(navigation image)
Home American Libraries | Canadian Libraries | Universal Library | Community Texts | Project Gutenberg | Biodiversity Heritage Library | Children's Library | Additional Collections
Search: Advanced Search
Anonymous User (login or join us)
Upload
See other formats

Full text of "Malacologia"

HARVARD UNIVERSITY 

Library of the 

Museum of 

Comparative Zoology 




MALACOLOGIA 



International Journal of Malacology 



-1Î 



Ш 



Vol. 43(1-2) 



* 



шЁ0^^ 



"»' 



\ 









^ 




^ее^ЁЁ/ШЕЕ^ 



/ 




001 



Ч 



■iä^ 



MALACOLOGIA 

EDITOR-IN-CHIEF: 
GEORGE M. DAVIS 



Editorial Office 

Malacologia 

P.O. Box 1222 

West Falmouth, MA 02574-1222 



Business & Subscription Office 

Malacologia 

P.O. Box 385 

Haddonfield, NJ 08033-0309 



Co-Editors: 
EUGENE COAN 
California Academy of Sciences 
San Francisco, CA 



CAROL JONES 
Denver, CO 



Managing Editor: 

CARYL HESTERMAN 
Haddonfield, NJ 



Associate Managing Editor 

TIMOTHY A. PEARCE 

Delaware Museum of 

Natural History 

Wilmington, DE 

Associate Editor: 

JOHN B. BURCH 

University of Michigan 

Ann Arbor 



Graphics Editor 

THOMAS WILKE 

George Washington 

University 

Washington, DC 



MALACOLOGIA is published by the INSTITUTE OF MALACOLOGY the Sponsor Members of 
which (also serving as editors) are: 



RÜDIGER BIELER 
Field Museum, Chicago 

JOHN BURCH 

MELBOURNE R. CARRIKER 
University of Delaware, Lewes 

GEORGE M. DAVIS 
Secretary and Treasurer 

CAROLE S. HICKMAN 

President 

University of California, Berkeley 



ALAN KOHN 

Vice President 

University of Washington, Seattle 

JAMES NYBAKKEN 

President Elect 

Moss Landing Marine Laboratory, California 

CLYDE F E. ROPER 

Smithsonian Institution, Washington, D.C. 

SHI-KUEI WU 

University of Colorado Museum, Boulder 



Participating Members 



EDMUND GITTENBERGER 

Secretary, UNITAS MALACOLOGICA 

Rijksmuseum van Natuurlijke 

Historie 

Leiden, Netherlands 



JACKIE L. VAN GOETHEM 
Treasurer, UNITAS MALACOLOGICA 
Koninklijk Belgisch Instituut 
voor Natuurwetenschappen 
Brüssel, Belgium 



Emeritus Members 



J. FRANCES ALLEN, Emérita 
Environmental Protection Agency 
Washington, D.C. 

KENNETH J. BOSS 

Museum of Comparative Zoology 

Cambridge, Massachusetts 



ROBERT ROBERTSON 

The Academy of Natural Sciences 

Philadelphia, Pennsylvania 

W. D. RUSSELL-HUNTER 
Easton, Maryland 



Copyright © 2001 by the Institute of Malacology 
ISSN: 0076-2997 



2001 
EDITORIAL BOARD 



J. A. ALLEN 

Marine Biological Station 
Millport. United Kingdom 
¡alien @ udcf. gla.ac. ul< 

E. E. BINDER 

Museum d'Histoire Naturelle 

Geneve. Switzerland 

P. BOUCHET 

Muséum National d'Histoire Naturelle 
Paris, France 
bouchet@cimrs 1 . mnhn. fr 

P. CALOW 

University of Sheffield 
United Kingdom 

R. CAMERON 

Sheffield 

United Kingdom 

R. Cameron @ Sheffield, ac. и к 

J. G. CARTER 

University of North Carolina 

Chapel Hill, U.S.A. 

MARYVONNE CHARRIER 

Universite de Rennes 

France 

Maryvonne. Charrier @ и niv- rennes 1 . fr 

R. COWIE 
Bishop Museum 
Honolulu, HI.. U.S.A. 

A. H, CLARKE, Jr. 
Portland. Texas, U.S.A. 

B. С CLARKE 
University of Nottingham 
United Kingdom 

R. DILLON 

College of Charleston 

SC U.S.A. 

C.J. DUNCAN 
University of Liverpool 
United Kingdom 

D.J. EERNISSE 
California State University 
Fullerton, U.S.A. 

E. GITTENBERGER 
Rijksmuseum van Natuurlijke Historie 
Leiden, Netherlands 

sbu2eg @ rulsfb. leidenuniv. de 

F. GIUSTI 

Universita di Siena. Italy 
giustif@unisi.it 



A. N. GOLIKOV 
Zoological Institute 
St. Petersburg. Russia 

S.J. GOULD 
Harvard University 
Cambridge, Mass.. U.S.A. 

A. V. GROSSU 
Universitatea Bucuresti 
Romania 

T. HABE 

Tokai University 

Shimizu. Japan 

R. HANLON 

Marine Biological Laboratory 

Woods Hole. Mass., U.S.A. 

G. HASZPRUNAR 

Zoologische Staatssammlung Muenchen 

Muenchen. Germany 

haszi@zi.biologie.uni-muenchen.de 

J. M. HEALY 

University of Queensland 

Australia 

¡healy@ zoology, uq. edu.au 



J. A. HENDRICKSON, Jr. 
Academy of Natural Sciences 
Philadelphia. PA. U.S.A. 



D. M. HILLIS 
University of Texas 
Austin. U.S.A. 

K. E. HOAGLAND 

Council for Undergraduate Research 

Washington. DC. U.S.A. 

Elaine@cur.org 

B. HUBENDICK 
Naturhistoriska Museet 
Göteborg. Sweden 

S. HUNT 
Lancashire 
United Kingdom 

R. JANSSEN 

Forschungsinstitut Senckenberg, 
Frankfurt am Main, Germany 

M, S. JOHNSON 
University of Western Australia 
Nedlands, WA, Australia 
msj@cyllene.uwa.edu.au 

R. N. KILBURN 
Natal Museum 
Pietermaritzburg, South Africa 



M. A. KLAPPENBACH 

Museo Nacional de Historia Natural 

Montevideo, Uruguay 

J. KNUDSEN 

Zoologisk Institut Museum 

Kcbenhavn. Denmark 

С. LYDEARD 
University of Alabama 
Tuscaloosa. U.S.A. 
clydeard@biology.as. ua. edu 

C. MEIER-BROOK 

Tropenmedizinisches Institut 
Tubingen. Germany 

H. K. MIENIS 

Hebrew University of Jerusalem 

Israel 

J. E. MORTON 
The University 
Auckland. New Zealand 

J. J. MURRAY, Jr. 
University of Virginia 
Charlottesville. U.S.A. 

R. NATARAJAN 
Manne Biological Station 
Porto Novo. India 

DIARMAIDOFOIGHIL 
University of Michigan 
Ann Arbor U.S.A. 

J. OKLAND 
University of Oslo 
Norway 

T. OKUTANI 
University of Fisheries 
Tokyo. Japan 

W. L. PARAENSE 

Instituto Oswalde Cruz. Rio de Janeiro 

Brazil 

J. J. PARODIZ 
Carnegie Museum 
Pittsburgh. U.S.A. 

R. PIPE 

Plymouth Marine Laboratory 
Devon, United Kingdom 
RKPI @wpo. nerc.ac.uk 

J. P POINTIER 

Ecole Pratique des Hautes Etudes 
Perpignan Cedex. France 
pointier© gala, univ-perp. fr 

W. F. PONDER 
Australian Museum 
Sydney 



01 Z. Y 

Academia Sínica 

Qingdao. People's Republic of China 

D. G. REID 

The Natural History Museum 

London. United Kingdom 

S. G. SEGERSTRALE 
Institute of Mahne Research 
Helsinki. Finland 

A. STANCZYKOWSKA 
Siedlce. Poland 

F. STARMÜHLNER 

Zoologisches Institut der Universität 

Wien. Austria 

Y I. STAROBOGATOV 
Zoological Institute 
St. Petersburg. Russia 

J. STUARDO 
Universidad de Chile 
Valparaiso 

C.THIRIOT 

University P. et M. Curie 
Villefranche-sur-Mer, France 
thiriot @ obs-vlfr. fr 

S. TILLIER 

Museum National d'Histoire Naturelle 

Paris. France 

J. A.M. VAN DEN BIGGELAAR 
University of Utrecht 
The Netherlands 

N. H. VERDONK 

Rijksuniversiteit 
Utrecht. Netherlands 

H. WÄGELE 

Ruhr-Universität Bochum 

Germany 

Heike. Waegele @ ruhr-uni-bochum. de 

ANDERS WAREN 

Swedish Museum of Natural History 

Stockholm. Sweden 

B. R. WILSON 

Dept. Conservation and Land Management 
Kallaroo, Western Australia 

H. ZEISSLER 
Leipzig. Germany 

A. ZILCH 

Forschungsinstitut Senckenberg 

Frankfurt am Main, Germany 



MALACOLOGIA, 2001, 43(1-2): 1-11 

GENETIC VARIATION IN THE LAND SNAIL ISOGNOMOSTOMA 
ISOGNOMOSTOMA (GASTROPODA: PULMONATA: HELICIDAE) 

P. Van Riel^^ K. Jordaens,^ J. L. Van Goethem & T. Backeljau^ ^ 

ABSTRACT 

Genetic and phenotypic variation in 13 populations of Isognomostoma isognomostoma 
(Schröter, 1784) from central and peripheral areas of its distribution range in central Europe was 
estimated by means of allozyme electrophoresis at 11 loci and a morphometric analysis of six 
shell and 12 genital tract measurements. 

Because of the effects of genetic drift and inbreeding, which may lead to rapid genetic differ- 
entiation, peripheral isolates may play an important role in diversification and speciation. Besides 
this, these populations may also be vulnerable to extinction because of the genetic impoverish- 
ment resulting from the same population genetic processes. 

Population differentiation as evidenced by allozyme electrophoresis was very high (mean Fg-^: 
0.550) and genetic variation was found to be partitioned among regions (mean Fp-,.: 0.480), 
rather than between populations within regions (mean Fgpi 0.152). Only low allozyme variation 
could be detected within local populations (mean F|g: 0.373; mean number of alleles per locus: 
1.27; mean expected heterozygosity: 0.062). Although morphological differentiation was less 
pronounced among populations and/or regions, it revealed mainly the same pattern of variation. 
No genetic variation, or the loss of it, could be attributed to the position of populations near the 
periphery of the distribution range. 

Key words: allozymes, morphology, population genetics, peripheral populations, Isogno- 
mostoma isognomostoma. 



INTRODUCTION 

Isognomostoma isognomostoma (Schröter, 
1784) is a terrestrial helicid snail with a distri- 
bution in Europe extending over the moun- 
tainous regions of central Europe, from the 
Harz, Sauerland and the Eitel region in 
the north, to the Carpathians in the east and 
the Alps, Jura and Vosges in the south and 
southwest (Ant, 1963; Kerney et al., 1983). 
The species is considered to be of Alpine- 
Carpathian origin and probably dispersed 
northward during inter- and postglacial peri- 
ods (Ant, 1963). 

At the western edge of its geographic 
range, /. isognomostoma occurs in the valley 
of the river "Ourthe" near La Roche-en-Ar- 
denne (Belgium) where it was recorded for 
the first time by Van Belle (1 970). On the map 
provided by Kerney et al. (1983), the popula- 
tions in this region are shown as being iso- 
lated from the main region of distribution (Fig. 
1). Irrespective of whether this is truly the 
case, the Belgian populations are peripheral 
and although /. isognomostoma might have 



established Itself in this region a long time 
ago, it is equally possible that it represents a 
recent introduction. In any event, the species 
has been known in this region for at least 30 
years. 

Generally, small and isolated populations 
are prone to effects of genetic drift and in- 
breeding, resulting in two possible, though not 
mutually exclusive, outcomes. Usually, ge- 
netic drift and inbreeding will lead to loss of al- 
leles and decreased heterozygosity, resulting 
in reduced evolutionary flexibility and a higher 
risk of extinction (Leberg, 1992; Frankham & 
Ralls, 1998; Saccheri et al., 1998). Alterna- 
tively, genetic drift and inbreeding may also 
lead to rapid genetic change, possibly en- 
hanced by an increased selection pressure 
near the edge of a species' range (Levin, 
1970; Soulé, 1973; Carson, 1975; Templeton, 
1980). Hence, peripheral isolates may gener- 
ate biodiversity and may therefore be valu- 
able for conservation (Lesica & Allendorf, 
1995). Furthermore, the Convention on Bio- 
logical Diversity explicitly recognizes that 
intraspecific variation needs protection be- 



Royal Belgian Institute of Natural Sciences (RBINSc), Vautierstraat 29, B-1000 Brussels, Belgium 

^University of Antwerp (RUCA), Department of Biology, Groenenborgerlaan 171, B-2020 Antwerp, Belgium; 
vanriel@ruca.ua.ac.be 



1 



VAN RIEL ET AL. 




FIG. 1 . Map indicating sampling localities and distribution of /. isognomostoma in west and southeast Europe 
(Kerneyetal., 1983:Alzona, 1971). 



cause of its fundamental contribution to biodi- 
versity (Anonymous, 1992). We used mor- 
phometrlc and allozyme data to determine to 
what degree the peripheral Belgian popula- 
tions of /. Isognomostoma are differentiated 
from populations elsewhere in Europe. 



MATERIALS AND METHODS 
Sampling and Sample Preparation 

From the central part of the species' range, 
11 populations were sampled for comparison 
with the Belgian material (Fig. 1, Table 1). 
Snails were collected by hand and frozen in 
liquid nitrogen and then stored at -80°C. For 
the allozyme analysis, the digestive gland 
was removed, weighed and homogenized in a 
20% sucrose solution (5 |il/mg tissue). The re- 



maining soft body parts were stored in 70% 
ethanol for subsequent measuring. Geo- 
graphically distant populations were arbitrarily 
grouped into different regions (Table 1), ac- 
cording to the map given in Figure 1. 

Allozyme Electrophoresis 

Vertical Polyacrylamide gel electrophoresis 
(PAGE) was carried out following Backeljau 
(1989). Staining recipes were modified from 
Harris & Hopkinson (1976). Allele frequencies 
(p), observed (H^) and expected (H^) het- 
erozygosities, mean number of alleles (A), 
Nei's (1978) unbiased genetic distances and 
Cavalli-Sforza & Edwards' (1967) chord dis- 
tances between populations were computed 
using BIOSYS-1 v1.7 (Swofford & Selander, 
1 981 ). Deviations from Hardy-Weinberg (HW) 
equilibrium expectations and population differ- 



GENETIC VARIATION IN ISOGNOMOSTOMA 3 

TABLE 1. Origin of sampled populations, population codes and numbers of sampled individuals (N) of 
/. isognomostoma. 



Nr. 


Country 


Region 


Locality 




Code 


N 


1 


Belgium 


Ardennen 


La-Roche-en- 


Ardenne (West) 


AR1 


33 


2 


Belgium 


Ardennen 


La-Roche-en- 


Ardenne 


(East) 


AR2 


26 


3 


Germany 


Harz Mountains 


Hüttenrode 






Hl 


15 


4 


Germany 


Harz Mountains 


Treseburg 






H2 


23 


5 


Germany 


Harz Mountains 


Alexisbad 






H3 


34 


6 


Germany 


Ertz Mountains 


Wolkenstein 






El 


5 


7 


Czech Republic 


Ertz Mountains 


Lestina 






E2 


40 


8 


Austria 


Alps-Karawanken 


Wildenstein 






AK 


11 


9 


Austria 


Alps-Karnische Alpen 


Leisach 






AKA1 


39 


10 


Austria 


Alps-Karnische Alpen 


Sillian 






AKA2 


8 


11 


Austria 


Alps-Vorarlberg 


Inner Latterns 




AVI 


22 


12 


Liechtenstein 


Alps-Vorarlberg 


Schaanwald 






AV2 


46 


13 


Switzerland 


Alps-Mitteland 


Langnau 






AM 


45 



entiation were analyzed with F-statistics 
based on a general ANOVA approach (Weir & 
Cockerham, 1984) using the programs FSTAT 
vl.2 (Goudet, 1995) and GENEPOP v3.1b 
(Raymond & Rousset, 1995). The BIOSYS-1 
program was used to perform a hierarchical 
analysis of F-statistics (Wright, 1978) in order 
to assess how genetic differentiation (Fg-p) was 
partitioned within (Fgp) and between (Fp-p) 
regions. The Mantel test implemented by 
NTSYS v1.8 (Rohlf, 1993) was used to com- 
pare genetic (Fg-p) and geographical dis- 
tances, as well as to compare distance mea- 
sures based on genetic and morphometric 
data. Conformance to HW expectations, het- 
erogeneity of allele frequencies, following 
Weir & Cockerham's (1984) F-statistics and 
the Mantel statistic were tested for signifi- 
cance using exact procedures (permutations 
or Markov chain method; 1 ,000 iterations). For 
the hierarchical F-statistics, x^ significance 
tests were performed according to Neel & 
Ward (1972). Corrections for multiple testing 
were applied using the sequential Bonferroni 
technique (Rice, 1989). Non-specific es- 
terases (EST) were analyzed with isoelectric 
focusing (lEF) in a 5-8 pH-gradient using Phar- 
macia's LKB PhastSystem (Olsson et al., 
1 988). As heterozygous animals, by definition, 
have more different alleles than homozygotes, 
the mean number of lEF bands (over all indi- 
viduals) was used as an indirect measure of 
heterozygosity in each population. Pearson's 
product-moment correlations were calculated 
with STATISTICA v5.1 (StatSoft Inc., 1995) 
to evaluate the concordance of these values 
with measures of H^ found with PAGE by direct 
(proportion of heterozygotes) and indirect 
methods (mean number of allozyme bands 
over all loci). The association index of Dice 



(Sq) was used to calculate genetic distances 
(1 - Sq) between populations by comparing 
the lEF banding patterns in five pairs of ran- 
domly choosen individuals (Backeljau et al., 
1994). 

Genetic distances (PAGE and lEF) were 
evaluated by UPGMA clustering and non- 
metric multidimensional scaling (NMDS) com- 
bined with a minimum spanning tree (MST) as 
implemented by NTSYS v1 .8 (Rohlf, 1 993). 

Morphometric Analysis 

Six shell measurements were taken using 
calipers, while 12 measurements of the geni- 
tal tract were taken with a Wild-Heerbrugg mi- 
crometer under a stereomicroscope (Fig. 2). 
For the length measures from the genital 
tract, structures were stretched when neces- 
sary. In each individual we measured: diago- 
nal, height and width of the shell aperture 
(DIA, HA and WA), height and width of the 
shell (HS and WS), height of the body whorl 
(HB), length of the flagellum (LF), length (be- 
tween the penis retractor and the vas defer- 
ens) and width (at the vas deferens) of the 
epiphallus (LE and WE), length and width (at 
the central enlargement) of the penis (LP and 
WP), length and width (at the top enlarge- 
ment) of the dart sac (LDS and WDS), length 
(between the pedunculus and the sper- 
moviduct) of the free oviduct (LFO), mean 
length of both mucus glands (LM), length of 
the diverticulum (LDV) and length of the pe- 
dunculus (LPD1: between the free oviduct 
and the diverticulum; LPD2: between the di- 
verticulum and the bursa copulathx). 

To analyze shape differences, we corrected 
for body size by regressing (model II regres- 
sion) all other variables against WS. The со- 



VAN RIEL ET AL. 








FIG 2 (A) Measurements of the shell and (В) the genital tract of /. isognomostoma^ ^^?c T'lTíií WA- 
axis of CO inq DIA- diagonal aperture, HA: height aperlure, HB: height body whorl, HS. height shell_WA. 
:; h Ipe^e, WS': w,d?h shell'(B) B: bursa copulatnx, DS: dart sac, ^V. diverticulum E: epiphallu^R f a- 
gellum FO: free oviduct, GA: genital atnum, M: mucus gland, P: penis, PD1. pedunculus 1, PD2. peduncu 
lus 2, PR: penis retractor, SO: spermoviduct, V: vagina, VD: vas deferens. 



GENETIC VARIATION IN ISOGNOMOSTOMA 



TABLE 2. Enzymes studied, EC numbers and buffers (electrode/gel) used for PAGE. 
Abbreviations: TC = Tris-citric acid (pH 8), TG = Ths-Glycine (pH 9), THCI = Tris-HCI (pH 9). 



Enzyme 



EC number 



Buffer system 



Dihydrolipoamide Dehydrogenase (DDH) 
Esterases (EST1-2) (non-specific) 
Glucose-6-phosphiate Isomerase (GPI) 
Hydroxybutyrate Dehydrogenase (HBDH) 
Isocitrate Dehydrogenase (IDH) 
Peptidases (PEP) (substrate: leu-ala) 
Phosphoglucomutase (PGM) 
Phosphogluconate Dehydrogenase (PGDH) 
Sorbitol Dehydrogenase (SDH) 
Superoxide Dismutase (SOD) 



1.8.1.4 


Т0ЯНС1 


3.1. 1.- 


ТСАГС 


5.3.1.9 


TCATC 


1.1.1.30 


TC/TC 


1.1.1.42 


TC/TC 


3.4.13.11 


TG^HCI 


5.4.2.2 


TG^HCI 


1.1.1.44 


TC/TC 


1.1.99.21 


TG/THCI 


1.15.1.1 


ТСЛ"С 



variance matrix of size-free residuals was then 
used in a discriminant analysis (DA). After ex- 
traction of the discriminant factors, squared 
Mahalanobis distances (Manly, 1994) be- 
tween the centroids of the point clouds were 
calculated and evaluated by NMDS/MST and 
UPGMA clustering using NTSYS v1.8 (Rohlf, 
1993). The variables that contributed most to 
the separation of the different groups in the DA 
were subjected to a multivariate analysis of 
variance (MANOVA) followed by a Scheffé 
test. When necessary, variables were trans- 
formed to meet the parametric assumptions of 
normality which was tested using the Kol- 
mogorov-Smirnov test. All computations were 
done with the the software package STATIS- 
TICA v5.1 (StatSoft Inc., 1995) and SAS v6.1 
(SAS Institute Inc., 1989). 

RESULTS 
Allozyme Analysis 

Ten enzyme systems, coded by 11 putative 
loci, were surveyed (Table 2). Sample sizes 
(N), allele frequencies and values for H^, H^, 
A and F|g are given in Table 3. Five loci were 
fixed (PEP, SDH and SOD) or nearly fixed 
(one heterozygote for IDH and GPI) for the 
same allele in all populations. After Bonferroni 
correction (a = 0.05), the remaining six loci 
showed significantly (p < 0.01) different allele 
frequencies among populations. Five popula- 
tions (AR1, AR2, AV, AM) also showed signif- 
icant deviations (after Bonferroni correction) 
from HW expectations at either HBDH or 
EST-2 (both loci in population AM). The inter- 
pretation of the HBDH zymograms was 
straightfonл/ard, yet no heterozygotes could 
be detected for the two fastest electromorphs 
that occurred at high frequencies in the three 
westernmost populations (AR1 , AR2 and AM; 
Table 3). Genetic variability within populations 



was generally low with mean values for A and 
Hg of 1 .27 (range: 1 .1 -1 .6) and 0.062 (range: 
0.005-0.194) respectively, and with the high- 
est values observed in population AM (Table 
3). 

There were no diagnostic alleles in Belgian 
/. isognomostoma. Nevertheless, after Bon- 
ferroni correction (a = 0.05), these animals 
were differentiated from all other populations 
(except El, but this may be attributed to the 
small sample size of this population) by a sig- 
nificant allele frequency heterogeneity at 
HBDH (p<0.01). 

The various graphical representations 
(UPGMA, NMDS/MST) of the genetic dis- 
tances (Table 4) showed the same general 
picture presented in Figure ЗА, where popula- 
tions are grouped according to regions. F-sta- 
tistics confirmed this pattern (Table 5). Fg-p 
values were significantly (p < 0.01) higher 
than zero (mean Fg-p: 0.550) at all six poly- 
morphic loci (after Bonferroni correction), indi- 
cating strong population differentiation. Over 
all loci, the between-regions component (Fp-^) 
accounted for 86% of the total variation (mean 
Fp^-p: 0.480; mean Fg^: 0.152). Also when re- 
gions with a single population (AK & AM) were 
included in the closest adjacent region (AKA & 
AV respectively), Fp-p still accounted for 74% 
of the total variation (Fp|-p=0.418, Fgp=0.241). 
There was a weak, though significant correla- 
tion (r = 0.53; p < 0.01) between geographic 
distances and Fg-p suggesting a pattern of 
"isolation by distance" (Wright, 1978). 

Although there was only a weak correlation 
between the genetic distance matrices ob- 
tained from lEF and PAGE (r = 0.48; p < 0.01 ), 
lEF (results not shown) yielded similar popu- 
lation groupings as PAGE. The two Belgian 
populations had the lowest mean number of 
EST bands with lEF (except for AVI). How- 
ever, the mean number of EST bands were 
not significantly correlated (p > 0.05) with mul- 



VAN RIEL ET AL. 



^ — ш 



C\J 1^ ■.- 00 00 CM 

00 о ■>- со Г-- C\J 

1- 00 о о (M r^ 

'^ ö ö ö ö юоо 

■^ I -^ 



C4J 00 о 

00 '- Ю 

■■- 00 00 

ö ö ö in 



00 C\J 
h- CVJ 

y- 00 



о 

I 8 



CO t^ ^i 

00 •>- I ■* 
t^ CM I C\J 



Ю 1Л 
O) о 

о o> 



о 

8 I 



Г-- со 1^ in 

CD ^J- in I ■* 

'i '- 00 I CM 



en •■- CD 

00 ■■- CD 

^ in 00 

Ö CD CD CD 



in Ю in 

h- CM CO 

T- oo oo 



о '- о о 



•^ со M- 1^ 
7- h- •.- о 
о О) о о 



Г-- о CD СЭ о г- т- 



о 
о 
о 








CD 

со 


CD 

со 


^ 




о 
о 
о 


^ '^ 






;: 


CD 


о 


о 

1 


;i 


■^ 


о 


со 

C\J 
05 


о 
о 




о 
о 
о 


1 






о 
о 
о 


со 


CD 

о 
о 
о 


Ö 

1 


о 


о 
о 


о 
о 




о 


о 
о 
о 



о 
о I 
о 



т- CD un 
г- CM ■-- 
CD о о 


CD -i- О) 
о 05 CM 
со CD in 


о 
о 
q 


CD CD О 

1 


'ï CD CD d ^ 

со со 


■^ 


1^ СО 

h- eg 
О) о 


in in 00 
in ^ 00 
'T in eg 


о 
о 
о 



со 1^ CD 

'sí- in ■^ 

r^ eg О 

r^ CD CD CD in 



OOCD ^^ — CD-^'sfl^'sI- 

OOO ^-^COCOt^CO'^CDCDinTi 

r-COCM СОСМГ^ СМГ^ OOi- pi- OCM 
CDOÖi-dcM^CMÖcDCDcbCDCD 



(D о о 
CD CD С) 



О О О О О 1- т- 



I О 



I о 



т- (D 1- 



ej О О О СО ■-- 



I о 



I ё I 



о 
о 
о 



т- О) 

■-- 00 

о CD 

CD о CD 



I О I 



00 

5 


CM 
00 


CD 




о 
о 
q 


1- CD 


d 


d 

1 


^ 


■^ 


00 

CD 
CO 


eg 

CO 


eg 

CD 

о 




о 
о 
q 


CO d 

CO 


d 


d 


о 


■^ 


о 
о 


1 






о 
о 



I о I 



'-^ '--CM '^ (D CM Tj- 

'^oo'^ooco-rregooincM 
■^CMinq'^qoqoqin 
T-'d^cM-r^dddddd 



^^Ю 00 о ■^ 
.— CM — en CO •■- h- CO 

^CMcor^inoooqoo 
•r^dcDi-^i-ddddd 



^^CO CO CO CO о 

.-^00 -^-^ ooi- ---I- T-o 
T^i-cocoi-coqoqoo 



^^ ^~, in in in in r^ 

'--CD coco r^o oo oo 

c\ic\iegoo-'-qoooo 

'-dcMCM'T-dddddd 



. — . ,-^ CD CD CD ■^ r^ 

---oo coeg incD coin сосм 

cOi-T-cooocMqoqo-r^ 

i-OT^T^T-T^ddddd 



.-. -^CO CO '^ ■* CD 

— i-CMoo'^cocMcoegeg 
cMi-^q^coqooooo 
^dcM i--r-dddddd 



.-^00 00 CO 00 о 
.— ^~. in^-i-T-T-O 

T-T-'icoeg-^qqoqo 
■r^dcMCM -r-'dddddd 



CO 
CD 
CO 


о 

CD 


CD 

00 

eg 




1 


о 
о 
q 




о 
о 
о 


'i d 


d 


d 


in 




■^ 




in -г-' 


Ю 
CD 
CO 


Ю 
CO 
CD 


00 
CD 
Ю 




00 
CO 

in 


eg 

CD 


о 
о 
q 


о 
о 
о 


CD d 
CM 


d 


d 


CD 
CM 


d 


d 


■^ 


CD 1- 

eg 


CO 

о 


CD 
CD 

en 


о 
о 
о 






CD 
CM 
CM 


b 
о 
о 


о 
о 
о 


eg d 


d 


т^ 


1- 


d 


d 


т^ 


eg т-' 



о о in ^^ . — ,->- Г^ см CD см 

ininO ^^COTj^cDCDCOOO-^in 

r^-ogq-^egincor^ г^оооосм 
ddd-r-'degeg-r^dddddd 



со i^ со _ ^^со in in к со 

т-0ОГ~- ,-- OOCDCOincOCDrJ-CO 

qqqcoeginr^inr^qoqo-r^ 



^^ .-^eg eg in in со 

-—со OOCDOCOCO^-^OO 
•.-T-LncDCOinOOOOCM 



I о 



— ^-К h- СП о г- 

— vin eg(DO->-i-oocDo 

едт-оосо-.--*оооооо 



—. --.о о 00 eg о 

— -О CDOOOOC0C0O 

eg-f-cooooooooo 
T-^dd-r^-r^ddddd--- 



< m ü z < CD о z < CD z < m ü z<cû z < m ü 





T- 


CM 


X 


X 




X 


1-!- 


H- 


Q 


Q 


^ 


Q 


COÜ) 


СЯСЛ 


сяШ 


V)(J 


слО 


Û 


LL Ш 


LL Ш 


U. X 


LL Q. 


LL Q. 



u. < 



GENETIC VARIATION IN ISOGNOMOSTOMA 



о 
< 

s 

о 
о " 

с ^ 

§^ 
~" О 

—- jr 

Ч- о 

^^ 

^\ь 

со О) 

1 Б 

iÇ со 

â| 

ош 

= oÖ 

"3 со 

с N 

CD -Ь: 
ф = 

JD СО 

со го 

^^ с:п 
си со 
о^ 

s 5 

w о 
^ф 

ф8 



< Ф 



COCOOCDCDLO-'-O^COr^'* 

cû^co(^J^-(мcмcт)Cлcr)C£)■l- 

ООООООООООО-г^ 
dcDcbÖÖdcDÖCDCDÖd 



■^-^-o•^(^Jcûcз5^0чlOт- 
coo^-t^ooœcor-i-i-Ln 

CMC\Ii--'--'--^-^CMCOCOO 

ööööööööööö 



I ^^ 
I CM 



СОСОСОООООСХЗЮЮГ^Г^ CJ)Cr> 

сосоооослкюоосхз I cû-r- 

T-T-T-T-i-OOt-----^ I t-CM 

dddcDCDÖddcDCD ö ö 



CD^i-CM-1 -СЛОООО I 1ЛСОО 
T-T-T^-r-T-OOOO I (TJ'ÍCO 

ddddddddd ö ö ö 



cû^■.-(^J1-cJ>cзoo I соююсз) 

i-i-T^i-T^OOO I OCOTfCvI 

dddddddd dddd 



O^T-OOCOOin COCD(330OCO 

r^mcMC\jc\jooo I ocdt-cnjcj) 
1-1-1-1-1--I-0 I ■^-oco^^c^J 



о о о о о о о 



о о о о о 



OCOCDOJI^íM CDCOf^i-CDCX) 

OOOOOO I CMCNJCMCMCO-'- 



o o o o o o 



OOOOOO 



r-o^cj5'^ оокюсмсо<>ат- 
ooooo I т-(^JcмcJ(^J<r>cм 
Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö 



cocineo ■*СХ)Г^С\]-1-С7>Г^Ю 

OOOO I i-i-C0<ncOCM(^i- 

dddddddd 



OOOO 



r^CJ)0 Г-^Г--Г--1--.--.-ЮСО 

^-c^JO , ююг^с>и-^-^сх)^о 

ooo ! o-t-T-cocococgcocM 

Ö Ö Ö ööööööööö 



■^ t^ LncnOJtDC\JCM'*T-OCO 

h-CN I CDO^mcNOOK-^OJ 

OO I O-'--'--'-C0C0C0C\JC0CM 

Ö Ö ÖÖÖÖÖÖÖÖÖÖ 



un ^Г^СХЗСОСОЮГ^С731-СОС31 

■■- I юсосюо-^юсосо-^!^--- 

O I ■■-■'-■'-eMCNJCOCOCOCOCOCM 

d ööööööööööö 



I i_i 1— c'j c'j c_; ■>— u; i'j ■^ i'j ;_) ■^ 

I ■'-(MCMCMOJCNcocococo^cTM 

ÖÖÖÖÖÖÖÖÖÖÖÖ 



■^C\J <T-C\J-,-CM^ 

a:a:-.-(Mco-,-cM^i¿:i£:>>^ 

<<11ХШШ<<<<<< 



VAN RIEL ET AL. 



AV2 



AKA1 




(A) 




(В) 

FIG 3 Three dimensional plots of Cavalli-Sforza & Edwards' (1967) chord distance (A) and squared Maha- 
lanobis distance (B) аглопд 13 populations of /. isognomostoma obtained via nonmetric multidimensional 
scaling with a superimposed minimum spanning tree. Population codes are given in Table 1 . 



GENETIC VARIATION IN ISOGNOMOSTOMA 



TABLE 5. F-statistics for all polymorphic loci (variation at GPI and IDH was 
negligible). F|-p, F|g and Fg-^ (left column) were calculated following Weir & 
Cockerham (1984). Fg-p values in tine right column and the partitioning of 
Fgj into a within- (Fg^,) and between-region (Fp.p) component were calcu- 
lated according to Wright's (1978) method (Swofford & Selander, 1981). 
Significant departures from zero after Bonferroni correction are marked 
with an asterix. 



Locus 


F,T 


F,s 


F. 


3T 


FsR 


Frt 


DDH 


0.807* 


0.022 


0.802* 


0.872* 


0.035 


0.867* 


EST-1 


0.593* 


0.167 


0.511* 


0.392* 


0.333* 


0.089* 


EST-2 


0.725* 


0.655* 


0.203* 


0.215* 


0.125* 


0.102* 


HBDH 


0.943* 


0.884* 


0.512* 


0.539* 


0.078* 


0.500* 


PGDH 


0.793* 


-0.115 


0.796* 


0.761* 


0.016 


0.758* 


PGM 


0.120* 


-0.111 


0.208* 


0.197* 


0.113* 


0.095* 


All: 


0.718* 


0.373* 


0.550* 


0.568* 


0.152* 


0.480* 



tilocus heterozygosities (H^) or mean number 
of allozyme bands found with PAGE (Table 3). 

Morphometric Analysis 

Using every population as a separate group 
in the DA, the first three roots had eigenval- 
ues > 1 , together explaining 72% of the varia- 
tion. The highest loadings were associated 
with shell measurements (DIA, HA and HS in 
the first root; HB and HA in the second root). 
Although all variables in the three roots con- 
tributed significantly (p < 0.05) to the separa- 
tion of the populations, generalizations that 
might appear from the canonical variables 
were not always significant for all compar- 
isons according to the Scheffé test. This sug- 
gested a more complex pattern of differentia- 
tion. However, the NMDS/MST graphs and 
UPGMA clustering based on the Mahalanobis 
distances (Fig. 3B) revealed, once again, that 
most variation was partitioned between re- 
gions (correlation with the matrix of genetic 
distances, r = 0.45; p < 0.01 ). 



DISCUSSION 

In contrast to chromosomal inversions, ho- 
mozygosity at allozyme loci is not directly cor- 
related with the position of a population near 
the periphery of a species' range (Carson, 
1955; Tigerstedt, 1973; Levin, 1978; Brus- 
sard, 1984), but is mostly attributed to the ef- 
fects of inbreeding and genetic drift in isolated 
populations (Shumaker & Babble, 1980; 
Coutellec-Vreto et al., 1994; Hafner & Shus- 
ter, 1996; Rankevich et al., 1996; Leijs et al., 
1999). Hence, the relatively low levels of ge- 



netic variation in most /. isognomostoma pop- 
ulations studied here might reflect the number 
or size of bottlenecks (founder events) that 
were involved in the colonization of new areas 
during inter- or postglacial periods (Hewitt, 
1996; Leijs et al., 1999), so that subsequent 
genetic differentiation through isolation by dis- 
tance might have resulted in the current pop- 
ulation structure (Wright, 1978). Although this 
seems the most plausible scenario for neutral 
genetic markers, such as allozymes, the role 
of selection cannot be excluded (Ayala, 1999; 
Arter, 1990). 

High levels of allozyme differentiation, even 
between adjacent populations, is a common 
phenomenon in land snails, but mean Fg-^ in /. 
isognomostoma (0.550) exceeds the values 
found for most other outcrossing pulmonate 
land snails, such as Cepaea nemoralis (Fg^ = 
0.308), C. hortensis (Fg-^ = 0.206) (Ochman et 
al., 1987), Cristalabrum primum (Fgy = 0.450) 
(Woodruff & Solem, 1990), Helix aspersa (Fg-p 
= 0.162) (Selander & Kaufman, 1975), Man- 
darina aureola (Fg-,- = 0.280), M. ponderosa 
(Fg^ = 0.130) (Chiba, 1993), and Solatopupa 
similis (Fgj = 0.568) (Boato, 1988). 

Assuming no methodological flaws (sam- 
pling error, interpretation of gels), the het- 
erozygote deficiency at HBDH in the periph- 
eral populations (AR1 -2) and population AM is 
currently difficult to explain, particularly since 
the overall heterozygozity (H^) in population 
AM is exceptionally high compared to the 
other studied populations. The high H^ in AM 
suggests that low levels of genetic variation 
are not a property of the species, but rather of 
local populations. Although we cannot ex- 
clude autogamy, heterozygous individuals at 
four other loci (PGM, DDH, PGD & EST-1) 



10 



VAN RIEL ET AL. 



and HW equilibrum in most populations, sug- 
gest that autogamy is not the general mode of 
reproduction. Multilocus heterozygosity levels 
are also within the range found in other out- 
crossing helicid snails (e.g., Nevo, 1978; Se- 
iander & Ochman, 1983; Falniowski et al., 
1993). The incongruent results between direct 
(PAGE) and indirect (lEF) estimates of het- 
erozygosity are probably because lEF of EST 
provides both genotypic and non-genetic 
data, so that non-Mendelian variation will also 
contribute to variability (e.g., Jordaens et al., 
1999, and references therein). Nevertheless, 
since the population groupings found with 
PAGE and DA were also found with lEF, the 
use of lEF profiles of EST may be useful for 
studying intraspecific variation. Despite the 
fact that the pattern of morphological differen- 
tiation is in good agreement with the elec- 
trophoretic data, this might also have resulted 
from adaptation to local climatic and/or eco- 
logical conditions or differences in age struc- 
ture. Since the Belgian populations are only 
slightly differentiated from neighbouring popu- 
lations and because they were only discov- 
ered in 1970, it is also possible that they have 
been introduced only recently. 

ACKNOWLEDGEMENTS 

PVR is funded by an IWT scholarship. This 
work was supported by the project "Genetic 
characterization of peripheral and isolated an- 
imal populations in Belgium, in execution of 
the Convention of Rio" (RBINSc) and FWO 
grant 2.0023.94. We thank H. Van Paesschen 
for his help with the illustrations. 



LITERATURE CITED 

ALZONA, C, 1971 , Malacofauna Itálica, catalogo e 
bibliografía del moíluschi viventi, terrestri e d'ac- 
qua dolce. AW della Société Italiana di Scienze 
Naturali e del Museo Cívico di Storia Naturale di 
Milano, 111: 1-433. 

ANONYMOUS. 1992, Convention on Biological Di- 
versity (^ 992). 
http://www.biodiv.org/chm/conv/default.htm. 

ANT, H.. 1963, Faunistische, ökologische und tier- 
geographische Untersuchungen zur Verbreitung 
der Landschnecken in Nordwestdeutschland. Ab- 
handlungen aus dem Landesmuseum für Natur- 
kunde zu Münster, 25: 1-121. 

ARTER, H. E., 1990, Spational relationship and 
gene flow paths between populations of the 
alpine snail Arianta arbustorum (Pulmonata; He- 
licidae). Evolution. 44: 966-980. 



AYALA, R J., 1999, Molecular clock mirages. Bio- 
Essays. 2^■.7^ -75. 

BACKELJAU. T, 1989, Electrophoresis of albumen 
gland proteins as a tool to elucidate taxonomic 
problems in the genus Arion (Gastropoda, Pul- 
monata). Journal of Medical and Applied Mala- 
cology 1: 29-41. 

BACKELJAU, T, K. BREUGELMANS, H. LEIRS, T 
RODRIGUEZ. D. SHERBAKOV, T SITNIKOVA, 
J.-M, TIMMERMANS. J. L. VAN GOETHEM & E. 
VERHEYEN, 1994, The application of isoelectric 
focusing in molluscan systematics. Thie Nautilus, 
Supplement, 2: 156-167. 

BOATO, A., 1988, Microevolution in Solatopupa 
land snails (Pulmonata Chondrinidae): genetic di- 
versity and founder effects. Biological Journal of 
ttie Linnean Society 34: 327-348. 

BRUSSARD, P. R, 1984, Geographic patterns and 
environmental gradients: the central-marginal 
model in Drosophila revisited. Annual Review of 
Ecology and Systematics. 1 5: 25-64. 

CARSON, H. L., 1955, The genetic characteristics 
of marginal populations of Drosophila. Cold 
Spring Harbour Symposia on Quantitative Biol- 
ogy 20: 276-287. 

CARSON, H. L., 1 975, The genetics of speciation at 
the diploid level. American Naturalist, 109: 83- 
93. 

CAVALLI-SFORZA, L. L. & W. R EDWARDS, 1967, 
Phylogenetic analysis: models and estimation 
procedures. Evolution. 21: 550-570. 

CHIBA, S., 1993, Modern and historical evidence 
for natural hybridization between sympatric 
species in Mandarina (Pulmonata: Camaenidae). 
Evolution, 47: 1539-1556. 

COUTELLEC-VRETO, M. A., A. GUILLER & J. 
DAGUZAN, 1994, Allozyme variation in some 
populations of the freshwater snails Lymnaea 
peregra. L. auricularia & L. stagnalis (Gas- 
tropoda: Pulmonata). Journal of Molluscan Stud- 
ies. 60: 393-403. 

FALNIOWSKI, A., A. KOZIK, M. SZAROWSKA, M. 
RAPALA-KOZIK & I. TURYNA, 1993, Morpholog- 
ical and allozymic polymorphism and differences 
among local populations in Bradybaena fruticum 
(O. R MÜLLER, 1777) (Gastropoda: Stylommato- 
phora: Helicoidea). Malacologia, 35: 371-388. 

FRANKHAM, R. & K. RALLS, 1998, Inbreeding 
leads to extinction. Nature, 392: 441-442. 

GOUDET J., 1995, FSTAT (version 1.2): A com- 
puter program to calculate F-statistics. Journal of 
Heredity 86: 485-486. 

HAFNER, D. J. & С J. SHUSTER, 1996, Histoncal 
evidence of western peripheral isolates of the 
least shrew, Cryptotis parva. Journal of Mammal- 
ogy 77: 536-545. 

HARRIS, H. & D. A. HOPKINSON, 1976, Handbook 
of enzyme electrophoresis in human genetics. El- 
sevier, Amsterdam. 410 pp. 

HEWITT, G. M., 1996, Some genetic consequences 
of ice ages, and their role in divergence and spe- 
ciation. Biological Journal of the Linnean Society, 
58: 247-276. 



GENETIC VARIATION IN ISOGNOMOSTOMA 



11 



JORDAENS, K., P. VAN RIEL, R. VERHAGEN & T 
BACKELJAU, 1999, Food-induced esterase 
electromorphs in Carinarion spp. and their effects 
on taxonomic data analysis (Gastropoda, Pulmo- 
nata, Arionidae). Electrophoresis, 20: 473-479. 

KERNEY, M. P., R. A. D. CAMERON & J. H. JUNG- 
BLUTH, 1983, Die Landschnecl<en Nord- und 
Mitteleuropas. Paul Parey Verlag, Hamburg. 384 
pp. 

LEBERG, P. L., 1992, Effects of population bottle- 
necks on genetic diversity as measured by al- 
lozyme electrophoresis. Evolution, 46: 477-494. 

LEUS, R., R. С VAN APELDOORN & R. BIJLSMA, 
1999, Low genetic differentiation in north-west 
European populations of the locally endangered 
root vole, Microtus oeconomus. Biological Con- 
servation, 87: 39-48. 

LESICA, P. & F. W. ALLENDORF, 1995, When are 
peripheral populations valuable for conserva- 
tion? Consen/ation Biology. 9: 753-760. 

LEVIN, D. A., 1970, Developmental instability and 
evolution in peripheral isolates. American Natu- 
ralist, 104:343-353. 

LEVIN, D. A., 1978, Genetic variation in annual 
Phlox: self-compatible versus self-incompatible 
species. Evolution. 32: 245-263. 

MANLY, B. F J., 1994, Multivariate statistical meth- 
ods. A primer Chapman & Hall, London. 215 pp. 

NEEL, J. V & R. H. WARD, 1 972, The genetic struc- 
ture of a tribal population, the Yanomama Indi- 
ans. VI. Analysis by F-statistics (including a com- 
parison with the Makiritare and Xavante). 
Genetics, 72: 639-666. 

NEI, M., 1978, Estimation of average heterozygos- 
ity and genetic distance from a small number of 
individuals. Genetics, 89: 583-590. 

NEVO, е., 1978, Genetic variation in natural popu- 
lations: patterns and theory. Theoretical Popula- 
tion Biology, 13: 121-177. 

OCHMAN, H., J. S. JONES & R. K. SELANDER, 
1987, Large scale patterns of genetic differentia- 
tion at allozyme loci in the land snails Cepaea 
nemoralis and Cepaea hortensis. Heredity 58: 
127-138. 

OLSSON, I., U. B. AXIÖ-FREDRIKSSON, M. 
DEGERMAN & B. OLSSON, 1988, Fast horizon- 
tal electrophoresis. Isoelectric focusing and Poly- 
acrylamide gel electrophoresis using PhastSys- 
tem. Electrophoresis. 9:16-22. 

RANKEVICH, D., L. BATIA, E. NEVO, A. BEILES & 
Z. ARAD, 1996, Genetic and physiological adap- 
tations of the prosobranch landsnail Pomatias 
olivieri to microclimatic stresses on Mount Car- 
mel, Israel. Israel Journal of Zoology, 42: 425- 
441. 

RAYMOND, M. & F. ROUSSET 1995, GENEPOP 
(version 1.2): population genetics software for 
exact tests and ecumenicism. Journal of Hered- 
ity 86: 248-249. 



RICE, W. R., 1989, Analyzing tables of statistical 
tests. Evolution. 43: 223-225. 

ROHLF, F. J., 1993, NTSYS-pc version 1.80. Ap- 
plied Biostatistics Inc., Setauket. 

SACCHERI, I., M. KUUSSAARI, M. KANKARE, P. 
VIKMAN, W. FORTELIUS & I. HANSKI, 1998, In- 
breeding and extinction in a butterfly metapopu- 
lation. Nature, 392: 491-494. 

SAS INSTITUTE INC., 1989, SAS/STAT User's 
Guide, Version 6, 4th Ed. Cary, North Carolina, 
USA. 

SELANDER, R. K. & W. KAUFMAN, 1975, Genetic 
structure of populations of the brown snail (Helix 
aspersa). I. Microgeographic variation. Evolution, 
29:385-401. 

SELANDER, R. K. & H. OCHMAN, 1983, The ge- 
netic structure of populations as illustrated by 
molluscs. Isozymes: Current Topics In Biological 
and Medical Research, 10: 93-123. 

SHUMAKER, K. M. & G. R. BABBLE, 1980, Pat- 
terns of allozymic similarity in ecologically central 
and marginal populations of Hordeum jubatum in 
Utah. Evolution. 34: 110-116. 

SOULÉ, M., 1973, The epistasis cycle: a theory of 
marginal populations. Annual Review of Ecology 
and Systematics, 4: 165-187. 

STATSOFT 1995, Statistica for Windows version 
5.0. 3958 pp. 

SWOFFORD, D. L. & R. B. SELANDER, 1981, 
BIOSYS-1 : A fortran program for the comprehen- 
sive analysis of electrophoretic data in population 
genetics and systematics. Journal of Heredity, 
72:281-283. 

TEMPLETON, A. R., 1980, The theory of speciation 
via the founder principle. Genetics, 94: 1011- 
1038. 

TIGERSTEDT, P. M. A., 1973, Studies on isozyme 
variation in marginal and central populations of 
Picea abies. Hereditas, 75: 47-60. 

VAN BELLE, R. A., 1970, Isognomostoma Isogno- 
mostoma (GMELIN, 1790) een nieuwe landslak 
voor België. Gloria Marls. 6: 117-118. 

WEIR, B. S. & С С. COCKERHAM, 1984, Estimat- 
ing F-statistics for the analysis of population 
structure. Evolution, 38: 1358-1370. 

WOODRUFF D. S. & A. SOLEM, 1990, Allozyme 
variation in the Australian camaenid land snail 
Cristalabrum primum: a prolegomenon for a mol- 
ecular phylogeny of an extraordinary radiation in 
an isolated habitat. The Vellger, 33: 129-139. 

WRIGHT S., 1978, Evolution and genetics of pop- 
ulations: Volume IV: Variability within and among 
natural populations. The University of Chicago 
Press, London. 580 pp. 

Revised ms. accepted 19 May 2000 



MALACOLOGIA, 2001, 43(1-2): 13-23 

FACTORS AFFECTING THE DISTRIBUTION OF POMACEA CANALICULATA 
(GASTROPODA: AMPULLARIIDAE) ALONG ITS SOUTHERNMOST 

NATURAL LIMIT 

Pablo R. Martin, Alejandra L. Estebenet & Néstor J. Cazzaniga 

Universidad Nacional del Sur, Departamento de Biología, Bioquímica y Farmacia, San Juan 
670, 8000 Bahía Blanca, Argentina; pmartin ©criba. edu.ar 

ABSTRACT 

The Argentinean apple snail Fornácea canalicuiata is a recent invader in paddy fields in most 
Southeast Asian countries, where it has dispersed explosively since about 1980. Determinants 
of the natural range of F canalicuiata in its original area are poorly understood. In this study, fac- 
tors affecting its distribution in the southern limit of its native area in Buenos Aires Province were 
investigated. Salty, alkaline, poorly vegetated aquatic environments with high desiccation risk in 
the western part of the study area probably act ae a natural barrier for its dispersal toward the 
south and west. Sites inhabited by F canalicuiata are generally shallow, quiet, turbid, with low 
Na"'/(K'' + Mg*^) ratios compared to the uninhabited sites. Contrary to previous statements, F 
canalicuiata is frequently found in streams, where it reaches the highest densities. Most of the 
inhabited environments are located on the northern slope of the Tandilia and Ventanía moun- 
tains, this physical barrier and not temperature, being probably the main factor impeding the 
species' spread southwards in Buenos Aires Province. Fornácea canalicuiata also inhabits iso- 
lated sites on the southern slopes of these mountains, where it appears to have been introduced. 
Its spread is slow within and among water bodies in this area. Repeated introductions, tropical 
climate, and integrated and flood-prone drainage systems probably account for the faster ex- 
pansion of this species in southeastern Asia. 

Key words: apple snail, native distribution, ecological factors, natural barriers. 



INTRODUCTION 

The Argentinean apple snail Pomacea 
canalicuiata (Lamarck, 1822), is well known 
as a recent invader in paddy fields in most 
Southeast Asian countries (Halwart, 1994). 
The evidence of damage to aquatic crops 
(Yusa & Wada, 1999) and its ability to dis- 
place native species (Cowie, 1995) are of se- 
rious concern, especially in countries where 
rice is the staple food. The potential introduc- 
tion of apple snails to Australia prompted 
Baker (1998) to evaluate the extent of sus- 
ceptible areas in that country. The model used 
to determine the potential area that could be 
invaded was based mostly on published infor- 
mation on the climatic range of the species in 
South America. Baker (1998) predicted that 
other as-yet uninvaded Asian countries are 
potentially at risk of invasion. 

Nevertheless, the factors determining the 
natural range of Pomacea canalicuiata in 
its native region are poorly understood. The 



habitat of this species has usually been de- 
scribed only qualitatively, with no informa- 
tion on physico-chemical conditions. The spe- 
cies has been described as a lentic dweller, 
mostly inhabiting shallow lakes, ponds, and 
swamps (Hylton-Scott, 1 958). It has also been 
recorded from prairie streams and vegetated 
backwaters (Cazzaniga, 1987). 

For more than a century it has been known 
that the southern limit of the species— the 
southernmost apple snail in the world — is 
somewhere in the south of Buenos Aires 
Province, Argentina (d'Orbigny, 1847; Hylton- 
Scott, 1958). Cazzaniga (1987) mentioned P. 
canalicuiata from Calaveras stream (38° 
04'S-59°18'W), this being the most southerly 
locality known until now. 

Knowledge of the factors affecting the 
species' distribution at the southern edge of 
its natural range is of interest in understand- 
ing the factors determining its potential range 
in areas where it has been introduced re- 
cently. 



13 



14 



MARTINETAL. 



MATERIALS & METHODS 

The sampling region extended from 36°S to 
39"S in southern Buenos Aires Province. This 
range covers the southern part of the pampas 
(approximately 120,000 square kilometers) 
and includes the only two mountainous areas 
in the province (Ventanía and Tandilia moun- 
tains). Rivers and streams have scant and 
very variable water flow, with a pluvial hydro- 
logical regime. The typical lentic habitats in 
the pampas are small, shallow lakes, many of 
them of temporary nature (Toresani et al., 
1994). 

The climate of the region is temperate, with 
a marked humidity gradient from the NE 
(mean annual rainfall 900 mm) to the SW (600 
mm). The whole region lies within the 14"C 
and 16'C annual mean isotherms. 

The sampling scheme included all the main 
drainage basins and many isolated streams 
and lakes. The limits of the sampling region 
were set by reference to published literature 
and personal experience: apple snails live al- 
most everywhere in Buenos Aires Province to 
the north of 36°S latitude (Hylton-Scott, 1958) 
and are naturally absent to the south of 38°S 
(Cazzaniga, 1981, 1987). They have never 
been found in La Pampa Province (i.e., west 
of 63'W), the westernmost records being two 
ponds located near 62°40'\/V (Estebenet & 
Cazzaniga, 1993). 

Seventy-six sites were visited in February 
and March 1998 (late summer) (Fig. 1). More 
complex drainage basins (i.e., with third- or 
fourth-order streams) were sampled at more 
than one location. 

The local reproductive season of P. canalic- 
ulata runs from late October to early April 
(Hylton-Scott, 1958; personal observations). 
During this period, the conspicuous, aerial, 
pink egg masses are an easily visible sign of 
the presence of apple snails, even if the snails 
are in low densities. 

Two people carefully inspected up to 200 m 
of the shores of every water body investi- 
gated, searching for egg masses on the emer- 
gent aquatic vegetation and other substrata. 
Living apple snails were searched for among 
the submerged vegetation, under stones, or 
buried in the substratum. Surrounding land 
was searched for empty shells. We consid- 
ered as inhabited by P. canaliculata only the 
sites where egg masses or live snails were 
found. Where possible, relative abundance of 
living apple snails was estimated by reference 



to search effort (number of snails >20 mm 
caught per hour). 

We recorded the number of other species of 
aquatic snails and the number of plant 
species (submerged, floating or emergent 
macrophytes) at every site. Also 16 environ- 
mental variables were recorded. Depth (m) 
and surface water velocity (m.s^^) were mea- 
sured at different points within each site. Con- 
ductivity (mS.cm^^) and pH were determined 
in situ with a multimeter (Horiba U-10). A sub- 
surface water sample for chemical analyses 
was collected at each site, immediately fixed 
with formaldehyde and stored in a refrigerator. 
Total and volatile suspended matter (g.i~^) 
were determined according American Public 
Health Association (1 981 ) methods. The con- 
centrations (meq.r^) of Na\ Ca^^ Mg^^ K* 
and SO4" were measured with an inducted 
plasma emission spectrometer (Shimadzu 
ICPS 1000-111), and Cr, СОз= and HCO3" 
were measured by titration. 

The dominant substratum was character- 
ized on an arbitrary scale: 1 (sapropel, mud), 
2 (sand), and 3 (pebbles, boulders, lime- 
stone). The trophic resource availability was 
coded as 1 (low), 2 (medium), and 3 (high), 
through a visual estimation of the abundance 
of macrophytes, microphytes, riparian vege- 
tation and their debris. 

The environmental variables and the 
species richness of macrophytes and snails 
were standardized and examined by stepwise 
discriminant analysis (SDA) to find linear 
combinations of variables maximizing dis- 
tances between groups of sites. Group sizes 
were used to determine group membership 
probabilities. The variables were included one 
by one according to their individual discrimi- 
natory power and they were kept or removed 
after assessing if they improved or not the 
total discriminatory power. 



RESULTS 

Pomacea canaliculata was recorded at 25 
sites. The absence of egg masses during the 
sampling period, which was within the repro- 
ductive season, proved to be a good indicator 
of the absence of the species; all habitats 
where apple snails were collected had egg 
masses, and in only two places where we 
found eggs were we unable to find live snails 
or empty shells. 

Six other species of snails were found in the 



DISTRIBUTION OF POMACEA 



15 




FIG. 1 . Map of Buenos Aires Province showing the 76 sites visited (inset map of Argentina). Squares and cir- 
cles represent lotie and lentic habitats, respectively. Empty symbols indicate sites surveyed but not inhabited 
by any species of snail. 



16 



MARTIN ETAL. 



16 

14 

12 

10 

8 

6 

4 

2 

О 

2 

4 



I with snails (СС: iœ%) 
: without snails (CC: 64.7%) 




Canonical con-elation = 0.759 
Wilks' Lambda = 0.423*" 



-4.5 ^.5 -2.5 -1.5 -0.5 0.5 1.5 

discriminant score 



2.5 



3.5 



45 



variables 

TcDF 



HCO, 



Mg* 



-0.631 -0.187 



MSR Ca 

0.509 0.363 



FIG. 2. Frequency histograms of discriminant scores for sites not inhabited (n = 17) and inhabited (n = 59) 
by any species of snail (CC: percentage of correctly classified cases; r^^pp: correlation between discriminat- 
ing variables and canonical discriminant function; MSR: macrophyte species richness). 



area. The most widespread species (24 to 32 
sites) were Chilina parchappii (d'Orbigny, 
1835) (Chilinidae), Biomphalaria peregrina 
(d'Orbigny, 1835) (Planorbidae), and Heleo- 
bia parchappii (d'Orbigny, 1835) (Hydrobi- 
Idae). Infrequent species (eight sites or less) 
were Gundlachia concéntrica (d'Orbigny, 
1835) (Ancylidae), Lymnaea viator (d'Or- 
bigny, 1835) (Lymnaeidae) and Ptiysa sp. 
(Physidae; may be an introduced species). 

No snail species were recorded in 17 of the 
76 sites (Fig. 1). A stepwise discriminant 
analysis was performed with the environmen- 
tal variables (snail species richness excluded) 
to charactehze the sites with and without 
snails. High values of Ca"""" and macrophyte 
species richness, as opposed to high concen- 
trations of HCO3" and Mg"^, characterize the 
sites inhabited by at least one species of 
snail; eleven sites that were correctly classi- 
fied as not inhabited were considered not 
habitable (Fig. 2), and therefore excluded 
from further analyses (one stream and ten al- 
kaline lakes, nine of them located on the west 
end of the studied zone). 



Table 1 summarizes mean and extreme val- 
ues of selected environmental variables in the 
sampled sites, discriminated as not habitable, 
potentially habitable for freshwater snails and, 
among the latter, those inhabited or not by P. 
canaliculata. 

To characterize the habitats with and with- 
out apple snails (n = 65; Fig. 3), we performed 
a stepwise discriminant analysis with the vari- 
ables used in the former analysis plus snail 
species richness. The variables Na"" and 
water velocity, as opposed to K"^, Mg"^"^, total 
suspended matter and depth, discriminate be- 
tween sites not inhabited and inhabited by P. 
canaliculata (Fig. 4). They mostly inhabit non- 
shallow sites, with null or low water velocity, 
high content of suspended material, and low 
NaV(K" + Mg"^) ratios (Table 1). 

Abundance was higher in streams (92.1 
snails. h^) than in lakes (41.3 snails. h"^) (t 
test for unequal vahances: t = 2.78, df = 
13.18, p < 0.02). The highest densities in the 
streams were found in mats of Ludwigia sp. 
(Onagraceae), where high numbers of apple 
snails were immersed in flocculent sediments 



DISTRIBUTION OF POMACEA 



17 



TABLE 1 . Mean and extreme values of selected environmental variables (conductivity values are given in 
mS.cm"\ ionic concentrations in meq.r\ depth in m, water velocity in m.s"^ and total suspended matter 
ing.r). 







Not habitable 


Habitable 


Not inhabited by 


Inhabited by 




All sites 


for snails 


for snails 


P. canaliculata 


P. canaliculata 


n 


76 


11 


65 


40 


25 


pH 


8.35 


9.03 


8.24 


8.17 


8.35 




7.30-9.90 


8.48-9.40 


7.30-9.90 


7.30-9.54 


7.30-9.90 


Conductivity 


3.50 


16.37 


1.32 


1.48 


1.06 




0.15-83.50 


2.10-83.50 


0.15-3.33 


0.15-3.33 


0.23-2.89 


Na" 


30.79 


160.29 


8.87 


10.34 


6.53 




0.47-820.00 


11.40-820.00 


0.47-28.61 


0.47-28.61 


0.85-19.84 


Ca"" 


1.39 


0.74 


1.49 


1.44 


1.59 




0.36-3.69 


0.36-1.47 


0.38-3.69 


0.45-2.94 


0.38-3.69 


Mg"" 


1.51 


2.14 


1.40 


1.31 


1.54 




0.33-4.84 


0.61-4.84 


0.33-2.81 


0.33-2.70 


0.56-2.81 


К" 


0.42 


1.57 


0.22 


0.20 


0.25 




0.04-6.66 


0.24-6.66 


0.04-0.60 


0.04-0.35 


0.07-0.60 


сг 


14.59 


79.62 


3.59 


4.07 


2.81 




0.44-389.60 


2.80-389.60 


0.44-11.44 


0.44-11.44 


0.52-9.96 


S04= 


6.76 


30.88 


2.68 


3.59 


1.23 




0.04-180.00 


1.74-180.00 


0.04-17.34 


0.04-17.34 


0.07-15.31 


С03~ 


1.29 


7.04 


0.31 


0.37 


0.22 




0.00-21.90 


0.53-21.90 


0.00-2.12 


0.00-2.12 


0.00-1.43 


нсоз= 


8.10 


19.43 


6.18 


6.36 


5.88 




1.10-33.80 


7.02-33.80 


1.10-11.40 


1.61-11.40 


1.10-9.95 


Na"/(K" + Mg"") 


10.03 


36.23 


5.60 


6.73 


3.78 




0.53-71.30 


4.87-71.30 


0.53-16.76 


0.59-16.76 


0.53-10.12 


K"/Na" 


0.040 


0.014 


0.044 


0.036 


0.057 




0.007-0.143 


0.008-0.036 


0.007-0.143 


0.007-0.113 


0.014-0.143 


Depth 


0.83 


0.70 


0.85 


0.73 


1.04 




0.15-3.00 


0.35-2.00 


0.15-3.00 


0.15-3.00 


0.30-1.70 


Water Velocity 


0.17 


0.02 


0.20 


0.22 


0.15 




0.00-0.77 


0.00-0.18 


0.00-0.77 


0.00-0.77 


0.00-0.67 


Mg""/Ca"" 


1.28 


2.95 


1.00 


0.93 


1.10 




0.43-7.81 


0.76-7.81 


0.43-3.06 


0.43-1.43 


0.52-3.06 


Total Suspended Matter 


0.023 


0.043 


0.019 


0.013 


0.029 




0.000-0.099 


0.015-0.099 


0.000-0.088 


0.000-0.062 


0.000-0.088 



rich in organic matter. The midstream surface 
velocity of the sampled streams was generally 
low (0.22 m.s"^ ± 0.03, mean ± SE), but oc- 
casionally apple snails were found adhered to 
different substrata in faster running water. 

The frequency of water bodies inhabited by 
P. canaliculata on both sides of the Tandilla 
and Ventanía mountains was clearly different 
(Fig. 3). Of the 31 habitable sites located to 
the north of the mountainous area, 19 (61%) 
were inhabited by apple snails (83% of the 
lentic habitats; 56% of the lotie ones). To the 
south of the mountains, only 18% of the sites 
had P. canaliculata: it was found in only six, 
mostly isolated locations in four different 
basins (from west to east: Chasicó, Sauce 
Grande, Quequén Grande and El Durazno). 

To test if differences between inhabited and 



not inhabited sites could be explained by their 
location on the northern or southern slope we 
performed a SDA using only the six variables 
distinguishing inhabited and not inhabited 
sites. The habitats located to the north of the 
mountains differ significantly from the south- 
ern sites by their higher K"/Na" ratios (Fig. 5). 
Within the northern slope, high values of 
depth and Mg"" characterize the habitats with 
apple snails (SDA with the 18 environmental 
variables. Fig. 6). Eight of the 11 lotie environ- 
ments with no P. canaliculata on this slope are 
located near the stream sources (Fig. 3); five 
of them are the only streams running through 
the plains between Ventanía and Tandilla 
mountains and have the lowest concentra- 
tions of Mg"". It was not possible to discrimi- 
nate between sites inhabited and not inhab- 



18 



MARTIN ETAL. 



Vailimanca Rivi 




Atlantic Ocean 



FIG. 3. Map of the study area showing the 65 sites considered habitable for snails. Squares and circles lo- 
cate lotie and lentic habitats respectively. Empty and filled symbols indicate sites not inhabited and inhabited 
by Pomacea canaliculata respectively. 



ited by P. canaliculata on the southern slope: 
no individual variable showed a significant dif- 
ference (all Wilks Lambda > 0.89, p > 0.05). 



DISCUSSION 

Ecosystems with alkaline waters, high 
Mg^VCa""^ ratios and poor in macrophytes are 
adverse for snails within the study area. Low 
concentrations of Ca^"^ and high concentra- 
tions of Mg"^^ (either absolute or relative to 
Ca""*) are a constraint for the distribution of 
freshwater snails (Lodge et al., 1987; Mad- 
sen, 1987; Savage & Gazey, 1987; Brown, 
1994). A positive relation is found between 
snail and macrophyte species richness, al- 
though this correlation may in part be be- 
cause macrophyte distribution is also affected 
by the water chemistry (Ökland, 1979; Pip, 
1987). 

The predominance of salty, alkaline, poorly 
vegetated aquatic environments with high 



desiccation risk in the western part of Buenos 
Aires and eastern part of La Pampa provinces 
(Damario & Pascale, 1993; Gilbert et al., 
1996) is probably a natural barrier for the dis- 
persal of snails and other freshwater organ- 
isms toward the south and west. This barrier 
is not evident from topographic or hydro- 
graphic standpoints and was not appealed to 
in Argentinean studies on biogeography (e.g., 
Ringuelet, 1975; Bonetto, 1973). 

Irrespective of their geographical position 
relative to the mountains, sites inhabited by P. 
canaliculata generally are shallow, quiet and 
turbid, with low NaV(K^ + Mg"^"^) ratios as com- 
pared to the uninhabited ones. Most of the in- 
habited environments are located on the 
northern slope of the mountains and these dif- 
fer from the southern ones in their low KVNa"^ 
ratios. It is probable, thereby, that the geo- 
graphic position biased the selection of the 
distinctive variables of the habitats inhabited 
by P. canaliculata, especially in the chemical 
aspect. 



DISTRIBUTION OF POMACEA 



19 



10 
8 

6 ^ 

4 

2 H 



2 

4 

6 

8 ^ 



10 



■ with P. canaliculeta (CC: 84.0%) 
D without P. canaliculata (CC: 87.5%) 



Canonical coaelation = 0.71 1 
Wilks' Lambda = 0.494* 




-4.5 -3.5 -2.5 -1.5 -0.5 0.5 1.5 

discriminant score 



2.5 



3.5 



4.5 



variables 

TCDF 



Na' 

-0.283 



VEL 

-0.146 



Mg** D K* TSIVI 

0.174 0.252 0.254 0.407 



FIG. 4. Frequency histograms of discriminant scores for habitable sites actually inhabited (n = 25) and not 
inhabited (n = 40) by Pomacea canaliculata (CC: percentage of correctly classified cases; r^^^p: correlation 
between discriminating variables and canonical discriminant function; VEL: water velocity; D: depth; TSM: 
total suspended matter). 



Shallowness is probably related to the risk 
of beconning temporally dry, and also to a 
lower stability. Water bodies In the area are al- 
most exclusively fed by rainfall, summer being 
the season with lower water level. Droughts 
are frequent in this area (Damario & Pascale, 
1993), and many water bodies dry up (Gron- 
dona, 1975; Toresani et al., 1994). Though 
adult P. canaliculata are able to survive for 
several months out of water (d'Orbigny, 
1847), summer dryness might lead to local 
extinctions as a result of a combination of high 
temperatures, dehydration, hypoxia, starva- 
tion or prédation. The resistance of juveniles 
to these factors may be lower than that of 
adults, as in Pomacea paludosa (Say, 1829) 
(Turner, 1996). 

In this region it takes approximately 1 7 days 
from oviposition to hatching (unpublished 
data). Even if a water body does not dry up 
completely, recruitment may be affected by 
the withdrawing of the water edge (especially 
in streams), which may lead newly hatched 
snails to drop on drying soil. Other Pomacea 
species attain their highest densities in more 
permanent habitats (Kushlan, 1975; Donnay 
& Beissinger, 1993). 



Some literature states that P. canaliculata 
inhabits lentic water bodies, while Pomacea 
insularum (d'Orbigny, 1835) lives in lotie habi- 
tats only (Hylton-Scott, 1958; Bachmann, 
1960). Our data show that P. canaliculata also 
occurs frequently in streams, where it reaches 
its highest densities, though quantitatively 
confirm that it prefers still or slow-running wa- 
ters. Water speed does not seem, however, to 
be a limiting factor per se in most uninhabited 
streams, since on the one hand midstream 
surface velocities are generally low and on 
the other the species has been observed to 
endure high velocities. Probably the influence 
of water velocity is related to the general in- 
cline of the stream section, which in turn af- 
fects its hydrological regime. 

The preference for sites with high content of 
suspended matter probably is not supported 
either by trophic needs or by the nature of the 
sediments, since suspended organic matter 
and sediment types were not selected by the 
stepwise discriminant analysis. Maybe it is 
more related to the protecting turbidity that re- 
duces the probability of prédation. 

The influence of Mg"^"" in the northern zone 
is probably related to extremely low concen- 



20 



MARTIN ETAL. 



16 



о 4 



S" 



I northern slope (CC: 80.6%) 



Canonical correlation = 0.573 
Wiiks' Lambda = 0.672"* 




-4.5 



-35 



-2.5 



-1.5 -0.5 0.5 1.5 

discriminant score 



variables 

TcDF 



K* 

-0.304 



Na* 
0.601 



FIG. 5. Frequency histograms of discriminant scores for habitable sites in the northern (n = 31) and south- 
ern slope (n = 34) of the Ventanía and Tandilia mountains (CC: percentage of correctly classified cases; r^^pi 
correlation between discriminating variables and canonical discriminant function). 



trations in a particular group of short intermit- 
tent rivulets located in the inter-mountain 
plain, a flat area with scarce and scattered 
water bodies where apple snails are absent. 

Pomacea canallculata is able to survive 
and reproduce in colder regions, such as Rio 
Colorado Valley (Fig. 3; Cazzaniga, 1981). 
The minor temperature gradient between the 
northern and southern boundaries of the 
study area (2°C) suggests that temperature is 
not the factor limiting the distribution of apple 
snails in the south of Buenos Aires Province. 
Even if aridity limits the distribution of apple 
snails towards the west, probably it is not a 
limiting factor towards the south, since cli- 
matic conditions to the south of Tandilia are 
not dryer than those found on the northern 
slope of Ventanía. 

The discontinuity between the northern and 
southern drainages is the physical barrier lim- 
iting the spread of P. canaliculata, in spite of 
our records in six localities (four isolated 
basins) to the south of it. Sport fishing is in- 
tense in three of these four basins, fishermen 
coming frequently from northern locations 
(Grossman, 1993; personal observations), 
and they may have introduced P. canaliculata 



into these areas. The use of apple snails as 
fishing bait has been one of the reasons for its 
rapid dispersal in southeastern Asia (Ander- 
son, 1 993; Wada, 1 997). Fish sowing activities 
may also have caused accidental introduction 
of P. canaliculata. At present, the southern- 
most location is Paso de las Piedras reservoir, 
Sauce Grande basin (38°24'S), where the 
apple snails were first seen in 1991 (Kaspar 
Delhey, pers. comm., 1991 ; this study). 

The distribution of P. canaliculata is essen- 
tially tropical and subtropical, including the 
La Plata basin (Ihering, 1919). Maybe its 
southerly distribution was reduced to a mini- 
mum during the last glacial age (Pleistocene- 
Holocene boundary), when the cold, arid cli- 
matic conditions of present-day Patagonia 
extended up to 750 km northward, north of the 
Paraná river delta (Fig. 1 ; Iriondo, 1 994). Sub- 
tropical conditions advanced to southern 
Buenos Aires Province during the middle 
Holocene (8-6 Kyr BP), extending the maxi- 
mum potential distribution of P canaliculata to 
the south. There are numerous Holocene fos- 
sil deposits containing freshwater snails on 
the southern slope of Tandilia and Ventanía 
mountains (e.g., Frenguelli, 1945; Kerlleñe- 



DISTRIBUTION OF POMACEA 



21 



2 - 



.fe 1 



2 - 

3 - 
4 



■ with P. canaliculata (CC: 84.2%) 
Lj without P. canaliculata (CC; 66.7 




Canonical correlation = 0.71 1 
Wilks" Lambda = 0.494*" 



-4.5 -3.5 -2.5 -1.5 -0.5 0.5 1.5 

discriminant score 



2.5 



3.5 



4.5 



variables 

TCDF 



Mg** D 

0.388 0.712 



FIG. 6. Frequency histograms of discriminant scores for habitable sites in the northern slope of the Ventanía 
and Tandilia mountains actually inhabited (n = 19) and not inhabited (n = 12) by Pomacea canaliculata (CC: 
percentage of correctly classified cases; r^^p; correlation between discriminating variables and canonical dis- 
criminant function; D: depth). 



vich, 1989; Bonadonna et al., 1995). Though 
they yield the same snail species that now 
occur in the area, none of them contains P. 
canaliculata, although P. canaliculata is com- 
mon as a fossil on the northern slope 
(Frenguelli, 1945; Camacho, 1966; Dangavs, 
1988). The only fossil record from the south- 
ern slope corresponds to shell fragments from 
the late Pleistocene near El Durazno stream 
that Frenguelli (1921) identified as P. canalic- 
ulata. However, the species was not recorded 
among the freshwater snails found in more re- 
cent sediments there. 

Pomacea canaliculata seems to have been 
unable to surmount the obstacle of the 
Tandilia and Ventanía mountains in the past. 
However, these mountains were not a barrier 
for the other freshwater snails living in the 
area, which are present all over Buenos Aires 
Province and northern Patagonia (Castel- 
lanos & Landoni, 1996). As compared to 
these snails, P. canaliculata has a larger body 
size and takes longer to reach maturity, and it 
is dioecious, with aerial eggs. All these char- 
acteristics could theoretically lead to lesser 
dispersal ability. 

Pomacea canaliculata appears unable to 



spread even within one same basin in the 
southern slope. In the Chasicó basin, it was 
collected only from one lake (Laguna Los 
Chilenos) and the proximal sections of two 
streams flowing in and out of it, although it is 
known to have been present in that lake since 
1985, when we recorded high densities of 
both old shells and living snails. In Sauce 
Grande basin (first record 1991) and Que- 
quén Grande basin (first record 1983; Caz- 
zaniga, 1987), they were found only in one 
lentic site each. The most effective natural 
dispersal mechanism seems to be floating 
downstream, but it does not appear to be 
enough to generate populations downstream 
of the introduction point even after eight years 
or more. 

The slow dispersal of P. canaliculata within 
and among water bodies on the southern 
slope of the mountains strongly contrasts with 
its fast expansion in southeastern Asia. Sev- 
eral factors may contribute to an explanation 
of these differences. The most obvious one is 
the initial interest in actively spreading a po- 
tential economic resource before realizing the 
risks. Apple snail stocks were introduced sev- 
eral times into almost all countries in that re- 



22 



MARTIN ETAL. 



gion (Haiwart, 1994: Naylor, 1996; Cowie, in 
press). Pomacea spp. attain maturity at an 
early age and reproduce all year round in 
tropical and subtropical climates (Milward de 
Andrade et al., 1978; Pointier et al., 1988; 
Donnay & Beissinger, 1993; Halwart, 1994), 
two factors that probably enhanced the quick 
establishment and spread of apple snails in 
southeastern Asia (Naylor, 1996; Cowie, in 
press). Periodic floods caused by summer 
monsoons may have contributed to its fast 
spread among and within Asian water bodies 
(Anderson, 1993; Wada, 1997). 

In Buenos Aires Province, growth of P. 
canaliculata is slower than in tropical areas, 
age at maturity is greater, and thermal sea- 
sonality determines a short reproductive pe- 
riod (about six months), and a winter resting 
period (Bachmann, 1960; Estebenet & Caz- 
zaniga, 1992, 1993, 1998). In addition, on the 
southern slope of the Buenos Aires mioun- 
tains, rivers are relatively short and run paral- 
lel to each other and into the Atlantic Ocean, 
with almost no connection among their 
basins, these conditions precluding a more ef- 
fective expansion. 



ACKNOWLEDGMENTS 

This work was funded with grants by CON- 
ICET ("Consejo Nacional de Investigaciones 
Científicas y Técnicas") and "Agencia Na- 
cional de Promoción Científica y Técnica", Ar- 
gentina. ALE is a researcher in CONICET and 
NJC is a researcher in "Comisión de Investi- 
gaciones Científicas de la Provincia de 
Buenos Aires". 



LITERATURE CITED 

AMERICAN PUBLIC HEALTH ASSOCIATION, 
1981, Standard methods for the examination of 
water and wastewater APHA, Washington, 1134 

PP- 

ANDERSON, В.. 1993, The golden Kuhol disaster. 
Agriscope. 7: 45-48. 

BACHMANN, A., 1960. Apuntes para una hidrobi- 
ología argentina. 11. Ampullaria insularum Orb. y 
A. canaliculata Lam. (Moll. Prosobr., Ampullari- 
dae). Observaciones biológicas y ecológicas. 
Actas y Trabajos del I Congreso Sudamericano 
de Zoología: 19-26. La Plata 

BAKER, G. H., 1998, The golden apple snail, Po- 
macea canaliculata (Lamarck) (Mollusca: Am- 
pullariidae), a potential invader of freshwater 
habitats in Australia. Pp. 21-26 in: м. p. zalucki 
R. A. I. DREW & G. G. WHITE, eds., Proceedings of 



the Sixth Australasian Applied Entomological Re- 
search Conference, Brisbane. 
BONADONNA, F. P., G. LEONE & G. ZANCHETTA, 
1995, Composición isotópica de los fósiles de 
gasterópodos continentales de la provincia de 
Buenos Aires. Indicaciones paleoclimáticas. Pp. 

77-104 in: M. т. ALBERDI, G. LEONE & E. P. TONNI, 

eds.. Evolución biológica y climática de la región 
pampeana durante los últimos cinco millones de 
años. CSIC, Madrid. 

BONETTO, A. A., 1973, Náyades de la Patagonia. 
Revista de la Asociación de Ciencias Naturales 
del Litoral. 4: 177-185. 

BROWN, D. S., 1994, Freshwater snails of Africa 
and their medical importance. Taylor & Francis, 
Londres, 609 pp. 

CAMACHO, H. H., 1966, Invertebrados. Pp. 1-159 
in: A. V. BÓRRELO, ed.. Paleontografía bonae- 
rense. CIC, Buenos Aires. 

CASTELLANOS, Z. J. A. & N. A. LANDONI, 1996, 
Mollusca Pelecypoda y Gastropoda. Pp. 
759-801 in: E. С. LOPRETTO & G. TELL, eds., Eco- 
sistemas de aguas continentales III. Ediciones 
Sur, La Plata. 

CAZZANIGA, N. J., 1981, Evaluación preliminar de 
un gasterópodo para el control de malezas acuáti- 
cas sumergidas. Pp. 131-165 in CIC ed.. Il Re- 
unión sobre malezas suabacuáticas en canales 
de desagüe de CORFO. CIC, La Plata. 

CAZZANIGA, N. J., 1987, Pomacea canaliculata 
(Lamarck, 1801) [erratum pro 1822] en Cata- 
marca (Argentina) y un comentario sobre Am- 
pullaria catamarcensis Sowerby, 1874 (Gas- 
tropoda, Ampullaridae). Iheringia, Série Zoología, 
66: 43-68. 

COWIE, R. H., 1995, Identity, distribution and im- 
pacts of introduced Ampullariidae and Vivipari- 
dae in the Hawaiian islands. Journal of Medical 
and Applied Malacology 5 [1993]: 61 -67. 

COWIE, R. H., in press, Apple snails as agricultural 
pests: the biology, impacts, and management. 
Pp. 1 -28 in: G. M. BARKER ed., Molluscs as crop 
pests. CABI, Wallingford. 

DAMARIO, E. A. & A. J. PASCALE, 1993, Cartas 
agroclimáticas de las regiones pampeana, 
chaqueña y litoral de cultivo en secano. Proceder 
Agrotecnológico, 1: 28-47. 

DANGAVS, N. V., 1988, Geología, sedimentología 
y limnología del complejo lagunar Salada 
Grande. Ministerio de Economía de la Provincia 
de Buenos Aires, La Plata, 145 pp. 

DONNAY T J & S. R. BEISSINGER, 1993, Apple 
snail {Pomacea dolioides) and freshwater crab 
{Dilocarcinus dentatus) population fluctuations in 
the llanos of Venezuela. Biotropica, 25: 206-214. 

D'ORBIGNY, A. D., 1847, Voyage dans l'Amérique 
Méridionale. Tome 5: Mollusques. С. P. Bertrand, 
Paris, 711 pp. 

ESTEBENET A. L. & N. J. CAZZANIGA, 1992, 
Growth and demography of Pomacea canalicu- 
lata (Gastropoda: Ampullariidae) under labora- 
tory conditions. Malacological Review, 25: 1-12. 

ESTEBENET A. L. & N. J. CAZZANIGA, 1993, Egg 



DISTRIBUTION OF POMACEA 



23 



variability and the reproductive strategy of Po- 
macea canaliculata (Gastropoda: Ampullariidae). 
Apex, 8: 129-138. 

ESTEBENETA. L. & N. J. CAZZANIGA, 1998, Sex 
related differential growth in Pomacea canalicu- 
lata (Gastropoda: Ampullariidae). Journal of Mol- 
luscen Studies, 64: 119-123. 

FRENGUELLI, J., 1921, Los terrenos de la costa 
Atlántica en los alrededores de Miramar (prov. de 
Buenos Aires) y sus correlaciones. Boletín de la 
Academia Nacional de Ciencias en Córdoba, 24: 
325-485. 

FRENGUELLI, J., 1945, El piso Piálense. Revista 
del Museo de La Plata, Geología, 2: 287-31 1 . 

GILBERT v., О. DEL PONTI, M. WREDE, S. 
TIRANTE & I. DOMA, 1996, Ictiofauna y ambi- 
entes acuáticos en la provincia de La Pampa. 
Actas de las Vil Jornadas Pampeanas de Cien- 
cias Naturales, pp. 123-131, Santa Rosa. 

GRONDONA, M. F, 1975, Pendiente del Océano 
Atlántico. Pp. 203-394 in: SOCIEDAD argentina 
DE ESTUDIOS GEOGRÁFICOS, ed.. Geografía de la 
República Argentina: Hidrografía. GAE A, Buenos 
Aires. 

GROSSMAN, F, 1993, La pesca deportiva en el 
partido de Azul, Provincia de Buenos Aires. Actas 
de las V Jornadas Pampeanas de Ciencias Na- 
turales, pp. 67-74, Santa Rosa. 

HALWART, M., 1994, The golden apple snail Po- 
macea canaliculata in Asian rice farming sys- 
tems: present impact and future threat. Interna- 
tional Journal of Pest Management. 40: 
199-206. 

HYLTON-SCOTT, M. I., 1958, Estudio morfológico 
y taxonómico de los ampulláridos de la República 
Argentina. Revista del Museo Argentino de Cien- 
cias Naturales "Bernardino Rivadavia", Zoología, 
3: 233-333. 

IHERING, H., 1919, Las especies de /4mpu//ar/a en 
la Argentina. Actas de la Primera Reunión Na- 
cional de la Sociedad Argentina de Ciencias Na- 
turales, pp. 329-350, San Miguel de Tucumán. 

IRIONDO, M., 1994, Los climas cuaternarios de la 
región pampeana. Comunicaciones del Museo 
Provincial de Ciencias Naturales "Florentino 
Ameghino", 4: 6-46. 

KERLLEÑEVICH, S. C., 1989, Statistic study of the 
Holocene fresh water malacofauna from the 
Agua Blanca Formation, Arroyo Napostá Grande, 
Buenos Aires. Province, Argentina. Quaternary of 
South America and Antarctic Peninsula. 7: 137- 
160. 

KUSHLAN, J. A., 1975, Population changes of the 
apple snail, Pomacea paludosa, in the southern 
Everglades. Thie Nautilus, 89: 21 -23. 

LODGE, D. M., K. M. BROWN, S. P. KLOSIEWSKY, 
R. A. STEIN, A. P. COVICH, B. K. LEATHERS & 
С BRÖNMARK, 1987, Distribution of freshwater 
snails: spatial scale and the relative importance 



of physicochemical and biotic factors. American 
Malacological Bulletin, 5: 73-84. 

MADSEN, H., 1987, Effect of calcium concentration 
on growth and egg laying in Helisoma duryi, Bio- 
mphalaria alexandrina, B. camerunensis, and 
Bulinus truncatus (Gastropoda: Planorbidae). 
Journal of Applied Ecology, 24: 823-836. 

MILWARD DE ANDRADE, R., O. DOS SANTOS 
CARVALHO & С T GUIMARAES, 1978, Alguns 
dados bio-ecologicos de Pomacea haustrum 
(Reeve, 1956), predador-competidor de hos- 
pedeiros intermediarios de Scfiistosoma man- 
soni Sambon, 1907. Revista de Saude Publica, 
12:78-89. 

NAYLOR, R., 1996, Invasions in agriculture: as- 
sessing the cost of the golden apple snail in Asia. 
Amblo. 25: 443-448. 

ÖKLAND, J., 1979, Distribution of environmental 
factors and freshwater snails in Nonway. Mala- 
cologia, 18:211-222. 

PIP, E., 1987, Species richness of freshwater gas- 
tropod communities in central North America. 
Journal of Molluscan Studies, 53: 163-170. 

POINTIER, J. P, A. THÉRON & D. IMBERT-ES- 
TABLET, 1988, Decline of a sylvatic focus of 
Schistosoma mansoni in Guadeloupe (French 
West Indies) following competitive displacement 
of the snail host Biomphalaria glabrata by Am- 
pullaria glauca. Oecologia, 75: 38-43. 

RINGUELET, R. A., 1975, Zoogeografía y ecología 
de los peces de aguas continentales de la Ar- 
gentina y consideraciones sobre las áreas icti- 
ológicas de América del Sur. Ecosur, 2: 1-122. 

SAVAGE, A. A. & G. M. GAZEY, 1987, Relation- 
ships of physical and chemical conditions to 
species diversity and density of gastropods in 
English lakes. Biological Conservation, 42: 
95-113. 

TORESANI, N. I., H. L. LÓPEZ & S. E. GÓMEZ, 
1994, Lagunas de la Provincia de Buenos Aires. 
Ministerio de la Producción de la provincia de 
Buenos Aires Ed., 108 pp., La Plata. 

TURNER, R. L., 1996, Use of stems of emergent 
plants for oviposition by the Florida applesnail, 
Pomacea paludosa, and implications for marsh 
management. Florida Scientist, 59: 34-49. 

WADA, T, 1997, Introduction of the apple snail Po- 
macea canaliculata and its impact on rice agri- 
culture. Proceedings of the International Work- 
shop on Biological Invasions of Ecosystems by 
Pests and Beneficial Organisms, pp. 170-180, 
Tsukuba. 

YUSA, Y & T. WADA, 1999, Impact of the introduc- 
tion of apple snails and their control in Japan. 
Naga, The ICLARM Quarterly 22: 9-13. 

Revised ms. accepted 25 June 2000 



MALACOLOGIA, 2001, 43(1-2): 25-32 

LIFE CYCLE AND POPULATION DENSITY OF THE PEST SLUG ARION 
LUSITANICUS M ABILLE (MOLLUSCA: PULMONATA) ON GRASSLAND 

Brigitte Grimm 
Institut für Zoologie, Universitätsplatz 2, A-8010 Graz, Austria; grimm ©kfunigraz.ac.at 

ABSTRACT 

Arion lusitanicus is a univoltine, semelparous slug found in Austria. Hatchlings were found both 
during the autumn, in which the eggs were laid, and in the following spring. By far the largest part 
of this generation matured the following summer (June to August), with peaks of egg-deposition 
noted in late August and early September. Population density was measued by MRR (mark-re- 
lease-recapture) and hand-searching; the results obtained by the two methods did not differ sig- 
nificantly. In June 1 996 (the peak month for 1 996), MRR gave a density of 1 .6 slugs m"^ on grass- 
land. The high recapture rates of individually marked slugs, as well as the fact that their life 
parameters fell well within the range of unmarked individuals, is a proof of their unaltered vitality 
and thus of the applicability of the new method in the field. The effects of different weather con- 
ditions on the main life-parameters are discussed. 

Key words: Arion lusitanicus, life cycle, density, transponders, individual marking, weather 
conditions. 



INTRODUCTION 

Like other arionid slugs (Beyer & Saari, 
1978; South, 1989), A. lusitanicus Mabille, 
1868, is known to have a univoltine and 
semelparous cycle in western and northern 
Europe (Quick, 1952; Davies, 1987; Cheval- 
lier, 1971; Risch & Backeljau, 1989; von 
Proschwitz, pers. comm.). From the scattered 
evidence of life-history data presently avail- 
able, A. lusitanicus was assumed also to be 
annual and semelparous in central Europe 
(Graber & Buter, 1987; Grimm, 1991, 1996). 
The present investigation was designed to 
elucidate the details of the life cycle of this 
economically highly important pest slug (e.g., 
Schmid, 1970; Frank, 1998; von Proschwitz, 
1997; Fischer & ReischCitz, 1998), because 
the main life-history parameters as well as the 
knowledge of population densities are of 
basic relevance for determining the timing of 
efficient control methods. 

A new method of individually marking slugs 
by injecting magnetic transponders, which 
has yielded very promising results in the lab- 
oratory (Grimm, 1996), was applied under 
field conditions for the first time. A comparison 
of life cycle data of marked and unmarked 
slugs at the same site, would allow a definite 
conclusion about the applicability of the 
method in the field. 



The importance of different weather condi- 
tions as factors determining slug development 
(e.g., Dainton, 1954; Crawford-Sidebotham, 
1972; Young et al., 1993; Keller et al., 1999), 
was also investigated in the present study. 



MATERIALS & METHODS 
Study Area 

The study was conducted on grassland, 
which was mown twice a year. It was situated 
near St. Marein/Graz in Austria (47°1'N, 15° 
41 'E), elevation 300 m). The study area con- 
sisted of a small strip (10 to 12 m wide) run- 
ning from north to south for 200 m between a 
conventionally managed field to the east 
(used only in 1995), and stream-side vegeta- 
tion to the west and south (used in 1995 and 
1996). No herbicides and pesticides were 
used. A total area of 290 m^ was used in 1 995, 
and 260 m^ in 1996. In June 1996 the 
meadow had 90-95% plant cover. The sam- 
pling periods ran from May to November 1 995 
and from March to December 1996. 

Other slug species (Kerney et al., 1983) 
found on the site were: Arion subfuscus (Dra- 
parnaud, 1805); Arion fasciatus (Nilsson, 
1822); L/'maxmax/mus Linnaeus, 1758; Mala- 
colimax tenellus Müller, 1774; Dereceras 



25 



26 



GRIMM 



reticulatum (Müller, 1774); and Deroceras 
laeve (Müller, 1774). Their densities were not 
determined. 

Weather Conditions 

Monthly arithmetical means of temperature 
and precipitation are compared with a 30-year 
mean (1961-1990). Temperature was ob- 
tained from the Metereological Station at 
Graz-Thalerhof (distance to the site: 19.2 km) 
and precipitation from the Metereological Sta- 
tion at Gleisdorf (distance to the site: 8.8 km). 
Parameters from two different metereological 
stations were used, because their data were 
expected to resemble the situation of the ac- 
tual site best (Lazar, Institut für Meteorologie, 
Universität Graz, 1999, pers. comm.). 

Temperature: Greater monthly fluctuations of 
temperature were observed in 1996 (S.D. ± 
8.66) than in 1995 (S.D. ± 8.06), the latter 
also being the warmer year (mean 9.77°C in 
1995, 8.83' С in 1996). The winter of 1995/96 
was significantly colder than average, and 
also than 1994/95 (mean 95/96 1.5° (S.D. 
± 4.5); 30-year mean 2.1 (S.D. ± 4.6); mean 
94/95 5.1 (S.D. ± 6.9). Spring (February- 
May) was warmer in 1995 (mean 8.6°, S.D. 
± 4.6) than 1996 (mean 5.6°, S.D. ± 7.4) as 
was the late summer/autumn (July-October) 
of 1995 (mean 16.65°, S.D. ± 3.95) com- 
pared to the same period in 1996 (mean 
15.28°, S.D. ± 3.48). 

Precipitation: 1996 proved to be significantly 
wetter than 1995 (p = 4.8, d.f. = 22; 1995: 
mean = 64.87, S.D. r 39.45; 1996: mean = 
76.83, S.D. ± 39.03), except for an extremely 
dry July (54.4 mm below 30-year's average). 
The late spring and early summer (April- 
June) of 1995 was dry (55.9 mm below 30- 
year's average) compared to the same period 
of 1996 (54.3 mm more than 30-year's aver- 
age). 1995 also ended in a drier autumn than 
1996 (September-November; 1995: 115.6 
mm; 1996: 270.2 mm). The winter 1995/96 
(December-April) had high precipitation (33.1 
mm above average) and thus snow-coverage 
for three months. 

Refuge Traps 

To assess the local density of slugs, 50 x 50 
cm squares of 3 mm hardboard covered with 
5 cm polystyrene were used as shelter traps. 
In 1995, 54 traps were placed 2 m apart in a 



rectangular grid over the entire study site. 
Four rows of ten traps each were laid on the 
grassland area, another row of ten traps on 
the oil-pumpkin field, and a row of only four 
traps was placed in the stream-side vegeta- 
tion (stream meandering prevented the set- 
ting of further traps). In 1996 only the central 
four rows (40 traps) on the grassland were 
used. This was due to increasingly heavy un- 
dergrowth in the brook-vegetation area, and 
because permission to place traps on the con- 
ventionally managed field could not be ob- 
tained for the second year. The traps were 
placed on short-mown vegetation patches of 
identical size two weeks before the start of the 
investigation in 1995 and remained in place 
for both seasons; damaged traps were re- 
placed immediately. The living vegetation be- 
neath the traps disappeared within two weeks 
of their placement; dead plant remains could 
be found for a further four weeks. 

Marking 

A method of individually marking A. lusita- 
nicus by magnetic transponders (Grimm, 
1996) was used for the first time in the field; 
92 slugs were marked in 1995, and 139 slugs 
in 1 996. Between July 1 2 to 1 8 1 995, all 57 A. 
lusitanicus found under the shelter traps were 
given a unique mark directly in the field and 
replaced exactly where they had been found. 
In 1996, two similar marking events (one in 
June, one in August) were carried out. 

Recording of Activities 

The site was searched twice a day each 
day, throughout the periods May to November 
1995 and March to December 1996. All A. 
lusitanicus found under the shelter traps and 
the area in between were recorded and ex- 
amined for the presence of a transponder 
mark using the hand-reading instrument 
(Grimm, 1996). All mating pairs over the site, 
and all egg-batches found under the shelter 
traps, were also recorded. 

Determination of Developmental Status 
of A. lusitanicus 

Every week 20 A. lusitanicus. representing 
the full size-range at a time, were collected 
from a nearby field (distance 100 m) and 
taken to the laboratory for identification (lower 
genitalia; Kerney et al., 1983; Quick, 1960) 



LIFE CYCLE & POPULATION DENSITY OF A. LUSITANICUS 



27 



TABLE 1. Population density in 1995 and 1996 as determined by hand-searching (means, S.E., sig- 
nificance in difference between 1995 and 1996 (U-test; a = 0.05; ** highly significant, * significant, n.s. 
not significant) over the whole site (290 m^ in 1 995, 260 m^ in 1 996); shelter traps and between traps 
were combined (juveniles included in autumn). 





1995 




1996 




Signifie 
199 






mean 


S.E. 


mean 


S.E. 


Sand 1996 


March 


— 


— 


23.4 


1.3 




— 


April 


— 


— 


39.8 


1.8 




— 


May 


52.2 


4.02 


109.3 


7.9 




** 


June 


136.3 


12.8 


228.9 


18 




** 


July 


60.9 


7.4 


153.4 


19.5 




** 


August 


39.8 


5.9 


104.2 


13.1 




** 


September 


33.3 


3.4 


49.4 


6.2 




* 


October 


7.7 


1.3 


8.06 


2.9 




n.s. 


November 


1.2 


0.3 


1.04 


0.4 




n.s. 


December 


— 




0.34 


0.2 




— 



and for determination of their developmental 
status. When sperm could be found in the her- 
maphrodite duct , slugs were considered to be 
"male-mature"; before that they were regis- 
tered as "juvenile". Slugs showing an en- 
larged albumen gland and eggs in their 
oviduct were considered "female-mature". 
These results were complemented by field- 
observations of mating and egg-laying. 

Statistical Analysis 

Population densities were estimated ac- 
cording to mark-release-recapture (MRR) 
methods of Jolly in 1995, and Jackson's Pos- 
itive Method in 1996 (Begon, 1979). Descrip- 
tive statistics, t-test and Mann-Whitney U-test 
were calculated using SPSS©. 



RESULTS 
Seasonal Level and Absolute Densities 

In both years, a peak mean density occured 
in June (41.36% higher in 1996 than 1995) 
and was followed by a continuous decrease 
for the rest of the season (Fig. 1). The mean 
number of slugs for both years differed highly 
significantly from May to August, and by Sep- 
tember recorded numbers were still 57.8% 
above those reached in 1995 (significant) 
(Table 1). 

Specimens were marked in both years, al- 
lowing the population densities to be esti- 
mated according to the mark-release-recap- 



ture (MRR) methods. Over the entire site, in- 
cluding shelter traps, on July 14, 1995, the 
density estimated by MRR was 0.22 m"^, 
whereas the arithmetical mean of the num- 
bers counted by hand-searching for that 
month was 0.21 m"^ (Fig. 1), which was only 
4.5% less than the number estimated by MRR 
(difference not significant). In 1996, the esti- 
mate for June 18 was 1.6 m"^, compared to 
the number counted by hand-searching for 
the same day which was 1 .4 m"^. The differ- 
ence between the two months was again not 
significant (12.5%). 

A highly significant increase in the number 
of egg-batches per trap from 1.15 in 1995 to 
2.46 in 1996 was noted. 



Life Cycle 

In the present study, male-mature individu- 
als were first observed at the beginning of Au- 
gust (Table 2). The first spermatophores were 
found in the reproductive system one week 
before in 1 995, and two weeks before in 1 996. 
Part of the population remained in this state 
until October, while the remaining individuals 
entered female maturity (egg-laying phase) 
soon after (1995) or even before (1996) the 
first copulations were observed in the field 
(Table 2). According to data obtained from 
anatomical dissections, the first female-ma- 
ture slugs were found in the last week of July 
1995, and in the last week of June 1996. The 
peaks of egg-deposition were in early Sep- 
tember 1995 and late August 1996 (Fig. 2). 
The period of egg-laying was longer in 1996 



28 



GRIMM 



mean numbers of slugs/m^ 



1 1 




— ЯПЭЭб П1996 












H 










1 








П л 




J rJ"t=ln . 



0,9 
0,8 
0,7 
0,6 
0,5 
0,4 
0.3 
0,2 
0,1 



March April May June July Aug Sept Oct Nov Dec 

FIG. 1. Seasonal level of activity of A. lusitanicus in 1995 and 1996 (mean number of slugs per m^ and per 
searcfi). Data obtained by hiand-searcfiing over the whole area; shelter traps and between traps were com- 
bined (juveniles not included in autumn). 



TABLE 2. 
and 1996 


Reproductive 


data of marked and unmarked 


specimens 


according 


to field observations in 1995 








1995 








1996 






Unmarked 




Marked 


Unmarked 




Marked 



Dates 



Dates Copulations Aug. 6-Oct. 2 Aug. 6-Sep. 19 Aug. 7-Sep. 21 Aug. 11 -Aug. 27 

Dates Egg-laying Aug. 25-Sep. 29 Aug. 25-Sep. 19 Jun. 7-Nov. 11 Jun 7-Sep. 1 

Numbers Egg-batches 0.87 (:r 1.06) - 2.46 (±2.17) - 

(mean, ± S.D.) 

per trap 



Hatching 



Oct. 2-Oct. 29 



Sep. 17-Nov. 14 



than in 1995, extending to the middle of No- 
vember (Table 2). 

Hatching was first observed in mid-Sep- 
tember 1996, 15 days earlier than in 1995 
(Table 2). 



Marked Specimens 

The restricted life-history data obtained 
from marked specimens was within the range 
of data deriving from unmarked slugs (Table 
2). Recapture rates for marked slugs were 
83.2% in 1995, and 76.7% in 1996. 



DISCUSSION 



Methodology 



Since Oekland (1929), shelter traps have 
commonly been used for determining slug 
abundance. The type of trap used here, and 
previously by Kaiser et al. (1993) and Grimm 
et al. (1997), represents an improvement for 
this sort of field trial, even in comparison with 
pure cardboard (Grimm, 1991; Young et al., 
1996; Hawkins et al. 1998), because it pro- 
vides rather more stable microclimatic condi- 
tions (Grimm & Caíame, in prep.), and addi- 



LIFE CYCLE & POPULATION DENSITY OF A. LUSITANICUS 



29 




1-15 15-30 1-15 15-31 1-15 1&31 1-15 15^0 1-15 15-31 1-15 

Jun Jul Aug Sep Oct Nov 

FIG. 2. Seasonal frequency of egg-deposition (in %) of A. lusitanicus in 1995 and 1996. 



tional attractants, like baits, need not be used. 
Moreover, the traps can stay in the field for a 
full season or longer. Good microclimatic con- 
ditions are also provided by the shelter traps 
used by Hommay et al. (1991), and a direct 
comparison between these two In a field trial 
would provide valuable information for com- 
parison of data collected in the different in- 
vestigations (Grimm & Caíame, in prep.). It 
would be very desirable to try to unify shelter- 
trap methodology generally. 

Differences in attractiveness of the traps to 
different stages of slug, as shown by the much 
higher density in June compared with earlier 
in the same year, can either be explained by 
differences in the behaviour of the stages 
themselves (Grimm, in prep.), or by changes 
in the microclimatic conditions under the traps 
during the year. 

The life-long duration of the individual 
marking technique, coupled with the easy and 
reliable readability of the codes, as known 
from laboratory experiments (Grimm, 1996), 
were also important advantages in the pres- 
ent investigation, as were the high recapture 
rates of marked individuals. The fact that 
marking did not alter the animals' vitality 
under natural conditions was also demon- 
strated for the first time in this field trial, as the 
mating and egg-laying periods of the marked 



slugs fell well within the range of untreated 
specimens. 

Life Cycle 

Like other species of arionid slug (Cheval- 
lier, 1971; Beyer &Saari, 1978; South, 1989), 
A. lusitanicus has an annual, semelparous 
cycle in most parts of Europe (Quick, 1952; 
Davies, 1987; Chevallier, 1971; von Pro- 
schwitz, pers. comm.), showing male maturity 
in summer and egg laying in autumn, whereas 
in southwestern Europe this species mates in 
January-February (Castillejo, 1997), and egg- 
batches occur in late autumn and winter 
(Castillejo, pers. comm.). However, this incon- 
sistency in the biological data between south- 
west and all other parts of Europe could also 
be the result of taxonomic confusion, a possi- 
bility well worth investigating. In A. lusitanicus, 
as in A. intermedius (Normand, 1852), egg- 
batches and young hatchlings were found in 
autumn and spring (South, 1989). Thus, over- 
wintering can take place at both those stages. 
The hatching date is mainly dependent on in- 
tegrated temperature (Kaiser et al., 1993), as 
was first demonstrated for Insects (codling 
moth) by Shelford (1927). 

At any one time, body size can differ re- 
markably among individuals of a single gen- 



30 



GRIMM 



eration, with distinctly larger specimens being 
found in early spring (Grimm, 1991), and 
which most probably mature by early summer 
(Chevallier, 1971). This is also suggested by 
the timing of the first egg-batches, which were 
found at the beginning of June, the next only 
occuring in August. However, for the majority 
of the generation, it is probably not body size 
that is the main cause of maturity, as sug- 
gested by Lusis (1961), but rather synchro- 
nization with season (Smith, 1966), that is, 
day length (Sokolove & McCrone, 1978) and 
temperature (Rollo, 1983). These factors re- 
sult in a period of mating and egg-laying last- 
ing approximately two months for A. lusitani- 
cus, which is independent of the body size or 
weight of the slugs. Records of female-mature 
slugs earlier in the year than male-mature 
ones might result from the ability of A. lusita- 
nicus to self-fertilize (Foltz et al., 1982; von 
Proschwitz, pers. comm.). This and the ap- 
pearance of slightly acyclic specimens may 
provide security for this generally univoltine 
species. 

Population Densities 

Like A. subfuscus, A. lusitanicus reaches its 
peak population density in the early summer 
(June), whereas two other arionid slug 
species {A. fasciatus and the A. hortensis agg 
regate of species) show a distinct shift in their 
maximum densities towards the autumn 
(Barnes & Weil, 1944). This suggests that A. 
subfuscus and A. lusitanicus are closely re- 
lated not just morphologically (Backeljau, 
pers. comm.), but also ecologically. A heavy 
decline in numbers in the dry months of the 
summer (July onwards) and also in winter 
could be seen in the present investigation, 
agreeing with the findings of Runham & 
Hunter (1970) for A. hortensis. 

One of the causes of the increased pop- 
ulation density in the second year of the 
investigation may be the self-reinforcing 
mechanisms known to operate in growing 
populations (e.g., Wolda & Kreulen, 1973). 
The number of egg-batches was observed to 
be strongly linked to population density, as the 
significantly higher numbers of reproductive 
slugs in 1996 (64.4%) also produced signifi- 
cantly higher numbers of egg batches per trap 
(33.3%). Moreover, the prevailing weather 
conditions (e.g., Webley, 1964; Newell, 1968; 
Crawford-Sidebotham, 1972; Dainton, 1954; 
Young et. al., 1993), as well as the traps used 
as additional weather-protected egg-laying 



and resting sites, may also have contributed 
to the high population densities in 1996. How- 
ever, population densities in the present in- 
vestigation do not seem artificially high, be- 
cause in similar locations densities up to 10 
m"^ have been found in Sweden (von 
Proschwitz, 1994), up to 57.2 m'^ in Switzer- 
land (Frank, 1998), and up to 70 m"^ in Aus- 
tria (Grimm, unpublished). 

Unfavourable climatic conditions are gener- 
ally known to have a negative, delaying effect 
on feeding, growth and reproduction of arionid 
slugs (Laviolette, 1950; Hunter, 1968; Cheval- 
lier, 1971; Burenkov, 1977; South, 1982; 
Keller et al., 1999). The very dry late spring 
and summer of 1995 resulted not in post- 
poned mating, but in a distinctly delayed egg- 
laying period. This summer drought lasted for 
six weeks only, and does not seem to have 
been severe enough to delay egg-laying to 
the following spring, which is possible in A. 
lusitanicus (Chevallier, 1971), and has also 
been observed in A. Intermedlus by South 
(1 989). But the drought in July 1 996 may have 
caused the gap in egg-laying observed that 
year. Despite a mild autumn, which is known 
to accelerate egg-development (Kaiser et al., 
1993), the hatching of the juveniles was de- 
layed compared with 1996, as egg-laying also 
started later in 1995. Late hatching is defi- 
nitely disadvantageous for the new genera- 
tion, as they are not able to start feeding until 
very late in the year, and thus cannot accu- 
mulate reserves for the winter. This initial dis- 
advantage could be overcome by a winter 
with permanent snow-cover, and thus protec- 
tion against the low temperatures, followed by 
a moist and relatively warm spring (as in 
1996) with temperatures around optimal lev- 
els for arionid slugs (Chevallier, 1971; Hom- 
may, 1994). Such conditions would clearly 
favour survival and development of young 
hatchlings and eggs for the next generation. 

Control 

Control agents are normally applied when 
pest slugs are just about to reach maturity and 
are at a stage when they have the greatest 
potential for causing damage to crops; not 
only are they about to reproduce, but it is also 
known that they require considerably more 
food during this period of their life cycle (Rollo, 
1988). However, in some cases, it may be 
more appropriate to target the young hatch- 
lings, as in the case of the parasitic nematode 
Phasmarhabditis hermaphrodlta (Wilson et 



LIFE CYCLE & POPULATION DENSITY OF A. LUSITANICUS 



31 



al., 1993). This biological control agent has 
successfully been used against all stages of 
Deroceras reticulatum, but is known to be in- 
effective against adults of A. lusitanicus (Glen 
et al., 1966; Speiser, unpublished); it will, 
however, attack young hatchlings of this 
species (Grimm & Hass, in prep.). Thus, the 
knowledge of the life cycle of A. lusitanicus in 
central Europe provided by the present study 
will enable the accurate targeting of particular 
stages In the life history of A. lusitanicus, and 
therefore allow a more effective application of 
control methods in the future. 



ACKNOWLEDGEMENTS 

The field work was supported by a research 
project of the Austrian Federal Ministeries of 
Science & Transport (GZ 30.505/2-IV/8b/94) 
and of Agriculture & Forestry (No. L921/94), 
and publication by a project (GZ 30.686/1- 
IIIA/4a/98) of the Austrian Federal Ministry of 
Science & Transport. I would like to thank Dr. 
S. E. R. Bailey and Dr. P. B. Mordan for their 
critical and most helpful reviews of earlier 
drafts of this manuscript, and Mag. H. Unter- 
steiner for statistical advice. 



LITERATURE CITED 

BARNES, H. F. & J. W. WEIL, 1944, Slugs in gar- 
dens: their numbers, activities and distribution. 
Part I. Journal of Animal Ecology, 13: 140-175. 

BEGON, M., 1979, Investigating animal abundance: 
capture-recapture for biologists. Arnold, London, 
England. 97 pp. 

BEYER, W. N. & D. M. SAARI, 1978, Activity and 
ecological distribution of the slug Arion subfuscus 
(Stylommatophora; Arionidae). American Mid- 
land Naturalist, 100: 359-367, 

BURENKOV, M. S., 1977, Population structure of 
three slug species (order Stylommatophora, sub- 
class Pulmonata). Zhurnal Obshchei Biologii. 
Moskva. 38: 296-304. 

CASTILLEJO, J., 1997, Barbosas del Noroeste 
Ibérico. Servicio de Publicacións e Intercambio 
Científico, University of Santiago de Compostella, 
Spain. 192 pp. 

CHEVALLIER, H., 1971, Cycle biologique des 
grands Arion en France. Atti delta Società italiana 
di Scienze Naturali e del Museo Cívico di Storia 
Naturale in Milano, 112: 316-320. 

CRAWFORD-SIDEBOTHAM, T J., 1972, The influ- 
ence of weather upon the activity of slugs. Oe- 
co/og(/a (Berlin), 9: 141-154. 

DAINTON, B. H., 1954, The activity of slugs: I. The 
induction of activity by changing temperatures. 
Journal of Experimental Biology, 31 : 1 65- 1 87. 



DAVIES, S. M., 1987, Arion flagellus Collinge and 
A. lusitanicus Mabille in the British Isles. A mor- 
phological, biological and taxonomical investiga- 
tion. Journal of Conchology: 32, 339-354. 

FISCHER, W. & P. L. REISCHÜTZ, 1998, General 
aspects about slug pests. Die Bodenl<ultur (Vi- 
enna), 49(4): 281 -292. 

FOLTZ, D. W., H. OCHMANN, J. S. JONES, M. 
EVANGELISTI & R. K. SELANDER, 1982, Ge- 
netic population structure and breeding systems 
in arionid slugs (Mollusca: Pulmonata). Biological 
Journal of tt^e LInnean Society 17: 225-242. 

FRANK, T, 1 998, Slug damage and numbers of the 
slug pests, Arion lusitanicus and Deroceras reti- 
culatum, in oilseed rape grown beside sown wild- 
flower strips. Agriculture, Ecosystem & Environ- 
ment, 67: 67-78. 

GLEN, D. M., M. J. WILSON & L HUGHES, 1996, 
Exploring and exploiting the potential of the rhab- 
ditid nematode Phasmarhabditis hermaphrodita 
as a biocontrol agent for slugs. In: i. f. hender- 
son, ed.. Slug and snail pests in agriculture, 
BCPC Monograph, 66: 271 -280. 

GRABER, С. & H. SUTER, 1987, Schnecken Re- 
gulierung. Bühlmann & Co, Bern. 84 pp. 

GRIMM, В., 1991, Arion lusitanicus Mab.: Aktivität 
und Entwicklung in Abhängigkeit von Umweltfak- 
toren. Master's Thesis, University of Graz, Aus- 
tria. 75 pp. 

GRIMM, В., 1996, A new method for individually 
marking slugs (Arion lusitanicus Mabille) by mag- 
netic transponders. Journal of Molluscan Studies, 
62: 477-482. 

GRIMM, В., PAILL, W. & H. KAISER, 1997, Biolo- 
gische und angewandt-ökologische Unter- 
suchungen an Arion lusitanicus Mabille: ein inter- 
national-kooperatives Projekt zur Untersuchung 
einer in Europa verbreiteten Schadschnecke. 
Final Report, University of Graz, Austria. 73 pp. 

HAWKINS, J. W., M. W. LANKESTER & R. R. A. 
NELSON, 1998, Sampling terrestrial gastropods. 
Malacologia, 39(1 -2), 1 -9. 

HOMMAY G., 1994, Contribution à la biologie et à 
l'écologie des Limaces (mollusques gastéro- 
podes pulmones) de grandes cultures. PhD-The- 
sis. University of Colmar, France. 298 pp. 

HOMMAY G., D. PEUREUX & D. VERBEKE, 1991 , 
Un réseau d'observations sur les Limaces dans Г 
est de la France. Phytoma, 431: 14-19. 

HUNTER, R J., 1968, Studies on slugs of arable 
ground: II. Life cycles. Malacologia, 6: 379-389. 

KAISER, H., U. GEIERSBERGER, B. GRIMM & 
W. PAILL, 1993, Untersuchungen über die bio- 
logischen und ökologischen Voraussetzungen 
des Massenauftretens der Spanischen Weg- 
schnecke. Final Report, University of Graz, Aus- 
tria. 99 pp. 

KELLER, M., J. KOLLMANN & P. J. EDWARDS, 
1999, Palatability of weeds from different Euro- 
pean origins to the slugs Deroceras reticulatum 
Müller and Arion lusitanicus Mabille. Acta Oeco- 
iogica (Paris), 20(2): 109-118. 

KERNEY M. P., R. A. D. CAMERON & J. H. JUNG- 
BLUTH, 1983, Die Landschnecken Nord- und 



32 



GRIMM 



Mitteleuropas. Paul Parey ed., Hamburg/Berlin, 
Germany. 384 pp. 

LAVIOLETTE. P., 1950, Sur un retard de la maturité 
génitale observé chez Arion rufus L. Bulletin 
Mensuel de la Société Linnéenne de Lyon. 19: 
52-56. 

LUSiS, O., 1961, Post embryonic changes in the re- 
productive system of the slug Arion rufus L. Pro- 
ceedings of the Zoological Society of London. 
137:433-468. 

NEWELL, P. F., 1968, The measurement of light 
and temperature as factors controlling the sur- 
face activity of the slug Agriolimax reticulatus 
(Müller). Symposium oftfie British Ecological So- 
ciety 8: 141-146. 

ÖKLAND, P., 1929. Quantitative Untersuchungen 
der Landschneckenfauna Norwegens. Zeitschriñ 
für Morphologie und Ökologie der Tiere. 16: 
748-804. 

QUICK, H. E., 1952. Rediscovery of Arion lusitani- 
cus in Britain. Proceedings of the Malacological 
Society of London. 29: 93- 1 01 . 

QUICK, H. E., 1960. British slugs (Pulmonata: Tes- 
tacellidae, Ahonidae, Limacidae). Bulletin of the 
British Museum (Natural History). Zoological Se- 
ries. 6: 106-226. 

RISCH, R & T. BACKELJAU 1989, On the oc- 
curence of Arion lusitanicus Mabille, 1868, in Bel- 
gium (Mollusca, Pulmonata). Annals of the Royal 
Society of Belgium. 118: 25-38. 

RQLLO. С D., 1983, Consequences of competition 
on the reproduction and mortality of three species 
of terrestrial slugs. Researches on Population 
Ecology (Kyoio). 25: 20-43. 

ROLLO, С D,, 1988, The feeding of terrestrial slugs 
in relation to food characteristics. Starvation, mat- 
uration and life history. Malacologla. 28: 29-40. 

RUNHAM, N. W. & P J. HUNTER, 1970, Terrestrial 
slugs. Hutchinson, London. 184 pp. 

SCHMID, G., 1970, Arion lusitanicus in Deutsch- 
land. Archiv für Molluskenkunde. 100: 95-102. 

SMITH, В. J., 1966, Maturation in the reproductive 
tract of Arion ater (Pulmonata: Arionidae). Mala- 
cologla. 4: 325-349. 

SHELFORD, V. E., 1927, An experimental investi- 
gation of the relations of the codling moth to 
weather and climate. Bulletin of the Illinois State 
Natural History Survey 16:311 -440. 



SOKOLOVE, P G. & E. J. MCCRONE, 1978, Re- 
productive maturation in the slug Limax maximus 
and the effects of artificial photoperiod. Journal of 
Comparative Physiology (A)^25■. 317-325. 

SOUTH, A., 1 982, A comparison of the life cycles of 
Dereceras reticulatum (Müller), and Arion inter- 
medius (Normand) (Pulmonata: Stylommato- 
phora) at different temperatures under laboratory 
conditions. Journal of Molluscan Studies. 48: 
233-244. 

SOUTH, A., 1989, A comparison of the life cycles of 
the slugs Dereceras reticulatum (Müller) and 
Arion intermedius (Normand) on permanent pas- 
ture. Journal of Molluscan Studies. 55: 9-22. 

VON PROSCHWITZ. T, 1994, Iberiaskogsnegl - 
en art pa spredning i Norge. Ettertrykk fra Fauna, 
47(3), 195-203. 

VON PROSCHWITZ, T, 1997, Arion lusitanicus 
Mabille and A. rufus (L.) in Sweden: A compari- 
son of occurance, spread and naturalization of 
two alien slug species. Heldia. 4, (5): 137-138. 

WEBLEY, D., 1964, Slug activity in relation to 
weather. Annals of Applied Biology. 53: 407-414. 

WILSON, M., D. M. GLEN & S. K. GEORGE, 1993, 
The rhabditid nematode Phasmarhabditis her- 
maphrodita as a potential biological control agent 
for slugs. Biocontrol. Science and Technology 3: 
503-511. 

WOLDA, H. & D. A. KREULEN, 1973, Ecology of 
some experimental populations of the landsnail 
Cepaea nemoralis (L.).ll. Production and survival 
of eggs and juveniles. Netherland Journal of Zo- 
ology 23: 168-188. 

YOUNG, A. G., G. R. PORT A. D. CRAIG, D. A. 
JAMES & T GREEN, 1996, The use of refuge 
traps in assessing risk of slug damage: a com- 
parison of trap matenal and bait. In: i. F. hender- 
son, eds. Slug and snail pests in agriculture, 
BCPC Monograph. 66: 133-140. 

YOUNG, A. G., G. R. PORT & D. B. GREEN, 1993, 
Development of a forecast of slug activity: valida- 
tion of models to predict slug activity from meteo- 
rological conditions. Crop Protection, 12: 323- 
236. 

Revised ms. accepted 18 July 2000 



MALACOLOGIA, 2001, 43(1-2): 33-57 

THE UNCERTAIN HISTORY OF LAND SNAILS ON BARBADOS: 
IMPLICATIONS FOR CONSERVATION 

Ronald Chase^ & David G. Robinson^ 



ABSTRACT 

There is a growing need to document and conserve molluscan biodiversity, both for scholarly 
reasons and for public benefit. While the pursuance of these goals necessarily relies on histori- 
cal records, the accuracy of such records is often taken for granted. We analyzed six previously 
published lists of land snails on the island of Barbados, and we compared them with results from 
our own field survey and our study of institutional collections. The current fauna contains six en- 
demic species. Another endemic, Bulimulus fuscus, is probably extinct, and the status of two ad- 
ditional endemics, Lucidella barbadensis and Pseudopineria barbadensis, is unknown. Our total 
of 22 resident species is close to the total number of confirmed species collected by three ear- 
lier workers dating from 1862, but there are considerable differences in the four lists. When any 
one list is compared with any one of the others, each contains from one to six species that are 
absent from the other. Altogether, we confirm 31 species as present on Barbados at some time 
in the period 1862 to the present, compared with a total of 58 species reported by earlier work- 
ers. Our analysis allows us to confirm just 23 of the 37 species reported by Brown in 1 903, whose 
list is the basis for a widely consulted conservation reference. By examining institutional collec- 
tions and tracking down all pertinent literature, we discovered numerous errors of identity, local- 
ity and taxonomy. Adding to the task facing modern workers is the finding that at least 136 
species names have been used to refer to 38 valid taxa, as a result of misidentifications, syn- 
onyms and genus/species combinations. We conclude that indications of historical trends in snail 
diversity should be treated with caution until critically evaluated. 

Key words: Barbados, biodiversity, conservation, land snails, taxonomy. 



INTRODUCTION 

The goals of biological conservation now 
extend to land snails (van Bruggen at al., 
1995; Killeen et al., 1998), and studies of the 
diversity of land snail populations, while for- 
merly of interest only to biologists, are in- 
creasingly being used to document habitat 
degradation (Wäreborn, 1992; Gascoigne, 
1994; Getz & Uetz, 1994; Graveland et al., 
1994). For all these broadening purposes, it is 
generally recognised that historical records of 
fauna in a given locality are crucial, yet little 
consideration has been given to their accu- 
racy. There exist many records collected not 
by trained professionals but by amateurs who 
sometimes lack adequate knowledge or ex- 
perience. As Willing (1998) has pointed out, 
we should be grateful to the Conchological 
Society of Great Britain and Ireland, which 
has, since its founding in 1876, enforced pro- 
tocols to ensure authenticity. However, organ- 
isations such as this do not exist in other lo- 
calities, and even professional malacologists 



make unwitting errors. Policymakers as well 
as scholars often refer to published sum- 
maries of fauna! lists (e.g., Groombridge, 
1992) without examining the factual accuracy 
of the data included therein. Thus, although 
snails provide good historical records be- 
cause their shells have been collected for 
centuries, errors in reporting the data can lead 
to false interpretations and/or misguided con- 
servation efforts. 

There are many sources of error in faunal 
lists. To begin, surveys of snails in any geo- 
graphic region must rely on samples collected 
at selected sites, which necessarily give only 
estimates of true distributions, and for which 
the optimal method remains controversial. 
Identification of species by shell morphology 
alone is often impossible and, when it is pos- 
sible, genuine expertise is required. Because 
species names have changed so often, con- 
fusion can arise when two collectors or com- 
mentators apply different names to the same 
taxon. Voucher specimens are often missing 
or inaccessible. In addition to these problems, 



^Department of Biology, McGill University, Montréal, Québec НЗА 1B1, Canada; ronaid.chase@mcgill.ca 

^Research Associate, Department of Malacology, Academy of Natural Sciences, Philadelphia, Pennsylvania 19103, USA 



33 



34 



CHASE & ROBINSON 



early workers sometimes reported second- 
hand information of dubious validity. 

In this paper, we critically examine the his- 
torical record of land snails on Barbados. Our 
purpose was not to conduct a definitive sur- 
vey of the extant fauna, but rather to assess 
the accuracy and reliability of previous rec- 
ords. Small islands have traditionally been 
favoured locations for malacological investi- 
gations because of their manageable size and 
geographical isolation (Peake, 1981: Solem, 
1984). As a consequence, there is a fairly 
good record for Barbados, both in the litera- 
ture and in institutional collections. Our con- 
cern in this paper is the extent to which errors 
and ambiguities from the past may cause dif- 
ficulties for the modern investigator. 

The historical record of land snails on Bar- 
bados begins with Griffith Hughes (1750), 
who included a brief description of three 
snails in his account of the island's natural his- 
tory. Specifically, he mentioned the "land snail 
. . . generally of an ash-colour, or black" 
(possibly Pleurodonte Isabella), the "small 
spiral snails ... not above half an inch long, 
very slender, and sharp-pointed" (possibly 
one of the subulinids), and the "dung-snail 
. . . very small, and resembles a crusty wart" 
(possibly Streptaxis glabei). The first mollus- 
can survey was by Thomas Bland, who lived 
and collected in Barbados from 1842 to 1849 
(Abbott, 1973). Portions of Bland's material 
were deposited in ANSP BMNH and MCZ.^ It 
is unclear from Bland's publication (Bland, 
1862) how many of the specimens he himself 
collected. He notes that some specimens 
were collected by Rev. J. Parkinson and Mr. 
Gill. Other specimens were likely collected by 
the governor of Barbados, Rawson W. Raw- 
son, or his agents (records found in the MCZ). 
Next, in the period 1872-1876, Phillip Car- 
penter deposited material deposited in the 
RM. The Carpenter material was collected by 
Governor Rawson or his agents (letters in the 



^Institutional acronyms: 

ANSP Academy of Natural Sciences, Philadel- 
phia, Pennsylvania, USA 

BMNH Natural History Museum, London, Eng- 
land, UK 

FLMNH Florida Museum of Natural History, 
Gainesville, Florida, USA 

FMNH Field Museum of Natural History, Chicago, 
Illinois, USA 

MCZ Museum of Comparative Zoology, Harvard 
University, Cambridge, Massachusetts, 
USA 

RM Redpath Museum, McGill University, Mon- 
tréal, Québec, Canada 



McGill University Archives). Kobelt (1880) 
published a list of species from Barbados 
based on Bland's list, but with the addition of 
Hyalina incisa (Pfeiffer). Colonel H. W. 
Feilden collected shells from Barbados during 
1888 and 1889, and some of his material was 
deposited at ANSP and BMNH. A description 
was published by Smith & Feilden (1891), 
based on Feilden's collection. W. H. Rush was 
a member of a malacological expedition to a 
number of Caribbean islands that included a 
stopover at Bridgetown, Barbados (Rush, 
1891). Some of Rush's material is in the 
ANSP collection. The Barbados snails were 
described by L. B. Brown (1903), who de- 
posited some of his material in the ANSP and 
the BMNH. Brown also referred to "a type col- 
lection of nearly all the species enumerated" 
that had "been placed in the recently-formed 
Museum attached to the Barbados Natural 
History Society." Unfortunately, there is today 
no trace of such a collection at that institution. 
The most recent records are by J. B. Hender- 
son (1919), the malacologist aboard a zoo- 
logical expedition to the Caribbean mounted 
by the University of Iowa. 



METHODS 

Museum Collections 

Several major institutional collections (iden- 
tified in footnote 1) were surveyed to locate 
material deposited by earlier workers. We at- 
tempted to confirm, or in some cases re-iden- 
tify, the snails that had been collected from 
Barbados over the last 150 years. Additional 
material found in these museum collections, 
deposited by collectors other than those men- 
tioned in the Introduction and in Table 1, pro- 
vided further confirmations for certain taxa. 
The malacological literature was also sur- 
veyed, in particular for taxonomic works relat- 
ing to species represented, or reportedly rep- 
resented, in Barbados. 

Field Survey 

Surveys were conducted by R. Chase in 
December 1993, December 1994, and March 
1996. D. Robinson conducted a survey in Oc- 
tober 1 997. The survey sites are shown in Fig- 
ure 1 , and descriptions are given below. Most 
sites were examined at least twice, for a total 
of 2-12 hours per site. All sites were exam- 
ined at least once during rainfall or immedi- 



LAND SNAILS OF BARBADOS 



35 



12. 
10< 
9 



59°30' W 



15 



17,18 



13°15'N 



Speightstown 



16 



13 



20,21 



11 



19 




22 



24- 



N 

Ж 



Bridgetown 



14 



4 km 



Elevation >180 m 



FIG. 1 . Map of Barbados showing locations of sampling sites. 



ately thereafter. The sites were chosen to pro- 
vide a fair representation of the Island's geog- 
raphy and to maximise the total species 
count. Soil samples where taken at some lo- 
calities (Stations 1, 2, 7 and 9) where there 
appeared to be greater potential for small 
species (loose soil with considerable organic 
and calcareous particulate matter) and exam- 
ined under a binocular microscope. Cursory 
examinations of numerous other sites failed to 



produce any species additional to those found 
at the listed sites. The southern portion of the 
Island was surveyed less than other regions 
because it is heavily populated, relatively dry, 
and low lying. It Is also widely cultivated with 
sugar cane, and the cane fields are treated 
with pesticides. Coordinates were taken using 
a hand-held GPS (Eagle Explorer), but In In- 
stances where this was not possible (for ex- 
ample the presence of the tree canopy block- 



36 



CHASE & ROBINSON 



ing satellite readings), coordinates were take 
from topographic maps. 

Survey Sites 

1. Grounds of Bellairs Research Institute 
(McGill University), Holetown, Parish of 
St. James [13^11'33"N, 59°38'21"W- 
alt. 1 m]. 

2. Mahogany stand on the grounds of 
Porter's House, and adjacent wooded 
gully, Holetown, Parish of St. James [13° 
11'44"N, 59 38'18"W-alt. 2-4 m]. This 
locality is specifically mentioned by 
Brown (1903) as one of his collecting 
sites. Also known as Porter's Estate or 
Porter's Wood. 

3. Partially wooded hill northeast of Royal 
Westmoreland Landscape Garden Cen- 
tre, Holetown, Parish of St. James [13" 
12'01"N, 59°38'04"W-alt. 10 m]. 

4. Gully east of Royal Westmoreland Land- 
scape Garden Centre, Holetown, Parish 
of St. James [1 3°1 2'01 "N, 59"38'04"W - 
alt. 3 m]. 

5. Jack-in-the-Box Gully, Parish of St. 
Thomas. Located approximately 2 km 
south of Welchman Hall Gully [geodesic 
coordinates unavailable]. 

6. Edge of sugar cane field, adjacent to St. 
Thomas Church, Parish of St. Thomas 
[13'ir07"N, 59^^36'46"W-alt. 115 m]. 

7. Welchman Hall Gully, Parish of St. 
Thomas [13°11'44"N, 59°34'37"W to 
13°11'17"N, 59°34'34"W-alt. 240-270 
m]. 

8. Unnamed gully between Welchman Hall 
Gully and Lion Castle, Parish of St. 
Thomas [13°11'44"N, 59 34'35"W -alt. 
240 m]. 

9. Dry coastal forest 200 m south of Har- 
rison Point Lighthouse, Parish of St. Lucy 
[13^^18'23"N, 59^^38'58"W-alt. 30 m]. 

10. Steep rocky slope beneath Harrison 
Point Lighthouse, Parish of St. Lucy [13° 
18'31"N, 59'38'55"W-alt. 15m]. 

1 1 . East Coast from Bathsheba, Parish of St. 
Joseph, south to the Congor Rocks, 
Parish of St. John [geodesic coordinates 
unavailable]. 

12. Friendship, halfway between Crabhill Po- 
lice Post and Hannays intersection, 
Parish of St. Lucy [13^^18'32"N, 59°37" 
45"W-alt. 45 m]. 

13. Andromeda Botanic Gardens, Bath- 
sheba, Parish of St. Joseph [13'12'25"N, 
59'31'04"W-alt. 60-90 m]. 

14. Ashford plantation, Parish of St. Philip 



[geodesic coordinates unavailable]. 
Courtesy of Dr. Joan Marsden. 

15. 100 m southeast of Mullins Bay, Parish of 
St. Peter [13°14'00"N, 59°38'26"W-alt. 
2 m]. 

16. Turner's Hall Woods [Scotland District], 
Parish of St. Andrew [1 3"1 3'23"N, 59°35' 
60"W-alt. 150-180 m]. Although these 
woods are often referred to as the only 
virgin stand left on the island (Carrington, 
1993), the abundance of introduced 
snails would seem to indicate that the 
fauna, at least, is not as "virgin" as others 
have suggested. 

17. Barbados Wildlife Reserve, Parish of St. 
Andrew [13°16'04"N, 59°35'37"W-alt 
220-240 m]. 

18. Grenade Hall Signal Site, Parish of St. 
Andrew [13°16'05"N, 59°35'33"W-alL 
255 m]. 

19. Roadside, between Malvern House and 
adjacent sugar cane field. Parish of St. 
Joseph [13"11'43"N, 59°31 '30"W-alt. 
275 m]. 

20. Woods alongside sugar cane fields of 
Malvern Plantation, on top of Hackleton's 
Cliff, Parish of St. Joseph [13°11'58"N, 
59°3r21"W -alt. 300 m]. 

21. Relatively undisturbed forest, beneath 
Hackleton's Cliff, adjacent to Malvern 
Plantation, Parish of St. Joseph [13°11' 
58"N, 59°31 '21 "W -alt. 290 m]. This site 
represents probably the least altered 
habitat encountered during the study. The 
absence of any introduced snails, with the 
occurrence of only three endemic species 
{Helicina fasciata substriata Gray, 
Brachypodella costata (Guilding), and 
Pleurodonte Isabella (Férussac)), sug- 
gests that further exploration here for 
other endemics would be worthwhile. 

22. Grounds of Villa Nova, Parish of St. John 
[13°10'57"N, 59°31'32"W-alt. 240 m]. 

23. Oxnards Crescent, Parish of St. James 
[geodesic coordinates unavailable]. 
Courtesy of Dr. Angela Fields. 

24. Town of Valley, Parish of St. George [ge- 
odesic coordinates unavailable]. Cour- 
tesy of Dr. Angela Fields. 

RESULTS 

Survey Results Compared with 
Previous Records 

The results of our survey, together with 
those of earlier workers, are shown in Table 1 . 
A taxonomy of the species is given in the sec- 



LAND SNAILS OF BARBADOS 



37 



tion below. For convenience, Carpenter is re- 
ferred to as an "author" even though he did 
not publish his findings; his records are dated 
by the year (1876) in which he last received 
specimens from Barbados. 

We found a total of 22 species of land 
snails. Three of these are new records for 
Barbados, namely Happiella cf. decolarata, 
Luntia insignis and Zachrysia provisoria. ¡Hap- 
piella cf. decolorata and Luntia insignis may 
be new to the island or they may have been 
missed by earlier workers because they are 
uncommon and relatively inconspicuous. 
Zachrysia provisoria Is particularly common in 
lowland parts of the island, especially along 
the East Coast where it is the dominant snail 
species in some areas. It is an introduced 
species not previously reported as a member 
of the Barbadian fauna. 

We failed to find specimens of seven 
species for which there are either confirmed 
records for Barbados or unconfirmed records 
but with a likelihood of occurrence based on 
distributions on nearby islands (Table 1). 
Three of the missing species are endemics. 
Following Breure (1974), It appears that Bu- 
limulus fuscus Is extinct. However, further dili- 
gent search may yet turn up Lucidella bar- 
badensis and Pseudopineria barbadensis. 

Although the 22 species found In our survey 
corresponds fairly closely to the total numbers 
of confirmed species found by the most pro- 
ductive of earlier workers (Bland: 21 ; Smith & 
Fellden: 19; Brown: 23), an analysis of the 
records shows that the composition of the fau- 
nal lists has undergone constant change. 
Table 2 shows the number of species reported 
by any one worker but not by another, which 
Is a measure of faunal instability and/or inac- 
curate reporting. If the analysis is restricted to 
the present study plus the three most produc- 
tive earlier workers (bold font in Table 2), an 
average of 3.58 species is reported by one 
worker but not by another (mean of all bolded 
numbers; range, 1 -6). Examination of the row 
totals reveals no clear historical trend, sug- 
gesting a constant rate of novel observations. 
Similarly, there is no clear historical trend in 
the column totals, suggesting that the authors 
worked with the same degree of accuracy. 

In reviewing the results from earlier sur- 
veys, many errors or ambiguities were dis- 
covered. Several categories of uncertain 
records are indicated in Table 1, and a nu- 
merical summary is given in Table 3. The 
sources of uncertainty include misidentifica- 
tions, unverified records, and incomplete 
naming. Further details are provided in the 



taxonomic section below. Overall, we are un- 
able to confirm about one-fifth of all previous 
records. 

Taxonomy 

All species reported from Barbados are in- 
cluded below, whether from the faunal studies 
conducted by earlier workers, or from mention 
of individual species in taxonomies of particu- 
lar genera or families. Specimens or lots from 
major institutional collections were examined. 
The examined specimens comprised voucher 
materials from earlier workers and any other 
lots specifically with locality data for Barba- 
dos. An essential synonymy is provided for 
each taxon, meaning that the treatment is not 
exhaustive for species other than the Barba- 
dos endemics. Species citations are given as 
used by the original authors, plus any locality 
data provided. Our intention is to provide suf- 
ficient detail to convey the intricacy of the his- 
torical record. ^ 

Family HELICINIDAE 
Helicina fasciata substriata Gray, 1824 

Helicina substriata Gray, 1824: 66, pi. 6, fig. 4; 

Bland, 1862: 351; Gibbons, 1879: 134; 

Kobelt, 1880: 284; Smith & Fellden, 

1891:256; Brown, 1903:271 
Holotype: not found 
Helicina Occidentalis Guilding, 1828a: 529 

{partim: Barbados only) 
Helicina conoidea Pfeiffer. Sowerby, 1864: pi. 

270 (Helicinidae pi. 5), figs. 168, 169; 

1873: pi. 6, fig. 49; Smith & Feilden, 

1891: 256, non Pfeiffer, 1854 
Helicina convexa Pfeiffer. Rush, 1891: 67, 

non Pfeiffer, 1 849 
Helicina fasciata substriata Gray. Wagner, 

1911: 334, pl. 67, flg. 6-7; Henderson, 

1919: 95-96; Pilsbry, 1930: 229 

Distribution: Subspecies (variation ?) H. f. 
substriata Gray appears to be restricted to 
Barbados. The typical subspecies, H. f. fasci- 
ata, has a wider distribution in the Lesser 
Antilles. 

Status in Barbados: Locally abundant. 

Material Collected From: Sites 2, 3, 4, 9, 10, 
20, and 21. 

Additional Material Examined: ANSP 85450 
(12 specimens /eg/i Brown); BMNH 1998103 

^ legit = collected by; ex = from the collection of 



38 



CHASE & ROBINSON 



X X X X 

X X X 

X X X X 

X - X 

X X X X 

X X X 

X X XXX 

X XX 

X 
X X X 

X X X X X 

P 



21 



TABLE 1. Historical record of species diversity and results of the present survey. Symbols indicate the degree of authen- 
ticity of the individual records. Only valid species names are listed. In many cases, synonyms were used in the original 
records, for details of which see the taxonomy section in Results. Records in section e may also appear under the correct 
name in sections a-d. Column counts for sections a-d include only "X" and "x" symbols. 

Smith & 
Bland Carpenter Feilden Rush Brown Henderson Present 
1862 1876 1891 1891 1903 1919 Study 

(a) Endemic Taxa (9) 
Brachypodella costata (Guilding, 1828) 
Bulimulus fuscus Guilding. 1828 
Glyphyalinia barbadensis. new name 
Heliana fasciata substriata Gray, 1824 
Lucidella barbadensis (Pfeiffer, 1854) 
Pleurodonte Isabella (Férussac, 1822) 
Pseudopineria barbadensis Krauss, 1996 
Succinea barbadensis Guilding, 1828 
Truncatella barbadensis Pfeiffer, 1 857 

(b) Lesser Antillean and/or South American Taxa (8) 
Cecllioldes consobrinus minutissima (Guppy, 1868) 
Gastrocopta barbadensis (Pfeiffer, 1853) 
Happiellad. decolórala (Drouè\. 1859) 
Luntia insignis Smith, 1898 
Megalobulimus oblongus (Müller, 1774) 
MIradlscops implicans (Guppy, 1868) 
Orthalicus maracaibensis subpulchella (Pilsbry, 

1899) 
Slreplaxis glaber (Pfeiffer, 1 849) 

(c) Pan-Canbbean Taxa (5) 
Bullmulus guadalupensis (Bruguière, 1789) 
Cecllioldes aperta (Swainson, 1840) 
Lacteoluna selenlna (Gould, 1848) 
Lucidella plicatula (Pfeiffer, 1849) 
Zachrysia provisoria (Pfeiffer, 1858) 

(d) Pan-Tropical Taxa (8) 
Allopeas gracile (Hutton, 1 834) 
/í//opeas m /сга (d'Orbigny, 1835) 
Beckianum beckianum (Pfeiffer, 1846) 
Bradybaena simllaris (Rang. 1831) 
Gu/e//a b/co/or (Hutton, 1834) 
Leptinarla lamellata (Potiez & Michaud, 1835) 
Opeas hannense (Rang, 1 831 ) 
Subulina octona (Bruguière, 1792) 
Total number of confirmed taxa: 

(e) Dubious or Unrecognizable Taxa (12) 
Bullmulus diaphanus fraterculus (Potiez & 

Michaud. 1835) 
Bullmulus tenuissimus (d'Orbigny, 1 835) 
Cecllioldes acicula (Müller, 1774) 
Cerlon uva (Linné, 1 758) 
Gastrocopta pelluclda (Pfeiffer, 1848) 
Lacteoluna subaquila (Shuttleworth, 1834) 
Lacteoluna turbiniformis (Pfeiffer, 1839) 
Lucidella rugosa (Pfeiffer, 1839) 
Opeas sp. 

Polydontes perplexa (Férussac, 1 821 ) 
Pleurodonte dentiens (Férussac, 1 821 ) 
Succinea bermudensis Pfeiffer, 1 857 
Truncatella sp. 

X Confirmed taxa (seen): species collected and reported by authors, and confirmed by the existence of corresponding specimens in insti- 
tutional collections. 

X Confirmed taxa (unseen): species collected and reported by authors; specimens not found in institutional collections but the record is 
confirmed by ourselves or other workers. 

— Attributed taxa: species reported by authors, but only by attribution to earlier publications. 

p Unconfirmed taxa (likely): species collected and reported by authors; specimens not examined by us; possible occurrence on Barbados 
based on distribution patterns on nearby islands and on the South American mainland. 

u Unconfirmed taxa (unlikely): species collected and reported by authors, but unlikely to be part of the Barbados fauna based on pub- 
lished accounts of geographic distribution. 

?? Dubious taxa (locality): species reported with correct identification based on our own examination of the same specimens, but with dubi- 
ous or incorrect locality data. 

? Dubious taxa (identification): species reported with suspected incorrect identification based on our own examination of the same spec- 
imens. 

# Unrecognizable taxa: taxon name given incompletely by authors. 



19 



10 



X 
X 
X 
X 

P 
X 
X 
X 
23 



12 



X 
X 
X 

X 

X 
X 
X 
X 
X 

X 

X 

X 
X 

X 
X 
X 
22 



# 



LAND SNAILS OF BARBADOS 



39 



TABLE 2. Matrix of discrepancies between reports of confirmed species. Numbers represent species 
reported by author(s) listed at the left but not reported by author(s) listed at the top. Bold is used to highlight 
studies that reported approximately the same number of total species (range, 19-23). 









Smith & 








Present 


ROW 




Bland 


Carpenter 


Feilden 


Rush 


Brown 


Henderson 


Study 


TOTALS 


Bland 


- 


12 


4 


13 


1 


10 


5 


45 


Carpenter 





— 





2 


1 


2 


1 


6 


Smith & Feilden 


2 


11 


— 


10 


1 


6 


3 


33 


Rush 


2 


5 


1 


— 





2 





10 


Brown 


3 


15 


5 


11 


— 


10 


4 


48 


Henderson 


2 


5 





4 





— 





11 


Present study 


5 


15 


6 


12 


4 


10 


— 


52 


COLUMN TOTALS 


14 


63 


16 


52 


7 


40 


13 





TABLE 3. Species uncertainty. Numerical summary of the degree of authenticity of faunal studies. The char- 
acterization of taxa is taken from Table 1 , with the same definitions of categories as given there. 





Confirmed taxa 


Unconfirmed taxa 


Dubious taxa 




















Attributed 


Unrecognizable 


















Seen 


Not seen 


Likely 


Unlikely 


ID 


Locality 


taxa 


taxa 




(X) 


(X) 


(P) 


(u) 


(?) 


(??) 


(-) 


(#) 


Bland, 1862 


11 


11 




3 










Carpenter, 1876 


8 
















Smith & Feilden, 


3 


16 




1 




1 


3 




1891 


















Rush, 1891 


3 


7 






1 






1 


Brown, 1903 


20 


3 


2 




5 




5 




Henderson, 1919 




12 












1 


Present study 


22 

















(28 specimens legit Brown); BMNH 
1888.8.7.93-105 (13 specimens legit 
Feilden); FLMNH 185624 (4 miles east of 
Holetown, St. James -19 specimens); MCZ 
90491 (24 specimens /egf/f Rawson ex Bland); 
MCZ 90492 (27 specimens legit Rawson ex 
Bland; MCZ 318942 (specimens legit Rawson 
exBinney); MCZ 107933 (Blowers-2 speci- 
mens legit Kugler); MCZ 83527 (Bridgetown - 
1 specimen legit Garman). 

Discussion: This taxon belongs to the Heli- 
cina fasciata complex, the typical subspecies 
having been described from Puerto Rico and 
being distributed throughout the Lesser An- 
tilles, as well as on some western Caribbean 
islands. Minor differences in island popula- 
tions have led to a number of names being pro- 
posed, and only a taxonomic work beyond the 
scope of this study would determine their va- 
lidity. Pilsbry (1930) considered that Barbados 
specimens match the description and figure of 
Helicina substriata Gray, andonthatbasishe 
designated Barbados as the type locality for 
this taxon without designating a lectotype. 

The specimens of this species on Barbados 
range considerably in size, larger specimens 



living in more humid conditions at higher ele- 
vations than the smaller form that predomi- 
nates in drier areas, especially along the 
northwestern coast. This arboreal species 
was collected at many of the localities stud- 
ied, and is particularly abundant where there 
is less human disturbance, crawling on leaf 
surfaces, tree trunks and aerial tree roots. 



Lucidella (Poeniella) barbadensis 
(Pfeiffer, 1854) 

Helicina Barbadensis Pfeiffer, 1854: 60 ("Bar- 
badoes"); Bland, 1862: 351; Kobelt, 
1880: 284; Smith & Feilden, 1891: 256; 
Brown, 1903:266,271 

Type material: BMNH 1998024 (Cuming col- 
lection) 

Helicina conoidea Pfeiffer, 1854: 53 ("Barba- 
does. West Indies") 

Possible type - BMNH 1 998025 (Cuming col- 
lection) 

Not Helicina conoidea Pfeiffer. Sowerby, 
1864: pi. 270 (Helicinidae pi. 5), figs. 168, 
169; 1873: pi. 6, fig. 49 (=Helicina fasci- 
ata var. substriata Gray, 1824) 



40 



CHASE & ROBINSON 



Lucidella holoserica Wagner, 1910: 350-351 , 
pl. 69, fig. 16-19 ("die Insel Barbados") 

Lucidella (Poeniella) barbadensis (Pfeiffer). 
Baker, 1962: 18) 

Distribution: Endemie to Barbados. 

Status: Extinct? 

Material Examined: ANSP 14916 (4 speci- 
mens legit Bland): ANSP 14926 (14 speci- 
mens [labelled as "Helicina conoidea Pfr.?"] 
legit Shuttleworth): ANSP 85468 (12 speci- 
mens /eg/í Brown): BMNH (5 specimens legit 
Brown): BMNH 97.10.12.3-7 (Hackleton's 
Cliff -5 specimens legit Pavey): MCZ 90489 
(2 specimens ex Bland): MCZ 107932 
(Blowers -1 specimen legit Kugler). 

Discussion: The identity of Helicina conoidea 
has been problematical since its first descrip- 
tion. Pfeiffers taxon is a synonym of Lucidella 
barbadensis. described by him in the same 
year in the same paper. An examination of the 
material in the BMNH used by Pfeiffer to de- 
scribe the two taxa shows them to be within 
the range of variation of a single species. 
Sowerby (1873) in his Helicina monograph il- 
lustrated a totally different species, a fact that 
was somewhat acidly pointed out by Bland 
(1857: 247), although Bland himself seemed 
confused as to the identity of the taxon (see 
under Lucidella plicatula below). Smith & 
Feilden (1891) merely referred to the speci- 
mens in the Cuming collection. Brown even 
expressed doubt as to the occurrence of He- 
licina conoidea Pfeiffer on Barbados; he may 
indeed have been considering H. conoidea of 
Bland, as Brown did collect specimens of L. 
barbadensis from Porter's Wood. 

This species was reported as uncommon in 
the past, and no specimens were encoun- 
tered during our survey. 

Lucidella {Poeniella) plicatula (Pfeiffer, 1849) 

Helicina plicatula Pfeiffer, 1849: 123 ("Mar- 
tinique") 

Helicina conoidea Pfeiffer. Bland, 1862: 351; 
Kobelt, 1880: 284, non Pfeiffer, 1854 

Helicina rugosa (Pfeiffer). Brown, 1903: 266, 
271, пол Pfeiffer, 1839 

Distribution: Hispaniola; Puerto Rico and the 
Lesser Antilles. 

Status in Barbados: Extirpated? 

Material Examined: ANSP 14783 (3 speci- 
mens legit Bland); MCZ 318945 (10 speci- 



mens ex Bland); MCZ 107931 (Blowers -1 
specimen /eg/f Kugler). 

Discussion: The only known Barbados spec- 
imens of this widely distributed West Indian 
species available for inspection were col- 
lected by Bland, but misidentified as Helicina 
conoidea Pfeiffer. Brown's (1903) reference to 
the Cuban taxon Helicina rugosa Pfeiffer, de- 
scribing it as a "smaller shell" and "identified 
by the very strong diagonal striation," clearly 
is a reference to this species, and establishes 
its occurrence in Porter's Wood (St. James) at 
the time. 

Family TRUNCATELLIDAE 

Truncatella barbadensis Pfeiffer, 1 857 

Truncatella Barbadensis Pfeiffer, 1857: 337 
("Island of Barbadoes"); Bland, 1862: 
351; Kobelt, 1880: 284; Smith & Feilden, 
1 891 : 255-256; Brown, 1 903: 271 ; Torre, 
1960:87 

Types: BMNH (Cuming Collection)- lost. 

7 Truncatella sp. Henderson, 1919: 96 

Truncatella (Truncatella) bilabiata Pfeiffer. 
Clench & Turner, 1948: 153-154 (partim) 

Truncatella sp. nov. Rosenberg, 1996: 682- 
693 

Distribution: Endemic to Barbados. 

Status: Locally abundant. 

Material Collected From: Sites 9 and 10. 

Additional Material Examined: ANSP 85463 
(8 specimens legit Brown); ANSP 397286 
(Harrison Point Lighthouse - 1 00+ specimens 
legit Rosenberg); BMNH 88.8.7.106-17 (12 
specimens legit Feilden); BMNH 88.8.7.84- 
92 (9 specimens legit Feilden); BMNH 
1998105 (8 specimens /eg/i Brown); FLMNH 
271905 (Harrison's Cave -6 specimens legit 
F. G. Thompson); 

Discussion: Although Pfeiffer described Trun- 
catella barbadensis as a distinct species from 
Barbados, Clench & Turner (1948) syn- 
onymized it with the marine littoral and more 
widespread T bilabiata (Pfeiffer), and despite 
Torre's (1960) arguments that the Barbadian 
species should be considered distinct, this 
has generally been followed by workers ever 
since. Rosenberg (1996) recognized that the 
form he found on Barbados was quite differ- 
ent from other known Truncatella species 
from elsewhere in the Caribbean, suggested 



LAND SNAILS OF BARBADOS 



41 



that it was a new species, but he did not de- 
scribe it. Feiiden's material in the British 
Museum and Brown's material at both the 
British Museum and the Academy of Natural 
Sciences clearly are this species. Unfor- 
tunately, the matter cannot be laid to rest con- 
clusively, because Pfeiffer's type material is 
lost, and a neotype will have to be designated 
in order to define the taxon. Henderson's 
(1919) reference to a Truncatella species 
could be this taxon, or it could be one of the 
marine littoral Truncatella species that are 
also part of the Barbados fauna. 

This species lives primarily in the leaf litter 
of coastal forest under completely terrestrial 
conditions at over 30 m altitude, at the top of 
the coastal cliffs. However, it can tolerate 
habitats influenced by the marine environ- 
ment, some individuals living closer to the 
ocean under stones and boulders in areas 
somewhat affected by distant sea spray. It 
does not appear to live in the supralittoral 
zone environment, with which other species 
of this genus are normally associated. 

Family SUCCINEIDAE 
Succinea barbadensis GuM\r\g, 1828 

Succinea Barbadensis Guilding, 1828a: 532; 
Bland, 1862: 351, table 2; Gibbons, 
1879: 132; Kobelt, 1880: 284; Smith & 
Feilden, 1891: 255; Rush, 1891: 69; 
Brown, 1903: 270 

Succinea Bermudensis Pfeiffer. Bland, 1862: 
351 , tabl. 2; Kobelt, 1 880: 284, non Pfeif- 
fer, 1857 

Succinea sp. Henderson, 1919: 96 

Distribution: Barbados; throughout the West 
Indies? 

Status in Barbados: Locally abundant. 

Material Collected From: Sites 3, 4, 7, 9, 13, 
16, 18, and 20. 

Additional material examined: ANSP 10249 
(1 specimen legit Rush); ANSP 85459 (6 
specimens legit Brown); ANSP 332700 
(Porter's Estate 1 specimen /eg/f Hussey); 
RM 12075 (5 specimens /egf/íRawson ex Car- 
penter); BMNH 88.8.7.118-26 (9 specimens 
/eg/i Feilden); BMNH 1998104 (11 specimens 
legit Brown): MCZ 90372 (11 specimens legit 
Rawson ex Bland); MCZ 90373 (5 specimens 
legit Rawson ex Bland); MCZ 74182 (9 spec- 
imens legit Rawson); MCZ 318943 (near 



Gray's Cove, St. Lucy-St. Peter- 14 speci- 
mens /egf/i Clench). 

Discussion: A widespread and variable 
species in Barbados. Despite the variability in 
shell shape, all the specimens dissected dur- 
ing this study show an absence of anatomical 
variation and are considered to represent a 
single species. Unfortunately, the taxonomy 
of Caribbean Succinea species is in a state of 
disarray, little anatomical work having been 
done to properly define the numerous named 
taxa. It is therefore impossible to determine 
the true geographical extent of this species. 
The name S. barbadensis has been used in 
the literature for shells collected throughout 
the West Indies, but those records are here 
excluded from the synonymy. 



Family VERTIGINIDAE 
Gastrocopta barbadensis (Pfeiffer, 1853) 

Pupa Barbadensis Pfeiffer, 1853: 554 ("in in- 
sula Barbadoes"); Bland, 1862: 351; Ko- 
belt, 1880:284 

Pupa Jamaicensis Adams. Bland, 1862: 351; 
Kobelt, 1880:284 

Pupa pellucida Pfeiffer. Bland, 1862: 351; 
Gibbons, 1879: 132; Kobelt, 1880: 284; 
Smith & Feilden, 1891: 254-255; Brown, 
1903: 270, non Pfeiffer, 1848 

Gastrocopta barbadensis (Pfeiffer). Pilsbry, 
1916:83-85, pi. 18, figs. 1-5 

Distribution: Lesser Antilles, Venezuelan off- 
shore islands and coastal Venezuela. 

Status in Barbados: Uncommon. 



Material Collected From: Site 9. 

Additional Material Examined: ANSP 85464 
(11 specimens legit Brown); ANSP 332704 
(Porter's Estate-2 specimens /eg/f Hussey); 
ANSP 328617 (Blowers, St. James -1 speci- 
men legit Kugler); MCZ 90573 (Blowers -1 
specimen /egf/f Kugler). 

Discussion: Various workers have used three 
different names for this species. Pupa pellu- 
cida Pfeiffer, 1848, originally described from 
Cuba, its junior synonym P. jamaicensis 
Adams, 1849, from Jamaica, and P. bar- 
badensis Pfeiffer, 1853, described from 
Barbados. Smith & Feilden (1891) suggested 
all were the same species. There is no evi- 



42 



CHASE & ROBINSON 



dence for the occurrence of Gastrocopta pel- 
lucida (Pfeiffer) on Barbados; its known distri- 
bution is from eastern Mexico, the Bahamas 
Islands and the Greater Antilles, and Ber- 
muda (Pilsbry, 1916). 

Feilden collected Pupa barbadensis at 
Maxwell Hall (Parish of Christchurch), Hussey 
at Porter's Estate (St. James), and specimens 
were collected during this study from eastern 
Parish of St. Lucy. One of the smallest 
species of the Barbados molluscan fauna, it is 
easily missed, and may have a wider distribu- 
tion on the island. 

Pupisoma {Ptychopatula) dioscoricola 
(Adams, 1845) 

Helix dioscoricola Adams, 1845: 16 

Distribution: Ubiquitous throughout the 

Americas. 

Status in Barbados: Rare? 

Material Examined: FLMNH 119895 (Harri- 
son's Cave, St. Thomas -1 specimen legit 
Thompson); 

Discussion: Although a single specimen of 
this species has been collected in Barbados 
in recent years (none was collected during our 
field study), it is likely to be established in Bar- 
bados despite the lack of records, in view of 
its ubiquitous nature in anthropochorous envi- 
ronments throughout the Americas. It is 
minute and easily missed. 

Family CERIONIDAE 

Cerion uva (Linné, 1758) 

Turbo uva Linné, 1758: 765 

Cerion uva ("Lamarck"). Brown, 1903: 270 

Distribution: Endemic to Aruba, Curaçao and 

Bonaire. 

Status in Barbados: Dubious record. 

Discussion: Although Brown mentioned the 
collection of two specimens of this species by 
a Rev. N. B. Watson, one from St. Peter's and 
one from St. Philip's Parishes, there is no 
physical evidence that this species, or indeed 
any species of Cerion has ever been collected 
from Barbados. No specimens of this species 
collected from anywhere other than from the 
Dutch islands off the northern Venezuelan 
coast are in the ANSP, FLMNH or BMNH col- 
lections. 



Family BULIMULIDAE 

Bulimulus guadalupensis (Bruguière, 1789) 

Bulimus Guadalupensis Bruguière, 1789: 313 

Bulimus exilis (Gmelin). Bland, 1862: 351, 
non Helix exilis Müller, 1774 

Bulimulus exilis (Gmelin). Gibbons, 1879: 
130; Kobelt, 1880: 284; Smith & Feilden, 
1891: 252; Brown, 1903: 267, 269; Hen- 
derson, 1919: 202 

Bulimulus exiles [sic] (Gmelin). Rush, 1891: 
69 

Bulimulus (Thaumastus) exilis (Gmelin). 
Smith, 1895: 302, 305 

Distribution: West Indies, and northern South 
America. 

Status In Barbados: Locally abundant. 

Material Collected From: Sites 2, 3, 4, 5, 7, 
12, 13, and 22. 

Additional Material Examined: ANSP 85439 
(6 specimens legit Brown); ANSP 85440 
(6 specimens legit Brown); ANSP 85441 (6 
specimens legit Brown); ANSP 85442 (8 spe- 
cimens legit Brown); ANSP 62059 (6 speci- 
mens legit Rush); RM 13620 (8 specimens 
[labelled as Bulimus exilis] legit Rawson ex 
Carpenter); RM 1 3623 (St. Thomas Parish -3 
specimens [labeled as Bulimus guadalupen- 
sis] legit Rawson ex Carpenter); FLMNH 
113848 (Harrison's Cave, St. Thomas -4 
specimens legit Thompson); MCZ 90167 
(100+ specimens -/ep/i Rawson ex Bland); 
MCZ 83525 (Bridgetown -2 specimens legit 
Garman); MCZ 108728 (St. Joseph's -4 
specimens /eg/f Cockerel I); MCZ 251316 (St. 
Ann's Fort, St. Michael legit Ray & Allen). 

Discussion: This West Indian species is 
found throughout Barbados whereever there 
has been any kind of human activity. Breure 
(1974) considers this species native to the 
Windward Group of the Lesser Antilles, so it 
was probably introduced to Barbados by 
human commerce. 



Bulimulus fuscus Guilding, 1828 

Bulimulus fuscus Guilding, 1828b: 170 (Bar- 
bados) 

Bulimus Barbadensis Pieper, 1854: 61 ("in in- 
sula Barbados"); Bland, 1862: 351; Pils- 
bry, 1897:48-49, pi. 12, fig. 61 

Bulimus fuscus (Guilding). Bland, 1862: 351 



LAND SNAILS OF BARBADOS 



43 



Bulimulus fuscus (Guilding). Kobelt, 1880: 

284 
Bulimulus tenuissimus (Férussac). Smith & 

Feilden, 1891: 252; Brown, 1903: 268 

(doubtful occurrence; attributed to earlier 

workers), non Bulimus tenuissimus d'Or- 

bigny, 1835 
Bulimulus (Bulimulus) fuscus Guilding. 

Breure, 1974: 38-39, pi. V, figs. 1-4; pi. 

VII, fig. 5. 

Distribution: Endemic to Barbados. 
Status: Extinct? 

Material Examined: BMNH 197454 (lecto- 
type designated by Breure, 1974); BMNH 
197455 (2 paralectotypes); ANSP 3506 (3 
specimens /egf/f Bland); ANSP 3507 (1 speci- 
men legit Bland); ANSP 3512 (3 specimens 
legit Bland); ANSP 25612 (8 specimens legit 
Bland); RM 13650 (4 specimens /egf/YRawson 
ex Carpenter); MCZ 90415 (6 specimens legit 
Rawson ex Bland). 

Discussion: Smith & Feilden (1891) syn- 
onymized Bulimus barbadensis Pfeiffer [= Bu- 
limulus fuscus Guilding], which Feilden had 
collected in Barbados, with Bulimulus tenuis- 
simus, a superficially similar Brazilian species. 
Pilsbry (1897: 49) also noted the similarity be- 
tween the two taxa, but confirmed that the lat- 
ter was a distinct Brazilian species. Breure 
(1 974) in his treatment of Caribbean Bulimulus 
suggested that this species may be extinct, 
as all records are from the nineteenth century. 
No specimens were collected during this 
study. 

Bulimulus diaphanus fraterculus 
(Potiez& Michaud, 1835) 

Helix (Cochlogena) fraterculus Férussac, 

1821: 54 ("La Guadeloupe") [nomen 

nudum) 
Bulimus fraterculus "Férussac." Potiez & 

Michaud, 1835: pi. 13, figs. 7-8; 1838: 

141 ("La Guadeloupe") 
Bulimus fraterculus "férussac." Bland, 1862: 

351 
Bulimulus fraterculus "Férussac." Kobelt, 

1880: 284; Smith & Feilden, 1891: 252 
Bulimulus diaphanus (Pfeiffer). Pilsbry, 1897: 

47 (Barbados record), non Bulimus di- 
aphanus Pfeiffer, 1 854 
Bulimulus fraterculus "Férussac." Brown, 

1903: 269 (doubtful occurrence; atthb- 

uted to Bland) 



Bulimulus (Bulimulus) diaphanus fraterculus 
(Potiez & Michaud). Breure, 1974: 
32-34, pi. 3, figs. 6-10; pi. 7, fig. 1 

Distribution: St. Martin; Saba; St. Eustatius; 
Barbuda; Guadeloupe; Barbados? 

Status: Unknown. Dubious record. 

Material Examined: ANSP 25609 (2 speci- 
mens /egf/íFoderougher). 

Discussion: Brown (1903) stated that he was 
unable to confirm the occurrence of this 
species in Barbados. Breure (1974) in his tax- 
onomic review of the genus Bulimulus in the 
Caribbean indicated that the Barbados 
records of this taxon are "very doubtful," con- 
sidering that the records by Bland (1862), and 
Smith & Feilden (1891) are probably mis- 
identifications of the polymorphic Bulimulus 
guadalupensis. However, two specimens in 
the ANSP collection, reportedly from Barba- 
dos, are clearly B. d. fraterculus. Whether this 
indicates it was established in Barbados at 
one time, or represents an error in locality re- 
mains uncertain. 

Plekocheilus aurissileni (Born, 1780) 

Voluta auris Sileni Bom, 1780: 212, pi. 9, figs. 

3,4 
Plekocheilus (Plekocheilus) aurissileni (Bom). 

Breure, 1 975: 73-76, pi. VI, figs. 5-10 

Distribution: St. Vincent. 

Status in Barbados: Dubious record. 

Discussion: Breure (1975) reported this large 
and distinctive species being collected from 
Porter's Wood (north of Holetown, Parish of 
St. James) in Barbados. This was based on a 
specimen that was in Alan Solem's private 
collection but was not collected by him per- 
sonally (J. Siapcinsky, personal communica- 
tion), and was deposited in the Field Museum 
of Natural History, Chicago (FMNH 146430). 
There is no record of Solem ever having been 
to Barbados to collect, and presumably he ob- 
tained the specimen from an unknown collec- 
tor, together with erroneous locality data. 

Orthalicus maracaibensis subpulchella 
(Pilsbry, 1889) 

Orthalicus zebra (Müller). Smith & Feilden, 
1891: 253; Smith, 1895: 302, 306-307; 
Rush, 1891: 69 (Bridgetown); Brown, 



44 



CHASE & ROBINSON 



1903: 269, non Buccinum zebra Müller, 

1774 
Oxystyla maracaibensis var. subpulchella 

Pilsbry, 1889; 141 -142, pl. 28, flg. 38, 39 

(Union Island, Grenadines) 
Oxystyla sp. Henderson, 1919: 95 
Oxystyla pulchella (Spix). McGinty, 1939: 7, 

pl. 2, fig. 9, non Achatina pulchella Spix, 

1827 

Distribution: Barbados and the Grenadines. 

Status in Barbados: Common. 

Material Collected From: Sites 1,3,4, 5, 7, 
14, 15, 17, and 22. 

Additional Material Examined: ANSP 89699 
(nr. Bridgetown -1 specimen legit Clapp); 
ANSP 227834 (Bridgetown -2 specimens 
/eg/í Bales); ANSP 303292 (St. John's Wood - 
18 specimens /eg/f Jackson); FLMNH 113849 
(Harrison's Cave, St. Thomas -1 specimen 
legit F. G. Thompson); FLMNH 113851 
(Welchman Hall Gully -4 specimens); 
FLMNH 109541 (near Bank Hall -5 speci- 
mens; FLMNH 177917-St. Peter mangrove 
plantation); MCZ 251 304 (Barbados Museum, 
St. Michael legit Ray & Allen); MCZ 21085 
(near Bridgetown -3 specimens legit Kugier); 
MCZ 142231 (St. John's Church, St. David - 
49 specimens legit Howland); MCZ 108953 
(Hastins-36 specimens /eg/YHowland). 

Discussion: The taxonomic status of this 
common Barbados tree snail is uncertain, al- 
though it most closely resembles Orthalicus 
maracaibensis subpulchella (Pilsbry, 1889), 
from the Grenadines (typical maracaibensis is 
from the mainland of Venezuela). Henderson 
(1919) also recognized the Barbadian form to 
be "more nearly related to a South American 
group" as opposed to O. undatus jamaicensis 
Pilsbry. 1889. Pilsbry (1889) had placed refer- 
ences to Orthalicus zebra (Müller) (including 
that of Smith & Feilden, 1891) in synonymy 
with Oxystyla undatus var. jamaicensis Pils- 
bry, 1889, presumably without seeing speci- 
mens from Barbados (the specimens in the 
ANSP collection were received after Pilsbry 
had written the relevant text in the Manual of 
Conchology). Brown (1903) also discussed 
the taxonomic uncertainty of this species. The 
taxonomy of the various Caribbean and main- 
land species and named forms of Orthalicus 
is in need of revision. 

Smith & Feilden (1891) reported that 
Feilden had "brought a small basket full of 



[Orthalicus undatus jamaicensis] from Ja- 
maica to Barbados," that was then released 
on Pelican Island, a quarantine station just off 
Bridgetown. Feilden is quoted as later discov- 
ering that he "found them in limited numbers 
already introduced to gardens in the suburbs 
of Bridgetown." Doubtless he, too, was misled 
by the similarity of the two forms. Whether or 
not the Jamaican taxon has survived some- 
where in the Bridgetown area is unknown. 

Smith & Feilden's, and Rush's records 
(both 1891) are the earliest records of a 
species of Orthalicus in Barbados. It would 
seem that the species had recently been in- 
troduced from elsewhere, presumably the 
nearby Grenadines, as the species is now 
common in trees in inhabited areas and so 
visible as not to be easily missed. 

Family UROCOPTIDAE 

Brachypodella costata (Gullding, 1828) 

Brachypus costatus Guilding, 1828b; 167 ("in 

arboribus Barbadensibus") 
Siphonostoma costata (Guilding). Swainson, 

1840; 168, fig. 22 (non p. 333, fig. 97c, d) 
Cylindrella costata (Brachypus) (Guilding). 

Pfeiffer, 1844; 183, pl. 1, fig. 16 only; 

Bland, 1862: 351; Kobelt, 1880; 284 
Cylindrella (Gongylostoma) costata Guilding. 

Smith & Feilden, 1891: 255; Brown, 

1903:270 
Urocoptis sp. Henderson, 1919: 96 
Brachypodella costata (Guilding). Pilsbry, 

1904; 78-79. 
Brachypodella costata form albida Pilsbry, 

1904: 79. 

Distribution: Endemic to Barbados. Errone- 
ous records from St. Lucia. 

Status: Locally abundant. 

Material Collected From: 2, 7, 8, 9, 13, 19, 
and 21. 

Additional Material Examined: ANSP 73226 
(10 specimens legit Bland); ANSP 73228 (8 
specimens legit Bland types of Brachy- 
podella costata form albida Pilsbry, 1904); 
ANSP 73229 (13 specimens legit Bland); 
ANSP 85458 (13 specimens /egf/i Brown); RM 
14180 (7 specimens /eg/Y Rawson ex Carpen- 
ter); FLMNH 119898 (Harrison's Cave, St. 
Thomas -12 specimens legit Thompson); 
MCZ 171018 (13 specimens legit Ra\Nson ex 
Bland); MCZ 26922 (4 specimens ex Bland); 



LAND SNAILS OF BARBADOS 



45 



MCZ 75023 (Blowers -100+ specimens legit 
Kugler). 

Discussion: This species is common 
throughout the island, in some areas being 
abundant, found crawling on tree trunks and 
other vertical surfaces, as well as on rocks 
and boulders. Brown (1903) listed this 
species also being from St. Lucia, but this 
record refers to the similar Brachypodella tatei 
(Crosse). 

Pseudopineria barbadensis Kraus, 1996 

Bulimus Viequensis Pfeiffer. Bland, 1862: 
351, pi. 2; Pilsbry, 1904: 111-112, pi. 1, 
fig. 12, only, non Pfeiffer, 1856 

Pineria Viequensis var. minor Pfeiffer, 1 868: 
343 (Barbados) 

Stenogyra Wequens/s (Pfeiffer). Kobelt, 1880: 
284, non Pfeiffer, 1856 

Pineria viequensis (Pfeiffer). Smith & Feilden, 
1891: 253; Brown, 1903: 269, non Pfeif- 
fer, 1 856 

Pseudopineria barbadensis Kraus, 1996: 
109-113, figs. 8, 10 

Distribution: Endemic to Barbados. 

Status: Unknown. 

Material Examined: FLMNH 50324 (holo- 
type); FLMNH 180526 (5 paratypes legit J. J. 
Brown); ANSP 85454 (12 paratypes legit 
Brown); MCZ 23720 (17 paratypes legit 
Guppy). 

Discussion: Brown (1903) reported this 
species as Pineria viequensis occurring along 
the coast of the Parish of St. Philip, and 
Feilden collected it from the Parishes of 
Christchurch and St. Philip. Kraus (1996) rec- 
ognized the Barbados records as a distinct 
species based on museum specimens. No 
specimens were collected during this study, 
so its status is unknown. 

Family SUBULINIDAE 

Allopeas gracile (HuWon, 1834) 

Bulimus gracilis Hutton, 1834: 84 (Mirzapoor 
. . . Futtehpoor Sikra . . . between Agra 
and Neemuch [India]) 

Bulimus subula (Pfeiffer). Bland, 1862: 351 

Stenogyra subula (Pfeiffer). Kobelt, 1880: 
284; Smith & Feilden, 1891: 253-254 

Opeas subula (Pfeiffer). Brown, 1903: 270 



?Opeas sp. Henderson, 1919: 96 

Distribution: Tropics and subtropics world- 
wide; some Pacific island groups. 

Status in Barbados: Uncommon. 

Material Collected From: Sites 1 , 3, and 13. 

Additional Material Examined: ANSP 3101 (4 
specimens legit Bland); ANSP 85451 (4 spec- 
imens /eg/i Brown); MCZ 31 8940 (Blowers -1 
specimen /eg/i Kugler). 

Discussion: A worldwide species introduced 
by humans. Rush's (1891) reference to a 
species of Opeas could be either one of the 
/A//opeas taxa listed here or Opeas hannense. 
It is included here as Allopeas gracile, be- 
cause it is the largest of the three and the one 
most likely encountered by Rush. 



Allopeas miera (d'Orbigny, 1 835) 

Helix (Achatina) miera d'Orbigny, 1835: 9 

(Central America) 
Stenogyra miera (d'Orbigny). Gibbons, 1879: 

131 
Bulimus octonoidesAäams. Bland, 1862: 351 
Stenogyra octono/cfes Adams. Kobelt, 1880: 

284; Smith & Feilden, 1891: 254; Rush, 

1891:69 
Opeas octonoides Adams. Brown, 1903: 270 

Distribution: Mexico to Bolivia, and the West 
Indies; some Pacific island groups. 

Status In Barbados: Uncommon. 
Material Collected From: Sites 3, 7, and 9. 

Additional Material Examined: ANSP 3107 
(21 specimens legit Bland); ANSP 85460 (4 
specimens legit Brown). 

Discussion: A synanthropic species spread 
throughout the Americas and elsewhere. 

Beckianum beckianum (Pfeiffer, 1846) 

Bulimus beckianus Pfeiffer, 1846: 82 (Opara) 
Bulimus Caraccasensis Reeve. Bland, 1862: 

351 
Stenogyra caracasensis (sic) Reeve. Kobelt, 

1880:284 
Stenogyra Beckiana Pfeiffer. Smith & Feilden, 

1891:253; Rush, 1891:69 



46 



CHASE & ROBINSON 



Opeas Beckiana Pfeiffer. Smith, 1895: 302, 
309; Brown, 1903: 270 

Distribution: South and Central America, and 
the West Indies: some Pacific island groups. 

Status in Barbados: Locally abundant. 

Material Collected From: Sites 1, 2, 3, 7, 9, 
19, and 22. 

Additional Material Examined: ANSP 337234 
(1 specimen legit Bland); ANSP 85461 (12 
specimens legit Brown); ANSP 332714 
(Porter's Estate -2 specimens /eg/f Hussey): 
RM 15346 (8 specimens /egf/i Rawson ex Car- 
penter): MCZ 27231 (12 specimens legit 
Rawson): MCZ 136007 (9 specimens ex 
Bland): MCZ 318944 (near Fresh Water Bay 
legit Balch); MCZ 90579 (Blowers -3 speci- 
mens exKugler). 

Discussion: Smith & Feilden (1891) reported 
this species as being "not very common." 
Today the species is particularly widespread, 
often abundant, especially in disturbed habi- 
tats. 

Leptinaria lamellata 
(Potiez& Michaud, 1835) 

Achatina lamellata Potiez & Michaud, 1835: 

pi. 11,figs. 7, 8; 1838: 128 (Hab. ?) 
Tornatellina Antillarum Shuttleworth. Bland, 

1862:351 
Leptinaria antillarum (Shuttleworth). Kobelt, 

1880:284 
Leptinaria lamellata (Potiez & Michaud). 

Smith & Feilden, 1891 : 255; Smith, 1895: 

302, 309; Brown, 1903:270 
Leptinaria sp. Henderson, 1919: 96 

Distribution: Tropics and subtropics world- 
wide. 

Status in Barbados: Locally common. 



Material Collected From: 
19. 



Sites 2, 7, 13, and 



Additional Material Examined: ANSP 24089 
(2 specimens legit Bland); ANSP 85456 (4 
specimens legit Brown); MCZ 90578 (Blow- 
ers -3 specimens /eg/i Kugler). 

Discussion: This species is widely distributed 
on Barbados, although never in great num- 
bers. It is associated with areas of human dis- 
turbance. 



Luntia insignis Smith, 1898 

Luntia insignis Smith, 1898: 28, fig. 8 
(Trinidad) 

Distribution: Trinidad; Aruba; Saba; Barba- 
dos. 

Status in Barbados: Uncommon. 

Material Collected From: Sites 2, 3, 9, and 1 3. 

Discussion: This small subulinid is here re- 
ported from Barbados for the first time. It was 
originally known only from Trinidad, until it 
was reported on Aruba by Wagenaar Hum- 
melink (1940), and then on Saba by Haas 
(1962). It is probably distributed throughout 
the Lesser Antilles. 

Opeas ^annense (Rang, 1831) 

Hélice (Cochlicelle) hannensis Rang, 1831: 

41-42, pi. 3, fig. 8 ("Village de Hann sur 

la presque'île du Cap-Verd" [West 

Africa]) 

Bulimus Gooda/// (Miller). Bland, 1862: 351 

Stenogyra Goodalli (Miller). Kobelt, 1880: 

284; Smith & Feilden, 1891: 254 
Opeas c/ooda/// (Miller). Brown, 1903: 270 
Opeas ascendens Poey. Brown, 1903: 270 

Distribution: Tropical Central America; intro- 
duced worldwide. 

Status in Barbados: Rare. 

Material Collected From: Site 9. 

Additional Material Examined: ANSP 85462 
(4 specimens /egf/Y Brown). 

Discussion: We follow Proschwitz (1994) and 
Cowie (1997) in using Helix hannensis Rang 
as senior synonym of Helix goodalli Miller, 
1822, and Bulimus pumilus Pfeiffer, 1840. 
Although Brown (1903) listed both O. goodalli 
and O. ascendens, a note in the text by E. A. 
Smith (in Brown, 1903: 270) indicates that 
they are the same species. 

Although reported by various other workers 
on the Barbadian fauna, we found only two 
specimens of this species at a single locality. 

Subulina octona (Bruguière, 1792) 

Bulimus octonus "Chemnitz" Bruguière, 1792: 

325 ("Les îles Antilles") 
Achatina octona (Bruguière). Bland, 1862: 

351 



LAND SNAILS OF BARBADOS 



47 



Stenogyra octona (Bruguière). Gibbons, 
1879: 131; Kobelt, 1880: 284; Smith & 
Feilden, 1891:253 

Subulina sp. Rush, 1891: 69 

Subulina octona (Bruguière). Smith, 1895: 
302, 309; Brown, 1903: 270 

Distribution: Tropics and subtropics world- 
wide, as well as in greenhouses in the tem- 
perate zones of Europe and North America. 

Status in Barbados: Common; locally abun- 
dant. 

Material Collected From: Sites 1,2,3,5,6,7, 
9, 12, 13, 15, 16, 19, 20, and 22. 

Additional Material Examined: ANSP 85453 
(8 specimens legit Brown); RM 12742 (8 
specimens legit Rawson ex Carpenter); MCZ 
27131 (7 specimens -/eg/f Rawson); MCZ 
1 36006 (9 specimens ex Bland); MCZ 1 07934 
(Blowers -31 specimens exKugler). 

Discussion: One of the commonest and most 
widespread species on Barbados. Smith & 
Feilden (1891) reported that "it is very abun- 
dant throughout the island, and is met with in 
colonies under stones and rocks." Specimens 
are often observed containing a number of 
white eggs in the last two or three whorls of 
the shell, even when the shell is only half the 
length of the largest specimens encountered. 
It would appear that this snail, as other subu- 
linids, is capable of reproduction well before 
its maximum size is reached. 

Family FERUSSACIIDAE 

Cecilioides acicula (Müller, 1774) 

Buccinum acicula MüWer, 1774: 150-151 
Caecilianella acicula (Müller). Brown, 1903: 
266, 270 

Distribution: Europe; isolated records of in- 
troductions to other continents and Pacific is- 
lands. 

Status in Barbados: Dubious record. 

Discussion: Brown (1903) reported collecting 
a single specimen at Porter's Wood (St. 
James), together with specimens of C. conso- 
brinus minutissima (Guppy) (see below). 
However, he also misidentified specimens of 
С aporta, which upon closer examination are 
clearly individual variations of С consobrinus 



minutissima. It is likely that his determination 
of this European species was also in error. 

Cecilioides {Geostilbia) aperta 
(Swainson, 1840) 

Macrospira aperta "Guilding" Swainson, 

1840:335, fig. 97e,f 
Achatina GundlachiPieWer. Bland, 1862: 351 
Stenogyra Gundlachi {РШПег). Kobelt, 1880: 

284 
Stenogyra Gundlachi "Arango" Smith & 

Feilden, 1891: 254 (attributed to Bland, 

1862) 
Caecilianella aperta "Guilding" Brown, 1903: 

269-270 
Opeas gundlachi'^Arango." Brown, 1903: 266, 

270 (doubtful occurrence; attributed to 

Bland) 
Caecilianella gundlachi Pie\fíer. Brown, 1903: 

270 

Distribution: West Indies. 
Status in Barbados: Unknown. 

Material Examined: MCZ 90580 (Blowers - 
1 specimens ex Kugler). 

Discussion: Although Bland (1862) and 
Brown (1903, in Porter's Wood listed as C. 
gundlachi) reported this species from Barba- 
dos (Smith & Feilden, 1891, merely quoted 
Bland's record), we have been unable to find 
specimens from the island in any of the insti- 
tutional collections surveyed, although there 
is no reason to suppose this widely distributed 
Caribbean species has never been present 
on the island. Smith (1895) reported it from 
the neighbouring island of St. Vincent. Brown 
attributed Opeas gundlachi Arango to Bland. 
However, it was Smith & Feilden who used 
this name combination, although they were 
referring to Bulimus gundlachi Pfeiffer [= Ce- 
cilioides aperta (Swainson)], a species Brown 
believed he had collected (see next species). 
No specimen attributable to this taxon was 
collected during our survey. 

Cecilioides {Karolus) consobrinus 
minutissima {Guppy, 1868) 

Caecilioides minutissima Guppy, 1868a: 239 

(Trinidad) 
Cœcilianella minutissima (Guppy). Brown, 

1903:269 
Caecilianella aperta Guilding. Brown, 1903: 



48 



CHASE & ROBINSON 



270, non Macrospira aperta Swainson, 
1840 
СзэсШапеНа {Caecilioides) consobrinus var. 
minutissima (Guppy). Pilsbry, 1909: 
41-42, pl. 5, figs. 83, 85 

Distribution: Trinidad; St. Vincent; Barbados. 
Status in Barbados: Unknown. 

Material Examined: ANSP 85457 (5 speci- 
mens [labelled as СгесШапеНа minutissima] 
legit Brown); ANSP 85466 (3 specimens [la- 
belled as Cœcilianella aperta] legit Brov^n). 

Discussion: Pilsbry (1909) recognized the 
race/variety minutissima from the southern 
Lesser Antilles as distinct from the typical 
form. Brown collected two confirmed lots of 
this species from Barbados, although it was 
not found by any subsequent workers, includ- 
ing ourselves. It is a minute species living 
cryptically, and as such, it would be premature 
to conclude that it no longer lives on the is- 
land. 

Family STREPTAXIDAE 

Streptaxis (Streptartemon) glaber 
(Pfeiffer, 1849) 

Streptaxis glabra Pfeiffer, 1849: 126 (Demer- 

ara) 
Streptaxis deformis (Férussac). Smith & 

Feilden, 1891: 251; Rush, 1891: 68; 

Brown, 1903: 268; Henderson, 1919: 95; 

Pilsbry, 1908: x, pl. 52, fig. 5, non Helix 

deformis férussac, 1821 
Streptaxis (Odontertemon) glaber (Pfeiffer). 

Baker, 1925:39-40 
Streptaxis {Streptartemon) glaber Pfeiffer. 

Venmans, 1963: 53-68, figs. 12-16 

Distribution: Brazil; Suriname; Guyana; 
Venezuela; Isla Margarita; Trinidad; Barba- 
dos; St. Lucia; Dominica; St. Thomas; St. 
Croix; Virgin Islands. 

Status in Barbados: Common; locally abun- 
dant. 

Material Collected From: Sites 2, 3, 4, 7, 9, 
16, 19, 20, and 22. 

Additional Material Examined: ANSP 1202 (1 
specimen legit Bland); ANSP 5029 (1 speci- 
men legit Bland); ANSP 85445 (11 specimens 
/eg/f Brown); FLMNH 113853 (Welchman Hall 
Gully -1 specimen); FLMNH 119894 (Har- 



rison's Cave -2 specimens /eg/f Thompson); 
MCZ 318941 (near Fresh Water Bay legit 
Balch). 

Discussion: Although Férussac's name de- 
formis has been used by most authors for this 
streptaxid species, that taxon remains of un- 
known origin (Baker, 1925). One of the more 
common species in Barbados, it occurs wher- 
ever there has been any kind of human dis- 
turbance. Other than Hughes' (1750) descrip- 
tion of snails that may correspond to this 
species, the first published record is by Smith 
& Feilden (1891). It is clear that Bland col- 
lected this species, based on specimens that 
were deposited in the ANSP collection, but he 
did not list it in his 1862 publication, possibly 
because he was unable to identify the speci- 
mens. 

Gulella {Huttonella) ß/co/or( H utton, 1834) 

Pupa bicolor ИиПоп, 1834: 86, 93 (Mirzapur, 

India) 
Ennaea (Huttonella) bicolor (Hutton). Brown, 

1903:269 

Distribution: Tropics and subtropics world- 
wide. 

Status in Barbados: Unknown. 

Discussion: This species of Old World origin 
has been reported as introduced to various 
Caribbean islands, and there are several lots 
in the ANSP and FLMNH collections from 
throughout the West Indies. However, it ap- 
pears to be fairly uncommon at all localities. 
Brown (1903) also reported the species from 
St. Thomas, Dominica, as well as several lo- 
calities in Barbados (Bridgetown, Belle Plan- 
tation Wood and St. Philip's). He is, however, 
the only worker to report its occurrence on the 
island. Nevertheless, there is insufficient rea- 
son to conclude that the species is no longer 
living on Barbados. 

Family ZONITIDAE 

Glyphyalinia barbadensis 

Chase & Robinson, new name 

Helix incisa Pfeiffer, 1866: 78 ("Habitat in in- 
sula Barbados"); 1868: 107, non Helix in- 
cisa Gmelin, 1791 
Hyalina incisa (Pfeiffer). Kobelt, 1880: 284 
Vitrea incisa (Pfeiffer). Smith & Feilden, 1891: 
249; Brown, 1903: 268 (doubtful occur- 
rence) 



LAND SNAILS OF BARBADOS 



49 



? Vitrea sp. Henderson, 1919: 96 

Retlnella {Glyphyalinia) incisa (Pfeiffer). 
Baker, 1930: 209 {? Retinella (Gly- 
phyalinia) carolinensis {CockereW, 1890) 

Distribution: Endemic to Barbados. 
Status: Rare. 

Material Examined: ANSP 997 (3 specimens 
legit Bland); ANSP 48818 (2 specimens); 
FLMNH 119896 (Harrison's Cave -4 speci- 
mens /eg/Y Thompson) 

Discussion: The identity and even the exis- 
tence of this species has been confused ever 
since it was described by Pfeiffer (1 866). It ap- 
pears not to have been collected by any of the 
subsequent workers on the Barbados fauna. 
Kobelt (1880) merely listed it (immediately 
after the publication of Pfeiffer's description); 
Smith & Feilden (1891) and Brown (1903) 
doubted its occurrence on the island. Smith & 
Feilden (1891), studying Pfeiffer's type mate- 
rial, commented on "the distinct impressed 
lines of growth which divide the last whorl into 
numerous segments," characteristic of the 
shell of Glyphyalinia. There are two lots 
matching Pfeiffer's description in the ANSP 
collection. Both lots were collected from Bar- 
bados, and one is labelled as having been 
collected by Bland. Baker (1930) referred to 
one of the lots as containing potentially mislo- 
calized specimens of Glyphyalinia carolinen- 
sis (Cockerell), an eastern North American 
species. As he also pointed out, the name 
Helix incisa is pre-occupied, so this taxon 
lacks a specific name. We therefore propose 
to provide the name Glyphyalinia barbadensis 
for this species, one that we consider en- 
demic to Barbados. Several specimens of the 
species were collected by Thompson in 1 987, 
confirming the continued survival of this 
species on the island. 

Family SYSTROPHIIDAE 

Miradiscops implicans (Guppy, 1868) 

Zonites implicans Guppy, 1868b: 440 (Trini- 
dad) 

Vitrea implicans (Guppy). Brown, 1903: 268 
(doubtful occurrence; attributed to Smith 
[& Feilden]) 

Distribution: Venezuela and Trinidad. 

Status in Barbados: Unknown. 

Discussion: We cannot confirm that this 
species was ever collected from Barbados. 



Although much of Brown's material (report- 
edly collected at Porter's Wood) is deposited 
at the ANSP and the BMNH, there are no 
specimens of this species collected by Brown 
in either of these collections, and no other 
known records from Barbados. However, the 
occurrence of the following species, also of 
this South American family, suggests the pos- 
sibility that the tiny Miradiscops implicans may 
have been collected from Barbados. 

Happiella cf. decolorata (Drouët, 1859) 

Zonites decolorata Drouët, 1859: 50-51 , pi. 1 , 
figs. 3-5 

Distribution: Guyana and French Guyana. 

Status: Rare. 

Material Collected From: Sites 7 and 1 3. 

Additional Material Examined: FLMNH 
119897 (Harrison's Cave -4 specimens legit 
Thompson). 

Discussion: Examination of specimens col- 
lected at two localities during this study shows 
them to be virtually indistinguishable in terms 
of shell morphology from specimens of Hap- 
piella cf. decolorata (Drouët, 1859), a species 
known from Guyana and French Guiana. The 
generic placement of this species follows that 
of Ramirez (1993). 

Family MEGALOBULIMIDAE 

Megalobulimus oblongus (Müller, 1774) 

Helix oblongus Müller, 1 774: 86 

Bulimus oblongus (Müller). Bland, 1862: 351; 

Kobelt, 1880: 284; Rush, 1891: 65, 69; 

Smith, 1895:302,306 
Bulimus {Borus) oblongus (Müller). Smith & 

Feilden, 1891:251-252 
Strophocheilus (Borus) oblongus Müller. 

Brown, 1903: 268; Henderson, 1919: 

94-95 

Distribution: South America; Trinidad; To- 
bago; Grenada; St Vincent; Barbados. 

Status in Barbados: Uncommon. 

Material Collected From: Sites 2, 4, 5, 7, 14, 
and 16. Fragmentary specimen (observed, 
not collected) at site 19. 

Additional Material Examined: ANSP 83178 
(1 specimen legit Brown); ANSP 85470 (3 
specimens legit Brown); RM 13457 (2 sped- 



50 



CHASE & ROBINSON 



mens legit Rawson ex Carpenter); MCZ 
232161 (Lancaster Plantation, St. James legit 
Gooding): MCZ 230453 (Airy Hill, St. John - 1 
specimen legit Humes); MCZ 90359 (6 speci- 
mens legit Junious ex Bland); MCZ 50505 
(Bridgetown -2 speciments /eg/i Walker). 

Discussion: Megalobulimus oblongus is 
widely distributed throughout the island, al- 
though it was considerably more common in 
the past. Rush (1891) remarked on its abun- 
dance in Bridgetown, and Henderson (1919) 
reported the species as living "abundantly all 
over the island especially in gardens." Bland 
(1862) believed the species was introduced to 
Barbados from St. Vincent by Rev. J. Parkin- 
son, although the purpose for the introduction 
is unknown. 



Family SAGDIDAE 
Lacteoluna selenina (Gould, 1848) 

Helix selenina Gould, 1848: 38 (Georgia and 

Florida) 
Helix vortex Pfeiffer. Bland, 1862: 351; Pfeif- 
fer, 1876: 153 (reported from Barbados), 

non Linné, 1758 
Helix {Microphysa) vortex (Pfeiffer). Smith & 

Feilden, 1891:251 
Microphysa vortex (Pfeiffer). Kobelt, 1880: 

284 
He//xst7baQt7/7aShuttleworth. Rush, 1891: 68, 

non Shuttleworth, 1854 
Thysanophora \/o/tex (Pfeiffer). Brown, 1903: 

268 
? Thysanophora sp. Henderson, 1919: 96 
Lacteoluna selenina barbadensis Pilsbry, 

1930: 244 (Barbados); Baker, 1963: 242 

Distribution: Bermuda; Florida and the West 
Indies. 

Status in Barbados: Rare. 

Material Collected From: Site 9. 

Additional Material Examined: ANSP 8039 
(lectotype of L. s. barbadensis Pilsbry, 1930, 
designated by Baker, 1963); ANSP 28317 (11 
paralectotypes of L. s. barbadensis Pilsbry); 
ANSP 85469 (2 specimens /eg/Y Brown); MCZ 
905 (Blowers -3 specimens legit Kugler). 

Discussion: This synanthropic species, 
widely distributed throughout the Caribbean 
Basin, appears not to be common in Barba- 



dos. Pilsbry (1930) considered the Barbados 
populations as a distinct subspecies because 
they are a little larger than is typical for the 
species. Smith & Feilden (1891) reported 2 
specimens. Brown deposited 2 specimens in 
the ANSP collection, and 2 specimens were 
collected during this study. 

Lacteoluna {Aerotrochus) turbiniformis 
(Pfeiffer, 1839) 

Helix turbiniformis Pfeiffer, 1839: 350 (Cuba) 
Helix (Microphysa) turbiniformis Pfeiffer. 
Smith & Feilden, 1891: 251 (uncon- 
firmed) 
Thysanophora turbiniformis (Pfeiffer). Brown, 
1903: 266, 268 (doubtful occurrence; at- 
tributed to earlier workers) 

Distribution: Cuba and Jamaica. 
Status in Barbados: Dubious record. 

Discussion: Smith & Feilden (1891) reported 
a single specimen of this species, reputedly 
from Barbados, in the Cuming collection (in 
the British Museum). However, they also 
noted that the collection was "somewhat no- 
torious for errors of locality" (Smith & Feilden, 
1891: 248), and they could not confirm the 
occurrence of the species based on Feilden's 
collections from Barbados. No other workers 
reported the species, and Brown (1903) con- 
cluded that its occurrence was doubtful. We 
concur with earlier workers that this Greater 
Antillean species was erroneously reported 
from Barbados. 

Family CAMAENIDAE 
Pleurodonte Isabella (Férussac, 1822) 

Helix Isabella Férussac, 1821: 32, ("Les An- 
tilles, Cayenne") [nomen nudum); Bland, 
1862: 351, table 2 

Helicogena Isabella Férussac, 1822a: pi. 47, 
fig. 2 

Helix Barbadensis Lamarck, 1822: 78-79 ("la 
Barbade") 

Carocolla Barbadensis Guilding, 1828b: 167 
("sub lapidibus Barbadensibus") 

Helix (Dentellana) Barbadensis Lamarck. 
Beck, 1837: 35 

Helix barbadensis (Carocolla) Guilding. Pfeif- 
fer, 1847:310 

Helix dentiens Férussac. Deshayes, 1850: 
147-148, pi. 47, fig. 2 only; Pfeiffer, 



LAND SNAILS OF BARBADOS 



51 



1853: 213 (partim non Helix dentiens 

Férussac) 
Dentellaria Isabella (Férussac). Kobelt, 1880: 

284 
Helix {Dentellaría) Isabella Férussac. Pilsbry, 

1889: 85-86, pi. 24, figs. 42, 43; E. A. 

Smith & Feilden, 1891: 250 
Pleurodonte Isabella Férussac. Brown, 1903: 

268 
Pleurodonte (Caprínus) Isabella (Férussac). 

Henderson, 1919: 95 

Distribution: Endemic to Barbados. 

Status: Locally abundant. 

Material Collected From: Sites 2,3,4,5,7,8, 
11, 13, 15, 16, 17, 20, 21, and 22. 

Additional Material Examined: ANSP 987 (3 
specimens), ANSP 988 (4 specimens), ANSP 
989 (1 specimen), ANSP 990 (4 specimens), 
ANSP 991 (3 specimens), ANSP 992 (3 spec- 
imens), ANSP 993 (2 specimens), ANSP 994 
(1 specimen), ANSP 995 (2 specimens), 
ANSP 32584 (8 specimens), all legit Bland; 
ANSP 85443 (8 specimens legit Brown); 
ANSP 85444 (2 specimens legit Brown); RM 
14301 (9 specimens /egf/íRawson ex Carpen- 
ter); FMNH 146396 (Wentwood Gully -1 
specimen); FMNH 147023 (Codhngton Col- 
lege -4 specimens); FMNH 172045 (Speight- 
stown 6 specimens); MCZ 251322 (Farley 
Hill, St. Peter- 15 specimens legit Ray & 
Allen); MCZ 258049 (4 miles east of Hole- 
town, St. James -4 specimens legit 
Scheafer); MCZ 136004 (Christ Church -1 
specimen legit Bland); MCZ 251320 (cave 
near Hillaby, St. Thomas -9 specimens legit 
Ray & Allen); MCZ 107935 (Blowers -10 
specimens legit Kugler); MCZ 108727 (St. 
Joseph's -1 specimen /egr/i Cockerell); MCZ 
90325 (1 specimen ex Bland). 

Discussion: Pleurodonte Isabella is a ubiqui- 
tous Barbados endemic that appears to be 
relatively unaffected by human activity on the 
island, being extremely common in suburban 
gardens as well as relatively unspoiled forest 
areas. 

Pleurodonte dentiens (Férussac, 1822) 

Helix (Helicodonta) dentiens Férussac, 1821: 
33 ("La Guadeloupe, la Martinique, Saint- 
Domingue, les forêts de Cayenne et de la 
Guyanne") [nomen nudum) 

Helix dentiens Férussac, 1822b: pi. 48, fig. 2 



Helix dentiens Férussac. Deshayes, 1850: 
147_148; Pfeiffer, 1853: 2} 2> [partim) 

Pleurodonte dentiens (Férussac). Brown, 
1903: 268 (unconfirmed) 

Distribution: Guadeloupe, Dominica, and 
Martinique. 

Status in Barbados: Erroneous record. 

Discussion: Although Brown (1903) reported 
that Pleurodonte dentiens had been collected 
"by a Mr. E. W. Williams" in Pine Wood Estate, 
St. Michael's, he could not personally confirm 
the occurrence of this species. Apparently the 
confusion was created when both Deshayes 
(1850) and Pfeiffer (1853) placed Helix Is- 
abella as a junior synonym of Helix dentiens, 
and Brown was unaware of this taxonomic 
error. 



Polydontes perplexa (Férussac, 1832) 

Helix (Helicodonta) perplexa Férussac, 1832: 
pi. 56A, fig. 1 

Helix (Dentellaría) perplexa Férussac. Smith 
& Feilden, 1891:249 

Pleurodonte perplexa (Férussac). Brown, 
1903: 268 (doubtful occurrence; attrib- 
uted to Smith [& Feilden]) 

Distribution: Grenada and the Grenadines. 
Status in Barbados: Dubious record. 



Material Examined: BMNH 
specimens /ep/YRawson). 



70.10.12.7 (4 



Discussion: Smith & Feilden (1891) referred 
to specimens of Helix perplexa Férussac, as 
being "said to have come from that locality" 
[Barbados] that were collected by Sir Rawson 
and deposited at the British Museum (Natural 
History). Smith later (1895) listed this species 
from Grenada and the Grenadines, but not 
from Barbados. We have examined these 
specimens (BMNH 70.10.12.7), and although 
the identification can be confirmed, it is un- 
likely that they were collected from Barbados. 
Brown (1903) also was unable to confirm the 
occurrence of this species on the island. 

Zachrysia provisoría (Pfeiffer, 1858) 

Helix provisoria Pfeiffer, 1858: 39-40 (Man- 
zanillo, Cauto, and Guisa, Cuba) 



52 



CHASE & ROBINSON 



Distribution: Originally from Cuba; estab- 
lished in southern Florida, the Bahamas, St. 
Croix, and Barbados. 

Status in Barbados: Locally abundant. 

Material Collected From: Sites 1, 2, 3, 4, 13, 
and 15. 

Discussion: Although this large Cuban 
species has well established populations in 
southern Florida, as well as the Bahamas 
(Pilsbry, 1928), it has not been reported until 
now from anywhere in the Lesser Antilles. 
Nevertheless, this recently introduced arrival 
is particularly common in lowland parts of the 
island, especially along the East coast. In 
some areas, especially in gardens, it is the 
most conspicuous snail species. It is likely to 
have been introduced via the horticultural 
trade, possibly from Florida. 

Family BRADYBAENIDAE 

Bradybaena simllaris (Rang, 1831 ) 

Helix similaris Férussac, 1821: 43 ("Timor") 

(nomen nudum) 
Hélice (Héllcelle) similaris "Férussac" Rang, 

1831: 15 ("Bourbon . . . l'île de Cuba; 

. . . Rio-Janeiro et particulièrement au 

jardin de Saint-Christophe . . . Brésil."); 

Bland, 1855: 153; 1862: 351, table 2 
Fruticicola similaris "Férussac.'^ Kobelt, 1880: 

284 
Helix (Fruticicola) similaris "Férussac." Smith 

& Feilden, 1891: 250-251 
Helix (Dorcasia) similaris "Férussac." Rush, 

1891:69 
Eulota similaris "Férussac." Brown, 1903: 

268; Henderson, 1919: 96 

Distribution: Originally eastern Asia; estab- 
lished throughout the tropics and subtropics. 

Status in Barbados: Locally common. 

Material Collected From: Sites 3, 23 and 24. 

Additional Material Examined: ANSP 998 (4 
specimens /eg/f Bland); ANSP 85448 (4 spec- 
imens legit Brown); ANSP 62063 (2 speci- 
mens /eg/i Rush); MCZ 136009 (5 specimens 
ex Bland). 

Discussion: First reported from Barbados by 
Bland (1855), Smith & Feilden (1891: 250) 
later reported this species as being "the com- 



monest Helix in the island, ' presumably more 
so than Pleurodonte Isabella, which they also 
referred to as a Helix. They also noted that it 
was "abundant on the lowlands as well as on 
the high ground of Scotland District. . . ." 
Today, Bradybaena similaris appears to be 
much more restricted in distribution. In our 
survey, it was found in only three localities, 
both in St. James Parish, where it is common 
but considerably less so than Zachrysia provi- 
soria and Pleurodonte Isabella. 



DISCUSSION 

We have described significant discrepan- 
cies in the faunal lists obtained by seven 
groups of workers in Barbados, including our- 
selves. The variability cannot easily be attrib- 
uted to simple incompetence, because all the 
groups comprised, or at least included, per- 
sons with considerable experience as collec- 
tors and malacologists. While the results of 
our study clarify the current conservation sta- 
tus of land snails on Barbados, we believe 
they also have important implications for con- 
servation efforts generally. 

The reported faunal lists for Barbados sep- 
arate into two groups according to the length 
of the list, which presumably reflects the in- 
tensity of the collection effort (Table 1 ). In one 
group, the lists of Carpenter, Rush and Hen- 
derson are very likely incomplete. In the sec- 
ond group, comprising Bland, Smith and 
Feilden, Brown, and ourselves, the total num- 
bers of confirmed species range from 19 to 
23. The absence of any evident historical 
trend in these totals should not be taken to 
imply an absence of faunal change over the 
intervening 137 years. On the contrary, faunal 
change is indicated by our analysis in Table 2, 
which shows consistent disagreement among 
the workers with respect to the content of the 
lists. For example, the earliest worker. Bland, 
reported five confirmed species that were not 
found by us, and conversely, we found five 
species not reported by Bland. Similarly, 
Smith & Feilden reported three confirmed 
species not found by us, and we found six 
species not reported by Smith & Feilden. 
When Smith & Feilden's list is compared with 
Brown's, there is one "different" species re- 
ported by Smith & Feilden and five "different" 
species reported by Brown. Given that the 
foregoing account is based exclusively on 



LAND SNAILS OF BARBADOS 



53 



taxa for which the location in Barbados has 
been confirmed by our examination of institu- 
tional collections, or by other workers, the 
pattern of inconsistency is likely to reflect a 
combination of sampling error and actual fluc- 
tuations in the fauna. 

To know the exact size of the current fauna 
would require a more thorough field survey 
than we were able to conduct. All together, we 
confirmed 30 species from our own survey 
plus those of earlier authors (Table 1 ) In addi- 
tion, we confirmed Pupisoma dioscoricola 
from the FLMNH collection, to give a total of 
31 confirmed species present on the island at 
some time in the period 1862 to the present. 
Beyond these confirmed species, Miradis- 
cops implicans and Gulella bicolor are also 
likely to have been found on the island, al- 
though we did not examine any specimens, 
and some small, inconspicuous species may 
have escaped the notice of all collectors. On 
the other hand, three endemic species {Bu- 
limus fuscus, Lucidella barbadensis and 
Pseudopineria barbadensis) are probably ex- 
tinct, and one introducted species {Lucidella 
plicatula) is possibly extirpated. In summary, 
the total number of extant species is about 30, 
or slightly less. 

While we confirm 31 species for Barbados 
in the period 1862 to the present, a total of 46 
species were listed by the six authors whose 
works have been analyzed here. We also 
found 12 additional species reported by other 
workers scattered throughout the malacologi- 
cal literature. The disparity between the num- 
ber of confirmed species (31) and the total 
number of reported species (58) can be at- 
tributed to a combination of synonyms and er- 
roneous reports. 

Brown's (1903) faunal list has special sig- 
nificance because it is presumably the basis 
for a widely circulated estimate of the number 
of species present on Barbados. We refer to a 
report (Groombridge, 1992) complied by the 
World Conservation Monitoring Centre in col- 
laboration with a number of highly respected 
international conservation organisations. This 
report contains a list (p. 151, table 1 4.3) of the 
total number of land snails on various islands. 
Data in the list were compiled by the Species 
Survival Commission Mollusc Specialist 
Group of the International Union for Conser- 
vation of Nature and Natural Resources 
(lUCN/SSC), but without specific references. 
Barbados is said to have 37 species, which is 
the exact, and unique, number reported by 



Brown (1903). In light of the special status af- 
forded to Brown's total, and noting that we 
have been able to confirm the validity of only 
23 of the 37 "species" from his list (Table 1), a 
detailed analysis of Brown's list is warranted. 
In addition to the 23 confirmed species, two 
species are unconfirmed but likely to occur in 
Barbados, five species are correctly identified 
but of dubious locality, and five species were 
listed by Brown only by attribution to others 
(Table 3). By this reckoning, the total of con- 
firmed and unconfirmed species from Brown's 
list is 35. The two remaining taxa from 
Brown's list are redundant synonyms: Opeas 
goodalli and Opeas ascendens are both 
Opeas hannense; Cecilioides gundlachi and 
Opeas gundlachi are both Cecilioides aperta. 
Brown introduced further confusion by la- 
belling as Cecilioides aperta specimens that 
are in fact Cecilioides consobrinus minutis- 
sima. 

No doubt the reason that Groombridge 
(1992) lists the land snail fauna of 86 islands 
is that islands have been well studied by 
malacologists (e.g., Peake, 1981; Solem, 
1 984; Cowie, 1 997). On the face of it, the data 
set is a good basis for monitoring international 
conservation efforts. However, given the like- 
lihood that islands other than Barbados also 
have erroneous entries, the information con- 
tained therein, particularly by older workers, 
must be viewed with caution. Additionally, the 
notoriously disputed taxonomy of pulmonale 
gastropods can create major problems for 
modern workers. In our taxonomical section, 
in which 38 species are treated, 136 variant 
names are listed, covering synonyms, mis- 
identifications and variant genus/species 
combinations, but excluding different taxon 
authorships (often incorrect) and citations at 
the genus level only. We think it appropriate to 
advise that serious conservation work on 
many of these islands must be preceded by 
careful checking of the historical records. A 
similar laborious effort will be required for 
many non-island localities. 

Our survey results can be compared with 
those of earlier workers to assess the conser- 
vation status of the Barbadian land snails, al- 
beit with the reservations implicit in the com- 
ments above. It is evident, from all records, 
that species diversity on Barbados (430 km^) 
is low relative to other small Caribbean is- 
lands, for example, Saba (13 km^, 1 4 species; 
Clench, 1970) and St. Martin (98.5 km^, 39 
species; Coomans, 1967). This is likely a re- 



54 



CHASE & ROBINSON 



suit of several factors, but principally the ab- 
sence of rnountains on Barbados, the large 
distance of Barbados from neighboring is- 
lands, and the fact that Barbados lies to the 
east of other islands, hence upwind and up- 
current. In our surveys, we found six endemic 
species, five species native to the Lesser An- 
tilles and/or South America, three pan- 
Caribbean species and seven pan-tropical 
species. Conservation interest naturally fo- 
cuses on the endemic species, of which three 
were not found by us, including one, Bulimus 
fuscus. that is almost certainly extinct. On the 
other hand, we located specimens of Gly- 
phyalinia barbadensis, which had been con- 
sidered as an endemic based on Pfeiffer's 
original description of Helix Incisa (1866), but 
which had not been subsequently confirmed 
for the Barbados locality. Even if Lucldella 
barbadensis and Pseudoplneria barbadensis 
are eventually found, it is clear that the fauna 
is dominated by introduced taxa. Of these, 
several synanthropic species are particularly 
abundant, namely Bullmulus guadalupensis, 
Allopeas gracile. Allopeas micra, Becklanum 
becklanum, Leptlnaria lamellata, Zachrysia 
provisoria and Streptaxis glaber The synan- 
thropes represent a group of invasive species 
that are spreading by human transportation, 
hence referred to as "traveling species" 
(Robinson, 1999). 

While the overall diversity of land snails ap- 
pears to be approximately as great today as it 
was 150 years ago, its composition has 
evolved over time. Change will continue as 
new species are introduced from elsewhere 
(Cowie, 1998, Robinson, 1999), and tropical 
faunas worldwide become increasingly ho- 
mogenized. The synanthropic species, 
whether of Antillean or pan-tropical origin, are 
clearly the most abundant throughout Barba- 
dos, as little if any of the island remains in a 
truly undisturbed state. Whether the synan- 
thropes have actually displaced native 
species, or have simply occupied increasingly 
available habitats created by man, needs to 
be investigated. Of those endemic species 
that have survived, only those that are rela- 
tively catholic in their ecological requirements, 
or those whose natural habitat approximates 
an anthropochorous environment, seem to be 
maintaining stable populations. The remain- 
der seem destined to become extinct, if they 
have not already become so. In any case, it is 
clear from our study that any effort to under- 
stand the snail fauna of Barbados, or any 
other locality, with a view to identifying and 



protecting its indigenous elements, must 
carefully evaluate the evidence of historical 
trends. Indeed, the lessons learned here are 
equally applicable to all studies whose aim is 
to characterize biodiversity and conserve na- 
tive species. 

ACKNOWLEDGEMENTS 

Our field survey was made possible by fa- 
cilities and support provided by the Bellairs 
Research Institute of McGill University, 
Wayne Hunte, Director. For additional assis- 
tance of various kinds we are grateful to Alan 
Baldinger, Kenneth Boss, Robert Cowie, An- 
gela Fields, John Lewis, Joan Marsden, Fred 
Naggs, Gary Rosenberg, John Slapcinsky, 
Fred Thompson and two reviewers of the 
manuscript. The work was financially sup- 
ported by a grant to R.C. from the Natural Sci- 
ences and Engineering Research Council of 
Canada. 

LITERATURE CITED 

ABBOTT, R. T, 1973, American malacologists, 
Falls Church, Virginia, 494 pp. 

ADAMS, С В., 1845, Specierum novarum con- 
chyliorum in Jamaica repertorum, synopsis. Pro- 
ceedings of the Boston Society of Natural History, 
2: 1-17 

BAKER, H. В., 1925, The Mollusca collected by the 
University of Michigan-Williamson Expedition in 
Venezuela. Part III. Pupillidae toOleacinidae. Oc- 
casional Papers of the Museum of Zoology Uni- 
versity of Michigan, (156): 1-56, 11 pi. 

BAKER, H. В., 1930, The North American Retinel- 
lae. Proceedings of the Academy of Natural Sci- 
ences of Philadelphia, 82: 193-219, pi. 9-14. 

BAKER, H. В., 1962, Puerto Rican land opercu- 
lates. Nautilus, 76(1): 16-22. 

BAKER, H. В., 1963, Type land snails in the Acad- 
emy of Natural Sciences of Philadelphia. Part II. 
Land Pulmonata, exclusive of North America, 
north of Mexico. Proceedings of the Academy of 
Natural Sciences of Philadelphia, 115(8): 191- 
259. 

BECK, H. H., 1837, Index molluscorum prœsentis 
aevi musei Principis Augustissimi Christiani Fre- 
rerici. Hafniae, 124 pp. 

BLAND, T, 1855, Notes on certain terrestrial mol- 
lusks which inhabit the West Indies. Annals of the 
Lyceum of Natural History of New York, 6: 147- 
155. 

BLAND, T, 1862, On the geographical distribution 
of the genera and species of land shells of the 
West India islands; with a catalogue of the 
species of each island. Annals of the Lyceum of 
Natural History of New York, 7: 335-361 . 

BLAND, T, 1875, Examen critique de certaines es- 



LAND SNAILS OF BARBADOS 



55 



peces du Continent Américain et des Antilles, 
décrites dans la monographie des Helicina (Con- 
chologia Iconica) de L. Reeve, comme appar- 
tenant à ce genre. Journal de Conchyliologie. 23: 
245-252. 

BORN, I. VON, 1780, Testacea Musei Ceesarei Vin- 
dobonensis. Vienna, xxxvi + 442 + 17 pp., 18 pis. 

BROWN, L. В., 1903, Notes on the land and fresh- 
water shells of Barbados. Journal of Conchology, 
10:266-273. 

BREURE, A. S. H., 1974, Caribbean land molluscs: 
Bulimulidae I. Bulimulus. Studies on the Fauna of 
Caraçao and other Caribbean Islands, 45(145): 
1-80, 7 pi. 

BREURE, A. S. H., 1975, Caribbean land molluscs: 
Bulimulidae II. Plekocheilus ana Naesiotus. Stud- 
ies on the Fauna of Curaçao and other Caribbean 
Islands. 46(152): 71-93, pis. 6-8. 

BRUGGEN, A. D., VAN, S. M. WELLS & T. С M. 
KEMPERMAN, eds., 1995, Biodiversity and con- 
servation of the l\/lollusca. Leiden, Backhuys, 228 
pp. 

BRUGUIÈRE, J. G., 1789-1792, Encyclopédie 
méthodique. Histoire naturelle des vers. Tome 
premier Panckoucke, Paris, xviii + 757 pp. 

CARRINGTON, S., 1993, Wild plants of Barbados. 
MacMillan, London, vii + 128 pp. 

CLENCH, W. J., 1970, Land Mollusca of Saba Is- 
land, Lesser Antilles. Occasional Papers on Mol- 
lusks, Harvard University 3(38): 53-60. 

CLENCH, W. J. & R. D. TURNER, 1948, The genus 
Truncatella in the western Atlantic. Johnsonia. 
2(25): 149-164, pi. 63-73. 

COOMANS, H. E., 1967, The non-marine mollusca 
of St. Martin (Lesser Antilles). Studies on the 
fauna of Caraçao and other Caribbean islands, 
24: 118-145. 

COWIE, R. H., 1997, Catalog and bibliography of 
the nonindigenous nonmarine snails and slugs of 
the Hawaiian Islands. Bishop f[/luseum Occa- 
sional Papers, (5): 1 -66. 

COWIE, R. H., 1998, Patterns of introduction of 
non-indigenous non-marine snails and slugs in 
the Hawaiian Islands. Biodiversity and Conserva- 
tion, 7: 349-368. 

DESHAYES, G. P., 1850, in D. DE féRUSSAC & G. -P. 
DESMAYES, Histoire naturelle générale et partic- 
ulière des mollusques terrestres et fluviátiles, tant 
des espèces que l'on trouve aujourd'hui vivantes, 
que des dépouilles fossiles de celles qui n'exis- 
tent plus; classés d'après les caractères essen- 
tiels que présentent ces animaux et leurs co- 
quilles, tome premier A Bertrand, Paris, 402 pp. 

DROUËT, H., 1859, Essai sur les mollusques ter- 
restres et fluviátiles de la Guyane Française. 
Baillière, Paris, 116 pp. 

FÉRUSSAC, A. E. J. P J. F. DA., BARON DE., 
1 821 , Tableaux systématiques des animaux mol- 
lusques classés en familles naturelles 

Tableau de la famille des limaçons, Cochleae. 
Bertrand, Paris & Sowerby, London, 90 pp. 

FÉRUSSAC, A. E. J. P. J. F. DA., BARON DE,, 
1822a, Histoire naturelle générale et particulière 



des mollusques terrestres et fluviátiles, tant des 
espèces que l'on trouve aujourd'hui vivantes, 
. . ., livraison 14: pi. 8B, 8C, 25A, 42, 45, 47. 

FÉRUSSAC, A. E. J. R J. F. DA., BARON DE., 
1 822b, Histoire naturelle générale et particulière 
des mollusques terrestres et fluviátiles, tant des 
espèces que l'on trouve aujourd'hui vivantes, 
. . ., livraison 17: pi. 48, 53, 63, 75A, 75B, 113. 

FÉRUSSAC, A. E. J. R J. F. DA., BARON DE., 
1832, Histoire naturelle générale et particulière 
des mollusques terrestres et fluviátiles, tant des 
espèces que l'on trouve aujourd'hui vivantes, 
. . ., livraison 22: pi. 50, 54A, 56, 56A, 56B, 117. 

GASCOIGNE, A., 1994, The biogeography of land 
snails in the islands of the Gulf of Guinea. Biodi- 
versity and Conservation, 3: 794-807. 

GETZ, L. С & G. W. UETZ, 1994, Species diversity 
of terrestrial snails in the southern Appalachian 
mountains, U.S.A. /Wa/aco/ogf/ca/ Review. 27: 
61-74. 

GIBBONS, J. S., 1879, Notes on the habits and dis- 
tribution, &c., of certain W. Indian Pulmonifera. 
Journal of Conchology 2: 1 29- 1 34. 

GMELIN, J. F., 1791, Caroli a Linné systema natu- 
rae, ed. 13, 1(6): 3021-3909. 

GOULD, A. A., 1848, [New species from United 
States]. Proceedings of the Boston Society of 
Natural History. 3: 37-41 . 

GRAVELAND, J., R. VAN DER WAL, J. H. VAN 
BALEN & A. J. VAN NOORDWIJK, 1 994, Poor re- 
production in forest passerines from decline of 
snail abundance on acidified soils. Nature. 368: 
446-448. 

GRAY, J. E., 1824. Monograph of the genus Heli- 
cina. Zoological Journal. 1(1): 62-71, pi. 6. 

GROOMBRIDGE, В., ed., 1992, Global biodiver- 
sity: status of the earth's living resources. Chap- 
man & Hall, London, 585 pp. 

GUILDING, L., 1828a, Observations on the zoology 
of the Caribbean islands (continued). Zoological 
Journal. 3(12): 527-544, pi. 6. 

GUILDING, L., 1828b, Observations on the zoology 
of the Caribbean islands (continued). Zoological 
Journal. Л(^ 4): 164-175. 

GUPPY R. J. L., 1868a, Further additions to the 
catalogue of the land and freshwater Molluska of 
Trinidad. Proceedings of the Scientific Associa- 
tion of Trinidad. 1 : 237-245. 

GUPPY R. J. L., 1868b, On the terrestrial Mollusca 
of Dominica and Grenada; with an account of 
some new species from Trinidad. The Annals and 
!\Aagazine of Natural History, (4) 1 : 429-442. 

HAAS, F., 1962, Caribbean land molluscs: Subulin- 
idae and Oleacinidae. Studies on the Fauna of 
Curaçao and other Caribbean Islands, 13(58): 
49-60, pi. 7-11. 

HENDERSON, J. В., 1919, Mollusca, pp. 88-96, 
in с с. NUTTING, Barbados-Antigua Expedition, 
narrative and preliminary report of a zoological 
expedition from the University of Iowa to the 
Lesser Antilles under the auspices of the Gradu- 
ate College. Studies in Natural History, 8(3): 
274 pp. 



56 



CHASE & ROBINSON 



HUGHES, G., 1750, The natural history of Barba- 
dos. London, 314 pp. 

HUTTON, T, 1834, On the land shells of India. 
Journal of the Asiatic Society of Bengal. 3(26): 
81-93. 

KILLEEN. I. J., M. B. SEDDON & A. M, HOLMES, 
1998, Molluscan conservation: a strategy for the 
21st century. Journal of Conchology. Special 
Publication 2: 320 pp. 

KOBELT, W., 1880, Die geographische Verbreitung 
der Mollusken. Jahrbücher der Deutschen 
Malakozoologlschen Gesellschaft. 7: 241 -285. 

KRAUS, F., 1996. A revision of the Caribbean 
genus Pseudoplneria (Gastropoda; Pulmonata: 
Urocoptidae). Malacological Review. 28(1-2): 
107-117. 

LAMARCK. J. B. P. A. DE M. DE. 1822. Histoire na- 
turelle des animaux sans vertèbres. 6(2): 1 -230. 

LINN/EI [= LINNÉ], C, 1758, Systema naturas per 
régna tria naturœ . . ., tomus I, editio décima, re- 
formata. Holmiae, 824 pp. 

MCGINTY, T. L., 1939. OxystylaUom western Mex- 
ico (continued). Nautilus, 53(1): 4-7, pi. 2. 

MÜLLER, О. F.. 1774. Vermlum terrestrium et fluvi- 
atilium. seu animalium infusorium, helminthico- 
rum. et testaceorum. non marinorum. succincta 
historium. Volumen alterum. Heineck et Faber, 
Havniae [= Copenhagen] et Lipsiae [= Leipzig]. 
XXXV + 214 + 10 pp. 

ORBIGNY, A. D.. 1835, Synopsis terrestrium et flu- 
viatilium molluscorum, in suo per America merid- 
ionalem itinere. Magasin de Zoologie. 5(CI. V No. 
61): 1-22. 

PEAKE. J. F., 1981, The land snails of islands -a 
dispersalist's viewpoint. Pp. 247-263, in p. l. 
FOREY, ed.. The evoluting biosphere. British Mu- 
seum (Natural History) and Cambridge University 
Press, London and Cambridge, 311 pp. 

PFEIFFER, L., 1839. Bericht über die Ergebnisse 
meiner Reise nach Cuba im Winter 1838-1839, 
Archiv für Naturgeschichte, 5(1): 346-358. 

PFEIFFER, L. 1844, Cylindrella Tab. 1. In R. a. 
PHiLiPPi, ed.. Abbildungen und Beschreibungen 
neuer oder wenig gekannter Conchylien, 1(8): 
179-186. 

PFEIFFER, L., 1846, Symbolae ad historiam he- 
liceorum. Sectio tertia. T Fischer, Cassel, 100 pp. 

PFEIFFER, L.. 1847, f^onographia heliceorum 
viventium. Lipsiae. 1: 1-484. 

PFEIFFER, L., 1848, f^onographia heliceorum 
viventium. Lipsiae, 2: 1 -594. 

PFEIFFER, L., 1849, Descriptions of twenty-four 
new species of Helicea, from the collection of H. 
Cuming, Esq. Proceedings of the Zoological So- 
ciety of London: 1 26- 1 31 

PFEIFFER, L., 1853, Monographia heliceorum 
viventium, Lipsiae, 3: 1 -711 . 

PFEIFFER, L.. 1854, Descriptions of sixty-six new 
land shells, from the collection of H. Cuming, 
Esq. Proceedings of the Zoological Society of 
London (for 1852), 20: 56-70. 

PFEIFFER, L., 1856. Diagnosen neuer Land- 
schnecken. Malakozoologische Blätter, 3: 43- 
52. 



PFEIFFER. L.. 1857, Descnptions of sixteen new 
species of Pneumonopoma, from the collection of 
H. Cuming, Esq. Proceedings of the Zoological 
Society of London (for 1856), 24: 336-339. 

PFEIFFER, L., 1858, Zur Molluskenfauna der Insel 
Cuba. Malakozoologische Blätter 5: 37-49. 

PFEIFFER, L., 1866, Beschreibung neuer Land- 
schnecken. Malakozoologische Blätter 13: 76- 
91. 

PFEIFFER, L.. 1868, Monographia heliceorum 
viventium. 5: 1 -565. 

PFEIFFER, L., 1876, Monographia heliceorum 
viventium, 7: 1 -674. 

PILSBRY, H.A., 1889, Manual of conchology (2)5: 
1-216. 

PILSBRY, H. A., 1897-1898, Manual of conchol- 
ogy (2)11: 1-339. 

PILSBRY H. A., 1904, Manual of conchology (2) 
16: 1-329. 

PILSBRY H. A., 1907-1908, Manual of conchol- 
ogy (2)19: 1-366. 

PILSBRY H. A., 1909-1910, Manual of conchol- 
ogy (2)20: 1 -336. 

PILSBRY H. A., 1916-1918, Manual of conchol- 
ogy (2)24: xii H- 380. 

PILSBRY H. A., 1928, Studies on West Indian mol- 
lusks: the genus Zachrysia. Proceedings of the 
Academy of Natural Sciences of Philadelphia, 80: 
581-606, pis. 28-30. 

PILSBRY, H. A., 1930, Results of the Pinchot South 
Sea Expedition, - I. Land mollusks of the 
Caribbean Islands, Grand Cayman, Swan, Old 
Providence and St. Andrew. Proceedings of the 
Academy of Natural Sciences of Philadelphia. 82: 
221-261. 

POTIEZ, V L. V. &A. L. G.MICHAUD, 1835-1839, 
Galerie des mollusques, ou catalogue métho- 
dique, descriptif et raisonné des mollusques et 
coquilles du Muséum de Douai, tome premier. 
Paris & Londres, xxxvi h- 560 -i- 4 p. [1838]; Atlas: 
79 pp., 70 pis. [pis. 1-15: 1835]. 

PROSCHWITZ, T VON, 1994, Lamellaxis clavuli- 
nus (Potiez & Michaud) as a greenhouse species 
in Sweden. Journal of Conchology, 35(2): 
184-185. 

RAMIREZ, R. L., 1993, A generic analysis of the 
family Systrophiidae (Mollusca: Gastropoda): 
taxonomy, phytogeny and biogeography Unpub- 
lished M.A. thesis, Univ. Kansas, 218 pp. 

RANG, S., 1831, Description des coquilles ter- 
restres recueillies pendant un voyage à la côte 
occidentale d' Afnque, et au Brésil. Annales des 
Sciences Naturelles, 24: 5-63, pis. 1 -3. 

ROBINSON, D. G., 1999, Alien invasions: the ef- 
fects of the global economy on non-marine gas- 
tropod introductions into the United States. Mala- 
co/ogf/a, 41(2): 413-438. 

ROSENBERG, G., 1996, Independent evolution of 
terrestriality in Atlantic truncatellid gastropods. 
Evolution, 50(2): 682-693. 

RUSH, W. H., 1891 , List of species collected on the 
islands St. Thomas, St. Kitts, Barbados, Jamaica 
and at Pensacola, Flonda; with prefatory notes. 
Nautilus, 5(6): 65-70. 



LAND SNAILS OF BARBADOS 



57 



SMITH, E. A., 1895, Report on the land and fresh- 
water shells collected by Mr. Herbert H. Smith at 
St. Vincent, Grenada, and other neighbouring is- 
lands. Proceedings of the Malacological Society 
of London, 1: 300-322. 

SMITH, E. Д., 1898, On some land shells from 
Trinidad. Journal of Conctiology, 9(1): 27-29, 
figs. 1 -6. 

SMITH, E. A. & H. W. FEILDEN, 1891 , A list of the 
land and freshwater shells of Barbados. Annals & 
Magazine of Natural History, (6)8: 247-257. 

SOLEM, A., 1984, A world model of land snail di- 
versity and abundance, pp. 6-22, In: a. solem & 
A. H. с VAN BRUGGEN, eds., World-wide snails. E. 
H. J. Brill, Leiden, 289 pp. 

SOWERBY, G. В., II, 1864, Thesaurus conchylio- 
rum. or figures and descriptions of Recent shells, 
3(23): pis. 266-278 (Helicina Second mono- 
graph, pi. 1-13). 

SOWERBY, G. В., II, 1866, Second monograph of 
the genus Helicina, including the genera 
Trochatella, Lucldella, Helicina. Schiascheila and 
Aleadla, of authors. Thesaurus conchyliorum, or 
monographs of genera of shells. 3: pis. 277-302. 

SOWERBY G. В., II, 1873-1874, Conchologia 
iconica, 19 (Helicina): pis. 1-34. 

SWAINSON, W., 1840, A treatise on malacology: or 
the natural classification of shells and shell fish. 
Longman, Orme, Brown, Green & Longmans & 
John Taylor, London, viii -i- 419 pp. 

TORRE, С DE LA, 1960, Caribbean species of 
Truncatella. Nautilus, 73(3): 79-88. 

VENMANS, L. A. W. C, 1963, Caribbean land mol- 
luscs: Streptaxidae. Studies on the Fauna of Cu- 
raçao and Other Caribbean Islands, 14(61): 
41-76. 

WAGENAAR HUMMELINK, P., 1940, A survey of 
the mammals, lizards and mollusks. Studies on 
the Fauna of Curaçao and Other Caribbean Is- 
lands, 1:59-108. 

WAGNER, A. J., 1907-1911, Die Familie der Не- 
licinidae. Systematisches Conchylien-Cabinet 
von Martini & Chemnitz, (n. s.)1(18:2): 1-391, 
pis. 1-170. 

WÄREBORN, I., 1992, Changes in the land mollusc 
fauna and soil chemistry in an inland district in 
southern Sweden. Ecography 15: 62-69. 

WILLING, M. J., 1998, The conchological society 
and molluscan conservation: Past, present and 
future, pp. 139-145, In i. j. killeen, m. b. seddon. 
& A. M. HOLMES, Molluscan conservation: a strat- 
egy for the 21st century, Journal of Conchology 
Special Publication. 



Helicina fasciata substriata Gray, 1824- 

ANSP 399360 & 399361 
Truncatella barbadensis Pfeiffer, 1857- 

ANSP 401921 & 401922 
Succinea barbadensis Guilding, 1828- 

ANSP 399354 
Gastrocopta barbadensis (Pfeiffer, 1853)- 

ANSP 401923 
Bulimulus guadalupensis (Bruguière, 1789)- 

ANSP 399359 
Orthallcus maracalbensis subpulchella (Pils- 

bry, 1 889)- ANSP 399357 
Brachypodella costata (Guilding, 1828)- 

ANSP 399362 
Allopeas gracile (Hutton, 1834)- ANSP 

401924 
Allopeas miera (d'Orbigny, 1835)- ANSP 

401925 
Beckianum becklanum (Pfeiffer, 1846)- 

ANSP 401926 
Leptinaria lamellata (Potiez & Michaud, 

1835)- ANSP 401927 
Luntia insignis Smith, 1898 -ANSP 401928 
Opeas hannense (Rang, 1831)- ANSP 

401929 
Subulina octona (Bruguière, 1792)- ANSP 

399364 
Streptaxis glaber (Pfeiffer, 1849)- ANSP 

399355 
Happiella cf. decolorata (Drouët, 1859)- 

ANSP 401930 
Megalobulimus oblongus (Mijller, 1774)- 

ANSP 399356 
Lacteoluna selenina (Gould, 1848)- ANSP 

401931 
Pleurodonte Isabella (Férussac, 1822)- 

ANSP 399358 
Zachrysia provisoria (Pfeiffer, 1858)- ANSP 

399363 & AI 8831 
Bradybaena similaris (Rang, 1831)- ANSP 

401932 

Synoptic collections have been deposited 
at the Bellairs Research Institute of McGill 
University, Holetown, Barbados, and the De- 
partment of Biological and Chemical Sci- 
ences, University of West Indies, Cave Hill 
campus, St. Michael, Barbados. 



Revised ms. accepted 19 July 2000 



NOTE ADDED IN PROOFS 



APPENDIX 

The following specimens collected during 
this study have been deposited as vouchers 
in the Department of Malacology at the Acad- 
emy of Natural Sciences, Philadelphia. 



Subsequent to completion of the manu- 
script we received one specimen of Achatina 
fullea Bowdich, 1833, from Barbados. Its in- 
troduction probably occurred within the previ- 
ous year, but its distribution is yet to be deter- 
mined. 



MALACOLOGIA, 2001, 43(1-2): 59-85 

REPRODUCTION, DURATION OF EMBRYOGENESIS, EGG CAPSULES AND 

PROTOCONCHS OF GASTROPODS OF THE FAMILY BAICALIIDAE 

(CAENOGASTROPODA) ENDEMIC TO LAKE BAIKAL 

T. Sitnikova\ P. Röpstorf^ & F. Riedel^ 



ABSTRACT 

Data on the reproduction and duration of embryogenesis have been obtained for the first time 
for the Lake Baikal endemic gastropods of the family Baicaliidae. Their reproduction occurs 
throughout the year, but with peaks in spring and autumn. Embryogenesis duration supposedly 
depends on the near-bottom water temperature. Hatching appears to be timed to coincide with 
the periods of increased food supplies. Egg capsule and protoconch morphology has been ex- 
amined in several species, and four types of capsules are described. Shells of the Baicaliidae 
are orthostrophic, and only in Liobaicalia stiedae does the protoconch axis differ significantly 
from the teleoconch axis, which was previously mistaken for heterostrophy. Three groups were 
distinguished on the basis of a cluster analysis of size and number of protoconch whorls. These 
clusters do not fully coincide with the recent taxonomy of the Baicaliidae based on shell mor- 
phology and the female reproductive system. Some species assigned to the same genus or sub- 
genus differ either in protoconch size or egg capsule morphology. 

Key words: ancient lakes, Baikal, rissooidean gastropods, egg capsules, embryogenesis, pro- 
toconchs. 



INTRODUCTION 

More than 100 species of Gastropoda are 
known to inhabit Lake Baikal; of these, 40 are 
assigned to the family Baicaliidae (Sitnikova, 
1994) following the classification of 
Starobogatov & Sitnikova (1983), or to the 
subfamily Baicaliinae of the family Hydrobi- 
idae according to Ponder & Waren (1988). 
Baicaliids are one of the least studies groups 
of endemic molluscs in Lake Baikal. Never 
before has their embryonic shell been closely 
examined, though at least one baicaliid- L/- 
obaicalia stiedae (Dybowski, 1875)- was re- 
ported to possess a heterostrophic shell by 
Dybowski (1875), and this information Is in- 
cluded in various reference books on gas- 
tropods. Egg capsule morphology data are 
scarce: only three species (without precise 
identification) have been previously described 
(Sitnikova, 1991a). There is information 
(Gavhlov, 1953) on the reproduction of only 
one species, Maackia {Eubaicalia) herderiana 
(Gerstfeldt, 1859). Our initial goal was to 
study egg capsule and protoconch morphol- 
ogy, but in the process we obtained additional 
data relevant to the duration of reproduction 



and embryogenesis in several species. These 
data are included In this paper. 



MATERIALSAND METHODS 

Living gastropods and egg masses were 
collected by SCUBA divers or by means of a 
dredge or grab in 1995-1997 (Table 1, Fig. 1). 
The egg capsules were kept in 10 ml glass 
vials until hatching in a refrigerator (6°C). Ma- 
terial of previous expeditions, from other lo- 
calities, stored at the Limnological Institute, 
was used for comparison. 

Some adult gastropods were brought alive 
to the Institute of Ecological Toxicology in 
Baikalsk, where a steady stream of Lake 
Baikal water (from a depth of 40 m) with a 
constant temperature of 6°C was maintained. 
Each species was cultivated separately in a 
20 I glass vessel. In order to obtain egg cap- 
sules from a single species, all egg clutches 
laid on the shells prior to the experiment were 
removed. The clutches were kept in aquaria 
from July 1995 until May 1996 and were 
checked dally until the end of September, and 
then weekly until November. 



Vimnologlcal Institute, P.O. Box 4199, Irkutsk, 664033, Russia: sit@lin.lrk.ru 
Institute of Palaeontology, Freie Universität Berlin, Germany; palaeont@zedat.fu-berlin.de 



59 



60 



SITNIKOVA, ROPSTORF & RIEDEL 



TABLE 1 . List of investigated species and sites of their collection. 



Site 



Species 



1 Baklany Rock next to Pestchanaya. sand, 

5-10 m, 07.16.1995 

2 Bolshie Koty, sand, 9-10 m, 16.07.1995 

3 Bolshiie Koty, Zhilische canyon, rock, 

3-15 m, 27.07.1995, 14.12.1997 



4 Bolsfiie Koty, sand, 15-18 m, 27.07.1995 



5 Kultuk. Shaman Cape, silty sand, 20 m, 
27.08.1996 



6 Maloe More Strait, Ushun Cape, sand, 

10-12 m, 13.10.1995 

7 Maloe More Strait, OIkhon Gate, grey 

sand, 27-31 m, 13.10.1995 

8 Maloe More Strait, Ushun Cape, stones, 3 

and 14 m, 13.10.1995 

9 Maloe More Strait, Shaman Rock, stones, 

5 m, 14.09.1996 
10 Chivyrkui Bay, sand. 20-28 m, 20-25 m, 
16,10.1995 



11 Chivyrkui Bay, Kyltygei Island, stones, 

1.5-2 m, 08.10.1997 

12 Svyatoi Nos Peninsula, stones. 6-8.5 m, 

15.10.1995 

13 Boguchany, stones, 3 m, 18.10.1995 



14 Muzhinai, silty sand, 20-64 m, 

20.10.1995 

15 Barguzin Bay, sand, 25 m, 14.10.1995 



Parabaikalia oviformis (Dybowski, 1875); P. elata elata 
(Dybowski, 1875): Korotnewia semenkewitschi 
(Lindholm, 1909) 

Parabaikalia flon/f/on/ (Dybowski, 1875); P. elata elata 
(W. Dybowski, 1875) 

Baicalla /um/orm/s Lindholm, 1909; Maackia 
(Eubaicalla) bythlnlopsis {Undholm. 1909); M. (E.) 
herderlana (Gerstfeldt, 1859): M. (Maackia) costata 
(Dybowski, 1875) 

Liobaicalia stiedae [Dybowski, 1875); Pseudobalkalia 
(Pseudobaikalia) confabu/afa (Dybowski, 1875); P. 
(P) zac/7ivaiA:/n/ Kozhov, 1936 

Liobaicalia stiedae (W. Dybowski, 1875); Baicalla cari- 
nata (W. Dybowski, 1875); Pseudobaikalia [P.) con- 
tabulata (Dybowski, 1875); P. (Microbacalia) pulla 
pu//a (Dybowski, 1875) 

Parabaikalia florii kobeltiana Lindholm, 1909; P. elata 
e/aia (Dybowski, 1875) 

Teratobaikalia {Baicaliella) nana (Lindholm, 1909), T. 
(В), nana f. clandestina Beckman & Starobogatov, 
1975; Parabaikalia florii kobeltiana Lindholm, 1909 

Maackia [Eubaicalla) by№/n/ops/s (Lindholm, 1909); M. 
(E.) i/ar/escu/pía (Lindholm, 1909); Teratobaikalia 
{Teratobaikalia) macrostoma Lindholm, 1909 

Teratobaikalia (Teratobaikalia) macrostoma Lindholm, 
1909 

Parabaikalia elata dubiosa (Kozhov, 1936); Pseudo- 
baikalia (Pseudobaikalia) contabulata (Dybowski, 
1875); Teratobaikalia (Baikaliella) nanat clandestina 
Beckman & Starobogatov, 1975; T (B.) nanai. pro- 
ducta Beckman & Starobogatov, 1975; T (Trichlo- 
baikalia) du/b/ers// (Dybowski, 1875); Korotnewia 
semenkewitschi (L\nöho\m. 1909); Baicalla carinata 
(Dybowski, 1875); B. car/naíocosíaía (Dybowski, 
1875); Godlewskia pulchella (V^. Dybowski, 1875) 

Teratobaikalia (Teratobaikalia) macrostoma Lindholm, 
1909 

Maackia (Eubaicalla) uar/escu/pía (Lindholm, 1909); M. 
(E.) bythlnlopsis L\nóho\m, 1909 

Maackia (Eubaicalla) vanescu/pía (Lindholm, 1909); 
Baicalla dybowskiana Lindholm, 1909/W. (E.) bythln- 
lopsis Unóholm, 1909; Teratobaikalia (Trichiobaikalia) 
ciliata (W. Dybowski, 1875); 

Baicalia cannata (W. Dybowski, 1875); P. oviformis 
(W. Dybowski, 1875) Parabaikalia elata elata 
(W. Dybowski, 1875); 

Teratobaikalia (Baikaliella) nana clandestina Beckman 
& Starobogatov, 1975; T (B.) nana humerosa 
Beckman & Starobogatov, 1975; Pseudobaikalia 
(Microbaicalia) pulla tenuicosta (Lindholm, 1909) 



Hatched snails and juveniles with intact 
protoconchs were fixed in 70% ethanol. Egg 
capsules unused in the experiments were 
fixed in 4% formaldehyde or 2.5% glutaralde- 
hyde. 

The shells of hatched embryos and older ju- 
venile gastropods were examined and mea- 



sured using a Cambridge 360 SEM (Scanning 
Electron Microscope) in Berlin. Calcification of 
the embryonic shell was studied with a Zeiss 
Axiophot microscope using polarized light. 
The term "protoconch" can be applied here to 
the embryonic shell, because baicaliids have 
no free larvae and hence no larval shells. In 



REPRODUCTION AND EMBRYOGENY IN BAICALIID RISSOOIDEANS 61 



Boguchany 



Muzhinai 



Svyatoi Nos Peninsula 

Shaman Rock 
M aloe More - 
Ushim Cape -~- 



Kyltygei 

Chivyrkui 
Bi 

Barguzin Bay 



Angara 
River 

Kultul 



Pestchanaya 



Bolshie 



Loty 



Selenga River 



Baikalsk 

FIG. 1 . Map of Lake Baikal with indication of collection sites. 



addition to the description of their sculpture, 
four measurements are given: number of 
whorls, maximum diameter, maximum width 
of the non-spiral of the primordial shell (Fig. 
2), and the height from the apex to the end of 
the aperture. 
Calculation of the temperature sum (de- 



gree-days): The data on day-to-day variations 
of water temperature in near-bottom waters of 
the littoral zone of Lake Baikal are lacking. Ac- 
cording to Prof. Shimaraev (Limnological In- 
stitute, Irkutsk, personal communication), an 
expert on the thermal regime of the lake, it is 
possible to estimate approximately the tem- 



62 



SITNIKOVA, RÖPSTORF& RIEDEL 




FIG. 2. Apical view of a protoconch with explana- 
tions of measurements. I = initial point (axis of 
counting whorls), MD = maximal diameter, N = non- 
spiral (from Riedel. 1993). 

perature sum (degree-days) by using monthly 
averages of water temperatures basing on 
data for 1897-1902 for the Goloustnoye re- 
gion at depths of 5, 10, and 20 m. (Voznesen- 
sky, 1 908) and for 1 91 1 - 1 91 6 for Peschanaya 
Bay at 5, 10, 20 m depths (Verbolov et al., 
1965). These data are presented in Figure 3. 

We chose the temperature regimes of the 5, 
10 and 20 m depths, because the gastropods 
for which the egg-laying time and duration of 
embryonic development were investigated 
occur in large quantities at depths above 20 
m. The time of embryonic development of the 
gastropods is given (in days), and ambient 
water temperature in the laboratory or that es- 
timated in the lake (in X), which allows a cal- 
culation of the duration of embryogenesis in 
degree-days (or temperature sum), that is, av- 
erage temperature in °C multiplied by the 
number of days. 

Statistical processing (T-test, Cluster and 
Factor analysis) of data was performed using 
the Statistica 4.3 software package. Results 
were analysed and reported by T Y. Sitnikova. 

Most adult specimens are stored at the Lim- 
nological Institute of Siberian Branch of the 
Russian Academy of Sciences in Irkutsk. The 
SEM-preparations of protoconchs and em- 
bryos were deposited at the Institute of 
Palaeontology of the Free University of Berlin. 

RESULTS 
Duration of Embryogenesis 

Data on the reproduction of 15 species of 
baicaliids were obtained. Observations on em- 
bryonic development in culture have shown 
that when the egg capsules are laid, they con- 
tain a round, yellow embryo with no deter- 



mined structure of about 0.3 mm in diameter. 
After 1 -3 mo, the embryo begins to develop a 
foot, head and visceral mass. After another 
2-3 mo, the visceral mass is covered by an or- 
ganic shell, showing a pit (Fig. IIB). Calcifica- 
tion starts from the apical part of the shell. The 
margin of the mantle is extremely broad in all 
species examined (Fig. 7A). When the shell 
has reached 0.5-0.75 whorls, the operculum 
has formed, but at that time the embryo is un- 
able to retract into the shell. A fully developed 
young snail occupies the whole lumen of its 
capsule. The snails always hatch through a 
hole at the top of the capsule. 

Shell growth stops for a while before the 
embryos leave their capsules, despite their in- 
tense consumption of intracapsular sub- 
stance and excretion of faecal pellets. 

The duration of embryonic development 
was observed in eight species (Table 2). They 
laid clutches in the laboratory in autumn (Sep- 
tember-November). Under a constant tem- 
perature of 6°C development lasted 6-9 mo, 
but the actual temperature of near-bottom 
water at 10 m depth rises as high as 10-12°C 
in summer (Kozhov, 1963). Thus, the duration 
of the in vivo development of embryos ap- 
pears to be different. 

To calculate the duration of embryogenesis 
in baicaliids in their natural conditions, we 
have selected four species: Maackia herderi- 
ana, Baicalia cahnata, Parabaikalia florii, and 
Liobaicalia stiedae. Conditions were different 
for each. The first species occurs in great 
quantities at 5 m depth, the second and third 
at 5-10 m and deeper, the fourth at 15-20 m 
and deeper. 

Maackia herderlana: in laboratory culture, 
embryogenesis was equivalent to 1374 de- 
gree-days, egg capsules were laid in Septem- 
ber, and the young hatched in April. But the 
temperature sum in the lake at 5 m depth dur- 
ing the same period (from September to April) 
was calculated to be only 811 .8 degree-days; 
that is, under natural conditions, embryogé- 
nies should last longer. The young were pre- 
dicted to hatch in mid-August. For females 
laying capsules in mid-June, embryogenesis 
at 5 m depth may last about 7.5 mo, and the 
young will hatch in February (Table 3). This 
calculated duration of embryogenesis is con- 
sistent with what we have observed in nature: 
M. herderiana eggs collected at 5 m depth in 
October contained some mid-mature em- 
bryos (Table 4). 

Baicalia carinata: in laboratory culture, em- 
bryogenesis was 1290 degree-days and 



REPRODUCTION AND EMBRYOGENY IN BAICALIID RISSOOIDEANS 



63 




II III IV V 



VI VII VIII IX 
month 



XI XII 



FIG. 3. Temperature sum (degree-days) of water in different depthis per month, calculated after Voznesen- 
sky (1908) and Verbolov et al. (1965). 



TABLE 2. Data and duration of the embryogenesis in culture some of baicaliids collected from different 
regions of the Lake. 



Species 



Site 



Data of egg capsule 

laid in culture 

(number of 

capsules) 



Duration of 

embryogenesis in 

culture, in average 

days (range) 



Parabaikalia florii 

P. oviform i s 

P. elata 

Maackia herderiana 

M. variesculpta 

Baicalia carinata 

Pseudobaikalia 

zachwatkini 
Liobaicalia stiedae 



Maloe More strait, OIkhon 

Gate, Ushun Cape, 10- 

12 m, sand, 13.10.1995 
Southern Baikal, Baklany 

Rock 5-10 m, 16.07.1995 
Southern Baikal, Baklany 

Rock, 5-10 m, 16.07.1995 
Southern Baikal, Bolshie 

Koty, Zhilische canyon, 

rock, 3-15 m, 27.07.1995 
Boguchany, stones, 3 m, 

18.10.1995 
Kultuk, Shaman Cape, silty 

sand, 20 m, 27.08.1996 
Kultuk, Shaman Cape, silty 

sand, 20 m, 27.08.1996 
Kultuk, Shaman Cape, 20 m, 

sand, 27.08.1996 



01.11.1995 (n = 4) 



15.08-26.09.1995 

(n = 11) 
15.08.-09.09.1995 

(n = 3) 
23.08-29.09.1995 

(n = 3) 

31.10.1995-10.10.1996 
(n = 3) 

09.10.1995 (n = 1) 

01.09-03.10.1996 
(n = 6) 

03.09.1996 (n = 4) 



240 (238-245) 

216(170-253) 
217(192-253) 
229 (207-250) 

344 (n = 1 ) 

215 

190(186-194) (n = 2) 

180(174-186) 



lasted from October to April. Summed tem- 
perature in the lake at 10 m depth from Octo- 
ber to April inclusive was calculated to be 500 
degree-days. Under natural conditions, the 
embryogenesis of B. carinata in capsules laid 
in October has been predicted to last 11 .5 mo 



at 10 m depth (the young hatching in Septem- 
ber) and 11 mo at 20 m depth. For eggs laid in 
mid-June, embryogenesis may last 9.5 mo for 
10 m depth (the young will hatch in March), 
and 11.5 mo at 20 m depth (the snails will 
hatch in about May). (The summed yearly 



64 



SITNIKOVA, ROPSTORF & RIEDEL 



TABLE 3. Duration of the embryogenesis of some species in culture. 



Species 



Duration (degree* days) 
of embryogenesis 
in culture (in days) 



Predicted depth 

and time egg 

capsules were laid 



Predicted time of 

embryogenesis 

(in month) 



Maackia herderiana 
Baicalia carinata 



Liobaicalia stiedae 
Parabaikalia florii 



1374(229) 


5 m, September 


11.5 




5 m. mid-June 


7.5 


1290(215) 


10 m, October 


11.5 




10 m, mid-June 


9.5 




20 m, mid-October 


11 




20 m, June 


11.5 


1080(180) 


20 m. September 


10.5-11 


1440(240) 


5 m, November 


11 




5 m, June 


8-9.5 




10 m, November 


11.5 




10 m, June 


11 




20 m, November 


12.5 




20 m, June 


12 



TABLE 4. Data on the development of embryos collected from their natural habitat. 



Species 



Site 



Date of Egg 

collected egg capsulae Stage of embryos 

capsule Substrate number developing 



Maackia bythin- 


Northern and 


October 1995 


stones 


27 


various; from the first 


iopsis 


Middle Baikal 








stage of cleavage of a 
fairly developed 
embryo 




Southern Baikal 


December 
1997 


stones 


15 


embryos with a devel- 
oped shell 


M. herderiana 


different 


October 


stones 


35 


embryos possessing a 




regions 


1995 and 

December 

1997 






foot, head and vis- 
ceral mass 


M. vahesculpta 


Northern Baikal 


mid-October 
1995 


stones 


57 


shell-covered embryos 


Parabaikalia 


Maloe more 


July 1995 


large shells 


= 50 


shell-covered embryos 


florii florii 


strait (Middle 
Baikal) 




(own and 
Benedictia) 






p. elata el ata 


Southern Baikal 


July 1995 


the same 


= 10 


early development 


P. oviform is 


Southern Baikal 


July 1995 


the same 


6 


early development 






August 1995 


the same 


1 


embryo with a distinct 
foot, head and vis- 
ceral mass 


Baicalia carinata 


Northern Baikal 


October 1995 


own shells 


25 


early development 


8. dybowskiana 


Northern Baikal 


October 1995 


stones 


17 


shell-covered embryos 


God lews kia pul- 




October 1995 


own shell 


1 


early development 


chella 












Teratobaikalia 


Northern Baikal 


October 1997 


stones 


3 


shell-covered embryos 


macrostoma 












T. cil i ata 




October 1995 


stones 


10 


embryos were already 



developed and 
hatched a few days 
later 



REPRODUCTION AND EMBRYOGENY IN BAICALIID RISSOOIDEANS 



65 



temperature is 1460.55 for 10 m depth, and 
1342.65 degree-days for 20 m depth.) 

Liobaicalia stiedae: embryonic develop- 
ment in culture for capsules laid in September 
equalled 1080 degree-days, and the young 
hatched in March. Summed temperature in 
the lake at 20 m depth from September to 
March inclusive was calculated to be 718 de- 
gree-days. Thus, under natural conditions the 
young should be expected to hatch as late as 
July. 

Parabaikalia florii florii: embryonic develop- 
ment in culture lasted from November to 
June, and equalled 1440 degree-days. The 
temperature sum in the lake at 5 m depth from 
November to June was calculated to be 480.3 
degree-days. Consequently in nature, embry- 
onic development in capsules laid in early No- 
vember may last 11 mo, and the young will 
hatch in mid-October or later. For the same 
egg-laying time, embryogenesis has been 
calculated to last 11 mo at 10 m depth, and 
nearly 12 mo at 20 m depth. While embryonic 
development in clutches laid at 5 m depth in 
early June may progress faster than in cap- 
sules laid in November, that is, 8-9 mo (the 
young hatching in March-April), it is effec- 
tively the same for 10 m and 20 m depths: 
11.5-12.5 mo (the young hatching in May- 
June). 

These calculated values of embryonic de- 
velopment may not coincide with what really 
occurs in nature, because (a) near-bottom 
water temperatures at depths below 20 m (35 
m or 50 m in some areas) depend strongly on 
bottom relief and, despite being affected by 
seasonal changes, these temperatures are al- 
ways colder than at the surface (Rossolimo, 
1957); and (b) water temperature variations 
may be important for embryonic development 
in nature, and so the constant water tempera- 
ture in our experiment may have had a nega- 
tive effect on the overall duration of embryo- 
genesis. 

Egg Capsule Morphology 

Morphologically, egg capsules of the 15 
baicaliid species examined can be subdivided 
into four groups. 

(1) Single lens-shaped capsules with con- 
vex upper surface: On a smooth substratum, 
the lower surface is flat, but when laid in the 
umbilicus of another mollusc {Megalovalvata, 
Valvatidae; Choanomphalus, Planorbidae) or 
in a cavity in a stone, the lower part of the cap- 
sule is convex. The margin and the basis is 



mat and whitish, while the top is transparent. 
This type of capsule is laid by Liobaicalia 
stiedae (Fig. 4B), Maacl<ia herderiana, M. 
variesculpta, M. bythiniopsis (Fig. 5A), M. 
costata, Teratobaikalia ciliata (Fig. 5B), and 
Pseudobail<alia zacliwatl<ini (Fig. 4C). Cap- 
sules of /W. bythiniopsis are dark-brown, not 
transparent and have a pleated surface; cap- 
sules of the other species are smooth and 
lighter-coloured (light-yellow or light-brown). 
Thus, the capsules of different species differ 
in their overall sizes and the sizes of their mar- 
gins. 

(2) Cap-like capsules with no or small mar- 
gins, often in clusters: Their upper surface is 
hemispherical, the lower concave or almost 
flat (depending on the substratum the cap- 
sules are laid on). These capsules are 
smooth, and the top is more or less transpar- 
ent. The capsule color varies from light-yellow 
to light-brown. The basal part including the 
margin is mat and whitish. This type of cap- 
sule is laid by Parabaikalia oviformis (Fig. 
4D), P. florii, P. elata elata. Baicalia carinata 
and Godlewskia pulchella. 

(3) Cup-shaped capsules, single or in clus- 
ters: These are relatively high, with an im- 
pressed top, the inner surface being dark or 
light. This type of capsule is attached to rocks 
and stones and laid by Baicalia dybowskiana 
(Fig. 5C) and B. turriformis (Fig. 4A). 

(4) Single "oval bag", not attached to the 
substratum. This type of capsule is produced 
by Teratobaikalia macrostoma, is smooth, 
greyish green, almost transparent, and is laid 
on stones between strands of small algae 
(Fig. 5D). 

The sizes of the egg capsule of some 
baicaliid species are given in Table 5. 

Protoconch 

Protoconchs have been examined in 26 
species, but this paper discusses only the 18 
for which adequate numbers could be mea- 
sured. There are two groups of protoconchs. 
The first includes species with distinctly sculp- 
tured shells having 10-25 spiral lirae, for ex- 
ample: Teratobaikalia ciliata (Fig. 9H-K), T 
duthiersii {F\g. 9A-E), T macrostoma {F\g. 9F, 
G), T nana group (Fig. 10A-H), Maackia 
herderiana (Fig. 7B-D), M. variesculpta (Fig. 
7E-J), M. costata(F\g. 8A-C), Pseudobaikalia 
contabulata, Ps. zachwatkini (Fig. 6G-J), Li- 
obaicalia stiedae (Fig. 6A-F), and species of 
Korotnewia. Protoconchs of the second group 
have a malleate microsculpture and only spi- 



66 



SITNIKOVA, RÖPSTORF & RIEDEL 




FIG. 4. Egg capsules of baicaliid species. A, Baikalia turriformis-bo\h in frontal view. В, Liobaicalia stiedae- 
frontal and apical view. С, Pseudobaikalia zachwatkini~Uon\a\ and apical view. D, Parabaikalia oviformis- 
cluster in apical view. (Scale bars equal 1 mm). 



REPRODUCTION AND EMBRYOGENY IN BAICALIID RISSOOIDEANS 67 







D. 



FIG. 5. Egg capsules of baicaliid species, frontal and apical views. A, Maackia bythiniopsis. B, Teratobaikalia 
ciliata. C, Baicalia dybowskiana. D, Teratobaikalia macrostoma. (Scale bars equal 1 mm). 



68 



SITNIKOVA, ROPSTORF & RIEDEL 



TABLE 5. Egg capsule sizes (mm) of some baicaliids. Mean r standard deviation (range). 



Species (number of specimens) 
Liobaicalia stiedae (n = 10) 

Pseudobaikalia zachwatkini (n = 18) 

Maackia vahesculpta (n = 20) 

M. herderiana (n = 4) 

M. bythiniopsis (n = 14 for diameter, 

n = 5 for height) 
Teratobaikalia macrostoma (n = 3) 

T. ciliata (n = 6) 

Parabaikalia florii florii (n = 4) 

P. florii kobeltiana (n = 4) 

P. oviformis (n = 11) 

P elata elata (n = 8) 

Baicalia dybowskiana (n = 20) 

B. turn form is (n = 3) 

B. carinata (n = 13) 

Godlewskia pulctiella (n = 6) 



С 


)iameter 


He 


ight 


maximal 


minimal 




1.21 ± 0.10 


1.9 ± 0.05 


0.52 • 


0.07 


(1.04-1.25) 


(1.0-1.15) 


(0.42- 


-0.60) 


1.27 ± 0.09 


1.17 ±0.12 


0.63 • 


0.08 


(1.11-1.40) 


(1.10-1.35) 


(0.50- 


-0.85) 


1.38 ±0.08 


1.27 ±0.07 


0.60 


•0.07 


(1.30-1.50) 


(1.10-1.35) 


(0.50- 


-0.80) 


1 .40 ± 0.04 


1 .00 • 0.09 


0.34 • 


0.06 


(1.35-1.70) 


(0.80-1.20) 


(0.30- 


-0.50) 


1.75 ± 0.16 


1.61 ± 0.10 


1.09 ! 


0.162 


(1.50-2.00) 


(1.42-1.80) 


(0.8- 


-1.19) 


1.52 ± 0.06 


1.37 ± 0.03 


0.95 - 


0.03 


(1.55-1.7) 


(1.3-1.4) 


(0.95- 


-1.0) 


1.62 ± 0.12 


1.54 ± 0.04 


0.83 • 


0.12 


(1.65-1.68) 


(1.48-1.58) 


(0.73- 


-1.00) 


1.52 ± 0.04 


1.32 ± 0.03 


1.27 J 


0.04 


(1.48-1.55) 


(1.30-1.37) 


(1.22- 


-1.30) 


1.83 ±0.05 


1.60 ± 0.00 


1.04 ' 


0.08 


(1.8-1.9) 


(1.60-1.60) 


(0.95- 


-1.10) 


1.41 * 0.06 


1 .23 • 0.08 


0.94 • 


0.08 


(1.33-1.48) 


(1.11-1.37) 


(0.85- 


-1.11) 


1.36 ± 0.09 


1.24 ±0.09 


0.92 


0.11 


(1.23-1.48) 


(1.11-1.41) 


(0.74- 


-1.10) 


2.07 ± 0.12 


1.42 ± 0.22 


1.20 • 


0.18 


(1.80-2.25) 


(1.00-1.75) 


(0.90- 


-1.60) 


1.87 ±0.15 


1.50 ±0.26 


1.50 * 


0.10 


(1.7-2.0) 


(1.3-1.8) 


(1.40- 


-1.60) 


1 .66 ± 0.08 


1.52 ± 0.14 


0.94 ' 


0.09 


(1.54-1.79) 


(1.15-1.70) 


(0.77- 


-1,00) 


1 .44 ± 0.09 


1.23 ± 0.04 


0.80 • 


0.08 


(1.35-1.60) 


(1.20-1.30) 


(0.75- 


-0.90) 



ral striae but no lirae for example, M. bytliin- 
iopsis (Fig. 8D-F), Godlewskia pulchella, G. 
columella, B. dybowskiana (Fig. 12A-D), 
Baicalia carinata (Fig. 12E-G), B. turriformis 
(Fig. 12H-J), Parabaikalia oviformis (F\g. IIA, 
C-F), P. elata elata. and P florii (F\g. 11G-I), 
excluding Parabaikalia florii kobeltiana). SEM 
investigation revealed that species with lirae 
on the protoconch also may have lirae on the 
teleoconch (Fig. 7H: /W. vahesculpta. Fig. 9A: 
T. duthiersii. Fig: 9H: T. ciliata. Fig. 10E: T. 
nana group), but they may become faint on the 
last whorls. In L. stiedae \.he lirae continue as 
rows of periostracal "hairs" (Fig. IIA). 

A divergence in the angle between proto- 
conch and teleoconch axes is particularty no- 
ticeable in Liobaicalia stiedae. where it is 
sometimes as great as Ш' (Fig. 6A-C). Other 
species examined exhibit only little deviations 
between the axes, never exceeding 5-10' 



(Fig. 7H). In some species, it is almost impos- 
sible to detect an diverging angle. 

Variation of protoconch size and number 
of whorls has enabled statistical analysis to 
be performed for some species (Table 6). 
Maackia bythiniopsis has the biggest proto- 
conch diameter (1.305 mm) (figures in paren- 
theses are mean values) and the Terato- 
baikalia nana group the smallest (0.625 mm), 
having also the smallest number of whorls. 
The shells of the different species of the T. 
nana group described by Beckman & 
Starobogatov (1975) according to one of us 
(P.R.), may represent only intraspecific varia- 
tions of T. nana \.e., forma clandestina (Fig. 
10A), forma nana (Fig. 10B), forma producta 
(Fig. IOC), and forma humerosa (Fig. 10D). 
The protoconchs of both extremes, forma 
clandestina (Fig. 1 0E, F) and forma humerosa 
(Fig. 10G, H), do not differ neither in dimen- 



REPRODUCTION AND EMBRYOGENY IN BAICALIID RISSOOIDEANS 



69 




FIG. 6. A-F. Liobaicalia stiedae Uom Kultuk. A, Teleoconch with uncoiled whorls and rows of filaments. B, 
Nearly planispiral protoconch seen from above. Note the distinct angle to the teleoconch axis. C, Protoconch 
seen from beneath. D, Hatchling in frontal view. E, Hatchling in apical view. F, Close-up of the nonspiral of 
the protoconch. G-J, Pseudobaikalia zachwatkiniUom Kultuk. G, Teleoconch. H, Hatchling in apertural view. 
I, Hatchling in apical view. (Scale bars: A, G = 2 mm, B-E, H, I = 200 |.im, F, J = 50 цт). 



70 



SITNIKOVA, RÖPSTORF & RIEDEL 




FIG. 7. Maackia. A-D. M. herdenana. A, 2-month-old embryo. В, Teleoconch of specimen with well ex- 
pressed ribs. С Hatchling in apertural view. D, Hatchling in apical view. E-J, M. variesculpta. E, Typical teleo- 
conch. F. Hatchling in apertural view. G, Hatchling in apical view. H, Apex - protoconch tilted to teleoconch 
axis; spiral lirae of the protoconch continue onto the teleoconch whorls. I, Nonspiral in apical view. J, Magni- 
fication of spiral lirae. (Scale bars; A, I = 100 цт, В = 1 mm, E = 0.5 mm, C, D, F G = 200 pm, J = 10 цт). 



REPRODUCTION AND EMBRYOGENY IN BAICALIID RISSOOIDEANS 



71 




FIG. 8. Maackia. A-C, Maackia costata. A, Teleoconch. B, Hatchling in apertural view. C, Hatchling in apical 
view. D-F, Maackia bythiniopsis. D, Teleoconch. E, Hatchling in apertural view. F, Hatchling in apical view. 
(Scale bars: A, D = 5 mm, B, С = 200 jam, E, F = 500 цт). 



sions nor in sculpture. The highest proto- 
conch (0: 1.226 nnm) with the largest number 
of whorls (2.6) was found in Baicalla dy- 
bowskiana (Fig. 128, C) and the broadest 
non-spiral part (0: 0.223 mm) in Parabaikalia 
flora flora. Liobaicalia stiedae has been found 
to possess the lowest protoconch (0: 0.397 
mm, Fig. 6D). 

Cluster analysis (K-means clustering) has 
distinguished three groups based on their pro- 
toconch morphology (Fig. 13). The first group 
(or cluster) includes Parabaikalia oviformis, P. 
flora, P. elata elata, Teratobaikalia macros- 
toma, Maackia bythiniopsis, two specimens 
out of six Korotnewia semenkewitsctii (see 
below). The second group includes Baicalia 
carinata, B. dybowskiana, Godlewskia pul- 
chiella, and Teratobaikalia ciliata. The third 
group includes Liobaicalia stiedae, Pseudo- 
baikalia zachwatkini, Ps. pulla, Parabaikalia 



elata dubiosa, Teratobaikalia dutfiiersii, the T. 
nana group, Maackia herderiana, M. varies- 
culpta, Korotnewia korotnevi), and four speci- 
mens (out of six) of K. semenkewitschi (see 
below). 

Separation into more clusters (4-5) pro- 
duced a dubious result: specimens of the 
same species were included in different clus- 
ters. An effort to divide protoconchs into two 
clusters resulted in one cluster embracing the 
whole of the above first and second groups, 
while the second cluster just overlapped 
group three. The "joining tree clustering" den- 
drogram (complete linkage) shows the first 
two groups close to each other (Fig. 14). The 
similarity of these groups is manifest when 
comparing mean values of characters of each 
species from clusters one and two. 

For convenience, we will further refer to the 
three clusters obtained by the name of their 



72 



SITNIKOVA, RÖPSTORF & RIEDEL 




FIG. 9. Teratobaikalia (Trichiobaikalia). A-E, T. duthiersii. A, Teleoconch -where the spiral lirae cross the 
axial ribs, they differentiate to pehostracal hairs. B, Apex in lateral view-protoconch and teleoconch axes 
diverge. C, Protoconch in apical view. D, Close-up of spiral lirae. E, Nonspiral appears submerged. F-G, T. 
macrostoma. F, Conch of a juvenile with aperture charactenzed by a margin of collar-like plates; umbilicus 
widely open: transition from protoconch to teleoconch marked by an arrow. G, Nonspiral in lateral view. H-K, 
T. ciliata. H, Teleoconch of a specimen with well developed ribs and penostracal hairs. I, Hatchling in aper- 
tural view J, Hatchling in apical view. K. Nonspiral, (Scale bars: A = 500 pm, B, C, I, J = 200 urn, F H = 1 mm 
D = 10|jm, E.G = ЮОмт). 



REPRODUCTION AND EMBRYOGENY IN BAICALIID RISSOOIDEANS 



73 




FIG. 10. Teratobaikalia nana group. A, Teleoconch of T. nana f. clandestina. В, Teleoconch of T. nana f. pro- 
ducta. С, Teleoconch of T. nana f, nana. D, Teleoconch of T. nana f. humerosa. E, F, Protoconch and non- 
spiral of T. nana f. clandestina. G, H, Protoconch and nonspiral of T. nana f. humerosa. (Scale bars: A, D = 
1 mm, B, С = 0.5 mm, E, G = 200 цт, F, H = 100 цт). 



first species: the first cluster as the Para- 
baikalia oviformis group, the second as the 
Baicalia carinata group, and the third as the 
Liobaicalla stiedae group. 

All three groups reliably differ by the nunn- 
ber of whorls (no overlapping mean values). 



while the sizes of their non-spiral parts are al- 
most identical (Table 7). The protoconch type 
of the Baicalia carinata group species (cluster 
2) exhibits the highest number of whorls. Its 
diameter is close to the Liobaicalla stiedae 
group (cluster 3), but its height Is very close to 



74 



SITNIKOVA, RÖPSTORF & RIEDEL 




FIG. 11. Parabaikalia. A-F, Parabaikalia oviformis. A, Teleoconch. B, Initial shell formation in a 2-month-old 
embryo; the posterior visceral mass is covered by a purely organic shell exhibiting a pit-like structure re- 
flecting the activity of the shell gland. C, Embryonic shell with faint spiral striae and malleate microsculpture. 
D. Same specimen as in С in apical view. E, Apex of a juvenile which exhibits the transition between embry- 
onic and postembryonic shell by dense growth increments. F, Nonspiral of the same specimen as in С and 
D. G, H, Parabaikalia florii. G, Teleoconch. H, Hatchling with faint spiral striae and malleate microsculpture 
on its shell. I, Hatchling in apical view. (Scale bars: A, G = 5 mm, B, F = 100 цт, С, D = 200 цт, E, H, I = 
500 [im). 



REPRODUCTION AND EMBRYOGENY IN BAICALIID RISSOOIDEANS 



75 




FIG. 12. Baicalia. A-D, Baicalia dybowskiana. A, Teleoconch. B, Hatchling in apertural view. C, Hatchling in 
apical view demonstrating that the first axial ribs are already formed inside the egg capsule. D, Close-up of 
nonspiral and first whorl showing the shell ornamentation of faint striae and malleate deepenings. E-G, 
Baicalia carinata. E, Teleoconch. F, Hatchling in apertural view. G, Hatchling in apical view. H-J, Baicalia tur- 
riformis. H, Teleoconch. I, Hatchling in apertural view. J, Hatchling in apical view. (Scale bars: A, E, H, = 5 
mm, others = 100 цт). 



TABLE 6. Protoconch size of some baicaliids (diameter, height, width of nonspiral in mm, N-whorls: num- 
ber), mean r б (range), (number specimens). 



Species 


N-whorls 


Diameter 


Height 


Width of nonspiral 


Liobaicalia stiedae 


1.79 - 0.06 


0.904 - 0.114 


0.397 T 0.032 


0.104 - 0.040 




(1.75-1.85) 


(0.78-0.89) 


(0.37-0.42) 


(0.6-0.165) 




(n = 7) 


(n = 7) 


(n = 4) 


(n = 6) 


Teratobaikalia nana f. 


1.50 r 0.055 


0.625 ■ 0.018 


0.423 t 0.028 


0.132 _• 0.032 


clandestina 












(1.45-1.6) 


(0.6-0.64) 


(0.38-0.45) 


(0.088-0.17) 




(n = 5) 


(n = 5) 


(n = 5) 


(n = 5) 


T. nana f. numerosa 


1.45-1.5 


0.59-0.64 


0.4-0.43 


0.130-0.138 




(n-2) 


(n = 2) 


(n = 2) 


(n = 2) 


Maackia herderiana 


1.51 ± 0.07 


0.757 • 0.023 


0.574 1 0.012 


0.180 -' 0.037 




(1.4-1.65) 


(0.73-0.81) 


(0.56-0.59) 


(0.9-0.21) 




(n = 10) 


(n = 10) 


(n = 10) 


(n = 10) 


M. vahesculpta 


1.60 = 0.077 


0.73 r 0.021 


0.537 ± 0.038 


0.147 1 0.020 




(1.45-1.75) 


(0.67-0.75) 


(0.45-0.6) 


(0.115-0.19) 




(n = 14) 


(n = 14) 


(n = 14) 


(n = 14) 


M. bythiniopsis 


1.87 - 0.063 


1.305 • 0.061 


1.004 ± 0.069 


0.175 Í 0.043 




(1.8-2.0) 


(1.27-1.42) 


(0.93-1.14) 


(0.12-0.23) 




(n = 10) 


(n = 10) 


(n = 9) 


(n = 10) 


Pseudobaikalia pulls pulla 


1.56 = 0.225 


0.678 r 0.017 


0.56 1 0.028 


0.158 - 0.033 




(1.55-1.6) 


(0.66-0.70) 


(0.54-0.58) 


(0.110-0.180) 




(n = 4) 


(n = 4) 


(n = 2) 


(n = 4) 


Ps. zachwatkini 


1.75 - 0.00 


0.848 • 0.029 


0.725 1 0.021 


0.182 ± 0.017 






(0.80-0.88) 


(0.71-0.73) 


(0.165-0.200) 




(n = 3) 


(n = 4) 


(n = 2) 


(n = 3) 


Ps. contabulata 


1.58 r 0.063 


0.685 + 0.042 


0.555 ± 0.026 


0.163 * 0.031 




(1.55-1.75) 


(0,61-0.75) 


(0.51-0.59) 


(0.104-0,206) 




(n = 10) 


(n = 10) 


(n = 10) 


(n = 10) 


Teratobaikalia duthiersli 


1.60 - 0.087 


0.677 ^ 0.011 


0.553 ± 0.081 


0.127 * 0.032 




(1.55-1.70) 


(0.67-0.69) 


(0.49-0.61) 


(0.096-0.160) 




(n = 3) 


(n = 3) 


(n = 3) 


(n = 3) 


T. ci Ha ta 


2.21 ± 0.055 


0.779 1 0.036 


0.913 1 0.031 


0.136 - 0.023 




(2.15-2.25) 


(0.73-0.80) 


(0.87-0.94) 


(0.100-0.160) 




(n = 5) 


(n = 5) 


(n = 4) 


(n = 5) 


T. macrostoma 


2.08 ± 0.084 


1.172 - 0.127 


1.226 ±0.085 


0.211 - 0.022 




(2.0-2.2) 


(1.04-1.34) 


(1.1-1.31) 


(0.180-0.230) 




(n = 5) 


(n-5) 


(n-5) 


(n = 5) 


Korotnewia semenkewltschi 


1 .68 ± 0.052 


0.850 * 0.061 


0.728 ± 0.098 


0.196 * 0.027 




(1.65-1.80) 


(0.77-0.97) 


(0.63-0.88) 


(0.176-0.245) 




(n = 6) 


(n = 6) 


(n = 5) 


(n = 6) 


K. korotnevi 


1.65 ± 0.086 


0.87 1 0.072 


0.72 • 0.000 


0.14 - 0.028 




(1.6-1.75) 


(0.83-0.91) 




(0.120-0.160) 




(n = 3) 


(n = 6) 


(n = 3) 


(n = 2) 


Parabaikalia elata elata 


1.78 - 0.078 


0.961 - 0.0567 


1.018 ± 0.0537 


0.205 t 0.019 




(1.65-1.95) 


(0.86-1.05) 


(0.93-1.05) 


(0.180-0.240) 




(n = 10) 


(n = 10) 


(n = 10) 


(n = 10) 


P. elata dubiosa 


1.65 1 0.014 


0.82 - 0.473 


0.67 ± 0.021 


0.205 ' 0.009 




(1.55-1.75) 


(0.80-0.87) 


(0.65-0.68) 


(0.195-0.213) 




(n = 3) 


(n = 3) 


(n = 2) 


(n = 3) 


P. oviformis 


1.77 ± 0.094 


1.055 ' 0.054 


1.020 • 0.073 


0.206 - 0.023 




(1.6-1.92) 


(0.98-1.13) 


(0.87-1.14) 


(0.153-0.239) 




(n = 15) 


(n = 15) 


(n = 15) 


(n = 15) 


P. florii florii 


1.98 r 0.057 


1.137 t 0.056 


1.174 Í 0.071 


0.223 - 0.029 




(1.85-2.25) 


(1.08-1.16) 


(1.11-1.36) 


(0.185-0.270) 




(n = 7) 


(n = 7) 


(n = 7) 


(n = 7) 


Baicalia dybowskiana 


2.64 ± 0.114 


0.894 ± 0.053 


1.226 t 0.029 


0.186 ^ 0.029 




(2.55-2.75) 


(0.84-0.95) 


(1.21-1.27) 


(0.150-0.230) 




(n = 5) 


(n = 5) 


(n = 5) 


(n = 5) 


B. cari nata 


2.40 ± 0.092 


0.837 1 0.056 


1.115 ± 0.082 


0.193 ^ 0.035 




(2.25-2.60) 


(0.75-0.99) 


(1.06-1.34) 


(0.107-0.246) 




(n = 23) 


(n = 23) 


(n = 23) 


(n = 23) 


В. carinato-costata 


2.03 * 0.035 


0.76 Í 0.028 


0.855 ' 0.007 


0.185 ' 0.021 




(2.00-2.05) 


(0.74-0.78) 


(0.85-0.86) 


(0.170-0.200) 




(n = 2) 


(n = 2) 


(n = 2) 


(n = 2) 


Godlewskia pulchella 


2.38 ± 0.161 


0.638 - 0.042 


0.834 • 0.085 


0.150 ' 0.026 




(2.2-2.55) 


(0.61-0.71) 


(0.75-0.96) 


(0.123-0.180) 




(n = 5) 


(n = 5) 


(n = 5) 


(n = 5) 



REPRODUCTION AND EMBRYOGENY IN BAICALIID RISSOOIDEANS 



77 



a; 

XI 

E 

3 

с 



о 




-♦ — Cluster 1 
-D— dus ter 2 
-ж -Clusters 



n-whorls diameter height 

Characters 

FIG. 13. Plot of means for each cluster (protoconch size in mm) 



non.spir.part 



the Parabaikalia oviformis group (cluster 1). 
The L. stiedae and P. oviformis groups differ in 
the mean values of all characters. 



DISCUSSION 



Reproduction 



Prior to this study, data on baicaliid repro- 
duction could be found in one article only 
(Gavhlov, 1953). Based on egg capsules at- 
tached to stones lifted monthly from a depth of 
3 m near Listvenichnoe (18 km south of Bol- 
shie Koty). Gavrilov concluded that /Waac/c/a 
lierderiana reproduced all the year round and 
had no seasonality, but Table 8 shows two re- 
production peaks for this species: Septem- 
ber-October and March-May. 

Our data confirm that in Baicaliidae in gen- 
eral the reproduction continues and egg cap- 
sules were produced throughout the year, 
even in January. It is suggested that M. lierde- 
riana does have two reproduction peaks: (1) 
spring-first half of summer, and (2) second 
half of summer-early autumn. (/Waac/c/a vari- 
esculpta may also have two peaks in repro- 
duction.) 

Capsules found in summer and autumn 
with embryos at different development 



stages, and calculated duration of embryoge- 
nesis do not refute our hypothesis of two re- 
production maxima in littoral species. How- 
ever, it is not known how long the egg-laying 
period lasts in one female and how fecund it 
is, nor do we know if individual females lay 
eggs twice or only once a year. In the latter 
case, two generations -the spring-summer 
and the autumn — may be hypothesised to 
exist within these populations, with different 
egg-laying times. Besides, the reproductive 
period in one individual may be long enough 
for egg capsules at the end of one period to 
coincide in time with the capsules laid at the 
beginning of the other period. 

Our investigations show that the period 
when the young hatch in great numbers is re- 
stricted to two different seasons: spring-early 
summer and autumn. How can this be ex- 
plained? Earlier experiments by Sitnikova 
(unpubl. data) demonstrated that adult bia- 
caliids placed in aquaria with Lake Baikal 
water and substrata (stones with vegetation, 
sand with detritus) in September-October re- 
mained active at temperatures of 4-6°C with 
no food added until April; then all molluscs 
died, including the young that had been mov- 
ing along aquarium walls 10-15 days after 
hatching. Besides, the shells of littoral mol- 
luscs from the lake start to grow in spring. 



78 



SITNIKOVA, RÖPSTORF & RIEDEL 

Euclidean distance 



О 



0.2 0.4 0.6 0.8 



1 



1.2 1.4 1.6 




О 



0.2 0.4 0.6 0.8 



1 



1.2 1.4 1.6 



Linkage distance 



FIG. 14. Dendrogram of 144 specimens using protoconch size 



TABLE 7. Protoconch in the tree groups in the cluster analysis (size in mm), mean * standard deviation 
(range). 



Protoconch characters 



Cluster 1 (n = 49) 



Cluster 2 (n = 37) 



Cluster 3 (n = 58) 



N-whorls 

Diameter 

Height 

Width of nonspiral 



1.89 - 0.15 
(1.6-2.25) 
1.12 ± 0.14 
(0.86-1.42) 
1.08 - 0.12 
(0.87-1.36) 
0.2 ± 0.04 
(0.12-0.27) 



2.41 ± 0.14 
(2.15-2.75) 
0.81 r 0.09 
(0.61-0.99) 
1.07 ± 0.14 
(0.75-1.34) 
0.18 ± 0.04 
(0.1-1.11) 



1.59 ±0.11 
(1.4-1.85) 
0.73 ± 0.08 
(0.59-0.91) 
0.55 ± 0.09 
(0.37-0.74) 
0.16 ± 0.08 
(0.09-0.96) 



reaching 0.5-2.0 mm in diameter in May-July. 
These observations suggest that the gas- 
tropods may need additional food in spring, 
and this food becomes available in the spring- 
summer period. 
According to Gavrilov (1 953), M. herderiana 



is a bacterio-feeder, and he reported plank- 
tonic forms to be dominant among diatoms 
found in the stomachs of M. herderiana. Ex- 
amination of baicaliid distribution on stones 
and rocks in the Zhilische canyon (Bolshie 
Koty Bay; Fig. 1) in relation to rock slope has 



REPRODUCTION AND EMBRYOGENY IN BAICALIID RISSOOIDEANS 



79 



TABLE 8. Number of Maackia herderiana egg cap- 
sules laid in different periods (after Gavrilov, 1953). 



Date stones 


Date stones 


Number of 


placed on the 


raised up from 


egg capsules 


bottom 


the bottom 


on stones 


1 July 1947 


2 August 1947 


1 


5 August, 1947 


31 August 1947 


7 


3 September 


1 October 1947 


59 


1947 






6 October 1947 


3 November 
1947 


1 


13 November 


6 December 


3 


1947 


1947 




17 December 


7 January 1948 


9 


1947 






15 January 1948 


5 February 1948 


12 


12 February 


23-24 March 


18 


1948 


1948 




21-25 March 


21 -24 May 


38 


1948 






3 June 1948 


2-3 July 


15 



dance: the smaller occurs during the under- 
ice period (February), the larger takes place in 
summer (July) (Pomazkina, 2000). Increased 
content of both, detritus in bottom sediments 
and microphytobenthos, may act as a stimu- 
lus for the hatching of species feeding on de- 
tritus and microphytobenthos. These species 
include, for example, Parabaikalia elata, P. 
oviformis and P. florli, which collect their food 
directly from the lake bottom. 

Gastropods living in "soft" waters with low 
calcium content (up to 15mg/l in Lake Baikal, 
according to Votintsev, 1961), are known to 
consume calcium from water plants in order to 
build their shells (Young, 1975). This fact may 
indicate that Lake Baikal molluscs satisfy their 
calcium requirements by consuming phyto- 
plankton and phytobenthos. The available ev- 
idence suggests that hatching of the young 
may be timed specifically to coincide with in- 
creased vegetable resources. 



revealed a positive correlation between the 
abundance and biomass of this species and 
slope. This observation suggested M. herderi- 
ana may be a suspension-feeder (Kamaltynov 
et al., 1 998), that is, it could assimilate not only 
bacteria but all the nutrients in the near-bottom 
water layer (i.e., detritus and phytoplanktonic 
sediments). We did not specifically study 
baicaliid feeding, but random dissection of 
stomachs revealed planktonic and benthic di- 
atoms, detritus, sponge spicules, and white 
amorphous substance resembling yeast. 
Sometimes one component prevailed. 

Long-term observations (Kozhov, 1963; An- 
tipova, 1974) revealed two periods in phyto- 
plankton development in Lake Baikal, when 
its abundance and hence, biomass, in- 
creased: spring (April-May, maximum), and 
autumn (September-October, sometimes 
later). These periods may shift slightly from 
year to year, but their seasonality is constant. 
Bacterioplankton has also been found to ex- 
hibit two maxima in their development 
(Kozhov, 1963). 

Planktonic diatoms and bacteria sinking to 
the bottom of Lake Baikal may provide the 
necessary food for suspension-feeding mol- 
luscs. Plant detritus and microphytobenthos 
in the diet of molluscs that collect benthic food 
should not be ignored either. According to Vot- 
intsev (1961), the influx of organic matter into 
the Lake Baikal increases considerably during 
the spring and summer floods. Microphyto- 
benthos has been found to exhibit two peaks 
in the development of its biomass and abun- 



Egg Capsules and Protoconch 

Correlation analysis of all species exam- 
ined showed (Table 9) that the minimal diam- 
eter of egg capsules (margins excluded) cor- 
relates with the protoconch diameter (r = 0.73) 
and the capsule height generally correlates 
with the protoconch height (r = 0.82). The 
larger the protoconch, the greater volume it 
occupies in the capsule. But in several 
species - Pseudobaikalia zachwatkini, Tera- 
tobaikalia ciliata, Godlewskia pulchella, 
Parabaikalia oviformis, P. elata elata - the 
protoconch is higher than the egg capsule. 
Observation of the young of these species re- 
vealed that the molluscs either lie or lean in- 
side their capsules and thus make maximum 
use of the capsule's volume. 

How the protoconch size influences teleo- 
conch size is uncertain. The answer requires 
investigation of the teleoconch of each spe- 
cies, and sampling must be statistically reli- 
able. Based on shell size data reported by 
Kozhov (1936), we may ascertain the follow- 
ing: 

(1) In the species investigated, the teleo- 
conch is, on average, 13 times higher 
(minimum in Teratobaikalia nana f. clan- 
destina and T. macrostoma, maximum in 
Liobaicalia stiedae), six times wider (mini- 
mum in Godlewskia pulchella, maximum 
in Parabaikalia florli florii) and has three 
times more whorls (minimum in Terato- 
baikalia ciliata, maximum in Maackia 
herderiana) (Table 10) than the proto- 
conch. This means that height and width 



80 



SITNIKOVA, ROPSTORF & RIEDEL 



TABLE 9. Correlation of protoconch and egg capsule size. Marked correlations are significant at p < 0.05, 
mean • standard deviation (range), in mm. 



Characters 


m r 6 
(range) 
(n = 75) 


r(X,Y) 


t-value 


Characters 


m r Ö 
(range) 
(n = 95) 


r (X, Y) 


t-value 


egg capsule height 
protoconch height 


0.88 r 0.24 
(0.30-1.60) 
0.90 • 0.25 

(0.37-1.136) 


0.82 


12.08 


egg capsule 
diameter 
protoconch 
diameter 


1.17 ^ 0.23 
(1.04-2.25) 
0.91 * 0.20 
(0.59-1.42) 


0.73 


10.2 



TABLE 10. Comparison of teleoconch and proto- 
conch average size (H, h: height. W, w: width, N, n: 
number of whorls, capital letters refer to the teleo- 
conch, lower case to the protoconch); size of teleo- 
conch after Kozhov (1936). 



Species 


H/h 


W/w 


N/n 


Liobaicalia stiedae 


25.3 


5.1 


2.7 


Pseudobaikalia zachwatkini 


10.4 


4.5 


3.2 


Ps. contabulata 


10.8 


4.4 


3.5 


Ps. pulla tenulcosta 


9.9 


4.2 


3.7 


Maackia costata 


14.6 


7.65 


3.4 


M. herdehana 


15.1 


6.8 


3.8 


M. variesculpta 


12.5 


5.5 


3.5 


M. bythiniopsis 


10.1 


5.6 


2.8 


Teratobaikalia macrostoma 


7.8 


6.7 


2.2 


T. nana f. clandestina 


7.8 


3.2 


2.7 


T. duthiersii 


10.7 


5.8 


3.1 


T. dilata 


9.4 


5.6 


2.4 


Parabaikalia elata dubiosa 


9.8 


4.6 


2.7 


P. elata elata 


11.3 


6.2 


3.0 


P. oviform i s 


13.9 


7.9 


3.3 


P. flora florii 


19.7 


11.1 


3.1 


Korotnewla semenkewitschi 


11.9 


5.4 


3.6 


K. korotnevia 


24.8 


8.4 


4.7 


Baicalia cannata 


17.8 


7.9 


3.6 


B. dybowskiana 


8.7 


4.6 


2.6 


Godlewskia pu label la 


10.4 


4.4 


3.2 



do not increase uniformly with an increas- 
ing number of whorls. 

(2) Species assigned to one genus and simi- 
lar in teleoconch size, are also similar in 
protoconch size, and the growth of their 
teleoconchs differ very slightly, for exam- 
ple, in Maackia herderiana and M. varies- 
culpta, M. costata, Parabaikalia elata 
elata and P. oviformis. 

(3) Species with similar protoconch sizes may 
differ considerably in teleoconch height 
and width, for example, Parabaikalia florii 
florii and P. oviformis. The former is larger 
and its teleoconch is 20 times higher than 
the protoconch, compared to only 1 4 times 
in the latter species. 

(4) Parabaikalia elata elata and P. elata du- 
biosa differ in teleoconch and protoconch 



sizes (cluster analysis places them into 
different groups), and their definitive shell 
growth proceeds differently. 

We have distinguished four groups of 
baicaliid egg capsules; and three size-groups 
of protoconchs. Capsule and protoconch 
sizes correlate. Seven species - Liobaicalia 
stiedae, Maackia variesculpta. M. herderiana, 
M. bythiniopsis, M. costata, Pseudobaikalia 
zachwatkini, and Teratobaikalia c/7/afa-have 
lens-shaped capsules (Table 1 1 ). Five of them 
have been pooled together by embryonic 
shell size (cluster analysis) into cluster three 
{Liobaicalia stiedae group). Two species are 
exceptions; Teratobaikalia ciliata, assigned to 
cluster two {Baicalia carinata group) due to its 
protoconch size and large egg capsules, and 
M. bythiniopsis, also having large capsules, 
but these are dark-brown in color, with a 
pleated surface, and are assigned to cluster 
one {Parabaikalia oviformis group) based on 
protoconch size. The same cluster includes 
Teratobaikalia macrostoma based on proto- 
conch ratios, though this species lays oval, 
bag-shaped capsules. Species grouped to- 
gether by protoconch size into cluster one 
{Parabaikalia oviformis, P. elata elata, P. florii 
florii) have cap-shaped capsules. Finally, 
species pooled together by protoconch size 
into cluster two {Godlewskia pulchella, 
Baicalia dybowskiana, B. carinata and Terato- 
baikalia ciliata), have, with the exception of 
the last two, cup-shaped capsules. 

Taxonomic Remarks 

Size differences of egg capsules of two 
subspecies, Parabaikalia florii florii and P. 
florii kobeltiana, and of protoconchs of P. elata 
elata and P. elata dubiosa suggest the possi- 
ble existence of independent allopatrical 
species, but this must be tested by further 
analysis. Parabaikalia florii florii and P. elata 
elata inhibit southern and middle parts of Lake 



REPRODUCTION AND EMBRYOGENY IN BAICALIID RISSOOIDEANS 



81 



TABLE 11. Comparison of protoconch size and type of egg capsules of some baicaiiids. 



Species 


Protoconch-size cluster 


Type of egg capsulae 


Parabaikalia oviformis 


1 (middle size) 


cap-lil<e 


P. flora florii 


1 (middle size) 


the same 


P. elata elata 


1 (middle size) 


the same 


Baicalia carinata 


2 (large) 


the same 


Godlewskia pulchella 


2 (large) 


the same 


Baicalia turrlformis 


not determined 


cup-like 


B. dybowskiana 


2 (large) 


the same 


Teratobaikalia macrostoma 


1 (middle size) 


oval bag 


T. ciliata 


2 (large) 


lens-shaped, lighter colours, 
smooth 


T. dutfiiersii 


3 (small) 


unknown 


Maackia herderiana 


3 (small) 


lens-shaped, lighter colours, 
smooth 


M. variesculpta 


3 (small) 


the same 


M. cosíala 


not determined 


the same 


M. bythiniopsis 


1 (middle size) 


lens-shaped, dark-brown, 
pleated surface 


Pseudobaikalia zachwatkini 


3 (middle size) 


lens-shaped, lighter colours, 
smooth 


Liobalcalia stiedae 


3 (small) 


the same 



Baikal, whereas P. florii kobeltiana and P. 
elata dubiosa were found in northern Lake 
Baikal. 

We suggest that the reason the proto- 
conchs of Korotnewia semenkewitsclii from 
different regions of Lake Baikal fall into differ- 
ent clusters may be explained by this actually 
being two species. Judging from teleoconch 
variability it is possible but requires proving. 

Morphological similarity of protoconchs in 
the species examined of the genera Baicalia 
and Godlewskia - cluster analysis assigns 
them into the same cluster, height/width ratio 
(Table 12) does not differentiate between 
them reliably - allows to include them in one 
genus, but, perhaps, as independent subgen- 
era, in view of the differences in the structure 
of their female reproductive systems. The 
species of Baicalia have a wide renal oviduct 
loop located on the ventral and ventrolateral 
surface of the gonoduct, whereas species of 
Godlewskia have a narrow loop that runs 
downwards to the dorsal side (Sitnikova, 
1991b). 

Of the three species {Maackia bythiniopsis, 
M. herderiana and M. variesculpta) assigned 
by Lindholm (1909), Kozhov (1936) and Sit- 
nikova (1991b) to the subgenus Eubaicalia 
Lindholm, 1924, the first species has a larger 
protoconch lacking the lirae found in the other 
two species. Cluster analysis of variable char- 
acters places the protoconch of M. bythiniop- 



sis into the Parabaikalia oviformis group, and 
its size and sculpture are also similar to P. ov- 
iformis (and to the genus Parabaikalia, in 
general), apparently suggesting a relationship 
between these species. However, the teleo- 
conch of M. bythiniopsis, as in other species 
of the subgenus Eubaicalia, shows an aper- 
ture that is distinctly angulated anteriorly (e.g., 
Fig. 7), which represents an assumed apo- 
morphy of the subgenus. One of us (T. S.) at- 
tributes the presence of such an angle to an 
adaptation to laying egg-capsules in cavities 
of stones or rocks. The three species exam- 
ined of the subgenus Eurbaicalia dwell on 
hard substrata. (Maackia herderiana and M. 
variesculpta lay small capsules is small cavi- 
ties, whereas /W. bythiniopsis lays larger egg 
capsules in correspondingly larger cavities. 
The structure of the female reproductive sys- 
tem of M. bythiniopsis is similar to M. herderi- 
ana and M. variesculpta, the renal oviduct 
loop covers half of the surface of the albumen 
gland, whereas in the species of the genus 
Parabaikalia, this loop is smaller and covers a 
third of the surface of the albumen gland (Sit- 
nikova, 1991b). T-test pairwise comparison of 
the protoconch proportions of M. bythiniopsis, 
M. herderiana, M. variesculpta and Para- 
baikalia oviformis (Tables 11 , 12) show M. by- 
thiniopsis to differ (p < 0.05) from other 
species in whorl number/height and whorl 
number/width ratios, but height/width ratio 



82 



SITNIKOVA, RÖPSTORF & RIEDEL 



TABLE 12. Protoconch ratios (h - height, w 


- width, n - whorl 


number). 






h/w mean ^ Ô 


n/h mean * 6 


n/w mean t 8 


Species 


(range) 


(range) 


(range) 


Liobaicalia stiedae 


0.47 r 0.61 


4.62 Í 0.46 


2.18 - 0.13 




(0.41-0.53) 


(4.07-5.00) 


(2.08-2.37) 


Teratobaikalia nana f. clandestina 


0.69 r 0.04 


3.51 r 0.19 


2.41 = 0.10 




(0.63-0.73) 


(3.33-3.81) 


(2.34-2.58) 


T. nana f. humerosa 


0.68 = 0.07 


3.56 ± 0.27 


2.40 • 0.08 




(0.63-0.73) 


(3.37-3.75) 


(2.34-2.46) 


Maackia herderiana 


0.76 - 0.01 


2.62 r 0.04 


1.99 - 0.06 




(0.72-0.78) 


(2.50-2.79) 


(1.89-2.07) 


M. vahesculpta 


0.74 ± 0.06 


2.98 r 0.25 


2.20 = 0.12 




(0.61-0.85) 


(2.74-3.70) 


(2.00-2.40) 


M. bythiniopsis 


0.76 = 0.59 


1.87 ± 0.13 


1.42 ± 0.10 




(0.68-0.86) 


(1.71-2.11) 


(1.34-1.46) 


Pseudobaikalia pulla pulla 


0.84 - 0.036 


2.77 = 0.14 


2.33 i 0.03 




(0.80-0.88) 


(2.67-2.87) 


(2.31-2.35) 


Ps. zachwatkini 


0.83 r 0.01 


2.41 ± 0.07 


2.01 -: 0.03 




(0.83-0.84) 


(2.36-2.46) 


(1.99-2.03) 


Ps. contabulata 


0.81 - 0.04 


2.85 ± 0.18 


2.32 ± 0.18 




(0.73-0.85) 


(2.62-3.18) 


(2.09-2.54) 


Teratobaikalia duthiersii 


0.82 = 0.11 


2.93 = 0.42 


2.37 ± 0.15 




(0.69-0.88) 


(2.54-3.37) 


(2.25-2.54) 


T. ciliata 


1.18 ± 0.01 


2.44 ± 0.12 


2.89 = 0.18 




(1.16-1.25) 


(2.31-2.59) 


(2.69-3.09) 


T. macrostoma 


1.05 ± 0.08 


1.70 ± 0.18 


1.79 ±0.15 




(0.91-1.14) 


(1.60-1.82) 


(1.57-1.92) 


Korotnewia semenkewitschi 


0.87 i 0.06 


2.27 ± 0.30 


1.96 ±0.15 




(0.79-0.93) 


(2.0-2.62) 


(1.80-2.14) 


K. korotnevi 


0.82 = 0.04 


2.29 ± 0.12 


1.88 ±0.11 




(0.79-0.87) 


(2.2-2.4) 


(1.76-1.92) 


Parabaikalia elata elata 


1.06 ± 0.065 


1.76 ± 0.10 


1.86 ± 0.15 




(0.95-1.14) 


(1.62-1.93) 


(1.63-2.10) 


P. elata dubiosa 


0.84 ± 0.042 


2.37 ± 0.13 


1.99 ±0.01 




(0.81-0.87) 


(2.28-2.46) 


(1.99-2.00) 


P. oviform i s 


0.97 ± 0.05 


1.74 ± 0.11 


1.68 ± 0.11 




(0.84-1.03) 


(1.54-1.92) 


(1.49-1.86) 


P. flora flora 


1.04 ± 0.08 


1.70 ± 0.08 


1.77 ± 0.15 




(0.89-1.65) 


(1.56-1.80) 


(1.6-1.96) 


Baicalia dybowskiana 


1.37 ±0.076 


2.15 ± 0.21 


2.96 ± 0.28 




(1.29-1.43) 


(2.01-2.29) 


(2.71-3.27) 


B. carinata 


1.33 ± 0.06 


2.16 ± 0.15 


2.88 ± 0.19 




(1.23-1.44) 


(1.90-2.63) 


(2.52-3.20) 


Godlewskia pulchella 


1.31 ± 0.085 


2.86 - 0.17 


3.73 - 0.10 




(1.19-1.35) 


(2.71-3.03) 


(3.49-4.05) 



does not differentiate this species (p > 0.05) 
from other two species of the subgenus Eu- 
baicalia, but from Parabaikalia oviformis (p < 
0.05) (Table 13). 

Three species assigned to the genus Tera- 
tobaikalia - T ciliata, T duthiersii and T. 
macrostoma - also require discussion. Ear- 
lier, these species were assigned to inde- 
pendent subgenera of the genus Baicalia: 
T. macrostoma to subgenus Teratobaikalia, T. 
ciliata to subgenus Dybowskiola, and T. 
duthiersii to the subgenus Trichiobaikalia 
(Lindholm, 1909; Kozhov, 1936). Later, these 



three species were assigned to the genus Ter- 
atobaikalia based on the morphology of the fe- 
male reproductive system, but were divided 
into two subgenera: Teratobaikalia with T. 
macrostoma, and Trichiobaikalia with T ciliata 
and T duthiersii {Súnikova, 1991b). The pro- 
toconchs of these species differ in size, and 
analysis of their protoconch characters places 
them in different clusters. However, similar 
sculpture and protoconch shape suggest an 
affinity of these species, with T. ciliata and T. 
macrostoma being the most similar. This is 
also confirmed by the height/width ratio of the 



REPRODUCTION AND EMBRYOGENY IN BAICALIID RISSOOIDEANS 



83 



TABLE 13. Comparison of protoconch ratios in Maackia bythiniopsiswWh two other species of 
Maackia and Parabaikalia oviformis using T-test (h - height, w - width, n - whorl number), 

Maackia bythiniopsis (n = 10) 



h/w 



n/h 



n/w 



Maackia herderiana (n = 10) t 0,3, n.s. t 14.4, p 0.00 t 24.10, p 0.00 

M. variesculpta (n = 14) t 1.23, n.s. t 12.01, p 0.00 t 188.99, p 0.00 

Parabaikalia oviformis (n = 15) t 9.41 , p 0.00 t 2.50, p 0.02 t 6.93, p 0.00 



protoconch, which does not differentiate the 
species (p > 0.05). The fact that T. duthiersii 
differs (p < 0.05) from T. macrostoma in three 
of the protoconch ratios used (height/width, 
whorl number/height and whorl number/ 
width), and that T. ciliata and T. duthiersii do 
not differ in whorl number/height ratio (p > 
0.05), indicates that T. duthiersii '\s closer to T. 
ciliata in protoconch morphology than to T. 
macrostoma. The three species also have one 
feature in common: the protoconch sculpture 
that continues as lirae on the teleoconch, dif- 
ferentiates to periostracal hairs in T. ciliata, 
plates in T. macrostoma, and "brushes" in T. 
duthiersii {F\g. 9A, F, H). 



CONCLUSIONS 

Our results allow us to suggest that (1) 
baicaliids reproduce throughout the year, with 
two main egg-laying periods (late spring and 
late summer-autumn); (2) the duration of em- 
bryogénies depends on egg-laying time for 5 
m, 10 m and 20 m depths, where seasonal 
temperature varies; (3) that the young hatch 
in greater numbers twice a year, which for 
suspension-feeder species appears to be 
timed in coincidence with peaks of phyto- and 
bacterioplankton production, and for species 
that consume microphytobenthos and detri- 
tus, to production peaks in the former, and in- 
creased input of the latter. 

While there is a certain degree of specula- 
tion in our reasoning, we hope that our report 
will encourage research in order to examine 
the link between reproduction, hatching and 
feeding of Lake Baikal endemic molluscs. 

Morphologically, the egg capsules of the 1 5 
baicaliid species examined can be subdivided 
into four groups: (1) single lens-shaped cap- 
sules with a convex upper surface, (2) cap- 
like capsules with no or narrow margins, often 
in clusters, (3) cup-shaped capsules, in clus- 
ters or single, and (4) single "oval bags", not 
attached to the substratum. 



Protoconchs have been examined in 26 
baicaliid species. The ontogenetic continua- 
tion of the lirae on the teleoconch can be de- 
tected only in a few species. The protoconchs 
of Baicaliidae (including Llobalcalla stiedae) 
are orthostrophic, but in L. stiedae the proto- 
conch axis deviates significantly from the 
teleoconch axis. Three groups of baicaliids 
were distinguished on the basis of a cluster 
analysis of protoconch morphology, and the 
results do not fully coincide with currently ac- 
cepted taxonomy of the Baicaliidae. Some 
species currently assigned to the same genus 
(or subgenus) differ either in protoconch size 
or egg capsule morphology. 

Additional studies of morphology, taxon- 
omy, population variability of the shell and 
ecology of the Baicaliidae will provide further 
insights into the origin and evolution of this 
group in Lake Baikal. 



ACKNOWLEDGEMENTS 

The authors are sincerely grateful to the di- 
rector of the Limnological Institute of the 
Siberian Division of the Russian Academy of 
Sciences (RAS) Prof. M. A. Grachev for mak- 
ing it possible to conduct the work under his 
auspices, to the former and the current direc- 
tor of the Institute of Toxicology (City of 
Baikalsk), Dr. A. M. Beym (deceased) and Dr. 
E. I. Grosheva respectively, to the scientist of 
the latter institute, S. Kudelin, for having suc- 
cessfully managed experimental work in the 
aquarium; to the divers V. Votyakov and S. 
Selyandin, who self-denyingly lifted molluscs 
from the bottom of Lake Baikal heedless of 
the weather, and to the captains of the re- 
search vessels TItov, Vereshchagin, and 
Obruchev. We are sincerely grateful to M. Bu- 
lang-Lörcher (Freie Universität Berlin) for 
drawing most of the egg-capsules, to Dr. M. 
N. Shimaraev for consultation with regard to 
Baikalian water temperature, Drs. G. F. 
Mazepova, Z. V. Slugina, R. M. Kamaltynov, 



84 



SITNIKOVA. ROPSTORF & RIEDEL 



D. Y. Sherbakov (all Limnologlcal Institute of 
RAS in Irkutsk), Dr. Y. I. Starobogatov and Dr. 
V. G. Sideleva (Zoological Institute of RAS in 
St. Petersburg) for their kind reading of the 
manuscript and comments. Many thanks for a 
financial support from the Jessup-Foundation 
of the Academy of Natural Science of 
Philadelphia (ANSP) and for the kindness of 
Dr. С Gouíden (Director of the Institute for 
Mongolian Biodiversity and Ecological Stud- 
ies, ANSP). The first author was able to study 
contemporary literature in the maiacological 
library of the ANSP and to complete the man- 
uscript. We are particularly indebted to Dr. G. 
M. Davis (ANSP) for his critical remarks at the 
various stages of the progress of the manu- 
script. We also thank two anonymous review- 
ers for their comments on the manuscript. 

The work was supported by the Deutsche 
Forschungsgemeinschaft (DFG) project Ri 
809/1 (Dr. Riedel), the Russian Foundation of 
Basic Research (RFBR) grant N 97-04-96237 
(Dr. Timoshkin), RFBR grant N97-04-63036k 
(Prof. Grachev), RFBR grant N98-04-49276a, 
grant N98-04-63058k (Dr. Sitnikova) and by a 
Japanese grant (Prof. Wada): "An Integrative 
Study on Biodiversity Conservation under 
Global Change and Bioinventory Manage- 
ment System". 



LITERATURE CITED 

ANTIPOVA, N. L., 1974, Annual fluctuation of phy- 
toplankton in the area of Bolshiye Koty in the pe- 
riod of 1 960- 1 970. Pp. 75-84, in: O, M. kozhova, 
ed., Productivnosf Baikala i antropogennye 
izmemeniya ego prirody [Productivity of Lake 
Baikal and anttiropogenic cfianges of its nature], 
Ministerstvo vysshego i srednego obrazovaniya 
RSFSR, Irkutskiy gosudarstvennyi universitet, 
Irkutsk (in Russian). 

BECKMAN, M. Y, & Y I. STAROBOGATOV, 1975, 
Baikal deepwater molluscs and their related 
forms. Pp. 92-111, in; News on thie fauna of 
Baikal, part 1. Trudy Limnologicheskogo Instituta 
SO AN SSSR, 18(38) (in Russian). 

DYBOWSKI W., 1875, Die Gastropoden-Fauna des 
Baikal-Sees, anatomisch und systematisch Bear- 
beitet. Memories de l'Académie Imperiale des 
Sciences de St. Petersbourg, 22(8): 1 -73, 8 pis. 

GAVRILOV, G. В., 1953, The reproduction of the 
Baikalian mollusc Baicalia fierderiana and others. 
Zoologicheskiy Ztiurnal. 32(5): 840-843 (in 
Russian). 

KAMALTYNOV. R. M., E. B. KARABANOV, T Y 
SITNIKOVA & V N. ATAMANCHUKOV 1998, 
Biota of the underwater rock slopes — new com- 
ponent of the Baikalian ecosystem. Ekologich- 
eskie problemy basseinov krupnyti rek (Ecologi- 



cal problems in basins of large rivers). 203, ab- 
stract (in Russian). 

KOZHOV. M. M., 1936, Mollusques du lac Baikal. 
Systématique, distribution, écologie, quelques 
donnues sur la genese et histoire. Akademia 
Nauk SSSR, Trudy Baikal'skoi Limnologicheskoi 
Stantsii [Travaux de la Station Limnologique du 
Lac Bajkal]. 8: 1-350, 13 pis. (in Russian. Ger- 
man summary). 

KOZHOV M. M., 1963, Lake Baikal and its life. 
Monograpfiiae Biologicae. 11: 1-344. 

LINDHOLM, W. A., 1909. Die Mollusken der Baikal- 
Sees. Wissenschaftliche Ergebnisse einer Zoolo- 
gischen Expedition nach dem Baikal-See unter 
Leitung des Professors Alexis Korotneff in den 
Jahren 1900^1902. 4: 1-104, 2 pis. 

LINDHOLM, W. A., 1924, Collectanea baicalica I. 
Archiv für Molluskenkunde. 56(6): 217-225. 

POMAZKINA, G. I., 2000, Microphytobenthos of the 
southern Baikal. Abstract of the PhD thesis. Insti- 
tute of Geography, SD of RAS, Irkutsk, 1-20 (in 
Russian). 

PONDER, W. F & A, WAREN, 1988. Appendix: 
Classification of the Caenogastropoda and Het- 
erostropha — a list of the family-group names and 
higher taxa. Maiacological Review. Supplement 
4: 288-326. 

RIEDEL, F., 1993, Early ontogenetic shell formation 
in some freshwater gastropods and taxonomic 
implications of the protoconch. Limnologica, 
23(4): 349-368. 

ROSSOLIMO, L. L., 1957, The thermal regime of 
Lake Baikal. Trudy Baikalskoy Limnologicheskoy 
Stantsii AN SSSR. 16: 1-551 (in Russian). 

SITNIKOVA, T Y, 1991a, Results of study of egg- 
clusters of endemic Baikalian mollusks. Pp. 
61-73, in: Y. I. STAROBOGATOV, ed., Pazmnozhe- 
nie i kladki yaits mollyuskov [Reproduction and 
egg-clusters of molluscs]. Trudy Zoologich- 
eskogo Instituta AN SSSR. Vol. 228, Leningrad 
(in Russian). 

SITNIKOVA, T Y, 1991b, New structure of Baikal 
endemic molluscs of the family Baicaliidae. Pp. 

266-281, in: A, A. LINEVICH & E. L. AFANASIEVA, 

eds., Morfologiya i evolyutsiya bespozvonoch- 
nykh [Morphology and evolution of invertebrates], 
Nauka, Novosibirsk (in Russian). 

SITNIKOVA, T Y, 1994, Recent views on the his- 
tory and diversity of the Baikalian malacofauna. 
Archiv für Hydrobiologie. Ergebnisse der Lim- 
nologie. 44: 319-326. 

STAROBOGATOV, Y I. & T Y SITNIKOVA, 1983, 
The system of the Order Littoriniformes (Gas- 
tropoda Pectinibranchia). Pp. 18-22, in: i. M. 
LiKHAREV, ed., Mollusci. sistematika. ekologiya i 
zakonomernosti raspredeleniya. [Molluscs, their 
systematics. ecology and distribution]. Nauka., 
Leningrad (in Russian). 

VERBOLOV, V. I., V M. SOKOLNIKOV & M. N. 
SHIMARAEV, 1965, Hydrometeorological regime 
and temperature balance of Lake Baikal. Nauka, 
Moscow-Leningrad, 373 pp. (in Russian). 

VOTINTSEV, K. K., 1961, Hydrochemistry of Lake 
Baikal. Trudy Baikal'skoi Limnologicheskoi 



REPRODUCTION AND EMBRYOGENY IN BAICALIID RISSOOIDEANS 



85 



Stantsii [Proceedings of the Baikalian Limnologi- 
cal Station], 20: 1-311 (in Russian). 

VOZNESENSKY, A. V., 1 908, Outline of the climatic 
peculiarities of Lake Baikal. Pp. 173-329, in: o. 
K. DRiZHENKO, ed., Lotsia i fizil<o-geograficliesl<iy 
ocherl< ozera Bail<al [l\/laps and physical and ge- 
ographical outline of Lake Baikal], St. Petersburg 
(in Russian). 

YOUNG, J., 1975, A laboratory study using "^Ca 
tracer, on the source of calcium during growth in 



two freshwater species of Gastropoda. Proceed- 
ings of the Malacological Society of London, 41 : 
439-445. 

Revised ms. accepted 29 July 2000 



MALACOLOGIA, 2001, 43(1-2): 87-101 

A GENETIC APPROACH TO RESOLVING TAXONOMIC AMBIGUITY AMONG 
PLEUROBEMA (BIVALVIA: UNIONIDAE) OF THE EASTERN GULF COAST 

Karen L. Kandl\ Hsiu-Ping Liu^, Robert S. Butler^, Walter R. Hoeh'^ & Margaret Mulvey^ 

ABSTRACT 

Freshwater mussels in the genus Pleurobema (Bivalvia: Unionidae) from the eastern Gulf 
drainages of Florida, Georgia, and Alabama are variable conchologically, and several taxonomic 
names have been applied to shell phenotypes. Clarification of the species status of these mus- 
sels is important because they are recognized as imperiled throughout their range, mainly due 
to habitat destruction. Allozyme electrophoresis and restriction fragment length polymorphisms 
(RFLPs) of the nuclear ribosomal array showed little genetic differentiation among samples rep- 
resenting the phenotypes designated P. pyriforme and P. bulbosum. Partial DNA sequences of 
the mitochondrial cytochrome с oxidase subunit 1 distinguished P. reclusum from P. pyriforme 
and P. bulbosum. Genetic differentiation was observed between other Pleurobema species, 
specifically P. strodeanum, P. clava, and P. sintoxia. Genetic evidence indicates that the eastern 
Gulf Coast Pleurobema (P. pyriforme and P. bulbosum) are a single species, P. pyriforme, with 
variable shell characteristics. Pleurobema reclusum is different genetically and may represent a 
distinct valid species. Pleurobema pyriforme is a federally endangered species. Although we 
hesitate to call P. reclusum a distinct species because we were able to sequence DNA from only 
one individual, it is distinct genetically from P pyr/formeof the Apalachicola-Chattahoochee-Flint 
rivers basin and should merit conservation status. 

Key words: Pleurobema, Unionidae, RFLP analysis, allozymes, DNA sequencing, conserva- 
tion, endangered species. 



INTRODUCTION 

Freshwater unionacean mussels are 
among the most endangered fauna in North 
America (Bogan, 1993; Williams et al., 1993; 
Stolzenburg, 1995; Mulvey et al., 1997; 
Neves et al., 1997). North American unionids 
have a life cycle that requires a host (typically 
fishes) for development and metamorphosis 
of the glochidia, the unionid larval stage. 
When host species decline, the mussels that 
depend on them decline as well (Bogan, 
1993). Mussel habitat has been destroyed by 
siltation of rivers, stream channelization, in- 
stream gravel mining, dredging, and damming 
and polluted from paper mills and chemical 
factories, untreated municipal effluent, and 
non-point source pollution (Bogan, 1993; 
Neves et al., 1 997). Freshwater mussels have 
been commercially harvested for the pearl 
button industry in the early twentieth century 
(Bogan, 1993) and more recently for the Indo- 



Pacific pearl trade, for which their shells are 
ground into beads to form a nucleus for cul- 
tured pearls (Williams et al., 1993). Intro- 
duced species, including the Asian clam {Cor- 
bicula fluminea) and the zebra mussel 
[Dreissena polymorptia), compete with the 
native bivalves for space and food or, in the 
case of zebra mussels, actually use the native 
mussels as substratum (Bogan, 1993). World- 
wide, freshwater bivalves face similar pres- 
sures from humankind (Bogan, 1993). 

Many freshwater mussel species are cur- 
rently protected under the Endangered 
Species Act (ESA) of 1973 (amended in 
1978). Conservation of species under the 
ESA requires that species be recognized as 
distinct from other such groupings. However, 
species discriminations often depend upon 
characters that are phenotypically variable. 
Information regarding reproductive isolation 
or underlying genetic distinctiveness may not 
be available for most molluscan taxa. Taxono- 



University of New Orleans Department of Biological Sciences New Orleans, Louisiana 70148, U.S.A.; kkandl@uno.edu 
^Souttiwest Missouri State University Department of Biology 901 South National Avenue Springfield, Missouri 65804-0095, 
U.S.A. 

^United States Fish and Wildlife Service Asheville Field Office 160 Zillicoa St. Ashevllle, North Carolina 28801, U.S.A. 
''Kent state University Department of Biological Sciences Kent, Ohio 44242-0001, U.S.A. 

Virginia Institute of Marine Science Department of Environmental Science The College of William and Mary Gloucester 
Point, VA 23602-1 346, U.S.A. 



87 



88 



KANDLETAL. 



mists may lump phenotypic variants under a 
single species name, or conversely, may 
apply a specific name to each variant. For 
efforts towards conservation of biodiversity, 
failure to recognize cryptic species or prolifer- 
ation of taxonomic names can create man- 
agement problems. 

The ESA protects species of most organ- 
isms and populations of vertebrates, thus the 
recognition of valid species is critical to the 
implementation of the ESA. Several species 
concepts are currently in use, each differing 
from the others in their specific criteria (Roe & 
Lydeard, 1998). Two "universal" criteria of 
species concepts are (1) reproductive isola- 
tion and (2) distinct evolutionary lineages 
(Sites & Crandall, 1997). Populations of inver- 
tebrates are not legally protected under the 
ESA. In an effort to gain recognition, if not pro- 
tective status for populations of invertebrates 
and other organisms, the concept of evolu- 
tionary significant units (ESUs) has been em- 
ployed (Waples, 1991: Moritz, 1994). An ESU 
is a '"population (or group of populations) that: 
(1) is substantially reproductively isolated 
from other conspecific units, and (2) repre- 
sents an important component in the evolu- 
tionary legacy of the species" (Waples, 1991: 
Bowen. 1998: Roe & Lydeard, 1998). Roe & 
Lydeard (1998) argue that the ESU concept 
overlaps considerably with the phylogenetic 
species concept, which suggests that a 
species is "the smallest aggregation of popu- 
lations or lineages diagnosable by a unique 
combination of character states". Thus, some 
populations that are considered to be ESUs 
may reasonably be called species instead. 
For example, certain populations of Potamilus 
inflatus could be considered two distinct 
species because the populations are topolog- 
ically disjunct on a cladogram and reproduc- 
tively isolated, occurring in two different 
drainages (the Amite and the Black Warrior 
drainages) and therefore represent "phyloge- 
netically and evolutionarily distinct entities" 
(Roe & Lydeard 1998). 

The genus Pleurobema currently com- 
prises at least 32 species (Turgeon et al., 
1998: Williams et al., 1993), although Simp- 
son (1914) recognized 76 species. At least 22 
(71%) of the currently recognized species of 
Pleurobema are designated as threatened or 
endangered by Williams et al. (1993). As few 
as two and at least as many as nine nominal 
species of Pleurobema have been recognized 
from the Gulf drainages of Florida, Georgia, 
and Alabama (Clench & Turner, 1956; Simp- 



son. 1914). Historical records show that Pleu- 
robema was widespread and locally abundant 
throughout the Coastal Plain and Piedmont 
regions of the tri-state area (Brim-Box & 
Williams, 2000). 

Simpson (1914) recognized Pleurobema 
pyriforme (oval pigtoe), P. bulbosum (inflated 
clubshell), and P. reclusum (Florida pigtoe) 
based on morphological characteristics. 
These species, as well as P. modicum, were 
later synonomized under P. pyriforme by 
Clench & Turner (1956), who argued that vari- 
ation in shell characters did not reflect under- 
lying species differences. Some recent taxo- 
nomic treatments have again recognized P. 
bulbosum and P. reclusum as species distinct 
from P. pyriforme (Stansbery, 1976: Williams 
& Butler, 1994). Pleurobema pyriforme, how- 
ever, is the only species of Pleurobema cur- 
rently recognized by Turgeon et al. (1998) as 
occurring in northern Florida and southern 
Georgia from the Apalachicola River drainage 
to the Suwannee River drainage. Whether P. 
bulbosum and P reclusum are distinct 
species is a critical conservation issue. These 
mussels are rare in their ranges and threat- 
ened by habitat destruction (Williams & Butler, 
1994). Within the context of the Endangered 
Species Act, however, only taxonomically dis- 
tinct species of invertebrates may be consid- 
ered for conservation status. 

We examined specimens of Pleurobema 
from northern Florida, southern Georgia, and 
Alabama, including specimens identified as P 
pyriforme, P. bulbosum, P. reclusum, and P. 
strodeanum (fuzzy pigtoe) based on morpho- 
logical and historical collection site data. Pleu- 
robema pyriforme occurs from the Econfina 
Creek drainage in west Florida to the Suwan- 
nee River system, although Clench & Turner 
(1956) recognized it as occurring only in the 
Apalachicola and Suwannee river systems, 
and Williams & Butler (1994) considered it to 
be an endemic of the Apalachicola River sys- 
tem. Pleurobema pyriforme is known from 
Econfina Creek drainage from 1 970 and 1 993 
(USGS) records (J. D. Williams, personal 
communication to RSB). The type locality of P 
pyriforme is near Columbus, Georgia (Simp- 
son, 1914). The range of P. rec/usam includes 
the Ochlocknee and Suwannee river systems 
(Simpson, 1914: Williams & Butler, 1994), and 
its type locality is the Ochlocknee River in 
Leon County, Flohda (Simpson, 1914). Stans- 
bery (1976) recognized P bulbosum as a dis- 
tinct species from P. pyriforme. The historic 
range of P bulbosum was the Flint and Oc- 



TAXONOMIC AMBIGUITY AND CONSERVATION 



89 



mulgee river systems of Georgia (Simpson, 
1914), although the type locality, Macon, 
Georgia, on the latter river, is likely incorrect 
(Clench & Turner, 1 956; J. Brim-Box, personal 
communication to KLK). The type locality con- 
sidered valid is Spring Creek, Decatur 
County, Georgia, which is a tributary to the 
Flint River and part of the Apalachicola River 
drainage (J. Brim-Box, personal communica- 
tion to KLK). Pleurobema strodeanum is con- 
sidered a distinct species (Williams & Butler, 
1994). Its range extends from the Escambia 
River to the Choctawhatchee River system 
(Clench & Turner, 1956), and the type locality 
is the Escambia River in Florida (Simpson, 
1914). In Florida, P. sfrocyeantvm is considered 
a threatened species (Williams & Butler, 
1994). 

The taxonomy of freshwater mussels has 
been largely based on conchological charac- 
ters (Mulvey et al., 1997). Reliance on con- 
chological characteristics for taxonomic reso- 
lution is often problematic, because shell and 
nacre color, shell size, and shell shape can 
vary with environmental conditions and geo- 
graphic location (Stiven & Alderman, 1992; 
Mulvey et al., 1997). Molecular genetic tech- 
niques can provide additional information to 
better discriminate among species and to de- 
termine relationships among species which 
are unclear based on morphological charac- 
teristics alone (Davis, 1994; Hoeh, 1990; 
Hoeh et al., 1995; Mulvey et al., 1998). 

The objectives of this study were to assess 
the genetic distinctiveness of populations of 
Pleurobema in order to clarify the species 
status of eastern Gulf Pleurobema {P. pyri- 
forme, P. bulbosum, and P. reclusum). Al- 
lozyme electrophoresis, nuclear RFLPs, and 
mitochondrial DNA sequencing provided ge- 
netic characteristics and were used to evalu- 
ate relationships. To facilitate interpretation of 
the data, we compared our results to those of 
other studies that generated comparable ge- 
netic data for other freshwater mussel taxa. 



METHODS 

Twenty-eight specimens of Pleurobema 
from eleven northern Florida, southern Geor- 
gia, and southern Alabama populations were 
used for DNA analysis in this study (Table 1, 
Fig. 1). Pleurobema strodeanum, P. sintoxia, 
and P. clava were included to evaluate inter- 
specific genetic differences among Pleu- 
robema. Other genera from the subfamily Am- 



bleminae {sensu Lydeard et al., 1996), to 
which Pleurobema belongs, were selected for 
outgroups; these were Uniomerus carolini- 
ana, Elliptio sp., Quadrula apiculata, and Vil- 
losa lienosa. Based on a phylogenetic analy- 
sis of the 16S rRNA gene, Uniomerus and 
Elliptio are closely related to Pleurobema; 
Quadrula and Villosa are more distantly re- 
lated (Lydeard et al., 1996). 

Allozyme electrophoresis was performed 
on adductor muscle tissue from all specimens 
that were frozen (Table 1), and the following 
loci were scored: a-glycerophosphate dehy- 
drogenase (aGpd; E. С 1.1.1.8), fluorescent 
esterase (F-Est; E. С 3.1.1.1), glyceralde- 
hyde-3-phosphate dehydrogenase (Gapd; E. 
С 1.2.1.12), glucose-phosphate isomerase 1 
(Gpi-1; E. C. 5.3.1.9), lactate dehydrogenase 
(Ldh; E. С 1.1.1.27), malate dehydrogenase 
1 and 2 (Mdh-1 , Mdh-2; E. С 1 .1 .1 .37), malic 
enzyme (Me; E. С 1.1.1.40), peptidase using 
leucylalanine and phenylanylproline as sub- 
strates (la-Pep, pp-Pep; E. С 3.4.-.-), man- 
nose-6-phosphate isomerase (Mpi; E. С 
5.3.1 .8), nucleoside Phosphorylase (Np; E. С 
2.4.2.1), and phosphoglucomutase-2 (Pgm-2, 
E. С 5.4.2.2). Loci were analyzed on the fol- 
lowing buffer systems: Gapd, Mpi, and Pgm-2 
on Tris-citrate, pH 8.0 buffer (Selander et a!., 
1971), Np and Ldh on Tris-citrate-EDTA, pH 
7.1 buffer (Ayala et al., 1972); F-est, Me, Gpi, 
and aGpd on Tris-EDTA-borate, pH 8.0 buffer 
(Selander et al., 1 971 ); la-Pep and pp-Pep on 
lithium-hydroxide buffer, pH 8.1 (Selander et 
al., 1 971 ); Mdh-1 and Mdh-2 on amine-citrate, 
pH 6.1 buffer (Clayton & Tretiak, 1972). The 
most common allele was designated 100, and 
other alleles were assigned according to their 
mobilities relative to the 100 allele and the ori- 
gin. BIOSYS-1 (Swofford & Selander, 1981) 
was used to determine allele frequencies and 
to generate a UPGMA phonogram based on 
Nei's (1972) unbiased genetic distance. 

Genomic DNA, for RFLP analysis and DNA 
sequencing, was isolated following Liu et al. 
(1996). A 2.2 kilobase nuclear DNA fragment 
of the hbosomal region (partial 18S rRNA, 
ITS1 , 5.8S rRNA, ITS2, and partial 28S rRNA) 
was amplified via polymerase chain reaction 
(PCR) using the primers, mussel 18S and 
mussel D3 (Mulvey et al. 1 998). The hbosomal 
region DNA was digested with the following 
ten resthction enzymes: Dde I, Hae II, Hha III, 
Hinf\, Mbo I, Mbo II, Mse I, Msp I, Rsa I, and 
Taq I. Digests were run on 3% agarose gels 
with molecular weight markers and visualized 
with ethidium bromide. Polaroid photographs 



90 



KANDLETAL. 



TABLE 1. Species and populations examined using RFLP (R), allozyme electrophoresis (A), and DNA 
sequencing of the COI gene (S). The number of individuals examined using DNA analyses, population iden- 
tification letter (corresponding to Fig. 1 and Table 4). and location are also given. 



Taxa 



Study No. Ind. Pop. Id. 



Drainage 



River 



County, State 



P. bulbosum 
P. reclusum 
P. pyriforme 
P. pyriforme 

P. pyriforme 

P. pyriforme 

P. pyriforme 
P. pyriforme 
P. sp. 
P. sp. 
P clava 
P. strodeanum 
P. strodeanum 
P. sintoxia 
P. sintoxia 
Amblema plicata 
Elliptio sp. 
Elliptio crassidens 

Fusconaia flava 
Quadrula apicu- 

lata 
Uniomerus car- 

oliniana 
Villosa lienosa 



RAS 
RAS 
RA 
RA 

RAS 

RAS 

RAS 

RAS 

RAS 

RAS 

S 

RAS 

RA 

RS 

RS 

S 

RAS 

S 

S 

S 

RA 
A 



Chipóla 

Suwannee 

Chipóla 

Flint 

Flint 

Flint 

Chipóla 

Econfina 

Econfina 

Chattahoochee 

Ohio 

Escambia 

Escambia 

Mississippi 

Mississippi 

Genbank 

Chattahoochee 

Apalachicola 

Genbank 
Alabama 

Altamaha 

Kissimmee 



Dry Creek 
New River 
Chipóla River 
Kinchafoonee 

Creek 
Kinchafoonee 

Creek 
Chickasawhat- 

chee R. 
Baker Creek 
Econfina River 
Econfina River 
Sawhatchee River 
Little Darby Creek 
Conecuh River 
Escambia River 
Spring River 
Mississippi River 

Sawhatchee River 
Apalachicola 
River 

Little River 



Jackson, Florida 
Union, Florida 
Calhoun, Florida 
Webster, Georgia 

Webster, Georgia 

Terrell, Georgia 

Jackson, Florida 
Bay, Florida 
Bay, Florida 
Early, Georgia 
Madison, Ohio 
Pike, Alabama 
Escambia, Alabama 
unknown, Kansas 
unknown, Kansas 

Early, Georgia 
Gadsen, Florida 



Baldwin-Monroe, 
Alabama 
Altamaha River Long, Georgia 



Lake Arbuckle 



Polk, Florida 



were taken and fragment lengths were deter- 
mined by comparison with markers from the 
photographs. Restriction sites were mapped 
onto the nuclear ribosomal region by compar- 
ing fragment patterns to a related species {El- 
liptio complánala), with known restriction sites 
(Liu & Mulvey. unpublished data). For frag- 
ment sizes that differed from E. complánala, 
probable cutting sites were Inferred. For all 
study mussels, there was always a partial 
match of fragment sizes to those of E. com- 
plánala. Both the presence/absence of frag- 
ments and the restriction sites were analyzed 
by maximum parsimony (PAUP' 4.0 Beta ver- 
sion; Swofford, 1998) to examine the evolu- 
tionary relationships among taxa. A heuristic 
search using the MULPARS option was used 
to find the most parsimonious trees. A boot- 
strap analysis was performed using 2000 
bootstrap replicates and a heuristic search to 
obtain bootstrap values on a 50% majority rule 
consensus tree. 

A total evidence approach, in which al- 
lozyme and RFLP data were combined, was 



also utilized. For this analysis, allozyme data 
were coded as character states with loci as 
characters. Specimens exhibiting allozyme 
polymorphisms were coded as having multi- 
ple character states. For example, a speci- 
men having two different alleles at a particular 
locus might be coded as having a character 
state of 1 ,2. 

A 710 base pair segment of the mitochon- 
drial cytochrome с oxidase subunit 1 gene 
(COI) was amplified via PCR using primers, 
COIL 1490: 5 -GOT CAA CAA АТС ATA AAG 
ATATTG G-3', and COIL 2198: 5'-TAA ACT 
TCA GGG TGA CCA AAA AAT CA-3') (Folmer 
et al., 1994), but only 347 base pairs of this 
sequence were included in the analysis. DNA 
amplifications followed protocols established 
in Hershler et al. (1999). Amplification prod- 
ucts were purified with Microcon^'^-100 fil- 
ters. Purification products were used as tem- 
plate for automated sequencing following 
Applied Biosystem protocols. Sequences 
were aligned using Sequencher™ software 
and by visual examination. Relationships 



TAXONOMIC AMBIGUITY AND CONSERVATION 



91 




(DO)'-' 
ir- С > СЛ 

icf ra 5 "55 
Ф ^ .b "O 
a> о *= >_ 

о ^ 



Ü 



í¿: о 






°l 



О " 



ш 



^"Rcr 



Cl с 
со 

Ol 



о 

S г.- 

roo о; с 

;- "О 
^ О 



U- о 






го .Е 



ш 






го 



è^ 



DC 



Е „.- 

го 

-Í5 Ü: О- Е 
О ^ О ш 



¿ <1) _ 
.^ro^g 

Ш TD 



ü 
Ф 

О g 



Ф О ■,- 



lo: 



^ ГО 

О 9í "О 



I С^ .9 ^ i 



^ ;_ с Ф ф 

°^|^ г« 

^сс^ го ^ 

■В 5 è 5 ° 

§ "" 9- 1" 
^ i¿ 'Л ф 

Ф QJ о 



ГО 



О О ^ 



77- CÜ 



О - « 



92 



KANDLETAL. 



among samples were examined using maxi- 
mum parsimony analysis (PAUP* 4.0 Beta 
version; Swofford, 1998). A heuristic search 
was used to find the most parsimonious trees 
and a bootstrap analysis was performed using 
1000 replicates. 



RESULTS 

Ten of the eleven allozyme loci were poly- 
morphic across all taxa; only Gapd was 
monomorphic across all taxa. Eight loci were 
monomorphic for the eastern Gulf Pleu- 
robema (P. pyriforme. P. bulbosum. and P. 
reclusum) but were polymorphic across other 
taxa (Table 2). All allele frequencies are based 
on sample sizes of less than eight. Thus, this 
allozyme study can be used in a qualitative 
fashion to compare the presence/absence of 
alleles in populations, but should not be used 
to compare allele frequencies among popula- 
tions. The phenogram based on allozyme 
data contains a cluster consisting of speci- 
mens designated as P. pyriforme, P. bulbo- 
sum, and P. reclusum based on conchological 
traits (Fig. 2). The genetic distances (Nei, 
1972) between pairs of eastern Gulf Pleu- 
robema ranged from to 0.058 (Fig. 2, Table 
3). The genetic distance between P. stro- 
deanum and taxa in the eastern Gulf Pleu- 
robema cluster ranged from 0.117 to 0.227, 
and the genetic distance between the two 
populations of P. strodeanum was 0.114. The 
average pair-wise genetic distances between 
the eastern Gulf Pleurobema taxa and the 
outgroups, Uniomerus caroliniana anä Villosa 
lienosa, were 0.989 ± 0.016 and 1.206 ± 
0.016, respectively. 

Analysis of fragment presence/absence 
and restriction site presence/absence in the 
ribosomal array using PAUP produced similar 
results, therefore only restriction site data will 
be presented. The ten restriction enzymes 
produced 94 cutting sites (Fig. 3) and nine 
haplotypes (Table 4). Twenty-two out of 23 
samples that had been identified as P pyri- 
forme, P. bulbosum, P. reclusum, or P sp. 
were the same haplotype (AAAAAAAAAA); 
only one P pyriforme from Baker Creek had a 
different haplotype (AAAAAABAAA). 

Maximum parsimony of RFLP restriction 
sites produced 14 equally parsimonious trees 
when characters were weighted equally (TL = 
72, CI = 0.931, Rl = 0.762). A 50% majority 
rule consensus tree is shown in Figure 4. 
Eastern Gulf Pleurobema, including speci- 



mens designated as P. pyriforme, P. bulbo- 
sum, P. reclusum, and P sp., form a single 
clade. Pleurobema strodeanum from the Es- 
cambia River and Conecuh River form a dis- 
tinct clade, and this clade is the sister taxon to 
the P pyriforme clade. The combined data 
from restriction site and allozyme elec- 
trophoresis yielded a tree that was nearly 
identical to that in Figure 2. 

Maximum parsimony analysis of the COI 
mitochondrial gene sequences produced a 
single most parsimonious tree when all char- 
acters were weighted equally (TL = 148, CI = 
0.730, Rl = 0.523) (Fig. 5). The sample identi- 
fied as P reclusum from the Suwannee River 
is the sister taxon to other Pleurobema speci- 
mens from the eastern Gulf Coast identified 
as P. pyriforme, P. bulbosum, and P sp. The 
sequence divergence between P reclusum 
and the other eastern Gulf Coast specimens 
was 2.31%, whereas the sequence diver- 
gence among the other eastern Gulf Coast 
specimens was less than 0.2% over the 347 
bp sequence analyzed. Pleurobema stro- 
deanum + P. clava formed the sister clade to 
all of the eastern Gulf Pleurobema; the aver- 
age sequence divergence between these 
species was 5.4%. Interspecific sequence di- 
vergence values were 5.76% for P sintoxia 
vs. P. strodeanum, 5.19% for P pyriforme vs. 
P. sintoxia, 5.76% for P pyriforme vs. P. clava, 
6.34% for P clava vs. P sintoxia, and 6.05% 
for P. clava vs. P strodeanum. The eastern 
Gulf Pleurobema clade was most closely re- 
lated to the other Pleurobema species in this 
analysis, including P. clava, the type species 
of the genus Pleurobema. The Pleurobema 
clade was most closely related to Fusconaia 
flava, the type species of the genus Fus- 
conaia. Fusconaia is considered to be the sis- 
ter genus to Pleurobema (Davis & Fuller, 
1981). 

DISCUSSION 

Specimens referred to as Pleurobema pyri- 
forme, P. reclusum, and P. bulbosum (eastern 
Gulf Pleurobema) show substantial morpho- 
logical variation. In particular, P reclusum is 
morphologically distinct from P pyriforme and 
P. bulbosum in that P reclusum is not quite so 
inflated and is more plicate having two promi- 
nent hdges (Simpson, 1914; Williams & Butler, 
1994). Genetic evidence from DNA sequenc- 
ing of the COI mitochondrial gene supports 
the hypothesis that P reclusum is distinct from 
the other eastern Gulf Pleurobema. Sequence 



TAXONOMIC AMBIGUITY AND CONSERVATION 



93 



TABLE 2. Allele frequencies determined by allozyme electrophoresis. Population Id refers to tfie letter of the 
population in Fig. 1 . No. Ind. refers to the number of individuals that were used in this allozyme study. The 
following abbreviations are used for taxa: Pp = P pyriforme, Pb = P bulbosum, Pr = P reclusum, Psp = P 
sp., Ps = P strodeanum, Uc = Uniomerus caroliniana, VI = Villosa lienosa. 



Locus 


Pop Id. 


H 


G 


D 


E 


F 


A 


В 


H 


1 


К 


J 






and 


No. Ind. 


2 


7 


6 


5 


2 


4 


2 


2 


7 


2 


4 


2 


2 


Allele 


Taxon 


Pp 


Pp 


Pp 


Pp 


Pp 


Pb 


Pr 


Psp 


Psp 


Ps 


Ps 


Uc 


VI 



F-est 




























110 






0.08 


















1.00 




100 


1.00 


1.00 


0.92 


0.90 


1.00 


1.00 


1.00 


1.00 


1.00 


0.88 


1.00 






95 


























1.00 


90 




















0.12 








80 








0.10 




















Gapd 




























100 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


aGpd 




























106 


























1.00 


100 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 




Gpi 




























180 






















1,00 


0.50 




100 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 




0.50 


1.00 


Mdh-1 




























180 
























0.50 




150 
























0.50 




120 




















0.37 






1.00 


100 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


0.63 


1.00 






Mdh-2 




























108 
























1.00 




100 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 




1.00 


Me 




























170 
























0.50 




115 
























0.50 




100 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 




1.00 


Mpi 




























100 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


0.43 


1.00 


1.00 




0.50 


96 
























1.00 




86 


















0.57 










84 


























0.50 


PEIa 




























100 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 


1.00 




1.00 






95 




















1.00 








84 
























1.00 


1.00 


PEpp 




























115 
























1.00 




110 




0.17 


0.17 






0.50 


0.50 








0.50 




1.00 


100 


1.00 


0.83 


0.83 


1.00 


1.00 


0.50 


0.50 


1.00 


1.00 


0.88 


0.50 






90 




















0.12 








Pgm-2 




























118 






0.33 




0.50 


0.12 






0.71 










112 








0.20 




















100 


1.00 


1.00 


0.67 


0.80 


0.50 


0.88 


1.00 


1.00 


0.29 


0.88 


1.00 


1.00 




81 


























1.00 


88 




















0.12 









divergence between P. reclusum and P. pyri- 
forme was 2.31% for the 347 bp region ana- 
lyzed. This level of divergence is midway be- 
tween the levels of divergence within the P. 
pyriforme clade (all less than 0.29%) and the 
levels of divergence for pairwise comparisons 



among distinct Pleurobema species (5.19%- 
6.34%). This level of sequence divergence is 
not unexpected, given the geographic isola- 
tion of the Apalachicola-Chattahoochee-Flint 
rivers and Suwannee River drainage popula- 
tions. 



94 



KANDLETAL. 



к 



F. pyriforme - Econfina 

P. sp. - Econfina 

P. pyriforme - Baker 

P. pyriforme - Kinchafoonee 

P. pyriforme - Kinchafoonee 

P. pyriforme - Chickasawhatchee 

P. bulbosum - Chipóla 

P. reclusum - Suwannee 

P. sp. - Sawhatchee 

P. strodeanum - Escambia 

P. strodeanum - Conecuh 

Uniomerus - Altamaha 

Villosa - Kinchafoonee 



1.3 1.2 



1.1 



1.0 0.5 

-h--|---h- 



0.4 0.3 



0.2 0.1 

H h- 



0.0 



Genetic Distance (Nei, 1972) 

FIG. 2. UPGMA phenogram based on allozyme data. Branch lengths represent Nei's (1972) genetic dis- 
tance. 

TABLE 3. Comparison of genetic distances based on allozyme studies (Nei, 1972) * standard deviations 
among populations within a species and species within a genus of freshwater mussels. 





No. Pop. 


No. 






Taxon 


or species 


Loci 


Genetic Distance 


Reference 


Populations within a species 










Anodonta Cataracta 


5 


NA 


0.034 • 0.038 


Davis, 1994 


Elliptio complánala 


11 


8 


0.065 • 0.039 


Davis et al., 1981; Davis, 1994 


Lampsilis cariosa 


3 


11 


0.071 • 0.027 


Stiven & Alderman, 1992 


Lampsilis radíala 


5 


7 


0.018 • 0.010 


Kat& Davis, 1984 


Leplodea ochracea 


2 


11 


0.018 


Stiven & Alderman, 1992 


Pleurobema pyriforme 


9 


13 


0.031 ± 0.029 


this study 


Species within a genus 










Amblema 


3 


14 


0.219 ■ 0.025 


Mulvey et al., 1997 


Anodonta 


3 


14 


0.457 - 0.073 


Kat, 1983a 


Elliptio 


7 


14 


0.210 • 0.017 


Davis et al., 1981; Davis, 1984 


Lampsilis 


6 


14 


0.609 • 0.478 


Kat, 1983b 


Megalonaias 


2 


14 


all < 0.100 


Mulvey et al., 1997 


Pleurobema 


2 


13 


0.185 • 0.045 


this study 


Uniomerus 


3 


14 


0.308 • 0.165 


Davis et al., 1981; Davis 1994 



Allozyme analyses and RFLP data do 
not differentiate among any of the eastern 
Gulf Pleurobema populations. The average 
among-population genetic distance (Nei, 
1972) based on allozymes for eastern Gulf 
Pleurobema was 0.031 with a maximum value 
of 0.058. This value is well within the range of 
among-population genetic distances for other 



unionid species (Table 3). In addition, the phy- 
logenetic trees from the RFLP and sequence 
data show support for a single clade consist- 
ing of P. pyriforme, P. bulbosum, and P. 
reclusum. This clade is represented by the 
large polytomy in Figure 4. Allozyme elec- 
trophoresis and RFLP analysis of a nuclear 
gene are techniques that are less likely to dis- 



TAXONOMIC AMBIGUITY AND CONSERVATION 



Dde I [ 



HaeW 



Hha III 



Hini 1 



Mbo I 



Mbo II 



Mse I 




Msp I 



Rsa I 



Ta^I 







500 



1000 



1500 



2000 



A 
С 




FIG. 3. Cleavage maps from the 10 enzymes used to cut the 2.2 kb r RNA gene. The restriction enzymes 
producing the fragments are listed on the left side; capital letters that designate restriction digest patterns are 
listed on the right. The fragment sizes for each cleavage map are given in Table 5 in the order in which they 
appear in the figure. 



96 



KANDLETAL. 



TABLE 4. RFLP haplotype counts in the populations studied. Letters refer to the populations of Pleurobema 

listed in Table 1 and in Fig. 1. Psin-Sp = P. sintoxia from the Spring River, Psin-Mi = P. sintoxia from the 
Mississippi River. Esp = Elliptio sp. and Uc = Uniomerus caroliniana. 

Population 

Haplotype ABCDEFGH I JK Psin-Sp Psin-Mi Esp Uc 

AAAAAAAAAA 321222163-- - - -- 

AAAAAABAAA --_---i---- _ - -_ 

AAAAAADAAA ---------12 - - -- 

AAABAADAAA ---------2- - - - - 

AABAAAAAAA ___-------- 3 _ -_ 

AABAAAAAAD ----------- - 1 -_ 

ABBAAAAAAD ----------- - 1 -- 

AAAAAABAAB ----------- - - 2 - 

ACCCCCCCCC ----------- - - -1 



TABLE 5. 


RFLP fragment sizes to 


г each 


1 cleavage map given in Fig. 3. 










Restnction Restnction 






















Enzyme 


Digest Pattern 










Restriction Fragment S 


¡ize 






Dde\ 


A 


343 


316 


141 


354 


272 


98 279 


347 








HaeW 


A 


788 


524 


27 


237 


119 


218 176 


61 










В 


324 


464 


524 


27 


237 


119 218 


176 


61 








С 


300 


57 


164 


81 


186 


551 237 


241 


272 


61 




Hha III 


A 


205 


35 


410 


589 


495 


248 168 












В 


205 


35 


610 


389 


495 


248 168 












С 


205 


645 


389 


461 


34 


248 168 










Hinf 1 


A 


951 


229 


44 


154 


68 


120 357 


46 


181 








В 


951 


273 


154 


68 


120 


357 46 


181 










С 


951 


229 


198 


68 


120 


357 227 










Mbo\ 


А 


123 


194 


257 


95 


447 


190 747 


97 










С 


123 


161 


290 


95 


447 


190 747 


97 








MboW 


А 


692 


353 


157 


29 


656 














Е 


830 


215 


157 


292 


156 


500 










Mse\ 


А 


197 


216 


303 


368 


57 


1009 












В 


197 


216 


303 


425 


1009 














С 


197 


203 


316 


384 


41 


1009 












D 


197 


216 


303 


355 


70 


1009 










Msp\ 


А 


96 


149 


84 


267 


34 


143 10 


777 


590 








С 


96 


149 


84 


267 


34 


143 10 


857 


510 






Rsa 1 


А 


12 


327 


61 


607 


283 


174 47 


381 


258 








С 


12 


318 


70 


700 


190 


221 381 


258 








Taq\ 


А 


90 


133 


162 


79 


13 


184 77 


594 


489 


329 






В 


90 


133 


162 


179 


44 


79 197 


77 


594 


489 106 






С 


90 


133 


162 


179 


44 


79 38 


159 


77 


389 450 200 150 




D 


90 


133 


162 


191 


32 


79 18 


179 


77 


594 489 





tinguish among closely related taxa than is 
DNA sequencing of the COI gene, and nei- 
ther the allozyme data nor the RFLP data pro- 
vide sufficient resolution to distinguish these 
taxa(Hillisetal., 1996). 

All three genetic techniques clearly differen- 
tiate P. strodeanum, P. sintoxia, and P. clava 
fronn the eastern Gulf Pleurobema. Analysis 
of allozyme data reveal distances for P. stro- 
deanum vs. P. pyriforme that are all greater 
than 0.117. Although there is no absolute ge- 
netic distance value that separates popula- 



tions within a species or species within a 
genus, comparisons with genetic distances of 
taxa that are widely accepted to be differenti- 
ated at the population or species level may be 
useful in identifying the appropriate level of 
taxonomic classification (Davis, 1994). Both 
RFLP analyses and DNA sequence data sup- 
port the notion that P. strodeanum is geneti- 
cally distinct from P. pyriforme as well. Both 
RFLP and sequence data analyses group the 
two or three populations of P. sintoxia and sep- 
arate P. sintoxia from P. strodeanum, P. clava, 



TAXONOMIC AMBIGUITY AND CONSERVATION 
_— P. bulbosum - Chipóla 

-^^— P. reclusum - Suwannee 



97 



57 



42 



78 



61 



31 



18 



P. pyriforme - Kinchafoonee 
P. pyriforme - Kinchafoonee 
P. pyriforme - Chickasawhatchee 
P. pyriforme • Chipóla 
P. sp. - Sawhatchee 
P. pyriforme - Econfína 
P. sp. - Econfína 
P. pyriforme - Baker 
P. strodeanum - Escambia 
' P. strodeanum - Conecuh 
' P. sintoxia - Spring 
' P. sintoxia - Mississippi 



Elliptio sp. 



Uniomerus 



fu 



О) 



FIG. 4. 50% majority rule consensus tree (from 14 equally parsimonious trees), based on restriction site data 
for Pleurobema taxa, Uniomerus caroliniana, and Elliptio sp. Numbers are bootstrap values after 1000 repli- 
cates. 



and the eastern Gulf Pleurobema. The genus 
Pleurobema is monophyletic in both the RFLP 
and DNA analyses although bootstrap values 
indicate relatively poor support for this clade 
(Figs. 4, 5). 

Two main conclusions arise from these 
data sets. The first is that allozyme elec- 
trophoresis, RFLP analyses, and DNA se- 
quencing did not differentiate specimens 
identified as P. bulbosum from P. pyriforme, 
although these same techniques certainly dis- 
tinguish currently recognized species of Pleu- 
robema. The range of P. bulbosum is the Flint 
River, which is part of the Apalachicola River 



drainage. The range of P. pyriforme also in- 
cludes the Apalachicola River drainage 
(Williams & Butler, 1994). Thus, specimens 
identified as P. pyriforme or P. bulbosum may 
represent intraspecific morphological varia- 
tion that occurs in different rivers within the 
same drainage or they may represent distinct 
species. Pleurobema bulbosum and P. pyri- 
forme can be distinct species despite the low 
levels of genetic divergence (Sites & Crandall, 
1 997), but at this time and based on these ge- 
netic data, we can not recommend that they 
be considered distinct species. 
Pleurobema reclusum is genetically distinct 



98 



54 



56 



38 



50 



82 



KANDLETAL. 

^^^^ P. strodeanum - Escambia 
^^^^^— ^^ P. clava - Ohio 



80 



97 



P. pyriforme - Chickasawhatchee 
P. sp. - Sawhatchee 
P. pyriforme - Chipóla 
"^ P. pyriforme - Econfina 
~ P. pyriforme- Kinchafoonee 
P. bulbosum - Chipóla 
■" P. reclusum - Suwannee 



s 



^с I p. sintoxia - Mississippi 



99 



I 



P. sintoxia • Spring 
P. sintoxia • Spring 
F. flava 



s: 

Ci 



E. crassidens 



Á. plicata 



Q. apiculata 

FIG. 5. The single most parsimonious phylogram based on a 347 bp sequence of the mitochondrial gene, 
COI. Numbers are bootstrap values, after 2000 bootstrap replicates. 



from other eastern Gulf Pleurobema at the 
COI mitochondrial gene using DNA analysis. 
Regrettably, we had a tissue sample from only 
a single individual identified as P. reclusum 
from the Suwannee River. We hesitate to say 
that this one specimen represents a distinct 
species of Pleurobema, P. reclusum. On the 
other hand, because of these genetic differ- 
ences, we hesitate to say that this individual 
simply represents morphological and genetic 
variation present in P. pyriforme. Pleurobema 
reclusum is confined to the Ochlocknee and 
Suwannee River drainages, and it is unlikely 
that gene exchange occurs with P. pyriforme 
from the Apalachicola drainage; thus, we at- 
tribute the C01 divergence to geographic iso- 
lation, and perhaps reproductive isolation as 
well. Additional samples are needed to deter- 



mine whether this morphological and genetic 
variation is indicative of population-level dif- 
ferences or whether it is indicative of a 
nascent species-level divergence. Further 
studies to differentiate between these possi- 
bilities should include samples from the 
Ochlocknee River. Several attempts on our 
part to include specimens from the Ochlock- 
nee were unsuccessful. These samples are 
important because the Ochlocknee River, be- 
tween the Apalachicola drainage where P. 
pyriforme is found and the Suwannee River, is 
an area in which P. pyriforme and P. reclusum 
may co-occur. 

The Suwannee River drainage may repre- 
sent an area of endemism for freshwater mus- 
sels and other animals. Lydeard et al. (in 
press) showed that Quincuncina infucata in 



TAXONOMIC AMBIGUITY AND CONSERVATION 



99 



the Suwannee River is substantially geneti- 
cally different from other Q. infucata and sug- 
gested that populations in the Suwannee 
River be raised to the species level. Likewise, 
Hoeh et al. (1 995) found a distinct clade of Ut- 
terbackia peggyae in the drainages of north- 
western peninsular Florida, including the 
Suwannee River drainage. Populations of al- 
ligator snapping turtles from the Suwannee 
River are morphologically and genetically dis- 
tinct from other such populations, and this 
river represents the deepest evolutionary 
break in the phylogeny of alligator snapping 
turtles (Roman et al., 1999). One explanation 
for this region of endemism is that this area 
was inundated and then isolated from the sur- 
rounding region at least two times during the 
Cenozoic due to sea level changes (Hoeh et 
al., 1995). These vicahance events likely re- 
sulted in diversification of the freshwater 
fauna of the northern peninsula of Florida 
(Hoeh et al., 1995). 

Pleurobema in the eastern Gulf are in need 
of conservation (Williams et al., 1993; 
Williams & Butler, 1994). Clench & Turner 
(1956) noted that P. pyriforme (synonomized 
with P. reclusum and P. bulbosum in their 
study) was "relatively rare and perhaps only 
locally abundant". In the 40 years since 
Clench & Turner (1956), destruction of fresh- 
water mussel habitat has continued at an ac- 
celerated pace. Stansbery (1971) noted that 
P. pyriforme was becoming less abundant in 
its range, and five years later it was desig- 
nated as threatened in Alabama (Stansbery, 
1976). Williams et al. (1993) designated P 
pyriforme as endangered, and in 1 998 "feder- 
ally endangered" status was proposed for P 
pyriforme (U.S. Fish & Wildlife Service, 1 998). 
Although it is equivocal whether Pleurobema 
in the Suwannee River drainage represent a 
valid species, we found a distinct genetic vari- 
ant at the COI locus in a specimen from this 
region. There is also evidence that popula- 
tions of several animals, including freshwater 
mussels, are distinct in the Suwannee River. 
Thus, we urge wildlife managers to treat the 
Pleurobema that occur in the Suwannee River 
drainage as a separate entity for conservation 
purposes. 



ACKNOWLEDGMENTS 

We wish to thank the following people and 
organizations for providing us with specimens 
of Pleurobema: J. Brim-Box, J. Williams, and 



H. Blaylock-Herod, BRD-USGS in Gaines- 
ville, Florida; T. King and M. Smith, BRD- 
USGS in Leetown, West Virginia; С Lydeard, 
University of Alabama; A. Bogan, North Car- 
olina State Museum of Natural Sciences; and 
T Watters, Ohio State University. J. Williams, 
E. Keferl, and J. Brim-Box painstakingly gave 
advice and information concerning collection 
locations, shell identification, and explana- 
tions for aberrant data. The comments of С 
Lydeard and R. Dillon significantly improved 
this manuscript. С Guy helped prepare the 
map. This work was supported by contract 
DE-FC09-96SR18546 between U.S. Depart- 
ment of Energy and the University of Geor- 
gia's Savannah River Ecology Laboratory, 
and the U.S. Fish and Wildlife Service, 
Asheville, North Carolina. 



LITERATURE CITED 

AYALA, F.J., J.R. POWELL, M.L. TRACEY CA. 
MOURAO & S. PEREZ, 1972, Enzyme variability 
in the Drosophiila willistoni group. IV. Genetic vari- 
ation in natural populations of Drosophila willis- 
toni. Genetics, 70: 113-179. 

BOGAN, A. е., 1993, Freshwater bivalve extinc- 
tions: a search for causes. American Zoologist, 
33: 599-609. 

BOWEN, B.S., 1998, What is wrong with ESUs?: 
the gap between evolutionary theory and conser- 
vation principles. Journal of Shellfish Research, 
17: 1355-1358. 

BRIM-BOX, J. & J.D. WILLIAMS, 2000, Unionid 
mollusks of the Apalachicola Basin In Alabama, 
Florida, and Georgia. Bulletin of the Alabama Mu- 
seum of Natural History, 21, Tuscaloosa, Al- 
abama. 

CLENCH, W.J. & R.D. TURNER, 1956, The fresh- 
water mollusks of Alabama, Georgia, and Florida 
from the Escambia to the Suwannee River. Bul- 
letin Florida State Museum, 1 : 97-239. 

CLAYTON, J. W. & D. N. TRETIAK, 1972, Amine- 
citrate buffers of pH control in starch gel elec- 
trophoresis. Journal of the Fisheries Research 
Board of Canada, 22: 1169-1172. 

DAVIS, G. M., 1984, Genetic relationships among 
some North American Unionidae (Bivalvia): sib- 
ling species, convergence, and cladistic relation- 
ships. Malacologia, 25: 629-648. 

DAVIS, G. M., 1994, Molecular genetics and taxo- 
nomic discrimination. The Nautilus, Supplement, 
2: 3-23. 

DAVIS, G. M. & S. L. H. FULLER, 1 981 , Genetic re- 
lationships among recent Unionacea (Bivalvia) of 
North America. Malacologia, 20: 217-253. 

DAVIS, G. M., W. H. HEARD, S. L. H. FULLER & С 
HESTERMAN, 1981, Molluscan genetics and 
speciation in Elliptio and its relationship to other 
taxa of North American unionidae (Bivalvia). Bio- 



100 



KANDLETAL. 



logical Journal of the Linnean Society. 15: 131 - 
150. 

FOLMER, O., W. R. HOEH. M. B. BLACK & R. L, 
VRIJENHOEK, 1994, DNA primers for amplifica- 
tion of mitochondrial cytochrome С oxidase sub- 
unit 1 from metazoan invertebrates. Molecular 
Marine Biology and Biotechnology. 3: 294-299. 

HERSHLER, R., M. MULVEY & H.-P. LIU, 1999, 
Biogeography in the Death Valley Region: evi- 
dence from springsnails (Hydrobiidae: Tryonia). 
Zoological Journal of the Linnean Society 126: 
335-354. 

HILLIS, D. M., С MORITZ & В. К. MABLE, 1996, 
Molecular systematics. 2nd ed. Sinauer Associ- 
ates, Inc. Sunderland. Massachusetts, 655 pp. 

HOEH, W. R. 1990. Phylogenetic relationships 
among eastern North American Anodonta (Bi- 
valvia: Unionidae). Malacological Review. 23: 
63-82. 

HOEH, W. R., K. S. FRAZER, E. NARANJO-GAR- 
CIA & R. J. TRDAN, 1995, A phylogenetic per- 
spective on the evolution of simultaneous her- 
maphroditism in a freshwater mussel clade 
(Bivalvia: Unionidae: Utterbackia). Malacological 
Review. 28: 25-42. 

KAT, P. W.. 1983a, Genetic and morphological di- 
vergence among nominal species of North Amer- 
ican Anodonta (Bivalvia: Unionidae). Malacolo- 
gia. 23: 361-374. 

KAT, P. W., 1983b, Morphological divergence, ge- 
netics, and speciation among Lampsilis (Bivalvia: 
Unionidae). Journal of Molluscan Studies. 49: 
133-145. 

KAT, P. W. & G. M. DAVIS, 1984, Molecular genet- 
ics of peripheral populations of Nova Scotian 
Unionidae (Mollusca: Bivalvia). Biological Jour- 
nal of the Linnean Society 22: 157-185. 

LIU, H-R, J. B. MITTON & S.-K. WU, 1996, Pater- 
nal mitochondrial DNA differentiation far exceeds 
maternal mitochondrial DNA and allozyme differ- 
entiation in the freshwater mussel, Anodonta 
grandis grandis. Evolution. 50: 953-957. 

LYDEARD. C, M. MULVEY & G. M. DAVIS, 1996. 
Molecular systematics and evolution of reproduc- 
tive traits of freshwater unionocean mussels 
(Mollusca: Bivalvia) as inferred from 16S and 
rRNAgene sequences. Transactions of the Royal 
Society of London. (B)351: 1593-1603. 

LYDEARD, C, R. L. MINTON & J. D. WILLIAMS, in 
press, Prodigious polyphyly in imperiled freshwa- 
ter pearly-mussels (Bivalvia: Unionidae): a phylo- 
genetic test of species and generic designations, 
in: L. HARPER & J, TAYLOR, eds. The evolutionary 
biology of the Bivalvia. Special Publication of the 
Geological Society of London, London. 

MORITZ, С, 1994, Defining evolutionarily signifi- 
cant units. Trends in Ecology and Evolution. 9: 
373-375. 

MULVEY M., С LYDEARD, D. L. PYER, K. M. 
HICKS, J. BRIM-BOX, J. D. WILLIAMS & R. S. 
BUTLER, 1997, Conservation genetics of North 
American freshwater mussels, Amblema and 
Megalonaias. Conservation Biology 1 1 : 1-11. 

MULVEY M., H.-R LIU & K. L. KANDL, 1998, Ap- 



plications of molecular techniques to the conser- 
vation of freshwater mussels. Journal of Shellfish 
Research. 17: 1395-1405. 

NEI, M,, 1972, Genetic distances between popula- 
tions. American Naturalist. 106: 283-292. 

NEVES. R. J., A. E. BOGAN, J. D. WILLIAMS, S. A. 
AHLSTEDT&R W. HARTFIELD, 1997, Status of 
aquatic mollusks in the southeastern United 
States: a downward spiral of diversity. Pp 43-85, 
in: G. w. BENZ & D. E. COLLINS, ods, Aquatic fauna 
in peni: the southeastern perspective. Special 
Publication 1, Southern Aquatic Research Institu- 
tion, Chattanooga, Tennessee. 

ROE, K. J. & С LYDEARD, 1998, Species delin- 
eation and the identification of evolutionarily sig- 
nificant units: lessons from the freshwater mussel 
genus Poiam/7us (Bivalvia: Unionidae). Journal of 
Shellfish Research. 17: 1359-1363. 

ROMAN, J., S. D. SANTHUFF P. E. MOLER & В. 
W. BOWEN, 1 999, Population structure and cryp- 
tic evolutionary units in the alligator snapping tur- 
tle. Conservation Biology 13: 135-142. 

SELANDER, R. K., M. H. SMITH, S. Y YANG, W. E. 
JOHNSON & J. B. GENTRY 1971, Biochemical 
polymorphisms and systematics in the genus 
Peromyscus. I. Variation in the old-field mouse 
(Peromyscus polionotus). Studies in Genetics, 
7103: 49-90. 

SIMPSON, С T., 1914, A descriptive catalogue of 
the naides, or pearly fresh-water mussels. 1540 
pp., Bryant Walker, Detroit, Michigan. 

SITES, J. W., JR., & K. A. CRANDALL, 1997, Test- 
ing species boundaries in biodiversity studies. 
Conservation Biology 11:1 289-1 297. 

STANSBERY D. H., 1971, Rare and endangered 
fresh-water mollusks in eastern United States. 

Pp. 9-20, in: E. S. JORGENSON & R. W. SHARP, 

eds., Proceedings of a symposium of rare and 
endangered mollusks (naiads) of the United 
States. Minnesota Bureau of Sport Fish and 
Wildlife, U. S. Department of the Interior. 

STANSBERY D. H., 1976, Naiad mollusks. Endan- 
gered and threatened plants and animals of Al- 
abama. Bulletin of the Alabama Museum of Nat- 
ural History. 2: 42-52. 

STIVEN, A. E., & J. ALDERMAN, 1992, Genetic 
similahties among certain freshwater mussel 
populations of the Lampsilis genus in North 
America. Malacologia. 34: 355-369. 

STOLZENBURG, W, 1995, Scorecard of scarcity. 
The Nature Conservancy, May/June 1995: 6. 

SWOFFORD, D., 1998, PAUP' 4.0: phylogenetic 
analysis using parsimony (and other methods). 
Beta version. Sinauer Associates, Inc. 

SWOFFORD, D. L. & R. B. SELANDER, 1981, 
BIOSYS-1 : A fortran program for the comprehen- 
sive analysis of electrophoretic data in population 
genetics and systematics. Journal of Heredity, 
72: 281-283. 

TURGEON, D. D., J. F OUINN, JR, A. E. BOGAN, 
E. V. COAN, F G. HOCHBERG, W. G. LYONS, 
P M. MIKKELSEN, R. J. NEVES, C. F E. 
ROPER, G. ROSENBERG, В. ROTH, A. SCHEL- 
TEMA, F. G. THOMPSON, M. VECCHIONE & 



TAXONOMIC AMBIGUITY AND CONSERVATION 



101 



J. D. WILLIAMS, 1988, Common and scientific 
names of aquatic invertebrates from tlie United 
States and Canada: mollusl<s, second edition. 
American Fislieries Society, Special Publication, 
26, Bethesda, Maryland. 

U. S. FISH AND WILDLIFE SERVICE, 1998, En- 
dangered and threatened wildlife and plants: de- 
ternnination of endangered status for five fresh- 
water mussels and threatened status for two 
freshwater mussels from the eastern Gulf Slope 
drainages of Alabama, Florida, and Georgia. 
Federal Register 63: 12664-12687. 

WAPLES, R. S., 1991, Pacific salmon, On- 
corhynchus spp., and the definition of "species" 



under the endangered species act. Marine Fishi- 
eries Review, 53: 11-22. 

WILLIAMS, J. D., M. L. WARREN, JR., K. S. GUM- 
MINGS, J. L. HARRIS & R. J. NEVES, 1993, 
Conservation status of freshwater mussels of the 
United States and Canada. Fisheries, 18: 6-22. 

WILLIAMS, J. D. & R. S. BUTLER. 1994. Freshwa- 
ter bivalves. Pp. 48-128, in: м. deyrup & R. 
FRANZ, eds., R. E. ASHTON, JR., series ed.. Rare 
and endangered biota of Florida. Volume IV. In- 
vertebrates. University Press of Florida, Gaines- 
ville, Florida. 

Revised ms. accepted 1 September 2000 



MALACOLOGIA, 2001 , 43(1-2): 103-215 

A SURVEY OF THE EUROPEAN VALVATIFORM HYDROBIID GENERA, 

WITH SPECIAL REFERENCE TO HAUFFENIA POLLONERA, 1898 

(GASTROPODA: HYDROBIIDAE) 

Marco Bodon, Giuseppe Manganelli & Poico Giusti 

Dipartimento di Biología Evolutiva, Università di Siena, 
Via Mattioli 4, 1-53100 Siena, Italy; giustif@unisi.it 

ABSTRACT 

All the taxa of genus and species groups introduced for the European valvatiform hydrobiids 
are analyzed, and if possible revised. 

All the type species have been redescribed on the basis of new anatomical studies or data in 
the literature when spirit specimens were not available. This enabled the following taxa to be rec- 
ognized as junior synonyms of Hauffenia Pollonera, 1898 (type species Horatia (Hauffenia) 
tellinii PoWonera. 1898): Erythropomatiana Radoman, 1978 (type species Valvata erythropoma- 
tia Hauffen, 1856): Lobaunia Haase, 1993 (type species: Lobaunia danubialis Haase, 1993); 
Neohoratia Schutt, 1961 (type species Valvata (?) subpiscinalis Kuscer, 1932): and Vran/a Rado- 
man, 1978 (type species Valvata wagneri Kuscer, 1928). 

Of the species currently assigned to Hauffenia, only a few from the eastern Alps and Balkans 
actually belong to it: H. erythropomatia (Hauffen, 1856): H. /cerschner/ (Zimmermann, 1930): H. 
media Bole, 1961; H. subcarinata Bole & Velkovrh, 1987; H. subpiscinalis ( Kuscer, 1932); H. 
tellinii (Pollonera, 1898) (with H. michleh Kuscer, 1932, as junior synonym); H. tovunica Rado- 
man, 1978; H. wagneri (Kuscer, 1928); and H. wienerwaldensis Haase, 1992. Each is re- 
described. 

Many '^Hauffenia" species from the Balkans remain of uncertain generic status due to the ab- 
sence, or incompleteness of anatomical data. However, Horatia (Hauffenia) raefilei Schutt, 1980, 
is placed in the genus Fissuria Boeters, 1981 , on the basis of its anatomy. 

After anatomical study, most of the French "Hauffenia" have been assigned to Islamia Rado- 
man, 1973a, and tentatively to the following species: /. minuta (Draparnaud, 1805), /. globulina 
(Paladiihe, 1866), /. spirata (Bernasconi, 1985), and /. consolationis (Bernasconi, 1985). 
Anatomical study of the French "Horatia" exilis (Paladiihe, 1867) supports its allocation to a new 
genus: Heraultia, n. gen. 

The Spanish species currently assigned to "Horatia" or "Neohoratia" do not belong to these 
genera. Some of them, namely "Л/." afen/ (Boeters, 1969), "/V." globulus globulus (Bofill, 1909), 
and "Л/." g. /agar/ (Altimira, 1960), belong to Islamia. 

Diagnoses and keys are provided for the European valvatiform hydrobiid genera and for the 
species of Hauffenia, together with tables summarising their taxonomic status and distribution. 

Key words: Gastropoda, Caenogastropoda, valvatiform Hydrobiidae, taxonomy, systematics, 
geographical distribution, Europe. 



INTRODUCTION 

The European fauna is particularly rich in 
valvatifornn stygobiont hydrobiids (Radoman, 
1983; Bole & Velkovrh, 1986). The first 
species discovered were assigned to the het- 
erobranch valvatid genus Valvata Müller, 
1774, until the first hydrobiid genera were de- 
scribed. Since the 1950s, a plethora of new 
genera and new species have been intro- 
duced. This produced a puzzling taxonomic 
picture, with genera established on shell 
and/or few anatomical characters, frequent 
changes of rank of many supraspecific taxa. 



and species (including extra-European; see 
Bole & Velkovrh, 1986) assigned to genera on 
the basis of non-diagnostic characters. In an 
attempt to reduce this taxonomic chaos, we 
set out to revise all the taxa related to one of 
the oldest established genera, Hauffenia Pol- 
lonera, 1898. 

Hauffenia was introduced by Pollonera 
(1898) as a subgenus of Horatia Bourguignat, 
1887, for two new hydrobiids, collected by A. 
Tellini in the debris of the upper course of the 
Natisone River, Friuli, northeastern Italy: Ho- 
ratia tellinii and H. valvataeformis. 

Kuscer (1932, 1933a, b) ranked Hauffenia 



103 



104 



BODÓN, MANGANELLI & GIUSTI 



as a distinct genus, but this was not substan- 
tiated until Bole (1 970) studied the anatomy of 
H. tellinii and found that its genitalia were dif- 
ferent from that described by Radoman 
(1966) for the type species of Horatla. Bole 
(1970) listed three diagnostic characters of 
Hauffenia: (1) female genitalia with a small 
bursa copulatrix having short duct arising 
from the oviduct near where it enters the al- 
bumen gland (palliai oviduct), and a very 
small seminal receptacle arising from the 
renal oviduct where the oviduct loop ends: (2) 
male genitalia with a wide and flat penis; and 
(3) operculum with peg-like structure on its 
inner face. 

Boeters (1974) split Hauffenia into two sub- 
genera, Hauffenia (s. s.) and Neofioratia. the 
latter introduced by Schutt (1961a) as a sub- 
genus of Horatia for Valvata subpiscinalis 
Kuscer, 1932. Boeters (1974) regarded Neo- 
fioratia as a subgenus of Hauffenia because 
H. subpiscinalis shares the genital characters 
of the species of Hauffenia (s. s.), but it has no 
peg-like structure on the inner face of the op- 
erculum. 

Oddly, Radoman (1978, 1983) overlooked 
Neofioratia but divided Hauffenia into two 
subgenera: Hauffenia (s. s.) and Vrania Rad- 
oman, 1978 (type species: Valvata wagneri 
Kuscer, 1 928). the latter characterized only by 
an operculum with a thin edge and a small 
outgrowth on its inner face. Radoman (1978, 
1983) also introduced a number of new gen- 
era from the Balkans, one of these, Erytfiro- 
pomatiana Radoman, 1978 (type species: 
Valvata erytfiropomatia Hauffen, 1856), had 
an organization of the female genitalia similar 
to that of Hauffenia. 

Subsequently, Bole & Velkovrh (1986) and 
Boeters (1988, 1998) ranked Neofioratia as a 
distinct genus. Boeters (1 988, 1 998) probably 
based this assumption on the fact that three 
Iberian species and one French species, sup- 
posed by him to be congeneric with N. sub- 
piscinalis. had differently organized female 
genitalia: the sac-like structures arising from 
the renal oviduct are two seminal receptacles 
and not a bursa copulatrix and a seminal re- 
ceptacle, as in Hauffenia. Recently, Bole 
(1 993) re-examined the Slovenian taxa of this 
group, confirming Hauffenia, Erytfiropoma- 
tiana and Neofioratia as distinct genera, al- 
though they were characterized by rather in- 
significant anatomical characters. On the 
other hand, he treated Vrania as a junior syn- 
onym of Hauffenia, as proposed indepen- 
dently by Haase (1993). 



In this paper, we redescribe Hauffenia and 
define its relationships with nominal genera 
claimed to have similar anatomical organiza- 
tion (e.g., Erythropomatiana, Neofioratia. and 
Vrania). To do this, we first consider all the 
genera of the European valvatiform hydrobi- 
ids and redescribe their type species on the 
basis of literature and our own data. We also 
revise all the specific taxa assigned to these 
genera, claryifing which actually belong to 
Hauffenia and which belong to other genera. 
Each Hauffenia species is redescribed in the 
second section of the paper and a few mis- 
identified Hauffenia species are redescribed 
and discussed. 



MATERIAL AND METHODS 

Shells and live specimens were collected 
by sorting variable amounts of sediment from 
caves and springs. Unrelaxed material pre- 
served in 75% ethanol was studied by light 
microscopy (Wild M5A). Bodies were isolated 
after crushing the shells and were dissected 
using very fine, pointed watchmaker's for- 
ceps. Images of the body and isolated parts of 
the genitalia were drawn using a Wild camera 
lucida. Radulae were obtained by dissecting 
out buccal bulbs and soaking them in KOH 
solution to remove soft tissue. They were 
washed in distilled water, mounted on copper 
blocks with electronconductive glue, sputter- 
coated with gold, and photographed using a 
Philips 505 SEM. Shells and shell fragments 
were photographed under light and scanning 
electron microscopes. 

The anatomical parts are disposed as in life 
position. So when the penis is described, 
terms such as left, right, ventral and dorsal 
correspond to the left, right, ventral and dorsal 
sides of the snail in life position. When a struc- 
ture belonging to an organ is described, its 
position is indicated in relation to the proximal 
origin of the organ (e.g., "at about 2/3 of penis 
length" means about 2/3 of the distance from 
the base to the apex of penis). The terms 
used in the description are those recently pro- 
posed by Hershler & Ponder (1998), except 
for the following (parentheses-terminology of 
Hershler & Ponder, 1998): last whorl (body 
whorl); protoconch malleated (pitted or wrin- 
kled); right (outer) or left (inner) side of penis; 
seminal groove (ventral channel); lateral 
wings of central tooth (lateral margins); lamel- 
lae (filaments). We prefer these terms be- 
cause they are in current use by European 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



105 



authors or describe the aspect or function of 
the structure more exactly. 

In the description of the taxa, any reference 
to a structure will be omitted when its pres- 
ence/absence has been impossible to ascer- 
tain in an unequivocal manner (e.g., the hy- 
pobranchial gland) or when data in the 
literature is insufficient to allow their exact de- 
finition (e.g., the route of the penial duct). 

For identification of the different sac-like 
structures arising from the distal renal oviduct 
we adopted the following criteria, in the ab- 
sence of histological evidence: 

• the proximal seminal receptacle (PSR; sec- 
ond or RS2, according to Radoman, 1973b, 
1983) leaves the oviduct far from the bursa 
and level with the end of the oviduct loop; 

• the distal seminal receptacle (DSR; first or 
RS1, according to Radoman, 1973b, 1983) 
arises very close to the point where the 
oviduct enters the albumen gland (palliai 
oviduct) but proximally with respect to the 
bursa copulatrix; it is obviously easy to 
identify when the bursa is present; when 
the bursa is absent, it can be identified by 
the fact it arises further from where the 
oviduct enters the albumen gland than any 
bursa, and consequently lies in a position 
corresponding to that of the DSR in species 
that also have a bursa; 

• the bursa copulatrix (ВС) arises close to the 
point where the oviduct enters the albumen 
gland (palliai oviduct). 

When histological evidence exists, the 
bursa copulatrix (gametolytic gland) is a struc- 
ture that does not contain spermatozoa or 
contains few, non-oriented and partially di- 
gested spermatozoa (its contents are cen- 
trally located and never réfringent), whereas 
the seminal receptacle/s is/are the structure/s 
that contains/contain spermatozoa oriented 
with their heads anchored to the cells of the 
wall (Thompson & Bebbington, 1969; Giusti & 
Selmi, 1985). 

For histological study, the penis was fixed in 
75% ethanol, dehydrated, diaphanized with 
xylol, and mounted on microscope slides. The 
female genitalia (renal and palliai oviduct) 
were fixed in 75% ethanol, dehydrated, em- 
bedded in paraffin and cut serially; sections 
mounted on microscope slides were stained 
with haematoxylin-eosin. 

The material examined is listed as follows: 
locality name (municipality, district and/or 
country), UTM references, collector(s) and 
date (number of male and female specimens, 
shells, non-investigated specimens). 

Parsimony analysis was performed using a 



test version of PAUP (Version 4.0. b2 for Mac- 
intosh; Swofford, 1997). Tree search was per- 
formed using the heuristic search and the 
"collapse branches if minimum length is zero" 
options. The characters used for cladistic 
analysis were chosen on the list of Hershler & 
Ponder (1998). Only the type species of each 
genus was considered or, alternatively, that 
regarded to be the most closely related 
species, if the anatomy of the type species is 
not known. 

Much of the literature on the valvatiform hy- 
drobiids published after the fifties by S. 
Hadzisce and P. Radoman has questionable 
publication dates and conditions regarding the 
availability of the names. The main problem 
concerns the date of publication of two papers 
(one by Hadzisce and the other by Radoman) 
on the hydrobiids of Lake Ohrid. Radoman 
(1963a: 69; b: 85-86) claimed that Hadzisce 
paper was published in 1959 and his paper in 
1957: "Hadzisce's paper, although antedated 
to August, 1956, was actually issued only in 
April, 1959 (date taken from the inventory of 
the Hydrobiological Institute at Ohrid), while 
my paper was issued in October, 1957 (date 
taken from the inventory of the Publishing De- 
partment of Kolorac National University . . . 
in Beograd" (Radoman, 1963b: 86). Unfortu- 
nately, Radoman (1963a, b, 1973a, 1983) left 
room for confusion by continuing to cite the 
two papers with the putative year of publica- 
tion (1 956) and not the true year of publication 
(1957 for his paper, 1959 for Hadzisce's 
paper). This caused misinterpretation by sub- 
sequent authors dealing with the taxa estab- 
lished in these papers (Bole & Velkovrh, 1986; 
Jovanovic, 1991; Kabat & Hershler, 1993; 
Dhora & Welter-Schultes, 1996). 

We accepted 1957 as the date of publica- 
tion of Radoman's paper and 1 959 as the date 
of publication of Hadzisce's paper. In the case 
of species described by both authors, Rado- 
man's names therefore have priority over 
those of Hadzisce. Consequently Ohrigocea 
(Karevia) priitchevi Haözlsce, 1959, is a junior 
synonym of Pseudamnicola ornata Radoman, 
1957, and Ohridohoratia {Ohridohauffenia) 
gjorgjevici Hadzisce, 1959, is a junior syn- 
onym of Pseudamnicola depressa Radoman, 
1957. 

Other problems were caused by the fact 
that Radoman (1973a) established many 
nominal genera without a description or defin- 
ition but only by combining them with avail- 
able or new included nominal species. Some 
of these nominal genera were available at the 



106 



BODÓN, MANGANELLI & GIUSTI 



first introduction {Bracenica, Daphniola, Is- 
lamia and Strugia). others were only made 
available subsequently {Dolapla. Prespoll- 
torea and Zaumia), and others have never 
been made available [Naumia. Ohridostu- 
ranya and Rotondia). 

Key to acronyms in figures: AG, albumen 
gland; ВС, bursa copulatrix; C, ctenidium; 
CG, capsule gland: CS, cuticularized struc- 
ture (stylet); DSR, distal (first or RS1 ) seminal 
receptacle; FP, fecal pellets; GPD, gonopeh- 
cardial duct; HG, hypobranchial gland; I, in- 
testine; LO, loop of tfie oviduct; MP, muscular 
pleat; ОС, opercular crest; OE, oesophagus; 
OP, opercular peg; OS, osphradium; ОТ, op- 
ercular thickening; P, penis; PD, penial duct; 
PG, prostate gland; PGL, penial glandular 
lobe; PL, penial lobe; PSR, proximal (second 
or RS2) seminal receptacle; PW, posterior 
wall of palliai cavity; R, rectum; RC, mass of 
réfringent cells; S, stomach; SG, seminal 
groove; VD, vas deferens; VE, vas efferens 
(seminal vesicle). 



A SURVEY OF THE EUROPEAN 
VALVATIFORM HYDROBIID GENERA 

Arganiella Giusti & Pezzoli, 1980 

Arganiella G\usi\ & Pezzoli, 1980: 45. 
Type Species: Arganiella pescei G\us\.\ & Pez- 
zoli, 1980, by monotypy. 

Arganiella pescei G\us\i & Pezzoli, 1980 

Arganiella pescei Giusti & Pezzoli, 1980: 
45-46, fig. 19A-C. 

Type Locality: "reticoli di falda delle Marche, 
dell'Abruzzo e del Lazio (in questa re- 
gione limitatamente alia provincia di 
Rieti)", Italy. Restricted by Giusti & Pez- 
zoli (1981: 213) to: "Pozzo 163, lungo la 
SS 150, 32 m Sim, 42"30'13"N, 
01°27'55"E (versante orientale dell'Ap- 
pennino centrale, in provincia dell'Aquila, 
Abruzzo [Well no. 163, along state road 
no. 150, Km 9.8, altitude 32 m, 
42^30' 13"N, 0r^27'55"E, western side of 
central Apennines, province of L'Aquila, 
Abruzzo, Italy]" (actually, the restricted 
type locality is not in L'Aquila, but in Ter- 
amo). 

Type Material: holotype (shell) is in the Giusti 
collection, Siena, Italy; three paratypes 
(SMF 254290, shells) are at the Sen- 
ckenberg-Museum, Frankfurt am Main, 



Germany, and others (shells and pre- 
served specimens) in the Giusti and Pez- 
zoli collections, Milan, Italy (Giusti & Pez- 
zoli, 1981). 



Material Examined 

- Well no. P/1 63 along the state road 1 50, km 
9.8, Teramo, Abruzzo, Italy, 33T VH 12, 
R. Árgano & G. L. Pesce leg. 3.5.1975 (2 
males, 1 female, some shells) (Pesce & 
Silvehi, 1976). 

-Well no. P/1 61 near S. Petronilla, Roseto, 
Teramo, Abruzzo, Italy, 33T VH 12, R. 
Árgano & G. L. Pesce leg. 3.5.1975 (3 
males, 3 females, many specimens) 
(Pesce & Silverii, 1976). 

-Well no. P/42, state road 17, Centrada Buc- 
cella, L'Aquila, Abruzzo, Italy, 33T UG 69, 
G. L. Pesce leg. 16.12.1972 (1 male, 1 
specimen) (Árgano et al., 1975). 

-Well no. P/37, state road 17, turn-off to 
Sassa, before Raio Stream, L'Aquila, 
Abruzzo, Italy, 33T UG 59, G. L. Pesce 
leg. 9. 1976 (3 males, 5 females, many 
specimens) (Árgano et al., 1975). 

-S. Susanna springs, Rivodutri, Rieti, 
Latium, Italy, 33T UH 2307, M. Bodon 
leg. 12.4.1993 (5 shells), M. Bodon & G. 
Manganelli leg. 29.6.1995 (2 males, 1 fe- 
male, 7 shells). 

-Well no. R/23, Via Salaria, km 88.8, Rieti, 
Latium, Italy, 33T UG 29, G. L. Pesce leg. 
13.6.1973 (1 female) (Pesce & Fusac- 
chia, 1975). 

-Well no. R/28, Madonnella, Via Cicolana, 

Km 5.6, Rieti, Latium, Italy, 33T UG 29, 

G. L. Pesce leg. 13.6.1973 (1 male, 1 

specimen) (Pesce & Fusacchia, 1975). 

For other localities where only shells have 

been found see Giusti & Pezzoli (1981). 



Description 

Shell very small, valvatiform to planispiral, 
thin, pale whitish, glassy, transparent when 
fresh; surface of protoconch malleated; spire 
from rather raised to almost flat, consisting of 
2.75-3 rather rapidly growing convex whorls; 
last whorl large, dilated, more or less de- 
scending near aperture; umbilicus wide; aper- 
ture prosocline, roundish, sometimes pyri- 
form; peristome complete, slightly thickened, 
slightly reflected only at lower and columellar 
margin (Figs. 1, 10; Giusti & Pezzoli, 1980: 






FIGS. 1-9. Shell, operculum and anatomical details of Arganiella pescei G\us\\ & Pezzoli, 1980, from well 
no. P/37, state road 17, cross-roads for Sassa, before the Raio stream, L'Aquila, Abruzzo, Italy, G. L. Pesce 
leg. 9.1976 (Figs. 1-7) and shell and operculum of Daphniola exigua (Schmidt, 1856) from the spring 
Daphne in the Tembe valley, Thessalia, Greece, 7.1980, ex W.J. M, Maassen collection (Figs. 8-9). Figs. 1, 
8: shell; Figs. 2, 9: outer face (left), profile (centre in Fig. 2; right in Fig. 9) and inner face (right in Fig. 2) of 
operculum; Fig. 3: body of a male with palliai cavity open to show head and penis; Figs. 4, 5: penis of three 
males, dorsal side (left in Figs. 4, 5) and ventral side (right in Fig. 4); Fig. 6: renal and palliai oviduct, intes- 
tine and palliai organs of a female; Fig. 7: male genitalia (penis and testis excluded), intestine and palliai or- 
gans. Scale bar = 1 mm. 



108 



BODÓN, MANGANELLI & GIUSTI 



45, fig. 19A; 1981: 208-209, figs. 3, 7). Di- 
mensions: hieight = 0.85-1.05 mm: diameter 
= 1.65-2.00 mm. 

Operculum thin, yellowish white or yellow- 
ish orange, paucispiral, slightly thickened and 
often with a circular thickening at centre of 
inner face (Fig. 2: Giusti & Pezzoli, 1980: 45; 
1981:208, 213, fig. 2E). 

Body unpigmented; eye spots absent (Fig. 
3; Giusti & Pezzoli, 1980: 45, fig. 19B; 1981: 
208. 213. figs. IF. 2A). 

Male genitalia with prostate gland bulging 
slightly into palliai cavity: penis from short to 
elongated, flat, with sides corrugated, slightly 
dilated then tapering near apex, usually end- 
ing in very pointed tip; penis without lobes, but 
sometimes with a crest or a small swelling on 
ventral side near base; penial duct zig-zag- 
ging through right portion of penis, opening at 
penis tip (Figs. 4, 5, 7; Giusti & Pezzoli, 1980: 
45, fig. 1 9; 1 981 : 208-209, fig. 1 F-0). 

Female genitalia with distal seminal recep- 
tacle and a bursa copulatrix arising from distal 
renal oviduct; seminal receptacle rather de- 
veloped, arising from oviduct close to point of 
origin of duct of bursa copulatrix: bursa copu- 
latrix large, sac-like or kidney-shaped, with 
rather long duct entering on anterior side; 
seminal groove running along ventral side of 
capsule gland (Fig. 6; Giusti & Pezzoli, 1980: 
45. fig. 190: 1981: 208-209, fig. 1A-C). 

Radula with central tooth trapezoidal, with 
long lateral wings and basal tongue, its cutting 
edge V-like, with long robust central denticle 
and 5-6 smaller denticles on both sides in de- 
creasing order of size; two basal cusps at 
point where each lateral wing arises from face 
of central tooth; lateral teeth apically en- 
larged, their cutting edge with 9-11 denticles, 
central of which longer, larger; first marginal 
teeth with long lateral wing and elongated 
apex, its cutting edge with long row of 20-22 
small denticles; second marginal teeth with 
long, slender lateral wing and roundish, 
spoon-like apex with cutting edge carrying 
rather long row of 18-20 very small denticles 
(Giusti & Pezzoli, 1980: 45; 1981: 208-229, 
212. figs. 5A-D). 

Stomach without posterior caecum; intes- 
tine with well-developed, U- or S-like bend on 
palliai wall (Figs. 6, 7; Giusti & Pezzoli, 1980: 
fig. 190; 1981: 213, figs. 1A, B, 2A-D, F). 

Osphradium variable in size, oval or kidney- 
shaped; ctenidium consisting of 9-18 lamel- 
lae (Figs. 6, 7; Giusti & Pezzoli, 1980: 45, fig. 
190; 1981: 208, 213, figs. 1A-B, 2A, F). 

Nervous system unknown. 



Taxonomy 

The genus Arganiella is characterized by: 
shell very small, valvatiform to planispiral; op- 
erculum without peg; penis without lobes; fe- 
male genitalia with distal seminal receptacle 
and large, sac-like or kidney-shaped bursa 
copulatrix with anterior duct; central tooth with 
two pairs of basal cusps. It includes only the 
type species, which is endemic to the central 
Apennine, Italy. Another species, the French 
Valvata exilis Paladiihe, 1867, was erro- 
neously assigned to this genus by Bouchet 
(1990) (see "Description of a new valvatiform 
genus from France"). 

Bracenica Radoman, 1973a 

Bracenica Radoman, 1973a: 7, 20. 
Type Species: Bracenica spiridoni Radoman, 
1973a, by monotypy. 

Bracenica sp/r/don/ Radoman, 1973a 

Bracenica sp/Wdon/ Radoman, 1973a; 7, 20. 

Type Locality: "Spirov izvor, Podmeret, near 
Braceni, not far from Virpazar, Orna 
Gora", Montenegro. 

Type Material: lectotype (BEO 116, shell) at 
the Prirodnjacki Muzej u Beograd to- 
gether with a paralectotype (BEO 117, 
shell) (Jovanovic, 1991). 

Description 

Shell very small, valvatiform-planlspiral; 
surface of protoconch unknown; spire de- 
pressed, consisting of 2.75-3.25 rather 
rapidly growing convex whorls, first whorls 
slightly raised, last whorl large; umbilicus very 
wide, deep; aperture roundish to oval; peris- 
tome complete, thin, slightly reflected only at 
its lower and columellar margin (Radoman, 
1973a: 20; Radoman, 1983: 65, pi. 4, fig. 58; 
Jovanovic, 1991: pi. 4, fig. 26). Dimensions: 
height = 0.92-1 .18 mm; diameter = 1 .64-2.02 
mm (Radoman, 1983: table 4). 

Operculum thin, whitish with yellow central 
part and peg on inner face (Radoman, 1983: 
66). 

Body unpigmented; eye spots absent 
(Radoman, 1983: 66). 

Male genitalia with penis elongated and 
pointed, with one, evident, knob-like lobe on 
left side about half way along penis (Rado- 
man, 1973a: 20; 1983: 66, fig. 29). 

Female genitalia with two seminal recepta- 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



109 



cles and a bursa copulatrix arising from distal 
renal oviduct; proximal seminal receptacle 
very small; distal seminal receptacle very 
large, club-shaped; bursa copulatrix large, 
pyriform, with long slender duct that enters 
bursa on anterior side (Radoman, 1973a: 6, 
20; 1983:40, 66, fig. 29). 

Radula with central tooth with one pair of 
basal cusps; other details unknown (Rado- 
man, 1973a: 6; 1983:40). 

Stomach without posterior caecum; intes- 
tine unknown (Radoman, 1973a: 6; 1983: 40). 

Osphradium and ctenidium unknown. 

Nervous system with long pleuro-supraoe- 
sophageal and short pleuro-suboesophageal 
connectives (Radoman, 1983: 66). 

Taxonomy 

Radoman (1973a: 7, 20) established 
Bracenica without a description or definition 
but only giving a combined description of it 
and a single included new nominal species. 
This makes Bracenica available (ICZN, 1999: 
Art. 13.4). 

Bracenica is a little known genus character- 
ized by: shell very small, valvatiform-planispi- 
ral; operculum with peg; penis with one simple 
lobe; female genitalia with two seminal recep- 
tacles, distal larger than proximal, and large, 
pyriform bursa copulatrix with anterior duct. It 
contains only the type species from Montene- 
gro. 

Dabriana Radoman, 1974 

Dabriana Radoman, 1974: 81. 
Type Species: Dabriana bosniaca Radoman, 
1974, by original designation. 

Dabriana bosniaca Radoman, 1974 

Dabriana bosniaca Radoman, 1974: 81-84, 
figs. 1-3A-D. 

Type Locality: "Dabarska [Dabarska] pecina, 
neben dem Ursprung des Flüsschen 
Dabar, etwa 6 Km südlich der Stadt San- 
ski most, Bosnien". According to Rado- 
man (1983: 168), the type locality is 
"Dabarska [Dabarska] pecina (cave), by 
the source of the Dabar river, about 6 km 
south of the Sanski Most town". 

Type Material: the holotype and six paratypes 
(SMF 232168) are at the Senckenberg- 
Museum, Frankfurt am Main, Germany 
(Jovanovic, 1991). 



Description 

Shell very small, valvatiform, whitish, trans- 
parent when fresh; microsculpture of proto- 
conch unknown, surface of teleoconch with 
fine radial striations; spire moderately raised, 
consisting of 3.25-3.5 rapidly growing convex 
whorls; last whorl dilated, slightly descending 
near aperture; umbilicus moderately wide; 
aperture large, prosocline, roundish; peris- 
tome complete, slightly reflected only at col- 
umellar margin (Radoman, 1974: 81, fig. 1; 
1983: 167-168, pi. 11, figs. 201, 202; Jo- 
vanovic, 1991: pi. 10, fig. 6). Dimensions: 
height = 1 .85-2.1 8 mm; diameter = 2.06-2.49 
mm (Radoman, 1983: 208, table 9). 

Operculum probably without outgrowth, 
though not specified (Radoman, 1 974: fig. ЗА; 
1983: fig. 102A). 

Body unpigmented; eye spots absent; cau- 
dal tentacle at posterior apex of foot (Rado- 
man, 1974: 81, figs. 1, ЗА; 1983: 168, fig. 
102A, pi. 11, fig. 202). 

Male genitalia with penis conical elongated, 
without lobes; penial apex slender, pointed 
(Radoman, 1974: 82, fig. ЗА, В; 1983: 168, 
fig. 102A, В). 

Female genitalia with a seminal receptacle 
(probably distal) and a bursa copulatrix; sem- 
inal receptacle very large, ovoid, protruding 
posteriorly, with evident duct inserted halfway 
between end of oviduct loop and bursa copu- 
latrix duct; bursa copulatrix very small, ellipti- 
cal, with short duct entering bursa on anterior 
side; capsule gland divided in two parts, the 
anterior of which narrow; seminal groove run- 
ning all along ventral side of capsule gland 
(Radoman, 1974: 81-82, fig. 3C, D; 1983: 
167-168, fig. 102 C, D). 

Radula with central tooth trapezoidal with 
long lateral wings and basal tongue, its apical 
margin with robust central denticle and about 
6 smaller denticles on both sides in decreas- 
ing order of size; no basal cusp at point where 
lateral wing arises from face of central tooth; 
lateral teeth rake-like, apically enlarged, their 
anterior margin with about 6 large denticles, 
central of which larger; first marginal teeth 
rake-shaped, with a long lateral wing and 
elongated cutting edge with a long row of 
about 14 small denticles anteriorly; second 
marginal teeth scraper-shaped, with long 
slender lateral wing and roundish, spoon-like 
apex, cutting edge of which carrying rather 
long row of small denticles (Radoman, 1974: 
81, fig. 2; 1983: fig. 101). 

Stomach without posterior caecum; intes- 



110 



BODÓN, MANGANELLI & GIUSTI 




FIGS. 10-16. Microsculpture of protoconchs. Fig. 10: Arganiella pescei Giusti & Pezzoli, 1 980, from well no. 
P/37, state road 17, cross-roads for Sassa, before the Raio stream, L'Aquila, Abruzzo, Italy, G. L. Pesce leg. 
9.1976; Fig. 11: Daphniola exigua (Schmidt, 1856) from the spring Daphne in the Tembe valley, Thessalia, 
Greece, 7.1980, ex W. J. M. Maassen collection; Fig. 12: Hauffenia erythropomatia (Hauffen, 1856) from 
"Babja Luknja" cave, S. 35. Goricane, fvledvode, Slovenia, M. Bodon leg. 16.6.1985; Fig. 13: Fissuria boui 
Boeters, 1981, from the spring La Foux, Draguignan, Var, France, M. Bodon leg. 7.1.1990; Fig. 14: Hadziella 
ephippiostoma Kuscer, 1932, from the springs Mocilnik, Vrhnika, Slovenia, M. Bodon leg. 17.6.1985; Figs. 
15, 16: Hauffenia tellinii (PoWonera, 1898) from the spring between Spagnut and Biacis, upper Natisone val- 
ley, Pulfero, Udine, Fnuli-Venetia Julia, Italy, M. Bodon leg. 9.6.1985. Scale bar = 100 pm. 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



111 



tine unknown (Radoman, 1974: 82; 1983: 
166). 

Osphradium elliptical; ctenidlum absent 
(Radoman, 1974: 81; 1983: 168). 

Nervous system with very long pleuro- 
supraoesophageal and short pleuro-suboe- 
sophageal connectives (Radoman, 1974: 
81-82; 1983: 166). 

Taxonomy 

Dabriana is a little-known genus character- 
ized by: shell very small, valvatiform; opercu- 
lum without peg; foot with caudal tentacle; 
penis without lobes; female genitalia with 
large, probably distal, seminal receptacle and 
very small, elliptical bursa copulathx with an- 
terior duct; central tooth of radula without 
basal cusps. It contains only the type species 
from Bosnia-Herzegovina. 

Radoman (1983) dubiously places this 
genus in the Lithoglyphulidae, but Bole & 
Velkovrh (1986) and Kabat & Hershler (1993) 
assigned it to the Hydrobiidae. It shares some 
characters (central tooth of the radula without 
basal cusps; foot with caudal tentacle) with 
some marine rissooids. 

Da/maie//a Velkovrh, 1970 

Da/mate//a Velkovrh, 1970: 97, 103. 
Type Species: Dalmatella sketi Velkovrh, 
1970, by original designation. 

Dalmatella sketi \/e\ko\/rh, 1970 

Dalmatella s/cef/ Velkovrh, 1970: 97-98, 103, 
fig. 1A-D. 

Type Locality: "izvir pri odtoku Krke izpod 
elektrarne pod Skradinskim Bukom 
(Sibenik, Dalmacija)", Croatia. It corre- 
sponds to the "spring under power sta- 
tions near Skradinski Buk on the river 
Krka" (Bole & Velkovrh, 1986: 190). 

Type Material: holotype (9075/1) in the 
Velkovrh collection, Ljubljana, Slovenia, 
together with three paratypes (9075/2-4) 
(Velkovrh, 1970). 

Description 

Shell very small, valvatiform, keeled, con- 
vex above, rather flat below, transparent 
when fresh; microsculpture of protoconch un- 
known; spire rather raised, consisting of 3.66 
rather rapidly growing whorls; last whorl large, 



trapezoidal in outline, with marked, rather 
sharp peripheral keel at base, slightly dilated, 
descending near aperture; umbilicus wide; 
aperture prosocline, oval to roundish, with 
sort of beak at keel; peristome complete, sin- 
uous, not thickened, slightly reflected only at 
lower and columellar margin (Velkovrh, 1970: 
97-98, 103, fig. 1 A-D; Bole & Velkovrh, 1986, 
fig. 15). Dimensions: height = approximately 
1.6 mm; diameter = approximately 2.2 mm 
(Velkovrh, 1970:98). 
Operculum and anatomy unknown. 

Taxonomy 

A relatively unknown genus, including only 
the type species and another undeschbed en- 
tity (Bole & Velkovrh, 1986), both from Croa- 
tia. Dalmatella is listed as a distinct taxon, but 
due to lack of anatomical data, its validity is 
doubtful. 

Daphniola Radoman, 1973a 

Daphniola Radoman, 1973a: 8. 

Type Species: Daphniola graeca Radoman, 
1 973a, by monotypy. Daphniola graeca is 
a junior synonym of Valvata exigua 
Schmidt, 1856, according to Schutt 
(1980), and a junior synonym of Valvata 
(Cincinna) hellenica Westerlund, 1898, 
according to Reischütz & Sattmann 
(1993). 

Daphniola exigua (Schmidt, 1856) 

Valvata exigua Schmidt, 1856: 160. 

Type Locality: "Griechenland". Following the 
designation of the neotype by Schutt 
(1980), the type locality becomes "Thes- 
salien: mehrere kleine Quellen im Tem- 
pêtai in der Nähe der Bahnstation Agia 
Paraskeui". 

Type Material: neotype (SMF 262352, shell) 
in the Senckenberg-Museum, Frankfurt 
am Main, Germany (Schüft, 1980). 

Valvata (Cincinna) hellenica Westerlund, 
1898: 179. 

Type Locality: "Griechenland. Vyteria in Arka- 
dien". 

Type Material: lectotype (4667a, shell) in the 
Naturhistoriska Museet Göteborg, Göte- 
borg, Sweden, together with two paralec- 
totypes (4667b, shells) (Reischütz & 
Sattmann, 1993). 

Daphniola graeca Radoman, 1973a: 8, 22. 





FIGS. 17-34. Shell, operculum and anatomical details of Hauffenia erythropomatia {Haufíen, 1856) from thie 
spnng below "Babja Luknja"cave, Goricane, Medvode, Slovenia, M. Bodon leg. 16.6.1985 (Figs. 17-22) and 
of Fissuha bouiBoeters. 1981, from Fontaine de Vaucluse, Vaucluse, France, M. Bodon leg. 1.12.1984 (Figs. 
23-26, 28, 33), Source du Vivier, N.D. de Vaucluse, Auribeau-sur-Siagne, Alpes Maritimes, France, M. 
Bodon leg. 1.1.1991 (Figs. 27, 32), the spring La Foux, Draguignan, Var, France, M. Bodon leg. 7.1.1990 
(Figs. 29, 30), the spring La Fouan, Cháteauneuf Grasse, Alpes Maritimes, France, M. Bodon, E. Во & M. 
Sosso leg. 11.2.1994 (Fig. 31), the spring at the Gorges Mai Internet, Agay, Var, France, M. Bodon leg. 
31.12.1990 (Fig. 34). Figs. 17, 23: shell; Figs. 18, 26: outer face (left in Figs. 18,25) and profile (right in Fig. 
18) of operculum: Figs. 19, 24: body of a male with palliai cavity open to show head and penis; Figs. 20, 25: 
prostate gland, stomach (excluded in Fig. 25), intestine and palliai organs of a male; Figs. 21, 27: gonadal 
(excluded in Fig. 21), renal and palliai oviduct, intestine and palliai organs of a female; Fig. 22: penis; Figs. 
28, 29; renal and palliai oviduct in three females; Figs. 30-34: penis of four males, dorsal side (left) and ven- 
tral side (right). Scale bar = 1 mm. 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



113 



Type Locality: "spring Daphne, about 30 km 
north of Larissa, Greece". 

Type Material: lectotype (BEO 177, shell) in 
the Prirodnjacki Muzej u Beograd, to- 
gether with a paralectotype (BEO 178, 
shell) (Jovanovic, 1991). 

Material Examined 

-Daphne spring In Tembe valley, Thessalia, 
Greece, 7. 1980, exW. J. M. Maassen collec- 
tion (5 shells with dried soft parts). 

Description 

Shell very small, valvatiform-globose coni- 
cal; surface of protoconch malleated; spire 
well raised, consisting of 3-3.5 rather rapidly 
growing convex whorls; umbilicus small; aper- 
ture roundish to oval; peristome complete, its 
external margin thin, its columellar margin 
thickened, reflected (Figs. 8, 11; Schutt, 1962: 
164, fig. 5, as Horatia {Horatia) exigua; 
Schutt, 1980: 139-140, pi. 10a, fig. 41, as Ho- 
ratia {Daphniola) exigua; Radoman, 1973a: 
22, as Daphniola graeca; Radoman, 1983: 
84-85, pi. 5, fig. 87, as Daptiniola graeca; Jo- 
vanovic, 1991: pi. 6, fig. 44, as Daphniola 
graeca; Reischütz & Sattmann, 1993, pi. 8a, 
as Daphniola hellenica). Dimensions: height = 
1.22-1.52 mm; diameter = 1.30-1.40 mm 
(according to Schutt, 1962: 164, as Horatia 
(Horatia) exigua); height = 1 .1 -1 .3 mm; diam- 
eter = 1.0-1.2 mm (according to Radoman, 
1983: 203, table 5, as Daphniola graeca). 

Operculum thin, yellowish brown, paucispi- 
ral, slightly thickened at centre, without out- 
growth on inner face (Fig. 9; Schutt, 1962: 
163, as Horatia (Horatia) exigua; Radoman, 
1973a: 22, as Daphniola graeca; Schutt, 
1980: 140, as Horatia (Daphniola) exigua). 

Body pigmented; eye spots present 
(Schutt, 1962: 163, as Horatia (Horatia) ex- 
igua). 

Male genitalia with penis elongated and 
pointed, with slender lobe on left side at about 
half penis length (Radoman, 1973a: 22, as 
Daphniola graeca; Schutt, 1980: 140, as Hor- 
atia (Daphniola) exigua; Radoman, 1983: 
83-84, fig. 45, as Daphniola graeca). 

Female genitalia with two seminal recepta- 
cles and a bursa copulatrix (according to 
Radoman, 1973a, 1983; only one seminal re- 
ceptacle and bursa copulatrix, according to 
Schutt, 1980) arising from distal renal oviduct; 
proximal seminal receptacle markedly larger 



than distal; bursa copulatrix very large, oval, 
with long slender duct entering bursa on ante- 
rior side; seminal groove running along ven- 
tral side of capsule gland (Radoman, 1973a: 
6, 22, as Daphniola graeca; Schutt, 1980: 
140, as Horatia (Daphniola) exigua; Rado- 
man, 1983: 40, 83, fig. 45, as Daphniola 
graeca). 

Radula with central tooth with one pair of 
basal cusps; other details unknown (Schutt, 
1980: 140, as Horatia (Daphniola) exigua; 
Radoman, 1983: 40, as Daphniola graeca). 

Stomach without posterior caecum; intes- 
tine unknown (Radoman, 1973a: 6, as Daph- 
niola graeca; Radoman, 1983: 40, as Daph- 
niola graeca). 

Osphradium and ctenidium unknown. 

Nervous system with long pleuro-supraoe- 
sophageal and somewhat shorter pleuro-sub- 
oesophageal connectives (Radoman, 1983: 
83, fig. 45, as Daphniola graeca). 

Taxonomy 

Radoman (1973a: 8, 22) established Daph- 
niola without a description or definition but 
gave a combined description of it and a single 
included new nominal species which makes 
this nominal genus available (ICZN, 1999: Art. 
13.4). Thus, Daphniola Schutt, 1980 (type 
species: Valvata exigua Schmidt, 1856), is a 
junior homonym and a junior synonym of 
Daphniola Radoman, 1973a. 

Daphniola is here considered a distinct 
genus. However, some of its anatomical de- 
tails are unknown and its relationships to 
other Balkan genera (Horatia Bourguignat, 
1887, in particular), require further study. 
Daphniola is characterized by: shell very 
small, valvatiform; operculum without peg; 
penis with one simple lobe; female genitalia 
with two seminal receptacles, proximal larger 
than distal, and very large, oval bursa copula- 
trix with anterior duct. 

According to Schutt (1980), Daphniola 
graeca Radoman, 1973a (p. 22) (type locality: 
"spring Daphne, about 30 km north of Larissa, 
Greece") is a junior synonym of Valvata ex- 
igua Schmidt, 1856. Reischütz & Sattmann 
(1993) claimed that the identity of the last 
nominal taxon was uncertain and proposed to 
use, for this species, Valvata (Cincinna) hel- 
lenica Westerlund, 1898. However, since 
Schutt (1980) designated a neotype for 
Schmidt's species, its identity is without prob- 
lems. 

Another Greek entity, Horatia (Daphniola) 



114 



BODÓN, MANGANELLI & GIUSTI 



exigua pangaea Reischütz, 1984, has been 
assigned to Daphniola. As the anatomy of this 
entity has never been studied, its inclusion in 
this genus requires confirmation. 



Eryihropomatiana Radoman, 1978 

Erythropomatiana Radoman, 1978: 35. 
Type Species: Valvata erythropomatia Häuf- 
ten, 1856, by original designation. 



Erythropomatiana erythropomatia 
(Hauffen, 1856) 

Valvata erythropomatia Hauffen, 1856: 465. 

Type Locality: "Görzaher Grotte (Gorizane)" 
[="Babja Luknja" cave], Slovenia. 

Type Material: type material is in the "Ver- 
sammlung der Musealmitglieder des 
Laibacher Museums," Ljubljana, Slove- 
nia (Hauffen, 1856). 



Material Examined 

-"Babja Luknja" cave, S. 35, Goricane, Med- 
vode, Slovenia, 33T VM 51, M. Bodon 
leg. 16.6.1985 (2 females). 

— Spring below "Babja Luknja" cave, fed by 
waters from the same cave, Goricane, 
Medvode, Slovenia, 33T VM 51, M. 
Bodon leg. 16.6.1985 (1 male, 3 females, 
10 shells). 

-"Marijno Brezno" or "Velika Gipsovka" cave, 
S. 6, Skofja Loka, Slovenia, 33T VM 
4613, F. Stoch leg. 11.1.1998 (1 juv. 
specimen). 



Description 

Shell very small, valvatiform, thin, pale 
whitish, waxen, transparent when fresh; sur- 
face of protoconch malleated; spire rather flat, 
consisting of 2.75-3.25 rather rapidly growing 
convex whorls; last whorl dilated, slightly de- 
scending near aperture; umbilicus wide; aper- 
ture prosocline, roundish; peristome com- 
plete, thin, slightly reflected only at columellar 
margin (Figs. 12, 17; Radoman, 1978: 35-36, 
pi. 5, figs. 18-19; 1983: 123, pi. 9, fig. 146, 
tab. 7; Bole & Velkovrh, 1986: fig. 18). Dimen- 
sions: height = 0.73-1.13 mm; diameter = 
1.17-1.55 mm. 

Operculum thin, yellowish, paucispiral, 
slightly thickened but without outgrowth on 



inner face (Figs. 18, 35; Radoman, 1978: 35; 
1983: 123; Bole, 1993: 8, fig. 2B). 

Body unpigmented; eye spots usually ab- 
sent (only one out of six specimens examined 
had eye spots) (Fig. 19; Bole, 1963: 121). 

Male genitalia with prostate gland bulging 
slightly into palliai cavity; penis rather short, 
flat, with apex blunt and 2-3 (or one, accord- 
ing to Bole, 1993: fig. 1С), small, rather evi- 
dent knob-like lobes on left side near apex; 
penial duct zig-zagging through central por- 
tion of penis to open at penis tip; large oval 
mass of réfringent cells inside penis apex to 
right of penial duct; terminal portion of penial 
duct (immediately before opening) with very 
small stylet (Figs. 20, 22; Radoman, 1978: 35, 
fig. 6; 1983: 123, fig. 68; Bole, 1993: 8, fig. 
1С). 

Female genitalia with proximal seminal re- 
ceptacle and a bursa copulatrix arising from 
distal renal oviduct; seminal receptacle, very 
small and with very short duct arising from 
oviduct level with end of loop; bursa copulatrix 
reduced, small but slightly longer than semi- 
nal receptacle, not or slightly dilated at apex, 
arising very close to point at which oviduct en- 
ters albumen gland portion of palliai oviduct; 
seminal groove running along entire ventral 
side of capsule gland (Fig. 21; Radoman, 
1978: 35, fig. 6; 1983: 123, fig. 68; Bole, 1993: 
8, fig IB). 

Radula with central tooth trapezoidal, with 
long lateral wings and basal tongue, its apical 
margin V-like, with long, robust central denti- 
cle and 5-6 smaller denticles on both sides in 
decreasing order of size; 1 -2 basal cusps at 
point where each lateral wing arises from face 
of central tooth; lateral teeth rake-like, apically 
enlarged, their anterior margin with 11-13 
denticles, central of which longer larger; first 
marginal teeth rake-shaped with long lateral 
wing and elongated cutting edge with long 
row of 23-25 small denticles anteriorly; sec- 
ond marginal teeth scraper-shaped, with long 
slender lateral wing and roundish, spoon-like 
cutting edge, its cutting edge carrying rather 
long row of 15-19 very small denticles (Figs. 
44-45; Radoman, 1978: 35; Bole, 1993: 8, 
fig. 2A). 

Stomach without posterior caecum; intes- 
tine with well developed, tightly coiled, S-like 
bend on palliai wall (Figs. 20, 21; Bole, 1963: 
122, fig. 2B; Radoman, 1978: 35; 1983: 40). 

Osphradium variable in size, oval or elon- 
gated, kidney-shaped; ctenidium consisting of 
6-11 lamellae (Figs. 20, 21; Bole, 1963: fig. 
3C; 1993:8, fig. 1A). 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



115 



Nervous system with long pleuro-supraoe- 
sophageal and short pleuro-suboesophageal 
connectives (Radoman, 1978: 35; 1983: 123). 

Taxonomy 

Erythropomatiana is here considered a ju- 
nior synonym of Hauffenia Pollonera, 1898 
(see "The status and relationships of Hauffe- 
nia"). Radoman (1978) introduced this genus 
for Valvata erythropomatia Hauffen, 1856. Al- 
though the anatomy of this species was 
nearly the same as that of the Hauffenia 
species, Erytfiropomatiana was regarded as 
distinct from the latter by Radoman (1983), 
Bole & Velkrovh (1986), and Bole (1993). 

Radoman (1978) included in Erythropoma- 
tiana another species from a different site, E. 
verdica Radoman, 1978, distinguished only 
by shell characters. This species is here rec- 
ognized as a junior synonym of Hauffenia 
subpiscinalis (Kuskcer, 1932) (see below). 

Fissuria Boaters, 1 981 

Fissuria Boeters, 1981: 57-58. 
Type Species: Fissuria boa/ Boeters, 1981 , by 
original designation. 

Fissuria boui BoeXers, 1981 

Fissuria bou/ Boeters, 1981 : 58-59, figs. 5-9, 
pi. 6, figs. 5-7. 

Type Locality: "Frankreich, Dép. Vaucluse 
bzw. Bouches du Rhône, Durance- 
Grundwasser". 

Type Material: the holotype (SMF 253580) is 
at the Senckenberg-Museum, Frankfurt 
am Main, Germany; paratypes are at the 
Senckenberg-Museum, Frankfurt am 
Main, Germany (SMF 253581), at the 
Nationaal Natuurhistorisch Museum, Lei- 
den, The Nederlands, and in the Boeters 
collection (124, 418, 761), München, 
Germany (Boeters, 1981). 

Material Examined 

— Fontaine de Vaucluse, Vaucluse, France, M. 

Bodon leg. 1.12.1984, 22.6.1989 (3 
males, 6 females, 8 shells). 

— Debris of Durance River near Orgon, 

Bouches du Rhône, France, M. Bodon 
leg. 1.12.1984 (28 shells). 

— La Foux spring, Draguignan (Var, France), 

32T KP 92, M. Bodon leg. 7.1.1990 (4 
males, 4 females, many shells). 



-Spring at the Gorges Mai Internet, Agay, 
Var, France, 32T LP 21, M. Bodon leg. 
31.12.1990 (2 males, 11 females). 

—Source du Vivier, N.D. de Vaucluse, Au- 
ribeau-sur-Siagne, Alpes Maritimes, 
France, 32T LP 3231, M. Bodon leg. 
1.1.1991 (5 males, 5 females, many 
shells). 

-La Fouan spring, Châteneuf Grasse, Alpes 
Maritimes, France, 32T LP 3737, M. 
Bodon, E. Во & M. Sosso leg. 11.2.1994 
(6 males, 9 females, many shells). 

-Source de la Foux, Mouans-Sartoux, Alpes 
Maritimes, France, M. Bodon leg. 
2.1.1999 (2 females, many shells). 

-Alluvial springs in the bed of the Var River, 
on the right bank, 100-200 m upstream 
of wells, la Tuilière, St-Laurent du Var, 
Alpes Maritimes, France, M. Bodon leg. 
2.1.1999(3 males, 1 shell). 

Description 

Shell very small, valvatiform, thin, whitish, 
glassy, transparent when fresh; surface of 
protoconch malleated; spire from well raised 
to almost flat, consisting of 2.75-3.5 rather 
rapidly growing convex whorls; last whorl 
rather large, slightly dilated descending near 
aperture; umbilicus of variable width; aperture 
prosocline, roundish to ovoid; peristome com- 
plete, rather thin, slightly reflected only at 
lower and columellar margin (Figs. 13, 23; 
Boeters, 1981: 58, pi. 6, figs. 5-7). Dimen- 
sions: height = 1.19-1.61 mm; diameter = 
0.93-1.77 mm. 

Operculum thin, yellowish, paucispiral, not 
thickened and without outgrowth on inner face 
(Fig. 26). 

Body unpigmented (a few traces of pigment 
in wall of visceral sac); eye spots absent (Fig. 
24). 

Male genitalia with prostate gland slightly 
bulging into palliai cavity; penis rather short, 
flat, with apex pointed and 3-4 (rarely 2) more 
or less evident raised lobes containing mass 
of glandular tissue; lobes of variable size and 
position: usually two lobes on left side and 
one on ventral side at about 2/3 of penis 
length; sometimes also one lobe on dorsal 
side near base of penis); penial duct zig-zag- 
ging through right portion of penis to open at 
penis tip (Figs. 25, 30-34; Boeters, 1981: 
57-58, figs. 5-8). 

Female genitalia with two seminal recepta- 
cles and a bursa copulatrix arising from distal 
renal oviduct; proximal and distal seminal re- 



116 



BODÓN, MANGANELLI & GIUSTI 



ceptacles more or less equal in size; bursa 
copulatrix variable, from very small (Boeters, 
1981) to rather large, oval, with proportionally 
more or less elongated, slender duct entering 
bursa on anterior side; seminal groove run- 
ning along ventral side of capsule gland (Figs. 
27-29; Boeters, 1981: 57-58, fig. 9). 

Radula with central tooth trapezoidal with 
long lateral wings and basal tongue; anterior 
margin with 9-11 denticles, central of which 
longer and larger; two basal cusps, outer of 
which very small, at point where each lateral 
wing arises from face of central tooth; lateral 
teeth rake-like, apically enlarged, their ante- 
rior margin with 10-11 denticles, central of 
which longer and larger; first marginal teeth 
rake-shaped, with long lateral wing and elon- 
gated cutting edge with long row of 22-26 
small denticles anteriorly; second marginal 
teeth scraper-shaped, with long slender lat- 
eral wing and roundish spoon-like apex, its 
cutting edge carrying rather long row of 20-24 
very small denticles (Figs. 46, 47). 

Stomach without posterior caecum; intes- 
tine with rather developed, tightly coiled, S- 
like bend on palliai wall (Figs. 25, 27; Boeters, 
1981, fig. 8). 

Osphradium variable in size, more or less 
elongated, oval or kidney-shaped; ctenidium 
consisting of 6-13 lamellae (Figs. 25, 27). 

Nervous system unknown. 

Taxonomy 

The genus Fissuria is characterized by: 
shell very small, valvatiform; operculum with- 
out peg; penis with 2-4 glandular lobes; fe- 
male genitalia with two seminal receptacles 
equal in size and bursa copulatrix oval and of 
variable size, with anterior duct; central tooth 
with two pairs of basal cusps. 

Beyond the type species, Fissuria includes 
an undescribed species from Liguria, Italy 
(Pezzoli, 1988a; Bodon et al., 1995b). Other 
two additional species are tentatively as- 
signed to this genus; "Fissuria" planospira 
Bodon, Cianfanelli & Talenti, 1997, from Tus- 
cany, Italy, by Bodon et al. (1997) and IHoratia 
(Hauffenia) raehlei Schutt, 1980, from 
Cephalonia I., Greece, in this paper (see 
below). 

Gocea Hadzisce, 1956 

Gocea Hadzisce, 1956: 496-499. 
Type Species: Gocea ohridana Hadzisce, 
1956, by original designation. 



Gocea otiridana Hadzisce, 1956 

Gocea ohridana Hadzisce, 1956: 496-499, 
figs. 1-4. 

Type Locality: "Ohridsee. Die Schnecke lebt 
in einem bis jetzt fast ununtersuchten 
Biotop des Sees, nämlich an den steini- 
gen Zonen der litoralen Region, und zwar 
nicht an den oberflächigen Steinen, son- 
dern tiefer unten an solchen . . .", Mace- 
donia. According to Radoman (1983: 81) 
the type locality is: "Lake Ohrid on the 
stones by Veli Dab, spreading the east 
lake bank". 

Type Material: Hadzisce (1956) did not give 
any information about the type material. 

Material Examined 

-Trepcja south of Ohrid, Lake Ohrid, Mace- 
donia, 34T DL 83, ex W. J. M. Maassen 
collection (2 shells with dried soft parts). 

Description 

Shell very small, valvatiform, ram-horn-like, 
partly despiralized; surface of protoconch pit- 
ted; spire from rather raised to almost flat, 
consisting of 2.75-3.25 rather rapidly growing 
convex whorls; last whorl large, despiralized, 
descending; umbilicus (in spiralized part of 
shell) rather large; aperture prosocline, irreg- 
ularly pyriform due to sinuous contour (upper 
margin extended forward, angled at upper 
vertex; external margin convex, very slightly 
angled at periphery; lower margin slightly ex- 
tended forward; columellar margin concave); 
peristome complete, thin, slightly reflected 
only at columellar margin (Fig. 53; Hadzisce, 
1956: 496-497, 499, figs, la-b, 2a; Hadzisce 
et al., 1976; 2-3, figs. 1-4; Maassen, 1980: 
pi. 17, figs. 29-30; Radoman, 1983: 81, pi. 5, 
figs. 79, 80; Bole & Velkovrh, 1986: fig. 20). 
Dimensions: height = 0.55-0.85 mm; diame- 
ter = 1 .20-1 .60 (Hadzisce, 1956: 499); height 
= 0.53-0.85 mm; diameter = 0.60-1.55 mm 
(Radoman, 1983: 203, table 5). 

Operculum reddish, multispiral and pecu- 
liarly spiralized on outer face to resemble 
screw; foot tissue penetrating hole at centre of 
inner face (Fig. 54; Hadzisce, 1956: 497-498, 
fig. 2b; Hadzisce, 1959: 87; Hadzisce et al., 
1976, fig. 1; Radoman, 1983: 81, fig. 42A). 

Body slightly pigmented; eye spots present 
(Hadzisce, 1956, fig. 4). 

Male genitalia with penis elongated and 
rather pointed, with slightly raised but evident 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



117 




FIGS. 35-43. Operculum and opercular structures of Hauffenia erythropomatia (Häuften, 1856) from the 
spring below "Babja Luknja" cave, Goricane, Medvode, Slovenia, M. Bodon leg. 16.6.1985 (Fig. 35); Hauf- 
fenia tellinii (Pollonera, 1898) from the spring Perilo, near Robic, Nadiza valley, Slovenia, M. Bodon leg 
9.6.1995 (Figs. 36, 37); Kerkia kusceh (Bole, 1961) from the spring of the Krka River, Krka, Slovenia, M 
Bodon leg. 16.6.1985 (Figs. 38, 39); Pseudohoratia ochridana (Polinski, 1929) from Lake Ohrid, Macedonia 
ex P. Radoman collection (Fig. 40), Hauffenia subpiscinalis (Kuscer, 1932) from the "¿else Jame" caves, S 
576, near Rakek, Slovenia, 3.3.1966, ex F Velkovrh collection (Fig. 41) and Hauffenia wagneri {Kuscer, 
1928) from the spring of the "Vranja pec" cave, Bostanj, Sevnica, Krso, Slovenia, M. Bodon leg. 14.6.1985 
(Figs. 42, 43). Figs. 35, 36, 38, 40-42: inner face of operculum; Figs. 37, 43: detail of opercular peg; Fig. 39 
detail of opercular crest. Scale bar = 100 цт. 



118 



BODÓN, MANGANELLI & GIUSTI 




FIGS. 44-52. Radula of Hauffenia erythropomatia (Hauffen, 1856) from "Babja Luknja" cave, S. 35, 
Goricane, Medvode, Slovenia, M. Bodón leg. 16.6.1985 (Figs. 44, 45), Fissuria ¿ou/ Boeters, 1981, from 
Fontaine de Vaucluse, Vaucluse, France, M. Bodon leg. 1.12.1984 (Figs. 46, 47), Hauffenia tellinii (PoWonera, 
1898) from the spring between Spagnut and Biacis, upper Natisone valley, Pulfero, Udine, Friuli-Venetia 
Julia, Italy, M. Bodon leg. 9.6.1985 (Figs. 48, 49) and Hauffenia subpiscinalis ( Kuscer, 1932) from the spring 
Obrh, Gorenje Jezero, Cerknica, Slovenia, M. Bodon leg. 19.6.1985 (Figs. 50-52). Figs. 44, 46, 48, 50: cen- 
tral part of radula; Figs. 45, 47: outer marginal teeth; Figs. 49, 52: lateral, inner and outer marginal teeth; Fig. 
51 : three central teeth. Scale bar = 5 |.im. 



lobe on left side near apex (as deduced from 
Hadzisce, 1956: 499, fig. 4a, and from Rado- 
man's, 1983; fig. 42D; but according to Rado- 
man's, 1983, description: "penis long, cylindri- 
cal, smooth, without any outgrowth") 
(Hadzisce, 1956: 499, fig. 4a; Radoman, 
1983: 81, fig. 42D). 

Female genitalia with two seminal recepta- 
cles and a bursa copulathx arising from distal 



renal oviduct; proximal and distal seminal re- 
ceptacles about same size; bursa copulathx 
large, kidney-shaped, with long slender duct 
entering bursa on anterior side; seminal 
groove running all along ventral side of cap- 
sule gland (Radoman, 1983: 81 , fig. 42B, C). 
Radula with central tooth trapezoidal with 
long lateral wings and basal tongue, its apical 
margin V-like, with long robust central denticle 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



119 





54 




FIGS. 53-59. Shell and operculum of Gocea ohridana Hadzisce, 1956, from Trepcja south of Ohrid, Lake 
Ohrid, Macedonia, exW. J. M. Maassen collection (Figs. 53, 54) and shell, operculum and anatomical de- 
tails of Hadziella ephippiostoma Kuscer, 1932, from the Mocilnik springs, Vrhnika, Slovenia, M. Bodon leg. 
17.6.1985 (Fig. 55) and the spring at Lozice, Deskle, Soca [Isonzo] valley, Slovenia, M. Bodon leg. 10.7.1996 
(Figs. 56-59). Figs, 53, 55-56: shell; Figs. 54, 57: outer face (left), profile (centre in Fig. 54; right in Fig. 57) 
and inner face (right in Fig. 54) of operculum; Fig. 58: penis; Fig. 59: male genitalia (penis and testis ex- 
cluded), intestine and palliai organs. Scale bar = 1 mm. 



120 



BODÓN, MANGANELLI & GIUSTI 



and 4-5 smaller denticles on both sides in de- 
creasing order of size; one basal cusp at point 
where each lateral wing arises from face of 
central tooth; lateral teeth rake-like, apically 
enlarged, their anterior margin with 10-11 
denticles, central of which longer and larger; 
first marginal teeth rake-shaped, with long 
lateral wing and elongated cutting edge with 
long row of about 20 denticles antenorly; 
second marginal teeth scraper-shaped, with 
long slender lateral wing and roundish spoon- 
like apex, its cutting edge carrying rather long 
row of small denticles (Hadzisce, 1956: 
498, fig. 3: Hadzisce et al., 1976: 13, figs. 18, 
19). 

Stomach without posterior caecum; intes- 
tine unknown (Radoman, 1983: 40). 

Osphradium and ctenidium unknown. 

Nervous system with long pleuro-supraoe- 
sophageal and somewhat shorter pleuro- 
suboesophageal connectives (Radoman, 
1983:81). 

Taxonomy 

Gocea is here considered a distinct genus. 
However some of its anatomical details are 
unknown, and its relationships to other Balkan 
genera require further study. Gocea is char- 
acterized: by shell very small, valvatiform, 
ram-horn-like, partly despiralized; operculum 
without peg but spiralized on outer face to re- 
semble screw; penis with one simple lobe; fe- 
male genitalia with two seminal receptacles 
equal in size and large, kidney-shaped bursa 
copulathx with anterior duct; central tooth with 
one pair of basal cusps. 

It includes only the type species, which is 
endemic to Lake Ohrid. 

Hadziella Kuscer, 1 932 

Hadziella Kuscer, 1932: 54. 
Type Species: Hadziella ephippiostoma 
Kuscer, 1932, by monotypy. 

Hadziella ephippiostoma Kuscer, 1932 

Hadziella ephippiostoma Kuscer, 1932: 54- 

55, pi. 3, figs. 4a, b. 
Type Locality: "Quelle bei Podgora", Ljubljan- 

ica basin, Slovenia. 
Type Material: holotype (2004a) in the Kuscer 

collection, Institute of Biology, University 

of Ljubljana, Ljubljana, Slovenia (Kuscer, 

1932). 



Material Examined 

-Mocilnik springs, Vrhnika. Plentiful karstic 
springs which feed the Ljubljanica River, 
Slovenia, 33T VL 49, M. Bodon leg. 
17.6.1985 (32 shells). 

-Springs near the right bank of Verd Stream, 
upstream of Verd village, Vrhnika. Plenti- 
ful karstic sphngs, Slovenia, 33T VL 48, 
M. Bodon leg. 17.6.1985 (9 shells). 

-Obrh spring, Gorenje Jezero, Cerknica. 
Plentiful karstic spring in the Cerknisko 
Lake basin (the waters flow underground 
to feed the Rak River), Slovenia, 33T VL 
56, M. Bodon leg. 19.6.1985 (6 shells). 

-Cemun spring, Gorenje Jezero, Cerknica, 
Slovenia, 33T VL 56, M. Bodon leg. 
19.6.1985(3 shells). 

-Spring near Lozice, along road to Kanal, 
Soca valley, Slovenia, 33T UM 9201, M. 
Bodon leg. 10.7.1996 (1 male, many 
shells). 

Description 

Shell very small, planispiral, concave on 
both sides, whitish, glassy, transparent when 
fresh; microsculpture of protoconch consist- 
ing of spiral rows of minute, more or less elon- 
gated knobs; spire flat, consisting of 3-3.25 
rather rapidly growing whorls; external wall of 
last whorl flat obliquely with sort of obtuse 
keel at base, large, dilated, descending 
slightly near aperture; aperture prosocline, 
oval-triangular (slightly angled between col- 
umellar and external, external and lower and 
lower and columellar margin); peristome com- 
plete, thickened, reflected (Figs. 14, 55, 56; 
Kuscer, 1932: 54-55, pi. 3, figs. 4a, b; Bole, 
1963: 124, Fig. 4A, B; Maassen, 1975: pi. 27, 
figs. 9, 10; Bole & Velkovrh, 1986: fig. 21). Di- 
mensions: height = 0.51-0.56 mm; diameter 
= 1.43-1.75 mm. 

Operculum thin, multispiral, concave, with 
very reduced outgrowth at centre of inner face 
(Fig. 57; Bole, 1993: 13, 15, fig. 3D). 

Body unpigmented (a few traces of pigment 
in wall of visceral sac); eye spots absent. 

Male genitalia with entire prostate gland 
bulging into palliai cavity; penis slightly elon- 
gated, conical, with sides corrugated, tapering 
near apex, ending in pointed tip; penial duct 
zig-zagging through right portion of penis to 
open at penis tip (Figs. 58, 59; Bole, 1993: 13, 
15, fig. 3C). 

Female genitalia with only one (?) sac-like 
structure (bursa copulatrix) arising from distal 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



121 




FIGS. 60-66. Shell, operculum and anatomical details of Hadziella ani/ Schutt, 1960, from the "Bus de I'Ors" 
cave, no. 64 FR, Cornappo valley, Udine, Friuli-Venetia Julia, Italy, 33T UM 6923, M. Bodón & F Stoch leg. 
23.7.96. Fig. 60: shell; Fig. 61: body of a female with palliai cavity open to show head; Fig. 62: outer face 
(left), profile (centre) and inner face (right) of operculum; Fig. 63: dorsal side of penis; Fig. 64: male genitalia 
(penis and testis excluded), intestine and palliai organs; Figs. 65, 66: renal and palliai oviduct, intestine and 
palliai organs of a female. Scale bar = 1 mm. 



122 



BODÓN, MANGANELLI & GIUSTI 



renal oviduct: bursa copulatrix large, shoe- 
shaped, with rather long, wide duct entering 
bursa on posteroventral side; seminal recep- 
tacle absent (?): according to Bole (1993), its 
function carried out by portion of renal oviduct 
level with end of loop (from where proximal 
seminal receptacle usually arises); seminal 
groove running along ventral side of capsule 
gland (Bole, 1993: 13, 15, fig. 3C). 

Radula with central tooth trapezoidal with 
long lateral wings and basal tongue, its apical 
margin with long robust central denticle and 
about 4 smaller denticles on both sides in de- 
creasing order of size: one basal cusp at point 
where each lateral wing arises from face of 
central tooth; lateral teeth rake-like, apically 
enlarged, their anterior margin with many 
small denticles, central of which longer and 
larger: first marginal teeth rake-shaped, with 
long lateral wing and elongated cutting edge 
with long row of small denticles anteriorly; 
second marginal teeth scraper-shaped, with 
long and slender lateral wing and roundish, 
spoon-like apex, its cutting edge carrying 
rather long row of very small denticles (Bole, 
1993: 13, 15, fig. 3E). 

Stomach without posterior caecum; intes- 
tine with a twisted bend near the style sac and 
well developed, tightly coiled, Z-like bend on 
palliai wall (Fig. 59; Bole, 1993: 13, 15, fig. 
3B). 

Osphradium oval; hypobranchial gland well 
developed: ctenidium absent (Fig. 59; Bole, 
1993: 13, 15, fig. ЗА). 

Nervous system unknown. 

Taxonomy 

The genus Hadziella is characterized by: 
shell ven/ small, planispiral, concave on both 
sides; operculum with very reduced peg; 
penis without lobes; female genitalia with dis- 
tal seminal receptacle and large, shoe- 
shaped bursa copulatrix with posteroventral 
duct; central tooth with one pair of basal 
cusps. 

The description of the female anatomy of 
Hadziella is entirely based on Bole's (1993) 
study of the type species. Dissection of fe- 
males of H. anti (Figs. 60-66) confirmed 
some of the characters ascertained by Bole 
(1993) (bursa copulatrix large, shoe-shaped, 
duct entering bursa on posteroventral side), 
but also revealed others that were not de- 
scribed (palliai oviduct and bursa copulatrix 
entirely inside the palliai cavity). Some char- 
acters seem to distinguish H. anti (oviduct 



loop absent; seminal receptacle arising from 
renal oviduct close to point from where duct of 
bursa copulatrix arises) from H. ephippios- 
toma. Because H. anti and H. ephippiostoma 
are closely related (they share many shell and 
anatomical characters), the seminal recepta- 
cle and oviduct loop are presumably similar 
as well. The type species should therefore be 
reinvestigated. 

Apart from the type species, Hadziella in- 
cludes six other species from northeastern 
Italy and the northwestern Balkans: H. anti 
Schutt, 1960; H. deminuta Bole, 1961; H. 
krkae Bole, 1992; H. rudnicae Bole, 1992; H. 
sketi Во\е, 1961; and H. thermalis Bole, 1992 
(Bole & Velkovrh, 1986; Bole, 1992); another 
undescribed entity is cited by Bole & Velkovrh 
(1986). 

Hauffenia Pollonera, 1898 

Hauffenia Pollonera, 1898: 3, as a subgenus 
of Horatia. 

Type Species: Horatia (Hauffenia) tellinii Pol- 
lonera, 1898, by subsequent designation 
(Walker, 1918). 

Hauffenia te///n// (Pollonera, 1898) 

Horatia (Hauffenia) tellinii Pollonera, 1898: 

3-4, fig. 2. 
Type Locality: "L'alta valle del Natisone nel 

Friuli", Italy. 
Type Material: Pollonera (1898) did not give 

any information about the type material. 

The Pollonera collection is at the Museo 

Regionale di Scienze Naturali di Torino, 

but the syntypes of this species have not 

been traced (E. Gavetti, pers. com., 

27.11.1997). 
Horatia (Hauffenia) valvataeformis Pollonera, 

1898:3-4, fig. 3. 
Type Locality: 'Talta valle del Natisone nel 

Friuli", Italy. 
Type Material: Pollonera (1898) did not give 

any information about the type material. 

The Pollonera collection is at the Museo 

Regionale di Scienze Naturali di Torino, 

but the syntypes of this nominal taxon 

have not been traced (E. Gavetti, pers. 

com., 27.11.1997). 
Hauffenia micfileri Kuscer, 1932: 56-57, pi. 5, 

fig. 3. 
Type Locality: "Ljubljanica quellen Mocilnik", 

Slovenia. 
Type Material: holotype (2005a) in the Kuscer 

collection, "Zoologischen Institut der Uni- 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



123 




FIGS. 67-80. Shell, operculum and anatomical details of Hauffenia ie///n// (Pollonera, 1898) from debris of 
Natisone River, Paderno, Premariacco, Udine, Friuli-Venetia Julia, Italy, M. M. Giovannelli leg. 5. 1988 (Figs. 
67, 70), from the spring Perilo, near Robic, Nadiza valley, Slovenia, M. Bodon leg. 9.6.1995 (Figs. 68, 80), 
from the spring between Spagnut and Biacis, upper Natisone valley, Pulfero, Udine, Friuli-Venetia Julia, Italy, 
M. Bodon leg. 23.9.1993, 9.6.1985 (Figs. 69, 72-74, 77, 79), from the spring at Tarpezzo, Alberone valley, 
S. Pietroal Natisone, Udine, Friuli-Venetia Julia, Italy, M. Bodon leg. 1.4.1991 (Fig. 71) and from the springs 
of Timavo River, S. Giovanni al Timavo, Duino-Aurisina, Trieste, Friuli-Venetia Julia, Italy, M. Bodon leg. 
31.3.1991 (Figs. 75, 76, 78). Fig. 67: shell; Figs. 68-71: outer face (Fig. 68 left), profile (Fig. 68 centre; Figs. 
69-71) and inner face (Fig. 68 right) of operculum; Fig. 72: body of a male with palliai cavity open to show 
head and penis; Figs. 73-75: dorsal side of penis of eight males; Figs. 76, 77: prostate gland, stomach, in- 
testine and palliai organs of two males; Figs. 78, 79: renal and palliai oviduct, intestine and palliai organs of 
two females; Fig. 80: renal and palliai oviduct of a female. Scale bar = 1 mm (67-72, 74-80); = 0.5 mm (73). 



124 



BODÓN, MANGANELLI & GIUSTI 




FIGS. 81 -86. Shell, operculum and anatomical details of Hauffenia michleri Kuscer, 1932, (junior synonym 
of H. tellinii) from the Mocilnik springs, Vrhnika, Slovenia, M. Bodon leg. 17.6.1985 (Fig. 81) and the spring 
on right bank of the Verd brook, near the Verd spring, Vrhnika, Slovenia, M. Bodon leg. 17.6.1985 (Figs. 
82-86). Fig. 81 : shell; Fig. 82: outer face (left), profile (centre) and inner face (right) of operculum; Fig. 83: 
body of a male with palliai cavity open to show head and penis; Fig. 84: dorsal side (first picture on left and 
last two on right) and ventral side (second picture) of penis of three males; Fig. 85: prostate gland, stomach, 
intestine and palliai organs of a male; Fig. 86: renal and palliai oviduct, intestine and palliai organs of a fe- 
male. Scale bar = 1 mm. 



versität Ljubljana", Slovenia (Kuscer, 
1932). 

Material Examined 

- Perilo spring, Robic, upper Nadiza [Nati- 

sone] valley, Slovenia, 33T DM 8522, M. 
Bodon leg. 9.6.1995 (1 female, many 
shells). 

- Alluvial springs on left bank of the Nadiza 

River, 250 m upstream from the gorge, 
Hurja, Potoki, Slovenia, 33T UM 8323, M. 



Bodon, S. Cianfanelli & G. Manganelli 
leg. 25.7.1996 (1 male, 1 female, 4 
shells). 

-Alluvial springs on the right bank of the 
Nadiza River, at the km 37 milestone on 
the road to Kobarid, Slovenia, 33T UM 
8422, M. Bodon & I. Misic leg. 15.7.1996 
(1 male). 

-Plentiful spring 1.1 km from the Italy-Slove- 
nia border, welling out below the road in 
the upper Natisone valley (Pulfero, 
Udine, Friuli-Venetia Julia, Italy), 33T UM 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



125 



8318, M. Bodon leg. 1.4.1991 (1 female, 
many shells). 

-Spring between Spagnut and Biacis, upper 
Natisone valley, Pulfero, Udine, Friull- 
Venetia Julia, Italy, 33T UM 8211, M. 
Bodon leg. 23.9.1993, 9.6.1985, 
1.4.1991 (11 males, 3 females, many 
shells) (Pezzoli, 1988a). 

-Cave of S. Giovanni d'Antro no. 43 Fr, 
Pulfero, Udine, Friuli-Venetia Julia, Italy, 
33T UM 8212, M. Bodon leg. 22.9.1983 
(many shells), F Gaspare & F Stoch leg. 
19.7.1992 (2 females, 3 shells). 

-Mustig spring, Vedronza, Torre valley, Lu- 
severa, Udine, Friuli-Venetia Julia, Italy, 
33T UM 6524, M. Bodon, M. M. Giovan- 
nelli & F Stoch leg. 22.7.1989 (1 female, 
10 shells). 

-Spring at Tarpezzo, Alberone valley, welling 
below the road and flowing through the 
village, S. Pietro al Natisone, Udine, 
Friuli-Venetia Julia, Italy, 33T UM 8411, 
M. Bodon leg. 8.6.1985 (4 shells), 
1.4.1991 (4 males, 1 female, many 
shells) (Pezzoli, 1988a, cited, in part, as 
Islamia sp.). 

-Plentiful spring 1 km downstream from Bod- 
igoi, Ludrio valley, welling below the road, 
Prepotto, Udine, Friuli-Venetia Julia, 
Italy, 33T UM 8402, M. Bodon leg. 
1.4.1991 (1 female, many shells). 

-Spring 700 m upstream of Podresca, Ludrio 
valley, Prepotto, Udine, Friuli-Venetia 
Julia, Italy, 33T UM 8905, M. Bodon leg. 
7.7.1993 (3 males, 1 female, many 
shells). 

-Spring near Podclanz at the turn-off for 
Salamant, Ludrio valley, Prepotto, Udine, 
Friuli-Venetia Julia, Italy, 33T UM 9107, 
M. Bodon leg. 7.7.1993 (1 male, 1 fe- 
male, many shells). 

-Alluvial springs on the right bank of the Torre 
River, 100-200 m upstream from of the 
confluence of Isonzo, Papariano, Fiumi- 
cello, Udine, Friuli-Venetia Julia, Italy, 
33T UL 7774, M. Bodon leg. 27.7.1996 (1 
male, 5 females, 5 shells). 

-Alluvial springs on the right bank of the 
Isonzo River, under the railway viaduct, 
Papariano, Fiumicello, Udine, Friuli- 
Venetia Julia, Italy, 33T UL 7774, M. 
Bodon leg. 27.7.1996 (2 males and 1 fe- 
male). 

-Springs of the Timavo River, S. Giovanni al 
Timavo, Duino-Auhsina, Trieste, Friuli- 
Venetia Julia, Italy, 33T UL 9071, M. 



Bodon leg. 31.3.1991 (6 males, 2 fe- 
males, many shells) (Stammer, 1932; 
Pezzoli, 1988a). 

—Alluvial spring near Molin del Cucco, Rivoli 
di Osoppo, Osoppo, Udine, Friuli-Venetia 
Julia, Italy, 33T UM 4921 , S. Cianfanelli & 
M. Calcagno leg. 29.12.1998 (1 male). 

-"Grotta de la Foos" cave, no. 229 Fr, Cam- 
pone, Tramonti di Sotto, Pordenone, 
Friuli-Venetia Julia, Italy, 33T UM 3124, 
M. Bodon & F Stoch leg. 7.7.1991, 
15.7.1993 (1 male, 1 female, 2 shells) 
(Pezzoli, 1988b, 1989). 

-"Grotta I Landri" cave, no. 1254 V, Colli di 
Conegliano, San Pietro di Feletto, Tre- 
viso, Venetia, Italy, 33TTL8585, F Stoch 
leg. 15.7.1999 (1 juv. specimen). 

-Spring on the right bank of the Idrijca 
Stream, near Ukovnik, Spodnja Idrija, 
Slovenia, 33T VM 20, F Gasparo e F 
Stoch leg. 5.6.1993 (1 male, 1 female, 1 
shells). 

-Mocilnik springs, the main Ljublianica 
source near Vrhnika (type locality of 
Hauffenia michlen), Slovenia, 33T VL 49, 
M. Bodon leg. 17.6.1985 (1 female, many 
shells). 

-Springs on the right bank of Verd brook, 
Vrhnika, Slovenia, 33T VL 48, M. Bodon 
leg 17.6.1985 (3 males, 1 females, many 
shells). 

Other shells with operculum were examined 
from the following localities: 

-Spring "La Santissima" of the Livenza River, 
Polcenigo, Pordenone, Friuli-Venetia 
Julia, Italy, 33T UL 0499, M. Bodon leg. 
28.3.1991 (1 shell) (Pezzoli, 1988a). 

-Debris of Barcis lake, Barcis, Pordenone, 
Friuli-Venetia Julia, Italy, 33T UM 1318, 
M. Bodon leg. 8.7.1991 (1 shell). 

-Spring on the right bank of a stream affluent 
of the Pontaiba Stream, Colle di Pinzano, 
Pinzano, Pordenone, Friuli-Venetia Julia, 
Italy, 33T UM 4118, M. Bodon & F Stoch 
leg. 15.7.1993(1 shell). 

-Spring along the road upstream Casiacco, 
Arzino valley, Vito d'Asio, Pordenone, 
Friuli-Venetia Julia, Italy, 33T UM 4221, 
M. Bodon & F Stoch leg. 15.7.1993 (1 
shell). 

— Debris of the Tagliamento River, Ponte 

della Delizia, Valvasone-Codroipo, Por- 
denone-Udine, Friuli-Venetia Julia, Italy, 
33TUL3792,M. Bodon leg. 27.4.1986(1 
shell) (Pezzoli, 1988a). 

— Peschiera spring, Vedronza, Torre valley. 



126 



BODÓN, MANGANELLI & GIUSTI 



Lusevera, Udine, Fhuli-Venetia Julia, 
Italy. 33T UM 6524, M. Bodón leg. 
24.9.1983 (1 shell) (Pezzoli, 1988a). 

— Springs on left bank of Vedronza River, 

Casera Morandin, Lusevera, Udine, 
Fhuli-Venetia Julia, Italy, 33T UM 6425, 
M. Bodón leg. 24.9.1983 (1 shell) (Pez- 
zoli, 1988a). 
-Debris of the Natisone River, Paderno, Pre- 
mariacco, Udine, Friuli-Venetia Julia, 
Italy. 33T UM 7600. M. M. Giovannelli, 
leg. 5.1988(1 shell). 

— Spring between Robic and Suzid, Slovenia, 

33TUM8721, M. Bodon leg. 9.6.1985(1 
shell). 

-Springs downstream from Liessa, Cosizza 
valley. Grimacco, Udine, Friuli-Venetia 
Julia, Italy, 33T UM 9012, M. Bodon leg 
1.4.1991 (1 shell). 

-Springs on right bank of the Grivö Stream 
Canal di Grivô, Faedis. Udine, Friuli- 
Venetia Julia, Italy, 33T UM 7314, M 
Bodon leg. 8.7.1983(1 shell). 

-Debris of the Isonzo River, Peteano 
Sagrado d'Isonzo, Gorizia, Friuli-Venetia 
Julia. Italy, 33T UL 8783, M. Bodon leg 
20.6.1985 (1 shell) (Bodon & Giovannelli 
1994; Pezzoli, 1988a). 

-Debris of the Isonzo River, Papariano, Fiu 
micelio, Udine, Friuli-Venetia Julia, Italy, 
33T UL 7774, M. Bodon leg. 21.9.1983 
20.6.1985 (5 shells) (Bodon & Giovan- 
nelli, 1994; Pezzoli, 1988a). 

-Spring on right bank of the Idrijca Stream, 
upstream from Podroteja, Idrija, Slove- 
nia, 33T VL 29, M. Bodon leg. 13.7.1996 
(5 shells). 

Shell material from the type locality was col- 
lected in the following place: 

-Debris of the Natisone River, upstream Lin- 
der, Pulfero, Udine, Friuli-Venetia Julia, 
Italy, 33T UM 8216, M. Bodon leg. 
23.9.1983 (8 shells) (Pezzoli, 1988a). 

For other localities where only shells were col- 
lected see Pezzoli (1988a. 1996). 

Description 

Shell very small, valvatiform to planispiral, 
thin, pale whitish, waxen, transparent when 
fresh; surface of protoconch malleated; spire 
from rather raised to almost flat, consisting of 
2.5-3.5 rapidly growing convex whorls; last 
whorl large, dilated, more or less descending, 
sometimes slightly detached near aperture; 
umbilicus wide, about 1/6-1/3 of shell di- 



ameter; aperture more or less prosocline, 
roundish to pyriform; peristome complete, thin 
and not or slightly reflected only at columellar 
margin (Figs. 15, 16, 67, 81, 87; Pollonera, 
1898: 3, figs. 2, 3, as Horatia valvataeformis; 
Kuscer, 1932; 56-57, pi. 5, fig. 3, as Hauffe- 
nia michleri: Bole, 1967b; 112, fig. 1A, as 
Hauffenia michleri: Bole, 1970: 4-6, fig. 1; 
Maassen, 1975; pi. 27, figs. 4-8, as Hauffenia 
michleri: Pezzoli et al., 1975: pis. 1 , 2; Rado- 
man, 1978:34-35, pi. 4, figs. 13-15, as Hauf- 
fenla michleri: Bole, 1979: 36, figs. 1 -4a, b 
as Hauffenia michleri: Giusti & Pezzoli, 1980 
45, figs. 18B-D, 26L; Giusti & Pezzoli, 1982 
pi. 1, fig. 4; Radoman, 1983: 122, table 7, pi. 
9, figs. 143, 144, as Hauffenia michleri: Bole 
& Velkovrh, 1986: fig. 22; Pezzoli, 1989, pi. 5, 
fig. 1 1 ; Bodon & Giovannelli, 1 994: fig. 4M, N). 
Dimensions; height = 0.45-1.20 mm; diame- 
ter = 0.98-2.30 mm. 

Operculum yellowish, paucispiral, thick and 
with well developed spiralized peg at centre of 
inner face; peg variable in size in different 
populations, but always dilated at apex (Figs. 
36, 37, 68-71, 82; Pollonera, 1898: 3, fig. 2, 
fig. 3, as Horatia valvataeformis: Bole, 1967a: 
88, fig. 4(5), as Hauffenia michleri; Bole, 
1967b: 113, fig. 1B3, as Hauffenia michleri; 
Bole, 1 970: 91 , fig. 2A5; Bole, 1 993; 6, fig. 2B; 
Radoman, 1978; 33-34, as Hauffenia mich- 
leri; Radoman, 1983: 121-122, as Hauffenia 
michleri). 

Body unpigmented (a few traces of pigment 
sometimes on visceral sac); eye spots absent 
(Figs. 72, 83; Bole, 1967a: 87-88, fig. 4(2), as 
Hauffenia michleri; Bole, 1967b: 112-113, as 
Hauffenia michleri). 

Male genitalia with prostate gland bulging 
slightly into palliai cavity; penis rather short, 
flat, with apex blunt and no or 1 -2 slightly ev- 
ident lateral lobes on left side near apex, pe- 
nial duct zig-zagging through central portion 
of penis to open at penis tip; globular mass of 
réfringent cells inside penis apex to right of 
penial duct; terminal portion of penial duct 
(immediately before opening) with very small 
stylet (Figs. 73-77, 84-85, 95-99; Bole, 
1967a: 87, fig. 4(4), as Hauffenia michleri; 
Bole, 1967b: 112, fig. 1B2, as Hauffenia mich- 
leri; Bole, 1970: 91, fig. 2A3; Giusti & Pezzoli, 
1980: 45, fig. 18E; Radoman, 1983: 120, as 
Hauffenia michleri; Bole, 1993: 6, fig. 1С, as 
Hauffenia michleri). 

Female genitalia with proximal seminal re- 
ceptacle and a bursa copulatrix arising from 
distal renal oviduct; the smaller structure con- 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



127 



tains spermatozoa oriented witli their Ineads 
anchored to cells of the wall and is thus a 
seminal receptacle, and the larger contains 
few non-oriented and partially digested sper- 
matozoa and is thus a bursa copulathx; sem- 
inal receptacle very small and sessile or with 
very short duct arising from oviduct level with 
end of loop; bursa copulatrix very small but 
markedly longer than seminal receptacle, not 
dilated at apex, arising very close to point at 
which oviduct enters albumen gland portion of 
palliai oviduct; seminal groove running along 
ventral side of capsule gland (Figs. 78-80, 

86, 101; Bole, 1967a: 87-88, fig. 4(3), as 
Hauffenia michleri; Bole, 1970: 91, fig. 2A2; 
Giusti & Pezzoli, 1980: 43, fig. 18F; Rado- 
man, 1983: 40, 120, as Hauffenia michleri; 
Bole, 1993: 6, fig. IB; Bole, 1993: 6, as Hauf- 
fenia micfilen). 

Radula with central tooth trapezoidal with 
long lateral wings and basal tongue, its apical 
margin V-like, with long robust central denti- 
cle and 5-6 smaller denticles on both sides 
in decreasing order of size; 1 -2 basal cusps 
at point where each lateral wing arises 
from face of central tooth; lateral teeth rake- 
like, apically enlarged, their anterior margin 
with 10-13 denticles, central of which longer 
and larger; first marginal teeth rake-shaped, 
with long lateral wing and elongated cutting 
edge with long row of 16-26 small denticles 
anteriorly; second marginal teeth scraper- 
shaped, with long slender lateral wing and 
roundish, spoon-like apex, its cutting edge 
carrying rather long row of 15-18 very 
small denticles (Figs. 48-49; Bole, 1967a: 

87, fig. 4(6), as Hauffenia michleri: Bole, 
1967b: 112, fig. 1B4, as Hauffenia michleri; 
Bole, 1970: 91, fig. 2A4; Bole, 1993: 6, fig. 
2A). 

Stomach without posterior caecum; intes- 
tine with well developed, Z-like or question- 
mark-like bend on palliai wall (Figs. 76-79, 
85-86; Radoman, 1983: 40, as Hauffenia 
michleri). 

Osphradium variable in size, oval or elon- 
gated, kidney-shaped; ctenidium absent or 
consisting of 1-13 lamellae (Figs. 76-79, 
85-86; Bole, 1967a: 87 fig 4(1), as Hauffenia 
michleri; Bole, 1967b: 112, fig. 1B1, as Hauf- 
fenia michleri; Bole, 1970: 91, fig. 2A1; Bole, 
1993:6, fig. 1A). 

Nervous system with long pleuro-supraoe- 
sophageal and short pleuro-suboesophageal 
connectives (Radoman, 1983: 120, as Hauf- 
fenia michleri). 



Taxonomy 

Hauffenia is the second nominal genus es- 
tablished for the European valvatiform hydro- 
biids. It was introduced as a subgenus of Ho- 
ratia Bourguignat, 1887, and raised to the 
rank of distinct genus by Kuscer (1932, 
1933a, b). This was only demonstrated to be 
correct when Bole (1970) studied the type 
species anatomically and found its genitalia to 
be clearly different from those described by 
Radoman (1966) in the type species of Hora- 
tia. (For diagnosis, status and relationships of 
Hauffenia with Erythropomatiana Radoman, 
1978, Neohoratia Schutt, 1961, and Vrania 
Radoman, 1978, see "Status and Relation- 
ships of Hauffenia", below.) 

In the last 30 years, many valvatiform hy- 
drobiid species from western Europe were in- 
cluded into Hauffenia (also as Horatia {Hauf- 
fenia)), often simplistically on the basis of 
shell characters alone, by Bole (1 961 ), Schutt 
(1961b, 1980), Binder (1966) and Bernasconi 
(1975, 1984, 1985). Most of them are in need 
of revision because only the shells were stud- 
ied. Some are revised and redescribed in the 
present paper. This revision enabled us to as- 
certain that geographical distribution of Hauf- 
fenia is limited to the northern sector of the 
former Yugoslavia (Slovenia and Croatia), 
Austria and the neighbouring areas of north- 
eastern Italy. 

Hauffenia michleri \s here recognized as ju- 
nior synonym of H. tellinii (see taxonomic re- 
marks to H. tellinii in the section on Hauffenia 
species). 

Horatia Bourguignat, 1887 

Horatia Bourguignat, 1887: 46, 47-49. 

Type Species: Horatia klecakiana Bourguig- 
nat, 1887, by subsequent designation 
(Westerlund, 1902). 

Horatia klecakiana Bourguignat, 1887 

Horatia klecakiana Bourguignat, 1887: 
49-50, figs. 18-21. 

Type Locality: "sorgente près de Ribaric, dans 
la vallée de la Cettina", Croatia. Accord- 
ing to Radoman (1983: 52) this corre- 
sponds to "the Vrijovac spring in the 
source area of the Cetina river". 

Type Material: lectotype (shell) in the Bour- 
guignat collection. Museum d'Historié 
Naturelle de Genève, Geneva, Switzer- 
land (Binder, 1957). 



128 



BODÓN, MANGANELLI & GIUSTI 




FIGS. 87-94. Microsculpture of protoconchs. Fig. 87: Hauffenia michleri Kuscer, 1932, (junior synonym of 
H. tellinii) from the Mocilnik springs, Vrhnika, Slovenia, M. Bodon leg. 17.6.1985; Fig. 88: Horatia klecakiana 
Bourguignat, 1887, from Cetina near Vrlika, Croatia, 16.9.1964, ex F Velkovrh collection; Fig. 89: Kerkia 
kusceri (Bole. 1961) from the spring of the Krka River, Krka, Slovenia, M. Bodon leg. 16.6.1985; Fig. 90: 
Hauffenia subpiscinalis (Kuscer, 1932) from the spring Kotia, Rakov Skocjan, Slovenia, M. Bodon leg. 
18.6.1985; Fig. 91: Pezzolia radapalladis Bodon & Giusti, 1986, from the spring inside the Rio di Tonnego, 
Ponte della Vittoria, Rapallo, Genova, Liguria, Italy, M. Bodon leg. 16.12.1979; Fig. 92: Pseudohoratia ochri- 
dana (Polinski, 1929) from Lake Ohrid, Macedonia, ex P. Radoman collection; Fig. 93: Hauffenia wagneri 
(Kuscer, 1928) from the spring of the "Vranja Pec" cave, Bostanj, Sevnica, Krsko, Slovenia, M. Bodon leg. 
14.6.1985; Fig. 94: Hauffenia subcannata Bole & Velkovrh, 1987, from the spring near Lozice, along the road 
to Kanal, Soca valley, Slovenia, M. Bodon leg. 10.7.1996. Scale bar = 100 цт. 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



129 




«f 




1 






■- ■>.. ■■ ' 




' \:Ш 


1'f 


*r 'Г 


1 / 




, 


"■. ^^'*:H^ 


''">■ 


V^ > ' SG 


« 


4Í ' «^ • 


101 





.\ 




102 



^-.... '•', SG 




FIGS. 95-103. Penis, stylet and palliai oviduct of Hauffenia fe///n// (Pollonera, 1898) from the spring between 
Spagnut and Biacis, upper Natisone valley, Pulfero, Udine, Friuli-Venetia Julia, Italy, M. Bodon leg. 
23.9.1993, 1.4.1991 (Figs. 95, 96, 98, 101), Hauffenia michleri Kuscer, 1932, (junior synonym of H. tellinii) 
from the spring on right bank of the Verd brook, near the Verd spring, Vrhnika, Slovenia, M. Bodon leg 
17.6.1985 (Figs. 97, 99), and Hauffenia subpiscinalis (Kuscer, 1932) from the "Zelske Jame" caves, S. 576, 
near Rakek, Slovenia, 3.3.1966, ex F Velkovrh collection (Fig. 100) and from the Mocilnik springs, Vrhnika, 
Slovenia, M. Bodon leg. 17.6.1885 (Figs. 102, 103). Figs. 95-97: penis; Figs. 98, 99: apex of penis; Fig. 100: 
the entire stylet; Figs. 101, 1 02: section of capsule gland; Fig. 1 03: detail of seminal groove. Scale bar = 1 00 
|дт (95-97), 50 цт (98,99, 101, 102), 10цт(100, 103). 



130 



BODÓN, MANGANELLI & GIUSTI 




FIGS. 104-110. Operculum, shell and anatomical details of Horatia klecakiana Bourguignat, 1887, from 
Cetina near Vrlika, Croatia, 16.9.1964, ex F. Velkovrh collection. Fig. 104: outer face (left), and profile (right) 
of operculum; Fig. 105: shell; Fig. 106: body of a male with palliai cavity open to show head and penis; Fig. 
107: stomach; Fig. 108: renal and palliai oviduct, intestine and palliai organs of a female; Fig. 109: prostate 
gland, intestine and palliai organs of a male; Fig. 110: dorsal side of penis of three males. Scale bar = 1 mm. 



Material Examined 

-Cetina near Vrlika, Croatia, 33T XJ, 
16.9.1964, ex F. Velkovrh collection (3 
males, 2 females, many shells). 

Description 

Shell very small, valvatiform to ovoid, rather 
robust, whitish, opaque; surface of proto- 
conch malleated; spire more or less raised, 
consisting of 3.25-3.5 rather rapidly growing 
convex whorls; last whorl dilated and more or 
less descending near aperture; umbilicus not 



very wide; aperture prosocline, roundish to 
oval; peristome complete, external margin 
thin, columellar margin thickened, reflected 
(Figs. 88, 105; Bourguignat, 1887: 47-56, 
figs. 2, 3, as Horatia letourneuxi, figs. 4, 5, as 
H. praeclara, figs. 6, 7, as H. albanica, figs. 
10, 11, as H. obliqua, figs. 10-13, as H. ver- 
llkana, figs. 14, 15, as H. palustris, figs. 16, 
17, as H. fontinalis, figs. 18-23, as H. obtusa; 
Binder, 1957: 59-62, figs, la-r, u-w; Ant, 
1 962: 74, figs. 1 -21 , 25-30; Radoman, 1 965: 
143, Figs. 3, 4; Radoman, 1966: 246, fig. 2; 
Radoman, 1983: 52, pi. 3, fig. 38). Dimen- 
sions: height = 1.55-2.14 mm; diameter = 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



131 



1.81-2.18 mm (Radoman, 1965: table 2; 
1983:201, tables). 

Operculum thin, reddish yellow, paucispiral, 
slightly thickened at centre, lacking outgrowth 
on inner face (Fig. 104; Radoman, 1965: fig. 
3; Boeters, 1974: 86; Radoman, 1983: 52). 

Body slightly pigmented; eye spots present 
(Fig. 106; Boeters, 1974:86). 

Male genitalia with prostate gland bulging 
well into palliai cavity; penis rather elongated 
and slender, with apex pointed and single or 
double, rather evident, lobe on left side at 
about 2/3 of its length; penial duct zig-zagging 
through lateral portion of first half of penis, be- 
coming central before opening at penis tip 
(Figs. 109-110; Boeters, 1974: 86, figs. 1, 2; 
Radoman, 1983: 52, fig. 20). 

Female genitalia with two seminal recepta- 
cles and a bursa copulathx arising from distal 
renal oviduct; proximal seminal receptacle 
thin and bent to adhere to oviduct level with 
end of loop; distal seminal receptacle larger 
than proximal, wide at apex; bursa copulatrix 
large, kidney-shaped, with long slender duct 
that enters bursa on anterodorsal side; semi- 
nal groove running along ventral side of cap- 
sule gland (Fig. 108; Radoman, 1966: 249, 
fig. 8; 1973a: 6; Boeters, 1974: 86; Radoman, 
1983:40, 51, fig. 20). 

Radula with central tooth trapezoidal, with 
long lateral wings and basal tongue, its apical 
margin V-like, with long, robust central denti- 
cle and 5 smaller denticles on both sides in 
decreasing order of size; one basal cusp at 
point where each lateral wing arises from face 
of central tooth; lateral teeth rake-like, apically 
enlarged, their anterior margin with 10-11 
denticles, central of which longer and larger; 
first marginal teeth rake-shaped, with long lat- 
eral wing and elongated cutting edge with 
long row of 25-30 small denticles anteriorly; 
second marginal teeth scraper-shaped, with 
long, slender lateral wing and roundish, 
spoon-like apex, its cutting edge carrying 
rather long row of very small denticles 
(Binder, 1957: 62, fig. 2; Boeters, 1974: 86; 
Hershler & Longley, 1986: fig. 280). 

Stomach without posterior caecum; intes- 
tine with bend absent or relatively undevel- 
oped (Figs. 107-109; Radoman, 1973a: 6; 
Boeters, 1974: 86; Radoman, 1983: 40). 

Osphradium variable in size, elongated, 
kidney-shaped; ctenidium consisting of 7-11 
lamellae (Figs. 108, 109; Boeters, 1974: 86). 

Nervous system with long pleuro-supraoe- 
sophageal and rather long to somewhat short 



pleuro-suboesophageal connectives (Rado- 
man, 1966:249; 1983:40, 51) 

Taxonomy 

The genus Horatia is characterized by: 
shell very small, valvatiform to ovoid; opercu- 
lum without peg; penis with one simple lobe; 
female genitalia with two seminal receptacles, 
distal larger than proximal, and large, kidney- 
shaped bursa copulatrix, with anterodorsal 
duct; central tooth with one pair of basal 
cusps. 

Horatia was the first nominal genus estab- 
lished for the European valvatiform hydro- 
biids. Before then, and sometimes also 
after, valvatiform hydrobiids were included 
in the heterobranch genus Valvata Müller, 
1774. 

Together with the type species, Bourguig- 
nat (1887) introduced many nominal species 
of Horatia. Apart from Horatia servaini Bour- 
guignat, 1887, which is regarded as a junior 
synonym of Islamia valvataeformis (Möllen- 
dorff, 1873) (Radoman, 1983), all the others, 
from Dalmatia and Albania are currently re- 
garded as junior synonyms of Horatia l<le- 
cal<iana Bourguignat, 1887 (Binder, 1957; 
Radoman, 1983). They are: Horatia albanica 
Bourguignat, 1887; H. foni/na//s Bourguignat, 
1887; H. letourneuxi Bourguignat, 1887; H. 
obliqua Bourguignat, 1887; H. obtusa Bour- 
guignat, 1887; H. pa/usfr/s Bourguignat, 1887; 
H. praeclara Bourguignat, 1887; and H. ver- 
lil<ana Bourguignat, 1887. Ant (1962) also 
regarded H. /cnom Schüft, 1961 , as a possible 
junior synonym of H. I<lecal<iana, but this is 
very doubtful. 

Besides the type species, Horatia includes 
two other species inhabiting different drain- 
ages from that where H. klecai<iana lives: H. 
macedónica (Kuscer, 1936) and H. novose- 
lensis Radoman, 1966, both from Macedonia 
(Radoman, 1983). 

Reports of species of Horatia exist from 
other European and non-European countries 
(Willmann & Pieper, 1978; Bole & Velkovrh, 
1 986; Kabat & Hershler, 1 993), but all of them 
are questionable. 

Islamia Radoman, 1973a 

Islamia Radoman, 1973a: 10. 

Type Species: Horatia servaini Bourguignat, 
1887, by original designation. Horatia 
servaini is a junior synonym of Hydrobia 



132 



BODÓN, MANGANELLI & GIUSTI 





FIGS. 111-116. Shell, operculum and anatomical details of Islamia valvataeformis (Möllendorff, 1873) from 
Vrelo Bosne, Sarajevo, Bosnia, G. Vigna& A. Vigna leg. (Figs. 111-115) and shell of Karevia ornata {Radio- 
man. 1957) from the harbour of Trpezjca, Lake Ohrid, Macedonia, 5.1976, ex W. J. M. Maassen collection 
(Fig. 116). Fig. Ill: body of a male with palliai cavity open to show head and penis; Figs. 112, 116: shell; Fig. 
113: outer face of operculum: Fig. 114: intestine and palliai organs of a male; Fig. 115; dorsal side (left) and 
ventral side (right) of penis. Scale bar = 1 mm. 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



133 



valvataeformis Möllendorff, 1873, 
cording to Radoman (1983). 



ac- 



Islamia valvataeformis (Möllendorff, 1 873) 

Hydrobia valvataeformis Möllendorff, 1873: 
59. 

Type Locality: ". . . an Steinen in der Quelle 
der Bosna, welche am Fuss des Ig- 
mangebirges bei Sarajevo . . .", Bosnia. 
According to Radoman (1983: 126) the 
type locality corresponds to "Vrelo 
Bosne, near Sarajevo". 

Type Material: Möllendorff (1873) did not give 
any information about the type material. 

Horai/a se/va/n/Bourguignat, 1887: 52. 

Type Locality: "Sources de la Bosna, près de 
Sérajewo, Bosnie". 

Type Material: syntypes (2 shells) in the Bour- 
guignat collection. Museum d'Historié 
Naturelle de Genève, Geneva, Switzer- 
land (Binder, 1957). 

Material Examined 

—Vrelo Bosne, Sarajevo, Bosnia, 34T BP 85, 
G. Vigna & A. Vigna leg. (2 males, 3 
shells). 

Description 

Shell very small, valvatiform, conical-ovoid, 
thin, pale whitish, waxen, transparent when 
fresh and clean: microsculpture of protoconch 
unknown; spire well raised, consisting of 
3.5-4.25 rapidly growing convex whorls; last 
whorl large, dilated, more or less descending 
near aperture; umbilicus rather small; aper- 
ture prosocline, roundish to ovoid; peristome 
complete, thin, slightly thickened at columellar 
margin and slightly reflected at lower and col- 
umellar margin (Fig. 112; Bourguignat, 1887: 
52, figs. 8, 9, as Horatia servaini; Radoman, 
1973b: 227, 229, fig. 1A, as Islamia {Islamia) 
servaini; Radoman, 1983: 126, pi. 9, fig. 148). 
Dimensions: height = 1.62-2.00 mm; diame- 
ter = 1.53-1.81 mm (Radoman, 1983: Tab. 7). 

Operculum thin, yellowish, paucispiral, 
without thickening or outgrowth at centre of 
inner face (Fig. 113; Radoman, 1973b: 227, 
as Islamia {Islamia) servaini: Radoman, 1 983: 
124). 

Body pigmented; eye spots present (Fig. 
111; Giusti et al., 1981: fig. 4.3, as Islamia 
servaini). 

Male genitalia with penis large, elongated, 



dorso-ventrally flat, with cylindrical outline, 
apically bifid due to well-developed penial 
lobe on left side, slightly larger than tip of 
penis proper and containing mass of glandu- 
lar cells; muscular pleat on ventral side of 
penis about 2/3 of penis length near base of 
penial lobe; penial duct zig-zagging through 
right portion of penis to open at tip of penis 
proper (Fig. 115; Radoman, 1973b: 227, 231, 
233, fig. 3, as Islamia (Islamia) servaini; Giusti 
et al., 1981: fig. 4.3, as Islamia servaini; 
Radoman, 1983: 124, 126, fig. 690). 

Female genitalia with only two seminal re- 
ceptacles arising rather close to one another 
from distal renal oviduct half way between 
end of loop (where proximal seminal recepta- 
cle arises in most hydrobiids having two sem- 
inal receptacles) and where oviduct enters al- 
bumen gland (near where distal seminal 
receptacle arises); that arising proximally 
(closer to end of loop) being rather well devel- 
oped, always larger and longer than other, 
usually wider at apex than at base and with 
short but evident stalk; that arising distally 
(closer to where oviduct enters albumen 
gland) being very small and usually without 
evident stalk; bursa copulatrix absent; semi- 
nal groove running along ventral side of cap- 
sule gland (Radoman, 1973b: 227, fig. 2, as 
Islamia {Islamia) servaini; Radoman, 1973a: 
6, 10; 1983:40, 124, fig. 69A, B). 

Radula with central tooth trapezoidal, with 
long lateral wings and basal tongue, its apical 
margin V-like, with long robust central denticle 
and 5-6 smaller denticles on both sides in de- 
creasing order of size; one basal cusp at point 
where each lateral wing arises from face of 
central tooth; lateral teeth rake-like, apically 
enlarged, their anterior margin with 9-11 den- 
ticles, central of which longer and larger; first 
marginal teeth rake-shaped, with long lateral 
wing and elongated cutting edge with long 
row of 25-28 small denticles anteriorly; sec- 
ond marginal teeth scraper-shaped, with long 
and slender lateral wing and roundish, spoon- 
like apex, its cutting edge carrying rather long 
row of very small denticles (Radoman, 1 973b: 
227, fig. 2, as Islamia (Islamia) servaini; Giusti 
etal., 1981: 53, pi. 3, figs. 1-3, as Islamia ser- 
vaini; Radoman, 1983: 124). 

Stomach without posterior caecum; intes- 
tine with relatively undeveloped, U-like bend 
on palliai wall (Fig. 114; Radoman, 1973a: 6; 
Giusti et al., 1981 : fig. 4.3, as Islamia servaini; 
Radoman, 1983: 40). 

Osphradium variable in size, kidney- 
shaped; ctenidium consisting of 13-15 lamel- 



134 



BODÓN, MANGANELLI & GIUSTI 



lae(Fig. 114: Giusti etal.. 1981: 53, fig. 4.3, as 
Islamia servaini). 

Nervous system with long pleuro-supraoe- 
sophageal and short pleuro-suboesophageal 
connectives (Radoman, 1973b: 227, as Is- 
lamia {Islamia) servaini: Radoman, 1973a: 6; 
1983: 124). 

Taxonomy 

Radoman (1973a: 10) established Islamia 
without a description or definition, but only by 
combining it with an available species group 
name and some new species. After 1930, this 
condition did not make a generic name avail- 
able (ICZN, 1999: Art. 13.6). However, at the 
same time he designated a type species for 
the new nominal genus and introduced the 
new family group taxon, Islamiinae, of which 
he gave a diagnosis. Hence, we can consider 
this as a "combined description of a new fam- 
ily-group taxon and a new genus," which con- 
fers availability to each name (ICZN, 1999: 
Art. 13.5). 

The genus Islamia is characterized by: shell 
very small, ovoid to planispiral; operculum 
without peg: penis with one glandular (rarely 
non-glandular) lobe: female genitalia with two 
seminal receptacles, proximal larger than dis- 
tal, and without bursa copulatrix: central tooth 
with one or two pairs of basal cusps. 

Adriolitorea Radoman, 1973b (p. 234; type 
species: Islamia zermanica Radoman, 
1973a) and Mienisiella Schüft, 1991 (p. 134: 
type species: Mienisiella mienisi Schutt, 
1991) are junior synonyms of Islamia Rado- 
man, 1973a. Adnolitorea was introduced by 
Radoman (1973b) as a subgenus of Islamia 
and then regarded as synonym of the latter by 
Radoman (1983). Mienisiella is considered to 
be a junior synonym of Islamia on the basis of 
personal unpublished data. Schutt (1991) de- 
scribed the female genitalia of M. mienisi 
Schutt, 1991, and M. gaillardoti (Germain, 
1911) as having a very small bursa copulatrix 
and one seminal receptacle. Study of topo- 
typical specimens of M. mienisi and others of 
M. gaillardoti from many localities in Israel 
confirmed what is clearly evident from 
SchCitt's (1991: fig. 5c): the two species have 
two seminal receptacles located and shaped 
exactly as in the Islamia species. Penis struc- 
ture in Mienisiella (see Schutt 1 991 : 1 34-1 35, 
figs. 5b, 6b) is also exactly the same as that of 
the Islamia species. In fact, Schutts second 
"small, simple excrescence on left side of 
penis" is the muscular pleat described above 



on the penis of /. valvataeformis and present 
on the penis of many Islamia species studied 
up to now. Study of M. gaillardoti also showed 
that the penial duct runs in the right side of the 
penis to open at the tip of the penis proper 
(right branch of bifid apex of penis) and not, as 
figured by Schüft (1991), at the tip of the pe- 
nial lobe (left branch of bifid apex of penis). 

Boeters (1998) mistakenly regarded Is- 
lamia as a junior synonym of Neohoratia. In 
fact, he did not base this conclusion on the 
concordance between the type species of 
Neohoratia and Islamia {Valvata (?) subpisci- 
nalis Kuscer, 1 932, and Horatia servaini Bour- 
guignat, 1887 [a junior synonym of Hydrobia 
valvataeformis Möllendorff, 1873], respec- 
tively), but on the fact that an alleged "Neoho- 
ratia" species from western Europe actually 
turns out to be an Islamia species: Islamia cf. 
minuta (Draparnaud, 1805) (see "Descrip- 
tions of some taxa misidentified as Hauffenia 
species" below). 

A number of species from different sites in 
Europe and Turkey have been assigned to Is- 
lamia by Giusti & Pezzoli (1980), Giusti et al. 
(1981), Reischütz (1988), Radoman (1973a, 
b, 1 983) and Bodon et al. (1 995a, b). Some of 
them, assigned to Islamia on the basis of shell 
characters, are in need of revision. 

Karevia Hadzisce, 1959 

Karevia Hadzisce, 1959: 81-82, as a sub- 
genus of Ohrigocea Hadzisce, 1959. 

Types Species: Ohrigocea (Karevia) priitchevi 
Hadzisce, 1959, by subsequent designa- 
tion (Radoman, 1963a) according to 
ICZN (1999: Art. 69.2.2). Ohrigocea pri- 
itchevi is a junior synonym of Karevia ór- 
nala (Radoman, 1957), according to 
Radoman (1963a, b, 1983). 

Karevia ornata (Radoman, 1957) 

Pseudamnicola ornata Radoman, 1957: 
88-89, figs. 3, 6, 7C, F, 8. 

Type Locality: ". . . su uz istocnu obalu Ohrid- 
skog jezera, po obalskom kamenju, 
pocev od izvora Veli Dab pa do pocetka 
peskovite, juzne obale jezera, prema Sv. 
Naumu.", Lake Ohrid, Macedonia. The 
type locality is "Lake Ohrid, on the bank 
stones by Veli Dab. Spread from this lo- 
cality to a great sandy beach near Sveti 
Naum", according to Radoman (1983: 
81). 

Type Material: lectotype (BEO 161, shell) at 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



135 



the Prirodnjacki Muzej u Beograd, to- 
gether with a paralectotype (BEO 162, 
shell) (Jovanovic, 1991). 

Ohrigocea {Karevia) priitchevi Hadzisce, 
1959:83-86, figs. 20, 21. 

Type Locality: ". . . lebt an seichten steinigen 
Zonen der Litoralregion auf der nord- 
östlichen, östlichen und sudöstlichen 
Seite des Sees [Lake Ohrid], Macedo- 
nia". 

Type Material: Hadzisce (1959) did not give 
any information about the type material. 

Material Examined 

— Harbour of Trpezjca, Lake Ohrid, Macedo- 
nia, 34T DL 83, 5.1976, ex W. J. M. 
Maassen collection (1 shell with dried 
soft parts). 

Description 

Shell very small, valvatiform-planispiral, 
adorned with two rows of more or less raised 
nail-like projections, regularly spaced to follow 
course of a peripheral keel and basal keel; 
surface of protoconch malleated; spire de- 
pressed, consisting of 2.75-3.25 rather 
rapidly growing whorls; last whorl dilated, de- 
scending slightly near aperture, its external 
wall with peripheral keel and its lower wall with 
basal keel; umbilicus very wide; aperture 
prosocline, irregularly rhomboidal, angled 
above and at two keels; peristome complete, 
thin, slightly reflected only at columellar mar- 
gin (Fig. 116; Radoman, 1957: 88-89, fig. 3; 
Hadzisce, 1959: 83-86, figs. 20, 21, as 
Ohrigocea (Karevia) priitchevi; Hadzisce, 
1959: 86-87, fig. 23, as Ohrigocea (Karevia) 
sandanskli; Maassen, 1980: pi. 17, figs. 35, 
36; Radoman, 1963a: 78-79, fig. 7, as 
Pseudamnicola (Karevia) ornata; Radoman, 
1963b: 95-96, fig. 7, as Pseudamnicola 
(Karevia) ornata; Radoman, 1983: 80-81, pi 
5, fig. 77, as Dolapia ornafa; Jovanovic, 1991 
pi. 5, fig. 40, as Dolapia ornata). Dimensions 
height = 0.72-1 .10 mm; diameter = 1 .45-1 .73 
mm (Radoman, 1983: tab. 5). 

Operculum yellowish red, paucispiral, prob- 
ably without peg though not specified. 

Body pigmented; eye spots present. 

Male genitalia with penis large, flat with 
apex rather pointed and lobe on left side 
about 2/3 of penis length (Radoman, 1957: 
89, fig. 7F; Hadzisce, 1959: 86, fig. 20, as 
Ohrigocea (Karevia) priitchevi; Hadzisce, 
1959: 87, fig. 24, as Ohrigocea (Karevia) san- 



danskli; Radoman, 1963a: fig. 15, as Pseud- 
amnicola (Karevia) ornata; Radoman, 1963b: 
fig. 15, as Pseudamnicola (Karevia) ornata; 
Radoman, 1983: 80, fig. 41, as Dolapia or- 
nata). 

Female genitalia with two seminal recepta- 
cles and a bursa copulatrix arising from distal 
renal oviduct; proximal seminal receptacle 
much larger than distal, which is rudimentary; 
bursa copulatrix large, arched, kidney- or 
crescent-shaped, with long, slender duct en- 
tering bursa on anterior side; seminal groove 
running along ventral side of capsule gland 
(Radoman, 1957: 89, fig. 70; Radoman, 
1963a: 78, fig. 15, as Pseudamnicola (Kare- 
via) ornata; Radoman, 1963b: 95, fig. 15, as 
Pseudamnicola (Karevia) ornata; Radoman, 
1973a: 6, as Dolapia ornata; Radoman, 1983: 
40, 80, fig. 41, as Dolapia ornata). 

Radula with central tooth trapezoidal, with 
long lateral wings and basal tongue, its apical 
margin V-like, with long robust central denticle 
and 4-5 smaller denticles on both sides in 
decreasing order of size; one basal cusp at 
point where each lateral wing arises from 
face of central tooth; lateral teeth rake-like, 
apically enlarged, their anterior margin with 
9-13 denticles, central of which longer and 
larger; first marginal teeth rake-shaped, with 
long lateral wing and elongated cutting edge 
with long row of 14-20 denticles anteriorly; 
second marginal teeth scraper-shaped, with 
long, slender lateral wing and roundish, 
spoon-like apex, its cutting edge carrying 
rather long row of very small denticles (Rado- 
man, 1957: 90, fig. 6; Hadzisce, 1959: 85-86, 
fig. 22, as Ohrigocea (Karevia) priitchevi; 
Hadzisce, 1959: 86-87, fig. 24, as Ohrigocea 
(Karevia) sandanskli). 

Stomach without posterior caecum; intes- 
tine unknown (Radoman, 1 973a: 6, as Dolapia 
ornata; Radoman, 1983: 40, as Dolapia or- 
nata). 

Osphradium and ctenidium unknown. 

Nervous system with long pleuro-supraoe- 
sophageal and short pleuro-suboesophageal 
connectives (Radoman, 1957: 91, fig. 8; 
Radoman, 1 973a: 6, as Dolapia ornata; Rado- 
man, 1983: 80, as Dolapia ornata). 

Taxonomy 

Karevia is here considered a distinct genus, 
but its relationships to Ohridohauffenia 
Hadzisce, 1959, and Ohrigocea Hadzisce, 
1959, need to be clarified. Karevia is charac- 
terized by: shell very small, valvatiform- 



136 



BODÓN, MANGANELLI & GIUSTI 



planispiral, bicarinate and adorned with two 
rows of nail-like projections: operculum with- 
out peg; penis with one simple lobe; female 
genitalia with two seminal receptacles, proxi- 
mal larger than distal, which is rudimentary, 
and large, crescent-shaped bursa copulathx 
with anterior duct; central tooth with one pair 
of basal cusps. It includes only the type 
species, which is endemic to Lake Ohrid. 

Dolapia Radoman, 1983 (p. 80, type 
species; Pseudamnlcola ornata, Radoman, 
1957), is a junior synonym of Karevia Ha- 
dzisce, 1959. In fact, apparently overlooking 
his previous designation of Ohrigocea (Kare- 
via) priitchevi Hadzisce, 1959 (as P. ornata, 
with O. priitchevi as a junior synonym), as 
type species of Karevia, Radoman (1973a) 
designated another type species; Ohrigocea 
(Karevia) miladinovorum Hadzisce, 1959. At 
the same time, he introduced a new genus, 
Dolapia, for P. ornata. However, he (Rado- 
man, 1973a; 8) established this nominal 
genus without a description or definition but 
only by combining it with an available species 
group name. After 1930, this condition does 
not make a generic name available (ICZN, 
1999; Art. 13.6). 

Ohrigocea (Karevia) sandanskii Hadzisce, 
1959 (pp. 86-87, figs. 23, 24; type locality; 
". . . lebt auf der östlichen und sudöstlichen 
Seite des Sees, in den seichten Teilen seines 
steinigen Literals [Lake Ohrid]", Macedonia 
figs. 117-122 is another junior synonym of 
Karevia ornata (Radoman, 1963a, b, 1983). 

Kerkia Radoman, 1978 

Kerkia Radoman, 1978; 29. 
Type Species; Haufienia kuscerl Bo\e, 1961, 
by original designation. 

Kerkia kuscerl (Bole, 1 961 ) 

Haufienia kuscerl Bo\e, 1961 ; 62, 67, fig. ЗА. 

Type Locality; "Krska jama", Slovenia. Ac- 
cording to Radoman (1983; 112), the 
type locality is "Jama Krke (cave), south- 
east of Ljubljana". 

Type fy/laterial; Bole (1 961 ) did not give any in- 
formation about the type material. 

Material Examined 

-Spring of the Krka River, Krka, Slovenia, 
33T VL 88, M. Bodon leg. 16.6.1985 (1 
male, 1 female, many shells). 



-"Krska Jama" cave, S. 74, Krka, Slovenia, 
33T VL 88, F. Gaspare & F. Stoch leg. 
26.9.1992 (13 specimens, 2 shells). 

Description 

Shell very small, valvatiform, thin, whitish; 
surface of protoconch malleated; spire de- 
pressed to slightly raised, consisting of 
2.75-3.25 rather rapidly growing convex 
whorls; last whorl dilated, more or less de- 
scending near aperture; umbilicus wide; aper- 
ture prosocline, roundish to oval; peristome 
complete, thin, slightly reflected at columellar 
margin. (Figs. 89, 117; Bole, 1961; 62, 67, fig 
ЗА; Radoman, 1978; 29-30, pi. 4, figs. 3, 4 
1983; 110, 112, pi. 8, fig. 128). Dimensions 
height = 0.97-1 .44 mm; diameter = 1 .60-2.34 
mm (Radoman, 1983: tab. 6). 

Operculum slightly thickened, paucispiral, 
with low crest-like thickening at centre of inner 
face (Figs. 38, 39, 1 18; Bole, 1 961 ; 62, 67, fig. 
ЗА; Radoman, 1978; 30; 1983: 112; Bole, 
1993; 10, fig. 2B). 

Body unpigmented (a few traces of pigment 
in wall of visceral sac); eye spots absent (Fig. 
119). 

Male genitalia with prostate gland bulging 
well into palliai cavity; penis elongated, cylin- 
dro-conical, flat, slightly dilated then tapering 
near apex, with large non-glandular lobe on 
left side about 2/3 of penis length; penial duct 
zig-zagging through right portion of penis to 
open at penis tip (Figs. 120, 121; Bole, 1961; 
62, fig. ЗА; Radoman, 1978: 29, fig. 2C; 1983; 
110, fig. 580; Bole, 1993: 10, fig. 1С). 

Female genitalia with distal seminal recep- 
tacle and a bursa copulatrix arising from distal 
renal oviduct; seminal receptacle very long, 
slender; bursa copulatrix very large, oval to 
subtriangular, with long, slender duct entering 
bursa on anterior side; seminal groove run- 
ning along ventral side of capsule gland (Fig. 
122; Radoman, 1978: 29, fig. 2A, B; 1983; 40, 
110, fig. 58A, B). Bole (1993, fig. IB), illus- 
trates female genitalia with a very small bursa 
copulatrix; this is due to a misidentification of 
a female of the Haufienia species living in the 
same aquifer. 

Radula with central tooth trapezoidal, with 
long lateral wings and basal tongue, its apical 
margin V-like, with long robust central denticle 
and 5-6 smaller denticles on both sides in de- 
creasing order of size; two basal cusps at 
point where each lateral wing arises from face 
of central tooth; lateral teeth rake-like, apically 
enlarged, their anterior margin with 8-9 denti- 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



137 




FIGS. 117-122. Shell, operculum and anatomical details of Kerkia kuscerl (Bole, 1961) from the spring of 
the Krka River, Krka, Slovenia, M. Bodon leg. 16.6.1985. Fig. 117: shell; Fig. 118: outer face (top centre), pro- 
file (top left and right) and inner face (below) of operculum; Fig. 1 1 9: body; Fig. 1 20: dorsal side of penis; Fig. 
121: prostate gland, stomach, intestine and palliai organs of a male; Fig. 122: renal and palliai oviduct, in- 
testine and palliai organs of a female. Scale bar = 1 mm. 



138 



BODÓN, MANGANELLI & GlUSTI 



des, central of which longer and larger; first 
marginal teeth with apical row of 12-16 denti- 
cles; second marginal teeth with rather long 
row of 14-18 denticles (Bole, 1961: 62, 67, 
fig. ЗА; 1993: 10, fig. 2A). 

Stomach without posterior caecum; intes- 
tine with well developed, S-like bend on palliai 
wall (Figs. 121, 122; 1978: 29, fig. 2D; Rado- 
man, 1983: 40, fig. 58D). 

Osphradium variable in size, ovoid or elon- 
gated; ctenidium consisting of about 11-12 
lamellae (Figs. 121, 122; Bole, 1961: 62, 67; 
1993: fig. 1A). 

Nervous system with long pleuro-supraoe- 
sophageal and short pleuro-suboesophageal 
connectives (Radoman, 1978: 29; 1983: 110). 

Taxonomy 

The genus Kerkia is characterized by: shell 
very small, valvatiform to planispiral; opercu- 
lum without peg, but with crest-like projection 
or thickening on inner face; penis with one 
simple lobe; female genitalia with distal semi- 
nal receptacle and very large, oval to subtri- 
angular, bursa copulatrix with anterior duct; 
central tooth with two pairs of basal cusps. It 
includes the type species and a recently de- 
scribed species: K. brezicensis Bodon & 
Cianfanelli, 1996, both from Slovenia. Kerkia 
brezicensis differs from K. kusceri in shell (flat 
spire), opercular (circular thickening on inner 
face), and anatomical (slender penial apex, 
smaller penial lobe) characters (Bodon & 
Cianfanelli, 1996). 

Lobaunia Haase, 1993 

Lobaunia Haase, 1993: 98-99. 
Type Species: Lobaunia danubialis Haase, 
1993, by original designation. 

Lobaunia danubialis Haase, 1993 

Lobaunia danubialis Haase, 1993: 99-105, 
figs. 8B, 9-15. 

Type Locality: "Peilrohr A 63 am Eber- 
schüttwasser im SE Wiens", Austria. 

Type Material: holotype (NHMW 85027, fe- 
male) at the Naturhistorisches Museum 
Wien, Vienna, Austria; paratypes at 
the Naturhistorisches Museum Wien 
(NHMW 85028, 1 male: NHMW 85884, 
31 shells) and in the Stojaspal collection 
(3230, 16 shells), Vienna, Austria 
(Haase, 1993). 



Material Examined 

-Pipe A89, Lobau, Wien, Austria, Pospisil 
leg. 24.1.1992, exM. Haase collection (1 
shell with dried soft parts, 8 shells). 

Description 

Shell very small, valvatiform-planispiral, 
thin, whitish, transparent when fresh; surface 
of protoconch malleated; spire almost flat, 
consisting of 2.25-2.75 rather rapidly growing 
convex whorls; last whorl dilated, descending 
slightly near aperture; umbilicus wide; aper- 
ture prosocline, oval; peristome complete, 
thin, slightly reflected only at columellar mar- 
gin (Fig. 123; Haase, 1993: 98-99, 104-105, 
fig. 9A-C; Boeters, 1998: 29, figs. HI 3-1 4). 
Dimensions: height = 0.50-0.84 mm; diame- 
ter = 0.86-1.31 mm (Haase, 1993: table 1). 

Operculum thin, yellow-orange, paucispiral, 
slightly thickened at centre, but without out- 
growth on inner face (Fig. 124; Haase, 1993; 
98-99, figs. 10A, B). 

Body unpigmented (a few black spots on 
visceral sac level with stomach); eye spots 
absent (Haase, 1993: 98). 

Male genitalia with penis rather short, flat, 
tapering slightly near apex and ending in 
rather obtuse tip; penial duct zig-zagging 
through central portion of penis to open at 
penis tip; terminal portion of penial duct (im- 
mediately before opening) with very small 
stylet (Haase, 1993: 99, 103, Figs. 8B, 15; 
Boeters, 1998:29, fig. HI 5). 

Female genitalia with proximal seminal re- 
ceptacle and a bursa copulatrix arising from 
distal renal oviduct; seminal receptacle small 
but proportionally rather developed, arising 
from oviduct at end of loop; bursa copulatrix 
small, slightly larger than seminal receptacle, 
with very short duct entering on anterior side; 
according to Haase (1993), the seminal 
groove ("Ventralkanal") is a distinct duct- 
possibly similar to the "spermathecal duct" de- 
scribed by Davis et al. (1982) in Spurwinkia 
salsa (Pilsbry, 1895) completely separated 
from the lumen of the capsule gland, starting 
from proximal part of capsule gland and end- 
ing in the gonopore; the renal oviduct is sup- 
posed to end by entering the albumen gland 
through an opening ("Öffnung für Eizellen"); 
spermatozoa are supposed to enter the gono- 
pore, to run in the "spermathecal duct", then 
enter the palliai oviduct and, finally, to reach 
renal oviduct (and hence seminal receptacle) 
through another opening ("Öffnung für Sper- 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



139 



matozoen") connecting albumen gland di- 
rectly to renal oviduct (Haase, 1993: 98-99, 
102, 104, figs. 8B, 12-14; Boeters, 1998: 29, 
fig. H16). 

Radula with central tooth trapezoidal, with 
long lateral wings and basal tongue, its apical 
margin V-like, with long and robust central 
denticle and 5 smaller denticles on both sides 
in decreasing order of size; 1 -2 basal cusps 
at point where each lateral wing arises from 
face of central tooth; lateral teeth rake-like, 
apically enlarged, their anterior margin with 
10-11 denticles, central of which longer and 
larger; first marginal teeth rake-shaped, with 
long lateral wing and elongated cutting edge 
with long row of 17-21 small denticles anteri- 
orly; second marginal teeth scraper-shaped, 
with long and slender lateral wing and 
roundish, spoon-like apex, its cutting edge 
carrying rather long row of 13-15 small denti- 
cles (Haase, 1993: 98-99, figs. IIA, В). 

Stomach without posterior caecum; intes- 
tine with well developed, S-like bend on palliai 
wall (Haase, 1993: 98-99, fig. 12). 

Osphradium unknown; ctenidium consist- 
ing of 8-9 lamellae (Haase, 1993: 99). 

Nervous system with long pleuro-supraoe- 
sophageal and short pleuro-suboesophageal 
connectives (Haase, 1993: 99). 

Taxonomy 

Lobaunia is here considered a junior syn- 
onym of Hauffenia Pollonera, 1 898 (see "Sta- 
tus and relationship of Hauffenia"). Haase 
(1993) described Lobaunia as a distinct 
genus based on the extremely peculiar struc- 
ture of the female genitalia (see description) 
reconstructed by serial sectioning. If these 
characters were true, this genus would be dis- 
tinct from all other European hydrobiids (val- 
vatiform and non-valvatiform). However, the 
fact that Lobaunia matches Hauffenia, Neo- 
/70A'ai/'a Schüft, 1961, l/ran/a Radoman, 1978, 
and Eryttiropomatiana Radoman, 1978, in 
male genital characters and also lives in an 
area where IHauffenia is widespread, invited 
prudence and suggested the need for more 
careful anatomical study. Asked for details of 
the anatomy of Lobaunia, Haase (personal 
communication, 3.2.1995) replied that he had 
new data suggesting that his reconstruction of 
the female genitalia of Lobaunia, based on 
only one specimen, might be incorrect and 
that Lobaunia might correspond to ¡Hauffenia. 

Lobaunia included only the type species 
from Austria. 



Lyhnidia Hadzisce, 1959 

Lyfinidia Hadzisce, 1959: 88. 

Type Species: Lyfinidia tiadzii Hadzisce, 
1959, by subsequent designation (Rado- 
man, 1963a). 



Lyhnidia hadzii Hadzisce, 1959 

Lyhnidia hadzii Hadzisce, 1959: 90-93, figs. 
27-29. 

Type Locality: ". . . lebt in den seichten Teilen 
des steinigen Literals auf der östlichen 
und südöstlichen Seite des Sees [Lake 
Ohrid] wie auch in seinem Sublitoral, 
nämlich der Schalenzone und besonders 
der Zone der lebenden Dreissensien, 
Macedonia". According to Radoman 
(1983: 116) the type locality is "Lake 
Ohrid, by Veli Dab". 

Type Material: Hadzisce (1959) did not give 
any information about the type material. 

Material Examined 

-Harbour of Trpezjca, Lake Ohrid, Macedo- 
nia, 34T DL 83, 5.1976, ex W. J. M. 
Maassen collection (2 shells with dried 
soft parts). 



Description 

Shell very small, valvatiform-globose coni- 
cal, pale whitish, waxen, transparent when 
fresh; surface of protoconch malleated; spire 
rather raised, conical, consisting of 3.25-3.5 
rather rapidly growing convex whorls; last 
whorl large, slightly dilated, slightly descend- 
ing near aperture; umbilicus very small, slit- 
like; aperture prosocline, irregularly square; 
peristome complete, sinuous, with external 
margin concave above, convex at centre, 
concave again at border with the lower mar- 
gin, lower margin convex and slightly reflexed 
at border with columellar margin, columellar 
margin rather vertical, little thickened and re- 
flexed (Fig. 1 25; Hadzisce, 1 959: 90-91 , figs. 
27-28; Radoman, 1963a: 77, fig. 5a; 1963b: 
93, fig. 5a; 1983: 115-116, table 7, pi. 8, fig. 
135). Dimensions: height = 0.92-1.15 mm; di- 
ameter = 0.84-1.08 mm, according to Rado- 
man, 1983: table 7 (height = 1.0-1.2 mm; di- 
ameter = 0.9-1 .1 mm, according to Hadzisce, 
1959). 

Operculum thick, yellowish red, paucispiral, 





124 





FIGS. 123-131. Shell and operculum of Hauffenia danubialis (Haase, 1993), from tfie pipe A89, Lobau, 
Wien, Austria, Pospisil leg. 24.1.1992, ex M. Haase collection (Figs. 123, 124), shell of Lyhnidia hadzii 
Hadzisce, 1 959. from the harbour of Trpezjca, Lake Ohrid, Macedonia, 5. 1 976, ex W. J. M. Maassen collec- 
tion (Fig. 125) and shell, operculum and anatomical details of Erythropomatiana verdica Radoman, 1978, ju- 
nior synonym of Hauffenia subpiscinalis (Kuscer, 1932), from spring on right bank of the Verd brook, near the 
Verd spnng, Vrhnika, Slovenia, M. Bodon leg. 17.6.1985 (Figs. 126-131). Figs. 123, 125, 126: shell; Figs. 
124, 127: outer face (left), profile (Fig. 124 centre; Fig. 127 right) and inner face (Fig. 124 right) of opercu- 
lum; Fig. 128: body of a male with palliai cavity open to show head and penis; Fig. 129: intestine and palliai 
organs of a male: Fig. 130: dorsal side (left) and ventral side (right) of penis; Fig. 131: renal and palliai 
oviduct, intestine and palliai organs of a female. Scale bar = 1 mm. 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



141 



without outgrowth at centre of inner face 
(Hadzisce, 1959:92). 

Body pigmented; eye spots present. 

Male genitalia with penis elongated, flat, ta- 
pering near apex, ending in rather pointed tip 
and with a small lobe on left side near apex 
(Hadzisce, 1959: 92, fig. 28; Radoman, 
1963a: 77, fig. 13a; 1963b: 93, fig. 13a; 1983: 
116). Hadzisce (1959, fig. 29) and Radoman 
(1963a: fig. 13a; 1963b: fig. 13a) show a dis- 
tinct penial lobe; however, Radoman's (1983: 
116) diagnosis of the genus does not mention 
this character: "Penis . . . smooth (without 
any outgrowth)"; the diagnosis is based, 
rather, on L. gjorgjevici, which has a penial tip 
without a distinct lobe. 

Female genitalia with proximal seminal re- 
ceptacle and a bursa copulathx arising from 
distal renal oviduct; seminal receptacle rather 
well developed; bursa copulatrix large, kid- 
ney-shaped, with rather short, wide duct en- 
tering bursa on anterior side; seminal groove 
running along ventral side of capsule gland 
(Radoman, 1963a: 77, fig. 13a; 1963b: 93, fig. 
13a; 1973a: 6, 10; 1983: 40, 114, 116). Rado- 
man's diagnosis (1983: 116) described a 
bursa copulatrix "very small, hardly visible be- 
hind the oviduct loop, with a long duct (fig. 
63)", but it was based on L. gjorgjevici, not on 
L. hadzii. 

Radula with central tooth trapezoidal, with 
long lateral wings and basal tongue, its apical 
margin V-like, with long robust central denticle 
and 4 smaller denticles on both sides in de- 
creasing order of size; one basal cusp at 
point where each lateral wing arises from 
face of central tooth; lateral teeth rake-like, 
apically enlarged, their anterior margin with 
about 8-9 denticles, central of which longer, 
larger; first marginal teeth rake-shaped, with 
long lateral wing and elongated cutting 
edge with long row of about 23 small denticles 
anteriorly; second marginal teeth scraper- 
shaped, with long, slender lateral wing and 
roundish, spoon-like apex, its cutting edge 
carrying rather long row of very small denti- 
cles (Hadzisce, 1959: 92, fig. 29; Rado- 
man, 1963a, fig. 17b; 1963b, fig. 17b; 1983: 
114). 

Stomach without posterior caecum; intes- 
tine unknown (Radoman, 1963a, fig. 13a; 
1963b, fig. 13a; 1973a: 6; 1983: 40, 116). 

Osphradium and ctenidium unknown. 

Nervous system with long pleuro-supraoe- 
sophageal and slightly shorter pleuro-suboe- 
sophageal connectives (Radoman, 1973a: 6; 
1983: 116). 



Taxonomy 

Lyhnidia is here considered a distinct 
genus. However, some of its anatomical de- 
tails are unknown, and its relationships to 
other Balkan genera require further study. 
Lytmidia is characterized by: shell very small, 
valvatiform-globose conical; operculum with- 
out peg; penis with one simple lobe; female 
genitalia with proximal seminal receptacle 
and large, kidney-shaped bursa copulatrix 
with anterior duct; central tooth with one pair 
of basal cusps. 

Apparently overlooking his earlier type des- 
ignation (as in the case of Karevia), Radoman 
(1967) erroneously reported Lyhnidia gjorgje- 
vici Hadzisce, 1959, as a type species of Ly- 
hnidia. 

Radoman (1983) included four other spe- 
cies from Lake Ohrid in Lyhnidia: L. gjorgjevici 
Hadzisce, 1959, L. /caraman/ Hadzisce, 1959, 
L. stankovici Hadzisce, 1959, L. sublitoralis 
Radoman, 1967, distinguished on the basis of 
few shell characters. 

Neohoratia Schutt, 1961a 

Neohoratia Schutt, 1961a: 71-72, as sub- 
genus of IHoratia. 

Type Species: Valvata (?) subpiscinalis 
Kuscer, 1932, by original designation. 

Neohoratia subpiscinalis (Kuscer, 1932) 

Valvata (?) subpiscinalis Kuscer, 1932: 51- 

53, pi. 5, fig. 1. 
Type Locality: "Der Rak-Bach unweit der ju- 

goslavisch-italienischen Grenze", Slove- 
nia. 
Type Material: holotype (2001a) in the Kuscer 

collection, Ljubljana, Slovenia (Kuscer, 

1932). 
Erythropomatiana verdica Radoman, 1978: 

36, pi. 5, figs. 20, 21. 
Type Locality: "Quelle im Bett des Flüsschens 

neben dem Dorf Verd, unweit von 

Vrhnika", Slovenia. 
Type Material: holotype and two paratypes 

(SMF 249615) are at the Senckenberg- 

Museum, Frankfurt am Main, Germany 

(Jovanovic, 1991). 

Material Examined 

Bole (1967a) studied the anatomy of speci- 
mens from the subterranean waters of the 
Ljubljanica basin, Slovenia. The specimens 



142 



BODÓN, MANGANELLI & GIUSTI 




140 



FIGS. 132-140. Shell, operculum and anatomical details of Hauffenia subpiscinalis (Kuscer, 1932) from the 
"Zelske Jame" caves, S. 576, near Rakek (Slovenia), 3.3.1966, ex F. Velkovrh collection (Figs. 132-136, 
138, 140) and from the spring Obrh, Gorenje Jezero, Cerknica, Slovenia, M. Bodon leg. 19.6.1985 (Figs. 
137-139). Fig. 132: shell; Fig. 133: body of a male with palliai cavity open to show head and penis; Fig. 134: 
outer face (left) and profile (right) of operculum; Fig. 135: renal and palliai oviduct, intestine and palliai or- 
gans of a female; Figs. 136-137: renal and palliai oviduct of two females; Fig. 138: prostate gland, stomach, 
intestine and pallia! organs of a male; Fig. 139: dorsal (left), right (centre) and ventral side (right) of penis; 
Fig. 140: dorsal side of penis of two males. Scale bar = 1 mm. 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



143 



examined for the present study were from the 
following sites (the first two sites were at the 
spring and caves which feed the Rak River, so 
they belong to the type locality): 

-"Zelske Jame" caves, S. 576, near Rakek, 
Slovenia, 33T VL 46, 3.3.1966, ex F. 
Velkovrh collection (2 males, 1 female); 
M. Buda Dancevich & F Stoch leg. 
1.7.1993 (2 shells). 

-Kotia spring, Rakov Skocjan. Plentiful 
karstic spring flooding into the Rak River, 
Slovenia, 33T VL 46, M. Bodon leg. 
18.6.1985 (1 female, many shells); M. 
Buda Dancevich & F Stoch leg. 1.7.1993 
(many shells). 

-Obrh spring, Gorenje Jezero, Cerknica. 
Plentiful karstic spring in the Cerknisko 
lake basin (the lake water floods into 
sinkholes and feeds the Rak River), 
Slovenia, 33T VL 56, M. Bodon leg. 
19.6.1985 (2 males, 1 female, 15 shells). 

—Spring of Zerovniscica, Zerovnica, Cerk- 
nica, Slovenia, 33T VL 57, F Gasparo & 
F Stoch leg. 14.10.1994 (1 male). 

-"Planinska Jama" cave, S. 748, Planina, 
Slovenia, 33T VL 47, F Gasparo & F 
Stoch leg. 5.6.1993 (1 male, 4 shells). 

— Mocilnik springs, Vrhnika; plentiful karstic 

springs which feed the Ljubljanica River, 
Slovenia, 33T VL 49, M. Bodon leg. 
17.6.1885 (2 females, many shells). 
—Spring on right bank of Verd brook, near the 
Verd spring, Vrhnika, Slovenia, 33T VL 
49, M. Bodon leg. 17.6.1985 (2 males, 1 
female, many shells) (type locality of 
Erythropomatiana verdica). 

— Ukovnik cave, S. 1165, Spodnja Idrija, Idri- 

jca valley, Slovenia, 33T VM 20, F Gas- 
paro & F Stoch leg. 5.6.1993 (1 female). 
-"Draga pri Ponikvah" cave, S. 972, Ponikve, 
Stanjel, Slovenia, 33T VL 17, S. Dolce & 
F Stoch leg. 19.7.1994 (1 male, 1 shell). 

— Springs of the Timavo River, S. Giovanni al 

Timavo, Duino-Aurisina, Trieste, Friuli- 
Venetia Julia, Italy, 33T UL 9071, M. 
Bodon leg. 31.3.1991 (1 female, many 
shells) (Pezzoli, 1988a, cited as Islamia 
(?) sp.). 

-Cave of Trebiciano, no. 17 VG, Trieste, 
Fhuli-Venetia Julia, Italy, 33TVL0959, S. 
Dolce & F Stoch leg. 8.12.1991 (1 juv. 
specimen, 4 shells), 26.1.1992 (2 males, 
1 female, 2 spec, and 7 juv. spec), F 
Stoch leg. 2.7.1996 (10 shells). 

-Spring in the square of Bagnoli della Rosan- 
dra which feeds a basin, Trieste, Friuli- 



Venetia Julia, Italy, 33T VL 1151, M. 
Bodon, M. M. Giovannelli & F Stoch leg. 
29.3.1991 (2 juv. spec, many shells). 

For other localities in Italy where only con- 
chological material has been found see Pez- 
zoli (1988a) and Bodon & Giovannelli (1993). 
For other localities in Slovenia, see Kuscer 
(1932), Bole (1970, 1979, 1985) and Bole & 
Slapnik(1997). 

Description 

Shell very small, valvatiform, thin, pale 
whitish, waxen, transparent when fresh; sur- 
face of protoconch malleated; spire generally 
well raised, consisting of 3.25-3.75 rapidly 
growing, convex whorls; last whorl dilated, 
more or less descending, often slightly de- 
tached near aperture; umbilicus rather narrow; 
aperture wide, prosocline, roundish; peris- 
tome complete, thin, slightly reflected only at 
columellar margin (Figs. 90, 1 26, 1 32; Kuscer, 
1932: 51-52, pi. 5, fig. 1; Schutt, 1961a: 71; 
Bole, 1970: 92, fig. 3A-G; Bole: 1979a, fig. 
1(5a-5b); Maassen: 1975, pi. 27, figs. 1-3; 
Bole & Velkovrh, 1 986: fig. 31 ; Hershler & Lon- 
gley, 1986: fig. 71). Dimensions: height = 1.3- 
2.6 mm; diameter = 1 .4-2.9 mm. 

Operculum thin, yellowish, paucispiral, 
slightly thickened, but lacking peg or any kind 
of outgrowth at centre of inner face (Figs. 41 , 
127, 134; Bole, 1967a: 84, fig. 3A5; 1993: 8, 
fig. 2B). 

Body unpigmented (sometimes a few 
traces of pigment in wall of visceral sac); eye 
spots absent (Figs. 128, 133). 

Male genitalia with prostate gland bulging 
slightly into palliai cavity; penis rather short, 
flat, with apex enlarged, blunt or slightly 
pointed; 1 -3 small, knob-like lateral lobes on 
left side near apex; sometimes slightly raised 
pleat at centre of ventral side about 2/3 of 
penis length; penial duct zig-zagging through 
central portion of penis to open at penis tip; 
large, pyriform mass of réfringent cells inside 
penis apex to right of penial duct; terminal part 
of penial duct (immediately before opening) 
with very small stylet (Figs. 100, 129-130, 
138-140; Bole, 1967a: 84, fig. 3A4; 1993: 8, 
fig. 1С). 

Female genitalia with proximal seminal re- 
ceptacle and a bursa copulatrix arising from 
distal renal oviduct; seminal receptacle small, 
sessile or with very short duct arising from 
oviduct level with end of loop; bursa copulatrix 
reduced, small, but longer than seminal re- 



144 



BODÓN, MANGANELLI & GIUSTI 



ceptacle, not dilated at apex, arising very 
close to point at which oviduct enters albumen 
gland portion of pallia! oviduct; seminal 
groove running along ventral side of capsule 
gland (Figs. 102, 103. 131, 135-137; Bole, 
1967a; 84, fig. 3A3; 1993; 8, fig. IB). Histo- 
logical study of female genitalia gave results 
in line with those described for H. tellinii. 

Radula with central tooth trapezoidal, with 
long lateral wings and basal tongue, its apical 
margin V-like, with long robust central denticle 
and 5-6 smaller denticles on both sides in de- 
creasing order of size; 2-3 basal cusps at 
point where each lateral wing arises from face 
of central tooth; lateral teeth rake-like, apically 
enlarged, their anterior margin with 9-13 
denticles, central of which longer, larger; first 
marginal teeth rake-shaped, with long lateral 
wing and elongated cutting edge with long 
row of 19-25 small denticles anteriorly; sec- 
ond marginal teeth scraper-shaped, with long, 
slender lateral wing and roundish, spoon-like 
apex, its cutting edge carrying rather long row 
of 10-12 very small denticles (Figs. 50-52; 
Bole, 1967a: 83, fig. 3A6; Hershler & Longley, 
1986; fig. 28D; Bole, 1993; 8, fig. 2A). 

Stomach without posterior caecum; intes- 
tine with well developed, S-like bend on palliai 
wall (Figs. 129, 131, 135, 139; Bole, 1967a; 
83). 

Osphradium variable in size, elongated, 
oval or kidney-shaped; ctenidium consisting 
of 9-16 lamellae (Figs. 129, 131, 135, 139; 
Bole, 1967a; 83, fig. 3A1; 1993; 8, fig. 1A). 

Nervous system with very short connec- 
tives (Bole, 1967a; 84). 

Taxonomy 

Neohoratia is here considered a junior syn- 
onym of Hauffenia Pollonera, 1898 (see "The 
status and relationships of Hauffenia"). Schutt 
(1961a) introduced Neohoratia, as subgenus 
of Horatia, for Valvata subpiscinalis Kuscer, 
1932. Subsequently, Neohoratia was re- 
garded as a subgenus of Hauffenia by Boeters 
(1974), completely overlooked by Radoman 
(1978, 1983), and ranked as a full genus by 
Bole & Velkovrh (1986), Boeters (1988, 1998) 
and Bole (1993). 

Erythropomatiana verdica Radoman, 1978, 
is here recognized as junior synonym of Neo- 
horatia subpiscinalis (see taxonomic remarks 
to H. subpiscinalis, in the section on Hauffenia 
species). 

Many nominal species from different south 
European localities (from Greece to Spain) 



have been assigned to Neohoratia (some- 
times regarded as a subgenus of Hauffenia or 
Horatia, sometimes as a distinct genus) by 
Schutt (1962, 1980), Bernasconi (1975), Boe- 
ters (1981, 1988, 1998), Gittenberger (1982), 
Vidal-Abarca & Suarez (1985), Boeters & Ro- 
lan (1988), Bech (1990), Hinz et al. (1994), 
Ramos et al. (1992) and Rolan (1997a, b). All 
were assigned to Neohoratia on the basis of 
shell characters, only in few cases followed by 
anatomical study. All are in need of revision 
(see below). 

Ohridohauffenia Hadzisce 1959 

Ohridohauffenia Hadzisce, 1959; 74, as sub- 
genus of Ohridohoratia. 

Type Species; Ohridohoratia {Ohridohauffe- 
nia) gjorgjevici hadzisce, 1959, by mono- 
typy. Ohridohoratia gjorgjevici is a junior 
synonym of Pseudamnicola depressa 
Radoman, 1957, according to Radoman 
(1963a, b, 1983). 

Ohridohauffenia depressa (Radoman, 1957) 

Pseudamnicola depressa Radoman, 1957: 
88-91, figs. 2, 5, 7B, E. 

Type Locality: ". . . su uz istocnu obalu Ohrid- 
skog jezera, po obalskom kamenju, 
pocev od izvora Veli Dab pa do pocetka 
peskovite juzne obale jezera, prema Sv. 
Naumi", Lake Ohrid, Macedonia. Accord- 
ing to Radoman (1983: 75) the type lo- 
cality is "Lake Ohrid, on the bank stones 
by Veli Dab". 

Type Material: lectotype (BEO 142, shell) is at 
Prirodnjacki Muzej u Beograd (Jo- 
vanovic, 1991). 

Ohridohoratia (Ohridohauffenia) gjorgjevici 
Hadzisce, 1959; 75-76, figs. 12, 13. 

Type Locality: ". . . die ich an seichten Stellen 
des steinigen Literals gefunden habe 
. . .", Lake Ohrid, Macedonia. 

Type Material; Hadzisce (1959) did not give 
any information about the type material. 

Description 

Shell very small, valvatiform, depressed; 
microsculpture of protoconch unknown; spire 
rather depressed, consisting of 3-3.25 rapidly 
growing, slightly convex whorls; last whorl 
large, rather dilated, with distinct keel at pe- 
riphery; umbilicus moderately wide; aperture 
prosocline, pyriform, distinctly angled at cen- 
tre of external margin, with external margin 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



145 



slightly concave immediately above and 
below keel; peristome complete, thin, slightly 
reflected only at columellar margin (Rado- 
man, 1957: 88, fig. 2; Hadzisce, 1959: 75-76, 
fig. 12, as Ohridohoratia {Ohridohauffenia) 
gjorgjevici; Radoman, 1963a: fig. 4a; 1963b: 
fig. 4a; 1983: 75, pi. 5, fig. 69; Jovanovic, 
1991: pi. 5, fig. 35). Dimensions: height = 
0.81-1.04 mm; diameter = 1.25-1.53 mm 
(Radoman, 1983: 75, table 5). 

Operculum thin, yellowish red, paucispiral, 
slightly thickened, without outgrowth on inner 
face (Hadzisce, 1959: 76, as Ohridohoratia 
{Ohridohauffenia) gjorgjevici; Radoman, 
1983:75). 

Body pigmented; eye spots present. 

Male genitalia with penis large, flat with 
long conical tip, slightly obtuse apex, and one, 
more or less evident, sometimes pointed lobe 
on left side about 2/3 of penis length (Rado- 
man, 1957: 91, fig. 7E; Hadzisce, 1959: 76, 
fig. 12, as Ohridohoratia {Ohridohauffenia) 
gjorgjevici; Radoman, 1963: fig. 12a; 1963b: 
fig. 12a; 1983: 75, fig. 37). 

Female genitalia with two seminal recepta- 
cles and a bursa copulathx arising from distal 
renal oviduct; proximal seminal receptacle 
much larger than distal, which is rudimentary; 
bursa copulatrix large, kidney-shaped, with 
long, slender duct entering bursa on anterior 
side; seminal groove running along ventral 
side of capsule gland (Radoman, 1957: 
90-91, fig. 7B; 1963a: fig. 12a; 1963b: fig. 
12a; 1973a: 6; 1983: 75: fig. 37). 

Radula with central tooth trapezoidal, its 
cutting edge with 9-11 denticles, central 
longer; long lateral wings and basal tongue; 
one basal cusp at point where each lateral 
wing arises from face of central tooth; lateral 
teeth rake-like, apically enlarged, their ante- 
rior margin with 8-11 denticles, central of 
which longer, larger; first marginal teeth rake- 
shaped, with long lateral wing and elongated 
cutting edge with long row of 14-21 small 
denticles anteriorly; second marginal teeth 
scraper-shaped, with long, slender lateral 
wing and roundish, spoon-like apex, its cut- 
ting edge carrying rather long row of nu- 
merous, very small denticles (Radoman, 
1957: 90, fig. 5; Hadzisce, 1959: 76, fig. 13, 
as Ohridohoratia {Ohridohauffenia) gjorgje- 
vici). 

Stomach without posterior caecum; intes- 
tine unknown (Radoman, 1973a: 6; 1983: 40). 

Osphradium and ctenidium unknown. 

Nervous system with long pleuro-supraoe- 
sophageal and slightly shorter pleuro-suboe- 



sophageal connectives (Radoman, 1973a: 6; 
1983:75). 

Taxonomy 

Ohridohauffenia is here considered a dis- 
tinct genus, but its relationships to Ohrigocea 
Hadzisce, 1959, and possibly also Karevia 
Hadzisce, 1959, need to be clarified. Ohrido- 
hauffenia is characterized by: shell very small, 
valvatiform, sometimes carínate; operculum 
without peg; penis with one simple lobe; fe- 
male genitalia with two seminal receptacles, 
proximal larger than distal (which is rudimen- 
tary), and large, kidney-shaped bursa copula- 
trix with anterior duct; central tooth with one 
pair of basal cusps. 

Rotondia Radoman, 1964 (pp. 108, 109; 
type species: Pseudamnicola {Rotondia) ro- 
tonda Radoman, 1964, by original designa- 
tion), is regarded as a junior synonym of Ohri- 
dohauffenia Hadzisce, 1959, by Radoman 
(1983). Rotondia was established without a 
description or definition, but only by combining 
it with some available nominal species; it is 
therefore not available (ICZN, 1 999: Art. 1 3.6). 
Likewise, A/aum/a Radoman, 1973a, regarded 
by Radoman (1983) as a junior synonym 
of Ohridohauffenia, is not available. In fact, it 
was established by Radoman (1973a: 8, for 
Pseudamnicola {Rotondia) st. naumi[sic] Ra- 
doman, 1964) without a description or defini- 
tion, but only by combining it with an available 
species group name. After 1 930, this condition 
does not make a generic name available 
(ICZN, 1999: Art. 13.6). 

Radoman (1983) includes five other 
species from Lake Ohrid and nearby springs 
in Ohridohauffenia: O. sublitoralis (Radoman, 
1963a), O. rotonda (Radoman, 1964), O. min- 
uta (Radoman, 1955), O. drimica (Radoman, 
1964), and O. sanctinaumi {Radoman, 1964). 

Ohrigocea Hadzisce, 1959 

Ohrigocea Hadzisce, 1959: 76-77. 

Type Species: Ohrigocea samuili Hadzisce, 
1959, by subsequent designation (Rado- 
man, 1963a). 

Ohrigocea samu/// Hadzisce, 1959 

Ohrigocea {Ohrigocea) samuili Hadzisce, 
1959: 77-79, figs. 14, 15. 

Type Locality: "lebt in den seichten Zonen des 
steinigen Literals auf der nord-östlichen, 
östlichen und sud-östlichen Seite des 






150 




FIGS. 141-156. Shell and operculum of Ohrigocea samuili Hadzisce, 1959, from H. Gorica, Lake Ohrid, 
Macedonia, 5.1975, ex W. J. M. Maassen collection (Figs. 141, 142); shell, operculum and anatomical de- 
tails of Pezzolia radapalladis Bodon & Giusti, 1986, from the spring inside the Rio di Tonnego, Ponte della 
Vittoha, Rapallo, Genova, Liguna, Italy, M. Bodon leg. 16.5.1981, 4.10.1981, 6.11.1982 (Figs. 143, 144, 
1 48- 1 51 ) and from the spring on the right bank of the Bana Stream, below the tank of the aqueduct of Bana, 
Camogli, Genova, Liguria, Italy, M. Bodon leg. 26.1.1992 (Figs, 147, 152): anatomical details of Pezzolia sp. 
2 from alluvial spring on bed of the Gánate Stream near the cave of Cavassola, Genova, Liguria, Italy, 32T 
NQ 0222, M. Bodon leg. 24.12.1983 (Figs. 145, 155) and of Pezzolia sp. 1 from springs in the Nervi Stream 
valley, Genova, Liguria, Italy, 32T NQ 031 5, M. Bodon leg. 1 5. 1 . 1 983, 32T NQ 041 6, M. Bodon leg. 3. 1 2. 1 983 
(Figs. 146, 153, 154); shell of Prespolitorea valvataeformis Radoman, 1973a, from Lake Prespa, 3 Km north 
of Otesevo, Macedonia, exW. J. M. Maassen collection (Fig. 156). Figs. 141, 143, 156: shell: Figs. 142, 144: 
outer face (Fig. 1 42 left, Fig. 1 44), profile (Fig. 1 42 centre) and inner face (Fig. 1 42 right) of operculum: Figs. 
145-147: renal and palliai oviduct of three females: Fig. 148: intestine and palliai organs of a male: Fig. 149: 
renal and palliai oviduct, intestine and palliai organs of a female: Fig. 150: head of a male: Figs. 151-155: 
dorsal side of penis of six males. Scale bar = 1 mm. 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



147 



Sees [Lake Ohrid]", Macedonia. Accord- 
ing to Radoman (1983: 79), the type lo- 
cality is "Lake Ohrid, on bank stones by 
Veli Dab. Spread along all the rocky east 
lake bank, exclusively on stones". 
Type Material: Hadzisce (1959) did not give 
any information about the type material. 

Material Examined 

— H. Gorica, Lake Ohrid, Macedonia, 34T DL 
84, 5. 1975, exW. J. M. Maassen collec- 
tion (2 shells with operculum, 2 shells). 

Description 

Shell very small, valvatiform, sometimes 
depressed; microsculpture of protoconch un- 
known; spire slightly raised, consisting of 
2.75-3 rather rapidly growing, convex whorls; 
last whorl, large, dilated, more or less de- 
scending near aperture; umbilicus wide; aper- 
ture prosocline, ovoid to pyriform, moderately 
angled at its upper vertex, its external margin 
slightly concave at upper half; peristome com- 
plete, thin, slightly reflected only at columellar 
margin (Fig. 141; Hadzisce, 1959: 77-78, fig. 
14; Radoman, 1963a: fig. 6a; 1963b: fig. 6a; 
1983: 79, pi. 5, fig. 74). Dimensions: height = 
0.65-0.80 mm; diameter = 1.08-1.20 mm 
(Radoman, 1983: table 5). 

Operculum rather thick, yellowish red, pau- 
cispiral, thicker at centre of Inner face, without 
peg (Fig. 142; Hadzisce, 1959: 78). 

Body pigmentation not described; eye 
spots present (Hadzisce, 1959: fig. 14) 

Male genitalia with penis rather elongated, 
conical, moderately pointed, and with one, 
rather evident, pointed lobe on left side about 
2/3 of penis length (Hadzisce, 1959: 79, fig. 
14; Radoman, 1963a: 78, fig. 14a; 1963b: 94, 
fig. 14a; 1983: 78, fig. 39). 

Female genitalia with two seminal recepta- 
cles and a bursa copulatrix arising from distal 
renal oviduct; proximal seminal receptacle 
larger than distal, which is reduced; bursa 
copulatrix large, kidney-shaped, with long, 
slender duct entering bursa on anterior side; 
seminal groove running along ventral side of 
capsule gland (Radoman, 1963a: 78, fig. 14a; 
1963b: 94, fig. 14a; 1973a: 6; 1983: 40, 78, 
fig. 39). 

Radula with central tooth trapezoidal, with 
long lateral wings and basal tongue, its apical 
margin V-like, with long, robust central denti- 
cle and 4 smaller denticles on both sides in 



decreasing order of size; one basal cusp at 
point where each lateral wing arises from face 
of central tooth; lateral teeth rake-like, their 
anterior margin with about 9 denticles; first 
marginal teeth rake-shaped, with row of about 
20 denticles anteriorly; second marginal teeth 
scraper-shaped, with long, slender lateral 
wing and roundish, spoon-like apex, its cut- 
ting edge carrying row of about 20 denticles 
(Hadzisce, 1959: 78-79, fig. 15; Radoman, 
1963a: 90, fig. 17c; 1963b: 109, fig. 17c). 

Stomach without posterior caecum; intes- 
tine unknown (Radoman, 1973a: 6; 1983: 40). 

Osphradium and ctenidium unknown. 

Nervous system with long pleuro-supraoe- 
sophageal and slightly shorter pleuro-suboe- 
sophageal connectives (Radoman, 1973a: 6; 
1983:78). 

Taxonomy 

Ohrigocea is here considered a distinct 
genus, but its relationships to Ohridohauffenia 
Hadzisce, 1959, and possibly also Karevia 
Hadzisce, 1959, need to be clarified. Ohrigo- 
cea is characterized by: shell very small, val- 
vatiform, depressed, sometimes carínate; op- 
erculum without peg; penis with one simple 
lobe; female genitalia with two seminal recep- 
tacles, proximal larger than distal, which is 
rudimentary, and large, kidney-shaped bursa 
copulatrix with anterior duct; central tooth with 
one pair of basal cusps. 

Ohridosturanya Radoman, 1973a, re- 
garded by Radoman (1983) as a junior syn- 
onym of Ohrigocea, is not available. In fact, it 
was established by Radoman (1973b: 8; for 
IHoratia (Hauffenia) stankovici Hadzisce, 
1959) without a description or definition, but 
only by combining it with an available species- 
group name. After 1930, this condition does 
not make a generic name available (ICZN, 
1999: Art. 13.6). 

Radoman (1983: 78-80), assigned three 
other species to Ohrigocea: O. karevi 
Hadzisce, 1959, O. m/Vacf/'noi/orum Hadzisce, 
1959, and O. stentowc/ (Hadzisce, 1959). All 
are distinguished mainly by shell characters 
and live, together with O. samuili, in the Lake 
Ohrid. 

Pezzolia Bodon & Giusti, 1986 

Pezzolia Bodon & Giusti, 1986: 62-63. 
Type Species: Pezzolia radapalladis Bodon & 
Giusti, 1986, by original designation. 



148 



BODÓN, MANGANELLI & GIUSTI 



Pezzolia radapalladis Bodón & Giusti, 1986 Description 



Pezzolia radapalladis Bodón & Giusti, 1986: 
63-66, table 1, figs. 1A-G, pi. 1, figs. A- 
D, pi. 2, figs. A-D. 

Type Locality: "spring inside the Rio di Ton- 
nego, close to the Ponte della Vittoria, 
Rapallo, Genova. 3°14'34"N: 44°22' 
14"E; 30 m a. s. I. Square on the map of 
the Military Geographic Institute: 83 II 
SO, Rapallo", Italy. 

Type Material: the holotype (SMF 305486, 
shell) is at the Senckenberg-Museum, 
Frankfurt am Main, Germany; paratypes 
(shells and preserved specimens) are at 
the Museo Civico di Storia Naturale G. 
Doria, Genoa, Italy, and in the Giusti 
(Siena. Italy), Bodon (Genoa, Italy), and 
Pezzoli (Milan, Italy) collections (Giusti & 
Pezzoli, 1981). 

Material Examined 

-Spring inside the Rio di Tonnego, Ponte 
della Vittoria, Rapallo, Genova, Liguria, 
Italy, 32T NO 1613, M. Bodon leg. 
16.12.1979, 31,12.1979, 29.11.1980, 

3.12.1980, 4.4.1981, 3.4.1981, 

16.5.1981, 4.10.1981, 6.11.1982 (8 
males, 7 females, some specimens, 
many shells). 

-Spring at Le Rocche, Casalino, Rapallo, 
Genova, Liguria, Italy, 32T NO 1512, S. 
Gaiter leg. 28.8.1991 (1 female, many 
shells). 
Spring on right bank of the Bana Stream, 
below the tank of the Bana aqueduct, 
Camogli, Genova, Liguria, Italy, 32T 
NO 1410, M. Bodon leg. 26.1.1992, 
12.4.1992 (3 males, 5 females, some 
specimens, many shells). 
Cave Valdettaro no. 129 Li, Rapallo, Ra- 
pallo, Genova, Liguria, Italy, 32T NO 
1710, M. Bodon leg. 6.11.1992(1 male, 3 
females, 11 shells). 

-Spring on left bank of the S. Francesco 
Stream, II Campo, Rapallo, Genova, Li- 
guria, Italy, 32T NO 1913, M. Bodon leg. 
31.3.1996, 15.12.1996 (2 males, 1 fe- 
male, many shells). 

-Spring on right bank of the Recco Stream, 
below the church of Avegno, Genova, 
Liguria, Italy, 32T NO 1315, M. Bodon 
leg. 10.9.1994, 12.11.1994, 19.11.1996 
(1 male, 3 females, a few shells). 

For other localities where only shells have 
been collected see Pezzoli, 1988a. 



Shell very small, valvatiform, thin, whitish, 
waxen, transparent when fresh; surface of 
protoconch malleated; surface of teleoconch 
with thin growth-lines; spire raised, rarely de- 
pressed, planispiral, consisting of 2.5-3.25 
rather rapidly growing convex whorls; last 
whorl large, slightly dilated, descending near 
aperture; umbilicus wide; aperture prosocline, 
oval or slightly pyriform; peristome complete, 
thin, slightly reflected only at columellar mar- 
gin (Figs. 91, 143; Bodon & Giusti, 1986: 
62-64, pi. 1 , figs. AD). Dimensions: height - 
0.58-1 .05 mm; diameter = 0.95-1 .37 mm. 

Operculum thin, pale yellowish, paucispiral, 
slightly thicker, but without traces of outgrowth 
at centre of inner face (Fig. 144; Bodon & 
Giusti, 1986:62, 64, fig. 1С). 

Body unpigmented (a few traces of pigment 
in wall of visceral sac); eye spots absent (Fig. 
150; Bodon & Giusti, 1986; 62, 64, fig. 1A, B). 

Male genitalia with penis from short to elon- 
gated, flat, without lobes; penis terminal por- 
tion widening slightly before ending in short, 
pointed, conical-flat apex; penial duct zig-zag- 
ging through right portion of penis to open at 
penis tip (Figs. 151, 152; Bodon & Giusti, 
1986:62, 64, fig. IB, G, table 1). 

Female genitalia with two seminal recepta- 
cles and bursa copulathx (when present) aris- 
ing from distal renal oviduct; proximal seminal 
receptacle small, sometimes slightly smaller 
than distal; bursa copulathx very reduced or 
absent, with very short duct so as to appear 
equal in size to distal seminal receptacle or 
sometimes smaller; seminal groove running 
along ventral side of capsule gland (Figs. 147, 
149; Bodon & Giusti, 1986: 62, 64, fig. IE, F 
table 1). 

Radula with central tooth trapezoidal with 
long lateral wings and basal tongue; anterior 
margin with 15-19 denticles, central of which 
longer, larger; one basal cusp at point where 
each lateral wing arises from face of central 
tooth; lateral teeth rake-like, apically enlarged, 
their anterior margin with 13-18 denticles, 
central of which longer, larger; first marginal 
teeth rake-shaped, with long lateral wing and 
elongated cutting edge with long row of 1 1 - 1 6 
small denticles anteriorly; second marginal 
teeth scraper-shaped, with long and slender 
lateral wing and roundish, spoon-like apex, its 
cutting edge carrying rather long row of very 
small denticles (Bodon & Giusti, 1986: 62, 64, 
pi. 2, figs. A-D). 

Stomach without posterior caecum; intes- 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



149 



tine with well-developed S-like bend on palliai 
wall (Figs. 148-149; Bodon & Giusti, 1986: 
62, 64, fig. ID, E). 

Osphradium oval or reniform; ctenidium ab- 
sent (Figs. 148-149; Bodon & Giusti, 1986: 
62,64, Fig. 1D, E). 

Nervous system unknown. 

Taxonomy 

Pezzolia is characterized by: shell very 
small, valvatiform; operculum without peg; 
penis with or without glandular lobe/s; female 
genitalia with two seminal receptacles, proxi- 
mal equal or smaller than distal, and bursa 
copulathx very reduced or absent; central 
tooth with one pair of basal cusps. 

In the only population of Pezzolia radapal- 
ladis studied by Bodon & Giusti (1986), the 
bursa copulatrix was always present, but in 
other populations subsequently discovered, it 
may be extremely reduced or even absent 
(Fig. 147). Other populations of Pezzolia re- 
cently found in the subterranean waters of 
Liguria are distinct from P. radapalladis by 
virtue of conchological (more globose shell) 
and anatomical (penis with 1-2 glandular 
lobes) characters (Figs. 145, 146, 153-155). 
This may support the existence of more than 
one species of Pezzolia (Pezzoli, 1988a; 
Bodon et al., 1995b). 

Prespolitorea Radoman, 1983 

Prespolitorea Radoman, 1983: 68. 
Type Species: Prespolitorea valvataeformis 
Radoman, 1983, by original designation. 

Prespolitorea valvataeformis 
Radoman, 1973a 

Prespolitoralia [sic] valvataeformis Radoman, 
1973a: 20-21. 

Type Locality: "stony, south-west coast of 
Lake Prespa, on the stones in the shal- 
low coastal zone", Macedonia. 

Type Material: lectotype (BEO 120, shell) at 
the Prirodnjacki Muzej u Beograd, to- 
gether with a paralectotype (BEO 121, 
shell) (Jovanovic, 1991). 

Material Examined 

-Lake Prespa, 3 km north of Otesevo, Mace- 
donia, 33T DL 94, exW. J. M. Maassen 
collection (1 shell). 



Description 

Shell very small, valvatiform; surface of pro- 
toconch malleated; spire rather depressed, 
consisting of 3-3.5 rather rapidly growing, 
convex whorls; last whorl large, dilated, 
slightly descending near aperture; umbilicus 
moderately wide, sometimes partly covered 
by reflected columellar margin of peristome; 
aperture prosocline, irregularly ovoid, its ex- 
ternal margin sinuous, somewhat angled at 
periphery; peristome complete, thin, slightly 
thickened, reflected at columellar margin 
(Fig. 156; Radoman, 1973a: 20-21; 1983: 
68, pi. 4, fig. 60; Jovanovic, 1991: pi. 4, fig. 
28). Dimensions: height = 0.84-1.01 mm; di- 
ameter = 1.18-1.30 mm (Radoman, 1983: 
table 4). 

Operculum probably without outgrowth, 
though not specified. 

Body pigmented; eye spots present. 

Male genitalia with penis large, flat, apically 
extended in rather pointed conical tip, and 
with one small pointed lobe on left side about 
2/3 of penis length (Radoman, 1973a: 21; 
1983:68, fig. 31). 

Female genitalia with two seminal recepta- 
cles and a bursa copulatrix; proximal seminal 
receptacle much larger than distal, which is 
rudimentary; bursa copulatrix large, globose, 
with long, slender duct entering bursa on an- 
terior side; seminal groove running along ven- 
tral side of capsule gland (Radoman, 1973a: 
6,21; 1983:40, 68, fig. 31). 

Radula with central tooth with one pair of 
basal cusps; other details unknown (Rado- 
man, 1983: 40). 

Stomach without posterior caecum; intes- 
tine unknown (Radoman, 1973a: 6; 1983: 40). 

Osphradium and ctenidium unknown. 

Nervous system with long pleuro-supraoe- 
sophageal and shorter pleuro-suboesopha- 
geal connectives (Radoman, 1973a: 6; 1983: 
68). 

Taxonomy 

As Radoman (1973a: 7, 20-21) established 
Prespolitorea without a description or defini- 
tion, but only by combining it with two new 
species (one of which he designated as type 
species), this nominal genus was not made 
available in 1973 (ICZN, 1999: Art. 13.6). On 
the contrary, the two new nominal species are 
available (ICZN, 1999: Art. 11.9.3). Prespoli- 
torea is here considered a distinct genus. 
However, some of its anatomical details are 



150 



BODÓN. MANGANELLI & GIUSTI 



unknown, and its relationships to other Balkan 
genera (especially Daphnlola Radoman, 
1973, and Horatla Bourguignat, 1887) require 
further study. Prespolitorea is characterized 
by: shell very small, valvatifornn; operculum 
without peg; penis with one simple lobe; fe- 
male genitalia with two seminal receptacles, 
proximal larger than distal (which is rudimen- 
tary), and large, globose bursa copulatnx with 
anterior duct. 

Radoman (1973a: 21) included in Prespoli- 
torea the type species, endemic to Lake 
Prespa, and another species from Lake Malo, 
south of Lake Prespa. Albania. P. malapres- 
pensis Radoman. 1973a, distinguished from 
P. valvataeformis by shell shape. 



Pseudohoratia Radoman, 1967 

Pseudohoratia Radoman, 1967: 149-151. 
Type Species: Valvata ochridana Polinski, 
1929, by original designation. 

Pseudohoratia ochridana (Polinski, 1929) 

Valvata {Atropldina) ochridana Polinski, 1929: 
136-137. 

Type Locality: "[Lake Ohrid]", Macedonia. Ac- 
cording to Radoman (1983: 115): "Lake 
Ohnd, in the Chara zone in the Ohrid 
gulf. 

Type Material: Polinski (1929) did not give any 
information about the type material. 

Material Examined 

-Lake Ohrid, Macedonia, 34T DL, ex P. 
Radoman collection (2 males, 1 female). 



Description 

Shell very small, valvatiform, thin, yellow- 
ish, glassy, transparent when fresh; surface of 
protoconch malleated; spire raised, consist- 
ing of 3-3.25 rather rapidly, regularly growing, 
convex whorls: last whorl large, slightly di- 
lated, more or less descending near aperture; 
umbilicus from small to wide; aperture proso- 
cline, roundish to oval; peristome complete, 
slightly thickened, slightly reflected only at 
columellar margin (Figs. 92, 157; Polinski, 
1929: 136-137; 1932: 617, pi. 7, fig. 4; Rado- 
man, 1953: 64-66, figs. 1 -3, 8, table 1 ; 1955: 
60, table 4, pi. 5, figs. 9-11; 1967: 149, fig. 1; 



1983: 114, pi. 8, fig. 131). Dimensions: height 
= 0.94-1.30 mm; diameter = 1.00-1.39 mm 
(Radoman, 1983; table 7). 

Operculum slightly thickened, reddish yel- 
low, paucispiral, with small, not or slightly api- 
cally dilated peg at centre of inner face (Figs. 
40, 159; Radoman, 1953; 66, fig. 4; 1955: 
57-58; 1967: 149, fig. 1; 1983; 114) 

Body unpigmented; eye spots present (Fig. 
158). 

Male genitalia with prostate gland bulging 
well into palliai cavity; penis cylindrical, elon- 
gated, tapering near apex, ending in rather 
pointed tip, with small, non-glandular lobe on 
left side about 2/3 of penis length; penial duct 
zig-zagging through right or central (near tip) 
portion of penis to open at penis tip (Figs. 160, 
161; Radoman, 1955; 43-44, fig. 99; 1967: 
fig. 2c; 1983: 114, fig. 61D). 

Female genitalia with proximal seminal re- 
ceptacle and a bursa copulatrix arising from 
distal renal oviduct; seminal receptacle small 
but proportionally rather developed, bent to 
adhere to oviduct; bursa copulatrix very small, 
with long, slender duct entering bursa on an- 
terior side; seminal groove running along ven- 
tral side of capsule gland (Fig. 162; Radoman, 
1955: 36, 38-39, figs. 82, 83, 86-97; 1967; 
150, fig. 2d; 1973a: 6, 10; 1983: 40, 114, fig. 
61C). 

Radula with central tooth trapezoidal, with 
long lateral wings and basal tongue, its apical 
margin V-like, with long, robust central denti- 
cle and 3-4 smaller denticles on both sides in 
decreasing order of size; one basal cusp at 
point where each lateral wing arises from face 
of central tooth; lateral teeth rake-like, apically 
enlarged, their anterior margin with 9-11 den- 
ticles, central of which longer, larger; first 
marginal teeth rake-shaped, with long lateral 
wing and elongated cutting edge with long 
row of 15-18 small denticles anteriorly; sec- 
ond marginal teeth scraper-shaped, with long, 
slender lateral wing and roundish, spoon-like 
apex, its cutting edge carrying rather long row 
of very small denticles (Radoman, 1955: 
12-13, fig. 17, table 2; 1967: 150, fig. 2a; 
1983: 114, fig. 61A). 

Stomach without posterior caecum; intes- 
tine without bend on palliai wall (Figs. 161, 
162; Radoman, 1955: 21-24, figs. 34, 35; 
1973a: 6; 1983:40). 

Osphradium variable in size, elongated, el- 
liptical; ctenidium consisting of 7-9 lamellae 
(Figs. 161,1 62; Radoman, 1 955: 1 1 , table 1 ). 

Nervous system with long pleuro-supraoe- 
sophageal and shorter pleuro-suboesoph- 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



151 





FIGS. 157-170. Shell, operculum and anatomical details of Pseudohoratia ochridana (Polinski, 1929) from 
Lake Ohrid, Macedonia, ex P. Radoman collection (Figs. 157-162) and of Hauffenia wagneri {Kuscer, 1928) 
from the spring of the "Vranja pec" cave, Bostanj, Sevnica, Krsko, Slovenia, M. Bodon leg. 14.6.1985 (Figs. 
163-170). Figs. 157, 163-165: shells; Figs. 158, 168: body of a male with palliai cavity open to show head 
and penis; Figs. 159, 166: outer face (left), profile (centre; also extreme right in Fig. 166) and inner face (right) 
of operculum; Figs. 1 60, 1 69: dorsal side of penis of two males; Figs. 161,1 70: prostate gland, stomach (ex- 
cluded in Fig. 170), intestine and palliai organs of a male; Figs. 162, 167: renal and palliai oviduct, intestine 
and palliai organs of a female. Scale bar = 1 mm. 



152 



BODÓN, MANGANELLI & GIUSTI 



ageal connectives {Radoman, 1955: 45-46, 
fig. 123: 1967: 150. fig. 2b: 1973a: 6: 1983: 
114, fig. 61B). 

Taxonomy 

Pseudohoratia is characterized by: shell 
very small, valvatiform: operculum with peg; 
penis with one simple lobe: female genitalia 
with proximal seminal receptacle and bursa 
copulatrix very small, but with long anterior 
duct: central tooth with one pair of basal 
cusps. 

Horatia polinskii Radoman, 1953 (pp. 
64-67, figs. 1 -4; type locality: ". . . lac d'Ohrid 
. . . entre 20 et 120 m de profondeur . . .") is 
a junior synonym of Pseudohoratia ochri- 
dana (Polinski, 1929) according to Radoman 
(1983). 

Radoman (1983: 115) included two more 
species from Lake Ohrid in Pseudohoratia: P. 
brusinae (Radoman, 1953) and P. lacustris 
(Radoman, 1964). They are distinguished by 
shell shape. Two out of 100 females of P. 
brusinae had a very rudimentary distal semi- 
nal receptacle (Radoman, 1983: 115). 

Pseudoislamia Radoman, 1979 

Pseudoislamia Radoman, 1979: 23. 
Type Species: Pseudoislamia balcánica 
Radoman, 1979, by original designation. 

Pseudoislamia balcánica Radoman, 1979 



gin slightly concave; central part of external 
margin projected forwards, angled; lower 
margin convex): peristome complete, thin, 
slightly reflected only at columellar margin 
(Radoman, 1 979: 23, 27, pi. 1 , figs. 1 , 2; 1 983: 
83, pi. 5, figs. 84-86; Jovanovic, 1991: pi. 6, 
fig. 43). Dimensions: height = 0.84-1.05 mm; 
diameter = 1.18-1.34 mm (Radoman, 1979: 
table 1; 1983: table 5). 

Operculum presumably without outgrowth 
though not specified. 

Body pigmentation not described; eye 
spots present (Radoman, 1979: fig. 1; 1983; 
fig. 44). 

Male genitalia with penis elongated, with 
one evident lobe on left side near apex (Rado- 
man, 1979: 23, 27, fig. 1; 1983: 83, fig. 44). 

Female genitalia with two seminal recepta- 
cles and a bursa copulatrix arising from distal 
renal oviduct; proximal seminal receptacle 
slightly larger than distal; bursa copulatrix 
small, with long, slender duct entering bursa 
on anterior side; seminal groove running 
along ventral side of capsule gland (Rado- 
man, 1979: 6, 23, 27, fig. 1; 1983: 40, 83, fig. 
44). 

Radula with central tooth with one pair of 
basal cusps; other details unknown (Rado- 
man, 1979:23; 1983:40). 

Stomach without posterior caecum; intes- 
tine unknown (Radoman, 1983: 40). 

Osphradium and ctenidium unknown. 

Nervous system with long pleuro-supraoe- 
sophageal and shorter pleuro-suboesoph- 
ageal connectives (Radoman, 1979: 23; 
1983: 83). 



Pseudoislamia balcánica Radoman, 1979: 
23-27, fig. 1, table 1, pi. 1,figs. 1, 2. 

Type Locality: "Trichonis Lake, along the 
stone northeast bank, near by Mirtia, 
Greece". 

Type Material: the lectotype (BEO 171, shell) 
is at the Prirodnjacki Muzej u Beograd to- 
gether with a paralectotype (BEO 172, 
shell) (Jovanovic, 1991). 

Description 

Shell very small, valvatiform, depressed; 
microsculpture of protoconch unknown; spire 
depressed, consisting of 2.75-3.25 rather 
rapidly growing convex whorls; last whorl 
large, dilated; umbilicus rather wide, deep; 
aperture prosocline, irregularly oval due to 
sinuous contour (upper part of external mar- 



Taxonomy 

The genus Pseudoislamia is characterized 
by: shell very small, valvatiform, depressed; 
operculum without peg; penis with one simple 
lobe; female genitalia with two seminal recep- 
tacles, proximal sligtly larger than distal, and 
very small bursa copulatrix with long anterior 
duct; central tooth with two pairs of basal 
cusps. It includes only the type species which 
is endemic to Lake Trichonis, Greece (Rado- 
man, 1983). 

Sardohoratia Manganelli, Bodon, 
Cianfanelli,Talenti & Giusti, 1998 

Sardohoratia Manganelli, Bodon, Cianfanelli, 

Talenti & Giusti, 1 998: 51 -53. 
Type Species: Sardohoratia sulcata Man- 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



153 



ganelli, Bodon, Cianfanelli, Talenti & 
Giusti, 1998, by original designation. 

Sardohoratia sulcata Manganelli, Bodon, 
Cianfanelli, Talenti & Giusti, 1998 

Sardohoratia sulcata Manganelli, Bodon, 
Cianfanelli, Talenti & Giusti, 1 998: 53-55, 
figs. 28-30, 34-37, 40-45, 53-57. 

Type Locality: "Plentiful karstic spring "Su Col- 
ogone" at San Giovanni, 100 m a. s. I. 
(Oliena, Nuoro). UTM references: 32T 
NK 4260", Sardinia, Italy. 

Type Material: holotype (MZUF 11580, shell) 
and four paratypes (MZUF 1 1 559, 1 1 581 , 
4 shells) in the malacological collection 
of the Museo Zoológico "La Specola", 
Florence, Italy; other paratypes (145 
shells and 14 preserved specimens) are 
in the Bodon (Genova, Italy), Cianfanelli 
(Florence, Italy), Giusti (Siena, Italy), 
Maassen (Duivedrecht, Holland), Sosso 
(Genoa, Italy), and Talenti (Florence, 
Italy) collections (Manganelli et al., 
1998). 

Material Examined 

-Plentiful karstic spring "Su Cologone", San 
Giovanni, Oliena, Nuoro, Sardinia, Italy, 
32T NK 4260, M. Bodon, F. Giusti & G. 
Manganelli leg. 22.11.1986 (44 shells), 
M. Bodon leg. 24.3.1989 (3 males, 4 fe- 
males, 7 specimens, many shells). 

Description 

Shell very small, valvatiform, rather robust, 
whitish, waxen; surface of protoconch mal- 
leated surface of teleoconch with deep, scat- 
tered spiral groves; spire raised, consisting 
of 2.25-3 rather rapidly growing convex 
whorls; last whorl slightly dilated, not or 
slightly descending near aperture; umbilicus 
rather small; aperture prosocline, ovoid; peri- 
stome complete, thickened, columellar mar- 
gin slightly reflected (Manganelli et al., 1998: 
53-54, figs. 28-30, 34-37). Dimensions: 
height = 0.60-1 .13 mm; diameter = 0.62-1 .24 
mm (Manganelli et al., 1998: table 1). 

Operculum very thin, pale yellow, paucispi- 
ral, slightly thicker at centre, lacking out- 
growth on inner face (Manganelli et al., 1998: 
54, fig. 40). 

Body unpigmented; eye spots absent (Man- 
ganelli et al., 1998: 54, fig. 41). 

Male genitalia with penis rather elongated. 



slender, with pointed apex, without lobes; pe- 
nial duct zig-zagging through central portion 
of penis to open at penis tip (Manganelli et al., 
1998:54, figs. 41-43). 

Female genitalia with two seminal recepta- 
cles and a bursa copulatrix arising from distal 
renal oviduct; seminal receptacles of equal 
size; proximal seminal receptacle bent out- 
wards near end of loop; bursa copulatrix 
large, oval, with rather long duct entering 
bursa on anterior side; seminal groove run- 
ning along ventral side of capsule gland (Man- 
ganelli et al., 1998: 54, figs. 44, 45). 

Radula with central tooth trapezoidal, with 
long lateral wings and basal tongue, its apical 
margin V-like, with long, robust central denti- 
cle and 5 smaller denticles on both sides in 
decreasing order of size; one basal cusp at 
point where each lateral wing arises from face 
of central tooth; lateral teeth rake-like, apically 
enlarged, their anterior margin with 9 denti- 
cles, central of which longer, larger; first mar- 
ginal teeth rake-shaped, with long lateral wing 
and elongated cutting edge with long row of 
20-22 small denticles anteriorly; second mar- 
ginal teeth scraper-shaped, with long slender 
lateral wing and roundish, spoon-like apex, its 
cutting edge carrying rather long row of ap- 
proximately 12-15 small denticles (Man- 
ganelli et al., 1998: 54, figs. 53-57). 

Stomach without posterior caecum; intes- 
tine with S-like bend on palliai wall (Man- 
ganelli et al., 1998: 54-55, figs. 42, 44). 

Osphradium oval; ctenidium absent (Man- 
ganelli et al., 1998: 54-55, figs. 42, 44). 

Nervous system unknown. 

Taxonomy 

The genus Sardohoratia is characterized 
by: shell very small, valvatiform; operculum 
without peg; penis without lobes; female gen- 
italia with two seminal receptacles equal in 
size and large, oval bursa copulatrix with an- 
terior duct; central tooth with one pair of basal 
cusps. 

Besides the type species, Sardohoratia in- 
cludes another species from Sardinia, S. /s- 
lamioides Manganelli, Bodon, Cianfanelli, Ta- 
lenti & Giusti, 1998, which differs in a few 
characters. 

Strugia Radoman, 1973a 

Strugia Radoman, 1973a: 10. 
Type Species: Strugia ohridana Radoman, 
1973a, by monotypy. 



154 



BODÓN, MANGANELLI & GIUSTI 



Strugia ohridana Radoman, 1973a 

Strugia ohridana Radoman, 1973a; 10, 25. 

Type Locality: "Cave from which Sum spring 
comes out, about 4 km west of town 
Struga, Macedonia". 

Type Material: lectotype (BEO 262, shell) is at 
the Prirodnjacki Muzej u Beograd, to- 
gether with a paralectotype (BEO 263, 
shell) (Jovanovic, 1991). 

Description 

Shell very small, valvatiform; microsculp- 
ture of protoconch unknown; spire rather 
raised, consisting of 3.5-3.75 rather rapidly 
and regularly growing convex whorls; last 
whorl large, slightly dilated, more or less de- 
scending near aperture; umbilicus wide; aper- 
ture prosocline, roundish; peristome com- 
plete, slightly thickened, slightly reflected only 
at lower and columellar margin (Radoman, 
1973a: 25; 1983: 118, pi. 8, fig. 139; Jo- 
vanovic, 1991: pi. 8, fig. 65). Dimensions; 
height = 1 .50-1 .60 mm; diameter = 1 .60-1 .68 
mm (Radoman, 1983: table 7). 

Operculum reddish yellow, paucispiral, 
without outgrowth at centre of inner face 
(Radoman, 1973a: 25; 1983: 118). 

Body unpigmented; eye spots absent 
(Radoman, 1983: 119). 

Male genitalia with penis rather elongated, 
slightly dilated (at about 2/3 of penis length), 
then tapering to end in moderately pointed tip; 
small knob-like lobe on left side of penis level 
with subapical dilated portion (Radoman, 
1983; 119, fig. 65). 

Female genitalia with proximal seminal re- 
ceptacle and a bursa copulatrix arising from 
distal renal oviduct; seminal receptacle pro- 
portionally well developed, bent to adhere to 
oviduct; bursa copulatrix moderately large, 
sac-like or kidney-shaped, with rather long, 
slender duct entering bursa on anterior side; 
seminal groove running all along ventral side 
of capsule gland (Radoman, 1973a; 6, 25; 
1983: 119, fig. 65). 

Radula with central tooth with one pair of 
basal cusps; other details unknown (Rado- 
man, 1983; 114). 

Stomach without posterior caecum; intes- 
tine unknown (Radoman, 1973a: 6; 1983: 40) 

Osphradium and ctenidium unknown. 

Nervous system with long pleuro-supraoe- 
sophageal and shorter pleuro-suboesopha- 
geal connectives (Radoman, 1973a: 6; 1983: 
40, 118). 



Taxonomy 

Although Radoman (1973a: 10, 25) estab- 
lished Strugia without a description or defini- 
tion, but only by combining it with a new 
species, this nominal genus is available 
(ICZN, 1999; Art. 13.4). 

Strugia is here considered a distinct genus, 
but its relationships to Lyhnidia Hadzisce, 
1959, need to be clarified. Strugia is charac- 
terized by: shell very small, valvatiform; oper- 
culum without peg; penis with one simple 
lobe; female genitalia with proximal seminal 
receptacle and large, sac-like or kidney- 
shaped bursa copulatrix with anterior duct; 
central tooth with two pairs of basal cusps. 

A monotypic genus including only the type 
species, endemic to the Ohhd Basin. 



Vrania Radoman, 1978 

Vrania Radoman, 1978: 35, as subgenus of 

Hauffenia. 
Type Species: Valvata wagneri Kuscer, 1928, 

by original designation. 



Vrania wagneri {Kuscer, 1928) 

Valvata wagneri Kuscer, 1928: 50, fig. 1. 
Type Locality: "Grotte Vranja pec bei Bostanj, 

46°N, 15°7'E, Slovenia. 
Type Material: Kuscer (1928) did not give any 

information about the type material. 



Material Examined 

Spring of the "Vranja pec" cave, Bostanj, 
Sevnica, Krsko, Slovenia, 33TWL29, M. 
Bodon leg. 14.6.1985 (2 males, 2 fe- 
males, 6 shells). 
-Spodnja Klevevska Jama, S. 410, Smarjeta, 
Novo Mesto, Slovenia, 33T WL 18, F. 
Stoch leg. 16.6.1996 (1 female). 



Description 

Shell very small, markedly conical-valvati- 
form or valvatiform, thin, pale whitish, waxen, 
transparent when fresh; surface of proto- 
conch malleated; spire from moderately to 
well raised, consisting of 2.75-3.5 rather 
rapidly growing, convex whorls; last whorl di- 
lated, sometimes descending slightly near 
aperture; umbilicus moderately wide; aper- 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



155 












FIGS. 171-179. Radula of Hauffenia wagneri (Kuscer, 1928) from the spring of the "Vranja pec" cave, 
Bosanj, Sevnica, Krsko, Slovenia, M. Bodon leg. 14.6.1985 (Fig. 171), Fissuria raehlei (Schutt, 1980) from 
well no. G/143, Poros, Cephalonia, Greece, G. L. Pesce, D. Maggi & G. Silverii leg. 2.4.1978 (Figs. 172, 173), 
Islamia consolationis (Bernasconi, 1985) from the cave Biez-Airoux, Consolation-Maisionnettes, Doubs, 
France, M. Bodon & G. Manganelli leg. 13.6.1996 (Figs. 174-176) and Heraultia ex/7/s (Paladiihe, 1867) from 
the spring of Lez River, Hérault, France, M. Bodon leg. 2.12.1984 (Figs. 177-179). Figs. 171, 175: half of 
central portion of radula; Figs. 1 72, 1 77: central teeth; Figs. 1 73, 1 79: lateral, inner and outer marginal teeth; 
Fig. 174: central and lateral teeth; Fig. 176: outer marginal tooth; Fig. 178: four lateral teeth. Scale bar = 
5 |.im. 



156 



BODÓN, MANGANELLI & GIUSTI 



ture prosocline, roundish; реп51огле согл- 
plete, thin, slightly reflected only at columellar 
margin (Figs. 93, 163-165; Kuscer, 1928; 50, 
fig. 1; Radoman. 1978; 35, pi. 4, figs. 16, 17; 
1983; 122-123, pi. 9, fig. 145, table 7). Di- 
mensions: height = 0.71-1.14 mm; diameter 
= 0.95-1.60 mm. 

Operculum thin, yellowish, paucispiral, 
slightly thickened, with small, not apically di- 
lated but spiralized peg at centre of inner face 
(Figs. 42, 43. 166; Bole, 1970: 92, fig. 2B5; 
Radoman, 1978; 35, fig. 5F; 1983: 122, fig. 
67F). 

Body unpigmented (a few traces of pigment 
in wall of visceral sac); eye spots absent (Fig. 
168). 

Male genitalia with prostate gland bulging 
slightly into palliai cavity; penis rather short, 
flat, with apex blunt, and one rather evident, 
wide lobe on left side near apex; penial duct 
zig-zagging through central portion of penis to 
open at penis tip; large, roundish or pyriform 
mass of réfringent cells present inside penis 
apex right of penial duct; terminal part of pe- 
nial duct (immediately before opening) with 
very small stylet (Figs. 169-170; Bole, 1970; 
92, fig. 2B3). 

Female genitalia with proximal seminal re- 
ceptacle and a bursa copulatrix arising from 
distal renal oviduct; seminal receptacle very 
small, sessile, or with very short duct arising 
from oviduct level with end of loop; bursa 
copulatrix reduced, small but longer than 
seminal receptacle, not or slightly dilated at 
apex, arising very close to where oviduct en- 
ters albumen gland portion of palliai oviduct; 
seminal groove running along ventral side of 
capsule gland (Fig. 167; Bole, 1970: 92, fig. 
2B2). 

Radula with central tooth trapezoidal, with 
long lateral wings and basal tongue, its apical 
margin V-like, with long robust central denticle 
and 5-6 smaller denticles on both sides in de- 
creasing order of size; 1 -2 basal cusps at 
point where each lateral wing arises from face 
of central tooth; lateral teeth rake-like, apically 
enlarged, their anterior margin with 10-12 
denticles, central of which longer, larger; first 
marginal teeth rake-shaped, with long lateral 
wing and elongated cutting edge with long 
row of 21 -24 small denticles anteriorly; sec- 
ond marginal teeth scraper-shaped, with long, 
slender lateral wing and roundish, spoon-like 
apex, its cutting edge carrying rather long row 
of 14-19 very small denticles (Fig. 171 ; Bole, 
1970:92, fig. 2B4). 

Stomach without posterior caecum; intes- 



tine with well-developed, tightly coiled, S-like 
bend on palliai wall (Figs. 167, 170; Rado- 
man, 1978: 33; 1983; 40). 

Osphradium variable in size, oval or elon- 
gated, kidney-shaped; ctenidium consisting of 
7-11 lamellae (Figs. 167, 170; Bole, 1970; 92, 
fig. 2B1). 

Nervous system with long pleuro-supraoe- 
sophageal and short pleuro-suboesophageal 
connectives (Radoman, 1978: 33; 1983: 120). 



Taxonomy 

Vrania is here considered a junior synonym 
of Hauffenia Pollonera, 1898 (see "The status 
and relationship of Hauffenia"). Radoman 
(1978) introduced this taxon, as subgenus of 
Hauffenia. for Valvata wagneri Kuscer, 1 928. 
Vrania was confirmed as subgenus of ¡Hauffe- 
nia by Radoman (1983) and Bole & Velkrovh 
(1986). On the contrary. Bole (1993) and 
Haase (1 993) regarded it as a junior synonym 
of Hauffenia. 

Vrania included only the type species. 



Zaumia Radoman, 1983 

Zaumia Radoman, 1983; 119. 
Type Species; Horatia ¡<usceri Hadzisce, 
1959, by original designation. 

Zaum/a /cuscer/ (Hadzisce, 1959) 

Horatia l<usceri Hadzisce, 1959; 65-66, figs. 
4,5. 

Type Locality: "lebt in den Quellen des 
Klosters st. Naum am Südende des Sees 
und an den sechten, steinigen Teilen der 
Litoralregion auf der Ostseite des Sees", 
Ohrid Basin, Macedonia. According to 
Radoman (1983; 120), the type locality is 
"springs by Sveti Naum, near the south 
bank of Lake Ohrid". 

Type Material: Hadzisce (1959) did not give 
any information about the type material. 

Description 

Shell very small, valvatiform or conical- 
ovoid, thin, glassy, transparent when fresh; mi- 
crosculpture of protoconch unknown; spire 
well raised, consisting of 3.25-3.5 rather 
rapidly growing convex whorls; last whorl 
large, dilated, descending slightly near aper- 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



157 



ture; umbilicus small, hole-like; aperture 
prosocline, roundish to ovoid; peristome 
complete, thin, slightly thickened, slightly re- 
flected only at lower and columellar margin 
(Hadzisce, 1959: 65, fig. 4; Radoman, 1963a: 
79, fig. 8; 1963b: 96, fig. 8; 1983: 119-120, 
table 7, pi. 8, fig. 140). Dimensions: height = 
1.22-1.47 mm; diameter = 1.05-1.18 mm 
(Radoman, 1983: 206, table 7). 

Operculum thin, paucispiral, without out- 
growth at centre of inner side (Hadzisce, 
1959: 65; Radoman, 1983: 119). 

Body unpigmented; eye spots absent 
(Radoman, 1983: 120). 

Male genitalia with penis long, cylindrical, 
slightly dilated at about 2/3 of penis length, 
then tapering to end in rather pointed tip; 
slightly evident lobe on left side, level with 
subapically dilated portion (Radoman's (1 983: 
119) diagnosis reports: ". . . without clear 
outgrowth") (Hadzisce, 1959: 65, fig. 4; Rado- 
man, 1 963a: fig. 1 6; 1 963b: fig. 1 6; 1 983: 1 1 9, 
fig. 66). 

Female genitalia with proximal seminal re- 
ceptacle and a bursa copulatrix arising from 
distal renal oviduct; seminal receptacle small 
but proportionally rather developed; bursa 
copulatrix very smalt, with long, slender duct 
entering bursa on anterior side; seminal 
groove running along ventral side of capsule 
gland (Radoman, 1963a: 79, fig. 16; 1963b: 
96, fig. 16; 1973a: 6; 1983: 40, 114, 119, fig. 
66). 

Radula with central tooth trapezoidal, with 
long lateral wings and basal tongue, its apical 
margin V-like, with long, robust central denti- 
cle and about 4 smaller denticles on both 
sides in decreasing order of size; one basal 
cusp at point where each lateral wing arises 
from face of central tooth; lateral teeth rake- 
like, apically enlarged, their anterior margin 
with about 10 denticles, central of which 
longer and larger; first marginal teeth rake- 
shaped, with long lateral wing and elongated 
cutting edge with long row of about 20 small 
denticles anteriorly; second marginal teeth 
scraper-shaped, with long, slender lateral 
wing and roundish, spoon-like apex, its cut- 
ting edge carrying rather long row of very 
small denticles (Hadzisce, 1959: 65, fig. 5). 

Stomach without posterior caecum; intes- 
tine unknown (Radoman, 1973a: 6; 1983: 40). 

Osphradium and ctenidium unknown. 

Nervous system with long pleuro-supraoe- 
sophageal and slightly shorter pleuro-suboe- 
sophageal connectives (Radoman, 1963a: 
fig. 18b; 1963b: fig. 18b; 1973a: 6; 1983: 119). 



Taxonomy 

Radoman (1973a: 8) established Zaumia 
without a description or definition, but only by 
combining it with two available species group 
names. After 1930, this condition does not 
make a generic name available (ICZN, 1999: 
Art. 13.6). Zaumia is here considered a dis- 
tinct genus, but its relationships to Pseudoho- 
ratia Radoman, 1967, need to be clarified. Za- 
umia is characterized by: shell very small, 
valvatiform, conical-ovoid or depressed; oper- 
culum without peg; penis with one simple 
lobe; female genitalia with proximal seminal 
receptacle and very small bursa copulatrix, 
with long anterior duct; central tooth with one 
pair of basal cusps. 

Radoman (1983) included another species 
from Lake Ohrid in Zaumia: Z. sanctizaumi 
(Radoman, 1964), distinct from Z kusceri by 
valvatiform-planispiral shell. 



STATUS AND RELATIONSHIPS 
OF HAUFFENIA 

The western Palaearctic hydrobiids have 
rather constant anatomical organization, ex- 
cept for some features of the penis in males 
and the renal oviduct in females (Tables 1, 2, 
Fig. 1 80). Taxonomy at the rank of genus (and 
sometimes also at that of family) has thus 
been traditionally based on penis structure 
and the number and position of the sac-like 
structures associated with the renal oviduct 
(bursa copulatrix and seminal receptacle/s). 
The penis offers such characters as shape, 
presence of one of more lobes and their 
shape, glandular structures in the penis or 
lobes, papilla or filament at penis tip, stylet- 
like structures at penial duct opening, and po- 
sition of penial duct inside penis. These char- 
acters are generally constant in groups of 
species and are therefore good diagnostic 
features at the rank of genus. However, cases 
are known in which some of these characters 
are absent in one species of a genus (e.g., 
Pezzolia; F\g. 180). 

In supposedly related groups of species, 
the number and position of the sac-like struc- 
tures associated with the renal oviduct, bursa 
copulatrix, and seminal receptacles (one or 
two) are considered more important (Davis & 
Carney, 1973). Also in this case, however, 
there are some exceptions, for example, the 
bursa copulatrix may be reduced, present or 



158 



BODÓN, MANGANELLI & GIUSTI 



MALE 



FEMALE 



Seminal 
receptacle/s 



PSR + DSR 




Only DSR 



Bursa 
copulatnx 



Normal ВС 
or with long duct 





ВС absent 




Normal ВС with 
antenor duct 



Penis with stylet 



Penis with/ 
without lobe/s 




Penis without stylet 



Penis with Penis with 

simple lobe/s glandular lobe/s 



Penis lacking 
lobe/s 




Bracenica 

Daphniola 

Gocea 

Horatia 

Karevia 

Ohndohauffenia 

Ohngocea 

Prespolitorea 

Pseudoislamia 




Only PSR 





ВС with 

posteroventral or 

lateroposterior duct 




ВС smaller than 
DSR 




Normal ВС 
or with long duct 



Reduced ВС 
and duct 



Hauffenia 



Islamia p.p 





Fissuria 



Pez zoll a p p 



Islamia p p 
Pez zoll a pp. 



Kerkia 



Lyhnidia 

Pseudohoratia 

Strugia 

Zaumia 



Sardohoratia 



Pezzolla p.p 



Pezzolia p.p. 



Arganiella 



Hadziella 
Heraultia 



Dabriana 



FIG. 180. Synopsis of the European hydrobiid genera with valvatiform shell arranged according to the main 
anatomical characters of the genitalia {Dalmatella not included because anatomy unknown; it is identified by 
its keeled shell). The presence of the distal seminal receptacle needs to be confirmed in the type species of 
Hadziella (the genus is identified by its planispiral shell with reflected peristome). For each genus, only the 
characters of the type species or closely related species have been considered. 

Acronyms: ВС bursa copulatrix, DSR distal seminal receptacle (first seminal receptacle), PSR proximal sem- 
inal receptacle (second seminal receptacle). 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



159 



TABLE 1 . List of the main characters used in discussion of the status and relationships of Hauffenia. The 
character-state "0" was assigned to Hydrobia, because this genus is considered to be one of the primitive 
extant hydrobiids (Ponder, 1988a). 



Protoconch 

PI 

P2 

P3 
Teleoconch 

T1 

T2 

T3 
T4 
T5 
T6 
T7 
T8 
T9 
TÍO 
Aperture: peristome 



Surface depressions: absent (0); pits (1). 

Spirals: absent (0); spiral threads (1): spiral grooves (2). 

Wrinkles: absent (0); wrinkles or malleations (1). 

Shape: ovate-conic (0); planispiral (1); valvatiform (2); trochiform (3); neritiform (4); ovate 

(5); conic (6); elongate-conic (7). 
Spiralization: spire entirely coiled (0); despiralized only near aperture (1); almost entirely 

despiralized (2); horn-like, uncoiled (3). 
Whorl translation: apex of shell prominent (0); apex of shell flat (1). 
Whorl outline: flat (0); convex (1); shouldered (2). 
Color: absent (0); present (1). 

Microsculpture — Surface depressions: pits absent (0); pits present (1). 
Spiral microsculpture: absent (0); threads (1); grooves (2). 
Spiral sculpture: absent (0); crests (1); keel(s) (2). 

Axial sculpture: growth lines only (0); rounded ribs (1); lamelliform ribs (2). 
Spines: absent (0); present (1). 



AI 
A2 

A3 
Umbilicus 

U1 
Operculum 

01 

02 
03 

04 

05 
Head-foot 

HI 

H2 
Palliai cavity 

CI 

C2 

C3 

C4 



C5 

Radula 
R1 
R2 

R3 

R4 

R5 

R6 

R7 



Condition of outer lip relative to rest of apertural plan: simple (0); reflected (1); with varix 

at edge of outer lip (2); with vanx behind outer lip (3). 
Shape of adapical and abapical portions of outer lip: simple (0); adapically sinuous (1); 

abapically sinuous (2); adapically and abapically sinuous (3). 
Inclination of outer lip relative to coil axis: orthocline (0); prosocline (1); opisthocline (2). 

Size: absent (0); narrow (1); wide (2). 

Overall shape: ovate (nucleus central or subcentral) (0); elongate-ellipsoid (nucleus sub- 
marginal) (1); circular (nucleus central) (2). 

Coiling: paucispiral (less than four whorls) (0); multispiral (four or more whorls) (1). 

Nuclear thickening and peg: nucleus simple (0); nucleus area thickened (1); nucleus 
raised into arched peg (2); nucleus raised into spiral peg (3). 

Crest on inner surface: inner surface simple (0): inner surface with crest (1 ). 

Frill: absent (0); slightly developed (1): highly developed (2); forming solid ridge (3). 

Eyes: present, normal size (0); reduced (1); absent (2). 
Metapodial tentacle: absent (0); single tentacle present (1). 

Posterior palliai tentacle: present (0); absent (1). 

Ctenidium: present (0); absent (1). 

Osphradium — size: more than 66% of palliai cavity length (0); 50-66% of palliai cavity 

length (1); less than 50% of palliai cavity length (2). 
Osphradium — position relative to ctenidium: opposite posterior part of ctenidium (0); 

opposite middle of ctenidium (1); opposite anterior part of ctenidium (2); inapplicable 

(ctenidium absent) (-). 
Osphradium —overall shape: more than three times longer than broad (0): two to three 

times longer than broad (1); less than twice as long as broad (2). 

Central teeth — shape:trapezoidal (0); square (1); triangular (2); broadly rectangular (3). 
Central teeth — excavation of base: less than 25% of tooth height (0); 25%-50% of tooth 

height (1): more than 50% of tooth height (2). 
Central teeth — basal tongue length: absent (0); shorter than lateral wing (1); about equal 

to lateral wing (2); longer than lateral wing (3). 
Central teeth — basal tongue shape: narrow V-shaped (0); broad V-shaped (1); U-shaped 

to square (2); slightly convex (3). 
Central teeth — number of pairs of basal cusps: one pair (0); two pairs (1); three or more 

pairs (2); basal cusp absent (3). 
Central teeth — position of basal cusps: all cusps arise from lateral wing (0); one or more 

cusps arise from tooth face (1); inapplicable (basal cusps absent) (-). 
Central teeth — relative size of basal cusps: inner cusp larger (0); all cusps equal-size (1); 

inapplicable (one or no cusps) (-). 



160 BODÓN, MANGANELLI & GIUSTI 

TABLE 1. {Continued) 

R8 Lateral teeths — overall shape: outer margin straight or almost (0): outer margin with dis- 

tinct concave bend (1 ). 

R9 Lateral teeth — shape of face: taller than wide (0); square (1). 

RIO Lateral teeth — basal projection: absent (0): present (1). 

R11 Lateral teeth — length of cutting edge relative to outer wings: cutting edge much shorter 

(0): cutting edge slightly shorter to about equal in length (1). 

R12 Inner marginal teeth —cusp size: cusp larger than those of outer marginal teeth (0); cusp 

about as large as those of outer marginal teeth (1 ). 
Stomach 

51 Posterior caecum: present (0): rudimentary or absent (1 ). 

52 Shield caecum: absent (0); present (1). 
Intestine 

11 Coiling: simple coil around style sac (0): coil around style sac with additional coil on dorsal 

side of style sac (1); simple coil far from style sac (2). 

12 Shape of rectum within palliai cavity: straight or with slight bend (0): with U-shaped bend 

(1); with S-shaped bend initiated to left (2): with S-shaped bend initiated to right (3). 
Female reproductive system 
Fl Pigmentation of coiled oviduct: absent (0); present (1). 

F2 Overall coiling pattern: single bend or loop (0): two or more bends or loops (1 ); no loop (2). 

F3 Type A sperm duct: absent (0): present (1 ). 

F4 Number and position of seminal receptacles: one distal (RSI) (0); one proximal (RS2) (1); 

two seminal receptacles (one proximal, one distal) (2): none (3). 
F5 Relative size of seminal receptacles: distal (RSI) a little larger or equal to proximal (RS2) 

(0): distal (RS1 ) much larger than proximal (RS2) (1 ): distal (RSI ) smaller than proxi- 
mal (RS2) (2); inapplicable (one or no seminal receptacle) (-). 
F6 Position of proximal seminal receptacle (RS2) relative to end of loop: at end of loop (0); 

close to end of loop (1); inapplicable (proximal seminal receptacle absent) (-). 
F7 Position of proximal seminal receptacle (RS2) relative to bursa copulatrix: all or mostly 

anterior to bursa (0): lying against bursa (1): behind bursa (2); inapplicable (proximal 

receptacle or bursa absent) (-). 
F8 Shape of proximal (RS2) seminal receptacle: elongate (0); pyriform to globular (1): inap- 

plicable (proximal receptacle absent) (-). 
F9 Duct of proximal (RS2) seminal receptacle: no distinct duct (0): distinct duct shorter than 

seminal receptacle (1); duct much longer than seminal receptacle (2); inapplicable 

(proximal receptacle absent) (-). 
Fl Position of distal seminal receptacle (RSI ) relative to end of loop: far from end of loop, 

near bursa copulatrix duct (0): closer to end of loop than to bursa copulatrix duct (1 ); 

inapplicable (distal seminal receptacle or bursa absent) (-). 
F11 Position of distal seminal receptacle (RSI) relative to bursa copulatrix: all or most anterior 

to bursa (0); lying against bursa (1): behind bursa (2); inapplicable (distal receptacle or 

bursa absent) (-). 
F12 Shape of distal (RS1) receptacle: elongate (0): pyriform to globular (1): inapplicable (distal 

receptacle absent) (-). 
F13 Duct of distal (RSI) seminal receptacle: no distinct duct (0): distinct duct shorter than 

seminal receptacle (1): duct much longer than seminal receptacle (2): inapplicable (dis- 
tal receptacle absent) (-). 
Fl 4 Dimension of posterior bursa copulatrix relative to albumen gland: medium to large (0); 

rather small (1): very small or rudimentary (2); inapplicable (no bursa) (-). 
Fl 5 Bursal duct: anteroventral (0): anterodorsal (1); anterior (2): posterodorsal (3); pos- 

teroventral or posterior (4); posterolateral (5): inapplicable (no bursa) (-). 
Fl 6 Opening: bursal duct opens into coiled oviduct (0): bursal duct opens into spermathecal 

duct (1); bursal duct opens into cordoseminal duct (2): inapplicable (no bursa) (-). 
Fl 7 Length of bursal duct: about 50-100% of bursa length (0); less than 50% of bursa length 

(1); longer than bursa (2); inapplicable (no bursa) (-). 
F18 Glandular zones: homogeneous capsule gland (0): two or more glandular zones (1), 

Fl 9 Spermathecal duct: absent (0): common opening in capsule gland in anterior palliai cavity 

(1); opens separately to anterior palliai cavity (2): opens separately about halfway along 

capsule gland (3): opens separately to posterior palliai cavity (4). 
F20 Ending of uteral gland: not far from palliai margin (0): far from palliai margin (1 ). 

Male reproductive system 
Ml Overall shape of penis: gradually tapenng (0): broadly triangular (1): rectangular (2); 

strap-like, i.e., flat (3). 
M2 Shape of distal end: tapered (0): blunt (1); expanded (2); subapically expanded and 

tapered at tip (3). 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



161 



TABLE 1. (Continued) 



M3 Distal papilla: absent (0); present (1). 

M4 Corneous stylet: absent (0); present, at tip (1); present, inside apex (2). 

M5 Pigmentation of penis: absent (0); present (1 ). 

M6 Simple lobe/s (non-glandular or glandular) on right or upper edge: absent (0); apical (1); 

lateral, in distal half (2); lateral, in proximal half (3). 
M7 Simple lobe/s (non-glandular or glandular) on left edge: absent (0); apical (1); lateral, in 

distal half (2); lateral, in proximal half (3). 
M8 Non glandular pleat on lower edge: absent (0), present (1). 

M9 Glandular area inside simple lobe/s: absent (0), apocrine glands (1); internal glandular 

fields (2); inapplicable (no lobe) (-). 
MIO External glandular fields or ridges: absent (0); present (1). 

M11 Sucker-like apocrine glands: absent (0); present (1). 

M12 Tubular penial gland — number: none (0); one (1); two or more (2). 

M13 Tubular penial gland — position: absent (-); in penis only (1); in penis and haemocoel (2). 

Ml 4 Penial duct — position: near centre (0); near right edge (1). 



absent in a genus (and also in a species, see 
the case of Pezzolia). 

Clear relationstiips between Hauffenia, 
Lobaunia, Neohoratia. Vrania and Erythropo- 
matiana emerge from the redescriptions of 
their type species. In fact, they share the fol- 
lowing combination of characters: 

• male genitalia with penis apex rounded; pe- 
nial duct subcentral; terminal portion of pe- 
nial duct (immediately before opening) with 
very small stylet; mass of réfringent cells in- 
side right side of penis apex; variable num- 
ber (0-3) of more or less evident penial 
lobes on left side of penis near apex; 

• female genitalia with bursa copulatrix and 
proximal seminal receptacle arising from 
distal renal oviduct; bursa copulatrix very 
small, with very short duct; proximal semi- 
nal receptacle shorter than bursa copula- 
trix. 

This combination is unique and enables 
easy taxonomic identification of the Hauffenia 
group among all anatomically known valvati- 
form and non-valvatiform genera from all over 
the world (for the status and identification of 
all European valvatiform hydrobiid genera, 
see Tables 3, 4; Fig. 181). 

Only two characters are available for the 
subdivision of Hauffenia: the opercular peg 
and the penial lobes. Hauffenia has an evi- 
dent peg at the centre of the inner face of the 
operculum (very developed in H. tovunica 
Radoman, 1978, rather developed in H. 
tellinii), Vrania has a smaller peg, Neohioratia 
and Erythropomatiana lack a peg. As a first 
conclusion, Erytfiropomatiana can be pro- 
posed as a junior synonym of Neofioratia. 
Oddly, Radoman never considered or dis- 
cussed Neotioratia when introducing (Rado- 



man, 1978) and later redeschbing (Radoman, 
1983) Erytliropomatiana. Radoman (1978, 
1983) also included a species, E. verdica 
Radoman, 1 978, which is a junior synonym of 
N. subpiscinalis, the type species of Neofio- 
ratia in Erytfiropomatiana (see Taxonomy in 
Hauffenia subpiscinalis). 

Vrania was introduced as a subgenus of 
Hauffenia by Radoman (1978), on the basis of 
a single diagnostic character: the smaller op- 
ercular peg. Study of peg variations demon- 
strates that in specimens of H. tellinii Uom the 
type locality, the peg is more dilated apically 
and never as reduced as in V. wagneri. How- 
ever, its dimensions vary over a continuum 
(Figs. 69-71) from that of H. tellinii io that of 
V. wagneri. Hence, the peg is not a character 
sufficient to support differentiation of Vrania 
with respect to Hauffenia at the rank of genus 
or subgenus. Together with other possible 
characters, it could at most support differenti- 
ation at species or subspecies level. In con- 
clusion, we fully agree with Haase (1992) in 
considering Vrania a junior synonym of Hauf- 
fenia. 

The remarkable concordance of the genital 
and other anatomical characters in Hauffenia 
tellinii and Neohioratia subpiscinalis and the 
variation of the opercular peg from very well 
developed in H. tovunica Radoman, 1978, to 
rather well developed in H. tellinii, and small in 
V. wagneri, throw doubts on the value of the 
character "peg absent" in N. subpiscinalis and 
E. erythropomatia, and consequently on the 
validity of Neohoratia (with Erytfiropomatiana 
as a junior synonym) as a generic taxon dis- 
tinct from Hauffenia (with Vrania as a junior 
synonym). 

Apart the absence of an opercular peg, N. 



162 



BODÓN, MANGANELLI & GIUSTI 



S o 

> Í2 
Й В 

> o 

i o 
g Ф 

2 £ 

<D >> 

O) o 
o> . 

1 3 
o <1> 
■D ^ 

— ™ 

o "^ со 
*-,-:- тз 

^": 

с 
■o 5 
с o 
(O с 



LU 
с 
5 
о 

5^ 



О) 

о 
а> 
а. 

о О) 



ф (О 

£ £ 

о ¿ 

с 
о со 

о со 

<0 >: 

Ф ¿ 

<" О 

(0 QJ 1.1. 

ТЗ CÇ ^ 

'^ £ - 
(О .2 -^ 

ф с >■ 
(Л о t 

Р й- ° 

F Р со 

С 

со 

£| S3 

«Is. 

щ J- (Л 

ф Ö -g 

о _ 

t §,„, 

_£~ ел о 

со" 



о -с 



<- ф 






о 

3 - _ 

ш XJ £ 

^ Sä о 

£ о ф 

■Е 2 § 

Р о. £ 

ФСО к- 

_ X о 

■S 2 -о 

^ ^ Ф 

ф о .S 

ел (Л (Л 

"-' ф с 

ел тз о 

Ф _з о 

Я о с 

2 Ф я 

« 5 ^ 

6 2 ^ 

c\i .с ф 

i^ ^. ^ 

51 S. 



- 


с^- 


^ 


с^- 


с^- 


^ 


^ 


^ 


с- 


^ 


^ 


^ 


^ 


^ 


^ 


^ 


^ 


^ 


о 


^ 


^ 


с^- 


т- с- 


'- 


с^ 


'- 


о 


с^ 


^ 


^ 


'- 


С^' 


о 


■.- г- 


о- 


^ 


с^- 


с^- 


о 


с^ 


с^- 


с- 


с^- 


о 


С^' 


о 


с^- 


о 


с- 


о 


о 


с^ 


о 


о 


о 


о 


С' 


с^ 


о C^■ 


е.. 


С^' 


о 


о 


с^- 


C^ 


о 


о 


о 


о 


О С- 


с^ 


о 


- 


с^- 


- 


С' 


с^ 


с^ 


с- 


- 


с^ 


- 


C^ 


- 


с^ 


- 


- 


с^- 


- 


- 


- 


- 


- 


с^ 


•■- с^- 


с^ 


с^ 


- 


- 


с^ 


с^ 


- 


- 


- 


^ 


т- С^ 


с^- 


- 


о 


с^- 


о 


с^- 


С^' 


с^- 


о 


- 


о 


о 


о 


о 


г- 


- 


- 


с^- 


- 


о 


о 


о 


о 


с^- 


о С^- 


с^ 


с^- 


о 


о 


с- 


с^- 


о 


о 


о 


о 


о с^ 


с^- 


о 


- 


с- 


о 


с^ 


С^ 


- 


о 


- 


- 


- 


- 


- 


- 


- 


- 


с^- 


- 


- 


- 


- 


^ 


с^ 


1- с-' 


С-- 


с^- 


- 


- 


с^ 


о 


- 


- 


- 


- 


т- С^- 


с^- 


- 


о 


1 


1 


с^ 


1 


1 


о 


1 


1 


1 


1 


1 


1 


1 


о 


о 


1 


- 


1 


1 


1 


1 


1 ^ 


1 


1 


о 


1 


с^- 


1 


1 


1 


1 


1 


1 ^ 


с^ 


1 


о 


о 


1 


с^ 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о с- 


о 


о 


о 


о 


С^' 


о 


о 


о 


о 


о 


о с^- 


- 


о 


- 


о 


со 


с^- 


о 


о 


^ 


о 


о 


о 


о 


о 


о 


о 


- 


о 


о 


гм 


о 


о 


о 


о 


о о 


о 


о 


о 


о 


с^ 


о 


о 


о 


о 


гм 
о 


о с- 


гм 


о 


w 


с^- 


OJ 


с^- 


с^ 


- 


с^ 


OJ 


со 


- 


со 


- 


- 


- 


со 


- 


- 


- 


^ 


- 


гм 


с^ 


гм с^ 


с^ 


с^ 


- 


- 


о 


с^ 


- 


- 


гм 


- 


гм C^ 


гм 


- 


C\J 


с^- 


Cvj 


с^- 


с^ 


- 


с^ 


см 


- 


см 


- 


см 


см 


см 


- 


- 


гм 


гм 


гм 


гм 


гм 


с^ 


гм С^' 


с^ 


с^ 


^ 


гм 


с^ 


см 


гм 


гм 


гм 


гм 


гм с^ 


гм 


см 


CM 


с^- 


см 


с^- 


с^ 


см 


C^• 


CVJ 


см 


см 


см 


см 


см 


см 


гм 


гм 


гм 


гм 


гм 


см 


гм 


с^ 


см с^- 


гм 


с^- 


гм 


гм 


с^ 


гм 


гм 


гм 


гм 


гм 


гм с- 


- 


гм 


о 


с^- 


о 


с^- 


с^ 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


с^ 


о с- 


о 


С^' 


о 


о 


с^ 


о 


о 


о 


о 


о 


о с^- 


о 


о 


- 


с^- 


0- 


с^ 


с^ 


- 


- 


C^ 


- 


- 


- 


- 


- 


с^ 


- 


о 


с^- 


- 


<> 


с^ 


- 


с^ 


■■- с^- 


- 


С^- 


- 


с^ 


о 


- 


- 


- 


- 


- 


т- С^. 


с^- 


- 


- 


о- 


1 


с^- 


с^- 


- 


- 


с^- 


1 


- 


- 


- 


- 


с^ 


- 


с- 


с^- 


- 


г- 


с^- 


1 


с^ 


■■- с^. 


1 


г- 


- 


г- 


- 


- 


- 


- 


- 


- 


■.- C^• 


с- 


- 


C\J 


с^- 


с^- 


с^ 


с^ 


гм 


см 


с^ 


см 


см 


см 


см 


см 


с^ 


од 


о 


с^> 


гм 


С' 


с^ 


гм 


с^ 


гм с^ 


гм 


с^ 


гм 


с^ 


гм 


гм 


гм 


гм 


гм 


гм 


гм с^- 


с^ 


гм 


о 


с^- 


- 


с^ 


с^- 


о 


о 


с^- 


- 


о 


о 


о 


о 


с^ 


о 


о 


с^ 


о 


с^ 


C^ 


- 


с^ 


о с^ 


^ 


о 


о 


с^ 


о 


о 


о 


о 


о 


о 


о с^- 


с^ 


о 


о 


о 


^ 


С'- 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о о 


о 


о 


C\J 


см 


С\| 


С- 


о 


eg 


см 


о 


O^J 


см 


см 


о 


о 


о 


см 


гм 


о 


гм 


о 


о 


см 


о 


о о 


см 


гм 


см 


гм 


о 


гм 


- 


о 


о 


о 


гм гм 


о 


о 


о 


о 


о 


с^- 


о 


о 


о 


со 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о с^- 


о 


о 


о 


о 


о 


с^ 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


- 


о 


о 


о 


о 


о 


о 


о 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о с^ 


о 


о 


о 


со 


о 


с^- 


о 


о 


о 


о 


- 


со 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


гм о 


о 


о 


п 


о 


о 


о 


о 


о 


о 


о 


о о- 


о 


о 


о 


C^ 


с^- 


с^ 


о 


о 


о 


- 


- 


о 


о 


о 


о 


с^ 


о 


о 


о 


о 


о 


о 


о 


с^ 


о с^ 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о с~- 


о 


о 


C\J 


с^ 


С^' 


с^- 


C^J 


C\J 


см 


см 


гд 


см 


см 


гм 


см 


см 


гм 


гм 


гм 


гм 


с^ 


гм 


см 


C^ 


гм с^ 


гм 


о 


гм 


о 


о 


о 


о 


о 


о 


о 


о о 


о 


о 


C\J 


см 


C\J 
С^' 


см 


см 


см 


см 


см 


см 


см 


см 


см 


см 


см 


гм 


гм 


■^ 


гм 


гм 


гм 


см 


гм 


гм см 


гм 


см 

с^- 


гм 


гм 


■^ 


^ 


^ 


о 


о 


о 


о о 


о 


о 


о 


с^- 


с^ 


с^ 


о 


о 


о 


Cvj 


- 


о 


- 


см 


о 


о 


о 


о 


OJ 


о 


с^ 


о 


о 


о 


о с^ 


о 


с^ 


о 


(^■ 


о 


о 


о 


- 


- 


о 




- 


- 


о 


о 


с^ 


о 


о 


о 


о 


о 


- 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о о 


о 


о 


о 


о 


о 


о 


о 


п 


- 


о 




о 


- 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


- 


о 


о 


о 


о 


о 


о 


о 


о 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о о 


о 


о 


о 


о 


о 


C4J 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


гм 


о 


о 


о 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о о 


о 


о 


о 


о 


- 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о о 


гм 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о ■>- 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о о 


о 


о 


о 


о 


о 


о 
см 


о 


о 


о 


о 

см 


о 


о 


о 


о 


о 


о 
гм 


о 


о 


о 


о 


о 
гм 


о 


о 


о 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о о 


о 
о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


- 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


см 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о -- 


о 


о 


- 


- 


С\| 


см 


со 


см 


см 


см 


- 


см 


- 


см 


со 


гм 


см 


гм 


00 


гм 


гм 


гм 


гм 


гм 


со см 


сз 


см 


п 


со 


о 


о 


о 


о 


о 


о 


CD Г^ 


со 


о 


- 


C^ 


с^ 


с^ 


- 


- 


- 


о 


о 


- 


- 


- 


с^ 


с^- 


- 


о 


C^ 


о 


с^ 


с^ 


- 


с^- 


1- с^ 


о 


с^- 


- 


о 


- 


- 


- 


- 


- 


о 


у- о 


о 


^ 


о 


с^ 


с^- 


с^ 


о 


о 


о 


о 


- 


о 


о 


о 


с^ 


с^ 


о 


о 


с^ 


о 


с^ 


с^ 


о 


с^ 


о с^- 


о 


C^■ 


о 


с^ 


о 


о 


о 


о 


о 


гм 


о ■- 


о 


о 


о 


с^ 


с^- 


с- 


о 


о 


о 


^ 


о 


о 


о 


о 


с^ 


с- 


^ 


^ 


с^ 


^ 


г- 


с^ 


о 


с- 


о с- 


^ 


с^ 


о 


с^ 


о 


о 


о 


о 


о 


о 


о о 


о 


о 



5 ^ СП == -5 



Ï с " 



■S <о 9 



а э р .<с 



2 <о с ¿ 



ч: m Q 



i -ai. 



пз ? S ^ S S 



.<o 






eu !b 

JD со Q) 



(0 CD 
ce ■£ g 
SI) P E 



Д о 



í: Ü JS 



CD S 



s £ 2 



о S -S ■£ 



■Q "O 



5) С E 



(DCD<oo-ïïc5&0"5s2ÎS;ÇÏÏSi«!o(Di::^ 



iroilïlJSitii^ 



I 5 I 

о CD cu Э 

5 :g .5 è- S .1 I § g § 53 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



163 



о о о- о о ■■- t> о о о о о- о о о о о 



о ■.- т- о -- 

о С'- о- о о- 



о oc^•0'-Oí^ooooc^■ooc^■oooc^■c^•o 



(Г 


■^ 


"~ 


с^- 


■^ 


о 


■^ 


с^- 


■^ 


■^ 


■^ 


■^ 


о- 


■^ 


■^ 


с^- 


■^ 


■^ 


■^ 


■^ 


■^ 


"" 


о 


er 


1 


о 


с^ 


о 


1 


о 


о 


о 


1 


1 


1 


1 


- 


1 


1 


1 


1 


о 


1 


1 


1 


о 


er 


о 


о 


^- 


о 


о 


- 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


^ 


о 


о 


о 


о 


in 

DC 


о 


о 


C^ 


- 


о 


см 


- 


- 


о 


о 


о 


о 


гм 


о 


о 


о 


о 


гм 


о 


о 


о 


гм 
о 


tr 


С\| 


см 


с^ 


о 


- 


гм 


см 


см 


- 


- 


см 


1> 


- 


о 


- 


гм 


Гч] 


со 


- 


- 


см 


(>■ 


cr 


см 


см 


с^- 


- 


- 


- 


см 


см 


см 


см 


см 


;>■ 


гм 


гм 


гм 


eg 


- 


гд 


гм 


гм 


гм 


о 


C\J 
CE 


см 


см 


!>■ 


см 


см 


см 


см 


см 


см 


см 


гм 


о- 


см 


гм 


гм 


гм 


го 


- 


- 


гм 


eg 


- 


E 


о 


о 


^- 


о 


о 


о 


о 


о 


о 


о 


о 


с^- 


о 


о 


о 


о 


о 


о 


о 


о 


о 


- 


О 


- 


о 


^ 


^ 


см 


с^- 


- 


о 


о 


^ 


^ 


- 


гм 


- 


- 


го 


с^ 


о 


- 


- 


- 


гм 


ü 


- 


- 


1 


- 


1 


о 


- 


- 


- 


- 


- 


- 


о 


- 


- 


1 


C^ 


- 


- 


^ 


^ 


^ 


со 
О 


см 


- 


см 


см 


см 


см 


см 


см 


см 


см 


см 


гм 


eg 


гм 


см 


гм 


с^ 


гм 


eg 


гд 


см 


eg 


C\J 

О 


о 


о 


- 


о 


- 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


Гч] 


с^ 


о 


о 


о 


о 


о 


О 


- 


о 


- 


- 


- 


- 


- 


- 


о 


- 


^ 


- 


о 


- 


- 


^ 


^ 


- 


^ 


- 


- 


- 


см 

I 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


I 


о 


о 


см 


см 


см 


о 


см 
о 


о 


о 


см 


о 


см 


см 


см 


о 


гм 


гм 


о 


о 


см 


о 


гм 


in 

о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


О 


о 


о 


о 


см 


о 


о 


о 


о 


о 


о 


о 


гм 


- 


о 


о 


о 


о 


о 


о 


о 


о 


о 


см 
О 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


ñ 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 



о 


^ 


о 


о 


о 


^ 


о 


^ 


^ 


о 


'- 


гм 


гм 


о 


^ 


о 


о 


о 


'- 


о 


^ 


о 


- 


о 


- 


- 


- 


- 


- 


о 


о 


- 


о 


- 


- 


^ 


^ 


- 


- 


о 


о 


о 


о 


- 


о 


о 


- 


см 


- 


- 


- 


о 


о 


- 


о 


- 


- 


- 


о 


- 


- 


о 


о 


о 


о 


гм 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


гм 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


- 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


- 


о 


о 


о 


о 


о 


- 


о 


^ 


о 


- 


о 


- 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


- 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


^ 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


^ 


- 


о 


о 


о 


о 


о 


- 


- 


^ 


- 


- 


- 


о 


- 


- 


- 


- 


- 


- 


^ 


^ 


о 


- 


- 


- 


- 


о 


о 


о 


о 


о 


о 


о 


- 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


CD 


ю 


г^ 


о 


CD 


■* 


о 


о 


ю 


г^ 


о 


со 


со 


со 


ю 


г~ 


со 


со 


ю 


о 


ю 


со 


- 


- 


- 


- 


с^ 


о 


- 


о 


о 


о 


с^- 


о 


о 


- 


^ 


- 


о- 


- 


- 


- 


о 


о 


о 


- 


- 


о 


о 


о 


о 


гм 


о 


- 


С^' 


с^- 


о 


о 


о 


о 


|> 


- 


- 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


^ 


0- 


с^ 


о 


о 


о 


о 


с^- 


о 


о 


о 


о 


^ 



о й :ä S О, G У 



О) с £ te о с 
■~ -^ с -с £ G 



~ Ф о пз то 



'О пз N о 



* тэ .о с с ¿ € 



^ >-Ä -й 



i: .t: ct¡ tu 



""njnjcctc-c-ïïouiyi.TO.tç 



t ïS'-S2-Jj:j§§§OQ-CLQ.Q.CLU.U.Q.U.C0C0 P 



т- C^ т- c^ 

111^- 

о о о c^- 

о о о о 

о о о о 

I о I ^ 

1- о о о 

о гм о 1> 

о о о о 

о о о о- 

о о о о- 

о о о о- 

п о о о 

о о о с^- 

о о о <>■ 

о о о о- 

о о -^ с^- 

о о т- о 

о о о с^ 

см -^ eg о 

о о eg с^- 

о ■■- -^ о- 

о т- -^ с^- 

о о с\1 е> 

о о ■■- о- 



о о 
о о 
о о 
о о 
о о 
гм eg 
о о 
о о 
о гм 
о о 
о ■■- 
о eg 
о о 
о о 
о о 
о -^ 
о о 
гм гм 
о гм 



■■- с^- 

I I 

о о 
о о 
о о 

у- о 

о о 
eg гм 

s° 

о о 
о о 
о о 
со о 
о о 
о о 
о о 
о о 
гм гм 
о о 
гм -^ 
■^ о 



1- о •■- о 

II I I 

о о о о 
о о о о 
о о о о 

II I о 

о о о о 

о g о гд 

о о о о 

о о о о 

о eg о о 

о о о о 

о 1- о о 

о гм ■■- о 

о о о о 

о о о о 

о о о о 

о -^ eg о 

о о о о 

о eg LD -^ 

о eg о о 



■■- -^ о 
о о '- 
о о о 



о о 
о о 



о 1- т- 1- о 



о ем о о- 

о о о о 

о о о с^- 

о о о о- 

см с^ с^ с^ 

о о о о- 

о о о с^- 



■■- ем 

о о 

см I 

eg 1- 

о о 

о о 

о о 

г- гм 

о о 

о о 



о о 

о о 

гм гм о 

о о о 

о о гд 

о о о 

гм с^ гд 

о о о 

о о о 



■■- о eg 

о о о 

о о о 

о о о 

гм •>- о 

о о о 

о о о 



I- с^ 1- о 

ММ 

о о о о 

о о о о 

о о о о 

ем о о I 

■■- о о о 

■■- гм гм о 

о о о о 

о о о о 

о о о eg 

о о о о 

о о 00 т- 

ед о eg eg 

о о о о 

о о о с^- 

о о о о 

I о о -^ 

I о о о 

I см ■■- eg 

I о о eg 

т- о о \ 
^^о I 
I оо I 

I о о I 

■.- г- I о 

гд 
т- о 
гм см 

eg см о ■■- 

о о о о 

о о о о 

о о о о 

■■- с^ гм см 

о о о о 

о о о о 



то о Й Е 
О) 5 ■^ то 
Ч tn Q Q 



Q. ТО 2 ТО 






1 g то ? 1 f s 


.то 
È 


•S „ : 
Si is -^ 


U^cSíííí 






^ :^ г 



164 



BODÓN, MANGANELLI & GIUSTI 



C^-OC^•C^■r-OOC^■OC^■0^^^^-^-0'-^-^-C^•C^■•.-^-^-0^-00^-^-^-00 



I M M M I I I I M I I 



o 


o 


o 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


•^ 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


o 


o 


o 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


- 


о 


о 


о 


о 


о 


o 


o 


o 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


o 


o 


o 


о 1 


о 


о 


о 


1 


о 


о 


о 


1 


- 


^ 


о 


о 


1 


1 


1 


1 


о 


1 


1 


1 


1 


1 


1 


o 


- 


o 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


- 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


CM 


C\J 


ÍM 


Cvj о 


см 


см 


см 


о 


см 


см 


см 


о 


о 


- 


см 


см 


о 


о 


о 


о 


см 


о 


о 


о 


о 


о 


о 


o 


o 


o 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


со 


со 


см 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


o 


o 


o 


о о 


о 


о 


о 


о 


о 


о 


о 


- 


о 


о 


- 


с^ 


о 


о 


о 


о 


- 


- 


- 


о 


о 


о 


о 


o 


C\i 


o 


о о 


о 


о 


о 


о 


о 


см 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


- 


^ 


о 


о 


o 


o 


o 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


o 


- 


o 


о со 


о 


о 


- 


о 


о 


- 


о 


со 


со 


о 


со 


о 


^ 


о 


о 


о 


о 


со 


см 


- 


- 


о 


о 


o 


C\J 


o 


о со 


о 


о 


¡г> 


о 


о 


см 


о 


о 


о 


см 


о 


о 


о 


о 


о 


о 


о 


о 


см 


01 


со 


- 


- 


o 


o 


o 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


- 


о 


о 


о 


о 


о 


о 


о 


о 


o 


o 


o 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


- 


о 


о 


о 


о 


•ч- 


о 


о 


о 


о 


о 


o 


o 


o 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


- 


о 


о 


о 


о 


о 


o 


- 


o 


о 1- 


о 


см 


см 


о 


см 


- 


см 


о 


о 


- 


о 


о 


о 


о 


о 


1 


о 


см 


см 


о 


о 


о 


о 


o 


o 


o 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


^ 


о 


о 


1 


о 


- 


о 


о 


о 


о 


о 


CJ 


(M 


- 


■■- CkJ 


см 


см 


см 


см 


см 


см 


см 


со 


- 


о 


см 


- 


о 


'S- 


■ч- 


1 


см 


о 


- 


^ 


см 


"* 


о 


o 


CM 


o 


о см 


о 


см 


см 


о 




см 


см 


- 


о 


о 


о 


о 


о 


о 


о 


1 


о 


- 


- 


о 


о 


о 


^ 


1 


1 


o 


о о 


о 


1 


- 


- 


1 


1 


1 


о 


- 


о 


о 


- 


о 


- 


см 


см 


о 


- 


- 


1 


- 


- 


- 


1 


1 


o 


о — 


- 


1 


- 


о 


1 


1 


1 


о 


о 


- 


о 


о 


- 


о 


- 


- 


о 


о 


о 


1 


- 


о 


- 


1 


1 


o 


о •■- 


о 


1 


о 


о 


1 


1 


1 


о 


о 


о 


о 


- 


о 


- 


^ 


1 


- 


- 


о 


1 


^ 


- 


^ 


1 


1 


o 


о о 


о 


1 


о 


о 


1 


1 


1 


о 


о 


о 


о 


о 


о 


о 


о 


1 


о 


о 


о 


1 


о 


о 


о 


o 


o 


^ 


■^ о 


'- 


о 


.^ 


о 
о 


"" 


о 


о 
о 




о 


о 


о 










1 
1 








о 
о 








- 


<M 


- 


1- см 


- 


- 


- 


- 


- 


см 


- 




- 


- 


- 










1 








см 








o 

1 


o 

1 


o 

CM 


о о 
см о 


о 
см 


о 

1 


о 
о 


о 
о 


о 

1 


о 

1 


о 

1 




о 
о 


^ 


о 










1 
1 








о 

1 








- 


- 


CM 


см см 


см 


- 


см 


см 


- 


- 


- 


о 


см 


см 


см 


о 


о 


о 


о 


о 


о 


о 


о 


- 


о 


о 


о 


o 


o 


о 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


- 


о 


о 


о 


о 


- 


о 


о 


о 


о 


о 


o 


o 


о 


о о 


о 


о 


о 


о 


о 


о 


о 


- 


о 


о 


о 


о 


о 


о 


о 


- 


о 


о 


- 


о 


о 


о 


о 


o 


o 


о 


о о 


о 


о 


о 


о 


о 


о 


о 


- 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


- 


о 


о 


о 


о 


0- 


(N 


с^ 


с^ см 


с- 


о 


с^- 


см 


о 


см 


с^ 


о 


см 


о 


о 


о 


о 


см 


о 


C^ 


о 


о 


о 


см 


о 


с^- 


С^' 


o 


o 


о 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


см 


о 


о 


о 


о 


о 


о 


о- 


о 


o 


o 


о 


о о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


^ 


о 


о 


о 


о 


о 


о 



о I ^ 
о I о 



- I I 

- I I 



I I 



о о 

о о 

о о 

о о 

о о 

о см 

см о 

о о 

о о 

о о 

о со 

о о 

■■- о 

о о 

о о 

о о 

о о 

^ см 

о о 



I I 

о о 

о о 

о о 

I I 

о о 

о о 

о о 

о о 

о о 

о о 

со о 

о о 

С^- т- 

о о 

о о 

о о 

о о 

м- м- 

о о 



о о 

о о 

о о 

I о 

о о 

о см 

о см 

о -^ 

о о 

о о 

со о 

о о 

о о 

о о 

о о 



о о С^- t- -^ о о 

I I I I I I I 

о о о о о о о 

о о о о о о о 

о о о о о о о 



о о 
о о 



о о 

о о 

о о 

о о 

о о 

о о 

о о 

о о 

о о 

о о 

о о 

о о 

о о 

•* м- 

о о >- о 

,- т- ,- о 



о о о 

о о см 

о о со 

о >- о 

о о о 

о о о 

о ■■- о 

о ■■- о 

о о о 

о о о 

о о о 

о eg о 

о о о 

см >- 1- 



о о 

о о 

о о 

о о 

о у- 

о о 

о о 

о о 

о о 

о о 

о о 

о о 

о о 

см о 

'- о 



о - - 



■^ о 
см ■•- 
о о 



•.- о т- 

о о '- 
■■- о о 



1- I о 

- I I 

I I о 



о т- 1- 



COCMO-i-OCMOOOOOCM--- 

ооооооооооооо 
ооооооооооооо 

OOOOOOOOO-t-OOO 

ооооооос^оосмоо 
смоосмоооооооосм 
ооооооооооооо 



с 
= л 

со *: 
•с 3 

m £? 'О 

s о -с 

Ï -с ■§ 
COS 

д'? о 



со 



5 Э 



О) р 



l«lt 

s О) ¡г (О 

о О- о. 0- 



Е 2 
■S со 



•S Е 2 



со =, 

э> е Е 



■о -S 5 



р. со я с Э s 



OmcocOllU.S 






(Л 

ел 


= 5 


R- 




О. Si 




со 
-J 


^ê 


со CJ 
со О) 


-J -J 


s 5 



CD С € со о с 



t 0) 5 -S 



§6â: 



со 

'S 
i4 


1 

'S 
^0 


"S 


1 


ço 

О) 


g) 

1 


о 

i 

3 


1 

1 

Cl) 


ço 
■M 


-S 

t 


CO 


(0 


СП 


X- 


n 


U1 


m 


<n 


m 


О. 


0. 


О. 


Q- 


Q. 


Ü. 


Q. 


a. 


v> 


V> 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



165 



TABLE 3. Valvatiform hydrobiid taxa of the genus group from Europe and the Middle East (* taxa not dis- 
cussed in the paper) and their taxonomic status according to the present revisen or the recent literature. 



Nominal taxon 



Taxonomic status 



Adriolitorea Radoman, 1973b, as Islamia 

(Adriolitorea) 
Arganiella Giusti & Pezzoli, 1980 
Bracenica Radoman, 1973a 
Dabriana Radoman, 1974 
Da/maie//a Velkovrh, 1970 
Dap/7n/o/a Radoman, 1973a 
Daudebardiella* Boettger, 1905 
Dolapia Radoman, 1983 
Erythropomatiana Radoman, 1978 
Fissuria Boeters, 1981 
Gocea Hadzisce, 1956 
Hadziella Kuscer, 1932 

Hauffenia Pollonera, 1898, as Horatia (Hauffenia) 
Hera и I ti a n. gen. 
Horai/a Bourguignat, 1887 
Islamia Radoman, 1973a 
Karevia Radoman, 1973a (not Hadzisce, 1959) 
Karevia Hadzisce, 1959, as Ohrigocea {Karevia) 
Ker/c/a Radoman, 1978 
/-obaun/a Haase, 1993 
Lyhnidia Hadzisce, 1959 
/W/en/s/e//a Schutt, 1991 
Naumia Radoman, 1973a 

Neohoratia Schutt, 1961a, as Horatia (Neohoratia) 
Ohridohauffenia Hadzisce, 1959, as Ohridohoratia 

(Ohridohauffenia) 
Ohridosturanya Radoman, 1973a 
Ohrigocea Hadzisce, 1959, as Ohrigocea 

(Ohrigocea) 
Pezzolia Bodon & Giusti, 1986 
Prespolitorea Radoman, 1983 
Pseudohoratia Radoman, 1967 
Pseudoislamla Radoman, 1979 
Rotondia Radoman, 1964, as Pseudamnicola 

(Rotondia) 
Sardohoratia Manganeili, Bodon, Cianfanelli, 

Talenti & Giusti, 1998 
Sheitanok* Schutt & Sesen, 1991 
Sfrugf/a Radoman, 1973a 
Vrania Radoman, 1978, as Hauffenia (Vrania) 
Zaumia Radoman, 1983 



junior synonym of Islamia 

Arganiella 

Bracenica 

Dabriana 

Dalmatella 

Daphniola 

Daudebardiella* 

junior synonym of Karevia 

junior synonym of Hauffenia 

Fissuria 

Gocea 

Hadziella 

Hauffenia 

Heraultia 

Horatia 

Islamia 

junior synonym of Ohrigocea 

Karevia 

Kerkia 

junior synonym of Hauffenia 

Lyhnidia 

junior synonym of Islamia 

name not available (see remarks to Ohridohauffenia) 

junior synonym of Hauffenia 

Ohridohauffenia 

name not available (see remarks to Ohrigocea) 
Ohrigocea 

Pezzolia 

Prespolitorea 

Pseudohoratia 

Pseudoislamla 

name not available (see remarks to Ohridohauffenia) 

Sardohoratia 

Sheitanok 

Strugia 

junior synonym of Hauffenia 

Zaumia 



subpiscinalis and E. erythropomatia share an- 
other character state, the evident penial 
lobes, in the form of small pimples. Vrania 
wagneri apart from having a reduced opercu- 
lar peg, is characterized by one evident wide 
penial lobe. Hauffenia tellinii, apart from hav- 
ing a rather developed opercular peg, is char- 
acterized by wide, but not evident penial 
lobes, or none at all. Three groups, based on 
two diagnostic characters, can therefore be 
identified. 

The only anatomical difference between the 
four taxa consists in the different number and 



evidence of the penial lobes: 2-3, small, evi- 
dent and roundish {Neotioratia, Erythropoma- 
tiana); 0-2, large but not evident (Hauffenia); 
one, evident and wide (Vrania). These differ- 
ences are not sufficient for a distinction at the 
rank of genus or subgenus, in view of the 
marked variability in some of the type species 
studied by us (see above description and 
Figs. 22, 73-75, 84, 130, 138, 140, 169). We 
therefore propose Neofioratia, Vrania, Eryth- 
ropomatiana as junior synonyms of Hauffenia. 
Finally, with regard to Lobaunia, Haase's 
(1992) interpretation of its female genitalia 



TABLE 4. Analytical key for the identification of the European valvatiform hydrobiid genera (Dalmatella is not 
included, because its anatomy is unknown; it is easily identified by its shell characters). For characters used, 
see Fig. 181. 



la— Three sac-like structures on renal oviduct: a bursa copulatrix 
(ВС) and two seminal receptacles: distal (DSR) and proximal (PSR) 

lb — Two sac-like structures on renal oviduct: a bursa copulatrix 
(ВС) and a seminal receptacle (DSR or PSR) or two seminal 
receptacles (DSR and PSR) 

2a — ВС normal-sized, with evident duct 

2b — ВС reduced in size, not larger than a seminal receptacle, without 
evident duct: penis without lobe/s or with one or two glandular lobe/s 

3a — Penis with lobe/s 

3b — Penis without lobe/s: PSR bent outwards 

4a — Penis with one simple lateral lobe 

4b — Penis with 2-4 glandular lobes 

5a — ВС large, with duct about as long as ВС 

5b — ВС small, with duct about twice as long as ВС 

6a - DSR slightly larger or smaller than PSR 

6b — DSR much larger than PSR and about as long as bursa copu- 
latrix duct: ВС pyriform: operculum with peg 

7a -PSR distinct 

7b — PSR relatively indistinct, bent to adhere to wall of oviduct 

8a — ВС roundish 

8b — ВС not roundish 

9a -PSR much larger than DSR 

9b -PSR slightly larger than DSR 

10a — ВС pyriform 

10b — ВС arched, kidney- or crescent-shaped; shell with two rows of 
raised nail-like projections 

11a -PSR larger than DSR 

lib — PSR about as long as DSR: last whorl of shell despiralized; 
operculum spiralized on outer face to resemble screw 

12a — Seminal receptacle (PSR) at end of loop of oviduct 

12b - No seminal receptacle (PSR) at end of loop of oviduct (only 
DSR and ВС beyond end of loop) 

13a — ВС normal-sized with evident duct, if reduced with long duct: 
penis with simple lobe 

13b — ВС reduced in size, without evident duct, or absent (in the lat- 
ter case DSR present) 

14a — Penial lobe large 

14b — Penial lobe small 

15a — ВС medium-sized 

15b — ВС very small 

16a — ВС medium-sized 

16b — ВС very small; operculum with peg 

1 7a — ВС slightly larger than PSR; wide penial apex with stylet and 
subcentral penial duct; operculum with or without peg 

1 7b — ВС absent and DSR not larger than PSR; penial apex without 
stylet and with lateral penial duct 

18a — PSR usually larger than DSR and with evident duct; penis 
with one lateral or apical lobe, usually glandular 

18b — PSR usually smaller than DSR and without evident duct; 
penis without or with one or two glandular lobe/s 

19a -ВС larger than DSR 

19b — ВС small, smaller than DSR (which is very large); penis without 
lobe/s; caudal tentacle; central tooth of radula without basal cusps 

20a — Duct of bursa copulatrix entering bursa on anterior side 

20b — Duct of bursa copulatnx entenng bursa on posteroventral or 
lateroposterior side; penis without lobe/s 

21 a — Penis with one simple lobe; operculum with crest on inner face 

21b — Penis without lobe/s: operculum at most with circular thicken- 
ing at centre of inner face 

22a — Duct of bursa copulatrix entering bursa on posteroventral 
side; shell planispiral 

22b — Duct of bursa copulatrix entering bursa on lateropostenor side 



2 
12 

3 

Pezzolia (in part) (Liguria, Italy) 



Sardohoratia (Sardinia Island, Italy) 

5 

Fissuria (France, Italy, and Greece) 

6 

Pseudoislamla (Greece) 

7 

Bracenica (Montenegro) 



Horatia (Dalmatia and Macedonia) 

9 

10 

Prespolitorea (Prespa basin) 

Daphniola (Greece) 

11 

Karevia (Lake Ohrid) 

Ohrigocea and Ohridohauffenia 

(Ohrid basin) 
Gocea (Lake Ohrid) 

13 

19 



14 



17 

15 
16 

Lyhnidia (Ohrid basin) 
Zaumia (Ohrid basin) 
Strugia (Ohnd basin) 
Pseudohoratia (Lake Ohrid) 
Hauffenia (Austria, NE Italy, 

and NW Balkans) 
18 

Islamia (France, Switzerland, S Eu- 
rope, Turkey, Israel and Lebanon) 
Pezzolia (in part) (Liguria, Italy) 

20 

Dabriana (Bosnia-Herzegovina) 

21 
22 

Kerkia (Slovenia) 
Arganlella (Central Italy) 

Hadzlella (NE Italy and NW Balkans) 

Heraultia (Hérault, France) 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



167 









5a 



5b 



6a 



6b 



/i^ 



7a 




7b 



8a 



8b 



9a 



9b 





10a 



10b 



11a 



lib 



12a 



12b 





13a 



13b 



14a 



14b 



15a 



15b 








16a 



16b 



17a 



17b 



18a 



18b 




19a 



19b 




20a 



20b 




21a 



21b 




FIG. 181. Characters used in the analytical key for the identification of genera of European valvatiform hy- 
drobiids (Table 4). The bar at the end of the oviduct means that another structure (bursa copulatrix or semi- 
nal receptacle) may be present; the double bar that two other structures (bursa copulatrix and seminal re- 
ceptacle or two seminal receptacles) may be present. 



168 



BODÓN, MANGANELLI & GIUSTI 



needs confirmation. We propose this genus 
as a junior synonym of Hauffenia. 

Concluding, the genus Hauffenia (including 
Erythropomatiana, Neohoratia, Vrania and 
Lobaunia) is characterized by: shell very 
small, conical-valvatiform to planispiral; oper- 
culum with or without peg; penis with stylet 
and with or without lobes: female genitalia 
with proximal seminal receptacle and very 
small bursa copulatrix; central tooth with one 
or two pairs of basal cusps. 

We performed a parsimony analysis on a 
selection of European valvatiform and non- 
valvatiform hydrobiid genera in order to verify 
whether our conclusion about the affinities be- 
tween Hauffenia. Lobaunia. Neofioratia. Vra- 
nia and Erytfiropomatiana was supported by 
synapomorphies. The data matrix consisted 
of a selection of 44 of the 62 taxa listed in 
Table 2. Sixteen genera were excluded be- 
cause they were not well known (more than 
eight characters unknown: Adriofiydrobia, 
Bracenica. Clameia. Dabriana, Dalmatella, 
Dapfiniola, Graecoanatolica, Karevia. Iglica. 
Ohriofiauffenia. Ohrigocea. Palacanthiiliopsis. 
Prespolitorea. Pseudoislamia. Strugia and 
Zaumia). All characters were assigned equal 
weight, and multistate characters were 
treated as nonadditive. Twenty-two of the 79 
characters were parsimony uninformative: six 
were constant (T8, T10, H2, RIO, M3, M13) 
and 16 were autoapomorphies (T2, T6, T9, 
04, 05, C3, 04, R1, R11, S2, F2, F5, FIO, 
FIB, MIO, Mil). Character polarity was de- 
termined by outgroup comparison, choosing 
four different genera as outgroup: Hydrobia 
(subfamily Hydrobiinae), regarded as one of 
the most primitive extant genera (Ponder, 
1988a): Bytliinella, regarded as belonging to 
the family/subfamily Amnicolidae/Amnicoli- 
nae (Davis et al., 1985: Hershler & Thomp- 
son, 1988: Hershler & Ponder, 1988a): Heleo- 
bia, regarded as belonging to the subfamily 
Cochliopinae (= Littoridininae) (Davis et al., 
1983: Hershler & Thompson, 1992: Hershler 
& Ponder, 1998): Potamopyrgus. regarded as 
possibly belonging to the distinct subfamily 
Potamopyrginae (Boeters, 1988; Ponder, 
1988b). 

1152 most parsimonious hypotheses were 
generated by our data matrix. All had 332 
steps, with a Consistency Index of 0.425 and 
a Retention Index of 0.576 (Swofford, 1997). 
The strict consensus of the trees (Fig. 182) 
showed that 14 monophyletic groups ap- 
peared in all trees and that one of them was 



the Hauffenia group. If shell characters (P1- 
P3, T1-T10, AI -A3, U1) are excluded (most 
shell characters are considered to be plastic 
and subject to convergence: Ponder, 1988a), 
a total of 8208 most parsimonious hypotheses 
were generated by our data matrix. All had 
250 steps, with a Consistency Index of 0.432 
and a Retention Index of 0.571 (Swofford, 
1997). The strict consensus of these trees 
(Fig. 183) showed that eight monophyletic 
groups appeared in all trees and that one of 
them was the Hauffenia group. In the two sets 
of trees, the Hauffenia group is always sup- 
ported by the following synapomorphies: F4^ 
[proximal seminal receptacle], M2^ [penis with 
apex blunt], M42 [corneous stylet inside apex 
of penis] and M14q [penial duct running 
through central portion of penis], but only one 
of these, M42, is exclusive. 

Shell characters played a major role in re- 
solving phylogenetic relationships among the 
various genera (Fig. 182): when shell charac- 
ters are omitted, resolution diminishes and 
some of the monophyletic groups disappear 
or change. 

The cladistic analysis clearly produced a 
"non-result". Nevertheless, it was useful to 
show that morphological characters are not 
sufficient to reconstruct the phylogenesis of 
the hydrobiids. A combined approach, involv- 
ing consideration of morphological and ge- 
netic data, is the only valid alternative. 



STATUS OF THE SPECIES PRESENTLY 
ASSIGNED TO HAUFFENIA 

Many species from different European lo- 
calities (and even from outside Europe) have 
been assigned to Hauffenia and Neohoratia 
(Kuscer, 1932, 1933a, b; Bole, 1961, 1967a, 
b, 1979, 1993; Schutt, 1961b, 1962, 1980; 
Binder, 1966; Angelov, 1967; Radoman, 
1973a, 1978, 1983; Bernasconi, 1975, 1977, 
1984, 1985, 1988; Maassen, 1975, 1978; 
Boeters, 1973, 1974, 1981, 1988, 1998; Git- 
tenberger, 1982; Bole & Velkovrh, 1986, 
1 987; Boeters & Rolan, 1 988; Bech, 1 990; Jo- 
vanovic, 1991; Haase, 1992, 1993; Hinzetal., 
1984; Rolan 1997a, b). Most of them, studied 
on the basis of shell characters only, followed 
in only a few cases by anatomical study, are in 
need of revision. As far as possible, we 
checked the status of each of them by study- 
ing any new material available. 

Only a few species from the eastern Alps 
and Balkans actually belong to Hauffenia (for 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



169 




Alzoniella 

Pseudavenionia 

Arganiella 

Hadziella 

Sardohoralia 

Heraultia 

Kerkia 

Eryttiropomatiana 

Hauttenia 

Lobaunia 

Neohoratia 

Vrania 

Pezzolia 

Fissuria 

Gocea 

Horatia 

Lyhnidia 

Pseudohoralia 

Avenionia 

Belgrandia 

Belgrandiella 

Bythiospeum 

Istriana 

Litthabitella 

Lanzaiopsis 

Uthoglyphus 

Moitessieria 

Paladilhia 

Plagigeyeria 

Sardopaladilhia 

Paladilhlopsis 

Phreatica 

Heleobia 

Hydrobia 

Pseudamnicola 

Potamopyrgus 

Graziana 

Pauluccinella 

Islamia 

Mercuna 

Sadleriana 

Onentalina 

Marstoniopsis 

Bylhinella 



-r^ 



Alzoniella 

Pseudavenionia 

Arganiella 

Hadziella 

Sardohoralia 

Heraultia 

Kerltia 

Erythropomabana 

Hautlenia 

Lobaunia 

Neohoratia 

Vrania 

Pezzolia 

Fissuria 

Gocea 

Horatia 

Lyhnidia 

Pseudohoralia 

Avenionia 

Bythinella 

Marstoniopsis 

Islamia 

Mercuna 

Sadleriana 

Onentalina 

Belgrandia 

Pauluccinella 

Graziana 

Belgrandiella 

Bythiospeum 

Istriana 

Utthabltella 

Lanzaiopsis 

Lithoglyphus 

Moitessieria 

Paladilhia 

Plagigeyeria 

Sardopaladilhia 

Paladilhlopsis 

Phreatica 

Hydrobia 

Pseudamnicola 

Potamopyrgus 

Heleobia 



-r^ 



D 




' Alzoniella 
Pseudavenionia 
Arganiella 
Hadziella 
Sardotioratia 
Heraultia 
Kerkia 
Erythropomatiana 
Hautlenia 
Lobaunia 
Neohoratia 
Vrania 
Pezzolia 
Fissuna 
Gocea 
Horatia 
Lyhnidia 
Pseudotюгatia 
Avenionia 
Bythinella 
Marstoniopsis 
Islamia 
Mercuna 
Sadleriana 
Onentalina 
Belgrandia 
Pauluccinella 
Graziana 
Belgrandiella 



-r^ 



— Bythiospeum 

— Istriana 

Litthabitella 

^— Lanzaiopsis 
-^ Lithoglyphus 

— Moitessieria 

— Paladilhia 
-^ Plagigeyeria 

— Sardopaladilhia 
-^ Paladilhlopsis 
^— Phreatica 

— Heleobia 

-^ Potamopyrgus 
•^ Pseudamnicola 

— Hydrobia 



• Alzoniella 
Pseudavenionia 
Arganiella 
Hadziella 
Sardohoralia 
Heraultia 
Kerkia 

- Erythropomatiana 

- Hautlenia 

- Lobaunia 

- Neohoratia 

- Vrania 

- Pezzolia 

- Fissuna 

- Gocea 

- Horatia 

- Lyhnidia 

- Pseudohoralia 

- Avenionia 

- Bythinella 

- Marstoniopsis 

- Islamia 

- Mercuna 

- Sadleriana 

- Onentalina 

- Belgrandia 

- Pauluccinella 

- Graziana 

• Belgrandiella 

• Bythiospeum 

• Istriana 

■ Utthabltella 

• Lanzaiopsis 

• Lithoglyphus 

■ Moitessiena 

• Paladilhia 

• Plagigeyeria 

■ Sardopaladilhia 

• Paladilhlopsis 

• Phreatica 

■ Heleobia 

■ Hydrobia 

■ Pseudamnicola 

■ Potamopyrgus 



FIG. 182. The strict consensus trees of 1152 most parsimonious cladograms generated by tine data matrix 
(Table 2) using Bythinella, Heleobia, Hydrobia and Potamopyrgus as outgroup for determining character po- 
larity. 



170 



BODÓN, MANGANELLI & GIUSTI 



' Alzoniella 
' Fissuha 

■ Arganteíla 
' Avenionia 
' Islamia 

■ Belgrandia 

■ Belgrandiella 

■ Bythiospeum 

■ Eryttvopomatiana 
i Hautlenia 

' Lobaunia 
' Neohoratta 

■ Vrania 

■ Gocea 

■ Moraba 

• Graziana 

■ Hadziella 

• Heteobia 

■ Heraultia 

■ Hydrobia 

■ Mercuna 

■ Pseudamnicola 
. Istriana 

■ unhabitella 

■ Kerkia 

• Lanzaiopsis 

• Moitessiena 

■ Paladilhia 

• Phreatica 

■ Plagigeyeria 

• Sardopatadilhia 

• Uthoglyphus 

• Potamopyrgus 

• Marstoniopsis 

• Lyhnidia 

■ Pseudohoralia 

■ Onentalina 

• Paladilhiopsis 

• Pautuccinelta 

■ Pezzolia 

• Pseudavenionia 

■ Sadlenana 

' SafdohoraUa 

• Bythinella 



Atzoniella 

■ Fissuria 

■ Arganteíla 
' Avenionia 

■ Islamia 

■ Belgrandia 

■ Belgrar^diella 

• Bythtnella 

■ Bythiospeum 

■ Erythropomatiana 

• Hauftenia 

• Lobaunia 

■ Neohoratia 

• Vrania 

• Gocea 

• Horatia 

■ Graziana 

• Hadziella 
' Heraultia 

• Hydrobia 

■ Mercuna 

• Pseudamnlcola 

• Istnana 

■ ütthabitella 

■ Kerkia 

■ Lanzaiopsis 

- Moitessiena 

- Paladilhia 

- Phreatica 

- Plagigeyerla 

- SardopaladtlNa 

• Uthoglyphus 

- Potamopyrgus 

- Marstoniopsis 

- Lyhnidia 

- Pseudohoralia 

- Onentalina 

- Paladllhiopsis 

- Pauluccmella 

- Pezzolla 

- Pseudavenionia 

- Sadlenana 

- Sardohoratia 

- Heleobia 




Alzoniella 

Fissuria 

Arganietla 

Avenionia 

Islamia 

Belgrandia 

Belgrandiella 

Bythinella 

Bythiospeum 

Erythropomattana 

Hauftenia 

Lobaunia 

Neohoratia 

Vrania 

Gocea 

Moraba 

Graziana 

Hadziella 

Heleobia 

Heraultia 

Istrlana 

ütthabitella 

Kerkia 

Lanzaiopsis 

Moitessiena 

Paladilhia 

Phreatica 

Ptagigeyeria 

Sardopaladilhia 

Uthoglyphus 

Potamopyrgus 

Marstoniopsis 

Lyhnidia 

Pseudohoratia 

Onentalina 

Paladilhiopsis 

Pauluccmella 

Pezzoha 

Pseudavenionia 

Sadlenana 

Sardohoratia 

Mercuna 

Pseudamnicola 

Mydrobia 



Alzoniella 

■ Fissuria 

■ Arganiella 
' Avenionia 

■ tslamia 

■ Belgrandia 

' Belgrandiella 
. Bythinelta 

• Bytniospeum 

I Erythropomattana 

■ Hauftenia 

■ Lobaunia 

■ Neohoratla 

• Vrania 

■ Gocea 

• Moratta 

■ Grailana 

. Madzlella 

■ Heleobia 

■ Heraultia 

■ Hydrobla 
' Mercuría 

• Pseudamnicola 

• Islrtana 

■ ütthabitella 

• Kerkia 

• Lanzaiopsis 

• Moitessiena 

• Paladilhia 

■ Phreatica 

• Plagigeyena 

• Sardopaladilhia 

• Lyhnidia 

■ Pseudohoratla 

• Onerttalina 

■ Paladilhiopsts 

• Paulucclnella 

• Pezzolla 

• Pseudavenionia 

■ Sadlenana 

• Sardohoratia 

• Marsloniopsis 

• Uthoglyphus 

• Potamopyrgus 



FIG. 183. The strict consensus trees of 8208 rлost parsimonious cladograms generated by the data matrix 
(Table 2) when shell characters (P1-P3, T1-T10, AI -A3 and U1) are excluded. Character polarity was deter- 
mined by outgroup comparison, choosing four different genera as outgroup: Bythinella, Heleobia, Hydrobia 
and Potamopyrgus. 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



171 




FIG. 184. Geographic range of the genus Hauffenia Pollonera, 1898 (only species certainly belonging to the 
genus are considered). 



the distribution of Hauffenia and other Euro- 
pean valvatiform hydrobiid genera, see Figs. 
184-187; for the status and distribution of all 
European valvatiform hydrobiid species, see 
Tables 5, 6). In addition to the type species of 
Hauffenia, H. fe///n// (Pollonera, 1898); Erytti- 
ropomatiana, H. erytliropomatia (Hauffen, 
1856); Neolioratia, H. subpiscinalis (Kuscer, 
1932); and Vrania, H. wagneri {Kuscer, 1928), 
they are: H. /cersc/iner/ (Zimmermann, 1930), 
H. media Bole, 1961, H. subcarinata Bole & 
Velkovrh, 1987, H. tovunica Radoman, 1978, 
and /-/. wienerwaldensis Haase, 1992. They 
are redescribed below (for their identification, 
see Table 7, Fig. 188). 

The misidentified species will be discussed 
in four groups on the basis of their geograph- 
ical distribution (central-eastern European 
species, French species, Spanish species, 
and North American species). 



Central-Eastern European Species. Some 
nominal species described from the Balkan 
Peninsula are assigned to Hauffenia and to 
Neolioratia and listed as valid taxa by Bole & 
Velkovrh (1986), although all of them were 
overlooked by Radoman (1973, 1983). Their 
distribution far from Slovenia and northern 
Croatia (where species of Hauffenia live) 
throws serious doubt on their inclusion in 
Hauffenia. 

They are: "Hauffenia" ediaueri (Schutt, 
1961b), '^ Hauffenia" jadertina Kuscer, 1933a, 
"Hauffenia" lucidula (Angelov, 1967), "Hauffe- 
nia" plana Bole, 1961, "Hauffenia" raehlei 
(Schutt, 1980), "Hauffenia" sinjana (Kuscer, 
1933a, "Hauffenia" solitaria Bole & Velkovrh, 
1986 {nomen nudum), "Neohoratia" epirana 
(Schutt, 1962) and "Neohoratia" hadei (Git- 
tenberger, 1982). For these species (except 
"H." lucidula, "H." raehlei and "Л/." epirana). 



172 



BODÓN, MANGANELLI & GIUSTI 




FIG. 185. Geographie range of the genus Islamia Radoman, 1973a. The distribution is probably wider in 
western and eastern Europe and Asia Minor, where little research has been carried out. 



lack of anatomical data makes their inclusion 
in Hauffenia entirely speculative. In the case 
of "'H." lucidula and ''N."eplrana, there is too lit- 
tle anatomical data available to make a posi- 
tive generic arrangement. On the other hand, 
there is sufficient anatomical data on "/-/." 
raehleiXo allocate it to another genus, namely 
Fissuria (see Fissuha raehlei in the "Descrip- 
tions of some taxa misidentified as Hauffenia 
species"). 

French Species. Several very small, valvati- 
form, freshwater prosobranch gastropods 
from France were described under the 
generic name Valvata at the dawn of modern 



malacology: V. minuta Draparnaud, 1805; V. 
moquiniana Dupuy, 1851; V. globulina 
Paladiihe, 1866; V. ex///s Paladiihe, 1867; V. 
bourguignati Letourneux, 1869; V. micromet- 
rlca Locard, 1889; and V. turgidula Locard, 
1889. 

Germain (1913, 1931) made the first revi- 
sion, confirming only four species as valid: V. 
minuta (with V. turgidula as a junior synonym 
or form), V. globulina (wWb V. bourguignati and 
V. micrometrica as junior synonyms), V. mo- 
qulni [sic] and V. exilis. More recently, Binder 
(1966) regarded V. minuta and V. globulina as 
belonging to the same, very variable species. 
On the basis of available conchological and 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



173 




FIG. 186. Geographic range of the genera /Arg^an/e/Za Giusti & Pezzoli, 1980 (A), ßracen/ca Radoman, 1973a 
(B), Dabriana Radoman, 1974 (Db), Dalmatella Veikovrh, 1970 (Dl), Daphniola Radoman, 1973a (Dp), 
Hadziella Kuscer, 1932 (Ha), Horatia Bourguignat, 1887 (Ho), Kerkia Radoman, 1978 (K), Pezzolia Bodon 
& Giusti, 1986 (Pz), Pseudoislamia Radoman, 1979 (Ps) and endemic genera of Ohrid and Prespa basins 
(E) (Gocea Hadzisce, 1956, Karevia Hadzisce, 1959, Lyhnidia Hadzisce, 1959, Ohridohauffenia Hadzisce 
1959, Ohrigocea Hadzisce, 1959, Prespolitorea Radoman, 1983, Pseudohoratia Radoman, 1967, Strugia 
Radoman, 1973a, Zaumia Radoman, 1983). 



anatomical characters, he demonstrated that 
this species was a hydrobiid, which he as- 
signed to Hauffenia. 

BernasconI (1975, 1977, 1984, 1985, 1988) 
revised the French Hauffenia and concluded 
that only one species, Hauffenia {Neofioratia) 
minuta (Draparnaud, 1805), lived in France. 
He regarded V. globulina and V. moquiniana 
as junior synonyms of H. minuta, and, follow- 
ing Boeters (1974), V. exilis as a species of 
Horatia. He split H. minuta into four sub- 
species, two of which he established: H. mi- 
nuta minuta, H. minuta globulina (Paladilhe, 
1866), H. minuta spirata Bernasconi, 1985, 
and H. minuta consolationis Bernasconi, 
1985. The assignment of these taxa to Hauf- 



fenia (Neofioratia) was based on the small 
bursa copulathx and single seminal recepta- 
cle (characters typical of Hauffenia) and on 
the absence of the opercular peg (a character 
considered typical of Neofioratia). 

Unfortunately, Bernasconi's papers contain 
many mistakes, including misinterpretation of 
female genital structure. Our study of the 
French Hauffenia demonstrated that the two 
sac-like structures were two seminal recepta- 
cles, not a bursa copulatrix and a seminal re- 
ceptacle. This and the structure of the penis 
(presence of glandular lobe on left side; ab- 
sence of glandular mass in apical portion to 
right of penial duct; absence of stylet-like 
structure at tip) support inclusion of the 



174 



BODÓN, MANGANELLI & GIUSTI 




FIG. 187. Geographie range of the genera Fissuria Boeters, 1981 (F), Heraultia. n. gen. (H) and Sardohora- 
tia Manganelli, Bodon, Cianfanelli, Talenti & Giusti, 1998 (S). 



French Haufienia species in the genus /s- 
lamia (see "Descriptions of some taxa 
misidentified as Haufienia species"). 

Our study supports placennent of V. exilis in 
a new genus (see Heraultia n. gen. in "De- 
scription of a new valvatifornn genus from 
France"). 

Spanish Species. In a recent revision of the 
western European hydrobiids, Boeters (1988) 
assigned a number of Iberian valvatiform 
species to two genera: Horatia and 
Neolioratia. 

According to him, Horatia includes two Iber- 
ian species: H. gatoa Boeters, 1980; and H. 



(?) sturmi (Rosenhauer, 1856). The latter 
species was recently revised by Ramos et al. 
(1992) on topotypical material. None of these 
taxa belong to Horatia, notwithstanding the 
fact that they have a wide bursa copulatrix 
similar to that of species of Horatia (see de- 
scription of Horatia). In fact, Paludina sturmi 
has the penis divided into a wide basal portion 
and a very long, slender tip with a small lobe 
near its base, and the female genitalia have 
only two sac-like structures: a large bursa 
copulatrix and a seminal receptacle (proximal 
or RS2) (Boeters, 1988: 220^221, figs. 160, 
161, 172, 173; Ramos et al., 1992: 485). The 
same is true of Horatia gatoa, although this 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



175 



TABLE 5. Valvatiform hydrobiid taxa of species group from Europe and the Middle East (* taxa not discussed 
in the paper) and their taxonomic status according to the present revision or the recent literature (when the 
generic name is in quotation marks, allocation of the taxon is dubious or very uncertain). 



Nominal taxon 



Taxonomic status 



albanica, Horaf/a— Bourguignat, 1887 

amidicus\ Sheitanok— Schutt & Sesen, 1991 

anatolica*, /s/am/a— Radoman, 1973a 

anti, Hadz/e//a- Schutt, 1960 

asiana*, Daudebardiella—Boettger, 1905 

ateni, /W/crona— Boeters, 1969 

azarum, Neohoratia—BoeXers & Roían, 1988 

balcánica, Pseudoislamia— Radoman, 1979 

bendidis*, /s/am/a— Reischütz, 1988 

birsteim", Horai/a— Starobogatov, 1962 

borutzkir, /-/orai/a— Zhadin, 1932 

bosniaca\ /s/am/a— Radoman, 1973a 

bosniaca. Dabriana— Radioman, 1974 

boui, F/ssuna— Boeters, 1981 

bourguignati, l/a/vafa— Letourneaux, 1869 

brezicensis, Kerkia—Boöon & Cianfanelli, 1996 

brusinae, /-/oraf/a— Radoman, 1953 

burnabasa*, Horatia— Schutt, 1964 

cianensis, /s/am/a— Bodon, Manganelli, Sparacio & Giusti, 

1995 
consolationis, Hauffenia m/nufa— Bernasconi, 1985 
coronadoi. Va/uafa— Bourguignat, 1870 
danubialis. Lobaunia—Haase, 1993 
deminuta, Hadziella epiiippiostoma— Bole, 1961 
depressa, Pseudamnicola— Radoman, 1957 
drimica, Pseudamnicola (Rotondia)— Radoman, 1964 
ediaueri, Horatia {Hauffenia)^SchiJitt, 1961b 
ephippiostoma, Hadziella— Kuscer, 1932 
epirana, Horatia (Neohoratia)— Schutt, 1962 
erythropomatia, \/a/uafa— Hauff en, 1856 
exigua, Va/vaía— Schmidt, 1856 
exilis, Va/va/a- Paladiihe, 1867 
fezi, l/a/vafa (?Trop/d/na)- Altimira, 1960 
fontinalis, Horaf/a— Bourguignat, 1887 
gaillardoti, Valvata {Cincinna)— Germain, 1911 
gaiteri, /s/am/a— Bodon, Manganelli, Sparacio & Giusti, 

1995 
gasulli, Hauffenia (Neohoratia)— Boeters, 1981 
gatoa, Horatia— BoeXers, 1980 
gjorgjevici, /.y/in/d/a- Hadzisce, 1959 
gjorgjevici, Ohridohoratia (Ohridohauffenia)—Hadz\sce, 

1959 
globulina, l/a/i/afa-PaladiIhe, 1866 
gf/obu/us, -4mn/co/a— Bofil!, 1909 
graeca* , /s/am/a— Radoman, 1973a 

graeca, Dapfiniola- Radoman, 1973a 

hadei, Horatia {Neohoratia)—G\ttenberQer, 1982 

tiadzii, Lyhinidia—Hadzisce, 1959 

hellenica, Valvata (Cincinna)— \Nes\.er\und, 1898 

islamioides, Sarc/oA/oraf/a- Manganelli, Bodon, 

Cianfanelli, Talenti & Giusti, 1998 
jadertina, Hauffenia— Kuscer, 1 933a 
karamani Lyhinidia— Hadzisce, 1 959 
karevi, Ohrigocea (Ohrlgocea)— Hadzisce, 1959 
kerschneri, Horatia erythropomatia— Zimmermann, 1930 
klecakiana, /-/ora//a— Bourguignat, 1887 
knorri", Horatia- Schutt, 1961 



junior synonym of Horatia klecakiana 

Sheitanok amidicus* 

Islamia anatolica* 

Hadziella anti 

Daudebardiella asiana* 

Islamia ateni 

Islamia azarum 

Pseudoislamia balcánica 

"Islamia" bendidis* 

"Horatia" birsteinr 

"Horatia" borutzkir 

Islamia bosniaca* 

Dabriana bosniaca 

Fissuria boui 

possible junior synonym of Islamia globulina 

Kerkia brezicensis 

Pseudohoratia brusinae 

Islamia burnabasa* 

Islamia cianensis 

Islamia consolationis 

"Islamia" coronadoi 

Hauffenia danubialis 

Hadziella deminuta 

Ohridohauffenia depressa 

Ohridohauffenia drimica 

"Hauffenia" ediaueri 

Hadziella ephippiostoma 

"Islamia' epirana 

Hauffenia erythropomatia 

Daphniola exigua exigua 

Heraultia exilis 

"Islamia" fezi 

junior synonym of Horatia klecakiana 

Islamia gaillardoti 

Islamia gaiteri 

"Horatia" gasulli 

"Horatia" gatoa 

Ly h nidia gjorgjevici 

junior synonym of Ohridohauffenia depressa 

Islamia globulina 

Islamia globulus globulus 

Islamia graeca* (junior synonym of "Islamia" 

epirana?) 
junior synonym of Daphniola exigua exigua 
"Hauffenia" hadei 
Lyhnidia hadzii 

junior synonym of Daphniola exigua exigua 
Sardohoratia islamioides 

"Hauffenia" jadertina 
Lyhnidia karamani 
Ohrigocea karevi 
Hauffenia kerschneri 
Horatia klecakiana 
"Horatia" knorri 



176 



BODÓN, MANGANELLI & GIUSTI 



TABLE 5. (Continued) 



Nominal taxon 



Taxonomic status 



krkae. Hadziella- Bole, 1992 

kusceri. Hauffenla—Bo\e, 1961 

kusceri. /-/oraf/a— Hadzisce, 1959 

lacusths. Pseuc/amn/co/a (Rotond/a)— Radoman, 1964 

lagari. Pseudamn/co/a— Altimira, 1960 

latina', /s/am/a— Radoman, 1973a 

letourneuxi. Horaf/a— Bourguignat, 1887 

Ijovusdikini" . Horaf/a— Starobogatov, 1962 

loicliiana. IHauffenia kersclineri—Uaase. 1993 

lucidula. l4oratia(l4auffenia)—Ar\ge\oy. 1967 

lucidulus[$ic], f4oratia(i4auffenia)—Ange\o\j. 1967 

lytinidica. Pseudamnicoia(Olirigocea)— Radoman. 1963a 

macedónica, Sad/enana— Kuscer, 1936 

malaprespensis. Prespolitorea— Radoman, 1973a 

media. Hauffenia—Bo\e, 1961 

miclileri. Hauffenia—Kuscer, 1932 

micrometrica. \/a/i/aía— Locard, 1889 

mienisi. /W/en/s/e//a— Schutt, 1991 

miladinovorum. Oiihgocea (Karevia)—\-\adz\sce, 1959 

miljackae'. Dalmatella- Bo\e & Veikovrh, 1986 

minuta. Pseudamn/co/a— Radoman, 1955 

minuta. Va/va/a— Draparnaud, 1805 

moquiniana. Va/vafa— Dupuy, 1851 

naegelei'. Daudebard/e//a— Boettger, 1905 

novoselensis. Horaí/a— Radoman, 1966 

obliqua, /-/oraf/a— Bourguignat, 1887 

obtusa. Hora//a— Bourguignat, 1887 

ochridana. Valvata {Atropidina)—Po\\nsk\, 1929 

ohridana. Gocea— Hadzisce, 1956 

ohndana. Strugia— Radoman, 1973a 

omata. Pseudamnicola— Radoman. 1957 

palustris. Horaf/a— Bourguignat, 1887 

pangaea. Horatia (Daphniola) ex/gua— Reischütz, 1984 

pan/ulus'. Litlioglyphus—Naege\e, 1894 

pescei. Arganiella—GiusW & Pezzoli, 1980 

plana. Hauff enia— Bole. 1961 

planospira. "Fissuria"— Bodón. Cianfanelli & Taienti, 1997 

polinskli. Horatia— Radoman, 1953 

praeclara. Horaí/a— Bourguignat, 1887 

priitchevi. Ohngocea (Karevia)—Hadz\èce, 1959 

pseudorientalica' , /s/am/a— Radoman, 1973a 

pusilla, \/a/vafa- Piersanti, 1952 

radapalladis, Pezzolia— Bodón & Giusti, 1986 

raehlei. Horatia {Hauffenia)- Schün, 1980 

rotonda, Pseudamnicola {Rotondia)— Radoman, 1964 

rudnicae. Hadziella— Bo\e, 1992 

samuili. Ohirigocea (Ohrigocea)—\-\adz\sce, 1959 

sandanskii, Ohrigocea (Karevia)—Hadz\sce, 1959 

schuelei, Hauffenia (Neohoratia) coronado/— Boeters, 

1981 
servaini, Horaí/a- Bourguignat, 1887 
sinjana, Hauffenia jadertina—Kuscer. 1933a 
s/cef/, Da//77afe//a- Veikovrh, 1970 
s/cef/, Hadziella- Bole, 1961 
sokolovf, /-/ora//a— Starobogatov, 1962 
solitaria, Hauffenia- Bole & Veikovrh, 1986 
spirata, Hauffenia minuta— Bemasconl, 1985 
spiridoni, Bracenica— Radoman, 1973a 
sí. naum/[s/c], Pseudamnicola (Rotondia)— Radoman, 

1964 



Hadziella krkae 

Kerkia kusceri 

Zaumia kusceri 

Pseudohoratia lacustris 

Islamia globulus lagari 

Islamia latina* 

junior synonym of Horatia klecakiana 

"Horatia" Ijovuschkini" 

junior synonym of Hauffenia kerschineri 

"Hauffenia" lucidula 

"Hauffenia" lucidula 

junior synonym of Ohrigocea stankovici 

Horatia macedónica 

Prespolitorea malaprespensis 

Hauffenia media 

junior synonym of Hauffenia tellinii 

possible junior synonym of Islamia globulina 

Islamia mienisi 

Ohrigocea miladinovorum 

nomen nudum 

Ohridohauffenia minuta 

Islamia minuta 

possible senior synonym of Islamia globulina 

Daudebardiella naegelei" 

Horatia novoselensis 

junior synonym of Horatia klecakiana 

junior synonym of Horatia klecakiana 

Pseudotioratia ochridana 

Gocea ohridana 

Strugia ohridana 

Karevia ornata 

junior synonym of Horatia klecakiana 

"Daphniola" exigua pangaea 

"Horatia" párvula* 

Arganiella pescei 

"Hauffenia" plana 

"Fissuria" planospira 

junior synonym of Pseudohoratia ochridana 

junior synonym of Horatia klecakiana 

junior synonym of Karevia omata 

Islamia pseudorientalica* 

Islamia pusilla 

Pezzolia radapalladis 

Fissuria raehlei 

Ohridohauffenia rotonda 

Hadziella rudnicae 

Ohrigocea samuili 

junior synonym of Karevia omata 

Islamia schuelei 

junior synonym of Islamia valvataeformis 

"Hauffenia" sinjana 

Dalmatella sketi 

Hadziella sketi 

"Horatia" sokolovi* 

nomen nudum 

Islamia spirata 

Bracenica spiridoni 

Ohridohauffenia sanctinaumi 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



177 



TABLE 5. (Continued) 



Nominal taxon 



Taxonomic status 



St. zaumi[sic], Horai/a— Radoman, 1964 
stankovici, Horatia {Hauffenia)—Hadz\sce, 1959 
stankovici, Lyhnidia—Hadzisce, 1959 
sturmi, Paludina— Rosenhauer, 1 856 
subcarinata, Hauffenia {Hauffenia)—Bo\e & Velkovrh, 

1987 
sublitoralis, Lyhnidia— Radoman, 1967 
sublitoralis, Pseudamnicola (Ohridohauffenia)— Radoman, 

1963a 
subpiscinalis, l/a/vafa (?)— Kuscer, 1932 
sulcata, Sardohoratia— Mangane\\'\, Bodon, Cianfanelli, 

Talenti & Giusti, 1998 
supracarinata, Horatia— Bole & Velkovrh, 1986 
tellinii, Horatia (¡Hauffenia)— PoWonera, 1898 
tfiermalis, Hadziella-Bo\e, 1992 
tovunica. Hauffenia (Hauffenia)— Radoman, 1978 
thcfioniana* , Islamia— Radoman, 1979 
troglobja*, "Va/i/aia"-Bole & Velkovrh, 1986 
turgiduia, Va/i/afa— Locard, 1889 
umbilicata*, Hadziella-Bo\e & Velkovrh, 1986 
valvataeformis. Horatia (Hauffenia)— PoWonera, 1898 
valvataeformis. /-/усУгоЬ/а— Möllendorff , 1873 
valvataeformis, Prespolitorea— Radoman, 1973a 
verdica, Erythiropomatiana— Radoman, 1978 
verlikana, Horaf/a— Bourguignat, 1887 
wagneri, Va/i/a fa— К usee r, 1928 
wienerwaldensis, Hauffenia— Haase, 1992 
zermanica, Islamia— Radoman, 1973a 



Zaumia sanctizaumi 
Ohrigocea stankovici 
Lyfinidia stankovici 
"Horatia" sturmi 
Hauffenia subcarinata 

Lyhnidia sublitoralis 
Ohridotiauffenia sublitoralis 

Hauffenia subpiscinalis 
Sardotioratia sulcata 

nomen nudum (see Hauffenia subcarinata) 

Hauffenia tellinii 

Hadziella thermalis 

Hauffenia tovunica 

Islamia trichoniana* 

nomen nudum (= Islamia pusilla) 

possible junior synonym of Islamia globulina 

nomen nudum 

junior synonym of Hauffenia tellinii 

Islamia valvataeformis 

Prespolitorea valvataeformis 

junior synonym of Hauffenia subpiscinalis 

junior synonym of Horatia klecakiana 

Hauffenia v/agneri 

Hauffenia wienerwaldensis 

Islamia zermanica 



species appears to have a distal (or RS1) 
seminal receptacle (Boeters, 1988: 220, figs. 
1 62, 1 74). A distinct genus may have to be in- 
troduced for each of these species. However, 
we postpone this course of action until more 
anatomical detail is available. 

An even greater number of species was as- 
signed (sometimes tentatively) to Neohoratia 
by Boeters (1988), Boeters & Rolan (1988), 
Rolan (1997a, b), and Hinz et al. (1994): N. 
aten! (Boeters, 1969), N. azarum Boeters & 
Rolan, 1988; N. (?) согопасУо/ (Bourguignat, 
1870); N. (?) fezi (Altimira, 1960); N. (?) 
gasulli (Boeters, 1981); N. globulus (Bofill, 
1909) (with two subspecies: N. д. globulus 
and N. д. lagari (Altimira, I960)); and N. 
schuelei (Boeters, 1981). None of these ap- 
pear to belong to Hauffenia, as herein rede- 
fined. 

"Neohoratia" gasulli was more recently re- 
vised by Ramos et al. (1992) on topotypical 
material. It is peculiar in that it has a large 
pear-shaped bursa copulatrix and is com- 
pletely devoid of distinct seminal receptacles 
(according to Ramos et al., 1992, the function 
of seminal receptacles is supplied by the dis- 



tal portion of the renal oviduct which is en- 
larged and réfringent, as if it contained ori- 
ented spermatozoa); the penis has a lobe. 
Also in this case, we think a distinct genus will 
probably have to be introduced. 

Anatomical study of some other species 
("Л/." ateni, "Л/." g. globulus and "Л/." g. lagari; 
Figs. 189-208), showed that: the female gen- 
italia are characterized by the absence of a 
bursa copulatrix and the presence of two 
rather relatively separated seminal recepta- 
cles, the proximal larger than the distal one 
(Figs. 194, 200, 206); the penis is character- 
ized by the presence of a large lobe on the left 
side containing a réfringent mass of glandular 
cells; the penial duct runs inside the right side; 
an evident muscular pleat on ventral side, a 
glandular mass inside penis tip and a stylet- 
like structure at the opening of the penial duct 
are absent. Apart from the peculiar shell 
shape, amnicoliform or even bythinelliform 
(e.g., N. ateni), the anatomical characters dis- 
tinguish these three taxa from those included 
in Hauffenia. They suggest that "Л/." ateni, 
"Л/." g. globulus and "Л/." g. lagari belong to a 
group of Islamia, close to that including the 



178 



BODÓN, MANGANELLI & GIUSTI 



TABLE 6. Geographical distribution of valvatiform hydrobiid species from Europe and the Middle East (* taxa 
not discussed in the paper). The names of the countries are in parentheses when a species is present only 
in one or a few localities or areas of that country. 



Taxa 



Distribution 



Arganiella pescei G\us\\ & Pezzoli, 1980 
Bracenica spiridoni Radoman, 1973a 
Dabriana bosniaca Radoman. 1974 
Dalmatella sketi\/e\kovrh, 1970 
Daphniola exigua exigua (Schmidt, 1856) 
"Daphniola" exigua pangaea (Reischütz, 1984) 
Daudebardiella asiana' Boettger, 1 905 
Daudebardiella naegelei" Boettger, 1905 
F/ssur/a bou/ Boeters, 1981 

Fissuria raehiei (Schùn, 1980) 

"Fissuria" planospira' Bodon et al., 1997 

Gocea ohridana Hadzisce, 1956 

Hadziella anf/ Schutt, 1960 

l-iadziella deminuta Bole, 1961 

Hadziella ephippiostoma Kuscer, 1 932 

Hadziella krkae Bole, 1992 

Hadziella rudnicae Bole, 1992 

Hadziella sketiBo\e. 1961 

Hadziella thermalis Bole, 1992 

Hauffenia danubialis (Haase, 1993) 

Hauffenia erythropomatia (Häuften, 1856) 

Hauffenia kersctineri (Zimmermann, 1930) 

Hauffenia media Bole, 1961 

Hauffenia subcarinata Bole & Velkovrh, 1987 

Hauffenia subpiscinalis (Kuscer, 1932) 

Hauffenia tellinii {PoWonera, 1898) 

Hauffenia tovunica Radoman, 1978 
Hauffenia wagneri {Kuscer, 1928) 
Hauffenia wienenvaldensis Haase, 1992 
"Hauffenia' ed/auer/ (Schutt, 1961b) 
"Hauffenia' /7ade; (Gittenberger, 1982) 
"Hauffenia' jadertina Kuscer, 1933a 
"Hauffenia' lucidula (Angelov, 1 967) 
"Hauffenia' plana Bole, 1961 
"Hauffenia' siniana Kuscer, 1933a 
Heraultia exilis (Paladiihe, 1867) 
Horatia klecakiana Bourguignat, 1887 

Horatia macedónica (Kuscer, 1936) 
Horatia novoselensis Radoman, 1966 
"Horatia" birsteini' Starobogatov, 1962 
"Horatia' borutzkif Zhadin, 1932 
"Horatia' gasulli {Boeiers, 1981) 
"Horatia" gatoa Boeters, 1980 
"Horatia" knorrí Schutt, 1961 
"Horatia' Ijovuschkinr Starobogatov, 1962 
"Horatia" párvula' (Naegele, 1894) 
"Horatia" sokolovr Starobogatov, 1962 
"Horatia" sfum/ (Rosenhauer, 1856) 
Islamia anatolica* Radoman, 1973a 
Islamia ateni {Boelers. 1969) 
Islamia azarum (Boeters & Rolan, 1988) 
Islamia bosniaca' Radoman, 1973a 
Islamia burnabasa' (Schutt, 1964) 
Islamia cianensis Bodon et al., 1995 
Islamia consolationis (Bernasconi, 1985) 



Latium, Marche and Abruzzo (Italy) 

Montenegro 

Bosnia-Herzegovina 

Dalmatia (Croatia) 

Thessalia and Peloponnesus (Greece) 

East Makedonia (Greece) 

Turkey 

Turkey 

Vaucluse, Bouches du Rhône, Var and Alpes 

Maritimes (France) 
Cephalonia and Zante (Greece) 
Tuscany (Italy) 
Lake Ohrid 

Rab Island (Croatia), Slovenia and Friuli (Italy) 
Friuli-Venetia Julia (Italy) and Slovenia 
Slovenia 
Slovenia 
Croatia 
Croatia 

Slovenia and Croatia 
Niederösterreich (Austha) 
Slovenia 

Oberösterreich and Niederösterreich (Austria) 
Slovenia and Croatia 
Slovenia 

Friuli-Venetia Julia (Italy) and Slovenia 
Eastern Venetia, Friuli-Venetia Julia (Italy) and 

Slovenia 
Croatia 
Slovenia 

Niederösterreich (Austria) 
Dalmatia 

Lakonia, Peloponnesus (Greece) 
Dalmatia (Croatia) 
Bulgaria 
Montenegro 
Dalmatia (Croatia) 
Hérault (France) 
Dalmatia (Croatia) and Bosnia-Herzegovina, 

Albania (?) 
Macedonia 
Macedonia 
Caucasus 
Caucasus 
East Spain 
South Spain 
Dalmatia 
Caucasus 
Turkey 
Caucasus 
South Spain 
Turkey 

Northeast Spain 
Northwest Spain 
Bosnia-Herzegovina 
Turkey 
Sicily (Italy) 
Doubs (France) 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



179 



TABLE 6. (Continued) 



Taxa 



Distribution 



Islamia gaillardoti (Germain, 1911) 
Islamia gaiteri Bodon et al., 1 995 
Islamia globulina (Paladiihe, 1866) 
Islamia globulus globulus (Bofill, 1909) 
Islamia globulus /agar/ (Altimira, I960) 
Islamia graeca' Radoman, 1973a 
Islamia latina* Radoman, 1973a 
Islamia mienisi {Schutt, 1991) 
Islamia minuta (Draparnaud, 1805) 

Islamia pseudorientalica' Radoman, 1973a 
Islamia pusilla* (Piersanti, 1952) 
Islamia schuelei {BoBXexs, 1981) 
Islamia spirata (Bernasconi, 1985) 
Islamia trichoniana* Radoman, 1979 
Islamia valvataeformis (MoWenáoríi, 1873) 
Islamia zermanica Radoman, 1973a 
"Islamia" bendidis* Reischütz, 1988 
"Islamia" coronado/ (Bourguignat, 1870) 
"Islamia" epirana (Schutt, 1962) 
"Islamia" fez/ (Altimira, 1960) 
Karevia omata (Radoman, 1957) 
Kerkia brezicensis Bodon & Cianfanelli, 1996 
Kerkia kusceri (Bole, 1 961 ) 
Lyhnidia giorgievici Hadzisce, 1959 
Lyhnidia hadzii Haóz\sce, 1959 
Lyhnidia /caraman/ Hadzisce, 1959 
Lyhnidia stankovici Hadzisce, 1959 
Lyhnidia sublitoralis Radoman, 1967 
Ohridohauffenia depressa (Radoman, 1957) 
Ohridohauffenia drimica (Radoman, 1964) 
Ohridohauffenia minuta (Radoman, 1955) 
Ohridohauffenia rotonda (Radoman, 1964) 
Ohridohauffenia sancf/naum/ (Radoman, 1964) 
Ohridohauffenia sublitoralis (Radoman, 1963a) 
Ohrigocea karevi Hadzisce, 1959 
Ohrigocea miladinovorum Hadzisce, 1959 
Ohrigocea samuili Hadzisce, 1959 
Ohrigocea stankovici {Hadz\sce, 1959) 
Pezzolia radapalladis Bodon & Giusti, 1986 
Prespolitorea malaprespensis Radoman, 1973a 
Prespolitorea valvataeformis Radoman, 1973a 
Pseudohoratia brusinae (Radoman, 1953) 
Pseudohoratia lacustris (Radoman, 1964) 
Pseudohoratia ochridana (Polinski, 1929) 
Pseudoislamia balcánica Radoman, 1979 
Sardohoratia islamioides Manganelli et al., 1998 
Sardohoratia sulcata Manganelli et al., 1998 
Sheitanok amidicus* Schutt & Sesen, 1991 
Strugia ohridana Radoman, 1973a 
Zaum/a /cuscen (Hadzisce, 1959) 
Zaumia sanctizaumi (Radoman, 1964) 



Israel 

Elba Island (Italy) 

South and East France 

Northeast Spain 

Northeast Spain 

Amvrakia Lake, Etolia (Greece) 

Dalmatia (Croatia) 

Israel and Lebanon 

Doubs, Jura and Ain (France), Neuchâtel 

(Switzerland) 
Turkey 

Campania, Abruzzo and Apulia (Italy) 
South Spain 
Doubs (France) 

Trichonis Lake, Etolia (Greece) 
Bosnia-Herzegovina 
Croatia 

Samothraki Island (Greece) 
Central Spain 

Ipiros, Etolia and Lefkada (Greece) 
East Spain 
Lake Ohrid 
Slovenia 
Slovenia 

Sweti Naum Lake, Ohrid basin 
Lake Ohrid 
Lake Ohrid 
Lake Ohrid 
Lake Ohrid 
Lake Ohrid 
Ohrid basin 
Ohrid basin 
Lake Ohrid 
Ohrid basin 
Lake Ohrid 
Lake Ohrid 
Lake Ohrid 
Lake Ohrid 

Lake Ohrid and Ohrid basin 
Liguria (Italy) 

Mirka Prespa Lake (Albania) 
Prespa Lake 
Lake Ohrid 
Lake Ohrid 
Lake Ohrid 

Trichonis Lake Etolia (Greece) 
Sardinia Island (Italy) 
Sardinia Island (Italy) 
Turkey 
Ohrid basin 
Ohrid basin 
Lake Ohrid 



French "Hauffenia" species (see the re- 
description of the French Islamia in "Descrip- 
tions of some taxa misidentified as Hauffenia 
species"). 

North American Species. Two valvatiform 
species from North America, Valvata miera 



Pilsbry & Ferris, 1906, and Valvata miera 
nugax Pilsbry & Ferris, 1906, were assigned 
to Hauffenia by Bole & Velkovrh (1986) and to 
Hauffenia and Horatia respectively by Burch 
(1989). An anatomical revision by Hershler & 
Longley (1986) in the same years showed 
that these species belong to a distinct, North 



180 



BODÓN, MANGANELLI & GIUSTI 



TABLE 7. Analytical key for identification of the Hauffenia species (only species certainly belonging to 
Hauffenia are considered). For characters used, see Fig. 188. 



la — Operculum with peg, from small to very well developed 

1b -Operculum without peg or, all the most, with very reduced peg 

2a — Peg small, not dilated at the top 

2b — Peg well developed, dilated at the top 

3a — Shell with spire moderately to well raised; penis with one wide lateral lobe 

3b — Shell with spire slightly raised 

4a — Penis with one lateral lobe poorly developed; intestine with bend tightly coiled 

on palliai wall 
4b — Penis with one wide lateral lobe; intestine with bend slightly coiled on palliai 

wall 
5a — Peg of medium size; penis without or with slightly evident lobe/s 
5b — Peg very well developed; penis with one rather evident lateral lobe 
6a — Shell with a keel on the lower wall of the last whorl around umbilicus 
6b — Shell not keeled 

7a — Penis with 1 -3 small lateral lobes; no peg 
7b — Penis without lobes 

8a — Shell with spire well raised; diameter 1 .4-2.9 mm 
8b-Shell with spire rather flat; diameter 1.17-1.55 mm 
9a — No peg 
9b — Peg very reduced 



2 

7 
3 
5 

H. 

4 

H. media 



wagneri 



H. kerschneri 



H. tovunica 
H. subcarinata 
H. tellinii 



H. subpiscinalis 
H. erythropomatia 
H. danubialis 
H. wienerwaldensis 



American genus, Phreatodrobia Hershler & 
Longley, 1986. 



THE SPECIES OF HAUFFENIA 
Hauffenia danubialis (Haase, 1993) 

Lobaunia danubialis Haase, 1993: 99-105, 
figs. 8B, 9-15. 

Type Locality and Type Material: see Lobau- 
nia danubialis Haase, 1993, in the sec- 
tion on the taxa of the genus group. 

Diagnosis 

A species of Hauffenia having shell very 
small, valvatiform-planispiral, with spire al- 
most flat: operculum without peg; penis with- 
out lobes. 

Material Examined and Description 

See Lobaunia danubialis Haase, 1993, in 
the section on the taxa of the genus group. 

Distribution 

Niederösterreich, Austria. 

Taxonomy 

Hauffenia danubialis was assigned to a dis- 
tinct genus, Lobaunia, by Haase (1993). This 
genus is here regarded as a junior synonym 



of Hauffenia. It is distinct from H. wiener- 
waldensis, due to complete absence of an op- 
ercular peg. 

Hauffenia erythropomatia (Hauffen, 1856) 

Valvata erythropomatia Hauffen, 1856: 465. 

Type Locality and Type Material: see Eryth- 
ropomatiana erytiiropomatia (Hauffen, 
1856) in the section devoted to the taxa 
of the genus group. 

Diagnosis 

A species of Hauffenia having shell very 
small, valvatiform, with spire rather flat; oper- 
culum without peg; penis with 2-3 small lat- 
eral lobes. 

Material Examined and Description 

See Erytiiropomatiana erythropomatia 
(Hauffen, 1856) in the section devoted to the 
taxa of the genus group. 

Distribution 
North of Ljubljana, Slovenia. 

Taxonomy 

Hauffenia erythropomatia was assigned to 
a distinct genus, Erythropomatiana, by Rado- 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



181 




la 



lb 



2a 







3b 



4a 



4b 






6b 






8b 



9a 9b 



FIG. 188. Characters used in the analytical key for the identification of the Hauffenia species (Table 7). 



man (1978). This genus is here regarded as a 
junior synonym of Hauffenia. 



Horatia erythropomatia kerschneri Zimmer- 
mann, 1930: 233-234, pi. 13, figs. 3-6. 

Type Locality: ". . . in den zuführenden Quell- 
kanälen der Wasserleitung in Weyer an 
der Enns (Oberösterreich)", Austria. 

Type Material: lectotype (NHMW 85034) and 
19 paralectotypes (NHMW К 48844) at 
the Naturhistorisches Museum Wien, Vi- 
enna, Austria (Haase, 1993). 

Hauffenia l<ersctineri loichiana Haase, 1993: 
94-98. 

Type Locality: "Kleine Quelle unterhalb des 
Fuchslochs (Höhlenkatastern. 1837/24) 
bei Lolch im westlichen Niederösterreich 
(Seitental der Pielach)", Austria. 

Type Material: holotype (NHMW 85029) and 
68 paratypes (NHMW 85030, shells) at 



the Naturhistorisches Museum Wien, Vi- 
enna, Austria (Haase, 1993). 



Hauffenia kerschneri {Zimmermann, 1930) Diagnosis 



A species of Hauffenia having shell very 
small, valvatiform, with spire not very raised; 
operculum with small peg; penis with one 
wide lateral lobe. 

Material Examined 

-Spring in Weyer an der Enns (type locality), 
Oberösterreich, Austria, M. Bodon leg. 
10.6.1985 (3 males, 3 females, many 
shells). 

Description 

Shell very small, valvatiform, thin, waxen, 
transparent when fresh; surface of proto- 
conch malleated; spire not very raised, con- 



182 



BODÓN, MANGANELLI & GIUSTI 




192 




193 



194 




FIGS. 189-194. Shell, operculum and anatomical details of Islamia aten/ (Boeters, 1969) from tine thermal 
spnng at Banys de Sant Vicienç, Cataluña, Spain, M. Bodón leg. 14.9.1985. Fig. 189: shell; Fig. 190: outer 
face of operculum: Fig. 191: body of a male with palliai cavity open to show head and penis; Fig. 192: dor- 
sal side and ventral side (second picture) of penis of three males; Fig. 193: prostate gland, intestine and pal- 
liai organs of a male: Fig. 194: renal and palliai oviduct, intestine and palliai organs of a female. Scale bar = 
1 mm. 



sisting of 2.5-3.25 rather rapidly growing con- 
vex whorls; last whorl large, dilated, descend- 
ing slightly near aperture; umbilicus wide; 
aperture prosocline, oval; peristome com- 
plete, thin, slightly thickened, slightly reflected 
only at columellar margin (Figs. 214, 215; 
Zimmermann, 1930: 233-234, pi. 13, figs. 
3-6; Haase, 1993: 92, fig. 1A-D, table 1, as 
Hauffenia k. kerschneri: Haase, 1993; 94, fig. 
4A-D, table 1, as H. k. loichiana; Boeters, 
1998; 28, fig. H6). Dimensions ; height = 
0.70-1.09 mm; diameter = 1.00-1.61 mm. 
Operculum thin, orange, paucispiral, with 



small spiralized peg at centre of inner face 
(Fig. 216; Haase, 1993; 92, fig. 2A, B, as 
Hauffenia k. kerschneri: Haase, 1993; 94, as 
H. k. loicfiiana). 

Body unpigmented (a few black spots on 
visceral sac); eye spots absent (Fig. 217; 
Haase, 1993; 94, as H. k. loichiana). 

Male genitalia with prostate gland bulging 
well into palliai cavity; penis short, flat, with 
apex blunt, and one lateral, not very raised 
but wide lobe on left side; penial duct zig-zag- 
ging through central portion of penis to open 
at penis tip; globular mass of réfringent cells 




204 



FIGS. 195-206. Shell, operculum and anatomical details of Islamia globulus globulus (Bofill, 1909) from the 
spring near Guardiola, Cataluña, Spain, M. Bodon leg. 14.9.1985 (Figs. 195-200) and of Islamia globulus 
/agar/ (Altimira, 1960) from the spring Fuente Les Dous, Torrelles de Foix, Cataluña, Spain, M. Bodon leg. 
2.1.1992 (Figs. 201-206). Figs. 195, 201: shells; Figs. 196, 203: body of a male with palliai cavity open to 
show head and penis; Figs. 197, 202: outer face of operculum; Figs. 198, 205: prostate gland, stomach (ex- 
cluded in Fig. 198), intestine and palliai organs of a male; Figs. 199, 204: dorsal and ventral side (second 
picture) of penis; Figs. 200, 206: renal and palliai oviduct, intestine and palliai organs of a female. Scale bar 
= 1 mm. 



184 



BODÓN. MANGANELLI & GIUSTI 




FIGS. 207-213. Microsculpture of protoconchs. Fig. 207: Islamia aíen/ (Boeters, 1969) from the thermal 
spring at Banys de Sant Vicienç. Cataluña, Spain, M. Bodón leg. 14.9.1985; Fig. 208: Islamia globulus glob- 
ulus (Bofill, 1909) from the spring near Guardiola, Cataluña, Spain, M. Bodon leg. 14.9.1985; Fig. 209: Is- 
lamia minuta {Draparnauó, 1805) from the Source de l'Ain, Nozeroy, Jura, France, M. Bodon leg. 21.7.1985 
Fig. 210: Islamia globulina (Paladiihe, 1 866) from the Rivière souterraine de Labouiche, Foix, Ariège, France 
M. Bodon leg. 13.9.1985; Fig. 211: /s/am/a sp/raía (Bernasconi, 1985) from the stream near Pont les Moulins 
Cusancin valley, Doubs, France, M. Bodon leg. 22.7.1985; Fig. 212: Islamia consolationis (Bernasconi 
1985) from the springs at Consolation-Maisonnettes, Doubs, France, M. Bodon & G. Manganelli leg 
13.6.1996; Fig. 213: Heraultia exilis (Paladiihe, 1867) from the Source du Lez, Hérault, France, M. Bodon 
leg. 2.12.84. Scale bar = 100 ¡am. 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



185 




220 



FIGS. 214-221 . Shell, operculum and anatomical details of Hauffenia /cersc^er/ (Zimmermann, 1930) from 
the spring in Weyer an der Enns, Oberösterreich, Austria, M. Bodon leg. 10.6.1985. Figs. 214, 215: shells; 
Fig. 216: outer face (left), profile (centre) and inner face (right) of operculum; Fig. 217: body of a female with 
palliai cavity open to show head; Fig. 218: dorsal side of penis of two males; Fig. 219: prostate gland, stom- 
ach, intestine and palliai organs of a male; Fig. 220: renal and palliai oviduct, intestine and palliai organs of 
a female; Fig. 221 : renal and palliai oviduct of a female. Scale bar = 1 mm. 



inside penis apex to right of penial duct (no 
data about this in Haase, 1993); terminal part 
of penial duct (immediately before opening) 
with very small stylet (Figs. 218, 219; Haase, 
1993: 95-96, 98, figs. 5, 7, 8, as H. k. loichi- 
ana; Boeters, 1998: 28, fig. H7). 

Female genitalia with proximal seminal re- 
ceptacle and a bursa copulathx arising from 
distal renal oviduct; seminal receptacle very 
small, with very short duct arising from oviduct 
level with end of loop; bursa copulatrix re- 
duced, about same size as seminal recepta- 
cle, slightly dilated at apex, arising very close 
to where oviduct enters albumen gland por- 



tion of palliai oviduct; seminal groove running 
along ventral side of capsule gland (Figs. 220, 
221; Haase, 1993: 95, 98, figs. 5, 6, as Hauf- 
fenia k. loicfiiana; Boeters, 1998; 28, fig. H8). 
Radula with central tooth trapezoidal with 
long lateral wings and basal tongue, its apical 
margin V-like, with long robust central denticle 
and 5 smaller denticles on both sides, in de- 
creasing order of size; 2 basal cusps where 
each lateral wing arises from face of central 
tooth; lateral teeth rake-like, apically en- 
larged, their anterior margin with 9 denticles, 
central one longer, larger; first marginal teeth 
rake-shaped, with long lateral wing and elon- 



186 



BODÓN, MANGANELLI & GIUSTI 



gated cutting edge with long row of 21 -22 
small denticles anteriorly: second marginal 
teeth scraper-shaped, with long slender lat- 
eral wing and roundish, spoon-like apex, its 
cutting edge carrying rather long row of 1 3- 1 5 
very small denticles (Haase, 1993: 92, fig. ЗА, 
В, as H. к. kerschneri: Haase, 1993: 94, fig. 
3C, D, as H. k. loichiana). 

Stomach without posterior caecum: intes- 
tine with well developed, S-like bend on palliai 
wall (Figs. 219, 220: Haase, 1993: 95, fig. 5, 
as H. k. loichiana). 

Osphradium variable in size, elliptical or 
kidney-shaped: ctenidium consisting of 6-9 
lamellae (Figs. 219. 220; Haase, 1993: 94, as 
H. k. loichiana). 

Nervous system with long pleuro-supraoe- 
sophageal and short pleuro-suboesophageal 
connectives (Haase, 1993: 95, as H. k. loichi- 
ana). 

Distribution 

Oberösterreich and Niederösterreich, Aus- 
tria. 

Taxonomy 

The small opercular peg and the penis with 
wide penial lobe suggest relationships with 
Hauffenia wagneri {Kuscer, 1928) or H. media 
Bole. 1961. Nevertheless, due to other weak 
anatomical characters (intestine with less 
tightly coiled bend on palliai wall) and the dis- 
tance between the type localities and the dis- 
tributions of these species, we prefer to main- 
tain H. kerschneri as a distinct species. 

Haase (1993) divided the species into two 
subspecies on the basis of an unique differ- 
ence in the shell morphometry of a single pop- 
ulation: this is not significant considering the 
marked variability in shell dimensions of the 
single populations of Hauffenia species. 

Hauffenia media Bole, 1961 

i-iauffenia media Bole, 1961: 62-63, 67-68, 
fig. 3B. 

Type Locality: "jama Vrlovka pri Kamanju ob 
Kolpi", Croatia. 

Type Material: Bole (1 961 ) did not give any in- 
formation about the type material. 

Diagnosis 

A species of Hauffenia having shell very 
small, valvatiform, with spire slightly raised; 



operculum with very small peg; penis with one 
wide but not very raised lateral lobe. 

Material Examined 

-Spring near Kostanjevica, Krsko, Slovenia, 
33T WL 37, A. Ediauer leg., (Naturhis- 
torisches Museum Wien no. 21418; 1 
shell with operculum, 3 shells, deter- 
mined by H. Schutt). 

-"Kostanjeviska Jama" cave, S. 518, Kostan- 
jevica, Krsko. Slovenia, 33T WL 37, F. 
Stoch leg. 16.6.1996 (1 female). 

Description 

Shell very small, valvatiform, thin, waxen, 
transparent when fresh; surface of proto- 
conch malleated: spire slightly raised, con- 
sisting of 3-3.25 rather rapidly growing con- 
vex whorls; last whorl large, dilated, 
descending slightly near aperture; umbilicus 
wide; aperture prosocline, roundish; peris- 
tome complete, thin, slightly reflected only at 
columellar margin (Figs. 222-224; Bole, 
1961: 62-63, 67, fig. 3B). Dimensions: height 
= 1 .0-1 .2 mm; diameter = 1 .4-1 .9 mm (Bole, 
1961). 

Operculum thin, paucispiral, yellowish, with 
very small spiralized peg at centre of inner 
face (Figs. 225, 226; Bole, 1961, 62, 67, fig. 
3B; 1993:6). 

Body unpigmented (a few traces of pigment 
in wall of visceral sac); eye spots absent (Fig. 
227). 

Male genitalia with penis rather elongated, 
flat, with apex blunt, slightly pointed at centre 
and one wide, but not very raised lateral lobe 
on left side; penial duct zig-zagging through 
sub-central portion of penis to open at penis 
tip; no data available about existence of glob- 
ular mass of réfringent cells inside penis apex 
to right of penial duct and of stylet (Bole, 1 961 : 
62, 67, fig. 3B). 

Female genitalia with proximal seminal re- 
ceptacle and a bursa copulatrix arising from 
distal renal oviduct; seminal receptacle small, 
with very short duct arising from oviduct level 
with end of loop; bursa copulatrix reduced, a 
little longer than seminal receptacle, slightly 
dilated at apex, arising very close to where 
oviduct enters albumen gland portion of palliai 
oviduct; seminal groove running along ventral 
side of capsule gland (Fig. 228). 

Radula with central tooth trapezoidal, with 
long lateral wings and basal tongue, its apical 
margin V-like, with long robust central denticle 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



187 




FIGS. 222-228. Shell, operculum and anatomical details of Hauffenia media Bole, 1961, from the spring 
near Kostanjevica, Krsko, Slovenia, A. Ediauer leg., (Naturhistorisches Museum Wien no. 21418) (Figs. 222, 
223, 225) and from the "Kostanjeviska Jama" cave, S. 518, Kostanjevica, Krsko, Slovenia, F. Stoch leg. 
16.6.1996 (Figs. 224, 226-228). Figs. 222-224: shells; Figs. 225, 226: outer face (left), profile (centre) and 
inner face (right) of operculum; Fig. 227: body of a female with palliai cavity open to show head; Fig. 228: 
renal and palliai oviduct, intestine and palliai organs of a female. Scale bar = 1 mm. 



and 4-5 smaller denticles on both sides in de- 
creasing order of size; one basal cusp where 
each lateral wing arises from face of central 
tooth; lateral teeth rake-like, apically en- 
larged, their anterior margin with 1 denticles, 
central one longer, larger; first marginal teeth 



with apical row of 23-28 denticles; second 
marginal teeth with apical row of 18-24 denti- 
cles (Bole, 1961:62, 67, fig. 3B). 

Stomach without posterior caecum; intes- 
tine with well-developed, tightly coiled, S-like 
bend on palliai wall (Fig. 228). 



188 



BODÓN, MANGANELLI & GIUSTI 



Osphradium elongated; ctenidium consist- 
ing of 8-12 lamellae (Fig. 228; Bole, 1961 : 62, 
67). 

Nervous system unknown. 

Distribution 

Eastern Slovenia and northern Croatia. 

Taxonomy 

The anatomical data is not complete 
enough to draw conclusions on the status of 
this species. Penis shape, female genitalia 
and operculum structure are sufficient to infer 
it belongs to Haufienia. The small opercular 
peg suggests relationships with H. wagneri 
(Kuscer, 1928). 

Haufienia subcarinata 
Bole &Velkovrh, 1987 

Horatia supracarinata Bole & Velkovrh, 1986: 
193, nomen nudum. 

Hauff enia {Hauffenia) subcarinata Bole & 
Velkovrh, 1987; 72-73, 78-79, fig. 
1A-C, pi. 1,figs. 1,2. 

Type Locality; "Izvir v vasi Lozice pri Desklah 
V dolini Soce. 12 km severno severoza- 
hodno od Nove Gohce/Quelle im Dorf 
Lozice bei Deskle in Soca-Tal, 12 km 
NNW von Gorica", Slovenia. 

Type Material; holotype (35215a) in the 
Velkovrh collection, Biotehniska fakulteta 
Univerza Edvarda Kardeija, Ljubljana, 
Slovenia, together with paratypes 
(35215/80) (Bole & Velkovrh, 1987). 

Diagnosis 

A species of Hauffenia having shell very 
smalt, valvatiform, with spire moderately 
raised; lower wall of last whorl with keel; op- 
erculum with well-developed peg; penis with- 
out lobes. 

Material Examined 

-Spnng near Lozice, along road to Kanal, 
Soca valley, Slovenia, 33T UM 9201, M. 
Bodón leg. 10.7.1996 (1 shell with oper- 
culum, many shells) (type locality). 

—Spring in camping area at Kanal, Soca val- 
ley, Slovenia, 33T UM 9404, S. Cian- 
fanelli & M. Galcagno leg. 31.7.1994 (1 
shell with operculum, 5 shells). 



Description 

Shell very small, valvatiform, pale whitish, 
waxen, transparent when fresh; surface of 
protoconch malleated; spire moderately 
raised, conical, consisting of 2.75-3.5 rather 
rapidly growing convex whorls; last whorl 
large, dilated, descending slightly near aper- 
ture, its lower wall (around umbilicus) having 
keel ending at aperture; umbilicus wide; aper- 
ture prosocline, oval, slightly angled at lower 
margin (near keel); peristome complete, thin, 
slightly thickened, slightly reflected only at 
lower and columellar margin (Figs. 94, 229; 
Bole & Velkovrh, 1 987; 72, 78, pl.^1 , figs. 1 , 2; 
Bole, 1993; 6). Dimensions; height = 0.83- 
1.30 mm; diameter = 1.14-1.90 mm (Bole & 
Velkovrh, 1987). 

Operculum thick, yellowish brown, pau- 
cispiral, with well-developed, spiralized peg at 
centre of inner face (Fig. 230; Bole, & 
Velkovrh, 1987: 72, 79, fig. IB, C; Bole, 1993: 
6). 

Body unpigmented; eye spots absent. 

Male genitalia with penis rather elongated, 
cylindrical, flat, slightly tapering near apex, 
ending in a slightly blunt tip, without penial 
lobes; penial duct zig-zagging through central 
portion of penis to open at penis tip; no data 
available about existence of globular mass of 
réfringent cells inside penis apex to right of 
penial duct and of stylet (Bole & Velkovrh, 
1987; 72, 79, fig. 1A; Bole, 1993: 6). 

Female genitalia unknown. 

Radula with central tooth trapezoidal, with 
long lateral wings and basal tongue, its apical 
margin V-like, with long robust central denticle 
and 4 smaller denticles on both sides in de- 
creasing order of size; two basal cusps where 
each lateral wing arises from face of central 
tooth; lateral teeth rake-like, apically en- 
larged, their anterior margin with 10 denticles, 
central one longer, larger; first marginal teeth 
rake-shaped, with long lateral wing and elon- 
gated cutting edge with long row of 18-20 
small denticles anteriorly; second marginal 
teeth scraper-shaped, with long slender lat- 
eral wing and roundish, spoon-like apex, its 
cutting edge carrying rather long row of 1 4- 1 6 
very small denticles (Bole & Velkovrh, 1987: 
72, 79, fig. 1С; Bole, 1993: 6). 

Stomach, intestine, osphradium, ctenidium 
and nervous system unknown. 

Distribution 

Soca [Isonzo] valley, western Slovenia. 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



189 



Taxonomy 

Penis characters and operculum with peg 
are probably sufficient to justify inclusion of 
this species in the genus Hauffenia. 



Hauffenia subpiscinalis (Kuscer, 1932) 

Valvata (?) subpiscinalis Kuscer, 1932: 
51-53, pi. 5, fig. 1. 

Type Locality and Type Material: see Neoho- 
ratia subpiscinalis (Kuscer, 1932) in the 
section devoted to the taxa of the genus 
group. 

Erythropomatiana verdica Radoman, 1978: 
36, pi. 5, figs. 20, 21. 

Type Locality and Type Material: see the syn- 
onymy of Neohoratia subpiscinalis 
(Kuscer, 1932) in the section devoted to 
the taxa of the genus group. 



bursa copulathx), deduced from the drawings 
of /-/. subpiscinalis published by Bole (1967: 
fig. ЗА). It is true that Bole showed a squatter 
penis with larger lobes than those figured by 
Radoman (1978: fig. 6) in H. erythropomatia, 
but as we verified with topotypical specimens, 
E. verdica also has a squat penis (Fig. 130). 
Hauffenia subpiscinalis from the typical area 
showed penis lobes variable in number (2-3) 
and shape, often very similar to those of E. 
verdica and H. erythropomatia (Figs. 138, 
140). Regarding the bursa copulathx, our 
studies on many populations not only re- 
vealed bursa size to be rather variable, but 
also that specimens of H. subpiscinalis from 
the typical area have a bursa proportionally 
larger than those figured by Bole (1967) and 
similar to those found in E. verdica from 
Vrhnika (Figs. 131, 135-137). Shell shape is 
also similar in the type species of the two gen- 
era (cf., Bole, 1970, 1979; Radoman, 1978). 



Diagnosis 

A species of Hauffenia having shell very 
small but larger than the other species of the 
genus, valvatiform, with spire well raised; op- 
erculum without peg; penis with 1 -3 small lat- 
eral lobes. 



Material Examined and Description 

See Neohoratia subpiscinalis (Kuscer, 
1 932) in the section devoted to the taxa of the 
genus group. 



Distribution 

Eastern Friuli-Venetia Julia, Italy, and West- 
ern Slovenia, from Soca [Isonzo] valley to 
Ljubljana area. 



Taxonomy 

Hauffenia subpiscinalis was recently as- 
signed to a distinct genus, Neohoratia, by 
Bole & Velkovrh (1986), Boeters (1988), and 
Bole (1 993). This genus is here regarded as a 
junior synonym of Hauffenia. 

Erythropomatiana verdica Radoman, 1978, 
is here recognized as a junior synonym of H. 
subpiscinalis. Radoman (1978) distinguished 
H. verdica from H. subpiscinalis on the basis 
of few differences (penis shape; slightly larger 



Hauffenia tellinii {PoWonera, 1898) 

Horatia (Hauffenia) Tellinii PoWonera, 1898: 3, 
4, fig. 2. 

Type Locality and Type Material: see Hauffe- 
nia tellinii {PoWonera, 1898) in section de- 
voted to taxa of the genus group. 

Horatia {Hauffenia) valvataeformis Pollonera, 
1898:3-4, fig. 3. 

Type Locality and Type Material: see syn- 
onymy of Hauffenia tellinii (Pollonera, 
1898) in section devoted to the taxa of 
the genus group. 

Hauffenia michleh Kuscer, 1932: 56-57, pi. 5, 
fig. 3. 

Type Locality and Type Material: see syn- 
onymy of Hauffenia tellinii (Pollonera, 
1898) in section devoted to the taxa of 
the genus group. 



Diagnosis 

A species of Hauffenia having shell very 
small, valvatiform to planispiral, with spire 
from rather raised to almost flat; operculum 
with well developed peg; penis with 1 -2 
slightly evident lateral lobes, sometimes ab- 
sent. 



Material Examined and Description 

See Hauffenia tellinii (Pollonera, 1898) in 
section devoted to taxa of the genus group. 



190 



BODÓN, MANGANELLI & GIUSTI 



Distribution 

From eastern Venetia and Friuli-Venetia 
Julia, Italy, to western Slovenia in the Ljubl- 
jana area. 

Taxonomy 

We agree with Bole (1970) about the syn- 
onymy of the two species descnbed by 
Pollonera from the upper Natisone valley: Ho- 
ratia (Hauffenia) tellinli ano H. (H.) valvatae- 
formis. The latter is distinguished from the for- 
mer by a shell with raised spire, which is 
clearly only one end of a spectrum of shell 
shape. The two extreme morphs (spire de- 
pressed: tellinii: spire raised: valvataeformis) 
and their intermediates were found in many of 
the populations examined. 

Our study does not confirm the existence of 
constant and valid shell, anatomical and op- 
ercular characters that justify regarding H. 
michleri as a species distinct from H. tellinii. 
Traditional distinction of the two species was 
evidently based on anatomical study of very 
few specimens. Hence, we propose H. mich- 
leri as a junior synonym of H. tellinii. 

Hauffenia populations from the southeast- 
ern Karst in the province of Trieste have an 
operculum with a reduced peg; they were ten- 
tatively assigned to H. tellinii {PezzoW, 1988a; 
Bodon & Giovannelli, 1993). 

Hauffenia tovunica Radoman, 1978 

Hauffenia (Hauffenia) tovunica Radoman, 
1978: 34, fig 5A-E, pi. 4, figs. 11, 12. 

Type Locality: "Die Grotte Tounjcica, neben 
dem Ort Tounj, in der Nähe der Strasse 
Duga resa-Josipdol", Croatia. 

Type Material: holotype and four paratypes 
(SMF 249614) at the Senckenberg-Mu- 
seum, Frankfurt am Main, Germany (Jo- 
vanovic, 1991). 

Diagnosis 

A species of Hauffenia having shell very 
small, valvatiform, with spire not very raised; 
operculum with very well-developed dilated 
peg; penis with one rather evident lateral lobe. 

Material Examined 

—"Tounjcica Spiija" cave, Tounj, east of 
Ogulin, Croatia, E. Kletecki, F. Gasparo & 



F. Stoch leg. 13.7.1997 (1 male, 1 young 
specimen, 12 shells). 

Description 

Shell very small, valvatiform, not very thin, 
transparent when fresh; surface of proto- 
conch malleated; spire not very raised, con- 
sisting of 3.25-3.75 rather rapidly growing 
convex whorls; last whorl large, dilated, 
slightly descending near aperture; umbilicus 
wide; aperture prosocline, roundish; peris- 
tome complete, somewhat thickened and re- 
flected (Fig. 231; Radoman, 1978: 34, pi. 4, 
figs. 11, 12; Radoman, 1983: 122, pi. 9, fig. 
142; Jovanovic, 1991: pi. 8, fig. 66). Dimen- 
sions: height = 1.26-1.68 mm; diameter = 
1 .81 -2.02 mm (Radoman, 1983: table 7). 

Operculum rather thick but with thin edge, 
paucispiral, convex, but concave at centre, 
with very well-developed, dilated and spiral- 
ized peg at centre of inner face (Fig. 235; 
Radoman, 1978: 33-34, fig. 5D, E; Radoman, 
1983: 120, fig. 67D, E). 

Body unpigmented (a few black spots on 
visceral sac); eye spots absent (Fig. 233). 

Male genitalia with prostate gland bulging 
well into pallia! cavity; penis rather short, flat, 
with apex blunt, and one rather evident, knob- 
like, lateral lobe on left side near apex; penial 
duct zig-zagging through central portion of 
penis to open at penis tip; globular mass of ré- 
fringent cells inside penis apex to right of pe- 
nial duct and terminal part of penial duct with 
very small stylet (Fig. 232; Radoman, 1978: 
33, fig.SC; 1983: 120, fig. 67C). 

Female genitalia with proximal seminal re- 
ceptacle and a bursa copulathx arising from 
distal renal oviduct; seminal receptacle very 
small, with very short duct arising from oviduct 
level with end of loop; bursa copulatrix re- 
duced, small but markedly longer than semi- 
nal receptacle, slightly dilated at apex, arising 
very close to where oviduct enters albumen 
gland portion of palliai oviduct; seminal 
groove running along ventral side of capsule 
gland (Radoman, 1978: 33, fig. 5A, B; 1983: 
40, 120, fig. 67A, B). 

Radula with central tooth with one pair of 
basal cusps; other details unknown (Rado- 
man, 1978: 33; 1983: 114). 

Stomach without posterior caecum; intes- 
tine with well-developed, tightly coiled, S-like 
bend on palliai wall (Fig. 234; Radoman, 
1983:40). 

Osphradium kidney-shaped; ctenidium 
consisting of about 11 lamellae (Fig. 234). 





230 




235 




FIGS. 229-236. Shell, operculum and anatomical details of Hauffenia subcarinata Bole & Velkovrh, 1987, 
from the spring near Lozice, along the road to Kanal, Soca valley, Slovenia, 33T UM 9201, M. Bodón leg. 
10.7.1996 (Figs. 229, 230), Hauffenia tovunica Radoman, 1978, from the "Tounjcica Spiija" cave, Tounj, east 
of Ogulin, Croatia, E. Kletecki, F Gasparo & F. Stoch leg. 13.7.1997 (Figs. 231-235) and of Hauffenia 
wienenvaldensis Haase, 1992, from the upper well in Klamm 106, Wienerwald, Niederösterreich, Austria, M. 
Haase leg. 17.7.1989 (Fig. 236). Figs. 229, 231, 236: shells; Figs. 230, 235: outer face (left), profile (centre) 
and inner face (right) of operculum; Fig. 232: dorsal side of penis; Fig. 233: body of a male with palliai cav- 
ity open to show head and penis; Fig. 234: prostate gland, stomach, intestine and palliai organs of a male. 
Scale bar = 1 mm. 



192 



BODÓN, MANGANELLI & GIUSTI 



Nervous system with long pleuro-supraoe- 
sophageal and short pleuro-suboesophageal 
connectives (Radoman, 1978: 33; 1983: 120). 

Distribution 

Known only from the type locality, near 
Ogulin, northern Croatia. 

Taxonomy 

The study of the male genitalia confirms 
that the this species is distinct and that it be- 
longs to Hauffenia. Compared to H. tellinii, H. 
tovunica has more developed opercular peg 
and penial lobe. 

Hauffenia wagneri {Kuscer, 1928) 

Valvata wagneri Kuscer, 1928: 50, fig. 1. 

Type Locality and Type Material: see Vrania 
wagneri (Kuscer, 1928) in section de- 
voted to taxa of the genus group. 

Diagnosis 

A species of Hauffenia having shell very 
small, conical-valvatiform or valvatiform, with 
spire from moderately to well raised; opercu- 
lum with small peg; penis with one wide lateral 
lobe. 

Material Examined and Description 

See Vrania wagneri {Kuscer, 1928) in sec- 
tion devoted to taxa of the genus group. 

Distribution 

Mima valley, eastern Slovenia. 

Taxonomy 

The small opercular peg suggests relation- 
ships with Hauffenia media Bole, 1961. The 
variability of shell shape suggests that the two 
taxa may be synonyms. We prefer to maintain 
them as distinct species, pending further 
anatomical study of H. media. 

Hauffenia wienerwaldensis Haase, 1992 

Hauffenia wienerwaldensis Haase, 1992: 

208-213, figs. 1-11, table 1. 
Type Locality: "Upper well in Klamm 106", 

Wienerwald, Niederösterreich, Austria. 



Type Material: holotype (NHMW 85940) and 
paratypes (NHMW 85941-85946) at the 
Naturhistorisches Museum Wien, Vi- 
enna, Austria; other paratypes are in the 
ReischCitz collection (Baden, Austria) 
(Haase, 1992). 

Diagnosis 

A species of Hauffenia having shell very 
small, valvatiform, with spire from almost flat 
to slightly raised; operculum with very re- 
duced peg; penis without lobes. 

Material Examined 

-Upper well in Klamm 106, Wienerwald, 
Niederösterreich, Austria, M. Haase leg. 
17.7.1989 (13 shells). 

Description 

Shell very small, valvatiform, thin, waxen, 
transparent when fresh; surface of proto- 
conch malleated; spire from almost flat to 
slightly raised, consisting of 3-3.25 rather 
rapidly growing convex whorls; last whorl 
large, dilated, slightly descending near aper- 
ture; umbilicus wide; aperture prosocline, 
oval; peristome complete, thin, slightly re- 
flected only at columellar margin, sometimes 
detached from last whorl (Fig. 236; Haase, 
1992: 208, figs. 1, 2; Boeters, 1998: 29, figs. 
H9, 10). Dimensions: height = 0.67-1 .00 mm; 
diameter = 1.15-1.69 mm (Haase, 1992: 
table 1). 

Operculum thin, orange, paucispiral, 
sligfitly thickened at centre of inner face to 
give rise to very reduced peg (Haase, 1992: 
208, fig. 3A-D). 

Body unpigmented (a few black spots on 
visceral sac); eye spots absent (Haase, 1992: 
208, fig. 4). 

Male genitalia with penis rather short, large, 
flat, slightly tapering near apex, ending in a 
slightly blunt tip and without penial lobes; pe- 
nial duct zig-zagging through central portion 
of penis to open near penis tip; no data avail- 
able about existence of globular mass of ré- 
fringent cells inside penis apex to right of pe- 
nial duct; terminal part of penial duct 
(immediately before opening) with well-devel- 
oped stylet, which according to original de- 
scription "stands somewhat behind the tip of 
penis perpendicular to its axis and slightly in- 
clined to the right" (Haase, 1992: 210, figs. 
9-11; Boeters, 1998: 29, fig. H11). 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



193 



Female genitalia with proximal seminal re- 
ceptacle and a bursa copulatrix arising from 
distal renal oviduct; seminal receptacle very 
small, sessile or with very short duct arising 
from oviduct level with end of loop; bursa cop- 
ulatrix reduced, same size as seminal recep- 
tacle, slightly dilated at apex, arising very 
close to where oviduct enters albumen gland 
portion of palliai oviduct; seminal groove run- 
ning along ventral side of capsule gland 
(Haase, 1992: 209-210, fig. 8; Boeters, 1998: 
29, fig. H 12). 

Radula with central tooth trapezoidal, with 
long lateral wings and basal tongue, its apical 
margin V-like, with long robust central denticle 
and 5 smaller denticles on both sides in de- 
creasing order of size: 1 -2 basal cusps where 
each lateral wing arises from face of central 
tooth; lateral teeth rake-like, apically en- 
larged, their anterior margin with 10-12 denti- 
cles, central one longer, larger; first marginal 
teeth rake-shaped, with long lateral wing and 
elongated cutting edge with long row of 19-21 
small denticles anteriorly; second marginal 
teeth scraper-shaped, with long slender lat- 
eral wing and roundish, spoon-like apex, its 
cutting edge carrying rather long row of 1 5- 1 7 
very small denticles (Haase, 1992: 208, fig. 
6A, B). 

Stomach without posterior caecum; intes- 
tine with well-developed, S-like bend on palliai 
wall (Haase, 1992: 208-209, fig. 7). Haase 
(1992: 208) reports an "anterior digestive 
gland lobe" with a separate opening into the 
stomach. 

Osphradium kidney-shaped; ctenidium 
consisting of 9-10 lamellae; Haase (1992: 
208) reports the presence of a hypobranchial 
gland (Haase, 1992: 208, fig. 5). 

Nervous system with long pleuro-supraoe- 
sophageal and short pleuro-suboesophageal 
connectives (Haase, 1992: 209). 

Distribution 
Niederösterreich, Austria. 

Taxonomy 

The published data clearly confirms that the 
present species belongs to Hauffenia. As for 
the hypobranchial gland and the anterior di- 
gestive gland-lobe (the latter found by Haase, 
1992, in only 25% of dissected specimens), 
two structures never described before in the 
group (and which must be more carefully in- 



vestigated), their meaning for taxonomy ap- 
pears presently irrelevant. 

DESCRIPTIONS OF SOME TAXA 
MISIDENTIFIED AS HAUFFENIA SPECIES 

Fissuria rae/7/e/ (Schutt, 1980) 

Horatia (Hauffenia) rae/i/e/ Schutt, 1980: 140. 

Type Locality: "Insel Kephallinia, Schlucht bei 
Poros, Genist des Baches", Greece. 

Type Material: holotype (SMF 263529) at the 
Senckenberg-Museum, Frankfurt am 
Main, Germany (Schutt, 1980). 

Material Examined 

-Well no. G/54, Cephalonia, Greece, G. L. 
Pesce, D. Maggi & M. Miranda leg. 

7.5.1 977 (1 male, 1 female) (Pesce et al., 
1979). 

-Well no. G/57, S. Efimia, Cephalonia, 
Greece, G. L. Pesce, D. Maggi & M. Mi- 
randa leg. 7.5.1977 (1 male, 1 female) 
(Pesce et al., 1979). 
Well no. G/58, S. Efimia, Cephalonia, 
Greece, G. L. Pesce, D. Maggi & M. Mi- 
randa leg. 7.5.1977 (2 males, 1 shell) 
(Pesce et al., 1979). 

-Well no. G/143, Poros, Cephalonia, Greece, 
G. L. Pesce, D. Maggi & G. Silvehi leg. 

2.4.1978 (1 male) (Pesce et al., 1979). 
-Well no. G. 174, shore Zante-Lithakial, at 

the crossroads for Mouzaki, Zante, 
Greece, G. L. Pesce & G. Silvehi leg. 

8.4.1979 (1 male, 5 females, 2 shells) 
(Pesce & Maggi, 1983). 

-Well no. G. 194, near Katastahon, Zante, 
Greece, G. L. Pesce & G. Silvehi leg. 
9.4.1979 (1 male, 1 female, 2 shells) 
(Pesce & Maggi, 1983). 

Description 

Shell very small, valvatiform-planispiral, 
thin, whitish, transparent when fresh; surface 
of protoconch malleated; spire slightly raised, 
consisting of 2.75-3.25 rather rapidly grow- 
ing, convex whorls; last whorl large, dilated, 
descending near aperture; umbilicus very 
wide; aperture prosocline, roundish-ovoid; 
peristome complete, slightly reflected only at 
columellar margin (Figs. 237-238; Schutt, 
1980: 140, pi. 10a, fig. 42). Dimensions: 
height = 0.54-1 .07 mm; diameter = 1 .11 -1 .52 
mm. 

Operculum thin, yellowish, paucispiral. 



194 



BODÓN, MANGANELLI & GIUSTI 




244 



249 



FIGS. 237-249. Shell, operculum and anatomical details of Fissuria raeWe/ (Schutt, 1980) from well no. 
G/58. S. Efimia, Cephalonia, Greece, G. L. Pesce, D. Maggi & M. Miranda leg. 7.5.1977 (Figs. 237, 239, 
241 -242, well no. G/174, shore Zante-Lithakial, at the crossroads for Mouzaki, Zante, Greece, G. L. Pesce 
& G. Silveni leg. 8.4.1979 (Figs. 238, 247, 248), well no. G/54, Cephalonia, Greece, G. L. Pesce, D. Maggi 
& M. Miranda leg. 7.5.1977 (Figs. 240, 243, 244), well no. G/57, S. Efimia, Cephalonia, Greece, G. L. Pesce, 
D. Maggi & M. Miranda leg. 7.5.1977 (Figs. 245, 249) and well no. G/194, near Katastarion, Zante, Greece, 
G. L. Pesce & G. Silveni leg. 9.4.1979 (Fig. 246). Figs. 237-238: shells; Fig. 239: outer face (left) and pro- 
file (centre) of operculum; Fig. 240: body of a male with palliai cavity open to show head and penis; Figs. 241 , 
244-247: dorsal side of penis of six males; Fig. 242: prostate gland, intestine and pallia! organs of a male; 
Fig. 243: renal and palliai oviduct, intestine and palliai organs of a female; Figs. 248, 249: renal and palliai 
oviduct of two females. Scale bar = 1 mm. 



slightly thickened at centre of inner face but 
without peg (Fig. 239). 

Body unpigmented; eye spots absent (Fig. 
240). 

Male genitalia with prostate gland bulging 
well into palliai cavity; penis rather short or 
moderately long, flat, with apex pointed, and 
two, well-raised lobes; lobes of variable size 
and containing mass of glandular tissue: one 
on left side about 2/3 of penis length; another 
on dorsal-right side about 1/3 of penis length; 
penial duct zig-zagging through right portion 
of penis to open at penis tip (Figs. 241. 242, 
244-247). 

Female genitalia with two seminal recepta- 



cles and a bursa copulatrix arising from distal 
renal oviduct; proximal and distal seminal re- 
ceptacles elongated, more or less equal in 
size; bursa copulatrix variable in size from 
medium to very large, roundish to oval, with 
slender elongated duct entering bursa on an- 
terior side; seminal groove running along ven- 
tral side of capsule gland (Figs. 243, 248, 
249). 

Radula with central tooth trapezoidal with 
long lateral wings and basal tongue; two basal 
cusps where each lateral wing arises from 
face of central tooth; lateral teeth rake-like, 
apically enlarged, their anterior margin with 
10-11 denticles, central one longer, larger; 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



195 



first marginal teeth rake-shaped, with long lat- 
eral wing and elongated cutting edge with 
long row of 28-32 small denticles anteriorly; 
second marginal teeth scraper-shaped, with 
long, slender lateral wing and roundish, 
spoon-like apex, its cutting edge carrying 
rather long row of about 22 very small denti- 
cles (Figs. 172, 173). 

Stomach without posterior caecum; intes- 
tine with rather developed, S-like bend on pal- 
liai wall (Figs. 242, 243). 

Osphradium variable in size, elongated, 
oval or kidney-shaped; ctenidium consisting 
of 9-23 lamellae (Figs. 242, 243). 

Nervous system unknown. 

Taxonomy 

The study of many specimens from 
Cephalonia Island (some collected close to 
the type locality) and Zante Island revealed 
that the female genitalia has medium to large 
bursa copulatrix and two rather long seminal 
receptacles (proximal and distal) and that 
the male genitalia have a penis with two glan- 
dular lobes. These characters agree with 
those described for Fissuria boui and conse- 
quently support inclusion of Horatia {Hauffe- 
nia) raehlei'm the same genus. 

Islamia minuta (Draparnaud, 1805) 

Valvata minuta Draparnaud, 1805: 42, pi. 1, 
figs. 36-38. 

Type Locality: no locality is indicated by Dra- 
parnaud (1805) or is given in the labels 
accompanying the type material in the 
Draparnaud collection at Naturhisto- 
risches Museum Wien (К. Ediinger, pers. 
com.). It must therefore be assumed that 
the type locality is "France" from the title 
of Draparnaud's volume ("Histoire na- 
turelle des mollusques terrestres et fluvi- 
átiles de la France"). If the designation of 
a neotype is ruled by the ICZN, the type 
locality will become Source de l'Ain, 
Nozeroy, Jura. 

Type Matehal: original type material consists 
of the unidentifiable lectotype (a shell) in 
the Draparnaud collection. Naturhisto- 
risches Museum Wien (Austria) (Binder, 
1966). Bernasconi (1975) selected a 
neotype ["nouveau typoide"] for Valvata 
minuta, but this designation is invalid 
(see below). In order to preserve this 
name in the current sense, we are apply- 
ing to the ICNZ to set aside the type sta- 



tus of the lectotype and to designate the 
shell shown in Fig. 250 as neotype. The 
proposed neotype is in the Naturhis- 
torisches Museum Wien (catalogue no. 
100485). 

Material Examined 

-Source de l'Ain, Nozeroy, Jura, M. Bodon 
leg. 21.7.1985 (3 males, 1 female, many 
shells). 

— Source de I'Epinglier, near Poncin, Ain, M. 

Bodon leg. 26.8.1989 (1 male, 1 female, 
39 shells). 

— Source du Dessoubre, Consolation-Mai- 

sionnettes, Doubs, M. Bodon leg. 
21.7.1985 (1 male, 4 females, 48 shells). 

— Springs at Consolation-Maisonnettes, 

Doubs, M. Bodon & G. Manganelli leg. 
13.6.1996 (6 males, 14 females, many 
shells). 

-Springs along the stream in the Pare du 
Seminaire, N.D. de Consolation, Conso- 
lation-Maisonnettes, Doubs, M. Bodon 
leg. 21.7.1985 (6 males, 7 females, 27 
shells). 

-Source de l'Aiguille, Vallon Pont d'Arc, 
Ardèche, M. Bodon leg. 25.6.1989 (5 
males, 3 females, many shells). This 
population, assigned by Bernasconi 
(1988) to /. globulina, is here reported as 
Islamia cf. minuta because anatomically 
is similar to /. minuta, but the shell spire is 
more conical, like /. globulina. 

Description 

Shell very small, almost planispiral, thin, 
whitish, waxen, transparent when fresh; sur- 
face of protoconch malleated; spire almost 
flat, consisting of 2.75-3.25 rather rapidly 
growing, convex whorls: last whorl large, di- 
lated, descending slightly near aperture; um- 
bilicus wide; aperture prosocline, roundish; 
peristome complete, thin, slightly thickened, 
slightly reflected only at columellar margin 
(Figs. 209, 250-251; Draparnaud, 1805: 42, 
pi. 1 figs. 36-38; Locard, 1889: 331-333; 
1893: 128; Germain, 1931: 674-675; Binder, 
1966: 371-374, figs. 1, 2; Bernasconi, 1975: 
308-309, figs. 7a, b, 8a; 1977: 30, figs. 2a, 
3a; Boeters, 1998: 28, figs. HI, 2). Dimen- 
sions: height = 0.67-1.56 mm; diameter = 
1.09-2.11 mm (height = 0.7-1.5 mm; diame- 
ter = 1.0-2.2 mm according to Bernasconi, 
1975, 1977). 

Operculum thin, yellow orange, paucispiral, 



196 



BODÓN, MANGANELLI & GIUSTI 




FIG. 250. Proposed neotype of Islamia minuta (Draparnaud, 1805) from the Source de l'Ain, Nozeroy, Jura, 
M. Bodon leg. 21.7.1985. Naturhistorisches Museum Wien (catalogue no. 100485). Scale bar = 1 mm. 



a little thicker at centre but without outgrowth 
on inner face (Fig. 257; Bemasconi, 1975: 
307, fig. 6b, c). 

Body unpigmented (sometimes traces of 
pigment in wall of visceral sac); eye spots 
present or absent (Figs. 253, 255; Boeters, 
1979: 60; Bernasconi, 1975: 304, fig. lb). 

Male genitalia with prostate gland bulging 
slightly into palliai cavity; penis rather elon- 
gated, flat, with sides corrugated near base, 
not or slightly tapering near apex, which 
branches in two; right branch corresponding to 
tip of penis proper, variably elongated, cylin- 
dncal or conical, pointed; left branch being a 
lobe, variable in shape and size, but always 
shorter than penis tip and with inside réfringent 
mass of glandular cells; rather straight muscu- 
lar pleat on ventral side about 2/3 of penis 
length, running obliquely from right side to 
base of penial lobe and not protruding on left 
side; penial duct zig-zagging through right or 
central portion of penis to open at penis tip 
(Figs. 252, 254, 256; Bernasconi, 1975: 
305-306, fig. 4b, c; Boeters, 1 998: 28, fig. H4). 

Female genitalia with only two seminal re- 



ceptacles arising from distal renal oviduct, 
usually not very close to one another; that 
arising at end of loop (in position correspond- 
ing to that of proximal) well developed, always 
larger and longer than other, with short but ev- 
ident stalk, wider at apex; that arising close to 
where oviduct enters albumen gland (in posi- 
tion more or less corresponding to that of dis- 
tal) very small, usually without evident stalk, in 
some specimens with réfringent mass of ori- 
ented spermatozoa; no trace of bursa copula- 
trix; seminal groove running along ventral side 
of capsule gland (Figs. 259-261 ; Bernasconi, 
1975: 306, fig. 5b; Boeters, 1998: 28, fig. H5). 
Radula with central tooth trapezoidal, with 
long lateral wings and basal tongue, its apical 
margin V-like, with larger central denticle and 
five smaller denticles on both sides in de- 
creasing order of size; 2-3 basal cusps where 
each lateral wing arises from face of central 
tooth; lateral teeth rake-like, apically en- 
larged, their anterior margin with 11-13 denti- 
cles, central one longer, larger; first marginal 
teeth rake-shaped, with long lateral wing and 
elongated cutting edge with long row of 20-26 




260 



FIGS 251-261 Shell operculum and anatomical details of Islamia minuta (Drapamaud, 1805) from the 
Source de l'Ain, Nozeroy, Jura, M. Bodon leg. 21.7.1985 (Figs. 251-253, 255, 257, 259), from the springs 
along the stream in the Pare du Seminaire, N.D. de Consolation, Consolation-Maisonnettes, Doubs, M. 
Bodon leg 21 7 1985 (Figs. 254, 261), and from the Source de I'Epinglier, near Poncin, Am, M. Bodon leg. 
26 8 1989 (Figs 256 260). Fig. 251; shell; Figs. 252, 254, 256: dorsal and ventral side (the second picture 
of each series) of penis of seven males; Fig. 253: body of a male with palliai cavity open to show head and 
penis; Fig. 255: head of another specimen with eye spots; Fig. 257: outer face (left) and profile (right) of op-^ 
erculum- Fig 258: prostate gland, stomach, intestine and palliai organs of a male; Figs. 259, 260: renal and 
palliai oviduct, intestine and palliai organs of two females; Fig. 261: renal and palliai oviduct of a female. 
Scale bar = 1 mm. 



198 



% 



20 



10 



262 



% 



20 



10 



4=d 



Xi 



BODÓN, MANGANELLI & GIUSTI 
H 

1,2 
1.0 
0.8 



H/D 10 



0.6 0.8 1 



O H/D 263 




H/D 6 



264 



-xn 



Xl 



1.2 



1.0 



0.8 



Ü- 



0.6 



0.8 



H/D 



.0 1.2 1.4 1.6 



H/D 10 H/D o 




H/D 06 



265 



1.2 



1.4 



1.6 



FIGS. 262-265. Biometrie analysis of the shells of some populations of the French Islamia. Figs. 262, 263: 
/. minuta (Draparnaud, 1805) and /. globulina (Paladiihe, 1866) from the Source de I'Epinglier, near Poncin, 
Ain, M. Bodón leg. 26.8.1989: Figs. 264, 265: /. minuta and /. spirata (Bernasconi, 1985) from the springs 
along the stream in the Pare du Seminaire, N.D. de Consolation, Consolation-Maisonnettes, Doubs, M. 
Bodon leg. 21.7.1985. H: shell height: D: shell diameter; dimensions in mm. 



small denticles anteriorly; second marginal 
teeth scraper-shaped, with long slender lat- 
eral wing and roundish, spoon-like apex, its 
cutting edge carrying rather long row of 1 4- 1 8 
very small denticles (Bernasconi, 1975: 
304-305, fig. 2b, c). 

Stomach without posterior caecum; intes- 
tine with well-developed, S-like bend on palliai 
wall (Figs. 258-260; Bernasconi, 1975: 306, 
fig. 3b; Boeters, 1998: 28, fig. H3). 

Osphradium oval; ctenidium consisting of 
8-14 lamellae (Figs. 258-260; Bernasconi, 
1975:305, fig. 3b). 

Nervous system unknown. 

Distribution 

The distribution of Islamia in France in- 
cludes a large part of the Rhone basin to the 
east, the Languedoc and the Garonne, Dor- 
dogne basins and probably the Gascogne 
(Fig. 185) to the southwest. The distribution 



indicated by Bouchet (1990: Fig. 7) for "Hauf- 
feniä' minuta and by Ripert (1998: fig. 10) 
for "Neohoratia" globulina includes eastern 
Provence and the Côte d'Azur, southeastern 
areas in which Islamia has never been docu- 
mented (anatomical study of valvatiform hy- 
drobiids from the Départements of Vaucluse, 
Var and Alpes Maritimes, identified them as 
Fissuria boui Boe\ers, 1982). 

Populations surely attributed to /. minuta 
have only been found in the Jura mountains, 
the upper Rhone basin, the French depart- 
ments of Doubs, Jura and Ain and the Swiss 
cantons of Neuchâtel and Bern (Bernasconi, 
1975, 1977). 

Taxonomy 

Our study shows that the relative position of 
the two seminal receptacles and the point 
where they arise from the renal oviduct are 
quite constant in all the populations examined 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



199 



of Islamia minuta, I. globulina (Paladiihe, 
1866), /. spirata (Bemasconi, 1975) and /. 
consolationis (Bernasconi, 1985) (for the last 
three, see Descriptions below). It is important 
that the proximal seminal receptacle is always 
larger and longer than the distal one (see 
Description of Islamia). This contrasts with 
what Bernasconi (1975, 1977, 1984, 1985) 
claimed, that is, distal sac-like structure (aris- 
ing from renal oviduct just before it enters pal- 
liai oviduct) larger than proximal (arising close 
to end of loop). The fact that at least part of 
the material studied by Bernasconi comes 
from the same localities as the material stud- 
ied by us (Source de l'Ain, Nozeroy for /. min- 
uta; Vidourle, résurgence. Sauve for /. globu- 
lina) indicates that our material cannot belong 
to a taxon different from Bernasconi's and 
suggests that he misinterpreted the female 
genital structure. This may have been be- 
cause in wrongly interpreting the larger 
sac-like structure as a bursa copulatrix, 
Bernasconi illustrated it arising where the 
bursa copulatrix normally arises in the hydro- 
biids, that is, from the renal oviduct immedi- 
ately before the oviduct enters the palliai 
oviduct. This misinterpretation is indirectly 
confirmed by the fact that the position of the 
smaller sac-like structure, interpreted by 
Bernasconi as a seminal receptacle, is also 
imprecisely figured by him. In Bernasconi's 
figures, it does not have a constant position 
and sometimes arises proximally from the 
renal oviduct at the end of the loop and some- 
times about halfway along the loop (see 
Bernasconi, 1975, fig. 5; 1977, fig. le; 1984, 
fig. le; 1985, fig. Id). 

Our data on the structure of the female gen- 
italia and the penis (presence of glandular 
lobe on left side of penis; absence of mass of 
réfringent cells inside penis apex to right of 
penial duct; absence of stylet at tip of penis) is 
enough to conclude that these French 
species do not belong to Hauffenia, as Haase 
(1993: 106) suggested. The misinterpreted 
French "Hauffenia" must be assigned to Is- 
lamia. In fact, they only differ from the type 
species of Islamia from the Balkans (to which 
species from Italy, Asia Minor and Middle East 
are more or less related; cf., Radoman, 
1973a, 1983; Giusti & Pezzoli, 1980; Giusti et 
al., 1981; Schutt, 1991; Bodón et al. 1995a) in 
some minor anatomical features: for example, 
seminal receptacles sometimes more distant 
from one another and relatively undeveloped 
muscular pleat on ventral side of penis which 
does not protude on left side. 



It is particularly difficult to clarify the identity 
of Valvata minuta and the status of the 
forms/subspecies into which it has been sub- 
divided. Valvata minuta is cited by many clas- 
sic authors from various localities (Férussac, 
1807: 128; Bouchard-Chantereaux, 1838: 87; 
Gassies, 1849: 183; 1859: 60; Dupuy, 1851: 
585-586; Moquin-Tandon, 1856: 434). Pal- 
adilhe (1866: 25, 27) claimed that Gassies 
and the others misinterpreted it as "une char- 
mante Valvée microscopique de forme glob- 
uleuse", which he described as a distinct 
species: V. globulina. Locard (1895: 20, 
46-47) traced the type material of V. minuta. 
This consists of two shells in the Draparnaud 
collection in the Naturhistorisches Museum 
Wien, Austria, and one in the M. Bischof von 
Hohenwarth collection. Many years later. 
Binder (1966: 371-372) studied the two 
syntypes in the Naturhistorisches Museum 
Wien. One is a hydrobiid species (and is se- 
lected as the "type"), the other is a fragment of 
the apex of a shell of Valvata piscinalis 
(Müller, 1774). 

Bernasconi (1975) published a first re- 
description of V. minuta based on the study of 
some Swiss and French populations, but his 
paper contains many controversial aspects 
which have made a puzzle of the case. First of 
all, although he was aware of the existence of 
a lectotype, Bernasconi selected a neotype 
["nouveau typoide"] for V. minuta, in contra- 
vention of ICZN (1999: Art. 75) and conse- 
quently invalid. Moreover, his neotype does 
not belong to the nominotypical form/sub- 
species minuta but to the different form/sub- 
species globulina. The type locality indicated 
for the form/subspecies globulina (Vidourle, 
résurgence (Sauve)), and not that of the 
form/subspecies minuta (Areuse, résurgence 
(St. Sulpice)), is reported as type locality of 
the species. Both these restricted type locali- 
ties are outside the range reported by the au- 
thors of the taxa. In fact, that of the form/sub- 
species minuta is in the Swiss canton of 
Neuchâtel (under the king of Prussia until 
1815) and not in France; that of form/sub- 
species globulina in the Rhone basin, and not 
in the Garonne basin. As a consequence, his 
neotype designation and his type locality re- 
striction are invalid. 

Study of the lectotype (Draparnaud collec- 
tion no. 1820 xxvi/21; Naturhistorisches Mu- 
seum Wien, Austria; Binder, 1 966: fig. 1 ) does 
not enable certain identification of the spe- 
cies. It has a shell shape similar to the speci- 
mens of /. minuta from the Jura, but the shell 



200 



BODÓN, MANGANELLI & GIUSTI 



TABLE 8. Shell parameters of the Islamia species coexisting in the Source de I'Epinglier at 
Poncin, Ain, and the springs in the Pare du Seminaire at Consolation-Maisonnettes. Doubs. 
Acronyms: H shell height, D shell diameter. 



Locality 


Taxa 


Source de I'Epinglier, Poncin (Ain) 


Islamia minuta 


Islamia globulina 


mean ratio H/D r a 


0.65 1 0.05 


0.93 - 0.06 


(range) 


(0.51-0.73) 


(0.82-1.06) 


number of shells 


31 


28 


Springs in the Pare du Seminaire. 


Islamia minuta 


Islamia spirata 


Consolation-Maisonnettes (Doubs) 






mean ratio H/D ^ a 


0.62 • 0.06 


0.98 ^ 0.04 


(range) 


(0.53-0.81) 


(0.91-1.06) 


number of shells 


30 


19 



height is less. On the basis of shell size 
(height: 0.60 mm; diameter: 1.34 mm), it is 
more similar to Valvata exilis Paladiihe, 1867, 
from the Department de l'Hérault (see "De- 
scription of a new valvatiform genus from 
France" for redescription of V. exilis), differing 
in the fact that the last whorl is not dilated near 
the aperture. No locality is indicated by Dra- 
parnaud (1 805), nor is it given in the labels ac- 
companying the type material in the Dra- 
parnaud collection. If Draparnaud, who lived 
in Montpellier, collected this material near his 
town, then his V. rvinuta cannot be the 
species that is currently considered to be V. 
minuta, which lives much further north, but it 
may be V. exilis. In this situation, we think that 
it is better to apply to ICZN to set aside the 
Binder's (1966) type designation and to des- 
ignate a neotype for this species so that the 
current understanding of this nominal taxon is 
preserved. 

The proposed neotype (Fig. 250) was col- 
lected in the Source de l'Ain, Nozeroy, Jura. 
This proposed neotype (a shell) was chosen 
from a population for which the anatomy is al- 
ready known (Bernasconi, 1975). This popu- 
lation lives in a major spring of the French 
Jura. No other similar Islamia species lives in 
the same spring. The neotype is deposited in 
the Naturhistorisches Museum Wien (cata- 
logue no. 100485). 

Bernasconi (1984, 1985, 1988) regarded /. 
minuta as having four subspecies. All of them, 
apart from /. consolationis. which is character- 
ized by a larger shell, are identified by different 
values of the ratio of shell height and diameter 
(H/D) (/. minuta: 0.56 ± 0.07-0.66 ± 0.09; /. 
globulina: 0.76 ± 0.09-0.91 ± 0.06; /. spirata: 
1.00 ± 0.06-1.07 ± 0.08; Bernasconi, 1975, 
1985). In cases of coexistence of more forms/ 



subspecies, shell material clearly revealed 
that the populations are not homogeneous 
and that the frequencies of H/D values are dis- 
tributed on a bimodal curve. For example, the 
population from Source de I'Epinglier, Ain, 
consists of two quite distinct shell morphs 
(Table 8; Figs. 262, 263). Binder (1966) stud- 
ied the shells and claimed that the depressed 
shells, traditionally assigned to V. minuta, and 
the shells with raised spire, traditionally as- 
signed to V. globulina, were linked by a series 
of intermediate shells, and were the extremes 
of a continuum. He concluded that V. minuta 
and V. globulina were not distinct species 
("Cette distinction ne se justifie probablement 
pas. . ."). The evidence of two distinct coex- 
isting morphs is undeniable in this population. 
Unfortunately, there is too little anatomical 
data, only one female and one male (Fig. 256) 
examined, to confirm their status as distinct 
taxa on an anatomical basis. If we are to ac- 
cept the H/D criteria of Bernasconi (1975, 
1 985), these two morphs can be assigned to /. 
minuta and to /. globulina. 

The same happens near Consolation- 
Maisonnettes, Doubs, where three distinct 
shell morphs also coexist (Table 8; Figs. 264, 
265). Again, according to the dimensions and 
the H/D values of Bernasconi (1975, 1985), 
the three morphs can be assigned to /. mi- 
nuta, to /. spirata and to /. consolationis. 
Anatomical study revealed that the speci- 
mens attributed to /. minuta and /. consolatio- 
nis have a penial lobe shorter than the penial 
apex, and those assigned to /. spirata a penial 
lobe longer than the penial apex, while only /. 
minuta has eye spots (Figs. 254, 276-277, 
282, 284). 

Other specimens such as those collected in 
the Source de l'Aiguille, Vallon Pont d'Arc, 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



201 



Ardèche, and assigned by Bernasconi (1988) 
to /. globulina are characterized by H/D values 
(mean H/D: = 0.76 ± 0.05), which lie almost 
between those of /. globulina and /. minuta 
whereas the male genitalia, are identical to 
those of /. minuta (penial lobe shorter than 
penis apex). 

Islamia spirata is readily distinguishable by 
shell parameters only in the case of the type 
population. When other populations are con- 
sidered the distinction becomes problemati- 
cal. As well, the absence of eyes in the type 
population of /. spirata is of no help for distin- 
guishing it from /. globulina. In fact, other pop- 
ulations assignable to /. minuta or /. globulina 
contained specimens with eyes coexisting 
with specimens without eyes, suggesting that 
this character is occasionally variable. 

The above facts are evidence of a very 
complex situation and possibly of equivocal 
shell and anatomical characters. However, 
since almost all these taxa (except /. globulina 
and /. spirata) live together in some places 
and are distinguishable by morphometric and 
anatomical characters, there must be at least 
three distinct species. More populations must 
obviously be studied (especially from the type 
localities of all the taxa described in the past) 
in order to gather more biométrie and anatom- 
ical data for a better understanding of the tax- 
onomic setting of the group. We nevertheless 
feel justified in rejecting the current interpreta- 
tion of all French Islamia as subspecies of /. 
minuta. We suggest provisional recognition of 
the four taxa, /. minuta (Draparnaud, 1805), /. 



globulina (Paladiihe, 1866), /. spirata (Bern- 
asconi, 1975), and /. consolationis (Bern- 
asconi, 1985) as distinct species (see key in 
Table 9, Fig. 266). 

The shells of the different species of Islamia 
described to date (Radoman, 1973a, 1983; 
Giusti & Pezzoli, 1980; Giusti et al., 1981; 
Schutt, 1 991 ; Bodón et al., 1 995a) vary little in 
shape (mostly valvatiform with the spire raised 
to different degrees) and size. These two char- 
acters are not sufficiently diagnostic to deter- 
mine the status of allopathc taxa. This obvi- 
ously compels us to rely on anatomy, which 
also offers little in the way of diagnostic char- 
acters. Apart from the fact that French Islamia 
colonize an area geographically separate from 
the other areas inhabited by this genus (Spain, 
Italy, Corsica, Elba, Sicily, Balkans, Turkey, 
and Israel), two characters seem to confirm 
their distinctiveness. These characters, if con- 
stant, would be sufficient to support the exis- 
tence of a distinct branch in the radiation of 
Islamia. In fact, the French Islamia are distin- 
guished from all the eastern species, from the 
Balkans to Turkey and Israel (Radoman, 
1 973a, 1 983; Giusti et al., 1 981 ; Schutt, 1 991 ), 
by seminal receptacles, on the average, more 
distant from one another and a relatively un- 
developed muscular pleat on ventral side of 
penis, not protruding on left side as in typical 
Islamia. The same differences distinguish the 
French Islamia from the Italian /. pusilla (Pier- 
santi, 1952) (Giusti et al., 1981), while a 
markedly reduced penial lobe distinguishes 
two other recently described Islamia species 



TABLE 9. Provisional analytical key for the identification of French 
Islamia species. For characters used, see Fig. 266. 

1 a — Penial lobe shorter than penis apex 2 

1 b — Penial lobe longer than penis apex 3 

2a -Mean D < 2 mm; mean H/D = 0.56-0.66 /. minuta 

2b -Mean D > 2 mm; mean H/D = 0.80-0.90 /. consolationis 

3a - Mean H/D = 0.76-0.93 /. globulina 

3b -Mean H/D = 0.98-1.07 /. spirata 




FIG. 266. Characters used in the analytical key for the identification of the French Islamia species (Table 9). 



202 



BODÓN, MANGANELLI & GIUSTI 



from different Italian islands: /. cianensis 
Bodón, Manganelli. Sparacio & Giusti, 1995 
(penis with muscular pleat), and /. gaiteri 
Bodón, Manganelli, Sparacio & Giusti, 1995 
(penis without muscular pleat; Bodón et al,, 
1995a). Finally, other undescribed or little 
known Italian (see Giusti et al., 1981), Corsi- 
can and Spanish taxa differ in other anatomi- 
cal characters and/or the frequent absence of 
a muscular pleat on the ventral side of penis 
(for the Spanish species, see above). 

Islamia globulina (Paladiihe, 1866) 

?Valvata moquiniana Dupuy, 1851 : 586-587, 
pi. 28, fig. 15. 

Type Locality: ". . . alluvions du Lot, près de 
Mende . . .", Dep. Lozère, France. 

Type Material: Dupuy (1851) did not give any 
information about the type material. 

Valvata globulina Paladiihe, 1866: 170 [p. 27 
in reprint]. 

Type Locality: ". . . paraît spéciale au bassin 
de la Garonne, notamment dans les dé- 
partements du Gers et de Lot-et- 
Garonne.", France. 

Type Material: Paladiihe (1866) did not give 
any information about the type material; 
Binder (1966) stated that the type does 
not exist. 

7 Valvata bourguignati Letourneux, 1869: 
197-199. 

Type Locality: ". . . fontaine, prés du Moulin- 
Gachet (commune de Pissotte)", Dep. 
Vendée, France. 

Type Material: Letourneux (1869) did not give 
any information about the type matehal. 

? Valvata turgidula Locard, 1889: 333-334. 

Type Locality: ". . . lac de la Négresse, près 
de Bayonne, dans les Basses-Pyrénées 
. . .", France. 

Type Material: according to Locard (1889) 
type material is in the Bourguignat collec- 
tion, Geneve, Switzerland. 

? Valvata micrometrica Locard, 1889: 336- 
337. 

Type Locality: ". . . fontaine du Camarde, 
près de Valence dans le Gers", France. 

Type Material: Locard (1889) did not give any 
information about the type material. 

Material Examined 

-Source de I'Epinglier, near Poncin, Ain, M. 

Bodón leg. 26.8.1989 (34 shells). 
-Vidourle, résurgence, Sauve, Gard, 1.1976, 



ex R. Bernasconi collection (2 maies, 2 
females); M. Bodon leg. 2.12.1984 (3 
shells). 

-Source de la Nizon, Lirac, Gard, M. Bodon, 
H. Girardi & B. Bomba leg. 29.12.1998 (3 
males, 1 female, many specimens, many 
shells). 
Wells 13/PT/2, propriété Michon, Chateau- 
renard. Bouches du Rhône, С. Bou leg. 
4.1977, collection H. Girardi (1 male). 

-Résurgence du Moulis at Moulis, St. Girons, 
Ariège, M. Bodon leg. 13.9.1985 (1 male, 
2 females, 1 shell). 

— Rivière souterraine de Labouiche, Foix, Ar- 
iège, M. Bodon leg. 13.9.1985 (1 male, 2 
females, many shells). 

-Ruisseau souterrain d'Amiel, Penne, Tarn, 
С. Bou leg. 12.1991, ex H. Girardi collec- 
tion (3 males, 1 female). 

-Ruisseau souterrain de Cabeau, Penne, 
Tarn, С Bou leg. 12.1976, H. Girardi col- 
lection (1 maie, 1 female). 

-Source de la Mandre, Soreze, Tarn, С Bou 
leg. 10.1991, H. Girardi collection (1 
maie, 6 shells). 
Water-bearing stratum of the intake A.E.P. 
of Lescure, Tarn, C. Bou leg. 12.1991, ex 
H. Girardi collection (5 males, 2 females). 

-Fontaine des Canelles, Lalinde, Dordogne, 
M. Bodon leg. 27.6.1989 (1 female). This 
population is reported as Islamia cf. glo- 
bulina, because there were no male 
specimens for anatomical study. 

Description 

Shell very small, valvatiform, thin, whitish, 
waxen, transparent when fresh; surface of 
protoconch malleated; spire rather raised, 
consisting of 2.5-3.25 rather rapidly growing, 
convex whorls; last whorl large, dilated, de- 
scending slightly near aperture; umbilicus 
small; aperture prosocline, roundish; peris- 
tome complete, thin, slightly thickened, slightly 
reflected only at columellar margin (Figs. 210, 
267;Gassies, 1849: 183, pi. 2, fig. 7, as V. min- 
uta: Moquin-Tandon, 1855: 543, pi. 41, figs. 
26-28, as V. minuta: Locard, 1889: 334-336, 
1893: 127-128, fig. 130; Dupuy, 1851 : 585, pi. 
28, fig. 14, as V minuta: Germain, 1931: 
675-676, figs. 742, 743; Binder, 1966: 
371-374, figs. 2, 3; Bernasconi, 1975: 308, 
310, figs. 7c, 8b; 1977: 30, figs. 2a, 3a; 1984: 
205, fig. 7f). Dimensions: height = 0.7-1.8 
mm; diameter = 0.9-1.9 mm (height and di- 
ameter according to Bernasconi, 1975, 1977). 

Operculum thin, pale yellowish or yellow, 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



203 



paucispiral, a little thicker at centre but without 
outgrowth on inner face (Fig. 268; Boeters, 
1973: 65; Bernasconi, 1975: 307, fig. 6a; 
1984: fig. lb). 

Body unpigmented (sometimes traces of 
pigment in wall of visceral sac); eye spots 
present or absent (Fig. 269; Boeters, 1 973: 65; 
Bernasconi, 1975: 304, fig. la; 1984: fig. la). 

Male genitalia with prostate gland bulging 
slightly into palliai cavity; penis variably elon- 
gated, flat, with sides corrugated near base, 
not or slightly tapering near apex, which 
branches in two: right branch, forming tip of 
penis proper, short, conical, more or less 
pointed; left branch constituting lobe, variable 
in shape and size but always slightly longer 
than penis tip, with inside réfringent mass of 
glandular cells; rather straight muscular pleat 
on ventral side about 2/3 of penis length, run- 
ning obliquely from right side to base of penial 
lobe, not protruding on left side; penial duct 
zig-zagging through right or central portion of 
penis to open at penis tip (Figs. 270, 271; 
Boeters, 1973: 65; Bernasconi, 1975: 305- 
306, fig. 4a; 1984: fig. la, d). 

Female genitalia with only two seminal re- 
ceptacles arising from distal renal oviduct, 
usually not very close to one another; that aris- 
ing at end of loop (in position corresponding to 
that of proximal) well developed, always larger 
and longer than other, with short but evident 
stalk and apical enlargement; that arising 
close to where oviduct enters albumen gland 
(in position more or less corresponding to that 
of distal) very small, usually without evident 
stalk; no trace of bursa copulathx; seminal 
groove running along ventral side of capsule 
gland (Figs. 272, 273; Boeters, 1973: 65; 
Bernasconi, 1975: 306, fig. 5a; 1984: fig. 1e). 

Radula with central tooth trapezoidal, with 
long lateral wings and basal tongue, its apical 
margin V-like, with larger central denticle and 
5 smaller denticles on both sides, in decreas- 
ing order of size; 2-3 basal cusps where each 
lateral wing arises from face of central tooth; 
lateral teeth rake-like, apically enlarged, their 
anterior margin with 11-13 denticles, central 
one longer, larger; first marginal teeth rake- 
shaped, with long lateral wing and elongated 
cutting edge with long row of 20-26 small 
denticles anteriorly; second marginal teeth 
scraper-shaped, with long, slender lateral 
wing and roundish, spoon-like apex, its cut- 
ting edge carrying rather long row of 14-18 
very small denticles (Bernasconi, 1975: 
304-305, fig. 2a). 

Stomach without posterior caecum; intes- 



tine with well developed, U- or S-like bend on 
palliai wall (Figs. 272, 274; Boeters, 1973: 65; 
Bernasconi, 1975: 306-307, fig. 3a). 

Osphradium variable in size, oval or elon- 
gated; ctenidium consisting of 6-11 lamellae 
(Figs. 272, 274; Boeters, 1973: 65; Bern- 
asconi, 1975: 305, fig. 3a; 1984: fig. 1c). 

Nervous system unknown. 

Distribution 

The distribution of /. globulina includes 
much of France: the Rhone basin to the east, 
and the Languedoc, the Garonne and Dor- 
dogne basins and probably the Gascogne to 
the southwest (Bernasconi, 1975, 1977; 
Bertrand, 1998; Ripert, 1998). 

Taxonomy 

See also discussion of /. minuta. All the /s- 
lamia populations from southern France hav- 
ing shell characters of /. globulina can be con- 
sidered to belong to the same species on the 
basis of anatomical characters. 

Although, it has not been studied topotypi- 
cal material of all nominal species, having 
globulina-Wke shell described from southern 
France (e.g.,Valvata moquiniana Dupuy, 
1851; V. globulina Paladiihe, 1866; V. bour- 
guignati Letourneux, 1869; V. turgidula Lo- 
card, 1889; and V. micrometrica Locard, 
1889), it is very probable that they are syn- 
onymous. If this is true, the oldest established 
name available for this taxon is V. moquini- 
ana. Here we have maintained its current 
name V. globulina, awaiting a definitive revi- 
sion, including the study of material from the 
Departments of Gers and Lot-et-Garonne, the 
type locality of the species described by Pal- 
adiihe (1866). 

Islamia spirata (Bernasconi, 1985) 

Hauffenia minuta spirata Bernasconi, 1985: 

63-64, fig. la-e, table 1. 
Type Locality: "Bléfond, résurgence (Silley; V. 

3)", Dép. Doubs, France. 
Type Material: Bernasconi (1975) did not give 

any information about the type material. 

Material Examined 

-Springs along the stream in the Pare du 
Seminaire, N.D. de Consolation, Conso- 



204 



BODÓN, MANGANELLI & GIUSTI 





FIGS. 267-280. Shell, operculum and anatomical details of Islamia globulina (Paladilhe, 1866) from Vi- 
dourle, résurgence. Sauve, Gard, France 1.1976, exR. Bernasconi collection (Figs. 267, 268, 271-272, 274) 
and from the Résurgence du Moulis at Mouiis, St. Girons, Ariège, France, M. Bodon leg. 13.9.1985 (Figs. 
269, 270, 273) and of Islamia spirata (Bernasconi, 1985) from the springs along the stream in the Pare du 
Seminaire, N.D. de Consolation, Consolation-Maisonnettes, Doubs, France, M. Bodon leg. 21.7.1985 (Figs. 
275-280). Figs. 267, 275: shells; Figs. 268, 278: outer face (left) and profile (right) of operculum; Figs. 269; 
body of a male with palliai cavity open to show head and penis; Figs. 270, 271 , 277: dorsal and ventral side 
(second picture of each series) of penis of four males; Figs. 272, 279: renal and palliai oviduct, intestine and 
palliai organs of a female; Fig. 273: renal and palliai oviduct of a female; Figs. 274, 280: prostate gland, stom- 
ach, intestine and palliai organs of a male; Fig. 276: body of a female with palliai cavity open to show head. 
Scale bar = 1 mm. 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



205 



lation-Malsonnettes, Doubs, France, M. 
Bodon leg. 21.7.1985 (4 males, 7 fe- 
males, 9 shells). 
-Stream near Pont les Moulins, Cusancin 
valley, Doubs, France, M. Bodon leg. 
22.7.1985 (many shells). 

Description 

Shell very small, valvatiform, thin, whitish, 
waxen, transparent when fresh; surface of 
protoconch malleated; spire raised, consist- 
ing of 3-3.5 rather rapidly growing, convex 
whorls; last whorl large, dilated, descending 
slightly near aperture; umbilicus small; aper- 
ture prosocline, roundish; peristome com- 
plete, thin, slightly thickened, slightly reflected 
only at columellar margin (Figs. 211, 275; 
Bernasconi, 1975: 308, 310, figs. 7d, 8c; 
1985: table 1, fig. 2). Dimensions: height = 
0.90-1.51 mm; diameter = 0.90-1.44 mm 
(height = 1.0-1.9 mm; diameter = 1.0-1.8 
mm, according to Bernasconi, 1975). 

Operculum thin, yellowish, paucispiral, a lit- 
tle thicker at centre but without outgrowth on 
inner face (Fig. 278; Bernasconi, 1985: 63, 
fig. la). 

Body unpigmented (sometimes traces of 
pigment in wall of visceral sac); eye spots ab- 
sent (Fig. 276; Bernasconi, 1985: 63). 

Male genitalia with prostate gland bulging 
slightly into palliai cavity; penis rather elon- 
gated, flat, with sides corrugated near base, 
tapering slightly near apex, which branches 
into two; right branch, forming tip of penis 
proper, short, conical, more or less pointed; 
left branch, constituting lobe, cylindrical, 
slightly longer than penis tip, with inside ré- 
fringent mass of glandular cells; rather 
straight muscular pleat on ventral side about 
2/3 of penis length, running obliquely from 
right side to base of penial lobe, not protrud- 
ing on left side; penial duct zig-zagging 
through right or central portion of penis to 
open at penis tip (Fig. 277; Bernasconi, 1985: 
63-64, fig. le). 

Female genitalia with only two seminal re- 
ceptacles arising from distal renal oviduct, 
rather close to one another: that arising at end 
of loop (in position corresponding to that of 
proximal) well developed, always larger, 
longer than other, with short but evident stalk 
and apical enlargement; that arising close to 
where oviduct enters albumen gland (in posi- 
tion more or less corresponding to that of dis- 
tal) very small, usually without evident stalk; 



no trace of bursa copulatrix; seminal groove 
running along ventral side of capsule gland 
(Fig. 279; Bernasconi, 1985: 64, fig. Id). 

Radula details unknown (Bernasconi, 
1985:63). 

Stomach without posterior caecum; intes- 
tine with well-developed, S-like bend on palliai 
wall (Figs. 279, 280; Bernasconi, 1985: 64, 
fig. lb, c). 

Osphradium variable in size, oval or elon- 
gated; ctenidium consisting of 3-10 lamellae 
(Figs. 279, 280; Bernasconi, 1985: 63, fig. 
lb). 

Nervous system unknown. 

Distribution 

The distribution of /. spirata is limited to a 
small area in the Jura mountains, upper 
Rhone basin, in the French Department of 
Doubs (Bernasconi, 1975, 1985). 

Taxonomy 

See discussion of /. minuta. 

Islamia conso/af/on/s (Bernasconi, 1985) 

Hauff enia minuta consolationis Bernasconi, 
1985:64, figs. 2,3, table 2. 

Type Locality: "Maurepos, ... bei Consola- 
tion-Maisonettes," Doubs, France. 

Type Material: holotype at Museum d'Histoire 
Naturelle de Genève, Geneva, Switzer- 
land; paratypes are in the Bernasconi 
collection, Münchenbuchsee, Switzer- 
land (Bernasconi, 1985). 

Material Examined 

-Grotte du Biez-Airoux, Consolation-Maison- 
nettes, Doubs, M. Bodon & G. Manganelli 
leg. 13.6.1996 (3 males, 2 females, 10 
shells). 

-Grotte de Maurepos, Consolation-Maison- 
nettes, Doubs, M. Bodon & G. Manganelli 
leg. 13.6.1996(1 shell). 

-Source du Dessoubre, Consolation-Maison- 
nettes, Doubs, M. Bodon leg. 21.7.1985 
(many shells), M. Bodon & G. Manganelli 
leg. 13.6.1996 (2 females, 17 shells). 
Springs at Consolation-Maisonnettes, 
Doubs, M. Bodon & G. Manganelli leg. 
13.6.1996 (many shells). 

-Springs along the stream in the Pare du 
Seminaire, N.D. de Consolation, Conso- 



206 



BODÓN, MANGANELLI & GIUSTI 




FIGS. 281-286. Shell, operculum and anatomical details of Islamia consolationis (Bernasconi, 1985) from 
the Grotte du Biez-Airoux, Consolation-Maisonnettes, Doubs, France, M. Bodon & G. Manganelli leg. 
13.6.1996. Fig. 281: shell; Fig. 282: body of a male with palliai cavity open to show head and penis; Fig. 283: 
outer face (left) and profile (nght) of operculum; Fig. 284: dorsal and ventral side (second picture) of penis of 
two males; Fig. 285: testis, vas efferens, prostate gland, stomach, intestine and palliai organs of a male; Fig. 
286: renal and palliai oviduct, intestine and palliai organs of a female. Scale bar = 1 mm. 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



207 



lation-Maisonnettes, Doubs, 
leg. 21.7.1985(3 shells). 



Bodon 



Description 

Shell very small, valvatiforrn, thin, whitish, 
waxen, transparent when fresh; surface of 
protoconch very finely malleated; spire rather 
raised, consisting of 2.75-3.5 rather rapidly 
growing convex whorls; last whorl large, di- 
lated, descending slightly near aperture; игл- 
bilicus small; aperture prosocline, roundish; 
peristome complete, thin, slightly thickened, 
slightly reflected only at columellar margin 
(Figs. 21 2, 281 ; Bernasconi, 1 985: table 2, fig. 
3). Dimensions: height = 1.80-2.80 mm; di- 
ameter = 1.94-2.79 mm (height =1.63 ± 
0.53-2.09 ± 0.15 mm; diameter = 2.01 ± 
0.36-2.32 ± 0.21 mm according to 
Bernasconi, 1985). 

Operculum thin, yellow orange, paucispiral, 
a little thicker at centre but without outgrowth 
on inner face (Fig. 283). 

Body unpigmented (traces of pigment in 
wall of visceral sac); eye spots usually absent 
(Fig. 282). 

Male genitalia with prostate gland bulging 
slightly into palliai cavity; penis rather elon- 
gated, flat, with sides corrugated near base, 
not or slightly tapering near apex, which 
branches in two; right branch, forming tip of 
penis proper, variably elongated, conical, 
more or less pointed; left branch constituting 
lobe, cylindrical, shorter than penis tip, with in- 
side réfringent mass of glandular cells; rather 
straight muscular pleat present on ventral 
side at about 3/4 the penis length, running 
obliquely from right side to base of penial 
lobe, not protruding on left side; penial duct 
zig-zagging through right or central portion of 
penis to open at penis tip (Fig. 284). 

Female genitalia with only two seminal re- 
ceptacles arising from distal renal oviduct, 
rather close to one another: that arising at end 
of loop (in position corresponding to that of 
proximal) well developed, always larger, 
longer than other, with short but evident stalk 
and apical enlargement; that arising close to 
where oviduct enters albumen gland (in posi- 
tion more or less corresponding to that of dis- 
tal) small, without evident stalk; no trace of 
bursa copulathx; seminal groove running 
along ventral side of capsule gland (Fig. 286). 

Radula with central tooth trapezoidal, with 
long lateral wings and basal tongue, its apical 
margin V-like with long, robust central denticle 



and 5 smaller denticles on both sides in de- 
creasing order of size; 1 -2 basal cusps where 
each lateral wing arises from face of central 
tooth; lateral teeth rake-like, apically en- 
larged, their anterior margin with 9 denticles, 
central one longer, larger; first marginal teeth 
rake-shaped, with long lateral wing and elon- 
gated cutting edge with long row of 15-17 
long denticles anteriorly; second marginal 
teeth scraper-shaped, with long, slender lat- 
eral wing and roundish, spoon-like apex, its 
cutting edge carrying rather long row of about 
15 small denticles (Figs. 174-176). 

Stomach without posterior caecum; intes- 
tine with well-developed, S-like bend on palliai 
wall (Figs. 285, 286). 

Osphradium variable in size, oval or elon- 
gated; ctenidium consisting of 10-15 lamellae 
(Figs. 285, 286). 

Nervous system unknown. 

Distribution 

The distribution of /. consolationis is limited 
to a small area in the Jura mountains, upper 
Rhone basin, in the French Department of 
Doubs (Bernasconi, 1985). 

Taxonomy 
See discussion of /. minuta. 



DESCRIPTION OF A NEW VALVATIFORM 
GENUS FROM FRANCE 

Some of the species mentioned in the pres- 
ent paper and studied anatomically in the 
course of its preparation were found to belong 
to genera which have not yet been described. 
Here we only describe one, the type species 
of which was already known in the literature 
under an improper generic name. 



Heraultia n. gen. 



Diagnosis 



Hydrobiid snail with shell very small, plani- 
spiral, whitish, anatomically characterized by: 
male genitalia with penis conical, pointed, 
without lobes; female genitalia with distal 
seminal receptacle and a bursa copulatrix; 
bursa copulatrix very large, with very long 



208 



BODÓN, MANGANELLI & GIUSTI 




292 



FIGS. 287-294. Shell, operculum and anatomical details of Heraultia exills (Paladilhe, 1 867) from the spring 
of the Lez River, Hérault, France, M. Bodón leg. 2.12.84. Fig. 287: shell; Fig. 288; outer face (left) and pro- 
file (right) of operculum; Fig. 289: body of a male with palliai cavity open to show head and penis; Fig. 290: 
dorsal side of penis of three males; Fig. 291 : prostate gland, stomach, intestine and palliai organs of a male; 
Fig. 292: renal and palliai oviduct, intestine and palliai organs of a female; Figs. 293-294: renal and pallia! 
oviduct of two females. Scale bar = 1 mm. 



duct entering bursa on lateroposterior side; 
central tooth of radula with one basal cusp on 
each side. 

Etymology 

From Hérault, the Department of France, in 
which the species occurs. 

Type Species 

Valvata exilis Paladilhe, 1867. 
Taxonomy 

See discussion of H. exilis. 



Heraultia exilis (Paladilhe, 1867) 

Valvata exilis Paladilhe, 1867: 51-52, pi. 21, 
figs. 27-30. 

Type Locality: ". . . dans les fossés d'irrigation 
des prairies de la rive droit du Lez à la 
hauter du hameau de Lattes . . . Elle se 
rencontre aussi en petit quantité dans les 
alluvions du Lez recueillies sous le vil- 
lage de Casteinau, à près de 8 kilomètres 
en dessus de Lattes. Mais elle paraît bien 
plus abondante dans les alluvions de la 
Boyne (sous le village de Fontes, ar- 
rondissement de Béziers) . . .", Hérault, 
France. 

Type Material: syntypes (shells) in the Pal- 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



209 



adiihe collection, Faculté des Sciences, 
Montpellier, France (Boeters, 1974). 

Material Examined 

-Source du Lez, Hérault, France, M. Bodón 
leg. 2.12.1984(3 males, 5 females, many 
shells), 4.9.1985 (many shells). 

— Debris of the Lez River, Prades-le-Lez, 

Hérault, France, M. Bodon leg. 5.1.1992 
(4 shells). 

— Debris of the Lez River, Castelnau, Mont- 

pellier, Hérault, France, M. Bodon leg. 
3.12.1984 (many shells). 

— Debris of the Mosson River, Juvignac, Mont- 

pellier, Hérault, France, M. Bodon leg. 
4.9.1985 (2 shells). 

Description 

Shell very small, planispiral, thin, pale 
whitish, waxen, transparent when fresh; sur- 
face of protoconch malleated; spire flat, con- 
sisting of 2.25-3 rapidly growing convex 
whorls; last whorl large, dilated, descending 
to some extent near aperture; umbilicus wide; 
aperture prosocline, roundish; peristome 
complete, slightly sinuous at upper margin, 
slightly thickened, reflected especially at 
lower and columellar margin (Figs. 213, 287; 
Paladiihe, 1967: 51, pi. 21, figs. 27-30; Lo- 
card, 1889: 329; 1893: 127; Germain, 1913: 
323; 1 931 : 678; Boeters, 1 974: fig. 8). Dimen- 
sions: height = 0.48-0.68 mm; diameter = 
1.05-1.54 mm. 

Operculum slightly thickened, yellowish, 
paucispiral, thicker at centre of inner face, but 
without peg (Fig. 288; Boeters, 1974: 86). 

Body unpigmented; eye spots absent (Fig. 
289; Boeters, 1974: 86). 

Male genitalia with prostate gland bulging 
slightly into palliai cavity; penis rather long, 
conical, having short, wide basal portion with 
corrugated sides and longer, gradually taper- 
ing, apical portion ending in very pointed tip; 
penial duct zig-zagging through right portion 
of penis to open at penis tip (Fig. 290; 
Boeters, 1974: 83, fig. 3). 

Female genitalia with distal seminal recep- 
tacle and a bursa copulatrix arising from distal 
renal oviduct; seminal receptacle, club-like, 
small but proportionally rather developed, 
arising from oviduct very close to point of ori- 
gin of duct of bursa copulatrix; bursa copula- 
trix large, sac-like, oval to square in outline, 
with very long, slender duct entering bursa at 



lateroposterior side; seminal groove running 
along ventral side of capsule gland (Figs. 
292-294; Boeters, 1974: 83, fig. 4). Bursa 
copulatrix incorrectly depicted by Boeters 
(1974: fig. 4) as rather small with duct enter- 
ing on anterior side. 

Radula with central tooth trapezoidal with 
long lateral wings and basal tongue, its apical 
margin V-like with long, robust central denticle 
and 4-5 smaller denticles on both sides, in 
decreasing order of size; one basal cusp 
where each lateral wing arises from face of 
central tooth; lateral teeth rake-like, apically 
enlarged, their anterior margin with 9-10 den- 
ticles, central one longer, larger; first marginal 
teeth rake-shaped, with long lateral wing and 
elongated cutting edge with long row of 23-25 
small denticles anteriorly; second marginal 
teeth scraper-shaped, with long slender lat- 
eral wing and roundish, spoon-like apex, its 
cutting edge carrying rather long row of 1 8-20 
small denticles (Figs. 177-179). 

Stomach without posterior caecum; intes- 
tine with rather well-developed, U- or V-like 
bend on palliai wall (Figs. 291, 292; Boeters, 
1974:86, fig. 3). 

Osphradium oval or kidney-shaped; ctenid- 
ium consisting of 9-12 lamellae (Figs. 291, 
292; Boeters, 1974:86). 

Taxonomy 

Boeters (1974) assigned Valvata exilis to 
Horatia Bourguignat, 1887, which, at that 
time, was known to be characterized by: 
rather large bursa copulatrix and distal semi- 
nal receptacle (cf., Radoman, 1966; Rado- 
man, 1 973b). More recent anatomical study of 
Horatia revealed that the female genitalia not 
only have a bursa copulatrix and distal semi- 
nal receptacle, but also a proximal seminal re- 
ceptacle (Fig. 108; Radoman, 1983). Clearly, 
V. exilis does not belong to ¡Horatia, and our 
anatomical study of specimens collected near 
the type locality brought to light new data 
which supports the introduction of a new 
genus. 

Only one of the genera with valvatiform 
shells described so far is close to Heraultia, 
that is, Arganiella Giusti & Pezzoli, 1980 (see 
above). Arganiella is characterized by a penis 
lacking lobes and by female genitalia with a 
large bursa copulatrix and only the distal sem- 
inal receptacle. Our decision to introduce Her- 
aultia is prompted by the fact that Arganiella is 
clearly distinguished by: penis dilated subapi- 
cally and with shorter apical portion; bursa 



210 



BODÓN, MANGANELLI & GIUSTI 



copulatrix having a rather short duct entering 
on the anterior side: central tooth of radula 
with two basal cusps on each side. 

Heraultia exilis was reported from Spain by 
Alonso (1975). Vidal-Abarca & Suarez (1985) 
and Bech (1990). All these reports are based 
on shell material and are therefore unreliable. 



ACKNOWLEDGEMENTS 

We thank Antonella Daviddi and Leonardo 
Gamberucci for technical assistance, Helen 
Ampt for revising the English, Reno 
Bernasconi (Münchenbuchsee, Switzerland), 
H. Girardi (Montfavet, France), Martin Haase 
(Vienna. Austria), Wim J. M. Maassen (Duive- 
drecht, Holland), Giuseppe Lucio Pesce 
(L'Aquila, Italy), Pavie Radoman (Beograd, 
Serbia), Rajko Slapnik (Ljubljana, Slovenia), 
Fabio Stoch (Trieste, Italy) and France 
Velkovrh (Ljubljana, Slovenia) for information 
about or loan of material from their respective 
collections. Simone Cianfanelli (Florence, 
Italy), Karl Ediinger (Vienna, Austria), Anita 
Eschner (Vienna, Austria), and Elena Gavetti 
(Turin, Italy) for bibliographical research. 

Research partly financed by MURST (In- 
vertebrate fauna of soil and underground wa- 
ters of the Apennine and insular Italy) and 
University of Siena (The non marine molluscs 
of the Italian Fauna) grants. 



LITERATURE CITED 

ALONSO, M. R., 1975, Moluscos terrestres y dul- 
ceacuicoías de la depresión de Granada (Es- 
paña) y sus alrededores. Cuadernos de Ciencias 
Biológicas Universidad de Granada. 4:125-157. 

ANGELOV, Д., 1967, Horatia (Hauffenia) lucidula n. 
sp. ein neuer Vertreter der Molluskenfauna Bul- 
gariens. Archiv für Mollusl<enl<unde. 96: 145- 
148. 

ANT, H., 1962, Веглегкипдеп zum Genus Horatia. 
Archiv für t\/]olluskenkunde, 91 : 71 -76. 

ÁRGANO, R., G. L. PESCE & G. SILVERI, 1975, 
Pnnne osservazioni sul popolamento freático 
della conca aquilana (Abruzzo). Bollettino di Zo- 
ología, 42: 9-32. 

BECH, M., 1990, Fauna malacolögica de 
Catalunya. Molluscs terrestres i d'aigua doiça. 
Treballs Institució Catalana d'História Natural. 
12: 1-229. 

BERNASCONI, R., 1975, Les hydrobiides (mol- 
lusques gastéropodes) cavernicoles de Suisse et 
des régions limitrophes. V. Révision des Hauffe- 



nia Pollonera. Annales de Spéléologie, 30: 
303-311. 

BERNASCONI, R., 1977, Hauffenia (Neohoratia) 
minuta minuta, un mollusque gasteropode hydro- 
bidae des eaux souterraines du Jura Neu- 
chatelois. Cavernes. Suppl. 1 (La Chaux-de- 
Fonds): 27-32. 

BERNASCONI, R., 1984, Hydrobiides de France: 
Moitessieria. Bythiospeum et Hauffenia des dé- 
partements Gard, Ain, Isère (gastéropodes 
prosobranches). Revue Suisse de Zoologie. 91: 
203-215. 

BERNASCONI, R., 1985, Anatomie von Hauffenia 
minuta ssp. spirata Bernasconi 1975 und 
Beschreibung von Hauffenia minuta consolatio- 
nis n. spp. Heldia. 1 :63-65. 

BERNASCONI, R., 1988, Palacanthiliopsis vervierii 
n. gen. n. sp. et autres Hydrobiides (Mollusca, 
Prosobranchia) des eaux souterraines des 
Gorges de l'Ardéche (dpt Gard, France). Revue 
Suisse de Zoologie. 95: 289-295. 

BERTRAND, A., 1998, Notes sur la répartition des 
Hydrobiidae (Mollusca, Gastropoda, Proso- 
branchia) dans le Sud-Ouest de la France. Mé- 
moires de Biospéologie. 24: 209-216. 

BINDER, е., 1957, Note sur le genre Horatia Bour- 
guignat. Journal de Conchyliologie. 97: 59-62. 

BINDER, е., 1966, Position systématiques de Val- 
vata minuta Drap., Valvata globulina Palad. et 
d'autres petites espèces attribuées au genre Val- 
vata (Gastropoda, Prosobranchia). Atti della So- 
ciété Italiana di Scienze Naturali e del Museo 
Cívico di Storia Naturale dl Milano, 105: 
371-376. 

BODÓN, M. & S. CIANFANELLI, S., 1996, A new 
valvatoid-shelled stygobiont hydrobiid from 
Slovenia. Basteria. 60: 19-26. 

BODÓN, M., S. CIANFANELLI & E. TALENTI, 
1997, Idrobiidi freatici del hacino del F. Era in 
Toscana (Gastropoda: Prosobranchia: Hydrobi- 
idae). Bollettino Malacologico. in press. 

BODÓN, M. & M. M. GIOVANNELLI, 1993, Sulla 
presenza in Italia di Istriana mirnae Velkovrh, 
1971 (Prosobranchia: Hydrobiidae). Gortania, 
Atti del Museo Friulano di Storia Naturale. 14: 
195-206. 

BODÓN, M. & M. M. GIOVANNELLI, 1994, A new 
Hydrobiidae of the subterranean waters of Friuli 
(Gastropoda Prosbranchia). Basteria, 58: 
233-244. 

BODÓN, M. & F GIUSTI. 1986, A new valvatoid 
shelled hydrobiid from Liguria (Italy) (Gastro- 
poda: Prosobranchia). Archiv für Mollusken- 
kunde. 117: 61-71. 

BODÓN, M., G. MANGANELLI, F FAVILLI & F 
GIUSTI, 1995b, Prosobranchia Archaeogas- 
tropoda p.p. (Neritidae: generi 013-014): Proso- 
branchia Caenogastropoda Architaenioglossa 
(Cochlostomatidae, Aciculidae, Viviparidae: 
generi 060-065); Prosobranchia Caenogas- 
tropoda Neotaenioglossa p.p. (Thiaridae, 
Melanopsidae, Pomatiasidae. Bithyniidae. Hy- 
drobiidae, Pyrgulidae, Emmericiidae: generi 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



211 



070-071, 077, 095-126); Heterobranchia Het- 
erostropha p.p. (Valvatidae: genere 294). In: a. 
MiNELLi, s. RUFFO & S LA POSTA, eds.. Checklist 
delle specie della fauna d'ltalia, 14 (Gastropoda 
Prosobranchia, Heterobranchia): 60 pp. 

BODON, M., G. MANGANELLI, I. SPARACIO & R 
GIUSTI, 1995a, Two new species of the genus /s- 
lamia Radoman, 1973 from Italian islands 
(Prosobranchia, Hydrobiidae). Journal of Mollus- 
can Studies. 61: 43-54. 

BOETERS, H. D., 1973, Französische Rissoaceen- 
aufsammlungen von C. Bou. Annales de 
Spéléologie. 28: 63-67. 

BOETERS, H. D., 1974, Horatia Bourguignat, 
Plagigeveria Tomlin und Litthabitella Boeters. 
(Prosobranchia). Archiv für Molluskenkunde. 
104:85-92. 

BOETERS, H. D., 1979, Species concept of proso- 
branch freshwater molluscs in western Europe, I. 
Malacologia. 18: 57-60. 

BOETERS, H. D., 1981, Unbekannte westeu- 
ropäische Prosobranchia, 2. Archiv für Mol- 
luskenkunde, 111 : 55-61 . 

BOETERS, H. D., 1988, Westeuropäische 
Moitessieriidae, 2 und Westeuropäische Hydrobi- 
idae, 7. Moitessieriidae und Hydrobiidae in 
Spanien und Portugal (Gastropoda: Proso- 
branchia). Archiv für Molluskenkunde, 118: 
181-261. 

BOETERS, H. D. 1998, Mollusca: Gastropoda: Ris- 
sooidea. Süßwasserfauna von Mitteleuropa. 
5/1-2: 1-76. 

BOETERS, H. D., & E. ROLAN, 1988, Unknown 
west European prosobranchs, 9. Some new 
Spanish freshwater prosobranchs. Basteria. 52: 
197-202. 

BOLE, J., 1961, Nove Hidrobide (Gastropoda) iz 
podzemeljskih voda zahodnega balkana. Bi- 
oloski Vestnik. 9: 59-69. 

BOLE, J., 1963, О morfoloskih spremembah pri 
podzemeljskih polzih. Treci Jugosklavenski 
Speleoloski Kongress. Sarajevo: 121-124 [in 
Serbian with French summary]. 

BOLE, J., 1967a, Takonomska ekoloska in zoo- 
geografska problematika druzine Hydrobiidae 
(Gastropoda) iz porecja Ljubljanicve/Taxonomi- 
sche, ökologische und zoogeographische Prob- 
lematik der Familie Hydrobbidae (Gastropoda) 
aus dem Flussgebiet der Ljubijanica. Razprave. 
Slovenka Akademija Znanosti in Umetnosti 
Razred za Prirodoslovne in Medici nske Vede 
Oddeiek za Prirodoslovne Vede, 10: 73-108 [in 
Serbian with German summary]. 

BOLE, J., 1967b, Poizi iz freaticnik voda Jugoslav- 
ije/Die Schnecken asu den phreatischen 
Gewässern Jugoslawiens. Razprave. Slovenka 
Akademija Znanosti in Umetnosti Razred za 
prirodoslovne in Medicinske Vede Oddeiek za 
Prirodoslovne Vede, 10: 109-120 [in Serbian with 
German summary]. 

BOLE, J., 1970, Prispevek к poznavanju anatomije 
in taksonomije podzemeljskih Hidrobiid (Gas- 
tropoda, Prosobranchia)/Beitrag zur Kenntnis der 



Anatomie und Taxonomie der unterirdischen Hy- 
drobiiden (Gastropoda, Prosobranchia). Raz- 
prave. Slovenka Akademija Znanosti in Umet- 
nosti Razred za Prirodoslovne in Medicinske 
Vede Oddeiek za Prirodoslovne Vede, 13: 
85-111 [in Serbian with German summary]. 

BOLE, J., 1979, Malakoloske znacilnosti Planin- 
skega poija in okolice/Malacological characteris- 
tics of Planinsko polje (Slovenia, Yugoslavia). 
Varstvo Narave/Nature Conservation. 12: 33-44 
[in Serbian with English summary]. 

BOLE, J., 1992, Neue Arten der unterirdischen 
Schnecken Westbalkans/Nove vrste podze- 
meljskih polPev zahodnega Balkana. Razprave. 
Slovenka Akademija Znanosti in Umetnosti 
Razred za Prirodoslovne in Medicinske Vede 
Oddeiek za Prirodoslovne Vede, 33: 3-20. 

BOLE, J., 1993, Podzemeijski poIzi is druzine Hor- 
atiidae (Gastropoda, Prosobranchia) v Sloveniji 
in njihov taksonomski polozaj/Unterirdische 
Schnecken aus der Familie Horatiidae (Gas- 
tropoda, Prosobranchia) und ihre taxonomische 
Stellung. Razprave, Slovenka Akademija Zna- 
nosti in Umetnosti Razred za Prirodoslovne in 
Medicinske Vede Oddeiek za Prirodoslovne 
Vede. 34: 3-17 [in Serbian with English and Ger- 
man summaries]. 

BOLE J. & R. SLAPNIK, 1997, Molluscs (Gas- 
tropoda: Prosobranchia, Pulmonata; Bivalvia) of 
the Kocevje and Ribnica region (Slovenia)/ 
Mehkuzi (Gastropoda: Prosobranchia, Pulmo- 
nata; Bivalvia) Kocevsko ribniskega obmocja. 
Razprave IV. Razreda Sazu, 38: 137-163. 

BOLE, J. & F VELKOVRH, 1986, Mollusca from 
continental subterranean aquatic habitats. In: l. 
BOTOSANEANU, ed., Stygofauna mundi. A faunls- 
tic, distributional and ecological synthesis of the 
world fauna inhabiting subterreanean waters (in- 
cluding the marine interstitial): 177-208; Leiden. 

BOLE, J. & F VELKOVRH, 1987, Nove vrste 
podzemeljskih polzev Jugoslavije. Razprave, 
Slovenska Akademija Znanosti in Umetnosti 
Razred za Prirodoslovne in Medicinske Vede 
Oddeiek za Prirodoslovne Vede, 28: 69-83, Pis. 
1-3. 

BOUCHARD CHANTEREAUX, N. R., 1838, Cata- 
logue des mollusques terrestres et fluviátiles ob- 
servés jusqu'à ce jour à l'état vivant dans le de- 
partment du Pas-de-Calais. Mémoires de la 
Société d'Agricolture Sciences et Arts de 
Boulogne sur mer (II) 1: 141-230, 1 PI. 

BOUCHET, P, 1990, La malacofauna française: 
endemisme, patrimonie natural et protection. 
Revue d'Ecologie la Terre et la Vie, 45: 259-288. 

BOURGUIGNAT J. R., 1887, Étude sur les noms 
génériques des petites paludinidées a opercule 
spirescent suivie de la description du nouveau 
genre Horatia. Paris, 56 pp., 1 pi. 

BURCH, J. В., 1989, North American freshwater 
snails. Hamburg, Michigan, U.S.A., 365 pp. 

DAVIS, G. M. & W. P. CARNEY, 1973, Description 
of Oncomelania hupensis lindoensis, first inter- 
mediate host of Schistosoma japonicum in Su- 



212 



BODÓN, MANGANELLI & GIUSTI 



lawesi (Celebes). Proceedings of the Academy of 
Natural Sciences of Pfiiladelptiia. 1 25; 1-34. 

DAVIS, G. M., Y. H. GUO, K. E. HOAGLAND, P. L. 
CHEN, H. M. YANG & D. J. CHEN, 1985, Erfiaia. 
a new genus and new species of Pomatiopsidae 
from China (Gastropoda: Rissoacea). Proceed- 
ings of the Academy of Natural Sciences of 
Philadelphia. 137:48-78. 

DAVIS, G. M., M. MAZURKIEWICZ & M. MAN- 
DRACCHIA. 1982, Spum/zn/f/a.- morphology, sys- 
tematics, and ecology of a new genus of North 
American marshland Hydrobiidae (Mollusca: 
Gastropoda). Proceedings of the Academy of 
Natural Sciences of Philadelphia, 1 34: 1 43- 1 77. 

DHORA, DH. & W. WELTER-SCHULTES, 1996, 
List of species and atlas of the non-marine mol- 
luscs of Albania. Schriften zur Malakozoologie, 9: 
90-197. 

DRAPARNAUD, J. P. R., 1805, Histoire naturelle 
des mollusques terrestres et fluviátiles de la 
France. Montpellier et Paris, [+ 12] -i- viii -i- 164 [+ 
1] pp., 13 pis. 

DUPUY, D., 1851, Histoire naturelle des mol- 
lusques terrestres et d'eau douce qui vivent en 
France. 5: 459-594, pis. 22-24. 

FÉRUSSAC, J. B. L. DAUDEBARD DE, 1807, 
Essai d'une méthode conchyliologique appliquée 
aux mollusques terrestres et fluviátiles . . . Nou- 
velle édition augmentée d'une synonymie . . . 
d'une table de concordance systématiques . . . 
et terminée par un catalogue d'espèces ob- 
servées en divers lieux de la France, par J. 
Daudebard fils. Paris, xvi -i- 142 pp. 

GASSIES, J. В., 1849, Tableau méthodique et de- 
scriptif des mollusques terrestres et d'eau duoce 
de l'Agenais. Paris, 209 pp., 4 Pis. 

GASSIES, J. В., 1859, Catalogue raisonné des 
Mollusques terrestres et d'eau douce de la 
Gironde. Actes de la Société Linnéenne de Bor- 
deaux. 22: 233-306. 

GASULL, L., 1981, Fauna malacologica terrestre y 
de agua dulce de la provincia de Castellón de la 
Plana. Boletín de la Sociedad de Historia Natural 
de Baleares. 25: 55-102. 

GERMAIN, L., 1913, Mollusques de la France et 
des régions voisines. Tome deuxième. Gastéro- 
podes pulmones et prosobranches terrestres et 
fluviátiles. Paris, 374 pp. 

GERMAIN, L., 1931, Mollusques terrestres et fluvi- 
átiles. Deuxième partie. Faune de France, 22: 
478-897 -^■ ix-xiv, pis. 14-26. 

GITTENBERGER, E., 1982, Eine neue Horatia Añ 
aus Griechenland (Prosobranchia, Hydrobiidae). 
Basteria. 46: 68. 

GIUSTI, F. & E. PEZZOLI, 1980, Gasteropodi 2. 
(Gastropoda: Prosobranchia: Hydrobioidea, Pyr- 
guloidea). Consiglio Nazionale delle Ricerche. 
Collana del Progetto Finalizzato "Promozione 
della Qualita dell' Ambiente". Pubblicazione AQ/1/ 
47. Guide per il Ricoscimento delle Specie Ani- 
man delle Acque Interne Italiane, 8: 67 pp. 

GIUSTI, F. & E. PEZZOLI, 1981, Notulae mala- 
cologicae XXV. Hydrobioidea nuove о poco 



conosclute deintalia appenninica. Archiv für Mol- 
luskenkunde. 111: 207-222. 

GIUSTI, F. & E. PEZZOLI, 1982, Molluschi caverni- 
coli italiani (Notulae Malacologicae, XXVII). La- 
voh della Société Italiana di Biogeografia (N.S.), 
7:431-450. 

GIUSTI, F., E. PEZZOLI & M. BODON, 1981, Notu- 
lae Malacologicae, XXVIII. Primo contributo alla 
revisione del genere Islamia (Radoman, 1973) in 
Italia. Lavori della Società Malacologica Italiana 
{Atti del U' Convegno. Salice Terme, Pavía, 
9-11.5.1981): 49-71, 7 pis. 

GIUSTI, F. & M. G. SELMI, 1985, The seminal re- 
ceptacle and sperm storage in Cochlostoma 
montanum (Issel) (Gastropoda: Prosobranchia), 
Journal of Morphology 184: 121-133. 

HAASE, M., 1992, A new, stygobiont, valvatiform, 
hydrobiid gastropod from Austria (Caenogas- 
tropoda: Hydrobiidae). Journal of Molluscan 
Studies. 58: 207-214. 

HAASE, M., 1993, Hauftenia /(ersc/iner/ (Zimmer- 
mann 1 930): zwei Arten zweier Gattungen. Archiv 
für Molluskenkunde. 1 1 1 : 55-61 . 

HADZISCE, S., 1956, II. Beitrag zur Kenntnis der 
Gastropodenfauna des Ohridsees. Archiv für Hy- 
drobiologie, 51: 496-499. 

HADZISCE, S., 1959 ("1956"), III. Beitrag zur Kenn- 
tnis der Gastropodenfauna des Ohridsees. 
Beschreibungen des bis jetzt unbekannten 
Schnecken und Beispiele der Speciation bei den 
Gastropoden des Ohridsees. Zbornikna Rabotitei 
Hidrobioloski Zavod Ohrid [Recueil des Travaux, 
Station Hydrobiologique, Ohrid], 4: 57-107. 

HADZISCE, S., С M. PATTERSON, J. В. BURCH & 
P. T. LOVERDE, 1976, The embrionic shell sur- 
face sculpture of Gocea and Valvata. Malacolog- 
ical Review, 9: 1-14. 

HAUFFEN, H., 1856, Zwei neue Höhlenschnecken. 
Verhandlungen der Kaiserlichen Zoologisch- 
botanischen Gesellschaft in Wien. 6: 465-466. 

HERSHLER, R. & G. LONGLEY 1986, Phreatic hy- 
drobiids (Gastropoda: Prosobranchia) from the 
Edwards (Balcones Fault Zone) aquifer region, 
South-Central Texas. Malacologia, 27: 127-172. 

HERSHLER, R. & W. F. PONDER, 1998, A review 
of morphological characters of hydrobioid snails. 
Smithsonian Contributions to Zoology, 600: 
1-55. 

HERSHLER, R. & F. G. THOMPSON, 1988, Notes 
on morphology of Amnícola limosa (Say, 1817) 
(Gastropoda: Hydrobiidae) with comments on 
status of the subfamily Amnicolinae. Malacologi- 
cal Review, 2^: 81-92. 

HERSHLER, R. & F. G. THOMPSON, 1992, A re- 
view of the aquatic gastropod subfamily 
Cochliopinae (Prosobranchia: Hydrobiidae). 
Malacological Review, Supplement 5: 1-140. 

HINZ, W., H. D. BOETERS, & A. GÜNTER, 1994, 
Zur Süßwassermolluskenfauna in der spani- 
schen Provinz Cuenca. Malakologische Abhand- 
lungen. 17: 65-82. 

INTERNATIONAL COMMISSION ON ZOOLOGI- 
CAL NOMENCLATURE [ICZN], 1999, Interna- 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



213 



tional Code on Zoological Nomenclature. Fourth 
edition adopted by the International Union of Bio- 
logical Sciences. The International Trust for Zoo- 
logical Nomenclature, London, XXIX + 306 pp. 

JOVANOVIC, В., 1991, Katalog Zbirke Hydro- 
bioidea Pavia Radomana [Catalogue of the Hy- 
drobioidea collection of Pavie Radoman]. Glasnik 
Prirodnjackog Muzeja и Beogradu. (B) 46: 
207-273, pis. 1-11 [in Serbian]. 

KABAT, A. & R. HERSHLER, 1993, The proso- 
branch snail family Hydrobiidae (Gastropoda: 
Rissooidea): review of classification and 
supraspecific taxa. Smithsonian Contributions to 
Zoology, 547: iii + 94 pp. 

KUSCER, L., 1928, Drei neue Höhlenschnecken. 
Glasnik Muzeiskega Drustvaza Slovenyo. 7-8: 
50^51. 

KUSCER, L., 1932, Höhlen- und Quellenschecken 
aus dem Flussgebiet der Ljubijanica. Archiv für 
Molluskenkunde. 64: 48-62. 

KUSCER, L., 1933a, Prispevek к poznavanju 
podzemskih gastropodev Dalmacije in Herzé- 
govine. Prirodoslovna Istrazivanja Kraljevine Ju- 
goslavije, Zagrebu, 18: 59-67, 1 PI. [in Serbian]. 

KUSCER, L., 1933b, Beitrag zur Kenntnis subter- 
raner Schnecken Dalmatiens und der Herzegow- 
ina. Bulletin International de l'Academie Yougo- 
slave des Sciences et des Beaux-Arts de Zagreb, 
Classes des Sciences Mathématiques et Na- 
turelles, 26: 137-142, 1 PI. [A condensed Ger- 
man translation of Kuscer (1993a)]. 

LETOURNEUX, A., 1869, Catalogue des Mol- 
lusques terrestres et fluviátiles recueillis dans le 
département de la Vendée, et particulièrement 
dans l'arrondissement de Fontenay-le-Comte. 
Revue et Magazin de Zoologie Pure at Appliquée, 
(11)21: 49-64, 105-109, 145-148, 193-203. 

LOCARD, A., 1889, Contributions à la faune mala- 
cologique française XV. Monographie des es- 
pèces françaises appartenent au genre Valvata. 
Annales de la Société Linneenne de Lyon, (No. 
S) 35: 285-342, 1 table out of the text. 

LOCARD, A., 1893, Les coquilles des eaux douces 
et saumatres de France. Description des fami- 
lles, genres et espèces. Paris, 327 pp. 

LOCARD, A., 1895, Ipsa Draparnaudi Conchylia. 
Etudes critiques sur la collection conchyliolo- 
gique de Draparnaud, au Musée Royal et Impér- 
ial d'Histoire Naturelle de Vienne. 190 pp., Paris. 
Also published in 1897, in Annales de la Société 
dAgriculture, Sciences et Industrie de Lyon, 4: 
5-190. 

MAASSEN, W. J. M., 1975, Holenslakken uit 
Joegoslavie. De Kreukel, 11: 129-130, pis. 26- 
27. 

MAASSEN, W. J. M., 1978, Joegoeslavische Mol- 
lusken: zoetwatersiakjes uit brennen en grotten. 
De Kreukel, 14: 85-88, pis. 24-27. 

MAASSEN, W. J. M., 1 980, De Zoetwatermollusken 
van het Ohrid/en Prespameer en hun Omgeving. 
De Kreukel, 16: 81-98, pis. 15-18. 

MANGANELLI, G., M. BODON. S. CIANFANELLI, 
E. TALENTI & F GIUSTI, 1998, New hydrobiids 



from subterranean waters of eastern Sardinia, 
Italy (Gastropoda: Prosobranchia: Hydrobiidae). 
Basteria, 62: 43-67. 

MÖLLENDORFF О., von, 1873, Beiträge zur 
Fauna Bosniens, Görlitz, 73 pp. 

MOQUIN TANDON, A., 1855-1856, Histoire na- 
turelle des mollusques terrestres et fluviátiles de 
France, contenant des études générales sur leur 
anatomie et leur physiologie et la description par- 
ticulière des genres, des especies et des varietés. 
Paris. Published in six parts: 1(1) [12.5.1855]- 
1(2) [4.5.1855]: i-viii, 1-256 pp., 1(3) [1.8.1855]: 
257-416 pp.. Pis. 1-9: 2(4) [10.9.1855]-2(5) 
[2.1.1856]: 1-368, 2(6) [9.4.1856]: 369-646; 
Atlas: 1-92, 1 -54 Pis. [1856]. 

PALADILHE, A., 1866, [Nouvelles miscellanées 
malacologiques] II. Espèces inédites, nouvelles 
ou peu connues du département de l'Hérault. 
Revue et Magazin de Zoologie Pure at Ap- 
pliquée, (11)18: 54-63, 89-99, 168, 174, pi. 13. 
[Also as: A. PALADILHE, Nouvelles miscellanées 
malacologiques, 2: 5-31, pi. 1; Paris]. 

PALADILHE, A., 1867, Espèces inédites, nouvelles 
ou peu connues du département de l'Hérault. 
Revue et Magazin de Zoologie Pure at Appliquée, 
(11)19: 38-53, PI. 21 [Also as: A. PALADILHE, 
Nouvelles miscellanées malacologiques, 4:39- 
53, pl. 3; Paris]. 

PESCE, L. G. & G. FUSACCHIA, 1975, Indagini 
preliminari sul popolamento freático délia conca 
reatina. Rivista di Idrobiologia, 12: 47-69. 

PESCE, L. G. & D. MAGGI, 1983, Ricerche faunis- 
tiche in acque sotterranee freatiche délia Grecia 
méridionale ed insulare e stato attuale délie 
conoscenze sulla stigofauna di Grecia. Atti délia 
Società Italiana di Scienze Naturali e del Museo 
Cívico di Storia Naturale di Milano, 74: 1 5-78. 

PESCE, L. G. & G. SILVERN, 1976, Nuove stazioni 
ipogee freatiche per l'ltalia centrale (versante 
adriatico abruzzese). Memorie dello Speleo 
Club-Chieti. 3: 3-36. 

PESCE, L. G., D. MAGGI, A. CIOCCA & R. 
ÁRGANO, 1979, Biological researches on the 
subterraneuous phreatic waters of northern 
Greece. In: 1r Symposium International sur la 
Zoogeographie et l'Ecologie de la Grèce et des 
Regions Avoisinanthes, Athènes, Avril 1978. Bi- 
ología Gallo -Hellenica, 8: 109-126. 

PEZZOLI, E., 1988a, I molluschi crenobionti e 
stigobionti presentí nell'ltalia Settentrionale 
(Emilia Romagna compresa). Censimento délie 
stazioni ad oggi segnalate. Museo Cívico di 
Scienze Natural di Brescia, Monografie di 
"Natura В resolana", 9: 151 pp. 

PEZZOLI, е., 1988b, I molluschi crenobionti e 
stigobionti presentí in Italia. Censimento delle 
stazioni: seconde aggiornamento per il settentri- 
one e proseguimento per l'ltalia appenninica: 
IX — regione Toscana; X — regioni Marche ed 
Umbría. Quaderni della Cívica Stazione Idrobio- 
logica di Milano. 1 5: 65- 1 03. 

PEZZOLI, E., 1989, Molluschi crenobionti e stigob- 
ionti presentí in Italia. Censimento delle stazioni: 



214 



BODÓN, MANGANELLI & GIUSTI 



terzo aggiornamento. Quaderni della Cívica 
Stazione Idrobiologica di Milano. 16: 43-69. 

PEZZOLI, E.. 1996 — 1 molluschi crenobionti e 
stigobionti presentí in Italia. Censimento delle 
stazioní. Sesto aggiornamento. Quaderni della 
Civics Stazione Idrobiologica di Milano. 21: 63- 
102. 

PEZZOLI, [E.], [G.] FAGOTTO & [M.] PAOLETTI. 
1975, Fauna malacologica delle sorgenti e delle 
acque sotterranee (ipogee, freatiche) della val- 
lata trevigiana e zone limitrofe (Montello, Can- 
siglio, e F Livenza)-Nota Preliminare. Atti del 5^^ 
Convegno sulla Storia Naturale delle Preaipi 
Venete. Lago (TV). 8-9.9.1975: 123-165. 

POLINSKI, W., 1929, Limnoloska Ispitivanjia Balka- 
nskog. I. Relitktna Fauna Gasteropoda Ochnd- 
skog Jezera/La Faune reliquaire des gastéro- 
podes du lac d'Ochrida. Glas Srpska Kral'eveske 
Akademije, Beograd. Pn/i Razred. 137: 129-178. 
[in Serbian]. 

POLINSKI, W., 1932, Die reliktäre Gastropoden- 
fauna des Ochrida-Sees. Zoologische Jahr- 
bücher Abteilung für Systematik, Ökologie und 
Geographie der Tiere. 65: 611-666, Pis. 7-8. 

POLLONERA, C, 1898, Intorno ad aicune 
conchiglie del Friuli. Bollettino dei Musei di Zo- 
ología ed Anatomía connparata della Reale Uni- 
versita di Torino, 13(334): 4 pp. 

PONDER, W. F., 1988a, The truncatelloidean (= ris- 
soacean) radiation — a preliminar phylogeny. In: 
w. F. ponder: ed., Prosobranch Phylogeny. Mala- 
cological Review. Supplement, 4: 129-166. 

PONDER, W. F., 1988b, Potamopyrgus antipo- 
darum—A molluscan coloniser of Europe and 
Australia. Journal of Molluscanan Studies, 54: 
271-285. 

RADOMAN, P., 1953, Deux représentants nou- 
veaux du gastéropode Horatia Bourguignat dans 
le lac D'Ohrid. Zbornik na Rabotitei Hidrobioloski 
Zavod Ohrid [Recueil des Travaux, Station Hy- 
drobiologique, Oh rid], 1: 63-71. 

RADOMAN, P., 1955, Morfolosko-sistematska is- 
trazivanjia ohridskih hidrobida/Recherches mor- 
phologiques et systématiques sur les hydrobiides 
du Lac d'Ohrid. Spsko Biolosko Drustvo Pozebna 
Izdanjia/Société Serbe de Biologie, Éditions Spé- 
ciales, 1 : 1 - 1 06, pis. 1 -6 [in Serbian with French 
summary]. 

RADOMAN, P., 1957 ("1956"), Nove Ohndske Ну- 
drobiide [Nouvelles hydrobiides du Lac d'Ohrid]. 
Arhiv Bioloskih Nauka, Srpsko Biolosko Drustvo. 
Beograd, 8: 87-92 [in Serbian with French sum- 
mary]. 

RADOMAN, P., 1963a ("1962"), Nove Ohridske Hy- 
drobide (II) [New Ohrid hidrobids (II)]. Arhiv Bi- 
oloskih Nauka, Srpsko Biolosko Drustvo, 
Beograd. 14: 69-93 [in Serbian with English 
summary]. 

RADOMAN, P., 1963b, Some new Hydrobidae of 
Lake Ohrid (Ohridsko Jezero). Part 2. Archiv of 
Biological Sciences. The Serbian Biological Soci- 
ety, 14: 85-112 [An English translation of Rado- 
man (1963a)]. 



RADOMAN, P., 1964, Nove Ohndske Hydrobide 
(III) [New Ohnd hydrobids (III)]. Arhiv Bioloskih 
Nauka, Srpsko Biolosko Drustvo. Beograd. 15: 
101-109, 1 table [in Serbian with English sum- 
mary]. 

RADOMAN, P., 1965, Speciation der Gattung Ho- 
ratia im Flusstal der Cetina. Archiv für Mollus- 
kenkunde. 94: 139-146. 

RADOMAN. P., 1966, Die Gattung Pseudamnicola 
und Horatia. Archiv für Molluskenkunde. 95: 243- 
253. 

RADOMAN, P., 1967, Revision der Systematik 
einiger Hydrobiiden-Arten aus dem Ohrid-See. 
Archiv für Molluskenkunde. 96: 149-154. 

RADOMAN, P., 1973a, New Classification of fresh 
and brackish water Prosobranchia from the 
Balkans and Asia Minor. Pnrodnjacki Muzej 
Beogradu Posebna Izdanja, 32: 1 -30. 

RADOMAN, P., 1973b, Contribution a la connais- 
sance des gastéropodes des eaux douces de 
Bosnie et d'Herzégovine. Bulletin du Muséum 
d'Histoire Naturelle de Marseille, 33: 227-237. 

RADOMAN, P., 1974, Ein Beitrag zur Kenntnis der 
Höhlenfauna Bosniens. Archiv für Mollusken- 
kunde, 104:81-84. 

RADOMAN, F., 1978, Neue Vertreter der Gruppe 
Hydrobioidea von der Balkanhalbinsel. Archiv für 
Molluskenkunde, 109: 27-44. 

RADOMAN. P., 1979 ("1978"), Nov rod Pseudois- 
lamia i novi predstavnici rodova Islamia i Paraby- 
thinellaJA new genus Pseudoislamia, and new 
representatives of the genera Islamia and 
Parabythinella. Glasnik Prirodnjackog Muzeja и 
Beograd/ Bulletin du Muséum d'Histoire Na- 
turelle, Belgrade, (В) 33: 23-27 [in Serbian with 
English summary]. 

RADOMAN, P., 1983, Hydrobioidea a superfamily 
of Prosobranchia. I Sistematics. Serbian Acad- 
emy of Sciences and Arts, Monographs Depart- 
ment of Sciences. 57: 256 pp. 

RAMOS, M. A,, E. ROLAN & D. MORENO, 1992, 
New data on the genus Horatia (Prosobranchia, 
Hydrobioidea) in the Iberian Peninsula. In: F. 
GIUSTI & G. MANGANELLI, eds.. Abstracts of the 
Eleventh International Malacological Congress, 
Siena, Italy 1992: 482-485. 

REISCHÜTZ, P. L., 1984, Zur Kenntnis von Horatia 
(Daphniola) exigua (A. Schmidt, 1856) (Gas- 
tropoda, Prosobranchia, Hydrobioidea). Malakol- 
ogische Abhandlungen. 10: 17-18. 

REISCHÜTZ, P. L., 1988, Beitrag zur Mollusken- 
fauna Trakiens und Ostmakedoniens, II. Annales 
des Naturhistorischen Museums in Wien. Serie 
B-Botanik und Zoologie. 90/B: 341 -356. 

REISCHÜTZ, P. L., & H. SATTMANN, 1993, 
Beiträge zur Nomenklatur der europäischen Bin- 
nenmollusken, V. Die Taxa der Hydrobioidea 
des griechischen Festlands mit valvatoidem 
Gehäuse und Festlegung eines Lectotypus von 
Valvata {Cincinna) hellenica Westerlund 1898 
(gastropoda: Prosobranchia). Heidia, 2: 51-52, 
PI. 8a. 
RIPERT, M., 1998, Contribution à l'écologie d'Hy- 



REVISION OF EUROPEAN VALVATIFORM HYDROBIIDS 



215 



drobiidae (Mollusca, Gastropoda, Proso- 
branchia) souterrain dans le sud de la France. 
D.E. A. Adaptations et survie en environnements 
extrêmes. Université de Lyon l-Marseille II et 
Saint-Etienne, 28 pp. 

ROLAN, е., 1997a, Especies en riesgo — medio 
dulceacuícola. Noticiario de la Sociedad Es- 
pañola de Malacologia. 27: 31 -32. 

ROLAN, E., 1997b, Habitats en riesgo — medio dul- 
ceauícola. Noticiario de la Sociedad Española de 
Malacologia, 27: 32. 

SCHMIDT, A., 1856, Verzeichniss der Binnenmol- 
lüsken Norddeutschlands mit kritischen Be- 
merkungen. Zeitschriñ für die Gesamte Naturwis- 
senschaften, 8: 120-388. 

SCHUTT, H., 1961a, Das Genus Horatia Bourguig- 
nat. Archiv für Molluskenkunde, 90: 69-77. 

SCHUTT, H., 1961b, Weitere neue Süßwasser- 
Höhlenschnecken aus Dalmatien. Archiv für Mol- 
luskenkunde. 90: 139-144. 

SCHUTT, H., 1962, Neue Süsswasser-Proso- 
branchier Griechenland. Archiv für Mollusken- 
kunde, 9^■. 157-166. 

SCHUTT, H., 1980, Zur Kenntnis griechischer Hy- 
drobiiden. Archiv für Molluskenkunde, 110: 115- 
149. 

SCHUTT, H., 1 991 , A contribution to the knowledge 
of some inland water hydrobiid snails in Israel 
(Gastropoda, Prosobranchia). Basteria, 55: 129- 
137. 

STAMMER, H. J., 1 932, Die Fauna des Timavo. Fin 
Beitrag zur Kenntnis der Höhlengewässer, des 
süss- und Brackwasser im Karst. Zoologische 
Jahrbücher Abteilung für Systematik, Ökologie 
und Geographie der Tiere. 63: 521 -656. 



SWOFFORD, D. L., 1997, PAUP': phylogenetic 
analysis using parsimony, version 4.0. Sinauer, 
Sunderland, Massachusetts. 

THOMPSON. T E. & A. BEBBINGTON, A., 1969, 
Structure and function of the reproductive organs 
of three species of Aplysia (Gastropoda: Opistho- 
branchia). Malacologia, 7: 347-380. 

VELKOVRH, F, 1 970, Dve novi podzemeljski Hidro- 
biidi (Gastropoda). Bioloski Vestnik, 18: 97-106. 

VIDAL-ABARCA, С. & M. L. SUAREZ, 1985, Lista 
faunistica y bibliográfica de los moluscos (Gas- 
tropoda & Bivalvia) de las aguas continentales de 
la Península Ibérica e Islas Baleares. Asociación 
Española de Limnología, Publication, N. 2, 193 
pp. 

WALKER, В., 1918, А synopsis of the classification 
of the fresh-water Mollusca of North America, 
North of Mexico, and a catalogue of the more re- 
cently described species, with notes, Part I: syn- 
opsis. University of Michigan, Museum of Com- 
parative Zoology, Miscellaneous Publication, 6: 
1-213. 

WILLMANN, R. & H. PIEPER, 1978, Gastropoda. 
In: J. ILLIES, [ed.], Limnofauna Europaea, 
Stuttgart, New York, Amsterdam: 118-134. 

WESTERLUND, С A., 1898, Novum Specilegium 
Malacologicum. Annuaire du Musée Zoologique 
de I Académie Impériale des Sciences de St.- 
Pétersbourg, 3: 155-183. 

ZIMMERMANN, S., 1930, Horatia erythropoma- 
tiana kerschneri n. subsp. Archiv für Mollusken- 
kunde, 62: 233-234, pi. 13. 

Revised ms. accepted 29 July 2000 



MALACOLOGIA, 2001, 43(1-2): 217-222 

IMMUNOLOGICAL DETECTION OF A CK2 ACTIVITY IN TAPES 
SEMIDECUSSATUS (MOLLUSCA, BIVALVIA) MANTLE 

L. Mercado\ E. Itarte^, S. Marshall & G. Arenas^'^ 



ABSTRACT 

Casein kinase 2 (CK2) is a highly conserved enzyme present in a wide range of eukaryotes, 
including yeasts, invertebrates and mammals. This kinase is involved in a number of key regu- 
latory cellular processes. We describe a CK2-like protein in mantle tissue of Tapes semidecus- 
satus, a highly active organ responsible for cell healing and regeneration in this clam species. 
After subcellular fractionation of crude homogenized mantles, the putative enzymatic activity was 
clearly enriched after two-step cromatography partial purification. Furthermore, using a poly- 
clonal antibody elicited against the known subunits of the mammalian enzyme. Western blot 
analysis confirmed the presence of three reactive polypeptides. Two of these perfectly matched 
the expected molecular weights of the catalytic a (42 kDa) and a' (38 kDa) subunits of the ref- 
erence enzyme. Considering our research interest is centered on the relationship between ma- 
rine organisms and their environment, our preliminary work on a CK2-like kinase in clams offers 
a potential model system to study protein phosphorylation in molluscs as an indicator of the ef- 
fect of environment factors over selected physiological responses. 

Key words: CK2, kinase activity, biochemistry mollusc, bivalve mollusc, clams, mantle, im- 
munodetection. 



INTRODUCTION 

The study of protein phosphorylation, one 
of the most relevant covalent modification of 
proteins, has demonstrated the existence of 
networks of protein kinases involved in the 
regulation of cellular processes related to me- 
tabolism, gene expression and cell growth. 
(Hunter & Cooper 1985; Krebs, 1994). One 
component of the network is CK2, also known 
as casein kinase 2, a pleiotropic and highly 
conserved serine/threonine kinase described 
both in the nucleus and the cytosol of both 
vertebrates (Tuteja & Tuteja, 1998; Chevet et 
al., 1999; Guo et al., 1999) and invertebrates 
(Hu & Rubins, 1991; Jaffe et al., 1997; Co- 
queret et al., 1998). The enzyme is also re- 
quired for viability as well as for cell cycle pro- 
gression (Pinna & Meggio, 1997; Guerra & 
Issinger, 1999). The prototype enzyme is 
composed of 4 subunits: 2 catalytic ones, a 



and a' of 42-44 kDa and 38 kDa respectively, 
and two identical ß regulatory subunits of 28 
kDa each (Allende & Allende, 1995). In vivo 
CK2 exists as a tetrameric holoenzyme com- 
posed of either ajßg, aa'^^ or a'^^^ (Chester 
etal., 1995; Gietz et al., 1995). 

A number of cytosolic and nuclear sub- 
strates of CK2 has been described in rat he- 
patocytes, a classical model, due to their re- 
generative capacity (Pinna, 1990; Issinger, 
1993; Pancetti et al., 1996; Prowald et al., 
1997; Roher et al., 1998; Miro et al., 1999). 

In this report we describe the activity of a 
CK2-like protein in a novel invertebrate sys- 
tem, the bivalve mollusc Tapes semidecussa- 
tus (Mediterranean clam). Moreover, the fact 
that the enzymatic activity is recognized by 
polyclonal antibodies against mammalian en- 
zyme subunits, strongly suggests a potential 
equivalent role of the enzyme in marine inver- 
tebrates. 



Laboratorio de Fisiología Celular, Instituto de Biología, Facultad de Ciencias Básicas y Matemáticas, Universidad Católica 
de Valparaíso, Chile. 

Departannento de Bioquímica y Biología Molecular, Facultad de Ciencias, Universidad Autónoma de Barcelona, Spain. 

Laboratorio de Genética y Inmunología Molecular, Instituto de Biología, Facultad de Ciencias Básicas y Matemáticas, Uni- 
versidad Católica de Valparaíso, Chile. 

To whom correspondence: Laboratorio de Genética e Inmunología Molecular, Instituto de Biología, Universidad Católica 
de Valparaíso, Av. Brasil 2950, Casilla 4059, Valparíso, Chile; garenas@ucv.cl 



217 



218 



MERCADO ETAL 



MATERIALAND METHODS 
Tissue Preparation 

Twenty-five adult T. semidecussatus speci- 
mens were collected from the delta of the 
Ebro river, Mediterranean Sea, Tarragona, 
Spain. The individuals were dissected in the 
laboratory, with a yield of 35 g of whole man- 
tles and kept under liquid nitrogen. The frozen 
material was homogenized in 100 ml of buffer 
A (50 mM Tris/HCI ph 7.4. 5% v/v glycerol, 1 
mM DTT, 2 mM PMSF, 1 mg/ml aprotinin) 
using a steel mortar. The resulting ho- 
mogenate was submitted to serial centrifuga- 
tion steps, always recovering the supernatant: 
800 X g (20 min), 19,000 x g (30 min) and 
100,000 X g (75 min). The final soluble frac- 
tion, defined as S-100, contained 1.65 g of 
protein and was the source for enzyme en- 
richment. 

Partial Purification of CK2-like Protein 

To identify the enzyme activity, the whole S- 
100 was loaded into a Whatman P11 phos- 
phocellulose column (3 x 1 .5 cm) equilibrated 
with buffer A at 4°C, to a flow rate of 0.5 
ml/min. The column was washed with 40 ml of 
the same buffer at the same flow rate and the 
adsorbed proteins were eluted through a 
saline gradient between 0.0 and 1 .2 M NaCI in 
buffer A, into 45 individual 0.5 ml fractions. 
The mean 280 nm absorbance value was de- 
termined for each fraction to standarize the 
first CK2 enzymatic assay. Fractions display- 
ing enzymatic activity were dialized overnight 
against 1 /1 000 buffer A at 4"C. 

In order to enrich the enzymatic activity, a 
second step purification was done using a 
DEAE-Sepharose column (Sigma, DCL-6B- 
100) packed into 2 ml and equilibrated with 20 
ml of buffer A. The dialysed material was ap- 
plied to the column and eluted at a flow rate of 
0.5 ml/min, through a saline gradient between 
0.15 and 1.2 M Nad in buffer A. Absorbance 
values at 280 nm as well as CK2 activity were 
determined. To further increase specific activ- 
ity of the resulting positive fractions, they were 
pooled, dialysed and concentrated into a 300 
ul DEAE column, eluted at a one-step con- 
centration of 1.2 M NaCI in buffer A. 

Enzymatic Activity Assay 

CK2 activity was assayed measuring the in- 
corporation of ^^P from [""^^P] GTP into ß-ca- 
sein as substrate (Martos et al. 1985). The re- 



action mixture contained 10 \.i\ ß-casein (10 
mg/ml), 15 \.i\ of the test reagent and 5 \.i\ of 
sample. The test reagent contained 2.085 
pmol GT t'^^^lp 8 mM EGTA, 0,2 M MgCl2 and 
5 mM ATP/GTP in buffer В (19 mM DTT Ю 
mM EDTA, 500 mM ß-glycerolphosphate) pH 
7.0. The mixture was incubated for 15 min at 
30°C, chilled and spotted onto p81 phospho- 
cellulose paper squares, fixed with ice-cold 
10% TCA, and the radioactivity incorporated 
measured in a liquid scintillation counter. The 
activity of CK2 was expressed in mU/ml: one 
milliunit corresponds to the incorporation of 1 
pmol of I'^^^lp from GTP onto ß-casein (Plana 
etal., 1994). 

Protein Analysis and Immunodetection 

Protein concentration was determined by 
serial dilutions of samples assayed by the 
method of Bradford (1976) using bovine 
serum albumin as a standard. Polypeptide 
profiles of S-100, P11 and DEAE fractions 
were resolved by 10% SDS-PAGE (Laemmli, 
1970) and stained with Coomassie brilliant 
blue. 

The enriched DEAE-peak fraction, resolved 
in a 10% SDS-PAGE, was electrotransferred 
onto Immobilon-P membranes (Towbin et al., 
1979) for immunotesting using specific anti- 
bodies. Non-specific sites were blocked with 
3.0% non-fat milk. The primary antibody, anti- 
rat liver CK2 antibody already purified by im- 
munoaffinity chromatography (Krehan et al., 
1996), was a generous gift from Dr. P. Lorenz 
(Biochemische Zellphysiologie, Deutsches 
Krebsforschungszentrum DKFZ, Heidelberg, 
Germany). The mixture, a polyclonal antibody 
against a, о.', and ß subunits was used at 
1 :4,000 dilution for one hour at room temper- 
ature with gentle agitation. The secondary an- 
tibody, goat anti-rabbit-IgG alkaline phos- 
phatase conjugated IgG, was used at 1 :3,000 
dilution for one hour at room temperature. The 
membrane was developed using the commer- 
cial enzyme substrate, BCIP (5-bromo-4- 
chloro-3-indolyl phosphate) and NBT (nitro- 
blue tetrazolium) (BIORAD). The rat liver 
enzyme was used as a positive control. 



RESULTS 

An S-100 extract from clam mantle tissue 
was the source to identify CK2 like activity 
after serial P11 and DEAE-cellulose column 
chromatography. Polypeptide enrichment 
after each step was confirmed using poly- 



CK2-LIKE ACTIVITY IN CLAMS 

kDa 1 2 3 



219 




FIG. 1. 10% SDS-PAGE characterization of polypeptides resulting after sequential partial purification of a 
CK2-like enzyme from mantle crude extracts. Coomassie blue-stained profiles for identical protein concen- 
tration (30 ng) of 3 different purification steps: (1) S-100 fraction, (2) Post P-11 pool, (3) Post DEAE- 
Sepharose pool. 



300 г 



^ 


250 


E 








Э 




E 


200 


^ 








> 










150 


< 




2 




и 


100 



+ 



50 - 



A 

1 


I 


: ¡J 




V 




// 


\ \ 


- ^ 


\ 


^-t^ r— 


e-^4f_^ 



2 e 

a 
о 

Ж) 
fS 

< 



— 1 



20 24 28 32 36 

Fraction Number 



40 



FIG. 2. Elution profile of S-100 from clam mantles on Phosphocellulose P 11 column chromatography CK2 
referential activity in mU/ml across and the comparative protein concentration of each fraction as detected 
at 280 nm. 



acrylamide gel electrophoresis of equivalent 
protein concentration fractions (Fig. 1). Figure 
2 shows the profiles of biochemical activity as 
well as protein concentration values after P 11 
fractionation of S-100. CK2 activity was de- 
tected between fractions 22-32, with a peak 
in fraction 28, corresponding to an specific ac- 
tivity of 255.41 mU/ml. and to an elution NaCI 
concentration of 0.8 M. 



Figure 3 shows the elution profiles after the 
first DEAE column. The peak enzymatic activ- 
ity concentrates between fractions 12 to 18, 
matching with the highest protein concentra- 
tion. Western blotting assay of these samples 
revealed a 42 kDa polypeptide, which was 
recognized by anti-CK 2 a. It co-migrated at a 
similar molecular weight described for this 
subunit in mammals (Fig. 4A). 



220 



MERCADO ETAL 




о 
ж 

(S 



< 



12 16 20 24 

Fraction Number 



28 



32 



FIG. 3. Elution profile of post P 11 pooled fractions on a first DEAE-Sepharose column chromatography. CK2 
referential activity in mU/ml and the comparative protein concentration of each fraction as detected at 280 
nm. 



Fractions 12 to 15 (2 ml) were pooled, con- 
centrated to 300 ц1 and taken to a second 
DEAE column. The mixture was eluted as a 
unique fraction (post DEAE) at a single ionic 
strength of 1.2 M NaCI in buffer A. This frac- 
tion was probed with the anti rat liver CK2 
polyclonal antibody. 

Figure 4B shows three discrete polypeptide 
bands, two of them corresponding to the rela- 
tive molecular weights of rat liver subunits a 
and f/' (42 and 38 kDa, respectively), and a 
third band at 60 kDa, which might very well be 
a species-specific ß subunit, not equivalent in 
molecular weight to the rat liver counterpart, 
or simply a non specific reaction. We were not 
able to resolve either of these alternatives. 



DISCUSSION 

CK2 is an enzyme activity classically stud- 
ied in mammalian cells but not as yet in ma- 
rine organisms. Nontheless, the regulatory 
properties of eukaryotic CK2 enzymes are 
poorly understood (Guerra et al., 1999). The 
present work provides the basis for further 
studies on CK2- like activities in a new model 



system, marine bivalves, and the putative im- 
pact of protein phosphorylation in key biologi- 
cal processes, mainly those environmentally 
dependent. 

A number of features derived from our re- 
sults support the idea of the ubiquity of this 
enzyme. Firstly, the CK2 activity demon- 
strated in Tapes semidecussatus was at- 
tained using the same purification methods 
applied to mammals, and this could very well 
be considered a sign of biochemical and bio- 
physical conservation. 

Secondly, the fact that ß-casein, the well- 
known specific substrate for the mammalian 
CK2 enzyme, displays a reasonable phos- 
phorylating activity using a non-purified puta- 
tive clam enzyme and GTP/ATP as donors, is 
another supportive argument for our proposal. 

Last, but not least, is the existing cross im- 
munoreactivity between the purified rat liver 
enzyme and the putative CK2 like clam coun- 
terpart. Considering that the polyclonal anti- 
rat CK2 were elicited against specific 
aminoacidic residues involved in subunit as- 
sociation residues 1 5-27 of the (/ subunit and 
16-28 of the (/' subunit (Krehan et al., 1996), 
it becomes feasible that in the clam system a 
similar association exists that might represent 



CK2-LIKE ACTIVITY IN CLAMS 



221 



A 



kDa 
60H 

42 H 
ЗОН 



В 







1 


2 


kDa 
^60 


a 
a" 

R 


a 

a" 


_ 


• 


I <- 42 
<- 30 



12 13 14 15 CK2 



CK2 



FIG. 4. A Western blotting analysis of fractions from DEAE (first column). B, Immunoblot of a post DEAE (sec- 
ond column) fraction (1) shiowing recognition of putative clam mantle CK2 subunits. Purified rat liver CK2 (2) 
as positive control. Equivalent protein concentration in both samples. 



homologs of nnammallan enzymes. This is a 
known fact for a number of different species, 
such as frog (Jedlicki et al., 1992), chicken 
(Maridor et al., 1991), and human (Lozeman 
et al., 1990) when compared to the rat en- 
zyme. 

Thus, the similarity between the a subunits 
of mollusc and mammals would indicate that 
the in course of evolution, the catalytic sub- 
units could have been preferentially con- 
served and not necessarily the regulatory ß. 
The relevancy of this point is that the catalytic 
subunits of the enzyme are the ones acting 
upon the target substrates. 

CK2 ß subunit was not detected as expect 
in our system. One possibility is that amino 
acid residues 171-186, the region from the 
mammalian subunit of CK2 specifically recog- 
nized by antibodies (Krehan et al., 1996), are 
not present in putative subunits of the mollusc 
kinase. On the other hand, the unspecific de- 
tection of a 60 kDa polypeptide instead of the 
expected 28 kDa reported size for the mam- 
malian subunit (Meggio et al., 1992), might 
also mean that in mollusc it is in a dimeric or 
larger form. In fact, the literature reports a 
slightly larger ß subunits in the yeast S. cere- 
viseae (Bidwai et al., 1994). 



ACKNOWLEDGEMENTS 

L. M. was supported by a AECI Fellowship, 
Agenda Española de Cooperación Interna- 
cional. This work was supported by the Vice- 
recton'a de Investigación y Estudios Avanza- 
dos, Universidad Católica de Valparaíso, 



Chile. We thank Dr. Francesc Miró for help in 
the CK2 mammalian purification. 



LITERATURE CITED 

ALLENDE, J. E. & С С. ALLENDE, 1995, Protein 
kinase CK2: an enzyme with multiple substrates 
and puzzling regulation. FASEB Journal, 9: 313- 
323. 

BIDWAI, A. P., J. С REED & С V. С. GLOVER, 
1994, Casein kinase II of Sacharomyces cere- 
visiae contains two distinto regulatory subunits: ß 
and ß'. Archives of Biochemistry and Biophysics, 
309: 348-355. 

BRADFORD, M. M., 1976, A rapid and sensitive 
method for the quantitation of microgram quanti- 
ties of protein utilizing the principle of protein dye 
binding. Analytical Biochemistry, 72: 248-254. 

CHESTER, N., I. J. YU & D. R. MARSHAK, 1995, 
Identification and characterization of protein ki- 
nase CKII isoform in HeLa cells. Isoforms-spe- 
cific differences in rates of assembly from cat- 
alytic and regulatory subunits. The Journal of 
Biological Chemistry. 270: 7501 -7514. 

CHEVET е., h. N. WONG, D. GERBER, С. СО- 
СНЕТ А. FAZEL., Р. Н. CAMERON, J. N. 
GUSHUE, D. Y THOMAS & J. J. BERGERON, 
1999, Phosphorylation by CK2 and МАРК en- 
hances calnexin association with ribosomes. 
EMBO Journal, 18: 3655-3666. 

COQUERET O., N. MARTIN, G. BERUBE, M. 
RABBAT D. W. LITCHFIELD & A. NEPVEU, 
1 998, DNA binding by cut homeodomain proteins 
is down-modulated by casein kinase II. The Jour- 
nal of Biological Chemistry. 273: 2561 -2566. 

GIETZ, R. D., K. С GRAHAM & D. W. LITCH- 
FIELD, 1995, Interactions between the subunits 
of casein kinase II. The Journal of Biological 
Chemistry. 270: 13017-13021. 

GUERRA, В. & О. G.ISSINGER, 1999, Protein ki- 



222 



MERCADO ETAL. 



nase CK2 and its role in cellular proliferation, de- 
velopment and pathology. Electrophoresis. 20: 
391-408. 

GUERRA, В.. В. BOLDYREFF, S. SARNO, L. CE- 
SARO. O. G. ISSINGER & L. A. PINNA, 1999. 
CK2: a protein kinase in need of control. Phar- 
macology Theraphy. 82: 303-313. 

GUO, C. S. YU, A. T. DAVIS & K. AHMED, 1 999, Nu- 
clear matrix targeting of the protein kinase CK2 
signal as a common downstream response to an- 
drogen or growth factor stimulation of prostate 
cancer cells. Cancer Research. 59: 1146-1151. 

ни, E, & С S. RUBINS, 1991 , Casein kinase II from 
Caenorhabditis elegans. Cloning, characteriza- 
tion and developmental regulation of the gene 
encoding the ß-subunit. The Journal of Biological 
Chemistry. 266: 19796-19802. 

HUNTER, T & J. A. COOPER, 1985, Protein-tyro- 
sine kinases. Annual Review of Biochemistry. 54: 
897-930. 

ISSINGER, O. G., 1993, Casein kinases: pleio- 
tropic mediators of cellular regulation. Pharma- 
cology & Therapeutics. 59: 1-30. 

JAFFE, L., H. D. RYOO & R. S. MANN, 1997, A rol 
for phosphorylation by casein kinase II in modu- 
lating Antennapedia activity in Drosophila. Genes 
and Development. 11: 1327-1340. 

JEDLICKI. A., M. V. HINRICHS, С С. ALLENDE & 
J. E. ALLENDE. 1992, The cDNAs coding for the 
a and [3 subunits of Xenopus laevis casein kinase 
11. FEBS Letters, 297: 280-284. 

KREBS. E. G., 1994, The growth of research on 
protein phosphorylation. Trends in Biochemical 
Sciences. 19: 439. 

KREHAN, A.. P LORENZ, M. PLANA & W. PY- 
ERIN, 1996, Interaction sites between catalytic 
and regulatory subunits in human protein kinase 
CK2 holoenzymes as indicated by chemical 
cross-linking and immunological investigations. 
Biochemistry. 35: 4966-4975. 

LAEMMLI, U. K., 1970, Cleavage of structural pro- 
teins during the assambly of head of bacterio- 
phage T4. Nature. 227: 680-685. 

LOZEMAN, F J., D. W. LITCHFIELD, С PIENING, 
K. TAKIO, K. WALSH & E. G. KREBS, 1990, Iso- 
lation and characterization of human cDNA 
clones encoding the a and a' subunits of casein 
kinase II. Biochemistry. 29: 8436-8447. 

MARIDOR, G., W. PARK, W. KREK & E. A. NIGG, 
1991. Casein kinase II: cDNA sequences, devel- 
opmental esxpression, and tissue distribution of 
mRNAs for a. a' and (i subunits of the chiken 
enzyme. Journal of Biological Chemistry. 266: 
2362-2368. 



MARTOS, C, M. PLANA, M. D. GUASCH & E. 
ITARTE, 1985, Effect of starvation, diabetes and 
insulin on the casein kinase 2 from rat liver cy- 
tosol. Biochemistry Journal. 225: 321-326. 

MEGGIO, F, B. BOLDYREFF O. MARIN, L. A. 
PINNA & O. G. ISSINGER, 1992, Role of ß sub- 
unit of casein kinase-2 on the stability and speci- 
ficity of the recombinant reconstituted holoen- 
zyme. European Journal of Biochemistry. 204: 
293-297. 

MIRO. F, J. LELONG, F PANCETTI, N. ROHER, A. 
DUTHU. M. PLANA, J. BOURDON, O. BACHS, 
E. MAY & E. ITARTE, 1999, Tumour suppressor 
protein p53 released by nuclease digestion in- 
creases at the onset of rat liver regeneration. 
Journal of Hepalogy 31 : 306-314. 

PANCETTI, F, R. BOSSER, E. ITARTE & O. 
BACHS, 1996, Changes in the activity of nuclear 
protein kinase CK2 during rat liver regeneration. 
Biochemical and Biophysical Research Commu- 
nications. 218: 35-39. 

PINNA, L. A., 1990, Casein kinase II: an eminence 
grise in cellular regulation. Biochimistry and Bio- 
physics Acta. 1054: 267-284. 

PINNA, L. A. & F MEGGIO, 1997, Protein kinase 
CK2 ("casein kinase-2") and its implication in cell 
division and proliferation. Progress in Cell Cycle 
Research. 3: 77-97. 

PLANA, M., С GIL, E. MOLINA& E. ITARTE, 1994, 
Protein kinase CKII: possible regulation by inter- 
action with protein substrates. Cellular and [Mole- 
cular Biology Research. 40: 455-461 . 

PROWALD, A., N. SCHUSTER & M. MONTE- 
NARH, 1997, Regulation of the DNA binding of 
p53 by its interaction with protein kinase CK2. 
FEBS Letters. 408: 99-104. 

ROHER, N., F MIRO, M. JOSE, R. TRUJILLO, M. 
PLANA & E. ITARTE, 1998, Protein kinase CK2 
altered in insulin-resistant genetically obese 
(fa/fa) rats. FEBS Letters. 437: 211-215. 

TOWBIN, H., T STAEHELIN & J. GORDON, 1979. 
Electrophoretic transfer of proteins from Poly- 
acrylamide gels to nitrocellulose sheets: proce- 
dure and some applications. Proceedings of the 
National Academy of Sciences USA. 76: 4350- 
4354. 

TUTEJA, R. & N. TUTEJA, 1998, Nucleolin: a mul- 
tifunctional major nucleolar phosphoprotein. Crit- 
ical Reviews in Biochemistry and Molecular Biol- 
ogy 33: 407-436. 

Revised ms. accepted 10 November 2000 



MALACOLOGIA, 2001, 43(1-2): 223-236 

INFERENCES ON THE PHYLOGENETIC RELATIONSHIPS OF SUCCINEIDAE 
(MOLLUSCA, PULMONATA) BASED ON 18S rRNAGENE 

Ana Virginia Calogeras Dutra-Ciarke\ Charlene Williams^, Rebecca Dickstein\ 
Norbert Käufer^ & James R. Spotila^'"* 

ABSTRACT 

The systematic position of Succineidae and its relationship with Athoracophoridae and other 
pulmonate mollusl<s is controversial. In this paper, we attempted to study their relationships in 
the light of the 18S rRNA gene. We determined complete sequences from the 18S rRNA gene 
for Omalonyx matheroni (PoWez & Michaud, 1835), a closely related species to Succinea putris, 
the type-species of the family Succineidae (Tillier, 1981), and Athoracophorus bitentaculatus 
(Quoy & Gaimard, 1832), the type-species of the family Athoracophoridae. All complete se- 
quences of closely related pulmonate molluscs available from GenBank were included in the 
phylogenetic analysis in an attempt to find the positions of these taxa in the pulmonate tree. 
Comparative sequence analysis and base stacking energy methods were used to predict the 
secondary structure of the 18S rRNA gene. The secondary structure was used to resolve am- 
biguous nucleotide positions for our alignment. Stems El 0-1, E23-1, 43 and 49 of the 18S rRNA 
gene were highly variable and the suggested secondary structure was presented for 21 mol- 
lusks. We used maximum parsimony and maximum likelihood methods for assessment of the re- 
lationships of the Succineidae. The 18S rRNA data indicate Succineidae and Athoracophoridae 
taxa form a monophyletic clade, the Elasmognatha. The Elasmognatha is positioned among the 
stylommatophoran molluscs. The order Stylommatophora is monophyletic. The subclass Pul- 
monata is not supported. Siphonariids are an early diverging lineage to all taxa or positioned as 
a sister taxon to the pulmonales. Furthermore this study indicated that siphonariids are not part 
of or even closely related to the main lineage of basommatophorans represented here by Planor- 
bidae and Lymnaeidae. 

Key words: 18S rRNA gene; secondary structure; Succineidae; Athoracophoridae. 



INTRODUCTION 

The mollusk subclass Pulmonata, or the 
lung breathing snails, Includes the vast major- 
ity of terrestrial, numerous freshwater, and a 
few marine sublittoral mollusks. Their main ra- 
diation occurred among the representatives of 
the land snails order Stylommatophora, in 
which 71 to 92 families are reported (Ember- 
ton et al., 1990), and the number of species 
are estimated to be between 30,000 to 35,000 
(Solem, 1984). The fossil record dates from 
the mid-Paleozoic (Solem, 1979; Solem & 
Yochelson, 1979). The Pulmonata monophyly 
was strongly supported with partial se- 
quences of the 28S hbosomal RNA by Rosen- 
berg et al. (1994), who also pointed out the 
monophyly of the order Stylommatophora. 



Succineidae are distributed worldwide, with 
their origin considered as Laurasian (Tillier, 
1989) or Gondwanaland (Nordsieck, 1986). 
Athoracophoridae are considered to be a sis- 
ter group to Succineidae, according to mor- 
phological data (Nordsieck, 1986) and partial 
28S rRNA gene sequence analysis (Tillier et 
al., 1992), although their close relationships 
have been rejected in other studies (Solem, 
1978; Tillier, 1984, 1989; Schileyko, 1978). 
The Succineidae -f- Athoracophoridae clade 
was named as Elasmognatha, because, 
among pulmonate snails, the included taxa 
share a unique type of jaw called the elas- 
mognatha jaws. The Succineidae are a sty- 
lommatophoran family of land snails that oc- 
cupy a key position in the elucidation of the 
steps of pulmonate evolution. Tillier et al. 



'Department of Environmental Sciences, Engineering and Policy, Drexel University, 32nd & Chestnut Streets, Philadelphia, 
Pennsylvania 19104, U.S.A.; dutra-clarke@worldnet.att.net 

^Department of Biochemistry and Molecular Biology, Jefferson Institute of Molecular Medicine, Jefferson Medical School, 
Thomas Jefferson University, 233 So. 10th Street, Philadelphia, Pennsylvania 19107, U.S.A. 

^Institut für Genetik, Biozentrum Technische Universität Braunschweig, Spielmannstrasse 7, D-38106 Braunschweig, Ger- 
many. 
""To whom correspondence should be directed; spotiljr@drexel.edu 



223 



224 



DUTRA-CLARKE ETAL. 



(1 992) reestablished the taxon Elasmognatha 
by showing the monophyly between Succinei- 
dae and Athoracophoridae based on partial 
sequences from 28S rRNA gene. The Elas- 
mognatha seemed to retain many symple- 
siomorphic characters, and thus their classifi- 
cation based on morphology has been deeply 
affected by them (Dutra-Clarke. 1996). The 
systematic position of Succineidae within the 
Pulmonata has been a crucial problem in un- 
derstanding pulmonate evolution. Tillier et al. 
(1992) showed Succineidae and Athora- 
cophohdae related to Opistobranchia, and 
they stated: ". . . the position of this taxon, 
sister-group of the order Pulmonata or inside 
the Stylommatophora, varies in relation to 
minor changes in alignment. . . .". We ap- 
proached the problem of their relationships by 
means of a detailed analysis, including sec- 
ondary structure information, of complete se- 
quences of the 18S rRNA gene. The type- 
species Athoracophorus bitentaculatus was 
selected to represent Athoracophoridae. The 
Succiniedae is represented by the semi-slug 
Omalonyx matheronl. Omalonyx is related to 
Succinea, based on combined analysis of 
morphological data and partial sequence data 
from 18S rRNA gene (Dutra-Clarke, 1996) 
and on the hypothesis that Oma/onyx evolved 
from Stvcc/nea (Tillier, 1981). 

The small subunit rRNA or 18S rRNA gene 
is the most studied rRNA gene. In relation to 
the land mollusk order Stylommatophora, up 
to the present time. 18S rRNA sequences 
have been published for Achatinidae, Clausili- 
idae, Helicidae, and one Succineidae (Win- 
nepennickx et al., 1992, 1996, 1998). We are 
adding two more in this paper, that of a Suc- 
cineidae and of the type-species of Athora- 
cophoridae. The 18S rRNA gene remains ho- 
mogeneous as a result of concerted evolution 
(Hillis & Dixon, 1 991 ). This characteristic plus 
the diversity of domains from conserved to 
highly variable make the 1 8S rDNA full-length 
sequence a key molecule to approach rela- 
tionships from species to class level. 

Full-length 18S rRNA gene has been used 
to elucidate relationships within the mollusks 
(Adamkewicz et al. 1997; Kenchington et al., 
1994: Winnepennickx étal., 1992, 1994, 1995, 
1996, 1998a, b; Bargues & Mas-Coma, 1997) 
and closely related protostomates. Adam- 
kewicz et al. (1997) studied relationships of 
subclasses within Bivalvia. Kenchington et al. 
(1994) analyzed family level relationships; 
Winnepennickx et al. (1 992, 1 994, 1 995) used 
1 8S rRNA gene to establish the monophyly of 



the phylum Mollusca and (1996) the relation- 
ships among classes of the phylum Mollusca. 
Winnepennickx et al. (1998b) found the 18S 
rDNA could also resolve for "rapid" recent 
cladogenetic events, such as divergences 
between species of Littorinidae. Moreover, 
Bargues & Mas-Coma (1997) discriminate 
species of the family Lymnaeidae based on 
the sequence and characters of the secondary 
structure of 18S rRNA gene. 

The estimated ratio of transition to trans- 
version for our full length data-set was of 1:1. 
Therefore, substitutional saturation of sites 
seems not to be a problem. For a site that is 
at or near saturation, this ratio would be of 0.5 
(Aboudheif et al., 1998). Even when we elim- 
inate the highly variable sites of the molecule 
(bulges, loops and unpaired nucleotides on 
the secondary structure), this ratio was of 
1 :0.93, and a similar phylogeny was obtained. 

The purposes of this study were (1) to de- 
termine if 1 8S rRNA gene sequence data sup- 
port the hypothesis that the families Succinei- 
dae and Athoracophoridae belong to a 
monophyletic clade; (2) to test whether the 
Succineidae and Elasmognatha belong to the 
main pulmonate radiation, that of the stylom- 
matophorans, or if they are sister-group to the 
stylommatophorans; (3) to test the relation- 
ship of Succineidae and Achatinidae, consid- 
ered by Tillier (1989), based on morphology, 
to be more closely related than is Succineidae 
to Athoracophoridae; (4) to present a compar- 
ative analysis of the secondary structure of 
highly variable subdomains of the 18S rRNA 
gene for mollusks showing its importance for 
the phylogenetic inferences. 



MATERIALS & METHODS 

Specimens of the semi-slug Omalonyx 
matheroni were freshly collected from Brazil 
(vouchers deposited at the Academy of Nat- 
ural Sciences -ANSP AI 8026-A1 8038; 18S 
rRNA sequence data at GenBank, accession 
number AF047199) and Athoracophorus bi- 
tentaculatus, the type-species of Athoraco- 
phoridae, were museum preserved speci- 
mens from New Zealand (ANSP A7965b, d; 
18S rRNA sequence data at GenBank, ac- 
cession number AF047198). Closely related 
outgroup to pulmonates is represented by a 
Neogastropoda; another more distant related 
outgroup is represented by a Vetigastropoda. 
Published complete 18S rRNA gene se- 
quence data are the vetigastropod Mono- 



PHYLOGENETIC STUDY OF THE FAMILY SUCCINEIDAE 



225 



donta labio (X94271 ); the neogastropod Thais 
clavigera (X91979); and the euthyneurans 
Aplysia sp. (X94268), Lymnaea stagnalis 
(Z73984), Fossaria truncatula (Z73985), Ba- 
l<erilymnaea cubensis (Z83831), Radix pere- 
gra (Z73981), Stagnicola palustris (Z73983), 
Lymnaea glabra (Z73982), L. auricularia 
(Z73980), Blomphalaria glabrata (U65224), 
B. alexandrina (U65225), Siphonaria alge- 
sirae (X91973), Onchidella céltica (X70211), 
Limicolaria kambeul (X66374, Achatinidae), 
Helix aspersa (X91976, Helicidae), Oxyloma 
sp. (X94276), Balea biplicata (X94278), and 
Laevicaulis alte (X94270). Taxonomic groups 
resolved in our tree follow names proposed by 
Ponder & Lindberg (1997). 

DNA Extraction 

Foot muscle and liver tissue were taken 
from dissected alcohol preserved specimens 
{A. bitentaculatus) or only the foot muscle was 
taken from fresh-frozen snails (O. matheroni). 
DNA was obtained from at least two 
individuals of each species. Total DNA was 
extracted by an adaptation of the СТАВ (cetyl- 
trimethylammonium bromide) method as de- 
scribed for plant DNA using СТАВ as in Cur- 
rent Protocols in Molecular Biology (Ausubel, 
1994) and in Spolsky et al. (1996). 

PCR Reactions 

The PCR reactions were performed with 
GeneAmp (Parkin-Elmer Corp) on a Coy Tem- 
pcycler. The PCR primers are listed in Table 1 . 
Reactions were performed in a total volume of 
50 ul using the ampli-Taq DNA polymerase kit 
(200 uM of each dNTP; 1 uM of primers and 
2.0 и to 2.5 и of ampli-Taq DNA polymerase). 
The concentration of the template DNA varied 
between 50 ng and 1 00 ng. The standard PCR 
amplification profile consisted of an initial de- 
naturation step of 95°C for 2 min, followed by 
25 to 30 cycles of 94°C for 1 min, 48-51 °C for 
1 min, 72°C for 1 min and 30 sec, followed by 
10 min at 72°C for final extension. The purifi- 
cation of the PCR product was done with either 
the Magic Clean kit from Promega or with the 
Qiagen PCR purification kit from Qiagen Inc. 
The purified PCR product was then prepared 
for direct sequencing. 

Sequencing 

Both DNA strands of the 18S rRNA gene 
were sequenced. Automated sequencing 



used 3.2 pmol of each PCR primer to prime 
the cycle sequencing reactions in both the 
sense and antisense directions. The auto- 
mated cycle sequencing was performed in a 
Model 373A or Model 377 DNA sequencing 
system (Applied Biosystems Inc., Foster City, 
California), at the Department of Biochemistry 
of Thomas Jefferson University, Philadelphia, 
Pennsylvania. The sequences were read and 
entered into the multiple-sequence editor 
ESEE (Cabot & Beckenbach, 1989). 

The primers were complementary to con- 
served regions of the eukaryotic 18S riboso- 
mal gene and are listed in Table 1 . 

Secondary Structure and 
Sequence Alignment 

Compilations of rRNA small subunit struc- 
tures (Neefs et al., 1993; Van de Peer et al., 
1996) and the predicted secondary structure 
for the pulmonate snail L. kambeul (Win- 
nepennickx et al., 1992) were used as models 
to obtain the secondary structures here pro- 
posed. We followed the method described by 
Kjer et al. (1994) and Kjer (1995) to manually 
predict secondary structure and to write it on 
the aligned sequence. This comparative se- 
quence analysis is considered by Guttell et al. 
(1994) as a very refined test of homology and 
is based on the concept of positional covari- 
ance. Woese et al. (1990) showed that com- 
parative sequence analysis has been in- 
volved in the derivation of higher-order 
structures for a variety of different RNA mole- 
cules. We also applied the RNAdraw program 
(Matzura & Wennborg 1996), which uses min- 
imum energy structure prediction algorithm to 
fold the RNA to obtain diagrams of the sec- 
ondary structure. If used exclusively, this pro- 
gram can offer poor resolution. Optimal struc- 
tures could only be obtained when constraints 
for nucleotide pairings were previously de- 
fined according to the comparative analysis of 
aligned sequences. The diagrams of the pre- 
dicted secondary structure were used to ei- 
ther corroborate or decide for difficult homolo- 
gous nucleotide positions in our alignment. 
We followed the stems numbering as in Neefs 
et al. (1993). However, stems 20 and 21, as 
seen in Neeffs et al. (1993), compilations 
were not drawn for the pulmonate secondary 
structure model of L. kambeul (Winnepen- 
ninckx, 1992). We numbered the stems as 
Neefs et al. (1993) but omitted stems 20 and 
21 following the structure presented by Win- 
nepenninkx et al. (1992), because they are 



226 



DUTRA-CLARKE ETAL. 



TABLE 1 . List of primers 



ID 



Sequence 



Publication 



Position* 



#2 CAACCTGGTTGATCCTGCCCAGT 

NS1 GTAGTCATATGCTTGTCTC 

A AGGGYTCGAYYCCGGAGA 

#23 GGAGCATGAGAAACGGCTAC 

NS3 GCAAGTCTGGTGCCAGCAGCC 

NS2 GGCTGCTGGCACCAGACTTGG 

В CGCGGTAATTCCAGCTCCA 

С TTGGYRAATGCTTTCGC 

D TTAATCAAGAACGAAAGT 

G CCGTCAATTCCTTTAAGTTT 

NS4 CTTCCTCAATTCCTTTAAG 

E AATTTGACTCAACACGGG 

NS7 GAGGCAATAACAGGTCTGTGATGC 

F GGGCATCACAGACCTGTTA 

I TTTGTACACACCGCCCGTCG 

J GACGGGCGGTGTAC 

ITS1 GGAAGTAAAAGTCGTAACAAGG 

NS8 TCCGCAGGTTCACCTACGGA 

#1 CTGATCCTTCTGCAGGTTCACCTAC 



Rice (1990) 
White et a!. (1990) 
Winnepenninckx et al. 
This paper 
White et a!. (1990) 
White et a!. (1990) 
Whinnepenninckx et al 
Whinnepenninckx et al 
Whinnepenninckx et al 
Whinnepenninckx et al 
White et al. (1990) 
Whinnepenninckx et al 
White et al. (1990) 
Whinnepenninckx et al 
Whinnepenninckx et al 
Whinnepenninckx et al 
This paper 
White et al. (1990) 
Rice (1990) 



(1994) 



(1994) 
(1994) 
(1994) 
(1994) 

(1994) 

(1994) 
(1994) 
(1994) 



0- 

19- 

391- 

431- 

572- 

593- 

592- 

987- 

998- 

1185- 

1188- 

1216- 

1449- 

1474- 

1663- 

1679- 

1782- 

1829- 

1836- 



22 

38 

409 

410 

593 

572 

611 

970 

1016 

1165 

1168 

1234 

1472 

1454 

1680 

1663 

1807 

1809 

1811 



'Position as compared to the published sequence of L. /cambeu/ (Whinnepenninckx et al., 1994) 



not well formed for the molluscs studied here. 
The highly variable subdomains of the do- 
mains V2, V4, V7 and V9 in the 18S rRNA 
gene for the 21 mollusks studied here were 
represented by the stems E10-1; E23-1, 43 
and 49. Non-canonical base pairings G:U 
were common, but the non-canonical G:A 
were not allowed. Once the alignment for the 
highly variable regions V2, V4, V7 and V9 
were ready, and with the guidance of the sec- 
ondary structure, the rest of the 18S rRNA 
gene could be easily aligned. All diagrams 
were redrawn manually. 

We aligned the new complete 18S rRNA 
gene sequences with complete published se- 
quences for the pulmonates from GenBank. 
Very divergent domains of the 1 BS rRNA gene 
were difficult to align. However, with the sec- 
ondary structure predicted for each taxon, ho- 
mologous nucleotide positions were defined 
and a careful manual alignment resulted in a 
confident data set and allowed us to include 
the entire gene sequence into our analysis. 
ESEE multiple sequence editor software 
(Cabot & Beckembach, 1989) was used for 
the alignment. Gaps were inserted to account 
for length differences between the se- 
quences. 



Phylogenetic Analysis 

The two new complete 18S rRNA se- 
quences were manually aligned with pub- 



lished sequences. The sequences were for- 
matted for phylogenetic analysis using the 
software EAT (Cabot, 1 993). The ratio of tran- 
sition to transversion was empirically deter- 
mined by performing likelihood analyses on 
all taxa, testing a range of ratios varying from 
0.4 to 1.5. The ratio which yielded the higher 
log likelihood for the data was than selected. 

Phylogenetic analysis were performed 
using parsimony (PAUP 4.0d57; Swofford, 
1998) and maximum-likelihood (from PHYLIP; 
Felsenstein, 1993). Gaps were treated as 
missing data. Unweighted parsimony trees 
were found by conducting a heuristic search. 
The tree nodes were tested for reliability by 
bootstrapping (500 replicates on the full length 
sequencing data and 100 on the data-set ex- 
cluded of highly variable sites). Majority rule 
consensus trees were generated from the 
bootstrapped trees. We selected a more 
closely related species to the Euthyneura (the 
neogastropod Thais clavigera) and a more 
distant taxon (the vetigastropod Monodonta 
labio) based on gastropod relationships 
shown by Ponder & Lindberg (1997) and Win- 
nepenninckx (1998a). 

We applied two different tree-making meth- 
ods to 18S rRNA gene sequences, the maxi- 
mum likelihood (dnami from PHYLIP, Felsen- 
stein, 1993) and parsimony (PAUP 4.0d57; 
Swofford, 1998). They differ in their assump- 
tions on the evolutionary process, and could 
well constitute a test on the reliability of our 
data to generate a robust phylogeny. 



PHYLOGENETIC STUDY OF THE FAMILY SUCCINEIDAE 



227 



RESULTS 
Alignment and Secondary Structure 

The alignment of 21 taxa relied on the pro- 
posed secondary structure yielded 1926 com- 
parative sites, of which 176 were parsimony- 
informative. 

Secondary structure was predicted for the 
stems El 0-1 , E23-1 43 and 49 (Figs. 1 -4) be- 
cause of the variation found in nucleotide 
composition among the 21 aligned se- 
quences. The predicted secondary structure 
allows phylogenetic resolution for family and 
order level of relationships among the studied 
species representing families. Variability in 
stem El 0-1 was detected among succineid 
genera and between succineids and other 
pulmonates (Dutra-Clarke, 1996). 

GNRAtetra-loops were found in stem E10- 
1 and 49 (R stands for Purine and N for any 
nucleotide). These loops are considered to be 
a common RNA structural motif and an un- 
usual stable hairpin loop structure (Woese et 
al., 1990; Jucker & Pardi, 1995). Another 
tetra-loop sequence UCGC was found in the 
stem El 0-1 for Athoracophohdae and Suc- 
cineidae; in the stem E23-1 for Achatinidae, 
Athoracophoridae, Helicidae, Succineidae, 
Lymnaeidae, Onchididae, and Siphonahidae 
and in stem 49 for Onchididae. 



Phylogenetic Analysis 

The phylogenetic position of Succineidae 
and Athoracophoridae (Elasmognatha) rela- 
tive to others mollusks was inferred using 
maximum parsimony (Figs. 5, 7) and maxi- 
mum likelihood (Fig. 6) analyses. Tillier et al. 
(1992) consensus tree shows the Elasmog- 
natha in sister group position to all other pul- 
monates. Parsimony generated a consensus 
tree: length of 739 steps, consistency index 
(CI) of 79; homoplasy index (HI) of 0.21, re- 
tention index (Rl) of 0.74, and rescaled con- 
sistency index (RC) of 0.58 (fig. 5). The maxi- 
mum likelihood tree has a log of -6803.85 (Fig. 
6). Contradicting the overwhelming morpho- 
logical evidence presented by Dutra-Clarke 
(1 996) for the status of the family Succineidae 
as monophyletic, the molecular data support 
the hypothesis that Succineidae is para- 
phyletic due to shared sequence homologies 
between Athoracophorus and Omalonyx, di- 
verging from the published sequences of the 
succineid taxon Oxyloma sp. Therefore, the 
taxa Elasmognatha (reestablished by Tillier et 



al., 1 992) is here defended, and it is supported 
by 99% to 1 00% of the bootstrap value. There- 
fore, there is no indication of close relation- 
ships between Succineidae and Achatinidae, 
as supposed Tillier (1989). The subclass Pul- 
monata was not supported due to the poorly 
resolved relationships between the systelom- 
matophorans and siphonariids with the opisto- 
branch Aplysia, the relationships of which are 
unstable in the parsimony or maximum likeli- 
hood trees. There is an unresolved polytomy 
consisting of four clades - (1) "higher" ba- 
sommatophorans + stylommatophorans, (2) 
systelommatophorans, (3) Siphonaria, and (4) 
Aplysia sp. The taxa Euthyneura formed a ro- 
bust clade among gastropods, which is con- 
firmed with 100% confidence. Furthermore, 
our analysis indicates siphonariides are nei- 
ther part of the basommatophorans clade here 
represented by Planorbidae and Lymnaeidae, 
nor are they closely related to them. Among 
the "higher" basommatophorans, the family 
Lymnaeidae and the family Planorbidae are 
monophyletic and supported with 100% confi- 
dence. Among Lymnaeidae, there are two lin- 
eages, but the only clade well supported by 
99% to 1 00% bootstrap is formed by Lymnaea 
glabra as sister taxon to L. stagnalis and Stag- 
nicola palustris. This clade was also well sup- 
ported in the parsimony tree of Bargues & 
Mas-Coma (1997), and a name could be ap- 
plied for this node. The family Planorbidae is 
well supported with 100% bootstrap in both 
trees. For the data-set excluded of highly vari- 
able sites, parsimony generated a consensus 
tree: length of 690 steps, consistency index 
(CI) of 0.77; homoplasy index (HI) of 0.23, re- 
tention index (Rl) of 0.71 and rescaled consis- 
tency index (RC) of 0.55 (Fig. 7). There is a tri- 
cotomy, due to collapse in nodes representing 
species divergency among lymnaeids. These 
missing nodes were poorly supported in the 
trees generated by using full-length gene se- 
quence (Figs. 5, 6). The only robust node uni- 
fying the lymnaeid species Stagnicola palus- 
tris, Lymnaea glabra, and L. stagnalis is 
present and well supported by 70 of bootstrap 
value. 

DISCUSSION 

Boore & Brown (1994) appropriately com- 
ment: "a sequence alignment is fundamen- 
tally an hypothesis of homology at each of the 
aligned positions; changing the alignment of 
nucleotides can generate very different evolu- 
tionary trees." Once we obtained the se- 



228 



DUTRA-CLARKE ETAL. 



(A) 



,U"=G, 



s-u и < и С 


G С С А G 


■ С G G G и С ' 


1 1 1 1 1 
Э' A л и AG 


t 1 1 1 1 
UG G и и 


G С С С GG 



ACCAAUCG 
I I M I I I I 
UGGUUAGC 



CCGU CCCU 
I I I I I I I I 
GGCG GGGG, 



S'U и A и и 

I I I I I 

Э' A A и A G 



ACCAG CGGGu' 
I I I I I I I I I I 

UGGUU GCCCG 



I I I I I I I I 



CCGU GCCCU 
M I I I I I I I 
GGCG CGGGG, 



I A и и 
I I I 
и A G 



ACCAAU CGUCGUCUCGCCG" 
I I I I I I I I I I I I I I I I I I I 
UGGUUA GCGGCGGGGCGGCi 



ACCAAU CGCCGUCCUU 
I I I I I I I M I I I I I I I 
UGGUUA GUGGCGGGAG, 



ACCAU GGUCGUGCCCU 
I I I I II I I I I II M I I , 
_UGGU AC CGG С GUG G G G(;' 



,u и С Д ^ 



CGUCGUGCCCUu 
I M I I I I I I I С 

GCGGCGCGGGc* 



ru и A и и 


ACCAAU 
1 1 1 1 1 1 


CGCCGUGU^ 


"g С С G С GGUt 


С 


5'U и A и и 


"а С С А А " 


' С G С С G и GGU С u' 


1 1 1 i 1 
I' A A и A G 

г 


UGGUUA 


1 1 1 1 1 1 1 1 
GC G G С G С G . 


I 1 1 1 1 1 1 1 
. UGGUGCCG 


A 


1 1 1 1 1 
ГА А и А G 


1 1 1 1 1 
и G G ии 


II II II 1 1 1 1 1 
GCGG CGCCGGA 



SU и А и и 

I I I I I 

1°А А и А G 



А С С А 
I I I I 
и G G и 



UCGGCGU GCCCU' 
I I I I I I I I I I I I 
AGCUGCGUGGGG 



ACCA и CGUCGUGCCC^ 
I I I I I I I I I I II I I I 
UGGUUA CCGGCGCGGG, 



(B) 



ииСАд 220 



S'U и A и и 

I I I I I 

3'A A и A G 



ACCAAU 
M II I I 
UGGUUA 



"C и С * 



CGC CGCGUGC UCU ' 
III II I I I I I I II 
GUGGCGCGUGGGG, 



CcC 



5'U и A и и 

I I I M 

3'A A и A G 



^'CuC*^ 



GUCGUGCCCU' 
I I I I I I I I I I 
CGGCGUGGGG. 



i'U и A и и 

I I I I I 

ГА A и A G 



•"Cuca' 



ACCAAU CGCCGCGUGCGGG" 
lililí M I I I M II I I I I 
UGGUUA G С G G С G С GUG С и С дС 
■ С и 

СсС 



5'и и А и и 


ACCAAU 


1 1 1 1 1 


1 1 1 1 1 1 


З'А А и А G 


и G GUUA 



С GC С G С G и GCUCU ^ 
I I I I I I I I I I I I I 
GUG G С G С G UGGGG , 



"СиС*^ 



S'U и A и и 

I I I I I 

3'A A и A G 



ACCAAU CGCCGCGUGCGGGf. 
I I M I I I II II I II I I M I 
UGGUUA G С GG С G С G UG С и С a"" 



5'U и А и и 
I I I I I 



АССА и С G С С GU G С ecu иС 
I III I I I I II I I I II M I 
UGGUUA G С GG CGU GGGG GG , 



Í' и и A и и 

I I I I I 

3' A A и A G 



ACCA UGG UCGUGCCCU 

I I I I III I I I I I I I I I г 

UGGUrACC GGCGUGGGG, 
r. ^ г г С 



6'U и A и и 
I I I I I 

3'A A и A G 



ACCAAU CGCCGCGUGCCGGGr 
I I I I I I I I I I I I I I I I I I I I 
UGGUUA G С GG С G С GCG GC и С д'^ 



«си С * 



S'U и А и и 


А С С ДА 


Mill 
З'А А и А G 


1 1 1 1 1 
и G GUU 



С GC С UG GCUCU", 
Il I I I I I I I I I r 
GCGG GCCGGGGc 



FIG. 1. A, B. Secondary structure representations for stem El 0-1 in the 18S rRNAgene for 21 taxa. 



quences for this study one of the most careful 
and time consuming steps, was the align- 
ment. Secondary structure is suggested for 
stems E10-1, E23-1, 43 and 49, because 
those regions were ambiguous to align with- 
out the knowledge and guidance of their sec- 



ondary structure. As Kjer (1995) pointed out, 
the conservation of the rRNA secondary 
structure exceeds that of its nucleotides and 
should be used for the assignment of homol- 
ogous positions for phylogenetic studies. 
Many authors exclude highly variable regions 



PHYLOGENETIC STUDY OF THE FAMILY SUCCINEIDAE 



229 



(A) 



^"631 

с 

G G G и G и 


Б45 
CG с 
UCGCGU GUCC 


и и G и и 
III II ^ 


«'* 663 

С 
5'GGCG AGG 
lili III 


677 
CGGGCGGU CCGGC 
1 1 1 1 1 1 1 1 Mill 


1 1 1 1 II 
С С и G (. и G 


lililí lili 
GGCGCG UGGG 


G G и А А 


3'CCGU UCU 


GCCCGUCA GGCCG 



5'GG AUGGG 

II I I I I I 

3'CC UACCC 



6S8 

1 
CGCGCGGU CCGCC 
I I I I I I I I I I I I I 
GUGCGUCA GGCGG 
и CU 

и 



■ GG С G 

I I I I 

' CC G и 



AGG 
I I I 
UCU 



CGGGCGGU CCGGC 
I I I I II I I I I I I I 
GCCCGUCA GGCCG 



5'GGUG AGG CGGGCGGU CCGGC , 

I I I I I 11 I I I I I I I I I I I I I 

3'CCGU UCU GCCCGUCA GGCCG^' 
С С AU CU 

697 и 



S' G G и G 

I I I I 

3' С С G и 



AGGCGGGCGGU CCGGC 
I I I I I I I I I I I I I I I I 
UUUGCCCGUCA GGCCG 



ATH 

6<Z esB 

CA - l 

5'GGUG AGGCGGGCGGU CCGGC 

I I M I I I I I I I I I I I I I I I I 

3'CCGU UCUGCCCGUCA GGCCG 



695 



С С 



' GG и G 

I I I I 

' С CG и 



CAGGCGGGCGGU CCGGC 
I I I I I I I I I I I I I I I I I 
GUUUGCCCGUCA GGCCG 



5'GGUG AGGCGGGCGGU CCGGC < 

I I I I I I I I I I I I I I I I I I I I 
3'CCGU UUUGCCCGUCA GGCCG^' 



LAE 

643 857 

С и 

5'GGUG AGGC GGGCGGU CCGGC ( 

I I I I I I I I I I I I I I I Mill 

3'CCGU UCUG CCCGUCA GGCCGj.' 



BAL 

644 65в 

С ' < 

S'GGCG AGGCGGGCGGU CCGGC 
I I I I M I I I I I I I M Mill 
3'CCGU UUUGCCCGUCA GGCCG 



S'GGCG AGG 

I I II III 

3'CCGU UCC 



CGGGCGGU CGGC 
I II I II II II I I 
GCCCGUCA GCCG 



(B) 



5' G G и G 

I I M 

3' С С G и 



CAGGCGGGCGGU CCGGC' 
I I I I I I I II I I I I I I I I 
GUUUGCCCGUCA CGCCG, 



5GGUG 

II I I 

3'CC G и 



AG GCGGGCGGU 
II M I I I I I M 
UC UGCCCGUCA 



ББ4 
5' G G и G 



AGGCGGGCGGU CCGGC' 
M I I I I I I I I I Mill 
UUUGCCCGUCA GGCCG, 



AGGCGGGCGGU CCGGC 
I I I I I II I I M Mill 
UUUGCCCGUCA GGCCG 



LYS 

663 

5' GGU G 

I I II 

3' С CG и 

С 

716 С 



AGGCGGGCGGU CCGGC 
Il II I I I I I I I II I I I 
UUUGCCCGUCA GGCCG 



5' G G С G 

I I II 

3' С С G и 



GGCGGGCGGU CGGC 
I I I I I I I I M M I I 
UUGCCCGUCA GCCG 



5'GGUG AGGCGGGCGGU CCGGC ( 

I I I I I I II I I II I I I I I I I I 
3'CCGU UCUGCCCGUCA GGCCG,.' 



5' G G и G 

I I II 

3' С С G и 



AGGCGGGCGGU CCGGC 
Il II I I I I I II Mill 
UUUGCCCGUCA GGCCG 



5' G G С G 

I I II 

3' С С G и 



GGCGGGCGGU CGGC' 
I I I I I I I I M M I I 
UUGCCCGUCA GCCG 



FIG. 2. A, B. Secondary structure representations for stem E23-1 in the 1 8S rRNA gene for 21 taxa. 



230 



DUTRA-CLARKEETAL. 



(A) 



MON 
13« 


1зеэ 


S'CCu'^CUAA "aGUU 


CGCC GACAG ^ 


III II 1 1 1 1 1 1 


II 1 1 1 1 1 1 1 


3'GGA GAUU UCA A 


GCGG CUGUUG 


^ С и *C A 
1415 G 


-U <=-<= 
_C Gt 


THA 1 


и 


1353. 


,1387 



5-CCU CUAA AGUU CGCCGAU 

III I I I I I I I I I I I I I I I 

3'GGA GAUU UCAA GCGGCUG 



APL 

13S4 13Бв 

-' * AU I 

S'CCUUUAA AGUUCGCCGGU 
ill I I I I I I I I I I I I I I I 

3'GGA GAUU UCAAGCGGCCG, 

Ч cue I 

KOS 
ATH 



135B 



1362 



'A AU ' С '■ <^ С 

S'CCUUUAA AGUUGCGCCGGU 

I II I I I I I I II I I I I I I I I r 

3'GGA GAUU UCAACGCGGCCG 
С и f 



ВАК 



1412 



-G и A 



1375 



13в9 



А и 



С С 



5' ecu UUAA AGUU CGCCGGU 
I I I I I II I II I I II I II I 
3'GGA GAUU UCAA GCGGCCG, , 

x С и С ecu 

1427 



BIG 



137S 



neo 



A и 



ce 



5' ecu UUAA AGUUCGCCGGU 
III I I II I I II I I I I I I I 
3'GGA GAUU UCAA GCGGCCG, , 

С и С ecu 

1428 

ros 



S'CCUUUAA AGUUCGCC UCGGUGGU 

III I I II I I I I I I I I I I I I I I I I 

3'GGA GAUU UCAAGCGGAGCCGUUA, 



S'CCUUUAA AGUUCGCCGGU 

I I I I I I I I I I I I I I I I I I 

3'GGA GAUU UCAA GCGGCCG 



S'CCUUUAA AGUUCGCC UCGGUGGU 
I I I I I I I I I I I I I I I I I I I I II I 
3'GGAGAUU UCAAGCGGAGCCGUUA 
С и С и С 

bal'"« 

1351 13Б5 

/ А Ау ^ С ^ С 

S'CCUUUAA AGUUCGCCGGU U 

I I I II I I I I I I I I I I I I I и 

3'GGA GAUU UCAA GCGGCCG g 



S'CCUUUAA AGUUCGCCGGU UC 

I I I I I I I I I I I I II I I I I II 

3'GGA GAUU UCAAGCGGCCG AG 



UM 



1371 



1385 



A и 



S'CCUUUAA AGUUCGCCGGU UC 
I I I I I I I I I I I I I I I I I I II 
3'GGA GAUU UCAA GCGGCCG AG 

^ cue CU 

1422 " 



(B) 



1 1 1 I II I III 

3'GGA GAUU UCA 



CGCC UCGGUGGU 
I I I I I I I I I I I I 
GCGGAGCCGUUA, 



1347 



1351 



AU 



S'CCUUUAA AGUU CGCCGGU' 

I I I I M I I I I I I I II II I 
3'GGA GAUU UCAA GCGGCCG 

cue С 

1399 



LVG 

1380 

^ A AU 

5' ecu UUAA AGU 

I I I I I I I III 
3'GGA GAUU UCA 



CGCC 


и С GG UG GU " 


J 


S'CCU 


UUAA 


AGU 


MM 


1 1 1 1 1 1 1 1 


С 


1 1 1 


1 1 1 1 


1 1 1 


GCGG 


AGCCGUUA. 


I 


3'GGA 


GAUU 


UCA 



CGCC UCGGUGGU 
II I I I I I I I I I I 
GCGGAGCCGUUA 



S'CCUUUAA AGU 

I I I I I I I III 

3'GGA GAUU UCA 



CGCC UCGGUGGU 
I I I I I I II I I II 
GCGGAGCCGUUA 



1373 



AU 



1387 



S'CCUUUAA AGUUCGCCGGU' 

I I I I I II I I I I I I I I I I I 
3'GGA GAUU UCAA GCGGCCG 
cue <• 

1424 



ОМА 
1351 



1365 



A и 



S'CCUUUAA AGUU CGCCGGU 

I I I I I I I I I I I I II I I II 

3'GGA GAUU UCAA GCGGCCG 

cue С 

1403 



STA 
1382 








1396 






5' 


f 

ecu 


UUAA 


AU 

AGU 


и 


CGCC 


UCGGUGGU 




1 1 1 


MM 


1 1 1 




1 1 1 1 


1 1 1 1 1 


1 1 1 


3' 


GGA 


GAUU 


1 UCA 




GCGG 


AGCCG 


UU A 




\ 




CU С 




и и 






1439 






A 









С с. 



ONC 

1375 1389 

''A ди '' r - ~ 

S'CCUUUAA AGUU CGCCGGU»- U 

I I I I I I I I I I I II I I I I I 

3'GGA GAUU UCAA GCGGCCG 

CU С Cgy 

«427 



FIG. 3. A, B. Secondary structure representations for stem 43 in the 18S rRNA gene for 21 taxa. 



PHYLOGENETIC STUDY OF THE FAMILY SUCCINEIDAE 231 



(A) 



' * GA ' U.^,,"^' ,/„,'' Sirr^iirrriinirrrrrilll 5'UACUUC U U G AG С G GU U AG U GG GC U С U U GG U С С GGU С U GG U AC с 

5'UACU ce UÜGAAUGGUU AGU GACC UC UGG U С С G U С U G CC GC U U ' . , . . . , , , , , , I i i | || l I I I I 

III I I I I M I I I I I I I I I I III I M I I I I I I I M I U I I I I I I II I I I I I I I II I I I I M I I I I I I I I I I 1 I I I I M и 

"" " ""'"'"J ,rr г rrl ГГГ rrrrrirrrC 3'AUGA AG GGUUCGCUAG UCA CUCG AG AGCCGG GCCAGGCCGUG A 

3'AUGAGG GAUUUACUAG UCA CUGGAG G G С G G G С A GG С GG U GG G д д С AG А А G UC С * 



^■u'acU ce UÜGAAUGGUU AGU GGGCUC U U G G U С CGG С G С С U U U д S'UACUUC U U G AGC G G U U AG U GGNCUC U U G G UC " С G G U С U G G С GU с 

III II II Il I IIM MIHI, IUI I I I . 

3'AUGAGG GAUUUGCUAG UCA CUCCAG AGCUCG GCCG С G G G G G ^ 3' A U GA A G G G U U С G С U AG U CA CUCGAG AGCCGG GCCAGGCCUG * 



HV3« tUMl^UH U и МИД I.UHV.4H U 

5'UACU UC UUGAGCGGUU AGU GGGCUC UUGGUC CGGUCUGGCGUc 5'UACU UC U U GAG С GG U U AGU GGCCUC U U G G UC С GGUC UG GCGU q 

mill I III III II I I II III I I I I II I II III! I ИИ II , ИИ II I III III II I I II III I I I I II III I III II II III 

3'AUGA AG GGUUCGCUAG UCA CUCGAG AGCCGG G CC A G GC CGC G .'' 3'AUGA AG GGUU CGC U AG U CA CUCGAG AGCCGG GCCAGGCCGCG A 



5'UACU UC UUGAGCGGUU AGU GGGC UC U UG G UC UC G GU С U GG CAC с 5'UACU UC UU GAGC GG U U AG U GGGC UC UUGGUC CGGUCUGGCGU с 

lililí I III III II I I II Ml I I I I II I II III III I I I II I II I I II I III III II I I II III I I I I II I I I III I II M II I . 

3'AUGA AG GGUUCGCUAG UCA CUCGAG AGC С G G G G С CAG G CC G UG * 3'AUGAAG G G U U С G С U AG U С A CUCGAG GGCCGG GCCAGGCCGCG 

\ A A С AG * AG UU С * ч A A С AG С A G UU С ' 



A GA С GA С G A и G - A GA (; GA С G A U '' 

5'UACU UC UUGAGCGGUU AGU GGGC UC CUGGUC CGGUCUGGCGU с 5'UACU UC UUGAGCGGUU AGU GGGC UC UUGGUC CGCUCUGGUAC с 

III I II I III III II 1 1 II III I 1 1 I II 1 1 1 III! Il Mill д ИМ II I III III II I I II im I II II IIM Mill II III 

S'AUGAAG GGUUCGCUAG UCA CUCGAG GGCCGG GCCAGGCCGCG 3'AUGAAG G GU U С GC U AG U С A CUCCAG AG С С GG G С С AG G CCG U G * 

АД С AG С д G UU С * \ А А С AG А А G UC С « 



(В) 



LA£ 



'"*^А GA ■ С GA С g'a си G А GA G AG G С .„líVurr irr ггг\ 

5'UACU UC UUGAGCGGUU AGU GGGCUC UUGGUU CGGUCUGGCGU с 5'UACU UC UUGAGCGG UC GAG UCGGAUUUCUCG Ubü 1.Ь1.д 

НИМ I IM III IM I II III I I I I II III lllllll IUI , IUI II I III III I II III III II I I III II ' ' ' I' G 

3'AUGA AG GGUUCGCUAG UCA CUCGAG AG С CG G G CC A GAC С G UA ' 3' A U GA AG G GUU С GCU A G С UC /G С UU G A AGA GC "'•^"'■''i, 
A A С AG С AG UC С « ч A A * *g' GG ДА 

177Í '"5 



5'UACU Uc"uUGAGCGGUU^GU GGGCUC UU GG UC С GGUCU GG ÜAC с 5'UACU UC UU GAGCG GUU AG U GGGCUC UUGG UC CGGU CU GGUGU с 

M I III mill mil mill mi ^ тшити mi i i g 

3'AUGA AG GGUUCGCUAG UCA CUCGAG AGCC GG G CCA GGUC GUG * 3' A U GA AG G GU UCGCUAG UC A CUCGAG AGC С GG GCCA GGCCACG j" 

A« TACSAG II rr A AA CAG^A.G ULC 



; Д r,A / r GA с G A M / G A GA / С GA С G A U G 

5'UACU UC UUGAGCGGUU AGU GGGCUC UUGGUC CGGU С UGGCGU с 5'UACU UC UUGAGCGGUU AGU GGGCUC UUGG UC CGGU CUGGC AC с 

Hill m III I I I I II III III I I mill , MM II I III I II I I I III III lllllllllll . 

3'AUGA AG GGUUCGCUAG UCA CUCGAG AG CC GG GCCA GGCC G С G j' З'А U GA AG G GU UCGCUAG U С A CUCGAG AGC С GG GCCA GG CCGUG * 

^ A Д С AG С A G UU С - A A С AG A д G UU С A 



5'UACU UC UUGAGCGGUUAGU GGGCUC UUGGUC С GG U CUGGU GU °c 5'UACU UC UUGAGCGG UU AG U GGGCUC UUGGUC CGGUCUGGCGU с 

MM II I I I II III I I I I II III lllllllllll MM II I III I Ill MINI II I 

3'AUGA AG GGUUCGCUAGUCA CUCGAG AGCCGG GCCAGGCCGCG/ З'А U G A AG GGUUCGCUAG UCA CUCGAG AGCCGG GCCA GG С CGCG д« 

Ч A A С AG С Д G UU С \ A A С A G С A G UU С 



5'UACU UC UUGAGCGGUUAGU GGGCUC UUGGUC CGGUCUGGCGU с 5'UACU UC UUGAGCGGUUAGU GGGCUC UUGGUC CGGUCUGGCGU с 

IUI II I III III II II II III I I I III III lllllllllll. IIIMI I III III II I III III I I I III I II III I IIMIII Д 

3'AUGA AG GGUUCGCUAG UCA CUCGAG AGCC GG G С CA CGCC GC G д" З'А UG A AG GGUUCGCUAG UCA CUCGAG AGC С G G G CC A GG CCGCG 

A Д С AG С A G UU С . A A С AG С A G UC С 



(С) 



1700 1714 G "** 

5'UACU UC ÜUGAGCGGUu''aGU GGGCUC UUGGU c"cGGU CUGGCGU с 

III I II I Ml III II I I I III И I 

3'AUGAAG GGUUCGCUAGUCA CUCGAG AGCCGG GCCAGGCCGCGa 

\AA CAGCaG UUC 

1811 A 



FIG. 4. A-C. Secondary structure representations for stem 49 in tine 1 8S rRNA gene for 21 taxa. 



232 



100 



100 



92 



100 



HI 



62 



DUTRA-CLARKEETAL 

Monodonta labio 

Thais clavigera 

Aplysia sp. 

Siphonaria algesirae 

Oxyloma sp. 

Athoracophorus bitentaculatus 
Omalonyx matheroni 
Limicolaria kambeul 
Helix asperea 
Balea biplicata 
Bakerilymnaea cubensis 
Lymnaea glabra 
Lymnaea stagnalis 
Stagnicola palustns 
Fossaria truncatula 
65 1 — Lymnaea auricularia 
I — Radix peregra 
. QQ I — Biomphalaria alexandrina 
I — Btömphalaria glabrata 
Laevilocaulis alte 
Onchidella celte 



100 



[Taj- 



ea 



92 



с: 



ELASMOGNATHA 



STYLOMMATOPHORA 



Lymnaeidae 



Planorbidae 



SYSTELOMMATOPHORA 



FIG. 5. 50% majority-rule bootstrap conserisus tree from parsimony analysis based on 18S rRNA gene se- 
quences. The numbers above nodes indicate bootstrap values from 500 replicates. 



from their analysis. Moreover, Bargues & 
Mas-Coma (1997) discriminated species of 
the family Lymnaeidae based on the phyloge- 
netic information of the highly variable stem 
E10-1. 

Our alignment did not corroborate the find- 
ings of Kenchington et al. (1994). They de- 
scribed an eight base pair insertion located in 
a highly variable domain of the 18S rRNA 
gene (V-4, helix E23-5) as unique for the pul- 
monate family Achatinidae. For example, we 
found the same eight base pairs to be shared 
by the pulmonate families Succineidae, 
Siphonariidae, and Lymnaeidae; and by Atho- 
racophohdae, Helicidae and Onchididae (with 
only one change). Their findings could be 
considered a problem of taxon sampling, or 
could be simply an alignment problem. We re- 
ported only four of the nine highly variable 



subdomains of the 18S rDNA as referred by 
Kenchington et al. (1994) as phylogenetically 
important, because only those four were 
found to be highly variable and therefore more 
informative among the studied Euthyneura. 
Rosenberg et al. (1994) stressed the impor- 
tance of the alignment and of other factors 
such as bias in nucleotide composition, and 
the ratio of transition to transversion. Vawter & 
Brown (1993) pointed out there are no con- 
sistent transition to transversion biases in the 
18S rRNA gene. They found a С to T or vice- 
versa transition to be common, and also state 
there are phylogenetic biases in base compo- 
sition: Vertebrates are more G/C rich overall 
(1.24) than are the invertebrates (0.96). We 
also found changes in T to С (or С to T) to be 
common for our data set. 
The MP and ML analysis support unam- 



PHYLOGENETIC STUDY OF THE FAMILY SUCCINEIDAE 



233 













100 


— 










81 


69 


1 




22 






100 


|99 

74 ~ 


100 




43 




64 










68 






61 








91 


100 


34 














72 




26 


















93 r~ 



Monodonta labio 
Thais clavigera 

Aplysia sp. 

Biomphalaria glabrata 
Biomphalaria alexandrina 
Bal(erilymnaeacubensis 

Lymnaea glabra 
Lymnaea stagnalis 
Stagnicola palustris 
Fossariatruncatula 

Lymnaea auncularia 
Radix peregra 
Limicolaria kambeul 
Helix aspersa 
Balea biplicata 
Oxylomasp. 

Athoracophorus bitentaculatus 
Omalonyx matheroni 
Siphonaria algesirae 
Laevilocaulis alte 
Onchidella céltica 



Planorbidae 



Lymnaeidae 



EUTHYNEURA 



STYLOMMATOPHORA 



ELASMOGNATHA 



SYSTELOMMATOPHORA 



FIG. 6. Maximum likelihood tree based on 18S rRNA gene sequences. Numbers on the nodes represent 
bootstrap values out of 500 replicates. 



biguously the clade Elasmognatha on the 
nnain lineage of the pulmonates. However, 
both trees fail to support the monophyly of 
Succineidae. Perhaps there are undetectable 
honnoplasies or hidden mutations for the Atho- 
racophoridae that make their relationship with 
one of the Succineidae taxon artificially 
strong. Winnepenninckx et al. (1995) consid- 
ered an Euthyneura node without a represen- 
tative of the Opistobranchia. Thollesson 
(1999), based on the 16S rRNA gene data, 
found Opistobranchia was not monophyletic 
and suggested abandoning the taxon Opisto- 
branchia. This suggestion corroborates the 
hypothesis of Tillier et al. (1992, 1994) that 
Aplysia and Pulmonata are more closely re- 
lated to each other than is Aplysia to other 



nudibranchs. Tillier et al. (1992). using the D1 
domain of the 28S rRNA. also showed that 
the clade formed by Succinea (Succineidae) 
and Aneita (Athoracophohdae) was in a sister 
group position to all other pulmonates, ba- 
sommatophorans, and stylommatophorans, 
or it could be placed inside the stylom- 
matophorans. Our trees show the clade 
formed by Succineidae and Athoracophohdae 
taxa was positioned among the derived sty- 
lommatophorans and that they were not more 
related to Achatinldae or Helicidae than are 
those late taxa related to the systelom- 
matophorans, represented here by L. a/ieand 
O. céltica. Emberton et al. (1990), using par- 
tial sequence from 28S rRNA, discussed the 
position of basommatophorans in relation to 



234 



100 



60 



76 



DUTRA-CLARKEETAL. 

Monodonta labio 

Thais clavigera 

Aplysia sp. 

Siphonaha aigesirae 

Balea biplicata 



99 



I Oxyloma sp. 

r- Athoracophorus bitentaculatus 
93 L Omalonyx matheroni 

g^ Г- Helix aspersa 



{ 



100 



67 



Limicolaria kambeul 
Bakerilymnaea cubensis 
Fossaha tmncatula 
Lymnaea auricularia 
Radix peregra 



70 



Stagnicola palustris 



52P Lymnaea glabra 
L Lymnaea stagnalis 



^qqP Biomphalaria alexandrina 
Biomphalaria glabrata 



t 



r- Laevilocaulis alte 
- Onchidella céltica 



STYLOMMATOPHORA 



ELASMOGNATHA 



EUTHYNEURA 



Lymnaeidae 



Planorbidae 



SYSTELOMMATOPHORA 



FIG. 7. 50% nnajority-rule bootstrap consensus tree from parsimony analysis based on 18S rRNA gene se- 
quences excluded of bulges and unpaired nucleotides of the highly variable regions. The numbers above 
nodes indicate bootstrap values from 500 replicates. 



the styiomrnatophorans. Ва50глппа1орИога is 
paraphyletic, with lymnaeids + planorbids 
being sister to stylommatophorans when we 
conclude Siphonahidae does not represent 
the basonnmatophorans. Hubendick (1978) 
pointed out for the possibility of the basomm- 
matophorans to do not constitute a single 
phylogenetic unit. As Solem & Yochelson 
(1979) point out, there are problems in estab- 
lishing a direct relationship between basom- 



matophorans and stylommatophorans. They 
say the accepted position of the basom- 
matophoran as a stem group to various sty- 
lommatophoran is not supported by the his- 
torical sequence of the fossil record. Our 
results demonstrate the power of resolution of 
the complete sequences of 18S rDNA for 
studies of molluscan family and order rela- 
tionships, which includes from conserved to 
highly variable domains. 



PHYLOGENETIC STUDY OF THE FAMILY SUCCINEIDAE 



235 



ACKNOWLEDGEMENTS 

We thank Kenneth Emberton for useful 
comments on an early version of this manu- 
script, Thomas Wilke for very helpful com- 
ments on a later versions and Christine Spol- 
sky from the Department of Malacology of the 
Academy of Natural Sciences for helping with 
analysis of the data. We also thank Daniel 
Bramblett of the Department of Biochemistry 
and Molecular Genetics of the University of 
Alabama at Birmingham for his assistance 
with the secondary structure. K. M. Kjer of 
Rutgers University kindly assisted with the 
method of aligning sequence data including 
secondary structure notation. A. V. C. D.-C. is 
indebted to the Brazilian Council of Scientific 
Research (CNPq) for a doctorate scholarship. 
This work was supported by funds of the Betz 
Chair to J. R. S. and to George M. Davis, N. I. 
H. grant AI-1 1373. 



LITERATURE CITED 

ADAMKEWICZ, S. L., M. G. HARASEWYNCH, J. 
BLAKE, D. SAUDEK & С J. BULT 1997, A 
molecular phylogeny of the bivalve mollusks. 
Molecular Biology and Evolution. 14:61 9-629. 

ABOUHEIF E,, R. ZARDOYA & A. MEYER, 1998, 
Limitations of metazoan 18S rRNA sequence 
data: implication for reconstructing a phylogeny 
of the animal kingdom and inferring the reality of 
the Cambrian explosion. Journal of Molecular 
Evolution, 47: 394-405. 

AUSUBEL, F M., 1994, Current protocols in molec- 
ular biology, 2 vols. John Wiley & Sons, New 
York. 

BARQUES, M. D. & S. MAS-COMA, 1997, Phylo- 
genetic analysis of lymnaeid snails based on IBS 
rDNA sequences. Molecular Biology and Evolu- 
tion, 14:569-577. 

BOORE J. L. & W. M. BROWN, 1994, Mitochondrial 
genomes and the phylogeny of mollusks. Ttie 
Nautilus, Suppl. 2: 61-78. 

CABOT E. L., 1993, EAT (Eyeball Analysis Tool- 
box). Distributed by the author, Simon Fraser 
University, Vancouver, Canada. 

CABOT E. L. & A. T BECKENBACH, 1989, Simul- 
taneous editing of multiple nucleic acid and pro- 
tein sequences with ESEE. Computer Applica- 
tions in the Biosciences (CABIOS), 5: 233-234. 

DUTRA-CLARKE, A. V. C, 1996, Morphology and 
molecular phylogeny of Succineidae, a family of 
land snails. Ph.D. dissertation. Drexel University, 
Philadelphia. 

EMBERTON, K. C, G. S. KUNCIO, G. M. DAVIS, S. 
M. PHILLIPS, K. M. MONDEREWICZ Y H. GUO, 
1990, Comparison of recent classifications of 
Stylommatophoran land-snail families, and eval- 



uation of large-ribosomal-RNA sequencing for 
their phylogenetics. Malacologia 31 : 327-352. 

FELSENSTEIN, J., 1993, PHYLIP: Phylogeny in- 
ference package, version 3.5c. Distributed by the 
author, Department of Genetics, University of 
Washington, Seattle. 

GUTTELL, R. R., N. LARSEN & С R. WOESE, 
1994, Lessons from an evolving rRNA: 16S and 
23S rRNA structures from a comparative per- 
spective. Microbiological Review, 58: 10-26. 

HILLIS, D. M. & M, T DIXON, 1991, Ribosomal 
DNA: molecular evolution and phylogenetic infer- 
ence. Quarterly Review of Biology 66: 41 1 -453. 

HUBENDICK, В., 1978, Systematics and compara- 
tive morphology of the Basommatophora. In: v. 
FRETTER & J. PEAKE eds., Pulmonates, Vol. 2A. 
Systematics, evolution and ecology: 1 -47. Acad- 
emic Press, London. 

JUCKER F M. & A. PARDI, 1995, GNRAtetraloops 
make a U-turn. RA/A 1: 219-222. 

KENCHINGTON, E. L., D. L. RODDICK, R. K. 
SINGH, С J. BIRD, 1994, Analysis of small-sub- 
unit rRNA gene sequences from six families of 
mollusks. Journal of Mahne Biotechnology 1: 
215-217. 

KJER, K. M., 1995, Use of rRNA secondary struc- 
ture in phylogenetic studies to identify homolo- 
gous positions: an example of alignment and 
data presentation from frogs. Molecular Phyloge- 
netics & Evolution, 4: 314-330. 

KJER, K. M., G. D. BALDRIDGE & A. M. FALLON, 
1994, Mosquito large subunit ribosomal RNA: si- 
multaneous alignment of primary and secondary 
structure. Biochimica and Biophysica Acta, 1217: 
147-155. 

MATZURA, O. & A. WENNBORG, 1996, RNAdraw: 
an integrated program for RNA secondary struc- 
ture calculation and analysis under 32-bit mi- 
crosoft windows. Computer Applications in the 
Biosciences (CABIOS), 12: 247-249. 

NEEFS, J.-M., Y VAN DE PEER, L. HENDRIKS & 
R. DE WÄCHTER, 1993, Compilation of small ri- 
bosomal subunit RNA sequences. Nucleic Acid 
Research, 18, Suppl: 2237-2317. 

NORDSIECK, H., 1986, The system of the Stylom- 
matophora (Gastropoda), with special regard to 
the systematic position of the Clausiliidae, II. Im- 
portance of shell and distribution. Archiv für Mol- 
luskenkunde. 117: 93-116. 

PONDER, W. F & D. R. LINDBERG, 1 997, Towards 
a phylogeny of gastropod molluscs: an analysis 
using morphological characters. Zoological Jour- 
nal of the Linnean Society 1 1 9: 83-265. 

ROSENBERG, G., G. M. DAVIS, G. S. KUNCIO & 
M. G. HARASEWEYCH, 1994, Preliminary Ribo- 
somal RNA Phylogeny of Gastropod and Union- 
oidean Bivalve Mollusks. The Nautilus, Suppl. 2: 
111-121. 

SCHILEYKO, A. A., 1978, Peculiarities of the struc- 
ture of the excretory system of the Pulmonata in 
relation to subclass classification. Malacological 
Review, 11: 68-70. 

SOLEM, A., 1978, Classification of the land Mol- 



236 



DUTRA-CLARKE ETAL. 



lusca. Pp. 49-97, In: v. fretter & J. peake, eds., 
Pulmonates. Vol. 2A, Systematics. evolution and 
ecology. Academic Press. London. 

SOLEM, A., 1979, Biogeographical significance of 
land snails. Paleozoic to Recent. Pp. 277-287, 
In: J. GRAY, & A. BOUCOT, eds., Historical blogeog- 
raphy. plate tectonics, and changing environment 
Corvallis. 

SOLEIVI, A., 1984, A world model of land snail di- 
versity and abundance. Pp. 6-22, In: a. solem & 
A. с VAN BRUGGEN, eds., World-wide snails: bio- 
geographical studies on non-marine Mollusca. 
Brill, Leiden, 

SOLEM, A. & E. YOCHELSON, 1979. North Amen- 
can Paleozoic land snails, with a summary of 
other Paleozoic nonmarine snails. United States 
Geological Survey Professional Paper. 1072: 
1-42, pis. 1-10. 

SPOLSKY, С M., G. M. DAVIS & Z. Yl, 1996, 
Sequencing methodology and phylogenetic 
analyses: citocrome b gene sequence reveals 
significant diversity in Chinese populations of On- 
comelania (Gastropoda: Pomatiopsidae). Mala- 
cologia. 38: 213-221. 

SWOFFORD. D. L., 1998, PAUP: Phylogenetic 
analysis using parsimony, version 4.0. Labora- 
tory of Molecular Systematics. Smithsonian Insti- 
tution, Washington, D.C. 

THOLLESSON, M., 1999, Phylogenetic analysis of 
Euthyneura (Gastropoda) by means of the 16S 
rRNA gene: use of a "fast" gene for "Higher-level" 
phylogenies. Proceedings of the Royal Society of 
London. (B) 266: 75-83. 

TILLIER, S., 1981, South American and Juan Fer- 
nandez succineid slugs (Pulmonata). Journal of 
Molluscan Studies. 47: 125-146. 

TILLIER, S., 1984, Patterns of digestive tract mor- 
phology in the limacisation of helicarionid, suc- 
cineid and athoracophorid snails and slugs (Mol- 
lusca:Pulmonata). /Wa/aco/ogf/a, 25: 173-192. 

TILLIER, S., 1989, Comparative morphology, phy- 
logeny and classification of land snails and slugs 
(Gastropoda: Pulmonata). Malacologia. 30: 1- 
303. 

TILLIER, S., M. MASSELOT H. PHILIPPE & A. 
TILLIER, 1992, Phylogenie moléculaire des Gas- 
tropoda (Mollusca) fondee sur le sequencage 
partiel de l'ARN ribosomique 28S. Comptes Ren- 
dus deAcademie Sciences. Paris. (3)314: 79-85. 



TILLIER, S., M. MASSELOT J. GUERDOUX & A. 
TILLIER, 1994, Monophyly of major gastropod 
taxa tested from partial 28S-rRNA sequences, 
with emphasis on Euthyneura and hot-vent 
limpets Peltospiroidea. Nautilus. 108: 122-140. 

VAN DE PEER, Y, S. NICOLAI, R DE RUK & R. DE 
WÄCHTER, 1996. Database on the structure of 
small nbosomal subunit RNA. Nucleic Acid Re- 
search. 24: 86-91. 

VAWTER, L. & W. M. BROWN, 1993, Rates and 
patterns of base change in the small subunit h- 
bosomal RNA gene. Genetics. 134: 597-608. 

WINNEPENNINCKX, В., T BACKELJAU, Y VAN 
DE PEER & R. DE WÄCHTER, 1992, Structure 
of the small ribosomal subunit RNA of the pul- 
monate snail, Limicolaria kambeul, and phyloge- 
netic analysis of the Metazoa. FEBS Letters. 309: 
123-126. 

WINNEPENNINCKX, В., T BACKELJAU & R. DE 
WÄCHTER. 1994, Small Ribosomal Subunit 
RNA and the Phylogeny of Mollusca. The Nau- 
tilus. Suppl. 2: 98-110. 

WINNEPENNINCKX, В., T BACKELJAU & R. DE 
WÄCHTER, 1995, Phylogeny of Protostomate 
Worms derived from 18S rRNA Sequences. /Wo/- 
ecular Biology and Evolution. 12: 641-649. 

WINNEPENNINCKX, В., T BACKELJAU & R. DE 
WÄCHTER, 1996, Investigation of molluscan 
phylogeny on the basis of 18S rRNA sequences. 
Molecular Biology and Evolution. 1 3: 1 306- 1 31 7, 

WINNEPENNINCKX, В., G. STEINER, T BACKEL- 
JAU & R. DE WÄCHTER, 1998a, Details of gas- 
tropod phylogeny inferred from 18S rRNA 
sequences. Molecular Phylogenetics and Evolu- 
tion. 9: 55-63. 

WINNEPENNINCKX В., D. G. REID & T BACKEL- 
JAU, 1998b, Performance of 18S rRNA in 
Littorinid Phylogeny (Gastropoda: Caenogastro- 
poda). Journal of Molecular Evolution. 47: 586- 
596. 

WOESE, С R., S. WINKER & R. R. GUTEL, 1990, 
Architecture of ribosomal RNA: constraints on the 
sequence of "tetra-loops". Proceedings of the Na- 
tional Academy of Sciences, U.S.A.. 87: 8467- 
8471. 

Revised ms. accepted 26 November 2000 



MALACOLOGIA, 2001, 43(1-2): 237-311 

DEEP-SEA CRYPTOBRANCH DORID NUDIBRANCHS 

(MOLLUSCA, OPISTHOBRANCHIA) FROM THE TROPICAL WEST PACIFIC, 

WITH DESCRIPTIONS OFTWO NEW GENERA AND EIGHTEEN NEW SPECIES 

Ángel Valdés 

Department of Invertebrate Zoology and Geology, California Academy of Sciences, 
Golden Gate Park, San Francisco, CA 94118, U.S.A.; avaldes@calacademy.org 

ABSTRACT 

The study of a large collection of cryptobranchi dorid nudibranchs from deep waters in New 
Caledonia and the Philippines revealed the presence of Austrodoris kerguelenensis (Bergh, 
1884); 18 new species belonging to the genera Cadlina, Austrodoris, Geitodoris, Discodoris, 
Peltodoris, Paradoris, Diaulula, Rostanga, Sclerodoris, Baptodoris and Dendrodoris; and two 
previously undescribed genera, Goslineria and Pharodohs. The anatomy of all these species, in- 
cluding the digestive, reproductive, and nervous system, are studied in detail. 

All these species are clearly distinguishable from other members of their genera. Most of the 
species have a pale, simple background coloration, and two of them lack eyes. Both character- 
istics seem to be adaptations to living in deep waters. Other deep-water Atlantic and Pacific 
species of dorid nudibranchs have similar adaptations. The two new genera are characterized 
by the presence of large copulatory spines, numerous flexible spines in Goslineria. and two solid, 
bifid spines in Ptiarodohs. No other cryptobranch dorid genera previously described have simi- 
lar copulatory spines. 

Some of the species here described belong to genera previously reported from cold or tem- 
perate waters, such as Austrodoris, Cadlina and Diaulula. Most of the species belong to genera 
that are widespread in either cold, temperate or tropical waters {Rostanga, Paradoris, Geitodoris 
and Baptodoris), and only two belong to exclusively tropical genera (Sclerodoris and Den- 
drodoris). Vicariant events and vertical dispersal could explain the processes of speciation and 
the origin of these deep-water species. 

Key words: Mollusca, Nudibranchia, Doridina, deep-water. Pacific Ocean. 



INTRODUCTION 

In contrast to other groups of mollusks with 
a well-docunnentecl deep-sea occurrence and 
numerous described deep-water species, 
very little is known about deep-sea opistho- 
branch mollusks, and particularly about deep- 
sea dorid nudibranchs. 

To date, only three papers dealing with 
deep Atlantic species of dorids have been 
published. The first is Bouchet (1977), who 
described five new species and a new genus 
of cryptobranch dorids, including phyllidiids, 
from the northeast Atlantic. Later, Valdés & 
Ortea (1996) described two new deep-sea 
phyllidiids, also from the northeast Atlantic, 
and Valdés & Bouchet (1998a) described an 
abyssal new genus of Corambidae from the 
Norwegian Sea. 

The first report on deep-water Indo-Pacific 
dorids was Bergh's (1884) description of Ba- 
thydoris abyssorum Bergh, 1884, collected at 
4,435 m depth off New Ireland, Papua New 



Guinea, during the Challenger Expedition. 
Bergh (1884) also described Archidoris aus- 
tralis Bergh, 1884, collected off the Kerguelen 
Island at 1 73 m depth. Other dorids studied in 
that paper were collected from shallow water. 
Subsequently, Garcia et al. (1993) reported 
Austrodoris kerguelenensis (Bergh, 1884) 
from Antarctic deep waters. The genus Bathy- 
doris is collected from deep or cold shallow 
waters, and it is the only genus of dorid nudi- 
branchs that is consistently known from the 
deep sea (Wägele, 1989; Baranets, 1993; 
Valdés & Bertsch, 2000). 

There had not been a significant collecting 
effort of deep-sea opisthobranchs in the Indo- 
Pacific until the French Musorstom Expedi- 
tions. Three papers on dorid nudibranchs 
have been produced from the material col- 
lected in these expeditions: Valdés (2001) de- 
scribed 12 new species of Phyllidiidae (gen- 
era Phyllidia and Phyllidiopsis) from deep 
waters around New Caledonia; Valdés & 
Gosliner (in press) described four new 



237 



238 



VALUES 



species and a new genus of caryophyllidia- 
bearing dorids from New Caledonia and the 
Philippines: and Fahey & Gosliner (2000) de- 
scribed three new species of the genus Hal- 
gerda from these two areas and from Fiji. 

Despite this recent proliferation of papers, 
there are still numerous genera and families 
of dorids never reported from the deep sea. 
The present paper deals with the bulk of the 
collection of cryptobranch dorids collected 
during the f\/lusorstom Expeditions; it consti- 
tutes the first attempt to describe in detail the 
deep-water biodiversity of Indo-Pacific dorid 
nudibranchs. 



MATERIALS AND METHODS 

The material examined was collected during 
several French scientific expeditions to the 
southwest Pacific Ocean (Fig. 1) and the 
Philippines between the years 1 981 and 1 994, 
organized by the Institut de Recherche pour le 
Développement (IRD, formerly ORSTOM) and 
the Muséum National d'Histoire Naturelle, 
Paris. All specimens, including the type mate- 
rial, are deposited at the Laboratoire de Biolo- 
gie des Invertébrés Marins et Malacologie of 
the Muséum National d'Histoire Naturelle, 
Paris (MNHN), the Department of Invertebrate 
Zoology and Geology of the California Acad- 
emy of Sciences (CASIZ) and the Australian 
Museum, Sydney (AM). Registration numbers 
are not used in MNHN, and individual lots and 
specimens are identified by the unique combi- 
nation of the station number and cruise 
acronym. 

Descriptions of living animals are based on 
photographs or notes by collectors. All speci- 
mens available were dissected, and morpho- 
logical examination was facilitated by making 
a dorsal incision. The internal features were 
examined and drawn using a dissecting mi- 
croscope with a camera lucida. A portion of 
the mantle was critical-point dried for the 
Scanning Electron Microscope (SEM). Spe- 
cial attention was paid to the morphology of 
the reproductive system, digestive system, 
and central nervous system. The numbering 
of the nerves in the central nervous system 
was determined according to their relative po- 
sition on the ganglia. The buccal mass was re- 
moved and dissolved in 10% sodium hydrox- 
ide until the radula was isolated from the 
surrounding tissue. The radula was then 
rinsed in water, dried, and mounted for exam- 
ination with the SEM. 



DESCRIPTIONS 

Genus Cadllna Bergh, 1879 

Type Species: Doris repanda Alder & Han- 
cock, 1842, by monotypy [= Cadlina lae- 
ws (Linnaeus, 1767)]. 

Cadlina abyssicola Valdés, new species 
(Figs. 2A, 3, 4) 

Material Examined 

HOLOTYPE: East of New Caledonia, 
Bathus 1 Expedition, stn. CP670 (20°54'S, 
165°53'E), 394-397 m, 14 March 1993, 17 
mm preserved length, leg. P. Bouchet and B. 
Richer de Forges (MNHN). 

PARATYPES: New Caledonia, Musorstom 
4 Expedition, stn. DW222 (22°38'S, 
167"37'E), 535-560 m, 29 September 1985, 
one specimen 13 mm preserved length, dis- 
sected, leg. P. Bouchet and B. Richer de 
Forges (MNHN); stn. CC247 (22°09'S, 
167°13'E), 435-460 m, 4 October 1985, one 
specimen 20 mm preserved length, dis- 
sected, leg. P. Bouchet and B. Richer de 
Forges (MNHN). île des Pins, south of New 
Caledonia, SMIB 8 Expedition, stn. DW195 
(22°59'S, 168°21'E), 508-514 m, 1 February 
1993, one specimen 20 mm preserved length, 
dissected, leg. P. Bouchet and B. Richer de 
Forges (MNHN). South of New Caledonia, 
Bathus 2 Expedition, stn. CP735 (23°02'S, 
166°56'E), 530-570 m, 13 May 1993, one 
specimen 15 mm preserved length, leg. P. 
Bouchet and B. Richer de Forges (MNHN). 
Norfolk Ridge, New Caledonia, Bathus 3 Ex- 
pedition, stn. CP831 (23°04'S, 166°56'E), 
650-658 m, 30 November 1993, one speci- 
men 13 mm preserved length, leg. P. 
Bouchet, B. Richer de Forges and A. Waren 
(MNHN); stn. CP846 (23°03'S, 166°58'E), 
500-514 m, 1 December 1993, one specimen 
14 mm preserved length, leg. P. Bouchet, B. 
Richer de Forges and A. Waren (MNHN); stn. 
CP847 (23°03'S, 166"58'E), 405-411 m, 1 
December 1993, one specimen 15 mm pre- 
served length, leg. P. Bouchet, B. Richer de 
Forges and A. Waren (MNHN). Southwest of 
New Caledonia, Halipro 1 Expedition, stn. 
CP868 (21°14'S, 165"55'E), 430-455 m, 23 
March 1994, one specimen 12 mm preserved 
length, leg. B. Richer de Forges (MNHN); stn. 
CP869 (21°14'S, 165°55'E), 450-490 m, 23 
March 1994, three specimens 11-16 mm pre- 
served length, leg. B. Richer de Forges 
(CASIZ 121095). North of New Caledonia, 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



239 



16^ 



CORAL 
SEA 



Espj'ritu 
Sapto - 



^. 



jlaO 






Récifs 
d'Entrecasteaux 



18^ 



ñ- 



■ \ 

; ^ Ух 

Port-Vila Ç> '3, 



20' 



Récifs de 
'Astrolabe 




Cj Erromango 



Tanria 



Lifou^-\y. . : '^c 



о 



Anelghqwhat 



22° 



NEW 
CALEDONIA 



24' 



Mare 



Й 



;|^ île;des 
Pines 



о, 

'S- 

о- 

CO 



162° 164° 166° 168° 170° 

FIG. 1 . Map of the New Caledonia region, where most of the samples were collected. 



Bathus 4 Expedition, stn. DW941 (19°02'S, 
163°27'E), 270 nn, 8 August 1994, one speci- 
men 14 mnn preserved length, leg. B. Métivier 
and B. Richer de Forges (MNHN). 

External Morphology 

The body is somewhat elevated, oval (Fig. 
2A). The dorsum is covered with simple, con- 
ical tubercles. Some of them, more sparsely 
arranged, are much larger than the others. 
There are several, simple and isolated mantle 
glands around the mantle margin. The perfoli- 
ate rhinophores are composed of 30 lamellae. 
There are seven bipinnate branchial leaves. 



Ventrally, the oral tentacles are short and 
grooved (Fig. 3F). The anterior border of the 
foot is grooved but not notched. The mantle 
margin is about as wide as the foot. 

Based on the field notes, the background 
color of the living animals is uniformly white to 
cream. The apices of the larger tubercles are 
yellow. The rhinophores and gill have the 
same color as the dorsum. The mantle glands 
are yellow in the preserved specimens. 

Anatomy 

The posterior end of the oral tube has two 
strong retractor muscles (Fig. 3E), which are 



240 



VALDES 




FIG. 2. Preserved specimens. A, Cadllna abyssicola. new species, paratype from Musorstom 4 (stn. CC247); 
scale bar = 5 mm. B. Austrodoris kerguelenensis. Biocal (stn. DW33); scale bar = 2 mm. С Austrodoris 
caeca, new species, paratype from Halipro 1 (stn. CH876); scale bar = 5 mm. D. Pharodoris diaphora. new 
species, holotype; scale bar = 2 mm. E. Pharodoris philippinensis, new species, holotype; scale bar = 2 mm. 
F. Austrodoris laboutei, new species, holotype; scale bar = 2 mm. G. Geitodoris pallida, new species, holo- 
type: scale bar = 1 mm. H. Discodoris achroma, new species, paratype from Bathus 3 (stn. CP832); scale 
bar - 2 mm. I. Discodoris sp.; scale bar = 10 mm. 




FIG 3 Cadlina abyssicola, new species, paratype from SMIB 8 (stn. DW1 95). A. Dorsal view of the anatomy; 
scale bar = 1 mm B. Reproductive system; scale bar = 1 mm. С Detail of the ampulla and prostate con- 
nection- scale bar = 1 mm. D. Central nervous system; scale bar = 0.5 mm. E. Anterior portion of the diges- 
tive system- scale bar = 1 mm. F. Mouth area; scale bar = 1 mm. Abbreviations: a, ampulla; b buccal bulb; 
be bursa copulathx; bg, blood gland; bu, buccal ganglion; c, cerebral nerve; eg, cerebral ganglion; d, defer- 
ent duct; e, esophageal ganglion; f, female glands; g, genital nerve; h, hermaphrodite and digestive glands; 
ht heart- i intestine; 1, visceral loop; m, retractor muscle; o, esophagus; of, oral tube; p, pedal nerve, pi, 
pleural nerve; pig, pleural ganglion; pr, prostate; r, rhinophoral nerve; rs, renal synnx; s, seminal receptacle; 
sg, salivary gland; st, stomach; t, oral tentacle; v, vagina. 



242 



VALDES 



attached to the body wall. The small, oval, 
muscular buccal bulb has two additional mus- 
cles. Two long salivary glands connect to the 
buccal bulb at the sides of the esophageal 
junction. The buccal bulb is one-half as long 
as the oral tube. The jaws consist of numer- 
ous thin, unicuspid elements about 20 (.im 
long (Fig. 4D). The radular formula is 59 x 
(45.1.45) in a 20 mm preserved length speci- 
men. The rachidian teeth have 4-5 elongate 
denticles, none of them clearly larger than the 
others (Fig. 4A). The inner lateral teeth are 
hamate, having a single cusp and a series of 
denticles. The innermost lateral tooth has 3-4 
short denticles on the inner side and 6-7 
short, blunt denticles on the outer side. The 
following teeth have 7-10 blunt denticles only 
on the outer side. The teeth increase in size 
gradually towards the medial portion of the 
half-row. The mid-lateral teeth are hamate, 
with a long cusp, and they lack denticles (Fig. 
4B). The outermost teeth have 10-12 small 
denticles (Fig. 4C). The esophagus is long 
and connects directly to the digestive gland. 

The ampulla is long and convoluted; it nar- 
rows into the gonoduct, which branches into a 
short oviduct and the prostate (Fig. 3C). The 
oviduct enters the female glands near the 
center of the mass. The prostate is tubular 
and elongate (Fig. 3B); it narrows and ex- 
pands again into the short deferent duct. The 
deferent duct opens into a common atrium 
with the vagina. The penis is unarmed. The 
vagina is long and wide. At its proximal end, 
the vagina connects to the large, irregular 
bursa copulathx. From the distal end of the 
vagina, near the opening, a short duct con- 
nects to the seminal receptacle and the uter- 
ine duct. The bursa copulathx is about ten 
times larger than the seminal receptacle. 

In the central nervous system (Fig. 3D), the 
cerebral and pleural ganglia appear to be par- 
tially fused and distinct from the pedal gan- 
glia. There are four cerebral nerves leading 
from each cerebral ganglion, and two pleural 
nerves lead from each pleural ganglion. The 
buccal ganglia lie near the rest of the central 
nervous system, joined to the cerebral ganglia 
by two long nerves. Gastroesophageal, 
rhinophoral, and optical ganglia are present. 
The pedal ganglia are clearly separated, with 
two nerves leading from each. The pedal and 
parapedal commissures are enveloped to- 
gether with the visceral loop along all their 
length. 

The circulatory system (Fig. ЗА) consists of 



a heart and a single blood gland situated over 
the central nervous system. 

Etymology 

From the Ancient Greek abyssos (deep) 
and the Latin cola (dweller), in reference to 
the habitat of this species, used as a noun in 
apposition. 

Remarks 

Cadlina abyssicola is clearly distinguish- 
able from other species of the genus. All the 
species previously described have denticu- 
lated mid-lateral teeth (Rudman, 1984), 
whereas C. abyssicola has smooth mid-lat- 
eral teeth. Also, species of Cadlina, except 
Cadlina dubia Edmunds, 1981, have bifid jaw 
rodlets (Rudman, 1984), whereas in С 
abyssicola all of them are simple. Cadlina 
dubia, described from Ghana, differs from C. 
abyssicola in having much shorter radular 
teeth, all bearing strong denticles (Edmunds, 
1981). 

Cadlina willani Miller, 1980, from New 
Zealand, is the species with the closest geo- 
graphic range to С abyssicola. It is a white 
species with a mid-dorsal yellow sthpe and a 
yellow band around the mantle margin. It is 
very different from C. abyssicola, which is 
white with yellow spots. Moreover, the mor- 
phology of the radular teeth is very different 
between these two species. The inner lateral 
teeth of С abyssicola are narrow and elon- 
gate and have 6-7 short denticles on the 
outer side of the cusp, whereas those of C. 
willani are shorter and have only 3 denticles 
on the outer side (Miller, 1980). Also, the mid- 
lateral teeth of C. abyssicola are smooth, 
whereas in С willani the mid-lateral teeth 
have 7 strong denticles. 

Cadlina nigrobranchiata Rudman, 1985, 
from southern Australia is clearly distinguish- 
able from С abyssicola in having a black gill 
and black rhinophores (Rudman, 1985). Also, 
the radular morphology of these two species 
is very different. The rachidian teeth of С ni- 
grobranchiata are much shorter than those of 
С abyssicola. Moreover, the mid-lateral teeth 
of C. abyssicola are smooth, whereas in С 
nigrobranchiata they have several strong den- 
ticles. 

Schrödl (2000) reviewed the species of 
Cadlina from South America and Antarctica. 
All of them are clearly distinguishable from C. 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



243 




FIG. 4. Cadlina abyssicola. new species, paratype from SMIB 8 (stn. DW195). A. Inner lateral teeth; scale 
bar = 43 jam. B. Mid-lateral teeth; scale bar = 60 |.im. С Outer lateral teeth; scale bar = 43 |.im. D. Jaw ele- 
ments; scale bar = 30|лт. 



abyssicola in their radular morphology and 
anatomy. These five species - Cadlina ker- 
guelensis Thiele, 1912; С. sparsa (Odhner, 
1921); C. magellanica Odhner, 1926; С affi- 
nis Odhner, 1934; C. georgiensis Schrödl, 
2000 - have denticulate mid-lateral teeth, 
whereas they are smooth in C. abyssicola. In 



С affinis and С magellanica, the seminal re- 
ceptacle inserts in the middle of the vagina, in 
С kerguelensis and C. sparsa it inserts near 
the bursa copulatrix, whereas in C. georgien- 
sis and C. abyssicola the insertion is closer to 
the opening of the vagina. However, in C. 
abyssicola the seminal receptacle is more dis- 



244 



VALDES 



tal than in С. georgiensis and it is clearly 
stalked. In addition, the prostate and the am- 
pulla of С abyssicola appear to be longer 
than those of C. georgiensis. 

Cadlina sp. (Fig. 5) 

Material Examined 

New Caledonia, Biocal Expedition, stn. 
DW14 (22°47'S, 167°14'E), 440-450 m, 30 
August 1985, one specimen 5 mm preserved 
length, leg. P. Bouchet, B. Métivier and B. 
Richer de Forges (MNHN). 

External Morphology 

The body is somewhat elevated, oval. The 
dorsum is covered with simple, conical tuber- 
cles that are evenly arranged. The perfoliate 
rhinophores are composed of nine lamellae. 
There are five bipinnate branchial leaves. 
Ventrally. the oral tentacles are short and 
grooved. The antenor border of the foot is 
simple. The mantle margin is wider than the 
foot. 

The color of the living animal is unknown. 
The preserved specimen is uniformly white to 
cream. The rhinophores and gill have the 
same color as the dorsum. 

Anatomy 

The jaws consist of numerous thin, unicus- 
pid elements about 10 (.im long (Fig. 5D). The 
radular formula is 68 x (19.1.19) in a 5 mm 
preserved length specimen. The rachidian 
teeth have a large, single central cusp and 
5-6 blunt denticles on each side (Fig. 5A). 
The inner lateral teeth are wide, hamate, hav- 
ing a single cusp and a series of denticles. 
These teeth have 2-3 denticles on the inner 
side and 10-12 elongate denticles on the 
outer side. The teeth increase in size gradu- 
ally towards the medial portion of the half-row. 
The mid-lateral teeth are hamate, with a long 
cusp and 7-8 large denticles only on the outer 
side (Fig. 5B). The outermost teeth have 5-11 
denticles (Fig. 5C). 

The reproductive system of the single spec- 
imen collected was immature, so information 
on the genital morphology is not available. 

Remarks 

The radular morphology of this species is 
very distinct from other members of the genus 



Cadlina. The rachidian teeth have a number 
of small denticles on each side of the central 
cusp that are not present in any other species 
previously described (Rudman. 1984) 

However, since the color of the living animal 
is unknown, and the reproductive system of 
the single specimen collected is immature, I 
prefer not to name this species until new ma- 
terial becomes available. 

Genus Austrodoris Odhner, 1926 

Type Species: Archidoris rubescens Bergh, 
1898, by original designation [= Aus- 
trodoris l<erguelenensis (Bergh, 1884)]. 

Austrodoris kerguelenensis (Bergh, 1884) 
(Figs. 2B, 6, 7) 

Archidoris l<erguelenensis Bergh, 1884: 85- 

89, pi. 1,figs. 1-12. 
Austrodoris georgiensis Garcia et al., 1993: 

417-421, figs. 1-8, new synonymy 

herein. 
See Wägele (1990, 1993) for a complete list 

of synonyms. 

Material Examined 

New Caledonia, Biocal Expedition, stn. 
DW33 (23°10'S, 167°10'E), 675-680 m, 29 
August 1985, one specimen 13 mm pre- 
served length, leg. P. Bouchet, B. Métivier and 
B. Richer de Forges (MNHN). île des Pins, 
New Caledonia, SMIB 8 Expedition, stn. 
DW193 (25°59'S, 168°21'E), 500-508 m, 1 
February 1993, two specimens 10 mm pre- 
served length, leg. P. Bouchet and B. Richer 
de Forges (MNHN). 

External Morphology 

The body is oval, almost rounded and 
somewhat elevated (Fig. 2B). The whole dor- 
sum is covered with small, elongate tubercles. 
In general, tubercles are larger in the center of 
the dorsum. Some tubercles are clearly 
longer and are surrounded by areas with nu- 
merous short tubercles (Fig. 6D). The 
rhinophoral and branchial sheaths are edged 
by several long tubercles. The large, perfoli- 
ate rhinophores are composed of 38 lamellae. 
The gill consists of six short, bipinnate 
branchial leaves. 

Ventrally, there are two short, conical oral 
tentacles (Fig. 7E). The anterior border of the 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



245 




FIG. 5. Cadlina sp. specimen from Biocal (stn. DW14). A. Inner lateral teeth; scale bar = 15 ).im. B. Mid-lat- 
eral teeth; scale bar = 1 5 jam. С Outer lateral teeth; scale bar = 1 5 цт. D. Jaw elements; scale bar = 10 цт. 



foot is grooved but not notched. The mantle 
margin is wider than the foot. 

Based on the field notes, the color of the liv- 
ing animals is uniformly white, with yellowish 
tubercles. The rhinophores and gill are pale 
yellow. 



Anatomy 

The posterior end of the oral tube has six 
strong retractor muscles (Fig. 7C), which are 
attached to the body wall. The oval, muscular 
buccal bulb has two additional muscles. The 



246 



VALUES 




-.. ♦-<* •■'^,'^ ■— •■ ^ — ^ 

FIG. 6. Austrodoris kerguelenensis, specimen from SMIB 8 (stn. DW193). A. Inner lateral teeth; scale bar - 
43 |im. B. Mid-lateral teeth; scale bar - 60 |im. С Outer lateral teeth; scale bar = 60 |.tm. D. Dorsal tubercles; 
scale bar = 430 цт. 



buccal bulb is as long as the oral tube. The 
labial armature is snnooth. The radular for- 
mula is 36 X (56.0.56) in a 10 mm preserved 
length specimen. There are no rachidian 
teeth. The inner lateral teeth are hamate, hav- 
ing a single cusp, and they lack denticles (Fig. 
6A). The teeth increase in size gradually to- 
wards the medial portion of the half-row (Fig. 



6B). The outermost teeth are elongate and 
also lack denticles (Fig. 6C). The esophagus 
is long and connects to the stomach. 

The ampulla is long and convoluted; it nar- 
rows into the gonoduct, which branches into 
the short oviduct and the prostate. The 
oviduct connects to the female glands near 
the center of the mass (Fig. 7B). The prostate 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 
A /-^ В 

pr 



247 



I I 




FIG. 7. Austrodoris kerguelenensis, specimen from SMIB 8 (stn. DW193). A. Dorsal view of the anatomy; 
scale bar = 1 mm. B. Reproductive system; scale bar = 0.5 mm. С Anterior portion of the digestive system; 
scale bar = 0.5 mm. D. Central nervous system; scale bar = 0.5 mm. E. Mouth area; scale bar = 1 mm. Ab- 
breviations: a, ampulla; ab, abdominal ganglion; b, buccal bulb; be, bursa copulathx; bg, blood gland; bu, 
buccal ganglion; c, cerebral nerve; eg, cerebral ganglion; d, deferent duct; e, esophageal ganglion; f, female 
glands; g, genital nerve; h, hermaphrodite and digestive glands; ht, heart; i, intestine; I, visceral loop; m, re- 
tractor muscle; 0, esophagus; ot, oral tube; p, pedal nerve; pi, pleural nerve; pig, pleural ganglion; pr, 
prostate; r, rhinophoral nerve; s, seminal receptacle; sg, salivary gland; st, stomach; t, oral tentacle; v, vagina. 



248 



VALDES 



is tubular and convoluted; it expands again 
into the long and wide deferent duct. The def- 
erent duct opens into a common atrium with 
the vagina. The penis is unarmed. The vagina 
is short and connects distally to the oval bursa 
copulathx. From the bursa copulathx leads 
another duct that branches into the uterine 
duct and the seminal receptacle. The seminal 
receptacle has a short, convoluted stalk. The 
bursa copulathx is about three times larger 
than the seminal receptacle. 

In the central nervous system (Fig. 7D), the 
cerebral and pleural ganglia are fused and 
distinct from the pedal ganglia. There are four 
cerebral nerves leading from each cerebral 
ganglion, three pleural nerves leading from 
the right pleural ganglion and three from the 
left ganglion. The buccal ganglia lie near the 
rest of the central nervous system, joined to 
the cerebral ganglia by two long nerves. Gas- 
troesophageal, rhinophoral, and optical gan- 
glia are present. The pedal ganglia are clearly 
separated, with three nerves leading from the 
left ganglion and two from the right ganglion. 
The pedal and parapedal commissures are 
enveloped together with the visceral loop 
along most of their length. There is an ab- 
dominal ganglion on the right side of the vis- 
ceral loop. 

The circulatory system (Fig. 7A) consists of 
a heart and two blood glands situated in front 
and behind the central nervous system. 

Remarks 

The external morphology and anatomy of 
the specimens from New Caledonia are very 
similar to the descriptions by Bergh (1884) 
and Wägele (1990) of Austrodoris kerguele- 
nensis, and they clearly belong to the same 
species. In both the Antarctic and New Cale- 
donia specimens, the dorsal tubercles are 
rounded, some of them being clearly longer, 
surrounded by areas with numerous short tu- 
bercles. Also, the reproductive system of the 
New Caledonia specimens has a very long, 
muscular deferent duct, a short tubular 
prostate, and a large, convoluted ampulla, 
identical to the description of Wägele (1990) 
for A. kerguelenensis. The proportions and 
arrangement of the bursa copulatrix and sem- 
inal receptacle is also very similar between 
the Antarctic and New Caledonia animals. 
Moreover, the radula of A. kerguelenensis is 
composed of numerous simple, hamate teeth 
(Wägele, 1990), very similar to those de- 
scribed here. 



According to Wägele (1990), Austrodoris 
kerguelenensis is the only valid species of this 
genus. Recently, Garcia et al. (1993), de- 
scribed Austrodoris georgiensis based on a 
single specimen collected from South Geor- 
gia in the Atlantic Antarctic sector. The only 
difference between A. georgiensis ano A. ker- 
guelenensis is the presence of an elongate 
bursa copulatrix in the former. Because other 
features of both nominal species (e.g., exter- 
nal morphology, radula, other reproductive or- 
gans), are identical, it is likely that the single 
specimen assigned to A. georgiensis is just 
an aberrant specimen of A. kerguelenensis. 
Another possibility is that the bursa copulatrix 
is more variable than assumed until now. 

Austrodoris kerguelenensis, originally de- 
scribed from the Kerguelen Islands, is distrib- 
uted throughout the Atlantic sector of the 
Antarctica (Wägele, 1990; García et al., 
1993). Beuchet (1977) recorded A. kerguele- 
nensis from Atlantic waters off Uruguay (as 
Austrodoris macmurdensis). The present 
record, from New Caledonia, is a consider- 
able range extension for this species. 

Austrodoris caeca Valdés, new species 
(Figs. 2C, 8-10) 

Material Examined 

HOLOTYPE; Banc Combe, South Pacific, 
Musorstom 7 Expedition, stn. CP551 
(12°15'S, 177°28'W), 791-795 m, 18 May 
1992, 10 mm preserved length, leg. P. 
Bouchet, B. Métivierand В. Richer de Forges 
(MNHN). 

PARATYPES: Banc Combe, South Pacific, 
Musorstom 7 Expedition, stn. CP552 
(12°16'S, 177°28'W), 786-800 m, 18 May 
1992, one specimen 12 mm preserved length, 
dissected, leg. P. Bouchet, B. Métivier and B. 
Richer de Forges (MNHN). Banc Tuscarora, 
South Pacific, Musorstom 7 Expedition, stn. 
CP562 (11°48'S, 178°22'W), 775-777 m, 19 
May 1992, one specimen 12 mm preserved 
length, leg. P. Bouchet, B. Métivier and B. 
Richer de Forges (MNHN); stn. CP623 
(12°34'S, 178°15'W), 1280-1300 m, 28 May 

1 992, one specimen 1 8 mm preserved length, 
dissected, leg. P. Bouchet, B. Métivier and B. 
Richer de Forges (MNHN). South of New 
Caledonia, Bathus 2 Expedition, stn. CP766 
(22°10'S, 166°02'E), 650-724 m, 17 May 

1 993, one specimen 1 2 mm preserved length, 
leg. P. Bouchet and B. Richer de Forges 
(CASIZ 121096). Norfolk Ridge, New Caledo- 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



249 




FIG. 8. Austrodoris caeca, new species, paratype from Musorstom 7 (stn. CP552). A. Inner lateral teeth; 
scale bar = 60 цт. В. Mid-lateral teeth; scale bar ^ 75 |im. C. Outer lateral teeth; scale bar = 75 цт. D. Dor- 
sal tubercles; scale bar = 200 |дт. 



nia, Bathus 3 Expedition, stn. CC848 
{23°02'S, 166°53'E), 680-700 m, 1 Decem- 
ber 1993, two specimens 14 mm preserved 
length, leg. P. Bouchet, B. Richer de Forges 
and A. Waren (MNHN). New Caledonia, 
Halipro 1 Expedition, stn. CH876 (23°10'S, 
166°49'E), 870-1000 m, 31 March 1994, 23 



mm preserved length, dissected, leg. B. 
Richer de Forges (MNHN). Vanuatu, South 
Pacific, Musorstom 8 Expedition, stn. CP1074 
(15°48'S, 167°24'E), 775-798 m, 4 October 
1 994, one specimen 1 3 mm preserved length, 
dissected, leg. P. Bouchet and B. Richer de 
Forges (MNHN). 



250 



VALDES 




FIG. 9. Austrodoris caeca, new species, paratype from Musorstom 8 (stn. CP1074). A. Inner lateral teeth; 
scale bar = 60 цт. В. Mid-lateral teeth; scale bar = 1 00 |am. С Outer lateral teeth; scale bar = 75 |jm. D. Dor- 
sal tubercles; scale bar = 250 ¡im. 



External Morphology 

The body is oval, almost rounded and 
somewhat elevated (Fig. 2C). The whole dor- 
sum is covered with small, rounded tubercles. 
Some of them are irregularly distributed and 



larger than the others (Figs. 8D, 9D). The 
rhinophoral sheaths are elevated and covered 
with small tubercles. The large, perfoliate 
rhinophores are composed of 41 lamellae. 
The gill consists of six short, bipinnate 
branchial leaves. 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



251 




FIG. 10. Austrodohs caeca, new species, paratype from Musorstom 7 (stn. CP552). A. Dorsal view of the 
anatomy, scale bar = 1 mm. B. Reproductive system; scale bar = 1 mm. С Detail of several reproductive or- 
gans; scale bar = 1 mm. D. Anterior portion of the digestive system; scale bar = 1 mm. E, Central nervous 
system; scale bar = 0.5 mm. F Mouth area; scale bar = 1 mm. Abbreviations: a, ampulla; b, buccal bulb; be, 
bursa copulatrix; bg, blood gland; bu, buccal ganglion; c, cerebral nerve; eg, cerebral ganglion; d, deferent 
duct; e, esophageal ganglion; f, female glands; g, genital nerve; h, hermaphrodite and digestive glands; ht, 
heart; i, intestine; I, visceral loop; m, retractor muscle; o, esophagus; ot, oral tube; p, pedal nerve; pi, pleural 
nerve; pr, prostate; r, rhinophora! nerve; s, seminal receptacle; sg, salivary gland; st, stomach; v, vagina. 



252 



VALDES 



Ventrally, there are no oral tentacles (Fig. 
10F). The anterior border of the foot is 
grooved but not notched. 

The color of the living animals is unknown. 
The preserved specimens are uniformly 
cream or pinkish. The rhinophores and gill are 
pale cream. 

Anatomy 

The posterior end of the oral tube has six 
strong retractor muscles (Fig. 1 0D), which are 
attached to the body wall. The oval, muscular 
buccal bulb has two additional muscles. The 
buccal bulb is three times longer than the oral 
tube. The labial armature is smooth. The 
radular formula is 21 x (30.0.30) in a 12 mm 
preserved length specimen and 26 x 
(36.0.36) in a 13 mm preserved length speci- 
men. There are no rachidian teeth. The inner 
lateral teeth are hamate, having a single cusp, 
and they lack denticles (Figs. 8A, 9A). The 
teeth increase in size gradually towards the 
medial portion of the half-row (Figs. 8B, 9B). 
The outermost teeth are elongate but shorter 
than the adjacent ones, and also lack denti- 
cles (Figs. 8C, 9C). The esophagus is long 
and connects directly to the stomach. 

The ampulla is thin and elongate; it narrows 
into the gonoduct, which branches into the 
short oviduct and the prostate (Fig. IOC). The 
oviduct connects to the female glands near 
the center of the mass. The prostate is tubular 
and elongate (Fig. 10B); it narrows slightly 
and expands into the long, wide and strongly 
muscular deferent duct. The deferent duct 
opens into a common atrium with the vagina. 
The penis is unarmed and very long, about 
2/3 of the ejaculatory portion of the deferent 
duct length. The vagina is elongate. At its 
proximal end, the vagina connects to the oval 
bursa copulatrix. From the bursa copulatrix 
leads another duct that connects to the semi- 
nal receptacle and the uterine duct. The sem- 
inal receptacle has a long, convoluted stalk. 
The bursa copulatrix is about eight times 
larger than the seminal receptacle. 

In the central nervous system (Fig. 10E), 
the cerebral and pleural ganglia are fused and 
distinct from the pedal ganglia. There are four 
cerebral nerves leading from each cerebral 
ganglion, and two pleural nerves lead from 
each pleural ganglion. The buccal ganglia lie 
near the rest of the central nervous system, 
joined to the cerebral ganglia by two long 
nerves. Gastroesophageal, rhinophoral, and 
optical ganglia are present. There are no 



eyes. The pedal ganglia are clearly sepa- 
rated, with three nerves leading from each. 
The pedal and parapedal commissures are 
enveloped together with the visceral loop 
along most of their length. 

The circulatory system (Fig. 10A) consists 
of a heart and two blood glands situated in 
front and behind the central nervous system. 

Etymology 

From the Latin caecum (blind), in reference 
to the lack of eyes in this species. 

Remarks 

The genus Austrodoris is very closely re- 
lated to Archldoris Bergh, 1878. According to 
Wägele (1990), the main differences between 
these two genera are that in Austrodoris most 
of the length of the deferent duct is encased 
within a muscular sheath, there is no glans 
penis, and the seminal receptacle and bursa 
copulatrix insert opposite and not serially. The 
genus Austrodoris appears to be restricted to 
the Southern Hemisphere, whereas Arctii- 
doris is mainly distributed in the Northern 
Hemisphere. An anatomical study and com- 
parison between the type species of both gen- 
era is necessary before their systematic sta- 
tus can be determined. In the meanwhile, I 
follow Wägele's (1990) criteria and maintain 
Austrodoris as a valid genus. 

Austrodoris caeca clearly belongs to the 
genus Austrodoris in lacking a glans penis, 
having a very large, elongate and strongly 
muscular deferent duct, longer than the 
prostate, smooth and hamate radular teeth, 
and a smooth labial cuticle. 

Anatomically, A. caeca differs from Aus- 
trodoris kerguelenensis in having a seminal 
receptacle with a long stalk, having a much 
shorter ampulla, and in lacking eyes. In addi- 
tion, the outermost lateral teeth of A. caeca 
are very short compared to the mid-laterals, 
whereas in A. I<erguelenensis they are pro- 
portionally larger. 

Austrodoris /aboufe/ Valdés, new species 
(Figs. 2F 11, 12) 

Material Examined 

HOLOTYPE; East of New Caledonia, 
Bathus 1 Expedition, stn. CP711 (21"43'S, 
166°36'E), 315-327 m, 19 March 1993, one 
specimen 15 mm preserved length, dis- 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



253 




®l 




к 


^^Ш' 


ff/ ^ 


''ч 


Ш 




Г^ШЕ^^Н 




FIG. 11. Austrodoris laboutei, new species, holotype. A. Inner lateral teeth; scale bar = 43 цт. В. Mid-lateral 
teeth; scale bar = 75 цт. С, Outer lateral teeth; scale bar = 43 |.im. D, Dorsal tubercles; scale bar = 75 jam. 



sected, leg. P. Bouchet and B. Richer de 
Forges (MNHN). 

External Morphology 

The body is elongate and high (Fig. 2F). 
The mantle margin is very reduced. The 
whole dorsum is covered with small, rounded 
tubercles, all of them similar in size (Fig. 11 D). 



The rhinophoral sheaths are low, situated 
very anteriorly, and covered with small tuber- 
cles. The large, perfoliate rhinophores are 
composed of 19 lamellae. The gill sheath has 
a wide opening and it is situated very posteri- 
orly. The gill consists of seven long, tripinnate 
branchial leaves. 

Ventrally, the oral tentacles are wide, short, 
and grooved (Fig. 1 2E). The anterior border of 



254 



VALDES 





c1-3 



pl1-3 






FIG. 12. Austrodoris laboutei new species, holotype. A. Dorsal view of the anatomy; scale bar = 1 mm. B. 
Reproductive system; scale bar = 0.5 mm. С Anterior portion of the digestive system; scale bar = 1 mm. D. 
Central nervous system; scale bar = 0.5 mm. E. Mouth area; scale bar = 1 mm. Abbreviations: a, ampulla; 
ag, accessory gland; b, buccal bulb; be, bursa copulatrix; bg, blood gland; bu, buccal ganglion; c, cerebral 
nerve; d, deferent duct; e, esophageal ganglion; f, female glands; g, genital nerve; h, hermaphrodite and di- 
gestive glands; ht, heart; i, intestine; I, visceral loop; m, retractor muscle; o, esophagus; of, oral tube; p, pedal 
nerve; pi, pleural nerve; pr, prostate; r, rhinophoral nerve; s, seminal receptacle; sg, salivary gland; st, stom- 
ach; t, oral tentacle; v, vagina. 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



255 



the foot is grooved but not notched. The foot 
is wide. 

Based on the field notes, the color of the liv- 
ing aninnals is cream grayish. The dorsum is 
covered with a number of small, brown spots. 
The rhinophores are pale brown, and the gill 
is cream grayish with brown spots. The pre- 
served specimen is uniformly cream. 

Anatomy 

The posterior end of the oral tube has four 
strong retractor muscles (Fig. 12C), which are 
attached to the body wall. The oval, muscular 
buccal bulb has two additional muscles. Two 
long salivary glands are attached to the buc- 
cal bulb at the point where the esophagus 
connects. There is another glandular struc- 
ture that connects ventrally to the buccal bulb 
at the point where the oral tube opens into the 
buccal bulb. The buccal bulb is one-third the 
length of the oral tube. The labial armature is 
smooth. The radular formula is 15 x (16.0.16) 
in a 16 mm preserved length specimen. There 
are no rachidian teeth. The inner lateral teeth 
are hamate, having a very long, thin cusp that 
lacks denticles (Fig. IIA). The teeth increase 
in size suddenly towards the medial portion of 
the half-row. The mid-lateral teeth are long, 
having a short, conical cusp, and they lack 
denticles (Fig. IIB). The outermost teeth are 
small and also lack denticles (Fig. 11C). The 
esophagus is long and connects directly to 
the stomach. 

The ampulla is wide and convoluted; it nar- 
rows into the gonoduct, which branches into 
the long oviduct and the prostate (Fig. 12B). 
The oviduct connects to the female glands 
near the center of the mass. The prostate is 
tubular and elongate; it narrows slightly and 
expands again into the wide deferent duct. 
The deferent duct opens into a common 
atrium with the vagina. The penis occupies 
the whole ejaculatory portion of the deferent 
duct. The vagina is short. At its proximal end, 
the vagina connects to the irregular bursa 
copulatrix and to another short, wide duct that 
connects to the seminal receptacle and the 
uterine duct. The seminal receptacle has a 
short stalk. The bursa copulatrix is about eight 
times larger than the seminal receptacle. 

In the central nervous system (Fig. 12D), 
the cerebral and pleural ganglia are fused and 
distinct from the pedal ganglia. There are 
three cerebral nerves leading from each cere- 
bral ganglion, and three pleural nerves lead 
from each pleural ganglion. The buccal gan- 



glia lie near the rest of the central nervous 
system, joined to the cerebral ganglia by two 
long nerves. Gastroesophageal, rhinophoral, 
and optical ganglia are present. The pedal 
ganglia are clearly separated, with three 
nerves leading from each. The pedal and 
parapedal commissures are enveloped to- 
gether with the visceral loop. 

The circulatory system (Fig. 12A) consists 
of a heart and two blood glands situated in 
front and behind the central nervous system. 

Etymology 

After Pierre Laboute, who photographed 
specimens studied in this paper. 

Remarks 

Austrodoris laboutei belongs to the genus 
Austrodoris in lacking a glans penis, having a 
strongly muscular deferent duct, smooth and 
hamate radular teeth, and a smooth labial cu- 
ticle. Other features of this species that are 
also present in members of the genus Aus- 
trodoris are short, non-digitiform oral tenta- 
cles and simple dorsal tubercles. However, 
the deferent duct of A. laboutei is much 
shorter than in other species of the genus, 
and there is a gland that connects the oral 
tube and the buccal bulb and an accessory 
gland in the reproductive system, both of 
which are absent in other members of the 
genus. The allocation of A. laboutei in the 
genus Austrodoris is thus provisional, until a 
phylogenetic analysis of other related species 
will allow a more precise definition of the di- 
agnostic characters of the genera Archidoris 
and Austrodoris. 

Austrodoris laboutei is clearly distinguish- 
able from other species of the genus by the 
body shape, with a very reduced mantle mar- 
gin. The coloration of this species, cream 
grayish with small brown spots is different 
from that of A. kerguelenensis, which is uni- 
formly white with yellowish tubercles. 

Anatomically, A. laboutei differs from Aus- 
trodoris kerguelenensis and A. caeca in hav- 
ing an accessory gland in the reproductive 
system, a much longer prostate, and a very 
large and irregular bursa copulatrix. In addi- 
tion, the innermost and outermost radular 
teeth of A. laboutei are very long and thin 
compared to those of other species of the 
genus. On the contrary, the mid-laterals of A. 
laboutei are stronger than those of A. kergue- 
lenensis and A. caeca. 



256 



VALDES 



Genus Goslineria Valdés, new genus 

Type Species: Goslineria callosa Valdés, new 
species, here designated. 

Diagnosis 

Body elevated, oval, stiffened by numerous 
integumentary spicules. Dorsum covered with 
simple, conical tubercles. Anterior border of 
the foot grooved, not notched. Labial cuticle 
unarmed. Radula without rachidian teeth. 
Inner and mid-lateral teeth simple, hamate. 
Outermost lateral teeth with numerous, small 
denticles. Prostate flattened, flattened. Penis 
unarmed. Genital atrium with several large 
sacs, each containing a long, simple, flexible 
spine. 

Etymology 

Dedicated to Terry Gosliner, who made in- 
valuable comments on the manuscript and 
provided financial support for this study. 

Remarks 

The presence of several sacs in the repro- 
ductive system, each containing a flexible cop- 
ulatory spine, is the most distinctive feature of 
this new genus. Species of Paradoris may also 
have sacs with copulatory spines associated 
with the atrium, but in this genus the spines are 
rigid. Besides, species of Parador/s have jaws, 
armed with numerous denticles, whereas in 
Goslineria the labial cuticle is smooth. The 
new genus Pharodoris has two large, rigid 
copulatory spines. However, Pharodoris is 
different from Goslineria in having bifid spines, 
a highly elevated branchial sheath, and a tu- 
bular prostate. Other genera with copulatory 
spines are Hoplodoris. Asteronotus, Jorunna, 
and Sclerodoris, but in all those the spines 
are rigid and situated in the accessory gland, 
not in separate sacs (Gosliner & Behrens, 
1998; Valdés & Gosliner, in press). Moreover, 
Jorunna and Sclerodoris have caryophyllidia, 
which are absent in Goslineria, Asteronotus, 
Pharodoris and Paradoris. 

Goslineria callosa Valdés, new species 
(Figs 13A, 14, 15, 16B) 

Material Examined 

HOLOTYPE: Philippines, Musorstom 2 Ex- 



pedition, stn. CP41 (13°16'N, 122°46'E), 
166-172 m, 25 November 1980, 21 mm pre- 
served length, leg. P. Bouchet (MNHN). 

External Morphology 

The body is elevated and oval (Fig. 13A). 
The dorsum is covered with simple, conical tu- 
bercles (Fig. 14D). Some tubercles are clearly 
larger than the others. The perfoliate rhino- 
phores are each composed of 22 lamellae. 
There are seven tripinnate branchial leaves. 
The rhinophoral and branchial sheaths are 
somewhat elevated, bearing numerous tu- 
bercles. Ventrally, there are no oral tentacles 
(Fig. 15F). The anterior border of the foot is 
grooved, not notched. The mantle margin is as 
wide as the foot. 

Based on the photographs, the color of the 
living animal is uniformly pale cream. The 
rhinophores and gill have the same color as 
the dorsum. 

Anatomy 

The posterior end of the oral tube has six 
strong retractor muscles (Fig. 1 5E), which are 
attached to the body wall. The oval, muscular 
buccal bulb has two additional muscles. The 
buccal bulb tube is about twice as long as 
the oral tube. The labial cuticle is smooth. The 
radular formula is 39 x (42.0.42) in a 21 mm 
preserved length specimen. There are no 
rachidian teeth. The inner and mid-lateral 
teeth are hamate, having a single cusp, and 
they lack denticles (Fig. 14A). The teeth in- 
crease in size gradually towards the medial 
portion of the half-row (Fig. 14B). The outer- 
most lateral teeth are also hamate and have 
numerous, small denticles (Fig. 140). The 
esophagus is very long, convoluted, and con- 
nects directly to the stomach (Fig. 15A). 

The ampulla is long and convoluted; it nar- 
rows into the gonoduct, which branches into a 
short oviduct and the prostate (Fig. 150). The 
oviduct enters the female glands near the 
nidamental opening. The prostate is large and 
flattened (Fig 15B); it narrows and expands 
again into the long, wide and muscular defer- 
ent duct. The deferent duct opens into a com- 
mon atrium with the vagina. The atrium has 
six long sacs, each one containing a long, 
flexible copulatory spine (Figs. 15B, 16B). 
The largest copulatory spine reaches up to 
1.5 mm in length. The penis is unarmed. The 
vagina is very wide. At its proximal end, the 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



257 




FIG. 1 3. Living animals. A. Goslineria callosa, new genus and species, holotype. B. Paradoris araneosa, new 
species, paratypefrom SMIB8 (stn. DW182-184), photo J. L. Menou. С Paradoris imperfecta, new species, 
holotype, photo P. Laboute. D. Dendrodoris brodieae, new species, paratype from Chalcal 2 (stn. DW81), 
photo P. Laboute. 



vagina connects to the large and oval bursa 
copulatrix. From the vagina leads another 
very short duct that connects to the seminal 
receptacle and the long uterine duct. The 
bursa copulatrix is about five times larger than 
the seminal receptacle. 

In the central nervous system (Fig. 15D), 
the cerebral and pleural ganglia are fused and 
distinct from the pedal ganglia. There are 
three cerebral nerves leading from each cere- 
bral ganglia, and two pleural nerves lead from 
each pleural ganglion. The buccal ganglia lie 
near the rest of the central nervous system, 
joined to the cerebral ganglia by two long 
nerves. Gastroesophageal, rhinophoral, and 
optical ganglia are present. The pedal ganglia 
are clearly separated, with four (right) or three 
(left) nerves leading from them. The pedal and 
parapedal commissures are enveloped to- 
gether with the visceral loop along all their 
length. 



The circulatory system (Fig. 15A) consists 
of a heart and a blood gland situated over the 
central nervous system. 

Etymology 

From the Latin callosus (hard skin), in ref- 
erence to the hard texture of the mantle of this 
species. 

Remarks 

This species is clearly distinguishable from 
other dorids previously described by the pres- 
ence of several, flexible copulatory spines in 
the reproductive system. 

Genus Pharodoris Valdés, new genus 

Type Species: Pharodoris diaphora Valdés, 
new species, here designated. 



258 



VALDES 




FIG. 14. Goslineria callosa, new genus and species, holotype. A. Inner lateral teeth; scale bar = 43 цт. В. 
Mid-lateral teeth: scale bar = 75 цт. С. Outer lateral teeth; scale bar = 43 цт. D. Dorsal tubercles; scale bar 
= 250мт. 



Diagnosis 

Body elevated, oval, stiffened by numerous 
integunnentary spicules. Dorsunn covered with 
simple, conical tubercles. Branchial sheath 
very elevated. Anterior border of the foot 



grooved, not notched. Oral tentacles short. 
Labial cuticle unarmed. Radula without 
rachidian teeth. Inner and mid-lateral teeth 
simple, hamate. Outermost lateral teeth with 
numerous, small denticles. Prostate long, 
tubular. Penis unarmed. Genital atrium with 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



259 




FIG. 15. Goslineria callosa, new genus and species, holotype. A. Dorsal view of the anatomy; scale bar = 1 
mm. B. Reproductive system; scale bar = 1 mm. С Detail of several reproductive organs; scale bar = 1 mm. 
D. Central nervous system; scale bar = 0.5 mm. E. Anterior portion of the digestive system; scale bar = 1 
mm. F, Mouth area; scale bar = 1 mm. Abbreviations: a, ampulla; b, buccal bulb; be, bursa copulatrix; bg, 
blood gland; bu, buccal ganglion; c, cerebral nerve; d, deferent duct; e, esophageal ganglion; f, female 
glands; g, genital nerve; h, hermaphrodite and digestive glands; ht, heart; i, intestine; I, visceral loop; m, re- 
tractor muscle; o, esophagus; ot, oral tube; p, pedal nerve; pi, pleural nerve; pr, prostate; r, rhinophoral nerve; 
rs, renal syrinx; s, seminal receptacle; sa, copulatory spine sac; sg, salivary gland; sp, copulatory spine; st, 
stomach; v, vagina. 



260 



VALDES 




FIG. 16. Copulatory organs. A. Solid structures in the accessory gland of Geitodoris pallida, new species, 
holotype. B. Copulatory spine of Goslineria callosa, new genus and species, holotype. 



two large glands, each containing a long, 
bifid, rigid spine. 



branchial sheath is not so elevated (Wägele, 
1990; Valdés & Gosliner, in press). 



Е1угло1оду 

From the Ancient Greek pharos (light- 
house), in reference to the shape of the 
branchial sheath, that resennbles a lighthouse 
tower. 



Remarks 

The new genus Pharodoris is clearly distin- 
guishable from other genera of cryptobranch 
dorids previously described. It has several 
unique features, such as a very elevated 
branchial sheath and the presence of two 
large glands in the atrium, armed with bifid, 
rigid copulatory spines. 

The presence of simple dorsal tubercles, a 
radula lacking rachidian teeth and having sim- 
ple, hamate lateral teeth (except the outer- 
most), absence of labial armature, presence 
of a tubular prostate, and the anterior border 
of the foot grooved but not notched, relate 
Pharodoris with Archidoris and Austrodoris. 
However, these two genera lack accessory 
glands with copulatory spines, and the 



Pharodoris diaphora Valdés, new species 
(Figs 2D, 17, 18, 19C) 

Material Examined 

HOLOTYPE: East of New Caledonia, 
Bathus 1 Expedition, stn. CP707 (21°43'S, 
166°36'E), 347-375 m, 19 March 1993, 19 
mm preserved length, leg. P. Bouchet and B. 
Richer de Forges (MNHN). 

PARATYPES: New Caledonia, Musorstom 
4 Expedition, stn. DW231 (22°34'S, 
167°10'E), 75 m, 1 October 1985, one speci- 
men 7 mm preserved length, leg. P. Bouchet 
and B. Richer de Forges (MNHN). East of 
New Caledonia, Bathus 1 Expedition, stn. 
CP710 (21 43'S, 166'36'E), 320-386 m, 19 
March 1993, one specimen 18 mm preserved 
length, leg. P. Bouchet and B. Richer de 
Forges (CASIZ 121097); stn. CP711 
(2ГЧЗ'5, 166^^36'E), 315-327 m, 19 March 
1993, one specimen 16 mm preserved length, 
dissected, leg. P. Bouchet and B. Richer de 
Forges (MNHN). Vanuatu, Musorstom 8 Ex- 
pedition, stn. DW964 (20'^20'S, 169°49'E), 
360-408 m, 21 September 1994, one speci- 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



261 




S 




I 


J 


if 


|Jb \ ШШл 


T ^ 


i 


l^m. 1 




1^1 


kl 


pfl 


\ ШШ' \ ^ 


^ 


y 




FIG. 17. Pharodoris diaphora, new genus and species, paratype from Bathus 1 (stn. CP711). A. Inner lateral 
teeth; scale bar = 43 |im. B. Mid-lateral teeth; scale bar = 75 |am. С Outer lateral teeth; scale bar = 60 цт. 
D. Dorsal tubercles; scale bar = 300 |jm. 



nnen 9 nnm preserved length, leg. P. Bouchet 
and B. Richer de Forges (MNHN). 

ADDITIONAL MATERIAL: Passe Deverd, 
outer Barrier Reef, near Koumac, New Cale- 
donia (20°45.2'S, 164°15.2'E), 53 m, 22 Oc- 
tober 1993, 3 specimens 10-12 mm long 
alive, leg. W. Rudman (AM C200596). 



External Morphology 

The body is somewhat elevated, oval (Fig. 
2D). The dorsum is covered with simple, con- 
ical tubercles. Some of them, more abundant 
in the center of the body are twice as large as 
the others. There are several spicules pro- 




p1-3 



FIG 18. Pharodoris diaphora, new genus and species, paratype from Bathus 1 (stn. CP711). A. Dorsal view 
of the anatomy; scale bar = 1 mm. B. Reproductive system; scale bar = 0.5 mm. С Detail of several repro- 
ductive organs; scale bar = 0.5 mm. D. Anterior portion of the digestive system; scale bar = 1 mm. E. Cen- 
tral nervous system; scale bar = 0.5 mm. F. Mouth area; scale bar = 1 mm. Abbreviations: a, ampulla; b, buc- 
cal bulb; be, bursa copulatnx; bg, blood gland; bu, buccal ganglion; c, cerebral nerve; eg, cerebral ganglion; 
d deferent duct; e, esophageal ganglion; f, female glands; g, genital nerve; h, hermaphrodite and digestive 
glands; ht, heart; i, intestine; 1 , visceral loop; m, retractor muscle; o, esophagus; ot, oral tube; p, pedal nerve; 
pg, pedal ganglion; pi, pleural nerve; pr, prostate; r, rhinophoral nerve; rs, renal syrinx; s, seminal receptacle; 
sa, copulatory spine sac; sg, salivary gland; sp, copulatory spine; st, stomach; t, oral tentacle; v, vagina. 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



263 




FIG. 19. Pharodoris, new genus, copulatory spines. A. B. philippinensis, new species, holotype, apex of a 
spine. B. B. philippinensis new species, holotype, general view of a spine. C. B. diapiiora new species, 
paratype from Bathus 1 (stn. CP711), general view of a spine, holotype. 



truding from the dorsal surface of the tuber- 
cles (Fig. 17D). The branchial sheath is very 
elevated, rising clearly over the dorsal surface 
of the body. The perfoliate rhinophores are 
composed of 30 lamellae. There are five bip- 
innate, very elongate branchial leaves. Ven- 
trally, the oral tentacles consist of two triangu- 
lar prolongations on each side of the buccal 
area (Fig. 18F). The anterior border of the foot 
is grooved but not notched. The mantle mar- 
gin is narrower than the foot. 
Based on the field notes, the background 



color of the living animals is uniformly white to 
pale yellow. The rhinophores and gill have the 
same color as the dorsum. 

Three additional specimens of this species, 
which have not been studied for this paper, 
have been collected from New Caledonia by 
Bill Rudman (pers. comm.). His manuscript 
notes read as follows: mantle with low 
rounded tubercles, spicules radiating from 
them; central region (visceral hump) with 
brown speckling between tubercles and on 
sides of them; tips of tubercles translucent 



264 



VALDES 



clear; mantle margin translucent cream with 
some tubercles ringed in brown but most not; 
general appearance of brownish visceral 
hump and narrow translucent cream mantle 
margin; most remarkable feature is the highly 
developed tall and rigid gill pocket, same color 
and tuberculation as dorsum; six simple 
branchial leaves, translucent clear with white 
edging. It is clear from this description that 
these specimens are conspecific with the 
other material here examined. 



Anatomy 

The posterior end of the oral tube has six 
strong retractor muscles (Fig. 18D), which are 
attached to the body wall. The large, oval, 
muscular buccal bulb has two additional mus- 
cles. Two long salivary glands connect to the 
buccal bulb at the sides of the esophageal 
junction. The buccal bulb is four times longer 
than the oral tube. The labial armature is un- 
armed. The radular formula is 34 x (39.0.39) 
in a 16 mm preserved length specimen. The 
are no rachidian teeth. The inner lateral teeth 
are hamate, having a single cusp and one 
denticle on the outer side (Fig. 17A). The 
teeth increase in size gradually towards the 
medial portion of the half-row (Figs 17B). 
The mid-lateral teeth are hamate, with a long 
cusp, and they lack denticles. The three out- 
ermost teeth are very small and have 10-11 
small denticles (Fig. 17C). The esophagus is 
long and connects directly to the stomach 
(Fig. 18A). 

The ampulla is long and convoluted; it nar- 
rows into the gonoduct, which branches into a 
short oviduct and the prostate (Fig. 18C). The 
oviduct enters the female glands near the 
nidamental opening. The prostate is tubular 
and elongate (Fig. 18B); it narrows and ex- 
pands again into the short deferent duct. The 
deferent duct opens into a common atrium 
with the vagina. On the atrium, near the open- 
ing of the vagina, there are two large glands, 
each one containing a bifid, rigid spine about 
1 mm long (Figs. 18B, 19C). The penis is un- 
armed. The vagina is long and wide. At its 
proximal end, the vagina connects to the large 
and oval bursa copulatrix. From the medial 
part of the vagina leads the elongate seminal 
receptacle and the long uterine duct. 

In the central nervous system (Fig. 18E), 
the cerebral and pleural ganglia are fused and 
distinct from the pedal ganglia. There are 
three cerebral nerves leading from each cere- 



bral ganglion, and two pleural nerves lead 
from each pleural ganglion. The buccal gan- 
glia lie near the rest of the central nervous 
system, joined to the cerebral ganglia by two 
long nerves. Gastroesophageal, rhinophoral, 
and optical ganglia are present. The pedal 
ganglia are clearly separated, with three 
nerves leading from each. The pedal and 
parapedal commissures are enveloped to- 
gether with the visceral loop along most of 
their length. 

The circulatory system (Fig. 18A) consists 
of a heart and two blood glands situated in 
front and behind the central nervous system. 



Etymology 

From the Ancient Greek diaphoros (differ- 
ent), in reference to the strange shape of this 
animal. 



Remarks 

Pharodoris diaphora is different from all 
species of cryptobranch dorids previously de- 
scribed. The characteristic, very elevated 
branchial sheath is a unique feature of this 
genus. Internally, the presence of two large 
glands containing bifid, rigid spines is only 
present in this genus. For a comparison to 
other members of this genus, see Remarks on 
Pharodoris philippinensls. 



Pharodoris philippinensis Valdés, new 
species (Figs. 2E, 19A, B, 20, 21) 

Material Examined 

HOLOTYPE: Philippines, Musorstom 3 Ex- 
pedition, stn. CP121 (12°08'N, 121°18'E), 
73-84 m, 03 June 1985, 19 mm preserved 
length, dissected, leg. P. Bouchet and M. P. 
Triclot (MNHN). 



External Morphology 

The body is somewhat elevated, oval (Fig. 
2E). The dorsum is covered with simple, con- 
ical tubercles. Some of them, more abundant 
in the center of the body, are twice as large as 
the others. The branchial sheath is very ele- 
vated, rising clearly over the dorsal surface of 
the body. The perfoliate rhinophores are each 
composed of 36 lamellae. There are five bip- 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



265 



Ш^^^^^^^^^^Ш 




FWi 


¥Ш 4P^ ШШ 




№Чп 


àr^ 




НЦЦЬ^^^'^ ^к. Ш 


ж. J 




f ^ 


ш 




l^À 


^^% 


iL '^ 


^^^.^ш 


41 


)шЛ 


рЕь''^!^^^ 







FIG. 20. Pharodoris philippinensis, new genus and species, holotype. A. Inner lateral teeth; scale bar = 43 
|im. B. Mid-lateral teeth; scale bar - 60 цт. С. Outer lateral teeth; scale bar = 75 jam. 



innate, very elongate branchial leaves. Ven- 
trally, the oral tentacles consist of two triangu- 
lar prolongations on each side of the buccal 
area. The anterior border of the foot is 
grooved but not notched. The mantle margin 
is narrower than the foot. 
The color of the living animal is unknown. 



The preserved specimen is uniformly pale 
cream. 

Anatomy 

The labial armature is unarmed. The radu- 
lar formula is 39 x (44.0.44) in a 19 mm pre- 



266 



VALDES 




Remarks 

Pharodorls philippinensis differs from P. di- 
aphora in the radula and reproductive system 
morphology. The innermost lateral teeth of B. 
diaphora have a large denticle that is absent 
in B. philippinensis. Only few inner teeth of B. 
philippinensis have a small, rounded denticle 
on the inner side, whereas all the inner later- 
als of B. diaphora have a large, conical denti- 
cle. From the bursa copulathx of B. philip- 
pinensis emerge two ducts, one connecting to 
the vagina and the other, very short, branch- 
ing into the seminal receptacle and the uterine 
duct, whereas in B. diaphora a single duct 
emerges, branching into the vagina, the sem- 
inal receptacle and the uterine duct. 



FIG. 21. Pharodorls philippinensis, new genus and 
species, holotype, reproductive system. Abbrevia- 
tions: a. ampulla; be, bursa copulatrix; d, deferent 
duct; f, female glands: pr, prostate; s, seminal re- 
ceptacle; sa. copulatory spine sac; sp, copulatory 
spine; V, vagina. 



served length specimen. There are no rachid- 
ian teeth. The innermost lateral teeth are ha- 
mate, having a single cusp, and they lack 
denticles (Fig. 20A). Some inner lateral teeth 
may have a small, rounded tubercle on their 
inner side. The teeth increase in size gradu- 
ally towards the medial portion of the half-row 
(Fig. 20B). The mid-lateral teeth are hamate, 
with a long cusp, and they lack denticles. The 
three outermost teeth are very small and have 
8-10 small denticles (Fig. 20C). 

The ampulla is long and convoluted; it nar- 
rows into the gonoduct, which branches into a 
short oviduct and the prostate (Fig. 21). The 
oviduct enters the female glands near the 
nidamental opening. The prostate is tubular 
and elongate; it narrows and expands again 
into the short deferent duct. The deferent duct 
opens into a common atrium with the vagina. 
The atrium has two large glands, each one 
containing a bifid, rigid spine about 1 mm long 
(Figs. 19A, B, 21). The penis is unarmed. The 
vagina is long and wide. At its proximal end, 
the vagina connects to the large and rounded 
bursa copulatrix. From the bursa copulatrix 
leads a short duct that branches into the elon- 
gate seminal receptacle and the uterine duct. 

Etymology 

From the Philippines, the type locality of 
this species. 



Pharodoris sp. (Fig. 22) 

Material Examined 

Banc Argo, Coral Sea, Musorstom 5 Expe- 
dition, stn. 290 (23°06'S, 159°26'E), 300 m, 
11 October 1986, 14 mm preserved length, 
dissected, leg. P. Bouchet, B. Métivier and B. 
Richer de Forges (MNHN). 

External Morphology 

The body is somewhat elevated, oval. The 
dorsum is covered with simple, conical tuber- 
cles. Some of them are clearly larger than the 
others. The branchial sheath is elevated, ris- 
ing clearly over the dorsal surface of the body. 
The perfoliate rhinophores are composed of 
22 lamellae. There are six bipinnate, very 
elongate branchial leaves. Ventrally, the oral 
tentacles consist of two triangular prolonga- 
tions on each side of the buccal area. The an- 
terior border of the foot is grooved but not 
notched. The mantle margin is as wide as the 
foot. 

The color of the living animal is unknown. 
The preserved specimen is uniformly pale 
cream. 

Anatomy 

The labial armature is unarmed. The radu- 
lar formula is 33 x (40.0.40) in a 14 mm pre- 
served length specimen. The are no rachidian 
teeth. The innermost lateral teeth are hamate, 
having a single cusp, and they general lack 
denticles (Fig. 22A). Some inner lateral teeth 
may have a small, rounded tubercle on their 
inner side. The teeth increase in size gradu- 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



267 




FIG. 22. Pharodoris sp., specimen from Musorstom 5 (stn. 290). A. Inner lateral teeth, scale bar = 43 цт. В. 
Mid-lateral teeth; scale bar = 60 цт. С. Outer lateral teeth; scale bar = 60 ¡am. 



ally towards the medial portion of the half-row 
(Fig. 22B). The mid-lateral teeth are hamate, 
with a long cusp, and they lack denticles. The 
three outermost teeth are very small and have 
5-8 small denticles (Fig. 22C). 

The single specimen has the reproductive 
system partially developed. The two large 
glands associated with the atrium are visible, 
but some other organs are not discernible. 



Remarks 

The radula of Pharodoris sp. is very similar 
to that of Pharodoris philippinensis. In both, 
the mid-lateral teeth lack denticles, which are 
only present in the innermost and outermost 
lateral teeth. According to the available infor- 
mation, it is very likely that both animals be- 
long to the same species. However, in view of 



268 



VALDES 



the incomplete development of genital char- 
acters for this Pharodoris sp., I keep it provi- 
sionally separated. Moreover, since there is 
no information on the reproductive system 
and the external coloration of Pharodoris sp., 
I will leave it unnamed until more material and 
information becomes available. 

Genus Geitodoris Bergh, 1891 

Type Species: Doris complánala Verrill, 1880, 
by monotypy. 

Geitodoris pallida Valdés, new species 
(Figs2G, 16A, 23. 24) 

Material Examined 

HOLOTYPE: Norfolk Ridge, New Caledo- 
nia, Bathus 3 Expedition, stn. CP833 
(21 °14'S, 1 65°55'E), 441 -444 m, 30 Novem- 
ber 1993, 12 mm preserved length, dissected, 
leg. P. Bouchet, B. Richer de Forges and A. 
Waren (MNHN). 

External Morphology 

The body is elevated and oval (Fig. 2G). 
The dorsum is covered with irregular tuber- 
cles, having a number of spicules projecting 
all over the surface. There are some larger tu- 
bercles (up to 200 .um long) surrounded by 
smaller tubercles (Fig. 23E). The perfoliate 
rhinophores are composed of 22 lamellae. 
There are five unipinnate branchial leaves. 
Ventrally, the oral tentacles are short and tri- 
angular. The anterior border of the foot is 
notched and grooved (Fig. 24F). The mantle 
margin is about as wide as the foot. 

Based on the field notes, the background 
color of the living animal is uniformly pale 
cream. There are several pale brown spots in 
the mantle margin. The rhinophores and gill 
have the same color as the dorsum. 

Anatomy 

The posterior end of the oral tube has six 
strong retractor muscles (Fig. 24D), which are 
attached to the body wall. The small, oval, 
muscular buccal bulb has two additional mus- 
cles. The buccal bulb is ten times shorter than 
the oral tube. The jaws consist of numerous 
thin, unicuspid elements about 30 |am long 
(Fig. 23D). The radular formula is 18 x 
(23.0.23) in a 12 mm preserved length speci- 



men. There are no rachidian teeth. The inner 
lateral teeth are hamate, having a single cusp, 
and they lack denticles (Fig. 23A). The teeth 
increase in size gradually towards the medial 
portion of the half-row (Fig. 23B). The outer- 
most teeth are elongate plates with number of 
small denticles (Fig. 230). The esophagus is 
long and connects directly to the intestine. 

The ampulla is long; it narrows into the gon- 
oduct, which branches into a short oviduct 
and the prostate (Fig. 240). The oviduct en- 
ters the female glands near the center of the 
mass. The prostate is flattened and granular 
(Fig 24B); it is divided into two portions that 
are clearly distinguishable by their different 
texture and coloration. The largest portion is 
pale yellow and connects to the deferent duct, 
whereas the smallest portion is whitish and 
connects to the ampulla. The deferent duct is 
very long and narrow. It narrows and expands 
again into the short ejaculatory portion. The 
deferent duct opens into a common atrium 
with the vagina. The penis is unarmed. There 
is an accessory gland connected to the 
atrium, which has several rigid structures in- 
side. These structures are elongate, about 
1 50 |.im long (Fig 1 6A). The vagina is long and 
folded. At its proximal end, the vagina con- 
nects to the large and irregular bursa copula- 
trix. From the bursa copulatrix leads another 
long and convoluted duct that connects to the 
seminal receptacle and the uterine duct. The 
bursa copulatrix is about four times larger 
than the seminal receptacle. 

In the central nervous system (Fig. 24E), 
the cerebral and pleural ganglia are largely 
fused and distinct from the pedal ganglia. 
There are four cerebral nerves leading from 
each cerebral ganglion, and three pleural 
nerves lead from each pleural ganglion. The 
buccal ganglia lie near the rest of the central 
nervous system, joined to the cerebral ganglia 
by two long nerves. Gastroesophageal, 
rhinophoral, and optical ganglia are present. 
The pedal ganglia are clearly separated, with 
two nerves leading from each. The pedal and 
parapedal commissures are enveloped to- 
gether with the visceral loop along all their 
length. 

The circulatory system (Fig. 24A) consists 
of a heart and two blood gland situated in front 
and behind the central nervous system. 

Etymology 

From the Latin pallidus (pale), in reference 
to the color of this species. 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



269 




FIG. 23. Geitodoris pallida, new species, holotype. A. Inner lateral teeth; scale bar = 75 цт. В. Mid-lateral 
teeth; scale bar = 60 jam. С Outer lateral teeth; scale bar = 75 цпп. D. Jaw elennents; scale bar = 25 цт. E. 
Dorsal tubercles; scale bar = 150 цт. 



Remarks 

Geitodoris pallida clearly belongs to the 
genus Geitodoris in having the following com- 
bination of characters: anterior border of the 
foot notched and grooved, dorsal tubercles 



simple, presence of jaws, radula lacking 
rachidian teeth, inner lateral teeth hamate, 
outermost lateral teeth elongate, plate-like, 
prostate flattened, penis and vagina unarmed, 
presence of an accessory gland. 
This new species is characterized by the 



270 



VALDES 




p1-4 



FIG. 24. Geitodons pallida, new species, holotype. A. Dorsal view of the anatomy; scale bar = 1 mm. B. Re- 
productive system: scale bar = 0.5 mm. С Detail of several reproductive organs; scale bar = 0.5 mm. D. An- 
terior portion of the digestive system; scale bar = 1 mm. E. Central nervous system; scale bar = 0.5 mm. F. 
Mouth area; scale bar = 1 mm. Abbreviations: a, ampulla; ag, accessory gland; b, buccal bulb; be, bursa cop- 
ulatnx; bg, blood gland: bu, buccal ganglion; c, cerebral nerve; eg, cerebral ganglion; d, deferent duct; e, 
esophageal ganglion; f, female glands; g, genital nerve; h, hermaphrodite and digestive glands: ht, heart; i, 
intestine; I, visceral loop; m, retractor muscle; o, esophagus; ot, oral tube; p, pedal nerve; pg, pedal ganglion; 
pi, pleural nerve; pr, prostate; r, rhinophoral nerve; s, seminal receptacle; t, oral tentacle; v, vagina. 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



271 



presence of several solid structures, probably 
copulatory spines, in the accessory gland. 
The only described species of the genus with 
these structures Is Geitodoris pusae (Er. Mar- 
cus, 1955) described from southern Brazil. 
According to Er. Marcus (1955), G. pusae has 
a denticle on the inner side of the innermost 
lateral teeth, whereas it is absent in G. pallida. 
Another difference between these species is 
that the outermost lateral teeth of G. pallida 
have a number of small denticles that appear 
to be absent in G. pusae. In addition, the out- 
ermost teeth of G. pusae are much longer 
than the mid-laterals, whereas in G. pallida 
they are shorter. 

Other Pacific species of Geitodoris with a 
proximal geographic range are G. ohshimai 
Baba, 1936, and G. lutea Baba, 1937, from 
Japan, and G. sticta Miller, 1996, from New 
Zealand. Geitodoris ohshimai \s clearly distin- 
guishable from G. pallida in having denticles 
on the mid-lateral teeth (Baba, 1936). Geito- 
doris lutea has the outermost lateral teeth 
very elongate, longer than the mid-laterals 
and smooth (Baba, 1937), whereas in G. pal- 
lida they are shorter than the mid-laterals and 
bear numerous small denticles. Geitodoris 
sticta has short outermost lateral teeth with 
denticles, but in this species there are few, ir- 
regular denticles on the outer side of the cusp 
(Miller, 1996), whereas in G. pallida there are 
numerous, regularly arranged denticles on 
the inner side of the cusp. In addition, the re- 
productive system of G. sticta lacks an acces- 
sory gland that is present in G. pallida. 

Miller (1996) regarded the Australian spe- 
cies Discodoris palma Allan, 1932, and D. 
crawfordi Burn, 1969, as belonging to Geito- 
doris. According to the redescription of D. 
palma by Thompson (1975), this species has 
very elongate, smooth outer lateral teeth, 
which contrast with the short, denticulate outer 
laterals of G. pallida. The outer radular teeth of 
D. crawfordi are short and hamate (Burn, 
1 969), more similar to those of the genus Dis- 
codoris, and it is very likely that it belongs in 
this latter genus. Unfortunately, the reproduc- 
tive system of neither of these species has 
been described, so comparisons of the mor- 
phology of the genital organs is not possible. 

Genus Discodoris Bergh, 1877 

Type Species: Discodoris boholiensis Bergh, 
1877, by subsequent designation by O'- 
Donoghue (1926). 



Discodoris sp. (Figs. 21, 25, 26) 

Material Examined 

North of New Caledonia, Bathus 4 Expedi- 
tion, stn. CP910 (18°59'S, 163°09'E), 
560-608 m, 05 September 1994, 66 mm pre- 
served length, leg. B. Métivier and B. Richer 
de Forges (MNHN). 

External Morphology 

The body is elevated and oval (Fig. 21). The 
dorsum is covered with simple, elongate tu- 
bercles, all of them about 200 )im long (Fig. 
25E). The perfoliate rhinophores are com- 
posed of 35 lamellae. There are five bipinnate 
branchial leaves. The rhinophoral and 
branchial sheaths are somewhat elevated, 
bearing numerous tubercles. Ventrally, the 
oral tentacles are short and conical. The ante- 
rior border of the foot is notched and grooved 
(Fig. 26F). The mantle margin is narrower 
than the foot. 

The color of the living animals is unknown. 
The preserved specimen is uniformly pale 
cream. The rhinophores and gill have the 
same color as the dorsum. 

Anatomy 

The posterior end of the oral tube has six 
strong retractor muscles (Fig. 26D), which are 
attached to the body wall. The oval, muscular 
buccal bulb has two additional muscles. The 
oral tube is about twice as long as the buccal 
bulb. The jaws consist of numerous irregular 
elements, about 15 |jm long (Fig. 25D). The 
radular formula is 21 x (25.0.25) in a 66 mm 
preserved length specimen. There are no 
rachidian teeth. The inner lateral teeth are ha- 
mate, having a single cusp, and they lack 
denticles (Fig. 25A). The teeth increase in 
size gradually towards the medial portion of 
the half-row (Fig. 25A, B). The outermost 
teeth are also hamate and lack denticles (Fig. 
25C). The esophagus is very long, convoluted 
and connects directly to the stomach. 

The ampulla is very long and convoluted; it 
narrows into the gonoduct, which branches 
into a short oviduct and the prostate (Fig. 
26B). The oviduct enters the female glands 
near the nidamental opening. The prostate is 
elongate and granular; it narrows and ex- 
pands again into the long, wide and muscular 
deferent duct. The deferent duct opens into a 



272 



VALDES 




FIG. 25. Discodoris sp. A. Inner lateral teeth; scale bar = 200 цт. В. Mid-lateral teeth; scale bar = 150 цт. 
С. Outer lateral teeth; scale bar = 150 цт. D. Jaw elements; scale bar = 25 цт. E. Dorsal tubercles; scale 
bar = 250 цт. 



common atrium with the vagina. The penis is 
unarmed. The vagina is very wide; at its prox- 
imal end. it connects to the large and oval 
bursa copulatrix. From the vagina leads an- 
other long duct that connects to the seminal 
receptacle and the very long uterine duct (Fig. 
26C). The bursa copulatrix is about the same 
size as the seminal receptacle. 



In the central nervous system (Fig. 26E), 
the cerebral and pleural ganglia are fused and 
distinct from the pedal ganglia. There are 
three cerebral nerves leading from each cere- 
bral ganglion, and two pleural nerves lead 
from each pleural ganglion. The buccal gan- 
glia lie near the rest of the central nervous 
system, joined to the cerebral ganglia by two 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



273 




FIG 26 Discodoris sp. A. Dorsal view of the anatomy; scale bar = 2 тгл. В. Reproductive system; scale bar 
= 1 mm. С Detail of the seminal receptacle; scale bar = 1 mm. D. Anterior portion of the digestive system; 
scale bar = 1 mm. E. Central nervous system; scale bar = 1 mm. F Mouth area; scale bar = 2 mm. Abbrevi- 
ations: a, ampulla; b, buccal bulb; be, bursa copulatrix; bg, blood gland; bu, buccal ganglion; c, cerebral 
nerve; d, deferent duct; e, esophageal ganglion; f, female glands; g, genital nerve; h, hermaphrodite and di- 
gestive glands; ht, heart; i, intestine; I, visceral loop; m, retractor muscle; o, esophagus; ot, oral tube; p, pedal 
nerve; pi, pleural nerve; pr, prostate; r, rhinophoral nerve; s, seminal receptacle; sg, salivary gland; st, stom- 
ach; t, oral tentacle; v, vagina. 



274 



VALDES 



long nerves. Gastroesophageal, rhinophoral, 
and optical ganglia are present. The pedal 
ganglia are clearly separated, with two nerves 
leading from each. The pedal and parapedal 
commissures are enveloped together with the 
visceral loop along most of their length. 

The circulatory system (Fig. 26A) consists 
of a heart and two blood glands situated in 
front and behind the central nervous system. 

Remarks 

This species clearly belongs to the genus 
Discodoris as indicated by the presence of the 
following characters: dorsum covered with 
simple tubercles, presence of jaws, radula 
with hamate, smooth teeth, absence of ac- 
cessory gland and penis, and vagina un- 
armed. Other features of the genus Dis- 
codoris present in this species are foot 
notched and grooved, oval digitiform tenta- 
cles and prostate flattened. 

Numerous species have been assigned to 
the genus Discodoris, most of them from 
indo-Pacific tropical waters, but also from 
temperate and cold regions. Discodons sp. is 
the first species described from deep waters. 
The long vagina of this species appears to 
distinguish it from other members of the 
genus, but the lack of anatomical studies in 
most members of Discodoris makes difficult 
comparison with this new species. Consider- 
ing that only one specimen of this species is 
available and its external coloration is un- 
known, I prefer not to name this species until 
additional material becomes available. 

Discodoris actiroma Valdés, new species 
(Figs. 2H, 27, 28) 

Material Examined 

HOLOTYPE: New Caledonia, Musorstom 4 
Expedition, stn. CC245 (22°07'S, 167°11'E), 
415-435 m, 05 October 1985, 15 mm pre- 
served length, leg. P. Bouchet and B. Richer 
de Forges (MNHN). 

PARATYPES: New Caledonia, Biocal Ex- 
pedition, stn. CP109 (22"11'S, 167"16'E), 
495-515 m, 09 September 1985, one speci- 
men 12 mm preserved length, dissected, leg. 
P. Bouchet, B. Métivier and B. Richer de 
Forges (CASIZ 121098). New Caledonia, Mu- 
sorstom 4 Expedition, stn. CP242 (22''06'S, 
167°10'E), 500-550 m, 03 October 1985, one 
specimen 11 mm preserved length, dissected. 



leg. P. Bouchet and B. Richer de Forges 
(MNHN). Norfolk Ridge, New Caledonia, 
Bathus 3 Expedition, stn. CP832 (23°03'S, 
166°54'E), 650-659 m, 30 November 1993, 
one specimen 13 mm preserved length, dis- 
sected, leg. P. Bouchet, B. Richer de Forges 
and A. Waren (MNHN). 

ADDITIONAL MATERIAL: Coral Sea, Mu- 
sorstom 5 Expedition, stn. 323 (21°13'S, 
157°58'E), 970 m, 14 October 1986, 15 mm 
preserved length, leg. P. Bouchet, B. Métivier 
and B. Richer de Forges (MNHN). 

External Morphology 

The body is elevated and oval (Fig. 2H). 
The dorsum is covered with simple, conical 
tubercles, all of them about 100 |.im long (Fig. 
27E). The perfoliate rhinophores are com- 
posed of 33 lamellae. There are five bipinnate 
branchial leaves. The rhinophoral and 
branchial sheaths are somewhat elevated, 
bearing numerous tubercles. Ventrally, the 
oral tentacles are conical. The anterior border 
of the foot is notched and grooved (Fig. 28E). 
The mantle margin is wider than the foot. 

Based on the field notes, the color of the liv- 
ing animals is uniform translucent white. The 
rhinophores and gill have the same color as 
the dorsum. 

Anatomy 

The posterior end of the oral tube has six 
strong retractor muscles (Fig. 28C), which are 
attached to the body wall. The oval, muscular 
buccal bulb has two additional muscles. The 
oral tube is about twice as long as the buccal 
bulb. The jaws consist of numerous irregular 
elements about 50 |.im long (Fig. 27D). The 
radular formula is 15 x (18.0.18) in a 11 mm 
preserved length specimen and 16 x 
(18.0.18) in a 13 mm preserved length speci- 
men. There are no rachidian teeth. The inner 
lateral teeth are hamate, having a small cusp, 
and they lack denticles (Fig. 27A). The teeth 
increase in size gradually towards the medial 
portion of the half-row (Figs. 27A, B). The out- 
ermost teeth are also hamate and lack denti- 
cles (Fig. 27C). The esophagus is very long, 
convoluted and connects directly to the large 
stomach (Fig. 28A). 

The ampulla is very short and simple; it nar- 
rows into the gonoduct, which branches into a 
short oviduct and the prostate (Fig. 28B). The 
oviduct enters the female glands near the 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



275 




FIG. 27. Discodoris achroma, new species, paratype from Musorstom 4 (stn. CP242). A. Inner lateral teeth; 
scale bar = 60 |im. B. Mid-lateral teeth; scale bar = 60 цгл. С. Outer lateral teeth; scale bar = 43 |дт. D. Jaw 
elements; scale bar = 15 цт. E. Dorsal tubercles; scale bar = 100 цт. 



center of the mass. The prostate is very elon- 
gate and not flattened; it narrows and ex- 
pands again into the short, muscular deferent 
duct. The deferent duct opens into a common 
atrium with the vagina. The penis is unarmed. 
The vagina is very elongate and convoluted; 
at its proximal end, it connects to the rounded 



bursa copulatrix. From the vagina leads an- 
other long duct that connects to the seminal 
receptacle and the uterine duct. The bursa 
copulatrix is twice as large as the seminal re- 
ceptacle. 

In the central nervous system (Fig. 28D), 
the cerebral and pleural ganglia are fused and 



276 



VALDES 




FIG. 28. Discodoris achroma. new species, paratype from Bathus 3 (stn. CP832). A. Dorsal view of the 
anatomy; scale bar - 1 mm. B. Reproductive system; scale bar = 0.25 mm. С Anterior portion of the diges- 
tive system; scale bar = 1 mm. D. Central nervous system; scale bar = 0.5 mm. E. Mouth area; scale bar = 
1 mm. Abbreviations: a, ampulla; ab, abdominal ganglion; b, buccal bulb; be, bursa copulatrix; bg, blood 
gland; bu, buccal ganglion; c, cerebral nerve; eg, cerebral ganglion; d, deferent duct; e, esophageal ganglion; 
f, female glands; g, genital nerve; h, hermaphrodite and digestive glands; ht, heart; i, intestine; I, visceral loop; 
m, retractor muscle; o, esophagus; ot, oral tube; p, pedal nerve; pg, pedal ganglion; pi, pleural nerve; pig, 
pleural ganglion; pr, prostate; r, rhinophoral nerve; s, seminal receptacle; sg, salivary gland; st, stomach; t, 
oral tentacle; v, vagina. 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



277 



distinct from the pedal ganglia. There are 
three cerebral nerves leading from each cere- 
bral ganglion, and three pleural nerves lead 
from each pleural ganglion. The buccal gan- 
glia lie near the rest of the central nervous 
system, joined to the cerebral ganglia by two 
long nerves. Gastroesophageal, rhinophoral, 
and optical ganglia are present. The pedal 
ganglia are clearly separated, with three 
nerves leading from each. The pedal and 
parapedal commissures are enveloped to- 
gether with the visceral loop along all their 
length. There are three abdominal ganglia on 
the right side of the visceral loop. 

The circulatory system (Fig. 28A) consists 
of a heart and two blood glands situated in 
front and behind the central nervous system. 

Etymology 

From the Ancient Greek achromos (lacking 
color), in reference to the translucent white 
appearance of this species. 

Remarks 

This species clearly belongs to the genus 
Discodoris by the presence of the following 
characters: dorsum covered with simple tu- 
bercles, presence of jaws, radula with ha- 
mate, smooth teeth, absence of accessory 
gland and penis, and vagina unarmed. It dif- 
fers from other shallow-water members of the 
genus in having a translucent white coloration 
and lacking a flattened prostate. 

Discodoris achroma differs from Discodoris 
sp. in both the external morphology and 
anatomy. Discodoris acliroma is a small, 
translucent species, whereas Discodoris sp. 
is large and uniformly cream. Internally, they 
differ in the shape of the radular teeth. The in- 
nermost lateral teeth of D. acliroma are longer 
and have a shorter cusp. The outermost teeth 
are thinner and comparatively smaller in D. 
ac/iroma than in Discodoris sp. The reproduc- 
tive system of D. acliroma has the bursa cop- 
ulatrix connected to the vagina by a long, con- 
voluted duct, whereas in Discodoris sp. this 
duct is much wider and shorter. The uterine 
duct of Discodoris sp. connects near the sem- 
inal receptacle, instead of near the bursa cop- 
ulathx insertion, as in D. achroma. The am- 
pulla of D. achroma is short and simple, being 
very long and convoluted in Discodoris sp. 

The specimen from the Coral Sea was very 
poorly preserved and a definitive identification 



is not possible. The radula is very similar to 
that of the New Caledonia specimens of D. 
achroma, and it is therefore included in this 
species. 

Genus Pe/todor/s Bergh, 1880 

Type Species: Peltodoris atromaculata Bergh, 
1880, by subsequent designation by O'- 
Donoghue (1929). 

Peltodoris lippa Valdés new species (Figs. 
29A, 30, 31) 

Material Examined 

HOLOTYPE: Vanuatu, Musorstom 8 Expe- 
dition, stn. CP1132 (15°38'S, 167°03'E), 
161-182 m, 11 October 1994, 23 mm pre- 
served length, leg. P. Bouchet and B. Richer 
de Forges (MNHN). 

External Morphology 

The body is flat and oval (29A). The dorsum 
is covered with simple, conical tubercles. 
Some tubercles are clearly larger than others 
and can reach over 200 |лт long (Fig. 30D). 
The perfoliate rhinophores are composed of 
16 lamellae. There are six tripinnate branchial 
leaves. The rhinophoral and branchial sheaths 
are low and bear numerous tubercles. Ven- 
trally, the oral tentacles are conical. The ante- 
rior border of the foot is notched and grooved 
(Fig. 31 E). The mantle margin is as wide as the 
foot. 

Based on the field notes, the color of the liv- 
ing animal is uniform translucent white. The 
rhinophores and gill have the same color as 
the dorsum. 

Anatomy 

The posterior end of the oral tube has six 
strong retractor muscles (Fig. 31 D), which are 
attached to the body wall. The oval, muscular 
buccal bulb has two large additional muscles. 
The oral tube is about twice as long as the 
buccal bulb. The labial cuticle is smooth. The 
radular formula is 15 x (31.0.31) in a 23 mm 
preserved length specimen. There are no 
rachidian teeth. The inner lateral teeth are ha- 
mate, having a small cusp, and they lack den- 
ticles (Fig. 30A). The teeth increase in size 
gradually towards the medial portion of the 
half-row (Fig. 30A, B). The outermost teeth 



278 



VALDES 




FIG. 29. Preserved specimens. A. Peltodoris lippa, new species, holotype; scale bar = 2 mm. B. Rostanga 
ankyra. new species, holotype; scale bar = 1 mm. С Diaulula immaculata. new species, holotype; scale bar 
= 2 mm. D. Baptodoris phinei, new species, holotype; scale bar = 2 mm. E. Diaulula cerebralis. new species, 
paratype from Musorstom 3 (stn. CP128); scale bar = 3 mm. F. Dendrodoris orbicularis, new species, holo- 
type; scale bar = 5 mm. G. Sclerodoris virgulata new species, holotype; scale bar = 2 mm. 



are also hamate and have several, small den- 
ticles (Fig. 30C). The esophagus is very long, 
convoluted and connects directly to the large 
stomach. 

The ampulla is very short and simple; it nar- 
rows into the gonoduct, which branches into a 
short oviduct and the prostate (Fig. 31 C). The 
prostate is flattened, large and granular (Fig 
31 B); it is divided into two portions that are 
clearly distinguishable by their different tex- 



ture and coloration. The deferent duct opens 
into a common atrium with the vagina. The 
penis is unarmed. The vagina is very elongate 
and convoluted; at its proximal end, it con- 
nects to the oval bursa copulatrix. From the 
bursa copulatrix leads another duct that con- 
nects to the seminal receptacle and the uter- 
ine duct. The bursa copulatrix is twice as large 
as the seminal receptacle. 

In the central nervous system (Fig. 31 F), 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



279 




FIG. 30. Peltodoris lippa, new species, holotype. A. Inner lateral teeth; scale bar = 60 ¡.ivn. B. Mid-lateral teeth; 
scale bar = 60 цт. С. Outer lateral teeth; scale bar = 60 ¡am. D. Dorsal tubercles; scale bar = 150 цт. 



the cerebral and pleural ganglia are fused and 
distinct from the pedal ganglia. There are 
three cerebral nerves leading from each cere- 
bral ganglion, and four pleural nerves lead 
from each pleural ganglion. The eyes are very 
large and inflated. The buccal ganglia lie near 
the rest of the central nervous system, joined 
to the cerebral ganglia by two short nerves. 



Gastroesophageal, rhinophoral, and optical 
ganglia are present. The pedal ganglia are 
clearly separated, with three (left side) and 
four (right side) nerves leading from them. 
The pedal and parapedal commissures are 
enveloped together with the visceral loop 
along all their length. There is an abdominal 
ganglion on the right side of the visceral loop. 



280 



VALDES 




FIG. 31. Peltodorls lippa, new species, holotype. A. Dorsal view of the anatomy; scale bar = 1 mm. B. Re- 
productive system; scale bar = 0.5 mm. С Detail of several reproductive organs; scale bar = 0.5 mm. D. An- 
terior portion of thie digestive system; scale bar = 0.5 mm. E. Mouth area; scale bar = 1 mm. F. Central ner- 
vous system; scale bar = 0.5 mm. Abbreviations: a, ampulla; b, buccal bulb; ab, abdominal ganglion; be, 
bursa copulatnx; bg, blood gland; bu, buccal ganglion; c, cerebral nerve; eg, cerebral ganglion; d, deferent 
duet; e, esophageal ganglion; f, female glands; g, genital nerve; h, hermaphrodite and digestive glands; ht, 
heart; i, intestine; I, visceral loop; m, retractor muscle; o, esophagus; ot, oral tube; p, pedal nerve; pi, pleural 
nerve; pig, pleural ganglion; pr, prostate; r, rhinophoral nerve; rs, renal syrinx; s, seminal receptacle; sg, sali- 
vary gland; st, stomach; t, oral tentacle; v, vagina. 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



281 



The circulatory system (Fig. 31 A) consists 
of a heart and two blood glands situated in 
front and behind the central nervous system. 

Etymology 

From the Latin lippus (having inflamed 
eyes), in reference to the large size of the eye- 
balls of this species. 

Remarks 

Peltodoris was regarded as a synonym of 
Discodoris by Thompson (1975), without any 
justification. Examination of specimens of 
Peltodoris atromaculata Bergh, 1 880, the type 
species of the genus Peltodoris, revealed that 
this genus is distinguishable from Discodoris 
by the absence of jaw elements (Schmekel & 
Portmann, 1982). However, it is probable that 
the sole presence of this character, which is 
variable in other related genera, is not suffi- 
cient to separate Peltodoris from Discodoris. 
On the other hand, there may be other differ- 
ences between these two genera that need to 
be investigated. A review of the systematic 
status and a reconstruction of the phylogeny 
of the cryptobranch dorids is necessary be- 
fore definitive synonymies may be stabilized. 
In the meantime, the genus Peltodoris is here 
regarded as valid and different from Dis- 
codoris. 

Peltodoris lippa shares a number of fea- 
tures with Peltodoris atromaculata Bergh, 
1880, and it clearly belongs to this genus. 
These features in common are dorsum with 
simple, non-caryophyllidia tubercles, anterior 
border of the foot grooved and notched, oral 
tentacles present, radular teeth and labial cu- 
ticle smooth, absence of penial hooks or ac- 
cessory glands, and flattened prostate. 

This is the first species of Peltodoris de- 
scribed from deep waters, and it is clearly dis- 
tinguishable from other species of the genus 
in having a uniform translucent white col- 
oration. 

The species of Peltodoris with the most 
proximal geographic range to P. lippa is P. 
noumeae (Risbec, 1 937) described from shal- 
low waters of New Caledonia. There is not 
enough information in the original description 
of this species (Risbec, 1937) to determine 
whether it belongs to the genus Peltodoris. In 
any case, P. noumeae is clearly distinguish- 
able from P. lippa in having a yellow-orange 
background color with red spots. 



Peltodoris fellowsi Kay & Young, 1 969, orig- 
inally described from Hawaii and subse- 
quently reported from the Pitcairn Islands (Ed- 
munds & Preece, 1996), has a uniform white 
coloration as well. However, in P. fellowsi Xhe 
gill is black and the rhinophores are red- 
brown, whereas in P. lippa rhinophores and 
gill are white. Internally both species differ in 
the radular morphology. The outermost lateral 
teeth of P. fellowsi are shorter than those of P. 
lippa. 

Genus Paradoris Bergh, 1884 

Type Species: Paradoris granúlala Bergh, 
1 884, by monotypy [= Paradoris indecora 
(Bergh, 1881)]. 

Paradoris araneosa Valdés, new species 
(Figs. 13B, 32, 33) 

Material Examined 

HOLOTYPE: South of New Caledonia, 
Bathus 2 Expedition, stn. CP736 (23°03'S, 
166°59'E), 452-464 m, 13 May 1993, 14 mm 
preserved length, leg. P. Bouchet and B. 
Richer de Forges (MNHN). 

PARATYPES: South of New Caledonia, 
SMIB 8 Expedition, stn. DW182-184 
(23°18'S-23°19'S, 168°05'E), 314-367 m, 
31 January 1993, one specimen 35 mm pre- 
served length, dissected, leg. P. Bouchet and 
B. Richer de Forges (MNHN). Norfolk Ridge, 
New Caledonia, Bathus 3 Expedition, stn. 
DW838 (23°01'S, 166°56'E), 400-402 m, 30 
November 1993, one specimen 33 mm pre- 
served length, dissected, leg. P. Bouchet, B. 
Richer de Forges and A. Waren (MNHN). 
Southeast of New Caledonia, Halipro 1 Expe- 
dition, stn. CP851 (21°43'S, 166°37'E), 
31 4-364 m, 1 9 March 1 994, one specimen 1 3 
mm preserved length, dissected, leg. B. 
Richer de Forges (CASIZ 121099). 



External Morphology 

The body is elevated and oval (Fig. 13B). 
The dorsum is covered with simple, rounded 
tubercles. The dorsal surface, in the areas 
without tubercles, has a number of small de- 
pressions surrounded by minute ridges (Fig. 
32E). The perfoliate rhinophores are com- 
posed of 25 lamellae. There are six tripinnate 
branchial leaves. Ventrally, the oral tentacles 



282 



VALUES 






С" 


3 




J 


^л 


w 


г 

<(•*- 


«' ^Цц^^^Н 


f^J 




^F^ 

% J 






щ 


?5Л\^/>н 


Ч^^Я 


)Шц 






5' •--*?,♦ 



1^< 



« Ч -; у- - • 






<аЙЕк 



А 



J 



FIG. 32. Paradons araneosa, new species, paratype from Bathus 3 (stn. DW838). A. Inner lateral teeth; scale 
bar = 75 |im. B. Mid-lateral teeth; scale bar = 100 ¡.im. C. Outer lateral teeth; scale bar = 100 цт. D. Jaw el- 
ements; scale bar = 43 цт. E. Dorsal tubercles; scale bar = 600 цт. 



are short and conical. The anterior border of 
the foot is notched and grooved (Fig. 33F). 
The mantle margin is about as wide as the 
foot. 

Based on the photographs, the color of the 
living animals is pale brown. There are few, 



large, dark brown spots scattered on the dor- 
sal surface and several, more numerous, 
small darker dots. The larger tubercles are 
opaque white. The rhinophores are cream 
with opaque white lamellae. The branchial 
leaves are pale brown and the lamellae dark 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



283 




FIG. 33. Paradoris araneosa, new species, paratype from SMIB 8 (stn. DW182-184). A. Dorsal view of the 
anatorny; scale bar = 1 mm. B. Reproductive system; scale bar = 1 mm. С Detail of the accessory organs; 
scale bar = 0.5 mm. D. Central nervous system; scale bar = 0.5 mm. E. Anterior portion of the digestive sys- 
tem; scale bar = 1 mm. F. Mouth area; scale bar = 1 mm. Abbreviations: a, ampulla; ag, accessory gland; b, 
buccal bulb; be, bursa copulatrix; bg, blood gland; bu, buccal ganglion; c, cerebral nerve; eg, cerebral gan- 
glion; d, deferent duct; e, esophageal ganglion; f, female glands; g, genital nerve; h, hermaphrodite and di- 
gestive glands; ht, heart; i, intestine; I, visceral loop; m, retractor muscle; o, esophagus; ot, oral tube; p, pedal 
nerve; pg, pedal ganglion; pi, pleural nerve; pr, prostate; r, rhinophoral nerve; rs, renal syrinx; s, seminal re- 
ceptacle; sa, accessory sac; sg, salivary gland; st, stomach; t, oral tentacle; v, vagina. 



284 



VALDES 



brown. There are several white dots on the 
gill, more densely arranged near the base of 
the branchial leaves. 



Anatomy 

The posterior end of the oral tube has six 
strong retractor muscles (Fig. 33E), which are 
attached to the body wall. The oval, muscular 
buccal bulb has two additional muscles. The 
buccal bulb is about as long as the oral tube. 
The jaws consist of numerous thin, unicuspid 
elements about 30 ,um long (Fig. 32D). The 
radular formula is 68 x (16.0.16) in a 32 mm 
preserved length specimen. There are no 
rachidian teeth. The inner lateral teeth are ha- 
mate, having a single cusp, and they lack 
denticles (Fig. 32A). The teeth are very elon- 
gate with a short, strong cusp. The teeth in- 
crease in size gradually towards the medial 
portion of the half-row (Figs. 32A, B). The out- 
ermost teeth are elongate and also lack den- 
ticles (Fig. 32C). The esophagus is long and 
connects directly to the stomach. 

The ampulla is long and curved. It narrows 
into the gonoduct, which branches into a long 
oviduct and the prostate (Fig. 33B). The 
oviduct enters the female glands near the 
nidamental opening. The prostate is flattened 
and granular; it is divided into two portions 
that are clearly distinguishable by their differ- 
ent texture and coloration, the largest portion 
being pale yellow and connecting to the def- 
erent duct, whereas the smallest portion is or- 
ange and connects to the ampulla. The defer- 
ent duct is long and narrow; it narrows and 
expands again into the short ejaculatory por- 
tion. The deferent duct opens into a common 
atrium with the vagina. The penis is unarmed. 
There is a large, ramified accessory gland 
and two small sacs, containing one rigid spine 
each, connected to the atrium (Fig. 33C). The 
vagina is very long; at its proximal end, it con- 
nects to the large and oval bursa copulatrix. 
From the bursa copulatrix leads another long 
duct that connects to the seminal receptacle 
and the very short uterine duct. The bursa 
copulatrix is about six times larger than the 
seminal receptacle. 

In the central nervous system (Fig. 33D), 
the cerebral and pleural ganglia are fused and 
distinct from the pedal ganglia. There are four 
cerebral nerves leading from each cerebral 
ganglion, and four pleural nerves lead from 
each pleural ganglion. The buccal ganglia lie 
near the rest of the central nervous system. 



joined to the cerebral ganglia by two long 
nerves. Gastroesophageal, rhinophoral, and 
optical ganglia are present. The pedal ganglia 
are clearly separated, with three nerves lead- 
ing from each. The pedal and parapedal com- 
missures are enveloped together with the vis- 
ceral loop along all their length. 

The circulatory system (Fig. 33A) consists 
of a heart and two blood glands situated in 
front and behind the central nervous system. 

Etymology 

From the Latin araneosus (full of webs), in 
reference to the small hdges on the surface of 
this species, that resemble cobwebs. 

Remarks 

Paradons araneosa belongs to the genus 
Paradons in having the following combination 
of characters: anterior border of the foot 
notched and grooved, simple dorsal tuber- 
cles, reproductive system with an accessory 
gland and two rigid copulatory spines, jaws 
with numerous, simple elements, radula with 
strong teeth, which have a short cusp and 
lack denticles (Miller, 1995). 

Paradons leuca Miller, 1995, from New 
Zealand, is the species that has been found in 
closest proximity to P. araneosa. It differs from 
P. araneosa in lacking accessory glands and 
copulatory sacs armed with spines (Miller, 
1995). Due to the lack of these structures, it is 
likely that P. leuca does not belong to the 
genus Paradons. Other differences are the 
shape of the jaw elements, which have a tri- 
angular cusp in P. leuca and are rounded in P. 
araneosa. Externally, the dorsal tubercles of 
P. leuca are more evenly distributed and are 
smaller than those of P araneosa. 

Paradons tsurugensis Baba, 1986, from 
Japan, is distinguishable from P araneosa in 
having two accessory glands and two copula- 
tory sacs armed with spines, instead of a sin- 
gle accessory gland (Baba, 1986). Also, P 
tsurugensis has many more radular teeth than 
P araneosa at comparable size. The radular 
formula of the former is 90 x (20-25.0.20-25), 
whereas it is 68 x (16.0.16) in the latter. 

Miller (1995) included Platydoris galbanus 
Burn, 1958, from Victoria, Australia, and 
Peltodohs fellows! Kay & Young, 1969, from 
Hawaii, in the genus Paradons, but both 
species lack jaws (Burn, 1958; Kay & Young, 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



285 



1969), and therefore they rnust be placed in a 
different genus. 

Paradons imperfecta Valdés, new species 
(Figs. 13C, 34, 35) 

Material Examined 

HOLOTYPE: South of New Caledonia, 
Chalcal 2 Expedition, stn. CP18 (24°47'S, 
168°09'E), 274 m, 27 October 1986, 13 mm 
preserved length, leg. P. Bouchet, B. Métivier 
and B. Richer de Forges (MNHN). 

External Morphology 

The body is elevated and oval (Fig. 13C). 
The dorsum is covered with small, conical tu- 
bercles. There are several larger tubercles 
surrounded by smaller tubercles. Many tuber- 
cles, especially those situated in the center of 
the body, are joined to the adjacent ones by 
short ridges. The perfoliate rhinophores are 
composed of 20 lamellae. There are five bip- 
innate branchial leaves. Ventrally, the oral 
tentacles are short and conical. The anterior 
border of the foot is notched and grooved 
(Fig. 34F). The mantle margin is about as 
wide as the foot. 

The color of the living animals is uniformly 
cream. There are few, irregular pale brown 
spots and numerous small dark brown dots on 
the dorsal surface. The dark brown spots are 
situated on the mantle margin. There are two 
areas on both sides of the dorsal hump with a 
high concentration of dark brown spots. The 
rhinophores are cream with the lamellae dark 
brown. The gill is uniformly cream. 

Anatomy 

The posterior end of the oral tube has six 
strong retractor muscles (Fig. 34E), which are 
attached to the body wall. The oval, muscular 
buccal bulb has two additional muscles. The 
buccal bulb is about as long as the oral tube. 
The jaws consist of numerous thin, unicuspid 
elements, about 10 |лт long (Fig. 35C). The 
radular formula is 46 x (13.0.13) in a 13 mm 
preserved length specimen. There are no 
rachidian teeth. The inner lateral teeth are ha- 
mate, having a single cusp, and they lack 
denticles (Fig. 35A). The teeth are very elon- 
gate, with a short, strong cusp. The teeth in- 
crease in size gradually towards the medial 
portion of the half-row (Figs 35A-B). The out- 



ermost teeth are short and also lack denticles 
(Fig. 35C). The esophagus is long and con- 
nects directly to the stomach. 

The ampulla is short and simple; it narrows 
into the gonoduct, which branches into the 
oviduct and the prostate (Fig. 34B). The ovi- 
duct enters the female glands near the nida- 
mental opening. The prostate is long and 
granular; it is divided into two portions that are 
clearly distinguishable by their different tex- 
ture and coloration. The larger portion is pale 
yellow and connects to the deferent duct, 
whereas the smaller portion is orange and 
connects to the ampulla. The deferent duct is 
short and narrow; it expands again into the 
long ejaculatory portion. The deferent duct 
opens into a common atrium with the vagina. 
The penis is unarmed. There are two small 
sacs connected to the atrium, each containing 
a single rigid spine each. The vagina is very 
long; at its proximal end, it connects to the 
large, oval bursa copulatrix. From the bursa 
copulatrix leads another long duct that con- 
nects to the irregular seminal receptacle and 
the uterine duct (Fig 34C). The bursa copula- 
trix is about five times larger than the seminal 
receptacle. 

In the central nervous system (Fig. 34D), 
the cerebral and pleural ganglia are fused and 
distinct from the pedal ganglia. There are four 
cerebral nerves leading from each cerebral 
ganglion, and two pleural nerves lead from 
each pleural ganglion. The buccal ganglia lie 
near the rest of the central nervous system, 
joined to the cerebral ganglia by two long 
nerves. Gastroesophageal, rhinophoral, and 
optical ganglia are present. The pedal ganglia 
are clearly separated, having two nerves 
leading from each one. The pedal and para- 
pedal commissures are enveloped together 
with the visceral loop along all their length. 

The circulatory system (Fig. 34A) consists 
of a heart and two blood glands situated in 
front and behind the central nervous system. 

Etymology 

From the Latin imperfectus (imperfect), in 
reference to the lack of accessory gland in 
this species and the irregular shape of the 
seminal receptacle. 

Remarks 

Paradons imperfecta is clearly distinguish- 
able from P. araneosa in lacking an accessory 



286 



VALDES 




FIG. 34. Paradons imperfecta, new species, holotype. A. Dorsal view of the anatomy; scale bar = 1 mm. B. 
Reproductive system; scale bar = 1 mm. С Detail of several reproductive organs; scale bar = 1 mm. D. Cen- 
tral nervous system; scale bar = 0.5 mm. E. Anterior portion of tfie digestive system; scale bar = 0.5 mm. F. 
Mouth area; scale bar = 1 mm. Abbreviations: a, ampulla; b, buccal bulb; be, bursa copulatrix; bg, blood 
gland; bu. buccal ganglion; c, cerebral nerve; eg, cerebral ganglion; d, deferent duct; e, esophageal ganglion; 
f, female glands; g, genital nerve; h, hermaphrodite and digestive glands; ht, heart; i, intestine; I, visceral loop; 
m, retractor muscle; o, esophagus; of, oral tube; p, pedal nerve; pg, pedal ganglion; pi, pleural nerve; pig, 
pleural ganglion; pr, prostate; r, rhinophoral nerve; rs, renal synnx; s, seminal receptacle; sa, accessory sac; 
sg, salivary gland; sp, accessory spine; st, stomach; t, oral tentacle; v, vagina. 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



287 




FIG. 35. Paradons imperfecta, new species, holotype. A. Inner lateral teeth; scale bar = 43 цт. В. Mid-lat- 
eral teeth; scale bar = 43 fim. C. Outer lateral teeth; scale bar = 30 |jm. D. Jaw elements; scale bar = 20 \\rc\. 



gland. In addition, P. imperfecta has only two 
accessory sacs containing spines, which also 
distinguish this species from Paradons leuca 
and P. tsurugensis. Paradoris leuca does not 
have accessory glands or sacs, whereas P. 
tsurugensis has two glands and two sacs. 

Anatomical differences between P. arane- 
osa and P. imperfecta include the outermost 



lateral teeth of the radula, which are much 
shorter in P. imperfecta. Also, the lateral teeth 
appear to have a longer, more triangular cusp 
in P. imperfecta. The prostate of P. imperfecta 
is more elongate than that of P. araneosa, and 
the seminal receptacle is irregular and elon- 
gate, whereas in P. araneosa it is regularly 
oval. Also, the atrium of P imperfecta is much 



288 



VALDES 



larger and the vagina is shorter than those of 
P. araneosa. 

Externally, these two species differ in the 
coloration of the rhinophores and the gill. The 
rhinophores of P. araneosa have white lamel- 
lae, whereas in P. imperfectaXhe lamellae are 
dark brown. The gill of P. araneosa is pale 
brown with dark brown lamellae and white 
dots, whereas it is uniformly cream in P. im- 
perfecta. 

Genus Diaulula Bergh, 1878 

Type Species: Doris sandiegensis Cooper, 
1863, by monotypy. 

Diaulula Immaculata Valdés, new species 
(Figs. 29C, 36, 37) 

Material Examined 

HOLOTYPE: Loyalty Ridge, Musorstom 6 
Expedition, stn. DW428 (20°24'S, 166°13'E), 
420 m, 17 February 1989, 19 mm preserved 
length, leg. P. Bouchet and B. Richer de 
Forges (MNHN). 

PARATYPE: Chesterfield, Coral Sea, Mu- 
sorstom 5 Expedition, stn. 371 (19°55'S, 
158°38'E), 350 m, 20 October 1986, one 
specimen 9 mm preserved length, leg. P. 
Bouchet, B. Métivier and B. Richer de Forges 
(MNHN). 

External Morphology 

The body is elevated and oval (Fig. 29C). 
The dorsum is covered with thin caryophyl- 
lidia, the largest reaching over 75 цт (Fig. 
36D). They have a large, rounded ciliated tu- 
bercle and 6-7 spicules around it. The perfo- 
liate rhinophores are composed of 20 lamel- 
lae. There are four bipinnate branchial leaves. 
Ventrally, the oral tentacles are short and con- 
ical. The anterior border of the foot is notched 
and grooved (Fig. 37E). The mantle margin is 
wider than the foot. 

The color of the living animals is unknown. 
Preserved specimens are uniformly pale 
cream. The rhinophores and gill are also pale 
cream. 

Anatomy 

The posterior end of the oral tube has six 
strong retractor muscles (Fig. 37D), which are 
attached to the body wall. The oval, muscular 



buccal bulb has two additional muscles. The 
oral tube is about twice as long as the buccal 
bulb. The labial cuticle is smooth. The radular 
formula is 32 x (46.0.46) in a 9 mm preserved 
length specimen. There are no rachidian 
teeth. The inner lateral teeth are hamate, hav- 
ing a single cusp, and they lack denticles (Fig. 
36A). The teeth are very elongate with a short, 
strong cusp. The teeth increase in size gradu- 
ally towards the medial portion of the half-row 
(Figs. 36A, B). The outermost teeth are short 
and also lack denticles (Fig. 36C). The esoph- 
agus connects directly to the stomach. 

The ampulla is long and convoluted; it nar- 
rows into the gonoduct, which branches into 
the oviduct and the prostate (Fig. 37C). The 
oviduct enters the female glands near the 
center of the mass. The prostate is very large 
and granular (Fig 37B); it is divided into two 
portions that are clearly distinguishable by 
their different texture and coloration; the 
largest portion is pale yellow and connects to 
the deferent duct, whereas the smallest por- 
tion is orange and connects to the ampulla. 
The deferent duct is long and narrow, and 
opens into a common atrium with the vagina. 
The penis is unarmed. The vagina is long; at 
its proximal end, it connects to the large, oval 
bursa copulatrix. From the bursa copulathx 
leads another long duct that connects to the 
seminal receptacle and the uterine duct. The 
bursa copulatrix is about six times larger than 
the seminal receptacle. 

The circulatory system (Fig. 37A) consists 
of a heart and two blood glands situated in 
front and behind the central nervous system. 

Etymology 

From the Latin immaculatus (unspotted), in 
reference to the uniformly white dorsum of 
this species. 

Remarks 

Valdés & Gosliner (in press) revised the 
type species of the genus Diaulula and pro- 
posed a new diagnosis of the genus that in- 
cludes the following characteristics: dorsum 
covered with elongate caryophyllidia, prostate 
flattened, with two portions, penis and vagina 
unarmed, labial cuticle smooth and radular 
teeth hamate and smooth. Diaulula Immacu- 
lata has all these features and clearty belongs 
to this genus. 

Several species have been assigned to the 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



289 




FIG. 36. Diaulula immaculata, new species, paratype. A. Inner lateral teeth; scale bar = 25 цт. В. Mid-lateral 
teeth; scale bar = 30 цт. С. Outer lateral teeth; scale bar = 20 цт. D. Caryophyllidia; scale bar = 75 цгл. 



genus Diaulula after its original description, 
which was based on Doris sandiegensis 
Cooper, 1863, fronn California. Bergh (1905) 
described Diaulula rubra from the Philippines, 
but the description is very incomplete and it is 
impossible to determine the correct generic 
placement of this species. Two years later. 



Bergh (1 907) described two new species from 
South Africa, D. capensis and, with question, 
D. morosa. Both species appear to have 
caryophyllidia on the dorsum, but their repro- 
ductive systems are not described in enough 
detail to determine their correct generic place- 
ment. In any case, these species are distin- 



290 



VALDES 




FIG. 37. Diaulula Immaculata, new species, paratype. A. Dorsal view of the anatomy; scale bar = 1 mm. B. 
Reproductive system; scale bar = 0.5 mm. С Detail of several reproductive organs; scale bar = 0.5 mm. D. 
Anterior portion of the digestive system; scale bar = 1 mm, E. Mouth area; scale bar = 0.5 mm. Abbrevia- 
tions: a, ampulla; b, buccal bulb; be, bursa copulatrix; bg, blood gland; d, deferent duct; f, female glands; h, 
hermaphrodite and digestive glands; ht, heart; i, intestine; m, retractor muscle; o, esophagus; ot, oral tube; 
pr, prostate; s, seminal receptacle; sg, salivary gland; st, stomach; t, oral tentacle; v, vagina. 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



291 



gulshable from D. immaculata by their exter- 
nal coloration, light brown in D. capensis, dark 
greenish in D. morosa, and uniformly white in 
D. immaculata. 

Eliot (1907) transferred Doris vestita Abra- 
ham, 1877, to the genus Diaulula. Again, this 
species appears to have caryophyllidia, but 
the internal anatomy is not described in 
enough detail and its generic placement re- 
mains uncertain. Er. Marcus (1959) re- 
described Doris hispida d'Orbigny, 1 837, and 
placed this species in the genus Diaulula. 
This species has a dorsal ridge and could be 
a member of the genus Atagema J. E. Gray, 
1850 (Valdés & Gosliner, in press). 

Diaulula immaculata is clearly distinguish- 
able from D. sandiegensis by both the exter- 
nal morphology and anatomy. Externally, D. 
sandiegensis has very distinctive black circles 
or spots on the dorsum that are absent in D. 
immaculata. Also, the outermost radular teeth 
of D. sandiegensis are more elongated and 
the prostate comparatively smaller than those 
of D. immaculata. 

Diaulula cerebralis Valdés, new species 
(Figs 29E, 38, 39) 

Material Examined 

HOLOTYPE: Philippines, Musorstom 3 Ex- 
pedition, stn. CP144 (11°02'N, 124°15'E), 
379-383 m, 7 June 1985, 30 mm preserved 
length, leg. P. Bouchet and M. P. Triclot 
(MNHN). 

PARATYPE: Philippines, Musorstom 3 Ex- 
pedition, stn. CP128 (11°50'N, 121°42'E), 
815-321 m, 5 June 1985, one specimen 27 
mm preserved length, dissected, leg. P. 
Bouchet and M. P Triclot (MNHN). 

External Morphology 

The body is elevated and oval (Fig. 29E). 
The dorsum is covered with long, thin 
caryophyllidia, the largest reaching over 250 
|im (Fig. 38E). They have a large, oval ciliated 
tubercle and four long spicules around it. The 
perfoliate rhinophores are composed of 30 
lamellae. There are eight bipinnate branchial 
leaves. The rhinophoral and branchial 
sheaths are elevated. Ventrally, the oral tenta- 
cles are short and conical. The anterior border 
of the foot is notched and grooved (Fig. 39F). 
The mantle margin is about as wide as the 
foot. 



The color of the living animals is uniformly 
white. The rhinophores and gill are also white. 

Anatomy 

The posterior end of the oral tube has six 
strong retractor muscles (Fig. 39E), which are 
attached to the body wall. The oval, muscular 
buccal bulb has two additional muscles. The 
buccal bulb is about as long as the thin oral 
tube. The jaws consist of numerous thin, uni- 
cuspid elements, about 10 |.im long (Fig. 
38D). The radular formula is 21 x (21 .0.21 ) in 
a 27 mm preserved length specimen. There 
are no rachidian teeth. The three innermost 
lateral teeth are simple plates, lacking a cusp 
and denticles (Fig. 38A). The following lateral 
teeth have a single, short cusp and also lack 
denticles (Figs 38A-B). The teeth increase in 
size gradually towards the medial portion of 
the half-row. The outermost teeth are short, 
hamate and also lack denticles (Fig. 38C). 
The esophagus is long and connects directly 
to the stomach (Fig. 39A). 

The ampulla is long and very convoluted; it 
narrows into the gonoduct, which branches 
into the short oviduct and the prostate (Fig. 
39C). The oviduct enters the female glands 
near the nidamental opening. The prostate is 
long and granular (Fig. 39B); it narrows and 
expands again into the very large deferent 
duct, which opens into a common atrium with 
the vagina. The penis is unarmed. The vagina 
is wide and long; at its proximal end, it con- 
nects to the oval bursa copulatrix. From the 
distal end of the vagina leads another long 
duct that connects to the seminal receptacle 
and the uterine duct. The bursa copulatrix is 
about two times larger than the seminal re- 
ceptacle. 

In the central nervous system (Fig. 39D), 
the cerebral and pleural ganglia are partially 
fused and distinct from the pedal ganglia. The 
cerebral ganglia are very large and conspicu- 
ous. There are two cerebral nerves leading 
from each cerebral ganglion, and three (right 
side) or two (left side) pleural nerves lead 
from the pleural ganglion. The buccal ganglia 
lie near the rest of the central nervous system, 
joined to the cerebral ganglia by two long 
nerves. Gastroesophageal, rhinophoral and 
optical ganglia are present. The pedal ganglia 
are clearly separated, having three (right side) 
or four (left side) pedal nerves leading from 
them. The pedal and parapedal commissures 
are enveloped together with the visceral loop 
along all their length. 



292 



VALDES 




FIG. 38. Diaulula cerebralis, new species, paratype. A. Inner lateral teeth; scale bar = 100 |.im. B. Mid-lateral 
teeth; scale bar = 100 цгл. С. Outer lateral teeth; scale bar = 100 цт. D. Jaw elements; scale bar = 20 |.im. 
E. Caryophyllidia; scale bar = 250 цт. 



The circulatory system (Fig. 39A) consists 
of a heart and two blood glands situated in 
front and behind the central nervous system. 

Etymology 

From the Latin cerebrum (brain), in refer- 
ence to the extremely developed cerebral 
ganglia of this species. 



Remarks 

The generic position of this species is par- 
ticularly problematic. It fits within the genus 
Diaulula in having the dorsum covered with 
elongate caryophyllidia, prostate flattened, 
with two portions, penis and vagina unarmed 
and radular teeth hamate and smooth. How- 
ever, it is different from the other species of 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



293 




FIG. 39. Diaulula cerebralis, new species, paratype. A. Dorsal view of the anatomy; scale bar = 1 mm. B. Re- 
productive system; scale bar = 1 mm. С Detail of several reproductive organs; scale bar = 1 mm. D. Central 
nervous system; scale bar = 0.5 mm. E. Anterior portion of thie digestive system; scale bar - 0.5 mm. F Mouth 
area; scale bar = 1 mm. Abbreviations: a, ampulla; b, buccal bulb; be, bursa copulatrix; bg, blood gland; bu, 
buccal ganglion; c, cerebral nerve; eg, cerebral ganglion; d, deferent duct; e, esophageal ganglion; f, female 
glands; g, genital nerve; h, hermaphrodite and digestive glands; ht, heart; i, intestine; I, visceral loop; m, re- 
tractor muscle; o, esophagus; ot, oral tube; p, pedal nerve; pg, pedal ganglion; pi, pleural nerve; pr, prostate; 
r, rhinophoral nerve; s, seminal receptacle; sg, salivary gland; st, stomach; t, oral tentacle; v, vagina. 



294 



VALDES 



this genus in having jaws. The presence or 
absence of jaws is variable in other genera, 
such as Rostanga and Jorunna. and may not 
have much phylogenetic information (Valdés 
& Gosliner, in press). Other related genera in 
which this species could fit are Rostanga and 
Jorunna. However, Rostanga has very elon- 
gate and denticulate lateral teeth, and 
Jorunna has a large accessory gland with a 
copulatory spine. These characters are ab- 
sent in Diaulula cerebralis. Therefore, this 
species is provisionally placed in the genus 
Diaulula where it is better accommodated, 

Diaulula cerebralis differs from D. immacu- 
lata in having a much smaller prostate, the 
seminal receptacle connected to the vagina, 
instead of to the bursa copulatrix, the inner- 
most lateral teeth like simple plates, and the 
cerebral ganglia extremely developed com- 
pared to other dorid central nervous systems 
previously studied (Valdés & Gosliner, in 
press). However, the most important differ- 
ence between these two species is the pres- 
ence of jaws in Diaulula cerebralis. Diaulula 
sandiegensis is also different from D. cere- 
bralis in having dorsal black circles or spots 
and lacking jaws. 

Genus Rostanga Bergh, 1879 

Type Species: Doris coccínea Forbes, in Alder 
and Hancock, 1848, by original designa- 
tion [= Rostanga rubra (Risso, 1818)]. 

Rostanga ankyra Valdés, new species 
(Figs. 29B, 40, 41) 

Material Examined 

HOLOTYPE: South of New Caledonia, 
Chalcal 2 Expedition, stn. DW74 (24'^40'S, 
168 38'E), 650 m, 29 October 1985, 8 mm 
preserved length, leg. P. Bouchet, B. Métivier 
and B. Richer de Forges (MNHN). 

External Morphology 



the foot is notched and grooved. The mantle 
margin is about as wide as the foot. 

The color of the living animal is uniformly 
white. The rhinophores and gill are also white. 

Anatomy 

The single specimen was poorly preserved 
and only the radula and reproductive system 
were examined. The labial cuticle is smooth. 
The radular formula is 77 x (97.0.97) in a 8 
mm preserved length specimen. There are no 
rachidian teeth. The inner lateral teeth are ha- 
mate, having a long, thin cusp folded inwards, 
and a single, long denticle on the outer side 
(Fig. 40A). The base is very wide, thangular. 
The teeth increase in size gradually towards 
the medial portion of the half-row (Fig. 40A, 
B). The mid-lateral teeth are very long, with a 
curved cusp and two long denticles. The out- 
ermost teeth are also very elongate, with a 
single, long denticle (Fig. 400). 

The ampulla is short; it narrows into the 
gonoduct, which branches into a short oviduct 
and the prostate (Fig. 41). The oviduct enters 
the female glands near the center of the 
mass. The prostate is long and granular; it is 
divided into two portions that are clearly dis- 
tinguishable by their different texture and col- 
oration. The deferent duct is very long and 
narrow; it opens into a common atrium with 
the vagina. The vagina is very long; it expands 
into a large, muscular portion that narrows 
again before it connects to the large and ir- 
regular bursa copulatrix. From the bursa cop- 
ulatrix leads another long duct that connects 
to the seminal receptacle and the short uter- 
ine duct. The bursa copulatrix is about twenty 
times larger than the seminal receptacle. 

Etymology 

From the Ancient Greek ankyra (anchor), in 
reference to the shape of the innermost radu- 
lar teeth of this species. 



The body is elevated and oval (Fig. 29B). 
The dorsum is covered with long, thin 
caryophyllidia, the largest reaching over 100 
|im (Fig. 40D). They have a large ciliated tu- 
bercle and 5-6 spicules around it. The perfo- 
liate rhinophores are composed of 19, trans- 
verse lamellae. There are five bipinnate 
branchial leaves. Ventrally, the oral tentacles 
are short and conical. The anterior border of 



Remarks 

The radular morphology of R. ankyra is typ- 
ical of the genus Rostanga. It is characterized 
by having the innermost teeth with a triangu- 
lar, wide base and a cusp folded inwards, and 
the outermost teeth very elongate. Also, the 
oval body shape and the presence of long 
caryophyllidia on the dorsum clearly suggest 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



295 




FIG. 40. Rostanga ankyra, new species, holotype. A. Inner lateral teeth; scale bar = 15 цт. В. Mid-lateral 
teeth; scale bar = 25 |am. С Outer lateral teeth; scale bar = 20 |am. D, Caryophyllidium; scale bar = 43 цт. 



the piacernent of this species In the genus 
Rostanga. 

Rudman & Avern (1989) revised the genus 
Rostanga in the Indo-West Pacific. According 
to these authors there are nine valid species in 
this region, all of them characterized by a red 
or orange general color. More recently, 
Garovoy et al. (in press) described three new 



species from South Africa, and included Bore- 
odoris setidens Odhner, 1939, in the genus 
Rostanga. Rostanga setidens, as well as one 
of the new species from South Africa, have a 
white background color. However, the new 
species from South Africa is clearly distin- 
guishable from R. ankyra in having the dorsum 
covered with purplish brown spots (Garovoy et 



296 



VALDES 




FIG. 41. Rostanga ankyra. new species, holotype. 
Reproductive system. Abbreviations: a, ampulla; 
be, bursa copulatrix; d, deferent duct; f, female 
glands; pr, prostate; s, seminal receptacle; v, 
vagina. 



al., in press). Other differences include the 
presence of jaw elements, and the lack of den- 
ticles on the mid-lateral teeth of the new 
species from South Africa. Rostanga setidens. 
on the other hand, has a radular morphology 
very similar to R. ankyra, and both species 
lack jaws. The main radular difference is the 
presence of a single denticle in all the lateral 
teeth of R. setidens (see Odhner, 1939), 
whereas in the mid-lateral teeth of R. ankyra 
there are two long denticles. The reproductive 
system of R. ankyra has a very long deferent 
duct, and a wide, muscular portion in the 
vagina, whereas in R. setidens the deferent 
duct is shorter, and the vagina is simple. 

Genus Sclerodoris EWoX, 1904 

Type Species: Sclerodoris tuberculata Eliot, 
1904, by subsequent designation herein. 

Sclerodoris virgulata Valdés, new species 
(Figs. 29G, 42, 43) 

Material Examined 

HOLOTYPE: South of New Caledonia, 
Chalcal 2 Expedition, stn. CP27 (23°15'S, 



168°05'E), 283 m. 31 October 1985, 14 mm 
preserved length, leg. P. Bouchet, B. Métivier 
and B. Richer de Forges (MNHN). 

PARATYPES: South of New Caledonia, 
Chalcal 2 Expedition, stn. CP27 (23°15'S, 
168°05'E), 283 m, 31 October 1985, one 
specimen 12 mm preserved length, leg. P. 
Bouchet, B. Métivier and B. Richer de Forges 
(CASIZ 121100). Norfolk Ridge, New Caledo- 
nia, Bathus 3 Expedition, stn. CP847 
(23°03'S, 166°58'E), 405-411 m, 1 Decem- 
ber 1993, one specimen 10 mm preserved 
length, leg. P. Bouchet, B. Richer de Forges 
and A. Waren (MNHN). 

External Morphology 

The body is elevated and oval (Fig. 290). 
The dorsum is covered with long, thin caryo- 
phyllidia, the largest reaching over 100 цт 
(Fig. 42D). They have a small ciliated tubercle 
and 4-5 spicules around it. There are no dor- 
sal ridges or depressions. The perfoliate 
rhinophores are composed of 21 lamellae. 
There are four long, thin, bipinnate branchial 
leaves. Ventrally, the oral tentacles are short 
and conical (Fig. 43E). The anterior border of 
the foot is notched and grooved. The mantle 
margin is about as wide as the foot. 

The color of the living animals is white, with 
a series of dark brown spots and lines. These 
spots and lines are arranged in a regular pat- 
tern. There are numerous spots in the center 
of the dorsum that in two specimens may line 
up to form a line, running from the rhino- 
phores to the gill. Along the mantle margin 
there are several lines projecting radially from 
the center of the dorsum. There are small 
spots distributed irregularly among the central 
and radial lines. The rhinophores and gill are 
also white. 

Anatomy 

The posterior end of the oral tube has six 
strong retractor muscles (Fig. 43C), which are 
attached to the body wall. The oval, muscular 
buccal bulb has two additional muscles. The 
buccal bulb is about as long as the oral tube. 
The labial cuticle is smooth. The radular for- 
mula is 31 X (41.0.41) in a 10 mm preserved 
length specimen. There are no rachidian teeth. 
The inner lateral teeth are hamate, having a 
single cusp, and they lack denticles (Fig. 42A). 
The teeth increase in size suddenly towards 
the medial portion of the half-row. The mid-lat- 
eral teeth are also hamate and lack denticles 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



297 





Ш -^Ш 


1^ 


11 ,¿¡1 




ч 


1^ 




^ 2- 





FIG. 42. Scierodoris virgúlala, new species, paratype from Bathus 3 (stn. CP847). A. Inner lateral teeth; scale 
bar = 25 |im. B. Mid-lateral teeth; scale bar = 43 (.im. С Outer lateral teeth; scale bar = 30 цт. D. Caryophyl- 
lidium; scale bar = 30 |.im. E. Penial hooks; scale bar = 43 jam. 



(Fig. 42B). The outermost teeth are elongate, 
with a short base, and have 3-11 long denti- 
cles (Fig. 42C). The esophagus is long and 
connects directly to the stonnach (Fig. 43A). 

The ampulla is long; it narrows into the gon- 
oduct, which branches into a short oviduct 
and the prostate (Fig. 43B). The oviduct en- 



ters the female glands near the nidamental 
opening. The prostate is flattened and granu- 
lar; it is divided into two portions that are 
clearly distinguishable by their different tex- 
ture and coloration. The deferent duct is long 
and narrow; it opens Into a common, large 
atrium with the vagina. The penis is armed 



298 



VALDES 




FIG. 43. Sclerodoris virgúlala, new species, paratype from Bathus 3 (stn. CP847). A. Dorsal view of the 
anatonny; scale bar = 0.5 mm. B. Reproductive system; scale bar = 0.25 mm. С Anterior portion of the di- 
gestive system; scale bar = 0.5 mm. D. Central nervous system; scale bar = 0.25 mm. E. Mouth area; scale 
bar = 0.5 mm. Abbreviations: a, ampulla; ab, abdominal ganglion; b, buccal bulb; be, bursa copulatrix; bg, 
blood gland; bu, buccal ganglion; c, cerebral nerve; eg, cerebral ganglion; d, deferent duet; e, esophageal 
ganglion; f, female glands; g, genital nerve; gr, glandular region of the retractor muscles; h, hermaphrodite 
and digestive glands; ht, heart; i, intestine; I, visceral loop; m, retractor muscle; o, esophagus; ot, oral tube; 
p, pedal nerve; pg, pedal ganglion; pi, pleural nerve; pig, pleural ganglion; pr, prostate; r, rhinophoral nerve; 
s, seminal receptacle; sg, salivary gland; st, stomach; t, oral tentacle; v, vagina. 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



299 



with large, triangular hooks, about 70 |jm long 
(Fig. 42E). The vagina is very long; at its prox- 
imal end, it connects to the large and irregular 
bursa copulatrix. From the bursa copulatrix 
leads another long duct that connects to the 
seminal receptacle and the very short uterine 
duct. The bursa copulatrix is about ten times 
larger than the seminal receptacle. 

In the central nervous system (Fig. 43D), 
the cerebral and pleural ganglia are fused and 
distinct from the pedal ganglia. There are four 
cerebral nerves leading from each cerebral 
ganglion, and two (left) or one (right) pleural 
nerves lead from the pleural ganglion. The 
buccal ganglia lie near the rest of the central 
nervous system, joined to the cerebral ganglia 
by two long nerves. Gastroesophageal, 
rhinophoral, and optical ganglia are present. 
The pedal ganglia are clearly separated, hav- 
ing three nerves leading from each one. The 
pedal and parapedal commissures are en- 
veloped together with the visceral loop along 
all their length. There is an abdominal ganglia 
on the right side of the visceral loop. 

The circulatory system (Fig. 43A) consists 
of a heart and two blood gland situated in front 
and behind the central nervous system. 

Etymology 

From the Latin virgulatus (striped), in refer- 
ence to the numerous black lines on the dor- 
sum of this species. 

Remarks 



eral teeth denticulated, whereas they are 
smooth in S. virgulata. 

Genus Baptodoris Bergh, 1884 

Type Species: Baptodoris cinnabarina Bergh, 
1884, by monotypy. 

Baptodoris phinei Valúes, new species 
(Figs. 29D, 44, 45) 

Material Examined 

HOLOTYPE: Coral Sea, Musorstom 5 Ex- 
pedition, stn. 324 (2ri5'S, 157°51'E), 970 
m, 21 mm preserved length, leg. P. Bouchet, 
B. Métivier and B. Richer de Forges (MNHN). 

External Morphology 

The body is elevated and oval (Fig. 29D). 
The dorsum is covered with conical 
caryophyllidia, the largest reaching over 100 
|дт (Fig. 44D). They have a large, elongate 
ciliated tubercle and five spicules around it. 
The perfoliate rhinophores are composed of 
32 lamellae. There are five tripinnate 
branchial leaves. The rhinophoral and 
branchial sheaths are low. Ventrally, the oral 
tentacles are short and conical. The anterior 
border of the foot is notched and grooved 
(Fig. 45E). The mantle margin is narrower 
than the foot. 

The color of the living animal is uniformly 
white. The rhinophores and gill are also white. 



Rudman (1978) revised the genus Scle- 
rodoris in the Indo-West Pacific. He recog- 
nized eight valid species in this area (two of 
them unnamed), all of them very different from 
Sclerodoris virgulata. All the species previ- 
ously described have either dorsal ridges or 
depressions, which are absent in S. virgulata. 
Moreover, the combination of the following 
characters makes S. virgulata very easily dis- 
tinguishable from other members of the 
genus: white color pattern with radial dark 
brown lines, absence of an accessory gland, 
caryophyllidia lacking a projecting filament, 
and presence of four, thin branchial leaves. 

Another genus with caryophyllidia and den- 
ticulated outermost teeth is Taringa (Valdés & 
Gosliner, in press). However, S. virgulata 
does not fit in Taringa in having penial hooks 
and lacking a cuticular structure in the penis. 
In addition, Taringa has the inner and mid-lat- 



Anatomy 

The posterior end of the oral tube has six 
retractor muscles (Fig. 45C), which are at- 
tached to the body wall. The oval, muscular 
buccal bulb has two additional muscles. The 
buccal bulb is about as long as the oral tube. 
The labial cuticle is smooth. The radular for- 
mula is 20 X (18.0.18) in a 21 mm preserved 
length specimen. There are no rachidian 
teeth. The inner lateral teeth are hamate, hav- 
ing a single cusp with a large, rounded denti- 
cle (Fig. 44A). The teeth are very elongate 
with a short, strong cusp. The teeth increase 
in size gradually towards the medial portion of 
the half-row (Fig. 44A, B). The outermost 
teeth are short and have several, very small 
denticles (Fig. 44C). The esophagus is very 
long and wide, and connects directly to the 
stomach. 



300 



VALDES 




FIG. 44. Baptodoris phinei, new species, holotype. A. Inner lateral teeth; scale bar = 43 \.im. B. Mid-lateral 
teeth; scale bar = 60 цт. С. Outer lateral teeth; scale bar = 75 цт. D. Caryophyllidia; scale bar = 150 |im. 



The ampulla is long and convoluted; it nar- 
rows into the gonoduct, which branches into 
the short oviduct and the prostate (Fig. 45B). 
The oviduct enters the fennale glands near the 
nidamental opening. The prostate is large and 
granular; it is divided into two portions that are 
clearly distinguishable by their different tex- 
ture and coloration; the largest portion is pale 



yellow and connects to the deferent duct, 
whereas the smallest portion is orange and 
connects to the ampulla. The deferent duct is 
long and narrow; it expands into the ejacula- 
tory portion, which opens into a common 
atrium with the vagina. The penis is unarmed. 
There is a simple accessory gland that opens 
into the atrium, between the deferent duct and 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



301 




FIG. 45. Baptodoris phinei, new species, holotype. A. Dorsal view of the anatomy; scale bar = 1 mm. B. Re- 
productive system; scale bar = 1 mm. С Anterior portion of the digestive system; scale bar = 1 mm. D. Cen- 
tral nervous system; scale bar - 0.5 mm. E. Mouth area; scale bar = 1 mm. Abbreviations: a, ampulla; ab, 
abdominal ganglion; ag, accessory gland; b, buccal bulb; be, bursa copulatrix; bg, blood gland; bu, buccal 
ganglion; c, cerebral nerve; d, deferent duct; e, esophageal ganglion; f, female glands; g, genital nerve; h, 
hermaphrodite and digestive glands; ht, heart; i, intestine; 1, visceral loop; m, retractor muscle; o, esopha- 
gus; ot, oral tube; p, pedal nerve; pi, pleural nerve; pr, prostate; r, rhinophoral nerve; rs, renal syrinx; s, sem- 
inal receptacle; sg, salivary gland; st, stomach; t, oral tentacle; v, vagina. 



302 



VALDES 



the vagina. The vagina is short; at its proximal 
end, it connects to the large, oval bursa copu- 
latrix. From the distal portion of the vagina 
leads another long duct that connects to the 
seminal receptacle and the uterine duct. The 
bursa copulatrix is about twice as large as 
the seminal receptacle. 

In the central nervous system (Fig. 45D), 
the cerebral and pleural ganglia are fused and 
distinct from the pedal ganglia. There are 
three cerebral nerves leading from each cere- 
bral ganglion, and three pleural nerves lead 
from each pleural ganglion. The buccal gan- 
glia lie near the rest of the central nervous 
system, joined to the cerebral ganglia by two 
long nerves. Gastroesophageal, rhinophoral 
and optical ganglia are present. There are no 
eyes. The pedal ganglia are clearly sepa- 
rated, having three nerves leading from each. 
A large abdominal ganglion lies on the right 
side of the central nervous system. The pedal 
and parapedal commissures are enveloped 
together with the visceral loop along all their 
length. 

The circulatory system (Fig. 45A) consists 
of a heart and a single blood gland situated 
over the central nervous system. 



Etymology 

Dedicated to Phineus, the mythical prophet 
who was blinded by Zeus, in reference to the 
lack of eyes of this species. 

Remarks 

The genus Baptodoris was recently diag- 
nosed by Valdés & Gosliner (in press) as hav- 
ing the dorsum covered with caryophyllidia, 
prostate with two portions, penis armed with 
hooks, and a gap without hooks near the 
opening, accessory gland lobate, without a 
spine, labial cuticle smooth, and outermost 
lateral teeth very small and multidenticulate. 
Baptodoris phinei has all these characteristics 
except for the penial hooks. However, B. 
phinei share more features with members of 
the Baptodoris clade than with other caryoph- 
yllidia-bearing dorids and therefore it is provi- 
sionally placed in this genus. Also, B. phinei 
share with one of the two valid species of the 
genus, Baptodoris cinnabarina Bergh, 1884, 
the presence of a single, large denticle on the 
cusp of the lateral radular teeth. 

Baptodoris phinei is clearly distinguishable 
from the two other members of the genus 



Baptodoris by the external morphology and 
anatomy. Baptodoris cinnabarina is yellow to 
dark red with white and brown spots (Valdés & 
Gosliner, in press), and B. mimetica Gosliner, 
1991, is bright lemon yellow with white spots 
(Gosliner, 1991), whereas P. phinei is uni- 
formly pale cream. The anatomical unique 
features of P. phinei are the lack of eyes and 
the absence of penial hooks. 



Genus Dendrodor/s Ehrenberg, 1831 

Type Species: Dendrodoris lugubris Ehren- 
berg, 1831, by subsequent designation 
by Gray (1847). 



Dendrodoris orbicularis Valdés, new 
species (Figs. 29F, 46) 

Material Examined 

HOLOTYPE: Southeast of New Caledonia, 
Halipro 1 Expedition, stn. CC856 (21°44'S, 
166°37'E), 311-365 m, 20 March 1994, 47 
mm preserved length, dissected, leg. B. 
Richer de Forges (MNHN). 

PARATYPES: New Caledonia, Musorstom 
4 Expedition, stn. CP135 (18°55'S, 
163°22'E), 456 m, 19 September 1985, one 
specimen 46 mm preserved length, dis- 
sected, leg. P. Bouchet and B. Richer de 
Forges (MNHN). Southeast of New Caledo- 
nia, Halipro 1 Expedition, stn. CC851 
(21°43'S, 166°37'E), 314-364 m, 19 March 
1994, one specimen 14 mm preserved length, 
dissected, leg. B. Richer de Forges (MNHN). 
North of New Caledonia, Bathus 4 Expedition, 
stn.CP906(19°01'S, 163°15'E), 339-350 m, 
4 September 1994, one specimen 20 mm pre- 
served length, dissected, leg. B. Métivier and 
B. Richer de Forges (CASIZ 121101); stn. 
DW925 (18°55'S, 163°24'E), 370-405 m, 7 
August 1 994, one specimen 1 1 mm preserved 
length, dissected, leg. B. Métivier and B. 
Richer de Forges (MNHN). 



External Morphology 

The body is elevated, oval (Fig. 29F), soft in 
texture. The dorsum is smooth, lacking tuber- 
cles. The perfoliate rhinophores consist of 37 
lamellae. There are six tripinnate branchial 
leaves. Ventrally there are no oral tentacles. 
The anterior border of the foot has a deep 
notch where the mouth opens (Fig. 46E). The 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 
A ^— ^<t^b 



303 




FIG. 46. Dendrodoris orbicularis, new species, paratype from Musorstom 4 (stn. CP135). A. Dorsal view of 
the anatomy; scale bar = 2 mm. B. Reproductive system; scale bar = 2 mm. С Detail of several reproduc- 
tive organs; scale bar = 2 mm. D. Central nervous system; scale bar = 1 mm. E. Mouth area; scale bar = 3 
mm. Abbreviations: a, ampulla; b, buccal bulb; be, bursa copulatrix; bg, blood gland; bu, buccal ganglion; c, 
cerebral nerve; eg, cerebral ganglion; d, deferent duct; f, female glands; g, genital nerve; h, hermaphrodite 
and digestive glands; ht, heart; i, intestine; o, esophagus; p, pedal nerve; pi, pleural nerve; pig, pleural gan- 
glion; pr, prostate; pt, ptyaline gland; py, pyloric sac; r, rhinophoral nerve; s, seminal receptacle; v, vagina. 



foot is very wide, almost ten times wider than 
the mantle margin 

The color of the living animals Is unknown. 
Only one specimen, the holotype, retained 
some of the original coloration. It is pale 
brown with several, large rings of dark brown. 



The interior of some ridges is darker than the 
rest of the dorsum. The mantle margin is 
edged by a thin, white line, that is interiorly 
surrounded by a wider black band. Ventrally, 
there are faded brown spots densely distrib- 
uted on the foot sole, and a few, larger scat- 



304 



VALDES 



tered on the mantle margin. The other speci- 
mens are uniformly cream, some of them with 
faded patches of dark brown. 

Anatomy 

The posterior end of the buccal bulb has 
four thin retractor muscles (Fig. 46A), which 
attach to the body wall. There are no salivary 
glands. Two large ptyaline glands are joined 
together to a single duct that opens into the 
buccal bulb. There are no jaws and radula. 
The esophagus is long and convoluted. It has 
two rounded esophageal glands and con- 
nects directly to the digestive gland. The in- 
testine is short and has a pyloric sac on its 
proximal region (Fig. 46A). 

The ampulla is long and convoluted; it nar- 
rows into the gonoduct, which branches into a 
short oviduct and the prostate (Fig. 46C). The 
oviduct enters the female glands near the 
center of the mass. The prostate is tubular, 
granular, and elongate (Fig. 46B); it narrows 
and expands again into the long deferent 
duct. The deferent duct opens into a common 
atrium with the vagina. The penis is unarmed. 
The vagina is long and wide; at its proximal 
end, it connects to the large, irregular bursa 
copulatrix. Another very long, convoluted 
duct, which connects to the seminal recepta- 
cle and to the short uterine duct, leads from 
the bursa copulatrix. The bursa copulatrix is 
about twenty times larger than the seminal re- 
ceptacle. 

In the central nervous system (Fig. 46D), 
the cerebral and pleural ganglia are fused and 
distinct from the pedal ganglia. There are four 
cerebral nerves leading from each cerebral 
ganglion, and three pleural nerves lead from 
each pleural ganglion. The buccal ganglia lie 
near the rest of the central nervous system, 
joined to the cerebral ganglia by two short 
nerves. Optical ganglia are present. The 
rhinophoral ganglia appear to be fused with 
the cerebral ganglia. The two pedal ganglia 
are joined together ventrally, having three 
nerves leading from each one. There are no 
pedal and parapedal commissures. 

The circulatory system (Fig. 46A) consists 
of a heart and a single blood gland situated 
behind the central nervous system. 

Etymology 

From the Latin orbis (circle, ring), in refer- 
ence to the brown rings on the dorsum of this 
species. 



Remarks 

Dendrodoris orbicularis is easily distin- 
guishable from other Indo-Pacific species of 
Dendrodoris by its external coloration. There 
are no other species described from this area 
with a color pattern of large, dark dorsal rings. 

In addition, the lack of penial hooks in D. or- 
bicularis differentiates this species from most 
of the others studied anatomically. Only Den- 
drodoris corónala Kay & Young, 1969, also 
lacks penial hooks too (Kay & Young, 1969; 
Valdés & Gosliner, 1999), but this species is 
easily distinguished from D. orbicularis in hav- 
ing a white coloration with black spots, dorsal 
tubercles, the seminal receptacle larger than 
the bursa copulatrix and a very short ampulla 
(Valdés & Gosliner, 1999). 

Dendrodoris brodieae Valdés, new species 
(Figs. 13D, 47A, B, 48A) 

Material Examined 

HOLOTYPE: North of New Caledonia, Mu- 
sorstom 4 Expedition, stn. CP153 (19°04'S, 
163°21'E), 235 m, 14 September 1985, one 
specimen 14 mm preserved length, leg. P. 
Bouchet and B. Richer de Forges (MNHN). 

PARATYPES: South of New Caledonia, 
Musorstom 4 Expedition, stn. DW227 
(22°46'S, 167°20'E), 300 m, 30 September 
1 985, one specimen 1 9 mm preserved length, 
leg. P. Bouchet and B. Richer de Forges 
(CASIZ 121102). South of New Caledonia, 
Chalcal 2 Expedition, stn. DW81 (23°20'S, 
168°03'E), 311 m, 31 October 1986, one 
specimen 31 mm preserved length, dis- 
sected, leg. P. Bouchet, B. Métivier, В. Richer 
de Forges (MNHN). 

External Morphology 

The body of the living animal is elevated, 
oval, soft in texture (Fig. 13D). The dorsum is 
smooth, lacking tubercles. The perfoliate 
rhinophores consist of 32 lamellae. There are 
six tripinnate branchial leaves. Ventrally there 
are no oral tentacles. The anterior border of 
the foot has a deep notch where the mouth 
opens. The foot is very wide, almost ten times 
wider than the mantle margin. 

The general color of the body is pale brown. 
The dorsum is covered with numerous, 
rounded or oval pale cream spots. Among 
them, there are several large, dark brown 
patches. In some cases, the brown patches 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 
d 



305 





FIG. 47. Reproductive systems. A, B. Dendrodoris brodieae, specimen from Chalcal 2 (DW81); scale bar = 
1 mm. C, D. Dendrodoris sp., specimen from Musorstom 3 (stn. CP110); scale bar = 1 mm. Abbreviations: 
a, ampulla; be, bursa copulatrix; d, deferent duct; f, female glands; pr, prostate; s, seminal receptacle; v, 
vagina; vg, vestibular gland. 



overlap the white spots. The mantle edge is 
surrounded by a white or pale cream line, in- 
terrupted by dark brown, almost black spots. 
These spots are connected to pale brown 
spots situated on the mantle margin. The 
rhinophores are cream with the apex black. 
The gill is also cream with the lamellae edged 
with dark brown pigment. 

Anatomy 

The reproductive system has a wide, sim- 
ple ampulla; it narrows Into the gonoduct, 
which branches into a long oviduct and the 
prostate (Fig. 47B). The oviduct enters the fe- 



male glands near the center of the mass. The 
prostate is tubular, granular and elongate 
(Fig. 47A); it narrows and expands again Into 
the deferent duct. The deferent duct opens 
into a common atrium with the vagina. The 
penis is armed with several rows of elongate 
hooks. The hooks have long bases and coni- 
cal cusps, about 50 \.im long (Fig. 48A). The 
vagina is long and wide; at its proximal end, it 
connects to the large and rounded bursa cop- 
ulatrix. Another long, convoluted duct, which 
connects to the seminal receptacle and to the 
short uterine duct, leads from the bursa copu- 
latrix. The bursa copulatrix is about ten times 
larger than the seminal receptacle. 



306 



VALDES 




FIG. 48. Reniai hooks. A. Dendrodoris brodieae. specimen from Chalcal 2 (DW81); scale bar = 25 цт. В. 
Dendrodoris sp., specimen from Musorstom 3 (stn. CP110); scale bar = 20 ¡am. 



Etymology 

Dedicated to Gilianne Brodle, who is re- 
viewing the genus Dendrodoris in the Indo- 
West Pacific 

Remarks 

Dendrodoris brodieae is clearly distinguish- 
able from other Indo-Pacific species of Den- 
drodoris by its external coloration. The only 
other species with cream rounded spots on 
the dorsum is Dendrodons guttata (Odhner, 
1917). However, D. guttata has also black 
spots in the middle of the cream spots (Willan 
& Coleman, 1984), which are absent in D. 
brodieae. In addition, D. guttata has a fawn or 
apricot general color, whereas D. brodieae is 
pale brown. Also, the dark brown spots of D. 
brodieae are absent in D. guttata (Willan & 
Coleman, 1984). Dendrodoris denisoni 
(Angas, 1864) also resembles D. brodieae in 
the external coloration, but these two species 
are clearly distinguishable by the presence of 
large tubercles in the former. 

Internally, D. brodieae is characterized by 
having a very large vestibular gland. Other 
species of Dendrodoris with vestibular glands 
are D. nigra (Stimpson, 1855), D. denisoni 
(Angas, 1864), and D. albobrunnea Allan, 
1933 (Brodle et al., 1997; Valdés & Gosliner, 



1999). In D. nigra and D. denisoni, the 
vestibular gland is much smaller than that of 
D. brodieae. Only in D. albobrunnea it has a 
very large vestibular gland, comparable to 
that of D. brodieae. However, both species 
are distinguishable by the external morphol- 
ogy. Dendrodoris albobrunnea has small dor- 
sal tubercles, whereas D. brodieae has a 
smooth dorsum. Moreover, D. albobrunnea is 
a very pale species with small brown spots, 
whereas D. brodieae has a much more com- 
plex coloration, with brown patches and pale 
cream spots. 

Dendrodoris sp. (Figs. 47C, D, 48B) 

Material Examined 

Philippines, Musorstom 3 Expedition, stn. 
CP110 (14°00'N, 120°18'E), 187-193 m, 2 
June 1985, one specimen 27 mm preserved 
length, dissected, leg. P. Bouchet and M. P. 
Triclot (MNHN). 

External Morphology 

The body is elevated, oval, soft in texture. 
The dorsum is smooth, lacking tubercles. The 
perfoliate rhinophores consist of 31 lamellae. 
There are six tripinnate branchial leaves. Ven- 
trally there are no oral tentacles. The anterior 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



307 



border of the foot has a deep notch where the 
mouth opens. The foot is very wide, almost 
ten times wider than the mantle margin. The 
color of the living animal is unknown. 

Anatomy 

The reproductive system has a small, con- 
voluted ampulla; it narrows into the gonoduct, 
which branches into a short oviduct and the 
prostate (Fig. 47D). The oviduct enters the fe- 
male glands near the center of the mass. The 
prostate is tubular, granular and elongate 
(Fig. 47C); it narrows and expands again into 
the long and wide deferent duct. The deferent 
duct opens into a common atrium with the 
vagina. The penis is armed with several rows 
of penial hooks. The hooks have long bases 
and minute, rounded cusps, about 2 цт long 
(Fig. 48B). The vagina is long and wide; at its 
proximal end, it connects to the large and 
rounded bursa copulatrix. Another very long 
and convoluted duct, which connects to the 
seminal receptacle and to the short uterine 
duct, leads from the bursa copulatrix. The 
bursa copulatrix is about 20 times larger than 
the seminal receptacle. 

Remarks 

The penial hooks of this species appear to 
be very distinctive. However, a single speci- 
men of this species was collected, and there 
is not information on the external coloration of 
the living animal. Therefore, I prefer not to 
name this likely new species before more ma- 
terial becomes available. 



DISCUSSION 

The deep-water species of cryptobranch 
dorids described in this paper have been 
compared with their known closest relatives 
inhabiting shallow waters. The anatomy and 
the generic placement of many shallow-water 
species of cryptobranch dorids from the tropi- 
cal Indo-Pacific are poorly known. It may be 
possible that some of the tropical shallow- 
water species have large bathymétrie ranges, 
showing a pale or white coloration when they 
occur in deep waters. For example, the no- 
taspidean opisthobranch Umbraculum um- 
braculum Lightfoot, 1786, is found in eastern 
Australia from the intertidal zone to 274 m, 
and the deep-water specimens are translu- 
cent white, apparently lacking pigment (Rud- 



man, 1 999). However, most of the species de- 
scribed in the present paper, closest relatives 
of which have been anatomically studied, 
show notable anatomical differences from the 
shallow-water species and they clearly consti- 
tute new species. Moreover, the evidence in- 
dicates that most species of cryptobranch 
dorids have, in general, narrow bathymétrie 
ranges. As for the phyllidiids on the Norfolk 
Ridge (Valdés, 2001), the present material 
shows that several deep-sea assemblages 
replace each other in different depth zones. 
For instance, of the ten species found in the 
200-400-m depth interval, one {Cadlina 
abyssicola) has been recorded from deeper 
than 500 m and another {Pharodoris di- 
aphora) from more shallow than 100 m. Con- 
versely, of the seven species found in the 
500-1, 000-m interval, only two [Cadlina 
abyssicola and Discodoris achroma) are 
recorded from shallower depths than 500 m. 
Even if only species represented by more 
than one lot are considered, there is evidence 
for a considerable species turnover: of the five 
species found at more than one station in the 
200-400-m depth interval, one {Cadlina 
abyssicola) has been recorded from deeper 
than 500 m and another {Pharodoris di- 
aphora) from more shallow than 100 m. Con- 
versely, of the five species found at more than 
one station in the 500-1 000-m interval, two 
{Cadlina abyssicola and Discodoris achroma) 
have been recorded from more shallow than 
500 m. 

The species studied in this paper belong to 
13 genera of cryptobranch dorids. Most of 
these genera - Cad//na, Geitodoris, Dis- 
codoris, Peltodoris, Paradons, Diaulula, Ros- 
tanga, Sclerodoris and Dendrodoris are 
here reported from deep waters for the first 
time, and two, Goslineria and Pharodoris, are 
here described. Some of these genera are 
more commonly found in cold or temperate 
waters. Austrodoris has been reported from 
Antarctic cold Atlantic waters (Bouchet, 1977; 
Wägele, 1990), Cadlina has been found in 
cold and temperate waters of Antarctica, 
South America, Japan, North America, Europe 
and South Africa (Rudman, 1984; Gosliner, 
1987b), and Diaulula, which has only one 
species assigned with certainty, was de- 
scribed from cold or temperate waters in the 
Americas and Japan (McDonald, 1 983). Other 
genera, such as Rostanga, Paradoris, Geito- 
doris and Baptodoris, are widespread and are 
not commonly found in cold regions (Baba, 
1 986; Rudman & Avern, 1 989; Gosliner, 1 991 ; 



308 



VALDES 



Miller, 1995, 1996: Ortea, 1995). Finally, only 
two genera, Sclerodoris and Dendrodoris. are 
strictly from tropical or subtropical areas (Rud- 
man, 1978; Valdés & Gosliner, 1999). 

Several hypotheses could explain the pres- 
ence of both tropical and cold water species in 
Indo-Pacific deep waters. Species of Aus- 
trodoris. which are absent from the tropical 
Indo-Pacific, are likely related to the Antarctic 
species. A. kerguelenensis. also found in New 
Caledonia Austrodoris kerguelenensis also 
occurs in the Antarctic deep-sea, and has a 
very wide geographic and bathymétrie range 
(only in cold waters). Since the two other 
species found in New Caledonia share at 
least a portion of their geographic range with 
A. kerguelenensis. vicariance does not ex- 
plain the process of speciation that took place 
in this area. The species of Austrodoris de- 
scribed here are found in deeper and there- 
fore colder waters, from 500 to 1 ,300 m depth, 
whereas the rest of the species, with the ex- 
ception of Baptodoris phinei, were collected in 
shallower areas. It appears that Austrodoris is 
better adapted to cold waters than other gen- 
era and this genus occurs in large numbers in 
the Antarctic (Wägele, 1990) and the tropical 
deep sea. The tropical deep sea could be a 
relict area where species of Austrodoris oc- 
curred since the early Pliocene. Gosliner 
(1987a) hypothesized that during the early 
Pliocene, when ocean temperatures began to 
drop, it is likely that many species of marine 
organisms were widely distributed throughout 
the southern oceans. The oceanic warming 
during portions of the Pleistocene could have 
served as an extinction mechanism of these 
cold-water species in large areas of their geo- 
graphic ranges. The deep-water environment 
could have served as a refuge where Aus- 
trodoris species survived. 

On the other hand, most of the genera 
found in deep waters are not present in the 
Antarctica. In the case of Sclerodoris and 
Dendrodoris, the species found in New Cale- 
donia must have tropical sister taxa, since 
these genera are strictly found in tropical wa- 
ters. Vertical dispersal followed by subse- 
quent vicariance could explain the presence 
of these tropical species in the deep sea. 
Members of Sclerodoris and Dendrodoris 
have always been found at 460 m or less, 
being among the species with a shallowest 
occurrence. 

The genera Rostanga, Paradons, Cadlina 
and Geitodoris have representatives in the 
temperate waters of New Zealand (Miller, 



1980; Rudman & Avern, 1989; Miller, 1995, 
1996), very close to New Caledonia, and it is 
possible that vicariant events were involved in 
the evolution of this species. Again, as 
Gosliner (1987a) hypothesized for South 
African species, the ocean warming during 
the Pleistocene could have served as an iso- 
lating mechanisms that resulted in speciation. 
Members of Paradoris, Cadlina and Geito- 
doris appear to be absent from the rest of the 
Indo-Pacific and also vicariance seems to be 
a likely explanation for the range of these 
species. Phylogenetic studies on each genus 
would determine the sister-group relation- 
ships and biogeographic patterns of the deep- 
water species here described. 

Most of the species studied in this paper 
have a pale, simple external coloration. Many 
of them are uniformly pale cream or white, 
and only a few have two contrasting colors. 
Bouchet (1977) described several species 
from Atlantic deep waters with similar color 
patterns. Valdés (2001) found that species of 
Phyllidiopsis show certain correlation be- 
tween their color and their collection depth. 
Species found deeper have simpler and paler 
color patterns. The coloration of shallow- 
water dorid nudibranchs is believed to have a 
strong defensive significance (Gosliner & 
Behrens, 1990). Several defensive systems 
based on color have been described in dorid 
nudibranchs, that included aposematic col- 
oration and mimicry, but also crypsis and spe- 
cial resemblance. Due to the partial or total 
absence of light in deep waters, the coloration 
of deep-sea dwellers is probably not very use- 
ful in an interaction with potential predators. 
Therefore, deep-sea nudibranchs probably 
rely on other defensive systems, that are also 
present in shallow water species, for exam- 
ple, chemical defense and spicules (Avila, 
1995). Chemical studies have not been car- 
ried out on deep-sea nudibranchs, to deter- 
mine whether they may have higher concen- 
trations of toxic chemicals than shallow 
waters species. 

Since most deep-water dorids have a pale 
coloration, that must be some sort of ecologi- 
cal advantage for these animals. The most 
likely possibility is that deep-sea animals con- 
serve energy by not producing pigments that 
they are not going to use. Also, pale col- 
orations may help to camouflage species that 
inhabit moderately deep waters, where some 
light is still available. 

Two of the species studied in this paper 
lack eyes, in what also seems to be another 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



309 



adaptation to living in deep waters. Other 
blind species of nudibranchs have been pre- 
viously described from deep waters in the Arc- 
tic, Atlantic and Pacific Oceans (Wägele, 
1989; Baranets, 1993; Valdés & Bouchet, 
1998a, 1998b; Valdés & Bertsch, 2000). The 
blind species collected from New Caledonia 
are Austrodoris caeca and Baptodoris phinei, 
and both were collected at great depths, from 
650 to 1 ,330 m in the case of the former and 
at 970 m in the latter. The rest of the species, 
which have well-developed eyes, were col- 
lected from areas shallower than 700 m 
depth. The blind Atlantic species previously 
described are from 1 ,685 and 2,538-3,01 6 m 
depth (Valdés & Bouchet, 1998a, 1998b). 

For this paper, 23 species have been stud- 
ied, of which 18 are from New Caledonia, four 
from the Philippines, three from Vanuatu, and 
one from Wallis and Futuna (the total does not 
add up to 23 because some species occur in 
more than one region). According to Philippe 
Bouchet (pers. comm.). New Caledonia has 
been sampled more extensively than any 
other place, and the number of records un- 
doubtedly reflects this sampling effort more 
than actual differences in absolute species 
richness. It is noteworthy that nearly half of 
the total number (11 species) have been col- 
lected from the Norfolk Ridge alone, a site of 
complex topography with extensive hard bot- 
toms. 

Only three stations, all from New Caledo- 
nia, had more than one species (Bathus 1 sta. 
CP711: Austrodoris laboutei, Pharodoris di- 
aphora: Bathus 3 sta. CP847: Cadlina abyssi- 
cola, Sclerodoris virgulata; and Halipro 1 sta. 
CP851: Paradoris araneosa, Dendrodoris or- 
bicularis). This contrasts with the experience 
of opisthobranch collectors in tropical shallow 
water, where the syntopic co-occurrence of 
several species of cryptobranch dorids is not 
exceptional. 

An indication that the deep-water fauna of 
cryptobranch dorids is still far from adequately 
inventoried is given by the fact that 14 species 
(61%) are represented by single specimens. 



ACKNOWLEDGEMENTS 

I would like to recognize the generous sup- 
port of several individuals. Philippe Bouchet 
made available the material examined in this 
paper, collected with the financial support of 
MNHN and IRD (formerly ORSTOM) during 



the MUSORSTOM expeditions. Specimens 
were collected by Bertrand Richer de Forges, 
Philippe Bouchet, Anders Waren and Bernard 
Métivier. Pierre Laboute and Jean-Louis 
Menou took photographs of living specimens. 
Katie Martin edited the final version of the 
manuscript. Darrell Ubick helped to prepare 
the samples using the critic point technique 
for examination on SEM. Terry Gosliner, 
Philippe Bouchet and Bill Rudman made con- 
structive comments on the manuscript. 

This paper has been supported by the Na- 
tional Science Foundation through the РЕЕТ 
grant DEB-9978155 "Phylogenetic systemat- 
ics of dohd nudibranchs" to Terrence M. 
Gosliner, and the Ministerio de Educación у 
Cultura of Spain (SEUI), through its postdoc- 
toral fellowship program. Additional financial 
support has been made possible by the Cali- 
fornia Academy of Sciences. 



LITERATURE CITED 

AVILA, С, 1995, Natural products of opisthobranch 
molluscs: a biological review. Oceanography and 
Marine Biology: An Annual Review, 33: 487-559. 

BABA, К., 1936, Opisthobranchia of the Ryûkyû 
(Okinawa) Islands. Journal of the Department of 
Agriculture, Kyûshû Imperial University, 5: 1-50, 
pis. 1-3. 

BABA, К., 1937, Opisthobranchia of Japan. Journal 
of the Department of Agriculture, Kyûshû Imper- 
ial University 5: 290-344, pis. 1 , 2. 

BABA, К., 1986, Description of a new species of 
nudibranchiate Mollusca, Paradoris tsurugensis, 
Dorididae, from Japan. Boletim de Zoología, 10: 
1-8. 

BARANETS, О. N., 1993, The primitive nudi- 
branchiate mollusc: Bathydoris violácea sp. n. 
(Gastropoda, Nudibranchia). Vestnil< Sanl<t-Pe- 
terburgskogo Universiteta. (3)3: 13-18 [In Rus- 
sian]. 

BERGH, R., 1884, Report on the Nudibranchiata 
collected by H. M. S. Challenger, during the years 
1873-1876: 10: 1-154, pis. 1-14, in с w. THOM- 
SON & J. MURRAY, eds, Report on the scientific re- 
sults of the Voyage of H. M. S. Challenger during 
the years 1873-76 under the command of Cap- 
tain George S. Nares, R. N., F. R. S. and Captain 
Frank Tourle Thomson, R. N. Zoology. London: 
H. M. Stationery Office. 154 pp. 

BERGH, R., 1905, Die Opisthobranchiata der Si- 
boga-Expedition: 50: 1-248, pis. 1-20, in м. 
WEBER, ed., Uitkomsten op Zoologisch, Bota- 
nisch, Oceanographisch en Geologisch Gebied 
verzameld in Nederlandsch Oost-Indië 1899- 
1900 aan board H.M. Siboga onder commando 
van Luitenant ter zee /®kl. G.F. Tydeman. Leiden: 
Brill. 248 pp. 



310 



VALDES 



BERGH, R., 1907, The Opisthobranchiata of South 
Africa. Transactions of the South African Philo- 
sophical Society. 17: 1-144. pis. 1-14. 

BOUCHET, R, 1977, Opisthobranches de pro- 
fondeur de l'Océan Atlanatique: Il — Notaspidea 
et Nudibranchiata. Journal of Molluscan Studies. 
43: 28-66. 

BRODIE, G. D.. R. С WILLAN & J. D. COLLINS. 
1997, Taxonomy and occurrence of Dendrodoris 
nigra and Dendrodoris fumata (Nudibranchia: 
Dendrodondidae) in the Indo-West Pacific Re- 
gion. Journal of Molluscan Studies. 63: 407-423. 

BURN. R.. 1958. Further Victonan Opistho- 
branchia. Journal of the Malacological Society of 
Australia. 1(2): 20-36. 

BURN. R.. 1969. A глетопа1 report on the Tom 
Crawford collection of Victorian Opisthobranchia. 
Journal of the i\/lalacological Society of Australia. 
12: 64-106. 

EDMUNDS. M.. 1981. Opisthobranchiate Mollusca 
from Ghana: Chromodorididae. Zoological Jour- 
nal of the Linnean Society 72: 1 75-201 . 

EDMUNDS. M. & R. С PREECE. 1996, A collection 
of opisthobranch molluscs from the Pitcairn Is- 
lands. Journal of Conchology 35: 407-421. 

ELIOT С N. е., 1907. Nudibranchs from New 
Zealand and the Falkland Islands. Proceedings 
of the Malacological Society of London. 7: 
327-361. pi. 28. 

FAHEY. S. & T M. GOSLINER. 2000, New records 
of Halgerda Bergh, 1880 (Opisthobranchia, Nudi- 
branchia) from the deep western Pacific Ocean, 
with descriptions of four new species. Zoosys- 
tema. 22: 471 -498. 

GARCIA, F. J., J. S. TRONCOSO, J. С GARCÍA- 
GÓMEZ & J. L. CERVERA, 1993, Anatomical 
and taxonomical studies of the Antarctic nudi- 
branchs Austrodoris kerguelenensis (Bergh, 
1884) and A. georgiensis n. sp. from the Scotia 
Sea. Polar Biology 13: 417-421. 

GAROVOY. J. В.. A. VALDÉS & T M. GOSLINER. 
in press. Phylogeny of the genus Rostanga (Mol- 
lusca, Nudibranchia), with descriptions of three 
new species from South Africa. Journal of Mol- 
luscan Studies. 

GRAY, J. E., 1 847, A list of the genera of recent Mol- 
lusca, their Synonyma and types. Proceedings of 
the Zoological Society of London. 15: 129-219. 

GOSLINER. T M., 1987a, Biogeography of the 
opisthobranch gastropod fauna of southern 
Africa. American Malacological Bulletin. 5: 243- 
258. 

GOSLINER. T M.. 1987b, Nudibranchs of southern 
Africa. A guide to the opisthobranch molluscs of 
southern Africa. Monterey, California: Sea Chal- 
lengers. 136 pp. 

GOSLINER, T M., 1991, Four new species and a 
new genus of opisthobranch gastropods from the 
Pacific coast of North America. Veliger. 34: 
272-290. 

GOSLINER, T M. & D. W. BEHRENS, 1990, Spe- 
cial resemblance, aposematic coloration and 
mimicry in opisthobranch gastropods. Pp. 127- 



138. pis. 8-11, in: M. wiCKSTEN, ed.. Adaptive col- 
oration in invertebrates. American Society of Zo- 
ologists, Galveston. Texas. 

GOSLINER. T M. & D. W. BEHRENS, 1998, Two 
new discodorid nudibranchs from the Western 
Pacific with a redescription of Doris luteola Ke- 
laart, 1858. Proceedings of the California Acad- 
emy of Sciences. 50: 279-293. 

KAY E. A. & D. K. YOUNG, 1969, The Dohdacea 
(Opisthobranchia: Mollusca) of the Hawaiian Is- 
lands. Pacific Science. 23: 172-231. 

MARCUS, ER., 1955, Opisthobranchia from Brazil. 
Boletim da Facultado de Filosofía. Ciencias e Le- 
tras. Zoología. 20: 89-261, pis. 1 -30. 

MARCUS, ER., 1959, Lamellahacea und Opistho- 
branchia. Reports of the Lund University Chile 
Expedition 1948-49. 36: 1-133. 

McDonald, G. R., 1983, a review of the nudi- 
branchs of the California coast. Malacologie. 24: 
114-276. 

MILLER, M. C, 1980, Cadlina willani. a new dorid 
nudibranch (Gastropoda: Opisthobranchia) from 
New Zealand. New Zealand Journal of Zoology. 
7: 165-171. 

MILLER, M. C, 1995, New species of the dorid 
nudibranch genus Paradoris Bergh, 1884 (Gas- 
tropoda: Opisthobranchia) from New Zealand. 
Journal of Natural History. 29: 901 -908. 

MILLER, M. C, 1996, A new species of the dorid 
nudibranch genus Geitodoris Bergh, 1892 (Gas- 
tropoda, Opisthobranchia) from New Zealand. 
Journal of Molluscan Studies. 62: 433-442. 

ODHNER, N. H., 1939, Opisthobranchiate Mollusca 
from the western and northern coasts of Nonway. 
Det Kongelige Norske Videnskabersselskabs 
Skrifter. 1: 1-93. 

O'DONOGHUE, С H., 1926, A list of the nudi- 
branchiate Mollusca recorded from the Pacific 
coast of North America, with notes on their distri- 
bution. Transactions of the Royal Canadian Insti- 
tute, 34: 199-247. 

O'DONOGHUE. С H., 1929, Report on the 
Opisthobranchiata. Zoological results of the 
Cambridge Expedition to the Suez Canal, 1924. 
38. Transactions of the Zoological Society of Lon- 
don, 22: 713-841. 

ORTEA, J., 1995, Estudio de las especies atlánti- 
cas de Paradons Bergh, 1884 (Mollusca: Nudi- 
branchia: Discodorididae) recolectadas en las 
Islas Canarias. Avicennia. 3: 5-27. 

RISBEC, J., 1937, Note préliminaire au sujet de 
nudibranches Nêo-Calédoniens. Bulletin du Mu- 
seum National d'Histoire Naturelle. (2)9: 
159-164. 

RUDMAN, W. В., 1978, The dorid opisthobranch 
genera Halgerda Bergh and Sclerodoris Eliot 
from the Indo-West Pacific. Zoological Journal of 
the Linnean Society 62: 59-88. 

RUDMAN, W. В., 1984, The Chromodorididae 
(Opisthobranchia: Mollusca) of the Indo-West 
Pacific: a review of the genera. Zoological Jour- 
nal of the Linnean Society 81 : 1 1 5-273. 

RUDMAN, W. В., 1985, The Chromodorididae 



DORID NUDIBRANCHS FROM THE DEEP PACIFIC OCEAN 



311 



(Opisthobranchia; Mollusca) of the Indo-West 
Pacific: Chromodons aureomarginata, C. verrieri 
and C. fidelis color groups. Zoological Journal of 
the Linnean Society. 83: 241 -299. 

RUDMAN, W. В., 1999, Umbraculum from deep 
water off Australia. Available via: fittp://www.aust- 
mus.gov.au/seaslugs/umbrumbr.htm 

RUDMAN, W. B. & G. J. AVERN, 1989, The genus 
Rostanga Bergh, 1879 (Nudibranchia: Dorididae) 
in the Indo-West Pacific. Zoological Journal of the 
Linnean Society, 96: 281 -338. 

SCHMEKEL, L. & A. PORTMANN, 1982, Opistho- 
branchia des Mittelmeeres. Nudibranchia und 
Saccoglossa. Berlin: Springer- Verlag. 410 pp. 

SCHRÖDL, M., 2000, Revision of the nudibranch 
genus Cadlina (Gastropoda: Opisthobranchia) 
from the southern Ocean. Journal of the !\/larine 
Biological Association of the United Kingdom. 80: 
299-309. 

THOMPSON, T E., 1975, Dorid nudibranchs from 
eastern Australia (Gastropoda, Opisthobranchia). 
Journal of Zoology 176: 477-517. 

VALDÉS, A., 2001, Deep-water phyllidiid nudi- 
branchs (Gastropoda, Phyllidiidae) from the trop- 
ical south-west Pacific Ocean: 22, in: p. bouchet 
& B.A. MARSHALL, eds., Tropical deep-sea ben- 
thos. Mémoires du Muséum National d'Histoire 
Naturelle ^85■.33^ -369. 

VALDÉS, A. & H. BERTSCH, 2000, Redeschption 
and range extension of Bathydoris aloca Marcus 
& Marcus, 1962 (Nudibranchia: Gnathodori- 
doidea). Veliger, 43: 210-216. 

VALDÉS, A. & R BOUCHET 1 998a, A blind abyssal 
Corambidae (Mollusca, Nudibranchia) from the 
Norwegian Sea, with a réévaluation of the sys- 
tematics of the family. Sarsia. 83: 15-20. 

VALDÉS, A. & R BOUCHET 1998b, Naked in toxic 



fluids: a nudibranch mollusc from hydrothermal 
vents. Deep-sea Research II. 45: 319-327. 

VALDÉS, A. & T M. GOSLINER, 1999, Phylogeny 
of the radula-less dorids (Mollusca, Nudi- 
branchia), with the description of a new genus 
and a new family. Zoológica Scripta. 28: 
125-171. 

VALDÉS, A. & T M. GOSLINER, in press, System- 
atics and phylogeny of the caryophyllidia-bearing 
dorids (Mollusca, Nudibranchia), with descrip- 
tions of a new genus and four new species from 
Indo-Pacific deep waters. Zoological Journal of 
the Linnean Society. 

VALDÉS, A. & J. ORTEA, 1996, Review of the fam- 
ily Phyllidiidae in the Atlantic Ocean (Nudi- 
branchia, Doridoidea). American Malacological 
Bulletin, 13: 1-9. 

wAGELE, H., 1989, A revision of the Antarctic 
species of Bathydoris Bergh, 1884 and compari- 
son with other known bathydorids (Opistho- 
branchia, Nudibranchia). Journal of Molluscan 
Studies, 55: 343-364. 

WÄGELE, Н., 1990, Revision of the genus Aus- 
trodoris Odhner, 1926 (Gastropoda, Opistho- 
branchia). Journal of Molluscan Studies, 56: 
163-180. 

WÄGELE, H., 1993, New results on the systemat- 
ics of Nudibranchia (Opisthobranchia, Gas- 
tropoda) from the southern Polar Seas. Bollettino 
Malacologico. 29: 181-190. 

WILLAN, R. С & N. COLEMAN, 1984, Nudibranchs 
of Australasia. Sydney: Australasia Marine Pho- 
tographic Index. 56 pp. 

Revised ms. accepted 2 January 2001 



MALACOLOGIA, 2001, 43(1-2): 313-325 

REPRODUCTION, DWARF MALES, SPERM DIMORPHISM, AND LIFE CYCLE IN 

THE COMMENSAL BIVALVE PEREGRINAMOR OHSHIMAI SHÔJI 

(HETERODONTA: GALEOMMATOIDEA: MONTACUTIDAE) 

Jörgen Lützen\ Hiroshi Sakamoto^, Ayako Taguchi^ & Tohru TakahashP 

ABSTRACT 

The commensal brooding bivalve Peregrinamor ohshimai Shó\[ is dioecious. The female is up 
to 20 mm long and attached by a byssus to the sternum between the pereiopods of species of 
the burrowing mud shrimp Upogebia. Only one female is found per mud shrimp. Initial attach- 
ment of the female bivalves occurs in April and May on small mud shrimps that have settled in 
mid or late winter. When the host moults, the female bivalve moves to the new exoskeleton, 
which allows it to grow proportionally together with the host. Shells of one year-old female bi- 
valves are 11.9-12.9 mm long, but few individuals attain an age of 1.5 years, corresponding to 
a length of 14.0-16.8 mm. By depriving the mud shrimp of part of its food, the female bivalve re- 
tards the growth of its host. Females > 3.2 mm are normally accompanied by several ЗбО-цт- 
long dwarf males attached to the bases of the host's pereiopods. The number of males per fe- 
male increases during summer and autumn, but drops in December, and males are almost 
entirely absent during winter. Males are never transferred together with the female when the host 
moults, but left to perish on the old exoskeleton. Two types of sperm cells are produced. The typ- 
ical sperm (euspermatozoa) are stored in paired pouch-like seminal receptacles, which were 
previously mistaken for the species' testes. The breeding period of females < 3/4-years old is 
from July through November. When breeding starts for the second time in spring, the ova be- 
come fertilized by sperm that have survived the winter in the receptacles. Peregrinamor ohshi- 
mai produces females only in spring, while males are turned out throughout spring, summer and 
autumn. Atypical sperm (paraspermatozoa) reside in the suprabranchial cavity outside the re- 
ceptacle. Their role in reproduction is uncertain. 

Key words: Peregrinamor ohshimai, reproduction, dwarf males, sperm dimorphism, seminal 
receptacle. 



INTRODUCTION 

A remarkable commensal bivalve, Peregri- 
namor ohshimai Shôji, has been recorded 
from a number of Japanese localities. It is a 
frequent associate of the burrowing tha- 
lassinidian mud shrimp Upogebia major (De 
Haan), more occasionally of U. narutensis 
(Sakai), U. yokoyai Markov, or U. issaeffi 
(Baiss) (Miyazaki, 1936; Shôji, 1938, 1939; 
Sakai, 1968; Kimura& Yamamoto, 1990; Kato 
& Itani, 1995; Sakai et al., 1995; Itani & Kato, 
1996). A second species, p. gastrochaenans 
Kato & Itani, is a commensal with U. carini- 
cauda (Stimpson) (Kato & Itani, 2001). The 
shell of p. ohshimai is mytiliform and may 
reach a length of 20 mm and a width of > 12 
mm. The bivalve, always solitary, is attached 
to the longitudinal groove between the bases 



of the 1.-5. pereiopods of its host by means of 
a fan-shaped byssus. It occupies a constant 
and never changing position so that its me- 
dian plane is parallel with that of its host and 
its ventral side opposed to the host. The ante- 
rior part of the bivalve is always directed for- 
ward with respect to the host (Figs. 1 , 2). 

The systematic position of Peregrinamor 
has not been settled. Habe (1977) relegated 
the genus to the family Drelssenidae, but Kato 
& Itani (1 995) argued that It is most closely re- 
lated to the Montacutldae within the super- 
family Galeommatoldea. They considered its 
mytiliform shell, otherwise atypical for this fam- 
ily, as an adaptation to its unique posture. Sim- 
ilarly to other galeommatoldean bivalves, P. 
ohshimai spawns Its eggs Into the supra- 
branchial chamber, where they are brooded 
until they become liberated as vellgers. 



^Zoomorphology Departrnent, Zoological Institute, Universitetsparken 15, DK-2100 Copenhagen O, Denmark; jiutzen @ 

zl.ku.dk. 

Faculty of Education, Kumamoto University, 2-40-1, Kurokami, Kumarnoto 860-8555, Japan 
Faculty of Environmental and Symbiotic Sciences, Prefectural University of Kumamoto, 3-1-100, Tsukide, Kumamoto 862- 

8502, Japan 



313 



314 



LUTZEN ETAL. 




5 mm 



FIG. 1. Female Peregrinamor ohshimai (a) attached between the pereiopods of its host, Upogebia major, 
which is also parasitized by the rhizocephalan Sacculina upogebiae (b). Drawn by Beth Beyerholm. 



Based on section series or dissections, 
Shôji (1938) and Kato & Itani (1995) con- 
cluded that P. ohshimai \s a hermaphrodite. If 
true, this would imply that this commensal, 
since it always occurs singly, should repro- 
duce by obligatory auto-fertilization, or that 
sufficient sperm broadcast from one bivalve 
into the host burrow should find its way into a 
specimen associated with a host in another 
burrow. Both alternatives seem improbable. 
Two paired organs claimed to be the testes are 
situated far back in the body. However, unlike 
the testes of hermaphroditic galeomma- 
toideans, which always constitute an inte- 
grated part of an ovotestis, these organs are 
completely separated from the ovaries in P. 
ohshimai. We therefore decided to investigate 
the sexual status of P. ohshimai. resulting in 
the discovery that the large commensal bi- 
valve is a female, and that it usually lives in as- 
sociation with a number of hitherto overlooked 
dwarf males. In addition to dealing with the re- 
productive anatomy and sperm ultrastructure 
of Peregrinamor, we describe the relations be- 
tween the life cycles of host and commensal. 



MATERIAL AND METHODS 

The shrimps were dug up at low tide on the 
extensive mud flats at Kitashinchi, N. of Yat- 
sushiro, Kumamoto Prefecture, Kyushu. Reg- 
ular monthly or bimonthly samples of Upoge- 
bia major were taken from mid-April through 
mid-December 1998. Supplementary collect- 
ing at the same site were performed 1 7 March 



1 999 and 24 January 2000. Taking advantage 
of the fact that U. major is a popular bait in 
Japan during spring, many specimens har- 
bouring Peregrinamor (also originating from 
the Kitashinchi mud flats) were purchased live 
from angler's stores 4-23 May 1999. In addi- 
tion, eight large alcohol-preserved, undated 
U. major from Matsushima hosting P. ohshi- 
mai \j\jere kindly placed at our disposal by Dr. 
Takao Yamaguchi, Aitsu Marine Biological 
Laboratory, University of Kumamoto. A few of 
the mud shrimps with bivalves were para- 
sitized by the rhizocephalan Sacculina up- 
ogebiae (Shüno) (Fig. 1). 

Most of the samples were preserved in 70% 
ethanol, but for histological and cytological 
purposes a representative number of bivalves 
were fixed in Bouin's fluid (sea water formula) 
or Karnovsky's fixative. As far as possible, the 
mud shrimps were sexed, and the carapace 
length (CL) from the tip of the rostrum to the 
end of the carapace determined to the near- 
est 0.1 mm in a petri dish on graded paper or 
using a calibrated eye-piece. The presence or 
absence of Peregrinamor females and the 
number of dwarf males was noted and the an- 
teroposterior female shell length (SL) mea- 
sured to the nearest 0.1 mm. Eggs spawned 
into the female bivalve's suprabranchial cavity 
could often be seen through the semitrans- 
parent shell. If this was not possible, the fe- 
males were dissected or serially sectioned. A 
total of 69 8-|.im thick, hematoxylin-eosin- 
stained series of paraplast sections were 
made of ovigerous or non-ovigerous bivalves 
of sizes between 3.6 and 12.9 mm SL pre- 



REPRODUCTION IN A COMMENSAL BIVALVE 



315 




FIG. 2. Female Peregrinamor ohshimaiin situ on its 
host, Upogebia major, fb, filtering basl<et of host. 
Scale bar; 10 nnm. 



served in Bouln's fluid or 70% ethanol. Part of 
a few females plus several nnales were em- 
bedded in araldite and cut into 2-jam thick se- 
rial sections that were stained with toluidine 
blue. For ТЕМ, several females and dwarf 
males were fixed in Karnovsky's fixative, post- 
fixed in a 2% osmium tetraoxide in 0.1 M ca- 
codylate buffer, and cut into ultrathin sections 
that were examined with a Jeol JEM-100X 
electron microscope. 

To study the effect of moult in Upogebia 
upon females and dwarf males of Peregh- 
nanor, individual mud shrimps with bivalves 
from May 1 999 were placed in 200 ml beakers 



with running sea water and inspected twice 
daily throughout 14 days. Veligers released 
from several female Peregrinamor were cul- 
tured at room temperature for four weeks (7 
May-4 June 1999). The larvae were kept in 
aerated bowls in unfiltered sea water that was 
changed daily. They were fed a mixture of two 
species of cultured algae {Tetraselmis 
tetrathele and Chaetoceros gracilis). The 
veligers and a few males were studied live 
and their movements video-recorded. 



RESULTS 
Population Age Structure and Growth 

Upogebia major: Size-frequency distribu- 
tion of the mud shrimps revealed the year- 
round presence of three cohorts. The cohort 
consisting of smaller specimens was always 
distinctly separated from the other two, which 
in most samples were also discrete (Fig. 3). 
During the studied period, the females of the 
two larger size-classes carried eggs from No- 
vember through December. No ovigerous fe- 
males occurred from mid April through Octo- 
ber. The settlement of the smallest size class 
in 1998 therefore occurred sometime during 
mid or late winter 1 998, a period that is poorly 
represented in the samples. In April, the new 
cohort had grown to a size of 4-6-mm CL and 
by the end of December had reached 10-20 
mm CL, with an average of 1 6 mm CL. In April 
the > 1 -year old shrimps were 21 -mm CL, and 
the > 2-years old ones 25-32-mm CL. The 
size frequency distribution of males and fe- 
males generally corresponded. 

Female Peregrinamor olisiilmai: Through- 
out the life of the bivalve, its SL is linearly re- 
lated to the size (CL) of the host (Fig. 4). The 
smallest bivalves appeared on 1 5 and 27 April 
on 3.6-4.5-mm CL hosts, but were not mea- 
sured. Four 950-2, ЗОО-цт SL bivalves from 
12 May occurred on 3.5-6.5-mm CL U. major 
(Fig. 5). During summer and autumn, the bi- 
valves grew regularly together with the hosts 
and had reached an average size of 9.1 -mm 
SLby December. When approximately 1-year 
old next spring (April and May), they were 
11.9-12.9-mm SL. Larger bivalves were 
poorly represented in the samples. Among 
mud shrimps of the O-group, 9.56% hosted 
the bivalve, a figure that had decreased to 
one-fifth, or 1.88%, among animals of the 1- 
group. According to information from people 
used to collecting preferentially large Upoge- 



316 



LUTZEN ETAL. 



S 30 

ß 

J 25 
О 

fe 20 
"о" 

S 15- 




I I I I I I I I I 

APR MAY JUNE JULY AUG SEP OCT NOV DEC 



FIG. 3. Growth curves for Upogebia major calcu- 
lated from average CL of bimonthly samples April 
through December 1998. Kitashinchi, Amakusa Is- 
land. 



2U^ 








сРИ5 


15- 










10- 




M 


0^ 

h 




5- 


^^J 


f 








1 




1 1 





О 5 10 15 20 25 30 

Upogebia major CL (mm) 

FIG. 4. Relationship between sizes of Peregrinamor 
ohshimai and Upogebia major. April through De- 
cember 1998 and May 1999. The line is repre- 
sented as SL = -0.954 + 0.680CL, r2 = 0.824 (P < 
0.0001). Kitashinchi, Amakusa Island. 



bia for bait or food, large bivalves are very 
rare. Fifteen 14.2-15.6 mm large bivalves 
from September through November were 
probably approximately 1.5-years old. Judg- 
ing from the size of the host (29.2-mm CL) 
and their own length (17.0 and 18.3-mm SL), 
two specimens of Peregrinamor Uom July and 
August must have been more than 2 years 
old. Eight more large undated shells (16.6- 
20.0-m SL) associated with very large hosts 
(28.0-34.7-mm CL) were probably the same 
age. 

Male and female mud shrimps were associ- 
ated with the commensal bivalves to the same 
degree (7.8%, respectively 7.7%). For each of 
the months April through December, the aver- 
age CL of Upogebia of the 0-group hosting P. 



ohshimaiwas constantly 1 -2 mm shorter than 
that of the total material of hosts (Fig. 6). 

The Males 

When the female bivalves were cautiously 
lifted from their contact with the host or re- 
moved entirely, a number of tiny male bivalves 
were usually seen to be attached by byssus 
threads to the basis and coxa of the host's 
pereiopods or to the narrow sternal groove in 
between. For attachment, the fourth and fifth 
pereiopods facing the postehor part of the fe- 
male's mantle slit were preferred to the three 
foremost pairs. Occasionally, a few males 
were located on the female's shell margin or 
on its byssus. 

The shape and size of the shell of the dwarf 
males vary within narrow limits (Figs. 14, 15). 
It is regularly oval in shape, very slightly in- 
equilateral, semitransparent, approximately 
360 (.im long and 305 ¡.im high and laterally 
compressed. The hinge has two subsymmet- 
hcal lateral teeth. 

The foot is relatively large and partially cili- 
ated. The pedal glands are prominent (Figs. 
7, 8). Conspicuous antehor and posterior 
byssus retractor muscles are associated with 
the byssus gland. If live males are removed 
from the shrimp, they move around quickly. 
They do this by extending the foot to more 
than the shell length, stick its tip to the sub- 
stratum, then drag the body along. Males 
were occasionally seen to detach voluntarily 
and move from place to place on and between 
the limb bases. The gills are represented by 
inner demibranchs. A short, ciliated oesopha- 
gus terminates within a mass of undifferenti- 
ated yolk-rich endodermal cells. No other 
parts of the alimentary tract were demonstra- 
ble. All major ganglia are present, and a pair 
of statocysts lie adjacent to the large pedal 
ganglia. A prominent testis occupies the entire 
visceral mass and has paired openings pos- 
teriorly in the mantle cavity. 

Even if of constant SL, the males vary con- 
siderably in the development of the testes and 
some other organs. The specimen illustrated 
in Figure 7 represents an immature stage with 
a large 150 x 200 |.im testes demonstrating 
the early stages of spermiogenesis. The mass 
of yolk-rich cells is very extensive and the ad- 
ductor muscles are well developed. Figure 8 
shows the terminal stage in the life of the 
males. The testis has shrunk to a fraction of its 
original volume and is now filled with mature 



REPRODUCTION IN A COMMENSAL BIVALVE 



317 




1 1 1 1 1 1 1 1 1 — — I Г 

JAN FEB MAR APR MAY JUNE JULY AUG SEP OCT NOV DEC 



FIG. 5. Peregrinamor ohshimai. Frequency of males throughout the year and growth and reproduction of fe- 
males. Figures along the growth curve (c) indicate sample sizes (female p. ohshimai). All data from Kitash- 
inchi, Amakusa Island, except for those marked by an asterisk from Kato & Itani (1995) and Miyazaki (1936). 




without Peregrinamor ohshimai 
with Peregrinamor ohshimai 



APR MAY JUNE JULY AUG SEP OCT NOV DEC 

FIG. 6. Average size of Upogebia major with (n = 
283) and without Peregrinamor ohshimai (n = 
3,071), April through December 1998 (0-group). Ki- 
tashinchi, Amakusa Island. 

spermatozoans. The posteriorly directed, 
short spermiduct becomes clearly visible in 
live specimens. Characteristically at this 
stage, both adductor muscles have de- 
creased in volume, and the mass of endoder- 
mal cells has degenerated into a very small 
body. These two types, including any interme- 



diary stages, may occur on the same mud 
shrimp hosting a female bivalve. The number 
of males estimated to be sexually mature was 
small, however, and in ten mud shrimps ex- 
amined hardly exceeded 10%. 

Up to 53 males were recorded with a single 
female bivalve, but their number was usually 
much smaller (Fig. 9). The frequency of males 
was expressed in two ways: (1) as the per- 
centage of female bivalves associated with 
males, and (2) as the average number of 
males per female (Fig. 5). Apart from a very 
few males recorded in late June, they first be- 
came associated with the 0-group of females 
in late July. The smallest female co-occurring 
with males was 3.2 mm. Males became in- 
creasingly abundant in August when they oc- 
curred together with most of the females, al- 
though the number per female was still 
moderate. Their frequency peaked during au- 
tumn, when a high number (15-20) of males 
had associated with almost every female bi- 
valve. The samples from December showed a 
distinct drop in their number. Only one male 



318 



LUTZENETAL. 




100 mm 



FIGS. 7-8. Peregrinamor ohshimai. Anatomy of an immature (7) and sexually mature (8) dwarf male, left 
side view, aa, anterior adductor: ab, anterior byssal retractor; b, byssus; bg byssus gland; eg, cerebral gan- 
glion; f, foot; h, heart; id, inner demibranch; k, kidney; I, ligament; mm, mantle margin; oe, oesophagus; pa, 
posterior adductor; pb, posterior byssal retractor; pg, pedal ganglion; sm, shell margin; st, statocyst; t, testes; 
ud, undifferentiated tissue; vg visceral ganglion. Drawn by Beth Beyerholm. 




2 mm 



FIG. 9. A female Peregrinamor ohshimai (left side 
view) with its six dwarf males, is, extended inhalent 
siphon. Drawn by Beth Beyerholm. 

was found together with seven fennales of the 
1 -group from January through April. The 
males reappeared in early May, where on an 
average 9.7 males were associated with all of 
23 females. 

In general males were few or absent on 
large Upogebia associated with large female 
bivalves. Thus, males were only recorded to- 
gether with two among eight 16.6-20.2 mm 
long female P. ohshimai. The collecting date 
of these specimens were not known. 

The Females 

Whether small, medium-sized or large, the 
female's shell is always attached singly with its 
ventral shell margin facing the host's sternal 
groove and in such a way that its anterior shell 



margin is level with the basis of the first pair of 
pereiopods (chelipeds. Fig. 2). This is also true 
with the smallest shells (950-2,300 цт SL) 
that were placed far antehorly on the ventral 
part of the thorax between the first pair, or the 
first and second pairs of pereiopods. 

The shell of the smallest female (SL 950 
pm) is inequilateral, rounded, shortened be- 
hind, and with a distinct approximately 350- 
pm-long prodissoconch (Fig. 10). There are 
two subumbonal laterals. The surface is pol- 
ished and marked by week growth lines. In a 
1,500 |.im long specimen (Figs. 11, 12), the 
shell has started to become laterally inflated, 
the posterior part has elongated to exceed the 
front part in length, and the ventral margin has 
become almost straight. In older shells, 
growth chiefly takes place in the posterior part 
of the shell, which in a 2,300-цт-1опд speci- 
men (Fig. 13) had grown to double the length 
of the front part. When 3-4 mm long, the bi- 
valves had acquired the mytiliform shape, typ- 
ical of the species. 

A distinct ovary occupies a major portion of 
the anterior mantle and a small part of the 
foot, exactly as described by Shôji (1938) and 
Kato & Itani (1995). At each side, the ovary is 
divided into a large lateral portion and a much 
smaller elongate dorsal posteriorly directed 
portion. The two parts fuse just behind the 
middle of the body in a short and narrow lobe, 
which terminates medially at the wall of the 
suprabranchial cavity. In the absence of dis- 
tinct oviducts, this is presumably where a tem- 



REPRODUCTION IN A COMMENSAL BIVALVE 



319 




400 urn 





FIGS. 10-15. Peregrinamor ohshimai. FIG. 10, left shell of 950 цт long female. FIGS. 11, 12, left sfiell and 
hinge of right shell of 1,500 цт long female. FIG. 13, left shell of 2,300 |.im long female. FIG. 14, inside of 
right shell of male. FIG. 15, live specimen of male in left view, p, prodissoconch; t, testes; ud, undifferentiated 
tissue. Drawn by Beth Beyerholm. 



porary opening appears when the eggs are 
spawned into the incubatory cavity. Histologi- 
cally, the ovary consists of many branching 
tubular lobules. Besides a stock of oogenia 
along the wall of the lobule, the ovary contains 
two more or less distinct size classes of 
oocytes, which undergo vitellogenesis simul- 
taneously. When ripe, paraplast-embedded 
sectioned oocytes have a d'ameter of 85-90 
|im, corresponding to 100-105 |am measured 
in newly spawned live eggs. In females pre- 
served immediately before emission of the 
larvae, the next, and larger, generation of 
ovarial oocytes have almost attained their 
maximum size, and the even smaller genera- 
tion of oocytes vary between 25 and 45 |лт in 
diameter. Since at the peak of the reproduc- 
tive season (August-October) only three out 
of four sexually mature bivalves were oviger- 
ous (Fig. 5), there must be an interval sepa- 
rating the emission of the larvae and the next 
spawning, in which the larger oocytes grow to 
their final size. 

The lay-out of the reproductive organs was 
studied in many specimens from 3.5 to 12.9 
mm. Irrespective of the size of the specimens, 
a testis, whether part or not of the ovary, was 
absent. It is obvious, however, that the small, 
paired organs believed to be the testes by 
previous authors, are receptacles for the stor- 
age of sperm (Figs. 1 6, 1 7). Lying superficially 



far posteriorly within the mantle, they were 
visible as two usually whitish curved bodies 
through the thin, transparent shell. Each 
formed an oblong sinuous sac that is located 
close to the respective visceral ganglion. It 
had a narrow ciliated opening into the 
suprabranchial chamber (incubatory cham- 
ber) far posterior to the oviducts. The opening 
was placed within the margin of a small, 
raised area of the suprabranchial chamber 
wall lined with a tall, cylindrical, ciliated ep- 
ithelium (Fig. 16). The wall of the seminal 
receptacle also consisted of a cylindrical, cili- 
ated epithelium bearing numerous 2-3-|im- 
long slender microvilli (Fig. 20). The seminal 
receptacles were typically filled with fully de- 
veloped flagellated euspermatozoa orien- 
tated with part of their long, thin heads em- 
bedded in the surface of the cells of the lining 
epithelium (Figs. 20, 21). In all sizes exam- 
ined, there were absolutely no signs of sper- 
matogenesis. In addition, masses of sperm of 
another type, paraspermatozoa, with a much 
shorter head were usually present in the su- 
prabranchial cavity close to, but outside the 
seminal receptacles. We conclude that the 
large specimens of P. ohshimai are females 
and that at oviposition into the incubatory 
chamber the ova become fertilized by sperm 
cells discharged from the receptacles. 
While sperm were normally present in the 



320 



LUTZENETAL. 




-sr 



?%' ^r 





e re 









'^ J\ Ч 



% V\ 






"Ч 



0.x 






ер 



FIGS. 16-21. Peregrínamor ohshimai. Histological sections through the seminal receptacles filled with eu- 
sperrnatozoa (16 and 17); heads of paraspermatozoa (18) and euspermatozoa (19); Figs 20, 21, electron- 
rnicrograph showing aligned euspermatozoa embedded in the epithelial cells of the receptacle. 2 pm thin 
sections of araldite embedded matenal stained with toluidine blue (16) and 8 |am thick paraplast sections 
stained with H + E (17-19). a, acrosome of euspermatozoon; cr, ciliary root; d, duct of seminal receptacle 
which opens into the suprabranchial cavity (su) near arrow; e, embryo; ep, ciliated epithelial cell of recepta- 
cle with microvilli (m); n, nucleus of euspermatozoon; o, ovary; om outer mantle epithelium; p, parasperma- 
tozoa, re, raised ciliated area for reception of paraspermatozoa; sr, seminal receptacle. Scales represent 50 
Jim (16), 100 \xm (17), 10 цт (18 and 19), 2 um (20), and 1 цт (21). 



REPRODUCTION IN A COMMENSAL BIVALVE 



321 



receptacles of females that had passed 3.6 
mm SL, the oocytes did not become mature 
until at a SL of 5.5-6.0 mm. With the excep- 
tion of two 5.5-mm large ovigerous speci- 
mens, female P. ohshimai usually did not 
spawn until having attained a SL of 6.0 mm. 
Between a SL of 6.0 mm and 6.9 mm oviger- 
ous and non-ovigerous females were equally 
numerous, but when > 7.0 mm, there were ap- 
proximately three times as many ovigerous as 
non-ovigerous specimens. The reproductive 
activity, expressed as the percentage of 
ovigerous females, excluding specimens < 
6.0 mm, started in the latter half of July with a 
maximum in August, September and October. 
Reproduction declined again in November 
and had come to a complete stop in early De- 
cember, when none of the 36 females col- 
lected were ovigerous. Many females of the 1 - 
group had spawned in early May, but the 
percentage was not recorded. 

Through the semitransparent female shell, 
it could be observed that during incubation in 
the suprabranchial cavity, ova and embryos 
were rotating vigorously, probably moved by 
the action of the ciliated gill epithelium. Some 
of the ovigerous females that were kept alive 
in the laboratory liberated straight-hinged lar- 
vae 7 May. The shells of freshly released lar- 
vae measured 205 цт in length and 152 цт 
in height. One week-old larva had grown to 
250 |im and 200 цт in height and length, but 
did not increase further in size. At that stage 
the larvae mostly rested on the bottom and 
only now and then lifted from the substratum. 
They were still alive, but immobile, when at an 
age of 25 days the incubation was discontin- 
ued. 

The Sperm 

Peregrinamor ohshimai produces two types 
of flagellated sperm, euspermatozoa and 
paraspermatozoa (terminology of Healy & 
Jamieson (1981)). These types correspond 
broadly to the categories "typical" or "eu- 
pyrene" spermatozoa (= euspermatozoa) and 
"atypical" or "oligopyrene" spermatozoa (= 
paraspermatozoa) often used in older litera- 
ture. The euspermatozoon has a slender, al- 
most straight 9.5-10.0-|im-long head, 
whereas the head of the paraspermatozoon is 
shorter, 4.5 цт long, but broader and slightly 
conical (Figs. 18, 19). Both types were found 
in squash preparations of live males. Within 
the female's receptacles, only euspermato- 
zoa were found (Figs. 16, 17). The parasper- 



matozoa were either attached with their 
heads to the raised, ciliated epithelium of the 
suprabranchial cavity near the receptacle's 
orifice (Fig. 1 7), or occurred as masses of free 
cells in the adjacent part of the suprabranchial 
cavity, perhaps because they had been de- 
tached as a response to fixation. When unat- 
tached, the paraspermatozoa were often 
mixed with smaller amounts of euspermato- 
zoa. Spermatids of paraspermatozoa often 
occurred together with mature sperm. 

Euspermatozoa were present in all of 69 
sectioned females from 3.6 to 12.9 mm SL, 
except for a single 3.8-mm-long specimen. In 
two specimens (3.6 and 4.4 mm SL), they oc- 
curred in only one of the two receptacles. 
They were abundantly present in all females 
from winter (December through April). 
Paraspermatozoa were absent in most (N = 
13) of the smaller bivalves < 5.9 mm SL (N = 
16) and in all but one of seven females from 
January, March and April. In many sectioned 
bivalves with SLfrom 6.0 to 11 .4 mm collected 
from July through December various quanti- 
ties of paraspermatozoa occurred in approxi- 
mately 75% of the specimens. 

Behaviour of Females and Males at Moulting 
of the Host 

Kato & Itani (1995) demonstrated that dur- 
ing the moulting process of its host, Peregri- 
namor is able to detach itself from the old ex- 
oskeleton and move to the new exoskeleton 
and reattach in the proper location. We con- 
firmed this behaviour in several cases. To 
study the fate of the dwarf males, which were 
unknown to Kato & Itani, we compared their 
number on the old and new exoskeletons of 
seven isolated recently moulted hosts. Of a 
total of 44 dwarf males, only one accompa- 
nied the female to the new exoskeleton, and 
this was probably because it had originally at- 
tached to the female's byssus. In three other 
cases, where the presence of males before 
moulting, but not their number, were noted, 
again none of them were transferred to the 
new exuvia. Simulating a moult, in six other 
mud shrimps the female bivalves (SL 
11.6-12.1 mm) were removed by cutting the 
byssus, and the associated males were in- 
spected immediately following the operation 
and 12 hours later. Their reaction to the fe- 
male's removal was slight, as 38 of a total of 
45 males present remained in their original 
position, three had moved to beyond the 
coxae of the pereiopods and maxillipeds, and 



322 



LUTZEN ETAL. 



only four had left the host. In addition, we oc- 
casionally noted that mud shrimps with bi- 
valves and with an unusually clean exoskele- 
ton, consistent with a recent moult, were 
always devoid of any dwarf males. 



DISCUSSION 

Upogebia mayor lives in a U-shaped burrow 
excavated in the mud flats. Its four pairs of ab- 
dominal swimmerets generate a steady cur- 
rent of water through the burrow. The water 
current is being filtered by a fine-meshed bas- 
ket composed by numerous long close-set 
setae of its maxillipeds and first two pairs of 
pereiopods and maxillipeds (MacGinitie, 
1930; Mukai & Koike, 1984). Kato & Itani 
(1995) studied the feeding of the female P. 
ohshimal. When the shells gape, the right and 
left anterior mantle edges are extended to 
form an inhalent siphon that penetrates into 
the host's filtering basket (Fig. 9). The species 
is thus a true commensal, which feeds upon 
suspended matter retained in the host's bas- 
ket. The constantly smaller average CL of Up- 
ogebia hosting P. ohshimai (Fig. 6) seems to 
show that the bivalve removes a substantial 
part of the host's food. To reach into the filter- 
ing basket and not at the same time obstruct 
the movements of the pereiopods, or become 
damaged or even crushed by them, the exact 
position along the host's midline cannot be 
compromised (Fig. 2). This is probably why 
two or more bivalves were never seen to co- 
inhabit the same host individual in the several 
hundreds of instances of this association 
recorded in the literature or seen by us. 

Many galeommatoidean bivalves are 
protandric hermaphrodites and in most of the 
cases where dwarf males have been re- 
ported, they are merely considered as an 
initial stage in such a life cycle and capable 
later of transforming into a functional female 
(Ó Foighil, 1985a). All evidence suggests that 
P. ohshimal is strictly gonochoristic. The 
males that have attained sexual maturity are 
completely exhausted and evidently have no 
potential to develop further. Also no traces of 
any testes were ever found in the smallest fe- 
males examined histologically. Gonochorism 
in P. ohshimal is probably a secondary adap- 
tation to the species' extremely sedentan/ and 
solitary habits. The males are so small that, 
even when plentiful, they do not interfere with 
the female's position. Neither do they com- 
pete for food, since, living in a water current 



that has been filtered by the host's food bas- 
ket and having no functional alimentary tract, 
they must depend wholly on the energy re- 
sources accumulated in their own tissues. It 
must be assumed that the males are fairly 
short-lived, but that dead or lost individuals 
are being replaced by a supply of new ar- 
rivals. Morphologically the dwarf males of P. 
ohshimai show a striking resemblance to the 
dwarf males (complemental males) of Monta- 
cuta phascollonis (Dautzenberg & Fischer) 
discovered by Deroux (1961a). 

The female's particular feeding posture 
also means that small specimens, as was al- 
ways the case, have to be placed with their 
anterior shell gape close to the base of the fil- 
tering basket to allow the short inhalent 
siphon to reach into it. The reason for the ob- 
served linear correlation between sizes of the 
female bivalve and the host (Fig. 4), also ob- 
served by Kato & Itani (1995), suggests that 
efficient food uptake by the bivalve requires a 
fairly constant size-relation between the in- 
halent siphon and the food basket. 

The clear separation of the size-classes of 
the host allows a fairly accurate determination 
of its age from the size. Because P. ohshimai 
only settles upon small hosts and grow pro- 
portionately together with them, there is also 
no overlap between the size-classes of the 
commensal (Fig. 5). Relatively many more 
Upogebia of the 0-group were hosting Pere- 
ghnamor {hau those of the 1- and 2-groups. 
Kato & Itani (1995) found 29.2% of Upogebia 
of the 0-group from September to harbour the 
bivalve, compared to 18.4% among speci- 
mens of the 1 -group in April. Combined with 
the small number of records of large bivalves, 
this seems to show that the number of the 
commensals is greatly reduced before or 
while entering its second year, which is well in 
advance of the time when the host becomes 
sexually mature (November-December). This 
is a short life span compared to other com- 
mensal bivalves, which may attain a maxi- 
mum age of from four to seven years (Franz, 
1973; Ockelmann & Muus, 1978). 

There are at least two separate reproduc- 
tive periods during the life of P. ohshimai. 
Specimens of the 0-group commence spawn- 
ing in July, when they pass the critical 6.0 mm 
SL, but the almost constant presence of eu- 
spermatozoa in the receptacles in specimens 
> 3.6 mm SL is evidence that insemination oc- 
curs much earlier. Breeding continues 
through November but comes to a complete 
stop in December (Fig. 5). Of 41 females from 



REPRODUCTION IN A COMMENSAL BIVALVE 



323 



December through March, only one specimen 
(from January) was ovigerous, but all sec- 
tioned ones had very large oocytes in the 
ovary and the receptacles full of sperm. Fe- 
males of the 1 -group started to reproduce 
again in April, when all of nine 8.5-16.7 mm 
SL specimens were "producing eggs and 
brooding developing eggs and veligers" (Kato 
& Itani, 1995). The appearance of rather 
newly settled female Peregrinamor in April 
and May, and their absence in June, is also 
consistent with this conclusion. Many of the 1 - 
year old bivalves were ovigerous in early May, 
and so were three of four specimens from 
early June (Miyazaki, 1936) but there is no 
more information from the summer months. 

The freshly released larvae (205 x 152 цт) 
are slightly smaller than reported by Miyazaki 
(1936, as Erycina sp.), namely 220 x 170 цт. 
Miyazaki succeeded in incubating the larvae 
to the pediveliger stage, in which the shell 
measured 351 x 298 цт. This corresponds to 
the size of the prodissoconch of the female 
shell as well as to the shell size of the dwarf 
males (360 x 305 цт). Apparently, larvae de- 
veloping into both males and females settle 
upon the mud shrimps immediately after they 
have completed the planktonic phase. 

While there is a good correlation between 
the presence and abundance of dwarf males 
and the reproduction in the females of the 0- 
group, some males are still present, although 
at a reduced number, when reproduction 
comes to a stop in early winter (Fig. 5). The 
reproductive role of these males is probably 
largely played out and they cannot be com- 
pensated for as the production of larvae has 
ceased. In keeping with this, only a single 
male was found associated with the seven fe- 
males from January, March, and April. When 
spawning is resumed in spring, fertilization of 
the ova evidently depends upon the sperm 
that has been stored for three to four winter 
months within the receptacles. From the lar- 
vae produced by the 1 -group in the spring are 
recruited (1) the next 0-group of females, (2) 
males that become associated with the 0- 
group in June-July, and (3) the first males of 
the 1-year old female bivalves, noted first in 
early May. As no settling of female bivalves 
could be demonstrated during the breeding 
period of the 0-group, it follows that its sole 
contribution to the population is to produce 
males. This is apparently also the role of 
those females of the 1 -group that survive long 
enough to spawn during summer and autumn. 
In conclusion, P. ohshimai produces females 



only in spring, while males are turned out 
throughout spring, summer and autumn. 

The very high number of males compared 
to females partly compensates for their small 
size and individually limited sperm production. 
Upogebia major undergoes a number of 
moults throughout summer and autumn, and 
at each moult any males present are lost. 
Since males nevertheless increase in number 
during this period, lost males not only become 
replaced, but additional males are being 
added. The number of moults in U. major is 
not known, but in the smaller Mediterranean 
U. pusilla (Petagna) there are 7-9 moults per 
year (Dworschak, 1988). Assuming the num- 
ber of moults in U. major to be of the same 
order and the observed annual average of 
males per female of P. ohshimai at 10-15 
(Fig. 5), the number of males produced for 
each female is probably several times higher. 

Seminal receptacles in bivalves are known 
only in Xylophaga dorsalis (Turton) (Pho- 
ladoidea: Pholadidae) (Purchon, 1941) and In 
the family Montacutidae. All montacutids are 
brooders that incubate the ova in the 
suprabrancial cavity, with which the recepta- 
cles are associated. Among the Montacutidae 
there are three types of receptacles: In 
species of Jousseaumiella they are claimed to 
arise as pouches from the oviduct (Bourne, 
1906; Knudsen, 1944). Nipponomysella sub- 
truncata (Yokoyama) is peculiar in the pos- 
session of two mushroom-shaped recepta- 
cles, which protrude from the visceral mass 
into the incubatory cavity (Lützen et al., in 
press). In Litigiella glabra (Fischer), M. phas- 
colionis, IVIysella cuneata (Verrill & Bush), and 
Potidoma subtrigonum (Jeffreys), the recep- 
tacles are paired pouches from the floor of the 
suprabranchial cavity (Pelseneer, 1911; Der- 
oux, 1961b; Gage, 1968; Jespersen & Lützen, 
2000). Very similar pouches, so-called acces- 
sory male organs, are found in Mysella biden- 
tata (Montagu) (Deroux, 1 961 b; Ockelmann & 
Muus, 1978). The sperm depositories in P. 
ohshimai obviously belong to the same type. 
Since the species is strictly gonochohstic, it is 
certain that the sperm stored in the receptacle 
and in the adjacent part of the suprabranchial 
cavity are foreign sperm. Similarly to /W. 
bidentata, which have sperm depositahes as 
well as dimorphic sperm, only euspermatozoa 
were found within the receptacles of P ohshi- 
mai. It remains to be settled whether the 
sperm are transferred from the males in 
sperm bags, such as may occur in some other 
montacutids (Deroux, 1961b; Ockelmann & 



324 



LUTZEN ETAL. 



Muus, 1978; 

Ó Foighil, 1985a,b; Lützen et al., in press). 

Stored sperm enable P. ohshimai to repro- 
duce uninterruptedly even when males are 
absent. When the host moults, which proba- 
bly happens several times during the bivalve's 
breeding season, the female bivalve becomes 
dissociated from the accompanying males. 
Some time will elapse until new males settle 
and become sexually productive, but in the in- 
terval the stored sperm allow the female to re- 
produce at its convenience. During the winter 
months, males are totally absent, and re- 
sumption of the reproduction in spring in the 
1 -group is dependent on the euspermatozoa 
that have survived for 3-4 months in the re- 
ceptacles. Paraspermatozoa are obviously 
less viable, as they occurred only sparsely 
during winter. There are no other data to show 
how long sperm of bivalves may remain func- 
tional. But in some prosobranch gastropods, 
sperm may still be capable of fertilization for 
more than one year (Сое, 1942; Chi & Wag- 
ner, 1957). 

Compared to the condition in Proso- 
branchia, sperm dimorphism is rare in bivalves 
and confined to two species of the family Mon- 
tacutidae (Mysella bidentata: Montacuta te- 
nella Lovén) and the Thyasiridae {Axinodon 
symmetros (Jeffreys)) (Ockelmann, 1965). 
The list now includes also P. ohshimai. The 
significance of paraspermatozoa in molluscs 
is enigmatic. Ockelmann & Muus (1978) sug- 
gested that they perform some signal func- 
tion. Because they seem to be absent when 
the females of P. ohshimai resume spawn- 
ing in spring, they probably take no part in 
fertilization. 

Popham (1940) stated that the Montacuti- 
dae are characterized by lack of the outer 
demibranch. A vestige of the outer demi- 
branch is present in Peregrinamor (Shôji, 
1938), but it is also in the montacutid Monta- 
cutona (Morton, 1980). The discovery that 
Peregrinamor has seminal receptacles and 
dimorphic sperm, until now only known from 
species of the Montacutidae, lends support to 
the view of Kato & Itani (1995) that the genus 
is most closely related to this family. 



ACKNOWLEDGEMENTS 

We are very grateful to Dr. Ase Jespersen, 
Department of Zoomorphology, Copenhagen, 
for her assistance in operating the electron 
microscope. We would also like to thank Dr. 



Keiji Baba, Faculty of Education, Kumamoto 
University, and Dr. Takao Yamaguchi, Aitsu 
Marine Biological Station, Kumamoto Univer- 
sity, for providing us with specimens of P. 
ohshimai. 



LITERATURE CITED 

BOURNE, G. C, 1906, On Jousseaummia. a new 
genus of eulamellibranchs commensal with the 
corals l-ieterocyatiius and Heteropsammia. Cey- 
lon Pearl Oyster Fishery Report, 5: 243-266. 

CHI, L. & E. D. WAGNER, 1957, Studies on repro- 
duction and growth of Oncomelania quadras!, O. 
nosophora, and O. formosana, snail hosts of 
Schistosoma japonicum. American Journal of 
Tropical Medicine and Hygiene, 6; 949-960. 

СОЕ, W. R., 1942, The reproductive organs of the 
prosobranch mollusk Crepidula onyx and their 
transformation during the change from male to fe- 
male phase. Journal of l\/lorphology. 70: 
501-512. 

DEROUX, G., 1961a, Formation régulière de males 
mûrs, de taille et d'organisation larvaire chez un 
eulammellibranche commensal {Montacuta 
phascolionis Dautz.). Compte Rendu IHebdo- 
madaire des Séances de l'Académie des Sci- 
ences. Paris, 250: 2264-2266. 

DEROUX, G., 1961b, Rapports taxonomiques d'un 
leptonacé non décrit 'Lepton subtrigonum' Jef- 
freys (nomen nudum— ^873). Cahiers de Biolo- 
gie Marine, 2: 99-153, pi. 1. 

DWORSCHAK, P. C, 1988, The biology of Upoge- 
bla pusilla (Petagna) (Decapoda, Thalassinidea) 
III. Growth and production. Marine Ecology, 9: 
51-77. 

FRANZ, D. R., 1973, The ecology and reproduction 
of a marine bivalve, Mysella planulata (Eryci- 
nacea). Biological Bulletin, Woods Hole, 144: 
93-106. 

GAGE, J. D., 1968, The mode of life of Mysella 
cunéala, a bivalve 'commensal' with Phascolion 
strombi (Sipunculoidea), Canadian Journal of Zo- 
ology 46: 919-934. 

HABE, Т, 1977, Systematics of Mollusca in Japan: 
Bivalvia and Scaphopoda. Tokyo: Hokuryukan. 

HEALY, J. M. & B. G. M. JAMIESON, 1981, An ul- 
trastructural examination of developing and ma- 
ture paraspermatozoa in Pyrazus ebeninus 
(Mollusca, Gastropoda, Potamididae). Zoomor- 
phology, 98: 101-120. 

ITANI, G. & M. KATO, 1996, The life history of Pere- 
grinamor ohshimai. Proceedings of the 10th 
Meeting of Japanese Association of Benthology, 
20B-14: 99. 

JESPERSEN, A. & J. LÜTZEN, 2000, Sex, seminal 
receptacles, and sperm ultrastructure in the com- 
mensal bivalve Montacuta phascolionis (Ven- 
eroida; Galeommatacea). Acta Zoológica, Stock- 
holm, 81: 69-75. 

KATO, M. & G. ITANI, 1 995, Commensalism of a bi- 



REPRODUCTION IN A COMMENSAL BIVALVE 



325 



valve, Peregrinamor ohshimai. with a tha- 
lassinidean burrowing shrimp, Upogebia major. 
Journal of the Marine Biological Association of 
the United Kingdom. 75: 941 -947. 

KATO, M. & G. ITANI, 2000, Peregrinamor gas- 
trochaenans (Bivalvia; Mollusca), a new species 
symbiotic with the thalassinidean shrimp Upoge- 
bia carinicauda (Decapoda: Crustacea). Species 
Diversity. 2000: 309-316. 

KIMURA, S. & T. YAMAMOTO, 1 990, A new locality 
of Peregrinamor ohshimai Shô\\. Chiribotan. 21: 
12-13. (In Japanese). 

KNUDSEN, J., 1944, A gephyrian, a polychate and 
a bivalve (Jousseaumiella concharum nov. sp.) 
living together (commensalistically) in the Indo- 
Malayan Seas. Videnskabelige Meddelelser fra 
Dansk Naturhistorisk Forening. 108: 15-24. 

LÜTZEN, J., T. TAKAHASHI & T. YAMAGUCHI, in 
press. Morphology and reproduction of Nippono- 
mysella subtruncata (Yol<oyama), a galeomma- 
toidean bivalve commensal with the sipunculan 
Siphonosoma cumenense (Keferstein) in Japan. 
Journal of Zoology. London. 

MacGINITIE, G. E., 1930, The natural history of the 
mud shrimp Upogebia pugettensis (Dana). An- 
nals and [Magazine of Natural History, 6: 166- 
177. 

MIYAZAKI, I., 1936, On the development of some 
marine bivalves, with special reference to the 
shelled larvae. II. Journal of the Imperial Fishery 
Institute, 31(2): 35-41, pis. VIII-XII. 

MORTON, В., 1980, Some aspects of the biology 
and functional morphology (including the pres- 
ence of a ligamental lithodesma) of Montacutona 
compacta and M. olivácea (Bivalvia: Leptonacea) 
associated with coelenterates in Hong Kong. 
Journal of Zoology, London, 192: 431-455. 

MUKAI, H. & I. KOIKE, 1984, Behaviour and respi- 
ration of the burrowing shrimps Upogebia major 
(de Haan) and Callianassa japónica (de Haan). 
Journal of Crustacean Biology, 4:191 -200. 

OCKELMANN, K., 1965, Redescription, distribu- 
tion, biology and dimorphous sperm of Montacuta 
tenella Lovén (Mollusca, Leptonacea). Ophelia, 
2:211-221. 



OCKELMANN, K. & K. MUUS, 1978, The biology, 
ecology and behaviour of the bivalve Mysella 
bidentata (Montagu). Ophelia. 17: 1-93. 

Ó FOIGHIL, D., 1985a, Form, function, and origin of 
temporary dwarf males in Pseudopythina rugifera 
(Carpenter, 1864) (Bivalvia: Galeommatacea). 
The Veliger. 27: 245-252. 

Ó FOIGHIL, D., 1 985b, Sperm transfer and storage 
in the brooding bivalve Mysella túmida. Biological 
Bulletin, 169: 125-132. 

PELSENEER, P., 1911, Les lamellibranches de 
l'expédition du Siboga. Partie Anatomique. Si- 
boga-Expeditie. 53A: 1-125. Leiden. 

POPHAM, M. L., 1940, The mantle cavity of some 
Erycinidae, Montacutidae, and Galeommatidae 
with special reference to the ciliary mechanisms. 
Journal of the Mahne Biological Association of 
the United Kingdom, 24: 549-586. 

PURCHON, R. D., 1941, On the biology and rela- 
tionships of the lamellibranch Xylophaga dorsalis 
(Turton). Journal of the Mahne Biological Associ- 
ation of the United Kingdom. 25: 1 -39. 

SAKAI, K., 1968, Three species of the genus Up- 
ogebia (Decapoda, Crustacea) in Japan. Bulletin 
of Seika Women's Junior College, 1 : 45-50. 

SAKAI, K., S. MAEDA & K. HAYASHI, 1995, A re- 
markable commensal bivalve, Peregrinamor 
ohshimai (Gaimardiidae, Pelecypoda) attached 
to two upogebiids, Upogebia major and U. is- 
saeffi (Thalassinidea, Decapoda, Crustacea) 
from Tachibana Inlet, Tokushima. Bulletin of 
Shikoku University (B)4: 45-49. 

SHÔJI, K., 1938, A new commensal bivalve at- 
tached to a burrowing shrimp. Venus, 8: 1 1 9- 1 28 
(In Japanese with English summary). 

SHÔJI, K., 1939, On the curious commensal bi- 
valve {Peregrinamor ohshimai Shôji) which at- 
taches to Upogebia major Japanese Journal of 
Zoology, 51(2): 101 (In Japanese). 

Revised ms. accepted January 3, 2001 



MALACOLOGIA, 2001, 43(1-2): 327-336 

EYEBALLS AND PITFALLS: ESTIMATING THE DEGREE OF HETEROSTROPHY 
IN THE HETEROBRANCH SHELL (GASTROPODA: HETEROBRANCHIA) 

Roberto Cipriani^ ^ & Rüdiger Bieler^ 

ABSTRACT 

Heterostrophic gastropod shells, in which the coiling axes of proto- and teleoconchs diverge, 
pose interesting ontogenetic questions and complex morphological characters for systematic 
analyses. The inclination angle of the protoconch in relation to the axis of coiling of the teleo- 
conch has been used to distinguish between othen/vise similar heterostrophic species. The pre- 
cision of this metric, however, is very sensitive to measurement biases. This paper introduces a 
new technique, the box method, which provides a more precise estimate of the angle of inclina- 
tion of the protoconch. A rectangular box is drawn around an image of the protoconch; the box 
diagonal then is used as an estimator of the angle of inclination. The accuracy of the technique 
is investigated with a simulation model that calculates two-dimensional projections of realistic 
three-dimensional coiling morphologies. The results of the model suggest that the studied met- 
ric is dependent on the morphology of the protoconch and on its degree of immersion in the first 
teleoconch whorl. Caution is in order when basing taxonomic decisions on differences in the in- 
clination of the protoconch without considering the underlying morphologies and without know- 
ing the error associated with these differences. Given that the accuracy of this metric cannot be 
achieved or known, the precision of this angular measure should be maximized and its limits 
demonstrated. Authors are encouraged to include in their reports a description of the technique 
used to estimate the protoconch inclination and to give a measure of the error of the angular 
measurement made for each particular taxon or sample.^ 

Key words: Gastropoda, lower Heterobranchia, shell morphology, shell coiling, protoconch, 
angle measurement, statistics, precision. 



INTRODUCTION 

A key feature and putative synaponnorphy 
of the Heterobranchia - a large clade of Gas- 
tropoda encompassing the traditional groups 
of Pulnnonata, Opisthobranchia and various 
former "prosobranchs" such as Pyramidel- 
loidea, Architectonicoidea, and Valvatoidea - 
is the phenomenon of heterostrophy (Hasz- 
prunar, 1985, 1988; Bieler, 1992; Ponder & 
Lindberg, 1997). In other groups, the proto- 
conch (embryonic and larval shell) and teleo- 
conch (postlarval shell) are coiled around the 
same axis, resulting in a homeostrophic sheW. 
Heterostrophic shells, by contrast, display a 
divergence between the coiling axis of proto- 
conch and teleoconch (Fig. 1). [For helpful 
reviews of the terminology associated with 
coiling variability in gastropods, including het- 
erostrophy, see Cox (1960: 110-120) and 
Robertson (1993).] 



The obvious cases of heterostrophy are 
those in which a dramatic change of coiling 
occurs just before (e.g., Bande!, 1995; Cipri- 
ani, 1997) or at metamorphosis (e.g., Robert- 
son, 1985, 1993), resulting in noticeable di- 
vergence of the coiling direction/axes 
between protoconchs and teleoconchs. Het- 
erostrophy is particularly well expressed in 
basal heterobranchs -termed "lower hetero- 
branchs" in recent works -such as Pyra- 
midellidae, Architectonicidae, and Mathil- 
didae. Certain authors (e.g., Golikov & 
Starobogatov, 1975; Ponder & Waren, 1988; 
Bieler, 1992) have used Fischer's (1885) ex- 
pressive name "Heterostropha" for this proba- 
bly paraphyletic group of taxa. More recently, 
the name Heterostropha has also been used 
synonymously with Heterobranchia (e.g., 
Bändel, 1990; Schröder, 1995; Gründel, 
1998). 

In these strongly developed cases of het- 



Department of Zoology, Field Museum of Natural History, 1400 S. Lake Stiore Drive, Chicago, Illinois 60605-2496, U.S.A.; 
and Committee on Evolutionary Biology, University of Cfiicago; bieler@fmnh.org 

Current address: Departamento de Estudios Ambientales, Universidad Simón Bolívar, Caracas, Venezuela; send mail to: 
CCS 91392, P.O. Box 025323, Miami, Florida 33102-5323 U.S.A.; rcipri@usb.ve 

This paper is dedicated to Dr. Robert Robertson of The Academy of Natural Sciences of Philadelphia, in recognition of his 
pioneering work on the morphology of heterostrophic shells. 



327 



CIPRIANI & BIELER 




FIG. 1. Protoconch and early teleoconch shell of same specimen of Mathilda cf. amanda (New Caledonia; 
protoconcfi diameter of 460 |jm), viewed from two different angles. 



erostrophy, the protoconch is sinistrally 
coiled, but the larva is anatomically dextrally 
organized. The apparent sinistrality is a result 
of hyperstrophy (i.e, the inverted "upward" 
coiling along the axis, as opposed to coiling 
"downward" in regular orthostrophy). Other 
lower heterobranchs, such as Cornirostridae, 
Valvatidae, Orbitestellidae, Omalogyridae 
and Hyalogyrinidae, show only initial hyper- 
strophy (Bieler et al., 1998), a weak expres- 
sion of heterostrophy that affects only the ini- 
tial whorl(s) of the larval shell. An initial 
left-coiling of the first part of the protoconch 
whorl is also reported for the vetigastropod 
families Trochidae (Hadfield & Strathmann, 
1990) and the extinct Discohelicidae 
(Schröder, 1995). 

Heterobranch protoconchs, in contrast to 
the situation in Caenogastropoda, display few 
morphological features in shell pattern and 
sculpture. Among extant taxa, such features 
are usually limited to sutural wrinkles, aper- 
tural varices, anal keels and associated cal- 
luses (e.g., Robertson, 1964; Bieler, 1993), 
with more elaborate patterns restricted to 
members of a few groups, such as the pyra- 
midellid genus Chrysallida (e.g., Peñas & 
Rolan, 1998). In the absence of ornamental 
characters, differences in coiling parameters 
thus provide valuable morphological charac- 
ters used in heterobranch systematics. The 
traditional metric of heterostrophy is the incli- 
nation angle of the protoconch body whorl in 
relation to some fixed morphological refer- 
ences, usually the axis of coiling of the teleo- 
conch (Micali, 1992; Bieler, 1995; Schröder, 
1995). It is important to note that some au- 
thors give the smallest angle between the two 
hypothetical shell axes, rather than the de- 



gree of "turn"; a 25° divergence reported by 
Bändel (1995), for instance, corresponds to 
155° of other authors. 

An extreme case of heterostrophy exists in 
which the degree of heterostrophy is so great 
that the protoconch assumes an upside-down 
position on the teleoconch in widely umbili- 
cated forms actually protruding from the um- 
bilicus, rather than the spire, of the teleo- 
conch. This condition, for which Dautzenberg 
& Fischer (1896) introduced "anastrophie" 
and Minichev & Starobogatov (1971) "coxial 
heterostrophy," is prevalent in the family Ar- 
chitectonicidae and a few other groups. Char- 
acters of heterostrophy have thus been used 
at various taxonomic levels, from inferring 
membership to the Heterobranchia based on 
heterostrophic coiling (e.g., Bändel, 1994) to 
assigning membership to a particular family, 
genus, or species. 

As a systematic character at a lower taxo- 
nomic level, the inclination angle has been 
used to distinguish between otherwise similar 
species. As long as the recognized ranges of 
average measures of variability (e.g., vari- 
ance) are significantly different between the 
compared taxa, this character is useful for 
comparison and phylogenetic analysis. For in- 
stance, the angle appears to be near-constant 
within extant Indo-Pacific species of Mathilda 
(Bieler, 1995) and, in congruence with other 
morphological characters, often differs among 
species. By contrast. Lower Cretaceous 
species of the same genus were described 
with intraspecific variability ranging up to 35° 
(Schröder, 1995). Wise (1996) employed the 
protoconch angle as a character in his phylo- 
genetic analysis of Pyramidellidae, using nar- 
rowly delimited character states of 90-95°, 



ESTIMATING THE DEGREE OF HETEROSTROPHY 
Д Diagonal ß Average Line 



329 




Lines running 
parallel to wa 
of body whorl 
of protoconch 



FIG. 2. Box method. This method measures variables using a rectangular framework enclosing the proto- 
conch. Protoconch is rotated around coiling axis of teleoconch to estimate minimum inclination of box diag- 
onal from axis of teleoconch coiling. Use of this framework reduces measurement error, increasing precision 
of inclination angle measurement. Variables used in this method include (A) angle of diagonal of box, and (B) 
average angle of two lines running parallel to walls of body whorl of protoconch. 




120-125°, 130-135°, and 140-145°. Schän- 
der et al. (1999) used wider ranges for their 
character states of 90-100° and 100-145° in 
a subsequent analysis. Most modern taxo- 
nomic studies involving heterostrophic shells 
now provide detailed descriptions of the incli- 
nation angle, the number of protoconch 
whorls, and most recently also of the degree 
of immersion into the first teleoconch whorl 
(e.g., Hori, 1998). 

Several practical questions arise when 
using heterostrophy as a character in hetero- 
branch systematics: 

(1) How accurate/precise are such measure- 
ments made with the traditional method? 
How great is the measurement error? 

(2) Can the traditional method be improved, 
thus reducing the measurement error? 

(3) Is the degree of heterostrophy, as ex- 
pressed by "degree of inclination of the 
protoconch against the inferred axis of the 
teleoconch," a useful/meaningful charac- 
ter when comparing morphologies in 
which the protoconch has different de- 
grees of overlap by the first teleoconch 
whorl? 

The present paper attempts to answer 
these questions. 



MATERIALSAND METHODS 

To address our objectives, we used a het- 
erostrophic mathildid species, identified as 
Mathilda cf. amanda Thiele, 1925 (Hetero- 



branchia: Mathildidae), for which such mor- 
phological parameters as the angle of inclina- 
tion of the protoconch are easy to measure. 
Representatives of this morphological variety 
have previously been described from the 
Indo-Pacific (Bieler, 1995); the exemplar for 
this study was collected in the Eastern Atlantic 
(Sénégal, Region de Dakar; Marche-Marchad 
Sta. 9, 20 February 1957; Muséum National 
d'Histore Naturelle, Paris [MNHN]; not num- 
bered). The protoconch of this species is rela- 
tively large (about 500 цт in maximum diam- 
eter), has approximately 1.5 whorls, and is 
only half covered by the first teleoconch 
whorl. The 12 whorls of the teleoconch mea- 
sure 20.5 mm in height. This species was cho- 
sen to give a minimum estimate of measure- 
ment error, and measurements of species 
with less exposed protoconchs will likely be 
less accurate. All measurements were taken 
from the same shell. This implies that all the 
errors discussed are introduced by the re- 
searcher, by the methodology, or by its use on 
the shell, and are not due to differences be- 
tween or within species. Also, all measure- 
ments for this study were taken by a single ex- 
perimenter (RC); any human error is assumed 
consistent throughout repeated measure- 
ments. 

To compare the results of the traditional 
technique (Fig. 2) with those produced by the 
other techniques that follow, the angle of incli- 
nation of the protoconch was always esti- 
mated between the body whorl of the proto- 
conch and an imaginary line running parallel 
to the upper suture line of the first teleoconch 
whorl. To report this angle in traditional fash- 



330 



CIPRIANI &BIELER 



Angle of inclination 
of protoconch 



Angle of inclination of 
first teleoconch whorl 



Axis 






FIG. 3. Using box method, estimating maximum angle of protoconch from axis of coiling is equivalent to mea- 
suring minimum angle between diagonal of box and lower border of box. Protoconch is rotated around teleo- 
conch axis. In each step of rotation, inclination of protoconch is measured, and corresponding value is used 
as sample's angle. After all protoconch angles from same sample are collected at different instances of ro- 
tation, value of minimum angle is selected as most repeatable measure. Rotation sequence starts from po- 
sition A. Protoconch displays smallest angle in position B. 



Ion, the angle between this imaginary line and 
the axis of coiling of the teleoconch was mea- 
sured and added later to the first angle (see 
example below). Given that all measurements 
were taken from the same individual, it can 
safely be assumed that the error of this cor- 
recting angle is constant and therefore is not 
affecting the relative magnitudes of the mea- 
surement errors from the different protocols 
described below. The traditional technique 
was emulated by measuring the inclination of 
the protoconch from an orientation that ap- 
peared to show maximum angle to the eye. 

In an attempt to improve the estimation ac- 
curacy for the inclination angle of the proto- 
conch, a simple alternative we call the box 
method was developed and tested. This ap- 
proach uses a framework of reference (i.e., a 
rectangular box) around a two-dimensional 
image of the protoconch to overcome the 
problem of the absence of morphological 
landmarks on the shell. The lower border of 
this rectangle is aligned with the upper suture 
of the first teleoconch whorl. The upper border 
of the rectangle is a line parallel to the lower 
border, and separated from it by a perpendic- 
ular distance large enough to contain the pro- 
toconch body whorl between both lines. The 
lateral sides close the rectangle to contain the 
protoconch (Fig. 2). Two variables inside this 
box were used as guidelines to measure the 
inclination angle of the protoconch: (a) the di- 
agonal of the rectangle aligned with the body 



whorl of the protoconch, and (b) the average 
angle between two lines that run parallel to 
each side of the walls of the protoconch body 
whorl (Fig. 2). 

To further reduce the measurement error, 
the specimen was first mounted on a support 
with a rotating axis. This axis was mounted 
perpendicular to the plane of sight of a dis- 
secting microscope. The shell was attached 
to the tip of the rotating axis using a small 
quantity of modeling clay at the base of its 
body v\/horl. The coiling axis of the shell was 
aligned to the axis of rotation by correcting the 
shell's relative orientation until the off-center 
oscillations of its spire were minimal. The shell 
was positioned with its apex pointing toward 
the viewer. Then, the shell was ro