lasker,  H.  R.,  D.  A.  Brazeau.  J.  Calderon,  M.  A.  Coffroth,  R.  Coma, 
and  K.  Kim.  1996.  In  situ  rates  of  fertilization  among  broadcast 
spawning  gorgonian  corals.  Biol.  Bull.  190:  45-55. 

Levitan,  D.  R.  1991.  Influence  of  body  size  and  population  density  on 
fertilization  success  and  reproductive  output  in  a  free-spawning  inver- 
tebrate. Binl.  Bull.  181:  261-26X. 

Levitan,  D.  R.,  and  C.  Petersen.  1995.  Sperm  limitation  in  the  sea. 
Trends  Ecol.  Evnl.  10:  22X-231. 

Levitan,  D.  R.,  and  M.  A.  Sewell.  1998.  Fertilization  success  in 
free-spawning  marine  invertebrates:  review  of  the  evidence  and  fish- 
eries implications.  Can.  Spec.  Puhl.  Fish.  Ai/uat.  Sci.  125:  159-164. 

Levitan,  D.  R.,  and  C.  M.  Young.  1995.  Reproductive  success  in  large 
populations:  empirical  measures  and  theoretical  predictions  of  fertili- 
zation in  the  sea  biscuit  Clypeaster  rosaceus.  J.  Exp.  Mar.  Biol.  Ecol. 
190:  221-241. 

Levitan,  D.  R.,  M.  A.  Sewell,  and  F.-S.  Chia.  1991.  Kinetics  of 
fertilization  in  the  sea  urchin  Strongylocentrotus  franciscanus:  interac- 
tion of  gamete  dilution,  age.  and  contact  time.  Biol.  Bull.  181:  371-378. 

Levitan.  D.  R.,  M.  A.  Sewell,  and  F.-S.  Chia.  1992.  How  distribution 
and  abundance  influences  fertilization  success  in  the  sea  urchin 
Strongylocentrotus  franciscanus.  Ecology  73:  248-254. 

Liermann,  M..  and  R.  Hilborn.  1997.  Depensation  in  fish  stocks:  a 
hierarchic  Bayesian  meta-analysis.  Can.  J.  Fish.  Aquat.  Sci.  54:  1976- 
1984. 

Meidel.  S.  K.,  and  P.  O.  Yund.  2001.  Egg  longevity  and  time-inte- 
grated fertilization  in  a  temperate  sea  urchin  (Strongylocentrotus  droe- 
bachiensis).  Biol.  Bull.  201:  X4-94. 

Metaxas,  A.,  R.  E.  Scheibling,  and  C.  M.  Young.  2002.  Estimating 
fertilization  success  in  marine  benthic  invertebrates:  a  case  study  with 
the  tropical  sea  star  Oreaster  reticnlatiis.  Mar.  Ecol.  Prog.  Ser.  226: 
87-101. 

Milkman,  R.  1967.  Genetic  and  developmental  studies  on  Botryllus 
schlosseri.  Biol.  Bull.  132:  229-243. 

Morgan,  S.  G.  1995.  Life  and  death  in  the  plankton:  larval  mortality  and 
adaptation.  Pp.  279-321  in  Marine  Invertebrate  Larvae.  L.  McEdward. 
ed.  CRC  Press.  New  York. 

Myers,  R.  A.,  N.  J.  Barrowman.  J.  A.  Mulchings,  and  A.  A.  Rosenberg. 
1995.  Population  dynamics  of  exploited  fish  stocks  at  low  population 
levels.  Science  269:  1106-1108. 

Newlon,  A.  \V.  Ill,  P.  O.  Yund,  and  J.  Stewart-Savage.  2003.  Phe- 
notypic  plasticity  of  male,  female,  and  asexual  reproduction  in  a 
colonial  ascidian.  Botiylhis  schlosseri.  J.  Exp.  Zoo/.  297A:  180-188. 

Oliver,  J.,  and  R.  Babcock.  1992.  Aspects  of  the  fertilization  ecology 
of  broadcast  spawning  corals:  sperm  dilution  effects  and  in  situ  mea- 
surements of  fertilization.  Biol.  Bull.  183:  409-417. 

Pemberton,  A.  J.,  R.  N.  Hughes,  P.  H.  Manriquez,  and  J.  D.  D.  Bishop. 
2003.  Efficient  utilization  of  very  dilute  sperm:  sperm  competition 
may  be  more  likely  than  sperm  limitation  when  eggs  are  retained.  Proc. 
R.  Soc.  Loud.  B  (Suppl.l  270:  S223-S226. 

Pennington,  J.  T.  1985.  The  ecology  of  fertilization  of  echinoid  eggs: 
the  consequences  of  sperm  dilution,  adult  aggregation,  and  synchro- 
nous spawning.  Binl.  Bull.  169:  417-430. 

Pfister,  C.  A.,  and  A.  Bradbury.  1996.  Harvesting  red  sea  urchins: 
recent  effects  and  future  predictions.  Ecol.  Appl.  6:  298-310. 

Quinn,  J.  F.,  S.  R.  Wing,  and  L.  W.  Botsford.  1993.  Harvest  refugia 
in  marine  invertebrate  fisheries:  models  and  applications  to  the  red  sea 
urchin  Strongylocentrotus  franciscanus.  Am.  Zool.  33:  537-550. 

Roughgarden,  J.,  S.  Gaines,  and  H.  Possingham.  1988.  Recruitment 
dynamics  in  complex  life  cycles.  Science  241:  1460-1466. 

Sewell,  M.  A.  1994.  Small  size,  brooding,  and  protandry  in  the  apodid 
sea  cucumber  Leptosynapta  chirki.  Biol.  Bull.  187:  1 12-123. 

Shelton,  P.  A.,  and  B.  P.  Healey.  1999.  Should  depensation  be  dis- 
missed as  a  possible  explanation  for  the  lack  of  recovery  of  the  northern 
cod  (Gadns  mnrhua)  stock?  Can.  J.  Fish.  Aquat.  Sci.  56:  1521-1524. 


160 


A    PHILLIPPI  ET  AL. 


Stewart-Savage,  J.,  and  P.  O.  Vund.  1997.      Temporal  pattern  of  sperm 

release  from  the  colonial  ascidian,  Bolryllus  schlosseri.  J.  Exp.  Zoo/. 

279:  620-625. 
Stewart-Savage,  J.,  A.  Phillippi,  and  P.  O.  Vund.  200 la.      Delayed 

insemination  results  in  embryo  mortality  in  a  brooding  ascidian.  Bin/. 

Hull.  201:  52-58. 
Stewart-Savage.  J.,  A.  Stires,  and  P.  O.  Vund.  200 Ib.      Environmental 

effect  on  the  reproductive  output  of  Botryllus  schlosseri.  Pp.  311-314 

in  Biology  ofAscidians,  H.  Sawada,  H.  Yokosama,  and  C.C.  Lambert, 

eds.  Springer- Verlag,  Tokyo. 
Stoner,  A.  W.,  and  M.  Ray-Culp.  2000.      Evidence  for  Allee  effects  in 

an  over-harvested  marine  gastropod:  density-dependent  mating  and  egg 

production.  Mar.  Ecol.  Prog.  Ser.  202:  297-302. 
Strathmann.  R.  R.  1985.      Feeding  and  non-feeding  larval  development 

and  life-history  evolution  in  marine  invertebrates.  Annii.  Rev.  Ecol. 

Syst.  16:  339-361. 
Temkin.  M.  H.  1994.      Gamete  spawning  and  fertilization  in  the  gym- 

nolaemate  bryozoan  Membranipora  membranacea.  Bio!.  Bull.   187: 

143-155. 
Temkin,  M.  H.  1996.      Comparative  fertilization  biology  of  gymnolae- 

rnate  bryozoans.  Mar.  Biol.  127:  329-339. 
Thorson,  G.  1950.      Reproductive  and  larval  ecology  of  marine  bottom 

invertebrates.  Biol.  Rev.  25:  1-45. 
\\ahle,  R.  A.,  and  S.  H.  Peckham.  1999.      Density-related  reproductive 


trade-offs  in  the  green  sea  urchin.  Strongylocentrotus  droebachiensis. 

Mar.  Biol.  134:  127-137. 
Vund,  P.  O.  1990.      An  in  situ  measurement  of  sperm  dispersal  in  a 

colonial  marine  hydroid.  J.  Exp.  Zool.  253:  102-106. 
Vund,  P.  O.  1995.      Gene  flow  via  the  dispersal  of  fertilizing  sperm  in  a 

colonial  ascidian  (Botryllus  schlosseri}:  the  effect  of  male  density.  Mar. 

Biol.  122:  649-654. 
Vund,  P.  O.  1998.      The  effect  of  sperm  competition  on  male  gain  curves 

in  a  colonial  marine  invertebrate.  Ecology  79:  328-339. 
Vund,  P.  O.  2000.      How  severe  is  sperm  limitation  in  natural  populations 

of  marine  free-spawners?  Trends  Ecol.  Evol.  15:  10-13. 
Vund,  P.  O.,  and  M.  A.  McCartney.  1994.      Male  reproductive  success 

in  colonial  invertebrates:  competition  for  fertilizations.  Ecology  75: 

2151-2167. 

Yund,  P.  O.,  and  P.  G.  O'Neil.  2000.      Microgeographic  genetic  differ- 
entiation in  a  colonial  ascidian  (Bom/Ins  schlosseri)  population.  Mar. 

Biol.  137:  583-588. 
Vund,  P.  O.,  and  A.  Stires.  2002.       Spatial   variation  in  population 

dynamics  in  a  colonial  ascidian  (Butryllus  schlosseri}.  Mar.  Biol.  141: 

955-963. 
Vund,  P.  O.,  \.  Marcum,  and  J.  Stewart-Savage.  1997.      Life-history 

variation  in  a  colonial  ascidian:  broad-sense  heritabilities  and  tradeoffs 

in  allocation  to  asexual  growth  and  male  and  female  reproduction.  Biol. 

Bull.  192:  290-299. 


Reference:  Biol.  Bull.  206:  161-172.  (June  2004) 
©  2004  Marine  Biological  Laboratory 


Induction  of  Settlement  of  Larvae  of  the  Sea  Urchin 

Holopneustes  purpurascens  by  Histamine 

From  a  Host  Alga 


REBECCA  L.  SWANSON14*,  JANE  E.  WILLIAMSON,1  4t.  ROCKY  DE  NYSK4t 
NARESH  KUMAR24.  MARTIN  P.  BUCKNALL1,  AND  PETER  D.  STEINBERG14 

1  School  of  Biological,  Eartli  &  Environmental  Sciences,  ~  School  of  Chemical  Sciences, 

'  Bioanalytical  Mass  Spectrometry  Facilit\,     Center  for  Marine  Biofouling  &  Bio-Innovation, 

University'  of  New  South  Wales,  Svdnev  2052,  Australia 


Abstract.  Larvae  of  the  Australian  sea  urchin  Holopneu- 
stes purpurascens  are  induced  to  settle  and  metamorphose 
(termed  settlement  herein)  by  a  water-soluble  compound 
produced  by  the  red  alga  Delisea  pulchra,  the  main  host 
plant  of  new  recruits.  The  settlement  cue  for  H.  purpura- 
scens had  previously  been  identified  as  a  floridoside-isethio- 
nic  acid  complex,  and  this  paper  presents  new  evidence 
correcting  that  finding.  The  actual  settlement  cue  produced 
by  D.  pulchra  was  isolated  from  the  polar  extract  by  cation- 
exchange  chromatography  and  identified  as  histamine,  us- 
ing one-  and  two-dimensional  nuclear  magnetic  resonance 
spectrometry.  The  chemical  identity  of  the  cue  was  con- 
firmed by  gas  chromatography-mass  spectrometry  (GC- 
MS)  and  matrix-assisted  laser  desorption/ionization-time- 
of-flight  mass  spectrometry.  Synthetic  histamine  and 
histamine  at  4.5  /nM  isolated  from  D.  pulchra  both  induced 
rapid  settlement  in  80%-100%  of  the  larvae  of  H.  purpura- 
scens. Lower  concentrations  of  histamine  (0.9-2.3  /u,A/) 
induced  larval  settlement,  but  this  response  varied  from 
0%-90%.  The  histamine  content  of  two  host  plants  of  H. 


Received  24  October  2003:  accepted  8  April  2004. 

*  To  whom  correspondence  should  be  addressed.  E-mail: 
r.  swan  son  @  unsw.edu.au 

t  Current  address:  Department  of  Biological  Sciences.  Maequarie  Uni- 
versity. NSW  2109  Australia. 

+  Current  address:  School  of  Marine  Biology  &  Aquaculture,  James 
Cook  University,  QLD  4811  Australia. 

Abbreviations;  CX,  cation-exchange;  F-I.  floridoside-isethiomc  acid; 
GC-MS.  gas  chromatography-mass  spectrometry;  HPLC,  high-perfor- 
mance liquid  chromatography;  ISTD,  internal  standard;  MALD1-TOF  MS, 
matrix-assisted  laser  desorption/ionization-time-of-rlight  mass  spectrome- 
try; NMR.  nuclear  magnetic  resonance;  SSW,  sterile  seawater. 


purpurascens — D.  pulchra  and  Ecklonia  radiata — and  of 
four  other  common  species  was  quantified  using  GC-MS.  D. 
pulchra  had  the  highest  histamine  content,  which  is  consis- 
tent with  H.  purpurascens  recruiting  to  this  species.  Hista- 
mine was  also  detected  in  the  seawater  surrounding  these 
host  algae.  This  is  the  first  time  that  a  settlement  cue  has 
been  quantified  in  the  habitat  of  a  marine  organism. 

Introduction 

Most  marine  invertebrates  have  complex  life  histories  in 
which  a  dispersive  larval  phase  alternates  with  benthic 
juvenile  and  adult  phases.  The  demography  of  such  species 
is  highly  dependent  on  larval  recruitment  to  a  favorable 
habitat  (Pawlik,  1992;  Underwood  and  Keough,  2000).  and 
the  question  of  how  planktonic  larvae  locate  an  appropriate 
benthic  habitat  in  which  to  settle  has  long  been  a  focus  for 
marine  biologists.  The  current  view  is  that  hydrodynamic 
processes  dominate  at  large  spatial  scales  (meters,  kilome- 
ters), with  active  habitat  selection  becoming  progressively 
more  important  at  smaller  spatial  scales  (centimeters,  mil- 
limeters, micrometers)  (Keough  and  Downes,  1982;  Mul- 
lineaux  and  Butman,  1991;  Harvey  and  Bourget,  1997; 
Zimmer  and  Butman,  2000). 

Active  habitat  selection  requires  that  larvae  discriminate 
among  potential  settlement  sites,  which  is  possible  through 
the  detection  of  habitat-specific  cues.  Many  laboratory  ex- 
periments have  confirmed  that  larvae  from  a  diverse  range 
of  phyla  respond  both  behaviorally  (settlement — sinking  to 
the  bottom  for  substrate  exploration)  and  morphologically 
(metamorphosis — ontogenesis  into  the  benthic  form)  to 
such  physical  factors  of  a  habitat  as  light  (Maida  et  al.. 


161 


162 


R.  L.  SWANSON  ET  AL 


1994).  surface  orientation  (Raimondi  and  Morse,  2000). 
flow  conditions  (Mullineaux  and  Butman.  1991),  crevices 
(Keough  and  Dowries,  1982),  and  surface  texture  (Bernts- 
son  et  al.,  2000).  Larvae  can  also  be  induced  to  settle  and 
metamorphose  (collectively  termed  settlement  in  this  paper) 
by  surface-bound  or  waterborne  chemical  cues,  which  are 
thought  to  indicate  a  suitable  habitat  for  the  benthic  stage 
(Hadfield  and  Paul.  2001).  The  source  of  such  chemical 
cues  (inducers)  may  be  conspecifics  (Burke.  1986),  host 
organisms  (Williamson  et  al.,  2000).  prey  (Hadfield  and 
Scheuer,  1985),  or  biofilms  (Wieczorek  and  Todd.  1998). 

The  chemical  cues  for  larval  settlement  that  have  been 
isolated  from  natural  sources  within  the  habitat  appear  to  be 
diverse;  however,  most  have  been  only  partially  character- 
ized. These  include  small  peptides  (the  sand  dollar  Den- 
draster  excentricus — Burke.  1984;  the  oyster  Crassostrea 
virginica — Zimmer-Faust  and  Tamburri,  1994;  the  jellyfish 
Cassiopea  xamachana — Fleck  and  Fitt,  1999).  uncharacter- 
ized  low-molecular-weight  water-soluble  compounds  (the 
nudibranch  Phestilla  xibogae — Hadfield  and  Pennington. 
1990;  the  cephalaspidean  Haminaea  callidegenita — Gibson 
and  Chia,  1994),  carbohydrates  (the  coral  Agaricia  humi- 
lis — Morse  and  Morse,  1996;  the  ascoglossan  Alderia  mod- 
esta — Krug  and  Manzi.  1999).  and  glycoproteins  (the  bar- 
nacle Balanus  amphitrite — Clare  and  Matsumura,  2000). 

In  contrast  to  the  numerous  partially  characterized  induc- 
ers, there  are  only  a  few  examples  in  which  the  chemical 
structure  of  a  settlement  cue  isolated  from  a  natural  source 
has  been  determined.  Delta-tocopherols  from  Sargassuin 
tortile  induced  settlement  of  the  hydroid  Coyne  uchidai 
(Kato  et  al.,  1975),  jacarone  isolated  from  the  red  alga 
Delesseria  sanguined  induced  settlement  of  the  scallop 
Pecten  maximum  (Yvin  et  al.,  1985),  narains  and  antho- 
samines  A  and  B  isolated  from  marine  sponges  induced 
settlement  of  ascidian  larvae  (Tsukamoto  et  al..  1994, 
1995).  and  lumichrome  isolated  from  conspecifics  induced 
settlement  of  larvae  of  the  ascidian  Halocynthia  roretzi 
(Tsukamoto  et  al.,  1999).  In  most  cases,  the  ecological 
relevance  of  these  compounds  in  situ  is  not  clear,  either 
because  the  source  of  the  settlement  cue  is  not  necessarily 
related  to  the  recruitment  patterns  of  the  organism  (Yvin  et 
til..  1985;  Tsukamoto  et  al..  1994.  1995).  or  because  the 
availability  of  the  cue  to  settling  larvae  has  not  been  dem- 
onstrated (Tsukamoto  et  al..  1999). 

A  naturally  occurring  characterized  settlement  cue  that 
appears  to  strongly  affect  the  demography  of  the  sea  urchin 
Holopneustes  purpurascens  Agassiz  1872  (Temnopluridae: 
Echinodermata)  was  recently  reported  by  Williamson  et  al. 
(2000).  //.  purpurascens  is  an  endemic  Australian  echinoid 
that  lives  in  shallow  subtidal  habitats  in  the  canopy  of 
macroalgae.  particularly  Deli.sea  pulchra  Greville  (Mon- 
tagne)  1844  and  Ecklimia  nuliata  (C.  Agardh)  J.  Agardh 
1898  at  Bare  Island,  Sydney  (Williamson  et  al.,  2000. 
2004).  Although  abundant  on  both  host  plants,  the  smaller 


size  classes  of  H.  purpurascens  were  most  abundant  on  D. 
pulchra.  with  the  smallest  size  class  (test  diameter  £  5  mm) 
found  only  on  that  species.  This  suggested  that  D.  pulchra 
might  produce  a  settlement  cue  for  larval  H.  purpurascens 
(Williamson  et  al.,  2000).  Fresh  pieces  of  D.  pulchra  (but 
not  E.  radiata)  and  seawater  collected  in  situ  near  D.  pul- 
chra plants  induced  settlement  in  larvae  of  H.  purpurascens. 
The  water-soluble  cue  was  subsequently  isolated  and  char- 
acterized as  a  complex  between  the  sugar  floridoside  and 
isethionic  acid  (F-I  complex;  Williamson  et  al..  2000). 

During  further  research  on  this  system,  we  obtained  in- 
ductive fractions  that  contained  isethionic  acid  but  not  flori- 
doside. and  we  were  also  unable  to  reproduce  a  synthetic  F-I 
complex  that  induced  settlement  of  larval  H.  purpurascens. 
Subsequently,  we  hypothesized  that  the  F-I  complex  was 
not  a  natural  settlement  cue  for  this  urchin.  This  paper 
identifies  the  true  nature  of  this  chemical  cue  from  D. 
pulchra  for  settlement  of  H.  purpurascens  larvae,  correcting 
the  previous  finding  of  Williamson  et  al.,  (2000).  In  addi- 
tion, we  quantify  the  settlement  cue  in  host  and  non-host 
algae  of  H.  purpurascens — the  first  time  that  a  natural 
settlement  cue  has  been  quantified  in  the  habitat  of  a  marine 
organism. 


Materials  and  Methods 


Stud\  site 


All  animals  and  algae  used  in  this  study  were  collected 
from  sublittoral  habitats  ( 1-3  m  depth)  at  Bare  Island  (33° 
59'  38"  S.  151°  14'  00"  E)  at  the  north  head  of  Botany  Bay, 
Sydney,  Australia.  At  this  site  individuals  of  Holopneustes 
purpurascens  are  primarily  found  wrapped  in  the  laminae  of 
the  brown  kelp  Ecklimia  radiata  (Laminariales:  Phaeo- 
phyta)  or  in  the  fronds  of  the  red  foliose  alga  Delisea 
pulchra  (Bonnemaisonales:  Rhodophyta).  A  more  detailed 
description  of  this  habitat  and  the  ecology  of  this  system  are 
found  in  Wright  and  Steinberg  (2001 )  and  Williamson  el  al. 
(2004). 

Preparation  of  the  polar  extract  (/Delisea  pulchra 

The  results  of  Williamson  el  al.  (2000)  indicated  that  any 
settlement  cues  were  contained  within  the  polar  fraction  of 
the  crude  extract  of  D.  pulchra.  A  polar  extract  of  D. 
pulchra  was  thus  prepared  from  1 .0  kg  (wet  weight)  of  algae 
collected  from  Bare  Island.  Epibiota  were  removed,  the 
plants  blotted  dry,  and  the  thallus  exhaustively  extracted  in 
methanol  (OmniSolv.  EM  Science).  The  methanol  extract 
was  filtered  (Whatman  #1 ).  dried  by  rotary  evaporation  ;';; 
vnciio  at  40  °C.  and  partitioned  between  dichloromethane 
(OmniSolv)  and  Milli-Q  water.  The  Milli-Q  phase  was 
filtered  (Whatman  #1)  and  dried  in  racuo  at  40  C.  The 
dried  crude  polar  extract  was  dissolved  in  absolute  ethanol 


SETTLEMENT  INDUCTION  BY  HISTAMINE 


163 


three  times,  pooling  each  extract,  and  dried  in  menu  at  40 
°C  to  yield  the  polar  extract. 

Isolation  of  the  settlement  cue  in  Delisea  pulchra  by 
bioassay- guided  fractionation 

High-performance  liquid  chromatography.  The  polar  ex- 
tract of  D.  pulchra  was  fractionated  using  reversed-phase 
high-performance  liquid  chromatography  (HPLC — Adsor- 
bosil  CIS  column,  5-ju.m  particle  size,  250  mm  X  4.6  mm, 
Waters  R410  Rl-detector)  (100%  Milli-Q  water  at  1 
ml  •  min  ' ).  The  polar  extract  was  dissolved  in  Milli-Q 
water  (50  mg-ml"1),  filtered  (0.22  /u,m).  and  manually 
injected  (20  /u,l).  HPLC  resolved  two  major  peaks,  peak  1 
with  a  retention  time  (rt)  of  2.7  min,  and  peak  2  with  rt  = 
3.4  min  (Fig.  1A).  Each  peak  fraction  was  collected  from 
multiple  injections  and  dried  by  rotary  evaporation  in  vacua 
at  40  °C.  Peak  fractions  were  tested  for  bioactivity  in 


A  -  HPLC         Polar  extract 

50  rng-ml"1  (MQ) 


Adsorbosll  C18  column 
FR  - 1  ml-min1  (MQ) 


Peak  1  Peak  2 

(rt-2.7  min)  (rt-3.4  min) 

I  I 

NMR  spectroscopy  analysis  &  settlement  assays 


B  -  CX  Chromatography 


Polar  extract 


200-40Q 

AG50W-X2  resin 
FR  -  2  ml-min1  (MQ) 


mg-mr(MQ) 


MQ 

MO 

MQ 

NH3 

NH3 

pH-10 

3% 

30% 

F1              F2             F3             F4            F5 

I 

I 

NMR  spectroscopy  analysis  &  settlement  assays 

Figure  1.  Diagram  of  the  bioassay-guided  fractionation  of  the  polar 
extract  of  Delisea  pulchra,  using  either  reversed-phase  HPLC  (A)  or 
cation-exchange  (CX)  chromatography  (B).  MQ  =  Milli-Q  water,  FR  = 
flow  rate,  rt  =  retention  lime,  F  =  fraction. 


settlement  assays  and  analyzed  by  'H-  and  l3C-nuclear 
magnetic  resonance  (NMR)  spectroscopy  (Bruker  DMX 
500). 

Cation-exchange  chromatography.  The  settlement  cue 
could  not  be  isolated  as  a  pure  fraction  using  HPLC,  so  an 
alternative  procedure,  cation-exchange  (CX)  chromatogra- 
phy, was  used  to  fractionate  the  polar  extract  of  D.  pulchra. 
CX  resin  (AG50W-X2  [H+  form],  BioRad)  in  Milli-Q 
water  was  poured  into  a  50-ml  burette,  taking  care  to 
exclude  air  bubbles.  The  resin  (25-ml  bed  volume)  was 
equilibrated  with  Milli-Q  water  at  2  ml-min"1  until  the 
eluant  was  pH  5-6.  The  polar  extract  of  D.  pulchra  (1-2  g) 
was  dissolved  in  5  ml  of  Milli-Q  water,  filtered  (0.22  ju,m), 
and  gently  loaded  onto  the  column.  Unbound  compounds 
were  collected  in  100  ml  of  Milli-Q  water  (fraction  1)  and 
another  100  ml  of  Milli-Q  water  (fraction  2).  Retained 
compounds  were  eluted  using  a  series  of  basic  solutions:  30 
ml  of  dilute  NH,  in  Milli-Q  water  (pH  10;  fraction  3),  30  ml 
of  3%-NH4OH  w/w  (fraction  4),  and  30  ml  of  30%-NH4OH 
w/w  (fraction  5,  Fig.  IB).  Fractions  1-5  were  collected  as 
controls,  using  the  same  method  but  without  loading  any  D. 
pulchra  extract  on  the  column;  none  of  these  fractions  had 
any  subsequent  activity.  CX-fractions  were  dried  in  a  cen- 
trifuge in  vacua  (speed- vac  SVC200,  Savant),  tested  for 
bioactivity  in  settlement  assays,  and  analyzed  by  'H-NMR 
spectroscopy. 

Identification  of  isolated  settlement  cue 

Nuclear  magnetic  resonance  spectroscopy.  Bioassay- 
guided  fractionation  of  the  polar  extract  of  D.  pulchra  by 
cation-exchange  chromatography  yielded  one  active  frac- 
tion (CX-fraction  5,  F5).  The  inducing  compound  in  F5  was 
identified  by  'H  and  I3C-NMR  experiments  (D2O),  and  a 
high-field  two-dimensional  'H-'?N  HMBC  NMR  experi- 
ment (d4  MeOH,  Bruker  DMX  500).  To  confirm  the  puta- 
tive structure  of  F5  as  histamine,  3  mg  of  F5  was  dissolved 
in  D,O  and  analysed  by  'H-NMR  spectroscopy.  Synthetic 
histamine  (3  mg)  was  added  to  F5  and  the  sample  re- 
analysed.  The  'H-NMR  spectra  of  the  unspiked  F5  sample 
and  the  spiked  F5  sample  were  then  compared. 

Gas  chromatography-mass  spectrometry.  NMR  spectros- 
copy analyses  identified  the  isolated  settlement  cue  as  his- 
tamine, and  this  was  confirmed  by  gas  chromatography- 
mass  spectrometry  (GC-MS).  Putative  (naturally  isolated) 
histamine  (1  mg)  and  synthetic  histamine  (1  mg)  were 
derivatized  with  heptafluorobutyric  anhydride  (Aldrich)  and 
then  acetic  anhydride  (Aldrich),  using  the  method  of  Baran- 
cin  et  al.  (1998).  Derivatized  samples  were  diluted  100-fold 
in  ethyl  acetate  before  analysis.  A  Zebron  ZB-5  column  (15 
in.  0.25  /o,m  X  0.25  mm  ID;  Phenomenex)  was  used  on  a 


164 


R.  L.  SWANSON  ET  AL. 


Hewlett  Packard  (HP)  5980  series  II  gas  chromatograph 
equipped  with  an  HP5971A  or  HP5972  mass  selective  de- 
tector. Injections  (2  jul)  were  in  the  splitless  mode  with  an 
inlet  pressure  of  170  kPa.  The  injection  port  was  held  as  290 
°C  and  the  interface  at  300  °C.  The  gas  chromatograph  was 
held  at  90  °C  for  2  min  and  ramped  at  10  °C  •  min~ '  to  200 
°C,  then  at  50  °C  •  min" '  to  3 10  °C  and  held  for  2  min  (17.2 
min  per  run).  Helium  was  used  as  the  carrier  gas.  The  mass 
selective  detector  was  operated  in  scan  mode  (ni/-  50-550). 
The  average  retention  times  of  derivatized  putative  hista- 
mine  and  derivatized  synthetic  histamine  were  recorded 
from  five  injections  of  each  sample  (mean  ±  SD,  n  =  5). 
The  electron  impact  ion-spectra  of  derivatized  putative  his- 
tamine and  derivatized  synthetic  histamine  were  compared. 

Matrix-assisted  laser  desorption/ionization-time-of- flight 
mass  spectrometry.  The  elemental  formula  of  putative  his- 
tamine was  determined  by  matrix-assisted  laser  desorption/ 
ionization-time-of-flight  mass  spectrometry  (MALDI-TOF 
MS)  (Bucknall  et  al.,  2002).  A  Perseptive  Voyager  DE  STR 
(Perseptive  Biosystems,  Framingham,  MA)  MALDI-TOF 
MS  was  operated  in  both  positive-ion  linear  delayed-extrac- 
tion  mode  and  reflector  delayed-extraction  mode  for  accu- 
rate mass  analysis.  The  test  samples  were  prepared  in  ace- 
tonitrile/Milli-Q  water  (50:50)  and  contained  either  100 
ng'/Lil"1  of  putative  histamine  or  synthetic  histamine. 
a-Cyano-4-hydroxycinnamic  acid  (5  mg  •  ml" ' )  prepared  in 
acetonitrile/Milli-Q/trifluoroacetic  acid  (80:20:0.02)  was 
used  as  the  matrix.  Glycine  (500  ng  •  jaP1)  and  [sarcosine- 
l5N-methyl-d-,]creatinine  •  HC1  (5  ng  •  /uF  '.  Cambridge 
Isotope  Laboratories  #DNLM-2171 )  were  added  as  internal 
mass  calibrants  for  accurate  mass  determinations.  An  accu- 
rate mass  for  the  putative  protonated  histamine  molecular 
ion  [M  +  H]+  was  determined  by  10  repeat  analyses  of  each 
sample.  The  mean  molecular  weight  was  calculated  for 
these  mass  spectra  and  compared  with  both  the  theoretical 
molecular  weight  for  histamine  and  the  molecular  weight 
measured  for  synthetic  histamine  using  the  same  analytical 
technique.  The  standard  deviation  for  these  mass  measure- 
ments was  taken  as  an  estimate  of  the  mass  measurement 
error. 

Settlement  assa\s 

H.  inirpitrascens  larvae  were  cultured  as  previously  de- 
scribed (Williamson  ct  al.,  2000).  Larvae  reached  compe- 
tency (i.e.,  become  developmentally  ready  for  settlement) 
within  6  days,  as  recognized  by  the  presence  of  five  well- 
developed  tube  feet.  All  settlement  assays  were  done  at  leJ 
"C  with  a  12-h-light/12-h-dark  regime,  in  40-mni  petri 
dishes  and  5  ml  of  sterile  seawater  (SSW).  Replicates  were 
randomly  assigned  among  treatments,  with  10-15  replicates 
per  treatment  and  one  6-day  larva  per  replicate  dish.  We 
were  unable  to  use  multiple  larvae  per  dish  in  these  assays 


because  this  species  is  a  "dribble"  spawner  and  generally 
yields  low  numbers  of  larvae  (settlement  is  not  gregarious; 
Williamson  et  al.,  2000).  Larvae  were  added  once  all  petri 
dishes  were  prepared,  and  percent  settlement  (i.e.,  percent 
metamorphosed)  was  recorded  at  set  time  intervals. 

HPLC  peak  fractions.  Peak  1  and  peak  2  fractions  were 
tested  against  larvae  to  determine  the  presence  of  a  settle- 
ment cue.  Peak  fractions  were  dissolved  in  Milli-Q  water 
(10  ing -ml"1  stock  solution)  and  aliquots  of  each  stock 
solution  were  added  to  assigned  petri  dishes  for  final  test 
concentrations  of  25  ju,g  •  ml~'  of  peak  1  and  51  jug  •  ml  ' 
of  peak  2.  A  floridoside-isethionic  complex  sample  ("F-I 
complex")  from  the  previous  study  (Williamson  et  al.. 
2000)  was  also  tested  in  the  assay  at  a  final  concentration  of 
76  /tig-mi"1.  Pieces  of  fresh  D.  pulchra  (  —  10  mg)  were 
used  as  a  positive  control,  and  Milli-Q  water  and  SSW  were 
used  as  the  negative  controls.  Percent  settlement  was  scored 
after  18  h  (/;  =  12  replicates  per  treatment). 

Cation-exchange  fractions.  Each  CX-fraction  (F)  was  tested 
against  larvae  to  determine  the  presence  of  a  settlement  cue. 
Fl.  F2,  F3,  F4  and  the  polar  extract  of  D.  pulchra  (used  as 
a  positive  control)  were  dissolved  in  Milli-Q  water  at  5 
mg  •  ml"1.  Aliquots  of  the  appropriate  fraction  were  added 
to  the  petri  dish  to  give  final  test  concentrations  of  50 
jitg-ml"1  for  each  treatment.  F5  was  dissolved  in  Milli-Q 
water  at  100  /xg  •  ml~ ',  and  aliquots  were  added  to  assigned 
petri  dishes  for  final  test  concentrations  of  0.1-1.0 
jLig-ml  '  (much  lower  concentrations  of  F5  were  tested 
because  of  a  low  yield  in  F5).  Initial  settlement  assays 
showed  that  only  F5  induced  settlement:  therefore,  CX- 
control-fraction  5  (CF5)  was  tested  in  future  settlement 
assays  as  the  procedural  control.  CF5  was  dissolved  in 
Milli-Q  water  at  100  jug  •  ml  '  and  tested  at  1.0  ^ig  '  ml"1. 
Milli-Q  water  and  SSW  were  used  as  the  negative  controls. 
Percent  settlement  was  scored  after  1  h  (n  -  10  replicates 
per  treatment). 

Natural  versus  synthetic  histamine.  Settlement  assays  were 
used  to  compare  the  responses  of  larvae  to  (i)  natural 
histamine  isolated  using  CX  chromatography.  (ii)  synthetic 
histamine,  and  (iii)  synthetic  histamine  run  through  the 
same  procedure  used  to  isolate  natural  histamine.  Stock 
solutions  of  900  /LtM  of  each  histamine  treatment  were 
prepared  in  Milli-Q  water,  and  aliquots  of  the  appropriate 
stock  solution  added  to  assigned  petri  dishes  for  final  test 
concentrations  of  0.9-9.0  /nM.  Pieces  of  fresh  D.  pulchra 
(  -- 10  mg)  and  50  jug  •  ml  '  of  the  polar  extract  D.  pulchra 
were  used  as  the  positive  controls,  and  Milli-Q  water  and 
SSW  were  used  as  the  negative  controls.  Percent  settlement 
was  scored  after  1  h  (;;  =  12  replicates  per  treatment  I. 


SETTLEMENT  INDUCTION  BY  HISTAMINE 


165 


Delisea  pulchra  treated  with  antibacterial  agents.  Because 
some  marine  bacteria  produce  histamine  (Fujii  et  al.,  1997). 
the  identification  of  histamine  as  the  settlement  cue  (see 
Results)  raises  the  possibility  that  the  bacterial  biofilm  on 
the  surface  of  D.  pulchra  may  be  the  source  of  the  cue.  To 
test  this,  the  ability  of  D.  pulchra  to  induce  settlement  after 
various  antibacterial  treatments  was  examined  in  a  settle- 
ment assay.  Antibacterial  treatments  were  adapted  from 
previous  studies  in  which  treatments  were  shown  to  be 
effective  in  reducing  surface  bacteria  (Xue-Wu  and  Gordon, 
1987;  Aguirre-Lipperheide  and  Evans,  1993;  Johnson  and 
Sutton,  1994).  Seven  plants  of  D.  pulchra  were  collected 
from  Bare  Island  and  brought  back  to  the  laboratory,  where 
portions  of  each  plant  were  allocated  to  each  of  seven 
treatments.  There  were  six  antibacterial  treatments  and  a 
procedural  control.  All  antibacterial  treatments  included  a 
5-min  soak  in  a  10%  betadine-SSW  solution,  followed  by 
three  rinses  in  SSW  and  a  24-h  treatment  in  either  ( 1 )  SSW 
(the  "soak"  treatment);  (2)  SSW  containing  20  mg  •  1~ ' 
streptomycin  (Aldrich),  10  mg-F1  penicillin  G  (Aldrich), 
and  10  mg  -I"1  kanamycin  (Aldrich;  "SPK"  treatment);  (3) 
SSW  containing  10  mg-l~'  ciprofloxacin  (Bayer,  "cipro- 
floxacin" treatment);  (4)  SSW  after  pieces  of  D.  pulchra 
were  gently  wiped  across  an  agar  plate,  before  and  after  the 
24-h  soak,  to  physically  remove  bacteria  ("wipe"  treat- 
ment); and  the  combination  treatments  (5)  "wipe  +  SPK". 
and  (6)  "wipe  +  ciprofloxacin."  The  procedural  control  was 
a  24-h  soak  in  SSW  without  the  initial  betadine  soak  ("soak 
control"  treatment).  The  next  day.  subsections  of  several  D. 
pulchra  plants  were  collected  as  a  "fresh  control"  treatment 
and  used  in  the  settlement  assay  on  that  day.  Pieces  of  D. 
pulchra  (  —  10  mg)  from  each  treatment  were  added  to 
assigned  sterile  petri  dishes,  and  percent  settlement  was 
scored  after  20  h  (n  =  15  replicates  per  treatment). 

Quantitative  analysis  of  histamine  in  various  algae 

If  histamine  is  a  natural  settlement  cue  for  this  urchin,  we 
would  expect  D.  pulchra,  the  primary  host  plant  of  new 
recruits  of  H.  purpurascens,  to  have  higher  levels  of  hista- 
mine than  other  algae  in  the  habitat.  To  test  this,  we  quan- 
tified the  histamine  content  of  six  species  of  algae  from  the 
habitat  of//,  purpurascens.  The  two  primary  host  plants  (D. 
pulchra  and  E.  radiata)  and  four  other  prominent  species  of 
algae  (Amphiroa  anceps,  Corallina  officinulis.  Homeostri- 
chus  olsenii,  and  Sargassum  vestitum)  were  collected  from 
Bare  Island  in  January  2003.  Five  replicates  of  each  alga 
were  analyzed,  with  each  replicate  consisting  of  three  small 
sections  taken  from  different  parts  of  one  thallus,  which 
were  then  pooled  into  a  single  sample  for  analysis  (2-4  g 
wet-weight).  A  polar  extract  of  each  algal  sample  was 
prepared  as  described  above.  Polar  extracts  were  dissolved 
in  Milli-Q  water  (200  /id)  and  acidified  with  50  /id  of  glacial 
acetic  acid,  [a,  a,  J3,  j3-d4]Histamine  •  2HCI  (1  jug.  Cam- 


bridge  Isotope  Laboratories.  #DLM  2911)  was  added  to 
each  sample  as  the  internal  standard  (ISTD).  Strong  cation- 
exchange  solid-phase  extraction  cartridges  (50  mg,  Alltech) 
were  equilibrated  with  Milli-Q  water  (5  ml)  at  a  flow  rate  of 
1  ml  •  min"1,  and  the  sample  was  loaded.  Unbound  com- 
pounds were  eluted  in  2  ml  of  Milli-Q  water  (fraction  1 )  and 
another  2  ml  of  Milli-Q  water  (fraction  2).  All  retained 
compounds  were  eluted  in  1  ml  of  30%  NH4OH  w/w 
(fraction  3)  and  dried  in  a  speed  vac.  Standards  that  con- 
tained l-jug  ISTD  and  cither  O.I,  0.5,  1.0,  5.0,  or  10  jug  of 
synthetic  histamine  were  prepared.  Standards  and  fraction  3 
samples  were  derivatized  with  heptafluorobutyric  anhydride 
and  acetic  anhydride  using  the  method  of  Barancin  et  al. 
(1998). 

A  DB-5MS  column  (15  m.  0.25  /im  <  0.25  mm  ID,  J  & 
W  Scientific)  and  a  packed  liner  (3%  SP-2250,  Supelco; 
Smythe  et  al..  2002)  were  installed  on  the  GC-MS  instru- 
ment previously  described,  and  the  same  run  conditions 
were  used.  The  mass  selective  detector  was  operated  in 
selected  ion  monitoring  mode  using  ions  characteristic  of 
the  analyte  (derivatized  histamine — in/-  94,  307,  349)  and 
the  ISTD  (HI/-  97.  311.  353).  Extracted  ion  chromatograms 
were  used  to  manually  integrate  the  area  under  each  ion 
peak  (which  is  proportional  to  the  amount  of  analyte  in  the 
sample).  For  each  standard  and  sample,  the  areas  of  the 
analyte  ions  (in/z  94,  307,  349)  were  added  together  and  the 
areas  of  the  ISTD  ions  (in/:.  97,  311.  353)  were  added 
together.  The  ratio  of  the  combined  areas  of  analyte:ISTD  in 
standards  was  used  to  generate  a  standard  curve.  The  his- 
tamine content  of  the  samples  was  calculated  by  reference 
to  the  standard  curve  and  expressed  in  terms  of  micrograms 
per  gram  (wet  weight)  of  algal  tissue  (jttg  •  g  :). 

After  checking  that  the  data  met  the  assumptions  of  the 
test,  the  histamine  content  of  different  algae  was  trans- 
formed [ln(.v  +  1 )]  and  compared  by  using  a  one-factor 
analysis  of  variance.  We  excluded  A.  anceps  and  C.  offici- 
nalis  from  the  analysis  because  no  histamine  was  detected 
in  these  species.  Bonferroni's  post  hoc  test  was  used  to 
determine  which  species  differed  in  their  histamine  contents 
(SYSTAT  ver.  7.0).  We  were  concerned  that  one  high  value 
for  D.  pulchra  might  be  unduly  influencing  our  analysis,  but 
the  outcome  was  unchanged  when  we  repeated  the  analysis 
with  this  value  omitted.  Therefore,  we  report  the  results  of 
the  initial  analysis. 

Reanalvsis  of  samples  from  Williamson  et  al.  (2000) 

Samples  remaining  from  the  study  published  in  William- 
son et  al.  (2000)  were  analyzed  by  GC-MS  for  the  presence 
of  histamine.  Any  histamine  in  the  old  samples  was  isolated 
using  cation-exchange  solid  phase  extraction  cartridges,  as 
outlined  previously  tor  isolating  algal  histamine.  and  then 
derivatized  with  heptafluorobutyric  anhydride  and  acetic 
anhydride,  using  the  method  of  Barancin  et  til.  ( 1998)  for 
quantitative  GC-MS  analysis. 


166 


R.   L.   SWANSON  ET  AL. 


Results 

Isolation  of  the  settlement  cue  in  Delisea  pulchra  by 
bioassay- guided  fractionation 

HPLC  fractions — NMR  spectroscopy  analysis  and  settle- 
ment assays.  The  polar  extract  of  Delisea  pulchra  was 
separated  into  two  fractions  using  HPLC  (peak  1  and  peak 
2,  Fig.  1A).  These  were  analyzed  by  NMR  spectroscopy 
(1-min  'H-  and  30-min  13C-NMR  experiments)  and  tested 
in  settlement  assays.  Peak  1  displayed  the  pattern  of  isethio- 
nic  acid  (Barrow  et  al..  1993),  as  determined  by  'H-  and 
13C-NMR  spectroscopy,  as  well  as  some  additional  signals 
that  were  not  characteristic  of  floridoside  (see  next  section). 
The  13C-NMR  spectrum  of  peak  2  corresponded  to  previ- 
ously published  data  for  floridoside  [cv-D-galactopyranosyl- 
( l-2)-glycerol]  (Karsten  et  al.,  1993).  Therefore,  the  isethio- 
nic  acid  and  floridoside  components  of  the  F-I  complex 
eluted  separately,  in  peak  1  and  peak  2,  respectively.  Peak 
1  induced  settlement  of  Holopneustes  purpurascens  larvae 
in  settlement  assays,  but  peak  2  did  not  (Fig.  2).  Four 
batches  of  peak  1  (25  jug  •  ml"1)  induced  80%-100%  set- 
tlement in  five  assays,  whereas  neither  of  two  batches  of 
peak  2  (51  jug-mi"')  induced  settlement  in  two  assays 
(representative  data  shown  in  Fig.  2).  These  data  suggested 
that  the  F-I  complex  is  not  a  settlement  cue  for  H.  purpura- 
scens and  that  peak  1  (which  lacked  rloridoside)  contained 
the  settlement  cue. 

Isethionic  acid  and  taurine  were  the  major  compounds  in 
peak  1.  as  determined  by  'H-  and  I3C-NMR  spectroscopy 


100-i 


c         75- 


50- 


25- 


treatment 

Figure  2.  The  settlement  (%)  of  larvae  of  Holopneustes  purpurascens 
after  1 8  h  incubation  with  fresh  Delisea  pulchra  (~  10  mg)  or  HPLC  peak 
fractions  of  the  polar  extract  of  the  alga.  Peak  1  (batch  A  or  B)  was  tested 
at  25  jig -ml"',  peak  2  was  tested  at  51  /ig-mP1.  and  a  floridoside- 
iselhionie  acid  complex  sample  ("F-I  complex")  from  Williamson  a  ul. 
i2ii()(ii  \\;is  tested  at  76  ng-ml"'.  Milli-Q  water  and  sterile  seawater 
(SSW)  were  included  as  the  nesiatne  controls  i/j  =  10). 


and  comparison  with  synthetic  samples.  When  isethionic 
acid  (1-25  jug-mi"1),  sodium  isethionate  (15-30 
jug-mF1),  and  taurine  (1-13  /xg-mP1)  were  tested  in 
settlement  assays  with  H.  purpurascens  larvae,  none  of 
these  compounds  induced  settlement  (data  not  shown).  Dif- 
ferent combinations  of  these  compounds  were  tested  to- 
gether (e.g.,  15  jug  •  ml"1  of  isethionic  acid  and  taurine)  in 
case  two  cues  were  required  for  settlement  of  H.  purpura- 
scens. There  was  no  settlement  in  the  combination  treat- 
ments (data  not  shown).  Following  these  results,  we  hypoth- 
esized that  one  or  more  trace  compounds  in  peak  1,  not  yet 
detected  by  NMR  analysis,  were  inducing  settlement.  To 
test  this,  a  larger  amount  of  peak  1  was  collected  and  a  much 
longer  (24-h)  13C-NMR  experiment  run  on  the  sample.  The 
I3C-NMR  spectrum  showed  about  20  additional  carbon 
signals  not  detected  previously  by  NMR  spectroscopy.  in- 
dicating that  additional  compounds  were  present  in  peak  1 
in  trace  amounts.  The  rinding  that  peak  1  induced  settlement 
of  larvae  of  H.  purpurascens  but  the  identified  major  com- 
ponents (isethionic  acid,  taurine)  in  peak  1  did  not  implied 
that  one  of  the  compounds  present  in  trace  amounts  was  the 
settlement  cue. 

Cation-exchange  fractions — settlement  assav.  The  settle- 
ment cue  could  not  be  isolated  as  a  pure  fraction  using 
HPLC,  so  the  polar  extract  of  D.  pulchra  was  fractionated 
using  CX  chromatography  (Fig.  IB).  Five  CX-fractions  (F) 
were  obtained  and  tested  in  settlement  assays;  only  F5 
induced  settlement  of  larvae  of  H.  purpurascens  (Fig.  3).  F5 
at  a  concentration  of  1.0  jug -ml"1  induced  100%  settle- 
ment in  larvae  after  1  h,  0.5  jug  •  mF '  induced  70%  settle- 
ment, and  0.1-0.25  jug -ml"'  did  not  induce  settlement. 
There  was  no  settlement  in  the  control  fraction  CF5  ( 1 .0 
jug  •  ml"1)  and  SSW  treatments  (Fig.  3). 

Identification  of  the  settlement  cue  for  Holopneustes 
purpurascens 

Nuclear  magnetic  resonance  spectroscopy.  The  'H-NMR 
(D,O)  spectrum  of  F5  showed  proton  signals  at  8  2.76  (2H, 
t,  J  7.0  Hz,  H2).  3.03  (2H,  t,  J  8.2  Hz,  HI).  6.86(1  H.  s  2H, 
imida/.ole  H),  and  7.57  (s.  1H,  imidazole  H).  The  I3C-NMR 
(D2O)  and  DEPT  spectra  of  F5  showed  carbon  signals  at  8 
25.9,  39.5  (CH:);  1 16.4,  136.5  (CH)  and  134.0  (quaternary 
C).  These  signals  supported  the  assignment  of  F5  as  hista- 
mine  (2-[  l//-imidazol-4-yl]-ethylamine,  MW  1  I  1.15).  The 
structure  of  F5  was  further  confirmed  by  a  high-field  two- 
dimensional  !H-15N  HMBC  NMR  experiment  in  which  the 
methylene  triplet  at  2.76  ppm  showed  two  three-bond  cor- 
relations to  the  ethylamine  NH^  group  and  the  imidazole 
nitrogen.  The  identity  of  F5  was  further  confirmed  by  a 
spiking  experiment.  All  F5  signals  increased  in  intensity 
and  no  additional  signals  were  detected,  confirming  the 
identity  of  F5  as  histamine. 


SETTLEMENT  INDUCTION  BY   HISTAMINH 


167 


100  -i 


c         75- 


50- 


8.         25- 


o      o      o      o      o      o      in 


p*     o 


treatment 

Figure  3.  The  settlement  (%)  of  larvae  of  Holopneustes  fiiirpiinisci'm, 
after  I  h  incubation  with  the  polar  extract  of  Delisea  pulchra  (PE)  and 
cation-exchange  fractions  (F)  of  the  PE.  The  different  test  concentrations  of 
each  treatment  are  shown  in  brackets  (/xg  •  mP1):  note  the  lower  concen- 
trations for  F5  and  the  procedural  control  (CF5).  Sterile  seawater  (SSW) 
was  used  as  the  negative  control  (n  =  10). 


Gas  chromatography—mass  spectrometry.  The  identity  of 
putative  histamine  (F5)  isolated  from  D.  pulchra  was  con- 
firmed using  GC-MS.  The  retention  times  (rt)  of  the  hep- 
tafluorobutyrlacyl  derivative  of  putative  histamine  (rt  = 
9.728  ±  0.0045.  mean  ±  SD.  /;  =  5)  and  synthetic  hista- 
mine (rt  =  9.732  ±  0.0045.  mean  ±  SD.  n  =  5)  were  nearly 
identical,  suggesting  that  they  were  the  same  compound. 
The  electron-impact  ion  spectra  of  both  derivatized  com- 
pounds displayed  the  same  major  fragment  ions  (m/- — 54. 
69.  81,  94.  138.  169.  226.  307.  349)  and  overall  fragmen- 
tation pattern,  confirming  that  they  were  the  same  com- 
pound. The  electron-impact  ion  spectra  for  derivatized  his- 
tamine matched  that  reported  in  the  literature  (Barancin  ct 
a!..  1998). 

Matrix-assisted   laser   desorptlon/ionization—time-of-flight 

mass  spectnunetry.  The  elemental  formula  of  putative  his- 
tamine isolated  from  D.  pulchra  was  confirmed  by  accurate 
mass  measurements  using  MALDI-TOF  MS.  The  measured 
accurate  mass  of  the  putative  protonated  histamine  molec- 
ular ion  [M  +  H]  +  was  112.08878  ±  0.0026  (n  =  10,  mean 
±  SD),  and  the  measured  mass  for  synthetic  histamine  was 
1 12.08853  ±  0.0025  (n  =  10.  mean  ±  SD).  The  measured 
masses  of  the  two  samples  were  different  by  only  2.2  ppm. 
These  values  were  different  from  the  calculated  monoiso- 
topic  mass  for  protonated  histamine  (112.08692 — elemen- 
tal formula  C_SHH)N3)  by  only  15  ppm  for  synthetic  proton- 
ated histamine  and  17  ppm  for  putative  protonated 
histamine.  This  is  most  likely  due  to  measurement  bias 
introduced  by  the  very  different  chemical  properties  of 
histamine,  glycine,  and  creatinine  (the  internal  calibrants). 
An  elemental  calculator  was  used  to  generate  all  possible 


elemental  formulas  with  a  mass  of  approximately 
112.08878.  The  nearest  other  candidate  was  C6H,0NO  at 
1 12.07569  with  a  difference  of  1 17  ppm  from  the  measured 
mass  of  putative  protonated  histamine.  This  difference  was 
much  higher  than  17  ppm  (difference  of  measured  mass  for 
putative  histamine  relative  to  calculated  mass  for  C5H]0N3), 
confirming  that  the  putative  protonated  histamine  had  the 
elemental  formula  of  C5H|,,NV 

The  response  of  Holopneustes  purpurascens  lamie  to 
natural  and  synthetic  histamine 

Natural  histamine  isolated  from  D.  pulchra  by  using  CX 
chromatography.  synthetic  histamine,  and  synthetic  hista- 
mine eluted  from  CX  resin  all  resulted  in  very  similar 
responses  in  larvae  when  assayed  concurrently  (Fig.  4). 
More  than  80%  of  the  H.  purpurascens  larvae  settled  within 
an  hour  of  incubation  in  4.5  and  9  \iM  natural  and  synthetic 
histamine.  The  lowest  test  concentration  of  synthetic  hista- 
mine that  consistently  induced  rapid  settlement  of  all  larvae 
was  4.5  \jM  (in  10  separate  assays).  Larvae  exhibited  a 
more  variable  response  to  0.9  and  2.3  juA/  histamine,  both 
within  and  across  different  batches  (Fig.  4).  Up  to  80%  of 
larvae  settled  in  response  to  0.09-0.45  juM  synthetic  hista- 
mine. but  only  after  long  incubation  times  (up  to  96  h)  or  as 
larval  age  increased  to  13-21  days  (data  not  shown). 

Response  of  lan'ae  to  Delisea  pulchra  after  antibacterial 
treatments 

In  response  to  D.  pulchra  that  had  received  antibacterial 
treatments,  larvae  of  H.  purpurascens  settled  at  levels 
equivalent  to  (or  greater  than)  those  in  response  to  control 


0) 
_0) 

e 
o 


100  -i 

-i 

-i 

i        n 

-    - 

n 

75- 

50-  1 

25- 

i|. 

, 

~ 

j 

-^ 
O 

~^      ™ 
LU              O>     CO 

in 

-*  i 

o         c 

D  CO  U 

1           ^        T 

t     O             O)     CO 

™       I       1 

no         > 

^-         o   cvi   *»   ci         ooi^oi         ocvi^oi         (/) 

(/> 

Nat  (u/W)             Syn  (u/M)          Syn-CX  (n/W) 

treatment 

Figure  4.  The  settlement  (%}  of  larvae  of  Holopneustes  purpurascens 
after  1  h  incubation  with  fresh  Delisea  pulchra  (~  10  mg).  its  polar  extract 
(50  /ig-ml"1)  and  0.9-9.0  /j,Af  of  natural  histamine  isolated  from  D. 
pulchra  (Nat),  synthetic  histamine  (Syn).  or  synthetic  histamine  eluted 
from  cation-exchange  resin  (Syn-CX).  Sterile  seawater  (SSW)  was  used  as 
a  negative  control.  Data  from  two  experiments  using  different  batches  of 
larvae  are  shown  (black  and  white  bars).  *  Indicates  no  settlement  in 
treatment  (n  =  12). 


168 


R.  L.  SWANSON  ET  AL. 


Table  1 

The  histamine  content  of  six  algal  species  was  significantly  different 
(ANOVA.  F,.M  =  9.903.  P  =  0.0006) 


Species 


Histamine  (/ig  •  g    '  [ww]) 
mean  ±  SE.  n  —  5 


Delisea  pulchra 
Ecklonia  radiata 
Sargassitm  vestintin 
Homeostrichus  olsenii 
Coral/ina  officinalis 
Amplnroa  anceps 


11.82  ±  6.56 
1.28  ±  1.01* 
0.35  ±  0.32* 
0.25  ±  0.09* 

nd 

nd 


D.  pulchra  treatments  (Fig.  5).  SSW  did  not  induce  settle- 
ment. 

Quantitative  analvsis  of  histamine  content  in  algae 

The  histamine  content  of  six  algal  species  was  deter- 
mined by  GC-MS  (Table  1).  D.  pulchra,  the  alga  on  which 
new  recruits  of  H.  purpurascens  are  found  (Williamson  et 
ai.  2000),  had  the  highest  histamine  content  of  all  algae 
surveyed.  Histamine  was  not  detected  in  any  samples  of 
Amphiroa  anceps  or  Corallina  officinalis.  The  histamine 
content  of  D.  pulchra.  Ecklonia  radiata.  Homeostrichus 
olsenii,  and  Sargassum  vestitum  differed  significantly  from 
each  other  (F3 16  =  9.903,  P  =  0.0006).  Pairwise  compar- 
isons showed  that  the  histamine  content  of  D.  pulchra 
(11.82  ±  6.56  /itg-g"1)  was  significantly  higher  than  the 
histamine  content  of  E.  radiata  (1.28  ±  1.01  jug  •  g"1,  P  = 
0.0092),  S.  vestitum  (0.35  ±  0.32  jug-g"',  P  =  0.0016), 
and  H.  olsenii  (0.25  ±  0.09  /u.g-g~',  P  =  0.0015).  The 
amount  of  histamine  in  different  D.  pulchra  plants  was 
highly  variable,  ranging  from  1.88-34.22  fig-g"1  wet 
weight  of  algal  tissue.  The  variability  in  histamine  levels  of 

E.  radiata  was  also  high,  with  no  histamine  detected  in  two 

samples,  yet  another  contained  4.73  jug  •  g"'  wet  weight  of        Reanalysis  of  samples  from  Williamson  et  al.  (2000) 


*  Indicates  species  in  which  histamine  content  differs  significantly  from 
D.  pulchra  (pairwise  comparisons,  P  <  0.0092);  nd,  not  detected;  ww,  wet 
weight. 


of  the  S.  vestitum  samples  analyzed,  but  another  contained 
1.48  ju.g-g~'  wet  weight  of  algal  tissue.  The  H.  olsenii 
plants  analyzed  showed  consistently  low  levels  of  hista- 
mine, ranging  from  0.05-0.46  /ng-g"1  (wet  weight)  of 

algal  tissue. 


algal  tissue.  Likewise,  histamine  was  not  detected  in  three 


100  n 


E         75- 


r         50- 


25- 


QO-£¥¥££S 

CCSlLaTjSQ. 


Q.  '= 

o          s 


treatment 


Figure  5.  The  settlement  C7t )  of  larvae  of  HolopneuMc-,  purpiinm.  I'm 
after  20  h  incubation  with  Delixea  pulchra  subjected  to  antibacterial 
treatments.  All  antibacterial  treatments  included  a  5-min  soak  in  a  10'i 
betadme  solution,  followed  by  3  rinses  in  sterile  seawater  (SSW)  and  a 
24-h  treatment  in  either  SSW  ("soak");  SSW  containing  streptomycin  (20 
mg-  1  ').  penicillin  G  ( 10  mg  •  1~  ')  and  kanamycin  I  10  mg  •  1~',  "SPK"); 
or  SSW  containing  ciprotloxacm  (10  mg'l  ',  "ciprorloxacin").  Other 
treatments  involved  wiping  pieces  of  D.  pulchra  across  an  agar  plate 
gently,  to  physically  remove  bacteria,  before  and  after  a  24-h  soak  in  SSW 
("wipe"),  SSW  containing  SPK  ("wipe  +  SPK").  or  SSW  containing 
ciprorloxacin  ( 10  mg  •  1~ '.  "wipe  +  cipro").  D.  pnlt  hid  soaked  in  SSW  for 
24  h  (without  betadine  soak)  uas  the  procedural  control  ("soak  control"), 
fresh  D.  pulchra  was  used  as  a  posttiu-  control  rtiesh  control"),  and  SSW 
was  used  as  a  negative  control  (n  =  15). 


Several  samples  remaining  from  the  previous  study  were 
analyzed  by  GC-MS  for  the  presence  of  histamine.  Hista- 
mine was  detected  in  F-I  complex  fractions  from  D.  pulchra 
(1.5-46  ^ig  •  mg  [sample]"')  in  a  synthetic  F-I  complex 
sample  (0.35  jug  •  mg  [sample]"'),  and  in  a  batch  of  flori- 
doside  used  to  make  the  synthetic  complexes  (0.45  jug  •  mg 
[sample]"'). 


Discussion 

Habitat-specific  cues  play  an  important  role  in  the  settle- 
ment of  many  benthic  marine  invertebrates  (Pawlik,  1992; 
Hadfield  and  Paul,  2001).  Larvae  presumably  maximize 
their  chances  of  post-settlement  survival  by  responding  to 
habitat-specific  cues,  as  settlement  in  a  preferred  habitat 
should  provide  shelter  and  food  to  the  vulnerable  juvenile 
life-history  phase  (Gosselin  and  Qian,  1997).  Chemical  cues 
for  larval  settlement  are  derived  from  conspecifics  (Burke. 
1986),  host  organisms  (Williamson  et  ai.  2000).  prey  (Had- 
field and  Scheuer,  1985),  or  biotilms  (Wieczorek  and  Todd. 
1998);  they  include  a  diverse  range  of  compounds  from 
small  peptides  (Zimmer-Faust  and  Tamburri.  1994)  to  com- 
plex macromolecules  (Clare  and  Matsumura.  2000).  The 
complete  characterization  of  chemical  settlement  cues  has, 
however,  proved  difficult  because  of  the  low  endogenous  or 
environmental  levels  of  such  compounds  and  the  rapid 
dilution  of  water-soluble  cues.  Few  studies  have  definitively 
characterized  settlement  cues  (reviewed  by  Hadfield  and 
Paul.  2001;  Steinberg  et  al..  2001 ). 

Williamson  et  al.  (2000)  reported  on  one  such  putative 


SETTLEMENT  INDUCTION  BY  HISTAMINE 


169 


characterized  cue,  a  metabolite  complex  isolated  from  the 
red  algal  host  Delisea  pulchra  that  induced  settlement  in 
larvae  of  the  sea  urchin  Holopneustes  purpurascens.  At 
Bare  Island  (Sydney,  Australia).  H.  purpurascens  is  found 
primarily  on  two  algal  hosts,  D.  pulchra  and  Ecklonia 
radiata.  with  the  smallest  size  class  (test  diameter  s  5  mm) 
only  found  on  D.  pulchra.  Larvae  metamorphosed  in  re- 
sponse to  pieces  of  D.  pulchra  and  the  polar  extract,  but  not 
to  pieces  or  extracts  of  E.  radiata  (Williamson  et  til.,  2000). 
A  water-soluble  cue  was  implicated  when  seawater  col- 
lected near  D.  pulchra  plants  in  situ  also  induced  settlement 
of  larvae.  The  settlement  cue  in  D.  pulchra  was  isolated  and 
characterized  as  the  floridoside-isethionic  acid  (F-I)  com- 
plex (Williamson  et  ai,  2000). 

New  evidence  presented  in  this  paper  shows  that  hista- 
mine,  not  the  F-I  complex,  is  a  natural  inducer  of  settlement 
in  H.  purpurascens.  The  settlement  cue  was  isolated  from 
the  polar  extract  of  D.  pulchra  by  using  bioassay-guided 
fractionation  by  cation-exchange  chromatography.  The  iso- 
lated compound  at  0.5  jug  •  mP  '  induced  settlement  in 
80%- 100%  of  larvae  within  an  hour.  The  settlement  cue 
was  identified  as  histamine  using  NMR  spectroscopy.  and 
this  was  confirmed  by  GC-MS  and  MALDI-TOF  MS.  The 
response  of  larvae  to  synthetic  histamine  in  settlement  as- 
says mirrored  their  response  to  natural  histamine  isolated 
from  D.  pulchra.  D.  pulchra,  the  primary  plant  on  which 
new  recruits  of  H.  purpurascens  are  found,  had  the  highest 
average  histamine  content  (11.82  ±  6.56  /Ag-g~'  wet 
weight),  approximately  an  order  of  magnitude  higher  than 
other  algae  surveyed.  Seawater  collected  near  D.  pulchra 
plants  in  the  study  by  Williamson  et  al.  (2000)  induced 
rapid  settlement  of  larval  H.  purpurascens;  however,  those 
samples  were  used  completely  in  bioassays  and  are  there- 
fore not  available  for  histamine  analysis.  We  have  since 
detected  histamine  in  seawater  surrounding  D.  pulchra  and 
E.  radiata  (at  concentrations  ranging  from  20  to  70  nM),  but 
not  in  samples  2  m  away  from  the  macroalgae.  A  compre- 
hensive analysis  of  histamine  levels  in  seawater  will  be 
reported  in  another  manuscript.  Although  the  histamine 
concentrations  measured  in  seawater  do  not  induce  rapid 
settlement  in  larvae  that  have  just  attained  competence,  this 
concentration  can  induce  settlement  of  H.  purpurascens 
larvae  over  longer  time  periods  and  in  older  larvae  (data  not 
shown).  In  addition,  the  natural  habitat  may  contain  other 
settlement  cues  that  if  detected  in  conjunction  with  hista- 
mine. may  lower  the  threshold  concentration  of  histamine 
required  for  rapid  induction  of  settlement.  These  findings 
support  our  proposal  that  histamine  released  from  macroal- 
gae is  a  natural  settlement  cue  for  H.  purpurascens. 

Reanalysis  of  samples  from  the  study  by  Williamson  el 
al.  (2000)  provides  an  explanation  for  the  incorrect  conclu- 
sion that  the  F-I  complex  is  a  settlement  cue  for  larvae  of  H. 
purpurascens.  The  F-I  complex  was  isolated  from  the  polar 
extract  of  D.  pulchra,  using  reversed-phase  HPLC  and 


methanol  as  the  mobile  phase,  and  eluted  as  a  single  peak 
(Williamson  et  al..  2000).  I3C-NMR  spectroscopy  analysis 
of  this  peak  showed  only  l3C-signals  for  floridoside  and 
isethionic  acid  (Williamson  et  al.,  2000).  However,  trace 
amounts  of  histamine  were  also  present  but  not  detected, 
because  their  levels  were  below  the  limit  of  detection  for 
I3C-NMR  spectroscopy.  Histamine  elutes  in  the  first  peak 
from  reversed-phase  (C18)  columns  regardless  of  the  mo- 
bile phase,  so  any  histamine  in  the  polar  extracts  of  D. 
pulchra  used  by  Williamson  et  al.  (2000)  would  have  co- 
eluted  with  the  F-I  complex  fraction.  Consequently,  the  "F-I 
complex"  samples  contained  histamine,  detected  here  using 
GC-MS,  and  induced  settlement  of  H.  purpurascens  larvae. 
Although  a  synthetic  F-I  complex  induced  rapid  settlement 
in  H.  purpurascens  larvae  in  the  previous  study  (William- 
son et  al.,  2000),  not  all  batches  induced  settlement  (R.  de 
Nys.  pers.  obs.).  The  synthetic  F-I  complexes  were  made 
using  natural  floridoside  isolated  from  D.  pulchra  and  syn- 
thetic isethionic  acid.  The  floridoside  used  to  make  the 
synthetic  F-I  complex  was  contaminated  by  histamine  and 
thus  induced  settlement.  Confirming  this,  histamine  was 
detected  by  GC-MS  in  a  floridoside  sample  (used  for  prep- 
aration of  the  synthetic  complex)  and  a  synthetic  F-I  com- 
plex sample  prepared  by  Williamson  et  al.  (2000).  In  sum- 
mary, histamine  was  present  in  trace  amounts  in  the  "F-I 
complex"  samples  that  induced  settlement  of  larval  H.  pur- 
purascens in  the  previous  study,  and  histamine  was  the 
inductive  compound  in  the  "F-I  complex"  samples. 

The  finding  that  histamine  is  a  natural  settlement  cue  for 
H.  purpurascens  is  of  considerable  interest  in  the  context  of 
linking  ecological  patterns  with  physiological  mechanisms. 
Histamine  is  a  biogenic  amine  produced  by  the  decarbox- 
ylation  of  the  amino  acid  histidine.  It  is  one  of  five  primary 
biogenic  amines  in  invertebrates,  along  with  serotonin,  oc- 
topamine,  dopamine,  and  tyramine  (Blenau  and  Baumann, 
2001).  Biogenic  amines,  all  decarboxylation  products  of 
amino  acids,  play  critical  roles  in  initiating  and  controlling 
behavior,  and  in  the  physiology  of  invertebrates,  by  acting 
as  classical  neurotransmitters,  neuromodulators,  and  neuro- 
hormones  (Katz,  1995:  Beltz,  1999).  For  example,  dopa- 
mine activates  hunting  behavior  in  an  opisthobranch  mol- 
lusc (Norekyan  and  Satterlie,  1993),  and  serotonin  controls 
aggressive  behavior  in  crustaceans  (Huber  et  al..  1997).  The 
photoreceptors  in  all  classes  of  arthropod  eyes  are  histamin- 
ergic;  that  is,  they  synthesize  histamine  and  use  it  as  their 
neurotransmitter  (Stuart.  1999).  Also,  histamine  is  thought 
to  be  an  inhibitory  neurotransmitter  in  the  stomatogastric 
and  cardiac  ganglia  and  the  sensory  system  of  lobsters 
(Claiborne  and  Selverston,  1984;  Bayer  et  al.,  1989; 
Hashemzadeh-Gargari  and  Freschi,  1992).  Importantly,  in 
the  context  of  this  study,  histamine  directly  gates  a  chloride 
channel  in  the  receptor  cells  of  the  olfactory  pathway  of 
lobsters  (McClintock  and  Ache,  1989).  Fast  neurotransmit- 
ters directly  gate  ion  channels,  which  leads  to  fast  behav- 


170 


R.   L    SWANSON  ET  AL. 


ioral  and  physiological  outcomes.  We  have  observed  that 
the  settlement  response  of  H.  purpurascens  to  histamine  is 
rapid,  with  complete  metamorphosis  within  half  an  hour. 
This  fast  response  is  consistent  with  the  notion  that  the 
larvae  of  H.  purpurascens  have  specific  receptors  that  bind 
histamine  and  act  directly  on  ion  channels,  leading  to  rapid 
settlement. 

Neurotransmitters,  or  their  precursors,  have  been  sug- 
gested to  mimic  the  function  of  natural  settlement  cues 
(Morse,  1985;  Bonar  et  ai,  1990).  The  best-known  example 
is  the  gamma-aminobutyric  acid  (GABA)-mimetic  peptide 
(or  peptides).  present  on  the  surface  of  crustose  coralline 
algae,  which  Morse  and  colleagues  proposed  as  a  settlement 
cue  for  abalone  (Morse  et  a!.,  1979,  1984).  Another  exam- 
ple comes  from  oyster  larvae,  where  L-3,  4-dihydroxyphe- 
nylalanine  (L-DOPA)  induced  stereotypical  searching  be- 
havior, while  epinephrine  and  norepinephrine  induced 
metamorphosis  (Coon  et  ai,  1985).  Endogenous  levels  of 
neurotransmitters,  and  their  precursors,  also  appear  to  mod- 
ulate the  behavioral  and  physiological  processes  accompa- 
nying settlement  (Coon  and  Bonar,  1987;  Pires  et  ai.  2000). 
Our  findings  show  that  a  naturally  produced  neurotransmit- 
ter  is  in  fact  a  settlement  cue  for  larvae,  a  phenomenon  that 
may  be  widespread  in  the  marine  environment. 

The  finding  that  histamine,  rather  than  the  F-I  complex,  is 
a  settlement  cue  for  H.  purpurascens  potentially  compli- 
cates the  previous  interpretations  of  the  relationship  be- 
tween settlement  cues  and  the  demography  of  this  sea 
urchin  (Williamson  et  ai,  2000,  2004).  Histamine,  a  simple 
breakdown  product  of  the  amino  acid  histidine,  may  be 
broadly  distributed  across  the  natural  habitat  of  H.  purpura- 
scens; for  example,  in  algal  and  animal  tissue,  and  in 
bacterial  communities  living  on  their  surfaces.  For  hista- 
mine to  be  an  ecologically  relevant  settlement  cue,  its  dis- 
tribution in  the  natural  habitat  must  relate  to  the  recruitment 
patterns  of  H.  purpurascens.  This  was  in  fact  the  case.  The 
histamine  content  of  the  algae  surveyed  was  consistent  with 
the  recruitment  patterns  of  the  organism,  with  much  higher 
levels  of  histamine  measured  in  D.  pulchra,  the  primary 
plant  on  which  we  find  new  recruits. 

I),  pulchra  had  the  highest  average  histamine  content 
(11.82  ±  6.56  ju.g-g~'  wet  weight),  ranging  from  1.88  to 
34.22  ng.g  [  wet  weight.  Similarly,  levels  of  histamine 
varied  for  E.  radiata,  with  concentrations  ranging  from  0  to 
4.73  jug.g  '  wet  weight.  Since  only  subsections  of  plants 
(not  whole  plants)  were  extracted,  these  results  may  reflect 
within-planl  variation,  within-species  variation,  or  both.  Fu- 
ture histamine  analyses  will  extract  whole  plants,  as  well  as 
specific  regions  of  thalli,  to  directly  test  these  possibilities. 
The  low  (or  absent)  levels  of  histamine  typically  measured 
in  E.  nuliiitci  samples  may  explain  why  pieces  and  extracts 
of  E.  radiata  did  not  induce  settlement  in  the  study  by 
Williamson  et  ai  (2000).  However,  we  have  observed  that 
some  pieces  of  E.  radiata  do  induce  settlement  of  H.  pur- 


purascens, which  is  consistent  with  the  variation  we  mea- 
sured in  levels  of  histamine  in  the  alga.  Given  this,  and  the 
large  biomass  of  E.  radiata  kelp  beds  in  the  natural  habitat 
of  H.  purpurascens.  E.  radiata  may  contribute  to  environ- 
mental levels  of  histamine,  inducing  the  settlement  of  larvae 
in  this  habitat.  Histamine  was  not  detected  in  the  turfing 
coralline  algae  Corallina  officinalis  and  Ampliiroa  anceps, 
although  they  induce  settlement  of  larvae  of  H.  purpura- 
scens (Williamson  et  ai,  2000;  R.  Swanson,  pers.  obs.)  and 
provide  a  habitat  for  new  recruits  (R.  Swanson,  pers.  obs.). 
Larger  samples  of  A.  anceps  (up  to  180  g  wet  weight)  were 
extracted  and  no  histamine  was  detected.  The  coralline 
algae  may  produce  a  different  settlement  cue  for  H.  pur- 
purascens, or  histamine  may  only  be  produced  and  released 
in  situ — for  example,  by  surface-associated  bacteria. 

Finally,  the  two  possible  sources  of  histamine  in  D. 
pulchra  are  the  host  alga  or  the  surface-associated  bacterial 
community  (or  both).  D.  pulchra  treated  with  various  anti- 
bacterial agents  still  induced  high  levels  of  settlement  in  H. 
purpurascens,  suggesting  that  the  host  alga  produces  the 
histamine.  A  bacterial  source  of  histamine  is,  however, 
possible,  as  a  known  histamine-producing  bacterium.  Plw- 
tobacterium  phosphoreum  (Fujii  et  ai.  1997)  is  a  constitu- 
ent of  the  microbial  community  on  local  algal  species  (M. 
Watson,  UNSW  Australia;  pers.  comm.).  If  histamine-pro- 
ducing bacteria  are  colonizing  algal  surfaces  within  the 
habitat,  then  it  is  possible  that  they  produce  and  release 
histamine  to  seawater,  which  could  lead  to  the  induction  of 
settlement  of  H.  purpurascens. 

Conclusion 

Many  larval  species  have  the  ability  to  respond  to  low- 
molecular-weight,  water-soluble  settlement  cues  (Hadfield 
and  Scheuer.  1985;  Zimmer-Faust  and  Tamburri,  1994; 
Boettcher  and  Targett.  1996;  Lambert  et  ai.  1997;  Fleck 
and  Fitt.  1999).  This  paper  has  presented  evidence  that 
histamine  is  a  natural  settlement  cue  for  the  sea  urchin.  H. 
purpurascens,  correcting  the  previous  study  of  Williamson 
et  ai  (2000).  Histamine  at  4.5  juA/  induces  settlement  (meta- 
morphosis) in  807r-100%  of//,  purpurascens  larvae  within 
half  an  hour,  fulfilling  two  essential  criteria  for  an  effective 
water-soluble  settlement  cue:  ( 1 )  larvae  must  perceive  low 
concentrations  of  inducer.  and  (2)  larvae  must  respond 
rapidly  to  the  inducer.  D.  pulchra  had  the  highest  histamine 
content  of  all  the  species  surveyed,  consistent  with  the 
recruitment  patterns  of  H.  purpurascens.  In  a  preliminary 
analysis,  we  detected  histamine  in  seawater  near  D.  pulchra 
and  E.  radiata  plants,  hut  not  in  seawater  collected  2  m 
away,  supporting  our  proposal  that  histamine  leaches  from 
algae  that  produce  this  settlement  cue.  This  hypothesis  is 
consistent  with  the  finding  of  Williamson  et  ai  (2000)  that 
seawater  collected  very  near  to  D.  pulchra  induced  settle- 
ment in  larvae  of  H.  purpurascens.  We  have  shown  that 


SETTLEMENT  INDUCTION   BY   HISTAMINE 


171 


histamine,  an  invertebrate  neurotransmitter,  is  also  a  natural 
settlement  cue  for  larvae  of  H.  purpurasccns,  linking  the 
physiology  and  ecology  of  the  organism. 

Acknowledgments 

This  research  was  supported  by  an  Australian  Postgrad- 
uate Award  to  RLS,  an  ARC  Research  Fellowship  to  RdN, 
an  ARC  Large  Grant  to  PDS  and  RdN.  and  the  Center  for 
Marine  Biofouling  and  Bio-Innovation.  We  thank  the  Bio- 
analytical  Mass  Spectrometry  Facility  at  UNSW  for  access 
to  equipment,  and  Dr.  Dustin  Marshall  for  advice  on  statis- 
tical analysis.  We  especially  thank  Dr.  Tim  Charlton  for  his 
invaluable  assistance  with  analytical  methods. 

Literature  Cited 

Aguirre-Lipperheide,  ,\1..  and  L.  V.  Evans.  1993.  A  sterilization  pro- 
tocol for  the  Dictyotales  (Phaeophyceae).  J.  Pin-col.  29:  243-251. 

Barancin.  C.  E.,  J.  C.  Smoot,  R.H.  Kindla.v,  and  L.  A.  Actis.  1998. 
Plasmid-mediated  histamine  biosynthesis  in  the  bacterial  tish  pathogen 
Vibrio  angiti/lanim.  PUismiil  39:  235-244. 

Barrow.  K.  D.,  U.  Karsten,  and  R.  J.  King.  1993.  Isethionic  acid  from 
the  marine  red  alga  Ceramium  flaccidum.  Phytochemislry  35:  1429- 
1430. 

Bayer,  T.  A.,  T.  S.  McClintock,  U.  Grunert,  and  B.  W.  Ache.  1989. 
Histamine-induced  modulation  of  olfactory  receptor  neurons  in  two 
species  of  lobster,  Panulirus  argnx  and  Homanix  amcricannx.  J.  Exp. 
Biol.  145:  133-146. 

Beltz,  B.  S.  1999.  Distribution  and  functional  anatomy  of  amine-contain- 
ing  neurons  in  decapod  crustaceans.  Microsc.  Res.  Tech.  44:  105-120. 

Berntsson,  K.  M.,  P.  R.  Jonsson,  M.  Lejhall.  and  P.  Gatenholm.  20(10. 
Analysis  of  behavioral  rejection  of  micro-textured  surfaces  and  impli- 
cations for  recruitment  by  the  barnacle  Balanux  improvixiix.  J.  Exp. 
Mar.  Biol  EC,,/.  251:  59-83. 

Blenau.  W.,  and  A.  Baumann.  2001.  Molecular  and  pharmacological 
properties  of  insect  biogenic  amine  receptors:  lessons  from  Drosophilu 
melangoster  and  Apis  melliferu.  Arch.  Insect  Biochem.  Phvsiol.  48: 
13-38. 

Boettcher,  A.  A.,  and  N.  M.  Target!.  1996.  Induction  of  metamorphosis 
in  queen  conch,  Strombus  gigas  Linnaeus,  larvae  by  cues  associated 
with  red  algae  from  their  nursery  grounds.  J.  Exp.  Mar.  Biol.  Ecol.  196: 
29-52. 

Bonar,  D.  B..  S.  L.  Coon.  M.  \Valch,  R.  M.  Weiner,  and  W.  Fitt.  1990. 
Control  of  oyster  settlement  and  metamorphosis  by  endogenous  and 
exogenous  chemical  cues.  Bull.  Mar.  Sci.  46:  484-498. 

Bucknall,  M.,  K.  Y.  C.  Yung,  and  M.  W.  Duncan.  2002.  Practical 
quantitative  biomedical  applications  of  MALDI-TOF  mass  spectrom- 
etry.  J.  Am.  Soc.  Mass  Spectrum.  13:  1015-1027. 

Burke,  R.  D.  1984.  Pheromonal  control  of  metamorphosis  in  the  Pacific 
sand  dollar.  Denilraster  excentriciix.  Science  225:  440-441. 

Burke,  R.  I).  1986.  Pheromones  and  the  gregarious  settlement  of  marine 
invertebrate  larvae.  Bull.  Mar.  Sci.  39:  323-331. 

Claiborne,  B.  J.,  and  A.  I.  Selverston.  1984.  Histamine  as  a  neurotrans- 
mitter in  the  stomatogastric  nervous  system  of  the  spiny  lobster.  J.  Neu- 
rosci.  4:  708-721. 

Clare,  A.  S.,  and  K.  Matsumura.  2000.  Nature  and  perception  of 
barnacle  settlement  pheromones.  Biofoiiling  15:  57-71. 

Coon,  S.  L.,  and  D.  B.  Bonar.  1987.  Pharmacological  evidence  that 
alpha- 1  adrenoceptors  mediate  metamorphosis  of  the  Pacific  oyster 
Crassostmi  gigas.  Neiiroscience  23:  1 169-1 174. 

Coon,  S.L.,  D.  B.  Bonar,  and   R.   M.   Weiner.   1985.     Induction  of 


settlement  and  metamorphosis  of  the  Pacific  oyster  Crasuixtrea  gigax 
(Thunberg)  by  i.-DOPA  and  catecholamines.  J.  Exp.  Mar.  Biol.  /•.«>/. 
94:  211-221. 

Fleck,  J.,  and  W.  K.  Fit!.  1999.  Degrading  mangrove  leaves  of  Rlu;o- 
I'hora  mangle  Linne  provide  a  natural  cue  for  settlement  and  metamor- 
phosis of  the  upside  down  jellyfish  Cuxxitipea  \amacliana  Bigelow.  J. 
Exp.  Mar.  Biol.  Ecol.  234:  83-94. 

Fujii,  T.,  A.  Hiraishi,  T.  Kohayashi.  R.  Yoguchi,  and  M.  Okimimi. 
1997.  Identification  of  the  psychrophilic  histamine-producing  marine 
bacteria  previously  referred  to  as  the  N-group  bacteria.  Fish,  Sci.  63(5): 
807-810. 

Gibson.  G.  D.,  and  F.-S.  Chia.  1994.  A  metamorphic  inducer  in  the 
opisthobranch  Hatninaca  callidegenita:  partial  purification  and  biolog- 
ical activity.  Bint.  Hull.  187:  133-142. 

Gosselin,  L.  A.,  and  P.  Y.  Qian.  1997.  Can  bacterivory  alone  sustain 
larval  development  in  the  polychaete  Hydriodes  elegans  and  the  bar- 
nacle Baliunix  anipliitritel  Mar.  Ecol.  Prog.  Ser.  161:  93-101. 

Hadfield.  M.  G..  and  V.  J.  Paul.  2001.  Natural  chemical  cues  tor 
settlement  and  metamorphosis  of  marine  invertebrate  larvae.  Pp.  431- 
461  in  Marine  Chemical  Ecology.  }.  B.  McClintock  and  B.  J.  Baker, 
cds.  CRC  Press,  Boca  Raton,  FL. 

I  hicllh  Id.  M.  G.,  and  J.  T.  Pennington.  1990.  Nature  of  the  metamor- 
phic signal  and  its  internal  iransduction  in  larvae  of  the  nudihranch 
Pht-xtilla  siboKiu:  Bull.  Mar.  Sci.  46:  455-464. 

Hadh'eld,  M.  G.,  and  D.  Scheuer.  1985.  Evidence  for  a  soluble  meta- 
morphic inducer  in  Phestilla  sibogae:  ecological,  chemical  and  biolog- 
ical data.  Bull.  Mar.  Sci.  37:  556-566. 

Harvey,  M.,  and  E.  Bourget.  1997.  Recruitment  of  marine  invertebrates 
onto  arborescent  epibenthic  structures:  active  and  passive  processes 
acting  at  different  spatial  scales.  Mar.  Ecol.  Prog.  Ser.  153:  203-215. 

Hashemzadeh-Gargari,  R.  M.,  and  J.  E.  Freschi.  1992.  Histamine 
activates  a  chloride  conductance  in  motor  neurons  of  the  lobster  cardiac 
ganglion.  J.  Neiirophvsiol.  68:  9-15. 

Huber,  R.,  K.  Smith,  A.  Delago,  K.  Isaksson.  and  E.  A.  Kravitz.  1997. 
Serotonin  and  aggressive  motivation  in  crustaceans:  altering  the  deci- 
sion to  retreat.  Proc.  Nat/.  Acini.  Sci.  LISA  94:  5939-5942. 

Johnson,  C.  R.,  and  I).  C.  Sutton.  1994.  Bacteria  on  the  surface  of 
crustose  coralline  algae  induce  metamorphosis  of  the  crown-of-thorns 
starfish  Acantluixter  planci.  Mar.  Biol.  120:  305-310. 

Karsten,  U..  K.  D.  Barrow,  and  R.  J.  King.  1993.  Flondoside.  1 
isofloridoside.  and  D-isofloridoside  in  the  red  alga  Porplivra  colninhina. 
Plant  Plnsiol.  Biochem.  103:  485-491. 

Kato,  T..  A.  S.  Kumanireng,  I.  Ichinose.  Y.  Kitahara,  Y.  Kakinuma.  M. 
Nishihira,  and  M.  Kato.  1975.  Active  components  of  Siirguxxiim 
tortile  effecting  the  settlement  of  swimming  larvae  of  Coryne  iichiclai. 
Experientia  31:  433-434. 

Katz.  P.  S.  1995.  Intrinsic  and  extrinsic  neuromodulation  of  motor 
circuits.  Curr.  Opiii.  Neurohiol.  5:  799-808. 

Keough,  M.  J.,  and  B.  J.  Downes.  1982.  Recruitment  of  marine  inver- 
tebrates: the  role  of  active  larval  choices  and  early  motility.  Oecologia 
54:  348-352. 

Krug,  P.  J.,  and  A.  E.  Manzi.  1999.  Waterborne  and  surface-associated 
carbohydrates  as  settlement  cues  for  larvae  of  the  specialist  marine 
herbivore  Akleria  moilexta.  Biol.  Bull.  197:  94-103. 

Lambert,  \V.  J..  C.  D.  Todd.  and  J.  D.  Hardege.  1997.  Partial  char- 
acterization and  biological  activity  of  a  metamorphic  inducer  of  the 
dorid  nudibranch  AJalaria  proxima  (Gastropoda:  Nudihranchia).  In- 
vertebr.  Biol.  116:  71-81. 

Maida,  M.,  J.  C.  Coll,  and  P.  W.  Sanimami.  1994.  Shedding  new  light 
on  scleractinian  coral  recruitment.  J.  Exp.  Mar.  Biol.  Ecol.  180:  189- 
202. 

McClintock,  T.  S.,  and  B.  W.  Ache.  1989.  Histamine  directly  gates  a 
chloride  channel  in  lobster  olfactory  receptor  neurons.  Pruc.  Nat/. 
AcaJ.  Sci.  USA  86:  8137-8141. 


172 


R.  L.  SWANSON  ET  AL. 


Morse,  A.  N.  C.,  and  D.  E.  Morse.  1996.  Flypapers  for  coral  and  other 
planktonic  larvae.  Bioscience  46(4):  254-262. 

Morse,  A.  N.  C.,  C.  A.  Froyd,  and  D.  E.  Morse.  1984.  Molecules  from 
cyanobacteria  and  red  algae  that  induce  larval  settlement  and  metamor- 
phosis in  the  mollusc  Haliotis  rufescens.  Mar.  Biol.  81:  293-298. 

Morse,  D.  E.  1985.  Neurotransmitter-mimetic  inducers  of  larval  settle- 
ment and  metamorphosis.  Bull.  Mar.  Sci.  37:  697-706. 

Morse,  D.  E.,  N.  Hooker.  H.  Duncan,  and  L.  Jensen.  1979.  Gamma- 
aminobutyric  acid,  a  neurotransmitter.  induces  planktonic  abalone  lar- 
vae to  settle  and  begin  metamorphosis.  Science  204:  407-410. 

Mullineaux.  L.  S.,  and  C.  A.  Butman.  1991.  Initial  contact,  exploration 
and  attachment  of  barnacle  (Balanus  amphitrite)  cyprids  settling  in 
flow.  Mar.  Biol.  110:  93-103. 

Norekyan,  T.  P.,  and  R.  Satterlie.  1993.  Neuronal  analysis  of  hunting 
behavior  of  the  pteropod  mollusc  Clione  limacina.  Neurosci.  Behav. 
Physiol.  23:  11-23. 

Pawlik.  J.  R.  1992.  Chemical  ecology  of  the  settlement  of  benthic 
marine  invertebrates.  Oceanogr.  Mar.  Biol.  Annu.  Rev.  30:  273-335. 

Pires,  A.,  R.  P.  Croll,  and  M.  G.  Hadfield.  2000.  Catecholamines 
modulate  metamorphosis  in  the  opisthobranch  gastropod  Phestilla  si- 
bogae.  Biol.  Bull.  198:  319-331. 

Raimondi,  P.  T.,  and  A.  N.  C.  Morse.  2000.  The  consequences  of 
complex  larval  behavior  in  a  coral.  Ecology  81:  3193-321 1. 

Smythe,  G.  A.,  O.  Braga,  B.  J.  Brew,  R.  S.  Grant,  G.  J.  Guillemin,  S.  J. 
Kerr,  and  D.  VV.  Walker.  2002.  Concurrent  quantification  of  quin- 
olic.  picolinic,  and  nicotinic  acids  using  electron-capture  negative-ion 
gas  chromatography-mass  spectrometry.  Anal.  Biochem.  301:  21-26. 

Steinberg,  P.  D.,  R.  de  Nys,  and  S.  Kjelleberg.  2001.  Chemical  medi- 
ation of  surface  colonization.  Pp.  335-387  in  Marine  Chemical  Ecol- 
ogy, J.  B.  McClmtock  and  B.  J.  Baker,  eds.  CRC  Press,  Boca  Raton. 
FL. 

Stuart,  A.  E.  1999.  From  fruit  flies  to  barnacles,  histamine  is  the  neu- 
rotransmitter of  arthropod  photoreceptors.  Neuron  22:  431-433. 

Tsukamoto,  S.,  H.  Kato,  H.  Hirota,  and  N.  Fusetani.  1994.  Narains: 
AW-dimethylguanidinium  styryl  sulfates,  metamorphosis  inducers  of 
ascidian  larvae  from  a  marine  sponge  Jaspis  sp.  Tetrahedron  Lett.  35: 
5873-5874. 


Tsukamoto.  S.,  H.  Kato,  H.  Hirota.  and  N.  Fusetani.  1995.  Pipecolate 
derivatives,  anthosamines  A  and  B.  inducers  of  larval  metamorphosis 
in  ascidians.  from  a  marine  sponge  Anthosigmella  off.  raromicrosc/era. 
Tetrahedron  51:  6687-6694. 

Tsukamoto,  S.,  H.  Kato,  H.  Hirota,  and  N.  Fusetani.  1999.  Lumi- 
chrome — a  larval  metamorphosis-inducing  substance  in  the  ascidian 
Halocynthia  roretzi.  Ear.  J.  Biochem.  264:  785-789. 

Underwood,  A.  J.,  and  M.  J.  Keough.  2000.  Supply-side  ecology:  the 
nature  and  consequences  of  variations  in  recruitment  of  intertidal 
organisms.  Pp.  183-200  in  Marine  Community  Ecology,  M.  D.  Bert- 
ness.  S.  D.  Gaines.  and  M.  E.  Hay.  eds.  Sinauer  Associates,  Sunder- 
land.  MA. 

Wieczorek,  S.  K.,  and  C.  D.  Todd.  1998.  Inhibition  and  facilitation  of 
settlement  of  epifaunal  marine  invertebrate  larvae  by  microbial  biofilm 
cues.  Biofouling  12:  81-118. 

Williamson,  J.  E.,  R.  de  Nys,  N.  Kumar,  D.  G.  Carson,  and  P.  D. 
Steinberg.  2000.  Induction  of  metamorphosis  in  the  sea  urchin  Ho- 
lopneustes  purpurascens  by  a  metabolite  complex  from  the  algal  host 
Delisea  pulchra.  Biol.  Bull.  198:  332-345. 

Williamson,  J.  E.,  D.  G.  Carson,  R.  de  Nys,  and  P.  D.  Steinberg.  2004. 
Demographic  consequences  of  an  ontogenetic  shift  by  a  sea  urchin  in 
response  to  host  plant  chemistry.  Ecology  85:  1355-1371. 

Wright,  J.  T..  and  P.  D.  Steinberg.  2001.  Effect  of  variable  recruitment 
and  post-recruitment  herbivory  on  local  abundance  of  a  marine  alga. 
Ecology  K:  2200-2215. 

Xue-wu,  L.,  and  M.  E.  Gordon.  1987.  Tissue  and  cell  culture  of  the 
New  Zealand  Pterocladia  and  Porphyra  species.  Hydrobiologia  151: 
147-154. 

Yvin,  J.  C.,  L.  Chevolet,  A.  M.  Chevolet-Maguer,  and  J.  C.  Cochard. 
1985.  First  isolation  of  jacarone  from  an  alga,  Delesseria  sanguinea: 
a  metamorphosis  inducer  of  Pecten  larvae.  J.  Nat.  Prod.  48:  814-816. 

Zimmer,  R.  K.,  and  C.  A.  Butman.  2000.  Chemical  signaling  processes 
in  the  marine  environment.  Biol.  Bull.  198:  168-187. 

Zimmer-Faust,  R.  K.,  and  M.  N.  Tamburri.  1994.  Chemical  identity 
and  ecological  implications  of  a  waterborne.  larval  settlement  cue. 
Limnol.  Oceanogr.  39:  1075-1087. 


Reference:  Bio/.  Bull.  206:  173-187.  (June  2004) 
©  2004  Marine  Biological  Laboratory 


Fitness  Consequences  of  Allorecognition-Mediated 
Agonistic  Interactions  in  the  Colonial  Hydroid 

Hydractinia  [GM]* 

DAVID  L.  FERRELL 
Department  of  Biological  Science.  Florida  State  University,  Tallahassee,  Florida  32306-1 100 


Abstract.  In  sessile  and  sedentary  organisms,  competition 
for  space  may  have  fitness  consequences  that  depend 
strongly  on  ecological  context.  Colonial  hydroids  in  the 
genus  H\dractinia  use  an  inducible  defense  when  encoun- 
tering conspecifics,  and  intraspecific  competition  is  com- 
mon in  natural  populations,  often  resulting  in  complete 
overgrowth  of  subordinate  competitors.  My  goal  in  this 
study  was  to  quantify  the  impacts  of  agonistic  interactions 
in  Hydractinia  [GM]  (an  undescribed  species  from  the  Gulf 
of  Mexico)  in  terms  of  three  primary  fitness  components: 
colony  survival,  growth  rate,  and  immature  gonozooid  pro- 
duction. The  results  demonstrate  that  the  fitness  conse- 
quences of  intraspecific  competition  depend  on  the  size  at 
which  competitive  encounters  are  initiated  and  the  growth 
form  (an  indicator  of  competitive  ability)  of  the  competi- 
tors. Moreover,  some  competing  colonies  consistently  pro- 
duced more  immature  gonozooids  than  the  controls  without 
competition,  and  they  exhibited  extremely  low  mortality 
even  after  90  days  of  growth.  These  results  have  several 
ramifications.  First,  agonistic  interactions  do  not  always 
proceed  to  competitive  elimination.  Second,  the  increase  in 
production  of  immature  gonozooids — an  investment  in  fu- 
ture reproduction — in  response  to  intraspecific  competition 
supports  the  hypothesis  that  indeterminately  growing  organ- 
isms increase  sexual  reproductive  effort  when  growth  be- 
comes limiting.  Lastly,  in  light  of  known  ontogenetic  vari- 
ation in  the  ability  of  Hydractinia  to  differentiate  among 


Received  20  August  2002;  accepted  2  April  2004. 

*  [GM]  is  the  designation  given  by  Cunningham  ct  al.  (19911  to  a 
species  of  Hydractinia  that  is  found  in  the  Gulf  of  Mexico  hut  has  not  been 
formally  described.  Reference:  C.  W.  Cunningham.  L.  W.  Buss,  and  C. 
Anderson.  1991.  Molecular  and  geological  evidence  of  shared  history 
between  hermit  crabs  and  the  symbiotic  genus  Hyilnu-liniti.  Evolution  45: 
1301-1316. 

E-mail:  ferrell@bio.fsu.edu 


genetically  related  colonies,  strongly  size-dependent  fitness 
consequences  are  consistent  with  an  adaptive,  kin-discrim- 
inating allorecognition  system. 

Introduction 

Competition  for  space  often  imposes  limitations  on  the 
fitness  of  sessile  and  sedentary  organisms  when  a  scarcity  of 
hard  substrata  limits  survival,  growth,  and  reproduction 
(Buss,  1986).  Much  effort  has  been  dedicated  to  discerning 
the  effects  of  spatial  competition  on  these  fitness  compo- 
nents (reviewed  in  Jackson,  1977,  1985:  Buss.  1986.  1990: 
Sebens,  1986).  Direct  competition  for  space  can  result  in 
overgrowth  (reviewed  in  Buss  and  Jackson,  1979)  in  both 
heterospecific  and  conspecific  interactions.  However,  com- 
petitive exclusion  through  overgrowth  (or  other  processes) 
is  not  inevitable;  competitors  may  be  restricted  spatially  but 
coexist,  even  on  densely  colonized  surfaces  (Francis,  1973; 
Purcell.  1977:  Karlson.  1980;  Yund  et  al.,  1987). 

Spatially  restricted  coexistence  ultimately  limits  the  size 
of  colonial  invertebrates  that  might  otherwise  exhibit  inde- 
terminate growth  (Harvell  and  Grosberg,  1988).  Because 
reproductive  potential  usually  increases  with  colony  size, 
size  limits  have  the  potential  to  impose  reproductive  costs. 
Consequently,  many  authors  (Abrahamson.  1975:  Hughes 
and  Cancino,  1985;  Harvell  and  Grosberg.  1988)  have  hy- 
pothesized that  indeterminately  growing  clonal  organisms 
should  maximize  fitness  by  increasing  sexual  allocation 
when  extrinsic  factors  limit  growth.  This  prediction  has 
been  supported  by  empirical  data  on  diverse  invertebrate 
taxa  (Hauenschild,  1954;  Braverman,  1974:  Yamaguchi, 
1975;  Stebbing.  1980:  Harvell  and  Grosberg,  1988). 

In  many  colonial  marine  invertebrates  (including 
sponges,  cnidarians,  bryozoans,  and  ascidians),  conspecific 
interactions  are  mediated  by  allorecognition  systems  that 


173 


174 


D.  L.  FERRELL 


restrict  somatic  fusion  to  self  or  close  kin,  thereby  limiting 
spatial  competition  and  spatially  restricted  coexistence  to 
unrelated  individuals  (Buss,  1987.  1990:  Grosberg.  1988). 
For  taxa  in  which  encounters  between  relatives  are  common 
(often  because  of  limited  dispersal  of  sexually  produced 
progeny),  allorecognition  may  serve  as  an  adaptive  mecha- 
nism of  kin  recognition  (Grosberg  and  Quinn.  1986;  Hart 
and  Grosberg,  1999).  If  intraspecific  competition  is  associ- 
ated with  extremely  high  costs,  such  as  the  energetic  cost  of 
agonistic  behavior  and  the  risk  of  injury  or  competitive 
exclusion  (Buss  el  ai,  1984),  then  intergenotypic  fusion 
may  be  favorable  despite  the  potentially  severe  fitness  costs 
associated  with  it  (Buss,  1982,  1987;  Rinkevich  and  Loya, 
1983;  Barki  et  al..  2002;  Rinkevich.  2002).  Conversely,  if 
low  costs  accompany  non-fusion,  then  fusion  may  be  too 
costly  an  alternative.  Thus,  the  fitness  consequences  of 
intraspecitic  competitive  encounters  provide  insight  into 
whether  the  evolution  of  allorecognition  systems  is  adap- 
tive. 

Colonial  hydroids  in  the  genus  Hydractinia  inhabit  shells 
occupied  by  hermit  crabs,  where  they  often  encounter  con- 
specifics  (Yund  et  ai,  1987;  Buss  and  Yund.  1988;  Yund 
and  Parker,  1989;  Hart  and  Grosberg,  1999;  Ferrell,  2004). 
A  genetically  coded  allorecognition  system  determines 
whether  contacting  colonies  will  fuse  (Grosberg  et  ai, 
1996:  Mokady  and  Buss,  1996)  or  attempt  to  overgrow  one 
another  (Ivker,  1972:  Buss  et  ai,  1984).  Here  I  present  the 
results  of  laboratory  experiments  demonstrating  that  the 
fitness  consequences  of  agonistic  interactions  between  col- 
onies of  the  undescribed  species  Hydractinia  [CM]  depend 
on  the  size  at  which  competitive  encounters  are  initiated  and 
the  growth  form  of  the  colonies  involved.  The  context- 
dependent  nature  of  competitive  outcomes  affects  the  pro- 
duction of  immature  reproductive  zooids — an  investment  in 
future  reproduction — and  permits  an  assessment  of  whether 
allorecognition  in  Hydractinia  is  adaptive. 

Materials  and  Methods 

Hydractinia  [GM],  study  species 

Cunningham  et  al.  ( 1991 )  constructed  a  phylogeny  of  the 
genus  Hydractinia  that  consists  of  two  distinct  clades.  One 
clade  includes  H.  symbiolongicarpus  and  H.  [GM],  which 
do  not  overlap  in  their  geographic  distribution.  H.  svmbi- 
olongicarpus  has  a  northwestern  Atlantic  distribution,  but 
H.  IGM]  is  found  only  in  the  Gulf  of  Mexico.  Mating 
experiments  reveal  nearly  complete  infertility  between  col- 
onies collected  in  the  Gull  and  the  northwestern  Atlantic, 
indicating  that  //.  [GMj  is  a  new.  undescribed  species  (pers. 
comm.,  C.W.  Cunningham.  Duke  University). 

Hydractinia  /GM /,  as  well  as  many  Atlantic  Hydractinia 
species  (Yund  a  ai,  1987;  Buss  and  Yund,  1988.  1989; 
Frank  et  ai,  2001 ).  encrusts  the  surface  of  gastropod  shells 
occupied  by  pagurid  hermit  crabs.  Colonies  are  gonocho- 


ristic  and  polymorphic,  possessing  specialized  reproductive 
polyps,  or  gonozooids,  on  which  the  gametes  are  produced. 
Sexual  reproduction  occurs  during  broadcast-spawning 
events  in  which  gametes  are  released  in  response  to  light 
cues  (Bunting,  1894;  Ballard,  1942;  Levitan  and  Grosberg, 
1993).  The  crawling  planula  larva  of  Hydractinia  attaches 
itself  to  a  gastropod  shell  inhabited  by  a  passing  hermit  crab 
(Yund  et  ai.  1987).  Metamorphosis  subsequently  occurs  on 
the  shell  surface.  When  two  or  more  colonies  recruit  to  the 
same  shell,  the  colonies  usually  grow  into  contact.  The 
resulting  competitive  interactions  occur  commonly  in  nature 
(\undetal.,  1987:  Buss  and  Yund.  1988:  Yund  and  Parker. 
1989;  Hart  and  Grosberg,  1999;  Ferrell.  2004). 

Allorecognition  and  agonistic  interactions  in  Hydractinia 

The  adaptive  significance  of  kin  fusion  to  the  allorecog- 
nition system  of  Hydractinia  is  uncertain  (Feldgarden  and 
Yund.  1992:  Yund  and  Feldgarden.  1992;  Grosberg,  1992). 
In  laboratory  assays,  the  probability  of  fusion  remains  high 
between  full  siblings  or  between  parent  and  offspring,  but  it 
drops  precipitously  between  colonies  of  lesser  relatedness 
(Hauenschild,  1954,  1956;  Mullen  1964:  Ivker.  1972;  Gros- 
berg et  al..  1996).  If  kin  interactions  are  rare  in  the  field, 
however,  discrimination  between  kin  and  non-kin  may  sim- 
ply reflect  imperfect  discrimination  of  self  from  non-self 
(Feldgarden  and  Yund,  1992;  Yund  and  Feldgarden,  1992). 
Although  kin  interactions  may  be  common  in  natural  pop- 
ulations of  H.  symbiolongicarpus  (Hart  and  Grosberg, 
1999),  adaptive  kin/non-kin  discrimination  should  persist 
only  if  kin  fusion  results  in  a  net  increase  in  a  genotype's 
fitness  relative  to  non-fusion. 

Upon  contact  with  genetically  unrelated  conspecific  tis- 
sue, Hydractinia  colonies  do  not  fuse  but  instead  usually 
mount  a  well-characterized  agonistic  response  (Ivker,  1972; 
Buss  et  al.,  1984).  The  ability  to  mount  an  agonistic  attack, 
or  competitive  ability,  has  a  strong  genetic  basis  and  de- 
pends directly  on  colony  growth  form  (Buss  and  Grosberg, 
1990).  (See  Fig.  1  for  an  illustration  of  growth  forms.)  Some 
individuals  grow  solely  by  expansion  of  continuous,  un- 
branching  tissue  ("mat"  phenotypes).  whereas  others  grow 
primarily  by  proliferating  thin  branches  of  tissue,  or  stolons 
("stoloniferous"  phenotypes).  Colonies  exhibit  continuous 
variation  between  these  two  morphological  extremes  ("in- 
termediate" phenotypes).  In  agonistic  interactions,  existing 
stolons  swell  due  to  the  recruitment  of  nematocytes  (cells 
bearing  the  nematocysts)  and  discharge  of  nematocysts 
(highly  specialized  stinging  organelles)  (Buss  et  al..  1984). 
These  "hyperplastic  stolons"  (Ivker,  1972)  discharge  nema- 
tocysts in  an  attempt  to  competitively  exclude  the  opposing 
colony  by  tissue  destruction  and  subsequent  overgrowth 
(Buss  and  Grosberg,  1990).  Thus,  colonies  with  greater 
stolon  proliferation  (stoloniferous  phenotypes)  have  an  in- 
creased capacity  to  mount  an  agonistic  response  and  com- 


FITNESS  CONSEQUENCES  OF  AGGRESSION 


175 


petitively  exclude  others  in  laboratory  competitive  interac- 
tions between  small  colonies  (Buss  and  Grosberg,  1990). 

Multiple  Hydmctinia  colonies  may  recruit  to  near  or 
distant  sites  on  a  gastropod  shell  depending  on  shell  mor- 
phology (Yund  et  al..  1987:  Buss  and  Yund.  1988:  Yund 
and  Parker.  1989)  and  size  (Buss  and  Yund,  1988).  As  a 
result,  conspecific  encounters  in  Hydnictiniu  may  occur 
between  small  or  large  colonies,  because  colonies  grow  ro 
different  extents  before  contact.  Previous  studies  have  em- 
phasized the  importance  of  intraspecitic  competition  be- 
tween small,  juvenile  colonies  (Buss  and  Yund.  1988;  Buss 
and  Grosberg,  1990),  but  agonistic  interactions  between 
large  colonies  have  been  documented  in  modern  and  his- 
torical populations  (Buss  and  Yund,  1988).  and  are  not 
uncommon  in  H.  [CM]  (Ferrell.  2004).  Yund  et  ul.  (1987) 
used  a  single  pair  of  competing  genotypes  to  document 
competitive  reversals  and  prolonged  agonistic  contests  (pos- 
sibly standoffs)  between  relatively  large  colonies.  However, 
the  generality  of  size-dependent  competitive  outcomes 
among  conspecifics  and  the  effect  of  growth  form  in  com- 
petitive encounters  between  larger  colonies  remain  largely 
unexplored. 

Laboratory  studies 

In  July  2000.  I  hand-collected  five  large,  well-estab- 
lished, sexually  mature  colonies  (designated  colonies  I-V 
hereafter)  of  H.  [CM]  from  shallow  water  ( 1-1 .5  m  deep)  in 
St.  Joseph's  Bay.  Florida,  located  in  the  northeastern  Gulf  of 
Mexico.  Each  colony  occupied  an  individual  gastropod 
shell  (Fasciolaria  lilium  hunteria,  F.  titlipa,  Polinices  du- 
plicatns.  or  Phvllonotns  pomitm)  inhabited  by  the  hermit 
crab  Pagunts  pollicaris.  In  the  laboratory,  small  pieces  of 
tissue,  or  explants.  including  four  or  five  gastrozooids  were 
excised  with  a  scalpel  and  transferred  with  watchmaker's 
forceps  to  plain  glass  microscope  slides  (7.64  cm  X  3.82 
cm.  1.1-1.3  mm  thick).  These  tissue  explants  were  held  in 
the  desired  position  using  a  single  monofilament  thread 
(8-lb.  test)  and  kept  in  artificial  seawater  (Instant  Ocean  Sea 
Salt,  ©1994:  temperature  =  24  °C,  salinity  =  32  ppt)  in  a 
single  aquarium.  Tissue  explants  attached  to  the  glass  sub- 
strate within  a  few  days.  This  technique  was  used  to  estab- 
lish all  experimental  replicates  (described  in  detail  below). 

Two  factors  were  manipulated  in  this  experiment:  ( 1 ) 
inter-competitor  spacing  and  (2)  relative  competitive  ability 
of  competing  colonies.  Two  competitive  treatments  were 
established  by  placing  tissue  explants  from  two  different 
field-collected  colonies  on  glass  slides  at  4-mm  or  12-mm 
apart,  resulting  in  interactions  between  small  and  large 
colonies,  respectively,  after  subsequent  colony  growth. 
Such  competitive  interactions  were  established  between  all 
10  pairwise  combinations  of  the  five  experimental  colonies. 
As  a  control,  I  also  established  each  experimental  colony 
singly  on  separate  glass  slides.  All  competing  pairs  and 


controls  were  replicated  five  times,  yielding  125  experimen- 
tal units  [(10  pairs  X  2  distances  X  5  replicates)  +  (5 
controls  X  5  replicates)  =-  125  units].  Glass  slides  were 
mounted  vertically  on  one  of  three  acrylic  plastic  racks  lined 
with  nine  plastic  columns  for  attachment.  Five  slides  could 
be  mounted  in  each  plastic  column,  generating  five  rows  of 
slides  on  each  rack.  All  slide  positions  were  assigned  ran- 
domly with  respect  to  rack,  column,  and  row.  The  three 
racks,  including  all  glass  slides,  were  maintained  in  artificial 
seawater  in  a  single  aquarium,  as  described  above.  Two 
underwater  pumps  ensured  adequate  circulation.  Colonies 
were  fed  daily  (3 — \  h)  to  repletion  with  2-day-old  brine 
shrimp  nauplii  (Ocean  Star  International,  Inc.,  Pro  100). 

At  15.  30.  60.  80,  and  90  days,  each  experimental  unit 
was  examined  under  a  dissection  microscope.  Survival, 
colony  width  and  length  (omitted  at  the  80-d  interval),  and 
the  number  of  immature  gonozooids  were  recorded.  The 
colonized  surface  area,  defined  here  as  the  area  covered  by 
connecting  stolon  tips  with  straight  lines  or  tracing  the  edge 
of  mat  tissue,  was  estimated  by  measuring  colony  width  and 
length  and  then  calculating  the  ellipsoid  area  [=  TT  X 
(length/2)  x  (width/2)].  The  surface-area  growth  rate  of 
colonies  was  then  calculated  (=  ellipsoid  area/time).  Digital 
computer  images  were  obtained  from  53  additional  labora- 
tory-cultured H.  [GM]  colonies  established  from  clonal 
explants,  and  linear  regression  was  performed  to  evaluate 
the  appropriateness  of  estimated  ellipsoid  area  as  an  indi- 
cator of  colonized  surface  area,  which  was  calculated  using 
SigmaScan  Pro  4  software.  Additionally,  the  presence  or 
absence  of  contact  between  competitors  was  noted  to  esti- 
mate the  time  in  contact  for  all  replicates.  For  example,  after 
90  d  of  growth,  the  estimated  time  in  contact  for  conspe- 
cifics in  contact  after  only  15  d  would  be  75  d. 

After  65  d  of  growth,  all  control  replicates  of  each  of  the 
five  experimental  colonies  were  analyzed  morphometrically 
to  determine  colony  growth  form  (i.e.,  relative  allocation  to 
mat  and  stolonal  tissue).  In  the  absence  of  substrate  limita- 
tion, mat  and  stolon  growth  rates  remain  constant  through- 
out ontogeny  (McFadden  et  <//..  1984;  Blackstone  and 
Yund,  1989).  Consequently,  morphological  assessment  at 
this  time  can  be  considered  to  represent  conditions  through- 
out the  experiment  (0-90  d). 

I  used  a  Nikon  camera  (60-mm  lens)  interfaced  to  a 
computer  to  obtain  and  store  black-and-white  images  of  the 
colonies.  After  tracing  all  tissue  (stolonal  or  mat)  of  each 
replicate  (see  Fig.  1  for  examples),  I  used  SigmaScan  Pro  4 
software  to  perform  the  morphometric  measurements 
needed  to  calculate  the  shape  metric  developed  by  Black- 
stone  and  Buss  ( 1991 ).  The  unitless  shape  metric  [=  perim- 
eter/(area)05]  is  a  reliable  quantitative  indicator  of  growth 
form  in  Hydractinia  and  other  organisms  that  have  similar 
colony  development.  Higher  values  correspond  to  increas- 
ingly stoloniferous  phenotypes.  The  biomass  surface  area 
covered  by  mat  tissue  and  individual  stolons  was  also  de- 


176 


D.  L.  FERRELL 


termined  by  using  SigmaScan  Pro  4  software.  Note  that  the 
biomass  surface  area  determined  from  these  images  of  con- 
trol-treatment colonies  was  calculated  differently  than  the 
estimated  ellipsoid  surface  area  used  to  evaluate  growth  rate 
in  all  experimental  units.  Calculations  of  the  shape  metric 
and  biomass  growth  rate  allowed  a  posteriori  assessment  of 
the  competitive  ability  of  the  five  experimental  colonies 
used  in  this  study.  The  competitive-dominance  hierarchy 
constructed  using  biomass  growth  rate  and  shape  metric 
determinants  was  then  compared  to  the  actual  competitive 
hierarchy  based  on  the  outcomes  (in  terms  of  colony  sur- 
vival) of  the  pairwise  competitive  encounters  between  all 
colonies. 

Statistical  analysis 

I  used  Contingency  \2  tests  of  independence  to  evaluate 
whether  colony  survival  was  associated  with  ( 1 )  intercolony 
spacing,  (2)  colony  identity,  and  (3)  competitor  identity.  In 
cases  in  which  expected  values  were  sufficiently  small 
(^5),  Fisher's  exact  test  of  independence  was  used  instead. 

Initially,  three-way  analyses  of  variance  (ANOVA)  were 
used  to  explore  the  effects  of  slide  position  on  the  two 
continuous  response  variables  (surface-area  growth  rate  and 
number  of  immature  gonozooids)  after  90  days  of  growth. 
The  main  effects  of  rack  (3).  column  (9),  and  row  (5)  were 
examined,  as  well  as  all  possible  interactions  (JMP,  ver. 
3.2.6).  Then,  mixed-model,  two-way  ANOVAs  were  used 
to  analyze  the  surface-area  growth  rate  and  the  number  of 
immature  gonozooids  after  90  days  of  growth.  Separate 
ANOVA  models  were  employed  for  each  of  the  five  exper- 
imental colonies  to  meet  model  assumptions  of  indepen- 
dence. The  main  effects  of  distance  between  competing 
colonies  (fixed;  4  vs.  12  mm)  and  competitor  identity  (ran- 
dom; genotype  of  competitor)  were  explored,  as  well  as  the 
interactions  between  these  two  main  factors.  For  each  dis- 
tance treatment  group,  contrasts  comparing  colony  perfor- 
mance against  each  competitor  were  performed  (12  total 
contrasts,  family  level  a  =  0.05.  Bonferroni  adjusted  a  = 
0.0042;  Sokal  and  Rohlf,  1995).  Differences  from  control 
colonies  in  growth  and  reproductive  variables  were  exam- 
ined separately  for  the  4-mm  and  12-mm  treatments  with 
one-way  ANOVAs;  contrasts  comparing  control  versus 
competitive  treatment  colonies  were  performed  (4  total  con- 
trasts, family  level  a  =  0.05.  Bonferroni  adjusted  o  = 
0.0125;  Sokal  and  Rohlf.  1995).  In  addition,  the  relationship 
between  immature  gonozooid  production  and  quantitative 
estimates  u!  colony  growth  form  (i.e.,  shape  metric)  was 
examined  using  simple  linear  regression  analysis  for  the 
4-mm  and  1 2-mm  treatments.  Natural  logarithmic  and 
square  root  data  transformations  were  used  when  necessary 
to  meet  model  assumptions  of  normality  and  homoscedas- 
ticity. 

One-way   ANOVAs  were  used  to  compare  the   mean 


biomass  growth  rate  and  mean  shape  metric  of  control 
replicates  of  the  five  experimental  colonies.  All  pairwise 
comparisons  were  performed  (10  total  contrasts,  family 
level  a  =  0.05.  Bonferroni  adjusted  a  =  0.005;  Sokal  and 
Rohlf,  1995). 


Results 


Effects  of  slide  position 


For  both  surface-area  growth  rate  and  number  of  immature 
gonozooids,  two  ANOVA  models  were  explored  for  the  ef- 
fects of  slide  position.  The  first  included  all  possible  interac- 
tions as  factors  in  the  model  [rack  (3),  column  (9).  row  (5), 
rack*column,  rack*row,  column*row,  rack*column*row|. 
However,  in  the  absence  of  statistically  significant  interactions, 
data  were  pooled  and  reanalyzed  including  only  the  main 
effects  of  rack,  column,  and  row.  Neither  of  these  statistical 
models  identified  significant  effects  of  slide  position  with  re- 
gard to  surface-area  growth  rate  or  number  of  immature  gono- 
zooids. Consequently,  slide  position  was  ignored  in  all  subse- 
quent analyses. 

Morphological  assessment 

Growth  forms  of  experimental  colonies  included  those 
that  were  entirely  mat  and  those  that  were  highly  stolonif- 
erous  as  well  as  intermediate  types  (Fig.  1).  For  ease  of 
interpretation,  I  assigned  Roman  numerals  I-V  to  colonies 
according  to  the  extent  of  stolon  proliferation.  After  65  d  of 
growth,  none  of  the  control  replicates  (established  in  the 
absence  of  competition)  of  colony  I  possessed  any  periph- 
eral stolons  branching  out  from  the  central  ectodermal  mat. 
In  contrast,  control  replicates  of  colony  V  were  highly 
stoloniferous,  with  most  growth  occurring  via  stolon  rather 
than  as  mat  tissue.  Control  replicates  of  colonies  II,  III,  and 
IV  displayed  intermediate  growth  forms  with  various  pro- 
portions of  mat  and  stolon  tissue. 

Figure  1  compares  quantitative  estimates  of  growth  form 
and  growth  rate  of  the  experimental  colonies.  The  growth 
rate,  in  terms  of  biomass  area  covered  after  65  d  of  growth, 
was  similar  among  experimental  colonies,  except  colony  V. 
Although  ANOVA  results  indicated  a  difference  in  the 
mean  biomass  area  of  the  colonies  (F42o  =  6.76.  P  ~ 
0.001).  Bonferroni  pairwise  comparisons  (adjusted  a  - 
0.005)  suggested  that  this  is  attributable  solely  to  colony  V, 
which  produced  biomass  coverage  at  a  rate  greater  than  the 
others.  The  clear  differences  in  growth  form  of  colonies  I, 
II,  III,  and  IV  (Fig.  1 )  did  not  result  in  significant  differences 
in  biomass  production.  Thus,  morphological  variation  in  //. 
[CM]  does  not  necessarily  reflect  differences  in  the  rate  of 
biomass  production.  In  contrast  to  biomass  growth  rate,  the 
shape  metric  reveals  a  relationship  between  morphology 
and  the  growth  differences  between  experimental  colonies. 
As  with  biomass  growth  rate,  ANOVA  showed  overall 


FITNESS  CONSEQUENCES  OF  AGGRESSION 


177 


0.6 

/^'V™ 

Q} 

CO 

0.5  - 

1  ,  1 

5 

o 

04 

CD 
CD 

0.3 

m  % 

CD 

(/) 
</) 
CD 

E 
o 

02 
0.1  - 

1            * 

1 

1  ,  1 

DO 

n 

V    "I  [  1                                                 I                                                  I 

0                       50                     100                    150                    200 

Shape  metric 

Figure  1.  Variation  in  growth  rate  and  colony  morphology  among  Hydmctinia  JGMI  experimental  colonies. 
Roman  numerals  I-V  were  assigned  to  colonies  according  to  the  extent  of  stolonal  proliferation  for  ease  of 
interpretation.  The  colony  outlines  illustrate  mat  (I),  highly  stoloniferous  (V),  and  intermediate  growth  mor- 
phologies (II.  Ill,  IV).  These  are  representative  tracings  of  images  obtained  from  control  replicates  (;i  =  5)  of 
experimental  colonies  I-V  after  65  d  of  growth.  Colonies  are  not  drawn  to  scale.  The  biomass  growth  rate 
(mnr/day)  reflects  the  total  area  covered  by  both  stolonal  and  mat  tissue  encrusting  the  surface  of  a  glass  slide 
after  65  d  of  growth.  The  shape  metric  (=  perimeter/Urea)"5),  developed  by  Blackstone  and  Buss  (1991).  is  a 
unitless  indicator  of  colony  growth  morphology  calculated  using  the  total  perimeter  and  area  covered  by  stolonal 
and  mat  tissue  combined. 


highly  significant  differences  in  the  mean  shape  metric 
(F42{>  =  24.78,  P  <  0.001).  However,  Bonferroni  pairwise 
comparisons  indicated  that  the  mean  shape  metric  of  colo- 
nies IV  and  V  both  differ  significantly  from  all  other  colo- 
nies. The  colonies  can  be  ranked  in  order  of  decreasing 
allocation  to  stolon  growth:  V  >  IV  >  III  =  II  =  I.  The 
"equal"  (  = )  symbol  denotes  no  statistical  difference. 

None  of  the  five  control  replicates  of  colony  I  exhibited 
any  stolon  growth.  This  attribute  reflects  a  qualitative  mor- 
phological distinction  between  colony  I  and  the  other  four 
colonies.  Thus,  while  morphometric  analysis  did  not  indi- 
cate significant  quantitative  differences  in  stolon  production 
between  colony  I  and  colonies  II  and  III,  an  important 
qualitative  difference  was  observed.  Noting  the  absence  of 
stolons  in  colony  I,  the  experimental  colonies  can  be  ranked 
in  order  of  decreasing  stolon  production  as  follows:  V  > 
IV  >  III  =  II  >  I. 

Survival 

Colony  survival  differed  markedly  as  a  function  of  inter- 
colony  spacing.  After  only  30  d  of  growth,  competing 
colonies  that  had  been  established  4-mm  apart  experienced 
reduced  survival  compared  to  those  established  12-mm 

apart  or  in  the  absence  of  competition  (^a!c  =  27.3,  ^n s 

=  3.8,  df  =  1.  P  <  0.001 ).  and  these  differences  in  survival 


remained  significant  for  the  duration  of  the  experiment. 
For  example,  after  60  d  of  growth,  survival  of  4-mm 
colonies  dropped  to  55%  and  was  significantly  lower  than 
the  85%  survival  seen  in  12-mm  colonies  after  90  d  (xla\c 
=  42.7,  xln.  005  =  3.8,  df  =  1.  P  <  0.001 ).  After  90  d. 
colonies  in  the  4-mm  treatment  showed  less  than  half  the 
survival  rate  of  those  in  the  12-mm  treatment  (42% 
compared  to  85%:  ^:al,  -  39.9,  ^2rll,  O.os  =  3.8,  df  =  1, 
P  <  0.001;  Fig.  2).  Thus,  competitive  encounters  between 
smaller  colonies  incur  greater  (or  at  least  earlier)  mortality 
than  encounters  between  larger  colonies.  By  contrast,  all 
control  colonies  had  100%  survival,  suggesting  that  in- 
traspecific  competition  caused  the  observed  mortality. 

Although  mortality  costs  from  competition  were  most 
intense  in  small-colony  encounters  (4-mm  treatment),  the 
five  experimental  colonies  differed  in  all  cases  with  respect 
to  the  onset  of  significant  mortality.  Differences  in  mortality 
between  4-mm  and  12-mm  treatments  were  statistically 
significant  (Fisher's  exact  test,  P  <  0.01 )  only  after  90  d  in 
colony  V.  the  most  stoloniferous  colony.  In  contrast,  sig- 
nificant mortality  differences  between  these  treatments  were 
evident  much  earlier  in  other  colonies  (30  d  in  colonies  I, 
III,  and  IV;  60  d  in  colony  II).  Colonies  in  the  4-mm 
treatment  did  not  exhibit  significantly  different  mortality 
when  pooled  over  all  competitors  (i.e.,  data  pooled  within 


178 


D.  L.  FERRELL 


Colony  V 


D  4  mm 
•  12mm 


05 

'5 

3 
C/5 


o 

Q. 


Colony  I 


1 

0.8 
0.6 

0.4 
0.2 


rlrlrl  • 


Ctl 


Competitor 

Figure  2.  Colony  survival  as  a  function  of  competitor  identity  and  intercolony  spacing  (4-mm  or  l2-mm>. 
The  proportion  of  colonies  surviving  after  90  d  in  competition  with  each  of  four  competitors  is  illustrated  for 
4-mm  and  12-mm  treatments.  The  performance  of  control  replicates  is  included  for  reference.  Colonies  are  not 
drawn  to  scale.  ND  =  no  data. 


each  colony  row  in  Fig.  2:  ^alc  =  1.7,  ^rit_  nns  =  9.5.  df  = 
4,  P  •  0.05).  Although  4-mm  clones  experienced  some 
mortality  in  all  competitive  pairings  (Fig.  2),  some  4-mm 
competitors  imposed  greater  overall  mortality  than  others 
(i.e..  data  pooled  within  each  competitor  column  in  Fig.  2; 
*i?alc  =  12.2.  v;M,  0.05  =  9-5.  df  =  4,  P  <  0.05).  Colonies 
were  least  likely  to  survive  competition  with  colony  V  and 
most  likely  to  survive  competition  with  colony  I. 

Survival  after  90  d  in  12-mm  treatments  was  not  signif- 
icantly different  among  colonies  when  pooled  over  all  com- 
petitors (i.e.,  data  pooled  within  each  colony  row  in  Fig.  2; 


A£alc  =  8.63.  fa*.  005  =  9.5.  df  =  4.  P  >  0.05).  Most  of  the 
observed  mortality  occurred  among  replicates  of  colonies  I 
and  IV,  however.  Mortality  in  all  other  colonies  (II,  III.  and 
V)  was  nearly  negligible,  as  survival  was  90%  or  higher.  As 
in  4-mm  treatments,  some  12-mm  competitors  imposed 
greater  overall  mortality  than  others  (i.e..  data  pooled  within 
each  competitor  column  in  Fig.  2;  Xc^  =  '5.7,  \cm  oos  = 
9.5.  df  =  4,  P  <  0.01 ).  In  12-mm  competitive  encounters  in 
which  mortality  occurred  (Fig.  2),  colonies  were  killed  by 
competitors  IV  and  V  almost  exclusively. 

Overall,  colonies  V  and  I  were  the  superior  and  inferior 


FITNESS  CONSEQUENCES  OF  AGGRESSION 


179 


competitors,  respectively.  Competitive  relationships  be- 
tween intermediate  competitors  were  less  distinct,  with  the 
genotypes  that  exhibited  the  more  stoloniferous  growth 
forms  generally  dominating  (Fig.  2). 


Growth  rate 

Estimates  of  ellipsoid  area  were  highly  correlated  with 
measurements  of  colonized  surface  area  (R2  =  94.9%, 
n  =  53),  and  were  therefore  used  as  an  indicator  of 
surface-area  growth  rate  for  experimental  colonies.  Col- 
onies established  4  mm  apart  often  suffered  marked  re- 
ductions in  growth  rate  relative  to  controls;  Bonferroni 
comparisons  indicated  that  all  competitor  treatments  (ex- 
cept one)  were  significantly  different  from  controls  for 
colonies  IV  and  V,  but  not  significantly  different  for 
colonies  I,  II.  and  III  (Table  1,  Fig.  3).  In  contrast,  the 
growth  rate  of  those  in  the  12-mm  treatment  was  most 
often  similar  to  controls;  Bonferroni  comparisons  indi- 
cated that  no  competitor  treatments  were  significantly 
different  from  controls,  with  two  exceptions  in  colony  V 
(Table  1,  Fig.  3).  Differences  in  growth  rate  after  90  d 
between  4-mm  and  12-mm  treatments  were  statistically 
significant  for  colonies  II,  IV,  and  V  (Table  2). 

Some  competitors  inflicted  greater  costs  in  growth  rate 
than  others  did.  After  90  d,  differences  in  growth  rate 


depending  on  competitor  identity  were  significant  for  all 
colonies  except  for  the  two  most  mat-like  phenotypes, 
colonies  I  and  II  (Table  2,  Fig.  3).  Instead,  the  effect  of 
competitor  identity  was  not  statistically  significant  for 
colonies  I  (P  =  0.604)  and  II  (P  =  0.406),  indicating  a 
uniform  cost  in  terms  of  growth  rate  regardless  of  the 
degree  of  attack  presented  by  a  competitor.  For  those 
colonies  (III,  IV,  and  V)  in  which  growth  rate  varied 
significantly  between  competitors,  Bonferroni  compari- 
sons were  generally  unable  to  differentiate  statistically 
which  competitors  imposed  greater  growth  rate  costs  than 
others.  The  two  exceptions  were  colony  III  in  the  4-mm 
treatment,  which  exhibited  a  significantly  greater  growth 
rate  in  competition  with  colony  I  than  with  colony  II  (Fig. 
3);  and  colony  IV  in  the  12-mm  treatment,  which  showed 
a  significantly  greater  growth  rate  in  competition  with 
colony  I  than  with  colony  V  (Fig.  3).  In  both  cases, 
colony  I  imposed  less  reduction  in  growth  rate  during 
intraspecific  competition.  After  90  d  of  growth,  in  no  case 
was  the  interaction  between  competitive  treatment  (4-mm 
and  12-mm)  and  competitor  identity  significant  (Table  2). 
Thus,  the  relative  ability  of  competitors  to  impose 
growth-rate  costs  did  not  vary  between  the  two  treat- 
ments. In  other  words,  the  severity  of  the  growth  reduc- 
tion imposed  by  competitors  did  not  depend  on  whether 
the  competing  colonies  were  large  or  small. 


Table  1 

Summary  of  one-way  ANOVAs  examining  differences  bet\veen  control  and  competing  colonies  (t  =  90  d)  in  4-mm  and  12-mm  treatments 


Variable                                        Focal  colony                     Treatment 

'4,20 

Significant  Bonferroni  comparisons 

Surface-area  growth  rate 
I                                    4  mm 
12  mm 
11                                   4  mm 
12mm 

0.86 
0.31 
1.32 
1.18 

— 

III                                  4  mm 

2.79 

— 

12  mm 

3.78* 

— 

IV                                    4  mm 

6.41** 

control 

vs.  II,  III.  V 

1  2  mm 

4.59** 

— 

V                                   4  mm 

8.46*** 

control 

vs.  I,  II,  III.  IV 

1  2  mm 

3.83* 

control 

vs.  III.  IV 

Number  of  immature  gonozoids 

I                                    4  mm 

0.91 

— 

12  mm 

0.93 

— 

II                                     4  mm 

13.29*** 

control 

vs.  I,  III,  IV.  V 

12  mm 

5.73** 

control 

vs.  Ill  (  +  ) 

III                                     4  mm 

1.39 

— 

1  2  mm 

8.82*** 

control 

vs.  I  (  +  ).  II  (  +  ) 

IV                                     4  mm 

3.45* 

control 

vs.  Ill,  V 

1  2  mm 

0.34 

— 

V                                     4  mm 

2.86 

control 

vs.  II 

12  mm 

1.17 

— 

Note:  Bonferroni  comparisons  indicate  lower  values  than  controls  except  where  indicated  with  a  plus  symbol  (  +  ).*  =  P  <  0.05.  **  =  P  <  0.01,  ***  = 
P  <  0.001. 


180 


D.  L.  FERRELL 


Colony  V 


2 
o 


Colony  I 


NO 


ai 


• 


D4  mm 
•  12  mm 


Competitor 

Figure  3.  Surface-area  growth  rate  as  a  function  of  competitor  identity  and  intercolony  spacing  (4-mm  or 
12-mm).  The  mean  (±  SE)  surface-area  growth  rate  (mirr/d)  after  90  d  in  competition  with  each  of  four 
competitors  is  illustrated  for  4-mm  and  12-mm  treatments.  The  performance  of  control  replicates  is  included  for 
reference.  Bonferroni  pairwise comparisons  (adjusted  a  =  0.0042)  indicated  no  significant  differences  in  means, 
with  the  following  exceptions:  colony  III.  4-mm;  colony  IV.  12-mm.  Significantly  different  means  arc  indicated 
by  different  lowercase  letters.  Colonies  are  not  drawn  to  scale.  ND  =  no  data. 


Production  <>j  immature  gonozooids 

The  number  of  immature  gonozooids  differed  remarkably 
as  a  function  ot  intercolony  spacing  for  four  out  of  five 
experimental  colonies.  Whereas  4-mm  colonies  invested 
very  little  or  no  energy  into  immature  gonozooids  (Fig.  4). 
12-mm  colonies  exhibited  immature  gono/ooid  investment 
that  was  similar  to  control  colonies  initially  (up  to  30  d>.  and 
then  in  some  cases  greater  than  controls  for  the  remainder  of 
the  experiment  (see  analysis  below). 


After  90  d.  differences  in  immature  gonozooid  produc- 
tion between  4-mm  and  12-mm  treatments  were  highly 
significant  for  all  colonies  except  colony  I  (Table  3.  Fig.  4). 
All  4-mm  competitive  treatments  exhibited  immature  gono- 
/ooid  production  similar  to  or  less  than  controls  (Table  1, 
Fig.  4).  In  contrast.  12-mm  competitive  treatments  exhibited 
immature  gonozooid  production  similar  to  or  greater  than 
controls  (Table  I.  Fig.  4). 

All    instances   of  augmented    production    of  immature 


FITNESS  CONSEQUENCES  OF  AGGRESSION 


181 


Table  2 

Summon,'  of  two-way  ANOVAs  examining  the  effects  of  intercolonv 
distance  and  competitor  genotype  on  surface-area  growth  rate  ft  = 
90  d) 


Focal  colony 

Source 

df 

MS 

F-ratio 

I 

Distance 

1 

0.136 

0.441 

Competitor 

3 

0.192 

0.625 

Interaction 

3 

0.113 

0.366 

Error 

32 

0.308 

II 

Distance 

1 

2.138 

15.063*** 

Competitor 

3 

0.142 

1.000 

Interaction 

3 

0.087 

0.612 

Error 

32 

0.142 

III 

Distance 

1 

0.001 

0.002 

Competitor 

3 

1.999 

3.975* 

Interaction 

3 

1.223 

2.433 

Error 

32 

0.503 

IV 

Distance 

1 

5.184 

20.843*** 

Competitor 

3 

2.057 

8.271*** 

Interaction 

3 

0.278 

1.116 

Error 

32 

0.249 

V 

Distance 

1 

5.247 

6.490* 

Competitor 

3 

3.409 

4.220* 

Interaction 

3 

0.347 

0.429 

Error 

32 

0.808 

Note:  Results  of  individual  ANOVAs  are  given  for  focal  colonies  I.  II, 
III.  IV.  and  V.  *  =  P  <  0.05,  ***  =  P  <  0.001. 


gonozooids  involved  poor  competitors  (I,  II,  III)  exhibiting 
mat  or  mat-like  (intermediate)  growth  forms  (Fig.  4).  By 
summing  the  shape  metrics  of  each  competing  pair,  the 
interactions  can  be  ranked  according  to  the  morphological 
attributes  of  the  encounter.  Mat-mat  encounters  have  the 
lowest  sums;  stoloniferous-stoloniferous  encounters  have 
the  greatest.  Simple  linear  regression  analysis  revealed  a 
highly  significant,  negative  relationship  between  production 
of  immature  gonozooids  and  the  sum  of  the  shape  metrics 
(FU8  =  26.0,  P  <  0.0001 ),  accounting  for  a  majority  (R2  = 
60.1%)  of  the  variation  in  immature  gonozooid  production 
in  12-mm  colonies  (Fig.  5).  This  relationship  was  not  de- 
tected in  4-mm  colonies  (FLI8  =  1.3,  P  =  0.26).  which 
showed  much  less  variability  in  immature  gonozooid  pro- 
duction (Fig.  4). 

Discussion 

Competitive  dynamics  in  Hydractinia  [GM]  clearly  de- 
pend on  the  ecological  context  in  which  intraspecific  com- 
petition transpires.  The  size  of  colonies  upon  encountering 
conspecifics  and  the  growth  form,  or  competitive  ability,  of 
competitors  both  strongly  influenced  the  fitness  conse- 
quences of  agonistic  interactions.  Interactions  between 


small  colonies  generally  imposed  greater  costs  in  colony 
survival,  growth  rate,  and  investment  in  future  reproduction. 
Superior  competitors  typically  eliminated  their  opponents  in 
small-colony  encounters,  but  only  the  most  dominant  colo- 
nies competitively  excluded  others  in  larger-colony  interac- 
tions. In  certain  conditions,  competing  colonies  consistently 
increased  their  investment  in  future  reproduction  (relative  to 
controls  without  competition)  and  exhibited  zero  mortality, 
although  reduced  growth  was  often  evident.  These  findings 
indicate  that  ( 1 )  agonistic  interactions  do  not  always  result 
in  the  elimination  of  inferior  competitors,  (2)  colonies  may 
increase  production  of  immature  gonozooids — an  invest- 
ment in  future  reproduction — as  a  result  of  growth  limita- 
tion by  conspecifics,  and  (3)  ontogenetic  changes  in  al- 
lorecognition-mediated  fusibility  may  be  due  in  part  to 
heavily  size-dependent  fitness  consequences  of  non-fusion. 

Competitive  outcomes 

The  fitness  consequences  of  intraspecific  competition  in 
H.  [GM]  were  heavily  size-dependent.  Not  only  may  the 
duration  of  encounters  between  larger  colonies  be  pro- 
longed, but  also  the  outcome  may  be  entirely  different. 
Whereas  encounters  at  small  size  usually  result  in  compet- 
itive exclusion  (Ivker.  1972;  Buss  et  al.,  1984;  Yund  et  al., 
1987;  Buss  and  Grosberg,  1990;  this  study),  this  may  not 
always  be  true  for  the  encounters  of  larger  colonies.  Indeed, 
when  given  a  distinct  size  advantage  over  its  superior  in- 
terspecific competitor,  the  colonial  hydroid  Podocoryne 
carnea,  Hydractinia  colonies  often  survived  interspecific 
contests  and  formed  intercolony  boundaries  stable  for  2-3 
months  (McFadden,  1986).  Work  with  other  spatial  com- 
petitors of  Hydractinia  on  artificial  substrata  similarly  sug- 
gests that  colonies  may  persist  by  inhibiting  the  growth  of 
adjacent  competitors  rather  than  by  attempting  overgrowth 
(Karlson,  1978).  In  the  present  study,  mat  and  mat-like 
Hydractinia  phenotypes  accrued  zero  mortality  in  intraspe- 
cific competitive  interactions  initiated  between  larger  colo- 
nies. 

Yund  et  al.  (1987)  also  report  coexistence,  rather  than 
overgrowth,  of  two  competing  Hydractinia  genotypes  es- 
tablished at  distant  recruitment  sites  after  9.5  weeks  of 
growth.  Even  after  18  weeks,  only  four  of  eight  replicates 
had  resulted  in  exclusion  of  one  of  the  two  genotypes, 
despite  significant  differences  in  growth  rate  (and  presum- 
ably competitive  ability)  between  them.  Had  such  interac- 
tions been  investigated  between  genotypes  with  relatively 
low  and  similar  growth  rates  (as  in  the  present  study),  Yund 
et  al.  (1987)  might  have  observed  even  less  or  no  over- 
growth in  large-colony  competitive  interactions.  Yund  et  al. 
(1987)  proposed  that  the  costs  of  non-fusion  are  actually 
much  greater  in  interactions  between  large  colonies.  This 
conclusion  implies  that  complete  overgrowth,  albeit  pro- 
longed, will  proceed  in  all  competitive  encounters.  If  this 


182 


D.  L.  FERRELL 


Colony  V 


Colony  IV 


Ctl 


cn 
£ 

CO 

E 


Colony  III 


Colony  II 


Ctl 


Colony  I 


30 

25 

20 
15 
10  • 
5 


3°i  f 

I        I 

J±L_       J          1 


30  • 

25 

20 

15 
10  - 
5 


30  i 

25 

20 

15 

: 

10 

J 

5  • 

ND 

O4  mm 
•  12mm 


Competitor 

Figure  4.  Immature  gonozooid  production  as  a  function  of  competitor  identity  and  intercolony  spacing 
1 4- mm  or  12-mm).  The  mean  (±  SE)  number  of  gonozooids  per  colony  after  90  d  in  competition  with  each  of 
four  competitors  is  illustrated  for  4-mm  and  12-mm  treatments.  The  performance  of  control  replicates  is  included 
for  reference.  Bonferroni  pairwise  comparisons  (adjusted  a  =  0.0042 1  indicated  no  significant  differences  in 
means,  with  the  following  exceptions:  colony  III,  12-mm;  colony  V.  12-mm.  Significantly  different  means  are 
indicated  hy  different  lowercase  letters.  Colonies  are  not  drawn  to  scale.  ND  =  no  data. 


were  the  case,  fitness  costs  indeed  would  be  more  severe, 
because  even  the  "winner"  laces  the  immense  energetic 
costs  of  such  a  prolonged  struggle.  My  results  are  consistent 
with  this  interpretation  in  that  highly  stoloniferous  colonies 
showed  evidence  of  overgrowth  regardless  of  intercolony 
spacing;  however,  in  the  absence  of  highly  stoloniferous 
phenot\  pes.  this  does  not  appear  to  be  the  case.  Overgrowth, 
while  likely  predominating  in  many  Hydmctinia  popula- 


tions as  a  result  of  recruitment  patterns  and  available  gas- 
tropod substrata  (Buss  and  Yund.  1988;  Yund  and  Parker. 
1989).  may  not  be  the  inevitable  product  of  intraspecific 
competition  in  H.  [CM]. 

Differences  in  the  outcome  of  competitive  encounters 
based  on  colony  size  are  important  ecologically  and  evolu- 
tionarily  only  if  the  frequency  of  encounters  between  small 
and  large  colonies  varies  predictably  in  natural  populations. 


FITNESS  CONSEQUENCES  OF  AGGRESSION 


183 


Table  3 


Summary  of  rnw-H-ay  ANOVAs  examining  the  effects  of  intercolony 
distance  and  competitor  genotype  on  the  number  of  immature 
gonozooids  ft  =  90  d) 


Focal  Colony 

Source 

df 

MS 

F-ratio 

I 

Distance 

1 

4.589 

3.603 

Competitor 

3 

3.238 

2.542 

Interaction 

3 

0.899 

0.706 

Error 

32 

1.274 

II 

Distance 

1 

32.876 

71.472*** 

Competitor 

3 

3.390 

7.369*** 

Interaction 

3 

3.660 

7.958*** 

Error 

32 

0.460 

III 

Distance 

1 

13.850 

22.761*** 

Competitor 

3 

4.546 

7.471*** 

Interaction 

3 

6.002 

9.864*** 

Error 

32 

0.608 

IV 

Distance 

1 

17.125 

22.011*** 

Competitor 

3 

1.384 

1.779 

Interaction 

3 

0.200 

0.257 

Error 

32 

0.778 

V 

Distance 

1 

6.750 

8.456** 

Competitor 

3 

0.098 

0.123 

Interaction 

3 

1.387 

1.737 

Error 

32 

0.798 

Note:  Results  of  individual  ANOVAs  are  given  for  focal  colonies  I.  II, 
III,  IV,  and  V.  **  =  P  <  0.01,  ***  =  P  <  0.001. 


Field  surveys  indicate  that  competitive  interactions  between 
large  colonies  occur  regularly  in  some  H.  [CM]  populations 
with  a  frequency  that  varies  predictably  with  the  availability 
of  different  sizes  and  types  of  gastropod  shells  (Ferrell, 
2004).  Shell  size  and  morphology  affect  the  likelihood  that 
multiple  larvae  will  recruit  to  distant  positions  on  a  shell 
(Buss  and  Yund,  1988;  Yund  and  Parker,  1989).  Yund  and 
Parker  (1989)  acknowledge  that  a  sizeable  portion  of  inter- 
actions may  occur  between  large  colonies  in  certain  Hy- 
dractinia  species.  However,  the  mean  shell  length  ( —42 
mm)  of  encrusted  gastropod  shells  in  some  H.  [CM]  pop- 
ulations (Ferrell,  2004)  greatly  exceeds  even  the  maximum 
shell  length  (-25  mm)  utilized  in  many  northwestern  At- 
lantic Hydractinia  populations  (as  reported  in  Buss  and 
Yund,  1988).  On  bigger  shells,  the  spacing  between  colo- 
nies can  be  greater;  thus  competitive  interactions  between 
extremely  large  colonies,  in  which  overgrowth  seems  in- 
creasingly improbable,  occur  in  H.  [CM]  (pers.  obs.).  As  in 
other  marine  cnidarians  (e.g..  Francis,  1973;  Karlson,  1980; 
Purcell.  1977),  agonistic  behavior  may  result  in  territorial 
defense  of  spatial  resources  rather  than  competitive  exclu- 
sion. 


Production  of  immature  gonozooids- 
fiitnre  reproduction 


-an  investment  in 


Not  only  were  instances  of  overgrowth  attributable  to 
colony  morphology,  but  immature  gonozooid  production 
(and  growth  rate  to  a  lesser  degree)  also  varied  as  a  function 
of  the  morphology  of  the  competitors.  When  growth  rate 
differed  significantly  among  opponents,  the  less  stolonifer- 
ous  competitor  experienced  the  greater  in  growth  rate  and 
produced  few  immature  gonozooids,  or  none  at  all.  These 
results  are  consistent  with  expectations  of  the  intensity  of 
aggression  based  on  colony  growth  form. 

Although  production  of  immature  gonozooids  was  higher 
in  colonies  encountering  less  formidable  opponents  (i.e.. 
mat  or  mat-like  intermediate  growth  forms),  production  in 
some  cases  was  even  higher  than  in  the  controls.  This  effect 
was  not  apparent  in  small-colony  interactions,  in  which 
overgrowth  proceeded  much  more  rapidly.  Even  Hydrac- 
tinici  colonies  with  as  few  as  two  feeding  polyps  are  capable 
of  producing  mature  gonozooids  (Hauenschild,  1954;  Miil- 
ler.  1964);  nevertheless,  their  extreme  vulnerability  to  over- 
growth and  the  scarcity  of  tissue  not  directly  involved  in 
colony  defense  most  likely  kept  the  small  colonies  from 
producing  many  gonozooids.  Only  colonies  of  mat  and 
mat-like  intermediate  morphologies  increased  their  produc- 
tion of  immature  gonozooids.  Hauenschild  (1954)  made 
several  observations  of  Hydractinia  that  shed  light  on  this 
trend:  ( 1 )  the  formation  of  mat  tissue  is  a  precondition  for 
the  production  of  gonozooids,  (2)  gonozooids  form  much 
earlier  in  mat  colonies.  (3)  entirely  mat  phenotypes  produce 
gonozooids  naturally,  even  when  occupying  an  unlimited 
substrate.  (4)  intermediate  phenotypes  do  not  develop  gono- 
zooids unless  confronted  with  growth  limitations,  and  (5) 
stoloniferous  colonies  require  full  colonization  of  surface 
before  gonozooids  arise.  Thus,  the  greater  production  of 
immature  gonozooids  observed  in  mat  and  mat-like  inter- 
mediates is  simply  a  by-product  of  their  larger  supply  of  mat 
tissue  upon  which  to  form  gonozooids,  coupled  with  an 
earlier  onset  of  sexual  reproduction.  If  Hauenschild' s 
(1954)  third  observation  is  true,  it  may  explain  why  the 
entirely  mat  phenotype.  unlike  the  mat-like  intermediate 
phenotypes.  did  not  increase  production  of  immature  gono- 
zooids substantially  above  control  levels.  (Table  1,  Fig.  4). 
That  is.  with  no  growth  limitations  (as  in  the  control  treat- 
ment), the  entirely  mat  phenotype  would  still  exhibit  sig- 
nificant immature  gonozooid  production,  whereas  the  inter- 
mediate phenotypes,  which  react  in  this  manner  only  in 
growth-limiting  conditions,  would  not. 

I  explored  two  alternate  explanations  for  the  observed 
patterns  in  immature  gonozooid  production.  First,  perhaps 
the  interacting  pairs  benefiting  from  positive  effects  on 
immature  gonozooid  production  were  relatives.  None  of  the 
interacting  colonies  exhibited  the  fusion  one  might  expect  if 
they  were  genetically  related.  However,  about  50%  of  Hy- 


184 


D.  L.  FERRELL 


0) 
01 


2  -I 
1.5  - 

1 
0.5 


i 
O 

cn 
!» 


€          ° 

£  35 

I      -0.5  H 


-1 

-1.5  - 

-2 
-2.5 


4  5 


•55 


Sum  of  shapes  (colony  +  competitor) 

Figure  5.  Simple  linear  regression  analysis  of  immature  gonozooid  production  vs.  the  sum  of  shape  metrics 
of  competing  colonies  established  12-mm  apart.  The  mean  percent  change  in  the  number  of  immature 
gonozooids  per  colony  (relative  to  controls)  in  each  competitive  pair  after  90  d  is  plotted  with  respect  to  the  sum 
of  the  shape  metrics  of  both  colonies  in  a  given  competitive  encounter.  By  summing  the  shape  metrics  of  each 
competing  pair,  the  interactions  can  be  ranked  according  to  the  morphological  attributes  of  the  encounter. 
Mat-mat  encounters  have  the  lowest  sums;  stoloniferous-stoloniferous  encounters  have  the  greatest.  Data 
represent  the  mean  immature  gonozooid  production  of  each  colony  in  each  of  10  competitive  pairs.  Both  axes 
have  been  In-transformed.  The  negative  relationship  is  highly  significant  (P  <  0.0001 )  and  explains  60.1'*  (R2) 
of  the  variation  in  immature  gonozooid  production.  See  "Materials  and  Methods"  section  for  explanation  of 
shape  metric. 


dnictinia  full  siblings  do  not  fuse  upon  contact  (Grosberg  et 
nl..  1996),  and  nun-fusing  kin  could  conceivably  exhibit 
reduced  aggression  accompanied  by  reduced  fitness  costs. 
On  the  other  hand,  the  probability  of  finding  close  relatives 
of  H.  [GM]  on  separate  shells  is  extremely  low  (as  indicated 
by  extremely  low  rates  of  fusion  between  such  colonies  in 
laboratory  assays;  D.L.  Ferrell.  unpubl.  data),  and  this  ex- 
planation requires  that  three  of  the  five  experimental  colo- 
nies (I.  II,  and  III)  be  closely  related.  Consequently,  this  first 
possibility  is  unlikely.  A  second  explanation  could  be  found 
in  the  gender  of  the  competitors.  It  is  conceivable  that  only 
male-female  (M-F)  interactions  result  in  increased  produc- 
tion of  immature  gono/ooids.  In  this  experiment,  only  col- 
on\  1  \\as  female.  Unfortunately,  only  two  of  the  four  clear 
instances  ot  augmented  immature  gonozooid  production 
involved  M-F  pairs,  suggesting  these  data  may  be  inconclu- 


sive with  regard  to  this  explanation.  There  are  six  other  M-F 
interactions,  however,  and  only  one  (I  v.v.  II)  of  these  shows 
any  evidence  of  increased  production.  Because  the  majority 
of  M-F  interactions  contradict  this  hypothesis,  the  second 
explanation  also  appears  unlikely.  In  contrast,  the  growth 
form  of  the  interacting  colonies  explains  much  of  the  vari- 
ation in  immature  gonozooid  production  (Fig.  5). 

Because  the  rate  at  which  H.  [GMj  extends  across  a 
substratum  increases  with  stolon  proliferation,  mat  and  mat- 
like  phenotypes  grow  more  slowly.  Although  dissimilar 
morphologies  may  not  differ  in  the  rate  of  tissue  production 
( v-axis  of  Fig.  1 ).  they  differ  considerably  in  the  rate  at 
which  a  colony  expands  from  its  initial  site  of  establish- 
ment. The  surface-area  growth  rate  measurement  used  in 
this  study  reflected  this  rate  of  expansion.  ANOVA  com- 
paring the  mean  surface-area  growth  rate  of  control  colonies 


FITNESS  CONSEQUENCES  OF  AGGRESSION 


185 


revealed  significant  differences  between  the  five  experimen- 
tal colonies  (F4:o  =  17.9,  P  <  0.001;  Fig.  3).  Bonferroni 
comparisons  (adjusted  a  =  0.008)  further  indicated  that  the 
surface-area  growth  rates  of  colonies  IV  and  V  are  both 
greater  than  those  of  colonies  I,  II,  and  III.  but  not  signifi- 
cantly different  from  one  another.  Thus,  colonies  IV  and  V 
extended  outward  (via  stolons)  more  quickly  than  colonies 
I,  II,  and  III.  As  a  result,  competitive  encounters  involving 
colonies  IV  and  V  most  likely  initiated  contact  with  com- 
peting conspecifics  sooner  than  others  did. 

The  greater  production  of  immature  gonozooids  observed 
in  some  encounters  in  the  12-mm  treatment  might  be  attrib- 
utable to  the  timing  of  contact  between  competitors  such 
that  more  recently  contacting  colonies  showed  less  reduc- 
tion in  production.  Indeed,  greater  immature  gonozooid 
production  was  observed  in  more  slowly  extending  mat  and 
mat-like  phenotypes  (i.e.,  colonies  I,  II,  III).  However,  these 
competitive  encounters  yielded  greater  immature  gonozooid 
production  not  only  relative  to  other  competing  colony 
pairs,  but  also  relative  to  control  replicates,  suggesting  that 
the  increases  were  not  attributable  solely  to  the  timing  of 
contact  between  conspecifics.  Moreover,  when  the  multiple 
regression  model  for  immature  gonozooid  production 
(12-mm  treatment)  included  the  estimated  time  in  contact  as 
an  independent  variable,  the  result  indicated  negligible  ex- 
planatory power  for  this  added  variable.  The  growth  phe- 
notypes of  competitors  (i.e.,  sum  of  shape  metrics)  remained 
significantly  correlated  with  immature  gonozooid  produc- 
tion even  after  the  time  in  contact  between  competitors  was 
accounted  for  (Table  4).  Interestingly,  time  in  contact  was 
not  statistically  significant  in  this  model  (Table  4).  After  a 
second  independent  variable  (time  in  contact)  was  added  to 
the  model,  the  R2  increased  only  slightly,  from  60.1%  to 
62.9%  (Table  4).  indicating  that  time  in  contact  explained 
very  little  of  the  variation  in  immature  gonozooid  produc- 
tion. 

Recent  experiments  have  shown  that  the  number  of  im- 
mature gonozooids  is  a  strong,  statistically  significant  indi- 

Table  4 

Summary  of  multiple  regression  analysis  of  the  effects  of  growth  form 
and  duration  of  contact  between  competitors  on  immature  gonozooid 
production  in  colonies  established  12-mm  apart  ft  =  90  d) 


Coefficient 


P-value 


Constant 

Sum  of  shape  metrics 

Time  in  contact 


+  5.183 
-0.487 
-0.594 


0.001 
0.002 
0.203 


Note:  The  sum  of  the  shape  metrics  of  both  colonies  in  a  competitive 
pair,  an  indicator  of  growth  form  of  the  interacting  colonies  (see  Fig.  5), 
and  the  length  of  time  that  the  competing  colonies  had  been  in  contact  were 
included  as  explanatory  variables  of  the  mean  percent  change  in  the 
number  of  immature  gonozooids  possessed  by  each  colony.  The  overall  R2 
for  this  regression  model  was  62.9%. 


cator  of  the  number  of  mature  gonozooids  borne  by  a  colony 
upon  sexual  maturation  (D.  L.  Ferrell,  unpubl.  data).  These 
data,  together  with  the  findings  reported  here  and  the  ob- 
servations of  Hauenschild  (1954).  support  pre-existing  ideas 
about  reproductive  allocation  in  clonal  organisms.  Because 
reproductive  potential  typically  increases  with  growth,  in- 
determinately growing  clonal  organisms  should  be  expected 
to  postpone  sexual  reproductive  effort  until  growth  becomes 
limiting  (Abrahamson.  1975;  Hughes  and  Cancino,  1985; 
Harvell  and  Grosberg,  1988).  A  variety  of  growth-limiting 
factors  have  been  shown  to  accelerate  the  onset  of  sexual 
maturity  or  increase  sexual  reproductive  investment  in 
clonal  plants  (reviewed  in  Abrahamson,  1980)  and  animals 
(Braverman.  1974;  Yamaguchi,  1975;  Stebbing,  1980;  Har- 
vell and  Grosberg,  1988).  Abrahamson  (1975)  and  Harvell 
and  Grosberg  (1988)  identified  intraspecific  competition  in 
particular  as  a  growth-limiting  factor  that  triggers  increased 
reproductive  allocation.  In  many  cnidarian  agonistic  inter- 
actions, competitors  may  experience  reductions  in  growth 
or  reproductive  investment,  or  even  be  overgrown  entirely 
(reviewed  in  Grosberg,  1988).  However,  when  the  agonistic 
assault  is  unlikely  to  result  in  overgrowth,  it  appears  that  H. 
[GM]  increases  reproductive  allocation  in  response  to  in- 
traspecific competition. 

Adaptive  allorecognition  and  costs  of  competition 

An  adaptive  allorecognition  system  is  molded  evolution- 
arily  by  the  fitness  consequences  of  the  behavioral  alterna- 
tives it  mediates.  Extremely  high  costs  associated  with 
non-fusion  increase  the  likelihood  that  intercolony  fusion 
will  optimize  colony  fitness  in  intraspecific  competitive 
interactions.  Despite  potentially  severe  costs  of  fusion  be- 
tween genetically  distinct  but  closely  related  colonies  (Buss, 
1982,  1987;  Rinkevich  and  Loya.  1983;  Barki  el  al.,  2002; 
Rinkevich,  2002),  fusion  may  still  increase  fitness.  On  the 
other  hand,  if  the  costs  of  non-fusion  and  fusion  are  com- 
parable, allorecognition  systems  may  be  nonadaptive  or 
linked  to  other  adaptive  processes  (Chadwick-Furman  and 
Weissman,  2003).  The  current  paper  demonstrates  that  non- 
fusion  entails  significantly  different  fitness  costs  depending 
on  the  size  and  competitive  ability  of  competitors.  Thus, 
fusion  behavior  is  likely  to  be  adaptive  in  some  ecological 
scenarios,  but  not  others.  As  a  consequence,  complexities 
should  be  expected  in  the  allorecognition  system  of  H\drac - 
tiniu  if  it  functions  adaptively  in  governing  intergenotypic 
fusion. 

The  immediate  costs  of  rejection  were  clearly  greater  in 
interactions  between  small  colonies  than  between  larger 
colonies.  Small  colonies  experienced  significantly  greater 
fitness  costs  in  terms  of  colony  survival,  growth  rate,  and 
immature  gonozooid  production.  Competitively  inferior 
colonies  suffer  higher  rates  of  mortality  (by  definition)  and 
are  typically  eliminated,  whereas  dominant  colonies  gener- 


186 


D.  L.  FERRELL 


ally  survive  but  suffer  significant  setbacks  in  growth  and 
reproduction. 

Because  the  size  of  the  competitors  affects  the  fitness 
consequences  in  conspecific  interactions,  it  probably  also 
affects  the  selective  pressures  that  influence  allorecognition 
(assuming  its  adaptive  kin-discriminatory  role)  in  Hydnic- 
tinia.  Interestingly,  the  allorecognition  system  of  Hydrac- 
tinia exhibits  ontogenetic  variation  in  full-sibling  fusibility, 
or  the  tendency  to  fuse  (Shenk  and  Buss,  1991;  R.K.  Gros- 
berg,  Univ.  of  California,  Davis,  pers.  comm.).  Shenk  and 
Buss  ( 1991 )  claim  that  fusibility  declines  with  ontogeny  and 
that  some  colonies  disengage  from  fusion  behavior  with  the 
onset  of  sexual  maturity,  suggesting  that  the  costs  of  fusion 
are  greater  at  this  time.  On  the  other  hand,  while  noting 
some  sort  of  ontogenetic  effect,  others  have  been  unable  to 
corroborate  the  decreased  fusibility  with  colony  ontogeny 
and  the  coupling  of  sexual  maturity  with  the  onset  of  rejec- 
tion (Gild  et  nl..  2003;  R.K.  Grosberg,  pers.  comm.).  More- 
over, the  costs  of  intergenotypic  fusion  may  be  greatest 
early  in  ontogeny  (R.K.  Grosberg,  pers.  comm.)  and  are 
probably  not  averted  by  delayed  rejection  (Gild  et  ai, 
2003).  That  is,  subsequent  colony  separation  may  provide 
little  protection  from  somatic  cell  parasitism,  the  primary 
cost  thought  to  accompany  fusion,  in  which  one  genotype  in 
a  chimera  contributes  very  little  to  somatic  growth  while 
contributing  greatly  to  gamete  production  (Buss,  1982). 
Unfortunately,  these  conflicting  reports  make  it  difficult  to 
incorporate  the  size-dependent  variability  in  the  costs  of 
non-fusion  reported  in  this  study  into  a  discussion  of  the 
possible  adaptive  significance  of  changes  in  fusibility  with 
colony  ontogeny. 

My  findings  have  a  straightforward  interpretation  if  the 
fitness  costs  of  fusion  truly  increase  with  ontogeny  and, 
hence,  colony  size.  In  this  scenario,  low  costs  of  non-fusion 
would  be  accompanied  by  increased  costs  of  fusion  later  in 
ontogeny.  Thus,  fusion  would  not  be  favorable  in  compet- 
itive interactions  between  large  colonies,  and  decreased 
fusibility  with  ontogeny  (Shenk  and  Buss,  1991 )  would  be 
expected.  Initially,  it  would  seem  that  this  expectation 
would  be  valid  even  if  the  costs  of  fusion  actually  were 
heavily  skewed  in  favor  of  intense  costs  early  in  ontogeny. 
However,  given  intensified  costs  of  early  ontogenetic  fu- 
sion, the  costs  of  fusion  late  in  ontogeny  could  be  even 
lower  than  the  low,  but  measurable,  costs  of  non-fusion  I 
have  reported  here.  An  opposite  trend  in  fusibility  then 
would  be  expected.  Of  course,  ridding  ourselves  of  such 
speculative  deliberations  depends  on  identifying  and  quan- 
tifying the  fitness  consequences  of  fusion  in  Hydractinia 
and  understanding  whether  these  consequences  vary  with 
colony  ontogeny.  Nevertheless,  recognizing  that  the  costs  of 
non-fusion  vary  ontogenetically  (Yund  <7  nl..  1987.  this 
study),  the  presence  of  ontogenetic  variation  in  fusibility  is 
consistent  with  an  adaptive  allorecognition  system  intended 
to  distinguish  kin  from  non-kin. 


Several  avenues  for  future  research  remain  unexplored. 
Long-term  monitoring  of  prolonged  encounters  is  needed  to 
verify  the  nature  of  their  dynamics  and  eventual  outcome 
(overgrowth  or  coexistence).  In  particular,  estimates  of  life- 
time reproductive  output,  although  difficult  to  obtain,  would 
be  most  helpful.  This  study  reveals  that,  in  some  circum- 
stances, reproductive  allocation  may  be  modified  in  the 
presence  of  conspecifics.  even  in  species  that  exhibit  ago- 
nistic behavior.  Similar  effects  may  have  been  previously 
overlooked  in  other  cnidarians  with  analogous  inducible 
defenses.  Lastly,  close  examination  and  quantification  of  the 
costs  of  fusion  is  needed  to  better  evaluate  the  adaptiveness 
of  kin  fusion  in  Hydractinia. 

Acknowledgments 

R.  Mariscal  provided  guidance  and  the  necessary  equip- 
ment to  design  and  execute  these  experiments.  W.  Herrn- 
kind,  L.  Keller.  D.  Levitan.  R.  Mariscal,  and  three  anony- 
mous reviewers  provided  many  helpful  comments  on  earlier 
versions  of  this  manuscript. 

Literature  Cited 

Abrahamson,  W.  G.  1975.     Reproductive  strategies  in  dewberries.  Ecol- 

<i.V.v  56:  72l-75(i. 
Abrahamson,  VV.  G.  198(1.     Demography  and  vegetative  reproduction. 

Pp.  89-106  in  Demography  and  Evolution  in  Plant  Populations.  O.  T. 

Solbrig.  ed.  University  of  California  Press.  Berkeley.  CA. 
Mallard,  W.  W.  1942.     The  mechanism  for  synchronous  spawning  in 

HyJnii-tiiiiii  and  Pfiimina.  Riol.  Bull.  82:  329-339. 
Barki,  Y.,  D.  Gateno,  D.  Graur,  and  B.  Rinkevich.  2002.     Soft-coral 

natural  chimerism:  a  window  in  ontogeny  allows  the  creation  of  entities 

comprised  of  incongruous  parts.  Mar.  Ecol.  Prog.  Ser.  231:  91-99. 
Blackstone,  N.  VV1.,  and  L.  VV.  Buss.  1991.     Shape  variation  in  hydrac- 

tiniid  hydroids.  Biol.  Bull.  180:  394-405. 
Blackstone.  N.  W.,  and  P.  O.  Vund.  1989.     Morphological  variation  in 

a  colonial  marine  hydroid:  a  comparison  of  size-based  and  age-based 

heterochrony.  Palcf>hii>li>ny  15:  1-10. 
Braverman,  M.  1974.     The  cellular  bases  of  morphogenesis  and  mor- 

phosiasis  in  hydroids.  Oceunogr.  Mar.  Biol.  12:  129-221 
Bunting.  M.   1894.     The  origin  of  sex  cells  in  H\dractinia  and  Podo- 

corvnc  and  the  development  of  H\dractinia.  J.  Mor/'liol.  9:  203-246. 
Buss,  L.  VV.  1982.  Somatic  cell  parasitism  and  the  evolution  of  somatic 

tissue  compatibility.  Proc.  Natl.  Acad.  Sci.  USA  79:  5337-5341. 
Buss,  L.  W.  1986.     Competition  and  community  organization  on  hard 

surfaces  in  the  sea.  Pp.  517-536  in  Community  Ecology.  T.  Case  and  J. 

Diamond,  eds.  Harper  and  Row.  New  York. 
Buss,  I,.  \V.  1987.      Tlw  Evolution  <>/ 'Individuality.  Princeton  University 

Press.  Princeton.  NJ. 

Buss,  L.  VV.  1990.     Competition  within  and  between  encrusting  inverte- 
brates. Trend',  /•;,•<>/.  Evol.  5:  352-356. 
Buss,   I,.   W.,  and   R.   K.  Grosberg.    1990.     Morphogenetic   basis   for 

phenotypic  differences  in  hydroid  competitive  behavior.  Nature  343: 

63-  (id 

Buss,  L.  VV.,  and  J.  B.  C.  Jackson.  1979.     Competitive  networks:  non- 
transitive  competitive  relationships  m  cryptic  coral  reef  environments. 

,4m.  ,V<;/.  113:  223-234. 
Buss,  I..   VV.,  and   P.  O.   Yund.    1988.     A   comparison   of  recent  and 

historical   populations  of  the  colonial  hydroid  Hydraclinia.   Eculu^y 

69(3):  646-654. 


FITNESS  CONSEQUENCES  OF  AGGRESSION 


187 


Buss,  L.  W.,  and  P.  ().  Vund.  1989.  A  sibling  species  of  Hydractinia  in 
the  northeastern  United  States.  J.  Mar.  Biol.  Assoc.  UK  69:  857-874. 

Buss,  L.  W.,  C.  S.  McFadden.  and  D.  R.  Keene.  1984.  Biology  of 
Hydractiniid  hydroids.  2.  Histocompatibility  effector  system/competi- 
tive mechanism  mediated  by  nematocyst  discharge.  Biol.  Bull.  167: 
139-158. 

Chadvtick-Furman,  N.  E.,  and  I.  L.  Weissman.  2003.  Effects  of  allo- 
geneic  contact  on  life-history  traits  of  the  colonial  ascidian  Botryllus 
schlosseri  in  Monterey  Bay.  Biol.  Bull.  205:  133-143 

Cunningham,  C.  W.,  L.  W.  Buss,  and  C.  Anderson.  1991.  Molecular 
and  geologic  evidence  of  shared  history  between  hermit  crabs  and  the 
symbiotic  genus  Hydractinia.  Evolution  45(6):  1301-1316. 

Feldgarden,  M.,  and  P.  O.  Yund.  1992.  Allorecognition  in  colonial 
marine  invertebrates:  does  selection  favor  fusion  with  kin  or  fusion 
with  self?B/<>/.  Bull.  182:  155-158. 

Ferrell,  D.  L.  2004.  Gastropod  shell  size  and  morphology  influence 
conspecific  interactions  in  an  encrusting  hydroid.  Mar.  Ecol.  Prog.  Ser. 
(In  press). 

Francis,  L.  1973.  Clone  specific  segregation  in  the  sea  anemone  Antho- 
pleura  e/egantissima.  Biol  Bull.  144:  64-72. 

Frank,  U.,  T.  Leitz,  and  W.  A.  Miiller.  2001.  The  hydroid  Hydractinia: 
a  versatile,  informative  cnidarian  representative.  Bioessays  23:  963- 
971. 

Gild,  S.,  U.  Frank,  and  O.  Mokady.  2003.  Allogeneic  interactions  in 
Hydractinia*:  is  the  transitory  chimera  beneficial?  Int.  J.  Dev.  Biol.  47: 
433-438. 

Grosberg,  R.  K.  1988.  The  evolution  of  allorecognition  specificity  in 
clonal  invertebrates.  Q.  Rev.  Biol.  63:  377-412. 

Grosberg,  R.  K.  1992.  To  thine  own  self  be  true?  An  addendum  to 
Feldgarden  and  Yund's  report  on  fusion  and  the  evolution  of  allorecog- 
nition in  colonial  marine  invertebrates.  Biol.  Bull.  182:  454-457. 

Grosberg,  R.  K.,  and  J.  F.  Quinn.  1986.  The  genetic  control  and 
consequences  of  kin  recognition  by  the  larvae  of  a  colonial  ascidian. 
Nature  322:  456-459. 

Grosberg,  R.  K.,  D.  R.  Levitan,  and  B.  B.  Cameron.  1996.  Evolution- 
ary genetics  of  allorecognition  specificity  in  the  colonial  hydroid  Hy- 
dractinia symbiolongicarpus.  Evolution  50:  2221-2240. 

Hart,  M.  W.,  and  R.  K.  Grosberg.  1999.  Km  interactions  in  a  colonial 
hydrozoan  (Hydractinia  symbiolongicarpus):  population  structure  on  a 
mobile  landscape.  Evolution  53:  793-805. 

Harvell,  C.  D.,  and  R.  K.  Grosberg.  1988.  The  timing  of  sexual 
maturity  in  clonal  animals.  Ecology  69(6):  1855-1864. 

Hauenschild,  C.  von.  1954.  Genetische  und  Entwicklungphysiologische 
Untersuchungen  uber  Intersexualitat  und  Gewebebevertralichkeit  bei 
Hydractinia  echiiuira  Flem.  Wilhelm  Roux's  Arch.  Entwicklungsmech. 
Org.  147:  1-41. 

Hauenschild,  C.  von.  1956.  Uber  die  Vererbung  einer  Gewebebever- 
tralichkeits  bei  dem  Hydroiclpolypen  Hydractinia  echinata.  Z. 
Natiirforsch.  116:  132-138. 

Hughes,  T.  P.,  and  J.  M.  C'ancino.  1985.  An  ecological  overview  of 
cloning  in  Metazoa.  Pp.  153-186  in  Population  Biology  and  Evolution 
of  Clonal  Organisms.  J.  B.  C.  Jackson,  L.  W.  Buss,  and  R.  E.  Cook, 
eds.  Yale  University  Press,  New  Haven. 

Ivker,  F.  B.  1972.  A  hierarchy  of  histo-compatibility  in  Hydractinia 
echinata.  Biol.  Bull  143:  162-174. 

Jackson,  J.  B.  C.  1977.  Competition  on  marine  hard  substrata:  the 
adaptive  significance  of  solitary  and  colonial  strategies.  Am.  Nat.  Ill: 
743-767. 


Jackson,  J.  B.  C.  1985.  Distribution  and  ecology  of  clonal  and  aclonal 
benthic  invertebrates.  Pp.  297-355  in  Population  Biologv  and  Evolu- 
tion of  Clonal  Organisms,  i.  B.  C.  Jackson,  L.  W.  Buss,  and  R.  E. 
Cook.  eds.  Yale  University  Press.  New  Haven. 

Karlson,  R.  H.  1978.  Predation  and  space  utilization  patterns  in  a  marine 
epifaunal  community.  J.  E\p.  Mar.  Biol.  Ecol.  31:  225-239. 

Karlson,  R.  H.  1980.  Alternative  competitive  strategies  in  a  periodically 
disturbed  habitat.  Bull.  Mar.  Sci.  30:  894-900. 

Levitan,  D.  L.,  and  R.  K.  Grosberg.  1993.  The  analysis  of  paternity  and 
maternity  in  the  marine  hydrozoan  Hydractinia  symbiolongicarpus 
using  randomly  amplified  polymorphic  DNA  (RAPD)  markers.  Mol. 
Ecol.  2:  315-326. 

McFadden,  C.  S.  1986.  Laboratory  evidence  for  a  size  refuge  in  com- 
petitive interactions  between  the  hydroids  Hydractinia  echinata  (Flem- 
ming)  and  Podocoryne  camea  (Sars).  Biol.  Bull.  171:  161-174. 

McFadden,  C.  S.,  M.  J.  McFarland,  and  L.  W.  Buss.  1984.  Biology  of 
hydractmiid  hydroids.  1.  Colony  ontogeny  in  Hvdractinia  echinata. 
Biol.  Bull.  166:  54-67. 

Mokady,  O.,  and  L.  W.  Buss.  1996.  Transmission  genetics  of  allorecog- 
nition in  Hydractinia  symbiolongicarpus  (Cnidaria:  Hydrozoa).  Genet- 
ics 143:  823-827. 

Miiller,  W.  1964.  Experimented  Untersuchungen  uber  Stockentwick- 
lung,  Polypdifferenzierung  und  Sexualchimaren  bei  Hydractinia  echi- 
nata. Wilhelm  Roux's  Arch.  Entwicklungsmech.  155:  181-268. 

Purcell,  J.  E.  1977.  Aggressive  function  and  induced  development  of 
catch  tentacles  in  the  sea  anemone  Metridium  senile  (Coelenterata, 
Actiniaria).  Biol.  Bull.  153:  355-368. 

Rinkevich,  B.  2002.  Germ  cell  parasitism  as  an  ecological  and  evolu- 
tionary puzzle:  hitchhiking  with  positively  selected  genotypes.  Oikos 
96:  25-30. 

Rinkevich,  B.,  and  Y.  Loya.  1983.  Oriented  translocation  of  energy  in 
grafted  corals.  Coral  Reef*  1:  243-247. 

Rinkevich,  B.,  and  Y.  Loya.  1985.  Intraspecific  competition  in  a  reef 
coral:  effects  on  growth  and  reproduction.  Oecologia  66:  100-105. 

Sebens,  K.  P.  1986.  Spatial  relationships  among  encrusting  marine  or- 
ganisms in  the  New  England  subtidal  zone.  Ecol.  Monogr.  56:  73-96. 

Shenk,  M.  A.,  and  L.  W.  Buss.  1991.  Ontogenetic  changes  in  fusibility 
in  the  colonial  hydroid  Hydractinia  symbiolongicarpus.  J.  E.\p.  Zool. 
257:  80-86. 

Sokal,  R.  R.,  and  F.  J.  Rohlf.  1995.  Biometry.  3rd  ed  W  H  Freeman. 
New  York. 

Stebbing,  A.  R.  D.  1980.  Increase  in  gonozooid  frequency  as  an  adaptive 
response  to  stress  in  Campanularia  //rwi«\<i.  Pp.  27-32  in  Develop- 
mental and  Cellular  Biology  of  Coelenterates,  P.  Tardent  and  R. 
Tardent.  eds.  Elsevier,  New  York. 

Yamaguchi,  M.  1975.  Growth  and  reproductive  cycles  of  the  marine 
touling  ascidians  Cionu  intestinalis,  Stvcln  plicata,  Botrylloides  viola- 
ceous, and  Leptoc/inum  mitsukurii  at  Aburatsubo-Moroiso  Inlet  (cen- 
tral Japan).  Mar.  Biol.  29:  253-259. 

Yund,  P.  O.,  and  M.  Feldgarden.  1992.  To  thine  own  self  be  true?  Yes! 
Thou  canst  not  then  be  false  to  any  other.  A  reply  to  Grosberg.  Biol. 
Bull.  182:  458-459. 

Yund,  P.  O.,  and  H.  M.  Parker.  1989.  Population  structure  of  the 
colonial  hydroid  Hydractinia  sp.  nov.  C  in  the  Gulf  of  Maine.  J.  Exp. 
Mar.  Biol.  Ecol.  125:  63-82. 

Yund,  P.  O.,  C.  W.  Cunningham,  and  L.  W.  Buss.  1987.  Recruitment 
and  postrecruitment  interactions  in  a  colonial  hydroid.  Ecology  68: 
971-982. 


Reference:  Biol.  Bull.  206:  IS.X-196,  (June  20041 
©  2004  Marine  Biological  Laboratory 


Effects  of  Hypercapnic  Hypoxia  on  the  Clearance  of 

Vibrio  campbellii  in  the  Atlantic  Blue  Crab, 

Callinectes  sapidus  Rathbun 

JEREMY  D.  HOLMAN,  KAREN  G.  BURNETT.  AND  LOUIS  E.  BURNETT* 
Grice  Marine  Laboratory,  College  of  Charleston,  205  Fort  Johnson,  Charleston,  South  Carolina  29412 


Abstract.  Callinectes  sapidus,  the  Atlantic  blue  crab,  en- 
counters hypoxia,  hypercapnia  (elevated  CO-,),  and  bacterial 
pathogens  in  its  natural  environment.  We  tested  the  hypoth- 
esis that  acute  exposure  to  hypercapnic  hypoxia  (HH)  alters 
the  crab's  ability  to  clear  a  pathogenic  bacterium.  Vibrio 
campbellii  90-69B3,  from  the  hemolymph.  Adult  male 
crabs  were  held  in  normoxia  (well-aerated  seawater)  or  HH 
(seawater  with  Po-,  =  4  kPa:  Pco,  =  1.8  kPa;  and  pH  = 
6.7-7. 1 )  and  were  injected  with  2.5  X  104  Vibrio  g~ '  body 
weight.  The  animals  were  held  in  normoxia  or  in  HH  for  45, 
75.  or  210-240  min  before  being  injected  with  Vibrio,  and 
were  maintained  in  their  respective  treatment  conditions  for 
the  120-min  duration  of  the  experiment.  Vibrio  colony- 
forming  units  (CPU)  ml  '  hemolymph  were  quantified  be- 
fore injection,  and  at  10.  20.  and  40  min  afterward.  Total 
hemocytes  (THC)  ml  '  of  hemolymph  were  counted  24  h 
before  (  —24  h).  and  at  10  and  120  min  after  injection.  Sham 
injections  of  saline  produced  no  change  in  the  bacterial  or 
hemocyte  counts  in  any  treatment  group.  Among  the  groups 
that  received  bacterial  injections.  Vibrio  was  almost  com- 
pletely cleared  within  1  h,  but  at  10-min  postinjection, 
Vibrio  CPU  ml  '  hemolymph  was  significantly  higher  in 
animals  held  in  HH  for  75  and  210-240  min  than  in  those 
held  in  normoxia.  Within  10  min  after  crabs  were  injected 
with  bacteria.  THC  ml  '  significantly  decreased  in  control 
and  HH45  treatments,  hut  not  in  the  HH75  and  HH2 10-240 
treatments.  By  120  min  after  injection  of  bacteria,  hemocyte 
counts  decreased  in  all  but  the  HH45  group.  These  data 
demonstrate  that  HH  significantly  impairs  the  ability  of  blue 


Received  2  Dccemher  20113;  accepted  X  April  2004. 

I'o   whom   tuiivs|>omK      e   should   he   addressed.   E-mail:   hurnettlts1 
cotc.edu 

Abbreviations:  ('Ft',  colony  toimm;j  unit:  HH,  hypercapnic  hypoxia; 
PPO.  prophenoloudase:  THC.  lotal  hemocyte  count. 


crabs  to  clear  Vibrio  from  the  hemolymph.  These  results 
also  suggest  that  HH  alters  the  normal  role  of  circulating 
hemocytes  in  the  removal  of  an  invading  pathogen. 

Introduction 

Where  they  occur  naturally  in  coastal  waters,  hypoxia 
(low  oxygen)  and  hypercapnia  (high  carbon  dioxide)  are 
believed  to  contribute  to  outbreaks  of  infectious  disease, 
such  as  mycobacteriosis  in  fish  (Rhodes  et  ai,  2001)  and 
infections  with  a  protozoan  parasite  in  oysters  (Anderson  et 
nl..  1998).  The  effects  of  hypoxia  and  hypercapnic  hypoxia 
(HH)  on  disease  susceptibility  are  likely  to  be  multiple  and 
complex,  changing  not  only  respiration  and  circulation,  but 
also  immune  defense  (Burnett,  1997).  In  laboratory-based 
studies,  we  and  others  have  shown  that  hypoxia  and  HH  can 
increase  the  rate  of  mortality  in  penaeid  or  palaemonid 
shrimp  injected  with  live  bacterial  pathogens  (Le  Moullac  et 
til..  1998;  Mikulski  et  ai.  2000).  Here  we  asked  whether 
levels  of  dissolved  d  and  CO^  that  increase  mortality  rates 
in  shrimp  also  reduce  the  rate  at  which  live  bacteria  are 
removed  from  the  hemolymph  of  another  crustacean  spe- 
cies, Callinectes  sapidus  Rathbun,  1896.  the  Atlantic  blue 
crab. 

Crustaceans  employ  a  broad  spectrum  of  soluble  (hu- 
moral) factors  in  immune  defense,  including  non-self  rec- 
ognition proteins,  immediate  defense  molecules  such  as 
clotting  proteins  and  prophenoloxidase,  and  antimicrobial 
peptides  (reviewed  by  Bachere  1998,  2000).  Many  of  these 
humoral  factors  are  produced,  stored,  and  released  from 
hemocytes — the  major  cellular  components  of  the  crusta- 
cean immune  system.  In  addition,  hemocytes  can  adhere  to 
a  pathogen,  triggering  phagocytosis  and  production  of 
highly  toxic  reactive  oxygen  species  (Song  and  Hsieh. 
1994;  Gargioni  and  Barracco.  1998;  Munoz  el  til..  2000). 


18X 


CLEARANCE  OF  BACTERIA  IN  BLUE  CRABS 


189 


In  well-aerated  normoxic  water,  crustaceans  rapidly  re- 
move bacteria  or  other  large  particles  from  the  hemolymph. 
with  a  coordinate  drop  in  the  total  hemocyte  count  per 
milliliter  of  hemolymph  (THC  ml"1)  (White  and  Ratcliffe, 
1982;  Martin  et  ol..  1993).  Smith  and  Ratcliffe  (1980)  and 
Martin  et  al.  (1993,  1998)  have  suggested  that  hemocytes 
aggregate  with  injected  particles  to  form  nodules  that  be- 
come trapped  in  small  capillary  beds  of  well-vascularized 
tissues  such  as  the  gill  and  the  hepatopancreas.  This  aggre- 
gation is  believed  to  involve  non-self  recognition  proteins, 
prophenoloxidase  (PPO),  and  antimicrobial  peptides.  In 
contrast,  van  de  Braak  et  al.  (2002)  presented  evidence  that 
hemocytes  become  fixed  in  peripheral  organs  before  taking 
up  bacteria  by  phagocytosis. 

After  shrimp  received  an  injection  of  pathogenic  bacteria, 
those  held  in  hypoxia  (Le  Moullac  et  al..  1998)  or  HH 
(Mikulski  et  al.,  2000)  had  higher  rates  of  mortality  than 
animals  held  under  normoxic  conditions.  Several  mecha- 
nisms underlie  the  effects  of  dissolved  gasses  on  the  sus- 
ceptibility of  organisms  to  a  pathogen.  Hypoxia  and  hyper- 
capnia  can  suppress  several  key  components  of  the 
invertebrate  immune  system  that  are  responsible  for  killing 
and  clearing  bacterial  pathogens  from  tissues.  In  penaeid 
shrimp,  both  hypoxia  (Le  Moullac  et  al..  1998)  and  HH 
(Mikulski  et  al.,  2000)  induced  significant  decreases  in  THC 
mP1  hemolymph  while  also  decreasing  resistance  to  bac- 
terial pathogens.  Low  O2  and  low  pH  (induced  by  high 
CO2)  independently  and  additively  suppressed  /;;  vitro  pro- 
duction of  reactive  oxygen  species  by  oyster  hemocytes 
(Boyd  and  Burnett,  1999).  and  hypoxia  suppressed  phago- 
cytosis in  the  blue  shrimp  Litopenaeus  stylirostris  (Le 
Moullac  et  al.,  1998).  However,  the  complexity  of  the 
immune  responses  in  the  whole  organism  makes  it  difficult 
to  attribute  changes  in  disease  outcome  to  any  specific 
defense  mechanism. 

As  an  alternative  approach  to  understanding  the  effects  of 
dissolved  O2  and  CO2  on  susceptibility  to  microbial  patho- 
gens in  crustaceans,  we  tested  whether  hypoxia  and  hyper- 
capnia  can  suppress  the  ability  of  the  blue  crab  to  eliminate 
live  bacteria  from  its  hemolymph.  We  chose  blue  crabs 
because  they  are  hearty  organisms  that  are  abundant  in 
estuaries  where  levels  of  oxygen  and  carbon  dioxide  fluc- 
tuate, and  they  can  easily  tolerate  experimental  manipula- 
tions such  as  a  bacterial  injection  and  multiple  samplings  of 
hemolymph.  Animals  with  prior  exposure  to  HH  for  0,  45. 
75,  or  210-240  min  were  injected  with  live  Vibrio  cainp- 
bellii  or  saline  and  were  maintained  in  HH.  For  control 
groups,  crabs  were  held  in  normoxia  before  and  after  injec- 
tion with  the  same  dose  of  live  bacteria  or  saline.  One  day 
before  injection  (-24  h)  and  at  10,  20,  and  40  min  after 
injection,  we  monitored  the  number  of  colony-forming  units 
(CPU)  of  bacteria  ml"1  hemolymph.  We  also  monitored 
THC  mP1  of  all  experimental  animals  at  -24  h,  10  min. 


and  120  min  postinjection  and  compared  the  responses  of 
their  circulating  hemocytes  to  bacterial  challenge. 

Materials  and  Methods 

Male  blue  crabs  were  trapped  in  the  creeks  of  Charleston 
Harbor,  Charleston,  South  Carolina  and  transported  to  the 
Grice  Marine  Laboratory  where  they  were  held  in  recircu- 
lating  seawater  at  25  ppt  salinity  and  24-26  °C.  The  crabs 
weighed  between  92  and  236  g  and  were  held  for  a  mini- 
mum of  3  days  prior  to  experimentation,  but  no  longer  than 
10  days.  The  animals  were  fed  frozen  fish  or  shrimp  each 
day,  but  food  was  withheld  for  at  least  24  h  before  the 
experiments  began. 

Preparation  of  the  crabs  for  treatment 

A  1-mm  hole  was  drilled  in  the  carapace  directly  over  the 
heart,  creating  a  port  through  which  saline  alone,  or  saline 
containing  bacteria,  was  injected  directly  into  the  ventricle. 
The  bacteria  injected  into  the  heart  would  then  be  rapidly 
distributed  throughout  the  circulatory  system.  Two  similar 
holes  were  drilled  over  the  pericardium  adjacent  to  the  heart 
through  which  hemolymph  was  withdrawn  from  the  peri- 
cardium. Two  holes  were  drilled  in  case  we  could  not  easily 
withdraw  hemolymph  from  one  hole.  A  thin  layer  of  latex 
rubber  was  glued  over  each  hole  with  cyanoacrylate  glue.  A 
needle  could  be  inserted  into  each  hole  through  the  rubber 
diaphragm  and  withdrawn  easily  without  causing  bleeding. 
These  procedures  were  performed  2  days  prior  to  experi- 
mentation. 

Intracardiac  (postbranchial)  injection  of  bacteria 

The  postbranchial  point  of  injection  used  in  the  present 
study  is  distinct  from  that  used  by  others  who  injected 
pathogens  into  muscle  tissues  (Alday-Sanz  et  al.,  2002)  or 
sinuses  downstream  from  the  heart  (Smith  and  Ratcliffe, 
1980;  Martin  et  al..  1993.  van  de  Braak  et  a!.,  2002). 
Injecting  bacteria  directly  into  the  single-chambered  heart 
ensures  that  the  bacteria  will  be  rapidly  and  evenly  distrib- 
uted throughout  the  circulatory  system.  The  heart  of  the  blue 
crab  distributes  hemolymph  through  seven  major  arteries 
(McGaw  and  Reiber.  2002),  and  the  high  cardiac  output 
typical  of  crabs  (McMahon  and  Burnett,  1990)  ensures  a 
uniform  distribution  throughout  the  crab's  circulatory  sys- 
tem, as  shown  by  studies  using  thermal  dilution  techniques 
(Burnett  et  al.,  1981 ). 

The  effects  of  acute  exposure  to  HH  on  the  cardiac  output 
of  C.  sapidus  are  unknown,  but  acute  hypoxia  causes  a 
reduction  in  heart  rate  of  about  25%  (deFur  and  Mangum. 
1979).  Cardiac  output  in  crustaceans  is  often  strongly  influ- 
enced by  changes  in  cardiac  stroke  volume  rather  than  heart 
rate,  but  even  with  a  25%  reduction  in  cardiac  output, 
mixing  and  circulation  of  bacteria  injected  into  the  ventricle 


190 


J.   D.   HOLMAN  ET  AL 


would  still  he  rapid.  Injection  of  bacteria  into  the  heart 
avoids  the  localization  of  pathogens  that  can  occur  for 
reasons  not  specifically  associated  with  normal  routes  of 
clearance  by  the  whole  organism.  For  example,  injecting 
pathogens  into  the  infrabranchial  sinus,  which  supplies  he- 
molymph  to  one  or  more  gills,  may  bias  the  observed  role  of 
the  gill  in  pathogen  clearance.  In  the  present  study,  sam- 
pling hemolymph  from  the  pericardia!  sinus,  which  is  im- 
mediately downstream  from  the  gill,  ensured  that  the  bac- 
teria sampled  had  made  a  complete  circuit  through  the 
circulatory  system. 

Preparation  of  the  pathogen 

The  bacterial  pathogen  used  in  these  studies  was  Vibrio 
campbellii  90-69B3,  which  was  originally  isolated  from 
diseased  shrimp  by  D.  Lightner  and  L.  Mahone  (University 
of  Arizona).  The  16S  rRNA  sequence  of  this  strain  places  it 
in  the  V.  parahaemolyticus/V,  hcin'eyi  family  with  99% 
identity  to  V.  campbellii  (unpubl.  data,  Eric  Stabb,  Univer- 
sity of  Georgia).  For  each  assay,  V.  campbellii  90-69B3 
(hereafter  referred  to  as  V.  campbellii)  was  thawed  from 
frozen  aliquots.  streaked  onto  tryptic  soy  agar  (TSA)  + 
2.5%  NaCl,  and  incubated  overnight  at  25  °C.  A  separate 
aliquot  was  used  for  each  assay.  A  wooden  applicator  stick 
was  used  to  transfer  the  bacteria  from  the  culture  plate  to 
sterile  2.5%  NaCl  buffered  with  10  mmol  l~]  HEPES 
adjusted  to  pH  7.6  (HEPES  saline).  The  concentration  til  I'. 
caniphcllii  was  adjusted  to  an  optical  density  of  0.1  at  540 
nm  (OD54(lnm).  This  OD540nm  had  previously  been  deter- 
mined to  equal  1.0X  1 0s  CPU  ml'1  (Mikulski  etui..  2000). 
The  bacterial  suspension  was  then  diluted  with  HEPES 
saline  to  obtain  the  desired  dose  for  injection. 

Assexsmcnt  of  baseline  conditions 

One  day  (i.e.,  -24  h)  before  each  bacterial  challenge 
experiment,  two  100-ju.l  samples  of  hemolymph  were  with- 
drawn through  the  pericardia!  sampling  port.  One  sample 
was  used  to  determine  whether  the  crab  had  detectable 
levels  of  live,  culturable  bacteria  in  the  hemolymph.  as 
measured  in  the  CFU  assay.  The  other  sample  was  used  to 
determine  the  THC  ml  '  in  the  hemolymph.  To  measure 
CFU  ml"  ',  one  part  of  hemolymph  was  diluted  with  9  parts 
HEPES  saline.  A  150-jul  sample  of  this  mixture  was  sus- 
pended in  marine  agar  and  plated  over  TSA  and  TCBS 
(thiosulfate  citrate  bile  sucrose)  agar  plates.  TSA  supports 
the  growth  of  a  wide  range  of  bacteria:  TCBS  agar  is  more 
selective,  and  supports  the  growth  of  a  few  species  of 
l:\clicricliiu  anil  Vibrio,  including  V.  campbellii.  Plates 
were  incubated  at  25  "C  for  24  h,  at  which  time  the  number 
of  bacterial  colonies  \\as  counted  and  recorded.  For  each 
hemolymph  sample,  bacterial  colonies  on  three  replicate 
plates  were  counted  and  averaged.  CFU  ml"1  was  calcu- 
lated according  to  the  formula  CFU  plate"'  X  10  dilution 


factor/0.15  ml,  where  CFU  is  the  average  number  of  bac- 
terial colonies  counted  on  three  replicate  TCBS  plates  for 
each  0. 15-ml  hemolymph  sample  diluted  10-fold  in  saline 
prior  to  plating.  Only  crabs  whose  hemolymph  had  no  CFU 
on  TSA  or  TCBS  plates  at  the  —  24  h  time  point  were  used 
in  these  experiments.  The  frequency  with  which  CFU  are 
detected  in  the  hemolymph  of  crabs  collected  from  the  Held 
varies  considerably  with  the  season.  During  early  to  mid- 
summer, when  these  experiments  were  performed,  about 
10%  to  15%  were  positive  for  CFU  in  the  hemolymph  at 
—  24  h  and  were  rejected  for  experimental  use.  The  same 
assay  was  used  to  determine  CFU  ml"'  in  hemolymph 
samples  taken  from  crabs  after  injection  of  V.  campbellii  or 
saline,  except  that  the  marine  agar  containing  the  diluted 
hemolymph  sample  was  plated  only  on  TCBS  plates.  This 
provided  a  measure  of  assurance  that  the  bacterial  colonies 
being  counted  in  the  hemolymph  arose  from  the  injected 
bacteria. 

The  THC  ml  '  in  a  hemolymph  sample  was  determined 
as  follows.  Hemolymph  (100  /u,l)  was  drawn  into  a  syringe 
containing  900  /u.1  of  ice-cold  10%  neutral  buffered  formalin 
(Mix  and  Sparks,  1980).  After  mixing,  an  aliquot  of  the 
hemocyte  suspension  was  transferred  to  a  hemocytometer 
for  direct  counting.  Hemocytes  were  counted  in  three  sep- 
arate aliquots  of  each  hemolymph  sample  and  averaged  for 
each  crab  at  each  time  point  in  these  experiments. 


Experimental  protocol 

In  a  typical  experiment  (Fig.  1 ),  a  crab  was  transferred  to 
a  17-1  glass  aquarium  in  which  oxygen  and  carbon  dioxide 
levels  were  regulated  (Mikulski  <•/  <//..  2000).  For  all  exper- 
iments, the  seawater  was  at  first  aerated  vigorously;  and  for 
treatments  in  normoxia,  crabs  were  held  in  this  well-aerated 
water  (20.7  kPa  />o,  and  <0.()6  kPa  /Vo,)  throughout  the 
experiment.  At  the  start  of  all  HH  treatments,  the  oxygen 
and  the  carbon  dioxide  pressures  of  the  water  were  regu- 
lated (Mikulski  et  al..  2000)  to  achieve  values  of  4  kPa  Po2 
and  1 .8  kPa  Pco->  within  20  to  30  min.  The  crabs  were  held 
in  HH  for  one  of  three  durations  prior  to  injection  of 
bacteria  (45,  75,  and  between  210  and  240  min),  and  they 
remained  in  these  HH  conditions  throughout  the  experiment 
(Fig.  1).  The  crabs  were  injected  with  V.  campbellii  sus- 
pended in  HEPES  saline.  The  bacterial  suspension  (between 
40  ju.1  and  140  jiil.  depending  on  the  size  of  the  crab)  was 
injected  directly  into  the  ventricle.  Control  animals  from  the 
normoxia  treatment  were  injected  with  the  same  dose  of 
bacteria. 

Crabs  were  injected  with  2.5  X  104  bacteria  g"'  body 
weight,  to  achieve  a  circulating  dose  of  1.0  X  K)"1  V. 
campbellii  ml  '  of  hemolymph.  assuming  a  hemolymph 
volume  of  25  ml  100  g~ '  body  weight  (Gleeson  and 
Zubkoff.  1977).  The  dose  is  slightly  below  the  LD50  for 


CLEARANCE  OF  BACTERIA  IN  BLUE  CRABS 


191 


Well  aerated 


HH210-240 


HH75 


HH45 


I-08, 


_    £    £ 

E 

E 

SOD 

3 

0 

U. 

I 

£     K    O 

O 

-240          -120  0    10  20         40         60 

Time  (min) 


120 


Figure  1.  An  illustration  of  the  experimental  design,  indicating  the 
timing  of  exposure  to  hypercapnic  hypoxia  (HH),  bacterial  injection,  and 
hemolymph  withdrawal  along  with  subsequent  analyses.  Crabs  were  placed 
in  experimental  tanks  and  HH  treatments  were  initiated  at  different  times 
prior  to  the  injection  of  bacteria,  which  is  indicated  at  time  =  0.  For 
example,  in  the  HH210-240  treatment,  HH  was  initiated  between  210  and 
240  minutes  before  injection  and  maintained  until  120  min  after  injection. 
The  normoxia  group  was  held  in  well-aerated  water  before  and  after  the 
injection  of  bacteria.  For  the  sham  injection  treatment,  crabs  were  held  in 
one  of  the  HH  treatments  or  in  normoxia,  then  were  injected  with  HEPES- 
saline  at  time  =  0,  and  maintained  in  the  same  treatment  condition  for  120 
min  after  injection.  Hemolymph  samples  were  taken  from  animals  in  all 
treatment  groups  at  the  same  time  points  and  for  the  same  assays  as 
illustrated. 

juveniles  of  the  penaeid  shrimp  Litopenaeus  vannamei 
(Mikulski  el  «/.,  2000). 

After  the  bacteria  were  injected,  animals  in  HH  treat- 
ments were  maintained  in  HH  and  those  in  normoxic  treat- 
ments were  held  in  normoxia.  Hemolymph  was  sampled 
from  the  pericardium  of  each  crab  at  10,  20,  40,  and  120 
min.  Preliminary  experiments  indicated  that  these  time 
points  would  be  optimal  for  discerning  the  impacts  of  HH 
on  hemocyte  counts  and  bacterial  clearance.  At  the  10-min 
time  point,  two  hemolymph  samples  were  withdrawn  from 
the  pericardium.  One  unfixed  sample  was  used  to  quantify 
the  Vibrio  CPU  ml"1  remaining  in  the  hemolymph,  as 
described  above.  The  other  sample  was  fixed  in  formalin 
and  used  to  quantify  THC  ml"1  hemolymph,  as  described 
above.  At  the  20-min  and  40-min  time  points,  hemolymph 
was  sampled,  and  the  number  of  CPU  ml" '  was  determined 
again.  Finally,  a  sample  of  hemolymph  taken  at  120  min 
was  fixed  in  formalin  to  monitor  THC  ml" '.  The  crab  was 
then  removed  from  the  aquarium,  frozen,  and  ultimately 
autoclaved  and  discarded. 

To  control  for  the  effects  of  injection  and  hemolymph 
sampling,  sham  experiments  were  performed  for  each  treat- 
ment (normoxia,  HH45,  HH75,  and  HH2 10-240)  by  inject- 


ing a  sterile  solution  of  HEPES  saline  into  the  ventricle  as 
described  above.  Hemolymph  was  sampled  at  the  time 
points  indicated  above  (Fig.  1),  and  V.  campbellii  and  he- 
mocytes  were  quantified.  During  all  injections  and  sam- 
plings, the  animals  remained  submerged  in  the  aquarium, 
either  in  normoxic  or  HH  water,  with  minimal  disturbance. 
The  crab  was  near  the  top  of  the  17-1  aquarium  on  a  plastic 
platform,  where  it  was  completely  immersed  and  free  to 
move.  To  inject  bacteria  or  sample  hemolymph,  the  crab 
remained  immersed  but  was  lifted  so  that  the  injection  or 
sampling  ports  on  its  carapace  were  raised  to  the  surface  of 
the  water. 

Aseptic  techniques  were  used  when  working  with  the 
bacteria,  and  all  waste  material  was  autoclaved  or  disin- 
fected with  2%  chlorine  bleach.  Experimental  tanks  were 
rinsed  with  2%  bleach  daily,  and  the  filtration  systems  were 
rinsed  with  fresh  water  daily. 

Data  analysis 

SigmaStat  3.0  software  was  used  to  perform  all  statistical 
analyses.  To  determine  whether  the  amount  of  bacteria  in 
the  hemolymph  changed  as  a  function  of  time  after  injec- 
tion, a  one-way  ANOVA  was  performed  on  the  V.  camp- 
bellii CPU  ml  '  hemolymph  at  10,  20,  and  40  min  within 
each  treatment  group.  All  tests  for  normality  (Kolmogorov- 
Smirnov  test)  failed;  therefore,  a  Kruskal-Wallis  ANOVA 
on  ranks  test  was  used.  When  differences  within  a  treatment 
group  were  detected,  the  Student-Newman-Keuls  method 
was  used  for  multiple  comparisons  between  individual  time 
points. 

To  determine  whether  there  were  differences  at  individ- 
ual times  among  treatment  groups,  a  one-way  ANOVA  was 
performed  on  CPU  ml  " '  data  at  1 0,  20,  and  40  min  across 
all  treatment  groups  (normoxia,  HH45,  HH75,  and  HH210- 
240).  As  above,  all  tests  for  normality  (Kolmogorov-Smir- 
nov  test)  failed,  so  a  Kruskal-Wallis  ANOVA  on  ranks  test 
was  used.  When  the  test  indicated  a  significant  effect  of 
treatment  within  a  time,  a  Dunn's  test  was  used,  because  of 
unequal  sample  sizes,  to  compare  HH  treatments  with  the 
normoxic  value. 

To  determine  whether  there  were  differences  in  THC 
ml" '  at  one  day  prior  to  the  initiation  of  the  experiments,  a 
one-way  ANOVA  was  performed  for  the  crabs  across  all 
normoxic  and  HH  treatments.  For  subsequent  analysis,  THC 
ml"  '  data  at  10  and  120  min  were  normalized  to  the  —  24  h 
counts  for  an  individual  crab.  A  one-way  ANOVA  was 
performed  on  normalized  THC  ml " '  for  each  normoxic  and 
HH  treatment  group  as  a  function  of  time  after  sham  and 
bacterial  injections.  All  tests  for  normality  (Kolmogorov- 
Smirnov  test)  or  equal  variances  failed  and,  therefore,  a 
Kruskal-Wallis  ANOVA  on  ranks  test  was  used.  When  a 
significant  effect  of  time  within  a  treatment  group  was 
indicated,  a  comparison  of  10-min  and  1 20-min  counts  with 


192 


J.  D.  HOLMAN  ET  AL 


-24  h  counts  was  performed  using  Dunnett's  test  (equal 
sample  sizes). 

Results 

Clearance  of  bacteria  from  the  hemolymph 

The  theoretical  maximum  Vibrio  CPU  mP1  hemolymph 
after  injection  is  1  X  105  ml"1.  This  value  is  based  on  the 
known  number  of  bacteria  injected  and  assumes  a  homoge- 
neous distribution  of  bacteria  in  the  hemolymph  as  well  as 
a  hemolymph  volume  of  25  ml  per  100-g  crab  (Gleeson  and 
Zubkoff,  1977).  Patterns  of  bacterial  clearance  were  similar 
in  all  treatment  groups:  when  the  crabs  were  injected  with 
bacteria.  V.  campbellii  CPU  ml"1  hemolymph  declined 
precipitously  to  very  low  levels  within  10  min  after  injec- 
tion and  became  almost  undetectable  after  40  min  (Table  1, 
Fig.  2).  Even  though  most  of  the  bacterial  clearance  oc- 
curred before  the  10-min  measurement,  the  decrease  be- 
tween the  CPU  ml" '  at  10  min  and  the  value  at  40  min  was 
significant  in  all  treatment  groups.  Comparisons  between  10 
and  20  min  and  between  20  and  40  min  revealed  significant 
differences  in  some,  but  not  all.  cases  (Table  1.  Fig.  2). 

Comparisons  of  different  treatments  at  single  time  points 
after  injection  of  V.  campbellii  revealed  significant  differ- 
ences in  CPU  ml"1  at  10  min  between  the  normoxic  treat- 
ment and  the  HH75  treatment  and  between  the  normoxic 
treatment  and  the  HH210-240  treatment  (Kruskal-Wallis 
ANOVA  on  ranks  and  Dunn's  multiple  comparison  proce- 
dure. P  =  0.002):  but  there  were  no  differences  between  the 
normoxic  and  the  HH45  treatments  (Fig.  2).  With  treatment 
as  a  variable,  differences  were  detected  20-min  postinjec- 
tion  (Kruskal-Wallis  ANOVA  on  ranks.  P  =  0.027).  but  no 
differences  among  the  individual  treatments  were  found 


Table  1 

Statistical  analysis  of  the  cnlony-fi>rminx  units  (CFUl  ml~'  of  Vibrio 
campbellii  in  the  hemnlymph  nfcrnhs  at  different  times  following 
injection 

P  value:  Pairwise 

comparisons  using  Student- 

Newman-Keuls  method 


P  value: 

Kruskal-Wallis 

10  and 

10  and 

20  and 

Treatment 

n 

ANOVA 

20  min 

40  min 

40  min 

Normoxia 

8 

0.005 

NS 

<0.05 

NS 

HH45 

4 

0.005 

NS 

<0.05 

<0.05 

HH75 

7 

<  0.001 

•  0.05 

<0.05 

<0.05 

HH2  10-240 

0 

().()(  IX 

(Ills 

<0.05 

NS 

4000  - 

-• 

* 

^ 

E 

3000  - 

HH75     Q 

"\ 

LL 

o_ 

2000  - 

HH21  0-240  %  \ 
\\ 

o 

A 

k. 
.0 

1000  - 

HH45     Jl             ^-                            L 

Normoxia     •~^>^?~  ~-  —  —  __ 

0  - 

5 

10  20  30 

Time  (min) 


40 


Tests  for  normality  failed  on  one-way  ANOVA:  therefore,  data  within  a 
treatment  group  were  tested  for  differences  usinn  a  Kruskal-Wallis 
ANOVA  on  ranks.  Values  at  different  time  intervals  within  a  treatment 
were  compared  pairwise  usini.'  the  Student-Newman-Keuls  method.  HH. 
hypercapnic  hypoxia:  NS.  nonsignificant. 


Figure  2.  Colony-forming  units  (CPU)  ml  '  of  Vibrio  campbellii 
circulating  in  the  hemolymph  at  different  times  after  injection  plotted  as  a 
function  of  treatment  in  well-aerated  normoxic  water  or  in  hypercapnic 
hypoxia  water  (Pco,  =  1.8  kPa.  Po2  =  4  kPa).  Crabs  were  exposed  to 
normoxia  or  to  hypercapnic  hypoxia  (HH)  for  different  times  (given  in 
minutes),  then  injected  with  bacteria  at  time  =  0.  and  for  the  subsequent 
duration  of  the  experiments  were  held  in  well-aerated  (normoxia)  or  HH 
water.  At  time  =  0.  crabs  were  injected  with  2.5  x  104  V.  campbellii  g~' 
body  weight  to  achieve  a  theoretical  circulating  concentration  of  100  X  103 
CPU  (colony-forming  units)  mr1  hemolymph.  Levels  of  bacteria  in  he- 
molymph (CPU  ml"1)  are  shown  at  10.  20.  and  40  min  after  injection. 
Mean  values  ±  standard  error  are  shown.  Significant  differences  between 
the  normoxic  treatment  and  the  HH  treatment  occurred  only  at  10  min  after 
injection  and  are  indicated  by  an  asterisk  (*). 


using  Dunn's  multiple  comparison  procedure.  No  differ- 
ences were  detected  among  treatments  at  40-min  postinjec- 
tion  when  treatment  was  used  as  a  variable  (Kruskal-Wallis 
ANOVA  on  ranks.  P  =  0.131 ).  No  bacterial  colonies  were 
detected  at  any  time  in  the  hemolymph  samples  from  ani- 
mals that  received  sham  injections  of  saline  (data  not 
shown). 

Hemocyte  counts 

The  THC  ml  '  in  hemolymph  of  crabs  prior  to  treatment 
( -24  h)  was  the  same  across  all  treatment  groups  (ANOVA, 
P  =  0.557:  Figs.  3  and  4).  No  treatment  group  that  received 
a  sham  injection  (H  =  17)  showed  a  significant  difference  in 
circulating  hemocyte  counts  at  any  time  (Kruskal-Wallis 
ANOVA  on  ranks.  P  >  0.155.  Fig.  3).  THC  ml  '  of 
animals  held  in  normoxia  (well-aerated  conditions)  declined 
significantly  10  and  120  min  after  injection  with  V.  camp- 
hcllii  (Table  2;  Fig.  4).  Circulating  hemocyte  counts  de- 
clined in  the  HH  45  (hypercapnic  hypoxia  45-min)  treat- 
ment group  10  min  after  injection  of  V.  campbellii,  but  at 
120  min.  the  count  was  not  detectably  different  from  the 
baseline  count  at  -24  h  (Table  2.  Fig.  4).  When  crabs  were 
held  in  HH  lor  75  min  and  then  injected  with  V.  campbellii. 
there  was  no  change  in  THC  ml~ '  after  10  min,  but  the 
hemocyte  concentration  declined  significantly  after  120 


CLEARANCE  OF  BACTERIA  IN  BLUE  CRABS 


193 


120x106 


Saline  Sham  Treatments 


100x106  - 


£       80x1 O6  - 
CO 

« 

•?,     60x1 O6  - 

u 

o 

I       40x1 O6  - 

X 

20x1 O6  - 


"~ 

|  Normoxia 

£3  HH45 

1-fJ 

fj  HH75 

I 

IK  HH210-240 
" 

I 

i 

i 

/ 

X 

X 
X 
X 

x 

X 

X 

x 

1 

'//////////////A 

T 

1    xy 

i         i         1         i         i 

-24  hours 


60 


120 


Time  (min) 


Figure  3.  Total  hemocyte  counts  (THC)  ml  '  of  hemolymph  in  crabs 
one  day  prior  to  treatment  (-24  h)  and  10  and  120  min  after  injection  of 
saline  in  four  treatment  groups.  Normoxia  =  crabs  in  well-aerated  water, 
HH  treatments  =  hypercapnic  hypoxia  (Po2  =  4  kPa,  Pco2  =  1.8  kPa) 
administered  for  45.  75,  and  210-240  min  before  the  saline  injection  at 
time  =  0.  No  significant  differences  were  detected  within  any  treatment 
between  pre-injection  (  —  24  h)  THC  ml~'  and  postinjection  values  at  10 
and  120  min.  Mean  values  +  standard  error  are  shown. 


min.  The  same  pattern  of  response  occurred  when  crabs 
were  incubated  in  HH  for  210-240  min  and  then  injected 
with  V.  campbellii  (Table  2;  Fig.  4). 

Discussion 

Minutes  after  being  injected  with  Vibrio  campbellii.  blue 
crabs  rapidly  remove  the  bacteria  from  their  hemolymph. 

Vibrio  Treatments 


|   Normoxia 

100x106  - 

0    HH45 

"E        80x1  06  - 

in 

0) 
Ix       60x106  - 

1 

I 

| 

D  HH75 

g    HH21  0-240 

u 
o 

^ 

^ 

I 

E        40x1  O6  - 

X 

^ 

X 

X 

T                                *    .. 

20x106  - 

•' 

X 

s 

|T 

N                                                 •       K  I 

X 

•X 

X; 

Bv 

x 

•v 

x 

H/ 

/ 

•0 

v                                          ^B^    loj 

SS       |!              '              '              i              '              ' 

-24  hours 


0  60 

Time  (min) 


120 


Figure  4.  Total  hemocyte  counts  (THC)  ml  '  of  hemolymph  in  crabs 
before  treatment  (  —  24  h)  and  10  and  120  min  after  injection  of  Vibrio 
campbellii  in  four  treatment  groups.  Normoxia  =  crabs  in  well-aerated 
water,  HH  treatments  =  hypercapnic  hypoxia  (Po2  =  4  kPa,  Pco2  =  1.8 
kPa)  administered  for  45,  75,  and  210-240  min  before  the  injection  of 
bacteria.  Significant  differences  within  a  treatment  between  pre-injection 
(-24  h)  THC  mP1  and  postinjected  values  at  10  and  120  min  are  indicated 
by  an  asterisk  (*).  Mean  values  +  standard  error  are  shown. 


Table  2 

Statistical  analysis  of  total  hemocyte  counts  ml 
injection  of  Vibrio  campbellii 


(THC  ml'1 1  following 


P  value: 

Comparison  with 

pretreatment  using 

Dunnett'x  method 

P  value:  Kruskal-Wallis 

Treatment 

n 

ANOVA 

10  min         120  min 

Normoxia 

8 

0.002 

<0.05           <0.05 

HH45 

4 

-   0.001 

<0.05              NS 

HH75 

7 

•   0(101 

NS              <0.05 

HH2  10-240 

9 

0.044 

NS              <0.05 

Data  were  normalized  to  pretreatment  (  —  24  h)  THC  ml  '  and  compared 
as  a  function  of  time.  Tests  for  normality  or  equal  variances  failed  on 
one-way  ANOVA:  therefore,  data  within  a  treatment  group  were  tested  for 
differences  using  a  Kruskal-Wallis  ANOVA  on  ranks.  THC  mP '  at  10  and 
120  min  after  injection  were  then  compared  to  pretreatment  numbers  using 
Dunnett's  method.  HH,  hypercapnic  hypoxia:  NS.  nonsignificant. 

For  animals  held  in  well-aerated  water,  this  rapid  clearance 
of  bacteria  is  associated  with  a  significant  decline  in  the 
concentration  of  circulating  hemocytes.  The  present  study 
demonstrates  that  bacterial  clearance  from  the  hemolymph 
of  blue  crabs  is  reduced  when  the  animals  are  held  in  water 
that  is  hypercapnic  and  hypoxic.  Moreover,  this  reduced 
ability  to  clear  bacteria  is  associated  with  a  slower  decline  in 
circulating  hemocytes  after  injection  of  bacteria.  Taken 
together,  these  findings  suggest  that  the  low-oxygen  and 
acidic  internal  milieu  of  a  blue  crab  exposed  to  hypercapnic 
hypoxia  may  impair  the  mechanisms  responsible  for  clear- 
ing pathogens  from  its  hemolymph. 

The  rapid  removal  of  bacteria  from  the  hemolymph  of  the 
blue  crabs  in  the  present  study  confirms  findings  in  other 
crustacean  species  (Merrill  ct  ai.  1979;  Smith  and  Ratcliffe, 
1980;  White  and  Ratcliffe,  1982;  Martin  et  al.,  1993;  van  de 
Braak  et  at.,  2002).  The  efficiency  and  the  rate  of  clearance 
vary  with  the  particular  pairing  of  host  and  bacterial  species. 
For  example,  Martin  ct  til.  (1993)  found  that  the  gram- 
positive  bacteria  Bacillus  ccrcus.  B.  subtilis,  and  Aerococ- 
CHS  viridans  were  cleared  to  undetectable  levels  from  the 
hemolymph  of  the  penaeid  shrimp  Sycionia  ingentis  within 
10  min  of  injection.  The  gram-negative  bacteria  Pseudomo- 
nas  fluorescens  and  Vibrio  alginolyticus  were  reduced,  but 
not  eliminated:  7.8%  and  23%,  respectively,  of  the  bacteria 
were  still  free  in  the  hemolymph  one  hour  after  injection. 
The  different  rates  at  which  bacteria  are  cleared  may  reflect 
the  binding  specificity  of  hemolymph  components  such  as 
lectins  ( Vargas- Albores  ct  til.,  1993,  1997),  anti-microbial 
peptides  (Schnapp  ct  u/.,  1996;  Destoumieux  et  al..  1997; 
Khoo  et  al.,  1999;  Bartlett  ct  ai,  2002),  the  prophenoloxi- 
dase  (PPO)  cascade  (Aspan  ct  ai,  1995),  and  hemocytes 
(Gargioni  and  Barracco.  1998). 

The  present  study  demonstrates  that  the  rate  of  bacterial 


194 


J.  D.  HOLMAN  ET  AL 


clearance  from  the  hemolymph  of  blue  crabs  is  reduced 
when  the  animals  are  held  in  water  that  is  hypercapnic  and 
hypoxic.  The  systemic  respiratory  responses  of  blue  crabs  to 
hypoxia  are  well-documented  and  are  typical  of  brachyuran 
crabs  (Burnett,  1992,  1997).  A  quiescent  blue  crab  in  well- 
aerated  water  has  the  high  postbranchial  oxygen  pressures 
(Po,  =  13  kPa)  typical  of  many  water-breathers  (deFur  et 
al..  1990).  Hemolymph  passes  through  the  tissues,  where 
oxygen  is  consumed,  and  returns  to  the  infrabranchial  sinus 
just  before  it  passes  through  the  gills,  where  it  is  oxygen- 
ated. Oxygen  pressures  of  prebranchial  hemolymph  are  as 
low  as  1  kPa  (Booth  et  al.  1982).  Thus,  a  hemocyte  circu- 
lating freely  in  the  hemolymph  is  exposed  to  a  wide  range 
of  oxygen  pressures.  During  hypoxia,  oxygen  pressures  in 
the  hemolymph  fall  to  levels  that,  depending  on  the  severity 
of  the  ambient  Po2.  may  be  very  low.  deFur  et  al.  (1990) 
reported  oxygen  pressures  of  2.4  kPa  in  the  postbranchial 
hemolymph  when  the  ambient  Po,  of  the  water  was  6.7  kPa. 
The  ambient  Po2  used  in  the  present  study  was  lower  (4 
kPa).  forcing  the  hemolymph  oxygen  pressures  to  fall  below 
2.4  kPa.  The  main  point  is  that  the  mechanisms  associated 
with  the  clearance  of  bacteria  must  operate  in  a  very  low- 
oxygen  environment  within  the  crab  when  the  animal  is 
exposed  to  hypoxic  water. 

In  the  present  study,  at  10  min  after  bacterial  injection, 
crabs  in  the  HH75  and  HH2 10-240  treatments  had  signif- 
icantly greater  numbers  of  V.  campbellii  in  the  hemolymph 
than  the  control  crabs  had  (Fig.  2).  Thus,  the  process  of 
bacterial  clearance  is  somehow  inhibited  by  hypercapnic 
hypoxia.  The  bacteria  are  ultimately  cleared  in  all  treat- 
ments, but  it  is  the  rate  of  clearance  that  is  compromised. 
These  data  support  the  idea  that  rapid  clearance  of  live 
bacteria,  whether  by  bactericidal  mechanisms  in  the  hemo- 
lymph or  by  physical  trapping  and  removal  to  peripheral 
sites,  contributes  to  disease  resistance  in  crustaceans  by 
limiting  the  spread  of  free  pathogens  to  other  tissues.  The 
effects  of  hypoxia  on  bacterial  clearance  in  crustaceans  have 
received  limited  attention.  Penaeus  monodon  exposed  to 
hypoxia  (1.8-2.0  mg  1  ~ '.  Po,  =  5.4-6.4  kPa)  cleared  live 
V.  han-eyi  more  slowly  from  the  hemolymph  than  did 
control  animals  (Direkbusarakom  and  Danayadol,  1998). 
However,  results  from  the  treatment  groups  were  highly 
variable,  and  the  authors  questioned  the  health  of  some  of 
the  animals.  The  ability  of  the  freshwater  prawn  Macrohra- 
chinnt  rosenbergii  to  clear  live  Enterococcus  was  signifi- 
cantly decreased  by  exposure  to  hypoxia  (Po2  =  4.4  and  7.0 
kPa)  for  12  h  (Cheng  et  ai.  2002).  Neither  study  (Direk- 
busarakom and  Danayadol,  1998:  Cheng  et  ai.  2002)  re- 
ported the  absolute  numbers  of  bacteria  in  the  hemolymph. 
Since  bacteria  arc  generally  cleared  from  crustacean  hemo- 
lymph within  minutes  to  hours  following  injection,  the 
results  of  these  two  studies  are  difficult  to  compare  with  the 
present  work. 

The  impacts  of  hypercapnia  alone  or  in  combination  with 


hypoxia  on  bacterial  clearance  in  crustaceans  have  been 
largely  neglected.  Mikulski  et  al.  (2000)  reported  that  hy- 
percapnic hypoxia  at  4  kPa  CK,  2  kPa  CO,,  and  a  pH  range 
of  6.8  to  7.0  decreased  survival  following  bacterial  chal- 
lenge in  both  Litopeneaus  vannamei  and  the  grass  shrimp 
Palaemonetes  pitgio. 

The  decline  in  circulating  hemocytes  that  accompanies 
the  clearance  of  injected  bacteria  in  crabs  from  the  nor- 
moxia  treatment  is  consistent  with  the  role  of  this  cell  type 
in  immune  defense  in  crustaceans.  This  effect  mirrors  sim- 
ilar declines  in  the  hemocyte  counts  of  crustaceans  that  have 
been  injected  with  foreign  substances  including  lipopoly- 
saccharide,  /3-1.3  glucan  (laminaran).  or  bacteria  (Smith  and 
Soderhall,  1983;  Persson  et  ai,  1987;  Martin  et  ai.  1993: 
van  de  Braak  et  ai.  2002).  although  this  decline  is  not 
universally  observed  (Destoumieux  et  ai.  2000;  Cheng  and 
Chen,  2001).  Following  injection  of  foreign  matter  into 
crustacean  tissues,  hemocytes  move  into  the  injection  site  to 
seal  the  wound  and  to  trap  and  kill  invading  bacteria  by 
mechanisms  such  as  melanization  (Fontaine  and  Lightner. 
1974;  van  de  Braak  et  ai.  2002).  Several  studies  using  in 
vitro  and  in  vivo  measurements  have  shown  that  hemocytes. 
in  the  presence  of  foreign  particles,  rapidly  associate  with 
each  other  to  form  aggregates,  or  nodules  (Smith  et  al.. 
1984;  Martin  et  al..  1998).  Aggregate  formation  may  be 
mediated  by  lectins  such  as  LPS-binding  protein  and  |3-glu- 
can-binding  proteins  ( Vargas- Albores  et  al..  1993.  1997). 
by  components  of  the  prophenoloxidase  cascade  (Aspan  et 
ai.  1995),  or  by  other  unidentified  receptors  on  hemocytes. 
Martin  et  al.  (1998)  presented  evidence  that  these  aggre- 
gates grow  in  size  by  the  adhesion  of  hemocytes  until  they 
become  trapped  in  the  narrowest  diameter  vessels  of  the 
body.  The  extensive  capillary  network  of  the  gill  that  sup- 
ports respiration  and  osmotic  regulation  appears  to  play  an 
important  role  in  the  trapping  and  removal  of  these  nodules 
(Fontaine  and  Lightner,  1974;  Johnson.  1976:  Smith  and 
Ratcliffe,  1980),  although  this  is  not  observed  in  all  cases 
(van  de  Braak  et  al..  2002).  Aggregates  of  hemocytes  with 
or  without  associated  bacteria  have  also  been  reported  to 
accumulate  in  the  heart,  the  hepatopancreas,  and  the  con- 
nective tissues  of  crabs  (Smith  and  Ratcliffe.  1980)  and 
lobsters  (Factor  and  Beekman.  1990)  and  in  the  lymphoid 
organ  of  penaeid  shrimp  (van  de  Braak  et  ai.  2002). 

No  significant  changes  in  the  concentration  of  hemocytes 
occurred  in  the  hemolymph  of  crabs  in  the  HH75  and 
HH21 0-240  treatments  at  10  min  after  injection  of  bacteria 
(Fig.  4).  It  is  possible  that  low  pH  and  low  O,  inhibited 
aggregate  formation  by  slowing  or  blocking  the  interactions 
of  hemocytes  with  bacteria  or  with  each  other.  An  alterna- 
tive possibility  is  that  hypercapnic  hypoxia  may  have  in- 
duced changes  in  the  process  by  which  aggregates  were 
removed  from  circulation.  Several  important  components  of 
the  innate  immune  system  involve  oxygen,  including  respi- 
ratory burst  reactions  that  generate  toxic  reactive  oxygen 


CLEARANCE  OF  BACTERIA  IN  BLUE  CRABS 


195 


species  and  reactive  nitrogen  species  as  well  as  phenoloxi- 
dase,  the  terminal  enzyme  of  the  PPO  cascade.  Inhibition  of 
the  production  of  reactive  oxygen  species  was  observed  in 
Crassostrea  virginica.  the  Eastern  oyster,  and  was  related 
specifically  to  low  levels  of  oxygen  and  pH.  which  occur 
naturally  in  the  tissues  of  oysters  exposed  to  hypercapnic 
hypoxia  (Boyd  and  Burnett.  1999).  Phagocytic  activity 
(Direkbusarakom  and  Danayadol,  1998)  and  respiratory 
burst  activity  (Le  Moullac  el  al..  1998)  were  decreased  in 
hemocytes  of  Penaeus  monodon  exposed  to  hypoxia  (25%- 
30%  and  15%  air  saturation,  respectively)  as  compared  to 
controls  in  air-saturated  water.  The  latter  study  also  reported 
an  increase  in  PPO  activity  associated  with  low  CK  condi- 
tions. Hemocyte  phagocytosis,  respiratory  burst,  and  PPO 
activity  were  significantly  reduced  in  Macrobrachium 
rosenbergii  exposed  for  24  h  to  hypoxia  (35%  air  saturation: 
Cheng  et  til.,  2002).  Note  that  these  tests  of  immune  func- 
tion in  P.  monodon  and  M.  rosenbergii  were  conducted  in 
vitro  under  air-saturated  conditions  and.  therefore,  do  not 
necessarily  reflect  changes  in  the  /;;  vivo  activity  of  the 
enzymes  involved. 

In  the  present  study,  pre-exposure  to  hypercapnic  hyp- 
oxia for  75  or  210-240  min  significantly  reduced  the  rate  at 
which  blue  crabs  removed  bacteria  from  their  hemolymph. 
These  results  support  the  concept  that  oxygen-dependent 
mechanisms  play  an  important  role  in  the  physical  removal 
and  killing  of  bacterial  pathogens.  The  accumulation  of 
hemocytes  and  bacteria  in  the  gill  that  has  been  observed  by 
others  (Smith  el  al..  1984;  Martin  et  ai,  1998)  may  be  an 
efficient  means  to  assure  optimal  Po2  for  immune  reactions 
such  as  the  respiratory  burst  and  the  PPO  cascade.  A  po- 
tential liability  of  this  accumulation  in  the  gill  is  that  ag- 
gregates of  hemocytes  or  hemocytes  and  bacteria  might 
impede  hemolymph  flow  in  the  microvasculature  of  the  gill 
lamellae,  reducing  hemolymph  oxygenation  and  pH.  This 
line  of  reasoning  leads  to  the  suggestion  that  tissues  of  the 
blue  crab,  and  other  crustaceans,  may  become  hypoxic  as  a 
consequence  of  mounting  an  immune  defense  against  a  new 
pathogen  or  during  an  active  infection.  Prior  exposure  of  the 
animal  to  hypercapnic  hypoxia  may  reduce  the  rate  of 
aggregate  formation,  minimize  occlusion  of  capillaries  in 
the  gill,  and  help  to  maintain  oxygenation  of  internal  tissues, 
while  increasing  exposure  of  internal  tissues  to  bacterial 
pathogens  circulating  in  the  hemolymph.  In  this  study  we 
did  not  directly  test  the  interplay  of  respiration,  acid-base 
balance,  and  immune  defense,  but  these  results  do  provide  a 
framework  for  testing  and  understanding  how  hypercapnic 
hypoxia  may  contribute  to  the  outbreaks  of  infectious  dis- 
ease in  coastal  waters. 

Acknowledgments 

This  material  is  based  upon  work  supported  by  the  Na- 
tional Science  Foundation  under  Grant  No.  IBN-02 12921 


and  REU  99-35204-8555  to  KGB  and  LEB.  JDH  was  sup- 
ported by  the  University  of  North  Texas  Ronald  E.  McNair 
Program.  We  wish  to  acknowledge  Austin  Dantzler  and  Joe 
Burgents  for  technical  assistance.  Contribution  263  to  the 
Grice  Marine  Laboratory. 

Literature  Cited 

Alday-Sanz,  V.,  A.  Roque,  and  J.  F.  Turnhull.  2002.  Clearance  mech- 
anisms of  Vibrio  vulnificus  biotype  I  in  the  black  tiger  shrimp,  Penaeus 
monodon.  Dis.  Ai/iuit.  Org.  48:  91-99. 

Anderson,  R.  S..  L.  L.  Brubaclier,  I,.  R.  C'alvo,  M.  A.  Unger,  and  E.  M. 
Burreson.  1998.  Effects  of  tributyltin  and  hypoxia  on  the  progression 
of  Perkin.iu.i  nuirinitm  infections  and  host  defence  mechanisms  in 
oyster.  Crassostrea  virginicu  (Gmelin).  J.  Fish  Dis.  21:  371-379. 

Aspan,  A.,  T.  S.  Huang,  L.  Cerenius,  and  K.  Soderhall.  1995.  cDNA 
cloning  of  prophenoloxidase  from  the  freshwater  crayfish  Pacifastacus 
Icniitscitlus  and  its  activation.  Pn>c.  Nail.  Acad.  Sci.  USA  92:  939-943. 

Bachere,  E.  1998.  Shrimp  immunity  and  disease  control:  an  integrated 
approach.  Pp.  129-134  in  Advances  in  Shrimp  Biotechnology.  T.  W. 
Flegel,  ed.  National  Center  for  Genetic  Engineering  and  Biotechnol- 
ogy. Bankok. 

Bachere.  E.  2000.  Penaeidms,  antimicrobial  peptides  of  shrimp:  a  com- 
parison with  other  effectors  of  innate  immunity.  Aquaculture  191: 
71-88. 

Bartlett.  T.  C.,  B.  J.  Cuthbertson,  E.  F.  Shepard,  R.  W.  Chapman,  P.  S. 
Gross,  and  G.  W.  Warr.  2002.  Crustins,  homologues  of  an  1  1.5-kDa 
antibacterial  peptide.  from  two  species  of  penaeid  shrimp.  Litopenaeus 
Yiinnunit'i  and  Litopenaeus  setiferns.  Mar.  Bioteclinol.  4:  278-293. 

Booth,  C.  E.,  B.  R.  McMahon,  and  A.  W.  Pinder.  1982.  Oxygen  uptake 
and  the  potentiating  effect  of  increased  hemolymph  lactate  on  oxygen 
transport  during  exercise  in  the  blue  crab,  Callinectes  sapidus.  J.  Comp. 
Physiol.  148:  111-121. 

Boyd,  J.  N..  and  L.  E.  Burnett.  1999.  Reactive  oxygen  intermediate 
production  by  oyster  hemocytes  exposed  to  hypoxia.  J.  Exp.  Bioi  202: 


Burnett,  L.  E.  1992.     Integrated  function  of  respiratory  pigments  (Corn- 

pleat  Crab  Symposium  I.  Am.  Zoo/.  32:  438  —  M-6. 
Burnett,  L.  E.  1997.     The  challenges  of  living  in  hypoxic  and  hypercap- 

nic aquatic  environments.  Am.  Zool.  37:  633-640. 
Burnett,  L.  E.,  P.  I,.  deFur,  and  I).  1).  Jorgensen.  1981.     Application  of 

the  thermodilution  technique  for  measuring  cardiac  output  and  assess- 

ing cardiac  stroke  volume  in  crabs.  J.  E.\p.  Zool.  218:  165-173. 
Cheng,  W.,  and  J.  C.  Chen.  2001.     Effects  of  intrinsic  and  extrinsic 

factors  on  the  haemocyte  profile  of  the  prawn.  Macrobrachium  rosen- 

bergii. Fish  Shellfish  Immunol.  11:  53-63. 
Cheng,  W.,  C.-H.  Liu.  J.-P.  Hsu,  and  J.-C.  Chen.  2002.     Effect  of 

hypoxia  on  the  immune  response  of  giant  freshwater  prawn  Macrobra- 

chium rosenbergii  and  its  susceptibility  to  pathogen  Enterococcus.  Fish 

Shellfish  Immunol.  13:  351-365. 
deFur,  P.  L.,  and  C.  P.  Mangum.  1979.     The  effects  ot  environmental 

variables  on  the  heart  rates  of  invertebrates.  Comp.  Biochem.  Ph\siol. 

62A:  283-294. 
deFur,  P.  L..  C.  P.  Mangum.  and  J.  E.  Reese.   1990.     Respiratory 

responses  of  the  blue  crab  Ctillinci  rt^  \upidns  to  long-term  hypoxia. 

Biol.  Bull.  178:  46-54. 
Destoumieux,  I).,  P.  Bullet,  I).  Loew,  A.  Van  Dorsselaer,  J.  Rodriguez. 

and  E.  Bachere.   1997.     Penaeidins.  a  new  family  of  antimicrobial 

peptides   isolated   from   the   shrimp   Penucus   vunmunei  (Decapoda). 

J.  Biol.  Client.  272:  2.S39S-2S406 
Destoumieux,  D.,  M.  Munoz,  C.  Cosseau,  J.  Rodriguez,  P.  Bulet,  M. 

Comps,  and  E.  Bachere.  2000.     Penaeidins.  antimicrobial  peptides 

with  chitin-binding  activity,  are  produced  and  stored  in  shrimp  granu- 


196 


J.  D.  HOLMAN  ET  AL. 


locytes  and  released  after  microbial  challenge.  J.  Cell  Sci.  113:  461- 
469. 

Direkbusarakom,  S.,  and  V.  Danayadol.  1998.  Effect  of  oxygen  de- 
pletion on  some  parameters  of  the  immune  system  in  black  tiger  shrimp 
(Penaeus  munodon}.  Pp.  147-149  in  Advances  in  Shrimp  Bioteclmol- 
ogv.  T.  W.  Flegel.  ed.  National  Center  for  Genetic  Engineering  and 
Biotechnology.  Bangkok. 

Factor,  J.  R..  and  J.  Beekman.  1990.  The  digestive  system  of  the 
lobster.  Humanis  americanus.  III.  Removal  of  foreign  particles  from 
the  blood  by  fixed  phagocytes  of  the  digestive  gland.  J.  Morphoi.  2(16: 
293-302. 

Fontaine,  C.  T.,  and  D.  V.  Lightner.  1974.  Observations  on  the  phago- 
cytosis and  elimination  of  carmine  particles  injected  into  the  abdominal 
musculature  of  the  white  shrimp,  Penaeus  seliferus.  J.  Invertebr. 
Pathol.  24:  141-148. 

Gargioni,  R.,  and  M.  A.  Barracco.  1998.  Hemocytes  of  the  palae- 
monids  Macrobrachium  rosenbergii  and  M.  acanthurus,  and  of  the 
penaeid  Penaeus  paulensis.  J.  Morphoi.  236:  209-221. 

Gleeson,  R.  A.,  and  P.  K.  Zubkoff.  1977.  The  determination  of  hemo- 
lymph  volume  in  the  blue  crab,  Callinectes  sapidus.  utilizing  14C- 
thiocyanate.  Comp.  Biochem.  Physio/.  56A:  41  1-413. 

Johnson,  P.  T.  1976.  Bacterial  infection  in  the  blue  crab.  Callinectes 
sapidus:  course  of  infection  and  histopathology.  J.  Invcrtebr.  Pathol. 
28:  25-36. 

Khoo,  L.,  D.  W.  Robinette,  and  E.  J.  Noga.  1999.  Callinectin.  an 
antibacterial  peptide  from  blue  crab.  Cal/inectes  sapidus.  hemocytes. 
Mar.  Biotechnol.  1:  44-51. 

Le  Moullac,  G.,  C.  Soyez,  D.  Saulnier,  D.  Ansquer,  J.  C.  Avarre,  and 
P.  Levy.  1998.  Effect  of  hypoxic  stress  on  the  immune  response  and 
the  resistance  to  vibriosis  of  the  shrimp,  Penaeus  xtylirostris.  Fish 
Shellfish  Innniinol.  8:  621-629. 

Martin,  G.  G.,  D.  Poole,  C.  Poole,  J.  E.  Hose,  M.  Arias,  L.  Reynolds,  N. 
McKrell,  and  A.  Whang.  1993.  Clearance  of  bacteria  injected  into 
the  hemolymph  of  the  penaeid  shrimp.  Sicyonia  ingeutis.  J.  Invertebr. 
Pathol.  62:  308-315. 

Martin,  G.  G.,  K.  Kay,  D.  Poole,  and  C.  Poole.  1998.  In  vitro  nodule 
formation  in  the  ridgeback  prawn.  Sicyonia  ingeniis.  and  the  American 
lobster,  Homarus  americanus.  Invertebr.  Biol.  117:  155-168. 

McGaw,  I.  J.,  and  C.  L.  Reiner.  2002.  Cardiovascular  system  of  the 
blue  crab  Callinectes  sapidits.  J.  Mnrphnl.  251:  1-21. 

McMahon,  B.  R.,  and  L.  E.  Burnett.  1990.  The  crustacean  open  cir- 
culatory system:  a  reexamination.  Physiol.  Znnl.  63:  35-71. 

Merrill,  D.  P.,  S.  A.  Mongeon,  and  S.  Fisher.  1979.  Distribution  of 
fluorescent  latex  particles  following  clearance  from  the  hemolymph  of 
the  freshwater  crayfish  Orconeclcs  vinlis  (Hagen).  J.  Comp.  Plnsiol. 
132:  363-368. 

Mikulski,  C.  M.,  I,.  E.  Burnett,  and  K.  G.  Burnett.  2000.  The  effects 
of  hypercapnic  hypoxia  on  the  survival  of  shrimp  challenged  with 
Vihnn  pin •ahacmolytii -us.  J.  Shellfish  Res.  19:  301-311. 

Mix,  M.  C'.,  and  A.  K.  Sparks.  1980.     Tanner  crab  Chionoecetex  Iviirdi 


Rathbun  haemocyte  classification  and  an  evaluation  of  using  differen- 
tial counts  to  measure  infection  with  a  fungal  disease.  J.  Fish  Dis.  3: 
285-293. 

Munoz,  M.,  R.  Cedeno,  J.  Rodriguez,  VV.  P.  \V.  van  der  Knaap.  E. 
Mialhe,  and  E.  Bachere.  2000.  Measurement  of  reactive  oxygen 
intermediate  production  in  haemocytes  of  the  penaeid  shrimp.  Penaeus 
vannamei.  Aauacultitre  191:  89—107. 

Persson,  M.,  L.  Cerenius,  and  K.  Soderhall.  1987.  The  influence  of 
haemocyte  number  on  the  resistance  of  the  freshwater  crayfish  Paci- 
fastacus  leniiiscu/us  Dana,  to  the  parasitic  fungus.  Aphanomyces  astaci. 
J.  Fish  Dis.  10:  471-477. 

Rhodes,  M.  W.,  H.  Kator,  S.  Kotob,  P.  van  Berkum,  I.  Kaattari,  W. 
Vogelbein,  M.  M.  Floyd,  W.  R.  Butler,  F.  D.  Quinn,  C.  Ottinger, 
and  E.  Shotts,  E.  2001.  A  unique  mycobacterium  species  isolated 
from  an  epizootic  of  striped  bass  (Morone  saxatilis).  Emerg.  Infect. 
Dis.  7:  896-899. 

Schnapp,  D.,  G.  D.  Kemp,  and  V.  J.  Smith.  1996.  Purification  and 
characterization  of  a  proline-rich  antibacterial  peptide.  with  sequence 
similarity  to  bactenecin-7,  from  the  haemocytes  of  the  shore  crab, 
Carcinus  maenas.  Eur.  J.  Biochem.  240:  532-539. 

Smith,  V.  J.,  and  N.  A.  Ratcliffe.  1980.  Host  defence  reactions  of  the 
shore  crab,  Carcinus  maenas  (L.):  clearance  and  distribution  of  injected 
test  particles.  J.  Mar.  Biol.  Assoc.  UK  60:  89-102. 

Smith.  V.  J.,  and  K.  Soderhall.  1983.  /3-1.3  glucan  activation  of  crus- 
tacean hemocytes  in  vitro  and  in  vivo.  Biol.  Bull.  164:  299-314. 

Smith.  V.  J..  K.  Soderhall,  and  M.  Hamilton.  1984.  /3-1.3-glucan 
induced  cellular  defense  reaction  in  the  shore  crab,  Carcinus  maenas. 
Comp.  Biochem.  Physiol.  77A:  635-639. 

Song,  V.  L.,  and  Y.  T.  Hsieh.  1994.  Immunostimulation  of  tiger  shrimp 
(Penaeus  monodon)  hemocytes  for  generation  of  microbicidal  sub- 
stances: analysis  of  reactive  oxygen  species.  Dev.  Comp.  linnninol.  18: 
201-209. 

van  de  Braak,  C.  B.  T.,  M.  H.  A.  Botterblom,  N.  Taverne,  W.  B.  Van 
Muisuinkel,  J.  H.  Rombout.  and  W.  P.  VV.  Van  der  Knaap.  2002. 
The  roles  of  haemocytes  and  the  lymphoid  organ  in  the  clearance  of 
injected  Vibrio  bacteria  in  Penaeus  monodon  shrimp.  Fish  Shellfish 
Immunol.  13:  293-309. 

Vargas-Albores,  F.,  A.  Guzman-Murillo,  and  J.  L.  Ochna.  1993.  A 
lipopolysaccharide-binding  agglutinin  isolated  from  brown  shrimp 
(Penaeus  califomiensis  Holmes)  haemolymph.  Comp.  Biochem. 
Physiol.  104A:  407-413. 

Vargas-Albores,  F.,  F.  Jimenez-Vega,  and  G.  Yepiz-Plascenda.  1997. 
Purification  and  comparison  of  (3-1.3-glucan  binding  protein  from  the 
white  shrimp  (Penaeus  vannamei).  Comp.  Biochem.  Phvsiol.  116B: 
453-458. 

White,  K.  H.,  and  N.  A.  Ratcliffe.  1982.  The  segregation  and  elimina- 
tion of  radio-  and  fluorescent-labelled  marine  bacteria  from  the  hae- 
molymph of  the  shore  crab,  Carcinus  maenas.  J.  Mar.  Biol.  Assoc.  UK 
62:  819-833. 


INDEX 


Actograph.  103 

Adaptable  defense:  a  nudibranch  mucu; 

changes  with  prey  type,  1 13 
Aggression.  173 
Alkylphenols,  13 
Antioxidants,  13 
Ascidian,  95.  144,  152 


inhibits  nematocyst  discharge  and 


pliciitula.  46 
rhizophorae,  46 
virginica,  46 

Crayfish,  78 
Crustacea,  134 
Cue 

chemical,  134 

visual,  I  34 
CURTIS,  NICHOLAS  E.,  see  Sidney  K.  Pierce,  125 


B 

Bacterial  clearance,  188 

Barnacle,  121 

Behavior,  134 

BIGGERS,  WILLIAM  J.,  AND  HANS  LAUFER,  Identification  of  juvenile  hor- 
mone-active alkylphenols  in  the  lobster  Homarus  americanus  and  in 
marine  sediments,  13 

Biological  rhythm,  103 

BIRENHEIDE,  RuDiOER,  see  Tatsuo  Motokawa,  4 

Bisphenol  A.  13 

Blubber,  125 

BOAL,  JEAN  G.,  see  Kendra  C.  Buresch,  1 

BORTOLAMI,  S.  B.,  see  M.  H.  Temkin.  35 

Botni/iis  sclilosse ri,  144,  152 

Brittle  star,  25 

Brooder.  144 

Bryozoa,  35 

BUCKNALL,  MARTIN  P.,  see  Rebecca  L.  Swanson,  Ifil 

BURESCH,  KENDRA  C.,  JEAN  G.  BOAL,  GREGG  T.  NAGLE,  JAMIE  KNOWLES, 
ROBERT  NOBUHARA,  KATE  SWEENEY,  AND  ROGER  T.  HANLON,  Exper- 
imental evidence  that  ovary  and  oviducal  gland  extracts  influence 
male  agonistic  behavior  in  squids,  1 

BURNETT,  KAREN  G.,  see  Jeremy  D.  Holman,  188 

BURNETT,  Louts  E.,  see  Jeremy  D.  Holman,  188 


Callinec tes  sapidus,  188 

Chemical  and  visual  communication  during  mate  searching  in  rock  shrimp 

134 
Chemical 

cues,  134 

sensing,  1 

Chemoreception,  65 
Chemotaxis,  95 
Chilean  Blob,  125 
Chlorophyll  fluorescence,  61 
Chromosomal  rearrangement,  46 
Collagen,  125 
Communication,  134 
Competition,  173 
Conflict  chemoreception,  1 
Confocal  microscopy,  65 
Contractile  connective  tissue,  4 
Contraction  and  stiffness  changes  in  collagenous  arm  ligaments  of  the 

stalked  crinoid  Metacrinus  rotundus  (Echinodermata),  4 
Coral,  61 

COSSON,  JACKY,  see  Makiko  Ishikawa,  95 
Crassostrea 

gigas,  46 


D 

DE  NYS,  ROCKY,  see  Rebecca  L.  Swanson.  1M 

Defense.  1 1 3 

DENNY,  MARK  W.,  see  Natasha  K.  Li.  121 

Density  effects.  152 

Deposit  feeding.  65 

Development,  25.  78 

larval.  87 
DI'AZ,  ELIECER  R..  AND  MARTIN  THIEL.  Chemical  and  visual  communication 

during  mate  searching  in  rock  shrimp,  134 
Differences  in  the  rDNA-bearing  chromosome  divide  the  Asian-Pacific  and 

Atlantic  species  of  Crassoslrea  (Bivalvia.  Mollusca),  46 


Echinoderm.  4 

EDMUNDS.  PETER  J..  AND  RUTH  D.  GATES,  Size-dependent  differences  in  the 

photophysiology  of  the  reef  coral  Porites  astreoides.  61 
Effects  of  hypercapnic  hypoxia  on  the  clearance  of  Vibrio  camphellii  in  the 

Atlantic  blue  crab,  Callinectes  sapidus  Rathbun,  188 
EHLINGER,  GRETCHEN  S..  AND  RICHARD  A.  TANKERSLEY,  Survival  and 

development  of  horseshoe  crab  (Linmlus  pol\phemits)  embryos  and 

larvae  in  hypersaline  conditions.  87 
Evolution.  134 
Experimental  evidence  that  ovary  and  oviducal  gland  extracts  influence 

male  agonistic  behavior  in  squids.  1 


FERRELL.  DAVID  L..  Fitness  consequences  of  allorecognition-mediated  ag- 
onistic interactions  in  the  colonial  hydroid  Hydractinia.  173 

Fertilization.  35.  144.  152 

Fertilization  in  an  egg-brooding  colonial  ascidian  does  not  vary  with 
population  density.  152 

Field  studies.  55 

Fitness,  103 

Fitness  consequences  of  allorecognition-mediated  agonistic  interactions  in 
the  colonial  hydroid  H\dractinia.  173 

Floridoside-isethionic  acid  complex.  161 

FOREST,  D.,  see  Sara  M.  Lindsay.  65 

Free-spawning  invertebrate.  144 


G 

GARRY,  KYLE,  see  Paul  G.  Greenwood.  1 13 

GATES,  RUTH  D.,  see  Peter  J.  Edmunds,  61 

GREENWOOD,  PAUL  G..  KYLE  GARRY,  APRIL  HUNTER.  AND  MIRANDA  JEN- 
NINGS, Adaptable  defense:  a  nudibranch  mucus  inhibits  nemalOLW 
discharge  and  changes  with  prey  type.  I  13 


197 


198 


INDEX  TO  VOLUME  206 


Growth  rate.  173 
Gulf  of  Mexico,  173 


Liiiiuliis  polv/iheiniis.  87 
Lobster.  13 


H 

HAMANN.  ELLEN,  see  Aimee  Phillippi.  152 

HANLON.  ROGER  T..  see  Kendra  C.  Buresch.  1 

HARPER.  S.  L..  AND  C  L.  REIBER.  Physiological  development  of  the 
embryonic  and  larval  crayfish  heart,  78 

Hemocyte.  188 

Histamine.  161 

HOLMAN,  JEREMY  D..  KAREN  G.  BURNETT.  AND  Louis  E.  BURNETT.  Effects 
of  hypercapnic  hypoxia  on  the  clearance  of  Vibrio  campbellii  in  the 
Atlantic  blue  crab,  Callinectes  su/iulus  Rathbun.  188 

Homarus  americanus,  1 3 

Horseshoe  crab,  87 

HUNTER.  APRIL,  see  Paul  G.  Greenwood.  1 1 3 

Hybridization  barrier.  46 

Hydrodynamics,  121 

Hypercapnia.  188 

Hypersalinity.  87 

Hypoxia.  78.  188 


I 

Identification  and  activity-dependent  labeling  of  peripheral  sensory  struc- 
tures on  a  spionid  polychaete,  65 

Identification  of  juvenile  hormone-active  alkylphenols  in  the  lobster  Ho- 
marus americanus  and  in  marine  sediments.  13 

Immunohistochemistry,  65 

Indian  River  Lagoon.  87 

Induction  of  settlement  of  larvae  of  the  sea  urchin  Holopneustes  purpura- 
scens  by  histamine  from  a  host  alga.  161 

Innate  immunity,  188 

Interaction  between  photoperiod  and  an  endogenous  seasonal  factor  in 
influencing  the  diel  locomotor  activity  of  the  benthic  polychaete 
Nereis  virens  Sars,  103 

Invertebrate.  173 

ISHIKAWA,  MAKIKO,  HIDEKAZU  TSUTSUI,  JACKY  COSSON.  YOSHITAKA  OKA, 
AND  MASAAKI  MORISAWA.  Strategies  for  sperm  chemotaxis  in  the 
siphonophores  and  ascidians:  a  numerical  simulation  study.  95 


JENNINGS.  MIRANDA,  see  Paul  G.  Greenwood.  1 1 3 

JOHNSON.  SHERI  L..  AND  PHILIP  O.  YUND.  Remarkable  longevity  of  dilute 

sperm  in  a  free-spawning  colonial  ascidian.  144 
Juvenile  hormone  activity,  13 


M 

Marine 

invertebrate.  121 
sediments.  13 

MARLIYAMA.  YOSHIHIKO  K..  Occurrence  in  the  field  of  a  long-term,  year- 
round,  stable  population  of  placozoans.  55 

MASSEY.  STEVEN  E.,  see  Sidney  K.  Pierce,  125 

Mating  systems,  134 

MAUGEL,  TIMOTHY  K..  see  Sidney  K.  Pierce.  125 

Metamorphosis,  161 

Methylfarnesoate,  13 

Microscopic,  biochemical,  and  molecular  characteristics  of  the  Chilean 
Blob  and  a  comparison  with  the  remains  of  other  sea  monsters: 
nothing  but  whales.  125 

Model.  95 

Molt  cycle  duration.  87 

MORISAWA,  MASAAKI,  see  Makiko  Ishikawa.  95 

Morphology.  1  - 1 

MOTOKAWA.  TATSUO,  OSAMU  SHINTANI,  AND  RUDIGER  BIRENHEIDE.  Con- 
traction and  stiffness  changes  in  collagenous  arm  ligaments  of  the 
stalked  crinoid  Metacrinus  rotundits  (Echinodermata),  4 

Mucus.  113 

Mutable  connective  tissue.  4 


N 

NAOLE.  GREGG  T.,  see  Kendra  C.  Buresch.  1 
NAKAMURA.  SHOGA.  see  Hideyuki  Tominaga,  25 
Nematocyst,  1 13 
Nereis  virens.  103 

Nudibranch.  1  13 


O 

Occurrence  in  the  field  of  a  long-term,  year-round,  stable  population  of 

placozoans.  55 

OKA,  YOSHITAKA.  see  Makiko  Ishikawa.  95 
OLAVARRI'A.  CARLOS,  see  Sidney  K.  Pierce.  1 25 
OLIVE.  PETER  J.  W..  see  Kim  S.  Last.  103 
Ontogeny.  78 
Osmoregulation.  87 
Oxygen  consumption.  78 


K 

KNOWLES,  JAMIE,  see  Kendra  C.  Buresch.  1 
KOMATSU,  MIEKO,  see  Hideyuki  Tominaga,  25 
KUMAR,  NARESH.  see  Rebecca  L.  Swanson.  161 


Larva.  161 

development  of,  87 

LAST.  KIM  S..  AND  PETER  J.  W.  OLIVE.  Interaction  between  photoperiod  and 
an  endogenous  seasonal  factor  in  influencing  the  diel  locomotor 
activity  of  the  henthic  polychaele  Nereis  virens  Sars.  103 

L  vi  1 1  K.  H  \NV  see  William  J.  Biggers.  I  3 

Li.  NATASHA  K.,  AND  MARK  W.  DENNY,  Limits  to  phenotypic  plasiicitv: 
Mow  effects  on  barnacle  feeding  appendages.  121 

Life  history.  103 

Limits  to  phenotypic  plasticity:  How  el'lecls  on  h.irnacle  Iccding  append- 
ages, 121 

LINDSAY,  SARA  M.,  TIMOTHY  .1.  RIORUXN.  JR..  \M>  D.  FOREST.  Identification 
and  activity-dependent  labeling  of  peripheral  sensory  structures  on  a 
spionid  polychaete.  65 


Phenotypic  plasticity.  121 

Pheromones.  1 

Pun  i  ii'i'i.  AIMI;K,  ELI  .EN  HAMANN,  AND  PHILIP  O.  YUND,  Fertili/ation  in  an 
egg-brooding  colonial  ascidian  does  not  vary  with  population  density. 
152 

Photophysiology,  61 

Physiological  development  ol  the  embryonic  and  larval  crayfish  heart,  78 

Pn'kci .  SIDMI  K..  STKVEN  E.  MASSEY.  NICHOLAS  E.  CURTIS.  GERALD  N. 
SMITH.  JR..  CARLOS  OLAVARRI'A.  AND  TIMOTHY  K.  MAUGEL.  Micro- 
scopic, biochemical,  and  molecular  characteristics  of  the  Chilean  Blob 
and  a  comparison  with  the  remains  ol  other  sea  monsters:  nothing  but 
whales.  125 

Placozoa,  55 

Polvchaeta.  103 


R 

Ri  mi  K,  C.  L.,  sec  S.  L.  Harper.  78 

Remarkable  longevity  ol  dilute  sperm  in  a  free-spawning  colonial  ascidian. 

144 
Reproduction.  25.  I  34 


INDEX  TO  VOLUME  206 


199 


Reproduction  and  development  of  the  conspicuously  dimorphic  brittle  star 

Ophiodaphne formula  (Ophiuroidea),  25 
Rhynchocinetes,  1 34 
Ribosomal  RNA  genes,  46 
RIORDAN,  TIMOTHY  J..  JR.,  see  Sara  M  Lindsay.  6? 


SWANSON,  REBECCA  L.,  JANE  E.  WILLIAMSON.  ROCKY  DE  NYS.  NARESH 
KUMAR.  MARTIN  P.  BUCKNALL.  AND  PETER  D.  STEINBERG.  Induction  of 
settlement  of  larvae  of  the  sea  urchin  Holopneustes  purpurascens  by 
histamine  from  a  host  alga.  Id  I 

SWEENEY.  KATE,  see  Kendra  C.  Buresch.  I 


Salinity  tolerance,  87 
Sampling 

slide.  55 

substrate,  55 
Sea 

anemone.  1 1 3 

lily.  4 

monster,  125 

urchin,  161 
Sensory  ecology,  65 
Settlement,  161 
Sexual  dimorphism.  25 
SHINTANI,  OSAMU.  see  Tatsuo  Motokawa.  4 
Shrimp.  134 
Simulation.  95 
Siphonophore,  95 
Size  mortality.  61 
Size-dependent  differences  in  the  photophysiology  of  the  reef  coral  Porites 

astreoides,  61 

SMITH.  GERALD  N..  JR..  see  Sidney  K.  Pierce.  125 
Sperm.  35 

half-lite.  144 

longevity,  144 
Spermatozeugmata,  35 
Spionidae.  65 
Stalked  crinoid.  4 

STEINBERG,  PETER  D..  see  Rebecca  L.  Swanson.  161 
Strategies  for  sperm  chemotaxis  in  the  siphonophores  and  ascidians:  a 

numerical  simulation  study.  95 
Survival.  87.  173 

Survival  and  development  of  horseshoe  crab  (Limulus  polyphemits)  em- 
bryos and  larvae  in  hypersaline  conditions,  87 


TANKERSLEY,  RICHARD  A.,  see  Gretchen  S.  Ehlinger.  87 

TEMKIN.  M.  H.,  AND  S.  B.  BORTOLAMI.  Waveform  dynamics  of  sperma- 

tozeugmata  during  the  transfer  from  paternal  to  maternal  individuals 

of  Membranipora  membranacea,  35 
Temperature  tolerance.  X7 
Thermal  stress,  61 
THIEL.  MARTIN,  see  Eliecer  R.  Dm/.,  134 

TOMINAGA,  HlDEYUKI,  SHOGO  NAKAMURA,  AND  MlEKO  KOMATSU,  Repro- 
duction and  development  of  the  conspicuously  dimorphic  brittle  star 
Ophiodaphne formata  (Ophiuroidea).  25 

TrichopliLx  adhaerens,  55 

TSUTSUI,  HIDEKAZU,  see  Makiko  Ishikawa.  95 


Vibrio  campbellii,  188 
Visual  cues,  134 


w 


WANG,  YONGPING,  ZHE  Xu,  AND  XIMING  Guo.  Differences  in  the  rDNA- 
bearing  chromosome  divide  the  Asian-Pacific  and  Atlantic  species  of 
Crassostrea  (Bivalvia,  Mollusca),  46 

Wave  exposure,  1 2 1 

Waveform  dynamics  of  spermatozeugmata  during  the  transfer  from  pater- 
nal to  maternal  individuals  ot  Mcniht'iiniptn'ii  nieinhi'nnucea.  35 

Whale.  125 

WILLIAMSON.  JANE  E..  see  Rebecca  L.  Swanson.  161 


YUND,  PHILIP  O..  see  Aimee  Phillippi.  152;  Sheri  L.  Johnson.  144 


THF 

BIOLOGICAL 
BULLETIN 

2004  Subscription  Rates 
Volumes  206-207 

*Paid  Subscriptions  include  both  print  and  electronic  subscriptions  at:  www.biolbull.org 

Institutional*     Individual* 


One  year  subscription  (6  issues 

-  2  volumes) 

$325.00 

$120.00 

Single  volume   (3  issues) 

$165.00 

$70.00 

Single  Issues 

$  75.00 

$25.00 

*Surface  delivery  included  in  above  prices. 
For  prompt  delivery,  we  encourage  subscribers  outside  the  U.S.  to  request  airmail  service. 

Airmail  Delivery  Charge 

U.S.  and  Canada:  $  45.00 

Mexico:  $  60.00 

All  other  locations:  $100.00 

Orders  Must  Be  Prepaid  in  U.S.  Dollars,  Check  Payable  to  The  Marine  Biological  Laboratory 

About  The  Biological  Bulletin 

ISSN:  0006-3185 

Frequency:  Bimonthly 

Number  of  issues  per  year:  6 

Months  of  Publication:   February,  April,  June,  August,  October,  December 

Subscriptions  entered  for  calendar  year 

Volume  indexes  contained  in  June  and  December  issues 

Annual  report  of  the  Marine  Biological  Laboratory  contained  in  August  issue 

Most  back  issues  available 

Claims  handled  upon  receipt 

No  agency  discounts 

Internet: 
www.biolbull.org 

Please  address  orders  to: 

Wendy  Child 

Subscriptions 

The  Biological  Bulletin 

Marine  Biological  Laboratory 

7  MBL  Street 

Woods  Hole,  MA  02543-1015    U.S.A. 
Fax:  508-289-7922  Tel:  508-289-7402  Email:  wchild@mbl.edu 

Published  by  the  Marine  Biological  Laboratory 
Woods  Hole,  Massachusetts,  02543  U.S.A. 


THE  BIOLOGICAL  BULLETIN 

(www.biolbull.org) 

2004  SUBSCRIPTION  FORM 

(VOLUMES  206-207, 6  ISSUES) 


(please  print) 

NAME: 


INSTITUTION: 
ADDRESS: 


CITY: STATE:. 

POSTAL  CODE: COUNTRY:. 

TELEPHONE:  FAX:. 

E-MAIL  ADDRESS 


All  subscriptions  run  on  the  calendar  year;  price  includes  both  print  and  online  journals 

G  Please  send  me  a  2004  subscription  to  The  Biological  Bulletin  at  the  rate  indicated  below: 

a  Individual:  $120.00  (6  ISSUES)  O  Institutional  :  $325.00  (6  ISSUES) 

O  Individual:  $70.00  (3  ISSUES)  O  Institutional  :  $165.00  (3  ISSUES) 

Check  one:  G  February  April  June     or     G  August  October  December 

G  Please  send  me  the  following  back  issue(s): 

O  Individual:  at  $25.00  (PER  ISSUE)     O  Institutional  :  at  $75.00  (PER  ISSUE) 

Delivery  Options 

Surface  Delivery  (Surface  delivery  is  included  in  the  subscription  price.) 

Air  delivery  (Please  add  the  correct  amount  to  your  payment.) 


O  U.S.  and  Canada:  $46.00  O  Mexico:  $60.00  O  All  other  locations:  $100.00 
Payment  Options 

Enclosed  is  my  check  or  U.S.  money  order  for  $ payable  to  The  Marine  Biological  Laboratory 

Please  charge  my  D  VISA,  G  MasterCard  G  Discover  Card  $ 

Please  send  me  an  invoice.  (Note:  Payment  must  be  received  before  subscription  commences.) 


Account  No.: Exp.  Date: 

Signature: Date:  


Return  this  form  with  your  check  or  credit  information  to: 

Marine  Biological  Laboratory 

Subscription  Office  +  The  Biological  Bulletin  +7  MBL  Street  4-  Woods  Hole,  MA  02543-1015 


OGL- OCEAN  GENOME 
LEGACY 

m  EXECUTIVE  DIRECTOR 

A  new  not-for-profit  foundation  devoted  to  the 
preservation,  distribution  and  evolutionary  genomics  of 
DNA  from  marine  organisms  is  seeking  an 
EXECUTIVE  DIRECTOR. 

The  successful  candidate  will  have  a  Ph.D.  in  cell  or 
molecular  biology,  4+  years'  experience  in  molecular 
biology,  and  be  highly  motivated  to  work  at  the  bench. 
Responsibilities  will  include  the  assembly  of  a  small  team 
of  scientists  for  the  long-term  preservation  of  marine 
organism  DNA,  development  of  tissue  culture 
techniques  for  marine  invertebrate  cells,  construction  of 
genome  libraries,  and  evolutionary  genomics  of  special 
marine  transition  groups. 

The  OGL  laboratory  will  be  temporarily  located  at  New 
England  Biolabs,  Inc.,  Beverly,  MA  until  a  new  facility  is 
constructed  in  Ipswich,  MA. 

Applicants  should  send  a  resume  and  three  references  to: 
Carol  Ann  Zapttstas,  New  England  Biolabs,  Inc., 
32  Tozer  Road,  Beverly,  MA  01915. 

OCEAN  GENOME  LEGACY 

An  Equal  Opportunity  Employer. 


POSITION  ANNOUNCEMENT 

Editor-in-Chief 
The  Biological  Bulletin 

Start  Date:  January  2005 
Term:  Five  years,  renewable 


The  Editor-in-Chief  is  responsible  for  the  overall  editorial  direction  of  the  Biological  Bulletin.  The  Editor-in-Chief 
appoints  Associate  Editors  and  members  of  the  Editorial  Board,  decides  which  manuscripts  are  published,  mediates 
editorial  disputes,  and  sets  policy  for  the  journal. 

The  Editor-in-Chief  is  an  independent  contractor  who  reports  to  the  Director  and  CEO  of  the  Marine  Biological 
Laboratory.  Stipend  for  the  position  is  $10,000  annually.  The  Bulletin 's  editorial  offices  are  based  in  Woods  Hole,  but 
the  Editor-in-Chief  may  work  from  his/her  home  institution.  The  Editor-in-Chief  is  expected  to  spend  some  part  of  the 
summer  months  in  Woods  Hole.  Housing  for  up  to  one  month  will  be  provided  in  Woods  Hole. 


The  successful  candidate  for  this 

position  will  meet  the  following 

requirements: 


A  broad  understanding  of  biology,  and  a  manifest  interest  in  its 

diversity  and  comparative  and  integrative  aspects 

A  track-record  of  publishing  in  peer-reviewed  journals 

Experience  reviewing  papers  for  scientific  journals 

Proven  skill  as  a  substantive  editor 

Ability  to  make  tough  decisions  and  willingness  to  work  with  other  editors 

to  reach  a  decision  on  difficult  papers 

Demonstrated  experience  with  the  editorial  process  (e.g.,  serving  as  an 

Editor  or  Associate  Editor  for  a  journal  similar  to  the  Biological  Bulletin) 

The  willingness  and  ability  to  commit  the  time  required,  approximately 

one  day  per  week,  to  fulfill  the  duties  outlined  here  for  five  years. 


Job  description: 


Nomination  packets  must  include 
the  following: 

1.  Letter  of  intent 

2.  Current  CV 

3.  Vision  Statement  for  the  journal 

Send  nominations  to: 

Pamela  Clapp  Hinkle 

Managing  Editor,  Biological  Bulletin 

Marine  Biological  Laboratory 

7  MBL  Street 

Woods  Hole,  MA  02543 

pclapp@mbl.edu 


The  Editor-in-Chief  devotes  a  minimum  of  six  hours  per  week  to  the 
operation  of  the  Biological  Bulletin.  The  Editor's  ongoing  activities  include 

1)  assigning  submitted  papers  to  the  appropriate  Associate  Editor; 

2)  reading  reviews  and  manuscripts  to  ensure  fairness  and  technical 
accuracy;  3)  writing  editorial  decision  letters  based  on  the  reviews; 

4)  fielding  telephone  and  e-mail  queries  on  a  daily  basis  from  authors 
deciding  whether  to  submit  their  work  to  the  Biological  Bulletin,  authors 
who  are  unhappy  about  an  editorial  decision,  and  Associate  Editors 
requesting  guidance  on  such  matters  as  the  identity,  availability, 

and  number  of  reviewers,  and  editorial  decisions  and  disputes; 

5)  communicating  regularly  (by  telephone  or  e-mail)  with  the  Managing 
Editor  and  other  editorial  staff  members  to  plan  future  issues,  to  arrange  the 
table  of  contents,  to  develop  the  issue  cover,  and  to  discuss  organizational 
issues;  6)  editing  accepted  manuscripts  as  necessary  for  substance, 
accuracy,  and  clarity;  7)  selecting  cover  photos  and  writing  associated 
legends;  8)  informing  editorial  staff  of  noteworthy  articles  for  the  media; 
9)  as  the  deadline  for  each  issue  approaches,  deciding  which  manuscripts 
will  be  published. 


Marine  Biological  Laboratory  •  Woods  Hole  •  Massachusetts 


Invented 

i 


At   Its   Best! 


m 


• 

• 


• . 


•  > 


.. 


Built  with  extraordinary 
Zeiss  expertise,  the  Axiovert  200 
is  all  you'll  ever  want  in  an 
inverted  research  microscope. 
Outstanding  ICS  infinity  optics, 
innovative  condensers  &  optimized 
fluorescence,  stability  &  reliability, 
unique  ergonomic  design, 
&  an  unusually  wide  scope 
of  sophisticated  documentation. 

But  the  Axiovert  200  is  much 
more.  It  is  a  powerful  tool  that 
will  carry  out  your  research  more 


precisely,  more  rapidly  and  more 
successfully  than  before.  And  this 
is  just  the  beginning! 

You  can  transform  your  , 

microscope  into  a  sophisticated 
image  handling  workstation 
for  observation  &  documentation 
of  living  cells  with  all  of  the 
components  superbly  matched 
by  Zeiss  for  outstanding  results. 

For  more  information 
call  800-233-2343. 


ZEISS 


Carl  Zeiss  Microlmaging,  Inc.  •  Thornwood,  NY  10594  •  micro@zeiss.com 


We  make  it  visible. 


MBL  WHOI  LIBRARY 


UH    1ART    U