Full text of "Journal of Hymenoptera research"

See other formats

3(1

GLL-

sOCIETy

'/>

Journal of
Hymenopter
Research

•SW\ITHS0K

1 M 0 6 twuu

Volume 9, Number 1 V /to« « y April 2000

■"" ISSN #1070-9428

CONTENTS

BELOKOBYLSKIJ, S. A. and D. L. J. QU1CKE. Seven new genera of the subfamily Doryctinae

(Hymenoptera: Braconidae) from the Old World Ill

BRICENO G., R. A. and M. J. SHARKEY. Bassus macadamiae sp. n. (Hymenoptera: Bracon-
idae: Agathidinae), parasitoid of Ecdytolopha torticornis and E. aurantianum (Lepi-
doptera: Tortricidae) in macadamia nut crops in Central and South America .... 99

ENGEL, M. S. A revision of the panurgine bee genus Arhysosage (Hymenoptera: Andren-

idae) 182

HERATY, J. M. and A. POLASZEK. Morphometric analysis and descriptions of selected

species in the Encarsia strenua group (Hymenoptera: Aphelinidae) 142

KAZENAS, V. L. New synonyms in Central and South Asian Sphecidae (Hymenoptera) ... 48

KTMSEY, L. S. Revision of the Australian tiphiid genus Leiothynnus (Hymenoptera: Tiphiidae:

Thynninae) 18

MATTHEWS, R. W. A new species of Nitela (Hymenoptera: Sphecidae: Larrinae) from

Australia with notes on the nests and prey of two species 41

MAUSS, V. and A. MULLER. A study of the bionomy of the Spanish pollen wasp Ceramius
hispanicus Dusmet (Hymenoptera, Vespidae, Masarinae): nesting, mating, and flower
associations 1

NEWMAN, T. M. and D. L. J. QUICKE. Sperm development and ultrastructure of mature

spermatozoa of Megalyra (Hymenoptera: Megalyroidea) 62

PACKER, L. The biology of Thrincohalictus prognathus (Perez) (Hymenoptera: Halictidae:

Halictini) 53

PITTS, J. P. and J. V. McHUGH. Stethophotopsis, a new genus of Sphaeropthalmini (Mutillidae:
Sphaeropthalminae) with a brachypterous male from Arizona

(Continued on back cover)

INTERNATIONAL SOCIETY OF HYMENOPTERISTS

Organized 1982; Incorporated 1991

OFFICERS FOR 2000

Andrew D. Austin, President

John LaSalle, President-Elect

James B. Woolley, Secretary

John T. Huber, Treasurer

E. Eric Grissell, Editor

Subject Editors
Symphyta and Parasitica Aculeata

Biology: Mark Shaw Biology. Sydney Cameron

Systematics: Donald Quicke Systematics: Wojciech Pulawski

All correspondence concerning Society business should be mailed to the appropriate officer at the
following addresses: President, Department of Crop Protection, University of Adelaide, Glen Os-
mond, Australia 5064; Secretary, Department of Entomology, Texas A&M University, College
Station, Texas 77843; Treasurer, Eastern Cereal & Oilseed Research Centre, Agriculture Canada,
K. W. Neatby Building, Ottawa, Ontario, Canada Kl A 0C6; Editor, Systematic Entomology Labo-
ratory, USDA, % National Museum of Natural History, Washington, D.C 20560-0168.

Membership. Members shall be persons who have demonstrated interest in the science of ento-
mology. Annual dues for members are US$40.00 per year (US$35.00 if paid before 1 February),
payable to The International Society of Hymenopterists. Requests for membership should be sent
to the Treasurer (address above). Information on membership and other details of the Society
may be found on the World Wide Web at http://IRIS.biosci.ohio-state.edu/ish.

Journal. The journal of Hymenoptera Research is published twice a year by the International Society
of Hymenopterists, % Department of Entomology, Smithsonian Institution, Washington, D.C.
20560-0168, U.S.A. Members in good standing receive the Journal. Nonmember subscriptions are
$60.00 (U.S. currency) per year.

The Society does not exchange its publications for those of other societies.

Please see inside back cover of this issue for information regarding

preparation of manuscripts.

Statement of Ownership

Title of Publication: Journal of Hymenoptera Research.

Frequency of Issue: Twice a year.

Location of Office of Publication, Business Office of Publisher and Owner: International Society
of Hymenopterists, % Department of Entomology, NHB 168, Smithsonian Institution, Wash-
ington, D.C. 20560, U.S.A.

Editor: E. Eric Grissell, Systematic Entomology Laboratory, USDA, % National Museum of Nat-
ural History, Washington, D.C. 20560-0168.

Managing Editor and Known Bondholders or other Security Holders: none.

This issue was mailed 5 May 2000

J. HYM. RES.
Vol. 9(1), 2000, pp. 1-17

A Study of the Bionomy of the Spanish Pollen Wasp Ceramius
hispanicus Dusmet (Hymenoptera, Vespidae, Masarinae): Nesting,

Mating, and Flower Associations

Volker Mauss and Andreas Muller

(VM) Institut fur Landwirtschaftliche Zoologie und Bienenkunde, Rheinische Friedrich-

Wilhelms-Universitat, Melbweg 42, D-53127 Bonn, Germany, E-mail: ULT402@uni-bonn.de;

(AM) Institut fur Pflanzenwissenschaften, Angewandte Entomologie, ETH, Clausiusstrasse

25 /NW, CH-8092 Zurich, Switzerland, E-mail: andreas.mueller@ipw.agrl.ethz.ch

Abstract. — Data about the bionomy of the Spanish pollen wasp species Ceramius hispanicus Dus-
met are presented for the first time. Following the concept of Gess and Gess (1988) C. hispanicus
can be characterized by the following ethological elements: a. Nest excavated in non-friable soil;
b. Burrow surmounted by a turret from earth extracted from within the burrow; c. Nest possibly
annual; d. Nest with relatively short main shaft, main shaft vertical to sub-vertical, with an ex-
pansion at the bottom of the shaft; e. Main shaft not terminated by a cell; f. Secondary shafts
absent; g. Cells sub-horizontal, in a group to one side, all at different depths; h. A constructed
mud-cell within an excavated-cell, formed from earth excavated within the burrow; i. Main forage
plants are representatives of Cistaceae, Primulaceae, Lamiaceae, and Fabaceae. The entrance turret
of the nest is unique in that it is reduced to three distally converging processes. During nest
excavation the females perform pellet dropping flights and use a defined pellet-dropping area.
Water is used to soften the soil. Females alight on the edge of a water source to collect water.
Cell construction rate during this investigation was about 0.5 cells per day. Analysis of brood cell
contents revealed Ceramius hispanicus to be polylectic. Cells were found to be provisioned with
pollen originating from six different plant families. The most important pollen sources were He-
lianthemum (Cistaceae), Coris (Primulaceae), several species of Lamiaceae, and Lotus (Fabaceae).
Pollen grains of the same plant taxa were found in crop and rectum of both male and female
wasps. Males patrol and perch at water and to a lesser extent at flowers. Pairings were frequently
observed at water. The daily period of activity lasted about 10 hours. Activity of males at water
was high in the morning and declined during the day, while female activity increased towards
the afternoon.

The genus Ceramius shows a disjunct
distribution with six species-groups occur-
ring in the Afrotropical Region and two
species-groups in the Palaearctic (Richards
1962, Gess 1992). For the Afrotropical taxa
it has been shown that there are distinct
differences between the species-groups in
regard to nest construction and flower as-
sociation (Gess 1996, Gess and Gess 1980,
1986, 1988, 1990). By contrast, the biono-
my of the Palaearctic species is insuffi-
ciently known (cf. Gess 1996) to make it
possible at present to draw conclusions
about the evolution of life history traits

within the whole genus. For the Palaearc-
tic Region comprehensive information is
only available for Ceramius tuberculifcr
Saussure (Ferton 1901, Giraud 1863, 1871,
Mauss 1996a). The knowledge of the bion-
omy of the remaining 13 species is very
poor (cf. Fonscolombe 1835, Mauss 1998,
Richards 1963), bionomical data concern-
ing Ceramius hispanicus Dusmet are com-
pletely lacking. Like Ceramius tuberculifcr,
C. hispanicus belongs to Ceramius species-
group 7 of Richards (cf. Mauss 1996b).
However, these species are not very close-
ly related, i.e. C. hispanicus is not a mem-

Journal of Hymenoptera Research

ber of the C. lusitanicus-complex (Mauss
1996b). Biogeographically C. hispanicus
seems to be restricted to Central, Eastern
and Southern Spain (cf. Ceballos 1956: 342,
Richards 1962: 107, Mauss unpubl.).

Data concerning habitat, nest architec-
ture, flower visiting, male activity and
mating of C. hispanicus are presented here
for the first time and are compared with
ethological accounts for other species of
Ceramius.

METHODS

Investigations were carried out from 19
to 26 June 1998. Weather conditions were
good throughout the whole period. Max-
imum air temperatures were circa 30 °C.
Sunrise took place at 4h24, sun-transit at
llh56 and sunset at 19h28 (Bien in lit.).
Time used is Greenwich Time. Observa-
tions were made with the aid of close-up
binoculars (Eschenbach Binoskop) and
documented using a 35 mm camera with
a 100 mm lens (scale up to 1:1) or a 300
mm lens.

Activity of males and females at water
was measured on 21 June (from 8h30 to
18h30) and 24 June (from 7h00 to 18h30).
A rectangular sample area of 2m X lm
was marked out with a string. The area
was completely shaded by the ridge of a
mountain after 17h30. Accuracy of count-
ing was improved by use of mechanical
hand-counters. Every half hour a measur-
ing cycle lasting 20 minutes was carried
out following the sequence:

1. Activity of females measured by
counting the number of females sitting on
the ground of the sample area every 30 s
during a period of 300 s, leading to 10
counts per period.

2. Activity of males measured by count-
ing crossings of the string into the sample
area (category "males flying") during a
period of 600 s and counting landings on
a perch within the sample area (category
"males perching").

3. Activity of females measured again
uring a period of 300s as described in I.;

female activity per half hour is the sum of
the 20 counts of a complete measuring cy-
cle (category "females at water").

Copulations were counted during the
complete 1200 s of the measuring cycle ir-
respective whether they occurred inside or
outside of the sample area. A situation
was rated as a "copulatory attempt" when
at least a short struggle on the ground
could be observed after a male ap-
proached a female and pounced on her.

Finally, two thermometers (precision:
0.5°C) were read one of which was situ-
ated 0.5 m above the ground in the shade
within a juniper tree (Tair), the other one
was placed on the wet ground with its
point in the shadow of plants (TBmund).
Short notes were made about the weather.
Radiation conditions were noted applying
the categories "cloudless" (sun not cov-
ered during the whole period), "hazy"
(sun covered by hazy clouds at least for a
short period, resulting in half shade) and
"cloudy" (sun covered by clouds at least
for a short period, resulting in shade). The
observed frequencies of the measured be-
havioural categories were summed up for
every hour. Then the proportion of activ-
ity for each hour to total activity for the
day was calculated separately for each cat-
egory and expressed as a percentage. For
statistical analysis, a Chi square test was
performed which was calculated by Aba-
cus Concepts, StatView® Student for Mac-
intosh. For 21 June the period from 8h30
to 12h30 was compared with the period
from 12h30 to 16h30. For 24 June the pe-
riod from 6h30 to 12h30 was compared
with the period from 12h30 to 18h30. For
each category the observed frequencies
were tested against the expected equal
distribution.

For nest excavation on 26 June the shaft
of each nest was completely filled with
Maizena® (fine maize flour) which was in-
jected with a squeezing bottle. Nests were
carefully excavated afterwards. Measure-
ments were taken by use of small strips of
graph paper, orientation of the cells was

Volume 9, Number 1, 2000

measured with a bearing-compass. All
nest cells were collected and stored in a
refrigerator for three days. Afterwards, all
cells were measured (external maximal di-
mensions) using a stereo-microscope
(Wild M3) with a calibrated ocular-micro-
meter; then they were opened and the
contents were recorded.

Flowering plants in the neighbourhood
of the nesting site were collected and pre-
served both dried and in 70% ethanol.
They are named according to Tutin et al.
(1964-1980). Pollen samples from the nest
and the alimentary tract of imagines fixed
in Bouin's solution were prepared using
the method outlined by Westrich and
Schmidt (1986). The different pollen types
were ascertained under a light microscope
at a magnification of 400 X or 1000X and
determined to the family or genus level
with the aid of a reference collection con-
sisting of pollen samples of 500 mainly
Mediterranean plant species including
those growing at the nesting site. Exact
knowledge of the plant species flowering
at the study site during nest provisioning
in some cases allowed pollen determina-
tion down to species level. The percentage
of the different pollen types per brood cell
was estimated by counting 50 grains at
each of 30 loci distributed randomly over
the cover slip. For each gut sample be-
tween 100 and 250 pollen grains were
counted.

RESULTS

Description of the Imbitnt. — A large pop-
ulation of Ceramius hispanicus was local-
ized in the Barranco de Zorita (GPS:
01°26.402 W 40°27.334 N), a small valley
in the Sierra de Albarracin about 6 km
north of Albarracin in Teruel province, sit-
uated on the north-east slope of the Val-
lejo Largo at an altitude of 1200 m. The
narrow, steeper part of the valley was ori-
entated from the east-south-east (down-
stream) to the west-north-west (up-
stream); at the upper end it got wider,
sloped only gently and changed its direc-

tion towards the southwest. A water
trough which was supplied by a perpetual
spring non-seasonally was situated at the
upstream end of the narrow part of the
valley. The water ran away from the
trough into a little stream (Fig. 1) that
dried out after about 100 m. Further
downstream a few puddles remained at
first but they dried out during the obser-
vation period. Two small ponds were sit-
uated about 100 m upstream of the
trough, the border of which was complete-
ly overgrown with rushes (J uncus sp., Jun-
caceae). The whole area was covered by
sparse montane forest, on calcareous soil,
dominated by trees and shrubs of differ-
ent junipers (Juniperus sp., Cupressaceae)
(cf. Polunin and Smythies 1973) forming a
Junipereto hemisphaerico-thuriferae sig-
mentum (Rivas-Martinez 1986). The
ground cover was about 70% in the valley
but decreased markedly uphill where it
became more rocky and much drier (Fig.
1). The following plant species were in
flower: the Lamiaceae Nepeta nepetella L.,
Marrubium supinum L., Sideritis spinosa
Lam. and Thymus zygis L., the Cistaceae
Helianthemum apenninum (L.) Mill, and H.
cinereum (Cav.) Pers., the Fabaceae Lotus
corniculatus L., Coronilla minima L. and
species of Ononis, Hippocrepis, Onobrychis,
Medicago and Vicia, the Primulaceae Coris
monspeliensis L., the Asteraceae Anacylus
clavatus Pers. and Achillea sp., the Rese-
daceae Reseda lutea L., the Boraginaceae
Echium vulgare L., the Rosaceae Potentilla
reptans L. and unidentified species of Bras-
sicaceae, Cichorioideae, Convolvulaceae
and Crassulaceae. The area was grazed by
sheep and goats. A small cornfield ad-
joined in the upper, widened part of the
valley.

Nest site. — An aggregation of five nests
was located on a bank of hard, clayey soil
mixed with some gravel. The bank was
about 20 m long, 2.5 m wide and rose
above the adjacent terrace by 0.4 m. It was
situated about 50 m upstream of the
ponds and ran from the southwest to the

Journal of Hymenoptera Research

Fig. 1-5. 1, Habitat <>t Ceramius hispanicus at Barranco de Zorita (Prov. Teruel, Spain) covered by sparse
montane forest dominated b\ different junipers. Males patrolled along the stream in the centre where females
collected water. 2, Male ol ( eramius hispanicus perching on a stone close to the water (glossa visible between
slightly opened mandibles) » Female ol ( '.eramius hispanicus Standing on the wet ground at the stream during
water uptake (note extended glossa). 4, Nest No. 1 oi ('animus hispanicus alter excavation on 2h June, 1998
(turret removed/ shaft filled with Maizena" ; s mam shaft; c constructed mud cell). 5, Constructed mud
cells of nest No. 3 of Ccrauiius hispanicus on 29 I line, 1998 (length ol scale bar 5 mm).

Volume 9, Number 1, 2000

Fig. 6-10. 6, Ceramius hispanicus female during nest excavation. The female had backed out of the entrance

with the soil-pellet held in her mandibles and was about to turn round and start the pellet discard flight. The
nest entrance is surmounted bv three elongated, distallv converging processes (= p; third process mainly
hidden by the middle one) (see also [ig. 11)7. female of Ceramius hispanit us initiating the turret at the entrance
of the main shaft (mud pellet supported bv mid-legs on the outside i. B, Female of Ceramius hispanicus placing
a mud pellet on the distal end of one of the processes of the turret. 9, Copulation of Ceramius hispanicus, male
and female grappling on the ground. 10, Copulation of Ceramius hispanicus; male still connected to the female
by its genitalia after it had lost its hold on the thorax of the female that had tried to escape. The situation
lasted for about 180 s.

Journal of Hymenoptera Research

Fig. 11. Schematic representation of the nest en-
trance of Ceramius hispanicus (see also Fig. 6) (weakly
dotted area = parts of the nest entrance which are
made out of mud by the female; p = elongated, dis-
tally converging processes probably homologous
with the turret; length of scale bar 1 mm).

northeast, gently sloping towards the lat-
ter. The nesting area measured about 2 m2,
its ground cover was 40-50%. The mini-
mum distances between the nests varied
from 0.4 to 1.2 m (median 0.7 m). Four
nests were situated on the face exposed to
the south-east and one was on top of the
bank.

Nest architecture. — All nest entrances
were to some extent hidden under leaves
of plants. The entrance was surmounted
by a low turret which was built of mud
pellets cemented together. It consisted of
a short basal ring which continued into
the lining of the shaft towards the base.
Distally, three elongated, converging, col-
umn-like processes arose obliquely from
the basal ring (Figs 6, 11). The processes
were about 3 mm long and were situated
around that half of the entrance which
was situated above the outside bend of the
oblique outset of the shaft forming a three-
pronged hood. Basally the processes were
separated from each other by gaps of ca.
1 mm.

The shaft ran obliquely downwards at
an angle of ca. 45° for the first 2-3 mm
(Fig. 12). Below this it continued down-
wards more or less vertically for 40-60
mm, except in nest No. 2 in which the
shaft descended obliquely to avoid stones
(Fig. 12). This section of the shaft was 5-6
mm in diameter. The remaining part of

the shaft was obliquely or vertically ori-
entated and was not terminated by a cell.
It widened to 9-10 mm in diameter in the
region of the brood cells which lay hori-
zontally to sub-horizontally and radiated
out from the main shaft. Secondary shafts
were lacking so that the cell openings
were directly integrated into the wall of
the shaft. The constructed mud cells could
be easily separated from the adhering soil
(Fig. 4). The cells were elongate, more or
less straight and noticeably wider at mid-
length than before and after it; the inner
end was markedly rounded (Fig. 5). Their
outer surface was irregular but more or
less homogenous (Fig. 5); the inner surface
was smooth but dull. Measurements of
each cell and details of its contents are list-
ed in Table 1. The cell provision was a
firm and relatively dry pollen and nectar
loaf which did not adhere to the wall.

Nest-building behaviour. — Initiation of a
nest by a female was observed three times.
The females were flying slowly low over
the ground. They interrupted their flight
several times to alight on the ground
which in some instances they scratched
with their mandibles. At the future site of
its nest, each female flew up from the
ground and performed a circular orienta-
tion flight, the diameter of which was
about lm. Then the female alighted on the
same spot again and directly started ex-
cavation.

Excavation was initiated by softening
the soil with a liquid which was appar-
ently regurgitated. A pellet of mud was
formed by the mandibles; scratching
movements of the fore- and mid-legs were
performed in addition. When a pellet had
attained about half the size of the head the
female flew up with the pellet held be-
tween her mandibles. She flew very rap-
idly about 0.1 m above the ground to-
wards an area situated between 0.3 to 0.7
m away from the nest in the immediate
vicinity of a plant. At the end she hovered
for a short moment, dipped down a few
centimetres while dropping the pellet, re-

Volume 9, Number 1, 2000

-
u

—

■x

e
-

°u

■5

ii
a

4-1

£
sc

£>

-E

^-^

■-*-

,__

(/)

■p

■-—

—

-..

—

-w

If,

(/I

c
re

■

—
o

-x

8 Journal of Hymenoptera Research

Table 1. Details pertaining to the five nests of Ceramius hispanicus excavated on 26 June, 1998 at Barranco
de Zorita (measurements of cells and investigation of cell content were made on 29 June, 1998).

Nest data

Details

of cells

Cell
no.

Orien-
tation

Depth
heli '\n

the sur-
face of
the

ground
(mm)

Exter-
nal

length
(mm)

Exter-
nal

width
(mm)

Inner
diamet-
er of
cell
open-
ing
(mm)

Condition

Nest

no.

Date of
founding

i fe-
males

cells

Content

22.06.
ilh.25

230°

sealed

small larva on pollen loaf

275°

19.4

8.4

4.0

open

egg underneath pollen loaf

22.06.
I2h47

30°

22.4

8.6

4.1

sealed

small larva laterally at the
bottom of pollen loaf

50°

21.0

8.2

4.3

open

egg underneath pollen loaf

22.06.
13h45

245°

17.3

8.4

4.1

sealed

larger larva below the pollen
loaf

245°

20.4

8.8

3.8

sealed

small larva laterally at the
bottom of pollen loaf

300°

17.5

8.8

3.8

sealed

small larva laterally at the
bottom of pollen loaf

320°

19.8

8.2

3.8

open

egg ± laterally from pollen
loaf

23.06.

110°

20.4

8.8

4.2

open

small larva laterally at the
bottom of pollen loaf

26.06.

turned to the previous flying height again
and flew rapidly back to the nest-initial.
The female repeated the whole sequence
of pellet formation and pellet dropping
several times, in which always the same

Table 2. Flower-visiting records tor males and fe-
males of Ceramius hispanicus during 11 hours of ob-
servation on three days at Barranco de Zorita (the
number of flowers visited per plant is not taken into

account).

mber of plants
visited by

Plant taxori

Mali

males

Lamiaceae

Nepeta nepetella

Marrubium supinum

Sideritis spinosa

///l/»//(s Zygis

Fabaceae

1
1

Lotus cornit ulatus

( iistaceae

/ lelianthemum apenninum

Helianthemum i inereutn

Astri.u eae

ellow < n horioideae sp.

area was used for pellet dropping. All fe-
males continued to use their individual
pellet-dropping areas over the whole ob-
servation period until 26 June. Once it was
observed that a stone which was obvious-
ly too heavy to be removed by a pellet
dropping flight was carried away from the
nest-initial on foot. Formation of a pellet
took about 30 seconds. After a female had
discarded three to five pellets she flew
away from the nesting site, probably to
collect water. On average females re-
turned after 205 seconds (n = 6) and con-
tinued to excavate the entrance of the nest.

After 25 to 60 minutes of excavation
shafts were sufficiently deep that an ex-
cavating female was no longer visible
when she had entered the nest. An exca-
vating female now had to back up the
shaft with a pellet held between her man-
dibles. As soon as such a female had left
the nest entrance she turned about 90° on
her vertical axis and performed a pellet
dropping flight as described before.

About 60 minutes after initiation of the

Volume 9, Number 1, 2000

Table 3. Pollen composition of provision from nine brood cells from four nests of Ceramius hispanicus
collected on 26 June, 1998 at Barranco de Zorita (n = 1500 pollen grains/ provision).

Nest

Nesl

Nest 4

Cell

Cistaceae

Helianthemum

94.3%

97.5%

61.9%

75.9%

97.7%

83.8%

64.8%

61.0%

94.9%

Primulaceae

Cor is

1.2%

1 .3%

12.1%

6.1%

1.6%

15.2%

33.8%

34.4%

1.0%

Lamiaceae

four species

0.7%

0.9%

15.0%

1 1 .8%

0.6%

1.0%

2.4%

3.0%

Fabaceae

Lotus

3.8%

0.3%

9.7%

6.0%

0.7%

0.4%

Convolvulaceae

0.2%

0.1%

0.3%

0.5%

0.1%

Crassulaceae

0.8%

0.1%

unknown pollen

1.1%

0.1%

0.2%

0.5%

100%

nest a female started to build a turret. At
this stage when she backed up the shaft
with a soil pellet held between her man-
dibles she held on to the ground around
the rim of the entrance with her hind legs
with her venter positioned outwards (Fig.
7). The wet soil pellet was placed on the
rim of the entrance of the shaft and
worked with the mouthparts from the in-
side while it was supported on the outer
surface with the mid-legs (Fig. 8). Finally
the female entered the shaft again and the
whole sequence started anew. On a few

occasions the female curved the metasoma
around while placing a pellet so that the
pellet was obviously supported on its out-
er surface by the ventral surface of the tip
of the metasoma and the mid-legs. After
about 15 minutes (interrupted by water
collecting flights) the turret was complet-
ed and the female resumed excavating the
nest as before (Fig. 6). The turret of nest
No. 1 was immediately rebuilt to similar
design by the female after it had been ex-
perimentally destroyed on 23 June.

The females always entered the nest

Table 4. Pollen composition of gut content of five males and five females of Ceramius hispanicus collected
at Barranco de Zorita (n = 100-250 pollen grains/ individual; dbM No. = serial number in the database of
V.Mauss, repeated on the determination labels).

Fern. lies

Males

dbM No.

1419

1421

1424

1430

1432

1418

142h

1 135

1441

1442

Cistaceae

Helianthemum

23%

97%

18%

65%

69%

74%

27%

40%

52%

56%

Primulaceae

Con's

25%

Lamiaceae

Sideritis

28%

15%

10%

16%

38%

15%

Marrubium

34%

other taxa

26%

56%

IS",,

56%

2g..(l

Fabaceae

Lotus

14%

Asteraceae

Anthemis-type

IS".,

Coniferopsida

unknown pollen

t •

2",.

1".,

10 Journal of Hymenoptera Research

head first. They were able to turn around ternately underneath their body. The for-

inside the nest, but during excavation they etarsi were brought to the mouthparts a

left the entrance always backwards. few times during the process, indicating

Water collection. — Females alighted fre- pollen uptake. When on flowers of this

quently at the edge of the little stream or plant species, the females were never ob-

on the damp soil in its immediate vicinity served to insert their heads into the corolla

to collect water. They were never ob- base.

served to settle on the water surface. After The brood cells were provisioned with

landing the females often walked a few a firm and relatively dry loaf composed of

steps forward, stopped, extended the glos- nectar and pollen. The pollen composition

sa and started to take up water, this being of all provision sampled was remarkably

accompanied by vigorous pumping move- similar. All provision contained high per-

ments of the metasoma (Fig. 3). During centages of pollen of Helianthemum apen-

water-collection females often chose spots ninum and H. cinereum (Tab. 3); less im-

on the damp soil or at the edge of the wa- portant pollen sources though well repre-

ter, which were hidden by vegetation. Fe- sented in some brood cells were Coris mon-

males were observed much less frequently speliensis, four different species of

at the two ponds and the trough than at Lamiaceae, and Lotus corniculatiis. Pollen

the stream. Females visiting the ponds of Convolvulaceae and Crassulaceae oc-

stood on the blades of the rushes during curred in small amounts in some cells,

water uptake; at the trough they held on Likewise, the alimentary tract of the ima-

to the vertical walls a short distance above gines contained pollen grains of Helianthe-

the surface of the water. mum, Coris, several species of Lamiaceae,

Forage plants. — Flower-visiting records and Lotus; pollen of Asteraceae occurred

for imagines are summarized in Table 2. in addition (Tab. 4).

Males visited the flowers of the Lamiaceae Mating behaviour. — Males were most fre-
extensively while the observed single vis- quently observed at water. They flew in
its to Helianthemum cinereum and the yel- elliptic flight paths along the stream banks
low Asteraceae were very short. The fe- in a slow, constant flight about 0.1 m
males were observed to visit mainly white above the ground. The most striking fea-
flowering Lamiaceae and Lotus comicula- ture of the flying males was the white col-
tus. Three times females were observed to oration of the clypeus and the mandibles,
change from one plant taxon to another which strongly contrasted with the dark
during a single foraging trip, indicating coloration of the body. In addition, the an-
low flower fidelity. The behavioural pat- tennae, raised at about 45° to the median
tern exhibited on flowers differed remark- axis of the body, showed their conspicu-
ably with the plant taxon. While visiting ously orange-marked curved distal ends,
flowers of Lamiaceae the imagines insert- The patrolling males sometimes interrupt-
ed the mouthparts and the distal parts of ed their flight and alighted on sun-ex-
the head deeply into the corolla. On one posed stones which were situated 0.1 to 1
occasion it was seen with certainty that m (exceptionally 3 m) away from the
the glossa was extended when the head stream. On the perch the males main-
was removed from the flower, indicating tained a characteristic posture. Antennae
nectar uptake. When females alighted on and wings were raised at about 45° to the
flowers of Lotus corniculatiis the alae of the median axis of the body; the head was of-
flower were pressed ventro-laterally. Si- ten slightly raised; and the mandibles
multaneously, the females performed lat- were usually closed, although it was ob-
I movements with the gaster and served a few times that the glossa was
moved the distal parts of the forelegs al- stretched forward slightly (Fig. 2). Perch-

Volume 9, Number 1, 2000

ing males occasionally rubbed the meta-
soma ventrally and laterally by alternate
movements of the hind-legs, or they
groomed the head, the thorax and the an-
tennae by alternate movements of the
fore-legs. The frequency of perching and
the time spent on a perch decreased dur-
ing the day. In the morning, males stayed
for up to 60 s on a perch whereas males
alighted only for a few seconds later in the
day. Interactions between males were ob-
served occasionally. Two incidents were
observed of two patrolling males rapidly
approaching each other, falling to the
ground, grappling there for a short time
and finally separating and flying away.
Flying males were also observed to ap-
proach perching males resulting in the de-
parture of the latter from the perch, fol-
lowed by contact in the air, grappling on
the ground, and finally separation.

Copulatory attempts were frequently
observed at the edge of the stream. Pa-
trolling males approached females which
were on the ground collecting water.
Males were often observed to turn away
after they had nearly reached the females
but before coming into contact with them.
However, they also frequently pounced
on sitting females, vigorous grappling on
the ground following (Fig. 9). Insertion of
the male genitalia was observed with cer-
tainty on three occasions although it prob-
ably occurred more often. On one occasion
the male lost its hold on the thorax of the
female during insertion and held on to a
plant while the female tried to escape. The
couple was still connected by the genitalia
and remained in this position for a further
180 s (Fig. 10). Often the pairs separated
after a short spell (1-5 s) of grappling on
the ground but some copulations lasted a
few minutes, at most six. Pairs never flew
off together during copulation but always
separated on the ground before they de-
parted independently.

Males also patrolled along plants in a
slow, constant flight. Patrolling males
were mainly observed in the afternoon at

patches of Marrubium supinum about 50 m
away from the nesting aggregation. Be-
tween 8h00 and 9h00 on 22 June two
searching males were observed; between
14h00 and 16h00 eight records of at least
six different patrolling males (marked or
collected) were made and five females
were observed visiting the flowers. No re-
sightings occurred. Copulations were not
observed but twice a male briefly ap-
proached and followed a honeybee work-
er (Apis mellifera L.). On 23 June one or
several males were repeatedly observed
patrolling over the nesting aggregation
and the adjacent vegetation at 12h40.

Activity pattern of males and females at wa-
ter.— The results of the activity measure-
ments are summarized in Figure 13. On
both days females collected water after
12h30 more frequently than expected (Chi-
Square test; p < 0.001). In contrast the ac-
tivity of males and the frequency of cop-
ulatory attempts was significantly higher
before 12h30 (Chi-Square test; p < 0.001
and p s 0.01 respectively) and declined in
the afternoon. Males were observed to
perch more often in the morning than later
in the day but this was only significant on
21 June (Chi square test; p < 0.001; p =
0.06 for 24 June). The first male appeared
at the stream at 7h36, the first female at
7h43. Males were not observed after 17h20
whereas females collected water until
18h03.

Associated organisms. — A female of a bee
(probably Lasioglossum sp., Halictidae)
was hiding in cell No. 2 of nest No. 1 on
June 26. It escaped during excavation.

DISCUSSION

Nest construction. — All species of Cer-
amius for which nesting is known con-
struct a cylindrical turret surmounting the
nest entrance (Gess and Gess 1988, 1992,
Mauss 1996a). The presence of a turret-like
structure in C. hispanicus is therefore con-
sidered to be a plesiomorphic trait, al-
though the shape of the turret is strongly
derived. The homology of the structures is

Journal of Hymenoptera Research

supported by their identical position at the
nest entrance and the strong similarities in
the behaviour of turret-construction (cf.
Gess and Gess 1980). A possible function
of the three converging processes of the
turret of C. hispanicus may be to camou-
flage the nest by disguising the contour of
the entrance hole. Thereby the nest is
nearly invisible to potential vertebrate
predators, made more so by hiding the en-
trance under leaves.

The burrow of C. hispanicus differs from
that of C. tuberculifer (cf. Giraud 1871, cf.
Mauss 1996a) and the majority of the Af-
rotropical Ceramius (Gess and Gess 1986,
1988, 1990, 1992) in that the main shaft is
not terminated by a cell, a situation which
is probably apomorphic. Within the
ground-nesting Masarinae lack of a ter-
minal cell at the end of the main shaft is
only known for Ceramius lichtensteinii
(Klug) (Gess and Gess 1980), Paragia tri-
color Smith (Houston 1984) and Jugurtia
confusa Richards (Gess and Gess 1980). A
further derived character of the nest of C.
hispanicus is the absence of secondary
shafts which are reported to occur in all
ground-nesting Masarinae for which nests
with more than one cell have been found
(cf. Gess 1996: 66 ff., 1999, Gess et al. 1995,
Mauss 1996a). As in members of the Af-
rotropical species-groups 3 and 6 the main
shaft of the nest of C. hispanicus is en-
larged at or near its base. In the remaining
taxa of Ceramius the main shaft shows a
short bulbous enlargement at mid-length
(Gess and Gess 1980, 1986, 1988, 1990,
1992) or is not enlarged (Gess 1999, Mauss
1996a). The "bulb" probably allows the
imagines to turn around in the shaft (Gess
and Gess 1988). Lack of a defined bulb in
C. hispanicus and C. tuberculifer (Mauss
1996a) may be functionally correlated
with the comparatively short length of the
main shaft which causes the basal turning
area to be situated in a tolerable distance
to the entrance.

The dimensions of the burrow of C. his-
panicus and C. tuberculifer (cf. Mauss

1996a) are quite similar, but they differ in
that the main shaft normally descends
more or less vertically in C. hispanicus
whereas it descends vertically (Giraud
1871) or obliquely to sub-horizontally
(Mauss 1996a) in C. tuberculifer. The dif-
ferences may only be modifications relat-
ed to the nature of the substrate at the nest
site. In contrast to C. tuberculifer (Mauss
1996a), the main shaft of the nest of C. his-
pmnicus is not terminated by a cell. Within
Ceramius this condition is merely known
from C. lichtensteinii (Gess and Gess 1988,
Gess 1996, Gess 1999) the only member of
species-group 5. The existence of con-
structed mud-cells (sensu Gess and Gess
1986) which are presumably built within
an excavated cell and the sub-horizontal
orientation of these cells can be assumed
to be plesiomorphic traits of C. hispanicus
which are adopted from the ground-pat-
tern (sensu Ax 1984: 156) of Ceramius.
They exist in the majority of species of
Ceramius and are also present in some Par-
agia (cf. Houston 1984, 1986) and Jugurtia
(Gess and Gess 1980, Gess 1996: 95).'

Digging females of C. Jiispanicus use a
clearly defined pellet-dropping area over
successive days. A set pellet-dropping
area is also used by C. tuberculifer (Mauss
1996a), C. rex Saussure, C. metanotalis Rich-
ards, C. bicolor (Thunberg), C. capicola
Brauns and C. socius Turner (Gess 1996,
Gess and Gess 1980, 1988), whilst females
of other Ce/w/m/s-species spread out the
pellets over a larger area (Gess and Gess
1980, 1988). All species of Ceramius discard
pellets in flight, with the exception of C.
tuberculifer, the females of which move to
the pellet-dropping area on foot (Mauss
1996a). The pellet-dropping area of C. his-
panicus is situated farther away from the
nest entrance than in the remaining five
species using a defined pellet-dropping
area (cf. Mauss 1996a, cf. Gess and Gess
1980, 1988). C. hispanicus utilizes a liquid
to soften the soil in nest construction. This
liquid is probably water since water is fre-
quently collected by the females. Usage of

Volume 9, Number 1, 2000

percentage of
total activity

40i

transit of sun : 1 lh56

temperature
cloud cover <°q

30-

21.06.

time of day
07h30 08h30 09h30 10h30 llh30 12h30 13h30 14h30 15h30 16h30 17h30 (Greenwich)

females at water (n = 389) 0 males flying (n = 454) LJ males perching (n = 29) LJ copulatory attemps (n = 18)

percentage of
total activity

transit of sun : 1 lh57

temperature
cloud cover (°C)

30"

t time of day

( Grt?t?nwich )
07h30 08h30 09h30 10h30 llh30 12h30 13h30 14h30 15h30 16h30 17h30

.^ females at water (n = 2629) £2 males flying (n = 685) O males perching (n = 42) CH copulatory attemps (n = 38)

Fig. 13. Activity pattern of males and females of Ccramius hispanicus on 21 |une and 24 |unc, ltH|S .it a little
stream in the Barranco de Zorita (prov. Teruel, Spain). The proportion of the summed activity ot each hour
to the amount of activity of the whole day (= n) is plotted against the time of the d^\ tor each category. The
line chart shows the temperature changes over the day; covering of clouds is expressed by symbols (for further
details see text).

14 Journal of Hymenoptera Research

water in nest building has been reported are Helianthemum (Cistaceae) and Coris

for all Afrotropical Ceramius and C. tuber- (Primulaceae), to a lesser extent also Lotus

culifer (Gess and Gess 1980, 1986, 1988, (Fabaceae) and four species of Lamiaceae.

1990, Gess 1996, Ferton 1901), although Furthermore, pollen of Crassulaceae and

the latter species may use nectar instead Convolvulaceae is used in small amounts

(Mauss 1996a). During water collection and the occurrence of pollen of Asteraceae

the females of C. hispanicus land on very in the alimentary tract of males and fe-

wet ground or at the edge of a water males indicates that pollen of this family

source. Standing on the ground during might be used for larval nourishment as

water uptake occurs in species-group 2 as well. Flowers of Helianthemum exclusively

well, while members of species-groups 3, provide pollen (Kugler 1970: 206), so that

4, 5, and 6 stand on the surface of the wa- the females have to take nectar from other

ter (Brauns 1910, Gess and Gess 1988, plants. Nectar seems to be mainly collect-

1990, Gess 1996: 76, 1999). Group 8 is ex- ed from flowers of various Lamiaceae

ceptional in showing inter- and intraspe- which is indicated by a high proportion of

cific variation in water-collecting behav- flower-visiting records being for Lami-

iour (Gess 1996: 76). Nothing is known aceae despite the comparatively low quan-

about the functional significance of the tity of pollen of Lamiaceae present in the

different water-collecting strategies. The provisions of the brood cells or in the al-

observed vigorous pumping movements imentary tract. Males also consume large

of the metasoma of the females during amounts of Helianthemum pollen indicat-

water uptake may serve to eliminate air ing that they do not incidentally ingest

from the anterior air-sacs to make some pollen during nectar uptake but actively

space for the dilatation of the crop. How- feed on it. As already established by Gess

ever, they may also turn out to be normal & Gess (1988) pollen analysis is the only

respiratory movements after a flight. reliable method to elucidate pollen-plant

Perennial re-use of nests has been re- preferences of masarine wasps,
corded for most Afrotropical species Some of the remaining members of Cer-
which construct mud-cells and C. tuber- amius species-group 7 are also polylectic.
culifer (Gess and Gess 1988, Gess 1996, Ceramius tuberculifer consumes pollen of
Mauss 1996a). Reuse of nests by C. hispan- Lamiaceae, Cistaceae and Fabaceae
icus can not be excluded, but it is remark- (Mauss 1996a) and other members of the
able that all the nests, examined were new- C. lusitanicus-complex have been recorded
ly founded. The cell-construction rate of C. visiting flowers of Lamiaceae, Fabaceae
hispanicus can be roughly estimated from and Apiaceae (Richards 1963). The main
the field data. Based on the present sam- pollen source of C. tuberculifer is Teucrium
pie, a female starting a new nest can be montanum L. (Lamiaceae) and the imagi-
expected to construct, provision and seal nes exhibit behavioural adaptations to the
0.5 (range 0.3 to 0.9) cells per day (open nototribic pollen presentation of Lami-
cells were calculated as 0.8 cells). Com- aceae (Mauss 1996a). Such behavioural ad-
parable data are not available for other aptations seem to be lacking in C. hispan-
ground-nesting masarines. The aerial nest- icus which uses flowers of Lamiaceae
ing Celonites abbreviatus (Villers) was ob- mainly as a nectar source. Afrotropical
served also to finish about 0.5 cells per species of Ceramius have not been record-
day (calculated from Bellmann 1984). ed even as casual visitors of this family

Forage plants.— Ceramius hispanicus is (Gess 1989, 1996) with the exception of

broadly polylectic and capable of dealing Ceramius ilamarinus Turner the imagines of

ith flowers of very different architecture, which use flowers of Lamiaceae as a nec-

i the study area the main pollen sources tar source (Gess 1999). It still remains un-

Volume 9, Number 1, 2000

certain whether polylecty is a character of
the ground pattern of species-group 7 or
if it evolved within the group, as Ceramius
ductus (F.) which diverged comparatively
early may be restricted to Asteraceae
(Mauss 1998). In contrast, the Afrotropical
species of Ceramius, like the majority of the
Masarinae (Gess 1996: 46-47), are mark-
edly oligolectic (Gess 1989, 1996: 41) using
only pollen of Asteraceae, Aizoaceae or
Fabaceae. Furthermore, preferences for
single plant families are characteristic at
the species-group level in Afrotropical
Ceramius.

Mating system. — Mate location behav-
iour of males of C. hispanicus includes
perching and patrolling at water-collect-
ing sites and also patrolling along flowers
of Lamiaceae at times when these are vis-
ited by the females. This is confirmed by
observations made at Valdelobus (Teruel)
where males also patrolled along the edge
of a stream and along Marrubium supinum
(Mauss unpubl.). Multiple encounter sites
are common for various aculeate Hyme-
noptera (Alcock et al. 1978, Eickwort and
Ginsberg 1980), however, most cases in-
volve only nesting areas and flowers. Cer-
amius like Paragia utilizes three potential
encounter sites: nesting areas, flowers and
water collecting sites (cf. Gess and Gess
1990, cf. Gess 1996: 59 ff., cf. Houston
1984, cf. Naumann and Cardale 1987).
Mate-seeking both at flowers and at water
has only been recorded for five Afrotrop-
ical species of Ceramius (Gess and Gess
1990, Gess 1996: 61, Gess 1999). In C. his-
panicus, preference for one of the encoun-
ter sites seems to be correlated with time
of the day. Males are most active at water
in the morning, where their activity de-
clines during the day, but they patrol
more frequently at flowers in the after-
noon. However, total activity of males is
much lower at flowers than at water and
copulatory attempts were only observed
at the latter. Interestingly enough, the
males of C. liispauicus encountered females
at their main nectar sources and not at the

pollen plants. Possibly the probability of a
male encountering a female was higher at
the nectar-plants, species of Lamiaceae,
since these were more aggregated in the
study area then were the major pollen-
plants which were scattered. Within the
patches of Lamiaceae the density of flow-
ers was comparatively high, so that a male
could patrol along higher numbers of
flowers per unit time than in the more
evenly distributed pollen plants, like e.g.
Helianthemum.

At water, mating occurs more frequent-
ly in the morning than in the afternoon
which corresponds well with the obser-
vation that males appear earlier than fe-
males. The decline of male activity in the
afternoon is probably not the result of
changes of the abiotic conditions, since fe-
male activity increases during the day and
the fewer males observed still behaved as
before. Two reasons should be considered.
First, the males may require nectar since
they have depleted their energy reserves
and secondly, the number of virgin fe-
males may decline during the day due to
the mating effort of the males. A compa-
rable activity pattern is exhibited by males
of the Australian masarine Paragia tricolor,
which Houston (1984) observed flying
around shrubs between 8h30 and 14h00
diminishing in numbers after midday.
Males of C. tuberculifer were observed to
patrol along flowers between 10h30 and
14h00 (Mauss 1996a). At water, the males
of C. hispanicus alternate between perching
and patrolling. The proportion of perching
to patrolling is highest at the onset of the
daily flight period and declines rapid Iv
thereafter. This may be correlated with ris-
ing temperature (cf. Alcock et al. 1978),
but as the males are active ahead of the
females it could be the arrival of the fe-
males which prompts this behavioural
change as well. The few incidents of grap-
pling between males indicate that some
kind of territoriality is involved in the
mating system (cf. Eickwort and Ginsberg
1980). It is important to emphasize that the

Journal of Hymf.noptera Research

males probably did not mistake each other
for a female, since all combats started in
the air. In contrast, patrolling males were
never observed to approach flying fe-
males, but frequently pounced on females
sitting on the ground. Important visual
signals which enable the males to recog-
nize each other possibly come from their
distinct coloration of head and antennae.
During mating, the males grappled vig-
orously with the females giving the im-
pression of a forced copulation. This could
indicate that the majority of the females
had been inseminated already. On the oth-
er hand it may be possible that the females
test the potential fitness of a male by of-
fering resistance.

Knowledge about the daily period of
flight activity of Ceramius is very fragmen-
tary. C. hispanicus seems to be unusual in
that its activity lasts for about 10 hours
being from 8h00 to 18h00 and imagines
are not much affected by some cloud cov-
er. Females even collected water in the
evening after the stream was completely
shaded by the ridge of the mountains. In
contrast the active period of the Afrotrop-
ical species and of C. tuberculifer seems to
be shorter (Gess and Gess 1980, 1990,
Mauss 1996a) and their imagines are very
sensitive to less favourable weather con-
ditions in general and disappear quickly
when the sun is obscured by cloud or a
breeze gets up (Gess and Gess 1980,
Mauss 1996a).

Associated organisms. — Presence of fe-
male halictine bees in nests of Ceramius
has also been recorded for C. lusitanicus
(Klug) (Mauss, unpubl.), the nests of
which they were observed to appropriate.

ACKNOWLEDGEMENTS

We are especially grateful to L. Castro (Teruel) for
his extraordinary hospitality and indispensable sup-
port of V. Mauss during the field studies and useful

comments on the manuscript. M. I.opiv (Diputacion
Genera] de Aragon) kindly issued the required col-
lection permits. R. Bien ( Astronomisehes Rechenin
hint 1 leidelberg) provided accurate limes ol sunrise,
sun-transit and sunset. Finally we are also very much

indebted to F.W. Gess and S.K. Gess (Albany Muse-
um Grahamstown) tor their critical reading of the
manuscript and improvement of our English.

LITERATURE CITED

Alcock, J., E. M. Barrows, G. Gordh, L. J. Hubbard,
L. Kirkendall, D. W. Pyle, T. L. Ponder, and F.
G. Zalom. 1978. The ecology and evolution of
male reproductive behavior in the bees and
wasps. Zoological Journal of the Linnean Society 64:
293-326.
Ax, P. 1984. Das Phylogenetische System — Systematisi-
erung der lebenden Natur aufgrund Hirer Phyloge-
nese. Gustav Fischer, Stuttgart.
Bellmann, H. 1984. Beobachtungen zum Brutverhal-
ten von Celouites abbreviates Villers (Hymenop-
tera, Masaridae). Zoologischer Anzeigcr 212: 321-
328.
Brauns, H. 1910. Biologisches iiber sudafrikanische
Hymenopteren. Zeitschrift fiir wissenschaftliche In-
sekten Biologic 6: 384-387, 445^147.
Ceballos, G. 1956. Catalogo de los Himenopteros de
Espaiia. Trabajos del Instituto Espanol de Entomo-
logia (Ins. Esp. Entomologia C.S.I.C.): 1-553.
Eickwort, G. C. and H. S. Ginsberg. 1980. Foraging
and mating behavior in Apoidea. Annual Review
of Entomology 25: 421-446.
Ferton, C. 1901. Notes detachees sur 1'instinct des Hy-
menopteres melliferes et ravisseurs avec la de-
scription de quelques especes. Annales de la So-
ciete Entomologique de France 70: 83-148.
Fonscolombe, H. B. de 1835. Description de Ceramius
fonscolombei (Latr.). Annales de la Societe Entomo-
logique de France 4: 421-427, plate 10A.
Gess, F. W. and S. K. Gess. 1980. Etiological studies
of jugurtia confusa Richards, Ceramius capicola
Brauns, C. linearis Klug and C. lichtensteinii
(Klug) (Hymenoptera: Masaridae) in the eastern
Cape Province of South Africa. Annals of the Cape
Provincial Museums Natural History 13 (6): 63-83.
Gess, F. W. and S. K. Gess. 1986. Ethological notes on
Ceramius bicolor (Thunberg), C. clypeatus Rich-
ards, C. nigripennis Saussure and C. socius Turner
(Hymenoptera: Masaridae) in the Western Cape
Province of South Africa. Annals of the Cape Pro
vincial Museums Natural History 16 (7): 161-178.
Gess, F. W. and S. K. Gess. 1988. A further contri-
bution of the ethology of the genus Ceramius La-
treille (1 lymenoptera: Masaridae) in the southern
and western Cape Province of South Africa. An-
nals of the Cape Provincial Museums Natural His-
tory 18 (1): 1-30.
Cess, F. W. and S. K. Gess. 1990. A fourth contribu-
tion to the knowledge ol the ethology of the ge-
nus Ceramius Latreille (1 lymenoptera: Vespoidea:
Masaridae) in southern Africa. Annals of the Cape
Provincial Museums Natural History IS (9): 183-
202.

Volume 9, Number 1, 2000

Gess, F. W. and S. K. Gess. 1992. Ethology of three
Southern African ground nesting Masarinae, two
Celonites species and a silk-spinning Quartinia
species, with a discussion of nesting by the sub-
family as a whole (Hymenoptera: Vespidae).
Journal of Hymenoptera Research 1: 145-155.

Gess, F. W., S. K. Gess, and R. W. Gess. 1995. An
Australian Masarine, Rolandia angulata (Richards)
(Hymenoptera: Vespidae): Nesting and evalua-
tion of association with Goodenia (Goodeniaceae).
journal of Hymenoptera Research 4: 25-32.

Gess, S. K. 1992. Biogeography of the masarine wasps
(Hymenoptera: Vespidae: Masarinae), with par-
ticular emphasis on the southern African taxa
and on correlations between masarine and forage
plant distributions, journal of Biogeography 19:
491-503.

Gess, S. K. 1996. The pollen zvasps — Ecology and natural
history of the Masarinae. Harvard University Press.
Cambridge, Massachusetts.

Gess, S. K. 1999. Distribution and ethology of Cer-
ainius dainariuus Turner (Hymenoptera: Vespi-
dae: Masarinae) in Namibia. University of Kansas
Natural History Museum Special Publications 24:
18-25.

Gess, S. K. and F. W. Gess. 1989. Flower visiting by
masarid wasps in southern Africa (Hymenop-
tera: Vespoidea: Masaridae). Annals of the Cape
Provincial Museums Natural History 18 (5): 95-134.

Giraud, J. 1863. Hymenopteres recueillis aux environs
de a Suse, en Piemont, et dans le departement
des Hautes-Alpes, en France et description de
quinze especes nouvelles. Verhandlungen der kais-
erlich-koniglichen zoologisch-botanischen Gesellschaft
in Wien 13: 11-46.

Giraud, J. 1871. Note sur les moeurs du Ceramius lu-
sitanicus Klug (Division Paraceramius Saussure).
Annates de la Societe Entomologique de France: 375-
379.

Houston, T. F. 1984. Bionomics of a pollen-collecting
wasp, Paragia tricolor (Hymenoptera: Masarinae),
in Western Australia. Records of the Western Aus-
tralia)! Museum 11: 141-151.

Houston, T. F. 1986. Biological notes on the pollen
wasp Paragia (Cygnaea) vespiformis (Hymenop-
tera: Vespidae: Masarinae) with description of a

nest. Australian Entomological Magazine 12 (6):
115-118.

Kugler, H. 1970. Blutenokologie. Gustav Fischer, Stutt-
gart.

Mauss, V. 1996a. Contribution to the bionomics of
Ceramius tuberculifer Saussure (Hymenoptera.
Vespidae, Masarinae). journal of Hymenoptera Re-
search 5: 22-37.

Mauss, V. 1996b. Morphological characters of Cer-
amius palaestinensis (Giordani Soika 1957) Gus-
enleitner 1992 (Hymenoptera, Vespidae, Masari-
nae) and considerations about its phvlogenetic
position. Einzer biologische Beitrage 28 (2): 953-
966.

Mauss, V. 1998. The identity and distribution of Cer-
amius auctus (Fabricius, 1804) Vecht, 1970 (Cer-
amius spiricornis Saussure, 1854 syn. now) and
Ceramius heaumonti (Giordani Soika, 1957) Rich-
ards, 1962 (Hymenoptera, Vespidae, Masarinae).
Annates de la Societe Entomologique de France 34
(2): 163-183.

Naumann, I. D. and J. C. Cardale. 1987. Notes on the
behaviour and nests of an Australian masarid
wasp Paragia (Paragia) decipiens decipiens Shuck-
ard (Hymenoptera: Vespoidea: Masaridae). Aus-
tralian Entomological Magazine 13 (5,6): 59-65.

Polunin, O. and B. E. Smythies. 1973. Flowers of South-
west Europe. Oxford University, London.

Richards, O. W. 1962. A revisional study of the masarid
zvasps (Hymenoptera, Vespoidea). British Museum
(Natural History), London.

Richards, O. W. 1963. New species of Ceramius La-
treille (Hymenoptera, Vespoidea) allied to Cer-
amius lusitanicus Klug. Zoologische Mededelingen
38 (13): 213-220.

Rivas-Martinez, S. 1986. Mapa de las series de vegetacisn
de Espaqa No. 14. Servicio de Publicaciones del
Ministerio de Agricultura, Pesca y AlimentaciMi.
Madrid.

Tutin, T. G., V. H. Hevwood, N. A. Burges, D. H.
Valentine, S. M. Walters and D. A. Webb. 1964-
1980. Flora Europaea. Volumes 1-5. Cambridge
University, Cambridge, England.

Westrich, P. and K. Schmidt. 1986. Methoden und
Anwendungsgebiete der Pollenanalyse bei Wild-
bienen (Hymenoptera, Apoidea). Linzer biologis-
che Beitrage 18 (2): 341-360.

J. HYM. RES.
Vol. 9(1), 2000, pp. 18-28

Revision of the Australian Tiphiid Genus Leiothynnus
(Hymenoptera: Tiphiidae: Thynninae)

Lynn S. Kimsey

Bohart Museum of Entomology, Department of Entomology, University of California,

Davis, CA 95616, USA

Abstract. — The Australian thyronine genus Leiothynnus Turner is revised, describing five new
species from Queensland, including cardalae, ferricolus, linnis, multimaculatus and ochrotarsus,
and two previously described species, mackayensis (Turner) and spinigerus Turner, also from
Queensland. Distribution maps of species and a key to males are given.

Most Australian genera of Thynninae with Agriomyia Guerin de Meneville, in-
are widespread, occurring in many Aus- eluding the flat male face (Fig. 5), with ex-
tralian states, with some even extending treme reduction of the antennal lobes, and
up into New Guinea, New Caledonia and simple male epipygium, lacking the well-
adjacent islands. However, there are some developed transverse carina or ridge typ-
small genera with relatively restricted dis- ical of Epactiothynnus and related genera,
tributions, such as Oncorhinothynnus, However, remnants of this ridge can be
which is only found in west central West- seen, particularly in cardalae and ochrotar-
ern Australia, or Gymnothynnus Turner, sus. Leiothynnus can be distinguished from
from Northern Territory and western these and other genera by the long brush
Queensland. The genus Leiothynnus Turn- of setae on the base of the male premen-
er is one of these relatively localized turn, the darkly stained marginal cell in
groups. All Leiothynnus species have been the forewing, and slender, petiolate male
collected from eastern Queensland. In ad- abdomen.

dition to the two described species, mack- Leiothynnus species differ from one an-

ayensis (Turner) and spinigerus Turner, other in modifications of the male legs, ab-

there are five new ones, which are de- dominal apex and to some extent color,

scribed below. All of the species treated below have the

The specific relationships between male thorax with dense, nearly contiguous
Leiothynnus and other thynnine genera are punctation, and the propodeal punctation
not fully resolved. Leiothynnus shares a obscured by fine shagreening. These fea-
number of features with Iswaroides Ash- tures may or may not be significant at the
mead and Epactiothynnus Turner, includ- species level. Collecting seems to be too
ing in the male the well-developed and patchy to say whether or not there are ad-
somewhat arcuate penis valves, volsella ditional undescribed species. Too few fe-
U-shaped in cross-section, stipes arcuate males have been collected to generalize
with long marginal fringe of setae, vertex about diagnostic features among the spe-
with small reddish spot behind the dorsal cies in females, although there appear to
eye margin, and a large oral plate. In the be differences in the overall shape of the
female, the pygidium has two submedial head and development of carinae or lobes
longitudinal carinae, subtended by a long on abdominal segment V.
tuft of setae. A few characters are shared Specimens were obtained from the fol-

yHWHUmi^HHHIIIIIflBDHHIBIMUaMHHWBnHiHaHl

Volume 9, Number 1, 2000

2. linnis

3. cardalae

6. ochrotarsus

7. mackayensis

8. spinigerus

9 cardalae

Figs. 1-9. Leiothynnus species. 1-3, Front view ol female face, antennae removed. 4, Front view of male face,
right antenna removed. 5, lateral view of male face. 6-9, Dorsal view of male body showing color pattern,
white = yellow, black = black, stippled = orange to red; wings removed.

Journal of Hymenoptera Research

lowing institutions and individuals: The
Australian National Insect Collection, CSI-
RO, Canberra, ACT, J. Cardale (CANBER-
RA); the Natural History Museum, Lon-
don, England, S. Lewis; Queensland Mu-
seum, Brisbane, Australia, C. Burwell
(BRISBANE-QM), and University of
Queensland, Insect Collection, Brisbane,
Australia, G. Daniels (BRISBANE-UQIC).
Some paratypes will be deposited in the
Bohart Museum of Entomology, Univer-
sity of California, Davis (DAVIS). The
types of both previously described species
were studied.

Leiothynnus cardalae Kimsey, new
species

(Figs. 3, 4, 9, 16, 18, 21, 27)

Male. — Body length 7.5 mm. Head: face
(Fig. 4) with dense small, nearly contigu-
ous punctures; flagellomere I length 1.5X
breadth; flagellomeres II-III 2.5 X as long
as broad. Thorax: punctures dense and
nearly contiguous; propodeal punctures
obscured by fine dense shagreening; scro-
bal sulcus strongly U-shaped, ventral loop
sharply defined; foretrochanter convex in
cross section; forefemur evenly convex ba-
sally, without carina, knob or other mod-
ification; midtrochanter and femur un-
modified; midcoxal inner margin narrow-
ly rounded, not angulate. Abdomen: hy-
popygial apex broadly rounded with short
medial projection (projection often weakly
sclerotized or translucent in some individ-
uals) (Fig. 21). Genitalia: paramere arcuate,
broadly rounded apically, broadest sub-
apically (as in Figs. 25, 26). Color (Fig. 9):
body black, with yellow and orange mark-
ings: head black with yellow clypeus, yel-
low along inner eye margin, between and
across antenna 1 lobes; scape pedicel and
flagellomeres I-V red; rest of flagellum
dark brown; pronotum black with yellow
transverse anterior and marginal posterior
bands; mesopleuron with subalar yellow
spot and large yellow spot above midcoxa;
one specimen with small yellow scutal
spot; scutellum and metanotum with large

medial yellow spot; propodeum with
large lateral yellow marks, narrowly sep-
arated medially; trochanter and femora
reddish brown, femoral apices sometimes
paler, tibiae red, tarsi yellow to cream-col-
ored; tergum I orange with transverse
subapical yellow band, narrowed medial-
ly; tergum II yellow with narrow dark
brown bands along anterior and posterior
margins; tergum III-IV entirely black; ter-
gum V-VI yellow anteriorly with narrow
blackish posterior band, or black with yel-
low lateral spot; tergum VII dark brown
to black; sternum I blackish basally, or-
ange apically with yellowish middle; ster-
num II orange; sterna III- VI black.

Female. — Body length 4 mm. Head (Fig.
3): broader than long, vertex somewhat
concave, with long seta above each eye;
genal area above mandible with carina ex-
tending the length of eye. Thorax (Fig. 16):
pronotal disk abruptly elevated above col-
lar, disk with longitudinal medial sulcus,
anterior margin with six long hairs; scu-
tellum about twice as broad as long, pro-
podeum strongly convex dorsally and el-
evated above scutellum, bulging medially
and flattened sublaterally, medial bulge
with long erect hairs. Abdomen: tergum I
with broadly W-shaped transverse sulcus;
tergum II with four large transverse ridg-
es; tergum V apicomedially emarginate;
tergum VI with narrow parallel-sided ca-
rina-edged medial plate, apically subtend-
ed by short dense tuft of setae (Fig. 18);
sternum VI apicomedially emarginate and
thin-edged, with long brush of setae lat-
erally and shorter brush apicomedially.
Color: dark reddish brown.

Type material. — Holotype 6: Queens-
land, Luster Creek, 8 km nw Mt. Molloy,
21-22 May 1980, I. Naumann and J. Car-
dale (CANBERRA). Seven paratypes— 3
6 6: Mt. Webb National Park, 15.04°S
145.07°E, 20-27 April 1981, I. Naumann; 1
6, one 9: Shipton's Flat, 15.47°S 145.07°E,
16-18 May 1981, I Naumann; 1 6: Coen,
13.57°S 143.12°E, 13 Jan.-25 Feb. 1994, mal-
aise trap, Zborowski and McKay; 1 6 : Tol-

Volume 9, Number 1, 2000

21. cardalae

22 //'nn/'s

24 //'nn/'s

25 //nn/'s

26. spinigerus

Figs. 10-26. Leiothynnus Figs. 10, 11, Lateral view of male forefemur and trochanter. 12-14, Lateral view ot
inner surface of male forefemur and trochanter. 15-17, Lateral view of female thorax, legs removed. 18-20,
Posterior view of female pygidium. 21-23, Dorsal view of male epipygium and hypopygium. 24. Ventral view
of female apical abdominal sternum. 25, Dorsal view of male genital capsule. 26, Lateral \ iew of male genital
capsule.

Journal of Hymenoptera Research

▲ cardalae
• linnis

Ik multimaculatus
□ mackayensis
O spinigerus
0 ferricolus

I ig. 27. Distribution map ol six species of Leiothynnus in Australia.

Volume 9, Number 1, 2000

ga, 3 Mar. 1964, R. Elder (BRISBANE-
UQIC CANBERRA, DAVIS).

Distribution. — Fig. 27.

Etymology. — This species is named in
honor of Jo Cardale, who was one of the
collectors of the holotype specimen. She
also made much of this study possible,
with collections support and encourage-
ment overall.

Discussion. — Leiothynnus cardalae is a
brightly colored species in the male, char-
acterized by having a reddish brown to
orange petiole. This coloration is shared
with ferricolus and multimaculatus. Male
cardalae can be distinguished by the un-
modified fore- and midfemur (a character-
istic shared with ochrotarsus), red legs and
bicolored antenna. The female of cardalae
has the least modified head of species
where females are known. The female tho-
rax is distinctive with a sparse row of long
hairs along the anterior margin of the
pronotum, strongly dorsally arched pro-
podeum, and pygidium with lateral cari-
nae parallel or converging slightly sub-
medially, with a small lateral lobe on ter-
gum VI.

Leiothynnus ferricolus Kimsey, new
species

(Figs. 10, 12, 27)

Male. — Body length 7.5-8.0 mm; punc-
tation as in cardalae. Head: flagellomere II
2.5 X as long as broad; flagellomere III
length 3x breadth. Thorax: scrobal sulcus
with ventral loop poorly defined; foretro-
chanter strongly flattened and concave
(Fig. 12); forefemur with short basoventral
longitudinal carina, basolateral angle ex-
panded and flattened ventrally (Fig. 12);
midfemur with long basoventral tooth,
tooth nearly as long as tarsal claw (Fig.
10), adjacent surface of trochanter flat-
tened; midcoxal inner margin sharp-
edged and angulate. Abdomen: hypopygial
apex angulate laterally with long medial
projection. Genitalia: as in Figs. 25, 26. Col-
or: black with yellow and orange mark-
ings; clypeus yellow, interantennal area

yellow; inner eye margin with broad yel-
low stripe; mandible red with basal yel-
low spot; pronotum with broad transverse
yellow anterior and posterior stripes; me-
sopleuron with large yellow subalar and
supracoxal spots; scutellum and metano-
tum with large yellow medial spot; pro-
podeum with large lateral yellow spots,
narrowly separated medially; hindcoxa
with yellow dorsal spot; trochanter and
femora dark brown, femoral apices some-
times paler, orange; fore and midtibiae or-
ange; hindtibia dark brown or orange; tar-
si yellowish brown; wing membrane yel-
low stained; abdominal segment I black
basally, becoming orange for most of
length, with transverse yellow band or
yellow spots; tergum II brown basally and
apically with broad medially yellow band;
sternum II brown with small lateral vel-

low spot; terga III, and in most specimens
IV, black with small lateral yellow spot;
terga V-VI black with large lateral yellow
spot, spots sometimes convergent medi-
ally; tergum VII black to dark brown; ster-
na III- VII black.

Female. — Unknown.

Type material. — Holotype 6: Queens-
land, Cape York Peninsula, Iron Range,
Apr. 7-May 4, 1973, S. R. Monteith (CAN-
BERRA). Nine paratype 6 6: same data as
holotype; 1 6: Mcllwrath Range, 8 km ne
Coen, 13°53.30S 143°15.21E, 13 Jan. 1994,
G. & A. Daniels and R. Eastwood (BRIS-
BANE-UQIC, CANBERRA, DAVIS).

Distribution. — Fig. 28.

Etymology. — This species is named after
its collection locality the Iron Range; ferrus
= iron, icolus = loving, Latin, masculine.

Discussion. — The most distinctive fea-
tures of this species in the male are the
cupped foretrochanter, basally carinate
forefemur and long midfemoral tooth.
Male coloration is very similar to that of
cardalae, as discussed under that species.

Leiothynnus linnis Kimsey, new species

(Figs. 2, 17, 20, 22, 24, 25, 27)

Male. — Body length 8-10 mm; puncta-
tion as in cardalae. Head: flagellomere I

Journal of Hymenoptera Research

length 1.5 X as long as broad; flagello-
meres II-III 2.2-2.4 X as long as broad. Tho-
rax: scrobal sulcus U-shaped, ventral part
weakly defined; foretrochanter convex in
cross section; forefemur evenly convex ba-
sally, without carina, knob or other mod-
ification; midtrochanter unmodified, mid-
femur projecting basoventrally in right an-
gle; mid- and hindcoxal inner margins
broadly rounded, not angulate. Abdomen:
hypopygial apex subtruncate, with strong
medial projection (Fig. 22). Genitalia (Fig.
25): paramere arcuate, broadly rounded
apically, broadest subapically. Color: body
black with yellow markings: head black
with yellow clypeus, yellow along inner
eye margin and between and across anten-
nal lobes; scape, pedicel and basal flagel-
lomeres red; rest of flagellum dark brown;
pronotum black, with yellow transverse
anterior band and band along posterior
margin; scutum with short yellow band
adjacent to tegula; mesopleuron with sub-
alar yellow spot and small yellow spot
above midcoxa; mesopleural lamellae
translucent with yellow margins; scutel-
lum and metanotum with large medial
yellow spot; propodeum with large lateral
yellow marks, narrowly separated medi-
ally; trochanter and femoral base dark
brown, femoral apices and rest of legs red-
dish orange; tergum I orange with trans-
verse subapical yellow marks becoming
darker basomedially, tergum II brown
with broad transverse medial yellow
band; tergum III-IV black without small
yellow spot laterally; tergum V-VI yellow
anteriorly, with narrow blackish posterior
band, or black with yellow lateral spot
(tergum V may also be entirely black); ter-
gum VII brown becoming paler apically.

Female. — Body length 5-7 mm. Head
(Fig. 2): slightly broader than long, strong-
ly indented laterally above eye; vertex
somewhat concave medially; genal area
between mandible and oral fossa deeply
longitudinally sulcate. Thorax (Fig. 17):
pronotal disk abruptly elevated above col-
lar, concave anteriorly; scutellum about

twice as broad as long, propodeum broad,
slightly convex dorsally, nearly planar be-
tween petiolar socket and scutellum,
strongly rounded laterally in dorsal view.
Abdomen: tergum I with broadly W-
shaped transverse sulcus; tergum II with
four large transverse ridges; tergum V ap-
icomedially emarginate; tergum VI with
narrow parallel-sided carina-edged medi-
al plate with lateral upturned flanges, api-
cal part subtended by long dense tuft of
setae (Fig. 20); sternum VI apicomedially
notched, separated into two halves, by
long ventral groove, with long brush of se-
tae laterally, and shorter brush apicome-
dially (Fig. 24). Color: dark reddish brown.

Type material. — Holotype 6: Queens-
land, Brisbane, March (BRISBANE). Para-
types: 29 6 6, 8 9 9, same data as holo-
type; 1 6, 8.5 km sse Dayboro, 27°16S
152°52E (BRISBANE, DAVIS).

Distribution. — Fig. 27.

Etymology. — The species name, linnis, is
a nonsense combination of letters and is
assumed to be masculine.

Discussion. — The color and general ap-
pearance of this species are similar to car-
dalae. However, linnis can be immediately
distinguished in the male by the unmod-
ified forefemur and small basoventral an-
gle on the midtibia, and in the female by
the peculiarly modified head and ventral-
ly divided apical abdominal sternum.

Leiothynnus mackayensis (Turner)

(Figs. 7, 14, 27)

Thynnus mackayensis Turner 1908:123. Lectotype
male (designated by Kimsey & Brown 1993);
Australia: Qld., MacKay (LONDON).

Male. — Body length 9-10 mm; puncta-
tion as in cardalae. Head: flagellomere I
1.5X as long as broad; flagellomere II 2.5 X
as long as broad; flagellomere III 3x as
long as broad. Thorax: scrobal sulcus U-
shaped, ventral segment well-defined;
foretrochanter convex in cross section;
forefemur deeply cupped ventrobasally
(Fig. 14); midtrochanter unmodified, mid-

Volume 9, Number 1, 2000

femur with basoventral tooth, nearly as
long as tarsal claw; midtrochanter unmod-
ified; mid- and hindcoxal inner margins
broadly rounded, not angulate. Abdomen:
hypopygium strongly exserted, apex api-
cally rounded, with strongly sclerotized
medial tooth. Genitalia: paramere arcuate,
rounded apically (as in Figs. 25, 26). Color
(Fig. 7): body black with yellow markings:
head black with yellow clypeus, yellow
along inner eye margin and between and
across antennal lobes; mandible yellow,
becoming reddish brown apically; scape,
pedicel and flagellomere I red; rest of fla-
gellum dark brown; pronotum with yel-
low transverse anterior band and posteri-
or lobe adjacent to tegula yellow; meso-
pleuron with subalar yellow spot and
large yellow spot above midcoxa; scutel-
lum and metanotum with large medial
and smaller lateral yellow marks; propo-
deum with large lateral yellow marks,
narrowly separated medially; trochanters
and most of femora dark brown, femoral
apices and rest of legs reddish brown; ter-
ga I and III-IV black with small apicola-
teral yellow spot; tergum II with large lat-
eral yellow spots nearly meeting medially;
terga V-VII black; sterna black, although
sternum II often with small yellow apico-
late-ral spot; wing membrane yellow-tint-
ed.

Female. — Unknown.

Material examined. — Australia: Qld,
Dunk Is. and Mackay; 5 6 6 were seen in-
cluding the lectotype.

Distribution. — Fig. 27.

Discussion. — Male mackayensis share
their dark coloration with spinigerus, al-
though unlike spinigerus this species has a
yellow band across the propodeum and
tergum II. L. mackayensis males can be
readily distinguished from spinigerus and
other species by the combination of the
basally cupped forefemur (shared with
multimaculatus), and strongly dentate mid-
femur (shared with ferricolus and spinige-
rus).

Leiothynnus multimaculatus Kimsey,
new species

(Figs. 11, 27)

Male. — Body length 11 mm; punctation
as in cardalae. Head: flagellomere I 1.5X as
long as broad; flagellomere II 2.2X as long
as broad; flagellomere III 2.5 X as long as
broad. Thorax: scrobal sulcus U-shaped
with ventral part weakly defined; forefe-
mur with deep U-shaped basoventral im-
pression, with associated longitudinal ca-
rina (similar to Fig. 12); foretrochanter un-
modified; midfemur with short basoven-
tral tooth, one half or less as long as tarsal
claw (Fig. 11), adjacent area on trochanter
flattened; mid and hindcoxae without
sharp inner margin, evenly rounded not
angulate. Abdomen: hypopygium slightly
flattened apically on either side of medial
spine. Genitalia: as in Figs. 25, 26. Color:
black with yellow and orange markings;
clypeus mostly yellow; antennal lobes and
subantennal sclerite yellow; inner eye
margin with broad yellow band; mandible
red with yellow basomedially; postocular
margin with short yellow band; scape,
pedicel and ventral surface of flagello-
meres I-IV paler red; rest of flagellum
black; pronotum with yellow band along
posterior margin; mesopleuron with large
yellow subalar spot; mesopleural lamella
with whitish stripe along inner margin;
scutellum and metanotum with large me-
dial yellow spot; propodeum with large
lateral spots, broadly separated medially;
coxae black becoming reddish dorsally on
mid and hindlegs; femora dark brown to
black, becoming red apically; tibiae and
tarsi red (except hindtibia darkened sub-
apically in holotype); terga III-IV black
without lateral yellow spots; tergum VI
black with small irregular medial yellow
spot; tergum VII black; sternum I orange;
sternum II orange becoming darker api-
cally with yellowish lateral spot; sterna III-
VI black

Female. — Unknown.

Type material. — Holotype 6: Queens-

Journal of Hymenoptera Research

land, Rockpool Gorge, Bluff Range, near
Biggenden, 4 Oct. 1976, H. Frauca (CAN-
BERRA). Paratype o\ Bluff Range, Biggen-
den, 9-20 Dec. 1972, H. Frauca (CANBER-
RA).

Distribution. — Fig. 27.

Etymology. — The species name is de-
rived from the multicolored male; multus
= many, maculatus = marks, Latin, mas-
culine.

Discussion. — The most distinctive fea-
tures of this species in the male are the
ventrally cupped forefemur, small basal
midfemoral tooth and associated indenta-
tion on the midcoxa, red legs and red bas-
al abdominal segments. L. multimaculatus
most closely resembles mackayensis but can
be distinguished by the more extensive
yellow and orange coloration and smaller
midfemoral angle (as in Fig. 11).

Leiothynnus ochrotarsus Kimsey, new
species

(Figs. 5, 6, 23)

Male. — Body length 11 mm; punctation
as in cardalae. Head (Fig. 5): flagellomere I
1.5X as long as broad; flagellomere II
length twice breadth; flagellomere III 2.3 X
as long as broad. Thorax: foretrochanter
convex in cross-section; forefemur basally
indented with short longitudinal carina;
mesopleuron with ventral part of scrobal
sulcus obsolescent; midfemur basoventral-
ly with slight angle or unmodified; mid-
trochanter unmodified; mid- and hindcox-
ae inner margins broadly rounded. Abdo-
men: epipygium with well-developed sub-
apical transverse ridge; hypopygium
broadly triangular apically (Fig. 23). Gen-
italia: as in Figs. 25, 26. Color (Fig. 6): head
yellow, except frons medially, mandibular
apex and occiput black; thorax yellowish
orange, except anterior face of pronotum
medially black, scutum black between no-
tauli surrounding large medial yellow
spot, mesopleural venter and propodeal
base black; legs orange to yellow except
base of coxae blackish; mesopleural la-
mellae translucent with yellow or whitish

margins; abdominal segment I orange be-
coming yellow laterally; abdominal seg-
ment II yellow with narrow dark brown
posterior band; abdominal segment III
black; tergum IV yellow, basally and api-
cally with narrow black band; terga V-VII
yellow with narrow basal black band; ster-
na IV-VII black with yellow lateral spot;
parameres yellow; wing membrane yel-
low-tinted, except marginal cell darker,
brownish.

Female. — Unknown.

Type material. — Holotype 6: Queens-
land, 30 km w Collinsville, 12 Sept. 1950,
E. F. Riek (CANBERRA).

Etymology. — orchros = yellow; tarsus =
legs, Greek, masculine.

Discussion. — Male ochrotarsus can be dis-
tinguished by the bright coloration, fore-
femur with basal depression and associ-
ated longitudinal carina and unmodified
midfemur. The apically triangular hypo-
pygium may or may not be diagnostic as
the holotype is an old individual with
highly worn mandibles and the hypo-
pygial apex may also be worn.

Leiothynnus spinigerus Turner

(Figs. 1, 8, 13, 15, 19, 26, 27)

Leiothynnus spinigerus Turner 1912:534. Lecto-
type male (designated by Kimsey & Brown
1993); Australia: Stradbroke Is., Moreton Bay
(LONDON).

Male. — Body length 9-12 mm; puncta-
tion as in cardalae. Head: flagellomere 1 1.3-
1.4X as long as broad; flagellomere II
twice as long as broad; flagellomere III
2.4 X as long as broad; punctation as in
cardalae. Thorax: mesopleuron with ventral
part of scrobal sulcus obsolescent; forefe-
mur with basoventral knob or swelling,
separated from longitudinal carina by in-
dentation (Fig. 13); forecoxa convex in
cross section; midfemur with long baso-
ventral tooth, nearly as long as tarsal claw;
midtrochanter flattened adjacent to femo-
ral tooth; mid and hindcoxae inner mar-
gins rounded. Abdomen: hypopygium

Volume 9, Number 1, 2000

strongly exserted, parallel-sided, apex
rounded with long medial tooth. Genitalia:
as in Figs. 25, 26. Color (Fig. 8): black, with
yellow and red markings; head black with
yellow band along inner eye margin, clyp-
eal apical margin yellow, antennal lobes
yellow; scape and pedicel reddish; flagel-
lum dark brown to black; pronotum with
short transverse anterior yellow band,
band sometimes ending at lateral notch;
mesopleuron may have subalar yellow
spot; scutellum in some specimens with
small medial yellow spot; mesopleural la-
mella translucent with white or yellow
margins; metanotum with yellow medial
spot; meso- and metapleuron with small
pale spot above coxae; coxae, trochanters
and midfemoral base and hindfemur and
hindtibia brown, rest of legs red; abdomen
black except small lateral spot on tergum
I-II or I-IV; wing membrane yellow-tinted,
becoming brownish in marginal cell.

Female. — Head (Fig. 1): vertex dorsally
convergent and angulate, not evenly
rounded; gena evenly rounded, without
sulci or grooves; posterior margin behind
eyes strongly convex in front view; clyp-
eus narrowly truncate apicomedially;
mandible slender, broadest basally, eden-
tate. Thorax (Fig. 15): pronotal disk broad-

ly quadrate, with scattered erect setae of
irregular lengths, particularly along ante-
rior margin; propleuron with ventral tuft
of long setae on either side; scutellum
about as long as broad; propodeum with
broadly convex dorsal surface, planar
with scutellum, flattened posteriorly, par-
allel-sided in posterior view, with erect se-
tae particularly laterally. Abdomen: tergum
V apicomedially emarginate; pygidium
with lateral carinae parallel-sided or di-
verging medially, subtended laterally by
short flange and long tuft of setae; ster-
num VI apex hoof-like (Fig. 19).

Material examined. — Australia: Qld,
Stradbroke Is., Brisbane, Bundaberg, and
Bribie Is.; 17 6 6 and 3 9 9 were examined
including the lectotype.

Distribution. — Fig. 27.

Discussion. — The coloration of male spi-
nigerus is similar to that of mackayensis, but
without the broad yellow bands or stripes
seen in that species. Other diagnostic fea-
tures of male spinigerus are the unmodi-
fied foretrochanter, forefemur with basal
knob and longitudinal carina, and long
midfemoral tooth. Females have a distinc-
tively narrowed vertex, tufted propleuron,
and pygidium subtended by a short
flange.

KEY TO MALES OF THE SPECIES LEIOTHYNNUS

1 Forefemur basoventrally convex, without depression or ridge 2

- Forefemur with basoventral depression, often accompanied by short longitudinal ridge (as

in Figs. 12-14) 3

2 Midfemur with small basoventral angle (as in Fig. 11); flagellum monochrome, brown or
red littnis Kimsey, new species

- Midfemur without basoventral angle; flagellum bicolored red and black (or dark brown)
cardalae Kimsey, new species

3 Forefemur with distinct longitudinal basoventral ridge and associated depression (as in Fig.

12) 4

- Forefemur with basoventral cuplike depression without longitudinal ridge (as in Fig. 14)
5

4 Foretrochanter strongly concave or cuplike in cross-section (Fig. 12); forefemur without
knob or swelling adjacent to longitudinal basal ridge (Fig. 12); midcoxa inner margin an-
gulate and sharp-edged ferricolus Kimsey, new species

- Foretrochanter convex in cross-section, unmodified; forefemur with knob or swelling ad-
jacent to longitudinal basal ridge (Fig. 13); midcoxa unmodified spinigerus Turner

28 Journal of Hymenoptera Research

5 Forefemur with large basoventral tooth, tooth nearly as long as tarsal claw; petiole (basal
two abdominal segments) black; tarsi red mackayensis (Turner)

- Forefemur with short basoventral tooth, less than half as long as tarsal claw, or basoven-
trally rounded without tooth or angle; petiole primarily yellow or orange; tarsi pale yellow,
red or brown 6

6 Midfemur unmodified; tarsi pale yellow ochrotarsus Kimsey, new species

- Midfemur with small basoventral tooth or angle (Fig. 11); tarsi red to brown

multitnaculatus Kimsey, new species

ACKNOWLEDGEMENTS nal °f the Australian Entomological Society. 32:

317-326.
Many thanks to Jo Cardale, Greg Daniels and Chris Turner, R. E. 1908. Revision of the Thynnidae of Aus-
Burwell for their assistance with this project. tralia. Part 2. Proceedings of the Linnaean Society

of New South Wales 33: 70-256.
LITERATURE CITED Turner, R. E. 1912. Notes on fossorial Hymenoptera.

1 1 . On some new Australian and Austro-Malay-
Kimsey, L. S. and G. R. Brown. 1993. Lectotype des- an Thynnidae. Annals and Magazine of Natural

ignations within the subfamily Thynninae. Jour- History 10: 533-546.

J. HYM. RES.
Vol. 9(1), 2000, pp. 29-33

Stethophotopsis, a New Genus of Sphaeropthalmini (Mutillidae:
Sphaeropthalminae) with a Brachypterous Male from Arizona

James P. Pitts and Joseph V. McHugh
Department of Entomology, University of Georgia, Athens, GA 30602, USA

Abstract. — A new genus of Mutillidae from southern Arizona with an bachypterous male, Steth-
ophotopsis Pitts, is described and illustrated, including the new species Stethophotopsis maculata
Pitts. The genus can be distinguished from males of other sphaeropthalmine genera by the pos-
terior position of the mesosternal processes, the dilated and elongated condition of the cuspis and
the absence of plumose pubescence on the cuspis.

The subfamily Sphaeropthalminae in-
cludes approximately 71 genera in two
tribes, Sphaeropthalmini and Dasylabrini.
Dasylabrini are restricted to the Old
World while Sphaeropthalmini occur in
the New World, Japan, and in the Medi-
terranean and Australian regions (Broth-
ers 1975). Of the 60 genera of Sphaerop-
thalmini, 55 occur in the New World. This
tribe is distinguished by two synapomor-
phies apparent in both sexes: the approx-
imately hemispherical, smooth and pol-
ished condition of the eye and the pres-
ence of plumose pubescence (Brothers
1975).

In a study of Mutillidae from the south-
western United States, two male speci-
mens of an undescribed brachypterous
species were found. Although no phylo-
genetic hypothesis is available for genera
of Sphaeropthalminae, this new species is
unique in several features considered to
be of generic-level importance for the sub-
family. This new genus and species are
described, illustrated and discussed be-
low.

MATERIALS AND METHODS

We follow the terminology suggested
by Menke (1993) for the scutum rather
than that of Schuster (1958). The term "tib-
ial spurs" is used instead of "calcaria."

We denote the second, third, etc. metaso-
mal tergites as T2, T3, etc. and the second,
third, etc. metasomal sternites as S2, S3,
etc.

Stethophotopsis Pitts, new genus

(Figs. 1-6)

Male. — Head: As wide as thorax. Ocel-
locular distance (Fig. 5) 2X width of lat-
eral ocellus. Clypeus forming a trapezoi-
dal, truncated anterior lobe, slightly to
moderately depressed below dorsal man-
dibular rim; clypeal base tuberculate. Ma-
lar space (Fig. 4) 0.5X maximum eye
width. Gena well developed, width ap-
proximately equal to width of mandibu-
lar base. Mandible tridentate apically,
ventral margin with slight excision, not
subtended by distinct sub-basal tooth.
Antennal scrobes carinate above, with tu-
bercle. First flagellomere 1.6X length of
pedicel; second flagellomere 1.3x length
of first flagellomere. Maxillary palp 6-
segmented, labial palp 4-segmented. Me-
sosoma: Mesoscutum with notali present
posteriorly, absent or obscure on anterior
third of mesoscutum. Tegula glabrous.
Wings brachypterous, reduced to 0.5 X
length of tegula. Mesosternum (Fig. 3)
armed with pair of densely pubescent,
triangular tapering processes, originating
near midline immediately anterior to me-

Journal of Hymenoptera Research

0.40 mm

0.65 mm

0.75 mm

0.35 mm

Figs. 1-6. Stethophotopsis maculata, Holotype. 1, Genitalia lateral view. 2, Genitalia, dorsal view on right,
ventral view on left. 3, Sternum (legs except coxae, sculpture and pilosity omitted). 4, Body, lateral view
(wings, legs except coxae, sculpture and pilosity omitted). 5, Head, frontal view (sculpture and pilosity omit-
ted). 6, Left mandible.

socoxae, appearing to cup anterior mar-
gin of mesocoxae. Tibial spurs 1-2-2; tib-
iae slender, not flattened. Metasoma: First
segment (Fig. 4) petiolate, slender, not
nodose, moderately constricted dorsally
and laterally at apex, distal width much
less than that of base of segment 2. Seg-
ment 2 with both tergal and sternal felt
lines. Apical margins of segments 1 and
2 with plumose pubescence. Pygidium
short, subtruncate at apex. Hypopygium
transverse, broader than long, laterally
undefined. Faramere arcuate, stout at
base and weakly dorsoventrally flattened.
Cuspis (Figs. 1, 2) elongate, about equal

to free length of paramere, curved ven-
trally, basal portion cylindrical, distal
portion dilated and weakly concave on
ventral surface, ventral surface with
dense simple pubescence distally. Digitus
devoid of pubescence.

Female. — Unknown

Etymology. — From the Greek stetho
"chest" + photopsis, a commonly used
sphaeropthalmine suffix, refering to the
characteristic sternal processes of this ge-
nus. Gender feminine.

Distribution. — USA, Southern Arizona.

Type species. — Stethophotopsis maculata
sp. nov.

Volume 9, Number 1, 2000

Stethophotopsis maculata Pitts, new
species

(Figs. 1-6)

Male. — Length: Holotype 7 mm, para-
type 8 mm. Color: Head, thorax, petiole,
second tergum, coxae, trochanters and tar-
si brownish-yellow. Femora and tibiae
dark brown. Third through seventh ab-
dominal segments reddish-brown. Two
round black maculations on anterior
fourth of T2 with deep punctation, ap-
pearing raised above surrounding disk.
Pubescence of head, pleural region, me-
sosternum and meatsomal sternites pale.
Pubescence of thoracic dorsum golden-
brown to pale. Pubescence of abdominal
tergites pale except black in areas of tergal
maculations. Head: Head as wide as tho-
rax, rounded behind eyes in dorsal view.
Ocelli salient, ocellocular distance (Fig. 5)
slightly greater than 2x width of lateral
ocellus, interocellar distance slightly great-
er than 2x width of lateral ocellus. Clyp-
eus anteriorly forming a trapezoidal, trun-
cated anterior lobe, slightly to moderately
depressed below dorsal mandibular rim.
Malar space 0.5 X maximum width of eye.
Gena (Fig. 4) well developed, width ap-
proximately equal to width of mandibular
base. Mandible (Fig. 6) tridentate apically,
ventrally with a slight excision not sub-
tended by a distinct sub-basal tooth, with
ventral carina ending before midlength
and with complete dorsal carina, raised at
midlength. Apical mandibular teeth with
Is" tooth basal width 4x and length 6x the
3rd tooth; 2nd tooth basal width IX and
length 2x the 3rd tooth. Antennal scrobe
carinate above, with small tubercle. First
flagellomere 1.6X length of pedicel; sec-
ond flagellomere 1.3X length of first fla-
gellomere. Ridges of hypostomal region
unmodified. Punctation of vertex conflu-
ent. Mesosoma: Pronotum, scutum and scu-
tellum shallowly, coarsely, confluently
punctate. Scutum with subcomplete no-
tauli, absent on anterior third of scutum.
Tegula glabrous. Propodeum coarsely

punctate. Mesopleuron with oblique sul-
cus indistinct; sculpture reticulate
throughout. Mesosternum (Fig. 3) armed
with pair of triangular, tapering processes,
originating immediately anterior to me-
socoxae, situated slightly medially from
center of coxae, covered with simple pu-
bescence; sinus broadly U-shaped. Meta-
sternum tridentate. Mesocoxae approxi-
mate and unarmed; metacoxa and tro-
chanter unarmed. Wings brachypterous,
reduced to 0.5 length of tegula. Metasoma:
First segment (Fig. 4) petiolate, slender,
not nodose, posteriorly moderately con-
stricted dorsally and laterally, posterior
width much less than base of second seg-
ment. Tl sparsely punctate, punctations
separated by at least 2x width. Anterior
margin of T2 coarsely, confluently punc-
tate becoming shallowly, sparsely punc-
tate posteriorly; S2 moderately punctate,
anterior fourth with median longitudinal
carina; sternal felt line approximately
0.75 x length of tergal felt line. Posterior
margin of Tl and T2 with plumose pubes-
cence. Pygidium transverse, broader than
long and subtruncate at apex. Hypo-
pygium transverse, broader than long, lat-
erally undefined by carinae. Paramere
(Figs. 1, 2) arcuate, stout at base and little
dorso-ventrally flattened, tapering, devoid
of long setose pubescence. Cuspis elon-
gate, reaching nearly to apex of paramere,
outwardly curved, distal portion distinctly
dilated and slightly spatulate, basal por-
tion cylindrical; distal portion with dense,
long simple pubescence, basal half sparse-
ly and minutely pubescent. Digitus de-
void of pubescence.

Female. — Unknown

Type material. — Holotype: "Brown Can-
yon, Baboquivari Mountains, Arizona,
September 6, 1958, Stange and Menke"
(LACM). Paratype: Arizona, Santa Cruz
County, Madera Canyon, Santa Rita
Mountains, 17-18.VIII.1949, Lloyd Martin
(LACM).

Etymology. — From the Latin maculata
"spotted," in reference to the pair of black

DISCUSSION

32 Journal of Hymenoptera Research

maculations on the anterior margin of the ous other diagnostic features. Morsyma is

second tergite. apterous and is superficially similar to

Comments. — The paratype closely re- Stctlwphotopsis because of its degree of bra-

sembles the holotype in most features ex- chyptery; however, Morsyma, has a broad-

cept that it is slightly larger. ly sessile abdomen, has smaller ovate eyes

and lacks sternal processes, notali and a
tooth on the antennal scrobe (Schuster

StetlwpJiotopsis is a distinct genus in the 1958). Protophotopsis shares with Stethopho-

Sphaeropthalmini (subtribe: Sphaerop- topsis a tridentate mandible and the lack

thalmina). The unique sternal processes Gf a ventral mandibular tooth, but it has

and the dilated, spatulate and elongate the anterior pronotal margin distinctly

condition of the genitalic cuspis are ap- emarginate, notauli absent, mesosternum

parently autapomorphic for the genus, unarmed and pubescence simple (Cambra

Stethophotopsis will key to subfamily and Quintero 1997). Photomorphus and

Sphaeropthalminae without difficulty in Stethophotopsis have well developed ster-

existing keys by Brothers (1993, 1995). In nal felt lines and a tuberculate clypeal

Schuster's (1958) key to the sphaeropthal- base; however, Photomorphus has dentate

mine males of the North American South- ridges on the anterior margin Qf the me-

west, Stethophotopsis fails to key beyond sosternum, has a ventral mandibular

the first couplet, where it may be diag- tooth/ and either lacks or has only vesti.

nosed by the autapomorphies listed giai pium0se pubescence (Schuster 1958).

a ove" Some subgenera of Sphaeropthalma Blake

Lelej and Nemkov (1997) presented a Sphaeropthalma, Physetapsis and Photopsioi-

phylogeny for the subfamilies of Mutilli- , x , . c X , . , , . ,T. ,

*, J b . y . „ , des) and species of Odontophotopsis Viereck

dae and synonymies for mutillid genera. , ., , , ,

„ i ■ , . , nave a similar hypopygium morphology

Because this work remains controversial t1 , n, ,, , , • », ,,

/r> .i innni c ii «- i , to that or Stethophotopsis. Also, some small

(Brothers 1999), we follow Schuster s . ,. ., , , rn , r ,, , , „,

/inco\ i c- L- £ x.i_ i ,11 individuals of Sphaeropthalma and Odon-

(1958) classification of the sphaeropthal- , , , r ., f . ,

™,, w ... . , tophotopsis are similar in having mcom-

mine genera. The subfamilies recognized , , „, br

here are those presented by Brothers plete notauli. The mesosternum of Sp/^r-

(1975, 1999). Currently, there is no phylo- °Pthalma> however, is never modified with

genetic hypothesis available for the sub- dentate nd§es or Processes. In S. (Sphaer-

tribe Sphaeropthalmina. Although it is ap- °Pthalma) and S. (Photopsioides) the cuspis

parent that Sphaeropthalma is paraphyletic also 1S dllated; however, it bears plumose

(pers. obs.), the othei genera of Sphaer- pubescence and is not spatulate. For Odon-

opthalmini may be monophyletic. tophotopsis, the cuspis is rod-like and the

The new species described here cannot pararnere js much longer than the cuspis.

be placed in any of the established genera Odontophotopsis (Odontophotopsis) has

of Sphaeropthalmini because it differs smaU dentate processes situated on the

from each one by characters considered to mesosternal midline far removed from the

be of generic-level significance. In the dis- mesocoxae and O. (Periphotopsis) has swol-

cussion that follows, we distinguish Steth- len> longitudinal processes running the

ophotopsis from the related genera with length of the mesosternum.

which it is most likely to be confused. Dilophotopsis Schuster and Ac r op] w topsis

Morsyma Fox, Protophotopsis Schuster Schuster differ greatly from Stethophotopsis
and Photomorphus Viereck share some in having a large dilated sub-basal tooth
characters which are of taxonomic signif- on the mandibles, dorsoventrally flattened
icance with Stethophotopsis, although they parameres and strongly depressed hypo-
differ in genitalic morphologies and vari- pygia with distinctly carinate lateral mar-

ItTrtittl

Volume 9, Number 1, 2000

gins (Schuster 1958), all of which are lack-
ing in Stethophotopsis.

Stethophotopsis shows the greatest ap-
parent affinity to the genus Acanthophotop-
sis Schuster. These genera share the fol-
lowing characters: (1) the clypeus is trun-
cate and depressed below mandibular
rim, (2) the genitalic cuspis is flattened
and dilated and (3) the mandibles are not
dentate below but have a small excision
(Schuster 1958). Despite these similarities,
Acanthophotopsis differs in a number of im-
portant characters warranting separation,
including the following: (1) loss of a me-
sotibial spur, (2) flattened and arcuate me-
sotibia, (3) cylindrical mesosternal pro-
cesses arising anterior to the posterior
margin of the mesosternum (whereas
Stethophotopsis has triangulate ridges that
arise from the posterior margin of the me-
sosternum and appear to cup the anterior
margin of the mesocoxae), (4) complete
notauli, (5) anteriorly reduced gena and
(6) sternal felt line absent.

ACKNOWLEDGEMENTS

We thank Denis Brothers (Peitermaritzburg, South
Africa), Donald Manley (Clemson, SC) and Theresa
Pitts-Singer (U.S. Forest Service) for critically review-

ing the manuscript. Roy Snelling graciously loaned
the specimens from the Natural History Museum of
Los Angeles County, Los Angeles, California
(LACM).

LITERATURE CITED

Brothers, D. J. 1975. Phylogeny and classification of
the aculeate Hymenoptera, with special reference
to Mutillidae. University of Kansas Science Bulletin
50: 483-648.

Brothers, D. J. 1993. Family Mutillidae. Pp. 188-203.
In: Goulet, H. and J.T. Huber (eds.), Hymenoptera
of the World: An Identification Guide to the Families.
Centre for Land and Biological Resources Re-
search, Ottawa, Ontario. Research Branch, Agri-
culture Canada, Publication 1894/E. 668 pp.

Brothers, D. J. 1995. Mutillidae. Pp. 541-548, In: Han-
son, P.E. and I.D. Gauld (eds.), The Hymenoptera
of Costa Rica, Oxford University Press, Oxford,
893 pp.

Brothers, D. J. 1999. Phylogeny and evolution of
wasps, ants, and bees (Hymenoptera, Chrysidoi-
dea, Vespoidea, and Apoidea). Zoologica Scripta
28: 233-249.

Cambra T., R. A. and D. Quintero A. 1997. A Revision
of Protophotopsis Schuster (Hymenoptera: Mutil-
lidae). journal of Hymenoptera Research 6: 263-272.

Lelej, A. S. and P. G. Nemkov. 1997. Phylogenv, evo-
lution and classification of Mutillidae (Hyme-
noptera). Far Eastern Entomologist 46: 1-24.

Menke, A. S. 1993. Notauli and parapsidal lines: just
what are they? Sphecos 24: 9-11.

Schuster, R. M. 1958. A revision of the sphaeropthal-
mine Mutillidae of America north of Mexico. II.
Entomologica Americana 37: 1-130.

J. HYM. RES.

Vol. 9(1), 2000, pp. 34-40

New Genera of Angarosphecinae: Cretosphecium from Early

Cretaceous of Mongolia and Eosphecinm from Early Eocene of

Canada (Hymenoptera: Sphecidae)

WOJCIECH J. PULAWSKI, ALEXANDR P. RASNITSYN, DENIS J. BROTHERS, AND

S. Bruce Archibald

(WJP) Department of Entomology, California Academy of Sciences, Golden Gate Park,

San Francisco, California 94118, USA; e-mail: wpulawski@calacademy.org;
(APR) Paleontological Institute, Russian Academy of Sciences, Moscow 117647, Russia;

e-mail: rasna@glasnet.ru;

(DJB) School of Botany and Zoology, University of Natal, Pietermaritzburg, Private Bag X01,

Scottsville 3209, South Africa; e-mail: brothers@zoology.unp.ac.za;

(SBA) Department of Biological Sciences, Simon Fraser University,

Burnaby, British Columbia V5A 1S6, Canada*

Abstract. — The new genus Cretosphecium Pulawski and Rasnitsyn is described for two Early
Cretaceous species from Mongolia: C. lobatum Pulawski and Rasnitsyn (type species) and C.
triste Pulawski and Rasnitsyn. Eosphecium Pulawski and Rasnitsyn is described to include only
the new species E. naumanni Brothers and Archibald from the Early Eocene of Canada. Eosphe-
cium, tentatively assigned to Angarosphecinae Rasnitsyn, 1975, may represent the first Cenozoic
record for the subfamily, known heretofore only from Early Cretaceous deposits.

Species of Angarosphecinae Rasnitsyn,
1975 (= Baissodinae Rasnitsyn, 1975) are
early sphecid wasps that lack synapomor-
phies of the extant subfamilies. Only a
small fraction of the available material has
been described so far (Rasnitsyn 1975;
Rasnitsyn et al. 1998, 1999), and three ad-
ditional fossils that we attribute to this
subfamily are described here. These spec-
imens are characterized by a unique wing
venation, found in no other sphecids, ei-
ther fossil or extant; and one shows pro-
notal lobes, a unique synapomorphy of
Apoidea. Two are from the Early Creta-
ceous, and the third is from the Early Eo-
cene, the first record from the Cenozoic
Era for the subfamily. Until now, Anga-
rosphecinae (including much undescribed
material housed at the Paleontological In-

* Currrnt address: Museum of ( omparative Zoolog) .
26 Oxford Street, Cambridge, Massachusetts 021 18;

e-mail: barchiba Id"" oeb.liarv.ird.edu

stitute, Russian Academy of Sciences)
were known exclusively from the Early
Cretaceous.

Morphological terminology used here
deviates from that of Brothers (1975) and
Bohart and Menke (1976) in several ways
and is as in Rasnitsyn et al. (1999). The fol-
lowing structures, variously termed in the
literature, are here defined or redefined for
the sake of clarity and convenience:

- adlateral line: parapsidal line of Bohart
and Menke (1976); we prefer the term
coined by Budrys and Kazenas (1992) as
it is more informative (self-explanatory
and analogous to the admedian line)
and also because the term parapsidal
line is used by many authors to desig-
nate the structure that Bohart and Men-
ke and most other hymenopterists call
notaulus;

interpostgenal suture: line of fusion of
the postgenae, extending from the oral
cavity to the occipital foramen;

Volume 9, Number 1, 2000

- metasoma: abdomen excluding the pro-
podeum (gaster of Bohart and Menke
1976);

- postgena: area between hypostomal ca-
rina and occipital foramen;

- spiracular lobe (Rasnitsyn 1988): pro-
notal lobe of Bohart and Menke (1976);

- costal space: cell C of Brothers (1975),
costal cell of Bohart and Menke (1976);

- cell 1 + 2r: cell SC + R of Brothers
(1975), submarginal cell I of Bohart and
Menke (1976);

- cell 3r: cell R of Brothers (1975), margin-
al cell of Bohart and Menke (1976);

- cells 2rm and 3rm: cells IS and 2S of
Brothers (1975), submarginal cells II and
III of Bohart and Menke (1976);

- cells lmcu and 2mcu: cells S + M and
1M of Brothers (1975), discoidal cells I
and II of Bohart and Menke (1976);

- cell 2cua: lCu of Brothers (1975), sub-
discoidal cell of Bohart and Menke
(1976);

- veins 2r-m and 3r-m: distal margins of
cells 2rm and 3rm, respectively (as in
Richards 1977, and Gauld and Bolton
1988), corresponding to crossveins ls-m
and 2s-m of Brothers (1975), and lr-m
and 2r-m of Bohart and Menke (1976);
we consider the true lr-m to be present
only in primitive Symphyta such as the
xyelid genus Pleuroneura Konow or Xye-
la lata D. Smith.

- veinlet lr-rs: partial vein within cell 1 +
2r, originally separating cells lr and 2r;
called lr by Bohart and Menke (1976).

- crossvein 2r-rs: vein separating cells 1 +
2r and 3r, called r-s by Brothers (1975)
and 2r by Bohart and Menke (1976).

Figs. 1 and 2 are by APR and Fig. 3 is
by DJB.

Cretosphecium Pulawski and Rasnitsyn,
new genus

(Figs. 1, 2)

Derivation of name. — Cretosphecium, from
the Latin word creta (chalk) and the Greek
word sphekion (little wasp); with reference

to its occurrence in the Cretaceous Period.
Gender neuter.

Diagnosis. — Cretosphecium has an unusu-
ally long cell 2rm whose posterior margin
is longer than that of cell 1 -I- 2r, veins lm-
cu and 2m-cu are received by cells 2rm
and 3rm, respectively, and cell 3r is trun-
cate apically. A similar venation is found
in Eosphecium. In Cretosphecium, however,
vein 2r-rs is less than the height of ptero-
stigma, cell 3r receives vein 3r-m next to
the apical truncation, vein lm-cu joins cell
2rm at the cell's midlength, cell 2rm is less
than 3 times as long as high, and cells
2cua, 2mcu, and lmcu are about equal in
height. In Eosphecium, vein 2r-rs is about
equal to the height of pterostigma, vein 3r-
m is markedly distant from the apex of
cell 3r, vein lm-cu joins cell 2rm before the
cell's midlength, cell 2rm is almost 5 times
as long as high, and cells 2cua and 2mcu
are about twice as high as cell lmcu.

Description. — The following comple-
ments the above characteristics. Pronotal
hindmargin angulate dorsolaterally adja-
cent to spiracular lobe. Scutum: notaulus
complete, extending from hindmargin to
foremargin; adlateral line extending from
hindmargin almost to foremargin. Fore-
wing: vein 2r-m oblique, sinuous or
straight, vein 3r-m oblique and sinuous (in
C. lobatum, not preserved in C. triste), its
anterior end insignificantly closer to wing
margin than to apex of cell 3r; vein cu-a
postfurcal. Hindwing (preserved only in
C. lobatum): cu-a postfurcal, angled with
first abscissa of Cu. Metasoma sessile.

Taxonomic position. — The presence of a
spiracular lobe (visible in C. lobatum) dem-
onstrates that Cretosphecium is a member
of Apoidea. The elongate notaulus that
reaches the mesoscutal hindmargin is an
ancestral character not found in any of the
extant apoid genera but is typical of the
subfamily Angarosphecinae.

Type species. — Cretosphecium lobatum Pu-
lawski and Rasnitsyn, new species.

Composition. — Two species from the Ear-
ly Cretaceous of Mongolia.

Journal of Hymenoptera Research

5 mm

Fig. 1. Cretosphecium lobatum Pulawski and Rasnitsyn, new species. Upper left and right: thoracic dorsum in
two aspects; al: adlateral line; aS: apical metasomal sternum; cr: costal; ex: coxa; f: femur; hyc: hypostomal
carina; md: mandible; msl: median mesoscutal line; n: notaulus; N,: pronotum; N,: metanotum; occ: occipital
carina; of: occipital foramen; pge: postgena; ph, pl3: meso- and metathoracic venters; pN3: metapostnotum ( =
propodeal enclosure); pp: propodeum; S,: metasomal sternum I; sc: scape; scl: scutellum; si: spiracular lobe;
sme: submentum; sti: stipes; ta: tarsus; tg: tegula; ti: tibia; tr: trochanter. Labels for veins and cells are con-
ventional or as explained in text.

Relationship of included species. — We treat
the two specimens described below as con-
generic because of their similar wing ve-
nation and in spite of their morphological
differences (presence or absence of the in-
terpostgenal bridge, form of the metatho-
racic venter). These differences could be re-
garded as generic, but we prefer to base
our classification solely on the wing vena-
tion, admittedly perhaps creating artificial
assemblages of unrelated taxa. This, how-

ever, appears to be the most realistic ap-
proach, given that the body structures are
unknown in the majority of fossils.

Cretosphecium lobatum Pulawski and
Rasnitsyn, new species

(Fig- 1)

Derivation of name. — Lobatum, a Latin
neuter adjective meaning lobed; with ref-
erence to the spiracular lobes which can
be clearly identified in the holotype.

Volume 9, Number 1, 2000

5 mm

Fig. 2. Cretosphecium triste Pulawski and Rasnitsyn, new species; d: discrimen (interpleural suture); ipgs:
interpostgenal suture; oc: eye; ps: propodeal spiracle. Other abbreviations as in Fig. 1.

Diagnosis. — Larger than C. triste (e.g.,
length of forewing about 9.0 mm rather
than about 6.8 mm), vein 2r-rs emerging
at about two-thirds pterostigmal length,
vein 2r-m sinuous, and foremargin of cell
3rm shorter than height of cell.

Description. — Sex unknown. No coarse
sculpture recognizable except pronotum
transversely ridged. Head nearly circular,
occipital carina complete, postgenae wide-
ly separated, gap between them obscured
by bases of maxillae and labium. Meso-
scutum with rudimentary median line.
Metathoracic venter forming a subtrian-
gular elevation between hindcoxae. Fore-
wing: vein 2r-rs emerging at about two
thirds of pterostigmal length; vein 2r-m
sinuous, its fore end closer to 3r-m than to

2r-rs; vein 3r-m oblique, sinuous; maxi-
mum width of cell 3rm markedly less than
its basal height. Length of midtrochanter
more than twice width. Midbasitarsus lon-
ger than midtarsomeres II-IV combined,
midtarsomere IV longer than wide. Meta-
somal segment I subtriangular, wider than
long, hindmargin of sternum I shallowly
emarginate. Sternum II longer and wider
than I, its anterior margin straight. Apical
sternum subtriangular, carinate laterally.
Body length as preserved 16.2 mm, fore-
wing about 9.0 mm long, head width 3.0
mm. Body dark (color unknown for miss-
ing parts: antenna! flagellum, hindtibiae
and tarsi), but the following are distinctly
paler: midtarsus (except basitarsus base)
and wing veins including pterostigma.

Journal of Hymenoptera Research

5 mm

Fig. 3. Eosphecium naumanni Brothers and Archibald, new species.

Type material. — Holotype: Mongolia,
Bayanhongor Aymag: Bon Tsagan, 5-8 km
north of Bon Tsagan Nuur (= Bon Tsagan
Lake); Early Cretaceous, impressed in
marl of the Khurilt rock unit, Bon Tsagan
Series (Sinitza 1993), possibly of Aptian
age (Ponomarenko 1990). Deposited in the
Paleontological institute, Russian Acade-
my of Sciences, Moscow, Russia (catalog
number 3559/4533).

Cretosphecium triste Pulawski and
Rasnitsyn, new species

(Fig. 2)

Derivation of name. — Triste, Latin neuter
adjective meaning sad; with reference to
the specimen's poor preservation.

Diagnosis. — Smaller than C. lobatum
(e.g., length of forewing about 6.8 mm
rather than about 9.0 mm), vein 2r-rs
emerging at pterostigmal midlength, vein

2r-m straight, and foremargin of cell 3rm
longer than basal height of the cell.

Description. — Sex unknown. Head near-
ly circular, postgenae broadly contacting
mesally, occipital carina complete and
meeting hypostomal carina near midline
of head. Scutum with no median line.
Apex of metapleural venter with triangu-
lar emargination. Propodeal spiracle long,
narrow. Forewing: vein 2r-rs emerging at
pterostigmal midlength; vein 2r-m
straight, its fore end equidistant from 2r-
rs and 3r-m. Legs appearing thicker than
in C. lobatum. Original color probably not
preserved (entire specimen uniformly
light).

Type material. — Holotype: Mongolia:
Bayanhongor Aymag: Bon-Tsagan (other
data as under Cretosphecium lobatum
above). Deposited in the Paleontological
Institute, Russian Academy of Sciences,

Volume 9, Number 1, 2000

Moscow, Russia (catalog number 3559/
694).

Eosphecium Pulawski and Rasnitsyn,
new genus

(Fig. 3)

Derivation of name. — Eosphecium, from
the Greek words eos (dawn, morning, ear-
ly) and sphekion (little wasp); with refer-
ence to the Eocene age of the specimen.
Gender neuter.

Type species. — Eosphecium naumanni
Brothers and Archibald, new species.

Diagnosis. — Like Creiosphecium, Eosphe-
cium is characterized by an elongate cell
2rm (the length of its posterior margin is
approximately equal to that of cell 1 + 2r),
veins lm-cu and 2m-cu are received by
cells 2rm and 3rm, respectively, and cell
3r is truncate apically. Unlike in that ge-
nus, the length of vein 2r-rs in Eosphecium
about equals the width of the pterostigma;
the anterior end of vein 3r-m is removed
from the apex of cell 3r by more than the
height of cell 2rm; veins RS + M and M
(= posterior margins of cells 1 + 2r, 2rm,
and 3rm) form an almost straight line (al-
though Creiosphecium lobatum approaches
this condition); vein lm-cu joins cell 2rm
before the cell's midlength; cell 2rm is al-
most 5 times as long as high (less than 3
times in Cretosphecium); and cells 2cua and
2mcu are about twice as high as cell lmcu
(about equal in Cretosphecium).

Taxonomic position. — In the absence of
other evidence, we assign Eosphecium to
Angarosphecinae based solely on the fore-
wing venation pattern that resembles that
of Cretosphecium. We also consider the
above differences and the major difference
in stratigraphic age sufficient to warrant
its description a separate genus.

Eosphecium naumanni Brothers and

Archibald, new species

(Fig. 3)

Derivation of name. — Named after Dr.
Ken Naumann who collected the speci-
men.

Description. — The following characters
are complementary to the generic diag-
nosis above: vein 2r-rs emerging at ptero-
stigmal midlength; vein 2r-m straight, its
fore end about equidistant from 2r-rs and
3-rm; vein 3r-m markedly angled near
midlength; vein cu-a slightly postfurcal;
vein Cu2 sinuous. Costal space densely se-
tose towards apex and deeply pigmented
(evident in counterpart), remainder of
wing pale; veins dark. Forewing length
about 14.2 mm (thus considerably larger
than both species of Cretosphecium).

Type material. — Holotype (forewing
only): Canada, British Columbia: Quil-
chena, 50°07'40.3"N, 120°30'34.7"W; Early
Eocene: Coldwater beds of the Kamloops
Group, 52-54 mya (Mathewes and Ville-
neuve in prep.). Deposited in the Depart-
ment of Biology, Simon Fraser University,
Burnaby, British Columbia, Canada, cata-
log number Q-0423a (part) and Q-0423b
(counterpart).

ACKNOWLEDGMENTS

We sincerely thank Dr. Ken Naumann (Langara
College, Vancouver) who donated the specimen of
Eosphecium naumanni to Simon Fraser University and
made it available for study- Financial assistance to
DJB from the University of Natal Research Commit-
tee is acknowledged with gratitude. Comments by an
anonymous reviewer helped improve the manu-
script

LITERATURE CITED

Bohart, R. M., and A. S. Menke. 1976. Sphecid Wasps
of the World. A generic revision. Universitv of Cal-
ifornia Press, Berkeley, 1 os Angeles, 1 ondon. 1
color plate, IX + 695 pp.

Brothers, I). J. 1975. Phylogenv and classification ot
the aculeate Hvmenoptera, with special reference
to Mutillidae. 77k University of Kansas Science Bul-
letin 50: 483-64N.

Budrys, E. R., and V. L. Kazenas. L992. Novye vidy
royushchikh os rod a Piodontus (Hvmenoptera,
Sphecidae) — New species of the genus Diodontus
( I [ymenoptera, Sphe< idae I. Zoologic heskiy
Zhurnal 71 (8): 24-31. English translation: 1993
New species of digger wasps of the genus Dio-
dontus. Entomological Review 72: 114 121.

Gauld, [., and B. Bolton. L988. The Hymenoptera. Brit-
ish Museum (Natural History) and Oxford I ni-
versit) Press, Oxford, 332 pp.

Journal of Hymenoptera Research

Ponomarenko, A. G. 1990. Nasekomyie i stratigrafiya
nizhnego mela Mongolii (= Insects and the Low-
er Cretaceous stratigraphy of Mongolia), p. 103-
108 in Krassilov V.A. (editor). Kontinental'nyi mel
SSSR. Materiyaly Soveshchaniya Sovetskoy Rabochey
Gruppy Proekta N" 245 "Korrelatsiya nemorsksogo
mela" Mezhdunarodnoy Programmy Geologicheskoy
Korrelatsyi (= Non-marine Cretaceous of the USSR.
The Submission from the Conference of the Soviet
Working Group of the 1GCP Project 245), Vladivos-
tok, 1988. Dal'nevostochnyi Otdel Akademii
Nauk SSSR, Vladivostok. 226 pp.

Rasnitsyn, A. P. 1975. Vysshye pereponchatokrylye
mezozoya — Hymenoptera Apocrita of Mesozoic.
Akademiya Nauk SSSR. Trudy Paleontologicheskogo
Instiiuta (= Academy of Sciences of the USSR.
Transactions of the Palaeontological Institute) 147:
1-133, I-VIII.

Rasnitsyn, A. P. 1988. An outline of evolution of the
hymenopterous insects (order Vespida). Oriental
Insects 22: 115-145.

Rasnitsyn, A. P., E. A. Jarzembowski, and A. J. Ross.
1998. Wasps (Insecta: Vespida = Hymenoptera)
from the Purbeck and Wealden Lower Creta-
ceous) of Southern England and their biostrati-
graphical and paleoenvironmental siginficance.
Cretaceous Research 19: 329-391.

Rasnitsyn, A. P., W. J. Pulawski, and X. Martinez-
Delclos. 1999. Cretaceous digger wasps of the
new genus Bestiola Pulawski and Rasnitsyn (Hy-
menoptera: Sphecidae, Angarosphecinae). Jour-
nal of Hymenoptera Research 8: 23-34.

Richards, O. W. 1977. Hymenoptera. Introduction and
keys to families, second edition. Handbooks for the
identification of British Insects, Vol. VI, Part 1. Roy-
al Entomological Society of London, London. 104

PP-

Sinitza, S. M. 1993. Yura i nizhniy mel Tsentral'noy
Mongolii (= Jurassic and Lower Cretaceous of
Central Mongolia). Trudy Sovmestnoy Sovetsko-
Mongol'skoy Paleontologicheskoy Ekspeditsii [ =
Transactions of the Joint Soviet-Mongolian Paleon-
tological Expedition). No. 42: 1-239 pp.

J. HYM. RES.
Vol. 9(1), 2000, pp. 41-47

A New Species of Nitela (Hymenoptera: Sphecidae: Larrinae) from
Australia with Notes on the Nests and Prey of Two Species

Robert W. Matthews
Department of Entomology, University of Georgia, Athens, GA 30602, USA

Abstract. — Nitela elegans Matthews, a new species from Australia, is described and illustrated.
The first biological data for N. elegans and N. australiensis Shultz, both nesting in pithy stems, are
presented. Both prey on Psocoptera, and appear to progressively provision their cells. Prey of N.
elegans were nymphs of sp. B (Psocidae) and nymphs of Heterocaecilius sp. (Pseudocaeciliidae).
Prey of N. australiensis were nymphs of Aaroniella razvlingsi Smithers (Philotarsidae). There appear
to be at least two generations per year in Canberra, Australia. The pteromalid chalcid Eupelmo-
photismus pulcher (Girault) was reared from pupae of both species. A clutch of 14 Ceraphronidae
{lAphanogmus sp.), possibly a hyperparasite of E. pulcher, was found inside a cocoon of N. aus-
traliensis.

Although Nitela Latreille is found Nitela elegans Matthews, sp. nov.

world-wide, with 43 species listed by Bo- (Figs. 1-8)

hart and Menke (1975), only three species Types.— Holotype female, 35.19S.,

are described from Australia, and noth- 148;08Ev Deakin, ACT, 4 April 1999, R. W.

ing has been published on the nesting be- Matthews, deposited in ANIC. Paratypes:

havior of any Australian species. Smith- 4 females, same locality and collector data

ers (1990) recorded three species of Pso- as holotype bearing dates 20.i.l999 (Bio

coptera as prey of an unidentified Aus- Note 185)/ 23.i.l999 (one with label Bio

tralian species listed only as Nitela sp., Note 186)/ and 3.^.1999, all deposited in

but provided no nest details. Studies of ANIC

other species of Nitela (Iwata 1939; Jan- Female.— Head: Globular, broader than

vier 1962; Valkeila 1955), indicate that high. Eyes stongly convergent dorsally,

members of the genus nest in pre-existing distance between eyes at level of the lat-

cavities in stems, galls, and beetle bur- eraj oceHj about half distance between

rows. Cells are separated from one anoth- eyes measured just above the toruli. Frons

er with bits of woody debris piled loosely (Fig. 1) evenly convex, rugulose, with lon-

in the burrow. gitudinal rugae more prominent. Vertex

Material in the Australian National In- (Fig. 4) finely punctate, except space be-

sect Collection (ANIC) in Canberra sug- tween lateral ocellus and orbit smooth; lat-

gests that there are several undescribed eral ocelli separated by just less than their

species of Nitela in Australia, but most are diameter, but narrowly separated from

represented by only one or two speci- eye margin by about 0.25 their diameter,

mens. In order to identify the two species Gena (Fig. 2) finely rugulose at mandible

discussed here, the types of each of the bases, becoming faintly reticulate dorsally.

three named species were studied. Vouch- Occipital carina entire, weakly costulate

er specimens of the wasps, parasites, prey, along anterior margin. Clypeus (Fig. 3)

and nests are deposited in the ANIC. smooth, the apical margin rounded, very

Journal of Hymenoptera Research

Figs. 1-8. Nitela elegans Matthews, sp. nov., paratype female: l, head, frontal view. 2, head and prothorax,
lateral view. 3, clypeus, labrum, mandibles, frontal view. \, head and pronotum, dorsal view. 5, mesoscutum
and scutellum. 6, propodeum, dorsal view. 7, mesosoma, lateral view, 8, Tl dorsal view. Scale lines 0.1 mm.

Volume 9, Number 1, 2000 43

slightly pointed medially, with prominent Wings hyaline, veins brown. Body Length:

median longitudinal raised carina, evenly 5.0 mm.

rounded in profile, not quite reaching Male: Unknown.

clypeal margin. Labrum (Fig. 3) short, Notes. — In Turner's (1916) key this spe-

smooth broadly emarginate apically. An- cies runs to N. kurandae Turner. It differs

tennal scrobes (Fig. 1) faintly transversely in that the frons sculpture (Figs. 1, 4) is

microreticulate. Scape about twice as long much more rugose, and the scapes and

as maximum breadth, length slightly less basal half of the flagellum are entirely

than length of pedicel plus first flagellar black.

segment. Second flagellar segment 1.3X as Biology. — Two active nests of this spe-

long as first. Mandibles (Fig. 3) bidentate, cies were found in slender (ca. 5 mm di-

the inner tooth smaller, blunter, and short- ameter) pithy stems of an unknown dead

er than apical tooth. Mesosoma: Transverse plant (possibly Lantana sp.) on 20 and 23

pronotal sulcus (Fig. 5) crenulate, slightly January 1999 in a suburban yard of Deak-

broader laterally, discontinuous medially in, ACT. One nest was newly initiated and

where it is broken by a posteriorly pro- the other nearly complete. The newly ini-

jecting "V"; lateral margins of pronotum tiated nest was in a burrow 102 mm long

weakly angulate. Mesoscutum (Fig. 5) and 2.0 mm in diameter. This nest con-

convex,uniformly punctate, except lateral tained a single half grown larva about

margins crenulate. Scutellum uniformly midway along the burrow and 8 Psocop-

punctate, separated from mesoscutum by tera nymphs (sp. B, Psocidae). Two prey

narrow costulate furrow. Mesopleuron were adhering to the larva's body, and the

(Fig. 7) subalar area coriaceous; signum others were scattered along the burrow,

deep, area below it becoming coarsely Those not yet fed upon were only lightly

punctate; episternaulus a distinct narrow paralyzed, able to kick their legs and

crenulate furrow; hypersternaulus dis- move their antennae, but lacked coordi-

tinct, broader, crenulate to rugulose, fad- nation. The female was resting near the

ing posteriorly; area anterior to epister- entrance, head facing out. No nest struc-

naulus rugose; propodeum lateral face ture was evident; there was no prelimi-

longitudinally strigose with weak rugu- nary plug or cell closure,

lose interspaces (Fig. 7); propodeal dorsal The second nest's burrow was 136 mm

face rugulose with longitudinal rugae long and 2.0 mm in diameter. It contained

more prominent; propodeal hind face (Fig. three completed cells and a fourth partial-

6) less strongly rugulose, with the trans- ly provisioned. The stem appeared previ-

verse rugae more prominent. Metasoma: Tl ously to have been used by another wasp

(Fig. 8) more or less smooth and shining, as the basal 36 mm of the burrow was

very faintly coriaceous dorsally, with faint tightly packed with pith fragments and

transverse microreticulation towards api- old insect parts. Cell 1 was 12 mm long

cal margin. T2-T6 with faint transverse mi- and contained a Nitcla cocoon snug

croreticulation. Forewing: Length 3.0 mm. against the packed matter in the inner end

Marginal cell distally truncate, weakly ap- of the burrow. The cylindrical tan-colored

pendiculate. lr-m vein straight, interstitial cocoon was 5 mm long and 1.8 mm in di-

with recurrent vein, and interrupted at ameter. It was later found to contain a ful-

about 0.25 of its length. Color. Head, me- ly formed dead adult chalcidoid parasit-

sosoma, metasoma non-metallic black, oid, Eupelmophotismus pulcher (Girault)

Antennae black. Mandibles black basally, (Pteromalidae: Cleonyminae). Cell 2 was 8

lighter apically. Legs orange, except coxae mm long and contained fragments of an

black, femora suffused with brown, and old cocoon. Cell 3 was 13 mm long and

distal three tarsomeres brown to black, contained a mature larva spinning a ma-

Journal of Hymenoptera Research

trix of silk. Several faecal pellets adhered
to the larva's body. Cell 4 was incomplete
and contained 2 prey, both nymphs of
Heterocaeciluis sp. (Pseudocaeciliidae). No
egg was present and both prey were light-
ly paralyzed and able readily to move
their appendages. Beyond these prey the
female was resting facing out.

The cells were separated by partitions
consisting of numerous bits and pieces of
organic debris, mostly not identifiable, but
appearing to be small bits of bark, pith,
insect exoskeleton fragments, seeds,
husks, caterpillar faeces, etc. loosely
packed along the burrow. The lengths of
the partitions closing the three cells were
7 mm, 33 mm, and 2 mm long respective-
ly. That cells 1 and 2 may have belonged
to an older, prior nest is suggested by the
fact that the cocoon in cell 2 was old and
empty, the cocoon in cell one contained a
dead parasite, and the closing plug of cell
2 was very long.

Both nests contained incomplete cells
apparently being actively provisioned by
the respective females. The first contained
a partly grown larva in the cell and the
second did not yet have an egg. Taken to-
gether, these facts suggest that either de-
layed mass provisioning or progressive
provisioning is practiced in this species.
Regardless, it appears that cells are not
closed until the larva is essentially full
grown.

The two prey species are typically
found either on bark, branches, and twigs,
or on the undersides of green leaves (C.
N. Smithers, in litt.). Nine prey found in
another nest (presumed to be N. elegans)
were also identified as psocid sp. B.

The parasitoid genus Eupelmophotismus
with about eight known species (Nau-
mann, unpublished) is endemic to Austra-
lia and New Guinea. Previous hosts re-
corded for E. pulcher are bees, including
Hylaeus sp., Amphylaeus morosus (Smith),
(both Colletidae) and Neoceratina australen-
sis Perkins (Anthophoridae) (Boucek
1988), and the sphecid wasp, Psenulus /'//-

terstitialis Cameron (Matthews 2000). All
of these hosts are twig nesters like N. ele-
gans. Presumably £. pulcher oviposits
through the stem wall and attacks the pu-
pal stages of its host, although it is possi-
ble in the case of Nitela that it burrows
through the loose cell partitions to reach
its host.

Nitela australiensis Schulz

This entirely black species of Nitela is
widespread throughout Australia, al-
though it has not yet been recorded from
the Northern Territory.

Biology. — Turner (1916) speculated that
it nested in old beetle burrows in dead eu-
calypts. I encountered it nesting in pithy
stems of various unidentified plants in
Deakin, a suburb of Canberra, ACT. Con-
tents of three nests discovered from 31
January to 4 March 1999 are reported here.

Architecturally the nests were indistin-
guishable from those of N. elegans, being
in burrows which had been excavated in
slender (ca. 5-7 mm diameter) pithy
stems, ranging from 27 to 96 mm long and
2 mm in diameter. From one to five cells
were separated by loose aggregations of
bits of organic debris, and were indistin-
guishable from those of N. elegans.

Two nests were complete when collect-
ed on 31 January 1999. One contained 5
cells, each with a typical tan-colored Nitela
cocoon. On 27 February a single chalcid
parasite (Eupelmophotismus pulcher) and
three N. australiensis females were found
to have emerged. One additional emerged
wasp escaped. The second completed nest
apparently consisted of two cells. Cell 1
contained a tan-colored Nitela cocoon 5.2
X 1.5 mm at the base of a short 27 mm
long burrow. When later checked this co-
coon was found to be moldy. One dead
female adult was found among the closure
debris which more or less filled the outer
20 mm of the burrow. It is likely that she
had recently emerged from a second cell
which had been destroyed in the process

Volume 9, Number 1, 2000

Figs. 9-11. Nitela australiensis Schulz: 9, Portion of nest showing two cocoons, a mature larva, M~\d prey
separated bv partitions of various lengths (scale marks are mm); 10, closeup of the 20 Aaroniella rawlingsi pre)
packed tightly in the cell; 11, cocoon, closeup, and the silk parchment-like inner lining on the partition at
right, plus bits ot the particles that separated the cells. Scale in 10 & 11 is the same, the cocoon is 4 mm long.

since there were Nitela cocoon fragments was found resting in the burrow. This

mixed among the closure particles. nest, in a burrow 74 mm long and 2 mm

The third nest (Fig. 9) collected on 4 in diameter, contained four completed

March 1999 was incomplete and a female cells and a fifth cell (Fig. 10) containing 20

DISCUSSION

46 Journal of Hymenoptera Research

moribund psocid nymphs packed tightly coarse sawdust particles, bits of charcoal,

together, one with an egg attached. The bits of a blackish resinous substance, and

egg was on one of the innermost prey af- small bits of frass. From this nest three fe-

fixed obliquely across the venter of the males and two males had been reared

prey's thorax. It measured 1.2 by 0.3 mm. (E.A. Sugden, personal communication).
Although laid on one of the first prey It appears that there are at least two

items, the egg had not yet hatched. How- generations per year in the Canberra area,

ever, the larva in the preceding cell was Evidence is circumstantial, based on the

already spinning, having consumed all the fact that progeny from the nest collected

prey. This suggests that new cells are not in late January emerged by late February,

provisioned until the larva in the previous whereas progeny of the nest collected in

cell is nearly full grown. early March had entered diapause.

Prey were all nymphs of Aaroniella raw-
lingsi Smithers (Philotarsidae), a bark
dwelling species. The delicate tan-colored The identity of the Nitela species men-
cocoons (Fig. 11) in cells 1-3 all contained tioned by Smithers (1990) remains un-
diapausing prepupae and were 4.0-4.5 known. Associated specimens were not
mm long. The mature spinning larva in found in the collection of the Australian
cell four was later found dead. Each com- Museum. However, except for a single fe-
pleted cell had a thin silk or parchment- male of Peripsocus milleri (Tillyard) (Per-
like inner closing partition to which pieces ipsocidae), the prey used by this species
of the particles separating the cells were were all nymphs belonging to the Elipso-
attached. These partitions appear to have cidae and Caeciliidae. Thus the Australian
been constructed by the mature larva dur- species of Nitela, like their congeners else-
ing the process of forming its cocoon. Such where in the world, specialize on Psocop-
a partition, which was always constructed tera (but see Zuijlen (1994) who notes a
in the base of the cell, may help the larva possible record for Zoraptera for N. bifida
to know the proper orientation for its co- Menke from Costa Rica), primarily those
coon. groups that live on the surface of bark,

Another nest, apparently belonging to with a strong preference for nymphs. Six
this species, was collected on 31 January families of psocids (Caeciliidae, Elipsoci-
1999. It had been usurped by another cav- dae, Peripsocidae, Philotarsidae, Pseudo-
ity-nesting wasp, Arpactophilus sp. (Sphe- caecilidae, and Psocidae) have now been
cidae: Pemphredoninae). The basal 33 mm recorded as prey of Australian Nitela.
of the burrow contained 4 cells with co- The provisioning data also suggest that
coons, from three of which emergence had parental investment by the female is rath-
taken place. The fourth cocoon, still intact, er extensive. Probably either progressive
was opened to reveal a clutch of 14 adult provisioning or delayed mass provision-
ceraphronid parasites (? Aphanogmus sp.), ing is normal in both species. At the very
probably hyperparasites of E. pulcher. Also least, the female appears to wait to begin
present in the nest debris was a single a new cell until the larva in the previous
dead N. australiensis female. cell is nearly full grown. Interestingly, the

In the Australian National Insect Collec- two parasitoids reared from these species

tion is a series of N. australiensis reared on were both found inside the cocoon. Be-

21 Feb. 1986 from a trap nest from Nadgee cause parental care apparently ceases by

Nature Reserve, New South Wales by E. the time the larva is full grown, perhaps

A. Sugden. This artificial burrow was 60 it is not surprising that the cocoon stage

mm long and had a bore diameter of 4.5 would be the most vulnerable to parasit-

mm. It contained six cells separated by ism.

Volume 9, Number 1, 2000

The only record of a nest of Nitela from
southern Africa concerns an undescribed
entirely black species, 4.6 mm in length
(Fred and Sarah Gess, unpublished). It
was constructed in a trap nest placed ver-
tically among dry inflorescence stems of
BerkJiei/n (Asteraceae) on a stream bank in
the Goegap Nature Reserve, Springbok,
Namaqualand in low karroid scrub. Col-
lected on 21 October 1987, the nest burrow
was 288 mm long and 6.5 mm diameter.
The nest burrow was closed at both ends,
with a crescent-shaped entrance at mid-
length. The nest had been in the field for
six days when collected, and was found to
have two completed cells provisioned
with unidentified Psocoptera and closed
with dry plant detritus and seeds. In nei-
ther cell were all the prey consumed be-
fore the larva spun a creamy-white cocoon
with dense brittle walls 0.06 mm thick and
rounded at both ends. A female later
emerged from a cocoon that was 5.2 mm
long and 2.0 mm diameter. The other co-
coon (not measured) produced a male.

ACKNOWLEDGEMENTS

I thank Dr. C. N. Smithers (Sydney Museum) for
identifying the Psocoptera prey, and Dr. Gary A. Gib-
son (Canadian National Collection, Ottawa, Canada)
for identifying the chalcid parasite. Dr. Ian D. Nau-
mann (CSIRO Entomology) provided valuable advice
and assisted in identifying the Nitela species and the
lAphanogmus sp. Fred and Sarah Gess kindly shar-
eded unpublished notes on a South African species
of Nitela, and their review of the manuscript greatly
improved it. Holotypes of Nitela species were kindlv

loaned from the British Museum of Natural History
(London) and the Museum fur Naturkunde, Hum-
boldt Universitat (Berlin) by Ms. Christine Thompson
and Dr. F. Koch, respectively. Eric Hines (CSIRO)
helped with the SEM photographs and the nest and
prey photos were taken by David McClenaghan (CSI-
RO). Financial support from the University of Geor-
gia and a McMaster Fellowship from CSIRO are
gratefully acknowledged.

LITERATURE CITED

Bohart, R. M. and A. S. Menke. 1976. Sphecid Wasps
of the World. A Generic Revision. University of Cal-
ifornia Press, Berkeley.

Boucek, Z. 1988. Australasia)! Chalcidoidea (Hymenop-
tera). A Biosystematic Revision of Genera of Fourteen
Families, with a Reclassification of Species. CAB In-
ternational, Wallingford.

Iwata, K. 1939. Habits of Rhinonitela domestica Wil-
liams, a minute book-louse hunter in Formosa.
Mushi 12: 13-16.

Janvier, H. 1962. Recherches sur les Hymenopteres
nidifiants aphidivores. Annates des Sciences Na-
turelles Zoologique (12) 4: 489-516.

Matthews, R. W. 2000. Nesting biology of the Austra-
lian stem-nesting wasp Psenulus interstitialis
Cameron (Hymenoptera: Crabronidae: Pemphre-
doninae) on Magnetic Island. Australian journal
of Entomology 39: 25-28.

Smithers, C.N. 1990. First record of Psocoptera as
prey of Australian Sphecidae (Hymenoptera).
Australian Entomological Magazine 17: 42.

Turner, R. E. 1916. Notes on fossorial Hymenoptera.
xxiii. On some Australian genera. Annals and
Magazine of Natural History (8) 18: 277-288.

Valkeila, E. 1955. Observations on the biology and
development of Nitela spinolae Dhlb. Annates En-
tomologica Fcnnici 21: 54-57.

Zuijlen, J. VV. A. van 1994. The amazonica species
group of the genus Nitela Latreille (Hymenop-
tera: Sphecidae: Crabroninae). Zoologisches
Meddelin Leiden 68: 249-269.

J. HYM. RES.
Vol. 9(1), 2000, pp. 48-52

New Synonyms in Central and South Asian Sphecidae

(Hymenoptera)

Vladimir L. Kazenas

Zoological Institute of MS-AS, Akademgorodok, Almaty, 480060, Kazakhstan;
e-mail: common@zool2.academ.alma-ata.su

Abstract. — A study of type material at the Natural History Museum, London, England, revealed
9 new synonyms for species described from Central Asia and former British India. These names
are: Ammophila bolanica Nurse, 1903 = Podalonia hirsuta mervensis (Radoszkowski, 1887); Cerceris
nursei Turner, 1912 = Cerceris antennata F. Morawitz, 1890; Cerceris supposita Kohl, 1916 =
Cerceris rothneyi Cameron, 1890; Cerceris compta Turner, 1912 = Cerceris turkestanica Radosz-
kowski, 1893 (= Cerceris rufonodis Radoszkowski, 1877); Cerceris barrei Radoszkowski, 1893 =
Cerceris tetradonta Cameron, 1890; Cerceris rhytichophora Turner, 1912 = Cerceris unidentata F.
Morawitz, 1890; Laphyragogus turanicus Gussakovskij, 1952 = Laphyragogus kohlii (Bingham,
1896) (described in Lianthrena); Palarus nursei Turner, 1911 = Palarusfunerarius F. Morawitz, 1890;
and Philanthus marikovskii Kazenas, 1977 = Philanthus elegantissimus Dalla Torre, 1897 (= Phi-
lanthus elegans F. Smith, 1873). Lectotypes are designated for Ammophila bolanica, Cerceris comp-
ta, Cerceris nursei, Cerceris rhytichophora, Laphyragogus kohlii, Laphyragogus turanicus, and
Palarus nursei.

One major problem facing students of
Central Asian insects is their relation to
the biotas of Pakistan and northwestern
India. For a variety of reasons, Russian au-
thors who studied the sphecid fauna of
Central Asia over the last 140 years (Ev-
ersmann, Radoszkowski, F. Morawitz,
Shestakov, Gussakovskij, Marshakov, my-
self and others) have not considered the
species described from former British In-
dia (now India and Pakistan) by Cameron,
Bingham, Nurse, F. Smith, and Turner.
These latter authors, conversely, showed
little interest in the work of Russian au-
thors. The two areas, however, are not
only adjacent geographically, but they
closely resemble each other in their habitat
types and ecological conditions (ranging
from lowland hot deserts to high moun-
tains with glaciers). With hundreds of spe-
cies described on each side, it is inevitable
that the ratio of synonyms may be high. A
number of synonyms in Sphecidae were
established by Pulawski (1975, 1979, 1995),

Marshakov (1977), Budrys (unpublished),
and Antropov (unpublished).

For more than 25 years I have been
studying sphecid wasps of Kazakhstan
and adjacent republics of Central Asia. I
previously studied almost all the types of
the species described by earlier Russian
authors during my many visits to the Zoo-
logical Institute of Russian Academy of
Sciences in St. Petersburg, and to the Zoo-
logical Museum of Moscow State Univer-
sity (Moscow, Russia). It was therefore im-
portant to compare these types with types
of the species described by British authors.

The Museum of Comparative Zoology
at the Harvard University (Cambridge,
Massachusetts, U.S.A.) awarded me an
Ernst Mayr grant for the travel to the Nat-
ural History Museum in London and to
the University Museum of Natural Histo-
ry in Oxford to study these types. I
worked there for 6 weeks in August and
September 1997. I have studied nearly 200
types and found nine new synonyms.

Volume 9, Number 1, 2000

The following abbreviations are used in Cerceris supposita Kohl, 1916:122, 6. Syntypes:
the text to designate institutions where the Turkmenistan: Serakhs (KRAK6W, exam-

type material is housed: ined). New synonym.

KRAKOW: Instytut Systematyki i Ewol-
ucji Zwierzat, Polska Akade-
mia Nauk, Krakow, Poland.

NHML: The Natural History Museum,
London, Great Britain.

OXUM: University Museum of Natu-
ral History, Oxford Universi-
ty, Great Britain.

ZIN: Zoological Institute, Russian

Academy of Sciences, St. Pe-
tersburg, Russia.

ZMMU: Zoological Museum, Moscow
State University, Moscow,
Russia.

LIST OF SPECIES

(arranged alphabetically by their valid

names)

Cerceris antennata F. Morawitz

Cerceris antennata F. Morawitz, 1890:598, 6. Ho-
lotype: 6, Turkmenistan: Kiiren-Dagh (ZIN,
examined).

Cerceris nursei Turner, 1912:512, 9, 6. Lecto-
type: 6, Pakistan: Quetta (NHML, exam-
ined), present designation, in order to ensure
that the name is properly and consistently
applied. New synonym.

The lectotype of C. nursei bears the fol-
lowing labels: 1. Quetta 5.03, 2. Cerceris
nursei Turn., type 6, and 3. Nurse Coll.:
1915-34.

This species belongs to the specularis
group. It differs from closely related spe-
cies by the markedly concave clypeus, un-
usually short pygidial plate, and presence
of flat brushes of dense setae in postero-
lateral corners of male sternum VI (Kazen-
as 1984:201-203).

Cerceris rothneyi Cameron

Cerceris rothneyi Cameron, 1890:251, 9 (as Roth-
neyi, incorrect original capitalization). Lecto-
type: 9, India: West Bengal: Barrackpore
(OXUM), designated bv Empev, 1984:7^ (Ar-
ticle 74.6).

The lectotype of Cerceris rothneyi should
be in Oxford (Empey, 1984), but I was un-
able to locate it. However, 3 specimens (2
9, 1 6) in NHML agree with the original
description. The first specimen has the fol-
lowing labels: 1. N. Kanara, and 2. Cerceris
rothneyi Cam.; the second one: 1. N. Ka-
nara, and 2. Bombay Presidency, pres. by
E. Comber 1910-255; the third one: 1. T.R.
Bell, Karachi, 2. Cerceris rothneyi Cam. 6\
and 3. 1911-276.

I consider these specimens to be con-
specific with C. supposita Kohl, a member
of the bupresticida group. It differs from all
closely related species by the combination
of the clypeal structure in the female, form
of the vertical lamella on female sternum
V, sculpture of propodeal enclosure, color,
and other features (Kazenas 1984:79-81).
In particular, the clypeal free margin of
the female has 4 teeth; the vertical lamella
of sternum V has a roundly prominent
margin; the propodeal enclosure is fullv
unsculprured, shiny; the female pygidial
plate is not narrowing posterad; male ter-
gum VI and sternum VI each has a pos-
terolateral tooth. Also, tergum I is partly
red (also tergum II in some specimens),
whereas female tergum IV has an uninter-
rupted pale yellow fascia apically.

Cerceris tetradonta Cameron

Cerceris tetradonta Cameron, 1890:261, 9, 6.
Syntypes: N. India: Poona (depository un-
known).

Cerceris barrel Radoszkowski, 1893:68, 9, 6".
Syntypes: Turkmenistan: Serax (KRAKOW,
not examined). New synonym.

There are six specimens of C. tetradonta
Cameron in NHML; one of them was col-
lected in Pakistan (Karachi), three came
from India (Abu, Deesa, and Khandala),
and two from Sri Lanka. They are conspe-
cific with specimens of Cerceris barrel Ra-
doszkowski from Turkmenistan in Zl\

Journal of Hymenoptera Research

determined by Gussakovskij and Shesta-
kov. C. tetradonta belongs to the albofascinta
group and closely resembles C. albofascinta
Rossi, but differs by the form of the clyp-
eal free margin in the female and details
of the body sculpture and color (Kazenas
1984:185-186). In particular, the clypeal
free margin is conspicuously dentate, the
mesopleuron and propodeal side have
yellow spots, and the gastral sterna large-
ly and the legs are yellow.

Cerceris turkestanica Radoszkowski

Cerceris rufonodis Radoszkowski, 1877:56, 9,6.
Syntypes: Uzbekistan: Djisak, Tashkent; and
Kyrghyzstan: Osh in Fergana Valley
(ZMMU, examined). Preoccupied by Cerceris
rufinodis F. Smith, 1856 (Article 58.12, use of
different connecting vowel).

Cerceris turkestanica Radoszkowski, 1893:66. Re-
placement name for Cerceris rufonodis Ra-
doszkowski, 1877 (proposed to replace Cer-
ceris rufinoda Cresson, 1865).

Cerceris compta Turner, 1912:803, 9 . Lectotype
9: Pakistan: Karachi (NHML, examined),
present designation, in order to ensure that
the name is properly and consistently ap-
plied. New synonym.

The lectotype female in NHML has the
following labels: 1. Type, 2. E. Comber,
Karachi, Oct. 09, 3. Cerceris compta Turn.
Type, 4. Bombay Presidency, pres. by E.
Comber 1910-255, and 5. B.M. Type Hym.
21.1, 362.

The type of C. compta is identical with
C. turkestanica. This species, a member of
the rybyensis group, is characterized by the
form of the female clypeus whose free
margin is slightly sinuous on each side of
the small, median incision. Also, sternum
II has a prominent basal plate, the pro-
podeal enclosure is almost entirely
smooth, and the gastral color pattern is
distinctive (see Kazenas, 1984:35); gastral
segment I may be red or black. The pro-
podeal side has a large yellow spot, and
the legs are yellow except the femora are
black ventrally.

Cerceris unidentata F. Morawitz

Cerceris unidentata F. Morawitz, 1890:601, 9.
Holotype: 9, Turkmenistan: Kopet-Dagh
near Chuli (ZIN, examined).

Cerceris rhynchophora Turner, 1912:510, 9, 8.
Lectotype: 9, Pakistan: Quetta (NHML, ex-
amined), present designation, in order to en-
sure that the name is properly and consis-
tently applied. New synonym.

The lectotype female of C. rhynchophora
in NHML has the following labels: 1. Type
H.T., 2. Quetta 5.03, 3. Cerceris rhynchopho-
ra Turn., Type, 4. 9, and 5. B.M. Type
Hym. 21.1.426.

The specimens of C. unidentata F. Mor-
awitz from Turkmenistan in ZIN are con-
specific with the lectotype female of C.
rhynchophora Turner. The species differs
from other Cerceris by the following: pro-
podeal enclosure closely punctate and
with fine, transverse ridges; jugal lobe of
hindwing 7-9 times shorter than anal cell;
middle clypeal lobe in female with char-
acteristic, overhanging, roof-like projec-
tion, in male with narrow, longitudinal ca-
rina and tridentate free margin (see Ka-
zenas, 1984:178-180).

Laphyragogns kohlii (Bingham)

Lianthrena kohlii Bingham, 1896:213, 9,8. Lec-
totype 8: "N. India", may be Pakistan: Pun-
jab: no specific locality (NHML, examined),
present designation, in order to ensure that
the name is properly and consistently ap-
plied.

Laphyragogus turanicus Gussakovskij, 1952:227.
Lectotype: 9, Tajikistan: Ayvadj at Kafirni-
gan River (ZIN, examined), present desig-
nation, in order to ensure that the name is
properly and consistently applied. New syn-
onym.

There are 3 specimens in NHML. Of
them, 1 9 and 1 8 were collected in Deesa
and 1 o* (lectotype) is simply labeled
North India. The last specimen has the fol-
lowing labels: 1. Type, 2. N. Ind., 3. Lian-
threna kohlii Bingh. 9 Type, and 4.
B.M.Type 21.88. It is actually a male.

De Beaumont (1959) and Gussakovskij

; IttlNUUfH

Volume 9, Number 1, 2000

(1952) discussed color differences between
kolilii and turanicus. The specimens I stud-
ied do not differ morphologically and are
very similar in color, so I consider them
conspecific. The species differs from its
congeners by the form of the first meta-
tarsal article in the female and the struc-
ture of the flagellum and sternum VII in
the male (Gussakovskij 1952).

Palarns funerarius F. Morawitz

Palarus funerarius F. Morawitz, 1890:136, 9. Ho-
lotype: 9, Mongolia: Zagan-Buryuk (ZIN,
examined).

Palarus nursei Turner, 1911:481, 9, 6. Lecto-
type: 6: Pakistan: Quetta (NHML, exam-
ined), present designation, in order to ensure
that the name is properly and consistently
applied. New synonym.

There are 3 specimens (2 9 , 1 8 ) of P.
nursei in NHML. The lectotype male has
the following labels: 1. Type H.T., 2. Quet-
ta 6.03, 3. 6,4. Palarus nursei Turner Type,

5. Col. C.G. Nurse Collection 1920-72, and

6. B.M. Type Hym. 21.77.

The specimens of P. nursei from Quetta,
Pakistan and of P. funerarius from many
localities in Central Asia are very close
morphologically and to my mind conspe-
cific. The differences in color are not con-
spicuous. P. funerarius is similar to P. bi-
signatus F. Morawitz, but differs in color
and in structure of the male flagellum (F.
Morawitz 1890b:136-139). Also, male ster-
num I of P. funerarius has a pair of tuber-
cles (none in P. bisignatus) and the apical
prominence of sternum II has 2 transverse
carinae (one in P. bisignatus, evanescent in
some specimens). The gaster of P. funer-
arius has no red, and femora have a large
black spot each.

Philanthus elegantissimus Dalla Torre

Philanthus elegans F. Smith, 1873:415, 9. Holo-
type or syntypes: "N. India", may be Paki-
stan: no specific locality (depository un-
known). Preoccupied by Philanthus elegans F.
Smith, 1856, now in Trachypus.

Philanthus elegantissimus Dalla Torre, 1897:485.

Replacement name for Philanthus elegans F.
Smith, 1873.
Philanthus marikovskii Kazenas, 1978:662, 9,6.
Holotype 9: Kazakhstan: 15 km E Ayak-Kal-
kan (ZIN, examined). New synonym.

I was unable to locate the original spec-
imens of F. Smith either in London or in
Oxford, but 3 specimens in NHML (2 9
and 1 6) from Deesa probably collected
by C.G. Nurse agree with the original de-
scription. I consider them to be conspecific
with Philanthus marikovskii. The species is
morphologically close to Ph. venustus
(Rossi) and Ph. rubriventris Kazenas, but
differs in having extensive pale yellow
coloration (Kazenas 1978: 662-664).

Podalonia hirsidta mervensis
(Radoszkowski)

Ammophila mervensis Radoszkowski, 1887:89, 9,
6. Syntypes: Turkmenistan: Samsaul; Cau-
casus; and Corsica (KRAKOW, not exam-
ined).

Ammophila bolanica Nurse, 1903:8, 9. Lectotype:
9, Pakistan: Quetta (NHML, examined), pre-
sent designation, in order to ensure that the
name is properly and consistently applied.
New synonym.

There are 3 9 of A. bolanica from Quetta
in NHML. The lectotype has 6 labels: 1.
Type, 2. Quetta, 3. 9, 4. Type, 5. Coll. C.G.
Nurse Collection 1920-72, and 6. B.M.
Type Hym. 21730.

These specimens are conspecific with
specimens of A. mervensis (Radoszkowski)
from Transcaspia in ZIN and ZMMU.
R.M. Bohart and A.S. Menke (1976) con-
sider A. mervensis to be a subspecies of Po-
dalonia hirsuta (Scopoli). It differs from the
nominotypical subspecies in having an all
black gaster.

ACKNOWLEDGMENTS

For thf support of mv work I thank Wojciech J.
Pulawski (California Academy of Sciences, San Fran-
cisco, California), Christopher O'Toole (University
Museum of Natural History, Oxford), the staff of the
Fintomology Department o\ the \atural History Mu-
seum, London, and the Ernst Mayr Grants Committee
(Museum of Comparative Zoology, Harvard Univer-

Journal of Hymenoptera Research

sity, Cambridge, Massachusetts). I also thank Arnold
S. Menke for his valuable comments on the manu-
script.

LITERATURE CITED

Beaumont, J. de. 1959. Le genre Laphyragogus Kohl
(Hym. Sphecid.). Revue Suisse de Zoologie 66, 4:
723-734.

Bingham, C. T. 1896. On some exotic fossorial Hy-
menoptera in the collection of the British Muse-
um with descriptions of new species and of a
new genus of the Pompilidae. The Journal of the
Linnean Society. Zoology 25: 422-445, pi. XIX.

Bohart, R. M., and A. S. Menke. 1976. Sphecid Wasps
of the World. A generic revision. University of Cal-
ifornia Press, Berkeley, Los Angeles, London. 1
color plate, IX + 695 pp.

Cameron, P. 1890. Hymenoptera Orientalis, or con-
tributions to a knowledge of the Hymenoptera of
the Oriental Zoological Region. Part. II Memoirs
and Proceedings of the Manchester Literary & Phil-
osophical Society 4, 3: 239-284, pi. IX-X.

Dalla Torre, K. W. von, 1897. Catalogus Hymenoptero-
nun hucusque descriptorum systematicus et synon-
ymicus. Vol. VIII: Fossores (Sphegidae). Lipsiae:
Guilelmi Engelmann. 749 pp.

Empey, H. N. 1984. Notes on the Cerceris types of
Cameron from the Oriental Region (Hymenop-
tera: Sphecidae: Philanthinae). journal of the En-
tomological Society of Southern Africa 47: 75-82.

Gussakovskij, V. V. 1952. Novye i maloizvestnye vidy
Psammocharidae i Sphecidae (Hymenoptera) za-
padnogo Tadzhikistana. Trudy Zoologicheskogo
Instituta Akademii Nauk SSSR^ 10: 199-288. (In
Russian)

Kazenas, V. L. 1978. Novye vidy royushych os (Hy-
menoptera, Sphecidae) iz yugo-vostochnogo Ka-
zachstana. Entomologicheskoye Obozrenie 57, 3:
661-665. (In Russian)

Kazenas, V. L. 1984. Royushyie osy Cercerisy Sredney
Azii i Kazakhstana. Alma-Ata: Nauka Kaz. SSR.
232 pp. (In Russian)

Kohl, F. F. 1916 (1915). Beitrag zur Kenntnis der Gat-
tung Cerceris auf Grundlage der O. Radoszkov-
skyschen Sammlung. Archiv fin Naturgeschichte,
Abteilung A 88, 7: 107-125.

Marshakov, V. G. 1977. Obzor ruyushehikh os triby
Crabronini (Hymenoptera, Sphecidae) fauny
SSSR. Rod Cnibro I abricius, 1775. Entomologiches
koe Obozreniye 56: 854-872. (In Russian)

Morawitz, F. 1889. Insecta, a cl. G. N. Potanin in Chi-
na d in Mongolia novissime lecta. IV. I [ymenop-

tera Aculeata. Horae Societatis Entomologicae Ros-
sicac 23: 112-168.

Morawitz, F. 1890. Hymenoptera fossoria transcas-
pica nova. Horae Societatis Entomologicae Rossicae
24: 570-645.

Nurse, C. G. 1903a. New species of Indian Aculeate
Hymenoptera. Annals and Magazi>ie of Natural
History (Series 7) 11: 511-526.

Nurse, C. G. 1903b. New species of Indian Hymenop-
tera. The journal of the Bombay Natural History So-
ciety 15: 1-18.

Pulawski, W. J. 1975 (1974). Synonymical notes on
Larrinae and Astatinae (Hymenoptera: Spheci-
dae). journal of the Washington Academy of Sciences
64: 308-323.

Pulawski, W. J. 1979. A revision of the World Proso-
pigastra Costa (Hymenoptera, Sphecidae). Polskie
Pismo Entomologiczne 49: 3-134.

Pulawski, W. ]. 1995. The wasp genus Gastrosericus
Spinola, 1839 (Hymenoptera: Sphecidae). Mem-
oirs of the California Academy of Sciences 18: 1-174.

Radoszkowski, O 1877. Sphegidae. In: Voyage au
Turkestan d'A. P. Fedchenko, fasc. 14, tome 2,
partie 5. Izvestiya Imperatorskogo Obshchcstva Lyu-
biteley Estestvoznaniya, Antropologii i Etnografii pri
Imperatorskom Moskovskom Universitete 26: 1-87,
pl. I-VIII. (In Russian)

Radoszkowski, O. 1887. Faune Hymenopterologique
Transcaspienne (suite). Horae Societatis Entomolo-
gicae Rossicae 21: 88-101, pl. IV-V.

Radoszkowski, O 1893. Faune hymenopterologique
Transcaspienne. Supplement. Horae Societatis En-
tomologicae Rossicae 27: 38-81,490-493. pl. IV-V.

Smith, F. 1856. Catalogue of hymenopterous insects in the
collection of the British Museum. Part IV. Sphegidae.
Larridac, and Crabronidae. London, p. 207-497, pl.
DC-XL

Smith, F. 1873. Descriptions of new species of fosso-
rial Hymenoptera in the collection of the British
Museum and of a species of the rare genus Iswara
belonging to the family Dorylidae. Annals and
Magazine of Natural History (Series 4) 12: 49-59,
99-108, 253-260, 291-300, 402-415.

Turner, R. E. 1911. Notes on fossorial Hymenoptera.
IV. Remarks on the Genus Palarus. Annals and
Magazine of Natural History (Series S) 7: 479-485.

Turner, R. E. 1912a. A monograph of the wasps of the
genus Cerceris inhabiting British India. With
Notes on other Asiatic Species. The journal of the
Bombay Natural History Society 21, 2: 476-516;
21,3: 794-819.

Turner, R. E. 1912b. Notes on Fossorial Hymenop-
tera.— X. On new species from the Oriental and
Ethiopian Regions. Annals and Magazine of Natu
ral History (Series S) 10: 361-377.

J. HYM. RES.
Vol. 9(1), 2000, pp. 53-61

The Biology of Thrincohalictus prognathus (Perez)
(Hymenoptera: Halictidae: Halictini)

Laurence Packer

Department of Biology, York University, 4700 Keele St., Toronto, ON, M3J 1P3, Canada;

E-mail: bugsrus@yorku.ca

Abstract. — The Halictine bee Thrincohalictus prognathus (Perez) was studied in Israel in May and
the beginning of June, 1998. Additional information was obtained from museum specimens. The
species appears to be both common and widespread in northern Israel, particularly in the Galilee
and Golan Heights where it occurs between altitudes of several hundred metres up to 1650m on
Mount Hermon. Despite having an unusually elongate head, the species visits a wide range of
flowers which generally do not possess a long corolla. Like most temperate halictines, only mated
females overwinter and become active in the spring, as early as mid March. Males are found no
earlier than mid May. The apparent age of females increases from March to May with newly
eclosed, unworn individuals appearing in late May /early June. All worn early summer individ-
uals were mated and had well developed ovaries. Thus, ovarian development and phenological
data are inconsistent with the species being eusocial but are consistent with it being univoltine.
The behaviour exhibited by paired females in artificial observation arenas indicates that T. prog-
nathus possesses the repertoire of agonistic and cooperative behaviours usually found in halictines
but that aggressive interactions predominate. Comparisons with other species indicate that the
relative frequency of passing behaviour is very low and inconsistent with that expected for a
communal species. I conclude that this species is probably solitary.

Phylogenetic methods are useful not
only in determining polarity of evolution-
ary changes among character states, but
also for predicting which species are par-
ticularly deserving of study (Packer 1997).
Based upon phylogenetic data, the mono-
typic genus Thrincohalictus is thought to
be particularly worthy of study because it
appears to be the sister taxon to the well
studied and behaviourally diverse genus
Halictus (Eickwort et al. 1996; Packer 1997;
Danforth et al. 1999). Thus, this species is
particularly important for assessing the
pattern of evolution of social behaviour in
the bee tribe Halictini.

Thrincohalictus prognathus (Perez) is a
relatively large, non-metallic halictine
with apical bands of tomentum on the ab-
dominal terga and, as the specific epithet
suggests, a long face. It is known, from
comparatively few specimens, to occur in

Turkey and northern Israel (Bluethgen
1955; Ebmer personal communication) at
least as far south as Jerusalem where one
male specimen is known from Mt. Scopus.
In May and June 1998 I studied this spe-
cies in Israel. Although detailed sociobio-
logical analysis requires observation over
several months (if not years, Yanega 1988;
Sakagami and Packer 1994), some sugges-
tive information can be obtained from
samples of dissected bees (Dunn et al.
1999). Additionally, behaviours of bees
caught from flowers but forced to interact
in artificial arenas (circle tubes) may also
be suggestive of social or solitary behav-
ioural ancestry (McConnell-Garner and
Kukuk 1997; Wcislo 1997; Paxton et al.
1999; Packer, unpublished observations).
In this paper I present data on i) the dis-
tribution of T. prognathus in Israel, ii) a list
of the flowers that it visits, iii) data from

Journal of Hymenoptera Research

dissected and /or measured bees from all
available samples and iv) the results of cir-
cle tube experiments. The last two sets of
data are potentially useful in elucidating
the type of social organisation T. progna-
tlius might possess.

METHODS

Sampling and phenological assessment. —
Most females of T. prognathus were col-
lected with a hand net from flowers al-
though some of the pinned specimens in-
cluded in some analyses were swept from
vegetation. Most males were collected
while they flew rapidly over bushes or
around small trees, presumably in search
of females. Some females were pinned but
most were preserved in buffered formalin
(Pabalan 1998) for subsequent dissection,
one was preserved in ethanol for DNA se-
quencing (Danforth et al. 1999). At two lo-
calities, a parking lot and adjacent road-
side near a garbage dump near Hazor,
and at the peak of Mount Meiron, both in
the Upper Galilee, large numbers of fe-
males were observed, not all of them were
collected. All males were pinned. Flower
visitation data were obtained from field
samples and, when given, also from
pinned specimens.

Bees preserved in formalin were dis-
sected to establish their degree of ovarian
development and whether or not they had
mated. The fraction of a fully developed
oocyte found upon microscopic examina-
tion of each of the six ovarioles was esti-
mated by eye. Whether the terminal oo-
cyte was developing or being resorbed
was noted. Resorbing oocytes have a
fuzzy outline and are often misshapen
(Goukon et al. 1988; Pabalan 1998). The
spermathecae of inseminated females are
opaque whereas those of unmated females
are clear and appear like glass bowls.

Head widths of all females (museum
specimens and those collected by the au-
thor) were measured to ascertain whether
there was any seasonal size variation sim-
ilar to that found in eusocial species in

which summer workers are generally
smaller than spring gynes (Breed 1975;
Packer and Knerer 1985). The number of
nicks in one forewing margin was counted
to estimate the relative age of specimens.
The largest number of nicks counted was
24, consequently, bees with the entire mar-
gin slightly eroded were coded as 25 and
those with more extensive abrasion coded
as 30. Although in reality wing wear mea-
sures comparative levels of activity which
will not always be directly related to age,
it is of some utility. For example, com-
pletely unworn individuals will either
have recently eclosed or be overwintered
females at the early stages of nest initia-
tion and heavily worn individuals will
have been active foragers probably for
several weeks or more.

Behavioural data. — Despite several days
searching in one locality where the species
was particularly common (in the vicinity
of Hazor in the Upper Galilee), no nest
sites were discovered. Behavioural obser-
vations were made upon pairs of bees in-
teracting in a "circle tube" — a 20cm long
piece of clear plastic with the ends joined
together such that moving bees are forced
to repeatedly interact with one another
(Breed et al. 1978).

Methods generally followed those of
earlier authors (Breed et al. 1978; Mc-
Connell-Garner and Kukuk 1997; Wcislo
1997b; Paxton et al. 1999; Pabalan et al.
submitted) with the exception that bees
were placed into circle tubes within ten
minutes of capture. This was because it
has been discovered that, for some halic-
tines at least, ovarian resorption begins
within 30 minutes of captivity (Pabalan
1998 and unpublished observations on La-
sio^lossum zephyrum), suggesting physio-
logical changes are occurring which may
be mirrored by altered behavioural inter-
actions among females.

The range of behaviours noted within
circle tubes were similar to those often
found in other studies (see references
above). Bees would sometimes nudge or

■ Iffllmt

Volume 9, Number 1, 2000

Table 1. List of flower records for Thrincohalictus prognathus.

Locality

# bees

Females
Mt. Hermon
Neve Ativ

Qirvat Shemona
Ein Fit

Hazor

El Rom
Mt. Meiron

Males

Katzrin

Snir

Ramot Naftali

1
dozens
dozens

3
dozens

1
1
1

Xcpcta cilicica Labiatae
Lonicera sp. Caprifoliaceae
Phlomis chrisophyla Labiatae
Cerasu> prostrata Rosaceac
Papaver Papaveraceae
Papaver Papaveraceae
Onopordum blanche
Certtaurea iberica Asteraceae
Phlomis viscosa Labiatae
Papaver Papaveraceae
Silybum marianum Asteraceae

Echinops Asteraceae

Vitex anguscastus Verbenaceae

Ballota saxatilis Labiatae

lunge at one another, back away from one
another either with or without reversing
or pass one another, venter to venter, a
manoeuvre requiring coordination be-
tween individuals. A more aggressive be-
haviour, the C-posture was also observed.
In this stance an individual bends its ab-
domen forward, beneath the thorax in an
apparent attempt at stinging the individ-
ual in front of it. It has also been suggest-
ed that secretions from the Dufours gland
may be released during this posture
(Smith and Weller 1989). The occurrence
of these behaviours was recorded contin-
uously for 20 (one pair) or 30 (the remain-
ing four pairs) minutes.

RESULTS

Flower records. — Table 1 shows the flow-
er record data for those specimens for
which this information was recorded. As
can be seen, most of the flowers do not
need a long tongue or face for their nectar
to be accessible to the bees. However, a
few individuals have been collected from
long corolla flowers such as the labiate Ne-
peta cilicica and for none of the observa-
tions was it definitively recorded whether
the bees were collecting pollen or nectar.

Distribution. — Localities where T. prog-

nathus was found and also those for which
museum records are available are shown
in Figure 1. The species appears to be
common in northern Israel, particularly in
the Upper Galilee and Golan Heights
where it occurs at a wide varietv of alti-
tudes, from just a few hundred metres
above sea level as at Katzrin to over
1,000m at the summit of Mt. Meiron. It has
also been collected at 1650m on Mt. Her-
mon. There is a single male from Jerusa-
lem, collected in the 1940's.

Phenology and dissection data. — Figures 2
and 3 plot head width and wing wear
against date of capture for all females
available for study. The data are consis-
tent with overwintered females becoming
active in March, becoming increasingly
worn as they forage through to mid May
and with the first individuals of the next
generation flying from mid May until June
for mating and pre-diapause feeding.
Midseason females (worn individuals col-
lected in May) are not smaller than those
found earlier in the year (mean head
width early bees = 2.31mm, SD = 0.05, n
= 18; midseason bees = 2.33mm, SD =
0.06, n = 37; t = 1.80, p > 0.05). In fact, in
this instance the direction of the size dif-
ference is in the opposite direction to that

Journal of Hymenoptera Research

Fig. 1. Map of Israel showing location of sites where
T. prognathic has been collected. H refers to Hazor
and M to Mount Meiron, the two localities where
most of the data dealt with in the text were obtained.

expected if midseason bees were workers
and early season ones gynes. Similarly,
worn late females are no smaller than the
unworn pre-overwintering females
(Mann-Whitney U test, U = 87, t = 0.39,
p > 0.5); a size difference would be ex-
pected if the worn bees were workers and
the unworn ones overwintering future
foundresses. Thus, there is no size varia-
tion suggestive of the caste differences
found in annual eusocial species.

A total of 20 bees from Hazor collected
between May 7"' and 10"1 (an additional 10
were pinned) and 17 from Mt. Meiron col-
lected on June 2nd (an additional 8 were
pinned) were dissected. All Hazor bees
were well worn with an average wing

wear of 10.2 (SD = 4.5, n = 30). All form-
aldehyde preserved bees were mated and
had well developed ovaries and 15 of
them (75%) had a chorionated oocyte and
at least one more ovariole with either a
healthy oocyte developing or a sizeable re-
sorbing oocyte. The remaining five bees
each contained at least one oocyte three
quarters the size of a fully developed one.
The average size of the 20 dissected bees
was 2.33mm (SD = 0.07) these results
change almost imperceptibly when
pinned specimens are added to the sam-
ple, mean size = 2.32 mm (SD = 0.06, n
= 30). No T. prognathus were found at Ha-
zor between May 28th and 30th, almost no
flowers remained in bloom at this time.
These data are consistent with the May
Hazor samples being composed of forag-
ing bees which had been active for at least
several weeks and which were reproduc-
tive individuals. That no males were
found suggests that the sample dates pre-
ceded the emergence of the next genera-
tion.

In contrast, the sample from Mt. Meiron
at the beginning of June contained mostly
unworn bees (22/25 or 88%) or bees with
a total index of wear of one (2/25). Only
one bee was well worn and it had 24 nicks
in the wing margin. All bees in this sam-
ple were mated and all but the heavily
worn individual had no ovarian develop-
ment, large amounts of fat in their abdo-
mens and a crop full of nectar. The excep-
tion had two % developed oocytes that
were resorbing, its abdomen contained no
obvious large fat deposits and its crop was
empty. The average size of the Mt. Meiron
sample is identical to that of the one from
Hazor (mean size = 2.33mm, SD = 0.06,
n = 25). These data are consistent with the
sampling period having occurred during
the emergence phase of the offspring gen-
eration with only one individual of the pa-
rental generation captured.

None of the bees dissected showed any
evidence of oophagy; they did not contain
pasty-white material in their guts.

1 PhVre...

Volume 9, Number 1, 2000

E
S

.c
■g

T3
TO
0)

z.z> -

2.45-

2.4 -

□

□ m

000

2 35 -

oooo

i mi i

000

ODD

□

2 3 -

OOODOO

□

inn i

OLD

00O

2.25 -

o o

□

ODD

2.2 -

□

2.15 -

□

2.1 -

2 05 -

15-Mar 25-Mar 4-Apr 14-Apr 24-Apr 4-May 14-May 24-May 3-Jun 13-Jun 23-Jun

Date

O unworn Dworn
Fig. 2. Head width against collection date for all females, circles represent unworn bees, squares worn ones.

30 n

04-0-
15-Mar

COO

00
000
00

000

oooo

000

30-Mar

14-Apr

29-Apr

Date

14-May

29-May

13-Jun

Fig. 3. Wing wear against collection date for all females.

Journal of Hymenoptera Research

Table 2. Comparison of the frequencies of passing and agonistic interactions among paired individuals of
various halictine species. Pass/FE is the frequency of successful passes per frontal encounter, A/FE is the
frequency of aggressive interaction per frontal encounter.

raxon

pss/FE

A/FE

Reference

Eusocial Species

L. zephyrum queens
L. zephyrum foragers
L. zephyrum guards

0.57
0.21
0.00

1.28
0.56
0.61

Breed et al. 1978
Breed et al. 1978
Breed et al. 1978

Communal Species

L. hemichalceum

0.81

0.02

Kukuk 1992

Solitary Species

L. figueresi

0.14

0.41

Wcislo 1997b

L. platycephalum
L. (Ctenonomia) sp.

0.30
0.33

0.1 1
0.22

McConnell-Garner
and Kukuk 1997

Species With Unknown Behaviour

r. prognathus

0.03

0.29

this paper

Bees collected and pinned from other
samples also have the same size profile as
those from samples discussed above, 34
bees from a variety of localities had an av-
erage head width of 2.32mm (SD = 0.06).

The first male was found at Ramot Naf-
tali on May 12th, 7 more were found there
on June lsl and one was collected at Mt.
Meiron on June 2nd. All of these males
were comparatively unworn. Few other
records are available, but it seems that the
first Ramot Naftali specimen is the earliest
record and that males may be found until
early July (Bluethgen 1955).

Behavioural observations. — A total of 218
encounters between paired bees in five cir-
cle tube experiments were observed. Thir-
ty-four of these were C postures, 28 were
nudges or lunges and 2 were pushes. Few-
er cooperative behaviours were observed:
7 examples of back and follow and 6 suc-
cessful passes, most of which were pre-
ceded by pass attempts; a total of 7 en-
counters resulted in pass attempts which
failed and led to one or both of the bees
backing off. Thus, 29.4% of all interactions
were classified as antagonistic (varying
between 10 and 35% among the pairs) and
only 3% were passes (varying between 0
and 7%). The remainder involved one or

both bees turning away and may thus be
considered as avoidance behaviours. The
relative frequency of agonistic and coop-
erative behaviours did not vary much
among the pairs, with the former always
exceeding the latter.

Comparisons of successful passes and
aggressive acts per encounter are shown
in table 2 for those halictines for which
such data are available. The behaviour of
T. prognathus shows the lowest rate of
passing (except for guard:guard pairs in L.
zephyrum) and a level of aggressive inter-
action that falls within the range for soli-
tary species and outside that for either
communal or eusocial taxa.

DISCUSSION

Thrincohalictus prognathus has been con-
sidered to be a rare species likely to have
a preference for flowers with a long co-
rolla. However, observations in northern
Israel confirm that it is widespread (Figure
1) and often common and that it does not
have a preference for long tubular flowers
(Table 1 ).

In solitary and communal halictine bees,
all individuals in a sample collected from
flowers may be expected to be of similar
age (except during a period of overlap of

Volume 9, Number 1, 2000

generations) and show similar evidence of
reproductive activity. Early season sam-
ples should be of mostly unworn bees
with average wear increasing monotoni-
cally until late in the season when the
young offspring generation individuals fly
to mate and to forage to fill their crops
with nectar. At this time, bimodalitv in
wear may be expected if some of the pa-
rental generation individuals have sur-
vived and are active. In samples of a eu-
social species, early samples may be ex-
pected to show evidence of reproduction
and comparatively little heavy wear, mid-
season samples should show varying pro-
portions of reproductively inactive indi-
viduals and a wide range of indices of
wear and the latest samples should com-
prise mostly unworn pre-diapause fe-
males and some heavily worn ageing
workers. Additionally, bees in samples of
eusocial species taken in mid season
should average smaller than those collect-
ed in spring as workers are usually small-
er than nest foundresses (Breed 1975) (al-
though the size difference varies from re-
quiring large sample sizes to achieve sta-
tistical significance (Eickwort 1985) to
being non-overlapping such that individ-
uals can be classified as queens or workers
on size alone (Knerer 1992)).

The samples of T. prognathus show no
evidence of eusociality. The earliest spec-
imen found was collected in mid March.
Most samples are from early May and
bees at this time are well worn but show
substantial and largely equivalent levels
of reproductive development. No unmat-
ed or ovarially undeveloped individuals
have been detected at this time, which, be-
ing just prior to the apparent emergence
of the overwintering brood, should have
consisted entirely, or almost entirely, of
workers if the species were eusocial. Al-
though data on recently emerged brood
are mostly from a separate and higher al-
titude (though nearby) locality, they indi-
cate that foraging by females of this spe-
cies has ceased by early June and that

males are actively searching for overwin-
tering females at this time. In most of the
region under discussion here, there are al-
most no flowers available for bee foraging
after early June. Indeed, there was an ex-
tremely marked deterioration of forage
availability at Hazor between early May
and the end of the month such that great
bee abundance had changed to an almost
complete absence, several hours of search-
ing between May 28th and 30th failed to re-
sult in any T. prognathus being found
whereas earlier in the month several doz-
ens could be observed in an hour.

Thus, based upon phenology, dissection
and wear data, I conclude that T. progna-
thus is not an eusocial species in Israel. I
now turn to the behavioural interactions
among individuals observed in circle
tubes.

Behavioural profiles of bees in circle
tubes seem to reflect the differences be-
tween the conflictive relationships in eu-
social and semisocial societies and har-
monious interactions in communal ones
(Kukuk and Crozier 1990; McConnell-Gar-
ner and Kukuk 1997; Paxton et al. 1999).
In eusocial societies, where competition
among individuals over oviposition or the
sex ratio of brood occurs, agonistic acts
such as C-postures, lunges and pushing
are common (McConnell-Garner and Ku-
kuk 1997; Pabalan et al. submitted). Con-
versely, communal species are much more
tolerant, pass one another readily (Paxton
et al. 1999) and unrelated individuals have
even been observed performing trophal-
laxis (Kukuk and Crozier 1990). Solitary
species show intermediate levels of both
aggressive and cooperative behaviours
(Table 2).

As noted above, the phenological and
dissection data suggest that T. prognathus
is not eusocial or semisocial. Similarly,
communal behaviour would seem to be
unlikely as the pass per encounter rates of
bees with this type of colony organisation
are consistently high (McConell-Garner
and Kukuk 1997; Packer unpublished ob-

Journal of Hymenoptera Research

servations) yet in T. prognathus they are
the lowest recorded except for pairs of
guards which are expected not to pass one
another. Thus, I conclude that the data are
most consistent with the hypothesis that
this species is solitary. Clearly more de-
tailed information is required and knowl-
edge of the nest architecture of T. pirogna-
tluis would also be of interest.

In conclusion, T. prognathus would seem
to be a locally abundant halictine in north-
ern Israel, it does not seem to specialise on
pollen or nectar from long corolla plants
and its phenology and behavioural pat-
terns in experimental arenas are consistent
with it being a solitary species, although
forms of quasisocial behaviour cannot be
definitively disproven.

ACKNOWLEDGMENTS

I thank Drs. Amnon Freidberg, Abraham Hefetz
and Avi Shmida for facilitating my studies in Israel,
and, in particular, Rani Kasher and his family for ac-
commodation during the study reported here and to
Rani for access to his collection and for identifying
the plants visited by T. prognathus. Jessica Janjic
helped with the figures and Dr. J. Shore provided
phytosystematic information. Financial support came
from the Natural Sciences and Engineering Research
Council of Canada.

LITERATURE CITED

Bluethgen, P. 1955. The halictinae (Hymen., Apoidea)
of Israel I. Genus Halictus (Subgenera Halictus
s.str. and Thrincohalictus). Bulletin of the Research
Council of Israel 5: 5-23.

Breed, M. D. 1975. Sociality and seasonal size varia-
tion in halictine bees. Insectes Sociaux 22: 375-380.

Breed, M. D., J. M.Silverman and W. J. Bell. 1978. Ag-
onistic behavior, social interactions and behav-
ioral specialization in a primitively eusocial bee.
Insectes Sociaux 25: 351-364.

Danforth, B. N., 1 1. Sauquet and L. Packer. Phylogeny
of the bee genus Halictus (Hymenoptera: Halic-
tidae) based on parsimony and likelihood anal-
yses of EF-lalpha sequences. Molecular Phyloge
netics and Evolution 13: 605-618.

Dunn, M., P. L. Mitchell and L. Packer. 1999. Phe-
nology and social biology of two sibling species
of Halictus in an area of sympatry. Canadian lour
ual of Zoology 76:

I ickwort, G. C. 1986. first steps into eusociality: the

sweat bee Dialictus lineatulus. Florida Entomologist
69: 742-754.

Eickwort, G. C, K. R. Eickwort, J. M. Eickwort, J. Gor-
don and A. Eickwort. 1996. Solitary behavior in
a high-altitude population of the social sweat bee
Halictus rubicundus (Hymenoptera: Halictidae).
Behavioral Ecology and Sociobiology 38: 227-233.

Goukon, K., Y. Maeta and S. F. Sakagami. 1988. Sea-
sonal changes in ovarian state in a eusocial hal-
ictine bee, Lasioglossum duplex, based on stages of
the oldest oocytes in each ovariole (Hymenop-
tera: Halictidae). Research in Population Ecology
29: 255-269.

Knerer, G. 1992. The biology and social behaviour of
Evylaeus malachurus (K.) (Hymenoptera; Halicti-
dae) in different climatic regions of Europe. Zool-
ogische Jahrbucher Abteilung fur Systematik, Oeko-
logie und Geographie der Tiere 119: 261-290.

Kukuk, P. F. 1992. Social interactions and familiarity
in a communal halictine bee Lasioglossum (Chilal-
ictus) hemichalceum. Ethology 91: 291-300.

Kukuk, P. F. and R. H. Crozier. 1990. Trophallaxis in
a communal halictine bee Lasioglossum (Chilalic-
tus) erythrurum. Proceedings of the National Acad-
emy of Sciences U.S.A. 87: 5401-5404.

McConnell-Garner, J. and P. F. Kukuk. 1997. Behav-
ioral interactions of two solitary halictine bees
with comparisons among solitary, communal
and eusocial species. Ethology 103: 19-32.

Pabalan, N. A. 1998. Aspects of the interaction between
reproductive morphology and social behaviour of a
primitively eusocial sweat bee, Halictus ligatus Say
(Hymenoptera; Halictidae). Unpublished Ph.D. the-
sis, York University, Toronto. 149pp.

Pabalan, N., K. G. Davey and L. Packer. Escalation of
aggressive interactions during staged encounters
in Halictus ligatus (Hymenoptera: Halictidae).
Journal of Insect Behavior. Submitted.

Packer, L. 1997. The relevance of phylogenetic sys-
tematics to biology: examples from medicine and
behavioral ecology, pi 1-29. In P. Grandcolas
(ed). The Origin of Biodiversity in Insects: Phyloge-
netic Tests of Evolutionary Scenarios. Memoires du
Museum National d'Histoire Naturcllc vol. 173.
360pp.

Packer, L. and G. Knerer. 1985. Social evolution and
its correlates in bees of the subgenus Evylaeus
(Hymenoptera: I lalictidae). Behavioral Ecology and
Sociobiology 18: 363-375.

Paxton, K. ]., P. F. Kukuk and J. Tengo. 1999. Effects
ol familiarity and nestmate number on social in-
teractions in two communal bees, Andrena SCOtica
and Panurgus calcaratus (Hymenoptera, Andren-
idae). Insectes Sociaux 46: 109-118.

Sakagami, S. F. and L. Packer. 1W4. Delayed euso-
ciality in halictine bees. p. 86 In: Lenoir, A., G.

Volume 9, Number 1, 2000 61

Arnold and M. Lepage (eds). Les Insectes Sociaux. and social interactions in a solitary bee Lasioglos-

Paris, Universite Paris Nord. 583pp. sum (Dialictus) figueresi (Hymenoptera: Halicti-

Smith, B. H. and C. Weller. 1989. Social competition dae). Insectes Sociaux 44: 199-208.

among gynes in halictine bees: the influence of Yanega, D. 1988. Social plasticity and early-diapaus-
bee size and pheromones on behavior, journal of ing females in a primitively eusocial bee. Pro-
Insect Behavior 2: 397-41 1. ceedings of the National Academy of Sciences U.S.A.

Wcislo, W. T. 1997. Elements of dominance behavior 85: 4374-4377.

J. HYM. RES.
Vol. 9(1), 2000, pp. 62-70

Sperm Development and Ultrastructure of Mature Spermatozoa of
Megalyra (Hymenoptera: Megalyroidea)

Terence M. Newman and Donald L. J. Quicke

(TMM) Unit of Parasitoid Systematics, CABI Bioscience UK Centre (Ascot),

Department of Biology, Imperial College at Silwood Park, Ascot, Berkshire SL5 7PY,

UK; (DLJQ) Unit of Parasitoid Systematic^ CABI Bioscience UK Centre (Ascot),

Department of Biology, Imperial College at Silwood Park, Ascot, Berkshire SL5 7PY, UK

and Department of Entomology, The Natural History Museum, London SW7 5BD, UK

Abstract. — Sperm ultrastructure and aspects of spermiogenesis are described for the first time
for a member of the hymenopteran superfamily Megalyroidea, the parasitic wasp, Megalyra fas-
ciipennis Westwood. The Megalyroidea are a poorly-known, putatively ancient group of the Apo-
crita (wasp-waisted wasps), and they are the first member of the Evaniomorpha group of super-
families (sensu Rasnitsyn 1988) whose sperm have been investigated in detail. Therefore their
spermatology might provide clues as to the groundplan for the higher Hymenoptera.

The Megalyroidea are among the more (Shaw 1990; Austin et al. 1994). Introduc-
elusive and least well known of the para- tions of one Australian species, Megalyra
sitic wasps, currently placed in the infor- fasciatipennis Westwood, into South Africa
mal 'Evaniomorpha' group of superfami- in an attempt at biological control of Phor-
lies as defined by Rasnitsyn (1988) which acantha has resulted in a population of the
comprises the Ceraphronoidea, Evanoidea parasitoid that in some years becomes nu-
s.l., Megalyroidea, Slephanoidea and Tri- merous enough to permit guaranteed and
gonaloidea. However, few characters are relatively straightforward collecting, and
known that unite this morphologically it was in one of those years that material
and biologically heterogeneous group, was obtained for spermatological investi-
and its monophyly is only weakly sup- gation. This study provides the first sper-
ported (Ronquist et al. 1999). How the Me- matological information on the Megaly-
galyroidea are related to the other apocri- roidea, and is also the first detailed ultra-
tan (wasp-waisted) Hymenoptera is there- structural investigation of sperm for any
fore not well understood, and several fea- of the 'Evaniomorpha' superfamilies. The
tures suggest that they may be one of the work was carried out to provide basic ul-
most basal groups, forming a transition trastructural information on sperm devel-
between the parasitic sawfly family Orus- opment in this rarely studied group, and
sidae and the other parasitic wasps (see to see if comparison with other Apocrita
Gibson 1985; Shaw 1990; Heraty et al. can provide phylogenetic information.
1994; Dowton & Austin 1994; Vilhelmsen That sperm ultrastructure might pro-
1997). Few species are known and most vide new character systems for resolving
are known from only one or a few speci- relationships within the Hymeoptera was
mens in collections (Shaw 1990). They are muted by Jamieson (1987), it was not until
idiobiont ectoparasitoids of concealed the preliminary comparative survey of
hosts, probably the majority attacking the non-aculeates by Quicke et al. (1992) that
wood-boring larvae of large beetles in- some of the wealth of characters they pos-
cluding the pest cerambycid, Phoracantha sess became apparent. But, while a grow-

' Bttlnftuu

Volume 9, Number 1, 2000 63

ing number of superfamilies of Hymenop- was not much wider than the tail at its

tera have had at least one included species widest and could be seen to taper from the

examined in detail for sperm ultrastruc- posterior of the nucleus to the tip of the

hire (see for example, Thompson & Blum acrosome.

1967; Lensky et al. 1979; Lingmei & Dunsu The mature sperm of Megalyra (Fig. 1),

1987; Wheeler et al. 1990; Newman & illustrate all of the organelles so far de-

Quicke 1998, 1999a,b) there are a number scribed in the sperm of other parasitic

of important and phylogenetically signifi- wasps, i.e. axoneme, mitochondrial deriv-

cant groups for which nothing is known, atives, deltoid bodies, acrosome and nu-

for example, Orussoidea, Stephanoidea, cleus. In the testes cysts are found with

Trigonaloidea and even the Evanoidea, sperm at many different stages of devel-

Ceraphronoidea, Cynipoidea and Platy- opment. Primary and secondary sper-

gastroidea, the last four of which are com- matocytes are found with the latter in a

mon and easy to obtain alive. It is hoped syncytium formed by incomplete cytogen-

therefore that the present work will help esis following the earlier mitotic division

encourage others to investigate the sper- (Fig. 2). The structural features are as fol-

matology of these taxa in order to add to lows:

the body of phylogenetic information for Axoneme. — The tail portion of the ma-
resolving higher relationships within the ture sperm contains a single axoneme
order. with a 9 + 9 + 2 arrangement of micro-
tubules for most of its length (Fie. 3).
MATERIAL AND METHODS There are we„ developed acc°SSOry ° ruc'.

Recently eclosed adult male Megalyrn tures, particularly linking the central pair
fasciatipennis Westwood were collected in of microtubules (Fig. 3, arrowed).
South Africa in September 1998 and trans- The axoneme develops from an electron
ported by air to the U.K., where testes and dense structure which becomes positioned
vas deferens were dissected under 2% glu- adjacent to the nucleus defining the pos-
taraldehyde in phosphate buffered saline terior pole of the nucleus (Fig. 4). This
(pH 7.2), fixed for two hours, then trans- structure, often referred to as a ring cen-
ferred to 2% osmium tetroxide in cacodyl- triole (Fig. 5), contains the basal body of
ate buffer (pH 7.2) for a further 2 hr fixa- the axoneme, from which the axoneme
tion. After two buffer washes, tissue was elongates. However, during spermiogen-
dehydrated to 50% ethanol and then con- esis, many sectioned cells are found with
trasted with a saturated solution of uranyl between two and four axoneme profiles
acetate in 50% ethanol prior to complete (Fig. 6). Usually one or more of the pro-
dehydration, embedding in Epon resin files exhibits a loss of structural integrity
and polymerisation overnight. Large sil- (arrowed Fig. 6) often appearing with less
ver sections were picked up on high res- than the full complement of microtubules,
olution grids and contrasted with uranyl It is not exactly clear what these represent
acetate and lead citrate. and the possibility that they are degener-
ating cells cannot be ruled out, though
their prevalence and the presence in each

Mature sperm of Megalyra fasciipennis of at least one apparently perfect axoneme
collected from the vas deferens were not profile suggest that they are a normal de-
formed into spermatodesmata. The indi- velopmental stage. No mature sperm with
vidual sperm ranged in length from 160 to multiple tails have been found.
200 (Jim, though most were close to 180fxm Mitochondrial derivatives and centriolar ad-
of which the head (acrosome plus nucleus) junct. — The mature sperm has two differ-
constituted approximately 17%. The head ently sized crystalloid mitochondrial de-

Journal of Hymenoptera Research

rivatives (Figs. 1 & 3), which run for the
length of the tail. The larger of the two
mitochondrial derivatives also runs into
the head of the sperm, parallel to the nu-
cleus (Fig. 7). In transverse section (Fig. 8)
it can be seen that the mitochondrial de-
rivative can occupy a greater proportion
of the shaft area than the nucleus itself
(Fig. 8, arroived).

The mitochondrial derivatives are de-
rived from a Nebenkern, the product of
the fusion of large numbers of small mi-
tochondria in the early spermatid. Unlike
other sperm so far reported, the Neben-
kern goes through a stage where the mi-
tochondrial material forms a tube, before
producing the asymmetrically-sized mito-
chondrial derivatives (Fig. 9, arrowed). The
association between the larger mitochon-
drial derivative and the nucleus is evident
from the earliest stages of nuclear shape
change (Fig. 10). Mitochondrial material

appears to be present at the locus of this
change.

The centriolar adjunct in the adult
sperm is positioned between the smaller
mitochondrial derivative and the nucleus
(Fig. 1). During development there is a
close association between the centriolar
adjunct and the developing axoneme (Fig.
11). In the cells where with multiple axo-
nemes additional centriolar adjuncts are
also present (Fig. 12) indicative of the
close association between the two organ-
elles.

Nucleus. — Axoneme development corn-
menses before nuclear elongation which
follows a similar pattern to that described
for the braconid Aleiodes, with the forma-
tion of lateral plates (Fig. 10) opposite ag-
gregations of dense chromatin strands (cf
Newman & Quicke 1998).

Acrosome. — The acrosome forms from
fusion of small vesicles at the posterior

Figs. 1-2. Mature sperm and early spermiogenesis of Megalyra: 1, transversely sectioned vas deferens with
mature sperm with axonemes (A), nucleus (N), asymmetrically sized mitochondrial derivatives (M) — includ-
ing some with only one mitochondrial derivative (arrowed) — and centriolar adjunct (C) in some sections where
it occupies the position of the smaller mitochondrial derivative just posterior to the nucleus (scale bar = 100
nm); 2, secondary spermatocytes forming a syncitium (S) because of incomplete cytokinesis following the
earlier mitotic division, the thickened membrane (arrowed) indicating intercellular bridges (scale bar = 0.5
ixm).

Figs. 3-6. Various stages in spermiogenesis of Megalyra: 3, transverse section of the tail portion of mature
sperm illustrating the 9 + 9 + 2 arrangement of microtubules, with accessory filaments evident, particularly
linking the central pair of microtubules (arrow), and with two deltoid bodies (D) in association with the
mitochondrial derivatives (scale bar == 100 nm); 4, early spermatid illustrating the growth of the axoneme
(arrowed) from a position at the posterior pole of the nucleus (N) (scale bar = 500 nm); 5, early spermatid
showing ring centriole (R) surrounding the basal body of the developing axoneme (scale bar = 250 nm); 6,
during development many cell sections show multiple axoneme profiles (A), closer than would be expected
if they represented sections through a single convoluted structure — note disruption of one of the profiles
(arrowed) (scale bar = 100 nm).

Figs. 7-10. Various stages in spermiogenesis of Megalyra: 7, longitudinal section of the sperm head piece
with the larger mitochondrial derivative (M) extending from the tail portion, where it is found adjacent to
the axoneme, and then running parallel to the nucleus (arrowed) (scale bar - 0.5 |xm); 8, transverse section
through mature spermatozoan illustrating differences in the size of the nucleus (N) and of the large mito-
( hondrial derivative (M) in the head portion of the sperm in the region of overlap between the two (scale bar
LOO nm); 9, transverse sec lion ot early spermatid illustrating a stage during formation of the mitochondrial
derivatives when the Nebenkern becomes tubular (arrowed) (si ale bar I |im); 10, one mitochondrial deriv-
ative (arrrowed) lies partly in a groove along the nucleus during earlier stages ol development note also the
lateral plates (between arrowheads) which appear to be anchor silt's for condensed chromatin during nuclear
shape change (scale bar = 0.5 (xm).

ftb.

Volume 9, Number 1, 2000

*:...<

■- ■

fc^gj^i

*-vT? *■'* v* ;-,f'u

■ r ■

v - . • . ■ v

" *'

'•

Journal of Hymenoptera Research

Volume 9, Number 1, 2000

Journal of Hymenoftera Research

pist j

■

i?i

> *t*

&i$i

«w i

r i

■ ry
ft?

»>

j**Ak» ■ ■ ■

-Wj|

Figs. 11-14. Various stages in spermiogenesis of Megalyra: 11, transverse section oi spermatid illustrating
how the centriolar adjunct (C) is closely associated with the axoneme (A) during development (scale bar =
LOO nm); 12, developing cyst ol spermatids showing that cells with multiple axonemes have accompanying
centriolar adjuncts (scale bar = 1 pun); 13, during development the acrosome (A) is formed from the fusion
of small vi'su Irs and becomes positioned .it the anterior pole of the nucleus (scale bar = 0.5 (xm); 14, acrosome
in lougitidin.il section (A) covering the perforatorium (arrowed) (scale bar 100 nm).

Volume 9, Number 1, 2000

pole of the nucleus (Fig. 13). Although it
develops a perforatorium (Fig. 14, arrow),
the acrosome is small and ill-developed in
comparison with the rest of the sperm and
was very hard to find despite searching
hundreds of transverse sections.

DISCUSSION

The presence of two markedly differ-
ently sized mitochondrial derivatives has
been reported in other parasitic wasps'
spermatozoa, e.g. Leptopilina, which be-
longs to the only distantly related super-
family Cynipoidea (Newman and Quicke
1999b). We have also found a similar ar-
rangement in the sperm of the xyelid saw-
fly, Xyela julii (Newman and Quicke
1999a). Whether this feature could be con-
sidered 'primitive' is doubtful given that
other sawflies (Cephnlcia of the Pamphili-
idae and Tremex of the Siricidae) have
equally sized mitochondrial derivatives.

The large length of overlap between one
of the mitochondrial derivatives and the
nucleus has only been found in sperm of
one other parasitic wasp, the distantly re-
lated chalcidoid wasp genus Trichogramma
(Lingmei & Dunsu 1987). The cynipoid,
Leptopilina, which also has asymmetric
sized mitochondrial derivatives, also has
an overlap of nucleus and mitochondrial
derivative, but over a much smaller dis-
tance (Newman & Quicke 1999b).

This intimate relationship of mitochon-
drial material and nucleus exists from an
early stage of spermiogenesis. The mito-
chondrial material is found at the focus of
the nuclear shape change which occurs
during cell elongation, where the nucleus
curves into a horse-shoe shape, a shape
change similar to that found in Aleiodes
(Newman & Quicke 1998). One aspect of
development which has not been previ-
ously reported is the occurrence of tubular
elements in the Nebenkern after fusion of
the small mitochondria of the early sper-
matid. This is probably an apomorphic
character state and it may be of potential

phylogenetic significance within the Eva-
niomorpha.

ACKNOWLEDGEMENTS

Ms Judy Moore most kindly collected the Megalyra
in South Africa and went to considerable trouble to
get them couriered to the U.K. alive for studv. The
authors gratefully acknowledge the assistance ot \K
Anne Dewar (EM Unit, Royal Brompton Hospital).
This research was supported by the NERC (Natural
Environment Research Council), Initiative in Taxon-
omy and a grant from the Leverhulme Trust to DLJQ
and Mike Fitton (The Natural History Museum).

LITERATURE CITED

Austin, A., D. L. J. Quicke and P. M. Marsh. 1994.
Systematics of the hymenopteran parasitoids of
the eucalypt longicorns, Phoracantha spp. (Cole-
optera: Cerambycidae) in Australia, with a de-
scription of a new doryctine genus (Hymenop-
tera; Braconidae). Bulletin of Entomological Re-
search 84: 145-174.

Dowton, M. and A. D. Austin. 1994. Molecular phy-
togeny of the insect order Hymenoptera: Apocri-
tan relationships. Proceedings of the National Acad-
emy of Sciences USA, 91: 9911-9915.

Gibson, G. A. P. 1985. Some pro- and mesothoracic
structures important for phylogenetic analysis of
Hymenoptera, with a review of terms used for
the structures. The Canadian Entomologist 117:
1395-1443.

Heraty, J. M., J. B. Woolley and D. C. Darling. 1994.
Phylogenetic implications of the mesofurca and
mesopostnotum in Hymenoptera. Journal of Hy-
menoptera Research 3: 241-277.

Jamieson, B. G. M. 1987. The Ultrastructure ami Pint-
logon/ of Insect Spermatozoa. Cambridge Univer-
sity Press, Cambridge, 320pp.

I ensky, Y, E. Ben-David, and H. Schindler. 1979. Ul-
trastructure of the spermato/oan of the mature
drone honeybee. Journal of Apiculture Researt h Is
264-271.

Lingmei, D. and W. Dunsu. 1987. Ultrastructural ob-
servations on the spermatozoa of Trichogramma.
Acta Zoologica Sinica 33: 262-266.

Newman, T. M. and D. L. J. Quicke. 1998. Sperm de-
velopment in the imaginal testes of Aleiodes cox-
alis (Hymenoptera: Braconidae: Rogadinae). Jour-
nal of Hymenoptera Research 7: 25-37.

Newman, T. M. and D. L. |. Quicke. 1999a. Ultrastruc-
ture oi imaginal spermatozoa ol sawflies ill\
menoptera: Symphyta). Journal oj Hymenoptera
Research 8: 35-47.

Newman, T. M. and D. L. J. Quicke. L999b. Ultra-
structure oi spermatozoa in leptopilina (Hyme-
noptera: Cynipoidea: Eucoilidae). Journal of Hy
menoptera Research 8: 197-203.

Journal of Hymenoptera Research

Quicke, D. L. J., S. N. Ingram, H. S. Baillie and P. V.
Gaitens. 1992. Sperm structure and ultrastructure
in the Hymenoptera (Insecta). Zoologica Scripta
21: 381-402.

Rasnitsyn, A. P. 1988. An outline of evolution of the
hvmenopterous insects (Order Vespida). Oriental
Insects 22: 115-145.

Ronquist, F., A. P. Rasnitsyn, A. Roy, K. Eriksson, and
M. Lindgren. 1999 Phytogeny of the Hymenop-
tera: a cladistic reanalysis of Rasnitsyn's (1988)
data. Zoologica Scripta 28: 13-50.

Shaw, S. R. 1990. Phylogeny and biogeography of the
parasitoid wasp family Megalyridae (Hymenop-
tera). Journal of Biogeography 17: 569-581.

Thompson, T. E. and M. S. Blum. 1967. Structure and
behaviour of spermatozoa of the fire ant Solenop-
sis saevissima (Hymenoptera: Formicidae). Annals
of the Entomological Society of America 60: 632-642.

Vilhelmsen, L. 1997. The phylogeny of lower Hyme-
noptera (Insects), with a summary of the early
evolutionary history of the order, journal of Zoo-
logical Systematics and Evolutionary Research 35:
49-70.

Wheeler, D. E., E. G. Crichton and P. H. Krutzsch.
1990. Comparative ultrastructure of ant sperma-
tozoa (Formicidae: Hymenoptera). journal of Mor-
phology 206: 343-350.

J. HYM. RES.
Vol. 9(1), 2000, pp. 71-84

Afrotropical Ants (Hymenoptera: Formicidae): Taxonomic Progress

and Estimation of Species Richness

Hamish G. Robertson

Life Sciences Division, South African Museum, P.O. Box 61, Cape Town 8000, South Africa;

e-mail: hroberts@samuseum.ac.za

Abstract. — Forty-three of the 82 Afrotropical ant genera (52%) have been revised to modern
standards resulting in a 50% increase in number of species. There are currently 1705 species of
ants known from the Afrotropical region, a figure that could increase to over 2136 species if all
ant genera receive a modern revision. To incorporate all undescribed species, total Afrotropical
ant species richness was calculated by extrapolating from data on the proportion of undescribed
species collected at Mkomazi Game Reserve in Tanzania and the Cape of Good Hope section of
the Cape Peninsula National Park in South Africa. On this basis there are an estimated 3105 species
of ants in the Afrotropical region, with 45% undescribed or currently occupying an infraspecific
taxonomic rank. This extrapolation assumes that the average range sizes of described and unde-
scribed species are similar, which in reality is unlikely because widely distributed species are
more likely to have been collected and described. I present a method that distinguishes between
widespread and localised species to correct for this problem, which extrapolates 4093 Afrotropical
ants species, with 58% of species estimated to be undescribed or currently recognised only at
infraspecific rank. It would take a highly productive systematist at least 21 years to complete
revisions of the unrevised ant genera. A strategy is presented for improving specimen collection
and taxonomy of Afrotropical ants.

Until recently, working on the taxono-
my of ants and identifying them to genus
was hindered by poor, out-dated cata-
logues and inadequate keys. Ant system-
atists, however, now have three books that
provide a synthesis of our current knowl-
edge: Bolton has produced keys to ant
genera of the world (Bolton 1994) and a
catalogue of world ants (Bolton 1995b)
and Ward et al. (1996) have provided a
thoroughly researched bibliography of ant
taxonomic literature. In addition, the book
by Shattuck (1999) makes identification of
Australian ant genera much easier than
before.

Despite the relative ease with which
ants can now be identified to genus, spe-
cies identification is much more difficult
because many ant genera have not been
recently revised. Species-level identifica-
tions in recently revised genera can also

be problematic when such revisions are
based on collections with limited geo-
graphic coverage that omit species and
population variation. Older taxonomic
works (mainly pre-1965) are difficult to
use for identifying species because they
are often burdened with poorly applied
quadrinomials (genus, species, subspecies,
variety) that do not correspond with evo-
lutionary relationships. With the catalogue
by Bolton (1995b), the bibliography by
Ward ct al. (1996), and a wealth of new
material collected using modern survey
methods, the tools are available to tackle
the revision of neglected ant genera. How-
ever, at present there is no strategy in
place for accomplishing this remaining
work and basic information on approxi-
mately how much work remains is nec-
essary for establishing goals and priorities.
Although Bolton (1995a) has provided a

72 Journal of Hymenoptera Research

taxonomic and zoogeographical census of alternative approach, which involves dis-
documented ant diversity, he did not as- tinguishing between widespread and lo-
sess the current taxonomic health of all calised species, is presented here to ad-
ants, nor does he address the issues of the dress the problem of range size differences
proportion of ant genera that lack modern between described and undescribed spe-
taxonomic treatment, and the effort that cies.
such treatment will require. The Afrotropical region is defined here

In addition to our inability to estimate according to Bolton (1994) as Africa south

the effort that will be required to revise all of the Sahara and the southern half of the

ant genera to modern taxonomic stan- Saudi Arabian Peninsula. Madagascar and

dards, we are also unable to reliably esti- its nearby islands are excluded. Our

mate how many ant species exist and how knowledge of the ant fauna of this region

many are undescribed. On a world level, is the product mainly of the following tax-

Gauld & Bolton (1988) estimated 15,000, onomists (see Ward et al. 1996 for publi-

and Holldobler and Wilson (1990) esti- cation details): F. Smith (1851-1879); Mayr

mated 20,000 species in total, these esti- (1853-1908); Forel (1869-1920's); Emery

mates being largely intuitive. By the end (1869-1926); Santschi (1906-1941); Arnold

of 1993, 9538 described valid ant species (1905-1962, including "A monograph of

in the world were recognised (Bolton the Formicidae of South Africa", pub-

1995a), so according to the above two es- lished 1915-1926); Brown (1943-1995); and

timates, 36-52% of ant species either re- Bolton (published 1969 to present),

main undescribed or currently occupy an The present paper is aimed at establish-

infraspecific rank. ing the current level of taxonomic knowl-

Estimates of total diversity are often edge of Afrotropical ant species by assess-
made using data from particular localities ing the proportion of ant genera that re-
where it has been possible to estimate the main to be revised to modern taxonomic
proportion of species that are unde- standards and the effort required to un-
scribed, and to use this proportion to ex- dertake these revisions. In addition, I es-
trapolate to a wider level (e.g. Hodkinson timate total ant species richness in the Af-
and Casson 1991, Hodkinson 1992 for He- rotropical region using data on the pro-
miptera). This approach implies that the portion of undescribed species collected at
average range sizes of described and two widely separated localities in Africa,
undescribed species are similar (Hodkin- namely Mkomazi Game Reserve in Tan-
son and Hodkinson 1993; Hammond zania and the Cape of Good Hope section
1995). In practice, this is highly unlikely as of the Cape Peninsula National Park in
widely distributed species are more likely South Africa. At both sites, ants have been
to be captured and described than species intensively collected using a variety of
with more localised distributions. Hodkin- methods, thereby increasing the probabil-
son and Hodkinson (1993) examined this ity that the observed ratio of undescribed
problem by comparing data from two to described species is a good estimate of
sites and providing a statistical test of the ratio for those species that have not
whether the probability of capture of de- been collected. I conclude by suggesting a
scribed species was different from the strategy for improving both the collecting
probability of capture of undescribed spe- and the taxonomic treatment of Afrotrop-
cies and then using the ratio of these two ical ants,
probabilities to adjust the final estimate of

species diversity. The outcome of such a METHODS

comparison depends largely on the simi- Estimation of species number increment

larity and proximity of the two sites. An from revision of genera. — I divided the Af-

Yfti«*i

Volume 9, Number 1, 2000

rotropical ant genera between those that
have received a modern revision (defined
here as from 1965 onwards) and those that
have not; revisions prior to 1965 are either
incomplete or use the old quadrinomial
system. Genera represented only by intro-
duced species (Linepithema humile (Mayr),
Wdsmannia auropunctata (Roger)) have
been excluded. Genera that have received
a modern revision are henceforth referred
to as 'revised genera' and the remaining
genera as 'unrevised genera'. For each re-
vised genus I calculated the species incre-
ment coefficient, i.e. the number of valid
species divided by the number prior to re-
vision. Descriptions of new species and
the raising of subspecies to species in-
creased the increment coefficient whereas
synonymising of previously valid species
decreased it. Lowering of rank from spe-
cies to subspecies was not encountered in
any of the revisions. In genera which have
received more than one revision since
1970 (e.g. Ocymyrmex), I calculated the
number of valid species before the first re-
vision and the number by completion of
the last revision. Subsequent papers de-
scribing additional new species in revised
genera were also included in the analysis.
An increment coefficient for all revised
genera was calculated based on the total
number of valid species before and after
for all revisions and new descriptions.

For unrevised genera, I counted the
number of valid species and multiplied
this by the increment coefficient for re-
vised genera to arrive at an estimate of the
total number of species after revision. The
total species for the revised genera plus
this estimated value for the unrevised
genera gives the 'Total estimated revised
species'.

Estimation of total species richness. — An
estimate of total ant species richness in the
Afrotropical region was obtained by de-
termination of the proportions of de-
scribed and undescribed species in Mkom-
azi Game Reserve, Tanzania, and in the

Cape of Good Hope section of the Cape
Peninsula National Park, South Africa.

Ants were collected in Mkomazi Game
Reserve using pitfall traps, malaise traps,
Winkler bag leaf litter extractions, soil
sieving, light traps, sweeping, and collect-
ing by hand (Robertson 1999). Mkomazi
Game Reserve has a wide range of vege-
tation types such as grassland, open and
closed woodland, and hilltop forest. It lies
in a region that does not have a long his-
tory of ant collecting although the vege-
tation types it contains have been sampled
in other regions such as Kenya and Zim-
babwe.

The Cape of Good Hope section of the
Cape Peninsula National Park consists of
mesic mountain fynbos, west coast strand-
veld and a few relict small patches of in-
digenous evergreen forest. Because of its
position near the southern tip of Africa,
many naturalists have collected in the
Cape Peninsula and one might thus expect
the ant fauna to be well known. However,
many cryptic species went unnoticed until
the recent systematic use of collecting
methods such as pitfall trapping and
Winkler bag leaf litter extraction.

For each of these two localities, I deter-
mined the ratio of undescribed species
that belong to revised genera:

Therefore

U/K = u/k

U = u(K/k)

where U is the number of undescribed
species in the Afrotropical region, u is the
number of undescribed species at the lo-
cality, K is the number of known (i.e. val-
id) species in the Afrotropical region and
k is the number of known species at the
locality. As already discussed, this ap-
proach assumes that the average range
size of known and undescribed species is
similar (Hodkinson and Hodkinson 1993;
Hammond 1995) which in reality is un-
likely because widely distributed species
would be more likely to have been col-

74 Journal of Hymenoptera Research

lected and described. In order to reduce years from 1972 to 1987 he worked single-
the bias, I arbitrarily categorised all mindedly at revising various ant genera,
known Afrotropical species in revised For each of his taxonomic publications
genera between 'widespread species' that during this period, irrespective of whether
have recorded distributions over three or they concerned Afrotropical ants, I record-
more countries and 'localised species' that ed the number of valid species before the
have been recorded from only one or two revision, the number of new species de-
countries (based on information obtained scribed and the number of valid species
from the revisions as well as from records resulting from the revision. The number of
in the South African Museum ant com- valid species in an unrevised genus divid-
puter database). The average range size of ed by the average number of initial valid
the localised species is likely to be more species processed per year by Bolton,
similar to the average range size of the un- gives the number of years it would take
described species than that of all known to revise the genus (at maximum produc-
species together. By reducing the bias in tivity).
this wav, the ratio of undescribed to lo-
calised species at an Afrotropical level

should therefore be similar to the ratio of Estimation of species number increment

undescribed to localised species at a local from revision of genera. — Modern revision

level and therefore of 43 (52%) of the Afrotropical ant genera

... has resulted in an overall 50% increase in

number of species, so that the number of
where, for recently revised genera, L is the species at the completion of the revisions
number of localised known species in the was 1.5 times greater than the initial num-
Afrotropical region and 1 is the number of ber (Table 1). At the one extreme are gen-
localised known species at a particular lo- era such as Anochetus, Psalidomyrmex, Pris-
cality. tomyrmex and Platythyrea that decreased in

Accumulation of described species as afunc- number of species as a result of species
tion of collecting date. — As an alternative being synonymised in the revision. At the
way of assessing the proportion of ant other extreme are genera such as Axinidris,
species that are still undescribed, for a Cyphoidris, Ocymyrmex, Paedalgus, Pyrami-
sample of revised genera I recorded the ca and Strumigenys that more than dou-
year the type was collected for each valid bled in size mainly as a result of the de-
species and plotted the accumulation of scription of new species,
species as a function of collection date. There are 862 valid species in the 39
The collection date was not recorded for (48%) unrevised Afrotropical genera (Ta-
many of the earlier types and for these I ble 2) and as the initial number of species
used the publication date instead. The ear- in the revised genera amounted to 561
ly ant taxonomists such as Emery and For- (Table 1 ), based on the relative number of
el usually provided descriptions for new species we are therefore about 39% of the
species within one or two years subse- way through revision of the genera to
quent to their collection. modern standards. Revision of the unre-

Time taken to revise genera. — In order to vised genera over a similar time period as

estimate the time that it would take to re- the revised genera would have swelled

vise the unrevised ant genera, I analysed the number of species from 862 species to

the productivity of the world's most pro- about 1293 (Table 2). Together with the

ductive ant systematist, Barry Bolton, who 843 species in the revised genera (Table 1)

has also done most of the revisionary there is a total of 2136 estimated revised

work on Afrotropical ants. During the 16 species, an increase of 20% over the 1705

Ihnaut

Volume 9, Number 1, 2000

Table 1. List of the Afrotropical ant genera that have received one or more modern taxonomic revisions
(1965 onwards). The initial number of valid species before the first modern revision, the final number of valid
species known at present, and the increment coefficient (used in Table 2) are shown.

Increment

coefficient

Modem revisions and subsequent

lniti.il species

Final species

(Final /Initial)

publications of new specie-

Afroxyidris

Belshaw and Bolton (1994)

Agraulomyrmex

Prins (1983)

Arikylomyrma

Bolton (1973b, 1981b)

Anochetus

0.75

Brown (1978)

Aphomothyrmex

0.50

Snelling (1979b)

Apomyrma

Brown, Gotwald and Lev-
ieux (1971)

Atopomyrmex

1.50

Bolton (1981b); Snelling
(1992)

Axinidris

4.33

Shattuck (1991)

Baracidris

Bolton (1981b)

Bondroitia

0.67

Bolton (1987)

Calyptomyrmex

1.23

Bolton (1981a)

Camponotus (fulvopilosus-group)

2.00

Robertson (1990); Robertson
and Zachariades (1997)

Cardiocondyla

0.82

Bolton (1982)

Cataulacus

1.03

Bolton (1974a, 1982); Snel-
ling (1979a)

Concoctio

Brown (1974a,b)

Cyphoidris

4.00

Bolton (1981b)

Decamorium

1.00

Bolton (1976)

Dicroaspis

1.00

Bolton (1981a)

Diplomorium

1.00

Bolton (1987)

Dolioponera

Brown (1974c,d)

Leptogenys

1.75

Bolton (1975a)

Leptothorax

1.00

Bolton (1982)

Melissotarsus

0.50

Bolton (1982)

Meranoplus

0.89

Bolton (1981a)

Messor

1 .00

Bolton (1982); Collingwood

(1993)

Micfadaceton

0.67

Bolton (1983)

Monomorium

149

1.66

Bolton (1987)

Ocymyrmex

3.08

Bolton (1981b); Bolton and
Marsh (1989)

Odontomachus

2.00

Brown (1976)

Paedalgns

3.00

Bolton and Belshaw (1993)

Petalomyrmex

Smiling (1979b)

Platythyrea

0.93

Brown (1975)

Plectroctena

1.31

Bolton (1974b); Bolton, Got-
wald and 1 eroux (1979)

Polyrhachis

1.09

Bolton (1973a)

Pristomyrmex

0.83

Bolton (1981b)

Prdbolomyrmex

1.00

Taylor (1965); Brown (1975)

Pyramica

2.63

Bolton (1983), Bolton (1999)

Psalidomyrmex

0.75

Bolton (1975b)

Rhoptromyrmex

1.67

Bolton (1976, 1986)

Simopone

1.29

Brown (1975); Kutter (1976,

1977)

Sphinctomyrmex

2.00

Brown (1975)

Strumigenys

2.47

Bolton (1983), Bolton (1999)

Terataner

1.20

Bolton (1981b)

Tetramorium

131

209

1.60

Bolton (1976, 1980, 1985)

Total

561

843

1.50

Journal of Hymenoptera Research

Table 2. Afrotropical ant genera that have not received a modern taxonomic revision. The number of
estimated species after revision was calculated by multiplying the number of valid species currently known
by the Increment coefficient (1.5) in Table 1. The minimum years to revise a genus is calculated on the basis
that B. Bolton processed species (i.e. the number of species before a revision) at a rate of 42/year.

Acropyga

Aenictogiton

Aenictus

Amblyopone

Anoplolepis

Asphinctopone

Camponotus (excl. fulvopilosus-gioup)

Carebara

Cataglyphis

Centromyrmex

Cerapachys

Crematogaster

Cryptopone

Discothyrea

Don/Ins

Ecphorella

Hypoponera

Lepisiota

Leptanilla

Myrmicaria

Mystrium

Oecophylla

Oligomyrmex

Pachycondyla

Paratrechina

Phasmomyrmex

Pheidole

Pheidologeton

Phrynoponera

Plagiolepis

Prionopelta

Proceratium

Pseudolasius

Santschiella

Solenopsis

Streblognathus

Tapinoma

hi hnomynnex

Tetraponera

Total

Number of

Estimated species

Years (minimum)

valid species

after revision

to revise genus

0.05

0.17

0.81

0.07

0.45

0.07

156

234

3.71

0.26

0.02

0.12

0.57

129

194

3.07

0.02

0.17

1.36

0.02

0.86

1.07

0.07

0.52

0.02

0.79

1.26

0.31

0.10

1.57

0.17

0.12

0.43

0.07

0.12

0.02

0.24

0.02

0.31

0.60

0.76

862

1293

20.52

valid species currently known from the
Afrotropical region.

Estimation of total species richness. — The
percentage of undescribed species within
recently revised genera is 30.9% for ants
in Mkomazi Game Reserve and 32.3% for
ants in Cape of Good Hope Nature Re-

serve (Table 3), remarkably similar values
considering the distance between the two
localities, the differences in their habitat
complements and differing histories of ant
collecting in the two regions. If these per-
centages are extrapolated to the unrevised
genera, and the 50% increase from revis-

SttW

Willi II III

Volume 9, Number 1, 2000

Table 3. Ant species diversity and composition in Mkomazi Game Reserve in Tanzania, Cape of Good
Hope section of the Cape Peninsula National Park (CGH) in South Africa, and in the Afrotropical region as
a whole.

Mkomazi

ecu

rotal

Afrotropical

All general:

Total recorded species

232

303*

1705

Revised genera:

No. widespread species

249

No. localized species

594

Total known species

843

% localized species

16.9

90.5

34.9

70.5

No. undescribed species

Total species

125

% undescribed species

30.9

32.3

31.2

Only one species (Technomyrmex albipes (F. Smith)) shared between the two localities.

ing genera is taken into account, then the
percentage of undescribed species for all
genera is 44% for Mkomazi Game Reserve
and 45% for Cape of Good Hope. Further
collecting and analysis of ants at these lo-
calities is still taking place so the percent-
ages above could change. There are con-
siderable differences between the two lo-
calities in the proportion of known species
in revised genera that have localised dis-
tributions covering only one or two coun-
tries (Table 3). Whereas only 16.9% of
known species in Mkomazi Game Reserve
have localised distributions, 90.5% of spe-
cies in Cape of Good Hope Nature Re-
serve are localised. Many of the Mkomazi
species are widely distributed in African
savannahs, often ranging from the north-
ern regions of South Africa through to
Ethiopia or with a Sahel distribution from
West Africa to Ethiopia and down into
East Africa (Robertson 1999). The forest
dwelling species also often have distribu-
tions extending into central Africa and
other countries in East Africa. Conversely,
many of the species in the Cape of Good
Hope section of the Cape Peninsula Na-
tional Park are limited to the Cape fynbos,
or have distributions that extend only as
far as Namaqualand or KwaZulu-Natal.
In the Afrotropical region as a whole,
70.5% of species are localised (Table 3).

Based on the combined data from both
Mkomazi Game Reserve and Cape of
Good Hope, simple extrapolation of the
proportion of undescribed species (using
the formula U = uK/k) produces an esti-
mated total of 3105 species for the Afro-
tropical region, whereas exclusion of the
widespread species in the calculation of
new species (using the formula U = uL/
1) increases the total by 32% to produce an
estimated total of 4093 species (Table 4).
The estimated diversity using the latter
formula on only the Mkomazi data is 6104
species, twice as high as the estimate
based on only Cape of Good Hope, caused
by the large difference between them in
the ratio of widespread to localised spe-
cies.

Based on the combined data from both
localities, approximately 45-58% of ant
species in the Afrotropical region are un-
described or are currently ranked as sub-
species when they should be ranked as
species (Table 4).

Accumulation of described species as a func-
tion of collecting date. — Analysis of the ac-
cumulation of described, valid species as
a function of collecting date (Fig. 1 ) shows
that undescribed species are being discov-
ered at an undiminishing rate, with the
species accumulation curve showing no
signs of plateauing. The curve shows that

Journal of Hymenoptera Research

Table 4. Estimates of total ant species diversity in the Afrotropical region, based on the proportion of
undescribed species in Mkomazi Game Reserve in Tanzania and in Cape of Good Hope section of the Cape
Peninsula National Park (CGH) in South Africa (Table 3). The first estimate uses the ratio of total known
species at a regional and local level and the second the ratio of localized known species (defined here as
species that have been recorded from only one or two countries) at a regional and local level (see Methods
for explanation of formulae).

Estimated using data from:

Mkomazi

CGH

Both sites

1. Revised genera, based on total known species
No. undescribed species (=uK/k) 376
Total species 1219
Ratio Total /Known 1.4462

2. Revised genera, based on localized species

No. undescribed species ( = uL/l) 1566

Total species 2409

Ratio Total /Known 2.8577

Estimated total species in all genera1

Based on (1) above 3089

Based on (2) above 6104

% new species or species currently at infraspecific rank2

Based on (1) above 44.8

Based on (2) above 72.1

401

382

1244

1225

1.4762

1.4535

313

772

1156

1615

1.3709

1.9160

3153

3105

2928

4093

45.9

45.1

41.8

58.3

= (Total estimated revised species) X (Total /Known). Total estimated revised species = 843 + 1293
2136 (See Tables 1 & 2).
2 = ((Estimated - Known)/ Estimated) X 100. The number of known species = 1705.

600 n

1750 1775 1800 1825

1850 1875 1900
Year collected

1925 1950 1975 2000

Fig. 1. Accumulation of new Afrotropical species in selected genera in relation to collection date of the type
(publication date used where collection date absent). Information from Bolton (1974a, 1980, 1981a, 1981b, 1982,
1983, 1987). Only revisions from 1980 onwards included except lor Cataulacus (Bolton L974a) which was
updated in the 1982 publication.

linWr:

Volume 9, Number 1, 2000

Table 5. Number of ant species revised and de-
scribed by B. Bolton over a 16 year period (includes
an extra year to account for the preparation time for
the 1973 publications). Initial species refers to the
number of valid species before the revision began.
Average number initial species processed per year =
672/16 = 42.

Year

published

Initial
species

No. new species

No. species
after revision

1973

1974

1975

1976

1977

1978

1979

1980

102

176

1981

1982

1983

107

1984

1985

1986

1987

107

167

Total

672

328

971

there was a burst of collecting from 1910
to 1925, overlapping with the period when
George Arnold was mainly active. Follow-
ing this burst, species accumulation in-
creased at a slower rate until the 1970's
when a new generation of ant collectors
started using collecting techniques such as
pitfall trapping, tree fogging and Winkler
bag leaf litter extractions that produced
species that had previously gone unde-
tected. These techniques are still yielding
many new species and additional tech-
niques such as soil sifting should start tap-
ping into the subterranean species that are
still poorly known.

Time taken to revise genera. — Over a 16-
year period, Barry Bolton revised genera
that initially contained a total of 672 spe-
cies, amounting to processing 42 initial
species per year (Table 5). The total of 971
species after revision amounts to describ-
ing and characterising a species every four
working days. Over such a long period
and taking into account other concerns
and responsibilities, this is a formidable

rate of species processing that is unlikely
to be equalled or bettered by anyone
working at an equivalent level of thor-
oughness.

Based on Bolton's level of productivity,
it would take about 21 years for one per-
son to revise the remaining unrevised gen-
era (Table 2). The genera Camponotus, Cre-
tnatogaster, Dorylus, Lepisiota, Pachycondyla
and Pheidole would each take more than a
year to revise.

DISCUSSION

Afrotropical ant species richness. — The
method presented here, that of excluding
widespread species in calculating the pro-
portion of new species, has not been pre-
sented before and is an attempt (following
on Hodkinson and Hodkinson 1993) to
address the problem of differences in the
average geographical distribution of
known and undescribed species. The es-
timate of 4093 Afrotropical ant species
produced by using this method is 32%
greater than the 3105 species estimated us-
ing the conventional ratio of undescribed
to all known species. These estimates
could be improved if more sites are in-
cluded.

In total, therefore, 45-58% of species are
undescribed or currently incorrectly
placed at subspecific rank. This range of
values compares favourably with the 52%
unknown species, calculated from H611-
dobler and Wilson's (1990) estimate of
20000 species world-wide and the actual
number (at the end of 1993) of 9538 spe-
cies determined by Bolton (1995a). Shat-
tuck (1999) states that the Australian ant
species diversity might well be double
that currently known, which also matches
the estimates presented here for the Af-
rotropical region. At a local level, Watt ei
al. (1997) estimated that 40% of the ants
they captured in Mbalmayo Forest Re-
serve in southern Cameroon were unde-
scribed which compares favourably with
the 44-45% undescribed species for all

Journal of Hymenoptera Research

genera recorded at the two localities in the
present study.

On the basis that 18% of the world's de-
scribed ant species are found in the Afro-
tropical region (calculated from Bolton
1995a), the species diversity estimates pre-
sented here can be extrapolated to a world
level to give an estimated world diversity
of between 17250 and 22739 species. How-
ever, as the Nearctic and Palaearctic ant
faunas are much better known than those
from other regions, the 18% Afro tropical
ant species is likely to be an underesti-
mate.

Progress with sampling of ants in Africa. —
Awareness about the threats to biodiver-
sity have increased funding for inventory-
based conservation research and as ants
are a favoured indicator taxon (Andersen
1997), there has been a consequent tre-
mendous recent growth in ant collections.
Intensive sampling projects in the Afro-
tropical region include: Mbalmayo Forest
Reserve in southern Cameroon (Watt et al.
1997); coastal and interior forest in Gabon
(Fisher, in prep.); Mkomazi Game Reserve
in Tanzania (Robertson 1999); Cape of
Good Hope, Robben Island, Brenton-On-
Sea, Fairfield Farm near Napier, Kogel-
berg Biosphere Reserve, and other sites in
the Cape fynbos, South Africa (Robertson
and co-workers, in prep.); Cape indige-
nous evergreen forests (Fisher, in prep.);
Mondi Estate in Kwazulu-Natal (Fisher, in
prep.); and widespread pitfall trapping by
E. Marais in Namibia. However, there are
still enormous gaps in our coverage.
Countries such as Angola, Mozambique,
Malawi, Zambia, Central African Repub-
lic, Ethiopia and Sudan have yet to be
sampled using modern inventory tech-
niques. Even the best sampled countries
such as South Africa and Zimbabwe re-
main patchily sampled and there is not
one country in the Afrotropical region
where ants have been sampled adequately
in all major vegetation regions.

Future strategies for collecting. — The best
approach to adequately sampling the ants

of a large area such as the Afrotropical re-
gion is through intensive inventory-based
sampling of particular localities by general
collecting and a combination of replicated
pitfall trapping, Winkler bag leaf litter ex-
tractions, beating or sweeping of vegeta-
tion, chemical knockdown of arboreal fau-
na and soil sampling. The use of replicable
sampling methods makes it possible to
statistically compare sites using tech-
niques described in Colwell & Codding-
ton (1994) and Chazdon et al. (1998) and
in this way to make scientifically based as-
sessments of alpha, beta and gamma di-
versity. Fisher (1996, 1998, 1999) has pio-
neered this approach in Madagascar al-
though only for leaf litter and ground fau-
na. Recent studies, still unpublished (e.g.
Fisher and Robertson in prep, for a site
near Ambositra in Madagascar), have
used a wider range of replicated sampling
techniques. Superficial general collecting
of many localities is of more limited value
than the inventory approach although it is
useful for providing distributional data.
As ants are dominant and ecologically im-
portant organisms in terrestrial ecosys-
tems, growth of collections will also con-
tinue due to the submission of specimens
by ecologists and agricultural researchers
for identification by ant systematists.

Inventory-based assessments of areas
for conservation using ants will ensure
continued funding of scientifically-based
ant collecting in the Afrotropical region,
provided there remains backup by ant
systematists. The areas to be sampled will
be largely dictated by the conservation
funding bodies and by the political stabil-
ity of the areas that need assessment. Not-
withstanding the political issues, the ne-
glected countries such as those listed
above, need attention. With this increased
ant collecting, the need for more taxonom-
ic work on ants will become all the more
apparent.

Current progress with Afrotropical ant tax-
onomy.— Based on relative proportion o\
species, we are about 39% of the way

^( «!»-"■

Volume 9, Number 1, 2000

through revision of the Afrotropical ant
genera to modern standards and to revise
the remaining genera would take one per-
son 21 years to complete at 'Bolton speed'.

On a world level, there are about 41
people currently working on the taxono-
my of ants. Although this seems a large
number, the productivity of most of these
taxonomists is much less than that of B.
Bolton and their work is often limited to
regional faunas. In addition, a number of
our key established 'global view' system-
atists have either recently retired or are
about to retire. We could end up with a
situation similar to that in termite taxon-
omy (Eggieton 1999) although we are like-
ly to remain stronger in terms of number
of systematists.

The low taxonomic productivity of most
ant systematists can be attributed largely
to their occupation with other endeavours:
ecological and biological research on their
study organisms, administration, contract
identification work, computer program-
ming, and teaching duties. Revising ant
genera at the rate that B. Bolton has
achieved is therefore rarely attained and
for most systematists one would need to
settle for a speed of revision at best half
or even quarter of Bolton's rate. However,
there is room for improvement and I feel
that ant systematists need to prioritise al-
pha taxonomy and not let it take a back
seat which seems to be increasingly the
case.

Unlike the situation in North America,
Europe, South America and Asia, there is
only one resident ant systematist in Africa
and hence progress with documenting Af-
rotropical ants will depend largely on the
involvement of outside 'global-view' sys-
tematists working on taxa that are repre-
sented in the Afrotropical region.

Strategies for advancing Afrotropical ant
taxonomy. — The two goals of a strategy to
improve ant taxonomy are firstly, to en-
sure that the number oi ant systematists
does not dwindle but remains stable or
grows and secondly, to improve the effec-

tiveness and productivity of current ant
systematists. Regarding the first aspect, it
is vital that the museums holding impor-
tant ant collections are committed to em-
ploying ant systematists. It is remarkable
that the most important ant collection in
the world at the Harvard Museum of
Comparative Zoology has no full-time ant
systematist committed to alpha taxonomy
and has a curator that can work only part-
time on this vital collection. The Natural
History Museum in London, with the sec-
ond largest ant collection in the world,
should continue its support of a position
in ant systematics once the present incum-
bent retires. The South African Museum
holds the largest ant collection in Africa
and should also remain committed to sup-
porting ant systematics, especially as it is
important to maintain an ant identification
service for applied entomologists in Afri-
ca.

Training is an important aspect of safe-
guarding the future body of ant systema-
tists because filling of positions in system-
atics is usually controlled more by the
quality of the candidate than by the group
he/she works on. Hence, the contribution
to training by ant systematists at univer-
sities is essential to the future growth of
ant systematics.

Regarding the second component in the
strategy, there are five ways in which the
effectiveness and productivity of current
ant systematists could be improved: (1) In
order to cope with the conflict between
projects geared to collection growth as op-
posed to taxonomic projects, we need to
make the latter a priority and plan time to
spend on them. For instance, university
lecturers often find it easiest to plan time
for taxonomic work over the King vaca-
tions. (2) Dedicated funding of ant taxo-
nomic revisions along the same lines as
the Australian Biological Resources fund-
ing for catalogues, in which money is al-
located in proportion to the size of the tax-
on, would be ideal for improving goal-set-
ting and productivity. In reality, this type

Journal of Hymenoptera Research

of funding is rare because a taxonomic re-
vision does not answer applied problems
directly. (3) A more realistic approach to
obtaining funding for ant taxonomy
would be to link it to more easily obtained
funding for applied field-based projects.
Funding from these projects can be used
for employing and training parataxono-
mists for time-consuming sorting, mount-
ing and curation of ants. Funding bodies
should commit themselves to permitting a
direct taxonomic component in the project
so that there are funds to employ people
to measure specimens and funds to visit
overseas ant collections to examine types.
Funding should also be built into these
projects for storage and curation of the
specimens. (4) There is a great need for
training of, and exchange of ideas be-
tween, established ant systematists, espe-
cially the large number residing outside
North America and Europe. Better com-
munication via e-mail would help, but the
funding of one or more training and plan-
ning meetings would be ideal. (5) As there
is still so much work to be done in revis-
ing all Afrotropical ant genera (at least 21
man-years), it is important to prioritise
groups for revision. In the Afrotropical re-
gion, the unrevised groups encountered
most frequently when identifying ants are
Pheidole, Crematogaster and Camponotus.
These groups also happen to be among
the most diverse of the unrevised genera
(Table 2) and are also among the most dif-
ficult taxonomically, either because of
worker polymorphism (Pheidole and Cam-
ponotus) or because of a paucity of external
morphological species-discriminating
characters (Crematogaster). Not surprising-
ly therefore, these groups have been
avoided and to get them done quickly it
would be best to develop a funded strat-
egy-
Ants are an economically and ecologi-
cally important group in terrestrial eco-
systems in the Afrotropical region and im-
proving their taxonomy would in turn im-
prove the networking of ecological, agri-

cultural and behavioural ant research. The
present study provides the information for
planning a funded strategy to document
the Afrotropical ant fauna. The challenge
is to create a synergy between the differ-
ent role players (systematists, ecologists,
funding bodies) so that individual efforts
are not swamped by the immensity of the
job at hand.

ACKNOWLEDGMENTS

I thank Brian Fisher for his comments on the man-
uscript and the following organisations and individ-
uals for helping with field work and processing of
samples: Royal Geographical Society, Tanzanian De-
partment of Wildlife, Simon van Noort, Tony Russell-
Smith, Daniel Mafunde, Omari Mohamed, Tandi
Russell, Dawn Larsen, Cape Peninsula National Park
(and prior to its formation, the management of the
Cape of Good Hope Nature Reserve) and Miemsie
Troskie.

LITERATURE CITED

Andersen, A. 1997. Ants as indicators of ecosystem
restoration following mining: a functional group
approach. Pp. 319-325 in P. Hale and D. Lamb
(eds) Conservation Outside Nature Reserves. Bris-
bane: University of Queensland.

Arnold, G. 1915-1924. A monograph of the Formici-
dae of South Africa. Annals of the South African
Museum 14: 1-766.

Arnold, G. 1926. A monograph of the Formicidae of
South Africa. Appendix. Annals of the South Af-
rican Museum 23: 191-295.

Belshaw, R. and B. Bolton 1994. A new myrmicine
ant genus from cocoa leaf litter in Ghana (Hy-
menoptera: Formicidae). journal of Natural Histo-
ry 28: 631-634.

Bolton, B. 1973a. The ant genus Poh/rhachis F. Smith
in the Ethiopian region (Hymenoptera: Formici-
dae). Bulletin of the British Museum (Natural His-
tory). Entomology 28: 283-369.

Bolton, B. 1973b. A remarkable new arboreal ant ge-
nus (Hym. Formicidae) from West Africa. Ento-
mologist's Monthly Magazine 108: 234-237.

Bolton, B. 1974a. A revision of the palaeotropical ar-
boreal ant genus Cataulacus F. Smith (Hymenop-
tera: Formicidae). Bulletin of the British Museum
(Natural History). Entomology 30: 1-105.

Bolton, B. 1974b. A revision of the ponerine ant genus
Plectroctena F. Smith (Hymenoptera: Formicidae).
Bulletin of the British Museum (Natural History).
Entomology 30: 309-338.

Bolton, B. 1975a. A revision of the ant genus l.epto-
gem/s Roger (Hymenoptera: Formicidae) in the
Ethiopian region with a review of the Malagasy

Volume 9, Number 1, 2000

species. Bulletin of the British Museum (Natural
History). Entomology 31: 235-305.

Bolton, B. 1975b. A revision of the African ponerine
ant genus Psalidomyrmex Andre (Hymenoptera:
Formicidae). Bulletin of the British Museum (Nat-
ural History). Entomology 32: 1-16.

Bolton, B. 1976. The ant tribe Tetramoriini (Hyme-
noptera: Formicidae). Constituent genera, review
of smaller genera and revision of Triglyphothrix
Forel. Bulletin of the British Museum (Natural His-
tory). Entomology 34: 281-379.

Bolton, B. 1980. The ant tribe Tetramoriini (Hyme-
noptera: Formicidae). The genus Tetramorium
Mayr in the Ethiopian zoogeographical region.
Bulletin of the British Museum (Natural History).
Entomology 40: 193-384.

Bolton, B. 1981a. A revision of the ant genera Mer-
anoplus F. Smith, Dicroaspis Emery and Calypto-
myrntex Emery (Hymenoptera: Formicidae) in
the Ethiopian zoogeographical region. Bulletin of
the British Museum (Natural History). Entomology
42: 43-81.

Bolton, B. 1981b. A revision of six minor genera of
Myrmicinae (Hymenoptera: Formicidae) in the
Ethiopian zoogeographical region. Bulletin of the
British Museum (Natural History). Entomology 43:
245-307.

Bolton, B. 1982. Afrotropical species of the myrmicine
ant genera Cardiocondyla, Leptothorax, Melissotar-
sus, Messor and Cataulacus (Formicidae). Bulletin
of the British Museum (Natural History). Entomol-
ogy 45: 307-370.

Bolton, B. 1983. The Afrotropical dacetine ants (For-
micidae). Bulletin of the British Museum (Natural
History). Entomology 46: 267-416.

Bolton, B. 1985. The ant genus Triglyphothrix Forel a
svnonvm of Tetramorium Mayr (Hymenoptera:
Formicidae). journal of Natural History 19: 243-
248.

Bolton, B. 1986. A taxonomic and biological review
of the tetramoriine ant genus Rhoptromyrmex
(Hymenoptera: Formicidae). Systematic Entomol-
ogy 11: 1-17.

Bolton, B. 1987. A review of the Solenopsis genus-
group and revision of Afrotropical Monomortum
Mayr (Hymenoptera: Formicidae). Bulletin of the
British Museum (Natural History). Entomology 54:
263-452.

Bolton, B. 1994. Identification Guide to the Ant Genera
of the World. Cambridge, Massachusetts: Harvard
University Press, 222 pp.

Bolton, B. 1995a. A taxonomic and zoogeographical
census of the extant ant taxa (Hymenoptera: For-
micidae). journal of Natural History 29: 1037-1056.

Bolton, B. 1495b. A New General Catalogue of the Ants
of the World. Cambridge, Massachusetts: Harvard
University Press, 504 pp.

Bolton, B. 1999. Ant genera of the tube Pacetonini

(Hymenoptera: Formicidae). journal of Natural
History 33: 1639-1689.

Bolton, B. and R. Belshaw 1993. Taxonomy and bi-
ology of the supposedly lestobiotic ant genus
Paedalgus (Hym.: Formicidae). Systematic Ento-
mology 18: 181-189.

Bolton, B.^ W. H. Gotwald Jr. and J. M. Leroux 1979
("1976"). A new West African ant of the genus
Plectroctena with ecological notes (Hymenoptera:
Formicidae). Annates de VUniversite Abidjan. Sene
E (Ecologie) 9: 371-381.

Bolton, B. and A. C. Marsh 1989. The Afrotropical
thermophilic ant genus Ocymyrmex (Hymenop-
tera: Formicidae). journal of Natural History 23:
1267-1308.

Brown, W. L. Jr. 1974a. Concoctio genus nov. Pilot Reg-
ister of Zoology Card No. 29.

Brown, W. L. Jr. 1974b. Concoctio concenta. Pilot Reg-
ister of Zoology Card No. 30.

Brown, W. L. Jr. 1974c. Dolioponera genus nov. Pilot
Register of Zoology Card No. 31.

Brown, W. L. Jr. 1974d. Dolioponera fustigera species
nov. Pilot Register of Zoology Card No. 32.

Brown, W. L. Jr. 1975. Contributions toward a reclas-
sification of the Formicidae. V. Ponerinae, tribes
Platythyreini, Cerapachvini, Cviindromvrmecini,
Acanthostichini, and Aenictogitini. Search. Agri-
culture (Ithaca, N. Y.) 5(1): 1-115.

Brown, W. L. Jr. 1976. Contributions toward a reclas-
sification of the Formicidae. Part VI. Ponerinae,
tribe Ponerini, subtribe Odontomachiti. Section

A. Introduction, subtribal characters. Genus
Odontomachus. Stadia Entomologica 19: 67-171.

Brown, W. L. Jr. 1978. Contributions toward a reclas-
sification of the Formicidae. Part VI. Ponerinae,
tribe Ponerini, subtribe Odontomachiti. Section

B. Genus Anochetus and bibliographv. Studia En-
tomologica 20: 549-638.

Brown, W. L. Jr., W. H. Gotwald Jr. and J. Levieux
1971 ("1970"). A new genus of ponerine ants
from West Africa (Hvmenoptera: Formicidae)
with ecological notes. Psyche (Cambridge) 77: 259-
275.

Chazdon, R. L., R. K. Colwell, J. S. Penslow and M.
R. Guariguata 1998. Statistical methods for esti-
mating spei ies richness of woodv regeneration in
primary and secondary rain forests of northeast-
ern Costa Rica. Pp. 285-309 in F. Pallmeier and
J. A. Comiskey (eds) Forest Biodiversity Research,
Monitoring and Modeling: Conceptual Background
and Old World Case Studies. Paris, France: Parthe-
non.

Collingwood, C. A. 1993. Description of the host ant
of Cossyphodinus bremeri Ferrer sp. nov. (Hyme-
noptera, Formicidae). Pp. 22t» 231 in 1 Ferrer and

C. A. Collingwood, New species oi Cossyphodinus
from Africa (Coleoptera, Tenebrionidae) and de-
scription of the host ant Messoi ferreri sp. nov.

Journal of Hymenoptera Research

(Hymenoptera, Formicidae). Entomofauna 14:

221-232.

Colwell, R. K. and J. A. Coddington 1994. Estimating
terrestrial biodiversity through extrapolation.
Philosophical Transactions of the Royal Society of
London. B. Biological Sciences 345: 101-118.

Eggleton, P. 1999. Termite species description rates
and the state of termite taxonomy. Insectes So-
ciaux 46: 1-5.

Fisher, B. L. 1996. Ant diversity patterns along an ele-
vational gradient in the Reserve Naturelle Inte-
grale d'Andringitra, Madagascar. Fieldiana: Zool-
ogy 85: 93-108.

Fisher, B. L. 1998. Ant diversity patterns along an ele-
vational gradient in the Reserve Speciale
d'Anjanaharibe-Sud and on the Western Masoala
Peninsula, Madagascar. Fieldiana: Zoology 90: 39-
67.

Fisher, B. L. 1999. Improving inventory efficiency: a
case study of leaf-litter ant diversity in Mada-
gascar. Ecological Applications 9: 714-731.

Gauld, I. and B. Bolton (Eds) 1988. The Hymenoptera.
Oxford: Oxford University Press, xii + 322 pp.

Hammond, P. M. 1995. Described and estimated spe-
cies numbers: an objective assessment of current
knowledge. Pp. 29-71 in D. Allsopp, R. R. Col-
well and D. L. Hawksworth (eds) Microbial Di-
versity and Ecosystem Function. Wallingford, UK:
CAB International.

Hodkinson, I. D. 1992. Global insect diversity revis-
ited, journal of Tropical Ecology 8: 505-508.

Hodkinson, I. D. and D. Casson 1991. A lesser pre-
dilection for bugs: Hemiptera (Insecta) diversity
in tropical rain forests. Biological journal of the Liu-
nean Society 43: 101-109.

Hodkinson, I. D. and E. Hodkinson 1993. Pondering
the imponderable: a probability-based approach
to estimating insect diversity from repeat faunal
samples. Ecological Entomology 18: 91-92.

Holldobler, B. and E. O. Wilson 1990. The Ants. Cam-
bridge, Massachusetts: Harvard University Press,
xii + 732 pp.

Kutter, H. 1976. Beitrag zur kenntnis der gattung Sim-
opone Forel. Mitteilungeu iter Schweizerischeu Eu-
tomologischen Gesellschaft 49: 273-276.

Kutter, H. 1977. Zweiter beitrag zur kenntnis der gat-
tung Simopone Forel. Mitteilungen der Schweizer-
ischen Entomologischen Gesellschaft 50: 173-176.

I'nns, A. | 1983. A new ant genus from southern Af-

rica (Hymenoptera, Formicidae). Annals of the
South African Museum 94: 1-11.

Robertson, H. G. 1990. Unravelling the Campouotus
fulvopilosus species complex (Hymenoptera: For-
micidae). Pp. 327-328 in G. K. Veeresh, B. Mallik
and C. A. Viraktamath (eds) Social Insects and the
Environment. Proceedings of the 11th International
Congress of ILISSI, 1990. New Delhi: Oxford &
IBH Publishing Co.

Robertson, H. G. 1999. Ants (Hymenoptera: Formici-
dae) of Mkomazi. Pp. 321-336 in M. Coe, N.
McWilliam, G. Stone and M. J. Packer (eds)
Mkomazi: the Ecology, Biodiversity and Conservation
of a Tanzanian Savanna. London: Royal Geograph-
ical Society (with the Institute of British Geog-
raphers).

Robertson, H. G. and C. Zachariades 1997. Revision
of the Campouotus fulvopilosus (De Geer) species-
group (Hymenoptera: Formicidae). African Ento-
mology 5: 1-18.

Shattuck, S. O. 1991. Revision of the dolichoderine ant
genus Axinidris (Hymenoptera: Formicidae). Sys-
tematic Entomology 16: 105-120.

Shattuck, S. O. 1999. Australian Ants: their Biology and
Identification. Collingwood, Victoria: CSIRO
Press, 226 pp.

Snelling, R. R. 1979a. Three new species of the Pa-
laeotropical arboreal ant genus Cataulacus (Hy-
menoptera: Formicidae). Contributions in Science
(Los Angeles) 315: 1-8.

Snelling, R. R. 1979b. Aphomomyrmex and a related
new genus of arboreal African ants (Hymenop-
tera: Formicidae). Contributions in Science (Los
Angeles) 316: 1-8.

Snelling, R. R. 1992. Two unusual new myrmicine
ants from Cameroon (Hymenoptera: Formici-
dae). Psyche (Cambridge) 99: 95-101.

Taylor, R. W. 1965. A monographic revision of the
rare tropicopolitan ant genus Probolomyrmex
Mayr (Hymenoptera: Formicidae). Transactions of
the Royal Entomological Society of London 117: 345-
365.

Ward, P. S., B. Bolton, S. O. Shattuck and W. L.
Brown, jr. 1996. A Bibliography of Ant Systematica.
Berkeley: University of California Press, 417pp.

Watt, A. dJ N. E. Stork, P. Eggleton, D. Srivastava,
B. Bolton, T. B. Larsen, M. J. D. Brendell and D.
E. Bignell 1997. Impact of forest loss and regen-
eration on insect abundance and diversity. Pp.
274-286 in A. D. Watt, N. E. Stork and M. D.
Hunter (eds) Forests and Insects. London: Chap-
man ^nd I lall.

J. HYM. RES.
Vol. 9(1), 2000, pp. 85-98

On the Identity of Pheidole vaslitii Pergande (Hymenoptera:
Formicidae), a Neglected Ant from Baja California

Philip S. Ward

Department of Entomology, University of California, Davis, California 95616, USA;
Fax: 530-752-1537; e-mail: psward@ucdavis.edu

Abstract. — The ant Pheidole vaslitii Pergande has remained a taxonomic enigma since its descrip-
tion over a hundred years ago from a series of workers collected in the Sierra San Lazaro, Baja
California Sur, Mexico. A reexamination of the apparent type series in the USNM collection reveals
that some of the specimens — including a major worker designated as "lectotype" by Creighton
(1958) — are not true types and are not conspecific with P. vaslitii. Selection of a new lectotype of
P. vaslitii secures its identity as a form closely related to P. hyatti. It differs from "typical" P. hyatti
by the presence of more extensive sculpture on the head of the major and minor workers and by
its shorter body appendages, but intermediate phenotypes occur in parts of Baja California and
California. Based on current evidence P. hyatti is reasonably interpreted as a single, polytypic
species, with both P. vaslitii and an infraspecific name — P. hyatti solitanea Wheeler, described
from Point Loma, California — as newly recognized junior synonyms.

In 1896 Pergande described a number of
new ant taxa from northwestern Mexico,
based on collections made by Eisen and
Vaslit during a California Academy of Sci-
ences expedition to the region (Pergande
1896). Most of the new ants were from Te-
pic in the state of Nayarit, but a few spe-
cies had been collected in the Cape Region
of Baja California. The taxonomic status of
most of these named forms has long since
been resolved, but one of the species from
Baja California — Pheidole vaslitii — has suf-
fered an ongoing identity crisis. Despite
pronouncements on P. imslitii by Forel
(1901), Wheeler (1914), and Creighton
(1958), its taxonomic status — whether it
represents a distinct species or is a junior
synonym — has never been satisfactorily
determined. Creighton (1958) actually
complicated the situation by designating
as the "lectotype" of P. vaslitii a major
worker that was not part of the series on
which Pergande's original description was
based. In preparing a checklist of the ants
of Baja California (Johnson and Ward, in
prep.) it became necessary to determine

the relationship of P. vaslitii to other
named taxa, and to deal with the conse-
quences of Creighton's (1958) actions. It
will be argued that Creighton's lectotype
designation was invalid and that it inap-
propriately tied the name "Pheidole vasli-
tii" to a mainland Mexican species not
found in Baja California. True P. z^aslitii
appears to be a geographical variant of the
widespread species Pheidole hyatti Emery.

MATERIALS AND METHODS

Specimens belonging to the original
type series of Pheidole vaslitii were exam-
ined from holdings of the California Acad-
emy of Sciences, San Francisco (CASC)
and the Smithsonian Institution, Washing-
ton, DC (USNM). Other relevant material
in the genus Pheidole was studied in those
two collections and in the following: Nat-
ural History Museum of Los Angeles
County (LACM), California Department
of Food and Agriculture, Sacramento
(CDAE), Bohart Museum of Entomology,
University of California at Davis (UCDC),
and Robert A. Johnson collection, Tempe,

Journal of Hymenoptera Research

Arizona (RAJC). Other collection abbrevi-
ations cited in the text are: AMNH (Amer-
ican Museum of Natural History, New
York), MCSN (Museo Civico di Storia Na-
turale, Genoa) and MCZC (Museum of
Comparative Zoology, Harvard Universi-

ty).

All measurements were taken at 50 X
using a Wild M5A microscope and a Ni-
kon stage micrometer, and are presented
here in millimeters to two decimal places.
The following measurements and indices
were used:

BSW

PrW

I III

SI
REL

Head width: maximum width of
the head, as seen in full-face (fron-
tal) view, excluding the eyes.
Head length: length of the head,
measured in full-face view, from
the anterior clypeal margin to the
midpoint of a line drawn across
the posterior margin.
Eye length: length of the eye, mea-
sured with the head in full-face
view.

Scape length: chord length of the
scape, from the base (excluding the
neck) to the apex; this measure-
ment was taken by positioning the
scape so that both ends lay in the
same focal plane.

Basal scape width: maximum mea-
surable width of the basal third of
the scape (measured in major
workers only).

Pronotum width: maximum width
of the pronotum, measured in dor-
sal view.

Length of the metatibia (hind tib-
ia): length of the metatibia mea-
sured in lateral view from the dis-
tal extremity to the proximal end,
excluding the medial lobe of the
articulation with the femur (see
Ward 1989, fig. 5).
Cephalic index: HW/HL
Scape index: SL/HW
Relative eye length: EL/HL

REL2 Relative eye length, using HW:

EL/HW
HTI Metatibial index: LHT/HW

The following index of pilosity was em-
ployed:

HTC Metatibial setal count: number of
standing hairs, i.e., those forming
an angle of 45° or more with the
cuticular surface (Wilson 1955),
visible in outline on the outer (ex-
tensor) surface of the metatibia.
This count was taken with the line
of view orthogonal to the plane of
tibial flexion.

TAXONOMIC HISTORY OF PHEIDOLE

VASLITII

Pergande (1896: 883) described Pheidole
vaslitii from specimens collected by Eisen
and Vaslit in the Sierra San Lazaro, Baja
California Sur, in September 1894. The
original series of twenty-two specimens
was said to comprise nine major workers
(or "soldiers") and thirteen minor workers
("workers"). In the same paper Pergande
described several other Pheidole taxa, in-
cluding one which he thought was related
to P. vaslitii and which he named Pheidole
obtusospinosa (Pergande 1896: 889). This
latter species was from Tepic, Nayarit,
however, and the description was based
on a large series ("many specimens") of
major workers only. Pheidole obtusospinosa
was synonymized with P. vaslitii by Forel
(1901: 430). Wheeler (1914) established,
however, that P. obtusospinosa was the
same as P. subdentata Pergande (1896), also
described from Tepic, but based on minor
workers only. By this time it was also clear
that, unlike most Pheidole species, the ma-
jor workers of P. subdentata are quite var-
iable in size. Wheeler treated P. subdentata
as a subspecies of P. vaslitii, a situation
that continued until 1958 when Creighton
assigned it species rank. Until recently this
species has gone by the name P. subdentata
Pergande, with P. obtusospinosa as a junior
synonym, but Bolton (1995) pointed out

tiiiLuitii

Volume 9, Number 1, 2000

that Pergande's subdentata is preoccupied
(it is a secondary junior homonym of Oec-
ophthora subdentata Mayr 1853). P. obtusos-
pinosa is the first available replacement
name for the species described from Tepic,
Nayarit.

In the meantime the problem of the
identity of Pheidole vaslitii was addressed
by Creighton (1958) who examined Per-
gande's type series in the USNM. He con-
cluded that type series comprised more
than one species, with most of the major
workers — and all of those that matched
Pergande's (1896) description of the P. vas-
litii major — being Pheidole cockerelli Wheel-
er (1908). The minor workers were said to
be a mix of Pheidole crassicornis tctra
Creighton (1950) and P. hyatti Emery
(1895). Concerned about the replacement
of P. cockerelli or P. crassicornis tetra by a
more obscure senior synonym, Creighton
chose as a lectotype of P. vaslitii a major
worker that did not correspond to Pergan-
de's (1896) original description. In fact, the
identity and labeling of the specimen des-
ignated as "lectotype" indicate that it was
not part of the original type series of P.
vaslitii (see below). Moreover, Creighton
(1958) admitted that he could not say
what species, if any, the "lectotype" rep-
resented, i.e., he could not determine
whether it belonged to any previously de-
scribed species of Pheidole, except that it
was not the species whose major worker
was described by Pergande (1896) as P.
vaslitii. This was the last action taken on
P. vaslitii whose identity has thus re-
mained in limbo for the last 40 years.

Other Pheidole names associated at var-
ious times with P. vaslitii are (1) P. hirtula
Forel (1899), originally described as a va-
riety of P. vaslitii, but later raised to spe-
cies by Creighton (1958); (2) P. arizonica
Santschi (1911), described as such, but
treated as a variety of P. vaslitii subdentata
by Wheeler (1914) and as a subspecies of
P. vaslitii by Creighton (1950), before being
synonymized under P. subdentata Pergan-
de (Creighton 1958); and (3) P. acolhua

Wheeler (1914), originally described as a
variety of P. vaslitii, but later synonymized
under P. hirtula (Creighton 1958).

REEXAMINATION OF THE TYPE
SERIES

Syntypes true and false

The solution to the Pheidole vaslitii prob-
lem lies in a careful analysis of the type
specimens. In the USNM there are 14 spec-
imens that appear, at first glance, to be
part of the original type series. These spec-
imens can be divided into two subsets (see
also Creighton 1958: 208).

Subset A comprises 11 specimens (4
major workers, 7 minor workers) each on
their own pin and bearing two sets of la-
bels (Fig. 1): (1) Pergande's handwritten
locality label "Sierra /San Lazaro/Cape re-
gion /L. Cal. Mex.", and (2) a printed label
"Collection/T Pergande". Two specimens
(one major and one minor worker) addi-
tionally bear a third, black-bordered label
with the following notation in Pergande's
hand: "Pheidole/ vaslitii/n. sp./Type
Perg.". On the label of the minor worker
"n. sp." is placed in parentheses. As
Creighton (1958) noted, the ink on the
handwritten labels has faded to brown
and the paper has yellowed. The major
workers and most of the minor workers
agree closely with Pergande's (1896) orig-
inal description of P. vaslitii.

Subset B consists of two major workers
and one minor worker whose labeling is
rather different (Fig. 2). The locality labels
are handwritten, evidently by Pergande,
in a black ink which has not, to this day,
faded, and the label paper has not yel-
lowed in color like that of subset A. The
locality for the two majors is given as "Si-
erra/S. Lazaro/Mex." and for the minor
"Tepic/Mex.". All three specimens bear a
red USNM type label as follows: "Type/
No. 4488/U.S.N.M.", with the number
handwritten and the remaining text print-
ed. One of the major workers also has a
third label in Pergande's writing: "Phei-

Journal of Hymenoptera Research

Collection
TPergancle

*")• fly.

»£

m .

Figs. 1-2. 1, Sample of labels from specimens in "subset A" of the apparent type series of Pheidole vaslitii.
The type label is from one of the major workers. See text for further details. 2, Sample of labels from specimens
in "subset B" of the apparent type series of P. vaslitii. The identification label is from one of the major workers.
All three specimens of "subset B" also bear a red USNM type label with the number "4488". See text for
further details.

dole/ vaslitii /Perg. Perg.". It is this speci-
men that Creighton (1958) designated as
the lectotype of P. vaslitii. None of these
three "type" specimens matches the orig-
inal description of P. vaslitii.

In discussing the different appearance
of the labels Creighton (1958: 209) sur-
mised that Pergande had rewritten those
of subset B when designating the speci-
mens as types: "Dr. Smith informs me that
Pergande noted in the type book of the
National Museum that he had marked
three specimens of vasliti as types. It
would appear that when he did so he al-
tered the locality labels of these three spec-
imens, probably because he realized that
the original labels were not holding up as
well as might have been wished".

Creighton (1958) did not mention — and
perhaps did not examine — the minor
worker from Tepic, but he freely admitted
that the two major workers were not part
of the series on which Pergande based his
description of P. vaslitii: "They may be
medias of a polymorphic species related to

subdentata or the majors of a dimorphic
one related to hyatti. But there is no doubt
about one thing: neither of them contrib-
uted anything to Pergande's description of
the major of vasliti" (Creighton 1958: 210).
As mentioned above, Creighton's choice
of a lectotype that did not correspond to
the species described by Pergande was
motivated by a desire to maintain nomen-
clatural stability: Creighton concluded
that the species represented in subset A
(i.e., the probable true syntypes of P. vas-
litii) included P. cockerelli and P. crassicor-
nis tetra and he did not want to see one of
these younger (and better known) names
relegated to synonymy.

Insofar as the designated specimen was
not a syntype of P. vaslitii, Creighton's
(1958) choice of lectotype is invalid (ICZN,
Article 74.2). Further evidence that his
"lectotype" was not part of the original
type series of P. iwslitii comes from con-
sideration of the identity of the three spec-
imens in subset B (Figs. 3-6): all three are
Pheidole obtusospinosa Pergande, a species

kBK

Volume 9, Number 1, 2000

3 *

«J 1 40

1 30

1 20

E 1.10

_i
(/)

1 00
0.90

hyatti Aobtusospinosa xvaslitn. subset A x "vaslitti" subset B

0 80

•

A A

a aA
A
A

A A

• • **

A* a * ♦

♦

• ♦ ♦ ♦

♦♦ X

. i ■ • i

1 00

1 20

1 40 1 60

HW(mm)

1 80

2 00

/[ ♦hyatti Aobtusospinosa xvaslitn. subset A x "vashtii" subset B

0 90

085 - „4 ♦**♦

0 80 -

5 0 75
in

0 70 -
0 65 -
0 60

0 50

#»♦«

♦♦♦ ♦

♦ ♦ ♦

AA ^A

*A A

060

070 080

PrW(mm)

0 90

1.00

♦ hyatti Aobtusospinosa xvaslitn. subset A x "vaslitu" subset B

w 1 40
1 30

1.20

- 1 10

i-
i
_i

1 00
090

0 80

A ^ A
AAA
X . A^
-A A*1

A F

a& A A

♦
•

♦ ♦ ♦

♦ ♦ ♦*> J ♦♦

• ♦

♦v

1 00

1 20

1 .40 1 60

HW(mm)

1 80

2 00

♦ hyatti Aobtusospinosa xvaslitn subset A x"vaslitn". subset B

0 60

0 50

0 60

0 70 0 80

PrW (mm)

0 90

1 00

Figs. 3-6. Bivariate plots of various measurements and indices in major workers of Pheidole obtusospinosa and
P. hyatti. Note that the P. vaslitii types from "subset A" fall within the values for P. hyatti, while those of
"subset B" correspond to P. obtusospinosa. The plots exclude "supermajors" of P, obtusospinosa (HW > 2.20).

which is widespread in adjacent mainland
Mexico but which is not known to occur
in Baja California. In the course of study-
ing the ant fauna of Baja California I have
examined many hundreds of specimens of
Pheidole in various collections (CASC,
CDAE, LACM, RAJC, UCDC, USNM).
None of the Baja specimens belonged to P.
obtusospinosa, although I encountered ex-
amples of this distinctive species from So-
nora, Sinaloa, Nayarit, Jalisco, and Arizo-
na. In fact, the two major workers of sub-
set B agree very closely with a series of
seventeen P. obtusopsinosa majors from Te-
pic, Nayarit (collected by Eisen and Vas-
lit), which had been placed under P. vas-
litii in the USNM collection. Given that
this arrangement of specimens was due to

Pergande, it indicates that he confused the
two species.

I conclude that Pergande's marking of
the three specimens in subset B as "types"
of P. vaslitii occurred after the original de-
scription of that species, and that it in-
volved the mislabeling of P. obtusospinosa
specimens collected at Tepic, Nayarit.
That Pergande was less than careful in
these matters is indicated by the fact that
in his original description of Pheidole gran-
ulata he cites the type locality as Tepic
(Pergande 1896: 891), although the type
specimens were actually from San Jose del
Cabo, Baja California Sur (Gregg 1969:
101). Removing the P. obtusospinosa speci-
mens from consideration as valid types of
P. vaslitii, we can refocus our attention on

Journal of Hymenoptera Research

subset A which, it seems clear, contains
the true syntypes.

A study of the USNM specimens in sub-
set A indicates that the following two spe-
cies are involved:

1. A Pheidole species conspecific with, or
closely related to, P. hyatti. This is rep-
resented by four major workers and
four minor workers. The majors were
misidentified by Creighton (1958) as P.
cockerelli, while he identified the minors
as P. hyatti. In the collection of the Cal-
ifornia Academy of Sciences (CASC)
there are two additional P. vaslitii syn-
types (one major worker, one minor)
that belong to this species. They both
bear faded labels "Sierra /San Lazaro"
and "Pergande/Type", in Pergande's
handwriting.

2. A second species of Pheidole, related to
P. crassicornis Emery, represented by
three minor workers. These were iden-
tified by Creighton (1958) as P. crassi-
cornis tetra.

Designation of a new lectotype

Given that subset A (in the USNM) and
the two CASC specimens are part of the
actual type series of P. vaslitii it is proper
that the lectotype be chosen from among
them. Of the two species present in the
type series, only one is represented by ma-
jor workers, so I have chosen as the lec-
totype of P. vaslitii one of the major work-
ers in the USNM series. This particular
specimen (with HW 1.32, HL 1.40, SL 0.98,
LHT 0.92) also bears the old faded "Phei-
dole/vaslitii/n. sp./Type Perg." label.
Formal lectotype designation is indicated
below under "Taxonomic summary".

The paralectotypes in USNM and CASC
are then as follows: (1) four major workers
(three in USNM, one in CASC) and five
minor workers (four in USNM, one in
CASC) conspecific with the lectotype, and
(2) three minor workers (in USNM) not
conspecific with the lectotype; these are
discussed further below in the section en-

titled "Identity of the second species in the
type series". Specifically excluded from the
paralectotype series are the three workers
of P. obtusospinosa (subset B).

With this action taken, the identity of P.
vaslitii becomes linked with the question
of the magnitude and nature of geograph-
ical variation in Pheidole hyatti, a species
widespread in the southwestern United
States and northern Mexico.

Relationship of Pheidole vaslitii to P.
hyatti

The major workers of P. vaslitii agree
well with P. hyatti majors from other parts
of Baja California and southwestern Unit-
ed States. They have the base of the scape
strongly bent and flattened (BSW/SL
0.12-0.14); the ventrolateral hypostomal
teeth are well developed and spine-like,
and displaced laterally about 0.8 times the
distance from the midline to the dorsolat-
eral hypostomal teeth; the posterior mar-
gin of the head is deeply impressed me-
dially, and this impression continues on
the dorsum of the head as a narrow, trans-
versely rugulose, median furrow which
changes to a broader smooth, shiny strip
above the frontal triangle; the mesonotum
is angular in lateral profile; the propodeal
spines are short, stout, and erect; the pet-
iolar node is narrowly transverse; and the
postpetiole is about 1.6 times broader than
long, with obtuse, blunt lateral angles (as
seen in dorsal view). Body sculpture is
like that of P. hyatti, with the mesosoma
largely foveolate and subopaque, the
sculpture weakening medially and on the
side of the pronotum; irregular transverse
carinulae occur on the anterior portion of
the pronotum. The head dimensions (HW
1.17-1.32, HL 1.25-1.40, CI 0.93-0.95), and
relative lengths of the scapes (SL/PrW
1.36-1.50) and legs (LHT/PrW 1.35-1.43)
fall within the values of P. hyatti and, in
the case of the last two indices, largely
outside those of P. cockerelli (see also Figs.
7-8). The body pilosity is relatively long
and fine-tipped, not blunt-tipped as in P.

Volume 9, Number I, 2000

1.15
1.10

1 05

£ 100

5J 095 |-
0.90
085 h

080

♦ hyatti ■ cockerelli x vaslitn types

«♦ ♦ ♦

°a

x><

052 056 0.60 0.64 0.68 0 72 0 76 0 80
PrW(mm)

078

♦ hyatti ■ cockerelli x vaslitil types

0 52 0 56 0.60

0.64 0 68
PrW(mm)

072 076 080

1 04

1.00

0.96

f 0.92

»j 0.88
084
080

076

♦ hyatti ■cockerelli x vaslitii types

♦
♦ ♦

♦ ♦

•

X
♦ x XX ■

♦ D

■
■

■

■
■

♦

■ ■

■

■ ♦

♦

■

1 . 1

0 32 0 36 0 40 0 44 0 48

PrW(mm)

052

0.56

060

♦ hyatti ■ cockerelli x vaslitn types

032

036

0 40 0 44

PrW(mm)

048

052

056

Figs. 7-10. Bivariate plots of various measurements and indices in major workers (Figs. 7-8) and minor
workers (Figs. 9-10) of Pheidole hyatti and P. cockerelli. The P. vaslitii types (subset A) lie closer to the cloud
of points representing P. hyatti.

cockerelli (compare Figs. 12 and 13), and
the tibiae are conspicuously hirsute (HTC
19-22, compared with HTC 1-17 in P.
cockerelli).

It may be that Creighton (1958) mistook
these P. vaslitii majors for P. cockerelli be-
cause the head sculpture is denser than is
typical for P. hyatti. Fine reticulate-foveo-
late sculpture extends to the posterolateral
corners of the head so that the occipital
lobes (normally shiny in P. hyatti) are
dulled. Rugoreticulum extends more than
half the distance from the upper margin
of the compound eye to the occipital lobes.
But the rugoreticulum is not as well de-
veloped as in the majors of P. cockerelli,
where it essentially covers the occipital
lobes. Differences between P. cockerelli and

P. vaslitii in pilosity, scape length, and leg
length are also evident, and with respect
to these characters the P. vaslitii types fall
within the orbit of P. hyatti (Figs. 7-8, 13-
14, 17-18).

The conspecific minor workers (4w in
USNM, lw in CASC) agree with P. hyatti
minors from other localities, although
they tend to exhibit more extensive fove-
olate sculpture on the head. This character
varies widely, however, and when consid-
ering P. hyatti minors from throughout the
range of this species one finds all degrees
of variation from an almost entirely
smooth, shiny head (except between the
compound eye and antennal insertions) to
one dulled by extensive foveolate sculp-
ture on all regions except medially. The P.

Journal of Hymenoptera Research

1.0 mm

-I

Figs. 11-18. Pheidole major workers, lateral views of the mesosoma (11 14) and anterior views ot the null tibia
(15-18). Pilosity shown in outline only. II, IS, /'. obtusospinosa (Tepic, Nayarit); 12, 16, /'. cockerelli (Yavapai
Co., Arizona); 13, 17, /'. hyatti (/'. vaslitii paralectorype from Sierra San Lazaro, BCS); 14, 18, /'. In/nlti (Riverside
Co., California).

Volume 9, Number 1, 2000

vaslitii workers lack the weak rugoreticu-
lum that typically occurs on the posterior
portions of the head in minors of P. cock-
erelli. The pilosity on these P. vaslitii minor
workers is also more slender and flexuous
than that of P. cockerelli. The tibial pilosity
is conspicuous (HTC 14-19), like that of P.
hyatti. Measurements and indices are well
within the limits of P. hyatti: HW 0.63-
0.66, CI 0.82-0.84, SI 1.44-1.49, SL/PrW
2.01-2.08, REL 0.23-0.24, HTI 1.19-1.22,
LHT 0.76-0.80, LHT/PrW 1.66-1.72 (n =
4 for the first six sets of values, because
one of the USNM specimens is headless)
(see also Figs. 9-10).

Thus, Pheidole vaslitii falls within the
range of variability that occurs in the
widespread species, P. hyatti. In addition
to denser head sculpture, the P. vaslitti
types also tend to have shorter scapes and
legs than P. hyatti from other regions (Figs.
3-10). The differences are not diagnostic,
however, and individuals intermediate in
morphology between P. vaslitii and more
"typical" P. hyatti occur widely, especially
on the Baja California peninsula and in
California. It is possible that there is more
than one biological species in this com-
plex, but I can find no consistent pheno-
typic discontinuities that would justify
recognition of more than one taxon. With-
out a more detailed (preferably genetic)
analysis of the situation, it seems advis-
able to treat P. hyatti as a single polytypic
species, with P. vaslitii as its junior syno-
nym. This is formally indicated below (un-
der "Taxonomic summary"), along with
the overdue synonymy of P. hyatti solita-
nea Wheeler under P. hyatti.

While it may be coincidental, it seems
worth noting that other Pheidole species in
Baja California show some evidence of
north-south clines in the intensity of head
sculpture. This is seen most strikingly in
Pheidole yaqui Creighton and Gregg: pop-
ulations of this species from California
and northern Baja California have the pos-
terior portion of the head of the major
worker largely smooth and shining, while

populations from farther south on the
peninsula show increasing development
of transverse rugulation on the posterior
margin of the head (Ward, pers. obs.).

Identity of the second species in the
type series

Three minor workers from the syntype
series of P. vaslitii belong to a distinctly
different species. The head is broader
(HW 0.66-0.68, CI 0.88-0.90), and the
scapes and legs are shorter (SI 1.18-1.21,
HTI 1.00-1.02). The head is sublucid, with
weak reticulate-foveolate sculpture over-
lain by irregular longitudinal carinulae;
the sculpture is less developed medially
where there are more extensive shiny in-
terspaces. The standing pilosity is short,
sparse and blunt, with about 7-9 standing
hairs visible in profile on the mesosoma
dorsum, and none on the extensor surface
of the tibiae.

Creighton (1958) identified these work-
ers as Pheidole crassicornis tetra Creighton.
He actually cited the author as W. M.
Wheeler (1908), but the name tetra did not
become available until 1950 when Creigh-
ton raised Wheeler's infrasubspecific
name to subspecies rank (Bolton 1995). In
the literature tetra has continued to be
treated as a subspecies of P. crassicornis.
Naves (1985) opined that it was a distinct
species, similar to P. dwersipilosa Wheeler
(1908), whereas Creighton (1950) empha-
sized the existence of intermediates and
considered all three names to refer to a
single species.

The three minor workers from Baja Cal-
ifornia evidently belong to what could be
called the P. erassieoniis complex. In com-
parison with minor workers from Arizona
and Texas, provisionally identified as P.
dwersipilosa and P. erassieoniis tetra respec-
tively, the Baja minors agree closely in
overall habitus, pilosity and body mea-
surements, but differ by having more con-
spicuous longitudinal carinulae on the
head, greater encroachment of reticulate-
foveolate sculpture on the center of the

Journal of Hymenoptera Research

pronotum, and slightly longer legs (LHT
0.66-0.70, HTI 1.00-1.02; compared with
LHT 0.53-0.62 and HTI 0.89-0.97 in the
Arizona and Texas material). With respect
to pilosity they are most similar to the Ar-
izona specimens, both having slightly
shorter hairs than the Texas workers. In
the Baja workers the length of the longest
seta on the petiole is 0.090-0.104 mm, on
the postpetiole 0.094-0.105 mm, and on
abdominal tergite IV 0.081-0.096 mm. In
the absence of any associated major work-
ers— and given continued uncertainty
about the relationship of crassicornis, tetra
and diversipilosa to one another — it does
not seem feasible to identify the minor
workers any further at this time.

TAXONOMIC SUMMARY

Pheidole hyatti Emery 1895

(Figs. 13, 14, 17, 18)

Pheidole hyatti Emery 1895. Syntype workers
(majors, minors), San Jacinto, California (E.
Hyatt) (AMNH, MCSN).

Pheidole vaslitii Pergande 1896. Syntype work-
ers, Sierra San Lazaro, Baja California Sur,
Mexico (Eisen & Vaslit) (CASC: 1 major
worker, 1 minor worker; USNM: 4 major
workers, 4 minor workers); one major work-
er in USNM here designated lectotype to
clarify application of the name P. vaslilli (see
previous discussion on page 90). Syn. nov.

Pheidole hyatti var. ecitonodora Wheeler 1908.
Syntype workers (majors, minors), Texas,
New Mexico, Colorado (AMNH, LACM,
MCZC). Synonymy by Creighton (1950: 180).

Pheidole hyatti subsp. solitanca Wheeler 1915.
Syntype workers (majors, minors), queens,
Point Loma, San Diego, California (W. M.
Wheeler; P. Leonard) (AMNH, MCZC). Syn.
nov. Synonymy previously listed in a report
by Snelling and George (1979: 104), not con-
sidered a formal publication by Bolton
(1995).

P. coekerelli; Creighton (1958), misidentification
of P. xmslitii syntypes (part)

Diagnosis, major worker. — Medium-sized
(HW 1.05-1.57; HL 1.14-1.63, LHT 0.81-
1 .09; n = 47); scape conspicuously flattened
and bent basal ly (BSW/SL 0.09-0.15), of

moderate length (SI 0.63-0.89, SL/PrW
1.28-1.79), not exceeding the posterior mar-
gin of the head when laid back against the
head; ventral hypostomal teeth well-devel-
oped, spine-like, much closer to the dor-
solateral hypostomal teeth than to the mid-
line; posterior margin of head with deep
median impression; eyes of moderate size,
REL 0.15-0.19; pronotal humeri not prom-
inent; mesonotum distinctly angular in
profile; propodeal spines short, stout and
directed posterodorsally; postpetiole with
blunt, obtuse lateral angles (dorsal view);
legs relatively long, HTI 0.64-0.81, LHT/
PrW 1.30-1.66. Anterolateral regions of
head with rugoreticulate and reticulate-fo-
veolate sculpture which variably invades
the medial and posterior portions of head
(a smooth, shiny area generally persists in
the medial impression above the frontal tri-
angle); posterior margin of head finely
sculptured or smooth, lacking conspicuous
rugoreticulum; mesosoma mostly foveolate
and (sub)opaque, becoming sublucid on
the side of the pronotum and on the pron-
otal dorsum, where there are usually trans-
verse carinulae. Body pilosity abundant,
long, slender, fine-tipped; conspicuous on
the tibiae (HTC 15-27). Color variable,
from light orange-brown to dark reddish-
brown, gaster often darker than the rest of
body.

Comments. — P. hyatti is found from Tex-
as, Oklahoma and Colorado west to Ne-
vada and California and south into north-
ern Mexico (Kempf 1972; Smith 1979). As
befits its wide distribution, the species oc-
cupies a broad range of habitats including
Chihuahuan, Sonoran and Great Basin de-
serts, short-grass prairie, piny on-juni per
woodland, oak woodland, riparian wood-
land, chaparral, and coastal sage scrub
(Droual 1983; Gregg 1963; Snelling and
George 1979; Suarez et ai 1998; Wheeler
and Wheeler 1973, 1986). With respect to
foraging behavior, P. hyatti appears to be a
generalist omnivore rather than a seed-har-
vesting specialist (Wheeler 1908; Snelling
and George 1979). Colonies of P. hyatti are

Volume 9, Number 1, 2000

frequently subject to raids of the army ant,
Neivumyrmex nigrescens (Droual and Topoff
1981; Mirenda et al. 1980; Ward 1999).

Pheidole obtusospinosa Pergande 1896

(Figs. 11, 15)

Pheidole obtusospinosa Pergande 1896. Syntype
workers (majors), Tepic, Nayarit (Eisen &
Vaslit) (LACM, USNM).

Pheidole subdentata Pergande 1896. Syntype
workers (minors), Tepic, Nayarit (Eisen &
Vaslit) (LACM, USNM). Note: Wheeler
(1914) synonymized P. obtusospinosa under P.
subdentata, but Pergande's P. subdentata is
preoccupied (Bolton 1995), so P. obtusospinosa
is the first available replacement name.

Pheidole vaslitii; Creighton (1958), misidentifi-
cation and invalid "lectotype" designation.

Diagnosis, major worker. — Large species,
variable in size (HW 1.36-2.90, HL 1.39-
2.55, LHT 1.13-1.50; n = 28); in medium-
sized workers (HW < 2.20) scape relative-
ly long (SI 0.63-0.88, SL/PrW 1.32-1.66)
and bent basally but usually not conspic-
uously broadened (BSW/SL 0.07-0.10); in
supermajors (HW > 2.20) scape relatively
short (SI 0.44-0.48, SL/PrW 1.00-1.13) and
basal portion notably broadened (BSW/SL
~ 0.14); ventral hypostomal teeth present,
generally spine-like, much closer to the
dorsolateral hypostomal teeth than to the
midline; posterior margin of head with
shallow, obtuse V-shaped impression, be-
coming more deeply notched in super-
majors (HW > 2.20); eyes relatively small,
REL 0.11-0.16; pronotal humeri not
strongly protuberant; mesonotum bluntly
angular in profile; propodeal spines short,
stout and directed posterodorsally; post-
petiole with blunt, obtuse lateral angles
(dorsal view), more prominent in super-
majors; legs long, HTI 0.52-0.86, LHT/
PrW 1.19-1.62 (in all but supermajors HTI
0.69-0.86, LHT /PrW 1.45-1.62). Upper
surface of mandibles smooth and shiny,
except for weak basal striae. Dorsum of
head largely covered with rugoreticulate
and reticulate-foveolate sculpture, densest
(and the longitudinal orientation of the ru-

gulae least evident) in supermajors; me-
sosoma mostly foveolate and (sub)opaque,
becoming sublucid on the side of the
pronotum and on the pronotal dorsum,
where there are transverse carinulae. Body
pilosity very abundant, shorter and more
blunt-tipped than in P. hyatti, conspicuous
on the tibiae (HTC 25-36). Color varying
from orange-brown to dark reddish-
brown, the gaster sometimes darker than
the rest of the body.

Comments. — P. obtusospinosa is known
from Arizona, Sonora, Sinaloa, Nayarit
and Jalisco. Creighton (1958) recorded the
species, under the name P. subdentata,
from "elevations up to 6300 feet in many
of the mountains of southern Arizona"
and noted that "while the number of sub-
dentata nests in an area is often quite large,
this species never seems to exclude other
ants from such areas". In Arizona I have
encountered P. obtusospinosa in oak-pine-
juniper woodland and oak-juniper wood-
land, at elevations ranging from 1670m to
2100m. Colonies were found nesting un-
der stones, and workers (including sol-
diers) foraged nocturnally on the ground,
and came to tuna fish baits. Groups of mi-
nor and major workers were also seen,
without brood, under a rotting log and in
a dead branch of Quercus grisea. There are
recent records of P. obtusospinosa workers
(mostly minors) visiting extrafloral nectar-
ies of Ferocactus, Opuntia and Pachycereus
at several sites near Punta Chueca, Sonora
(leg. Kevin Walker).

Pheidole sp. (crassicornis complex)

Pheidole vaslitii Pergande 1896 (part); 3 minor
workers, Sierra San Lazaro, Baja California
Sur, Mexico (Eisen & Vaslit) (USNM); not
conspecific with the above newly-designated
lectotype of P. vaslitii.

Pheidole crassicornis tetra; Creighton (1958).

Comments. — The identity of the three
minor workers is discussed above. Based
on material from southern United States
the major workers of this complex may be
recognized by the following features (1)

96 Journal of Hymenoptera Research

ventrolateral hypostomal teeth well devel- PrW < 1.16, (4) legs very short, HTI <

oped, spine-like, displaced laterally about 0.62, LHT/PrW < 1.18, (5) standing pilos-

0.75 times the distance from the midline ity blunt-tipped, sparse on appendages,

to the dorsolateral teeth, (2) base of scape HTC < 10, (6) posterior third of head

flattened and broadened (BSW/SL largely smooth and shining, lacking retic-

0.14), (3) scapes very short, SI < 0.60, SL/ ulate-foveolate sculpture.

KEY TO SPECIES ASSOCIATED WITH THE NAME PHEIDOLE VASUTII

The following key is not intended to be comprehensive. It is concerned only with those Pheidole
species that have been confused with Pheidole vaslitii, and is presented as a summary of the
differences between them. Most of these species belong to the P. fallax group, as defined by E. O.
Wilson in his forthcoming monograph on the New World Pheidole (Wilson, in prep.). Wilson
recognizes a separate P. crassicornis group that seems likely to be nested phylogenetically within
the P. fallax group, insofar as it possesses the basic features of the latter group but manifested as
more derived states. The term "P. crassicornis complex", as used below, refers to three taxa in the
P. crassicornis group (P. crassicornis, P. crassicornis tetra, and P. diversipilosa) whose relationships to
one another need further clarification.

Pheidole obtusospinosa and P. hirtula are very closely related. The distinctions cited in the key to
majors are taken from Creighton (1958), and are admittedly slight. Future study may well show
that these two taxa are simply geographical variants of a single species. I have been unable to
find diagnostic differences between the minor workers of P. obtusospinosa and P. hirtula.

Major workers

1 Legs relatively long, LHT 1.11-1.50, and eyes small (EL/LHT 0.16-0.21); major workers
variable in size (HW 1.31-3.07), and "supermajors" (HW > 2.20) occur; body pilosity
conspicuous, relatively short and dense (Figs. 11, 15), HTC 25^8 2

T Legs shorter, LHT < 1.10, and eyes relatively large (EL/LHT 0.22-0.29); major workers
less variable in size (HW 1.05-1.57), supermajors lacking; body pilosity variable (Figs. 12-
14, 16-18). generally less abundant, HTC 0-27 3

2 In largest individuals (HW > 2.50) head strongly cordate, conspicuously narrowed to-
wards the mandibular insertions (Creighton 1958, fig. 1); rugulate sculpture tending to be
less developed on posterior half of head, which may be sublucid (northeastern Mexico,
west to Chihuahua, Durango and Jalisco) hirtula Forel

2' In largest individuals (HW > 2.50), head less strongly cordate, less strikingly narrowed
anteriorly (Creighton 1958, fig. 2); posterior half of head with rugulate and reticulate-
foveolate sculpture tending to be more strongly developed (Arizona, Sonora, Sinaloa, Nay-
arit, Jalisco) obtusospinosa Pergande

3 Scapes and legs very short, SL/PrW < 1.16, LHT/PrW < 1.18; standing pilosity sparse,
HTC < 10 (southern United States, northern Mexico) crassicornis complex

3' Scapes and legs longer, SL/PrW 1.21-1.79, LHT/PrW 1.23-1.66; pilosity variable 4

4 Pilosity long, fine-tipped, and abundant (Figs. 13-14, 17-18), HTC 15-27; occipital lobes
varying from smooth and shiny to reticulate-foveolate and opaque, but lacking conspic-
uous rugoreticulum; scapes and legs longer, SL/PrW 1.28-1.79, LHT/PrW 1.30-1.66 (n

47) (see also Figs. 7-8), (southwestern United States, northern Mexico) hyatti Emery

4' Pilosity shorter, blunt-tipped and less dense (Figs. 12, 16), HTC 1-17; occipital lobes ru-
goreticulate and subopaque; appendages shorter, on average; SL/PrW 1.21-1.33, LHT/

Volume 9, Number 1, 2000

PrW 1.23-1.36 (n = 13) (see also Figs. 7-8) (southwestern United States, northern Mexico)
cockerelli Wheeler

Minor workers

1 Legs long, LHT 0.85-0.95, and eyes small (EL/LHT 0.19-0.23); body pilosity abundant and
moderately long, HTC 14-28 hirtula Forel and obtusospinosa Pergande

V Legs shorter, LHT 0.52-0.85, and eyes relatively large (EL/LHT 0.22-0.29); body pilosity
variable, often less abundant, HTC 0-24 3

2 Scapes and legs very short, SI 1.11-1.22, HTI 0.89-1.02 (n = 11); eyes smaller, REL2 0.23-
0.27; pilosity sparse and short, HTC 0-7 crassicornis complex

2' Scapes and legs longer, SI 1.24-1.71, HTI 1.07-1.38 (n = 41); eyes larger, REL2 0.27-0.34;
pilosity longer and more abundant, HTC 7-24 3

3 Pilosity on body and appendages long, fine-tipped, and abundant, HTC 11-24; upper third
of head smooth and shiny or partially invaded by foveolate sculpture and subopaque, but
lacking rugulae; head more elongate (CI 0.77-0.85), scapes and legs longer, SL/PrW 1.95-
2.50, LHT/PrW 1.64-2.01 (n = 28) hyatti Emery

3' Pilosity less common, blunt-tipped, HTC 7-18; upper third of head largely opaque, covered
with foveolate sculpture and overlain by weak rugoreticulum or longitudinal rugulation;
head broader (CI 0.82-0.90) and appendages shorter, on average, SL/PrW 1.74-1.99, LHT/
PrW 1.49-1.67 (n = 13) cockerelli Wheeler

CONCLUDING REMARKS

The "Plieidole vaslitii problem" exempli-
fies two difficulties that have often arisen
in ant taxonomy: insufficient access to, or
analysis of, type specimens on the one
hand, and yet (paradoxically) a subtle ty-
pological bias on the other hand, which
has- sometimes led investigators to over-
rate the significance of differences among
populations of the same species. It is iron-
ical that Creighton's (1958) dubious choice
for the lectotype of P. vaslitii would not
have occurred if he had recognized the
major workers in the type series as vari-
ants of the older-named Plieidole In/atti, in
which the "typically" smooth shiny occip-
ital lobes had become clouded by sculp-
ture. To be fair, it could be argued that
Creighton did not possess a sufficiently
large and geographically extensive series
of specimens of P. In/atti, especially from
Baja California. From the vantage point of
the more extensive data now available
Plieidole In/atti appears to be a classic ex-
ample of a polytypic species (Mayr 1982),

i.e., one that consists of a series of geo-
graphically dispersed and morphological-
ly disparate populations, linked together
by intermediate populations and showing
evidence of recent or ongoing gene flow.
At the same time, the possibility cannot be
excluded that one or more cryptic species
lurks within this complex of populations,
especially in view of the broad range of
habitats occupied.

ACKNOWLEDGMENTS

I thank the following curators for facilitating the
study of museum specimens: Wojciech Pulawski
(CASC), John Sorensen (CDAE), Roy Snelling
(I. ACM), and Ted Schultz (USNM). Additional useful
material from Baja California and adjacent regions
was provided by Rolf Aalbu. April Boulton, led
Case, Mark Trepanier, Andy Snare/, Kevin Walker
and, especially, Robert fohnson. I am grateful to Sean
Brady, Robert fohnson, |ohn I attke, Eric Grissell and
anonymous reviewer tor comments on the manu-
script, and to Ed Wilson for making available parts
of his forthcoming revision of Pheidole. Support ol the
University of California and the National Science
Foundation is appreciatively acknowledged

Journal of Hymenoptera Research

LITERATURE CITED

Bolton, B. 1995. A new general catalogue of the ants of
the world. Cambridge, Mass.: Harvard University
Press, 504 pp.

Creighton, W. S. 1950. The ants of North America.
Bulletin of the Museum of Comparative Zoology 104:
1-585.

Creighton, W. S. 1958 ("1957"). A revisionary study
of Pheidole vasliti Pergande (Hymenoptera: For-
micidae). Journal of the New York Entomological So-
ciety 65: 203-212.

Droual, R. 1983. The organization of nest evacuation
in Pheidole desertorum Wheeler and P. hyatti Em-
ery (Hymenoptera: Formicidae). Behavioral Ecol-
ogy and Sociobiology 12: 203-208.

Droual, R. and H. Topoff. 1981. The emigration be-
havior of two species of the genus Pheidole (For-
micidae: Myrmicinae). Psyche (Cambridge) 88:
135-150.

Emery, C. 1895. Beitrage zur Kenntniss der norda-
merikanischen Ameisenfauna. (Schluss). Zoolo-
gische Jahrbiicher. Ahteilung fur Systematik, Geogra-
phic und Biologic der Tierc 8: 257-360.

Forel, A. 1899. Formicidae. [part]. Biologia Centrali-
Americana. Hymenoptera 3: 57-80.

Forel, A. 1901. I. Fourmis mexicaines recoltees par M.
le professeur W.-M. Wheeler. II. A propos de la
classification des fourmis. Annates de la Socictc
Entomologiquc de Belgique 45: 123-141.

Gregg, R. E. 1963. The ants of Colorado, with reference
to their ecology, taxonomy, and geographic distribu-
tion. Boulder: University of Colorado Press, xvi
+ 792 pp.

Gregg, R. E. 1969. New species of Pheidole from Pa-
cific Coast islands (Hymenoptera: Formicidae).
Entomological News 80: 93-101.

Kempf, W. W. 1972. Catalogo abreviado das formigas
da regiao Neotropical. Studia Entomologica 15: 3-
344.

Mayr, E. 1982. The growth of biological thought. Diver-
sity, evolution and inheritance. Cambridge, Mass.:
Harvard University Press, xii 4- 974 pp.

Mayr, G. 1853. Einige neue Ameisen. Verhaudlungen
der Zoologisch-Botanischen Vereins in Wien 2: 143-
150.

Mirenda, J. T., D. G. Eakins, K. Gravelle and H. To-
poff. 1C)<S(). I'redatorv behavior and prey selection
by army ants in a desert-grassland habitat. Be-
havioral Ecology and Sociobiology 7: 119-127.

Naves, M. A. 1985. A monograph of the genus Phei

dole in Florida, USA (Hymenoptera: Formicidae).
Insecta Mundi 1: 53-90.

Pergande, T. 1896. Mexican Formicidae. Proceedings of
the California Academy of Sciences (2)5: 858-896.

Santschi, F. 1911 ("1909"). Formicides recoltes par Mr.
le Prof. F. Silvestri aux Etats Unis en 1908. Bullet-
tiuo della Societa Entomologica Italiana 41: 3-7.

Smith, D. R. 1979. Superfamily Formicoidea. Pp.
1323-1467 in: Krombein, K. V., Hurd, P. D.,
Smith, D. R., Burks, B. D. (eds.) Catalog of Hy-
menoptera in America north of Mexico. Volume 2.
Apocrita (Aculeata). Washington, D.C.: Smith-
sonian Institution Press, pp. i-xvi, 1199-2209.

Snelling, R. R. and C. D. George. 1979. The taxonomy,
distribution and ecolog]/ of California desert a)its. Re-
port to California Desert Plan Program, Bureau
of Land Management, U.S. Dept. Interior. 335 +
89 pp.

Suarez, A. V., D. T. Bolger and T. J. Case. 1998. Effects
of fragmentation and invasion on native ant
communities in coastal southern California. Ecol-
ogy 79: 2041-2056.

Ward, P. S. 1989. Systematic studies on pseudomyr-
mecine ants: revision of the Pseudomyrmex ocu-
latus and P. subtilissimus species groups, with
taxonomic comments on other species. Quaes-
tiones Entomologicae 25: 393-468.

Ward, P. S. 1999. Deceptive similarity in army ants
of the genus Neivamyrmcx (Hymenoptera: For-
micidae): taxonomy, distribution and biology of
N. californicus (Mayr) and N. nigrescens (Cresson).
Journal of Hymenoptera Research 8: 74-97.

Wheeler, G. C. and J. Wheeler. 1973. Ants of Deep Can-
yon. Riverside, Calif.: University of California,
xiii + 162 pp.

Wheeler, G. C. and J. Wheeler. 1986. The ants of Ne-
vada. Los Angeles: Natural History Museum of
Los Angeles County, vii + 138 pp.

Wheeler, W. M. 1908. The ants of Texas, New Mexico
and Arizona. (Part I.) Bulletin of the American Mu-
seum of Natural History 24: 399^485.

Wheeler, W. M. 1914. Ants collected by W. M. Mann
in the state of Hidalgo, Mexico, journal of the New
York Entomological Society 22: 37-61.

Wheeler, W. M. 1915. Some additions to the North
American ant-fauna. Bulletin of the American Mu-
seum of Natural History 34: 389-421.

Wilson, E. O. 1955. A monographic revision of the
ant genus Lasius. Bulletin of the Museum of Com
parative /.oology 113: 1—201 .

ttttlAu,

■ t -. f t \\ I

J. HYM. RES.
Vol. 9(1), 2000, pp. 99-103

Bassus macadamiae sp. n. (Hymenoptera: Braconidae: Agathidinae),

Parasitoid of Ecdytolopha torticomis and E. aurantianum
(Lepidoptera: Tortricidae) in Macadamia Nut Crops in Central and

South America

Rosa A. Briceno G. and Michael J. Sharkey

(RABG) Museo Entomologico "Jose Manuel Osorio", Departamento de Entomologia, Decanato

de Agronomia, Universidad Centroccidental "Lisandro Alvarado", Apdo. 400,Tarabana, Lara,

Venezuela; (MJS) Department of Entomology, University of Kentucky,

Lexington, Kentucky 40546-0091, USA

Abstract. — Bassus macadamiae Briceno and Sharkey, sp. n. is described and illustrated. Spec-
imens of B. macadamiae are solitary internal parasitoids of larvae of the tortricid moth Ecdytolopha
torticomis (Meyrick) and E. aurantianum (Lima), insect pests of macadamia crops, Macadamia in-
tegrifolia Maiden & Botche, in Central and South America.

Ecdytolopha torticomis (Meyrick) and £.
aurantianum (Lima) (Lepidoptera: Tortri-
cidae) are pests of the macadamia nut, Ma-
cadamia integrifolia Maiden & Botche (Fam.
Proteaceae), in Central and South America
(Arizaleta and Diaz 1995, Badilla 1996).
Lara (1987) reviewed the economic impor-
tance of Ecdytolopha torticomis in Costa
Rica, and reported damage of 16%. Blanco
et al. (1993) reported infestation rates in
Costa Rica of 12-39% for hulls, and 1-7%
for nuts. In Venezuela, Arizaleta et al.,
(1997) reported E. aurantianum as the main
pest attacking macadamia crops, but no
studies have been conducted to ascertain
damage levels.

Larvae of Ecdytolopha torticomis and E.
aurantianum feed mainly in the mesocarp
and endocarp of the nuts. Blanco et al.
(1993) reported three braconid wasps par-
asitizing larvae of E. torticomis in Costa
Rica, i.e., two Apanteles spp. and one As-
cogaster sp. Specimens of an undescribed
species of Bassus have been reared from
larvae of E. torticomis and £. aurantianum,
attacking young nuts of macadamia in
Costa Rica and Venezuela (Arizaleta and

Diaz 1995, as Agathis sp.) and due to its
economic importance we feel that a formal
name for the parasitoid is useful.

MATERIALS AND METHODS

The terminology for wing venation fol-
lows Sharkey and Wharton (1997). Other
terminology follows Chou and Sharkey
(1989). Abbreviations for insect collections
are as follows:

UCOB: Museo Entomologico "Jose Ma-
nuel Osorio" at the Universidad
Centroccidental "Lisandro Alva-
rado" in Barquisimeto, Venezue-
la.

UCR: Insect Collection of the Universi-
dad de Costa Rica, San Jose, Costa
Rica.

MIZA: Museo del Instituto de Zoologia
Agricola "Francisco Fernandez
Yepez", Universidad Central de
Venezuela, Maracay, Venezuela.

UK: Insect Collection of the Depart-
ment of Entomology, University
of Kentucky, Lexington, Ken-
tucky, USA.

100

Journal of Hymenoptera Research

Figs. 1-3. Bassus macadamiae: 1, head frontal view; 2, head lateral view; 3, head dorsal view.

Bassus macadamiae Briceno & Sharkey
sp. n.

(Figs. 1-10)

Holotype female. — (numbers in parenthe-
sis refer to ranges found in the 14 speci-
mens comprising the type series). Length:
Body 5.6 mm (4.4-6.8), antenna 4.7 mm
(3.9-5.7), forewing 5.1 mm (4.1-5.8), ovi-
positor sheath 5.0 mm (4.0-5.5). Head
(Figs. 1-3): Vertex sparsely minutely
punctate; distance between lateral ocelli
0.5 (0.46-0.60) times ocello-ocular distance

Fig. 4. Bassus macadamiae: wings.

and 1.2 (1.0-1.5) times diameter of median
ocellus; frons sparsely minutely punctate;
frontal depression moderately deep; an-
tenna with 35 (34-36) flagellomeres; scape
1.3 (1.1-1.5) times as long as wide; face 1.5
(1.4-1.6) times as wide as eye height and
0.6 (0.56-0.6) times as wide as head; face
and clypeus sparsely minutely punctate;
face 0.85 (0.7-0.9) times as high as wide;
tentorio-ocular line 0.93 (0.63-0.93) times
inter-tentorial line; malar space 2.7 (2.2-
3.0) times basal width of mandible and
0.62 (0.48-0.68) times eye height; temple,
in dorsal view, evenly curved; ridge be-
tween antenna absent; gena rounded pos-
teroventrally. Mesosoma (Figs. 4-8): Pron-
otum sparsely minutely punctate; notau-
lus complete and smooth; scutellar furrow
smooth, without carinae; scutellum weak-
ly punctate, without apical carina; poste-
rior semicircular depression of scutellum
present; posterior surface of scutellum
punctate; propleuron without distinct
bump; mesopleuron mostly smooth,

Volume 9, Number 1, 2000

101

Figs. 5-10. Bassus macadamiae: 5, dorsal view of mesosoma; 6, lateral view of mesosoma; 7, propodeum; 8,
tarsal claw; 9, dorsal view of first metasomal tergum; 10, dorsal view of second and third metasomal terga.

weakly punctate on margins, with poste-
rior margin carinate; sternaulus distinct,
with deep posterior depression; metapleu-
ron sparsely minutely punctate, rugulose
ventrally; propodeum carinate with two
distinct median longitudinal carinae and
two distinct lateral longitudinal carinae;
anterior median areola and posterior me-
dian areola present; anterior transverse ca-
rina present; propodeal pseudosternite
with strong transverse ridge; hind coxal

cavity separated from metasomal foramen
by wide and well developed sclerite; fore-
wing 3.1 (3.0-3.6) times as long as wide;
vein lcu-a of forewing postfurcal; 2nd
submarginal cell of forewing (IRS) trian-
gular and petiolate, i.e., 2RS and r-m veins
fused anteriorly; RS of forewing almost
straight; midtibia with 7 (7-9) spines; me-
dial midtibial spur 0.44 (0.36-0.55) times
length of basitarsomere; hind femur 3.1
(2.6-3.2) times longer than wide; medial

102

Journal of Hymenoptera Research

hind tibial spur 0.43 (0.36-0.47) times as
long as basitarsomere; tarsal claws simple
with a right-angled basal lobe. Metasoma
(Figs. 9-10): First median tergite costate,
0.91 (0.81-0.92) times as long as wide api-
cally; second median tergite costate 0.4
(0.27-0.4) times as long as wide, with
semicircular transverse groove; third me-
dian tergite costate, 0.29 (0.23-0.3) times as
long as wide, with semicircular transverse
groove; ovipositor sheath 1.05 (0.8-1.2)
times as long as forewing. Color: Mostly
reddish orange. Head, including antenna,
dark brown; clypeus and mouthparts light
brown; maxillary and labial palpi yellow;
pronotum and mesonotum dark brown;
metanotum, propodeum and metasoma
red to orange; fore and hind tarsus yellow,
remainder dark brown; hind coxa red to
orange, remainder dark brown; wings hy-
aline with weak infuscation; stigma and
veins dark brown; ovipositor sheath me-
lanic.

Male. — Essentially as in female.

Diagnosis. — Members of the new species
may be distinguished from all other New
World species of Bassus by the following
combination of characters: first three me-
tasomal medial tergites costate; propodeal
pseudosternite with a strong transverse
carina; hind tibia with 14-18 spines; ovi-
positor sheath about as long as the fore-
wing.

Material examined. — Holotype female:
VENEZUELA, Villanueva, Lara; 1200m;
VII-1993 (F. Diaz) (UCOB). Paratopes:
COSTA RICA: 1 Female, 1 male, Limon,
Siquirres, 03-VI-1995 (UCR). 3 females,
Turrialba, Cartago, 650 m, 29-VI-1996
(UCR). VENEZUELA, Lara: 3 females, Vil-
lanueva, 1200m, VII-1993 (F. Diaz)
(UCOB) (MIZA). 1 male, Villanueva, 1200
m, III-1993, (F. Diaz) (UCOB). 1 Female, 2
males, Villanueva, 1200 m, 02-11-1995, (F.
Diaz) (UCOB) (UK). 1 Female, Villanueva,
1200 m, ll-XI-97 (R. Paz) (UCOB).

Host. — Larvae of Ecdytolopha torticornis
and £. aurantianum. Females of B. maca-
damiae attack first instar larvae of both

hosts before they penetrate the nut. The
parasitoid larva develops until the host
leaves the nut to prepare to pupate. The
parasitoid then emerges from the host and
weaves a white cocoon on the external
surface of the nut inside the hull.

Etymology. — The specific name macada-
miae refers to the name of the host plant
Macadamia integrifolia.

Remarks. — The genus Bassus lacks any
apparent autapomorphy. At least, we
know of none and none has been offered
in the literature. The Microdini, to which
Bassus belongs (Sharkey 1992), is an as-
semblage of mostly monophyletic genera.
However, Bassus itself is probably ren-
dered paraphyletic by the recognition of
most or all of these genera. It will take a
more quantitative approach to test this
thesis.

Bassus macadamiae belongs to a species
group of Bassus that illustrates this para-
phyly problem. Members of this species
group share a few putative synapomor-
phies such as longitudinal costae on me-
tasomal terga one, two, and three, and a
strong transverse ridge of the propodeal
pseudosternite (area between the hind
legs). These same characters are found in
members of the genus Braunsia Kriechbau-
mer. On this limited evidence, and lacking
contrary hypotheses supported with char-
acter state evidence, it seems that Braunsia
s.l. and this species group of Bassus are
more closely related to each other than
members of the species group are to other
species presently placed within the con-
cept of Bassus. The distribution of the spe-
cies group is cosmopolitan with the rela-
tive species abundance being greater in
northern temperate regions. The similari-
ties between species of Braunsia and mem-
bers of this species group have never been
noted in the literature but they are obvi-
ous enough to have induced Enderlein to
describe some members of this species
group of Bassus in Braunsia; Bassus ochracea
(Enderlein) is one example. The species
group includes, Bassus ater (Chou and

■****-*—-"—

lltllllWllll

Volume 9, Number 1, 2000

103

Sharkey), B. ebulus (Nixon), B. atripes
(Cresson) and B. calcaratus (Cresson).

As it is presently defined, Braunsia is re-
stricted to the Old World and appears to
be monophyletic. Including the species de-
scribed here in Braunsia would drastically
expand the concept of the genus and, in
our view, this generic reappraisal should
only be done in the context of a more com-
plete cladistic analysis. Here we take a
conservative approach in applying the
name Bassus to the new species.

ACKNOWLEDGMENTS

We thank Dr. Paul Hanson, Universidad de Costa
Rica (Costa Rica) for providing part of the material
for this research, Dr. Eugenie Phillips Rodriguez (IN-
Bio-Costa Rica) for the host identification, Ing. Quirt-
tin Arias for assistance with graphics software, and
Eric Grissell and two annonymous reviewers for
helpful comments on a draft version. The Centro de
Microscopia Electronica Facultad de Agronomia-
UCV (CENMEFA-Venezuela) prepared specimens for
SEM and took the photomicrographs. Support to MJS
was supplied by Kentucky Agricultural Experimental
Station number 99-08-20. Support to RABG was sup-
plied by the Consejo de Desarrollo Cientifico, Hu-
manistico y Tecnologico (CDCHT) of the Universidad
Centroccidental "Lisandro Alvarado", Venezuela.

LITERATURE CITED

Arizaleta, M. and F. Diaz. 1995. Situacion actual de
las plagas de la nuez de macadamia en Villan-
ueva, Estado Lara. XIV Congreso Venezolano de
Entomologia y III Seminario National de Plagas de la
Cana de Aziicar. Resumenes p. 25.

Arizaleta P., M. A., Urdaneta, M. Arizaleta C, and J.
Zabala. 1997. Nuez de macadamia. Publication de
Fundacion Polar. 38 p.

Badilla, F. 1996. Programa manejo integrado de las
plagas insectiles de la macadamia. Boletin infor-
mative MAC MIR, Organo Oficial de Macadamia
Miravalles. n. 2, aho 1. Costa Rica, http://
www.macadamia.co.cr

Blanco, H., A. Watt, and D. Cosens. 1993. Ciclo de
vida y comportamiento de oviposicion de Ecdy-
tolopha torticornis (LEP: Tortricidae) barrenador
de la nuez de macadamia. Manejo Integrado de
Plagas (Costa Rica), n. 29. p. 36-39.

Chou, L. and M. J. Sharkey. 1989. The Braconidae
(Hymenoptera) of Taiwan. I. Agathidinae. Jour-
nal of Taiwan Museum, 42 (1): 147-223.

Lara, F. 1987. Studies on Cryptophlebia leucotreta
(Meyrick) (LEP: Tortricidae) on macadamia in
Costa Rica. Siquirres, Macadamia de Costa Rica.
8 p. (Mimeografiado).

Sharkey, M. J. 1992. Cladistics and tribal classification
of the Agathidinae (Hymenoptera: Braconidae).
Journal of Natural History. 26: 425-447.

Sharkey, M. J. and R. A. Wharton. 1997. Morphology
and terminology. In: Wharton, R. A., P. M. Marsh
and M. J. Sharkey (eds). 1997. Manual of the New
World genera of the family Braconidae (Hyme-
noptera). Special publication of the International So
ciety of Hynicuoptcrists. Number 1. 439 pp.

J. HYM. RES.
Vol. 9(1), 2000, pp. 104-107

A New Genus, and First Host Records, for the Adeshini:

Parasitoids of Hispine Beetles (Braconidae: Braconinae;

Coleoptera: Chrysomelidae)

Donald L. J. Quicke and Andrew Polaszek

Unit of Parasitoid Systematics, CABI Bioscience UK Centre (Ascot), Department of Biology,

Imperial College at Silwood Park, Ascot, Berkshire SL5 7PY, UK and Department of

Entomology, The Natural History Museum, London SW7 5BD, UK

Abstract. — The new genus Aneuradesha Quicke is described with its type species A. harleyi
Quicke. This new species is a parasitoid of the hispine beetle, Asmangulia cuspidata Maulik, a pest
of sugarcane and rice in India and Indonesia. In addition, we report that in insular Malaysia
Adesha albolineata Cameron is a parasitoid of another hispine beetle, Promecotheca cumingi Baly, a
pest of coconut palm. These are the first two host records for the braconine tribe Adeshini and
strongly suggest that adeshines are specialist parasitoids of hispines.

Adeshini are a small, entirely tropical
tribe of the large braconid wasp subfamily
Braconinae, occurring in the Afrotropical,
Oriental, Indo-Australian and Australian
regions. They are known from only seven
described species belonging to five genera
(Achterberg 1983; Quicke 1986, 1988;
Quicke & Ingram 1993), and the majority
of these are known from only one or a few
specimens. Until now, nothing was
known about their biology, though many
small tropical braconines are parasitoids
of either leafminers, stem borers, or gall
forming insects. Here we present the first
host records for the tribe, based on two
species, and describe a very distinctive
new genus and species.

Terminology follows Wharton et al.
(1997).

Aneuradesha Quicke gen. nov.

Diagnosis. — Aneuradesha can be distin-
guished from all other known genera of
Adeshini by the complete absence of fore
wing vein 2cu-a (Fig. 4; = vein CUlb in
terminology of van Achterberg 1983), and
also by the incomplete midlongitudinal

carina of the propodeum (Fig. 3). Mem-
bers of the Adeshini can be recognised by
fore wing vein 2CU arising at the same
level as 1CU (Achterberg 1983; Quicke
1987).

Description. — Terminal flagellomere
elongate, pointed but not acuminate. All
flagellomeres much longer than wide; bas-
al ones apically oblique. Face smooth and
shiny. Hypoclypeus not strongly recessed
into hypoclypeal depression. Eyes closest
together below middle. Mesoscutum
smooth and shiny, without a deep mid-
longitudinal groove (Fig. 1). Notauli deep-
ly impressed, meeting at posterior third of
mesoscutum where they form a weakly
depressed punctate area (Fig. 1). Meso-
pleuron smooth, largely glabrous (Fig. 2).
Middle lobe of metanotum without a mid-
longitudinal carina. Propodeum with an
incomplete, midlongitudinal carina (Fig.
3). 2nd submarginal cell short, vein 2RS
about as long as 3RSa. 2nd metasomal ter-
gite with a distinct small midbasal area
produced into a narrow midlongitudinal
ridge (Fig. 5). 2nd metasomal suture nar-
row and crenulate.

!i?ii>.

Volume 9, Number 1, 2000

105

Figs. 1-6. Environment chamber scanning electron micrographs of Aneurobracon harleyi gen. et sp. now, male
holotype: 1, habitus. 2, metapleuron. 3, scutellum to propodeum. 4, fore wing. 5, metasomal tergites 1-3. 6
lateral view of 5th metasomal tergite showing posterolateral emargination.

Type species. — Aneuradesha harleyi Quicke Aneuradesha Harleyi Quicke sp. nov.

sp. n. by monotypy and original designa- (Figs 1-6)
tion.

Remarks.— The complete lack of fore TWe material.— Male holotype: INDIA:

wing vein CUlb and the reduced propo- Muzzafarnagar, 8.vi.l998, Atar Singh, ex

deal carina are both probably autapomor- Asmangulk cuspidata, HE 23897 (BMNH).

phies of Aneuradesha with respect to the Male paratype (BMNH): same data as ho-

other genera of Adeshini. lotype.

106

Journal of Hymenoptera Research

Antenna with 34 flagellomeres. Height
of clypeus (excluding hypoclypeus): inter-
tentorial distance:tentorio-ocular distance
= 1.0:3.7:2.0. Height of eye: width of head
across eyes: width of face = 1.0:2.6:1.4.
Transverse diameter of posterior ocellus:
distance between posterior ocelli:shortest
distance between posterior ocellus and
eye = 1.0:1.2:2.2. Mesosoma 1.2 times lon-
ger than maximum height. Mesoscutum
(Fig. 1) smooth except for punctures at ba-
ses of setae; moderately densely setose ex-
cept the mid-longitudinal part of the mid-
dle lobe. Scutellar sulcus finely crenulate.
Scutellum with a weak but distinct pit.
Propodeum (Fig. 3) crenulate posteriorly.
Posterior margin of hind wing weakly
emarginate. Lengths of veins 2RS:3RSa:r-
m = 1.3:1.28:1.0. Lengths of veins r:3RSa:
3RSb = 1:1.45:5.75. Lengths of veins (Rs +
M)b:2M = 1.0:1.55. Fore wing vein lcu-a
marginally postfurcal. Vein 2-1A tubular
for approximately half length of 1st sub-
discal cell. Base of hind wing evenly se-
tose. Apex of vein C + SC + R with one
especially thickened bristle (basal hamu-
lus). Lengths of hind femur (excluding tro-
chantellus): tibia:basitarsus = 2.0:3.3:1.0.
First and 2nd metasomal tergites rugose
with overlying granulose sculpture; more
posterior tergites granulose superimposed
on weak foveate sculpture. Posterior mar-
gin of 5th tergite with a distinct, trans-
verse subposterior groove (Fig. 6).

Uniformly honey-yellow except for the
flagellomeres, an ill-defined mark on the
raised median area of the 1st metasomal
tergite and a mark medio-basally on the
2nd metasomal tergite, which are blackish.

Biologies of Adesha Albolineata and
Aneuradesha Harleyi

Aneuradesha harleyi is so far known only
from the hispine chrysomelid beetle As-
mangulia cuspidata Maulik, a leafminer
pest of sugarcane and rice in India and In-
donesia. Anwar (1944) records a "Micro-
bracon" sp. as an ectoparasitoid of A. cus-
pidata larvae causing up to 38% parasitisa-

tion. Since, to our knowledge, no other
braconid has ever been recorded from A.
cuspidata, it is conceivable that "Microbra-
con" represents a misidentification of the
species treated here as A. harleyi.

The authors recently had the opportu-
nity to examine material of another para-
sitoid of a hispine, Promecotheca cumingi
Baly, a pest of coconut palm in south and
southeast Asia (Gallego et al. 1983; Mathur
et al. 1984). A series of 12 specimens, sent
to the second author for identification,
turned out to belong to the type species of
the type genus of Adeshini, Adesha alboli-
neata Cameron (see van Achterberg 1983,
for a redescription of Adesha albolineata,
and Quicke, 1986, for a key to species of
Adesha). Previously, Adesha had been re-
corded from Borneo and the Malay Pen-
ninsula, and A. albolineata was known only
from two specimens. According to the col-
lector, A. albolineata is an ectoparasitoid of
larvae of P. cumingi. There appears, there-
fore, to be a very reasonable basis for con-
sidering Adeshini as specialist ectoparasi-
toids of hispine larvae.

Adesha albolineata: Material Examined:
5 956* MALAYSIA: Sarawak, Buntal ex
Promecotheca cumingi on Nipah (Cocos nu-
cifera) 20.V.1998 (Drahman coll.); 1 9 same
data except 17.ii.1998, HE 23809/ S132 (all
specimens in The Natural History Muse-
um, London).

ACKNOWLEDGMENTS

We thank Atar Singh, Sugarcane Research Station,
Muzzafarnagar, Uttar Pradesh, India, and Megir
Gumbek, Pusat Penyelidikan Pertanian, Sarawak,
Malaysia, for providing specimens of A. harleyi and
A. albolineata, respectively. Hasan Basibuyuk kindly
made the SEMs.

LITERATURE CITED

Achterberg, C. van. 1983. Six new genera of Bracon-
inae from the Afrotropical Region (Hymenop-
tera, Braconidae). Tijdschrifl voor Entomologie 122:
175-202.

Anwar, M. S. 1944. The natural control of Asmangulia
cuspidata Maulik, the sugarcane leaf-miner, by
parasites. Indian journal of Entomology 5: 248-249.

Gallego, V. C, Baltazar, C. R., Cadapan, E. P. and

Volume 9, Number 1, 2000

107

Abad, R. G. 1983. Some ecological studies on the
coconut leafminer Promecotheca cumingi (Coleop-

tera: Hispidae) and its hymenopterous parasit-
oids in the Philippines. Philippine Entomologist. 6:
471-493.

Mathur, P. N., Samathanam, G. J. and Singh, A. 1984.
Coconut leaf miner beetle (Promecotheca cumingi
Baly). Plant Protection Bulletin, India 36: 91-93.

Quicke, D. L. J. 1986. A revision of the Adeshini van
Achterberg with descriptions of three new gen-
era from the Palaeotropics (Insecta, Hymenop-
tera, Braconidae). Zoologica Scripta 15: 265-274.

Quicke, D. L. j. 1987. The Old World genera of bra-

conine wasps (Hymenoptera: Braconidae). Jour-
nal of Naural History 21: 43-157.

Quicke, D. L. J. 1988. A new genus and species of
Adeshini (Hym., Braconidae, Braconinae) from
Thailand. Entomologists' Monthly Magazine 124:
203-205.

Quicke, D. L. J. and S. N. Ingram. 1993. Braconine
wasps of Australia. Memoirs of the Queensland.
Museum 31: 299-336.

Wharton, R. A., P. M. Marsh and M. J. Sharkey (Eds).
Manual of the New World genera of the family Bra-
conidae (Hymenoptera). Special Publication of the
International Society of Hymenopterists, No. 1.

J. HYM. RES.
Vol. 9(1), 2000, pp. 108-110

Microgastrine (Hymenoptera: Braconidae) Parasitoids of Colias lesbia

(Fabricius) (Lepidoptera: Pieridae)

Michael J. Sharkey, Kathie Finnell, Jason Leathers, and Jorge Frana

(MJS, KF, JL) University of Kentucky, Department of Entomology, S-225 Ag. Science Center
North, Lexington, KY 40546-0091, USA; (JF) INTA, Estacion Experimental Agropecuaria Rafaela,

CC 22 2300-Rafaela, Santa Fe, Argentina

Abstract. — The microgastrine (Braconidae) parasitoids of Colias lesbia (Fabricius), a lepidopteran
pest of alfalfa in southern temperate regions of South America, are reviewed. Three species, Cotesia
ayerza (Brethes), C. glomerata (Linnaeus) and C. lesbiae (Blanchard) are recognized and the mor-
phological differences between them are presented. A lectotype for C. ayerza is designated.

Colias lesbia (Fabricius) is a lepidopteran
pest of alfalfa, and is widespread in the
southern temperate regions of South
America. Throughout its range, it is at-
tacked by three microgastrine (Braconi-
dae) parasitoids. The taxonomy and iden-
tification of these parasitoids, which are
all members of the genus Cotesia, have
been problematic, with between two and
five species being recognized in the com-
plex. The purpose of this paper is to re-
solve these problems and to present mor-
phological characteristics to distinguish
between the species of Cotesia that attack
Colias lesbia.

The subfamily Microgastrinae is cos-
mopolitan and contains thousands of spe-
cies (Shenefelt 1972). They are internal
parasitoids of larval Lepidoptera and are
important in the natural and manipulated
control of many pest species. The genus
Cotesia contains hundreds of species that
have been formally described, but even
more that have not yet been described.
The genus is also cosmopolitan and may
be distinguished from all other Microgas-
trinae by the sculpture and shape of the
first metasomal tergum and by the short
ovipositor of females (cf. Mason 1981).

Shenefelt (1972, 1980) lists three species
of Microgastrinae as parasitoids of Colias

lesbia, viz., Cotesia glomerata (Linnaeus), C.
ayerza (Brethes), and C. lesbiae (Blanchard)
(all as Apanteles). There are other micro-
gastrine names recorded as parasitoids of
Colias lesbia; however, owing to well-re-
searched synonymies (cf. Shenefelt 1972),
only these three remain current in the lit-
erature.

Syntypes of C. ayerza were borrowed
from the Museo Argentino de Ciencias
Naturales and specimens of C. lesbiae de-
termined by both Blanchard and Brethes
were borrowed from the Museo de La Pla-
ta. The type of C. glomerata is no longer
extant but the description by Nixon (1974)
and reliably identified specimens from Eu-
rope and North America (determined by
G.E.J. Nixon and W.R.M. Mason respec-
tively) were used for comparative purpos-
es.

C. glomerata may be distinguished from
the other two species by the color of the
hind femur which is yellow with a small
melanic region in the apical 1 / 6. The hind
femora of C. ayerza and C. lesbiae are uni-
formly brown. C. ayerza and C. lesbiae may
be distinguished from each other by the
dimensions of the medial tergite of the
first metasomal segment. That of C. ayerza
is about as wide as long whereas that of
C. lesbiae is more than 1.5 times longer

It...

Volume 9, Number 1, 2000

109

Table 1. Comparison of Cotesia species parasitizing Colias lesbia.

Taxa

Characters and st.iu

a = C. ayzera

g = C. glomerata

1 = C. lesbiae

1. Hind femur color.

a) Entirely brown (melanic)

b) Yellow except for brown in apical 1/6

2. Hypopygium of female.

a) tapering to a sharp point apically

b) with a deep semicircular emargination apically [c.f.
Fig. 46 in Nixon (1974)]

3. First metsomal median tergite.

a) more than 1.5 times longer than wide

b) about as long as wide

4. Sculpture of posteromedial region of mesoscutum,
directly anterad mesoscutellar sulcus.

a) with longitudinal rugosities (Fig. 1)

b) lacking longitudinal rugosities (Fig. 2)

a, 1
g

a, 1

than wide. Other morphological differenc-
es between the three species are summa-
rized in Table 1.

There may be a behavioral difference
between C. lesbiae and the other two spe-
cies. C. ayerza and C. glomerata, like most
species of Cotesia, are gregarious (Mason

1981, Nixon 1974) with many eggs laid in
each host, whereas C. lesbiae appears to be
a solitary parasitoid (Hamity 1978).

Brethes did not designate a holotype for
Apanteles ayerza and we take this oppor-
tunity to designate a lectotype and two
paralectotypes. All three specimens are on

Figs. 1-2. Dorsal aspects of mesosomata. 1 (left), Cotesia glomerata. The arrow on the mesoscutum indicates
longitudinal rugosities; 2 (right), Cotesia lesbiae.

Journal of Hymenoptera Research

the same pin, mounted on one, small,
quadrate, piece of paper. The lectotype is
a female and is the specimen in the middle
of the piece of paper flanked by the two
paralectotypes which both appear to be
males, but owing to the poor condition of
the specimens, sex is difficult to deter-
mine. The lectotype is missing both left
wings and the right hind wing but it is
intact otherwise. All specimens appear to
be conspecific. There are four original,
hand-written labels on the pin. The upper-
most reads "La Pampa 111.1920 J. Wil-
liamson". The second reads, "parasite de
Colias lesbia". The third label is small and
has a few marks that are not decipherable;
and the fourth reads "Apanteles Ayerza
Brethes". We have also added a red label
with the following: "Lectotype Apanteles
ayerza Brethes designated by Sharkey, Fi-
nell, and Leathers".

ACKNOWLEDGMENTS

We thank the UK Graduate School and the KYSS
(Kentucky Young Scientists Summer) program for
giving the second author the opportunity to work

with the senior author. Thanks to Pete Southgate for
photomicrographs, and to Eric Grissell, Jim Whitfield,
Dan Potter, and an anonymous person for reviewing
the manuscript. This research was facilitated by the
Kentucky Experiment Station Project Number 99-08-
20.

LITERATURE CITED

Hamity, M. G. A. de. 1978. Aspectos biologicos de
Apanteles lesbiae Blanchard (Hymenoptera: Bra-
conidae) parasito de la isoca de la alfalfa Colias
lesbia (F) (Lepidoptera: Pieridae). IDIA NE 337-
342. Jan-Jul. Pp: 39-45.

Mason, W. R. M. 1981. The polyphyletic nature of
Apanteles Foerster (Hymenoptera: Braconidae): a
phylogeny and reclassification of Microgastrinae.
Memoirs of the Entomological Society of Canada 115:
1-147.

Nixon, G. E. J. 1974. A revision of the North-western
European species of the glomeratus-group of
Apanteles Forester (Hymenoptera: Braconidae).
Bulletin of Entomoloical Research 64: 453-524.

Shenefelt, R. D. 1972. Braconidae 4. Microgastrinae,
Apanteles. In: Vecht, J. van des and Shenefelt, R.
D. (Eds). Hymenopterorum Catalogus (novo editio).
Pars 7. Pp. 429-668. Dr. W. Junk, The Hague.

Shenefelt, R. D. 1980. Braconidae 11, Introduction,
Guide to host names, Index to braconid names.
In: Achterberg, C. van, and Shenefelt, R. D. (Eds)
Hymenopterorum Catalogus (novo editio). Pars 16.
Pp. 1-384. Dr. W. Junk, The Hague.

J. HYM. RES.
Vol. 9(1), 2000, pp. 111-141

Seven New Genera of the Subfamily Doryctinae (Hymenoptera:

Braconidae) from the Old World

Sergei A. Belokobylskij and Donald L. J. Quicke

(SAB) Zoological Institute, Russian Academy, of Sciences, Universitetskaya nab. 1, St. Petersburg

199034, Russia; (DLJQ) Unit of Parasitoid Systematics, CABI Bioscience UK Centre (Ascot),

Department of Biology, Imperial College at Silwood Park, Ascot, Berks SL5 7PY, U.K. and

Department of Entomology, The Natural History Museum, London SW7 5BD, U.K.

Abstract. — Seven new genera of the subfamily Doryctinae from the tropical and subtropical
regions of the Old World are described and illustrated: Cryptodoryctes gen. nov. (type species
Cr. hirneri sp. nov. from South Africa), Chelonodoryctes gen. nov. (type species Ch. inopinatus
sp. nov. from Brunei), Synspilus gen. nov. (type species S. nitidus sp. nov. from Sarawak), Bra-
codoryctes gen. nov. (type species B. tergalis sp. nov. from New Guinea), Afrospathius gen. nov.
(type species Af. dispar sp. nov. from Africa), Hemispathius gen. nov. (type species H. polysten-
oides sp. nov. from Uganda), and Atitidoryctes gen. nov. (type species An. pronotalis sp. nov.
from Australia). Three further species of Bracodoryctes gen. nov. are also described: B. longitarsus
sp. nov., B. curvinervis sp. nov., B. nigriceps sp. nov. The affinities of the new genera are dis-
cussed.

The Doryctinae are one of the most in-
teresting and diversified subfamilies of
Braconidae. More than one hundred and
twenty valid genera have been described,
which, for the most part, are restricted to
tropical and subtropical regions (Shenefelt
& Marsh 1976; Belokobylskij 1992; Marsh
1993). The generic richness of the Doryc-
tinae is highest in the Neotropical region
but this region has also been the most
thoroughly investigated, especially by
Paul Marsh, who has described many new
genera from there (e.g. Marsh 1993), and
has recently provided a key to the genera
occurring in the New World (Marsh 1997).
In comparison, the generic composition of
the Old World fauna is really incomplete
but, even so, it would appear that the Old
World tropics are home to fewer genera
than the New World. This pattern of ge-
neric level diversity is, interestingly, the
opposite of that found in the closely-relat-
ed and apparently biologically similar
Braconinae which have far more genera in
the Old World tropics (Quicke 1987,
Quicke 1997).

Phylogenetic relationships between the
genera of Doryctinae have until recently
been based largely on the relatively im-
poverished Nearctic and Palaearctic fau-
nas (Fischer 1981, Belokobylskij 1992).
Further, the characters used have princi-
pally concerned external adult morpholo-
gy such as the presence and absence of
various carinae, sutures, and wing veins,
and the shape of the metasoma. The dis-
covery of many new internal characters
involving male genitalia (Belokobylskij
1987), the venom apparatus (Quicke ct al.
1992a) and most recently, the internal
sculpture of the ovipositor egg canal (Rah-
man ct al. 1998), has greatly increased the
possibility of obtaining a meaningful phy-
logenetic tree. Seven new genera from the
Old World tropics and subtropics are de-
scribed here to make their names available
for future publications on the phytogeny
of the subfamily (Belokobylskij, Marsh &
Quicke in preparation).

Of the new taxa described below, Chc-
lonodoryctes gen. nov., whose affinities are

112

Journal of Hymenoptera Research

uncertain, is the first doryctine genus in
which the 2nd and 3rd metasomal tergites
are greatly enlarged, covering the follow-
ing segments of the metasoma in the same
way as is known for various genera of Ro-
gadinae and Lysiterminae. Loss of both
the occipital and prepectal carinae is one
of the main characteristics of the subfam-
ily Braconinae and is a character used in
many older keys for separating the Bra-
coninae from the Doryctinae. The new ge-
nus Bracodoryctes gen. nov., of which four
new species are described below, is the
second known doryctine genus without
these carinae, the first being Sirngra Cam-
eron which was correspondingly separat-
ed from other doryctines in the tribe Sir-
agrini (Belokobylskij 1994). Transforma-
tions of the scape are known in several do-
ryctine genera (e.g. Syngaster Brulle,
Pseudodoryctes Szepligeti, Siragra Camer-
on, Binarea Brulle, Pseudorhoptrocentrus
Granger, Jarra Marsh & Austin) as they are
among the Braconinae (Quicke 1987).
However, the new genus Synspilus gen.
nov. is the first doryctine in which the
scape not only has an apical lobe demar-
cated by a preapical, transverse carina, but
also has a strong basal constriction as in
the Atanycolus Forster group of genera in
the Braconinae (Quicke 1987) which are all
parasitoids of bark-boring or subcortical
beetles in dead standing or fallen wood.
In addition, this genus is included in a
group with an apically open 1st subdiscal
cell and a strongly reduced vein 2RS (tribe
Heterospilini: Belokobylskij 1992). Crypto-
doryctes gen. nov. is an African genus that
appears to be related to Priosphys Ender-
lein and Odontodoryctes Granger, with
which it shares the following putative syn-
apomorphies: absense of the basoventral
tubercle of the hind coxa and the short
subbasal cell of the hind wing. It lacks an
occipital carina but has a distinct pronope
on the anterodorsal part of the neck. Two
new genera of the tribe Spathiini are de-
scribed in this paper. Afrospathius gen.
nov. is especially interesting because it is

the first genus of the subtribe Psenobolina
to be found in the Old World. The male
of the type species, A. dispar sp. nov., is
characterised by the loss of vein r-m of the
fore wing (present in the female) and by
the presence of a large stigma-like enlarge-
ment in the hind wing. Hemispathius gen.
nov. is related to Spathiomorpha Tobias
from the Palaearctic and Oriental Regions,
and also to the Neotropical genus Notios-
pathius Matthews & Marsh, making it par-
ticularly interesting biogeographically.

TERMINOLOGY AND COLLECTIONS

Terminology follows that of Wharton et
al. (1997). Because this is inconsistent with
the useage by the senior author in many
papers on the Doryctinae, a table is pro-
vided giving the equivalent new terms as
defined by Tobias (1976) (Table 1). The fol-
lowing abbreviations are used: POL — pos-
tocellar line, OOL — ocular-ocellar line,
Od — maximum diameter of lateral ocel-
lus. Specimens are held in The Natural
History Museum, London, England
(BMNH), the Bishop Museum, Honolulu
(BPBM) and the Zoological Institute, Rus-
sian Academy of Sciences, St. Petersburg,
Russia (ZIP).

DESCRIPTIONS OF NEW TAXA
Cryptodoryctes gen. nov.

Diagnosis. — This new genus is related to
two other African genera, Priosphys En-
derlein and to Odontodoryctes Granger.
Cryptodoryctes differs from the other two
by the hind coxa being without dorsal
teeth, lack of an occipital carina, the 2nd
tergite having lateral depressions, and the
presence of a pronope. Cryptodoryctes gen.
nov. differs from the Neotropical genus
Megaloproctus Schulz in that the subbasal
cell of the hind wing is very short, the oc-
cipital carina lost, a pronope is present,
and the 2nd metasomal suture has strong
lateral breaks.

Description. — Head: subcubical (Fig. 2),
1.4-1.5 times wider than long medially.

Volume 9, Number 1, 2000

113

Table 1. Correspondence between wing venation terms employed here (see also Wharton et al. 1997) and
those used in many papers on Doryctinae by Belokobylskij following Tobias (1976).

Wharton ef al. (1997)
and present paper

lohi.is <lTh

Forewing cells

1st subdiscal

brachial

1st discal

discoidal

marginal

radial

2nd submarginal

Forewing veins

2nd radiomedial

1-lA

anal

basal (lateral)

1M, 2M and 3M

medial (lst-3rd abscissas)

Rla (or Rl if Rib not present)

metacarpus

lcu-a

nervulus

2CUb

parallel

1st radial abscissa

3RSa

2nd radial abscissa

3RSb

3rd radial abscissa

2RS

1st radiomedial abscissa

r-m

2nd radiomedial abscissa

la and 2a

transverse anal veins

m-cu

Hind wing cells

recurrent

basal

medial

marginal

radial

subbasal

Hind wing veins

submedial

m-cu

recurrent

C + SC + R and SC + R

costal 1

costal 2

radial

2M (and 3M)

medial

cu-a

nervellus

M + CU

mediocubital 1

mediocubital 2

First flagellar segment nearly as long as
2nd segment. Scapus (Fig. 3) rather short
and wide, without apical lobe; almost 1.5
times longer than maximum width. Palpi
long; maxillary palpi 6-segmented, labial
palpi 4-segmented; 3rd segment of labial
palp relatively long. Malar suture absent.
Clypeal suture complete. Hypoclypeal de-
pression medium-sized and round (Fig. 1 ).
Face with 2 distinct submedial oval de-
pressions above the clypeal suture. Eyes
glabrous. Ocelli in triangle with base 1.2
times longer than sides. Occipital carina
entirely absent. Postgenal bridge very nar-

row. Frons not concave and without me-
dian keel. Mesosoma: depressed. Neck,
rather long, with convex dorsal lobe;
pronope present, but shallow; pronotal
keel distinct, near anterior margin of pron-
otum. Propleural lobe distinct and nar-
row. Mesonotum not strongly and round-
ly raised above promesosoma (Fig. 4). Me-
dian lobe of mesoscutum without antero-
lateral angulations (corners). Notauli
smooth, deep in anterior half, very shal-
low on posterior half. Prescutellar depres-
sion rather King and sparsely sculptured.
Scuto-scutellar suture distinct. Scutellum

114

Journal of Hymenoptera Research

WMMUu

Figs. 1-13. Cn/ptodoryctes turneri gen. & sp. nov. 1 — head, frontal view; 2 — head, dorsal view; 3 — basal seg-
ments of antenna; 4 — mesosoma; 5 — apical part of ovipositor; 6 — metasoma of female; 7 — metasoma of male;
8 — fore wing; 9 — hind wing; 10 — hind coxa; 11 — hind tibia; 12 — hind femur; 13 — male genitalia.

weakly convex, without lateral carinae,
striate posteriorly, its length nearly equal
to maximum width. Postscutellum with-
out median tooth. Subalar depression
shallow and wide. Mesopleural pit deep
and round. Sternauli deep, narrow, long,
straight and smooth. Prepectal carina dis-
tinct and complete. Metapleural flange
rather short, wide and pointed apically.
Propodeum without margined areas; lat-

eral tubercles and propodeal bridge ab-
sent. Propodeal spiracles small and round.
Fore wing: Pterostigma (Fig. 8) wide; vein
r arising from close to middle of pterostig-
ma. Marginal cell slightly shortened. Fore-
wing veins 2RS and r-m present. Vein m-
cu antefurcal. Vein lcu-a postfurcal. First
discal cell petiolate. Vein 2CUb arising
from posterior quarter of distal side of 1st
subdiscal cell. First subdiscal cell closed.

^i^^u

Volume 9, Number 1, 2000

115

Vein M + CU not curved towards vein
1A. Hind wing (Fig. 9) with 3 hamuli on
vein Rl. Vein cu-a present. Subbasal cell
short. Vein M + CU 0.4 times length of
1M. Vein m-cu present, curved toward
base of wing. Basal cell wide; nearly 0.5
times as long as hind wing. Vein RS aris-
ing from vein Rl. Marginal cell weakly
widened apically, without transverse vein.
Vein C + SC + R 0.8 times length of SC
+ R. Legs: All tibiae slender. Fore tibia
with sparse large spines more or less ar-
ranged in a single row. Hind tibia with 1-
3 spines on outer side and with area of
dense white setae on inner distal edge.
Hind coxa rather large, without basoven-
tral tooth (Fig. 10). Femora without anter-
odorsal protuberances. Hind femur 3.2-
3.3 times as long as wide (Fig. 12). Hind
tibial spurs rather short and slender, se-
tose, inner spur 0.2-0.25 times as long as
hind basitarsus. Hind basitarsus 0.9 times
as long as 2nd-5th segments combined.
Metasoma: First tergite not petiolate, rath-
er wide (Figs. 6, 7). Acrosternite 0.2 times
as long as 1st tergite, its apical margin lo-
cated anterior to spiracles. Dorsope of 1st
tergite large; basolateral lobes absent. Spi-
racular tubercles indistinct, spiracles in
basal quarter of 1st tergite; dorsal carinae
present on basal half. Second suture fine,
with strong breaks laterally. Second ter-
gite with parallel, lateral, wide furrows
(Fig. 6). Second to 3rd tergites with sepa-
rate laterotergites. Hypopygium small,
without medioposterior process. Oviposi-
tor longer than metasoma, down-curved
apically; apex of dorsal valve with 3 small
nodes and apex of ventral valves serrate.

Distribution. — South Africa.

Etymology. — From 'crypticus' (Greek for
'secret') and the generic name Doryctes,
because this genus is at least superficially
similar to the type genus of the subfamily.
Gender: masculine.

Type species. — Cryptodoryctes turner i sp.
nov.

Cryptodoryctes turneri sp. nov.

(Figs. 1-13)

Material examined. — Female holotype
with the following data: 'S. Africa, R. E.
Turner, Brit. Mus. 1923-341', 'Port St.
John, Pondoland, June 1-11.1923'
(BMNH). Paratypes. 1 female, 'E. Cape
Prov., Katberg. 4000 ft, 14-26.XI.1932', 'S.
Africa, R. E. Turner, Brit. Mus. 1932-577'
(BMNH); 1 female, 'S. Africa, R. E. Turner,
Brit. Mus. 1923-547', 'Port St. John, Pon-
doland, Oct. 1923' (ZIP); 1 male, 'Natal:
Kloof. 1500 ft, Sept. 1926', 'S. Africa, R. E.
Turner, Brit. Mus. 1926-404' (BMNH).

Description. — Female. Body length: 6.8-
8.3 mm; fore wing length 6.2-7.0 mm.
Head: Antennae slender, filiform, 48-seg-
mented. First flagellar segment almost 4.5
times as long as its apical width. Penulti-
mate segment 3.3 times as long as wide,
0.3 times as long as 1st segment, 0.8 times
as long as apical segment, which is with
short apical spine. Clypeus with very
short flange along lower margin. Width of
hypoclypeal depression 0.8 times distance
from depression to eye. Tentorial pits dis-
tinct. Cheek height 0.5 times height of eye,
0.9 times basal width of mandible. Face
width 1.2 times eye height and 1.4-1.5
times height of face and clypeus com-
bined. Eye 1.2 times as high as broad.
Temple behind eyes roundly narrowed,
transverse diameter of eye 1.5 times as
long as temple (dorsal view). Frons with
shallow longitudinal median furrow. POL
1.1-1.3 times Od, 0.5-0.6 times OOL; Od
0.5 times OOL. Head roundly narrowed
below eyes. Mesosoma: Length 2.2 times
its height. Subalar depression smooth,
punctulate on anterior quarter. Propo-
deum weakly convex and roundly nar-
rowed toward apex. Wings: Length of fore
wing 3.8-4.0 times its maximum width.
Pterostigma 4-5 times as long as wide, 0.9
times as long as vein Rl. Vein 3RSa 3.5-
3.7 times length of vein r, 0.5 times length
of 3RSb, 1.3-1.5 times length of 2RS. Vein
3RSb straight. Second submarginal cell

116

Journal of Hymenoptera Research

rather long, not widened apically, its
length 2.8 times its width, 1.1 times length
of 1st subdiscal cell. First subdiscal cell
wide. Distance from vein lcu-a to vein 1M
almost equal to length of lcu-a. Hind
wing 4.6 times as long as wide. Legs: Fore
tibia with 4-6 spines at one row on inner
side and with 5-7 spines on distal margin.
Middle tibia without spines on outer side
and with 5 spines on distal margin. Hind
tarsus as long as hind tibia. Second tarsal
segment 0.4-0.5 times as long as 1st seg-
ment, 1.4 times as long as 5th segment (ex-
cluding pretarsus). Hind basitarsus with
narrow lower keel. Metasoma: Length of
1st tergite 1.4-1.5 times its apical width;
apical width 1.8-2.0 times its basal width.
Length of 2nd tergite 0.4-0.5 times its bas-
al width, 1.2-1.3 times length of 3rd ter-
gite. Ovipositor sheath almost 1.1 times as
long as metasoma, 0.6 times as long as
body, 0.6-0.7 times as long as fore wing.
Sculpture and setosity: Head smooth; face
densely reticulate, smooth medially. Me-
soscutum smooth, strongly rugose on
great medioposterior area. Scutellum and
mesopleura smooth. Pronotum densely
rugulose, almost smooth laterally. Meta-
pleura strongly punctulate, with reticula-
tion. Propodeum finely punctulate, with
reticulation, partly smooth, with undulate
median carina at least on basal third. Legs
smooth. First metasomal tergite striate
with rugulae, smooth medioposteriorly,
remaining tergites smooth. Body with
long outstanding pale and sparse setae.
Legs with long, outstanding and rather
sparse setae, length of setae on dorsal side
of hind tibia 1.4-1.8 times as long as max-
imum width of hind tibia. Colour: Head
yellowish brown, frons and median part
of vertex dark brown. Mesosoma dark
reddish brown, promesosoma (except
dark dorsal part) and medioposterior spot
of mesoscutum yellowish brown. Meta-
soma light brown, 1st and 7th or 4th-7th
tergites dark reddish brown. Antennae al-
most black. Palpi and tegulae pale yellow.
Legs yellow. Wings infuscate, with more

or less distinct light spots near pterostig-
ma and along vein 2CUb. Pterostigma
pale yellow.

Male. Body length: 5.4 mm; fore wing
length 5.0 mm. Transverse diameter of eye
1.2 times as long as temple. Antennae
slender. First flagellar segment 6 times as
long as apical width. Mesosoma narrow,
its length 2.4 times its width. Metasoma
narrow (Fig. 7). Length of 1st tergite 2.1
times its apical width, apically 1.5 times
basal width. Lateral furrow of 2nd tergite
shallow. Length of 2nd tergite nearly
equal to its basal width. Second suture al-
most straight. First tergite almost entirely
and median area in basal half of 2nd ter-
gite striate. Basolateral areas of propo-
deum sparse punctulate. Otherwise simi-
lar to female.

Remarks. — We have studied one female
('S. Africa. R. E. Turner. Brit. Mus. 1924-
177', Tort St. John, Pondoland. 1-17. Mar.
1924'), which is very close to C. turneri sp.
nov., but differs by having a distinctly
shorter 1st metasomal tergite (its length al-
most equal to apical width). We are not
describing a new species for this specimen
here because it is possibly only an atypical
individual.

Etymology. — In memory of the collector
of the type specimen.

Chelonodon/ctes gen. nov.

Diagnosis. — This new genus differs from
all other Doryctinae in having a carapace
formed from the 2nd and 3rd metasomal
tergites which conceals all the following
segments. The genus is tentatively includ-
ed in the Doryctini.

Description. — Head: weakly transverse
(Fig. 15), 1.6 times wider than long me-
dially. Scapus (Fig. 16) wide and short,
without apical lobe; 1.3 times longer than
maximum width. First flagellar segment
simple, slightly longer than 2nd segment.
Palpi rather long; maxillary palpi 6-seg-
mented, Labial palpi 4-segmented; 3rd
segment of labial palp not shortened. Ma-
lar suture absent. Hypoclypeal depres-

Volume 9, Number 1, 2000

117

Figs. 14-25. Chelonodoryctes inopinatus gen. & sp. nov. 14 — head, frontal view; 15 — head, dorsal view; 16 —
basal segments of antenna; 17 — metasoma, posterior view; 18 — fore wing; 14 — hind wing; 20 — hind tibia; 21—
mesosoma; 22 — hind coxa; 23 — hind femur; 24 — metasoma, dorsal view; 25 — metasoma, lateral view.

sion small and round (Fig. 14). Clypeal su-
ture fine and complete. Frons weakly con-
cave and without median keel. Eyes gla-
brous. Ocelli in triangle with base 1.3
times side. Occipital carina present dor-
sally, absent ventrally and therefore not
fused with hypostomal carina. Postgenal
bridge wide. Mesosoma: Neck of prome-
sosoma short, simple dorsally. Pronotal
keel fine. Propleural lobe distinct and
wide. Mesonotum strongly and roundly

raised above promesosoma (Fig. 21). No-
tauli deep on anterior half, shallow on
posterior half, crenulate. Prescutellar de-
pression long. Scuto-scutellar suture dis-
tinct. Scutellum flat, with fine lateral cari-
nae, its length almost equal to maximum
width. Postscutellum with short median
tooth. Subalar depression shallow and
rather wide. Mesopleural pit shallow.
Sternauli deep, rather long, straight, wid-
ened posteriorly, crenulate. Prepectal ca-

118

Journal of Hymenoptera Research

rina distinct and complete. Metapleural
flange short, narrow and round apically.
Propodeum without marginate areas; lat-
eral tubercles and propodeal bridge ab-
sent. Propodeal spiracles small and round.
Fore wing: Pterostigma (Fig. 18) wide; vein
r arising from middle of pterostigma. Mar-
ginal cell not shortened. Veins 2RS and r-
m present. Vein m-cu slightly postfurcal.
Vein cu-a postfurcal. Discoidal cell petio-
late. Vein 2CUb interstitial, that is, arising
from junction of vein m-cu and lCUb.
First subdiscal cell closed. Vein M + CU
not curved to vein 1A. Hind wing (Fig. 19)
with 3 hamuli on vein Rl. Vein cu-a pre-
sent. Subbasal cell short. Vein M + CU 0.6
times length of 1M. Vein m-cu present but
unsclerotized and not tubular, curved to-
ward base of wing. Basal cell wide, 0.5
times as long as hind wing. Vein RS aris-
ing from vein Rl. Marginal cell weakly
widened toward apex, without additional
transverse vein. Vein C + SC -I- R 0.7
times length of SC + R. Legs: All tibiae
distinctly thickened. Fore and middle tib-
iae with sparse large spines forming a sin-
gle longitudinal row. Hind tibia with 6
spines on outer side of apex and with area
of dense white setae on inner distal edge.
Hind coxa medium sized, with basoven-
tral tooth (Fig. 22). Femora without anter-
odorsal protuberances. Hind femur 3
times as long as wide (Fig. 23). Hind tibial
spurs rather long and slender, almost gla-
brous, inner spur almost 0.3 times as long
as hind basitarsus. Hind basitarsus thick-
ened, 0.55 times as long as 2nd-5th seg-
ments combined. Metasoma: First tergite
not petiolate, wide (Fig. 24). Acrosternite
slightly elongate, 0.3 times as long as 1st
tergite, its apical margin near level of spi-
racles (Fig. 25). Dorsope of 1st tergite
small, basolateral lobes absent. Spiracular
tubercles very small, spiracles placed on
basal third of tergite, dorsal carinae pre-
sent and complete. Second suture present,
but shallow and fine. Second tergite with-
out areas (Fig. 24). Second and 3rd tergites
enlarged, covering following tergites, with

separate laterotergites. Posterior margin of
3rd tergite with 2 small ventrolateral teeth
and distinct semicircular emargination
medially (Figs. 17, 25). Hypopygium
large, with short pointed process medi-
oposteriorly. Ovipositor longer than me-
tasoma; apex of dorsal valve with single
small nodus, apex of ventral valves ser-
rate.

Distribution. — Island Borneo (Brunei).

Etymology. — From Chelonus, a generic
name in the subfamily Cheloninae, and
Doryctes a generic name in the Doryctinae,
because of the similar structure of the me-
tasoma to that of chelonines. Gender: mas-
culine.

Type species. — Chelonodoryctes inopinatus
sp. nov.

Chelonodoryctes inopinatus sp. nov.

(Figs. 14-25)

Material examined. — Female holotype
with the following data: 'Brunei: Bukit Su-
lang, nr Lamunin, N. E. Stork' (BMNH).

Description. — Female. Body length: 4.1
mm; fore wing length 3.1 mm. Head: An-
tennae with 39 segments. First flagellar
segment 4.8 times as long as its apical
width. Penultimate segment 4.5 times as
long as wide, 0.5 times as long as 1st seg-
ment, 0.9 times as long as apical segment.
Cheek height 0.5 times height of eye, ap-
proximately equal to basal width of man-
dible. Clypeus without flange along lower
margin. Width of hypoclypeal depression
0.7 times distance from depression to eye.
Tentorial pits small. Face width nearly
equal to eye height and equal to height of
face and clypeus combined. Eye 1.2 times
as high as broad. Temple behind eyes
strongly, roundly narrowed; transverse di-
ameter of eye 2.7 times as long as temple
(dorsal view). POL 1.2 times Od, 0.6 times
OOL; Od 0.5 times OOL. Head strongly
and almost linearly narrowed below eyes.
Mesosoma: Length twice its height. Pron-
otum laterally with distinct longitudinal
median carina. Subalar depression with
coarse longitudinal striae. Propodeum

Volume 9, Number 1, 2000

119

weakly convex and roundly narrowed to-
ward apex. Wings: Length of fore wing 3.5
times its maximum width. Pterostigma 3.8
times as long as wide, 0.7 times as long as
vein Rl. Vein 3RSa 2 3 times vein r, 0.45
times vein 3RSb, 1.25 times vein 2RS. Sec-
ond submarginal rather short and wide,
its length 2.8 times its width, 1.5 times
length of 1st subdiscal cell. First subdiscal
cell narrow. Distance from vein cu-a to
vein 1M 1.5 times length of cu-a. Hind
wing 5.8 times as long as wide. Legs: Fore
tibia with 5-6 spines at one row on inner
side and with 7 spines on distal margin.
Middle tibia with 5-6 median spines on
outer side and approximately 6 spines on
distal margin. Hind tarsus 0.9 times as
long as hind tibia. Second tarsal segment
0.5 times as long as 1st segment, nearly as
long as 5th segment (without pretarsus).
Hind basitarsus with lower keel. Metaso-
ma: Length of 1st tergite 1.3 times its api-
cal width; apical width nearly twice its
width. Second and 3rd tergites roundly
curved at sides. Length of 2nd and 3rd ter-
gites combined 1.6 times basal width of
2nd tergite, 1.3 times its maximum width.
Ovipositor sheath 1.8 times as long as me-
tasoma, 0.9 times as long as body, 1.1
times as long as fore wing. Sculpture and
setosity: Vertex and frons striate, with
granulation between striae; face and cheek
rugulose-reticulate; temple coriaceous in
upper two thirds and almost smooth in
lower third. Mesoscutum granulose-retic-
ulate, rugose in large medioposterior area.
Scutellum densely granulate. Mesopleura
coarsely rugose-reticulate. Propleura ru-
gose. Metapleura and propodeum coarse-
ly and densely reticulate. Hind coxa ru-
gulose dorsally, granulate laterally; hind
femur and tibia finely granulate. First and
2nd tergites entirely and basal two thirds
of 3rd tergite striate with short transverse
rugulae between striae; apical third of 3rd
tergite reticulate. Mesosoma with short
dense (especially on mesoscutum) white
setae. Legs with short, semi-erect, pale,
and rather dense setae, length of setae on

dorsal side of hind tibia 0.7-0.9 times as
long as maximum width of hind tibia.
Colour: Mesosoma and lst-3rd metaso-
mal tergites black with reddish tint. Head
reddish brown. Sternites and apical seg-
ments of metasoma light brown. Palpi
pale yellow. Antennae light reddish
brown, darkened toward apex. Tegulae
light brown. Legs yellow. Ovipositor
sheath black. Wings faintly infuscate. Pter-
ostigma yellow, with large brown spot in
apical half.

Male unknown.

Etymology. — From Latin ' inopinatus'
meaning 'unexpected' because the con-
struction of the carapace is very unusual
for members of the Doryctinae.

Syttspilus gen. nov.

Diagnosis. — This new genus appears to
be related to Heierospilus Haliday from
which it differs by the presence of a nar-
row but distinct apical lobe on the scape
and by a constriction at the base of the
scape, the presence of distinct lateral ca-
rinae on the prepectus, hind coxa without
a basoventral tooth, and the clypeus with
double lower carinae. Synspilus and Het-
erospilus share the following synapomor-
phies: 1st subdiscal cell open apically, vein
2RS of forewing strongly reduced, basal
cell of hind wing narrow, forewing vein
m-cu almost perpendicular to vein 2M
and propodeum with marginate basolater-
al areas.

Description. — Head: subcubical (Fig. 27),
1.5 times wider than long medially. Sea-
pus (Figs. 28, 29) rather short and wide,
with strong basal constriction and with
small semi-oval apical lobe and preapical
keel along inner side; 1.7 times longer than
maximum width. First flagellar segment
simple, longer than 2nd segment. Palpi
rather long; maxillary palpi 6-segmented,
labial palpi 4-segmented; 3rd segment of
labial palp not shortened. Malar suture
very shallow. Hypoclypeal depression
rather small and round (Fig. 26). Clypeus
with double lower carinae. Clypeal suture

120

Journal of Hymenoptera Research

Figs. 26-37. Synspilus nitidus gen. & sp. nov. 26 — head, frontal view; 27 — head, dorsal view; 28 — basal seg-
ments of antenna, dorsal view; 29 — basal segments of antenna, lateral view; 30 — areas of propodeum; 31—
fore wing; 32 — hind wing; 33 — mesosoma; 34 — hind coxa; 35 — hind femur; 36 — hind tibia; 37 — metasoma.

distinct, shallow dorsally. Face with 2 dis-
tinct submedian oval depression above
clypeal suture. Eyes glabrous. Frons weak-
ly concave and without median keel, with
lateral keels along border of eyes. Ocelli in
equilateral triangle. Occipital carina pre-
sent, complete, fused with hypostomal ca-
rina. Postgenal bridge distinct. Mesosoma:
Neck of promesosoma short, simple dor-
sally. Pronotal keel distinct, near mesos-
cutum. Propleural lobe distinct and wide.
Mesonotum highly and almost perpendic-
ularly raised above promesosoma (Fig.
33). Median lobe of mesoscutum with
short anterolateral angulations (corners).
Notauli deep and smooth. Prescutellar de-
pression rather long and smooth, with

sparse striae. Scuto-scutellar suture dis-
tinct. Scutellum weakly convex, without
lateral carinae, its length 1.3 times maxi-
mum width. Postscutellum with short me-
dian keel. Subalar depression rather deep
and narrow. Mesopleural pit very shallow
and elongate. Sternauli deep, rather long,
straight, and smooth. Prepectal carina dis-
tinct and complete. Prepectus with 2 lat-
eral longitudinal parallel carinae. Meta-
pleural flange rather short, narrow and
pointed apically. Propodeum with mar-
ginate areas; lateral tubercles and propo-
deal bridge absent. Propodeal spiracles
small and round. Fore wing: Pterostigma
wide (Fig. 31); Vein r arising almost from
middle of pterostigma. Marginal cell not

Volume 9, Number 1, 2000

121

shortened. Vein 2RS largely unsclerotized,
indistinct, postfurcal. Discoidal cell petio-
late. Vein 2CUb distinctly curved basally.
First subdiscal cell open apically. Vein M
+ CU not curved towards vein 1A. Hind
wing (Fig. 32) with 3 hamuli on vein Rl.
Vein cu-a present. Subbasal cell short.
Vein M + CU 0.7 times length of 1M. Vein
m-cu present, antefurcal, almost perpen-
dicular to medial vein, unsclerotized. Bas-
al cell narrow, 0.33 times as long as hind
wing. Hindwing vein RS arising from vein
Rl. Marginal cell weakly narrowed api-
cally, without additional transverse vein.
Vein C + SC + R 1.4 times length of SC
+ R. Legs: All tibiae slender. Fore tibia
with numerous small and dispersed
spines. Hind tibia with 4 spines on outer
side and with row of dense white setae on
inner distal edge. Hind coxa without ba-
soventral tooth (Fig. 34). Femora without
anterodorsal protuberances. Hind femur 3
times as long as wide (Fig. 35). Hind tibial
spurs rather short and slender, sparsely
setose, inner spur almost 0.25 times as
long as hind basitarsus. Hind basitarsus
0.4 times as long as 2nd-5th segments
combined. Metasoma: First tergite not pet-
iolate, narrow (Fig. 37). Acrosternite 0.25
times as long as 1st tergite, its apical mar-
gin distinctly anterior to spiracles. Dorso-
pe of 1st tergite distinct; basolateral lobes
absent; spiracular tubercles indistinct, spi-
racles on basal third of tergite; dorsal ca-
rinae present and complete. Second suture
distinct, very weakly curved laterally. Sec-
ond tergite with very small semi-oval me-
diobasal area. 3rd tergite with transverse
fine furrow in basal third. Second to 5th
tergites with separate laterotergites. Hy-
popygium small, with very short and
pointed process medioposteriorly. Ovi-
positor shorter than metasoma.

Distribution. — Sarawak.

Etymology. — From the parts of names of
'Syngaster' and 'Heterospilus' (genera of
Doryctinae), because the new genus in-
cludes the characters of both these gen-

era.though it is not related to the former.
Gender masculine.

Type species. — Synspilus nitidus sp. nov.

Synspilus nitidus sp. nov.

(Figs. 26-37)

Material examined. — Female holotype
with the following data: 'Sarawak: 4th div.
Gn. Mulu, RGS Exp., II-III 1978,
N.M.Collins' (BMNH).

Description. — Female. Body length: 4.6
mm; fore wing length 3.2 mm. Head: An-
tennae slender, remaining 14 segments.
First flagellar segment 5.3 times as long as
its apical width, 1.1 times as long as 2nd
segment. Width of hypoclypeal depres-
sion 0.6 times distance from depression to
eye. Cheek height 0.3 times height of eye,
0.7 times basal width of mandible. Tento-
rial pits small. Face width 0.9 times eye
height and 0.85 times height of face and
clypeus combined. Eye 1.1 times as high
as broad. Temple behind eyes strongly
roundly narrowed, transverse diameter of
eye twice as long as temple (dorsal view).
POL 0.6 times Od, 0.3 times OOL; Od 0.4
times OOL. Head strongly and roundly
narrowed below eyes. Mesosoma: Length
2.3 times its height. Subalar depression
smooth, with 4 striae in upper half. Pro-
podeum roundly narrowed toward apex.
Wings: Pterostigma 3.2 times as long as
wide, 0.7 times as long as vein Rl. Vein
3RSa 3.3 times vein r, 0.4 times vein 3RSb,
nearly equal to vein 2RS. Second submar-
ginal long, its length 3 times maximum
width, equal to length of 1st subdiscal cell.
First subdiscal cell narrow. Distance from
vein cu-a to vein 1M 0.5 times length of
cu-a. Hind wing 5.3 times as long as wide.
Legs: Fore tibia with numerous spines dis-
persed along inner side and with 5 spines
on distal margin. Middle tibia with nu-
merous spines on outer side and 5 spines
on distal margin. Hind tarsus 1.1 times as
long as hind tibia. Second tarsal segment
0.8 times as long as 1st segment, 1.4 times
as long as 5th segment (without pretar-
sus). Hind basitarsus without lower keel.

122 Journal of Hymenoptera Research

Metasoma: Length of 1st tergite 1.8 times soventral tooth, and the basal ring of the
its apical width; apical width 1.6 times its male genitalia with a dorsal bridge,
basal width. Length of 2nd tergite 0.65 Description. — Head: subcubical (Figs. 39,
times its basal width, 0.85 times length of 49, 58, 69), 1.4-1.5 times wider than long
3rd tergite. Ovipositor sheath 0.55 times as medially. Scapus (Figs. 40, 50, 59, 70) rath-
long as metasoma, 0.25 times as long as er wide and short, without any lobes; 1.7-
body, 0.4 times as long as fore wing. 2.0 times longer than maximum width.
Sculpture and setosity: Vertex and frons First flagellar segment longer than 2nd
smoothly striate, frons smooth medially; segment. Palpi rather long; maxillary pal-
face coarsely reticulate; temple smooth, pi 6-segmented, labial palpi 4-segmented;
Mesosoma smooth. Propleura smooth, 3rd segment of labial palp long. Malar su-
striate on lateral area. Metapleura smooth ture absent. Hypoclypeal depression rath-
on anterior half, reticulate on posterior er great and round (Figs. 38, 48, 57, 68).
half. Propodeum with large and pentago- Clypeal suture narrow and complete. Face
nal areola, median carina slightly shorter with 2 small, but usually distinct subme-
than anterior sides of areola; basolateral dian oval depression above clypeal suture,
areas smooth, rest part of propodeum (in- Eyes shortly setose. Frons not concave and
eluding near carinae) rugose. Legs without median keel. Ocelli almost in
smooth. First and 2nd metasomal tergites equilateral triangle. Occipital carina ab-
striate, rest part of metasoma smooth. Me- sent- Postgenal bridge very narrow. Me-
sonotum glabrous almost entirely. Legs sosoma: Neck of promesosoma rather
with short, semi-erect, pale, and dense se- l°ng or short, with more or less distinct
tae, length of setae on dorsal side of hind dorsal lobe. Pronotal keel present. Pro-
tibia 0.4-0.8 times as long as maximum pleural lobe distinct and wide. Mesono-
width of hind tibia. Colour: Body reddish tum rather strongly and roundly raised
brown, partly lighter. Antennae light above promesosoma (Figs. 41, 60, 71). Me-
brown, slightly darkened toward apex, dian l°De °f mesoscutum without antero-
Palpi pale yellow. Tegulae light brown, lateral angulations (corners). Notauli usu-
Legs light reddish or yellowish brown. auY smooth, deep in anterior half, absent
Wings faintly infuscate. Pterostigma dark in posterior half, sometimes entirely ab-
brown. sent. Prescutellar depression rather long
Male unknown. or short, smooth. Scuto-scutellar suture
Etymology. — From Latin 'nitidus' mean- distinct. Scutellum weakly convex, with-
ing 'shining' because most of the body of out lateral carinae, its length nearly equal
this species is without sculpture and is to its maximum width. Postscutellum
shiny. without median tooth. Subalar depression

deep, rather narrow and smooth. Meso-

Bracodoryctes gen. nov. pleural pit very shallow and long. Ster-

nauli shallow, long, straight and smooth.

Diagnosis.— This new genus differs from prepectal carina absent. Prepectus simple,

all other genera of the tribe Doryctini (to Metapleural flange rather long, narrow

which it might belong) by the absence of and pointed apically. Propodeum without

both the occipital and prepectal carinae. marginate areas; lateral tubercles absent;

Both of these carinae are also absent in Sir- propodeal bridge absent, rarely present,

agra Cameron of the Siragrini, from which but very narrow. Propodeal spiracles rath-

the new genus differs in having a simple er small and round or oval. Fore wing:

scape, i.e. without an apical lobe and ad- Pterostigma (Figs. 44, 51, 63, 74) rather

ditional carina, by having the propodeal narrow; Vein r arising before middle of

bridge indistinct, the hind coxa with a ba- pterostigma. Marginal cell not shortened

Volume 9, Number 1, 2000

123

■ •\f" " ""

■"" * ■ ■ -

~ - <^J

'MM^^^MM

r-^ss WX\\\^ v^vx^^^^v^^^. 7

Figs. 38-47. Bracodoryctes tergalis gen. & sp. nov. 38 — head, frontal view; 39 — head, dorsal view; 40— basal
segments of antenna; 41 — mesosoma; 42 — hind coxa; 43 — metasoma; 44 — fore wing; 45 — hind wing; 46 — hind
femur; 47 — hind tibia.

or only slightly shortened. Veins 2RS and
r-m present. Vein m-cu usually antefurcal,
rarely postfurcal (Fig. 74). Vein m-cu post-
furcal. Discoidal cell petiolate. Vein 2CUb
arising from middle or posterior third of
apical side of 1st subdiscal cell. First sub-
discal cell closed. Vein M + CU not
curved to vein 1A. Hind wing (Figs. 45,
52, 64, 75) with 4-5 hamuli on vein Rl.
Vein cu-a present. Subbasal cell short.
Vein M + CU 0.3-0.5 times length of 1M.
Vein m-cu present, slightly curved toward
base of wing. Basal cell narrow, nearly 0.5
times as long as hind wing. Vein RS aris-
ing from vein Rl. Marginal cell almost
parallel-sided, weakly narrowed near
apex, without additional transverse vein.
Vein C + SC + R 0.4-0.6 times length of

SC + R. Legs: All tibiae slender. Fore and
middle tibiae with sparse large spines ar-
ranged in single longitudinal row. Hind
tibia with 3 spines on outer side and with
area of dense white setae on inner distal
edge. Hind coxa with distinct basoventral
tooth in females (Figs. 42, 54, 61, 76), but
not in males (Fig. 77). Femora without cm-
terodorsal protuberances. Hind femur 3.0-
3.5 times as long as wide (Figs. 46, 56, 66,
78). Hind tibial spurs entirely or partly se-
tose, rather short and slender, inner spur
0.2-0.3 times as long as hind basitarsus.
Hind basitarsus 0.7-0.9 times as long as
2nd-5th segments combined, rarely equal
to its. Metasoma: First tergite not petio-
late, wide (Figs. 43, 53, 62, 72). Acroster-
nite nearly 0.2 times as long as 1st tergite,

124

Journal of Hymenoptera Research

-^x^W^W^

Figs. 48-56. Bracodoryctes longitarsus gen. & sp. nov. 48 — head, frontal view; 49 — head, dorsal view; 50-
basal segments of antenna; 51 — fore wing; 52 — hind wing; 53 — metasoma; 54 — hind coxa; 55 — hind tibia; 56-
hind femur.

its apical margin located anterior to spi-
racles. Dorsope of 1st tergite very large;
basolateral lobes absent. Spiracular tuber-
cles indistinct, spiracles placed in basal
third of 1st tergite; dorsal carinae present.
Second suture present, distinctly curved
laterally; sometimes very fine. Second ter-
gite with lateral, shallow, parallel or
oblique furrows. Second to 4th tergites
with separate laterotergites. Hypopygium

medium-sized, with short or long obtuse
process medioposteriorly. Ovipositor lon-
ger or shorter than metasoma.

Distribution. — New Guinea.

Etymology. — From 'Bracon' and 'Doryc-
tes' (generic names from the subfamilies
Braconinae and Doryctinae), because the
new genus displays characters of both
these genera. Gender masculine.

Type species. — Bracodoryctes tergal is sp. nov.

KEY TO SPECIES OF BRACODORYCTES gen. nOV.

1 Face width 0.85 times height of face and clypeus combined. First metasomal tergite short,
its length 0.75 times apical width. Ovipositor sheath short, 0.6 times as long as metasoma,
0.4 times as long as fore wing. Legs black. Metapleura entirely sculptured. Body length 7.5
mm B. tergalis sp. nov.

- Face width 1.1-1.3 times height of face and clypeus combined. First metasomal tergite long,
3 length nearly equal to apical width. Ovipositor sheath long, 1.1-1.45 times as long as

Volume 9, Number 1, 2000

L25

Figs. 57-67. Bracodoryctes curvinervis gen. & sp. now 57 — head, frontal view; 58 — head, dorsal view; 59 —
basal and apical segments of antenna; 60 — mesosoma; 61 — hind coxa; 62 — metasoma; 63 — fore wing; 64
hind wing; 65 — hind tibia; 66 — hind femur; 67 — apical part of ovipositor.

metasoma, 0.7-0.85 times as long as fore wing. Legs light or yellowish brown. Metapleura

in greater part smooth 2

2 Vein m-cu postfurcal. Second metasomal tergite of female only striate on basomedial half.

Second metasomal suture very fine. Head black. Body length 8.7-10.5 mm

B. nigriceps sp. nov.

- Vein m-cu antefurcal. Second metasomal tergite of female striate on all the median part.
Second suture distinct. Head light or yellowish brown 3

3 Notauli entirely absent. Second submarginal cell long and widened toward apex. Vein
2CUb arising from middle of distal margin of 1st subdiscal cell. First subdiscal cell not

wider than 2nd submarginal cell. Dorsal part of neck smooth. Body length 8.5 mm

B. longitarsus sp. nov.

- Notauli distinct in basal half of mesoscutum. Second submarginal short and not widened

126

Journal of Hymenoptera Research

Figs. 68-80. Bracodoryctes nigricqjs gen. & sp. nov. 68 — head, frontal view; 69 — head, dorsal view; 70 — basal
segments of antenna; 71 — anterior part of mesosoma; 72 — metasoma of female; 73 — male genitalia; 74 — fore
wing; 75— hind wing; 76 — hind coxa of female; 77 — hind coxa of male; 78 — hind femur; 79 — hind tibia; 80 —
metasoma of male.

toward apex. Vein 2CUb arising from posterior third of distal margin of 1st subdiscal cell.
First subdiscal cell wider than 2nd submarginal cell. Dorsal part of neck sculptured. Body
length 10.0 mm B. curvinervis sp. nov.

Bracodoryctes tergalis sp. nov.

(Figs. 38^7)

Material examined. — Female holotypk

with the following data: 'Papua N.G., Bul-
olo, 2. IX. 1981', 'Castanopsis sp. billet,
H.U.Roberts coll., CLE. A. 13485'
(BMNH).

Volume 9, Number 1, 2000

127

Description. — Female. Body length: 7.5
mm; fore wing length 6.6 mm. Head: An-
tennae rather slender, remaining 30 seg-
ments. First flagellar segment 4.5 times as
long as its apical width, 1.2 times as long
as 2nd segment. Width of hypoclypeal de-
pression 1.2 times distance from depres-
sion to eye. Clypeus with very short
flange along lower margin. Tentorial pits
distinct. Cheek height 0.3 times height of
eye, 0.7 times basal width of mandible.
Face width 0.8 times eye height and 0.85
times height of face and clypeus com-
bined. Eye 1.1 times as high as broad.
Temple behind eyes roundly narrowed,
transverse diameter of eye 1.7 times as
long as temple (dorsal view). POL 0.5
times Od, 0.3 times OOL; Od 0.5 times
OOL. Head roundly narrowed below
eyes. Mesosoma: Length nearly twice its
height. Neck of promesosoma rather long.
Pronotal keel distinct, but not high. No-
tauli distinct in anterior half only. Pre-
scutellar depression rather long. Subalar
depression entirely smooth. Propodeum
regularly roundly narrowed toward apex.
Wings: Length of fore wing 3.6 times its
maximum width. Pterostigma 4.8 times as
long as wide, as long as vein Rl. Marginal
cell slightly shortened. Vein 3RSa twice
vein r, 0.5 times the straight vein 3RSb, 1.5
times vein 2RS. Vein m-cu antefurcal. Sec-
ond submarginal rather long and narrow,
not widened apically, its length 3.3 times
its width, 1.3 times length of 1st subdiscal
cell. First subdiscal cell wide. Distance
from vein cu-a to vein 1M 0.7 times length
of cu-a. Hind wing 4.6 times as long as
wide. Legs: Fore tibia with 7 spines at one
row on inner side and with 8 spines on
distal margin. Middle tibia with 3 spines
on outer side and 5-6 spines on distal
margin. Hind tarsus 0.9 times as long as
hind tibia. Second tarsal segment 0.4 times
as long as 1st segment, 1.2 times as long
as 5th segment (without pretarsus). Hind
basitarsus with lower keel. Metasoma:
Length of 1st tergite 0.75 times its apical
width; apical width 2.2 times its basal

width. Length of 2nd tergite 0.33 times its
basal width, 0.9 times length of 3rd tergite.
Ovipositor sheath 0.6 times as long as me-
tasoma, 0.3 times as long as body, 0.4
times as long as fore wing. Sculpture and
setosity: Head and mesosoma smooth.
Mesoscutum striate at small medioposter-
ior area. Neck of promesosoma reticulate-
rugulose dorsally. Metapleura punctulate-
rugulose. Propodeum smooth at large ba-
solateral areas, remaining part densely
and strongly punctulate. Legs smooth.
First metasomal tergite (except anterior
quarter) densely and strongly punctulate;
2nd tergite rugulose-striate, smooth later-
allv. Remainder of metasoma smooth.
Legs with long, erect and rather dense se-
tae, length of setae on dorsal side of hind
tibia 0.7-1.0 times as long as maximum
width of hind tibia. Colour: Head and legs
black with reddish tint. Mesosoma red,
pronotum anteriorly and propleura dark-
ened. Metasoma black; greater part of 1st
tergite (except medioposterior triangle
spot), lateral parts of 2nd and anterolateral
parts of 3rd-6th tergites yellow; narrow
medioposterior bands of 3rd-6th tergites
transparent. Antennae black. Palpi dark
reddish brown, almost black. Wings faint-
ly infuscate. Pterostigma dark brown.

Male unknown.

Etymology. — From Latin "tergum" be-
cause the 1st metasomal tergite is very
short.

Bracodoryctes longitarsits sp. nov.
(Figs. 48-56)

Material examined. — Female holotype
with the following data: 'New Guinea:
Neth., Kutsime, West of Swart Val., 1500
m, Nov. 14, 1958', 'J.L. Gressitt Collector'
(BMNH).

Description. — Female. Body length: 8.5
mm; fore wing length 8.6 mm. Head: An-
tennae weakly setiform, remaining 47 seg-
ments. First flagellar segment 5.5 times as
long as its apical width, 1.2 times as long
as 2nd segment. Cheek height 0.3 times
height of eye, 0.6 times basal width of

128

Journal of Hymenoptera Research

mandible. Width of hypoclypeal depres-
sion 1.25 times distance from depression
to eye. Clypeus with flange along lower
margin. Tentorial pits distinct. Face width
0.9 times eye height and 1.1 times height
of face and clypeus combined. Eye 1.1
times as high as broad. Temple behind
eyes roundly narrowed, transverse diam-
eter of eye 1.2 times as long as temple
(dorsal view). POL equal to Od, 0.2 times
OOL; Od 0.2 times OOL. Head rather
strongly and roundly narrowed below
eyes. Mesosoma: Length nearly twice
times its height. Neck of promesosoma
long. Pronotal keel distinct and high. No-
tauli entirely absent. Prescutellar depres-
sion short. Subalar depression entirely
smooth. Propodeum weakly regularly
roundly narrowed toward apex. Wings:
Length of fore wing 4 times its maximum
width. Pterostigma 4.8 times as long as
wide, 0.8 times as long as vein Rl. Mar-
ginal cell not shortened. Vein 3RSa 4 times
vein r, 0.6 times the straight vein 3RSb, 2.4
times vein 2RS. Vein m-cu antefurcal. Sec-
ond submarginal long and wide, distinctly
widened toward apex, its length 2.7 times
its maximum width, 1.7 times length of 1st
subdiscal cell. First subdiscal cell wide.
Distance from vein cu-a to vein 1M 1.3
times length of cu-a. Hind wing 4.8 times
as long as wide. Legs: Fore tibia with 9
spines at almost one row on inner side
and with 6 spines on distal margin. Mid-
dle tibia with 1-2 spines on outer side and
6 spines on distal margin. Hind tarsus 1.2
times as long as hind tibia. Second tarsal
segment 0.4 times as long as 1st segment,
twice as long as 5th segment (without pre-
tarsus). Hind basitarsus with lower keel.
Metasoma: Length of 1st tergite equal to
its apical width; apical width almost twice
its basal width. Length of 2nd tergite 0.4
times its basal width, 0.9 times length of
3rd tergite. Ovipositor sheath 1.4 times as
long as metasoma, 0.7 times as long as
body, 0.7 times as long as fore wing.
Sculpture and setosity: Head and meso-
soma smooth. Promesosoma smooth. Me-

tapleura smooth, rugose in posterior mar-
gin. Propodeum smooth at large basolat-
eral areas, remaining part densely punc-
tulate. Legs smooth. First and 2nd (except
its smooth lateral parts) metasomal ter-
gites striate; remaining part of metasoma
smooth. Legs with long, almost erect and
rather dense setosity; setae on dorsal side
of hind tibia almost as long as maximum
width of hind tibia. Colour: Head, meso-
soma and legs light or yellowish brown,
with reddish tint partly. Whitish yellow:
greater part of 1st tergite (except large
round black spot in distal half), lateral
parts of 2nd, basal thirds of 3rd-7th ter-
gites. Apical third of 3rd-7th tergites
transparent; remaining parts of tergites
black or dark reddish brown. Antennae
dark reddish brown, lighter basally. Palpi
yellow. Tegulae light brown. Wings faint-
ly infuscate. Pterostigma brown.

Male unknown.

Etymology. — From Latin 'longus' for
'long' and 'tarsus' because all legs are
rather long.

Bracodon/ctes curvinervis sp. nov.

(Figs. 57-67)

Material examined. — Female holotype
with the following data: 'New Guinea:
Neth., Waris, S. of Hollandia, 450-500 m,
VII. 24-31-1959', 'T.C.Maa Collector. Bish-
op' (BPBM).

Description. — Female. Body length: 10.0
mm; fore wing length 8.7 mm. Head: An-
tennae setiform, 62-segmented. Apical
segment with slender apical spine. Pen-
ultimate segment 4 times as long as wide,
0.3 times as long as 1st segment, 0.9 times
as long as apical segment. First flagellar
segment 6 times as long as its apical
width, 1.2 times as long as 2nd segment.
Width of hypoclypeal depression 1.2 times
distance from depression to eye. Clypeus
with flange along lower margin. Tentorial
pits distinct. Cheek height 0.25 times
height of eye, 0.5 times basal width of
mandible. Face width 0.8 times eye height
and 1.1 times height of face and clypeus

Volume 9, Number 1, 2000

129

combined. Eye 1.3 times as high as broad.
Temple behind eyes roundly narrowed,
transverse diameter of eye 1.6 times as
long as temple (dorsal view). POL 0.7
times Od, 0.2 times OOL; Od 0.3 times
OOL. Head strongly and roundly nar-
rowed below eyes. Mesosoma: Length 2.2
times its height. Neck of promesosoma
long. Pronotal keel distinct, but not high.
Notauli rather deep, shallow posteriorly,
finely crenulate in anterior half. Prescutel-
lar depression rather long. Subalar de-
pression entirely smooth. Propodeum
weakly and regularly roundly narrowed
toward apex. Wings: Length of fore wing
3.6 times its maximum width. Pterostigma
5 times as long as wide, 0.75 times as long
as vein Rl. Marginal cell not shortened.
Vein 3RSa almost twice vein r, 0.2 times
the straight vein 3RSb, 1.5 times vein 2RS.
Vein m-cu antefurcal. Second submarginal
short and narrow, weakly widened to-
ward apex, its length 2.7 times its maxi-
mum width, 1.3 times length of 1st sub-
discal cell. First subdiscal cell wide. Dis-
tance from vein cu-a to vein 1M 0.75 times
length of cu-a. Vein 1M and anterior part
of 1st subdiscal cell curved. Hind wing 5
times as long as wide. Legs: Fore tibia with
7 thick spines at almost one row on inner
side and with 8 spines on lower margin.
Middle tibia with 3 spines on outer side
and 5 spines on lower margin. Hind tarsus
1.1 times as long as hind tibia. Second tar-
sal segment 0.4 times as long as 1st seg-
ment, 1.6 times as long as 5th segment
(without pretarsus). Hind basitarsus with
lower keel. Metasoma: Length of 1st ter-
gite nearly equal to its apical width; apical
width almost twice its basal width. Length
of 2nd tergite 0.4 times its basal width, 0.7
times length of 3rd tergite. Ovipositor
sheath 1.1 times as long as metasoma, 0.6
times as long as body, 0.7 times as long as
fore wing. Sculpture and setosity: Head
and mesosoma smooth. Mesoscutum with
2 striae in medioposterior third. Prome-
sosoma crenulate in narrow elongate area
laterally. Metapleura smooth, punctulate-

rugulose in posterior margin. Propodeum
smooth at large basolateral areas, remain-
ing part densely punctulate-rugose; with
distinct median and furcal carinae. Legs
smooth. First and 2nd (except its smooth
lateral parts) metasomal tergites striate;
remaining part of metasoma smooth. Legs
with long, semi-erect and dense setae,
length of setae on dorsal side of hind tibia
0.8-0.9 times as long as maximum width
of hind tibia. Colour: Head, mesosoma
and legs light brown, with reddish tint
partly. Yellow: greater part of 1st tergite
(except round dark spot in distal half), lat-
eral parts of 2nd, base of 3rd-5th tergites,
great part of 6th and entirely 7th tergites.
Apical thirds of 3rd-7th tergites transpar-
ent; remaining parts of tergites dark red-
dish brown. Antennae dark reddish
brown, 2 basal segments lighter. Palpi yel-
low. Tegulae light brown. Wings faintly
infuscate. Pterostigma brown.

Male unknown.

Etymology. — From Latin ' curvus' for
'curved' and 'nervus' for 'vein' because of
the distinctly curved vein 1M and veins of
the 1st subdiscal cell.

Bracodoryctes nigriceps sp. nov.

(Figs. 68-80)

Material examined. — Female holotype
with the following data: 'Songara PL, Po-
pondetta, N.G. Papua, Theobromocoeoa Blu-
te. 20.11 ■ 68, E. Hasson' (BMNH). Para-
type. 1 male, 'Dutch New Guinea: Japen
Is., Mt. Baduri, 1,000 ft, VIII.1938, L.E.
Cheesman, B.M. 1938-593' (BMNH).

Description. — Female. Body length: 10.5
mm; fore wing length 9.3 mm. Head: An-
tennae setiform, remaining 58 segments.
First flagellar segment 5 times as long as
apically wide, 1.2 times as long as 2nd
segment. Width of hypoclypeal depres-
sion 1.4 times distance from depression to
eye. Clypeus with flange along lower mar-
gin. Tentorial pits distinct. Cheek height
0.25 times height of eye, 0.55 times basal
width of mandible. Face width 0.8 times
eye height and 1.2 times height of face and

130

Journal of Hymenoptera Research

clypeus combined. Eye 1.2 times as high
as broad. Temple behind eyes roundly
narrowed, transverse diameter of eye 1.6
times as long as temple (dorsal view). POL
0.6 times Od, 0.3 times OOL; Od 0.45
times OOL. Head rather strongly and al-
most linearly narrowed below eyes. Me-
sosoma: Length twice its height. Neck of
promesosoma rather long. Pronotal keel
distinct and high. Notauli deep and
smooth in anterior half only, absent in
posterior half. Prescutellar depression
rather long. Subalar depression entirely
smooth. Propodeum weakly regularly
roundly narrowed toward apex. Wings:
Length of fore wing 3.8 times its maxi-
mum width. Pterostigma 0.8 times as long
as vein Rl. Marginal cell not shortened.
Vein 3RSa 1.6 times vein r, 0.2 times the
straight vein 3RSb, 1.5 times vein 2RS.
Vein m-cu postfurcal. Second submarginal
rather short and narrow, not widened to-
ward apex, its length 5 times its maximum
width, 1.1 times length of 1st subdiscal
cell. First subdiscal cell wide. Distance
from vein cu-a to vein 1M 0.7 times length
of cu-a. Hind wing 5.3 times as long as
wide. Legs: Fore tibia with 7 thick spines
at almost one row on inner side and with
7 spines on distal margin. Middle tibia
with 2 spines on outer side and 5 spines
on distal margin. Hind tarsus 0.9 times as
long as hind tibia. Second tarsal segment
0.4 times as long as 1st segment, 1.5 times
as long as 5th segment (without pretar-
sus). Hind basitarsus with lower keel. Me-
tasoma: Length of 1st tergite nearly equal
to its apical width; apical width twice its
basal width. Length of 2nd tergite 0.5
times its basal width, equal to length of
3rd tergite. Second suture very fine. Ovi-
positor sheath 1.45 times as long as me-
tasoma, 0.7 times as long as body, 0.85
times as long as fore wing. Sculpture
and setosity: Head and mesosoma
smooth. Promesosoma smooth. Meta-
pleura smooth, punctulate-rugulose in
posterior fifth. Propodeum smooth at
large basolateral areas, remaining part

reticulate-rugulose. Legs smooth. First
metasomal tergite entirely and 2nd in ba-
somedian half striate; remaining part of
metasoma smooth. Legs with large long,
semi-erect and rather dense setae, length
of setae on dorsal side of hind tibia 0.7-
0.9 times as long as maximum width of
hind tibia. Colour: Head black. Mesosoma
light reddish brown. Metasoma dark red-
dish brown, 1st tergite (except mediopos-
terior spot) and sides of 2nd tergite whit-
ish yellow. Antennae reddish brown, 2
basal segments lighter. Palpi yellow. Te-
gulae light brown. Fore and middle legs
light brown, hind leg light reddish brown,
yellowish distally. Wings faintly infuscate.
Pterostigma brown.

Male. Similar to female. Body length 8.7
mm; fore wing length 6.7 mm. Antennae
50-segmented. Penultimate segment 3.7
times as long as wide, 0.8 times as long as
apical segment. Mesosoma slender and
longer, its length 2.5 times height. Ptero-
stigma 5 times as long as wide. Basoven-
tral tooth of hind coxa indistinct. Metaso-
ma long and narrow. First tergite 1.6 times
as long as apical width. Second tergite
without lateral furrows, its length approx-
imately equal to basal width, 1.2 times
length of 3rd tergite. Second suture rather
distinct. Second tergite entirely striate; 3rd
tergite striate, basally and apically
smooth; 4th and 5th tergites almost entire-
ly finely granulose-striate. Length of setae
on dorsal side of hind tibia 1.0-1.2 times
as long as maximum width of hind tibia.
Genitalia Fig. 73.

Etymology. — From Latin 'nigrum' for
'black' and 'caput' for 'head' because the
new species has a black head.

Afrospathius gen. nov.

Diagnosis. — This is the first genus from
the subtribe Psenobolina (Spathiini) from
Old World. Afrospathius gen.n. differs
from other psenoboline genera in the ab-
sence of notauli, rather short marginal cell,
absence of the 2nd radiomedial vein in the
male, the male hind wing with stigma-like

Volume 9, Number 1, 2000

131

enlargement, the 2nd metasomal tergite
with a V-shaped figure, and the hind coxa
with a basoventral tooth. The occurrence
of both a hind wing parastigma in males,
and of a basiventral tooth on the hind
coxa, in many non-psenoboline doryctines
suggests that these are symplesiomorphies
and that the new genus is not simply a
derived species within that group.

Description. — Head: transverse (Fig. 82),
nearly 2.0 times wider than long medially.
Scapus (Fig. 84) wide and short, without
apical lobe; almost 1.5 times longer than
maximum width. First flagellar segment
simple, slightly curved, 1.1-1.3 times as
long as 2nd segment. Palpi rather long;
maxillary palpi 6-segmented, labial palpi
4-segmented; 3rd segment of labial palp
slightly shortened. Hypoclypeal depres-
sion small and round. Clypeus high. Clyp-
eal suture distinct. Malar suture absent
(Fig. 81). Face without submedian depres-
sions above clypeal suture. Eyes glabrous.
Frons not concave and without median
keel. Ocelli in triangle with base 1.3-1.4
times its sides. Vertex distinctly and
sharply convex medially. Occipital carina
present, absent ventrally and not fused
with hypostomal carina. Postgenal bridge
very narrow. Mesosoma: Neck of prome-
sosoma very short, simple dorsally. Pron-
otalkeel indistinct. Propleural lobe short
and narrow. Mesonotum strongly and al-
most perpendicularly raised above pro-
mesosoma, its upper one or two thirds
overhanging over promesosoma (Fig. 85);
anterior upper border of mesoscutum
sharp. Notauli absent or at most very shal-
low on anterior third. Prescutellar depres-
sion rather long and crenulate. Scuto-scu-
tellar suture distinct. Scutellum weakly
convex, without lateral carinae, its length
almost equal to maximum width. Post-
scutellum with small median tooth. Sub-
alar depression rather shallow and wide.
Mesopleural pit distinct. Sternauli shal-
low, long, straight, and crenulate. Prepec-
tal carina distinct and complete. Meta-
pleural flange short, narrow and round

apically. Propodeum without marginate
areas; lateral tubercles weak; propodeal
bridge absent. Propodeal spiracles small
and round. Fore wing: Pterostigma (Figs.
90, 92) wide; vein r arising from or slightly
before middle of pterostigma. Marginal
cell distinctly shortened; vein Rl nearly as
long as pterostigma. Veins 2RS and r-m
present in female (Fig. 90); in male vein r-
m absent (Fig. 92). Vein m-cu interstitial
or slightly antefurcal. Vein m-cu postfur-
cal. Discoidal cell petiolate. Vein 2CUb
slightly curved basally. First subdiscal cell
open apically. Vein M + CU sigmoid.
Hind wing (Figs. 91, 93) with 3 hamuli on
vein Rl. Vein cu-a present. Subbasal cell
medium size. Vein M + CU 1.1-1.4 times
length of 1M. Vein m-cu present, curved
towards base of wing, unsclerotized. Basal
cell narrow, 0.3 times as long as hind
wing. Vein RS arising from vein Rl. Mar-
ginal cell weakly roundly narrowed to-
ward apex, without additional transverse
vein. Vein C + SC + R 1.2-1.5 times
length of SC + R. Hind wing of male with
stigma-like enlargement (Fig. 93). Legs: All
tibiae distinctly thickened. Fore and mid-
dle tibiae with sparse small spines in sin-
gle longitudinal rows. Hind tibia (Fig. 95)
without spines on outer side of apex and
with area on dense white setae on inner
distal edge. Hind coxa small, with baso-
ventral tooth (Fig. 97). Femora with small
anterodorsal protuberances. Hind femur
3.6-3.8 times as long as wide (Fig. 96).
Hind tibial spurs rather short and slender,
sparsely setose, inner spur almost 0.3
times as long as hind basitarsus. Hind bas-
itarsus 0.6-0.7 times as long as 2nd-5th
segments combined. Metasoma: First ter-
gite petiolate, but rather wide (Figs. 87,
89). Acrosternite 0.6 times as long as 1st
tergite, its apical margin distinctly poste-
rior to spiracles (Fig. 88). Dorsope of 1st
tergite very fine; small round basolateral
lobes present. Spiracular tubercles distinct
and placed in basal third of 1st tergite;
dorsal carinae present in basal third only.
Second suture distinct, weakly curved lat-

132

Journal of Hymenoptera Research

Figs. 81-97. Afrospathius dispar gen. & sp. nov. 81 — head, frontal view; 82 — head, dorsal view; 83 — head,
lateral view; 84 — basal segments of antenna; 85 — mesosoma; 86 — mesoscutum; 87 — First metasomal tergite,
Literal view; 88 — First metasomal tergite, ventral view; 89 — metasoma; 90 — fore wing of female; 91 — hind
wing of female; 92 — fore wing of male; 93 — hind wing of male; 94 — male genitalia; 95 — hind tibia; 96 — hind
femur; 97 — hind coxa.

Volume 9, Number 1, 2000

133

erally. Second tergite with V-like figure
(Fig. 89). Second to 6th tergites with sep-
arate laterotergites. Hypopygium small,
with median pointed process mediopos-
teriorly. Ovipositor longer than metaso-
ma; apex of dorsal valve with 2 very small
nodes and apex of ventral valves serrate.
Male genitalia (Fig. 94) without volsellar
apodema, dorsal bridge and basal lobe of
basal ring present.

Distribution. — Africa (Senegal, Came-
roun, South Africa).

Etymology. — from 'afro' for Africa, and
the doryctine genus Spaihius, because this
genus is related to Spaihius. Gender mas-
culine.

Type species. — Afrospathius dispar sp.
nov.

Afrospathius dispar sp. nov.

(Figs. 81-97)

Material examined. — Female holotype
with the following data: 'Senegal, Barn-
bey, 1944, J. Risbec' (BMNH). Paratypes: 5
females, 11 males, 'Senegal, Bambey, 1944,
J. Risbec' (BMNH, ZIP); 2 males, 'Senegal,
Bambey, 623, J. Risbec', '13.V.31' (BMNH);
1 female (without fore wings), 'S.Africa,
R.E. Turner, Brit. Mus. 1921-476', 'Mossel
Bay, Cape Province, 1-14. XI. 1921'
(BMNH).

Description. — Female. Body length: 3.0-
4.3 mm; fore wing length 2.2-3.0 mm.
Head: Antennae 23-24-segmented. First
flagellar segment 6.0-6.5 times as long as
its apical width. Penultimate segment 4.0-
4.5 times as long as wide, 0.5 times as long
as 1st segment, nearly as long as apical
segment. Apical segment not acuminate.
Width of hypoclypeal depression 0.5-0.7
times distance from depression to eye.
Clypeus with flange along lower margin.
Tentorial pits very small. Cheek height
0.4-0.6 times height of eye, approximately
equal to basal width of mandible. Face
width 0.9-1.0 times eye height and equal
to height of face and clypeus combined.
Eye 1.3 times as high as broad. Temple be-
hind eyes weakly roundly narrowed,

transverse diameter of eye 2.5-2.8 times as
long as temple (dorsal view). POL 1.5-1.8
times Od, 0.5-0.6 times OOL; Od almost
0.3 times OOL. Head strongly and round-
ly narrowed below eyes. Mesosoma:
Length 1.7-1.8 times its height. Mesoscu-
tum weakly and shortly concave medially
on anterior sharp margin. Subalar depres-
sion widely crenulate, with granulation
between crenulae. Propodeum slightly
and almost linearly narrowed toward
apex, with small discontinuity near mid-
dle. Wings: Length of fore wing 3.3-3.5
times its maximum width. Pterostigma
2.5-2.8 times as long as wide. Vein 3RSa
1.5-2.0 times vein r, 0.3-0.4 times vein
3RSb, 0.9-1.0 times vein 2RS. Vein 3RSb
roundly curved. Second submarginal nar-
row and rather short, its length 3.3-4.0
times its width, almost equal to length of
1st subdiscal cell. Distance from vein cu-a
to vein 1M 0.7-1.0 times length of cu-a.
First subdiscal cell rather narrow. Hind
wing 4.0-4.7 times as long as wide. Legs:
Fore tibia with 5-6 spines at one longitu-
dinal row on inner side. Hind tarsus 1.1
times as long as hind tibia. Second tarsal
segment 0.5-0.6 times as long as 1st seg-
ment, 1.4-1.5 times as long as 5th segment
(without pretarsus). Metasoma: Length of
1st tergite 1.5-1.7 times its apical width;
apical width 1.6-1.8 times its basal width.
Length of 2nd tergite 0.7-0.8 times its bas-
al width, 0.7-0.8 times length of 3rd ter-
gite. Ovipositor sheath 1.1—1.4 times as
long as metasoma, 0.6-0.7 times as long as
body, 0.9-1 times as long as fore wing.
Sculpture and setosity: Vertex densely
striate; frons, face and cheek densely gran-
ulate, with sparse rugae; temple striate,
with fine granulation. Mesoscutum dense-
ly and irregularly reticulate, only granu-
late in narrow lateral elongate areas. Scu-
tellum granulose-reticulate. Mesopleura
coriaceous in lower half, longitudinally
striate in upper half. Propleura striate in
upper two thirds, granulate in lower third.
Metapleura and propodeum rugulose-re-
ticulate. Legs densely and finely granu-

134

Journal of Hymenoptera Research

late. First metasomal tergite reticulate,
with striations. Second and 3rd tergites
striate with fine transverse rugulae be-
tween striae. Posterior third of 3rd tergite
and 4th-5th tergites entirely very densely
granulate. Legs with very short, semi-
erect, pale, and sparse setae, length of se-
tae on dorsal side of hind tibia almost 0.3
times as long as maximum width of hind
tibia. Colour: Mesosoma and metasoma
black or dark reddish brown. Head and
mesosoma dorsally reddish brown. Palpi
dark reddish brown. Antennae light red-
dish brown, slightly darkened toward
apex. Tegulae dark reddish brown. Legs
reddish brown, yellowish distally. Ovi-
positor sheath black, reddish brown ba-
sally. Wings hyaline, with several wide
dark transverse bands and spots. Ptero-
stigma dark brown. Parastigma and short
distal part of vein SC + R pale yellow.

Male: Body length 2.3-4.3 mm; fore
wing length 1.7-2.9 mm. Antennae 19-24-
segmented. Vein 3RSa regularly roundly
curved. Second radiomedial vein absent.
Stigma-like enlargement of hind wing nar-
row, its length nearly equal to or slightly
shorter than distance from enlargement to
base of wing. Vein SC + R absent. Meso-
scutum variable, smooth or sometimes
coarsely or finely reticulate. Genitalia Fig.
94. Otherwise similar to female.

Remarks. — We have also examined one
male from Cameroun ('Cameroun,
Nkoemvon, 23.IX-25.X.1980, D. Jackson'),
which represents a second species of this
new genus. This specimen differs from A.
dispar sp. nov. by its more elongate body,
its 1st flagellar segment being as long as
the 2nd, the first metasomal tergite being
narrower and longer, the stigma-like en-
largement of the hindwing being smaller,
and the sculpture of mesoscutum being
finer. We are not describing this species
here because we only have a single male
specimen.

Etymology. — From Latin 'dispar' mean-
ing 'different' because males and females

are distinctly different in several morpho-
logical characters.

Hemispathius gen. nov.

Diagnosis. — This new genus is related to
Spathiomorplia Tobias and differs by hav-
ing the hind coxa without basoventral
tooth, body strongly depressed, 2nd and
3rd tergites with two lateral parallel shal-
low furrows, propodeum without margin-
ated areas, and mesoscutum granulate.
Hemispathius gen. nov. differs from Notios-
patJiius Matthew & Marsh by having the
1st subdiscal cell of fore wing closed, body
strongly depressed, 2nd and 3rd tergites
with two lateral parallel shallow furrows,
propodeum without marginated areas.

Description. — Head: subcubical (Fig. 99),
1.3 times wider than long medially. Sea-
pus (Fig. 101) wide and rather short, with-
out any lobes; 1.6 times longer than max-
imum width. First flagellar segment lon-
ger than 2nd segment. Palpi rather long;
maxillary palpi 6-segmented, labial palp
4-segmented; 3rd segment of labial palpi
more or less long. Hypoclypeal depression
rather great and oval (Fig. 98). Clypeal su-
ture complete. Malar suture absent. Face
with 2 small submedian depressions
above clypeal suture. Eyes glabrous. Frons
not concave and without median keel.
Ocelli in equilateral triangle. Occipital ca-
rina present, lower lost and not fused with
hypostomal one. Postgenal bridge narrow.
Mesosoma: Body depressed. Neck of pro-
mesosoma long, with distinct convex dor-
sal lobe. Pronotal keel high, on anterior
third of pronotum. Propleural lobe dis-
tinct and narrow. Mesonotum very weak-
ly and roundly raised above promesoso-
ma (Fig. 102). Median lobe of mesoscutum
without anterolateral angulations (cor-
ners). Notauli crenulate, deep in anterior
half, absent in posterior half. Prescutellar
depression rather short and sculptured.
Scuto-scutellar suture distinct. Scutellum
flat, without lateral carinae, its maximum
width 1.3 times length. Postscutellum with
median carina. Subalar depression shal-

Volume 9, Number 1, 2000

135

109

Figs. 98-110. Hemispathius polystenoides gen. et sp. nov. 98 — head, frontal view; 99 — head, dorsal view; 100 —
head, lateral view; 101 — basal and apical segments of antenna; 102 — mesosoma; 103 — fore wing; 104— hind
wing; 105 — hind tibia; 106 — hind coxa; 107 — hind femur; 108 — First metasomal tergite. lateral view; 109 —
First metasomal tergite, ventral view; 110 — metasoma.

low and rather narrow. Mesopleural pit
shallow and long. Sternauli rather deep,
long, straight and smooth. Prepectal cari-
na distinct and complete. Metapleural
flange rather long, narrow and rounded
apically. Propodeum without marginate

areas; lateral tubercles and propodeal
bridge absent. Propodeal spiracles small
and round. Fore wing: Pterostigma (Fig.
103) rather narrow; Vein r arising almost
from middle of pterostigma. Marginal cell
not shortened. Veins 2RS and r-m present.

136

Journal of Hymenoptera Research

Vein m-cu strongly antefurcal. Vein m-cu
postfurcal. Discoidal cell petiolate. Vein
2CUb arising from middle of apical side
of 1st subdiscal cell. First subdiscal cell
closed. Vein M + CU not curved to vein
1A. Hind wing (Fig. 104) with 3 hamuli
on vein Rl. Vein cu-a present. Subbasal
cell short. Vein M + CU 0.6 times length
of 1M. Vein m-cu present, curved toward
base of wing. Basal cell wide, nearly 0.5
times as long as hind wing. Vein RS aris-
ing from vein Rl. Marginal cell almost
parallel-sided, weakly narrowed near
apex, without additional transverse vein.
Vein C + SC + R 0.6 times length of SC
+ R. Legs: All tibiae slender. Fore tibia
with sparse large spines almost a single
row. Hind tibia without spines on outer
apical side and with area of dense white
setae on inner distal edge. Hind coxa long,
without basoventral tooth (Fig. 106). All
femora without anterodorsal protuberanc-
es. Hind femur 3.2 times as long as wide
(Fig. 107). Hind tibial spurs rather short
and slender, glabrous or sparsely setose,
inner spur almost 0.2 times as long as hind
basitarsus. Hind basitarsus 0.8 times as
long as 2nd-5th segments combined. Me-
sosoma: First tergite petiolate, narrow
(Figs. 108-110). Acrosternite 0.6 times as
long as 1st tergite, its apical margin placed
posterior to spiracles. Dorsope of 1st ter-
gite small; small round basolateral lobes
present. Spiracular tubercles placed in
basal third of 1st tergite; dorsal carinae
present basally only. Second suture fine
and almost straight. Second and 3rd ter-
gites with lateral, shallow, parallel fur-
rows (Fig. 110). Second to 6th metasomal
tergites with separate laterotergites. Ovi-
positor shorter than metasoma; apex of
dorsal valve with 2 small nodes and apex
of ventral valves serrate.

Distribution. — Africa (Uganda).

Etymology. — From Greek 'kemi' for 'half
and the doryctine genus name Spathius,
because this genus has a separate position
in the Spathius-group. Gender: masculine.

Type species. — Hemispathius polystenoides
sp. nov.

Hemispathius polystenoides sp. nov.

(Figs. 98-110)

Material examined. — Female holotype
with the following data: 'Uganda, Kitab-
wa, 2.12.63, Scolytid, K.W.Brown, B2475'
(BMNH).

Description. — Female. Body length: 5.4
mm; fore wing length 3.8 mm. Head: An-
tennae slender, weakly setiform, 42-seg-
mented. First flagellar segment 5 times as
long as its apical width, 1.3 times as long
as 2nd segment. Penultimate segment 5
times as long as wide, 0.5 times as long as
1st segment, as long as apical segment, not
acuminate. Width of hypoclypeal depres-
sion 1.7 times distance from depression to
eye. Clypeus with short flange along low-
er margin. Tentorial pits distinct. Cheek
height 0.2 times height of eye, 0.35 times
basal width of mandible. Face width 0.8
times eye height and 1.5 times height of
face and clypeus combined. Eye 1.2 times
as high as broad. Temple behind eyes
roundly narrowed, transverse diameter of
eye 1.7 times as long as temple (dorsal
view). POL 0.9 times Od, 0.5 times OOL;
Od 0.6 times OOL. Head roundly nar-
rowed below eyes. Mesosoma: Length 3.4
times its height. Subalar depression entire-
ly smooth. Sternauli deep medially. Pro-
podeum almost linearly narrowed toward
apex. Wings: Length of fore wing 4.8 times
its maximum width. Pterostigma 5.5 times
as long as wide, 0.8 times as long as vein
Rl. Vein 3RSa 4.2 times vein r, 0.35 times
the straight vein 3RSb, 1.7 times vein 2RS.
Second submarginal rather short, nar-
rowed apically, its length 2.8 times its
width, nearly equal to length of 1st sub-
discal cell. First subdiscal cell rather nar-
row. Second abscissa of medial vein long,
0.6 times Vein m-cu. Distance from vein
cu-a to vein 1M almost twice length of cu-
a. Hind wing 5.8 times as long as wide.
Legs: Fore tibia with 8 spines at one row
on inner side and with 6 spines on lower

Volume 9, Number 1, 2000

137

margin. Middle tibia with 3 spines on out-
er side and 4-5 spines on lower margin.
Hind tarsus as long as hind tibia. Second
tarsal segment 0.4 times as long as 1st seg-
ment, 1.4 times as long as 5th segment
(without pretarsus). Hind basitarsus with
lower keel. Metasoma: Length of 1st ter-
gite 3 times its apical width; apical width
nearly twice its basal width. Length of 2nd
tergite almost equal to its basal width,
equal to length of 3rd tergite. Ovipositor
sheath 0.6 times as long as metasoma, 0.3
times as long as body, 0.5 times as long as
fore wing. Sculpture and setosity: Head
smooth, face striate. Mesoscutum finely
granulate, rugose on greater medioposter-
ior area. Scutellum very finely granulate.
Mesopleura smooth. Lateral part of pron-
otum rugulose. Metapleura rugulose-stri-
ate. Propodeum densely punctulate-rugu-
lose. Hind coxa and femur very finely
granulate, hind tibia striate. First-3rd me-
tasomal tergites densely rugulose; 4th-6th
tergites finely rugulose-reticulate in basal
halves; 7th tergite finely coriaceous. Body
with long outstanding and rather sparse
setae. Legs with long, erect and rather
dense setae, length of setae on dorsal side
of hind tibia 1.7-2.3 times as long as max-
imum width of hind tibia, significantly
longer than length of setae on ventral side.
Colour: Head light reddish brown. Me-
sosoma light reddish brown, dark dorsal-
ly. Metasoma dark reddish brown, with
light areas laterally and posteriorly on
2nd-6th tergites. Antennae light brown,
darkened toward apex. Palpi yellow. Legs
yellowish brown; hind femur in subapical
two fifths dark. Tegulae yellow. Wings
faintly infuscate. Pterostigma pale yellow,
with brown large median spot.

Male unknown.

Etymology. — From the generic name Po-
lystenus because the habitus is similar to
that of Polystenus species.

Antidon/ctes gen. nov.

Diagnosis. — This new genus belongs to
the Binariini (sensu Belokobylskij, 1992)

being most closely related to the Neotrop-
ical genus Liobracon Szepligeti. The Bina-
riini are defined by the following syna-
pomorphies: occipital carina absent, neck
of pronotum with one or two obtuse or
pointed tubercles or spines, hind coxa
without ventral tubercle, second metaso-
mal tergite with furrows defining an area
and usually with the third segment of the
labial palp distinctly shortened. All of
these are also displayed by the new genus.
The new genus differs from Liobracon in
the scapus not being depressed and lack-
ing the dense apical row of setae, though
the scapus does have a distinct apical lobe
as in Liobracon. It also differs in that the
marginal cell of the hind wing lacks an ad-
ditional transverse vein, and in that the
dorsal part of the pronotum is flat and has
low lateral tubercles. The new genus also
appears to be related to the Australian
binariine genus Acanthodoryctes Turner
from which it differs in having the third
segment of labial palp short, frons rather
flat, scapus with distinct apical lobe, mar-
ginal cell of fore wing not shortened, hind
wing with vein m-cu, pronotum without
a pair of spine-like protuberances, and 1st
metasomal tergite without especially
modified setosity (Quicke 1984; Quicke et
al. 1992b; Austin et al. 1994).

Description. — Head: subcubical (Fig.
112), 1.3 times wider than medially long.
Scapus with distinct semicircular apical
lobe (Fig. 114), rather narrow and long, 2.5
times longer than maximum width. Palpi
relatively long; maxillary palp 6-segment-
ed, labial palp 4-segmented. Third seg-
ment of labial palp shortened, subtrian-
gular, 0.55-0.6 times as long as 2nd and
4th segments separately. Hypoclypeal de-
pression small and round (Fig. 111). Clyp-
eal suture wide and complete. Subocular
(malar) suture very shallow. Face with
two distinct submedian, oval depressions
above clypeal suture. Eyes glabrous. Frons
not concave and without a midlongitudi-
nal keel. Ocellar triangle with base 1.2
times longer than sides. Postgenal bridge

138

Journal of Hymf.noptera Research

Figs. 111-122. Antidoryctes pronotalis gen. et sp. nov. Ill — head, frontal view; 112 — head, dorsal view; 113-
labial palp; 114 — scapus and pedicellus; 115 — mesosoma, lateral view; 116 — hind coxa; 117 — hind tibia; 118-
hind femur; 119 — metasoma, dorsal view; 120 — apex of ovipositor; 121 — fore wing; 122 — hind wing.

very narrow. Mesosoma: Neck of prome-
sosoma rather long, more or less flat dor-
sally, with two distinct elongate, obtuse,
wide lateral protuberances. Pronotal keel
high, concave medially, situated near an-
terior margin of pronotum. Propleurae
without protuberances. Propleural lower
lobe distinct and wide. Mesonotum rather
highly and roundly raised above prome-
sosoma (Fig. 115). Medial lobe of meson-
otum without antero-lateral angulations
(corners). Notauli smooth, deep along an-
terior half, shallow or almost absent pos-
teriorly. Prescutellar depression rather
short and sculptured. Scuto-scutellar su-
ture distinct. Scutellum weakly convex,
without lateral carinae, 1.3 times longer
than maximum width. Postscutellum (me-
dian area of metanotum) with short, flat
medial tooth. Subalar depression deep,

narrow and placed rather low (Fig. 115).
Mesopleural pit shallow. Sternauli deep,
long, straight, and crenulate. Prepectal ca-
rina distinct and complete, not higher than
sternauli. Prepectus with distinct and
oblique lateral furrows. Metapleural
flange rather long, wide and round api-
cally. Metapleural suture present. Propo-
deum without areas; lateral, tubercles and
propodeal bridge absent. Propodeal spi-
racles small. Wings: Pterostigma of fore
wing (Fig. 121) wide; Vein r arising almost
from middle of pterostigma. Marginal cell
slightly shortened. Veins 2RS and r-m pre-
sent. Vein m-cu antefurcal. Vein m-cu in-
terstitial. Discoidal cell short, petiolate.
Vein 2CUb arising from posterior fifth of
apical side of 1st subdiscal cell. First sub-
discal cell closed. Veins la and 2a absent.
Hind wing (Fig. 122) with four hamuli on

Volume 9, Number 1, 2000

139

vein Rl. Vein cu-a present. Subbasal cell
large. Vein M + CU nearly twice length
of 1M. Vein m-cu present, antefurcal, al-
most perpendicular to medial vein. Basal
cell wide, 0.55 times as long as hind wing.
Vein RS arising from vein 1M near vein
Rl. Marginal cell weakly narrowed to-
wards apex, without additional transverse
vein. Vein C + SC + R 1.5 times length of
SC + R. Legs: Fore and middle tibiae with
one longitudinal row of widely-spaced,
large spines. Hind tibia with two small
spines apico-laterally, and with area of
dense white setae near apex medially.
Hind coxa small, without basoventral
tooth (Fig. 116). Femora simple, without
dorsal protuberances. Hind femur 3.5
times longer than wide (Fig. 118). Hind
tibial spurs rather short, weakly thick-
ened, sparsely setose, inner spur approxi-
mately 0.33 times as long as hind basitar-
sus (Fig. 117). Hind basitarsus 0.7 times
length of segments 2-5 combined. Meta-
soma: First tergite not petiolate, wide (Fig.
119), with small round basolateral lobes.
Dorsope large. Spiracular tubercles indis-
tinct, spiracles located on basal third of
tergite. Acrosternite approximately 0.25
times as long as 1st tergite, its apical mar-
gin distinctly before spiracles. Second ter-
gite with small, semi-oval mediobasal area
(Fig. 119). Second suture distinct, weakly
curved laterally. Second and third tergites
with separate laterotergites. Hypopygium
small, with two pointed and separate pro-
cesses medioposteriorly. Ovipositor lon-
ger than metasoma; apex of dorsal valve
with 2 small nodes (Fig. 120).

Distribution. — Australia.

Type species. — Antidoryctes pronotalis sp.
nov.

Etymology. — From Latin " anti" for "con-
trary" and the generic name Doryctes.
Gender masculine.

Antidoryctes pronotalis sp. nov.
(Figs. 111-122)

Material examined. — Female holotype
with the following data: "Millstream Falls,

near Ravenshoe, NQ1, 5 Jan. 1967", "M. V.
Lamp, D. K. McAlpine & G. Holloway"
(BMNH).

Description. — Female. Body length: 15
mm; fore wing length 10.8 mm. Head:
strongly and roundly narrowed below
eyes. Width of hypoclypeal depression 0.8
times distance from depression to eye.
Clypeus without carina separating off hy-
poclypeus. Tentorial pits distinct. Cheek
height 0.4 times height of eye, 0.8 times
basal width of mandible. Width of face
nearly equal to height of eye and equal to
combined height of face and clypeus. Eye
1.2 times higher than broad. Temple be-
hind eyes roundly narrowed, transverse
diameter of eye 1.5 times length of temple
(in dorsal view). POL 0.7 times Od, 0.5
times OOL; Od 0.7 times OOL. Mesoso-
ma: 2.2 times longer than high. Subalar
depression smooth, crenulate on anterior
third. Propodeum convex and roundly
narrowed towards apex. Wing: Length of
fore wing 3.5 times its maximum width.
Pterostigma 3.3 times as long as wide, 0.6
times length of vein Rl. Parastigma thick-
ened. Vein r arising from middle of pter-
ostigma. Vein 3RSa 3.3 times vein r, 0.4
times the straight vein 3RSb, 1.4 times 2nd
radiomedial vein. Second submarginal
rather short, twice as long as wide, 0.8
times length of 1st subdiscal cell. First sub-
discal cell wide. Vein 2M rather short, 0.3
times length of vein m-cu. Hind wing 4.5
times as long as wide. Legs: Fore tibia with
longitudinal row of 5-6 spines and with 7
spines on distal margin. Middle tibia with
two medial spines and with 6 spines on
distal margin. Hind tarsus 0.7 times length
of hind tibia. Hind basitarsus 2.0 times
longer than 2nd segment. Second segment
approximately as long as telotarsus (ex-
cluding pretarsus). Hind basitarsus with-
out ventral keel. Metasoma: Length of 1st
tergite 0.9 times its apical width. Second
tergite 0.6 times as long as basally wide,
1.2 times length of 3rd tergite. Ovipositor
sheath 1.2 times metasomal length, 0.6
times body length, 1.1 times fore wing

140

Journal of Hymenoptera Research

length. Sculpture and setosity: Head
smooth; face coarsely and irregularly re-
ticulate-rugose. Mesosoma largely
smooth; propleura rugose on anterior
third, metapleura reticulate rugose, almost
smooth on upper, anterior third. Propo-
deum finely reticulate. Legs smooth. Me-
tasoma smooth, furrow around basal area
of 2nd tergite distinctly, sparsely crenu-
late. Metapleura and propodeum with
sparse, long, pale setae. Legs with long,
erect, pale, rather sparsely distributed se-
tae; lengths of setae arising from dorsal
surface of leg 1.1-1.3 times maximum
width of hind tibia. Colour: Head yellow-
ish white. Pro- and mesothorax (except
posterior side of mesoscutum and scutel-
lum) and 3rd-6th metasomal tergites
black. Rest of mesosoma and posterior of
metasoma light reddish brown. Metaso-
mal tergites 1 and 2 yellow. Scapus dark
reddish brown, pedicel light reddish
brown. Palpi yellow. Legs light reddish
brown. Fore coxae largely, mid and hind
coxae entirely, mid and hind trochanters
and hind femur dark reddish brown to
black. Mid- and hind tarsi reddish. Tegu-
lae reddish brown. Wings infuscate with
yellowish tint. Pterostigma and veins on
basal quarter yellow, remaining venation
dark but becoming paler again towards
apex.

Male unknown.

Etymology. — Because the pronotum is
likely to show species level defferences as
in other genera of Binariini.

ACKNO WLEDGEM ENTS

We thank Amoret Brandt for editorial assistance.
This work was supported by the NERC Initiative in
Taxonomy.

LITERATURE CITED

Austin, A. D., D. L. J. Quicke and P. M. Marsh. 1994.
Systematics of the hymenopteran parasitoids of
the eucalypt longicorns, Phoracantha spp. (Cole-
optera: Cerambycidae) in Australia, with a de-
scription of a new doryctine genus Hymenop-
tera; Braconidae). Bulletin of Entomological Re
\earch 84: 145-174.

Belokobylskij, S. A. 1987. Structure of the male geni-
talia in the braconid subfamily Doryctinae (Hy-
menoptera, Braconidae), their evolution and im-
plications for the classification of the group. Tru-
dy Vsesoyuznogo Entomologicheskogo Obschestva 69:
209-219. (In Russian.)

Belokobylskij, S. A. 1992. On the classification and
phylogeny of the braconid wasps subfamilies
Doryctinae and Exothecinae (Hymenoptera, Bra-
conidae). Part I. On the classification, 1. Entomo-
logicheskoye obozreniye 71: 900-928. (In Russian.)

Belokobylskij, S. A. 1994. A new tribe of the subfam-
ily Doryctinae from Papua New Guinea (Hy-
menoptera: Braconidae). Zoolsystematica Rossica 3,
141-145.

Fischer, M. 1981. Versuch einer systematischen Glied-
erung der Doryctinae insbesondere der doryctini,
und Redeskriptionen nach Material aus dem Na-
turwissenschaftlichen Museum in Budapest (Hy-
menoptera, Braconidae). Polskic Pismo Entomolo-
giczne 51: 41-99.

Marsh, P. M. 1993. Descriptions cf new western hemi-
sphere genera of the subfamily Doryctinae (Hy-
menoptera: Braconidae). Contributions of the
American Entomological Institute 28: 3-58.

Marsh, P. M. 1997. Subfamily Doryctinae. In R. A.
Wharton, P. M. Marsh and M. J. Sharkey (Eds).
Manual of the New World genera of the Family Bra-
conidae (Hymenoptera). Special Publication of the
International Society of Hymenopterists 1: 206-
233.

Quicke, D. L. J. 1984. The genus Acanthodoryctes Turn-
er (Hymenoptera, Braconidae): Re-description
and new generic synonymy. Pan-Pacific Entomol-
ogist 60: 97-100.

Quicke, D. L. J. 1987. The Old World genera of bra-
conine wasps (Hymenoptera: Braconidae). Jour-
nal of Natural History 21: 43-157.

Quicke, D. L. J. 1997. Subfamily Braconinae. In R. A.
Wharton, P. M. Marsh and M. J. Sharkey (Eds).
Manual of the New World genera of the Family Bra-
conidae (Hymenoptera). Special Publication of the
International Society of Hymenopterists 1: 149-
174.

Quicke, D. L. J., J. Tunstead, J. V. Falco, and P. M.
Marsh. 1992a. Venom gland apparatus in cyclo-
stome braconid wasps with special reference to
the subfamily Doryctinae (lnsecta, Hymenoptera,
Braconidae). Zoologica Scripta 21: 403-4 16.

Quicke, D. L. ]., S. N. Ingram, |. Proctor and T. Hud-
dleston. 1992b. Batesian and Mullerian mimicry
between species with connected life histories
with a new example involving braconid wasp
parasites ot Phoracantha beetles, journal of Natural
History 26: 1013-1034.

Rahman, M. II., M. G. litton and D. L. |. Quicke.
1998. Ovipositor internal microsculpture and
other features in doryctine wasps (lnsecta, Hy-

Volume 9, Number 1, 2000 141

menoptera, Braconidae). Zoologica Scripta 27: Opredelitel nasekomykh evropeyskay chasti SSSR.

333-343. Pereponchatokrylye [Keys to the insects of the Eu-

Shenefelt, R. D. and P. M. Marsh. 1976. Hymenopter- ropean part of the USSR. Hymenoptera], Lenin-

orum Catalogus (nova editio). Pars 13. Braconidae grad, Nauka 3, P. 7-15. (In Russian.)

9. Doryctinae. 's-Gravenhage: Dr. W. junk. 1263- Wharton, R. A., P. M. Marsh and M. J. Sharkey. 1997.

1424. Manual of the New World Genera of the Family Bra-
Tobias V. I. 1986. Order Hymenoptera. Family Bra- conidae (Hymenoptera). Special Publication of the

conidae. Introduction. In: G. S. Medvedev, (ed.). International Society of Hymenopterists, 1.

J. HYM. RES.
Vol. 9(1), 2000, pp. 142-169

Morphometric Analysis and Descriptions of Selected Species in the
Encarsia strenua Group (Hymenoptera: Aphelinidae)

J. M. Heraty and A. Polaszek

(JMH) Department of Entomology, University of California, Riverside, CA 92521, USA;

(AP) CABI Bioscience, Ascot, SL5 7PY, U.K.

Abstract. — The Encarsia strenua group is defined using three synapomorphies: presence of 1-3
specialized setae at the apex of the costal cell, a bare area above the stigmal vein and closely
placed scutellar sensillae. Few morphological characters were found that could accurately distin-
guish some species of the strenua group because of variability within species and the lack of
diagnostic differences among species. The morphometric relationships of females of five closely
related species of the strenua group were explored using bivariate and multivariate statistical
methods. Univariate or bivariate measures could not distinguish all groups, however, all five
species were discriminated along the first two canonical variates. Host relationships, although
having a strong effect on general size, do not affect the discrimination of taxa An identification
key is provided for six species of the strenua group. Encarsia citri, E. protransi'ena and £. strenua
are redescribed. Two new species, E. bimaculata and E. neocala, are described. Encarsia sophia
(Girault & Dodd) is proposed as a senior synonym of E. transvena (Timberlake).

The genus Encarsia (Hymenoptera:
Aphelinidae, Coccophaginae) is a diverse
and cosmopolitan group of species usual-
ly parasitic on Aleyrodidae (whiteflies),
Diaspididae (armored scales), or them-
selves (as autoparasitoids) (Polaszek
1991). A few species are parasitoids of the
eggs of Lepidoptera (Polaszek 1991). At
present there are more than 200 described
species of Encarsia (Polaszek et al. 1992),
and new species are continually being de-
scribed or recognized. The genus Encarsia
represents one of the most important par-
asitic groups used in biological control,
and various species are currently being
collected as part of intensive foreign ex-
ploration efforts to search for parasites of
whiteflies of the genus Bemisia. Several
species of Encarsia have demonstrated
their importance for control of San Jose
Scale (£. perniciosi (Tower)) (Clausen
1978), Greenhouse whitefly (E.formosa Ga-
han) (Clausen 1978), Ash whitefly (£. ina-
ron (Walker)) (Bellows et al. 1992), and
Spiny blackfly (£. sittithi (Silvestri)) (Ku-

warta 1934). New programs are focusing
on the control of Bemisia with E. protrans-
vena Viggiani and £. sophia (Girault) and
on citrus whitefly in California with £.
variegata Howard (T. Bellows, pers.
comm.). Biological and taxonomic charac-
teristics remain poorly known even for
common species of Encarsia.

Within Encarsia, approximately 29 spe-
cies groups are recognized by various au-
thors (Viggiani & Mazzone 1979; Hay at
1989; Polaszek et al. 1992), with as few as
16 groups in the most recent treatment by
Hayat (1998). Few of these groups are rec-
ognized by morphological characters and
different species may be included in each
by various authors. We have rediagnosed
the strenua species group, which is here
recognized by having closely spaced scu-
tellar sensilla (Figs. 5, 20), a group of one
to three marginal setae at the apex of the
costal cell of the fore wing (Fig. 10, arrow),
and a bare area just anterior to the stigmal
vein (Fig. 10). The strenua group now in-
cludes 40 species, more than a third of
these previously undescribed.

Volume 9, Number 1, 2000

143

In this paper we attempt to address
problems in the taxonomy of a subset of
species, which rank among the more im-
portant members of the stremia group for
the control of economically important
whiteflies. Resolution of this complex is
necessary before going ahead with an
identification key to the 40 recognized
species. Morphometric analysis, descrip-
tions and an identification key are pre-
sented to express the differences between
E. bimaculata new species, E. citri Ishii (re-
vised status), E. neocala new species, E.
protransvena, and E. strenua. One of the
most commonly enountered species in ag-
ricultural settings, £. sophia, can be readily
distinguished by discrete morphological
attributes from other species in the strenua
groups, and was not included in the mor-
phometric analyses.

MATERIALS AND METHODS

Morphometric analysis. — In total, 196 fe-
males of five species of Encarsia, £. bima-
culata (n = 61), £. citri (12), £. neocala (15),

E. protransvena (83) and £. strenua (24)
were measured. Males are rare or un-
known for some species and were not in-
cluded. Measurements were taken from
slide-mounted material (Table 1) amassed
from collections at the National Museum
of Natural History (USNM), University of
California (UCRC), Texas A&M Universi-
ty (TAMU), and Instituto di Entomologia

F. Silvestri, Portici, Italy (IEUN). Encarsia
protransvena were included from multiple
locations in various Gulf Coast States
(Mississippi, Florida, Georgia), Puerto
Rico, Colombia, Spain and the Grand Cay-
mans, and several different host white-
flies: Bemisia tabaci (Gennadius), Dialeuro-
des citri (Ashmead), D. citrifolii (Morgan),
D. kirkaldii (Kotinsky), Parabetnisia myricae
(Kuwana), and Trialeurodes abutiloneus
(Haldeman). Encarsia neocala were mea-
sured from a single collection from New
Caledonia reared from Orchamoplatus
[probably caledonicus (Dumbleton)] (Aley-
rodidae). Encarsia citri were measured

from a single collection in Japan from D.
citri. Encarsia bimaculata were sampled
from the Oriental Region (Hong Kong, In-
dia, Philippines, Thailand) and the Nearc-
tic Region (Florida, Texas) and reared only
from B. tabaci. Most specimens were
mounted in Hoyer's medium, although a
few were mounted in Canada Balsam.
Measurements of type material were in-
cluded for E. strenua, E. bimaculata and £.
protransvena. The type material of £. pro-
transvena is distorted, with measurements
of the ovipositor most affected. Although
this distortion greatly affected the univar-
iate statistics, and hence their separation
in the identification key, there was no
overall affect on the placement of these
specimens in the discriminant analyses.
Measurements of the holotype of £. armata
were initially included but they were very
distinct from the other material and the
data were removed from further analyses
to prevent a general distortion of the re-
sults from the single specimen. Specimens
were chosen that could be measured for
all of the values so that missing values
were not a part of the data set.

Size and shape differences were char-
acterized by choosing 16 landmark points
(black dots, Fig. 1) on the fore wing (1A,
5 points), gaster (IB, 3 points), mid tibia
(1C, 2 points) and antenna (ID, 6 points).
Measures of the apex of the fore wing
could not be associated with specific struc-
tures and points were chosen by estimat-
ing the most apical point of the fore wing
(FWL) and the greatest distance perpen-
dicular to the anterior margin of the fore
wing (FWW). The 10 measures (Fig. 1, Ta-
ble 2) were selected as being appropriate
for separating these and other species of
Encarsia.

Specimens were measured using a Leica
DMRB microscope at 78.8 X magnifica-
tion. Point measures were taken using
Morphosys (Meachum & Duncan 1987)
through a Sony DXC-107 videochip cam-
era. Reference coordinates were collected
and converted to euclidean distances in

144

Journal of Hymenoptera Research

Table 1. Encarsia species and associated geographic and biological information used in the morphometric
analysis. The host list is complete for the material available. Additional host records for E. protransvena include
Trialeurodes variabilis on Carica (Caricaceae) and Aspidiotus on Dioscorea (probably erroneous). Questionable
localities (possibly contaminated laboratory cultures) are marked by a double question mark.

Encarsia

jcality

Host species

Plant host

E. bimaculata

Hong

Kong

Bemisia tabaci

Hibiscus (Malvaceae)

India

Bemisia tabaci

Hibiscus

India

Bemisia tabaci

culture

Israel

Bemisia tabaci

culture

Mexico ??

Bemisia tabaci

Hibiscus

Philippines

Bemisia tabaci

Solatium (Solanaceae)

Sudan ??

Bemisia tabaci

culture

USA:

Florida

Bemisia tabaci

Hibiscus

USA:

Florida

Bemisia tabaci

Sesamum (Pedaliaceae)

USA:

Florida

Bemisia tabaci

Euphorbia (Euphorbiaceae)

USA:

Texas

Bemisia tabaci

culture

E. citri

Japan

Dialeurodcs citri

Citrus (Rutaceae)

E. neocala

New

Caledonia

Orchamplatus sp.

Citrus

E. protransvena

Colombia ??

Dialeurodes citrifolii

Citrus

Grand Cayman

Dialeu rodes citrifolii

Citrus

USA:

Florida

black whitefly

Eiquidambar (Hamamelidaceae)

USA:

Florida

Dialeurodes citri

Ligustrum (Oleaceae)

USA:

Florida

Dialeurodes citri

Melia (Meliacae)

USA:

Florida

Dialeurodes citri

Citrus

USA:

Florida

Dialeu rodes citrifolii

Dioscorea (Dioscoreaceae)

USA:

Florida

Dialeurodes citrifolii

Citrus

USA:

Florida

Dialeurodes kirkaldii

Jasminum (Oleaceae)

USA:

Florida

Dialeurodes sp.

Jasminum

USA:

Florida

Trialeurodes abutilonia

Solatium (Solanaceae)

USA:

Georgia

Dialeurodes citri

Jasminium

USA:

Georgia

Bemisia tabaci

Gossypium (Malvaceae)

USA:

Georgia

Bemisia tabaci

Hibiscus

USA:

Mississippi

Bemisia argentifolia

Abelmoschus (Malvaceae)

USA:

Mississippi

Bemisia argentifolia

Cleome (Capparaceae)

Puerto Rico

Dialeurodes citrifolii

Citrus

Puerto Rico

Dialeurodes citri

Citrus

Puerto Rico

Parlatoria ziziphi*

Citrus

Spain

Parabemisia myricae

unknown

E. strenua

China: Guangzhou

Dialeurodes sp.

Citrus

Hong

Kong

Dialeurodes kirkaldii

jasmin nan

Hong

Kong

Bemisia giffardii (HT)

unknown

India

Dialeurodes citri

Citrus

USA:

California

Parabemisia myricae

Citrus

* Probably a wrong association (Diaspididae).

Morphosys, and analyzed using the statis-
tical analysis system (SAS, Version 6.12)
software. Principle component analysis
(PCA) was performed on the variance-co-
variance matrix for the 10 variables
formed from the logarithms (base 10) of
the raw data. PCA was performed to ob-

serve the distribution of observations
without the a priori constraints of assign-
ing them to a particular species (class). Ca-
nonical variates analysis (CVA) was used
to evaluate variables for the discrimina-
tion of individuals using the five species
as class variables in the analysis. In all cas-

Volume 9, Number 1, 2000

145

Fig. 1. Measurements of female Encarsia for morphometric analysis. Dots are landmark points, the coordi-
nates of which were recorded in Morphosys; heavy lines are calculated distances. (A) fore wing, (B) gaster,
(C) mid tibia, (D) antenna.

es, analysis of the raw data was virtually ses was rejected (P < 0.0001, x: = 405.05,

the same as the log-transformed data but 220 df); therefore within class rather than

only the latter is presented. Homogeneity pooled covariance matrices were used,

of the covariance matrices of the five clas- The data sets and a list of locality and host

Table 2. Description of distances measured for morphometric analyses.

Abbrevi-
ation

Charac tei

FWL

Fore wing length

FWW

Fore wing width

MFL
OVL

TVL

Marginal fringe length
Ovipositor length
Third valvula length

MTL

Metaribial length

CLV

Clava length

FUN

Funicle length

F1L
F2L

Flagellomere 1 length
Flagellomere 2 length

■ iption

Maximum length from apex of humeral plate to wing apex.

Maximum width measured perpendicular to tore wing margin.

length of fringe seta at posterior wing margin.

I ength trom proximal margin of basal ring to extreme apex

Maximum lateral length.

Maximum dorsal length.

Maximum dorsal length (excluding anellus).

Maximum dorsal length.

146 Journal of Hymenoptera Research

information is available from the authors ric and usually occur in different hosts

upon request. {Bemisia versus Dialeurodes), although both

have been reared from Bemisia. Some spe-

KhbULlb cjes are p0lyphagous. Encarsia protrans-

Two distinct clusters of species were ap- vena were reared from seven different host
parent from our initial observations of species in four genera, and in many cases,
specimens, although these can be difficult were reared from different host species at
to separate on the basis of one or even a the same locality. The two specimens of £.
few absolute characteristics. Encarsia stren- protransvena reared from Parabemisia in
ua and E. neocala have a proportionally Spain represent a substantial departure in
longer ovipositor in relation to body size both host and range, but these specimens
than do E. bimaculata, E. citri and E. pro- clustered for all of the following measure-
transvena. Although this characteristic is ments and comparisons with other E. pro-
usually distinct, a number of specimens transvena. Interestingly, it had been a sin-
fall into a gray zone in which making an gle odd specimen, a dark female of Encar-
accurate decision is difficult. Within each sia transvena from Florida (females nor-
cluster, species are also difficult to sepa- mally completely yellow), that had raised
rate because of few clearly defined or ab- our initial suspicions about whether £. bi-
solute characteristics. Encarsia protransvena maculata was merely a dark form of E. pro-
and E. citri have been considered as the transvena, and prompted this study,
same species in the past (Polaszek et al. Univariate and Bivariate Analysis. — Uni-
1992), but characteristics of the third val- variate measures, along any particular
vula (angulate with a prominent lateral axis, are either overlapping or very mar-
seta in E. citri) suggest they are distinct ginally separate species (Table 3), exem-
species, but again, no single measurement plifying the problems associated with sep-
or ratio provides absolute separation of all arating species by individual measures,
individuals. Females of Encarsia bimaculata Although certain species can be clearly
are easily distinguished from other species separated, there is a narrow zone of over-
in the analysis by their predominantly lap, at least in size, for the pairs of species
dark color (usually a feature of males) and we would consider as closely related (E.
much shorter ovipositor to clava ratio neocala and E. strenua, E. protransvena and
(1.33-1.78 versus greater than 2.0 in the E. citri). Of the two groups initially rec-
other species), but otherwise they are very ognized (E. bimaculata, E. citri and E. pro-
similar to E. protransvena. transvena versus E. strenua and E. neocala),

The host ranges for each Encarsia spe- the ratio of ovipositor length to mid tibial
cies vary from very specific to polypha- length (OVL/MTL) is probably the best
gous (Table 1). For E. citri and E. neocala, means of separation (Table 4). The overlap
host specificity may be a product of geo- in the range of OVL/MTL for E. protrans-
graphic isolation and limited host avail- vena with E. strenua and E. protransvena is
ability. For example, a laboratory culture primarily the result of distortions in the
of E. citri has been reared successfully for type material; only one paratype specimen
a few years on Bemisia argent ifolii Bellows exceeds a ratio of 1.58, and only five spec-
& Perring (Bellows, pers. comm.; cultures imens, including the two paratypes, ex-
verified by Heraty & Polaszek). However, ceed a ratio of 1.55, which is less than any
Encarsia bimaculata has a broad geographic of the E. strenua or E. neocala. No other
host range and has been reared only from measures by themselves distinguished the
one (B. argentifolii, but possibly also B. ta- two groups. Since not all specimens can be
baci) species of Bemisia (Table 1). Both E. mounted perfectly, any separation based
bimaculata and £. protransvena are sympat- only an OVL/MTL ratio of more or less

Volume 9, Number 1, 2000

147

Table 3. Univariate statistics for variables in the morphometric analyses of Encarsia data set. Variables are
means (standard deviation) over range in millimeters.

Variable

bimaculata

protransvena

citri

strenua

neoatfa

FWL

0.48 (0.04)

0.60 (0.07)

0.77 (0.06)

0.73 (0.70)

0.55 (0.04)

0.34-0.54

0.48-0.75

0.65-0.85

0.61-0.82

0.50-0.63

FWW

0.16 (0.02)

0.21 (0.03)

0.31 (0.02)

0.28 (0.03)

0.23 (0.02)

0.12-0.20

0.16-0.28

0.26-0.35

0.02-0.33

0.21-0.27

MFL

0.07 (0.01)

0.06 (0.01)

0.07 (0.01)

0.06 (0.01)

0.05 (0.01)

0.06-0.08

0.05-0.07

0.06-0.08

0.04-0.07

0.04-0.06

OVL

0.02 (0.02)

0.30 (0.03)

0.34 (0.02)

0.47 (0.05)

0.30 (0.03)

0.15-0.23

0.22-O.37

0.28-0.36

0.35-0.55

0.27-0.34

TVL

0.06 (0.00)

0.08 (0.01)

0.09 (0.01)

0.14 (0.02)

0.10 (0.01)

0.05-0.07

0.05-0.11

0.08-0.10

0.11-0.16

0.08-0.12

MTL

0.16 (0.01)

0.21 (0.03)

0.26 (0.02)

0.27 (0.03)

0.18 (0.02)

0.12-0.18

0.16-0.27

0.22-0.28

0.21-0.32

0.16-0.21

CLV

0.13 (0.01)

0.16 (0.01)

0.13 (0.01)

0.10-0.15

0.09-0.15

0.14-0.17

0.13-0.17

0.12-0.14

FUN

0.12 (0.01)

0.14 (0.02)

0.19 (0.01)

0.18 (0.02)

0.12 (0.01)

0.08-0.14

0.10-0.17

0.17-0.21

0.15-0.20

0.10-0.14

FIL

0.04 (0.00)

0.05 (0.01)

0.06 (0.01)

0.04 (0.01)

0.03-0.05

0.03-0.06

0.05-0.07

0.04-0.07

0.03-0.05

F2L

0.04 (0.01)

0.05 (0.01)

0.07 (0.00)

0.06 (0.01)

0.04 (0.01)

0.02-0.05

0.03-0.06

0.02-0.05

0.04-0.06

0.03-O.05

than 1.55 may fail and other measures or
characteristics are necessary.

Through combinations of variables,
more distinctive nonoverlapping differ-
ences occur. Encarsia bimaculata are dis-
tinct from £. citri in all bivariate plots (Fig.
2). Encarsia protransvena show some over-
lap with £. bimaculata and £. citri in most
plots, with £. citri most distinct for OVL/
CLV (Fig. 2B), OVL /FUN (Fig. 2C) and
TVL /FUN (Fig. 2D) and £. bimaculata
most distinct for OVL /CLV (Fig. 2B) and

OVL /FUN (Fig. 2C). In no case is there a
clear, non-overlapping, separation of these
species based on either univariate statis-
tics (Table 2) or, with the exception of
OVL /CLV for £. bimaculata, the ratios
formed by each of these combinations (Ta-
ble 4). The noticeable overlap between £.
neocala and £. protransvena for some char-
acters (Figs. 2: B, C) can be dismissed by
other more distinctive morphological
characteristics (dark pronotum, broader
fore wing, longer ovipositor). Encarsia two-

Table 4. Range of ratio measures for the combinations of features represented in Figure 1.

Ratio

hlHlih'uliUti

protransvena

FWL /FWW

2.58-2.99

2.62-3.11

2.39-2.68

2.44-2.67

2.32-2.44

OVL /CLV

1.33-1.78

2.00-3.37

2.00-2.34

2.43-3.26

2.16-2.56

OVL /FUN

1.52-1.94

1.85-2.85

1.63-2.01

2.35-2.89

2.39-2.76

TVL/FUN

0.43-0.59

0.40-0.79

0.42-0.54

0.70-0.89

0.72-0.98

TVL /OVL

0.25-0.36

0.19-0.32

0.24-O.30

0.27-0.34

0.29-0.38

OVL /MTL

1.09-1.38

1.29-1.74

1 .22-1 .35

1.56-1.97

1.60-1.79

148
0.9

08
rP 0.7

Journal of Hymenoptera Research

0.6

J 0.5

0.4

bimaculata

protransvena

strenua

neocala

citri

0.3 4—
0.10

u.o -

» »

-0.5 -

V v

f04-

0 °

ositor Le
o

o °
o

o <f

■

g.
°0.2 -

o°

•

° •

•

0.1

— i 1

0.15 020 025 030

Forewing Width (FWW)

0.35

n o 4

c
m

£ 0.3

(A
O
Q.
>

0.2

.■<*,'.*.

;>**•--•

■j

0.40 0.08

0.18

_0.16

t0. 14

£0.12

i 0.10 ^

0.10 0.12 014 016

Clava Length (CLV)

0 18

-d 0.08

006

'? ♦

'»' .

°4K

0.1 -1— — i— — r— — i— — r— — <— — r— —I 0.04

0 06 0.08 0.10 0.12 0.14 0.16 018 0.20 0.22 0.06 0.08 0 10 0.12 0.14 0 16 0.18 0 20 0.22

Funicle Length (FUN) Funicle Length (FUN)

0.6

U. IO

0.16

• » <

' V

to. 14 ■

» T

<5 0.12 -

g 0.10 -

-o 0.08 -

0.06 -
n 04

01 0.2 0.3 0.4

Ovipositor Length (OVL)

0.5

0.6

0.10 0.15 0.20 0.25

Midtibial Length (MTL)

030

035

Fig. 2. Two-variable scatterplots tor the five species of Encarsia. All measurements in mm.

cala and £. strenua are clearly separated
from each other on all of the bivariate
plots (Fig. 2), although for ratio compari-
sons, they are distinct, but overlapping,
only for FWL/FWW (Table 4). In all cases,
the five specimens of £. strenua reared
from Parabemisia in California were small-
est in size for most characteristics, usually
forming a distinct cluster isolated from the
majority of the southeast asian E. strenua
(Fig. 2).

Bivariate plots of the variables which
best discriminate the species of Encarsia
(Fig. 2), in general, demonstrate a strong
positive correlation based on size. Fore
wing length and width (Fig. 2A) have the
most direct linear association. Size varia-
tion of the host whiteflies does appear to
have an effect on parasitoid size: Bemisia
consistently yielded the smallest parasit-
oids (£. bimaculata and £. protransvena),
Parabemisia yielded moderately-sized wasps

Volume 9, Number 1, 2000

149

(E. protransvena and £. stroma), and Or-
chamoplatus yielded intermediate sized
wasps (neocala). Dialeurodes, however,
yielded almost the entire range of sizes
found in £. citri, E. protransvena and £.
strenua. Within Dialeurodes, D. citri and D.
kirkaldii yielded the complete range of size
variants for both £. protransvena and £.
strenua; E. protransvena reared from D. ci-
trifolii had a similar range of size variants,
but only within the bounds of that species.

Principal Components Analysis. — Individ-
ual specimens of the five species are pro-
jected on the first two principal compo-
nents, which accounted for 92.6% of the
overall variance (Fig. 3). The first principal
component (PCI) accounts for 84.4% of the
variance. Even with log-transformed data,
size has an obvious impact on the distri-
bution of points along PCI with the small-
est species, £. bimaculata, having strong
negative values along PCI and the larger
species, E. citri and £. strenua, having
strong positive values along PCI. Eigen-
values and weights for the first two com-
ponents are presented in Table 5. Margin-
al fringe length (MFL) had almost no con-
tribution to PCI. This absence of any cor-
relation was reflected in a bivariate plot of
MFL against FWL, which showed almost
no correlation within species; a rather sur-
prising result considering the importance
of the relative length of the MFL in Encar-
sia taxonomy. Along PCI, the other vari-
ables had approximately equal contribu-
tions, although measurements of the ovi-
positor (OVL, TVL) had the largest influ-
ence. Along PCII, the marginal fringe
(MFL), ovipositor (OVL, TVL) and anten-
na (FUN, F1L, F2L) had the greatest influ-
ence.

Five distinct clusters, representing the
five species, occur within the first two
principal components of the log-trans-
formed data (Fig. 3). Encarsia protransvena
had the greatest scatter of points and over-
laps minimally with £. neocala, £. bimacu-
lata and £. citri, but not at all with £. stren-
ua. Considering that there are no a priori

assumptions of group membership, we re-
gard the clustering of points as a strong
indicator of their group membership. Each
overlapping group was clearly distin-
guished on examination of the third prin-
cipal component.

A principal components analysis of only
£. protransvena, using either host or local-
ity as a priori groups, failed to separate out
any meaningful clusters along the first
three principal components.

Canonical Variates Analysis. — Individual
specimens are projected along the first two
canonical variates (CVI & CVII) of the log-
transformed data, which account for
89.3% of the original variance (Fig. 4). The
five species are clearly discriminated,
however no species can be completely
separated along the first canonical variate
and only E. neocala can be clearly separat-
ed along the second. Although £. citri ap-
pears to overlap with E. bimaculata and E.
protransvena, it is very clearly discriminat-
ed on a projection of the second and third
canonical variate. The points for E. citri are
in a plane clearly behind (class mean of
-4.32 along CVIII; Table 6) those of E. bi-
maculata (x = 0.88) and £. protransvena (x
= —0.37). The single specimen of £. bi-
maculata that appears to overlap the £. citri
cluster along CVI and CVII is part of a
long series reared from Bemisia in India.
This specimen has a longer ovipositor
(0.233 mm) than other E. bimaculata but,
although it is an outlier on all of the bi-
variate plots, it is not distinct from the
main cluster and is never included in the
E. citri group in the univariate compari-
sons (Fig. 2). Also, the score for the spec-
imen along CVIII (1.34) is about average
from other £. bimaculata and very distinct
from £. citri (-4.98 to -3.52). Encarsia pro-
transvena and £. citri, which are difficult to
separate on univariate characteristics, very
marginally overlap on CVI & CVII; the
clusters for each are distinct along CVII &
CVIII, but with an overlap of scores along
each variate. Notably, £. strenua and E.
neocala are clearly separated on both CVI

150

Journal of Hymenoptera Research

0.3

0.2

= 0.1

0.0

c
o

E
o

Q-

f -0.2

■0.3

•

E. bimaculata

E. protransvena

▼

E. strenua

E. neocala

-0.8. -0.6 -0.4 -0.2

0.0

0.2

0.4

0.6

Principal Component I (84.4 %)

Fig. 3. Plot of the first two principal components from the principal components analysis of the log-trans-
formed data set. The first principal component contains 84.4% of the sample variance, the second principal
component contains 8.2%. Artificial boundaries define the limits of a priori groups.

& CVII (Fig. 4) and CVII & CVIII, with the
majority of separation in both cases occur-
ring along CVII (Table 6). A reclassifica-
tion of individuals using the discriminant

Table 5. Eigenvalues and weights for the first two
principal components, computed from the covariance
matrix of the log-transformed data.

Variable

PCI

PCI I

Eigenv£

ilue

0.073

0.007

Proportion of Variance

0.844

0.082

FWI.

0.28

0.14

FWW

0.32

0.09

MFL

0.06

0.46

OVL

0.45

0.34

TVL

0.44

-0.55

MTL

0.32

0.11

CLV

0.14

0.16

FUN

0.30

0.29

F1L

0.33

0.30

F2L

0.31

0.37

functions resulted in 100% allocation to
the correct a priori grouping. Stepwise dis-
criminant analysis failed to identify any
variables that could be excluded and still
provide accurate classification of all spec-
imens.

The standardized and raw coefficients
for the log-transformed data are presented
in Table 6. The standardized coefficients
represent the amount that the canonical
variate will change for each change in the
original variable by one standard devia-
tion (Woolley & Browning 1987). Larger
coefficients are generally better characters
for discriminating points along that partic-
ular analysis. Characteristics of the ovi-
positor (OVL) and fore wing (FWL, FWW)
had the strongest contribution along the
first variate (CVI). These were also ranked
as the best variables for discrimination in

Volume 9, Number 1, 2000

151

c\i

C\J

-4->

'c
o

-2

-4

-6

-8

▼

E. bimaculata
E. protransvena
E. strenua
E. neocala
E. citri

-6

-4

-2

Canonical Variate I (66.4 %)

Fig. 4. Plot of the first two canonical variates from the canonical variates analysis of the log-transformed
data set. The first canonical variate contains 66.4% of the sample variance, the second canonical variate con-
tains 22.9%. Artificial boundaries define the limits of (7 priori groups.

the stepwise analysis. Of the two most
substantial features, £. strenua and E. neo-
cala have a proportionally longer oviposi-
tor, as already noticed, and £. bimaculata
has a proportionally shorter fore wing.
Length of the metatibia (MTL) and, again,
the fore wing (FWL, FWW) were strong
contributors to the second canonical vari-
ate.

A canonical variates analysis of only £.
protransvena, using either host or locality
as reference criteria, failed to separate out
any meaningful clusters in different ordi-
nations of the first three canonical vari-
ates. The only segregation using host as a
class criterion was along the first canonical
variate, with individuals reared from Be-
misia mostly negative (canonical scores be-
low 0) and individuals from all of the oth-
er whitefly species mostly positive (scores

greater than -1). Bemisia are smaller than
the other whiteflies, and this likely repre-
sents segregation by size. Using geograph-
ical locality as the class criterion, there
was no meaningful segregation of clusters
by locality along any axes; the only seg-
regation of clusters was again host related,
corresponding to species reared from Be-
misia versus other whiteflies along the first
canonical variate. The error rate for reclas-
sifying the observations was 23.9% for all
observations and 56.4% for specimens
from Florida (n = 39).

DISCUSSION

Our initial grouping of species is sup-
ported by the distinct clustering of groups
found using either principal components
or canonical variates analysis. Most of the
specimens were segregated along the first

152

Journal of Hymenoptera Research

Table 6. Standardized and raw coefficients and class means for the canonical variates analysis. The rows
have been sorted by the elements of the vector of standardized coefficients for the first canonical variable.
Standardized coefficients are the amount that the canonical structure will change for a change in the original
variable of one standard deviation.

Standardized coefficients

Raw coefficients

Variable

cvi

CV2

CV3

cvi

CV2

CV3

OVL

5.91

-1.88

0.36

46.81

-14.85

2.86

FWW

2.88

6.02

-1.53

31.64

66.04

-16.83

TVL

1.11

1.85

1.08

8.55

14.16

8.26

F1L

0.74

0.10

-0.62

0.77

1.09

-6.42

MFL

-0.01

-0.18

0.12

-0.21

-3.24

2.15

F2L

-0.28

0.10

-1.84

-3.03

1.12

-19.99

CLV

-0.57

0.68

1.19

-11.18

13.46

23.54

FUN

-0.75

-0.80

1.52

-8.79

-9.44

17.86

MTL

-1.40

-3.75

3.06

-15.59

-41.62

33.98

FWL

-3.31

-2.65

-3.42

-42.56

-34.06

-44.04

Species

Class means

bimacult

-5.08

1.49

0.88

protrtuis

vena

0.45

-2.43

-0.37

citri

-0.57

1.20

-4.32

strenua

7.98

0.02

1.79

neocala

5.84

6.39

-0.96

two axes in both analyses, and any area of
overlap was resolved along the third axis.
The fact that all specimens could be cor-
rectly reclassified to their respective a
priori groups is another indication of their
distinctness. The complexity of the sepa-
ration is, however, reflected by the inabil-
ity to remove any of the variables to
achieve complete reclassification.

Encarsia bimaculata is the most distinc-
tive species in both color and morphology,
and none of the analyses would support
these as mere color variants of £. protrans-
vena. Both £. bimaculata and £. protransvena
are parasites of Bemisia tabaci/argentifolii in
the same geographical region, and yet
both maintain their morphometric integ-
rity. Encarsia citri can be separated from £.
protransvena by the structure of the third
valvula and setae of the midlobe. These
characters are subtle and may not be trust-
worthy. However, £. citri formed a mor-
phometric grouping distinct from £. pro-
transvena in all analyses. Again, both spe-
cies use D. citri as a host but, even when
using the same host, £. citri were consis-

tently larger in size for almost all features
except ovipositor length. The separation of
£. citri from £. protransvena in the mor-
phometric analyses was along all three
axes, suggesting that both size and shape
contributed to the difference.

Encarsia protransvena were most variable
for both size and host range. Hosts, which
vary in size, have an obvious impact on
size of the parasitoids. Specimens of £.
protransvena reared from Bemisia were gen-
erally smaller for most features than those
reared from other hosts. In the canonical
variates analysis by host, the specimens
reared from Bemisia were separated along
the first axis, with highest weights applied
to the length and width of the fore wing
(shorter and broader in specimens reared
from Bemisia), although this was barely
noticeable in the bivariate plots and is
here considered as inconsequential. The
full range of size, from smallest to largest
were found in specimens reared from Di-
aleurodes, and among these, D. citri yielded
the largest size range. Whether the size
range from D. citri is a result of parasitoids

Volume 9, Number 1, 2000

153

emerging from different sized host or dif-
ferent instars is unknown.

Encarsia bimaculata, E. citri, E. neocala
and E. strenua all have a southeast Asian
origin. Encarsia bimaculata was purpose-
fully introduced into Florida from India
(Nguyen & Bennett 1995). Encarsia strenua
was probably introduced into California
from original material collected in India.
Although material of £. strenua from India
was reared in quarantine in Riverside, CA,
in 1969, there is no record of a purposeful
release of this species. The californian £.
strenua was collected only between 1980
and 1982 at Tustin and the Irvine Ranch,
both in Orange County, California. The or-
igin of £. protransvena in the New World
is more puzzling, especially as only two
of the 40 species that we place in the stren-
ua group are apparently endemic in the
New World. Encarsia protransvena has
been recorded primarily from the gulf
coast states (Florida through Texas) and
Puerto Rico, and from single rearings in
Grand Cayman, Colombia (D. citrifolii),
California (D. citri), and Honduras (B. ta-
baci) (Polaszek et al. 1992). The records
from Central and South America and
Grand Cayman all appear to be valid rear-
ings from field collected material. The sin-
gle record from California is probably
from release efforts being undertaken at
that time (Bellows, pers. comm.). For all of
the bivariate and multivariate analyses,
these odd rearings of £. protransvena clus-
tered within the main group of specimens
and are indistinguishable by any set of
measurements from other £. protransvena.
Bemisia and both species of Dialeurodcs
have been known from Florida since the
early 1900's (Mound 1978; Nguyen et al.
1993), and yet no members of the strenua
group were reared from whiteflies in any
of these countries prior to 1984 (collection
date of type material), even though there
are several earlier collections of other spe-
cies of Encarsia from whiteflies in Florida
(Nguyen et al. 1993) and despite a re-
newed research program focusing on the

parasitoids of Dialeurodes in the late 1970's
(Nguyen and Sailer 1979; Sailer et al. 1984).
A collection of three specimens reared
from Parabemisia in Valencia, Spain (in-
cluded in the morphemetric analyses),
three specimens from China and Taiwan
reared from Dialeurodes and Aleurotrache-
lus (Huang & Polaszek 1998), and one fe-
male from Egypt reared from Dialeurodes
(Polaszek et al. 1999) are the only collec-
tions of £. protransvena from the Old
World. Although from a unique host, the
two specimens from Spain were certainly
not unique morphologically and were
about average (clustering centrally) for all
bivariate and multivariate comparisons.
The Egyptian specimen agrees in all char-
acters with £. protransvena. The specimens
from China and Taiwan were not part of
this analysis, but exhibit diagnostic differ-
ences (see comments after description of
£. protransvena) from the New World and
Spain material that might suggest they
could be a different species close to £. pro-
transvena or £. citri. If £. protransvena did
have an eastern Palearctic or southeast
Asian origin, we expect that it would be
more widespread as it is in the New
World. However, the distribution and suc-
cess of £. protransvena cannot be used to
demonstrate its origin, and the evidence
remains equivocal over the origin of £.
protransvena in the southeastern United
States as to whether it was accidentally in-
troduced from the Old World (western Pa-
learctic or southeast Asia) and became
abundant in its new habitat, or if it spread
northward from an origin in South Amer-
ica or the Carribean. It might be interest-
ing to postulate that the appearance of £.
protransvena coincides with the apparent
replacement of Bemisia tabaci with B. argen-
tifolii, but the parasitoid also was found to
be common on other genera of whiteflies
in the same geographical range.

A discriminant function may be the best
means of separating species such as £. pro-
transvena and £. citri. However, in all cas-
es, a majority of specimens can be sue-

154 Journal of Hymenoptera Research

cessfully keyed using relatively straight- all of the specimens. Although still creat-

forward measurements having a minimal ing complex couplets, we feel that this

amount of overlap, and any specimens would be the best means to painlessly sep-

within the zone of overlap can be segre- arate species and is the method used in

gated using other characters which may the accompanying identification key.
apply only to these specimens but not to

KEY TO FEMALES OF COMMONLY ENCOUNTERED SPECIES OF THE STRENUA GROUP

This identification key refers only to the species dealt with in this paper, a small representation
of the 40 species that we have recently examined. It will, however, work for the species most
commonly encountered in economically important crops. Members of the strenua group are rec-
ognized by having a combination of 2-3 marginal setae along the dorsal margin of the costal cell
at the apex, a bare area just above the stigmal vein, and scutellar sensillae closely placed or
touching.

1. Ovipositor almost as long as gaster, more than 1.56 times as long as middle tibia, if between
1.5 and 1.65 times then fore wing less than 2.6 times as long as broad. Ovipositor robust,

tip often bent at an angle in slide-mounted specimens 2

- Ovipositor clearly shorter than length of gaster, less than 1.5 times as long as middle tibia,
some E. protransvena 1.5-1.6 times [deformed holotype 1.74 times], but then fore wing more
than 2.67 times as long as broad [2.9 times in holotype of E. protransvena]. Ovipositor
slender, tip always straight 3

2. Third valvula entirely yellow. Fore wing less than 2.44 times as long as broad and ovi-
positor less than 2.6 times as long as clava E. neocala Heraty and Polaszek, n. sp.

- Third valvula dark brown at the extreme tip, otherwise yellow (Fig. 16). Fore wing more
than 2.44 times as long as broad and ovipositor usually more than 2.7 times as long as
clava, if shorter then fore wing more than 2.5 times as long as broad . . . £. strenua (Silvestri)

3. Metasomal tergite 7 (tergite with spiracles) with 4 setae, only 2 long setae medial to cerci
(Fig. 29); ocellar triangle irregularly aciculate E. sophia (Girault) (= transvena)

- Mt7 with 6 setae, 4 long setae medial to cerci (Fig. 27); ocellar triangle usually reticulate,

if aciculate then with a different pattern [not all species included in this keyl 4

4. Body with extensive dark pigmentation (at least a large part of the mesoscutum, or two
or more gastral tergites, dark) (Fig 5). Ovipositor less than 1.8 times as long as clava

E. bimaculata Heraty and Polaszek n. sp.

- Body, including antennae, almost entirely yellow. Ovipositor more than 2.0 times as long

as clava 5

5. Basal seta of third valvula long, exceeding base of subapical seta; subapical seta located
half way between basal seta of third valvula and apex (Fig. 14). Midlobe of mesosoma
usually with 5 pairs of setae, preapical pair overlapping or exceeding base of apical pair.
Fore wing usually less than 2.6 times as long as broad (83.3% of specimens examined), if

between 2.6 and 2.7 times, then clava more than 0.14 mm in length E. citri Ishii

Basal seta of third valvula not reaching base of subapical seta; subapical seta located be-
yond half way (0.65) between basal seta of third valvula and apex (Fig. 15). Midlobe of
mesosoma usually with 4 pairs of setae, preapical pair not reaching base of apical pair.
Fore wing usually more than 2.7 times as long as broad (92.8% of specimens examined),

if between 2.6 and 2.7 times, then clava less than 0.14 mm in dorsal length

E. protransvena Viggiani

Volume 9, Number 1, 2000

155

^^T^-

Figs. 5-12. Encarsia bimaculata: 5-11, female; 5, body; 6, mid tibia; 7, antenna; 8, mid tarsus; 9, mouthparts;
10, base of fore wing; 1 1, tore wing; 12, antenna of male. Arrow points to apical two costal cell setae diagnostic
of the strenua group.

Encarsia bimaculata Heraty and
Polaszek, new species

(Figs. 5-12)

Female. — Antenna with 6 flagellomeres,
clava 3-segmented; Fl 2.0-2.2 X as long as
broad and as long as F3; antenna yellow
basally, slightly darkened apically. Head
confused transverse colliculate (as in fin-
gerprint), ocellar triangle similar but
sculpture somewhat areolate; yellow ex-

cept for a pale transverse band of brown
across back of head; dorsal setae slight.
Maxillary palpus 1 -segmented. Mandibles
3/3 dentate, marginal teeth acute. Meso-
soma mostly yellow except following
which are brown: pronotum, midlobe of
mesoscutum anteriorly and medially, te-
gula, axilla and propodeum submediallv.
Mesosoma with light hexagonally areolate
sculpture dorsally; midlobe with 4 pairs of

156

Journal of Hymenoptera Research

Figs. 13-16. 13-14, Encarsia citri: 13, antenna of male; 14, third valvulae. 15, Encarsia protransvena, third
valvulae; 16, Encarsia strenua, third valvulae.

setae, setae delicate and about equal in
size, side lobe with 3 pairs, axilla with 2
pairs (lateral pair minute) and scutellum
with 2 pairs. Scutellar sensillae ovoid and
separated by less than their own maxi-
mum diameter; median groove usually
narrow and distinct. Apical spur of mid
tibia 0.6-0.8 X as long as basitarsus; basi-
tarsomeres of midtarsus without pegs.
Tarsal formula 5-5-5. Fore wing 2.58-
2.99 X as long as broad, marginal fringe
0.25-0.36 X width of fore wing; disc uni-
formily setose; costal cell with row of 9-
10 minute setae and with 1 long marginal
setae apically; submarginal vein with 2
large setae, basal area with 5-6 setae pos-
terior to submarginal vein; frenal fold
with several prominent thornlike spines;
wing mostly hyaline, weakly infuscate at
base of submarginal vein and base of fre-
nal fold. Metasoma mostly yellow, tergites
I + II mostly brown, sometimes with faint
medial spot on tergites V + VI; laterally

with weak cellulate reticulation; dorsal se-
tal formula from tergite III: 2-2-2-6-6-6.
Ovipositor 1. 09-1. 38 X as long as mid tib-
ia, 1.33-1. 78 X as long as clava, 0.6 X as
long as gaster (base to tip of third valvu-
la); third valvula stout, 1. 6-2.2 X as long
as broad, slightly extruded beyond epy-
gium, entirely yellow.

Male. — Coloration similar to female but
darker with entire metasoma brown, head
with a transverse medial band of brown
infuscation, and wings may be weakly in-
fuscate in the basal half. Antenna with 6
flagellomeres, apical two flagellomeres
fused, with segments distinctly separated
(Fig. 12).

Comments. — This species is similar to E.
dialeurodis Hayat for all features except for
the darker coloration of the axillae, pron-
otum and mesoscutum (medially) (versus
all yellow in E. dialeurodis) and Fl about
equal in length to F2 (versus distinctly
subequal). It is readily distinguished from

Volume 9, Number 1, 2000

157

other species of the stremia group by the
dark mesosomal coloration of females and
the shorter ovipositor to clava ratio. The
only noticable difference in female color-
ation was a more extensive dark pigmen-
tation of the metasoma in the specimens
from Hong Kong, with gastral tergites V
& VII almost completely dark; otherwise
these did not differ from other specimens.
Two smashed specimens from Thailand,
one reared from Bemisia t abaci but with no
other data, and the other from Bemisia ta-
baci on Gossypium hirsutum (Ban Ton Tea,
20.U992, F." Bennett 1224 [= Encarsia sp.
in Nguyen & Bennett 1995]; both 9
USNM), are identical for all characters of
this species, except the ocellar triangle is
transversely aciculate, the mandibles are
less acutely toothed and the mid tibial
spur is only 0.44X as long as the basitar-
sus. It is of interest that, assuming a ran-
dom sampling, the original shipment of
material of E. bimaculata from India
(#1248) was only slightly biased for fe-
males (6:4), whereas, except for the Hon-
duras lab culture (1:17), only two males
have been discovered in all of the subse-
quent rearings. Another undescribed spe-
cies in Florida (Gainesville; USNM) is very
close, but it has a proportionally longer
ovipositor (>2.0X as long as the clava), the
female gaster is entirely dark, and the legs
are also brown. This other species has also
been reared from Bemisia and Trialeurodes
abutilonea. Encarsia birnaculata is the Encar-
sia I [India], G [Guatemala] and S [Sudan]
species released in Florida against Bemisia
argentifolia (Nguyen & Bennet 1995).

Host. — Reared from Bemisia argentifolia
and B. tabaci (Aleyrodidae).

Distribution. — India, Philippines, Thai-
land and USA (Florida, Texas?), and pos-
sibly Sudan, Israel and Mexico [possibly
culture contaminations].

Material Examined. — Holotype, V, India: labar-
bhani, 19.vii.1994, culture in Gainesville, Florida, R.
Nguyen, autoparasitoid, M9201S. Deposited in
USNM. Paratypes (80 females, 29 males): Honduras:
lab culture [Florida] vi.1992, quarantine 1261 (1 •■ 176
USNM). Hong Kong: kou loon Park, 14.vii.1992, F.

Bennett Y944, Bemisia tabaci on Chamaescyel hirta (29
USNM). India: same data as holotype (4 9, USNM,
79 Id BMNH, 109 Id UCRC); quarantine [Florida],
30.V.1991, R. Nguyen 903, 1065, 1248, Bemisia tabaci
(69 USNM); Tabarhani, 1 4. i v. 1992, R. Nguyen, ex Be-
misia tabaci on tlibiscits (3 9 USNM); lab culture [ Flor-
ida] quarantine, original shipment 124S, 1992 (69 4o"
USNM). Phillipines: Benguet, 8.iii.l994, Legaspi,
Carruthers, Poprawski, ex Bemisia tabaci on white po-
tatoes, autoparasitoid, M94014 (119 UCRC, 59
BMNH); Quezon Dolores, 15.xii.1993, C. Moomaw,
M93069, on eggplant (2 9 TAMU). Israel: [lab culture
in Florida], R. Nguyen 1250, on Bemisia tabaci (79 16"
USNM). USA: Florida: Alachua Co., Gainesville,
7.ix.l992, F. Bennett Y935, Bemisia tabaci on Euphorbia
heterophylla (29 16 USNM); Alachua Co., Gainesville,
14. ix. 1992, F. Bennett Y958, Bemisia tabaci on Sesamum
(29 USNM); Alachua Co., Gainesville, 27.viii.1992, F.
Bennett Y936, Bemisia tabaci on Sesamum indicum (29
26 USNM); Alachua Co., Gainesville, 6.ix.l992, F.
Bennett Y934, Bemisia tabaci on Chamaesyce hirta (39
Id USNM); Hamilton Co., Jasper, 8.iv.l992, F. Ben-
nett Y693, Magnolia sp. (Id USNM); Texas: Mission
biological control laboratory (in culture from India),
16.xii.1993, M92018 (5 9 TAMU). Mexico: Taxco,
1992, P. Stansley 1292, Bemisia tabaci on Chamaesyce
hyssopifolia (1 9 USNM). Sudan: [lab culture in Flori-
da], 30.iv.1992, R. Nguyen 1249, on Bemisia tabaci (39
USNM). Thailand: xi.1977, G. Yonimoton [?], cotton
(19 USNM).

Encarsia citri (Ishii)

(Figs. 13, 14)

Prospaltella citri Ishii, 1938: 29-30. Type data: Ja-
pan: Nagasaki. Syntypes, female. Type de-
pository: National Institute of Agroenviron-
mental Sciences, Tsukuba, Japan. Described:
female. Reared from Dialeurodes citri.

Encarsia stroma; Polaszek ct al. 1992: 338. Incor-
rect synonymy.

Encarsia citri, Huang & Polaszek 1998: 352. Re-
vised status.

Female. — Antenna with 6 flagellomeres,
clava 3-segmented; Fl 2.4-3.0X as long as
broad and 0.9 X as long as F3; antenna
very pale brown, contrasting in color to
rest of the body which is yellow. Vertex
weakly areolate to colliculate, ocellar tri-
angle weakly areolate; dorsal setae stout.
Maxillary palpus 1 -segmented. Mandibles
chisel-shaped or very weakly 3/3 dentate,
apical margin nearly flat. Mesosoma with
weak hexagonally areolate sculpture dor-

158

Journal of Hymenoptera Research

sally; midlobe with 5 pairs of setae (rarely
6 pairs), posterior and lateral setae only
slightly stouter than medial setae, side
lobe with 3 pairs, axilla with 2 pairs (lat-
eral pair minute), and scutellum 2 pairs,
medial pair lateral to sensillae. Scutellar
sensillae ovoid and separated by less than
than their own maximum diameter (rarely
by a full diameter); median groove dis-
tinct. Apical spur of mid tibia 0.7-0.8 X as
long as basitarsus; basitarsomere of mid-
tarsus with 2-3 strong pegs, tarsomeres 3-
5 each with 1 apical peg. Tarsal formula
5-5-5. Fore wing 2.39-2.68 X as long as
broad, marginal fringe 0.1 8-0.25 X width
of fore wing; disc uniformly setose; costal
cell with row of 15-19 small setae and 2-
3 long marginal setae apically; submargin-
al vein with 2 (rarely 3 on one side) large
setae, basal area with 7-9 setae posterior
to submarginal vein; frenal fold with sev-
eral minute thornlike spines; wing hya-
line. Metasoma yellow; laterally with
weak cellulate reticulation; dorsal setal
formula from tergite III: 2-2-2-6-6-6. Ovi-
positor 1. 22-1. 34 X as long as mid tibia,
2.00-2.34 x as long as clava, 0.5-0.6 x as
long as metasoma (base to tip of third val-
vula); third valvula stout (Fig. 14), 1.26-
1.95X as long as broad, barely, if at all,
extruded beyond epygium, entirely yel-
low.

Male. — Overall coloration pale brown,
darker brown pattern on head and meso-
soma similar to £. bimaculata female, gas-
ter entirely brown. Setation pattern of me-
sosoma and metasoma as in female; some
males with fewer setae in basal area (13)
or fore wing and costal cell (4). Basitarso-
mere of middle leg with only 2 pegs. An-
tenna with 5 flagellomeres, apical two fla-
gellomeres (5&6) fused, with segments
distinguished only by a break in the pat-
tern of linearia (Fig. 13).

Comments. — The shape and setation of
the third valvula are distinct among all
members of the strenua group. This spe-
cies is most easily confused with £. pro-
transvena but can be separated by the fea-

tures outlined in the key and usually the
presence of 5 pairs of setae on the midlobe
of the mesoscutum (versus 4 pairs).

Hosts. — Aleyrodidae: Dialeurodes citri
(Ashmead) (Ishii 1938).

Distribution. — Palaearctic: Japan (Ishii
1938).

Material Examined (6 males, 12 fe-
males).— Japan: Kyushu: Kagoshima City,
2.v, 15.vii.1970, S. Ohga, R70-31, R72-36,
Dialeurodes citri on Citrus spp. (12$ 4d 1
pupa UCRC); Kagoshima, Taremian, 18-
19.viii.1972, S. Ohga, R72-50 (26 UCRC
[with 26 of E. transvena on same slide]);
Fukuoka, Tsuyazaki, 4.viii.l995, H. Kajita,
ex Dialeurodes citri on Citrus (2? BMNH).

Encarsia neocala Heraty and Polaszek,
new species

(Figs. 17-24)

Female. — Antenna with 6 flagellomeres,
clava 3-segmented; Fl 1.6-1.9X as long as
broad and 0.8-1. Ox as long as F3; antenna
yellow basally, darkened beyond or in-
cluding pedicel. Vertex confused trans-
verse colliculate, ocellar triangle similar
but sculpture somewhat areolate; head
yellow except for weak infuscation on in-
ner margins of ocelli; dorsal setae slight.
Maxillary palpus 1-segmented. Mandibles
2/2 or 3/3 dentate, ventral teeth acute,
dorsal tooth blunt or rounded and often
not apparent. Mesosoma mostly yellow
except pronotum brown and axillae and
propodeum laterally pale brown. Meso-
soma with light hexagonally areolate
sculpture dorsally; midlobe with 4-5 pairs
of setae, posterior and lateral setae only
slightly stouter than medial setae, side
lobe with 3 pairs, axilla with 2 pairs (lat-
eral pair minute), and scutellum 2 pairs,
medial pair lateral to sensillae. Scutellar
sensillae ovoid and separated by less than
than their own maximum diameter; me-
dian groove narrow and distinct. Apical
spur of mid tibia 0.8-1 .OX as long as bas-
itarsus; basitarsomere of midtarsus with
2-4 strong pegs, tarsomeres 4 and 5 each
with 1 apical peg. Tarsal formula 5-5-5.

Volume 9, Number 1, 2000

159

ft i^Mi fL

/ i i i / -/- ,
•' / / '! l r /i

Figs. 17-24. Encarsia neocala, female: 17, antenna; 18, midtarsi; 19, third valvulae; 20, body; 21, mid tibia; 22,
mandible; 23, base of fore wing; 24, fore wing.

Fore wing 2.32-2.44X as long as broad,
marginal fringe 0.29-0.38 X width of fore
wing; disc uniformly setose; costal cell
with row of 12-16 small setae and 2-4
long marginal setae apically; submarginal
vein with 2 large setae, basal area with 4-
5 setae posterior to submarginal vein; fre-
nal fold with several minute thornlike
spines; wing mostly hyaline, weakly in-
fuscate at base of submarginal vein. Me-

tasoma mostly yellow, tergites I + II usu-
ally brown, sometimes almost completely
yellow; laterally with weak cellulate retic-
ulation; dorsal setal formula from tergite
III: 2-2-2-6-6-6. Ovipositor 1.60-1. 79 X as
long as mid tibia, 2.16-2.56X as long as
clava, 0.7X as long as metasoma (base to
tip of third valvula); third valvula elon-
gate (Fig. 19), 2. 6-3. Ox as long as broad,
extruded beyond epygium, entirely yellow.

160

Journal of Hymenoptera Research

Male. — Unknown.

Comments. — The longer third valvulae,
longer ovipositor relative to gaster length,
and stouter ovipositor (indicated by a ten-
dency for the tip to be bent in slide
mounts) place this species as similar to £.
stremia. However, in E. neocala the third
valvula is entirely yellow (versus tipped
brown in E. strenua), the midlobe of the
mesoscutum is entirely yellow with the
axillae slightly darker (versus entirely yel-
low or the midlobe slightly darkened an-
teriorly in £. strenua), fewer setae in the
costal cell, and the ocellar triangle more
weakly sculptured.

Host. — Reared from Orchamoplatus cale-
donicus (Dumbleton) (Aleyrodidae) [reads
Orchamnus neocaledonicus on label] on
Citrus.

Material Examined. — Holotype, 9, New
Caledonia, Noumea, 10.ix.1970, G. Fadres,
ex [Orchamnus neocaledonicus]. Deposit-
ed in USNM. Paratypes (37 females): same
data, (5? USNM, 5$ F3MNH, 27? UCRC).

Encarsia protransvena Viggiani

(Figs. 15, 25-28)

Encarsia protransvena Viggiani, 1985a: 89-90.
Type data: USA: FL, Broward Co., Fort Lau-
derdale. Holotype female, by original desig-
nation. Type depository: IEUN. Described:
female. Ulust. Reared from ~Dialeurod.es kirkal-
dii. Placed in strenua group by Hayat (1989).

Encarsia strenua; Polaszek et al. 1992: 388. De-
scribed: female. Illust. (in part).

Encarsia stroma; Schauff et al. 1996: 29. De-
scribed: female. Illust. Misidentification.

Encarsia protransvena; Schauff et al. 1996: 27. De-
scribed: female. Illust.; Huang & Polaszek
1998: 1941; Polaszek et al. 1999: 158.

Female. — Antenna with 6 flagellomeres,
clava 3-segmented; Fl 2.1-3.2X as long as
broad and 0.7-1.1 X as long as F3; antenna
and entire body yellow except small spots
of brown along inner margins of ocelli.
Vertex weakly areolate, ocellar triangle
areolate; dorsal setae stout. Maxillary pal-
pus 1-segmented. Mandibles 3/3 dentate,
teeth sharp or blunt. Mesosoma with weak

hexagonally areolate sculpture dorsally;
midlobe usually with 4 pairs of setae
(rarely with as few as 3 setae per side and
as many as 5 pairs total), posterior and lat-
eral setae much stouter than medial setae
(almost twice as broad), side lobe with 3
pairs, axilla with 2 pairs (lateral pair mi-
nute), and scutellum 2 pairs, medial pair
lateral to sensillae. Scutellar sensillae
ovoid and separated by less than than
their own maximum diameter (rarely by a
full diameter); median groove distinct.
Apical spur of mid tibia 0.8-0.9 X as long
as basitarsus; basitarsomere of midtarsus
with 2-3 strong pegs, tarsomeres 3-5 each
with 1 apical peg. Tarsal formula 5-5-5.
Fore wing 2.62-3.1 IX as long as broad,
marginal fringe 0.20-0.40 X width of fore
wing; disc uniformly setose; costal cell
with row of 12-18 small setae and 1-3
long marginal setae apically; submarginal
vein with 2 large setae, basal area with 7-

9 setae posterior to submarginal vein; fre-
nal fold with several minute thornlike
spines; wing hyaline. Metasoma laterally
with weak cellulate reticulation; dorsal se-
tal formula from tergite III: 2-2-2-6-6-6.
Ovipositor 1.29-1. 74 X as long as mid tib-
ia, 2.0-3. 37X as long as clava, 0.6-0.7X as
long as metasoma (base to tip of third val-
vula); third valvula stout (Fig. 15), 1.7-
2.8 X as long as broad, barely, if at all, ex-
truded beyond epygium, entirely yellow.

10 small setae and basal area with 5-7 se-
tae. Basitarsomere of middle leg with only
2 pegs. Antenna with 5 flagellomeres, api-
cal two flagellomeres (5&6) fused with li-
nearia overlapping (Fig. 26).

Comments. — This species can be separat-
ed from other members of the strenua
group by the shorter ovipositor and third
valvulae, more delicate antenna (clava

Volume 9, Number 1, 2000

161

Figs. 25-30. 25-28, Encarsia protransvena: 25, antenna of female; 26, antenna of male; 27, apex of gaster, dorsal
view; 28, base of fore wing. 29, Encarsia sophia, apex of gaster. 30, Encarsia strenua, antenna oi male.

only slightly broader than the funicle), they are almost always arranged in 5 pairs

and longer fore wing. The setae of the in £. citri, and the arrangement of setae

midlobe of the mesosoma are usually ar- (shorter and more apical) on the third val-

ranged in 4 pairs (rarely 3 or 5), whereas vulae is distinct from £. citri. Of the hun-

162

Journal of Hymenoptera Research

dreds of specimens examined, only the
two males, collected at the same locality
as other E. protransvena females, can be at-
tributed to this species. This is probably
the parasite recorded as Encarsia stremta
attacking Bemisia argentifolia in South Car-
olina (Simmons 1998).

The specimens of E. protransvena de-
scribed from China (1 female) and Taiwan
(2 females) by Huang & Polaszek (1998)
are nearly identical to those described in
this paper. However, the taiwanese spec-
imens have a band of 14 setae in the basal
area of the fore wing (their fig. 273) as
compared to a single row of only 7-9 setae
in both E. protransvena and E. citri. They
also describe 5 pairs of setae on the mid-
lobe of the mesosoma, which is rarely en-
countered in specimens from the New
World (usually 4 pairs). The Chinese spec-
imen agrees for all characters with £. pro-
transvena, but it has a strongly and densely
reticulate vertex, as compared to the very
weak and more broadly spaced sculpture
of all other £. protransena examined, and
the basal segment of the clava is more dis-
tinctly separated from the following seg-
ment. More material will need to be ex-
amined before these can be included or
excluded from £. protransvena with confi-
dence.

Hosts. — Aleyrodidae: Aleurotrachelus
rubi Takahashi (Huang & Polaszek 1998),
Bemisia argentifolia Bellows & Perring, Be-
misia tabaci (Gennadius), Dialeurodes citri
(Ashmead), Dialeurodes citrifolii (Morgan),
Dialeurodes kirkaldii (Kotinsky) (Viggiani
1985a), Parabemisia myricae (Kuwana), Tri-
aleurodes abutiloneus (Haldeman), Trialeu-
rodes packardi (Morrill) (Huang & Polaszek
1998), Trialeurodes variabilis (Quaintance).
Diaspididae: Aspidiotus sp.?, Parlatoria zi-
ziphil. [diaspidid hosts almost certainly
are incorrect associations]

Distribution. — Nearctic: United States of
America: California (Polaszek et al. 1992),
Florida (Viggiani 985a), Hawaii (Nguyen
& Hamon 1989 [not examined]). Neotrop-
ical: Colombia; Cayman Islands; Hondu-

ras (Polaszek et al. 1992); Puerto Rico (Po-
laszek et al. 1992). Palaearctic: Spain;
Egypt (Polaszek et al. 1999). Oriental: Peo-
ple's Republic of China: Guangdong; Tai-
wan (Huang & Polaszek 1998).

Material Examined (390 females, 2 males). Colom-
bia: Valle: Dagua, 28.V.1991, R. Caballero, 108, Di-
aleurodes citrifolii on Citrus aurantifolia (4 9 USNM).
Grand Cayman: Cayman, 13. vi. 1986, F.D. Bennett,
Y729, whitefly on Citrus (19 USNM); Savannah,
17.X.1987, F.D. Bennett, 164, Dialeurodes citrifolii on
Citrus (2 9 USNM). Puerto Rico: Rio Piedras,
5.V.1990, 4.vi.l990, 18.ix.1988, 18.xi.1988, 24.xi.l988„
F.D. Bennett, Y501, Y560, Y1042, Y1043, Y1051, 128,
828, 1585, Dialeurodes citrifolii on Citrus, Dialeurodes
citri on Citrus, Dialeurodes kirkaldyi on Jasminum, Gym-
naspis on bromeliad (15 9 USNM); Corozal,
27.xi.1988, l.xii.1989, F.D. Bennett, 159, 161, Dialeu-
rodes citrifolii on Citrus (5 9 USNM); Adjuntas,
15.xi. 1988, F.D. Bennett, Y719, Y1045, Y1046, 163, Di-
aleurodes citrifolii on Citrus (89 USNM); Mayaquez,
16.xi.1988, F.D. Bennett, Y1047, 160, Dialeurodes citri-
folii on Citrus, Parlatoria ziziphi on Citrus (5 9 USNM);
Fortuna, 3.xii.l987, F.D. Bennett, 151, Dialeurodes on
Citrus (8 9 USNM). Spain: Valencia, xi.1994, F.S.
Mari, Parabemisia myricae (4 9 USNM). USA: Florida:
Dade County: North Miami "Little Haiti", 28.V.1987,
22.vi.1987, R. Prange & F.D. Bennett, RP-1, Dialeurodes
citrifolii on Citrus (209 lcT TAMU); 17.X.1987, F.D.
Bennett & H. Glenn, FDB-3, Dialeurodes citrifolii on
Citrus, Dialeurodes citrifolii on Dioscorea alata (109
TAMU); 19.U986, F.D. Bennett, J.H. Frank & R.
Nguyen, Dialeurodes citrifolii on Citrus (19 USNM);
12.X.1987, F.D. Bennett, 1331, Aspidiotus destructor on
Dioscorea alata, Dialeurodes citrifolii on Dioscorea alata
(39 USNM); Miami, 12.x. 1987, F.D. Bennett & H.
Glenn, 87, Dialeurodes citrifolii on Dioscorea alata (69
lcT USNM); 29.X.1990, F.D. Bennett, 746, Bemisia tabaci
on Ricinus communis (19 USNM). Alachua County:
Gainesville, records for every month of the year, 1989
to 1993, collectors include F.D. Bennett, G.A. Evans,
J. Marenco and L. Nong, host records include Bemisia
tabaci on soybean, Bemisia tabaci on Emilia sonchifolia.
Trialeurodes abutilonea on Hibiscus mutabilis, Trialeu-
rodes packardi on Cercis canadensis, Dialeurodes citri on
Ligustrum siuense, Dialeurodes citri on Viburnum, Di-
aleurodes citrifolii on Citrus, Bemisia tabaci on Sesamum
indicum, Bemisia tabaci on Chamaesyce hyssopifolia, Be
misia tabaci on Cassia obtusifolia, Bemisia tabaci on Eu
phorbia heterophylla, Bemisia tabaci on Brassica oleracea
var. acepbala, Bemisia tabaci on Hibiscus mutabilis, Be
misia tabaci on Desmodium tortuosum (1709 USNM);
Micanopy, 3.iv.l988, 28.vii.1991, ll.ix.1988, 21. ix. 1989,
21. x. 1989, F.D. Bennett, Y287, 1, 95, 127, 154, 771, Di-
aleurodes citri on Citrus, Dialeurodes citri on Viburnum.
Dialeurodes citri on Melia azadarach, Trialeurodes pack-
ardi on Cercis canadensis (189 USNM); Alachua,

Volume 9, Number 1, 2000

L63

xi.1992, H. McAuslane, 1339, Bemisia tabaci on peanut
(39 USNM); near Alachua, 12.ix.1991, F.D. Bennett,
Y399, Y400, Bemisia tabaci on soybean 5? (USNM).
Monroe County: Isla Morada, 1. v. 1993, F.D. Bennett,
Y1060, Dialeurodes citrifolii on Citrus aurantifolia (39
USNM). Broward County: Pompano Beach,
22.iii.1992, 23.vii.1991, 23.viii.1991, 4.xi.l988, F.D.
Bennett, Y274, Y437, Y490, Y664, Bemisia talma on I m-
ilia sonchifolia, Dialeurodes citrifolii on Citrus, Dialeu-
rodes kirkaldyi on Jasminum (109 USNM). Orange
County: Apopka, 29.xi.1989, K. Hoelmer, 380, Trialeu
rodes variabilis on Carica papaya (29 USNM). Indian
River County: Beach, 10. iv. 1987, D. Mooney, Creni-
dorsum new species on Coccoloba uvifera (2 9 USNM).
Jackson County: Mariana, 18.viii.1987, F.D. Bennett,
946, Dialeurodes citri on Melia (259 USNM). Bradford
County: Starke, 26.iv.1989, W.A.A. Klerks, Pseudau-
lacaspis cockerelli (1 9 USNM). Gadsden County: Quin-
cy IFAS, 13. ix. 1991, F.D. Bennett, Y396, Y401, Bemisia
tabaci on soybean, Bemisia tabaci on tomato (49
USNM). Palm Beach County: West Palm Beach,
6.ii.l991, l.iv.1991, 13.vi.1992, 19.x. 1991, F.D. Bennett,
F104, Y428, Y450, Y838, 1183, Dialeurodes kirkaldyi on
Jasminum, Bemisia tabaci on Chamaesyce hyssopifolia, Be-
misia tabaci on Emilia sonchifolia (89 USNM). Hills-
borough County: Ruskin, 29. vi. 1990, Eclipta (19
USNM). Osceola County: Orange Creek, 18.iii.1990,
F.D. Bennett, 407, Trialeurodes abutilouea on Solatium
americanum (19 USNM); Canoe Creek, 22.xi.1990,
F.D. Bennett, 1091, Dialeurodes or Aleurothrixus floc-
cosus on Citrus (1 9 USNM). County?: Brywood,
4.vi.l992, F.D. Bennett, Y901, black whitetly on Uq-
uidambar styraciflua (19 USNM). South Carolina:
Charleston County: Charleston, 31.viii.1993, 7.ix.l993,
29. ix. 1993, A. Simmons, 1610, 1614, 1615, Bemisia ta-
baci on sweetpotato (29 USNM). Mississippi: Simp-
son County: Magee, 10. ix. 1994, D.H. Headrick,
DHH96-0423, DHH96-0424, DHH96-0438, Bemisia ar
gentifolii on Cleome hasslerana (3 9 UCRC). Forrest
County: Hattiesburg, 5.ix.l994, D.H. Headrick,
DHH94-0361, Bemisia argentifolii on okra (1 9 UCRC).
Georgia: Bryan County: Savannah, 15. xi. 1991, F.D.
Bennett, 1 161, Bemisia tabaci on Chamaesyce hyssopifolia
(69 USNM). Tift County: Tifton, 20.x. 1992, J. Cham-
berlain, 1355, 1395, Bemisia tabaci on Gossypium hir-
sutum (119 USNM); 29. iv. 1992, 15. ix. 1992,' W. Hud-
son, Y714, Y715, Y716, Y717, 1346, Bemisia tabaci on
Gossypium liirsutum, Dialeurodes citri on Jasminum
(219 USNM).

Encarsia sophia (Girault & Dodd)

(Fig. 28)

Coccophagus sophia Girault & Dodd, 1915: 49, 56.
Type data: Australia: QLD, Cairns. Syntypes,
female. Type depository: Brisbane: Queens-
land Museum, Queensland, Australia; type
no. Hy.2926.

Prospaltella transvena Timberlake, 1926: 312-315.
Type data: USA: Hawaii, Oahu. Holotype fe-
male. Type depository: Honolulu: Bernice P.
Bishop Museum, Dept. Ent. Coll., HI, USA;
type no. 5690. Described: both sexes. Illust.
Reared from Trialeurodes [as Aleyrodes] vapor-
ariorum on tomato. Placed in lahorensis group
by Hayat (1989) and in strenua group by Po-
laszek et al. (1992) and Hayat (1998). Gerling
(1985) states that E. sublutea is known in Ha-
waii as E. transvena. New Synonymy.

Prospaltella sophia; Compere 1931: 11. Change of
combination.

Prospaltella sublutea Silvestri, 1931: 20-22. Type
data: Somalia: Duca [?]. Syntypes, female.
Type depository: IEUN. Described: female.
Illust. Synonymy with transvena by Gerling
& Rivnay in Viggiani 1985: 90.

Prospaltella betnisiae Ishii, 1938: 30. Type data:
Japan: Ikawa-cho, Mei-Ken. Syntypes, fe-
male. Type depository: National Institute of
Agroenvironmental Sciences,Tsukuba, Japan.
Described: female. Synonymy with transvena
by Polaszek et al. 1992: 388-389. Reared from
Parabemisia [as Bemisia] myricae Kuwana.

Prospaltella flava Shafee, 1973: 254-255. Type
data: India: Uttar Pradesh, Aligarh. Holotype
female, by original designation. Type depos-
itory: Aligarh: Aligarh Muslim University,
Deptartment of Zoology, India. Described:
female. Illust. Synonymy by Hayat 1989: 72.
Preoccupied by flavus Compere 1936: 300.
Questionably treated as a junior synonym of
transvena by Viggiani (1985). The type mate-
rial was reared from a coccid which, if cor-
rect, represents a significant departure in
host range.

Encarsia sophia; Viggiani 1985b: 249. Described:
female. Illust. Change of combination.

Encarsia transvena; Gerling & Rivnay in Viggiani
1985a: 90-92. Described: both sexes. Illust.
Change of combination.

Encarsia shafeei Hayat, 1986: 163. Replacement
name for E. flava Shafee.

Encarsia transvena; Hayat 1989: 71-73; Polaszek
et al. 1992: 388-389; Schauff et al. 1996: 31-33;
Hayat 1998: 205-207; Huang & Polaszek
1998: 1954-1956. Described: both sexes. Illust.

Continents. — This is the most distinctive
species in the stroma group and can be
recognized by the transversely striate ocel-
lar triangle, a patch of longer setae in the

164 Journal of Hymenoptera Research

posterior half of the wing disc, and pres- been some accidental movement, especial-

ence of only 4 setae on Mt7 (Polaszek et ly to Hawaii (type locality of E. transvena),

ah 1992; Schauff et al. 1997). All of the fe- determining the origin and movements

male specimens examined were complete- through introductions of each geographi-

ly yellow except for a single female from cal population will be essential to the cor-

Thailand (ex Bemisia tabaci on Lantana ca- rect assignment of names, if this is indeed

marara [USNM]), which has the same dark a species complex.

pattern of colour as £. bimaculata. Especially for the purposes of biological
The type specimen of £. sopJiia, like control and the associated need for accu-
most of the Girault material, is in poor rate identification of museum and field
condition; however, all of the diagnostic material, what concept of a species is most
features shared with E. transvena, and oth- useful? Among the many definitions pro-
er species names currently synonymized posed, there are only two basic and, in
with E. tranvena, are clearly visible. Since some ways opposable, concepts. The Bio-
it was described as different species in logical Species Concept (Mayr 1963) re-
Australia (Girault & Dodd 1915), Hawaii quires that populations of the same spe-
(Timberlake 1926), Somalia (Silvestri cies, whether they are in contact or not,
1931), and Japan (1938), we assume that have the potential to interbreed. The de-
this group was widespread in the Old gree and conditions under which inter-
World, prior to recent movements of spe- breeding will take place are problematic
cies for use in the biological control of (Donoghue 1985), especially when they
whiteflies. Both authors of this paper have are used to assess allopatric populations
examined several hundred E. transvena that have varying degrees of reproductive
from around the world and found no di- incompatibility (cf. Rosen & DeBach 1979).
agnostic characters that would separate The ability to interbreed in Aphelinidae
any population as distinct from the others, and other Chalcidoidea can be further
Recent studies, however, have shown complicated by other factors, such as en-
mating incompatibilities and morphomet- dosymbiotic bacteria that can induce re-
ric (shape) differences between popula- productive incompatibility within or be-
tions of £. transvena from Spain and Pak- tween populations (O'Neill et al. 1997;
istan (G. Viggiani, pers. comm.) that al- Luck et al. in press). These incompatible
lude to the potential for this to be a cryptic populations can even be cured through
or sibling species complex. Should we antibiotics or heat treatments and inter-
proceed with the synonymy or wait for breeding reestablished (Stouthamer &
further evidence of potential species Luck 1993; Luck et al. in press), which
boundary characteristics? The synonymy brings into question the criterion of in-
is justified on both philosophical and prac- compatibility for separating otherwise in-
tical grounds. For practical purposes, the distinguishable populations that have
assignment of an appropriate specific ep- been treated previously as either cryptic,
ithet to any of the geographically isolated sibling or semi species. In contrast, under
populations is complicated by their taxo- a Phylogenetic Species Concept (Dono-
nomic history. Five names were proposed ghue 1985), at least one diagnostic char-
within this complex, of which £. sophia is acter is required for each species to denote
the oldest, and £. transvena (described an evolutionary lineage. The simple no-
from Hawaii, where it may have been ac- tion of reproductive incompatibility, the
cidentally introduced from Japan, south- foundation of the Biological Species Con-
east Asia or Australia) is probably the cept, is not sufficient. A discrete morpho-
least applicable to the populations from logical character found in all individuals
Pakistan or Spain under study. If there has is usually taken as the best criterion for

Volume 9, Number 1, 2000

165

separating species; species are both diag-
nosable and unique. Whether both molec-
ular and morphometric (shape) character-
istics are considered diagnostic under a
Phylogenetic Species Concept is debat-
able, especially since they may be describ-
ing only population level differences that
do not contribute to the "potential" for a
species to interbreed (Avise & Wollenberg
1997). In any case, differences must be
demonstrated over the range of a species
to assure that they are not merely repre-
sentative of clinal variation in a series of
populations belonging to a single species.
Currently, £. sophia and E. transz^ena, and
all of the names synonymized of £. trans-
vena, cannot be distinguished using diag-
nostic morphological characters, and syn-
onymy under the oldest valid senior
name, E. sophia, is justified.

Hosts. — Aleyrodidae: Acaudalei/rodes
rhachipora (Singh) (Hayat 1989), Aleurocy-
botus indicus David & Subramaniam (Po-
laszek et al. 1992), Aleurodicus dispersus
Russell (Polaszek et al. 1992), Aleurolobus
sp. near niloticus (Hayat 1989a), Bemisia?
(= Aleyrodes) hibisci (USNM 29067), Bemi-
sia tabaci (Gennadius) (Polaszek et al. 1992,
Hayat 1989, Gerling 1985), Parabemisia
myricae (Kuwana) (Polaszek et al. 1992),
Pealius hibisci (Kotinsky) (Timberlake
1926), Trialeurodes ricini (Misra) (Hayat
1998), Trialeurodes zmporariorum Westwood
(Polaszek et al. 1992, Timberlake 1926,
Gerling 1985). Aphididae: Aphis sacchari
Zehntner? (Timberlake 1926). Coccidae:?
(Shafee 1973). Psyllidae: Diaphorina citri
Kuwayama (Polaszek et al. 1992). [The
psyllid host is correct, although possibly
E. sophia is a hyperparasitoid on Tamarixia
radiata (Waterston) [Huang & Polaszek
1998], so the aphid and coccid associations
also may be "primary" hosts of hyperpar-
asitic males.]

Distribution. — Cosmopolitan in the Old
World, introduced in the New World. Af-
rotropical: Burundi; Cape Verde (Hayat
1998); Ivory Coast; Morocco; Niger (Hayat
1998); Sierra Leone; Somalia (Silvestri

1931). Oriental: Hawaiian Islands (Tim-
berlake 1926); Hong Kong; India (Hayat
1989); Indonesia; Sri Lanka (Hayat 1998);
Pakistan (Hayat 1989); People's Republic
of China (Huang & Polaszek 1998); Tai-
wan; Thailand. Palaearctic: Japan (Ishii
1938); Spain.

Material Examined (289 females, 71 males). — Burun-
di: Bujumbura, vii.1987, J. Yaninek, whitefly on Cas-
sava (1? USNM). Hong Kong: Kovvloon Park,
14.vii.1992, F.D. Bennett, Y944, Bemisia tabaci on Cha-
maesyce (?) hirta (1 9 USNM). India: Rajkot, 9.ii.l958,
G.W. Angolet, whitefly on Ricinu^ communis (49
USNM); India (no other locality), 19.xii.1990, G. But-
ler, Bemisia tabaci (19 USNM). Indonesia: Java: Ban-
doeng, x.1929, C. P. Clausen, 2420, Asterochiton (109
UCRC). Ivory Coast: 20 km west of Abidjan,
21.iv.1988, L.D.C. Fishppol, 125, Bemisia tabaci on Ma-
nihot esculentum (2 9 USNM). Japan: Shikoku: Kochi,
23.vii.1980, P. DeBach, R.80.28, R.80.29, R.80.34, Par-
abemisia myricae on Moras, Parabemisia myricae on Cit-
rus (43 9 lei UCRC); 20-25.ix.1979, M. Rose, R79-67-
1 & 2, Parabemisia myricae on Morns (139 56 UCRC);
Kyushu: Kagoshima City, 8.viii.l972, S. Ogo, R72-42,
"Dialeu.rod.es citri on Citrus (39 UCRC); Honshu: Mie
Prefecture, near Kuana City, 11, 15, 16, 18, 20,
21.viii.1981, M. Rose, R81-34, R81-35, R81-36, R81-37,
R81-39, R81-40, R81-41, R81-42, Parabemisia myricae on
Morns (60 9 46 UCRC); Shizuoka, L7.vii.1981,
5.viii.l982, K. Furuhashi, R82-30, on Moms (49
UCRC); 22-24.viii.1981, M. Rose, R81-43, Parabemisia
myricae on Moras (19 UCRC). Morocco: Agadir,
vi.1992, Parabemisia myricae (19 USNM). Niger:
4.xi.l987, Hansen, CIE A19340, Alcurocybotus indicus
on rice (19 USNM). Pakistan: Sialkot, 25.ix.1969, R.
Ahmad, R69-110, Dialeurodes citri on Citrus (16
UCRC); Pakistan (no other locality), L5.V.1987, L. Os-
borne, 803, Bemisia tabaci (19 USNM). People's Re-
public of China: Sichuan Province: Bei-Pei District,
19.viii.1980, P. DeBach, C3, whitefly on Moms (79 Id
UCRC); Guangdong Province, Guangzhou,
Ll.vii.1992, F.D. Bennett, Y894, whitefly on lactuca
(16 USNM). Sierra Leone: viii.1960, Bemisia (79
USNM). Spain: Murcia, L9.vii.1994, EBCL— A. Kirk ,v
L. Lacey, M93002, Bemisia tabaci on Lantana (19 9
UCRC). Taiwan: Tao-vuan, 3.xii.l993, C. Moomaw,
Mission Biological Control Lab culture (Texas)
M93054, Bemisia on Pomsetlia (39 TAMU). Thailand:
Chiang Mai, 14.iii.1994, L. Lacey & A. Kirk M94041,
Bemisia tabaci on Poinsettia (9 9 UCRC, 19 \6
TAMU); Chiang Mai University, L5.L1993, F.D. Ben-
nett, Y1009, whitefly on Hibiscus mutabilis (1.
USNM); Pang Hang, I5.iii.1994, I . Lacey & A. Kirk.
M94049, Bemisia tabaci on Xanthium; W^n Ion Lea,
20.L1992, F.D. Bennett, 1224, Bernini tabaci on Gossy
pium hirsutum (69 USNM); near Bangkok, iii.1992,
F.D. Bennett, 1245, Bemisia tabaci on Solatium melon-

166

Journal of Hymenoptera Research

gena (6 9 USNM). USA: Arizona: Cochise County:
Guadalupe Canyon, 31 miles east of Douglas,
14.ix.1978, J.B. Woolley, 78035, whiteflies on mesquite
(19 TAMU). Florida: Dade County: Miami,
14.vi.1992, 21.vii. 1991, 22.vii.1991, 31.viii.1991,
19.X.1991, F.D. Bennett, Y276, Y277, Y358, Y459, Y834,
Bemisia tabaci on Chamaesyce hyssopifolia, Bemisia tabaci
on Euphorbia(119 196 USNM); Homestead, 4.V.1992,
F.D. Bennett, Y757, Bemisia talma on Emilia sonchifolia
(16 USNM); Snapper Creek, 13. vi. 1992, 14.vi.1992,
19.X.1991, F.D. Bennett, Y457, Y830, Y837, Bemisia ta-
baci on Emilia sonchifolia, Bemisia tabaci on Chamaesyce
hyssopifolia (49 46 USNM). Alachua County: Ala-
chua, xi.1992, H. McAuslane, 1376, Bemisia on peanut
(3 9 USNM); Gainesville, 19.iii.1968, M. Kosztarab
874, Diaspis on Opuntia (2 9 USNM); 3.V.1992, G.A.
Evans, 1251, on Ilex (16 USNM); 27.viii.1992, F.D.
Bennett, Y936, Bemisia tabaci on Sesamum indicum (19
USNM); Micanopy, 20.U990, F.D. Bennett, Y487,
whitefly on Citrus (19 USNM). Saint Lucie County:
Fort Pierce, 9.viii.l992, F.D. Bennett, Y904, Bemisia ta-
baci on Emilia sonchifolia (29 Id USNM). Okeechobee:
Fort Drum, 17.x. 1991, F.D. Bennett, Y440, Bemisia ta-
baci on Emilia (3 9 6c? USNM). Orange County: Apop-
ka, 15.viii.1988, L. Osborne, Bemisia tabaci on Euphor-
bia (179 46 TAMU); 10.ix.1987, Rose & Osborne,
T87032, Bemisia tabaci (?) on Euphorbia (46 TAMU);
vi-vii.1989, 14.x. 1989, 25.x. 1989, 29.xi.1989, K. Hoel-
mer, Bemisia tabaci on Lantana, Trialeurodes variabilis
on papaya (19 3d USNM). Broward County: Pom-
pano Beach, 22.iii.1992, v.1993, 10.viii.1992, 19.x. 1991,
19.xi.1991, F.D. Bennett, Y448, Y541, Y665, Y908,
Y1056, Bemisia tabaci on Chamaesyce hyssopifolia, Be-
misia tabaci on Emilia sonchifolia (13 9 76 USNM).
Palm Beach County: West Palm Beach, ll.iv.1992,
10.viii.1992, ll.ix.1992, F.D. Bennett, Y907, Y933, 1559,
Bemisia tabaci on Emilia sonchifolia, Bemisia tabaci on
Chamaesyce hyssopifolia (39 46* USNM). Monroe
County: Isla Morada, 30.iv.1993, 18.x. 1991, F.D. Ben-
nett, Y453, Y1108, Bemisia tabaci on Chamaesyce hys-
sopifolia, Bemisia tabaci on Chamaesyce hirto (29 16
USNM); Key Largo, 18.x. 1991, F.D. Bennett, Y444, Be-
misia tabaci on Desmodium tortuosum (39 36 USNM).
Manatee County: Bradenton, 13. v. 1993, E. Vasquez,
Y1053, Bemisia tabaci (49 26 USNM). Texas: Hidalgo
County, Mission Biological Control Lab, 16.xii.1993,
M93002 (MBCL culture voucher specimen), Bemisia
tabaci (1 9 TAMU). California: Orange County: U.C.
South Coast Field Station, 1 5-16. xii. 1982, S. Key, Par
abemisia myricae on lemon (99 16 UCRC); Los An-
geles County: San Gabriel, 22. iv. 1982, Rose & Ferren-
tino, Parabemisia myricae on orange (19 UCRC). Ha-
waii: Oahu: Moiliili, 15.iii.1984, B. Kumashiro, Bemisia
tabaci on eggplant (7 9 TAMU).

Encarsia strcnua (Silvestri)

(Figs. 16, 30)

Prospaltclla strcnua Silvestri, 1928: 34-36. Type
data: China: Macao. Holotype female, by

monotypy. Type depository: IEUN. De-
scribed: female. Illust. Reared from Bemisia
gijfardii on Citrus. Placed in strcnua group by
Viggiani & Mazzone (1979) and Hayat
(1989).

Encarsia strenua, Viggiani & Mazzone, 1979: 46.
Change of combination.

Encarsia strenua; Polaszek et ai. 1992: 388;
Schauff et al. 1996: 29. Described: female. Il-
lust. Broadly defined to include what is now
recognized as E. protransvena and E. citri.

Encarsia strenua; Polaszek & Huang 1998: 1951-
53. Described: female. Illust. Based on Chi-
nese and Taiwan material.

Female. — Antenna with 6 flagellomeres,
clava 3-segmented; Fl 2.6-3.6 X as long as
broad and 0.9-1. OX as long as F3; antenna
yellow basally, darkened beyond or in-
cluding pedicel. Vertex and ocellar trian-
gle strongly areolate; head yellow except
for weak infuscation on inner margins of
ocelli; dorsal setae robust. Maxillary pal-
pus 1-segmented. Mandibles 2/2 or 2/3
dentate, teeth blunt to hardly recogniz-
able, dorsal tooth, if visible, minute. Me-
sosoma mostly yellow except pronotum
pale brown medially and anterior margin
of midlobe of mesoscutum sometimes pale
brown, rarely axillae and metasoma more
extensively pale brown. Mesosoma with
hexagonally areolate sculpture dorsally;
midlobe with 4-5 pairs of setae, posterior
and lateral setae noticably stouter than
medial setae, side lobe with 3 pairs (rarely
with additional seta), axilla with 2 pairs
(lateral pair minute), and scutellum 2
pairs, medial pair lateral to sensillae. Scu-
tellar sensillae ovoid and separated by less
than than their own maximum diameter;
median groove narrow and distinct. Api-
cal spur of mid tibia 0.7-0.9 X as long as
basitarsus; basitarsomere of midtarsus
with 4-5 large pegs, tarsomeres 3-5 each
with 1 robust apical peg, rarely a single
peg on tarsomere 2. Tarsal formula 5-5-5.
Fore wing 2.44-2.67X as long as broad,
marginal fringe 0.13-0.29X width of fore
wing; disc uniformly setose; costal cell
with row of 13-23 small setae and 1-3

Volume 9, Number 1, 2000

167

long marginal setae apically; submarginal
vein with 2 large setae, basal area with 8-
12 setae posterior to submarginal vein; f re-
nal fold without spines; wing hyaline. Me-
tasoma mostly yellow, tergites I + II
sometimes with faint infuscation, usually
yellow; laterally with weak cellulate retic-
ulation; dorsal setal formula from tergite
III: 2-2-2-6-6-6. Ovipositor 1.56-1.97X as
long as mid tibia, 2.43-3.26X as long as
clava, 0.8-0.9 X as long as metasoma (base
to tip of third valvula); third valvula elon-
gate, 2.9-4.7X as long as broad, extruded
beyond epygium, yellow except for ex-
treme tip dark brown.

Male. — Overall coloration pale brown,
darker brown pattern on head and meso-
soma similar to E. bimaculata female, gas-
ter entirely brown. Setation pattern of me-
sosoma and metasoma as in female but
midlobe of mesoscutum with 4-5 pairs of
setae. Midbasitarsomere with only 2 pegs.
Antenna with 5 flagellomeres, apical two
flagellomeres (5&6) fused, with segments
distinguished only by a break in the pat-
tern of linearia (Fig. 30).

Comments. — The Californian population
differs from the Asian forms by having
darkened axillae and gaster (yellow in
asian forms) and the third valvulae less
elongate, being less than 3.5 X as long as
broad. All females of E. strenua have at
least 4 large pegs on the midbasitarso-
mere, a long ovipositor and third valvula,
8-12 setae in the basal area of the fore
wing, and the tip of the third valvula
brown. The males from India have a
slightly more elongate antenna (ca. 1.2X
as long as head width), whereas the single
male has a slightly more compact antenna
(ca. 1.1 X as long as head width). The dif-
ference could be due to different mount-
ing techniques, and for other characters
the males were identical.

Hosts. — Aleyrodidae: Aleurobus subro-
tundus Silvestri (Clausen 1934), Aleuropla-
tus (Clausen 1934), Asterochilton (Clausen
1934), Bemisia gijfardii (Kotinsky) (Silvestri
1928), Dialeurodes citri (Ashmead) (Polasz-

ek et al. 1992), Dialeurodes kirkaldii (Kotin-
sky) (Polaszek et al. 1992), Parabemisia myr-
icae (Kuwana) and Siphonius phillyreae
(Haliday). The host records from Clausen
(1934) have not been verified. The host
range presented here is more restricted
than that of Polaszek et al. (1992) after ex-
clusion of much of the New World mate-
rial now placed as E. protransvena.

Distribution. — Nearctic: USA (Califor-
nia). Oriental: China (Fujian, Guangdong)
(Huang & Polaszek 1998); Hong Kong
(Polaszek et al. 1992); India; Macau (Sil-
vestri 1928).

Material Examined (60 females, 40 males). — Hong
Kong: Kowloon, 2.xii.l986, F. Bennett, ex Jasmine
whitefly on Jasminium (19 16 USNM, 19 BMNH).
India: Uttar Pradesh: Ranikhet, 4.viii, 7.viii, 18-
19.viii, 11. ix, lO.ix, 7.x. 1969, G. Chamora, R69-81, R69-
85, R69-89, R69-101, R69-103, D. citri on Citrus (8?
246 UCRC); West Bengal: Kalimpang, 2.ix, 12.ix,
18.ix.1969, Kurup (CIBC), R69-98, R69-104, 69-106,
R69-116, Dialeurodes citri on Citrus (439 216 UCRC);
Kayala: Bakarkhola [locality not verified], 21.vii.1969,
G. Chondra, R69-77 (39 UCRC); [locality?] R69-93
(37 d UCRC). P.R. China: Guangdong: Guangzhou,
ll.vii.1992, F. Bennett Y941, Dialeurodes on Cirrus (1 9
USNM). Israel? [no locality, just Tel-Aviv University
header]: viii.1990, D. Gerling, on leaf with Siphonius
phyllireae (29 USNM).

ACKNOWLEDGMENTS

We would like to thank Lai Shan Mui for the illus-
trations and Dave Hawks for assistance in gathering
measurement data. Mike Rose, Jim Woolley and Mike
Schauff provided loans of material, and tremendous
hospitality was offered by Gennaro Viggiani during
visits to the Silvestri collection in Portici. This work
was supported in part by grants from the National
Biological Control Institute (to M. Schauff) .\nd the
California Department of Food and Agriculture
(JMH).

LITERATURE CITED

Avise, J. C. and K. Wollenberg. 1997. Phylogenetics
and the origin of speed's. Proceedings oj the Na
tional Academy of Sciences l,4: 7748-7755.

Bellows, T. S., T. D. Paine, J. R. Gould, L. Bezark, J.
C. Ball, W. Bentley, R. Coviello, J. Downer. P.
I lam, D. Flaherty, P. Gouveia, K. Koehler, R.
Molinar, N. O'Connell, E. Perry and G. Vogel.
1992. Biological control of ash whitefly: a success
in progress. California Agriculture 46: 24, 27-28.

Clausen, C. P. 1934. The natural enemies oi Aleyrod-

168

Journal of Hymenoptera Research

idae in tropical Asia. Philippine Journal of Science
53: 253-265.

Clausen, C. P. 1978. hit roil need parasites and predators
of arthropod pests and weeds: A world review. Ag-
ricultural Handbook 480 (USDA-ARS). 545 pp.

Compere, H. 1931. A revision of the species of Coc-
cophagus a genus of hymenopterous coccid-in-
habiting parasites. Proceedings of the United States
National Museum 78:1-132.

Donoghue, M. J. 1985. A critique of the Biological
Species Concept and recommendations for a
phvlogenetic alternative. The Bryologist 88: 172-
181.

Gerling, D. 1985. Parasitoids attacking Beiuisia tabaci
(Horn.: Aleyrodidae) in Eastern Africa. Entomo-
phaga 30: 163-165.

Girault A. A. and A. P. Dodd. 1915. The cane grubs
of Australia. Bulletin of the Bureau of Sugar Exper-
iment Stations, Queensland Division of Entomology
2: 1-60.

Hayat, M. 1986. Family Aphelinidae. Pages 143-171
in: Subba Rao, B. R. & Hayat, M, The Chalci-
doidea of India and the adjacent countries. Part
2. A catalogue. Oriental Insects 20: 1-430.

Hayat, M. 1989. A revision of the species of Encarsia
Foerster (Hymenoptera: Aphelinidae) from India
and the adjacent countries. Oriental Insects 23: 1-
131.

Hayat, M. 1998. Aphelinidae of India (Hymenoptera:
Chalcidoidea): A taxonomic revision. Memoirs of
the American Entomological Society 13: 416 pp.

Huang, J. 1994. Systematic Studies on Aphelinidae of
China. Chongquing Publishing House, Chongqu-
ing. 348 pp.

Huang, J. and A. Polaszek. 1998. A revision of the
Chinese species of Encarsia Forster (Hymenop-
tera: Aphelinidae): parasitoids of whiteflies, scale
insects and aphids (Hemiptera: Aleyrodidae,
Diaspididae, Aphidoidea). journal of Natural His-
tory 32: 1825-1966.

Ishii, T. 1938. Descriptions of six new species of
Aphelinidae with a revised table of genera. Kon-
tyii 12: 27-32.

Kuwana, I. 1922. Notes on a newly imported parasite
of the spiny whitefly attacking citrus in japan.
5th Pacific Science Congress Proceedings 5: 3521-
3523.

Luck, R. F., L. Nunney and K. Stouthamer. In press
Factors affecting sex ratio and quality in the cul-
turing of parasitii Hymenoptera: a genetic ami
evolutionary perspective (Chapter 7). In Biologi-
cal Control, T. Fischer el id. (ed). University of C al-
ifornia Press.

M.ivr, E. 1963. Animal Species and I volution. Harvard
University Press.

Meachum, C. A. and T. Duncan. 1987. Morphosys, ver
sion 1.29. University of California, Berkeley.
It ware)

Mound, L. A. and S. H. Halsey. 1978. Whitefly of the
'world: A systematic catalogue of the Aleyrodidae (Ho-
moptera) with host plant and natural enemy data.
John Wiley & Sons: Chichester.

Nguyen, R. and F. D. Bennett. 1995. Importation and
field release of parasites against silverleaf white-
fly, Bemisia argentifolii (Bellows and Perring) in
Florida from 1990-1994. Proceedings of the Florida
State Horticultural Society 108: 43-47.

Nguyen, R., R. I. Sailer and A. B. Hamon. 1993. Cat-
alog of Aleyrodidae on citrus and their natural
enemies (Homoptera: Aleyrodidae). Occasional
Papers of the Florida State Collection of Arthropods
8: 1-57.'

Nguyen, R. and R. I. Sailer. 1987. Facultative hyper-
parasitism and sex determination of Encarsia smi-
thi (Silvestri) (Hymenoptera: Aphelinidae). An-
nals of the Entomological Society of America 80: 713-
719.

O'Neill, S. L., A. A. Hoffmann and J. H. Werren. 1997.
Influential Passengers: Inherited Microorganisms and
Arthropod Reproduction. Oxford University Press.

Polaszek, A. 1991. Egg parasitism in Aphelinidae
(Hymenoptera: Chalcidoidea) with special refer-
ence to Centrodora and Encarsia species. Bulletin
of Entomological Research 81: 97-106.

Polaszek, A., S. Abd-Rabou and J. Huang. 1999. The
egyptian species of Encarsia (Hymenoptera:
Aphelinidae): a preliminary review. Zoologische
Medelingeu Leiden 73: 131-163.

Polaszek, A., G. A. Evans and F. D. Bennett. 1992.
Encarsia parasitoids of Bemisia tabaci (Hymenop-
tera: Aphelinidae, Homoptera: Aleyrodidae): a
preliminary guide to identification. Bulletin of En-
tomological Research 82: 375-392.

Rosen, D. and P. DeBach 1979. Species of Apln/tis of
the World (Hymenoptera: Aphelinidae). Series
Entomologica 17: 801 pp.

Sailer, R. I., R. E. Brown, B. Munir and J. C. E. Nick-
erson. 1984. Dissemination of the citrus whitefly
(Homoptera: Aleyrodidae) parasite Encarsia la-
horensis (Howard) (Hymenoptera: Aphelinidae)
and its effectiveness as a control agent in Florida.
Bulletin of the Entomological Society of America 30:
36-39.

Schauff, M. E., G. A. Evans and J. M. Heratv 1997. A
pictorial guide to the species of Encarsia (Hvm:
Aphelinidae) parasitic on whiteflies (1 lomoptera:
Aleyrodidae) in North America. Proceedings of the
Entomological Society of Washington c)8: 1-35.

Shafee, S. A. N73. Indian species of the genus Pros-
paltella Ashmead (Hym.: Aphelinidae). Entomo
phaga 18: 251 -258.

Silvestri, F. 1928 (1927). Contribuzione alia conoscen-
za degli Aleurodidae (Insecta: Hymenoptera)
viventi su Citrus in estremo Oriente e die loro
parassiti. II Descrizione e notizie biologiche dei
parassiti di Aleurodidi vivienti si Citrus. Bollet

Volume 9, Number 1, 2000

169

tino del Laboratorio di Zoologia Generate e Agraria,
Portici 21: 20-60.

Silvestri, F. 1931. Descrizione di una nouva specie di
Prospaltella della Somalia. Bollettino della Societa
Entomologica Italiana 63: 20-22.

Simmons, A. M. 1998. Survey of parasitoids of Bemisia
argentifolii (Homoptera: Aleyrodidae) in coastal
South Carolina using yellow sticky traps. Journal
of Entomological Science 33: 7-14.

Stouthamer, R. and R. F. Luck. 1991. Influence of mi-
crobe-associated parthenogenesis on the fecun-
dity of Trichogramma deion and T. pretiosum. En-
tomologia Experimentia el Applicata 67: 183-192.

Timberlake, P. H. 1926. New species of Hawaiian
chalcid-flies (Hymenoptera). Proceedings of the
Hawaiian Entomological Society 6: 305-320.

Viggiani, G. 1985a. Notes on a few Aphelinidae, with
descriptions of five new species of Encarsia Foers-
ter (Hymenoptera, Chalcidoidea). Bollettino del

Laboratorio di Entomologia Agraria 'Filippo Silvestri'
di Portici 42: 81-94.

Viggiani, G. 1985b. Additional notes and illustrations
on some species of aphelinids described by A. A.
Girault and A. P. Dodd in the genera Coccophagus
Westwood, Encarsia Foerst. and Prospaltella
Ashm. (Hym.: Chalcidoidea). Bollettino del Labor-
atario di Entomologia Agraria 'Filippo Silvestri' ill
Portici 42: 233-255.

Viggiani, G. and P. Mazzone. 1979. Contributi alia
conoscenza morfo-biologica delle specie del com-
presso Encarsia Foerster -Prospaltella Ashmead
(Hym. Aphelinidae). Bollettino del Laboratario di
Entomologia Agraria 'Filippo Silvestri' di Portici 36:
42-50.

Woollev, J. B. and H. W. Browning. 1997. Morpho-
metry analysis of uniparental Aphytis reared
from chaff scale, Parlatoria pergandii Comstock,
on Texas citrus (Hymenoptera: Aphelinidae; Ho-
moptera: Diaspididae). Proceedings of the Ento-
mological Society of Washington 89: 77-94.

J. HYM. RES.
Vol. 9(1), 2000, pp. 170-175

A Peculiar New Genus and Species of Entedoninae (Chalcidoidea:

Eulophidae) from Southeast Asia

Rosichon Ubaidillah, John LaSalle, and Donald L. J. Quicke

Unit of Parasitoid Systematics, CABI Bioscience UK Centre (Ascot), Department of Biology,

Imperial College at Silwood Park, Ascot, Berks, SL5 7PY, UK and Department of Entomology,

The Natural History Museum, Cromwell Road, London SW7 5BD, UK; and (RU) Museum

Zoologicum Bogoriense, LIPI, Gedung Widyasatwaloka, Jin Raya km 46, Cibinong,

Bogor 16911, Indonesia

Abstract. — Ambocybe petiolata Ubaidillah and LaSalle gen. and sp. n. from Peninsular Malay-
sia, Sulawesi and Papua New Guinea is described and illustrated and placed in the Entedoninae
(Hymenoptera: Eulophidae). In addition to having several unique features, Ambocybe lacks im-
portant characters that have been used previously as defining characters of the Entedoninae.
Possible relationships of the new genus to other entedonine genera are discussed.

Sorting of mass-collected material from
Southeast Asia revealed a peculiar genus
of Entedoninae (Eulophidae). This genus
differs from other entedonines in having a
strong ridge surrounding the frons on the
front of the head, and a similar one sur-
rounding the entire occipital region on the
back of the head. In addition, it differs
from most entedonines in having several
pairs of setae on the scutellum, having a
single dorsal seta on the submarginal vein,
and lacking a frontal sulcus.

We are describing this genus as part of
an interest among the authors to, (1) de-
scribe the eulophid fauna of Southeast
Asia, and (2) provide a necessary frame-
work for understanding variation within
the Eulophidae, including exceptions to
characters used for subfamily definition.

A single diagnosis and description are
offered for this new genus and new spe-
cies. Without additional species it is im-
possible to distinguish between species
level and genus level characters.

Acronyms used in the text are as fol-
lows. Collections: ANIC, Australian Na-
tional Insect Collection, CSIRO, Canberra,

Australia; BMNH, The Natural History
Museum, London, UK; MZB, Museum
Zoologicum Bogoriense, Bogor, Indonesia;
UCR, University of California, Riverside,
California, USA; USNM, United Stated
National Museum of Natural History,
Washington, D.C., USA. Terminology:
MV, marginal vein; OOL, oculo-ocellar
length, the distance between the lateral
ocellus and eye margin; POL, postero-
ocellar length, the distance between the
lateral ocelli; PMV, postmarginal vein;
SMV, submarginal vein; and SV, stigmal
vein.

Ambocybe Ubaidillah and LaSalle, new
genus

(Figs. 1-7)

Type species: Ambocybe petiolata Ubaidillah and
LaSalle

Diagnosis. — Head with a strong, invert-
ed U-shaped ridge surrounding the frons
(Fig. 4), and a similar one surrounding en-
tire occipital region (Fig. 5). Scutellum
with 5-6 pairs of setae (Fig. 6). Submar-
ginal vein with single dorsal seta (Fig. 2).
Forewing with speculum absent. Fore bas-

Volume 9, Number 1, 2000

171

Figs. 1-3. Amboq/be petiolata, female. 1. Habitus. 2. Forewing. 3. Antenna.

172

Journal of Hymenoptera Research

Figs. 4-7. Ambocybe petiolata, female: 4. Head, frontal view. 5. Head and mesosoma. 6. Scutellum and pro-
podeum. 7. Propodeum and petiole.

itarsus elongate, slender, about twice as
long as second segment (Fig. 1). Pronotum
small, not visible in dorsal view (Fig. 5).
Propodeum with distinct plicae; with two
subparallel median carinae; area between
median carinae slightly depressed and
sculptured; plicae converging along pos-
terior margin of propodeum and ending
at arcute adpetiolar carinae (Fig. 6). Petiole
long and slender, reticulate dorsally (Fig. 7).

Ambocybe petiolata Ubaidillah and
LaSalle, new species

(Figs. 1-7)

Female. — Length of body 1.0-1.3 mm;
length of forewing 0.75-0.95 mm. Head
and body dark brown, lower face and me-
tasoma paler. Antenna yellow-brown.
Legs pale yellow except coxae yellow-
brown. Sculpture on mesosoma reticulate,
shiny.

Volume 9, Number 1, 2000

173

Head (Figs. 4, 5) broad with shiny, weak
coriaceous to imbricate sculpture and in-
conspicuous pilosity. Compound eyes
convex and large. Frons defined by an in-
verted U-shaped ridge extending from an-
terior ocellus along eye margin to lower
face. Lower face produced medially, con-
cealing clypeus, which is reduced and in-
flected. Strong longitudinal median carina
present between toruli. Back of head with
strong ridge forming a large curve from
vertex to gena and defining a large,
smooth occiput. Temple narrow. Vertex
shiny, although finely wrinkled, with fine
transverse carina between lateral ocellus
and compound eyes. POL/OOL = 1.6.
Antenna (Fig. 3) with scape long and slen-
der, about 5 times as long as wide, reach-
ing above vertex. Pedicel short, slender,
about 2 times as long as wide. Two trans-
verse anelli. Funicle with three segments,
all longer than wide. Club with two seg-
ments.

Mesosoma (Figs. 5-6) except propo-
deum reticulate. Pronotum reduced and
not visible in dorsal view. Mesoscutum
transverse; midlobe with 2-3 pairs of se-
tae; notaulus incomplete, but indicated
posteriorly by wide shallow depression.
Scutellum longer than broad, with 5-6
pairs of setae; slightly produced posteri-
orly" so dorsellum concealed in dorsal
view. Propodeum medially 0.40-0.50 as
long as length of scutellum, with plicae
and paired, subparallel median carinae;
median carinae and plicae joined by trans-
verse carina at posterior margin of scutel-
lum. Legs long and slender; fore basitar-
sus elongate, slender, about twice as long
as second segment (Fig. 1). Forewing (Fig.
2) with SMV tapering at apex and joining
parastigma anteriorly to base of parastig-
ma. Speculum absent. SMV with 1 dorsal
seta. PMV very reduced, almost absent.
MV/SMV 1.5-1.75; MV/SV 4.45-5.4.

Metasoma. Petiole (Fig. 7) unusually
long, about three times as long as wide;
broader distally; with 2 setae on each lat-
eral margin; reticulate dorsally, with lon-

gitudinal dorso-lateral carina. Gaster
smooth, elongate elliptical. Ovipositor
short, apex not visible in dorsal view. Hy-
popygium extending 0.75-0.90 length of
gaster.

Male. — Unknown.

Biology and host. — Unknown.

Distribution. — Currently known from
Peninsular Malaysia, Sulawesi (Indonesia)
and Papua New Guinea. The somewhat
disjunct distribution spans both sides of
Wallace Line, and suggests that this spe-
cies may be more widespread through
Southeast Asia and Australasia.

Material examined. — Holotype female:
INDONESIA, Sulawesi, Dumoga Bone
N.P., Toraut, 16-23.V.1985, Malaise trap,
J.S. Noyes (MZB) (card mounted). 21 fe-
male paratypes (all card mounted): IN-
DONESIA: same data as holotype (5 fe-
males MZB; 5 females BMNH; 3 females
USNM; 3 females ANIC); same data as ho-
lotype but v.1985 (2 females BMNH). MA-
LAYSIA, Selangor, Serdang, UPM Cam-
pus, 25.viii-3.lx.1992, Malaise Trap, J.
LaSalle (1 female BMNH). PAPUA NEW
GUINEA: Central Province, -45 km NW
Port Moresby, 5km NW Brown River
Bridge (Hiritano Hwy).29.xii.l985, G.
Gordh, rainforest (1 female UCR); Central
Province, 20 km SE Port Moresby, l.i.1986,
G. Gordh, forest edge (1 female UCR).

Etymology. — Ambocybe is formed from
the Greek arnbon, for ridge or crest, and
kybe for head. Gender feminine. The spe-
cific name, petiolata, reflects the presence
of a long petiole.

Discussion. — Ambocybe is placed in the
Entedoninae, although it differs from most
other entedonines in several important
characters. The Entedoninae is one of the
best defined subfamilies of the Eulophidae
(Boucek 1988, Schauff 1991). It is easily
recognised by a variety of characters
which include: scutellum with a single
pair of setae (as opposed to two or more
pairs); submarginal vein with two dorsal
setae; mesoscutal midlobe with two pairs
of setae; male scape with sensory pores re-

174

Journal of Hymenoptera Research

stricted to the ventral edge; face with fron-
tal sulcus distinctly separated from the an-
terior ocellus; propodeum with subspira-
cular tubercles; marginal vein relatively
long; stigmal vein relatively short (Boucek
1988, Schauff 1991). The most important of
these characters are the single pair of setae
on the scutellum, the presence of only two
strong setae on the submarginal vein, and
the position of the frontal sulcus. None of
these characters are present in Ambocybe,
however all of these characters do show
variation within the Entedoninae.

A single pair of scutellar setae is one of
the best characters for defining the Ente-
doninae (Schauff 1991), and is found in al-
most all members of the subfamily. Am-
bocybe has 5-6 pairs of setae on the scutel-
lum. There are a few other entedonines
which have more than a single pair of se-
tae on the scutellum. These include Para-
Jwrismenus Girault (Boucek 1988), two spe-
cies of Pediobius Walker (Kerrich 1973,
Boucek 1977), and all members of the En-
tedononecremnus genus group in the Eu-
deromphalini (Entedononecremnus Girault,
Aleuroctonus LaSalle and Schauff, Dasyom-
phale LaSalle and Schauff; see LaSalle and
Schauff 1994).

Another important character for defin-
ing the Entedoninae is the submarginal
vein with two usually strong dorsal setae
(Schauff 1991). Ambocybe only has a single
seta. This character is also known in Myr-
mokata Boucek (Boucek 1972) and two gen-
era in the Euderomphalini, Pomphale Hu-
sain, Rauf and Kudeshia and Baeoentedon
Girault (LaSalle and Schauff 1994).

The frontal sulcus in Entedoninae is
generally distinctly separated from the an-
terior ocellus (Schauff 1991). This sulcus is
absent in Ambocybe. The frontal sulcus is
absent from several other Entedoninae, in-
cluding many species of Entedon Dalman
and some Paracrias Ashmead (Schauff
1991), as well as members of the Entedon-
onecremnus genus group (see above).

The mesoscutal midlobe in Entedoninae
typically has two pairs of setae (Schauff

1991), but this character is more homo-
plastic than the preceding three charac-
ters, and there are numerous exceptions.
Ambocybe has 2-3 pairs of setae on the me-
soscutal midlobe.

Despite the numerous characters by
which Ambocybe differs from other Ente-
doninae, we still feel that it is best placed
in this subfamily. Characters to support
this are the incomplete notauli, the struc-
ture of the carinae and plicae on the pro-
podeum which are similar to those in Pe-
diobius Walker, the presence of a small
subspiracular propodeal tubercle, the rel-
atively long marginal vein, and the short
stigmal vein.

The relationships of Ambocybe remain
unknown. The presence of distinct plicae
on the propodeum would suggest an af-
filiation with other genera which also have
this putatively synapomorphic character
(such as Pediobius Walker, Pediobomyia Gi-
rault, Rhynchentedon Girault, Apleurotropis
Girault, Pleurotroppopsis Girault, ParaJwr-
ismenus Girault, Zaommomentedon Girault,
Schizocharis Kerrich, Platocharis Kerrich,
Kratoysma Boucek, Horismenus Walker,
Paracrias Ashmead). Within this group of
genera, it could be closest to those genera
which posses some form of paired median
carinae on the propodeum, such as Pediob-
ius, Pediobomyia, and Rhynchentedon. How-
ever, it is not at all clear that Ambocybe is
related to these genera, because all of the
above genera possess a distinct transverse
carina on the pronotum, and the prono-
tum is distinct and clearly visible in dorsal
view. Ambocybe lacks a transverse carina
on the pronotum, and the pronotum is
short and not visible in dorsal view.

ACKNOWLEDGMENTS

Wo thank the GEF-Indonesian Biodiversity and
Collection Project tor funding KU and John Noyes
(The Natural History Museum, London) tor provid-
ing some specimens used in this study. Chris Burwell
and Christer Hansson made many useful suggestions
on the manuscript.

Volume 9, Number 1, 2000

175

LITERATURE CITED

Boucek, Z. 1972. Descriptions of new eulophid para-
sites (Hym., Chalcidoidea) from Africa and the
Canary Islands. Bulletin of Entomological Research
62: 199-205.

Boucek, Z. 1977. Taxonomic studies on some Eulo-
phidae (Hym.) of economic interest mainly from
Africa. Entomophaga 21: 40H14.

Boucek, Z. 1988. Australasian Chalcidoidea (Hymenop-
tera). A biosystematic revision of genera of fourteen
families, with a reclassification of species. CAB In-
ternational, Wallingford. 832 pp.

Kerrich, G. J. 1973. A revision of the tropical and sub-
tropical species of the eulophid genus Pediobius
Walker (Hymenoptera: Chalcidoidea). Bulletin of
the British Museum (Natural History), Entomology
29: 115-200.

LaSalle, J. and M. E. Schauff. 1994. Systematics of the
tribe Euderomphalini (Hymenoptera: Eulophi-
dae): parasitoids of whiteflies (Homoptera: Al-
eyrodidae). Systematic Entomology 19: 235-258.

Schauff, M. E. 1991. The Holarctic genera of Entedon-
inae (Hymenoptera: Eulophidae). Contributions of
the American Entomological Institute 26: 1-109.

J. HYM. RES.
Vol. 9(1), 2000, pp. 176-181

An Introduced Species of Epichrysocharis (Hymenoptera:

Eulophidae) Producing Galls on Eucalyptus in California with Notes

on the Described Species and Placement of the Genus

M. E. SCHAUFF AND R. GARRISON

(MES) Systematic Entomology Laboratory, USD A, PSI, Agricultural Research Service,

c/o National Museum of Natural History, Washington, D.C. 20560-0168, USA;

(RG) Department of Agricultural Commissioner, Weights and Measures,

County of Los Angeles, 3400 La Madera Ave., El Monte, CA 91732, USA

Abstract. — Epichrysocharis burzvelli Schauff, new species (Hymenoptera: Eulophidae) is de-
scribed from specimens collected in southern California. Epichrysocharis burzvelli forms small blis-
ter-like galls on the leaves of Eucalyptus citriodora. The previously described species of Epichryso-
charis are reviewed and separated from E. burwelli. Evidence suggests that this species was acci-
dentally introduced into the United States from Australia.

In early 1999, specimens of a small chal- had been unknown, although it was stated
cidoid wasp were submitted to the Sys- that they had been "associated with small
tematic Entomology Laboratory, USDA, galls on Eucalypt leaves" (Boucek 1988).
by the California Department of Food and The specimens recorded from California
Agriculture (CDFA) for identification, were reared from small blister-like galls
These tiny wasps were found emerging on the leaves of Eucalyptus citriodora and
from galls on the leaves of Eucalyptus ci- unemerged specimens have been dissect-
triodora in the Los Angeles area. Recently, ed from inside galls on the leaves. We can
their occurrence has been noted in several find no evidence that E. burwelli is para-
nurseries, and they are becoming wide- sitizing some other insect in or associated
spread in the Los Angeles area. Study of with the galls. It can now be confirmed
these specimens and subsequent rearings that this species is a gall former. The galls
revealed them to belong to the genus Ep- themselves appear as small reddish or
ichrysocharis (Hymenoptera: Eulophidae). brownish blisters on the surface of the leaf
This genus was only known to occur in (Figs. 5, 6). The galls are expressed on both
Australia and includes 3 species (Boucek surfaces of the leaves (that is, a single gall
1988). After study of the types of those produces a "blister" on both surfaces) and
species it was determined that the speci- the wasps do not seem to have a prefer-
mens reared in California represented a ence for one side or the other as emer-
species unknown to science. We take this gence holes can be seen on both sides of a
opportunity to describe this species and single leaf. The emergence holes are round
present information on the known species and tend to be in the center of the gall
of the genus to facilitate their identifica- (Fig. 6). The galls can be quite numerous
tion. Given the known distribution of this and we have counted in excess of 40 in a
genus, it is highly likely that this species single square centimeter of leaf surface,
was accidentally introduced into Califor- Whether or not this gall formation causes
nia from Australia. significant damage to the plant has not yet

The biology of Epichrysocharis species been assessed. However, the appearance

Volume 9, Number 1, 2000

177

Figs. 1-6. 1-4. Scanning electron micrographs: 1, Female antenna, dorsolateral view. 2, Female clava, dor-
soapical view. 3, Mesosoma, dorsal view. 4, Propodeum. 5-6. Eucalyptus citriodora leaf: 5, Surface with galls.
6, Closeup of gall showing emergence hole.

of these galls on nursery stock would most
likely reduce the attractiveness of the
plant and lower its market value. The
wasps appear to be spreading and are
now found in seven localities within Los
Angeles County.

During the editing of this paper an ad-
ditional series of three specimens of an-
other small tetrastichine was reared from

Eucalyptus leaves in Santa Barbara, Cali-
fornia. This species is readily distin-
guished from Epichrysocharis burwelli, but
because of the condition and limited num-
ber of specimens I have been unable to de-
finitively assign this species to a genus.
Along with a third species of tetrastichine
described by Headrick et al. (1995) from
California, and introduced from Australia

178

Journal of Hymenoptera Research

on Chamelaucium unciatum (Myrtaceae), it
is apparent that phytophagous species are
increasingly becoming established in the
U.S.

Terminology for morphology follows
Gibson (1997) and LaSalle (1994).

Acronyms for museums are: (BM) Bo-
hart Museum, University of California,
Davis, CA, USA; (CNC) Canadian Nation-
al Collection, Ottawa, Ontario, Canada;
(QM) Queensland Museum, Brisbane,
Australia; (BMNH) The Natural History
Museum, London, UK; (USNM) National
Museum of Natural History, Smithsonian
Institution, Washington, D.C., USA.

Epichrysocharis Girault

Epichrysocharis Girault 1913b:36. Type species,
Epichrysocharis fusca Girault. Original desig-
nation.

Brachychrysocharopsis Girault, 1922:103. Type
species, Brachychrysocharopsis aligherini Gi-
rault. By monotypy. Synonymy by Boucek
(1988: 690).

Diagnosis. — Length generally 0.5mm or
less; antenna (Figs. 1, 2) with 2 anelli, 3
funicles, all quadrate or wider than long,
Fl wider than F2 or F3, F2 smaller than
F3, Fl closely appressed to F2 and par-
tially extended over and covering F2 such
that in some views F2 is hidden giving the
impression that the funicle is 2-segment-
ed, clava longer than funicle; clava 3-seg-
mented, 3rd segment with suture oblique-
ly angled from 2nd (Fig. 2); malar suture
complete; pronotum very narrow medial-
ly, overhung by anterior margin of mesos-
cutum and not visible from above; mesos-
cutum large, convex, without median lon-
gitudinal groove, adnotaular setae restrict-
ed to area near notaulus in one or two
irregular lines and often with only 2-3 se-
tae on each side; scutellum with subme-
dian grooves and two pair of setae; pro-
podeum very short medially, generally
equal to or shorter than metanotum, with
no median or subspiracular carinae; spi-
racle round; metasoma sessile, broadly at-
tached to mesosoma and with no obvious

petiole, phragma generally projecting into
gaster. Submarginal vein with single dor-
sal seta, marginal vein subequal to sub-
marginal, stigmal vein well developed
and about 1/2 length of marginal.

EpidwysocJiaris closely resembles a num-
ber of small Australian tetrastichines
which also have very short antennae but
are currently placed in the large genus
Aprostocetus. In addition, there are other
genera generally considered closely relat-
ed to Aprostocetus, which have shortened
funicles (all 3 funiculars quadrate to
slightly wider than long, about the same
width, and funicle about equal in length
to or slightly longer than clava [see, for
example, A. (Epomphaloides) flavus (Boucek
1988, fig. 1191)]). While we have not stud-
ied these species closely, and many are
probably undescribed, one of the defining
characters of Aprostocetus is that the raised
lobe of the callus partially overhangs the
outer rim of the propodeal spiracle (Gra-
ham 1987; LaSalle 1994). We have not ob-
served this condition in the species which
we place in Epichrysocharis.

Boucek (1988) synonymized Epentasti-
chus Girault under Aprostocetus. The senior
author has examined the type species,
Epentastichus nugatorius Girault (QM). Un-
fortunately, the body of the type has been
lost and only two heads, mounted on a
slide, remain. These heads are in poor con-
dition, but the antennae of these two par-
tial specimens are very similar to Epichry-
socharis. However, given the fragmentary
nature of the specimens, and in the ab-
sence of more detailed revisionary work,
we do not feel that enough evidence exists
at this time to make any further nomen-
clatural changes regarding the placement
of £. nugatorius. Boucek (1988) also syn-
onymized Epomphaloides with Aprostocetus.

Several species of other genera from the
Australian fauna have also been reared
from or associated with galls on Eucalyp-
tus. Although they were studied at the ge-
neric level by Boucek (1988), the included
species have not been critically revised.

Volume 9, Number 1, 2000

179

What is apparent, is that this whole com-
plex of generic names and species is much
more diverse than indicated by the few
species described at this time, and that
much work on the taxonomy will need to
be done to increase our understanding of
the limits of this group of genera.

Species of Epichn/socharis

Epichn/socharis aligherini (Girault)

Brachychrysocharopsis aligherini Girault 1922:
103. Transferred to Epichn/socharis by Boucek
1988.

Diagnosis. — Mesosoma and metasoma
black; forewing with apical fringe equal to
about 1/3 wing width; ovipositor about
2/3 to 3/4 length of metasoma, slightly
exserted past tip of gaster. This species is
distinguished by the uniform dark color-
ation and the elongate ovipositor which
extends for well over half the length of the
metasoma.

Type. — The single type specimen of this
species is slide mounted. It is badly
crushed and disarticulated with the head,
mesosoma, metasoma, legs, and antennae
scattered over the slide. The head is frag-
mented and the antennae mostly disartic-
ulated and shriveled making it nearly im-
possible to make out the relative sizes and
numbers of segments. A single forewing
remains attached to the mesosoma. The
other wings cannot be found. The speci-
men is not cleared, but a few characters
can be discerned, and based on what can
be seen, it appears that this species is ap-
propriately placed in Epichrysocharis.
There is no register number evident on the
slide. Deposited in QM.

Epichrysocharis fasca (Girault)

Quadrastichus fusca Girault 1913b: 234. Trans-
ferred to Epichrysocharis by Girault 1913b.
Isotypic with Q. fusca.

Diagnosis. — Body light brown or yellow,
head yellow; antenna with Fl, F2, and F3
all wider than long and all subequal in
length. Fl and F2 each with a single lon-

gitudinal sensillum. Ovipositor about 1/3
length of metasoma. This species is dis-
tinctive because it is the only one with a
longitudinal sensillum on F2.

Type. — The type (QM register no. Hy-
1847) of this species is a female, slide
mounted with the body minus the head
under one cover slip and the head under
the second cover slip. The head is badly
crushed, but one antenna is clearly visible.
The body is not cleared. Deposited in QM.

Epichrysocharis nigriventris (Girault)

Epentastichus nigriventrus Girault 1913a: 242.
Transferred to Epichn/socharis by Boucek
1988.

Diagnosis. — Head yellow, mesosoma
yellow orange, metasoma brown to dark
brown, hind femur brown, hind tibia and
tarsus yellow; mesoscutum and scutellum
striate reticulate; mesocutum about 2x as
long as scutellum, metasoma ovate and
slightly shorter than mesosoma (30:25);
antenna with Fl as long as wide, 3x as
long as F2, clava about 4x as long as F2
and 2X as long as wide; only Fl and clava
with multiporous plate sensillae; hypo-
pygium reaching nearly to end of meta-
soma.

Types. — Two specimens (QM register
no. Hy-1849) of this species are point
mounted on a single pin. Girault noted
that the species was described from two
females, but did not designate a holotype.
We hereby designate as lectotype the spec-
imen nearest the point of the card mount
and the other specimen as paralectotype.
The lectotype is partially submerged in
glue, but not as completely as the paralec-
totype. The heads of both specimens have
been slide mounted, and there is no way
of associating any one head with one of
the point mounted bodies although it
seems that both specimens do belong to
the same species. Deposited in QM.

Epichrysocharis burwelli Schauff, new
species

(Figs. 1-4)
Diagnosis. — Body brown, with face ver-
tex, upper margin of eyes, and scrobes yel-

180

Journal of Hymenoptera Research

low; Fl with longitudinal sensillum (Fig.
1); ovipositor about 1/2 length of meta-
soma, with hypopygium reaching half the
length; forewing fringe about 1/4 wing
width. The distinctly brown and yellow
head with a uniformly brown mesosoma
and metasoma and relatively short ovi-
positor set this species apart from the oth-
ers in the genus. In addition, E. nigriventris
has the hypopygium reaching almost to
the end of the metasoma and £. aligherini
has a longer ovipositor which is slightly
exserted past the tip of the metasoma.

Description. — Female. Length 0.5-
0.6mm. Color. Brown or light brown ex-
cept following yellow: a small strip below
each torulus, scrobes, vertex, dorsal occi-
put, a small thin stripe bordering the eye
from about the line of the toruli up and
around the back of the eye for about half
its length, antennae, and apices of tibiae
and usually first three tarsomeres.

Head: Face alutaceous to strigose, scobal
basin nearly smooth, vertex and occiput
rugose to finely alutaceous. Posterior ocel-
li widely separated, anterior ocellus only
about 1 diameter in front of posterior ocel-
li and with POL about 5 X OOL. Mandible
with 3 distinct teeth. Toruli inserted even
with bottom of eye. Antenna (Figs. 1, 2)
with scape 3X as long as wide, second
anellus with 2 dorsal setae, Fl slightly lon-
ger than wide (10:12) on ventral surface,
as long as wide on dorsal surface, with
single longitudinal sensillum, F2 2x as
wide as long, loosely appressed to Fl and
partially covered dorsally by Fl, F3 1.5X
as wide as long, clava 2X as long as wide
with several longitudinal sensillae some of
which extend past tip of clava.

Mesosoma: Pronotum reduced, not visi-
ble medially from above. Mesoscutum,
scutellum, dorsellum, and lateral propo-
deum finely alutaceous or coriaceous (Fig.
3). Mesoscutal midlobe with 2 or 3 minute,
inconspicuous setae at notaular margin.
Dorsellum lightly alutaceous. Propodeum
smooth to very lightly alutaceous laterally
Fig. 4), with two minute setae laterad of

spiracle. Forewing 2x as long as wide,
with longest marginal fringe seta 1/4
width of wing. Ratio of costal cell : paras-
tigma : submarginal vein : marginal vein :
stigmal vein 20:15:25:28:15.

Metasoma: Slightly shorter than meso-
soma, ovate and slightly longer than wide,
rounded posteriorly. First tergum nearly
smooth medially, rest of mesosoma uni-
formly, densely rugose reticulate. Ovipos-
itor about 1/2 length of metasoma. Hy-
popygium reaching about 1/2 length of
metasoma.

Male. — Similar to female.

Types. — Holotype female on slide with
data: California, Los Angeles Co., Monte-
rey Park, Wilcox & 60 Fwy (s. side), 11
May, 1999. Reared Eucalyptus citriodora.
Coll. D. Humphreys and M. Suim. Depos-
ited in USNM. 52 female and 1 male par-
atypes with same data. Paratypes depos-
ited in BMNH, BM, CNC, QM.

Etymology. — The species epithet honors
Dr. C. Burwell, Queensland Museum
without whose help this study could not
have been completed.

ACKNOWLEDGMENTS

We are grateful to John Sorenson, California De-
partment of Agriculture for sending the initial lot of
specimens that led to this study. Chris Burwell,
Queensland Museum, Brisbane, Australia for the loan
of types and specimens. John LaSalle, CABI Biosci-
ence, UK, F. C. Thompson, and D. R. Smith, System-
atic Entomology Lab, USDA made valuable com-
ments on the draft manuscript. Tami Carlow and Nit
Malikul, Systematic Entomology Lab, ARS, USDA
provided technical support.

LITERATURE CITED

Boucek, Z. 1988. Australasian Chalcidoidea (Hymenop
tera): A biosystematic revision of genera of fourteen
families, with a reclassification of speeies. CAB In-
ternational. Wallingford, UK. 832pp.

Gibson, G. A. P. 1997. Chapter 2, Morphology and
terminology, pp. 16—44. In. Gibson, G. A. P. et
al., eds. Annotated keys to the genera of North Amer-
ican Chalcidoidea (Hymenoptera). NRC Research
Press, Ottawa.

Girault, A. A. 1913a. Australian Hymenoptera: Chal-
cidoidea. IV. The family Eulophidae with do-

Volume 9, Number 1, 2000 181

scriptions of new genera and species. Memoirs of phidae), with a revision of certain genera. Bulle-
tin' Queenland Museum 2: 140-296. tin of the British Museum (Natural History). Into

Girault, A. A. 1913b. A few new chalcidoid Hyme- mology Series 55: 1-392.

noptera from Queensland, Australia. Bulletin of Headrick, D. H., J. LaSalle, and R. A. Redak. 1995. A

the Wisconsin Natural History Society 11: 35-48. new genus of Australian Tetrastichinae (Hyme-

Girault, A. A. 1922. New chalcid flies from eastern noptera: Eulophidae): an introduced pest of G?-

Australia — II. (Hymenoptera: Chalcididae). Inse- melaucium unciatum (Mytaceae) in California.

cutor Inscitiae Menstruus 10: 100-108. Journal of Natural History 29: 1029-1036.

Graham, M. W. R. de v. 1987. A reclassification of the LaSalle, J. 1994. North American genera of Tetrasti-

European Tetrastichinae (Hymenoptera: Eulo- chinae. journal of Natural History 28: 109-236.

J. HYM. RES.

Vol. 9(1), 2000, pp. 182-208

A Revision of the Panurgine Bee Genus Arhysosage
(Hymenoptera: Andrenidae)

Michael S. Engel

Division of Invertebrate Zoology, American Museum of Natural History,
Central Park West at 79th Street, New York, New York 10024-5192, USA

Abstract. — The South American bee genus Arhysosage Brethes (Panurginae: Calliopsini) is re-
vised. In addition to the previously recognized Arhysosage flava Moure, A. cactorum Moure, A.
ochracea (Friese), and A. bifasciata (Friese) (new combination), two new species are described: A.
atrolnnata Engel and A. zamicra Engel. Arhysosage germana Moure is newly synonymized with
A. ochracea and A. melanothricha Moure is synonymized with A. cactorum, while A. bifasciata is
resurrected from synonymy under A. ochracea with Camptopoeum opuntiarum Torgensen as a junior
subjective synonym (new synonymies). The genus is newly diagnosed and a key to the currently
recognized species is presented. The name appearing in the literature as A. xanihina is a nomen
nudum. The phylogenetic position of the genus among other calliopsine bees is briefly summarized
as are relationships among the species. A cladistic analysis of Arhysosage produces a single tree
with the following hierarchy: A. cactorum (A. flava, A. zamicra (A. ochracea (A. atrolunata, A. bifas-
ciata))). Biological information on Arhysosage is summarized. The genus is presently known from
Argentina, southern Brazil, Bolivia, and Paraguay and is apparently a specialist on Cactaceae
(presently recorded from Echinocactus, Echinopsis, Gymnocalycium, Notocactus, Opuntia, and Tricho-
cereus).

Bees of the genus Arliysosage Brethes
(1922) are among the most distinctive of
the South American panurgines, being
characterized by the fairly robust size of
most individuals, large heads of males,
and mostly yellow body coloration (Fig.
1). Individuals can be readily captured at
flowers of various cactus genera (e.g.,
Gymnocalycium, Notocactus, Opuntia, &c.)
upon which they are presumably oligolec-
tic (Schlindwein 1992, Schlindwein and
Wittmann 1995). Outside of their affinity
for cactus flowers, however, the biology of
Arhysosage species has not been the focus
of any published study, although Schlind-
wein and Wittmann (1995) give a few de-
tails of mating behavior in Arhysosage.
Their observations indicate that mating is
initiated at cactus flowers. Males search
flowers for females, sometimes staying
motionless in inflorescences for up to sev-
en minutes. Once a female appears, the

male grabs her waist with his long man-
dibles and initiates copulation. The couple
frequently continues mating during flight
and may visit several flowers throughout
the encounter, with the female continuing
to forage the whole time. Such mating be-
havior is reminiscent in some respects to
that described for Perdita (Macrotera) tex-
ana (Cresson 1878). Like Arhysosage, this
group is oligolectic on Cactaceae (Snelling
and Danforth 1992, Neff and Danforth
1992) and also demonstrates a dramatic
head-size polymorphism in males that,
among other uses, allows males to grasp
females during copulation (Danforth and
Neff 1992). Future field work on Arhyso-
sage species should explore possible etho-
logical-morphological associations in
males as has been done for Perdita.

The genus was established by Brethes
(1922) for an enigmatic bee species in
northern Argentina, but its systematic po-

Volume 9, Number 1, 2000

183

Fig. 1. Dorsal habitus of male Arhysosage ochracea (Friese).

sitiori in the Panurginae remained unrec-
ognized until the late 1950s when Moure
and Michener were able to examine the
type series (Moure 1958). Brethes was un-
aware that Friese (1908) had already de-
scribed the species in Camptopoeum Spi-
nola (1843). Cockerell in 1940 described
the species for a third time. Timberlake
(1952a) was the first to place the genus in
the Calliopsini but under the name Riti-
ziella as he was unaware of, or not able to
interpret, Brethes' work. Moure (1958) cor-
rectly established the name of the genus,
described two new species, and briefly
discussed its placement in the Panurginae,
although he disagreed with Timberlake's
assignment of the genus to Calliopsini.
Following a phylogenetic study of the

Panurginae based on the external mor-
phology of adults, Ruz (1986, 1991) placed
Arfn/sosage in the tribe Calliopsini together
with four other genera. Arln/sosage was
placed as the sister to a clade consisting of
Callonychium Brethes (1922) and Spinoliella
Ashmead (1899) (Fig. 2). The three genera
were grouped on the shared presence of
yellow metasomal markings, the weak or
absent transverse ridge on the male la-
brum, absence of an inflection at the fe-
male labral apex, position of the male an-
tenna] sockets on the lower third or fourth
of the face, broken pattern of keirotrichia
on the inner surface of the female metati-
bia, and absence of a volsella. Arhysosage
was excluded from the Callonychium +
Spinoliella clade by the primitive presence

184

Journal of Hymenoftera Research

■PERDITINI

i — PROTOMELITURGINI

Acamptopoeum
Calliopsis

I — Arhysosage

Spinoliella
Callonychium

Fig. 2. Phylogeny of tribe Calliopsini (after Ruz
1991) indicating the position of Arhysosage and relat-
ed genera. Perditini and Protomeliturgini are out-
group tribes.

of a slightly convex lower paraocular area,
presence of keirotrichia on most of the in-
ner surface of the male metatibia, pattern-
ing of the keirotrichia on the inner surface
of the female metatibia, composition of the
metatibial scopa of only moderately abun-
dant hairs, absence of a lateral ridge on
the female S6, gonostylus being one-half
to one-third the length of the gonocoxa,
and absence of internal sclerotization in
the aedeagus. While Arhysosage is known
only in Argentina, southern-most Brazil,
Paraguay, and southeastern Bolivia, both
Callonychium and Spinoliella are somewhat
more widely distributed. Callonychium oc-
curs in Argentina, Brazil, Chile, Paraguay,
and Peru (Ruz 1991, Toro and Herrera
1980) while Spinoliella is distributed in
Chile (Ruz 1991, Toro 1995, Toro and Ruz
1972), Argentina, and Peru (Engel unpubl.
data). Given the present collection locali-
ties for Arhysosage it seems likely that the
genus will someday be discovered in Uru-
guay.

Herein I present a revision of Arhysosage
including a generic description modified
from that provided by Ruz (1991), incor-
porating the changes that result from ad-
dition of new species to the genus. A key
to calliopsine genera distinguishing Arhy-
sosage has been presented by Ruz (1991)
and Michener (in press).

MATERIALS AND METHODS

Morphological terminology generally
follows Michener (1944) with additions for
mandibular structure provided by Miche-
ner and Fraser (1978); also, I use anal vein
in place of vannal. The abbreviations F, S,
and T are employed for flagellomere, me-
tasomal sternum, and metasomal tergum,
respectively. The most common species,
A. ochracea, is described in detail and all
other descriptions are referenced to this
one so as to avoid repetition.

A total of 479 specimens (215 9 9, 264
6 8 ) were examined during the course of
this study. Specimens were provided by
the following institutions: AMNH, Amer-
ican Museum of Natural History, New
York, New York, J. G. Rozen, Jr., and M.
G. Rightmyer; BMNH, The Natural His-
tory Museum (British Museum), London,
United Kingdom, G. Else and C. Taylor;
CAS, California Academy of Sciences, San
Francisco, California, W. J. Pulawski and
R. L. Zuparko; CTMI, Central Texas Mel-
ittological Institute, Austin, Texas, J. L.
Neff; CUIC, Cornell University Insect Col-
lection, Ithaca, New York, J. K. Liebherr
and E. R. Hoebeke; LACM, Natural His-
tory Museum of Los Angeles County, Los
Angeles, California, R. R. Snelling;
MACN, Museo Argentino de Ciencias Na-
turales, Buenos Aires, Argentina, A. Roig-
Alsina; MLPA, Museo de La Plata, Univ-
ersidad Nacional de La Plata, La Plata, Ar-
gentina, J. A. Schnack; NHRS, Naturhis-
toriska Riksmuseet, Stockholm, Sweden,
T. Pape; PCIA, Personal Collection of Isa-
bel Alves dos Santos, Sao Paulo, Brazil;
SEMC, Snow Entomological Collection,
Natural History Museum, University of
Kansas, Lawrence, Kansas, R. W. Brooks
and C. D. Michener; USNM, United States
National Museum of Natural History,
Smithsonian Institution, Washington,
D.C., R. J. McGinley, M. Mello, and D. G.
Furth; ZMHB, Zoologisches Museum an
der Humboldt-Universitat, Berlin, Ger-
many, F. Koch.

Volume 9, Number 1, 2000

185

Table 1. Character matrix and character descrip-
tions used in cladistic analysis of the internal phytog-
eny of Arhysosage. Callonychium and Spinoliella are
used as outgroups. Refer to Material and Methods for
details of analysis. 1. Inner hind tibial spur: (0)
straight (1) curved. 2. Compound eyes below: (0)
parallel, (1) diverging. 3. Metasoma: (0) much broader
than head, (1) as broad as head. 4. Male clypeal apex:
(0) straight between lateral corners, (1) gently convex
between lateral corners. 5. Male pygidial plate emar-
gination: (0) absent, (1) present. 6. Male 57 lateral pro-
cesses: (0) broad, expanded towards base, (1) narrow,
not expanding towards base. 7. Aedeagus: (0) shorter
than penis valves, (1) as long as or longer than penis
valves.

Taxa

Character

A. atrolunata
A. bifasciata
A. flava
A. ochracea
A. cactorum
A. zamicra
Spinoliella
Calloin/chnun

1234567
1111111
1111111
1110101
1111101
1110000
1110101
0000000
0000710

A cladistic analysis of Arhysosage spe-
cies was undertaken. Species of Callony-
chium and Spinoliella were used as out-
groups. Seven characters were identified
and coded for the taxa employed. The sin-
gle interrogative mark presented in the
data matrix (Table 1) is a polymorphism
for this character in Callonychium and not
missing information. Character descrip-
tions are given with the data matrix (Table
1 ). The data matrix was constructed in
DADA (Nixon 1995) and analyzed using
the ie* command in HENNIG86 (Farris
1988). Trees were visualized and printed
using CLADOS (Nixon 1993).

SYSTEMATICS
Genus Arhysosage Brethes

Arhysosage Brethes 1922: 121. Type species: Ar-
hysosage johnsoni Brethes 1922 (= Campto-
poeum ochraceum Friese 1908), monobasic.
Ruz 1991: 238.

Ruiziella Timberlake 1952a: 105. Type species:
Camptopoeum ochraceum Friese 1908, original
designation. Preoccupied ()iec Cortes 1951).

Ruziapis Timberlake 1952b: 528. Type species:
Camptopoeum ochraceum Friese 1908, autobas-
ic. Replacement name for Ruiziella Timber-
lake 1952a (nee Cortes 1951) and lapsus calami
for Ruizapis Timberlake 1953 (justified emen-
dation).

Ruizapis Timberlake 1953: 598. Type species:
Camptopoeum ochraceum Friese 1908, autobas-
ic. Justified emendation of Ruziapis Timber-
lake 1952b (lapsus calami).

Diagnosis. — Arhysosage differs from oth-
er South American panurgines by the ven-
tral divergence of the compound eyes
(Figs. 10, 12, 14-15, 18, 20, 22, 24), the
broad heads (same figures as just men-
tioned), the curved inner metatibial spur
(Fig. 6), and the mostly yellow body col-
oration (e.g., Fig. 1).

Description. — Head broader than long in
frontal view, broader than thorax (Fig. 1).
Glossa longer than prementum, slender;
paraglossa shorter than suspensorium;
first segment of labial palp less than twice
as long as combined lengths of segments
2-4. Maxillary blade longer than prepalpal
part of galea; galeal comb absent. Labrum
less than twice as broad as long, partially
or entirely setose. Apical margin of clyp-
eus with variably developed projection
just outside lateral labral margin. Episto-
mal sulcus forming an obtuse angle (Figs.
9-10). Inner subantennal suture angulate
(Figs. 9-10); subantennal area wider than
length of inner suture and than antennal
socket; anterior tentorial pit near middle
of outer subantennal suture (Fig. 16). An-
tennal socket far below middle of face
(Fig. 15). Lower median paraocular area
slightly convex. Facial fovea strongly im-
pressed, narrow (Fig. 10). Median ocellus
set below upper tangent of compound
eyes. Vertex convex. Mesepisternum with
flattened anterior-facing surface reduced;
preepisternal groove distinguishable only
above scrobal level, continued downward
as black line (difficult to see on dark in-
tegument). Forewing with cu-a as long as
or longer than second abscissa of M + Cu;
lm-cu well distad lr-m; 2m-cu basad 2r-

186

Journal of Hymenoptera Research

m; pterostigma longer than and slightly
wider than prestigma, border within mar-
ginal cell straight; apex of marginal cell
obliquely and broadly truncate, longer
than distance from apex to wing tip; first
submarginal cell as long as or longer than
second submarginal cell (Fig. 1). Hind
wing with cu-a slightly less than one-half
to one-third as long as second abscissa M
+ Cu; 10 distal hamuli arranged in a sin-
gle series. Protarsomeres 2-A unmodified;
malus of antenna cleaner pectinate. Me-
sotibial spur half as long as or longer than
mesobasitarsus, apex distinctly curved,
finely serrate. Mesobasitarsus about as
long as probasitarsus and shorter than
metabasitarsus, tarsomeres 2-A unmodi-
fied. Metatibial spurs curved at apices,
outer spur as long as or longer than inner
spur; teeth small. Metatarsus unmodified.
Claws deeply cleft. Basal area of propo-
deum slightly longer than metanotum,
with exceedingly fine striae along apical
margin, depressed medially. Metasoma
with yellow bands very extensive to in-
complete or absent; terga without setal
bands; lateral fovea of T2 slightly de-
pressed. Pubescence generally short and
sparse; appressed hairs on most of dor-
sum of mesosoma and metasoma. Punc-
tures generally very fine and dense, nearly
contiguous on mesoscutum. Male: Most of
head and thorax yellow (Figs. 1, 10, 12, 14,
18, 22, 24). Labrum flat, with slight trans-
verse ridge. Mandible arcuate, longer than
compound eye (except in A. zamicra), up-
per margin with prebasal projection (Fig.
18: arrow) and subapical tooth (Fig. 10).
Length of clypeus more than four times
width, gently protuberant. Flagellum un-
modified, much shorter than head; Fl as
long as or slightly longer than F2, about
as long as broad. Inner orbits of com-
pound eyes markedly divergent below.
Pronotum with dorsal preapical ridge
rounded, strong. Length of probasitarsus
five times width. Metatibia with keirotri-
chia on most of inner surface but sparser
ventrally. Basitibial plate with borders

well-defined. Rami of claws subequal in
length. Metasoma wider than thorax (Fig.
1); T2-5 with gradulus posterolaterally
long (surpassing middle of each tergum),
carinate, and with postgradular depres-
sion narrow, shallow; posterior marginal
areas of Tl-5 minutely setose; pygidial
plate well developed, abruptly elevated
and carinate laterally towards apex; hem-
itergum hexagonal; S4-5 with apical mar-
gins slightly and broadly concave medi-
ally; S6 distally bilobed, with small me-
dian V-shaped emargination; S7 with two
short, finger-like apicolateral projections,
proximal arms long and forming a U
(Figs. 26-31); S8 with long, clavate apico-
median projection, abruptly separated
from basal part which has weak median
ridge dorsally (Figs. 32-37). Gonocoxal
apodeme not inflexed; gonocoxa short,
squared, completely fused both dorsally
and ventrally; gonostylus short, finger-
like, fused to gonocoxa; volsella apparent-
ly absent or indistinguishably fused to
gonocoxa; penis valve long, tapered to-
ward apex, dorsally fused together by
small, narrow bridge; aedeagus proximal-
ly wider and fused to valve, distal half
well sclerotized ventrally (Figs. 38-45). Fe-
male: Yellow areas of head variable in
size. Labrum nearly flat. Length of clypeus
three times width, distinctly protuberant.
Inner orbits of compound eyes only slight-
ly divergent below. Pronotum with dorsal
preapical ridge rounded, weak. Length of
probasitarsus four times width. Metatibia
longer than metabasitarsus; inner surface
with keirotrichia in patch at base and
apex, sparse or absent toward dorsal mar-
gin, absent ventrally. Metatibial scopa of
moderately dense and apparently simple,
but minutely branched setae. Inner ramus
of claws shorter than outer. Posterior mar-
ginal areas of Tl-4 minutely setose; T7 not
expanded dorsally but with conspicuous
ventral proximal projection; Sl-5 minutely
setose, as in male, but setae somewhat
longer and denser; S6 with basal spine-
like sclerotization, lateral margin with

Volume 9, Number 1, 2000

187

\Spinoliella
Callonychium
cactorum

zamicra
ochracea
m—m atrolunata
bifasciata

Fig. 3. Phytogeny of Arhysosage species (Length 8, C.I. 87, R.I. 90). Callonychium and Spinoliella are outgroup
genera. Black bars indicate unreversed forward transitions while white bars indicate homoplastic character^

strong curved ridge, apical margin con-
cave medially, apically with a well-de-
fined, curved and dense band of curved
setae. Sting short, not reaching stylus
apex.

Biological notes. — Species of Arhysosage
are oligolectic on Cactaceae. The long,
curved mandibles of males seem to be a
modification for grasping the female dur-
ing mating, while the mostly yellow body
coloration appears to be an adaptation for
minimizing visibility in flowers, which are
generally yellow or off-white. Immature
stages of A. flava have been discovered by
Jerome G. Rozen, Jr. (AMNH) and will be
treated in a forthcoming paper concerning
the immature stages of Calliopsini (Rozen
and Engel in prep.).

Phytogeny. — The result of a cladistic
analysis for Arhysosage (see Material and
Methods) is presented in figure 3. A single
tree resulted from analysis of the data ma-
trix (Table 1); the topology had a length of
8, a C.I. of 87, and an R.I. of 90. This anal-
ysis places A. cactorum as the sister to the
remainder of Arhysosage. Two species, A.
flava and A. zamicra, were unresolved in a
polytomy (Fig. 3). These species are ex-
ceedingly similar with A. zamicra possess-

ing a number of autapomorphic features
which allow for its recognition but fail to
confidently group it with any other spe-
cies of Arhysosage [i.e., whether sister to
the remainder of Arhysosage (exclusive of
A. cactorum), to A. flava, or to Arhysosage
exclusive of A. flava and A. cactorum].

Arhysosage ochracea (Friese)

(Figs. 1, 5, 8, 17-21, 26, 32, 38, 49)

Camptopoeum ochraceum Friese 1908: 29. Exam-
ined (ZMHB).

Arhysosage johnsoni Brethes 1922: 122.

Camptopoeum castellam Cockerell 1940: 1. Ex-
amined (AMNH).

Ruiziella ochracea (Friese); Timberlake 1952a:
105.

Ruiziella castellani (Cockerell); Timberlake
1952a: 105.

Arhysosage ochracea (Friese); Moure 1958: 44.

Arhysosage genitalia Moure 1958: 47. New syn-
onymy. Examined (SEMC).

Diagnosis. — The species can be most
readily separated from other Arhysosage
species by the strong banding of the me-
tasoma (Fig. 1).

Description. — Male: Total body length
8.0-12.6 mm; forewing length 5.8-7.2 mm.
Head width 2.3^.0 mm, length 1.6-3.0

188

Journal of Hymenoptera Research

Figs. 4-8. Characteristics of Arhysosage. 4, Pygidial plate of male 17 of Arhysosage cactorum Moure. 5, Pygidial
plate of male 17 of A. ochracea (Friese). 6, Inner hind tibial spur of A. cactorum. 7, Basitibial plate of A. cactorum.
8, Basitibial plate of A. ochracea.

mm. Mandible longer than compound
eye; inner tooth well-defined, not partic-
ularly strong, somewhat rounded (Figs.
18, 20). Upper interorbital distance 1.3-2.3
mm, lower interorbital distance 1.5-3.1
mm. Intertegular distance 1.4-2.5 mm.
Basitibial plate apex broadly rounded (Fig.
8). Apex of pygidial plate slightly emar-
ginate (Fig. 5). Apex of penis valve bend-
ing ventrally (Figs. 45-49); aedeagus
reaching, or very near to, apex of penis
valve (Figs. 38^42, 45-49); terminalia oth-
erwise as depicted in figures 26, 32, 38,
and 49.

Mandible mostly smooth with a few
faint punctures on dorsal surface running
from base in a narrow band to point of
inner tooth; a few faint punctures in outer
interspace, disappearing by point where

outer ridge and condylar ridge meet; ven-
tral surface with similar punctures as
those of dorsal surface and disappearing
by about the same point. Clypeus with
faint, coarse punctures scattered over sur-
face, integument otherwise smooth. Su-
bantennal areas smooth and impunctate.
Supraclypeal area below antennal sockets
and between inner subantennal sutures as
on clypeus; between antennal sockets
punctures well-defined, smaller, and near-
ly contiguous. Scape punctured as on su-
praclypeal area between antennal sockets.
Face lateral to outer subantennal sutures
and below level of antennal sockets as on
clypeus; at level of antennal sockets punc-
tures become smaller, well-defined, and
gradually more closely spaced until nearly
contiguous by level just above antennal

Volume 9, Number 1, 2000

189

sockets; remainder of face and vertex with
such fine, well-defined punctures, nearly
contiguous. Gena as on vertex except
punctures becoming faint on lower half
and separated by 1-2 times puncture
width, integument otherwise smooth,
punctures also become fainter posteriorly
near preoccipital area. Postgena impunc-
tate and smooth. Pronotum with minute,
well-defined punctures on dorsal surface
along border with mesoscutum, medially
and anteriorly on collar integument im-
punctate and imbricate; lateral surfaces
smooth and impunctate except on prono-
tal lobe which has a few minute punc-
tures. Mesoscutum and scutellum with
small, well-defined, nearly contiguous
punctures. Tegula similar to mesoscutum
except punctures quite faint. Metanotum
with scattered faint, coarse, punctures, in-
tegument between faintly imbricate. Pree-
pisternal area as on mesoscutum except
punctures becoming exceedingly faint and
more widely spaced ventrally; mesepister-
num with faint, coarse punctures separat-
ed by less than puncture width, integu-
ment between smooth, punctures becom-
ing more widely spaced along posterior
border and fainter ventrally; metepister-
num with faint, minute punctures sepa-
rated by width or less, integument be-
tween smooth. Basitibial plate with mi-
nute punctures separated by less than a
puncture width. Propodeal lateral surface
with minute, well-defined punctures sep-
arated by 1-3 times puncture width, integ-
ument between smooth; posterior surface
with minute punctures separated by
width or less, integument imbricate. An-
terior surface of Tl faintly imbricate, re-
mainder of surface minutely punctured,
punctures nearly contiguous except apical
margin imbricate and impunctate; T2-6
minutely punctured, punctures nearly
contiguous except apical margins imbri-
cate and impunctate; T7 imbricate; sterna
imbricate with scattered, faint punctures.
Head mostly yellow except facial fo-
veae black and two spots on clypeus dark

brown to black. Inner tooth, subapical
tooth, and mandibular apex reddish
brown to black. Proboscis light brown;
hypostomal fossa as well as bordering ar-
eas of postgena and preoccipital area
dark brown to black. Labrum yellow. Fla-
gellum light brown. Pronotum yellow.
Mesoscutum, tegula, scutellum, and me-
tanotum yellow. Preepisternum, mesepis-
ternum, and metepisternum yellow ex-
cept on ventral-facing surface dark brown
to black; propleuron dark brown to black
except posterolateral corner yellow. Inner
halves of procoxa dark brown to black,
remainder yellow; protrochanter yellow
except ventral border brown; profemur
yellow with brown spot on inner and
ventral surface at base; remainder of fore-
leg yellow; inner halves of mesocoxa dark
brown to black; ventral and inner borders
of mesotrochanter and mesofemur
brown; ventral border of mesotibia light
brown; remainder of midleg yellow; me-
tacoxa and metatrochanter mostly dark
brown or black except yellow on dorsal
borders; metafemur with inner and outer
borders brown, remainder yellow; inner
border of metatibia and metabasitarsus
light brown, remainder yellow; claws
reddish brown at apices; mesotibial spine
and metatibial spurs amber. Wing mem-
brane hyaline; veins amber to dark
brown. Propodeum yellow except basally
bordering metanotum dark brown to
black with mediolongitudinal, narrow
line of black running from the basal area
onto the posterior surface and ending me-
dially at marginal area of propodeum.
Mediolongitudinal line of Tl anterior sur-
face amber, remainder yellow except api-
cal margin amber; T2-6 yellow except
graduli, areas lateral to graduli, and api-
cal margins amber, although yellow areas
on central disc become gradually and
progressively narrower on T3-6 until
mostly obscured on T6 by overhang of
preceding tergum; 17 amber; sterna am-
ber with dark brown on central discs ex-
cept medial amber interruptions on S3-5.

190 Journal of Hymenoptera Research

Pubescence generally sparse, golden, Face colored as in figures 17 and 19.

moderately long, and simple. Particularly Gena yellow. Proboscis light brown; hy-

dense areas of long setae along apicolater- postomal fossa, postgena, and preoccipital

al margins of clypeus, just above and lat- area dark brown to black. Labrum brown,

eral to antennal sockets, on postgena, and Antenna light brown. Pronotum black ex-

on ventral borders of preoccipital area, cept pronotal lobe and posterior median

Pronotum generally without hairs except border yellow. Mesoscutum black except

at pronotal lobe; metanotum with mat of two longitudinal stripes and border with

shorter, more dense hairs intermixed with tegula yellow. Scutellum yellow except

moderately long, spare hairs. Mesotibia anterior border and median transverse

and tarsus with short, stiff, amber setae band black, small longitudinal median

along outer borders; metafemur with sim- black band connecting these two black ar-

ilar setae on outer apex; metatibia and tar- eas; axilla black. Tegula and metanotum

sus with longer, stiff, amber setae on outer yellow. Pleura black except metepister-

surfaces. Terga with sparse hairs except num yellow. Propodeum as in male except

lateral to pygidial plate where they are lateral surface bordering metepisternum

long, dense, frequently branched, and am- dark brown to black.

ber to fuscous; sterna similar except patch- Pubescence generally sparse, golden,

es of long, amber to fuscous hairs on ei- moderately long, and simple. Particularly

ther side of apical cleft of S6. dense areas of long setae along apicolater-

Female: As described for the male ex- al margins of clypeus, just above and lat-
cept as follows: Total body length 7.0-10.9 eral to antennal sockets, on postgena, and
mm; forewing length 3.9-6.3 mm. Head at base of stipes. Terga with sparse hairs
width 1.9-2.9 mm, length 1.5-2.5 mm. Up- except apex of T5 and lateral to pygidial
per interorbital distance 1.2-1.9 mm, low- plate with long, dense, frequently
er interorbital distance 1.3-2.2 mm. Inter- branched, amber hairs; sterna similar ex-
tegular distance 1.3-2.0 mm. Pygidial cept borders of long, amber hairs on apical
plate in profile straight or gently curved sterna.

ventrally towards apex; dorsally gently ta- Variation.— Areas described in the male

pering to narrowly rounded apex. as dark brown to black can vary to light

Clypeus with faint, coarse punctures brown or even yellow (except facial foveae

scattered over surface, most faint central- and clypeal spots). Similarly the areas de-

ly, integument otherwise smooth. Supra- scribed as black in the female can some-

clypeal area as on clypeus. Scape punc- times be lighter and appear as dark

tured as on upper half of face. Face out- brown. The relative widths of the yellow

side of outer subantennal sutures and be- areas on tne terga can vary dramatically

low level of antennal sockets as on clypeus as well Tnere is, however, always some

although punctures slightly smaller and yellow banding present on Tl-3. In fe-

more faint; at level of antennal sockets maleS/ color variation is more dramatic as

punctures becoming smaller, well-defined, is demonstrated by the facial patterns de-

and gradually more closely spaced until picted in figures 17 and 19 and by the fact

separated by puncture width or less by that the amber bands of the metasoma can

level just above antennal sockets; remain- be quite broad and variable from light

der of face and vertex with such fine, well- reddish brown to nearly black,

defined punctures. Gena with scattered Holotype.— ARGENTINA: Mendoza: 9,

faint punctures, integument otherwise 24 November 1906, Jensen (ZMHB).

smooth, punctures become exceedingly Additional material— ARGENTINA: Catamarca:

faint near preoccipital area and postgena. joyango-Colpes Site, int. Biol. Program, 24 October 197?,

Tegula imbricate. J. L. NTeff, on Opuntia sulphurea (l 9 Id CAS). Andalgala,

Volume 9, Number 1, 2000

191

IBP Program, Desert Scrub Site, ]. L. Neff, on Opimtia
sulphured, various dates: 20, 24, 31 October 1972, 27, 31
January 1973 (49 936 6CAS). Andalgala Desert Site,
IBP, J. L. Neff (193<JCUIC). El Pucara, IBP Program,
Research Site, J. L. Neff (16CUIC). Londres, 16 Novem-
ber 1973, J. L. Neff (1 9CUIC). Santa Maria, 18 January
1973, J. L. Neff (16CUIC). Andalgala Desert site, 2 No-
vember 1973, J. L. Neff, on Opimtia sulphured
(1926 6CTMI). Santa Maria, II km S. Punta |de] Bal-
asto, 15 January 1986, J. L. Neff, on Gymnocalycium sp.
(26 6CTMI). Andalgala Desert site, 10 December 1973,
J. L. Neff, on Opimtia glomerata (19CTMI). Andalgala
IBP Program, Desert scrub site, 31 January 1973, J. L.
Neff, on Trichocereus terscheckii (16CTMI). Andalgala
IBP Program, Desert scrub site, 31 January 1973, J. L.
Neff, on Echinopsis leucantha (19CTMI). Cuesta Minos
Copillita, 21 December 1973, J. L. Neff, on Opimtia sul-
phured (1 iCTMI). Andalgala Desert site, IBP, J. L. Neff,
on Opimtia sulphured, various dates: 20, 28, 31 October,
1, 6-7, 10, 12, 21, 24 November 1972 (109 996 6LACM).
Andalgala Int. Biol. Prog., 4 November 1972, J. L. Neff,
on Senecio flagtllisectis (26 6 AMNH). El Desmonte, 25
November 1993, J. G. Rozen (16 AMNH). Joyango-Col-
pes site, IBP, 2 December 1972, J. L.Neff, on Opuntia
sulphured (16 AMNH). Andalgala, IBP, 11 December
1972, J. L. Neff, on Trichocereus terscheckii (16 AMNH).
El Desmonte, 23-24 November 1989, J. G. Rozen and A.
Roig-Alsina (46 6 AMNH). San Fernando, 3-6 Novem-
ber 1989, J. G. Rozen and A. Roig-Alsina (16 AMNH).
El Desmonte, 1 December 1989, J. G. Rozen and A. Roig-
Alsina, on Opimtia sp. (16 AMNH). Rio del Valle, 580
m, 5 November 1951, F. Plaumann (1 91cTAMNH). An-
dalgala, IBP, Desert scrub site, J. L. Neff (29 9 AMNH).
Andalgala Desert site, 24 November 1972, J. L. Neff, on
Opimtia sulphured (1 9 AMNH). Andalgala Desert site, 20
December 1972, J. L. Neff, on Opimtia quimilo
(1 9 AMNH). Andalgala, 28 November 1971, D. J. Broth-
ers (139 986 6SEMC). Andalgala, IBP Program, Desert
scrub site, 31 January 1973, J. L. Neff, on Opimtia sul-
phured (26 6SEMC). Rio del Valle, 580 m, 3 November
1951, F. Plaumann (149 936 6SEMC). November 1951,
Foester [sic?: J. Foerster?] (39 926 6SEMC). Recreo, De-
cember 1951, F. H. Walz (209 916SEMC, 36 6 USNM,
29 9BMNH, 29 9 AMNH). El Pucara, IBP Program re-
search site, 1 January 1974, J. L. Neff, on Opimtia sul-
phured (29 916SEMC). Londres, 10 November 1973, J.
L. Neff (19SEMC). Londres, 15 November 1998; Rozen,
Ugarte, Navarrete (49 986 6 AMNH). Cordoba: Jesus
Maria, 3 December 1973, J. L. Neff, on Opimtia sulphured
(16CTMI). Cordoba-San Luis border January 1939, A.
Castellanos (16 AMNH: holotype of C. Cdstellani;
19USNM: paratype of C. castellani). La Rioja: Iliar., Feb-
ruary 1934, M. Gomez (29 9SEMC, 19CUIC). San Bias
to Chilecito, 30 November 1983, L. E. Peha (Id AMNH).
14 km W Schaqui, 26 November 1989, J. G. Rozen and
A. Roig-Alsina, on Opimtia sp. (29 966* 6" AMNH). 14
km VV Schaqui, 29 November 1989, J. G. Rozen and A.
Roig-Alsina, on white Opimtia sp. (39 916* AMNH).

Same data as previous except on yellow Opimtia sp.
(39 9 AMNH). Dique, Los Sauces, December 1951, F. H.
Walz (16SEMC). Mendoza: 28 November 1906
(19USNM, 19NHRS). 15 November 1906 (16NHRS).
10 November 1906, H. V. Jensen (1 6ZMHB). 24 No\ em-
ber 1906 (16ZMHB). Dto. Lujan, Cerro Cacheuta, De-
cember 1972, A. Roig-Alsina (16MACN). 21 November
1906, Jensen (19 CAS). P. Herbst collection, ex. Reed
(16* CAS). 15 km W. Mendoza, 1000 m, 7-8 December
1979, C and M. Vardy, B.M. 1980-67 on Trichocereus
candicans or Opimtia sulphured (59 936 6BMNH). 21
November 1906 (19 AMNH). Tucuman, 2000 m
(16 AMNH). Salta: 4 km NE Alemania, 13 November
1993, J. G. and B. L. Rozen, on Opimtia sp.
(26 6 AMNH). Cruz Quemada, 31 km S General Gue-
mes, 10 November 1989, J. G Rozen and A. Roig-Alsina,
on Opimtia sp. (29 926 6AMNH). Payogasta, January
1991, M. Fritz (256 6 AMNH). Santiago del Estero: El
Pinto, November 1956 (19CUIC). Choya, January 1958
(119 9136 6SEMC). Tucuman: Amaicha del Valle, 23
November 1989, J. G. Rozen and A. Roig-Alsina, on
Opimtia sp. (16 AMNH). Amaicha del Valle, 2 Novem-
ber 1989, J. G. Rozen and A. Roig-Alsina (26 6 AMNH).
7-11 km E-SE Amaicha del Valle, 23 November 1993, J.
G. Rozen (16 AMNH).

Floral records. — This species has been
captured at flowers of Echinopsis leucantha,
Gymnocalycium sp., Opuntia glomerata, O.
quimilo, O. sulphured, Trichocereus candi-
cans, T. terscheckii (new records). A single
male of A. ochracea has been captured con-
suming nectar of the composite Senecio fla-
gellisectis.

Phenology. — Arhysosage ochracea has
been captured from late October through
late February.

Comments. — Moure (1958: 45) mentions
that the type of C. castellani is located in
the USNM. Actually, the USNM specimen
is a paratype while the holotype of Cock-
erell's species is housed in the AMNH.
This is the most common species of the
genus and the most variable in size. Small-
er individuals of this species were previ-
ously known under the name A. germana
and before that as Camptopoeum castellani.

An attempt to locate the type of A. john-
soni was unsuccessful. It was at one time
in the collection in Buenos Aires but is
now missing. It was at one time in the
possession of Moure and as it may still be
with him, I have hesitated to designate a

192

Journal of Hymenoptera Research

Figs. 9-10. Arhi/sosage atrolunata n. sp., faces, pubescence omitted. 9, Female. 10, Male, ff = facial fovea.
Stippling indicates black areas, remainder yellow.

neotype. I have followed Moure (1958) in
considering A. johnsoni to be a synonym
of A. ochracea.

Arhysosage atrolunata Engel, new
species

(Figs. 9-10, 29, 35, 41, 45)

Diagnosis. — The males of this species
can be immediately distinguished by the
black, crescent-shaped marking around
the ocelli in males (Fig. 10), the predomi-
nantly black mesoscutum, and nearly uni-
formly colored metasoma, which is amber
to dark brown with yellow spots laterally
on Tl-2. Females of A. atrolunata lack me-
tasomal banding, possess round punc-
tures on the clypeus, and have dense setal
tufts on the apicolateral margins of the
clypeus.

Description. — As for A. ochracea (see be-
low) with the following modifications:
Male: Total body length 9.4-11.4 mm;
forewing length 5.8-6.5 mm. Head width
3.1-3.7 mm, length 2.2-2.6 mm. Mandible
longer than compound eye; inner tooth
well-defined and somewhat rounded (Fig.
10). Upper interorbital distance 1.7-2.1

mm, lower interorbital distance 2.0-2.7
mm. Intertegular distance 2.0-2.6 mm.
Basitibial plate apex broadly rounded.
Terminalia as depicted in figures 29, 35,
41, and 45.

Head mostly yellow except facial foveae
black, two spots on clypeus dark brown to
black, and large crescent-shaped black
pattern connecting dorsal margins of fa-
cial foveae and running across and just
posterior to ocelli (Fig. 10). Pronotum yel-
low except mediotransverse band of dark
brown to black running onto lateral sur-
face and lower lateral border. Mesoscu-
tum yellow with three longitudinal stripes
of black, stripes very broad so that yellow
areas quite narrow. Scutellum yellow ex-
cept lateral three-quarters of axilla dark
brown to black. Metanotum yellow. Pleu-
ra dark brown to black except hypoepi-
meral area, metepisternum, and upper
corner of preepisternal area yellow. Pro-
coxa and protrochanter dark brown to
black; profemur dark brown to black ex-
cept yellow on outer surface and in a lon-
gitudinal band on inner surface; remain-
der of foreleg yellow; mesocoxa and me-

Volume 9, Number 1, 2000

193

sotrochanter dark brown to black; ventral
border of mesotibia dark brown to black;
remainder of midleg yellow; metacoxa
and metatrochanter dark brown to black;
metafemur dark brown to black except
apex yellow; remainder of hind leg amber.
Propodeum yellow except basally border-
ing metanotum black with mediolongitu-
dinal, broad line of black running from the
basal area onto posterior surface and bor-
dering ventral margins of posterior sur-
face. Mediolongitudinal line of Tl anterior
surface amber, remainder amber or light
brown except transverse band of yellow
before apical border, band interrupted
medially by amber coloration; T2 amber
with lateral spots of yellow; remaining ter-
ga brown to black; sterna amber to dark
brown.

Terga with sparse hairs except lateral to
pygidial plate where they are long, dense,
frequently branched, and amber; sterna
similar except patches of long, amber hairs
on either side of apical cleft of S6.

Female: As described for the male except
as indicated: Total body length 9.4 mm;
forewing length 5.7 mm. Head width 3
mm, length 2.2 mm. Upper interorbital dis-
tance 1.6 mm, lower interorbital distance
1.8 mm. Intertegular distance 1.8 mm.

Facial coloration as in figure 9. Probos-
cis light brown; labrum, hypostomal fossa,
postgena, and preoccipital area dark
brown. Antenna brown. Pronotum dark
brown except pronotal lobe, median basal
border, and median apical border yellow.
Mesoscutum black except two narrow lon-
gitudinal stripes on either side of median
line and border with tegula yellow. Scu-
tellum yellow except basal border and
central disc black; axilla black. Metanotum
and tegula yellow. Pleura black except
metepisternum yellow. Legs dark brown
except apices of pro- and mesofemur, en-
tirety of pro- and mesotibiae, and entirety
of pro- and mesotarsi yellow. Metasoma
uniformly amber.

Holotype.— ARGENTINA: Cordoba: 6,
W. M. Davis (LACM). Allotype— ARGEN-

TINA: Cordoba: 9, [W. M.] Davis
(LACM). Paratypes.— ARGENTINA: Cor-
doba: W. M. Davis (Id LACM). Salta: Ro-
sario de Lerma, El Golgota, 2400 m, 21
January 1986, J. L. Neff, on Opuntia sp.
(2c?dAMNH, ldCTMI).

Additional material. — ARGENTINA: Salta: Payogas-
ta, January 1991, M. Fritz (lcJAMNH).

Floral records. — Arhysosage atrolunata has
been captured on flowers of an unidenti-
fied Opuntia.

Etymology. — The specific epithet is de-
rived from the Latin words ater (black)
and lunatus (crescent-shaped) and refers to
the black, crescent moon-shaped marking
on the vertex of males just behind the ocel-
li.

Phenology. — This species has presently
only been captured in January.

Comments. — The crescent shaped pat-
tern on the face of the males can be easily
confused with a similar pattern that oc-
curs in females of A. flava. Males of A. fla-
va, however, have the face completely yel-
low except for the facial foveae, which are
black in all species. Since females of A.
atrolunata lack metasomal banding what-
soever, they therefore superficially resem-
ble females of A. flava. Females of A. atro-
lunata differ from those of A. flava in their
facial pattern, in having round punctures
on the clypeus, and in possessing dense
setal tufts on the apicolateral margins of
the clypeus.

Arhysosage bifasciata (Friese), new
combination

(Figs. 11-12, 30, 36, 42, 47)

Psacin/tlua bifasciata Friese 1908: 41. Examined

(ZMHB).
Camptopoeum bifasciatum (Friese); Jorgensen

1912: 118.
Camptopoeum opuntiarum jorgensen 1912: 118.

Examined (MLPA). New synonymy.
Ruiziella bifasciata (Friese); Timberlake 1952a:

105.

Diagnosis. — Females of A. bifasciata are
distinctive for their dark coloration with
only a few yellow markings; the propo-

194

Journal of Hymenoptera Research

Figs. 11-12. Arhysosage bifasciata (Friese), faces, pubescence omitted. 11, Female. 12, Male. Stippling indicates
black areas, remainder yellow.

deum is entirely black or infrequently
marked by tiny yellow spots on the pos-
terior border of the basal area. Males of A.
bifasciata differ from A. ochracea in the ab-
sence of banding on the metasoma and in
the terminalia.

Description. — As for A. ochracea (see be-
low) with the following modifications:
Male: Total body length 10.5-11.3 mm;
forewing length 6.7-7.0 mm. Head width
3.3-3.7 mm, length 2.4-2.6 mm. Mandible
longer than compound eye; inner tooth
weak (Fig. 12). Upper interorbital distance
1.9-2.2 mm, lower interorbital distance
2.4-2.6 mm. Intertegular distance 2.0-2.2
mm. Basitibial plate apex broadly round-
ed. Terminalia as depicted in figures 30,
36, 42, and 47.

Proboscis light brown; hypostomal fos-
sa as well as bordering areas of postgena
and preoccipital area yellow to amber.
Preepisternum, mesepisternum, and me-
tepisternum yellow or amber; propleuron
amber. Legs amber; claws reddish brown
at apices; mesotibial spine and metatibial
spurs amber. Propodeum yellow except
basally bordering metanotum dark brown
with a mediolongitudinal, narrow line of
brown running from the basal area onto

the posterior surface and ending medially
at marginal area of propodeum. Metaso-
ma uniformly amber.

Female: As described for the male ex-
cept as indicated: Total body length 9.3-
10.9 mm; forewing length 5.2-6.1 mm.
Head width 2.5-3.0 mm, length 2.0-2.6
mm. Upper interorbital distance 1.5-1.9
mm, lower interorbital distance 1.7-2.2
mm. Intertegular distance 1.6-2.0 mm.

Facial color pattern as in figure 11; re-
mainder of head black except gena yellow.
Mesosoma black except yellow on prono-
tal lobe, apicolateral corner of pronotal
dorsal surface, tegula, posterior margin of
scutellum, and pro- and mesofemur-tibia
junctions. Metasoma black except apical
margins of terga dark brown; Tl-2 with
small lateral spots of yellow just inside
graduli; T3 with similar spots but length-
ened transversely; T4-5 with narrow me-
dian bands of yellow.

Pubescence of legs and metasoma fus-
cous.

Holotype.— ARGENTINA: Mendoza: 9,
[no date or collector's name] (ZMHB).

Additional material. — ARGENTINA: Mendo-
za: 24 November L905, Jensen (19ZMHB). Cerrillos
sur C. de la Gloria, December 1976, A. Roig-Alsina

Volume 9, Number 1, 2000

195

Figs. 13-14. Arhysosage flava Moure, faces, pubescence omitted. 13, Female. 14, Male. Stippling indicates black
areas, remainder yellow.

(1916MACN). [no locality information, #5a]
(16MACN). 16 November 1906, P. Jorgensen
(19MLPA: holotype of C. apuntiarum). 15 km W.
Mendoza, 1000 m, 7-8 December 1979, C. and M.
Vardy, B.M. 1980-67, on Trichocereus candicans or
Opuntia sulphured (29 94c? 6BMNH). 1200 m, 3 No-
vember 1908 (1 9 AMNH). 5 km N. San Rafael, 20 No-
vember 1973, J. L. Neff, on Opuntia sulphurea
(19CTMI). Catamarca: El Desmonte, 23-24 Novem-
ber 1989, J. G. Rozen and A. Roig-Alsina, nests 1-3,
5-6 (89 9 AMNH). El Desmonte, 25 November 1993,
J. G. Rozen (19 AMNH). El Desmonte, 1 December
1989, J. G. Rozen and A. Roig-Alsina, on Opuntia sp.
(19 AMNH). El Desmonte, 7 November 1989, J. G.
Rozen and A. Roig-Alsina, nest 1 (1 9 AMNH). Punta
de Balasto, 2 November 1989, J. G. Rozen and A.
Roig-Alsina, on Opuntia sp. (1 9 AMNH). Santa Maria,
18 January 1973, j. L. Neff, on Opuntia sulphurea
(1 9CTMI). Salta: Rosario de Lerma, El Golgota, 2400
m, 21 January 1986, J. L. Neff, on Opuntia sp.
(19CTMI). Payogasta, January 1991, M. Fritz
(139 9 106*6" AMNH). Tastli, 3000 m, January 1991,
M. Fritz (1 9 AMNH). El Allsal, January 1994, M. Fritz
(19 AMNH).

Floral records. — This species has been
captured at flowers of Opuntia sp. and
Echinocactus sp. (Jensen-Haarup 1908: as
Psaenythia bifasciata) as well as Trichocereus
candicans and O. sulphurea (new records).

Phenology. — Arhysosage bifasciata has
been captured from early November
through late January.

Comments. — As mentioned in the diag-
nosis of the species, females of A. bifasciata

are distinctive for their dark coloration.
Most of the body is black with only a few
yellow markings on the face (Fig. 11), me-
sosoma, and metasoma. This characteristic
easily separates females of A. bifasciata
from all other species, only infrequently
being confused with darker females of A.
ochracea. In these later cases, however, fe-
males of A. ochracea are always still much
more yellow and the propodeum in par-
ticular is mostly yellow with black restrict-
ed to the basal margin and in a median
band while in A. bifasciata the propodeum
is entirely black or infrequently marked
by tiny yellow spots on the posterior bor-
der of the basal area.

Arhysosage flava Moure
(Figs. 13-16, 28, 34, 40, 48)

Arhysosage flava Moure 1958: 45. Examined
(SEMC).

Diagnosis. — This species is notable for
the absence of metasomal bands, the elon-
gate punctures of the clypeus (Figs. 15-
16), the absence of dense setae on the lat-
eral borders of the clypeus, and the pat-
terning of black marks on the female face
(Fig. 13).

Description. — As for A. ochracea (see be-
low) with the following modifications:

196

Journal of Hymenoptera Research

Volume 9, Number 1, 2000

197

Male: Total body length 7.8-10.4 mm;
forewing length 4.8-6.6 mm. Head width
2.4-3.7 mm, length 1.6-2.4 mm. Mandible
longer than compound eye; inner tooth
strong, somewhat rounded although fre-
quently pointed (Figs. 14-15). Upper in-
terorbital distance 1.5-2.4 mm, lower in-
terorbital distance 1.6-2.8 mm. Intertegu-
lar distance 1.5-2.2 mm. Basitibial plate
apex broadly rounded. Terminalia as de-
picted in figures 28, 34, 40, and 48.

Outer interspace of mandible with fine
longitudinal striae at level of inner tooth.
Clypeus with faint, coarse punctures,
punctures nearly contiguous and longitu-
dinally extended making surface appear
roughened. Supraclypeal area with coarse,
nearly contiguous punctures. Face lateral
to outer subantennal sutures and below
level of antennal sockets with punctures
separated by 1-2 times puncture width,
integument otherwise smooth; at level of
antennal sockets punctures become small-
er, well-defined, and gradually more
closely spaced until nearly contiguous at
level just above antennal sockets. Gena as
on vertex except punctures becoming faint
on lower three-quarters and separated by
2-A times puncture width, integument
otherwise smooth, punctures also become
fainter posteriorly near preoccipital area.
Postgena faintly and coarsely punctured,
integument between punctures smooth.

Proboscis light brown to yellow; hypos-
tomal fossa as well as bordering areas of
postgena and preoccipital area yellow.
Preepisternum, mesepisternum, metepis-
ternum, and propleuron yellow. Legs yel-
low. Propodeum yellow except sometimes
with dark brown to black spot medially
on basal area. Mediolongitudinal line of
Tl anterior surface yellow; terga and ster-

na uniformly yellow or yellowish-amber,
sometimes with light brown spot on T2
outside of lateral gradulus (on ventral-fac-
ing surface of tergum).

Pubescence along apicolateral margins
of clypeus sparse and simple. Terga with
sparse hairs except lateral to pygidial plate
where they are long, dense, frequently
branched, and golden or amber; sterna
similar without patches of long, golden
hairs on either side of apical cleft of S6,
hairs golden, short, and not clustered into
patches.

Female: As described for the male ex-
cept as indicated: Total body length 8.0-
10.6 mm; forewing length 4.8-6.3 mm.
Head width 2.3-3.0 mm, length 1.7-2.4
mm. Upper interorbital distance 1.4-2.0
mm, lower interorbital distance 1.5-2.2
mm. Intertegular distance 1.5-2.0 mm.

Face colored as in figure 13. Gena yel-
low. Proboscis dark brown; hypostomal
fossa as well as bordering areas of post-
gena and preoccipital area dark brown to
black. Labrum yellow. Scape outer surface
yellow, inner surface black; remainder of
antenna light brown. Pronotum yellow ex-
cept transverse median line of dark brown
to black on dorsal surface. Mesoscutum
yellow except three very narrow longitu-
dinal stripes and border with tegula black.
Scutellum yellow except anterior margin
black. Tegula and metanotum yellow.
Pleura yellow except ventrallv dark
brown to black; propleuron black. Wing
veins amber. Coxae and trochanters black;
femora black basally, remainder yellow;
remainder of legs yellow. Propodeum yel-
low with basal margin and narrow medi-
olongitudinal line black. Terga yellow;
sterna yellow with paired spots of brown
on central discs.

<—

Figs. 15-16. Scanning electron micrographs of Arhysosage flava Moure, male head. 15, Full face; the mandib-
ular striations are slightly visible on the outer border of the left mandible (right side in the micrograph). lr>,
Labrum and lower half of face; note the sharply curved inner subantennal suture and the position ot the

anterior tentorial pit nearly at the midpoint of the outer subantennal suture.

198

Journal of Hymenoptera Research

Variation. — The areas of dark brown to
black on the venter of the female can
sometimes be light brown or with various
regions being entirely yellow. Similarly,
Tl in the female can sometimes have a
small brown spot centrally by the bend
separating the anterior-facing and dorsal-
facing surfaces. On the face, females some-
times have small black patches at the up-
per border of the compound eyes. These
patches can sometimes connect the black
crescent of the upper face with the com-
pound eye margins.

Holotype.— ARGENTINA: Formosa: S,
Ing. Juarez, December 1950, F. H. Walz
(SEMC).

Additional material. — ARGENTINA: Cata-
marca: Recreo, December 1951, F. H. Walz
(19USNM, lcJAMNH, 193ddSEMC). Cordoba:
Jesus Maria, 3 December 1973, J. L. Neff, on Opun-
tia sp. (1 96c? cJCTMI). Arguello, J. A. de Carlo and
M. J. Viana (1 9 SEMC). Formosa: Ing. G. N. Juarez,

30 November 1949, F. Monros (191<5MACN). Ing.
Juarez, December 1950, F. H. Walz (1<5AMNH,
1<3BMNH, l93dc?SEMC). Gran Guardia, 15 No-
vember 1952, J. Foerster (191.5SEMC). San Luis:
A. Stevenin (3d JMACN). Santiago del Estero: Rio
Salado, Wagner (192ddMACN). [no date or col-
lector's name] (29 93c? dMACN). El Pinto, Novem-
ber 1956 (259 925 6 6 SEMC). Choya, January 1958
(49 9 176 cJSEMC). M. Gomez (1 9 1 <3SEMC). Dpto.
Matara, Desvio 511, 24 October 1928, M. Gomez
{26 6SEMC). Loreto, December 1992, M. Fritz
(19AMNH). Salta: Cruz Quemada, 40 km S Gen-
eral Guemes, 20 November 1989, J. G. Rozen and
A. Roig-Alsina (29 921 6 6 AMNH). Same as pre-
vious collection data except in copula on flowers
of Opuntia sp. (19ldAMNH). Same as previous
[9 don same pin] (191 6" AMNH). Cruz Quemada,

31 km S General Guemes, 10 November 1989, J. G.
Rozen and A. Roig-Alsina, on Opuntia sp.
(39 97ddAMNH). Cruz Quemada, 9 November
1993, J. G. and B. L. Rozen, on Opuntia sp.
(16* AMNH). 20 km W-NW Hickmann, 12-14 No-
vember 1989, J. G. Rozen and A. Roig-Alsina
(1 92b" cJ AMNH). BOLIVIA: Santa Cruz: San Isidro
(16* AMNH). PARAGUAY: Chaco, Loma Plata, Ar-
riagado, February 1993 (lei AMNH).

Floral records. — This species has at pres-
ent been found only on flowers of an un-
identified Opuntia (new record).

Phenology. — Arhysosage flava has been
captured from early November into early
February.

Comments. — This species resembles to
some degree A. ochracea but differs most
notably in the absence of metasomal
bands, the elongate punctures of the clyp-
eus (Figs. 15-16), the absence of dense se-
tae on the lateral borders of the clypeus,
and the patterning of black marks on the
female face (Fig. 13). Arhysosage flava is
most similar to the poorly known A. zam-
icra but differs in the male mandible being
longer than the compound eye (Fig. 14),
the absence of black markings on the me-
sepisterna, the presence of fine striae on
the mandibular outer interspace (Fig. 15),
and the broadly rounded basitibial plate
apex (Fig. 8).

The above specimens of this species in
Bolivia and Paraguay are the first records
for this genus in both countries.

Arhysosage zamicra Engel, new species

(Figs. 22, 27, 33, 39, 46)

Diagnosis. — This is presently is distin-
guished by the combination of the absence
of banding on the metasoma, the elongate
punctures of the clypeus, the mandible be-
ing slightly shorter in length than the
length of the compound eye, the absence
of mandibular striae, the presence of ven-
tral-facing black spots on the mesepister-
na, and the pointed apex of the basitibial
plate (Fig. 7).

Description. — As for A. ochracea (see
above) with the following modifications:
Male: Total body length 6.8 mm; forewing
length 4.2 mm. Head width 2 mm, length
1.3 mm. Mandible shorter than compound
eye; inner tooth strong and pointed (Fig.
22). Upper interorbital distance 1.2 mm,
lower interorbital distance 1.4 mm. Inter-
tegular distance 1.3 mm. Basitibial plate
apex pointed (similar to that depicted for

Volume 9, Number 1, 2000

199

A. cactorum: Fig. 7). Terminalia as depicted
in figures 27, 33, 39, and 46.

Outer interspace of mandible with faint,
coarse punctures, integument between
faintly imbricate, without striae. Clypeus
with faint, coarse punctures, punctures
nearly contiguous and longitudinally ex-
tended making surface appear roughened
(as in A. flava). Supraclypeal area with
coarse, nearly contiguous punctures. Face
outside of outer subantennal sutures and
below level of antennal sockets with punc-
tures separated by 1-2 times puncture
width, integument otherwise smooth; at
level of antennal sockets punctures be-
coming smaller, well-defined, and gradu-
ally more closely spaced until nearly con-
tiguous just above antennal sockets. Gena
as on vertex except punctures becoming
faint on lower half and separated by 2-3
times puncture width, integument other-
wise smooth, punctures become faint near
preoccipital area. Postgena faintly imbri-
cate.

Head mostly yellow except facial foveae
black and two spots on clypeus dark
brown. Inner tooth and mandibular apex
reddish brown to black. Proboscis light
brown; hypostomal fossa as well as bor-
dering areas of postgena and preoccipital
area yellow. Antenna yellow. Mesosoma
yellow except posterior third of axilla
black and spot of dark brown on ventral-
facing surface of mesepisternum. Metaso-
ma yellow except small dark brown spot
laterally outside of gradulus on T2.

Pubescence along apicolateral margins
of clypeus sparse and simple. Terga with
sparse hairs except lateral to pygidial plate
where they are long, dense, frequently
branched, and golden; sterna similar with-
out patches of long, golden hairs on either
side of apical cleft of S6, hairs golden,
short, and not clustered into patches.

Female: Unknown.

Holotypc— ARGENTINA: Santiago del
Estero: 6, El Pinto, November 1956
(SEMC).

Etymology. — The specific epithet is a

combination of the Greek words za (very)
and mikros (small).

Phenology. — This species has so far only
been captured in November.

Comments. — This is presently the small-
est known species of Arhysosage. It is sim-
ilar to smaller specimens of A. ochracea but
differs most notably in the absence of the
banding pattern on the metasoma, in this
respect resembling A. flava to which it is
perhaps a close relative. Like A. flava, A.
zamicra has the elongate punctures of the
clypeus but differs from this species in the
mandible being slightly shorter than the
compound eye, the absence of mandibular
striae, the presence of ventral-facing black
spots on the mesepisterna, and the point-
ed apex of the basitibial plate (Fig. 7).

Arhysosage cactorum Moure

(Figs. 4, 6-7, 23-25, 31, 37, 43-44)

Arhysosage melanotricha Schlindwein and Witt-
mann 1995: 32. Lapsus calami and nomen nu-
dum.
Arhysosage cactorum Moure 1999: 241
Arhysosage melanothricha Moure 1999: 245. New
synonymy.

Diagnosis. — The male of this species is
recognized by the upper half of the face
being black (Figs. 24-25), the absence of an
emargination at the pygidial plate apex
(Fig. 4), the apices of penis valves not
bending ventrally (Fig. 44), and the aedea-
gus not extending apically near to the api-
ces of the penis valves (Figs. 43-44). The
female can be distinguished by the mostly
yellow labrum, the absence of yellow
markings of any sort on the metasoma,
and the pygidial plate strongly curved
ventrally towards apex in profile and dor-
sally quickly tapering to a well-defined
point.

Description. — As for A. ochracea with the
following modifications and additions:
Male: Total body length 8.8 mm; fore wing
length 5.7 mm. Head width 3 mm, length
2 mm. Mandible longer than compound
eye; inner tooth strong and pointed (Figs.
24-25). Upper interorbital distance 1.8

200

Journal of Hymenoptera Research

Figs. 17-19. Arhysosage ochracea (Friese), faces, pubescence omitted. 17, Female, most common color pattern.
18, Male, arrow indicates inner tooth. 19, Female, second facial pattern. Stippling indicates black areas, re-
mainder yellow.

mm, lower interorbital distance 2 mm. In-
tertegular distance 1.8 mm. Basitibial plate
apex pointed (Fig. 7). Apex of pygidial
plate not emarginate (Fig. 4). Apex of pe-
nis valve not bending ventrally (Fig. 44);
aedeagus not extend apically near to apex
of penis valve (Figs. 43-44); terminalia
otherwise as depicted in figures 31, 37,
and 43-44.

Integument of mandible in outer inter-
space roughened, becoming smooth by
point where outer ridge and condylar
ridge meet. Clypeus with faint, coarse
punctures, punctures nearly contiguous

and longitudinally extended making sur-
face appear roughened. Subantennal areas
faintly imbricate. Supraclypeal area below
antennal sockets and between inner su-
bantennal sutures minutely roughened;
between antennal sockets punctures well-
defined, smaller, and nearly contiguous.
Face outside of outer subantennal sutures
and below level of antennal sockets
coarsely punctured, punctures separated
by puncture width or less, integument be-
tween smooth; at level of antennal sockets
punctures become smaller, well-defined,
and gradually more closely spaced until

Volume 9, Number 1, 2000

201

'"'"•-,. :

-.N

*/*■■

sit ^ r -

1 .1

■- . -c_ \

.^JtLjy ^ :

s- x

,..--^'"^1

IT* h '■

.x 1

- \

^ /

ll*

Ik \

* ^^-*^-"""

Hk».\

■TF1 fl

1 Jv

r^ *

^1 IF1I Ell r

\ /^^

^ *^l w I'M 1 ^a

$p BP^

.•-" '

>^ ^>^^pSp

Figs. 20-21. Scanning electron micrographs ot .-b/n/sc'SKyc oihracea (Friese), male head. 20, lull face. 21, La-
bium, lower paraocular area, and supracivpeal area.

202

Journal of Hymenoptera Research

Fig. 22. Arhysosage zamicra n. sp., male face, pubes-
cence omitted. Stippling indicates black areas, re-
mainder yellow.

nearly contiguous by level just above an-
tennal sockets; remainder of face and ver-
tex with such fine, well-defined punctures,
nearly contiguous. Gena as on vertex ex-
cept punctures becoming smaller and
faint. Pronotal lateral surfaces imbricate
and impunctate. Tegula imbricate. Metan-
otum with contiguous faint, coarse, punc-

tures, integument between imbricate.
Preepisternal area as on mesoscutum ex-
cept punctures becoming faint and slight-
ly more widely spaced ventrally; mesepis-
ternum with faint, coarse punctures sep-
arated by less than puncture width, integ-
ument between faintly imbricate,
punctures become fainter ventrally; mete-
pisternum with faint, minute punctures
separated by width or less, integument be-
tween imbricate. Propodeal lateral surface
with minute, well-defined punctures sep-
arated by puncture width or less, integu-
ment between smooth; posterior surface
as on lateral surface except punctures
faint.

Head coloration as in figures 24-25. Pro-
boscis brown; hypostomal fossa, postgena,
and preoccipital area black. Labrum yel-
low. Scape with inner surface black, outer
surface yellow; remainder of antenna
brown. Pronotum black except pronotal
lobe, medioapical border, and lateral spot
yellow. Mesoscutum black except border
with tegula and two very small spots bor-
dering median line yellow. Scutellum yel-
low except mediobasal border black. Te-
gula and metanotum yellow. Pleura black

I igs. 23-24. Arhysosage cactorum Moure, faces, pubescence omitted. 23, Female. 24, Male. Stippling indicates
black areas, remainder yellow.

Volume 9, Number 1, 2000

203

Fig. 25. Arhysosage cactorum Moure, lateral view of
male head.

except upper quarter of preepisternal area
and medial third of metepisternum yel-
low. Coxae and trochanters black; basal
border and inner surfaces of femora black,
remainder yellow; remainder of legs yel-
low. Propodeum yellow except basally
bordering metanotum black with a medi-
olongitudinal, narrow line of black run-
ning from the basal area onto the posterior
surface and ending medially at marginal
area of propodeum; basal half of lateral
surface black. Metasoma uniformly am-
ber.

Pubescence along apicolateral margins
of clypeus sparse and simple. Terga with
sparse hairs except lateral to pygidial plate
where they are long, dense, frequently
branched, and amber; sternal hairs amber,
short, and not clustered into patches.

Female: As described for the male ex-
cept as indicated: Total body length 8.3
mm; forewing length 5.9 mm. Head width
2.9 mm, length 1.9 mm. Upper interorbital
distance 1.7 mm, lower interorbital dis-
tance 1.8 mm. Intertegular distance 1.8
mm. Pygidial plate in profile strongly

Figs. 26-31. Male S7 of Arhysosage species, pubescence on right halves only. 26, Arhysosage ochracea (Friese).
27, A. zamicra n. sp. 28, A. flam Moure. 29, A. atrolunata n. sp. 30, A. bifasciata (Friese). 31, A. cactorum Moure.

204

Journal of Hymenoptera Research

Figs. 32-37. Male S8 of Arhysosage species, pubes-
cence on right halves only. 32, Arhysosage ochracea
(Friese). 33, A. zamicra n. sp. 34, A. flava Moure. 35,
A. atrolunata n. sp. 36, A. bifasciata (Friese). 37, A. cac-
toruiii Moure.

curved ventrally towards apex, quickly ta-
pering to well-defined point in dorsal
view.

Facial coloration as in figure 23. Gena
yellow. Proboscis dark brown; hyposto-
mal fossa, postgena, and preoccipital area
dark brown. Labrum yellow except apical
margin brown. Pronotum black except

pronotal lobe, posterior median border,
and anterior median border yellow. Me-
soscutum black except border with tegula
yellow. Tegula yellow. Axilla and anterior
half of scutellum black, remainder yellow.
Metanotum yellow except anterior border
black. Pleura black. Legs dark brown ex-
cept apices of pro- and meso-femora, out-
er surface of protibia, inner surface of me-
sotibia, and protarsus yellow. Basal area
of propodeum yellow except basal margin
and mediolongitudinal line black; lateral
and posterior surfaces black except two
yellow spots on either side of propodeal
pit yellow. Terga amber except anterior-
facing surface of Tl dark brown, median
band of dark brown on T2, and apical half
of T6; sterna light brown.

Topotype. — BRAZIL: Rio Grande do
Sul: 6* Lavras do sul ("Rincao do Infer-
no") 11 January 1991, C. Schlindwein. I
was unable to examine the holotype but
have seen a male and female of Moure's
species (identified by Padre Moure) in the
collection of Isabel Alves dos Santos. The
male I examined was collected at the same

time and place as the holotype.

Additional material— ARGENTINA: Salta: El Carril,
11 November 1989, J. G. Rozen and A. Roig-Alsina,
on Opuntia sp. (6 AMNH). N. El Carril, 13 November
1993, J. G. and B. L. Rozen, on Opuntia sp. (9 AMNH).
Sumalao, November 1994, M. Fritz (49 9
3c5 6 AMNH). BRAZIL: Rio Grande do Sul: Lavras
do sul ("Rincao do Inferno") 11 January 1991, C.
Schlindwein. (cJPCIA). Cacapava do Sul, 11 Novem-
ber 1990, C. Schlindwein (9PCIA).

Floral records. — Captured at flowers of
an unidentified Opuntia.

Phenology. — This species has been col-
lected in November and January.

KEY TO SPECIES OF ARHYSOSAG1
(Unknown and not included: Females of A. zamicra)

1. Males 2

- Females 7

2. Face predominantly yellow (Figs. 10, 12, 14, 18, 22); scape yellow or at most with small
brown patches on inner surface; pygidial plate apex emarginate, sometimes weakly so
(Fig. 5); apex of penis valve bent ventrally (Figs. 45-49) 3

Volume 9, Number 1, 2000

205

- Upper half of face entirely black (Fig. 24); scape yellow on outer surface, black on inner
surface; pygidial plate apex not emarginate (Fig. 4); apex of penis valve not bent ventrally
(Fig. 44) A. cactorum Moure

3. Face with black markings restricted to facial fovea (Figs. 12, 14, 18, 22) 4

- Face with black markings on facial fovea and with a black crescent-like area that connects
foveae just above ocelli (Fig. 10) A. atrohmata n. sp.

4. Clypeus with coarse, elongate punctures (Fig. 16); clypeus with dense pubescence at ap-
icolateral margins 5

- Clypeus with coarse, rounded punctures (Fig. 21); clypeus with sparse pubescence at
apicolateral margins 6

5. Mandible longer than compound eye (Fig. 14), with fine striae on outer interspace (Fig.
15); mesepisterna yellow, without black markings; basitibial plate apex broadly rounded
(Fig. 8) A. flava Moure

- Mandible slightly shorter than compound eye (Fig. 22), outer interspace without striae,
instead imbricate with coarse punctures; mesepisterna with paired black spots; basitibial
plate apex pointed (Fig. 7) A. zamicra n. sp.

6. Metasoma banded, yellow with transverse amber bands (Fig. 1) A. ochracea (Friese)

- Metasoma uniformly amber A. bifasciata (Friese)

7. Labrum black or brown, infrequently with some small yellow spots or bands; pygidial
plate straight or weakly curved in profile, dorsally gently tapering to narrowly rounded
apex 8

- Labrum mostly yellow except apical border brown; pygidial plate strongly curved in
profile, dorsally quickly tapering to a well-defined point at apex A. cactorum Moure

8. Clypeal integument with coarse, rounded punctures (Fig. 21), clypeus with some black
markings aside from paired spots of brown (Figs. 9, 11, 17, 19) 9

- Clypeal integument with coarse, elongate punctures (Fig. 16), clypeus yellow without
black markings aside from paired spots of brown (Fig. 13) A. flava Moure

9. Propodeum entirely black, infrequently with small paired spots or transverse bands of
yellow along posterior border of basal area; facial color pattern as in figure 11; metasoma
mostly black with small yellow spots or bands A. bifasciata (Friese)

- Propodeum yellow with black along anterior border of basal area and in a mediolongi-
tudinal band running from border with metanotum to metasoma; facial color pattern as
in figure 9, 17, or 19; metasoma frequently mostly yellow or amber, sometimes mostly
dark but with complete transverse yellow bands on most segments 10

10. Metasoma uniformly amber, without yellow banding or spots; facial color pattern as in

figure 9 A. atrohmata n. sp.

- Metasoma banded; facial color pattern as in figure 17 or 19 A. ochracea (Friese)

NOMINA NUDA IN ARHYSOSAGE

Arhysosage xanthina Moure, notnen
nudum

Arhysosage xanthina Moure /;/ Schlindwein and
Wittmann 1995: 32.

Comments. — Schlindwein and Wittmann
(1995) presented a study on the pollina-
tion of the cactus genera Notocactus and
Gymnocalycium in which they mention
several species of Arhysosage visiting these
flowers. Both in the text and in the ac-

knowledgments they attribute several Ar-
hysosage identifications and names to Pa-
dre Moure.

The information presented in Schlind-
wein and Wittmann (1995) extends the
range of the genus into southern-most
Brazil. These authors record the locality at
which they observed bees on cactus flow-
ers as follows: Serra do Sudeste, southeast
of Rio Grande do Sul (30°-32° S, 51°-54°
W), Brazil, at approximately 500 m eleva-
tion. The area is described as subtropical
to temperate being humid most of the year

206

Journal of Hymenoptera Research

Figs. 38-43. Male genitalia of Arhysosage species; left halves are ventral views, right halves are dorsal views.
Aedeagus stippled in figures. 38, Arhysosage ochracea (Friese). 39, A. zamicra n. sp. 40, A. flava Moure. 41, A.
atrolunata n. sp. 42, A. bifasciata (Friese). 43, cactorum Moure.

Volume 9, Number 1, 2000

207

Figs. 44-49. Male genitalia of Arkysosage species in lateral view; outlines of penis valve apodemes omitted
except for a two species so as to contrast their shapes and demonstate variation in the genus. Aedeagus
stippled in figures. 44, Arhysosagc cactorum Moure. 45, Arh\/>o>n^e ativlitnatn n. sp. 46, A. zamicra n. sp. 47, A.
bifasciata (Friese). 48, A. flava Moure. 49, A. ochracea (Friese).

although with water deficiency from De-
cember through February. These authors
also record bees visiting several cactus
flowers: Natacactus pah/acanthus, N. succi-
neus, N. sellowii, Gymiwcalycium denudatum
(Schlindwein and Wittmann 1995) and
Fraileu phaeodisca, F. pygmaea, N. neohorstii,
N. attains, Opuntia brunneogemmia, O. viri-
dirubra (Schlindwein 1995, Schlindwein
and Wittmann 1997). On average 95% of
the pollen in loads of individual females
came from a single cactus species
(Schlindwein and Wittmann op. cit.).

ACKNOWLEDGMENTS

I am grateful to Isabel Alves dos Santos tor a loan
of A. cactorum specimens and to Padre Jesus S. Moure

for communications concerning Arhysosage. I am
thankful to the persons mentioned in the Materials
and Methods who graciously loaned material under
their stewardship. Molly G. Rightmyer kindly assist-
ed with the scanning electron microscopy and prep-
aration of the final images. I thank John L. \ett who
provided information on floral associations tor spe< -
imens ot ArhysOSdge he collected during expeditions

in 1972-1973 and 1986. John I Neff, Molly G. Right-
myer, Jerome ti. Ro/en, Jr., and two anonymous re-
viewers read early versions ot the manuscript .md
provided valuable suggestions tor its improvement.
Support tor my studies has been generously provided

by Robert ci. Goelet, chairman Emeritus ot the

\\l\l I board ot I rusUvs.

LITERATURE CITED

Ashmead, \\ . II L899. ( lassification ot the bees, or
tlir superfamily Apoidea. Transactions of the
American I ntomological Society 26: 4l> inn

208

Journal of Hymenoptera Research

Brethes, J. 1922. Himenopteros y Dfpteros de varias
procedencias. Anales de la Sociedad Cientifica Ar-
gentina 93: 119-146.

Cockerell, T. D. A. 1940. A new bee from the argen-
tine republic. American Museum Novitates 1080: 1.

Cortes, R. 1951. Nuevos generos de Tachininae chi-
lenos con cerdas facio-orbitales (Diptera Tachin-
idae). Revista Chilena Entomologia 1: 249-262.

Cresson, E. T. 1878. Descriptions of new North Amer-
ican Hymenoptera in the collection of the Amer-
ican Entomological Society. Transactions of the
American Entomological Society 7: 61-136.

Danforth, B. N., and J. L. Neff. 1992. Male polymor-
phism and polyethism in Perdita texana (Hyme-
noptera: Andrenidae). Annals of the Entomological
Society of America 85: 616-626.

Farris, J. S. 1988. HENNIG86, v. 1.5, Program and
Documentation. Port Jefferson, New York.

Friese, H. 1908. Die Apidae (Blumenwespen) von Argen-
tina uach den Reisenergebnissen der Herrn A. C. Jen-
sen-Haarup und P. Jorgensen in den jahren 1904—
1907. Verlag "Flora og Fauna", Silkeborg, Den-
mark, 111 + [4] pp.

Jensen-Haarup, A. C. 1908. Biological researches
amongst the argentine bees with special refer-
ence to flowers they visit. Pages 95-107, In H.
Friese Die Apidae (Blumenwespen) von Argen-
tina nach den Reisenergebnissen der Herrn A. C.
Jensen-Haarup und P. Jorgensen in den Jahren
1904-1907. Verlag "Flora og Fauna", Silkeborg,
Denmark, 111 + [4] pp.

Jorgensen, P. 1912. Revision der Apiden der Provinz
Mendoza, Republica Argentina (Hym.). Zoologis-
che Jahrbiicher, Abteilung fur Systematik, Geogra-
phic, und Biologic der Tiere 32: 89-162.

Michener, C. D. 1944. Comparative external mor-
phology, phylogeny, and a classification of the
bees. Bulletin of the American Museum of Natural
History 82: 151-326.

Michener, C. D. In press. The Bees of the World. Johns
Hopkins University Press, Baltimore, United
States.

Michener, C. D., and A. Fraser. 1978. A comparative
anatomical study of mandibular structure in
bees. University of Kansas Science Bulletin 51: 463-
482.

Moure, J. S. 1958. On the genus Arln/sosage Brethes
from Argentina (Hymen., Apoidea, Panurginae).
Entomological News 69: 43-48.

Moure, J. S. 1999. Duas especies novas de Arln/sosage
Brethes do Brasil (Rio Grande do Sul) e da Ar-
gentina (Salta) (Hymenoptera, Apoidea, Panur-
ginae). Revista Brasileira tie Zoologia, supl, .?, 16:
241-247.

Neff, J. I.., and B. N. Danforth. 1992. The nesting and
foraging behavior of Perdita texana (Cresson)
(Hymenoptera: Andrenidae). Journal of the Kansas
Entomological Sot levy 64: 394-405.

Nixon, K. C. 1993. CLADOS, v. 1.4.88, Program and
Documentation. Trumansburg, New York.

Nixon, K. C. 1995. DADA, v. 0.96.1, Program and
Documentation. Trumansburg, New York.

Ruz, L. 1986. Classification and Phylogenetic Relation-
ships of the Panurgine Bees (Hymenoptera- Andreni-
dae). Ph.D. Dissertation, University of Kansas,
Lawrence, Kansas, 312 pp.

Ruz, L. 1991. Classification and phylogenetic relation-
ships of the panurgine bees: The Calliopsini and
allies (Hymenoptera: Andrenidae). University of
Kansas Science Bulletin 54: 209-256.

Schlindwein, C. 1992. Arln/sosage sp. (Hymenoptera,
Apoidea, Andrenidae) an oligolectic pollinator of
cactus flowers. Resumes do 12th Congresso Latino-
Americano de Zoologia e 19th Congresso Brasileiro
de Zoologia 1992: 61.

Schlindwein, C. 1995. Melittophilous plants, their pol-
len and flower visiting bees in southern Brazil.
2. Cactaceae. Biociencias, Porto Alegre 3: 35-71.

Schlindwein, C, and D. Wittmann. 1995. Specialized
solitary bees as effective pollinators of South Bra-
zilian species of Notocactus and Gymnocalycium
(Cactaceae). Bradleya 13: 25-34.

Schlindwein, C, and D. Wittmann. 1997. Stamen
movements in flowers of Opuntia (Cactaceae) fa-
vour oligolectic pollinators. Plant Systematics and
Evolution 204: 179-193.

Spinola, M. 1843. Sur quelques Hymenopteres peu
connus, recueillis en Espagne, pendant 1'annee
1842, par M. Victor Ghiliani, voyageur-natural-
iste. Annalcs de la Societe Entomologique de France
1: 111-144.

Snelling, R. R., and B. H. [sic: N.], Danforth. 1992. A
review of Perdita, subgenus Macrotera (Hyme-
noptera: Andrenidae). Contributions in Science
436: 1-12.

Timberlake, P. H. 1952a. Descriptions of new species
of Nomadopsis from California and Texas, and a
new allied genus from South America. Annals of
the Entomological Society of America 45: 104-118.

Timberlake, P. H. 1952b. A new name for the bee
genus Ruiziella. Annals of the Entomological Society
of America 45: 528.

Timberlake, P. H. 1953. Erratum. Annals of the Ento-
mological Society of America 46: 598.

Toro, H. 1995. Una nueva especie de Spinoliella (Apo-
idea: Andrenidae) del norte de Chile. Acta Ento
mologica Chilena L9: 105-107.

Toro, H., and M. Herrera. 1980. Las especies chilenas
del genero Callonychium (Andrenidae-Apoidea) v
description de un nuevo genero [sic: subgenera].
Anales del Museo de Historia Natural de Valparaiso
13: 213-225.

Toro, H., and L. Ruz. 1972. Revision del genero Spi-
noliella (Andrenidae-Apoidea). Anales del Museo
de Historia Natural de Valparaiso 5: 137-171, 293-
295.

J. HYM. RES.
Vol. 9(1), 2000, p. 209

NOTE

Cretobestiola, a replacement name for Bestiola Pulawski and
Rasnitsyn, 1999 (Hymenoptera: Sphecidae)

Wojciech J. Pulawski a\d Alexandr P. Rasmtsyn

(WJP) Department of Entomology, California Academy of Sciences, Golden Gate Park, San

Francisco, California 94118, USA; e-mail: wpulawski@calacademv.org; (APR) Paleontological

Institute, Russian Academy of Sciences, Moscow 117647, Russia; e-mail: rasna@glasnet.ru

We recently described the sphecid wasp
genus Bestiola (in Rasnitsyn et al. 1999) to
accommodate four species from Lower
Cretaceous of Spain, eastern Russia, and
Mongolia. This generic name, however, is
preoccupied by Bestiola Nikol'skaya
(1963), an aphelinid, as pointed out to us
by Mr. John K. Page (Zoological Records,
York, Great Britain) and also by Signor
Guido Pagliano (Torino, Italy). We there-
fore propose the name Cretobestiola to re-
place it. The name is derived from the Lat-
in creta (chalk), with reference to Creta-

ceous geological period, and bestiola (little
beast).

LITERATURE CITED

Nikol'skaya, M. N. 1963. Dva novykh roda afelinid
(Hvmenoptera, Chalcidoidea), vyvedennykh iz
bambukovoi shchitovki Odonapis secreta na Kav-
kazke (Ckll.) [Two new genera of Aphelinidae
(Hymenoptera, Chalcidoidea) bred from Odon-
apis secreta (Ckll.) in Caucasus.] Entomologiches-
koye Obozrenye 42: 186-189.

Rasnitsyn, A. P., W. J. Pulawski, and X. Martinez-
Delclos. 1999. Cretaeous digger wasps of the new
genus Bestiola Pulawski and Rasnitsyn (Hvme-
noptera: Sphecidae: Angarosphecinae). journal of
Hymenoptera Research 8: 23-34.

J. HYM. RES.
Vol. 9(1), 2000, pp. 210-212

NOTE

Two New Records of Pimpline Ichneumonids Attacking Battus pliilenor

(Linnaeus) (Lepidoptera: Papilionidae)

Karen R. Sime

Department of Ecology & Evolutionary Biology, and Department of Entomology, Cornell

University, Ithaca, New York 14850

A series of seven ichneumonids redis-
covered in the American Museum of Nat-
ural History collection offers two new host
associations. All seven parasitoids were
reared from pupae of Battus philenor (Lin-
naeus); one of the specimens is Theronia
atalantae (Poda), and the other six are
Apechthis annulicornis (Cresson). The host
pupae were all collected on October 3,
1960, at a single site ("North Carolina:
above Crabtree to Betsey's Gap; 3956';
Haywood Co.; coll. Gertsch, Ivie"), and
the wasps emerged in November 1960.
The pupal remains were kept with the
wasps, permitting confirmation of the
hosts' identity.

These associations are particularly inter-
esting because Battus philenor is consid-
ered relatively immune to attack by par-
asitoids. It may be protected by toxins ac-
quired from its food plants, which are the
various North American species of Aris-
tolochia (Aristolochiaceae). The adults have
long been recognized as the unpalatable
models for a Batesian mimicry ring (Brow-
er 1958); like many other species in the
tribe Troidini Nishida 1995), B. pliilenor se-
questers substantial quantities of aristo-
lochic acids to the adult stage (Sime, in
prep.). Experimental evidence indicates
that these compounds are unusually toxic,
at least to non-adapted lepidopteran lar-
vae (e.g. Miller and Feeny 1989). Haase
(1893) was the first to link Aristolochi-
aceae-feeding with low parasitism rates,
observing that B pliilenor pupae never

yielded parasitoids while the pupae of the
palatable mimics Papilio troilus Linnaeus
and P. glaucus Linnaeus frequently pro-
duced ichneumonids.

Immature B. philenor are commonly col-
lected and studied, and the considerable
rearing data available in collections and in
both published and unpublished studies
suggest that larval and larval-pupal para-
sitoids are nearly nonexistent and pupal
parasitoids rather rare. Among reports in
the literature involving larvae, there is just
a single record, lacking ecological data, for
the tachinid Compsilura concinnata (Mei-
gen) (Schaffner and Griswold 1934), which
when in butterflies is a larval-pupal par-
asitoid (Ford and Shaw 1991). I have
reared some 90 B. philenor (found as lar-
vae) from the Blue Ridge Mountains of
Virginia (a habitat similar to that for the
new records), but obtained only butter-
flies. Rausher (1981), in an exhaustive
study of B. philenor ecology in Texas, not-
ed that in four field seasons no parasitoids
emerged from several hundred field-col-
lected larvae reared to adulthood. Other
authors have collected pupae: West and
Hazel (1982) reported no parasitoids in a
Virginia study, though Sims and Shapiro
(1983) found that Brachymeria ovata (Say)
(Chalcididae) occasionally inflicts high
mortality in some California populations
of B. philenor. Gambrus amoenus (Graven-
horst) (= nuncius (Say)) (Ichneumonidae)
has reportedly been reared from B. phile-
nor, but the genus is thought only to attack

Volume 9, Number 1, 2000

211

cocooned hosts, and Townes and Townes
(1962) and Gupta (1983) consider this spe-
cies a specialist on Callosamia and a few
other Saturniidae.

Theronia atalantae is common and wide-
spread; it is a polyphagous parasitoid of
pupae apparently capable of both primary
and secondary parasitism, though almost
invariably found to be a secondary para-
sitoid when possible to investigate
(Townes 1940). Almost always associated
with Lepidoptera, it has been reared from
at least 16 families, most frequently Ly-
mantriidae and Lasiocampidae. (The ap-
parent bias towards these two families
may be an artifact of the attention that
pests such as gypsy moth and forest tent
caterpillars have received.) Whether the
new record represents primary or second-
ary parasitism (perhaps on A. annulicornis)
is not known. As a secondary parasitoid,
however, its presence in 8. philenor would
not necessarily be remarkable: if the pri-
mary parasitoid detoxifies plant poisons
in the lepidopteran pupa, it might itself
become a non-toxic host for T. atalantae.

ApechtJiis annulicornis is a pupal parasit-
oid of Lepidoptera; it is reared less often
than is T. atalantae, but a number of re-
ports indicate that it has a broad host
range, attacking Neophasia menapia (Felder
& Felder) (Pieridae) and various species of
Choristoneura (Tortricidae) and Orgyia (Ly-
mantriidae) (Carlson 1979 and refs. there-
in). This record, together with those of 8.
ovata and C. concinnata (each of which at-
tacks many families and over 100 species
of Lepidoptera (Arnaud 1978; Halstead
1988)), indicates that 8. philenor is the oc-
casional host of several relatively polyph-
agous parasitoids that are reared much
more often from other, less toxic Lepidop-
tera. This phenomenon may reflect a
broad constitutive tolerance of plant alle-
lochemicals on the part of the generalists:
that larval and larval-pupal hymenopter-
an parasitoids are, in contrast, entirely
lacking suggests that the unusual toxicity
of aristolochic acids has prevented the

evolution of specialist, koinobiont parasit-
oids of 8. philenor.

ACKNOWLEDGMENTS

I thank Michael Engel and Eric Quinter (AMNH)
for arranging the loan of specimens, and Rick Hoe-
beke for assistance with the identification of ichneu-
monid species. Paul Feeny, Cheryl Heinz, Mike
McDonald and Mark Shaw provided helpful com-
ments on the manuscript.

LITERATURE CITED

Arnaud, P. H. 1978. A host-parasite catalog of North
American Tachinidae (Diptera). U.S. Department
of Agriculture Miscellaneous Publications No. 1319:
1-860.

Brower, J. V. Z. 1958. Experimental studies of mim-
icry in some North American butterflies. II. Bat-
tus philenor and Papilio iroilus, P. polyxenes, and
P. glaucus. Evolution 12:123-136.

Carlson, R. W. 1979. Family Ichneumonidae. pp. 315-
379 in: A catalog of Hymenaptera in America north
of Mexico, volume 1 (eds K. V. Krombein, P. D.
Hurd, D. R. Smith, and B. D. Burks). Smithsonian
Institution Press, Washington D.C.

Ford, T. H. and M. R. Shaw. 1991. Host records of
some West Palearctic Tachinidae (Diptera). En-
tomologist's Record and journal of Variation 103:23-
38.

Gupta, V. 1983. The ichneumonid parasites associated
with the gypsy moth (Lymantria dispar). Contri-
butions to the American Entomological Institute 19:
1-168.

Haase, E. 1893. Untersuchungen tiber die Mimicry auf
Grundlage ernes natiirlichen Systems der Papilioni-
den (Zwciter Theil). E. Nagele, Stuttgart.

Halstead, J. A. 1988. First records of Platychalcis in
North America and new host records of Ceratos-
micra spp. (Hymenoptera: Chalcididae). Entomo-
logical News 99:193-198.

Miller, J. S. and Feeny, P. P. 1989. Interspecific differ-
ences among swallowtail larvae (Lepidoptera:
Papilionidae) in susceptibility to aristolochic ac-
ids and berberine. Ecological Entomology 14:287-
296.

Nishida, R. 1995. Sequestration of plant secondary
compounds bv butterflies and moths. Chemoecol-
ogy 5/6:127-138.

Rausher, M. 1981. Host plant selection by Battus phi-
lenor butterflies: the roles of predation, nutrition,
and plant chemistry. Ecological Monograph'- 51(1):
1-20.

Schaffner, 1. V. and Criswold, C. L. 1934. Macrolepi-
doptera and their parasites reared from field col-
lections in the northeastern part of the United
States. U.S. Department of Agriculture Miscella
neous Publications No. 188:l-lw).

212 Journal of Hymenoptera Research

Sims, S. R. and Shapiro, A. M. 1983. Pupal color di- Part I. Memoirs of the American Entomological Iu-

morphism in California Battus philenor L. (Papi- stitute 11:1-300.

lionidae): mortality factors and selective advan- Townes, H. K., and Townes, M. 1962. Ichneumon-flies

tage. Journal of the Lepidopterists' Society 37:236- of America north of Mexico: 3. Subfamily Geli-

243. nae, Tribe Mesostenini. United States National

Townes, H. K. 1940. A revision of the Pimplini of Museum Bulletin 216 (3): 1-602.

eastern North America. Annals of the Entomologi- West, D. A., and Hazel, W. N. 1982. An experimental

cal Society of America 33:283-323. test of natural selection for pupation site in swal-

Townes, H. K. 1969. The genera of Ichneumonidae, lowtail butterflies. Evolution 36:152-159.

INSTRUCTIONS FOR AUTHORS

General Policy. The Journal of Hymenoptera Research invites papers of high scientific quality reporting
comprehensive research on all aspects of Hymenoptera, including biology behavior, ecology, systematics,
taxonomy, genetics, and morphology Taxonomic papers describing single species are unlikely to be accepted
unless a strong case is evident, such as importance in economic entomology or with concurrent biology or
ecology. Manuscript length generally should not exceed 50 typed pages; however, no upper limit on length
has been set for papers of exceptional quality and importance, including taxonomic monographs at generic
or higher level.

All papers will be reviewed by at least two referees. The referees will be chosen by the appropriate sub-
ject editor. However, it would be helpful if authors would submit the names of two persons who are compe-
tent to review the manuscript.

The language of publication is English. Summaries in other languages are acceptable.

The deadline for receipt of manuscripts is 1 October (for the April issue) and 1 April (for the October
issue).

Format and Preparation. Three copies of each manuscript, including copies of illustrations, should be
submitted on letter size or A4 paper, double spaced, with at least 25 mm margins on all sides. On the upper
left of the title page give name, address and telephone and fax numbers of the author to whom all corre-
spondence is to be sent.

The paper should have a concise and informative title, followed by the names and addresses of all authors.
The sequence of material should be: title, author(s), abstract, text, acknowledgments, literature cited, appen-
dix, figure legends, figure copies (each numbered and identified), tables (each numbered and with heading).
Each of the following should start a new page: (1) title page, (2) abstract, (3) text, (4) literature cited, (5) figure
legends, (6) footnotes.

Following acceptance of the manuscript, the author should provide the editor with one copy of the
manuscript accompanied by a copy on diskette using DD, double sided computer diskettes — IBM compati-
ble MS DOS 5.25 inch or IBM and Macintosh 3.5 inch diskettes. (Authors who do not have access to a com-
puter should submit three copies of the manuscript.) The paper may be submitted in most PC and Mac word
processor programs such as Microsoft Word, FullWrite Professional, WordPerfect, WriteNow, Nisus, Mac-
Write, or Mac Write II. If possible, all words that must be italicized should be done so, not underscored.
Tables may be formatted in a spread sheet program such as MS Works or MS Excel. Text should be double-
spaced typing, with 25 mm left and right margins. Tables should be put in a separate file. Diskettes should
be accompanied by the name of the software program used (e.g., WordPerfect, Microsoft Word). Authors
should keep backup copies of all material sent to the Editor. The Society cannot be responsible for diskettes
or text mislaid or destroyed in transit or during editing.

Illustrations should be planned for reduction to the dimension of the printed page (14 X 20.5 cm, column
width 6.7 cm) and allow room for legends at the top and bottom. Do not make plates larger than 14 X 18 in.
(35.5 X 46 cm). Individual figures should be mounted on a suitable drawing board or similar heavy stock.
Photographs should be trimmed, grouped together and abutted when mounted. Figure numbers should be
on the plate, and it is strongly recommended that names be included after the numbers (e.g., Fig. 2, texanus).
Include title, author(s) and address(es), and illustration numbers on back of each plate. Original figures need
not be sent until requested by the editor, usually after the manuscript has been accepted. Reference to figures /tables
in the text should be in the style "(Fig. 1)" "(Table 1)". Measurements should be in the metric system.

All papers must conform to the International Code of Zoological Nomenclature. The first mention of a plant
or animal should include the full scientific name including the authority Genus names should not be abbre-
viated at the beginning of a sentence. In taxonomic papers type specimens must be clearly designated, type
depositories must be clearly indicated, and new taxa must be clearly differentiated from existing taxa by
means of keys or differential diagnoses. Authors are required to deposit all type material in internationally
recognized institutions (not private collections). Voucher specimens should be designated for specimens
used in behavioral or autecological studies, and they should be deposited similarly

Acceptance of taxonomic papers will not require use of cladistic methods; however, authors using them
will be expected to specify the phylogenetic program used (if any), including discussion of program options
used. A data matrix should be provided if the subject is complex. Cladograms must be hung with characters
and these should include descriptors (not numbers alone) when feasible. The number of parsimonious
cladograms generated should be stated and reasons given for the one adopted. Lengths and consistency
indices should be provided. Adequate discussions should be given for characters, plesiomorphic conditions,
and distributions of characters among outgroups when problematical.

References in the text should be (Smith 1999), without a comma, or Smith (1999). Two articles by a single
author should be (Smith 1999a, 1999b) or Smith (1999a, 1999b). For multiple authors, use the word "and,"
not the symbol "&" (Smith and Jones 1999). For papers in press, use "in press, not the expected publication
date. The Literature Cited section should include all papers referred to in the paper. Journal names should
be spelled out completely and in italic s.

Charges. Publication charges are $10.00 per printed page. At least one author oi the paper must be a
member of the International Society of Hymenopterists. Reprints are charged to the author and must be
ordered when returning the proofs; there are no free reprints. Author's corrections and changes in proof .ire
also charged to the author. Color plates will be billed at full cost to the author.

All manuscripts and correspondence should be sent to:

Dr. E. Eric Grissell

Systematic Entomology Laboratory, USDA

' '< National Museum of Natural History

Washington, DC 20560-0168

Phone: (202) 382-1781 Fax: (202) 786-9422 E-mail: egrissel@sel.barc.usda.gov

CONTENTS
(Continued from front cover)

PULAWSKI, W. J., A. P. RASMTSYN, D. J. BROTHERS, and S. B. ARCHIBALD. New genera
of Angarosphecinae: Cretospheciwn from Early Cretaceous of Mongolia and Eosphecium
from Early Eocene of Canada (Hymenoptera: Sphecidae) 34

QUICKE, D. L. J. and A. POLASZEK. A new genus, and first host records, for the
Adeshini: parasitoids of hispine beetles (Braconidae: Braconinae; Coleoptera:
Chrysomelidae) 104

ROBERTSON, H. G. Afrotropical ants (Hymenoptera: Formicidae): taxonomic progress

and estimation of species richness 71

SCHAUFF, M. E. and R. GARRISON. An introduced species of Epichrysocharis (Hymenop-
tera: Eulophidae) producing galls on Eucalyptus in California with notes on the
described species and placement of the genus 176

SHARKEY, M. J., K. FTNNELL, J. LEATHERS, and J. FRANA. Microgastrine (Hymenoptera:

Braconidae) parasitoids of Colias lesbia (Fabricius) (Lepidoptera: Pieridae) 108

UBAIDILLAH, R., J. LaSALLE, and D. L. J. QUICKE. A peculiar new genus and species

of Entedoninae (Chalcidoidea: Eulophidae) from Southeast Asia 170

WARD, P. S. On the identity of Pheidole vaslitii Pergande (Hymenoptera: Formicidae), a

neglected ant from Baja California 85

NOTES

PULAWSKI, W. J. and A. P. RASNITSYN. Cretobestiola, a replacement name for Bestiola

Pulawski and Rasnitsyn, 1999 (Hymenoptera: Sphecidae) 209

SIME, K. R. Two new records of pimpline ichneumonids attacking Battus philenor

(Linnaeus) (Lepidoptera: Papilionidae) 210

itfhoClETy

Journal of

Hymenoptera
Research

IBRAR^S
Volume 9, Number 2 ^ October 2000

ISSN #1070-9428
CONTENTS

AZEVEDO, C. O, J. C. SILVA-Jr, and L. A. de O. CAMPOS. Description of a new species
of Emersonella (Hymenoptera: Eulophidae) from Brazil, with prelimary observations
on its biology 298

BAPTISTE, L. A. and L. S. KJMSEY. New Caledonian Tiphiidae: revision of the genus Eirone

(Hymenoptera: Thynninae) 395

CONTI, E., P. F. ROVERSI, and F. BIN. Morphofunctional adaptations of parasitoids

attacking concealed eggs of two arboreal mirids in Italy 385

DELVARE, G. and J. LaSALLE. Trisecodes gen. n., (Hymenoptera: Eulophidae: Entedoninae),

the first eulophid with three tarsal segments 305

DIAZ; F. A. The Venezuelan species of Pimpla (Hymenoptera: Ichneumonidae) 246

EBERHARD, W. G. The natural history and behavior of Hymenoepimecis argyraphaga
(Hymenoptera: Ichneumonidae) a parasitoid of Plesiometa argyra (Araneae:
Tetragnathidae) 220

EDGAR, P. K. and J. R. COELHO. Load-lifting constraints on provisioning and nest build-
ing in the carpenter wasp, Monobia quadridens L. (Hymenoptera: Eumenidae) .... 370

FORTIER, J. C. Description of a new gregarious species of Aleiodes Wesmael (Hymenoptera:

Braconidae: Rogadinae) 288

GAULD, I. D. The re-definition of pimpline genus Hymenoepimecis (Hymenoptera: Ich-
neumonidae) with a description of a plesiomorphic new Costa Rican species .... 213

HANSSON, C. Description of a new genus of Entedoninae (Hymenoptera: Eulophidae)

from the Neotropical Region, including three new species 313

JOHNSON, R. A. Reproductive biology of the seed-harvester ants Messor julianus (Per-
gande) and Messor pergandei (Mayr) (Hymenoptera: Formicidae) in Baja California,
Mexico 377

(Continued on back cover)

INTERNATIONAL SOCIETY OF HYMENOPTERISTS

Organized 1982; Incorporated 1991

OFFICERS FOR 2000

Andrew D. Austin, President

John LaSalle, President-Elect

James B. Woolley, Secretary

John T. Huber, Treasurer

E. Eric Grissell, Editor

Subject Editors
Symphyta and Parasitica Aculeata

Biology: Mark Shaw Biology: Sydney Cameron

Systematics: Donald Quicke Systematics: Wojciech Pulawski

All correspondence concerning Society business should be mailed to the appropriate officer at the
following addresses: President, Department of Crop Protection, University of Adelaide, Glen Os-
mond, Australia 5064; Secretary, Department of Entomology, Texas A&M University, College
Station, Texas 77843; Treasurer, Eastern Cereal & Oilseed Research Centre, Agriculture Canada,
K. W. Neatby Building, Ottawa, Ontario, Canada Kl A 0C6; Editor, Systematic Entomology Labo-
ratory, USD A, % National Museum of Natural History, Washington, D.C 20560-0168.

Membership. Members shall be persons who have demonstrated interest in the science of ento-
mology Annual dues for members are US$40.00 per year (US$35.00 if paid before 1 February),
payable to The International Society of Hymenopterists. Requests for membership should be sent
to the Treasurer (address above). Information on membership and other details of the Society
may be found on the World Wide Web at http://IRIS.biosci.ohio-state.edu/ish.

Journal. The Journal of Hymenoptera Research is published twice a year by the International Society
of Hymenopterists, % Department of Entomology, Smithsonian Institution, Washington, D.C.
20560-0168, U.S.A. Members in good standing receive the Journal. Nonmember subscriptions are
$60.00 (U.S. currency) per year.

The Society does not exchange its publications for those of other societies.

Please see inside back cover of this issue for information regarding

preparation of manuscripts.

Statement of Ownership

Title of Publication: Journal of Hymenoptera Research.

Frequency of Issue: Twice a year.

Location of Office of Publication, Business Office of Publisher and Owner: International Society
of Hymenopterists, % Department of Entomology, Smithsonian Institution, 10th and
Constitution NW, Washington, D.C. 20560-0168, U.S.A.

Editor: E. Eric Grissell, Systematic Entomology Laboratory, USDA, % National Museum of Nat-
ural History, Washington, D.C. 20560-0168.

Managing Editor and Known Bondholders or other Security Holders: none.

This issue was mailed 27 October 2000

J. HYM. RES.
Vol. 9(2), 2000, pp. 213-219

The Re-definition of Pimpline Genus Hymenoepimecis (Hymenoptera:
Ichneumonidae) with a Description of a Plesiomorphic New

Costa Rican Species

Ian D. Gauld
The Natural History Museum, Cromwell Road, London SW7 5BD, UK

Abstract. — An aberrant new species of the Neotropical genus Hymenoepimecis, H. argyraphaga
Gauld n. sp. is described from Costa Rica, and the genus is redefined to accommodate this new
taxon. A key is provided to identify the Costa Rican species. It is hypothesised that H. argyraphaga
occupies a basal position in the genus, and is the sister group to all other species. The systematic
position of Hymenoepimecis within the Polysphincta genus-group is discussed and a sister-group
relationship with Acrotaphus, another New World genus, is demonstrated. It is suggested that this
clade has arisen from within a paraphyletic "Polysphincta" complex, a cosmopolitan group that
has yet to be resolved as a series of monophyletic taxa. Host records for the clade are summarised,
and it is shown that the group are specialist parasitoids of orb-web spiders of the families Ara-
neidae and Tetragnathidae.

Hymenoepimecis is an exclusively neo-
tropical genus of ichneumonid wasps that
belongs to the Polysphincta complex of
genera, the "Polysphinctini" seiisu Townes
(1969), a monophyletic clade that has aris-
en from within the pimpline tribe Ephial-
tini (Wahl and Gauld, 1998). This clade is
biologically unique within the Ichneu-
monidae because all members are koino-
biont ectoparasitoids of spiders (Fitton et
al. 1988; Gauld 1991; Gauld et al. 1998).
Elsewhere in the Hymenoptera such an as-
sociation is only known in a few Pompi-
lidae (Wasbauer 1995). The female ichneu-
monid temporarily paralyses a spider by
stinging it, and then attaches an egg either
to the cephalothorax (the Schizopyga/
Dreisbachia subgroup) or to the abdomen
(the Polysphincta and Zatypota subgroups).
The ichneumonid larva develops as an ec-
tophagous parasitoid on the active spider.
The Hymenoepimecis of southern Mesoa-
merica are reasonably well-known (Gauld
1991; Gauld et al. 1998), but recently, a
new species of has been found in Costa
Rica which possesses certain plesiomorph-
ic features that necessitate redefining the

genus. The purpose of this paper is to do
this, and to describe and characterise this
new species, in order to provide a taxo-
nomic background for the following paper
(Eberhard, 2000) which describes the bi-
ology of these fascinating insects.

Genus Hymenoepimecis Viereck

Epimecis Brulle 1846: 112. Type-species: Epimecis
bicolor Brulle, designated by Ashmead 1900:
54. Qunior homonym of Epimecis Hiibner.]

Hymenoepimecis Viereck 1912: 149. [Replace-
ment name for Epimecis Brulle.]

Diagnosis. — Medium to large insects
(fore wing length 6-14 mm) which are
generally orange with black marking, with
the wings from more or less hyaline to
completely black, occasionally black and
yellow patterned. Head somewhat glo-
bose, though abruptly declivous posteri-
orly; clypeus simple, not transversely di-
vided, flat, apically truncate or slightlv
concave; mandible slender, strongly ta-
pered with upper tooth distinctly the lon-
ger; palp formula 5:4; occipital carina very
strong, dorsallv convex, flange-like, con-
tinuous to base of mandible, with part just

214

Journal of Hymenoptera Research

below level of foramen magnum expand-
ed to approach its counterpart below neck
in some species; eyes large; antennae long
and slender. Pronotum in profile from
moderately to exceptionally long, with an-
terior margin reflexed, projecting below
the occipital flange, with part immediately
behind this modified into a anteriorly
opening "pocket-like" structure; epomia
entirely absent. Mesoscutum smooth and
polished, more or less glabrous; notauli
weakly to moderately impressed; meso-
pleuron polished, with epicnemial carina
from completely absent to present ven-
trally, but laterally not reaching above lev-
el of lower corner of pronotum; metapleu-
ron polished, with submetapleural carina
usually absent, sometimes present anteri-
orly; propodeum quite short and evenly
rounded posteriorly, without discernible
carina, except for vestiges peripherally,
but never with any enclosed areae; pro-
podeal spiracle more or less circular. Legs
slender, but with fore legs variously de-
veloped, sometimes of similar size to mid-
dle legs, but often enlarged and with the
fore femur conspicuously larger than mid-
dle femur; claws of female with large bas-
al lobe, which in many species is high and
short, but in one large South American
species group is long and low, almost
tooth-like; claws of male simple, with a
small internal membranous vesicle. Fore
wing with 3rs-m entirely absent, but al-
ways with 2rs-m quite long; hind wing
with first abscissa of M+Cul straight or
weakly angled proximal to its centre; dis-
tal abscissa of Cu\ present, joining cu-a
from slightly to conspicuously closer to M
than to 1A Metasoma slender, depressed,
polished and more or less impunctate; ter-
gite II with weak to strong oblique im-
pressions anterolaterally, tergites III-IV
with weak lateromedian convexities; ovi-
positor with a distally angulate basal
swelling ventrally, with shaft from more
or less straight to slightly up-curved, 1.0-
1.4 times the length of the hind tibia,

weakly swollen centrally, apically elon-
gately tapered to a fine sharp point.

Remarks. — Hymenoepimecis is a Central
and South American genus, comprising
eight described species (Yu and Horst-
mann 1997). Approximately ten unde-
scribed species are known mainly from
lowland or mid-altitude South America,
occurring between sea-level and 1800 me-
tres (in collections of American Entomo-
logical Institute, Gainesville, and The Nat-
ural History Museum, London). The geo-
graphical range of the genus extends from
tropical Mexico and Cuba south to sub-
tropical Southern Brazil (c. 29°S). In earlier
systematic works (e.g., Townes 1969), the
genus has been described as lacking both
the epicnemial and submetapleural cari-
nae, but recently an exception has been
found in Costa Rica. This somewhat ab-
errant species has a discernible epicnemial
carina and a more or less fully developed
submetapleural carina. However, its ge-
neric placement is attested by the posses-
sion of two autapomorphies of Hymenoe-
pimecis. First, the pronotum is mediodor-
sally modified to have a unique anteriorly
opening "pocket-like" flange just behind
the reflexed anterior margin. Second, the
fore legs are enlarged, with the femora
slightly larger than the middle femur.
These apomorphies are unique within the
Pimplinae, and strongly suggest that the
slightly expanded Hymenoepimecis is a
monophyletic group.

Systematic position. — Hymenoepimecis be-
longs to the Polysphincta genus-group ( =
Polysphinctini sensu Townes 1969), a
clearly definable monophyletic clade of
Ephialtini (Wahl and Gauld 1998). It is pu-
tatively the sister group of another pri-
marily Neotropical genus, Acrotaphus, a
relationship that is supported by three au-
tapomorphies. First, the occipital carina is
strongly raised, flange-like, and projects
posteriorly to surround the anterior re-
flexed end of the pronotum. Second, the
head is rounded (more or less "door-knob
shaped") with the genae strongly nar-

Volume 9, Number 2, 2000

215

other
■' Polysphincta" spp

Polysphincta
dizardi sp-grp

Acrolaphus

Hymenoepimecis
argyraphaga

other
Hvmenoepimecis spp

Fig. 1. Cladogram summarizing hypotheses of relationship of Hymenoepimecis argyraphaga. The derived fea-
tures supporting these clades are: (1) long straight ovipositor with an angulate basal swelling; metasomal
tergites II-III biconvex: (2) absence of epomia; enlarged ocelli and eyes: (3) occipital carina is strongly raised,
flange-like, projecting backwards to surround the anterior reflexed end of the pronotum; head rounded with
genae strongly narrowed from eyes to occipital flange; pronotum unusually elongate, with a long horizontal
part mediodorsally: (4) pronotum mediodorsally with a forwardly directed "pocket-like" flange; fore legs
enlarged, with the femora of similar size to or larger than the mid femur: (5) presence of a horizontal pronotal
"shelf": (6) cocoon without a caudal orifice: (7) wings uniformly blackish: (8) loss of epicnemial carina; loss
of submetapleural carina. All characters are polarized with reference to the condition in Tromatobia.

rowed from the eyes to the occipital
flange. Third, the pronotum is unusually-
elongate, with a long horizontal part me-
diodorsally.

The Hymenoepimecis/ Acrotaphus clade is,
in its turn, the sister group of yet another
Neotropical group, the Polysphincta dizardi
species-group (Gauld 1991). All three of
these taxa lack any trace of an epomia,
and are slender, highly polished insects
with enlarged eyes and ocelli.

This entire lineage is part of the Polys-
phincta subgroup, a large cosmopolitan
group of species that is characterized by
having a uniquely basally swollen, ovi-
positor, and possessing biconvex metaso-
mal tergites II-IV. The detailed phylogeny
of this clade has yet to be fully resolved,
but the genus Polysphincta (sensu Townes,
1969 and all subsequent authors) is appar-
ently a paraphyletic assemblage, although

most of the species-groups within it are
demonstrably monophyletic (Gauld 1991;
Gauld et al. 1998) (Fig. 1).

All recorded hosts of the Polysphincta
subgroup (i.e., "Polysphincta" s.l., Acrota-
phus and Hymenoepimecis) are orb- web spi-
ders of the families Araneidae and Tetrag-
nathidae (Nielsen 1923; Townes and
Townes, 1960; Fitton et al. 1988; Fincke et
al. 1990; Gauld 1991). All records of "Po-
lysphincta" are from Araneidae (e.g.
Townes and Townes 1960; Fitton et al.
1988; unpublished records in Natural His-
tory Museum, London), whereas various
species of Acrotaphus and Hymenoepimecis
have been reared either from Araneidae or
Tetragnathidae (Shannon 1913; Gauld et
al. 1998; Eberhard 2000).

Costa Rican species. — Despite a very in-
tensive country-wide sampling pro-
gramme (Hanson and Gauld, 1995), spe-

216

Journal of Hymenoptera Research

cies of Hytnenoepimecis are rather seldom
collected in Costa Rica. Three species have
been recorded (Gauld et al. 1998), but re-
cently a fourth, undescribed species has
been found on the Pacific coastal plain.
Unusually for parasitoids, the majority of
the Costa Rican Hytnenoepimecis specimens
in collections (25 out of 36) have been
reared, rather than field-collected. Hosts
are known for all of the four Costa Rican
species. Hytnenoepimecis tedfordi Gauld has
not uncommonly been reared by W.G.
Eberhard as a parasitoid of Leucauge mar-
iana (Keyserling) (Tetragnathidae) (Gauld
1991), several specimens of H. robertsae
Gauld have been found in Panama para-

sitizing Nephila clavipes (L.) (Tetragnathi-
dae) (Fincke et al. 1990) and a single indi-
vidual of the apparently rare H. heidyae
Gauld has also been reared by W.G. Eber-
hard at La Selva, from Cyrtophora nympha
(Simon) (Araneidae). The new species has
been reared from by W.G. Eberhard from
Plesiometa argyra (Walckenaer) (Tetrag-
nathidae).

As mentioned above, the new species
differs strikingly from all previously de-
scribed Hytnenoepimecis in possessing a
number of plesiomorphic features. It is de-
scribed below, after a key which will fa-
cilitate its separation from other, sympat-
ric species.

KEY TO SPECIES OF HYMENOEPIMECIS PRESENT IN COSTA RICA

1. Fore wing uniformly blackish; submetapleural carina discernible, reaching at least 0.5 times
length of metapleuron (Fig. 2); epicnemial carina present ventrally, although not laterally
extended far onto mesopleuron argyraphaga Gauld, sp. n.

- Fore wing more or less hyaline, at most slightly infumate distally; submetapleural carina
more or less absent (Fig. 3), at most discernible as a small denticle on extreme anterior
margin of metapleuron; epicnemial carina only discernible as weak swellings ventrally
either side of mid-line 2

2. Metasoma with tergites all entirely black; sternite I with a low, rounded swelling poste-
riorly; pronotum long, so that distance from tegula to head is about 0.6 times distance
from tegula to hind margin of propodeum tedfordi Gauld

- Metasoma with tergites predominantly orange; sternite 1 with a large acute or nasute
protuberance near posterior margin (Fig. 3); pronotum exceptionally long, so that distance
from tegula to head is greater than 0.7 times distance from tegula to hind margin of
propodeum 3

3. Hind coxa and femur orange; sternite I with an acute, thorn-like ventral projection; female
with ovipositor 1.0-1.2 times as long as hind tibia; hind leg slender, with tibia and tarsus
combined, more than 0.9 times fore wing length robertsae Gauld

- Hind coxa and femur extensively black; sternite I with a high laterally compressed nasute
ventral protuberance; female with ovipositor 1.3-1.4 times as long as hind tibia; hind leg
fairly stout, with tibia and tarsus combined about 0.6 times fore wing length

heidyae Gauld

Hytnenoepimecis argyraphaga Gauld, head in dorsal view with gena long,

sp. n. strongly but evenly narrowed behind

eyes; ocelli of moderate size, the lateral

Female.— lower face elongate 0.8 times one separated from eye by about 0.7 times

as broad as high (from clypeofacial suture jts own maximum diameter; lower end of

to base of antenna), flat, centrally smooth occipital carina only very weakly raised,

and impunctate, laterally with fine setifer- not produced mesally to approach its

ous punctures bearing long fine hairs; counterpart on the midline. Pronotum

Volume 9, Number 2, 2000

217

Fig. 2-3. 2, Hymenoepimecis spp. 2, //. argyraphaga, head, and mesosoma, lateral. Note the comparatively
plesiomorphic body shape, in comparison with Fig. 3. 3, H. robertsac, head, and mesosoma, lateral, showing
typical body form of members of this genus.

long so that distance from tegula to head present ventrally, weak but extending

is about 0.6 times the distance from tegula across the ventral portion of the mesoso-

to hind margin of pronotum; scutellum in ma so that it is just visible in profile; me-

profile strongly convex; mesopleuron tapleuron quite convex, smooth and pol-

smooth and polished; epicnemial carina ished, glabrous; submetapleural carina ex-

218 Journal of Hymenoptera Research

tending at least 0.5 of length of pleuron, i.1996 (Eberhard) (Natural History Muse-
usually more or less complete; propo- urn, London). Paratypes: 3 9, 3 6, same
deum smooth, laterally with very fine se- locality as holotype (Eberhard) (American
tiferous punctures. Fore wing length 8.0- Entomological Institute, Natural History
8.5 mm; cu-a slightly distal to base of Museum, London and INBio, Santo Do-
Rs&M; Irs-m about 0.6 times as long as mingo, Costa Rica).

abscissa of M between 2rs-m and 2m-cu; Remarks. — Hymenoepimecis argyraphaga
hind wing with abscissa of Cul between may easily be recognized in Costa Rica by
M and cu-a 0.3-0.4 times as long as cu-a. its black wings. I have seen no other spe-
Hind leg moderately long and slender cies, described or undescribed with uni-
with tibia plus tarsus 0.6 times the fore formly black wings, although several
wing length; hind tarsal claws short, with South American species, including H. het-
a deep basal lobe (this condition is com- eropus (Kriechbaumer) have black and yel-
mon to all Costa Rican species, but in low patterned wings. Hymenoepimecis ar-
South America a large number have the gyraphaga is also the only species I have
claw unusually long, and the lobe low, seen in the genus with discernible epic-
sometimes tooth-like). Metasoma moder- nemial and submetapleural carinae, and
ately slender, tergite I 1.4-1.5 times as unlike other species it does not have the
long as posteriorly broad, centrally evenly lower end of the occipital carina produced
convex, with lateral carinae present only mesally more or less to meet its counter-
anteriorly bordering the anterior concavi- part medioventrally and partially close the
ty; sternite I with a low rounded medio- oral fossa. The possession of these pie-
ventral prominence; tergite II 1.1-1.2 times siomorphic features strongly suggests H.
as long as posteriorly broad, with weak argyraphaga is one of the more basal spe-
oblique grooves anterolaterally; tergite III cies in the genus. This is supported by oth-
about 1.2 times as long as posteriorly er features. H. argyraphaga has short, deep
broad with a median anterior swelling, hind tarsal claws, like Acrotaphus, whereas
centrally glabrous and with scattered hairs most South American species have highly
around the periphery of the tergite; ter- modified long, low claws with a tooth-like
gites IV-V similar in sculpture and pilosi- basal lobe. Additionally sternite I of this
ty; ovipositor 1.0-1.1 times as long as hind species is not modified but it generally has
tibia. a thorn-like protuberance in other species.

Head black with mouthparts yellowish Furthermore, although enlarged, the fore

brown; antenna blackish; mesosoma or- legs of H. argyraphaga are not as massive

ange-brown; metasoma with anterior two as many of the apparently more derived

or three tergites orange anteriorly and species in the genus.

broadly infuscate posteriorly, the area of These preliminary suggestions about
infuscation increasing in extent and inten- both the phylogenetic position of H. argyr-
sity on each tergite progressively towards aphaga within Hymenoepimecis and of this
the hind end, which has the tergites black; genus with respect to others in the genus-
ovipositor sheath black. Anterior two group, have important implications for
pairs of legs orange-brown, the hind legs understanding the evolution of biological
blackish, with bases of coxae brownish, traits within this uniquely adapted group
Wings blackish infumate, pterostigma and of ichneumonids.
veins black.

Male.— similar to female in structure ACKNOWLEDGMENTS

and colour; claspers black. . ., . D.„ „ , , , ,, . , , . .

r 1 thank bill Eberhard for allowing me to study nis

Material examined.— Holotype 9, Costa reared specimens. David x. Wahl and l are collabo-

Rica, Puntarenas Province, Parrita, 20 m, rating closely in an attempt to unravel the phyloge-

Volume 9, Number 2, 2000

219

netic interrelationships of the Pimplinae, and the dis-
cussion above has benefited from his insight. I thank
David Wahl and Andy Bennett for their comments
on the manuscript.

LITERATURE CITED

Ashmead, W. H. 1900. Classification of the ichneu-
mon flies, or the superfamily Ichneumonoidea.
Proceedings of the United States National Museum
23: 1-220.

Brulle, A. 1846. Hymenopteres, 4. In: Lepeletier de
Saint-Fargeau, A. (ed.) Histoirc Naturelle des In-
sectes. Paris. 680pp.

Eberhard, W. G. 2000. The natural history and behav-
ior of Hymenoepimecis argyraphdga (Hymenoptera:
Ichneumonidae) a parasitoid of Plesiometa argyra
(Araneae: Tetragnathidae). Journal of Hymenoptera
Research 9: 220-240.

Fincke, O. M., Higgins, L. and Rojas, E. 1990. Para-
sitism of Nephila chwipes (Araneae, Tetragnathi-
dae) by an ichneumonid (Hymenoptera, Polys-
phinctini) in Panama. Journal of Arachnology 18:
321-329.

Fitton, M. G., Shaw, M. R. and Gauld, I. D. 1988.
Pimpline ichneumon-flies (Hymenoptera, Ich-
neumonidae, Pimplinae). Handbook for Identifica-
tion of British Insects 7(1): 1-110.

Gauld, I. D. 1991. The Ichneumonidae of Costa Rica,
1. Memoirs of the American Entotnological Institute
47: 1-589.

Gauld, I. D., Ugalde-Gomez, J. A. and Hanson, P. E.

1998. Gui'a de los Pimplinae de Costa Rica. Re-
vista Biologia Tropical 46 (Supplement 1): 1-189.

Hanson, P. E. and Gauld, I. D. 1995. The Hymenoptera
of Costa Rica. Oxford University Press, Oxford.
893 pp.

Nielsen, E. 1923. Contributions to the life history of
the pimpline spider parasites (Polysphincta, Zag-
lyptus, Tromatobia) (Hym. Ichneum.). Entomologis-
ke Meddelelser 14: 137-205.

Shannon, R. C. 1913. Epimecis wiltii Cresson and its
host. Proceedings of the Entomological Society of
Washi)igton 15: 162.

Townes, H. 1969. Genera of Ichneumonidae 1. Mem-
oirs of the American Entomological Institute 11: 1-
300.

Townes, H. and Townes, M. 1960. Ichneumon-Flies
of America North of Mexico: 2. Subfamilies
Ephialtinae, Xoridinae, Acaenitinae. United States
National Museum Bulletin 216 (2): 1-676.

Viereck, H. L. 1912. Descriptions of five new genera
and twenty-six new species of Ichneumon-flies.
Proceedings of the United States National Museum
42: 139-153.'

Wahl, D. and Gauld I. D. 1998. The cladistics and
higher classification of the Pimpliformes (Hy-
menoptera: Ichneumonidae). Systematic Entomol-
ogy 23: 265-298.

Wasbauer, M. S. 1995. Pompilidae, pp. 522-539. In:
Hanson, P.E. and Gauld, I.D. The Hymenoptera of
Costa Rica. Oxford University Press, Oxford. 893
pp.

Yu, D. and Horstmann, K. 1997. Catalogue of world
Ichneumonidae (Hymenoptera). Memoirs of the
American Entomological Institute 58: 1-1558.

J. HYM. RES.

Vol. 9(2), 2000, pp. 220-240

The Natural History and Behavior of Hymenoepimecis argyraphaga
(Hymenoptera: Ichneumonidae) a Parasitoid of Plesiometa argyra

(Araneae: Tetragnathidae)

William G. Eberhard

Smithsonian Tropical Research Institute, and Escuela de Biologia, Universidad de Costa Rica,

Ciudad Universitaria, Costa Rica

Abstract. — Larvae of the koinobiont ectoparasitoid Hymenoepimecis argyraphaga Gauld used a
series of different adaptations as they matured to hold onto the abdomen of their host spider,
Plesiometa argyra, its web, and the larval cocoon: the first instar did not leave the egg chorion,
which was glued to the spider by the female wasp when she oviposited; the second instar used
two pairs of ventral abdominal protuberances to help hold onto both the first larva's molted cuticle
and to what was probably a sheet of coagulated spider hemolymph that adhered to the larva and
to wounds that it made on the spider's abdomen; the early final instar grasped the shed second
instar cuticle that remained attached to the coagulated hemolymph with the ventral surface of its
abdomen; and the late final instar used a row of mobile dorsal protuberances with sharply curved
spines that grasped lines of a unique web that the larva induced the spider to spin just before
killing it, and then the larva's own cocoon silk. The pupa used a pair of toothed protuberances
at the tip of the abdomen to stay at the upper end of its cocoon. Other aspects of the wasp's
biology that are described include infanticide by adult females; aculeate-like lack of use of the
ovipositor to oviposit; manipulation of host web-spinning behavior, apparently by means of a
fast-acting larval secretion with long-term effects; manipulation of host bleeding; alternative tactics
in attacks on spiders; use of pheromones by females to attract males; cocoon spinning behavior;
and a bias to parasitize female rather than male spiders.

Although Ichneumonidae is undoubt- species resembles that of some European
edly one of the largest of all animal fam- polysphinctines. It is an external koino-
ilies, remarkably little is known about the biont on a spider, the tetragnathid Nephila
behavior of the larvae. Excluding studies clavipes (L.). The female temporarily par-
of foraging behavior, adult behavior is alyzes the host by stinging it in the ceph-
also poorly studied (e.g., Hanson and alothorax, and then glues an egg on its ab-
Gauld 1995). The neotropical polysphinc- domen. Spiders with a wasp egg or a
tine pimplines are no exception. The more young larva are active, and build appar-
derived polysphinctines are known to be ently normal prey capture webs and feed
koinobiont ectoparasitoids of spiders while the larva feeds by sucking the spi-
(Gauld 1995, Wahl and Gauld 1998), and der's hemolymph and gradually matures,
several European species were observed The spider's webs become more irregular
in careful detail by G. C. Bignell (1898) and reduced one to two days before the
and E. Nielsen (1923, 1928, 1929, 1935). larva kills it and constructs its pupal co-
There is apparently only a single study of coon, which is attached to the spider's
a neotropical species, that of Fincke et al. web. A second species, H. tedfordi Gauld,
(1990) on Hymenoepimecis robertsae Gauld parasitizes another tetragnathid spider,
(for probable identification see Gauld etal. Leucauge marinae Keyserling (Gauld et al.
1998). The general natural history of this 1998), but nothing more is known about

Volume 9, Number 2, 2000

221

Table 1. Degree of development of eggs in the ovaries (6-7 ovarioles/ ovary) of female wasps of different
ages (N = number of wasps; W = white eggs apparently ready to be laid, Y = yellow, still-immature eggs;
uric acid determined on arbitrary scale of 0-3).

Age of wasp

outside cocoon

(hrs)

Mean length and coll

>r <i\ eggs (mm)

Amount

of uric

acid

Largest (basal) egg
in each ovariole

Color

Second

largest egg

Color

6-12

0.15 ± .18

2, 3

0.22 ± .20

1,2,2

approx. 36

0.82 ± .04

0.27 ± .02

approx. 60

0.59 ± .27

W/Y

0.08 ± .17

I, 1

approx. 72

0.84 ± .02

0.68 ± .21

0, 1

approx. 84

0.84 ± .05

0.56 ± .14

0, 0

its behavior. The present observations
concern a third, newly discovered species,
H. argi/raphaga Gauld (Gauld 2000).

MATERIALS AND METHODS

Field observations were made in Janu-
ary and February of 1999 and 2000 in the
undergrowth of plantations of approxi-
mately 10-15 m tall African oil palms
(Elaeis guianensis) near Parrita, Puntarenas
Province, Costa Rica (elevation about 20
m). Spiders were checked for parasites in
the field with a 10 X hand lens while hold-
ing the spider by its legs, and some wasp
attacks were observed using a 2X head-
band magnifier. Spiders and immature
stages of the wasps were transported to
San Antonio de Escazu (1300 m), and
reared there. All observations were at
room temperature, and durations of some
immature stages of the wasps may be
slight overestimates, due to the lower tem-
peratures in San Antonio. Dissections and
measurements were made using recently
killed individuals in saline solution.
Bleeding and coagulation were studied by
poking a minuten pin through the abdom-
inal cuticle of mature female spiders.

Video recordings of behavior were
made using a Sony CCD-TR700 camcord-
er with + 7 closeup lenses. Voucher spec-
imens of wasps have been deposited in
the The Natural History Museum, Lon-
don, the Museo de Insectos of the Univ-
ersidad de Costa Rica, and the U. S. Na-
tional Museum of Natural History. Spe-

cies names follow Fitton et al. 1988, and
Gauld et al. 1998. The species observed by
Bignell (1898) is cited as an undetermined
polysphinctine because of confusion re-
garding its identity (M. Shaw, pers.
comm.).

RESULTS
Adults

Maturation of eggs. — Dissections of fe-
males kept with access to water and honey
after they emerged as adults showed that
females emerged without any well-devel-
oped eggs, but with massive fat bodies
that contained large amounts of small
white pellets (presumably uric acid) (Ta-
ble 1). Over the next 3-4 days the fat and
uric acid diminished, and the yellow de-
veloping eggs gradually grew and
changed to large, whitish eggs that were
apparently ready to lay. Eggs matured one
by one, rather than synchronously, both
within a given ovariole and in different
ovarioles.

Sexual behavior. — Males were seen re-
peatedly in the field. They flew slowly,
and did not stay in any given area. They
repeatedly hovered near the tips of leaves
at the tops of undergrowth plants. Their
flight patterns were inappropriate to en-
counter pupal cocoons, which were gen-
erally lower and deeper in the vegetation.
Males showed no signs of sustained ag-
gression when they encountered each oth-
er, although one male flew into and

222 Journal of Hymenoptera Research

knocked another from his perch on a leaf ered about 10-30 cm from the spider, fac-

tip. ing toward it as it rested at the hub of its

Two interactions between males and fe- more or less horizontal orb for several sec-
males were observed in the field. Both in- onds. Usually the attack was launched
volved virgin females that had recently from about 10-15 cm above the spider,
emerged from their cocoons. Each female The wasp darted rapidly at the spider and
rested on the side of her cocoon for at least grasped it through the web with her legs.
90 min, where she eliminated small white The wasp did not consistently strike from
masses (presumably uric acid) and peri- downwind of the spider, and in one case
odically cleaned herself. No males ap- she first hovered at one side of the spider,
proached the females as they rested on then flew over it, turned 180° to face it
their cocoons. Eventually each female flew again, and attacked from the other side.
1-2 m and landed on the tip of a leaf Thus at least the final stage of host local-
about 1.5 m above the ground, near the ization appeared to depend on visual rath-
top of the undergrowth. Close inspection er than chemical cues. Wasps were more
of one of the females using the headband likely to attack larger spiders (see section
magnifier as she rested on the plant failed below on parasitism rates),
to reveal any obvious sign of pheromone There was always a brief struggle dur-
emission (extension of abdomen, drops of ing which it was not possible to resolve
liquid, eversion of membranous sac). Nev- exactly what was happening; probably the
ertheless, one female had only been on the wasp jabbed rapidly and forcefully with
leaf for about 65 s when a male arrived, her ovipositor while she grasped the spi-
The wind was too slow and erratic to de- der with her legs. When I was finally able
termine whether or not he arrived from to resolve the animals' positions (usually
downwind. He landed directly on the fe- after 10 s or less), the wasp's ovipositor
male, and immediately curled his abdo- was inserted into the anterior end of the
men forward ventrally and copulated. Af- spider's cephalothorax; in four cases it
ter 5-10 s, the female began to walk, the was apparently thrust into the spider's
male gave a couple of brief buzzes of his mouth, in two it was just to the side of
wings, the pair separated, and both wasps one chelicera, and in another it was on the
flew away. anterior side of the spider's first coxa. This

The second virgin female moved from first long sting lasted for up to 120 s, dur-

one leaf tip to another twice before being ing which the spider's struggles gradually

approached by a male. This male flew per- became less vigorous. In two attacks on

sistently from tip to tip of the pinnules of relatively small spiders the sting was only

a palm leaf that was just downwind of the about 10-20 s. After withdrawing her ovi-

female, landing briefly on each. Then he positor, the wasp performed a series of ap-

flew about 1 m upwind and returned to parent jabs with her ovipositor, and in two

search again. On his third or fourth ap- cases she inserted it again into the spider's

proach the male encountered the plant on cephalothorax. By this time the spider

which the female was resting, and landed rested completely immobile at the hub of

near her. She immediately took flight, and its web (Fig. 1). Paralysis generally lasted

the male continued to investigate leaf tips for approximately 5-10 min.

in the vicinity for about 1 min more before The wasp then positioned herself under

moving on. the spider's abdomen, facing posteriorly

Hunting for spiders. — I witnessed 14 at- (Fig. 1), and bent her abdomen ventrally

tacks (eight successful) in their entirety, and repeatedly wiped, jabbed and rubbed

and parts of five others. The early stages with the distal portion of her ovipositor

of all attacks were similar. The wasp hov- for as long as several minutes over the an-

Volume 9, Number 2, 2000

223

tip of
ovipositor

site where
egg emerged
r>-

Fig. 1. Diagrammatic illustration of a female wasp
hanging on paralyzed spider at the hub of its web
and ovipositing at the point indicated (drawn from
field notes; it is not certain whether the wasp's tarsi
held the spider, as in the drawing, or the web just
above it).

terior and dorsal surface of the spider's
abdomen. These probing movements
probably served to locate, perhaps to
sting, and to dislodge the eggs or larvae
of previous wasps that had attacked this
spider. In one case, repeated probing
movements of the ovipositor in the vicin-
ity of a first instar or early second instar
larva may have included one or more in-
sertions of the ovipositor into the larva,
and they finally resulted in the larva being
levered off of the spider's abdomen and
onto the middle portion of the wasp's ovi-
positor. The wasp then knocked off the
larva to the ground with cleaning move-
ments, and soon afterward laid an egg of
her own. In two other cases an egg (iden-
tity confirmed by subsequent collection)
was moved onto the middle of the ovi-
positor and then fell to the ground.

Of 16 parasitized spiders collected in
1999 with eggs or first instar larvae on
their abdomens, four gave further evi-
dence that larvae are sometimes removed:

there were one or more groups of larval
feeding scars on portions of the abdomen
that were inaccessible to the current larva
in two cases, and there were larval feeding
scars but no larvae and only an egg in two
others. In contrast, only one spider was
doubly parasitized, carrying both an egg
and a second instar larva. Similar data
from 2000 gave even more dramatic evi-
dence of infanticide. Of 55 mature female
spiders, nearly half (26) had at least one
patch of feeding and bleeding scars on her
abdomen (the total of additional patches
was 43; the maximum on one spider was
four). Only three spiders were doubly par-
asitized. It should be noted that these data
undoubtedly underestimate the frequency
of infanticide, because removal of eggs
from hosts cannot be detected using feed-
ing scars.

Finally the wasp oviposited. Holding
her ovipositor sheaths elevated dorsally
and her ovipositor pressed against the an-
terior surface of the spider's abdomen
(Fig. 1), she pressed the tip of her abdo-
men near the surface of the spider's ab-
domen briefly. The egg emerged from the
tip of her abdomen (and not from the tip
of her ovipositor), and adhered to the spi-
der's abdomen. Within about 30 sec after
ovipositing the wasp flew away. In no
case did a wasp give any sign of attempt-
ing to feed on the spider. Although eggs
were generally placed on the anterior dor-
sal surface of the spider's abdomen, the
exact sites varied widely (Fig. 3). The oval
egg was glued tightly on its ventral side
to the spider's abdominal cuticle. Two
eggs which were observed being laid and
then inspected periodically hatched be-
tween 48 and 72 hours later.

An incomplete observation of one inter-
action indicated that the wasps have an
alternative hunting strategy that depends
on deceiving the spider. When they were
first encountered, the spider was resting at
the edge of its orb, and the wasp was
hanging immobile from radii in the free
zone near the hub, facing downward with

224

Journal of Hymenoptera Research

Fig. 2. Evidence of two infanticides. The anterior
surface of the abdomen of a P. argyra spider bears a
wasp egg, and two arrays of feeding and bleeding
scars (dark spots) that were presumably produced by
wasp larvae that had hatched from eggs laid previ-
ously, but that were then removed when subsequent
female wasps attacked this spider.

most or all of her legs extended stiffly. The
wasp appeared to be either dead or para-
lyzed, and a gentle nudge of the wasp
with my finger confirmed that she was
completely immobile. She remained mo-
tionless until the spider returned to the
hub about 5 min later. As the spider ar-
rived at the hub, however, there was a
sudden tangle of legs and it quickly be-
came clear that the wasp's ovipositor was
inserted near the spider's mouth. Soon the

Lateral

Dorsal

Fig. 3. Schematic representation of 125 sites of the
anterior ends of egg and the bleeding scars of the
larva on the spider's abdomen in lateral and dorsal
views.

spider became immobile, and the wasp,
which had fooled both the spider and me
by playing dead, proceeded to oviposit.

Wasps also showed a certain flexibility
in oviposition behavior. When one spider
began to move after the wasp had spent
several minutes attempting to remove an
egg, the wasp moved to its anterior end
and apparently stung it again, then re-
sumed egg removal.

Failed wasp attacks illustrate possible
kinds of selection on spiders to avoid at-
tacks. In one case the spider's orb was in-
clined so that much of its surface was be-
tween the wasp and the spider as the
wasp hovered above and to the side of the
spider; when the wasp finally struck, it hit
and was arrested by the orb before reach-
ing the spider, the spider moved away,
and the wasp flew on. In two other cases
(one first seen after the interaction had al-
ready begun), the spider hung from its
dragline about 10-15 cm below the hub,
and when the wasp struck from above it
hit and was arrested by the orb, and thus

Volume 9, Number 2, 2000

225

did not reach the spider. The wasp then
hovered nearby, and the spider twice
climbed very rapidly to the hub but im-
mediately dropped again. Finally the spi-
der dashed to the edge of the web, and
the wasp flew on. The presence of web
threads between the spider and the wasp
that were not right next to the spider thus
appeared to reduce the likelihood that a
wasp's attack would succeed. A final fail-
ure occurred when a gentle wind appar-
ently made it more difficult for the wasp
to hover steadily near the spider, and she
eventually crashed into the web and then
flew away. Windier sites may thus be saf-
er for spiders.

Larvae

First instar. — The first instar larva ap-
parently burst open one end of the egg,
but only its anterior end emerged from the
chorion. Its posterior end remained
lodged inside the chorion, and thus at-
tached to the spider. The first instar larvae
possessed neither the ventral nor the dor-
sal structures used by later instars to hold
onto the spider and its web. A small
brown spot or feeding scar (see below) ap-
peared on the spider's abdomen just be-
yond the edge of the chorion of recently
emerged larvae. The subsequent gradual
accumulation of feeding scars on the spi-
der's abdomen, which were always re-
stricted to the vicinity of the larva's head,
indicated that the larva fed at small holes
it made in the spider's abdomen (Figs. 2,
4). As the larva grew, it gradually pro-
truded more and more from the egg cho-
rion. The head, the entire thorax, and the
first two to three abdominal segments
were free by the time the larva was ready
to molt to the second instar, and by then
there were 8-10 feeding scars on the spi-
der's abdomen. The first instar lasted be-
tween 58 and 69 hours (N = 2).

First instar larvae were able to remain
attached when the spider molted, as evi-
denced by two pale, soft newly-molted
adult spiders each having a first instar lar-

molted cuticle

feeding scar

larval tap

chorion

feeding scar

bleeding scar

Fig. 4. Pattern of brown scars on the abdomen of a
spider earning a second instar larva in lateral view
(above) and ventral view, looking outward through
the spider's cuticle (below). The sites of insertion of
the larva's taps were not visible, and were deter-
mined by subsequent dissection.

va attached to its abdomen. In both cases
(and in two other spiders) a portion of the
cuticle of the previous instar (usually the
dorsal portion of the cephalothorax plus a
wrinkled portion of the abdomen) was at-
tached to the spider's abdomen, apparent-
ly at a bleeding scar (Fig. 4).

Second instar. — The transformation from
first to second instar was not witnessed,
and the probable series of events was re-
constructed from preserved specimens.
The newly molted second instar larva was
completely outside the collapsed egg cho-
rion. The larva's ventral surface rested on
the flattened, shed first instar larval cuti-
cle, and this cuticle in turn rested on a
large, stiff sheet of brown amorphous ma-
terial (Figs. 4, 5) (the "saddle" of Nielsen

226

Journal of Hymenoptera Research

Fig. 5. Micrographs of apparent feeding scars (A and B) and saddle material (C) of a second instar larva on
the corrugated abdominal cuticle of a spider. Many feeding scars were produced into more or less conical
protuberances of different shapes (A). A closeup view (B) shows that the scar material (presumably coagulated
hemolymph) flowed over the corrugated abdominal cuticle around the perforation before hardening. The
"saddle" material is amorphous, and is not a shed larval skin.

1923). The empty egg chorion was on the
inner surface of the saddle that contacted
the surface of the spider's abdomen. The
saddle was probably composed of coagu-
lated hemolymph, and had a different
form in each parasitized spider. It was
tightly attached to the spider's abdomen
near the open end of the egg. The anterior
end of the shed larval cuticle was near the
anterior edge of this sheet, indicating that
molting probably involved a split of the
first instar's cuticle along the dorsal mid-
line of most of the larva's body, rather
than a rearward sloughing of cuticle as oc-
curred at pupation (see below).

The saddle adhered to both the ventral
surface of the larva on its outer side, and

to the spider's abdominal cuticle on its in-
ner side, and could be peeled away intact
from both except at the central attachment
area. Here it was attached tightly to the
spider's abdomen at several brown spots
that were similar to the feeding scars men-
tioned above but larger (Fig. 4). In some
cases projections of the saddle extended
into the larva's intersegmental grooves
(Fig. 4), indicating that the saddle had
been a liquid at some time after the larva
molted. Two pairs of protuberances
("taps" of Nielsen 1923) on the ventral
surface of the larva's segments 8 and 9
were inserted deeply into the saddle (and
perhaps also the shed skin) (Fig. 4). They
adhered so tightly to the saddle that it was

Volume 9, Number 2, 2000 227

difficult to separate the larva from it with- sue after the specimen was preserved in

out damaging the taps. alcohol, were smooth and dark, similar to

The second instar larva apparently con- those of feeding scars,

tinued feeding as before, as brown feeding The number of second instar larvae pri-

scars gradually accumulated on the side of or to their final day (below) in collections

the spider's abdomen on which the larva's made in 2000 was approximately equal to

head rested. Many feeding scars were pro- the number of eggs and of first instar lar-

duced externally into more or less conical vae (62 second instars, 73 eggs, 57 first in-

shapes whose tips pointed anteriorly on stars). Assuming that the egg stage lasts

the abdomen (toward the larva's head) about 2.5 days and that the relative num-

(Fig. 5). The spider's pattern of coloration, bers of the different immature stages were

which was due to soft tissues under the fairly constant over the space of a few

transparent abdominal cuticle, was often weeks (supported by the similarity in

(though not always) intact in areas with numbers in the surveys made on 28-30

feeding scars. Thus larvae probably usu- Jan. and 9-10 Feb, 2000 — -Chi2 = 2.7, df =

ally consumed hemolymph, rather than 3, p > 0.4), this suggests that the second

digesting other internal tissues. instar normally lasts two to three days in

When the spider's abdominal tissue was nature. It can also last much longer, how-
dissected away, there were no inward ex- ever. The second instar lasted 46 days in
tensions of either the feeding scars or the one case in which the spider was kept cap-
attachment spots; all were relatively five with only infrequent feeding. Spiders
smooth on their inner surfaces. Smaller carrying first and second instar larvae oc-
feeding scars were concentrated nearer the curred on apparently normal orbs in the
egg (where the larva presumably fed field (Eberhard in prep.),
when it was smaller — Fig. 4). The feeding The true number of larval instars is not
scars had a remarkably regular distribu- certain. Fitton et al. (1988) speculated that
tion, with larger spaces between larger all pimplines may have five larval instars,
scars (Figs 2, 4). on the grounds that Pimpla does, with "the

Saddle-like puddles of hemolymph did middle three being very similar and hard

not form at experimental wounds (ap- to distinguish". If so, then the stages des-

proximately 0.1 mm diameter) made by ignated here as first and second may ac-

puricturing the abdominal cuticle with a tually represent three or four stages that I

fine pin, despite the fact that these holes was unable to distinguish. The distribu-

were larger than feeding scars (about 40 tion of the widths of the head capsules of

|xm in dia — see Fig. 5). In nearly all cases 81 larvae (Fig. 6) did not clarify this. There

the hole was immediately sealed by a were two peaks within the range of sizes

small plug when the pin was withdrawn, classified here as first instars, while sev-

This plug, which was little more than the eral final instar larvae (which can be rec-

diameter of the hole, was initially liquid ognized inequivocably by the dorsal tu-

when touched with the pin, but hardened bercles covered with curved spines) were

to a solid within 10-15 s, and darkened to substantially smaller than several others

a light brown color. In two cases in which which were clearly in the previous instar

a small sheet (up to about 0.3 mm in di- (the curved spines were visible, but were

ameter) of hemolymph emerged from the covered with a transparent layer of cuti-

wound before a plug formed, the sheet cle). It may be that head capsule width is

did not turn dark brown, but instead ac- not constant within an instar, as some

quired a nearly transparent golden color, sclerites may be connected by elastic

The inner surfaces of these wounds, re- membranes,

vealed by dissecting away underlying tis- Final ("third") instar. — There were sev-

228

Journal of Hymenoptera Research

CD
_Q 10

"first instar"

"second instar"

^ '

mature second instar
confirmed third instar

0.2

0.4 0.6

Width head capsule (mm)

Fig. 6. Distribution of head capsule widths of 81 larvae, and approximate limits of classifications of larval
instars used in this study. "Confirmed" final (supposed third) instar larvae had hooked spines on dorsal
tubercles; "mature" second instar larvae had hooks that were clearly visible under the larva's dorsal cuticle.

eral differences between second and third
(final) instar larvae. The dorsal surfaces of
eight segments (3-10 posterior to the
head) of the final instar, which had been
smooth in previous instars, each had a re-
tractable two-lobed tubercle whose tips
were covered with curved spines (Fig. 7).
There was a pair of taps on the ventral
surface of segments 8 and 9 as in the sec-
ond instar, but they were free (Fig. 8), and
not embedded in the saddle. The shed cu-
ticle of the second instar formed a com-
pact sheet bent into a cup. It adhered
tightly to the saddle, apparently where the

taps of the cuticle of the second instar
were inserted. The saddle, in turn, still ad-
hered tightly to the spider's abdomen. The
larva grasped the posterior edge of the
sheet of second instar cuticle between its
final (13th) segment and the bulging ven-
tral margin of its penultimate (12th) seg-
ment (Fig. 8C). In addition, the larva's
head capsule was substantially different
(Fig. 9).

The final instar was relatively brief. All
larvae raised to final instars or collected in
the field as swollen second instars or as
final instars killed the spider the following

Fig. 7. Hooks on a dorsal tubercle of a final instar larva that have snagged tangled spider silk.

Volume 9, Number 2, 2000

229

coagulated hemolymph

head capsule

cuticle of 2nd instar
head capsule

coagulated hemolymph
spider abdomen

Fig. 8. (A) Attachment of the final instar larva to the spider's abdomen, seen in lateral view. (B) Dorsal view
of the cup-shaped mass of larval cuticle. (C) Lateral view of the posterior tip of a larva removed from its
attachment to the spider, showing the protruding ventral surface of segment 12 that gripped the edge of the
cup of larval cuticle.

night. An estimate from field collections of
swollen last day second instar larvae and
early final instars on spiders in 2000 was
in accord with the estimate of a duration

Fig. 9. Antero-lateral view of head capsule of final
instar larva.

of only one day or slightly less (only 18
individuals, as compared with 73 eggs
and 57 first instars).

The final day in the spider's life was
eventful. At least some spiders built an
orb of apparently normally design and
size in the morning, but during the day
the second instar larva grew to an esti-
mated one quarter to one third of the vol-
ume of the spider's abdomen. At about 23:
00-01:00 the spider built a modified "co-
coon web" of a few highly reinforced ra-
dial lines that was especially appropriate
to support the cocoon the larva would
build the next evening. In two cases the
larva repeatedly extended its body nearly
straight while the spider built the cocoon
web.

The cocoon web and the behavior em-
ployed to build it are described elsewhere

230

Journal of Hymenoptera Research

(Eberhard in press, in prep.). Briefly, the
spider used one portion of one subroutine
of frame line construction over and over
to build a small number (mean 3.8 + 1.4,
N = 39) of radial lines, each of which is a
cable composed of many individual lines.
This web did not resemble any prey cap-
ture, resting, molting, or egg sacs webs
normally built by P. argyra. Experimental
removal of larvae showed there to be a
complex, long-term effect on the spider's
behavior that is probably mediated chem-
ically. Typical cocoon web construction
followed in three cases when a swollen
second instar larva was removed from a
spider that had been kept in a confined
space until about midnight, when it
would probably have begun cocoon web
construction. These spiders were still alive
the next day, and the next evening they
each built a second typical cocoon web.

Thirteen other spiders from which the
larvae were removed between 22:00 and
02:00 built structures that were neither
normal orbs nor cocoon webs. Three of
these spiders were observed building.
They placed radial lines from the hub to
the edge using the behavior used to con-
struct typical cocoon webs (Eberhard in
prep.), but also broke and reeled up these
lines while moving back toward the hub.
The final products were sparse networks
of more or less radial lines in which there
were large accumulations of reeled up silk
(fluff) near the hub. All of these spiders
were also alive and active the next morn-
ing.

Soon after it finished the cocoon web,
the parasitized spider became immobile.
All of nine spiders were dead or complete-
ly immobile by 03:00 (in one checked un-
der the microscope, the heart had stopped
beating), and the larva had lifted the an-
terior portion of its body above that of the
spider to grasp the lines of the web with
its dorsal protuberances (see below). The
posterior portion of its body remained at-
tached to the saddle. The larva proceeded
to suck the spider dry over the course of

Extend

Retract

Fig. 10. Diagrammatic representation of the move-
ments of the curved spines at the tip of a turret that
caused lines to be snagged when the tubercle was
everted (above), and release of lines when it was re-
tracted (below).

the morning, feeding first on the spider's
abdomen and then on its cephalothorax.

The mechanism by which the larva
grasped and released lines with its hook-
covered dorsal tubercles was revealed by
observations under a dissecting micro-
scope. The tubercles were extremely mo-
bile, and could be extended so that the
distance of their tips from the dorsal sur-
face of the larva's body was up to about
one third of the diameter of the body.
They could also be retracted rapidly so
that the entire tubercle and all of its hooks
disappeared completely into a pocket on
the dorsal surface of the larva's body. Be-
cause the spines near the tip of each tu-
bercle were sharply curved, eversion of
the tubercle resulted in a grasping effect,
as lines were snagged by the curved
spines (Figs. 7, 10). The spines released
their holds on lines when the tubercle was
retracted into the larva's body.

Volume 9, Number 2, 2000

231

Coordination of tubercle movements
was complex. When the larva moved its
anterior end, the anterior-most three tu-
bercles often contacted the web only spo-
radically. When the tubercles were out of
contact they were often everted and re-
tracted simultaneously. In contrast, the
more posterior tubercles, which usually
held onto threads and supported the lar-
va's weight, moved less often and sequen-
tially. When the larva moved its entire
body forward or backward, each tubercle
that was holding silk released its hold by
retracting, everted toward the next tuber-
cle where it seized silk, and the next tu-
bercle then released its hold and was
everted toward the next, and so on. These
stepping movements swept along the lar-
va's body rapidly, and it sometimes
stepped with several tubercles in a second.

Feeding by a final instar larva on a dead
spider was observed under a dissecting
microscope. The first stage of a feeding
bout involved apparent searching and
hooking of the mouthparts against the
surface of the abdominal cuticle. I was not
able to discern any pattern to these move-
ments, nor any responses to the brown
feeding scars already present. Finally,
sometimes after minutes of such search-
ing, the larva's head came to rest at a par-
ticular site where it apparently began to
produce a hole.

After a minute or so, the larva began to
suck. The rhythmic movements of its head
were reminiscent of those of a nursing hu-
man infant (Fig. 11). Approximately once
every second the larva pulled its head
slightly away from the abdomen without
breaking contact with its mouthparts, then
sprang slightly toward it again. In one
case it was possible to see the flow of the
spider's tissues through the transparent
cuticle of the abdomen as the larva
sucked. Clumps of abdominal tissue
flowed steadily into the larva's mouth.
Two timed feeding bouts lasted about 30
min. They ended when the larva pulled its
head away and rested immobile for sev-

spider abdomen

Fig. 11. Diagrammatic representation of the head of
a feeding larva; the stippled areas pulsed as the larva
sucked.

eral minutes. When the larva withdrew its
head after feeding, there was a small
amount of clear liquid on the surface of
the spider which quickly dried up; no hole
was visible, nor did a brown spot form.

On three occasions it was clear that the
larva interrupted sucking and that a clear
liquid flowed from its mouth into the spi-
der for several seconds. This liquid
formed a small pool around the point
where the larva's head contacted the ab-
domen, and it also flowed under the cu-
ticle, as deduced from brief movements of
spider tissue away from the larva's
mouthparts. Presumably the clear liquid
contained digestive enzymes.

When feeding ended, the larva freed it-
self from the now more or less empty but
intact cuticle of the spider, and it dropped
to the ground below. This process was not
observed directly, and it was not clear
whether the larva actively unhooked the
spider's tarsal claws from the web. The
saddle was still attached to the discarded
carcass of the spider, and bore the imprint
of the larva's last two abdominal segments
(Fig. 8). In two cases the discarded carcass
of the spider represented about 50% of the
larva's weight: larvae which weighed 15.7
and 26.2 mg discarded carcasses that
weighed, respectively, 6.1 and 10.4 mg.

The now somewhat greenish larva hung
motionless, curled ventrally as it held the

232 Journal of Hymenoptera Research

web with its dorsal tubercles, for the rest in snagging the line on the tubercle. The

of the daylight hours. Larvae in the field larva then extended the rear portion of its

were remarkably coordinated in killing body downward, thus probably pulling

and consuming their hosts. All but one of more silk, and it moved its head back up

13 final instar larvae found before 13:00 to contact the spider web above and make

were still feeding on the dead host, while another attachment there. The usual du-

all of 11 found between 13:00 and 17:00 ration of one complete cycle was about 5-

had dropped the spider and were resting 10 s.

immobile at the hub of the cocoon web. By repeating this sequence of spinning

Cocoon construction began soon after movements over and over, the larva grad-

darkness fell (about 18:40). The process of Ually produced a bundle of lines that ran

first attaching the cocoon's suspension line from the attachments to the spider web

to the spider's web, then extending the down to the rear end of its own body and

line below the web, and then forming the back up to the web again. This bundle

walls of the cocoon was accomplished as would form the suspension line of the co-

the larva slowly inched backward over a coon The suspension line was lengthened

period of up to an hour or more. The larva when me larva grasped the bundle with

maintained a hold on silk lines with its the dorsal tubercles, moving rearward

dorsal tubercles at all times. At first it held along the bundi6/ and men resuming spin-

onto the silk of the spider's cocoon web, ning moVements. Eventually the upper at-

then later onto the suspension line of its tacnments of spinning movements were to

cocoon. fae suspension line itself rather than to the

The larva produced a silk line (or lines?) SDider's web

from its head by pulling away from a ' The final ' q( CQCOOn construction

point where the line was attached, and algo involved a si le ttern repeated

then attached this line to others by tap- , /T:. 10T3N TU , ,

, , , . . J _/ over and over (Fig. 12B). The larva moved

pine or rubbing its head against them. The .. , , . , . ■. , £ ., , „

5. ,. ° , , ° „ , its head to touch the edge of the bundle

first lines were attached repeatedly to the , ,. , , .. i j

.. , , , , , . j , , i of lines already spun near its lower end,

lines at the hub of the spider s web, and , „ , i . j- , j

,, i j- j ^ j then pulled away a short distance and

were often somewhat dispersed. Gradu- , r , , , i i ,

,, ,, , , , ... then moved back to touch the edge again

ally they condensed into a single multi- ,. , . , , , , , . ,

. j j v ii. i jui slightly farther up, and repeated this be-

stranded line as the larva moved back- & J , , i i

ward a few millimeters. The suspension ^avior until [t reached the suspension line,
line of the cocoon was produced by a sim- then bent downward again to begin the
pie sequence of movements repeated over next series of attachments near the bottom
and over (Fig. 12A). First the larva at- ed8e of the bundle- The larva thus Srad"
tached its line to the spider's web, and ually extended the bundle laterally to
drew out a line by moving its head down- form a bag-like sheet that enclosed the
ward. Usually it paused immobile for sev- posterior portion of its body. Later the bag
eral seconds, and then moved its head far- was gradually extended upward to en-
ther, toward the posterior end of its body, close the upper portion of its body also,
which was bent anteriorly. The head usu- The bag was closed by addition of lines to
ally dabbed or scraped repeatedly against its inner surface, about 4-5 hrs after co-
the posterior portion of the body, gradu- coon construction began. Once the bag
ally touching points more and more to- was closed it was more difficult to observe
ward its dorsal surface. During the last the larva's behavior, but it was clear that
few scrapes it often dragged its mouth- it sometimes turned 180° to face down-
parts across its rearmost dorsal tubercle, ward and add more lines to the bottom of
Probably these movements often resulted the cocoon. Cocoon construction contin-

Volume 9, Number 2, 2000

cocoon web

233

cocoon
web

suspension line

Fig. 12. The sequence of movements as a larva built the suspension line of the cocoon (A ) and when it began
the cocoon itself (B).

234

Journal of Hymenoptera Research

ued through the night and the following
morning.

Cocoons spun in captivity were all very
light yellow in color, and gradually dark-
ened over the next day or so. Those kept
in closed containers out of the light were
especially pale. Some of those found in na-
ture were dark yellow, while most were
bright orange. About 36-65 hrs. after co-
coon construction began, the larva ejected
its meconium, which generally fell
through the circular hole at the bottom of
the cocoon (Gauld et al. 1998). One larva
molted to a pupa between 4 and 5 days
after killing its host.

Pupa

Pupal behavior could not be observed
directly, except for the short series of rap-
id dorso-ventral contractions of the abdo-
men usually made when the pupa was
disturbed. Indirect evidence suggests that
the pair of toothed prominences near the
tip of the pupal abdomen, which were im-
mobile, served to engage the tip of the ab-
domen against the inner wall of the co-
coon, and thus hold the pupa at the upper
end of its cocoon. All of seven living pu-
pae checked by cutting a slit in the side of
the cocoon were wedged at the upper end
of the cocoon (the pupa occupied only an
estimated average 83 ± 6% of the length
of the cocoon). All pupae observed in co-
coons were oriented with the head up-
ward, and the circular emergence slit
made by the adult was always at the up-
per end of the cocoon. Presumably this
position served to keep the pupa's poste-
rior end away from the meconium or the
shed larval skin that was sometimes pre-
sent at the bottom tip of the cocoon. Four
adults emerged 10-12 days after cocoon
construction, so the pupal stage lasted
about a week. A total of 26 males and 38
females were raised from field-collected
cocoons (not significantly different from
50:50 with Chi2 Test).

Other aspects of natural history

Rates of parasitism. — Mature female spi-
ders were approximately ten times more
heavily parasitized than were mature
males (42.9% of 203 females compared
with 6.9% of 72 males in 1999; 66.4% of
125 females vs. 3.2% of 62 males in 2000).
The rate of parasitism of mature females
earlier in 1999 (27-30 Jan) was lower than
that later (2-5 Feb.) the same year (26.5%
of 83 females compared with 50% of 120
females — p<0.001 with Chi2). In contrast,
the first survey in 2000 showed a higher
rate for mature females than for the sec-
ond survey that year (84.2% of 57 females
on 28-30 Jan., vs. 51.5% of 68 on 9-10 Feb.,
p < 0.001 with Chi2). The rates of parasit-
ism of mature males did not differ signif-
icantly for the two surveys in either year
(7.1% of 28 compared with 6.9% of 44 in
1999, 3.1% of 32 vs. 3.3% of 30 in 2000).

Mature females were also more heavily
parasitized than were immatures. In the
first survey of 2000, 84.2% of mature fe-
males, but only 50.8% of 63 penultimate
females, 39.5% of 43 penultimate males,
and 25.7% of ante-penultimate nymphs
were paralyzed (all rates were lower than
that for mature females, p < 0.001 with
Chi2; ante-penultimates were less parasit-
ized than penultimates, p = 0.033 with
Chi2). Similarly, penultimate spiders
showed less evidence of infanticide (25
cases in 73 spiders, compared with 43 cas-
es among 55 mature females, p < 0.001
with Chi2).

Enemies of the wasp. — Mortality in the co-
coon was relatively low. Seven Conura of
two different species, one in the immacu-
lata group of the subgenus Ceratosmicra,
and the other in the vau group of the sub-
genus Conura (Chalcididae) were raised
from 105 inhabited cocoons collected in
the field in 1999, and 4 of 85 empty co-
coons had Conura sp. pupal skins, giving
a total rate of 5.8%. An eighth female Con-
ura was captured after being first seen
resting on the side of a cocoon in the field.

Volume 9, Number 2, 2000

235

Two days later this cocoon contained a
young pupa of H. argyraphaga, suggesting
that the late larval or early pupal stage of
the host was parasitized. Two chalcidids
that pupated in captivity each had a dead
H. argyraphaga pupa in the same cocoon,
and three empty cocoons collected in the
field that had a pupal cuticle of Conura
also had the remains of a H. argyraphaga
pupa.

Other field mortality of stages in co-
coons, presumably due to predators, was
noted as removal of the entire cocoon
from the cocoon web (8 cases), or com-
plete removal of the cocoon's contents (as-
sociated with a large hole in the side in
two cases, and with multiple small ragged
holes in two others). Two mature female
spiders in the field carried dead first instar
larvae, but the cause of death was not
clear.

Two adult H. argyraphaga, one male and
one female, were found dead at the hubs
of orb webs of the araneid Gasteracantha
cancriformis (L.), despite the fact that the
wasps seem to be chemically defended.
Even recently emerged adults less than
four hours old released a pungent odor
when grasped between the fingers (neither
large second instar larvae nor their host
spiders had any perceptible smell or
taste). One tug of war between a larva and
a salticid spider at the hub of a new co-
coon web resulted in the larva's loss of the
dead spider, and nearly resulted in pre-
dation on the larva.

One further predatory event may have
been an artifact, but it illustrates another
potential danger to the wasp. A penulti-
mate instar male spider with a swollen
second instar larva was placed in a plastic
bag in a more or less cramped position.
An hour or so later, the spider was feed-
ing on the anterior end of the larva, which
was still attached posteriorly to the sad-
dle. In no other case did a parasitized spi-
der exhibit any behavior directed toward
the larva on its abdomen.

DISCUSSION

Chemical manipulation of the host. — Lar-
vae of H. argyraphaga manipulate both the
behavior and the physiology of their
hosts. The changes in the spider's behav-
ior which resulted in the production of the
otherwise unique, strong "cocoon" web
that is particularly well designed to sus-
tain the wasp's cocoon, involved induc-
tion of the first steps of one subprogram
of orb web construction that were repeat-
ed over and over to the exclusion of others
(Eberhard in press, in prep.). Experimental
removal of larvae showed that these be-
havioral changes occurred as a result of a
fast-acting substance or substances with
long-term effects introduced into the spi-
der just before the larva molted to the final
instar. It appears that the larva's induction
of one type of building behavior and re-
pression of others may represent separate
effects, as their manifestation was partially
uncoupled by early removal of the larva
(Eberhard in prep.). Induction by the final
instar during cocoon web construction
seems unlikely, due to both the softness of
the final instar's pale head capsule soon
after molting, and the complete cocoon
webs obtained after the mature second in-
star was removed. In contrast, the death
of the spider soon after the cocoon web
was finished probably resulted from ma-
terial injected by the final instar larva just
after the cocoon web was finished, when
it began to feed; spiders did not die when
the larva was removed just prior to this
molt.

Manipulation of spider bleeding oc-
curred when the larva molted from the
first to second instar, and resulted in the
production of the saddle. The form and
the position of the saddle suggest that liq-
uid hemolymph emerged in unusually
large amounts from the large holes in the
spider's abdomen and did not immediate-
ly coagulate as usual (one saddle was
about 0.9 X 1.5 mm, while the largest pud-
dle of hemolymph produced by wound-

236 Journal of Hymenoptera Research

ing with a minuten pin was only about were very small when they were found,

0.27 mm in diameter). These holes were apparently soon after the spider's molt,

probably made just before the first instar Perhaps these larvae had not been hatched

larva emerged from the egg chorion to long enough to inhibit the molt,

molt, because the newly molted second in- Comparisons with related wasps. — There

star larva would have had a soft head cap- are many points of similarity between the

sule, presumably incapable of biting behavior and natural history of H. argyr-

through the spider's cuticle. Judging by aphaga and H. robertsae (Fincke et al. 1990),

the apparent difficulty that the larger final and with polysphinctines of other genera

instar larva had in perforating the spider's (Bignell 1898, Nielsen 1923, Fitton et al.

relatively tough cuticle, it probably took 1988, Gauld et al. 1998). Females of H. rob-

the first instar larva many minutes to ertsae may also attack spiders at the hubs

make these large holes. The spider's he- of their webs, sting the spider in the ceph-

molymph must have coagulated only alothorax to produce a temporary paraly-

slowly, and was evidently still liquid after sis (Fincke and colleagues witnessed only

ecdysis occurred, since saddle material what were apparently aftermaths of at-

sometimes flowed part way up the side of tacks, however), and lay an egg on the an-

the second instar larva's cuticle (Fig. 4). terior surface of the abdomen. The female

Liquid hemolymph may have helped the wasp also moves the ovipositor back and

larva adhere to the spider during the del- forth over the spider's abdomen (for up to

icate period after it had abandoned its egg five min) prior to ovipositing, and thus

but was still a first instar and thus lacked may also remove previously deposited

grasping structures. The extensive flow of eggs or larvae. Fincke et al. (1990) found

hemolymph and the long delay before it four doubly parasitized spiders, however,

coagulated contrast with the small plugs Thus H. argyraphaga is the only species yet

of rapidly coagulated hemolymph at found in which it is certain that females

puncture wounds made with a fine pin. kill the offspring from previous attacks on

Presumably the larva added something to the host. The selective advantage of infan-

the spider's blood which retarded coagu- ticide seems obvious. Only one of proba-

lation. bly several hundred cocoon webs seen in

One other possible manipulation was the field had two cocoons, and only one

the inhibition of molting by host spiders, of these two produced a wasp. A second

The evidence is only indirect, however, doubly parasitized spider was killed and

Despite the fact that wasp larvae were consumed in captivity by the larger larva,

able to remain attached when their host while the smaller larva fell to the ground

molted (as also occurs in other polys- (still alive) with the discarded cadaver of

phinctines — Nielsen 1923), and that the the spider.

rate of parasitism of penultimate male spi- Similar use of the egg chorion to hold

ders was not significantly different from onto the spider occurs in Acrodactyla mad-

that of penultimate females (39.5% of 45 ida (Haliday) (= Polysphincta clypeata),

penultimate males versus 50.8% of 63 pen- though Nielsen's (1923) drawings indicate

ultimate females in 2000), the rate of par- that the egg of this species is also used by

asitism of mature males was only about a larger larvae, rather than only the first in-

tenth of that of mature females the same star as in H. argyraphaga. The dorsal tu-

year. Of 32 parasitized penultimate and bercles ("warts") of the final instar are

ante-penultimate spiders reared for two similar in form and placement to those of

weeks, not a single spider molted. The Zatypota albicoxa (Walker) (= Polysphincta

only evidence that spiders molted after be- eximia) and Polysphincta tuberosa Graven-

ing parasitized involved wasp larvae that horst (Nielsen 1923). The two pairs of ven-

Volume 9, Number 2, 2000

237

tral taps on segments 8 and 9 of the final
instar larva of H. argyraphaga also resem-
bled those of most of the species studied
by Nielsen (1923), except that he recorded
three pairs (on segments 7, 8 and 9) in P.
tuber osa.

The use of the sharply hooked setae on
the tubercles to seize silk lines was appar-
ently identical in all other species ob-
served. Although Fincke et al. (1990) made
no direct observations of larval behavior
of H. robertsae, their Fig. 3 clearly shows
dorsal tubercles on a large larva, leading
to the supposition that they also have
curved spines and are used to hold onto
the spider's web. Bignell (1898) seems to
have been correct in stating that lines were
released by retracting these tubercles rath-
er than by extending them, as also occurs
in a pimpline ichneumonid that is proba-
bly fairly closely related to Polysphinctini,
Tromatobia oculatoria (Fabricius) (Nielsen
1923) (Nielsen 1923 may have been mis-
taken in describing the opposite process of
releasing by extending in Z. albicoxa).

Only some details of how larvae of H.
argyraphaga hold onto the host spider re-
semble descriptions of other species. In-
sertion of the paired ventral taps into a
mass of material (the saddle) that adheres
to the spider's abdomen, as described for
second instar H. argyraphaga, has been
seen in several other species (Nielsen 1923,
1935), though no difference was noted be-
tween second and final instar larvae. Niel-
sen (1923) stated that the cuticle of the first
instar larva of Z. albicoxa was "glued to
the host", but this was not true for H. ar-
gyraphaga. In conjunction with this idea,
Nielsen supposed that the saddle consist-
ed of larval exuviae (Nielsen 1923, 1935),
and this has been reiterated by later au-
thors (e.g., Fitton et al. 1987, 1988). It
seems likely, however, that the portion of
the second instar's saddle that adhered to
the host was coagulated spider hemo-
lymph as in H. argyraphaga (Figs. 4, 5),
rather than first instar larval cuticle. In fact
Nielsen (1923) mentioned that wounds

might be involved in allowing the larva to
adhere to the spider.

None of the descriptions of other spe-
cies mentioned the final instar larva's
change to hold onto the shed cuticle of the
second instar with its terminal segments
instead of its taps, as seen in H. argyrapha-
ga. The mature larva's ability to release the
spider in all of the species in order to pu-
pate (presumably by relaxing the muscles
that squeezed the shed cuticle), and the es-
pecially active movements of the posterior
tip of the larva during the only molting
process that has ever been observed di-
rectly (Nielsen 1923: 148-149 on Z. albi-
coxa; ". . . the repeated attempts at fixing
made by the hind end . . ."), suggest that
similar changes may occur in other spe-
cies.

Both Nielsen and Bignell also noted that
the larva of respectively Zatypota and an
undetermined polysphinctine utilized the
posterior part of the abdomen to pull out
silk lines during cocoon construction, al-
though their descriptions differ in details.
It is not clear whether these differences
were due to differences between species
or, as supposed by Nielsen (1923), to dif-
ferences in the precision of observations.
The cocoons of H. robertsae were similar in
form and color to those of H. argyraphaga.
Increases in the duration of the larval
stage when the host is feeding poorly, as
in H. argyraphaga, probably also occurs in
other species (Nielsen 1923).

Females of H. robertsae were also larger
than males, as is common among pimp-
lines (Gauld et al. 1998), implying that ovi-
positing females fertilize or refrain from
fertilizing the egg on the basis of the size
of the prey. If molting by the host is in-
hibited by H. argyraphaga, then the size of
the spider when it is attacked will corre-
late with the size of the resulting wasp.
Both species avoided parasitizing mature
males of their hosts, probably for different
reason. Mature male N. clavipes are prob-
ably too small to produce an adult H. rob-
ertsae (Fincke et al. 1990). Mature males of

238 Journal of Hymenoptera Research

P. argyra were, in contrast, not too small argyraphaga was similar to that observed

to produce adult wasps. For instance one (in captivity) in Schizopyga podagrica (Niel-

moderately small mature male spider sen 1935).

weighed 14.0 mg, somewhat more than One possible difference between H. ar-
the 13.7 mg of a parasitized penultimate gyraphaga and H. robertsae is that the latter
male and 12.1 mg of a parasitized ante- apparently does not induce the spider to
penultimate male. Mature male P. argyra spin a highly modified cocoon web. Per-
were only parasitized about a tenth as of- haps induction of behavioral changes has
ten as mature females, however (totals of been lost, as the larger size of Nephila cla-
5.1% of 136 males and 51.8% of 328 fe- vipes and the corresponding greater dura-
males in the two years). It was clear that bility of the mesh lines near its orbs
both of the mature males parasitized in (which often remain more or less intact for
2000 had been attacked when they were in several days without repair by the spi-
the penultimate instar, because part of the der — W. Eberhard unpub.) may make a
cuticle from the previous instar adhered to modified web to support the cocoon un-
the male's abdomen at the feeding scar be- necessary. Another possibility is that mod-
low the larva in both cases. ification of spider behavior is a relatively

The reason for lower parasitism of ma- recently derived character in H. argyrapha-

ture males was presumably either because ga, but the probable plesiomorphic status

female H. argyraphaga rejected mature of this species within Hymenoepimecis

male spiders, or were less able to find and (Gauld 2000) and the ability of H. tedfordi

attack them. Active rejection seems likely, to modify the behavior of L. mariana (W.

because mature males of P. argyra often Eberhard, in prep.) argue against this idea,

chase off smaller individuals and use their Neither Bignell (1898) nor Nielsen

orbs to capture prey (10 of 11 males (1923) mention modified spider webs in

checked for this detail were at the hubs of most of the polysphinctine larvae they

an orb). Thus mature males are probably studied, but Shaw (1994:125) states that

often exposed to hunting female wasps, "many spiders about to succumb to po-

Active avoidance of males may be advan- lysphinctines seek a concealed site into

tageous to the wasps because at least which they spin themselves". Nielsen

sometimes mature males fail to construct (1923) noted that the last web that the host

a cocoon web (Eberhard in prep.), thereby Cyclosa conica (Pallas) made before pupa-

probably making the wasp's cocoon more tion by Polysphincta nielseni Roman was

vulnerable to enemies. unusually small, and that such small orbs

The mating system of H. argyraphaga ap- were especially resistant to damage. In

parently differs from that of at least some contrast, he noted an apparently normal

other ichneumonids in which males are at- web of a "certain TJieridia" with the co-

tracted to sites where females are emerg- coon of a Acrodactyla degener (Haliday)

ing. Males of H. argyraphaga were appar- (Nielsen 1923). The web of the theridiid

ently not attracted to emerging or recently "Theridion" with the cocoon of a Zatypota

emerged females as they rested on their albicoxa that he figured (Nielsen 1923) also

cocoons, but quickly approached females seems normal, while Jimenez (1987) states

after they flew to nearby vegetation. Fe- that Zatypota sp., which parasitizes Theri-

males probably actively release a long- dion contreras, attaches its cocoon to the

range attractant pheromone. Males ap- substrate rather than suspending it in the

peared to concentrate their searching be- web. I have seen the cocoon of an uniden-

havior at the tips of leaves of prominent tified species of Zatypota in an apparently

plants, suggesting that they also use visual unmodified web of its theridiid host, Ane-

stimuli. The very short copulation of H. losimus sp. These sparse data thus suggest

Volume 9, Number 2, 2000 239

the preliminary conclusion that the non- der. The larger larvae won out over small-
orb webs in which these wasps pupate are er individuals in two cases in which two
not modified. A possible variation is Po- larvae grew on the same host.
lysphincta tuberosa Gravenhorst, which Selection on spiders. — The success of at-
parasitizes the orb weaver Araneus quadra- tacks by H. argyraphaga depended on the
tus; but, judging from the figure of the co- wasp grasping the spider through the web
coon and an accompanying web (Nielsen as it rested at the hub of its orb. Both the
1923), this species may pupate in the silk spider's observed defensive behavior
retreat made by the host (Jones 1983) rath- (dropping quickly on a drag line below
er than on the orb. Much more work re- the orb in response to the wasp's ap-
mains to clarify the evolution of the ability proach from above), and the circumstanc-
of these larvae to manipulate host web es in which some wasp attacks failed
spinning behavior. (when the wasp hit the orb too far from

The failure of female H. argyraphaga to the spider to grasp it) support the old idea

use the ovipositor for oviposition resem- that meshes of lines associated with orb

bles oviposition in aculeate wasps. Simi- webs function to defend the spider from

lar, presumably convergent oviposition enemies (summaries in Lubin et al. 1982,

direct from the genital opening has been Eberhard 1990). The strategy of attacking

seen in an unspecified adelognathine ich- the spider from above functions well with

neumonid, and is suspected in the braco- the more or less horizontal orbs of P. ar-

nid Histeromerus (Shaw 1995). The ovipos- g}/ra, but leaves the wasp unable to follow

itor of H. argyraphaga also injected para- the spider down its drag line when it

lyzing venom into the spider host, and the drops, as Bignell (1898) observed an un-

attacking wasp probably stabs the spider identified polysphinctine to do by walking

with her unsheathed ovipositor during the down the line.

instant she is landing and seizing it. In ad- This limitation on wasp attacks makes
dition, the ovipositor was used to pry eggs it difficult to explain why late instar and
and larvae of previous females from the mature female P. argyra seldom spin a
spider's abdomen, and may also be used mesh above or below the orb. Such mesh-
to sting these larvae. Live larvae are dif- es often occur in the web of earlier instars
ficult to pry from the spider. One of the of this species. Among 31 webs of as many
distinguishing traits of Polysphinctini in adult females, 90% lacked any mesh above
general is a very sharply pointed ovipos- the orb, while the corresponding frequen-
itor (Fitton et al. 1988). It is tempting to cy for 52 penultimate nymphs was 65% (p
suppose that the sharp point is an adap- = 0.05 with Chi:). Unpublished data from
tation to aid rapid penetration and im- student projects strongly suggest that spi-
mobilization of spider hosts, which are ders build such meshes even more fre-
potentially dangerous hosts. quently in earlier instars. The phylogeny

Most European polysphinctines appear proposed for Plesiometa, Leucauge, and re-
to oviposit at rather consistent sites on lated genera (Hormiga et al. 1995) sug-
their hosts (Shaw 1998), but extensive de- gests that mesh construction is a derived
scriptions of intra-specific variation in ovi- trait in these two genera,
position sites on their host (e.g., Fig. 3) are
not available for other polysphinctines, so
it is not clear whether the substantial var- • tl"'ank Ian Gauld for help with literature and for
iation in H. argyraphaga is unusual. It is kindlv identifying assorted ichneumonids 1 have
., , ,i , .. . . , brought him over the years. I am also eratetul to Im-
possible that selection to escape infanti- , x, , , , >i , m
r i dro I riacon tor locating a cruaaJ cocoon in the field.

cide by subsequent females favors varia- Giibert Barrantes tor helping to End spiders, Paul

tion in where eggs are placed on the spi- Hanson tor identifying the chalcidids, Maribelle Var-

ACKNOWLEDGMENTS

240

Journal of Hymenoptera Research

gas for producing the SEM images, and R. R. Askew,
M. G. Fitton, Ian Gauld, Paul Hanson, and Mark
Shaw for commenting on previous drafts. The Smith-
sonian Tropical Research Institute and the Vicerrec-
toria de Investigacion of the Universidad de Costa
Rica provided financial support.

LITERATURE CITED

Bignell, G. C. 1898. The Ichneumonidae (parasitic
flies) of the South of Devon. Report and Transac-
tions—Devonshire Association for the Advancement
of Science, Literature and Art (1898):458-504.
Eberhard, W. G. 1990. Function and phylogeny of spi-
der webs. Annual Revieiv of Ecology and System-
atics 21:341-372.

Eberhard. W. G. 2000. Spider web manipulation by a
wasp larva. Nature 406:255-256.

Eberhard, W. G. in prep. Under the influence: web
construction behavior by Plesiometa argyra (Ara-
neae: Tetragnathidae) parasitized by the ichneu-
monid wasp Hymenoepitnecis argyraphaga (Hy-
menoptera: Ichneumonidae).

Fincke, O.M., L. Higgins and E. Rojas. 1990. Parasit-
ism of Nephila clavipes (Araneae, Tetragnathidae)
by an ichneumonid (Hymenoptera, Polysphinc-
tini) in Panama. Journal of Arachnology 18:321-
329.

Fitton, M. G., M. R. Shaw and A. D. Austin. 1987. The
Hymenoptera associated with spiders in Europe.
Zoological Journal of the Linnean Society 90:65-93.

Fitton, M. G., M. R. Shaw and I. D. Gauld. 1988.
Pimpline ichneumon-flies Hymenoptera, Ichneu-
monidae (Pimplinae). Handbooks for the Identifi-
cation of British Insects (Royal Entomological So-
ciety of London) 7(1):1-110.

Gauld, I. D. 1995. Ichneumonidae. pp. 390-431 In P.
Hanson and I. D. Gauld (eds) Hymenoptera of Cos-
ta Rica. Oxford University Press: Oxford. 904pp.

Gauld, I. D. 2000. The re-definition of pimpline genus
Hymenoepitnecis (Hymenoptera: Ichneumonidae)
with a description of a plesiomorphic new Costa
Rican species. Journal of Hymenoptera Research 9:
213-219.

Gauld, I. D., J. A. Ugalde G. and P. Hanson. 1998.
Guia de los Pimplinae de Costa Rica (Hymenop-

tera: Ichneumonidae). Revista de Biologia Tropical
46 (Suppl. 1):1-189.
Hanson, P. and I. Gauld. 1995. The Hymenoptera of

Costa Rica. Oxford University Press: Oxford.
Hormiga, G., W. G. Eberhard and J. A. Coddington
1995. Web construction behavior in Australian
Phonognatha and the phylogeny of nephiline and
tetragnathid spiders (Araneae, Tetragnathidae).
Australian Journal of Zoology 43:313-364.
Jimenez, M. L. 1987. Relaciones biologicas entre ar-
anas y avispas. Folia Entomologica Mexicana 73:
173-183.
Jones, D. 1983. The Larousse guide to spiders. New

York: Larousse and Co. 320 pp.
Lubin, Y. D., B. Opell, W. G. Eberhard and H. W.
Levi. 1982. The "orb plus cone" webs in Ulobor-
idae (Araneae) with a description of a new genus
and four new species. Psyche 89:29-64.
Nielsen, E. 1923. Contributions to the life history of
the pimpline spider parasites (Polysphincta, Zag-
lyptus, Tromatobia). Entomologiske Meddelelser 14:
137-205.
Nielsen, E. 1928. A supplementary note upon the life
histories of the Polysphinctas (Hym. Ichneum.).
Entomologiske Meddelelser 16:152-155.
Nielsen, E. 1929. A second supplementary note upon
the life histories of the Polysphinctas (Hym. Ich-
neum. ).Entomologiske Meddelelser 16:366-368.
Nielsen, E. 1935. A third supplementary note upon
the life histories of the Polysphinctas (Hym. Ich-
neum.). Entomologiske Meddelelser 19:193-215.
Shaw, M. R. 1994. Parasitoid host ranges. In Hawkins,
B. A. and W. Sheehan eds. Parasitoid Community
Ecology. New York: Oxford Univ. Press; 111-144.
Shaw, M. R. 1995. Observations on the adult behav-
iour and biology of Histeromerus mystactnus Wes-
mael (Hymenoptera: Braconidae). The Entomolo-
gist 114:1-13.
Shaw, M. R. 1998. Hymenopteres europeens en par-
ticulier les Polysphinctini dont les larves se nour-
rissent d'araignees. Connaissance des Invertebres,
Serie Arachnidcs 3:14-40.
Wahl, D. B. and I. D. Gauld. 1998. The cladistics and
higher classification of the Pimpliformes (Hy-
menoptera: Ichneumonidae). Systematic Entomol-
ogy 23:265-298.

j. HYM. RES.
Vol. 9(2), 2000, pp. 241-245

Molecular Confirmation of Host Records for Ichneumonoid
Parasitoids of Wood-boring Beetle Larvae

Nina M. Laurenne, Robert Belshaw, Gavin Broad and Donald L. J. Quicke

(NML) Finnish Museum of Natural History, Zoological Museum, Entomological Division, P.O.

Box 17 (P. Rautatiekatu 13), FIN-00014 University of Helsinki, Finland. (RB, GB, DLJQ) Unit of

Parasitoid Systematics, CABI Bioscience UK Centre (Ascot), Department of Biology, Imperial

College at Silwood Park, Ascot, Berkshire SL5 7PY, U.K., (GB, DLJQ) Centre for Population

Biology, Imperial College at Silwood Park, Ascot, Berkshire SL5 7PY, U.K., and (DLJQ)

Department of Entomology, The Natural History Museum, London SW7 5BD, U.K.

Abstract. — Field observations in Sabah of a large braconine wasp, Shelfordia sp., investigating
and ovipositor-probing at a frass hole in an exposed tree root suggested the possible location of
a host. Investigation of the substrate revealed a paralysed and partly consumed larva of an an-
thribid beetle that had a 1st instar parasitic wasp larva on it. Both adult and larval wasps were
sequenced, in separate laboratories, for the D2-D3 expansion region of the nuclear 28S rDNA
gene. The sequences were identical and consideration of their unique features compared with
many other sequences from ichneumonoids leads to confirmation that the hosts of Shelfordia spp.
include Anthribidae living in tree roots. The implications of DNA sequencing for constructing
quantitative food webs are discussed.

Host records for parasitic Hymenoptera
are notoriously unreliable as has been well
documented by Shaw (1994) and Noyes
(1994). Errors in the literature derive from
several sources including misidentifica-
tion of the parasitoid, misidentification of
the host, misidentification of both, and
through the wrong association of a para-
sitoid with a putative host because of con-
tamination of the rearing system. These
problems are particularly true for con-
cealed hosts such as wood-borers, gall
makers, etc., because these substrates can
contain many potential host species apart
from the one that may be the focus of at-
tention. Simply rearing a parasitoid and a
potential host from a given piece of sub-
strate has consequently often led to incor-
rect conclusions about what is parasitising
what. Although it is sometimes possible
carefully to dissect substrate and to iden-
tify any host and parasitoid remains, or to
isolate and rear the host and its parasitoid
in isolation, these are both difficult pro-

cedures requiring much skill and at least
some luck. The development of molecular
techniques, in particular DNA sequencing,
has opened new and in some respects eas-
ier ways to solve these problems.

The braconine genus Shelfordia Cameron
is relatively common from India, through
the Indo-Australian Region, to N.E. Aus-
tralia, often being found in local collec-
tions, no doubt because its species are
rather large by parasitic wasp standards.
Its identification has not been without
problems though, and since its original
description (Cameron 1902), nothing had
been published on it under that name un-
til it was discovered to be a senior syno-
nym of Sigalphogastra Cameron (Quicke
1982). The genus name Sigalphogastra had,
however, been very inconsistently ap-
plied, and few of the older publications
citing this name (Shenefelt 1978) actually
refer to taxa congeneric with the type spe-
cies. In 1984, Quicke described a new ge-
nus Rostraulax, based on a species similar

242 Journal of Hymenoptera Research

to Shelfordia sensn stricto, but which had an be searching. However, after several hours
elongate labio-maxillary complex and of observation, the wasps were never seen
partly fused apical flagellomeres (Quicke near this tree, but only near the path. The
1984a). Although Rostraulax is recognisa- wasps were very cautious; they remained
ble by these autapomorphies, Shelfordia is, stationary on the low vegetation for long
as far as we can tell at present, left para- periods, and were easily disturbed by tour-
phyletic with respect to Rostraulax, and the ists passing by. After some while, however,
letter was formally synonymised with we observed one and then another fly to
Shelfordia by van Achterberg (1993). Prior land on a small (approximately 5cm diam-
to now, there have been no available host eter) tree root that was partially exposed by
data for the genus Shelfordia, although the the path. Again the wasps remained station-
especially long ovipositor of one Indian ary for about 20 minutes when one of them
species, S. longicaudata van Achterberg, approached a boring from which fresh-
suggests that it is potentially a parasitoid looking wood particles were exuded. After
of a host living deeply within wood (van antennating the site for several minutes, she
Achterberg 1993). Since its original de- raised her metasoma and probed into the
scription, some 35 species have been re- frass hole with her ovipositor and sheathes,
classified into it (or its synonym, Rostrau- After a few moments she was observed
lax) (Quicke 1983, 1984b, 1985, 1988, 1991, making marked twisting movements with
Quicke and van Achterberg 1990, Quicke the apex of her metasoma and she was then
and Koch 1990, van Achterberg 1993, van collected.
Achterberg and O'Toole 1993), of which

11 are from the island of Borneo, all from METHODS
Sarawak. No species-level keys are avail- Collection. — The apparently-ovipositing
able for Shelfordia, and proper taxonomic adult female Shelfordia was collected with
revision is required before the species re- a net and placed into a clean vial contain-
ferred to here can be properly identified. ing 95% ethanol. Other adult wasps re-
ferred to in this paper were collected in
FIELD OBSERVATIONS me same way or in Maiaise traps contain-
In August 1999, DLJQ and NML had the ing 95% ethanol. The tree root with frass
opportunity to collaborate with the group of hole was dissected the same day with a
Dr Maryati Mohamed of the Tropical Bio- saw, hammer and chisel, and a boring lo-
diversity and Conservation Unit, Universiti cated below the frass hole which con-
Malaysia, Sabah, and to observe some large tained a paralysed and partly deflated
braconid wasps in lowland tropical rain for- beetle larva upon which was a single
est at Poring (Kinabalu National Park), small (<lmm long) parasitoid larva. The
Along a short stretch of one popular forest beetle and parasitoid larvae were handled
trail, some six or seven conspecific females with watch-makers' forceps and trans-
of the large, entirely tropical, braconine ferred to a clean tube with 100% ethanol.
wasp genus Shelfordia, were seen flying or Laboratory protocols. — For adult insects,
sitting on low vegetation over a period of DNA was extracted in the U.K. from sin-
several days. As no host records are known gle individuals stored in 100% ethanol by
for this genus we decided to observe them incubation at 37°C in Proteinase K for ap-
to see what they were attacking. Large bra- proximately 18 hours, followed by sodium
conine wasps are typically thought to be acetate /ethanol precipitation and re-sus-
parasitoids of wood-boring beetle or lepi- pension in 20|xl TE buffer. PCR reactions
dopteran hosts, and a large dead tree with were carried out in 50fxl volumes contain-
abundant signs of borer activity nearby ing 0.5(xl DNA extract, 0.5|xl Boehringer
seemed to be the obvious place for them to Taq, 1.25 fxl 20|xM primer, 1.25 |xl lOmM

DISCUSSION

Volume 9, Number 2, 2000 243

dNTPs and 5|xl buffer. PCR conditions of the D2 region that was readable for

were 30 cycles of 98°C denaturation (15 both (the small larva gave a weak se-

seconds), 48°C annealing (30 seconds) and quence). These sequences were aligned by

72°C extension (40 seconds) with an initial eye to each other and to those of a range

denaturation of 3 minutes at 93°C and a of other S.E. Asian Braconinae, including

final extension of 3 minutes. PCR products a similarly-sized species of the related ge-

were purified with Pharmacia Amersham nus Diamblomera Enderlein, collected in a

PCR purification kit and then sequenced similar site approximately 150 meters

directly using Amplitaq FS on an ABI 373 away (Quicke et al. 2000), and several oth-

automated sequencer. er braconines from Poring. Part of the

The parasitoid larva was stored in 95% alignment is shown in Figure 1, in which

ethanol and DNA extraction and sequenc- several features that are shared by both

ing was carried out in Helsinki. The larva the female Shelfordia and the parasitoid

was dried and ground in 50li1 TNE-buffer larva found are indicated in bold italics.
(1 M Tris, 5 M NaCl, 0.5 M EDTA) and
IliI proteinase K (Sigma Chemical Co.).

The samples were then incubated at 37°C The present findings of an identical 28S

overnight followed by sodium acetate D2 DNA sequence for both the adult Shel-

and ethanol precipitation, and resuspen- fordia and the parasitic wasp larva found

sion in 20 |jl1 TE-buffer (as TNE but with- on its anthribid host (Fig. 1) can only be

out NaCl). PCR reactions were carried out considered in the light of our knowledge

in 50 fxl volume reactions, 5 |xl 10 X Buffer of interspecific variation of this gene re-

II (Perkin-Elmer), 5 |xl of 25 nM MgCL, 2 gion within the Braconidae, and more pre-

|xl 10 llM primer, 3 llI of 10 nM dNTP, 0.25 cisely, the Braconinae. In the laboratory at

|xl Amplitaq DNA Polymerase, 31.75 luI Silwood Park, this gene region has been

H20 and 1 jxl DNA template. PCR condi- sequenced for more than 250 species of

tions after an initial denaturation at 94°C Braconidae and for 98 species of Braconi-

(2 min), were denaturation at 96°C (15 s), nae (Belshaw et al. 1998, in preparation),

annealing at 55°C (30 s), extension at 72°C On no occasion were any two species

(1 min) for 35 cycles and a final extension found to have identical sequences, even

72°C (7 min). congeneric species always differing by at

The larval PCR product was purified us- least two or three bases, and often by the

ing Nucleospin PCR Purification kit and presence of species-specific insertions or

then sequenced in both directions using Big deletions (the above-mentioned Braconi-

Dye terminators on an automatic sequencer nae data set includes 7 species each of Di-

ABI PRISM 377 (Perkin-Elmer). gonogastra Ashmead and of Bracon Fabri-

The beetle larva was identified as an cius). Note also that there are several dif-

anthribid by reference to Lawrence and ferences between the sequences of the two

Britton (1991). Specimens are deposited Nesaulax Roman species from Sabah se-

in The Natural History Museum, Lon- quenced (Fig. 1). Contamination of the

don. Full DNA sequences are in the samples is considered highly improbable

EMBL/GenBank/DDBJ databases; acces- because the specimens were not handled

sion numbers AJ231540, AJ231541 and by the same equipment, were placed in

AJ277499-AJ277504. separate clean vials, and DNA extraction

and sequencing was carried out in differ-
ent countries. This study emphasises the

The parasitoid larva and the putatively potential for the use of DNA sequence

conspecific Shelfordia adult produced iden- technology for making firm parasitoid/

tical sequences for the 480 base pair length host associations that would not otherwise

244

Journal of Hymenoptera Research

Shelf ordiaAD
Shelf ordiaLA
D i amb lomeraS
Nesaulax sp 1
Nesaulax sp 2
Pachybracon
Nedinoschiza
Cratobracon
Hybogaster

Shelf ordiaAD
Shelf ordiaLA
D i amb 1 ome r a S
Nesaulax sp 1
Nesaulax sp 2
Pachybracon
Nedinoschiza
Cratobracon
Hybogaster

TAATTGTAAGATGTTGTCGGCGTGCACTTCT
TAATTGTAAGATGTTGTCGGCGTGCACTTCT
TAATTGTAAGATGTTGTCGGCGTGCACTTCT
TAATTGTAAGATGTTGTCGGCGTGCACTTCT
TAATTGTAAGATGTTGTCGGCGTGCACTTCT
TAATTGTAAGATGTTGTCGGCGTGCACTTCT
TAATTGTAAGATGTTGTCGGCGTGCACTTCT
TAATTGTAAGATGTTGTCGGCGTGCACTTCT
TAATTGTAAGATGTTGTCGGCGTGCAcTTCT

CCCCTAGTAGGACGTCGCGACCCGT
CCCCTAGTAGGACGTCGCGACCCGT
CCCCTAGTAGGACGTCGCGACCCGT
CCCCTAGTAGGACGTCGCGACCCGT
CCCCTAGTAGGACGTCGCGACCCGT
CCCCTAGTAGGACGTCGCGACCCGT
CCCCTAGTAGGACGTCGCGACCCGT
CCCCTAGTAGGACGTCGCGACCCGT
CCCCTAGTAGGACGTCGCGACCCGT

TGAGT TTTTTTGTT - -GGT
TGAGT TTTTTTGTT - -GGT

TGAAT GTT--GGT

TGAGT GTTTCGGT

TGAGT TGTT--GGT

TGAGT GTT--GGT

TGAGTAC GTT--GGT

TGAGT TGTT--GGT

CTACGGCCCAAGTGGAAGCTTT
CTACGGCCCAAGTGGAAGCTTT
CTACGGCCCAAGTGGTAGCTTT
CTACGGCCCAAGTGGAAGCTTT
CTACGGCCCAAGTGGAAGCTTT
CTACGGCCCAAGTGGGAGCTTT
CTACGGCCCAAGTGGAAGCTTT
CTACGGCCCAAGTGGTAGCTTT
CTACGGCCCAAGTGGGAGCTTT

TAATAAATT-
TAATAAATT-

TAGTGAATT

TAATGAATT

TAATGAATG-AATT-

TAATGAATT

TAGTGAATGAAATTT

TAATGAATA

TAATGAATT

TTATTTATTAAAAA-CCCTTGGTGTT TCCTGACTGGCACTCGT

TTATTTATTAAAAA-CCCTyGGTGTT TCCTGACTGGCACTCGT

TTATTCATTGAAAA-CCCTTGGTGTT TCCTGACTGGCATTCGT

TTATTTATTGAAAA-CCCTTGGTGTT TCCTGACTGGCACTCGT

TTATTTGTTGAAAA-CCCTTGGTGTT TCCTGACTGGCACTCGT

TTATTCATTGAAAA-CCCTTGGTGTT ACCTGACTGGCACTCGT

TTATTCATTGAAAA-CCCTTGGTGTT TCCTGACTGGCACTCGT

TTATTCATTGAAAA-CCCTTGGTGTTGTTTCCTGACTGGCACTCGT
TTATTCATTGAAAAACCcTTGGTGTT TCCTGACTGGCGCTCGT

C GGT AT AT AC
C GGT AT AT AC
CGGTAT-T-C
CGGTAT-T-C
CGGTAA-T-C
CGGTAT-T-C
CGGTAT-T-C
CGGTAT-T-C
CGGTAT-T-C

Shelf ordiaAD

ATATGGTATTGA-

Shelf ordiaLA

ATATGGTATTGA-

DiamblomeraS

GTATGGTATTGA-

Nesaulax sp 1

GTATGGTATTGAT

Nesaulax sp 2

GTATGGTATTGA-

Pachybracon

GTATGGTATTGA-

Nedinoschiza

GTATGGTATTGA-

Cratobracon

GTATGGTATTGA-

Hybogaster

GTATGGTATTGA-

--GCCGCAT-TA-AT
--GCCGCAT-TA-AT

--GCCGCAT AT

CAGCCGCAT AT

--GCCGCAT AT

--GCCGCATAT--AT
--GCCGCATATATAT

--GCCGCA AT

--GCCGCAC AT

TA TATGCGT

knnnnnnnnnnnn

TA TATGCGT

TATATATATGCGT
TA ATATGCGT

CTAT--AT
nnnnnnnn
TCAT--AT
TCGT--AT
CCAAATAT
CCAT--AT
TCAT--AT
CCAT--AT
CCTT--GT

CTGTCGC
nnnnnnn
CTGTCGC
CTGTCGC
CTGTCGC
CTGTCGC
CTGTCGC
CTGTCGC
CTATCGC

Fig. 1. Manually aligned 28S D2 rDNA sequences including adult of the Shelfordia found probing the an-
thribid burrow (ShelfordiaAD), the larva found on the anthribid beetle larva (ShelfordiaLA), other braconines
from Poring (Diamblomera sp., Nesaulax spp 1 and 2 and Pachybracon sp.), and other large braconine wasps
from the Island of Borneo. Bases unique to the Shelfordia female and the putatively conspecific parasitoid larva
are indicated in bold italics.

be possible. Although DNA-based tech-
niques have been used to detect parasitoid
larvae inside their hosts (e.g., Greenstone
and Edwards 1998), and similar results
have been obtained recently for predatory
insects using traces of prey DNA remain-
ing in the predator's gut in a well char-
acterised predator-prey system (Agusti et
al. 1999), DNA has not yet been used
'blind' to determine hosts or prey in open
systems. We show here that DNA se-
quence data, in combination with a data
base of sequences of related taxa, has the
potential to greatly facilitate studies not
only on the autecologies of particular

hosts through providing data on their par-
asitoids, but also to allow construction of
fully quantitative food webs (e.g., Mem-
mott and Godfray 1993). In this latter case,
it also opens up the possibility of working
on groups that are notoriously difficult to
rear in isolation such as species that con-
sume rotting wood and their parasitoids.
With the addition of order-specific prim-
ers, it should also be possible to discover
and identify endoparasitoids.

ACKNOWLEDGMENTS

This work was funded in part by a British Council
CICHE link with the Universiti Malaysia Sabah and

Volume 9, Number 2, 2000

245

by the Natural Environment Research Council. We
are grateful to Professor Maryati Muhamed and Dr
Homathevi Rahman, Tropical Biodiversity and Con-
servation Unit, UMS for all their help and advice. Dr
Mark Shaw provided many helpful suggestions in
the preparation of this MS.

LITERATURE CITED

Achterberg, C. van. 1993. A new species of the genus
Shelfordia Cameron (Hymenoptera: Braconidae)
with very long ovipositor from NE India. Zoolo-
gische Mededelingen, Leiden 67: 365-373.

Achterberg, C. van and C. O'Toole 1993. Annotated
catalogue of the types of Braconidae (Hvmenop-
tera) in the Oxford University Museum. Zoologis-
che Verhandelingen, Leiden 287: 1^48.

Agusti, N., M. C. DeVicente and R. Gabarra. 1999.
Development of sequence amplified character-
ized region (SCAR) markers of Helicoi'erpa armi-
gera: a new polymerase chain reaction-based
technique for predator gut analysis. Molecular
Ecology 8: 1467-1474.

Belshaw, R., M. Fitton, E. Herniou, C. Gimeno and D.
L. J. Quicke. 1998. A phylogenetic reconstruction
of the Ichneumonoidea (Hymenoptera) based on
the D2 variable region of 28S ribosomal RNA.
Systematic Entomology 23: 109-123.

Cameron, P. 1902. On the Hymenoptera collected by
Mr. Robert Shelford at Sarawak, and on the Hy-
menoptera of the Sarawak Museum, journal of the
Straits Branch of the Royal Asiatic Society 37: 29-131.

Greenstone, M. H. and M. J. Edwards. 1998. DNA
hybridisation probe for endoparasitism by Micro-
plitis croceipes (Hymenoptera: Braconidae). An-
nals of the Entomological Society of America 91: 415-
421.

Laurence, J. F. and E. B. Britton. 1991. Coleoptera.
Chapter 35. The Insects of Australia (2,ul edition).
CSIRO, Melbourne.

Memmott, J. and H. C. J. Godfray. 1993. Parasitoid
webs. In J. LaSalle and I. D. Gauld eds, Hyme-
noptera and Biodiversity, pp. 217-234. CABI Inter-
national Press. VVallingford.

Noyes, J. S. 1994. The reliability of published host-
parasitoid records: A taxonomist's view. Norwe-

gian Journal of Agricultural Science Supplement 16:
59-69.

Quicke, D. L. J. 1982. The genus Shelfordia Cameron
(Hymenoptera: Braconidae): Discover)' of type
specimen, reclassification of species, new svn-
onymy and notes on related genera. Oriental In-
sects 15: 227-233.

Quicke, D. L. J. 1983. Reclassification of twenty spe-
cies of tropical, Old World Braconinae described
by Cameron, Strand and Szepligeti (Hvmenop-
tera: Braconidae). Entomologist's Monthly Maga-
zine 119: 81-83.

Quicke, D. L. J. 1984a. Three new genera of Indo-
Australian Braconinae (Hvmenoptera: Braconi-
dae). Entomologist's Monthly Magazine 120: 73-79.

Quicke, D. L. J. 1984b. Further reclassification of Afro-
tropical and Indo-Australian Braconinae (Hyme-
noptera: Braconidae). Oriental Insects 18: 339-353.

Quicke, D. L. J. 1985. Reclassification of some Indo-
Australian and Afrotropical Braconinae (Hyme-
noptera: Braconidae). Entomologist's Monthly
Magazine 121: 215-216.

Quicke, D. L. J. 1988. Reclassification of twentv-four
species of Old World Braconinae (Hym., Bracon-
idae). Entomologist's Monthly Magazine 124: 77-79.

Quicke, D. L. J. 1991. The Braconinae type specimens
of G. Szepligeti in Budapest (Hvmenoptera, Bra-
conidae). Annals Historico-Naturalis Museum Na-
tionalis Hungarici 83: 169-186

Quicke, D. L. J. and C. van Achterberg. 1990. The type
specimens of Enderlein's Braconinae (Hymenop-
tera: Braconidae) housed in Warsaw. Tijdschrifl.
voor. Entomologie 133: 251-264.

Quicke, D. L. J., G. Broad, N. M. Laurenne and J. Nai-
man. 2000. First possible host record for the brac-
onid wasp genus Diamblomera Enderlein (Bracon-
inae). Journal of Hymenoptera Research 9: 430-431.

Quicke, D. L. J. and F. Koch. 1990. Die Braconinae-
Typen der beiden bedeutendsten Hvmenopteren
Sammlungen der DDR. Deutsche Entomologische
Zeitschrift 37: 213-227.

Shaw, M. R. 1994. Parasitoid host ranges. In: B. A.
Hawkins and W. Sheehan (Eds). Parasitoid Com-
munity Ecology. Oxford University Press, Oxford,
pp. 111-144.

Shenefelt, R. D. 1978. Hymenopterorum Catalogus (Nova
Editio). Braconidae It). Junk, The Hague, pp. 1425-
1872.

J. HYM. RES.
Vol. 9(2), 2000, pp. 246-253

The Venezuelan Species of Pimpla (Hymenoptera: Ichneumonidae)

Francisco A. Diaz.

Urbanization Chucho Briceno, Segunda Etapa, Carrera 11, N° 282, Cabudare 3023, Lara,

Venezuela, Tlf. 051-619414, 051-592485, Fax: 051-592304; Departamento de Ciencias Biologicas,

Decanato de Agronomia, Universidad Centroccidental Lisandro Alvarado, Apartado 400,

Tarabana, Lara, Venezuela, e-mail: dbfrancis@hotmail.com.

Abstract. — The Venezuelan species of Pimpla (Hymenoptera: Ichneumonidae: Pimplinae) are re-
viewed. Four new species are described and illustrated: P. lasallei, P. mitchelli, P. vangeli and
P. vayonae. An identification key to 18 species is given, including the previously described spe-
cies: P. albomarginata Cameron, P. azteca Cresson, P. bolivari Porter, P. caeruleus Cresson, P. croceipes
Cresson, P. croceiventris (Cresson), P.flavipennis Enderlein, P. ichneumonifbrmis Cresson, P. platysma
Porter, P. punicipes Cresson, P. piyramis Porter, P. sanguinipes Cresson, P. sumichrasti Cresson and
P. tonnjris Schrottky. Pimpla croceipes, P. croceiventris, P. ichneumoniformis, P. pyramis and P. tomyris
are recorded for the first time in Venezuela.

Pimpla is a large genus represented in
almost all regions of the world, although
it does not seem to be present in Australia
and New Zealand (Gauld 1984, Gupta
1987). The species of Pimpla are idiobiont
parasitoids of lepidopterous pupae and
prepupae. Teran (1980) recorded the fol-
lowing host associations from Venezuela:
P. azteca from a pupa of Alabama argillacea
(Noctuidae); P. platysma from a pupa of
Antichloris eriphia (Syntomidae); P. punici-
pes from A. argillacea, Oiketicus sp. and Pla-
toeceticus sp. (Psychidae), and Phobetron
hipparchia (Eucleidae); P. sumichrasti from
a pupa of Hypsipylla grandella (Pyralidae).

Townes and Townes (1966) recorded 29
species as occurring in the Neotropics, but
only P. albomarginata, P. punicipes and P.
sanguinipes were cited from Venezuela.
Porter (1970) conducted the first taxonom-
ic study of the South America members of
the genus. He treated 35 species, of which
21 were described as new. Only P. bolivari
was described as new from Venezuela and
P. caeruleus was recorded for the first time
in this country. Gauld (1991) treated 17
Costa Rican species of which 8 are present
in Venezuela. These last two works must
be seen for a detailed review of the infor-

mation available on biology, etology and
host preferences.

MATERIALS AND METHODS

Species treated in this study were iden-
tified using the keys of Porter (1970) and
Gauld (1991) or through comparison with
material examined in The Natural History
Museum (British Museum) in 1996. Ap-
proximately 800 specimens of Pimpla were
examined. The following institutions pro-
vided specimens for this study:
BMNH: The Natural History Museum,

London, U.K.
MIZA: Museo del Instituto de Zoologfa
Agrfcola, Facultad de Agronom-
ia, Universidad Central de Vene-
zuela, Maracay, Venezuela.
UCOB: Museo Dr. J. M. Osorio, Depar-
tamento de Ciencias Biologicas,
Agronomia, Universidad Cen-
trooccidental Lisandro Alvarado,
Tarabana, Lara, Venezuela.
The nomenclatural treatment, morpholog-
ical terminology and taxonomic characters
used here follow the work of Gauld
(1991). Microsculpture terminology fol-
lows that of Eady (1968).

Volume 9, Number 2, 2000 247

KEY TO VENEZUELAN SPECIES OF PIMPLA

1. Metasoma with laterotergite V broad, more than 0.5 times as broad as long (Fig. 1); malar
space wide, as long as or longer than basal mandibular width, that of male more than

0.7 times basal mandibular width 2

- Metasoma with laterotergite V narrow, less than 0.3 times as broad as long (Fig. 2); malar
space narrow, less than 0.75 times as long as basal mandibular width, that of male less
than 0.6 times basal mandibular width (in P. flavipennis is more than 1.0 times basal
mandibular width) 3

2. Laterotergites II and III more than 0.5 times as broad as long, of similar width to later-
otergites IV and V (Fig. 1); female with posterolateral corner of mesopleuron usually
finely punctate; male hind tibia with central white band punicipes Cresson

- Laterotergites II and III less than 0.3 times as broad as long, clearly narrower than later-
otergites IV and V (Fig. 2); female with posteroventral corner of mesopleuron striated;
male hind tibia reddish sanguinipes Cresson

3. Forewing with Rs strongly sinuous (Fig. 3); tergite I of female rather slender, in profile
evenly convex 4

- Forewing with Rs more or less straight (Fig. 4); tergite I of female short and broad, in
profile generally strongly convex 10

4. Head and mesosoma predominantly yellow or orange, sometimes with black marks, fore-
wing with an apical black spot 5

- Head and mesosoma predominantly black or blackish brown; forewing without apical
black spot 7

5. Mesoscutum entirely yellow or orange 6

- Mesoscutum yellow with three longitudinal black stripes; female with tergites VI and VII

of metasoma almost entirely black sumichrasti Cresson

6. Metasoma predominantly orange, at most with only extreme anterior margins of tergites
I-IV black; propodeum smooth and polished azteca Cresson

- Metasoma predominantly yellow; female with tergites VI and VII of metasoma wholly
black; propodeum with several strong transverse wrinkles mitchelli sp.n

7. Metasoma black with extensive yellow marks 8

- Metasoma black without yellow marks, sometimes apical margins of tergites with a
brownish tinge 9

8. Ovipositor very strongly flattened beyond basal 0.5; mesopleuron without wrinkles in
posteroventral corner platysma Porter

- Ovipositor stouter and not strongly flattened; posteroventral corner of mesopleuron with
some wrinkling tomyris Schrottky

9. Antenna brownish; forewing yellowish with entire anterior margin stronglv infumate;
basal 0.5 of tergite I closely and coarsely punctate ichneumoniforniis Cresson

- Antenna black; forewing uniformly yellow; tergite I almost wholly smooth

flavipennis Enderlein

10. Apex of clypeus deeply bilobed (Fig. 5); forewing with cu-a slightly distal to the base of

Rs & M 11

- Apex of clypeus slightly concave; fore wing with cu-a opposite to the base of Rs & M . . . . 16

11. Mesoscutum entirely black; propodeum without conspicuous posterolateral tubercles .. 12

- Mesoscutum black with white marks; propodeum with conspicuous posterolateral tuber-
cles 14

12. Tergite I in profile with high, more or less sharply pyramidal hump; all coxae black;

mesopleural suture strongly foveolate pyramis Porter

Tergite I in profile with moderately high blunt hump; coxae without black markings;
mesopleural suture weakly foveolate 13

13. Sternite I with strongly produced swelling, postscutellum black; fore coxa white; meta-
soma black and white banded albotnarginata Cameron

248

Journal of Hymenoptera Research

Figs. 1-5. Pimpla. 1-2, Metasoma, lateral view, showing laterotergites (It): 1, P. punicipes; 2, P. sumichrasti. 3-
4, Fore wing: 3, P. sumichrasti; 4, P. lasallei. 5, P. lasallei. Clypeus, anterior view.

Ventral swelling on sternite I rather low and rounded; postscutellum pale yellow; forecoxa
pale yellow; metasoma black and white with reddish-brown tinge that becomes stronger
on tergites VI and VII bolivari Porter

14. Ovipositor stout; tergites VI and VII reddish with apical margins yellowish; sternite I

yellowish-brown lasallei sp.n

Ovipositor thin and short; tergites VI and VII black and white banded or uniformly
reddish; sternite I black 15

15. Tergite I short, almost as long as apical width; propleuron with two white marks; hind
tibia black with premedial white band vayonae sp.n

- Tergite I 1.5 times as long as apical width; propleuron wholly black; hind tibia reddish,

its extreme base black and premedial band yellow vangeli sp.n

16. Body metallic blue, wings blackish; male with forecoxa white marked anteriorly

caernlea Cresson

- Body not metallic, head and mesosoma black, wings hyaline 17

17. Metasoma and hind coxa uniformly black; hind tibia bright yellow croceipes Cresson

- Metasoma and hind coxa reddish; hind tibia orange croceiventris (Cresson)

Pimpla mitchelli Diaz, new species

Holotype female. — Forewing length 13.5
mm. Head in dorsal view moderately
short, with genae rounded behind eyes;
frons strongly concave; posterior ocellus
separated from eye by diameter of ocellus.
Mandibles moderately long, strongly and
evenly tapered, with upper tooth approx-

imately 1.6 times the length of lower
tooth; clypeus in profile weakly convex
basally, apically flat; clypeus in anterior
view 2.5 times as wide as medially long,
with apical margin very slightly concave;
malar space 0.4 times as long as basal
mandibular width; lower face centrally
weakly convex, smooth and shining, with

Volume 9, Number 2, 2000 249

few irregularly dispersed punctures under somere I of foreleg, tarsomeres 3-5 of mid-
the antennal sockets. Mesoscutum pol- die leg, hind tarsus except basitarsomere,
ished, with fine punctures separated by apical half of hind tibiae, two rounded
about 1.0 X their diameter; weakly convex; spots in the middle of tergite I, anterior
scutellum polished with few dispersed margin of tergite II-V and posterior mar-
fine punctures separated by about 1.5 X gin of tergites I- V, dark brown to blackish,
their diameter. Mesopleuron highly pol- Wings with slight yellow tinge and with
ished, with few and sparse puctures sep- distinct subapical blackish spot. Pterostig-
arated by about 3.0 X their diameter, pos- ma yellow.

terodorsally smooth; epicnemial carina Etymology. — This species is dedicated to

reaching above level of centre of prono- Pam Mitchell for her generosity and her

turn; metapleuron convex, smooth and contribution to the study of Neotropical

polished, with punctures only along its Icheneumonidae.

upper margin; submetapleural carina Remarks. — P. mitchelli belongs to the sum-
strongly raised in anterior part, evanes- ichrasti species-group. It differs from P. sum-
cent in posterior 0.4 of metapleuron. Pro- ichrasti in having the mesoscutum, meso-
podeum in profile rounded; pleural carina pleuron, propodeum, and mid and hind
absent; anterior 0.5 of the dorsal surface coxae orange. It differs from P. azteca and
with several strong transverse wrinkles, the Central American species P. personni in
posterior 0.5 smooth. Forewing with distal the coloration of the metasoma. The only
abscissa of Rs strongly sinuous; cu-a distal specimen at hand was collected with a net.
to base of Rs & M by 0.2 times its own Nothing is known about its biology,
length; discosubmarginal cell densely se- Material examined. — Holotype 9, Vene-
tose; abscissa of Cul between lm-cu and zuela, Bolivar State, Caicara- San Juan de
Cula as long as Culb. Tergite I of meta- Manapiare road, km 210, 30. m, iv-1976
soma short and stout, almost as long as (Gelvez & Salcedo) (MIZA).
apical width, smooth; tergite I in lateral
view with dorsal surface weakly convex; Pimpla lasallei Diaz, new species

sternite I not clearly swollen centrally; ter- Holotype female. — Forewing length 12
gite II highly polished, with disperse mm. Head in dorsal view moderately
punctures in anterior part, punctures sep- short, with genae reduced behind eyes;
arated by about 1.5X their diameter, pos- frons strongly concave; posterior ocellus
terior part smooth, anterolaterally with separated from eye by 0.6 times diameter
well-defined oblique grooves; tergites III- of ocellus. Mandible of moderate length,
V similar, but with oblique grooves pro- strongly and evenly tapered, with upper
gressively weaker on succeeding seg- tooth 1.5 times length of lower; clypeus
ments; laterotergites II-V narrow and in- basally moderately convex, apically flat-
conspicuous, less than 0.2 times as broad tened; clypeus in anterior view 1.7 times
as long. Ovipositor sheath 0.8 times as as broad as medially long, apically bilo-
long as hind tibia; apex of ovipositor sub- bate; malar space 0.8 times as long as basal
cylindrical, with upper valve smooth and mandibular width; lower face centrallv
lower valve with 7 ridges that do not ex- weakly convex, shallowly and closely
tend laterally. Color: Predominantely or- punctate, punctures separated by about
ange. Mandibular teeth, small D-shaped 0.5 X their diameter. Mesoscutum slightly
spot between posterior ocellus and eye, polished, shallowly punctate, punctures
small triangular spot under median ocel- separated by about 0.5 X their diameter;
lus, scape and pedicel dorsally, flagellum, scutellum convex, smooth. Mesopleuron
scuto-scutellar sulcus, tergite VI, and most slightly polished, with punctures separat-
of tergite VII, black. Posterior half of tar- ed by about 1.0X their diameter, epicne-

250 Journal of Hymenoptera Research

mial carina reaching above level of centre with irregular D-shaped whitish spot on

of pronotum; metapleuron moderately proximal end dorsally, trochanter and tro-

convex, coarsely striate; submetapleural chantellus yellow, femur brown, tibia with

carina complete, anteriorly raised. Propo- proximal end brown, its basal half yellow-

deum in profile moderately declivous, ish and its apical half brown, tarsomeres

posterolateral tubercles slightly pointed; orange, progressively darker. Wings with

pleural carina incomplete; dorsal surface slight yellowish tinge. Pterostigma yellow-

of propodeum centrally strongly striate, orange.

striae crossing tubercles, anteriorly weakly Male. — Similar to female but with fore

striated, posteriorly smooth and polished, wing length 8.3 mm; malar space 0.6 times

Forewing with distal abscissa of Rs as long as basal mandibular width; dis-

straight; cu-a distal to base of Rs&M by cosubmarginal cell with glabrous area

less than 0.2 times length of cu-a; disco- only below pterostigma; color as female

submarginal cell with glabrous area along except that metapleuron and mesoscutum

veins Rs&M, Cu 1 and 1 m-cu; abscissa of in front of tegulae without white spots.

Cu 1 between 1 m-cu and Cula 1.8 times Etymology. — This species in named in

as long as Culb. Tergite I of metasoma honor of John LaSalle for his studies on

moderately long, 1.7 times as long as api- Neotropical Eulophidae and his spirit of

cal width; tergite I in lateral view slightly friendly collaboration,

convex, lateral carina distinct on spiracle. Remarks. — P. lasallei belongs to the al-

Sternite I moderately long, weakly swol- bomarginata group. It is easily recognized

len just behind its centre; tergite II smooth, by its large size, the strongly produced

with few irregularly sparse and shallow ventral swelling on sternite 1, and its color

punctures, anterolaterally with deep pattern.

oblique grooves. Tergites III-V similar, an- Biological notes. — P. lasallei has only been

terolateral grooves becoming progressive- found in Venezuela. Two specimens were

ly weaker; laterotergites III-V narrow and taken with a net in a typical rain forest,

inconspicuous, 0.2 times as broad as long. No host records are available for this spe-

Ovipositor sheath 0.6 times as long as cies.

hind tibia; apex of ovipositor depressed, Material examined. — Holotype 9, Vene-
the lower valve not laterally expanded, zuela, Lara State, Yacambu National Park,
Color: Predominantly black. Clypeus La Pastora, 1600 m, III - 1981 (F. A. Diaz
brown-reddish. The following whitish- & C. Pereira) (UCOB). Paratype. Venezue-
yellow: scape ventrally, palpi, upper and la: Lara State, Yacambu National Park, 1
anterior margins of pronotum, propleu- M, same data as holotype (UCOB).
ron, lateral margin of mesoscutum, nar-
row stripes along position of notauli that Pitnpla vayonae Diaz, new species

reach scutoscutellar sulcus, scutellum, Holotype female. — Forewing length 7.3

small crescentic spot on postscutellum, mm. Head in dorsal view short, with ge-

upper margin of tegula, subalar promi- nae constricted behind eyes; frons strongly

nence, two elongate spots on epicnemiun, concave. Posterior ocellus separated from

antero-dorsal area of mesepisternum, cir- eye by about 0.6 diameter of ocellus. Man-

cular spot on the lower-posterior part of dibles moderately long, evenly tapered,

mesepisternum, mesepimeron, drop- with upper tooth about 2.0 times length of

shaped spot on the upper area of meta- lower; clypeus in anterior view 2.0 times

pleuron, propodeal tubercles, and poste- as broad as medially long, apically strong-

rior margin of tergites. Fore and middle ly bilobate; malar space 0.8 times as long

legs yellowish, excepting for orange of as basal mandibular width; lower face

dorsal area of femora. Hind coxa brown centrally weakly convex, with shallow

Volume 9, Number 2, 2000 251

punctures separated by about 0.7X their soepimeron, propodeal tubercles, posteri-
diameter. Mesoscutum shining with punc- or half of propodeum except area petio-
tures separated by about 0.7X their di- laris, hind margin of all tergites. Foreleg
ameter; scutellum convex, smooth. Meso- with coxa except extreme base, trochanter,
pleuron highly polished, ventrally with inner face of trochantellus, stripe along in-
close punctures separated by about 1.5X ner face of femur, apex of outer face of
their diameter, dorsoposteriorly smooth; femur, and inner and outer faces of tibia
epicnemial carina reaching above level of white. Remainder of trochantellus, femur,
centre of pronotum. Metapleuron moder- and tibia, orange. Tarsus orange, tarso-
ately convex, dorsally with some striae mere V darker. Middle leg with coxa
and coarse punctures separated by about white, except for orange dorsal face; tro-
IX their diameter, ventrally with sparse chanter, trochantellus, and femur orange;
fine punctures separated by about 2X tibia with its basal 0.2 and apical 0.3 dark
their diameter; submetapleural carina brown, its central part white; tarsus dark
complete, raised anteriorly. Propodeum in brown, tarsomere V blackish. Hind leg
profile weakly declivous, with strong and with coxa reddish, its dorso-anterior face
blunt tubercles posterolaterally; pleural with circular white mark; trochanter, tro-
carina only present anteriorly; dorsal sur- chantellus and femur, red; tibia black with
face of propodeum anteriorly transversely a premedial white ring. Tarsus black,
weakly wrinkled, area between tubercles Wings hyaline. Pterostigma black with
smooth and shining. Forewing with ab- base and apex whitish,
scissa of Rs straight; cu-a distal to base of Male. — Unknown

Rs&M by 0.3 times its own length; disco- Etymology. — This species is named in
submarginal cell moderately setose, with honor of Venezuela Carrizo Ayona for her
setae more sparse toward margin of generosity and spirit of collaboration.
Rs&M; abscissa of Cul between lm-Cu Remarks. — P. vayonae belongs to the al-
and Cula 1.6 times as long as Culb. Ter- bomarginata species complex, and is relat-
gite I very short and stout, almost as long ed to P. vangeli and the Mesoamerican P.
as apical width; tergite I in lateral view edgari Gauld. All three species have the
convex; sternite I short, strongly swollen ovipositor short and thin. P. vayonae dif-
just before its centre, with swelling direct- fers from P. vangeli and P. edgari in the
ed forward. Tergite II microaciculate and coloration of propleurum, mesopleurum
shining, anterolaterally with deep oblique and hind legs, and in having tergite I al-
impressions; tergites III-V similar, with most quadrate and the propodeum weak-
anterolateral furrows becoming progres- ly striated.

sively weaker. Laterotergites II-V narrow Biological notes. — P. vayonae has only
and inconspicuous, 0.2 times as broad as been found in Venezuela. The specimen
long. Ovipositor short and thin; ovipositor was collected in a Malaise trap situated in
sheath 0.4 times as long as hind tibia; apex a coffee-Macadamia area. Nothing is
of ovipositor cylindrical. Color: Predomi- known about its biology,
nantly black. The following white: Ventral Material examined. — Holotype F. Venezue-
face of scape, palpi, upper and anterior la: Lara state: Villanueva, Finca "Las Lo-
margins of pronotum, two oval marks on mas", 900m. III-1994 (F.A.Diaz) (UCOB).
propleurum, two triangular marks on an-
terior margin of mesoscutum which run Pimpla vangeli Diaz, new species

backward along notauli, scutellum, post- Holotype Female. — Forewing length 9.3-

scutellum, tegula, subalar prominence, an- 9.6 mm. Head in dorsal view short, with

terodorsal area of mesepisternum, circular genae constricted behind eyes; frons

spot located just above middle coxa, me- strongly concave; posterior ocellus sepa-

252 Journal of Hymenoptera Research

rated from eye by 0.4-0.6 times diameter low-brownish. The following white: Dor-
of ocellus. Mandibles of moderate length, sal and anterior margins of pronorum, an-
strongly and evenly tapered, with upper terolateral margin of mesoscutum, narrow
tooth 1.5-1.6 times length of lower; clyp- stripe along notauli, tegula, scutellum,
eus in profile moderately convex, apically subalar prominence, mesopleuron, pro-
flattened; clypeus in anterior view 1.6-1.7 podeal tubercles, posterior half of propo-
times as broad as medially long, apically deum and hind margin of tergites I-IV.
bilobate; malar space 0.7-1.0 times as long Posterior half of tergite V and tergites VI
as basal mandibular width; lower face and VII reddish. Foreleg with coxa white,
centrally weakly convex, with shallow its inner basal extreme blackish; trochan-
punctures separated by 0.7 X their diame- ter whitish; trochantellum whitish except
ter. Mesoscutum slightly polished, with for orange inner face; femur, tibiae, and
shallow punctures separated by about tarsus orange. Middle leg with coxa yel-
0.5 X their diameter; scutellum convex, lowish, its outer face orange, basal and
smooth. Mesopleuron weakly polished, apical extremes infuscated, rest of middle
evenly, finely and closely punctate, the leg orange excepting for lighter premedial
punctures separated by 0.5 X their diame- area of tibia. Hind leg with coxa reddish,
ter; epicnemial carina reaching above level its outer face with D-shaped whitish mark
of centre of pronorum. Metapleuron con- and its apex black; femur reddish with
vex, coarsely striate; submetapleural cari- apex black; tibia reddish with its basal 0.1
na distinct, complete, anteriorly sharply black, and premedial area yellow, its outer
raised. Propodeum in profile slightly in- face darker than inner face; tarsi dark
clivous, pleural carina present only ante- brown. Wings weakly and evenly infus-
riorly; dorsal surface of propodeum ante- cated. Pterostigma blackish,
riorly transversely wrinkled, posteriorly Male. — Similar to female but with fore
with pair of strong and blunt turbercles, wing length 8.1 mm, malar space 0.7 times
area between turbercles smooth and shin- as long as basal mandibular width, pro-
ing. Fore wing with distal abscissa of Rs podeal wrinkles weaker, tergite I longer
almost straight; cu-a distal to the base of and tergites II- VII with abundant setifer-
Rs&M by 0.3 times length of cu-a; disco- ous punctures.

submarginal cell evenly and densely se- Eh/mologi/. — This species is named in

tose; abscissa of Cul between lm-Cu and honor of Angel Luis Viloria (University of

Cula 1.7-1.8 times as long as Culb. Ter- Zulia, Venezuela), for his dedication to the

gite I of metasoma moderately short and study of Satyridae (Lepidoptera) and for his

stout, 1.5 times as long as apical width; unique concept of friendship and solidarity,

tergite I in lateral view strongly convex; Remarks. — P. vangeli belongs to the al-

lateral carina present only posteriorly, bomarginata species complex. It can be eas-

Sternite I moderately long, strongly swol- ily distinguished by its short and thin ovi-

len just before its centre, apex of swollen positor, the color of metasoma and hind

area directed anteriorly. Tergite II mi- legs and the wings evenly infuscated.

croaciculate, weakly polished, anterolat- Three specimens collected with a net are

erally with oblique grooves. Tergites III-V at hand. No details of the biology of this

similar; laterotergites II-V narrow and in- species are known.

conspicuous, less than 0.2 times as broad Material examined. — Holotype O. Vene-

as long. Ovipositor very short and thin; its zuela: Lara state: Rio Claro,1200 m, v-1973

sheath 0.4 times as long as hind tibia; apex (J. M. Osorio and R. Gonzalez) (UCOB). Par-

of ovipositor depressed. Color: Predomi- atypes: Venezuela. 1 female, Lara state, San-

nantly black with clypeus and mandibles are, 1350m, VII-1993 (A. J. Escalona)

brown, palpi yellowish, apex of scape yel- (BMNH). 1M, Lara state, 8 km SE Sanare,

Volume 9, Number 2, 2000

253

La Capilla, 1800 m, 11-1993 (F. A. Diaz)
(UCOB).

ACKNOWLEDGMENTS

This study was supported by the project 03-5A-93
of the Consejo de Desarrollo Cientifico, Humanfstico
y Tecnologico, Universidad Centroccidental Lisandro
Alvarado, Barquisimeto, Lara, Venezuela and a grant
from The Darwin Initiative, London, UK. I am espe-
cially grateful to Ian Gauld, Pam Mitchell, John La
Salle, Angel Viloria, Venezuela Carrizo, David Wahl,
and the institutions that provided specimens for this
study.

LITERATURE CITED

Eady, R. D. 1968. Some illustrations of microsculpture
in the Hymenoptera. Proceedings of the Royal En-
tomological Society of London (A) 43: 66-72.

Gauld, I. D. 1984. An Introduction to the Ichneumon-
idae of Australia. British Museum (Natural His-
tory), London. 413 pp.

Gauld, I. D. 1991. The Ichneumonidae of Costa Rica,
1. Memoirs of the American Entomological Institute
47: 1-571.

Gupta, V. 1987. The Ichneumonidae of the Indo-Aus-
tralian area (Hymenoptera). Memoirs of the Amer-
ican Entomological Institute 41: 1-1210.

Porter, C. C. 1970. A revision of the South American
species of Coccygomymus (Hymenoptera: Ichneu-
monidae). Stadia Entomologica 13 (1-4): 1-192.

Teran, J. 1980. Lista preliminar de Hymenoptera par-
asitos de otros insectos en Venezuela. Revista de
la Facultad de Agronomia (Maracay) XI (1^4): 238-
389.

Townes, H. and Townes, M. 1966. A catalogue and
reclassification of the Neotropic Ichneumonidae.
Memoirs of the American Entomological Institute 8:
1-367.

J. HYM. RES.

Vol. 9(2), 2000, pp. 254-270

Family Group Names in Braconidae (Hymenoptera: Ichneumonoidea)

R. A. Wharton and C. van Achterberg

(RAW) Biological Control Laboratory, Department of Entomology, Texas A&M University,

College Station, Texas 77843-2475, USA; (CVA) Afdeling Entomologie (Hymenoptera), Nationaal

Natuurhistorisch Museum, Postbus 9517, 2300 RA Leiden, The Netherlands

Abstract. — The known family-group names for Braconidae are listed with their authors and
dates of publication. The status of the 224 previously proposed names is reviewed, with particular
attention to the validity and priority of names used by nineteenth century authors.

The family Braconidae is exceptionally
diverse. It is the second largest family
within the Hymenoptera, and contains
over 15,000 described species. Consider-
able attention has been given to the clas-
sification of the Braconidae in recent years,
including the production of comprehen-
sive catalogs and regional synopses and
the publication of several treatises on
higher order relationships within the fam-
ily (e.g., Shenefelt 1969, 1980, Fischer 1971,
1972, Capek 1965, 1970, Mackauer and
Stary 1967, Mackauer 1968, Tobias 1976b,
1986, Mason 1981a, 1983, van Achterberg
1984, Quicke and van Achterberg 1990,
Shaw and Huddleston 1991, Wharton et
al. 1992, 1997, van Achterberg and Quicke
1992). There have been numerous changes
in the subfamily classification, and shifts
in rank are commonplace. In the same
year, for example, Sharkey (1993) and van
Achterberg (1993) recognized 29 and 43
subfamilies, respectively, in the Braconi-
dae. As subfamilies, tribes, and subtribes
are either combined into larger units or
split into smaller ones, it is essential to
know which family-group names are
available, and which have priority. The
following discussion on available family-
group names is therefore offered to facili-
tate the correct application of family-
group names to braconid taxa. We wel-
come further discussion on this matter.

INTERNATIONAL CODES OF
ZOOLOGICAL NOMENCLATURE

As noted by Menke (1997), there have
been detailed presentations on how the
Third Edition of the International Code of
Zoological Nomenclature (ICZN 1985) ap-
plies to family-group names in other
groups of Hymenoptera (Fitton and Gauld
1976, Michener 1986). The recently pub-
lished Fourth Edition (ICZN 1999) con-
tains only a few pertinent additions. We
therefore present a brief discussion here,
focusing of those provisions of particular
relevance to the Braconidae. Some knowl-
edge of the history of braconid classifica-
tion relative to the development of various
Codes or Regies is also necessary for a
complete understanding of the rationale
for earlier name changes. Prior to the pub-
lication of the 1961 version of the Code
(ICZN 1961), for example, replacement of
a family-group name was a standard and
acceptable practice when its type genus
was discovered to be a junior synonym.
This practice was disallowed under the
1961 Code for names falling into synony-
my after 1960. Nevertheless, some of the
older replacement names have become
well established in the Braconidae, and are
still used today (Article 40.2).

Names not based on genera are not
available (Article 11.7). This applies to the
names used by Wesmael (1835) to group

Volume 9, Number 2, 2000

255

genera within the Braconidae, names that
were nevertheless adopted by most sub-
sequent authors through the first half of
the 20th century. A family-group name
proposed after 1930 must also be accom-
panied by a statement of characters differ-
entiating the group, or reference to same,
or be a replacement name (Article 13).
Though there are few such cases in the
Braconidae, it is not always clear when
these names have met the criteria for
availability in subsequent publications.
Article 13.2.1, a new section added to
ICZN (1999), further complicates this
problem.

Articles 35.4 and 40.2 apply to the au-
thorship and dates of availability of fam-
ily-group names affected by replacements
for unjustified emendations or synony-
mies. We agree with Menke (1997) that the
results are not particularly satisfying
(since a name could then become available
before the birth of its author), but we ac-
cept this, and have noted those cases be-
low. Similarly, there are a few family-
group names in the Braconidae that are in-
valid because the type genus is a junior
homonym (Article 39).

ASSESSMENT OF RELEVANT
LITERATURE

The works of Nees von Esenbeck (1812,
1814, 1816) represent the first attempt to
establish a hierarchical framework for the
Braconidae. Working in close association
with Gravenhorst, who had just published
his first significant monograph on the
Icheumonidae (Gravenhorst 1807), Nees
concentrated on the "Ichneumonides ad-
sciti," which contained the species now in-
cluded in the Braconidae. In this series of
papers (dated 1811-1813, but actually
published from 1812-1816), Nees used the
word "familia" to denote both groups of
species within a genus as well as groups
of genera. He also gave collective names
to some of these groups of species and
two of the groups of genera. The collective
names used in this series of papers include

names later used to establish formal ge-
neric and suprageneric categories in sub-
sequent papers (Nees von Esenbeck 1819,
1834). The collective names so used by
Nees were Cheloni, Sigalphi, Microgas-
teres (-i), Agathides, Bracones, and Bassi.
The first four names were clearly used in
the sense of groups of species within a ge-
nus, though this is not apparent unless all
three parts of the series are examined. The
genus Sigalphus Latreille, for example, was
divided into "Familia I. Sigalphi" (Nees
von Esenbeck 1816, p. 247) and "Familia
II. Cheloni" (Nees von Esenbeck 1816, p.
260). The 18 nominal species treated by
Nees (1816) under his "Familia II. Che-
loni" were all listed in binominal form
with Sigalphus as the genus name. These
four names thus do not satisfy Article
11.7.1.2 (ICZN 1999) for establishment of
family group names. Nevertheless, there
has been some confusion in this regard,
with the subfamily names Agathidinae,
Cheloninae and Microgastrinae variously
attributed to Nees, Blanchard (1845) or
Foerster (1862) over the past 30 years.

The names Bracones Nees von Esen-
beck, 1812 and Bassi Nees von Esenbeck,
1812, however, were used in a hierarchical
sense to denote suprageneric groups. The
nominal genera included in Bracones were
Stephanus Jurine, Bracon ¥., Microgaster La-
treille, Microdus Nees, and Agathis Latreil-
le (Nees von Esenbeck 1812, 1814). Nom-
inal genera included in Bassi were Bassus
Nees, Eubazus Nees, Helcon Nees, Sigal-
phus, and Ichneutes Nees (Nees von Esen-
beck 1814, 1816). Bracones and Bassi are
the oldest available family group names
known to us for members of what is now
the family Braconidae. The family name
Braconidae can thus be attributed to Nees
(1812). Bassinae Nees (available from Nees
1812, but not completely described until
Nees 1814, p. 200) is unfortunately prob-
lematic, since it is based on Bassus Nees,
1814. Nees (1814) inexplicably proposed
the name Bassus for Ah/sia Latreille, 1804,
citing Latreille's Alysia on the line follow-

256 Journal of Hymenoptera Research

ing "Bassus mihi." Nees (1814) failed to presented classifications or arrangements
cite the use of the name Bassus by Fabri- of parasitic wasps in general or ichneu-
cius (1804), which, based on the accepted mons in particular. Several adopted the
type species Ichneumon calculator F., 1798, names proposed by Nees (1812, 1814,
belongs to the Agathidinae rather than the 1834) and Leach (1815) to designate
Alysiinae. While it is also possible that groups of genera, while others proposed
Nees simply misidentified Bassus Fabri- additional names. Most of the newly pro-
cius (following the interpretation of Bassus posed names in these early publications
by Spinola (1808) and others), Nees (1814) were not based on included genera and
nevertheless used the term "mihi" when thus do not satisfy the requirements of the
describing Bassus, leading to uncertainty current Code of Zoological Nomenclature
in the application of the name. The family (ICZN 1999) for availability of family-
group name Bassi is thus based on a junior group names. To our knowledge, only two
objective synonym (of Alysia) as well as a other authors proposed valid, family-
junior homonym (of Bassus F.). group names prior to the work of Foerster

Nees (1819) eventually recognized Alysia, (1862). These were Haliday (1833b) and

and later (Nees 1834) replaced the family Blanchard (1845).

group name Bassi with Alysioideorum. Ear- Haliday (1833a) presented an outline of
lier, however, Leach (1815) proposed Aly- his classification of the parasitic Hyme-
siada and Stephens (1829) proposed Alysi- noptera of Britain, then filled in the out-
idae as family-group names for the species line with descriptions of the genera and
placed in Alysia. Thus, the subfamily name species in subsequent issues of the Ento-
Alysiinae dates from Leach (1815), though mological Magazine. In a "Tabula Synop-
it is often credited to Stephens (1829). Since tica," Haliday (1833b) proposed a division
the family group name Bassi was replaced of Nees' Ichneumones adsciti into 4 tribes:
well before 1961, and the replacement name Aphidini, Sigalphini, Braconii, and Agath-
has won general acceptance, Article 40.2 enses. The currently used family-group
(ICZN 1999) would appear to apply, and names Agathidinae, Aphidiinae, and Si-
Bassinae would therefore become a syno- galphinae should therefore be attributed
nym of Alysiinae. Nevertheless, Article 39 to Haliday (1833b). Haliday's proposal of
(ICZN 1999) also applies, and Bassinae, valid family-group names is often over-
based on a junior homonym, is thus invalid, looked because Haliday did not use these
If, however, Bassus Nees is treated as a mis- names in the remainder of his work, and
identification of Bassus Fabricius, then Bas- later, Haliday (1840) unfortunately aban-
sinae could be viewed as a senior synonym doned this arrangement in favor of the di-
of Agathidinae. As stability would be af- visions used by Wesmael (1835). Wes-
fected in this case (by the resurrection of mael's names (Cyclostomes, Areolaires,
Bassinae after 163 years), Articles 41 and 65 Polymorphes, and Cryptogastres), though
(ICZN 1999) apply, and the matter would unavailable from the standpoint of formal
have to be referred to the Commission. As family-group taxa, were nevertheless
all internal evidence points to Bassus Nees widely used by subsequent authors well
as a separate taxon from Bassus F., it seems into the 20th century,
logical to treat Bassinae as invalid due to Blanchard (1845) was the next author to
homonymy of the type genus. propose new family-group taxa in a manner

The first three family-group names ap- consistent with the Code. Blanchard (1845)

plicable to our current concept of the fam- arranged the braconid genera known to him

ily Braconidae were thus proposed by into six named groups. Four of these had

Nees (1812) and Leach (1815). Several oth- already been proposed as family-group

er early workers, some predating Nees, names (Nees 1812, Leach 1815, Haliday

Volume 9, Number 2, 2000

257

1833b). The remaining two, Hybrizonites
(containing Hybrizon F., Ephedrus Haliday,
and Praon Haliday) and Opiites (containing
17 genera), are the oldest valid and avail-
able names for their respective family-group
taxa. The subfamily name Opiinae thus
dates from Blanchard (1845). Blanchard
clearly states that he followed the classifi-
cation of earlier authors fairly closely, but
his hierarchical arrangement and use of
names based on included genera makes it
easier to recognize these unequivocally as
family-group taxa. Paxylommatinae is cur-
rently treated as a subfamily within Ichneu-
monidae, and as a senior synonym of Hy-
brizontinae. Previously (Shenefelt 1969, Ma-
son 1981b) the oldest family-group name for
this taxon was thought to be Pachylomma-
toidae Foerster, 1862.

Throughout the 19th century, the fami-
ly-group name based on Sigalphus Latreil-
le was largely used in a very different
sense than it is today. Blanchard (1845)
presented a clear picture of the earliest use
of the name for a group of genera contain-
ing Sigalphus, Chelonus Jurine, and Triaspis
Haliday. When used in this sense, Sigal-
phinae is thus a senior synonym of Che-
loninae. After Foerster's (1862) description
of the Chelonoidae, and his separation of
Chelonoidae from Sigalphoidae, however,
the subfamily name Sigalphinae was gen-
erally misapplied to a group of helconines
now known as the Brachistini. It was not
until Viereck (1914) finally tied the name
Sigalphus to its correct type species that the
subfamily name took on its present mean-
ing (Baker 1926).

Most of the better-known subfamily and
tribal names in use today date from the
work of Foerster (1862), who proposed a
large number of family-group names for
the Braconidae. Foerster proposed the fol-
lowing as new: Chelonoidae and Micro-
gasteroidae (validating the species group
names used by Nees), Blacoidae, Brachis-
toidae, Dacnusoidae, Diospiloidae, Doryc-
toidae, Eumicrodoidae, Euphoroidae, Eu-
spathioidae, Exothecoidae, Hecaboloidae,

Helconoidae, Hormioidae, Ichneutoidae,
Liophronoidae, Macrocentroidae, Perilito-
idae, Rhyssaloidae, and Rogadoidae. Of
these names, Liophronini is currently
treated as a synonym of Euphorini within
the Euphorinae (based on the classification
of Shaw (1985)), Euspathioidae is based on
an unjustified emendation (Euspathius
Foerster, 1862) of Spathius Nees, 1819
within the Doryctinae, and Eumicrodoi-
dae may also be based on an unjustified
emendation, though unlike Euspathius,
Foerster did not explicitly propose Eumi-
crodus Foerster, 1862 as an emendation for
Microdus Nees, 1814 (only implying as
much by his selection of the same type
species). Eumicrodini could therefore also
be interpreted as an unused senior syno-
nym of Microdini (as the latter is defined
by Sharkey (1992)) within the Agathidi-
nae. With the exception of these three
(Liophronoidae, Eumicrodoidae, Euspa-
thioidae), all other family-group names
proposed by Foerster (1962) are currently
in use as either tribes or subfamilies with-
in the Braconidae. In those cases where
several of these taxa are combined as
tribes under a single subfamily, the pri-
ority of the subfamily name has been es-
tablished solely on the basis of historical
usage (essentially following a first reviser
principle). Thus, Diospilini is treated as a
tribe of Helconinae and not vice versa.
The same is true for the tribal classifica-
tion of the Doryctinae and Euphorinae.
Only in the case of the names Hormiinae
and Exothecinae has lack of consistent us-
age as well as uncertainties regarding re-
lationships led to problems of priority, as
explained by Wharton (1993).

Marshall (1872) was the first to use the
correct form for Foerster's Euspathioidae
when he proposed the familv-group name
Spathiides. Based on Article 35.4 (ICZN
1999), the valid familv-group name must
be based on the name Spathius, and should
be attributed to Foerster (1862) despite the
priority of usage of the correct form of the
name by Marshall (1872). Marshall (1872)

258 Journal of Hymenoptera Research

is often overlooked as a source for newly several family-group names, all published
proposed family-group names, with most in 1900. Slight confusion has arisen, how-
authors incorrectly referring to his later ever, because many of the names pro-
publications, or sometimes to Parfitt posed by Ashmead were transmitted to
(1881) for the family-group names Spathi- several workers in applied entomology
ides and /or Calyptides. Similarly, the prior to the appearance of Ashmead's
family-group name Pambolides was first (1900b) Classification of the Ichneumono-
published by Marshall (1885), though idea, and a few of the family-group names
Marshall (1887) or Marshall in Cresson thus first became available in these other
(1887) is sometimes cited. Calyptinae (-ini) works. Despite the complexities of this
and Pambolinae (-ini) thus date from Mar- matter, the names Aphrastobraconinae
shall (1872) and Marshall (1885) respec- (-ini), Cardiochilinae (-ini), Euurobraconi-
tively. As explained in detail by Mason nae (-ini), Orgilinae (-ini), Trioxinae (-ini),
(1974), the names Brachistinae and Brach- and Zelinae (-ini) should all be attributed
istini have priority over Calyptinae and to Ashmead, with Cardiochilinae and Or-
Calyptini even though the latter were gilinae in Ashmead (1900a) and the rest in
widely used prior to Mason's (1974) pub- Ashmead (1900b). Ashmead (1900a,
lication. The spellings Rhogas and Rhoga- 1900b) also appears to have been the first
dinae, which are unjustified emendations, to use Microdini in place of Foerster's Eu-
date from Marshall (1872). microdoidae, though no specific reason

In 1887 both Cresson (as Meteorinae) was offered. As with Spathiinae, however,

and Marshall (as Meteorides) used a fam- the family-group name Microdini should

ily-group name based on the generic name probably be attributed to Foerster (1862),

Meteorus Haliday. In the report dated 26 since Eumicrodus appears to be an unjus-

May 1887 (Transactions of the American tified emendation of Microdus (ICZN 1999,

Entomological Society 1887: v), Cresson's Article 35.4). Fourteen other authors each

paper is listed as an addition to the Soci- proposed a single family-group name dur-

ety's library. Marshall's contribution is ing the first half of the 20th century. Only

published in the June issue of the Trans- Szepligeti, Viereck, Enderlein and Fahrin-

actions of the Entomological Society of ger proposed more than one during this

London, and thus was published after period. The publications by Marshall

Cresson's. Meteorinae (-ini) therefore (1885, 1887, 1888, 1889, 1891), Marshall in

dates from Cresson (1887), even though Dalla Torre (1898), Ashmead (1900b), and

Cresson (1887) cites Marshall for kindly Szepligeti (1904) did much to promote the

sending him a preprint of his manuscript use of a standard set of subfamily names

on the British fauna. The family group in Braconidae during the 20th century,

name Toxoneurinae also dates from Cres- even though these names were still fre-

son, 1887. This name was replaced with quently placed within the framework of

Cardiochilinae by Ashmead (1900a, 1900b) Wesmael's older groupings,

when Ashmead sank Toxoneuron Say, 1836 The works of Viereck (1914, 1918, 1919,

as a junior subjective synonym of Cardi- 1921) are especially noteworthy as they

ochiles Nees, 1819. Though Toxoneurinae provide explicit designations for the type

has priority, Cardiochilinae has gained species of genera and thus a clear meaning

widespread acceptance (ICZN 1999, Arti- for the family-group names based on these

cle 40.2), and should thus be used as the genera. Subsequent authors have dis-

valid name for this taxon even though agreed with several of Viereck's interpre-

Toxoneuron has recently been reinstated tations, but the value of Viereck's work

(Whitfield and Dangerfield 1997). lies in his attempt to provide stability for

William H. Ashmead is responsible for ichneumonoid classification through a rig-

Volume 9, Number 2, 2000

259

orous application of the type species con-
cept (following adoption of a set of rules
for zoological nomenclature in 1901 (Re-
gies 1905)). Gahan's (1917) use of the sub-
family name Vipiinae and Viereck's (1918)
subsequent adoption of Vipionidae for
nine subfamilies formerly included in the
Braconidae were a direct result of Vi-
ereck's (1914) interpretation of the type
species of the genus Bracon. This particular
interpretation led to a transfer of the name
Bracon to the group known then and now
as the Agathidinae. Viereck (1914) also
corrected previous designations for the
type species of Sigalphus Latreille, and fur-
ther noted the possiblity that Incubus
Schrank was a senior synonym of Avhidius
Nees. These and other actions resulted in
several major changes in generic concepts
and the consequent proposal of several
new family-group names as replacements
for existing ones no longer deemed appro-
priate (e.g., Bridwell 1920, Essig 1942). To
counter this, various petitions (e.g., for
Bracon) were made to the International
Commission of Zoological Nomenclature
to fix certain generic concepts, leading to
re-establishment of the older names used
by Marshall in Dalla Torre (1898), Ash-
mead (1900b), and Szepligeti (1904).

From the standpoint of newly proposed
family-group names, the last major author
of the first half of the 20th century was
Fahringer. Fahringer (1928, 1929, 1930,
1936) proposed numerous new names for
suprageneric taxa, principally in his mon-
umental work, Opuscula Braconologica,
published in several fascicles over a 12
year period. Most of the tribal and subtri-
bal names he proposed were properly
formed and thus available, but a few of
them (such as the subtribe Longiradialii)
are not because they are not based on ge-
neric names. Fahringer also provided
what appear to be valid family-group
names for two sections (a suprageneric
category he used below subtribe).

Aside from Mackauer's (1961) proposal
of seven new family-group names for

aphidiines, there were relatively few new
suprageneric taxa described from 1940-
1969. By contrast, there were as many new
family-group names proposed from 1970-
1998 as there were from 1812-1969. About
50 of the names proposed after 1969 were
based on newly described genera, with
nearly all of these representing new dis-
coveries of unusual taxa rather than mere
splitting of existing genera. Most of the re-
maining family-group taxa described after
1969 represent attempts to add structure
to larger subfamilies such as the Agathi-
dinae, Doryctinae, Euphorinae, and Opi-
inae. Major works containing new family-
group names during this period include
those of Fischer (1970, 1981a), van Achter-
berg (1979c, 1984a, 1988, 1995), Mason
(1981a), Shaw (1985), Tobias (1987), Zettel
(1990), Belokobylskij (1992, 1993), and
Sharkey (1992). '

A few of the family-group names first
proposed after 1930 apparently do not
meet the criteria for availability set out in
Article 13 of the previous edition of the
Code (ICZN 1985). Under this provision,
names proposed in catalogues, if such
names were unaccompanied by descrip-
tions, are unavailable (e.g., Cosmophori-
nae Muesebeck and Walkley, 1951). How-
ever, a new provision, Article 13.2.1
(ICZN 1999), provides an exception for
names (such as Cosmophorinae) proposed
between 1930 and 1961. Article 13 may
also apply to names first proposed in dis-
cussions of relationships among higher
taxa, when there is no clear statement on
how the newly named taxon is differenti-
ated (e.g., Capek 1965). In such cases, it is
also difficult to determine when these
names first meet the criteria of availability.
We have noted these problems in brackets
in the chronological list below, as well as
our proposals for when the names first be-
came available. Our findings are summa-
rized below in two forms: a chronological
list of all family-group names known to us
and an appendix of all proposed names in
alphabetical order.

260

Journal of Hymenoptera Research

CHRONOLOGICAL LIST OF FAMILY-
GROUP NAMES IN BRACONIDAE,
USING SPELLINGS AS ORIGINALLY
PROPOSED

The list below contains all family-group
names known to us with the exception of
those not based on generic names. Names
are followed by their author, date first
proposed, and page number where the
name is first found. Complete citations for
each author are in the Literature Cited. We
are aware that there are many variant
spellings that have been used subsequent
to the first proposal of these names (es-
pecially before standardization of endings
for family-group names), but we have not
treated them here. We have focused our
attention on the priority of names, and
have thus also avoided discussion of the
important issue of correct spellings for the
most part. Where useful, we include ad-
ditional information on validity and avail-
ability in brackets, especially for younger
names thought to have had priority.
Bracones Nees, 1812: 3.
Bassi Nees, 1812: 3 [invalid name; based
on junior homonym (Bassus Nees, 1814,
not Bassus Fabricius, 1804)].
Alysiada Leach, 1815: 143 [= Alysiidae

Stephens, 1929: 355].
Cheloni Nees, 1816: 260 [unavailable
name, see introduction].

Aphidini Haliday, 1833b: 482.

Sigalphini Haliday, 1833b: 482 [= Sigal-
phites Blanchard, 1845: 157].

Agathenes Haliday, 1833b: 482 [= Agath-
ites Blanchard, 1845: 157].

Opiites Blanchard, 1845: 157.

Euspathioidae Foerster, 1862: 227.

Hecaboloidae Foerster, 1862: 227.

Doryctoidae Foerster, 1862: 227.

Hormioidae Foerster, 1862: 227.

Rogadoidae Foerster, 1862: 228.

Rhyssaloidae Foerster, 1862: 228.

Chelonoidae Foerster, 1862: 228.

Microgasteroidae Foerster, 1862: 228.

Eumicrodoidae Foerster, 1862: 228.

Euphoroidae Foerster, 1862: 228.

Perilitoidae Foerster, 1862: 228.
Brachistoidae Foerster, 1862: 229.
Blacoidae Foerster, 1862: 229.
Liophronoidae Foerster, 1862: 229.
Ichneutoidae Foerster, 1862: 229.
Helconoidae Foerster, 1862: 229.
Macrocentroidae Foerster, 1862: 229.
Diospiloidae Foerster, 1862: 229.
Dacnusoidae Foerster, 1862: 229.
Exothecoidae Foerster, 1862: 279.
Spathiides Marshall, 1872: 97.
Rhogadides Marshall, 1872: 99.
Calyptides Marshall, 1872: 116.
Pambolides Marshall, 1885: 9.
Meteorinae Cresson, 1887: 55.
Toxoneurinae Cresson, 1887: 55.
Orgilini Ashmead, 1900a: 590.
Cardiochilinae Ashmead, 1900a: 592.
Microdini Ashmead, 1900a: 592.
Alloeini Ashmead, 1900b: 104.
Aphrastobraconini Ashmead, 1900b: 136.
Euurobraconini Ashmead, 1900b: 136.
Trioxini Ashmead, 1900b: 113.
Zelini Ashmead, 1900b: 118.
Cenocoelionidae Szepligeti, 1901: 353.
Gnathobraconinae Szepligeti, 1904a: 2.
Mimagathidinae Enderlein, 1905: 449.
Holcobraconini Cameron, 1905: 90.
Leiophroninae Schmiedeknecht, 1907: 511

[first correct spelling of Liophronoidae

Foerster, 1862].
Helorimorphinae Schmiedeknecht, 1907:

511.

Microtypinae Szepligeti, 1908: 426.
Capitoniidae Viereck, 1910: 616.
Trachypetinae Schulz, 1911: 85.
Stephaniscinae Enderlein, 1912: 1 [invalid

name, based on junior homonym].
Psenobolini Enderlein, 1912: 2 [= Pseno-

bolina Belokobylskij, 1992: 922].
Pseudospathiini Enderlein, 1912: 2.
Vipiinae Gahan, 1917: 196 [= Vipioninae

Viereck, 1918: 69].
Elasmosominae Viereck, 1918: 69.
Mesocoelinae Viereck, 1918: 69.
Apantelinae Viereck, 1918: 69.
Miracinae Viereck, 1918: 69.
Adelinae Viereck, 1918: 69 [= Acoeliini

Telenga, 1955: 14].

Volume 9, Number 2, 2000

261

Bassinae Viereck, 1918: 70.

Triaspinae Viereck, 1918: 71.

Pelecystominae Viereck, 1918: 71.

Neoneurinae Bengtsson, 1918: 27.

Coeliniinae Viereck, 1919a: 48.

Stantoninae Viereck, 1919b: 198.

Microbraconinae Bridwell, 1920: 389.

Ypsistocerinae Cushman, 1923: 54.

Phanerotomini Baker, 1926: 453.

Aleiodinae Muesebeck, 1928: 901.

Atanycoloidea Fahringer, 1928: 7 [pro-
posed as a Sectio].

Iphiaulacoidea Fahringer, 1928: 7.

Habrobraconini Fahringer, 1928: 7.

Gastrothecini Fahringer, 1928: 7 [incor-
rectly attributed to Foerster; invalid
name, based on junior homonym].

Phanomerini Fahringer, 1928: 7.

Acanthobraconini Fahringer, 1928: 7.

Rhaconotini Fahringer, 1928: 8.

Pseudostephaniscini Fahringer, 1928: 8
[unavailable, not based on a valid ge-
neric name].

Baeocentrini Fahringer, 1928: 8.

Rhamnurini Fahringer, 1929: 234 [ =
Rhamnurini van Achterberg, 1981: 88].

Histeromerini Fahringer, 1930: 121.

Gynocryptinae Quilis Perez, 1931: 26.

Incubinae Brues and Melander, 1932: 482
[published as junior synonym of Aphi-
diinae].

Chiviniini Shestakov, 1932: 258.

Pseudodicrogeniinae Fahringer, 1936: 572.

Aneurobraconinae Fahringer, 1936: 587.

Incubidae Essig, 1942: 644 [first valid
treatment of name, which then becomes
available as of 1932 (ICZN 1999, Article
11.6.1)].

Minangina De Saeger, 1948: 71.

Odontobraconinae Granger, 1949: 17.

Cosmophorinae Muesebeck and Walkley,
1951: 183 [nomen nudum but possibly
valid under Article 13.2.1].

Neobraconinae Hellen, 1957: 33 [nomen
nudum; attributed to Fahringer, thus
probably a misspelling of Neorhacodi-
nae].

Chremylini Hellen, 1957: 34.

Acrisidini Hellen, 1957: 35.

Ecphylini Hellen, 1957: 36.

Coeloidini Tobias, 1957: 1347.

Glyptomorphini Tobias, 1957: 1348.

Cosmophorinae Capek, 1958: 153 [the first
publication in which this name satisfies
criterion of availability under Article
13.1].

Iseurini Hedqvist, 1959: 486 [incorrectly
included in Megalyridae].

Ephedrinae Mackauer, 1961: 794.

Prainae Mackauer, 1961: 794.

Aclitinae Mackauer, 1961: 795.

Paralipsina Mackauer, 1961: 800.

Lysiphlebina Mackauer, 1961: 800.

Protaphidiina Mackauer, 1961: 801.

Monoctonina Mackauer, 1961: 801.

Telengainae Tobias, 1962: 269.

Centistinae Capek, 1965: 99 [nomen nudum,
available from Capek 1970].

Meteorideinae Capek, 1965: 99. [apparent
nomen nudum; if so, available from To-
bias 1967].

Meteorideinae Tobias, 1967: 395.

Lysitermini Tobias, 1968: 28.

Archaphidina Mackauer, 1968: 30.

Muesebeckiini Mason, 1969: 263.

Centistinae Capek, 1970: 867.

Ademonini Fischer, 1970: 82.

Gnaptodonina Fischer, 1970: 85 [ =
Gnamptodontinae Fischer 1970 as a re-
sult of ICZN Opinion 1424 (1987)].

Biosterina Fischer, 1970: 85.

Coleopiina Fischer, 1970: 85.

Pokomandyina Fischer, 1970: 86.

Desmiostomini Fischer, 1972: 55 [= Des-
miostomatini Fischer, 1972: 56].

Mesostoinae van Achterberg, 1975: 158.

Proteropini van Achterberg, 1976: 43.

Zemiotini van Achterberg, 1976: 44.

Gnaptogastrini Tobias, 1976b: 319.

Exodontiellini Wharton, 1978: 298.

Apozygidae Mason, 1978: 609.

Betylobraconinae Tobias, 1979: 130.

Cercobarconinae Tobias, 1979: 134.

Amicrocentrinae van Achterberg, 1979a: 1.

Xiphozelinae van Achterberg, 1979b: 29.

Charmontini van Achterberg, 1979c: 241.

Homolobinae van Achterberg, 1979c: 241.

Microplitini Mason, 1981a: 24.

262

Journal of Hymenoptera Research

Forniciini Mason, 1981a: 24.

Cotesiini Mason, 1981a: 24.

Evaniodini Fischer, 1981a: 44.

Binareina Fischer, 1981a: 45.

Dendrosotina Fischer, 1981a: 45.

Stenocorsina Fischer, 1981a: 45.

Heterospilini Fischer, 1981a: 45.

Neoclinocentrina Fischer, 1981a: 45.

Pedinotina Fischer, 1981a: 46.

Bitomina Fischer, 1981b: 29.

Mononeurina Fischer, 1981c: 47.

Khoikhoiinae Mason, 1983: 49.

Brulleiini van Achterberg, 1983a: 281.

Adeshini van Achterberg, 1983b: 175.

Dirrhopinae van Achterberg, 1984a: 41.

Acampsini van Achterberg, 1984a: 41 [ap-
parent nomen nudum].

Dyscoletini van Achterberg, 1984a: 41 [ap-
parent nomen nudum].

Leptorhaconotini van Achterberg, 1984a:
41 [apparent nomen nudum].

Aspidobraconina van Achterberg, 1984b:
137.

Physaraiina van Achterberg, 1984b: 137.

Rhysipolini Belokobylskij, 1984: 1021.

Dinocampini Shaw, 1985: 277.

Townesilitini Shaw, 1985: 277.

Microctonini Shaw, 1985: 277.

Loxocephalini Shaw, 1985: 277 [apparent
nomen nudum; also invalid based on ju-
nior homonym].

Syntretini Shaw, 1985: 277.

Ecnomiinae van Achterberg, 1985: 341.

Pselaphanini van Achterberg, 1985: 341.

Victoroviellini Tobias, 1986: 95.

Cryptoxilonini Tobias, 1986: 183.

Diospilitinae Tobias, 1987: 845.

Acampsohelconini Tobias, 1987: 847.

Chelonohelconini Tobias, 1987: 847.

Oncometeorini Tobias, 1987: 848.

Prosyntretini Tobias, 1987: 850.

Semionini Tobias, 1987: 854.

Vaepellinae Quicke, 1987a: 73.

Bathyaulacini Quicke, 1987b: 43.

Antestrigini van Achterberg, 1987: 3.

Praonopterinae Tobias, 1988: 645.

Lissogastrini Oltra and Michelena, 1988:
165.

Chalaropini van Achterberg, 1988: 3.

Blacozonini van Achterberg, 1988: 3.

Stegnocellini van Achterberg, 1988: 3.

Dyscoletini van Achterberg, 1988: 3 [ap-
parently the first publication in which
this name satisfies criterion of availabil-
ity under Article 13].

Isomecini Tobias, 1990: 174.

Pentatermini Belokobylskij, 1990: 116.

Odontosphaeropygini Zettel, 1990: 147.

Phanerotomellina Zettel, 1990: 147.

Pseudophanerotomini Zettel, 1990: 147.

Pseudohelconina van Achterberg, 1990a:
283.

Pronkiini van Achterberg, 1990b: 169.

Yeliconini van Achterberg, 1991a: 3.

Clinocentrini van Achterberg, 1991a: 3.

Argamaniini van Achterberg, 1991b: 204.

Afrocampsini van Achterberg and Austin,
1992: 3.

Acampsini van Achterberg and Austin,
1992: 3 [apparently the first publication
in which this name satisfies criterion of
availability under Article 13].

Doryctomorphina Belokobylskij, 1992:
908.

Caenophanina Belokobylskij, 1992: 908.

Acanthodoryctina Belokobylskij, 1992:
910.

Ivondroviina Belokobylskij, 1992: 912.

Pambolideina Belokobylskij, 1992: 913.

Percnobraconoidina Belokobylskij, 1992:
915.

Labaniini Belokobylskij, 1992: 917.

Sericobraconini Belokobylskij, 1992: 918.

Spathiostenina Belokobylskij, 1992: 920.

Leptorhaconotini Belokobylskij, 1992: 920
[apparently the first publication in
which this name satisfies criterion of
availability under Article 13].

Sisupalina Belokobylskij, 1992: 921.

Trigonophasmina Belokobylskij, 1992: 921.

Ptesimogastrina Belokobylskij, 1992: 922.

Spathioplitina Belokobylskij, 1992: 922.

Percnobraconini Belokobylskij, 1992: 924.

Westwoodiellini van Achterberg, 1992
359.

Cremnoptini Sharkey, 1992: 425.

Disophrini Sharkey, 1992: 425.

Earinini Sharkey, 1992: 425.

Volume 9, Number 2, 2000

263

Hydrangeocolini Whitfield, 1992: 274
[possibly a women nudum].

Dimerina Belokobylskij, 1993: 145.

Oncophanina Belokobylskij, 1993: 148.

Acanthormiina Belokobylskij, 1993: 151.

Tritermina Belokobylskij, 1993: 152.

Cedriina Belokobylskij, 1993: 154.

Chremylomorphini Belokobylskij, 1993: 155.

Canberriini Belokobylskij, 1993: 156.

Monitoriellini Belokobylskij, 1993: 156.

Avgini Belokobylskij, 1993: 157.

Leuriniina Belokobylskij, 1993: 158.

Parahormiina Belokobylskij, 1993: 158.

Austrohormiini Belokobylskij, 1993: 159.

Stiropiini van Achterberg, 1993: 25.

Syngastrini van Achterberg, 1993: 55 [no-
men nudum].

Ussurohelconini van Achterberg, 1994: 3.

Siragrini Belokobylskij, 1994: 141.

Maxfischeriini Papp, 1994: 143.

Mendesellinae Whitfield and Mason, 1994:
61.

Facitorini van Achterberg, 1995: 3.

Mannokeraiini van Achterberg, 1995: 3.

Masoninae (-ini) van Achterberg, 1995: 3.

Planitorini van Achterberg, 1995: 3.

Embobraconina van Achterberg, 1995: 4.

Tetra termini van Achterberg, 1996: 249.

Xyeloblacini van Achterberg and Alten-
hofer, 1997: 291.

Myiocephalini Chen and van Achterberg,
1997: 3.

Vervoortihelconina van Achterberg, 1998:
401.

Excluded names (not Braconidae):

Hybrizonites Blanchard, 1845: 155 [be-
longs to Ichneumonidae, as senior syn-
onym of Paxylommatinae Foerster].

Excultinae Sharma, 1984. Reichenbachia
22: 76 [belongs to Chrysididae].

ACKNOWLEDGMENTS

The senior author is particularly thankful to Roy
Shenefelt and Henry Townes (American Entomolog-
ical Institute) (both deceased) and to Paul Marsh (for-
merly USDA, ARS, Systematic Entomology Labora-
tory) for access to and discussions about some of the
early literature. Lisa Brown and Terry Junek provid-
ed considerable assistance by typing names and lit-

erature into databases that greatly facilitated compi-
lation of the lists presented here. This work was fund-
ed in part by the National Science Foundation
(DEB9712543). Support of the Texas Agriculture Ex-
periment Station is also gratefully acknowledged.

LITERATURE CITED

Achterberg, C. van. 1975. A new genus, Mesostoa gen.
nov., from W. Australia, belonging to a new sub-
family (Hymenoptera, Braconidae). Entomologis-
che Berichten Amsterdam 35: 158-160.

Achterberg, C. van. 1976. A preliminary key to the
subfamilies of the Braconidae (Hymenoptera).
Tijdschrift voor Entomologie 119: 33-78.

Achterberg, C. van. 1979a. A revision of the species
of Amicrocentrinae, a new subfamily (Hvmenop-
tera, Braconidae), with a description of the final
larval instar of Amicrocentrum curvinervis by
J.F.T. Short. Tijdschrift voor Entomologie 122: 1-28.

Achterberg, C. van. 1979b. A revision of the new sub-
family Xiphozelinae (Hymenoptera, Braconidae).
Tijdschrift voor Entomologie 122: 29^16.

Achterberg, C. van. 1979c. A revision of the subfamily
Zelinae auct. (Hymenoptera, Braconidae).
Tijdschrift voor Entomologie 122: 241^479.

Achterberg, C. van. 1981. The position of the genus
Rhamnura Enderlein among the Braconidae (Hy-
menoptera). Entomologische Berichten 41: 88-91.

Achterberg, C. van. 1983a. A revision of the new tribe
Brulleiini (Hymenoptera: Braconidae). Contribu-
tions of the American Entomological Institute 20:
281-306.

Achterberg, C. van. 1983b. Six new genera of Braconinae
from the Afrotropical region (Hymenoptera, Bra-
conidae). Tijdschrift voor Entomologie 126: 175-202.

Achterberg, C. van. 1984a. Essay on the phylogeny of
Braconidae (Hymenoptera; Ichneumonidae). En-
tomologisk Tuiskrift 105: 41-58.

Achterberg, C. van. 1984b. Revision of the genera of
Braconini with first and second metasomal ter-
gite immovably joined (Hymenoptera, Braconi-
dae, Braconinae). Tijdschrift voor Entomologie 127:
137-164.

Achterberg, C. van. 1985. Notes on Braconidae V-VI.
V. The systematic position of the genera Ecnomios
Mason and Pselaphanus Szepligeti (Hymenop-
tera: Braconidae). Zoologische Mededelingen Leiden
59: 341-348.

Achterberg, C. van. 1987. Revisionary notes on the
subfamily Orgilinae (Hymenoptera: Braconidae).
Zoologische Verhandelingen Leiden 242: 1-111.

Achterberg, C. van. 1988. Revision of the subfamily
Blacinae Foerster (Hymenoptera, Braconidae).
Zoologische Verhandelingen Leiden 24^: 1-324.

Achterberg, C. van. lWOa. Revision oi the subtribe
Pseudohelconina nov. (Hymenoptera: Braconi-
dae). Zoologische Mededelingoi Leiden 63: 283-308.

Achterberg, C. van. 1990b. Pronkia. a new genu^ of

264

Journal of Hymenoptera Research

the Meteorideinae (Hymenoptera: Braconidae)
from New Zealand. Zoologische Mededelingen Lei-
den 64: 169-175.
Achterberg, C. van. 1991a. Revision of the genera of
the Afrotropical and W. Palaearctical Rogadinae
Foerster (Hymenoptera: Braconidae). Zoologische
Verhandelingen Leiden 273: 1-102.
Achterberg, C. van. 1991b. The taxonomic position of
the genus Argamania Papp (Hymenoptera: Bra-
conidae). Zoologische Mededelingen Leiden 65: 203-
207.
Achterberg, C. van. 1992. Revisionary notes on the
subfamily Homolobinae (Hymenoptera: Bracon-
idae). Zoologische Mededelingen Leiden 66: 359-368.
Achterberg, C. van. 1993. Illustrated key to the sub-
families of the Braconidae (Hymenoptera: Ich-
neumonoidea). Zoologische Verhandelingen Leiden
283: 1-189.
Achterberg, C. van. 1994. Generic revision of the sub-
family Cenocoeliinae Szepligeti (Hymenoptera:
Braconidae). Zoologische Verhandelingen Leiden
292: 1-52.
Achterberg, C. van. 1995. Generic revision of the sub-
family Betylobraconinae and other groups with
modified fore tarsus. Zoologische Verhandelingen
Leiden 298: 1-242.
Achterberg, C. van. 1996. In: Achterberg, C. van and
H. Steiner. A new genus of Tetratermini (Hy-
menoptera: Braconidae: Lysiterminae) parasitic
on grasshoppers (Gryllacrididae). Zoologische Me-
dedelingen Leiden 70: 249-259.
Achterberg, C. van. 1998. Vervoortihelcon, a new genus
of the subfamily Helconinae Foerster (Hymenop-
tera: Braconidae) from Chile. Zoologische Verhan-
delingen Leiden 323: 401^05.
Achterberg, C. van and E. Altenhofer. 1997. Xyeloblacus
gen. nov. (Hymenoptera: Braconidae: Blacinae) par-
asitoid of Xyelinae (Xyelidae: Hymenoptera). Zool-
ogische Mededelingen Leiden 71: 291-298.
Achterberg, C. van and A. D. Austin. 1992. Revision
of the genera of the subfamily Sigalphinae (Hy-
menoptera: Braconidae), including a revision of
the Australian species. Zoologische Verhandelingen
Leiden 280: 1-44.
Achterberg, C. van and D. L. J. Quicke. 1992. Phylog-
eny of the subfamilies of the family Braconidae:
a reassessment assessed. Cladistics 8: 237-264.
Ashmead, W. H. 1900a. In: Smith, J. B. Insects of New
Jersey. Report to the New Jersey Board of Agricul-
ture, Supplement 27: 1-755. [Report for 1899, pub-
lished early 1900. |
Ashmead, W. H. 1900b. Classification of the Ichneu-
mon flies of the superfamily Ichneumonidae.
Proceedings of the United States National Museum
23: 1-220. [Date of publication October 13, 1900.]
Baker, C. F. 1926. Braconidae-Cheloninae of the Phil-
ippines, Malaya, and Australia 1. Chelonini (ex-

cept Chelonus). Philippine journal of Science 31:
451-489.
Belokobylskij, S. A. 1984. On the division of the tribe
Exothecini s.l. (Hymenoptera, Braconidae) in two
with the description of a new genus and subge-
nus. Zoologicheskii Zhitrnal U.S.S.R. Academy of
Science Leningrad 63: 1019-1026. [In Russian]
Belokobylskij, S. A. 1990. Material for Braconid Fauna
of Supertribe Exothecidii (Hymenoptera, Bracon-
idae, Doryctinae) of Vietnam. Trudy Zoologisches-
kogo Instituta Akademii Naitk SSSR 209: 115-140.
[In Russian]
Belokobylskij, S. A. 1992. On the classification and
phylogeny of the braconid wasp subfamilies Do-
ryctinae and Exothecinae (Hymenoptera, Bracon-
idae). Part I. On the classification, 1. Entomologis-
cheskoye Ohozrenie 71: 900-928. [In Russian]
Belokobylskij, 1993. On the classification and phylog-
eny of the braconid wasp subfamilies Doryctinae
and Exothecinae (Hymenoptera, Braconidae).
Part I. On the classification, 2. Entomologischeskoye
Ohozrenie 72: 143-164. [In Russian]
Belokobylskij, S. A. 1994. A new tribe of the subfam-
ily Doryctinae from Papua New Guinea (Hy-
menoptera: Braconidae). Zoosystematica Rossica 3:
141-145.
Bengtsson, S. 1918. Braconologische Beitraege I. Die
Gattungen Neoneurus Hal. und Elasmosoma
Ruthe, monographisch Dargestellt. Lunds Univ-
ersitets Arsskrift. (2)14: 1-28.
Blanchard, E. 1845. Histoire des insects traitant de leurs
moeurs et de leurs metamorphoses en general et com-
prenant une nouvelle classification fondee sur leurs
rapports naturels. 1. Didot, Paris. 398 pp.
Bridwell, J. C. 1920. Miscellaneous notes on Hyme-
noptera, 2nd Paper, with descriptions of new
species. Proceedings of the Hawaiian Entomological
Society 4: 386-403.
Brues, C. T. and A. L. Melander. 1932. Classification
of Insects. A key to the known families of insects
and other terrestrial arthropods. Bulletin of the
Museum of Comparative Zoology 73: 1-672.
Cameron, P. 1905. On the phytophagous and parasit-
ic Hymenoptera collected by Mr. E. Green in
Ceylon. Spolia Zeylanica Bulletin of the National
Museums of Ceylon 3: 75-143.
Capek, M. 1958. Revision der Europaeischen Arten
der Gattung Cosmophorus Ratz. (Hym. Braconi-
dae). Acta Entomologica Musei Nationalis Pragae
32:151-169.
Capek, M. 1965. The classification of Braconidae
(Hym.) in relation to host specificity. Proceedings
of the Xll International Congress of Entomology Lou
don 12: 98-99.
Capek, M. 1970. A new classification of the Braconi-
dae based on the cephalic structures of the final
instar larva and biological evidence. Canadian En-
tomologist 102: 866-875.

Volume 9, Number 2, 2000

265

Chen, X. and C. van Achterberg. 1997. Revision of the
subfamily Euphorinae (excluding the tribe Me-
teorini Cresson) (Hymenoptera: Braconidae)
from China. Zoologische Verhandelingen Leiden
313: 1-217.

Cresson, E. T. 1887. Synopsis of the families and gen-
era of the Hymenoptera of America, north of
Mexico together with a catalogue of the de-
scribed species, and bibliography. Transactions of
the Entomological Society, Supplementary Volume 4:
1-350.

Cushman, R. A. 1923. A new subfamily of Braconidae
(Hymenoptera) from termite nests. Proceedings of
the Entomological Society of Washington 25: 54-56.

De Saeger, H. 1948. Cardiochilinae et Sigalphinae
(Hymenoptera Apocrita) Fam. Braconidae. Explo-
ration du Pare National Albert Mission G. F. de Wri-
te (1933-1935). 53: 1-272.

Enderlein, G. 1905. Die Braconiden-Subfamilie Mim-
agathidinae m. Zoologischer Anzeiger 28: 449^154.

Enderlein, G. 1912. Zur Kenntnis der Spathiinen un
einiger verwandter Gruppen. Archive fuer Natur-
geschichte (A) 78 (2): 1-37.

Essig, E. O. 1942. Family Braconidae, pp. 643-645. In:
College Entomology. MacMillan, New York. 900 pp.

Fabricius, J. C. 1798. Supplementum Entomologiae Sys-
tematicae. Proft and Storch, Hafniae. 572 pp.

Fabricius, J. C. 1804. Systema Piezatorum secundum Or-
dines, Genera, Species adiectis Synonymis, Locis, Ob-
servationibus, Descriptionibus. Reichard, Brunsvi-
ga. 439 pp.

Fahringer, J. 1928. Aethiopische Region. Opuscula Bra-
conologica 2(1-3): 1-224.

Fahringer, J. 1929. Aethiopische Region. Opuscula Bra-
conologica 2(4): 225-304.

Fahringer, J. 1930. Palaeartikische Region. Opuscula
Braconologica 3(1-2): 1-160.

Fahringer, J. 1936. Ueber einige merkwuerdige und sel-
tene Hymenopteren-Gattungen aus Afrika. Fest-
schrift fuer Professor Dr. Embrik Strand 1: 568-591.

Fischer, M. 1970. Probleme der Systematik bei den
Opiinae (Hymenoptera, Braconidae). Zeitschrifl
der Arbeitsgemeinschaft Oesterreicher Entomologen
22: 81-88.

Fischer, M. 1971. Hym. Braconidae. World Opiinae. In
dex of Entomophagous Insects. Le Francois, Paris.
189 pp.

Fischer, M. 1972. Hymenoptera: Braconidae (Opiinae
I). Das Tierreich 91: 1-620. [Published October,
1972, though both 1972 and 1973 are printed on
the cover.]

Fischer, M. 1981a. Attempt at a systematic classifica-
tion of Doryctinae, especially Dorvctini, (Hyme-
noptera, Braconidae). Polskie Pismo Entomologi
cine 51: 41-99.

Fischer, M. 1981b. Hymenoptera. Fam. Braconidae:
Opiinae. Catalogue Faunae Austriae I6j: 1-38.

Fischer, M. 1981c. Mo}]oneuron, ein neues Dorvcti-

nen — Genus aus Brasilien (Hymenoptera, Bra-
conidae). Zeitschrifl der Arbeitsgemeinschaft Oster-
reichischer Entomologen 33: 47-51.

Fitton, M. G. and I. D. Gauld. 1976. The family-group
names of the Ichneumonidae (excluding Ichneu-
moninae) (Hymenoptera). Systematic Entomology
1: 247-258.

Foerster, A. 1862. Synopsis der Familien und Gattun-
gen der Braconen. Verhandlungen des Naturhisto-
rischen Vereines preussischen Rheinlande und West-
phalens 19: 225-288. [A variety of spellings have
been used for the journal name.]

Gahan, A. B. 1917. Descriptions of some new parasitic
Hymenoptera. Proceedings of the United States Na-
tional Museum 53: 195-217.

Granger, C. 1949. Braconides de Madagascar. Memo-
ires de L'Institut Scientifique de Madagascar Serie A.
Biologic Animate 2: 1^428.

Gravenhorst, J. L. C. 1807. Vergleichende Uebersicht des
Linneischen und einiger neueren zoologischen Syste-
me nebst dem eingeschalteten Verzeichniss der zool-
ogischen Sammlung des Verfassers. Dieterich, Goet-
tingen. 476 pp.

Haliday, A. H. 1833a. An essay on the classification
of the parasitic Hymenoptera of Britain, which
correspond with the Ichneumones minuti of Lin-
naeus. Entomological Magazine 1: 259-276.

Haliday, A. H. 1833b. Essay on the classification of
parasitic Hymenoptera &c. Of the Ichneumones
of the Second Line, (Ichneumones adsciti, Essen-
beck.). Entomological Magazine 1:480-491.

Haliday, A. H. 1840. Subfamily 2. Braconides Westw.
(Ichneumones Adsciti Esenb.), pp. 61-65. In:
Westwood, J. O. (editor). Synopsis of the Genera of
British Insects. Spottiswood, London. 158 pp.

Hedqvist, K.-J. 1959. Chapter XXVIII Hymenoptera
(Ichneumonoidea): Megalvridae. South African
Animal Life. Results of the Lund University Expe
dition m 1950-1951 6: 485-490.

Hellen, W. 1957. Zur Kenntnis der Braconidae: I v
clostomi Finnlands. Notulae Lntomologicac 37:
33-52.

International Commission on Zoological Nomencla-
ture. 1961. International Code of Zoological Nomen-
clature Adopted />t/ the XV International Congress of
Zoology. International Trust for Zoological No-
menclature, London. 176 pp.

International Commission on Zoological Nomencla-
ture. 1985. International Code of Zoological Somen
cloture, third edition. Charlesworth & Co., Hud-
dersfield. 338 pp.

International Commission on Zoological Nomencla-
ture. 1987. Opinion 1424. Gnamptodon Halidaj
1833 (Insecta: Hymenoptera): Bracon pumilio
Nees, 1834 designated as type species. Bulletin of
Zoological Nomenclature 44: 55-56.

International Commission on Zoological Nomencla-
ture. 1999. International Code oj Zoological Nomen-

266

Journal of Hymenoptera Research

cloture, fourth edition.Tipografia La Garangola,
Padova. 306 pp.

Latreille, P. A. 1804. Table methodique des insectes,
pp. 129-200 In: Nouveau Dictionnaire d'Historie
Naturelle..., first edition, volume 24. Deterville,
Paris. 258 pp.

Leach, W. E. 1815. Entomology, pp. 57-172. In: Brew-
ster, D. (editor). Edinburgh Encyclopaedia, volume 9.

Mackauer, M. 1961. Die Gattungen der Familie Aphi-
diidae und ihre verwandtschaftliche Zuordnung
(Hymenoptera: Ichneumonoidea). Beitraege zur
Entomologie 11: 792-803.

Mackauer, M. 1968. Pars 3 Aphidiidae. In: Ferriere,
Ch. and J. van der Vecht (editors). Hymenoptero-
rum Catalogus, nova editio. W. Junk, The Hague.
103 pp.

Mackauer, M. and P. Stary. 1967. The Aphidiidae of the
World. Index of Entomophagous Insects. Le Fran-
cois, Paris. 195 pp.

Marshall, T. A. 1872. Braconidae, pp. 96-132. A Cat-
alog of the British Hymenoptera. Part 4: Chrysidi-
dae, lchneumonidae , Braconidae, and Evaniidae.
Napier, Entomological Society of London, Lon-
don. 137 pp.

Marshall, T. A. 1885. Monograph of British Braconi-
dae. Part I. Transactions of the Royal Entomological
Society of London 1885: 1-280.

Marshall, T. A. 1887. Monograph of British Braconi-
dae. Part II. Transactions of the Royal Entomological
Society of London 1887: 51-131.

Marshall, T. A. 1888. Les Braconides. In: Andre, E.
Species des Hymenopteres D'Europe & D'Algerie,
volume 4. Andre, Beaune (Cote D'Or) 609 pp.
[Shenefelt (1965) indicates publication in 1890
but this is incorrect.]

Marshall, T. A. 1889. A Monograph of British Bracon-
idae. Part III. Transactions of the Royal Entomolog-
ical Society of London 1889: 149-210.

Marshall, T. A. 1891. A monograph of British Bracon-
idae. Part IV. Transactions of the Entomological So-
ciety of London 1891: 7-61.

Marshall, T. A. 1898. Braconidae. In: Dalla Torre, C.
G. de Catalogus Hymenopterorum, IV, volume 8.
Engelmann, Leipzig. 323 pp.

Mason, W. R. M. 1969. Muesebeckiini, a new tribe of
Braconidae (Hymenoptera). Proceedings of the En-
tomological Society of Washington 71: 263-278.

Mason, W. R. M. 1974. A generic synopsis of Brachistini
(Hymenoptera: Braconidae) and recognition of the
name Charmon Haliday. Proceedings of the Entomo-
logical Society of Washingto)i 76: 235-246.

Mason, W. R. M. 1978. A new genus, species and fam-
ily of Hymenoptera (Ichneumonoidea) from
Chile. Proceedings of the Entomological Society of
Washington 80: 606-610.

Mason, W. R. M. 1981a. The polyphyletic nature of
Apanteles Foerster (Hymenoptera: Braconidae): a
phylogeny and reclassification of Microgastrinae.

Memoirs of the Entomological Society of Canada 115:
1-147.

Mason, W. R. M. 1981b. Paxylommatidae: The correct
family-group name for Hybrizon Fallen (Hyme-
noptera: Ichneumonoidea), with figures of un-
usual antennal sensilla. Canadian Entomologist
113: 433^39.

Mason, W.R.M. 1983. A new South African subfamily
related to Cardiochilinae (Hymenoptera: Bracon-
idae). Contributions of the American Entomological
Institute 20: 49-62.

Menke, A. S. 1997. Family-group names in Sphecidae
(Hymenoptera: Apoidea). Journal of Hymenoptera
Research 6: 243-255.

Michener, C. D. 1986. Family-group names among
bees. Journal of the Kaiisas Entomological Society 59:
219-234.

Muesebeck, C. F. W. 1928. Family Braconidae, pp.
895-920. In: Leonard, M. D. A list of the insects
of New York with a list of the spiders and certain
allied groups. Memoirs of the Cornell University
Agricultural Experiment Station, volume 101.
[Cover dated August, 1926, but date of issue was
January, 1928.]

Muesebeck, C. F. W. and L. M. Walkley 1951. Family
Braconidae, pp. 90-184. In: Muesebeck, C. F. W.,
K. V. Krombein, and H. K. Townes Hymenoptera
of America, north of Mexico Synoptic Catalog. U.S.
Government Printing Office, Washington, D. C.
1420 pp.

Nees von Esenbeck, C. G. 1812. Ichneumonides ad-
sciti in genera et familias divisi a Dre. Nees ab
Esenbeck. Magazin Gesellschaft Naturforschender
Freunde zu Berlin 5: 3-37. [Volume dated 1811,
published 1812.]

Nees von Esenbeck, C. G. 1814. Ichneumonides ad-
sciti in genera et familias divisi a Dre. Nees ab
Esenbeck. Continuatio. Magazin Gesellschaft Na-
turforschender Freunde zu Berlin 6: 183-221. [Vol-
ume dated 1812, published 1814.]

Nees von Esenbeck, C. G. 1816. Ichneumonides ad-
sciti in genera et familias divisi a Dre. Nees ab
Esenbeck. Continuatio. Magazin Gesellschaft Na-
turforschender Freunde zu Berlin 7: 243-277. [Vol-
ume dated 1813, published 1816.]

Nees von Esenbeck, C. G. 1819. Appendix ad J. L. C.
Gravenhorst conspectum generum et familiarum
ichneumonidum. Genera et familias ichneumon-
idum adscitorum exhibens. lsis 9: 299-310. [Vol-
ume dated 1818, published 1819.]

Nees von Esenbeck, C. G. 1834. Hymenopterorum Ich-
neumonibus affinium monographiae, genera Europaea
ei species illustrantes, volume 1. Cotta, Stuttgart
and Tuebingen. 320 pp.

Oltra Moscardo, M. and M. Michelena Saval, 1988.
Contribution al conocimiento de los Microgastri-
nae en la Peninsula Iberica (Hym., Braconidae):

Volume 9, Number 2, 2000

267

III. Cotesini. Eos Rei'ista Espanola de Entomologia
64: 165-171.

Papp, J. 1994. Maxfischeria tricolor gen. n. et sp. n. from
Australia (Insecta: Hymenoptera: Braconidae).
Annalen des Naturhistorischen Museum in Wien 96:
143-147.

Parfitt, E. 1881. The fauna of Devon. Order Hym.
Fam. Ich. Section Pupivora. Reports and Transac-
tions of the Devonshire Association for the Advance-
ment of Science, Literature, and Art 13: 240-292.

Quicke, D. L. J. 1987a. A new subfamily of Braconi-
dae, the Vaepellinae, based on a new genus and
species from Ghana (Insecta, Hymenoptera).
Zoologica Scripta 16: 73-77.

Quicke, D. L. J. 1987b. The Old World genera of bra-
conine wasps (Hymenoptera: Braconidae). jour-
nal of Natural History 21: 43-157.

Quicke, D.LJ. and V.I. Tobias, 1990. New genera of
braconid wasps of the subfamily Braconinae
(Hymenoptera, Braconidae) from Australia. En-
tomologischeskoye Obozrenie 69: 164-180.

Quicke, D. L. J. and C. van Achterberg. 1990. Phylog-
eny of the subfamilies of the family Braconidae
(Hymenoptera: Ichneumonoidea). Zoologische
Verhandelingen Leiden 258: 1-95.

Quilis Perez, M. 1931. Especies nuevas de Aphidiidae
espanoles (Hym. Brae). Eos Rei'ista Espanola de
Entomologia 7: 25-84.

Regies Internationales de la Nomenclature Zoologique
Adoptees par les Congres Internationaux de Zoologie.
1905. F. R. de Rudeval, Paris.

Say, T. 1836. Descriptions of new species of North
American Hymenoptera, and observations on
some already described. Boston journal of Natural
History 1: 209-305.

Schmiedeknecht, O. 1907. Die Hymenopteren Mitteleu-
ropas. Fischer, Jena. 804 pp.

Schulz, W. A. 1911. Zweihundert alte Hymenopteren.
Zoologische Annalen 4: 1-220.

Sharkey, M. J. 1992. Cladistics and tribal classification
of the Agathidinae (Hymenoptera: Braconidae).
journal of Natural History 26: 425^148.

Sharkey, M. J. 1993. Family Braconidae, pp. 362-395.
In: Goulet, H. and J. T. Huber (editors). Hyme-
noptera of the World: An identification guide to fam-
ilies. Research Branch, Agriculture Canada Pub-
lication 1894/E, Ottawa. 668 pp.

Sharma, V. 1984. A new subfamily Excultinae with
description of type genus; from Jammu (India)
(Hymenoptera, Braconidae). Reichenbachia 22: 75-
77.

Shaw, S. R. 1985. A phylogenetic study of the subfam-
ilies Meteorinae and Euphorinae (Hymenoptera:
Braconidae. Entomography 3: 277-370.

Shaw, M. R. and T. Huddleston. 1991. Classification
and biology of braconid wasps. Handbooks for the
Identification of British Insects 7(11): 1-126.

Shenefelt, R. D. 1965. A contribution towards knowl-

edge of the world literature regarding Braconi-
dae. Beitraege zur Entomologie 15: 243-500.

Shenefelt, R. D. 1969. Pars 4 Braconidae 1 Hybrizon-
tinae, Euphorinae, Cosmophorinae, Neoneuri-
nae, Macrocentrinae. In: Ferriere, Ch. and J. van
der Vecht (editors). Hymenopterorum Catalogus,
nova editio. Junk, The Hague. 176 pp.

Shenefelt, R. D. 1980. Pars 16 Braconidae 11: Intro-
duction, Guide to host names, Index to braconid
names. In: Achterberg, C. van and R. D. Shenefelt
(editors). Hymenopterorum Catalogus, nova editio.
Junk, The Hague. 384 pp.

Shestakov, A. 1932. Zur Kenntnis der asiatischen Bra-
coniden. Zoologischer Anzeiger 99: 255-263.
[Sometimes cited as 1930 or (1930) 1932, but date
submitted = 24 March 1932].

Spinola, M. 1808. Insectorum Liguriae Species Novae aut
Rariores, quas in Agro Ligustico nuper Detexit, Des-
cripsit, et iconibus Illustravit, volume 2. Gravier,
Genua. 263 pp.

Stephens, J. F. 1829. The Nomenclature of British In-
sects. In: Systematic Catalogue of British Insects.
Baldwin and Cradock, London. 68 pp.

Szepligeti, G. 1901.Tropische Cenocoelioniden und
Braconiden aus der Sammlung des Ungarischen
National-Museums. Termeszetrajzi Fuzetek 24:
353-402.

Szepligeti, G. 1904a. Ueber Gnathobracon A. Costa.
Annuario del Museo Zoologico della R. Universita di
Napoli 1: 2.

Szepligeti, G. V. 1904b. Hymenoptera. Fam. Braconi-
dae. In: Wytsman, P. Genera Insectorum, volume
22. Verteneuil and Desmet, Bruxelles. 253 pp.

Szepligeti, G. 1908. Braconiden aus der Sammlung
des Ungarischen National-Museums. II. Theil.
Annates Musei Nationalis Hungarici 6: 397—127.

Telenga, N. A. 1952. Origin and evolution of parasit-
ism in Hymenoptera Parasitica and development
of their fauna in the USSR. Academy of Sciences of
the Ukrainian SSR. 112 pp. [In Russian, English
translation published in 1969]

Telenga, N. A. 1955. Braconidae, subfamily Micro-
gastrinae, subfamily Agathinae. Fauna USSR. Hy-
menoptera 5(4): 1-311. [In Russian, English trans-
lation published in 1964]

Tobias, V. I. 1957. On morphology, taxonomy and
phytogeny of the supertribus Braconina Tel. (1 1\ •
menoptera, Braconidae). Zoologicheskii Zhurnal
36: 1338-1354. [In Russian]

Tobias, V. I. 1962. A new subfamily ol Braconidae
from Middle Asia. Transactions of the Zoological
Institute Academy of Sciences, USSR 30: 268-270.
[In Russian]

Tobias, V. I. 1967. A review of the classification phy-
togeny and evolution of the family Braconidae
(Hymenoptera). Entomologicheskoye Obozrenie 46:
M5-669. [In Russian]

Tobias. V. I. 1968. Problems ot the classification and

268

Journal of Hymenoptera Research

phylogeny of the family Braconidae (Hymenop-
tera). Entomological Society, USSR Academy of Sci-
ences Special Issue Dedicated to the Memory ofN. A.
Kholodkovski: 3-43. [In Russian]

Tobias, V. I. 1976a. Gnaptogaster mongolica gen. and
sp. n. from a new tribe of braconids (Hymenop-
tera, Braconidae, Opiinae) and some problems of
the phylogeny and evolution of this family. In-
sects of Mongolia 4: 315-321. [In Russian]

Tobias, V. I. 1976b. Braconidae of the Caucasus (Hy-
menoptera, Braconidae). Akademia Nauk, Len-
ingrad. 110: 1-286. [In Russian]

Tobias, V. I. 1979. Two new and little-known subfam-
ilies of Braconidae (Hymenoptera) from Austra-
lia. Entomologicheskoye Obozrenie 58: 128-142. [In
Russian]

Tobias, V. I. 1986. Keys to the insects of the European
part of the USSR. HI. Hymenoptera, 4: 1-501.
Akademia Nauk, Leningrad. [In Russian, English
translation published in 1995]

Tobias, V. I. 1987. New taxa of braconids (Hymenop-
tera, Braconidae) from Baltic amber. Entomologi-
cheskoye Obozrenie 66: 845-859. [In Russian]

Tobias, V. 1.1988. A new subfamily of braconids (Hy-
menoptera, Braconidae) from Australia. Entomo-
logicheskoye Obozrenie 67: 644-648. [In Russian]

Tobias, V. I. 1990. In: Quicke, D.L.J, and V.I. Tobias.
New genera of braconid wasps of the subfamily
Braconinae (Hymenoptera, Braconidae) from Aus-
tralia. Entomologischeskoye Obozrenie 69: 164-180.

Viereck, H. L. 1910. Braconidae, pp. 605-615, Alysi-
dae, pp. 615-616, Capitoniidae, p. 616. In: Smith,
J. Annual Report of the Neiv Jersey State Museum
Including a Report of the Insects of New Jersey, 1909.
MacCrellish and Quigley, Trenton.

Viereck, H. L. 1914. Type species of the genera of
ichneumon flies. Bulletin of the United States Na-
tional Museum 83: 1-186. [Date of publication Jan-
uary 13, 1914.]

Viereck, H. L. 1918. A list of families and subfamilies
of ichneumon-flies or the Superfamily Ichneu-
monoidea (Hymenoptera). Proceedings of the Bio-
logical Society of Washington 31: 69-74.

Viereck, H. L. 1919a. Additions and corrections to "a
list of families and subfamilies of ichneumon-
flies or the Super Family Ichneumonoidea (Hy-
menoptera)." Proceedings of the Biological Society
of Washington 32: 48.

Viereck, H. L. 1919b. Additions to "a list of families
and subfamilies of ichneumon-flies or the Super-
family Ichneumonoidea (Hymenoptera)." Pro
ceedings of the Biological Society of Washington 32:
198.
Viereck, H. L. 1921. First supplement to "type species
of the genera of ichneumon-flies." Proceedings of
the United States National Museum 59: 129-150.
Wesmael, C. 1835. Monographie des Braconides de

Belgique. Nouveaux memoires de V academic royale
des sciences et belles-lettres de Bruxelles 9: 1-252.

Wharton, R. A. 1978. Exodontiellini, a new tribe of
Opiinae with exodont mandibles (Hymenoptera:
Braconidae). Pan-Pacific Entomologist 53: 297-303.
[Volume dated October, 1977, but issued 14 Feb-
ruary 1978.]

Wharton, R. A. 1993. Review of the Hormiini (Hy-
menoptera: Braconidae) with a description of
new taxa. Journal of Natural History 27: 107-171.

Wharton, R. A., P. M. Marsh and M. j/sharkey. 1997.
Identification manual to the New World Genera
of the family Braconidae (Hymenoptera). Inter-
national Society of Hymenopterists Special Pub-
lication No. 1. 439 pp.

Wharton, R. A., S. R. Shaw, M. J. Sharkey, D. B. Wahl,
J. B. Woolley, J. B. Whitfield, P. M. Marsh and
W. Johnson. 1991. Phylogeny of the subfamilies
of the family Braconidae (Hymenoptera: Ichneu-
monoidea): A reassessment. Cladistics 8: 199-235.

Whitfield, J. B. 1992. The polyphyletic origin of en-
doparasitism in the cyclostome lineages of Bra-
conidae (Hymenoptera). Systematic Entomology
17: 273-286.

Whitfield, J. B. and W. R. M. Mason 1994. Mendesel-
linae, a new subfamily of braconid wasps (Hy-
menoptera, Braconidae) with a review of rela-
tionships within the microgastroid assemblage.
Systematic Entomology 19: 61-76.

Whitfield, J. B. and P. D. Dangerfield. 1997. Cardi-
ochilinae, pp. 177-183. In: Wharton, R. A., P. M.
Marsh and M. J. Sharkey (editors). Identification
manual to the New World Genera of the family
Braconidae (Hymenoptera). International Society
of Hymenopterists Special Publication No. 1.

Zettel, H. 1990. Eine revision der Gattungen der Che-
loninae (Hymenoptera, Braconidae) mit Beschrei-
bungen neuer Gattungen und Arten. Annalen des
Naturhistorischen Museum in Wien 91: 147-196

APPENDIX 1

The following is an alphabetical list of family-
group names in the Braconidae, with indication of
their subfamily placement. Though classifications
vary from author to author, and are presently contro-
versial, the subfamily arrangement used here is based
largely on Quicke and van Achterberg (1990) and van
Achterberg (1993, 1995). Tribes and subtribes largely
follow Mackauer (1968), Mason (1981), van Achter-
berg (1987, 1988, 1991b, 1992, 1994, 1995), Shaw
(1985), Quicke (1987), Zettel (1990), Belokobylskij
(1992), Sharkey (1992), and van Achterberg and Aus-
tin (1992).

Acampsini van Achterberg and Austin, 1992 (Sigal-
phinae)

Acampsohelconini Tobias, 1987 (Cenocoeliinae)
Acanthobraconini Fahringer, 1928 (Braconinae)
Acanthodoryctina Belokobylskij, 1992 (Doryctinae)

Volume 9, Number 2, 2000

269

Acanthohormiini Belokobylskij, 1993 (Lysiterminae)
Aclitina Mackauer, 1961 (Aphidiinae)
Acrisidini Hellen, 1957 (Rhyssalinae)
Adeliinae Viereck, 1918 (Adeliinae)
Ademonini Fischer, 1970 (Opiinae)
Adeshini van Achterberg, 1983 (Braconinae)
Afrocampsini van Achterberg and Austin, 1992 (Si-
galphinae)

Agathidinae (-ini) Haliday, 1833 (Agathidinae)
Aleiodini Muesebeck, 1928 (Rogadinae)
Alloeini Ashmead, 1900 (Alysiinae)
Alysiinae (-ini) Leach, 1815 (Alysiinae)
Amicrocentrinae van Achterberg, 1979 (Amicrocen-
trinae)

Aneurobraconini Fahringer, 1936 (Agathidinae)
Antestrigini van Achterberg, 1987 (Orgilinae)
Apantelini Viereck, 1918 (Microgastrinae)
Aphidiinae (-ini) Haliday, 1833 (Aphidiinae)
Aphrastobraconini Ashmead, 1900 (Braconinae)
Apozyginae Mason, 1978 (Apozyginae)
Archaphidina Mackauer, 1968 (Aphidiinae)
Argamaniini van Achterberg, 1991 (Braconinae)
Aspidobraconina van Achterberg, 1984 (Braconinae)
Atanycolina Fahringer, 1928 (Braconinae)
Austrohormiini Belokobylskij, 1993 (Hormiinae)
Avgini Belokobylskij, 1993 (Hormiinae)
Baeocentrini Fahringer, 1928 (Opiinae)
Bassinae Nees, 1812 (invalid)
Bassinae Viereck, 1918 (Agathidinae)
Bathvaulacini Quicke, 1987 (Braconinae)
Betylobraconinae (-ini) Tobias, 1979 (Betylobraconi-
nae)

Binareini Fischer, 1981 (Doryctinae)
Biosterini Fischer, 1970 (Opiinae)
Bitomina Fischer, 1981 (Opiinae)
Blacinae (-ini) Foerster, 1862 (Blacinae)
Blacozonini van Achterberg, 1988 (Blacinae)
Brachistini Foerster, 1862 (Helconinae)
Braconidae (-inae) Nees, 1812
Brulleiini van Achterberg, 1983 (Helconinae)
Caenophanina Belokobylskij, 1992 (Doryctinae)
Calyptini Marshall, 1872 (Helconinae)
Canberriini Belokobylskij, 1993 (Hormiinae)
Capitoniini Viereck, 1910 (Cenocoeliinae)
Cardiochilinae Ashmead, 1900 (1887) (Cardiochilinae)
Cedriina Belokobylskij, 1993 (Pambolinae)
Cenocoeliinae (-ini) Szepligeti, 1901 (Cenocoeliinae)
Centistini Capek, 1970 (Euphorinae)
Cercobarconini Tobias, 1979 (Trachypetinae)
Chalaropini van Achterberg, 1988 (Blacinae)
Charmontinae van Achterberg, 1979 (Charmontinae)
Cheloninae (-ini) Foerster, 1862 (Cheloninae)
Chelonohelconini Tobias, 1987 (Helconinae)
Chiviniini Shestakov, 1932 (Braconinae)
Chremylini Hellen, 1957 (Pambolinae)
Chremylomorphina Belokobylskij, 1993 (Pambolinae)
Clinocentrini van Achterberg, 1991 (Rogadinae)
Coeliniina Viereck, 1919 (Alysiinae)

Coeloidini Tobias, 1957 (Braconinae)
Coleopiina Fischer, 1970 (Opiinae)
Cosmophorini Capek, 1958 (Euphorinae)
Cotesiini Mason, 1981 (Microgastrinae)
Cremnoptini Sharkey, 1992 (Agathidinae)
Cryptoxilonini Tobias, 1986 (Euphorinae)
Dacnusini Foerster, 1862 (Alysiinae)
Dendrosotina Fischer, 1981 (Doryctinae)
Desmiostomatini Fischer, 1972 (Opiinae)
Dimerina Belokobylskij, 1993 (Pambolinae)
Dinocampini Shaw, 1985 (Euphorinae)
Diospilitinae Tobias, 1987 (Aphidiinae)
Diospilini Foerster, 1862 (Helconinae)
Dirrhopinae van Achterberg, 1984 (Dirrhopinae)
Disophrini Sharkey, 1992 (Agathidinae)
Doryctinae (-ini) Foerster, 1862 (Doryctinae)
Doryctomorphina Belokobylskij, 1992 (Rhyssalinae)
Dyscoletini van Achterberg, 1988 (Blacinae)
Earinini Sharkey, 1992 (Agathidinae)
Ecnomiinae van Achterberg, 1985 (Ecnomiinae)
Ecphylini Hellen, 1957 (Doryctinae)
Elasmosomini Viereck, 1918 (Neoneurinae)
Embobraconina van Achterberg, 1995 (Doryctinae)
Ephedrini Mackauer, 1961 (Aphidiinae)
Euphorinae (-ini) Foerster, 1862 (Euphorinae)
Euurobraconini Ashmead, 1900 (Braconinae)
Evaniodini Fischer, 1981 (Doryctinae)
Excultinae Sharma, 1984 (Chrysididae)
Exodontiellini Wharton, 1978 (Opiinae)
Exothecinae Foerster, 1862 (Exothecinae)
Facitorini van Achterberg, 1995 (Betylobraconinae)
Forniciini Mason, 1981 (Microgastrinae)
Gastrothecini Fahringer, 1928 (invalid)
Glyptomorphina Tobias, 1957 (Braconinae)
Gnamptodontinae Fischer, 1970 (Gnamptodontinae)
Gnaptogastrini Tobias, 1976 (Gnamptodontinae)
Gnathobraconini Szepligeti, 1904 (Braconinae)
Gynocryptina Quilis Perez, 1931 (Aphidiinae)
Habrobraconini Fahringer, 1928 (Braconinae)
Hecabolini Foerster, 1862 (Doryctinae)
Helconinae (-ini) Foerster, 1862 (Helconinae)
Helorimorphini Schmiedeknecht, 1907 (Euphorinae)
Heterospilini Fischer, 1981 (Doryctinae)
Histeromerinae Fahringer, 1930 (Histeromerinae)
Holcobraconini Cameron, 1905 (Doryctinae)
Homolobinae (-ini) van Achterberg, 1979 (Homolo-
binae)

Hormiinae (-ini) 1-oer^ter, 18h2 (Hormiinae)
Hydrangeocolini Whitfield, 1442 (Hormiinae)
Ichneutinae (-ini) Foerster, lSh2 (Ichneutinae)
Incubinae Brues and Melander, 1932 (Aphidiinae)
Iphiaulacini Fahringer, 1928 (Braconinae)
Isomecina Tobias, 1990 (Braconinae)
Iseurini Hedqvist, 1959 (Cenocoeliinae)
[vondroviina Belokobylskij, 1992 (Doryctinae)
Khoikhoiinae Mason, 1983 (Khoikhoiinae)
Labaniini Belokobylskij, 1992 (Doryctinae)
Leiophronini Foerster, 1862 (Euphorinae)

270

Journal of Hymenoptera Research

Leptorhaconotini Belokobylskij, 1992 (Doryctinae)
Leuriniini Belokobylskij, 1993 (Hormiinae)
Lissogastrini Oltra and Michelena, 1988 (Microgastrinae)
Loxocephalini Shaw, 1985 (invalid)
Lysiphlebina Mackauer, 1961 (Aphidiinae)
Lysiterminae (-ini) Tobias, 1968 (Lysiterminae)
Macrocentrinae Foerster, 1862 (Macrocentrinae)
Mannokeraiini van Achterberg, 1995 (Masoninae)
Masoninae (-ini) van Achterberg, 1995 (Masoninae)
Maxfischeriini Papp, 1994 (Helconinae)
Mendesellinae Whitfield and Mason, 1994 (Mende-
sellinae)

Mesocoelini Viereck, 1918 (Agathidinae)
Mesostoinae van Achterberg, 1975 (Mesostoinae)
Meteorideinae (-ini) Capek, 1965 (Meteorideinae)
Meteorini Cresson, 1887 (Euphorinae)
Microbraconini Bridwell, 1920 (Braconinae)
Microctonini Shaw, 1985 (Euphorinae)
Microdini Foerster, 1862 (Agathidinae)
Microgastrinae (-ini) Foerster, 1862 (Microgastrinae)
Microplitini Mason, 1981 (Microgastrinae)
Microtypinae Szepligeti, 1908 (Microtypinae)
Mimagathidini Enderlein, 1905 (Orgilinae)
Minangini De Saeger, 1948 (Sigalphinae)
Miracinae Viereck, 1918 (Miracinae)
Monitoriellini Belokobylskij, 1992 (Rhyssalinae)
Monoctonina Mackauer, 1961 (Aphidiinae)
Mononeurina Fischer, 1981 (Doryctinae)
Muesebeckiini Mason, 1969 (Ichneutinae)
Myiocephalini Chen and van Achterberg, 1997 (Eu-
phorinae)

Neobraconinae Hellen, 1957 (nomen nudum)
Neoclinocentrina Fischer, 1981 (Doryctinae)
Neoneurinae (-ini) Bengtsson, 1918 (Neoneurinae)
Odontobraconina Granger, 1949 (Doryctinae)
Odontosphaeropygini Zettel, 1990 (Cheloninae)
Oncometeorini Tobias, 1987 (Euphorinae)
Oncophanina Belokobylskij, 1993 (Rhyssalinae)
Opiinae (-ini) Blanchard, 1845 (Opiinae)
Orgilinae (-ini) Ashmead, 1900 (Orgilinae)
Pambolideina Belokobylskij, 1992 (Doryctinae)
Pambolinae (-ini) Marshall, 1885 (Pambolinae)
Parahormiini Belokobylskij, 1993 (Hormiinae)
Paralipsina Mackauer, 1961 (Aphidiinae)
Pedinotina Fischer, 1981 (Doryctinae)
Pelecystomini Viereck, 1918 (Rogadinae)
Pentatermini Belokobylskij, 1990 (Lysiterminae)
Percnobraconini Belokobylskij, 1992 (Doryctinae)
Percnobraconoidina Belokobylskij, 1992 (Doryctinae)
Perilitini Foerster, 1862 (Euphorinae)
Phanerotomellina Zettel, 1990 (Cheloninae)
Phanerotomini Baker, 1926 (Cheloninae)
Phanomerini Fahringer, 1928 (Exothecinae)
Physaraiini van Achterberg, 1984 (Braconinae)
Planitorini van Achterberg, 1995 (Betylobraconinae)
Pokomandyina Fischer, 1970 (Opiinae)

Praini Mackauer, 1961 (Aphidiinae)
Praonopterinae Tobias, 1988 (Mesostoinae)
Pronkiini van Achterberg, 1990 (Meteorideinae)
Prosyntretina Tobias, 1987 (Euphorinae)
Protaphidiina Mackauer, 1961 (Aphidiinae)
Proteropini van Achterberg, 1976 (Ichneutinae)
Pselaphaninae van Achterberg, 1985 (Pselaphaninae)
Psenobolina Enderlein, 1912 (Doryctinae)
Pseudodicrogeniini Fahringer, 1936 (Braconinae)
Pseudohelconina van Achterberg, 1990 (Helconinae)
Pseudophanerotomina Zettel, 1990 (Cheloninae)
Pseudospathiini Enderlein, 1912 (Doryctinae)
Pseudostephaniscini Fahringer, 1928 (Doryctinae)
Ptesimogastrina Belokobylskij, 1992 (Doryctinae)
Rhaconotina Fahringer, 1928 (Doryctinae)
Rhamnurini Fahringer, 1929 (Braconinae)
Rhysipolinae Belokobylskij, 1984 (Rhysipolinae)
Rhyssalinae (-ini) Foerster, 1862 (Rhyssalinae)
Rogadinae (-ini) Foerster, 1862 (Rogadinae)
Semionini Tobias, 1987 (Microgastrinae)
Sericobraconini Belokobylskij, 1992 (Doryctinae)
Sigalphinae (-ini) Haliday, 1833 (Sigalphinae)
Siragrini Belokobylskij, 1994 (Doryctinae)
Sisupalina Belokobylskij, 1992 (Doryctinae)
Spathiini Foerster, 1862 (Doryctinae)
Spathioplitina Belokobylskij, 1992 (Doryctinae)
Spathiostenina Belokobylskij, 1992 (Doryctinae)
Stantonini Viereck, 1919 (Orgilinae)
Stegnocellini van Achterberg, 1988 (Blacinae)
Stenocorsina Fischer, 1981 (Doryctinae)
Stephaniscini Enderlein, 1912 (invalid)
Stiropiini van Achterberg, 1993 (Rogadinae)
Syngastrini van Achterberg, 1993 (nomen nudum)
Syntretini Shaw, 1985 (Euphorinae)
Telengaiinae Tobias, 1962 (Telengaiinae)
Tetratermini van Achterberg, 1996 (Lysiterminae)
Townesilitina Shaw, 1985 (Euphorinae)
Toxoneurinae Cresson, 1887 (invalid)
Trachypetinae (-ini) Schulz, 1911 (Trachypetinae)
Triaspina Viereck, 1918 (Helconinae)
Trigonophasmina Belokobylskij, 1992 (Doryctinae)
Trioxina Ashmead, 1900 (Aphidiinae)
Triterminae Belokobylskij, 1993 (Lysiterminae)
Ussurohelconini van Achterberg, 1994 (Cenocoeliinae)
Vaepellinae Quicke, 1987 (Vaepellinae)
Vervoorrihelconina van Achterberg, 1998 (Helconinae)
Victoroviellina Tobias, 1986 (Braconinae)
Vipiina Gahan, 1917 (Braconinae)
Westwoodiellini van Achterberg, 1992 (Homolobinae)
Xiphozelinae van Achterberg, 1979 (Xiphozelinae)
Xyeloblacini van Achterberg and Altenhofer, 1997
(Blacinae)

Yeliconini van Achterberg, 1991 (Rogadinae)
Ypsistocerini Cushman, 1923 (Doryctinae)
Zelini Ashmead, 1900 (Euphorinae)
Zemiotini \,m Achterberg, 1976 (Euphorinae)

J. HYM. RES.
Vol. 9(2), 2000, pp. 271-276

Taxonomic Notes on Costa Rican Mendesellinae (Ichneumonoidea:
Braconidae), with Description of a New Central American

Species of Mendesella

A. A. Valerio1 and J. B. Whitfield

(AAV) Central American Institute of Biological Research and Conservation (CIBRC), P.O. Box
2398-2050 San Pedro de Montes de Oca, San Jose, Costa Rica, e-mail: avalerio@cibrc.org; (JBW)
Department of Entomology, University of Arkansas, Fayetteville, Arkansas 72701, USA, e-mail:

jvvhitfie@comp.uark.edu.

Abstract. — One new species of mendeselline braconid wasp is described, Mendesella orianae
Valerio and Whitfield sp. nov., and the male of Epsilogaster tico Whitfield and Mason is described
for the first time. Mendesella orianae from Costa Rica represents the northernmost record of Men-
desella in the Americas, and the first recorded species of this genus in Costa Rica. The male
genitalia of E. tico is also described, providing the first record of male genitalic characters for the
subfamily Mendesellinae.

The braconid subfamily Mendesellinae
was described by Whitfield & Mason
(1994), who included two genera and nine
species, all new. So far as is known, the
species are endoparasitoids of Lepidop-
tera feeding within plant tissue, but bio-
logical records are sparse, and specimens
of this subfamily are rarely collected in
general. Since the original description
there- has been no further review of the
distribution and biology of the known
species, nor any further species described.
Recently, new specimens of both genera in
the subfamily have been discovered by the
senior author in the collections of the In-
stituto Nacional de Biodiversidad (INBio).
The new records add significantly to the
known geographical distribution of men-
deselline genera, as well as the morphol-
ogy of male Mendesellinae. One of the
species is new to science and it is describe
below.

' Current Address: Department of Entomology, Uni-
versity of Arkansas, Fayetteville, AR 72701 USA, e-
mail: avaleri@comp.uark.edu.

MATERIAL AND METHODS

The morphological terminology used in
the species descriptions is that of Huber
and Sharkey (1993), and Schuh (1989); ex-
cept for the morphology of the propo-
deum, which is used sensu Townes (1969,
Fig. E). The cuticular sculpturing termi-
nology is that of Harris (1979), while the
terminology for the wing venation is a
variation of the Comstock-Needham sys-
tem used by Sharkey and Wharton (1997,
Fig. 15).

The metasoma of one specimen of Ep-
silogaster tico was detached, placed in
warm 10% KOH overnight, and run
through ethanol and xylene baths into Eu-
paral mounting medium for slide-mount-
ing. The male genitalia were pulled away
from the remainder of the metasoma and
illustrated using a microprojector.

Epsilogaster tico Whitfield and Mason
1994

(Figs, la, 2, 3)

Male. — Body color: Mainlv light yellow;
scape and pedicel light brown as face, ver-
tex, frons, hind tarsomeres, middle telo-

272

Journal of Hymenoptera Research

Fig. 1. Wing venation for male Epsilogaster tico Whitfield & Mason (a), and for female Mendesella orianae
Valerio & Whitfield sp. nov. (b).

tarsus and metasomal terga 4-6; metano- aline (Fig. la); wing veins with light yel-

tum with darker yellow than remainder low coloration. Body length = 2.61-2.75

mesosoma; compound eyes silver; palpus mm; Fore wing length = 2.44-2.47 mm.

whitish-yellow. Fore and hind wings hy- Head: head height /compound eye height

Volume 9, Number 2, 2000

273

Figs. 2-A. 2,3. Epsilogaster tico, male. 2, Face, showing enlarged eyes. 3, Genital capsule. 4, Propodeum and
anterior metasomal tergites of Mendesella orianae, sp. now

= 1.17-1.18; head height /compound eye
length = 1.53-1.65; length of first antennal
flagellomere = 0.18-0.22 mm; length of
first antennal flagellomere /width of first
antennal flagellomere = 4.40-5.20; length
of first antennal flagellomere /length of
second antennal flagellomere = 1.29-1.44;
length of first antennal flagellomere/

length of third antennal flagellomere =
1.38-1.44; distal flagellomere length/
width of distal flagellomere = 4.67-5.0; in-
tertentorial pit distance = 0.13-0.16 mm;
ocell-ocular distance = 0.03-0.04 mm; dis-
tance between toruli and tentorial pits =
0.25-0.27 mm; face wide at dorsal edge of
clypeus = 0.28 mm. Antenna with 27 fla-

274 Journal of Hymenoptera Research

gellomeres; face nitid, without punctate lose sculpturing, medial area raised form-
sculpturing, but with few scattered ob- ing two semicircular lower areas that con-
scure rugulose sculpturing features; vertex tain 5 costulae each; terga 2-6 smooth and
and gena with coarsely-punctate sculptur- unsculptured, also terga 2-6 much more
ing as on posterior-ventral area of head; strongly desclerotized that first metasomal
occiput nitid; malar suture present; malar tergum.

space very short; ocelli forming an equi- Material examined. — Described from two

lateral triangle. Mesosoma: mesosomal males: Costa Rica, Alajuela, RNVS Cafio

length /mesosomal width = 1.43-1.55, me- Negro, Playuelas, 20 m. 1-18 /ii/ 1994, Col.

sosomal height = 0.60-0.61 mm; hind tibia K. Martinez.

length /hind tibia maximum width = Comments. — The studied males have a
3.60-3.89; propleural distal edge with a more elongate metasoma and strongly en-
ridge; pronotum with mid longitudinal larged compound eyes than the known fe-
area with scrobiculate sculpturing; meson- male (Fig. 2). Also, E. tico male eyes are
otum evenly setose throughout; notaulus strongly enlarged in comparison with
conspicuously foveate throughout; area at those described for £. bicolor, the only oth-
notaulus union without a depressed area er males known for the genus,
and some punctate sculpturing present by The male genitalia (Fig. 3) are the first
setae; union of notaulus near transscutal to be described for a mendeselline braco-
articulation; transscutal articulation with a nid. As with most Cardiochilinae and Mi-
smooth carina that is absent laterally; scu- crogastrinae (Maeto 1996), the cuspis and
tellar sulcus wide, with 3 deep pits pre- digitus freely articulate, and there are
sent; scutellum subpentagonal, without about 10 very small teeth distally on the
any posterior apico-medial pits or sculp- digitus, as in some Cardiochilinae. The
turing; antero-medial area of metanotum basal ring is longer than in most micro-
with two subcircular pits, remainder of gastrines (i.e., forms a broad transverse
medial area nitid; axillary troughs of me- band), but shorter than in some derived
sonotum with spaced scrobiculate sculp- microgastrine genera. Thus for the most
turing; metapleuron dorsally nitid, re- part, mendeselline male genital capsules
mainder with areolate-rugulose sculptur- exhibit relatively plesiomorphic features,
ing present; propodeum, parallel mid-Ion- as would be expected from their proposed
gitudinal carinae united by complete phylogenetic relationships (Whitfield and
transversal carinae between them, remain- Mason 1994).
der with areolate-rugulose sculpturing

present, latero-longitudinal carinae cris- Mendesella orianae Valerio & Whitfield

tate as mid-loneitudinal carinae (no other SP' nov-

carinae as cristate), areas between carinae vrigs- iD' ^)

nitid or with fine obscure colliculate sculp- Male. — Body color: Mainly honey yel-

turing present. Metasoma: distal width of low, with antennal flagellomeres as dark

tergum 1/ basal width of tergum 1 = brown as inter-ocellar space; scape and

0.38-0.39; length of tergum 1 / distal width pedicel light brown, metasomal terga 2-7

of tergum 1 = 4.0-4.40; first metasomal (except median area of tergum 2 and 3

tergum: dorso-lateral carinae with well- whitish-yellow), hind telo and basitarsus,

defined and cristate dorsal carinae curving hind tibia distal 1/5 and fore as middle

close to one another apically and extend- leg telotarsus. First metasomal tergum

ing 0.70 length of tergum, conspicuously with lateral areas yellow. Head, mesono-

cristate basally; rugulose sculpturing turn and hind tibia with a darker tone of

densely present dasally on tergum, re- yellow than mesopleuron coloration; com-

mainder with more widely spaced rugu- pound eyes silver; palpus whitish-yellow.

Volume 9, Number 2, 2000

275

Fore and hind wing slightly infuscate
throughout; wing veins light brownish-
yellow, except hind RS and 2M nebulose
(with a short basal area tubular) with a
dark brown coloration. Body length =
3.80 mm; Fore wing length = 3.19 mm.
Head: head height /compound eye height
= 1.25; head height /compound eye length
= 1.67; length of first antennal flagellom-
ere = 0.26 mm; length of first antennal fla-
gellomere/ width of first antennal flagel-
lomere = 3.2; length of first antennal fla-
gellomere/ length of second antennal fla-
gellomere = 1.33; length of first antennal
flagellomere/ length of third antennal fla-
gellomere = 1.45; distal flagellomere
length /width of distal flagellomere = 3.0;
intertentorial pit distance = 0.18 mm;
ocell-ocular distance = 0.05 mm; distance
between toruli and tentorial pits = 0.28
mm; face wide at dorsal edge of clypeus
= 0.36 mm. Antenna with 38 flagellom-
eres, distal flagellomere with a long and
thick spine; face, frons, vertex, gena (ex-
cept ventral area) densely punctate; clyp-
eus mainly nitid, with scattered punctate
sculpturing present; malar suture present;
malar space very short; ocelli forming an
equilateral triangle. Mesosoma: mesoso-
mal length /mesosomal width = 1.64, me-
sosomal height = 0.82 mm; hindtibial
length /hindtibial width = 3.5; Pronotal
lateral areas with few obscure longitudi-
nal lineate sculpturing; mesonotum even-
ly punctate throughout as setose; notaulus
foveate anteriorly, remainder with ob-
scure foveate sculpturing; area at notaulus
union with rugulo-punctate sculpturing in
a depressed area; union of notaulus near
transscutal articulation; mesopleuron nit-
id, setose ventrally and remainder scat-
tered setose; sternaulus obscurely im-
pressed and nitid; transscutal articulation
with a smooth carina; scutellar sulcus
deep and wide, with 9 conspicuous pits
present; scutellum subpentagonal, with
two subrectangular pits close to one an-
other at posterior apico-median area; an-
tero-medial area of metanotum with two

subcircular pits near scutellar subrectan-
gular pits, distal edge punctate through-
out; axillary troughs of mesonotum with
coarsely-rugose sculpturing; propodeum
with parallel mid-longitudinal carinae
united by transversal carinae between
them, remainder with areolate-rugulose
sculpturing present, latero-longitudinal
carinae as cristate as mid-longitudinal ca-
rinae (no other carinae as strongly cris-
tate). Metasoma: Distal width of tergum
1/ Basal width of tergum 1 = 1.10; Length
of tergum 1/ Distal width of tergum 1 =
2.11; first metasomal tergum, dorso-lateral
carinae strong, dorsal carinae curving
close to another apically and not conspic-
uously cristate, rugulose sculpturing
throughout tergum, medial area raised
forming two semicircular lower areas that
contain 5 costulae each; terga 2-6 smooth
and unsculptured; tergum 2 with a "E"
shaped form, the mid-dorsal part as
strongly sclerotized as lateral areas of it,
but not reaching half of the length of the
tergum.

Holoti/pe. — Costa Rica, Guanacaste,
Parque Nacional Guanacaste, Estac. Los
Almendros, 300 m. 23/iii-28/iv/1994, Col.
E. Lopez. Deposited in INBio.

Comments. — This species is similar to
Mendesella magna and M. braziliensis, both
described by Whitfield & Mason (1994),
but can be separated from them by the ab-
sence of two elongated mid-lateral pits on
the first metasomal tergum, by metasomal
tergum 2 having an "E" shaped form with
the mid-dorsal area as strongly sclerotized
as the lateral areas, and the presence of
rugulose sculpturing throughout the first
metasomal tergum. Also, M. orianae can be
separated from any other Mendesella spe-
cies by the fore wing pattern of very weak
infuscation, the mesopleuron and prono-
tum not being darkened, the smaller bodv
size, and the darker metasomal terga 3-6.

Etymology. — Gender: feminine. The pre-
sent species is named in honor of Oriana
Valerio Contreras; live longer and pros-
per!

276

Journal of Hymenoptera Research

DISCUSSION
At present, the appearance of Mendesella
orianae in Costa Rica expands the northern
limit of known distribution for the genus
Mendesella. Until now, the genus was re-
ported only from Brazil, Bolivia and Ec-
uador (Whitfield & Mason 1994) with no
observed specimens of the genus in the
Caribbean zone of America. In contrast,
the genus Epsilogaster has a reported
northern limit of the southern U.S. (in-
cluding the Caribbean area), with a south-
ern limit in Brasil. The present observed
sparse distribution is likely to be the result
of the lack of specimens collected in other
areas, in combination with the difficulty of
identifying braconid wasps.

ACKNOWLEDGMENTS

We would like to thank The Instituto Nacional de
Biodiversidad (INBio) for the loan of their mendesel-
line material. Thanks also to Axel Retana for his ac-
curate comments, to Andy Deans for his help in the
wing drawing technique, to "la canalla biologica de
la calle de la perdision" in Costa Rica for their con-
stant support, and of course to "Cukha" for her un-
conditional presence.

LITERATURE CITED

Harris, R. A. 1979. A glossary of surface sculpturing.
Occasional Papers of the Bureau of Entomology of the
California Department of Agriculture. No. 28, p 32.

Huber, J. T. and M. J. Sharkey. 1993. Structure, Chap-
ter 3. Pp 13-59. In: Goulet, H. and J.T. Huber
(eds.), Hymenoptera of the world: An identification
guide of families, Agriculture Canada Publication
18894/E, Ottawa.

Maeto, K. 1996. Inter-generic variation in the external
male genitalia of the subfamily Microgastrinae
(Hymenoptera, Braconidae), with a reassessment
of Mason's tribal system. Journal of Hymenoptera
Research 5: 38-52.

Schuh, R. T. (ed.). 1989. The Torre-Bueno Glossary of
Entomology (revised edition). The New York En-
tomological Society, New York, 849 pp.

Sharkey, M. J. and R. A. Wharton. 1997. Morphology
and terminology, pp. 19-37 in: Wharton, R. A.,
P. M. Marsh and M. J. Sharkey, eds., Manual of
the New World Genera of the Family Braconidae (Hy-
menoptera), Special Publication of the Internation-
al Society of Hymenopterists, No.l. 439 pp.

Townes, H. 1969. The genera of Ichneumonidae, Part 1;
Ephialtinae to Agriotypinae. Memoirs of the Amer-
ican Entomological Institute 11: 1-300.

Whitfield, J. B. 1997. Mendesellinae, pp. 320-323 in:
Wharton, R. A., P. M. Marsh and M. J. Sharkey,
eds., Manual of the New World Genera of the Family
Braconidae (Hymenoptera), Special Publication of
the International Society of Hymenopterists,
No.l. 439 pp.

Whitfield, J. B. & W. R. M. Mason. 1994. Mendesel-
linae, a new subfamily of the braconid wasp (Hy-
menoptera, Braconidae) with a review of rela-
tionships within the microgastroid assemblage.
Systematic Entomology 19: 61-76.

J. HYM. RES.

Vol. 9(2), 2000, pp. 277-287

Revision of the Enigmatic Genus Marshiella Shaw in the New World
with the Description of Three New Species (Hymenoptera:

Braconidae: Euphorinae)

Scott R. Shaw and Paul M. Marsh

(SRS) U.W. Insect Museum, c/o Department of Renewable Resources, University of Wyoming,

Laramie, Wyoming 82071-3354 USA; (PMM) Cooperating Scientist, USDA Systematic

Entomology Laboratory, c/o U.S. National Museum of Natural History, MRC-168, Washington,

D.C. 20560, USA (correspondence address: P.O. Box 384, North Newton, Kansas 67117 USA)

Abstract. — The genus Marshiella Shaw is revised for the New World region. Included are two
previously described species, Marshiella plumicornis (Ruthe) and M. pulvillicornis (Walley and
MacKay), and three newly described species, M. bobella Shaw, M. lettermani Shaw, and M.
marshi Marsh. A key to New World species is provided, along with species descriptions, diag-
nostic characters, distribution, antennal micromorphology, and phylogenetic patterns.

The euphorine braconid genus Marshiel-
la was erected by Shaw (1985) to include
two enigmatic species with unusually
modified antennae that had previously
been placed in other genera. Marshiella
plumicornis (Ruthe) was formerly placed in
Microctonus Wesmael (Shenefelt 1969),
while M. pulvillicornis (Walley and
MacKay) was previously placed in Streblo-
cera Westwood (Walley and MacKay
1963),. but Shaw (1985) demonstrated that
these species were closely related based
on the uniquely modified, densely setose
basal flagellomeres (Figs. 1-2) and must
be assigned to a new genus. Previously
the genus was known only from the Hol-
arctic region, extending as far south as
Mexico in the New World (Shaw 1985).
More recently the genus has been record-
ed as far south as Costa Rica (Shaw 1997)
and two new species have been recentlv
described from China (Chen and van Ach-
terberg 1997) extending the known distri-
bution to the Oriental region. In this paper
the New World species are reviewed and
three new species are described including
material from Arizona, Texas, Mexico,
Costa Rica, and Brazil.

A full generic diagnosis for the genus
Marshiella has been published by Shaw
(1985) and more recently by Chen and van
Achterberg (1997), so it is not necessary to
repeat that information here. Recognition
of the genus is quite easy as it is the only
braconid with flagellomeres 1-4 or 1-5
flattened and densely setose ventrally (as
in Figs. 1-2, 5-6, 10-16, 18-19). Specimens
can be keyed to genus using the keys pro-
vided by Shaw (1985), Chen and van Ach-
terberg (1997), or Shaw (1997).

Very little is known about the biology
of Marshiella species, but they are pre-
sumed to be koniobiont endoparasitoids
of adult Coleoptera as are most other bas-
al clades of the Euphorinae (Shaw 1985,
1988; Shaw and Huddleston 1991). Only
one species, M. plumicornis (Ruthe) has
been reared from a host, an anthicid bee-
tle, Notoxus monoceros L. (Smith 1953; Gor-
nitz 1937). The same species has been col-
lected at cantharadin-baited traps in Mich-
igan, indicating that Marshiella species
probably orient to their hosts using chem-
ical cues (Shaw 1985; Dettner 1997). Most-
ly Marshiella species are quite rare, with

278

Journal of Hymenoptera Research

the Canadian species M. pulvillicornis
(Walley and MacKay) and the two Chi-
nese species, M. binarius Chen and van
Achterberg and M. sinensis Chen and van
Achterberg, being known only from the
holotypes. However, two of the new spe-
cies treated in this paper have been col-
lected in series from Malaise traps in Cos-
ta Rica, and occasionally are attracted to
lights. Males are totally unknown. The
function of the modified flagellum in Mar-

shiella females has not been observed, but
its form suggests the possibility that it is
an adaptation for grasping the host beetle
during oviposition since female euphori-
nes oviposit by swinging the metasoma
ventrally and anteriorly and exserting the
ovipositor forward between the legs and
in front of the face of the advancing wasp.
Authorship for new species is by either
Shaw or Marsh, as indicated for each spe-
cies.

KEY TO THE FEMALES OF NEW WORLD SPECIES OF MARSHIELLA SHAW

1. Dorso-lateral areas of propodeum entirely rugulose (Fig. 3); flagellomeres 2-A in dorsal
view only slightly broader than flagellomeres 8-10 Marshiella plumicornis (Ruthe)

- Dorso-lateral areas of propodeum entirely smooth and highly polished (Fig. 4); flagellom-
eres 2-A in dorsal view strongly widened and heart-shaped (Figs. 5-6), about 2X broader
than flagellomeres 8-10 2

2. Flagellomere 5 in dorsal view nearly cylindrical, and only slighter wider than flagellomere

6, not strongly flattened 3

- Flagellomere 5 in dorsal view strongly flattened, distinctly heart-shaped and nearly 2X
broader than flagellomere 6 4

3. Body size very small, less than 2 mm long; antenna short, with only 17 flagellomeres;
mesosoma reddish brown; known only from Canada

Marshiella pulvillicornis (Walley and MacKay)

- Body size larger, more than 2 mm long; antenna longer, with 19-21 flagellomeres; meso-
soma jet black; known only from Costa Rica .... Marshiella lettermani Shaw, new species

4. Metasomal tergum 1 entirely smooth on posterior half, beyond spiracles; ocellar-ocular
space pale yellowish white; known only from Brazil

Marshiella tnarshi Marsh, new species

- Metasomal tergum 1 finely rugulose on posterior half, beyond spiracles; ocellar-ocular
space entirely or partly dark chocolate brown to black; know from Arizona, Texas, Mexico,
and Costa Rica Marshiella bobella Shaw, new species

Marshiella bobella Shaw, new species

(Figs. 1-2, 4, 6, 8, 12-13)

Description of holoti/pe female. — Body
length 2.3 mm; forewing length 2.3 mm;
ovipositor length 1.1 mm. Color: frons,
vertex, temple, and entire mesosoma
black; flagellomeres 1-5 dorsally, remain-
der of flagellum, wing venation, entire
metasoma and ovipositor sheath dark
chocolate brown; scape, pedicel, flagel-
lomeres 1-5 ventrally, remainder of head,
legs entirely, and ovipositor light yellow-
ish brown; eye silvery gray; wing mem-

brane hyaline; setae, especially on flagel-
lomeres 1-5 ventrally, pale silvery white.
Head: scape 2.3 X longer than wide, apical
ventral margin protruding and carinate
longitudinally; flagellomeres 1-5 modi-
fied, pulvilliform, heart-shaped in dorsal
view, ventrally densely setose with long
wispy setae (Figs. 12-13); flagellomere 1
2x longer than wide; flagellomere 2 about
as long as wide; flagellomeres 3-4 slightly
wider than long; flagellomere 5 smaller,
about as long as wide; remainder of fla-
gellum comprising 15 flagellomeres of

Volume 9, Number 2, 2000

279

Figs. 1-2. Marshiella bobella Shaw, anterior view. 1,
head and antennae. 2, basal section of antenna show-
ing modified flagellomeres 1-5.

normal form; face somewhat protruding
below antennal insertions; eyes conver-
gent ventrally, closest near mid-point of
face; ocelli small, ocellar-ocular distance
5x width of lateral ocellus. Mesosoma:
mesoscutum smooth and highly polished
except notauli finely foveate, lateral lobes
mostly devoid of setae; scutellar furrow 2-
foveate; scutellar disc and dorso-lateral
faces of propodeum smooth and highly
polished; mesopleuron smooth and highly
polished except smooth and finely-foveate
sternaulus; length of marginal cell 0.6X
length of pterostigma; smooth dorso-lat-
eral surfaces of propodeum margined pos-
teriorly by V-shaped carinae; posterior
surface of propodeum slightly depressed
medially, margined laterally by carinae;
median line of propodeum, posterior, and
lateral surfaces rugulose, but polished and

Figs. 3-4. Propodeum, dorso-lateral view, 220X. 3,
Marshiella plumicornis (Ruthe). 4, Marshiella bobella
Shaw.

shining. Metasoma: petiolate tergum 1
narrow basally, then gradually wider,
posterior width 3x wider than extreme
basal width; petiole 7x longer than wide
at extreme base; dorsal surface of petiole
finely longitudinally rugose; remainder of
metasoma smooth and highly polished;
ovipositor length 2X length of tergum 1,
basally emerging from longitudinal ven-
tral slit about at mid-point of metasoma
below tergum 3, widely separated from
base of ovipositor sheath.

Variation. — paratype females appearing
similar to holotype except apical 'normal'
section of flagellum with 14 or 15 flagel-
lomeres. The ovipositor is extremely flex-
ible and varies in appearance depending
on its position at death. Ovipositor shape
varies from curved along basal Vi to nearly
straight. Depending on the degree to
which the tip of the metasoma is flexed
ventrally and anteriorly the ovipositor
base may appear to emerge apically or

280 Journal of Hymenoptera Research

ventrally near the mid-point of the meta- flagellomere 5 modified along with flagel-

soma. The specimens from Texas have less lomeres 1-4, larger body size, and longer

dark brown color on the top of the head, flagellum. The only other Marshiella spe-

but otherwise agree with the diagnosis of cies with flagellomere 5 modified is Mar-

this species. shiella marshi from Brazil, which can be

Material examined. — Holotype female: distinguished by its smooth metasomal

Costa Rica, San Jose Province: Zurqui de tergum 1 and lighter head color.

Moravia, 1600 m, April 1992, P. Hanson, Etymology. — The species name is an ar-

Malaise trap, deposited at University of bitrary combination of letters to form a eu-

Wyoming. Paratype females: 1 same data phonious combination,
as holotype; 1 same data except July 1990;

6 same data except November-December Marshiella lettermani Shaw, new
1990; 1 same data except May 1992; 3 same species
data except June 1992; 1 same data except (Fl§s- 14_16)
July 1992; 1 same data except February Description of holotype female. — Body
1996. Cartago Province: 1, La Cangreja, length 2.9 mm; forewing length 2.8 mm;
1950m, July 1991, P. Hanson, Malaise trap; ovipositor length 1.3 mm. Color: frons me-
1 same data except June-July 1992. Guan- dially, ocellar triangle, and entire meso-
acaste Province: 1, P. N. Guanacaste, 9 km soma except prosternum black; flagellom-
S Santa Cecilia, Estacion Pitilla, 700 m, 2- eres 1-4 dorsally, remainder of flagellum,
19 March 1992, P. Rios, INBio barcode prosternum, wing venation, entire meta-
CR1 000^420531; 1 same data except 31 soma and ovipositor sheath dark choco-
March-15 April 1992, INBio barcode late brown; scape, pedicel, flagellomeres
CR1000-771575; 1, Tierras Morenas, 700m, 1-4 ventrally, remainder of head, legs en-
December 1992, G. Rodriguez, INBio bar- tirely, and ovipositor very pale yellowish
code CR1001-288145; 1, Santa Rosa Na- brown; eye silvery gray; wing membrane
tional Park, 300 m, 14 August-6 Septem- hyaline; setae, especially on flagellomeres
ber 1986, I. D. Gauld and D. Janzen, Mai- 1-5 ventrally, pale silvery white. Head:
aise trap, Bosque Humedo, mature ever- scape 2.3 X longer than wide, apical ven-
green dry forest, fully shaded. Mexico: 1, tral margin protruding and carinate lon-
Chis., L. Montebello National Park, 5000 gitudinally; flagellomeres 1-4 modified,
ft., 30 May 1969, Malaise trap. U.S.A.: 1, pulvilliform, heart-shaped in dorsal view,
Arizona, 5 mi. W Portal, 7 July 1956, O. L. ventrally densely setose with long wispy
Cartwright, light trap; 2, Texas, Sabine setae on flagellomeres 1 and 4, shorter
Co., 9 mi. E. Hemphill, 23 June to 2 July bent Velcro-like setae on flagellomeres 2-
1989, Anderson and Morris, flight inter- 3 (Figs. 14-16); flagellomere 1 2X longer
cept trap in beech /magnolia forest. Para- than wide; flagellomere 2 about as long as
types deposited at University of Wyo- wide; flagellomere 3 slightly wider than
ming, Universidad de Costa Rica, Instituto long; flagellomere 4 smaller, about as long
Nacional de Biodiversidad, Texas A&M as wide; remainder of flagellum compris-
University, and U.S. National Museum of ing 17 flagellomeres of normal form; face
Natural History. somewhat protruding below antennal in-

Comments. — Specimens of this species sertions; eyes convergent ventrally, closest
from Arizona and Mexico had been pre- near mid-point of face; ocelli small, ocel-
viously treated as variations of M. pulvil- lar-ocular distance 3.5 X width of lateral
licornis by Shaw (1985), but the substantial ocellus. Mesosoma: mesoscutum smooth
series of specimens now available from and highly polished except notauli finely
Costa Rica show this to be a distinct spe- foveate, lateral lobes mostly devoid of se-
cies most easily separated by its having tae; scutellar furrow 2-foveate; scutellar

Volume 9, Number 2, 2000

281

Figs. 5-6. Basal section of antennal flagellum, dorso-
lateral view. 5, Marshiella pulvillicornis (Walley and
MacKay), 230 X. 6, Marshiella bobella Shaw, 235 X.

disc and dorso-lateral faces of propodeum
smooth and highly polished; mesopleuron
smooth and highly polished except
smooth and coarsely-foveate sternaulus;
length of marginal cell 0.9 x length of pter-
ostigma; smooth dorso-lateral surfaces of
propodeum margined posteriorly by V-
shaped carinae; posterior surface of pro-
podeum slightly depressed medially, mar-
gined laterally by carinae; median line of
propodeum, posterior, and lateral surfaces
rugulose, but polished and shining. Me-
tasoma: petiolate tergum 1 narrow basal-
ly, then gradually wider, posterior width
2.8 X wider than extreme basal width; pet-
iole 6X longer than wide at extreme base;
dorsal surface of petiole finely longitudi-
nally rugose on basal 3/4; posterior 1/4 of
petiole and remainder of metasoma
smooth and highly polished; ovipositor
length 1.9X length of tergum 1, basally
emerging from longitudinal ventral slit
about at mid-point of metasoma below
tergum 3, widely separated from base of
ovipositor sheath.

Figs. 7-9. Metasomal tergum 1, dorso-lateral view. 7, Marshiella plumicornis (Ruthe), 220x. 8, Marshiella bobella
Shaw, 195X; 9, Marshiella marshi Marsh, 220x.

282

Journal of Hymenoptera Research

Figs. 10-11. Marshiella plumicornis (Ruthe), basal section of antennal flagellum, ventral view. 10, flagellomeres
1-5, 295 X. 11, detail of flagellomeres 1-3 showing spatulate setae, 700x.

Variation. — paratype females appearing
similar to holotype except apical 'normal'
section of flagellum with 15 to 17 flagel-
lomeres, body size 2.2 to 2.9 mm, and dark
brown covering most of frons and vertex.

Material examined. — Holotype female:
Costa Rica, Puntarenas Province: San Vito,
Estacion Biological Las Alturas, 1500 m,
December 1991, P. Hanson, Malaise trap,
deposited at University of Wyoming, Lar-
amie. Paratype females: 1 same data as ho-
lotype; 1 same data except November
1991; 2 same data except June 1992. Para-
types deposited at University of Wyoming
and Universidad de Costa Rica.

Comments. — Marshiella lettermani is most
similar to M. pulvillicornis (Walley and
MacKay) in that both of these species have

flagellomeres 1-4 greatly widended and
densely setose, but flagellomere 5 is not so
modified. The Costa Rican species M. let-
termani can be distinguished from M. pul-
villicornis by its larger body size (nearly 3
mm), black mesosoma, short bent Velcro-
like setae on flagellomeres 2-3 (Fig. 16),
and longer flagellum with 19-21 flagel-
lomeres. M. pulvillicornis is much smaller
(less than 2 mm), has a reddish brown me-
sosoma, shorter flagellum with only 17 fla-
gellomeres, entirely long wispy flagellar
setae, and is known only from Canada.

Etymology. — The species name is a pa-
tronym for David Letterman, host of the
Late Show, in appreciation for his out-
standing contributions to late night enter-
tainment. Many a dull day has been im-

Volume 9, Number 2, 2000

283

Figs. 12-13. Marshiella bobella Shaw, basal section of
antennal flagellum, ventral view. 12, flagellomeres 1-
5, 215x. 13, detail of flagellomere 5 showing long
wispy setae, 905 X.

proved by his humor. It somehow seems
appropriate that a really weird insect
should be named in his honor.

Marshiella marshi Marsh, new species

(Figs. 9, 17-19)

Description of holotype female. — Body
length 2.9 mm; forewing length 2.8 mm;
ovipositor length 1.2 mm. Color: frons,
vertex, and temple medially light brown;
margins of ocelli and notauli black; flagel-
lomeres 1-5 dorsally, remainder of flagel-
lum, wing venation, mesosoma except
prosternum, metasoma except petiole ba-
sally, and ovipositor sheath dark reddish
brown; scape, pedicel, flagellomeres 1-5
ventrally, remainder of head, legs entirely,
and ovipositor very pale yellowish brown
to yellowish white; eye silvery gray; wing
membrane hyaline; setae, especially on
flagellomeres 1-5 ventrally, pale silvery
white. Head: scape 3.0 x longer than wide,
apical ventral margin protruding (Fig. 17)

and carinate longitudinally; flagellomeres
1-5 modified, pulvilliform, heart-shaped
in dorsal view, ventrally densely setose
with long wispy setae, some of which are
intertwined or braided (Figs. 18-19); fla-
gellomere 1 1.5X longer than wide; flagel-
lomere 2 about as long as wide; flagellom-
eres 3^4 slightly wider than long; flagel-
lomere 5 smaller, about as long as wide;
remainder of flagellum comprising 15 fla-
gellomeres of normal form; face somewhat
protruding below antennal insertions;
eyes convergent ventrally, closest near
mid-point of face; ocelli small, ocellar-oc-
ular distance 4X width of lateral ocellus.
Mesosoma: mesoscutum smooth and
highly polished except notauli finely fo-
veate, lateral lobes mostly devoid of setae
medially; scutellar furrow 2-foveate; scu-
tellar disc and dorso-lateral faces of pro-
podeum smooth and highly polished; me-
sopleuron smooth and highly polished ex-
cept smooth and finely-foveate sternaulus;
length of marginal cell 0.7x length of
pterostigma; smooth dorso-lateral surfaces
of propodeum margined posteriorly by V-
shaped carinae; posterior surface of pro-
podeum slightly depressed medially, mar-
gined laterally by carinae; median line of
propodeum, posterior, and lateral surfaces
rugulose, but polished and shining. Me-
tasoma: petiolate tergum 1 narrow basal-
ly, then gradually wider, posterior width
3x wider than extreme basal width; peti-
ole 7x longer than wide at extreme base;
dorsal surface of basal 1 /2 of petiole finely
longitudinally rugose; posterior 1/2 of
petiole and remainder of metasoma
smooth and highly polished; ovipositor
length 2x length of tergum 1, basally
emerging from longitudinal ventral slit
about at mid-point of metasoma below
tergum 3, widely separated from base of
ovipositor sheath.

Material examined, — Holotype female:
Brazil, Rondonia, Vilhena, 21 degrees 40
minutes S, 60 degrees 08 minutes W, Oc-
tober 1973, M. Alvarenga, deposited at Ca-
nadian National Collection, Ottawa.

284

Journal of Hymenoptera Research

Figs. 14-16. Marshiella lettermani Shaw, basal section of antennal flagellum, ventral view. 14, flagellomeres
1-5, 215X. 15, flagellomeres 3-4, 745X, showing variation of seta form and density. 16, flagellomere 3, 1450X,
showing detail of short, bent, Velcro-like setae.

Comments. — Marshiella marshi can be
separated from most other species by its
having flagellomere 5 modified along with
flagellomeres 1-4, larger body size, and
longer flagellum. The antennal scape is
slighly more protruberant and setose (Fig.
17) than other species. Some of the long
wispy setae on flagellomeres 2-3 are in-
tertwined or braided (Fig. 18-19), but the
sample size is too limited to determine if
this is natural or a post-mortem effect of
preservation methods. The only other
Marshiella species with flagellomere 5
modified is M. bobella from Arizona, Costa
Rica, and Mexico, which can be distin-
guished from M. marshi by its rugulose
metasomal tergum 1 and darker head col-
or.

Etymology. — The species is named in
honor of Jon Marsh, son of the junior au-
thor.

Marshiella plumicornis (Ruthe)

(Figs. 3, 7, 10-11)

Microctonus plumicornis Ruthe, 1856. Re-
classified by Shaw, 1985.

Description of female based on North Amer-
ican material. — Body length 1.8-1.9 mm;

forewing length 1.7-1.8 mm; ovipositor
length 0.6-0.7 mm. Color: frons, vertex,
temple, gena, mesosoma except pronotum
and prosternum, flagellomeres 4-16, wing
venation, entire metasoma and ovipositor
sheath dark chocolate brown to black (fad-
ing to yellowish brown in old specimens);
scape, pedicel, flagellomeres 1-3, remain-
der of head, legs entirely, and ovipositor
light yellowish brown; eye silvery gray;
wing membrane hyaline; setae, especially
on flagellomeres 1—4 ventrally, pale sil-
very white. Head: scape 2.2 X longer than
wide, apical ventral margin not protrud-
ing or carinate longitudinally; flagellom-
eres 1-4 modified, pulvilliform, narrowly
heart-shaped in dorsal view, ventrally
densely setose with setae expanded and
flattened apically into spatulate tips (Figs.
10-11); flagellomere 1 3x longer than
wide; flagellomeres 2-3 about 2X as long
as wide; flagellomere 4 1.5X wider than
long; remainder of flagellum comprising
12 flagellomeres of normal form; face not
protruding below antennal insertions;
eyes convergent ventrally, closest near
ventral margin of face; ocelli small, ocel-
lar-ocular distance 5X width of lateral

Volume 9, Number 2, 2000

285

Figs. 17-19. Marshiella marshi Marsh, basal section of antenna. 17, scape and pedicel, lateral view, 380x. 18,
flagellomeres 1-5, ventral view showing long wispy setae, 250x. 19, flagellomere 2, ventral view showing
detail of intertwined, braided setae, 885x.

ocellus. Mesosoma: mesoscutum smooth
and highly polished except notauli fove-
ate, median and lateral lobes mostly de-
void of setae; scutellar furrow 2-foveate;
scutellar disc smooth and highly polished;
mesopleuron smooth and highly polished
except coarsely-foveate sternaulus; length
of marginal cell 0.4 X length of pterostig-
ma; rugulose dorso-lateral surfaces of pro-
podeum margined posteriorly by V-
shaped carinae; posterior surface of pro-
podeum slightly depressed medially, mar-
gined laterally by carinae; median line of
propodeum, dorso-lateral, posterior, and
lateral surfaces rugulose, but somewhat
polished and shining. Metasoma: petiolate
tergum 1 narrow basally, then gradually
wider, posterior width 3x wider than ex-
treme basal width; petiole 5X longer than
wide at extreme base; dorsal surface of
petiole finely longitudinally rugose; re-
mainder of metasoma smooth and highly
polished; ovipositor length 1.6X length of
tergum 1, basally emerging from longitu-
dinal ventral slit apically to near mid-
point of metasoma below tergum 3, wide-
ly separated from base of ovipositor
sheath.

Material examined. — U.S.A., Arizona: 1

female, Safford, 4 November 1955, G. D.
Butler, swept from alfalfa. California: 1 fe-
male with cocoon, Chino, July 1932, A. J.
Basinger, ex. peaches infested by A. linea-
tella. Florida: 1 female, St. Lucie Co., 31
March-5 April 1930, J. R. Barass, Florida
fruit fly trap survey; 1 female, Indian Riv-
er, 10 March 1930, J. R. Barass, Florida
fruit fly trap survey. Michigan: 2 females,
Ingham Co., Dewitt Township, 10-17 June
1982, D. K. Young, taken at cantharadin
bait. 1 female, Kalamazoo Co., Harrison
Lake, T3S, R12W, sec. 34, 16-26 June 1982,
J. K. Young, taken at cantharadin bait.
South Carolina: 1 female, Clemson, no
date, G. G. Ainslie; 1 female, Clio, 22 July
1936, on cotton, lot 36-30265. Deposited at
U.S. National Museum of Natural History,
Washington, D.C. Holotype female from
Germany examined by Shaw (1985), de-
posited at the Natural History Museum,
London.

Comments. — This species has the widest
distribution of any Marshiella species, be-
ing recorded from both Europe (Chen and
van Achterberg 1997) and the United
States (Shaw 1985). M. plumicornis can be
easily distinguished from all other New
World species of Marshiella by the dorso-

286 Journal of Hymenoptera Research

lateral areas of the propodeum being en- discovered, therefore there is no need to

tirely rugulose and flagellomeres 2-4, in redescribe the species here. In addition to

dorsal view, being only slightly wider other characters mentioned in the key, this

than flagellomeres 8-10. species can be distinguished from other

The distinctive flagellar setae micromor- Marshiella by its small body size (less than
phology (Figs. 10-11), with the ventral se- 2mm), short flagellum with 17 flagellom-
tae of flagellomeres 1-4 having flattened, eres, and reddish brown mesosoma.
spatulate tips, was previously document- Discussion of PJiylogenetic Consider-
ed by Shaw (1985). It was previously pre- ations. — Our understanding of variation
sumed that this setal micromorphology for characters of possible phylogenetic sig-
was a characteristic of the genus Marshiella nificance in Marshiella species is no doubt
(Shaw 1985; Chen and van Achterberg limited by the scarcity of material for sev-
1997), however, the more complete survey eral species, and also the lack of biological
presented here indicates that setal micro- data for all but one species. Nevertheless,
morphology varies among Marshiella spe- it is tempting to speculate on the possible
cies, and the spatulate form has so far only phylogenetic interpretation of several
been documented in M. plumicornis. characters, especially the unique antennal

Biology. — M. plumicornis has been reared modifications which are presumptive syn-

from the anthicid Notoxus monoceros L. in apomorphies by out-group comparison

Europe (Gornitz 1937; Smith 1953), but it with the presumed sister-group, Toumesi-

has not yet been reared in North America, lit us (Shaw 1985).

It has been attracted to cantharadin bait Four of the New World species appear

(Shaw 1985), suggesting possible chemo- to form a distinctive monophyletic cluster

sensory location of coleopteran hosts including M. bobella, M. lettermani, M. mar-

(Dettner 1997). Dan Young (pers. comm.) shi, and M. pulvillicornis. Synapomorphies

reports having seen braconids attracted to supporting this lineage include greatly

cantharadin in Michigan (presumably this widened and strongly flattened basal fla-

species) attacking anthicids near the trap, gellomeres (Fig. 18), modified scape with

One specimen was reared from peaches the apical ventral margin protruding (Fig.

infested with the gelechiid Anarsia linea- 17), dorsum of propodeum with large

tella Zeller (the peach twig borer), but it smooth areas devoid of sculpture (Fig. 4),

seems unlikely that this was the actual and face with pale coloration. Although

host (more likely it was a beetle in the the two Chinese species were not available

same substrate). for examination, the published descrip-
tions agree more closely with the condi-

Marshiella pulvillicornis (Walley and tk)ns seen in the more basal M plumicornis

JVlacKay) which has more cylindrical and less flat-

^ §• ' tened flagellomeres, shorter and less pro-

Streblocera pulvillicornis Walley and truding scape, rugose propodeum, and

MacKay, 1963. Reclassified by Shaw, 1985. brown face. The significance of a derived

Material examined. — Holotype female, cluster including M. bobella, M. lettermani,
Canada, Quebec, Gatineau Park, Meach M. marshi, and M. pulvillicornis is two-fold.
Lake, 9 June 1961, G.S. Walley, sweeping, First, this indicates that all the more basal
No. 8223, deposited in Canadian National species of Marshiella have holarctic or pa-
Collection, Ottawa. learctic distributions, while all the species

Comments. — This species was described with Neotropical distributions belong to a
by Walley and MacKay (1963) based on a derived strictly New World cluster. This
single female specimen from Quebec. No is consistent with an hypothesis of one in-
new material of the species has since been vasion of South America, from the north

Volume 9, Number 2, 2000

in-

temperate zone. Second, it shows that the
one species with known biology is basal,
suggesting the possibility that the highly
modified antennae of the more southern
New World species may also be modifi-
cations for locating hosts via cantharadin
or other semiochemicals.

ACKNOWLEDGMENTS

Special thanks to Prof. Paul Hanson, of the Univ-
ersidad de Costa Rica, for running the Malaise Trap
network over many years, which yielded most of the
Costa Rican material treated here. Specimens were
also provided bv the Canadian National Collection,
Ottawa, the Instituto Nacional de Biodiversidad (IN-
Bio), Heredia, and the U.S. National Museum of Nat-
ural History, Washington, D.C. Thanks to Prof. Dan
Young, of the University of Wisconsin, for sharing his
observations on braconids attracted to cantharadin.

LITERATURE CITED

Chen, X. And C. van Achterberg. 1997. Revision of
the subfamily Euphorinae (excluding the tribe
Meteorini Cresson) (Hvmenoptera: Braconidae)
from China. Zoologische Verhandelingen 313: 1-
217.

Dettner, K. 1997. Chapter 8. Inter- and intraspecific
transfer of toxic insect compound cantharadin.

Pp. 115-145, In: Dettner, K. et al. (eds.), Vertical
food web interactions, Ecological Studies, Vol.
130, Springer- Verlag, Berlin, Heidelberg.

Gornitz, K. 1937. Cantharadin als gift und anlock-
ungsmittel fur insekten. Arbeit Physiologische An-
gewandten Entomologie Berlin-dahlem 4: 116-157.

Shaw, M. R. and T. Huddleston. 1991. Classification
and biology of braconid wasps (Hvmenoptera:
Braconidae). Handbooks for the identification of Brit-
ish insects 7: 1-126.

Shaw, S. R. 1985. A phylogenetic study of the subfam-
ilies Meteorinae and Euphorinae (Hymenoptera:
Braconidae). Entomography 3: 277-370.

Shaw, S. R. 1988. Euphorine phvlogeny: the evolution
of diversity in host-utilization by parasitoid
wasps (Hymenoptera: Braconidae). Ecological En-
tomology 13: 323-335.

Shaw, S.R. i997. Subfamily Euphorinae. Pp. 234-234,
In: Wharton, R. A., P. M. Marsh and M. J. Shar-
key, eds. Manual of the New World genera of
the family Braconidae. Special publication of the In-
ternational Society ofHymenopterists. No. 1, 438 pp.

Shenefelt, R. D. 1969. Hymenopterorum Catalogus,
Braconidae 1, Euphorinae. W. Junk, The Hague,
176 pp.

Smith, O. J. 1953. Species, distribution, and host re-
cords of the braconid genera Microctonus and
Perilitus (Hvmenoptera: Braconidae). Ohio Journal
of Science 53: 173-178.

Walley, S. G. and M. R. MacKay. 1963. The discovery
of Streblocera in Canada (Hymenoptera: Braconi-
dae). The Canadian Entomologist 95: 999-1001.

J. HYM. RES.
Vol. 9(2), 2000, pp. 288-291

Description of a New Gregarious Species of Aleiodes Wesmael
(Hymenoptera: Braconidae: Rogadinae)

Joseph C. Fortier
Gonzaga University, Spokane, Washington 99258, USA

Abstract. — Aleiodes leptocarina Fortier, a new species from Costa Rica, is described and illustrated.
Specimens were reared from a large lepidopteran caterpillar, making this species one of only three
presently known gregarious Aleiodes species. Morphological comparisons are made with A. stig-
mator, the other New World gregarious species.

The rogadine braconid genus Aleiodes clusively on non-catocaline noctiiids. They
Wesmael is worldwide in distribution suggest an evolutionary pattern for koino-
(Shaw et ah 1997). Fortier and Shaw (1999) biont endoparasitoids in which more de-
list 208 Aleiodes species worldwide. Evi- rived species tend to have narrower host
dence (Fortier, unpublished data) suggests ranges than less derived species (Fortier
that it may be far more species-rich in the and Shaw 1999).

Neotropics than had heretofore been Evidence (Fortier and Shaw 1999) sug-

known. gests a coevolutionary trend between Al-

Species of tribe Rogadini, to which Al- eiodes and their lepidopteran hosts. Basal

eiodes belongs, are koinobiont endoparasi- host families are more likely to be at-

toids of more or less exposed lepidopteran tacked by basal Aleiodes species while the

larvae (Shaw 1983, 1994; Shaw and Hud- most derived host family, Noctuidae, is

dleston 1991; Shaw 1995, Fortier and Shaw more likely to be attacked by derived Al-

1999). A characteristic of Rogadini is that eiodes species.

pupation takes place inside the dead So far as known previous to this study,

host's larval skin, which hardens and only two Aleiodes species, a Palaearctic

darkens to become a 'mummy' (Shaw and species and the Nearctic species A. stig-

Huddleston 1991). rnator (Say), are gregarious (Shaw and

Aleiodes host mummies can usually be Huddleston 1991, Shaw 1997).
distinguished from those of its putative

sister group Rogas (Whitfield, 1992) in that METHODS
1) a slit is cut in the ventral area of the This species can be identified as a mem-
host's thoracic region, through which a ber of the subfamily Rogadinae by using
sticky substance is emitted, which often the keys of Shaw (1995), Shaw and Hud-
functions to glue the mummy to a sub- dleston (1991), or Wharton et ah (1997).
strate, and 2) the emergence hole cut by My definition of Aleiodes follows that of
the emerging adult parasitoid is normally van Achterberg (1991), Fortier and Shaw
less jagged and more circular as compared (1999), Shaw (1993), and Shaw et ah (1997).
with Rogas (Shaw 1995, 1997; see Fig. 8 Specimens can be determined as Aleiodes
this paper). using the key of Shaw (1997).

Fortier and Shaw have argued that bas- Terminology follows that used by Shaw

al Aleiodes species tend to be less host spe- et ah (1997). Microsculpture terminology

cific while derived species tend to feed ex- follows that of Harris (1979). Wing vein

Volume 9, Number 2, 2000

289

Figs. 1-4. Aleiodes leptocarina. 1, Head. 2, Mesopleuron. 3, Flagellomeres near middle of antenna. 4, Wings.

terminology agrees with that adopted by
Wharton et al. (1997) and by Goulet and
Huber (1993).

Aleiodes leptocarina Fortier, new
species

(Fig. 1-7)

Female. — Body color: honey yellow, legs
and mandibles honey yellow except man-
dibular teeth and ocellar triangle black,
clypeus occasionally with black; anten-
nomeres dark honey yellow, wings hya-
line, veins, stigma dark honey yellow.
Body length: 6-7 mm; fore wing length,
5.5-6.0 mm. Head: 44-46 flagellomeres,
first flagellomere length about 1.6 times
width, 20th flagellomere length about 1.5
times width (Fig. 3); oral opening height
slightly greater than or equal to width,
clypeus protruding with distinct apical
edge (Fig. 1); occipital carina interrupted
at apex and not meeting hypostomal ca-
rina; ocelli moderately large, slightly

greater than ocell-ocular distance; face
finely colliculate; longitudinal ridge be-
tween antennae occasionally extending
down face up to 0.35 length of antenno-
clypeal space; vertex colliculate; temples
colliculate. Mesosoma: pronotum collicu-
late; mesonotum and scutellum collicula-
te; notauli without carinae; mesopleuron
finely colliculate with a dull shine, subalar
groove without carinae, sternaulus absent
(Fig. 2); propodeum rugose or rugulose
posteriad, faintly rugulose over colliculate
surface anteriad, or without rugae (Fig. 5).
Legs: tarsal claws of all legs completely
pectinate (Fig. 6); hind coxae evenly colli-
culate dorsally and laterally. Wings (Figs.
4): hyaline; front wing vein r about half
the length of 3RSa and about 1.3 times
length of rm; vein lCU-a about 0.8 length
of lCU-b; rear wing vein m-cu absent; RS
slightly recurved, marginal cell narrowest
at midpoint; vein r-m shorter than vein
1M; vein 1A meeting and terminating at

290

Journal of Hymenoptera Research

Figs. 5-8. Aleiodes leptocarina. 5, Propodeum. 6, Metatarsal claw. 7, Second metasomal tergite. 8, Dorsal view
of host caterpillar.

apex of vein cu-a; vein M+CU over 1.5
times as long as vein 1M. Metasoma: me-
tasomal tergite weakly rugulose, raised
transverse carinae of first metasomal ter-
gite at base joining medially to form me-
dian carina, median carina becoming
fainter apically, first metasomal tergite
length slightly less than or equal to apical
width, basal width slightly greater than
0.5 apical width; second metasomal tergite
weakly rugulose, median carina weak, oc-
casionally absent in apical (Fig. 7); third
metasomal tergite mostly shiny, finely col-
liculate with faint rugulation antero-me-
dially, median carina usually absent ba-
sally, never present apically; tergites api-
cad of third metasomal tergite smooth;
ovipositor sheath length about 0.35 times
basitarsis length.

Male. — Essentially as in female, except
41-43 flagellomeres, 20th flagellomere
length over twice the width, forewing

length 5.0-5.5 mm., first metasomal tergite
length slightly greater than apical width,
third metasomal tergite weakly rugulose
in basal half, weakly rugulose or shiny-
colliculate in apical half, median carina oc-
casionally weakly present in basal half.

Holotype.— Female: COSTA RICA, Car-
tago, P. N. Tapanti, 1150 m., LS194000,
559800, IX-5-1995, G. Mora, collector. De-
posited in INBio.

Paratypes.— COSTA RICA: 76 females,
15 males, Cartago, P. N. Tapanti, 1150 m.,
LSI 94000, 559800, IX-5-1995, G. Mora, col-
lector. Paratypes deposited in INBio,
Wheeling Jesuit University Insect Collec-
tion, Texas A&M Department of Entomol-
ogy Insect Collection, and Rocky Moun-
tain Systematic Entomology Laboratory.

Distribution. — Known only from Costa
Rica.

Biology. — Holotype and paratypes all
reared from a single lepidopteran host

Volume 9, Number 2, 2000

291

(Donald Davis, personal communication)
(Fig. 8) about 7 cm. long.

Comments. — This species and A. stigma-
tor (Say) are the only described gregarious
New World species. The tarsal claw is
closely similar to that of A. stigmator in ar-
rangement of the pectin and in overall
shape. This species differs from A. stig-
mator in having more than 34 antennom-
eres, clypeus protruding with distinct api-
cal edge, shiny mesopleuron, finely retic-
ulate rugulation on first and second me-
tasomal tergites, and females with little or
no rugulation on third metasomal tergite.
Morphological features including short
pronotum place it in the gastritor species-
group. A. stigmator is also in this species-
group (Fortier and Shaw 1999, Shaw et al.
1997). The clypeus protruding and edged
apically is a derived character state found
elsewhere in the gastritor species-group.

Etymology. — From the Greek leptos
meaning "fine, delicate," and carina mean-
ing "ridge," in reference to the finely re-
ticulate rugulation on the first two meta-
somal tergites.

ACKNOWLEDGMENTS

I thank Ugalde Gomez Jesus, curator of the Hy-
menoptera collection at INBio, Instituto Nacional de
Biodiversidad, Santo Domingo de Heredia, Costa
Rica, who provided specimens for this study. Thanks
are due Scott R. Shaw, curator of the Rocky Mountain
Systematic Entomology Laboratory, University of
Wyoming, Laramie, Wyoming, who made those spec-
imens accessible to me. I also thank Ms. Diane Barry
at NIOSH (National Institute for Occupational Safety
and Health) in Morgantown, West Virginia, for her
assistance with the Scanning Electron Microscope and
photography- I would also like to thank Mark Shaw
and Don Quicke for reviewing the manuscript and
offering constructive comments, and Don Davis for
identifying the host.

LITERATURE CITED

Achterberg, C. van. 1991. Revision of the genera of
the Afrotropical and W. Palaearctic Rogadinae

Foerster (Hymenoptera: Braconidae). Zoologische
Verhandelingen 273: 1-102.

Fortier, J. and S. R. Shaw. 1999. Cladistics of the Al-
eiodes lineage of the subfamily Rogadinae (Hy-
menoptera: Braconidae). journal of Hymenoptera
Research 8:204-237.

Goulet, H. and J. T. Huber. 1993. Hymenoptera of the
World: An identification guide to families. Agricul-
ture Canada Publication 1894/ E, Ottawa.

Harris, R. A. 1979. A Glossary of Surface Sculpturing.
Occasional Papers in Entomology, California Depart-
ment of Agriculture 28: 1-33.

Shaw, M. R. 1983. On[e] evolution of endoparasitism:
the biology of some genera of Rogadinae (Bra-
conidae). Contributions of the American Entomolog-
ical Institute 20:307-328.

Shaw, M. R. 1994. Chapter 7, Parasitoid host ranges.
Pp. 112-144, In: Hawkins, B. A. and W. Sheehan
[eds.], Parasitoid Community Ecology, Oxford Uni-
versity Press, Oxford.

Shaw, M. R. and T. Huddleston. 1991. Classification
and biology of braconid wasps. Handbooks for the
Identification of British Insects 7: 1-126.

Shaw, S. R. 1993. Systematic status of Eucystomastax
Brues and characterization of the Neotropical
species (Hymenoptera: Braconidae: Rogadinae).
journal of Hymenoptera Research 2:1-11.

Shaw, S. R. 1995. Chapter 12.2, Braconidae. Pp. 431-
463, In: Hanson, P. E. ajd I. D. Gauld [eds.], The
Hymenoptera of Costa Rica, Oxford University'
Press, Oxford.

Shaw, S. R. 1997. Subfamily Rogadinae s.s. Pp. 403-
412, In: Wharton, R. A., P. M. Marsh, and M. J.
Sharkey [eds.], Manual of New World genera of the
family Braconidae. Special Publication of the Inter-
national Society of Hymenopterists. No.l, 438
pp.

Shaw, S. R., P. M. Marsh, and J. C. Fortier. 1997. Re-
vision of North American Aleiodes Wesmael (Part
1): the pulchripes Wesmael species-group in the
New World (Hymenoptera: Braconidae, Roga-
dinae). journal of Hymenoptera Research 6(1): 10
35.

Wharton, R. A., P. M. Marsh, and M. J. Sharkey, eds.
1997. Manual of New World genera of the family
Braconidae. Special Publication of the International
Society of Hymenopterists. No.l, 438 pp.

Whitfield, J. B. 1992. The polyphyletic origin ot en-
doparasitism in the cyclostome lineages oi Bra-
conidae (Hymenoptera). Systematic Entomology
17: 273-286.

J. HYM. RES.
Vol. 9(2), 2000, pp. 292-297

Descriptions and Biological Notes on Two New

Phytophagous Species of the Genus Allorhogas from Brasil

(Hymenoptera: Braconidae: Doryctinae)

Paul M. Marsh, Margarete Valverde de Macedo and Marina C. P. Pimental

(PMM) P. O. Box 384, North Newton, Kansas 67117, USA (cooperating scientist, Systematic

Entomology Laboratory, U. S. Department of Agriculture, Washington, DC); (MVM, MCPP)

Laboratorio de Ecologia de Insetos, Departamento de Ecologia, CP 68020, IB, Universidade

Federal do Rio de Janeiro, Ilha do Fundao, Rio de Janeiro, Brasil, CEP 21941-590

Abstract. — Two new species of the genus Allorhogas are described from the Poco das Antas
Biological Reserve, Rio de Janeiro State, Brasil: A. spermaphagus Marsh, reared from seed pods
of Stryphnodendron polyphyllum (Leguminosae) and A. brasiliensis Marsh, reared from seed pods
of Pithecellobium pedicellare (Leguminosae). Biological notes are provided and a key is presented
to the species reared from plant seeds or galls in Brasil.

For centuries, species in the family Bra- For many years, there have been records

conidae were thought to be always para- of species in the genus Allorhogas being

sitoids of other insects. Macedo and Mon- reared from plant galls but no firm biolog-

teiro (1989) presented the first document- ical data was available. For example, A.

ed case of phytophagy in the family Bra- galicola Gahan was reared from oak galls

conidae for a species of the braconid (Gahan 1912) and A. heringeri (Guimaraes)

genus Allorhogas (subsequently described and A. muesebecki (Guimaraes) were

as A. dyspistus by Marsh 1991) which at- reared from plant galls (Guimaraes 1957).

tacks seeds of the legume Pithecellobium No species have ever been definitely

tortum Martius in Brasil. Since then, more reared as parasitoids of other insects in

records of phytophagy in the Braconidae galls or seed pods As noted above and

have been noted. Infante, et al. (1995) from the bioiogicai information presented

showed that species of the genus Momto- here/ it ig now firmly established that spe.

riella formed galls on Philodendron in Cen- ^ ^ the g attack geed dg and are

tral and South America. Ramirez and ., c .u

i ^™^v i-ii r i not parasitic on any other insect, rurther-

Marsh (1996) described two species of the , \ , ., , c

„ ' , , „ r„. , . , more, several undescnbed species from

genus Psenobolus from Costa Rica which _ _. , , , /

, ... ,■ ti ..i Costa Rica have been reared from various

develop as inquilines in figs. Recently, , . „ , , . ., , , . , . .

Austin and Dangerfield (1998) showed leaf §al s' althou§h ™ detailed biological

that a species of the genus Mesostoa forms studies have yet been made- ,

galls on Banksia in Australia and Macedo The following new species of the genus

et al. (1998) provided further information Allorhogas are described in order to pro-

on the biology of A. dyspistus in Brasil. vide names for further biological studies

One of us (PMM) has seen a new species being done by two of us (MVM, MCPP).

of Allorhogas from Costa Rica that has These species were reared from seeds of

been reared from another species of Pithe- Stryphnodendron polyphyllum Martius and

cellobium. Thus, it is now well established Pithecellobium pedicellare (DC.) Benth. in

that phytophagy does occur in the family Brasil and preliminary observations are

Braconidae. given under each species description be-

Volume 9, Number 2, 2000

293

low. The genus is in need of study for the
Neotropical Region. There are an estimat-
ed 50 species from Brasil, nearly all un-
described and mostly without biological
information. A study is in progress on the
genus from Costa Rica with an estimate of
25 undescribed species.

The names of the two new species are
to be attributed only to the senior author;
all biological observations were made by
the junior authors. The genus Allorhogas
can be identified by keys presented in
Marsh (1997). Morphological terminology
is based on Wharton, et al. (1997).

KEY TO SPECIES OF ALLORHOGAS REARED FROM PLANT SEEDS OR GALLS IN BRASIL

(Based on females only)

1. Ovipositor barely visible, shorter than first metasomal tergum 2

- Ovipositor at least half as long as metasoma 3

2(1). Malar space 2/5 eye height dyspistus Marsh

- Malar space nearly equal to eye height muesebecki (Guimaraes)

3(1). Fore wing vein m-cu arising distad of vein 2RS heringeri (Guimaraes)

- Fore wing vein m-cu interstitial with or arising basad of vein 2RS 4

4(3). Fore wing vein m-cu interstitial with 2RS (Fig. 2); body length 3.50-3.75 mm; 29-30

antennomeres, flagellum light brown spermaphagns Marsh, new species

Fore wing vein m-cu arising basad of 2RS, thus a short section of (RS+M)b present (Fig.
1); body length 4.0-4.5 mm; 34-35 antennomeres, flagellum honey yellow on basal 1/2,
brown on apical 1/2 brasiliensis Marsh, new species

Allorhogas spermaphagns Marsh, new
species

(Figs. 2-6)

Female. — Body color: head, mesosoma
and metasoma honey yellow; legs yellow;
flagellum and pedicel light brown; wings
hyaline, fore wing vein C+Sc + R and stig-
ma yellow, rest of veins light brown, hind
wing veins yellow. Body length: 3.50-3.7
mm. Head: 29-30 antennomeres; face ru-
gulose-coriaceous medially, strongly ru-
gose along inner eye margins; frons exca-
vated, coriaceous; vertex (Fig. 3) coria-
ceous, weakly rugulose behind ocelli; tem-
ple coriaceous; malar space 1/3 eye
height; oral opening small, circular, di-
ameter equal to basal width of mandible;
ocell-ocular distance twice diameter of lat-
eral ocellus; occipital carina distinct, meet-
ing hypostomal carina. Mesosoma (Figs.
4-5): pronotum weakly rugulose-coria-
ceous laterally with deep median scrobic-
ulate groove bordered ventrally by carina;
mesonotum sharply declivous anteriorly,

mesonotum and scutellum coriaceous,
middle lobe with median scrobiculate
groove extending to anterior edge of me-
sonotum; notauli distinctly scrobiculate,
meeting in large rugose area before scu-
tellum; scutellar furrow with three cross
carinae; mesopleuron coriaceous, sternau-
lus deep and smooth or weakly scrobicu-
late; propodeum rugose, with two baso-
lateral semicircular rugulose-coriaceous
areas enclosed by carina, apical area above
metasoma insertion usually smooth, en-
closed by carina. Legs: fore tibia with scat-
tered row of 15-20 stout spines on anterior
edge; hind coxa with distinct baso-lateral
tubercle. Wings (Fig. 2): fore wing vein r
nearly as long as 3RSa, vein m-cu intersti-
tial with 2RS, first subdiscal cell open,
vein 2cu-a absent; hind wing vein M + CU
about equal in length to 1M, vein m-cu
curved slightly toward wing apex. Meta-
soma (Fig. 6): first tergum longitudinally
costate-rugulose, wider at apex than long,
medially with two strong longitudinal ca-
rinae setting off raised median area and

294

Journal of Hymenoptera Research

Figs. 1-2. Wings of Allorhogas species. 1, brasiliensis n. sp. 2, spermaphagus n. sp.

connected at base by distinct cross carina;
tergum 2 + 3 longitudinally costate on bas-
al 2/3, remainder coriaceous, groove be-
tween terga 2 and 3 weak or absent; ter-
gum 4 costate on basal 1/5, remainder co-
riaceous; remainder of terga coriaceous;
ovipositor about 2/3 length of metasoma.

Male. — Essentially as in female; femora
swollen, hind femur with length about
twice width.

Holotype Female. — BRASIL: Poco das
Antas Biological Reserve, Silva Jardim
County, Rio de Janeiro State, September
1995, M. V. Macedo, reared from seeds of
Stryphnodendron sp. Deposited in Depar-

tamento de Ecologia-IB-CCS, Universidad
Federal do Rio de Janeiro, Brasil.

Paratypes. — BRASIL: 7 females, 4 males,
same data as holotype. Deposited in:
Universidade Federal do Rio de Janiero,
Brasil; Universidade Federal de Sao Car-
los, Brasil; National Museum of Natural
History, Washington, DC.

Comments. — This species is very similar
to brasiliensis, but the most consistent dis-
tinguishing characters are: smaller size
(3.5-3.75 mm) than in brasiliensis (4.0-4.5);
antenna with 29-30 antennomeres (34-35
in brasiliensis); entirely brown flagellum
(yellow at base, brown at apex in brasilien-

Volume 9, Number 2, 2000

295

Figs. 3-6. Allorhogas spermaphagus n. sp. 3, vertex. 4, mesosoma, lateral view. 5, mesosoma, dorsal view. 6,
metasoma, dorsal view.

sis); fore wing vein m-cu interstitial with
vein 2RS (basad of 2RS in brasiliensis); fore
wing vein r about equal to vein 3RSa (3/
4 length of 3RSa in brasiliensis). In some
specimens of spermaphagus the face is often
more distinctly rugose near the eyes than
in spermaphagus; also the vertex of sper-
maphagus is often rugulose behind the
ocelli but usually only coriaceous in bras-
iliensis.

Biology. — This species was reared from
seeds of Stryphnodendron polyphyllum Mar-
tius (Leguminosae) which is native to the
Atlantic forest region of Brasil. The biolo-

gy is similar to that described for A. dys-
pistus by Macedo and Monteiro (1989) and
Macedo et al. (1998). Pods of Stryphnoden-
dron contain about 10 seeds arranged side
by side. The Allorhogas female oviposits
directly into immature seeds when abun-
dant endosperm and a small embryo are
still present. Oviposition is directly
through the pod wall and the egg is
placed inside the seed. After oviposition
by the braconid, the seed divides internal-
ly and externally (see Macedo et al.
(1998)), resulting in an intact region joined
to the funicle where the seed embryo is

296 Journal of Hymenoptera Research

usually found. In many cases this region groove bordered ventrally by carina; me-
of the seed continues growing even after sonotum sharply declivous anteriorly, me-
the adult Allorhogas has emerged. In most sonotum and scutellum coriaceous, mid-
of the attacked seeds that were observed die lobe with median scrobiculate groove
(n = 34) more than one Allorhogas was not extending to anterior edge of meson-
found in a single seed — 29% were ob- otum; notauli distinctly scrobiculate,
served to have two braconids per seed meeting in large rugose area before scu-
and 62% had three per seed. In these cas- tellum; scutellar furrow with three cross
es, more than one division of the seed oc- carinae; mesopleuron coriaceous, sternau-
curs but a single intact region is still found lus deep, scrobiculate; propodeum rugose,
with the seed embryo. with two baso-lateral semicircular rugu-

Two species of chalcid wasps were lose-coriaceous areas enclosed by carina,
reared from the same pods: Lycrus sp. apical area above metasoma insertion
(Pteromalidae) and Eurytoma sp. (Eury- strongly rugose. Legs: fore tibia with scat-
tomidae). Although we did not observe tered row of 15-20 stout spines on anterior
these wasps emerging directly from Allor- edge; hind coxa with distinct baso-lateral
hogas larvae, one was observed feeding on tubercle. Wings (Fig. 1): fore wing vein r
an Allorhogas larva. Because the chalcid about 3/4 length of 3RSa, vein m-cu meet-
pupae were dissected from seeds exhibit- ing RS+Ma slightly before 2RS, thus a
ing the same damage caused by the brae- short segment of (RS+M)b visible, first
onids, we are assuming the chalcids were subdiscal cell open, vein 2cu-a absent;
attacking the Allorhogas. hind wing vein M+CU about 3/4 length

Etymology. — The specific name is from of 1M, vein m-cu curved slightly toward
the Greek sperma meaning seed and the wing apex. Metasoma: first tergum Ion-
Greek phagein meaning to eat in reference gitudinally costate, wider at apex than
to the biology of this seed-eating braconid. long, medially with two strong longitudi-
nal carinae setting off raised median area

Allorhogas brasiliensis Marsh, new and connected at base by distinct cross ca_

species rina; tergum 2+3 longitudinally costate on

^ 1§' ' basal 2/3, remainder coriaceous, groove

Female. — Body color: head, mesosoma between terga 2 and 3 weak or absent; ter-

and metasoma dark honey yellow, pro- gum 4 costate on basal 1/5, remainder co-

podeum and mesonotum often light riaceous; remainder of terga coriaceous;

brown; legs yellow; flagellum honey yel- ovipositor slightly more than 1/2 length

low on basal 1/2, turning to brown on of metasoma.

apical 1/2; wings hyaline, fore wing vein Male. — Essentially as in female; femora

C+Sc + R yellow, stigma brown, rest of swollen, hind femur with length about

veins light brown, hind wing veins yel- twice width; propodeum and first meta-

low. Body length: 4.0-4.5 mm. Head: 34- somal tergum dark brown.

35 antennomeres; face rugulose-coria- Holotype Female. — BRASIL: Pocp das

ceous; frons excavated, coriaceous; vertex Antas Biological Reserve, Silva Jardim

and temple coriaceous; malar space 1/3 County, Rio de Janeiro State, October

eye height; oral opening small, circular, 1995, M. C. Pimentel, reared from seeds of

diameter equal to basal width of mandi- Pithecellobium sp. Deposited in Departa-

ble; ocell-ocular distance twice diameter of mento de Ecologia-IB-CCS, Universidad

lateral ocellus; occipital carina distinct, Federal do Rio de Janeiro, Brasil.

meeting hypostomal carina. Mesosoma: Paratypes. — BRASIL: 6 females, 6 males,

pronotum weakly rugulose-coriaceous lat- same data as holotype. Deposited in Univ-

erally with deep median scrobiculate ersidade Federal do Rio de Janiero, Brasil,

Volume 9, Number 2, 2000

297

Universidade Federal de Sao Carlos, Bras-
il, and National Museum of Natural His-
tory, Washington, DC.

Comments. — See comments under sper-
maphagus for distinguishing characters of
the two species.

Biology. — This species was reared from
seeds of Pithecellobium pedicellare (DC.)
Benth. Preliminary observations show that
the biology is similar to that of A. sper-
maphagus. The seed damage caused by
both A. spermaphagus and A. brasiliensis is
very similar to that observed for A. dys-
pistus.

Etymology. — The specific name is in ref-
erence to the locality of this species.

ACKNOWLEDGMENTS

We thank Eric Grissell, Systematic Entomology
Laboratory, USDA, Washington, DC, for identifica-
tion of the chalcids and the staff of the Poco das An-
tas Biological Reserve for providing field facilities.

LITERATURE CITED

Austin, A. D. and P. C. Dangerfield. 1998. Biology of
Mesostoa kerri Austin and Wharton (Insecta: Hy-
menoptera: Braconidae: Mesostoinae), an endem-
ic Australian wasp that causes stem galls on
Banksia marginata Cav. Australian journal of Botany
46:559-569."

Gahan, A. B. 1912. Descriptions of two new genera
and six new species of parasitic Hymenoptera.
Proceedings of the Entomological Society of Washing
ton 14:2-6.

Guimaraes, J. A. 1957. Cintribuicao ao estudo de Ce-
cidilogia Brasiliana. Thesis, Escuela National
Agronotma, Universidad Federal Rura do, Rio de Ja-
neiro, p. 25.

Infante, F., P. Hanson and R. Wharton. 1995. Phyto-
phagy in the genus Monitoriella (Hymenoptera:
Braconidae) with description of a new species.
Annals of the Entomological Society of America 88:
406-415.

Macedo, M. V. de and R. T. Monteiro. 1989. Seed pre-
option by a braconid wasp, Allorhogas sp. (Hy-
menoptera). journal of the New York Entomological
Society 97:359-362.

Macedo, M. V. de, M C. P. Pimentel and R. C. Vieira.
1998. Response of Pithecellobium tortum Martius
(Leguminosae) seeds to the attack of the phy-
tophagous braconid Allorhogas dyspistus Marsh
(Hymenoptera: Braconidae). journal of Hymenop-
tera Research 7(2):274-279.

Marsh, P. M. 1991. Description of a phytophagous
doryctine braconid from Brasil (Hymenoptera:
Braconidae). Proceedings of the Entomological So-
ciety of Washington 93:92-95.

Marsh, P. M. 1997. Subfamily Doryctinae, pp. 207-
233. In: Wharton, R. A., P. M. Marsh and M. J.
Sharkey, eds., Manual of the New World genera
of the family Braconidae (Hymenoptera). Special
Publication of the International Society of Hymen
opterists. No. 1, 439 pp.

Ramirez, W. B. and P. M. Marsh. 1996. A review of
the genus Psenobolus (Hymenoptera: Braconidae)
from Costa Rica, an inquiline fig wasp with bra-
chypterous males, with description of two new
species, journal of Hymenoptera Research 5:64-72.

Wharton, R. W., P. M. Marsh and M. J. Sharkey, eds.
1997. Manual of the New World genera of the
family Braconidae (Hymenoptera). Special Publi-
cation of the International Society of Hymenopterists.
No. 1, 439 pp.

J. HYM. RES.
Vol. 9(2), 2000, pp. 298-304

Description of a New Species of Emersonella
(Hymenoptera: Eulophidae) from Brazil, with Preliminary

Observations on its Biology

Celso O. Azevedo, Juvenal C. Silva-Jr, and Lucio A. de O. Campos

(COA) Universidade Federal do Espfrito Santo, Departamento de Biologia, Av. Marechal

Campos 1468, Maruipe, 29040-090 Vitoria, ES, Brazil; (JCSJ) Universidade Estadual do Sudoeste

da Bahia, Departamento de Ciencias Biologicas, Rua Jose Moreira Sobrinho s/n, 45200-000

Jequie, BA, Brazil; (LAOC) Universidade Federal de Vicosa, Departamento de Biologia Geral,

36571-000 Vicosa, MG, Brazil

Abstract. — Emersonella trimacnlata Azevedo and Silva, new species, an egg parasitoid of
chrysomelids, from northeastern Brazil is described and illustrated. Host age influences percent
parasitism, which decreases as age increases, but it does not influence the sex ratio. The egg phase
has an average duration of 1.05 ± 0.04 days, larval phase of 5.04 ± 0.19 days, pupal phase of 6.74
± 1.16 days. The total time of development is 13.29 ± 0.53 days for males and 13.96 ± 0.48 days
for females.

Emersonella Girault is a small genus of For the biological studies, mated and

Entedoninae (Hymenoptera, Eulophidae) nulliparous females were maintained sep-

restricted to the New World (Boucek arately in flasks of 50ml containing a drop

1977). All species with known biology are of a 1:1 solution of honey and water stuck

idiobiont endoparasitoids of eggs of Chry- to the wall of the glass as food, covered

somelidae (Cox 1994), mainly Cassidinae. with cotton and kept at 28 ± 1°C The par-

De Santis (1983) revised the genus and de- asitoid and its host Zatrephina meticulosa

scribed four species from Brazil, Argenti- (Spaeth) (Coleoptera, Chrysomelidae) was

na and Uruguay. In this paper, a new spe- obtained from field collections from Sao

cies of Emersonella from the State of Mar- LuiZ/ state of Maranhao, northeastern Bra-

anhao in northeastern Brazil, is described zil This beetle occurs natUrally on the

and illustrated. Some preliminary biolog- leaves of Ipomoea pes-caprae L. (Convolvu-

ical studies are also included. Influence of laceae) in coast sand plain

the host age on the capacity of parasitism TwQ experiments were carried out. Ex_

and sex ratio of the parasitoid is verified, iment x was to verif the influence of

the egg morphology is characterized, and ,u u . .u . •.■ ,

, , bt> r * i i i me nost aSe on me percent parasitism and

the longevity of the egg, larval and pupal .. c . , ., T ,u.

i ° j . , r r sex ratio of the parasitoid. In this experi-

phases are determined. , nn r„ ... , ,.c

r ment, 80 egg masses of Z. meticulosa of dir-

MATERIAL AND METHODS ferent ages, varying from 1 to 8 days, were

Morphological terminology for the de- offered to females, separately in a flask.

scription generally follows Gibson (1997) The females were kept with the host egg

and sculpture follows Harris (1979). The masses for 10 days before being removed

material examined was provided by the from the flasks. Experiment 2 was to ver-

Entomological Collection of Universidade ify the duration of the egg, larval and pu-

Federal do Espirito Santo (UFES) and pal phases, and morphological character-

Universidade Federal de Vicosa (UFVB). istics of the egg. Host egg masses at 48

Volume 9, Number 2, 2000

299

Figures 1-6. Emersonella trimaculata, female, dorsal view. 1, head; 2, antenna; 3, thorax; 4, propodeal disc, 5,
metasoma; 6, ovipositor sheathes.

hours old were offered to groups of 30 to
40 nulliparous, recently mated females for
3 hours. To verify the phase of parasitoid
development, samples of 15 host eggs
were dissected in physiologic solution, at
intervals of 24 hours. To verify the para-
sitoid egg phase, 10 host eggs were ob-
served at one hour intervals. Observations
were made from the 15"1 until the 29"1 hour

to determine the type, morphology and
size of the egg.

Emersonella trimaculata Azevedo and
Silva, new species

(Figs. 1-12)

Female.— Length 0.85-1. 01mm. Head
and body black, except: head, scutellum
and propodeum with yellowish green me-

300

Journal of Hymenoptera Research

■V / 1 ?" AM 3 - ■■

^^1 aA -^H

ggv\\v1B

^V|

■M ■ri^^^^IZ?/ ^^

Figures 7-12. Emersonella trimaculata, male, 7, head, dorsal view; 8, mandibles, lateral view; 9, antenna, lateral
view; 10, antenna sensillae, lateral view; mesosoma, dorsal view; 12, metasoma, dorsal view.

tallic reflections; pronotum and scutum
with blue metallic reflections; mandible
testaceous-brown; scape yellowish white,
pedicel brown, flagellomeres black; legs
slightly yellowish, distal tarsomeres and
anterior face of fore femur darker, coxae
black with weak blue metallic reflection;
bristles on body pale yellow; wings hya-
line and veins light brown. Head (Fig. 1):

1.22-1.42 X as wide as long, 1.06-1.18 X
wider than thorax in dorsal view. Frons
and gena smooth, face nearly so, vertex
imbricate. Distance between lateral ocellus
2.25-3.0 X as long as distance from lateral
ocelli to eye. Transverse fronto-facial su-
ture complete and conspicuous. Scrobal
depression as long as scape. Malar space
about 0.43-0.53 X the height of eye. To-

Volume 9, Number 2, 2000

301

-J

.Js

'ffi

pa,

o
a

r.
'J
r.

01/

Oil

1.2

l.o •

0,8

0.6

0.4

0.2

0.0

-0.2

1 2 3 4 5 6 7 X

Eggs masses age (Days)

Figure 13. Percentage of egg mass posture not parasited by Emersonella trimaculata, in different ages of the
host eggs. The bars represent the standard deviation.

rulus slightly closer to eye margin than
clypeus. Vertex with ocular-ocellar suture.
Eye with short hairs. Mandible bidentate,
the lower larger, and the upper with up-
per margin serrated (Fig. 8). Antenna (Fig.
2): scape 3.75^4.3 X longer than wide; ped-
icel almost twice as long as wide; three
anelli, the first slightly larger, the others
subequal, funicular segments subquadra-
te, slightly longer than wide, club uniseg-
mented, apex extended into terminal
spine, 2-3 X longer than wide and 1.33-
1.5 X longer than funicular segments. Sen-
sillae capitate and elongate with apex
slightly directed upward (Fig. 10). Meso-
soma (Figs. 3-4): subquadrate in dorsal
view, 1.16-1.25 X longer than wide,
arched in lateral view. Pronotum not vis-
ible in full dorsal view, with a row of six
setae along the posterior margin. Meso-
scutum foveolate, with two rows of two
adnotaular setae on each side, notaulus
very weak, missing medially. Scutellum
imbricate, enlarged, 0.75-0.89 X longer
than mesosoma, 0.55-058 X as wide as me-
sosoma, about as long as wide, lateral
sides distinctly convex. Dorsellum smooth.

Propodeum smooth, with a pair of sub-
triangular depressions touching the ante-
rior margin, with weak longitudinal striae
medially, separated from each other by
1.2-1.5 X their width, without median ca-
rina and plica, with a sublateral carinae
strongly arched, spiracle rounded, sepa-
rated from the anterior margin of propo-
deum by about 1.0 X their diameter. Cal-
lus with two setae. Mesopleuron with a
small anterior central pit. Forewing with
marginal vein 2.3-2.4 X longer than sub-
marginal vein. Postmarginal vein about as
long as stigmal vein. Metasoma (Fig. 5):
stout, subsessile, with few setae, 1.03 X as
long as mesosoma; first gastral tergite
large, about 0.5 X length of gaster, lateral
margin evenly convex in dorsal view. Ovi-
positor sheath short (Fig. 6), anterior half
concealed, ovipositor stylus 0.87 X as long
as gaster.

Male. — Length 0.9-1.06 mm. Same color
as female, except by: fore femur, fore tar-
sus and the other distal tarsomeres darker;
gaster with three yellowish white spots, a
pair of spots at anterior corner of first gas-
tral segment, straight anteriorly and

302 Journal of Hymenoptera Research

rounded behind, separated from each oth- front of the large one, and the femora and
er by 2.2-2.5 X their diameter, the third tibiae are yellowish white rather than
spot very large, occupying nearly the en- black as in the two former species. This
tire width of the posterior half of the first species is also similar to £. rotunda (Ash-
gastral tergite. Head (Fig. 7): Distance be- mead), but in the last species the mid and
tween lateral ocelli about 4-6 X as long as hindcoxae are white and funicular seg-
distance from lateral ocellus to eye. Anten- ments are slightly longer. Emersonella tri-
na (Fig. 9): funicular segments slender, in maculata displays the same pattern of sex-
ratio of about 2:2:2.6:2.3 X as long as wide; ual dimorphism as other species in the ge-
club 3-4 X as long as wide. Mesosoma nus. The male has funicular segments lon-
(Fig. 11): 1.29-1.66 X longer than wide, ger than those of the female and the gaster
scutellum 0.6-0.66 X wider than mesoso- has three light spots on the first gastral
ma. Forewing with marginal vein 2.1-2.4 tergite, while in the female the gaster is
X longer than submarginal vein. Metaso- evenly black.

ma (Fig. 12): petiolate, petiole larger be- Biology. — A total of 80 egg masses were

hind, first gastral tergite 1.4-2 X longer analyzed, with 57 parasitized (71.3%) and

than the rest of gaster, with anterior mar- 23 (28.7%) not parasitized. The results in-

gin straight medially and angulate at cor- dicate that host age influences parasitism

ner laterally. Genitalia: paramere devel- by E. trimaculata. Parasitism decreased

oped inward ventrally, with an apical se- when older egg masses were offered to the

tae directed outward; digitus wide, with females (logistic regression x2 = 12.7; g.l.

two conspicuous spines directed outward = 1 and p <0.01; Fig. 13). The variation

apically, and with a small outer tooth; ae- observed in parasitism was from only 11%

deagus with two lobes rounded apically; not parasitized in the one-day-old egg

phallobase little developed in ventral side; masses up to 100% not parasitized in the

aedeagus apodeme extending beyond the eight-day-old egg masses,

basal margin of phallobase only slightly. According to the logistic regression, the

Material examined. — 9 holotype, 11 9 9 expected value for eight-day-old egg mas-

and 15 6 6 para types BRAZIL, Maranhao, ses was approximately 65% not parasit-

Sao Luiz, coast sand plain vegetation, ized, although the value was 100%. Only

26. i. 1998, J. C. Silva Jr. col. (UFES); 298 9 9 three egg masses were observed in the

and 298 6 6 BRAZIL, reared in laboratory samples on the 8th day, while for the other

(AMNH, BMNH, CASC, CNCI, CUIC, days the number of egg masses was never

DCBU, DZUP, EMUS, FSCA, IGBE, INPA, smaller than nine. This difference might

LACM, MCZH, MEPG, MZSP, OSUC, explain the deviation in relation to the

PMAE, UCDC, UCRC, UFES, UFVB, model.

USNM). This same pattern was observed when

Remarks. — This species runs to Emerso- the number of individual eggs parasitized
nella niveipes Girault in the key presented was verified in each egg mass. Parasitism
by De Santis (1983), but here the mandible varied on the average from 81%, for one-
is bidentate and the male has three white day-old egg masses, up to 12%, for eight-
spots in the gaster, while E. niveipes has day-old egg masses. Thus, as age of host
the mandible with six teeth and the male increases, a reduction in parasitism occurs
has two transverse stripes just beyond the in both the number of egg masses and the
middle of the gaster. E. ooecia De Santis number of eggs parasitized with each
and E. lecitophaga De Santis are two spe- mass.

cies with a sub-basal white spot in the gas- Host age does not influence sex ratio,

ter of males as in E. trimaculata, but here The difference in sex ratio produced by fe-

there are two additional small spots in males of £. trimaculata in egg masses of

Volume 9, Number 2, 2000

303

0,96

0.92
0.88
0.84

o 0.80
C 0.76

0.72 •

0.68 ■

0.64

I I

12 3 4 5 6 7

Eggs age (Days)

Figure 14. Relationship between the age of the egg and the sex ratio of Emersonella trimaculata. The bars
represent the standard deviation.

different ages is not significant (x2 = 0.2;
g.l. = 1 and p = 0.7; Fig. 14).

£. trimaculata eggs are 25.6 ±1.4 \xm in
length with a maximum width of 6.8 ±1.0
(xm (Fig. 15). The eggs are simple, hymen-
opteriform, oblong or ovoid, slightly
arched and with both poles smoothly
round, with chorion delicate and without
ornamentation as usually found in Hy-
menoptera (Clausen 1940). The egg phase
had an average duration of 1.04 ± 0.04
days. The micropyle of the eggs was not
observed, probably due to the transpar-
ency of the eggs (Fig. 15). However, there

is a differentiated area in the anterior area,
which might indicate the presence of the
micropyle, which is usually located in the
anterior region of the egg. In some species,
however, it has been observed in the pos-
terior area (Quicke 1997).

The larval phase has a duration of 5.0 ±
0.2 days, while the pupal phase lasts 6.7
±1.2 days. The pigmentation process be-
gins in the first day of the pupal phase.
Males of this species emerge before the fe-
males (x: = 99.13; p <0.01), with almost
all males emerging by the end of the sixth
day of the pupal stage (91.56%), but only

Figure 15. Eggs of Emersonella trimaculata; a, 2 hours of development; b, 20 hours of development. (Scale Kir
= 5 |j.m).

304

Journal of Hymenoptera Research

65.47% of the females. The total time of
development was 13.3 ± 0.5 for males and
14.0 ± 0.5 for females.

In E. trimaculata, a small variation is
seen in the duration of the egg and larval
phases and a larger variation in the pupal
phase. This can indicate the existence of
mechanisms that synchronize the phases
in this species. The results seem to indicate
an abbreviation of the pupal phase of the
males without loss of absorption of nutri-
ents, since size differences do not exist be-
tween males and females.

ACKNOWLEDGMENT

We thank J. LaSalle (IEE CABI Bioscience) who
compared this new species to E. niveipes and carefully
revised the manuscript.

LITERATURE CITED

Boucek, Z. 1977. Descriptions of two new species of
Neotropical Eulophidae (Hymenoptera) of eco-

nomic interest, with taxonomic notes on related
species and genera. Bulletin of Entomological Re-
search 67:1-15.

Clausen, C. P. 1940. Entomophagous Insects. New York,
McGraw-Hill.

Cox, M. L. 1994. The Hymenoptera and Diptera par-
asitoids of Chrysomelidae, p. 419-467. In: Jolivet,
P.H., M. L. Cox and E. Petitpierre (eds.). Novel
aspects of the biology of Chrysomelidae. Nether-
lands, Kluwer Academic Publishers.

De Santis, L. 1983. Las especies argentinas, uruguayas
y brasilenas del genero Emersonella Girault, 1916
(Insecta, Hymenoptera, Eulophidae). Anais da So-
ciedade Entomologica do Brasill2(2):249-259 .

Gibson, G. A. P. 1997. Morphology and Terminology,
p. 16^4. In: Gibson, G. A. P., J. T. Huber & J. B.
Wooley. Annotated keys to the genera of Nearctic
Chalcidoidea (Hymenoptera). Ottawa, NRC Re-
search Press.

Harris, R. A. 1979. A glossary of surface sculpturing.
Occasional Papers in Entomologi/, California Depart-
ment of Agriculture 28:1-31.

Quicke, D. L. J. 1997. Parasitic zvasps. London, Chap-
man & Hall.

J. HYM. RES.
Vol. 9(2), 2000, pp. 305-312

Trisecodes gen. n., (Hymenoptera: Eulophidae: Entedoninae), the First

Eulophid with Three Tarsal Segments

Gerard Delvare and John LaSalle

(GD) CIRAD, TA 40/02, Avenue d'Agropolis, 34398 Montpellier Cedex 5, France, e-mail:

gerard.delvare@cirad.fr ; (JL) Unit of Parasitoids Systematics, CABI Biosciences UK Centre

(Ascot), Department of Biology, Imperial College at Silwood Park, Ascot, Berks, SL5 7PY, UK,

e-mail: j.lasalle@ic.ac.uk

Abstract. — The neotropical genus Trisecodes, and its type species T. agromyzae, are described
in the eulophid subfamily Entedoninae. Its placement within the Chalcidoidea and the Eulophidae
is discussed. Its hosts, all belonging to Agromyzidae (Diptera) are listed. This is the first Eulo-
phidae, as well as the first member of the Chalcidoidea outside of the Trichogrammatidae, where
both sexes have three tarsal segments.

Resume. Les auteurs decrivent le nouveau genre neotropical Trisecodes, ainsi que son espece
type, T. agromyzae, dans la sous-famille des Entedoninae (Eulophidae). lis discutent ensuite de
sa position systematique a l'interieur des Chalcidoidea puis des Eulophidae. lis citent les hotes
de cette espece, qui appartiennent tous a la famille des Agromyzidae (Diptera). II s'agit du premier
Eulophidae, mais aussi du premier chalcidien n'appartenant pas aux Trichogrammatidae, dont
les deux sexes presentent des tarses trimeres.

Understanding the evolution of the su-
perfamily Chalcidoidea, and deriving ro-
bust phylogenetic hypotheses, is a major
challenge. The difficulty comes from the
biodiversity of the group, one of the most
speciose superfamilies of the Hymenop-
tera (Noyes 1998), and the plasticity of
both morphological and biological fea-
tures exhibited by these wasps (Gibson
1990; Gibson et al. 1999). The genus de-
scribed below is an example of such plas-
ticity. Up to now, the only Hymenoptera
known to have 3-segmented tarsi were
members of the family Trichogrammati-
dae, and some highly derived and dimor-
phic male fig wasps (Agaonidae). The
presence of three tarsal segments in both
sexes has been considered a synapomor-
phy for the Trichogrammatidae, many of
whose members also have lines of setae on
the forewing. The wasp described in this
paper, Trisecodes agromyzae, shares these
features with the Trichogrammatidae but
does not belong to this family.

Specimens of the newly described spe-
cies have been deposited in the following
institutions: Natural History Museum,
London, UK (BMNH), Centre de Cooper-
ation Internationale en Recherche Agron-
omique pour le Developpement, Montpel-
lier, France (CIRAD), United States Na-
tional Museum, Washington D. C, USA
(USNM), Canadian National Collection of
Insects and other Arthropods, Ottawa,
Canada (CNC).

Trisecodes Delvare and LaSalle, new
genus

(Figs. 1-12)

Name derivation. — A combination of tri-
suggesting the tarsal formula and -secodes
from Asecodes, a genus of Entedoninae.
Some members of Asecodes have lines of
setae on the forewing which are similar to
those seen in Trisecodes. Gender neuter.

Type species. — Trisecodes agromyzae Del-
vare and LaSalle, new species.
Head (Fig. 1): Frons with distinct scrobal

306

Journal of Hymenoptera Research

Figs. 1-6. Trisecodes agromyzae, new genus, new species. 1, head in frontal view; 2, head and basal pari of
mesosoma in dorsal view; 3, mesonotum; 4, apical part of mesosoma; 5, propodeum in posterior view; 6,
mesosoma in lateral view.

Volume 9, Number 2, 2000

307

Figs. 7-12. Trisecodes agromyzae. 7, fore tibia and tarsus; 8, female metasoma in dorsal view; 9, forewing; 10,
detail of the base of the forewing; 11, female antenna; 12, male flagellum.

sutures which extend dorsally to the fron-
tal sutures and define a median strip, the
strip slightly raised over the surface of the
frons and slightly overlapping it laterally-
Frontal sutures V-shaped, clearly separat-
ed from the median ocellus. Malar sulcus
groove like. Clypeus not delimited from
lower face. Mandibles bidendate, the teeth
acute, of same length. Maxillary palpi bis-
egmented, labial palpi unisegmented. La-
brum strongly bilobed ventrally. Antenna
(Figs. 11-12): Flagellum with one anellus,

a 3-segmented funicle and a 3-segmented
clava. Funicular segments transverse,
bearing multiporous plate sensilla of two
types: usual ones, as found in other Chal-
cidoidea (elongate sensilla longitudinally
oriented with raised and sharp apex) and
half-ring ones, embracing each of the seg-
ments as well as the apex of the clava; lat-
ter sensilla are in oblique or even tran-
verse orientation (except on third clava]
segment). Multiporous plate sensilla of the
usual type are replaced in males by

308 Journal of Hymenoftera Research

whorls of long setae. Mesosoma (Figs. 2- with slight bluish reflections. Tarsi whit-
6): Pronotum and mesonotum with dis- ish. Wings hyaline. Veins dark brown,
tinct raised reticulation, same short and Head (Fig. 1): Relative measurements
very sparse setae, the former narrowly vis- (made from a slide mounted specimen):
ible dorsally, with its posterior margin Height 70, width 87, fronto-vertex in front
deeply emarginate. Mesoscutum and scu- of the median ocellus 48, POL 23, OOL 9,
tellum with distinct median furrow. No- lateral ocelli diameter 7, eyes height 43,
tauli complete, straight, of same appear- width of eye (frontal view) 16, malar space
ance throughout. Axillae distinctly pro- 20, oral fossa 21, antennal toruli-eye dis-
truding anteriorly. Scutellum without sub- tance 14, distance between toruli 10, toruli
lateral furrows or lines, distinctly convex diameter 7, toruli-lower margin of clypeus
both dorsally and laterally. Propodeum length 10. Inner margin of eyes parallel,
mostly reticulate, with spiracular groove Malar groove nearly straight as well as ge-
hardly impressed, without subspiracular nae. Labrum with a row of 4 hairs (one
tubercle, supracoxal flange and nucha, specimen examined). Lower edge of an-
Spiracle formed through incision of the tennal toruli at lower eye margin. One
anterior margin of the propodeum, not r0w of 7-8 hairs along inner margin of eye
completely closed. Phragma not reaching plus one pore. Lower face very faintly
the posterior margin of the mesosoma. squamose, frons reticulate. Upper frons,
Prepectus large, reticulate, triangular in above frontal sutures, coriaceous ( = en-
lateral view. Mesopleuron convex anteri- graved reticulate), more or less imbricate,
orly, femoral scrobe reticulate, upper me- vertex with elongate cells which are trans-
sepimeron very large, separated from low- versely oriented on its anterior part then
er mesepimeron by a row of punctures, oblique. Antenna (Fig. 11): Scape nearly 5
the latter very small. Metapleuron small times as iong as wide (28:6). Pedicel slight-
but visible, triangular, delimited from the jy longer than wide (in lateral view 9:7).
propodeum by a broad, shallow groove. pirst funicular segment very transverse (7:
Legs (Fig. 7): All tarsi 3-segmented, seg- n^ following segments progressively less
ments about of same length. Apical spur so First claval segment slightly transverse
of foretibia slightly curved, bifid, the furca (10:12), second one subquadrate, last one
at mid length of the spur, the inner branch eiongate (9:5). Each of the flagellar seg-
hardly visible and much shorter than the ments bearing 3 ring-like sensilla, in near-
outer one. Wings (Figs 9-10). Submarginal ly transverse orientation on Fl, more
vein with one dorsal seta. No break be- oblique in the following segments. Two
tween submarginal vein and parastigma, dongate sensma at apex of M3 are pincer.
but a hyaline break between parastigma Hke Mesosoma (Figs. 2-6): Relative mea-
and marginal vein. Forewing with stigmal surements: Lengm 95/ width 66/ iength of
and postmarginal veins very short. Disc of mesoscutum 37/ of scutellum 45, width of
wing sparsely setose. Hairlines (Rsl and r- ^^ 4Q Pronotum beari 3^ irs of
m) originating from stigmal vein present. ^ Qn terior in Mid iobe of me_

Cubital vein setose and distinct. Metaso- r , _ „° . , , „«*,.,.

_. ^x ^ . , soscutum bearing 7-8 pairs of short setae

ma (Fie. 8): Caster on a transverse petiole, , ,, ,, ,. °, . .„„

. , „& . T . f .. .. laterallv. Median furrow on posterior two

with 7 tergites. Last tergite not subdivid- Li . , ,1 , c . n -.u

, „ ,^ . f? Ll , thirds, smooth on bottom. Scutellum with

ed. Cereal hairs on small tubercles. , . ., , c r.£.u

furrow visible on anterior tour fifths.

Trisecodes agromyzae Delvare and Three pairs of short hairs respectively

LaSalle, new species slightly before and behind mid length of

(Figs. 1-12) scutellum, last pair, longer, near apex.

Female. — Length 0.70-0.85 mm. Color: Dorsellum as a raised reticulate plate. Lat-

Body, legs except tarsi and antennae dark eral part of metanotum also reticulate but

Volume 9, Number 2, 2000 309

sculpturing finer than on dorsellum. Pro- Material examined. — Holotype 9 : BE-
podeal callus with one short seta. Lower LIZE: Cayo Province, Las Cuevas, 550 m,
mesepimeron ventrally punctate. Meta- Chiquibul Forest (Lewis O. T.), ex Haplo-
pleuron smooth. Fore basitarsus with a myza sp. on Senna cobanensis, 27 VIII 1998
row of 5 bristly hairs ventrally. Relative (NQ 5649) (Lewis O. T.)(in BMNH). Para-
measurements on mid leg. Tibia 51, tarsus types (in BMNH, CIRAD, USNM, CNC).
40, basitarsus 15 (on dorsal outline), apical Same locality and collector, ex Calycomy-
spur of tibia 14; latter simple and straight, zal cassiae on Senna cobanensis, 21 IX 1997
Measurements of hind leg. Tibia 53, basi- (1 6,4 9 9) (NQ 16.040, 16.042, 16.043 &
tarsus 14, apical spur of tibia 7. Forewing 16.046), 26 IX 1997 (1 9 ) (NQ 389), 5 XI
(Figs 9-10): Relative measurements: 1997 (1 6) (NQ 1543), 26 VIII 1998 (1 6, 1
Length 164, width 82, costal cell 45, mar- 9) (NQ 5573), 29 VIII 1998 (1 9) (NQ 5716)
ginal vein 40, stigmal 5, postmarginal 3, and 31 VIII 1998 (1 9 ) (NQ 5914), 4 IX 1998
fringe 9. Wing very distinctly widened at (19) (N9 6023); 1 6, same locality and
apex and regularly rounded. Costal cell collector, 5 II 1998 (N° 1719); same locality
with 3-4 dorsal hairs at apex, ventrally and collector, on Stizophyllum riparium, 6
bare. Parastigma bearing 2 dorsal hairs, VI 1998 (1 6 ) (NQ 3300), 30 VII 1998 (1 6 )
marginal vein with 9-10 dorsal hairs of (Ne 4895); 1 8, same locality and collector,
about twice the width of the vein. A line ex Nesomyza sp. on Amphilophium panicu-
of 7-8 setae present near anterior wing latum (N- 4805); 1 8, same locality and
margin, originating near stigmal vein and collector, ex Calycomyza sp. on Triwnfetta
extending apically. Basal vein with 2-3 bogotensis, 6 VII 1998 (N° 4305); 1 8 , same
hairs; another one closely beside it. Anal locality and collector, on Sida rhombilolia,
vein (subcubital) represented by a row of 11 VIII 1998 (N° 5342); same locality and
5-6 sparse hairs in front of the retinacu- collector, ex Calycomyza sidae on Sida acuta,
lum and more basally by 2-3 isolated 10 X 1997 (1 6,1 9) (NQ 905 & 598), 5 II
hairs behind the basal vein. Basal cell bare. 1998 (1 6,4 9 ) (NQ 1700, 1701, 1702, 1703
Hind wing: Relative measurements: & 1704); 5 IX 1998 (1 9) (N2 6125). COSTA
Length 112, width 33. Wing bearing 3 RICA: Guanacaste, Santa Rosa N. P., 300
hamuli, narrowly rounded at apex. Me- m, 25 IV / 16 V 1987 (Janzen D. H. &
tasoma (Fig. 8): petiole with transverse Gauld I. D.) H-l-O (H)& H-2-C (1 6).
lamina on anterior margin. Gaster about GUADELOUPE:, Bouillante, Pigeon, 7 XI
1.35 times as long as wide (95:69) on slide- 1995, reared from a leaf of Daphnopsis
mounted specimens. Gastral tergite 1 de- americana mined by Liriomyza sclnnidti,
pressed behind petiole. Tergite 2 with a (Etienne J.)(l 9) (Ne 13783/GP 1195).
row of 5 hairs laterally (Fig. 8). Each of the Distribution. — Belize, Costa Rica and
following tergites with one dorsal line of Guadeloupe (Neotropical Region),
hairs. Ovipositor valvula 70, gonostyli 12. Hosts. — Agromyzidae (Diptera) mining
Anterior end of the ovipositor near the plants belonging to various families (Big-
base of the gaster. Cereal hairs short, on noniaceae: Stizophyllum riparium and Am-
small tubercles. philophium paniculatum; Leguminosae: Sida
Male (Fig. 12). — Length 0.60-0.80 mm. rhombilolia; Malvaceae: Sida acuta and S.
All characters identical but antennal fla- rhombifolia; Thymeleaceae: Daphnopsis
gellum devoid of elongate sensilla, latter americana; Tiliaceae: Triwnfetta bogotensis)
replaced by whorls of long hairs. Only 1, and belonging to several different genera:
rarely 2, ring-like sensilla on each of the Liriomyza, Calycomyza and Nesomyza.
flagellar segments. Gaster length 80, width According to O. T. Lewis (pers. comm.),
45. One long cereal hair. Two long hairs T. agromyzae is a larval parasitoid.
on apex of epipygium. Systettiatic placement. — The combination

310 Journal of Hymenoftera Research

of characters exhibited by T. agromyzae (1997) showed that the tibial spur is more
does not match any of the currently rec- variable than formerly thought. However
ognized families of chalcids. Trichogram- recent molecular studies (Gauthier e t al.
matidae is the only family of Hymenop- 2000) demonstrate that Eulophidae when
tera having 3-segmented tarsi in both sex- including Elasmus does actually represent
es, and it has long been considered to be a monophyletic group,
one of the most easily recognizable and Many of the derived states found in In-
definable families of Chalcidoidea because secodes are found in some eulophids (see
of this character (Gibson et al. 1999). Ad- Table 1). For example the shape and place-
ditionally, many trichogrammatids have ment of the frontal sutures, the reduced
lines of setae on the forewing. On the sur- number of tarsal segments, the reduced
face, it would thus appear that Trisecodes number of setae on the submarginal vein,
should be placed in this family. However, the short stigmal vein, the very short post-
the number of tarsal segments is a reduc- marginal vein, and the presence of line of
tion character, and a loss of a tarsal seg- hairs on the forewing. The fore tibial spur
ment (5 to 4) is seen many times in the of Trisecodes is also similar to what was
Chalcidoidea in the families Eulophidae, recently illustrated for the Eulophidae
Encyrtidae, Aphelinidae, Mymaridae, Te- (LaSalle et al. 1997). Eulophidae include fi-
tracampidae, and even Pteromalidae nally many larval or /and pupal parasit-
(LaSalle et al. 1997). It is not inconceivable oids of agromyzid flies,
that the loss of an additional tarsal seg- If we consider the following suite of
ment has occured in one of these other lin- characters 1 ) reduced number in antennal
eages. The presence of lines of setae on the segments; 2) special structure of the fore
forewing radiating from the stigma is also tibial spur; and 3) petiolate gaster with
known in several chalcid families: Tricho- phragma restricted to mesosoma, not en-
grammatidae, Eulophidae (Euderinae, En- tering metasoma, then the unique possi-
tedoninae), Torymidae and Pteromalidae bility of familial placement for Trisecodes
(Colotrechninae, Ormocerinae: Systasini), within a currently recognized family of
and does not restrict a genus to any one Chalcidoidea is Eulophidae.
family. Moreover, in trichogrammatids, Table 1 lists the characters shared by
the funicle is at most 2-segmented, the Trisecodes with species of Eulophidae ac-
gaster is broadly attached to the mesoso- cording to their subfamilial placement,
ma and the phragma goes into the meta- Some are left unpolarized, others are de-
soma, most often deeply so; the frontal su- rived. The table shows that Trisecodes
tures are also different from Trisecodes, the shares the largest number of derived sim-
mesosoma never has raised reticulation, ilarites with the Entedoninae.
and the fore tibial spur is simple instead It must however be mentioned that the
of bifid. Finally all the trichogrammatids placement of Trisecodes within this sub-
whose biology is known are egg parasit- family poses problems as it differs from
oids of various insects. most other entedonines in several impor-
Despite only having three tarsal seg- tant characters. Entedoninae is one of the
ments, we are therefore placing Trisecodes best defined subfamilies of the Eulophidae
in the Eulophidae. Unfortunately, there is (Boucek 1988; Schauff 1991). Support for
little convincing morphological evidence its monoplyly includes: scutellum with a
for the monophyly of this family. The single pair of setae; submarginal vein with
combination of 4 tarsal segments and a two dorsal setae; mesoscutal midlobe with
short, simple fore tibial spur have been two pairs of setae; face with frontal su-
considered to be the best characters sup- tures distinctly separated from the anteri-
porting their monophyly, but LaSalle et al. or ocellus; male scape with sensory pores

Volume 9, Number 2, 2000

311

Table 1. Morphological characters of Trisecodes and their distribution in the subfamilies of Eulophidae.

Subfamily

Eulophinae

Euderinae

Tetrastichinae

Entedoninae

many species

Character
Unporalized characters

notauii:

complete and deep

scutellum
general habitus

mesonotum:
raised reticulation

mesopleuron

Derived states
antennal segments: all species

reduced number

mandibular formula

frontal sutures

anelli:

reduced number

mesoscutum:
median groove

scutellum:
median groove

hairs on propodeal callus:
reduced number

hairs on submarginal vein:
reduced number

fore tibial spur bifid
(LaSalle et al. 1997)

short stigmal vein

short postmarginal vein

lines of hairs figuring
Rsl, & r-m

all species
all species
most species

all species

some species
(at least)

most species

all species

few species

very few species most species

some species: (see
Schauff 1991 fig.
81 p. 101)

all species

hosts: Agromyzidae several species a few species

many species
some species

some species
(at least)

most species

a few species

all species

some species
most species
many species

some species

many species

all species

some species
(at least)

all species

most species

some species

several species

restricted to the ventral edge; propodeum
with a subspiracular tubercle; marginal
vein relatively long; stigmal vein relative-
ly short (Boucek 1988; Schauff 1991).

Unfortunately, many of these characters
are absent in Trisecodes. There are 3 pairs
of very small setae on the scutellum, onlv
a single seta on the dorsal surface of the
submarginal vein, and no subspiracular
spiracle. Also the notauii are complete, an-

other character which is unusual but not
unknown in the Entedoninae. However,
exceptions are known to all of the char-
acters listed above (see Ubaidillah et al.
2000 for some examples), and Trisecodes
does possess one very strong character to
support it as an entedonine, the shape and
placement of the frontal sutures. Addi-
tionally, one genus of Entedoninae, Ase-
codes, which includes species previously

312

Journal of Hymenoptera Research

placed in Teleopterus (Hansson 1996), may
have the forewing with almost identical
lines of setae radiating from the stigmal
vein. However, it is doubtful that there is
a close relationship between Trisecodes and
Asecodes based on other characters, such as
the strength of the sculpturing in Triseco-
des.

ACKNOWLEDGMENTS

We are grateful to Dr. O. T. Lewis who provided
most of the material used for the description of the
Trisecodes and for the information on its biology. We
also thank Dr. C. Hansson and Dr. J. Pinto for dis-
cussion about the placement of Trisecodes agromyzae
and useful comments on the manuscript.

LITERATURE CITED

Boucek, Z. 1988. Australasian Clialcidoidea (Hymenop-
tera): A biosystematic revision of genera of fourteen
families, with a reclassification of species. Walling-
ford, UK, CAB International, 832 pp.

Gauthier, N., J. LaSalle, D. L. J. Quicke and H. C. J.
Godfray. 2000. Phylogeny of Eulophidae (Hy-
menoptera, Chalcidoidea), with a reclassification
of Eulophinae and the recognition that Elasmi-
dae are derived eulophids. Systematic Entomology
(in press).

Gibson, G. A. P. 1990. A word on chalcidoid classi-
fication. Chalcid Forum, 13: 7-9.

Gibson, G. A. P., J. M. Heraty and J. B. Woolley. 1999.
Phylogenetics and classification of Chalcidoidea
and Mymarommatoidea a review of current con-
cepts (Hymenoptera, Apocrita). Zoologica Scripta,
28(1-2): 87-124.

Hansson, C. 1996. The status of the genera Asecodes
Forster, Ionympha Graham and Teleopterus Silves-
tri (Hymenoptera: Eulophidae), with a review of
Nearctic species. Entomologica Scandinavica, 27(2):
159-167.

LaSalle, J., A. Polaszek, J. S. Noyes and G. Zolnerow-
ich. 1997. A new whitefly parasitoid (Hymenop-
tera: Pteromalidae: Eunotinae), with comments
on its placement, and implications for classifica-
tion of Chalcidoidea with particular reference to
Eriaporinae (Hymenoptera: Aphelinidae). Sys-
tematic Entomology, 22(2): 131-150.

Noyes, J. S. 1998. Catalogue of the Chalcidoidea of the
World. CD-Rom. Amsterdam, Nederland, Expert
Center for Taxonomic Information.

Schauff, M.E. 1991. The Holarctic genera of Entedon-
inae (Hymenoptera: Entedoninae). Contributions
of the American Entomological Institute, 26(4): 1-
108.

Ubaidillah, R., J. LaSalle, D. J. L. Quicke. 2000. A pe-
culiar new genus and species of Entedoninae
(Chalcidoidea: Eulophidae) from Southeast Asia.
Journal of Hymenoptera Research, 9: 170-175.

J. HYM. RES.
Vol. 9(2), 2000, pp. 313-319

Description of a New Genus of Entedoninae (Hymenoptera:
Eulophidae) from the Neotropical Region, Including Three

New Species

Christer Hansson

Department of Zoology, Lund University, Helgonavagen 3, S-223 62 Lund, Sweden, e-mail:

christer.hansson@zool.lu.se

Abstract. — Acanthala gen.n. including three new species, albiclava, plaumanni, pubipennis, of
the subfamily Entedoninae (Hymenoptera: Eulophidae) is described from the Neotropical Region
(Belize, Brazil and Costa Rica). Acanthala is unique among Eulophidae by having the forewing
with a row of strong setae on the dorsal surface of the marginal vein. The three species are known
only from the female sex and nothing is known about their biology.

The Eulophidae has a worldwide distri-
bution and is one of the largest families of
Chalcidoidea. The knowledge of the
group is unevenly distributed, with a
strong displacement towards the northern
hemisphere, although the group is expect-
ed to be more species rich in tropical ar-
eas. Estimates of the eulophid fauna in the
New World tropics corroborates this (e.g.
Gaston et al. 1996, LaSalle and Schauff
1995), but very little is known about the
eulophid fauna of this region.

To. increase our knowledge of eulophids
in general, and of the eulophid fauna in the
Neotropical region in particular, a new ge-
nus with unique morphological features is
described below. The descriptions of three
new species belonging to the new genus are
also included. Unfortunately information
regarding the biology is not yet known.

Acronyms of museums used in the text
are as follows: BMNH: The Natural His-
tory Museum, London; CNC: Canadian
National Collections of Insects and Arach-
nids, Ottawa; INBio: Instituto Nacional de
Biodiversidad, Santo Domingo, Costa
Rica; LUZM: Lund University Zoology
Museum, Sweden; MIUCR: Museo de In-
sectos, Universidad de Costa Rica; USNM:
United States Museum of Natural History,
Washington, D.C.

Acanthala Hansson, new genus

Type species. — Acanthala pubipennis
Hansson, new species.

Diagnosis. — Dorsal surface of marginal
vein with a row of strong setae (Figs. 1,
8); eyes hairy (Figs. 1, 6, 7); mandibles
with a single tooth at apex (Fig. 7); frontal
cross-groove incomplete, not reaching
eyes (Fig. 6), or missing (Fig. 7); pedicel
conspicuously hairy on dorsal surface
(Figs. 2-A); mesoscutum and scutellum
with small-meshed and strong reticulation
(Fig. 1), hence dull.

Description. — Flagellum with sensilla
ampullacea short and symmetric, present
on all segments. Antenna with 2-3 anelli.
Mandibles with a single tooth at apex.
Clypeus weakly delimited laterally, but
not delimited dorsally. Antennal scrobes
join on frontal cross-groove (or cross-
groove missing). Frontal cross-groove V-
shaped, not reaching eyes, or missing.
Eyes hairy. Occiput with a weak median
groove in upper part, close to occipital
margin (plaumanni, pubipennis), or median
groove missing (albiclava). Pronotum well
developed and clearly visible in dorsal
view, without transverse carina. Midlobe
of mesoscutum with two pair of strong se-
tae; notauli not visible (plaumanni, pubipcn-

314

Journal of Hymenoptera Research

Fig. 1. Acanthala pubipennis habitus.

nis), or indicated in anterior 1/2 (albiclava).
Scutellum with one pair of strong setae,
situated at equal distance from anterior
and posterior margins of scutellum (pubi-
pennis) or closer to anterior margin (albi-
clava, plaumanni). Transepimeral sulcus
(i.e. the sulcus separating upper and lower
mesepimeron) almost straight (pubipennis,
albiclava) or curved (plaumanni). Dorsellum
visible in dorsal view. Propodeal callus
with two setae. Forewing rounded; costal
cell narrow; postmarginal vein 0.8-1.6 X as

long as stigmal vein; speculum open (al-
biclava, plaumanni) or closed (pubipennis)
below; radial cell bare, without stigmal
hairlines. Petiole short, hardly visible in
dorsal view, and transverse.

Biology. — Not known.

Distribution. — Neotropical region (Be-
lize, Brazil, Costa Rica).

Etymology. — Named after the row of
strong spinelike setae on dorsal surface of
marginal vein: acanth-ala = spiny wing.
The gender is regarded as feminine.

Volume 9, Number 2, 2000

315

Figs. 2-8. Acanthala spp. females. 2-4, antenna in lateral view: 2, A. pubipennis; 3, A. plaumanni; 4, .-\. albiclava.
5, thoracic dorsum in lateral view of A. pubipennis. 6-7, head in frontal view: 6, A. pubipennis; 7, A. albiclava.
8, forewing of A. albiclava.

Discussion. — The dorsal row of setae on
the marginal vein is a unique character
state for Acanthala within the Eulophidae,
and hence a strong apomorphy. The man-
dibles with a single apical tooth is also
unique to Acanthala. A similar character
state is present in some species of Paracrias
Ashmead, but different from Acanthala
since in Paracrias there is a single large
tooth and a small second tooth dorsally
(Fig. 14 in Schauff 1985). Another apo-
morphy present in Acanthala is the incom-
plete or missing frontal cross-groove.
However, this apomorphy is present in

several entedonine genera, e.g. in some
species of Chn/socharis Forster, in most
species of Entedon Dalman, in Entcdono-
necremnus Girault and Eprhopalotus Gi-
rault. The occurence among genera not
otherwise shown to be closely related (e.g.
Schauff 1991, LaSalle & Schauff 1994) does
not indicate a high information value with
regard to relationship.

The dorsal row of strong setae on mar-
ginal vein and the dense and strong but
still fine reticulation on vertex and thorac-
ic dorsum makes Acanthala easily recog-
nizable, habituallv not resembling any

316

Journal of Hymenoptera Research

other entedonine genus from the Neotrop-
ical region.

In Boucek (1988) Acanthala runs either to
Chri/socharis (couplet 149), or to Chrysono-
tomyia (couplet 153). In Schauff et al.
(1997) Acanthala runs either to couplet 126
(Chrysocharis or Grahamia) or (with some
difficulties, due to the fact that Acanthala
does not possess the complete combina-
tion of characters presented in the cou-
plets) to either Asecodes (couplet 132) or to

Neochrysocharis (couplet 134). However,
the row of strong setae on dorsal surface
of marginal vein makes Acanthala easy to
separate from above mentioned genera,
and from any other entedonine genera.
Note: the first character used under cou-
plet 134 in Schauff et al. (1997), the shape
of the transepimeral sulcus has been con-
fused: Closterocerus has a strongly arched
sulcus while Neochrysocharis has a weakly
curved or straight sulcus! (Hansson 1995).

KEY TO FEMALES OF ACANTHALA

1. Predominantly yellowish-brown nonmetallic species; antenna with a distinct antennal clava
(Fig. 4), clava white and remaining flagellum brown; frontal cross-groove missing (Fig. 7)

albiclava new species

- Predominantly dark and ± metallic species; antenna without distinct clava (Figs. 2, 3),
flagellum completely pale brown; frontal cross-groove present medially (Fig. 6) 2

2. Forewing (Fig. 1) with comparatively dense setation, speculum closed below; flagellum
narrower, e.g. flagellomeres II and III 2x as long as wide, and with more distinct constric-
tions between flagellomeres (Fig. 2) pubipennis new species

- Forewing with comparatively sparse setation (as in albiclava (Fig. 8)), speculum open below;
flagellum stouter, e.g. flagellomeres II 1.7X and III 1.4 x as long as wide, and with less
distinct constrictions between flagellomeres (Fig. 3) plaumanni new species

Acanthala albiclava Hansson, new
species

(Figs. 4, 7, 8)

Diagnosis. — Predominantly yellowish-
brown nonmetallic, with only major part
of vertex and upper 1/2 of occiput metal-
lic (bluish-purple); antenna (Fig. 4): scape
comparatively wide, 3.8 X as long as me-
dian width, yellowish-brown; pedicel and
flagellomeres 1-3 brown, flagellomeres 4-
5 white with ventral surface densely se-
tose, flagellum with a distinct clava; with-
out frontal cross-groove (Fig. 7); setae on
vertex and thoracic dorsum comparatively
thin, as thick as setae on marginal vein;
compared to pubipennis (Fig. 1), forewing
in albiclava (Fig. 8) with sparse setation
(wing surface distad of speculum with
same setation, Fig. 8 only shows setation
below base of marginal vein and on sur-
face just distad of postmarginal and stig-

mal veins), speculum open below (i.e. cu-
bital hairline missing below speculum),
hind margin of forewing strongly curved
upwards just below base of marginal vein;
anteromedian part of propodeum strongly
raised into a peak; propodeum with a
complete median carina that splits in two
carinae in posterior part; propodeal sur-
face reticulate.

Female. — Length of body = 0.9-1.0 mm.
Colour: Scape yellowish-brown; pedicel
and flagellomeres 1-3 brown, flagello-
meres 4-5 white. Frons yellowish-brown,
with a white stripe from eye to eye along
upper border (Fig. 7). Vertex yellowish-
brown in front of anterior ocellus, remain-
ing vertex metallic bluish-purple. Upper
1 /2 of occiput metallic bluish-purple, low-
er 1/2 yellowish-brown. Mesosoma, in-
cluding legs, yellowish-brown. Forewing
with a weak infuscate stripe below stigmal
vein, stripe reaches hind margin of wing.

Volume 9, Number 2, 2000

317

Gaster yellowish-brown. Head: Antenna
as in Fig. 4; with three discoid anelli. Ra-
tios height of eye /malar space /width of
mouth: 2.1/1.0/1.4. Frons with rather
strong small-meshed reticulation, meshes
isodiametric. Vertex dull, with strong
small-meshed reticulation. Ratios distanc-
es between posterior ocelli /one posterior
ocellus and eye /posterior ocelli and occip-
ital margin: 2.0/1.0/1.0. Occiput without
a weak median groove in upper part; oc-
cipital margin rounded. Ratio width of
head /width of thorax (measured across
mesoscutum, just in front of base of fore-
wing) = 1.2. Mesosoma: Mesoscutum and
scutellum dull, with rather strong small-
meshed reticulation, meshes on mesoscu-
tum isodiametric, on scutellum slightly
elongate. Dorsellum concave and strongly
reticulate with small meshes. Forewing
speculum open below; ratio length of
postmarginal vein/ length of stigmal vein
= 0.8; ratios length of wing (measured
from base of marginal vein to the point
along outer margin of forewing farthest
away from base of marginal vein) /length
of marginal vein /height of wing: 1.9/1.0/
1.0. Anteromedian part of propodeum
strongly raised into a peak, with a com-
plete median carina that splits in two ca-
rinae in posterior part; propodeal surface
reticulate with small meshes. Metasoma:
Gaster ovate; ratio length of mesosoma/
length of gaster = 0.7-0.8.

Type material. — Holotype female: BRA-
ZIL: Bahia Itabuna, ll-14.ii.1984, F. Ben-
ton (deposited in BMNH). Paratypes: Two
females with same label data as holotype
(1 female in BMNH, 1 female in LUZM);
from same locality as holotype but col-
lected iv.1983 (1 female, in BMNH), 2-
6.V.1983 (1 female, in USNM), viii.1983 (1
female in BMNH, 1 female in LUZM).

Etymology. — Named after white anten-
nal clava: albi-clava = white club.

Acanthala plaumanni Hansson, new
species

(Fig. 3)
Diagnosis. — Predominantly dark and
metallic species; entire antenna brown,

scape comparatively narrow, 5.7X as long
as median width (Fig. 3), flagellum with-
out distinct clava, flagellomeres stout and
with less distinct constrictions between
them; head shrivelled in type series, but
frontal cross-groove visible at least medi-
ally; setae on vertex and thoracic dorsum
comparatively strong, about twice as thick
as setae on marginal vein (as in pubipennis
(Fig. 5)); hind margin of forewing not
strongly curved upwards below base of
marginal vein (as in pubipennis (Fig. 1));
forewing with comparatively (compared
to pubipennis (Fig. 1)) sparse setation (as in
albiclava (Fig. 8)), speculum open below
(as in albiclava (Fig. 8)); propodeum with
weak reticulation, smooth and shiny in
some places.

Female. — Length of body = 0.8 mm (in
both type-specimens). Colour: Antenna
pale brown. Frons golden-green. Vertex
metallic bluish-purple. Occiput golden.
Mesoscutum golden-green. Scutellum me-
tallic purple in median 1/2, golden-green
in lateral 1/4 in holotype; paratype with
entire scutellum golden-green. Propo-
deum golden-green. Fore and hind coxae
dark and metallic, mid coxa infuscate;
femora infuscate; tibiae and tarsi pale.
Forewing weakly infuscate below margin-
al vein, infuscation reaching to hind mar-
gin of wing. Gaster golden-purple. Head:
Antenna as in Fig. 3; with one discoid and
one slightly larger anellus. Ratios height of
eye /malar space /width of mouth: 1.9/
1.1/1.0. Frons with rather weak small-
meshed reticulation, meshes ± isodiamet-
ric. Vertex with weak reticulation, shiny.
Ratios distances between posterior ocelli/
one posterior ocellus and eye /posterior
ocelli and occipital margin: 1.7/1.0/1.0.
Occiput with a weak median groove in
upper part, close to occipital margin; oc-
cipital margin rounded. Ratio width of
head /width of thorax (measured across
mesoscutum, just in front of base of fore-
wing) = 1.0. Mesosoma: Mesoscutum and
scutellum dull, with rather strong small-
meshed reticulation, meshes isodiametric.

318 Journal of Hymenoptera Research

Dorsellum concave and reticulate. Fore- coxa pale; femora dark; tibiae and tarsi in-

wing speculum open below; ratio length fuscate. Forewing weakly infuscate below

of postmarginal vein /length of stigmal marginal vein, infuscation reaching to

vein = 1.4; ratios length of wing (mea- hind margin of wing. Gaster golden-pur-

sured from base of marginal vein to the plish. Head: Antenna as in Fig. 2; with

point along outer margin of forewing far- two discoid anelli. Ratios height of eye/

thest away from base of marginal vein)/ malar space /width of mouth: 1.6/1.0/1.0.

length of marginal vein /height of wing: Frons with rather weak small-meshed re-

2.0/1.2/1.0. Propodeum with weak retic- ticulation, meshes transverse. Vertex dull,

ulation, smooth and shiny in some places, with strong small-meshed reticulation. Ra-

Metasoma: Gaster ovate; ratio length of tios distances between posterior ocelli/

mesosoma /length of gaster = 0.9-1.0. one posterior ocellus and eye /posterior

Type material. — Holotype female: BRA- ocelli and occipital margin: 2.0/1.7/1.0.

ZIL: Santa Catarina, Nova Teutonia, Occiput with a weak median groove in

xi.1949, F. Plaumann (deposited in upper part, close to occipital margin; oc-

BMNH). Paratype: One female from same cipital margin rounded. Ratio width of

locality as holotype but collected ix.1943 head /width of thorax (measured across

(in BMNH). mesoscutum, just in front of base of fore-

Etymology. — Named after F. Plaumann, wing) = 0.9. Mesosoma: Mesoscutum and

collector of type series. scutellum dull, with rather strong small-
meshed reticulation, meshes isodiametric.

Acanthala pubipennis Hansson, new Dorsellum convex and reticulate with

species small meshes. Forewing speculum small

(rigs, i, z, d, t>; ancj cioseci below, cubital hairline curved

Diagnosis. — Predominantly dark and upwards towards base of marginal vein;
metallic species; entire antenna brown, ratio length of postmarginal vein /length
scape comparatively narrow (Fig. 2), 4.7X of stigmal vein = 1.6; ratios length of wing
as long as median width, flagellum with- (measured from base of marginal vein to
out distinct clava, flagellomeres slender the point along outer margin of forewing
and with distinct constrictions between farthest away from base of marginal
them; setae on vertex and thoracic dorsum vein) /length of marginal vein /height of
comparatively strong, about twice as thick wing: 1.8/1.1/1.0. Propodeum smooth
as setae on marginal vein (Fig. 5); frontal and shiny; propodeal callus with small-
cross-groove present, missing only close meshed reticulation. Metasoma: Gaster
to eyes (Fig. 6); forewing (Fig. 1) with ovate; ratio length of mesosoma /length of
comparatively dense setation, speculum gaster = 0.8-1.0.

small and closed below, cubital hairline Type material. — Holotype female: BE-

curved upwards towards base of marginal LIZE: Las Cuevas, ix.1995, T. King & A.

vein; hind margin of forewing not strong- Howe (deposited in BMNH). Paratypes:

ly curved upwards below base of margin- Following from same locality as holotype

al vein; propodeum smooth and shiny but collected iv.1995 (1 female, in LUZM),

(Fig. 1). vi.1995 (1 female, in BMNH); 1 female

Female. — Length of body = 0.7-1.0 mm. COSTA RICA: Alajuela, Perias Blancas,
Colour: Antenna pale brown. Frons dark 700m, ii.1987, E. Cruz (in CNC); 1 female
with weak golden tinges. Vertex dark with COSTA RICA: Guanacaste, P.N. Santa
weak metallic tinges. Occiput dark with Rosa, 300m, 20. xii. 1986-10. i. 1987, D.H.
metallic tinges. Mesoscutum, scutellum Janzen & I.D. Gauld (in BMNH); follow-
and propodeum dark with golden-purple ing from same locality as previous but col-
tinges. Fore and hind coxae dark, mid lected 31. i-21 .ii.1987 (1 female, in USNM),

Volume 9, Number 2, 2000

319

16.v-6.vi.1987 (1 female, in INBio); 1 fe-
male COSTA RICA: Puntarenas, Golfo
Duke, 3km SW Rincon, 10m, vii.1991, P.
Hanson (in MIUCR).

Etymology. — Named after densely setose
forewing: pubi-pennis = hairy wing.

ACKNOWLEDGMENTS

I am indebted to the following persons for their aid
in loan of material: C. Godoy and J. A. Ugalde (IN-
Bio), P. Hanson (MIUCR), J.T. Huber (CNC) and J.S.
Noyes (BMNH). The TMR Programme (of the Euro-
pean Union) is hereby acknowledged for funding a
stay at the NHM in 1999. I also would like to thank
the Board of Trustees of the Natural History Museum
in London for permitting access to NHM collections.

LITERATURE CITED

Boucek, Z. 1988. Australasian Chalcidoidea (Hymenop-
tera), a biosystematic revision of genera of fourteen
fatuities, with a reclassification of species. CAB In-
ternational. Wallingford. 832 pp.

Gaston, K.J.; Gauld, I.D. and Hanson, P. 1996. The
size and composition of the hymenopteran fauna
of Costa Rica, journal of Biogeography 23:105-113.

Hansson, C. 1995. Revision of the Nearctic species of
Neochrysocharis Kurdjumov (Hymenoptera: Eu-
lophidae). Entomologica Samdinavica 26:27-46.

LaSalle, J. & Schauff, M.E. 1994. Systematics of the
tribe Euderomphalini (Hymenoptera: Eulophi-
dae): parasitoids of whiteflies (Homoptera: Al-
eyrodidae). Systematic Entomology 19: 235-258.

LaSalle, J. and Schauff, M.E. 1995. Eulophidae, in
Hanson, P.E. and Gauld, I.D. The Hymenoptera of
Costa Rica. Oxford University Press. 893 pp.

Schauff, M.E. 1985. The New World genus Paracrias
Ashmead (Hymenoptera: Eulophidae). Proceed-
ings of the Entomological Society of Washington 87:
98-109.

Schauff, M.E. 1991. The Holarctic genera of Entedon-
inae (Hymenoptera: Eulophidae). Contributions of
the American Entomological Institute 26(4): 1-109.

Schauff, M.E.; LaSalle, J. and Coote, L.D. 1997. Eulo-
phidae, in Gibson, G.A.P.; Huber, J.T. and Wool-
ley, J.B. Annotated Keys to the getiera of Nearctic
Chalcidoidea (Hymenoptera). NRC Research Press.
Ottawa. 794 pp.

J. HYM. RES.
Vol. 9(2), 2000, pp. 320-323

The Identity of Pteroptrix imitatrix (Fullaway)
(Hymenoptera: Aphelinidae)

Andrew Polaszek and Gerhard L. Prinsloo

(AP) Unit of Parasitoid Systematics, CABI Bioscience UK Centre (Ascot), Department of

Biology, Imperial College at Silwood Park Asoct, Berks SL5 7PY, UK; (GLP) Plant Protection

Research Institute, Private Bag X134, Pretoria 0001, South Africa

Abstract. — Taxonomic notes are provided on two aphelinid wasps, Pteroptrix imitatrix (Fulla-
way), described from Hawaii, and Pteroptrix albifemur (Girault), described from Australia. The
former is shown to be a synonym of the latter. New taxonomic, distributional and biological data
are provided.

Among several Aphelinidae collected in type designation and distributional infor-

the Galapagos Islands by Dr John Heraty mation are published to clear up some of

(UCR) were three specimens of a Pteroptrix the many taxonomic problems that still

species belonging to the maritima-group exist in this genus.

sensu Viggiani and Garonna (1993). This Terminology follows Hayat (1983) ex-
species-group formerly comprised part of cept that the terms mesosoma and meta-
the genus Archenomus, and using the key soma replace thorax plus propodeum, and
to world species of Archenomus by Prins- gaster, respectively. Abbreviations of de-
loo and Neser (1990) the specimens were positories can be found under "Acknowl-
identified by the first author as Pteroptrix edgments".
( = Archenomus) albifemur (Girault). Con-
sulting the description of P. imitatrix (Ful- Pteroptrix albifemur (Girault 1915)
laway) and non-type material of that spe- (Fi8s- l-3)
cies at the United States National Muse- Aptewptrix albifemur Girault 1915: 65.
urn, it became apparent that the speci- Archenomus albifemur (Girault): Prinsloo and
mens from the Galapagos were also very Neser 1990: 23.

close, if not identical, to that species. Pteroptrix albifemur (Girault): Viggiani and Gar-

Prinsloo and Neser did not treat P. imita- onna 1993: 61; Hayat 1998:245.

trix as the type was not located by them. Pseudopteroptrix imitatrix Fullaway 1918: 464.

P. imitatrix was described from Hawaii, Syn. nov.

and after consultation with Mr G. Nishida Archenomus imitatrix (Fullaway): Prinsloo and

of the Bishop Museum the type material Neser 1990: 23.

was finally located by Mr B. Kumashiro at Pteroptrix imitatrix (Fullaway): Viggiani and

the Department of Agriculture. We have Garonna 1993: 60.

compared the types of P. albifemur (Gi- Female.— Colour: Antenna with flagel-
rault), P. imitatrix (Fullaway) and the Gal- lUm pale brown, the scape with its outer
apagos (Ecuador) material, and find them edge darker brown, radicle dark brown.
to be conspecific. Subsequently, material Head with the lower occiput, genae and
from Florida, Puerto Rico and India was stemmaticum dark brown, the eye mar-
also found to belong to P. albifemur. The gins darkest, frons and upper occiput pal-
following synonymy, redescription, lecto- er brown. Mesosoma brown, the scutel-

Volume 9, Number 2, 2000

321

Figs. 1-3. Pteroptrix albifemur, female. 1, Antenna. 2, Fore wing. 3, Mesonotum, showing sculpture of mesos-
cutal mid lobe (specimen from Santa Cruz, Galapagos).

lum strikingly white, side lobes and bor-
der of mesoscutum paler brown. Legs
white, the hind coxa and leading edge of
the hind femur slightly darkened. Wings
hyaline, slightly darkened below the mar-
ginal vein. Metasoma brown. Morpholo-
gy: Mandibles with two teeth and a trun-
cation. Antennal formula 1,1,3,3 (fig. 1);
scape slightly more than 2 X pedicel
length. Funicle segments all longer than
wide, subequal in length. F2 slightly the
shortest; funicle about 0.5 x length of
club. Flagellum with the following num-
bers of longitudinal sensilla: Fl: 0; F2: 0;
F3: 0-1; F4: 3-4; F5: 3-4; F6: 3. Mid lobe of
mesoscutum (fig. 3) with 6-7 setae, each
lateral lobe with 1, each axilla with 1, and

scutellum with 4. Fore wing (fig. 2) with 1
seta on submarginal vein, 2-4 setae in bas-
al cell. Anterior margin of marginal vein
with 5-6 setae, and one large seta at the
junction of the submarginal vein and par-
astigma. Maximum width of wing 2.6-2.9
X longest seta on marginal fringe. Length
of second valvifers 3.3-3.6 x third valvu-
lae. Second valvifer and third valvula
combined 1.1 X length mid tibia. Meta-
soma oval, longer than wide and about 1.5
X length mesosoma. Terga II-VII with 0,
1 + 1, 1 + 1, 1 + 1, 1+2+1 and 1+2 + 1 setae
respectively.

Male. — Unknown

Variation. — Insignificant in the material
examined.

322 Journal of Hymenoptera Research

Material examined. — Type material: Ho- mur. Fullaway (1918) mentioned a slide-
lotype female Apteroptrix albifemur Girault mounted specimen reared from Hemiber-
[AUSTRALIA: Cairns, Gordonvale] Type lesia (as Aspidiotus) rapax (Comstock). This
HY/2962 (3894) (QM). Lectotype female specimen has not been seen by us.
(here designated) Pseudopteroptrix imitatrix Distribution. — Australia, Ecuador, Ha-
Fullaway [HAWAII:] Honolulu. 17.i.[19]18 waii (and presumably widespread in the
ex Howardia biclavis (HDA, slide-mount- Pacific), India, Puerto Rico, USA (Florida),
ed); paralectotypes, 5 females: 1 female Discussion. — Pteropterix albifemur be-
[HAWAII:] Honolulu, Oahu, 12.i.l8 (D.T. longs to the maritima-group of Pteroptrix,
Fullaway) Hoivardia biclavis (BMNH, slide- where it was correctly placed by Viggiani
mounted). [HAWAII:] Honolulu, Oahu, and Garonna (1993). This group is char-
4.ii.l8 (D.T. Fullaway) Howardia biclavis (1 acterized by lacking the complete sulcus
female HDA, card-point; 1 female USNM above the occipital foramen and antennal
slide-mounted). [HAWAII:] Tantalus, el. formula of female 1.1.3.3. Viggiani and
1300 ft (J. Kotinsky) H. biclavis (2female, Garonna (1993) were mistaken in suggest-
HDA). Additional material: ECUADOR: ing that P. imitatrix belongs to the bicolor-
Galapagos, Santa Cruz, Darwin Sta. 20m group. Prinsloo and Neser (1990) placed
PAN 14-18.V.91 (J. Heraty) arid zone (lfe- albifemur in their peratus-group, and sug-
male, BMNH). ECUADOR: Galapagos, Is- gested imitatrix could belong to their in-
abela, C. Azul, 3 Km W Cal. Iguana 200 colus-group. These last-mentioned species
m 25.V.91 (J. Heraty) deciduous forest groups were combined into the maritima-
H91/061 (1 female, BMNH). ECUADOR: group, following the redefinition of spe-
Galapagos, Isabela, Alcedo 7 Km SW NE cies groups by Viggiani and Garonna
Playa 600 m 25.vi.91 (J. Heraty) arid forest (1993), a step that was necessitated by the
H91/118 (1 K, BMNH). ECUADOR: Fer- incorporation of Archenomus into Pterop-
nandina, 5 Km NE Cabo Hammon 110 m trix. Pteroptrix albifemur is morphologically
4-10.V.91 (J. Heraty) pan. Palo Santo forest close to the following species in the mari-
H91/031 (1 female, USNM). INDIA: Kar- tima-group: P. opaca Erdos, P. patriciae
nataka, 25 Km W. of Mudigere 28.x. — (Prinsloo and Neser) and P. abnormis
3.xi.l979 J.S. Noyes (1 female, BMNH; (Prinsloo and Neser). We have not exam-
Hayat det.). PUERTO RICO: Indiera 9- ined type material of P. opaca (described
10.iii.1936 H.L. Dozier "ex Howardia bi- from Hungary), which appears to be lost
clavis on sapotaceous tree, Lucuma sp." (7 (J. Papp, personal communication). We
female, USNM). PUERTO RICO: Maya- have, however, examined specimens from
guez 18.x. 1935 H.L. Dozier "sweeping Ro- Hungary (though not from the type local-
ble and roadside vegetation at 1000 ft" (1 ity) and from Italy, which agree in all re-
female, USNM). PUERTO RICO: Rio Pie- spects with the original description. Pter-
dras 3.ix.l912 T.H. Jones "from twig of optrix opaca differs from P. albifemur most
achiote, Bixa orellana, on which Hoivardia strikingly in the colour of the legs (tibiae
biclavis was present" (1 female, USNM). and femora dark in P. opaca, very largely
USA: Florida, Oneco J.W. Collins 2.ix.l922 pale in P. albifemur). The wing of P. opaca
(1 female, USNM). is much more deeply infuscated below the

Host. — Diaspididae: Howardia biclavis marginal vein than in P. albifemur, as well

(Comstock). A pantropical, polyphagous as being noticeably more densely setose,

species (Williams and Watson, 1988) oc- Pteroptrix abnormis also differs from P. al-

casionally recorded as a pest, for example bifemur in the colour and setation of the

of citrus (Grillo et al., 1983). The "eulo- fore wings, although the legs and anten-

phid" parasite of H. biclavis recorded by nae are very similar in colour and propor-

the latter authors could well be P. albife- tions to those of P. albifemur. The sculpture

Volume 9, Number 2, 2000

323

of the face and mesoscutum of P. abnormis
is, however, much less pronounced than
in P. albifemur. Differences between P. pa-
triciae and P. opaca are slight, being re-
stricted largely to the colour of the legs
(although the Fl and F3 of the female an-
tenna in P. patriciae are slightly longer
than those of P. opaca). In this respect, P.
patriciae is somewhat intermediate be-
tween P. opaca and P. albifemur. We sug-
gest that a thorough review of the species
comprising the maritima-group of Pterop-
trix be carried out before synonymising
any of these species based on the limited
material available during this study.

ACKNOWLEDGMENTS

For the loan or donation of material, we are grate-
ful to the following: J. Heraty, University of Califor-
nia, Riverside, (UCR); M. Schauff, United States Na-
tional Museum, Washington, D.C. (USNM); G. Mon-
teith, Queensland Museum, Brisbane, Australia
(QM); W. Nagamine, Hawaii Department of Agricul-
ture, Honolulu (HDA); G. Viggiani, University of Na-
ples, Portici, Italy; J. Papp, Hungarian National Nat-
ural History Museum, Budapest. The authors also
thank John LaSalle for his help and advice. This study
was facilitated by a Smithsonian Institution visitors'
grant to the first author, which is gratefully acknowl-
edged. Additional space and facilities during this
study were kindlv provided by the Department of

Entomology, The Natural History Museum, London
(BMNH).

LITERATURE CITED

Fullaway, D.T. (1918) A new genus of pteroptricine
Aphelinidae (Hymenoptera). Proceedings of the
Hawaiian Entomological Society 3: 463^164.

Girault, A. A. (1915) Australian Hymenoptera Chal-
cidoidea — VII: Encyrtidae. Memoirs of the Queens-
land Museum 4: 1-184.

Grillo, M., N. del Valle and M. Alvarez (1983) Ho-
wardia biclavis (Comstock) (Homoptera: Cocci-
dae) en citricos. Centro Agricola 10: 47-53.

Hayat, M. (1983) The genera of Aphelinidae (Hyme-
noptera) of the World. Systematic I ntomology 8:
63-102.

Hayat, M. (1998) Aphelinidae of India (Hymenoptera:
Chalcidoidea): a taxonomic revision. Monographs
on Entomology International 13: 1-416.

Prinsloo, G.L. and O.C. Neser (1990) The southern
African species of Archenomus Howard (Hyme-
noptera: Aphelinidae) with a key to the species
of the world. Entomology Memoir, Department
of Agricultural Development, Republic of South
Africa 79: 1-26.

Viggiani, G. and A. P. Garonna (1993) Le specie itali-
ane del complesso Archenomus Howard, Archen-
omiscus Nikolskaya, Hispaniella Mercet e Pterop-
trix Westwood, con nuove combinazioni generi-
che (Hymenoptera: AphelinidaeJ Bollettino del La-
boratory di Entomologia agraria "F Hippo Silvestri"
Portici 48: 57-88.

Williams, D.J. and Watson, G.W. (1988) The scale in-
sects of the tropical South Pacific region Part 1 The
armoured scales (Diaspididae) CAB International,
Wallingford, U.K. 290 pp.

J. HYM. RES.
Vol. 9(2), 2000, pp. 324-346

A Review of the Sphex flavipennis Species Group
(Hymenoptera: Apoidea: Sphecidae: Sphecini)

A. S. Menke1 and W. J. Pulawski

(ASM) Systematic Entomology Laboratory, PSI, USD A, National Museum of Natural History,

Washington D.C. 20560-0168, USA; (WJP) Dept. of Entomology, California Academy of Sciences,

San Francisco, California 94118-4599, USA, e-mail: wpulawski@calacademy.org

Abstract. — The Sphex flavipennis species group, a Palearctic assemblage formerly called the max-
illosus species group, is characterized, its species are diagnosed, keyed, their distributions sum-
marized, and male antennae illustrated. The large Eurasian wasp formerly known as maxillosns
Fabricius or rufocinctus Brulle must now be called fnnerarius Gussakovskij. Similarly, the species
formerly known as afer Lepeletier must now be called leuconotus Brulle. The following species are
included (new synonyms are listed in parentheses): atropilosns Kohl, 1885; flavipennis Fabricius
1793 (rufocinctus Brulle 1833); fnnerarius Gussakovskij 1934 (maxillosus Fabricius 1793, a junior
homonym of Sphex maxillosus Poiret 1787; obscurus Fischer de Waldheim 1843; and mavromous-
takisi de Beaumont 1947); leuconotus Brulle 1833 (triangulum Brulle 1833, a junior homonym of
Sphex triangulum Villers 1789; afer Lepeletier 1845; sordidus Dahlbom 1845; tristis Kohl 1885;
pluniipes Radoszkowski 1886, a junior homonym of Sphex plumipes Drury 1773; and pachysoma
Kohl 1890); libycus de Beaumont 1956; melas Gussakovskij 1930; and oxianus Gussakovskij 1928
(nubilis de Beaumont 1968). A lectotype is designated for Sphex funerarius Gussakovskij 1930, and
a neotype is designated for Sphex leuconotus Brulle 1833. Descriptive notes are provided for the
type material of Sphex atropilosns Kohl, fitnerarius Gussakovskij, leuconotus Brulle, rufocinctus Brulle,
and triangulum Brulle.

It is rather ironic, after all these years,
that the proper scientific names have not
been established for Sphex maxillosus Fa-
bricius 1793 and afer Lepeletier 1845, since
these represent two of the largest Palearc-
tic sphecid wasps. This problem is cor-
rected here. Initially our study was
prompted by Menke's examination in
1964 of Brulle's type specimens at the Mu-
seum National d'Histoire Naturelle, Paris,
which suggested that two taxa recognized
by Kohl (1890) as synonyms of maxillosus
(rufocinctus Brulle and triangulum Brulle)
were not conspecific with that species.
This was corroborated by Pulawski in
1975, who re-examined the same material.

'Mailing address: Ammophila Research Institute,
1429 Franklin St., Bisbee, AZ 85603-6211, USA,
e-mail: asm@theriver.com

In 1994 both of us restudied the types and
confirmed our prior assessments of them.
These were important findings because
van der Vecht (1959) noted that maxillosus
Fabricius was a junior homonym and the
species needed a replacement name. Van
der Vecht believed that leuconotus Brulle
was the oldest available replacement for
maxillosus. However, we are certain that
leuconotus is a senior synonym of afer Le-
peletier. In this paper we establish that fu-
nerarius Gussakovskij is the proper name
for maxillosus Fabricius and leuconotus
Brulle the proper name for afer Lepeletier.
Our study has enabled us to construct
an identification key to the Palearctic spe-
cies of the flavipennis group. This key
should be regarded as provisional because
these wasps are taxonomically difficult,
and we have not made an exhaustive

Volume 9, Number 2, 2000

325

study of the species. Too little is known
about geographic variation in the flavipen-
nis group, particularly the color of the
wings, setation, legs, and gaster. These
may prove to be variable within some spe-
cies, but a very large specimen database
would be required to resolve species lim-
its and the significance of geographic var-
iation. The apparent variation in male
placoid distribution on the antenna also
needs to be carefully analyzed, as well as
possible variation in the male genitalia.
Currently the male genitalia seem identi-
cal or nearly so in the taxa we discuss
here.

The family group names used in the ti-
tle are based on Melo (1999).

SOURCES OF MATERIAL

Abbreviations used to indicate location

of specimens are listed below with corre-
sponding institutions.

CAS: California Academy of Sciences, San
Francisco, California, U.S.A.

Copenhagen: Zoologisk Museum, Copen-
hagen, Denmark

Dresden: Staatliches Museum fur Tierkun-
de, Dresden, Germany

Genova: Museo Civico di Storia Naturale
"Giacomo Doria", Genova, Italy

Krakow: Instytut Systematyki i Ewolucji
Zwierzat, Polska Akademia Nauk, Kra-
kow, Poland

Lausanne: Musee Cantonal de Zoologie,
Lausanne, Switzerland

Lund: University of Lund, Lund, Sweden

Menke: A. S. Menke Collection, Ammo-
phila Research Institute, Bisbee, Arizo-
na, U.S.A.

Moscow: Zoological Museum, Moscow
State University, Moscow, Russia

Palermo: Istituto di Zoologia, Universita
di Palermo, Palermo, Italy

Paris: Museum National d'Histoire Natu-
relle, Paris, France

Stockholm: Naturhistoriska Riksmuseet,
Stockholm, Sweden

St. Petersburg: Zoological Institute, Rus-

sian Academy of Sciences, St. Peters-
burg, Russia

USNM: United States National Museum
of Natural History, Washington D.C.,
U.S.A.

Wien: Naturhistorisches Museum, Wien,
Austria

Zurich: Entomologisches Institut, Eidge-
nossische Technische Hochschule, Zur-
ich, Switzerland

METHODS

Morphological terms used here follow
Bohart and Menke (1976) except that we
follow Salmon (1929) for the name of the
curved, cord-like "tendon" at the base of
the petiole. Salmon called this the funicle,
and we adopt his term because it is not a
tendon in the true sense of the word.

Measurements of the abdominal petiole
are made as follows: the width is mea-
sured at the base of tergum I, the length
is measured from the base of the funicle
(on the petiole) to the base of tergum I.

When describing color we use the term
"red" to indicate non-black areas of the
legs. In reality, the true color more closely
approximates amber, or reddish brown in
many instances. Setal color is described as
pale or white vs. dark brown or black. In
some cases, pale or white setae are really
silver.

For the uncommonly collected species
we have listed locality records known to
us.

The fourth edition of the International
Code of Zoological Nomenclature (ICZN
1999) stipulates in Article 74.7.3 that "to
be valid, a lectotype designation made af-
ter 1999 must contain an express state-
ment of the taxonomic purpose of the des-
ignation". These statements must accom-
pany each designation (Article 74.3). Tra-
ditionally lectotype designations have
been indicated by the words "present des-
ignation" and the purpose is clear to all,
namely to fix the identify of the name in-
volved. To add a statement after each des-
ignation seems redundant and repetitive

326 Journal of Hymenoptera Research

to us, but to satisfy the Code, we have fol- gellomeres are more elongate than in

lowed "present designation" with the fol- those two species. The female mid and

lowing statement "in order to ensure the hindlegs are black, but the foretibia and

name's proper and consistent use". tarsus are reddish.

Species discrimination in the flavipennis

The flavipennis Species Group grQup ig ^^ espedally in females

The species discussed here belong to a Previous authors have used wing color,

lineage that de Beaumont (1960) called the setal color, presence or absence of long se-

maxillosus group. Because maxillosus is a tae on the femora, and proportions of the

junior homonym, we have renamed it the petiole and /or comparisons of its length

flavipennis group, using the oldest valid witn the length of one of the hindtarso-

species name. meres to separate females of some species.

Females of the flavipennis group share However, the separation of females of /la-
the following defining characters: clypeal vipennis, /unerarius, and oxianus is partic-
disk conspicuously convex, but abruptly ularly vexing, and association with males
depressed near free margin, delimiting a may often be the only reliable way to
narrow, flat rim; labral apex with inverted identify these species. The most useful
Y- or V-shaped carina whose arms project male character is the number and width
as small lobes; base of Y or V often ex- of placoids on the flagellum (although
tending as a median carina toward labral they are variable in /umrarius especially;
base. In addition to these apparently de- see that spedes bdow for details). other
rived characters, the species lack certain male features that have been used by pre.
specializations of other Sphex: the metan- vious WQrkers are ^ ]ength rf tRe lateml
otum is simple (not bituberculate); the ^ bmshes of sternum VII, the form of

propodeal dorsum lacks coarse, widely .11 1 c • j 1 u.

r r J the clypeal tree margin, and color pattern.

spaced, transverse carinae or wrinkles; ^ n i_ ,.i_ u

r , / ,,,,, . , Generally, however, these characters are

and the propodeal side lacks a vertical , „ ,. , , ,, , .. ,. , , .,

„. . . , . , not wholly reliable. Male genitalia lack the

swelling anterior to the spiracular groove. 1,1 . . e j •

. , , .1 1 i r . t ■ unusual elaborations found in some sec-

Males apparently lack features of species . , , . .....

. r .,. J r tions of the genus and appear identical in

group significance. . . , ° _ . . rr _-

Ti .u r 11 n 1 species of the flavivennis group. The penis

the group contains the following Pale- r, , , J r t° \ .,r ,

... . 1 r, 1, 100c a valve head is arcuate in lateral profile and

arctic species: atropilosus Kohl 1885, /lain- r

pennis Fabricius 1793, /unerarius Gussa- is aymed ventrallY with a row of teeth.

kovskij 1934 (= maxillosus Fabricius 1793, The lowing authors provide keys, re-

nec Poiret 1787; ru/ocinctus of authors after cords' and other valuable information on

1975), leuconotus Brulle 1833 (= a/er Lepe- sPecies in the flavipennis group: Kohl

letier 1845), libycus de Beaumont 1956, me- (1890)' worldwide revision of genus; Dus-

las Gussakovskij 1930, and oxianus Gus- met and Mercet (1906), Spanish species;

sakovskij 1928. Roth (1925), North African species; Ber-

In addition to the seven species listed land and Bernard (1949), French species;

above we have studied three males and de Beaumont (1951), Moroccan species,

one female from Morocco collected at Ait- and (1960), placoids of male antenna; Sco-

Saouin (between Ouarzazate and Agdz) biola (1960), Romanian species; Kazenas

southwest of the Jbel Sarhro Mts. (CAS) (1978), Kazakh species; Pulawski (1978),

that may be a new species or an extreme species of the European part of former

form of one of the currently known spe- USSR; Mingo and Gayubo (1984), Spanish

cies. They resemble flavipennis and funer- species; Hamon, Fonfria, and Tussac

arius, but the male antenna has broad pla- (1991), French species; and Bitsch et al.

coids on flagellomeres IV- VI, and the fla- (1997), western European species.

Volume 9, Number 2, 2000 327

KEY TO SPECIES OF THE SPHEX FLAVIPENNIS GROUP

Females

1. Erect setae of head and thorax dark brown or black 2

- Erect setae of head and thorax white or pale yellow 4

2. Gaster red and black (at least tergum II partly red); foretibia(at least partly) and tarsus
amber, midtibia partly amber; wings yellow tinted with dark apical band, veins brown;
Iberian Peninsula to Greece, Slovakia, Hungary, Romania, Kazakhstan; Algeria(?)

atropilosus Kohl

- Body all black; wings darkly infumate, with no apical band 3

3. Appressed setae of face brown; hindfemur asetose; Iran, Turkmenistan

melas Gussakovskij

- Appressed setae of face silver; hindfemur with erect setae; northeastern Libya, northwest-
ern Egypt libycus de Beaumont

4. Petiole wider than long (as measured dorsally from base of funicle to base of tergum I) or

at least not longer than wide; Mediterranean region to central Asia leuconotus Brulle

- Petiole longer than wide 5

5. Legs black (including tarsi); gaster usually all red (sometimes bicolored or all black); east-
ern Mediterranean region to Afghanistan and Tajikistan oxianus Gussakovskij

- Some or all legs partly to entirely red (at least foretibia with some red apically); gaster
bicolored (all black in some areas of Kazakhstan, Siberia, China); widespread in Palearctic
Region 6

6. Pronotal collar and scutum with appressed white setae (best seen from in front); length
24-32 mm flavipennis Fabricius

- Pronotal collar and scutum without appressed white setae (scutum sometimes with nar-
row, median stripe of white setae or traces of white setae posterolaterally); length 16-26
mm funerarius Gussakovskij

Males

1. Flagellomere III with placoid 2

- Flagellomere III without placoid 4

2. Erect setae of head and thorax dark brown or black; flagellomeres III-VII with placoids; at
least tergum II partly red; Iberian Peninsula to Greece, Slovakia, Romania, Hungary, Ka-
zakhstan; Algeria(?) atropilosus Kohl

- Erect setae of head and thorax white or pale yellow; placoid distribution and gaster color
variable 3

3. Gaster red basally, black distally (western Palearctic; Sichuan, China), or all black (e. Ka-
zakhstan, Siberia; Gansu, China); placoids usually present on flagellomeres III-VIII (Fig.
2), but sometimes on II-VIII, II-IX, III-VI (Fig. 1), III-IX (or IV- VI in Corsica)

funerarius Gussakovskij

- Gaster all black; placoids present on flagellomeres III-VI (Fig. 3); eastern Mediterranean
region to Tajikistan and Afghanistan oxianus Gussakovskij

4. Wings nearly uniformly darkly infumate, with no apical dark band; remaining body black;
erect setae of head and thorax dark brown or black 5

- Wings nearly hyaline or yellowish to slightly infumate, with darker apical band; gaster at
least partly red; legs black or partly red; erect setae of head and thorax dark brown to pale
yellow or white 6

5. Iran, Turkmenistan melas Gussakovskij

- Northeastern Libya, northwestern Egypt libycus de Beaumont

6. Flagellomeres V-VI (Figs. 6-7) or only VI with placoids; gaster color variable

flavipennis Fabricius

- Flagellomeres IV- VI with placoids (Figs. 4-5) (Corsican funerarius will key here, but gaster

is red and black); gaster black leuconotus Brulle

328

Journal of Hymenoptera Research

Volume 9, Number 2, 2000

329

Figs. 4-9. Scanning electron photographs of male antenna showing placoids on flagellomeres (= F). 4-5,
Sphex leuamotus, 4 is specimen from Cherkes, Cvprus with placoids on F IY-YI; 5 is specimen from Zaragoza,
Spain with placoids on F rV-VI. 6-7, Sphex flauipennis, 6 is specimen from Carpentras, France with placoids
on F Y-VI; 7 is specimen from Zaragoza, Spain with placoids on F V-VL 8, Sphex melas from Repetek, Turk-
menistan with placoids on F V-VI. 9, Sphex libycus from Marsa Matruh, Egypt with placoids on F V-YI.

DISCUSSION OF SPECIES
Sphex atropilosus Kohl

Sphex maxUlosus var. atropilosus Kohl 1885:202.
Holotype: female, "Tultscha" [= Tulcea, Ro-
mania] (VVien), examined.

Sphex. atrohirtus Kohl 1890:437 (lapsus for and
redescription of atropilosus, raised to species.)

Subsequent records as atropilosus: Berland 1952:
88 (France); Leclercq 1955:19 (Africa); Le-
clercq 1956:324 (Greece); Bajari 1957:79 (Hun-
gary); de Beaumont 1962:19 (Spain); de Beau-
mont 1965:14 (Greece); Pulawski 1978:183 (s.
Russia, Caucasus); Mingo and Gayubo 1984:
145 (Spain); lozan 1986:367 (Hungary); Ga-
yubo 1987:106 (Spain); Hamon, Fonfria, and
Tussac 1991:131 (France); Bitsch et al., 1997:
69 (s. France); Shkuratov 1998:97 (Rostov Ob-
last', Russia).

Subsequent records as atrohirtus: Roth 1925:397

(Africa); Chaudoir 1947:142 (France); Zavalil
and Snoflak 1948:168 (Czechoslovakia); de
Andrade 1949:8 (Portugal); Berland and Ber-
nard 1949:4 (France); Hamon 1950:29
(France); Benedek 1968:70 (Hungary); Bal-
thasar 1972:421 (Czechoslovakia); Kazenas
1978:40 (Kazakhstan); Dollfuss 1989:12, 15
(type material); Padr (in Sedivy) 1989:166
(Slovakia).

Recognition. — The dark erect setae of the
head and thorax distinguish atropilosus
from other species in the fUwipennis group
with red and black legs and gaster. The
short female petiole (at most minimallv
longer than wide) is similar to that of leu-
amotus, but the erect setae are pale in that
species. The female mid- and hindfemora
have erect setae but thev are shorter on
the dorsum than in leuamotus. The broad

Figs. 1-3. Scanning electron photographs of male antenna showing placoids on flagellomeres ( F). 1-2,
Sphex funerarius, 1 is specimen from Tanger, Morocco with placoids on F III-Y1 2 is specimen from Italy with
placoids on F III-YII1. 3. Sphex oxianus from Kondara Canyon, Tadjikistan with placoids on h III-YI

330

Journal of Hymenoptera Research

placoids on male flagellomeres III- VII dif-
ferentiate atropilosus from leuconotus which
has narrower ones on IV- VI (Figs. 4-5).
The size range of female atropilosus is 18-
27 mm which is somewhat less than the
common parameters for females of leucon-
otus (22-33 mm).

Material examined. — Kohl's holotype
bears his handwritten label "atrohirtus
Kohl Type", and he obviously intended
the species name to be atrohirtus, but it
was published as atropilosus. A second fe-
male from "Transcauc." also has Kohl's
label "atrohirtus Kohl type" (Vienna), but
it was not mentioned in the original de-
scription and cannot be a type. It was list-
ed by Kohl (1890) who also had material
from Sarepta (= Volgograd, Russia).

Other material examined: SPAIN: Vil-
larina, Salamanca, July 21, 1995 (female,
Menke), Valdepenas, June 21, 1983 (male,
Menke), Madrid (female, CAS); FRANCE:
Canet, June 14, 1948 (female, Menke), St.
Nazaire, June 14, 1948 (male, Menke);
GREECE: Kalamata (one of a series stud-
ied by de Beaumont 1965) (male, CAS);
RUSSIA, Kalmyk Republic: 10 km NW of
Chernozemel'sk (female, CAS); and AL-
GERIA: "Oran, 1895", collected by
Schmiedeknecht (three females, one male,
Vienna) and identified by Kohl as "atro-
hirtus" (i.e., atropilosus). However, these
Algerian specimens may have incorrect
provenance labels (see Distribution be-
low).

Holoh/pe features. — Kohl's holotype has
yellow tinted wings. The legs are largely
black but the following are reddish: ante-
rior face of forefemur, and all of foretibia
and tarsus; distal fourth of anterior face of
midfemur, and anterior face of midtibia.
Tergum I is red but there is a large, cir-
cular black spot on the anterior face. Ter-
gum II is entirely red, and III is red lat-
erally. Sterna I-III are red (except petiole
is black). The specimen is 21 mm long.

Variation. — Petiole length and color of
the gaster and legs vary in atropilosus. Fe-
male petiole length varies from 0.9 X to

1.1 X its apical width, but it is usually
slightly more than the distal width (ex-
ample ratios are 18:17, 19.5:17, 21:20).
Sometimes the dimensions are equal. In
the largest female studied, a specimen 27
mm long labeled Oran, the petiole is
slightly shorter than its width (ratio 21:24).
In smaller specimens from Oran the peti-
ole is as long as wide. Increasing body size
thus may be correlated with a shortening
of the petiole. The male petiole is longer
than wide (20.5:17.5, Oran; 20:14, Greece).

Gaster color in the female from Cher-
nozemel'sk is similar to the holotype, but
the red is limited to tergum I apically and
laterally and tergum III basolaterally. Red
is reduced in the Spanish females: narrow
strip along distal margin of tergum I, ter-
gum II laterally, and most of sternum II.
The Spanish male is similar, but addition-
ally has red laterally at the extreme base
of tergum III (M. Ohl in litt. to Menke says
tergum III is all black in Spanish males he
has studied). A female and male from
France are similar, but the red is more ex-
tensive in the female: tergum II all red,
and III red basolaterally. In the Greek
male red covers the sides of tergum I, all
of II, tergum III basolaterally, all of ster-
num II, and the basal half or so of sternum
III.

Legs are bicolored in females, but the
amount of black and red varies. The fe-
male from Russia is similar to the holo-
type, but the posterior surface of the for-
etibia is black. The midleg of one female
from Oran is black except for a small, cir-
cular amber spot at the femoral apex, and
the hind surfaces of the foreleg are dark.
In the Spanish females red is limited to the
apex of the fore- and mid femora anteri-
orly, and to the anterior surfaces of the
fore- and midtibiae. The legs are all black
in the French and Greek males.

Females are 18-27 mm, and males are
17-22 mm long.

Distribution. — Northern Mediterranean
region (except Italy) eastward to Kazakhs-

Volume 9, Number 2, 2000 331

tan. The species is uncommonly collected, worn away. In such cases association with
although locally abundant at times. males may offer the only reliable means of
Specimens mentioned above labeled identification (note however, that if long,
Oran, Algeria, may have been mislabeled erect setae are present but appressed setae
since the species has not been collected in are absent, it is likely that a specimen is
that country by modern workers (e.g., de not flavipennis). Females of flavipennis tend
Beaumont, Guichard, Roth); nor did col- to be larger than those oifunerarius (24—32
lectors of the 1890's find it (Saunders 1910, mm long versus 16-26 mm). Some females
Morice 1911). The only other record from of Sphex leuconotus have appressed white
Algeria is by Roth (1925) who saw a fe- setae on the thoracic dorsum but the pet-
male from Orleansville (now El Asnama) iole is shorter than wide or at most as long
dated 1867 in the Sichel Collection (Paris), as wide. Females of flavipennis have a pet-
iole that is longer than wide.
Sphex flavipennis Fabricius The appressed pale setae are less devel_

(rigs. 6-/) oped in males, but placoids are found

Sphex flavipennis Fabricius 1793:201. Lectotype: only on flagellomeres V-VI (rarely only on

female, "Italia" (Copenhagen), designated by VI), and they are narrow (Figs. 6-7). Infu-

van der Vecht 1961:31, not examined. nerarius, placoids are broad (Figs. 1-2) and

Sphex rufocinctus Brulle 1833:367. Holotype (or usually present on flagellomeres III-VIII

syntype): male, "Petalidi, Moree" [= Korone (but see that species for placoid variation).

or Koroni, Peloponnesus, Greece] (Paris), ex- Males of leuconotus have placoids on fla-

amined. New synonym. gellomeres IV- VI (Figs. 4-5).

Sphex bicolor Dahlbom 1845:437. Holotype: Females are 24-32 mm, and males are

male, "Dalmatia" [= coastal Croatia and 17_26 mm lone

Monteneerol (Berlin?), (junior primary horn- r> • i u j a. u

,~ ,J . . , ' v, . . K,„„r., - Previous workers have used other char-

onvm of Sphex bicolor Fabricius 1775), not ex- ■■,.<■ n ■ i i

, c . ix ui -loo-. ->r> i. acters to identifv flavipennis, but we have

amined. Svnonvmv bv Kohl 1881:39 who saw , , ,

Dahlbom's material (with maxillosus), and found them unreliable: yellow-tinted

Kohl 1890:236 (with flavipennis). wings and golden erect setae on the face.

Sphex cinereorufocinctus Dahlbom 1845:437. Svn- The erect facial setae are sometimes silver

types: male, "Rhodus" [= Rhodes, Greece] in flavipennis, and nearly always this color

(Lund), not examined. Synonymy by de in funerarius. The yellow tinted wings,

Beaumont 1949:127 who saw Dahlbom's ma- from which the species derives it name, is

terial. not a reliable recognition character for fla-

Sphex sellae Gribodo 1873:86. Holotype: female, vipennis because some funerarius also have

"Sicilia" [= Sicily, Italy] (Genova?), not ex- yellowish wings, although typically they

amined. Synonymy by Kohl 1890:236. are hghtlv brown stained. Several authors

Sphex flavipennis var. rufodorsatus De-Stefani have usecj comparative lengths of the pet-

1887:88, pi. 2, fig. 8. Holotype: female, "Sici- iole and hindtarsomere I or III to distin-

lia" [= Sicily, Italy] (Palermo?, Geneva? de- jsh females of flavi ms from finwrar.

stroyed?), not examined. Svnonvmv by Kohl • T. • i i .• i i '.i

1890-716 lus' 1S unc^ear h°w petiole length was

measured by these workers, but we have
Recognition. — The presence in most fe- been unable to find any useful differences,
males of appressed white setae on the Comparisons of the length and width of
pronotal collar and scutum identifies fla- the female petiole itself show nearlv the
vipennis and separates the species from the same parameters in both species (15 spec-
similar funerarius which lacks such pubes- imens of each species measured): flavipen-
cence. Unfortunately the appressed setae nis — petiole length is 1.1 to 1.4 X width; fu-
are poorly developed in some popula- nerarius — petiole length is 1.1 to 1.6X
tions, and in older material they are often length.

332

Journal of Hymenoptera Research

Hamon, Fonfria, and Tussac (1991) il-
lustrated two male characters that earlier
authors had used to separate flavipennis
and fun erarius: the form of the clypeal free
margin and the length of the lateral setal
brushes of sternum VII. These characters
are useful, but they are not always reli-
able. The clypeal free margin in flavipennis
is usually a simple arc, but sometimes
there is a shallow emargination that may
be broad or narrow. In funerarius the clyp-
eal free margin usually has a pronounced
emargination (see Fig. 10 in Hamon et al.
1991). The lateral setal brushes of male
sternum VII are shorter in flavipennis in
comparison to funerarius (see figs. 11-12 in
Hamon et al. 1991), but the reliability of
this character remains to be proven.

Type material. — Brulle's holotype (or
sole surviving syntype) of rufocinctus, a
male, has been studied by each of us on
two occasions. The specimen is poorly
preserved, very dirty, and badly worn.
The mandibles are truncated from consid-
erable use, and the setation of the clypeal
disk is worn away. The type has lost most
of its antennae; the scapes and pedicels re-
main, and the right antenna still has fla-
gellomeres I-II. Although the pronotum is
dirty, some silver appressed setae (one of
the characteristics of flavipennis) are faintly
visible. Traces of appressed silver setae
are also visible in the scutal furrows and
on the hindmargin of the scutellum. The
clypeal margin is not emarginate although
it is straight at the middle. The lateral setal
brushes on sternum VII are dirty, but the
setae are as short as in flavipennis (shorter
than in funerarius). The body length of 25
mm is also typical of male flavipennis. The
gaster is mostly black, but tergum II is red
except for a narrow, transverse dark band
along the distal margin, and tergum III is
red laterally. This color pattern is typical
of flavipennis. These characters convince us
that the type of rufocinctus is not conspe-
cific with funerarius (maxillosus of authors),
but instead is flavipennis Fabricius. The bi-

colored gaster indicates that rufocinctus is
not conspecific with leuconotus.

We have been unsuccessful in locating
the type material of bicolor Dahlbom, sellae
Gribodo, and rufodorsatus De-Stefani, and
have relied on Kohl (1890) for their syn-
onymy.

Variation. — Occasionally the thoracic
dorsum of female flavipennis has reddish
areas, a trait that immediately identifies
Mediterranean specimens as this species
(similar reddish areas are found on some
central Asian specimens of funerarius). De
Beaumont and Bytinski-Salz (1955) noted
that occasional Israeli females have an en-
tirely red thorax, but they occur with nor-
mally colored specimens. The thorax of
some females in Iran is also extensively
red (de Beaumont 1957). De Beaumont
(1960) noted a male from Cyprus with a
placoid only on flagellomere VI.

In a male of flavipennis from the Mashad
area, Iran (CAS), the lateral setal brushes
of SVII are longer than a midocellus di-
ameter. Four other males from Mashad
have typically short brushes.

Distribution. — Mediterranean region in-
cluding islands of Mallorca, Sardinia, Si-
cily, Crete, Rhodes and Cyprus; eastward
to Hungary, Bulgaria, and south-central
Asia (Kazakhstan, Uzbekistan, Tajikistan,
Turkmenistan); Arabia: United Arab Emir-
ates; Iran, Afghanistan.

Sphex funerarius Gussakovskij

(= Sphex maxillosus of authors before
1976, or rufocinctus of authors after 1975)

(Figs. 1-2)
Sphex maxillosus Fabricius 1793:208. Lectotype:
female, "Barbaria" [= northwest Africa] (Co-
penhagen), designated by van der Vecht
1961:30, (junior primary homonym of Sphex
maxillosus Poiret 1787).
Sphex obscurus Fischer de Waldheim 1843:122.
Syntypes: male, "in Rossia australi" (Mos-
cow, St. Petersburg, Dresden?), (junior pri-
mary homonym of Sphex obscurus Schrank
1802, and Sphex obscurus Fabricius 1804). Syn-
onymy with maxillosus by Kohl 1895:69. New
synonym.

Volume 9, Number 2, 2000

333

Sphex maxillosus var. pedibus nigris Zanon 1925:
90. Holotype: female, Fueihat, Libya (Geno-
va?) . Polynomial, not available, see Art. 11.4
of the Code.

Sphex funerarius Gussakovskij 1934:3. Lectotype:
male, [Bei-lung-shui,] S. Kansu [= Gansu],
China (Stockholm), here designated in order
to ensure the name's proper and consistent
application, examined. New synonym.

Sphex maxillosus ssp. mavromoustakisi de Beau-
mont 1947:383. Holotype: female, Polemidia
Hills, Cyprus (Lausanne), examined. New
synonym.

Sphex rufocinctus (misinterpretations since
1975): Lomholdt 1975:68 (Gotland I., Swe-
den); Bohart and Menke 1976:116 (listed, no-
menclature problems); Guichard 1978:270
(Greece); Richards 1979:400 (British Channel
Is.); Pagliano 1980:110 (Italy); Dollfuss 1983:2
(Austria); Mingo and Gayubo 1984:146
(Spain); Schmidt and Westrich 1983:120
(Greece); Gayubo 1984:356 (Portugal); Gayu-
bo and Tormos 1984:8 (Spain); Pagliano 1984:
367 (Italy); Chevin and Chevin 1985:38
(France); Eiroa and Novoa 1985:23 (Spain);
Jozan 1985:55 (Hungary), 76 (floral records),
83 (ecological and zoogeographic character-
istics); Pagliano 1985:12 (Italy); Tormos and
Jimenez 1985:32 (Spain); Westrich and
Schmidt 1985b:112 (Germany: endangered in
Baden-Wurttemberg); Gayubo 1986a:35
(Spain), 1986b:30 (Spain); Gayubo and Heras
1986:26 (Spain); Gayubo and Sanza 1986:27
(Spain); Gayubo and Tormos 1986a:8 (Spain),
1986b:4 (Spain); Islamov 1986:515 (Uzbeki-
stan); Asis and Jimenez 1987:23 (Spain); Ga-
yubo 1987:106 (Spain); Tormos and Jimenez
1987a:122 (Spain), 1987b:316 (Spain); Anders-
son et al. 1987:72 (endangered in Sweden);
Dollfuss 1987:18 (latest Austrian specimens
collected in 1952 and 1953); Schmidt and
Westrich 1987:358 (Germany); Chevin 1988:
14 (France); Dollfuss 1988:20 (Austria); Jan-
zon 1988:1 (Sweden); Karsai 1988:99 (Hun-
gary); Islamov 1989:49 (Uzbekistan: nest and
prey); Jacobs 1989:3 (Germany); Jozan 1989:
100 (Hungary); Asis, Gayubo, and Tormos
1990:240 (mature larva); Gayubo, Asis, and
Tormos 1990:9 (Spain); Jacobs and Oehlke
1990:122, 132 (German Democratic Republic:
not collected after 1960); Pagliano 1990:60 (in
catalogue of Italian Sphecidae); Day 1991 :xix
(summary of European Endangered Hyme-

noptera Lists); Dollfuss 1991:27 (in revision of
Austrian Sphecidae); Gayubo, Borsato, and
Osella 1991:392 (Italy); Gayubo and Torres
1991:Table I and p. 81 (Spain: effects of urban
pressure); Hamon, Fonfria, and Tussac 1991:
128, 131 (in key to French Sphecini), 132
(France); Jozan 1991:602 (Hungary); Kazenas
and Nasyrova 1991:38 (Kazakhstan); Negri-
solo 1991:316 (Italy); Schembri 1991:177 (pre-
vious records from Malta); Gayubo, Borsato,
and Osella 1992:275 (Greece, Turkey); Jozan
1992:171 (Hungary); Kazenas and Tobias
1992:29 (sleeping aggregations); Gayubo,
Tormos, and Asis 1993:308 (teratological
specimen); Torregrosa, Gayubo, Tormos, and
Asis 1993:11 (Spain); Luchetti 1993:10 (Italy:
Sardegna); Dollfuss 1994:98 (endangered in
Austria); Gayubo and Borsato 1994:199 (Ita-
ly); Tormos, Asis, and Gayubo 1994:187
(Spain); Jozan 1995:104 (Hungary); Krasno-
bayev et al. 1995:139 (Russia: Samara Ob-
last'); Negrisolo 1995:18, 22 (floral records);
Pagliano and Pesarini 1995:83 (Italy); Pagli-
ano and Scaramozzino 1995:731 (Italy);
Schmid-Egger, Risch and Niehuis 1995:208
(Germany); Vernier 1995:176 (in key); Gus-
enleitner 1996a:809 (Austria), 1996b:818 (Cro-
atia); Minoranskiy and Shkuratov 1996:81
(Russia: Rostov Oblast'); Schmid-Egger 1996:
19 (Germany); Schmid-Egger, Schmidt, and
Doczkal 1996:374, 378 (Germany: endan-
gered); Voblenko, Gorobchishin and Nester-
ov 1996:14 (Ukraine); Bitsch et al. 1997:71 (in
sphecid fauna of western Europe); Schmidt
and Schmid-Egger 1997:27 (in checklist of
German Sphecidae); Dollfuss, Gusenleitner,
and Bregant 1998:509 (Austria); Gonzalez,
Gayubo, and Torres 1998:72, 73 (Spain);
Zehnder and Zettel 1999:13 (Switzerland);
Gonzalez, Gayubo, and Torres 1999:334.

Recognition. — Sphex funerarius varies
over its extensive range, both in female
and male color and number of male an-
tennal placoids. Some females especiallv
can be difficult to separate from oxianus
and flavipennis. Males are easiest to iden-
tify because most specimens have broad
placoids on flagellomeres III-VIII (Fig. 2)
(males from Corsica are among the more
notable exceptions — see Variation below).
Only two other species have a placoid on

334

Journal of Hymenoptera Research

III: atropilosus and oxianus. However, the
erect setae on the head and thorax are
white or pale yellow in male fiinerarius,
while they are dark brown or black in atro-
pilosus. Most commonly males of fiinerar-
ius have a bicolored gaster in contrast to
the all black gaster of oxianus. Males of fii-
nerarius from China can have a black gas-
ter, but the presence of placoids on flagel-
lomeres III- VIII will separate them from
oxianus which has placoids only on III-VI
(Fig. 3) and is unknown from China.

The following are variable in the species,
but may aid in identification. The male
clypeal free margin usually has a pro-
nounced broad emargination in fiinerarius,
and is arcuate or shallowly emarginate in
flavipennis. However, exceptions in both
species weaken the usefulness of this dif-
ference. The lateral setal brushess on male
sternum VII are longer than a midocellus
diameter in fiinerarius, while in other spe-
cies the these are usually shorter than, or
about equal to a midocellus diameter.
However, there are also exceptions to this
character (see Variation under flavipennis).

The absence of appressed pale setae on
the pronotal collar and scutum separates
females of fiinerarius from flavipennis. Fe-
males of flavipennis typically have ap-
pressed silver setae on the thorax, but this
pubescence is often sparse or worn away.
Thus, association with males is often the
best way to identify females of both spe-
cies. As noted under flavipennis, female
petiole length is essentially identical be-
tween the two species. Females of fiiner-
arius usually have bicolored fore- and
midlegs, and the hindleg, except for the
tarsus, is usually black. However, red is
limited to the foretibial apex in some me-
lanic Chinese specimens. A similar leg
pattern is present in one Iranian female
seen by us, but, unlike the black Chinese
specimens, the gaster is bicolored. Females
of oxianus have entirely black legs, includ-
ing the tarsi.

Females are 16-26 mm, and males are
17-20 mm long.

Nomenclatural history. — This relatively
common Palearctic species was known as
Sphex maxillosus Fabricius 1793, for more
than 170 years. Then van der Vecht (1959:
214) pointed out that Fabricius' name was
a junior homonym of Sphex maxillosus
Poiret 1787, currently assigned to the ge-
nus Chlorion. He noted that unless Poiret's
name was suppressed, maxillosus Fabricius
would have to be replaced by the next
available synonym. Van der Vecht be-
lieved that to be leuconotus Brulle based
upon Dalla Torre's (1897) catalog, but that
is not true. Bohart and Menke (1976:116)
called the species rufocinctus Brulle 1833,
adopting the first of several synonyms of
maxillosus recognized by Kohl (1890:433),
even though Menke pointed out (footnote
23) that the type of rufocinctus appeared to
be a synonym of a different species, flavi-
pennis Fabricius. Menke urged European
workers to study the problem and clarify
the identity of Brulle's species. That action
has not been forthcoming, and, unfortu-
nately, nearly all contemporary authors
since 1976 have used rufocinctus as the
proper name for the invalid maxillosus Fa-
bricius. Our studies of the Brulle types es-
tablishes that none of his names, rufocinc-
tus, leuconotus, or triangulum, are available
for maxillosus Fabricius. Instead, the oldest
available name is fiinerarius Gussakovskij
1934.

Type material. — Gussakovskij (1934) list-
ed 15 males and 3 females of fiinerarius
from Bei-lung-shi, S. Kansu, China, 15- VI-
30, and 2 males from N. O. Szechuan, Chi-
na, 20-V-30, all collected by Dr. Hummel,
and also 3 males and a female from south-
ern Altai (Karasengir) [= Siberia], and one
male from Saissan [= Lake Zaisan, Ka-
zakhstan]. We have examined three male
and six female syntypes (Stockholm). All
but one male are labeled Kina [= China],
S. Kansu, Sven Hedins Exp. Ctr. Asien, Dr.
Hummel, and one male and one female
from Kansu have Gussakovskij's species
labels with the word "typus". One male
is labeled Kina, N. O. Szechuan, etc., and

Volume 9, Number 2, 2000 335

it also has a Gussakovskij label. We have ical color pattern of the species. Interme-

selected and labeled as lectotype the male diate leg color patterns are seen in four

from S. Kansu with Gussakovskij's "ty- females from Iran (CAS): the foretibia is

pus" label. We have also put paralectoty- black and red, and the midleg is all black

pe labels on the male and female that have except for an inner distal red spot on the

Gussakovskij labels. The three males have femur, and the tarsi are sometimes brown-

placoids on flagellomeres III-VIII and are ish (Elburz Mts.); or the foretibia is black

entirely black. The females are black ex- and red and the midtibia is reddish on its

cept the apical half of the foretibia which anterior surface only, and the midtarsus is

is brownish red. In one female the whole brownish (Khorasan). Another Iranian fe-

outer side of the foretibia is reddish. In male from Tilabad (USNM) has entirely

two females the inner apex of the forefe- black legs except for red on the anterior

mur is also reddish. surface of the foretibia.

Variation in placoid distribution. — In a se- In females of most populations of funer-
ries of papers de Beaumont (1960:229; arius, the gaster is red with a black apex
1961a:272; 1961b:45; 1967:276; 1970b:4) (segments IV-VI or V-VI typically). How-
studied variation in the number of pla- ever, the gaster may be all black in females
coids in western Palearctic males. He re- from eastern Kazakhstan, southern Sibe-
corded their distribution as follows: on ria, and the provinces of Sichuan and Gan-
flagellomeres III-VIII (most European su in China (sternum II pale laterally in
specimens, Fig. 2), but occasionally II-VIII some specimens from Gansu). The gaster
or III-VII; II-VIII or II-IX (Turkey); II-VIII is also all black in males from Siberia and
(Crete, Iran); II-IX (Afghanistan); II-VIII or Gansu, China. In females from Cyprus,
II-IX (Cyprus); and III-VI (Fig. 1), III-VII, the gaster (except the black petiole), fem-
or III-VIII (north Africa). Males from the ora and tibiae are red. This insular popu-
island of Corsica are exceptional in lacking lation was described as maxillosus mavrotn-
placoids on flagellomeres II and III (de oustakisi by de Beaumont (1947). We have
Beaumont 1960:229, also one male in examined the type series of mavromoustak-
CAS). On this island placoids are only isi (2 females, 3 males, from Cyprus), and
found on flagellomeres IV-VI, and we sus- do not feel that recognizing the subspecies
pect this to be the typical condition on that is warranted. The Corsican population, for
island. example, is as distinct based upon male

Color variation and subspecies. — Female antennal placoid distribution, and yet we

legs are bicolored throughout the range of also feel it needs no name.

funerarius, although the hindleg is often The thorax is typically all black in fu-

largely black. The following are common- nerarius, but it is partly red in a female

ly red: tibiae and tarsi of the fore- and from the Kopet-Dagh Mountains south of

midlegs and the hindtarsi (the midtibia Askhabad, Turkmenistan (CAS). The fol-

varies from all red to partially or wholly lowing are red in this specimen: pronotum

black). Sometimes the fore- and mid-fern- apicomesally and laterally, most of scu-

ora have red areas distally. However, the turn, scutellum, postscutellum and part of

legs are almost wholly black in females propodeal dorsum. Additionally only the

from Gansu, China (type series of funer- last gastral segment (VI) is black in this

arius) except for some reddish brown on specimen, and the inner side of the hind-

the forefemoral apex and inner side of the tibia is reddish.

foretibia. In one specimen of this series red Larva. — The mature larva of funerarius

occurs only on the inner apical half of the was described by Asis, Gayubo, and Tor-

foretibia. Specimens that we have seen mos (1990).

from other parts of China display the typ- Conservation. — Sphex funerarius was list-

336

Journal of Hymenoptera Research

ed as endangered in Austria, Germany,
and Sweden (summary in Day 1991, also
Andersson et al. 1987, and Janzon 1988).
Dollfuss (1987) reported that the last Aus-
trian specimens were collected in 1952 and
1953, and Jacobs and Oehlke (1990) noted
that no specimens were collected in the
former German Democratic Republic after
1960. One female, however, was found in
Austria in 1996 (Gusenleitner 1996a).
Schmid-Egger, Risch, and Niehuis (1995)
reported that the species was relatively
common in the upper Rhine area of Ger-
many in the 1950's and early 1960's, but
disappeared subsequently. However,
sightings of fiinerarius increased in the
states of Hessen, Baden- Wurttemberg, and
Rheinland-Palatinate. M. Ohl in lift, to
Menke says the species has also been
found recently in Bavaria. Janzon (1988)
noted that on the Swedish island of Got-
land funerarius occurs in open sandy areas,
often along the shore. Habitat overgrowth
is the main danger to populations of fu-
nerarius on this Baltic island.

Distribution. — Mediterranean Basin in-
cluding North Africa from Morocco to
Egypt. The Balearic Islands (Compte Sart
1959), as well as the islands of Corsica,
Sardinia, Sicily, Malta, Crete, and Cyprus.
Recorded from Jersey in the Channel Is.
(Richards 1979), but the species does not
occur on the British Isles proper. Most of
Europe north to Gotland I. and Faro I. in
the Baltic Sea but not in Sweden proper
(Andersson et al. 1987) and Poland; east-
ward to Hungary, Romania, Bulgaria, s.
Russia, Siberia (Krasnoyarsk), and south-
central Asia: Iran, Afghanistan, Uzbeki-
stan, Kazakhstan, Turkmenistan, Tajikis-
tan; n. China (Gansu, Sichuan, Nei Mon-
gol, Shandong, Liaoning).

Sphex leuconotus Brulle, new status

(Sphex afer of authors)
(Figs. 4-5)

Sphex leuconotus Brulle 1833:366. Holotype: fe-
male, "Petalidi, Moree" [= Korone or Ko-
roni, Peloponnesus}, Greece, (originally Par-

is, now lost). Neotype: holotype of Sphex
triangulum Brulle, present designation in or-
der to ensure the name's proper and consis-
tent use (Paris), examined.

Sphex triangulum Brulle 1833:365, pi. 50, fig. 6.
Holotype: female, "Petalidi, Moree" [= Ko-
rone or Koroni, Peloponnesus], "a la fin de
Mai", Greece (Paris), (junior primary hom-
onym of Sphex triangulum Villers 1789), ex-
amined. New synonym.

Sphex afer Lepeletier 1845:350. Lectotype: fe-
male, Oran, Algeria, designated by Menke in
Bohart and Menke 1976:114 (Paris). New syn-
onym.

Sphex sordidus Dahlbom 1845:436. Syntypes: sex
unknown, "Rhodus" [= Rhodes, Greece]
(Stockholm?). Regarded as subspecies of afer
by de Beaumont 1953:195. New synonym.

Sphex tristis Kohl 1885:200. Syntypes: male,
Spain (Wien). Synonymy with afer ssp. sordi-
dus by de Beaumont 1953:105. New syno-
nym.

Sphex plumipes Radoszkowski 1886:25, figs. 18a-
i. Holotype: male, Askhabad [Turkmenistan]
(Krakow), (junior primary homonym of
Sphex plumipes Drury 1773), examined. New
synonym.

Sphex pachysoma Kohl 1890:436. Syntypes: fe-
male, "Kilasi" and "Kuba Breku" [= Kilyazi
and Kuba, Azerbaijan?]; Cyprus; "Syra" [ =
Syros I., Greece] (Wien). Synonymy with tris-
tis by Dusmet and Mercet 1906:516, with afer
by Schulz 1911:68 and with afer ssp. sordidus
by de Beaumont 1953:195. New synonym.

Recognition. — The female and most
males of leuconotus can be recognized by
an unusually short petiole whose distal
width is usually greater than the length.
In occasional specimens the measure-
ments are equal. In 12 females measured,
the petiole width varied from 1.0X to 1.5X
its length, with the average being 1.2 X.
Some females have appressed white setae
on top of the pronotal collar. Traces of ap-
pressed white setae can also sometimes be
seen on the scutum. In the male, narrow
placoids are present on flagellomeres IV-
VI (Figs. 4-5).

Females are 25-34 mm, and males are
17-23 mm long.

Type material and synonymy. — Kohl

Volume 9, Number 2, 2000 337

(1890:433) synonymized triangulum Brulle dicate that his leuconotus was similar to Sa-
with Sphex maxillosus Fabricius, and Bo- vigny's figure. In any case, his description
hart and Menke (1976) listed it as a syno- of leuconotus agrees with afer sordidus.
nym of rufocinctus Brulle. The holotype (or Since the differences between leuconotus
the only surviving syntype) is actually and triangulum appear to represent age
identical with Sphex afer sordidus Dahlbom. differences of the specimens, and Brulle's
The specimen has the typical short petiole own feeling was that he would otherwise
of afer (ratio 24:19). The mid and hindfe- regard them as identical, we are certain
mora have long, erect setae on the upper, that leuconotus is conspecific with triangul-
outer, and lower surfaces. Tergum I of the um. Accordingly we have made the type
type is mostly black (apex red), and terga of triangulum the neotype of leuconotus
IV- VI are also black. Terga II-III are red. and have so labeled it.
The legs are black and the wings are yel- A result of the foregoing is that Sphex
lowish. The name triangulum Brulle is a ju- afer sordidus must now be called leuconotus
nior homonym. Brulle. According to de Beaumont (1953:
The next available name for this species 195), tristis Kohl and pachysoma Kohl are
is leuconotus Brulle which was collected at synonyms of sordidus. Thus they are new
the same locality as triangulum. We were synonyms of leuconotus Brulle s.s.
unable to find a type of leuconotus in Paris, We have also studied the male type of
and apparently it has been destroyed, plumipes Radoszkowski. It is labeled "plu-
Brulle stated that leuconotus and triangul- mosus" in Radoszkowski's handwriting,
um were very similar, differing primarily and agrees with his description, but the
in the form of the mandible and the seta- type lacks its antennae and the gastral
tion of the clypeus. His description of the apex, presumably lost when he extracted
mandible of triangulum suggests that he the genitalia (which are glued to a piece
had a female with mandibular wear com- of card mounted on the pin with the spec-
mon to old specimens, the result of much imen). Sphex plumipes was tentatively syn-
nest excavation, and this is confirmed by onymized with pachysoma (i.e., leuconotus)
examination of the holotype. The mandi- by Kohl (1890:436), whose interpretation is
bles are badly worn. Concurrent with such most likely correct. The type is all black
wear is the loss of clypeal setation, and with some appressed white setae on the
Brulle described the clypeus of triangulum collar, almost silvery scutal setae, and
as being largely devoid of setae. Brulle's slightly yellowish wings with a darker
specimen of leuconotus, on the other hand, apical band. This color combination is
must have been a fresh one, judging from found only in leuconotus and oxianus, but
his description. The mandible was long, the holotype's relatively short gastral pet-
and the clypeus was mostly covered with iole (length equal to 1.25X apical width)
setae. In his description of leuconotus, Brul- suggests leuconotus. In any case, Radosz-
le refered to plate 14, fig. 1, in Savigny's kowski's name is a junior homonym.
(1809-1829) Description de I'Egypte. The fig- Color variation and subspecies. — Gaster
ures on the plates from this work are re- color varies in females. Sometimes it is en-
markable for their time, but they were tirely red (Cyprus, Uzbekistan), or tergum
based on material from Egypt, and Sphex I may be black basally and IV-VI entirely
afer is not known from that country. The so (Cyprus, Spain, n.w. Africa). In Roma-
wasp shown in figure 1 has a short petiole nia the gaster may be all black (Scobiola
although it is longer than wide. The ac- 1960), and de Beaumont (1960:227) stud-
companying figure of the mandible shows ied a single female with a black gaster
an unworn one with a long, acuminate from eastern Libya and four females with
apex. Perhaps Brulle simply wanted to in- bicolored gasters from western Libya.

338 Journal of Hymenoptera Research

Males of leuconotus from northwest Af- Taxonomic history. — Spkex libycus was
rica have darker erect body setae than first described in detail by Roth (in Schul-
specimens from the northern Mediterra- thess 1926:210) who studied one female
nean and eastward, and the wings are from Agedabia in Cyrenaica, Libya, call-
smoky. The wings are clear in the eastern ing it "Sphex maxillosus var. tota nigra, alis
Libyan female mentioned above, and valde infumatis." He noted the all black
those from western Libya are less smoky body (except for partly dark red mandi-
than females from northwest Africa, bles), the dark body setation, and intense-
Those who would like to treat the north- ly infumate wings. De Beaumont (1956)
west African population as a subspecies recognized that Roth's wasp was a differ-
(an action we do not endorse) will have to ent species and gave it the name libycus.
call it leuconotus ssp. afer. Material examined. — We have seen three

Distribution. — Mediterranean region (ex- females and four males collected 64 km W

cept Egypt and known only from the Pyr- of Marsa Matruh, EGYPT, by Pulawski on

enees-Orientales Departement in France) 28-29 May 1993 (CAS, USNM).

including islands of Sardinia, Rhodes, and Distribution. — Known only from the

Cyprus; eastward to Bulgaria, Greece, northeast coast of Africa: northeastern

Turkey, Israel, Iraq, Iran, Afghanistan and Libya and northwestern Egypt,
the central Asian republics of Kazakhstan,

Turkmenistan and Uzbekistan. sPhex melas Gussakovskij

(Fig. 8)

Sphex libycus de Beaumont Sphex melas Gussakovskij 1930:207. Syntypes:

(Fig. 9) male, female, Repetek, Turkmenistan (St. Pe-
tersburg), not examined.

Sphex libycus de Beaumont 1956:182. Holotype: „ ... n , , . ,

r, , „ r, j- tl /^- ■\^ i Recognition. — Sphex melas is nearly

female, Porto Bardia, Libya (Zurich), not ex- ..,„.. • , • ,,

amined. Subsequent record: de Beaumont unique in the /7ni;/^nms group in being all

1960:227 (Libya, Egypt). black' including the wings, legs, and all

erect setae. Appressed silver setae are
Recognition and status. — This species is found only on the face of the male. Sphex
wholly black except for appressed silver libycus is the only similar species, but the
facial setae in both sexes. The wings are brown appressed facial setae of female me-
darkly infumate. The female hindfemur las separate it from libycus which has silver
has erect setae, and the male has placoids facial setae. Males of the two species can-
on flagellomeres V-VI (Fig. 9). Sphex liby- not presently be separated morphological-
cus is almost identical to melas Gussakov- ly. Other characters of melas include: no
skij, another all black species, and certain- silvery setae on pronotum, male with
ly the males cannot presently be separat- broad placoids on flagellomeres V-VI (Fig.
ed. The only difference in the females is 8, placoids narrower in flavipennis Figs. 6-
the color of the appressed facial setae: sil- 7), and lateral setal brushes of sternum VII
very in libycus and brown in melas. Erect markedly shorter than in funerarius.
hindfemoral setae are present on the pos- Females are 22-28 mm, and males are
teroventral edge in libycus, but in melas 15.5-17 mm long.

they may be present (Iranian female) or Some male specimens of Sphex funerar-

absent (Turkmen female). Much more ma- ius from the eastern part of its range (e.

terial of both species is needed to deter- Kazakhstan, s. Siberia, China) are all

mine if libycus is a valid species or merely black, as are males of oxianus and some

a geographic color form of melas. males of leuconotus. However, the erect

Females are 24-28 mm, and males are body setae are pale in these species, and

20-22 mm long. the wings are only slightly infumate.

Volume 9, Number 2, 2000

339

Material examined. — We have examined
topotypic material of melas (2 females, 4
males) determined by Gussakovskij (Mos-
cow, CAS, USNM), and also a female from
Hamadan, IRAN (CAS) and a female from
Imam Baba, TURKMENISTAN (USNM).

Distribution. — Turkmenistan and Iran.

Sphex oxianns Gussakovskij

(Fig- 3)

Sphex oxianus Gussakovskij 1928:3. Syntypes:
male, "Kara-tau mountains, right shore of
Amu-Darya, below Khiva" [Uzbekistan] (St.
Petersburg), not examined. Subseqent re-
cords: Gussakovskij 1930:208 (description of
female; Turkmenistan, Uzbekistan); Gussa-
kovskij 1933:273 (Iran); Gussakovskij 1935:
413 (Tadjikistan); de Beaumont 1960:170 (Af-
ghanistan); de Beaumont 1967:276 (Turkey);
de Beaumont 1968:156 (redescription); de
Beaumont 1969:81 (Turkey); de Beaumont
1970a:393 (Afghanistan); de Beaumont 1970b:
4 (Iran).

Sphex oxianus form nubilus de Beaumont 1968:
156. Holotype: female, Ein Gedi, Israel (W.
Schlaffle Collection, Kaiseraugst, Switzer-
land), not examined. Bohart and Menke
(1976:116) listed nubilus as a subspecies of ox-
ianus thus validating de Beaumont's name —
Article 45.6.4.1 of the Code, 4th edition
(ICZN, 1999). New synonym.

Recognition. — The entirely black legs, in-
cluding the tarsi, separates oxianus from
other species in the flavipennis group ex-
cept melas and libycus which are similarly
colored. However, oxianus has pale erect
setae on the head and thorax, unlike the
dark setation of melas and libycus. The fe-
male petiole is longer (length 1.6-2.0 X
width) than in the other species of the
group. For example: 0.6-l.Ox apical width
in leuconotus, 0.9-1.1 X apical width in atro-
pilosus, 1.1-1.4X apical width in flavipen-
nis, and 1.1-1.6X apical width in funerar-
ius. In the male, broad placoids are present
on flagellomeres III-VI (Fig. 3), the gaster
is all black, and the lateral setal brushes of
sternum VII are inconspicuous (shorter
than in funerarius).

Females of oxianus from the eastern

Mediterranean with an all black gaster can
be distinguished from the similarly col-
ored melas by the pale erect body setae.
Most females of oxianus have virtually no
erect setae on the mid- and hindfemora,
or setation is very sparse. In contrast, fe-
males of flavipennis and funerarius usuallv
have some erect setae on the mid- and
hindfemora, especially on the lower sur-
face. The femora of female leuconotus have
considerable erect setae.

Diagnostic characters given by Gussa-
kovskij (1928, 1930) are of little value be-
cause he compared the species to Sphex
pruinosus Germar rather than to a species
in the flavipennis group. De Beaumont
(1968) thought that oxianus differed from
flavipennis and funerarius (as maxillosus) in
being slenderer, in having a slightly lon-
ger female petiole, finer body sculpture,
and a female clypeus that is smooth and
shiny along the median line and next to
the clypeal lip. However, only the female
petiole length is useful.

Females are 19-29 mm and males are
14.5-22 mm long.

Material examined. — We have seen a
male and female identified by Gussakov-
skij as oxianus from TADJIKISTAN: Chan-
ghir and Kabadian (Menke, USNM), and
one female identified by Gussakovskij
from TURKMENISTAN: Krasnovodsk
(Menke). The following have also been
studied, all in the CAS: TURKEY: Urfa
(male, female); TURMENISTAN: Bahar-
den (3 females); TADJIKISTAN: Ramit,
Dushanbe, Khodzha, and Kondara Can-
yon (3 males, 4 females).

Variation. — Both Gussakovskij and de
Beaumont thought the female was char-
acterized by an entirely red gaster (exclud-
ing the petiole), although de Beaumont
saw an all black specimen from Israel (his
nubilus). De Beaumont (1969:81) noted a
female from Turkey in which gastral seg-
ments V-VI were black, the remainder red.
We have seen similar females from Urfa,
Turkey, and Baharden, Turkmenistan (all
CAS). The gaster and petiole are all red in

340

Journal of Hymenoptera Research

a female from Dushanbe, Tajikistan (CAS).
From this we conclude that the female
gaster varies from all red to all black in
oxianus.

Distribution. — Israel, Turkey, Iran, Af-
ghanistan, Uzbekistan, Turkmenistan, and
Tajikistan.

ACKNOWLEDGMENTS

We thank the following people for lending speci-
mens for our study: Michel Sartori, Musee Cantonal
de Zoologie, Lausanne, Switzerland, who lent the
type series of Sphex maxillosus mavromoustakisi de
Beaumont and helped us locate the holotype of nu-
bilis; Max Fischer, Naturhistorisches Museum, Wien,
Austria, who lent the type material of Sphex atrohirtus
Kohl; Lars-Ake Janzon, Naturhistoriska Riksmuseet,
Stockholm, Sweden, who lent syntypes of Sphex fu-
nerarius Gussakovskij and translated an essential part
of his 1988 paper from Swedish into English; Wal-
demar Celary, Instytut Systematyki i Ewolucji
Zwierzat, Krakow, Poland, who lent the type of Sphex
plumipes Radoszkowski; and Janine Casevitz-Weu-
lersse, Museum National d'Histoire Naturelle, Paris,
France, who lent the type material of Sphex triangul-
um Brulle and rufocintus Brulle. Guido Pagliano, Mu-
seo Regionale di Scienze Naturali, Torino, Italy, at-
tempted to locate the type material of Sphex sellae Gri-
bodo and Sphex flavipennis var. rufodorsatus De-Ste-
fani. He was unsuccessful, but we thank him for his
efforts.

Alexander Antropov, Zoological Museum of the
Moscow State University, Moscow, Russia, provided
us with material of Sphex melas Gussakovskij. Sever-
iano Gayubo, Universidad de Salamanca, Spain,
Maximilian Schwarz, Ansfelden, Austria, and Jacques
Hamon, Gaillard, France sent material of SpJiex atro-
pilosus Kohl.

Darrell Ubick, California Academy of Sciences, San
Francisco, California, assisted with scanning electron
photographs of the antennae. Vincent Lee California
Academy of Sciences, San Francisco, California; Mi-
chael Prentice, Albany, California; and Michael Ohl,
Zoologisches Museum der Humbolt Universitat, Ber-
lin, Germany, reviewed the manuscript for which we
extend our deepest appreciation.

LITERATURE CITED

(Dates in parentheses represent incorrect dates print-
ed on original publications)

Andersson, H., C.-C. Coulianos, B. Ehnstrom, O.
Hammarstedt, L. Imby, L.-A. Janzon, A. Linde-
low, and H.W. Walden, 1987. Hotade evertebra-
ter in Sverige — Threatened invertebrates in Swe-
den. Entomologisk Tidskrift 108:65-75.

Asis, J. D., S. F. Gayubo, and J. Tormos, 1990 (1989).
Preimaginal stages of Iberian Sphecidae V. Sphex
rufocinctus Brulle and Ammophila laevicollis Ed.
Andre (Hymenoptera, Sphecidae). Annates His-
torico-Naturales Musei Nationalis Hungarici 81:
239-244.

Asis, J. D., and R. Jimenez, 1987. Contribucion al con-
ocimiento de la esfecidofauna de la provincia de
Castellon. I. Sphecinae, Pemphredoninae, Asta-
tinae y Crabroninae (Hym. Sphecidae). Boleti'n de
la Asociacion Espanola de Entomologia 11:19-29.

Bajari, E., 1957. Magyarorszagi uj kaparodarzsak
(Hym. Sphecidae). Rovartani Kbzlemenyek 10:133-
144.

Balthasar, V., 1972. Grabwespen Sphecoidea. Fauna
CSSR 20, 471 p.

Benedek, P., 1968. A hazai kaparodarazsak (Hym.,
Sphecoidea) elohelyi viszonyai es viraglatogatasa —
The biotopes and the flower-visiting of the Hun-
garian Sphecoidea. Rovartani Kdzlentinyek (New
Series) 21:65-88.

Berland, L., 1952. Sur quelques Hymenopteres des
Pyrenees-Orientales dont un Sphex nouveau pour
la Fance. Vie et Milieu 3:87-89.

Berland, L. and F. Bernard, 1949 (1947). Les Sphex de
France. Annates de la Societe Entomologique de
France 116:1-16.

Bitsch, J., Y. Barbier, S. F. Gayubo, K. Schmidt, and
M. Ohl, 1997. Hymenopteres Sphecidae d'Europe
Occidentale, Volume 2. Faune de France 82:1^29.

Bohart, R. M., and A. S. Menke, 1976. Sphecid Wasps
of the World. A generic revision. University of Cal-
ifornia Press, Berkeley, Los Angeles, London. 1
color plate, ix + 695 p.

Brulle, A., 1832-1833. Expedition scientifique de Moree.
Section des sciences physiques. Tome III. Ire partie.
Zoologie. Deuxieme section. — Des animaux articules.
F.G. Levrault, Paris. 400 p. (1-288 = 1832; 289-
400 = 1833). Dating after Sherborn and Wood-
ward (1901:336).

Chaudoir, G., 1947. Captures d'Hymenopteres.
L'Entomologiste 3:142.

Chevin, H., 1988. Les Hymenopteres Sphecides du
department de la Manche. Memoires de la Societe
Nationale des Sciences Naturelles et Mathematiques
de Cherbourg 59 (1981-1985):13-19.

Chevin, H., and S. Chevin, 1985. Les Hymenopteres
Sphecides et Pompilides du Massif de la Clape
(Aude). Bulletin de la Societe Versaillaise des Sci-
ences Naturelles (4) 2:34-43.

Compte Sart, A., 1959. Sobre los esfecidos de Mallor-
ca. Graellsia 17:129-140.

Dahlbom, A. G., 1843-1845. Hymenoptera Europaea
praecipue borealia; formis typicis nonnullis Sped
erum Generumve Exoticorum nut Extraneorum prop-
ter nexum systematica-^ associatis; per Familias, Gen
era, Species et Varietates disposita atque descripta.
Tomus: Sphex in scnsu Linneano. Officina Lund-

Volume 9, Number 2, 2000

341

bergiana, Lund, xliv + 528 p. (fasc. 1:1-172, 1843;
fasc. 2:173-352, 1844, fasc. 3:353-528, i-xliv, ta-
bles, 1845). Dating after Menke (1974).

Dalla Torre, C. G. de, 1897. Catalogus Hymenopterorum
hucusquc descriptorum systematica et synonymicus,
Volumen VIII: Fossores (Sphegidae). Guilelmi En-
gelmann, Lipsiae. 749 p.

Day, M. C, 1991. Towards the conservation of acu-
leate Hymenoptera in Europe. Convention on the
Conservation of European Wildlife and Natural Hab-
itats, Nature and Environment Series 51:1-44, i-
xxxiii.

de Andrade, N. F., 1949. Esfecidos de Portugal (Hym.
Sphecidae). Memdrias e Estudos do Museu Zoolo-
gico da Universidade de Coimbra (194):l-27.

de Beaumont, J., 1947. Sphecidae (Hym.) de 1'ile de
Chypre. Mitteilungen der Schweizerischen Entomo-
logischen Geselhchaft 20:381-402.

de Beaumont, J., 1949. Synonymie de quelques espe-
ces de Sphecidae (Hym.). Mitteilungen der
Schweizerischen Entomologischen Gesellschaft 22:
127-128.

de Beaumont, J., 1951 (1949). Hymenopteres recoltes
par une mission Suisse au Maroc (1947) Spheci-
dae 1. Bulletin de la Societe des Sciences Naturelles
du Maroc 29:259-284.

de Beaumont, J., 1953. Notes sur quelques types de
Sphecidae decrits par A. G. Dahlbom (Hym.).
Opuscula Entomologica 18:193-198.

de Beaumont, J., 1956. Sphecidae (Hym.) recoltes en
Libye et au Tibesti par M. Kenneth M. Guichard.
Bulletin of the Britsh Museum (Natural History) En-
tomology 4(5):167-215.

de Beaumont, J., 1957. Sphecidae du nord de l'lran
(Hym.). Mitteilungen der Schweizerischen Entomo-
logischen Geselhchaft 30:127-139.

de Beaumont, J., 1960. Sphecidae (Hym.) recoltes en
Tripolitaine et en Cyrenai'que par M. Kenneth M.
Guichard. Bulletin of the British Museum (Natural
History) Entomology 9:219-251.

de Beaumont, ]., 1961a. Ergebnisse der Deutschen Af-
ghanistan-Expedition 1956 der Landessammlun-
gen fur Naturkunde Karlsruhe. Sphecidae (Hy-
menoptera). Beitrdge zur Naturkundlichen For-
schung in Siidwestdeutschland 19:271-276.

de Beaumont, J., 1961b. Sphecidae de 1'ile de Crete
(Hym.). Mitteilungen der Schweizerischen Entomo
logischen Gesellschaft 34:43-52.

de Beaumont, J., 1962. Contribution a l'etude des
Sphecidae d'Espagne (Hymenoptera). Eos, Revis
ta Espaiiola de Entomologia 38:17-40.

de Beaumont, J., 1965. Les Sphecidae de la Grece
(Hym.). Mitteilungen der Schweizerischen 1 ntomo
logischen Gesellschaft 38:1-65.

de Beaumont, J., 1967. Hymenoptera from Turkey.
Sphecidae, I. With appendix. Sphex Linne, sub-
genus Palmodes Kohl par P. Roth. Bulletin of the

Britsh Museum (Natural History) Entomology 19(5):
253-382.

de Beaumont, J., 1968. Sphecidae palearctiques nou-
veaux ou peu connus (Hym.). Mitteilungen der
Schweizerischen Entomologischen Gesellschaft 41:
145-168.

de Beaumont, J., 1969. Sphecidae de Turquie (Hym.).
Mitteilungen der Schweizerischen Entomologischen
Gesellschaft 42:79-95.

de Beaumont, J., 1970a (1969). Beitrage zur Kenntnis
der Fauna Afghanistans. (Sammelergebnisse von
O. Jakes 1963-1964, D. Povolny 1965, D. Povolny
& Fr. Tenora 1966, J. Simek 1965-66, D. Povolny,
J. Gaisler, Z. Sebek & Fr. Tenora 1967). Spheci-
dae, Hym. Acta Musei Moraviae 54 (Supplemen-
tum):385-406.

de Beaumont, J., 1970b. Sphecidae de l'lran (Hym.).
Stuttgarter Beitrage zur Naturkunde aus dem Staa-
tlichen Museum fur Naturkunde in Stuttgart (220):
1-18.

de Beaumont, J., and H. Bytinski-Salz, 1955. The
Sphecidae (Hymen.) of Erez Israel. I. (Subfam.:
Sphecinae, Nyssoninae; Trib.: Bembecini, Sti/mi).
The Bulletin of the Research Council of Israel, Section
B: Zoology 5:32-60.

De-Stefani, T., 1887. Un nuovo genere di Crabronidi
et altri imenotteri nuovi o poco cogniti raccolti
in Sicilia. // Naturalista Siciliano 6:59-62, 85-90,
110-114, 143-147, pi. II [incorrectly referred to as
pi. I in text).

Dollfuss, H., 1983. Catalogus Faunae Austriae. Ein sys-
tematischer Verzeichnis oiler auf bsterreichischem Ge-
biete festgestellten Tierarten. Teil XVII: Fam.: Sphe-
cidae. Verlag der Osterreichischen Akademie der
Wissenschaften, Wien. 32 p.

Dollfuss, H., 1987. Neue und bemerkenswerte Funde
von Grabwespen (Hymenoptera, Sphecidae) in
Osterreich. Linzer Biologische Beitrdge 19:17-25.

Dollfuss, H., 1988. Faunistische Untersuchungen uber
die Brauchbarkeit von Grabwespen (Hymenop-
tera, Sphecidae) als Umweltindikatoren durch
Vergleich neuer und alterer Aufnahmen von aus-
gewashlten Lokalfaunen im ostlichen Osterreich.
Linzer Biologische Beitrage 20:3-36.

Dollfuss, H., 1989. Verzeichnis der Grabwespentypen
am Naturhistorischen Museum in Wien (Hyme-
noptera/ Sphecidae). Kataloge der wissenschaftlich-
en Sammlungen des Naturhistorischen Museums in
Wien, Entomologie 7(4): 1-26.

Dollfuss, H., 1WI. Bestimmungsschlussel der Grab-
wespen Nord- und Zentraleuropa^ (llvmenop-
tera, Sphecidae) mil spe/iellen Angaben /ur
Grabwespenfauna Osterreichs. Stapfia 24:1-247.

Dollfuss, H., 1994. Rote Liste gefardeter Grabwespen
(Hymenoptera, Sphecidae), p. 95-104 in J. Gepp
(editor): Rote Listen gefahrdeter Tiere Osterreichs.
Gnine Reihe des Bundesministeriums tur I m-

342

Journal of Hymenoptera Research

welt, Jugend und Familie, volume 2. Styria Me-
dien Service, Graz. 355 p.
Dollfuss, H., J. Gusenleitner, and E. Bregant, 1998.
Grabwespen in Burgenland (Hymenoptera:
Sphecidae). Stapfia 55:507-552.
Dusmet, J. M., and R. G. Mercet, 1906. Los Sphex de
Espana. Boletin de la Real Sociedad Espanola de His-
toria Natural 6:500-517.
Eiroa, M. E., and F. Novoa, 1985. La entomofauna de
las dunas de la playa de Barra (Cangas, Ponte-
vedra), I: Hymenoptera, Aculeata. Boletin de la
Asociacion Espanola de Entomologia 9:15-30.
Fabricius, J. C, 1793. Entomologia systematiea emendata
et aucta. Secundum classes, ordines, genera, species
adjectis synonymis, locis, observationibus, descrip-
tionibus. Vol. 2. Christ. Gottl. Proft, Hafniae. VIII
+ 519 p.
Fischer de Waldheim, G., 1843. Observata quaedam
de Hymenopteris Rossicis. Magazin de Zoologie (2)
5:1-4, pi. 122.
Gayubo, S. F., 1984. Aportacion al conocimiento de
los esfecidos de El Algarve (Portugal) (Hymv
Sphecidae). Boletim da Sociedad Portuguesa de En-
tomologia 2:349-387.
Gayubo, S. F., 1986a. Notas sobre la esfecidofauna an-
daluza (Hymenoptera: Sphecidae). Trabajos y
Monografias del Departamento de Zoologia, Univer-
sidad de Granada (N.S.) 8:31-44.
Gayubo, S. F., 1986b. Fauna esfecidologica de la Prov-
incia de Zamora. I. Sphecinae, Pemphredoninae,
Astatinae y Larrinae (Hymenoptera: Sphecidae).
Anales de Biologia, Universidad de Murcia 7:27-35.
Gayubo, S. F., 1987 (1986). Fauna esfecidologica de la
Provincia de Ciudad Real. I. Sphecinae, Pem-
phredoninae, Astatinae y Larrinae. Graellsia 42:
103-119.
Gayubo, S. F., J. D. Asis, and J. Tormos, 1990 (1989).
Nuevos datos sobre la esfecidofauna iberica II
(Hymenoptera: Sphecidae). Eos, Revista Espanola
de Entomologia 65:7-21.
Gayubo, S. F., and W. Borsato, 1994 (1991). Contri-
bucion al conocimiento de la esfecidofauna ital-
iana (Hymenoptera: Sphecidae). Bollettino del
Museo Civico di Storia Naturale di Verona 18:195—
225.
Gayubo, S. F., V. Borsato, and G. Osella, 1991 (1988).
Esfecidos Italianos de la Coleccion del Museo
Civico de Historia Natural de Verona (Italia). Bol-
lettino del Museo Civico di Storia Naturale di Verona
15:383^24.
Gayubo, S. F., V. Borsato, and G. Osella, 19^2 (1989).
Esfecidos palearticos de la collection del Museo
Civico de Historia Natural de Verona (Italia)
(Hymenoptera: Sphecidae). Bollettino del Museo
Civico di Storia Naturale di Verona 16:269-294.
Gayubo, S. F., and C. Heras, 1986. Esfecidofauna de
las areas de Cuellar y Segovia (Provincias de Se-

govia y Valladolid). Hymenoptera: Sphecidae.
Acta Salamanticensia 78:1-105.
Gayubo, S. F., and F. Sanza, 1986. Esfecidofauna de
la margen derecha de la cuenca alta del Duero
(Hymenoptera: Sphecidae). Acta Salamanticensia,
Serie Vana 74:1-115.
Gayubo, S. F., and J. Tormos, 1984. Nuevas aportaciones
al conocimiento de la esfecidofauna valenciana (Hytn.,
Sphecidae). Publica Fundacion Entomologica "Juan
de Torres Sala", Serie Hymenoptera, Cuaderno 1.
Valencia, title page, 35 unnumbered p.
Gayubo, S. F., and J. Tormos, 1986a. Notas sobre la
esfecidofauna de Castellan de la Plana (Hytn., Sphe-
cidae). Publica Fundacion Entomologica "Juan de
Torres Sala", Valencia, Serie Hymenoptera,
Cuaderno 3. Valencia. 22 p.
Gayubo, S. F., and J. Tormos, 1986b. Nuevas aporta-
ciones al conociemiento de la esfecidofauna valenciana
{ID (Hym., Sphecidae). Publica Fundacion Ento-
mologica "Juan de Torres Sala", Serie Hymenop-
tera, Cuaderno 2. Valencia. 9 p.
Gayubo, S. F., J. Tormos, and J. D. Asis, 1993. Tera-
tologias in esfecidos ibericos
(Hymenoptera, Sphecidae). Fragmenta Entomologica
24:307-311.
Gayubo, S. F., and Torres, F., 1991. Efecto de la pre-
sion urbana sobre abejas y avispas (Hymenop-
tera, Aculeata). IV. Sphecidae. Boletin de la Socie-
dad Espanola de Historia Natural (Seccion Biologia)
87:73-92.
Gonzalez, J. A., S. F. Gayubo, and F. Torres, 1998.
Diversidad y abundancia de esfecidos (Hyme-
noptera, Sphecidae) en un sector arenoso de la
Submeseta Norte (Espana). Boletin de la Real So-
ciedad Espanola de Historia Natural 94:71-85.
Gonzalez, J. A., S. F. Gayubo, and F. Torres, 1999.
Estudio comparativo de la biodiversidad de es-
fecidos colectados mediante trampa Malaise en
un sector arenoso de la cuenca de Duero (Es-
pana) (Hymenoptera: Sphecidae). Nouvelle Revue
d'Entomologie (Nouvelle Serie) 15:351-370.
Gribodo, G., 1873. Contribuzioni alia fauna imenot-
terologica italiana. Bollettino delta Societa Entomo-
logica Italiana 5:73-87.
Guichard, K. M., 1978. Additions to the Greek wasp
fauna (Hymenoptera: Sphecidae). Annates Musei
Goulandris 4:267-272.
Gusenleitner, J., 1996a. Hymenopterologische Noti-
zen aus Osterreich - 6 (Insecta: Hymenoptera
aculeata). Linzer Biologische Beitrage 28:809-816.
Gusenleitner, J., 1996b. Kurzbericht iiber Sphecinae in
Istrien (Croatia) (Hymenoptera, Sphecidae). Lin-
zer Biologische Beitrage 28:817-819.
Gussakovskij, V. V., 1928. Novyie vidy Sphecidae iz
Zakaspiya i Khivy— Sphecidarum species novae.
Izvestii/a kursov Prikladnoy Zoologii I Fitopatologii
(= Bulletin de I'Institut de Zoologie Appliquee et de
Phytopathologie) 4:3-19.

Volume 9, Number 2, 2000

343

Gussakovskij, V. V., 1930. Novyie i malo izvestnyie
vidy rodov Ammophila Kby. I Sphex L. (Hyme-
noptera, Sphecidae) — Species novae vel parum
cognitae generum Ammophila Kby. et Sphex L.
(Hymenoptera, Sphecidae). Russkoye Entomologi-
cheskoye Obozreniye 24:199-211.

Gussakovskij, V. V., 1933 (1932). Sphecidae i Psam-
mocharidae (Hymenoptera), sobrannyie N. Za-
rudnym v vostochnoy Persii — Sphecidae et
Psammocharidae (Hymenoptera), a cl. N. Zarud-
nyi in Persia orientali collectae. Trudy Zoologis-
cheskogo Instituta Akademii Nauk SSSR (= Travaux
de I'Institut Zoologique de I'Academie des Sciences de
I'URSS) 1:369-404 (misprinted as 269-304).

Gussakovskij, V. V., 1934. Schwedisch-Chinesische
Wissenschaftliche Expedition nach den nordwes-
tlichen Provinzen Chinas unter Leitung von Dr.
Sven Hedin und Prof. Sii Ping-Chang. Insekten
gesammelt vom Schwedischen Arzt der Expedi-
tion Dr. David Hummel 1927-1930. 41. Hyme-
noptera. 6. Sphegidae. Arkiv for Zoologi 27A(21):
1-15.

Gussakovskij, V. V., 1935. K faune os (Hymenoptera,
Sphecodea et Vespodea) Tadzhikistana — Sphe-
codea und Vespodea von Tadjikistan. Trudy Tad-
zhikskoy Bazy Akademii Nauk SSSR (= Travaux de
la Filiate de I'Academie des Sciences de I'URSS au
Tadjikistan) 5:409-467.

Hamon, J., 1950. Quelques Hymenopteres vespifor-
mes rares pris dans le Pyrenees-Orientales.
L'Entomologiste 6:28-29.

Hamon, J., R. Fonfria, and M. Tussac, 1991. Les Sphe-
cini de France continentale et de Corse (Hyme-
noptera: Sphecidae). Especes presentes et cles
d'identification. Bulletin de la Societe Entomolo-
gique de France 96:125-134.

Internationa] Commission on Zoological Nomencla-
ture, 1999. International Code of Zoological Nomen-
clature. Fourth Edition adopted by the International
Union of Biological Sciences. The International
Trust for Zoological Nomenclature, London.
XXIX + 306 p.

Islamov, Sh. D., 1986. Royushchiye osy (Hymenop-
tera, Sphecidae) gornykh rayonov Uzbekistana —
Digger-wasps (Hymenoptera, Sphecidae) in the
mountainous regions of Uzbekistan. Entomologi
cheskoye Obozreniye 65:513-534. [English transla-
tion: 1987. Digger-wasps (Hymenoptera, Spheci-
dae) of the mountainous regions of Uzbekistan.
Entomological Review 66:35-59.)

Islamov, Sh. D., 1989. Royushchiye osy (Hymenop-
tera, Sphecidae) okhotyashchyesya za pryamok-
rylymi nasekomymi v zapadnom Tian-Shane.
Uzbekskiy Biologicheskiy Zhurnal 5:49-50.

Jacobs, H. J., 1989. Ein Verzeichnis der bisher in
Mecklenburg nachgewiesenen Grabwespenarten
(Hymenoptera, Sphecidae). Natur und Natur-
schutz in Mecklenburg-Vorpommem 28:2-36.

Jacobs, H. J., and J. Oehlke, 1990. Beitrage zur Insek-
tenfauna der DDR: Hymenoptera: Sphecidae. 1.
Nachtrag. Beitrage zur Entomologie 40:121-229.

Janzon, L.-A., 1988. Status och skydd av rovstekeln
Sphex rufocinctus. Inventeringar 1987. Lansstyrel-
sen i Gotlands Lan, Naturvdrdsfunktionen 1988:1-6.

Jozan, Z., 1985. Del-Dunatul kaparodarazs (Hyme-
noptera, Sphecoidea) faunajanak alapvetese —
Grundriss der Sphecoidea-Fauna (Hymenoptera)
des Siid-Transdanubiens, Ungarn. A Janus Pan
nonius Mtizeum Evkonyve 29:53-86.

Jozan, Z., 1986. The Scolioidea and Sphecoidea Fauna
of the Kiskunzag National Park. The Fauna of the
Kiskunsdg National Park, p. 365-381.

Jozan, Z., 1989. A Tihanyi Tajvedelmi Korzet fullan-
kos faunaja (Hymenoptera, Aculeata), I — Aculea-
ta-Fauna (Hymenoptera) des Landschaftschutz-
gebietes von Tihany, Ungarn, I. Folia Musei His-
torico-Naturalis Bakonyiensis 8:79-110.

Jozan, Z., 1991. The Scolioidea, Sphecoidea and Apoidea
fauna of the Bdtorliget Nature Reserves (Hymenop-
tera: Aculeata), p. 601-621 in S. Mahunka (editor):
The Batorliget Nature Reserves — after forty
years. Vol. 2. Magyar Termeszettudomanyi Mu-
zeum, Budapest, p. 499-848

Jozan, Z., 1992. A Boronka-melleki Tajvedelmi Korzet
fullankos hartyasszarnyu (Hymenoptera, Acu-
leata) faunajanak alapvetese — Grundriss der
Aculeaten-Fauna (Hymenoptera) des Land-
schaftschutzgebietes Boronka-melleki, Ungarn.
Dundntuli Dolgozatok Termeszettudomanyi Sorozat
7:163-210.

Jozan, Z., 1995. Adatok a tervezett Duna-Drava Ne-
mzeti Park fullankos hartyasszarnyu (Hymenop-
tera, Aculeata) faunajanak ismeretehez — Beitrage
zur Kenntnis der Aculeatenfauna (Hymenoptera)
des Nationalparkes Duna-Drava (Ungarn, Siid-
Transdanubien). Dundntuli Dolgozatok Termeszet-
tudomanyi Sorozat 8:99-115.

Karsai, I., 1988. Ecofaunistical investigations of sphe-
roid fauna on a sandy grassland. Acta Biologica
(Szeged) 34:97-106.

Kazenas, V. L., 1978. Royushchiye osy Kazakhstana i Sred
ney Azii (Hymenoptera, Sphecidae). Opredelitel'—The
digger zoasps of Kazakhstan and Middle Asia (Hyme-
noptera, Sphecidae). The determinant. Izdatektvo
Nauka Kazakhskoy SSR, Alma Ata. 172 p.

Kazenas, V. L., and S. R. Nasyrova, 1991. Royushchi-
ye osy (Hymenoptera, Sphecidae) — vragi pry-
amokrylykh (Orthoptera) v pustvnnov zone Ka-
zakhstana [ Digger wasps (Hymenoptera,
Sphecidae) as predators of Orthoptera in the de-
sert zone of Kazakhstan]. Izvestiya Akademii Nauk
Kazakhskoy SSR. Seriya Biologicheskaya 6:37-40.

Kazenas, V. I .. and V. I robias, L992 Nochevochnyie
skopleniya royushchikh os (Hymenoptera, Sphe-
cidae) v yugo-vostochnom Kazakhstane — Night
sleeping aggregations oi digger wasps (Hvme

344

Journal of Hymenoptera Research

noptera, Sphecidae) in southeastern Kazakhstan.
Entomologicheskoye Obozreniye 71:28-31.

Kohl, F. F., 1881. Sphegidologische Studien. Ueber ei-
nige Dahlbom'sche Sphexarten. Entomologische
Nachrichten 7:27-31, 37-40, 53-56, 90-94, 239-244.

Kohl, F. F., 1885. Die Gattungen der Sphecinen und
die palaarktische S/?/;ex-Arten. Termeszetrajzi Fiiz-
etek 9:154-207, pi. VII-VIII.

Kohl, F. F., 1890. Die Hymenopterengruppe der Sphe-
cinen. I. Monographie der naturlichen Gattung
Sphex Linne (sens. lat.). Annalen des k. k. Natur-
historischen Hofmuseums 5:77-194, 317-462., pi.
VIII-XII,

Kohl, F. F., 1895. Zur Monographie der naturlichen
Gattung Sphex Linne. Annalen des k. k. Naturhis-
torischen Ho/museums 10:42-74, pi. IV-V.

Krasnobayev, Y., P., A. V. Antropov, I. V. Lyubvina,
and S. I. Zabelin, 1995. Fauna bespozvonochnykh
Zhiguley [= Invertebrates of Zhiguli Hills, Eu-
ropean Russia]. V. Otryad Hymenoptera (Insec-
ta). Samarskaya Luka 6:123-144.

Leclercq, J., 1955. Hymenoptera Sphecoidea (Sphecidae I.
Subfam. Sphecinae). Exploration du Pare National
de I'Upemba, fasc. 34. 137 p.

Leclercq, J., 1956. Mission E. Janssens et R. Toilet en
Grece (Juillet-aout 1953). 14e Note. Hymenop-
tera— Sphecidae et Vespidae. Bulletin & Annates
de la Societe Entomologique de Belgique 92:324-326.

Lepeletier de Saint Fargeau, A., 1845. Histoire naturelle
des Insectes. Hymenopteres, Vol. 3. Librairie Ency-
clopedique de Robert, Paris. 646 p., pi. 25-36.

Lomholdt, O., 1975. The Sphecidae (Hymenoptera) of
Fennoscandia and Denmark. Faufia Entomologica
Scandinavica 4(l):l-224.

Luchetti, D., 1993. Lista preliminaria degli Imenotteri
dell'arcipelago della Maddalena (Sardegna). Bol-
lettino della Societa Entomologica Italiana 125:103-
108.

Melo, G. A. R., 1999. Phylogenetic relationships and
classification of the major lineages of Apoidea
(Hymenoptera), with emphasis on the crabronid
wasps. Scientific Papers, Natural History Museum,
The University of Kansas (14):l-55.

Menke, A. S., 1974. The dates of publication of A.G.
Dahlbom's Hymenoptera Europaea, vol. 1. Pol-
skie Pismo Entomologiczne 44:315-317.

Mingo, E., and S. F. Gayubo, 1984 (1983). Sphecidae
de Espaha. I. Ampulicinae y Sphecinae (Hym.).
Eos, Revista Espafwla de Entomologia 59:137-164.

Minoranskiy, V. A., and A. V. Shkuratov, 1996. K fau-
ne royushshikh os (Hymenoptera, Sphecidae)
Rostovskoy oblasti. [= On the sphecid fauna of
Rostov Oblast', Russia]. Izvestiya Vysshikh Uch-
ebnykh Zavedeniy. Severo-Kavkazskiy Regyon.
Estestvennyie nauki 1996(4):80-83.

Morice, F. D., 1911. Hymenoptera Aculeata collected
in Algeria. The Sphegidae. (Being Part V of the
work commenced by the late Edward Saunders,

F. R. S., in Trans. Ent. Soc. 1901, p. 515.). Trans-
actions of the Entomological Society of London 1911:
62-135.

Negrisolo, E., 1991 (1990). Hymenoptera Sphecidae e
Scoliidae raccolti nel Friuli-Venezia Giulia e nel
Veneto orientale. Gortania, Atti del Museo Friulano
di Storia Naturale 12:313-327.

Negrisolo, E., 1995. The aculeate communities (Hy-
menoptera Aculeata) of two coastal areas of the
Veneto region (northeastern Italy). Lavori, cieta
Veneziana di Scienze Naturali 20:15-25.

Padr, Z., 1989. Sphecoidea, p. 165-171 in J. Sedivy
(editor): Enumeratio Insectorum Bohemoslovak-
iae. Acta Faunistica Entomologica Musei Natiorudis
Pragae. 194 p.

Pagliano, G., 1980. Fauna imenotterologica delle
Langhe. (Nota faunistica II — Sphecidae). Rivista
Piemontese di Storia Naturale 1:105-135.

Pagliano, G., 1984. Sphecinae italiani (Hymenoptera:
Sphecidae). Parte I. Bollettino, Museo Regionale di
Scienze Naturali, Torino 2:359-370.

Pagliano, G., 1985. Sphecinae italiani (Hymenoptera:
Sphecidae). Parte II. Bollettino, Museo Regionale di
Scienze Naturali, Torino 3:5-27.

Pagliano, G., 1990. Catalogo degli Imenotteri italiani.
II. — Sphecidae. Bollettino, Museo Regionale di
Scienze Naturali, Torino 8 (1): 53-141.

Pagliano, G., and F. Pesarini, 1995. Nota preliminare
sugli imetotteri sfecidi della provincia di Ferrara
(Hymenoptera Sphecidae). Quaderno della Stazio-
ne Ecologica del Museo Civico de Storia Naturale di
Ferrara 8:81-95.

Pagliano, G., and P. Scaramozzino, 1995. Hymenop-
tera Gasteruptiidae, Ichneumonidae e Aculeata
(esclusi Chrysidoidea, Mutillidae e Formicidae),
p. 723-738 in B. Massa (editor): Arthropoda di
Lampedusa, Linosa e Pantelleria (Canale di Si-
cilia, Mar Mediterraneo). // Naturalista Siciliano 19
(Supplement).

Pulawski, W. }., 1978. Nadsem. Sphecoidea, p. 173-279
in G. S. Medvedev (editor): Opredelitel' naseko-
mykh evropeyskoy chasti SSSR, Tom III. Perepon-
chatokrylyye, Pervaya chast' [= Keys to the iden-
tification of insects of the European USSR, Vol.
3, part 1]. Nauka, Leningrad. 584 p.

Radoszkowski, O., 1886. Faune Hymenopterologique
Transcaspienne. Horae Societatis Entomologicae
Rossicae 20:3-56, pi. I-XI.

Richards, O. W., 1979 (1978). The Hymenoptera Acu-
leata of the Channel Islands. Report ami Transac-
tions, La Societe Guernesiaise 1978:389^124.

Roth, P., 1925. Les Sphex del'Afrique du Nord. An-
nates de la Societe Lutomologique de France 94:365-
404.

Salmon, K. A., 1929. The external morphology of Pep-
sis elegans Lepeletier (Hymenoptera: Psammo-
charidae). Transactions of The American Entomo-
logical Society 55:119-153.

Volume 9, Number 2, 2000

345

Saunders, E., 1910. Hymenoptera Aculeata collected
in Algeria by the Rev. Alfred Edwin Eaton, M.
A., F. E. S., and the Rev. Francis David Morice,
M. A., F. E. S. Part IV. Descriptions of new
Sphegidae. Transactions of the Entomological Soci-
ety of London 1910:517-531.

Savigny, M. J. C. L. de, 1809-1829. Description de
I'Egypte, on recueil des observations et des recherches
qui ont ete fades en Egypte pendant I'expedition de
Varmee francaise, public par les ordres de sa Majeste
I 'Empereur Napoleon le Grand. Vol. 1, Part 4, Ex-
plication sommaire des Planches. Insectes [by J- V.
Audouin], p. 187-202 [1826]. See Tollitt (1986) for
details about this work.

Schembri, S., 1991. Sphecids [sic] wasps of the Mal-
tese Islands. A review (Hymenoptera Sphecidae).
Bollettino della Societa Entomologica Italiana 122:
175-184.

Schmid-Egger, C, 1996. Neue oder bemerkenswerte
siidwestdeutsche Stechimmenfunde. BeinbiX 7:
18-21.

Schmid-Egger, C, S. Risch, and O. Niehuis, 1995. Die
Wildbienen und Wespen in Rheinland-Pfalz (Hy-
menoptera, Aculeata). Verbreitung, Okologie
und Gefahrdungsituation. Fauna und Flora in
Rheinland-Pfalz Beiheft 16:1-296.

Schmid-Egger, C, K. Schmidt, and D. Doczkal, 1996.
Rote Liste der Grabwespen Baden-Wiirttembergs
(Hymenoptera: Sphecidae). Natur und Laudschaft
71:371-380.

Schmidt, K., and Ch. Schmidt-Egger, 1997. Kritisches
Verzeichnis der deutschen Grabwespen (Hyme-
noptera, Sphecidae). Mitteilungen der Arbeitsge-
meinschaft Ostivestfdlisch-Lippischer Entomologen
13, Beiheft 3:1-35.

Schmidt, K., and P. Westrich, 1983. Beitrag zur Kennt-
nis der Grabwespenfauna Nord-Griechenlands
(Hymenoptera, Sphecidae). Nachrichtenblatt der
Bayerischen Entomologen 32:118-126.

Schmidt, K., and P. Westrich, 1987. Stechimmen (Hy-
menoptera: Aculeata) des Mainzer Sandes und
des Gonsenheimer Waldes. Mainzer Naturwissen
schaftliches Archiv 25:351-107.

Schulthess, A., 1926. Contribution a la connaissance
de la faune des Hymenopteres de l'Afrique du
Nord. Deuxieme Partie — Fossores (en collabora-
tion avec P. Roth). Bulletin de la Sociite d'Histoire
Nat ii relic de l'Afrique du Nord 17:206-220.

Schulz, W. A., 1911. Grabwespen-Tvpen Tourniers,
Brulles, Lepeletiers und Schencks. Societu> I ///<>
mologica 26:57-59, 63-64, 67-68.

Scobiola, X., 1960. Les especes de Sphex l.inne et Am-
mophila Kirby (Hymenoptera, Sphecidae) de la
faune de la Republique Populaire Roumaine.
Travuiix du Museum d'Histoire Naturelle Grigore
Antipa 2:229-239.

Sherborn, C. D., and B. B. Woodward, 1901. Dates of
publication of the zoological and botanical por-

tions of some French voyages. — Part II. Ferret
and Galinier's 'Voyage en Abyssinie'; 'Lefebvre's
'Voyage en Abyssinie'; 'Exploration scientifique
de l'Algerie'; Castelnau's 'Amerique du Sud';
Dumont d'Urville's 'Voyage de 1' Astrolabe'; La-
place's 'Voyage sur la Favorite'; Jacquemont's
'Voyage dans I'lnde'; Trehouart's 'Commission
scientifique d'lslande'; Cailliaud, 'Voyage a Mer-
oe'; 'Expedition scientifique de Moree'; Fabre,
'Commission scientifique du Nord'; Du IVtit
Thouars, 'Voyage de la Venus'; and on the dates
of the 'Faune Francaise.' Annals and Magazine of
Natural History (7) 8:161-164, 333-336, 491-194.

Shkuratov, A. V., 1998. Dopolneniya k faune royush-
chikh os (Hymenoptera, Sphecidae) Rostovskoy
oblasti. Izvestiya Vysshikh Uchebnykh Zavedeniy.
Sevew-Kavkazskiy Regyon. Estestvennyie Nauki 3:
97-99.

Tollitt, M. E., 1986. Dates and authorship of the text
volumes of the Histoire Naturelle section of Sa-
vigny's Description de I'Egypte. A. N.(S.) 2515.
The Bulletin of Zoological Nomenclature 43:107-111.

Tormos, J., J. D. Asfs, and S. F. Gayubo, 1994. Espe-
cidofauna [sic] de la Provincia de Albacete (Hy-
menoptera: Sphecidae). Al-Basit. Revista de E^tu
dios Albacetenses 20:183-246.

Tormos, J., and R. Jimenez, 1985. Contribucion al con-
ocimiento de la esfecidofauna de la Provincia de
Alicante (Hym. Sphecidae). Mediterranea (Serie de
Estudios Biologicos) 8:29-15.

Tormos, J., and R. Jimenez, 1987a. Esfecidos de la
Provincia de Valencia (Hym., Sphecidae). Gracll-
sia 42:121-130.

Tormos, J., and R. Jimenez, 1987b. Estudio compara-
tive de la esfecidofauna de la Dehesa de El Saler
(Hymenoptera, Sphecoidea). Eos, Revista Espanola
de Entomologia 62:315-318.

Torregrosa, S. G., S. F. Gayubo, J. Tormos, and J. D.
Asfs, 1993. Esfecidos de la provincia de Alicante
(Hymenoptera: Sphecidae). Boletin de la Asocia-
cion Espanola de Entomologia 17:9-25.

van der Vecht, J., 1959. Notes on aculeate Hymenop-
tera described in the period 1758-1810. Part III.
Entomologische Berichten 19:211-215.

van der Vecht, J., 1961. Hymenoptera Sphecoidea Fa-
briciana. Zoologische Verhandelingen 4S:l-85.

Vernier, R., 1995. Isodontia mcxicana (Sauss.), un Sphe-
cini americain naturalise en Suisse (Hymenop-
tera, Sphecidae). Mitteilungen do Schweizerischen
Entomologischen Gesellschafi 68 169 177.

Voblenko, A. S., V. A. Gorobchishin, and M. A. Nes-
terov, 1996. Digger wasps (Hymenoptera, Sphe-
cidae) of Ukrainian Polesye. Sphecos 30:14-15.

Westrich, P., and K. Schmidt, 1985. Role Liste der Ste-
chimmen Baden-Wiirttembergs (I [ymenoptera
Aculeata ausser Chrysididae) (Stand 1. 1. 1985).
Verqffentlichungen fur Naturschutz und land
schaftspflege in Baden-Wurttemberg 59-60:93- 120.

346 Journal of Hymenoptera Research

Zanon, V., 1925. Contribute) alia conescenza della fau- Zehnder, G., and J. Zettel, 1999. Auensukzession un

na entomologicha di Bengasi. Memorie della Pout. Zonation im Rottensand (Pfynwald, Kt. VS). I.

Accademia delle Science Nuovi Lincei (2) 8:61-100. Wiederbesiedlung einer Uberschwemmungsfla-

Zavadil, V., and ]. Snoflak, 1948. Kutilky (Sphecidae) che durch Grabwespen (Hymenoptera, Spheci-

Ceskoslovenske Republiky. Entomolgicke Prirucky dae). Mitteihtiigen der Schweizerichen Entomolo-

Entomologickych Listit (13):1-179. gischen Gesellschaft 72:123-137.

J. HYM. RES.
Vol. 9(2), 2000, pp. 347-351

Didineis massaica, New Species, the First Afrotropical Member of

the Genus, and Redescription of Didineis nigricans Morice, 1911

(Hymenoptera: Apoidea: Crabronidae: Bembicinae)

WOJCIECH J. PULAWSKI

Department of Entomology, California Academy of Sciences, Golden Gate Park, San Francisco,
California 94118, USA, e-mail: wpulawski@calacademy.org

Abstract. — Didineis massaica Pulawski, new species, is the first member of the genus known
to occur in subsaharan Africa. It can be recognized by its all black gaster and proportions of the
flagellomeres. The type series was collected 27 km SSE of Naivasha in the Rift Valley Province of
Kenya. Didineis nigricans Morice, 1911, from Algeria is redescribed.

Didineis is a genus of 26 currently
known species (Bohart and Menke 1976,
Guichard 1990). Of them, 17 are Palearctic
(ranging from Great Britain to Japan, and
from Denmark to Algeria, Turkey, and
Turkmenistan), 7 are Nearctic (Pennsyl-
vania to Florida, Washington to Baja Cal-
ifornia, extending south to Nuevo Leon
State in Mexico), 1 is Neotropical (Cuba
only), and 1 Oriental (Bengal). During a
recent expedition to Kenya, Jere S. Schwei-
kert and I collected a series of specimens
of a previously unknown species, the first
to be found in subsaharan Africa. Didineis
nigricans Morice, a little known species
from Algeria, is redescribed as a byprod-
uct of this study.

The family group names used in the ti-
tle are based on Menke (1997) and Melo
(1999). The morphological terminology
follows Bohart and Menke (1976).

Didineis massaica Pulawski, new
species

Derivation of name. — Massaica is a Neo-
latin feminine adjective derived from the
Massai people of Kenya in whose tribal
area this species was collected.

Diagnosis. — Didineis massaica differs
from most of its congeners in having an
all black gaster (rather than red at least

basally). The only other Didineis with an
all black gaster are: barbieri (de Beaumont),
bucharica Gussakovskij, the male of latro
(de Beaumont), nigricans Morice (terga
somewhat reddish apically), orientalis
Cameron, sibirica Gussakovskij, and tur-
anica Gussakovskij. Of these species, I
have seen only the holotype of nigricans
and one male of latro, but they can be dis-
tinguished from massaica by the characters
detailed below following the original de-
scriptions of Cameron (1897), de Beau-
mont (1967, 1968), and Gussakovskij
(1937), Tsuneki's (1968) description of Di-
dineis sibirica nipponica, and the key by Ne-
mkov (1995):

Didineis barbieri from Algeria (female unknown)
has flagellomere I and IX about 1.3 x and
less than 1.0 X as long as wide, respectively.
In massaica, these ratios are about 2.0 and 1.0
respectively.
Didineis bucharica from Uzbekistan (female un-
known) has flagellomeres I-III somewhat ex-
panded laterally, and flagellomeres III and IV
no longer than wide. In the male of massaica,
the respective flagellomeres are cylindrical
and longer than wide.
Didineis latro from Turkey has a black scape,
appressed tergal setae, and no tergal fasciae.
In massaica, the scapal venter is yellow, ter-
gum I bears several erect setae laterally, and
at least tergum I has a broadly interrupted
setal fascia.

348

Journal of Hymenoptera Research

Figs. 1-6. Didineis species: 1-3, Didineis massaica: 1, male clypeus. 2, apical male flagellomeres. 3, propodeal
enclosure. 4-6, Didineis nigricans: 4, male clypeus. 5, apical male flagellomeres. 6, propodeal enclosure.

Didineis nigricans from Algeria (female un-
known) has an obtusely tridentate clypeal
free margin (Fig. 4) and flagellomere I about
as long as wide. In the male of massaica, the
clypeal free margin is evenly arcuate and fla-
gellomere I is about 2.0 X as long as wide.

Didineis orien talis from Bengal (female un-
known) has yellow markings on the tegula
and tibiae, whereas such markings lack in
massaica.

Didineis sibirica from Eastern Siberia and Japan

has female flagellomeres abotit 2.0 x as long
as wide, and male flagellomeres I and IX
about 1.5 X as long as wide, respectively. In
massaica, female flagellomeres II and IX are
about 2.5 X and 1.5 X as long as wide, re-
spectively, and male flagellomeres I and IX
are about 2.0 and 1.0 X as long as wide, re-
spectively.
Didineis turanica (female unknown) has the me-
dian and penultimate flagellomeres longer
than wide, forefemur with ventral margin

Volume 9, Number 2, 2000

349

somewhat flattened, and foretibia slightly
broader apically than near the midlength. In
the male of massaica, flagellomeres VIII and
IX are about as long as wide, the forefemur
is not flattened (ventral margin evenly arcu-
ate), and the foretibia is not broadened api-
cally.

Description. — Frons finely, evenly punc-
tate, punctures less than 1 diameter apart
(averaging more than 1 diameter apart on
interocellar area and between ocelli and
orbits). Pronotum with no transverse ca-
rina. Mesoscutum evenly punctate, punc-
tures about 1 diameter apart. Mesopleu-
ron dull, punctate (punctures less than 1
diameter apart except more posteroven-
trally), without well-defined ridges poster-
oventrally. Propodeal enclosure narrow,
acutely angulate apically (Fig. 3); side ir-
regularly ridged, apicolateral spine well
defined, as in lunicornis Fabricius (the type
species of the genus). Tergal punctures
well defined.

Mesopleural setae in female denser be-
low scrobal sulcus than on remaining sur-
face, almost forming a discrete patch. Ter-
gum I with apical, broadly interrupted se-
tal fascia (also II and III in one of the males
examined). Tergum I laterally with erect
setae (some setae on remaining terga also
erect).

Head, thorax, and gaster black (includ-
ing flagellum and pronotal lobe), but man-
dible yellowish red mesally, scapal venter
pale yellow, and tegula dark brown in one
of the males. Femora black in female ex-
cept forefemur reddish brown ventrally
and apically; in male forefemur reddish
brown except dorsum black in basal half,
midfemur reddish brown except dorsum
black, and hindfemur all black or with
brownish outer surface. Tibiae reddish
brown, mid- and hindtibiae darkened api-
cally. Tarsi dark brown. Wing membrane
slightly infumate, with darker fascia that
covers all marginal cell, distal portion of
submarginal I, all of submarginal II, distal
part of discoidal II, an area of varying

width distad of discoidal II, and in female
submarginal III.

9 — Clypeus uniformly, closely punctate
except impunctate and shiny anteromesal-
ly (impunctate area about as long mesally
as basal punctate area); free margin tri-
dentate. Length of flagellomere II about
2.5 x width, of flagellomere IX about 1.5
X width. Dorsoexternal hindtibial setae
suberect, shorter setae interspersed with
longer ones.

6 — Clypeus uniformly, closely punc-
tate, free margin nearly straight mesally
(Fig. 1). Scape not concave laterally. Fla-
gellomeres I-X cylindrical (flagellomere X
with usual apicoventral expansion); dorsal
length of I about 2.0 X apical width, equal
to that of II whose length is about 1.7 x
width, following articles progressively
shorter, VIII and IX about as long as wide;
flagellomere XI markedly curved, with
sharp apex (Fig. 2). Foretibia and foretar-
sus not widened.

Records. — Holotype: 6\ Kenya: Rift Val-
ley Province, 27 km SSE Naivasha at
0°54.6'S 36°31.0'E, 3 June 1999, W.J. Pu-
lawski and J.S. Schweikert (California
Academy of Sciences). Paratypes: same
data and depository (1 9,2 6).

Didineis nigricans Morice

(Figs. 4-6)

Didineis nigricans Morice, 1911:111, 6. Holo-
type: 6, Algeria: Biskra (Oxford University
Museum). — Gussakovskij, 1937: 616 (original
description copied, discussion of characters);
R. Bohart and Menke, 1976:459 (listed).

This distinctive species is known from a
single specimen collected more than 100
years ago that has never been reexamined
since the original description. The latter
omits some important structures (e.g., the
shape of the propodeal enclosure) and in-
accurately depicts some structures (e.g.,
"clypeus evidenter tridentatus").

Diagnosis. — The male of nigricans can be
immediately recognized by its obtusely
tridentate clypeal free margin (Fig. 4) and
by the proportions of the flagellomeres

350

Journal of Hymenoptera Research

(flagellomere I about as long as wide, II
about 1.5 X as long as wide, VIII and IX
as long as wide).

Description. — Frons finely, evenly punc-
tate, punctures about 1 diameter apart
(several diameter apart on interocellar
area and between ocelli and orbits). Pron-
otum without transverse carina. Mesos-
cutum evenly punctate, punctures aver-
aging about 2 diameters apart. Mesopleu-
ron dull, somewhat irregularly punctate,
with punctures no more than 1 diameter
apart except episcrobal area shiny, with
punctures more than 1 diameter apart,
without well-defined ridges posteroven-
trally. Propodeal enclosure somewhat
broadened and not acutely angulate at
apex (Fig. 6); side irregularly ridged, api-
colateral spine slightly shorter than in {un-
icornis. Tergal punctures well defined, but
markedly smaller on tergum I than on re-
maining terga.

Gastral terga without setal fasciae. Ter-
gum I laterally with erect setae.

Head, thorax, and gaster black (includ-
ing flagellum and pronotal lobe), but man-
dible reddish mesally and scapal venter
reddish brown, and apical depressions of
terga reddish from certain angles. Femora
reddish brown (hindfemur somewhat
darkened basally), tibiae and tarsi reddish.
Wings membrane slightly infumate, with
marginal cell, submarginal cell II, and dor-
soapical portion of discoidal cell II mini-
mally darker.

6. — Clypeus uniformly, closely punc-
tate, free margin obtusely tridentate mes-
ally (Fig. 4). Scape not concave laterally.
Flagellomeres I-X cylindrical (flagellomere
X with usual apicoventral expansion); dor-
sal length of I about equal to apical width
and equal to 0.75 of II (whose dorsal
length is 1.5 X apical width); III-VII be-
coming gradually shorter, VIII and IX as
long as wide; flagellomere XI markedly
curved, with apex sharp (Fig. 5). Foretibia
and foretarsus not widened.

Collecting date.— -29 May 1898.

Material examined. — Only the holotype
was seen.

ACKNOWLEDGMENTS

I sincerely thank Jere S. Schweikert (California
Academy of Sciences, San Francisco, California) for
helping collect the specimens, Christopher O'Toole
(Oxford University Museum, Great Britain), for lend-
ing the holotype of Didineis nigricans, Virginia Kirsch
(San Francisco), for generating the illustrations, and
E. Eric Grissell (Systematic Entomology Laboratory,
USD A, Washington, D.C.), Arnold S. Menke (Am-
mophila Research Institute, Bisbee, Arizona) and Mi-
chael A. Prentice (Albany, California) for reviewing
an earlier version of the manuscript.

LITERATURE CITED

Bohart, R.M., and A.S. Menke. 1976. Sphecid Wasps of
the World. A generic revision. University of Cali-
fornia Press, Berkeley, Los Angeles, London. 1
color plate, IX + 695 pp.

Cameron, P. 1897. Hymenoptera Orientalia, or con-
tributions to a knowledge of the Hymenoptera of
the Oriental Zoological Region. Part VI. Memoirs
and Proceedings of the Manciiester Literary & Phil-
osophical Society 41 (4):l-28, pi. 16.

de Beaumont, J. 1967. Hymenoptera from Turkey.
Sphecidae, I. With Appendix. Sphex Linne, Sub-
genus Pahnodes Kohl par P. Roth. Bulletin of the
British Museum (Natural History). Entomology 19:
253-382.

de Beaumont, J. 1968. Sphecidae palearctiques nou-
veaux ou peu connus (Hym.). Mitteilungen der
Schweizerischen Entomologischen Gesellschaft 41:
145-168.

Guichard, K.M. 1990. New Sphecidae from South
Spain (Hymenoptera, Sphecidae). Entomofauna
11:273-280.

Gussakovskij, V.V. 1937. Obzor palearkticheskikh vi-
dov rodov Didineis Wesm., Pison Latr. i Psen Latr.
(Hymenoptera Sphecodea) — Especes palearc-
tiques des genres Didineis Wesm., Pison Latr. et
Psen Latr. (Hymenoptera Sphecodea). Trudy
Zoologicheskogo Instituta Akademii Nauk SSSR ( =
Travaux de 1'lnstitut Zoologique de 1'Academie des
Sciences de 1'USSR) 4:599-698, pi. 1.

Melo, G.A.R. 1999. Phylogenetic relationships and
classification of the major lineages of Apoidea
(Hymenoptera), with emphasis on crabronid
wasps. Scientific Papers. Natural History Museum.
The University of Kansas 14:1-55.

Menke, A.S. 1997. Family-group names in Sphecidae
(Hymenoptera: Apoidea). journal of Hymenoptera
Research 6:243-255.

Morice, F.D. 1911. Hymenoptera aculeata collected in
Algeria. The Sphegidae (Being I'art V of the work
commenced by the late Edward Saunders, F.R.S.,

Volume 9, Number 2, 2000 351

in Trans. Entomol. Soc, 1901, p. 515). The Trans- Setchatokrylyie, skorpionnitsy, perqjonchatokrylyie.

actions of the Entomological Society of London 1911: Chast' 1. Nauka, Sankt-Peterburg. 604 + 2 un-

62-135. numbered pp.
Nemkov, P.G. 1995. Podsem. Nyssoninae, p. 445^166 Tsuneki, K. 1968. Descriptions and records of some

in P.A. Lehr (editor). Opredelitel' nasekomykh fossorial wasps in Japan (Hym., Sphecidae). Eti-

Dal'nego Vostoka Rossii i> shesti tomakh. Tom IV. zenia 27:1-8.

J. HYM. RES.
Vol. 9(2), 2000, pp. 352-362

A Revision of Entomosericus Dahlbom 1845 (Hymenoptera: Apoidea:
"Sphecidae") with Description of a New Species

Christian Schmid-Egger
Flemingstr. 10, D-10557 Berlin, Germany, e-mail: schmideggC@aol.com

Abstract. — Entomosericus Dahlbom, 1845, is a palearctic genus with three species: E. haiiseri
Schmid-Egger, new species, from Israel, Jordan and southern Turkey, E. kaufinani Radoszkowski
from southern-central Asia, and E. concinnus Dahlbom from eastern and southern Mediterranean
area, Ukraine and Russia. E. concinnus rufescens de Beaumont is synonymized with E. concinnus
(new synonym). A key to species identification is presented. A lectotype of E. kaufinani is desig-
nated. Gastral color is determined unsuitable for distinguishing species.

Entomosericus Dahlbom, 1845, is a pa- Handlirsch 1888), while females from the

learctic genus of three species. Bohart and mainland Greece have red terga I and II.

Menke (1976) and Menke (1997) placed it Later, he (1967) reported two females of the

in its own subfamily because they could species from Turkey with red basal terga,

not associate it with any other sphecid considering the presence of E. kaufinani in

group. Kazenas and Alexander (1993) sug- the western Palaearctic to be doubtful,

gested a relationship to the clade of Nys- My own studies confirmed the obser-

soninae (now Bembecinae sensu Menke vations of de Beaumont (1965, 1967). Ad-

1997), Philanthinae and Astatinae based ditionally, a new species from the eastern

on larval characters. Melo (1999) finally Mediterranean area was found. Sternal

proposed a relationship to the Pemphre- and antennal characters allow males to be

doninae. He considered Entomosericus as a reliably distinguished and the geographi-

sister subtribe to the Psenini (sensu Bohart cal distribution of the species to be delin-

and Menke 1976). eated. Females of the species remain dif-

Two species of Entomosericus have been ficult to distinguish and require compari-

described: £. concinnus Dahlbom, 1845, from son with determined material to be iden-

the Greek island Rhodos and E. kaufinani tified.

Radoszkowski, 1877, from central Asia. In Sources of material. — Specimens from the

current keys, the two species have been pri- following institutions were examined (ab-

marily distinghuished through color. breviations used are given):

According to Balthasar (1972), all of the Arens coll. Werner Arens, Bad

terga are black in E. concinnus while the Hersfeld, Germany

first two or three terga are red in E. kaufi- CAS California Academy of Sci-

mani. Pulawski (1978) also described the ences, San Francisco, Cali-

respective form of antennal flagellomere fornia, USA

XI as a distinguishing character. Hartmann coll. Peter Hartmann, Bay-

De Beaumont (1965) noted a broad geo- reuth, Germany

graphic variation in color and punctation in Hauser coll. Martin Hauser, Univ.

these species. He noted that all males of £. Illinois, Urbana, USA

concinnus from Rhodos, Corfu, mainland MCZL Musee Cantonal der Zoolo-

Greece, and Croatia have black terga (also gie, Lausanne, Switzerland

Volume 9, Number 2, 2000

353

NHMW Naturhistorisches Museum,
Wien, Austria

Niehuis coll. Oliver Niehuis, Mar-
burg, Germany

OLL Oberoesterreichisches Lan-

desmuseum, Linz, Austria

SE coll. Christian Schmid-Eg-

ger, Berlin, Germany

SMNS Staatliches Museum fur Na-

turkunde, Stuttgart, Germany

ZMHB Zoologisches Museum der
Humbold-Universitat, Ber-
lin, Germany

ZMUM Zoological Museum of the
Moscow State University

ZSM Zoologische Staatssammlung,

Muenchen, Germany

Technical terms. — The morphological ter-
minology employed in this paper follows
Bohart and Menke (1976).

KEY TO SPECIES OF ENTOMOSERICUS

Males

1. Flagellomere XI shovel-like, flattened (ventral surface is concave), narrower than more
based flagellomeres, curved downwards (Fig. 3). Middle flagellomeres with ill-defined
lateral tyloids (Fig. 3). Sternum VIII nearly flat, without lateral thickening, with long setae
(Fig. 7). Inner (transparent) appendix of gonostylus twice as wide as outer (opaque) ap-
pendix, the latter with long setae (Fig. 6). Disk of sternum II with evanescent punctures
that are 4-6 diameters apart, sternal surface shiny, unsculptured. Central Asia

kaufmani Radoszkowski

- Flagellomere XI excavated beneath, nearly as wide as more basal flagellomeres. Flagellom-
eres with well-defined central tyloids (Fig. 1, 2). Sternum VIII uneven, with lateral thick-
ening, asetose or with short setae (Fig. 10, 11). Inner (transparent) appendix of gonostylus
half as wide as outer (opaque) appendix (Fig. 4), the latter asetose. Disk of sternum II with
more densely arranged punctures that are 0.5-3 diameters apart. Eastern and southwest
Mediterrean area 2

2. Flagellomeres VIII-XI reddish. Lateral thickening of sternum VIII with an oval concavity
(Fig. 11). Sternum II unsculptured between punctures, with short setae. Tyloids on flagel-
lomeres VII-VIII well-defined, flagellomere VI with pointed tyloid, flagellomere IX with
ill-defined lateral tyloid (Fig. 1). At least tergum I red (southern Turkey to Israel, northwest
Africa) or terga black (Europe to Turkey). France?, eastern Mediterranean area, southwest
central Asia, northwest Africa concinnus Dahlbom

- Flagellomeres black. Lateral thickening of sternum VIII evenly convex (Fig. 10). Sternum
II microsculptured between punctures, nearly asetose. Tyloids on flagellomeres VII-VIII
smaller, flagellomeres VI and IX both with a minute, ill-defined tyloid (Fig. 2). Terga black.
Southern Turkey, Israel, Jordan hauseri Schmid-Egger, new species

Females

1. Shiny area between lateral ocellus and eye extending to eye margin (Fig. 12). Clypeal free
margin with five distinct teeth, median teeth prominent, distinctly larger than lateral teeth
(Fig. 15). Sternum II with fine and scattered, similary sized punctures, that are many di-
ameters apart. Terga I and II red. Central Asia kaufmani Radoszkowski

- Shiny area between lateral ocellus and eye smaller, and not extended to eye margin, or
absent (Fig. 13, 14). Medial teeth of the clypeal free margin less prominent, not distinctly
larger than lateral teeth (figs 16, 17). Sternum II with uneven sized punctures that are
unevenly distributed and about 1-3 diameters apart. Terga I and II red or black. Eastern
and southwest Mediterrean area 2

2. Shiny area between lateral ocellus and eye essentially absent (Fig. 14). Gaster black. Punc-
tation of sternum II denser than in concinnus, punctures 0.5-1.5 diameters apart. Surface

354

Journal of Hymenoptera Research

of sterna more densely microsculprured, not shiny. Tergum II without a distinct step, or
edge, at the base of the apical tergal depression. Apical tergal depression of tergum II

markedly broader medially. Southern Turkey, Israel, Jordan

hanseri Schmid-Egger, new species

Shiny area between lateral ocellus and eye larger, about as large as lateral ocellus (Fig. 13).
Gaster red basally (at least tergum I red in specimens from southern Turkey, Israel, Jordan)
except all black in specimens from Rhodos Island (Greece) and western Turkey. Punctures
of sternum II less dense arranged, separeted by 1-3 diameters, interspaces shiny. Tergum
II usually with a distinct step, or edge, at the base of apical tergal depression. France?,
eastern Mediterranean area, southwest central Asia, northwest Africa . . concinnus Dahlbom

Entomosericus Dahlbom

Entomosericus Dahlbom 1845: 486. Type
species Entomericus (sic) concinnus Dahl-
bom 1845, by monotypy. Spelled Entho-
tnosericus by Dahlbom, 1845, on Tabula
Examinationis Synoptica Generum Nys-
sonidarum.

Entomosericus hauseri Schmid-Egger,
new species

(Figs. 2, 4, 5, 9, 10, 14, 16, 18)
Diagnosis and discussion. — The male of
Entomosericus hauseri is easily distin-
guished from concinnus by its different
form of sternum VII. Also, the tyloids and
setae of last sternum differ from those of
concinnus. The female closely resembles
concinnus, but punctures are denser than
in that species. Also, both sexes are differ-
ent in color from concinnus in the areas
where they occur sympatrically. £. hauseri
is black, while concinnus has red terga.
Only in Turkey might black males of both
species occur together.

Male. — 9-11 mm. Body black, tarsal seg-
ments and lateral parts of tergum I red-
dish. Head densely punctate, including
area on each side of lateral ocellus (cf. Fig.
14). Clypeal free margin with five small
teeth, outer tooth minute, nearly rounded.
Inner margin of eye and clypeus with long
setal fascia. Face with long erect setae. An-

tenna black, with small, oblong tyloids on
venter of flagellomeres VII-VIII and point-
form tyloids on flagellomere VI and IX
(Fig. 2). Tyloids smaller and less distinct
than in concinnus. Thorax and upper part
of head with long silver setae. Thorax in-
cluding scutellum and propodeum dense-
ly punctate, interspaces shiny. Lower me-
sopleuron inpunctate, shiny. Gaster and
legs only with short setae. Terga I and II
without microsculpture, punctures 0.1-1
diameters apart. Terga III-VII rugulose.
Sterna microscopially punctate, interspac-
es microsculprured, sterna II and III with
dense, coarse punctation, punctures 0.1-1
diameters apart. Disk of sternum II of
smaller specimens nearly unsculptured.
Sternum VIII: Fig. 10. Setal fascia at distal
margin of sterna III and IV small, setae
very thin and short (half as long as in con-
cinnus). Sterna VI and VIII (in profile) with
very short, erect setae (Fig. 9). Genitalia:
Figs. 4, 5. Inner translucent appendix of
gonostylus half as wide as outer (opaque)
appendage. Wing venation and stigma
dark brown, costal venation yellowish,
wing membrane slightly darkened, yel-
lowish-brown.

Female. — 9-10 mm. Body black, with
apex of tergites, sides of tergum I and tar-
sal segments slightly reddish. Punctures
denser and larger than in concinnus. Head

li^s. 1-6. Entomosericus spp., male. 1-3, antenna! flagellum; a: ventral view; b: lateral view. 1, E. concinnus.
2, E. hauseri. 3, E. kaufmani. 4-6, gonostylus, lateral view. 4, /.'. hauseri. 5, E. hauseri. 6, /.'. kaufmani.

Volume 9, Number 2, 2000

355

2b 3a 3b

356

Journal of Hymenoptera Research

IV U

— -~^^

V\N^^W%

„,/<'^

#*iD

Figs. 7-17. Entomocericus spp. 7-9, male sterna VI-
VID, lateral view. 7, E. kaufmani. 8, £. concinnus. 9, E.
hauseri. 10-11, sterna VII-VIII, ventral view. 10, E.
hauseri. 11, E. concinnus. 12-14, punctation of female
between eye (left) and lateral ocellus. 12, E. kaufmani.
13, E. concinnus. 14, E. hauseri. 15-17, clypeal free mar-
gin of female. 15, E. kaufmani. 16, E. hauseri. 17, E.
concinnus.

densely punctate, including area on each
side of lateral ocellus (Fig. 14). Clypeus
basally minutely, densely punctate, api-
cally with longitudinal ridges (Fig. 16).
Scutellum smooth and shiny basally,
coarsely, longitutionally ridged apically.
Punctures of tergum 1 1-2 diameters apart,
without punctures on disk. Punctures of
terga II-V 2-3 diameters apart, punctures
half as wide as in concinnus. Tergum II
without a distinct step, or edge, at the base
of the apical tergal depression. Apical ter-
gal depression of tergum II markedly

broader medially. Punctures of sternum II
2-3 diameters apart. Sterna II-VI finely
and densely microsculptured, basolateral
corner finely, densely punctate. Wings ve-
nation dark brown, wing membrane
slightly darkened.

Habitat. — In northern Israel, hauseri was
found in the Mediterranean climate area
with limestone substrate. The specimens
were flying near the ground in grass on
small paths and were collected by sweep-
ing plants. There were unused fields and
cattle pasture nearby.

Etymology. — The species is dedicated to
Martin Hauser, a friend and specialist of
Stratiomyidae (Diptera), who supported
the expedition to Israel in 1996.

Geographic distribution (Fig. 18). — Israel
and Jordan to southern Turkey.

Type material— HOLOTYPE male: IS-
RAEL, 40 km NE Haifa, 1 km E Hurfeish,
33.01°N 35.21° E, 16.05.1996 leg. SE (ZSM).
PAPvATYPES: ISRAEL: 40 km NE Haifa, 1
km E Hurfeish, 33.01°N 35.21° E, 16 May
1996 8 males (SE, Hauser); 15 km E Qiryat
Shemona, Foothill of Hermon, 33.15° N
35.44° E, 17 May 1996 2 males (SE). JOR-
DAN: Jarash 1 May 1996 1 male (OLL);
North Shuna 30 April 1996 1 female
(OLL). TURKEY: Mardin, 23 May 1988 2
males (SE)- Urfa, 3 June 1988 1 female
(MCZL); 25 km E Golbasi 7 June 1998 6
males 11 females (OLL); 10 km NW Ga-
ziantep 20 June 1997 1 male (OLL); N. of
Akseki, 19 June 1998 7 males (OLL); Tuz-
lagozu (Baykan) 4 June 1998 1 male (OLL);
Kahraman Maras, 40 km SE, 10 June 1998
19 males 1 female (OLL); 30 km N Erdem-
li, Aslani 17 June 1998 1 male 1 female
(OLL)— Gaziantep, Nizep 27 May 1978 1
male (CAS); Kuzuzcebelen/Mersin 25
May 1998 1 male (OLL).

Entomosericus concinnus Dahlbom 1845
(Figs. 1, 8, 11, 13, 17, 19)

Entomosericus concinnus Dahlbom, 1845:
486, male, Holotype or syntypes:
Greece, Rhodos Island (Lund)

Entomosericus concinnus rufescens Beau-

Volume 9, Number 2, 2000

357

♦39 00

.37 00

|CFF 1.2 - 1996

.35 00

.33 00

♦27 00

♦31 00

♦33 00

+35 00

♦37 00

♦41 00

♦45 00

Fig. 18. Collecting localities of Entomosericus hauseri in the eastern Mediterranean.

mont 1950: 403. Holotype: female Al-
geria, Taouiala (MCZL). New Syno-
nym.

Diagnosis and discussion. — The male of
this species is easily characterized by the
form of sternum VIII and the flagellom-
eres. Females may be distinguished from
the other species by punctation and other
characters (see key). Entomosericus concin-
nus has been confused with kaufmani.
However, concinnus occurs only in the
western Palearctic, whereas kaufmani is a
central asian species. The ranges of the
species overlap in the Ural river area in
northern Kazakhstan and Russia. £. con-
cinnus has two color forms. In Europe and
northern and central Turkey the male gas-

ter is all black, while in southern Turkey,
Syria, Israel and northwest Africa the gas-
ter base is red. Females of the species have
a red gaster base except in specimens from
Rhodos (the type locality) and western
Turkey, where the gaster is all black. The
isolated color form in the Dahlbom's type
material might have caused confusion for
earlier authors (Handlirsch 1888). Females
with an all black gaster have not been
found in other areas. The subspecies con-
cinnus rufescens Beaumont, which was de-
scribed from northwest Africa, is only a
light color form of the species. It differs
slightly from typical concinnus (see below),
which itself is variable in the extend of
gaster coloration in the eastern Mediter-

358

Journal of Hymenoptera Research

9 concinnus
A kaufmani

+5300

+4800

+4300

+38.00

♦33 00

+28 00

-200 +3 00 +8 00 +13 00 +18.00 +23.00 +28 00 +33 00 +38 00 +43 00 +48 00 +53.00 +58 00 +63 00 +68 00 +73.00 +78 00 +83 00

Fig. 19. Collecting localities of Entomosericus concinnus and E. kaufmani in southern Europe, western and
central Asia and northern Africa.

ranean area. Males of concinnus concinnus
from Syria and Israel are similar to males
of concinnus rufescens from north-west Af-
rica, while females of concinnus rufescens
have a more light red gaster than females
of concinnus concinnus. Therefore, the sta-
tus of rufescens as a subspecies of concinnus
is not justified due to the observed vari-
ability in concinnus.

Male. — 9-12 mm. Body black, or with
red basal terga. Tarsi red. Head densely
punctate, shiny area between eye and lat-
eral ocellus present (cf. Fig. 13). Clypeal
free margin with five small teeth. Upper
part of face with long erect setae. Dorsal
side of flagellomeres VIII-XI, surface of
flagellomere X-XI red. Flagellomeres VII-
VIII with large and well-defined tyloids;
flagellomere VI with small, pointed tyloid;
tyloid at flagellomere IX indistinct, ventro-
laterally situated (Fig. 1). Body sparsely
punctate. Thorax with long, silver setae.
Thorax surface and mesopleuron with
shiny interspaces, punctures 1-2 diame-
ters apart. Terga I-II coarsely punctate,
punctures 0.2-1 diameter apart. Terga III-
VI finely, densely punctate. Disk of ster-
num II shiny, coarsely and densely punc-
tate, punctues 1-3 diameters apart. Ster-
num II laterally in specimens form Tur-

key, Europe with fine, dense punctation;
in specimens from southern Turkey, Isra-
el, Morokko with the same punctation as
disk. Sterna III-VI more or less micros-
culptured, finely, densely punctate. Lat-
eral thickening of sternum VII with an
oval concavity (Fig. 11). Lateral edge of
sternum III with long band of brown se-
tae. Sternum VIII (in profile) with dense
erect setae as long as fourth tarsal segment
of hind leg, sterna V and VI with erect se-
tae (Fig. 8). Genitalia similar to that of hau-
seri spec. n. Wings venation and stigma
dark brown, costal and basal venation yel-
lowish, wing membrane slightly darkened
yellowish brown.

Female. — 10-11 mm. Body black, or with
red basal terga. Tarsi partly red. Head
densely punctate, area beside lateral ocel-
lus smooth and shiny (Fig. 13). Clypeal
free margin with five rounded teeth (Fig.
17), often worn down. Clypeus apically
longitudinally ridged. Mesoscutum with
smoth spaces between longitudinal punc-
tures. Punctation of thorax variable, but
punctures of mesoscutum at least many
diameters apart. Anterior part of scutel-
lum smooth, posterior part longitudinally
wrinkled. Mesopleuron densely punctate
in upper part, punctures in lower part

Volume 9, Number 2, 2000

359

many diameters apart. Terga I-III distinct-
ly and densely punctate, punctures 0.2-1
diameter apart. Base of terga III-IV with
denser punctation than the apex. Apical
margin of tergum II variable: in specimens
from Europe and Turkey it is straight (or
barely emarginated) and strongly stepped
with keel basally (a step between disk of
tergum II and apical tergal depression); in
specimens from Israel and Jordan it is
slightly rounded; in specimens from Mo-
rocco and Algeria it is barely stepped,
with a rounded basal edge. Sternum II
with a few deep punctures of variable di-
ameter (1-2 diameters apart), with fine mi-
crosculptured between punctures. Wing
venation dark brown except with yellow-
ish basal venation in specimen not from
southern Turkey.

Variation. — Males and females from Mo-
rocco differ slightly from Turkish and
Greek specimens: Diameter of punctures
of the terga and sterna are half as wide.
The apical margin of tergum II is barely
dented with a rounded flat basal edge.

Color variaton. — Europe, northern and
central Turkey, Russia and Ukraine: Males
with all terga black; females with tergum
I and II red. Rhodos island (Greece) and
Western Turkey (Aegean coast): Males
and females with all terga black. Syria, Is-
rael, southern Turkey and Jordan: Males
with tergum I red and tergum II black
with red parts; females with terga I-II red.
Northwest Africa: Males with tergum I
and base of tergum II red. Females with
terga I-III and base of tergum IV red, some
specimens with tergum IV black.

Doubtful specimen. — A single female
from Jordan (20km S North Shuna, Tall al
Arbatin 19 April 1998, coll. SE) could not
assigned to species. It has a black gaster
(normally gaster base is red in Jordan), a
shiny area with only few punctures be-
tween the lateral ocellus and the eye, the
tergum II is as in average concinnus. A
male of concinnus was collected on the
same day at the same locality.

Geographic distribution (Fig. 19). — East-

ern mediterranean area to southern Russia
and northwest Africa.

Records.— ALGERIA: Taouiala [33'54'N 01 '51 'EL
Holotype of E. concinnus rufescens (de Beaumont 1950,
in British Museum London). Not seen, but other spec-
imens of type series examined. ARMENIA: Urcadzor

14 June 1988 1 male (gaster black) (OLL). BULGARIA
Melnik 23 May 1985 3 males 22 June 1997 2 males
(OLL); Slancev Brjag 15 June 1997 1 male (OLL); San-
danski 14 July 1979 2 females (CAS); Slancev Brjag
July 1972 1 female 2 males (OLL) (males: gaster black,
females: terga I and II red); Albena 17 July 1978 1
female (OLL); Ivanski near Schumen 15-30 July 1969
1 male (coll Burger).? FRANCE: Gallia mer., Ancev,
1897 1 male (NHMW, gaster black). Specimen prob-
abely mislabeled. GREECE, MAINLAND: Alexandro-
pulos 16 June 1994 1 female (NHMW); Alt Korinth
28 May 1996 1 male; 7 June 1997 2 males 1 female
(Arens); Korinth 15 May 1970 (ZMHB); Attika 1 male
(NHMW); Cephalonia 4 males 1 female (NHMW)
(det Maidl as kaufmani); Graecia, Argostoli? 26 Mav
1908 1 male 1 female (NHMW) (female det Maidl als
kaufmani); Attika 1 female (NHMW) (det Maidl als
kaufmani); Olympia 10 June 1961 1 female (CAS);
Olympia, Alfios-Tal 4 June 1995 1 male (Arens); Ka-
lamata, Avia 14 May 1995 2 females; 10 June 1996 2
females (Arens); Peloponnes, Midea 19 June 1996 1
female (Arens); Peloponnes, Sparta, Amyklai 5 June
1996 1 female 1 male (Arens); Peloponnes, Sparta,
Menelaion 26 May 1997 3 males; 21 May 1997 2 males
1 female; 4 June 1996 6 males 6 females (Arens); Pe-
loponnes, Sykion 8 June 1997 2 females (Arens);
Olympia 19 June 1961 1 female; 1 June 1963 1 female
1 male (MCZL); Pyrgos 11 June 1961 3 females
(MCZL); Kalamata 15 Mav 1964 2 females 5 males
(MCZL); Nea Kefissia 19 June 1957 1 female 2 males
(MCZL) (males: gaster black, females: terga I and II
red).; GREECE, RHODOS ISLAND: Kritinia, 2 May
1990 9 males 1 female (SMNS) ; Salakos, Kamiros 3
May 1990 2 males 2 females (SMNS) ; Rhodos, no
specific locality, June 1939 3 males (MCZL); Rhodus,
no specific locality, 1869 4 males 2 females (NHMW);
W Apolakkia, N Monolithos 23 April 1998 1 male 1
female (Hartmann) (gaster black). HUNGARY: male,
without date and exact locality, may be today' s Ro-
mania (ZMHB, also referred by Handlirsch 1895: 850
gaster black); 'Ungarn coll. Hindlmayer' 1 male
(ZSM). ISRAEL: Lehavim junction, 11 km N IVVr
Sheva, 27 March 1991, 2 males (SE) (gastral base red ).
JORDAN: Petra 14 May 1995 3 males (OLL) (gastral
base red); North Shuna 29 April 1996 1 female (OLL);
20km S North Shuna, Tall al Arbatin 19 April 1998 I
male (OLL) (gastral base black). MOROKKO: Agadir,

15 April 1947 1 male 1 female (MCZL, Paratype of /
c. rufescens de Beaumont): Iftilt, 15 June 1962 1 male
(MCZL, Paratype of / c. rufescens lie Beaumont); 50
km NE Taroundannt, 5 km E Kreuzung Tizn-Test/
Aoulouz 12 April 1996 4 females (Niehuis, SE); 10 km

360

Journal of Hymenoptera Research

N Rich, 23 May 1995 1 female (OLL); 10 km S Bouarfa
20 May 1995 1 female (OLL); 40 km S Guercif 15 May

1995 1 female (OLL). ROMANIA: Dobrogea, Camar-
aua Fetii 26 June 1993 3 males (OLL) (gaster black);
Tultscha [= Tulcea] 1859 1 female (leg. Mann,
NHMW, terga I and II red); Mehadia [leg] Mann 1859
2 females (NHMW, gastral base red). Scobiola-Palade
(1966) mentions E. concinnus and E. kaufmani from Ro-
mania, but the latter is probably the red form of E.
concinnus. RUSSIA: Southern Ural, Kargala b. Oren-
burg, 1915-1917 1 male (ZMHB, gaster black). SYRIA:
Mezze near Damascus 21 May 1954 2 males 3 females
(CAS, MCZL); Damascus, road to Kissoue 2-18 May
1960 2 males 1 female (MCZL); Marbi, 9 May 1996 1
male (OLL); 30 km s Suwayda, Dibbin 15-17 May

1996 1 male; 10 km SE Suwayda, Kafr 19 May 1996

1 male (OLL); Anata, 50 km SE of Suwayda 20-21
May 1996 1 female (OLL) (gastral base red). TURKEY:
First terga of males black, tergum I and II of fe-
males red: Horasan, 18 km E Delibaba 25 June 1993

2 males (OLL); 30 km N Kutahya, Porsuk Baraji 15
June 1997 2 males (OLL); Guriin 7 June 1970 1 female
(CAS); Konya, Karaman 11 June 1979 1 male (CAS);
Urfa 21 May 1972 1 female (CAS); Sille, Konya, 16
June 1968 1 male (MCZL); Amasya 1,400 ft, 9 June
1959 1 male (MCZL); Asia minor 11 July 1852 1 fe-
male (ZSM); Osmaneli 14 June 1997 3 males 1 female
(OLL); 40 km E Mut, Cornelek 29 May 1996 4 males
1 female (OLL); Capadocia, Urgup 13 June 1998 8
males 1 female (OLL); Capadocia, 10 km NW Urgup
15 June 1998 1 male 1 female (OLL); Tuzlagozu (Bay-
kan) 4 June 1998 1 male (OLL); Bozkir 26 May 1998
1 male (OLL); Agri 27 June 1993 1 male (OLL); G6-
reme 23 June 1993 1 male (OLL); Konya, 30 km S of
Aksehir 24 June 1998 1 male (OLL); 20 km SE Hora-
san, Delibaba 3 July 1997 1 female (OLL); Bolu, 17 km

5 Seben 17 June 1998 1 female (OLL); Manisa, 30 km
E 20 June 1998 1 female (OLL); Hop Gecidi, Mardin

6 June 1998 1 female (OLL); Ankara, 40 km W Ayas
26 June 1998 1 female (OLL); Sivas, 45 km E Yarhisar
24 June 1993 1 female (OLL); Taskesigi/10 km E An-
talya 1998 18 males (OLL); Gevas/Van Golii 29 June
1993 1 female (OLL); Terga I and II of males red:
Elazig 7 June 1980 1 male (SE); Urfa 20 May 1967 1
male (MCZL) -Halfeti (Birecik) 31 May 1998 1 male
(OLL); Tuzlagozu (Baykan) 4 June 1998 1 male (OLL);
Halfeti 3-5 May 1994 1 male (OLL). Gaster of fe-
males black: W-Turkey, SSO Milas, Camkoy lake 20
June 1998 1 female (Niehuis); W-Turkey, SO Milas,
Akyoi 19 June 1998 1 female (Niehuis). UKRAINE:
Falzfeinowo a. Dnipr 12 May-7 June 1914 1 male
(gaster black) (ZMHB); Otuzysches Tal, auf Teucrium
polium, leg. Wuczeticz, 4 July 1926 1 female (NHMW,
det Maidl as kaufmani, tergum I and 2 red) (= prob-
ably Otuzy Valley or Otuzskaya Dolina in Crimea,
Ukraine); Umg. Tokluk, near Sudak, at Reseda lutea 4
June 1924 1 male Wuczeticz [leg] (NHMW, gaster
black) (= probably Sudak in Crimea, Ukraine)

Entomosericiis kaufmani Radoszkowski

1877
(Figs. 3, 6, 7, 12, 15, 19)

Enthomosericus kaufmani Radoszkowski
1877: 46. Male, female. Misspelled 'kauf-
manni' in most subsequent publications.
Lectotype, male: Kasachstan, Kyzylkum
[desert], 28 April 1871 (A.P.Fedchenko
coll.) [appr. 43°13'N-71° 35'E]. Designed
as lectotype by A. Antropov (ZMUM).

Diagnosis. — The male of Entomosericus
kaufmani is easily recognizable by its flat
sternum VIII and its ventrally concave fla-
gellomere XL Females have a large shiny
area between the lateral ocellus and eye.
The species ist smaller and more slender
than concinnus. It occurs only in southern-
central Asia from Kazakhstan to Turk-
menistan (Kazenas and Alexander 1993).
An isolated record comes from Uralsk in
northern Kazakhstan. All examined 'kauf-
mani' (det. Madl or Handlirsch, coll.
NHMW) from Europe or Turkey are mis-
identifications of the red colored form of
concinnus.

Male. — 8-9 mm, Body black, tergum I
and parts of tergum II red. Legs red except
tibiae. Face covered with a dense silver
pubescence in lower part and erect setae
in upper part. Area between eye and lat-
eral ocellus only with few punctures near
eye (cf. Fig. 12). Clypeal free margin with
5 teeth, median tooth and lateral teeth dis-
tinctly smaller than mediolateral teeth.
Flagellomere XI with a concave ventral
surface witch is ventrally curved. Ventral
surface of flagellomeres V-IX with indis-
tinct lateral tyloids and with half moon
shaped red spots. Ventral surface of fla-
gellomeres X-XI completly red, flagellom-
ere XI also partly red on dorsal surface
(Fig. 3). Punctation of body less dense
than in concinnus, spaces between punc-
tures shiner than in concinnus. Punctures
of terga I and II 0.5-2 diameters apart.
Sterna II and III unsculptured with only
few scattered punctures, that are separet-
ed by many diameters. Disk of sterna IV

Volume 9, Number 2, 2000

361

and V finely and densely punctate, later-
ally only with a few coarse punctures.
Sternum III with long band of setae (as in
concinnus), medial setae of band half as
long as lateral setae. Sterna VI and VIII
(sometimes V) with long silver setae (Fig.
7). Sternum VIII nearly flat, without lateral
thickening. Inner transparent appendix of
gonostylus twice as wide as outer opaque
appendage (Fig. 6). Wings venation and
stigma dark brown except yellowish costal
and basal venation. Wing membrane
slightly darkened.

Female. — 9-10 mm. Body, including
legs, black, terga and sterna I-II red. Head
finely and densely punctate (punctures
0.5-1 diameter apart). Clypeus apically in-
distinctly longitudinal ridged, without
punctation, basally finely punctate. Clyp-
eal free margin with five well developed
teeth. Shiny area between lateral ocellus
and eye large, extending to eye, some-
times with scattered punctures (Fig. 12).
Thorax unsculptured, shiny, coarsely
punctate. Upper part of mesopleuron
densely, finely punctate, lower part only
with few punctures. Punctures at disk of
terga I-II 1-2 diameters apart, punctures of
succeeding terga more densely arranged.
Edge between disk of tergum II and apical
tergal depression rounded, apical margin
of tergum II slightly dented. Disk of sterna
II-III nearly unsculptured, sternum II with
only a few scattered punctures that are
many diameters apart. Wings venation
dark brown, wing membrane slightly
darkened.

Life history. — Kazenas and Alexander
(1993) described the nest architecture and
larva of kaufmani from southeastern Ka-
zakhstan, Talas River. The females dig
nearly vertical burrows in sandy soil and
fill each cell with eight to 18 leafhoppers
(Homoptera, Cicadellidae).

Type material— PARALECTOTYPES
(Lectotype see above): All designed as
paralectotypes by A. Antropov. The type
series is deposited in ZMUM and includes
the following specimens: Zeravshan valley

9 May 1869 2 males (A.P. Fedchenko coll.)
[appr. 39°33'N-63°40'E]; Zeravshan valley
23 May 1869 1 male (A.P. Fedchenko coll.);
Chardara, 25 April 1871 2 males (A.P. Fed-
chenko coll.) [41°15'N-67 °58'E]; Chardara
27 April 1871 1 female 1 male (A.P. Fed-
chenko coll.); Kyzylkum [desert] 28 April
1871 1 female (A.P. Fedchenko coll.) [appr.
42°40'N-63°37'E]; Kyzylkum [desert] 1
May 1871 2 males (A.P. Fedchenko coll.);
Syutkent, 3 May 1871 1 male (A.P. Fed-
chenko coll.) [41°55'N-68°5'E]; Bayrakum
[Baygakum] 4 May 1871 1 male (A.P. Fed-
chenko coll.) [44°18'N-66°28'E]; Karak-
skaya steppe 6 May 1871 1 female (A.P.
Fedchenko coll.) [appr. 49°18'N-69°50'E].

Geographic distribution (Fig. 19). — South-
ern-central Asia from Kazakhstan to Turk-
menistan.

Records.— KAZAKHSTAN: 2 females 1 male from
coll Radoszkowski (ZMHB), [male without locality,
females from Chardara and Kyzylkum (in russian let-
ters), all labelled as 'Type', probably belonging to the
syntypes serie, not designated as paralectotypes]; 10
km E Ddjambul 31 May 1994 6 males 3 females (OLL)
-Darbaza 40 km N Tachkent 30 May 1994 4 males 8
females (OLL); Vanovka, 80 km E Djambul 1 male
(OLL); Alma Ata 1 May 1994 1 female (OLL); 10 km
N Chayan 1 male (CAS); vicinity of village Togusken
on Talas River 1 female (CAS); vicinity of Uralsk 1
female (CAS). TADJIKISTAN: 3 km W Dusti, 130 km

5 Duchanbe 15-16 May 1991 1 female (OLL). TURK-
MENIA: Sandikazi 3-13 May 1993 18 males 3 females
(OLL); Askahbad 22 May 1964 1 male (CAS); Star.
Nisa/Ashabad 28 April 1977 1 male (OLL). UZBEK-
ISTAN: Samarkand 19-21 May 1994 ca. 200 males ca.
40 females (OLL); Czirczik 28 May 1994 14 males 5
females (OLL); 5 km W Ddjizak 23 May 1994 9 males

6 females (OLL); Djuma 1 male 1 female (CAS)- Sam-
arkand: Chupan-Ata-Mountain 2 males 2 females
(CAS)- Sary-Agach in Tashkent Distrikt 1 male (CAS).

ACKNOWLEDGMENTS

I greatly appreciate the help of Dr. Werner \rens,
Bad Hersfeld, Germany, Frit/ Gusenleitner, Lin/,
Austria, Dr. Frank Koch, Berlin /Germany, Dr. Peter
Hartmann, Bayreuth, Germany, Dr. Stephan Schodl
Wien, Austria, Erich Diller and Johannes Schubert,
Miinchen, Germany, Martin Hauser, Urbana, Illinois,
Oliver Niehuis, Albersweiler, Germany, Dr. Till Os-
tein, Stuttgart, Germany, Dr. Wojdech Pulawski, San
Francisco, California and Dr. Michael Sartori, Lau-
sanne, Switzerland, tor the loan of specimens. Also, I
extend my sincere thanks to Wojdech Pulawski tor

362

Journal of Hymenoptera Research

his advice and suggestions, Alexander V. Antropov,
Moscow, for his help, and Kevin Holsten, Urbana,
Illinois for kindly checking the english.

LITERATURE CITED

Balthasar, V. 1972. Grabwespen; Sphecoidea. Fauna
CSSR 20. 471 pp. Prag, Accidentia Verlag.

Bohart, R. M. and A. S. Menke 1976. Sphecid wasps
of the world. A generic revision. University of Cal-
ifornia Press, Berkeley, ix + 695 pp.

De Beaumont, J. 1950. Sphecidae Hymenoptera re-
coltes en Algerie et au Maroc par M. Kenneth
M.Guichard. Bulletin British Museum Natural His-
tory Entomology, !'■ 391-727.

De Beaumont, J. 1965. Les Sphecidae de la Grece
Hym. Mitteilungen Schweizer Entomologische Ge-
sellschaft 38: 1-56.

De Beaumont, J. and P Roth 1967. Hymenoptera
from Turkey. Sphecidae, I. Bulletin British Muse-
um Natural History Entomology 19: 251-382.

Dahlbom, A.G. 1843-1845. Hymenoptera Europaea
praecipue borealia; formis typicis nonnullis Spe-
cierum Generumve Exoticorum aut Extraneorum
propter nexum systematicus associatis. Tomus
Sphex in sensu Linneano. Offincina Lundbergiana,
Lundberg fasc. 3: 353-528, 1845 dating after Men-
ke 1974.

Handlirsch, A. 1888. Monographie der mit Nysson
und Bembex verwandten Grabwespen. II. Sit-
zungsberichte der Kaiserlichen Akademie der Wissen-
schaften in Wien, Mathemathisch-Naturwissenschaf-
tliche Classe 96: 219-311.

Handlirsch, A. 1995. Nachtrage und SchluGwort zur
Monographie der mit Nysson und Bembex ver-
wandten Grabwespen. Sitzungsberichte der Aka-
demie fur Wissenschaften, Wien Abteilung 1, 104:
801-1079 + Tafeln.
Kazenas, V.L. and B.A. Alexander 1993. The nest,
prey, and larva of Entomosericus kaufmani Ra-
doszkowski. Hymenoptera: Sphecidae. journal of
Hymenoptera Research 2: 221-226.
Menke, A. S. 1974. The dates of publications of A.G.
Dahlbom's Hymenoptera Europaea, vol. 1, Pol-
skie Pismo Entomologia 44: 315-317.
Menke, A. S. 1997. Family-group names in Sphecidae
Hymenoptera: Apoidea. Journal of Hyttienoptera
Research 6: 243-255.
Melo, G.A. 1999. Phylogenetic relationships and clas-
sifications of the major lineages of Apoidea Hy-
menoptera, with emphasis on the Crabronid
wasps. Scientific Papers. Natural History Museum
of the University of Kansas 14: 1-55.
Pulawski, W. 1978. Nadsem. Sphecoidea, p. 173-279
in G.S. Medvedev Editor. Opredelitel' naseko-
mykh yevropeyskoy chasti 5SR, Tom III. Pere-
ponchatokrylyye, Pervaya chast' [Keys to the
Identification of insects of European USSR, Vol.
3, part 1]. Nauka, Leningrad 584 pp.
Radoszkowskii, O. 1877., ,Sphegidae„ in: Voyage au
Turkestan d'A.P. Fedchenko, fasc. 14, tome 2,
partie 5. Bulletin societe Imperialis Amis Sciences
Naturalis 26: 1-87.
Scobiola-Palade, X. 1966. Donnees nouvelles concer-
nant les Hymenopteres du delta du Danube. Tra-
veaux Musee Histoire naturalis Griorgi Antipa 6:
389-396.

J. HYM. RES.
Vol. 9(2), 2000, pp. 363-369

New Odour Glands in Xylocopa Males
(Hymenoptera: Apoidea: Anthophoridae)

B. O. SCHLUMPBERGER AND D. WlTTMANN

Institut fur Landwirtschaftliche Zoologie und Bienenkunde, Universitat Bonn, Melbweg 42,

53127 Bonn, Germany

Abstract. — Odour glands were found in all tergites in males of the neotropical Xylocopa bima-
culata Friese and X. nigrocincta Smith as well as in the palaearctic X. violacea Linne. Furthermore
odour glands were found in the fore, middle and hind legs of X. bimaculata and X. nigrocincta.
Males of X. bimaculata and X. nigrocincta establish non-resource based territories to which they
attract females by spreading secretions of the odour glands over their body. For this they brush
with specialized hairs on their hind legs over the abdomen, which they extend in order to expose
the pores of the odour glands. The function of glands in all three pairs of legs is discussed in
comparison with similar findings of odour glands in other species of carpenter bees and leafcutter
bees.

Territorial male carpenter bees that ac-
tively search for females establish two
kinds of territories: at nesting sites or at
flowering plants (Hurd and Linsley 1975,
Alcock 1991). Such territories may cover
an area of several square meters. Other
males attract females with sex phero-
mones to territories which contain neither
nests nor food plants, so called non-re-
source based territories. These territories
may cover a space less than one cubic me-
ter, in many cases they measure 10 to 15
cm'. In some species a single male estab-
lishes its territory alone, for example in a
tree. In others conspecific males establish
their non-resource based territories to-
gether in close vicinity, forming so called
leks. In these cases the distance between
single territories may be as short as one
meter.

Males in non-resource based territories
have to cope with two problems: they
have to leave their territories in order to
find nectar as energy for their long lasting
territorial flights. In Xylocopa nigrocincta
males dehydrate the nectar that is fed to
them by the mother in the nest. Thereby
they get rid of excess water, and with a

higher concentration of sugar they im-
prove their energy budget. Of males with
the same amount of sugar in their crop
those fly longer in their territories which
have diluted the sugar in small volumes
of water (Wittmann and Scholz 1989).

Furthermore their success in attracting
a female depends on the amount of pher-
omones secreted per time. This may be
one of the reasons why males establish
their territories close to each other in leks.
The advantage of such leks is probably
that together the males have better chanc-
es to attract a female.

Within the genus Xylocopa, odour
glands have been described from the head
(mandibular gland) and from the thorax
(mesosomal gland) (Wheeler ct al. 1976,
Vinson et al. 1986). Furthermore odour
glands were found recently in the fore legs
of some Old and New World Xylocopa
males (Wittmann and Blochtein 1995).

Males of X. hisutissima and X. sulcatipes
have been reported marking their mating
territories with the secretions of the man-
dibular glands (Velthuis and Camargo 1975
a & b, Hefetz 1983). Territorial males can
identify conspecific males as intruders of

364 Journal of Hymenoptera Research

their territory by the secretions of the man- Compounds were identified by their mass

dibular glands. In consequence this odour spectra and using Kovats indices,
elicits defence behaviour in the owner of the

territory (Velthuis and Camargo 1975 a & RESULTS
b). Mesosomal glands are male specific. The Abdominal glands. — SEM analyses of the
males frequently brush their legs over their sternites and tergites of X. bimaculata re-
body thereby spreading the odour (Vinson vealed that pores of odour glands are pre-
et al. 1986). The secretions of these glands sent in tergites I — VI. These pores are lo-
are supposed to act as territorial phero- cated on the frontal part of the tergites
mones in non-resource based territories which are hidden under the anterior ter-
(Gerling et al. 1989). gites (Fig. la). They are the openings of

chitinous ducts which lead into glandular

MATERIAL AND METHODS cdls in the abdomen. After maceration

All observations on behaviour were these ducts are visible on the inner surface
made between September and November of the tergites. In tergites I-V we found the
1995 in the natural habitat in the forest highest amount of pores. On tergite I and
reservation area Pro-Mata of the PUC- II the pores were scattered, while on ter-
Uni versify Porto Alegre (Brazil). The area gites III, IV and V most of the pores ap-
is located in the northern highlands of Rio peared clumped. Between 10 and 20 pores
Grande do Sul, the Serra Geral (50°-51° W were grouped in round areas with a di-
and 29°-30° S) in an elevation of ca. 900 ameter of 8-10 fjim (Fig. lb). The distances
m, about 150 km north of Porto Alegre. between these areas ranged between 20

For identification we used the key to and 40 \xm. On the inner side of the tergite

subgenera by Hurd and Moure (1963). these groups of pores correspond with a

Furthermore the bees were compared with bundle of cuticular ducts of odour glands

the collection of the Biological Research (Fig. 2a). The terminal part of each duct is

Station of the University of Tubingen / covered with short lateral ducts. This end

Germany at the PUC-University in Porto apparatus is normally inside the glandular

Alegre, Brazil. Critical species were iden- cell that has been macerated (Fig. 2b). In

tified by Dr. J. S. Moure. tergite VI only a few scattered pores were

To analyse the territorial behaviour found, mostly on the lateral parts of the

males were filmed during the territorial tergite.

flight with a Panasonic F15. Description of hairs on the abdomen. —

For SEM-analysis we used a Stereoscan Noteworthy are three different types of

250 Mk2 and a Hitachi S-800. The bees, or hairs on the tergites. On those parts of the

parts of them, were macerated in 5 % tergites that are covered by the anterior

KOH for 24 hours, after which they were tergites the hairs are plumose and about

dehydrated in 50-100 % ethanol and dried 200 (xm long. The hairs on the posterior

for 24 hours at 30°C. If glands with chitin- part of the tergite are unbranched and be-

ized ducts are present, these structures re- tween 0.5 and 1 mm long. Most conspic-

main after the mazeration. uous are the bunches of bristles on the

To check the presence of volatile sub- sides of the last three tergites.

stances in the area of glandular pores we Abdominal glands in males of other Xylo-

washed the abdomen of a freshly killed ter- copa species. — We also found pores of

ritorial male in pentane. The samples were odour glands in all tergites of X. nigro-

analyzed with a Fisons MD-800 GC-MS on cincta and in X. violacea. In both species

a fused silica column, DB-5 (15 m X 0.32 single pores have also a diameter of 2 (xm.

mm), the temperature was programmed However, they are not arranged in groups

from 80°C (for 2 min) to 200°C at 10°C/min. as in X. bimaculata. The chitinous ducts of

Volume 9, Number 2, 2000

365

Figs. 1-2. 1, Outer surface of X. bimaculata tergite IV: la, The median of the tergite is on the right borderline,
the pores are hidden under the dense coverage of short hairs; lb, Aggregation of 12 pores of odour glands.
Each of the pores has a diameter of about 2 u.m. 2, Inner side of the tergite IV: 2a, Bundles of cuticular ducts
of odour glands, diameter of each duct is ca. 2 jjum. 2b, Cuticular duct and the terminal apparatus. Scale bars:
la) 1 mm, lb) 10 (xm, 2a) 20 (xm, 2b) 40 ^m.

the odour glands have the same appear-
ance in all three species (Fig.3a & b).

Glands in legs. — On the fore, middle and
hind legs of X. bimaculata we found pores
of odour glands. On the fore legs the pores
were on the dorsal and anterior side of the
basitarsus and also on the ventral side of
the other tarsalia of the fore leg. On the
middle leg pores were found on the dorsal
side of the basitarsus, while on the hind
leg the pores were found on the ventral
side of the basitarsus. In X. nigrocincta
pores were also found on the basitarsus of
the fore leg.

Hairs on the fore legs. — A notable feature
on the fore leg of X. bimaculata is a specific
type of hair. When the male is viewed

frontally the hairs of the anterior side of
the tarsalia and parts of the tibia appear
shining white. The front leg bears on the
anterior dorsal edge of the tarsalia a fan
of bristles which are about three times as
long as the diameter of the basitarsus.
Such shiny white hairs are also present on
the tarsi of the middle legs.

Hairs on the hind legs. — On the ventral
side of femur and tibia of the hind legs we
found a conspicuous type of hairs. They
have smooth shafts and their tips are
broadened and flattened forming a con-
cave spatula (Fig. 4a). The concave side
points to the surface of the cuticula. Be-
sides these hairs the femur, tibia and the
tarsi bear long pointed bristles with a

366

Journal of Hymenoptera Research

Figs. 3-4. 3, Chitinous odour ducts (with a diameter of ca. 2 |xm). 3a, on the inner side of tergite I of X.
nigrocincta; 3b, on the inner side of tergite II of X. violacea. 4, Hairs on the hind legs of male X. bimaculata. 4a,
the widened and flattened tips form a concave spatula. 4b, hairs on the anterior side of the femur. 4c, hairs
on the anterio-ventral side of the tibia. Scale bars: 3a) 40 |xm, 3b) 100 (xm, 4a) 40 |xm, 4b) 200 |xm, 4c) 200 pmi.

rough surface. On the femur the spatula- long axis (Fig. 4c). The function of this po-

like hairs are directed rectangular to the sition of the hairs on the hind leg becomes

long axis of the femur (Fig. 4b) whereas clear when we look at the behaviour of X.

on the tibia they are directed parallel to its bimaculata males in their territories.

Volume 9, Number 2, 2000 367

Territories. — The mating period of X. hi- landed were observed to brush their legs

maculata is from early October until late over their body.

November. Due to the high altitude of the While on wing in their territory the

study site there is only one mating period, males held their fore and middle legs close

Males were recorded to fly in their terri- to the body, so that the shiny white hairs

tories between 06:15 and 16:30, the mini- on the fore and middle leg basitarsalia di-

mum temperature was 18°C. Individual rected downwind and forward. The hind

territorial flights lasted up to 1.5 hours. legs were stretched out backwards and

The territories of these males were al- away from the body. With high frequency
ways found at the very margins of the ar- (up to 11 times per minute) the males
aucaria forest in non-flowering trees or brushed with their hind legs from anterior
shrubs. The males established their terri- to posterior over the dorsilateral parts of
tories always on the sunny side of the for- the abdomen, bending the abdomen
ests and shifted them according to the po- downwards. They then rubbed the hind
sition of the sun. They flew in territories legs to each other and then to their middle
with a radius of ca. 30 cm, sited between legs. Less frequently they rubbed the mid-
twigs or close to a bough, always in the die legs to the fore legs and rarely the fore
shadow, positioned between 0.5 and 4 me- legs to the head. Towards the end of the
ters above the ground. The males kept territorial flight the males carried out
their head downwind and changed their these brushing movements with an ever
direction (not the position) according to decreasing frequency,
the wind. Marked males were found to oc- During the observation of 167 territories
cupy the same territory on different days, not a single female approached a male in
However, this was not the rule. its territory.

In 1995 we observed 167 territories, 74% Males of X. bimaculata regurgitated and

of them as single territories, in 26% 2-A dehydrated nectar while hovering in the

males established territories in close vicin- territory.

ity in the same tree. In 1994 we found leks Aggressions between males. — Males in

with up to 10 males. The number of males neighbouring territories have sometimes

in a lek changed frequently often within a been observed to suddenly attack their

few minutes. Sometimes the distance be- neighbour. Some incoming males attacked

tweeri the territories measured only 50 cm. territorial males immediately or were at-

Territorial behaviour. — Within their terri- tacked by the hovering male. Sometimes
tories the males of X. bimaculata hovered the defending male left the territory to flv
with loud buzzing mostly at one position, towards the intruder and hovered in front
only shifting the direction from time to of him until one of them started to show
time to stay with the abdomen in the up- antagonistic behaviour, including hits
wind position or in search for approach- with the front legs, tumbling down while
ing females. Sometimes a male moved to clinging to each other or chasing the op-
establish the territory in another place ponent until both got out of sight of the
without any recognizable reason. Males observer.

that left their territory probably to feed re- Finally one male returned to the former

turned to their former or to a different po- territorial position, or in some cases even

sition. In about 5% of the observed terri- both males started to hover in close vicin-

torial flights males landed on the substrate ity. Aggressive behaviour could be artifi-

within the territories. However, we could daily initiated when we approached a

never observe them to rub their mandi- dead male closer than 30 cm to a territorial

bles, their abdomen or legs over the sub- male,

strate. Some of these males which had Volatile substances in cuticular wash-

368 Journal of Hymenoptera Research

ings. — In cuticular washings from the dor- Those substances may more likely serve as
silateral parts of the abdomen we could short range signals, maybe for mate accep-
determine a series of alkanes with a chain tance in a female choice system or to de-
length of 18 and longer as well as alkenes tect the males at the margins of the forests,
with the same chain length. Further studies on the chemical properties

of the gland secretions and their function

uio^uajivji\ during territorial and mating behaviour

Males of X. bimaculata were found to es- are necessary,

tablish non-resource based territories, ei- Unfortunately we could not observe

ther alone or together with other males in copulations in X. bimaculata. Therefore,

leks. We could not observe that they mark any further considerations on the function

substrate in their territories in order to at- of the modified forelegs can only be hy-

tract females. Instead males were seen to pothetical.

brush their body with their legs. We sup- Anzenberger (1977) clearly observed

pose that while the hind legs brush over that during copulation males of X. (Meso-

the abdomen they take up secretions of trichia) torrida Westwood cover at least a

the odour glands and spread them during part of the female's compound eyes with

further movements over the plumose the fan of long bristles on their mid legs,

hairs over the abdomen and over the hind Osten (1989) showed that in Xylocopa spe-

and middle legs. Good evidence for this is cies from Africa and Sri Lanka such fans

that the males bend their abdomen down- on fore legs also function as blind folds

wards and stretch it so that the pores of during copulation. These blind folds may

the odour glands are exposed. While the have the effect that females stop flying

males move their hind legs over their ab- when grabbed in mid air or prevent them

domen femur and tibia are held in a 90° to take off when mounted by a male on

angle. The different exposition of the spe- substrate.

zialized hairs on femur and tibia ensures The phenomenon that male Hymenop-

that they brush straight over the pores of tera have blind folds and odour glands in

glands. So the spatula-like tips can take up modified forelegs was so far found in

the secretions from the plumose hairs sur- more than one hundred species of me-

rounding these pores and spread them gachilid bees, in several species of neo-

subsequently over the long bristles on tropical and Old World carpenter bees

both sides of the abdomen and over the and furthermore in a sphecid wasp (Crabro

other legs. These movements and the high cribrarius) (Wittmann 1992, Wittmann and

frequency with which they are carried out Blochtein 1995, Blochtein 1995).

strongly suggest that the males perfume Osten (1989) has described that during

their body in order to attract conspecifics. copula position in X. perforator males hold

While the male is emitting these secre- their basitarsi on the female's head. In
tions he is facing downwind. This position these basitarsi Wittmann and Blochtein
possibly ensures that the male might see (1995) found odour glands. Combining
incoming females that follow an odour both findings we strongly suggest that
trace. The white areas in his face and the males during copula bring the secretions of
shiny white hairs on his middle and front the odour glands in close contact with the
legs could then serve as a further signal antennae of the female. Further students of
for approaching females to detect the male X. bimaculata mating behaviour may there-
in its territory. fore check whether such a copula position

The chain length of the alkanes and al- can also be found in these bees,

kenes we found in the cuticular washings In contrary to male X. nigrocincta, which

suggests that they are not highly volatile, concentrate the nectar in the mother's nest

Volume 9, Number 2, 2000

369

before each territorial flight (Wittmann
and Scholz 1989), the males of X. bimacu-
lata dehydrated nectar while hovering in
the territory. We suppose that thereby
male X. bhnaculata improve their energy
budget as has been shown for X. nigro-
cincta. While the latter are fed by their
mother in the nest, the males of X. bhna-
culata collect the nectar by themselves and
therefore have to evaporate the redundant
water during the territorial flight.

ACKNOWLEDGMENTS

This study was carried out in co-operation with the
PUC-University, Porto Alegre, Rio Grande do Sul,
Brazil, the University of Tubingen and the University
of Bonn. We thank Dr. J.S. Moure for identification
of the bees, Horst Schoppmann for scillfull help at
the scanning microscope and Andreas Jux for the GC-
MS analysis.

LITERATURE CITED

Alcock, J. 1991. Mate-locating behaviour of Xylocopa
California* arizonensis Cresson (Hymenoptera: An-
thoporidae). Journal of the Kansas Entomological
Society 64: 349-356.

Anzenberger, G. 1977. Ethological study of African
Carpenter bees of the genus Xylocopa (Hymenop-
tera: Anthophoridae). Zeitschrift fur Tierpsycholo-
gie 44: 337-374.

Blochtein, B. 1995. Die Bedeutung spezialisierter
Beinstrukturen und Duftdriisen der Mannchen in
der Paarungsbiologie von Blattschneiderbienen
(Hymenoptera; Megachilidae). Dissertation Univ-
ersitdt Tubingen, 96 p.

Gerling, D., Velthuis, H. H. W. and Hefetz, A. 1989.
Bionomics of the large Carpenter bees of the ge-
nus Xylocopa. Annual Reviews of Entomology 34:
163-190.

Hefetz, A. 1983. Function of secretion of mandibular
gland of male in territorial behavior of Xylocopa

sulcatipes (Hymenoptera: Anthophoridae). Jour
nal of Chemical Ecology 9: 923-931.

Hurd, P. D. and Linsley, E. G. 1975. The principal
Larrea bees of the southwestern United States
(Hymenoptera: Apoidea) Smithsonian Contribu-
tions to Zoology 193: 1—47.

Hurd, P. D. & Moure, J. S. 1963. A classification of
the large carpenter bees (Xylocopini) (Hymenop-
tera, Apoidea). University of California, Berkeley
Publications in Entomology, Vol. 29. 365 pp.

Osten, T. 1989. Vergleichend-funktionsmorphologis-
che Untersuchungen des Paarungsverhaltens
von Platynopoda und Mesotrichia (Hymenoptera:
Xylocopini). Stuttgarter Beitriige zur Naturkunde,
Ser. A, 433, 18 pp.

Velthuis, H. H. W. and Camargo, J. M. F. 1975a. Ob-
servations on male territories in a carpenter bee,
Xylocopa (Neoxylocopa) hirsutissima Maidl (Hy-
menoptera, Anthophoridae). Zeitschrift fur Tierp-
sychologie 38: 409^118.

Velthuis, H. H. W. and Camargo, J. M. F. 1975b. Fur-
ther observations on the function of male terri-
tories in the carpenter bee Xylocopa (Neoxylocopa)
hirsutissima Maidl (Hymenoptera, Anthophori-
dae). Netherlands Journal of Zoology 25: 516-528.

Vinson, S. B., Frankie, G. W. and Williams, H. J. 1986.
Description of a new dorsal mesosomal gland in
two Xylocopa species (Hymenoptera: Anthophor-
idae) from Costa Rica. Journal of the Kansas En-
tomological Society 59: 185-189.

Wheeler, j' W., Evans, S. L., Blum, M. S., Velthuis, H.
H. W., and Camargo, J. M. F. 1976. ds-2-Methyl-
5-hydroxyhexanoic acid lactone in the mandib-
ular gland secretion of a carpenter bee. Tetrahe-
dron Letters 45: 4029-4032.

Wittmann, D. 1992. Funktionsmorphologie der Vor-
derbeine von Megachiliden-Mannchen. 13. Ta-
gung der deutschsprachigen lUSSI-Sektio)i, Blaubeu
ren. 17 p.

Wittmann, D. and Blochtein, B. 1995. Why males of
leafcutter bees hold the females' antennae with
their front legs during mating. Apidologie 2b: 181
195.

Wittmann, D. and Scholz, E. 1989. Nectar dehydra-
tion by male carpenter bees as preparation for
mating flights. Behavioral Ecology 6 Sociobiology
25:387-391.

J. HYM. RES.
Vol. 9(2), 2000, pp. 370-376

Load-lifting Constraints on Provisioning and Nest Building in the

Carpenter Wasp, Monobia quadridens L.

(Hymenoptera: Eumenidae)

Paula K. Edgar and Joseph R. Coelho

(PKE) Department of Instructional Services, John Wood Community College, 150 South 48th
Street, Quincy, Illinois 62301, USA; (JRC) Department of Biology, Culver-Stockton College, One

College Hill, Canton, Missouri 63435, USA

Abstract. — The foraging and mud-carrying capacity of the trap-nesting carpenter wasp, Monobia
quadridens L., was examined in relation to load-lifting ability. The body mass of caterpillar prey
collected increased over the course of the season. Consequently, the ability of the wasps to carry
prey became compromised late in the season. Caterpillar mass was not correlated with wasp size,
but the mass of mudballs used in nest construction was related to wasp size. Wasp foraging may
be constrained by the size of pyralid caterpillars available at any particular time, which changes
because of caterpillar growth. Mudballs are constructed by the wasps themselves; therefore, wasps
may be able to optimize mudball size in accordance with their own size, but mudballs were much
lighter than caterpillars and never approached the upper limit of the wasps' ability to carry them.

Optimal foraging theory suggests that an
animal will experience increased fitness as
it becomes more efficient at obtaining food
or energy. One obstacle encountered by
flying insects that carry food loads is the
need to generate sufficient lift force to re-
main airborne. Prey selection may be lim-
ited by the size of the prey the insect can
successfully carry while in flight. Marden
(1987) demonstrated that maximum still-air
lift force in flying animals depends primar-
ily on flight muscle mass (MhJ. A fixed
minimum ratio of flight muscle mass to to-
tal mass lifted, the marginal flight muscle
ratio, is required for successful takeoff. An-
imals with higher flight muscle ratios
(FMR) have greater maneuverability, and
should be better able to lift and carry loads,
seize prey, avoid predators and vie for ter-
ritories and mates (Marden 1987).

Recent studies examining the relation-
ship between maximum lift force and ac-
tual load carriage in foraging and provi-
sioning wasps have used ground-nesting
species, including Vespula spp. (Coelho
and Hoagland 1995), Sphecius speciosus

Drury (Coelho 1997), and Sphex ichneu-
moneus L. (Coelho and LaDage 1999). In
the present study we investigate load car-
riage during provisioning and mud-car-
rying in Monobia quadridens L. (Hymenop-
tera: Eumenidae), an aerial nester.

Aerial nesting may apply additional
constraints to load carriage. Two ground
nesting species, the cicada killer (Sphecius
speciosus) and the great golden digger
wasp (Sphex ichneumoneus) are able to car-
ry heavier loads than are theoretically pos-
sible, primarily by climbing vegetation,
then flying toward their burrows (Coelho
1997, Coelho and LaDage 1999). Although
presumably using maximum power, such
overloaded wasps can only descend. Ae-
rial nesters lack this option, as the final
flight to the nest requires a vertical take-
off and ascent to the nest entrance. M.
quadridens may not attempt to carry near-
maximal loads if the load compromises
flight maneuverability and nest entry.

The carpenter wasp, M. quadridens, read-
ily nests in old borings of carpenter bees,
Xylocopa spp. (Tandy 1908, Rau 1935), and

Volume 9, Number 2, 2000

371

is the largest vespoid wasp to use wood
trap-nests (Krombein 1967). A mature fe-
male removes debris inside the nest cavity
and collects mudballs by moistening soil
with water stored in the wasp's crop
(Spradbery 1973) or with saliva (Evans and
Eberhard 1970). Mudballs are used to con-
struct the nest's interior plug, cellular par-
titions and exterior plug. Prior to mass pro-
visioning with paralyzed caterpillar prey, a
female deposits an egg near the inner end
of the cell (Krombein 1967, Spradbery
1973). A partition is constructed between
cells. A vacant space, the vestibular cell, is
made near the nest's opening and sealed
with a thick exterior plug. Monobia quadri-
dens takes four to seven days to provision
a nest (Krombein 1967).

The larva emerges 5 to 8 days after the
egg is laid, feeds on the paralyzed cater-
pillars, applies a varnish to the cell's in-
terior and pupates. The elapsed time be-
tween pupation and adult emergence av-
erages 17 days for males and 18 days for
females (Krombein 1967). Teneral adults
remain inside their cells for 2 to 3 days
while their integument and wings sclero-
tize, then chew through the cell partition
to escape from the nest (Krombein 1967,
Cowan 1991).

Monobia quadridens often provisions its
nest with a single species of Lepidoptera;
with pyralid caterpillars the most fre-
quent. Stenomid and tortricid caterpillars
were also used to provision nests (Krom-
bein 1967). Female M. quadridens collecting
long caterpillars, 10-18 mm, used fewer
caterpillars per cell than those using prey
that were only 6-13 mm in length (Krom-
bein 1967). Theoretically, wasps carrying
larger loads make fewer trips, thus con-
serving time and energy (Reavey 1993).
The demands of temporal and energetic
efficiency therefore interact with the con-
straints of load-lifting.

This study examines how load-lifting
limitations influence the provisioning and
mud-carrying strategies of M. quadridens.
A female wasp should carry caterpillars

and mudballs that are near the maximum
load-lifting capacity without exceeding it
in order to save time and energy by re-
ducing the number of trips. In other
words, a female carrying prey or mudballs
should have a FMR slightly above the
marginal FMR for Hymenoptera, 0.179
(Marden 1987).

MATERIALS AND METHODS

Field research was conducted from June
through September 1996, 1997 and 1998 at
Alice L. Kibbe Life Science Station, Han-
cock County, Illinois. Observations and
data collection were limited to sunny days
because M. quadridens was not very active
on overcast or rainy days.

M. quadridens females were nesting in
abandoned carpenter bee holes in the
wooden support beams beneath the upper
level porch on the east side of the Frank
House, a wooden frame building housing
the field station's education center. To
provide additional nesting sites for M.
quadridens, artificial trap-nests were con-
structed according to Krombein (1967). A
12.7-mm diameter hole was drilled along
the central longitudinal axis of straight-
grain pine boards (38.1 mm X 38.1 mm x
200 mm) to a depth of approximately 152
mm. 12.7 mm dia holes adequately accom-
modate M. quadridens females' large size
(Krombein 1967). Metal brackets held the
traps in place on the faces of the support
beams at two meters.

Initially, female wasps without prey
were captured with an insect net and co-
axed individually into a 1.5 ml microcen-
trifuge tube (ventilated by puncturing a
hole in the lid) and placed in the refrig-
erator for 30 minutes. Wasps were marked
on the dorsal side of the thorax with one
or two small dots of enamel hobby paint.
Special care was taken to avoid getting
paint on antennae, wings or spiracles.
Body mass (Mb) for each wasp was deter-
mined to the nearest 0.001 g on an OhausK
electronic balance. The wasp was then
placed outdoors near the nesting site and

372

Journal of Hymenoptera Research

allowed to recover fully and fly away. In-
dividuals recaptured over the course of
several days had Mh measured for each of
those days.

Subsequent captures of marked females
were made whenever they returned with
a caterpillar or mudball. Wasp and cater-
pillar were collected and placed into a
ventilated tube and unventilated tube, re-
spectively. The caterpillar's body mass
(Mprey) was determined to the nearest 0.001
g. Wasps returning with mudballs were
also captured. Wasp and mudball were
collected and placed into a ventilated tube
and unventilated tube, respectively. Gen-
tle handling of the mudballs was em-
ployed to prevent them from crumbling.
The mudball's mass (Mmud) was deter-
mined to the nearest 0.001 g. In both sit-
uations, marked wasps were chilled, re-
weighed, and released as previously de-
scribed. Multiple caterpillars and /or mud-
balls were often collected from a single
individual. After a wasp arrived with its
third (at most) caterpillar it was placed in
an airtight tube and frozen. The number
of mudballs collected before the wasp was
taken was highly variable. For two indi-
viduals, both caterpillar and mudball data
were obtained. Female wasps were frozen
and transported to the laboratory for ad-
ditional measurements. An Ohaus analyt-
ical balance accurate to ± 0.0001 g was
used to determine Mb for each female
wasp. The head, abdomen, legs and wings
were cut away and thorax mass (Mlh) was
measured. Because flight muscle compos-
es 95% of thorax mass in Hymenoptera
(Marden 1987), flight muscle ratio was cal-
culated as 0.95Mth/Mb. Operational (load-
ed) flight muscle ratio (FMR,,) was deter-
mined as 0.95Mth/(Mb + mass of load car-
ried). Voucher specimens were deposited
in the Entomology Museum of Western Il-
linois University.

Average Mb and unloaded FMR were
calculated for individual wasps that car-
ried multiple caterpillars and /or mud-
balls. The individual averages were then

0.35

~ 0.3

</) 0.25

E 0.2

!o.15

£ 0.1 +

° 0.05

180

200

220 240

Julian day

260

Fig. 1. The effect of time of year on body mass of
caterpillars carried by Monobia quadridens.

used to determine all descriptive statistics
for each of these categories to avoid pseu-
doreplication (Zar 1996). Statistical analy-
ses were performed using Systat' 6.0 for
Windows (SPSS Inc., Chicago, IL), Corel
Quattro Pro' 6.02 for Windows (Corel
Corp. Ltd.), and StatMost" (Datamost
Corp.)

RESULTS

Data were collected on a total of 54 fe-
male M. quadridens: 10 from 1996, 24 from
1997 and 20 from 1998. Thirteen wasps re-
turned more than once with loads prior to
being sacrificed, thus sample sizes differ
for prey, mudballs and total wasps. All
prey carried by M. quadridens were in the
family Pyralidae.

Regression analysis of Mprey on Mb for
all wasps was not significant, nor was
Mprev on Mth (P > 0.05). The average Mb
was 0.2184 ± 0.0059, n = 54. The smallest
wasp (0.09 g) was observed hauling two
caterpillars simultaneously with a total
prey mass of 0.104 g. This load was almost
identical to the average load carried by a
female nearly three times the size of the
smallest wasp.

Caterpillar body mass increased over
the course of the season and was linearly
related to Julian day (Mprey = -0.299 +
0.001 9day, n = 74, R2 = 0.316, F = 33.3, p
< 0.0001) (Figure 1). Late-season caterpil-
lars were nearly double the Mb of those
taken during June and July.

Increasing caterpillar size affected the

Volume 9, Number 2, 2000

373

U.4

0.35

-o 0.3

-2 0.25

*■ 0.2 +

0.15

180

£ -3.

-marginal

200

220 240

Julian day

260

Fig. 2. The effect of time of year on operational
(prey-loaded) flight muscle ratio in wasps carrying
caterpillars. The marginal level indicates the mini-
mum flight muscle ratio required for successful take-
off.

5 12

E 8

I 6

Marginal
FMR

Ll-Dil

HH.

0.14 0.18 0.22 0.26 0.3 0.34 0 38 0 42
Prey-loaded FMR

Fig. 3. The distribution of operational flight muscle
ratios among wasps carrying caterpillars. The mar-
ginal level indicates the minimum flight muscle ratio
required for successful take-off.

prey loaded FMR„ (0.2633 ± 0.0054, n =
71), which decreased significantly over the
course of the season (FMR,, = 0.544-
0.0131day, n = 71, R2 = 0.267, F = 25.1, p
< 0.0001) (Figure 2). Late in the season,
the increase in prey mass caused the load-
ed FMRs to fall below the marginal FMR
for Hymenoptera.

In four of 71 (5.6%) foraging events, the
wasp had an average loaded FMR below
the marginal FMR (Figure 3). Each of these
individuals carried large caterpillars
weighing an average of 0.252 g. This mass
was 233% greater than the overall mean
Mprev (0.108 g). No early-season, prey-lad-
en wasp approached the marginal FMR
for Hymenoptera.

As wasp size increased, the size of mud-
balls (mean = 0.0513 ± 0.0032 g) used
during nest construction increased. Signif-
icant relationships demonstrated the effect
of wasp mass on mudball mass: Mb versus
Mmud (Mmud = 0.0051 + 0.1943Mb, n = 38,
R2 = 0.270, F = 13.3, p = 0.0008) (Figure
4). A weaker, but significant effect of Mlh
on Mmud was also present (Mmiu) = -0.0054
+ 0.6072M,,,, n = 27, R2 = 0.205, F = 6.44,
p = 0.018).

The average mudball mass was 50% less
than and significantly different from (t =
7.36, df = 99, p < 0.0001, t-test) the aver-
age prey mass (0.1081 g ± 0.0069, n = 74).
Consequently, the mean FMR for females

loaded with mudballs, (0.3099 ± 0.0033, n
= 27) was well above the marginal FMR.

DISCUSSION

Wasp body mass and thorax mass did
not affect the size of prey provisioned. If
females were actively selecting prey by
size, they should take the largest caterpil-
lars they can lift. Thus, larger wasps
would be choosing larger prey, as occurs
in S. ichneumoneus (Coelho and LaDage
1999) and Palinodes laeviventris Cresson
(Gwynne and Dodson 1983). Females
would spend less time foraging and en-
ergy would be conserved. However, ob-
servations of M. quadridens did not sup-
port this hypothesis.

As the season progressed, caterpillar

0.1

_0 08
a>

lo.06

I 0 04

5 0.02

0 14 0.16 0 18 0 2 0.22 0.24 0.26 0.28 0.3 0 32
Wasp body mass (g)

Fig. 4. The effect of wasp bodv mass on mass of
mudballs carried bv Monobia quadridens.

374 Journal of Hymenoptera Research

size increased, consequently decreasing time and energy resulting from failed for-
the FMRo of foraging wasps. Early in the aging attempts on large caterpillars sug-
season, females exhibited no difficulty in gests that either small caterpillars were in
carrying prey. Prey mass was never large short supply, or that success was frequent
enough to substantially decrease the enough to outweigh failure. Indeed, on oc-
FMR,,; therefore, loaded females remained casion females successfully brought in
well above the marginal FMR for Hyme- prey larger than themselves. In one case,
noptera. In August, however, provision- a female was loaded with a caterpillar 1.5
ing females encountered load-lifting con- times greater than her own body mass,
straints because of the increasingly large Similar effects of changing prey size be-
caterpillars. As a result, the FMR of loaded cause of prey growth are known from oth-
individuals dropped near or slightly be- er species. Seasonal variation in caterpillar
low the marginal FMR. size also dramatically affects the provi-
Considering the prey cues available to sioning style of the solitary digger wasp
predatory wasps and their acute visual Ammophila sabulosa L. (Field 1992). Large
abilities, it is doubtful that early in the sea- prey are taken more frequently during the
son M. quadridens females would be inca- second part of the nesting period (entire
pable of finding larger caterpillars if such nesting period runs from late June
prey were present (Stamp and Wilkens through early September) and are carried
1993). It is more likely that females pro- on foot. Early in the season, when smaller
visioned smaller prey at this time because prey are more common, provisioning
they were the most readily available, if not wasps require a greater number of small
the only suitable prey available. prey, which they carry in flight. Further-
In early summer, females, regardless of more, smaller wasps multiply-provision
individual size, primarily foraged on their nests (using smaller prey) more fre-
small-bodied caterpillars. Caterpillars pre- quently than larger wasps (Field 1992).
sumably grew as the summer progressed, Brockman and Grafen (1992) describe
and late in the season M. quadridens fe- the effect of the growth of spiders on their
males were not always successful in their predator, the mud-dauber, Trypoxylon pol-
attempts to carry the larger caterpillars. Hum Say. At the start of the season, wasps
On one occasion a female made no at- forage on a genus of spiders (Eustala) that
tempt to recover a large caterpillar after overwinter as adults. The majority of the
dropping it. Another low-flying wasp fell season, wasps provision with the genus
to the ground without dropping the prey Neoscona, which overwinter as spiderlings.
item, crawled 30 cm up a beam then flew As spider size gradually increases, wasps
183 cm (horizontal flight) and landed on a late in the season experience difficulty
chair. Again, she tumbled to the ground hauling the larger spiders, frequently
and dragged the caterpillar 147 cm dropping them. Additionally, wasps ex-
through the grass prior to abandoning it. pend more energy and risk being attacked
These two late season caterpillars had an by large adult spiders. Landes et al. (1987)
average mass of 0.256 g, which was twice found that "wasps collected spiders in
the size of the largest early season cater- numbers relative to their seasonal and rel-
pillar. As a result, individual FMR,, fell to ative abundance, accessibility as prey, or
between 0.239 and 0.165, and caterpillars size suitability."

were dropped. In addition to carrying caterpillar prey,
Typically, predators choose prey that female M. quadridens also carried mud-
are large enough to make it worth their balls used in nest construction. Wasp
time and energy, yet small enough to be body mass significantly influenced the
easily carried (Reavey 1993). The loss of mass of mudballs carried. This effect sug-

Volume 9, Number 2, 2000

375

gests that females constructed mudballs of
a size proportional to their individual
body size. These findings are consistent
with Archer's (1977) study of Paravespula
vulgaris (L.), in which forager body size
was significantly correlated to the earthen
load carried by wasps leaving the nest.

In contrast to several of the prey-loaded
FMRs that dropped below the marginal
FMR, females never carried mudballs
large enough to substantially decrease
their FM^. The FMRmud values were far
greater than the marginal FMR. M. quad-
ridens may not optimize energy costs of
mudball production and carriage because
of the style used to carry mudballs. Wasps
may be restricted to making small, round
mudballs compact enough to be easily car-
ried in their mandibles. The difference in
carriage style between prey and mud per-
haps best explains why female M. quadri-
dens could haul heavier prey loads than
mudballs. Caterpillars were grasped with
all legs and held lengthwise against the fe-
male's underside without altering the cen-
ter of gravity (Evans 1962). In contrast,
mudballs carried with the mandibles and
forelegs placed additional weight toward
the head, altering balance. To compensate,
individuals may have been restricted to
hauling mudballs that were much lighter
than the prey.

On average, M. quadridens' unloaded
FMR (0.385), although higher than the
mean for Hymenoptera (0.34 ± 0.013, n =
15; data from Marden 1987, Coelho 1991,
1997, Coelho & Hoagland 1995, Coelho
and LaDage 1999), is similar to that of oth-
er vespoids such as Vespula (Coelho and
Hoagland 1995). M. quadridens' FMR was
considerably lower than that of the
ground-nesting sphecids Sphecius speciosus
(0.416, Coelho 1997) and Sphex ichneumo-
neus (0.462, Coelho and LaDage 1999). M.
quadridens is therefore less maneuverable
than the ground nesters when unladen.
However, the mass allocation of M. quad-
ridens should be matched to the maximum
demands of load carriage, which occur

when prey are carried. Only 5.6% of pro-
visioning events caused M. quadridens to
have an FMR,, below marginal. In contrast,
Sphecius speciosus and Sphex ichneumoneus
provision at levels below marginal FMR„
90% (Coelho 1997) and 25% (Coelho and
LaDage 1999) of the time, respectively.
Therefore, M. quadridens is on average
more maneuverable when provisioning
than the ground nesters. Aerial nesting
may, in fact, carry maneuverability restric-
tions as predicted.

ACKNOWLEDGMENTS

Appreciation is given to Richard V. Anderson and
Gregg Dieringer for their support and insightful sug-
gestions. Gratitude is extended to Robert W. Longair
for identifying Monobia quadridens and for his helpful
advice. Sharon Bringer, Quoc Giang and Brian Kras-
kiewicz provided additional assistance in the field.
Matthew McClure helped identify the caterpillars.
Andy Edgar constructed the trap nests.

LITERATURE CITED

Archer, M. E. 1977. The weights of forager loads of
Paravespula vulgaris (Linn.) (Hymenoptera: Ves-
pidae) and the relationship of load weight to for-
ager size. Insectes Sociaux 24: 95-102.

Brockman, H. ]. and A. Grafen. 1992. Sex ratios and
life history patterns of a solitary wasp, Trypoxy-
lon (Trypargilum) politum (Hvmenoptera: Spheci-
dae). Behavioral Ecology and Sociobiology 30: 7-27.

Coelho, J. R. 1991. The effect of thorax temperature
on force production during tethered flight in
honeybee (Apis mellifera) drones, workers, and
queens. Physiological Zoology 64: 823-835.

Coelho, J. R. 1997. Sexual dimorphism and flight be-
havior in cicada killers, Sphecius speciosus. Oikos
79: 371-375.

Coelho, J. R. and J. Hoagland. 1995. Load-lifting ca-
pacities of three species of yellow-jackets (\ es
pula) foraging on honev-bee corpses. Functional
Ecology 9: 171-174.

Coelho, J.R. and L.D. LaDage. 1999. Foraging capacity
of the great golden digger wasp, Sphex ichneu-
moneus L. Ecological Entomology 24: 4S0-4S3.

Cowan, D. P. 1991. The solitary and presoda] vespi-
dae. pp. 33-73. In: K. G. Ross and R. VV. Mat-
thews (eds), The Social Biology <■' Wasps. Corn-
stock Publishing Associates, Ithaca, 673 pp.

Evans, H. E. 1962. The evolution ol prey-carrying
mechanisms in wasps / volution 16: 468 483

Evans, H. E. and M. J. Eberhard. 1970. The Wasps. The
University of Michigan Press, Ann Arbor 265

376

Journal of Hymenoptera Research

Field, J. 1992. Patterns of provisioning and parental
investment in the solitary digger wasp Ammo-
phila sabulosa. Ecological Entomology 17: 43-51.

Gwynne, D. T. and G. N. Dodson. 1983. Nonrandom
provisioning by the digger wasp, Palmodes laevi-
ventris (Hymenoptera: Sphecidae). Annals of the
Entomological Society of America 76: 434^436.

Krombein, K. V. 1967. Trap-Nesting Wasps and Bees:
Life Histories, Nests, and Associates. Smithsonian
Press, Washington, D.C., 570 pp.

Landes, D. A., M. S. Obin, A. B. Cady, and J. H. Hunt.
1987. Seasonal and latitudinal variation in spider
prey of the mud dauber Chalybion californiatm
(Hymenoptera: Spechidae). Journal of Arachnology
15: 249-256.

Marden, ]. H. 1987. Maximum lift production during
takeoff in flying animals. Journal of Experimental
Biology 130: 235-358.

Reavey, D. 1993. Why body size matters to caterpil-
lars, pp. 248-279. In: N. E. Stamp and T. M. Cas-

ey (eds), Caterpillars: Ecological and Evolutionary
Constraints on Foraging. Chapman and Hill, New
York, 587 pp.

Rau, P. 1935. The courtship and mating of the wasp,
Monobia quadridens (Hymen. :Vespidae). Entomo-
logical News 16: 57-58.

Spradbery, J. P. 1973. Wasps: an Account of the Biology
and Natural History of Solitary and Social Wasps.
University of Washington Press, Seattle, 408 pp.

Stamp, N. E. and R. T. Wilkens. 1993. On the cryptic
side of life: being unapparent to enemies and the
consequences for foraging and growth of cater-
pillars, pp. 283-330. In: N. E. Stamp and T. M.
Casey (eds), Caterpillars: Ecological and Evolution-
ary Constraints on Foraging. Chapman and Hill,
New York, 587 pp.

Tandy, M. 1908. The carpenter mud wasp (Mo)iobia
quadridens). Entomological News 19: 231-232.

Zar, J. 1996. Biostatistical A>ialysis. Prentice-Hall, New
Jersey, 620 p.

J. HYM. RES.
Vol. 9(2), 2000, pp. 377-384

Reproductive Biology of the Seed-harvester Ants Messor julianus
(Pergande) and Messor pergandei (Mayr) (Hymenoptera: Formicidae)

in Baja California, Mexico

Robert A. Johnson
Department of Biology, Arizona State University, Tempe, Arizona 85287-1501, USA

Abstract. — The seed-harvester ant Messor julianus (Pergande) exhibits a parapatric distribution
pattern with the ecologically equivalent congener M. pergandei (Mayr) in the Baja California pen-
insula of Mexico; M. pergandei replaces M. julianus in drier soil microhabitats within the contact
zone between these two species. This paper describes the reproductive biology of M. julianus and
M. pergandei to provide a first step in understanding factors involved in causing this replacement
pattern. Mating flights of M. julianus were observed over a several week period from early Feb-
ruary to early March, and thus appear similar to those of M. pergandei. Likewise, starting nests of
both species contained one foundress. Moreover, the similar ecology and mating flights of M.
julianus and M. pergandei suggest that the replacement pattern exhibited by these two species is
associated with patterns of foundress survival. In regard to mating flights, both M. julianus and
M. pergandei are postulated to have diverged from the putative ancestral condition of summer
mating flights that occur in other Nearctic congeners. This seasonal difference in timing of the
mating flight for these two species correlates with their being the only Nearctic species of Messor
that are restricted to hot desert habitats. Alate females for both M. julianus and M. pergandei have
poor tolerance to high temperature relative to desert ants in the genera Aphaenogaster and Pogon-
omyrmex.

The seed-harvesting ant genus Messor
(Hymenoptera: Myrmicinae) is common
throughout the southwestern deserts of
the United States and northwestern Mex-
ico. Four species of Messor, M. andrei
(Mayr), M. julianus (Pergande), M. pergan-
dei (Mayr), and M. stoddardi (Emery), oc-
cur in the Baja California peninsula of
Mexico; M. julianus is endemic to the pen-
insula (Johnson 2000a; R. Johnson and P.
Ward, unpubl. data) (Fig. 1). Two of these
species, M. julianus and M. pergandei, are
common in most low elevation habitats (<
— 1000 m) with their combined geographic
distributions encompassing all but the
northwest portion of the peninsula. The
other two species, M. andrei and M. stod-
dardi, are largely restricted to coastal and
adjacent inland areas along the Pacific
Coast. In the Baja California peninsula, M.
andrei is restricted to the relatively mesic

California Floristic province in the north-
west portion of the peninsula (R. Johnson
and P. Ward, unpubl. data). The range of
M. stoddardi extends to central portions of
the peninsula, but this species rarely co-
exists with M. julianus or M. pergandei (R.
Snelling, unpubl. data; R. Johnson, pers.
obs.) (Fig. 1).

Messor julianus and M. pergandei are eco-
logically similar species. Colonies of both
species consist of many thousands of
workers that forage in long columns
(Johnson 2000a), and these two species are
the only Nearctic Messor that are restricted
to occurring in hot desert habitats (Wheel-
er and Wheeler 1973). Geographically, M.
julianus is mostly restricted to central and
southern portions of the peninsula, while
M. pergandei occurs in eastern portions of
the peninsula to as far south as northeast-
ern BCS (the state of Baja California Sur)

378

Journal of Hymenoptera Research

California

Baja California

Messor
A andrei
o julianus
• pergandei
a stoddardi

Baja California Sur

70 0 70 140 Kilometers

Fig. 1. Geographic distribution of species of Mt'ssor that occur in the Baja California peninsula, Mexico. The
full geographic distribution of each species is given in Johnson (2000a).

(Fig. 1). In northern and central BC (the
state of Baja California), M. julianus inhab-
its a narrow range along the cool Pacific
Coast, while M. pergandei is restricted to
xeric desert areas along the eastern coast.
Moreover, these two species exhibit a par-
apatric distribution pattern (herein de-
fined as species that occupy separate but
adjoining areas, such that only a small

fraction of individuals in each encounters
the other [Futuyma and Mayer 1980]) with
ranges of the two species overlapping
across a contact zone in the central pen-
insula (Fig. 1). While the two species are
often sympatric within the contact zone,
the pattern across the contact zone is one
in which the two species replace one an-
other along local gradients that correlate

Volume 9, Number 2, 2000 379

with abiotic habitat features (Johnson out the flight period each day, alates fly-
2000a). Across the contact zone, M. pergan- ing from nests were counted during se-
dei inhabits the drier microhabitats, i.e., quential 2 minute visits to each nest. Am-
those that are lower in elevation or in bient temperature was measured periodi-
which the soils have a higher percentage cally about 5 cm above ground using a
composition of sand (drier soils) (R. John- thermocouple thermometer,
son, pers. obs.). The number of foundresses per starting
Colony founding is the most vulnerable colony was determined by excavating
stage in the life history of ants (Tschinkel founding nests of M. julianus and M. per-
1992, Herbers 1993, Johnson 1998), and it gandei. Data for M. julianus were collected
is this stage that likely determines micro- 17-18 km west of La Purisima, BCS,
and macro-distribution of adult colonies. (26°09'N, 112°13'W) in March 1992, and
Thus, comparative data on reproductive near Punta San Hipolito, BCS, (27°00'N,
biology of M. julianus and M. pergandei 114°00'W) in February 1998. These same
provide a first step in understanding fac- data were collected for M. pergandei near
tors involved in causing the replacement Highway 1 at 17.5 km west of Bahia de los
pattern exhibited by these two species. Angeles, BC, (28°59'N, 113°44'W) and
Mating flights of M. pergandei are well along Highway 1 at 6 km south of the pa-
known and typically occur between late ved turnoff to Bahia de los Angeles, BC,
January and mid-March (Pollock and Riss- (29°00'N, 114°10'W) in February 1995.
ing 1985, Ryti 1988, Cahan et al. 1998), and I assessed relative tolerance to high tem-
thus deviate seasonally from the summer perature by comparing survival for alate
mating flights of other Nearctic Messor females of M. julianus and M. pergandei
(Creighton 1953, Cole 1963, McCluskey with that of two species of Aphaenogaster
1963, Wheeler and Wheeler 1973, Snelling (A. albisetosa and A. cockerelli) and four
and George 1979, Brown 1999, R. Snelling, species of Pogonomyrmex (P. barbatus, P. oc-
unpubl. data, M. Bennett, pers. comm.). In cidentalis, P. rugosus, and P. salinus) (see
contrast, the mating flights and the female Table 1 for collection data); mating flights
sexuals of M. julianus are undescribed in of both species of Aphaenogaster and all
the literature. Based on the fact that M. ju- four species of Pogonomyrmex are trig-
lianus and M. pergandei are the only Ne- gered by summer rains (Johnson 2000a).
arctic Messor that are restricted to hot de- Trials used test tubes that were partially
sert habitats, I hypothesized that the sea- filled with water trapped by cotton plugs,
sonal timing of mating flights was similar Alate females were placed into the tubes
for these two species. I assessed potential and the openings were plugged with
physiological constraints on mating flight moist cotton, thus providing ad libitum
season by comparing high temperature water at both ends. Trials at each temper-
tolerance for alate females of Messor, ature used one tube containing 25 individ-
Aphaenogaster, and Pogonomyrmex. uals of one species that had been collected

from at least four colonies. A separate set

Mb 1 HODS Qf individuais was used at each tempera-

I observed ten colonies of M. julianus ture. Each species was tested over 1° C in-
over nine days in mid-February 1993, near crements that resulted in mortality rang-
Highway 1 at 26 km northwest of Santa ing from 0-100%. The tubes were placed
Rosalia, BCS (27°23'N, 112°28'W). All ten in a darkened incubator for 2 hours at the
colonies had large nests and an active for- appropriate temperature; individuals un-
aging column. The site was a sandy plain able to right themselves after that time
dominated by Larrea tridentata, Opuntia were considered dead. Mortality data
cholla, and Pachycereus pringlei. Through- were compared among congeners and

380

Journal of Hymenoptera Research

Table 1. Collection data for alate females used in

temperature tolerance tests.

Localities

are in the United

States except as noted.

Species

Collection Locale

Latitude

Longitude

Elevation

(m)

Collection
Date

Aphaenogaster

A. albisetosa Mayr

AZ: Pinal Co., 8 km NE
Casa Grande

32°56'N

111°42'W

430

26 JUL 1995

A. cockerelli Andre
Messor

NM: Hildago Co., Jet.
Hwys 9 & 80

31°56'N

109°02'W

1260

16 JUL 1994

M. julanus (Pergande)

MEXICO: Baja Califor-
nia, 47.5 km S Bahia
de los Angeles

28°38'N

113°20'W

3 FEB 1995

M. pergandei (Mayr)

MEXICO: Baja Califor-
nia, 29 km S Bahia de
los Angeles

28°41'N

113°26'W

105

4 FEB 1995

Pogonomyrmex
P. barbatus (Smith)

NM: Hildago Co., 3 km
N Rodeo

31°52'N

109°02'W

1225

5 JUL 1993

P. occidentalis

(Cresson)

P. rugosus Emery

P. salinus Olsen

AZ: Yavapai Co., Chino

Valley
NM: Hildago Co., Jet.

Hwys 9 & 80
NV: Clark Co., Dry Lake

34°46'N
31°56'N
35°54'N

112°27'W
109°02'W
114°56'W

1450

1260

520

30 JUL 1995

5 JUL 1993

30 AUG 1993

across genera using a contingency table
analysis. For across genera comparisons,
data sometimes were not available for
temperatures below or above those caus-
ing 0 and 100% mortality. To make these
comparisons, I assumed that the upper
and lower bounds were threshold temper-
atures.

Voucher specimens are deposited at the
Museum of Comparative Zoology, Har-
vard University, Cambridge, Massachu-
setts, the Los Angeles County Museum of
Natural History, Los Angeles, California,
and the Robert A. Johnson collection,
Tempe, Arizona.

RESULTS

I observed mating flights of M. julianus
from early February to early March. At the
site northwest of Santa Rosalia, BCS,
alates flew from 6 of the 10 observation
colonies, with few alates released each
day. Flights occurred on 4 of 9 days and
were relatively synchronous among colo-
nies, i.e., on a given day, alates either flew
from several colonies or none of the colo-

nies (Figure 2). Mating flights typically oc-
curred from 0830-1000 h (MST) at tem-
peratures of 16-23° C. Flights occurred ir-
respective of mild breezes or overcast
skies, but were precluded by light rain or
moderate breezes. Alates temporarily re-
treated into nests following gusts of wind.
After the last day, I excavated the ten ob-
servation colonies and several adjacent
colonies. In all colonies, alates were pre-
sent in very low numbers or absent.

Mating flights of M. julianus were also
observed on 5 March, 1992, at 17 km west
of La Purfsima, BCS, (26°09'N, 112°13'W)
and on 5 February, 1995, at 48.7 km south
of Bahia de los Angeles, BC (28°38'N,
113°20'W). At the latter site, ten marked
colonies of M. julianus were observed on
31 January and 5 February. On 31 January,
no alates were observed outside any of the
ten colonies and no foundresses were lo-
cated at the site. On 5 February, alates
were observed outside 6 of the 10 colonies
and individuals flew from one of these
nests and from several unmarked nests.
Mating flights of M. pergandei were ob-

Volume 9, Number 2, 2000

381

i i

i i i

K 10
LU

a. 5

LU
CD

l,o

s 5

i i i

< 10

10
5

i i i

13 14 15 16 17 18 19 20 21
FEBRUARY

Fig. 2

Flight activity for six colonies of Messor ju-
lianus northwest of Santa Rosalia, Baja California Sur,
Mexico, during February 1993. For each day, data are
from the two minute observation period in which the
highest number of alates were released from the nest.

served on 26 February, 1991, at Punta Es-
trella, BC, (30°55'N, 114°43'W) on 29 Feb-
ruary, 1992, along Highway 1 at 16.0 km
east of San Ignacio, BCS, (27°20'N,
112°46'W) and on 1-2 February, 1995,
along Highway 1 at 17.5 km west of Bahia
de los Angeles, BC (28°59'N, 113°44'W).
The latter site had been visited several
days earlier, but no foundresses of M. per-
gandei were located. All of 44 and 127
starring nests for M. julianus and M. per-
gandei, respectively, contained one foun-
dress (Table 2).

Tolerance to high temperature was first
compared between congeners. Species
within all three genera had similar toler-
ance to high temperature (Chi-square, P >
0.10), so data for species within each ge-
nus were pooled. In contrast, tolerance to
high temperature varied significantly
across genera (Chi-square = 231.9, 14 df,
P < 0.001). Subsequent between-genus
tests demonstrated that temperature tol-
erance differed between Messor and both
Aphaenogaster (Chi-square = 34.9, 5 df, P
< 0.001) and Pogonomyrmex (Chi-square =
181.3, 7 df, P < 0.001). The primary con-
tributors to Chi-square values were at low
temperatures, where mortality was higher
than expected for Messor and lower than
expected for Aphaenogaster and Pogonomyr-
mex (Table 3). Overall, most individuals
survived to 42^13° C in Messor, 44—45° C
in Aphaenogaster, and 46-47° C in Pogono-
myrmex.

DISCUSSION

Reproductive biology of M. julianus ap-
pears similar to that of M. pergandei. The
asvnchronous late winter to early spring
mating flights of both species appear cued
by photoperiod (McCluskey 1963) and ex-
tend for several weeks both within and
among nests (Pollock and Rissing 1985).
Mating flights of M. julianus were ob-
served from early February7 through early
March, and anecdotal observations sug-
gest that most alates were released during
this several week period. For example, at
one site alates were observed outside of
nests in earlv Februarv but not several
days earlier, which suggests that this was
near the beginning of the mating flight
season. Similarly, few if any alates could
be excavated from nests after late Febru-
ary, suggesting the end of the mating
flight season.

Mating flights of M. pergandei occur
from earlv to mid-morning under clear
skies as air temperatures reach about 22
C. The lower temperatures at which A I. ju-
lianus initiates mating flights are associat-

382

Journal of Hymenoptera Research

Table 2. Number of foundresses in starting nests of Messor julianus and M. pergandei in the Baja California
peninsula, Mexico. For location, BC = Baja Californa; BCS = Baja California Sur.

Foundress

Association Size

Location

Latitude

Longitude

Elevation

(m)

Species

Date

M. julianus

17-18 km W La
Purisima, BCS

26°09'N

112°13'W

100

4-5 MAR 1992

Punta San Hipoli-
to, BCS

26°58'N

113°59'W

10 FEB 1998

Total

M. pergandei

Punta Estrella, BC

30°55'N

114°43'W

25-27 FEB 1991

Highway 1 at 17.5
km W of Bahia
de los Angeles,
BC

28°59'N

113°44'W

3 FEB 1995

Highway 1 at 6
km S of turnoff
to Bahia de los
Angeles, BC

29°00'N

114°10'W

365

3 FEB 1995

Total

127

ed with this species also foraging at much
lower temperatures. During winter and
spring, foraging columns of M. julianus
form prior to dusk and foraging continues
into the night until ground temperatures
decrease to < 11° C (R. Johnson, unpubl.
data). Conversely, M. pergandei forages di-
urnally during this season, beginning after
ground temperatures reach about 18° C
(Bernstein 1974). While flights of M. per-
gandei are often precluded by overcast
weather or slight breezes (Pollock and
Rissing 1985), those of M. julianus often

proceeded, at least at low levels, under
these conditions.

Both M. pergandei and M. julianus are
haplometrotic (one foundress per starting
nest) in the Baja California peninsula. In
M. pergandei, the number of foundresses
varies geographically from haplometrosis
in southern California to pleometrosis
(multiple foundresses per starting nest) in
southeastern California and Arizona (Pol-
lock and Rissing 1985; Ryti 1988; Cahan et
al. 1998; Rissing et al. 2000). However, ma-
ture colonies of M. pergandei have a single

Table 3. High temperature tolerance (°C) for alate females in the ant genera Aphaenogaster, Messor, and
Pogonorm/rtnex. Values are per cent mortality for 25 individuals over 2 h with ad libitum moisture.

Species

I emperature ( C)

A. albisetosa
A. cockerelli

M. julianus
M. pergandei

P. barbatus
P. occidental is
P. rugosus
P. salinus

0.0

4.0

0.0

48.0

80.0

100.0

0.0

4.0

44.0

100.0

0.0

72.0

100.0

4.0

88.0

100.0

0.0

44.0

100.0

0.0

12.0

100.0

0.0

2.0

0.0

48.0

100.0

0.0

80.0

100.0

Volume 9, Number 2, 2000 383

queen regardless of the initial founding sumably having invaded North America
strategy (Rissing and Pollock 1987; S. Riss- from Asia via Beringia (R. Snelling, pers.
ing and J. Parker, unpubl. data). These comm.). Alternatively, some recent evi-
data extend the distribution of haplome- dence suggests that the Aphaenogaster spe-
trosis for M. pergandei from southeastern cies belonging to the former Novomessor
California to its southern range limit in the (including A. albisetosa and A. cockerelli)
Baja California peninsula such that both are the sister group to Nearctic Messor
M. pergandei and M. julianus are haplo- (Bennett 2000). Moreover, evaluating the
metrotic where the two species are sym- ancestral mating flight condition depends
patric. Mating occurs in the air for M. per- upon determining the appropriate out-
gandei (S. Rissing, pers. comm.) and M. an- group. The relationship between M. juli-
drei (R. Johnson, pers. obs.), with in copulo anus and M. pergandei is also poorly re-
pairs of both species sometimes falling to solved (Bennett 2000) because the clade
the ground; mating in M. julianus is prob- containing these two species also contains
ably similar. M. lariversi, which is a Great Basin species

The replacement pattern exhibited by that has summer mating flights.
M. julianus and M. pergandei is common One possible evolutionary scenario is
among seed-harvester ants in western the late winter to early spring flights
North America (Johnson 2000a). For ex- evolved one time and are common by de-
ample, the ecologically equivalent species scent in M. pergandei and M. julianus. If
Pogonomyrmex barbatus and P. rugosus seg- this is the case, the shift from a summer
regate microhabitats along gradients of to a late winter to early spring flight sea-
soil texture. Foundresses of P. rugosus son may have been necessitated by phys-
have a higher tolerance to desiccating con- iological constraints related to tempera-
ditions, which correlates with this species ture tolerance, and prerequisite to these
occurring in drier soil microhabitats (John- two species invading hot desert habitats,
son 2000b). The similar ecology and mat- Moreover, alate females of both species
ing flights of M. julianus and M. pergandei have poor heat tolerance compared to spe-
suggest that the micro- and macro-habitat cies of Aphaenogaster and Pogonomyrmex,
differences exhibited by these two species suggesting Messor foundresses could not
are also associated with patterns of foun- survive soil temperatures present during
dress survival. Given that M. pergandei in- summer. A similar temperature constraint
habits the more xeric micro- and macro- occurs in the desert leaf-cutter ant Acro-
habitats, it is predicted that foundresses of myrmex versicolor, whose mating flights
this species are more desiccation tolerant are triggered by late summer rains. Fe-
than are foundresses of M. julianus (John- males of A. versicolor also have poor tol-
son 2000a). erance to high temperature, and the foun-

The late winter to early spring mating dresses survive by selectively initiating

flights of M. julianus and M. pergandei are nests in shaded, cooler microhabitats

correlated with these being the only two (Rissing et al. 1986).
Nearctic Messor that are restricted to hot

desert habitats (Wheeler and Wheeler ACKNOWLEDGMENTS

1973). However, it is difficult to determine Tnis manuscript benefited from comments and dis-

the sequence of character-state change in cussions uith S.W. Rissing and R.R. Snelling, and by

, .•, ,. n. , , .,, . xt .• comments from two anonymous reviewers.
timing of the mating flight within Nearctic

Messor because the phylogenetic relation- LITERATURE CITED

ships of this species group are unclear. Bennett M 2000 Systematics ot tlu, Nearcti( l,,im.

Messor is a predominantly Old World ge- vore ant genus Veromessor. PhD thesis, Univ. Ca-

nus, with the Nearctic components pre- lit.

384

Journal of Hymenoptera Research

Bernstein, R.A. 1974. Seasonal food abundance and
foraging activity in some desert ants. American
Naturalist 108:490-498.

Brown, M.J.F. 1999. Semi-claustral founding and
worker behaviour in gynes of Messor andrei. In-
sectes Sociaux 46:194-195.

Cahan, S., Helms, K.R., Rissing, S.W. 1998. An abrupt
transition in colony founding behaviour in the
ant Messor pergandei. Animal Behaviour 55:1583-
1594.

Cole, A.C. 1963. A new species of Veromessor from
the Nevada test site and notes on related species
(Hymenoptera: Formicidae). Annals of the Ento-
mological Society of America 56:678-682.

Creighton, W.S. 1953. New data on the habits of the
ants of the genus Veromessor. American Museum
Novitates 1612:1-18.

Futuyma, D.J., Mayer, G.C. 1980. Non-allopatric spe-
ciation in animals. Systematic Zoology 29:254-271.

Herbers, J.M. 1993. Ecological determinants of queen
number in ants, pp. 262-293. In L. Keller (ed.),
Queen Number and Sociality in Insects. Oxford
University Press, New York.

Johnson, R.A. 1998. Foundress survival and brood
production in the desert seed-harvester ants Po-
gonomyrmex rugosus and P. barbatus (Hymenop-
tera, Formicidae). Insectes Sociaux 45:255-266.

Johnson, R.A. 2000a. Seed-harvester ants (Hymenop-
tera: Formicidae) of North America: an overview
of ecology and biogeography. Sociobiology 36:83-
122.

Johnson, R.A. 2000b. Habitat segregation based on
soil texture and body size in the seed-harvester

ants Pogonomyrmex rugosus and P. barbatus. Eco-
logical Entomology, in press.

McCluskey, E.S. 1963. Rhythms and clocks in har-
vester and Argentine ants. Physiological Zoology
36:273-292.

Pollock, G.B., Rissing, S.W. 1985. Mating season and
colony foundation of the seed-harvester ant, Ver-
omessor pergandei. Psyche 92:125-134.

Rissing, S.W., Pollock, G.B. 1987. Queen aggression,
pleometrotic advantage and brood raiding in the
ant Veromessor pergandei (Hymenoptera: Formi-
cidae). Animal Behaviour 35:975-981.

Rissing, S.W., Johnson, R.A., Martin, J.W. 2000. Col-
ony founding behavior of some desert ants: geo-
graphic variation in metrosis. Psyche 103:95-101.

Rissing, S.W., Johnson, R.A., Pollock, G.B. 1986. Natal
nest distribution and pleometrosis in the desert
leaf-cutter ant Acromyrmex versicolor (Hymenop-
tera: Formicidae). Psyche 93:177-186.

Ryti, R.T. 1988. Geographic variation in cooperative
colony foundation in Veromessor pergandei (Hy-
menoptera: Formicidae). Pan-Pacific Entomologist
64:255-257.

Snelling, R.R., George, CD. 1979. The Taxonomy, Dis-
tribution and Ecology of California Desert Ants (Hy-
menoptera: Formicidae). Report to Bur. Land Man-
age., US Dept. Int., Riverside, Calif.

Tschinkel, W.R. 1992. Brood raiding and the popu-
lation dynamics of founding and incipient colo-
nies of the fire ant, Solenopsis invicta. Ecological
Entomology 17:179-188.

Wheeler, G.C., Wheeler, J. 1973. Ants of Deep Canyon.
Univ. Calif. Press, Berkeley.

J. HYM. RES.
Vol. 9(2), 2000, pp. 385-394

Morphofunctional Adaptations of Parasitoids Attacking Concealed

Eggs of Two Arboreal Mirids in Italy

Eric Conti, Pio F. Roversi, and Ferdinando Bin

(EC, FB) Department of Arboriculture and Plant Protection, University of Perugia, Borgo XX

Giugno, Perugia, 06121 Italy; (PFR) Experimental Institute for Agricultural Zoology, Forest

Entomology Section, Ministry for Agricultural Politics, Via Lanciola 12/ A, Firenze, 50125 Italy

Abstract. — The morphofunctional adaptations of the egg parasitoids of two arboreal mirids (Het-
eroptera: Miridae) for reaching the concealed eggs of their hosts, Calocoris quadripunctatus (Villers)
and Calocoris trivialis (Costa), were studied in a natural ecosystem (oak forest) and in an agroe-
cosystem (orange groves), respectively. Calocoris quadripunctatus is a predator of immature stages
of Tortrix viridana (L.) (Lepidoptera: Tortricidae) in deciduous oak forests, Quercus spp., in Tus-
cany. Eggs are laid in clusters and concealed among the scales of dead buds, where they are
exploited by two parasitoid species. Chaetostricha walkeri (Forster) (Hymenoptera: Trichogram-
matidae) has a long ovipositor which is inserted between the scales to reach the host eggs, and
is therefore an "ovipositor prober". Instead, Telenomus sp. laricis Walker group (Hymenoptera:
Scelionidae) has a depressed metasoma which is introduced between the scales, and is therefore
a "metasomal prober". Calocoris trivialis is a phytophagous species that damages orange groves,
Citrus sinensis (L.), and other Citrus spp. in Sicily. The eggs are concealed in the soft, decaying
wood of old pruning wounds and are attacked by at least two parasitoids. Aprostocetus n. sp. near
miridivorus (Domenichini) (Hymenoptera: Eulophidae) is probably both an "ovipositor prober"
and an "ovipositor driller", as it can also drill through the wood. Telenomus lopicida Silvestri
(Hymenoptera: Scelionidae) has a long ovipositor and a compressed metasoma, which is intro-
duced into the host incision, and is therefore a "metasomal prober". Such morphological adap-
tations appear to be linked to the host oviposition sites and explain some aspects of parasitoid
exploitation efficiency; they may also help interpret other host-parasitoid associations that are
unknown or questionable.

Mirid bugs (Heteroptera: Miridae), the
largest family of Heteroptera, are very
common both in arboreal and herbaceous
ecosystems, were they feed on plants
(phytophagous species), other arthropods
(zoophagous) or both (zoophytophagous)
(Wagner and Weber 1964, Alomar and
Wiedenmann 1996). Their eggs are elon-
gated with a true operculum on their an-
terior pole and are more or less deeply
embedded in dead or living plant tissues,
or concealed between plant organs (Kul-
lenberg 1946, South wood 1956, Cobben
1968, Hinton 1981). In spite of these kinds
of protection, mirid eggs can be attacked
by parasitoids belonging to Eulophidae,
Trichogrammatidae, Scelionidae and My-

maridae (Hymenoptera) (Bin and Vinson
unpublished). Some of these host-parasit-
oid associations from a natural ecosystem,
oak forest, in Tuscany (central Italy) and
from an agroecosystem, orange groves, in
Sicily (southern Italy), are described here,
focusing on morphological features relat-
ed to parasitoid strategies.

Oaks in Tuscany are attacked by Tortrix
viridana (L.) (Lepidoptera: Tortricidae),
which is distributed over large portions of
the Palaearctic region, from northern Eu-
rope to the Mediterranean region, and
during population outbreaks can seriously
defoliate vast groves (Bogenschutz 1978).
Eggs and possibly young larvae of this
tortricid are preyed upon (Roversi unpub-

386

Journal of Hymenoptera Research

lished) by the zoophytophagous mirid
Calocoris quadripunctatus (Villers) (Wagner
and Weber 1964), the population size of
which was found to be directly dependent
on T. viridana density (Roversi et al. in
preparation). Calocoris quadripunctatus has
one generation per year and overwinters
in the egg stage. Eggs are concealed in
dead buds, between external scales that
are partially spaced out, where they are
attacked by Chaetostricha walkeri Forster
(Hymenoptera: Trichogrammatidae) and a
Telenomus sp. (Hymenoptera: Scelionidae)
(Conti et al. 1997, Roversi et al. 1998) which
belongs to the T. laricis Walker species
group (Huggert 1983, Johnson 1984); both
are new host records. Parasitoid impact on
the predator, pooled for the two species,
averaged 17% in 1994 (Conti et al. 1997,
Roversi et al. in preparation).

Orange groves in Sicily are attacked by
the phytophagous mirid Calocoris trivialis
(Costa), which causes apical deformation
of shoots, leaf necrosis and drop of flower
buds (Barbagallo 1970). This mirid also
has one generation per year and overwin-
ters in the egg stage, but the eggs are em-
bedded in the soft dead and decaying
wood of old pruning wounds. These eggs
are attacked by Aprostocetus miridivorus
(Domenichini) (Barbagallo 1969, 1970,
Graham 1987), Aprostocetus new species
near miridivorus (Hymenoptera: Eulophi-
dae) (Conti et al. 1991, 1997) and Telenomus
lopicida Silvestri (Hymenoptera: Scelioni-
dae) (Barbagallo 1970, Conti et al. 1991,
1997). Total parasitoid impact averaged
57-70% in the different years and loca-
tions (Barbagallo 1969, 1970, Conti et al.
1991, 1997, Roversi et al. in preparation).
Aprostocetus miridivorus and T. lopncida
were also recorded from overwintering
eggs of the mirid Capsodes lineolatus, deep-
ly embedded inside incisions in herba-
ceous plants (Silvestri 1932, 1939, Graham
1987). However, it is unknown whether
the same parasitoids shift between two al-
ternative hosts or if they are two different

biotypes, with different habitat preferenc-

es.

Some aspects of these mirid — egg par-
asitoid associations on oak and orange
groves are described in this paper by com-
bining observations on host oviposition
sites and parasitoid morphological adap-
tations, with the aim of defining oviposi-
tion strategies.

MATERIALS AND METHODS
Sampling Procedures

Oak groves. — Field research on egg par-
asitoids associated with C. quadripunctatus
was carried out in five permanent sam-
pling areas with mixed stands of Quercus
pubescens Will, and Q. cerris L., ranging
from 350 m to 700 m above sea level, in
central Tuscany (central Italy). Quercus pu-
bescens is included in the overstorey, as the
masts are more palatable to livestock,
while Q. cerris is part of the understorey
and is used mainly for timber. In this
landscape of gently rolling hills, oak
stands normally alternate with vineyards
and olive groves.

During the winters of 1994 and 1996, 36
branches, 1 m long, were collected in each
sampling area (total 180 branches) and
transferred to the laboratory. All dead
buds were counted, collected and kept un-
der a shelter at outdoor conditions. In
spring, when nymphs and parasitoids had
emerged, buds were dissected and exam-
ined under the stereomicroscope.

Orange groves. — Overwintering eggs of
C. trivialis, embedded in the soft decayed
wood of the pruning wounds, were col-
lected on 9-10 January 1991 and 2-5 Feb-
ruary 1992 in 6 orange, Citrus sinensis (L.),
groves, the same both years, in 5 localities
of the Provinces of Catania and Siracusa
(Sicily, southern Italy).

Pruning wounds of different sizes and
suitable for oviposition by C. trivialis were
sampled randomly over the whole area of
the groves. Twenty (20) to 62 samples per
grove were collected in 1991 (total 224

Volume 9, Number 2, 2000

387

samples), 30 per grove in 1992 (total 180
samples). The samples were then trans-
ferred to the laboratory and kept under
controlled conditions (25 ± 1 °C, 60%-95%
RH; photoperiod L:D 14:10) in different
kinds of screened containers (30 X 160
mm glass tubes, 140 X 25 mm Petri dishes,
185 X 140 X 290 mm plastic food contain-
ers), depending on the size of the samples.
All the material was examined under the
stereomicroscope in summer, when emer-
gence of nymphs and parasitoids was
complete.

Host Oviposition Sites and Parasitoid
Structures

For both species of Calocoris, eggs were
classified in the following categories: —
healthy (i.e., eclosed), — parasitized (i.e.,
containing the parasitoid or with the pres-
ence of an emergence hole), — dead due to
other agents (predators or unknown). Egg
length was measured under a stereomi-
croscope and the characteristics of healthy
and parasitized eggs were described. In
the case of C. quadripunctatus, the distri-
bution of healthy and parasitized eggs in
each cluster was mapped.

The position of the parasitoid piercing
point on the host egg was recorded when
visible under the stereoscopic or com-
pound microscope. However, on eggs of
C. trivialis such parasitoid punctures are
often hidden by remains of wood that are
glued to the chorion, due to a sticky se-
cretion from the ovipositing female. In an
attempt to dissolve this secretion, eggs
were sonicated at room temperature for at
least 15 minutes in different solvents (wa-
ter, ethanol, acetone, chloroform), or
soaked in boiling chloroform (61.2 °C) in
a beaker inside a water bath for 15 min-
utes.

Parasitoids' structures used for reaching
the concealed host eggs were evaluated by
measuring the total body length, metaso-
ma size and ovipositor length of 5 or 10
females of each species. To measure ovi-
positor length, the two scelionids were

cleared with potassium hydroxide and
mounted on slides. Measurements were
made using a micrometer eyepiece mount-
ed on a compound microscope, or under
a Nikon E 600 microscope connected to a
JVC TK-C1380 video camera, and using a
computer program for visual image anal-
ysis (Lucia 3.5).

RESULTS AND DISCUSSION

Host oviposition sites. — The eggs of C.
quadripunctatus, concealed among the
scales of dead buds on oak, are laid in
clusters, most frequently with 3 to 5 eggs,
and nothing appears externally to indicate
their presence. In 1994 and 1996 buds with
eggs contained on average 6 to 8 clusters
each (Roversi et al. in preparation) (Figs.
1, 3 and 4). In contrast, the eggs of C. tri-
vialis, concealed in the pruning wounds on
orange trees, are laid singly and distrib-
uted variably on the wound surface where
the decaying wood is soft enough for ovi-
position. The wounds sampled in 1991
and 1992 had a very variable diameter,
from 13 to 98 mm, with an average of 45
mm. Wounds with eggs contained on av-
erage 8.3 eggs each in 1991 and 5.1 in 1992.
Normally these eggs were deeply embed-
ded, with the operculum at 386 ± 37.2 |xm
(Mean ± SEM, n = 10) under the substrate
and not visible externally, although par-
tially exposed eggs were also found in
rare cases. The oviposition incisions, that
indicate egg presence, may close partially
or completely when rainwater swells the
wood, thus becoming inconspicuous or to-
tally invisible (Figs. 2, 11 and 12).

Both the dead buds on oak and the
pruning wounds on orange trees con-
tained recently laid eggs and eggs that
had been laid during previous seasons,
thus indicating that they provide a suit-
able oviposition substrate for several
years. Also, because of wood erosion by
atmospheric agents, old egg shells of C.
trivialis on pruning wounds were often
more or less exposed and directly visible

388

Journal of Hymenoptera Research

Figs. 1-2. 1, Dead oak bud partially dissected to show egg clusters of Calocoris quadripunctatus concealed
between scales. 2, Pruning wound with soft decaying wood on orange tree and, in the inserted photo, a cross
section partially exposing an embedded egg of Calocoris trivialis.

under the stereomicroscope or even to the
naked eye.

Parasitoids' morphological adaptations and
strategies. — How do the parasitoids reach
and attack such concealed and, therefore,
protected eggs?

The egg parasitoids of C. quadripuncta-
tus in oak buds have developed two dif-
ferent morphological adaptations and
strategies (Figs. 5, 6, 8 and 9). The tricho-
grammatid Chaetostricha walkeri has a very
long ovipositor, 3.15 times the length of its
metasoma. The proximal end reaches the
prothoracic coxae, where it is articulated
on a special structure, probably used as an
extension device (Figs. 5 and 6, Table 1).
In contrast, the scelionid Telenomus sp. lar-
icis group has a depressed (dorso-ventral-
ly flattened) metasoma, 69% of the length
of the whole body, which facilitates its in-
sertion between bud scales. The ovipositor
is 86% of the length of the metasoma and
is invaginated in it, from which it is ex-

tended for parasitization (Figs. 8 and 9;
Table 1). Similarly, lygaeid egg parasitoids
in Telenomus and Eumicrosoma also have
depressed metasoma (A. Polaszek, pers.
comm.).

In spite of these adaptations, both C.
zvalkeri and Telenomus sp. laricis group can
hardly reach the most internal eggs, as
only the first (peripheral) and second (sub-
peripheral) ones are normally attacked, al-
though there are a few exceptions (Roversi
et al. in preparation). In addition, both par-
asitoids attack the peripheral egg more
frequently than the sub-peripheral one, al-
though C. walkeri can reach both much
more often than Telenomus sp. (Fig. 19).
Whether in such cases one species can dis-
criminate between healthy eggs and eggs
parasitized by the conspecific or other spe-
cies is unknown. Similar differences of ef-
fectiveness, due to metasoma morphology
and ovipositor length, were also observed
on species attacking egg masses of the rice

Volume 9, Number 2, 2000

389

1mm

Figs. 3-10. Calocoris quadripunctatus and its egg parasitoids. 3, Schematic section of a dead oak bud showing
C. quadripunctatus egg clusters concealed between scales. 4, Detail of a scale with a duster of lour eggs. 5 and
6, Lateral and dorsal views of Chaetostriclia walkcri Forster showing the long ovipositor 7 I lost egg parasitized
by C. walkeri showing the parasitoid piercing point on the chorion. 8 and l>, I ateraJ and dorsal views of
Telenomus sp. laricis group showing its depressed metasoma with the ovipositor indicated (dotted line). 10,
Host egg parasitized by Telenomus sp. laricis group showing the parasitoid piercing point on the chorion and
the characteristic transversal band.

390

Journal of Hymenoptera Research

1mm

Figs. 11-18. Calocoris trivialis and its egg parasitoids. 11, Example of a pruning wound on orange showing
a distribution of C. trivialis eggs (circles). 12, Schematic section of a host oviposition incision to indicate egg
position in relation to the substrate. 13 and 14, Lateral and dorsal views of Aprostocetus n. sp. near miridivorus.
15, Host egg parasitized by Aprostocetus n. sp. near miridivorus showing the parasitoid piercing point on the
chorion. 16 and 17, Lateral and dorsal views of Telenomus lopicida showing its compressed metasoma with the
long ovipositor indicated (dotted lines). 18, Host egg parasitized by T. lopicida showing the parasitoid piercing
point on the chorion and the characteristic transversal band.

Volume 9, Number 2, 2000

391

Table 1. Measurements (mean ± SEM; in mm) of female parasitoid body parts to show morphological
adaptations for reaching the host egg concealed between dead bud scales (C. quadripunctatus) or in decaying
wood (C. trivialis).

Host

Body
length

Metasoma

dimensions

Parasitoid

Length

Lateral
Max. Min.

Dorso-ventral
(max.)

Ovipositor
length

Chaetostricha walkeri"

4-ptmctatus

0.843 ± 0.022

0.479 ± 0.015

0.268 + 0.005

0.274 ± 0.010

1.511 ± 0.029

Telenomus sp. -

4-pitnctatus

0.796 ± 0.020

0.548 ± 0.010

0.141 + 0.002

—

0.053 ± 0.002

0.472 ± 0.004

Aprostocetus sp :

trivialis

1.230 £ 0.053

0.652 ± 0.017

0.284 ± 0.008

—

0.330 ± 0.014

0.617 ± 0.025

Telenomus lopicidam

trivialis

1.095 ± 0.018

0.635 ± 0.015

0.162 ± 0.004

0.027 ± 0.005

0.146 ± 0.007

0.832 ± 0.039

10;

stemborer Scirpophaga incertulas (Walker)
(as Tryporyza incertulas Walker) (Lepidop-
tera: Pyralidae) in Vietnam (Vu and
Nguyen 1987) and on Telenomus busseolae
Gahan attacking the maize stemborer Se-
samia nonagrioides (Lefevre) (Lepidoptera:
Noctuidae) in Greece (Alexandri and Tsit-
sipis 1990).

The egg parasitoids of Calocoris trivialis
on orange have also developed two dif-
ferent strategies (Figs. 13, 14, 16 and 17).
The eulophid Aprostocetus n. sp. near mir-
idivorus shows no apparent morphological
adaptations. The ovipositor is 95% of the

length of the metasoma and is probably
introduced into the incision or inserted by
drilling through the wooden substrate
(Figs. 13 and 14; Table 1). Laboratory ob-
servations on the oviposition behavior of
A. miridivorus towards Calocoris norvegicus
(Gmelin), indicate that the parasitoid in-
tensely antennates oviposition incisions
containing host eggs and, in most cases,
inserts its ovipositor through the incision,
although it also appears to drill through
the dead wood (Conti and Bin unpub-
lished). This is especially important in the
open field where, because of wood swell-

O250

O 200 -

S 150

£ 100

■o
o

Parasitized egg (black colored):

peripheral
sub-peripheral
periph. + sub-periph.

A3 '*

VS///A

Telenomus sp.

C. walkeri

Fig. 19. Frequency of Calocoris quadripunctatus egg clusters (4 eggs per cluster on average) parasitized by
Telenomus sp. laricis group or Chaetostricha walkeri, related to the position of the parasitized egg/s in the ( luster.
For the sake of clarity, the very few cases of more than 2 parasitized eggs per cluster have not been represented

in the graph.

392 Journal of Hymenoptera Research

ing caused by rain, the incisions can be that this area can be excluded as a piercing

partially or completely closed. site by the parasitoid. Such parasitized

The scelionid T. lopncida presents a much eggs of C. trivialis were also characterized

more evident adaptation. The distal half by a light amber-colored chorion and ap-

(53% of total length) of its metasoma is lat- peared darker close to eclosion because of

erally compressed and its distal quarter the presence of the darkening pupa or the

(23%) is only 27 fxm wide (Figs. 16 and 17; adult, visible within. Similar to C. quadri-

Table 1). This strongly facilitates its intro- punctatus, eggs of C. trivialis parasitized by

duction into the host oviposition incisions, T. lopncida show a dark transverse band at

as has been observed with eggs of Capso- the level of the meta thorax (Fig. 18) while

des lineolatus (Brulle) (Heteroptera: Miri- those parasitized by Aprostocetus sp. do

dae) embedded in stems of Scabiosa col- not show any particular pattern (Barba-

umbaria L. (Silvestri 1932, 1939). In addi- gallo 1969, Mineo and Sinacori 1978) (Fig.

tion, the ovipositor of T. lopncida is 1.31 15).

times the length of the metasoma and is Escaping from the host substrate is an-

partially contained in a dorso-metasomal other critical situation for which the

hump (Figs. 16 and 17; Table 1). emerging parasitoids, both males and fe-

The parasitoid strategies described males, need a morphological adaptation

above are also confirmed by the position (Quicke 1997). Parasitoids of C. quadri-

of the parasitoid piercing point on the egg punctatus in most cases escape from the

chorion (Figs. 7, 10, 15 and 18). In the case buds by crawling out between the scales,

of C. quadripunctatus, this point is evi- although C. walkeri may also chew circular

denced by the presence of a brown circu- holes in the scales. In contrast, both para-

lar area localized on the exposed side of sitoids of C. trivialis have to chew a hole

the egg (Figs. 7 and 10). Such eggs, when of variable length in the soft decaying

parasitized by C. walkeri, are visibly swol- wood, depending on their distance from

len and light amber colored. In contrast, the surface. While in most cases the emer-

those attacked by Telenomus sp. laricis gence hole of both species is localized in

group are slightly opaque, with a dark the apical third of the egg, including the

transverse band evident from the pupal egg cap area, sometimes T. lopncida pu-

stage of the parasitoid onwards, and ap- pates upside-down and therefore has to

pear darker close to eclosion, due to the chew a much longer tunnel in the wood,

presence of the pupa or the adult, visible This is obviously performed with mandi-

within. bles well adapted to chew plant tissues.

In the case of C. trivialis, the parasitoid No other adaptive cephalic feature is

piercing point is less recognizable under presented by T. lopncida since its frons is

the microscope because the darkened area smooth, whereas other species, also be-

is often not appreciable and because part longing to the T. laricis group, exhibit a

of the chorion is generally hidden by marked scale-like sculpture on the frons

wood remains glued to it. These remains and vertex (Johnson 1984) probably useful

could be removed only mechanically, for escaping in combination with mandi-

when possible at all, as the glue is not sol- bles (Bin and Conti unpublished) and

uble in any of the solvents tested. The have a pointed head, the distinctive fea-

piercing points, when distinguishable, ture of the laricis group (A. Polaszek, pers.

were localized on the apical third of the comm.).
concave egg side, under the egg cap area

(Figs. 15 and 18). No piercing points on CONCLUSIONS

the egg cap were observed and, indeed, Ideally, host-parasitoid associations

due to its thickness and hardness, it seems should be defined using a complete set of

Volume 9, Number 2, 2000

393

characters, ranging from physical and
chemical cues for habitat and host loca-
tion, to physiological and biochemical in-
teractions for host suitability. However,
some pieces of such a complex mosaic can
be provided by comparing the features of
the microhabitat, selected by the host to
escape adverse climatic events, with the
ability of the parasitoid to overcome such
physical barriers in order to reach the host
and eventually emerge from it.

It is clear that in some cases the mor-
phology of the ovipositor (Austin 1983),
the metasoma and, possibly, other body
parts are evolutionarily linked to the ex-
ploitation of particular hosts. Therefore, in
the future these morphological adapta-
tions may be used to predict the most like-
ly host groups or oviposition sites (Austin
1983).

The parasitoid species considered here
appear to be well adapted for reaching
their concealed host eggs, and the mor-
phological adaptations especially involve
the metasoma and /or the ovipositor sys-
tem. Their oviposition strategies can be
defined by comparison with similar strat-
egies described in the literature (Gauld
and Hanson 1995, Smith et al. 1993; Smith
and Wiedenmann 1997), although more
direct observations are needed to better
understand their behavior. Chaetostricha
ivalkeri inserts its long ovipositor between
bud scales and is therefore an "ovipositor
prober". Aprostocetus n. sp. near miridivo-
rus is both an "ovipositor prober" and an
"ovipositor driller", as it probably inserts
its terebra either inside the host oviposi-
tion wound or through the soft wooden
substrate. In contrast, both Telenomus spe-
cies are "metasomal probers". In fact,
their metasoma is adapted to reach the
host eggs by inserting at least part of it
into the host oviposition sites, specifically
between bud scales in the case of Teleno-
mus sp. laricis group, or in the host ovi-
position incision in the case of T. lopicida.

We have shown that Chaetostricha ivalk-
eri is an egg parasitoid of Calocoris quad-

ripunctatus. This is a new host record and
it suggests that previous ones were erro-
neous. In fact, C. walkeri has been reported
from eggs of Tortrix viridana (Kolubajiv
1959 according to Du Merle 1983, Marti-
nek 1963), from the coccid Leucaspis pini
Htg. (Nikol'skaya 1952), or from unknown
hosts, supposedly xylophagous larvae
(Silvestri 1917 citing Foster) or Heterop-
tera eggs embedded in wood (Silvestri
1917). The eggs of C. quadripunctatus, the
true host, were evidently overlooked be-
cause they were not visible externally.

Many of the available host records for
other Telenomus species in the laricis group
are similarly questionable, and a careful
reassessment is needed before supposed
host associations can be accepted as reli-
able.

ACKNOWLEDGMENTS

We are grateful, for insect identifications, to Paride
Dioli (Calocoris quadripunctatus), John LaSalle (Apros-
tocetus n. sp. near miridivorus) and Gennaro Viggiani
(Chaetostricha ivalkeri). We also thank the reviewers
for their useful comments on the manuscript, Sebas-
tiano Barbagallo and Santi Longo for collaboration
and hospitality in Sicily, Beyene Ayano Ejigu for
helping with data collection on C. trivialis in the lab-
oratory, Mario Michelassi and Aldo Mommi for pho-
tographs and technical assistance, and Fabrizio Pen-
nacchio for parasitoid measurements using the visual
image analysis program. This research was financial-
ly supported by MURST 40%, MURST 60% and
MiPA Research Project "Biological and integrated
pest control in agricultural and forest plants", re-
search group "Forest plants".

LITERATURE CITED

Alexandri, M. P. and J. A. Tsitsipis. 1990. Influence of
the egg parasitoid Platytelenomus busseolae (1 Ivm :
Scelionidae) on the population of Sesamia nona
grioides (Lep.: Noctuidae) in central Greece. £;/-
tomophaga 35(1): 61-70.

Alomar, O. and R. N. Wiedenmann (eds.). 1996.
Zoophytophagous Heteroptera: Implications for life
luston/ and integrated pest management. The I nto-
mological Society of America ["nomas Say Pub-
lications in Entomology, Lanham, Maryland, 202

PP-

Austin, A. D. 1983. Morphologv and mechanics of the

ovipositor system of Ceratobaeus Ashmead (Hy-
menoptera: Scelionidae) and related genera. In

394

Journal of Hymenoptera Research

ternational Journal of Insect Morphology and Embry-
ology 12(2/3): 139-155.

Barbagallo, S. 1969. Appunti morfo-biologici su Te-
trastichus miridivorus Domenichini (Hymenop-
tera: Eulophidae) parassita oofago di Eterotteri
Miridi. Bollettino di Zoologia Agraria e di Bachicol-
tura (Ser. 11) 9: 115-122.

Barbagallo, S. 1970. Contributo alia conoscenza del
Calocoris (Closterotomus) trivialis (Costa) (Rhyn-
chota-Heteroptera, Miridae). Morfologia
dell'adulto e biologia. Entonwlogica 6: 1-104.

Bogenschutz, H. 1978. Tortricinae. Pp. 55-89 In: W.
Schwenke (ed.), Die Forstschddlinge Europas. 3
Band. Paul Parey, Hamburg, Berlin.

Cobben, R. H. 1968. Evolutionary trends in Heteroptera.
Part I. Eggs, architecture of the shell, gross embry-
ology and eclosion. Centre for Agricultural Pub-
lishing and Documentation, Wageningen, 475
pp.

Conti, E., S. Colazza and F. Bin. 1991. Imenotteri par-
assitoidi di uova endofitiche di Eterotteri: alcune
associazioni nei Miridi e nei Nabidi. Atti XVI
Congresso Nazionale Italiano di Entomologia, Bari—
Martina Franca, 23-28 Sept. 1991: 929-931.

Conti, E., P.F. Roversi and F. Bin. 1997. Egg parasit-
oids associated with arboreal mirids Hym.: Par-
asitica; Het.: Miridae). Proceedings from the 6'h
European Workshop on Insect Parasitoids. Va-
lencia, 1-^ March 1997. Boletin de la Asociacion Es-
pafwla de Entomologia, Suplemento al Volumen 21:
94-95.

Du Merle, P. 1983. Les facteurs de mortalite des oeufs
de Tortrix viridana (L.) (Lep., Tortricidae). Agron-
omic 3(5): 429^34.

Gauld, I. D. and P. E. Hanson. 1995. The structure of
Hymenoptera. Pp. 102-137 In: P. E. Hanson and
I. D. Gauld (eds.) The Hymenoptera of Costa Rica.
Oxford University Press, Oxford, 893 pp.

Graham, M. W. R. de V. 1987. A reclassification of the
European Tetrastichinae (Hymenoptera: Eulo-
phidae), with a revision of certain genera. Bulle-
tin of the British Museum (Natural History). Ento-
mology series 55(1): 116-117.

Hinton, H. E. 1981. Biology of insect eggs. Vol. I-III.
Pergamon Press, Oxford, 1125 pp.

Huggert, L. 1983. On Telenomus, mainly European;
redescriptions, new taxa, synonymies and com-
binations (Hymenoptera, Proctotrupoidea: Sce-
lionidae). Entomologica Scandinavica 14: 145-167.

Johnson, N. F. 1984. Systematics of Nearctic Teleno-
mus: classification and revisions of the podisi and
phymatae species groups (Hymenoptera: Scelion-
idae). Bulletin of the Ohio Biological Survey 6(3): 1-
113.

Kolubajiv, S. 1959. Orientacni pokusy s umelym
chovem drobnenky rodu Trichogramma z hmy-

zich lesnich skudcu. Shorn CSAZV-Lesnictvi,
32(12): 1057-1070.

Kullenberg, B. 1946. Studien iiber die biologie der
Capsiden. Zoologiska Bidrag 23: 1-522.

Martinek, V. 1963. Nekteri vajecni cizopasnici lesnich
skudcu a moznosti jejich pestovani. Prdce Vy-
zkumnych Ustavu Lesnickych CSSR 26: 5^-8.

Mineo, G. and A. Sinacori. 1978. Studi morfo-biolo-
gici comparativi sugli stadi preimmaginali degli
Scelionidi (Hym. Proctotrupoidea). IV. Nota su
Telenomus lopicida Silv. Bollettino dell'Istituto di
Entomologia Agraria e dell'Osservatorio di Fitopato-
logia di Palermo 10: 105-112.

Nikol'skaya M. N. 1952. The Chalcid Fauna of the
U.S.S.R. (Chalcidoidea). Keys to the fauna of the
U.S.S.R. No. 44. Zoological Institute of the Acad-
emy of Sciences of the U.S.S.R., Moscow, Lenin-
grad (Translated from Russian. Israel Program
for Scientific Translations, Jerusalem 1963).

Quicke, D. L. J. 1997. Parasitic wasps. Chapman &
Hall, London, 470 pp.

Roversi, P. F., E. Conti and F. Bin. 1998. Ooparassi-
toidi di Miridi arboricoli di ambienti forestall e
agrari. Atti XVIII Congresso Nazionale Italiano di
Entomologia, Maratea, 21-26 giugno 1998: 225.

Silvestri, F. 1917. Contribuzione alia conoscenza del
Genere Centrobia Forster (Hymenoptera, Chalci-
didae). Bollettino di Zoologia Generate e Agraria del-
ta R. Scuola Superiore d'Agricoltura in Portici 12:
245-251.

Silvestri, F. 1932. Contribuzione alia conoscenza del
Lopus lineolatus (Brulle) e di un suo parassita. So-
ciete Entomologique de France, Livre du Centenaire,
pp. 561-565.

Silvestri, F. 1939. Lopus lineolatus Brulle. Pp. 262-269
In: F. Silvestri, Compendio di Entomologia Applica-
ta. Parte speciale Vol. 1. Tipografia Bellavista, Por-
tici.

Smith, J. W. Jr. and R. N. Wiedenmann. 1997. For-
aging strategies of stemborer parasites and their
application to biological control. Insect Science
and its Application 17(1): 37-49.

Smith, J. W. Jr., R. N. Wiedenmann and W. A. Ov-
erholt. 1993. Parasites of lepidopteran stemborers of
tropical gramineous plants. ICIPE Science Press,
Nairobi, 89 pp.

Southwood, T. R. E. 1956. The structure of the eggs
of the terrestrial Heteroptera and its relationship
to the classification of the group. Transactions of
the Royal Enomological Society of London 108: 163-
221.

Vu, Quang Con and Van San Nguyen. 1987. Effec-
tiveness of egg parasites (Hymenoptera) depend-
ing on the parasite abdomen structure and on the
type of egg-batches in lepidopteran rice pests.
Zoologichesky Zhurnal 66(1): 60-65. [In Russian].

Wagner, E. and H. H. Weber. 1964. Faune de France.
Vol. 67. Heteropteres Miridae. Federation Francaise
des Societes de Sciences Naturelles, Paris, 591 pp.

J. HYM. RES.
Vol. 9(2), 2000, pp. 395-415

New Caledonian Tiphiidae: Revision of the Genus Eirone

(Hymenoptera: Thynninae)

Lawrence A. Baptiste and Lynn S. Kimsey

Bohart Museum of Entomology, Department of Entomology, University of California,

Davis, California 95616

Abstract. — Ten new species of New Caledonian Eirone are described based on males, including
anone Kimsey, invini Baptiste, koghisica Kimsey, laniensis Baptiste, maigretae Baptiste, nasalis
Kimsey, nepouiensis Baptiste, paniensis Kimsey, rivierensis Baptiste, and zvebbi Kimsey. In ad-
dition, females of invini, transversa Brown, nepouiensis, and xvebbi, are also described. Male genitalia
are described and illustrated for both the new species and for the first time for colorata Brown,
marginata Brown, fieocaledonica Turner, nigra Brown, obtusidens Turner, salteri Brown, subtuberculata
Brown and transversa Brown. These previously described species are also rediagnosed. A key to
males of the species of New Caledonian Eirone is also included.

As recently as the early 1980's only nine
species of Eirone Westwood were known
from New Caledonia (Brown 1984). Sub-
sequent malaise trap collecting by Michael
Irwin, Evert and Marion Schlinger and
Donald Webb have demonstrated that the
thynnine fauna of New Caledonia is sub-
stantially richer than previously thought.
Their efforts have turned up ten undescri-
bed species of Eirone. Based on their col-
lecting efforts, Eirone appears to be the
only thynnine genus present on New Cal-
edonia.

MATERIALS AND METHODS

Specimens were obtained for this study
from the following institutions and indi-
viduals: Bernice P. Bishop Museum, Hon-
olulu, Hawaii, G. Nishida (HONOLULU);
Illinois Natural History Survey, Universi-
ty of Illinois, Champaign-Urbana, M. E. Ir-
win (URBANA), Canadian National Insect
Collection, Ottawa, Ontario, L. Masner
(OTTAWA), University of California, Da-
vis, S. L. Heydon (DAVIS). Holotypes of
the new species described below will all
be deposited in the Museum Nationale
d'Histoire Naturelle, Paris (PARIS). The
type of Eirone impunctata Brown was to

have been deposited in the collection of
the Rydalmere Quarantine Station, NSW.
This collection has been moved to the Ag-
ricultural Scientific Collections Unit, NSW
Agriculture, Orange Agricultural Institute,
Orange, Australia (P. S. Gillespie). How-
ever, the type cannot be located. Specimen
and type repositories are indicated in the
text by the city name in capital letters.

The following abbreviations are used
for the sake of brevity: F = flagellomere,
MOD = midocellus diameter, PD = punc-
ture diameter.

SPECIES DESCRIPTIONS

Eirone anone Kimsey, new species

(Fig. 19)

Male. — Body length 15-18 mm; fore-
wing length 12-14 mm; face with tiny con-
tiguous punctures between inner eye mar-
gins and antennal sockets; frons with
punctures 0.5-2 apart, except impunctate
along medial sulcus and adjacent to anten-
nal socket; clypeus with punctures larger
than along inner eye margin, punctures
contiguous; clypeal apex broadly triangu-
lar, with single apicomedial lobe; F-I
length 2.4-2.5 X breadth; F-II length 3.0-

396

Journal of Hymenoptera Research

Pouebo

Pourma

Noumea

Fig. 1. Distribution map of Eirone species in New Caledonia.

3.2 X breadth; pronotal punctures 1-3 PD
apart; mesopleural punctures 1-2 PD
apart separated by dense, fine shagreen-
ing; mesopleural lamella posteriorly
rounded; scutal punctures densest along
notauli (nearly contiguous), medially
sparsest (0.5-1 PD apart); scutellum nearly
impunctate medially, punctures denser
laterally, 0.5-1.0 PD apart; propodeum
punctate medially and laterally, punctures
0.5-1.0 PD apart, impunctate sublaterally;
metasomal sternum I sharply keeled and
somewhat hooked posteriorly, abruptly
declivous posteriorly; epipygium and hy-
popygium flattened and apex narrowly
subtruncate; genital capsule (Fig. 19): gon-
ocoxa with medial angular lobe on inner
surface; aedeagus apical column broad,
and flattened apically, ending abruptly
with rounded basal angle and narrow,
hooked apical lobe, column extending
more than half its length beyond penis
valve bending dorsally; penis valve with
short dorsal hook, hooked ventral lobe
and elongate basal lobe; volsella with
hooked bilobate dorsal surface and obso-
lescent asetose ventral surface; color: or-
ange, with extensive black markings on
vertex, extending down along side anten-
nal sockets, on occiput, pronotum anteri-
orly and medially, scutum except large
yellow medial spot, mesopleural margins,
scutellum anteromedially, coxae dorsally,
propodeum anterior margin black to en-

tirely black, metasomal segments I and VI
entirely black, segment VII anterior mar-
gin black; gonocoxa orange; wing mem-
brane yellow-tinted, veins black; vestiture
long, erect and orange-colored.

Type material. — Holotype 6; trail to Mt.
Panie, 22 km NW Hienghene, 11-25 Nov.
1992, Webb & Schlinger, malaise trap
(PARIS). Paratypes: 15 6 6, same data as
holotype; 3 6 6, Mt. Mandjanie, 5.3 km
WSW Pouebo, 500 m, 9-26 Nov. 1992, D.
W. Webb, malaise trap (DAVIS, ILLI-
NOIS). This species was collected in No-
vember.

Etymology. — The species name, anone, is
a nonsense combination of letters, as-
sumed to be feminine.

Discussion. — This species closely resem-
bles obtusidens in coloration, presence of a
midcoxal spine, rounded mesopleural la-
mella, and unilobate, densely setose clyp-
eus. It can be immediately separated from
obtusidens by the strongly keeled metaso-
mal tergum I and apically acute aedeagus.
The unilobate clypeus is unique to these
two species.

Eirone colorata Brown

(Fig. 9, 22)

Eirone colorata Brown 1984:254. Holotype 6:
New Caledonia: Col de Ho (HONOLULU),
examined.

Male. — Body length 12-15 mm; fore-

Volume 9, Number 2, 2000

397

wing length 9-12 mm; face with tiny con-
tiguous punctures between inner eye mar-
gins and antennal sockets; frons with
punctures 1—4 PD apart; clypeus with
punctures larger than along inner eye
margin, punctures 0.5-1.0 PD apart; clyp-
eal apex broadly truncate, 2.6-2.8 MOD
wide; F-I length 2.2 X breadth; F-II length
2.8 X breadth; pronotal punctures \-A PD
apart; mesopleural punctures 1-2 PD
apart, finely, shagreened between; meso-
pleural lamella rounded apically; scutum
medially, with punctures 1.0-1.5 PD apart,
punctures becoming finer and denser lat-
erally, 0.5-1.0 PD apart; scutellar punc-
tures 1-4 PD apart; propodeum punctate
medially and laterally, punctures 0.5-1.0
PD apart, impunctate sublaterally, finely
and densely shagreened between punc-
tures; midcoxa with apical spine (Fig. 9);
metasomal sternum I keeled medially,
keel extending two-thirds of length, slop-
ing obliquely to posterior margin; epipy-
gium and hypopygium flattened and
broadly rounded apically; genital capsule
(Fig. 22): gonocoxa with low submedial
angular projection on inner surface; aedea-
gus unmodified, with slender apical col-
umn extending less than half its length be-
yond penis valve, and bending ventrally;
penis valve saddle-shaped with short dor-
sal hook; volsella with small bilobate dor-
sal projection and ventral surface with 6-
8 long erect setae; color orange, becoming
yellower on face, pronotum, tegula and
subalar region of mesopleuron; scape or-
ange, flagellum dark brown, black mark-
ings on vertex, pronotal middle, scutum
black except large medial mark and sides
yellow, scutellum anteriorly black, pro-
podeum anteriorly, mesopleuron along
dorsal margin, coxae and femoral dorsal
margin, metathorax laterally, apical ab-
dominal segments darker; wing mem-
brane yellow-tinted, veins black; pubes-
cence silvery on head and thorax and
black on metasoma.

Material examined. — 21 6 6 (including
the holotype); Col de Ho, 22 km NW

Hienghene (trail to Mt. Panie), and Mt
Panie, 9.7 km NW Sarramea. These spec-
imens were collected in the months of Oc-
tober, November, January and February.

Discussion. — Eirone colorata most closely
resembles rivierensis based on the emar-
ginate mesopleural lamellae, midcoxal
spine, metasomal sternum I obliquely
sloping posteriorly, and apically truncate
clypeus. The two species differ in the ves-
titure of the abdominal terga, rivierensis
has dense tufts of long black setae on T-
VI and VII, which are lacking in colorata,
and the aedeagus of colorata is small and
unremarkable, whereas the apical aedea-
gal column in rivierensis is broadly flat-
tened and subtriangular. Finally, colorata
specimens are at least partly reddish or-
ange, whereas rivierensis specimens lack
this reddish orange coloration.

Eirone emarginata Brown

(Fig. 23)

Eirone emarginata Brown 1984:256. Holotype 8;
New Caledonia: Col des Rousettes (HONO-
LULU), examined.

Male. — Body length 16-21 mm; fore-
wing length 11-15 mm; face with tinv,
contiguous punctures between inner eye
margins and antennal sockets; frons with
punctures irregular, 0.5-1.0 PD apart, ex-
cept impunctate medial sulcus; clypeus
convex medially, with punctures larger
than along inner eye margin, punctures
contiguous to 0.5 PD; antennal lobe with
small subsidiary ventrally projecting lobe;
clypeal apex medially emarginate, acutelv
pointed on either side, 2.6 MOD wide; F-
I length 2.5X breadth; F-II length 3.0X
breadth; pronotal punctures 0.5-1.0 PD
apart; mesopleural punctures 0.5 PD
apart; mesopleural lamella short, posteri-
orlv emarginate; scutal punctures medial-
ly 0.5-1.0 PD apart, becoming finer and
nearly contiguous laterally; scutellar
punctures large and 0.5-1.0 PD apart near
midline becoming smaller, denser and
nearly contiguous laterally; propodeum

398

Journal of Hymenoptera Research

2. koghisica

3. laniensis

8. webbi

14. salteri

15. rivierensis

16. irwini

Figs. 2-16. Eirone species. 2-6, Front view of male face, with right antenna removed. 7, Lateral view of male
face. 8, 10, Ventral view of male meso- and metathorax. 9, Oblique ventral view of male meso- ^nd metathorax.
11, Ventral view of male mesothorax. 12-15, Lateral view of male metasomal segment 1. 16, Ventral view of
male metasomal segment 1. Abbreviations: ct = clypeal truncation, MOD = midocellus diameter, td = tran-
santennal distance.

Volume 9, Number 2, 2000

399

17. neocaledonica

18. salteri

20. laniensis

21 . maigretae

19. anone

22. colorata

26. laniensis

27. maigretae

28. nasalis

Figs. 17-28. Eirone species. 17-19, Dorsal view of male epipygium. 20-21, Lateral view oi male abdominal
apex. 22-28, Interior surfaces of genital capsule. Abbreviations: a = aedeagus, g = gonocoxa, pv penis
valve, v = volsella.

400

Journal of Hymenoptera Research

29. neocaledonica

30. nepouiensis

31. nigra

32. obtusidens

33. paniensis

34. rivierensis

35. sa/ten

36. subtuberculata

37. transversa

38. webb/

Figs. 29-38. Eirone species, Interior surfaces of genital capsule. Left side gonocoxa and volsella. Right side
penis valve uppermost. Inner margins of both sides are the ventral surface of the genital capsule; outer margins
are the dorsal surface. 35, Right side of genital capsule only. Abbreviations: a = aedeagus, g = gonocoxa, pv
= penis valve, v = volsella.

punctate medially and laterally, punctures extending half length, sloping obliquely to

1-2 PD apart, impunctate sublaterally; posterior margin; epipygium strongly con-

midcoxa without apical spine; metasomal vex, posterior margin broadly rounded,

sternum I with short, carinate medial keel with slight indentation medially; hypo-

Volume 9, Number 2, 2000

401

pygium flat, broadly rounded apically;
thorax and metasoma finely and densely
shagreened between punctures; genital
capsule (Fig. 23): gonocoxa narrowed me-
dially, inner surface smooth without pro-
jections, ridges or lobes; aedeagus apical
column elongate, extending more than
half its length beyond penis valve, bend-
ing abruptly ventrally; penis valve leaf-
like with small dorsal hook; volsella with
large hoof-like dorsal lobe, ventral lobe
with short spine-like setae; color black,
with small, pale yellow spot on antennal
lobe, genital capsule yellow to orange;
wing membrane brown-tinted, veins
black; pubescence silvery.

Material examined. — 9 6 6 (including the
holotype); 22 km NW Hienghene; Riviere
Bleue Prov. Pk., km 25.8 Riviere Bleue
Road; 7.5 km NW Sarramea; 17 km nne
Noumea; Riviere Bleue Prov. Pk., trail to
Valle de Pourina (DAVIS, HONOLULU,
URBANA). Specimens were collected in
October, November and February.

Discussion. — As discussed under webbi,
there are five species of New Caledonian
Eirone that lack a midcoxal spine. Of these
emarginata and maigretae are most similar.
Both are large-bodied, with the epipygium
broadly rounded apically and strongly
convex in profile, and both have a sharply
cornered clypeal truncation. Diagnostic
features of emarginata include the medially
emarginate clypeal truncation, black body
and apically truncate hypopygium.

Eirone impunctata Brown

Eirone impunctata Brown 1984:256. Holotype 8:
New Caledonia: Foret de la Thy (Reposito-
ry?).

Material examined. — No specimens of
this species have been seen. The type is
apparently unavailable. According to
Brown (1984) the holotype was collected
in April.

Discussion. — See webbi.

Eirone irwini Baptiste, new species

(Figs. 16, 24)

Male. — Body length 15-17 mm; fore-
wing length 12-14 mm; face with small,
nearly contiguous punctures between in-
ner eye margins and antennal sockets;
frons with punctures 0.5-1 PD apart, ex-
cept nearly impunctate medial longitudi-
nal band; clypeus with punctures much
larger than along inner eye margin and
nearly contiguous; clypeal apex weakly
trilobate, with medial lobe extending fur-
thest, distance between outer lobes 3.3
MOD; F-I length 2.4-2.5 X breadth; F-II
length 3.4-3.5 X breadth; pronotal punc-
tures 1-3 PD apart; mesopleural punctures
1-2 PD apart medially, finely shagreened
between; mesopleural lamella apically
rounded and bending slightly ventrally;
scutal punctures medially 1-2 PD apart,
becoming finer and denser laterally 0.5 PD
apart; scutellar punctures 1-1.5 PD apart,
except for medial longitudinal impunctate
stripe; propodeum punctate medially and
laterally (punctures 1-2 PD apart), im-
punctate along sublateral band and above
petiolar socket; metasomal sternum I
sharply keeled medially, sloping obliquely
to pointed apex, apex extending over base
of metasomal sternum II (Fig. 16); epipy-
gium narrowed and flattened apically,
apical margin indented medially; hypo-
pygium narrowly rounded apically; geni-
tal capsule (Fig. 24): gonocoxa with pro-
truding submedial longitudinal ridge; ae-
deagus apical column arcuate, with apical
flag, strongly bending dorsally; penis
valve saddle-shaped, with long dorsal
hook; volsella with large bilobate dorsal
end, ventral part short, with brush of
dense, stout setae. Body black, with yel-
low or cream-colored markings on: lower
half of inner eye margins, lower two-
thirds of outer eye margins, spot on upper
inner of eye margin, spot on antennal
lobe, transverse band on anterior carina of
pronotum, anterolateral spot on prono-
tum, tegula basally, anterolateral edge of

402

Journal of Hymenoftera Research

scutellum, submedial spots on metano-
tum; wing membrane light brown, darkest
near apex, with black veins; vestiture
black on face and metasoma, silvery on
rest of head and thorax.

Female. — Body length 11 mm; head and
thorax coarsely punctate, punctures con-
tiguous to 0.5 PD apart; abdominal punc-
tures slightly smaller and 0.5-1.0 PD
apart; frons with medial longitudinal sul-
cus, extending more than halfway to pos-
terior head margin; clypeal margin cen-
trally concave and pointed apically; F-I
length 1.3X breadth, F-II length 1.6 X
breadth; propodeum subrectangular in
dorsal view, with transverse basal carina
and lateral edge marked by sharp carina;
T-I punctures longitudinally striatiform;
metasomal sternum I with short medial
longitudinal carina; body dark brown to
black, with pale, silvery setae.

Type material. — Holotype 6 (flagellom-
eres affixed to point below specimen):
NEW CALEDONIA, Sarramea, 24 Dec.

1991, M. E. Irwin (PARIS). Paratypes: 6
6 6, 3 6 6, same data as holotype; 1 6, 1
9 (in copula), Sarramea, 24-25 Dec. 1991,
M. E. Irwin, D. W. Webb, malaise trap
across forest opening; 1 6, trail to Mt.
Panie, 22 km NW Hienghene, 11 Nov.

1992, D. W. Webb, E. & M. Schlinger, mal-
aise trap in tropical rainforest, 457 m (DA-
VIS, ILLINOIS). This species was collected
in November and December.

Etymology. — The species is named in
honor of the collector, Michael E. Irwin.

Discussion. — Males of both iriuini and ni-
gra share the oddly keeled metasomal ster-
num I, and both are black with pale mark-
ings. However, irwini can be immediately
distinguished by the presence of a mid-
coxal spine and fully developed meso-
pleural lamellae. The shape of the aedea-
gus is also unique to irwini.

Eirone koghisica Kimsey, new species

(Fig. 2, 25)

Male. — Body length 11-13 mm; fore-
wing length 10-11 mm; face (Fig. 2), punc-

tures widely separated on frons and ver-
tex, 2-A PD apart, becoming smaller and
denser toward inner eye margin, tiny and
contiguous between inner eye margin and
antennal socket; clypeal punctures contig-
uous and somewhat striatiform medially;
clypeal apex slightly flared anteriorly,
slightly depressed medially when viewed
in profile, apex weakly trilobate and 3
MOD wide between outer lobes; F-I length
2X breadth; F-II length 2.3 X breadth;
pronotal and scutal punctures sparse and
2-A PD apart medially, becoming smaller
and denser laterally, contiguous to 0.5 PD
apart; mesopleural punctures 0.5-1.0 PD
apart; scutellum impunctate basally, be-
coming punctate posterolaterally, punc-
tures 0.5-1.0 PD apart; propodeum finely
shagreened, punctures 0.5-1.0 PD apart,
with impunctate sublateral area; midcoxal
spine present; abdominal segments finely
shagreened, with scattered punctures 2-A
PD apart; metasomal sternum I with me-
dial keel extending three-fourths of total
length, abruptly declivitous posteriorly;
epipygium with narrowly rounded apex;
hypopygium with narrowly rounded
apex; genital capsule (Fig. 25): gonocoxa
with submedial welt or swelling on inner
surface; aedeagus apical column bending
dorsally, with apex broadened; penis
valve with large dorsal hook; volsella dor-
sally broadened and subrectangular, ven-
trally with brief row of dense short setae
or spines. Body black, with pale yellow or
cream-colored markings on lower three
quarters of inner and outer eye margins,
antennal lobes, transverse band on lower
face from mandibular bases across clype-
us, mandibular base, transverse band
along anterior pronotal carina broken me-
dially, arc on posterior lobe of pronotum
near tegula, basally on tegula, scutum at
posterolaterally, metanotum medially;
wing membrane brown becoming darker
in medial cell, with brown veins; vestiture
silvery on head and thorax, black on me-
tasoma.

Female. — Unknown.

Volume 9, Number 2, 2000

403

Type material. — Holotype 6: NEW CAL-
EDONIA, Prov. Sud, Mt Koghis, 17 km
nne Noumea, malaise across path in rain-
forest, 425m, 8-10 Jan. 1996, M. E. Irwin,

D. W. Webb, E. I. Schlinger, 22°10'34"S
166°30'17"E (PARIS). Paratypes: 6 6 6, 2
6 6 , Riviere Bleue Prov. Pk., trail to Upper
Riviere Bleue, 19-28 Nov. 1992, 305 m, D.
W. Webb; Riviere Bleue Prov. Pk., km 21.9
Riviere Bleue road, Nov. 1992, 290 m, M.

E. Irwin, D. W. Webb; 2 6 6, same as pre-
vious, except, 5-16 Nov. 1992, 290 m, D.
W. Webb; 1 6, Riviere Bleue Prov. Pk.,
trail to Vallee de Pourina, 19-28 Nov.
1992, 850 m, D. W. Webb; 1 6, Mt Koghis,
17 km nne Noumea 5-15 Nov. 1992, D. W.
Webb (DAVIS, ILLINOIS). This species
was collected in November and early Jan-
uary.

Etymology. — This species is named after
the collection site on Mt. Koghis.

Discussion. — Eirone khogisica most close-
ly resembles laniensis, based on the apical-
ly convex clypeus, shallowly convex me-
tasomal sternum I, presence of a midcoxal
spine and well-developed mesopleural la-
mella. Both species are basically black
with yellow to whitish markings. How-
ever, koghisica can be distinguished from
laniensis by the trilobate clypeus, and api-
cally rounded or truncate epipygium.

Eirone laniensis Baptiste, new species

(Figs. 3, 20, 26)

Male. — Body length 10-16 mm; fore-
wing length 9-13 mm; face (Fig. 3); punc-
tation as in koghisica, except clypeal punc-
tures 1-2 PD apart; clypeal apex gently
convex medially and 2.5 MOD wide; F-I
length 2.3X breadth; F-II length 3.6X
breadth; midcoxal spine present; metaso-
mal sternum I with medial longitudinal
carina extending about halfway from an-
terior edge; epipygium with narrowly
truncate bilobate apex, medially de-
pressed subapically, with long setae aris-
ing from margins, strongly flattened in
profile; hypopygium narrowly rounded
apically and flattened in profile, with

short, stout fringe of setae along apex (Fig.
20); genital capsule (Fig. 26): gonocoxa
with subapical ridge; aedeagus with apical
column slender and elongate, extending
two-thirds length of gonocoxa, bending
dorsally; penis valve appearing strongly
trilobate, with long dorsal hook; volsella
strongly bilobate dorsally, ventrally with
densely setose surface. Head black, with
yellow or cream-colored markings on an-
tennal lobes, lower half of clypeus, inner
and outer eye margins, spot behind eye,
base of mandible; pronotal band on ante-
rior carina, on pronotal lobe near tegula;
mesopleuron black, with yellow spot be-
low tegula; scutum black with yellow spot
basally on tegula; scutellum and metano-
tum with yellow markings medially and
on anterolateral edge; propodeum with
posterior yellow submedial spots; legs or-
ange, except coxae black with yellow-or-
ange ventral markings ventrally; metaso-
ma orange, with black markings basally
and apically on T-I, apically on metasomal
sternum II and T-V, T-VI, metasomal ster-
num I, S-V and S-VI entirely black; wing
membrane light brown with dark brown
veins; vestiture silvery on head and tho-
rax, orange on metasomal except black in
specimens from Mt. Koghis and Mt. Dzu-
mac.

Female. — Unknown.

Type material. — Holotype 6: NEW CAL-
EDONIA, Upper La Ni Valley, 2-17 Nov.
1992, D. W. Webb, 103 m, malaise trap
across logging road (PARIS). Paratypes 42
6 6, 34 6 6 , same data as holotype; 2 6 6,
Riviere Bleue Prov. Pk., trail to Vallee de
Pourina, 19-28 Nov. 1992, 850 m, D. W.
Webb, malaise trap across forest path; 1 6 ,
Riviere Bleue Prov. Pk., km 25.8, Riviere
Bleue road, 30 Oct - 3 Nov. 1992, 213 m,
M. E. Irwin, D. W. Webb; 2 6 6, Mt. Kogh-
is, 500 m, 17 km nne Noumea, 5-15 Nov.
1992, D. W. Webb; 1 6, Mt. Koghis, 500
m, 17 km nne Noumea, 1-3 Nov. 1992, M.
E. Irwin, D. W. Webb, malaise trap in
tropical forest; 1 6, Mt. Koghis, 800 m, 1-
6 Sept. 1972, J. F. McAlpine; 1 6, Mt. Dzu-

404 Journal of Hymenoftera Research

mac, 900 m, 166°28'E 22°1'45"S, 1-10 Nov. face; aedeagus apical column elongate,

1986, R. L. Brown, Malaise trap (DAVIS, sinuous, and slender, bending ventrally;

ILLINOIS, OTTAWA). This species was penis valve with large, slender dorsal

collected in November. hook and ventral lobe strongly expanded

Etymology. — Eirone laniensis is named af- apically; volsella dorsally large and fist-

ter the collection site in the La Ni Valley. like with small subsidiary lobe with 3-5

Discussion. — Eirone laniensis most closely long apical setae, ventrally with curved

resembles koghisica as discussed under digitate lobe margined by erect, long,

that species. Additional diagnostic fea- somewhat curly setae, apical margin with

tures include the presence of a midcoxal short erect setae. Head yellow, with black

spine, apically convex clypeal margin and markings, except orange on pedicel, ven-

well-developed mesopleural lamella, tral surface of scape and apical rim of

Specimens from Mt. Koghis and Mt. Dzu- clypeus, on frons back to occiput, diagonal

mac tend to be darker, with more black bands extending from upper posterior eye

coloration than the rest. However, struc- margins to occiput, flagellomeres and dor-

turally they appear to be the same as the sal surface of scape, mandibular apex;

rest of the paratypes. pronotum yellow, with black markings

anteriorly, submedially behind anterior

Eirone maigretae Baptiste, new species carina to lateml area posterior margin

(rigs. 4, 1U, 11, I/) transparent and orange-tinted; mesopleu-
Male. — Body length 18-21 mm; fore- ron orange, with black markings along
wing length 14-16 mm; face (Fig. 4) punc- upper anterior edge to wing fossa; scutum
tures tiny between antennal lobes and in- black, except anteromedially orange, with
ner eye margins, contiguous to 0.5 PD posterior submedial yellow longitudinal
apart, becoming slightly larger and less bands; scutellum black, with yellow sub-
dense, 0.5-1.0 PD apart on frons and ver- medially; metanotum black with yellow
tex; clypeus medially gently convex, api- band medially; propodeum orange with
cal truncation 2.2-2.3 MOD wide, punc- black submedially, and medial longitudi-
tures small and 0.5-1.0 PD apart medially; nal yellow band; legs orange, with black
F-I 2.2 X; F-II length 3.2 X breadth; prono- dorsally on the coxae, trochanters and
tal punctures tiny and 2-4 PD apart; scutal femora; metasoma orange, with black on
punctures tiny and nearly contiguous lat- posterolateral area of T-I and on hypopy-
erally, becoming 0.5-2 PD apart laterally; gium; wing membrane brown, darkest
mesopleural punctures 0.5-2.0 PD apart; apically, with dark brown-black veins;
mesopleural lamella apically rounded and vestiture silvery to pale yellow on head
flat against body; scutellum punctate me- and thorax, orange on metasoma.
dially and submedially, punctures 1-2 PD Female. — Unknown,
apart; propodeum finely and densely sha- Type material. — Holotype 6: NEW CAL-
greened, punctures 1-2 PD apart, impunc- EDONIA, trail to Mt. Panie, 22 km NW
tate laterally; abdominal segments finely Hienghene, 11-25 Nov. 1992, D. W. Webb,
shagreened, punctures tiny and 4-6 PD E. & M. Schlinger, malaise trap, in tropical
apart; metasomal sternum I with medial forest, 457 m (PARIS). Paratypes 28 6 6:
longitudinal keel extending about halfway 19 6 6, same data as holotype; 6 6, same
from anterior edge, sloping obliquely to as holotype, except, 11 Nov. 1992, E. & M.
posterior margin; epipygium strongly con- Schlinger, 238-548 m; 1 6, Mt. Koghis, 500
vex in profile, apex rounded (Fig. 21); hy- m, 17 km nne Noumea, 3-4 Nov. 1992, M.
popygium with broadly rounded apex; E. Irwin, D. W. Webb, E. & M. Schlinger;
genital capsule (Fig. 27): gonocoxa with at 1 6 , Mt. Koghis, 500 m, 17 km nne Nou-
most an obsolescent ridge on inner sur- mea, 24-26 Dec. 1991, M. E. Irwin, D. W.

Volume 9, Number 2, 2000

405

Webb; 1 6, Mt. Panie, 250-350 m, 30 Oct.
1986, R. L. Brown, sweeping; (DAVIS, IL-
LINOIS, OTTAWA). This species was col-
lected from late October into late Decem-
ber.

Etymology. — This species of Eirone is
named after Carolyn S. Maigret.

Discussion. — Eirone maigretae can be dis-
tinguished from the other species lacking
a midcoxal spine as discussed under emar-
ginata and webbi.

Eirone nasalis Kimsey, new species

(Figs. 7, 12, 28)

Male. — Body length 15-19 mm; fore-
wing length 10-14 mm; face (Fig. 7) lower
facial punctures tiny and nearly contigu-
ous, except upper clypeal margin nearly
impunctate; clypeus projecting subapical-
ly, with well-developed, horizontally ori-
ented ventral bevel, apex medially form-
ing anteriorly projecting knob, with long
pale setae, strongly nasiform in profile;
frons punctures larger and 0.5-1.0 PD
apart, except nearly impunctate medially
below midocellus; vertex punctures 0.5-
1.0 PD apart; F-I length 2.7 X breadth; F-II
length 2.8 X breadth; pronotal and scutal
punctures 0.5-1.0 PD apart, becoming
sparsest medially; mesopleural punctures
0.5 PD apart; scutellar punctures 1 PD
apart laterally, becoming sparser medial-
ly; midcoxal spine present; propodeum
primarily punctate, punctures 0.5-1.0 PD
apart, except anterolaterally impunctate;
abdominal segments finely shagreened,
punctures irregularly spaced, 2-6 PD
apart; metasomal sternum I with medial
keel along entire length and abruptly de-
clivous posteriorly (Fig. 12); epipygium
with medial depression, apex bilobate,
flattened in profile; hypopygium subrect-
angular, slightly narrowed and subtrun-
cate apically; genital capsule (Fig. 28):
gonocoxa with subapical ridge on inner
surface and large subbasal lobe on dorsal
margin connected to setose medial lobe on
inner surface; aedeagus apical column
elongate, extending more than two-thirds

length of gonocoxa, sharply angled ven-
trally, apex broadly elongate triangular;
penis valve with slender and elongate dor-
sal hook and ventral lobe; volsella broadly
truncate dorsally, ventral surface with row
of erect curved setae. Black, with cream-
colored or light yellow band along inner
and outer eye margins; wing membrane
light brown with brown veins; vestiture
silvery on head, thorax and metasomal
basal segments, black on apical segments.

Female. — Unknown.

Type material. — Holotype 6: NEW CAL-
EDONIA, trail to Mt. Panie, 22 km NW
Hienghene, 11-25 Nov. 1992, D. W. Webb,
E. & M. Schlinger, malaise trap in tropical
forest, 600 m (PARIS). Paratypes 39 6 6,
25 8 8, same data as holotype, except 457
m; 6 6 6, same data as holotype, except
457 m and 11 Nov. 1992; 4 6 6, Mt. Mand-
janie, 5.3 km wsw Pouebo, 9-26 Nov.
1992, D. W. Webb, 550 m, malaise trap in
tropical forest (DAVIS, ILLINOIS). This
species was collected in November.

Etymology. — The species name refers to
the nose-like projection of the clypeus.

Discussion. — This species can be imme-
diately recognized by the projecting nose-
like clypeus. Additional diagnostic fea-
tures include the large rounded meso-
pleural lamella, presence of a midcoxal
spine and black body color.

Eirone neocaledonica Williams

(Figs. 17, 29)

Eirone neocaledonica Williams 1945:415. Holo-
type 6: New Caledonia: Thi River Valley
near St. Louis (WASHINGTON), examined.

Male. — Body length 9-11 mm; forewing
length 7-9 mm; face with tiny contiguous
punctures between inner eye margins and
antennal sockets; frons nearlv impunctate,
with punctures widely separated, partic-
ularly along medial sulcus; clypeus with
punctures much larger than along inner
eye margin, punctures 0.5-1.0 PD apart,
but obscured by fine shagreening; clypeal
apex narrowly truncate, truncation 2.2

406

Journal of Hymenoptera Research

MOD wide; F-I length 2.2 X breadth; F-II
length 3X breadth; pronotum almost im-
punctate with few scattered lateral punc-
tures; mesopleural punctures 0.5-1.5 PD
apart, with dense, fine shagreening be-
tween; mesopleural lamella rounded pos-
teriorly; scutal punctures medially 3-5 PD
apart, becoming finer and denser laterally,
1-2 PD apart; scutellum nearly impunctate
medially, laterally punctures 1-2 PD
apart, with dense, fine shagreening; pro-
podeum laterally with large tubercle,
nearly impunctate except small medial
patch of punctures (2-5 PD apart) and lat-
erally below tubercle punctures smaller
and 0.5-1.0 PD apart; midcoxal spine pre-
sent; metasomal sternum I strongly trian-
gular in profile, sloping abruptly to pos-
terior margin; epipygium convex with two
large digitate apicolateral lobes; hypopy-
gium flat and broadly angulate apically;
genital capsule (Fig. 29): gonocoxa with
medial swelling associated with tuft of
long setae on inner surface; aedeagus api-
cal column elongate, slender and sinuous,
bending ventrally; penis valve with broad
dorsal lobe and broad, wing-like apical
lobe; volsella with broad dorsal lobe, se-
tose medial lobe and asetose ventral sur-
face; color: black; wing membrane untint-
ed basally, brown-tinted apically, partic-
ularly in marginal cell of forewing; pubes-
cence on head and thorax silvery, on
metasoma black.

Material examined. — 3 males (including
the holotype): 9.1 km NW Sarramea, Thi
River Valley, and Mt. Koghis (17 km nne
Noumea) (HONOLULU, URBANA,
WASHINGTON). This species was col-
lected in the months of December and Jan-
uary.

Discussion. — Eirone neocaledonica is one
of the most unusually modified species
and does not resemble any other in the
genus. It can be immediately recognized
in the male by the bidigitate epipygium,
tuberculate propodeum and mesopleuron
and truncate clypeal apex.

Eirone nepouiensis Baptiste, new species

(Figs. 10, 13, 30)

Male. — Body length 10-14 mm; fore-
wing length 9-11 mm; clypeal punctures
discrete and nearly touching; clypeal apex
bilobate in ventral view, apical bevel near-
ly horizontal in profile, apical truncation
2.8 MOD wide; punctures along lower in-
ner eye margin tiny and contiguous; frons
punctures much larger and 0.5-2 PD
apart; vertex punctures 0.5-1.0 PD apart;
F-I length 2.0-2.1 x breadth; F-II length
2.4-2.5 X breadth; pronotal punctation 1-4
PD apart, except nearly impunctate me-
dially; scutal punctures 0.5 PD apart an-
teriorly and laterally, becoming 1-3 PD
apart medially; scutellar punctures contig-
uous laterally, 2-3 PD apart medially; me-
sopleural punctation 1-3 PD apart, becom-
ing much finer and denser near meta-
pleural suture; propodeal punctures 1-2
PD apart, becoming impunctate sublater-
ally; metasomal punctures 2-A PD apart;
midcoxal spine present (Fig. 10); metaso-
mal sternum I with medial carina extend-
ing one-third to one-half distance from an-
terior edge, obliquely sloping to posterior
margin (Fig. 13); epipygium broadly
rounded apically, medially depressed; hy-
popygium with bluntly rounded apex;
genital capsule (Fig. 30): gonocoxa broad,
inner surface without distinct ridges or
lobes; aedeagus apical column slender,
short, extending only slightly beyond pe-
nis valve; penis valve with broad, wing-
like apical and basal lobes, dorsal lobe
broadly rounded and hooked apically;
volsella with bilobate and hooked dorsal
surface, ventrally asetose and abbreviated;
color black, with yellow markings on an-
tennal lobes, clypeus except distal edge,
inner and outer eye margins, basal two-
thirds of mandibles, across anterior pron-
otal carina (broken medially) and near
dorsolateral apex, pronotal lobe, basal
edge of tegula, band submedially on scu-
tum, spot on scutellum anterolateral^ and
posterolaterally, metanotum submedially

Volume 9, Number 2, 2000

407

and at hind wing base attachment, meso-
pleuron with spot below tegula, forefemur
anteriorly; propodeum posterolaterally; T-
I-III with lateral spots; wing membrane
brown, with dark brown veins; vestiture
brownish on head and thorax, black on
metasoma.

Female. — unknown.

Type material. — Holotype 6 (right an-
tennal flagellomeres 2-3 missing, flagel-
lomeres IV-XI mounted on point below
specimen): Presqu'ile de Pindai, 6 km sw
Nepoui, 25 Dec. 1991, M. E. Irwin (PARIS).
Paratypes, 2 6 6, Plage de Pindai, 6 km
sw Nepoui, 7-13 Nov. 1992, D. W. Webb,
malaise trap in coastal dunes area (DAVIS,
ILLINOIS). Specimens were collected in
November.

Etymology. — This species is named after
the collection site on Nepoui.

Discussion. — The flattened metasomal
sternum I, emarginate mesopleural lamel-
la, midcoxal spine and black coloration are
characteristics shared by nepouiensis and
transversa. However, nepouiensis can be
distinguished from transversa by the ven-
trally bilobate clypeus and nearly horizon-
tal clypeal bevel.

Eirone nigra Brown

(Figs. 11, 31)

Eirone nigra Brown 1984:257. Holotype 6: New
Caledonia: Hienghene (HONOLULU), ex-
amined.

Male. — Body length 13 mm; forewing
length 11 mm; face with tiny contiguous
punctures between inner eye margins and
antennal sockets; frons impunctate around
medial sulcus, laterally punctures 0.5-1.0
PD apart; clypeus with punctures larger
than along inner eye margin, punctures
0.5-1.0 PD apart; clypeus convex medially,
apex narrowly truncate, truncation 1.2
MOD; F-I length twice breadth; F-II length
2.8 X breadth; pronotal punctures 1-3 PD
apart; mesopleural punctures 1-2 PD
apart; mesopleural lamella short, apically
emarginate; scutal punctures sparsest me-

dially (1-3 PD apart), becoming finer and
denser laterally (0.5-1.0 PD apart); scutel-
lum impunctate medially, denser laterally,
lateral punctures 0.5-1.0 PD apart; pro-
podeum punctate in small medial patch
(punctures 1-2 PD apart) and laterally
(punctures 0.5-1.0 PD apart), impunctate
sublaterally; midcoxa without apical
spine; metasomal sternum I gently con-
vex, with short medial carina extending
about half length, sloping gently to pos-
terior margin; epipygium strongly convex,
apically subtruncate; hypopygium flat,
broadly rounded apically; genital capsule
(Fig. 31): gonocoxa with swelling above
volsella on inner surface; aedeagus with
slender apical column bending ventrally;
penis valve with long dorsal hook, ventral
lobe with long slender digitate apical lobe
bending dorsally; volsella with large,
broadly rounded dorsal lobe, ventrally
with densely setose digitate lobe; color:
black, wing membrane dark brown-tinted,
veins black; pubescence on head and tho-
rax silvery, metasoma black.

Material examined. — Only the holotype
has been seen. It was collected in Hiengh-
ene in January.

Discussion. — The lack of a midcoxal
spine and short mesopleural lamella sug-
gests a close relationship between nigra,
and tfiaigretae and emarginata. However,
the shorter F-I, clypeal truncation narrow-
er than the transantennal distance and the
black abdominal setae distinguish nigra
from these two species.

Eirone obtusidens Turner

(Figs. 5, 32)

Eirone obtusidens Turner 1919:236. Holotype 6:
New Caledonia: Noumea (LONDON), ex-
amined.

Eirone obtusidens var. supcrstcs Cockerell 1929:
239. Holotype 8: New Caledonia: Bourail
(WASHINGTON). Synonymized by Brown
1984.

Male. — Body length 13-14 mm; fore-
wing length 11-12 mm; face with tiny con-
tiguous punctures between inner eye mar-

408 Journal of Hymenoptera Research

gins and antennal sockets; frons with Eirone paniensis Kimsey, new species

punctures 0.5-2 apart, except impunctate (Fig. 6, 33)
along medial sulcus and adjacent to anten- . , , „ , - , _
nal socket; clypeus with punctures larger , Mf 7?°^ length 7-12 mm; forewing
than along inner eye margin, punctures lf §th ^J° mm; faCe <Fi§- 6> Potation;
contiguous; clypeal apex broadly triangu- ^PeUS ^greened, most punctures 1-2
lar, with single apicomedial lobe; F-I PD apart, becoming sparser apically, inner
length 2.4-2.5 X breadth; F-II length 3.0- e^e mar§insr with tir7' nearly contiguous
3.2X breadth; pronotal punctures 1-3 PD Punctures; fro™ with punctures 2-5 PD
apart; mesopleural punctures 1-2 PD aPart' imPunctate medially; clypeus gent-
apart separated by dense, fine shagreen- ^ convex' aPex broadly truncate, trunca-
ing; mesopleural lamella posteriorly tlon 2 MOD Wlde; vertex Pictures 2-5
rounded; scutal punctures densest along PD aPart; W len§th 2X breadth; F-II
notauli (nearly contiguous), medially length 3 X breadth; malar lobe subtending
sparsest (0.5-1 PD apart); scutellum nearly mandibular articulation tooth-like; prono-
impunctate medially, punctures denser tum impunctate and polished dorsally,
laterally, 0.5-1.0 PD apart; propodeum Slde Wlth punctures 1-2 PD apart; meso-
punctate medially and propodeum punc- Pleuron bulging and knob-like medially,
tate medially and laterally, 0.5-1.0 PD punctures 0.5-2 PD apart, densest dorsal-
apart; propodeum punctate medially and lY' mesopleural lamella broadly rounded
laterally, punctures 0.5-1.0 PD apart, im- aPicallY and bending slightly ventrally;
punctate sublaterally; metasomal sternum scutum strongly depressed posteriorly
I sharply keeled, keel somewhat hooked alon§ notalices, finely shagreened, scutal
posteriorly, abruptly declivous posterior- punctures 0.5-5 PD apart, becoming near-
ly; epipygium and hypopygium flattened ty impunctate posteromedially; scutellar
and apex narrowly subtruncate; genital punctures 1-5 PD apart, nearly impunc-
capsule (Fig. 32): gonocoxa with low me- tate medially; propodeum finely shagree-
dial angular lobe on inner surface; aedea- ned and impunctate dorsally except for
gus elongate, apical column broad and punctate medial band, strongly rubercu-
flattened, bending dorsally, apically trun- late sublaterally, becoming densely punc-
cate, column extending more than half its tate laterally, punctures 0.5-2 PD apart;
length beyond penis valve; penis valve midcoxa with acute spine; metasomal ster-
with short dorsal hook, large, rounded num I broadly triangular in profile, slop-
ventral lobe and elongate basal lobe; vol- ing obliquely toward posterior margin,
sella with bilobate dorsal projection, apical not medially carinate; epipygium broadly
lobe capitate and ventral surface slender rounded apically, apical margin with
with row of long setae. slight medial indentation, convex in pro-

Material examined. — 7 6 S (including the file; hypopygium broadly rounded and

holotype of obtusidens), from Prov. Sud, spinose, with flattened apex; genital cap-

7.5 km NW and 1 km NW Sarramea, Ri- sule (Fig. 33): gonocoxal inner surface

viere Bleue, Mt. Panie, Noumea and Bour- smooth; aedeagus apical column slender,

ail. Specimens were collected in October, elongate and sinuous, extending more

November and January. than two-thirds length of gonocoxa; penis

Discussion. — The shape of the clypeus in valve with rounded dorsal and ventral

obtusidens and anone is unique among the lobes; volsella with large truncate and se-

New Caledonian species. Eirone obtusidens tose dorsal lobe, ventral surface with erect,

can be distinguished from anone by the dense row of setae. Body black, with pale

gently convex metasomal sternum I as dis- yellow or cream-colored markings on

cussed under that species. mandibular base, lower half of clypeus,

Volume 9, Number 2, 2000 409

along inner and outer eye margins, on an- mesopleural lamella rounded apically and

tennal lobes, transverse band (broken me- bending ventrally; scutum punctate and

dially and sublaterally) along anterior shagreened laterally, punctures 0.5-1 PD

pronotal carina, spot on pronotal lobe, dis- apart, becoming sparsely punctate medi-

tal forecoxal spot and subalar spot on me- ally with punctures 1-3 PD apart; scutel-

sopleuron, spot on tegula and on scutel- lum laterally punctate, punctures 0.5-1 PD

lum laterally; wing membrane brown, be- apart, medially polished and impunctate;

coming darkest on apical third, with black propodeum finely shagreened, with punc-

veins; vestiture silvery on head and tho- tures 1-2 PD apart, except laterally 0.5-1

rax, black on metasoma. PD apart, sublaterally impunctate; mid-

Female. — Unknown. coxal spine present; metasomal sternum I

Type material. — Holotype 6: trail to Mt. broadly triangular in lateral view, sloping
Panie, 22 km NW Hienghene, 11-25 Nov. obliquely posteriorly (Fig. 15); epipygium
1992, 600 m, tropical forest, malaise trap, narrowly rounded apically, flattened in
D. W. Webb and E. & M. Schlinger (PAR- profile; hypopygium with narrowly
IS). Paratypes, 5 8 8, same data as holo- rounded apex, apical rim medially thick-
type (DAVIS, ILLINOIS). All specimens ened and spinose; genital capsule (Fig. 34):
were collected in November. gonocoxa with angulate ridge subapically

Etymology. — Eirone paniensis is named on inner surface; aedeagus with apical col-
after the collection site, Mt. Panie. umn Flattened and becoming broadly sub-

Discussion. — Much like neocaledonica, triangular apically; penis valve small with

paniensis has a prominent knob on either sharply hooked dorsal and ventral lobes,

side of the propodeum and very similar occupying half or less the distance across

aedeagus and penis valve. Both species genital capsule; volsella dorsally fist-like,

are relatively small-bodied, 7-10 mm long, ventral half forming a long flat surface

and black, with few pale markings. How- with row of dense, stout setae. Body black,

ever, paniensis can be distinguished from with light yellow or cream-colored mark-

neocaledonica by the strongly tuberculate ings on clypeus above apical margin,

mesopleuron, gonocoxa with large interior along lower two-thirds of inner and outer

brush of long setae, and tooth-like genal eye margins, antennal lobes, band along

projection. In addition, paniensis has a pronotal transverse anterior carina (bro-

midcoxal spine and well-developed me- ken medially), band anterolaterally and

sopleural lamella posterior lobe of pronotum; wing mem-
brane brown, with brown veins; vestiture

Eirone rivierensis Baptiste, new species silvery on head and thorax metasomal

(Figs. 15, 34) terga j_VII with long/ erect black setae

Male. — Body length 8-14 mm; forewing along posterior margin that are densest on

length 9-12 mm; facial punctures 1-3 PD VII; sternum II-VI with long, erect black

apart, except area between inner eye mar- setae along posterior margin,

gin and antennal bases with tiny, nearly Female. — Unknown,

contiguous punctures, and narrow im- Type material. — Holotype 8 (left anten-

punctate longitudinal band below mido- nal flagellomeres II-XIII missing): Riviere

cellus; clypeus convex medially and api- Bleue Prov. Pk., 19-20 Nov. 1992, 213 m,

cally truncate, apical truncation 2 MOD D. W. Webb & E. and M. Schlinger (PAR-

wide; F-I length 2x breadth; F-II length IS). Paratypes 9 8 6, 1 6, Riviere Bleue

3X breadth; pronotal punctures 1-3 PD Prov. Pk., km 25.8 Riviere Bleue road, 5-

apart; mesopleuron projecting medially, 16 Nov. 1992, 213 m, D. W. Webb, E. & M.

integument shagreened, with punctures Schlinger; 1 8 6, ibid., except, 30 Oct.-3

1-2 PD apart, becoming denser dorsally; Nov., M. E. Irwin, D. W. Webb; 2 8 6,

410 Journal of Hymenoptera Research

ibid., except, km 19.6, 18-20 Nov. 1992, D. apart, laterally 1-2 PD apart; propodeum

W. Webb; 2 6 6, ibid., except, km 21.9, 20- with oblique sublateral swelling, punc-

28 Nov. 1992, M. E. Irwin, D. W. Webb; 1 tures medially 1-3 PD apart, laterally con-

6, 30 km NW Yate, 550 m, 27-28 Decern- tiguous to 0.5 PD apart, impunctate sub-

ber 1991, M. E. Irwin, D. W. Webb; 1 6 , laterally; midcoxa with short apical tooth;

Riviere Bleue Prov. Pk., trail to upper Ri- meso-, metathorax and propodeum finely

viere Bleue, 5-16 Nov. 1992, 290 m, D. W. and densely shagreened between punc-

Webb; 1 6\ Riviere Bleue Prov. Pk., trail tures; metasomal sternum I with sharp,

to Vallee de Pourina, 19-28 Nov. 1992, 850 posteriorly hooked, medial keel, over-

m, D. W. Webb; (DAVIS, ILLINOIS). This hanging metasomal sternum II; epipy-

species was collected in November and gium strongly convex, apically narrowed

December. and truncate; hypopygium flat, apically

Etymology. — This species is named after narrowed and bilobate; genital capsule

the collection site in Riviere Bleue Prov- (Fig. 35): gonocoxa inner surface smooth,

ince. without distinct ridges or lobes; aedeagus

Discussion. — This species can be recog- with apical column elongate, slender and

nized by the primarily black coloration, sinuous, bending ventrally; penis valve

without any reddish coloration, presence large, dorsal lobe with blunt hook, ventral

of a midcoxal spine, rounded mesopleural lobe large and wing-like, extending api-

lamellae and truncate clypeal margin. E. cally; volsella with long curly setae along

rivierensis is most similar to colorata but apical surface, dorsally large and capitate,

can be separated by the dense black tuft ventrally with large flat lobe tipped by

of setae protruding from T-VI and VII. two long setae; color black, with whitish

This tuft of setae is absent in colorata. markings on antennal lobes, inner and

outer eye margins, mandible base, clype-

Eirone salteri Brown us, transverse anterior pronotal margin,

(Figs. 16, 18, 35) pronotum adjacent to tegula, mesopleuron

Urone salteri Brown 1984:250. Holotype 6 : New bel°W te§ula' scutellum ™ th two lateral

Caledonia: St. Louis "Val" (HONOLULU), sPots; ^etanorum medially; legs orange;

examined. wing veins orange, except stigma black;

wing membrane dark yellow-tinted, apex
Male. — Body length 12-14 mm; fore- often browner; vestiture on head and mo-
wing length 10-12 mm; face with tiny, rax silvery to yellowish, on metanotum
contiguous punctures between inner eye brown to black.

margins and antennal sockets; frons with Material examined. — 4 6 6 (including ho-

punctures 0.5-1.0 apart, except nearly im- lotype): Sarramea, St. Louis Val, and 1 km

punctate medially; clypeus subapically n and 9.1 km NW Sarramea. All speci-

concave, apex narrowly produced into mens were collected in late December,

two lobes, 1.2-1.4 MOD apart, surface January and February (DAVIS, HONO-

finely shagreened, punctures much larger LULU, URBANA).

than along inner eye margin, 0.5-1.0 PD Discussion. — Diagnostic features of sal-
apart; F-I length 2.2-2.3 X breadth; F-II teri include the presence of a midcoxal
length 3.2-3.4X breadth; pronotal punc- spine, mesopleural lamella short and
tures 0.5-1.0 PD apart; mesopleural punc- sharply emarginate, keel-like metasomal
tures 0.5-1.0 PD apart; mesopleural la- sternum I overhanging metasomal ster-
mella short, apically truncate; scutal punc- num IT, apically bilobate clypeus, bilobate
tation medially 1-2 PD apart, becoming epipygium and amber-colored wing mem-
finer and denser laterally, 0.5-1.0 PD brane. Metasomal sternum I is the same
apart; scutellar medial punctures 2-A PD odd shape as seen in irwini, but the other

Volume 9, Number 2, 2000

411

features given above will immediately
separate the two.

Eirone subtuberculata Brown

(Fig. 36)

Eirone subtuberculata Brown 1984:253. Holotype
6: New Caledonia: Mts. de Koghis (HON-
OLULU), examined.

Mfl/e.--Body length 15-17 mm; fore-
wing length 11-14 mm; face with tiny con-
tiguous punctures between inner eye mar-
gins and antennal sockets; frons with
punctures contiguous to 0.5 PD apart, ex-
cept impunctate along medial sulcus;
clypeus produced into subapical knob,
with punctures larger than along inner
eye margin, punctures contiguous and
shagreened; clypeal apex truncate, trun-
cation 3.0-3.2 MOD across; F-I length 2.2-
2.3 X breadth; F-II length 3x breadth;
pronotal punctures 1-3 PD apart; meso-
pleural punctures 0.5-1.0 PD apart, sha-
greened between punctures; mesopleural
lamella posteriorly triangular to rounded;
scutal punctures medially 0.5-1.0 PD
apart, becoming finer and denser laterally,
contiguous to 0.5 PD apart; scutellar punc-
tures 2-3 PD apart, laterally 0.5-1.0 PD
apart; propodeum punctures 1-2 PD apart
except anterolaterally, impunctate and
finely shagreened; midcoxa with short
apical tooth; metasomal sternum I strong-
ly produced into slightly hooked keel,
sloping vertically to sternum II; epipy-
gium flattened, apically broadly bilobate;
hypopygium flat, broadly truncate apical-
ly, with slight medial emargination; geni-
tal capsule (Fig. 36): gonocoxa with large
submedial swelling on inner surface and
subbasal lobe on ventral margin; aedeagus
apical column elongate, about two-thirds
as long as gonocoxa, apically curved, ex-
panded and lanceolate; penis valve with
slender dorsal and ventral, apically
hooked lobes, barely obscuring aedeagal
base; volsella with broad dorsal lobe and
slender obsolescent ventral surface, with
short erect setae along apical margin; color

black, with occasional small faint pale
mark on inner and outer eye margin; wing
membrane brown-tinted, veins black; ves-
titure of head and thorax silvery, metaso-
mal brown to black.

Material studied.— 13 6 6: ML Koghis; 17
km nne Noumea (DAVIS, URBANA,
HONOLULU). All specimens were col-
lected in the months of December, January
and February.

Discussion. — Eirone subtuberculata ap-
pears to be most similar to rivierensis and
colorata based on the presence of a mid-
coxal spine, emarginate mesopleural la-
mella, apically truncate epipygium and
thin clypeal apical margin. However, it is
much larger than these two species, rang-
ing from 12-16 mm long. The metasomal
sternum I of subtuberculata differs as well
resembling that of nasalis with an abruptly
declivous posterior margin.

Eirone transversa Brown

(Fig. 37)

Eirone transversa Brown 1984:254. Holotype 8:
New Caledonia: Mts. de Koghis (HONO-
LULU), examined.

Male. — Body length 10-15 mm; fore-
wing length 8-12 mm; face with tiny con-
tiguous punctures between inner eye mar-
gins and antennal sockets; frons with
punctures 1-2 PD apart, except impunc-
tate along medial sulcus; clypeus slightlv
convex, with transverse subapical bevel,
punctures larger than along inner eye
margin, 0.5-1.0 PD apart, shagreened be-
tween; clypeal apex truncate, truncation
2.0-2.2 MOD wide; F-I length 2.1-2.2X
breadth; F-II length 2.5-2.6 X breadth;
pronotal punctures tiny, 1^4 PD apart;
mesopleural punctures 0.5-1.0 PD apart,
finely shagreened between; mesopleural
lamella short, apically emarginate; scutal
punctures medially 1-2 PD apart, becom-
ing finer and denser laterallv along notau-
li, contiguous to 1 PD apart; scutellum
nearly impunctate medially, lateral punc-
tures 1-2 PD apart; propodeum punctate

412 Journal of Hymenoptera Research

medially and laterally, punctures 1-A PD Riviere Bleue Road, km 21 and 26; Riviere

apart, impunctate anterolaterally and fine- Bleue Prov. Pk, 30 and 36 km NW Yate;

ly shagreened; midcoxa with apical spine; Riviere Bleue Prov. Pk., trail to Vallee de

metasomal sternum I broadly convex, Pourina; Riviere Bleue Prov Pk., trail to

with short basal carina, sloping gradually Upper Riviere Bleue (DAVIS, ILLINOIS),

to posterior margin; epipygium strongly Specimens were collected in the months of

convex, apex slightly bilobate or emargin- October through January,

ate; hypopygium flat, with broadly round- Discussion. — Most similar to nepouiensis,

ed apex; genital capsule (Fig. 37): gono- as discussed under that species, transversa

coxa narrowed medially, inner surface rel- can be distinguished from nepouiensis by

atively smooth without discrete ridges or the clypeal apex broadly rounded in ven-

lobes; aedeagus with slender and elongate tral view and the apical clypeal bevel

apical column, reaching to apical third of oblique when viewed in profile,
gonocoxal, apical column medially arcu-

ate, extending apically, not bending dor- Eirone webbi Kimsey, new species

sally or ventrally; penis valve dorsal and U^gs- °> ^o)

ventral lobes broadly rounded without Male. — Body length 8-13 mm; forewing

apical hook; volsella dorsally bilobate length 7-11 mm; facial punctures tiny,

with long erect setae along apical margin, contiguous to 1 PD apart across lower

ventral surface with row of elongate erect face, frons and vertex essentially impunc-

setae; color black, with yellowish mark- tate and shiny; clypeus gently convex,

ings on antennal lobes, apical clypeal mar- apex narrowly truncate, truncation 2.1-2.3

gin, mandibular base, spot on inner and MOD wide; F-I length 2X breadth; F-II

outer eye margin, pronotum with medi- length 3x breadth; pronotum highly pol-

ally broken transverse anterior band, ished and nearly impunctate, except lat-

pronotal angle adjacent to tegula, tegula, erally with scattered tiny punctures; me-

small anterolateral scutellar spot; wing sopleural punctation consisting of small

membrane brown-tinted, veins black; pu- punctures about 1 PD apart, becoming

bescence of head and thorax silvery, me- nearly impunctate ventrally; mesopleural

tasoma black. lamellae acute, strongly narrowed apically

Female. — Body length 7-8 mm; body and bending somewhat ventrally (Fig. 8);
coarsely punctate, with fine, dense longi- scutum highly polished, punctures 2-8 PD
tudinal striae; facial punctures large and apart; scutellum with punctures 1-5 PD
somewhat striatiform; frons with obscure apart, densest laterally; propodeum essen-
medial longitudinal groove; F-I as long as tially impunctate, densely and finely sha-
broad; F-II length 1.2X breadth; clypeal greened; metasomal sternum I with short
apex truncate; pronotum rounded lateral- medial carina forming obtuse angle in
ly; propodeum impunctate laterally, elon- profile; epipygium with narrowly round-
gate with flattened dorsal surface and lat- ed apex; hypopygium broadly rounded,
eral edges rounded, not carinate; T-I con- with narrow, thickened spine-rimmed api-
tinuous with II, not constricted posterior- cal margin; genital capsule (Fig. 38): par-
ly; metasomal sternum I with strongly amere with smooth inner surface; aedea-
projection medial keel, appearing sharply gus with short apical column; penis valve
triangular in profile. with rounded dorsal lobe, ventral lobe

Material studied. — 91 6 6, 1 9: Mt. short and apically hooked; volsella with

Koghis; 17 km nne Noumea; Riviere Bleue large truncate dorsal lobe, setose medial

Prov. Pk., 9-10 km NW Sarramea; 13 km lobe and ventral surface asetose. Body

se Kaala-Gomen; trail to Mt. Panie, 22 km black, with pale yellow or cream-colored

NW Hienghene; Riviere Bleue Prov. Pk. markings on mandibular bases, clypeus,

Volume 9, Number 2, 2000 413

inner and outer eye margins, antennal m, malaise trap in tropical forest; 2 6 6,1

lobe, pronotum with transverse band on 9, Riviere Bleue Prov. Pk., 30 km NW

anterior carina and narrow band on pos- Yate, 270 m, 27 Dec. 1991, M. E. Irwin, D.

terior lobe, mesopleuron with small sub- W. Webb; 1 6, ibid., except 36 km NW

alar spot, tegula with small spot, scutel- Yate, 21 Dec. 1991, M. E. Irwin, D. W.

lum with lateral spot, metanotum with Webb; 5 6 6, Riviere Bleue Prov. Pk., trail

medial spot, propodeum with postero- to Vallee de Pourina, 19-28 Nov. 1992, 850

medial and small lateral spots (faint in ho- m, D. W. Webb; 19 6 6, 1 9, trail to Mt.

lotype); wing membrane brown with Panie, 22 km NW Hienghene, 11-25 Nov.

black veins; vestiture sparse, silvery to 1992, D. W. Webb, E. & M. Schlinger; 1 6,

yellowish on head and thorax, brown to same as previous location, except 11 Nov.

black on metasoma. 1992; 1 6 , Mt. Do, 14 km ne Bouloupari,

Female.— Body length 5-6 mm; frons 31 Oct.^4 Nov. 1992, M. E. Irwin, D. W.
with medial longitudinal irregular groove Webb, E. & M. Schlinger, 1000 m;l d, Mt.
extending two- thirds head length; head, Panie, 250-350 ft., 30 Oct. 1986, R. L.
thorax and abdomen covered with fine Brown; 1 6, Riviere Bleue, 166°39.55'E
dense longitudinal striae; clypeal margin 22°6'S, 18 Oct. 1986, R. L. Brown (DAVIS,
medially concave and broadly truncate; F- ILLINOIS). Specimens were collected in
I length lx breadth; F-II length 1.3X the months of October and November,
breadth; pronotum subquadrate, slightly Other material examined. — 1 9, Riviere
narrowed anteriorly, dorsally impunctate Bleue Prov. Pk., trail to Vallee de Pourina,
except for irregular row of punctures ex- 19-28 Nov. 1992, 850 m, D. W. Webb; 1 9,
tending medially and continuing across same as above, except trail to Upper Riv.
scutellum and propodeum; propodeum Bleue, 16-19 Nov. 1992, 290 m.
long and flattened, lateral edge rounded, Etymologx/. — This species is named after
not carinate, impunctate medially, with the collector, Donald W. Webb,
punctures clustered along margins; T-I no- Discussion. — Most individuals of this
dose, strongly constricted posteriorly; me- species are entirely black. However, some
tasomal sternum I shallowly convex, with- are orange or have varying amounts of
out distinct medial keel or carina; tergal black and orange coloration. Eirone webbi
punctures sparse and somewhat striati- is one of the New Caledonian species lack-
form; T-VI with elevated longitudinal me- ing a midcoxal spine, the others being im-
dial impunctate welt; body dark brown punctata, emarginata, nigra and maigretae.
with pale setae. Unlike these species, webbi can be distin-

Type material. — Holotype 6: NEW CAL- guished by the strongly apically narrowed

EDONIA, Riviere Bleue Prov. Pk., trail to and flattened epipygium and hypopy-

Upper Riviere Bleue, 5-16 Nov 1992, 290 gium. The epipygium is slightly indented

m, D. W. Webb, malaise trap across forest apicomedially and not broadly rounded as

path (PARIS). Paratypes, 57 6 6, 11 6 6, in the other species. In webbi the clypeal

same data as holotype; 2 6 6, ibid., except apex is broadly truncate, and the trunca-

3-5 Nov. 1992; 5 6 6, ibid., except 19-20 tion has blunt lateral corners. In maigretae

Dec. 1992; 1 6, Riviere Bleue Prov. Pk., km and even more so in emarginata, the cor-

19.6 Riviere Bleue rd., 20-28 Nov. 1992, ners are acute, and in emarginata the clvp-

183 m, D. W. Webb; 1 6 , Riviere Bleue eus is apicomedially emarginate. The epi-

Prov. Pk., km 25.8 Riviere Bleue rd., 17 pygium in maigretae, nigra and emarginata

Nov. 1992, 213 m, D. W. Webb, E & M. is strongly convex in profile, not flattened

Schlinger; 1 6 , ibid., except 19-20 Nov. as it is in webbi. Eirone maigretae and emar-

1992; 6 6 6, Mt. Mandjanie, 5.3 km wsw ginata are considerably larger than webbi,

Pouebo, 9-26 Nov 1992, D. W. Webb, 550 ranging between 18 and 22 mm in length.

414

Journal of Hymenoptera Research

Although color and body size vary consid-
erably in webbi, this species can be distin-
guished by the acute and ventrally point-
ed mesopleural lamella. In the few indi-
viduals where the lamellae have been bro-
ken off the narrowed and flattened
epipygium and hypopygium and config-
uration of the clypeus will prove diagnos-
tic.

£. impunctata is another species of Eirone
from New Caledonia that lacks a midcoxal
spine. Although we have not been able to

see the type of impunctata, webbi appears
to be a different species based on Brown's
description and illustrations of impunctata.
A few specimens of webbi are small, rela-
tively impunctate, and are the ferrugine-
ous color mentioned by Brown in his de-
scription of impunctata (1984). However,
Brown does not mention the peculiar me-
sopleural lamellae seen in webbi and his
illustration of the face of impunctata indi-
cates that the clypeal truncation is consid-
erably narrower than that of webbi.

KEY TO MALES OF THE NEW CALEDONIAN EIRONE SPECIES

Midcoxa without apical spine or tooth on posterior angle (as in Figs. 8, 11) 2

Midcoxa with apical spine or tooth on posterior angle (as in Figs. 9, 10) 6

Mesopleural lamella elongate, apically acute (Fig. 8) and bending ventrally; epipygium

strongly narrowed apically and flattened in profile (as in Fig. 20) webbi Kimsey

Mesopleural lamella foreshortened, apically emarginate (as in Fig. 10), not bending ven-
trally; epipygium broadly rounded or truncate apically and strongly convex in profile (as

in Fig. 21) 3

Small, body length 8 mm or less impunctata Brown

Larger, body longer than 8 mm 4

4. Flagellomere I barely twice as long as broad; metasomal setae blackish; clypeus strongly
convex medially, apex narrowly truncate, truncation narrower than distance from the
outer margin of one antennal socket to that of the other; wing membrane dark amber . .

nigra Brown

- Flagellomere I more than twice as long as broad; metasomal setae pale, silvery to yellow-
ish; clypeus flattened medially, apex broadly truncate, truncation as wide or wider than
distance from the outer margin of one antennal socket to that of the other; wing mem-
brane yellowish to light brown tinted 5

5. Body black; clypeus with lateral angles of apical truncation acute or dentate; hypopygium
apically truncate emarginata Brown

- Body predominantly orange, with some black and yellow; clypeus with apical truncation
broadly angulate laterally (Fig. 4); hypopygium apically broadly rounded

maigretae Baptiste

6. Mesopleural lamella abbreviated and emarginate posteriorly 7

- Mesopleural lamella not abbreviated, rounded or acute posteriorly 9

7. Sternum I medially keeled, posterior margin pointed medially and extending over base
of sternum II (Fig. 14); clypeal apex bilobate; hypopygium apically bilobate (Fig. 18) ....

salteri Brown

- Sternum I flattened posteriorly (as in Fig. 13); clypeus broadly rounded in profile, with
broad subrectangular apical bevel 8

8. Clypeal apex in ventral view bilobate, apical bevel nearly horizontal in profile

nepouiensis Baptiste

Clypeal apex in ventral view broadly rounded, apical bevel oblique in profile

transversa Brown

9. Clypeus subapically bulging, with polished medial knob and subtriangular apical bevel,

nasiform in profile (Fig. 7) nasalis Kimsey

Clypeus subapically flattened or broadly rounded, apex truncate or medially lobate (as

in Figs. 2-6) 10

Volume 9, Number 2, 2000 415

10. Clypeal apex medially clearly convex or lobate (Figs. 2, 3, 5) 11

- Clypeal apex truncate, flat or concave (Figs. 4, 6) 15

11. Metasomal sternum I medially keeled, posterior margin pointed medially and extending
over base of sternum II (Fig. 12 and as in Fig. 14); clypeus weakly trilobate

invini Baptiste

- Metasomal sternum 1 posteriorly flattened or arched, if arched then abruptly declivitous
before base of sternum II, not overlapping II (as in Figs. 12, 13, 15); clypeus convex or
trilobate (Figs. 2, 3), or unilobate (Fig. 5) 12

12. Clypeal apex medially unilobate (Fig. 5) 13

- Clypeal apex medially convex or trilobate 14

13. Metasomal sternum I strongly keeled and abruptly declivitous posteriorly (as in Fig. 12)

anone Kimsey

- Metasomal sternum I gently convex medially gently sloping posteriorly to sternum II . . .

obtusidens Turner

14. Clypeal apex medially obtusely rounded and thin-edged, without bevel (Fig. 3), broadly
convex in profile; epipygium apicomedially emarginate (Fig. 20) laniensis Baptiste

- Clypeal apex medially broadly trilobate and projecting anteriorly, with well-developed
horizontal bevel seen in ventral view (Fig. 2); epipygium apicomedially rounded or trun-
cate koghisica Kimsey

15. Gena with tooth-like projection adjacent to mandibular condyle (Fig. 6); mesopleuron
medially tuberculate; propodeum sublaterally tuberculate paniensis Kimsey

- Gena rounded or with small angle adjacent to mandibular condyle (as in Figs. 2, 3, 5);
mesopleuron and propodeum not tuberculate (except propodeum in neocaledonica) .... 16

16. Epipygium terminating in long digitate apicolateral lobes, flattened medially (Fig. 17);
propodeum sublaterally tuberculate neocaledonica Williams

- Epipygium apically truncate or rounded, without digitate lobes; propodeum evenly con-
vex, not tuberculate 17

17. Sternum I strongly arched and abruptly declivitous before base of sternum II (as in Fig.
12); clypeus with polished subapical tubercle and polished and thickened apical margin

snbtubercnlata Brown

- Sternum I broadly rounded or elevated medially and extending obliquely to posterior
margin (as in Fig. 15); clypeus without subapical tubercle, with thin apical margin .... 18

18. Terga VI and VII with dense tufts of long dense setae; body color black

rivierensis Baptiste

- Terga VI and VII without dense tufts of setae, setae long and scattered; color black to
orange colorata Brown

ACKNOWLEDGMENTS previously known New Caledonian species. In-
ternational Journal of Entomology 26:49-2::>t,

This study was made possible by the intensive col- Tumer R E. i907. A revision of the Thynnidae of

lecting efforts of Michael Irwin, Evert and Marion Australia. Part I. Proceedings of the Unnaean

Schlinger and Donald Webb. Thanks also to the col- ch/ (l, Vi r S(,////( u-;/(.s 32:206-290

lection managers and scientists of the bishop Muse- vVjHiamS/ F. X. 1945. The aculeate wasps of New Cal-

um, Canadian National Collection and the Illinois edonia, with natural history notes. Proceedings of

Natural History Survey. tlu. Hllu,lUlllll Entomological Society 12:07 437

LITERATURE CITED

Brown, G. R. 1984. New species of Eironc from New
Caledonia and Australia, with a review of the

J. HYM. RES.
Vol. 9(2), 2000, pp. 416^26

Review of the Species of Deutereulophus (Hymenoptera:
Chalcidoidea: Eulophidae) of North America

Michael E. Schauff

Systematic Entomology Laboratory, ARS, USD A, National Museum of Natural History,

Washington, D.C. 20560-0168, USA

Abstract. — Although species of Deutereulophus (Hymenoptera: Chalcidoidea: Eulophidae) are
known in America north of Mexico, none have been described. In this paper five new species are
recognized: D. arizonensis, D. floridensis, D. occularis, D. pecki, and D. smithi, and a key is
presented.

Ashmead (1904) described the genus to recognize specimens in these collections

Eulophopteryx and included two species, and organize them for study. It is difficult,

not realizing that the generic name was if not impossible, for other researchers to

preoccupied (Moschler 1878). The name sort material from collections, because of

Deutereulophus was supplied by Schulz the lack of identification aids or illustra-

(1906) as a replacement for Eulophopteryx. tions to guide them. I have not personally

Girault (1913) described the genus Ente- been able to examine or sort through all

donomorpha and Girault (1913, 1915, 1922, collections and therefore, I have not been

1938) and Yoshimoto and Ishii (1965) later able to obtain specimens from many parts

added several species from Australia and of North America. This is especially true

Guam to this genus which was synony- io\the ™est coast of th* U-S" ^Canada.

j i.i_ r-> j. ii u t c ii a Although western collections have not
mized with Deutereulophus by LaSalle and . , , r . <■ ^ , ,

Schauff (1992). Although Deutereulophus Y^ded specimens o( Deutereulophus to

. - T ', . . /f, i cc L i date, it is likely that at least one or a few
occurs in North America (Schauff et al. \ .,

„_-_,, , , . , species occur along the west coast.

1997), no species from that region have ^ ^ j reyiew ^ g frQm

been described and no keys or other in- North America and provide names and a

formation are available. k for t\xem

The majority of specimens used for this ' Acronyms for museums are: (CNC) Ca-

study are from the eastern U.S. due to two nadian National Collection, Ottawa, On-

factors: 1) extensive malaise trapping by tari0/ Canada; (USNM) National Museum

Dr. D. R. Smith in Maryland and Virginia 0f Natural History, Smithsonian Institu-

and an extensive collecting effort along tion, Washington, D. C., USA; (BMNH)

the eastern seaboard in the mid to late The Natural History Museum, London,

1980s by a team of scientists from Canada, UK. Terminology for morphology follows

and 2) the author is one of the few scien- Gibson (1997). A diagram showing mea-

tists familar with the genus and was able surements of the head is given in Fig. 9.

KEY TO SPECIES OF DEUTEREULOPHUS

1) Legs beyond coxae yellow; scutellum smooth (Figs. 5, 8) 2

Legs beyond coxae at least partly black or brown, scutellum with distinct alutaceous or
reticulate sculpture (Figs. 1, 3) 4

Volume 9, Number 2, 2000

417

2) First funicular segment equal in length to second (Fig. 14) pecki, n. sp.

- First funicular segment distinctly longer than second (about 1.5 x as long) (Fig. 13) 3

3) Thorax and head with distinct metallic green sheen, posterior margin of the gena on line
with the posterior margin of eye; vertex rounded and area behind evenly sculptured

floridensis, n. sp.

- Thorax and head black, without metallic green coloration; posterior margin of eye pro-
jecting behind posterior margin of gena (Fig. 7); vertex with transverse carina just behind
ocelli, area below carina with distinct sculpture medially, smooth laterally . . occularis, n. sp.

4) Vertex with distinct transverse carina behind ocelli (Fig. 1), nearly smooth behind posterior
ocelli smithi, n. sp

- Vertex rounded and without distinct median carina, mostly reticulate behind posterior
ocelli with v-shaped smooth area medially (Fig. 2) arizonensis, n. sp.

Deutereulophus Schulz

Eulophopteiyx Ashmead 1904: 341, 342, 374.
Types species Eulophopteryx chapadae Ash-
mead (original designation). Preoccupied by
Eulophopteryx Moschler 1878: 684.

Deutereulophus Schulz 1906: 146. Replacement
name for Eulophopteryx Ashmead 1904 (not
Eulophopteryx Moschler, 1878).

Entedouomorpha Girault 1913: 261. Type species
Entedonotnorpha tennysoni Girault (original
designation). Synonymy by LaSalle and
Schauff 1992: 17.

Diagnosis. — Head concave behind (Fig. 1),
often with a transverse carina on the vertex
behind the ocelli and with the posterior eye
margin contiguous with the back of the
head such that there is no noticeable temple
when viewed dorsally; eyes setose; clypeus
delimited by sutures above and lateral to
the mouth margin; pronotum semiglobose,
and rounded anteriorly, without a trans-
verse carina; notauli complete; scutellum
with curving (sinuate) lateral grooves con-
verging posteriorly and meeting medially
(Figs. 3, 5); propodeum with a simple me-
dian carina diverging posteriorly and
bounding a large open area at the nucha
(Figs. 4, 6), laterally with at least a partial
plical carina and with a transverse carina
below the spiracle that defines the dorsal
edge of an area which lies nearly perpen-
dicular to the spiracular surface and that
usually contains a group of setae below and
medial to the callus setae; petiole with a for-
ward projecting flange on dorsal and lateral

surface; hypopygium reaching about half
length of metasoma; outer ovipositor plates
visible and generally reticulate; female fu-
nicle 3-segmented and with first funicular
segment usually pedunculate (Fig. 13), clava
3-segmented; male funicle 4-segmented and
usually with at least first 2 funicles pedun-
culate (Fig. 14); stigmal vein well devel-
oped; postmarginal vein equal to or slightly
longer than stigmal vein.

Discussion. — While no phylogenetic
analysis of relationships within the Eulo-
phinae has yet been published, several
characters of the thorax (e.g. the lateral
scutellar grooves, complete notauli, me-
dian propodeal carina) strongly suggest
that Deutereulophus is closely related to a
group of genera that includes Hyssopus,
Elachertus, and Diglyphomorphomyia and
several others. The shape of the pronotum
is very similar to that found in Hyssopus
and is a feature not shared by most of the
other eulophid genera.

The pedunculate male antennae and the
usually pedunculate first funicular seg-
ment of the females, however, argue for a
close relationship to Diglyphomorphomyia
(an Australian genus). The presence of a
group of setae below the spiracle, which
is apparently an extension of the usual
line of callus setae, may be unique to this
genus. I have not been able to examine all
the types of Australian Deutereulophus so
it is not possible to make a definitive state-
ment about that character at this time. In

418 Journal of Hymenoptera Research

some species from the South Pacific re- ed, reticulate behind with inverted v-

gion, the area below the callus contains shaped smooth area (Fig. 2); mesoscutum

only one or a few setae. and scutellum alutaceous (Fig. 3).

The forward projecting flange (Fig. 4) This species is similar to D. smithi but

on the dorsal and lateral surface of the differs in that smithi has the vertex with a

petiole is also a feature which I have not distinct transverse carina (Fig. 1), and the

observed in other similar genera of eulo- area behind the carina is lightly sculp-

phines and which seems to be constant hired, nearly smooth, and without a dis-

within the species examined. Some species tinct v-shaped area.

of Hoplocrepis have lateral flanges on the Description. — Female. Length 1.9 mm.

petiole, but no dorsal flange. Color black except: scape yellow, flagel-

The posterior bifurcation of the median lum brown; fore coxa brown to black, rest

propodeal carina that forms a large open of leg yellow. Head: Face lightly reticulate

areola at the posterior median margin of to nearly smooth, sculpture slightly heavi-

the propodeum, and the presence of at er below toruli. In frontal view, head wid-

least a short forward projecting lateral ca- er than high (40:35). Gena reticulate. Clyp-

rina that originates from the anterior lat- eus set off by irregular lateral and dorsal

eral margin of the areola (Figs. 4, 6) both suture line. Mandible with one large ven-

seem to be unique to Deutereulophus. They tral tooth and 3 smaller dorsal teeth. Malar

are present in all species and may be the suture complete, slightly curved. Ratio of

most reliable defining characteristic of the malar space: eye height 10:32. Toruli in-

group. I have seen species of Hoplocrepis serted level with lower margin of eye. Ra-

which have a somewhat similar condition tio of width of face: width of eye 34:15.

in which the median propodeal carina Occiput rounded, reticulate and with a

ends posteriorly at the nucha but does not central inverted v-shaped smooth area,

clearly bifurcate or enclose a cell or areola. Posterior margin of eye on same line as

The presence of sinuate lateral grooves posterior margin of gena. Ocelli slightly
on the scutellum has been used in keys removed from margin of occiput, POL 2X
(e.g. Schauff et al. 1997) but this character, OQl. Antenna: Scape about 7X as long as
while stable for all North America species wide Ratio 0f length of Fl:F2:F3:Clava 14:
I have examined, is highly variable in oth- H:ll:19, width 6 at Fl to 7 at clava. Me-
er parts of the world and has been ob- sosoma: (Fig. 3). Pronotum reticulate ex-
served in a modified form in some Aus- cept at postenor margin, with numerous
tralian species of eulophids which I would scattered setae. Mesoscutum smooth an-
not place in Deutereulophus. Recent au- teriorly/ then becoming reticulate, with 2
thors seem to agree that this genus con- pairg of getae along notaular margin, side
tains a natural group of related species, lobes reticulate laterally, then alutaceous
and I believe that the characters cited with a of getae along anterior mar.
above reinforce that conclusion. Exami- . Axi]la smooth Scutellum alutaceous
nation of specimens borrowed from mu- tQ reticulate Metanotum anteriorly pro-
seums in the Pacific basin indicate that mi- Qut frQm scutellum and bordered
merous species exist in that region and a median dorsa] ed b a of
that the center of diversity of Deutereu- ^^ gnd anQther band of fjner al_

ophus is probably the Australasian realm. ... J . . . d-,*~~j«,,«,

r r j veoh along posterior margin. Propodeum

Deutereulophus arizonensis Schauff, new medially smooth, with about 12 long

species white setae laterad of spiracle and about

(Figs. 2, 3, 4) 20-25 setae below the spiracle. Petiole

Diagnosis. — Legs yellow except fore (Fig. 4) rugose dorsally, as long as wide,

coxa black; funicles brown; vertex round- anterodorsal flange well developed, with

Volume 9, Number 2, 2000

419

Figs. 1-6. Scanning electron micrographs of Deutereulophus. 1, D. smithi, thorax and head. 2, D. arizonensis,
head, posterior view. 3. D. arizonensis thorax. 4, D. arizonensis, propodeum and petiole. 5, D. floridensis mesoma.
6, D. floridensis propodeum.

lateral flanges well developed. Forewing.
Hyaline, 2.3 X as long as wide. Submargin-
al vein with 6-7 dorsal setae. Ratio of sub-
marginal: marginal: stigmal: postmarginal
vein = 33:33:12:15. Metasoma: Ovate,
slightly longer than wide. Ovipositor
sheaths reaching just past tip of gaster.

Male. — Unknown.

Distribution. — Known only from Arizo-
na.

Types. — Holotype female with data: Ar-

izona, Patagonia, 27 June 1953. W. W.
Wirth Collector. Deposited in USNM.

Etymology. — This species is named for
the locality of the type.

Deittereulophus floridensis new species

(Figs. 5, 6, 12)

Diagnosis. — Head, lateral lobes of me-
soscutum, and propodeum metallic green;
in lateral view, posterior margin of eye not
distinctly protruding behind hind margin

420

Journal of Hymenoptera Research

of gena; vertex rounded, without trans-
verse carina and area behind uniformly
smooth or lightly sculptured; mesoscutal
midlobe and axilla smooth; scutellum
smooth or very lightly alutaceous (Fig. 5);
metasoma mostly yellow; legs white to
yellow. Male scape with a small sensory
patch containing only about 2 sensilla
(Fig. 12).

This species is similar to D. occularis,
which shares a smooth scutellum and yel-
low legs. However, D. floridensis has the
thorax and head distinctly metallic green
whereas D. occularis has a black head. D.
floridensis has the posterior margin of the
eye in lateral view not projected behind
the gena and the vertex is rounded and
uniformly scuptured behind (occularis
with median transverse carina on vertex
and the posterior margin of the eye pro-
jecting behind margin of gena (Fig. 7) and
a distinctly sculptured area below occiput
contrasting with the smooth lateral areas).

Description. — Female. Length 1.6-2.0
mm. Color: face, mesoscutal midlobe, ax-
illa, and propodeum, occasionally lateral
margin of metasoma metallic green; back
of head, pronotum, scutellum, lateral tho-
rax, ventral thorax, petiole black; antenna
yellow except clava sometimes light
brown; legs yellow to white; metasoma
yellow except with brown on lateral mar-
gin and usually with an elongate trian-
gular brown area medially on the poster-
odorsal surface. Head: Face and vertex
smooth. In frontal view, wider than high
(57:38). Gena reticulate. Clypeus set off by
irregular suture line. Mandible with one
large ventral tooth and 3 smaller dorsal
teeth. Malar groove complete, slightly
curved. Ratio of malar space: eye height =
8:13. Toruli inserted level with lower mar-
gin of eye. Ratio of width of face: width
of eye = 31:15. Occiput rounded, area be-
hind smooth to lightly alutaceous, shiny.
Posterior margin of eye in lateral view on
same line as posterior margin of gena.
Ocelli contiguous with margin of occiput,
POL 2X OOL. Antenna: Scape about 6X

as long as wide. Ratio of length of F1:F2:
F3:Clava = 15:11:12:22, width 6 at Fl to 7
at clava. Mesosoma: Pronotum weakly
alutaceous to smooth, with numerous
scattered setae (Fig. 5). Mesoscutum
smooth anteriorly, then becoming aluta-
ceous posteriorly, with 2 pairs of setae
along notaular margin, side lobes smooth,
with group of setae along anterior margin.
Axilla smooth. Scutellum very weakly alu-
taceous medially. Metanotum smooth,
projecting out from scutellum anteriorly.
Propodeum smooth medially, with about
10 long white setae lateral to spiracle and
about 12-15 setae below the spiracle (Fig.
6). Petiole rugose dorsally, about as long
as wide, anterodorsal flange small with
lateral flanges well developed. Forewing.
Hyaline, 2.3 X as long as wide. Submargin-
al vein with 5-6 dorsal setae. Ratio sub-
marginal: marginal: stigmal: postmarginal
vein = 40:30:12:15. Metasoma: Ovate,
slightly longer than wide. Ovipositor
sheaths reaching just past tip of gaster.

Male. — Similar to the female except: An-
tenna with scape about 5X as long as
wide. Flagellum with ratio of F1:F2:F3:F4:
clava = 15:15:15:15:24. Scape with a very
small sensory patch containing only 2 sen-
silla just above midline (Fig. 12).

Distribution. — Known only from Flori-
da.

Types. — Holotype female with data:
Florida: Monroe Co., No Name Key, 23.11-
3.VI. 1986. S&J Peck, 86-13, hammock,
FLT. Deposited in CNC. Paratypes: 1 fe-
male and 2 males with same data; 2 males
with same data except 3.VIII-18.XI.1985,
S&J Peck, hammock forest, malaise & FLT;
1 female and 1 male with same as previ-
ous except 4. V^4. VIII. 1985; 5 females and
3 males same as holotype except Fat Deer
Key, 18.XI.1985-25.II.1986, S&J Peck, ham-
mock forest, malaise & flight intercept
trap; 1 male with same data as previous
except 2.VIII-16.XI.1985; 3 females and 5
males same as holotype except Big Pine
Key, SI, T67S, R29E, 30.VII-17-XI.1985,
S&J Peck, Cactus Hammock, malaise &

Volume 9, Number 2, 2000

421

Figs. 7-8. Scanning electron micrographs of Deutereulophus occularis. 7, Head and anterior mesosoma, side
view. 8, mesosoma, dorsal view.

flight intercept trap, forest; 1 female same
as previous except 6.VIII-17.IX.1985; 1 fe-
male same as holotype except Everglades
National Park, 1.5 km NW Royal Palm,
3.III.-28.IV.1985; 1 female same as holo-
type except N. Key Largo, Sec. 35, l.VIII-
16.XI.1985, S&J Peck, hammock forest,
malaise & flight intercept trap; 1 female
same as holotype except Sugar Loaf Key,
Kitchings, 26.II-6.VI.1986, S&J Peck, 86-29,
hammock forest FIT; 1 male same as pre-
vious except SE Va, S23, 26.II-6.VI. 1986, 86-
31, hammock for., FLT, deposited in CNC;
1 female and 1 male same as previous de-
posited in USNM.

Etymology. — This species is named for
the state locality of the type series, Florida.

Deuternlophus occularis Schauff, new
species

(Figs. 7, 8, 10)

Diagnosis. — Legs and antenna yellow;
posterior margin of eye projecting behind
posterior margin of gena (Fig. 7) in lateral
view; vertex with transverse carina and
area below distinctly sculptured medially
contrasting with smooth lateral area; head
and thorax black; mesocutum and axilla
smooth. Male scape with sensory patch
entending for most of top half of scape
with about 13 sensillae (Fig. 10).

This species is somewhat similar to Deu-
tereulophus floridensis which also has the
dorsal thorax mostly smooth and shiny.

However, D. floridensis has a distinct me-
tallic green sheen to the head (black in oc-
cularis), mesoscutal side lobes and propo-
deum, and the posterior margin of the
gena is on line with the posterior margin
of the eye. In addition, D. floridensis has
the posterior margin of the eye ending
about in line with the posterior margin of
the gena when viewed laterally, and the
vertex is rounded and not carinate.

Description. — Female. Length 2.3 mm.
Color: Head and thorax black, antenna
and legs light yellow except base of fore
coxa brown; metasoma yellow except lat-
eral margin of all but first tergum brown
and with a median triangular brown spot
which covers the last two terga and the
median portion of the previous two terga.
Head: Face and vertex mostly smooth
with faint reticulation near eyes and on
vertex. In frontal view, wider than high
(56:38). Gena smooth. Clypeus set off by
irregular suture line. Mandible with one
large ventral tooth and 3 smaller dorsal
teeth. Malar groove complete, slightlv
curved. Ratio of malar space: eye height =
10:25. Toruli inserted level with lower
margin of eye. Ratio of width of face:
width of eye = 28:15. Vertex with trans-
verse carina, area behind carina smooth
laterally and striate alutaceous to reticu-
late medially. Posterior margin of eye pro-
jecting behind posterior margin of gena
(Fig. 7). Ocelli contiguous with margin of

422

Journal of Hymenoptera Research

vertex, POL 2.5 X OOL. Antenna: Scape
about 6.5 X as long as wide. Flagellum
with ratio Fl:F2:F3:clava = 15:11:11:20,
width 6 at Fl to 7 at clava. Scape with a
sensory patch containing about 13 sensilla
extending for almost entire length of top
half (Fig. 10). Mesosoma: Pronotum weak-
ly alutaceous to smooth, with numerous
scattered setae (Fig. 8). Mesoscutum
smooth anteriorly, then becoming aluta-
ceous, with 2 pairs of setae along notaular
margin, side lobes smooth, with a group
of setae along anterior edge. Axillae
smooth. Scutellum very weakly aluta-
ceous medially. Metanotum projecting out
from scutellum anteriorly, smooth. Pro-
podeum smooth medially, with about 7
long white setae latera to spiracle and
about 30 setae below spiracle. Petiole ru-
gose dorsally, about as long as wide, dor-
sal anterior flange large and tongue-like
with lateral flanges well developed. Fore-
wing. Hyaline, 2.5 X longer than wide.
Submarginal vein with 6-7 dorsal setae.
Ratio submarginal: marginal: stigmal:
postmarginal veins: 45:50:20:25. Metaso-
ma: Ovate, slightly longer than wide. Ovi-
positor sheaths reaching just past tip of
gaster.

Male. — Similar to the female except: An-
tenna with scape about 5X as long as
wide, with sensory patch about V2 length
of scape and containing 12-15 sensillae
(Fig. 10). Flagellum with 4 funicular seg-
ments and 2-segmented clava. Ratio of Fl:
F2:F3:F4:clava = 15:15:15:15:24.

Distribution. — Known only from the
type locality in Florida.

Types. — Holotype female with data:
Florida: Monroe Co., NoName Key, 19-XI-
85-25-11-86. S. & J. Peck. Hammock forest.
Malaise & FIT. Deposited in CNC. Para-
types 1 female and 1 male with same data
except female collected 3-VIII-18-XI-85
and male collected 4-III-29-IV-85. Female
paratype deposited in USNM, male in
CNC.

Etymology. — This species epithet refers
to the eyes.

Deutereulophus pecki Schauff, new
species

(Fig. 14)

Diagnosis. — Legs yellow; antennal funi-
cle brown; first funicular segment equal in
length to second; mesoscutum, axilla, and
scutellum mostly smooth with only very
light reticulation on anterior mesoscutum.

This species is similar to D. occularis and
D. floridensis in that the scutellum is
smooth and the legs yellow. However, D.
pecki has the first funicular segment of the
female antenna equal in length to the sec-
ond (distinctly longer in both D. occularis
and D. floridensis) and the flagellum
brown (yellow in D. occularis and D. flori-
densis).

Description. — Female Length 1.1 mm.
Color: Head and thorax dark brown; scape
and legs light yellow; funicle brown; me-
tasoma yellow. Head: Face and vertex
mostly smooth with faint reticulation near
eyes and on vertex. In frontal view, head
wider than high (56:38). Gena smooth.
Clypeus set off by irregular suture line.
Mandible with one large ventral tooth and
3 smaller dorsal teeth. Malar suture com-
plete, straight. Ratio of malar space: eye
height = 12:25. Toruli inserted level with
lower margin of eye. Ratio of width of
face: width of eye = 33:15. Vertex acute,
but without transverse carina, striate alu-
taceous to reticulate above and smooth be-
low. Posterior margin of eye ending be-
fore posterior margin of gena. Ocelli
slightly removed from margin of occiput,
POL 2.0 X OOL. Antenna: Scape about
6.5 X longer than wide. Ratio of length of
Fl:F2:F3:clava = 10:10:11:24, width 6 at Fl
to 7 at clava (Fig. 14). Mesosoma: Prono-
tum weakly alutaceous to smooth, with
numerous scattered setae. Mesoscutum
smooth anteriorly to very weakly reticu-
late at lateral margin, with 2 pairs of setae
along notaular margin, side lobes smooth
medially and weakly reticulate at lateral
margin, with a single seta along anterior
edge. Axilla smooth. Scutellum smooth

Volume 9, Number 2, 2000

423

occularis

smithi

floridensis

Figs. 9-14. Deutereulophus. 9, Generalized head, anterior view. OOL = ocellar ocular length. POL = posterior
ocellar length. EH = eye height. EW = eye width. FW = face width. FH = face height. MS = malar space.
HW = head width. 10-12, male scapes. Figs. 13-14. Antennae. 13, female. 14, male.

with only a faint hint of reticulation me-
dially. Metanotum smooth, projecting out
from scutellum anteriorly. Propodeum
smooth medially, with about 7 long white
setae lateral to spiracle and about 6 setae
below spiracle. Petiole rugose dorsallv,
about as long as wide, and anterodorsal
flange large and tongue-like with lateral
flanges well developed. Forewing. Hya-
line, 2.4X as long as wide. Submarginal

vein with 4 dorsal setae. Ratio submargin-
al: marginal: stigmal: postmarginal veins
= 40:30:20:15. Metasoma: Ovate, slightly
longer than wide. Ovipositor sheaths
reaching just past tip of gaster.

Male. — Unknown.

Distribution. — Known only from the
type locality in Florida.

Types. — Holotype female with data:
Florida: Monroe Co., Key Largo, Sec. 35,

424

Journal of Hymenoptera Research

1-VIII-16-XI-85. S&J Peck. Hammock for-
est. Malaise & FLT. Deposited in CNC.

Etymology. — This species is named for
Stuart Peck who collected many of the
specimens included in this study.

Deutereulophus smithi Schauff, new
species

(Figs. 1, 11, 13)

Diagnosis. — Legs except coxae white to
yellow except fore coxae black; first funic-
ular segment distinctly longer than sec-
ond; occiput with distinct median carina,
evenly, but very weakly sculptured, near-
ly smooth behind posterior ocelli; mesos-
cutal side lobes reticulate or alutaceous;
scutellum alutaceous. Male scape with
small sensory patch containing about 6
sensillae (Fig. 11).

This species is similar to D. arizonensis,
which also has mostly yellow legs (except
for the fore coxae). However, D. arizonen-
sis has a rounded vertex without a distinct
transverse carina and occiput with a tri-
angular smooth spot bordered laterally by
distinct scupture (Fig. 2).

Description. — Female. Length 2.0-2.2
mm. Color black except as follows: scape
white, pedicel and first funicular segment
yellow, remainder of flagellum brown;
fore coxa brown or brown basally, becom-
ing yellow in apical half, rest of legs yel-
low to white with occasional brownish in-
fuscation on fore femur. Head: Face weak-
ly reticulate to nearly smooth, sculpture
slightly stronger below toruli. Head in
frontal view, wider than high (FH: FW =
60:43). Gena reticulate. Clypeus set off by
irregular suture line. Mandible with one
large ventral tooth and 3 smaller dorsal
teeth. Malar suture complete, slightly
curved. Ratio of malar space: eye height =
8:13. Toruli inserted level with lower mar-
gin of eye. Ratio of width of face: width
of eye = 38:15. Vertex with distinct trans-
verse carina, occiput smooth to weakly
alutaceous, shiny. Posterior margin of eye
on same line as posterior margin of gena.
Ocelli contiguous with margin of occiput,

POL 2X OOL. Antenna: Scape about 7X
as long as wide. Ratio of length of F1:F2:
F3:clava = 20:14:15:25, width 6 at Fl to 7
at clava (Fig. 13). Mesosoma: Pronotum
reticulate except at posterior margin, with
numerous scattered setae (Fig. 1). Mesos-
cutum smooth anteriorly, then becoming
alutaceous to reticulate posteriorly, with 2
pairs of setae along notaular margin, side
lobes reticulate laterally, then alutaceous
with a group of setae along anterior mar-
gin. Axilla smooth. Scutellum alutaceous
to reticulate. Metanotum projecting out
from scutellum anteriorly and bordered
along median dorsal edge by a group of
alveoli and by another band of finer al-
veoli along posterior margin. Propodeum
medially smooth, with about 12 long
white setae laterad of spiracle and about
20-25 setae below spiracle. Petiole rugose
dorsally, slightly wider than long, anter-
odorsal flange small with lateral flanges
well developed. Forewing. Hyaline or
with very slight infuscation below mar-
ginal vein, 2.1 X longer than wide. Sub-
marginal vein with 6-7 dorsal setae. Ratio
submarginal: marginal: stigmal: postmar-
ginal vein = 35:35:12:15. Metasoma:
Ovate, slightly longer than wide. Ovipos-
itor sheaths reaching just past tip of gas-
ter.

Male. — Similar to female except as fol-
lows: Fore coxae sometimes completely
yellow; antenna with scape about 5X as
long as wide and with a small sensory
patch containing about 7 sensillae just
above midline (Fig. 11). Flagellum with ra-
tio of Fl:F2:F3:F4:clava = 20:17:17:17:24.

Distribution. — Florida, Georgia, Louisi-
ana, Maryland, Texas, and Virginia. Most
records are from Maryland, Virginia, and
Florida but this is no doubt due to exten-
sive collecting in these areas. The range is
almost certainly broader than indicated by
the specimens available.

Variation. — The forewing of females
may have a noticeably infuscate brown
area behind the marginal vein which ex-
tends to the hind margin of the wing. Col-

Volume 9, Number 2, 2000

42?

oration of the metasoma ranges from near-
ly entirely black to mostly yellow with
some brown spots laterally. The fore coxa
may be entirely yellow or have the basal
half brown to black. In one specimen from
Texas with a very darkly infuscated area
on the forewing, the legs are also light
brown. The flagellum varies from a dark
honey yellow to brown but in most spec-
imens the color is distinctly lighter on the
first funicle.

Types. — Holotype female with data: Vir-
ginia: Essex Co., 1 mi. E. Dunnsville, 17-
IX-10-X-1991, Malaise trap. D. R. Smith.
Deposited in USNM. Paratypes: 3 females
same as holotype; 3 females Virginia:
Louisa Co., 4 mi. S Cuckoo, 12-27. V.1987,
J. Kloke & D. R. Smith, malaise trap; 1 fe-
male and 4 males with same as previous
except 19.VIII-2.X.1987; 1 female and 1
male 16-31. VII. 1987; 1 male 25.VI-
5.VTI.1987; 2 males 3-24.IX.1987; 1 female
VA: Page Co., Shenandoah Nat. Pk., 5-
22.V.1987, 1300m, CNC [BRD] Hym. team,
malaise trap in meadow; 1 male VA: Fair-
fax Co., near Annandale, 29.III-11.IV.1988,
malaise trap, D.R. Smith; 1 male Mary-
land: Howard Co., Clarksville, 3.VIII.1986;

1 female same as previous except
13.VII.1986; 2 females Florida: Monroe
Co., Big Pine Key, Watson's Hammock,
3-VI-27.Vin.1986, S&J Peck, malaise trap
deposited in USNM; 1 female Texas: Jim
Wells Co., 8 mi. W Ben Bolt La Copita Re-
search Station, 20. V.1987, 87/006, J.B.
Woolley deposited in TAMU; following
all deposited in CNC: 4 females Maryland:
Calvert Co., 6 km W Prince Frederick, 18-
26. VIII. 1986, Sharkey; same as previous
except 3 females and 5 males 25.VIII.1986;

2 females and 1 male 7 km S Prince Fred-
erick, 24.IX-14.XI.1987, Malaise trap, hard-
wood forest, CNC [BRD] Hym team; 3
males 4 mi. S Prince Frederick Co., 16. IV-
7.V.1987, L. Masner, Flight intercept trap;
Calvert Co., 1 female Scientist's Cliffs,
7. VII. 1987, G. Gibson; 1 female Port Re-
public, VIII-IX.1986, Sharkey & Monroe; 1
female Chesapeake Bay Beach, 13. VI. 1985,

L. Masner, s.s., plants in forest; 2 males
Seneca, Potomac River trail Mouth of Sen-
eca Creek.), 16.VI.1986, L. Masner, SS, un-
dergrowth along old canal; 1 male Prince
George's Co., Paruxent Research Station
21-29.VI.1986. D. Wahl, Malaise trap; 1 fe-
male Kentucky: Rowan Co., 24 km SW
Morehead, Cave Run Lake, 14. V-
20.VIII.1983, M. Kaulbars; 1 female and 1
male Georgia: Clarke Co., Lake Herrick,
Oconee Forest Park., 11-12.VII.1987, L.
Dumouchel; 1 male Mcintosh Co., Sapelo
Island, 9-21.IX.1987, live oak forest, CNC
[BRD] team; 1 male 15.IX-16.XI.1987; Ath-
ens, 1 female 14.IX.1987, L. Masner; 1 fe-
male and 1 male Louisiana: Grant Parish,
28 km N Alexandria, Stuart Lake Camp-
ground, 19-21. V. 1983, M. Kaulbars; 4
males Florida: Alachua Co., Gainesville,
l.V-20. VIII. 1988, D. Wahl, flight intercept
trap; 1 female same as previous except
(AEI), 30.IV.1987, SS, L. Masner, 87/14; 1
male 10-20.11.1987, W. Mason; 1 female 8-
14.IV.1987; 1 female 15-22.111.1987, Mal-
aise trap, hardwood forest; 1 male Amer-
ican Entomological Institute, 9-17.IV.1986,
G. Gibson, sweep; 3 females and 5 males
Tallahassee, 18-23.V.1986, H. Howden,
flight intercept trap; 3 females Monroe
Co., Big Pine Key, Watson's Hammock,
I.XI.84-3.III.1985, S&J Peck flight intercept
trap; 1 female same as previous except
19.XI.1985-25.II.1986; 1 female 3.V-
3.VIII.1985; 23.II-3.VI.1986; 1 female 3.VL-
27. VIII. 1986, hammock forest, Malaise
trap /flight intercept trap, 86-10; 2 females
Dade Co., S Miami, 7900 Swth St., Old
Cutler Hammock, 21.II-1.VI.1986, flight
intercept trap, S&J Peck, hammock; 1 fe-
male Chekika State Recreation Area, 50
km SW Miami, Grossman Hamrruu k
1.IX.1984-3.III.1986, S&J Peck, flight inter-
cept trap; 1 male 3.III.-28.IV.1985; 2 fe-
males and 3 males Fat Deer Key, 4. III-
28.IV.1985, S&J Peck, hammock forest,
malaise & flight intercept trap; 4 females
Monroe Co., Everglades National Park,
Royal Palm Hammock; 1.XI-3.III.19
S&J Peck, malaise; 2 females and 3 males

426

Journal of Hymenoptera Research

1.5 km NW Royal Palm, 3.III.-28.IV.1985,
hardwood hammock forest, malaise-flight
intercept trap; 2 females N. Key Largo,
Sec. 35, 4.III^.VIII.1985, S&J Peck, ham-
mock forest, malaise & flight intercept
trap; 4 females and 1 male same as pre-
vious except 4.III-28.IV.1985; 1 male
4.VIII-16.XI.1985; 1 female St John's Co.,
Theodore Roosevelt Preserve, 13. X. 1980,
Masner & Bowen, 8029; 1 female Liberty
Co., Torreya St. Pk, 7.X.1980, 8022, Masner
& Bowen; 4 females and 4 males Texas:
San Jacinto Co., 5 km S Coldspring Double
Lake Campground, 22-24.V.1983, M.
Kaulbars; 1 male Brazos Co., College Sta-
tion, 1982, R. Wharton, M. Hrncir, pan
trap.

Etymology. — This species is named in
honor of David R. Smith, Systematic En-
tomology Laboratory, USD A, who collect-
ed part of the type series and whose col-
lecting over the years has added greatly to
the U.S. National Collection of Insects.

ACKNOWLEDGMENTS

I thank Dr. C. Burwell, Queensland Museum, Bris-
bane; Dr. S. Heydon, Bohart Museum, University of
California, Davis; Dr. J. LaSalle, CABI Bioscience, UK;
and Dr. J. Huber, Canadian Forestry Service and Ca-
nadian National Collection, Ottawa for the loan of
specimens. Ms. Tami Carlow provided technical as-
sistance and editorial support. Drs. S. Heydon, N.
Vandenberg, and D. Smith provided useful com-
ments on drafts of the manuscript.

LITERATURE CITED

Ashmead, W. H. 1904. Classification of the chalcid
flies of the superfamily Chalcidoidea, with de-

scriptions of new species in the Carnegie Muse-
um, collected in South America by Herbert H.
Smith. Memoirs of the Carnegie Museum 1: i-ix,
225-551.

Gibson, G. A. P. 1997. Chapter 2, Morphology and
terminology, pp. 16-44. In Gibson, G. A. P. et al.,
(eds.) Annotated keys to the genera of North Amer-
ica)! Chalcidoidea (Hymenoptera). NRC Research
Press, Ottawa.

Girault, A. A. 1913. Australian Hymenoptera Chal-
cidoidea— IV. The family Eulophidae with de-
scriptions of new genera and species. Memoirs of
the Queensland Museum 2:140-296.

Girault, A. A. 1915. Australian Hymenotpera Chal-
cidoidea IV. Supplement. Memoirs of the Queens-
land Museum 3:180-299.

Girault, A. A. 1922. New chalcid flies from eastern
Australia (Hymenoptera, Chalcididae). II. lnse-
cutor Inscitiae Menstruus. 10:100-108.

Girault, A. A. 1938. Some new Australasian insects
which are parasites (Hym., Chalcidoidea). Revista
de Entomolgia, Rio de Janeiro 8:80-89.

LaSalle, J. and M. E. Schauff. 1992. Preliminary stud-
ies on neotropical Eulophidae (Hymenoptera:
Chalcidoidea): Ashmead, Cameron, Howard and
Walker species. Contributions of the American En-
tomological Society 27: 1-47 pp.

Moschler, H. B. 1878 [1877]. Beitrage zur Schmetter-
lings-Fauna von Surinam. 11. Verhandlungen
Zoologisch-botanischen Gesellschaft im Wien 27:629-
700.

Schauff, M. E., J. LaSalle, and L. Coote. 1997. Family
Eulophidae, p. 327-429. In Gibson, G. A. P. et al.,
(eds.) Annotated keys to the genera of North Amer-
ican Chalcidoidea (Hymenoptera). NRC Research
Press, Ottawa.

Schulz, W. A. 1906. Spolia Hymenopterologica. 355pp.
Paderborn.

Yoshimoto, C. M. and T. Ishii. 1965. Insects of Micro-
nesia: Hymenotpera Chalcidoidea: Eulophidae,
Encyrtidae (part), Pteromalidae. Insects of Micro-
nesia 19: 109-178.

J. HYM. RES.
Vol. 9(2), 2000, pp. 427-429

NOTE

The Presence of Antero-lateral Abdominal Glands in Euderomphale
(Hymenoptera: Chalcidoidea: Eulophidae)

John LaSalle and Andrew Polaszek

Unit of Parasitoid Systematics, CABI Bioscience UK Centre (Ascot), Department of Biology,
Imperial College at Silwood Park, Ascot, Berks, SL5 7PY, UK

Quicke et al. (1997) discussed the pres-
ence of antero-lateral abdominal glands
(ALAGs) in the braconid subfamily Bra-
coninae, and provided detailed anatomi-
cal descriptions of them. Virtually all bra-
conines possess these glands, although
they are not known in other braconid sub-
families. They are eversible, sac-like glan-
dular invaginations of the unsclerotized
lateral cuticle between the terga and ster-
na on the first and second metasomal (sec-
ond and third abdominal) segments. AL-
AGs are present in both sexes, and pro-
duce an odoriferous secretion which is
characteristic of braconine wasps.

The exact function of ALAGs in bracon-
ines is unknown. Since the glands are
everted, and their product secreted, most
notably when the wasps are disturbed,
Quicke et al. (1977) suggested that the
product might be a chemical that was dis-
tasteful to predators. However, they also
discussed several problems with this pos-
sibility, including that braconines were
not distasteful to vertebrates, and that ar-
thropods avoided non-braconines (with-
out ALAGs) as readily as they avoided
braconines (with ALAGs). Similarly, the
role of ALAGs in the production of sex
pheremones was questioned as these
glands are present in both sexes. Another
suggestion was that the ALAGs play a
more general role in intra-specific signal-
ling, such as an aggregation or alarm
pheremone. Quicke et al. (1997) recorded
ALAGs only in Braconinae and Diprion

similis (Diprionidae), although they con-
cluded that it was unlikely that these are
homologous structures.

The present paper reports the presence
of ALAGs in the eulophid genus Euder-
omphale, species of which are parasitoids
of whiteflies (see LaSalle and Schauff 1994
for a discussion of the systematic place-
ment of this genus). This is the first report
of the presence of these glands in any
member of the Chalcidoidea.

The ALAGs in Euderomphale seem sim-
ilar to those of braconines in that they ap-
pear to be eversible, sac-like invaginations
of the unsclerotized cuticle between the
terga and sterna of the second metasomal
(third abdominal, first gastral) segment.
There is only a single pair of the glands,
and these are present in both sexes (Figs.
1-6). As with braconines, their function is
unknown, but it is not clear that they are
used in response to disturbance, as one of
us (AP) has actually observed Euderom-
phale held in plastic bags everting and re-
tracting these ALAGs while there was
nothing obvious to disturb them. It may
be that in Euderomphale, as suggested by
Quicke et al. (1997), the ALAGs play a
more general role in intra-specific signal-
ling, but what this role might be remains
unknown.

It is also worth noting that the shape of
the anterior margin of the gastral tergites
appears to provide useful characters for
differentiation of species in Euderomphale.
For example, in £. cortinae Graham (Figs.

428

Journal of Hymenoftera Research

Volume 9, Number 2, 2000

42m

3-4) the second gastral tergite is deeply
emarginate medially, and there are similar
emarginations on tergites 3 and 4, al-
though these are more prominent in males
(Fig. 4) than females (Fig. 3). In £. flavi-
media (Howard) (Figs. 5-6), the first gastral
tergite is slightly produced medially with
a very small incision, with very broad,
shallow lateral emarginations; tergites 3
and 4 are entire or only very slightly
emarginate. This condition is found in

both males and females. Slide-mounted
material is necessary to clearly see this
character.

LITERATURE CITED

LaSalle, J. and M.E. Schauff. 1994. Systematics of the
tribe Euderomphalini (Hvmenoptera: Eulophi-
dae): parasitoids of whiteflies (Homoptera: Al-
eyrodidae). Systematic Entomology 19: 235-2^

Quicke, D.L.J., R.A. Wharton and H. Sittertz-Bhatkar.
1997. Antero-lateral abdominal scent gland-- oi
braconine wasps (Hymenoptera: Braconidae).
Journal of Hymenoptera Research 6: 219-230.

Figs. 1-6. Euderomphale species. 1-4. Euderomphale cortinae Graham. 1, male gastei showing ALAGs. 2, close
up of ALAG. 3, female gaster. 4, male gaster. 5-6. Euderomphale flavimedia (Howard). 5, female gaster. ft, male
gaster.

J. HYM. RES.
Vol. 9(2), 2000, pp. 430-431

NOTE

First Possible Host Record for the Braconid Wasp Genus
Diamblomera Enderlein (Hymenoptera: Braconinae)

Donald L. J. Quicke, Gavin Broad, Nina M. Laurenne, and Jupailin Naiman

(DLJQ, GB) Unit of Parasitoid Systematics, CABI Bioscience UK Centre (Ascot), Department of

Biology, Imperial College at Silwood Park, Ascot, Berkshire SL5 7PY, U.K., Centre for
Population Biology, Imperial College at Silwood Park, Ascot, Berkshire SL5 7PY, U.K., (DLJQ)

Department of Entomology, The Natural History Museum, London SW7 5BD, U.K.; (NML)

Finnish Museum of Natural History, Zoological Museum, Entomological Division, P.O. Box 17

(P. Rautatiekatu 13), FIN-00014 University of Helsinki, Finland. (JN) Tropical Biodiversity and

Conservation Unit, Universiti Malaysia Sabah, Sabah, Malaysia.

Determining host associations for para- itor more or less between her hind legs
sitic wasps is fraught with difficulties and and started 'drilling'. This activity was
many published records are erroneous watched for approximately 15 minutes
(Noyes 1994; Shaw 1994). These errors and as she then started moving her me-
stem both from misidentifications of hosts tasoma around more noticeably, it was
and parasitoids, and from wrongly assum- thought that she may have located a host
ing associations. They are particularly or even oviposited. At this point she was
problematic when it comes to concealed caught and the exact position where her
hosts, especially those living in deep or ovipositor was 'drilling' was carefully not-
potentially complex situations where there ed. We proceeded to cut into this piece of
may be more than one species, and the dead vine. The stem of the vine is flat-
identity of the true host or hosts in these tened and at this place was approximately
situations is often ambiguous. 10 cm wide by 3.5 cm thick. Along a

Field observations in Sabah of a large bra- length of vine of approximately 40 cm we

conine wasp, Diamblomera sp., strongly in- discovered more than twenty, apparently

dicate that it is a parasitoid of larvae of cer- conspecific cerambycid beetle larvae be-

ambycid beetles belonging to the subfamily longing to the subfamily Lamiinae (iden-

Lamiinae. Details of our observations and tified as such because of the complete ab-

identifications are provided below. sense of legs, and the relatively elongate

During a reconnaissance visit to Poring head with the cardines, submentum and
Springs, a resort within lowland rainforest maxillary articulating areas fused). These
of Kinabalu National Park, Sabah, NML were almost all of very similar size (ap-
and DLJQ noticed a large female braconid proximately 20 mm long, range 12-23
wasp flying around a large dead (uniden- mm, and 2-3 mm wide) and apparently of
tified) tree. However, the wasp subse- an appropriate size to be a host for the
quently settled on a vine hanging from the wasp, Diamblomera sp., the females of
tree and a second, apparently conspecific which were approximately 18 mm long
female wasp was then noticed already to (excluding ovipositor), but a little narrow-
be sitting on the same piece of vine about er than the beetle larvae. No other poten-
20 cm away. Both wasps intermittently tial hosts were present, i.e. no other even
walked over that piece of vine, apparently remotely similarly sized insect larvae were
searching for hosts, and after some time found. Unfortunately, no host was found
(approximately 5 minutes) one female immediately below the point of ovipositor
raised her metasoma, 'located' her ovipos- penetration but since it took almost twen-

Volume 9, Number 2, 2000

431

ty minutes for us fully to cut out and dis-
sect this piece of vine, it is quite possible
that any beetle larva had simply moved
away from that place, possibly due to the
disturbance we caused. A third individual
of the wasp was subsequently observed
flying around the site but she did not land
on the now damaged vine. The vine was
identified as Agelaea borneensis (Hook. F.)
Merr. (Connaraceae) by Mr. Sukup Akin.
Agelaea is a common SE Asian genus of
trees, vines and shrubs (Jarvie and Ermay-
anti 1996 onwards).

Given that two females of the same spe-
cies of Diamblomera were intensively inves-
tigating the same piece of host substrate
with one starting to go through oviposition
behaviour, and that the substrate contained
many, apparently suitably sized larvae of a
single species of cerambycid beetle, we feel
confident that this is a valid host-parasitoid
association. Unfortunately there are no
identification keys to the species of Diam-
blomera. Only two species were described
under that generic name originally (Ender-
lein 1920; Quicke and Achterberg 1990), and
no further species have subsequently been
transferred to it despite ongoing reclassifi-
catory work; however, there probably exist
other described species that are currently
classified under different genera and full re-
vision is needed.

This is the nearest thing to a first host
record for a member of the genus Diam-
blomera, although it may be objected that
none of the more than twenty putative
hosts seen appeared to have been parasit-
ised. The larger braconines belonging to
the Aphrastobraconini (= Iphiaulacini) are
often parasitic on concealed wood or stem
boring hosts and this association with a
vine-feeding cerambycid is therefore not
exceptional, though records of parasitism
of hosts in vines (lianas) are rare. Further,
from what little is known about the hosts
of the larger braconines (almost entirely
from temperate taxa, particularly those as-
sociated with forestry pests), it appears
that many attacking subcortical beetles
may be quite polvphagous — but whether

all the host records that are listed in She-
nefelt (1978) for members of such bracon-
ine genera as Atanycolus Foerster, which
may have similar biologies to Diamblom-
era, are reliable is far from certain. That
there is some degree of specialisation is
apparent from the fact that, at the same
locality, we observed several other species
of large Braconinae — belonging to other
genera — that were each showing interest
in different sites or dead trees (Laurenne
et al. 2000). Only the accumulation of ac-
curate host records and other details of
host ecology, such as substrate, plant or
fungal associations, for these taxa will
start to show what factors may be impor-
tant in determining host ranges.

The specimens of Diamblomera and the
beetle larvae are deposited in The Natural
History Museum, London.

ACKNOWLEDGMENTS

We would like to thank Professor Marvati and Dr.
Homathevi Rahman (TBCU, UMS, Sabah) for their
assistance with planning this visit, Mr. Sukup Akin
who kindly managed to identify the vine from a rath-
er poor specimen, and Dr. Mark Shaw for valuable
improvements to the MS.

LITERATURE CITED

Enderlein, G. 1920. Zur Kenntnis aussereuropaischer
Braconiden. Ardriv fiir Naturgesddchte 84iAk 51-
224.

Jarvie, J.K. and Ermayanti (1996 onwards). Tree Gen-
era of Borneo — Descriptions and Illustrations.
http://django.harTMtrd.edu/users/jjartrie Borneo.htm.

Laurenne, NI. M., R. Belshaw, G. Broad and D. L. J.
Quicke. 2000. Molecular confirmation of host re-
cords for ichneumonoid parasitoids of wood-bor-
ing beetle larvae, journal of Hymenoptera Research
9:241-24-

Noyes, J. S. 1994. The reliability of published host-par-
asitoid records: A taxonomist's view. Norwegian
Journal of Agricultural Science, Supplement 16: 59-69.

Quicke, D. L. J. and C. van Achterberg. 1990. The type
specimens of Enderlein's Braconinae (Hymenop-
tera: Braconidae) housed in Warsaw. Tijdschrifl
voor Entomologie 133: 251-264.

Shaw, M. R. 1994. Parasitoid host ranges. In: B. A.
Hawkins and \\ Sheehan 'I ds). Parasitoid Com-
munity Ecology. Oxford University Press, Oxford,
pp. lil-144

Shenefelt, R.D. 197S. Hymenopterorum Catalog)

Editio). Braconidae 10. lunk, The Hague, pp.
142- 1872

J. HYM. RES.
Vol. 9(2), 2000, pp. 432

CORRECTION

P. S. Ward. On the identity of Pheidole vaslitii Pergande (Hymenoptera: Formicidae),
a neglected ant from Baja California. Journal of Hxjmenoptera Research 9(1): 85-98.

Page 94, left column, line 30. The name proof stage by the editor, who regrets hav-
"vaslilli" is incorrect and should be spelled ing added a further complication to the
vaslitii. This error was created at the nomenclature surrounding this name.

INSTRUCTIONS FOR AUTHORS

General Policy. The Journal of Hymenoptera Research invites papers of high scientific quality reporting
comprehensive research on all aspects of Hymenoptera, including biology, behavior, ecology, systematics,
taxonomy, genetics, and morphology. Taxonomic papers describing single species are unlikely to be accepted
unless a strong case is evident, such as importance in economic entomology or with concurrent biology or
ecology. Manuscript length generally should not exceed 50 typed pages; however, no upper limit on length
has been set for papers of exceptional quality and importance, including taxonomic monographs at generic
or higher level.

The language of publication is English. Summaries in other languages are acceptable.

The deadline for receipt of manuscripts is 1 October (for the April issue) and 1 April (for the October
issue).

The paper should have a concise and informative title, followed by the names and addresses of all authors.
The sequence of material should be: title, author(s), abstract, text, acknowledgments, literature cited, appen-
dix, figure legends, figure copies (each numbered and identified), tables (each numbered and with heading).
Bach of the following should start a new page: (1) title page, (2) abstract, (3) text, (4) literature cited, (5) figure
legends, (6) footnotes.

Following acceptance of the manuscript, the author should provide the editor with one copy of the
manuscript accompanied by a copy on diskette using DD, double sided computer diskettes — IBM compati-
ble MS DOS 5.25 inch or IBM and Macintosh 3.5 inch diskettes. (Authors who do not have access to a com-
puter should submit three copies of the manuscript.) The paper may be submitted in most PC and Mac word
processor programs such as Microsoft Word, FullWrite Professional, WordPerfect, WriteNow, Nisus, Mac-
Write, or MacWrite II. If possible, all words that must be italicized should be done so, not underscored.
Tables may be formatted in a spread sheet program such as MS Works or MS Excel. Text should be double-
spaced typing, with 25 mm left and right margins. Tables should be put in a separate file. Diskettes should
be accompanied by the name of the software program used (e.g., WordPerfect, Microsoft Word). Authors
should keep backup copies of all material sent to the Editor. The Society cannot be responsible for diskettes
or text mislaid or destroyed in transit or during editing.

Illustrations should be planned for reduction to the dimension of the printed page (14 X 20.5 cm, column
width 6.7 cm) and allow room for legends at the top and bottom. Do not make plates larger than 14 X 18 in.
(35.5 X 46 cm). Individual figures should be mounted on a suitable drawing board or similar heavy stock.
Photographs should be trimmed, grouped together and abutted when mounted. Figure numbers should be
on the plate, and it is strongly recommended that names be included after the numbers (e.g., Fig. 2, texanus).
Include title, author(s) and address(es), and illustration numbers on back of each plate. Original figures need
not be sent until requested by the editor, usually after the manuscript has been accepted. Reference to figures/tables
in the text should be in the style "(Fig. 1)" "(Table 1)". Measurements should be in the metric system.

All papers must conform to the International Code of Zoological Nomenclature. The first mention of a plant
or animal should include the full scientific name including the authority. Genus names should not be abbre-
viated at the beginning of a sentence. In taxonomic papers type specimens must be clearly designated, type
depositories must be clearly indicated, and new taxa must be clearly differentiated from existing taxa bj
means of keys or differential diagnoses. Authors are required to deposit all type material in internationally
recognized institutions (not private collections). Voucher specimens should be designated for specimens
used in behavioral or autecological studies, and they should be deposited similarly.

Acceptance of taxonomic papers will not require use of cladistic methods; however, authors using them
will be expected to specify the phylogenetic program used (if any), including disc ussnm of program options
used. A data matrix should be provided if the subject is complex. Cladograms must be hung with chara< ters
and these should include descriptors (not numbers alone) when feasible. The number oi parsimonious
cladograms generated should be stated and reasons given for the one adopted. I engths and consistency
indices should be provided. Adequate discussions should be given for characters, plesiomorphic conditions,
and distributions of characters among outgroups when problematical.

References in the text should be (Smith 1999), without a comma, or Smith (1999). Two articles b) a single
author should be (Smith 1999a, 1999b) or Smith (1999a, 1999b). lor multiple authors, use the word 'and.'
not the symbol "&" (Smith and Jones 1999). For papers in press, use "in press," not the expected publication
date. The Literature Cited section should include all papers referred to in the paper, lournal names should
be spelled out completely and in italics.

Charges. Publication charges are $10.00 per printed page. At least one author of the paper must be a
member of the International Society of HymenopteristS. Reprints are charged to the author and must be
ordered when returning the proofs; there an' no free reprints. .Author's corrections and i hanges in proof are
also charged to the author. Color plates will be billed at full cost to the author

All manuscripts and correspondence should be sent to:

Dr. E. Fric C.rissell

Systematic Entomology Laboratory, USDA

r, National Museum ot Natural History

Washington, DC 20560-0168
Phone: (202) 382-1781 Fax: (202) 7Xh-W422 E-mail: ci;rissel(<Dsel.barc.usda.go\

CONTENTS
(Continued from front cover)

LAURENNE, N. M., R. BELSHAW, G. BROAD, and D. L. J. QUICKE. Molecular confirma-
tion of host records for ichneumonoid parasitoids of wood-boring beetle larvae . . 241

MARSH, P. M., M. V. de MACEDO, and M. C. P. PIMENTAL. Descriptions and biological
notes on two new phytophagous species of the genus Allorhogas from Brasil
(Hymenoptera: Braconidae: Doryctinae) 292

MENKE, A. S. and W. J. PULAWSKI. A review of the Sphex flavipennis species group

(Hymenoptera: Apoidea: Sphecidae: Sphecini) 324

POLASZEK, A. and G. L. PRINSLOO. The identity of Pteroptrix imitatrix (Fullaway) (Hy-
menoptera: Aphelinidae) 320

PULAWSKI, W. J. Didineis massaica, new species, the first Afrotropical member of the genus,
and redescription of Didineis nigricans Morice, 1911 (Hymenoptera: Apoidea: Cra-
bronidae: Bembicinae) 347

SCHAUFF, M. E. Review of the species of Deutereulophus (Hymenoptera: Chalcidoidea:

Eulophidae) of North America 416

SCHLUMPBERGER, B. and D. WITTMANN. New odour glands in Xylocopa males (Hy-
menoptera: Apoidea: Anthophoridae) 363

SCHMID-EGGER, C. A revision of Entomosericus Dahlbom 1845 (Hymenoptera: Apoidea:

"Sphecidae") with description of a new species ' 352

SHAW, S. R. and P. M. MARSH. Revision of the enigmatic genus Marshiella Shaw in the
New World with the description of three new species (Hymenoptera: Braconidae:
Euphorinae) 277

VALERIO, A. A. and J. B. WHITFIELD. Taxonomic notes on Costa Rican Mendesellinae
(Ichneumonoidea: Braconidae), with description of a new Central American species
of Mendesella 271

WHARTON, R. A. and C. van ACHTERBERG. Family group names in Braconidae (Hy-
menoptera: Ichneumonoidea) . 254

NOTES

LaSALLE, J. and A. POLASZEK. The presence of antero-lateral abdominal glands in

Euderomphale (Hymenoptera: Chalcidoidea: Eulophidae) 427

QUICKE, D. L. J., G. BROAD, N. M. LAURENNE, and J. NAIMAN. First possible host
record for the braconid wasp genus Diamblomera Enderlein (Hymenoptera:
Braconinae) 430

CORRECTION 432

r s

Heckman

BINDERY. IN C.
Bound-To -Please*

SEPT 01

N. MANCHESTER, INDIANA 46962
L J

ITHSONIAN INSTITUTION LI

3 9088 01058 9570

Internet Archive Audio

Featured

Top

Images

Featured

Top

Software

Featured

Top

Books

Featured

Top

Video

Featured

Top

Mobile Apps

Browser Extensions

Archive-It Subscription

Save Page Now

Full text of "Journal of Hymenoptera research"

See other formats