(navigation image)
Home American Libraries | Canadian Libraries | Universal Library | Community Texts | Project Gutenberg | Children's Library | Biodiversity Heritage Library | Additional Collections
Search: Advanced Search
Anonymous User (login or join us)
Upload
See other formats

Full text of "Malacologia"

1{Ö\ 

M I SX 



MaLACOLOGIA 



International Journal of Malacology 






/ 



/. 



/^ 






s 



л 




Vol. 45(1) 





j0m04^it 



I 







tu«. 



20031 



MALACOLOGIA 
http:\\malacologia. fmnh.org 



EDITOR-IN-CHIEF: 
GEORGE M. DAVIS 



Editorial Office 

Malacologia 

P.O.Box 1222 

West Falmouth, MA 02574-1222 

Copy Editor: 

EUGENE COAN 

California Academy of Sciences 

San Francisco, CA 



l\/lanaging Editor: 

CARYL HESTERMAN 
Haddonfield, NJ 



Graphics Editor: 

THOMAS WILKE 

George Washington 

University 

Washington, DC 



Business & Subscription Office 

Malacologia 

RO. Box 385 

Haddonfield, NJ 08033-0309 

Associate Editor: 

JOHN B. BURCH 

University of Michigan 

Ann Arbor 

Assistant Business Managers: 

KEVIN ROE & STAFF 

Malacology Department 

Delaware Museum of Natural History 

Wilmington, DE 



MALACOLOGIA is published by the INSTITUTE OF MALACOLOGY, the Sponsor Members of 
which (also serving as editors) are: 



RÜDIGER BIELER 
Field Museum, Chicago 

JOHN BURCH 

MELBOURNE R. CARRIKER 
University of Delaware, Lewes 

GEORGE M. DAVIS 
Secretary and Treasurer 

CAROLE S. HICKMAN 

President 

University of California, Berkeley 



ALAN KOHN 

Vice President 

University of Washington, Seattle 

JAMES NYBAKKEN 

President Elect 

Moss Landing Marine Laboratory, California 

CLYDE F E. ROPER 

Smithsonian Institution, Washington, D.C. 

SHI-KUEI WU 

University of Colorado Museum, Boulder 



Participating Members 



EDMUND GITTENBERGER 

Secretary, UNITAS MALACOLOGICA 

Rijksmuseum van Natuurlijke 

Historie 

Leiden, Netherlands 



JACKIE L.VAN GOETHEM 
Treasurer, UNITAS MALACOLOGICA 
Koninklijk Belgisch Instituut 
voor Natuurwetenschappen 
Brüssel, Belgium 



Emeritus Members 



J. FRANCES ALLEN, Emérita 
Environmental Protection Agency 
Washington, D.C. 

KENNETH J. BOSS 

Museum of Comparative Zoology 

Cambridge, Massachusetts 



ROBERT ROBERTSON 

The Academy of Natural Sciences 

Philadelphia, Pennsylvania 

W. D. RUSSELL-HUNTER 
Easton, Maryland 



Copyright © 2003 by the Institute of Malacology 
ISSN: 0076-2997 



2003 
EDITORIAL BOARD 



J.A.ALLEN 

Marine Biological Station 
Millport. United Kingdom 
¡alien @ udcf. gla.ac. uk 

E.E.BINDER 

Museum d'Histoire Naturelle 

Geneve. Switzerland 

P. BOUCHET 

Muséum National d'Histoire Naturelle 

Paris. France 

bouchet @ cimrs 1 . mnhn. fr 

P. CALOW 

University of Sheffield 
United Kingdom 

R.CAMERON 

Stieffield 

United Kingdom 

R. Cameron @ stieffield. ac. uk 

J.G.CARTER 

University of North Carolina 

Chapel Hill. U.S.A. 

MARYVONNE CHARRIER 

Universite de Rennes 

France 

Maryvonne. Charrier @ univ-rennes 1 . fr 

R. H.COWIE 
University of Hawaii 
Honolulu. Hi. U.S.A. 

A. H.CLARKE, Jr. 
Portland, Texas. U.S.A 

B.C.CLARKE 

University of Nottingham 
United Kingdom 

R.DILLON 

College of Charleston 

SC. U.S.A. 

C.J.DUNCAN 
University of Liverpool 
United Kingdom 

D.J. EERNISSE 
California State University 
Fullerton. U.S.A. 

E.GITTENBERGER 
Rijksmuseum van Natuurlijke Historie 
Leiden, Netherlands 
sbu2eg @ rulsfb. leidenuniv. de 

F. GIUSTI 

Universita di Siena. Italy 

giustif@unisi.it 



A. N. GOLIKOV 
Zoological Institute 
St. Petersburg. Russia 

A.V. GROSSU 
Universitatea Bucuresti 
Romania 

T. HABE 

Tokai University 

Shimizu. Japan 

R, HANLON 

Marine Biological Laboratory 

Woods Hole. Mass.. U.S.A. 

G, HASZPRUNAR 

Zoologische Staatssammlung Muenchen 

Muenchen. Germany 

haszi@zi. biologie, uni-muenchen. de 

J. M. HEALY 

University of Queensland 

Australia 

jhealy @ zoology, uq. edu.au 

D. M. HILLIS 
University of Texas 
Austin, U.S.A. 

K. E. HOAGLAND 

Council for Undergraduate Research 

Washington, DC. U.S.A. 

Elaine@cur.org 

B. HUBENDICK 
Naturhistoriska Museet 
Göteborg. Sweden 

S. HUNT 
Lancashire 
United Kingdom 

R.JANSSEN 

Forschungsinstitut Senckenberg. 
Frankfurt am Main. Germany 

M.S.JOHNSON 
University of Western Australia 
Nedlands, WA, Australia 
msj @ cyllene. uwa.edu.au 

R. N.KILBURN 
Natal Museum 
Pietermahtzburg, South Africa 

MA. KLAPPENBACH 

Museo Nacional de Historia Natural 

Montevideo. Uruguay 

J. KNUDSEN 

Zoologisk Institut Museum 

Kobenhavn, Denmark 



с. LYDEARD 
University of Alabama 
Tuscaloosa, U.S.A. 
clydea rd @ biology, as.ua.edu 

C.MEIER-BROOK 
Tropenmedizinisches Institut 
Tubingen, Germany 

H.K. MIENIS 

Hebrew University of Jerusalem 

Israel 

J. E. MORTON 
Ttie University 
Auckland. New Zealand 

J. J. MURRAY, Jr. 
University of Virginia 
Charlottesville. U.S.A. 

R. NATARAJAN 

Marine Biological Station 

Porto Novo, India 

DIARMAIDOFOIGHIL 
University of Michigan 
Ann Arbor. U.S.A. 

J. OKLAND 
University of Oslo 
Norway 

T. OKUTANI 
University of Fisheries 
Tokyo. Japan 

W. L. PARAENSE 

Instituto Oswaldo Cruz. Rio de Janeiro 

Brazil 

J. J. PARODIZ 
Carnegie Museum 
Pittsburgh. U.S.A. 

R. PIPE 

Plymouth Marine Laboratory 
Devon, United Kingdom 
RKPI @ wpo. nerc.ac. uk 

J. R POINTIER 

Ecole Pratique des Hautes Etudes 
Perpignan Cedex. France 
pointier® gala, univ-perp. fr 

W. F. PONDER 
Australian Museum 
Sydney 

01 Z.Y 

Academia Sínica 

Qingdao, People's Republic of China 



D. G.REID 

The Natural History Museum 

London. United Kingdom 

S. G. SEGERSTRÁLE 
Institute of Marine Research 
Helsinki. Finland 

A. STANCZYKOWSKA 
Siedlce. Poland 

F. STARMÜHLNER 

Zoologisches Institut der Universität 

Wien, Austria 

Y I. STAROBOGATOV 
Zoological Institute 
St. Petersburg. Russia 

J. STUARDO 
Universidad de Chile 
Valparaiso 

C.THIRIOT 

University P. et M. Curie 

Villefranche-sur-Mer France 

thiriot@obs-vlfr.fr 

S.TILLIER 

Museum National d'Histoire Naturelle 
Paris, France 

J.A.M. VAN DEN BIGGELAAR 
University of Utrecht 
The Netherlands 

N.H.VERDONK 
Rijksuniversiteit 
Utrecht, Netherlands 

H.WÄGELE 

Ruhr-Universität Bochum 

Germany 

Heike. Waegele @ ruhr-uni-bochum. de 

ANDERS WAREN 

Swedish Museum of Natural History 

Stockholm. Sweden 

B.R.WILSON 

Dept. Conservation and Land Management 

Kallaroo. Western Australia 

H.ZEISSLER 
Leipzig. Germany 

A. ZILCH 

Forschungsinstitut Senckenberg 

Frankfurt am Main. Germany 



"SSIÎTHSOÎÎ/^^ 

^ / 2005 

MALACOLOGIA, 2003, 45(1 ): 1 -40 \^ "^ 

TOWARD A SYSTEMATIC REVISION OF BROODING FRESHWATER 

CORBICULIDAE IN SOUTHEAST ASIA (BIVALVIA, VENEROIDA): 

ON SHELL MORPHOLOGY, ANATOMY AND MOLECULAR PHYLOGENETICS 

OF ENDEMIC TAXA FROM ISLANDS IN INDONESIA 

Matthias Glaubrecht^*, Thomas von Rintelen^ &Alexei V. Korniushin^ 



• ABSTRACT 

The Indonesian island of Sulawesi, with its central zoogeographical position within the 
so-called "Wallacea", harbors a large number of endemic faunal elements, rendering this 
region a biodiversity hotspot. The present paper shows that this holds also true for limnic 
molluscs of the family Corbiculidae. Although less species-rich than previously assumed, 
we document here that the Indonesian corbiculids exhibit more anatomical and life-history 
variation than in the rest of their collective Old World distribution. 

As a first step toward a comprehensive revision of the Southeast Asian corbiculids, 
morphological characters and molecular genetics are studied in the various taxa described 
from Sulawesi and Sumatra. Based on morphological studies of materials collected recently, 
especially in the central lakes on the island of Sulawesi and supplemented by historical 
museum collections, we conclude that Corbicula is represented on Sumatra by at least 
one and on Sulawesi by four endemic taxa. Corbicula javanica (Mousson, 1849), known 
from several islands of Indonesia, and С moltkiana Prime, 1 878, sampled in lakes Singkarak 
and Manindjau on Sumatra are similar in their anatomical characters and the mode of 
brooding to the widely distributed Asian C. fluminea (Müller, 1 774), but differ from the latter 
in shell form and sculpture. The distinctness of C. linduensis Bollinger, 1914, restricted to 
the basin of the Palu River in North Sulawesi is confirmed in finding a peculiar mode of 
ovoviviparous reproduction, that is, incubation of embryos in the gills until juveniles are 
1.3 mm long. Corbicula matannensis P. Sarasin & F. Sarasin, 1898, and С loehensis 
Kruimel, 1913, both occurring within the Malili lake system on Sulawesi, as well as C. 
possoensis P. Sarasin & F. Sarasin, 1898, endemic to Lake Poso, all release small larvae, 
a reproductive mode similar to C. fluminea, but they differ from the latter in having broad 
siphons with slit-like apertures. Corbicula loehensis differs from С matannensis in its very 
delicate sculpture and hinge, whereas С possoensis is distinguished from other species 
in having big posterior adductors and especially broad inhalant siphon. In addition, only С 
possoensis broods in both demibranchs, whereas all other known brooding corbiculids 
incubate in the inner demibranch only. Monoflagellate spermatozoa were observed in all 
studied Indonesian taxa except С javanica, in which sperm structure remains unknown. 

Phylogenetic analyses of COI sequences (MP and NJ) including now five Indonesian 
taxa studied herein show distinct clades occuring (i) on Sumatra, identified as С moltkiana, 
and (ii) on Sulawesi with two seperate lineages of С possoensis from Lake Poso being 
most distinct from С matannensis and С loehensis from the Malili lake system. The analyses 
also suggest a close relationship of С javanica to the Korean C. fluminea within an Asian 
cluster, including also the Australian corbiculid. Systematic, biogeographical and evolutionary 
implications of these results are discussed. 

Key words: freshwater Bivalvia, Corbicula, ovoviviparity, anatomy, systematics, 
biogeography, endemics, Sulawesi. 



'Museum of Natural History, Department of Malacozoology, Institute of Systematic Zoology, Humboldt University, 

Invalidenstrasse 43, D-10115 Berlin, Germany 

^1. I. Schmalhausen Institute of Zoology, the National Academy of Sciences, Kiev, Ukraine 

'Corresponding author: matthias.glaubrecht@rz.hu-berlin.de 



GLAUBRECHTETAL. 



INTRODUCTION 

Limnic bivalves of the family Corbiculidae are 
widespread in tropical and subtropical regions 
of the Old and New worlds. The genus Cor- 
bicula is also widely distributed and abundant in 
fresh and brackish waters of Africa, the south- 
ern parts of Asia, extending from Turkey and 
Israel in the west to China, the Malayan Penin- 
sula and the Sunda Archipelago, New Guinea 
and eastern Australia. Members of the genus 
were also introduced to both Americas and 
Western Europe (reviews: Morton, 1986; 
Araujoetal., 1993; Pfenningeret al., 2002). 

Comprising brackish-water and freshwater 
species and, therefore, representing different 
stages of adaptation to freshwater environ- 
ments, renders Corbicula an important model 
organism for evolutionary and ecological stud- 
ies not only among molluscs. However, its tax- 
onomy and systematics is far from being 
resolved and many aspects are still disputable. 
A great number of species were described, 
especially from Southeast Asia (e.g.. Martens, 
1897; P. Sarasin & F. Sarasin, 1898; Kruimel, 
1913; reviews: Prashad, 1930; Morton, 1979), 
resulting in a plethora of named taxa. To date a 
comprehensive revision of these corbiculids is 
lacking. 

While an earlier review (Prashad, 1930) dealt 
exclusively with conchological characters, rec- 
ognizing many congeneric morphospecies, 
some later investigations focused on anatomy 
(Britton & Morton, 1979; Harada & Nishino, 
1995) and particularly on reproductive biology 
(Morton, 1979, 1986), resulting in greatly reduc- 
ing the number of species considered valid. 
For example, Morton (1986) recognized only 
two species, namely С fluminalis Müller, 1774, 
and C. fluminea Müller, 1774. According to this 
author, C. fluminalis more frequently inhabits 
estuaries, tolerates higher salinity (thus, basi- 
cally being a brackish-water representative) 
and releases free-swimming veliger larvae. In 
contrast, C. fluminea occurs in pure freshwa- 
ter only and incubates embryos in the gills, 
which are not released before the foot of the 
juveniles is well developed. Summarizing the 
available biological data, Morton (1986) con- 
cluded that both Corbicula species are distrib- 
uted throughout the range of the genus and 
include a great variety of conchological forms 
with overlapping characters. 

A different taxonomic concept of Corbicula is 
accepted in Japan (Harada & Nishino, 1995). 
The estuarine, non-incubating species is re- 



ferred to as С japónica Prime, 1864, and the 
local freshwater incubating form as С leana 
Prime, 1864, and С fluminea is reported from 
several Japanese localities (Harada & Nishino, 
1995; Komaru et al., 1998). Komaru et al. 
(1998) provided morphological characters to 
distinguish C. leana from С fluminea. In addi- 
tion, С sanda/ Reinhardt, 1878, is recognized 
as an endemic species restricted to Lake Biwa 
in Japan. 

To further complicate corbiculid systematics, 
new insights into the genetic structure of Asian 
Corbicula are salient to any taxonomic revision. 
As shown first by Okamoto & Arimoto (1986), 
Japanese taxa have different karyotypes, with 
C. japónica and С sandai being diploid (with 2n 
= 38 and 36, respectively), whereas С leana is 
triploid (3n = 54). Recently, polyploidy has also 
been discovered in several taxa from Korea 
(Park et al., 2000) and in two color forms of С 
fluminea from China, Sechuan Province (Qiu et 
al., 2001 ). It has been repeatedly reported that 
polyploidy is associated with peculiar biflagel- 
late spermatozoa and ameiotic reproduction, 
resulting in clonality (Komaru & Konishi, 1996, 
1999; Komaru et al., 1997,2000; Konishi et al., 
1998; Siripattrawan et al., 2000; Qiu et al., 
2001 ; Lee et al. 2002). For example, those in- 
vestigations of the reproductive biology of Cor- 
bicula showed that biflagellate spermatozoa 
observed in С leana from Japan and С 
fluminea from China and Taiwan are non-re- 
ductional, and that these molluscs reproduce 
by means of androgenesis, that is, the elimina- 
tion of the mother's genome from eggs and 
development of embryos from the genome of 
spermatozoon only. Similar biflagellate sper- 
matozoa were reported for the С fluminea 
samples from Thailand, Korea and the exotic 
forms introduced into the USA. Thus, appar- 
ently this taxon is a heterogeneous assem- 
blage of variably polyploid and ameiotic clonal 
lineages (Siripattrawan et al., 2000). Spermato- 
zoa of the Australian C. australis (Lamarck, 
1818) are also biflagellate (Byrne et al., 2000), 
therefore indicating a clonal structure for this 
taxon as well (Siripattrawan et a!., 2000). 

All these clonal lineages, to our present 
knowledge, lack sexually reproducing parental 
taxa and, therefore, greatly complicate the 
meaningful application of specific names. Con- 
sequently, the name С fluminea has been ap- 
plied to multiple genetically distinct clonal 
lineages of unknown parentage in recent stud- 
ies on European and introduced North Ameri- 
can populations. In contrast, there is only one 



FRESHWATER CORBICULIDAE FROM INDONESIA 



documented sexual species of freshwater Cor- 
bicula, С sandai, endemic to the "ancient" 
Lake Biwa (Hurukawa & Mitsumoto, 1953). In- 
terestingly, at the same time only C. sandai 
has monoflagellate spermatozoa, thus allowing 
to correlate reproductive mode with sperm 
morphology (Konishi etal., 1998; Siripattrawan 
et al., 2000). In addition, C. sandai is also the 
only known gonochoric freshwater Corbicula, 
whereas all other taxa appear to be hermaph- 
roditic (Komaru & Konishi, 1996; Byrne et al., 
2000; Siripattrawan et al., 2000). 

Surprisingly, only diploid karyotypes were re- 
ported for the two introduced European Cor- 
bicula morphotypes, traditionally identified as 
С fluminalis and С ilumine a (Pfenninger et al., 
2002). In the absence of direct evidence of 
clonality in these morphotypes, hybridization 
between those two morphotypes, which was 
discovered in this molecular study, might indi- 
cate sexual reproduction. Accordingly, clonality 
is widely distributed, especially among most 
Asian taxa, albeit not the universal feature 
among freshwater Corbicula. Therefore, the 
genetic structure of these limnic clams needs 
further investigation. 

Furthermore, not only these new data on ge- 
netics, polyploidy and reproduction disagree 
with the two-species concept of Asian Cor- 
bicula as suggested by Morton (1979, 1986). 
Preliminary data from mitochondrial DNA se- 
quences utilizing the COI gene (Siripattrawan 
et al., 2000; Lee et al., 2002) indicate that С. 
leana, С. japónica and С. sandai are distinct 
lineages alongside С fluminea, whereas two 
North American morphotypes (forms A and B) 
might have different origin, with the first (form A) 
being closer related to Japanese С leana and 
the second (form B) to C. fluminea from Ko- 
rea. This analysis, as well as a later one that 
included samples from China, Israel and Eu- 
rope (Pfenninger et al., 2002), demonstrated 
that all studied freshwater Corbicula form one 
single clade with poorly resolved relationships, 
though, with the exception of C. 
madagascariensis Smith, 1882, from Mada- 
gascar (erroneously referred to as С africana 
from "Africa" in the latter paper as well as in 
GenBank). The modest levels of genetic diver- 
gence demonstrated for the freshwater lin- 
eages suggested evolutionary recent common 
origin (Sihpattrawan et al., 2000; Pfenninger et 
al., 2002). 

Despite these accounts, to date many re- 
gions remain poorly investigated with respect 
to Corbicula diversity and distribution, in par- 



ticular islands of the Sunda Archipelago, such 
as the Indonesian islands of Sumatra and 
Sulawesi. This island chain is among the bio- 
logically most diverse regions in the world, rep- 
resenting one of the major hot spots of 
biodiversity, areas exceptionally rich in endemic 
species and harbouring rare and threatened 
species (Myers et al., 2000; Mittermeier et al., 
2000; Reid, 1998). Due to its biogeographically 
central position within the so-called "Wallacea", 
in the heart of the complex crossroads of two 
continents Asia and Australia, Sulawesi not only 
harbours a number of unique and endemic fau- 
nal elements, but recently also figured promi- 
nently in palaeogeographical research 
providing new geological insights (Whitmore, 
1981; Hall & Blundell, 1996; Metcalfe et al., 
2001). Consequently, this region became a 
central focus of biogeographic interest again 
(Whitmore, 1987; Hall & Holloway, 1998; 
Metcalfe etal., 2001). 

Although molluscs have unfortunately only 
rarely been considered in biogeographic re- 
search (Davis, 1982), especially limnic gastro- 
pods from the Sunda region were recently 
utilized as models in an approach to synthesize 
systematic and geological patterns (overview: 
Glaubrecht, 2000). For example, based on the 
known distributional pattern found in the con- 
stituent taxa for the mainly viviparous 
Pachychilidae which are widely distributed 
throughout the mainland of Southeast Asia and 
the Indo-Malayan Archipelago, reaching as far 
east as the Philippine Islands and Sulawesi, it 
has been hypothesized that the biogeography of 
these limnic snails (i) find their explanation in 
palaeogeographical events that go back to the 
Cretaceous and early Cenozoic instead of ex- 
plaining the distribution as correlated to the 
forming of the so-called Sunda- and Sahulland, 
respectively, and (ii) that it implies vicariance 
over dispersal as causation (Glaubrecht, 2000; 
Köhler et al., 2000; Köhler & Glaubrecht, 2001 , 
2003; Glaubrecht & Rintelen, 2003). 

In contrast, according to Siripattrawan et al. 
(2000) and Pfenninger et al. (2002), the known 
patterns of distribution and genetic divergence 
in Corbicula, based on data for continental 
Southeast Asia, Japan and Australia, suggest 
rather dispersal than vicariance scenario for 
these freshwater bivalves. Therefore, it is 
promising to test the mentioned scenario by 
extending the data set, and to compare the pat- 
terns of morphological and genetic divergence 
among Indonesian bivalves with that of the 
sympatric pachychilid snails. In this context, 



GLAUBRECHTETAL. 



the corbiculid bivalves provide a second model 
group that inhabits the same limnic environ- 
ments in this crucial biogeographic region and, 
with them incubating eggs and embryos in their 
gills, also share a similar reproductive strategy 
with the ovoviviparous and viviparous 
pachychilid gastropods. 

However, any zoogeographical evaluation has 
to be based on solid systematic knowledge. 
Unfortunately, any modern revision of the 
Corbiculidae is still lacking. For example, from 
Sulawesi a total of nine endemic corbiculid spe- 
cies have been described, especially from its 
ancient central lakes (Martens, 1897; P. 
Sarasin & F. Sarasin, 1898; Kruimel, 1913; 
Bollinger, 1914). In contrast, Prashad (1930) 
recognised only two endemic species on 
Sulawesi, assigning all lacustrine taxa to C. 
subplanata Martens, 1897. In his revision of the 
corbiculids from Sulawesi, Djajasasmita (1975, 
1977) recognised four taxa - three endemic 
species living in lakes in addition to C. 
subplanata as the only riverine form. He also 
reported on one widely distributed Asian spe- 
cies, С javanica (Mousson, 1849), as occur- 
ring on Sulawesi. From Sumatra, also a total 
of nine endemic species of Corbicula have 
been described (Prime, 1878; Clessin, 1887; 
Martens, 1897, 1900), of which Djajasasmita 
(1977) recognized four as valid - C. moltkiana 
Prime, 1878, С gustaviana Martens, 1900, С 
sumatrana Clessin, 1887, and C. tobae Mar- 
tens, 1900, and, in addition, recorded four 
widely distributed Asian species on the island, 
viz. C. javanica, С pullata Philippi, 1851, С 
rivalis (Philippi, 1850), and C. túmida Deshayes, 
1854. 

However, none of these studies provided any 
sufficiently distinctive characters for the indi- 
vidual species. Although shell proportions, 
angle between lateral teeth, position of beaks, 
shell thickness and sculpture are usually used, 
the intraspecific variability of these characters 
remained largely unknown and, therefore, the 
taxonomic decisions appeared as being highly 
arbitrary. Consequently, Morton (1979, 1986) 
tentatively suggested conspecificy of the Indo- 
nesian species reviewed by Prashad (1930) 
and Djajasasmita (1975, 1977) with С 
fluminea, synonymizing the species names 
listed above with the latter taxon. However, 
Morton did not discuss in detail the taxonomy, 
nor did he provide any new data on the mor- 
phology or biology of these Indonesian 
corbiculids. Thus, not only is the systematics 
and phylogenetic relationships of the presum- 



ably endemic insular Corbiculidae unknown, 
but the anatomy and reproductive biology of 
any of the disputable species from this region 
has remained undescribed. 

The recent discovery of an endemic genus of 
Corbiculidae from Lake Poso with its unique 
cemented mode of life (Bogan & Bouchet, 
1998) shows that the molluscan fauna at least 
of this lake on Sulawesi is much more specific 
than assumed earlier. This stimulated the 
present study of other Corbiculidae, namely 
species of the genus Corbicula inhabiting Poso 
and neighbouring lakes, as was suggested by 
Bogan & Bouchet (1998). Accordingly, we here 
integrate shell characters, new data on the 
anatomy, especially the reproductive biology, 
and molecular genetics (sequences of COI 
mitochondrial gene fragment) for six nominal 
taxa of Corbicula from Indonesia, namely C. 
Javanica, С moltkiana, С linduensis, C. 
matannensis, С loehensis and С possoensis, 
based on recent sampling by the authors on 
Sumatra and Sulawesi, and we compare with 
historical material deposited in the museum 
collections. In addition, we report for the first 
time for any Indonesian Corbicula principal fea- 
tures of sperm morphology, as well as pres- 
ence and localization of larvae in gills. We also 
provide a preliminary evaluation of the status 
and affinities of the studied taxa, but any final 
taxonomic decision is postponed until more 
molecular data on the diverse morphotypes 
from lacustrine and riverine habitats in the area 
are available. Some other taxa described by 
Martens (1897, 1900) from Sumatra and 
Sulawesi are also awaiting revision. However, 
because no fresh material on these taxa was 
available, these are beyond the scope of our 
current study. Nevertheless, we document here 
that the corbiculids endemic to the region (Fig. 
1), although less species-rich than assumed 
before, exhibit more anatomical and life-history 
variation than in the rest of their collective Old 
World range. 



MATERIALSAND METHODS 

Material Studied 

The material at hand (Fig. 1) was collected 
during two field trips to Sulawesi in August 
1999 and March 2000 by M. G. and T v. R., and 
on Sumatra in April 2000 by Frank Köhler and 
Sabine Schutt It is housed in the Malacological 
collection of the ZMB, voucher material is also 



FRESHWATER CORBICULIDAE FROM INDONESIA 




Lontoa 



Masapi 



50 









10 



oñ?y on m^%°r?a7e?ammed т^жГп^!^^^ ?''^ ^°'^''"' °" 'ndonesian islands based 

uMiy un maienai examined in the present study; details are q ven for С moltkiana on Siimatrp (A) 



GLAUBRECHTETAL. 



provided to the Zoological Museum in Bogor. 

Type and other historical material represent- 
ing Corbicula species from Sulawesi and 
Sumatra, including the type specimens of C. 
subplanata Martens, C. celebensis Martens, С 
lacustris Martens, С possoensis P. Sarasin & 
F. Sarasin, and C. matannensis P. Sarasin & F. 
Sarasin, also housed in the ZMB, were studied 
for comparison. This is supplemented by the 
relevant type materials recovered in other mu- 
seums, including the lectotype of C. fluminea 
designated by Araujo et al. (1993), as well as 
type lots of С javanica and C. sumatrana. 
Comparative alcohol material of C. fluminea 
was kindly provided by C. Ituarte (collected 
near Buenos Aires, Argentina). 

Shell Morphology and Anatomy 

All newly collected material was fixed in 70% 
ethanol after cracking the shells of some 
specimens per sample; this material is given 
as w = wet material in the Material sections 
below. Shell measurements were made with a 
caliper to a precision of 0.1 mm; size of adduc- 
tor scar was measured as the distance be- 
tween its uppermost point and junction with 
mantle line. Dissections were made under a 
Leica MZ 9.5 stereomicroscope, and anatomi- 
cal structures illustrated using a camera lu- 
cida. Pieces of mantle for the study of 
musculature were stained by eosine (water 
solution) and mounted in Canada Balsam. 

Sperm Morphology 

Sperm was obtained from gonads of ethanol- 
fixed specimens. Its morphology was studied 
by means of interference contrast optics (DIC) 
and scanning electron microscopy (SEM), in 
the latter case applying hexamethyldisilazane 
(HMDS) following the procedure described by 
Nation (1983). 

Molecular Genetics 

DNA was purified from about 1-2 mm^ of foot 
tissue by СТАВ extraction (Winnepenninckx et 
al-, 1993). Polymerase chain reaction (PCR) 
was used to amplify a region of -71 bp at the 
5'-end of the cytochrom oxidase subunit I gene 
(CGI). PCR was performed in 25 pi volumes 
containing IX Taq buffer, 1.5 mM MgCI2, 200 
pM each dNTP, 1-2.5 U Taq polymerase, ap- 
proximately 100 nM DMA and ddH^O up to vol- 
ume on a Perkin Elmer GeneAmp 9600 or 



2400 thermocycler. After an initial denaturation 
step of 3 min at 94°C, cycling conditions were 
35 cycles of 1 min each at 94°C, 45-53°C, and 
72°C, with a final elongation step of 5 min. 

Primers used were LCO 1490 [5' GCTCAA 
CAAATCATAAAGATATT 3'] and HC02198 [5' 
TAAACTTCAGGGTGACCAAAAAATCA 3'] 
(Folmer et al., 1 994). PCR products were puri- 
fied with QiaQuick PCR purification kits 
(Qiagen) following the standard QiaQuick PCR 
purification protocol. Both strands were cycle 
sequenced with the original primers using ABI 
Prism BigDyeTM terminator chemistry and vi- 
sualized on an ABI Prism 377 automated DNA 
sequencer. The resulting sequence electro- 
pherograms of both strands were corrected 
manually for misreads and merged into one 
sequence file using BioEdit Version 5.0.1 (Hall, 
1999). Sequences were aligned manually and 
checked by translating the DNA sequences 
into amino acids in DAMBE 4.0.75 (Xia & Xie, 
2001) using the genetic code for invertebrate 
mitochondrial DNA. The sequences obtained 
by this study were analyzed together with Cor- 
bicula sequences published by Siripattrawan et 
al. (2000) and Pfenninger et al. (2002); the lat- 
ter included samples from Hong Kong, which 
is near to the type locality (Canton) of С 
fluminea, and from Israel (presumably С 
f lumin alls). 

Polymesoda caroliniana (Bosc, 1801) and 
Neocorbicula limosa (Maton, 1809) were used 
as outgroups. The latter taxon needs a nomen- 
clatorial commentary. As pointed out by 
Parodiz (1996: 265), the generic name 
Cyanocyclas Blainville, 1818, is a senior sub- 
jective synonym of Neocorbicula Fisher, 1887, 
and, therefore, should have priority. Under- 
standing that this taxon is in need of a taxo- 
nomic revision and possibly formal decision of 
the ICZN, we for the time being will use here 
the latter generic name, as done in recent mo- 
lecular literature (e.g., Siripattrawan et al., 
2000; Pfenninger et al., 2002). GenBank ac- 
cession numbers of all sequences used and 
ZMB catalogue numbers for original material 
are provided in Table 1 . 

Aligned sequences were processed with 
PAUP* 4.0b10 (Swofford, 1998). Corrected se- 
quence divergence levels were calculated by 
using a General Time Reversible model, to ob- 
tain the matrix comparable with that of 
Siripattrawan et al. (2000). Phylogenetic trees 
were reconstructed using neighbor joining (NJ, 
Saitou & Nei, 1987) and maximum parsimony 
(MP) methods as implemented in PAUP*. NJ 



FRESHWATER CORBICULIDAE FROM INDONESIA 7 

TABLE 1. Sources of the corbiculid material utilized in this study for CGI sequence data analyses; 
numbers in brackets refer to analyses of sequence data as given in Table 4 and Figs. 18 and 19. 







Museum 


GenBank 




Taxon 


Locality data 


catalog no. 


accession no. 


Reference 


Corbicula javanica 


Bogor, Java 


ZMB 106449 


AY275668 


This study 


(Mousson, 1849) 










С. moltkiana 


L. Singkarak, 


ZMB 103024 


AY275660 


This study 


Pnme, 1878(1) 


Sumatra 








С moltkiana (2) 


L. Singkarak, 
Sumatra 


ZMB 103034 


AY275659 


This study 


С moltkiana (3) 


L Manindjau, 
Sumatra 


ZMB 103025 


AY275657 


This study 


C. moltkiana (4) 


L Manindjau, 
Sumatra 


ZMB 103032 


AY275658 


This study 


C. matannensis Sarasin 


L Matano, 


ZMB 103002 


AY275663 


This study 


aSarasin, 1898(1) 


Sulawesi 








С matannensis (2) 


L. Matano, 
Sulawesi 


ZMB 103003 


AY275664 


This study 


C. matannensis (3) 


L. Mahalona, 
Sulawesi 


ZMB 103009 


AY275665 


This study 


С loehensis Kruimel, 


L. Lontoa, Sulawesi 


ZMB 103033 


AY275667 


This study 


1913(1) 










C. loehensis (2) 


L. Masapi, 
Sulawesi 


ZMB 103011 


AY275666 


This study 


С possoensis Sarasin & 


L. Poso, Sulawesi 


ZMB 190024 


AY275661 


This study 


Sarasin, 1898(1) 










C. possoensis (2) 


L. Poso, Sulawesi 


ZMB 103028 


AY275662 


This study 


С fluminea 


Thailand 


UMMZ 


AF196270 


Siripattrawan et al., 


(Müller, 1774) 




266691 




2000 


С. fluminea 


Korea 


UMMZ 
266690 


AFI 96269 


Siripattrawan et al., 
2000 


С. fluminea 


Hong Kong 


- 


AY097292 


Pfenninger et al., 
2002 


С leana Pnme, 1864 


Japan 


UMMZ 
266668 


AFI 96268 


Siripattrawan et al., 
2000 


С sandal Reinhardt, 


L. Biwa, Japan 


UMMZ 


AFI 96272 


Siripattrawan et al., 


1878 




266689 




2000 


С. fluminalis? 


Israel 


- 


AY097299 


Pfenninger et al., 
2002 


С. australis 


NSW, Australia 


UMMZ 


AF196274 


Siripattrawan et al., 


(Lamarck, 1818) 




266662 




2000 


Corbicula "form A" 


Michigan, USA 


UMMZ 
266693 


AFI 96280 


Siripattrawan et al., 
2000 


Corbicula "form B" 


Utah, USA 


UMMZ 
266695 


AFI 96278 


Siripattrawan et al., 
2000 


C. madagascariensis 


Madagascar 


UMMZ 


AFI 96275 


Sinpattrawan et al.. 


Smith, 1882 




255293 




2000 


C. japónica Pnme, 1864 


Japan 


UMMZ 
266688 


AF196271 


Siripattrawan et al., 
2000 


Neocorbicula limosa 


Argentina 


UMMZ 


AFI 96277 


Siripattrawan et al., 


(Maton, 1809) 




265500 




2000 


Polymesoda caroliniana 


Florida, USA 


UMMZ 


AF196276 


Siripattrawan et al.. 


(Bosc, 1801) 




265499 




2000 



8 



GLAUBRECHTETAL. 



analyses were conducted using the random 
initial seed option to break ties. The robustness 
of inferences was assessed through bootstrap 
resampling (1000 replicates) (Felsenstein, 
1985). In the MP analyses, the heuristic search 
algorithm was employed with 10 random addi- 
tions of taxa and tree bisection-reconstruction 
(TBR) branch swapping. All other settings 
were left at default values. Support for nodes 
was estimated by bootstrap resampling (500 
replicates) with one random addition per repli- 
cate. 

Abbreviations Used in Figures 

aa - anterior adductor, es - exhalant siphon, 
is - inhalant siphon, mc - concentric mantle 
musculature, mp - papillae, mr - radial mantle 
musculature, p - papillae, pa - posterior ad- 
ductor, pss - presiphonal suture, sr - siphonal 
retractor. 

Museum Acronyms 

MLP - Museo de La Plata, Buenos Aires, Ar- 
gentina; MZB -Zoological Museum Bogor, In- 
donesia; SMF - Senckenbergsmuseum, Frankfurt/ 
Main, Germany; UZMC ~ Universitetets Zoo- 
logisk Museum, Copenhagen, Denmark; ZMA - 
Zoological Museum Amsterdam, The Nether- 
lands; ZMB - Museum für Naturkunde, 
Humboldt University, Berlin, Germany (formerly 
Zoological Museum Berlin); ZMZ - Zoolo- 
gisches Museum, Universität Zürich, Switzer- 
land. 



SYSTEMATIC ACCOUNT 

Species from the Sunda Islands 

Corbicula javanica (Mousson, 1849) 
Figs. 2A-C, 3D-F 

Cyrena orientalls ^^ar. javanica Mousson, 1849: 

86, pi. 15, fig. 2. 
Corbicula ducalis Prime, 1862: 274; Martens, 

1897: 114. 
Corbicula javanica - Martens, 1897: 111; 

Prashad, 1930: 203, pi. 25, figs. 7-20; 

Djajasasmita, 1977: 6. 
Type Locality: Tikojia (probably an error for 

Tjikoya), Java. 
Type Material: Lectotype ZMZ 532199 (Fig. 2A) 

from Tijkoya, Java, leg. Zollinger, ex. coll. 

Mousson; corresponding to the specimen fig- 



ured by Mousson (1849: pi. 15, fig. 2) with the 
following measurements: L = 39.5, H = 33.0, 
W/2 = 11.9 mm (present designation, to fix 
the status of this specimen as the sole name 
bearing type). Paralectotypes (2 specimens) 
from the same original lot, ZMZ 532199a. 
Paralectotypes ZMZ 532200 (2 specimens), 
the same locality and collector. 

Other Material Examined: Java: Tjiponnas near 
Garut (ZMB Moll. 103054w; leg. M. Schmidt 
1902); Bogor (ZMB Moll. 106459; leg. T v. 
Rintelen, May 2002). Lombok: Narmada (ZMB 
Moll. 75535w; leg. Rensch, Sunda Expedi- 
tion). Sulawesi: Lake Tempe (ZMB Moll. 
103024; leg. Max Weber; originally identified 
as Corbicula ducalis Prime, 1862). 

Taxonomic Remarks: In respect to the discrep- 
ancy of the spelling of the type locality for this 
taxon, we follow here Djajasasmita (1977), 
who interpreted it as Tjikoya. The latter author 
also synonymized C. ducalis Prime, 1862, 
which was reported earlier on as a valid spe- 
cies from several Indonesian islands (Mar- 
tens, 1897; Prashad, 1930) with С javanica. 
Our revision of specimens from Sulawesi 
originally identified by Martens as C. ducalis 
is consistent with this point of view, although 
some minor differences to the typical C. 
javanica are discernable. Specimens from 
Lombok included in this study (Fig. 2C) also 
correspond well to the published descriptions 
(Prashad, 1930) and revised type specimens 
of С javanica (Fig. 2A, B). 

Description 

Shell: Oval or broad triangular, without angles, 
somewhat inequilateral, convex. Beaks 
broad, protruding, markedly shifted anteriorly. 
Periostracum yellow to brown, shiny. Internal 
coloration usually white or pale blue, with 
purple pattern at lateral teeth. Concentric 
sculpture coarse and widely spaced (8-11 
ribs per 1 cm), ribs usually not sharp (wave- 
like). Hinge plate relatively narrow; cardinal 
teeth small; anterior lateral teeth long, 
arched. Specimens from Lombok and 
Sulawesi up to 20 mm long; Javanese speci- 
mens much larger, up to 50 mm long. 

/Anatomy.- Adductors small, oval. Posterior ad- 
ductor diameter about 0.13 length of shell 
(Table 2). Presiphonal suture not elongated, 
length equal to breadth of inhalant siphon. Si- 
phons conical, with thick walls (when con- 
tracted) and circular or short oval apertures, 
both narrow; inhalant siphon with about 30 



FRESHWATER CORBICULIDAE FROM INDONESIA 









FIG. 2. Shells of Corbicula ja\/anica in comparison with C. fluminea: A. С javanica, Java, lectotype 
(ZMZ 532199); B. C.javanica, one of the paralectotypes (ZMZ 532200); С C.javanica, Lonnbok (ZMB 
Moll. 75535); D. С fluminea, China, lectotype (UZMC). Scale bars = 5 тгл. 



GLAUBRECHTETAL. 




^jsJí^JVWiA 



FIG. 3. Anatomy of Corbicula fluminea, Argentina (MLP 5329) (A-C) and С javanica, Lombok (ZMB 
Moll. 75535) (D-F); A. Habitus of soft body; B. Siphons from inside; C, D. Siphons from outside; E. 
Section of siphons; F. Marginal mantle papillae. Scale bars = 1 mm. 



FRESHWATER CORBICULIDAE FROM INDONESIA 



11 



TABLE 2. Morphometric indices (mean and standard deviation provided) calculated from measure- 
ments of shells and siphon structure of the Corbicula species studied: L - shell length; H - shell 
height; W - shell thickness (two valves); U - distance from beak to anterior end; HH - hinge plate 
length; A - diameter of the posterior adductor scar; S - breadth of siphons. Note that for the last two 
taxa only range is given for siphons. 





No of 
















measured 














Species 


specimens 
(dry/wet) 


H/L 


W/H 


U/L 


HH/H 


A/L 


S/L 


С fluminea (lectotype) 


1 


0.93 


080 


0.48 


100 


0.14 


not 
measured 


С javanica 


5/0 


0.83 


0.75 


0.43 


0.059 


14 


not 


ZMZ 532199, 532200 




±0.059 


±0.066 


±0.017 


±0.005 


±0.012 


measured 


(type lot) 
С javanica 


3/0 


0.82 


0.81 


0.39 


0.057 


0.13 


not 


ZMB 75535 




±0.035 


±0.022 


±0.021 


±0.006 


±0.009 


measured 


С javanica 


10/5 


0.89 


0.73 


0.42 


0069 


0.12 


0.12 


ZMB 106459 




±0.041 


±0.020 


±0.018 


±0.004 


±0.013 


±0.010 


C. moltkiana 


10/2 


0.78 


0.68 


0.47 


0.080 


0.14 


0.24 


ZMB 54370, 103058 




±0.056 


±0.020 


±0.022 


±0.016 


±0.007 


±0.05 


С moltkiana SM F 5994 


10/0 


0.95 


0.73 


0.46 


0.099 


0.18 


not 


(paratypes of С 




±0.049 


±0.065 


±0.047 


±0.007 


±0.020 


measured 


sumatrana) 
C. moltkiana 


6/0 


0.94 


0.80 


0.44 


0.111 


0.18 


not 


ZMB 170000-01 




±0.126 


±0.033 


±0.069 


±0.016 


±0043 


measured 


(syntypes of С lacustns) 
C. moltkiana 


5/4 


0.91 


0.69 


0.47 


0.079 


0.17 


0.18 


ZMB 103024 




±0.029 


±0.039 


±0.040 


±0.004 


±0.015 


±0.013 


С moltkiana 


7/4 


0.84 


0.69 


0.50 


0.073 


not 


0.19 


ZMB 103032 




±0.049 


±0.039 


±0.032 


±0.008 


measured 


±0.030 


C. linduensis 


10/4 


0.77 


0.63 


0.49 


0081 


0.14 


0.18 


ZMB 103016 




±0.022 


±0039 


±0.029 


±0.007 


±0.015 


±0.033 


С matannensis 


10/6 


0.84 


0.64 


0.42 


0.098 


0.15 


0.24 


ZMB 103002 




±0,043 


±0035 


±0.022 


±0.005 


±0.010 


±0.015 


С matannensis 


9/7 


0.83 


0.59 


0.39 


0.96 


0.13 


0.26 


ZMB 103009 




±0.045 


±0.041 


±0.031 


±0.013 


±0.017 


±0.034 


С matannensis 


4 


0.96 


0.70 


0.42 


0.111 


0.15 


not 


ZMB 103006 




±0.050 


±0.090 


±0.052 


±0.016 


±0.016 


measured 


С loehensis 


5 


0.88 


0.68 


0.44 


0.078 


0.14 


not 


ZMB 103010 




±0.028 


±0.034 


±0.011 


±0.015 


±0.023 


measured 


C. loehensis 


8/3 


0.88 


0.68 


0.47 


0.075 


0.12 


0.32 


ZMB 103011 




±0.040 


±0.026 


±0.046 


±0.011 


±0.010 


±0.032 


C. loehensis 


3/2 


0.87 


0.60 


0.44 


0.070 


0.12 


0.27-0.33 


ZMB 103033 




±0.047 


±0.040 


±0.026 


±0.014 


±0.004 




С possoensis 
ZMB 103028 


10/7 


0.93 
±0.028 


0.65 
±0.033 


0.41 
±0.033 


0.115 
±0.007 


0.23 
±0.019 


0.32 
±0.022 


C. possoensis 


3/2 


0.89 


0.75 


0.31 


0.120 


0.21 


0.30-0.31 


ZMB1 90024 




±0.070 


±0.037 


±0.010 


±0.012 


±0.022 





papillae usually arranged in one row (Fig. 
3D), sometimes with additional row of short 
papillae. Black pigment concentrated in rings 
internally at base of both siphons (Fig. 3E); 
outer surface of siphons white or with pale 



brown pigment (in specimens from Lombok). 
Larger papillae of inhalant siphon with dark 
rings. Siphonal muscles strong, arranged in 
broad bands. Papillae on outer surface of 
presiphonal suture arranged in two rows (Fig. 



12 



GLAUBRECHTETAL. 



о 
о 

о 
'S 
ö 



О 
со 

ш 

_| 

CÛ 

< 



О 



О 



О 



О 



О 



О го -^ 

3 О) ф 

.5 ¿Í Q. 



^ 


ф 


»— ' 






- 


(Л 


ш 


Ф 


^ 


"Ü 


3 






d 




ш 


СП 


о 


3 


s 


о 


с 




о 


о 


Q. 


го 


го 


о: 








Z 



^ 2 

-t; Ш Ф 

^ "со О) 

.^ о с 

й О- го 

Ç Ф m 



О 


ф 




с 




> 




ф 


^ 


о 




о 










i 


ф 


ф 


5: 




« 


СП 


о 


15 


о 


с 




> 


о. 


го 


га 



с 1_ 

го о 



> -а ^ 

о го" S Ф 



го о э 



_ О) о ф 

^2 о g 

.го Ф о. ä 

к : 



тз 




СП 


го 


- 


с 


о 


го 


го 


¿ 


=3 


"3 


1_ 


СП 


о 


о 


с 


.с 




го 




го 

> 




1 








E¿ 


1 


X! 


ю 


(Л 


о 




го 


-Q 


Е о 


OJ 


го 


о 


ф 


о о 


о 


Ü 


! 






'и_ 


О) 


^^ 


TI "О 


ф 


■о 


CNJ 


о 


Ф го 


О) 


с 


о 


"m 


о. р 




3^ 





о j_ 



о о 



S-1- ф 
Ф 

S "О 
со о 



Е >^ 



00 



ф 
га "О 



о -^ 



го 
со 



го 



í: го 



_ , , о 
-Q Ol I 
О см 



ел о Р 

"- ф ^ 

ф о. ф Ö 

#î^ 2c¿S 

ф I ф о = 

> о "О С) го 

s ^ (Л 



£ "Ö ^. р 
Е roocN 

о 1^ f^ о 
о ' 



-^ <Л ф -т: о ^ 



Ü^^ гоГ 
-О 9- V (i^ о = 
=i го ' " • "" 



(Л 



ел 



"О — - 

CD о -Q Е 

2 со 



^ ■•-' ^ 



i 5 

со о ^ С) 

-От- г- I 

í= ;_ о о 

Ф ф сЬ ^ 

^ '^^ lo 

- ^ 5 ю =¿ 

Ф -^ о о = 

> I t о "5 

го 00 Î5 — Е 

s Z со 



(Я 

го 
ф 
ш 



ф 

о. 

о 
со 



-о bi 
с ел 



ф 

Е 

О) 



о 



(Л 



со о 



о ^_^ 
-О Гч| 



"О CnJ 

■— о 



о 



о 



ф ^^ 

Р "О ю 

о Ф С\1 

«л ?, о 



о 



со 

Е 
о 



со 



if í= 

i £ 

¿; СП 



ел 



i ^ â^ g' ф 

g ф .û s Е 

>- го ™ Ь 3 

CL со Z 



го 



(Л О) '^ <íl 

СП ф хз 5 

^ го § Е 

го "- Ь =5 

Q со Z 



*- -^ с: СП 



ф 
5 Е 

со Z 



X о -J^ (Л ^ 
ФХ ^.g O-g 

X < со 



(Л ел 

, g ^ ф 

d я о г^ 

Ф о "^ ^^ 

с .у- 3 го 

с; гл /— #— 



ф 

■D ТЗ 



го 



— о 


(J 


J 




ф 


о 




ф 




о о 


.^ со 


С 




Е 

О) 




"О 

с 


тз 
ф 


о "^ 
о 




о 


со 


а. 


го 

с 


ф 


3 

Х2 


го 
го 


о — 


ТЭ CNi 


3 
о 
о 


5 
о 


Ф 


.^' 


о 


.^' 


Q. 


S? 


:^ О 


tr 


го 
ф 


го 


го 
ф 


Ф 
(Л 



= Е_ 

Ф г; -^^ ,-; 

а)Г"Е ° 

<2 ^ -ё ¿ 

о ^ = <>1 

с о -п го Q 

о ^ о Е ^ 
s CÛ со 



^ ¿ 



В О) Е 



СП ^ 



ф 

ТЗ "О 



.^ií о. 
го ф 
Ф ел 



ЕЕ ^ 

.. <и 3 

iíí о ТЗ _ о 

с I ф го -g 

о CD с Е ^ 

^ -Е со 



в ^ ^ 

^ E¿ й 

ё) ^Е о 

¡^ ■^ "О 9 

о \ ^=сп 

с -^ Ф го о 

о -^ с Е ^ 

2 s со 



о 



ф 



в <и 



го 
.g 

^ 2 ^ |.ф 

ТЗ го 5= тз 

с: о. о CD ;_ Ф 

3 ф с 1 ф ~ 

X! ел о оо с 



ф CT 3 



ел (U 
^ Е 

ТЗ 



Е 
Е 

со 

Í-Í- -^ Sí, -^ i- CD 

'^ ï ^см fe 5 

ф го !*± -^ тз LO 

^ СП Q. о I ._ = е^ 

ОтФС^фГОсЭ 

u.ií¿eлo■^cE"^ 

^ со 



ш^= Е -о 



СП 



со 



со 



_ - 2^ 

с .9- 5 го ^3 

с ел с с с -ti 

.а)ч_ fc с ф го го 

О- ° m m го Е g 



го 5.2 о о §,5.15 ^ 
mro>--s;.cE'ro^¿ 
О-В В д. m о. го ^ 
S СО S о: 



го 





L_ 


ел 






X! 




' — ^ 


с 


Е 


15 

с 


с 


о 

с 

V 


ф 


tí= 


о 


тз 




с 




^ 


.^ 


ф 


го 


с 


с: 


с 


Е 


3 


Э 


с 


со 




Ф -р 


тз 






>> О) 


о 






■ — - с 


о 






го в 


X) 






11 


^о 


ф 

N 




с 
о 






го .с 


ел 




Е тз 




15 




о. го 


го 
о 


^ 




о 


го 




со 


_| 


_J 





FRESHWATER CORBICULIDAE FROM INDONESIA 



13 



3D). Marginal mantle papillae well developed, 
densely arranged (Fig. 3F). Radial mantle 
muscles strong, arranged in band, individual 
bundles not separated. 

Reproductive Biology: Only eggs were found in 
all dissected specimens, therefore sperm 
morphology remained unknown. One speci- 
men from Java contained in its inner 
demibranchs several hundred small larvae 
(0.13-0.15 mm long) with uncalcified shells. 
Since these larvae were apparently not fully 
developed, the final size of released young 
remains unknown. Other studied specimens 
were not brooding. 

Distribution and Ecology: According to 
Djajasasmita (1977), this taxon is widely dis- 
tributed in Southeast Asia, from the Malay 
Peninsula to Timor and Aru Islands, as well 
as to the Philippines. It occurs in several dif- 
ferent types of lentic and lotie habitats, that 
is, rivers, creeks and irrigation canals as well 
as lakes and ponds (Djajasasmita, 1977). 

Remarks: This taxon is recognizable as a dis- 
tinct morphotype, differing from the typical 
form of С fluminea in its inequilateral shell, 
anterior shift of beaks, and relatively narrow 
hinge plate (Fig. 2, Table 3). Anatomical 
characters described here well agree with 
those reported for C. fluminea (Britton & 
Morton, 1979; Harada & Nishino, 1995) and 
observed in specimens of the latter species 
studied here for comparison (Fig. 3A-C), 
with the only difference of a darker pigmen- 
tation of the outer surface of siphons. In 
fact, we anticipate that С javanica might 
probably just be a variety of С fluminea. 
However, this supposition should be con- 
firmed by investigating the reproductive biol- 
ogy and molecular genetics of the relevant 
forms in more detail. 

Corbicula moltkiana Prime, 1878 
Figs. 4 6, 7A, B, 8A, В 

Corbicula moltkiana Prime, 1878: 43, pi. 2, fig. 

2a, b, c; Prashad, 1930: 200, pi. 25, figs. 17- 

22; Djajasasmita, 1977:4. 
Corbicula sumatrana Clessin, 1887: 78, pi. 3, 

fig. 7; Prashad, 1930: 198, pi. 25, figs. 18; 

Djajasasmita, 1977: 7. 
Corbicula ve rbec к i C\ess\r\, 1887: 79. 
Corbicula moltkeana [sic] Prime - Martens, 

1897: 111, pi. 7, figs. 1-6. 
Corbicula lacustris Martens, 1897: 118, pi. 7, 

figs. 20-24. 
Type Locality: "Sumatra", not exactly specified. 



Type Material: Type specimens of C. moltkiana 
Prime located in UZMC are presumed to be 
lost (T. Schlotte, pers. comm.). Presumably 
syntypes (although catalogued as paratypes) 
of С sumatrana Clessin, "Lake Singkarah" 
[sic!], leg. Verbeck 1880 (SMF 5994, 5995). 
Holotype of C. verbecki, Clessin, same local- 
ity data (SMF, not numbered). Syntypes of С 
lacustris Martens, Lake Singkarah, leg. We- 
ber (ZMB Moll. 170000, 170001, 170002). 

Other Material Examined: Sumatra: Lake 
Manindjau (ZMB Moll. 54370w, 103058, 
103059; leg. Max Weber; originally identified 
as С moltkiana by E. v. Martens); Lake 
Manindjau, at shore near Manindjau (ZMB 
Moll. 103024, 103034; leg. Köhler & Schutt , 
April 2000); Lake Singkarak (0°32.89'S, 
100°31.92'E) (ZMB Moll. 103025, 103032; 
leg. Köhler & Schutt, April 2000) (Fig. 1 ). 

Taxonomic Remarks: We have at our disposal 
one alcohol lot and two dry lots coming from 
the collection of Eduard von Martens, bearing 
his identification. Obviously, the specimens 
are those cited in Martens' (1897) monograph 
as "moltkeana" (evidently a misspelling of 
Prime's original name). While characters of 
these specimens (Fig. 4E) well agree with 
the original description and figures of Prime 
(1878), we retain the original identificaton as 
С moltkiana. Comparison of type speci- 
mens of the three taxa described from Lake 
Singkarak, namely С sumatrana Clessin 
(Fig. 4B), C. verbecki Clessin, and С 
lacustre Martens (Fig. 4C), as well as recent 
collections of Corbicula from this lake (Fig. 
4D) with the available figures and material of 
С moltkiana did not provide convincing dis- 
tinctive characters and, thus, suggests that 
these taxa are conspecific. 

Description 

Shell: Variable in shape, but usually triangular 
or trapezoid, from high to markedly elongated, 
compressed. Posterior margin somewhat 
truncate, with characteristic posteroventral 
right or obtuse angle. Beaks narrow, central 
or somewhat shifted anteriorly, not protrud- 
ing. Periostracum yellow, dark green or dark 
brown to black, shiny. Internal shell surface 
from white to dark purple. Concentric sculp- 
ture of variable spacing (9-12 ribs per 1 cm), 
ribs sharp. Hinge plate moderately broadened 
to broad (Table 2, 3). Cardinal teeth well de- 
veloped; anterior lateral teeth thick, straight or 
slightly arched. Up to 30 mm long. 



14 



GLAUBRECHTETAL. 

В 




FIG 4 Shells of Corbicula moltkiana from Sumatra with synonyms as suggested in the present paper. 
A Original figure from Prime (1878), locality unknown (not to scale); B. One of the syntypes of C. 
sumatrana, Lake Singkarak (SMF 5995); С One of the syntypes of С lacustre. Lake Singkarak 
(ZMB Moll. 170000); D. С moltkiana, Lake Singkarak (ZMB Moll. 103024); E. С moltkiana, Lake 
Manindjau (ZMB Moll. 54370). Scale bar = 5 mm. 



FRESHWATER CORBICULIDAE FROM INDONESIA 



15 





к 



u 



FIG. 5. Anatomy of Corbicula moltkiana, Sumatra, Lake Manindjau: A. Habitus of soft body; B. Siphons 
from outside; C-D. Papillae of inhalant siphon (C - ZMB Moll. 54370, D - ZMB Moll. 103034); E-F. 
Marginal mantle papillae (E - ZMB Moll. 54370, F - ZMB Moll. 103034). Scale bars = 1 mm. 



/Anatomy.- Adductors small, oval (Fig. 5A, Table 
2). Presiphonal suture longer than aperture of 
inhalant siphon. Siphons conical, narrow in 
small specimens and rather broad in full 
grown ones, with thick walls and circular or 
oval apertures; number of inhalant siphon pa- 



pillae varies from 30 to about 80, arranged in 
one or two rows (Figs. 5B-D, 68), in largest 
specimens additional row of small papillae 
may appear. Black pigment concentrated in 
rings at base of papillae in both siphons, but 
patches of pigment also seen around siphons 



16 



GLAUBRECHTETAL 




FIG. 6. Corbicula moltkiana, Sumatra, Lake 
Singkarak (ZMB Moll. 103025), view of mantle 
and gill: A. Siphons from inside, B. Section of 
siphons; С Gill with incubated larvae, from 
inside. Scale bars = 1 mm. 



(Fig. 6A, B), in some specimens internal sur- 
face of siphons almost entirely pigmented. 
Some papillae of inhalant siphon with dark 
rings. In specimens from Martens' collection 
pattern of pigmentation indistinguishable. 
Siphonal muscles strong, arranged in broad 
bands (Fig. 6A). Papillae on outer surface of 
presiphonal suture arranged in single row, 
sometimes in two rows. Marginal mantle pa- 
pillae well developed, densely arranged. Ra- 
dial mantle muscles strong, arranged in 
band, their bundles indistinguishable in 
smaller specimens but distinct in large ani- 
mals (Fig. 7A, B). 
Reproductive Biology: Gonads of the dis- 
sected animals contained either sperm or 
eggs. Spermatozoa (Fig. 8A-B) monoflagel- 
late; head length 11.5 ± 0.58 |.im (n = 7). 
Eight out of 15 specimens collected in Lake 
Singkarak (ZMB Moll. 103026) were brooding 
and their inner demibranchs contained sev- 
eral hundred larvae of approximately equal 
size (0.25-0.3 mm long). The only gravid 



specimen found in Lake Manindjau (ZMB 
Moll. 54370) contained larger larvae (about 
0.35 mm long). 

Distribution and ecology: To date known from 
several localities on Sumatra and the Malay 
Peninsula, according to Djajasasmita (1977). 
Material revised by this study was collected in 
lakes only (Fig. 1 A), but the species was also 
recorded in rivers and ditches (Djajasasmita, 
1977). 

Remarks: This species is remarkably variable 
both in shell and anatomical characters. 
Specimens from Lake Manindjau differ from 
those collected in Lake Singkarak (type local- 
ity of C. sumatrana and C. lacustris) in their 
narrower hinge plate and densely arranged 
ribs. Moreover, the old lots from Lake 
Manindjau are distinguished from the new 
collections from the same lake by their elon- 
gated shells, broadened siphons, and weaker 
mantle muscles; anatomical differences 
might be associated with the larger size of 
animals collected by Weber, in comparison 
with those from our collections (26-28 and 
15-18 mm, respectively). Furthermore, the 
purple form found in both sampled lakes 
(stored separately as ZMB Moll. 103032, 
103034) alongside the yellow one (ZMB Moll. 
103024, 103025) showed also somewhat 
more delicate ribs and darker internal pig- 
mentation of siphons. The form described as 
C. lacustre is characterized by smaller size 
(up to 18 mm), high, thick-walled shell, and 
especially coarse sculpture; it is probably a 
deep water variety of the same species 
(Djajasasmita, 1977). While differences be- 
tween the extreme forms from the localities 
discussed here are rather pronounced (Fig. 
4), intermediate forms could be also found. 
All forms assigned here to С moltkiana can 
be recognized by their angulate compressed 
shell, narrow not protruding beak, relatively 
broad hinge plate and sharp ribs. These 
characters distinguish it from the widely dis- 
tributed Southeast Asian taxon, C. javanica 
(Table 3), as well as from the typical form of 
C. fluminea. The differences from С javanica 
in shell elongation and convexity, position of 
beaks, and relative breadth of hinge plate 
(Table 2) were significant at p < 0.05. Note- 
worthy, one specimen of C. javanica was 
found in Weber's lot from Lake Manindjau 
(ZMB Moll. 103.058), being well distinguish- 
able from the sympatric C. moltkiana by its 
protruding beak, narrow hinge and widely 
spaced smoothened ribs. 



FRESHWATER CORBICULIDAE FROM INDONESIA 



17 






mr 



mc 



FIG. 7. Mantle musculature of Indonesian Corbicula: A. C. moltkiana, Sumatra, Lake Singkarak (ZMB 
Moll. 103024); B. С moltkiana, Sumatra, Lake Manindjau (ZMB Moll. 54370); С С. matannensis, 
Sulawesi, Lake Matano (ZMB Moll. 103002); D. С possoensis, Sulawesi, Lake Poso (ZMB Moll. 
103028). Scale bar = 1 mm. mc - concentric musculature, mr - radial musculature. 



Large specimens of С moltkiana are similar 
in some anatomical characters (form of 
siphons and patterns of mantle musculature) 
to the lacustrine taxa from Sulawesi (C. 
matannensis and С loehensis). Dark rings 
of pigment seen at base of both siphons in C. 
moltkiana are similar to those of С fluminea 
(Britton & Morton, 1979; Harada & Nishino, 
1995), but the internal pigmentation of siphons 
in the former taxon is generally more intense 
than in the latter. 

Sperm and eggs were not found in the same 
animal. We understand as functional males 
those animals producing sperm, while we did 
not find the relatively large eggs when in- 
specting the gonad. Although the exact ex- 
pression of sexuality in this species remains 
to be verified by detailed seasonal observa- 
tions and histological study of gonads, we 
anticipate that С moltkiana is not a simulta- 
neous hermaphrodite. In this aspect, it might 



be similar to С sanda/ from Lake Biwa, but 
apparently differs from the other freshwater 
taxa studied so far (Konishi et al., 1998; 
Byrne et al., 2000; Qiu et al., 2001 ). It should 
be stressed again here, that our finding of 
monoflagellate sperm in this taxon provides 
an indication of meiosis and sexual reproduc- 
tion (Siripattrawan et al., 2000). 

Species from Sulawesi 

Corbicula linduensis Bollinger, 1914 
Figs. 8C, 9A, B, 10, 11 

Corbicula moltkiana var. linduensis Bollinger, 

1914:575, pi. 18, fig. 12. 
Corbicula linduensis Bollinger - Djajasasmita 

1975:84, fig. 1. 
Corbicula lindoensis [sic!] Bollinger - 

Djajasasmita, 1977: 4. 
Type Locality: Lake Lindu, Sulawesi. 



18 



GLAUBRECHTETAL. 

В 




FIG. 8. Sperm morphology (SEM) of Indonesian Corbicula exhibiting monoflagellate spermatozoa: A, 
B. С moltkiana (ZMB Moll. 103024); С С. linduensis (ZMB Moll. 103016); D. С matannensis (ZMB 
Moll. 103003); E. С loehensis (ZMB Moll. 103010); F, G. С possoensis (ZMB Moll. 103028). Scale 
bars = 2 цт. 



Type Material: Syntypes deposited at the Natu- 
ral History Museum Basel (Switzerland) are 
reported to be lost (U. Wüest, pers. comm.). 

Material Examined: Sulawesi: river at the road 
from Palu to Gimpu, basin of the Palu River 
(01°13.75'S, 119°56.69'E) (ZMB Moll. 
103016w; leg. Brinkmann & Rintelen, March 
2000) (Fig. 1). 

Description 

Shell: Oval, usually markedly elongated, with 
rounded posteroventral angle (Fig. 9A, B). 



Periostracum yellow to brown. Internal col- 
oration white or purple. Beaks central, narrow 
and not protruding. Surface sculpture with 
widely spaced, low ribs (n = 10-12 ribs per 
1 cm); pronounced folds of periostracum no- 
ticeable between ribs. Hinge plate moderately 
broad. Cardinal teeth delicate; lateral teeth 
relatively short, straight. Largest specimen 
available for this study was 1 7 mm long. Ac- 
cording to the literature, the specimens from 
Lake Lindu were on average 23 mm long. 
/Anatomy.' Adductors small, round (Fig. 10A, 
Table 2). Presiphonal suture not elongated, 



FRESHWATER CORBICULIDAE FROM INDONESIA 



19 





В 





FIG. 9. Shells of Corbicula taxa from Sulawesi (right valve from outside, left valve from inside): A, B. 
Corbicula linduensis, Palu River system (ZMB Moll. 103016); С Syntype of C. matannensis, Lake 
Matano (ZMB Moll. 50799); D. С matannensis, Lake Matano (ZMB Moll. 103002); E. С matannensis, 
Lake Mahalona (ZMB Moll. 103009); F. С matannensis. Lake Towuti (ZMB Moll. 103006); G. Juvenile 
specimen of the same species from Lake Towuti (ZMB Moll. 103007). Scale bars = 5 mm. 



20 



GLAUBRECHTETAL. 
В 




FIG. 10. Anatomy of Corbicula linduensis, Sulawesi (ZMB Moll. 103016): A. Habitus of soft body; B. 
Siphons from outside; С Inhalant siphon papillae; D. Marginal mantle papillae; E. Clutch of juveniles 
from a gill. Scale bars = 1 mm (C and D to same scale). 



length equal to diameter of inhalant siphon. 
Siphons conical, thin-walled, apertures circu- 
lar or short oval, both somewhat broadened; 
inhalant siphon with about 50 papillae ar- 
ranged in two rows (external row with shorter 
papillae) (Figs. 108, C, IIA, В). Internal pig- 
mentation of siphons weak, but pale internal 
ring sometimes noticeable around exhalant 
siphon. Papillae not pigmented. Siphonal 
muscles rather strong, arranged in broad 
bands. Papillae on outer surface of 
presiphonal suture arranged in two uneven 
rows (Fig. 10B). Marginal mantle papillae well 



developed, densely spaced (Fig. 10D). Ra- 
dial mantle muscles strong, arranged in 
band, with only anterior bundles distinct, 
separated from each other. 
Reproductive Biology: Gonads of the dissected 
animals contained either sperm or eggs. 
Spermatozoa (Fig. 8C) monoflagellate, rela- 
tively small (head length 8.8 ± 0.27 |.im, n = 
7). Eight of 12 studied specimens were 
brooding. Some of them contained several 
hundred larvae of usual size for Corbicula. 
However, most of the gravid animals carried 
in each inner demibranch 10 to 35 juveniles 



FRESHWATER CORBICULIDAE FROM INDONESIA 



21 




FIG. 11. View of mantle and gills of Corbicula 
linduensis, Sulawesi (ZMB Moll. 103016): A. 
Siphons from inside; B. Section of siphons; С 
Gill with incubated larvae, from inside. Scale 
bars = 1 mm. 



with up to 1.5 mm long shells (Fig. 10E, 
11C). 

Distribution and Eco/ogy.' Apparently restricted 
to the lake and river of the Palu basin. To date 
only known from lacustrine habitats 
(Djajasasmita, 1975, 1977). Our recent find- 
ings extend the known distribution from the 
lake proper to the Palu valley, though, since 
the specimens studied here were collected in 
a small river, on muddy bottom with vegeta- 
tion. 

Remarks: This species is similar in its elon- 
gated shell to some forms of С moltl<iana. 
However, the sculpture (smoothened ribs) 
and siphonal characters of C. linduensis are 
more similar to that in С fluminea and C. 
javanica (Table 3). Sperm and eggs were not 
found in the same animal. Taking into ac- 
count the monoflagellate type of sperm, we 
suggest that this species is meiotic, 
similarily to C. moltl<iana. It is distinguished 
from the other taxa studied by the significantly 
smaller spermatozoa (p < 0.01, t-test). Char- 
acteristics of its brooding process, i.e. having 



the largest incubated juveniles known, are 
unique among Corbicula species. According 
to Djajasasmita (1975) the population from 
Lake llindu has dramatically decreased since 
1950, thus rendering conservation strategy 
for this unique bivalve an urgent task. 

Corbicula matannensis P. Sarasin & 

F. Sarasin, 1898 

Figs. 7C, 8D, 9C-G, 12, 13 

Corbicula matannensis P. Sarasin & F. Sarasin 
1 898: 92, pi. 1 1 , figs. 1 58-1 60; Kruimel, 1913 
231; Djajasasmita, 1975: 84, fig. 3 
Djajasasmita, 1977:4. 

Corbicula towutensis Kruimel, 1913: 231 , pi. 4, 
fig. 3. 

Corbicula mahalonensis Kruimel, 1913: 231 , pi. 
4, fig. 4. 

Corbicula subplanata (partim) Martens - 
Prashad, 1930: 203, pi. 26, figs. 7-9, 13. 

Type Locality: Lake Matano, Sulawesi. 

Type Material: Syntype of C. matannensis P. 
Sarasin & F. Sarasin (ZMB 50799), from Lake 
Matano (Fig. 11 A). Syntypes of С towutensis 
Kruimel and C. mahalonensis Kruimel (ZMA) 
[vidi]. 

Other Material Examined: Sulawesi: Lake 
Matano: S shore, small bay (02°28.04'S, 
12Г14.04'Е) (ZMB Moll. 103000w; leg. 
Glaubrecht & Rintelen, 15 August 1999); S 
shore (02°28.44'S, 12Г15.78'Е) (ZMB Moll. 
103001w; leg. Glaubrecht & Rintelen, 15 Au- 
gust 1999); E bay, at outlet of Petea River 
(02°32.06'S, 12Г28.50'Е) (ZMB Moll. 
103002w; leg. Glaubrecht & Rintelen, 16 Au- 
gust 1999); S shore, at Salonsa (02°30.49'S, 
12Г19.96'Е) (ZMB Moll. 103003w; leg. 
Glaubrecht & Rintelen, August 1999); NW 
shore (2°26.01'S, 12Г13.03'Е) (ZMB Moll. 
103004w; leg. Glaubrecht & Rintelen, 11-12 
August 1999). Lake Towuti: W shore, bay at 
outlet of Larona River (02°46.09'S, 
12Г21.57'Е) (ZMB Moll. 103006; leg. 
Glaubrecht & Rintelen, 18 August 1999); N 
shore, swamp W of Mahalona inlet, lake side 
ofsand-bar(02°40'S,12r31.8'E) (ZMB Moll. 
103007w; leg. Bouchet, 1991). Lake 
Mahalona: at mouth of outlet (02°36.88'S, 
12Г30.98'Е) (ZMB Moll. 103008; leg. 
Glaubrecht & Rintelen, 24 August 1999); E 
shore, cape (02°35.58'S, 12Г30.68'Е) (ZMB 
Moll. 103009w; leg. Glaubrecht & Rintelen, 
24August 1999) (Fig. 1). 

Taxonomic Remarks: Comparison of the avail- 
able material of C. matannensis to the 



22 



GLAUBRECHTETAL. 




FIG. 12. Anatomy of Corbicula matannensis from Sulawesi, Lake Matano (ZMB Moll. 103002): A. 
Habitus of soft body; В. Siphons from outside; С. Papillae of inhalant siphon; D. Marginal mantle 
papillae. Scale bars = 1 mm (C and D to the same scale). 



syntypes of С subplanata Martens, 1897 
(ZMB Moll. 103017, from Minralang River, near 
Tempe, Sulawesi), confirmed the differences 
in patterns of sculpture between these taxa 
mentioned by Djajasasmita (1975). However, 
the status of the latter taxon remains unclear, 
until its soft parts are available for anatomical 
and molecular study. Given that the differ- 
ences between the respective taxa concern 
only shell proportions, which proved to be 
variable in Corbicula (Morton 1979, 1986; 
Harada & Nishino 1 995), we accept here the 
synonymization of C. mahalonensis and С 
towutensis under C. matannensis as sug- 
gested by Djajasasmita (1975). 

Description 

Shell: Circular in young specimens and tetrago- 
nal in fully grown ones, with obtuse postero- 



ventral angle (Fig. 9C-G). Periostracum from 
pale yellow to dark violet in small shells and 
usually black in large ones, dull. Internal col- 
oration from white to deep purple, usually 
darker on outer margin. Beaks central in 
young shells but markedly shifted forward in 
adults, narrow, not protruding. Concentric 
sculpture pronounced, densely spaced (15- 
20 ribs per 10 mm), ribs sharp. Hinge plate 
usually broad; cardinal teeth well developed; 
lateral teeth straight. Length up to 32.5 mm 
(syntype from Lake Matano). 
Anatomy: Adductors small, oval (Fig. 12A, 
Table 2). Presiphonal suture relatively long. 
Siphons cylindrical, thin-walled, with broad 
slit-like apertures; inhalant siphon somewhat 
broader than exhalant, with 55 to 70 papillae 
arranged in two rows (internal row of long, ex- 
ternal of short papillae) (Figs. 12B, C, 13A- 
C). Both inner and outer surface of siphons 



FRESHWATER CORBICULIDAE FROM INDONESIA 



23 




FIG. 13. Corbicula matannensis from Sulawesi, view of mantle and gill: A. Siphons from inside, Lake 
Matano (ZMB Moll. 103002); B. Section of siphons from specimen of the same locality; С Section of 
siphons, Lake Towuti (ZMB Moll. 103006); D, E. Gill with incubated larvae, Lake Matano (ZMB Moll. 
103002). Scale bars = 1 mm. 



and papillae densely pigmented; with dark 
median internal stripe along presiphonal su- 
ture. Siphonal muscles weak, forming two 
narrow bands and dispersed fibers below 
and above these bands (Figs. 1 2A, 1 3А). Ar- 
rangement of papillae on outer surface of 
presiphonal suture variable: sometimes ar- 
ranged in several rows, sometimes in single 
row or dispersed (Fig. 128). Marginal mantle 
papillae small, widely spaced (Fig. 12D). Ra- 
dial mantle muscles weak, forming separate 
bundles (Fig. 70). 
Reproductive Biology: Gonads of the dis- 
sected animals contained either sperm or 
eggs. Spermatozoa monoflagellate, head 
length 11.1 ± 0.30 цт (n = 7). Brooding speci- 
mens were found in three samples (two from 
Lake Matano and one from Lake Mahalona), 



representing a total of eight gravid specimens 
out of 30 specimens dissected. Numerous 
larvae (0.30-0.33 mm long) were located 
only in inner demibranchs (Fig. 13D, E). 

Distribution and Ecology: Occurring in the 
larger lakes of the Malili system, that is, 
Lake Matano, Mahalona and Towuti. This 
species is known from lacustrine habitats 
only so far. 

Remarks: This species is distinguished from 
C. subplanata, as described by Martens 
(1897), by its sculpture. Corbicula 
matannensis has much more densely placed 
ribs, and they are narrower and more sharp; 
because spacing between ribs in Corbicula 
increases with age, equally sized specimens 
should be compared. The latter taxon is also 
characterized by rather peculiar anatomical 



24 



GLAUBRECHTETAL. 




FIG 14 Shells of Corbicula from Sulawesi: A. С. loehensis, Lake Masapi (ZMB Moll. 103010); В. С. 
loehensis, Lake Lontoa (ZMB Moll. 103005); С Syntype of Corbicula possoensis, Lake Poso (ZMB 
Moll 50798; D. Corbicula possoensis, Lake Poso (ZMB Moll. 190024). Scale bars = 5 mm. 



FRESHWATER CORBICULIDAE FROM INDONESIA 

В i^Y:/ 



25 




FIG. 15. Anatomy of Corbicula loehensis. Lake Masapi (ZMB Moll. 103010): A. Habitus of soft body; 
B. Siphons from outside; С Siphons from inside. Scale bars = 1 mm. 



characters (broad siphons with strong inside 
pigmentation, and widely spaced marginal pa- 
pillae of mantle). One sample from Lake 
Towuti contained small shells (up to 16 mm 
long) with delicate sculpture (Fig. 9G) that 
show some similarity to С loehensis (see be- 
low). However, none of these specimens were 
brooding, therefore, we conclude that all of 
them were young and could represent C. 
matannensis, in which juveniles have more 
delicate sculpture than adults. Noteworthy, the 
doubtful specimens from Towuti were similar 
to young Corbicula from Lake Matano and dis- 



tinguished from C. loehensis of Lake Masapi 
and Lake Lontoa (older name: Wawontoa) by 
their broad hinge plate. The shells from Lake 
Matano are the largest (length up to 35 mm) 
characterised by well developed sculpture (n = 
14-16 ribs per 10 mm in the middle and 
about 12 at the outer margin, near the beaks 
ribs are fine) and strong hinge. The speci- 
mens from Lake Towuti are very similar to that 
from Lake Matano, but they never reach such 
a large size (largest specimen found was 23 
mni long) and are more round and convex 
(Fig. 11D, Table 2). This form is similar to 



26 



GLAUBRECHTETAL. 




FIG. 16. Corbicula loehensis and C. possoensis, view of siphons and gills: A. С loehensis, Lake 
Lontoa (ZMB Moll. 103005), section of siphons; B. С possoensis, (ZMB Moll. 190024), siphons from 
inside; С С. possoensis (ZMB Moll. 190024), section of siphons; D. С loehensis, Lake Masapi (ZMB 
Moll. 103010), gill with incubated larvae from outside; E. С possoensis (ZMB Moll. 190024), anterior 
portion of gill from inside (inner demibranch partly removed). Scale bars = 1mm. 



small specimens of С possoensis, but can 
be readily distinguished by the size of the ad- 
ductors (see below). The corbiculids from 
Lake Mahalona are more elongated (espe- 
cially posterior part) and flat (see Fig. 9E, 
Table 2). However, variation within one and 
the same lake (Matano) is also considerable 
(Fig. lie, D, Table 2). 

In features of reproductive biology (i.e., in 
presence of sperm and eggs in different ani- 
mals, sperm morphology and mode of 
brooding) this species is similar to C. 
moltkiana from Sumatra. 

Corbicula loehensis Kruimel, 1913 
Figs. 8E, 14 A, B, 15, 16 A, D 

Corbicula loehensis Kruimel, 1913: 232, pi. 4, 
figs. 2, 3; Djajasasmita, 1975: 84, fig. 3; 
Djajasasmita, 1977: 4. 



Corbicula masapensis Kruimel, 1913: 232, pi. 
4, fig. 1. 

Corbicula subplanata Martens (part.) - 
Prashad, 1930: 203, pi. 26, figs. 11-12. 

Type Locality: SE shore of Loeha Island, Lake 
Towuti. 

Type Material: syntypes ZMA [vidi]. 

Other Material Examined: Sulawesi: Lake 
Masapi: S shore (02°50.84'S, 121°21.09'E) 
(ZMB Moll. 103011w; leg. Brinkmann & 
Rintelen, 30 March 2000); Lake Masapi, local- 
ity not specified (ZMB Moll. 103010w; leg. 
Bouchet, 1991). Lake Lontoa (= Wawontoa): 
SW shore (02°39.6'S, 12Г44.8'Е) (ZMB 
Moll. 103005w; leg. BoucheL October 1991); 
W shore (02°39.90'S, 121°43.46'E) (ZMB 
Moll. 103033w; leg. Brinkmann & Rintelen, 
Mar 2000) (Fig. 1). 

Taxonomic remarks: Djajasasmita (1975) 
synonymised C. masapensis with С 



FRESHWATER CORBICULIDAE FROM INDONESIA 



27 



loehensis. This point of view is tentatively ac- 
cepted here, but we suggest to study Lake 
Towuti populations carefully before a final de- 
cision on the taxonomic status of the forms 
under consideration is possible. Identity of 
the form present in Lake Lontoa to С 
loehensis was first shown by Djajasasmita 
(1975). 

Description 

Shell: Round to ovate, with somewhat obtuse 
posterior edge (Fig. 14A, B). Periostracum 
yellow in specimens from Lake Masapi and 
dark violet in those from Lake Lontoa, with 
silky glitter. Internal coloration white and 
purple, respectively. Beaks subcentral. 
Sculpture very fine, formed by delicate ribs 
(30-40 per 1 cm). Hinge plate moderately 
broad; cardinal teeth delicate; laterals rela- 
tively short, straight. The largest examined 
specimen was 18 mm long, but according to 
literature data the species may reach a 
length of 25 mm (Djajasasmita, 1975). 

Anatomy: Adductors small, oval (Fig. 15A, 
Table 2). Siphons cylindrical, rather thin- 
walled, with broad oval apertures, inhalant si- 
phon somewhat broader than exhalant, with 
about 50 papillae arranged in two rows. Inter- 
nal surface of siphons, papillae and 
presiphonal suture usually strongly pig- 
mented (Figs. 15B, C, 16A). Marginal mantle 
papillae small, widely spaced. Mantle muscu- 
lature weak, muscle bundles well distin- 
guishable and separated. 

Reproductive biology: Gonads of the dissected 
animals contained either sperm or eggs. 
Spermatozoa monoflagellate, head length 9.1 
± 0.21 |.im (n = 7). The largest of the studied 
specimens was brooding. Larvae located in 
its inner demibranchs (Fig. 16D) were about 
0.24 mm. 

Distribution: Recorded ashore in Lake Towuti 
(Kruimel, 1913; Djajasasmita, 1975) and its 
satellite lakes Masapi and Lontoa. 

Remarks: Anatomical characters of С 
loehensis and С matannensis are similar 
(Table 3), as well as are juvenile shells. How- 
ever, the characters of juvenile shells in the 
former species (very fine sculpture and deli- 
cate hinge) are also retained in more ad- 
vanced individuals of the latter species, 
which might indicate distinct developmental 
trends. Differences in coloration between the 
shells from Lakes Masapi and Lontoa are 
also noteworthy. 



This species is similar in features of repro- 
ductive biology (structure of gonads, sperm 
type and mode of brooding) to С moltkiana 
and C. matannensis, but differs in having sig- 
nificantly smaller spermatozoa (p < 0.001 ). 

Corbicula possoensis P. Sarasin & F. 

Sarasin, 1898 
Figs. 7D, 8F-G, 140, D; 16B, C, E; 17 

Corbicula possoensis P. Sarasin & F. Sarasin, 
1898:92, pi. 11, figs. 161-162; Kruimel, 1913: 
231. 

Corbicula subplanata Martens (part.) - 
Prashad, 1930: 203, pi. 26, figs. 10, 17-20. 

Corbicula matannensis P. Sarasin & F. Sarasin 
(part.) - Djajasasmita, 1975: 84; 
Djajasasmita, 1977: 4. 

Type Locality: Lake Poso, Sulawesi. 

Type Material: syntype ZMB Moll. 50798 (Fig. 
140). 

Other Matenal Examined: Lake Poso: S shore, 
Tentena, beach at Hotel "Pamona Indah" 
(0r45.92'S, 120°38.42'E) (ZMB Moll. 
190024w; leg. Glaubrecht & Rintelen, Sep- 
tember 1999); at Hotel "Mulia" (02°03.9rS, 
120°41.50'E) (ZMB Moll. 103028w; leg. 
Brinkmann & Rintelen 23 September 2000); 
SW shore, Matawai (02°02.4'S, 120°38.ГЕ) 
(ZMB Moll. 103012w; leg. Bouchet, Septem- 
ber 1991); E shore, Tolambo Bay (0r59.8'S, 
120°42.1'E) (ZMB Moll. 103013w; leg. 
Bouchet, 1991); N shore, Saluopa 
(0r46.6'S, 120°32.9'E) (ZMB Moll. 103014w; 
leg. BoucheL 1991) (Fig. 1). 

Description 

Shell: Triangular or short tetragonal, often with 
blunt keel at posterior end (Fig. 140, D). 
Periostracum dark violet to black, some- 
times yellowish in very young specimens, 
shiny. Internal coloration purple. Posterior 
margin truncate (diagnostic feature). Beaks 
markedly shifted fon/vard, in small specimens 
relatively narrow while in large ones this can 
not be seen because shells are eroded. 
Hinge plate relatively broad, even in young 
specimens. Oardinal teeth well developed; 
lateral teeth somewhat shortened, straight. 
Sculpture: 25 30 delicate ribs per 1 cm. 

Anatomy: Adductors large, posterior larger 
than anterior one (Figs. 14, 17A). Diameter of 
posterior adductor more that V^. length of shell 
(Table 2). Presiphonal suture relatively short, 
not exceeding diameter of inhalant siphon. 



28 



GLAUBRECHTETAL. 




В 




IíJ^^^^^-ЯЛЛJí^ 




FIG. 17. Anatomy of Corbicula possoensis, Lake Poso: A. Habitus of soft body (ZMB Moll. 103014); B. 
Siphons from outside (ZMB Moll. 190024); С Papillae of inhalant (ZMB Moll. 190024); D. Marginal 
mantle papillae (ZMB Moll. 190024). Scale bars = 1 mm (C and D to same scale). 



Siphons broad, cylindrical, inhalant siphon 
markedly broader than exhalant, both with 
slit-like apertures; inhalant siphon with 60 to 
70 papillae (depending on age), arranged in 
one or two rows (papillae of outer row al- 
ways relatively smaller) (Figs. 168, C, 17A, 
B). Both inner and outer surface of siphons 
and papillae densely pigmented, presiphonal 
suture also pigmented internally. Papillae on 
the outer surface of presiphonal suture 
scarce, unevenly arranged (Fig. 17B). Mar- 
ginal mantle papillae small and widely 
spaced (Fig. 17D). Mantle musculature 
weak, muscle bundles separated, dispersed 
(Fig. 7D). 
Reproductive Biology: Gonads of the dis- 
sected animals contained either sperm or 
eggs. Spermatozoa monoflagellate, head 
length 10.7 ± 0.37 |.im (n = 6). Branchial incu- 
bation was observed in two samples contain- 



ing larger specimens (exceeding 18 mm); 6 
of 15 dissected specimens were brooding 
and contained larvae in both demibranchs of 
each gill (Figs. 16E), one gravid specimen 
had larvae in inner demibranch only, though. 
Larvae were 0.26-0.30 mm long. 

Distribution: Restricted to Lake Poso in Central 
Sulawesi. 

Remarks: Conchologically, this species is dis- 
tinguished from С matannensis by its trun- 
cate posterior edge, fine sculpture (more 
than 20 ribs per 10 mm) and larger posterior 
adductor scar (Table 3). Beaks in large shells 
are somewhat broader and placed more an- 
teriorly than in all previous species; also the 
hinge plate is relatively higher. Corbicula pos- 
soensis differs from C. matannensis also in 
having broad siphons extending over about 
V3 of the body length in the former and V^ in 
the latter species. Differences in relative 



FRESHWATER CORBICULIDAE FROM INDONESIA 



29 



height of hinge plate, adductor size, siphons 
breadth and number of ribs were confirmed 
by t-test (p < 0.001 ). These diagnostic char- 
acters were consistent among all examined 
specimens, which is, in concert with our mo- 
lecular data, the argument against synony- 
mization of С possoensis with C. matannensis 
as was earlier on suggested by Djajasasmita 
(1975). 

Corbicula possoensis differs from other stud- 
ied congeners in characteristics of brooding, 
because it is the only Corbicula species 
known that incubates in both demibranchs, 
instead of only the inner demibranch. Slight 
but significant (p < 0.05) difference in sperm 
size between this taxon and C. matannensis 
is also noteworthy. Other reproductive fea- 
tures of C. possoensis are similar to those 
shown for the taxa from Sumatra and 
Sulawesi (Table 3). 



MOLECULAR PHYLOGENETICS 

Of a total of 614 base pairs included in the fi- 
nal alignment, 103 were parsimoniously infor- 
mative. Heuristic search recovered 56 most 
parsimonious trees of 368 steps (CI = 0.742, 
Rl = 0.685). The strict consensus tree (Fig. 18) 
shows that all newly sequenced taxa included 
in the present molecular study form a well sup- 
ported monophyletic clade with those freshwa- 
ter taxa of Corbicula studied earlier, with the 
exception of С madagascariensis. Within this 
clade three distinct Indonesian taxa are sup- 
ported in this study, occuring (i) on Sumatra, 
identified as C. moltkiana, and (ii) on Sulawesi 
with C. matannensis and C. loehensis from 
the Malili lake system. In addition, two different 
sequences with unresolved relationships were 
obtained from specimens identified morphologi- 
cally as C. possoensis from Lake Poso. Fur- 
thermore, one other of the Indonesian taxa, С. 
javanica, is shown in the parsimony analysis 
as closely related to С fluminea from Korea 
and the North American Corbicula "form B", a 
clade that is also well supported. The second 
sequence attributed to С fluminea, originating 
from material from Thailand, a sequence of С 
australis from Australian, and C. cf. fluminalis 
from Israel is also clustering with this clade; 
however, the bootstrap support for the joint 
group is weak. 

The NJ tree (Fig. 19) is more resolved than 
the consensus tree recovered by the maximum 
parsimony analysis, but the clades supported 



by high bootstrap values are basically the 
same in both reconstructions. The two differ- 
ent morphotypes of C. moltkiana from Lake 
Manindjau cluster together, as well as the two 
different morphotypes from Lake Singkarak, ir- 
respective of the morphological similarity be- 
tween the corresponding morphotypes found in 
each of the two takes; thus, the four samples 
from Sumatra cluster according to geography 
instead of morphology. The NJ analysis also 
indicates an outstanding position of С 
moltkiana and a sister relationship between С 
loehensis and С matannensis, although the 
support of the relevant clades is below the 50% 
level. Heterogeneity of C. possoensis is found 
in this analysis as well. 

Distance analyses show remarkable similar- 
ity in COI sequences (divergence levels not 
exceeding 1%) between the samples from the 
adjacent lakes Manindjau and Singkarak on 
Sumatra, as well Matano and Mahalona on 
Sulawesi (Table 4). The divergence between 
sequences obtained from different samples in 
Lake Matano was approximately of the same 
level as the difference between the samples 
from Matano and Mahalona. Only minor differ- 
ences were recovered for C. loehensis from 
Masapi and Lontoa, while divergence level be- 
tween this taxon and С matannensis reaches 
3.5%. The distance between two sequences of 
C. possoensis comprised 3.8%. Most of the 
pairwise sequence divergence levels calcu- 
lated for the freshwater Corbicula taxa by this 
study did not exceed the level of 4.1 % reported 
by Siripattrawan et al. (2000); only С. moltkiana 
showed greater distances, especially when 
compared with C. possoensis (up to 5.7%) and 
С australis (up to 5.2%). 

In conclusion, the molecular data agree with 
the morphological comparisons presented 
above in showing (i) distinctness of three 
lacustrine taxa from Sumatra (C. moltkiana) 
and Sulawesi (C. matannensis and C. 
loehensis), respectively, (ii) distinctness of 
these Indonesian taxa with respect to known 
continental Asian lineages, and (iii)the relation- 
ship of C. javanica and C. fluminea. However, 
the results concerning C. possoensis are 
equivocal, because no morphological charac- 
ters correlated with the observed sequence 
differences were found. Plotting sperm mor- 
phology data on the trees based on COI se- 
quence data suggests polyphyletic origin of the 
biflagellate condition, since no close relation- 
ship between the lineages sharing this state 
could be found. 



30 



GLAUBRECHTETAL. 



100 



84 



93 



99 



73 



51 



100 



100 



70 



Polymesoda caroliniana 

Neocorbicula limosa 

Corbicula japónica, Japan 

С madagascahensis, Madagascar 

С. possoensis, Poso (1 ) I 

С. possoensis, Poso (2) | 

С. sandai, Biwa 

С. loehensis, Masapi 

С. loehensis, Lontoa 

C. matannensis, Matano (2) 

С matannensis, Matano (1) 

С matannensis, Mahalona (3) 

C. /eana, Japan 

Corbicula "form A", USA 

C. fluminea, China 

С moltkiana, Singkarak (1) 

C. moltkiana, Singkarak (2) 

C. moltkiana, Manindjau (3) 

■ C. moltkiana, Manindjau (4) 
. С australis, NSW 

• C. fluminea, Thailand 

■ С fluminalis?, Israel 

■ C. javanica, Java 

■ С fluminea, Korea 

• Corbicula "form B", USA 



I Sulawesi 
P Japan 



Sulawesi 



Asia 



Sumatra 



[j Australia 



Asia 



FIG. 18. Strict consensus of 56 maximum parsimony trees (368 steps, CI = 0,742, Rl = 0.685) 
obtained for the corbiculid CO! extended dataset. The numbers below branches show bootstrap 
support (if more than 50%). 



FRESHWATER CORBICULIDAE FROM INDONESIA 



31 



Polymesoda caroliniana 



100 



96 



100 



— 0.01 substitutions/site 



Neocorbicula limosa 

Corbicuia japónica, Japan 

С madagascariensis, Madagascar 

С moltkiana, Singkarak (1) j 

С moltkiana, Singkarak (2) | 

- С moltkiana, Manindjau (3) | 

C. moltkiana, Manindjau (4) ,; 

C. possoensis, Poso (2) 

Corbicuia "form A", USA 

С leana, Japan 

L С fluminea, China 

С australis, NSW 



100 
51 



100 



99 



— С fluminea, Thailand 

— C. fluminalis?, Israel 
Corbicuia "form B", USA 
C.javanica, Java 

C. fluminea, Korea 
C. sandai, Biwa 

— С possoensis, Poso (1) 



77 
69 



С. loehensis, Masapi 

L C. loehensis, Lontoa 

100 

— С matannensis, Matano (2) 
г С. matannensis, Matano (1) 

- С matannensis, Mahalona (3) 



Sumatra 



I Sulawesi 

I Asia 

« 

I 

[] Australia 

Asia 
[] Japan 



Sulawesi 



FIG. 1 9. A neighbor joining tree obtained for the corbiculid CO! extended dataset. The numbers below 
branches show bootstrap support (if more than 50%). 



32 



GLAUBRECHTETAL 



а) хз 
.£ß 
го^ 

о с 
ел Ш 
О) > 
О- оз 

р 

о о 

о 2 



ф 


« 


тз 


ф 


о 


^ 


Е 


Е 


ш 


3 


хз 


Z 


w 


_^-:^ 




ел 


ф 


со 


> 


о 


ф 




о: 


ф 


ф 


Е 


Е< 


i- 


ф 






го 






о 


ф 




с 


тз 


ф 


ф 


CD 


о 




3 


(Л 

Ф 


тз 
о 


о 




с 


с 


ф 




СП 


ф 




ся 


ф 


о 


>^ 






тз 


Q- 


ф 


с 


о 




с 


тз 


ф 


3 


13 


о 


CT 


X 


ф 


ф 



Q. 


:^ 


тз 


ев 


(1) 


Ci 


о 


.о 


ф.С 


Í— 


(Ч 


о 

о 


о 


■^ 


ф 






ш 


(- 


ш 


(Л 


< 


ф 



00 



со 



со to ,^ 
Ç 5 го со' 



ССт- (tj'cNJ CD £2. ce 5^^ 

cD^cD^ctj^cD^C-^ScMSro-';^-' 

^ го ^ го è -^è ^-2 о -2 о 2 5 ^ 5.-С 

çcrorororororo 



с 


с 


CD 


^ CD СП CD CD 




со 


fÑT <i^ 


Cb 


о 


CD Ф С CU CD 


., , 


•^ 


Cío 
ro со 


о 

со 
со 


5 


flumin 

ael 

flumin 

ng Ko 

flumin 

ailand 

flumin 

rea 

leana 




2 

00 


O o 

с Ci. 


о 
о. 


CD 
СО 


3 

CD 


о 






.1- о .с о 






^O 


о 


о 


о «OXOI-O^O 


О 


о 


сэ 


^ 


c\i 


со -^ LT) CD Г-- 


00 


СП 



























1 


со 
о 


го 
го 


оо 
со 


а> 




























со 


гч 


сч 


со 
























. 


гч 
со 


СП 

со 


со 
со 


СП 

со 


со 


























^ 


сч 


^ 


сч 


со 






















, 


о 

СП 


CD 

гч 


ю 


ю 


in 
о 


сч 
1^ 
























Csi 


со 


-- 


со 


^ 


со 




















, 


in 


со 
со 


со 
со 


см 
о 


го 


оо 
го 


о 






















со 


-- 


сч 


го 


го 


го 


t-~^ 


















, 


со 
со 


СП 

о 


CD 


СП 


со 

00 


см 

со 


со 

со 


со 
со 




















^ 


со 


о 


^" 


сч 


^' 


Гч] 


со 
















1 




СП 
СП 


см 


00 

гч 


CD 


о 


гч 


го 


со 


















го 


со 


^ 


со 


со 


'чГ 


го 


^ 


г- 














1 


со 

со 


ю 
о 


m 
in 


го 

00 


00 
00 




in 


in 

00 


СП 


о 
















со 


го 


со 


со 


CnÍ 


со 


го 


гч 


со 


00 












, 


00 

о 


in 
in 


00 

го 


in 

OJ 


сч 


сч 


О) 


со 
ю 


о 
гч 


сч 
со 


о 

00 














го 


со 


CSJ 


со 


гм 


сч 


сч 


сч 


гч 


со 


со 










, 


г-- 


со 
оо 


со 


сзз 


ю 
о 


in 


сч 
о 


о 


го 


о 


•^ 


1^ 












о 


CNÍ 


со 


Cvj 


со 


сч 


сч 


гч 


сч 


гч 


^ 


со 








, 


со 


CNJ 


00 
00 


со 


г^ 


го 
о 


а> 


о 
о 


CJ3 
CD 


о 
1^ 


о 
о 


00 

со 


h- 










^ 


^ 


rsi 


со 


сч 


со 


сч 


сч 


гч 


сч 


гч 


со 


CD 






. 


СП 
СП 


о 


CN 


CD 
00 


CD 


гч 

in 


со 
со 


сч 


со 


о 


о 


со 


со 
о 










сз 


Csi 


см 


CM 


со 


сч 


со 


го 


сч 


го 


го 


см 


со 


1^ 




. 


СП 
СП 


со 
со 


со 




Г-- 


о 

со 


г^ 


со 
о 


СП 


о 
о 


оз 
со 


о 
1^ 


о 
о 


00 

со 


;: 






сЬ 


о 


^ 


^ 


Гч] 


со 


Гч1 


со 


гм 


сч 


гч 


гч 


гч 


со 


Г-- 


1 


СП 


CD 


СП 
CNJ 


CD 
СП 


г^ 




со 
о 


Сч| 


00 

сч 


со 
см 


гч 


гч 
гч 


гч 


СП 


со 
о 


1^ 




м^ 


'^ 


'í 


со 


■^ 


cri 


^ 


го 


■^ 


■^ 


со 


со 


^ 


со 


in 


г-^ 


CD 


оо 


со 
со 


оо 


00 


сзз 

СП 




см 


о 

CD 


CD 


го 


сч 


о 


in 


со 

СП 


сч 
сч 


оо 

СП 


О 


^ 


^ 


^ 


го 


го 


ю 


^ 


го 


■^ 


■^ 


со 


го 


■^ 


го 


in 


г- 


'^ о 
1 со ю 


о 


CD 


о 


СЗ) 
CD 


о 

СП 


СП 
CD 


о 


гч 
in 


00 

со 


ю 


го 
го 


о 
го 


го 


in 
оо 


со 


сп 

СП 


о о 


'^ 


^ 


^ 


го 


го" 


in 


^ 


со 


^ 


^ 


го 


го 


^ 


со 


ю 


1^ 


1^ CD со 
-^ т- со 


СП 

см 


CD 


СП 

см 


о 

CD 


оо 


in 
ю 


со 
о 


гм 


со 

гч 


со 
гч 


гч 


гч 
см 


см 


in 


со 
о 


t^ 
г- 


о сЬ о 


■^ 


'чГ 


м^ 


со 


со 


in 


•^ 


со 


■^ 


■^ 


со 


го 


'ñT 


го 


ю 


г^ 



03 
CD 

TD СО 

CD С 

р .С13 

г < CD 

О о 



FRESHWATER CORBICULIDAE FROM INDONESIA 



33 



DISCUSSION 
Taxonomy and Systematics 

Previous phylogenetic investigations sug- 
gested a common, monophyletic origin of all 
Old World freshwater Corbicula, with the es- 
tuarine C. japónica being the sister taxon 
(Siripattrawan et al., 2000; Pfenninger et al., 
2002). This is confirmed in the present study 
by the inclusion of new sequence data from In- 
donesian taxa. 

In an attempt to clarify the systematics of 
these Indonesian corbiculids, mainly of those 
species inhabiting Sumatra and Sulawesi, five 
taxa were found to possess specific distinct- 
ness and identity, based on shell morphology, 
anatomy and the features of reproductive biol- 
ogy (including brooding), as well as on molecu- 
lar data. While the corbiculids studied from 
Sumatra are identified as С moltkiana, four 
distinct taxa were identified on Sulawesi: C. 
possoensis (with two distinct lineages revealed 
in the NJ analysis) endemic to Lake Poso and 
С matannensis plus С loehensls occurring in 
the central Malili lake system. Suitable material 
of the fourth species, С linduensis from the 
Lindu River, was not available for molecular in- 
vestigation. 

The species distinctness of С javanica from 
the island of Java remains doubtful in the ab- 
sence of data on sperm morphology and, thus, 
there is the possibility of clonality. Remarkable 
is its close affinity to Asian lineages of C. 
fluminea found in our study. However, the taxo- 
nomic status of the latter is also problematic, 
because it was shown to be an assemblage of 
several clonal lineages, probably of different 
origin, that also includes allochthonous popula- 
tions introduced into North America and Eu- 
rope (Siripattrawan et al., 2000; Pfenninger et 
al., 2002). Therefore, any synonymizations in 
this stage of investigation seem to be prema- 
ture. 

Corbicula taxonomy has historically been 
plagued by a plethora of nominal taxa de- 
scribed from numerous, at least partly 
ecophenotypic shell morphs. The occurrence 
of polyploidy, unisexual reproduction, hermaph- 
roditism, and androgenesis recently reported 
for certain Corbicula populations (see Introduc- 
tion) suggest that variation observed in these 
freshwater bivalvia could be the result of 
clonality and not necessarily imply species level 
differences, as discussed in Siripattrawan et 
al. (2000). Because polyploidy is prevalent in 



some freshwater molluscs, especially among 
bivalves, it is assumed to have played an im- 
portant role in shaping their diversity and can 
pose significant challenges to reconstruct phy- 
logenetic evolution also in Corbiculidae (Lee et 
al., 2002). 

While the determination of presence or ab- 
sence of meiosis is a rather laborious task ap- 
plicable only in adequately fixed material, 
fortunately in Corbicula there is an exception- 
ally convenient morphological marker to help 
distinguish clonal forms, since, to the present 
knowledge, studied ameiotic lineages all have 
biflagellate spermatozoa (Komaru & Konishi, 
1999; Siripattrawan et al., 2000; Qiu et al., 
2001). Our preliminary observations suggest 
that Indonesian corbiculids reproduce sexually 
and have monoflagellate spermatozoa (with the 
exception of С javanica, in which sperm 
structure remains unknown). In this respect, 
they appear to be similar to C. sandal from the 
"ancient" Lake Biwa in Japan, which is known 
to be diploid and reproduces sexually with 
monoflagellate sperm (Hurukawa & Mitsumoto, 
1953; Okamoto & Arimoto, 1986). Interestingly, 
our NJ analysis revealed that С sandal clus- 
ters together with the Sulawesi clade, whereas 
the topology of the MP tree is not resolved in 
this respect. 

Given the notorious variability of morphologi- 
cal characters applied traditionally in Corbicula 
taxonomy, which is also shown in this study, 
and the incompleteness of data on reproduc- 
tive biology as well as molecular genetics, any 
final decision about the systematics and taxo- 
nomic status of different forms (morphotypes) 
distributed across Australasia is still not pos- 
sible. Uncertainties remain in particular for the 
Javanese form and the question concerning the 
existence, distribution and identity of С 
fluminea. However, several of our systematic 
conclusions based on the new data on Indone- 
sian taxa are in agreement with some of those 
already reached in previous revisions, mainly 
those by Djajasasmita (1975, 1977). 

Implications from Morphology 

Generally, confirming the presence of en- 
demic taxa in several lacustrine habitats on 
Sumatra and Sulawesi, this study adds sup- 
port to the recognition of the following taxa: С. 
moltkiana, С. linduensis, С. possoensis, С. 
matannensis and C. loehensis. The first of 
these taxa recorded in the lakes on Sumatra is 
similar to the widely distributed Asian C. 



34 



GLAUBRECHTETAL. 



fluminea (Britton & Morton, 1979; Morton, 1986; 
Araujo et al., 1993; Chen et al., 1995; Harada & 
Nishino, 1995; Komaru et al., 1997, 2000), in 
anatomical characters and the features of 
brooding; however, its species status is sup- 
ported by sperm morphology and COI se- 
quence data. 

Taxonomic distinctness of Corbicula 
linduensis from North Sulawesi, first suggested 
by Djajasasmita (1975), is supported here by 
characteristics of brooding (limited number of 
large juveniles incubated in gills) not known in 
any other Corbicula. However, in the absence 
of molecular data for this taxon, its relation- 
ships remain unknown. Noteworthy, brooding in 
C. linduensis seems to be somewhat similar to 
the South American Neocorbicula limosa, as 
described by Ituarte (1994). Since the latter rep- 
resents an independent lineage within the fam- 
ily, judging from morphological study (Dreher 
Mansur & Meier-Brook, 2000) and molecular 
data (Siripattrawan et al., 2000; Figs. 18, 19), 
its mode of reproduction has apparently 
evolved independently. 

The taxa inhabiting the Malili lake system on 
Sulawesi differ from their congeners not only in 
shell parameters, but also in anatomical char- 
acters, for example in the form and pigmenta- 
tion of siphons. Although diagnostic 
applications of these characters in Corbicula is 
hindered by the considerable intraspecific vari- 
ability (see, for example, the description of C. 
moltkiana), in this particular case anatomical 
differences are supported by molecular data. 
As shown in this study, the distinctness of C. 
matannensis occurring in Lake Matano and 
Lake Mahalona (connected through the Petea 
River; Fig. 1) from С loehensis inhabiting the 
satellite lakes Masapi and Lontoa of Lake 
Towuti (but both connected via separate river 
systems) is in agreement with the taxonomy 
used by Djajasasmita (1975). Unfortunately, no 
molecular data are available to date for the lat- 
ter species from Lake Towuti proper, where 
both taxa possibly live sympatrically according 
to Djajasasmita (1975). 

The data on С possoensis restricted to Lake 
Poso are controversial. While morphological 
observations show similarity of all available 
lots, molecular data suggest their heterogene- 
ity. Although Corbicula from Lake Poso appar- 
ently needs further study, the outstanding 
position of С possoensis in relation to 
corbiculids inhabiting the Malili lake system 
found in the present study is consistent with 
recent results on endemic pachychilid gastro- 



pods from Lake Poso, which exhibit a similar 
isolated position among the Tylomelania clade 
in morphological and molecular phylogenies 
(Rintelen & Glaubrecht, 1999, 2002; Rintelen et 
al., submitted). 

Some anatomical characters, for example 
the broad cylindrical (fringe-like) form of si- 
phons and the number and arrangement of the 
exhalant siphon papillae, which are common in 
Corbicula species inhabiting Lake Poso and the 
Malili Lakes on Sulawesi were also reported for 
the Japanese estuarine species С japónica 
(Harada & Nishino, 1995). However, the internal 
coloration of siphons and papillae is remarkably 
similar in all Sulawesi taxa but differ from that 
of С japónica, which is also very distinct 
karyologically (Okamoto & Arimoto, 1986), in its 
non-brooding reproduction (reviewed by 
Morton, 1986) and its molecular genetics 
(Siripattrawan et al., 2000). Therefore, any 
similarity in form of siphons between the fresh- 
water corbiculids in question and their probable 
estuarine sister taxon are unlikely to be 
synapomorphic. 

Spermatozoan Morphology 

The new data on sperm morphology shown 
here for Indonesian taxa suggest that 
monoflagellate spermatozoa are more com- 
mon among freshwater Corbicula than as- 
sumed in previous studies (Komaru & Konishi, 
1996, 1999; Byrne et al., 2000; Sihpattrawan et 
al., 2000). Interestingly, the monoflagellate type 
is known to occur in species inhabiting lacus- 
trine habitats, such as, for example, Lake Biwa 
in Japan (C. sandal), lakes Singkarak and 
Manindjau on Sumatra (C. moltkiana). Lake 
Poso (С. possoensis) and the Malili lake sys- 
tem (C. matannensis, С loehensis) on 
Sulawesi. 

In addition, while all Corbicula with biflagellate 
spermatozoa are simultaneous hermaphro- 
dites (Komaru & Konishi, 1996, 1999; Konishi 
et al., 1 998; Byrne et al., 2000), the Indonesian 
corbiculids with monoflagellate sperm appar- 
ently have a different expression of sexuality. 
Since monoflagellate sperm is reported for the 
gonochoric Corbicula sandal (Siripattrawan et 
al., 2000, and literature cited therein), we hy- 
pothesize that the Indonesian taxa also have 
separate sexes. 

However, sperm morphology of many riverine 
corbiculids, especially those occurring on other 
Sunda Islands, is still not studied; therefore, it 
is too early to judge on this habitat-sperm mor- 



FRESHWATER CORBICULIDAE FROM INDONESIA 



35 



phology correlation. Our phylogenetic recon- 
struction does also not reveal a close relation- 
ship between lineages sharing the biflagellate 
type of sperm, because the latter occurs in 
clonal Corbicula within both Asian clades found 
in the analyses (Figs. 18, 19). 

The diversity of head size in spermatozoa of 
Corbicula is remarkable, although no correla- 
tion between size and the monoflagellate/bi- 
flagellate type was found. The biflagellate 
spermatozoa of the Chinese C. fluminea and 
Japanese С leana are distinguishable by their 
large size of 16-25 |.im (Komaru & Konishi, 
1996; Qiu et al., 2001), whereas biflagellate 
spermatozoa of C. australis are relatively small 
with 9.3 |.im on average (Byrne et al., 2000). 
The latter are, thus, similar in size to the 
monoflagellate spermatozoa found here for С 
loehensis (9.1 |.im). Biflagellate spermatozoa of 
another Japanese form, C. aff. fluminea, are 
reported to be also relatively small compared 
with the sympatric С leana (13.9 |.im and 16.9 
).im, respectively) (Konishi et al., 1998). Size 
difference in corbiculid sperm observed in taxa 
from China was found to be correlated with 
ploidy (Qiu et al., 2001 ) and in taxa from Japan 
with number of mitochondria (Konishi et al., 
1998). 

Brooding 

Observations presented above on reproduc- 
tion in Indonesian corbiculids agree with the lit- 
erature data in showing prevalence of brooding 
among freshwater Corbicula (Morton, 1986; 
Byrne et al., 2000; Siripattrawan et al., 2000). To 
date, within the genus only the estuarine (i.e., 
brackish-water) sister taxon С japónica is 
non-brooding and characterized by the devel- 
opment with free-swimming veligers (Byun & 
Chung, 2001). Among the freshwater 
corbiculids the endemic С sandai from Lake 
Biwa with its benthic egg masses with direct 
developing young (Hurukawa & Mitsumoto, 
1953) remains the only known exception of an 
ovoviviparous reproductive mode. 

However, we here documented a greater di- 
versity of brooding characteristics in taxa 
particulahly from Sulawesi than was witnessed 
earlier for the rest of the collective Old World 
range of Corbicula. Remarkable is the pres- 
ence of large juveniles being incubated in the 
gills of C. linduensis and the brooding utilizing 
both demibranchs in С possoensis, which is 
both not known in any other congeners. 



Historical Zoogeography 

According to the phylogenetic systematics 
discussed above, two groups of taxa can be 
distinguished among Indonesian corbiculids. 
On one hand, there is at least one common 
widespread clade in Asia that includes popula- 
tions identified as С fluminea occuring in Ko- 
rea and Thailand, as well as those populations 
from the Sunda Islands Java and Lombok as- 
signed here tentatively to С javanica and С 
australis in Australia. 

On the other hand, Sumatra and Sulawesi 
seem to harbour Corbicula species with fairly 
restricted occurrences that cluster according 
to their distribution not only on but within these 
islands. To the present knowledge, all lacustrine 
forms described herein are endemic to their 
respective lakes and lake systems with three 
separate regions to be distinguished (Fig. 1 ): (i) 
Northwest Sulawesi with the graben or basin of 
the Palu River and Lake Lindu where С 
linduensis occurs, (ii) Lake Poso with the en- 
demic C. possoensis, and (iii) the central lakes 
of the Malili system with C. matannensis 
(mainly in Lake Matano and Lake Mahalona) 
and С loetiensis (in the satellite lakes of and in 
Lake Towuti). Another species, С subplanata 
was described based on shells only from a 
fourth region in southwest Sulawesi (area of 
Minralang), but its specific identity and status 
remains to be substantiated by anatomical and 
molecular data. In contrast, sampling on 
Sumatra is to date too scarce to allow for any 
solid judgement of an equally restricted occur- 
rence of С moltkiana in lakes Manindjau and 
Singkarak only. In addition, the specific identity 
and affinity of C. tobae endemic to Lake Toba in 
northern Sumatra remains unresolved. 

The pattern of endemic occurrences of 
lacustrine corbiculids strongly correlates with 
the distribution recently studied in detail for 
pachychilid gastropods of the endemic 
Tylomelania clade on Sulawesi (Rintelen & 
Glaubrecht, 1999, 2002; Rintelen et al., submit- 
ted), as well as with the biogeography of Indo- 
nesian Ancylidae (Glaubrecht, unpub. data), 
and is, therefore, no artefact of insufficient data 
on the range of limnic molluscs in Southeast 
Asia. In case of the evolution of endemic 
corbiculid bivalves in separate areas within the 
geologically complex island of Sulawesi, it re- 
mains to be tested, based on further sampling 
and detailed molecular studies, whether this 
biogeographic pattern finds its historical expia- 



36 



GLAUBRECHTETAL. 



nation in the spatial isolation over longer geo- 
logical time in concert with the composite na- 
ture of this odd shaped island that formed by 
fusion of several microplates (terranes) in Late 
Miocene-Early Pliocene (palaeogeographical 
background: Whitmore, 1981; Hall & Bundell, 
1996; Metclafeetal.,2001). 

Using other limnic molluscs as models, it has 
recently been hypothesized that, for example, 
the phylogeny and biogeography of pachychilid 
gastropods of Brotia, sensu lato, in Southeast 
and Austral Asia reflect palaeogeographical 
events since the Cretaceous/Cenozoic rather 
than more recent geological history 
(Glaubrecht, 2000; Glaubrecht & Rintelen, 
2003; Köhler et al., 2000; Köhler & Glaubrecht, 
2001 , 2003). The latter comprise, for example, 
those events related to the formation of 
Sundaland and its drowning during the Plio- 
Pleistocene. Accordingly, the distribution of 
taxa of the Brotia, sensu lato, complex might 
represent an ancient vicahance pattern caused 
by plate and terrane tectonics that has not 
been obscured subsequently, presumably due 
to comparatively restricted dispersal abilities of 
these viviparous snails in conjunction with eco- 
logical factors. 

In contrast, the available evidence in case of 
the East Asian and Australian freshwater 
corbiculids was regarded incompatible with an 
ancient vicariance scenario. Above all, an as- 
sumed late Cenozoic origin of freshwater Cor- 
bicula restrict applicability of the studied group 
as indicator of a long and complex geological 
history and biogeography within the so-called 
"Wallacea" (as transitional zone between the 
Australian and Oriental region). Second, the 
mitochondrial COI sequences generated for 
those corbiculids collectively distributed from 
the Japanese Archipelago to Australia indicated 
a phylogenetically shallow polytomy, suggesting 
an evolutionary recent common origin to 
Siripattrawan et al. (2000) and Pfenninger et al. 
(2002). Showing rather low levels of genetic 
distances between different lineages of Asian 
freshwater Corbicula, our analyses including 
now the Indonesian taxa in general support this 
scenario of rather late divergence of freshwater 
lineages. Nevertheless, the higher sequence 
distances in particular shown by C. moltkiana 
on Sumatra may indicate that this divergence 
started earlier than Pleistocene age suggested 
by Pfenninger et al. (2002). 

In summary, three statements of biogeo- 
graphical importance are implied by the 
present study: (i) presence of distinct and, in 



relation to other Asian forms, old taxa on 
Sumatra and Sulawesi, (ii) a remarkable diver- 
sity of Corbicula on the island of Sulawesi with 
at least three distinct lineages and taxa, re- 
spectively, and (iii) presumably a relatively late 
colonization of the Sunda Islands Java and 
Lombok by С javanica with its strong affinity to 
C. flu minea. 

Evolutionary Ecology 

The COI sequence data in conjunction with 
the new finding of exceptional life history and 
anatomical characteristics, including features 
of sperm morphology and incubation, pre- 
sented herein for Indonesian Corbicula suggest 
an evolutionary ecology hypothesis on their ori- 
gin (theoretical background, reviews: 
Glaubrecht, 1996; Streit et al., 1997). In par- 
ticular, the diversity of Corbicula in the so- 
called "ancient" lakes on Sulawesi deserve 
such an explanation, while there is only one riv- 
erine corbiculid which has been collectively 
assigned to С subplanata (see Introduction). 

Accordingly, we anticipate colonization of 
Sumatra and Sulawesi by an early, sexual re- 
producing and incubating corbiculid ancestor 
with monoflagellate spermatozoa and subse- 
quent radiation by speciation of individual 
corbiculids in situ particularly in Lake Poso and 
the Malili lake system, respectively, once these 
special habitats open up and provided new 
ecological opportunities. A time frame for this 
process can be given very tentatively only, with 
an estimated age of Lake Poso and the Malili 
lakes of about 1-2 myr (Rintelen et al., submit- 
ted). 

Apparently, local ancient lakes with their tem- 
porally stable habitats facilitated an endemic 
radiation of specialized forms in case of C. 
possoensis in Lake Poso and C. matannensis 
and C. loehensis inhabiting the Malili lakes. The 
latter two lineages might originate from 
intralacustrine divergence within (at least tem- 
porarily) separated lakes and/or independent 
colonizations of the Malili system. In contrast, 
this specific intralacustrine speciation in an 
ancient lake setting is more unlikely in case of 
C. linduensis (for which riverine localities are 
also reported here for the first time), because 
Lindu is not known to fulfill the criteria of being 
an ancient lake. Nevertheless, the outstanding 
mode of brooding in С linduensis may indicate 
rather long isolation. 

Exceptional cases for lacustrine speciation 
and adaptive radiation on Sulawesi are pro- 



FRESHWATER CORBICULIDAE FROM INDONESIA 



37 



vided by gastropods of known incidences in 
Pachychilidae {Tylomelania), Ancylidae 
{Protancylus) and Lymnaeidae {Miratesta){P. 
Sarasin & F. Sarasin, 1898; Rintelen & 
Glaubrecht, 1999; Rintelen et al., submitted), 
and among bivalves also by the evolution of the 
endemic corbiculid genus Possostrea in Lake 
Poso (Bogan & Bouchet, 1998). On a more 
subdued scale, such a process that involves 
the evolution of several adaptations unknown 
for long in other freshwater congeners seems 
to have occurred only in Corbicula sandai of 
Lake Biwa. Although not brooding but laying 
benthic eggs masses with direct developing 
young, this endemic Japanese corbiculid share 
certain reproductive features (i.e., the 
monoflagellate sperm) with taxa endemic to 
Sulawesi, to which also its sequence data ex- 
hibit a certain affinity. 



CONCLUSION 



and collecting permits, and Ahmat Munandar 
for field assistence in August 1999 on Sulawesi. 
We thank E. Wasch, V. Heinrich and N. 
Brinkmann for various technical help with pho- 
tographs, as well as I. Kilias for her help with 
literature research. We also thank Philippe 
Bouchet (Paris), R. Araujo (Madrid) and С 
Ituarte (Buenos Aires) for providing material for 
comparison, and Diarmaid Ó Foighil and two 
anonymous reviewers for valuable comments 
on an earlier version that helped to significantly 
improve the manuscript. A. K. was funded 
through a travel grant of the Deutsche For- 
schungsgemeinschaft (September to Decem- 
ber 2000) and an Alexander von Humboldt 
Research Fellowship (March 2002 to February 
2003) allowing for research visits to the ZMB. 
The 1999/2000 field work in Indonesia has 
been funded through grants of the Deutsche 
Forschungsgemeinschaft to M.G. (Gl 297/1 and 
297/4). 



As shown in the present study, peculiarities 
of shell morphology, anatomy, sperm morphol- 
ogy and the brooding process, as well as avail- 
able molecular data support the presence of 
several endemic Corbicula taxa on Sumatra 
(C. moltkiana) and particularly on Sulawesi (C. 
linduensis, С possoensis, С matannensis 
and С loehensis). These taxa apparently rep- 
resent relatively old and distinct genetic lin- 
eages which show no particularly close 
relationship to any previously studied Corbicula 
from the Japanese islands, Asian mainland or 
Australia. In contrast, С javanica that is sup- 
posed to be widely distributed across the 
Sunda Archipelago, appears closely related to 
a Korean lineage identified as C. fluminea 
within an Asian cluster, and might be a later 
migrant in this region. Future additional mor- 
phological, biological and molecular investiga- 
tions may provide more decisive information 
concerning the evolutionary pathways along 
which Corbicula species colonized freshwater 
habitats in Southeast and Austral-Asia. 



ACKNOWLEDGEMENTS 

We are grateful to Frank Köhler for his 
assistence during field work in Indonesia, and 
to Sabine Schutt (both ZMB) for material col- 
lecting on Sumatra in 2000. We thank 
Ristiyanti Marwoto (MZB) for logistical help dur- 
ing the field work, LIPI for providing research 



LITERATURE CITED 

ARAUJO, R., D. MORENO & M. A. RAMOS, 
1993, The Asiatic clam Corbicula fluminea 
(Müller, 1774) in Europe. American Malacologi- 
cal Bulletin, 10 (1): 39-49. 

BOGAN, A. & R BOUCHET, 1998, Cementation 
in the freshwater bivalve family Corbiculidae 
(Mollusca: Bivalvia): a new genus and species 
from Lake Poso, Indonesia. Hydrobiologie, 
389: 131 139. 

BOLLINGER, G., 1914, Süsswassermollusken 
von Celebes. Ausbeute der zweiten Celebes- 
Reise der Herren Dr. P. und F. Sarasin. Revue 
Suisse de Zoologie, 22: 557-579. 

BRITTON, J. С. & В. MORTON, 1979, Corbicula 
in North America: the evidence reviewed and 
evaluated. Pp. 249-287, in: J. D britton, ed., 
Proceedings of the First International Cor- 
bicula Symposium. Texas Christian University 
Fort Worth, Texas, Oct. 13-15. Fort Worth: 
Texas Christian University Research Founda- 
tion. 

BYRNE, M., H. PHELPS, T CHURCH, V. ADAIR, 
P SELVAKUMARASWAMY & J. POTTS, 2000, 
Reproduction and development of the fresh- 
water clam Corbicula australis in southeast 
Australia. Hydrobiologia, 418: 185-197. 

BYUN, K.-S. & E.-Y CHUNG, 2001, Distribution 
and ecology of Marsh Clam in 
Gyeongsangbuk-do. II. Reproductive cycle 
and larval development of the Corbicula 
japónica. Korean Journal of Malacology, 17 
(1): 45-55. [in Korean, with English summary]. 

CHEN, T C, K. Y LIAO & W. L. WU, 1995, 
Anatomy of Corbicula fluminea (Bivalvia: 
Corbiculidae). Bulletin of Malacology, Republic 
of China, 19: 9-19. [in Chinese, with English 
summary]. 



38 



GLAUBRECHTETAL. 



CLESSIN, S., 1887, Neue Arten des Genus Cor- 
bicula Muhlf. aus Vorder- und Hinter-Indien, 
Borneo und Sumatra. Malakozoologische 
Blätter, 2 (9): 67-80. 

DAVIS, G. M., 1982, Historical and ecological fac- 
tors in the evolution, adaptive radiation, and 
biogeography of freshwater mollusks. Ameri- 
can Zoologist, 22: 375-395. 

DJAJASASMITA, M., 1 975, On the species of the 
genus Corbicula from Celebes, Indonesia 
(Mollusca, Corbiculidae). Bulletin Zoologisch 
Museum Universiteit van Amsterdam, 4 (10): 
83-87. 

DJAJASASMITA, M., 1977, An annotated list of 
the species of the genus Corbicula from Indo- 
nesia (Mollusca: Corbiculidae). Bulletin 
Zoologisch Museum Universiteit van 
Amsterdam, 6 (1): 1-9. 

DREHER MANSUR, M. С & С. MEIER-BROOK, 
2000, Morphology of Eupera Bourguignat 
1854, and Byssanodonta Orbigny 1846 with 
contributions to the phylogenetic systematics 
of Sphaeriidae and Corbiculidae (Bivalvia: 
Veneroida). Archiv für Molluskenkunde, 128 
(1/2): 1-59. 

FELSENSTEIN, J., 1985, Confidence limits on 
phylogenies: an approach using the boot- 
strap. Evolution, 39: 783-791. 

FOLMER, O., M. BLACK, W. HOEH, R. LUTZ & 
R. VRIJENHOEK, 1 994, DNA primers for ampli- 
fication of mitochondrial cytochrome с oxidase 
subunit I from diverse metazoan invertebrates. 
Molecular Marine Biology and Biotechnology, 
3: 294-299. 

GLAUBRECHT, M., 1996, Evolutionsökologie 
und Systematik am Beispiel von Sijß- und 
Brackwasserschnecken (Mollusca: Caeno- 
gastropoda: Cerithioidea): Ontogenese- 
Strategien, paläontologische Befunde und 
Historische Zoogeographie. Leiden: Backhuys 
Publishers. 544 pp. 

GLAUBRECHT, M., 2000, A look back in time. 
Toward an historical biogeography as a syn- 
thesis of systematic and geological patterns 
outlined with limnic gastropods. Zoology, 102: 
127-147. 

GLAUBRECHT M. & Т v. RINTELEN, 2003, Sys- 
tematics, molecular genetics and historical 
zoogeography of the viviparous freshwater 
gastropod Pseudopotamis (Cerithioidea, 
Pachychilidae): a relic on the Torres Strait Is- 
lands, Australia. Zoológica Scripta, 32 (2), in 
press. 

HALL, R. & D. BLUNDELL, eds., 1996, Tectonic 
evolution of Southeast Asia. London: Geologi- 
cal Society. 566 pp. 

HALL, R. & J. D. HOLLOWAY, eds., 1998, Bioge- 
ography and geological evolution of SE Asia. 
Leiden: Backhuys Publishers. 417 pp. 

HALL, T A., 1999, BioEdit: a user-friendly bio- 
logical sequence alignment editor and analy- 
sis program for Windows 95/98/NT. Nucleic 
Acids Symposium Series, 41: 95-98. 

HARADA, E. & M. NISHINO, 1995, Differences in 
inhalant siphonal papillae among the Japa- 
nese species of Corbicula (Mollusca: Bivalvia). 



Publications of Seto Marine Biology Labora- 
tory, 36 (6): 389-408. 

HURUKAWA, M. & S. MIZUMOTO, 1958, An eco- 
logical studies on the bivalve "Seta-shijumi", 
Corbicula sandai Reinhardt of the Lake Biwa. 
II. On the development. Bulletin of the Japa- 
nese Society of Scientific Fisheries, 19 (2): 
91-94. [in Japanese, with English summary]. 

ITUARTE, С F., 1994, Corbicula and Neocor- 
bicula (Bivalvia: Corbiculidae) in the Paraná, 
Uruguay and Rio de La Plata basins. Nautilus, 
107 (4): 129-135. 

KÖHLER, F. & M. GLAUBRECHT, 2001, Toward 
a systematic revision of the Southeast Asian 
freshwater gastropod Brotia H. Adams, 1866 
(Cerithioidea: Pachychilidae): an account of 
species from around the South China Sea. 
Journal of Molluscan Studies, 67: 281-318. 

KÖHLER, F. & M. GLAUBRECHT, 2003, Mor- 
phology, reproductive biology and molecular 
genetics of ovoviviparous freshwater gastro- 
pods (Cerithioidea, Pachychilidae) from the 
Philippine Islands, with description of the new 
genus Jagora. Zoológica Scripta, 32 (1): 35-59. 

KOHLER, F., T V. RINTELEN & M. GLAUB- 
RECHT, 2000, Morphology, molecules and 
Wallacean biogeography. The case study of 
the Southeast Asian freshwater gastropod 
Brotia (Cerithioidea: Melanatriidae). Pp. 51- 
52, in: R. DE JONG, ed.. Abstracts International 
Symposium Biogeography of Southeast Asia 
2000. Leiden: University of Leiden. 58 pp. 

KOMARU, A. & K. KONISHI, 1996, Ultrastructure 
of biflagellate spermatozoa in the freshwater 
clam, Corbicula leana (Prime). Invertebrate 
Reproduction and Development, 29 (3): 193- 
197. 

KOMARU, A. & K. KONISHI, 1999, Non-reduc- 
tional spermatozoa in three shell color types of 
the freshwater clam Corbicula fluminea in Tai- 
wan. Zoological Science, 16: 105-108. 

KOMARU, A., K. KONISHI, I. NAKAYAMA, T 
KOBAYASHI, H. SAKAI & K. KAWAMURA, 
1997, Hermaphroditic freshwater clams in the 
genus Corbicula produce non-reductional 
spermatozoa with somatic DNA content. Bio- 
logical Bulletin, 193: 320-323. 

KOMARU, A., K. KONISHI, K. KAWAMURA & H. 
SAKAI, 1998, Morphological remarks on a 
Corbicula species collected in Saga Prefec- 
ture, Japan. Bulletin of the National Research 
Institute of Aquaculture, 27: 37-41. 

KOMARU, A., K. OOKUBO & M. KIYOMOTO, 
2000, All meiotic chromosomes and both cen- 
trosomes at spindle pole in the zygotes dis- 
carded as two polar bodies in clam Corbicula 
leana: unusual polar body formation observed 
by antitubulin immunofluorescence. Develop- 
ment Genes and Evolution, 210: 263-269. 

KONISHI, K., K. KAWAMURA, H. FURUITA&A. 
KOMARU, 1998, Spermiogenesis of the fresh- 
water clam Corbicula aff. fluminea Müller 
(Bivalvia: Corbiculidae). Journal of Shellfish 
Research, 17 (1): 185 189. 

KRUIMEL, J. H., 1 91 3, Verzeichnis der von Herrn 
E.C. Abendanon in Celebes gesammelten 



FRESHWATER CORBICULIDAE FROM INDONESIA 



39 



SCisswasser-Mollusken. Bijdragen tot de 
Dierkunde, 19: 217-235. 

LEE, T., A. WALTHER & D. Ó FOIGHIL, 2002, 
Polyploid molluscs: double the phylogenetic 
trouble? R 61, in: R т Dillon, ed.. Abstracts 
of the 68"' meeting of tfie American Malaco- 
logical Society. Charleston, South Carolina: 
American Malacological Society. 124 pp. 

MARTENS, E. v., 1897, Süss- und Brackwasser- 
Mollusken des Indischen Archipels. Pp. 1 -331 , 
in: M. WEBER, ed., Zoologisctie Ergebnisse 
einer Reise in Niederländiscii Ost-Indien, vol. 
4. Berlin: Reimer. 331 pp. 

MARTENS, E. v., 1900, Über Land- und 
Süßwasser-Schnecken aus Sumatra. 
Nachricfitsblatt der deutsciien Malakolo- 
giscfien Gesellscliaft, 32: 3-18. 

METCALFE, I., J. M. B. SMITH, M. MORWOOD & 
I. DAVIDSON, 2001, Fauna! and floral migra- 
tions and evolution in SE Asia-Australasia. 
Lisse: A.A. Balkema Publishers. 416 pp. 

MITTERMEIER, R. A., N. MYERS & С G. 
MITTERMEINER, 2000, Hotspots: earttiS bio- 
logically richest and most endangered terres- 
trial ecoregions. Chicago: University of 
Chicago Press. 432 pp. 

MORTON, В., 1979, Corbicula in Asia. Pp. 15 
38, in: J. D BRITTON, ed.. Proceedings of the 
First International Corbicula Symposium. 
Texas Christian University Fort Worth. Texas, 
Oct. 13-15. Fort Worth: Texas Christian Uni- 
versity Research Foundation. 

MORTON, В., 1986, Corbicula in Asia - an up- 
dated synthesis. American Malacological Bul- 
letin, Special Edition, 2: 113-124. 

MOUSSON, A., 1849, Die Land- und Süß- 
wassermollusken von Java. Zürich: F. 
Schulthess. 126 pp. 

MÜLLER, О. F., 1774, Vermium terrestrium et 
fluviatilium, sen animalium infusoriorum, 
helminthicorum, et testaceorum, non 
marinorum, succincta historia, Vol. 2. Testa- 
cea. Havnie et Lipsiae. 214 pp. 

MYERS, N., R. A. MITTERMEIER, С G. MITTER- 
MEINER, G. A. В. da FONSECA & J. KENT, 
2000, Biodiversity hotspots for conservation 
priorities. Nature, 403: 853-858. 

NATION, J. L., 1983, A new method using 
hexamethyldisilazane for preparation of soft 
insect tissues for scanning electron micros- 
copy. Stain Technology, 58 (6): 347-351. 

OKAMOTO, A. & B. ARIMOTO, 1986, Chromo- 
somes of Corbicula japonice, С. sandai and С 
(Corbiculina) leana (Bivalvia, Corbiculidae). 
Venus, 45 (3): 194-202. 

PARK, G.-M., T-S. YONG, K.-l. IM & E.-Y. 
CHUNG, 2000, Karyotypes of three species of 
Corbicula (Bivalvia: Veneroida) in Korea. Jour- 
nal of Shellfish Research, 19 (2): 979-982. 

PARODIZ, J. J., 1996. The taxa of fossil mollusca 
introduced by Hermann von Ihering. Annals of 
Carnegie Museum, 65 (3): 183-296. 

PFENNINGER, M., F. REINHARDT & В. STREIT, 
2002, Evidence for cryptic hybridization be- 
tween different lineages of the invasive clam 



genus Corbicula (Veneroida, Bivalvia). Journal 
of Evolutionary Biology, 15: 818-829. 

PRASHAD, В., 1930, Revision of the Asiatic spe- 
cies of the genus Corbicula. 4. The species of 
the genus Corbicula from the Sunda islands, 
the Celebes and New Guinea. Memoirs of the 
Indian Museum, 9: 193-203. 

PRIME, T, 1862, Descriptions of two new spe- 
cies of shells. Proceedings of the Boston Soci- 
ety of Natural History, 7: 273-274. 

PRIME, T, 1878, Description of a new species of 
Corbicula, with notes on other species of the 
Corbiculidae family. Bulletin of the Museum of 
Comparative Zoology, 5 (4-5): 43-46. 

QIU, A., A. SHI & A. KOMARU, 2001 , Yellow and 
brown shell color morphs of Corbicula 
fluminea (Bivalvia: Corbiculidae) from Sichuan 
Province, China, are triploids and tetraploids. 
Journal of Shellfish Research, 20 (1): 323- 
328. 

REID, W. v., 1998, Biodiversity hotspots. Trends 
in Ecology and Evolution, 13 (7): 275-280. 

RINTELEN, T v. & M. GLAUBRECHT, 1999, On 
the reproductive anatomy of freshwater gas- 
tropods of the genera Brotia H. Adams, 1866 
and Tylomelania Sarasin & Sarasin, 1897 in 
the central lakes on Sulawesi, Indonesia 
(Cerithioidea: Melanatriidae). Courier For- 
schungs-Institut Senckenberg, 215: 163-169. 

RINTELEN, T v. & M. GLAUBRECHT, 2002, 
Gene trees and species trees - a case study 
from a species flock of viviparous freshwater 
gastropods (Caenogastropoda: Cerithioidea: 
Pachychilidae) from the ancient lakes of Sula- 
wesi, Indonesia. P. 110, in: R. т DILLON, ed.. 
Abstracts of the 68'" meeting of the American 
Malacological Society. Charleston, South Caro- 
lina: Amehcan Malacological Society. 124 pp. 

RINTELEN, T v., A. B. WILSON, A. MEYER & M. 
GLAUBRECHT, Snails on the fast lane: rapid 
parallel evolution of a species flock of freshwa- 
ter snails in the ancient lakes on Sulawesi, In- 
donesia, submitted to Science. 

SAITOU, N. & M. NEI, 1987, The neighbor-join- 
ing method: a new method for reconstructing 
phylogenetic trees. Molecular Biology and 
Evolution, 4: 406-425. 

SARASIN, R & R SARASIN, 1898, Süssv^asser- 
Mollusken von Celebes. Wiesbaden: C.W. 
Kreidel's Verlag. 104 pp. 

SIRIPATTRAWAN, S., J.-K. PARK & D. Ó 
FOIGHIL, 2000, Two lineages of the intro- 
duced freshwater clam Corbicula occur in 
North America. Journal of Molluscan Studies, 
66: 423-429. 

STREIT В., T STADLER, & С. M. LIVELY 1997, 
eds., Evolutionary ecology of freshwater 
annimals. Concepts and case studies. Basel: 
Birkhäuser. 366 pp. 

SWOFFORD, D.L., 1998, PAUP*. Phylogenetic 
Analysis Using Parsimony (*and Other Meth- 
ods). Sunderland, Massachusetts: Sinauer. 

WHITMORE,T C, 1981, ed., Wallace's line and 
plate tectonics. Oxford: Clarendon Press. 238 
pp. 



40 GLAUBRECHTETAL. 

WHITMORE, T C, 1987, ed., Biogeographical 
evolution of the Malay Archipelago. Oxford: 
Clarendon Press. 147 pp. , „ ^^ r. 

WINNEPENNINCKX, В., T BACKELJAU & R. De 
WÄCHTER, 1993, Extraction of high molecular 
weight DNA from molluscs. Trends in Genetics, 
9: 407. , . . 

XIA, X. & Z. XIE, 2001 , DAMBE: Data analysis in 
molecular biology and evolution. Journal of 
Heredity, 92: 371-373. 

Revised ms. accepted 28 February 2003 



MALACOLOGIA, 2003, 45(1 ): 41-1 00 

THE APPLE SNAILS OF THE AMERICAS 

(MOLLUSCA: GASTROPODA; AMPULLARIIDAE: 

ASOLENE, FEUPPONEA, MARISA, POMACEA, POMELLA): 

A NOMENCLATURAL AND TYPE CATALOG 

Robert H. Cowie^ & Silvana С. Thiengo^ 



• ABSTRACT 

Ampullahidae are freshwater snails predominantly distributed in humid tropical and sub- 
tropical habitats in Afhca, South and Central America and Asia. This catalog is concerned 
only with the American species, the majority of which are placed in the genus Pomacea. 
Species of Pomacea are found throughout most of South and Central America and the 
Caribbean, with a single species extending into southeastern USA. The other American 
genera are Asolene, Felipponea, Pomella and Marisa, all South American. The taxonomy 
of the group is heavily based on shell morphology but the true number of valid taxa re- 
mains unknown, pending revisionary work. This catalog provides the rigorous nomencla- 
tura! base for this future work by bringing together all the available and unavailable 
genus-group and species-group names that have been applied to American ampullariids, 
indicating their current nomenclatural status (species, subspecies, synonyms, etc.). The 
catalog lists 14 published genus-group and 307 published species-group names for Ameri- 
can ampullariids. Of these, 7 genus-group (including 2 subgeneric) and 141 species-group 
(including 23 infraspecific) names are currently valid. There are 4 genus-group synonyms, 
133 species-group synonyms, and 11 species-group homonyms. Also listed are 3 unavail- 
able genus-group and 23 unavailable species-group names. The catalog provides biblio- 
graphic details for all names, details of type localities and locations of type material, and 
geographic distribution as far as can be ascertained given the confused state of the tax- 
onomy. The catalog is a work of nomenclature; it is not a revisionary work of taxonomy. 

Key words: Ampullahidae, freshwater snails, nomenclature, type material. North America, 
South America, Central America. 



INTRODUCTION 

Ampullariidae are freshwater snails predomi- 
nantly distributed in humid tropical and sub- 
tropical habitats in Africa, South and Central 
America and Asia. They include the largest of 
all freshwater snails {Pomacea urceus can at- 
tain a shell height of 145 mm - Burky, 1974; P. 
maculata can exceed 155 mm - Pain, 1960) 
and frequently constitute a major portion of the 
native freshwater mollusk faunas of these re- 
gions. Among the seven to ten genera usually 
recognized, the two largest are Pomacea, per- 
haps with about 50 real species (but 1 1 7 nomi- 
nally valid species recognized herein), and Pila, 
with about 30 (Berthold, 1 991 ). Snails in these 



two genera particularly are frequently known as 
"apple snails" because many species bear 
large, round, often greenish shells. The term 
"apple-shell" was first used by Perry (1810c) in 
his introduction of the name Pomacea, for his 
new species P. maculata, because of "its gen- 
eral resemblance to ... an apple" (Vomum" in 
Latin), and not from the Greek Пшра, which 
means an operculum. 

Ampullahidae (junior synonym Pilidae; Cowie, 
1997a; ICZN, 1999a) are operculate snails. 
They are most closely related to the 
Viviparidae, together with which they form the 
superfamily Ampullahoidea in the orders or su- 
perorders (depending on classification) 
Mesogastropoda of earlier authors and Caeno- 



'Corresponding author. Center for Conservation Research and Training, University of Hawaii, 3050 Maile Way, 

Gilmore 408, Honolulu, Hawaii 96822, USA; cowie@hawaii.edu 

^instituto Oswaldo Cruz, Av. Brasil 4365, 21045-900 Rio de Janeiro, RJ, Brasil; sthiengo@ioc.fiocruz.br 



41 



42 



COWIE&THIENGO 



gastropoda of more recent authors (Ponder & 
Waren, 1988; Berthold, 1989; Bieler, 1992; 
Ponder & Lindberg, 1997). 

Traditional subdivision of the family, by vari- 
ous authors, has been into seven to ten gen- 
era, with the form of the siphon and the 
operculum considered diagnostically significant 
(e.g., Michelson, 1961). Pain (1972) briefly re- 
viewed the history of taxonomic work on the 
family. More recently. Berthold (1991: 245-250) 
recognized ten genera (and three subgenera) 
with approximately 120 species. His detailed 
anatomical account treated representative spe- 
cies from each of these generic groupings. He 
divided the family into two subfamilies: the 
Afropominae (containing just a single Recent 
African species in the genus Afropomus); and 
the Ampullariinae, which he subdivided into the 
tribes Sauleini (one genus, Saulea, containing 
two African species, one Recent, one fossil) 
and Ampullariini (the remainder). He further 
subdivided the Ampullariini into the groups 
Heterostropha and Antlipneumata, but these 
divisions and names have been criticized by 
Bieler (1993), who reanalyzed Berthold's data 
using cladistic techniques. Bieler's reanalysis 
showed that the various groupings of genera 
remained more or less similar to those of 
Berthold, but the relationships among these 
groups were inconsistent. Given these incon- 
sistencies, it seems unwise to force the vari- 
ous clades into a traditional hierarchy of 
family-group names. One of the ten genera 
recognized by Berthold (1991), Pseudo- 
ceratodes (African, fossil only), was included in 
the family only tentatively. Of the remaining nine 
genera, six contain fewer than six species 
each: Afropomus and Saulea are African; 
Asolene, Felipponea, Pomella and Marisa are 
South American. The three genera Lanistes 
Montfort, Pila {Ampullaria Lamarck and 
Ampullarius Montfort are junior synonyms; 
Cowie, 1997a; ICZN, 1999a) and Pomacea, 
containing 21 , about 30, and about 50 species, 
respectively, comprise the great majority of 
species in the family. Lanistes (distinguished 
by its hyperstrophic and hence superficially sin- 
istral shells) is African (including Madagascar). 
Pila is African and Asian. Pomacea is South 
and Central American. 

This catalog is concerned only with the 
American species, the majority of which are 
placed in the genus Pomacea. Species of 
Pomacea are found throughout most of South 
and Central America and the Caribbean, with a 
single species, Pomacea paludosa, extending 
into the southeast USA. The genus is divided 



into two subgenera, Pomacea sensu stricto 
and Pomacea {Effusa). Berthold (1991) con- 
sidered Pomacea to be monophyletic, with 
Marisa as its sister-group, and the similarities 
between Marisa and Pomacea subgenus 
Effusa to be convergent (see also Pilsbry, 
1933: 72-73). However, the relationships 
among the two subgenera of Pomacea and the 
genus Marisa are not well resolved (Bieler, 
1993) and, at least in terms of shell morphol- 
ogy, the three taxa intergrade. The distinctions 
among these and the other American genus- 
group taxa have been generally not well under- 
stood. This catalog follows Berthold (1991: 
248-250) regarding validity and status of ge- 
nus-group names, without necessarily implying 
support for his taxonomic views. 

One or more species of Pomacea, introduced 
to Southeast Asia and islands of the Pacific, in- 
cluding the Hawaiian Islands, have become 
major agricultural pests, notably in rice and taro 
but also in other crops (Cowie, 2002). However, 
the true identity of the species involved is uncer- 
tain, having been treated variously as Pomacea 
canaliculata (Smith, 1992; Hendarsih et al., 
1994), P. lineata (Cheng, 1989; Laup, 1991), P 
gigas (see Guerrero, 1991), P. "insularis" (see 
Acosta & Pullin, 1991), Pomacea cf. 
canaliculata (Ng et al., 1993), simply Pomacea 
sp. (Acosta & Pullin, 1991), a "hybrid [of] 
Ampullaria canaliculata and Ampullaria cuprina" 
(Anderson, 1993), and even "Ampularius sp. a 
hybrid of undetermined origin" (Lacanilao, 
1990). Keawjam & Upatham (1990) recognized 
three species of Pomacea introduced in Thai- 
land: P. canaliculata, P. insularum and an uni- 
dentified species o^ Pomacea. Mochida (1991) 
indicated that as well as P. canaliculata (which 
he considered frequently to have been 
misidentified as P. insularum) two other species 
of Pomacea have also been introduced to the 
Philippines: P. gigas and P. cuprina (the latter 
possibly a misidentification of P. bridgesii, a spe- 
cies that has been carried all over the world by 
the domestic aquarium trade - Cowie, 1995). In 
Japan, three "strains of Pomacea canaliculata" 
have been identified, differing in shell colour and 
pattern, salinity tolerance, and in aspects of re- 
production and growth (Brand et al., 1990; Pujío 
et al., 1991 ). In the Philippines, the snails have 
even been identified as species of Pila (see 
Guerrero, 1991). In Hawaii, where four 
ampullahid species are recorded (Cowie, 1995), 
snails in an aquaculture project have been re- 
ported as hybrids of Pomacea canaliculata and 
P. paludosa (Nishimura et al., in Tamaru, 
1996). 



NEW WORLD AMPULLARIIDAE 



43 



Ampullariid species-level taxonomy has been 
heavily reliant on shell morphology, yet snail 
shells, and especially ampullariid shells, ex- 
hibit much intraspecific variation. The tax- 
onomy and systematics of most species have 
not been adequately worked since their original 
descriptions. The pest species (even if it turns 
out to be more than one species) in Southeast 
Asia nevertheless appears to belong to a rela- 
tively well circumscribed group of more or less 
closely related species from South America. 
However, within this group, the species and 
their relationships are very poorly understood. 
The group comprises a large number of nomi- 
nal species, including P. canaliculata. From 
time to time, some of the species within this 
"canaliculata group" have been formally syn- 
onymized, informally linked together, distin- 
guished as separate species, and so on. This 
confusion was discussed but not resolved by 
Alderson (1925), the most recent author to re- 
vise Pomacea and Pila widely (referring to the 
two genera together as "Ampullaria"). He im- 
plicitly recognized most of the species in the 
"canaliculata group" as a more or less closely 
knit group. Within this group he further recog- 
nized a number of rather vaguely defined as- 
sociations of species, for instance explicitly 
linking Pomacea immersa, P. amazónica and 
P. haustrum, although without formally synony- 
mizing them; and informally referring to an- 
other subset of the group as "the lineata 
group". However, he did retain most species 
as valid. It is quite possible that, just as for the 
large number of Central American species 
synonymized under Pomacea flagellata by 
Pain (1964), many other "species" of 
Ampullariidae, including those in the 
"canaliculata group", do not deserve distinct 
specific status (Pain, 1960; Cazzaniga, 1987, 
2002). A modern revision, involving not only 
conchology but also internal anatomy and mo- 
lecular characters, might reduce the 
"canaliculata group" to as few as three spe- 
cies, possibly P. canaliculata, P. lineata and P. 
gigas (= maculata ~ see main catalog). Until 
such work is undertaken, however, the status 
of these various nominal species will remain 
obscure. 

The purpose of this catalog, then, is to pro- 
vide a rigorous base for this revislonary work 
by bringing together all the available and un- 
available genus-group and species-group 
names in the large genus Pomacea and the 
other much smaller South American genera of 
Ampullariidae, indicating their current nomen- 



clatural status (species, subspecies, syn- 
onyms, etc.) generally according to the most 
recent revisions; a total of 14 genus-group and 
307 species-group names (Table 1 ). The cata- 
log also provides bibliographic details for all 
names, details of type localities and locations 
of type material, if known, and geographic dis- 
tribution as far as can be ascertained given the 
confused state of the taxonomy. 



EXPLANATORY INFORMATION 

Scope 

This catalog lists all published genus-group 
and species-group names found in the litera- 
ture, whether available or unavailable accord- 
ing to the International Code of Zoological 
Nomenclature (ICZN, 1999b), that have been 
applied to the Ampullariidae of North, Central, 
and South America, and the Caribbean region. 

Arrangement and Treatment of Taxa 

The sequence of genera is alphabetical. 
Subgenera appear in alphabetical order within 
genera. Genus-group synonyms are listed 
chronologically under the genus-group head- 
ing. All species-group names (valid and in- 
valid, available and unavailable) are listed 
alphabetically within genera/subgenera. Incor- 
rect spellings are listed only if confusion might 
be caused by their omission; they may also 
be mentioned in Remarks sections. Treatment 
of species-group names follows the major 
authoritative revisions, although few of these 
are recent. Names proposed as "forms", "va- 



TABLE 1 . Summary of the numbers of names of 
American ampullariid taxa (including names that 
are incerae sedis) treated in this catalog. 



Available 



Unavailable 



Genus-group 
names 



Valid genus 
Valid subgenus 
Synonym 



Species- 


Valid species 


117 


group names 


Valid infra- 
specific 


23 




Synonym 


133 




Homonym* 


11 



23 



*lncludes homonyms considered to represent valid 
species (10) and valid infraspecific taxa (1). 



44 



COWIE&THIENGO 



rieties", etc., and neither already synonymized 
nor raised to subspecific status are simply 
treated, along with subspecies, as infraspe- 
cific. Treatment of genus-group names also 
follows the most recent authoritative revisions. 
In some instances in which we treat a name 
as a junior synonym, one or more other 
names automatically become synonyms of the 
senior synonym because they had already 
been treated as synonyms of the junior syn- 
onym. In some cases this results in the intro- 
duction of a new synonymy, indicated in 
boldface by "N. syn.". However, no other revi- 
sionary work has been attempted and no new 
taxonomic decisions have been made. 

Typographical Treatment of Names 

Family and genus-group headings are cen- 
tered in upper case type. Valid genus-group 
names are listed flush left in boldface upper 
case type. Valid, available species-group 
names are listed flush left in boldface, in- 
fraspecific names preceded by a "+". Syn- 
onyms are listed in italics flush left, upper case 
for family and genus-group names, lower case 
for species-group names. In the species- 
group, junior homonyms are also listed in ital- 
ics flush left, or in boldface italics flush left if 
new or replacement names have not been pro- 
vided. Nomenclaturally unavailable names are 
listed in plain type, flush left. 

Taxonomic References 

The citation for the original proposal of a ge- 
nus-group name follows the name. The refer- 
ence consists of author(s), date of publication 
and page number. For species-group names, 
on the line following the name and indented, 
the name is given in its original generic combi- 
nation (including subgenus if in the original de- 
scription, and using the original orthography, 
even if incorrect) and with its original status in- 
dicated (e.g., subspecies, "var.", as neces- 
sary). The name is followed by its author(s), 
date of publication, page number, and plate/fig- 
ure number(s). When an author published the 
same name as new for the same taxon in 
more than one place, the later citation is given 
in square brackets following the first citation. 

The author/date citation acts as a reference 
to the work as listed in the Literature Cited 
section. If an author published more than one 
work in the same year, a suffix (a, b, c, etc.). 
Indicating chronological order of publication, is 



attached to the date in both the catalog text 
and the Literature Cited. Authors' names con- 
taining the terms "de", "d"', "von", if being of 
European continental origin, are cited and 
alphabetized in the Literature Cited by the 
main name, e.g., "Ampullaha guadelupensis 
Martens, 1 857" in the main body of the catalog 
and "Martens, E. von. 1857" in the Literature 
Cited. 

The page number cited is that on which the 
name first appeared. In some instances, the 
name first appeared on different pages, for in- 
stance in a list or key, with the actual descrip- 
tion beginning on a subsequent page. In such 
cases, both page numbers are cited. 

If the current status of a species-group 
name differs from that in the original descrip- 
tion, this is indicated, with appropriate refer- 
ences, in a Remarks section below the 
standard entry for the species. 

Type Species 

For nomenclaturally available genus-group 
names, the type species and its method of 
fixation (following Code Arts. 66-70) are given 
following the literature citation. 

Homonyms and Replacement Names 

Homonymy of species-group names is indi- 
cated in the Remarks section under the name. 
In many cases, the junior homonym has al- 
ready been synonymized with another earlier 
name, or a replacement name has already 
been provided. In cases in which a replace- 
ment name appears necessary, no replace- 
ment name is here provided, pending further 
research. We have not made an exhaustive 
search for possible senior homonyms. 

Unavailable Names 

Unavailable names are listed with full citation 
and a statement of why the name is unavail- 
able, e.g., "nom. nud", "first published as a jun- 
ior synonym of . . .", etc. No other information is 
provided except for explanatory details in the 
Remarks section, if necessary. Obviously in- 
correct spellings are not listed but may be 
mentioned in annotations. 

Misidentifications 

Misldentifications are not formally listed. No 
genus-group misidentifications are mentioned. 



NEWWORLDAMPULLARIIDAE 



45 



Species-group misidentifications are noted in 
square brackets or in Remarks sections, if 
necessary for clarity. 

Miscellaneous Annotations 

Under each genus-group heading, explana- 
tory and other useful information is given im- 
mediately under the genus-group synonymy. 
Annotations other than those indicated in the 
above paragraphs are placed in square brack- 
ets immediately follov^/ing the item to be clari- 
fied or, if the annotations are more extensive, 
placed in a Remarks section following the 
standard entry for the species. 

Type Localities and Type Material 

The type locality ("the geographical ... place 
of capture, collection or observation of the 
name-bearing type" [Code Art. 76]) is given for 
each available species-group name immedi- 
ately following the author and citation. The lo- 
cation is given verbatim as published by the 
author, without translation. If no locality was 
given by the author, this is simply stated, in 
square brackets. Any additional intepretive or 
explanatory information regarding the type lo- 
cality is placed in square brackets following 
the originally published locality, or, if extensive, 
in the Remarks section. However, an exhaus- 
tive attempt to determine the exact collection 
locality has not been made. 

Location and catalog numbers of type mate- 
rial, if known, are given, following the type lo- 
cality information. In many instances, the 
original descriptions did not designate a holo- 
type or even identify a type series. Even 
though many of these descriptions were prob- 
ably based on single specimens, it is rarely 
possible to determine this with certainty. 
Therefore, in most cases, the material known 
to have been used in describing a new spe- 
cies should be designated as a lectotype (or 
lectotype and paralectotype(s) if more than 
one specimen is present in the inferred type 
series) {Code Rec. 73F). Rather than desig- 
nating lectotypes here, we consider such 
specimens to be syntypes, pending further 
study. The information provided is derived 
from the literature (citations given), and from 
enquiries made to numerous museums and 
our own study in various museums (see Ac- 
knowledgments); an exhaustive search for 
type material has not been made. 



Distributions 

The distribution (if known) of each species is 
given following the type locality and type material 
information. In most cases this information is 
not detailed, providing simply the country or re- 
gion from which the species has been recorded 
in the literature. Citations for the sources of this 
information are provided, unless the only infor- 
mation available is the type locality, for which the 
reference has already been provided. 

Museum Collection Acronyms and Type Mate- 
rial Holdings 

The following acronyms are used for the vari- 
ous museum collections referred to in the 
catalog. The number of American taxa repre- 
sented by type or possible type material in 
each collection, as known to us or referred to in 
the literature, is indicated in parentheses. Re- 
search will undoubtedly uncover additional type 
material in many of these collections. 

AMNH American Museum of Natural History, 
New York, U.S.A. (4) 

ANSP Academy of Natural Sciences, Philadel- 
phia, U.S.A. (22) 

BMNH The Natural History Museum, London, 
U.K. (83) 

CAS California Academy of Sciences, San 
Francisco, U.S.A. (1) 

CMNH Carnegie Museum of Natural History, 
Pittsburgh, U.S.A. (1) 

HUJ Hebrew University of Jerusalem, Israel (5) 

IMLA Fundación e Instituto Miguel Lillo, 
Universidad Nacional de Tucumán, Ar- 
gentina (1) 

MACN Museo Argentino de Ciencias Natu- 
rales, Buenos Aires, Argentina (1 ) 

MCZ Museum of Comparative Zoology, Har- 
vard University, Cambridge, U.S.A. (29) 

MCSN Museo Civico di Storia Naturale, 
Milano, Italy (0) 

MHNG Muséum d'Histoire Naturelle, Genève, 
Switzerland (8) 

MHNS Museo de Historia Natural La Salle, 
Caracas, Venezuela (1) 

MMUE The Manchester Museum, University of 
Manchester, Manchester, U.K. (1) 

MNCN Museo Nacional de Ciencias Natu- 
rales, Madrid, Spain (3) 

MNHN Muséum National d'Histoire Naturelle, 
Paris, France (30) 

MNHNS Museo Nacional de Historia Natural, 
Santiago, Chile (possibly 21) 

MNRJ Museu Nacional, Rio de Janeiro, Brasil 

(1) 
MZUSP Museu de Zoología da Universidade de 
Sao Paulo, Brasil (0) 



46 



COWIE&THIENGO 



NMW National Museum of Wales, Cardiff, 
U.K. (10) 

NZSI Zoological Survey of India, National 
Zoological Collection India, West Ben- 
gal, Calcutta, India (1) 

RMNH Nationaal Natuurhistorische Museum, 
Leiden, Netherlands (2) 

SMFD Forschungsinstitut und Naturmuseum 
Senckenberg, Frankfurt-am-Main, 
Germany (possibly 2) 

UF Universisty of Florida, Florida Museum 

of Natural History, Gainesville, U.S.A. (1) 

UMMZ University of Michigan, Museum of Zo- 
ology, Ann Arbor, U.S.A. (5) 

USNM National Museum of Natural History, 
Washington D.C., U.S.A. (11) 

ZMHB Museum für Naturkunde der Humboldt- 
Universität, Berlin, Germany (24) 

ZMUH Universität von Hamburg, Zoologisches 
Institut und Zoologisches Museum, 
Hamburg, Germany (0) 

ZMZ Zoologisches Museum der Universität, 
Zürich, Switzerland (1) 

ZSM Zoologische Staatssammlung München, 
Germany (14) 

Abbreviations 

The following abbreviations are used 
throughout the catalog. 



Art(s). 


Article(s) (of the Code) 


Code 


International Code of Zoological 




Nomenclature (ICZN, 1999b) 


fig(s). 


figure(s) 


ICZN 


International Commission on 




Zoological Nomenclature 


nom. nud. 


nomen nudum 


N. syn. 


New synonymy 


pl(s). 


plate(s) 


p- 


page 


pers. comm. 


personal communication 


Rec. 


Recommendation (of the СосУе) 


S.I. 


sensu lato 


spm(s). 


specimen(s) 


s. str. 


sensu stricto 


subg. 


subgenus 



SYSTEMATIC CATALOG 
Family AMPULLARIIDAE Gray, 1824 

AMPULLARIIDAE Gray, 1824: 276. Type ge- 
nus Ampullaria Lamarck, 1799 [= Pila Röding, 
1798]. 

PILIDAE Preston, 1915: 96. Type genus Pila 
Röding, 1798. 

ICZN (1999a), following Cowie (1997a: 83 
88), confirmed the name Pilidae as a junior syn- 
onym of Ampullariidae and invalid. 



Genus ASOLENEOrbigny, 1838 

ASOLENE Orbigny, 1838d: 364. Type species: 
Helix platae Maton, 1 81 1 , by subsequent des- 
ignation of Gray (1 847: 148). 

AMPULLOIDEA Orbigny, 1841e: 379. New 
name ^or Asolane Orbigny, 1838 (see Pilsbry, 
1933:74). 

AMPULLOIDES Orbigny, 1842c: 1. Incorrect 
spelling oí Ampulloidea Orbigny, 1841. 

ASOLENA Herrmannsen, 1846a: 84. Incorrect 
spelling of /Aso/ene Orbigny, 1838. 

AMPULLAROIDES Gray, 1847: 148. Incorrect 
spelling oí Ampulloidea Orbigny, 1841 (see 
Pilsbry, 1933:74). 

Treated as a full genus following Berthold 
(1991: 23). Orbigny (1841e: 379) replaced 
Asolene with Ampulloidea, treating only platae 
Maton, 1811, but without explicitly saying that 
this was the only species and hence not desig- 
nating it as the type. Previously (Orbigny, 
1838d: 364), he had included two species 
(platae Maton, 1811, and celebensis Quoy & 
Gaimard, 1834 [the latter is now placed in Pila 
Röding, 1798]). 

brownii 
Ampullaria Brownii Jay, 1839: 112, pi. 1, fig. 4. 
River Amazon [= Brasil]. Syntype: AMNH 
561 07 (Boyko & Cordeiro, 2001 : 1 6) [labeled 
as "figd type" in Jay's handwriting (P. M. 
Mikkelsen, pers. comm. to RHC, 7 May 
2002)]; possible additional syntype material: 
MCZ. Distribution: Brasil. 

Remarks: Pain (1960: 430) stated that 
"[t]hrough the kindness of Dr. J. С Bequaert 
and Dr. W. J. Clench [both of the MCZ], I have 
been able to examine the type". This is not 
considered an inadvertent lectotype designa- 
tion because it is not specific as to the speci- 
men examined (Boyko & Cordeiro, 2001: 16). 
Synonym of crassa Swainson, 1823, teste 
Philipp! (1852a: 34), Paetel (1887: 477), 
Kobelt(1913f: 189) and Pain (1960: 429). 

crassa 
Ampullaria crassa Swainson, 1823a: pi. 136, 
upper and lower figs. [No locality given.] 
Syntypes ("the only specimen I have" and the 
specimen in "the figure of Martini" (Swainson, 
1823a: pi. 136): possibly MMUE (Dean, 1936: 
232; H. McGhie, pers. comm. to RHC, 28 
July 2002), not found by us in BMNH (cf. 
Dance, 1986: 227). Distribution: Brasil, Bo- 
livia, Peru, Equador, Colombia, Venezuela, 



NEWWORLDAMPULLARIIDAE 



47 



Guyana, Surinam, French Guiana (Baker, 
1914:661; Pain, 1960: 430; Geijskes & Pain, 
1957:45). 

Remarks. Placed in Limnopomus Dal! by 
Pain (1952: 31, 1960: 429) and Geijskes & 
Pain (1957: 45), but in Asolene Orbigny by 
Tillier(1980: 21), followed here. 

crassa 
Ampullaria crassa Orbigny, 1835a: 33. Rio 
Parana (república Argentina). Syntypes: 
BMNH 1854.12.4.332 (13 spms.) [labeled 
"roissyf]. 

Remarks. Junior primary homonym of 
crassa Swainson, 1823, and crassa 
Deshayes, 1830 [= Melantho ponderosa 
(Deshayes, 1825), teste Paetel (1887: 478); 
not Ampullariidae], replaced by roissyi 
Orbigny, 1841. Synonym of pa/c/?e//a Anton, 
1838, teste Gaudion (1879: 38), Ihering 
(1898: 50, 1919: 337) and Hylton Scott (1958: 
310). 

cyclostoma 
Ampullaria cyclostoma Spix, in Wagner, 
1827: 4, pi. 4, fig. 5. Brasilia. Syntype: ZSM 
20012075 (E. Schwabe, pers. comm. to 
RHC, 28 July 2002; see also Fechter, 1983: 
221). Distribution: Argentina, Paraguay, Uru- 
guay, Bolivia, Brasil (Paraguay-Parana drain- 
age) (Pain, 1960:430). 

Remarks. Authorship is given here as "Spix, 
in Wagner", following Cowie et al. (in prep.). 
Synonym 0^ platae Maton, 1811 , teste Hylton 
Scott (1958: 308) and S. С Thiengo (unpub- 
lished), followed here, although contrary to 
Pain (1960: 430), who retained it as a valid 
species in Limnopomus Dall, 1904, which is 
here treated as a synonym of Pomacea 
Perry, 1810. 

exumbilicata 
Helicina exumbilicata Spix, in Wagner, 1827: 

4, pi. 5, fig. 4. In aquis Provinciae Bahiensis. 
Type material: probably lost (S. С Thiengo, 
unpublished). 

Remarks: Authorship is given as "Spix, in 
Wagner", following Cowie et al. (in prep.), who 
also explain the publication history of this 
work. Spix illustrated exumbilicata as a valid 
species, but Wagner, in writing the deschption, 
treated it as a variety of crassa Swainson, 
1823. Synonym of crassa Swainson, 1823, 
teste Philippi (1852a: 73) and Pain (1950b: 
72), although the latter cited Spix's pi. 4, fig. 2. 
fasciolata 
Helix fasciolata Spix, in Wagner, 1827: 4, pi. 

5, fig. 1. In aquis Provinciae Bahiensis. Type 



material: probably lost (S. С Thiengo, unpub- 
lished). 

Remarks. Authorship is given here as "Spix, 
in Wagner", following Cowie et al. (in prep.), 
who also explain the publication history of this 
work. Spix illustrated fasciolata as a valid spe- 
cies, but Wagner, in writing the descriptions, 
treated it as a variety of crassa Swainson, 
1823. Synonym of crassa Swainson, 1823, 
teste Pain (1950b: 72), although he cited pi. 
5, fig. 2. 

+ gallardoi 
Ampullaria pulchella Ga//ardo/ Ihering, 1919: 
337. curso inferior del río Paraná hasta 
Corrientes, del Chaco Argentina y del señor 
A. de W. Bertoni, de la Asunción. Type mate- 
rial: not found by us in MACN, not found by us 
in MZUSP (cf. Dance, 1986: 214). Distribu- 
tion: Argentina, Bolivia (Hylton Scott, 1958: 
311). 

granulosa 
Ampullaria granulosa Sowerby, 1894: 49, pi 
4, fig. 24. Cayenne. Lectotype (Pain, 1949b 
pi. 2, figs. 5, 6; see also Tillier, 1980: 20) 
BMNH 1894.6.11.1. Distribution: Guyana 
Surinam, French Guiana (Vernhout, 1914a 
43; Pain, 1952: 30; Geijskes & Pain, 1957 
46; Tillier, 1980:20) 

Remarks. Placed in Limnopomus Dall by 
Pain (1952: 31) and Geijskes & Pain (1957: 
45). Placed here in Asolene following Tillier 
(1980: 17). The original description was not 
explicitly based on a single shell, so the 
specimen figured by Pain as the "type" must 
be considered a lectotype {Code Art. 74.6, 
Rec. 73F). 

impervia 
Ampullaria impervia Philippi, 1851: 17, pi. 4, 
fig. 7 [1852b: 21]. Brasilien. Syntype: ZSM 
20012067 (E. Schwabe, pers. comm. to 
RHC, 28 July 2002). Distribution: "Brésil" 
(Gaudion, 1879: 31), "Bolivia, etc." (Sowerby, 
1909a: 353). 

Remarks. Synonym of crassa Swainson, 
1823, teste Pain (1960: 429). 

montícola 
Ampullaria crassa var. montícola Vernhout, 
1914b: 47, pi. 1 [not pi. 2, as indicated in the 
text], fig. 15a, b. Mount Cottica on the right bank 
of the Lawa ... altitude of 450 m ... French 
Guyana. Holotype: RMNH; paratype(s): RMNH. 
Distribution: French Guyana (Tillier, 1980: 21). 
Remarks. Three specimens were men- 
tioned in the text, but only two were figured. 
These were RMNH no. 1 32 (fig. 1 5a) and no. 



48 



COWIE&THIENGO 



131 (fig. 15b), but neither was specified as 
being the holotype. Synonym of crassa 
Swainson, 1823, teste Tillier (1980: 21). 

naticoides 
Ampullaha naticoides Orbigny, 1835a: 33. Un- 
available name; first published as a junior syn- 
onym oi platae [as Platea] Maton, 1811 , not 
made available before 1961 (Coc/e, Art. 11.6). 
Syntypes: BMNH 1854.12.4.337 (7 spms.). 

Remarks. Locality given by Orbigny (1835a: 
33) as "Rio de la Plata, provincia Buenos- 
Ayres (república Argentina)". Treated as a 
synonym of platae Maton, 1811, by Orbigny 
(1841e: 379), Paetel (1887: 480), Sowerby 
(1909a: 356), Pilsbry (1933: 74) and Hylton 
Scott (1958: 308). 

+ nubila 
Ampullaria nubila Reeve, 1856c: pi. 14, fig. 
65. River Salomoens. Syntypes: BMNH 
20020672 (2 spms.). Distribution: Brasil, Bo- 
livia, Peru (Pain, 1960:430). 

Remarks. Subspecies of crassa 
Sv^/ainson, 1823, teste Pain (1960: 430). 

oblonga 
Ampullaria {Pomus) crassa var. oblonga 
Nevill, 1884: 11. Brazil; Amazon Rv. Type ma- 
terial: possibly NZSI, not found by us in BMNH 
(cf. Dance, 1986: 220). Distribution: Brasil. 

Remarks. Junior primary homonym of 
oblonga Swainson, 1823. Synonym of crassa 
Swainson, 1823, teste Paetel (1887: 480). 

olivieri 
Ampullaria Olivieri Deshayes, 1830a: 31. 
Cayenne. Type material: probably lost (Tillier, 
1980: 16). Distribution: French Guiana. 

Remarks. Synonym of crassa Swainson, 
1823, teste Deshayes (1838: 548), Philippi 
(1852a: 34), Paetel (1887: 480) and Sowerby 
(1909a: 347). 

ormophora 
Ampullaria ormophora Morelet, 1857: 30. 
Nova Caledonia [error]. Syntype: BMNH 
1893.2.4.1805. Distribution: Brasil (from 
syntype label). 

Remarks. No ampullariids are known from 
New Caledonia, which has therefore been 
considered in error (Crosse, 1871: 185). Ten- 
tatively place in Asolene Orbigny, based on 
the syntype label, on which is written "= 
nubila Reeve". 

petiti 
Ampullaria Petiti Crosse, 1891 : 214, pi. 4, fig. 
2. in flumine Amazonidum, Americas meri- 
dionalis. Type material: MNHN (Sowerby, 
1909b: 363) [not found by us]; topotype: 
MNHN ("coll. Jousseaume"; Tillier, 1980: 19). 



Remarks. Sowerby (1909a: 356) thought it to 
be "perhaps a variety of /\. impen/la, Phil." but 
subsequently (Sowerby, 1909b: 363) consid- 
ered the two taxa distinct. Synonym of crassa 
Swainson, 1823, teste Pain (1960: 429), but 
treated here as a valid species, following 
Berthold (1991: 250; see also Tillier, 1980: 21). 

platae 
Helix Platae Maton, 1811 : 331 , pi. 24, figs. 16, 
17. America australi ... Rio de la Plata. Type 
material: location not known to us. Distribu- 
tion: Paraguay (Martens, 1857: 200; Paetel, 
1873: 65, 1888: 481); Paraná (Pilsbry, 1933: 
74); La Plata (Sowerby, 1909a: 356; Pilsbry, 
1933: 74); La Plata and southern Brasil, 
"sistema del río Paraná" (Ihering, 1919: 333). 

pulchella 
Ampullaria pulchella Antou, 1838: 50. [No lo- 
cality given]. Type material: location not 
known to us. Distribution: Rio Parana, La 
Plata, Bolivia (Sowerby, 1909a: 348). 

Remarks. Synonym of cyclostoma Spix, in 
Wagner, 1827, teste Pain (1960: 430), but 
treated here as a valid species in Asolene, 
following Hylton Scott (1958: 310) and 
Berthold (1991: 250). 

roissii 
Ampullaria roissii Orbigny, 1838c, pi. 52, figs. 
1-3. Unavailable name; incorrect original 
spelling of ra/ssy/ Orbigny, 1838. 

roissyi 
Ampullaria roissii Orbigny, 1838c, pi. 52, figs. 
1-3 [given as "Roissyi" by Orbigny (1841e: 
377)]. New name for crassa Orbigny, 1835, 
non Swainson, 1823, non Deshayes, 1830. 
Disthbution: Rio Parana, Argentina (Orbigny, 
1835a: 33). 

Remarks. The name roissyi, as given by 
Orbigny (1841e: 377), was an incorrect sub- 
sequent spelling {Code, Art. 33.3); it was not 
an emendation, as it was not demonstrably 
intentional (Code, Art. 33.2). However, "roissyi' 
is in prevailing use, attributed to Orbigny, and 
is therefore deemed the correct original spell- 
ing {Code, Art. 33.3.1 ). Variety of cyclostoma 
Spix, 1827, teste Sowerby (1909a: 348). Syn- 
onym of cyclostoma Spix, 1827, teste Pain 
(1960: 430). Synonym of pulchella Anton, 
1838, teste Philippi (1852a: 33), Ihering (1898: 
50, 1919: 337) and Hylton Scott (1958: 310), 
followed here. 

sloanii 
Ampullaria Sloanii Férussac, 1827: 413. Un- 
available name; nom. nud. 

Remarks. Listed as from "Cayenne" by 
Férussac (1827: 413), Jay (1836: 47; 1839: 



NEW WORLD AMPULLARIIDAE 



49 



65; 1850: 283), Drouët (1859: 84), Gaudion 
(1879: 40) and Paetel (1888:481). Listed as 
a synonym of crassa Swainson, 1823, by 
Tillier(1980:21). 

solida 
Ampullaria solida Busch, 1859: 168. Ecuador. 
Syntypes: BMNH 20020683 (2 spms.). Distri- 
bution: Ecuador (Miller, 1879: 149). 

Remarks. Synonym of crassa Swainson, 
1823, teste Pain (1960: 429). 

sowerbyi 
Ampullaria son/erby/ Vernhout, 1914a: 29, pi. 
1, fig. 13 [holotype]. Lawa. Holotype: RMNH. 
Distribution: Surinam. 

Remarks. The description is explicitly 
based on only a single specimen. The "type" 
(i.e., the single specimen) is indicated as be- 
ing in RMNH, and a specimen, which must be 
this single specimen, is figured. Synonym of 
granulosa Sowerby, 1894, teste Pain (1952: 
30), Geijskes & Pain (1957: 45) and Tillier 
(1980:20). 

spixii 
Ampullaria Sp/x// Orbigny, 1838d: 376, pi. 52, 
figs. 7, 8. New name for zonata Orbigny, 
1835, поп Spix, 1827. Distribution: "Sistema 
del Plata у del rio Paraná ... Puerto Bertoni, 
Alto Paraná, en Rio Grande do Sul ... у en el 
río Uruguay" (Ihering, 1919: 336). 

Remarks. Synonym of cyclostoma Spix, 
1827, teste Sowerby (1909a: 348), but treated 
here as a valid species, following Hylton Scott 
(1958: 312) and Berthold (1991: 250). 

Storeria 
Ampullaria Storeria Jay, 1839: 112, pi. 1, fig. 
5. River Amazon [= Brasil]. Probable syntype: 
AMNH 56107 (Boyko & Cordeiro, 2001: 16) 
[labeled as "figd type" in Jay's handwriting (P. 
M. Mikkelsen, pers. comm. to RHC, 7 May 
2002)]. Distribution: Brasil. 

Remarks. Considered a variety of platae 
Maton, 1811, by Jay (1850: 283). Philippi 
(1852a: 34, 63) could not decide its status as 
a real species or a synonym of p/atee Maton, 
1811. Treated here as a synonym oí platae 
Maton, 1811, following Martens (1857: 210) 
and Gaudion (1879: 37). 

zonata 
Ampullaria zonata Orbigny, 1835a: 32. Rio 
Parana (república Argentina). ..Lacubus 
provinciœ Corrientes (república Argentina). 
Syntypes: BMNH 1854.12.4.327-329 (28 
spms.) [labeled "sp/x//"], MNHN (2 lots, 8 
spms.), MCZ (2 spms.) [labeled as para- 
types]. 

Remarks. Junior primary homonym oí zonata 
Spix, 1827; replaced by sp/x// Orbigny, 1838. 



Genus FELIPPONEA Dall, 1919 

FELIPPONEA Dall, 1919: 10. Type species: 
Ampullaria (Felipponea) neritiniformis Dall, 
1919, by monotypy. 

Considered a synonym of Asolene Orbigny, 
1 838, by Pilsbry (1 933: 74), but treated here as 
a full genus with three included species, fol- 
lowing Hylton Scott (1958; 317) and Berthold 
(1991:23,250). 

el on да ta 

Ampullaria {Felipponea) elongata Dall, 1921: 
133. Uruguay River, Dept. of Paysandú. Holo- 
type: USNM 333024. Distribution: Uruguay. 

Remarks. Junior primary homonym of 
elongata Orbigny, 1842, which is here listed 
under Pomacea Perry, 1810. 

iheringi 
Asolene iheringi Pilsbry, 1933: 73, pi. 2, figs. 
7 [paratype], 8 [paratype], 9 [holotype], 9a [ho- 
lotype]. Rapids of Butni, Rio Uruguay, be- 
tween San Borja and Uruguayana, Rio 
Grande do Sul, Brazil. Holotype [figured and 
distinguished by measurements given in the 
text]: ANSP 1 2461 5 ["1 2461 5a" (Baker, 1 964: 
168)]; paratypes; ANSP 365363 (3 spms.). 
Distribution: Southern Brasil. 

neritiniformis 
Ampullaria {Felipponea) neritiniformis Dall, 
1919: 10. Rio Uruguay, Department of 
Paysandu. Holotype: USNM 332780; 
topotype: ANSP 141211 (Pilsbry, 1933: 76). 
Distribution: Uruguay River basin: Argentina, 
Brasil, Uruguay (Hylton Scott, 1958: 318; 
Faracoetal.,2002). 

Genus MARISA Gray, 1824 

MARISA Gray, 1824: 276. Type species: Helix 

cornuahetis Linnaeus, 1758, by subsequent 

designation of Gray (1847: 148). 
CERATODES Guilding, 1828: 537, 540. Type 

species: Helix cornuahetis Linnaeus, 1758, 

by original designation. 

Gray (1824: 276) established Marisa "for a 
genus of shells which has been confused with 
Ampullaria, but which differs from it in having a 
horny operculum and simple peristome". That 
is, he was establishing Marisa for American 
ampullariids, distinguishing them from Old 
World species with a calcified operculum, 
which are now placed in Pila Röding, 1798. 
[Ampullaria Lamarck, 1799, is a junior objective 
synonym oí Pila Röding, 1798 (Cowie, 1997a; 



50 



COWIE&THIENGO 



ICZN, 1999a; and see below under Pomacea 
Perry, 1810)]. Martens (1899: 424) took Gray's 
Marisa to have been "intended for all American 
Ampullariœ", but incorrectly considered it jun- 
ior to Ceratodes Guilding, 1828, because of 
the date of establishment of cornuarietis 
Linnaeus, 1758, as the type species. Dall 
(1904: 52) misinterpreted Ampullaria as refer- 
ring to American species with a horny opercu- 
lum, and Marisa to "cover Ampullaria s.s." 
[what would now be called Pomacea Perry, 
1810], and, incorrectly, to exclude 
cornuarietis, which he considered, again in- 
correctly, to have "so persistently and inaccu- 
rately been asserted to be the type of Marisa". 
Modern usage restricts Marisa Gray, 1824, to 
those species related to the type, cornuarietis 
Linnaeus, 1 758, and places the majority of the 
remaining American species in Pomacea 
Perry, 1810 (with a small number in Asolene 
Orbigny, 1838, Felipponea Dall, 1919, and 
Pomella Gray, 1847). 

The type species of Marisa Gray, 1824, has 
been considered as Marisa intermedia Gray, 
1824, by monotypy (e.g., Pilsbry & Bequaert, 
1927: 169; Baker, 1930: 11; Berthold, 1991: 
249), whereas in fact cornuarietis Linnaeus, 
1758, was also an originally included species, 
as Pilsbry (1933: 72) realized. Dall (1904: 52) 
misinterpreted Marisa Gray as not including 
cornuarietis Linnaeus, 1758. Gray (1847: 148) 
designated cornuarietis Linnaeus, 1758, as the 
type of Marisa Gray. Ceratodes Guilding, 1828, 
was established with two species included: 
fasciatus Guilding, 1828, and cornuarietis 
Linnaeus, 1758; the latter was explicitly desig- 
nated as the type, contrary to the statement of 
Berthold (1991 : 249) that the type was estab- 
lished by monotypy. Hence, Ceratodes 
Guilding, 1 828, is a junior objective synonym of 
Marisa Gray, 1824. 

Berthold (1991: 25, 159) included only two 
species {cornuarietis Linnaeus, 1758, and 
planogyra Pilsbry, 1933) in his summary of the 
genus, but although he illustrated (pp. 1 2-1 3) a 
third species, chiquitensis Orbigny, 1838, he 
apparently considered this (p. 249) to be part of 
the wide range of morphological variation in 
cornuarietis Linnaeus, 1758. 

chiquitensis 
Ampullaria Chiquitensis Orb\gny, 1838d: 367, 
pi. 48, figs. 10, 11. sud-est de la province de 
Chiquitos (république de Bolivia) ... entre les 
Missions de San-Miguel e de San-José ... à 
peu près de la première Mission, dans le lac 



de los Migueleños, et dans les marais des 
environs. Syntypes: BMNH 1854.12.4.326 (9 
spms.), MNHN (1 spm.). Distribution: Bolivia 
(Berthold, 1991: 13). 

Remarks. Described in genus Ampullana, 
subgenus Ampullaria s. str., and within a sec- 
tion {Ceratodes) composed of "Espèces 
déprimées", but as the binomen "Ceratodes 
Chiquitensis". Thus, the original combination 
could be considered to be with either 
Ampullaria or Ceratodes. Since the species 
was explicitly described within the genus 
Ampullaria, we prefer Ampullana chiquitensis 
as the original combination (cf. Petit & 
Harasewych, 1990: 69). Retained as a dis- 
tinct species by Pilsbry (1933: 72) but here 
considered a synonym of cornuarietis 
Linnaeus, 1758, following Sowerby (1909a: 
359) and Berthold (1991 : 249). 

contrarius 
Planorbis contrarius Müller, 1774: 152. [No 
locality given]. Syntypes: the specimens fig- 
ured by Seba, as cited by Müller; locations 
unknown, possibly Uppsala University 
(Dance, 1986:225). 

Remarks. Synonym of cornuarietis 
Linnaeus, 1758, teste Orbigny (1835a: 30), 
Anton (1838: 50) and Gaudion (1879: 27). 

cornuarietis 
Helix Cornu ahetis Linnaeus, 1758: 771. O. 
Europaso [error; "probably Venezuela, but 
certainly somewhere between the Guianas 
and Colombia" (Pilsbry, 1933: 71)]. Type ma- 
terial: the specimen(s) figured by Lister, re- 
ferred to by Linnaeus (1758: 771) (Pilsbry, 
1933: 71); lost (Dance, 1967: 21). Distribu- 
tion: northern South America, including Co- 
lombia, Venezuela, Guyana, Surinam [? 
error; Geijskes & Pain (1957: 47)], French 
Guiana, Bolivia, Brasil, Trinidad and Tobago 
(Pilsbry, 1933:71-72). 

Remarks. Ihering (1919: 333) appears to 
have incorrectly recorded this species south 
of the Amazon basin, from the Rio Paraguay, 
Rio de la Plata, and Rio Grande do Sul. 

fasciatus 
Ceratodes fasciatus Guilding, 1828: 540, pi. 
supp. 28, figs. 4-7 in fluviis Americas aequinoc- 
tialis. Type material: not found by us in BMNH 
(cf. Dean, 1936: 234; Dance, 1986: 213). 

Remarks. Synonym of cornuarietis 
Linnaeus, 1758, teste Guppy (1866: 44), and 
here retained as such despite being consid- 
ered a subspecies (as knorrii Philippi, 1852) 
of cornuarietis Linnaeus, 1758, by Baker 
(1930: 26). Junior secondary homonym of 



NEW WORLD AMPULLARIIDAE 



51 



fasciata Roissy, 1805, when both species are 
placed in Pomacea (e.g., Baker, 1930: 26). 

intermedia 
Marisa intermedia Gray, 1824: 276. Brazils. 
Syntype: BMNH 1895.11.6.1 [although 
Berthold (1991: 249) stated "Typus ... 
verschollen ist"]. 

Remariis. Pilsbry (1933: 72) considered 
intermedia Gray, 1824, to be "doubtless an 
Effusa, but ... unrecognizable specifically". 
Berthold (1991 : 249) treated intermedia Gray, 
1824 [Marisa] as different from intermedia 
Férussac [Pomacea subgenus Effusa], con- 
sidering the former (incorrectly) as the type of 
the genus Marisa Gray. Either a junior syn- 
onym of cornuarietis Linnaeus, 1758, or a 
senior synonym o\ planogyra Pilsbry, 1933, 
teste Berthold (1991: 249). 

i<norrii 
Ampullaria Knom/ Philippi, 1852a: 57, pi. 18, 
fig. 3 [1852b: 28]. die Insel Trinidad. Type 
material: probably MNHNS. Distribution: Ven- 
ezuela, Guyana, Surinam, Trinidad, Colom- 
bia, Panama (Baker, 1930: 26). 

Remarl<s. Synonym of cornuarietis 
Linnaeus, 1758, teste Guppy (1866: 44) and 
Sowerby (1909a: 359), or of fasciatus 
Guilding, 1828, teste Philippi (1852a: 57) and 
Baker (1930: 26). 

planogyra 
Marisa planogyra Pilsbry, 1933: 70, pi. 2, figs. 
2-5a. Santa Rosa, in the Descalvados region 
of Matto Grosso. Holotype: ANSP 158776 
[158776a (Baker, 1964: 168)]; paratypes: 
ANSP 158780 (16 spms.), 158787 (19 
spms.), 365366 (3 spms., from holotype lot), 
MCZ(1 spm.). Distribution: Brasil. 

rotula 
Ampullaria rotula Mousson, 1869: 183. 
unteren Magdalenstrome [= Lower 
Magdalena river, Colombia]. Syntypes: ZMZ 
525321 (3 spms.). Distribution: Panama, 
Costa Rica (Pilsbry, 1933: 71), Colombia 
(Martens, 1899:425). 

Remarks. Mousson (1873: 19) placed it in 
Ceratodes Guilding, 1828. Synonym of 
cornuarietis Linnaeus, 1758, teste Sowerby 
(1909a: 359), and retained here as such de- 
spite being considered a distinct, closely re- 
lated species or subspecies of cornuarietis 
Linnaeus, 1758, by Pilsbry (1933: 71). 

Genus POMACEA Perry, 1810 

POMACEA Perry, 1810c: [unnumbered plate 
and text] [= pi. 12 (Mathews & Iredale, 1912: 



11; Clench & Turner, 1956: 120; Geijskes & 
Pain, 1957: 42; R. E. Petit, pers. comm. to 
RHC, 1 6 October 2000); not pi. 1 1 , as stated 
by Cowie (1997a: 84)]. Type species: 
Pomacea maculata Perry, 1810, by mono- 
typy. 

CONCHYLIUM Cuvier, 1816: 426. Type spe- 
cies Nerita urceus Müller, 1774, by subse- 
quent designation of Pilsbry & Bequaert 
(1927: 170) [as Bulimus urceus Bruguière]. 

LIMNOPOMUS Dall, 1904: 52. Type species: 
Ampullaria columellaris Gould, 1848, by origi- 
nal designation. 

The status of the genus-group names 
Ampullaria Lamarck, 1799, and Ampullarius 
Montfort, 1810, both frequently used incorrectly 
in combination with names of species of 
Pomacea, have been clarified by Cowie 
(1997a) and ICZN (1999a) as junior objective 
synonyms of Pila Röding, 1798 (see also Pain, 
1956b: 79). Pomus "Humph." Gray, 1847, is 
also a junior objective synonym of Pila Röding, 
1798. Limnopomus Dall, 1904, is here treated 
as a synonym o^ Pomacea Perry, 1810, follow- 
ing Berthold (1991). 

The distinction between the two subgenera 
Pomacea s. str. and Pomacea (Effusa) is not 
clear. Only those species that have been ex- 
plicitly placed in subgenus Effusa are listed 
under that heading. Others whose placement 
is uncertain are listed under Pomacea s. str., 
pending further research. Many of the more 
obscure species-group names have never be- 
fore been placed in combination with the ge- 
nus-group name Pomacea, because of the 
traditional but incorrect use of the genus-group 
name Ampullaria for these American species 
(Cowie, 1997a; ICZN, 1999a). Hence many of 
the species listed here are probably new com- 
binations with Pomacea. 

Subgenus EFFUSA Jousseaume, 1889 

EFFUSA Jousseaume, 1889: 255. Type spe- 
cies: Helix glauca Linnaeus, 1758, by subse- 
quent designation of Baker (1930: 11 ). 

Baker (1930: 20) considered luteostoma 
Swainson, 1823, to be distinct from glauca 
Linnaeus, 1758, but the luteostoma of most 
other authors, including Jousseaume (1889: 
255), to be misidentifications of glauca 
Linnaeus, 1758. Subsequent authors have syn- 
onymized luteostoma Swainson, 1823, with 
glauca Linnaeus, 1758 (see below). 



52 



COWIE&THIENGO 



baeri 

Ampullaria ßaer/ Dautzenberg, 1902: 312, pi. 
9, figs. 12, 13. Rio Mixiollo [= Misciotto; 
Berthold, 1991: 13], province de Huallaga, 
Pérou. Lectotype (Fischer-Piette, 1950: 170): 
MNHN; paralectotypes: ANSP 99328 (1 
spm.), MCZ (1 spm.), UMMZ 46767 [? error], 
ZMHB 59269 (1 spm.); possible 
paralectotypes: ZMHB 63631 (2 spms.), 
109517 (1 spm.) (M. Glaubrecht, pers. 
comm. to RHC, 1 March 2003). Distribution: 
Peru (Berthold, 1991: 13). 

Remarks. Probably synonymous with 
glauca Linnaeus, 1758, teste Boss & 
Parodiz (1977: 116), but not definitively syn- 
onymized. 

balteata 
Ampullaria balteata Philippi, 1851: 21, pi. 5, 
fig. 7 [1852b: 22]. [No locality given. Trinidad 
"chosen" by Baker (1930: 25).] Lectotype 
(Baker, 1930: 25): the specimen illustrated in 
"Philippi's first figure" [= pi. 5, fig. 7], probably 
MNHNS. Distribution: "Trinidad; also shells 
from Venezuela . . . , Colombia . . . , Tobago . . . , 
and Martinique ... that are intermediate be- 
tween this form and neritina" (Baker, 1930: 
25); also "Venezuela - Guyane - Maroni - 
Orenoque" (Gaudion, 1879: 24). 

Remarks. Baker (1930: 25) explicitly ex- 
cluded the later figures of Philippi (1 852a: 55, 
pi. 17, fig. 4). Although the precise origin of 
the designated lectotype is unknown. Baker's 
choice of Trinidad as the type locality follows 
Code Rec. 76A.1.4. Synonym of luteostoma 
Swainson, 1823 [= glauca Linnaeus, 1758], 
teste Paetel (1887: 477) and Alderson (1925: 
6), but treated as a form of glauca Linnaeus, 
1758, by Sowerby (1909a: 350) and Baker 
(1930: 25). Synonym of glauca Linnaeus, 
1758. N.syn. 

castanea 
Ampullaria castanea Deshayes, 1830a: 31. 
[No locality given.] Syntype: MNHN. Distribu- 
tion: "Orinocco" (Philippi, 1852a: 41); "La 
Guyane - Haut-Brésil = Haut-Amazone" 
(Gaudion, 1879: 26); "Guyana" (Paetel, 1873: 
64, 1887: 477); "unknown" (Baker, 1930: 22). 
Remarks. Synonym of luteostoma 
Swainson, 1823 [= glauca Linnaeus, 1758], 
teste Jay (1850: 36), or possibly of neritina 
Gmelin, 1791 [= glauca Linnaeus, 1758], 
teste Baker (1930: 22). Synonym of glauca 
Linnaeus, 1758. N. syn. 

chlorostoma 
Ampullaria chlorostoma Sowerby, 1825: 44. 
Unavailable name; first published as a junior 



synonym oí luteostoma Swainson, 1823, not 
made available before 1961 (Code Art. 11.6). 

cingulata 
Ampullaria cingulata Philippi, 1851: 19, pi. 5, 
fig. 3 [1852b: 22]. [No locality given.] Syntype; 
ZMHB 1376 (1 spm.) (M. Glaubrecht, pers. 
comm. to RHC, 1 March 2003). Distribution: 
Venezuela (Martens, 1857: 203; 1873: 202). 
Remarks. Sowerby (1909a: 347) consid- 
ered it a "doubtful species which may possi- 
bly be young of A. gigas", but it was 
considered a valid species and placed in 
subgenus Effusa by Baker (1930: 10). Baker 
(1930; 10) considered "Lago de Valencia, 
Ven. [= Venezuela]" as the type locality. This 
was probably correct because Philippi (1851: 
19) described the species from material in 
the Berlin Museum, and Martens (1873: 202) 
gave this as the only known locality for mate- 
rial in the Berlin Museum. However, Martens 
(1873: 202) also indicated that some of the 
material was without locality data. Strictly 
then, the type locality probably includes the 
above location but may not be restricted to it. 

cónica 
Ampullaria effusa variety cónica Guppy, 
1866: 44 [by bibliographic reference to 
Guppy, 1864: 244]. Trinidad. Type material: 
probably Victoria Inst., Trinidad [destroyed], 
not found by us in BMNH (cf. Dance, 1986: 
213). Distribution; Trinidad. 

Remarks. Junior primary homonym of 
cónica Lamarck, 1804 [also 1822] (now 
placed in family Naticidae), cónica Swainson, 
1823 [= virens Lamarck, 1822 (Philippi 
(1852a: 73)] (now placed in Pila Röding, 
1798), and cónica Wood, 1828 [Ampullaria 
cónica selected as the correct original com- 
bination by Cowie (1997b: 4)] (now placed in 
Pila Röding, 1798). Synonym of neritina 
Gmelin, 1791 [= glauca Linnaeus, 1758], 
teste Baker (1930:22). Synonym of glauca 
Linnaeus, 1758. N. syn. 

crocostoma 
Ampullaria crocostoma Philippi, 1852a: 42, pi. 
12, fig. 3 [1852b; 26]. Caraccas. Possible 
syntypes; ZMHB 109501 (3 spms.) (M. 
Glaubrecht, pers. comm. to RHC, 1 March 
2003) [the largest shell is very similar to the 
original figure (F. Köhler, pers. comm. to RHC, 
6 March 2003)]; possibly also MNHNS. Distri- 
bution: Venezuela, Guyana (Pain 1950b: 71). 
Remarks. Synonym of glauca Linnaeus, 
1758, teste Baker (1930: 18) and 
Starmühlner (1988; 253), followed here, al- 
though treated as a variety ofthat species by 



NEW WORLD AMPULLARIIDAE 



53 



Pain (1950b: 69). See also Boss & Parodiz 
(1977: 116). 

cuprina 
Ampullaria cuprina Reeve, 1856e: pi. 1 , fig. 1 . 
[No locality given.] Syntypes: BMNH 
20020652 (2 spms.). Distribution: unknown. 
Remarks. Synonym of glauca Linnaeus, 
1758, teste Starmühlner (1988: 253), fol- 
lowed here, although considered a variety of 
that species by Sowerby (1909a: 351 ). 

dubia 
Ampullaria dubia Guilding, 1828: 539, pi. 
supp. 27, figs. 7, 8. in fluviis Annericae 
aequinoctialis ... small river in the Gulph of 
Paria ... canals of Demorara [Baker (1930: 
15-16), in designating the lectotype, re- 
stricted the type locality to the "Gulf of Paha, 
probably one of distributaries of Rio 
Orinoco"]. Lectotype (Baker, 1930: 15): the 
specimen in Guilding's fig. 7, not found by us 
in BMNH (cf. Dean, 1936: 234; Dance, 1986: 
213). Distribution: Guyana, Surinam, Rio 
Orinoco, St. Lucia (Lesser Antilles), 
Guadeloupe (Baker, 1930: 16). 

Remarks. Synonym of luteostoma 
Swainson, 1823 [= glauca Linnaeus, 1758], 
teste Sowerby (1909a: 350). Synonym of 
glauca Linnaeus, 1758, teste Starmühlner 
(1988: 254), followed here (see also Baker, 
1930: 12, 15), despite Alderson (1925: 3) and 
Pain (1950b: 70) considehng it unidentifiable. 

effusa 
Nerita effusa Müller, 1774: 175. [No locality 
given. Rio Yaracuy, Ven. [= Venezuela] cho- 
sen by Baker (1930: 17).] Syntypes: the 
specimens figured by Seba and Geve, as 
cited by Müller, and the specimens "In Museo 
Moltkiano" (Müller, 1774: 176; see also Baker, 
1930: 17) [not in the Copenhagen Museum 
(O. S. Tendahl, pers. comm. to RHC, 1 8 AphI 
2002)]; not the specimen illustrated by Lister, 
as cited by Müller, nor ANSP 50596 (Baker, 
1930: 17). Distribution: French Guiana [? er- 
ror], Surinam [? error] (Drouët, 1859:79), 
Martinique (Saulcy, 1854: 141; Paetel, 1887: 
478), Venezuela (Baker, 1930: 17), Guyana 
(Pain, 1950b: 65). 

Remarks. Baker (1930: 17) considered the 
locality of ANSP 50596 as the type locality, 
but although this action was not a valid neo- 
type designation (Code Art. 75) and the origin 
of the true type material is unknown, his 
choice of the type locality appears to follow 
Code, Rec. 76A.1.4. Synonym of glauca 
Linnaeus, 1758, teste Swainson (1823a: pi. 
157), Philippi (1852a: 43) and Starmühlner 



(1988: 253), followed here (see also Baker, 
1930: 12, 17), contrary to Sowerby (1909a: 
350) who treated it as a variety of that spe- 
cies. Gmelin (1791: 3626) listed effusa 
Müller, 1774, as variety "y" of ampullacea 
Linnaeus, 1758, which is now placed in Pila 
Röding, 1798. However, Philippi (1852a: 43) 
and Starmühlner (1988: 253), in listing 
Gmelin's variety as a synonym of glauca 
Linnaeus, 1758, gave it as "ampullaria var. y. 
Gm" and "/-/e//'x ampullaria var. j", respec- 
tively; and Gaudion (1879: 29), in listing it as 
a synonym of effusa Müller, 1 774, gave it as 
"Helix ampullaria var Gmel". These usages 
of "ampullaria" are misspellings of 
"ampullacea" . 

expansa 
Ampullaria expansa Miller, 1879: 152, pi. 15, 
fig. 6. Rio Santiago prope Playa de oro, in 
provincia Esmeraldas. Type material: location 
not known to us. Distribution: Ecuador (Miller, 
1879: 152; Sowerby, 1909a: 349). 

Remarks. Placed in subgenus Effusa fol- 
lowing Kobelt (1913a: 147), who placed it in 
his "Formenkreis der Ampullaria glauca L. 
(Effusae Martens)". Junior primary homonym 
of expansa Nevill, 1877, which is now placed 
in P//a Röding, 1798. 

geveana 
Ampullaria Geveana Philippi, 1852a: 26. 
Unjustified emendation of gevesensis 
Deshayes, 1838. 

Remarks. Philippi (1852a: 26) explicitly 
made the emendation. However, the original 
name is here considered a result of incorrect 
latinization, which is not treated as an inad- 
vertent error and therefore not a justification 
for emendation {Code Art. 32.5.1). As an 
emendation, geveana Philippi, 1852, is avail- 
able and a junior objective synonym of 
gevesensis Deshayes, 1838 {Code Art. 
33.2.3.), and hence a synonym of glauca 
Linnaeus, 1758, as indicated by Starmühlner 
(1988:253). 

gevesensis 
Ampullaria Gevesensis Deshayes, 1838: 
541. [No locality given.] Syntype: MNHN. Dis- 
tribution: French Guiana (Sowerby 1909a: 
350), Guyana, Venezuela "in all probablility ... 
from Venezuela in the north, southwards to 
the Amazon Valley" (Pain, 1950b: 71), 
Surinam (Pain, 1952; 31; Geijskes & Pain, 
1957:44). 

Remarks. Variety of g/auca Linnaeus, 1758, 
teste Sowerby (1909a: 350 [as 
"Geveanensis"]), Pain (1950b: 69) and 



54 



COWIE&THIENGO 



Geijskes & Pain (1957: 44). Synonym of 
effusa Müller, 1774 [= glauca Linnaeus, 
1758], teste Baker (1930: 17). Synonym of 
glauca Linnaeus, 1758. N. syn. 

glauca 
Helix glauca Linnaeus, 1758: 771. [No locality 
given. Rio Tuca, near Tucacas, Venezuela 
"chosen" by Baker (1930: 12, 18).] Type mate- 
rial: lost (Dance, 1967: 21). Distribution 
{glauca Linnaeus, 1758, and its varieties): 
Brasil, Bolivia, Colombia, Venezuela, Guyana, 
Surinam, French Guiana, Trinidad, Grenada, 
Barbados, Guadeloupe, Dominica, Martinique, 
St Lucia (Vernhout, 1914a: 43; Pain, 1950b: 
69; Geijskes & Pain, 1957: 44; McKillop & 
Harrison, 1980: 271; Tillier, 1980: 24; 
Starmühlner, 1984: 89-91, 1988: 254). 

Remarks. The designation by Baker (1930: 
19) of Knorr's figure as a neotype ["type"] was 
invalid (Code Art. 75). Hov\/ever, although the 
origin of the type material is unknown. Baker's 
choice of the type locality appears to follow 
Code, Rec. 76A.1.4. Baker (1930: 12-13) rec- 
ognized nine "forms" oi glauca Linnaeus, 1758, 
considering that "at least the first six of these 
are not geographic subspecies". Some of 
these "forms" are here treated as synonyms, 
others as undetermined infraspecific taxa. Be- 
cause glauca Linnaeus, 1758, is highly variable 
(e.g.. Arias, 1952: 64) revisionary study would 
probably synonymize all nine "forms". 

guadelupensis 
Ampullaria guadelupensis Martens, 1857: 
199. Caripe auf Guadeloupe. Syntypes: 
ZMHB 1385 (2 spms.) (M. Glaubrecht, pers. 
comm. to RHC, 1 March 2003); no type mate- 
rial found by us in BMNH or MCZ (cf. Dance, 
1986: 218). Distribution: Guadeloupe. 

Remarks. Synonym of glauca Linnaeus, 
1758, teste Baker (1930: 18) and Star- 
mühlner (1988: 253). 

intermedia 
Ampullaria intermedia Férussac, in Quoy & 
Gaimard, 1825d: 489, pi. 68, figs. 1-3. Brésil. 
Syntypes: MNHN (2 spms.). Distribution: 
Brasil (Berthold, 1991: 12). 

Remarks. Synonym of sórdida Swainson, 
1823, teste Orbigny (1835a: 31), Philippi, 
(1852a: 38), Sowerby (1909a: 357) and 
Thiengo (1989: 351), followed here, although 
contrary to Berthold (1991: 23), who treated it 
as a valid species in subgenus Effusa. 

luteostoma 
Ampullaria luteostoma S\Na\uson, 1823a: pi. 
157, top and bottom figs. [No locality given.] 
Type material: possibly MMUE (Dean, 1936: 



232; H. McGhie, pers. comm. to RHC, 29 
July 2002), not found by us in BMNH (cf. 
Dance, 1986: 227). Distribution: Venezuela, 
Guyana, French Guiana, Martinique, 
Guadeloupe (Pain, 1950b: 71). 

Remarks. Variety of glauca Linnaeus, 1758, 
teste Pain (1950b: 69, 71). Synonym of 
glauca Linnaeus, 1758, teste Boss & 
Parodiz (1977: 116), followed here. 

+ minúscula 
Fornácea (Effusa) glauca form minúscula 
Baker, 1930: 24, pi. 30. fig. 8. Quebrada 
Sucremo, a small, swampy brook in heavy 
forest near Boquerón, Venezuela (station 
number "H, VIM, b, 29"). Holotype: UMMZ 
92069; paratypes: ANSP 147706 (2 spms.), 
MCZ (1 lot, 3 spms.). Distribution: Venezu- 
ela. 

Remarks. Retained as a distinct infraspe- 
cific taxon, following Baker (1930: 12, 24) and 
pending further research. 

neritina 
Helix neritina Gmelin, 1791 : 3638. [No locality 
given. Belmont, near Port of Spain, Trinidad 
"chosen" by Baker (1930: 22).] Holotype: the 
specimen illustrated in "Kaemerer Conch. 
Rudolst. p. 185. n. 2. t. 11. f. 7." (cited by 
Gmelin), location not known to us. Distnbu- 
tion: ? Colombia, Venezuela, Trinidad, To- 
bago, St. Lucia, Martinique, Guadeloupe 
(Baker, 1930:22). 

Remarks. Synonym of glauca Linnaeus, 
1758, teste Philippi (1852a: 43), Paetel 
(1887: 480) and Starmühlner (1988: 253) 
(see also Baker, 1930: 12, 22). Although the 
locality of the holotype is unknown. Baker's 
choice of the type locality appears to follow 
Code, Rec. 76A.1.4. 

oculuscommunis 
Helix oculus communis Gmelin, 1 791 : 3621 . 
[No locality given. Rio Yaracuy, Venezuela, 
"chosen" by Baker (1930: 14).] Lectotype 
(Baker 1930:14): the specimen illustrated by 
"Seba (Thes., pi. 40, figs. 3-5)"; paralecto- 
types: the specimens illustrated in the other 
figures cited by Gmelin (1791: 3621). Distri- 
bution: Venezuela, Guyana, French Guiana 
(Baker, 1930: 14). 

Remarks. Baker (1930: 14) designated the 
lectotype; and, although the locality of this 
specimen is unknown, his choice of a type 
locality appears to follow Code Rec. 76A.1 .4. 
Synonym of glauca Linnaeus, 1758, teste 
Philippi (1852a: 43), Sowerby (1909a: 350) 
and Starmühlner (1988: 253) (see also Bak- 
er, 1930: 12, 14). Synonym of gei/esens/s 



NEWWORLDAMPULLARIIDAE 



55 



Deshayes, 1838 [= glauca Linnaeus, 1758], 
teste Pain (1950b: 69). 

oUglsta 
Pomacea {Effusa) oligista Pilsbry & Olsson, 
1953: 98, pi. 6, fig. 6. on the road ... from 
Cartagena to Barranquilla ... a freshwater lake 
known as the Ciénaga de Luruaco. Holotype: 
ANSP 189546 ["189546a" (Baker, 1964: 168)]; 
paratypes: ANSP 189547 (10 spms.), 365367 
(3 spms., figured). Distribution: Colombia. 

Remarks. Pilsbry & Olsson (1953: 98) gave 
measurements of the "type" and the largest 
"paratype" but gave no catalog numbers. 
Synonym oí planorbula Philippi, 1852, teste 
Pain (1956a: 76-77). 

orinoccensis 
Ampullaria or/noccens/s Troschel, 1848: 548. 
am obern Pomeroon. Syntypes: ZMHB 1384a 
(1 spm.), 1384b (3 spms.), 1384c (2 spms.) 
(M. Glaubrecht, pers. comm. to RHC, 1 
March 2003); possible syntypes: MCZ [la- 
beled as paratypes, but as "oronocoensis 
Reeve"]; type material possibly also in the 
Dohrn collection, Stettin Museum [destroyed; 
Dance, 1986: 210: 229]; no type material 
found by us in BMNH (cf. Dance, 1986: 210). 
Distribution: Guyana, Surinam, Venezuela 
(Vernhout, 1914a: 43; Pain, 1952: 30-31; 
Geijskes & Pain, 1957: 45), French Guiana 
(Tillier, 1980:27). 

Remarks. Name attributed to Ziegler by 
Troschel (1848: 548). Variously misspelled, 
e.g., as "Oronocensis" by Reeve (1856b: pi. 
10, fig. 45) and "Orinocensis" by Martens 
(1873: 204). Synonym of dubia Guilding, 
1828 [= glauca Linnaeus, 1758], teste Baker 
(1930: 15). Variety or subspecies of glauca 
Linnaeus, 1758, teste Pain (1950b: 70; 1952: 
31), Geijskes & Pain (1957: 44) and Tillier 
(1980: 26). Synonym of glauca Linnaeus, 
1758, teste Starmühlner (1988: 253 [as 
"oronocensis Reeve"]), followed here. 

pachystoma 
Ampullaria pachystoma Philippi, 1849: 17. 
Brasilia [? error]. Type material: probably 
MNHNS. Distribution: Brasil [? error]. 

Remarks. Synonym of luteostoma 
Swainson, 1823 [= glauca Linnaeus, 1758], 
teste Paetel (1887: 480) and Alderson( 1925: 
6). Variety of glauca Linnaeus, 1758, teste 
Sowerby (1909a: 350). Retained as a distinct 
species by Baker (1930: 16-17). Synonym of 
glauca Linnaeus, 1758, teste Starmühlner 
(1988:253), followed here. 

pattersoni 
Pomacea {Effusa) pattersoni Boss & 
Parodiz, 1977: 112, figs. 7-9. Vicinity of 



Yarina(6°172'S; 75°172'W), upstream from 
Isla Navarro, close to Rio Huallaga, Depart- 
ment of San Martin, Peru. Holotype: MCZ 
272900; paratype: MCZ 272918. Distribution: 
Peru. 

philippiana 
Pomacea (Effusa) glauca form pfiilippiana 
Baker, 1930: 14. canal near Georgetown, 
British Guiana. Holotype ANSP 70016 
["170016a" (Baker, 1964: 168)]; paratypes: 
ANSP 365368 (14 spms.). Distribution: 
Surinam to Orinoco and Guadeloupe (Baker, 
1930: 14). 

Remarks. Synonym of glauca Linnaeus, 
1758 (see Baker, 1930: 12, 14). N. syn. 

+ planorbula 
Ampullaria planorbula Philippi, 1852a: 26, pi. 
7, fig. 3 [1852b: 23]. [No locality given.] 
Syntype: ZMHB 2131 (M. Glaubrecht, pers. 
comm. to RHC, 1 March 2003). Distribution: 
"Payta" (Paetel, 1888: 481), "Para." 
(Sowerby, 1909a: 359). 

Remarks. Retained as a distinct infraspe- 
cifictaxon, following Baker (1930: 12, 24) and 
pending further research. Pilsbry (1933: 72) 
considered it "to be the young stage of some 
variety of P. {Effusa) glauca (L.)". 

prunulum 
Ampullaria prunulum Reeve, 1856c: pi. 18, 
fig. 82. New Granada [in 1856 = present-day 
Colombia and Panama]. Syntypes: BMNH 
20020679 (3 spms.). Distribution: Colombia 
and/or Panama. 

Remarks. Synonym of glauca Linnaeus, 
1758, teste Starmühlner (1988: 253), fol- 
lowed here, although considered a variety of 
that species by Pain (1950b: 69). 

quinindensis 
Ampullaria quinindensis Miller, 1879: 151, pi. 
15, fig. 5. Rio Quinindé qui influit in fluminem 
Esmeraldas. Type material: location not 
known to us. Distribution: Ecuador (Miller, 
1879: 152; Sowerby, 1909a: 357 [as 
"quinquidensis"]). 

rhodostoma 
Ampullaria rfiodostoma Appun, 1871: 141, 
548. Unavailable name; nom. nud. 

Remarks. Treated as a synonym of 
luteostoma Swainson, 1823, by Alderson 
(1925:6). 

suprafasciata 
Ampullaria geveana var. suprafasciata 
Kobelt, 1913b: 157, pi. 57, figs. 7, 8. [No lo- 
cality given.] Type material: possibly SMFD, 
ZMHB (Dance, 1986: 215), but not found in 
ZMHB (M. Glaubrecht, pers. comm. to RHC, 
1 March 2003). 



56 



COWIE&THIENGO 



Remarks. Synonym of glauca Linnaeus, 
1758, teste Baker (1930: 18). 

tamsiana 
Ampullaria Tamsiana Philippi, 1852a: 51, pi. 
16, figs. 1, 2 [1852b: 27]. Puerto Cabello. 
Syntype: ZMHB 109502 (1 spm.) [= pi. 16, fig. 
2], 109503 (2 spms.); possible syntypes 
109503 (2 spms.) [one of these ? = pi. 16, 
fig. 1] (M. Glaubrecht, pers. comm. to RHC, 1 
March 2003; F. Köhler, pers. comm. to RHC, 
6 March 2003), possibly also MNHNS. Distri- 
bution: Venezuela (Berthold, 1991). 

Remarks. Name attributed to Dunker by 
Philippi (1852a: 51; 1852b: 27). Synonym of 
glauca Linnaeus, 1758, teste Baker (1930: 
18,20). 

teres 
Ampullaria teres Philippi, 1849: 19. [No local- 
ity given.] Syntype: ZMHB 109504 (M. 
Glaubrecht, pers. comm. to RHC, 1 March 
2003); type material possibly also in MNHNS. 
Distribution: Cuba [? error] (Gaudion, 1879: 
40; Paetel, 1888: 482), "La Plat." [? error] 
(Paetel, 1873:65). 

Remarks. "Form" of glauca Linnaeus, 
1 758, teste Pilsbry (1 927a: 251 ). Synonym of 
neritina Gmelin, 1791 [= glauca Linnaeus, 
1758], teste Baker (1930: 22) (see also 
Baker, 1930: 12). Synonym of glauca 
Linnaeus, 1758. N. syn. 

trist i s 
Ampullaria efíusa variety tristis Guppy, 1866: 
44. Trinidad [in title of publication]. Type mate- 
rial: probably Victoria Inst., Trinidad [de- 
stroyed], not found by us in BMNH (cf. Dance, 
1986: 213). Distribution: Trinidad. 

Remarks. Synonym of ner/í /ла Gmelin, 1791 
[= glauca Linnaeus, 1758], teste Baker 
(1930: 22) (see also Baker, 1930: 12). Syn- 
onym of glauca Linnaeus N. syn. 

villata 
A. villata Sowerby, 1909a: 350. Unavailable 
name; first published as a junior synonym of 
gevesensis Deshayes, 1838 [as "geveanen- 
sis"], not made available before 1961 {Code 
Art. 11.6). 

Remarks. Name attributed to Martens by 
Sowerby (1909a: 350) and listed as a syn- 
onym of gevesensis Deshayes, 1838 [= 
glauca Linnaeus, 1758]. Not listed under Mar- 
tens' authorship by Ruhoff (1980: 564), the 
Zoological Record or Kabat & Boss (1997: 
365). 

Subgenus POMACEA Perry, 1810 

Details as for genus Pomacea Perry, 1810. 



acuta 
Ampullaria acuta Paetel, 1873: 64 [1887: 
476]. Unavailable name; nom. nud. 

Remarks. Name attributed to Menke by 
Paetel (1873: 64, 1887: 476), and by Gaudion 
(1879: 23), with locality "Vera Cruz". Not 
listed by Sowerby (1916: 70), Sherborn 
(1922-1933) or Ruhoff (1980: 123). 

aldersoni 
Pila (Pomacea) aldersoni Pain, 1946a: 180; 
pi. 6, figs. 1, 2. Ecuador, in a marsh near 
Santa Barbara, about 170 miles S.E. of 
Quito. Holotype and paratype (distinguished 
as such in the text and the only two speci- 
mens on which the description was based): 
BMNH 1946.6.24.25 (1 spm.), possibly 
NMW.Z. 1981. 118. 00091 (1 spm.) or 
NMW. 1955. 158.02411 (Melvill-Tomlin collec- 
tion, 1 spm.). Distribution: Ecuador. 

Remarks. The original label of NMW. 
1955.158.02411 states that it was collected in 
November 1939, whereas the type series 
was collected in January 1939; however, it 
does say "co-type". NMW.Z. 1981. 11 8.00091 is 
small compared to the type dimensions and is 
not the specimen figured (H. Wood, pers. 
comm. to RHC, 30 October 2001 ). 

amazónica 
Ampullaria Amazónica Reeve, 1856b: pi. 12, 
fig. 55. River Amazon. Syntype: BMNH 
20020645. Distribution: Amazon (Sowerby, 
1909a: 346). 

angulata 
Ampullaria angulata Jay, 1836: [85 (explana- 
tion of pi. 3)], pi. 3, fig. 7. Mexico [error]. 
Syntype: AMNH 56108 (Boyko & Cordeiro, 
2001: 16) [labeled as "figd pi. 3, fig. 7" in 
Jay's handwriting (P. M. Mikkelsen, pers. 
comm. to RHC, 7 May 2002)]. 

Remarks. Synonym of scalaris Orbigny, 
1835, teste Jay (1839: [116]), Martens (1857: 
202), Gaudion (1879: 23) and Ihering (1898: 
48), which has never been found as far north 
as Mexico. We therefore consider Jay's local- 
ity to be incorrect. 

angulata 
Ampullaria angulata Dunker, 1845: 188. 
reipublicae Argentinae. Type material: not in 
ZMHB (F. Köhler, pers. comm. to RHC, 6 
March 2003), not found by us in BMNH (cf. 
Dance, 1986:210). 

Remarks. Junior primary homonym of 
angulata Jay, 1836. 

angulata 
Ampullaria angulata Deshayes, 1850: 45, pi. 
72, fig. 23. [No locality given.] Type material: 
possibly École des Mines, not found by us in 



NEW WORLD AMPULLARIIDAE 



57 



BMNH or MNHN (cf. Dance, 1986: 210). Dis- 
tribution: unknown. 

Remarks. Junior primary liomonym of 
angulata Jay, 1836, and angulata Dunker, 
1845. Probably a synonym of scalaris 
Orbigny, 1835, and hence retained here as a 
South American species. 

angulata 
Pomus angulata H. Adams & A. Adams, 
1854c: 347. Unavailable name; nom. nud. 

Remarks. Name attributed to Jonas by H. 
Adams & A. Adams (1854c: 347). Not listed 
by Sowerby (1916: 70), Sherborn (1922- 
1933) or Trew (1992: 16). Perhaps the attri- 
bution to Jonas was in error, or Jonas' 
concept of the species was a mis- 
identification of one of the three taxa listed 
above. 

arata 
Ampullaria malleata var. Arata Fischer & 
Crosse, 1890: 235 [1888: pi. 44, fig. 6d, 6e; 
plate published without name], in Laguna de 
los Cocos, provinciœ Vera Cruz ..., in 
paludibus prope Palizada et San Geromino, 
provincias Yucatan ..., in paludibus fluminis 
Usumasinta, prope Balancan, provinciœ 
Tabasco. Type material: Sallé collection, not 
found by us in BMNH, MNHN, etc. (cf. Dance, 
1986: 209, 225). Distribution: Mexico. 

Remarks. Synonym oUlagellata Say, 1829, 
teste Baker (1922: 37) and Pain (1964: 227). 

+ archimedes 
Ampullaria Archimedes Spix, in Wagner, 
1 827: 1 , pi. 2, fig. 2. [No locality given.] Type 
material: probably lost (Philippi, 1851: 10; 
Fechter, 1983: 221; S. С. Thiengo, unpub- 
lished). Distribution: unknown. 

Remarks. Authorship is given here as "Spix, 
in Wagner", following Cowie et al. (in prep.), 
who also explain the publication history of this 
work. Spix illustrated archimedes as a full 
species, but Wagner, in writing the descrip- 
tions, treated archimedes "Spix" as a variety 
of zonata "Wagner". We retain it as an in- 
fraspecific taxon of zonata Spix, 1827, follow- 
ing Philippi (1 851 : 1 0) and Sowerby (1 909a: 
359), though they were synonymized by Mar- 
tens (1857: 202). 

armeniacum 
Ampullaria armeniacum Hupe, 1857: 69, pi. 
13, fig. 5. le fleuve des Amazones. Distribu- 
tion: "Haut-Amazone" (Gaudion, 1879: 24). 
Type material: not found by us in MNHN (cf. 
Dance, 1986:214). 

aulanieri 
Ampullaria Aulanieri Deville & Huppé, 1850: 
642, pi. 15, fig. 4. lac de Cruz Playa, sur la 



rivière de l'Ucayali (Pérou). Syntypes: MNHN 
(3 lots, 15 spms.). Distribution: Peru (Pain, 
1960:424). 
auriformis 
Ampullaria auriformis Reeve, 1856e: pi. 28, 
fig. 133a, b. Honduras. Syntype: BMNH 

20020646. Distribution: Honduras. 
Remarks. May be a variety of hopetonensis 

Lea, 1834, teste Sowerby (1909a: 346), but 
note the skepticism of Pain (1964: 225) re- 
garding this. 

aurostoma 
Ampullaria aurostoma Lea, 1856: 110. 
Carthagena. Syntypes: USNM 106299 [fig- 
ured by Lea (1866, pi. 22, fig. 4), labeled in 
the USNM as the holotype], USNM 106273 (11 
spms.) [labeled as paratypes], MCZ (1 lot) [la- 
beled as paratypes]. Distribution: Mexico [? 
error] (Paetel, 1887: 477), Colombia, Ven- 
ezuela (Baker, 1930: 9; Pain, 1956a: 78). 

Remarks. Also published by Reeve (1856e: 
pi. 28, fig. 131a, b), who said "Lea MS". Re- 
tained as a distinct species following Baker 
(1930: 8) and Pain (1956a: 78), contrary to 
Sowerby (1909a: 347) and Kobelt (1913a: 
145) who synonymized it with cerasum 
Hanley, 1854. Placed in subgenus 
Limnopomus Dall by Baker (1930: 8). 

australis 
Ampullaria australis Orbigny, 1835a: 32. 
lacubus Pampas meridionalibus Buenos- 
Ayres (república Argentina). Syntype: BMNH 
1854.12.4.335. Distribution: Argentina. 

Remarks. Synonym of insularum Orbigny, 
1 835, teste Sowerby (1 909a: 353), or a vari- 
ety of hopetonensis Lea, 1834 [= paludosa 
Say, 1829], teste Sowerby (1909a: 352; but 
see Pain, 1964: 225). Synonym of 
canaliculata Lamarck, 1822, teste Hylton 
Scott (1958: 299) and Cazzaniga (2002: 
73). 

autumnalis 
Ampullaria autumnalis Reeve, 1856a: pi. 4, 
fig. 16. [No locality given.] Syntype: BMNH 

20020647. Distribution: unknown. 
Remarks. Synonym of sórdida Swainson, 

1823, teste Sowerby (1909a: 357) and Kobelt 
(1913h:206). 
avellana 
Ampullaria avellana Sowerby, 1909a: 346 
[name], 360 [description], text fig. Lagunella, 
Venezuela. Syntypes: BMNH 1909.10.19.34 
(1 spm.) (see also Sowerby, 1909a: 359), 
HUJ 21519 (1 spm.) (H. Mienis, pers. comm. 
to RHC, 4 August 2002), MHNG 1093/99 (2 
spms.) (Y. Finet, pers. comm. to RHC, 22 
August 2002). Distribution: Venezuela. 



58 



COWIE&THIENGO 



Remarks. Junior primary homonym of 
avellana Lamarck, 1822 [not Ampullariidae 
(Sowerby, 1825: 44; Jay, 1850: 294)]. 

batabana 
Ampullaria batabana Paetel, 1887: 477. Un- 
available name; nom. nud. 

Remarks. Listed as from Cuba by Paetel 
(1887:477). 

belizensis 
Ampullaria Belizensis Crosse & Fischer, in 
Fischer & Crosse, 1888: [explanation of] pi. 
45, fig. 2, 2a-c [Crosse & Fischer, 1890: 110; 
see also Fischer & Crosse (1890: 231 , pi. 48, 
fig. 9, 9a)]. [No locality given, in colonia 
anglicâ Belize (Crosse & Fischer (1890: 
110).] Syntypes: MNHN (5 lots, 36 spms.) 
(see also Sowerby, 1909b: 363). Distribution: 
Belize. 

Remarks. Synonym of flagellata Say, 1829, 
teste Pain (1964: 227). 

brasiliensis 
Ampullaria Brasiliensis Paetel, 1887: 477. 
Unavailable name; nom. nud. 

bridgesij 
Ampullaria Bridgesil Reeve, 1856b: pi. 11, 
figs. 50, 51. Rio Grande, Bolivia. Lectotype 
(Pain, 1960: 425): BMNH 20010487 (shell fig- 
ured as no. 50 by Reeve); paralectotype: 
BMNH 20010488. Distribution: Brasil (Baker, 
1914:660), Bolivia. 

Remarks. Pain (1960: 425) considered the 
nominotypical subspecies oí bridgesil Reeve, 
1856, to be a rare and local form, with the 
subspecies diffusa Blume, 1957, being much 
more widespread. Sometimes synonymized 
with scalaris Orbigny, 1835 (e.g., Ihering, 
1898: 48), but almost certainly incorrectly. 

bulla 
Ampullaria bulla Reeve, 1856d: pi. 22, fig. 
104a, b. [No locality given but type material 
labeled as from Mexico.] Syntypes: BMNH 
20020648 (2 spms.). Distribution: Ecuador [? 
error] (Paetel, 1887: 477), Mexico (Sowerby, 
1909a: 346). 

buxea 
Ampullaria buxea Reeve, 1856e: pi. 23, fig. 
112. [No locality given.] Syntype: BMNH 
1907.10.28.210. Distribution: Colombia 
(Paetel, 1887: 477), Jamaica (Sowerby, 
1909a: 346). 

Remarks. Synonym of fasciata Roissy, 
1805, teste Pilsbry (1927a: 247), although 
considered a possible synonym of 
hopetonensis Lea, 1834, by Martens (1857: 
203). 



caliginosa 
Ampullaria caliginosa Reeve, 1856e: pi. 25, 
fig. 118. [No locality given.] Type material: not 
found by us in BMNH. Distribution: Florida 
(Walker, 1918: 124). 

Remarks. Synonym oí paludosa Say, 1829, 
teste Sowerby (1916: 70), followed here, 
though Pilsbry (1927a: 250) was not certain 
of this synonymy. 

camena 
Pomacea camena Pain, 1949a: 258; pi. 13, 
figs. 5, 6. shallow stream near Lagunella, 
Venezuela, at 800 metres. Holotype: BMNH 
1946.10.2.4 (Pain, 1949a: 258; incorrectly cit- 
ing BMNH 1946.10.2.3, which is the number 
of the holotype of vickeryi Pain, 1949, in both 
his paper and the BMNH register); paratypes 
(1 only mentioned by Pain (1949a: 258)): 
HUJ 21516 (1 spm.) (H. Mienis, pers. 
comm. to RHC, 4 August 2002), 
NMW.Z. 1981. 118. 00108 (Pain collection, 2 
spms.), NMW. 1955. 158.0241 2 (Melvill-Tomlin 
collection, 1 spm.), MCZ. Distribution: Ven- 
ezuela. 

Remarks. The holotype in the BMNH is not 
a close match to the specimen illustrated by 
Pain (1949a: figs. 5, 6), although the other 
two holotypes illustrated in Pain's paper are of 
the BMNH specimens (P. B. Mordan, pers. 
comm. to RHC, 2 November 2001 , 7 Febru- 
ary 2003). 

canaliculata 
Ampullaria canaliculata Lamarck, 1822a: 178. 
les rivières de la Guadeloupe [? error; per- 
haps Lago Guadeloupe, Argentina, not the 
Caribbean island of Guadeloupe (Pain, 
1946b: 58; Hylton Scott, 1958: 300; Thiengo 
et al., 1993: 68; Cazzaniga, 2002: 74)]. Pos- 
sible holotype: MHNG 1093/91 (Sowerby, 
1909b: 363; Mermod, 1952: 88; Y. Finet, pers. 
comm. to RHC, 24 October 1994, 22 August 
2002). Distribution: Argentina, Bolivia, Brazil, 
Paraguay, Uruguay (Hylton Scott, 1958: 301- 
303) [but ascertaining the true distribution of 
this variable species depends on detailed 
taxonomic study; e.g., Cazzaniga (1987)]. 

Remarks. Lamarck (1804: 32) also de- 
scribed a marine fossil from the Eocene of 
France as Ampullaria canaliculata, this spe- 
cies being the type species of Amauropsina 
Chelot, 1885, which is either in the Naticidae 
(Kabat, 1991: 426) or Ampullospiridae 
(Tracey et al., 1996: 116). An application 
(Cowie et al., 2001) was submitted to the 
ICZN to retain both names as valid (Cocie Art. 



NEW WORLD AMPULLARIIDAE 



59 



23.9.5), and this was so ruled by the ICZN 
(2002: 137). 

cassidiformis 
Ampullaha Cassidiformi Reeve, 1856b: pi. 
12, fig. 56. Lake of Maracaibo, Venezuela. 
Syntype: BMNH 20020649. Distribution: Ven- 
ezuela. 

Remarks. The original spelling, as given 
above, is considered incorrect, as it was 
clearly an inadvertent error [Code Art. 32.5.1] 
inasmuch as other species published by 
Reeve at the same time with similarly 
formed names did not lack the "s". The index 
to Reeve's work has "cassidiformis", but this 
was published later and therefore is to be 
considered as evidence external to the origi- 
nal publication. Synonym of eximia Dunker, 
1853, teste Baker (1930: 6). 

castelloi 
Ampullaha Castelloi Sowerby, 1894: 48, pi. 4, 
fig. 22. River Meta, S.E. of Bogota. Lectotype 
(Pain, 1949b: pi. 1, figs. 1, 2): BMNH 
1893.5.29.3 [possibly part of the type series 
but not the specimen originally figured by 
Sowerby; P. B. Mordan, pers. comm. to 
RHC, 7 February 2003]; possible paralecto- 
types: MCZ (1 lot) [labeled "? paratypes"]. Dis- 
tribution: Colombia, Surinam (Vernhout, 
1914a: 29, 41 , 43) [? error; Geijskes & Pain, 
1957:45). 

Remarks. Placed in Limnopomus Dall by 
Pain (1949b: 39). Sowerby (1894: 48) based 
his description on more than one shell ("... in 
some specimens [the umbilicus is] com- 
pletely closed"). Therefore, the specimen fig- 
ured by Pain (1 949b: pi. 1 , figs. 1 , 2) as the 
"type" must be considered a lectotype {Code 
Art. 74.5, Rec. 73F). 

castelnaudii 
Ampullaria castelnaudii Hupe, 1857: 65, pi. 
11 , fig. 1 . le fleuve des Amazones. Syntypes: 
MNHN (4 lots, 7 spms.). Disthbution: "Haut- 
Amazone" (Gaudion, 1879: 26). 

catamarcensis 
Ampullaria catamarcensis Sowerby, 1875: 
600, pi. 72, fig. 4. Catamarca (on the Andes 
of Peru) [? = Cajamarca (Peru); Cazzaniga 
(1987: 59-61)]. Syntypes: BMNH 1875.4.19.2 
(2 spms.). Distribution: Peru. 

Remarks. Placed in subgenus Limnopomus 
Dall by Cazzaniga (1987: 59-61 ). 

+ catemacensis 
Ampullaria patula catemacensis Baker, 
1922: 39, pi. 14, figs. 2-4, pi. 15. fig. 7. Lake 
Catemaco. Holotype (Baker, 1922: pi. 14, fig. 



2): UMMZ 31850; paratypes: UMMZ 31850 (5 
spms., not separated from the holotype), 
ANSP 133680 (4 spms.); topotypes: MCZ. Dis- 
tribution: Lake Catemaco, Mexico (Naranjo- 
Garcia & Garcia-Cubas, 1986: 603). 

cerasum 
Ampullaria cerasum Hanley, 1854: [unnum- 
bered page], Ampullaria pi. 2, fig. 7. [No lo- 
cality given.] Syntype: BMNH 1907.11.21.83. 
Distribution: Mexico (Martens, 1899: 421; 
Sowerby, 1909a: 347). 

Remarks. Not listed among Hanley's taxa 
by Norris & Dance (2002: 370). 

+ chamana 
Ampullaria lattrei chamana Hinkley, 1920: 53 
[1921: pi. 4, fig. 5]. Guatemala [in publication 
title]. Lectotype (Baker, 1964: 168): ANSP 
"46231" [error; correctly 46321] ; para- 
lectotypes: Bryant Walker collection. Mu- 
seum of the Illinois University, Hinkley 
collection (Hinkley, 1920: 54), ANSP 76238 (2 
spms.; originally 3 spms. in this lot), MCZ. 
Distribution: Guatemala. 

chiaquensis 
Pomacea canaliculata chaquensis Hylton 
Scott, 1948: 242. Madrejón de Ingeniero 
Juárez, Chaco salteño. Formosa. Syntypes 
["Cotipos"]: IMLA. Distribution: Argentina, Bo- 
livia (Hylton Scott, 1958: 304). 

Remarks. Synonym of canaliculata 
Lamarck, 1822, teste Cazzaniga (1987: 56). 

chemnitzii 
Ampullaria Chemnitzii Philippi, 1852a: 39, pi. 
10, fig. 5 [1852b: 25]. [No locality given. 4.5 
kilometers south ... from Tucacas "chosen" 
by Baker (1930: 5)] Lectotype: the specimen 
illustrated in "Philippi's figure" (Baker, 1930: 
5) Type material: probably MNHNS. Distribu- 
tion: Ecuador, Colombia, Venezuela (Pain, 
1956a: 75). 

Remarks. Although the origin of the desig- 
nated lectotype is unknown. Baker's (1930: 5) 
type locality choice (the locality being that of 
his own material) appears to follow Code Rec. 
76A.1.4. Synonym oí lineata Spix, 1827, teste 
Sowerby (1909a: 354) and Vernhout (1914a: 
27), but retained here as a distinct species, 
following Baker (1930: 5). 

chiapasensis 
Ampullaha malleata var. Chiapasensis 
Fischer & Crosse, 1890: 235, pi. 48, fig. 5. in 
paludibus prope Las Playas, in provincia 
Chiapas. Type material: Morelet collection, not 
found by us in BMNH or MNHN, not found in 
MHNG by Y. Finet (pers. comm. to RHC, 5 



60 



COWIE&THIENGO 



August 2002) (cf. Dance, 1986: 219). Distri- 
bution: Mexico. 

Remarks. Synonym of livescens Reeve, 
1856, tesie Pain (1964: 228). 

ci neta 
Ampullaria cincta Cristofori & Jan, 1832: 
[Section IIa, Pars la] 7, [Mantissa] 3. Jamaica. 
Type material: formerly MCSN [destroyed; A. 
Garassino, pers. comm. to RHC, 5 Septem- 
ber 2002]. Distribution: Jamaica. 

Remarks. Synonym of fasciata Roissy, 
1805, teste Pilsbry (1927a: 247). 

citreum 
Ampullaria citreum Reeve. 1856e: pi. 24, fig. 
116a, b. [No locality given.] Syntype: BMNH 
1907.11.21.83. Distribution: "Western Hemi- 
sphere" (Sowerby, 1909a: 347). 

columbensis 
Ampullaria Columbensis Jay, 1836: 47 [1839: 
65; 1850: 282]. Unavailable name; nom. nud. 
Remarks. South America given as locality 
by Jay (1836: 47). 

columbiensis 
Ampullaria columbiensis Philippi, 1851: 20, 
pi. 5, fig. 5. [No locality given; "West- 
kolumbien" on label in ZMHB] Syntypes: 
ZMHB 1343 (2 spms.) (M. Glaubrecht, pers. 
comm. to RHC, 1 March 2003), possibly also 
MNHNS. Distribution: possibly "Rio Pastása 
in Andibus ohentalibus" (Miller, 1879: 150), 
Colombia. 

Remarks. Name attributed to Sowerby by 
Philippi (1851: 20). Miller (1879: 150) dis- 
cussed his material under "Ampullaria aff. 
Columbiensis Phil.". Alderson (1925: 53) con- 
sidered it "unrecognized" but discussed it 
under interrupta Sowerby, 1909, which was 
placed in Limnopomus Dall, 1904, by 
Sowerby (1 909a: 361 ). We therefore include 
it tentatively in Pomacea Perry, 1810. 

columbiensis 
Ampullaria columbiensis Reeve, 1856b: pi. 5, 
fig. 25. Chiriqui, Veragua [Colombia]. 
Syntypes: BMNH 20020650 (2 spms.), MNHN 
(3 spms.). 

Remarks. Name attributed to Sowerby, MS. 
Junior primary homonym of columbiensis 
Philippi, 1851; replaced by martensiana 
Nevill, 1884. Also replaced by tristrami 
Fischer & Crosse, 1890, Fischer & Crosse 
(1890: 245) apparently being unaware of 
Nevill, 1884. Synonym of /7age//ate Say, 1829, 
teste Pain (1964: 227). 

columellaris 
Ampullaria columellaris Gould, 1848: 74. 
Province of Maynas, Peru. Lectotype 



(Johnson, 1964: 57): USNM 5547. Disthbu- 
tion: Peru. Bolivia, ? Ecuador (Pain, 1960: 
429). 

Remarks. Unless it can be determined that 
Gould based his description on only a single 
specimen, Johnson's (1964: 57) listing of the 
"holotype" in fact designated a lectotype 
(Code Art. 74.6, Rec. 73F). The type species 
of Limnopomus Dall, 1904, which is here 
considered a synonym of Pomacea Perry, 
1810. 

commissionis 
Amp. decussate var. commissionis Ihering, 
1898: 51. Iguape. Syntypes: ZMHB 109513 
(1 spm.), 109514 (2 spms.) (M. Glaubrecht, 
pers. comm. to RHC, 1 March 2003); no type 
material in MZUSP (cf. Dance, 1986: 214). 
Distribution: Brasil (Pilsbry, 1933: 74). 

Remarks. Raised to full species level and 
placed in Asolene Orbigny, 1838, by Kobelt 
(1913h: 202), but removed from Asolene 
Orbigny, 1838, by Ihering (1919: 341). 

conoidea 
Ampullaria conoidea Martens, 1899: 423, pi. 
24, figs. 10, 11. Costa Rica. Possible 
syntypes (description based explicitly on 2 
spms. only): ZMHB 21857 (2 spms.) (M. 
Glaubrecht, pers. comm. to RHC, 4 May 
2002, 1 March 2003). Distribution: Costa 
Rica. 

consolatrix 
Ampullaria consolatrix Ihering, 1919: 338. Fl. 
Uruguay, prope Itaquy, Rio Grande do Sul. 
Type material: not found by us in MZUSP (cf. 
Dance, 1986: 214). Distribution: Brasil. 

contamanoensis 
Ampullaria contamanoensis Preston, 1914: 
527. Contamano, Rio Ucayali, Eastern Peru. 
Syntypes: BMNH 1915.1.6.84, 

NMW.Z. 1981. 118. 00096 (Pain collection, 1 
spm.), not in HUJ, not found by us in UMMZ 
(cf. Dance, 1986: 206, 222). Distribution: 
Peru. 

Remarks. Synonym of aulanieri Deville & 
Huppé, 1850, teste Pain (1960: 424). 

cornucopia 
Ampullaria cornucopia Reeve, 1856e: pi. 1, 
fig. 4. Columbia [= Colombia]. Syntype: 
BMNH 20020651. Distribution: Colombia 
(Sowerby, 1909a: 347). 

costaricana 
Ampullaria costaricana Martens, 1899: 418, 
pi. 24, figs. 14-17. Nicaragua: Lake of Nicara- 
gua ... N.W. Costa Rica: Rio Saveyre, at 
Boca Culebra ... S.W. Costa Rica: Palmar, 
south of the Rio Grande de Terraba ... N. 



NEWWORLDAMPULLARIIDAE 



61 



Panama: Chiriqui. Syntypes: ZMHB 109507 
(1 spm.) [= fig. 16], 109508 (1 spm.) [= fig. 
15], 109509 (1 spm.) [= fig. 17], 109510 (1 
spm.) [= fig. 14], 109511 (7spms.), 109512(1 
spm.) (IVl. Glaubrecht, pers. comm. to RHC, 
1 March 2003; F. Köhler, pers. comm. to 
RHC, 6 March 2003); no type material found 
by us in BMNH or MCZ (cf. Dance, 1986; 
218). Distribution; Nicaragua, Costa Rica, 
Panama. 

Remarks. Additional localities in Costa Rica 
given by Martens (1 901 : 644). 

cousini 
Ampullaria Cousini Jousseaume, 1877; 185, 
pi. 3, fig. 3. la République de l'Equateur. 
Syntypes; MNHN (2 lots, 3 spms.). Distribu- 
tion; Ecuador (Sowerby, 1909a; 347). 

crosseana 
Ampullaha Crosseana Hidalgo, 1871; 206 
[1872: 142, pi. 7, fig. 1]. in fluvio Amazonum 
dicto, Americœ meridionalis. Syntypes: 
MNCN 15.05/11485(1 spm., figured), 15.05/ 
1047 (1 spm.) (Villena et al., 1997; 75). Dis- 
tribution: River Amazon (Sowerby, 1909a; 
348). 

Remarks. Synonym of maculata Perry, 
1810, teste Pain (1960: 423). 

cubensis 
Ampullaha cubensis Morelet, 1849: 24. prov. 
boreaiis insulae Cuba. Syntypes; BMNH 
1893.2.4.1675-6 (2 spms.). Distribution; 
Cuba [? error; Pilsbry, 1927a; 252]. 

Remarks. Synonym of teres Philippi, 1849, 
teste Paetel (1887; 478), and according to 
the syntype labels. However, Pilsbry (1927a; 
252) conclusively demonstrated that it is not 
teres Philippi, 1849 (nor cubensis Reeve, 
1856), but he was unable to locate the type 
material (see also cubensis Reeve, 1856) and 
hence considered the species too poorly 
known to place it in the synonymy of any 
known species. 

cubensis 
Ampullaha Cubensis Reeve, 1856c: pi. 18, 
fig. 83a, b. Cuba. Type material; not found by 
us in BMNH. Distribution: Cuba. 

Remarks. Junior primary homonym of 
cubensis Morelet, 1849, replaced by poeyana 
Pilsbry, 1927. Treated as a variety of glauca 
Linnaeus, 1758, by Sowerby (1909a: 350) 
and placed in the "Formenkreis" of glauca 
Linnaeus, 1758, by Kobelt (1913a; 150). Syn- 
onym of glauca Linnaeus, 1758, teste 
Starmühlner (1988; 253 [as "culemsis"]). 
Pilsbry (1927a; 251-252), followed here, re- 
tained poeyana Pilsbry, 1927, as a distinct 



species not in the "same section of the ge- 
nus [as glauca Linnaeus, 1758]" (i.e., subg. 
Effusa). It is possible that the syntypes listed 
under cubensis Morelet, 1849, although la- 
beled "Morelet", are syntypes of cubensis 
Reeve, as we found no type material labeled 
"cubensis Reeve" in the BMNH. If Pilsbry had 
thought this to be the case, it would explain 
his inability to find Morelet's material. How- 
ever, neither specimen matches Reeve's fig- 
ures. 

cumingii 
Ampullaha Cumingii King & Broderip, 1831: 
344. in Sinu Panamœ, (Island of Saboga, in a 
small hill-stream). Type material: not found by 
us in BMNH (cf. Dance, 1986; 215); topotype: 
USNM 4673 (Morrison, 1946; 6). Distribution: 
Mexico [? error], Panama, Ecuador [? error] 
(Sowerby, 1909a: 348). 

Remarks. Confusion over the type locality 
was clarified by Morrison (1952; 105-106), 
who considered the locality as originally pub- 
lished ("Saboga") to be correct. 

dacostae 
Ampullaha Da Costœ Sowerby, 1909a; 348 
[name], 359 [description], text fig. Costa 
Rica. Syntype; BMNH 1909.10.19.35 (see 
also Sowerby, 1909a: 359). Distribution: 
Costa Rica. 

decussata 
Ampullaha decussata Moricand, 1836: 445, 
pi. 2, figs. 26, 27. Bahia [in publication title; 
Lake Baril, Brasil, according to the label as- 
sociated with the MHNG syntypes]. Syntypes: 
HUJ 21518 (2 spms.) (H. Mienis, pers. 
comm. to RHC, 4 August 2002), MCZ (2 lots; 
one of them is 141866), MHNG 33484 (9 
spms.) (Y. Finet, pers. comm. to RHC, 26 
August 2002), MNHN (2 lots, 13 spms.), 
ZMHB 109516 (2 spms.) (M. Glaubrecht, 
pers. comm. to RHC, 1 March 2003). Distri- 
bution: Brasil (Sowerby, 1909a; 348). 

delattrei 
Ampullaha Delattrei Fischer & Crosse, 1890: 
246. pi. 48, fig. 7, 7a [1888; pi. 45, fig. 4, 4a]. 
Unjustified emendation of /aííre/ Reeve, 1856. 
Remarks. Although the name was given as 
" Delattrei' by Fischer & Crosse (1888: [expla- 
nation of] pi. 45, fig. 4), this was not explicitly 
an emendation. The emendation was explicit 
in Fischer & Crosse (1890; 246), and there- 
fore dates from 1890. Reeve (1856b: pi. 5, 
fig. 22) gave the collector's name incorrectly 
as "Lattre" and spelled the species name as 
"Lattrer. However, there is no evidence in the 
original publication of an inadvertent error 



62 



COWIE&THIENGO 



(Code Art. 32.5.1 ) that would justify the emen- 
dation. Although accepted by some (e.g., 
Martens, 1899: 419; Alderson, 1925:31), the 
emendation has not been accepted by others 
(e.g., Hinkley, 1920: 53; Pain, 1964: 229) and 
so cannot be considered to be in prevailing 
use; it is therefore an unjustified emendation 
(Code Art. 33.2.3. 1 ) and a junior objective syn- 
onym of lattrei Reeve, 1856. 

depressa 
Ampullaha depressa Say, 1824: 264, pi. 14, 
fig. 2. East Florida ... tributary to St. John's 
river, and on the plantation of Mr. Fatio ... Lake 
George. Lectotype (Clench & Turner, 1956: 
121; see also Baker, 1964: 168): ANSP 
50580; para lectotype: ANSP 365373. 

Remarks. Junior primary homonym of 
depressa Lamarck, 1804 [not Ampullariidae]. 
Replaced by paludosa Say, 1829. 

+ diffusa 
Pomacea bridges! diffusa Blume, 1957: 1, 
[unnumbered text figs.; holotype]. Lagune 
mitten in der Stadt St. Cruz, Bolivia. Holotype: 
ZSM 20011991; paratypes: ZSM 20011990 (4 
spms.) [? ex coll. Blumej; possible 
paratypes: ZSM 20011989 (c. 110 spms.) [? 
the "alle anderen Paratypoide" (Blume, 1957: 
2)]; Pain collection (1 spm.) (Blume, 1957: 2; 
E. Schwabe, pers. comm. to RHC, 28 July 
2002). Distribution: Brasil, Peru, Bolivia (Pain, 
1960:425). 

Remarks. Possibly a valid species (F. 
Naggs, pers. comm. to RHC, 9 July 2002). 
The true identity and origin of the snails cur- 
rently referred to widely as bridgesii Reeve, 
1856, in the domestic aquarium trade (Perera 
& Walls, 1996) is not known; they may be 
more correctly referred to diffusa Blume, 
1957. 

dilatata 
Ampullaria fasciata variété dilatata Orbigny, 
1842c: 4. Cuba [in publication title]. Type ma- 
terial: not found by us in BMNH (nor listed by 
Gray, 1 855: 27-29) or MNHN; not in MHNG (Y. 
Finet, pers. comm. to RHC, 20 August 2002) 
(cf. Dance, 1986: 219, 220). Distribution: 
Cuba. 

Remarks. Synonym oi paludosa Say, 1829, 
teste Pilsbry (1927a: 250). 

disseminata 
Ampullaria disseminata De Kay, 1843: 124. 
Unavailable name; first published as a junior 
synonym o^ paludosa Say, 1829, not made 
available before 1961 (Code Art. 11.6). 

Remarks. DeKay (1843: 124) attributed the 
name to Say as a manuscript name, but the 



name does not occur in Say's published writ- 
ings (Binney, 1858: [237], 1865: 5). 

dolioides 
Ampullaria Dolioides Reeve, 1856c: pi. 16, 
fig. 75a, b. Bombay [error]. Syntypes: BMNH 
20020653 (2 spms.). Distribution: Guyana, 
Surinam, French Guiana, Venezuela (Pain, 
1950b: 65; Geijskes & Pain, 1957: 43; Tillier, 
1980:29). 

Remarks. For a history of the interpretation 
ofthis species see Prashad (1925: 83; 1931: 
167). Considered a synonym of lineata Spix, 
1827, by Pain (1952: 31) but in error accord- 
ing to Geijskes & Pain (1957: 43), followed 
here, who treated it as a valid species, as did 
Tillier (1980: 29). 

dolium 
Ampullaria dolium Philippi, 1852a: 40, pi. 11, 
fig. 1 [1852b: 25]. Guyana, namentlich der 
Orinoco. Type material: probably MNHNS. 
Distribution: Guyana. 

Remarks. Synonym oí urceus Müller, 1774, 
teste Gaudion (1879: 41), Sowerby (1909a: 
358), Alderson (1 925: 1 0) and Baker (1 930: 2). 

dorbignyana 
Ampullaria Dorbignyana Philippi, 1852a: 65, 
pi. 21 , fig. 4. [The locality of Orbigny's speci- 
men; "die La Plata Staaten" (Philippi, 1852a: 
66)]. Holotype: the specimen illustrated in 
Orbigny's (1835a) figure (pi. 4, fig. 4), loca- 
tion not known to us. Distribution: "Brésil - 
Parana - Plata" (Gaudion, 1879: 35). 

Remarks. Philippi (1852a: 65) explicitly de- 
scribed this species on the basis of 
Orbigny's (1835a) figure. Philippi (1852a: 49) 
also named it "d'Orbignyf [= dorbignyi]. We 
select dorbignyana, the heading of Philippi's 
description and the more widely used alter- 
native (e.g., Alderson, 1925: 21), as the cor- 
rect original spelling. Synonym of canaliculata 
Lamarck, 1822, teste Ihering (1898: 49) and 
Sowerby (1909a: 348; 1909b: 363). 

dorbignyi 
Ampullaria d'Orbignyi Philippi, 1852a: 49. In- 
correct original spelling of dorbignyana 
Philippi, 1852. 

+ dysoni 
Ampullaria Dysoni Hanley, 1854: [unnum- 
bered page], Ampullaria pi. 2, fig. 5. Hondu- 
ras. Syntype: BMNH 1907.11.21.65. 
Distribution: Honduras (Martens, 1899:417; 
Pain, 1964:230). 

Remarks. Subspecies of flagellata Say, 
1829, teste Pain (1964: 230). Not listed 
among Hanley's taxa by Norris & Dance 
(2002:371). 



NEW WORLD AMPULLARIIDAE 



63 



electrina 

Ampullaria electrina Reeve, 1856c: pi. 20, fig. 
95a, b. [No locality given.] Syntypes: BMNH 
20020654 (3 spms.). Distribution: unknown. 
Remarks. Sowerby (1909a: 349) placed it in 
Pomacea [as Ampullaria]. 

elegans 
Ampullaria elegans Orbigny, 1835a: 33. Rio 
Piray, provincia Santa Cruz de la Sierra (re- 
publica Boliviana). Syntypes: BMNH 
1854.12.4.330 (3 spms.), MNHN (4 lots, 14 
spms.). Distribution: Bolivia. 

Remarks. Synonym of cyclostoma Spix, 
1827, teste Pain (1960: 430). 

elongata 
Ampullaria fasciata variété elongata Orbigny, 
1842c: 4. Cuba [in publication title]. Type ma- 
terial: not found by us in BMNH (nor listed by 
Gray, 1854: 17) or MNHN, not in MHNG (Y. 
Finet, pers. comm. to RHC, 20 August 2002) 
(cf. Dance, 1986: 220). Distribution: Cuba. 

Remarks. Synonym of paludosa Say, 1829, 
teste Pilsbry (1927a: 250). 

+ erogata 
Ampullaria erogata Crosse & Fischer, in 
Fischer & Crosse, 1888: [explanation of] pi. 
46, figs. 6, 6a, 7 [Crosse & Fischer, 1890: 
113; see also Fischer & Crosse (1890: 251 )]. 
[No locality given. Peten, Guatemalae ... 
Cacoprieto, in isthmo de Tehuantepecensi, 
reipublicae Mexicanae (Crosse & Fischer, 
1890: 113)]. Holotype: the specimen illus- 
trated by Crosse & Fischer, in Fischer & 
Crosse (1888, fig. 6, 6a), not found by us in 
MNHN. Distribution: as for flagellata Say, 
1829 (Pain, 1964:230). 

Remarks. Treated by Pain (1964: 229) as 
an "ecological race" of flagellata Say, 1829, 
occupying the same geographic range. De- 
termining its true taxonomic status requires 
further study. 

errónea 
Ampullaria errónea Nevill, 1877: 17. S. 
America. Holotype: NZSI. Distribution: South 
America. 

erythrostoma 
Ampullaria erythrostoma Reeve, 1856c: pl. 
13, fig. 59. Zanzibar [error (Sov^erby, 1909a: 
349; Pain, 1950b: 68)]. Type material: not 
found by us in BMNH. Distribution: Peru 
(Sowerby, 1909a: 349). 

Remarks. Synonym of guyanensis 
Lamarck, 1822, teste Sowerby (1909a: 349), 
Kobelt (1913f: 186) and Pain (1960: 427), and 
hence of urceus Müller, 1774 (see Tillier, 
1980:27). N.syn. 



eu miera 
Ampullaria eumicra Crosse & Fischer, 1890: 
113 [see also Fischer & Crosse (1890: 243, 
pl. 48, fig. 10, 10a)]. provincia Oajaca dicta, 
reipublicae Mexicanae. Syntypes: MNHN (4 
spms.). Distribution: Mexico. 

Remarks. Synonym of flagellata Say, 1829, 
teste Pain (1964: 227). 

exculpta 
Ampullaria malleata var. Exculpta Fischer & 
Crosse, 1890: 235 [1888: pl. 44, fig. 6, 6a-c; 
plate published without name], in Laguna de 
los Cocos, provinciœ Vera Cruz ..., in 
paludlbus prope Palizada et San Geromino, 
provinciae Yucatan ..., in paludibus fluminls 
Usumasinta, prope Balancan, provinciae 
Tabasco. Type material: Sallé collection, not 
found by us in BMNH, MNHN, etc. (cf. Dance, 
1986: 209, 225). Distribution: Mexico. 

Remarks. Synonym of flagellata Say, 1829, 
teste Baker (1922: 37) and Pain (1964: 227). 

eximia 
Ampullaria eximia Dunker, 1853: 93. die 
Provinz Coro am See von Maracaybo, 
Republik Venezuela. Syntypes: MCZ 125225, 
ZMHB 4039 (3 spms.) (M. Glaubrecht, pers. 
comm. to RHC, 4 May 2002, 1 March 2003). 
Distribution: Venezuela (Baker, 1930: 6). 

falconensis 
Pomacea falconensis Pain & Arias, 1958: 6, 
pl. 1, figs. 1-4, pl. 2, figs. 1-7. 5 km. SW de 
Chichiriviche, Estado Falcon, Venezuela 
(68 152' W; 10 502' N). Holotype: MHNS 
4000 (female); paratypes: MHNS 3499 (7 
spms.), NMW.Z. 1981. 118. 00116 (Pain col- 
lection, 4 spms.), MCZ 224267 (2 spms.); 
ZSM 20012070 (1 spm.) (E. Schwabe, pers. 
comm. to RHC, 28 July 2002). Distribution: 
Venezuela. 

fasciata 
Ampullaria fasciata Roissy, 1805: 374. les 
rivières de la Jamaïque, de la Guadeloupe et 
de Saint-Domingue [Haiti]. Type material: lo- 
cation not known to us. Distribution: Jamaica 
only, Guadaloupe and Haiti being incorrect 
(Pilsbry, 1927a: 248). 

Remarks. Pilsbry (1927a: 247) clarified the 
status of this species as being from Ja- 
maica, as Roissy had stated, and that it is 
not an Asian species in the synonymy of 
ampullacea Linnaeus, 1758 (which is now 
placed in Pila) as Sowerby (1909a: 354) had 
considered; that is, Roissy (1805: 374; see 
also Schumacher, 1817: 200) mistakenly in- 
cluded ampullacea Linnaeus, 1758, in his 
synonymy. 



64 



COWIE&THIENGO 



fasciata 
Ampullaria fasciata Reeve, 1856b: pi. 9, fig. 
41. [No locality given.] Lectotype (Kobelt, 
1914b: 220): BMNH 20020655. 

Remarks. Junior primary homonym of 
fasciata Roissy, 1805, and fasciata Lamarck, 
1816 [incertae sedis in family Ampullariidae]. 
Synonym of insularum Orbigny, 1835, teste 
Sowerby (1909a: 353). Kobelt (1914b: 220) 
designated the specimen in Reeve's pi. 9, fig. 
41 as a lectotype, copying the figure as his 
own pi. 77, fig. 1. 

ferruginea 
Ampullaria ferruginea Martens, 1857: 205. 
Unavailable name; nom. nud. 

Remarks. Attributed to "R. pi. 14" [= Reeve, 
1856b, pi. 14] with locality "Laplata". However, 
the name ferruginea" does not appear in 
Reeve's work. Gaudion (1879: 29) also listed 
the name and said "Reev [sic] Hab: La Plata" 
but with no other information. Not listed by 
Sowerby (1916: 71), Ruhoff (1980: 271) or 
Kabat& Boss (1997: 208). 

figulina 
Ampullaria figulina Spix, in Wagner 1827: 3, 
pi. 4, fig. 4. [Type locality as for lineata Spix, 
1827]. Syntypes: ZSM 20012063-5 (3 lots, 4 
spms.) (E. Schwabe, pers. comm. to RHC, 
28 July 2002; cf. Fechter, 1983: 221). Distri- 
bution: Brasil (Baker, 1914: 659). 

Remarks. Authorship is given here as "Spix, 
in Wagner", following Cowie et al. (in prep.), 
who also explain the publication history of this 
work. Spix illustrated figulina as a full species, 
but Wagner, in writing the description, treated 
figulina "Spix" as a variety of lineata 
"Wagner". Wagner at first sight appears to 
have also treated it as a synonym of his own 
new species-group name "minor". Cowie et 
al. (in prep.) discuss why this is not the case 
and why "minor" is not an available name. 
Alderson (1925: 29) considered figulina Spix, 
1827, impossible to identify with certainty. 
Synonym of lineata Spix, 1827, teste Pain 
(1960: 422), followed here, although he cited 
pi. 6, fig. 4. 

flagellata 
Ampullaria flagellata Say, 1829c: 260. Mexico 
... a short distance below Vera Cruz. Lecto- 
type (Pilsbry, 1891a: 325-326): ANSP 50645 
["50645a" (Baker, 1964: 168)]; paralectotype: 
ANSP 50645; topotypes: MCZ 139677. Distri- 
bution: Central America, from central Mexico 
to Panama, extending into northern Colombia 
(Magdelana drainage area) (Pain, 1964: 228; 



Naranjo-Garcia & Garcia-Cubas, 1986: 603). 
Remarks. Although Baker (1964: 168) con- 
sidered the type as fixed by monotypy ["TOM" 
(Baker, 1964: 149)], he also noted that this 
specimen was the "smaller and fresher of 
type lot", implying that there were additional 
specimens. Thus, Pilsbry (1891a: 325 326) 
in referring to a single specimen as "Say's 
type", and providing dimensions for it, desig- 
nated a lectotype (Code Art. 74.6), for which 
Baker (1964: 168) gave the catalog number. 

flatilis 
Ampullaria flatilis Reeve, 1856b: pi. 7, fig. 31 . 
Tabasco, Mexico. Syntype: BMNH 20020656. 
Distribution: Mexico. 

Remarks. Synonym of flagellata Say, 1829, 
teste Pain (1964: 227). 

flava 
Pomacea paludosa flava Smith, 1937: 147. 
canals near Pinecrest on the Tamiamai Trail. 
Central Everglades and near Miami, Florida. 
Lectotype (Baker, 1964: 168): ANSP 188992 
[as "188992a"]; paralectotype: ANSP 365372 
(2 spms.). Distribution: Florida. 

Remarks. Synonym of paludosa Say, 1829, 
teste Clench & Turner (1956: 120). 

fumata 
Ampullaria fumata Reeve, 1856e: pi. 26, fig. 
124a, b. Province of Chiapes [= Chiapas], 
Mexico. Type material: not found by us in 
BMNH. Distribution: Mexico. 

Remarks. Synonym oUlagellata Say, 1829, 
teste Pain (1964: 227). Discussed briefly by 
Strebel(1873:32). 

+ garciae 
Pomacea paludosa garciae Richards, 1933: 
169, fig. 21. swamp near the town of 
Mendoza (or Paso Real) about five kilome- 
ters from the terminus of the Ferro-Cariles 
Unidos de la Habana at Guane, Pinar del Rio, 
Cuba. Holotype: ANSP 160873 ["160873a" 
(Baker, 1964: 168)]; paratypes: ANSP 365371 
(2 spms.); topotype: MCZ. Distribution: Cuba. 

georgii 
Ampullaria Georgii Williams, 1889: 47. 
marshes near the La Plata, at Buenos Ayres, 
in the Argentine Republic. Type material: loca- 
tion not known to us. Distribution: Argentina. 

Remarks. Synonym of insularum Orbigny, 
1835, teste Sowerby (1909a: 353). 

ghiesbreghti 
Ampullaria Ghiesbrechtii Reeve, 1856e: pi. 
26, fig. 123. Province of Chiapes [= Chiapas], 
Mexico. Syntype: BMNH 20020657. Distribu- 
tion: Mexico, Guatemala (Pain, 1953: 222). 



NEW WORLD AMPULLARIIDAE 



65 



Remarks. Originally spelled ^'Ghiesbrechtii' 
but explicitly emended to "Ghiesbreghtr by 
Fischer & Crosse (1890: 233). Although there 
is no evidence in the original publication of an 
inadvertent error (Code Art. 32.5.1 ) that would 
justify the emendation, the emendation is in 
prevailing use attributed to Reeve (e.g., 
Pllsbry, 1893: 338; Alderson, 1925: 44; Pain, 
1953: 222, 1964: 228) and is therefore 
deemed to be a justified emendation {Code 
Art. 33.2.3.1). Synonym of //Vescens Reeve, 
1856, teste Pain (1964: 228). 

gigantea 
Ampullana ? gigantea Barbosa Rodrigues, 
1892: 52. avec ÏEmys macrococcygeana ... 
à la même époque géologique ... ; dans les 
ravins des environs du Rio Nanay; Loreto- 
Yacu, dans l'étage tertiaire [probably near 
Loreto on the upper Amazon in Peru, above 
the junction with the Rio Javari (Boss & 
Parodoz, 1977: 111)]. Type material: may 
have been lost (Patterson, 1936: 50; Boss & 
Parodiz, 1977: 111). Distribution: Peru. 

Remarks. Fossil, probably Pliocene (Boss 
& Parodiz, 1977: 111). Junior secondary 
homonym of g/ganteus Tristram, 1864. 

giganteus 
Pomus g/ganteüs Tristram, 1864: 414. Lake 
Peten, Vera Paz [Guatemala]. Type material: 
not found by us in BMNH (cf. Dance, 1986: 
229). "Paratype" (Pain, 1953: 222) [? = 
syntype]: NMW.Z.1 981 . 1 1 8.001 25 (Pain col- 
lection, 1 spm.). Distribution: Guatemala. 

Remarks. Synonym of livescens Reeve, 
1856, teste Pain (1964: 228). 

gigas 
Ampullaria gigas Spix, in Wagner, 1827: 1 , pi. 
1 , figs. 1 , 2. In flumine Amazonum. Type ma- 
terial: formerly in ZSM but probably lost 
(Alderson, 1925: 16; Fechter, 1983: 221; S. 
С. Thiengo, unpublished); possible syntype: 
MHNG 33489 (1 spm.) (Y. Finet, pers. comm. 
to RHC, 26 August 2002). Distribution: Brasil 
(Sowerby, 1909a: 350; Baker, 1914: 659). 

Remarks. Authorship is given here as "Spix, 
in Wagner", following Cowie et al. (in prep.). 
Synonym of macúlala Perry, 1810, teste 
Pilsbry (1927b: 63), Pain (1956a: 79, 1960: 
423), Geijskes & Pain (1957: 42) and Boss & 
Parodiz (1977: 112), contra Ihering (1919: 
334), who synonymized it with insularum 
Orbigny, 1835. 

gossei 
Ampullaria Gossei Reeve, 1856c: pi. 20, fig. 
93a, b. Jamaica. Syntypes: BMNH 20020658 



(3 spms.). Distribution: Jamaica (Sowerby, 
1909a: 351; Pilsbry, 1927a: 249). 

guaduasensis 
Ampullaria guaduasensis Auäerson, 1928: 
23, pi. 1, figs. 19, 20. near San Juan de Rio 
Seco, on the east border of the upper valley 
of the Magdalena River, Colombia. Holotype: 
CAS 2721. Distribution: Colombia. 

Remarks. Pleistocene fossil (Boss & 
Parodiz, 1977: 118). 

gualtieh 
Amp. Gua/i/er/ Orbigny, 1835a: 32. Unavail- 
able name; first published as a junior syn- 
onym of canaliculata Lamarck, 1822, not 
made available before 1961 (Code, Art. 11.6). 
Remarks. Name attributed to Sowerby by 
Orbigny (1835a: 32) but we have been un- 
able to find it in any Sowerby work. 

guatemalensis 
Ampullaria flagellata var. guatemalensis Mar- 
tens, 1899: 413, pi. 22, fig. 11, 11a. N. Guate- 
mala: Panzos ... Cahabon ... W. Guatemala: 
Paso Antonio, in the lower part of the Rio 
Michatoya, near the Pacific coast ... Cerro 
Zunil. Syntypes: MCZ [labeled as paratypes], 
ZMHB 109505 (4 spms.), 109506a (8 spms.), 
109506b (1 spm.) (M. Glaubrecht, pers. 
comm. to RHC, 1 March 2003; F. Köhler, 
pers. comm. to RHC, 6 March 2003); no type 
material found by us in BMNH (cf. Dance, 
1986: 218). Distribution: Guatemala. 

Remarks. Synonym of flagellata Say, 1 829, 
teste Sowerby (1909a: 352 [as "Morelet ?"]). 

guyanensis 
Ampullaria Guyanensis Lamarck, 1822a: 
176. les rivières de la Guyane. Lectotype 
(Tillier, 1980: 27): MHNG 1093/90 (Y Finet, 
pers. comm. to RHC, 27 August 2002) (see 
also Sowerby, 1909a: 349; Mermod, 1952: 84; 
Pain, 1960: 427); probable paralectotypes: 
MNHN (2 spms., "coll. Lamarck"; 1 spm., 
"coll. Buffon"; see also Tillier, 1980: 27). Dis- 
tribution: Brasil, Peru, Colombia, Venezuela, 
Guyana, French Guiana (Pain, 1960: 427). 

Remarks. Subspecies of urceus Müller, 
1774, teste Pain (1960: 426) and Geijskes & 
Pain (1957: 47). Synonym of urceus Müller, 
1 774, teste Tillier (1 980: 27), followed here. 

haemastoma 
Ampullaria haemastoma Reeve, 1856b: pi. 7, 
fig. 34. Peru. Syntype: BMNH 20020659. Dis- 
tribution: Peru. 

Remarks. Synonym of guyanensis 
Lamarck, 1822, teste Sowerby (1909a: 351; 
1909b: 363) and Alderson (1925: 12), and 



66 



COWIE&THIENGO 



hence of urceus Müller, 1774 (see Tlllier, 
1980:27). N.syn. 

hanleyana 
Ampullaria hanleyana A\dersor\, 1926: 42. 
Type material: lost ["Hanley's type" is lost 
(Pain 1951: 146)]. Distribution: Brasil (Pain, 
1960:424). 

Remarks. Introduced as a new name for 
swainsoni Hanley, 1854. However, Hanley 
(1854: [unnumbered page], Ampullaria pi. 1, 
fig. 1 ) clearly indicated that he thought he was 
illustrating swainsoni Philippi, 1852, not a new 
species. Thus, swainsoni Hanley, 1854, is not 
a homonym of swainsoni Philippi, 1852, as 
Alderson (1926: 42) thought, but a 
misidentification. Alderson's (1926: 42) new 
name and citing of Hanley's figure therefore 
constitutes the original description of this spe- 
cies. Not listed by Morris & Dance (2002: 377). 

hanleyi 
Ampullaria Hanleyi Reeve, 1856e: pi. 23, fig. 
113. [No locality given.] Type material: not 
found by us in BMNH. Distribution: Rio 
Paraná (Ihering, 1919: 336). 

Remarks. Synonym of pulchra Griffith & 
Pidgeon [as "Gray"], 1834, teste Alderson 
(1925:33, 1926:42). 

haustrum 
Ampullaria haustrum Reeve, 1856b: pi. 5, fig. 
23. River Marañen. Possible syntype: BMNH 
20020660. Distribution: Brasil, Bolivia, Peru 
(Pain, 1960:422-423). 

Remarks. Synonym of canaliculata 
Lamarck, 1822, teste Ihering (1898: 49) and 
Thompson (1 997: 91 ), but here retained as a 
distinct species because of its reported pro- 
duction of green eggs, in contrast to the pink 
eggs of canaliculata Lamarck, 1822 (Cowie, 
2002). 

hollingsworthi 
Pila (Pomacea) hollingsworthi Pain, 1946a: 
180; pl. 6, figs. 3-5. Colombia, in a swiftly 
flowing stream with a rocky bed near Bogota. 
Holotype: BMNH 1946.6.24.24; paratype: 
NMW.Z.1981. 118. 00198 (H. Wood, pers. 
comm. to RHC, 30 October 2001). Distribu- 
tion: Colombia. 

Remarks. Belongs in Limnopomus Dall, 
1904, teste Pain (1946a: 181), although Pain 
agreed with Alderson (1925: 1) that 
Limnopomus Dall, 1904, is not a distinguish- 
able taxon. 

hondurasensis 
Ampullaha Hondurasensis Reeve, 1856a: pl. 
3, fig. 15. Honduras. Syntypes: BMNH 
20020662 (2 spms.). Distribution: Honduras, 



Guatemala (Nevill, 1884: 9), Nicaragua (Mar- 
tens, 1899:420). 

Remarks. Synonym of flagellata Say, 1 829, 
teste Pain (1964: 227). 

hopetonensis 
Ampullaha Hopetonensis Lea, 1834: 115, pl. 
19, fig. 84. Hopeton, near Darien, Georgia. 
"Paratypes": MCZ 151580 (Clench & Turner, 
1956: 121). Distribution: USA (Georgia). 

Remarks. Synonym o^ paludosa Say, 1829, 
teste Alderson (1925: 29), Pilsbry (1927a: 
249) and Clench & Turner (1956: 120). 

immersa 
Ampullaha immersa Reeve, 1856b: pl. 11, fig. 
52. Rio Grande, Bolivia. Syntypes: BMNH 
20020663 (1 spm.), MCZ [labeled as 
"cotypes"]; topotypes: MCZ. Distribution: Bo- 
livia (Sowerby, 1909a: 351). 

Remarks. Synonym of canaliculata 
Lamarck, 1822, teste Ihering (1898: 49). Syn- 
onym of haustrum Reeve, 1856, teste Pain 
(1960:422). 

innexa 
Ampullaria innexa Crosse & Fischer, in 
Fischer & Crosse, 1888: [explanation of] pl. 
44, fig. 7, 7a-c [Crosse & Fischer, 1 890: 1 1 1 ; 
see also Fischer & Crosse (1890: 242)]. [No 
locality given. Monte de Mistan, propè 
Coapan, in provincia Oajaca, reipublicas 
Mexicanas (Crosse & Fischer (1890: 111).] 
Type material: not found by us in MNHN. Dis- 
tribution: Mexico. 

Remarks. Synonym of flagellata Say, 1829, 
teste Pain (1964: 227). 

insularum 
Ampullaria insularum Orbigny, 1835a: 32. Rio 
Parana (república Argentina). Syntypes: 
BMNH 1854.12.4.309-313 (7 spms.), MNHN 
(3 lots, 5 spms.), MHNG 33487 (2 spms.) (Y. 
Finet, pers. comm. to RHC, 26 August 2002). 
Distribution: Argentina, Brasil (Baker, 1914: 
659). 

Remarks. Synonym of gigas Spix, 1827, 
teste Ihering (1898: 49) and S. С Thiengo 
(unpublished), followed here, although con- 
trary to various authors (e.g.. Baker, 1914: 
659), who treated it as a valid species. 

interrupta 
Ampullaria interrupta Sowerby, 1909a: 353 
[name], 361 [description], text fig. Laguna 
Urao, Venezuela. Syntype: BMNH 
1909.10.19.33 (see also Alderson, 1925: 52; 
Pain, 1950a: 110). Distribution: Venezuela. 

Remarks. Placed in Limnopomus Dall, 
1904, by Sowerby (1909a: 361) and dis- 
cussed as such by Pilsbry (1933: 75). 



NEWWORLDAMPULLARIIDAE 



67 



intropicta 
Ampullaria intropicta Reeve, 1856d: pi. 21, 
fig. 101a, b. [No locality given.] Syntypes: 
BMNH 20020664 (3 spms.). Distribution: 
Brasil (syntype label). 

Remarlis. Synonym of decussata 
Moricand, 1836, teste Sowerby (1909a: 348). 

labiosa 
Ampullaria labiosa Philippi, 1852a: 58, pi. 18, 
fig. 5 [1852b: 28]. [No locality given.] Holotype 
["das einzige Exemplar" (Philippi, 1852a: 58)]: 
Koch collection, location not known to us. 
Distribution: unknown. 

Remarks. Philippi (1852a: 58) attributed the 
name to Koch. Synonym of flagellata Say, 
1829, teste Pain (1964: 227), though listed 
as from India by Paetel (1887: 479) and 
"Indes orientales" by Gaudion (1879: 32). 

lamarckii 
Ampullaria Lamarckii Ph\\\pp\, 1852a: 67, pi. 
21, fig. 5. [No locality given.] Type material: 
probably MNHNS. Distribution: unknown. 

Remarks. Synonym oUlagellata Say, 1829, 
teste Pain (1964: 227). 

lattrei 
Ampullaria Lattrei Reeve, 1856b: pi. 5, fig. 22. 
Coban, Guatemala. Syntypes: BMNH 
20020665 (2 spms.). Distribution: Guatemala 
(Martens, 1899: 419; Sowerby, 1909a: 354; 
Pain, 1964:229). 

Remarks. See delattrei Fischer & Crosse, 
1890. 

lemniscata 
Ampullaria lemniscata Crosse & Fischer, in 
Fischer & Crosse, 1888: [explanation of] pi. 
44, fig. 5, 5a-c [Crosse & Fischer, 1890: 112; 
see also Fischer & Crosse (1890: 248)]. [No 
locality given, colonia anglicâ Belize (Crosse 
& Fischer (1890: 112).] Syntypes: MNHN (4 
spms.) (see also Sowerby, 1909b: 363). Dis- 
tribution: Belize, Mexico (Sowerby, 1909a: 
352). 

Remarks. Synonym of f/age//a/a Say, 1829, 
teste Pain (1964: 227). 

leucostoma 
Ampullaria leucostoma Swainson, 1823a: pi. 
175. [No locality given.] Type material: possi- 
bly MMUE (Dean, 1936: 232; H. McGhie, 
pers. comm. to RHC, 29 July 2002), not 
found by us in BMNH (cf. Dance, 1986: 227). 
Distribution: Venezuela (Paetel, 1887: 479). 
Remarks. Synonym of urceus Müller, 1774, 
teste Philippi (1852a: 54), Gaudion (1879: 
41), Sowerby (1909a: 358) and Alderson 
(1925: 10). 



levior 
Ampullaria levior Sowerby, 1909a: 354 
[name], 361 [description], text fig. Amazon 
River. Syntype: BMNH 1909.10.19.36. Distri- 
bution: Amazon River; Surinam, Brasil 
(Vernhout, 1914a: 28, 43). 

Remarks. Synonym of lineata Spix, 1827, 
teste Pain (1960:422). 

lineata 
Helix lineata Spix, in Wagner, 1827: 3, pi. 5, 
fig. 2. in aquis Provinciae Bahiensis, e.g. in 
fluvio Itahype [see also Thiengo (1987: 563)]. 
Syntypes: ZSM 20012054 (1 spm.), 
20012066 (1 spm.), 20012074 (1 spm.) (E. 
Schwabe, pers. comm. to RHC, 28 July 
2002; cf. Fechter, 1983: 221), MNHN (2 
spms.). Distribution: Brasil, Guyana, French 
Guyana, Surinam (Sowerby, 1909a: 354; 
Baker, 1914: 660; Vernhout, 1914a: 43) 
[Brasil only, teste Pain (1960: 422)]. 

Remarks. Authorship is given here as "Spix, 
in Wagner", following Cowie et al. (in prep.), 
who also explain the publication history of this 
work. Pain (1950b: 72) listed "Helix liniata 
Spix" in the synonymy of crassa Swainson, 
1823 (although he cited Spix's pi. 5, fig. 1), 
but subsequently (Pain, 1960: 422), followed 
here, treated lineata Spix, 1827, as a valid 
species. Misspelled lineolata" by Deshayes 
(1850:44). 

linnaei 
Ampullaria L /шае/ Philippi, 1852a: 62, pi. 20, 
fig. 6 [1852b: 29]. [No locality given.] Holotype 
["eines ... Exemplares" (Philippi, 1852a: 62)]: 
probably MNHNS. Distribution: unknown. 

Remarks. Synonym of lineata Spix, 1827, 
teste Sowerby (1909a: 354). 

+ livescens 
Ampullaria livescens Reeve, 1856b: pi. 5, fig. 
21. [No locality given.] Syntype: BMNH 
1986214. Distribution: Tabasco and Chiapas, 
Mexico; Lake Peten, northern Guatemala 
(Pain, 1964:228). 

Remarks. Subspecies of flagellata Say, 
1829, teste Pain (1964: 228). 

lutea 
Poomacea [sic] paludosa Say var. lutea 
Farfante, 1942: 51. Unavailable name; nom. 
nud. 

Remarks. Listed as a synonym of paludosa 
Say, 1829, by Clench & Turner (1956: 120). 

lymnaeaeformis 
Ampullaria lymnœœformis Reeve, 1856b: pi. 
8, fig. 39. River Marañen. Syntypes: BMNH 
20020666 (2 spms.). Distribution: Peru. 



68 



COWIE&THIENGO 



Remarks. Synonym of aulanieri Deville & 
Huppé, 1850, teste Pain (1960: 424). Fre- 
quently spelled "lymnaeformis". 

maculata 
Pomacea maculata Perry, 1810c: [unnum- 
bered plate and text] [= pi. 12 (Mathews & 
Iredale, 1912: 11; Geijskes & Pain, 1957: 42; 
R. E. Petit, pers. comm. to RHC, 16 October 
2000)]. the South Sea [error; Mathews & 
Iredale, 1912: 11]. Type material: not found by 
us in BMNH (cf. Dance, 1986: 221). Distribu- 
tion: Brasil, Peru (Pain, 1960: 423). 

Remarks. Possibly a synonym of urceus 
Müller, 1774, teste Berthold (1991: 248). 

malleata 
Ampullaria malleata Jonas, 1844: 35 [1846: 
122, pi. 10, fig. 11, 11a, lib]. Juxta Tabasco, 
urbem Mexicanum. Lectotype ["le type de 
Jonas" (Fischer & Crosse, 1890: 237)]: prob- 
ably ZMHB 109515 (M. Glaubrecht, pers. 
comm. to RHC, 1 March 2003; F. Köhler, 
pers. comm. to RHC, 6 March 2003, 20 
March 2003); possible paralectotypes [la- 
beled paratypes]: MCZ. Distribution: Mexico. 
Remarks. Fischer & Crosse (1890: 237) 
stated that the "type" of Jonas was collected 
in Tabasco by Fokkes. Martens (1899: 412) 
mentioned two specimens, one collected 
from Tabasco by Fokkes and given by Jonas 
to Dunker, and another, from the Dunker col- 
lection, illustrated by Martens (1899: pi. 22, 
fig. 10) but with no mention of its collector or 
whether it had ever been in Jonas' posses- 
sion. Although Martens (1899: 412) sug- 
gested that the latter specimen might be 
Jonas' "type", it seems more likely that the 
former is the "type" and that it is the speci- 
men indicated as such by Fischer & Crosse 
(1 890: 237). Martens' figure and that of Jonas 
(1846: fig. 11) are almost identical. Jonas 
gave his collection to ZMUH, which would ex- 
plain the statement of Fischer & Crosse 
(1890: 237) that Jonas' "type" was there. Mar- 
tens, however, stated that both his speci- 
mens were from the Dunker collection, in 
ZMHB, and the specimen ZMHB 109515 al- 
most perfectly matches Jonas' figure, even 
to the small depression in the lower rim of 
the aperture (F. Köhler, pers. comm. to RHC, 
20 March 2003). This probably came about 
through donation or exchange, as Dunker 
certainly exchanged material with collectors 
in Hamburg, because there is material of 
other taxa from him that ZMUH obtained from 
the Altonaer Museum (another museum in 



Hamburg) after the ZMUH collections were 
destroyed in the Second World War (B. 
Hausdorf, pers. comm. to RHC, 10 March 
2003). However, it yet could be that Fischer & 
Crosse (1890: 237) and Martens (1899: 412), 
although both referred to the "type", were ac- 
tually referring to different shells. Synonym of 
flagellata Say, 1829, teste Baker (1922: 37) 
and Pain (1964: 226). 

manco 
Pomacea manco Pilsbry, 1944: 145, pi. 11, 
figs. 31, 32. collecting station 161, on the 
Pachitea River, about one mile upstream 
from Quebrada Sungarillo. Holotype: ANSP 
Invertebrate Paleontology 4596 ["4596a" 
(Baker, 1964: 168)]; paratypes: ANSP In- 
vertebrate Paleontology 78898 (2 spms.). 
Distribution: Peru (Boss & Parodiz, 1977: 
110). 

Remarks. Fossil. Placed in Limnopomus 
Dall, 1904, by Parodiz (1969: 110). 

manetou 
Pila Manetou Röding, 1798: 145. [No locality 
given.] Type material: possibly Art and Natural 
History Museum, Gotha (Stewart, 1930: 35; 
Dance, 1986: 206). Distribution: unknown. 

Remarks. Synonym of urceus Müller, 1774, 
teste Baker (1930: 2). 

+ marginatra 
Ampullaria marginatra Jonas, 1845: 169. [No 
locality given.] Type material: "in Museo hon. 
Grüner" (Jonas, 1845: 169), ZMHB 29964 
(lost; M. Glaubrecht, pers. comm. to RHC, 1 
March 2003). Distribution: unknown. 

Remarks. Variety of zonata Spix, 1827, 
teste Philippi (1851: 10; 1852a: 63, 74) and 
Sowerby (1909a: 359). 

martensiana 
Ampullaria (Pomus) martensiana Nevill, 1884: 
10. New name for columbiensis Reeve, 1856; 
non Philippi, 1851. Distribution: Colombia. 

Remarks. Synonym of flagellata Say, 1829, 
teste Pain (1964: 227). 

martinezi 
Ampullaria Martinezi Hidalgo, 1866: 345, pi. 
14, fig. 5. Santa-Rosa, Reipublicœ /Equatohs 
[Ecuador]. Lectotype: MNHN (Fischer-Piette, 
1950: 68); paralectotypes: MNHN (1 spm) 
(Fischer-Piette, 1950: 68), MNCN 15.05/7524 
(1 spm.), 15.05/12306 (7 spms.) (Villena et 
al., 1997: 75). Distribution: Ecuador (Miller, 
1879: 151; Sowerby, 1909a: 354). 

melanocheila 
Ampullaria melanocheila Reeve, 1856b: pi. 5, 
fig. 24. [No locality given.] Syntype: BMNH 



NEWWORLDAMPULLARIIDAE 



69 



20020667. Distribution: Brasil (Paetel, 1887: 
480). 

Remarks. Synonym of sórdida Swainson, 
1823, teste Sowerby (1909a: 357). 

melanostoma 
Ampullaria reflexa Van melanostoma Phiiippi, 
1 852a: 35, 58, pi. 1 8, fig. 4. [No locality given.] 
Syntype: ZMHB 109500 (M. Glaubrecht, pers. 
comm. to RHC, 1 March 2003); type material 
possibly also in MNHNS. Distribution: un- 
known. 

Remarks. Phiiippi (1852a: 35) attributed the 
name to "Parr, in litt." Synonym of malleata 
Jonas, 1844, teste Martens (1857: 189, 207), 
but a variety of flagellata Say, 1829, teste 
Martens (1899: 411). Treated here as a syn- 
onym of flagellata Say, 1829. N. Syn. 

meridaensis 
Pomacea (Limnopomus) meridaensis Pain, 
1950a: 109. Merida, Venezuela. Holotype 
(Pain, 1950a: 110): the specimen figured by 
Alderson (1925: pi. 11, fig. 7); paratypes: 
Alderson collection (Pain, 1950a: 110), HUJ 
21517 (1 spm.) (H. Mienis, pers. comm. to 
RHC, 4 August 2002), MCZ 171558 (2 
spms.), FMNH (1 spm.), ZSM 20012068 (1 
spm.; ex Alderson collection) (E. Schwabe, 
pers. comm. to RHC, 29 July 2002). Distribu- 
tion: Venezuela. 

Remarks. Synonym oí camena Pain, 1949, 
tesfe Pain (1957: 175). 

mermodi 
Ampullaria mermodi Sowerby, 1919: 152, [un- 
numbered text figure]. Central America. 
Syntypes: MHNG 33490 (3 spms.) (Y. Finet, 
pers. comm. to RHC, 26 August 2002; see 
also Tillier, 1980: 19 [as "Sowerby, 1905"]). 
Distribution: ? Guyana, ? Central America 
(Pain, 1950b: 72). 

Remarks. Pain (1950b: 72) stated that this 
species was founded on a single specimen. 
However, this was not made explicit by 
Sowerby (1919: 152-153), who described it 
from "photographs" sent to him by Mermod. 
Tillier (1980: 19) indicated that Sowerby's 
(1919: 152) figure illustrated the largest of 
three syntypes. 

meta 
Ampullaria meta Ihering, 1915: 12, pi. [3], figs. 
6, 7. Cidade da Barra, Rio S. Francisco River, 
Bahia. Holotype: MNRJ. Distribution: Brasil. 

+ metcalfei 
Ampullaria Metcalfei Reeve, 1856e: pi. 25, 
fig. 119a, b. [No locality given.] Type material: 
not found by us in BMNH. Distribution: Ven- 
ezuela (Baker, 1930:4). 



Remarks. Possibly a synonym of vexillum 
Reeve, 1856, teste Alderson (1925: 14). Sub- 
species of swainsoni Phiiippi, 1852, teste 
Baker (1930: 4), although he noted collec- 
tions containing both forms and a "good se- 
ries of intermediates". 

mexicana 
Ampullaria Mexicana Martens, 1857: 207. 
Unavailable name; nom. nud. 

Remarks. Listed by Martens (1857: 207) as 
a manuscript name of Phiiippi; also listed by 
Gaudion (1879: 33). Treated as a synonym 
of malleata Jonas, 1844, by both these au- 
thors. Also listed by Paetel (1873: 65, 1887: 
480). 

+ miamiensis 
Ampullaria miamiensis Pilsbry, 1899: 365 
[1927a: 252, pi. 22, figs. 5 (lectotype), 6, 7]. 
creek flowing from the Everglades near Mi- 
ami, Dade County, in southeastern Florida. 
Lectotype (Pilsbry, 1927a: 253; see also 
Baker, 1964: 168): ANSP 77369; 
paralectotypes: ANSP 361441 (59 spms., 
uncounted juveniles), CMNH 62.19966 (1 
spm.), 62.33743 (1 spm.) (Parodiz & Tripp, 
1988: 141), USNM (1 spm.) [labeled as 
"cotype"], MCZ ("paratypes"; Clench & 
Turner, 1956: 122). Distribution: Florida. 

Remarks. Treated by Clench & Turner 
(1956: 122) as a "race" or "local population" of 
paludosa Say, 1829, but not formally synony- 
mized. 

miltocheilus 
Ampullaria miltocheilus Reeve, 1856e: pi. 25, 
fig. 120a, b. Province of Chiapes [= Chiapas], 
Mexico. Lectotype ["Le type"; Fischer & 
Crosse (1890: 248)]: BMNH 20020668/1; 
paralectotypes: 20020668/2-5 (5 spms.); 
based on our study of the BMNH material. 
Distribution: Mexico. 

Remarks. Variety of ghiesbreghti Reeve, 
1856, teste Martens (1899: 418). Synonym of 
cumingii King & Broderip, 1831, teste 
Sowerby (1909a: 348). Probably a synonym 
of quitensis Busch, 1859, teste Alderson 
(1925: 44). Not a synonym of ghiesbreghti 
Reeve, 1856, teste Pain (1953: 223), who 
also remarked on its shell "resembling spe- 
cies of Limnopomus". 

miltochilus 
Ampullaria miltochilus Fischer & Crosse, 
1890: 247. Unjustified emendation of 
miltocheilus Reeve, 1856. 

+ minor 
Ampullaria (Pomus) gigas var. minor Nevill, 
1884: 9. les environs de Corrientes, et sur les 



70 



COWIE&THIENGO 



rivages de la Plata, près de Buenos-Ayres [lo- 
cality given by Orbigny (1838d: 372) for the 
variety illustrated in his pi. 50, fig. 5]. Holo- 
type/syntypes: the specimen(s) illustrated by 
Orbigny (1838e: pi. 50, figs. 5, 6) [the two fig- 
ures probably illustrate a single (live) speci- 
men but this is not certain], location not 
known to us. Distribution: La Plata (Orbigny, 
1838d: 372), Rio Parana (Nevill, 1884: 9). 

Remarks. Name proposed by bibliographic 
reference to Orbigny (1 838e: pi. 50, figs. 5, 6). 
Junior primary homonym of т/шг Nevill, 1877, 
which is now placed in Pila Röding, 1798. 

modesta 
Ampullaria modesta Busch, 1859: 168. Ecua- 
dor. Type material: location not known to us. 
Distribution: Ecuador (Miller, 1879: 150). 

monachus 
Ampullaria monachus Crosse & Fischer, in 
Fischer & Crosse, 1888: [explanation of] pi. 
46, fig. 5, 5a [Crosse & Fischer, 1890: 112 [as 
"monacha"]; see also Fischer & Crosse 
(1890: 250)]. [No locality given. Santa 
Efigenia, in Isthmo Tehuantepecensi, 
reipublicae Mexicanae (Crosse & Fischer 
(1890: 113)]. Holotype: the specimen illus- 
trated by Crosse & Fischer, in Fischer & 
Crosse (1888, fig. 5, 5a), not found by us in 
MNHN. Distribution: Mexico. 

Remarks. Synonym of flagellata Say, 1829, 
teste Pain (1964: 227). 

monstrosa 
Ampullaria fasciata var. monstrosa Sowerby, 
1825: 44. Unavailable name; nom. nud. 

Remarks. Not listed by Sherborn (1922- 
1933). 

nais 
Pomacea nais Pain, 1949a: 257; pi. 13, figs. 
3, 4. small stream on the south bank of the 
Amazon near Obidos, Brasil. Holotype: 
BMNH 1947.2.3.1 [not 1946.2.3.1, as stated 
by Pain (1949a: 257)]; paratype: 
NMW.Z. 1981. 118. 00093 (Pain collection, 1 
spm.). Distribution: Brasil (Pain, 1960: 424). 
Remarks. May be a "local race" of lineata 
Spix, 1827, teste Pain (1960: 424). 

nigrilabris 
Ampullaria nigrilabris Philippi, 1852a: 65, pi. 
21 , fig. 2 [1 852b: 29]. [No locality given.] Type 
material: probably MNHNS. Distribution: "Rio 
Janeiro" (Gaudion, 1879: 34; Sowerby, 1909a: 
355; see also Paetel, 1873: 65, 1887: 480). 

nobilis 
Ampullaria nobilis Reeve, 1856a: pi. 2, fig. 8. 
River Marañen. Possible syntype: BMNH 



20020669; topotypes: ANSP 120276 (Baker, 
1930:3). Distribution: Venezuela (Baker, 
1930: 3), East Peru (Sowerby, 1909a: 354), 
Brasil (Baker, 1914:660). 

Remarks. Synonym of guyanensis 
Lamarck, 1822, teste Pain (1960: 427), and 
hence of urceus Müller, 1774 (see Tillier, 1980: 
27). N. Syn. 

notabilis 
Ampullaria notabilis Reeve, 1856c: pi. 14, fig. 
63. [No locality given.] Syntype: BMNH 
20020670. Distribution: Peru (Sowerby, 
1909a: 355) [? error; Alderson, 1925: 45; 
Pilsbry, 1927a: 250]. 

Remarks. Synonym of nubila Reeve, 1856, 
teste Paetel (1887: 480). Possibly a syn- 
onym o^ paludosa Say, 1829, teste Alderson 
(1925: 45) and Pilsbry (1927a: 250). Re- 
tained here as a distinct species, pending fur- 
ther study. 

novaegranadae 
Ampullaria novœ-granadœ Busch, 1859: 169. 
New Granada [in 1859 = present-day Colom- 
bia and Panama]. Syntypes: BMNH 
20020671 (2 spms.). Disthbution: Colombia 
and/or Panama. 

oajacensis 
Ampullaria malleata var. Oajacensis Fischer 
& Crosse, 1890: 235 [1888: pi. 46, fig. 3, 3a, 
3b; plate published without name]. Monte de 
Mistam, prope Coapam, provinciae Oajaca. 
Type material: Sallé collection, not found by 
us in BMNH, MNHN, etc. (cf. Dance, 1986: 
209, 225). Distribution: Mexico. 

Remarks. Synonym oí flagellata Say, 1829, 
teste Pain (1964: 227). 

oblonga 
Ampullaria oblonga Swainson, 1823a: pi. 
136, middle figs. [No locality given.] Syntypes: 
"in the late Mrs. Bligh's collection" 
(Swainson, 1823a: pi. 136), location not 
known to us. Distribution: Venezuela (Philippi, 
1851: 21; Sowerby, 1909a: 355), Guadeloupe 
(Gaudion, 1879:35). 

Remarks. Synonym oí urceus Müller, 1774, 
teste Pain (1960: 426), but retained here as a 
valid species based on our own observations 
(S. С Thiengo, unpublished). 

ocanensis 
Ampullaria (aurisformis var. ?) ocanensis 
Kobelt, 1914b: 222, pi. 77, figs. 4, 5 [1914e; 
177]. Ocaña in Neu-Granada [= Colombia]. 
Figured specimen (Kobelt, 1914b: figs. 4, 5): 
ZMUH [destroyed; B. Hausdorf, pers. comm. 
to RHC, 3 May 2002]. Distribution: Colombia. 



NEW WORLD AMPULLARIIDAE 



71 



occlusa 
Ampullaria occlusa Crosse & Fischer, in 
Fischer & Crosse, 1888: [explanation of] pi. 
45, fig. 3, 3a-c [Crosse & Fischer, 1890: 111; 
see also Fischer & Crosse (1890: 244)]. [No 
locality given. Tanesco, Guatemalœ (Crosse 
& Fischer (1890: 112).] Syntypes: MNHN (2 
lots, 11 spms.) (see also Sowerby, 1909b: 
363). Distribution: Guatemala. 

Remarks. Synonym oUlagellata Say, 1829, 
teste Pain (1964: 227). 

ochracea 
Ampullaria ochracea Jay, 1836: [85 (explana- 
tion of pi. 3)], pi. 3, fig. 8 [1839: [explanation of 
pi. 3, fig. 8]. Spanish Maine [= isthmus of 
Panama to mouth of Orinoco River]. 
Syntypes: AM N H 56106(1 spm.) [labeled as 
"figd type" in Jay's handwriting (P. M. 
Mikkelsen, pers. comm. to RHC, 7 May 
2002)], 56106A (1 spm.); additional 6 
syntypes [Jay (1839: 116) mentioned 8 spms. 
in total]: location not knov\/n (Boyko & 
Cordeiro, 2001: 16). 

Remarks. Synonym oUlagellata Say, 1829, 
teste Martens (1899: 405) and Pain (1964: 
226). 

+ olivácea 
Ampullaria olivácea Spix, in Wagner, 1827: 2, 
pi. 3, fig. 1. in fluminibus Amazonum, 
Solimoès, Japurá alliisque in interiore 
continente Brasiliae aequatohalis. Type mate- 
rial: probably lost (Fechter, 1983: 221; S. С. 
Thiengo, unpublished). Distribution: Brasilian 
Amazon (Pain, 1960:428). 

Remarks. Authorship is given here as 
"Spix, in Wagner", following Cowie et al. (in 
prep.). Junior primary homonym of 
Ampullaria olivácea Lamarck, 1816. How- 
ever, Lamarck (1822a: 178), followed by 
Philipp! (1852a: 28), placed olivácea 
Lamarck, 1816, in the synonymy of 
Ampullaria guinaica Lamarck, 1822, which 
has long been placed in the African genus 
Lanistes (e.g., Nevill, 1884: 14). Thus, be- 
cause olivácea Spix, 1827, and olivácea 
Lamarck, 1816, have not been considered 
congeneric after 1899, no replacement 
name is provided and the case must be re- 
ferred to the ICZN for a ruling {Code, Art. 
23.9.5). Wagner (1827: 2) listed the older 
name guyanensis Lamarck, 1822, in syn- 
onymy. However, Pain (1960: 427), followed 
here, treated olivácea Spix, 1827, as a sub- 
species of urceus Müller, 1 774, and distinct 
from guyanensis Lamarck, 1822. 



oviformis 

Ampullaria oviformis Deshayes, 1830a: 34. 
Cayenne. Syntypes: MNHN (2 lots, 2 spms.). 
Distribution: French Guiana (Sowerby, 
1909a: 355) [? error; Tillier, 1980: 16]. 

Remarks. The two syntypes are clearly two 
different species, indicating the need for fur- 
ther study to clarify this species' true identity 
(see also Tillier, 1980: 16). 

palmeri 
Ampullaria palmeri Marshall, 1930: 4, pi. 1, 
figs. 5, 8. small stream in dense jungle, 13 
kilometers south of Puerto Santos, Province 
of Santander del Norte, Republic of Colom- 
bia. Holotype: USNM 380696; paratypes: 
USNM 380697. Distribution: Colombia. 

paludosa 
Ampullaria paludosa Say, 1829c: 260. New 
name for depressa Say, 1824, non Lamarck, 
1804. Distribution: USA (Alabama, Georgia, 
Florida), Cuba (Clench & Turner, 1956: 122; 
Cowie, 1997b: 5). 

papyracea 
Ampullaria papyracea Spix, in Wagner, 1827: 
3, pi. 4, figs. 1, 2. in fluviis et stagnis 
Provinciarum Bahiensis, Pernambucanae et 
Piauhiensis. Syntypes: ZSM 20012059 (2 
spms.) (E. Schwabe, pers. comm. to RHC, 
28 July 2002; see also Fechter, 1983: 221). 
Distribution: Brasil, Peru, Venezuela, Guyana, 
Surinam, French Guiana (Pain, 1950b: 66, 
1960:429). 

Remarks. Authorship is given here as "Spix, 
in Wagner", following Cowie et al. (in prep.). 

patula 
Ampullaria patula Reeve, 1856d: pi. 21, fig. 
100a, b. [No locality given.] Syntypes: BMNH 
20020673 (3 spms.). Distribution: Amazon, 
Brasil, New Granada [= Colombia and 
Panama] (Walker, in Baker, 1922: 39). 

Remarks. Junior primary homonym of 
patula Lamarck, 1804, which is now placed in 
the family Naticidae (see also Lamarck, 
1822b: 549). Not listed by Sowerby (1912: 72). 

pealiana 
Ampullaria peallana Lea, 1838: 16, pi. 23, fig. 
77. Turbaco, Colombia, South America. Lecto- 
type [as "Figured holotype"] (Abbott, 1955: 126, 
pi. 4, fig. 2): ANSP 192933; paralectotypes: 
MCZ 161600. Distribution: Ecuador, Colombia 
(Pain, 1956a: 78), Venezuela (Paetel, 1887: 
480), Panama (Martens, 1899: 423). 

Remarks. We treat "pealeana" Philippi, 
1852 (1852a: 62) as an incorrect subsequent 
spelling. 



72 



COWIE&THIENGO 



penesma 
Ampullaria penesma DeKay, 1843: 124. Un- 
available name; first published as a junior 
synonym oi paludosa Say, 1829, not made 
available before 1961 (Coc/e Art. 11.6). 

Remarks. DeKay (1843: 124) attributed the 
name to Say as a manuscript name, but the 
name does not occur in Say's published writ- 
ings (Binney, 1858: [237], 1865: 5). 

periscelis 
Pila periscelis Röding, 1798: 146. [No locality 
given.] Type material: possibly Art and Natu- 
ral History Museum, Gotha (Stewart, 1930: 
35; Dance, 1986:206). 

Remarks. Possibly a synonym of 
chemnitzii Philippi, 1852, teste Baker (1930: 

5). 
peristomata 

Ampullaria peristomata Orbigny, 1835a: 33. 
Guarayos (república Boliviana). Syntypes: 
BMNH 1854.12.4.331 (10 spms.), MNHN (2 
lots, 6 spms.). Distribution: Brasil (Baker, 
1914: 660), Peru (Paetel, 1888: 481), Bolivia. 
Remarks. Synonym of cumingii King & 
Broderip, 1831, teste Sowerby (1909a: 348) 
and Kobelt (1912h: 141), and of elegans 
Orbigny, 1835, teste Gray (1855: 29), but 
treated as a valid species by Baker (1914: 
660), followed here. The BMNH and MNHN 
syntype lots are clearly two different species, 
indicating the need for further study to clarify 
this species' true identity. 

pernambucensis 
Ampullaria Pernambucensis Reeve, 1856d 
pi. 22, fig. 103. Pernambuco. Syntypes 
BMNH 20020674 (3 spms.). Distribution 
Brasil. 

+ pertusa 
Ampullaria pertusa Sowerby, 1894: 48, pi. 4, 
fig. 22. [No locality given.] Holotype (the single 
specimen on which the description was ex- 
plicitly based): BMNH 20020675 (figured also 
by Pain, 1949b: pi. 1, figs. 3, 4). Distribution: 
Venezuela (Sowerby, 1909a: 355, Pain, 
1949b: 39). 

Remarks. Variety of castelloi Sowerby, 
1894, teste Pain (1949b: 39). 

phaeostoma 
Ampullaria phaeostoma Philippi, 1852a: 45, 
pi. 13, fig. 3 [1852b: 26]. [No locality given.] 
Type material: probably MNHNS. Distribution: 
"Haut-Amazone" (Gaudion, 1879: 37) [? er- 
ror]. 

Remarks. Synonym of flagellata Say, 1829, 
teste Pain (1964: 227). 



physis 
Ampullaria physis Hupe, 1857: 67, pi. 12, fig. 
2 [two figs.], le fleuve des Amazones. 
Syntypes: MNHN (2 lots, 4 spms.). Distribu- 
tion: Amazon River (Sowerby, 1909a: 356). 

Remarks. Synonym of lineata Spix, 1827, 
teste Pain (1960: 422). 

physoides 
Ampullaria Physoides Reeve, 1856d: pi. 22, 
fig. 107a, b. Pernambuco. Syntypes: BMNH 
20020676 (4 spms.). Distribution: Brasil, India 
[error; one of the BMNH syntypes has a horny 
operculum, indicating its New World origin] 
(Paetel, 1888:481). 

picta 
Ampullaria picta Reeve, 1856e: pi. 24, fig. 
117a, b. [No locality given.] Syntypes: BMNH 
1907.11.21.91-92 (2 spms.). Distribution: 
Mexico (Mazatlan) (Sowerby, 1909a: 356). 

pinei 
Ampullaria Pinei Dall, 1898: 75. Homosassa 
River, Florida. Possible syntype: USNM 
152699 [labeled as the figured "type", al- 
though Dall (1898: 75-76) did not designate 
or figure a type]. Distribution: USA. 

Remarks. Synonym o^ paludosa Say, 1829, 
teste Clench & Turner (1956: 120). 

poeyana 
Ampullaria poeyana Pilsbry, 1927a: 251, pi. 21, 
figs. 7, 8 ["Type"], 9. New name for cubensis 
Reeve, 1856, non Morelet, 1849. Distribution: 
Cuba. 

Remarks. Pilsbry (1927a: 251 , 253) provided 
this name as a "n. sp." and designated a "ho- 
lotype" (ANSP 50618) ["50618a" (Baker, 1964: 
168)]. Two specimens from the same lot are 
now ANSP 365370. However, Pilsbry was sim- 
ply providing a replacement name for 
cubensis Reeve, 1856, so the type material of 
this species is Reeve's and Pilsbry's designa- 
tion of a holotype is invalid. Although cubensis 
Reeve, 1856, has been considered a variety 
or synonym of glauca Linnaeus, 1758 (which 
is listed here under Pomacea subg. Effusa 
Jousseaume, 1889), we follow Pilsbry (1927a: 
251-252) in retaining poeyana Pilsbry, 1927, 
as a valid species in Pomacea s. str. 

pomatia 
Ampullaria pomatia Martens, 1857: 194. 
Brasilien. Syntypes: ZMHB 1366a (3 spms.), 
1366b (3 spms.) (M. Glaubrecht, pers. comm. 
to RHC, 1 March 2003). Distribution: Brasil. 

pomum 
Ampullaria pomum Philippi, 1851: 13, pi. 3, 
figs. 3, 4 [1852b: 20]. [No locality given.] Type 



NEW WORLD AMPULLARIIDAE 



73 



material: probably MNHNS. Distribution: un- 
known. 

porphyrostoma 
Ampullaria porphyrostoma Reeve, 1856b: pi. 
6, fig. 30. [No locality given.] Syntypes: 
BMNH 20020677 (3 spms.). Distribution: Ven- 
ezuela (Baker, 1930: 5), New Granada [= 
present-day Colombia and Panama from 
1830 to 1903 and Colombia only from 1903 
on](Sowerby, 1909a: 353). 

Remarks. Synonym of chemnitzii Philippi, 
1852, teste Baker (1930: 5) and Pain (1956a: 
74). 

prasina 
Ampullaria malleata var. Prasina Fischer & 
Crosse, 1890: 235, pi. 48, fig. 4, 4a. Misantia, 
provincia Vera Cruz. Type material: not 
found by us in MNHN. Distribution: Mexico. 

Remarks. Synonym of flagellata Say, 1829, 
teste Pain (1964: 227). 

producta 
Ampullaria producta Reeve, 1856c: pi. 15, 
fig. 68a, b. [No locality given.] Syntypes: 
BMNH 20020678 (3 spms.). Distribution: "F. 
Magdalen" [= Colombia] (Paetel, 1888: 481), 
Amazon River (Sowerby, 1909a: 356), Neu- 
Granada [= Colombia and/or Panama] 
(Kobelt, 1913h:205). 

prourceus 
Pomacea (Pomacea) prourceus Boss & 
Parodiz, 1977: 110, figs. 1-4. Chicocoa (a 
single farmhouse on the east bank of the Rio 
Huallaga ...), east of Chasuta [Chazuta] (6° 
352' S; 76° 112' W), the Rio Huallaga, Depart- 
ment of San Martin, Peru. Holotype: MCZ 
272899. Distribution: Peru. 

Remarks. Tertiary fossil, possibly middle or 
late Eocene (Boss & Parodiz, 1977: 110). 

pulchra 
Paludlna pulchra Griffith & Pidgeon, 1834b: 
599, pi. 1, fig. 6 [pi. 1 predated p. 599 and 
was possibly published in 1833 (Cowan, 
1969: 139)]. [No locality given.] Syntype: 
BMNH 20020680. Distribution: South America 
(Sowerby, 1909a: 356). 

Remarks. Name attributed to Gray by 
Griffith & Pidgeon (1834b: 599). Placed in 
Pomacea [as Ampullaria] by Sowerby 
(1909a: 356). 

punctlculata 
Ampullaria puncticulata Swainson, 1823a: pi. 
143, figs. 3, 4 [middle figs.]. [No locality 
given.] Type material: possibly MMUE (Dean, 
1936: 232; H. McGhie, pers. comm. to RHC, 
28 July 2002), not found by us in BMNH (cf. 



Dance, 1986: 227). Distribution: Brasil [error] 
(Drouët, 1859: 81), Colombia, Guyana, 
French Guiana (Pain, 1950b: 72); also Ven- 
ezuela (Gaudion, 1879: 38). Spelled as 
"punctulata" by Mousson (1873: 18), Paetel 
(1888: 481) and Ihering (1919: 332). 

Remarks. Synonym of guyanensis 
Lamarck, 1822, teste Pain (1960: 426), and 
hence of urceus Müller, 1774 (see Tillier, 
1980:27). N. Syn. 

puntaplaya 
Ampullaria puntaplaya Cousin, 1887: 278, pi. 
4, fig. 2. Punta-Playa. Syntypes: MNHN (2 
lots, 4 spms.). Distribution: Ecuador 
(Sowerby, 1909a: 356). 

+ purpurascens 
Ampullaria purpurascens Guppy, 1864: 243. 
Trinidad [in publication title]. Syntypes 
(Guppy, 1864: 248): BMNH, not found by us. 
Distribution: Trinidad (Sowerby, 1909a: 356). 
Remarks. Treated as a variety of urceus 
Müller, 1774, by Guppy (1866: 44). 

+ pyrum 
Ampullaria pyrum Philippi, 1851: 18, pi. 5, fig. 
2 [1852b: 21]. Brasilien. Syntype: ZSM 
20012060 (E. Schwabe, pers. comm. to 
RHC, 28 July 2002). Distribution: Brasil 
(Gaudion, 1879:38). 

Remarks. Variety of hopetonensis Lea, 
1834 (= paludosa Say, 1829), teste Sowerby 
(1909a: 353), but note the skepticism of Pain 
(1964: 225) regarding this. Either it is not a 
variety (or synonym) of paludosa Say, 1829, 
or the locality (Brasil) is incorrect. 

quercina 
Ampullaria quercina Spix, in Wagner, 1827: 2, 
pi. 3, fig. 2. in fluminibus Amazonum, 
Solimoès, Japurá alliisque in interiore 
continente Brasiliae aequatorialis [as for 
olivácea Spix, 1827]. Syntype: ZSM 20012061 
(E. Schwabe, pers. comm. to RHC, 28 July 
2002; cf. Fechter, 1983: 221). Distribution: 
Amazon drainage (Pain, 1960: 428). 

Remarks. Authorship is given here as "Spix, 
in Wagner", following Cowie et al. (in prep.), 
who also explain the publication history of this 
work. Spix illustrated quercina as a full spe- 
cies, but Wagner, in writing the description, 
treated quercina "Spix" as a variety of 
olivácea Spix, 1827. Retained as a variety by 
Sowerby (1909a: 355), but treated here as a 
distinct species, following Pain (1960: 428). 
Berthold (1991: 23) placed quercina "Wagner 
non Spix" in Pomacea subg. Effusa 
Jousseaume, 1889. 



74 



COWIE&THIENGO 



quitensis 
Ampullaria quitensis Busch, 1859: 168. Ecua- 
dor. Type material: location not known to us. 
Distribution: Ecuador (Miller, 1879: 149). 

Remarks. Synonym of cumingii King & 
Broderip, 1831, teste Sowerby (1909a: 348). 

reflexa 
Ampullaria reflexa Swainson, 1823b: 377 
[1823a: pi. 172]. [No locality given.] Type ma- 
terial: possibly MMUE (Dean, 1936: 232; H. 
McGhie, pers. comm. to RHC, 28 July 2002), 
not found by us in BMNH (cf. Dance, 1986: 
227). Distribution: Cuba (Paetel, 1873: 65, 
1888: 481; Sowerby, 1909a: 353; Henderson, 
1916: 322) [error; Alderson, 1925: 34]; Co- 
lombia (Alderson, 1925: 34; Pain, 1964: 224). 
Remarks. Alderson (1925: 31, 34) dis- 
cussed the confused history of 
misidentification of reflexa Swainson, 1823, 
confusion that apparently continues, as it 
was considered a synonym o^ paludosa Say, 
1829, by Yong & Perera (1984: 121). Consid- 
ered either a variety of flagellata Say, 1829, or 
a distinct species by Alderson (1925: 34). 
Retained here as a distinct species, following 
Pain (1964: 224). 

retusa 
Ampullaria retusa Phllippi, 1851: 18, pi. 5, fig. 
1 [1852b: 21]. Guyana, namentlich der Rio 
Rupunin, und Brasilien [? error]. Syntype: 
ZMHB 1339 (M. Glaubrecht, pers. comm. to 
RHC, 1 March 2003); type material possibly 
also in MNHNS. Distribution: Brasil, Guyana 
(Martens, 1857: 188, 1899: 424; Gaudion, 
1879: 39) [Terror]. 

Remarks. Name attributed to Olfers by 
Philippi (1851: 18; 1852b: 21). Synonym of 
flagellata Say, 1829, teste Pain (1964: 227). 
However, flagellata Say, 1829, is a Central 
American species, extending southwards 
only into northern Colombia (Pain, 1964: 
228), suggesting either that the localities 
given for retusa Philippi, 1851, are incorrect 
or that Pain was incorrect in synonymizing 
the two species. 

rey re i 
Ampullaria Reyre/ Cousin, 1887: 279, pi. 4, 
fig. 7. Napo. Probable syntype: MNHN; 
topotype: MCZ 92312. Distribution: Ecuador 
(Sowerby, 1909a: 357). 

robusta 
Ampullaria robusta Philippi, 1852a: 50, pi. 15, 
figs. 4, 5 [1852b: 27]. [No locality given.] Type 
material: probably MNHNS. Distribution: un- 
known. 



Remarks. Synonym of columellaris Gould, 
1848, teste Alderson (1925: 54). 

rugosa 
Ampullaria rugosa Lamarck, 1801: 93. [No 
locality given; "Mississipi" [? error] (Lamarck, 
1822a: 177)]. Syntypes: the specimens illus- 
trated in the works cited by Lamarck (1801 
93); possible syntype: MHNG 1093/93 (Y. 
Finet, pers. comm. to RHC, 22 August 2002 
see also Mermod, 1952: 85). Distribution 
unknown. 

Remarks. Synonym of urceus Müller, 1774, 
teste Valenciennes (1833: 258), Gaudion 
(1879: 41), Paetel (1888: 481), Sowerby 
(1909a: 358), Alderson (1925: 10), Prashad 
(1925: 72) and Mermod (1952: 86). 

+ sanjosensis 
Pomacea cumingii sanjosensis Morrison, 
1 946: 6, pi. 1 , fig. 1 . three small streams (not 
of contiguous drainage) on the west side of 
San José Island. Holotype: USNM 542136; 
paratypes: ANSP 190947 (5 spms.), 215480 
(3 spms.), 386773 (4 spms.), BMNH 
1951.11.1.6-9 (4 spms.), MNCN 15.05/23733 
(2 spms.) (Villena et al., 1997: 76), UF (1 lot, 
3 spms.), USNM 598924, ZSM 20012076 (3 
spms.) (E. Schwabe, pers. comm. to RHC, 
28 July 2002), MCZ, UMMZ. Distribution: 
Panama. 

scalaris 
Ampullaria scalaris Orbigny, 1835a: 31. Rio 
Parana (república Argentina) ... Guarayos 
(república Boliviana) ... provincia Santa-Cruz 
de la Sierra (república Boliviana). Syntypes: 
BMNH 1854.12.4.333-4 (9 spms.), MNHN (4 
lots, 10 spms.), MHNG 33488 (1 spm.) (Y. 
Finet, pers. comm. to RHC, 26 August 2002). 
Distribution: Bolivia, Paraguay, Argentina, 
Brasil, Uruguay (Paraguay-Parana drainage) 
(Pain, 1960:425). 

scholvieni 
Ampullaria scholvieni Kobelt, 1914b: 223, pi. 
77, figs. 6, 7 [1914e: 178]. Puerto Cabello. 
Holotype: ZMUH 15880 [destroyed; В. 
Hausdorf, pers. comm. to RHC, 3 May 2002]. 
Distribution: Venezuela (Baker, 1930: 5). 

Remarks. Synonym of chemnitzii Philippi, 
1852, teste Baker (1930: 5) and Pain (1956a: 
74). 

semjtecta 
Ampullaria semitecta Mousson, 1873: 18. 
nördlichen Süd-Amerika [in publication title]. 
Type material: location not known to us, not in 
ZMZ (T. Meier, pers. comm. to RHC, 15 Au- 
gust 2002), not found by us in MNHN (cf. 



NEW WORLD AMPULLARIIDAE 



75 



Dance, 1986: 220). Distribution: Colombia, 
Venezuela (Pain, 1956a: 75). 

semperi 
Ampullaria (? figulina var.) semperi Kobelt, 
1914b: 221, pi. 77, figs. 2, 3 [1914e: 176]. 
[No locality given. "Fundort nicht genau 
bekannt, doch sicher in Brasilien" (Kobelt, 
1914e: 176)]. Type material: possibly 
SMFD, ZMHB (Dance, 1986: 215), but not 
found in ZMHB (M. Glaubrecht, pers. 
comm. to RHC, 1 March 2003); possible 
syntype(s): ZMUH [all ZMUH dry material 
destroyed in the second world war; B. 
Hausdorf, pers. comm. to RHC, 3 May 
2002]. Distribution: ? Brasil. 

Remarks. In the group of lineata Spix, 1827, 
teste Kobelt (1914b: 221). 

simplex 
Ampullaria simplex Reeve, 1856d: pi. 21 , fig. 
98a, b. [No locality given.] Syntype: BMNH 
20020682. Distribution: unknown. 

Remarks. Synonym of lineata Spix, 1827, 
teste Pain (1960:422). 

sórdida 
Ampullaria sórdida Swámson, 1823a: pi. 143, 
figs. 1, 2 [top and bottom figs.]. [No locality 
given.] Type material: possibly MMUE 
EM265907 (1 spm.) (H. McGhie, pers. 
comm. to RHC, 29 July 2002), not found by 
us in BMNH (cf. Dance, 1986: 227). Distribu- 
tion: "Brésil - Rio-Janeiro - Plata" (Gaudion, 
1879: 40), French Guiana (possibly intro- 
duced; Tillier, 1980:24). 

spirata 
Ampultaria [sic] spirata Deville & Huppé, 
1850: 643. [No locality given.] Type material: 
location not known to us. Distribution: un- 
known. 

Remarks. Name attributed to Orbigny. By 
comparing it with Ampullaria aulanieri Deville 
& Huppé, 1850, sufficient description was 
provided to make the name available. Junior 
primary homonym of Ampullaria spirata 
Lamarck, 1804, which is now placed in family 
Naticidae (see also Lamarck, 1822b: 549). 
Not listed by Sherborn (1922-1933) or Ruhoff 
(1980:504). 

sprucei 
Ampullaria Sprucei Reeve, 1856e: pi. 28, figs. 
134a, b. Tarapoto, east side of the Andes. 
Syntypes: BMNH 20020684 (2 spms.); 
topotype: ANSP. Distribution: Peru (Paetel, 
1888:481). 

Remarks. Synonym of columellaris Gould, 
1848, teste Alderson (1925: 54). 



strebeli 
Ampullaria malleata var. Strebeli Fischer & 
Crosse, 1890: 235. Misantia, provinciae Vera 
Cruz. Syntypes: ZMHB 23203 (1 spm.; ? = 
Strebel, 1873, pi. 3a, fig. 13a) (M. Glaubrecht, 
pers. comm. to RHC, 1 March 2003; F. 
Köhler, pers. comm. to RHC, 6 March 2003), 
location of the 5 other spms. listed by Strebel 
(1873: 26) not known to us. Distribution: East 
Mexico (Martens 1899: 415). 

Remarks. Described by bibliographic refer- 
ence to Strebel (1873: 25, pi. 3, fig. 13, pi. 3a, 
fig. 13a, b). Synonym oiflagellata Say, 1829, 
teste Pain (1964: 227). Martens (1899: 415) 
considered it a full species and gave more 
detailed locality information. 

superba 
Ampullaria superba Marshall, 1926: 3, pi. 1, 
fig. 9 [holotype]. Ciénaga Totuma, Depart- 
ment of Atlántico, United States of Columbia 
[= Colombia]. Holotype: USNM 362863. Distri- 
bution: Colombia (Pain, 1956a: 77). 

swainsoni 
Ampullaria Swainsoni Philippi, 1852a: 53, pi. 
16, fig. 5. [No locality given; Brasil given by 
Swainson (1831-1832, pi. 64)]. Holotype: 
MMUE (Swainson, 1831-1832: pi. 64). Distri- 
bution: Brasil, Guyana [error] (Baker, 1930: 3). 
Remarks. Philippi (1852a: 53) explicitly 
based his description on Swainson's (1831- 
1832) figure of "Ampullaria fasciata var." [not 
fasciata Swainson, 1822; see swainsonii 
Hupe, 1857], which he copied, and although 
Swainson had given the locality as Brasil, 
Philippi stated that the locality was unknown. 
Baker (1930: 3) mistakenly gave the locality 
as Demorara [Guyana], which Swainson 
(1831-1832: pi. 64) had mentioned but in ref- 
erence to other specimens. See also 
Swainson (1822c: 12 [Appendix]). Synonym 
oí lineata Spix, 1827, teste Sowerby (1909a: 
354), but treated here as a distinct species, 
following Baker (1930: 3). See also 
/?an/eyana Alderson, 1926. 

swainsonii 
Ampullaria swainsonii Hupe, 1857: 66. Brasil. 
Holotype: the shell illustrated by Swainson 
(1821 1822a: pi. 103, fig. 2), possibly MMUE 
(H. McGhie, pers. comm. to RHC, 28 July 
2002), not found by us in BMNH (cf. Dance, 
1986: 227). Distribution: Brasil. 

Remarks. Introduced as a new name for 
fasciata Swainson, 1822, which Hupe con- 
sidered preoccupied by Lamarck, 1816 [also 
Roissy, 1805]. However, fasciata Swainson, 



76 



COWIE&THIENGO 



1822 (see Swainson, 1821 1822a: pi. 103) is 
a misidentification oí fasciata Roissy, 1805, 
so Hupé's citation of Swainson's figure con- 
stitutes the original description of this spe- 
cies. Junior primary homonym of swainsoni 
Philippi, 1852. 

tenuissima 
Ampullaria tenuissima Jousseaume, 1894: 
120, text fig. La Coca, province d'Orient 
(Equateur) [Ecuador]. Type material: not 
found by us in MNHN (cf. Dance, 1986: 215). 
Distribution: Ecuador (Sowerby, 1909a: 358). 

testudinea 
Ampullaria testudinea Reeve, 1856e: pi. 24, 
fig. 114. [No locality given.] Syntype: BMNH 
1900.2.13.20. Distribution: "Amazons" 
(Sowerby, 1909a: 358); Brasil (Baker, 1914: 
660). 

Remarks. Synonym of lineata Spix, 1827, 
teste Pain (1960: 422). 

tristrami 
Ampullaria tristrami Crosse & Fischer, in 
Fischer & Crosse, 1890: 245. New name for 
columbiensis Reeve, 1856, non Philippi, 
1851. Distribution: Columbia; also "Pérou [er- 
ror] - Guatemala" (Gaudion, 1879: 26); also ? 
Panama. 

Remarks. Martens (1899: 413) considered 
that tristrami Crosse & Fischer, 1890, referred 
to the shell given to Tristram by Salvin, which 
Tristram (1864: 414) had misidentified as 
columbiensis Reeve, 1856. Martens argued, 
therefore, that tristrami Crosse & Fischer, 
1890, should not be accepted as a replace- 
ment name for columbiensis Reeve, 1856, but 
should stand as a valid name for Tristram's 
shell. However, the misidentification notwith- 
standing, the nomenclatural act of Crosse & 
Fischer was valid, even despite there already 
being a new name for columbiensis Reeve, 
1856 (i.e., martensiana Nevill, 1884). Pain 
(1964: 228), placed Tristram's "columbiensis" 
in the synonymy of livescens Reeve, 1856. 
Because columbiensis Reeve, 1856, is 
treated here as a synonym of flagellata Say, 
1829, tristrami Crosse & Fischer, 1890, is 
also a synonym of flagellata Say, 1829. N. 
syn. 

+ unicolor 
Ampullaria gigasVar. tvn/co/or Philippi, 1852a: 
47, pi. 10, fig. 2. [No locality given.] Type ma- 
terial: probably MNHNS. Distribution: un- 
known. 

+ urabaensis 
Pomacea cumingi urabaensis Pain, 1956a: 



75, text fig. (holotype). Golfo de Uraba, north- 
ern Antioquia, Colombia. Holotype and three 
paratypes (listed with dimensions by Pain 
(1956a: 75) but without giving their location): 
NMW.Z. 1981. 118. 00114 (Pain collection, 3 
spms. only); additional paratypes: MCZ (1 lot, 
2 spms.). Distribution: Colombia. 

Remarks. None of the NMW specimens is 
large enough to be the holotype (H. Wood, 
pers. comm. to RHC, 30 October 2001 ), the 
location of which is therefore unknown. 

urceus 
Nerita urceus Müller, 1774: 174. in insulis 
Indiae. Syntypes: the specimen figured by 
Lister, as cited by Müller, and the specimen(s) 
"In Museo Moltkiano" (Müller, 1774: 175), loca- 
tion not known to us, not in the Copenhagen 
Museum (O. S. Tendahl, pers. comm. to 
RHC, 18 April 2002). Distribution: Brasil, Peru, 
Ecuador, Colombia, Venezuela, Guyana, 
French Guiana, Trinidad (Pain, 1960: 426), ? 
Surinam (Vernhout, 1914: 30) [? error; 
Geijskes & Pain, 1957: 46, Tillier, 1980: 29], 
Mexico [error] (Paetel, 1873: 65). 

venetus 
Ampullaria venetus Reeve, 1856b: pi. 4, fig. 
17. [No locality given.] Syntypes: BMNH 
20020686 (2 spms.). Distribution: Guatemala 
(Paetel, 1888:482). 

Remarks. Synonym of flagellata Say, 1829, 
teste Pain (1964: 227). 

vermiformis 
Ampullaria vermiformis Reeve, 1856b: pi. 12, 
fig. 54. Paraguay. Syntype: BMNH 20020687. 
Distribution: Paraguay. 

Remarks. Synonym of canaliculata 
Lamarck, 1822, teste Martens (1857: 210). 
Synonym of gigas Spix, 1827, teste Ihering 
(1898: 49). Synonym of insularum Orbigny, 
1935, teste Sowerby (1909a: 353; 1909b: 
363). 

vexillum 
Ampullaria vexillum Reeve, 1856a: pi. 4, fig. 
20. [No locality given; locality unknown 
(Baker, 1930: 7; Pain, 1950b: 72).] Syntypes: 
BMNH 20020688 (2 spms.). Distribution: Ven- 
ezuela (Baker, 1930: 7). 

Remarks. Synonym of puncticulata 
Swainson, 1823, teste Sowerby (1909a: 356) 
and Kobelt (1913e: 180), but retained here as 
a valid species, following Pain (1950b: 72). 

vi eke ry i 
Pomacea vickeryi Pain, 1949a: 257; pi. 13, 
figs. 1, 2. marsh near Buenos Aires, La Plata. 
Holotype: BMNH 1946.10.2.3; paratypes: 



NEW WORLD AMPULLARIIDAE 



77 



NMW.Z. 1981. 118. 00107 (Pain collection, 2 
spnns.). Distribution: Argentina. 

Remarks. Synonym of insularum Orbigny, 
1935, teste Scott (1958: 295). Neither of the 
two NMW specimens is large enough to be 
the paratype for which Pain (1949a: 257) 
gave measurements; presumably they are 
two others of the total of 10 that were col- 
lected (H. Wood, pers. comm. to RHC, 30 
October 2001). 

violácea 
Ampullaria wo/acea Valenciennes, 1833: 260. 
in sylvis Americas. (Nova Hispania.). Lecto- 
type (Fischer & Crosse, 1888: [explanation 
of] pi. 46, fig. 4, 4a): MNHN. Distribution: 
Mexico (Martens, 1899: 415; Sowerby, 
1909a: 358). 

Remarks. Synonym oUlagellata Say, 1829, 
teste Pain (1964:226). 

welwitschiana 
Ampullaria Welwitschiana Drouët, 1859: 82, 
pi. 3, figs. 33, 34. la rivière du Diamant, les 
environs de Cayenne. Type material: not 
found by us in MNHN, not mentioned by Tillier 
(1980: 27-29). Distribution: French Guiana. 
Remarks. Synonym of urceus Müller, 1774, 
teste Tillier (1980: 27). 

woodwardi 
Ampullaria Woodwardi Dohrn, 1858: 134. 
Ceylon [in publication title; error]. Lectotype 
(Prashad, 1931: 168): BMNH 20020689. Dis- 
tribution: South America (Prashad, 1931: 
168). 

Remarks. "Probably an abnormal and 
somewhat eroded shell of Pomacea (Marisa) 
cyclostoma" (Prashad, 1931: 168). This 
statement does not definitively synonymize 
woodwardi Dohrn, 1858, so it is retained here 
as a valid species pending further research. 
Prashad (1925: 85) could only find one shell 
in the BMNH (as could we) and (Prashad, 
1931: 168) mentioned "the unique type", 
hence designating that specimen the lecto- 
type. 

+ yatesii 
Ampullaria Yatesii Reeve, 1856b: pi. 6, fig. 28. 
River Marañen. Type material: not found by 
us in BMNH. Distribution: Peru (Pain, 1960: 
427). 

Remarks. Subspecies of urceus Müller, 
1774, teste Pain (1960: 427). Boss & 
Parodiz (1977: 111) implied that they are 
synonyms, without formally synonymizing 
them. The single specimen labeled as 
yatesii Reeve, 1856, in the BMNH type col- 



lection does not fit the hardened glue on the 
board in its box, nor does it look like urceus 
Müller, 1774, nor does it match Reeve's fig- 
ure. This specimen is therefore not yatesii 
Reeve, 1856, the type material of which 
must be considered lost. 

yucatanensis 
Ampullaria yucatanensis Crosse & Fischer, 
1890: 110 [see also Fischer & Crosse (1890: 
240, pi. 48, fig. 3, 3a)]. San Gerónimo, 
provinciae Yucatan dictae, reipublicae 
Mexicanae. Type material: not found by us in 
MNHN. Distribution: Mexico. 

Remarks. Synonym of flagellata Say, 1829, 
teste Pain (1964:227). 

yzabalensis 
Ampullaria yucatanensis var. yzabalensis 
Martens, 1899: 420, pi. 24, fig. 9. E. Guate- 
mala: Lake of Yzabal. Syntypes: ZMHB 47109 
(2 spms.) (M. Glaubrecht, pers. comm. to 
RHC, 3 March 2002); type material not found 
by us in BMNH or MCZ (cf. Dance, 1986: 
218). Distribution: Guatemala. 

Remarks. Synonym of flagellata Say, 1829, 
teste Pain (1964: 227). 

zeteki 
Pomacea zeteki Morrison, 1946: 8, pi. 1 , fig. 
3. Chagres River near Gatuncilla, Republic of 
Panamá. Holotype: USNM 542137; 
paratypes: ANSP 190941 (5 spms.), BMNH 
1951.11.1.10-15 (6 spms.), HUJ 21515 (1 
spm.) (H. Mienis, pers. comm. to RHC, 4 Au- 
gust 2002), USNM 5421 38, ZSM 2001 2055 (4 
spms.) (E. Schwabe, pers. comm. to RHC, 
28 July 2002). Distribution: Panama (Pain, 
1956a: 76). 

zischkai 
Pomacea zischkai Blume & Pain, 1952: 267, 
pi. 7. Chapara Region, at 400 m. Bolivia 
tropica. Holotype: ZSM 20012062 (E. 
Schwabe, pers. comm. to RHC, 28 July 
2002); paratypes: ANSP 212117 (2 spms.), 
FMNH 35467 (1 spm.), 38001 (3 spms.), 
MHNG 33486 (1 spm.) (Y. Finet, pers. 
comm. to RHC, 26 August 2002), 
NMW.Z. 1981. 118. 00117 (Pain collection, 2 
spms.) (H. Wood, pers. comm. to RHC, 30 
October 2001 ), ZMHB 98762 (2 spms.) (M. 
Glaubrecht, pers. comm. to RHC, 1 March 
2003), ZSM 20012050 (24 spms.) 20012051 
(2 spms.), 20012052 (101 spms.), 
20012053 (155 spms.), 20012057 (9 spms), 
20012058 (2 spms.) (E. Schwabe, pers. 
comm. to RHC, 28 July 2002). Distribution: 
Bolivia (Pain, 1960:428). 



78 



COWIE&THIENGO 



zonata 

Ampullaria zonata Spix, in Wagner, 1827: 1, 
pi. 2, fig. 1. in rivulis ... Provinciae Bahiensis. 
Syntype: ZSM 20012056 (E. Schwabe, pers. 
comm. to RHC, 28 July 2002; see also 
Fechter, 1983: 221). Distribution: Columbia, 
Brasil (Gaudion, 1879: 43; Sowerby, 1909a: 
359). 

Remarks. Authorship is given here as "Spix, 
in Wagner", following Cowie et al. (in prep.). 

Genus POMELLAGray, 1847 

POMELLA Gray, 1847: 148. Type species: 
Ampullaria nehtoides Orbigny, 1835 [= 
megastoma Sowerby, 1825], by original des- 
ignation. 

Treated as a full genus, with two subgenera 
{Pomella s. str., Surinamia) following Berthold 
(1991:24,250). 

Subgenus POMELLAGray, 1847 

Details as for genus Pomella Gray, 1847. 

americanista 

Ampullaria americanista Ihering, 1919: 330, 
[unnumbered text figure ("Cotipo")]. Rio 
Paraná (Encarnación e Iguazú). Syntype: 
MACN 8776a (Ihering, 1919: 331). Distribu- 
tion: Argentina, Brasil, Paraguay (Ihering, 
1919: 335; Hyiton Scott, 1958: 316). 

Remarks. Placed in Pomella following 
Hyiton Scott (1958: 316) and S. С. Thiengo 
(unpublished). 

megastoma 
Ampullaria megastoma Sowerby, 1825: 44 
[name], x [description]. [No locality given.] 
Holotype ("The only specimen ... that we 
have seen"): not found by us in BMNH. Distri- 
bution: Uruguay (Sowerby, 1909a: 359), Ar- 
gentina (Ihering, 1919:333). 

nehtoides 
Ampullaria nehtoides Orbigny, 1835a: 31. Rio 
Uruguay (república Uruguayensi ohentali). 
Syntypes: BMNH 1854.12.4.306-7 (4 spms.), 
MNHN (2 lots, 3 spms.). Distribution: Uru- 
guay. 

Remarks. Synonym of megastoma 
Sowerby, 1825, teste Pilsbry (1933: 74) and 
Hyiton Scott (1958: 314). 

Subgenus SURINAMIA Clench, 1933 

SURINAMIA Clench, 1933: 71 . Type species: 
Asolene {Surinamia) fairchildi C\ench, 1933 



[= sinamahna Bruguière, 1792], by original 
designation. 

fairchildi 
Asolene (Suhnamia) fairchildi C\er\ch, 1933: 
71, pi. 7, figs. 1, 2. in the cataract of the 
Surinam River below Kedjo, Dutch Guiana 
(100 miles up river from Paramaribo). Holo- 
type: MCZ 80515; paratypes: MCZ 80516, 
ANSP 161782 (1 spm.), UMMZ (Clench, 
1933: 72) [not found by us]. Distribution: 
Surinam. 

Remarks. Synonym of sinamahna 
Bruguière, 1792, teste Geijskes & Pain 
(1957: 46) and Tillier (1980: 17). 

schrammi 
Ampullaha Schrammi Crosse, 1876: 102. in 
flumine Oyapock, Guyanae Gallicae. Lecto- 
type (Fischer-Piette, 1850: 150, pi. 5, fig. 81): 
MNHN. Distribution: French Guiana. 

Remarks. Synonym of sinamahna 
Bruguière, 1792, feste Tillier (1980: 17). 

sinamarina 
Bulimus Sinamahnus Bruguière, 1792: 342, 
pi. 18, figs. 2, 3. la rivière de Sinamah dans la 
Guyane française. Type material: not found 
by us, nor by Tillier (1 980: 1 7), in MNHN. Dis- 
tribution: Guyana, Surinam, French Guiana 
(Vernhout, 1914: 43; Pain, 1950b: 73, 1952: 
31; Geijskes & Pain, 1957:46). 

Remarks. Placed in Suhnamia Clench, 
1933, by Pain (1952: 31) and Tillier (1980: 17). 

Incertae sedis in family AMPULLARIIDAE 
Gray, 1824 

The following species are not well enough 
known to place them in a particular genus or in 
some cases to definitively include or exclude 
them as South American. 

bilineata 

Ampullaha bilineata Reeve, 1856e: pi. 23, fig. 
110a, b. [No locality given.] Type material: not 
found by us in BMNH. Distribution: unknown. 
Remarks. Gaudion (1879: 24) gave 
"Manille" [= Manila, Philippines] as the locality. 
Placed in Pila Röding, 1798, by Sowerby 
(1910: 56-57) and, confusingly, considered to 
be "based on young shells" of globosa 
Swainson (which is now placed in Pila 
Röding, 1798) by Prashad (1925: 72; see 
also Nevill, 1877: 2) but "certainly the same" 
as gracilis Lea (also now placed in Pila 
Röding, 1798) by Prashad (1925: 81). How- 
ever, Alderson (1925: 30) treated it as a syn- 
onym of buxea Reeve, 1856, considering it 



NEW WORLD AMPULLARIIDAE 



79 



"nothing more than a stunted specimen of this 
variety [buxea]". Pilsbry (1927a: 247) treated 
buxea Reeve, 1856, as a synonym of 
fasciata Roissy, 1805 [Pomacea] and con- 
sidered bilineata Reeve 1856, as a possible 
synonym oí fasciata Roissy, 1805. 

equestris 
Pila equestris Röding, 1798: 145. [No locality 
given.] Type material: possibly Art and Natu- 
ral History Museum, Gotha (Stewart, 1930: 
35; Dance, 1986: 206). Distribution: un- 
known. 

Remarlo. Not listed by Gaudion (1879) or 
Sowerby(1916:71). 

fasciata 
Ampullaria fasciata Lamarck, 1816: 12 [liste], 
pi. 457, fig. 3a, b [1822a: 177]. [No locality 
given, "les rivières de l'Inde, des Moluques et 
des Antilles" (Lamarck, 1822a: 177)]. Lecto- 
type ["die von Lamarck citirte Figur der 
Encyclopädie" (Philippi, 1852a: 53)]: MHNG 
(Mermod, 1952: 88) [not MHNG 1093/92, teste 
Y. Finet (pers. comm. to RHC, 22 August 
2002)]. 

RemariKS. Junior primary homonym of 
fasciata Roissy, 1805. Its correct placement 
is unclear (e.g., Alderson, 1925: viii, 60) and 
depends on further study. Mermod (1952: 87) 
considered it probably a synonym of 
ampullacea Linnaeus, 1758, which is now 
placed in Pila Röding, 1798. Misidentified by 
Swainson (1821 1822a: pi. 103); see 
swainsonii Иире, 1857. 

gibbosa 
Ampullaria gibbosa Paetel, 1887: 478. Un- 
available name; nom. nud. 

Remarks. Attributed to "Sw." [= Swainson], 
with reference to "Ad. Gen." [= H. Adams & A. 
Adams, 1853-1854], by Paetel (1887: 478). 
However, it is not listed by H. Adams & A. 
Adams (1853-1854), Sowerby (1916: 71), 
Sherborn (1922-1933) or Ruhoff (1980: 288) 
and appears never to have been made avail- 
able. Paetel (1887: 480) listed "pachystoma 
Benson" as a synonym, suggesting that the 
species is Asian, since Benson worked in In- 
dia (Naggs, 1997). 

hepataha 
Ampullaria hepataria Reeve, 1856c: pi. 17, 
fig. 77. [No locality given.] Syntype: BMNH 
20020661. Distribution: unknown. 

Remarks. Synonym of corrugata Swainson 
(which is now placed in Pila Röding, 1798), 
teste Nevill (1884: 2). Listed as a "Western 
Hemisphere" species and possibly a form of 
hopetonensis Lea, 1834, by Sowerby (1909a: 
351 ). However, Alderson (1925: 46) excluded 



it from the synonymy of hopetonensis Lea, 
1834 [= paludosa Say, 1829]. Also note the 
skepticism of Pain (1964: 225) regarding 
Sowerby's synonymies. 

ignota 
Pila ignota Röding, 1798: 146. [No locality 
given.] Type material: possibly Art and Natu- 
ral History Museum, Gotha (Stewart, 1930: 
35; Dance, 1986: 206). Distribution: un- 
known. 

Remarks. Not listed by Gaudion (1879) or 
Sowerby (1916: 71). 

imperforata 
Ampullaria imperforata Swainson, 1823b: 
377. [No locality given.] Type material: possi- 
bly MMUE (Dean, 1936: 232; H. McGhie, 
pers. comm. to RHC, 28 July 2002), not 
found by us in BMNH (cf. Dance, 1986: 227). 
Distribution: unknown. 

Remarks. Sowerby (1916: 70) was unable 
to identify this species. Swainson (1823b: 
377) said "operculum horny ?", which would 
suggest a New World species. 

nucleus 
Ampullaria nucleus Philippi, 1852a: 25, pi. 7, 
fig. 1 [1852b: 23]. [No locality given.] Syntypes: 
ZMHB 1374 (2 spms.; larger spm. = original 
illustration) (M. Glaubrecht, pers. comm. to 
RHC, 1 March 2003). Distribution: unknown. 

Remarks. Considered close to crasssa 
Swainson, 1823, and with a horny operculum 
(Philippi, 1852a: 25), so included here as a 
New World species. 

obtusa 
Ampullaria obtusa Deshayes, 1850: 45, pi. 
72, fig. 24. [No locality given.] Type material: 
not found by us in MNHN or BMNH (cf. 
Dance, 1986: 210). Distribution: unknown. 

pachystoma 
Ampullaria pachystoma Paetel, 1887: 480. 
Unavailable name; nom. nud. 

Remarks. Attributed to Benson, but not 
listed by Sowerby (1916: 72), Sherborn 
(1922-1933) or Ruhoff (1980: 415) and ap- 
pears never to have been made available. 
Material not in Cambridge (R. С Preece, 
pers. comm. to RHC, 27 August 2002), not 
found by us in BMNH. May be pachystoma 
Philippi [Pomacea] or possibly an Asian spe- 
cies (see gibbosa Paetel, 1887). 

planorboides 
Ampullaria planorboides Cristofori & Jan, 
1832: [Section IIa, Pars la] 7. Unavailable 
name; nom. nud. 

Remarks. Name attributed to Ziegler by 
Cristofori & Jan (1832: 7), who gave "Austr. 
N. Holl." as the locality. Martens (1857: 208) 



80 



COWIE&THIENGO 



was unsure of the locality, saying "Botanybay 
(?) Quid [= where]?". Gaudion (1879: 37) 
gave the locality as "Nouv. Hollande". Not 
listed by Sowerby (1916: 72). Material for- 
merly in MCSN [destroyed; A. Garassino, 
pers. comm. to RHC, 5 September 2002]. 
May not be an ampullariid. 

rufilineata 
Ampullaria rufilineata Reeve, 1856a: pi. 2, fig. 
7. [No locality given.] Syntypes: BMNH 
20020681 (3spms.). Distribution: uncertain. 
Remarks. Sowerby (1916: 69) placed this 
species in Pila, giving "Pegu" as the locality 
(the locality on the BMNH label). Martens 
(1857: 209) and Gaudion (1879: 39), how- 
ever, gave Venezuela as the locality. Blume & 
Pain (1952: 267) considered the location and 
generic placement uncertain. 

sepulta 
Pila sepulta Röding, 1798: 146. [No locality 
given.] Type material: possibly Art and Natu- 
ral History Museum, Gotha (Stewart, 1930: 
35; Dance, 1986: 206). Distribution: un- 
known. 

Remarks. Not listed by Gaudion (1879) or 
Sowerby (1916: 72). 

tristis 
Ampullaria tristis Gaudion, 1879: 41. Unavail- 
able name; nom. nud. 

Remarks. Name attributed to Say, al- 
though Say appears never to have pub- 
lished it (Binney, 1858: [237]). "Amérique 
Septentrionale" given as locality. Possibly 
Bulimus tristis Jay, 1839 [now placed in the 
genus Lanistes Montford, 1810, which is Afri- 
can]. 

trochulus 
Ampullaria trochulus Reeve, 1856c: pi. 14, 
fig. 66. [No locality given.] Syntype: BMNH 
20020685. Distribution: unknown. 

Remarks. Listed as a New World species 
by Sowerby (1909a: 358). 

Non-American species in family 
AMPULLARIIDAEGray, 1824 

To prevent confusion, we list those non- 
Amencan ampullariids that have at some time 
been considered as American or possibly 
American. The list may not be comprehensive. 

adusta 

Ampullaria adusta Reeve, 1856a: pi. 3, fig. 
11 . [No locality given.] Type material: BMNH 
20020690 [labeled "Zanzibar"]. 



Remarks. Nevill (1884: 10) gave the locality 
as "South America". Confirmed as African 
(and hence to be placed in Pila Röding, 1798) 
byAlderson(1925:86). 

aparta 
Ampullaria aperta Philippi, 1849: 18. [No lo- 
cality given.] Type material: probably MNHNS. 
Remarks. Gaudion (1879: 24) and Paetel 
(1873: 64, 1887: 476) gave the locality as 
Venezuela. Considered Indian and placed in 
ГагЬ/'п/со/а Annandale & Prashad, 1921 [= 
Pila, teste Berthold, 1991: 247], by Prashad 
(1925:88). 

bruguierj 
Ampullaria Bruguieri Deshayes, 1830a: 32. 
Cayenne [?]. Syntypes: MNHN (3 spms.). 

Remarks. One of the syntypes has a calci- 
fied operculum and the label says "= A. 
kordofana Parreyss" suggesting that it is a 
species of Pila from Africa (see also Tillier, 
1980: 16). 

exigua 
Ampullaria exigua Philippi, 1852a: 46, pi. 13, 
fig. 4 [1852b: 26]. [No locality given.] Type 
material: probably MNHNS. 

Remarks. Sowerby (1909a: 349), following 
Philippi (1852b: 27), first considered that it 
"may be a variety of A. crassa, Swainson" 
but subsequently (Sowerby, 1910: 58) treated 
it as a species of Pila from Egypt. Listed 
from Egypt by Paetel (1887: 478). 

+ pallens 
/\три//аг/а pa//ens Philippi, 1849: 17. Indiae 
orientalis. Type material: probably MNHNS. 

Remarks. Gaudion (1879: 36) gave Mexico 
as the locality. Philippi (1852a: 32) had previ- 
ously said "wahrscheinlich Ostindien" and 
Martens (1901: 644) stated that it was from 
the Philippines. Variety of virens Lamarck, 
1822 (which is now placed in Pila Röding, 
1798), teste Sowerby (1910: 62). 

paludinoides 
Ampullaria paludinoides Cristofori & Jan, 
1832: [Section IIa, Pars la] 7, [Mantissa] 3. 
Am. mer. Type material: formerly MCSN [de- 
stroyed; A. Garassino, pers. comm. to RHC, 
5 September 2002]. 

Remarks. The locality was reiterated as 
"America mehdionalis" by Philippi (1852b: 24) 
and "Amer, m." by Paetel (1873: 65). Martens 
(1857: 213) considered it African. Paetel 
(1887: 480) listed it from "Moulmein" and it 
was considered Indian by Nevill (1877: 7-9), 
though perhaps based on misidentifications 
by the previous authors he cited. Placed in 



NEW WORLD AMPULLARIIDAE 



81 



Pila Röding, 1798, by Sowerby (1910: 57, 
62). 
prunella 

Ampullaria prunella Hupe, 1857: 67, pi. 12. 
fig. 4, 4a. les parties centrales de l'Amérique 
du Sud, de Rio de Janeiro a Lima, et de Lima 
au Para [in publication title]. Syntypes: MNHN 
(7 spms.; see also Tillier, 1980: 16); possible 
syntype: MNHN (1 spm.). 

Remarks. The syntypes are labeled as 
from "Cayenne" but have calcified opercula, 
indicating that this is not an American spe- 
cies (Tillier, 1980: 16). 
rotundata 
Ampullaria rotundata Say, 1829b: 245. St. 
John's River in Florida. Type material: "not 
found" (Baker, 1964: 168). 

Remarks. Sowerby (1909a: 357) consid- 
ered it "most likely a form of Hopetonensis" 
[= paludosa Say, 1829], but it was subse- 
quently synonymized with globosa Swainson 
(which is now placed in Pila Röding, 1798) by 
Pilsbry (1953: 60; see also Walker, 1918: 
124; Clench, 1955: 107; Clench & Turner, 
1956: 120). Spelled by Binney (1858: 147) as 
"Ampluria rotundata". 

Unpublished names in family 
AMPULLARIIDAE Gray, 1824 

The following names of ampullariids, some of 
them perhaps referring to American species, 
have been found by us on museum collection 
labels. They appear never to have been pub- 
lished and are not nomenclaturally available. 

"adjusta". No author. Treated as a synonym of 

sórdida Swainson, 1823 in ANSP. 
"burmeisteri". Attributed to Ihering. ZMHB 

109518 (M. Glaubrecht, pers. comm. to RHC, 

1 March 2003). 
"gualteriana". No author, "nov. РегпатЬисоЛ. 

fasciata Sw. van?" on label in MNHN. 
"mlquitensis". Attributed to Spix in UMMZ. 
"palmieri". Attributed to Preston in UMMZ. 
"tacarigua".Attributed to Pilsbry. ANSP 161137, 

labeled "Holotype". 
"undata". No author. USNM. 
"unicolor". Attributed to Martens in UMMZ. 
"venezullum". No author. UMMZ. 

Non-ampullahids described originally 
in family AMPULLARIIDAE Gray, 1824 

The following taxa were described originally 
in Ampullaria or Pomacea but are not now con- 



sidered to belong to the Ampullariidae. Some 
may be nomenclaturally unavailable. The list is 
not comprehensive. 

Ampullaria acuminata Lamarck, 1804 
Ampullaria acuta Lamarck, 1804 
Pomacea annularis Perry, 1811 
Ampullaria avellana Lamarck, 1822 
Ampullaria buccinoidea Young & Bird, 1 828 
Ampullaria bulimoides Deshayes, 1842 
Ampullaria canaliculata Lamarck, 1 804 
Ampullaria canalífera Lamarck, 1822 
Pomacea bibliana Marshall & Bowles, 1932 
Ampullaria borealis Valenciennes, 1 833 
Ampullaria cónica Lamarck, 1804 
Ampullaria crassa Deshayes, 1830 
Ampullaria crassatina Lamarck, 1804 
Ampullaria depressa Lamarck, 1804 
Ampullaria elongate Bennett, 1831 
Ampullaria excavata Lamarck, 1804 
Ampularia faujasii Senes, 1829 
Ampullaria frag His Lamarck, 1822 
Ampullaria galloprovincialis Matheson, 1843 
Ampullaria fiybrida Lamarck, 1804 
Ampullaria laevigata Deshayes, 1 842 
Pomacea linearis Perry, 1811 
Ampullaria media Bennett, 1831 
Ampullaria patula Lamarck, 1 804 
Ampullaria perovata Conrad, 1846 
Ampullaria ponderosa Deshayes, 1825 
Ampullaria proboscidea Matheson, 1843 
Ampullaria pygmaea Lamarck, 1804 
Ampullaria rosea Spix, 1 827 
Ampullaria scalariformis Deshayes, 1825 
Ampullaria sigaretina Lamarck, 1804 
Ampullaria spirata Lamarck, 1804 
Ampullaria tasmaniae Guillou, 1842 
Pomacea variegata Perry, 1811 



ACKNOWLEDGEMENTS 

For information from the collections of their 
various institutions, for assistance with obtain- 
ing and dating literature, and for facilitating vis- 
its to the collections in their care we thank 
Paula Mikkelsen and Julia Sigwart (AMNH), 
Paul Callomon, George Davis, Mark Kitson and 
Gary Rosenberg (ANSP), Peter Mordan, Fred 
Naggs, Kathie Way and Richard Williams 
(BMNH), Tim Pearce (CMNH), O. S. Tendahl 
(Copenhagen Museum), Rüdiger Bieler and 
Jochen Gerber (FMNH), Henk Mienis (HUJ), 
Gina Douglas (Linnean Society), Alessandro 
Garassino (MCSN), Ken Boss and Silvard Kool 
(MCZ), Yves Finet (MHNG), Laurence Cook 



82 



COWIE&THIENGO 



and Henry McGhie (MMUE), Philippe Bouchet, 
Virginie Héros, Pierre Lozouet and Philippe 
Maestrati (MNHN), Sergio Letelier (MNHNS), 
Luiz De Simone (MZUSP), Mary Seddon and 
Harriet Wood (NMW), Fred Thompson (UF), 
Jack Burch, Doug Eernisse, Daniel Graf and 
Diarmaid Ó Foighil (UMMZ), Bob Hershler and 
Richard Houbrick (USNM), Alfredo Castro- 
Vazquez (Universidad Nacional de Cuyo, Ar- 
gentina), Néstor Cazzaniga (Universidad 
Nacional del Sur, Argentina), Roberto Cipriani 
(Universidad Simón Bolívar, Venezuela), 
Matthias Glaubrecht and Frank Köhler (ZMHB), 
Bernhard Hausdorf (ZMUH), Trudi Meier (ZMZ), 



Michael Schrödl and Enrico Schwabe (ZSM). 

We also thank Matthias Glaubrecht, Peter 
Mordan and Dick Petit for detailed reviews of 
the manuscript, Eugene Coan, Neal Evenhuis, 
Jochen Gerber, Riccardo Giannuzzi-Savelli, 
Matthias Glaubrecht, Alan Kabat, Alan Kohn, 
Dick Petit, Andrew Rindsberg, Barry Roth, 
Michael Schrödl, Enrico Schwabe and Fred 
Thompson for additional assistance and dis- 
cussion, and Rüdiger Bieler for help with Ger- 
man translation. 

The United States Department of Agriculture 
Special Grants Program for Tropical and Sub- 
tropical Agriculture provided partial funding. 



LITERATURE CITED 



We have seen all the references listed, thereby 
ensuring accuracy of citation. Dates of publication 
in some cases have been taken from Evenhuis & 
Cowie (1995) and Cowie (1998); other dates de- 
rive from subsequent research. Citation is given 
verbatim, unless a publication represents a pre- 
sentation made at a meeting, in which case it can- 
not be cited verbatim and a paraphrased title is 
provided and placed in square brackets. The date 
of publication, as accurately as could be ascer- 
tained from the publication itself and from outside 
sources, is placed in square brackets at the end of 
the citation. The dates recorded here are the ear- 
liest found for each citation. If the year of publica- 
tion was different from that printed in the 
publication itself, the actual year of publication is 
placed in square brackets. In many instances of 
works published in parts (Lieferungen, livraisons, 
etc.), the original wrappers have not been seen, 
only the complete bound work. Dating has then 
been obtained from other, secondary sources. 
The dates that were printed on the original wrap- 



pers have therefore not always been verified. The 
year(s) of publication of the entire work, if differ- 
ent from that which actually appeared in the work 
(usually on the frontispiece) are therefore not 
placed in square brackets, pending further re- 
search on the original wrappers. If no date other 
than year could be found, the publication date 
must be treated as 31 December until such time 
as evidence of earlier publication is discovered. 
Sources for dates listed here are held by the first 
author When an author published more than 
one paper in a year, the papers are listed chrono- 
logically and the year given a letter suffix corre- 
sponding to the citation in the catalog. Where 
tabular collation is given for publications issued in 
parts, the date letter for each part is given in the 
"Date of publication" column. An author's initials 
are placed in square brackets if not given in the 
publication. Publications of the International Com- 
mission on Zoological Nomenclature are cited with 
authorship as "ICZN" in the catalog but spelled out 
in this bibliography. 



ABBOTT R. T, 1955, The Titian R. Peale shell collection. The Nautilus, 68(4): 123-126, pi. 4. [28 April] 
ACOSTA, В. О. & R. S. V. PULLIN, 1991, Environmental impact of the golden snail (Pomacea sp.) on 

rice farming systems in the Philippines. Freshwater Aquaculture Center, Central Luzon State 

University, Munoz, Nueva Ecija; ICLARM, Manila, vi + 34 pp. 
ADAMS, H. & A. ADAMS, 1853-1854, The genera of Recent Mollusca; arranged according to their 

organization. Vol. I. J. Van Voorst, London. 



art 


Plates 


Pages 


Date of publication 


1 


1-4 


1-32 


January 1853a 


2 


5-8 


33-64 


February 1853b 


3 


9-12 


65-96 


June 1853c 


4 


13-16 


97-128 


August 1853d 


5 


17-20 


129-160 


September 1853e 


6 


21-24 


161-192 


October 1853f 


7 


25-28 


193-224 


November 1853g 


8 


29-32 


225-256 


December 1853h 


9 


33-36 


257-288 


January 1854a 


10 


37-40 


289-320 


February 1854b 


11 


41-44 


321-352 


March 1854c 


12 


45-48 


353-384 


April 1854d 


13 


49-52 


385-416 


May 1854e 


14 


54-56 


417-448 


June 1854f 


15 


57-60 


449-484 


July 1854g 



NEW WORLD AMPULLARIIDAE 83 

ALDERSON, E. G., 1925, Studies in Ampullaria. Heffer, Cambridge, xx + 102 pp., 19 pis. 
ALDERSON, E. G., 1926, The Ampullaria swainsonioi Philippi, Hanley, and Reeve. Proceedings of the 

Malacological Society of London, 17(1); 42-43. [30 April] 
ANDERSON, В., 1993, The Philippine snail disaster. The Ecologist, 23: 70-72. 
ANDERSON, F. M., 1928, Notes on lower Tertiary deposits of Colombia and their molluscan and 

foraminiferal fauna. Proceedings of the California Academy of Sciences, (4)17(1): 1-[29]. [22 June] 
ANTON, H. E., 1838, Verzeichniss der Conchylien welche sich in der Sammlung von Hermann Eduard 

Anton befinden. Eduard Anton, Halle, xvi + 110 pp. 

"Im Druck beendigt den 9 October 1838" appears on p. 110, which we translate as "Printing completed ... ", 
although "1839" appears on the title page, Cernohorsky (1978; 299) showed that this publication was indeed 
distributed in 1838. 

APPUN, С F., 1871, Unter den Tropen. Wanderungen durch Venezuela, am Orinoco, durch Britisch 

Guyana und am Amazonenstrome in den Jahren 1849-1868. Erster Band. Venezuela. Hermann 

Costenoble, Jena, xii + 560 pp., 6 pis. 
ARIAS, S., 1952, Algunos moluscos de la region Baruta-E! Hatillo. Memoria de la Sociedad de 

Ciencias Naturales La Salle, 12: 47-65. 
BAKER F., 1914, The land and fresh-water mollusks of the Stanford Expedition to Brazil. Proceedings 

of the Academy of Natural Sciences of Philadelphia, 65[1913]: 618-672, pis. 21-27. [28 January] 
BAKER, H. В., 1922, The Mollusca collected by the University of Michigan - Walker expedition in 

southern Vera Cruz, Mexico. I. Occasional Papers of the Museum of Zoology, University of 

Michigan, 106: 1-95. [18 February] 
BAKER, H. В., 1930, The Mollusca collected by the University of Michigan - Williamson expedition m 

Venezuela. Part VI. Occasional Papers of the Museum of Zoology, University of Michigan, 210: 1- 

95. [14 February] 
BAKER, H. В., 1964, Type land snails in the Academy of Natural Sciences of Philadelphia. Part III. 

Limnophiie and thalassophile Pulmonata. Part IV. Land and fresh-water Prosobranchia. Proceedings 

of the Academy of Natural Sciences of Philadelphia, 116(4): 149-193. [20 October] 
BARBOSA RODRIGUES, J., 1892, Les reptiles de la vallée de l'Amazone. Vellosia, 2: 41-58. 
BERTHOLD, T., 1989, Comparative conchology and functional morphology of the copulatory organ of 

the Ampullahidae (Gastropoda, Monotocardia) and their bearing upon phylogeny and 

palaeontology. Abhandlungen des Natunfl/issenschaftlichen Vereins in Hamburg, (NF) 28: 141-164. 
BERTHOLD, T., 1991, Vergleichende Anatomie, Phylogenie und historische Biogeographie der 

Ampullariidae (Mollusca, Gastropoda). Abhandlungen des Naturwissenschaftlichen Vereins in 

Hamburg, (NF) 29: 1-256, 
BIELER, R., 1992, Gastropod phylogeny and systematics. Annual Review of Ecology and 

Systematics, 23: 311-338. 
BIELER, R., 1993, Ampullariid phylogeny - Book review and cladistic re-analysis. The Veliger, 36: 

291-299. 
BINNEY, W. G., ed., 1858, The complete writings of Thomas Say, on the conchology of the United 

States. H. Bailliere, New York, vi + 252 pp., 75 pis. 
BINNEY, W. G., 1865, Land and fresh-water shells of North America. Part III. Ampullahidae, Valvatidae, 

Viviparidae, fresh-water Rissoidae, Cyclophoridae, Truncatellidae, fresh-water Neritidae, 

Helicinidae. Smithsonian Miscellaneous Collections, 7(144): viii + 120 pp. [September] 
BLUME, W., 1957, Eine bis heute unbekannte Interart von Pomacea bridgesi Rve. Opuscula 

Zoológica, 1: 1-2. [15 May] 
BLUME, W. & T. PAIN, 1952, A new species of Pomacea from Bolivia. Journal of Conchology, 23(8): 

267-268, pi. 7. 
BOSS, K. J. & J. J. PARODIZ, 1977, Paleospecies of Neotropical ampullahids and notes on other fossil 

non-marine South American gastropods. Annals of Carnegie Museum, 46(9): 107-127. [28 

September] 
BOYKO, С В. & J. R. CORDEIRO, 2001. Catalog of recent type specimens in the Divisen of 

Invertebrate Zoology, American Museum of Natural History. V. Mollusca, part 2 (Class Gastropoda 

[exclusive of Opisthobranchia and Pulmonata], with supplements to Gastropoda [Opisthobranchia], 

and Bivalvia. Bulletin of the American Museum of Natural History, 262: 1-170. [5 June] 
BRAND, E. von, T. YOKASAWA & Y. FUJIO, 1990, Chromosome analysis of apple snail Pomacea 

canaliculata. Tohuku Journal of Agricultural Research, 40: 81-89. 
BRUGUIÈRE, J. G., 1792, Sur une nouvelle espèce de Bulime. Journal d'Histoire Naturelle, 1(9): 339- 

343, pi. 18, figs. 2, 3. 
BURKY, A. J., 1974, Growth and biomass production of an amphibious snail, Pomacea urceus (Müller), 

from the Venezuelan savannah. Proceedings of the Malacological Society of London, 41: 127-143. 
BUSCH, [G.] von dem, 1859, On some new freshwater shells from Ecuador and New Granada, in the 

collection of Hugh Cuming, Esq. Proceedings of the Zoological Society of London, 1859(2): 167- 

169, [between July and October] 
CAZZANIGA, N. J., 1987, Pomacea canaliculata (Lamarck, 1801) en Catamarca (Argentina) y un 

comentario sobre Ampullaria catamarcensis Sowerby, 1874 (Gastropoda, Ampullariidae). Iheringia, 

Série Zoología, 66: 43-68. [30 May] 



84 COWIE&THIENGO 

CAZZANIGA, N. J., 2002, Old species and new concepts in the taxonomy of Pomacea (Gastropoda: 

Ampullahidae). Biocell, 26(1): 71-81. 
CERNOHORSKY, W. O., 1978, The date of publication of Anton's "Verzelchniss der Conchylien". The 

Veliger, 20(3): 299. [1 January] 
CHENG, E. Y., 1989, Control strategy for the introduced snail Pomacea lineata, in rice paddy. Pp. 69- 

75, in: I. F. HENDERSON, ed.. Slugs and Snails in World Agriculture, British Crop Protection Council 

Monograph 41 . 
CLENCH, W. J., 1933, Suhnamia, a new ampullahid from Dutch Guiana. The Nautilus, 47(2): 71-72. 

[1 November] 
CLENCH, W. J., 1955, Melania cancellata Say. The Nautilus, 68: 107. [11 February] 
CLENCH, W. J. & R. D. TURNER, 1956, Freshwater mollusks of Alabama, Georgia, and Florida from 

the Escambia to the Suwannee River. Bulletin of the Florida State Museum, Biological Sciences, 

1(3): 99-239. [3 October] 
COUSIN, A., 1887, Faune malacologique de la République d l'Equateur. Bulletin de la Société 

Zoologique de France, 12: 187-287, pi. 4. 
COWAN, С F., 1969, Notes on Griffith's Animal Kingdom of Cuvier (1824 1835). Journal of the 

Society for the Bibliography of Natural History, 5(2): 137-140. [April issue] 
COWIE, R. H., 1995, Identity, distribution and impacts of introduced Ampullariidae and Viviparidae in 

the Hawaiian Islands. Journal of Medical and Applied Malacology, 5[1993]: 61-67. 
COWIE, R. H., 1997a, Pila Röding, 1798 and Pomacea Perry, 1810 (Mollusca, Gastropoda): 

proposed placement on the Official List, and Ampullariidae Gray, 1824: proposed confirmation as 

the nomenclaturally valid synonym of Pilidae Preston, 1915. Bulletin of Zoological Nomenclature, 

54(2): 83-88. [March] 
COWIE, R. H., 1997b, Catalog and bibliography of the nonindigenous nonmarine snails and slugs of 

the Hawaiian Islands. Bishop Museum Occasional Papers, 50: 1-66. [25 February] 
COWIE, R. H., 1998, Catalog of the nonmarine snails and slugs of the Samoan Islands. Bishop 

Museum Bulletin in Zoology 3. Bishop Museum Press, Honolulu, viii + 122 pp. [13 January] 
COWIE, R. H., 2002, Apple snails (Ampullariidae) as agricultural pests: their biology, impacts and 

management. Pp. 145-192, in: G м. barker, ed.. Molluscs as Crop Pests. CABI Publishing, 

Wallingford. 
COWIE, R. H., N. J. CAZZANIGA & M. GLAUBRECHT, in prep.. The South American Mollusca of 

Johann Baptist Ritter von Spix and their publication by Johann Andreas Wagner. 
COWIE, R. H., A. R. KABAT & N. L. EVENHUIS, 2001 , Ampullaria canaliculata Lamarck, 1822 (currently 

Pomacea canaliculata; Mollusca, Gastropoda): proposed conservation of the specific name. Bulletin 

of Zoological Nomenclature, 58(1): 13-18. [31 March] 
COX, L. R., 1942, Publication dates of Traité élémentaire de conchyliologie, by GP. Deshayes. 

Proceedings of the Malacologial Society of London, 25(3): 94-95. [20 December] 
CRISTOFORI, J. de & G. JAN, 1832, Catalogus in IV. sectiones divisus rerum naturalium in museo 

exstantium Josephi de Chstofori et Georgii Jan plurium Acad. Scient, et Societ. Nat. Cur Sodalium 

complectens adumbrationem oryctognosiae et geognosiae atque prodromum fauna et florae Italiae 

superiohs. Sectio II. Pars I. Carmignani, Parmae. iv + 8 + [1] + 4 + 4 pp. [April] 
CROSSE, H., 1871, Des espèces terrestres et fluviatilies quel'on a considérées, à tort, comme 

appartenant à la faune malacologique de la Nouvelle-Calédonie. Journal de Conchyliologie, 19(3): 

170-187. [27 September] 
CROSSE, H., 1876, Diagnosis Ampullariae novae, Guyanae Gallicae incolae. Journal de 

Conchyliologie, 24(1): 102. [1 March] 
CROSSE, H., 1891, Description d'un Ampullaria nouveau de l'Amazone. Journal de Conchyliologie, 

39(2): 214-216, pi. 4, fig. 2. [20 August] 
CROSSE, H. & P. FISCHER, 1890, Diagnoses Ampullariarum novarum Guatemalae et reipublicae 

Mexicanae incolarum. Journal de Conchyliologie, 38(2): 110-114. [23 September] 
CUVIER, [G. L. С F. D.], [1816], Le règne animal distribué d'après son organisation, pour servir de 

base a l'histoire naturelle des animaux et d'introduction a l'anatomie comparée. Avec figures, 

desinées d'après nature. Tome II, contenant les reptiles, les poissons, les mollusques et les 

annélides. Deterville, Paris, xviii + 532 pp. [2 December] 
DALL, W. H., 1898, Description of a new Ampullaria from Florida. The Nautilus, 12(7): 75 76. [7 November] 
DALL, W. H., 1904, Notes on the genus Ampullaria. Journal of Conchology, 11(2): 50-55. 
DALL, W. H., 1919, A new form of Ampullaria. The Nautilus, 33(1): 10-11. [16 July] 
DALL, W. H., 1921, Two new South American shells. The Nautilus, 34(4): 132-133. [5 May] 
DANCE, S. P., 1967, Report on the Linnaean shell collection. Proceedings of the Linnean Society of 

London, 178(1): 1-24, pis. 1-10. [January issue] 
DANCE, S. P, 1986, A history of shell collecting. E.J. Bhll/Dr. W. Backhuys, Leiden, xv + 265 pp., 32 pis. 
DAUTZENBERG, P., [1902], Descriptions de coquilles nouvelles rapportées du Pérou par M. Baer. 

Journal de Conchyliologie, 49(4): 306-313. [28 April] 
DEAN, J. D., 1936, Conchological cabinets of the last century. Journal of Conchology, 20(8): 225- 

252. [1 July] 



NEW WORLD AMPULLARIIDAE 85 

DeKAY, J. E., 1843, Zoology of New York, or the New-York fauna; comprising detailed descriptions of 
all the animals hitherto observed within the State of New York; with brief notices of those occasion- 
ally found near its borders: and accompanied by appropriate illustrations. Part V. Mollusca. Carroll 
and Cook, Albany, [xiv] + 271 pp., 40 pis. 

DESMAYES, G. P., 1830-1832, Encyclopédie méthodique. Histoire naturelle des vers. Tome second. 
Agasse, Paris, vil + 256 + 594 pp. 

Published in parts. Dates of publication as follows (from Evenhuis, 2003): 

Part Livraison Pages Date of publication 

1 101 i-vii, 1-256 1 February 1830a 

2 101 1-144 1 February 1830b 

2 102 [part] 145-594 29 September 1832 

Livraison 102 also included volume 3, with pages 595-1152. 

DESMAYES, G. P., 1838, Tome huitième. Mollusques. Pp. 1-660, in: G. P. DESMAYES & H. MILNE 
EDWARDS, Histoire naturelle des animaux sans vertèbres, présentant les caractères généraux et 
particuliers de ces animaux, leur distribution, leurs classes, leurs familles, leurs genres, et la citation 
des principales espèces qui s'y rapportent: précédée d'une introduction offrant la détermination des 
caractères essentiels de l'animal, sa distinction du végétal et des autres corps naturels: enfin, 
l'exposition des principes fondamentaux de la zoologie. Deuxième édition. Revue et augmentée de 
notes présentant les faits nouveaux dont la science s'est enrichie jusqu'à ce jour. J.B. Baillière, 
Paris. [June] 

DESMAYES, G. P., 1839-1857, Traité élémentaire de conchyliologie avec les applications de cette 
science a la Géologie. Explication des planches. Victor Massen, Paris. 80 + xi [Appendice] pp., 132 
pis. 



Published in parts. Dates of publication as follows (Сох, 1942: 95): 



Pages 


Date of publication 


1-24 


1839 


25-48, Appendice i-iv 


1850 


49-80 


1853 


Appendice v-xi 


1857 



DEVILLE, E. & [L.] H. MUPPÉ, 1850, Description de quelques coquilles nouvelles provenant de 

l'expédition de M. de Casteinau. Revue et Magasin de Zoologie Pure et Appliquée, (2) 2: 638-644. 

[December issue] 
DOMRN, M., 1858, Descriptions of new species of land and freshwater shells collected in Ceylon, 

from the collection of M. Cuming, Esq. Proceedings of the Zoological Society of London, 26: 133- 

135. [12 July] 
DROUET, M., 1859, Essai sur les mollusques terrestres et fluviatile de la Guyane Française. J.-B. 

Baillière, Paris. 116 pp., 4 pis. 
DUNKER, W. [B. R. H.], 1845, Vorläufige Diagnosen mehrerer neuer Conchylien aus der 

norddeutschen Liasbildung, die nächstens ausführlicher beschreiben und abgebildet erscheinen 

werden. Zeitschrift für Malakozoologie, 1(December 1844 issue): 186-188. [January] 
DUNKER, W. [B. R. H.], 1853, Ampullaria eximia. Zeitschrift für Malakozoologie, 10(6): 93-95. 
EVENMUIS, N. L., 2003, Dating and publication of the Encyclopédie Méthodique (1782-1832), with 

special reference to the parts of the Histoire Naturelle and details on the Histoire Naturelle des 

Insectes. Zootaxa 166: 1-48. 
EVENMUIS, N. L. & R. M. COWIE, 1995, Bibliography. Pp. 205-35, in: RH. COWIE, N.L. EVENHUIS s. ce 

CHRISTENSEN, Catalog of the native land and freshwater molluscs of the Hawaiian islands. 

Backhuys Publishers, Leiden. [3 June] 
FARACO, P., I. L. VEITENMEIMER-MENDES & E. BORGES, 2002. Felipponea neritiniformis 

(Gastropoda, Ampullariidae): concha, rádula, complexo peniano e comportamento reprodutivo. 

Biocièncias 10(2): 65-78. 
FARFANTE, I. P., 1942, Moluscos de la region de Camoa y Somorrostro y sus condiciones de vida. 

Memorias de la Sociedad Cubana de Historia Natural, 16(1): 45-56. [30 May] 
FECMTER, R., 1983, Liste des Typenmaterials der von J. B. v. Spix in Brasilien gesammelten 

Gastropoda. Spixiana, Supplement 9: 221-223. [15 December] 
FÉRUSSAC, [A. E. J. P. J. F. d'A. de], 1827, Suite du catalogue des espèces de mollusques terrestres 

et fluviátiles, recueillies par M. Rang, dans un voyage aux Grandes-Indes. Bulletin des Sciences 

Naturelles et de Géologie 10: 408-413. 
FISCMER, P & M. CROSSE, [1870-1902], Recherches zoologiques pour servir à l'histoire de la faune 

de l'Amérique Centrale et du Mexique, publiées sous la direction de M. Milne Edwards, membre de 



86 COWIE&THIENGO 

l'Institut. Septième partie. Études sur les mollusques terrestres et fluviátiles du Mexique et du 
Guatemala. Imprimerie Nationale, Paris. 702 + 731 pp., 72 pis. 

Published in livraisons containing feuilles, as follows: 



Volume 


Livraison 


Feuilles 


Pages 


Plates 


Date of publication 


1 


1 


1-19 


1-152 


1-6 


1870 




2 


20-38 


153-304 


7-12 


1872 




3 


39-48 


305-384 


13-16 


1873a 




4 


49-58 


385-464 


17-20 


1873b 




5 


59-68 


465-546 


21-24 


1875 




6 


69-78 


457-624 


25-28 


1877 




7 


79-88 


625-702 


29-31 


1878 


2 


8 


1-10 


1-80 


32-36 


1880 




g 


11-16 


81-128 


37-42 


1886 




10 


17-22 


129-176 


43-46 


1888 




11 


23-32 


177-256 


47-48 


1890 




12 


33-39 


257-312 


49-52 


1891 




13 


40-49 


313-392 


53-54 


1892 




14 


50-61 


393-488 


55-58 


1893 




15 


62-72 


489-576 


59-62 


1894a 




16 


73-82 


577-655 


63-66 


1894b 




17 


83-92 


657-731 


67-72 


1902 



FISCHER-PIETTE, E., 1950, Liste des types décrits dans le Journal de Conchyliologie et conservés 

dans la collection de ce journal. Journal de Conchyliologie, 90: 8-23, 65-82, 149-180, pis. 1-5. 
FUJIO, Y., H. KURIHARA&E. von BRAND, 1991, Differences metric traits among three strains of apple 

snail, Pomacea canalicualta. Tohuku Journal of Agricultural Research, 41(3-4); 61-68. 
GAUDION, H., 1879, Liste alphabétique des espèces du genre Ampullaria de Lamarck. Bulletin de la 

Société d'Étude des Sciences Naturelles de Béziers, 4: 20-43. 
GEIJSKES, D. С & T. PAIN, 1957, Suriname freshwater snails of the genus Pomacea. Studies on the 

fauna of Suriname and other Guyanas, 1(3): 41-48, pis. 9, 10. 
GMELIN, J. F., 1791, Caroli a Linné. Systema naturae per regna tria naturae secundum classes, 

ordines, genera, species, cum caracteribus, differentiis, synonymis, locis. Editio decima tertia. 

aucta, reformata. Tom. 1. Pars VI. Georg Emanuel Beer, Lipsiae [= Leipzig], pp. 3021-[3910]. [14 

May] 
GOULD, [A. A.], 1848, [Descriptions of shells from the collection of the Exploring Expedition]. 

Proceedings of the Boston Society of Natural History, 3: 73-75. [November] 
GRAY, J. E., 1824, Zoological notices. The Philosophical Magazine and Journal, 63(311): 274-277. 

[30 April] 
GRAY, J. E., 1847, A list of the genera of Recent Mollusca, their synonyme and types. Proceedings of 

the Zoological Society of London, 15: 129-219. [November] 
GRAY, J. E., 1854, List of the shells of Cuba in the collection of the British Museum, collected by M. 

Ramon de la Sagra. Described by Prof. Alcide d'Orbigny, in the "Histoire de l'Ile de Cuba.". British 

Museum, London, [i] + 48 pp. [9 December] 
GRAY, J. E., 1855, List of the shells of South America in the collection of the British Museum. Collected 

and described by M. Alcide d'Orbigny, in the 'Voyage dans l'Amérique Méridionale.". British 

Museum, London, [i] + 89 pp. [13 January] 
GRIFFITH, E. & E. PIDGEON, [1833]-1834, The Mollusca and Radiata. Arranged by the Baron 

Cuvier, with supplementary additions to each order. Whittaker and Co., London, vil + 601 pp. 

Published as volume 12 of Griffith and others' translation of Cuvier's Le règne Animai .... in three parts, tentatively 
dated by Cowan (1969: 139) as follows: 

Part Date of publication 

38 December 1833 

39 March 1834a 

40 June 1834b 

GUERRERO, L., 1991, The biology of golden snail in relation to Philippine conditions. Pp. 10-11, in: 
B. o. ACOSTA & R. s. V. PULLiN, eds., Environmental impact of the golden snail (Pomacea sp.) on rice 
farming systems in the Philippines. Freshwater Aquaculture Center, Central Luzon State University, 
Munoz, Nueva Ecija; ICLARM, Manila. 

GUILDING, L., 1828, Observations on the zoology of the Caribaean Islands. The Zoological Journal, 
3: 527-544. [after April] 

GUPPY, R. J. L., 1864, Descriptions of new species of fluviatile and terrestrial operculate Mollusca 
from Trinidad. Annals and Magazine of Natural History, (3) 14(82): 243-248. [issue for October] 



NEW WORLD AMPULLARIIDAE 87 

GUPPY, R. J. L., 1866, On the terrestrial and fluviatile Mollusca of Trinidad. Annals and Magazine of 

Natural History, (3) 17(97): 42-56. [issue for January] 
HANLEY, S. [C. T.], 1854-1858, The Conchological Miscellany. Illustrative of Pandora, Amphidesma, 

Ostrea, Melo. the Melaniadae, Ampullaria and Cyclostoma. Williams and Norgate, London and 

Edinburgh. 12 pp., 40 pis. 

The plates treating Ampullaria were published in November 1854. 

HENDARSIH, S., S. SURIAPERMANA, A. FAGI & I. MANWAN, 1994, Potential offish in rice-fish culture 
as a biological control agent of rice pests. Pp. 32-33, in; CR delà cruz, ed., Role of fish in 
enhancing hcefield ecology and in integrated pest management. Agency for Agricultural Research 
and Development, Bogor; ICLARM, Manila. 

HENDERSON, J. В., 1916, A list of the land and fresh-water shells of the Isle of Pines. Annals of the 
Carnegie Museum, 10(3-4): 315-324. [July] 

HERRMANNSEN, A. N., 1846-1849, Indicis generum malacozoorum phmordia. Nomina subgenerum, 
generum, familiarum. tnbuum, ordinum, classium; adjectis auctoribus, temporibus, locis systematicis 
atque literariis, etymis. synonymis. Praetermittuntur cirripedia, Tunicata et Rhizopoda. Vol. I. T. 
Fischer, Cassellis [= Cassel]. xxvii + 637 pp. 

Published in Lieferungen, as follows (data from the Supplementa et corrigenda associated with this work; R. E. 
Petit, pers. comm. to RHC, 22 February 2003): 



Lieferung 


Pages 


Date of publication 


1 


i-xxvii. 1-104 


1 September 1846a 


2 


105-232 


1 December 1846b 


3 


233-360 


1 IVlarch 1847a 


4 


261-488 


18 Apnl 1847b 


5 


489-616 


25IVIay 1847c 


6 (part) 


617-637 


17 July 1847d 



HIDALGO, J. G., 1866, Description d'espèces nouvelles de la République de l'Equateur. Journal de 

Conchyliologie, 14(4): 343-344. [7 October] 
HIDALGO, J. G., 1871, Description d'un Ampullaria nouveau, provenant du fleuve des Amazones. 

Journal de Conchyliologie, 19(3): 206-207. [27 September] 
HIDALGO, J. G., 1872, Description d'espèces nouvelles. Journal de Conchyliologie, 20(2): 142-144, 

pi. 7, figs. 1, 2. [6 May] 
HINKLEY, A. A., 1920, Guatemala Mollusca. The Nautilus, 34(2): 37 55. [6 November] 

Plate 4, with one figure (Fig. 5) associated with this article, was published in The Nautilus 34(3) on 11 January 1921. 

HUPÉ, [L.] H., 1857, Animaux nouveaus ou rares recueillis pendant l'expédition dans les parties 
centrales de l'Amérique du sud. de Rio de Janeiro a Lima, et de Lima au Para: exécutée par ordre 
du gouvernement français pendent les années 1843 a 1847, sous la direction du comte Francis de 
Casteinau. Mollusques. P. Bertrand, Paris. 96 pp., 20 pis. [There are two spellings of this author's 
name; see Deville & Huppé (1850)] 

HYLTON SCOTT, M. I., 1948, Moluscos del noroeste Argentine. Acta Zoológica Lilloana, 6: 241-274, 
1 pi. [before 29 December] 

HYLTON SCOTT, M. I., 1958, Estudio morfológico y taxonómico de los ampullaridos de la República 
Argentina. Revista del Museo Argentino de Ciencias Naturales "Bernardino Rivadavia" e Instituto 
Nacional de Investigación de las Ciencias Naturales. Ciencias Zoológicas, 3(5): [2] pp. + 233-333, 
23 pis. [17 April] 

IHERING, H. von, 1898, As especies de Ampullaria da República Argentina. Annales del Museo 
Nacional de Buenos Aires, 4: 47-52. [13 August] 

IHERING, H. von, 1915, Annexe N. 5. Molluscos. Commissâo de Linhas Telegraphicas Estratégicas de 
Matto-Grosso ao Amazonas, Rio de Janeiro. 14 pp., 3 pis. 

IHERING, H. von, 1919, Las especies de Ampullaria de la Argentina y la historia del Rio de la Plata. 
Pp. 329-350, pis. 37-38, in: Primera reunion de la sociedad Argentina de ciencias naturales. 
Tucumán 1916. Imprenta y Casa Editora "Coni", Buenos Aires. [May] 

INTERNATIONAL COMMISSION ON ZOOLOGICAL NOMENCLATURE [ICZN], 1999a, Opinion 1913. 
Pila Röding, 1798 and Pomacea Perry, 1810 (Mollusca, Gastropoda): placed on the Official List, 
and AMPULLARIIDAE Gray, 1824: confirmed as the nomenclaturally valid synonym of PILIDAE 
Preston, 1915. Bulletin of Zoological Nomenclature, 56(1): 74-76. [March] 

INTERNATIONAL COMMISSION ON ZOOLOGICAL NOMENCLATURE [ICZN], 1999b, International 
Code of Zoological Nomenclature. Fourth edition. International Trust for Zoological Nomenclature, 
London, xxix + 306 pp. 

INTERNATIONAL COMMISSION ON ZOOLOGICAL NOMENCLATURE [ICZN], 2002, Opinion 1997 
(Case 3175). Ampullaria canaliculata Lamarck, 1822 (currently Pomacea canaliculata; Mollusca, 
Gastropoda): specific name conserved. Bulletin of Zoological Nomenclature, 59(2): 137-138. [28 
June! 



88 COWIE&THIENGO 

JAY, J. С, 1836, A catalogue of Recent shells with descriptions of new or rare species in the collection 
of John С Jay, M.D. Second edition. [Publisher not indicated], New York. 79 + [1] + [4] pp., 4 pis. 

JAY, J. C, 1839, A catalogue of the shells, arranged according to the Lamarckian system: together 
with descriptions of new or rare species, contained in the collection of John С Jay, M.D. Third edi- 
tion. Wiley & Putnam, New York and London. 125 + [1] pp., 10 pis. [after April] 

JAY, J. C, 1850, A catalogue of the shells, arranged according to the Lamarckian system, with their 
authorities, synonymes, and references to works where figured or described, contained in the 
collectin of John С Jay, M.D. Fourth edition. [Publisher not indicated]. New York. [1] + 459 + [1] pp. 

Supplement (pp. [460]-479) published 1852. 

JOHNSON, R. I., 1964, The Recent Mollusca of Augustus Addison Gould. United States National 
Museum Bulletin, 239, 182 pp., 45 pis. [28 July] 

JONAS, J. H., 1844, Vorläufige Diagnosen neur Conchylien, welche ausführlicher beschreiben und 
abgebildet nächstens erscheinen werden. Zeitschrift für Malakozoologie, 1 (March issue) : 33-37. 

JONAS, J. H., 1845, Neue Conchylien. Zeitschrift für Malakozoologie, 2(November issue): 168-173. 

JONAS, J. H., 1846, Molluskologische Beiträge. Abhandlungen aus dem Gebiete der Naturwissen- 
schaften herausgegeben von dem naturwissenschaftlichen Verein in Hamburg, 1: 99-130, pis. 7-11. 

JOUSSEAUME, F., 1877, Mollusques nouveaux de la République d l'Equateur. Bulletin de la Société 
Zoologigue de France, 12: 165-186, pl. 3. 

JOUSSEAUME, F., 1889, Voyage de M. Eugène Simon au Venezuela (Décembre 1887-Avril 1888). 
Mollusques. Mémoires de la Société Zoologique de France, 2: 232-259, pl. 9. 

JOUSSEAUME, F, 1894, Description d'un mollusque nouveau. Le Naturaliste, (2) 8(173): 120-121 . [15 May] 

KABAT, A. R., 1991, The classification of the Naticidae (Mollusca: Gastropoda): review and analysis of 
the supraspecific taxa. Bulletin of the Museum of Comparative Zoology, 152: 417-449. [23 September] 

KABAT A. R. & K. J. BOSS, 1997, Karl Eduard von Martens (1831-1904): his life and works. Depart- 
ment of Mollusks, Museum of Comparative Zoology, Harvard University, Cambridge, vii + 417 pp. 

KEAWJAM, R. S. & E. S. UPATHAM, 1990, Shell morphology, reproductive anatomy and genetic pat- 
terns of three species of apple snails of the genus Pomacea in Thailand. Journal of Medical and 
Applied Malacology, 2: 49-62. 

KING, P. P. & W. J. BRODERIP, 1831, Description of the Cirrhipeda, Conchífera and Mollusca, in a 
collection formed by the officers of H.M.S. Adventure and Beagle employed between the years 1826 
and 1830 in surveying the southern coasts of South America, including the Straits of Magalhaens 
and the coast of Tierra del Fuego. The Zoological Journal, 5: 332-349. [after September] 

KOBELT, W., 1911-1914, Die Gattung Ampullaria. Neue Folge. In Abbildungen nach der Natur mit 
Beschreibungen. Pp. 1-236, pis. 22-79, in: H. с KÜSTER, Systematisches Conchylien-Cabinet von 
Martini und Chemnitz. Neue Folge. Ersten Bandes zwanzigste Abtheilung. Baur & Raspe, Nürnberg 
[= Nuremburg]. 

Text published in sections, which are dated on the first page of each section. The sections seem to have been 
combined into "parts", for which later dates are given by some authors. The earlier dates are taken as the dates 
of publication in this catalog. The most recent collation is that of Welter-Schultes (1999), who had some later dates 
than those accepted here. 



ection 


Pages 


Part 


Printed date 


Date in other lists 


1 


1-8 


550 


13 March 1911a 


1911 


2 


9-16 


550 


19 March 1911b 


1911 


3 


17-24 


550 


19 May 1911c 


1911 


4 


25-32 


556 


24 May 191 Id 


1912 


5 


33-40 


556 


15 October 191 le 


1912 


6 


41-48 


556 


2 November 191 If 


1912 


7 


49-56 


557 


4 November 191 Ig 


1912 


8 


57-64 


557 


25 November 1911 h 


1912 


9 


65-72 


557 


30 November 19111 


1912 


10 


73-80 


560 


2 December 191 1j 


1912 


11 


81-88 


560 


5 January 1912a 


1912 


12 


89-96 


560 


12 January 1912b 


1912 


13 


97-104 


560 


10 January 1912c 


1912 


14 


105-112 


563 


30 June 1912d 


1913 


15 


113-120 


563 


12 September 1912e 


1913 


16 


121-128 


563 


12 September 1912f 


1913 


17 


129-136 


563 


1 November 1912g 


1913 


18 


137-144 


565 


12 November 1912h 


October 1913 


19 


145-152 


565 


4 March 1913a 


October 1913 


20 


153-160 


567 


8 July 1913b 


November 1913 


21 


161-168 


567 


12 July 1913c 


November 1913 


22 


169-176 


567 


14 July 1913d 


November 1913 



(Continues) 



NEWWORLDAMPULLARIIDAE 89 



Continued 
Section 


) 

Pages 


Part 


Printed date 


Date in other lists 


23 


177-184 


570 


4 August 1913e 


1913 


24 


185-192 


570 


21 December 191 3f 


1913 


25 


193-200 


570 


23 December 1913g 


1913 


26 


201-208 


574 


29 December 1913h 


1914 


27 


209-216 


574 


12 January 1914a 


1914 


28 


217-224 


576 


9 July 1914b 


1915 


29 


225-232 


576 


15 July 1914c 


1915 


30 


233-236 


576 


16 July 1914d 


1915 



KOBELT, W., 1914e, Drei neue Ampullarienformen. Nachrichtsblatt der Deutschen Malako- 
zoologischen Gesellschaft, 46(4): 176-178. [October] 

LACANILAO, F., 1990, Reproduction of the golden apple snail (Ampullaridae [sic]): egg mass, hatch- 
ing, and incubation. Philippine Journal of Science, 119: 95-105. 

LAMARCK, J. B. [R A. de M. de], 1801, Système des animaux sans vertèbres ... L'auteur, Deterville, 
Paris, viii + 432 pp. [21 January] 

LAMARCK, [J. В. P. А. de M. de], 1804, Suite des mémoires sur les fossiles des environs de Paris. 
Annales du Muséum National d'Histoire Naturelle, 5(25): 28-36. 

LAMARCK, [J. B. P. A. de M. de], 1816, Encyclopédie méthodique. Tableau Encyclopédique et 
méthodique des trois règnes de la nature. Vingt-troisième partie. Liste des objets représentés dans 
les planches de cette livraison. V. Agasse, Paris. 16 pp., pis. 391-488. [14 December] 

This is the 84th livraison, which contains plates and 16 pages of explanations of the plates in the "Liste des objets". 

LAMARCK, [J. В. P. A. de M.] de, 1822a, Histoire naturelle des animaux sans vertèbres ... Tome 
sixième. 2"'^ partie. L'auteur, Paris. 232 pp. [April] 

LAMARCK, [J. В. P. А. de M.] de, 1822b, Histoire naturelle des animaux sans vertèbres ... Tome 
septième. L'auteur, Paris. 711 pp. [August] 

LAUP, S., 1991, Golden apple snail and its eradication in Papua New Guinea. Pp. 55-62, in: R. 
KUMAR, ed.. Proceedings of a seminar on pests and diseases of food crops - urgent problems and 
practical solutions. Department of Agriculture and Livestock, Konedobu. 

LEA, I., 1834, Observations on the naïades; and descriptions of new species of that and other fami- 
lies. Transactions of the American Philosophical Society, (new series) 5: 23 119, pis. 1-19. [August 
or September] 

LEA, I., 1 838, Description of new freshwater and land shells. Transactions of the American Philosophi- 
cal Society, (new series) 6: 1-154, pis. 1-24. [after 15 June] 

LEA, 1., 1856, Description of thirteen new species of exotic Peristomata. Proceedings of the Academy 
of Natural Sciences of Philadelphia, 8(3): 109-111. [after 26 June, before 15 August] 

LEA, I., 1866, New Unionidae, Melanidae, etc., chiefly of the United States. Journal of the Academy of 
Natural Sciences of Philadelphia, (new series) 6(2): 113-187, pis. 22-24. [December] 

LINNAEUS, C, 1758, Systema naturae per regna tria naturae, secundum classes, ordines. genera, 
species, cum caracteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. L. Salvii, 
Holmiae [= Stockholm], [iv] + 824 pp. [1 January] 

MARSHALL, W. В., 1926, New land and fresh-water mollusks from Central and South America. Pro- 
ceedings of the United States National Museum, 69(12): 1-12, pis. 1-3. [6 November] 

MARSHALL, W. В., 1930, New land and fresh-water mollusks from South America. Proceedings of the 
United States National Museum, 77(2): 1-7, pis. 1, 2. [25 January] 

MARTENS, [K] E. von, 1857, Die Ampullarien des Berliner Museums. Malakozoologische Blätter, 4: 
181-213. 

MARTENS, [K.] E. von, 1873, Die Binnenmollusken Venezuela's. Pp. 157 225, pis. 1-2, in: к. в. 
REICHERT, ed., Festschrift zur Feier des hundertjährigen Bestehens der Gesellschaft 
naturforschende Freunde zu Berlin. Ferd. Dümmler's Verlag, Berlin. 

MARTENS, [К.] E. von, 1890 1901, Biología Centrali-Americana. Land and freshw/ater Mollusca. R.H. 
Porter, London, xxviii + 706 pp., 44 pis. 

Published in parts. Dates of publication are from Kabat & Boss (1997: 82-84, 86-87, 90-94) as follows: 



Pages 


Plates 


Date of publication 


1-40 


1 


1890 


41-96 


2-5 


1891 


97-176 


6-9 


1892 


177-248 


10-12 


1893 


- 


13-15 


1894 


249-288 


16 


1897 


289-368 


17-20 


1898 


369-472 


21-28 


1899 


473-608 


29-41 


1900 


609-706, i-xxviii 


42-44 


1901 



90 COWIE&THIENGO 

MATHEWS, G. M. & T. IREDALE, 1912, "Perry's Arcana" - an overlooked work. Victorian Naturalist, 

29(1): 7-16. [9 May] 
MATON, W. G., 1811, Description of seven new species of Testacea. The Transactions of the Linnean 

Society of London, 10: 325-332, pi. 24. 

Maton's contribution was read on 7 November 1809, the date frequently cited for Helix platae However, the correct 
dates of publication of volume 10 are as follows: 

Pages Date of publication 

1-228 8 March 1810 

229-414 (with index and title page) 7 September 181 1 

MCKILLOP, W. B. & A. D. HARRISON, 1980, Hydrobiological studies of eastern Lesser Antillean is- 
lands V. St. Lucia: freshwater habitats, water chemistry and distribution of freshwater molluscs. 
Archiv für Hydrobiologie Supplementband, 57: 251-290. [April] 

MERMOD, G., 1952, Les types de la collection Lamarck au Muséum de Genève. Mollusques vivants, 
III. Revue Suisse de Zoologie, 59(2): 23-97. [March] 

MICHELSON, E. H., 1961, On the generic limits in the family Pilidae (Prosobranchia: Mollusca). 
Breviora, 133: 1-10. [27 February] 

MILLER, K., 1879, Die Binnenmollusken von Ecuador (Schluss). Malakozoologische Blätter, (Neue 
Folge) 1: 117-203, pis. 4-15. 

MOCHIDA, О., 1991, Spread of freshwater Fornácea snails (Pilidae, Mollusca) from Argentina to Asia. 
Micronesica. Supplement, 3: 51-62. 

MORELET, A., 1849, Testacea novissima insulae Cubanae etAmericae centralis. Part 1. J.-B. Baillière, 
Paris. 31 pp. 

MORELET, A., 1857, Testacea nova Australiae. Bulletin de la Société d'Histoire Naturelle du 
Département de la Moselle, 8: 26-33. [after 2 April] 

MORICAND, S., 1836, Mémoire sur les coquilles terrestres et fluviátiles, envoyées de Bahia par M.J. 
Blanchet. Mémoires de la Société de Physique et d'Histoire Naturelle de Genève, 7(2): 415^46, pi. 2. 

MORRISON, J. P. E., 1946, The nonmarine mollusks of San José Island, with notes on those of Pedro 
Gonzales Island, Pearl Islands, Panamá. Smithsonian Miscellaneous Collections, 106(6): 1-49, pis. 
1-3. [12 September] 

MORRISON, J. P. E., 1952, Correction of the type locality of Pomacea cumingii (King) 1834. The 
Nautilus, 65(3): 105-106. [25 February] 

MOUSSON, A., 1869, Notiz über einige von Herrn Gustav Wallis aus dem nördlichen Süd-Amerika 
zurückgebrachte Mollusken. Malakozoologische Blätter, 16: 170-189. 

MOUSSON, A., 1873, Zweite Notiz über einige von Herrn Gustav Wallis aus dem nördlichen Süd- 
Amerika zurückgebrachte Mollusken. Malakozoologische Blätter, 21: 1-19. 

MÜLLER, O. F., 1774, Vermium terrestrum etfluviatilium, seu animalium infusoriorum. helminthicorum, 
et testaceorum, non mahnorum, succincta historia. Volumen alterum. Heineck & Faber, Havniae [= 
Copenhagen] & Lipsiae [= Leipzig], xxxv + 214 + [10] pp. 

NAGGS, F., 1997, William Benson and the early study of land snails in British India and Ceylon. Ar- 
chives of Natural History, 24(1): 37-88. 

NARANJO-GARCÍA, E. & A. GARCÍA-CUBAS, 1986, Algunas consideraciones sobre el genero 
Pomacea (Gastropoda: Pilidae) en México y Centroamérica. Anales del Instituto de Biología, 
Universidad Nacional Autónoma de México. Serie Zoología, 56(2): 603-606. [20 November] 

NEAVE, S.A., 1 940, Nomenclátor zoológicas. A list of the names of genera and subgenera in zoology 
from the tenth edition of Linnaeus 1758 to the end of 1935. Vol. III. Zoological Society of London, 
London. 1065 pp. 

NEVILL, G, 1877, Catalogue of Mollusca in the Indian Museum. Calcutta. Fasciculus E. Indian Mu- 
seum, Calcutta, [iv] + 42 pp. 

NEVILL, G, 1884, Hand list of Mollusca in the Indian Museum, Calcutta. Fart II. Gastropoda. 
Prosobranchia-Neurobranchia (contd.). Indian Museum, Calcutta, x + 306 pp. 

NG, P. K. L., L. M. CHOU & T J. LAM, 1993, The status and impact of introduced freshwater animals 
in Singapore. Biological Conservation, 64: 19-24. 

NORRIS, A. & S. P DANCE, 2002, Sylvanus Charles Thorp Hanley (1819-1899) a nineteenth-century 
dilettante of the shell world. Journal of Conchology, 37(4): 363-382. 

ORBIGNY, A. [D.] d', 1835a, Synopsis terrestrium et fluviatilium molluscorum, in suo per Americam 
meridionalem itinere. Magasin de Zoologie, 5(61-62): 1-44. [after 1 July] 

ORBIGNY, A. [D.] d', 1835-1847, Voyage dans l'Amérique Méridionale (le Brésil, la république 
orientale de l'Uruguay, la république Argentine, la Patagonie, la république du Chili, la république 
de Bolivia, la république du Pérou), exécuté pendant les années 1826. 1827, 1828. 1829. 1839. 
1831. 1832 et 1833. Tome cinquième. 3." partie: mollusques. P. Bertrand, Paris; V.'' Levrault, 
Strasbourg. 758 pp., 82 pis. 



NEW WORLD AMPULLARIIDAE 



91 



Published in livraisons as follows: 



3ison 


Pages 


Plates 




Wrapper date 


Date of publication 
















(Evenhuis & Cowie, 1995) 


1 


- 




1,2 




1834 


15 May 1835b 


3 


- 




4 






1835 


15 May 1835c 


4 


- 




3 






1835 


Before 31 August 1835d 


5 


- 




5, 6, 7 




1835 


31 August 1835e 


6 


1-48 


10, 


12 




1834 


14 September 1835f 


7 


49-72 


- 






1835 


23 November 1835g 


8 


73-- 


104 


- 






1834 


7 December 1835h 


9 


105- 


-128 


9, ' 


11, 13 


1834 


4 January 1836a 


11 


129- 


-152 


17, 


21 




1835 


18Apnl 1836b 


12 


153- 


-176 


8 






1835 


30 May 1836c 


13 


- 




18, 


19, 


22 


1835 




14 


- 




20, 


25 




1835 


11 July 1836e 


15 


- 




23 






1835 


1 August 1836f 


16 






15, 


16 




1834 


26 September 1836g 


17 


177- 


-184 


27, 


28 




1836 


3 October 1836h 


18 


- 




14, 


26 




1836 


7 November 1836i 


21 


- 




31 






1836 




22 


- 




24, 


35 




1836 


27 February 1837a 


23 


- 




30, 


32, 


34 


1836 


3 April 1837b 


24 


- 




35, 


37 




1836 


5 June 1837c 


25 


- 




38, 


41 




1837 


19 June 1837d 


26 


- 




38, 


39 




1837 


7 August 1837e 


27 


- 




40, 


45 




1837 


18 September 1837f 


28 


- 




29, 


46 




1837 




29 


- 




40, 


42, 


43 


1837 


6 November 1837h 


31 


185- 


-232 


44 






1837 


5 March 1838a 


32 


233- 


-280 


47 






1837 


23Aphl 1838b 


33 


281- 


-328 


48, 


52 




1837 


6 May 1838c 


34 


329- 


-376 








1837 


11 June 1838d 


35 






49, 


50, 


51 


1837 


15 October 1838e 


36 


- 




55 






1835 


12 November 1838f 


37 


- 




56 






1834 


8 April 1839a 


38 


- 




57 






1837 


29Apnl 1839b 


39 


- 




58 






1836 


24 June 1839c 


42 


- 




59 






1839 


11 November 1839d 


43 


- 




64, 


65 




1939 


21 November 1839e 


44 


- 




54, 


60- 


-63 


1839 


6 September 1841a 


46 


- 




66 






1839 


8 November 1841b 


47 


- 




68, 


69 




1839 


8 November 1841c 


48 


- 




70 






1940 


8 November 184 Id 


49 


377- 


-408 


- 






1840 


15 November 184 le 


50 






53, 


67, 


71 


1840 


15 November 184 If 


51 


409- 


-424 


72 






1841 


15 November 184 Ig 


52 


425- 


-472 


73, 


74, 


79 


1841 


15 November 1841 h 


53 


473- 


-488 


75, 


76, 


80 


1841 


14 February 1842a 


82 


489- 


-528 


- 






1846 


- 


83 


529- 


-600 


- 






1845 


- 


84 


601- 


-656 


- 






1846 




85 


657- 


-704 


- 






1846 




86 


705- 


-728 


- 






1846 


- 


- 


729- 


-758 










- 


88 






83, 


85 




1842 


- 


89 


- 




78, 


81 




1847 


- 


90 


- 




79, 


82 




1847 


- 



92 COWIE&THIENGO 

ORBIGNY, A. [D.] d', [1842] 1853, Mollusques. Tome second. Pp. [Ihv], 1-380, 28 pis., in: R. DE LA 
SAGRA, Histoire ptiysique, politique et naturelle de I'ile de Cuba. Arthus Bertrand, Paris. 

Published in livraisons. Few details are available; the following are from G. Rosenberg (pers. comm to RHC, 
October 2001): 



Pages 


Date of publication 


1-112 


1842c 


113-128 


8 November 1844 


129-208 


16 February 1848 


209-380 


1853 



PAETEL, F., 1873, Catalog der Conchylien-Sammlung von Fr. Paetel. Nebst Uebersicht des 
angewandten Systems. Gebrüder Paetel, Berlin, [iv] + 172 pp. [after April] 

PAETEL, F., 1887-1888, Catalog der Conchylien-Sammlung von Fr Paetel. Vierte Neubearbeitung. 
Erste Abtheilung: die Cephalopoden, Pteropoden und Meeres-Gastropoden . Gebrüder Paetel, 
Berlin, [i] + 16 + 639 pp. 

Published in Lieferungen as follows: 
Lieferung Pages Date of publication 

1-6 1-480 after June 1887 

7,8 481-639 before 22 October 1 888 

PAIN, T, [1946]a, Two new species of Pila (= Ampullaria) from South America. Proceedings of the 

Malacological Society of London, 26: 180-181, pi. 6. [31 January] 
PAIN, T, 1946b, On Pila canaliculata and its locality. Proceedings of the l\/lalacological Society of 

London, 27(2): 58-59. [5 September] 
PAIN, T., 1949a, Three new species of Pomacea from South America. Proceedings of the 

Malacological Society of London, 27(6): 257-258, pi. 13. [14 January] 
PAIN, T, 1949b, On the types of three species of Pomacea described by GB. Sowerby III. Proceedings 

of the Malacological Society of London, 28(1): 39-40, pis. 1, 2. 
PAIN, T, 1950a, A new species of Pomacea (Limnopomus) from Venezuela. Journal of Conchology, 

23(4): 109-111. [July] 
PAIN, T, 1950b, Pomacea (Ampullariidae) of British Guiana. Proceedings of the Malacological Society 

of London, 28: 63-74, pis. 6-8. 
PAIN, T, 1951, Pomacea hanleyana (Alderson). Journal of Conchology, 23(5): 145-146. [5 March] 
PAIN, T., 1952, Notes on the Pomacea of Surinam, with special reference to Ampullaria sowerbyi 

Vernhout. Basteria, 16(1/2): 30-32. 
PAIN, T., 1953, Pomacea ghiesbreghti (Reeve) in Guatemala. Proceedings of the Malacological 

Society of London, 29(6): 222-223. [16 January] 
PAIN, T, 1956a, On a collection of Pomacea from Colombia, with description of a new subspecies. 

Journal of Conchology, 24(3): 73-79. [20 February] 
PAIN, T, 1956b, Notes on the generic names Pomacea and Ampullarius. Journal of Conchology, 

24(3): 79. [20 February] 
PAIN, T, 1957, Pomacea of the Sierra de Merida, Venezuela. Journal of Conchology, 24(5): 175-176. 

[4 January] 
PAIN, T., 1960, Pomacea (Ampullariidae) of the Amazon River system. Journal of Conchology, 24(12): 

421-432. [16 December] 
PAIN, T, 1964, The Pomacea flagellata complex in Central America. Journal of Conchology, 25(6): 

224-231, pi. 13. 
PAIN, T., 1972, The Ampullariidae, an historical survey. Journal of Conchology, 27: 453 462. 
PAIN, T & S. ARIAS, 1958, Descripción de una especie nueva de Pomacea de Venezuela 

(Mesogastropoda, Architaenioglossa, Mollusca). Novedades Científicas. Contribuciones 

Ocasionales del Museo de Historia Natural La Salle, Serie Zoológica, 24: 5-11. [22 December] 
PARODIZ, J. J., 1969, The Tertiary non-marine Mollusca of South America. Annals of Carnegie 

Museum , 40: 1-242. [30 June] 
PARODIZ, J. J. & J. J. TRIPP 1988, Types of Mollusca in the collection of the Carnegie Museum of 

Natural History. Part 1. Bivalvia and Gastropoda (Prosobranchia and Opisthobranchia). Annals of 

Carnegie Museum, 57: 111-154. [20 May] 
PATTERSON, В., 1936, Caiman latirostris from the Pleistocene of Argentina, and a summary of South 

American Cenozoic Crocodilia. Herpetologica, 1(2): 43-54. [28 December] 
PERERA, G & J. G WALLS, 1996, Apple Snails in the Aquarium. TF.H. Publications, Inc., Neptune 

City, New Jersey. 121 pp. 
PERRY, G., 1810-1811, Arcana: or the museum of natural history. Stratford, London. 84 pis. 

[unnumbered], associated text. 

issued in monthly parts of unnumbered plates and associated text. The plates were numbered by Mathews & 
Iredale (1912) and monthly dates are here given following those authors. Pomacea macúlala appears on pi. 12. 



NEWWORLDAMPULLARIIDAE 



93 



However, Cowie (1997a: 84) indicated that P. maculata appeared on pi. 11, based on pencilled numbers in the 
BMNH copy. Neave (1940: 866) indicated that it appeared in signature G5. A full collation is in preparation and 
confirms that P. maculata appeared on pi. 12 in signature G5 (R. E. Petit, pers. comm. to RHC, 16 October 2000). 



Plates 


Date of publication 


[1-4] 


1 January 1810a 


[5-8] 


February 1810b 


[9-12] 


1 March 1810c 


[13-16] 


April 181 Od 


[17-20] 


May 1810e 


[21-24] 


June 1810f 


[25-28] 


July 1810g 


[29-32] 


August 1810h 


[33-36] 


September I8IO1 


[37-40] 


October 1810J 


[41-44] 


November 1810k 


[45-48] 


December 18101 


[49-52] 


January 1811a 


[53-56] 


February 1811b 


[57-60] 


March 1811c 


[61-64] 


Apnl 181 Id 


[65-68] 


May 1811e 


[69-72] 


June 1811f 


[73-76] 


July 1811g 


[77-80] 


August 1811h 


[81-84] 


September 1811 i 



PETIT, R. E. & M. G. HARASEWYCH, 1990, Catalogue of the superfamily Cancellahoidea Forbes and 
Hanley, 1851 (Gastropoda: Prosobranchia). The Nautilus, Supplement, 1: 1-69. [6 March] 

PHILIPPI, R. A., 1849, Centuria tertia testaceorum novorum. (Contin.) Zeitschrift für Malakozoologie, 
6(2): 17-26. [May] 

PHILIPPI, R. A., 1851-[1852], Die Gattung Ampullaha. In Abbildungen nach der Natur mit 
Beschreibungen. 74 pp., pis. A, 1-21, in: H с. KÜSTER, Systematisches Conchylien-Cabinet von 
Martini und Chemnitz. Neu herausgegeben und vervollständigt. Ersten Bandes zwanzigste 
Abtheilung. Bauer & Raspe, Nürnberg [= Nuremberg]. 

Published in parts as follows: 



Part 


Pages 


Plates 


Date of publication 


104 


1-24 


A. 1-5 


1851 


107 


25-48 


6-11 


1852a 


110 


49-74 


12-17 


1852a 


113 




18-21 


1852a 



PHILIPPI, R. A., 1852b, Centuria quinta testaceorum novorum. (Contin.) Zeitschrift für 

Malakozoologie, 9(2): 20-29. [25 March] 
PILSBRY, H. A., 1891, Land and fresh-water mollusks collected in Yucatan and Mexico. Proceedings 

of the Academy of Natural Sciences of Philadelphia, 43: 310-334, pis. 14, 15. 

Published in two parts as follows: 



Pages 

310-328 
329-334 



Date of publication 

25 August 1891a 
22 September 1891b 



PILSBRY, H.A., 1 893, Notes on a collection of shells from the state of Tabasco, Mexico. Proceedings 
of the Academy of Natural Sciences of Philadelphia, 44[1892]: 338-341, pi. 14. [24 January] 

PILSBRY, H. A., 1 899, A new Ampullaha. Proceedings of the Academy of Natural Sciences of Philadel- 
phia, 51: 365. [8 September] 

PILSBRY, H.A., 1927a, Revision of the Ampullahidae of Jamaica and Cuba. Proceedings of the Acad- 
emy of Natural Sciences of Philadelphia, 79: 247-253, pis. 21-22. [10 September] 

PILSBRY H. A., 1927b, On Pomacea Perry (Ampullahidae). The Nautilus, 41(2): 63-64. [27 October] 

PILSBRY, H. A., 1933, Zoological results of the Matto Grosso expedition to Brazil in 1931, - II. Mol- 
lusca. Proceedings of the Academy of Natural Sciences of Philadelphia, 85: 67-76, pi. 2. [17 July] 

PILSBRY, H. A., 1944, Molluscan fossils from the Rio Pachitea and vicinity in eastern Peru. Proceed- 
ings of the Academy of Natural Sciences of Philadelphia, 96: 137-153, pis. 9-11. [11 August] 

PILSBRY, H. A., 1953, The case of Pa/ud/na multilineata Say. The Nautilus, 67(2): 58-61. [11 November] 



94 COWIE&THIENGO 

PILSBRY, H. A. & J. T. BEQUAERT, 1927, The aquatic mollusks of the Belgian Congo. With a geo- 
graphical and ecological account of Congo malacology. Bulletin of the American Museum of Natural 
History, 53(2): 69-602, pis. 10-77. [9 May] 

PILSBRY, H. A. & A. A. OLSSON, 1953, A Colombian Pomacea of the Effusa group. The Nautilus, 
66(3): 98-99, pi. 6, fig. 6. [2 February] 

PONDER, W. F. & D. R. LINDBERG, 1997, Towards a phylogeny of gastropod molluscs: an analysis 
using morphological characters. Zoological Journal of the Linnean Society, 119: 83-265. 

PONDER, W. F. & A. WAREN, 1988, Classification of the Caenogastropoda and Heterostropha - a list 
of the family-group names and higher taxa. Malacological Review, Supplement, 4: 288-326. 

PRASHAD, В., 1925, Revision of the Indian Ampullariidae. Memoirs of the Indian Museum, 8(2): 69- 
89, pis. 13-15. [May] 

PRASHAD, В., 1931, Further notes on Indian Ampullariidae {- Pilidae). Proceedings of the Malaco- 
logical Society of London, 19(4): 167-168. [March] 

PRESTON, H. В., 1914, New non-marine Mollusca from Peru and Argentina. Annals and Magazine of 
Natural History, (8) 13 (77): 522-528. [May - on cover of issue] 

PRESTON, H. В., 1915, The fauna of British India, including Ceylon and Burma. Mollusca. (Freshwa- 
ter Gastropoda & Pelecypoda). Taylor and Francis, London, xiv + 244 pp. [March] 

QUOY, J. R. С & L. P GAIMARD, 1824-[1826], Zoologie, Pp. i-vii, 1-712, 96 pis., in: L. С D. DE 
FREYCINET, Voyage autour du monde, entrepris par ordre du Roi sous le rninistère et conformément 
aux instructions de S. Exe. M. le Vicomte du Bouchage. Secrétaire d' État au Département de la 
Marine, exécuté sur les corvettes de S. M. l'Uranie et la Physicienne, pendant les années 1817, 
1818, 1819 et 1820: publié sous les auspices de S. E. M. le Comte Corbière, Secrétaire d'État de 
l'Intérieur pouv la partie historique et les sciences naturelles, et de S. E. M. le Marquis de 
Clermont-Tonnerre, Secrétaire d'Etat de la Marine et des Colonies, pouv la partie nautique. Pillet 
Aîné, Paris. 

Published in livraisons as follows: 



Livraison 


Pages 


Date of publication 


1 


1-40 


26 June 1824a 


2 


41-88 


31 July 1824b 


3 


89-128 


28 August 1824c 


4 


129-184 


18 September 1824d 


5 


185-232 


9 October 1824e 


6 


233-280 


20 November 1824f 


7 


281-328 


18 December 1824g 


8 


329-376 


29 January 1825a 


9 


377-424 


26 March 1825b 


10 


425-464 


7 May 1825c 


11 


465-496 


18 June 1825d 


12 


497-536 


6 August 1825e 


13 


537-576 


1 October 1825f 


14 


577-616 


17 December 1825g 


15 


617-664 


26 April 1826a 


16 


665-712 


14 June 1826b 



In the "Préface" to this work (unnumbered page 3), Quoy & Gaimard thank Férussac for the nomenclature of the 
terrestrial mollusks. In the introduction to the terrestrial and freshwater mollusks, Quoy & Gaimard state (pp. 463- 
464) that "Nous devons à M. de Férussac la description des espèces que nous avons rapportées, dont il a fait 
figurer plusiers dans son magnifique ouvrage sur les mollusques terrestres et fluviátiles." Thus, authorship of the 
descriptions of the terrestrial and freshwater mollusks (pp. 465-496, including Ampullaria) is Férussac, in Quoy 
& Gaimard, though Quoy & Gaimard are the authors of the introductory text to that chapter (pp. 462-464). 

REEVE, L. [A.], 1856, Monograph of the genus Ampullaria. Pis. 1-28, in: L. [A.] reeve, Conchologia 
Iconica: or, illustrations of the shells of molluscous animals. Vol. X. Lovell Reeve, London. 

This is a lambda book (a book in which plates were published separately, along with unnumbered pages of 
explanatory text, as the plates were ready). After all plates were completed, they were bound into volumes. Dates 
of publication as given on the bottom of the explanatory text for each plate are as follows for Ampullaria. 

Plates Date of publication 

2-4 June 1856a 

5-12 August 1856b 

13-20 October 1856c 

21, 22 November 1856d 

1, 23-28 December 1856e 



NEWWORLDAMPULLARIIDAE 95 

RICHARDS, H. G., 1933, A conchological expedition to Cuba. Proceedings of the Pennsylvania Acad- 
emy of Science, 7: 167-172. [4 December] 

RÖDING, R R, 1798, Museum Boltenianum. Pars Secunda. J. С Trapp, Hamburg, viii + 199 pp. [Sep- 
tember] 

Authorship of this work determined by ICZN Direction 48. 

ROISSY, F. de, 1805, Histoire naturelle, genérale et particulière, des mollusques, animaux sans 
vertèbres et a sang blanc. Tome cinquième. F. Dufart, Paris. 448 pp. 

RUHOFF, F. A., 1980, Index to the species of Mollusca introduced from 1850 to 1870. Smithsonian 
Institution Contributions to Zoology, 294: [i]-iii, 1-640. 

SAULCY, E. de, 1854, Note sur I'ampullaire ceil dAmmon, Ampullaria effusa (Lamarck). Bulletin de la 
Société d'Histoire Naturelle du Département de la Moselle, 6: 139-147, 1 pi. 

SAY, T., 1824, Appendix. Part I. - Natural History. 1. Zoology. Pp. 253-378, pis. 14-15, in: W H. KEATING, 
ed.. Narrative of an expedition to the source of St. Peter's River, Lake Winnepeek, Lake of the 
Woods, &c. &c. Performed in the year 1823. by order of the Hon. J. С Calhoun, Secretary of war, 
under the command of Stephen H. Long, Major U.S. Т.Е. Vol. II. H.C. Carey & I. Lea, Philadelphia. 

SAY, T., 1829, Descriptions of some new terrestrial and fluviatile shells of North America. The Dissemi- 
nator of Useful Knowledge [New Harmony], 2. 

Published In parts, as follows: 

Pages Date of publication 

229-230 29 July 1829a 

244-246 1 2 August 1 829b 

259-261 26 August 1829c 

275-277 9 September 1829d 

291-293 23 September 1829e 

308-310 7 October 1829f 

323-325 21 October 1829g 

339-341 4 November 1829h 

355-356 18 November 18291 

SCHUMACHER, С F., 1817, Essai d'un nouveau système des habitations des vers testacés avec XXII 
planches. Schultz, Copenhague, [il] + 287 pp., 22 pis. 

SHERBORN, С D., 1922-1933, Index animalium sive index nominum quae ab A.D. MDCCLVIII 
generibus et speciebus animalium imposita sunt. Sectio secunda a kalendis ianuariis, MDCCI 
usque ad finem decembhs, MDCCCL. British Museum, London, cxlvii + vii + [i] +7056 + 1098 pp. 

SMITH, B. D., 1992, Introduction and dispersai of apple snails (Ampullahidae) on Guam. Pacific Sci- 
ence Association Information Bulletin, 44: 12-14. 

SMITH, M., 1937, East coast mahne shells. Descriptions of shore mollusks together with many living 
below tide mark, from Maine to Texas inclusive, especially Florida. Edwards Brothers, Inc., Ann Ar- 
bor, vii + 308 pp. [before 12 June] 

SOWERBY, G. B. [1st of the name], 1825, A catalogue of the shells contained in the collection of the 
late Earl of Tankerville, arranged according to the Lamarckian conchological system; together with 
an appendix, containing descriptions of many new species. G.B. Sowerby, London, vii + 92 + xxxiv 
pp., 9 pis. 

SOWERBY, G. B. [3rd of the name], [1 875], Descriptions of five new species of shells. Proceedings of 
the Zoological Society of London, 1874(4): 598-600, pi. 72. [April] 

SOWERBY, G. B. [3rd of the name], 1894, Descriptions of three new species oí Ampullaria. Proceed- 
ings of the Malacological Society of London, 1(2): 48-49. [March] 

SOWERBY, G. B. [3rd of the name], 1909a, Notes on the family Ampullariidae, with list of species, 
varieties, and synonyms, also descriptions of four new species. Proceedings of the Malacological 
Society of London, 8: 345-362. [September] 

SOWERBY, G. B. [3rd of the name], 1909b, Notes on certain types of Ampullaria in the Paris and 
Geneva museums. Proceedings of the Malacological Society of London, 8: 363-364. [September] 

SOWERBY, G. B. [3rd of the name], 1910, Notes on the family Ampullariidae (continued). Proceedings 
of the Malacological Society of London, 9(1): 56-64. [March] 

SOWERBY, G. B. [3rd of the name], 1916, Notes on the family Ampullariidae (continued). Proceedings 
of the Malacological Society of London, 12(2/3): 65-73. [28 November] 

SOWERBY G. B. [3rd of the name], 1919, Description of Ampullaria mermodi, n. sp. Proceedings of 
the Malacological Society of London, 13(5/6): 152-153. [October] 

STARMÜHLNER, F., 1984, Occurrence, longitudinal distribution and geographical range of the fresh- 
and brackish water molluscs of the Lesser Antillean islands (Guadeloupe, Dominica and 
Martinique). Soosiana, 12: 83-102. 

STARMÜHLNER, F., 1988, Ergebnisse der Österreichisch-Französischen hydrobiologischen Mission 
1979 nach Guadeloupe, Dominica und Martinique (Kleine Antillen) Teil II: Beiträge zur Kenntnis der 



96 COWIE&THIENGO 

Süß- und Brackwassermollusken von Guadeloupe, Dominica und Martinique. Annalen des 
Naturhistorischen Museums in Wien. Serie B, 90: 221-339, pis. 1-6. [8 July] 

STEWART, R. В., 1930, Gabb's California Cretaceous and Tertiary type lamellibranchs. Academy of 
Natural Sciences Special Publication, 3: 1-314, pis. 1-17. [9 August] 

STREBEL, H., 1873, Beitrag zur Kentniss der Fauna mexikanischer Land- und Süsswasser Con- 
chylien. Abhandlungen aus dem Gebiete der Naturwissenschaften herausgegeben von dem 
Naturwissenschaftlichen Verein in Hamburg, 6(1): 1-69, pis. 1-3, За, 4-7. 

SWAINSON, W., 1821-1823, Zoological illustrations, or original figures and descriptions of new, rare, 
or interesting animals, selected chiefly from the classes of ornithology, entomolgy, and conchology 
and arranged on the principles of Cuvier and other modern zoologists. Vol. II, Vol. III. Baldwin, 
Cradock, and Joy, and W. Wood, London. 

Vol 



Plates 


Pages 


Date of publication 


67-119 


[12] + [63] 


1821-1822a 


120-134 


[15] 


1822b 


135-182 


[48] 


1823a 



SWAINSON, W., 1822c, A catalogue of the rare and valuable shells, which formed the celebrated 

collection of the late Mrs. Bligh. With an appendix, containing deschptions of many new species, 

and two plates. W. Smith, Dubois, Wood, London. 58 + [2] + 20 [Appendix] pp., 2 pis. 
SWAINSON, W., 1823b, The characters of several rare and undescribed shells. The Philosophical 

Magazine and Journal, 61: 375-378. [31 May] 
SWAINSON, W., 1831-1832, Zoological illustrations, or original figures and descriptions of new, rare, 

or interesting animals, selected chiefly from the classes of ornithology, entomolgy and conchology, 

and arranged according to their apparent affinities. Second senes. Vol. II. Baldwin & Cradock, and 

R. Harwell, London, [iv] + [46] pp., pis. 46-91. 
TAMARU, С S., 1 996, Control of the apple snail (Pomacea canaliculata), planning project. Six month 

report: contract 40785. Unpublished Sea Grant Miscellaneous Report. University of Hawaii Sea 

Grant College Program, Honolulu. 18 + [5] + 24 pp. 
THIENGO, S. C, 1987, Observations on the morphology of Pomacea linéate (Spix, 1827) (Mollusca, 

Ampullariidae). Memorias do Instituto Oswalde Cruz, 82(4): 563-570. 
THIENGO, S. С, 1989, On Pomacea sórdida (Swainson, 1823) (Prosobranchia, Ampullariidae). 

Memorias do Instituto Oswalde Cruz, 84 (3): 351-355. 
THIENGO, S. С, С. E. BORDA & J. L. В. ARAIJJO, 1993, On Pomacea canaliculata (Lamarck, 1822) 

(Mollusca; Pilidae: Ampullariidae). Memorias do Instituto Oswalde Cruz, 88(1): 67-71. 
THOMPSON, F. G, 1997, Pomacea canaliculata (Lamarck, 1822) (Gastropoda, Prosobranchia, 

Pilidae): a freshwater snail introduced to Florida, U.S.A. Malacological Review, 30: 91. 
TILLIER, S., 1980, Gastéropodes terrestres et fluviátiles de Guyane Française. Mémoires du 

Muséum National d'Histoire Naturelle. Nouvelle Série. Série A, Zoologie, 118: 1-189. 
TRACEY, S., J. A. TODD, J. Le RENARD, С KING & M. GOODCHILD, 1 996, Distribution of Mollusca 

in units SI to S9 of the Selsey Formation (middle Lutetian), Selsey Peninsula, West Sussex. Tertiary 

Research, 16(1-4): 97-139, 3 pis. 
TREW, A., 1992, Henry and Arthur Adams's new molluscan names. National Museum of Wales, 

Cardiff. 63 pp. 
TRISTRAM, H. В., [1864], Supplemental catalogue of terrestrial and fluviatile mollusks collected in 

Guatemala by O. Salvin, Esq., M.A., F.Z.S. Proceedings of the Zoological Society of London, 

1863(1): 411-414. [April] 
TROSCHEL, F. H., 1848, Mollusca. Pp. 545-551, in: R. SCHOMBURGK, Reisen in Britisch-Guiana in 

den Jahren 1840-1844. Im Auftrag Sr Majestät des Königs von Preussen. Nebst einer Fauna und 

Flora Guiana's nach Vorlagen. Mit Abbildungen und einer Karte von Britisch-Guiana. Dritter Theil. 

J.J. Weber, Leipzig. 
VALENCIENNES, A., 1833, Coquilles univalves terrestres et fluviátiles. Pp. 238 261 , pis. 55-57, in: A. 

DE HUMBOLDT & A. BONPLAND, Recueil d'observations de zoologie et d'anatomie comparée, faites 

dans l'océan Atlantique, dans l'intérieur du nouveau continent et dans la mer du sud pendant les 

années 1799, 1800, 1801, 1802 et 1803. Deuxième volume. J. Smith & Gide, Paris. 
VERNHOUT, J. H., 1914a, The non-marine molluscs of Surinam. A/oies from the Leyden Museum, 

36(1): 1-46, pi. 1, figs. 1-14, pi. 2. [ 31 March] 
VERNHOUT, J. H., 1914b, On a new variety of Ampullaria crassa Swainson from French Guyana. 

Notes from the Leyden Museum, 36(2): 46-48, pi. 1, fig. 15a, b. [ 31 March] 
VILLENA, M., M. T APARICIO, L. BARATECH & J. TEMPLADO, 1997, Los "ejemplares tipo" de las 

colecciones malacologicas del Museo Nacional de Ciencias Naturales. Volumen II. Monografías del 

Museo Nacional de Ciencias Naturales, 13: 1-170, 3 pis. 
WAGNER, J. A., 1827, Testacea fluviatilia quae in itinere perBrasiliam annis MDCCCXVII - MDCCCXX 

jussu et auspiciis Maximiliani Joseph i I. Bavariae regis augustissimi suscepto collegit et pingenda 

curavit Dr J. B. de Spix, quondam ordinis regii coronae Bavaricse civilis eques, academiœ 



NEW WORLD AMPULLARIIDAE 



97 



scientiarum Bavaricœ socius Ordinarius, musei regii zoologici. zootomici et ethnographici conserva- 
tor re!. С Wolf, Monachii. iv + [ii] + 36 pp., 29 pis. 

Authorship of this work and the species described in it are discussed by Cowie et al. (in prep). There is a variant 
issue also published in 1827 by Т.О. Weigel, Lipsiae [- Leipzig]. 

WALKER, В., 1918, A synopsis of the classification of the fresh-water Mollusca of North America, 
north of Mexico, and a catalogue of the more recently described species, with notes. University of 
IVIiciiigan Museum of Zoology Miscellaneous Publications 6: 1-213. [30 December] 

WELTER-SCHULTES, F. W., 1999, Systematisches Conchylien-Cabinet von Martini und Chemnitz 
(1837-1920), bibliography of the volumes in Göttingen. Archives of A/aiura/ History, 26(2): 157-203 
[June] 

WILLIAMS, J. W., 1889, Note on a new species oí Ampullaria from the La Plata. Annals and Magazine 
of Natural History, (6) 4(19): 47-49. [July issue] 

YONG, M. & G. PERERA, 1 984, A preliminary study of the freshwater mollusks of the Isle of Youth (Isle 
of Pines), Cuba. Walkerana. 2(7): 121-123. [December] 

Revised ms. accepted 12 March 2003 



INDEX OF LISTED TAXA 

This index includes all ampullariid names 
listed in the main body of the catalog. Family- 
group names are in BOLDFACE capitalized 
letters. Genus-group names are in all 
CAPITALIZED letters. Unavailable names are in 
italics. Unpublished names are listed in quotes 
in plain type. 

acuta Paetel 56, 81 

"adjusta" no author 81 

adusta Reeve 80 

aldersoni Pain 56 

amazónica Reeve 43, 56 

americanista Ihering 78 

AMPULLARIIDAE Gray 41-81 

AMPULLAROIDES Gray 46 

AMPULLOIDEA Orbigny 46 

AMPULLOIDES Orbigny 46 

angulata Jay 56-57 

angulata Dunker 56-57 

angulata Deshayes 56 

angulata H. Adams & A. Adams 57 

aperta Philippi 80 

arata Fischer & Crosse 57 

archimedes Spix & Wagner 57 

armeniacum Hupe 57 

ASOLENA Herrmannsen 46 

ASOLENE Orbigny 41 42, 46 50, 60, 78 

aulanieri Deville & Huppé 57, 60, 68, 75 

auriformis Reeve 57 

aurostoma Lea 57 

australis Orbigny 57 

autumnalis Reeve 57 

avellana Sowerby 57-58, 81 

baeri Dautzenberg 52 

balteata Philippi 52 

batabana Paetel 58 



belizensis Crosse & Fischer 58 

bilineata Reeve 78-79 

brasiliensis Paetel 58 

bridgesiiReeve42,58, 62 

brownii Jay 46 

bruguieri Deshayes 80 

bulla Reeve 58 

buxea Reeve 58, 78-79 

caliginosa Reeve 58 

camena Pain 58, 69 

canaliculata Lamarck 42-43, 57-59, 62, 65-66, 

76,81 
cassidiformis Reeve 59 
castanea Deshayes 52 
castelloi Sowerby 59, 72 
castelnaudii Hupe 59 
catamarcensis Sowerby 59 
catemacensis Baker 59 
cerasum Hanley 57, 59 
CERATODES Guilding 49-51 
chamana Hinkley 59 
chaquensis Scott 59 
chemnitzii Philippi 59, 72-74 
chiapasensis Fischer & Crosse 59 
chiquitensis Orbigny 50 
chlorostoma Sowerby 52 
cincta Cristofori & Jan 60 
cingulata Philippi 52 
citreum Reeve 60 
columbensis Jay 60 
columbiensis Philippi 60 
columbiensis Reeve 60, 68, 76 
columellaris Gould 51 , 60, 74-75 
commissionis Ihering 60 
C0NCHYLIUMCuvier51 
cónica Guppy 52, 81 
conoidea Martens 60 
consolatrix Ihering 60 
contamanoensis Preston 60 



98 



COWIE&THIENGO 



contrarius Müller 50 

cornuarietis Linnaeus 49-51 

cornucopia Reeve 60 

costaricana Martens 60 

cousini Jousseaume 61 

crassa Orbigny 47 48 

crassa Swainson 46-49, 67, 80 

crocostoma Philippi 52 

crosseana Hidalgo 61 

cubensis Morelet61 

cubensis Reeve 61 , 72 

cumingii King & Broderip 61 , 69, 72, 74 

cuprina Reeve 42, 53 

cyclostoma Spix & Wagner 47-49, 63, 77 

dacostae Sowerby 61 

decussata Moricand 60-61 , 67 

delattrei Fischer & Crosse 61 , 67 

depressa Say, 62,71,81 

diffusa Blume 58, 62 

dilatata Orbigny 62 

disseminata Kay 62 

dolioides Reeve 62 

dolium Philippi 62 

dorbignyana Philippi 62 

dorbignyi Philippi 62 

dubia Guilding 53, 55 

dysoni Hanley 62 

EFFUSA Jousseaume 42, 51-55, 61 , 72-73 

effusa Müller 53-54, 56 

electrina Reeve 63 

elegans Orbigny 63, 72 

elongata Dall49 

elongata Orbigny 49, 63 

equestris Röding 79 

erogata Crosse & Fischer 63 

errónea Nevill63 

erythrostoma Reeve 63 

eumicra Crosse & Fischer 63 

exculpta Fischer & Crosse 63 

exigua Philippi 80 

eximia Dunker 59, 63 

expansa Miller 53 

exumbilicata Spix & Wagner 47 

fairchildi Clench 78 

falconensis Pain & Arias 63 

fasciata Lamarck 64, 79 

fasciata Reeve 64 

fasciata Roissy 51 , 58, 60, 63 64, 76, 79 

fasciatus Guilding 50-51 

fasciolata Spix & Wagner 47 

FELIPPONEA Dall 41-42, 49-50 

ferruginea Martens 64 

figulina Spix & Wagner 64, 75 

flagellata Say 43, 57-58, 60, 62-77 

flatilis Reeve 64 

flava Smith 64 

fumata Reeve 64 



gallardoi Ihehng47 

garciae Richards 64 

georgii Williams 64 

geveana Philippi 53, 55 

gevesensis Deshayes 53-54, 56 

ghiesbreghti Reeve 64-65, 69 

gibbosa Paetel 79 

gigantea Barbosa Rodrigues 65 

giganteus Tristram 65 

gigas Spix & Wagner 42-43, 52, 65-66, 69, 76 

glauca Linnaeus 51-56, 61, 72 

gossei Reeve 65 

granulosa Sowerby 47, 49 

guadelupensis Martens 44, 54 

guaduasensisAnderson 65 

gualtieh Orbigny 65 

"gualteriana" no author 81 

guatemalensis Martens 65 

guyanensis Lamarck 63, 65, 70-71 , 73 

haemastoma Reeve 65 

hanleyana Alderson 66, 75 

hanleyi Reeve 66 

haustrum Reeve 43, 66 

hepataria Reeve 79 

hollingsworthi Pain 66 

hondurasensis Reeve 66 

hopetonensis Lea 57-58, 66, 73, 79, 81 

ignota Röding 79 

iheringi Pilsbry49 

immersa Reeve 43, 66 

imperforata Swainson 79 

impervia Philippi 47 48 

innexa Crosse & Fischer 66 

insularum Orbigny 42, 57, 64-66, 76-77 

intermedia Férussac 54 

intermedia Gray 50-51 

interrupta Sowerby 60, 66 

intropicta Reeve 67 

knorrii Philippi 50-51 

labiosa Philippi 67 

lamarckii Philippi 67 

lattreiReeve59, 61 62,67 

lemniscata Crosse & Fischer 67 

leucostoma Swainson 67 

levior Sowerby 67 

LIMNOPOMUS Dall 47, 51 , 57, 59-60, 66, 68-69 

lineata Spix & Wagner 42-43, 59, 62, 64, 67, 

70, 72, 75-76 
linnaei Philippi 67 
livescens Reeve 60, 65, 67, 76 
lutea Farfante 67 
luteostoma Swainson 51-55 
lymnaeaeformis Reeve 67 
maculata Perry 41 , 43, 51 , 61 , 65, 68 
malleata Jonas 57, 59, 63, 68-70, 73, 75 
manco Pilsbry 68 
manetou Röding 68 



NEW WORLD AMPULLARIIDAE 



99 



marginatra Jonas 68 

MARISA Gray 41 -42, 49 51 , 77 

martensiana Nevill 60, 68, 76 

martinezi Hidalgo 68 

megastoma Sowerby 78 

melanocheila Reeve 68 

melanostoma Philippi 69 

meridaensis Pain 69 

mermodi Sowerby 69 

meta Ihering 69 

metcalfei Reeve 69 

mexicana Martens 69 

miamiensis Pilsbry 69 

miltocheilus Reeve 69 

miltochilus Fischer & Crosse 69 

minor Nevill 69-70 

minúscula Baker 54 

"miquitensis" Spix 81 

modesta Busch 70 

monachus Crosse & Fischer 70 

monstrosa Sowerby 70 

montícola Vernhout47 

nais Pain 70 

naticoides Orbigny 48 

neritina Gmelin 52, 54, 56 

neritiniformis Dall 49 

neritoides Orbigny 78 

nigrilabris Philippi 70 

nobilis Reeve 70 

notabilis Reeve 70 

novaegranadae Busch 70 

nubila Reeve 48, 70 

nucleus Philippi 79 

oajacensis Fischer & Crosse 70 

oblonga Nevill 48 

oblonga Swainson 48, 70 

obtusa Deshayes 79 

ocanensis Kobelt 70 

occlusa Crosse & Fischer 71 

ochracea Jay 71 

oculuscommunis Gmelin 54 

digista Pilsbry & Olsson 55 

olivácea Spix & Wagner 71 , 73 

olivieri Deshayes 48 

orinoccensis Troschel 55 

ormophora Morelet 48 

oviformis Deshayes 71 

pachystoma Paetel 79 

pachystoma Philippi 55 

pallens Philippi 80 

palmer! Marshall 71 

"palmieri" Preston 81 

paludinoides Cristofori & Jan 80 

paludosa Say 42, 57-58, 62-64, 66-67, 69-74, 

79,81 
papyracea Spix & Wagner 71 
pattersoni Boss & Parodiz 55 



patula Reeve 59, 71 

pealiana Lea 71 

penesma Kay 72 

periscelis Röding 72 

peristomata Orbigny 72 

pernambucensis Reeve 72 

pertusa Sowerby 72 

petiti Crosse 48 

phaeostoma Philippi 72 

philippiana Baker 55 

physis Hupe 72 

physoides Reeve 72 

picta Reeve 72 

PILIDAE Preston 41, 46 

pineiDall72 

planogyra Pilsbry 50 51 

planorboides Cristofori & Jan 79 

planorbula Philippi 55 

platae Maton 46-49 

poeyana Pilsbry 61 , 72 

POMACEA Perry 41 -43, 47, 49-51 , 54-56, 58- 

60, 62-64, 66, 68-70, 72-74, 76-77, 79, 81 
pomatia Martens 72 
POMELLA Gray 41-42, 50, 78 
pomum Philippi 72 
porphyrostoma Reeve 73 
prasina Fischer & Crosse 73 
producta Reeve 73 
prourceus Boss & Parodiz 73 
prunella Hupe 81 
prunulum Reeve 55 
pulchetia Anton 47-48 
pulchra Griffith & Pidgeon 66, 73 
puncticulata Swainson 73, 76 
puntaplaya Cousin 73 
purpurascens Guppy 73 
pyrum Philippi 73 
quercina Spix & Wagner 73 
quinindensis Miller 55 
quitensis Busch 69, 74 
reflexa Swainson 74 
retusa Philippi 74 
reyrei Cousin 74 
rA70c/ostoma Appun 55 
robusta Philippi 74 
roissii Orbigny 48 
roissyi Orbigny 47-48 
rotula Mousson 51 
rotundata Say 81 
rufilineata Reeve 80 
rugosa Lamarck 74 
sanjosensis Morrison 74 
scaiaris Orbigny 56-58, 74 
scholvieni Kobelt 74 
schrammi Crosse 78 
semitecta Mousson 74 
semperi Kobelt 75 



100 



COWIE&THIENGO 



sepulta Röding 80 

simplex Reeve 75 

sinamarina Bruguière 78 

sloanii Férussac48 

solida Busch 49 

sórdida Swainson 54, 57, 69, 75, 81 

sowerbyi Vernhout 49 

spirata Deville & Hupe 75 

spixii Orbigny49 

sprucei Reeve 75 

Storeria Jay 49 

streben Fischer & Crosse 75 

superba Marshall 75 

suprafasciata Kobelt 55 

SURINAMIA Clench 78 

swainsoni Philippi 66, 69, 75-76 

swainsonii Hupe 75-76, 79 

"tacarigua" Pilsbry 81 

tamsiana Philippi 56 

tenuissima Jousseaume 76 

teres Philippi 56, 61 

testudínea Reeve 76 

tristis Gaudion 80 

thstis Guppy 56 



tristrami Crosse & Fischer 60, 76 

trochulus Reeve 80 

"undata" no author 81 

"unicolor" Martens 81 

unicolor Philippi 76 

urabaensis Pain 76 

urceus Müller 51 , 62 63, 65-68, 70-71 , 73 74, 

76-77 
venetus Reeve 76 
"venezullum" no author 81 
vermiformis Reeve 76 
vexillum Reeve 69, 76 
vickeryi Pain 58, 76 
villata Sowerby 56 
violácea Valenciennes 77 
welwitschiana Drouët77 
woodwardi Dohrn 77 
yatesii Reeve 77 

yucatanensis Crosse & Fischer 77 
yzabalensis Martens 77 
zeteki Morrison 77 
zischkai Blume & Pain 77 
zonata Orbigny49 
zonata Spix & Wagner 49, 57, 68, 78 



MALACOLOGIA, 2003, 45(1 ): 101 -108 

ASSESSMENT OF GENETIC HETEROGENEITY WITHIN LABORATORY- 
MAINTAINED SCHISTOSOMA MAN SON l-RES\SJANT STOCKS OF 
BIOMPHALARIA GLABRATA SNAILS BY RAPD-PCR 

Wannaporn lttiprasert\ Christopher Rowe^ Carolyn Patterson^, André Miller^ 
Nithya Raghavan^, Susan BandonP, Fred Lewis^ & Matty Knight^* 

ABSTRACT 

Random amplified polymorphic DNA (RAPD)-PCR analysis was used to assess the extent of 
genetic diversity within two laboratory-maintained Schistosoma manson/'-resistant stocks of 
Biomphalaria glabrata (10-R2 and BS-90). Both stocks routinely serve as parents in crosses 
with susceptible snails for studying the genetics of parasite resistance in the snail host. 
Genomic DNA was isolated from individual adult 1 0-R2 and BS-90 snails. From RAPD-PCR 
conducted with 16 anonymous primers, no polymorphisms were detected within the BS-90 
stock, whereas 13 primers revealed considerable intrastrain variations showing different 
sized bands among the 10-R2 snails. The polymorphisms in the 10-R2 stock allowed us to 
identify three distinct groups (Types 1, 2 and 3) within these snails. Random screening of 
individual 1 0-R2 snails revealed that, of the three distinct types. Types 1 and 2 snails were 
found at similar frequencies (approximately 45%), whereas 1 0% fell into the third group (Type 
3). The identification of genetic variants within the 10-R2 stock demonstrates the need for 
careful assessment of the existence of diverse forms in this stock prior to conducting genetic 
crosses with these snails. 

Key words: genetic heterogeneity, Biomphalaria glabrata, Schistosoma mansoni, interme- 
diate snail host, intrastrain variation, resistance, DNA polymorphisms, RAPD-PCR. 



INTRODUCTION 

Much of the research on the genetics of the 
interrelationship between the parasitic helminth 
Schistosoma mansoni and the snail host 
Biomphalaria glabrata has been made possible 
because of the availability of several genetically 
defined ß. glabrata stocks that breed true for a 
variety of traits (Richards, 1970). From crosses 
conducted between many different snail stocks, 
these have been grouped into four categories 
(Types l-IV) based on susceptibility to S. 
mansoni (Richards & Shade, 1987, review). 
Snails in the Type I category are resistant to 
parasite infection at any age. Type II snails are 
susceptible as juveniles, but adult resistant. 
Type III snails are susceptible at any age, 
whereas Type IV snails are juvenile susceptible 
and adult variable. Of all these categories, 
snails from categories Types I and III have re- 
ceived the most attention by investigators study- 



ing the molecular basis of resistance and sus- 
ceptibility to infection. Accordingly, many of these 
studies have been done using either the proto- 
type Type I resistant stocks 10-R2, 13-16-R1 
or the "Salvador" strain (also referred to as BS- 
90), or the susceptible Type III M-line and NMRI 
snail stocks. 

It is known that genes of both the snail and 
parasite affect the outcome of this host/para- 
site relationship. Based on this, it was sug- 
gested as early as the late 50s (Hubendick, 
1958) that one method for reducing transmis- 
sion may involve the use of parasite resistant 
snails to replace susceptible ones in an en- 
demic area. Whether or not this form of control 
will become reality, studying the molecular bi- 
ology of the snail and parasite has become the 
focus of considerable research in recent years. 
For the emerging field of molecular malacology, 
the existence of genetically defined B. glabrata 
snail stocks has therefore been invaluable. 



'Department of Microbiology and Immunology, Faculty of Tropical Medicine, Mahidol University, Bangkok, Thailand 
^Biomedical Research Institute, 12111 Parklawn Drive, Rockville, Maryland 20852, U.S.A. 
department of Biology, SUNY-Geneseo, Geneseo, New York, U.S.A. 
'Corresponding author: mknight@afbr-bri.com ~ 



101 



102 



ITTIPRASERTETAL. 



Although recent success has been achieved 
in defining molecular markers for resistance 
in B. g/abraia (Knight et al., 1999), there is evi- 
dence that molecular heterogeneity may exist 
between individual snails within either resis- 
tant or susceptible laboratory-maintained 
stocks, potentially complicating interpretation 
of experimental results. In earlier studies, 
while searching for RFLPs in the small ribo- 
somal gene, we reported on a smaller scale 
the genetic diversity within both resistant (10- 
R2) and susceptible (M-line) snail stocks 
(Knight et al., 1991). Later, Mulvey & Bandoni 
(1994) reported differences in allozyme fre- 
quencies among nine enzymes from M-line 
snails obtained from several different labora- 
tories. 

For this study, we were interested in further 
documenting the genetic variability among our 
resistant snail stocks. Our goal was to assess 
the extent of genetic diversity in the present 
laboratory-maintained resistant stocks by 
means other than RFLP analysis before us- 
ing them to conduct crosses with the suscep- 
tible M-line snails. Although the original 10-R2 
stock was maintained in the laboratory for 
many generations without loss or reduction of 
the refractory trait (Richards, personal com- 
munication), some stocks in other laborato- 
ries occasionally show partial susceptibility, 
especially when they are exposed as juveniles. 

The RAPD-PCR method only detects domi- 
nant alleles and has the potential to show in- 
consistencies in results if assays have not 
been optimized (Williams et al., 1990; Welsh 
& McClelland, 1990). On the other hand, the 
method has been used effectively in assess- 
ing genetic diversity in both laboratory main- 
tained and field populations of ß. glabrata 
(Larson et al., 1 996; Vidigal et al., 1 994). More- 
over, in comparison to other DNAgenotyping 
tools available, for example RFLP analysis and 
examination of polymorphic microsatellite 
(simple sequence repeats) loci, RAPD-PCR 
requires no prior sequencing or cloning steps, 
uses negligible amounts of DNA, and requires 
no radioactive isotopes in the assay. 

Here, we compare the genotypes of indi- 
vidual schistosome-resistant BS-90 and 10- 
R2 snails using RAPD-PCR analysis. Of the 
two stocks, no genetic diversity was found be- 
tween snails of the BS-90 stock by this analy- 
sis. Genetic heterogeneity however was found 
in the 1 0-R2 stock, allowing us to identify three 
distinct substocks (herein after referred to as 
Types 1-3). 



MATERIALSAND METHODS 



Snails 



The two different S. manson/'-resistant stocks 
of B. glabrata used in this study were the 10- 
R2 (Richards, 1975) and BS-90 (Paraense & 
Correa, 1963) snails. Adult snails (10-14 mm 
in diameter) were reared as individuals in self- 
fertilizing lineages in beakers (400 ml) with petri 
dish covers in aerated tap water, and fed ro- 
maine lettuce. Cohorts of the snails used in this 
study, after exposure to S. mansoni miracidia, 
have always displayed the resistance phenotype. 

Genomic DNA Extraction 

Genomic DNA was prepared from the whole 
body of individual snails (Knight et al., 1 998). Snails 
were cleaned with a Q-tip and maintained over- 
night in sterile deionized water (DW) containing 
100 |.ig/ml of ampicillin at room temperature. In 
some cases, DNA was isolated from snail ten- 
tacles. For this, tentacles were snipped off live 
snails with a pair of fine tipped forceps under a 
dissecting microscope, placed in siliconized tubes 
and kept frozen at -70°C until required. The fro- 
zen tentacles were thawed into 200|iil СТАВ buffer 
(2% w/v of cetytthmethylammonium bromide, 1 .4 
M NaCI, 20 mM EDTA, 0.2% v/v of ß- 
mercaptoethanol, 1 00 mM Ths-HCI, pH8.0) con- 
taining proteinase К (0.1 mg/ml), homogenized 
with a motorized pestle (Kimble, Illinois), and in- 
cubated at 55 С for 1 h and processed further 
as deschbed previously (Knight et al., 1998). 

DNA was recovered by centrifugation and 
washed in cold 70% ethanol, air dried and re- 
suspended in an appropriate volume of sterile 
distilled water. The quality of DNA was deter- 
mined by horizontal flat-bed gel electrophore- 
sis (0.8% agarose) resolved in TBE buffer (89 
mM Tris-base, 89 mM Boric acid and 2 mM 
EDTA, pH 8.0). DNA concentration was mea- 
sured under UV illumination (Eagle Eye, 
Stratagene, California) from the intensities of 
ethidium bromide staining of the extracted DNA 
samples compared to that of known amounts 
of standard DNA spotted (1.0 ^ú) onto agarose 
plates incorporated with ethidium bromide. 

Random Amplified Polymorphic DNA 
(RAPD)-PCR 

Genetic diversity between individual resistant 
snails was analyzed by RAPD-PCR as described 
previously (Larson et al., 1996). The genotypes 



GENETIC HETEROGENEITY OF BIOMPHALARIA GLABRATA 



103 



TABLE 1. The frequency of detecting variant 
forms (%) of 10-R2 snails based on genotypying 
DMA from individual snails assayed by RAPD- 
PCR with random oligonucleotide decamer prim- 
ers. Some primers produced no product (N/P) 
and others detected no genetic diversity within 
the snails (indicated by 0). 





Sequence 5'->3' 


Va 


nants (%) 


Primer 


Type 1 


Type 2 


ТуреЗ 


OPM-05 


GGGAACGTGT 


45 


45 


10 


OPM-07 


CCGTGACTCA 


45 


45 


10 


OPZ-05 


TCCCATGCTG 


45 


45 


10 


OPM-01 


GTTGTTGGCT 


45 


45 


N/P 


OPM-04 


GGCGGTTGTC 


45 


45 


N/P 


OPM-08 


TCTGTTCCCC 


45 


45 


N/P 


OPM-09 


GTCTTGCGGA 


45 


45 


N/P 


OPM-10 


TCTGGCGCAC 


45 


45 


N/P 


OPZ-01 


TCTGTGCCAC 


45 


45 


N/P 


OPZ-03 


CAGCACCGCA 


45 


45 


N/P 


OPZ-06 


GTGCCGTTCA 


45 


45 


N/P 


OPZ-07 


CCAGGAGGAC 


45 


45 


N/P 


OPZ-10 


CCGACAAACC 


45 


45 


N/P 


OPM-06 


CTGGGCAACT 











OPM-11 


GTCCACTCTC 











OPZ-1 1 


GTCCACTGTG 












of individual 1 0-R2 and BS-90 snails were deter- 
mined by anonymous 10-mer oligonucleotide 
primers (listed in Table 1 ) obtained from Operon 
Technologies (Alameda, California). The control 
(no template DNA) was sterile distilled water. Af- 
ter amplification, the reaction was mixed with 5 
pi of loading buffer (40% sucrose, 0.25% bro- 
mophenol blue and 0.25% xylene cyanol) and run 
on a 1 .2% agarose gel containing 0.5 pg/ml of 
ethidium bromide in TBE buffer (voltage at 1 0OV). 
The amplified bands were visualized by UV illu- 
mination and sizes estimated based on the mi- 
gration of a 1 00-base pair (bp) ladder (Gibco BRL, 
Gaithersburg, Maryland). 



RESULTS AND DISCUSSION 

RAPD analysis was performed using DNA 
extracted from two different stocks of B. 
glabrata. DNA samples from 24 individuals 
of the 10-R2 stock and 20 individual BS-90 
snails were compared using 16 random prim- 
ers. The results revealed that with all of the ran- 
dom primers tested, no polymorphisms were 
found between individual BS-90 snails, whereas 
13 of 16 primers revealed variations (different 



sized bands) between the 10-R2 snails ana- 
lyzed (Table 1 ). Thirteen of the primers revealed 
that approximately 45% of the individuals ana- 
lyzed could be grouped into one of two geno- 
types (Types 1 or 2). Three primers (OPM-05, 
OPM-07, OPZ-05) revealed a third type (Type 
3) but at a lower frequency (10%). Only three 
primers (OPM-06, OPM-11 and OPZ-11) 
showed no polymorphisms between all indi- 
vidual 1 0-R2 snails tested. 

Results of specific bands obtained for the 
three 10-R2 types, using the 13 primers that 
produced amplified products, are summa- 
rized in Table 2. Seven primers (OPM-04, 
OPM-05, OPM-07, OPM-08, OPM-10, OPZ-03 
and OPZ-10) amplified different sized prod- 
ucts for Type 1 snails, but not for Type 2, thus 
allowing differentiation between the two 
types. Six primers produced bands specific 
for Type 2 snails and three primers amplified 
specific products for Type 3 snails. 

Representative examples of the polymor- 
phisms that enabled us to segregate the 1 0-R2 
snails into three distinct groups using three dif- 
ferent primers OPM-05, OPM-07 and OPZ-05, 
can be seen in Figures 1A C, respectively. 
Primer OPM-05 (Fig. 1A), revealed the pres- 
ence of high molecular weight bands (shown 
by the arrows) in Type 1 (approximately, 
1 600bp), and Type 3 (1 550bp) snails that were 
absent in Type 2 snails. Amplification using 
primer OPM-07 (Fig. 1 B) showed (indicated by 
arrows) two specific bands (1500bp and 
700bp) in Type 1 snails that were absent in 
Types 2 and 3 snails and the presence of Type 
3 specific bands (1600bp, ISOObp, 900bp and 
750bp). DNA from the 3 types amplified using 
primer OPZ-05 (Fig. 1С) produced specific 
markers for each (a band of 550bp for Type 1 , 
650bp and 800bp for Type 2,and a 1 600bp frag- 
ment and a doublet at approximately 1500bp/ 
1 550bp for Type 3). Amplification with the same 
three primers (OPM-05, OPM-07 and OPZ-05) 
using DNA from individual BS-90 snails (Figs. 
2A-C, respectively) showed that unlike the 
10-R2 snails, intrastrain variation was not de- 
tected within this stock. In some cases, results 
showed differences in the intensities of bands 
but because the same size bands were ampli- 
fied from all individual BS-90 snails, these dif- 
ferences in band intensities may be due to 
minor inconsistencies in the amount of tem- 
plate DNA utilized rather than inherent genetic 
differences in this stock. 

Using RAPD-PCR, we thus revealed consid- 
erable molecular diversity between individual 



104 



ITTIPRASERTETAL. 



TABLE 2. The detection of Type-specific bands by RAPD-PCR analysis of individual 
10-R2 snails. The sizes of the various substock specific bands were determined by 
agarose gel electrophoresis as described in Materials and Methods. No amplified 
products (N/P) were produced by ten of the primers. 







Specific bands (bp) 




Primer 


Type 1 


Type 2 


Type 3 


OPM-05 
OPM-07 
OPZ-05 


1,550 

1,400,650 

550 


650, 800 


1,500 

800 

1,600, 1500 (db) 


OPM-01 
OPM-09 
OPZ-07 


750, 400 

1,400 

1,550,400 


500 

700, 550, 500 

350 


N/P 
N/P 
N/P 


OPM-04 
OPM-08 
OPM-10 
OPZ-03 
OPZ-10 


1,550, 1,500 

1,550, 700 

1,550 

650 

1,550, 550, 500,400 




N/P 
N/P 
N/P 
N/P 
N/P 


OPZ-01 
OPZ-06 




900 (db), 1,100 
600 (db) 


N/P 
N/P 


OPM-06 
OPM-11 
OPZ-1 1 


no 


polymorphisms detected 





10-R2 snails, one of the most commonly used 
resistant stocks in investigations of the molecu- 
lar basis of the B. glabrata/S. manson/ relation- 
ship. Similar genetic heterogeneity was not 
detected between snails of another commonly 
used resistant stock (BS-90). Because of cur- 
rent research interest in these snails in the 
search for genes that define the resistance phe- 
notype, we felt that a thorough background of 
their genetic diversity/stability was warranted in 
order to avoid misscoring of genotypes in fu- 
ture molecular genetic studies. Although our 
focus is not population genetics, we also point 
to findings that may be pertinent for furthering 
our understanding of the population biology of 
these organisms. 

From our earlier crosses between the resis- 
tant (BS-90) snails and the susceptible (M-line) 
snails we were able to demonstrate that RAPD- 
markers segregated with the adult resistant 
phenotype (Knight et al., 1999). We hoped 
that crosses generated with other resistant snail 
stocks (e.g., 1 0-R2) would enable us to not only 
confirm our earlier results but help identify other 
DNA markers that may be associated with the 
refractory phenotype. 



The level of variability observed in the 1 0-R2 
snails was higher than expected, given that 
these snails were laboratory selected and main- 
tained for many years by selfing. However, 
Mulvey & Vhjenhoek (1 981 ) previously reported 
polymorphisms for four of 1 6 allozyme loci stud- 
ied in this stock. In addition, the 10-R2 snails 
are derived in part from the M-line stock devel- 
oped by Newton (1955) (Richards, 1973). M- 
line snails have been shown, by allozyme 
analysis, to display a high degree of genetic 
heterogeneity (Mulvey & Vrijenhoek, 1981; 
Mulvey & Bandoni, 1994). Earlier molecular 
studies in our laboratory using the 1 0-R2 snails, 
based on RFLP analysis of ribosomal RNA 
genes, had also revealed a certain degree of 
genetic heterogeneity within this stock (Knight 
et al., 1991). Our earlier study was limited in 
scope, however, and the fact that we can dis- 
tinguish three distinct subgroups within the 
stock with only a small subset of primers by 
RAPD-PCR was unexpected. 

Contamination might explain the variability 
observed in the 10-R2 stock, and has previ- 
ously been reported in the M-line stock of 
Blomphalaria glabrata (Mulvey & Bandoni, 



GENETIC HETEROGENEITY OF BIOMPHALARIA GLABRATA 
Type 1 Type 2 Typ^ C ontro l 



105 



A) 



1500 — 




OPM-05 



200 — 



Type 1 



B) 



1500 — 



800- 
600 



400 — 



Type 2 Type 3 Control 

1= 




OPM-07 



Type 1 



Type 2 Type 3 Control 



C) 



1 500 — 




OPZ-05 



400 — 



FIG. 1. Ethidium bromide stained agarose gels showing RAPD-PCR products amplified by anony- 
mous primers (A) OPM-05, (B) OPM-07, and (0) OPZ-05 using DNA from individual 10-R2 snails that 
segregated into three different substocks (Types 1-3). The different Type-specific bands identified 
with these primers are indicated by the arrows. Control lanes represent amplifications done in the 
absence of template DNA. 



106 

A) 



ITTIPRASERTETAL. 



1500 




OPM-05 



B) 



1500 




OPM-07 



C) 



500 — 


^B I^B <s ^B ЩЁ B| 


в^-Я ж" ш' 1 


800 — 
600 — 

400 — 
200 — 





OPZ-05 



FIG. 2. Ethidium bromide stained agarose gels showing RAPD-PCR products using primers (A) OPM- 
05, (B) OPM-07 and (C) OPZ-05 and DNA from individual BS-90 snails. Control lanes represent ampli- 
fications done with the same primers without DNA template as control. 



GENETIC HETEROGENEITY OF BIOMPHALARIA GLABRATA 



107 



1994). However, because the 10-R2 snails 
were reared as individual selfing lineages, it is 
very unlikely that the within-population varia- 
tion seen in this stock is due to contamination. 
The black-eye pigmentation of these snails 
makes them readily distinguishable from al- 
bino stocks maintained in the laboratory. 

Several genetic mechanisms might explain 
the presence of the three multilocus genotypes 
observed. The occurrence of only three mul- 
tiple locus genotypes would be consistent with 
the history of selfing in the snails that we stud- 
ied. It is possible that the three genotypes found 
within these snails may reflect derivation from 
separate self-fertilizing lineages. Further study 
of these markers using progeny from selfing 
and outcrossing individuals would be needed 
to establish this. It is also possible that inbreed- 
ing has produced distinctive combinations of 
alleles at multiple loci that work best in concert, 
without disruption. Again, further research is 
needed in order to investigate this possibility. 
Finally, spontaneous genetic mutations within 
other susceptible stocks have also been re- 
ported. For example, selection of mutants from 
the NMRI stock gave rise to the LAC-line snails, 
which display the non-susceptible phenotype, 
in addition to other abnormalities (Cooper et al., 
1994; Cousin et al., 1995). 

In contrast to our observations for the BS-90 
snails, the laboratory-derived resistant 10-R2 
stock, on which considerable research has 
been reported, has proven to be morphologi- 
cally more variable (Richards, personal com- 
munication). This stock was selected for 
juvenile resistance and maintained in self-fertil- 
izing lineages. Frequent exposure of snails 
from our 10-R2 stock, either as adults or juve- 
niles, has revealed no susceptibility to the para- 
site, and snails from the three types reported 
here do not have obvious phenotypic differ- 
ences. Several morphologic differences have, 
however, been detected in this stock over the 
years. These include deformed, everted 
mouthparts, abnormal intestine, variations in 
egg clutch size, abnormal position of the aorta, 
unusual shell development, and abnormal ten- 
tacles (Patterson & Richards, unpublished). It 
is also not clear if any of these morphological 
abnormalities may be related to inbreeding de- 
pression in this stock, and warrants further in- 
vestigation. 

The mechanism(s) by which genome plas- 
ticity occurs in 10-R2 snails remains un- 
known. In unrelated, ongoing studies in our 



laboratory, however, we have identified sev- 
eral expressed sequence tags (ESTs) show- 
ing a high degree of sequence identity to 
genes normally associated with transposable 
elements, such as transposase and reverse 
transcriptase (Miller et al., 2001 ; Raghavan, in 
preparation). Future studies will compare the 
frequency (copy-number) and gene activity of 
some of these retrotransposon-like se- 
quences between 10-R2 and BS-90 snails. 

The BS-90 snail stock, which has been 
used for most of the resistance-related genet- 
ics conducted in our laboratory, was derived 
from snails that were isolated by Paraense & 
Correa (1963) in the field (Salvador, Brazil). 
Since its arrival in our laboratory 12 years ago, 
this stock has remained robust and stable, 
with no detectable changes either in morphol- 
ogy or fecundity, regardless of whether they 
are kept as pedigree selfing snails or in a 
group. 

The inability to detect polymorphisms within 
the BS-90 stock was surprising, as allozyme 
polymorphisms were detected in a previous 
study (Bandoni et al., 1995). It is possible that 
additional variation at the level of the DNA may 
be revealed using a more sensitive tool, such 
as the examination of polymorphic micro- 
satellite loci. The analysis of variations within 
microsatellite loci of 8. glabrata as a means of 
assessing diversity among snails is steadily 
gaining significance (Jones et al., 1999; 
Malvares et al., 2000). In recent years, ge- 
nome sequencing projects for several organ- 
isms have been initiated. It is hoped that, as is 
being done for the mosquito vectors of ma- 
laria, a genome project may be forthcoming 
for 6. glabrata. In view of the present study, we 
hope that the inherent intra-strain diversity that 
exists within these snails will be taken into 
consideration before a particular snail stock is 
chosen as representative of this organism. 



ACKNOWLEGEMENTS 

We would like to thank Ms. Frances Barnes 
and Dr. Charles Richards for helpful discus- 
sions in preparation of this manuscript. This 
work was funded in part by NIH grant AI-27777. 
Ms. Ittiprasert was supported by the Royal 
Golden Jubilee Ph.D. Program, Thailand Re- 
search Fund. Susan Bandoni was supported 
by a Mid-Career Summer Fellowship from 
SUNYGeneseo. 



108 



ITTIPRASERTETAL. 



LITERATURE CITED 

BANDONI, S. M., M. MULVEY & E. S. LOKER, 
1995, Intraspecific and interspecific patterns 
of allozyme variation among species of 
Biomphalaria Preston, 1910 (Gastropoda: 
Planorbidae). Biochemical Systematics and 
Ecology, 23: 593-616. 

COOPER, L. A., С S. RICHARDS, F. A. LEWIS & 
D. J. MINCHELLA, 1994, Schistosoma man- 
soni: Relationship between low fecundity and 
reduced susceptibility to parasite infection in 
the snail Biomphalaria glabrata. Experimental 
Parasitology, 79: 21-28. 

COUSIN, C, K. OFORI, S. ACHOLONU, A. N. 
MILLER, С RICHARDS, F. LEWIS & M. KNIGHT 
1995, Schistosoma mansoni: changes in the 
albumen gland o^ Biomphalaria glabrata snails 
selected for non-susceptibility to the parasite. 
Journal of Parasitology, 81: 905-911. 

HUBENDICK, В., 1958, A possible method of 
schistosome vector control by competition be- 
tween resistant and susceptible strains. Bul- 
letin of the World Health Organization, 8: 
1113-1116. 

JONES, С S., A. E. LOCKYER, D. ROLLINSON, 
S. B. PIERTNEY & L. R. NOBLE, 1999, Iso- 
lation and characterization of micosatellite 
loci in the freshwater gastropod, Biom- 
phalaria glabrata an intemediate host for 
Schistosoma mansoni. Molecular Ecology, 8: 
2149-2151. 

KNIGHT M., P J. BRINDLEY С S. RICHARDS & R 
A LEWIS, 1 991 , Schistosoma mansoni: Use of a 
cloned ribosomal RNA gene probe to detect re- 
striction fragment length polymorphisms in the 
intermediate host Biomphalaria glabrata. Experi- 
mental Parasitology, 73: 285-294. 

KNIGHT M., A. N. MILLER, N. S. M. GEOG- 
HAGEN, F. A. LEWIS & A. R. KERLAVAGE, 
1998, Expressed sequence tags (ESTs) of 
Biomphalaria glabrata, an intermediate snail 
host of Schistosoma mansoni: use in the iden- 
tification of RFLP markers. Malacologia, 39: 
175-182. 

KNIGHT M., A. N. MILLER, С N. PATTERSON, 
С G. ROWE, G. MICHAELS, D. CARR, С S. 
RICHARDS & RA. LEWIS, 1999, The identifi- 
cation of markers segregating with resistance 
to Schistosoma mansoni infection in the snail 
Biomphalaria glabrata. Proceedings of the Na- 
tional Academy of Science USA , 99: 1510- 
1515. 

LARSON, S. E., P L.ANDERSEN, A. N. MILLER, 
С E. COUSIN, С S. RICHARDS, R A. LEWIS 
&M. KNIGHT, 1996, Use of RAPD-PCR to dif- 
ferentiate genetically defined lines of an inter- 
mediate host of Schistosoma mansoni, 
Biomphalaria glabrata. Journal of Parasitol- 
ogy, 82: 237-244. 



MARVARES, J., M. AMARISTA, J. P POINTER & 
P JARNE, 2000, Microsatellite variation in the 
freshwater Schistosome transmitting snail 
Biomphalaria glabrata. Molecular Ecology, 9: 
1009-1011. 

MILLER, A. N., N. RAGHAVAN, P С FITZ- 
GERALD, R A. LEWIS & M. KNIGHT 2001 , Dif- 
ferential gene expression in hemocytes of the 
snail Biomphalaria glabrata: effects of Schis- 
tosoma mansoni infection. International Jour- 
nal of Parasitology, 31: 687-696. 

MULVEY, M. & S. M. BANDONI, 1994, Genetic 
variability in the M-line stock of Biomphalaria 
glabrata. Journal of the Helminthological So- 
ciety of Washington, 61: 103-108. 

MULVEY, M. & R. С VRIJENHOEK, 1981, Ge- 
netic variation among laboratory strains of the 
planorbid snail Biomphalaria glabrata. Bio- 
chemical Genetics, 19: 1169-1182. 

NEWTON, W. L., 1955, The establishment of a 
strain oí Australorbis g/abraius which combines 
albinism and high susceptibility to infection with 
Schistosoma mansoni. Journal of Parasitology, 
41: 526-528. 

PARAENSE, W. & L. CORREA, 1963, Variation 
in susceptibility of populations of Australorbis 
glabratus to a strain of Schistosoma mansoni. 
Revista do Instituto de Medicina Tropical de 
Sao Paulo, 5: 15-22. 

RICHARDS, С S., 1970, Genetics of a mollus- 
can vector of schistosomiasis. Nature, 227: 
806-810. 

RICHARDS, С S., 1973, Susceptibility of adult 
Biomphalaha glabrata to Schistosoma mansoni 
infection. American Journal of Tropical Medi- 
cine and Hygiene, 22: 748-756. 

RICHARDS, С S., 1975, Genetic factors in sus- 
ceptibility of Biomphalaha glabrata for differ- 
ent strains of Schistosoma mansoni. Parasi- 
tology, 70: 231-241. 

RICHARDS, С S. & P С. SHADE, 1987, The 
genetic variation of compatibility in Biom- 
phalaria glabrata and Schistosoma mansoni. 
Journal of Parasitology, 73: 1146-1151. 

VIDIGAL, T H. D. A., E. DIAS-NETO, O. D. S. 
CARVALHO&A. J.G.SIMPSON, 1994, в /om- 
phalaria glabrata: Extensive genetic varaiation 
in Brazilian isolates revealed by random am- 
plified polymorphic DNA analysis. Experimen- 
tal Parasitology, 79: 187-194. 

WELSH, J. & M. McClelland, 1990, Fingerprint- 
ing genomes using PCR with arbitrary primers. 
Nucleic Acids Research, 18: 7213-7218. 

WILLIAMS, J. G. K., A. R. KUBELIK, K. J. LIVAK, 
J. A. RAFOLSKI & V. S. TINGEY, 1990, DNA 
polymorphisms amplified by arbitrary primers 
are useful as genetic markers. Nucleic Acids 
Research. 18: 6531 6535. 

Revised ms. accepted 17 September 2002 



MALACOLOGIA, 2003, 45(1): 109-120 

DEPTH EFFECTS ON ZEBRA MUSSEL REPRODUCTION 
Paride Mantecca', Giovanni Vaiiati', Letizia Ganbaldi2& Renato Bacchetta^* 

ABSTRACT 

Male and female Dreissena polymorpha from 2 m depth in Lake Iseo, northern Italy, 
spawned synchronously, and their gametogenic cycle followed the annual pattern previ- 
ously observed in other Italian and European populations. Water temperature of 12°C and 
phytoplankton blooms triggered spawning, and seasonal variation in gametogenesis was 
related to photoperiod. Some mussels at 25 m depth always had active gonads, and re- 
production continued all year, with no seasonal gametogenic phases. Hypolimnetic envi- 
ronmental conditions, such as slight variation in water temperature, darkness and low food 
availability, may cause this reproductive strategy. No evidence of hermaphroditism or modi- 
fied sex ratios were noted at either depth. Gametogenesis and spawning ability of zebra 
mussels in the hypolimnion must be reconsidered. 

Key words; Dreissena polymorpha^ reproduction, depth, gametogenesis, histology. 



INTRODUCTION 

For the last two centuries, the zebra mussel, 
Dreissena polymorpha, has been steadily 
spreading over Europe (Stanczykowska, 
1977). In Italy, D. polymorpha was first de- 
tected at the end of the 1960s in Lake Garda 
(Giusti & Oppi, 1972), and from then on, It 
reached all the great subalpine lakes, the major 
northern rivers, and, recently. Lake Trasimeno 
in central Italy. By the 1980s, it had also in- 
vaded the major river systems and numerous 
inland lakes throughout the northeastern USA 
(Ram&McMahon, 1996). 

Among the factors that favor such a wide 
geographic distribution, high fecundity is one of 
the most important (Sprung, 1989). But the 
mechanisms that regulate zebra mussel re- 
productive behavior are not well understood. 
Many authors have investigated its reproduc- 
tion, both in Europe (Tourari et al., 1988; 
Borcherding, 1991; Neumann et al., 1993; 
Bacchetta et al., 2001) and North America 
(Haag & Garton, 1992; Gist et al., 1997), and all 
have found an annual cycle involving a gamete 
development phase in winter and early spring, 
spawning events in late spring and summer, 
followed by a gonad resting stage. 

Temperature is considered the main environ- 
mental factor that regulates both gametogen- 



esis and the start of spawning in D. poly- 
morpha (Borcherding, 1991; Bacchetta et al., 
2001), whereas such other factors as food 
availability and phytoplankton bloom are in- 
volved in regulating the number of reproductive 
events (Gist et al., 1997) and the onset of 
spawning (Ram & Nichols, 1993). In laboratory 
experiments, the gonadal cycle is not closely 
associated with photoperiod variation (Borcher- 
ding, 1995). 

In lakes, D. polymorpha forms a characteris- 
tic belt around the shores, usually covering the 
littoral and upper sublittoral zones. The area 
occupied by this species varies greatly, de- 
pending on the littoral zone width and slope. In 
shallow lakes, it can occupy both inshore areas 
and mid-lake zones, whereas in deep lakes it 
has been found to 30 m (Lake Geneva) and 
55 m (Lake Constance) (Stanczykowska, 
1977). Although zebra mussels are most com- 
mon between 2 and 8 m, they have been re- 
ported from the wave zone to 1 1 m (Claxton & 
Mackie, 1998). 

In Lake Iseo, also known as Sebino (45°39- 
49'N, 2°21-30'W), D. polymorpha forms dense 
populations along the wave zones and occurs 
to at least 50 m, although density progressively 
decreases from 5 m and is very low at 30-40 
m. Lake Iseo lies in the foothills of the Alps and 
reaches a maximum depth of 251 m. Limno- 



^ipartimento di Biologia, Università degli Studi di Milano, Sezione di Zoología e Citología 26 Via Celoria, 1-20133 

Milan, Italy 

^Dipartimento di Scienze deH'Ambiente e Territorio, Università degli Studi di Milano-Bicocca 15 Via Emanueli, 

1-20126 Milan, Italy ^-_ 

•Corresponding author: renato.bacchetta@unimi.it 



109 



110 



MANTECCAETAL. 



logically, Lake Iseo is classified as warm 
monomictic, and like other deep lakes, it is dis- 
tinctively holo-oligomictic. Because of its geo- 
graphic location in the temperate belt and its 
morphology, complete overturn is uncommon, 
only occurring in particularly cold, windy win- 
ters (Ambrosetti et al., 1992). The lake is strati- 
fied for a long period during summer-autumn 
and is eutrophic (Garibaldi et al., 1997). These 
attributes, and observations that depth may 
control bivalve reproductive cycles (Mackie, 
1984), led us to investigate possible differences 
in reproductive behavior between shallow and 
deep water mussels. To this end, and because 
only one work (Claxton & Mackie, 1998) has 
considered depth variation in gametogenesis 
and spawning, we used qualitative histological 
methods to follow the D. polymorpha repro- 
ductive cycle from two depths and over two 
spawning seasons in a Lake Iseo population. 



The slides were then stained with Mayer's 
Haemalaun (Merck), counterstained with alco- 
holic Eosin (Merck), mounted in Eukitt (Kindler 
GmbH, Freiburg), and observed using a light 
microscope with calibrated eyepiece. A total of 
1 , 1 63 mussels were histologically examined. 

Maturity Index and Sex Ratio 

The stage of gametogenic development for 
both males and females was described using 
a four-step qualitative evaluation, as given by 
Gist et al. (1997): stage = gonad inactive, 
stage 1 = developing, stage 2 = prespawn, 
stage 3 = postspawn. The Maturity Index (Ml) 
was calculated for both sexes as the mean 
gonadal stage for all the specimens examined 
on each sampling occasion. 

Mussels were sexed by microscopic exami- 
nation of the histological slides and sex ratios 
were estimated for all the samples. 



MATERIALSAND METHODS 



Environmental Parameters 



Sampling 

To investigate the timing of gonadal develop- 
ment, 20 samples of mussels were collected 
from a densely settled site in Lake Iseo, near 
the town of Tavernola Bergamasca, from March 
1999 to September 2000. Scuba divers 
brought up rocks covered with D. polymorpha 
from about 2 and 25 m depths, above and 
below the summer thermocline. On each sam- 
pling occasion, about 60 specimens of D. poly- 
morpha > 18 mm in length were detached from 
the rocks and fixed in aqueous Bouin's for his- 
tological analysis. 

Histological Methods 

After nearly one week in Bouin's fluid, about 
30 mussels were randomly selected to deter- 
mine gonadal condition. Specimens were 
washed overnight in running tap water, and 
then their visceral sacs were separated from 
the remaining tissues, dehydrated in an as- 
cending alcohol series, and embedded in Bio- 
Plast tissue embedding medium (melting point 
57°C). Using a rotary microtome, samples 
were cut in 7 pm transverse sections at the 
proximal, central and distal levels of the gonad 
in order to detect any heterogeneous develop- 
ment within the ovaries. About ten serial sec- 
tions from each portion were placed on 
microscope slides and dried overnight at 37°C. 



From February 1999 to September 2000, we 
recorded water temperature, food availability, 
photoperiod, and water transparency. Water 
temperature was measured at 1, 10, 20 and 
30 m. To evaluate food availability, chlorophyll-a 
(Chl-a) concentration was determined in inte- 
grated samples from six depths from to 20 m 
collected in a Van Dorn sampling bottle. After 
collection, the samples were placed in polyeth- 
ylene bottles, put in thermic bags in the dark, 
and transported to the laboratory. Once in the 
laboratory, each sample was filtered through a 
GF/F glass microfibre filter (WHATMAN, pore 
size 0.45 pm) and then stored at -4°C until pro- 
cessing. Chl-a concentrations were measured 
with a standard spectrophotometric method 
(Lorenzen, 1967) after 24 h extraction with 
90% acetone. Daylength on each sampling oc- 
casion was calculated from sunrise and sunset 
times published by the Italian Airforce Weather 
Bureau and reported as light-minutes per day. 
A Secchi disk was used to estimate water 
transparency. The epilimnion of Lake Iseo was 
taken to be the upper 15 m, representing 10% of 
the lake's volume; the hypolimnion was the wa- 
ter mass below 15 m (Garibaldi etal., 1997). 

Statistical Analysis 

Ninety-five percent confidence intervals were 
calculated for the Ml at each date and depth. 
Thus, when the confidence intervals of two Mis 



DEPTH EFFECTS ON ZEBRA MUSSEL REPRODUCTION 



111 



CL 'Л 



■o + 

_ CO 

ro Ф 
E 

о ФЙ 
__ CO V 

^^ Q. 
CNÍ| II 
■Г-' Ф* 

Ф oro 

ro CD.Si 

о 'l^ с 
Ф II о 



œ 



■о (Я in 

(M о ro 
ел о '"^ 

го .E 

Ф Ф (Л 
(Л с ф 

t« фЕ 
s "О 

о^ с 

'rol"' 
■^ > со 

го « ф 
> ф го 

-п "^ Р 

EQ^ 

5фЕ 

ф О) 3 

•У Ф сг 

О) X ф 

о*^ о 
.Í5 ^ ел 

-С^ Ф 
ел СП -^ 

ел ,- *г 

zi . о 

Е— ел 

*- го ел 

±; *- ф 

D Ф с 
-D *-;-0 

го ел о 

О^ О) 

1_ Oes, 

Е- о 
-? >^ ф 



^ о го 

го > 

Ш (л- 

_| 01 го 

ÛÛ СП.9 
< iS • с 
I— "ел о 



T^ÖÖÖCOCDCNiÖÖOCbÖfOCOO'^ 

crirMcocoeMh-CMCMcocoroí^cioocoroo 
SS^SÍo<oinSin-*in'*4-cocoencp 
oooooöooocboöooooo 

осо-ч -cooooooooo-r-oooo 

oocNj'-'iocMeDcoeííinifiOOOcncoco 

о-ч-ем01Псоеососог--^о-^'--г-"«''П 

''''coeoocNOOOO'^ooocneocn'^CN 

^^r-T-CNOr\ieNir)TÍ-OOOOCDCD»-OCM 

O'T-ocOT-incoeouiT-cNOOcoooT- 
ооооооооооооо^ооо 
a)oooo5^i^°r-IÎ^Œicn^CMCsjcoco 

t^CMCNCNT-OOOT-OCO^^IeDCNCNCSJ 

ooooooooooooooooo 
юсоооеошоепсоаэтсо-Ч-е^г; oeooo 



T- t^ rt 
со Ю со 
ö (э со 



о о о 

о о о 

Ц Ш т- 

- ? -^г 

о о о 

т- о ю 

го CD о 

fSJ о го 

о о о 



■t <D СП 



со со со 

о о ■^ '" о 
еЬ CN cnÍ 



CD 



<л со 

CN о 
■^ÖCsiÖÖÖCDCMO 



о Ö о о о о о 

о о о о о о о 

о ^г -^ Î? Í! I-- о 

о ° '^ ^ oi oi <^ 

1Í? т- о о о о о 

о о о о -^ со $ii 

Oí Ю CN CN 



Tf CD 

о Ь 

о о 

о о 

о о 

о о 



со CD 
т со 
Ö о 



о о 

о о 

о о 

т- со 

•ч- m 



1Я ю 



■^ CN т- 



т- m 00 



о см т- т- о о о 

о о о о о о о 

о со ^ О) ^ ^ о 

о CD г- CN ■* *- о 

¡р ю •^ о о со ел 

о о о о о со со 

Ю ТГ СП '— иГ5 00 Г^ 



со m en со (^ ^- 00 

о о о о Ç о g 

œ 00 о5 о о en ез> 

CNJ о CN см т- см ^ 



о о 

о о 

о о 

о о 



о о 

о о 

о о 

о о 

■* о 



CD о о о 



ю г- ■* о 



о о о о о о 

о о о о о о 

о о о f^ см г- 

о о о ■* со CN 

ЭТ Ю Т- Q Q Q 

т- о о о о -^ 

■^ Ifí т- т- о о 



о о о о о о 

о о о о о о 

о о о ? <^ "" 

о о •* о о т- 

J2 J CD »- о о 

о о о о о о 

со 'S" о en ст> см 



о о о 

со ■^ CD 

о о о 

CD см о 

т- т- ГЧ| 



Г^ 00 т- 

CD го со 
о '- о 



о о о 

о о о 

см ■>- о 

CD о о 

о о о 

см ез) ^ 

о о со 



~ ÏJ со 



о о о 
о о о 



^ ез> 



О) Oí 

о5 35 
о о 



г- г\1 со Ю CD г- 

о о о Q о о 

о5 о ÎD г^ s i; 

о CM CM о о о 



en о о 

о ? ÍÍ 

о '- •* 

Tí CD CD 



О) CJ> со 



112 



MANTECCAETAL. 



overlapped, we considered there to be no sig- 
nificant difference between them. The relation- 
ship between the Mis of the two depths was 
tested using Spearman's Rank correlation 
analysis (Snedecor & Cochran, 1980), and a 
palrwise Pearson correlation matrix (Sokal & 
Rohlf, 1 981 ) was used to determine the corre- 
lation between the environmental parameters 
and the gonadal cycle. A Chi square goodness- 
of-fit test (Snedecor & Cochran, 1980) was 
used to test the hypothesis of a 1 ;1 sex ratio 
and to determine the relationships between the 
presence of oocyte degeneration in females 
from the two depths. Differences were consid- 
ered significant at the 5% level (p < 0.05). 



RESULTS 

The number of specimens at each gonadal 
stage and the sex ratio on each sampling occa- 
sion and at each depth are given in Table 1. 
The histological appearance of the ovary and 
testis at different matunty stages is illustrated in 
Figures 1 and 2. 



Reproductive Behavior at 2 m 

The gonadal phases of development, matura- 
tion, spawning, and inactivity were temporally 
well defined (Fig. 3). Spawning events occurred 
in spring/summer starting in May, when the first 
postspawned specimens were seen, and end- 
ing in July (1999) or August (2000). During 
these periods, samples in pre- and post- 
spawned stages were observed and showed a 
continuous process of maturation and gamete 
release. The onset of spawning was always 
preceded by a period with gonads in the devel- 
oping stage, followed by a quick gamete matu- 
ration phase, highly synchronized among 
individuals. At the end of the spawning season, 
testes of all males became inactive until the 
end of September; October signaled the restart 
of gametogenesis (Fig. 3). The resting stage of 
ovaries is shorter than that of testes and in- 
volved only a few mussels. At the time of the 
last spawning, some females were already de- 
veloping gonads, and by late September all 
were (Fig. 3). The Ml trend confirmed these 
observations. During the reproductive season. 




FIG. 1. Histology of the Dreissena polymorpha ovary. A. Developing stage: developing oocytes (^) 
attached to wall of acini; B. Prespawn stage: acini filled with mature oocytes; С Postspawned stage: 
enlarged acini contain only few large oocytes in lumen ( Ч); D. Mixed stage: acini filled with oocytes 
at different maturity levels. 



DEPTH EFFECTS ON ZEBRA MUSSEL REPRODUCTION 



113 




FIG. 2. Histology of the Dreissena polymorphe testis. A. Developing stage: detail of an acinus filled 
with undifferentiated cells, arranged radially; B. Prespawn stage: villi-like processes with spermatozoa 
(*), spermatocytes on periphery (Ч); C. Postspawned stage: villi detached from underlying generative 
layers (Ч), spermatozoa free in lumen (*); D. Mixed stage: detail of an acinus with radially arranged 
cells, together with mature spermatozoa (*). 



both males and females showed values 
around 2 or greater, but in the other months the 
Mis were around 1 , with lower values for males. 
Only just before the spawning period were the 
male and female Mis similar (Fig. 4). The 
Spearman's Rank correlation analysis showed 
highly significant synchrony between the Ml 
trends of the two sexes (r = 0.91 ; p < 0.01 ). 

Reproductive Behavior at 25 m 

Postspawned females were present in all 
samples, and none with inactive ovaries was 
ever observed (Fig. 3). The frequency of the 
postspawn stage was always high, except in 
winter when the developing stage was domi- 
nant. Prespawned ovaries were recorded 
throughout 1999, whereas except for one 
specimen in January they were not observed in 
2000. This indicates that during 1999, female 
mussels had spawned successfully following 
massive oocyte maturation. This did not hap- 



pen in 2000, suggesting a slackening in repro- 
duction. In March 2000, a new gametogenic 
stage was observed in which the ovary condi- 
tion could not be assigned to any of the four 
stages. We call these morphologies "mixed 
stages", because the ovary acini were filled 
with oocytes at different maturity levels. Even 
though no maturity stage predominated, we 
underline the spawning activity Initiated by 12 
mussels, by classifying them as postspawned 
(Fig. 3, Table 1). 

Prespawned, postspawned, and inactive 
male mussels were almost always present. 
Synchrony among individuals was low. All four 
stages of testis maturity occurred contempora- 
neously at seven different times (Fig. 3). Thus, 
we hypothesize a tendency towards continu- 
ous male gamete production and release even 
if, contrary to the females, individual mussels 
often underwent a brief inactive period. The fre- 
quency of inactive males increased in the fall 
and was maximal in November 1999. By winter 



114 



MANTECCAETAL 



and until March, reproductive activity was re- 
duced, with most males in an inactive or devel- 
oping stage. 

The tendency towards continuous reproduc- 
tion was confirmed by the presence of "mixed 
stages" in males in May and June 1999, and in 
February 2000. Their testes had acini with radi- 
ally arranged cells, typical of the developing 
stage, together with mature sperm, typical of 
the postspawned stage, but without the usual 
detachment between generative layers (Fig. 2). 
These, too, were classified as postspawned. 

In both sexes. Ml values were almost always 
high, particularly in females, for which they ex- 
ceeded 2 except in January and February 2000 
(Fig. 4). The Ml trends of the two sexes were 
synchronous (Spearman r = 0.62; p < 0.01 ). 



Significantly, more mussels from 25 m depth 
showed oocyte degeneration than those from 2 
m (x^ = 25.73, p < 0.01). Specimens with this 
histopathological condition were frequently ob- 
served in the 25 m mussels, while it was de- 
tected only in May and June 1999 in the 2 m 
mussels (Table 1 ). Degenerating oocytes pre- 
sented a vacuolated apical portion that de- 
tached from the lower cytoplasm and 
accumulated in the lumen of the acini. At times, 
the oocytes were completely disgregated. 

Sex Ratio 

Of the 562 mussels from the 2 m depth, 294 
were females and 268 males, whereas of 601 
mussels from 25 m, 322 were females and 



-2m females 



-2m males 





ÍÍ 



Ш О О 



< со со ^-^ Z -5 li. 






-25m females 



-25m males 





г Stage 



В Stage 1 



Stage 2 



Stage 3 



FIG. 3. Gametogenic cycles of adult mussels from 2 (upper panels) and 25 m in depth (lower panels). 
Histograms show relative frequency of the four gonadal stages for each sampling. Stage = gonad 
inactive; stage 1 = developing; stage 2 = prespawn; stage 3 = postspawn. 



DEPTH EFFECTS ON ZEBRA MUSSEL REPRODUCTION 



115 



279 males (Table 1 ). At both depths, there was 
no significant difference in the total number of 
males and females (x^ = 1-20, p > 0.05 for 
mussels from 2 m; x^ = 3.07, p > 0.05 for 
mussels from 25 m). The monthly compari- 
sons showed no statistical difference in male 
and female numbers, except in March 2000 for 
the 25 m deep mussels (x^ = 3.90, p < 0.05). 
No evidence of hermaphroditism was found. 



Environmental Parameters 

At 2 m, water temperature showed the same 
trend in both years, with a rapid increase in 
spring-summer, reaching the highest values in 
August 1999 (22.6°C) and July 2000 (23. OX), 
with a clear decrease in autumn to a minimum 
of 6.3°C in winter (Fig. 5). At the beginning of 
May in both years, temperature rose above 



Females 



|2 



(D 

■o 

(0 



О 



Ш 



I 



^ Ï 



1 



i 



ü 



л л í 



¡ 



oooooïoomoîcDiocû 

(NOOJCnJt-CsI-^OCMt- 

m й^2^^зз 0)0.0. 



o 

o 



> 

o 



CD 

o 

с 
со 



о 
.о 

(D 

u. 



Ю 
CM 



h- 
о 
>. 

CD 



о 



о CVJ 



O) со 

T- {>4 

a> o. 

=3 0) 

< w 



Maies 



|2 

(0 



л 

T3 
CD 

с 
о 

о 





! ¡ 




f , -- É 


A T \ 


~^ 






L -T 




Q 


— 


; ^ í¡ 


■" 


1- rfi 


-^ 




j 1 


^ 


-. 




. 


. 


TI ^ 


-^ 


! 
i 




1 L 








Г 


T 




(-.. 










À 


i 


W\ 


1 


■^ 



1 --Ж— - - к L 



00 


CO 


<л 


о 


о 


ю 


О) 


CD 


LO 


CÛ 


'^Г 


О) 


о 


ю 


г^ 


TÍ- 


,,— 


О) 


C7Î 


го 


(N 


о 


04 


Сч| 


■1Г- 


см 


т— 


О 


см 


т— 


т— 


о 


см 


см 


о 


о 


о 


CN 




см 


to 


03 

2 


>. 

ГО 


С 

— э 


3 
— э 


3 
— э 


СЗ) 

< 


О 
Ш 


о 
ш 


о 

о 


> 
о 

Z 


с 
го 

-5 


£1 


го 


>ч 

го 


с 


3 
— J 


3 

—5 


О) 

< 


о. 
со 



FIG. 4. Maturity Index values from the two depths. Data are presented as the mean gonadal stage 
± 95% ci. Black bars = mussels from 2 m depth. Shaded bars = mussels from 25 m depth. 



116 



MANTECCAETAL. 



^-Surface -^-20m -^-30m 





.^ 4 

E 
■£ 6 

Q. 
Ф 

Û 8 



10 



12 - 



! 






1 1 Г 


j 






1 










1 




■ 


! 











FIG. 5. Environmental parameters. Water temperature (upper panel), chlorophyll-a 
concentration (mid panel), transparency (lower panel). 



DEPTH EFFECTS ON ZEBRA MUSSEL REPRODUCTION 



117 



12.0°C, which has been considered the tem- 
perature that triggers spawning (Borcherding, 
1 991 ). At 20 m, the temperature stayed below 
10.0°C for most of the year and varied mini- 
mally, reaching 12.0°C only in November 1999 
and September 2000. At 30 m, the temperature 
curve flattened even more and ranged only be- 
tween 6.4°C and 8.4°C. 

Chl-a concentrations showed two peaks per 
year, one in April before the onset of spawning 
(especially high in 2000), and one in summer. 
During the 2000 spring bloom, the highest Chl- 
a concentration value recorded was 32 pg/L. 
Minimum values occurred in winter, except for 
the June 2000 sample, when the Chl-a was 2 
pg/L (Fig. 5). 

Transparency showed an opposite trend 
from Chl-a, indicating that algae were the main 
component of suspended matter. Minimum val- 
ues were observed in August, concurrent with 
the summer algal bloom, whereas the highest 
values were in February. However, transpar- 
ency never exceeded 11.2 m, indicating that 
25 m mussels were always in the dark. 



DISCUSSION 

The reproductive cycle of zebra mussels in 
northern Italian waters is annual, as in the rest 
of Europe (Bacchetta et al., 2001). This was 
confirmed for the 2 m mussels from Lake Iseo, 
where the spawning period started in May and 
ended in July, in both 1999 and 2000. This pe- 
riod followed well-synchronized phases of ga- 
mete development and maturation. Oogenesis 
restarted soon after the end of the last spawn- 
ing, while spermatogenesis began later. In gen- 
eral, males and females showed similar 
reproductive patterns, culminating in synchro- 
nous spawning, except for the longer resting 
gonad period in males than in females. In fact, 
females had empty gonads only in a few 
cases, indicating that they began gamete pro- 
duction for the next season just before the end 
of the late spawning events. 

These results corroborate those from other 
Italian water bodies (Bacchetta et al., 2001), 
suggesting that in shallow waters a similar 
course of reproductive events may be general- 
ized for all subalpine populations of D. poly- 
morpha. 

Reproductive behavior at 25 m differed 
greatly from that at 2 m. Intense spawning ac- 
tivity occurred throughout the study period, ex- 
cept during winter months, when reproduction 



slackened. The constant presence of spawning 
mussels indicates a much reduced annual re- 
productive pattern for D. polymorpha at this 
depth. The female Ml trend confirmed this (Fig. 
4), and Ml values always exceeded 2, except in 
January and February 2000. In these two 
months, the Ml was still over 1, which agreed 
with the reduction in spawning activity, in con- 
trast to clear reproductive inactivity. 

The lack of prespawn females at 25 m in 
2000 may indicate different reproductive be- 
havior in the two years. By March 2000 females 
may be unable to mature large numbers of oo- 
cytes simultaneously, modifying the reproduc- 
tive event from an "explosive" phenomenon to a 
slow and continuous release of gametes. But 
why such behavior? At 25 m, environmental 
conditions may prevent a regular annual 
course of gamete maturation and spawning. 
Thus, reproductive events may only happen 
once in two or more years. The high frequency 
of mussels with developing ovaries in January 
and February 2000, not followed by prespawn 
specimens, support this assertion. Moreover, 
the "mixed stages" observed in females after 
these months strengthen this hypothesis. 

Regarding males, their reproductive pattern 
was similar in the two years and, as in the fe- 
males, differed from that of those living near the 
surface (Fig. 3). The presence of all four stages 
of testis maturity in many samples indicated a 
very low level of synchronization, but suggests 
a tendency towards continuous reproduction. 
Nevertheless, the course of the male gonadal 
cycle at 25 m also differed from that of the fe- 
males, mainly in the percentage of inactive go- 
nads observed in males all year round. The 
difference between sexes may be a result of the 
major energy demand to mature oocytes, 
which at 25 m, could be a limiting factor. 

The loss of seasonality in deep water may 
result from the environmental conditions in the 
hypolimnion, including small variation in water 
temperature, darkness, and low food availabil- 
ity (perhaps because of the stable deep water 
environment, contrasting with the shallow wa- 
ter wave movement). In the epilimnion, many 
environmental factors contribute to regulate 
gametogenesis and spawning in bivalves. The 
most important are usually considered to be 
water temperature, food availability, photope- 
riod, and depth (Giese & Pearse, 1979; Mackie, 
1984). It is commonly held that for D. poly- 
morpha water temperature is the main factor 
involved in triggering spawning, whereas food 
availability plays a role in determining the num- 



118 



MANTECCAETAL. 



ber and intensity of reproductive events 
(Borcherding, 1991; Ram et a!., 1996). Al- 
though photoperiod does not affect gametoge- 
nesis in laboratory experiments (Borcherding, 
1995), it has well-recognized regulatory prop- 
erties in many other invertebrate species 
(Bohlken & Joosse, 1982; Olive & Pillai, 1983; 
Foster & Hodgson, 1995), including bivalves 
(Giese, 1959). With regard to depth, the tem- 
poral aspects of breeding strategy vary with 
depth, although it is often difficult to separate 
the effect of temperature and depth (Mackie, 
1984; Claxton & Mackie, 1998). 

In many European, Russian, and American 
populations, breeding starts when water tem- 
perature exceeds 12°C, even if other environ- 
mental conditions differ markedly according to 
the populations examined. Stanczykowska 
(1977) indicated 15°C as the temperature 
when spawning starts, whereas Sprung 
(1987) stated that a range of 12-14°C is suit- 
able for spawning, with an optimum around 
18°C. Tourari et al. (1988) observed that ga- 
mete spawning occurs when temperature 
reaches 16-1 7°C, whereas Borcherding 
(1991) and Neumann et al. (1993) reported 
the onset when water temperature exceeds 
12°C. In North America, Haag & Carton (1992) 
found that spawning started between 22°C 
and 23°C, even if in the same waterbody, 
Lake Erie, disjunct populations start spawning 
at different temperatures (Nichols, 1996). 
McMahon (1996) indicated that spawning can 
begin at 12°C, but is maximized around 17- 
18°C, whereas Gist et al. (1997) reported the 
onset of the breeding season when water tem- 
perature is above 20°C. 

Our results indicate that 2 m deep mussels 
started spawning in May when water tempera- 
ture reached 13.2°C (1999) and 12. ГС 
(2000), thus triggering the event, confirming 
the observations of Borcherding (1991) and 
Neumann et al. (1993) in central Europe, and 
of Bacchetta et al. (2001 ) in other north Italian 
water bodies. 

The lack of data about the relationship be- 
tween photoperiod and the D. polymorpha re- 
productive cycle does not permit speculation 
about the role of this factor on the onset of 
gamete deposition. However, previous data by 
Bacchetta et al. (2001) show delayed 
spawnings in a river population compared to a 
lacustrine population, despite the same light 
conditions. In fact, while in Lake Como ga- 
mete release started at the beginning of May, 
when water temperature reached 13°C, in the 



Adda River this threshold was reached only 
two weeks later. 

Photoperiod played a major role in regulating 
gametogenic phases, because in 2 m deep 
mussels, this factor was correlated with Mis 
trend (r = 0.75; p < 0.001 for females, r = 0.69; 
p < 0.01 for males). 

Even if Chl-a concentration was not signifi- 
cantly related to the reproductive cycle, we 
suggest that the two Chl-a peaks preceding 
the spawning season may be involved in 
spawning induction by signaling the trophically 
advantageous conditions for success of the 
subsequent larval developmental period. In D. 
polymorpha, phytoplankton blooms, with their 
associated chemicals, may be the first in- 
ducer of gamete release, followed by further 
chemical stimulus associated with gametes 
that induces spawning in the opposite sex 
(Ram & Nichols, 1993). In conclusion, the D. 
polymorpha gametogenic events strictly fol- 
lowed the seasonal variations of photoperiod, 
while spawning events were mainly regulated 
by food availability and water temperature. 

At 25 m depth, below the thermocline, this 
reproductive pattern vanished. Water tem- 
perature never exceeded the threshold of 12- 
1 3°C for the onset of spawning, but stayed for 
most of the year below 10°C, the value that 
has been considered the minimum spawning 
and fertilization temperature for D. poly- 
morpha (Sprung, 1987). We can say nothing 
about fertilization and larval developmental 
success at this depth, but both males and fe- 
males matured and released their gametes, 
as evidenced by the presence of spawning 
specimens, even when temperature was 6- 
7°C. Dreissena polymorpha also reproduces 
at low temperatures in other regions: in Lake 
Constance, at4.5-5.5°C, and in Lake Grosser 
Plöner at 2.5X (Walz, 1978). Nichols (1996) 
reported that zebra mussel larvae were col- 
lected at temperatures below 5°C, and that D. 
polymorpha is theoretically able to produce 
larvae at temperatures below 1 0°C. 

Another dreissenid, the quagga mussel, 
Dreissena bugensis, has been reported to 
spawn at low temperatures in deep waters 
(Roe & Maclsaac, 1997). These authors ob- 
served gonadal development and spawning at 
4.8°C in Lake Erie, and Claxton & Mackie 
(1998) found that D. bugensis and D. 
bugensis "profunda" spawned in the same 
lake at 9-1 0°C. 

While it has now been shown that D. 
bugensis spawns in the hypolimnion at tem- 



DEPTH EFFECTS ON ZEBRA MUSSEL REPRODUCTION 



119 



peratures below the minimum dreissenid 
spawning and fertilization temperature 
(Claxton & Mackie, 1998), our findings suggest 
that this minimum must also be reconsidered 
for D. polymorpha, and that the zebra mussel 
is able to reproduce in a hypolimnion environ- 
ment. This contrasts with the findings of 
Claxton & Mackie (1 998), who found no game- 
togenic development or spawning in hypo- 
limnetic Lake Erie zebra mussels. 

In our study, significantly more females with 
degenerating oocytes were observed at 25 m 
than at 2 m (x^ = 25.73, p < 0.01 ). Oocyte de- 
generation in D. polymorpha is triggered by 
several cues, among them, low temperature 
and low food availability (Borcherding, 1995). 
The presence of degenerating oocytes in the 
ovaries, together with detritus clearly visible in 
the lumen of the acini, indicates intense recy- 
cling activity by the gonad in disadvantageous 
environmental conditions. This has been previ- 
ously observed in D. polymorpha (Bielefeld, 
1991), as well as in other mollusks, for ex- 
ample, Mytilus edulis (Pipe, 1987) and 
Mactra veneriformis (Chung & Ryou, 2000). 
The hermaphroditic state in gonochoristic 
bivalves is also determined by environmental 
factors (Mackie, 1984), but even if the particu- 
lar hypolimnetic conditions in Lake Iseo 
caused oocyte degeneration and altered 
spawning activity, they did not seem to influ- 
ence sex determination. In fact, the sex ratio, 
even in deep waters, was not significantly dif- 
ferent from 1:1, and no hermaphrodites were 
seen, contrary to Antheunisse (1963), who 
found 4% hermaphroditic mussels in the 
Amstel River. 

In conclusion, the reproductive behavior of 
25 m deep mussels differed significantly from 
that of those in shallow water, where an annual 
pattern was confirmed. In deep water, at the 
low limit of the thermal discontinuity, reproduc- 
tion continued all year, without seasonal 
changes of gametogenic phases. Elsewhere, 
reproduction can continue throughout the year, 
depending mainly on the geographic locality of 
a given water body and its thermal condition, 
as in warmer reservoirs, where the reproduc- 
tive period is longer (Stanczykowska, 1977). 
Even in the hypolimnetic waters of Lake Iseo, 
where temperatures were always low, zebra 
mussels were observed to spawn continu- 
ously, suggesting that variations in water tem- 
perature are more important in regulating the 
timing of reproduction than absolute tempera- 
ture. 



ACKNOWLEDGEMENTS 

Our field samplings were assisted by Scuba 
divers of the Federazione Italiana Attività 
Subacquee. We thank Drs. Lorenzo Colombi 
and Maddalena Pesenti for their help. We are 
grateful to the reviewers who improved the 
clarity of the manuscript. 



LITERATURE CITED 

AMBROSETTI, W., L. BARBANTI, R. MOSELLO & 
A. PUGNETTI, 1992, Limnological studies on 
the deep southern Alpine lakes Maggiore, 
Lugano, Como, Iseo and Garda. Memorie 
deiristituto Italiano dildrobiologia, 50: 117-146. 

ANTHEUNISSE, L. J., 1963, Neurosecretory phe- 
nomena in the zebra mussel Dreissena 
polymorpha Pallas. Archives Néerlandaises de 
Zoologie, 15: 237-314. 

BACCHETTA, R., P MANTECCA & G. VAILATI, 
2001 , Reproductive behavior of the freshwater 
mussel Dreissena polymorpha in Italy: a com- 
parison between two populations. Archiv für 
Hydrobiologie, 151: 247-262. 

BIELEFELD, U., 1991, Histological observation 
of gonads and digestive gland in starving 
Dreissena polymorpha (Blvalvia). Malacologia, 
33: 31-42. 

BOHLKEN, S. & J. JOOSSE, 1982, The effect of 
photoperiod on female reproductive activity 
and growth of the freshwater pulmonate snail 
Lymnaea stagnalis kept under laboratory 
breeding conditions. International Journal of 
Invertebrate Reproduction, 4: 213-222. 

BORCHERDING, J., 1991 , The annual reproduc- 
tive cycle of the freshwater mussel Dreissena 
polymorpha Pallas in lakes. Oecologia, 87: 
208-218. 

BORCHERDING, J., 1995, Laboratory experi- 
ments on the influence of food availability, 
temperature and photoperiod on gonad de- 
velopment in the freshwater mussel Dreissena 
polymorpha. Malacologia, 36: 15-27. 

CHUNG E. Y. & D. K. RYOU, 2000, Gametogen- 
esis and sexual maturation of the surf clam 
Mactra veneriformis on the west coast of Ko- 
rea. Malacologia, 42: 149-163. 

CLAXTON, W. T & G. L. MACKIE, 1998, Sea- 
sonal and depth variations in gametogenesis 
and spawning of Dreissena polymorpha and 
Dreissena bugensis in eastern Lake Erie. Ca- 
nadian Journal of Zoology, 76: 2010-2019. 

FOSTER, G G & A. N. HODGSON, 1995, An- 
nual reproductive cycle of three sympatric 
species of intertidal holothurians (Echinoder- 
mata) from the coast of the Eastern Cape 
Province of South Africa. Invertebrate Repro- 
duction and Development, 27: 49-59. 

GARIBALDI, L., M. С BRIZZIO, V. MEZZA- 
NOTTE, A. VARALLO & R. MOSELLO, 1997, 
Evoluzione idrochimica e trófica del Lago 



120 



MANTECCAETAL. 



d'Iseo. Documenta dell'lstituto Italiano di 
Idrobiologia, 61: 135-151. 

GIESE, A. C, 1959, Comparative physiology: 
annual reproductive cycle of marine inverte- 
brates. Annual Review of Physiology, 21 : 547- 
576. 

GIESE, A. С & J. S. PEARSE, 1979, Introduc- 
tion: general principles. Pp. 1-49, in: A. С 
GIESE & J. S. PEARSE, eds., Reproduction of 
Marine Invertebrates. Academic Press, New 
York, San Francisco, London. 

GIST, D. H., M. С MILLER & W. A. BRENCE, 
1997, Annual reproductive cycle of the zebra 
mussel in the Ohio River: a comparison with 
Lake Erie. Archiv für Hydrobiologie, 138: 365- 
379. 

GIUSTI, F. & E. OPPI, 1972, Dreissena 
polymorphe (Pallas) nuevamente in Italia 
(Bivalvia, Dreissenidae). Memorie del Museo 
Cívico di Storia Naturale di Verona, 20: 45-49. 

HAAG, W. R. & D. W. GARTON, 1992, Synchro- 
nous spawning in a recently established popu- 
lation of mussel, Dreissena polymorpha, in 
western Lake Erie, USA. Hydrobiologia, 234: 
103-110. 

LORENZEN, С J., 1967, Determination of chlo- 
rophyll phaeopigments: spectrophotometric 
equations. Limnology and Oceanography, 12: 
343-346. 

MACKIE, G. L., 1984, Bivalves. Pp. 351-418, in: 
E. R TRUEMAN &. M. R. CLARKE, eds.. The Mol- 
lusca. Academic Press, San Diego, California. 

McMAHON, R. F., 1996, The physiological ecol- 
ogy of the zebra mussel, Dreissena poly- 
morpha, in North America and Europe. 
American Zoologist, 36: 339-363. 

NEUMANN, D., J. BORCHERDING & B. JANTZ, 
1993, Growth and seasonal reproduction of 
Dreissena polymorpha in the Rhine River and 
adjacent waters. Pp. 95-109, in: т f. nalepa& 
D w. SCHLOESSER, eds,, Zebra mussels: biol- 
ogy, impacts, and control. Lewis Publishers, 
Boca Raton, Florida. 

NICHOLS, S. J., 1996, Variations in the repro- 
ductive cycle of Dreissena polymorpha in Eu- 
rope, Russia, and North America. American 
Zoologist, 36: 311-325. 

OLIVE, P. J. W. & G. PILLAI, 1983, Reproductive 
biology of the polychaete Kefersteinia cirrata 
Keferstein (Hesionidae). II. The gametogenic 
cycle and evidence for photoperiodic control 



of oogenesis. International Journal of Inverte- 
brate Reproduction, 6: 307-315. 

PIPE, R. K., 1987, Oogenesis in the marine mus- 
sel Mytilus edulis: an ultrastructural study. 
Marine Biology, 95: 405-414. 

RAM, J. L., R P FONG & D. W. GARTON, 1996, 
Physiological aspects of zebra mussel repro- 
duction: maturation, spawning, and fertilization. 
American Zoologist, 36: 326-338. 

RAM, J. L. & R. L. MCMAHON, 1996, Introduc- 
tion: the biology, ecology and physiology of ze- 
bra mussels. American Zoologist, 36: 239-243. 

RAM, J. L. & S. J. NICHOLS, 1993, Chemical 
regulation of spawning in the zebra mussel 
{Dreissena polymorpha). Pp. 307-314, in: T. F. 
NALEPA& D. w SCHLOESSER, eds., Zebra mus- 
sels: biology impacts, and control. Lewis Pub- 
lishers, Boca Raton, Florida. 

ROE, S. L. & H. J. MACISAAC, 1997, Deepwater 
population structure and reproductive state of 
quagga mussels {Dreissena bugensis) in Lake 
Erie. Canadian Journal of Fisheries and 
Aquatic Sciences, 54: 2428-2433. 

SNEDECOR, G. W. & W. G. COCHRAN, 1980, 
Statistical methods. Iowa State University 
Press, Ames, Iowa. 

SOKAL, R. R. & F. J. ROHLF, 1981, Biometry. 
W. A. Freeman, San Francisco, California. 

SPRUNG, M., 1987, Ecological requirements of 
developing Dreissena polymorpha eggs. Archiv 
für Hydrobiologie/Supplement, 79: 69-86. 

SPRUNG, M., 1989, Field and laboratory obser- 
vations of Dreissena polymorpha larvae: abun- 
dance, growth, mortality and food demands. 
Archiv für Hydrobiologie, 115: 537-561 . 

STANCZYKOWSKA, A., 1977, Ecology of 
Dreissena polymorpha (Pall.) (Bivalvia) in 
lakes. Polskie Archiwum Hydrobiologii, 24: 
461 530. 

TOURARI, A. L., С CROCHARD & J. С PIHAN, 
1988, Action de la temperature sur le cycle de 
reproduction de Dreissena polymorpha 
(Pallas) étudié "in situ" et au laboratoire. 
Haliotis, 18: 85-98. 

WALZ, N., 1978, The energy balance of the 
freshwater mussel Dreissena polymorpha 
(Pallas) in laboratory experiments and in Lake 
Constance. II. Reproduction. Archiv für 
Hydrobiologie/Supplement, 55: 106-119. 

Revised ms. accepted 6 February 2003 



MALACOLOGIA, 2003, 45(1): 121 124 

THE EGG OF OXYCHILUS (DROUETIA) ATLANTICUS 

(PULMONATA: ZONITIDAE): 

SURFACE STRUCTURE AND CARBOHYDRATE COMPOSITION 

Armindo S. Rodrigues^*, Regina T. Cunha^ & Benjamin J. Gómez^ 

ABSTRACT 

Oxychilus atlanticus is an oviparous species with eggs of the heavily calcified type. The 
eggshell is formed of calcite crystals and is endowed with large amounts of neutral 
polysaccharides, galactogen and glycogen, providing nutritive reserves for embryo 
development. The egg is surrounded by mucopolysaccharides as it passes along the 
spermoviduct. This component probably acts as a mechanical support element, as well as 
a chelation promoter of calcium ions during eggshell construction. 

Key words: oviparous snail; calcite crystals; galactogen; glycogen; mucopolysaccharides. 



INTRODUCTION 

Apart from the works of Bayne ( 1 966, 1 968), 
Tompa (1974, 1976, 1979), Baur (1994), Baur 
& Baur (1998), and Heller (2001 ), little is known 
about the structure and composition of pulmo- 
nate eggs, and no information exists about egg 
formation inside the spermoviduct of oviparous 
species. This could be due to the fact that, in 
oviparous species, such as the stylom- 
matophoran land snails and slugs, the eggs are 
laid as they are made inside the spermoviduct 
and distal female genital ducts (Tompa, 1 979). 

The surface structure, composition and func- 
tion of molluscan eggs have received little atten- 
tion. In general, the egg is known to protect the 
embryo against adverse environmental effects, 
but it is also considered to act as a calcium re- 
serve for itself and the newly hatched juvenile 
(Fournie &Chétail, 1982a). Baur & Baur (1998) 
consider that eggs are decisive for the survival 
of the offspring in invertebrates, especially when 
the species do not have post-laying egg care. 

After studying a great number of eggs from 
different gastropods, Hall & Taylor (1971) con- 
cluded that the eggshell is generally made by 
calcite or aragonite crystals, although they re- 
fer to a new form of calcium carbonate crys- 
tals, vaterite, in the eggshell of four species of 
Ampullaha Lamarck, 1 799, for the first time. Ac- 
cording to Tompa (1976), 36 of 65 stylom- 



matophoran families have eggshells made of 
calcium carbonate, that is, in calcareous eggs, 
commonly in the form of calcite. Tompa (1974) 
suggests that the reason for the common pres- 
ence of aragonite in the body shell is due to its 
higher resistance to the abrasion by soil particles, 
whereas calcite, frequently found in the eggshell, 
involves less investment because it occupies 
more space per mole of CaCOj secreted. 

Tompa (1976) classified the eggs of the 
Stylommatophora into three types - heavily cal- 
cified {Cepaea nemoralis Linnaeus 1758), partly 
calcified, and uncalcified (Limacidae), accord- 
ing to the degree of calcification. In the same 
work, the size of the egg and its surface ultra- 
structure were considered to be of taxonomic 
value, even between closely related species. 

Concerning the resources of the eggs. Heller 
(2001) considers that they are rich in energy 
and nutrients, including proteins, mucopolysac- 
charides and calcium. 

This study describes the carbohydrate com- 
position of the egg of Oxychilus (Drouetia) 
atlanticus (Morelet & Drouët 1857) (Pulmonata 
Zonitidae) during its formation inside the 
spermoviduct, as well as the structure and com- 
position of its surface after being laid. 

The aim of this work is to contribute to the 
knowledge of the reproductive biology of an 
endemic species from Sao Miguel Island, 
Acores. 



departamento de Biología, Uníversidade dos Acores, 9500 Ponta Delgada, Portugal 

^Departamento de Zoología y Dinámica Celular Animal, Facultad de Ciencias, Universidad del Pais Vasco, Apdo 

644, 48080 Bilbao, Spain 

'Corresponding author: rodrigues@notes.uac.pt 



121 



122 



RODRIGUES ETAL. 



MATERIALSAND METHODS 

Specimens of О. atlanticus were collected at 
Abelheira, 3 km north of Ponta Delgada, be- 
tween June and September. The species 
reaches maturity between June and November, 
with a shell diameter of 7 mm (Rodrigues et 
al., 1998). From over 200 specimens analysed, 
only two adults had eggs inside the sperm- 
oviduct, observable through the translucent 
shell. Therefore, only these two specimens 
were used for histochemical tests. 

Genitalia with eggs were dissected and fixed 
in Baker's formol (Culling, 1 974), embedded in 
paraffin, and sectioned at 7 цт thickness. Sec- 
tions were routinely processed for light micros- 
copy and stained using various histological and 
histochemical methods. 

The following histochemical methods were 
carried out: The Periodic acid-Schiff (P.A.S.) 
technique was used as a general method for 
identifying neutral carbohydrates (Culling, 1974). 
Acetylation, followed by saponification and dia- 




FIG. 1. A. Cross section of a fractured egg of 
Oxychilus (Drouetia) atlanticus. Arrowheads 
indicate the outer surface; arrows show the inner 
border (scale bar = 10 \^vг\). B. Surface view of 
the egg showing the large calcite crystals (scale 
bar= 10 |jm). С Surface view of the egg showing 
individual calcite crystals (scale bar = 1 |jm). 



stase treatment, were used as controls (Martoja 
& Martoja-Pierson, 1970). Alcian blue staining 
was used at pH = 0.5 to stain strongly sulphated 
mucosubstances and at pH = 2.5 for carboxy- 
lated and weakly sulphated mucosubstances 
(Martoja & Martoja-Pierson, 1 970). Best's car- 
mine was used to identify glycogen deposits, 
with previous digestion with diastase as a con- 
trol. Best's carmine was also used to detect 
the presence of galactogen, according to 
Grainger &Shillitoe (1952). 

In order to study the eggshell structure, indi- 
viduals of O. atlanticus were collected from the 
field and laid eggs under laboratory conditions 
from November 1 997 to January 1 998. The di- 
ameter of 40 eggs was measured under a ste- 
reomicroscope with the aid of a camera lucida. 
To perform scanning electron microscope 
(SEM) observations, the shells of ten eggs were 
broken and their fragments placed in a cham- 
ber with silica gel for two days of dehydration. 
The material was then mounted on specimen- 
stubs, coated with carbon and gold-palladium 
(60-40%) in a vacuum evaporator (JEE 400) 
for observation with a JEOL SEM (JSM 5410) 
at15kVor25kV. 



RESULTS 

The eggs of O. atlanticus are 1 .5 ± 0.05 mm 
in diameter, with a hard and brittle surface, and 
a thickness of 34.1 + 1.9 pm (Fig. 1 A). The egg 
surface consists of a continuous layer of cal- 
cium carbonate, which reacts with hydrochlo- 
ric acid. The calcium carbonate develops as 
geometric forms (Fig. 1 B, C), with a symmetry 
that fits into a hexagonal system, typical of cal- 
cite (Almeida, personal communication). Sol- 
ids of calcite show a perfect cleavage in three 
directions that may originate rhombohedral hab- 
its (Dana, 1 969), as shown in Figure 1 В and С 

The histochemical tests reveal the presence 
of an organic layer, 5 |.im in thickness, over the 
calcified shell, mainly composed of acid muco- 
polysaccharides and some neutral polysaccha- 
rides, which react strongly with alcian blue 
solution (pH 2.5) and Best's carmine, respec- 
tively. The inner shell membranes between the 
calcified shell and the perivitelline fluid show a 
high positivity for P.A.S. and a moderate posi- 
tivity for Best's carmine, revealing the presence 
of neutral carbohydrates. The histochemical 
composition of this layer is very similar to that 
of the perivitelline fluid, the most important fea- 
ture of which is a complete maintenance of the 



THE EGG OF OXYCHILUS ATLANTICUS 



123 



TABLE 1. Staining reactions of O. atlanticus eggs pulled from the spermoviduct. P.A.S. = Periodic 
acid-Schiff; Acetyl. /P.A.S. = control Acetylation/P.A.S.; Acetyl. /S/P.A.S. = control Acetylation/saponifi- 
cation/P.A.S.; gr. = granules; - = no reaction; ± = weak positivity; + = moderate positivity; ++ = high 
positivity ; +++ - very intense positivity. 



Carbohydrates Outer Calcified Inner shell Penvitelline 

Stain detected shell layer shell membranes fluid Vitellus 



Alcian blue pH 0.5 
Alcian blue pH 2.5 

Best's carmine 

Control 

PAS. 

Acetyl./P AS. 

Acetyl./S/P.A.S 

PAS. -without 
oxidation 



Strongly sulphated 
mucosubstances 
Carboxylated and 
weakly sulphated 
mucosubstances 
Glycogen and 
galactogen 



Neutral 
carbohydrates 



gr. ± 



gr. ++ gr. ++ 



gr. ++ gr ++ 



reaction intensity with Best's carmine test and 
control, indicating the presence of galactogen. 
In the vitellus, the observed polysaccharide is 
glycogen because it shows a high positivity for 
Schlff's reagent and Best's carmine, but it is 
digested by diastase (Table 1 ). 



DISCUSSION 

Oxychilus atlanticus is an oviparous species 
in which a sequential synthesis and release of 
each egg occurs, with a clutch consisting of 5- 
6 eggs (Rodrigues & Cunha, unpubl. data). The 
difficulty in finding gravid individuals in O. 
atlanticus may be related to its oviparity, as 
stated by Tompa (1979) for other oviparous 
species. He reports that, in thousands of speci- 
mens analysed, not a single individual from the 
oviparous species was found to be gravid, in 
contrast with the ovoviviparous and viviparous 
species. 

The eggshells of O. atlanticus bear a com- 
pact and brittle construction of calcite crystals, 
which we classify as of the heavily calcified type 
(Tompa, 1976; 1984). This strong structure may 
function as a protection against predators and 
desiccation, in addition to its role in the support 
of the internal components (Bayne, 1966). Fur- 



thermore, the eggshell may also function as a 
calcium reserve to supply the developing em- 
bryo with enough calcium to form its embry- 
onic shell (Heller, 2001 ). 

In the egg of O. atlanticus, mucopolysaccha- 
rides prevail in the vicinity of the shell, whereas 
neutral polysaccharides are the main elements 
internally. 

According to Grainger & Shillitoe (1 952), dia- 
stase digests the polysaccharide glycogen, but 
it Is unable to digest galactogen. Thus, this 
methodology is suitable for detecting the pres- 
ence of galactogen, indicating that the perivi- 
telline fluid and vitellus mainly contain 
galactogen and glycogen, respectively. Wijsman 
& Wijck-Batenburg (1987) mentioned that 
galactogen and proteins are the major compo- 
nents of the egg of Lymnaea stagnalis 
Linnaeus, 1758. According to Bayne (1968), 
neutral polysaccharides, as well as proteins, 
are abundant in the perivitelline fluid, whereas 
mucopolysaccharides occur in the external lay- 
ers of the egg; the neutral polysaccharides and 
proteins are mainly involved with the nutrition 
of the embryo, and the mucopolysaccharides 
are more involved in mechanical support. We 
suggest that the mucopolysaccharides found 
between the eggshell and the spermoviduct 
epithelium may also act in the chelation of the 



124 



RODRIGUES ETAL. 



calcium ions (Chétail et al., 1982; Fournie & 
Chétail, 1982b), promoting eggshell mineraliza- 
tion. 



ACKOWLEDGEMENTS 

This work was supported by the project 
Praxis/2/2. 1/BI A/1 69/94-Biodiversidade, and 
Centro de investigaçâo em Recursos Naturais, 
University of Azores. We thank Jorge Medeiros 
for his support with scanning electron micros- 
copy, Helena Almeida for her help on the deter- 
mination of the structure of calcium carbonate 
crystals, Robert Cameron for helpful discus- 
sions, and Brian Morton for his help and com- 
ments on the first drafts of this paper. 



LITERATURE CITED 

BAUR, В., 1994, Parental care in terrestrial gas- 
tropods. Expehentia, 50: 5-14. 

BAUR, A. & B. BAUR, 1998, Altitudinal variation 
in size and composition of eggs in the land snail 
Arianta arbustorum. Canadian Journal of Zo- 
ology, 76 (11): 2067-2074. 

BAYNE, С J., 1966, Observations on the com- 
position of the layers of the egg of Agriolimax 
reticulatus, the grey field slug (Pulmonata, 
Stylommatophora). Comparative Biochemistry 
and Physiology, 19: 317-338. 

BAYNE, С J., 1 968, Histochemical studies on the 
egg capsules of eight gastropod molluscs. Pro- 
ceedings of the Malacological Society of Lon- 
don, 38: 199-212. 

CHÉTAIL, M., M. DERER & J. FOURNIE, 1982, 
L'epithelium de l'organe de perforation de 
Thais lapillus L. (Mollusca, Prosobranchia): un 
epithelium transporteur d'ions. Malacologia, 
22: 305 311. 

CULLING, С. F. A., 1974, Handbook of histo- 
pathological and histochemical Techniques. 
3th. ed., Butterworths & Co. Ltd., London. 
xiv+712 pp. 



DANA, J. D., 1969, Manual de mineralogía. 
Livres Técnicos e Científicos Editora, Rio de 
Janeiro. 642 pp. 

FOURNIE, J. & M. CHÉTAIL, 1982a, Evidence for 
a mobilization of calcium reserves for repro- 
duction requirements in Dereceras reticulatum 
(Syn: Agriolimax reticulatus) (Gastropoda: 
Pulmonata). Malacologia, 22: 285-291. 

FOURNIE, J. & M, CHÉTAIL, 1982b, Accumula- 
tion calcique au niveau cellulaire chez les 
mollusques. Malacologia, 22: 265-284. 

GRAINGER, J. N. R. & A. J. SHILLITOE, 1952, 
Histochemical observations on galactogen. 
Stain Technology, 27: 81-85. 

HALL,A. &J. D.TAYLOR, 1971 , The occurrence 
of vaterite in gastropod egg-shells. Mineral- 
ogical Magazine, 38: 521-525. 

HELLER, J., 2001, Life history strategies. Pp. 
413-445, in: G M. barker, ed.. The biology of 
terrestrial molluscs. CAB International, U.K. 

MARTOJA, R. & M. MARTOJA-PIERSON, 1970, 
Técnicas de histología animal, 1st ed. 
Barcelona. Xvi + 350 pp. 

RODRIGUES, A. S., B. J. GÓMEZ, R. T CUNHA 
& A. M. F. MARTINS, 1998, Maturation diag- 
nostic characters in Oxychilus (Drouetia) 
atlanticus (Morelet & Drouët, 1857) (Pul- 
monata: Zonitidae). Iberus, 16 (2): 75-84. 

TOMPA, A. S., 1974, The structure of calcareous 
snail eggs. Malacological Review, 7: 49-50. 

TOMPA, A. S., 1976, A comparative study of the 
ultrastructure and mineralogy of calcified land 
snail eggs (Pulmonata: Stylommatophora). 
Journal of Morphology, 150: 861-888. 

TOMPA, A. S., 1979, Oviparity, egg retention 
and ovoviviparity in pulmonates. Journal of 
Molluscan Studies, 45: 155-160. 

TOMPA, A. S., 1984. Land snails (Stylom- 
matophora). Pp. 47-140, in: A A. TOMPA, N. H. 

VERDONK & J. A. M VAN DEN BIGGELAAR, eds., 

The Mollusca, Reproduction, vol. 7, Orlando, 
Academic Press. 486 pp. 
WIJSMAN, T С M. & H. WIJCK-BATENBURG, 
1987, Biochemical composition of the fresh- 
water snail Lymnaea stagnalis and oviposi- 
tion-induced restoration of albumen gland 
secretion. International Journal of Inverte- 
brate Reproduction and Development, 12: 
199 212. 



Revised ms. accepted 19 December 2002 



MALACOLOGIA, 2003, 45(1): 125-132 

INFLUENCE OF INORGANIC COMPOUNDS ON FOOD SELECTION 

BY THE BROWN GARDEN SNAIL CORNU ASPERSUM (MÜLLER) 

(GASTROPODA: PULMONATA) 

Laure Chevalier\ Martine Le Coz-Bouhnik^ & Maryvonne Charrier^* 

ABSTRACT 

Cornu aspersum's (synonym: Helix aspersa) ingestion rates were determined for 19 wild 
plant species and revealed strong feeding preferences. The plant species were classified 
according to their palatability. The inorganic contents of 3 appetent and 3 inappetent 
plants, analysed by ICP-MS, revealed significant differences, the appetent species being 
poorer in zinc and richer in calcium than inappetent ones. 

Trials facing isolated snails with a test solution against distilled water as control were 
performed. Farm snails previously fed with a calcium-rich food did not react differently to- 
wards two solutions of different calcium carbonate concentrations, whereas wild snails fed 
with a calcium-lacking food significantly preferred a 1 mg x ml ' calcium carbonate solution. 
Farm snails were significantly repelled by a 13 mg x mM zinc sulphate solution. 

The detection of inorganic compounds by snails and its possible influence on feeding 
regulation is discussed. 

Key words: Cornu aspersum. Helix aspersa, food selection, inorganic compounds, cal- 
cium, zinc 



INTRODUCTION 

Chemoreception via the tentacles, lips and 
foot (Croll, 1983; Kohn, 1983; Chase, 2002) 
enables a snail to direct itself towards the food 
source (olfaction), to analyse it by touch and 
taste, and to determine whether it is a suitable 
food or not. This analysis requires the interven- 
tion of a specialized olfactory neuronal system 
(Chase, 2002) and learning capacities linked 
with previous feeding history (Balaban, 1993; 
Desbuquois & Daguzan, 1995; Ungless, 
1998). Associative learning and post-ingestive 
effects may also modify future food selection 
(Gelperin, 1975; Chevalier et al., 2000). 

Several factors may influence the feeding 
choices of terrestrial molluscs. Secondary 
metabolites produced by plants, such as terpe- 
noids (Gouyon et al., 1983; Linhart & Thomp- 
son, 1995), glucosinolates (Glen et al., 1990) 
or alkaloids (Speiser et al., 1992; Chevalier et 
al., 2000), were recognized as deterrent for 
slugs and snails, and physical features of 
plants such as height (Rathcke, 1985) or tex- 



ture (Wadham & Wynn Parry, 1981) may also 
constitute a barrier against feeding activity. 
Some inorganic compounds, such as copper, 
calcium and trace metals, are necessary nutri- 
ents for molluscs (Johannsen & Solhoy, 2001 ), 
whereas chrome, nickel or selenium are not 
essential (Simkiss & Mason, 1983). Because 
of seasonal needs for calcium, snails store 
this mineral mainly as calcium carbonate and 
possess high reallocation capacities (Tompa & 
Wilbur, 1977; Fournie & Chétail, 1984). As cal- 
cium phosphate, it constitutes the mineral rings 
of the spherites located in the calcium (crypt) 
cells of the digestive gland (Almendros & 
Porcel, 1992) that have a heavy metal detoxify- 
ing function (Beeby & Richmond, 1988). 

Few studies have dealt with the role that inor- 
ganic compounds might play in snail nutrition. 
Williamson & Cameron (1976) and Wadham & 
Wynn Parry (1 981 ) hypothesized that the silica 
content of grasses may be responsible for 
their rejection by the snail Cepaea nemoralis 
and the slug Deroceras reticulatum, respec- 
tively. High levels of cadmium, copper and zinc 



'UM R. C.N. RS. 6553 "EcoBio". Université de Rennes 1, 263 Avenue du Général Ledere, 35042 Rennes Cedex, 

France 

^Géosciences Rennes, UMR CNR S. 6118, Université de Rennes 1, 263 Avenue du Général Ledere, 35042 Rennes 

Cedex, France 

'Corresponding author: maryvonne.charrier@univ-rennes1.fr 

125 



126 



CHEVALIER ETAL. 



were found to reduce the food intake of snails 
and be toxic (Laskowski & Hopkin, 1996; 
Gomot-de Vaufleury, 2000). Iglesias & 
Castillejo (1999) have suggested that the 
appetence of Urtica dioica for Cornu 
aspersum was linked with its richness in cal- 
cium. 

The aims of this study were to investigate 
the plant preferences of С aspersum and re- 
late these preferences to the mineral compo- 
sition of six selected food plants. Trials were 
then performed to observe the snail's gusta- 
tory sensitivity when faced with the most im- 
portant minerals revealed by the analysis. 



MATERIALSAND METHODS 
Consumption of Plants 

Samples of 19 plant species were collected 
in two coastal sites where populations of С 
aspersum were well established. Three plant 
species were common to the two sites. 
Those sites were in the salt-pans of 
Guérande, France, and in the polders of the 
Mont-Saint-Michel bay, where we determined 
previously the diet of С aspersum (Chevalier 
et al., 2001). Twenty-two groups of farmed 
snails, each of 15 snails of equivalent sizes 
(32.4 ± 1 .0 mm) and weight (1 1 .0 ± 1 g) were 
used (ANOVA on sizes: df = 21, F = 0.218, p = 
0.99). These snails were considered as naive 
as they originated from a snail farm, had al- 
ways tDeen fed with a cereal-based flour and 
had never experienced any fresh plant mate- 
rial. They were starved two days before the 
experiment. 

Snails were kept individually in plastic boxes 
and received a fresh sample of one plant spe- 
cies weighing around 2 g. The relationships 
between fresh and dry plant weights were es- 
tablished with plant samples oven-dried to 
constant mass. After 48 h, plant remains were 
weighed, dried and the dry weight of plant in- 
gested calculated. It was then divided by the 
fresh weight of the snail to obtain ingestion 
rates. Each snail was used once and each 
plant was tested against 15 snails. 

ICP-MS Analysis 

Six of the 19 plant species studied were 
chosen according to their strong appetence 
or inappétence: three from Guérande: Picris 
eciiioides and Carduus tenuif loris (Astera- 



ceae) and Beta maritima (Salsolaceae), and 
three from the Mont Saint-Michel polders: 
Urtica dioica (Urticaceae), Bractiythecium 
rutabulum (Bryophyta Brachytheciaceae), and 
Elytrigia repens (Poaceae). 

Leaf samples of those six plants were col- 
lected in the field, rapidly frozen in liquid nitro- 
gen, and dried by lyophilisation. Each 
powdered sample (nominally 100 mg) was di- 
gested in a screw-top Teflon- bomb (Savillex®, 
USA) on a hot-plate by three treatments using: 

(1) nitric acid (HNO3 14N sub-boiling grade); 

(2) hydrogen peroxide (Analytical reagent 
30%); (3) nitric acid together with hydro- 
xyfluoric acid (HF 29N sub-boiling grade). The 
sample was dissolved in HNO3 and evapo- 
rated to dryness. The completely mineralised 
samples were dissolved in 100ml of HNO3 
0.37N (HNO3 14N diluted with ultrapure deion- 
ized water Milli-Q'"' system). 

Samples spiked with 100 ppb of indium (In- 
ternal standard), were analyzed with an Induc- 
tively Coupled Plasma Mass Spectrometer 
(ICP-MS Agilent-Technologie® model HP4500) 
(Table 1). Calibrations were determined using 
synthetic multi-element solutions. To quantify 
the accuracy of our ICP-MS analyses, we 
used the NIST standard SRM 1573a (Standard 
Reference Material of Tomato leaves - National 
Institute of Standards and Technology, USA), 
and a reagent blank. 

Calcium Carbonate and Zinc Sulphate Experi- 
ments 

Six batches of 35 to 50 adult snails of 
equivalent sizes (30.6 ± 1 .0 mm) and weights 



TABLE 1: ICP-MS operating conditions 



Instrument parameters: 


Plasma gas 


15L/min 


Auxiliary gas 


I.OL/min 


Carrier gas 


1.13L/min 


Nebulizer 


Cross flow 


Spray chamber 


Scott 


T° spray chamber 


2°C 


CeOVCe' 


0.6% 


Ce'VCe" 


1% 


Data acquisition parameters: 


Quantitative analysis 


3s/mass 


Repetition 


2 



INORGANIC COMPOUNDS IN SNAIL FEEDING CHOICES 



127 



(8.9 ± 1 .0 g) (ANOVA, df = 59, F = 0.01 , p = 
0.991) were used. These snails, originating 
from different clutches were maintained at 
20°C, 80% relative humidity under a 12 h light- 
12 h dark period. Two days before the experi- 
ment, they were starved in order to enhance 
their feeding motivation. 30 min before the test, 
their locomotion was stimulated by a gentle 
spray of tepid distilled water. At the beginning of 
the experiment, carried out during the 
scotophase, they were individually placed at 
the bottom of a plastic box (1 1 .5 x 8.5 x 4.5 cm) 
between two nylon gauzes of 24 cm^ each. 
One gauze was impregnated with 2 ml of dis- 
tilled water, the other with 2 ml of the test solu- 
tion. Boxes were covered with a transparent 
glass sheet. They were observed in dim-light 
for 30 min and the time spent on the gauzes 
was checked. Time was recorded when snails 
remained active, not retracted into their shells, 
head and lips in contact with the gauze. 

Among the six batches, two comprised naïve 
snails reared with a specific meal rich in cal- 
cium carbonate (20% CaCOj) ("farm snails"). 
Two other batches comprised wild snails from 
Rennes, France, fed with lettuce for two 
months before the experiment ("wild snails"). 
Lettuce is well known as attractive to snails 
and also poor in calcium, between 300 and 500 
mg X kg ^ (Feinberg et al., 1991; Couplan, 
1998). A batch of farm snails and a batch of 
wild snails were tested with a 0.1 mg x mM 



СаСОз solution, while the two others were 
tested with a 1 mg x ml^ CaCOj solution. 

One of the two remaining batches of farm 
snails was tested with a 1 mg x ml^ ZnSO^ 
solution, that roughly corresponds to the zinc 
concentration of lettuce (Dallinger & Wieser, 
1984) and the second with a 13 mg x ml"' 
ZnSO^ solution, a value higher than the toxic 
threshold of zinc determined by Gomot-de 
Vaufleury (2000) in the food of C. aspersum. 
This high value compensated for the short 
time of exposure (30 min), the objective being 
to demonstrate the perception of this metal by 
the snail. 

Statistical Analysis 

Differences in ingestion rates among plant 
species were evaluated using ANOVA followed 
by a Fisher's PLSD test when a significant dif- 
ference was detected. The normality of the 
data was checked by the Wilk-Shapiro 
method. 

ICP-MS data from Guérande and Mont-Saint- 
Michel, and data from preferred and rejected 
plants, were compared by a Student t-test. 

The trials data were analyzed using a 
Wilcoxon, Mann & Whitney test for paired 
samples. The total activities of the snails - 
time spent on the test gauze + time spent on 
the control - were compared between different 
concentrations by a Student t-test. 



S О) 

О) ^ 

11 

-о о 
.Ç £ 
с .Я> 
о о 

ю Z 

ф -С 

с Ф 

"od 



30 п А IA 

i 

jllliiiiliii 

ov^ о о о ^о ^о о Ö хЛ о лч^ о,^ ^^^ л^ о-\^ о ^\^ о л\^ о о ^ 



FIG. 1. Laboratory feeding trials showing the ingestion of 19 plant species by 15 adult Cornu 
aspersum. Values are means ± S.E. G = saltpans of Guérande, BM = polders of the Mont-Saint- 
Michel bay. A group = appetent plants; lA group = inappetent plants; ANOVA, p < 0.05. 



128 



CHEVALIER ETAL. 



RESULTS 
Consumption of Plants 

The results, figured according to decreasing 
ingestion rates were recorded for 19 species: 
14 dicotyledonous, four monocotyledons 
(Poaceae), and one Bryophyta (Fig. 1). Signifi- 
cant differences between ingestion rates were 
highlighted by ANOVA (df = 21 , F = 1 2.205, p < 
0.0001) but data were continuous so that we 
could not separate all the plants species into 
different groups according to their appetence. 
From the ingestion rates, we could only con- 
sider two groups: the A group of four appetent 
plants that were significantly more ingested 
than the lA group of 5 inappetent plants (Fig. 1 ). 
Then, the ICP-MS analysis was performed on 
three plants belonging to the A group {Urtica 
sp., Carduus sp., Picris sp.) and the three oth- 
ers belonging to the I A group {Beta sp., Elythgia 
sp., Bractiyttiecium sp.). 

Among the 11 most ingested plants, Poa- 
ceae were represented by Festuca rubra, 
Dactylis glorverata and Bromus hordeaceus, 
whereas the tough Elythgia repens figured 
among the less eaten species. Festuca rubra 
and Dactylis glomerata seemed to be less pal- 



atable for С aspersum when they came from 
the Mont-Saint-Michel than from Guérande. 

Inorganic Compounds 

Forty-two elements were quantified in the 
plant samples, but we show only the 12 ele- 
ments having biological interest, that is, Na, Mg, 
K, Ca, Mn, Ni, Cu, Zn, As, Sr, Cd, Pb (Table 2). 

With 52 and 21 g x kg ^ respectively, B. mar- 
itima and P. echioides from Guérande showed 
high sodium contents compared to the other 
species (Table 2). The lead content of the 
moss B. rutabulum reached ten times the 
level found in E. repens or U. dioica; В. mar- 
itima was about eight times richer in cadmium 
than E. repens or B. rutabulum. 

Plants from Guérande were significantly 
richer in sodium than Mont-Saint-Michel plants 
(t-test, p = 0.049). No other significant differ- 
ence, for any compound, was observed be- 
tween the plants from the two sites (t-test, n = 
6, p > 0.05). lA plants showed significantly 
lower concentrations of calcium and strontium 
than the A ones. A plants were roughly ten times 
richer as the lA plants. On the other hand, lA 
plants had a high zinc concentration (t-test, 
n = 6, p = 0.049). 



Ç 

'e 

<D 
N 

CD 
O) 

CD 

С 
О 



П Control 
■ CaCO 




0.1 mg/ml 
Farm snails 



1 mg/ml 



0. 1 mg/ml 



1 mg/ml 
Wild snails 



FIG. 2. Time spent by adult snails on a gauze impregnated with CaCOj solutions compared to a 
control gauze saturated with distilled water. Values are means ± S.E. 



INORGANIC COMPOUNDS IN SNAIL FEEDING CHOICES 



129 



il 

_j го 
uro 



^ о 
■do 

^t 

" с § 
2Í Ш о 

^- со CL 

8 0) Ê 

ф 



Ф Ф го 



Ф 



^c Î=S 



D)' 



ro ro 



«iH Ф 

с ro CL 
O 5 CL 

■^ ^ ro 
ro -í¿ с 
Ъ ^'~ 
с i5 "Cl 
ф ^ c 

ёф"' 
o£ с 
<^Z. Ф 
ш о ф 
¿со. 

г— о о. 

"■- ф 

ф 



^ ф 
го тэ 

го-о^ 
^ с ш 

Q СЛ ф 

- ш ^ 

-Q ^ 
сотз 

.£ -= го 
го "*" о 

о ^J^ 



ôï 



О) 



ГО 



ся 

Ф í: СЛ 
>-'^ Ф 
ф "О TS 

roi5T3 
*; э с 
■£ oi- 

CD го • 
3 О ^ 

О Ф ГО 
< E О. 

I— := о. 



h-CM C^Jr^^OI^CN-^rvICD-^ 

r-O т-О^^'ХОСОООт-т- 

2 ю 



■^'~Tj-T-£;!cocMCD 

X XCMCN^CMCOCM 



CNJ CM 



CO Ю о 'Л о Q X Í5 s s ^- «я 
°^ o^'v OC.-CO-CO--Í 

CNJ 










^ 








in 
ro 
10 











en 





(-) 


X 


T— 


со 


r- 00 





1^ 




c\j 





X 


00 


CNJ со 


•^ 


•^ 


■Ч- 


CNJ 


Ю 









ro 

CN 


lO 


со т- 

СМ CNJ 


CSJ 

CNJ 


со 



CD о r4j о Ф 
■r- ^ CNI СО 



ro CNJ CN со -^ 



СО CD -^ r^ •^ CD 
r~- 1^ -^ Ю T- о 

ro Ю (35 CD 00 со 



T- T- C35 со CNJ со 



X CNJ 05 ^. 



Ш L-l tr о 

> Û СО о; С 
< СО (Г О 3 



О С 



Е 






со ^CDS 


о 


.^^ 




g/a repen 

maritima 
a dioica В 


CD 
СО 


1- 
ф 

СО 


Е 

с 


ш 


(U 


о 


■^ 


Jt: 


о 


"> 


г 


0) 


i: о (D ü 


(Г 


си 


(U 


^2 ^t 


СО 


m 


Q 


uj CQ CQ :::d 



со 

g) 




Ti 


Д 





О) 


-с 




С) 


со 


Qí 


сз 


СО 


CS 




та 


Ц- О 



о со -^ t^ in CNI 
■^ CNJ СО CN (N t^ 



X О CN О О О -^ 



TJ- О о LO О -^ 



о о о о о о 



со (D 



° о С35 CD -* 



о - 
о. ^г 
о 



X CN CD 



С^ СП '-' "^ ° 

;^ Х^ со г- CNJ 

(М CNJ CN 



■<- о «^ — о 
о сэ сэ о 



о t^ со со CN С\1 т- 
■^ CN Ю Ю CNI т- CD 
ií о ■* о о 00 N- 



о о о о о о 



C35|^T-OOCNOOCDOOCD 
СЭ^ Х"^ООС35СОЮЮ 
CO'-'q XcOt-4-CNJCNCN 
CNI CD 

го 



0-^2'^'^CD'^'^CD'^ 
N-T- T-COOOh-'^COOO 

^tcD ^ хсЬ-^сЬ'Ч-азоо 



> Û C/5 05 с 

< СЛ q: ü 3 



Ш .È Q. 



о 



Co с Ï I с 

Ш о CD i: со 

■- -^ '^^ ^ p 

с Ф £ o та 

i5 ш ^ 5 Ф 

m Q LU CQ CQ 



о 

<о 
та 7; с 

о 9 QJ 

о -с *" 

i; о <0 
^ О) =5 

та (О 5 
УС Î 
t о та 

:э CL о 



CÛ а s 



CD а s 



130 



CHEVALIER ETAL. 



CD à 
N 

ce 

D) 

^ 2 
О 

с 
о 

I 1 

Q. 
Cft 

0) 

£ 
i= 



D Control 
■ ZnSOn 




1 mg/ml 



13 mg/ml 



Farm snails 



FIG. 3. Time spent by adult farm snails on a gauze 
impregnated with ZnS04 solutions compared to a 
control gauze saturated with distilled water. Val- 
ues are means ± S.E. 



Calcium Carbonate and Zinc Sulphate Experi- 
ments 

The total activities - that is, time spent on 
both gauzes - of the wild and the farm snails 
for the four СаСОз trials were similar (t-test, n 
= 140, p = 0.32). Wild snails significantly pre- 
ferred the gauze impregnated with the 1mg x 
mh^ calcium carbonate concentration 
(Wilcoxon, Mann & Whitney test, n = 35, p = 
0.036). Wild snails subjected to 0.1 mg x ml^ 
СаСОз and farm snails for both concentrations 
did not behave differently towards the two 
gauzes (Fig. 2). 

The total activities of the two batches of farm 
snails exposed to two different concentrations 
of zinc sulphate were not significantly different 
(t-test, n = 100, p = 0.44). During the 1 mg x 
ml^ ZnSO^ trials, snails showed a non-signifi- 
cant tendency to avoid the zinc sulphate solu- 
tion (Wilcoxon Mann & Whitney, n = 50, p = 
0.16) (Fig. 3). This reaction became significant 
with the 13 mg x ml^ ZnSO^ concentration 
which was tasted half as often as the control 
(Wilcoxon Mann & Whitney, n = 50, p = 0.04). 



DISCUSSION 

Amongst the plant species eaten by snails, 
grasses were represented by Festuca rubra 
and Dactylis glomerata, whereas the tough 
grass Elytrigia repens was less appreciated. 



This result is consistent with our previous data 
(Chevalier et al., 2001 ). Williamson & Cameron 
(1976) and Waddham & Wynn-Parry (1981) 
hypothesized that the tough texture of some 
grasses may be responsible for their deter- 
rence towards slugs and snails. Differences in 
the ingestion rates of the same grass species 
from the two different locations may be due to 
the fact that grass species often present sub- 
species (Metcalfe, 1960). The soil and climate 
differences between the two sites could also 
induce phenological and/or toughness differ- 
ences. 

The rejection of the bryophyte Brachythecium 
rutabulum and the sea beet Beta maritima 
could be linked to their richness in lead and 
cadmium respectively. Bryophyta are known to 
accumulate heavy metals but the much higher 
concentrations known to be toxic to C. 
aspersum - 146 mg x kg^ for cadmium 
(Russell et al., 1981), 12700 mg x kg 4or lead 
(Laskowski & Hopkin, 1996) - cannot support 
this hypothesis. 

The sodium content of B. maritima and P. 
echioides, representing nearly 50% and 30% 
respectively of the total amount of inorganic 
compounds recorded may be related to the 
proximity of the saltpans. Some halophytes 
were also met near our studied area: Suaeda 
sp., Obione sp. or Salicornia sp. Considering 
that free salt (NaCI) is often used as a barrier 
for molluscs, we may hypothesize that a deter- 
rence threshold for sodium could take place for 
concentrations around 50 g x kg ^ found in Beta 
maritima. 

Although other chemical (secondary metabo- 
lites) and physical (height, hairiness) character- 
istics might account for differences in 
consumption, it seems that inorganic com- 
pounds and especially calcium, strontium and 
zinc could play a role in С aspersum's feeding 
choices. Calcium and strontium values are of- 
ten expressed as Sr/Ca ratios in the literature, 
as they show similar variations (Klein et al., 
1996). In this study, "farm snails" were reared 
with a flour supplemented with calcium carbon- 
ate. Since snails have strong calcium storage 
and reallocation capacities, especially from 
their shells (Fournie & Chétail, 1984), it is diffi- 
cult to assess precisely whether a snail lacks 
calcium. This becomes possible with wild 
snails fed with lettuce, 10-fold poorer in cal- 
cium compared to industrial snail food. The 
positive reaction towards calcium carbonate 
shown by wild snails can therefore be related to 
this lack. Snails may thus be able to detect the 
CaCO available in the soil or in the plants and 



INORGANIC COMPOUNDS IN SNAIL FEEDING CHOICES 



131 



to balance their diet in order to optimize their 
calcium intake. In term of optimal foraging, nu- 
trients constraints sometimes drive feeding 
decision (Boyer, 1997). Such an active balance 
was observed in slugs tov\/ards amino-acids 
(Cook et al., 2000) and was suggested in 
snails for calcium by Iglesias & Castillejo 
(1999). Recently, damages made by C. 
aspersum have been observed on house 
paints in different regions of Brittany. The work 
carried out with 16 water-based house paints 
proved that the more calcium they contained, 
the more snails ingested them (Chevalier & 
Charrier, 1999; Charrier, in Chesnais, 1999). A 
comparison between two groups of snails liv- 
ing in Brittany, one group originating from a nar- 
row band of soil rich in calcium and the other 
from a chalky poor soil, supported the hypoth- 
esis that snails lacking this mineral ate more 
calcium-rich paints. Many works and the 
present study allow us to state that calcium is 
one of the major mineral elements governing 
the feeding strategy of С aspersum, regard- 
less of which factors are controlling its cellular 
incorporation. 

Like copper, zinc is an essential nutrient for 
snails but over a certain threshold it has inhibi- 
tory effects on the growth, development and fit- 
ness of snails (Laskowski & Hopkin, 1996; 
Gomot-de Vaufleury, 2000). Those effects are 
often accompanied by a decrease in food in- 
gestion (Russell et al., 1981; Simkiss & 
Watkins, 1991; Laskowski & Hopkin, 1996). 
The 13 mg X ml ' zinc concentration that de- 
terred snails during our no-choice trials is 
higher than those found in the three deterrent 
plant species, but within 30 minutes, the dura- 
tion of the trial, the response was a fast rejec- 
tion after contact chemoreception. In contrast, 
in nature, the snails are regularly exposed to 
the metals in plants and soil. Therefore, post- 
ingestive effects may occur after several days, 
the compounds being stored and becoming 
toxic by a cumulative pattern. 

Our experiment accounts for oral chemore- 
ception, but uptake of calcium (Fournie & 
Chétail, 1984) and water (Prior et al., 1989) can 
also be integumental, suggesting the presence 
of Ca^* channels and aquapohnes in the snail 
integument. 

This study has shown that gastropods can 
use inorganic compounds as clues for deciding 
whether or not to feed. Nutritional quality of the 
plants may influence the distribution of the 
snails in their environment. Snails' pressure on 
their food plants may in turn influence the bal- 



ance of competition between plants, resulting 
in modifications of their distribution. Such stud- 
ies might contribute to the knowledge of eco- 
logical niche occupancy in relation to food 
resources. 

Further investigations on inorganic com- 
pounds are needed by using complete artificial 
diets with different ratios in elements (Ca, Na, 
Zn) concentrations and by testing these diets 
on snails deprived specifically of such ele- 
ments. This could help us to assess whether 
snails have the capacity to respond to the inor- 
ganic compounds contents of plants and to 
regulate their intake. 



ACKNOWLEDGEMENTS 

We wish to thank Prof. S. E. R. Bailey 
(Manchester University, United Kingdom) and 
Dr. Annette Gomot-Berset de Vaufleury 
(Université de Besançon, France) for their val- 
ued comments on this manuscript and Valérie 
Briand (Université de Rennes, France) for her 
kind help. 



LITERATURE CITED 

ALMENDROS, A. & D. PORCEL, 1992, A struc- 
tural and microanalytical (EDX) study of cal- 
cium granules in the hepatopancreas of Helix 
aspersa. Comparative Biochemistry and Pliysi- 
oiogyA, 103: 757-762. 

BALABAN, P., 1993, Behavioral neurobiology of 
learning in terrestrial snails. Progress in Neu- 
robiology, 41; 1-19. 

BEEBY, A. & L. RICHMOND, 1988, Calcium me- 
tabolism in two populations of the snail Helix 
aspersa on a high lead diet. Archives of Envi- 
ronmental Contamination and Toxicology, 17: 
507-511. 

BOYER, J. F., 1997, Nearly optimal foraging in 
patches under nutrients constraints. Biological 
Bulletin, 193: 171-186. 

CHASE, R., 2002, Behavior and its neural con- 
trol in gastropod molluscs. Pp. 124-169. Ox- 
ford University Press, New York. 314 pp. 

CHESNAIS, E., 1999, Peintures, les escargots 
attaquent. Que Choisir, 360: 46-47. 

CHEVALIER, L. &M. CHARRIER, 1999, Attaque 
de revêtements semi-épais par l'escargot 
petit-gris Helix aspersa Müller. Rapport de 
Contrat pour la SOGEFI, 42 pp. 

CHEVALIER, L., С DESBUQUOIS, J. PAPINEAU 
& M. CHARRIER, 2000, Influence of the 
quinolizidine alkaloid content of Lupinus albus 
(Fabaceae) on the feeding choices of Helix 
aspersa (Gastropoda: Pulmonata). Journal of 
Molluscan Studies, 66: 61-68. 



132 



CHEVALIER ETAL. 



CHEVALIER, L., С DESBUQUOIS, J. LE LANNIC 
& M. CHARRIER, 2001 , Poaceae in the natural 
diet of the snail Helix aspersa Müller (Gas- 
tropoda, Pulmonata). Comptes Rendus de 
l'Académie des Sciences III, 324: 1-9. 

COOK, R, T., S. E. R. BAILEY, С. R. 
McCROHAN, B. NASH & R. M. WOODHOUSE, 
2000, The influence of nutritional status on 
the feeding behaviour of the field slug 
Deroceras reticulatum (Müller). Animal 
Behaviour, 59: 167-176. 

COUPLAN, F., 1998, Guide nutritionnel des 
plantes sauvages et cultivées. Pp. 100, in: Les 
guides pratiques du naturaliste. Lausanne, 
Suisse: Delachaux & Niestle. 255 pp. 

CROLL, R. P.. 1983, Gastropod chemo- 
reception. Biological Review of the Cambridge 
Philosophical Society, 58: 293-319. 

DALLINGER, R. & W. WIESER, 1 984, Patterns of 
accumulation, distribution and liberation of Zn, 
Cu, Cd and Pb in different organs of the land 
snail Helix pomatia L. Comparative Biochemis- 
try and Physiology C, 79: 117-124. 

DESBUQUOIS, С & J. DAGUZAN, 1995, The in- 
fluence of ingestivo conditioning on food 
choices in the land snail Helix aspersa Müller 
(Gastropoda: Stylommatophora). Journal of 
Molluscan Studies, 61: 353-360. 

FEINBERG, M., J. С. FAVIER & J. IRELAND- 
RIPERT, 1991, Répertoire général des ali- 
ments: table de composition. Fondation 
Française pour la Nutrition, Centre 
Informatique sur les Aliments. Lavoisier, Paris. 

FOURNIE, J. & M, CHÉTAIL, 1984, Calcium dy- 
namics in land gastropods. American Zoolo- 
gist, 24: 857-870. 

GELPERIN, A., 1975, Rapid food-aversion learn- 
ing by terrestrial mollusk. Science, 189: 567- 
570. 

GLEN, D. M., H. JONES & J. K. FIELDSEND, 
1990, Damage to oilseed rape seedlings by 
the field slug Deroceras reticulatum in relation 
to glucosinolate concentration. Annals of Ap- 
plied Biology, 117: 197-207. 

GOMOT-de VAUFLEURY, A., 2000, Standardized 
growth toxicity testing (Cu, Zn, Pb and pen- 
tachlorophenol) with Helix aspersa. Eco- 
toxicology and Environmental Safety, 46: 
41-50. 

GOUYON, R H., R FORT & G. CARAUX, 1983, 
Selection of seedlings of Thymus vulgaris by 
grazing slugs. Journal of Ecology, 71: 299- 
306. 

IGLESIAS, J. & J. CASTILLEJO, 1999, Field ob- 
servations on the land snail Helix aspersa 
Müller. Journal of Molluscan Studies, 65: 411- 
423. 

JOHANNESSEN, L. E. & T SOLH0Y 2001, Ef- 
fects of expehmentally increased calcium lev- 
els in the litter on terrestrial snail populations. 
Pedobiologia, 45: 234-242. 

KLEIN, R. T, K. С LOHMANN & С. W. THAYER, 
1996, Sr/Ca and ^Ю/^^С ratios in skeletal cal- 



cite of Mytilus trossulus: covariation with meta- 
bolic rate salinity and carbon isotopic composi- 
tion of seawater. Geochimica Cosmochimica 
Acta, 60: 4207 4221, 

KOHN, A. J., 1983, Feeding biology of gastro- 
pods. Pp. 1-63, in: S. M SALEUDDIN & K. M. 
WILBUR, eds.. The Mollusca, 5, Academic 
Press, New York, 500 pp. 

LASKOWSKY R. & S. P HOPKIN, 1996, Effect of 
Zn, Cu, Pb, and Cd on fitness in snails (Helix 
aspersa). Ecotoxicology and Environmental 
Safety, 34: 59-69. 

LINHART, Y В. & J. D. Thompson, 1995, Ter- 
pene-based selective herbivory by Helix 
aspersa (Mollusca) on Thymus vulgaris 
(Labiatae). Oecologia, 102: 126-132, 

METCALFE, С R,, 1960, Anatomy of the mono- 
cotyledons. I: Gramineae. Oxford University 
Press, New York, 750 pp, 

PRIOR, D. J,, I, G, WELSFORD & P A, BANTA, 
1989, Ingestion of substrate fluid by Helix 
aspersa Müller: a feeding response induced 
by low molecular weight chemical stimuli. Com- 
parative Biochemistry and Physiology A, 94: 
73-74. 

RATHCKE, В., 1985, Slugs as generalist herbi- 
vores: tests of three hypotheses on plant 
choices. Ecology 66: 828 836. 

RUSSELL, L.K., J. I. DE HAVEN & R. R BOTTS, 
1 981 , Toxic effects of cadmium on the garden 
snail (Helix aspersa). Bulletin of Environmental 
Contamination and Toxicology, 26: 634-640. 

SIMKISS, K. & A. Z. MASON, 1983, Metal ions: 
metabolic and toxic effects. Pp. 101-164, in: D. 
WILLOWS, ed., The Mollusca, 2, Academic 
Press, New York. 362 pp. 

SIMKISS, K. & B. WATKINS, 1991, Differences in 
zinc uptake between snails Helix aspersa 
(Müller) from metal- and bacteria-polluted 
sites. Functional Ecology, 5: 787-794. 

SPEISER, В., J. HARMATHA & M. ROWELL- 
RAHIER, 1992, Effects of pyrrolizidine alkaloids 
and sesquiterpenes on snail feeding. 
Oecologia, 92: 257-265. 

TOMPA, S. & M, WILBUR, 1977, Calcium 
mobilisation during reproduction in snail Helix 
aspersa. Nature, 270: 53-54, 

UNGLESS, M. A,, 1998, A pavlovian analysis of 
food-attraction conditioning in the snail Helix 
aspersa. Animal Learning and Behavior, 26: 
15-19. 

WADHAM, M. D. & D. WYNN PARRY 1981, The 
silicon content of Oryza sativa L. and its effect 
on the grazing behaviour of Agriolimax 
reticulatus Müller. Annals of Botany, 48: 399- 
402. 

WILLIAMSON, R & R. A. D. CAMERON, 1976, 
Natural diet of the landsnail Cepaea 
nemoralis. Oikos. 27: 493-500. 



Revised ms. accepted 7 March 2003 



MALACOLOGIA, 2003, 45(1): 133-140 

SHELL-BAND COLOR POLYMORPHISM IN CEPAEA VINDOBONENSIS 
ATTHE NORTHERN LIMIT OF ITS RANGE 

Alois Honek 

Research Institute of Crop Production, Drnovslo 507, 

CZ-16106 Praiia 6-Ruzyne, Czechi Republic; 

honek@hb. vurv. cz 

ABSTRACT 

The distribution of black-, brown- and faint-banded morphs in populations of Cepaea 
vindobonensis (Férussac) was established at the northwestern edge of the species' 
distribution. In the Czech Republic, the species was sampled at 1 32 localities in the Morava 
and Elbe river basins, between 48°45' and 50°15'N. Even in this narrow zone, there was a 
significant trend for increasing frequency of the black-banded morph with increasing 
geographic latitude and altitude. The variation paralleled the decreasing length of sunshine 
(April-August), which is > 10% shorter at the northern than at the southern localities. The 
habitats occupied by northern populations (grassy steppe-like stands) differed from those 
preferred by southern populations (synanthropic weed stands, mostly stinging nettle). 
Geographic trends and habitat differences in morph frequencies may be affected by climatic 
selection. Other possible causes of variation are discussed, comparisons are made with 
other species, and gaps in evidence are identified. 

Key words: Cepaea, Helicidae, shell-band color, polymorphism, geographic distribution, 
climatic selection, microclimate, vegetation. 



INTRODUCTION 

Cepaea vindobonensis (Férussac) is a me- 
dium-sized helicid snail (shell diameter 20-25 
mm) living in steppe or ruderal localities of 
southeast Europe. In the northwest, its distri- 
bution extends to north Carpathian, Súdete and 
east Alp mountains, and only a few populations 
pass this limit along the Danube and Elbe riv- 
ers (Schilder & Schilder, 1953; Lozek, 1956; 
Kerney & Cameron, 1999). Cepaea vindo- 
bonensis has been studied less than its close 
relatives, С nemoralis (L.) and C. hortensis 
(Müller), although this species is common in the 
area of its distribution. Consequently, geo- 
graphic variation and ecological significance of 
shell banding and color polymorphisms are less 
understood. Variation of these characters is, 
however, simpler and less marked than in the 
two congeners, which should make interpreta- 
tion easier. 

The shell of С vindobonensis is whitish with 
five dark bands. Two or more bands may fuse 
together, but individuals with confluent bands 
are rare. The polymorphism consists usually in 
differences of band color, which varies between 
black and pale yellow. As the band color be- 



comes paler, the sharpness of band margins 
decreases so that finally the color of the shell 
becomes uniformly yellowish. The decolorized 
"faint-banded" individuals dominate some popu- 
lations of the Balkan Peninsula and southern 
central Europe (Zimmermann, 1919; Lozek, 
1956; Schilder & Schilder, 1957), whereas 
northern populations consist of dark-banded in- 
dividuals. Detailed studies of morph distribution 
in the northern Balkan Peninsula (Jones, 1973, 
1974; Jones et al., 1977) revealed that propor- 
tion of morphs in local populations depends on 
microclimate. 

Cepaea vindobonensis is abundant in lowland 
areas of the basin of the Morava River (Lisicky, 
1991). This eastern part of the Czech Republic 
(Moravia, approx. east of 16°E) is essentially a 
valley opening to the south. In the western part 
of the Czech Republic (Bohemia), С vindo- 
bonensis lives in north-central lowland parts, 
mainly along the Elbe River. Earlier investiga- 
tion (Zimmermann, 1919; Lozek, 1956) showed 
that Moravian and Bohemian populations differ 
in the proportion of faint-banded individuals. 
However, the precise distribution of forms and 
its environmental correlates were not known. 
Assuming the effect of climatic selection, I ex- 



133 



134 



HONEK 



pected a north-south dine of increasing propor- 
tion of faint-banded morph in local populations. 
The existence of this variation was studied in 
106 Moravian and 26 Bohemian populations of 
C. vindobonensis that were sampled and for 
which geographic and climatic conditions were 
established. 



MATERIALSAND METHODS 

Color Morphs 

Shell pattern and coloration of C. vindo- 
bonensis has been illustrated (Jones, 1973; 
Kerney & Cameron, 1999) and described 
(Jones, 1973, 1975; Cook, 1998; Staikou, 1998, 
1 999; Kerney & Cameron, 1 999) several times. 
The descriptions require some precision with 
respect to variation encountered in populations 
of the Czech Republic. The shell has five bands 
conventionally indicated band 1 (dorsal) to 5 
(ventral). In populations of the Czech Republic, 
the occurrence of shells with absent or con- 
fluent bands was very rare. Considering this 
variation was therefore immaterial for quantita- 
tive description of the composition of popula- 
tions, and only differences in band and shell 
ground color were important. The categories 



used here are based on bands 3-5 because 
bands 1 and 2 are narrow and often paler. I dis- 
tinguish three morphs with respect to color of 
bands 3-5: (i) black-banded morph with black 
or dark-violet-black bands (violet coloration of- 
ten appears in worn living and dead weathered 
shells), (ii) brown-banded morph, and (iii) faint- 
banded morph with yellow bands. The ground 
coloration in black-banded individuals is always 
white. In band morphs (ii) and (iii) the band 
margins may be blunted. Brown or yellow color 
then becomes "diffuse" and "spreads" into ar- 
eas of white coloration between bands so that 
final shell coloration may become uniformly pale 
brown or yellow. 

Sampling and Habitat Description 

The snails were sampled in 1 990-2001 at lo- 
calities (Appendix) of southern and central 
Moravia and central Bohemia (Fig. 1). Search 
for localities started in areas where species 
occurrence was already established (Lozek, 
1 956; Lisicky, 1 991 ) and progressed to neigh- 
boring territories up to the edge of the species 
distribution. The sampling was made in April- 
June when snails are most active. At each lo- 
cality, living animals and well-preserved dead 
shells were collected at a plot of usually 



50^ 




100 km 
I 1 



FIG. 1. The presence of shell-band color morphs at local С vindobonensis populations (Appendix). 
A. Black-banded individuals only. 8. Brown-banded individuals present. С Faint-banded (and brown- 
banded) individuals present. Dashed line: isotherm of 17°C mean June temperature. Dotted line: 
isotherm of 15°C mean April-September temperature. Numbers 1-7 indicate the position of 
meteorology stations (Table 2). The reaches of Elbe (E) and Morava (M) rivers are indicated. 



BAND COLOR POLYMORPHISM IN CEPAEA VINDOBONENSIS 



135 



< 1 000 m^ size. The number of animals of each 
morph was recorded together with geographic 
coordinates, altitude (established by Global 
Position System or read from 1:50,000 maps) 
and vegetation of the locality. Vegetation stands 
were divided into four categories: grassy closed 
(grass sward with no or few small spots of bare 
ground), grassy open (sparse grassy vegeta- 
tion with large parts of bare ground), forb closed 
(dense forb stands with no bare ground between 
the plants) and forb open (forb stands not 
closed, with large spots of bare ground). Cli- 
matic data were taken from published sources. 
The Atlas of the Climate of Czechoslovakia 
(Anonymous, 1958) indicates the isotherms of 
mean monthly temperatures or mean tempera- 
tures accumulated over selected longer peri- 
ods, calculated from data of 1901-1950. The 
Statistical Yearbook of the Czech Republic 
2001 (Anonymous, 2001) indicates average 
monthly temperatures and sunshine hours for 
selected meteorology stations, calculated from 
data of 1961-1990. 




FIG. 2. The regression of the proportion of black- 
banded individuals (arcsin transformation) on the 
geographic latitude and altitude of the locality of 
collection. Data for populations of Moravia. 



Data Processing 

The multiple linear regression of proportion 
of the black-banded morph in local populations 
(arcsin transformed) on geographic latitude and 
altitude of the locality and the second order re- 
gression (P = bg+b^S+b^S^, where P is arcsin 
transformed proportion of black-banded morph 
and S is sunshine hours) of this characteristic 
on sunshine hours recorded at the nearest me- 
teorology station were calculated. The differ- 
ences in morph frequency on localities with 
different types of plant cover were tested by G- 
test and Fisher exact test. All calculations were 
made using Statistica for Windows (StatSoft, 
1994). 



RESULTS 

Geographic Distribution of Shell-Band Color 
Forms 

The distribution of populations containing 
faint-banded and brown-banded morphs (Fig. 
1) was limited to south Moravia. The faint- 
banded animals were found at 26 localities situ- 
ated below 49°20'N and 320 m altitude (aver- 
age altitude 217 m a. s. I.). The brown-banded 
morph was found at all these and further 44 lo- 
calities, that is, at a total of 70 localities situ- 
ated below 49°30'N and 340 m (average alti- 
tude 230 m a. s. I.). The populations consisting 



only of black-banded morph were found at 36 
localities between 48°48'N and 49°46'N and 1 80 
to 360 m (average altitude 260 m a. s. I.). The 
occurrence of morphs was thus not geographi- 
cally separated. Nevertheless, within Moravia, 
the proportion of the black-banded morph in C. 
vindobonensis local populations (Fig. 2) signifi- 
cantly increased (R2= 0.3166, F,2, 02) = 23.628, 
p < 0.001 ) with geographic latitude (tio2 = 4.67, 
p < 0.001 ) and altitude (tio2 = 2.31 , p < 0.05) of 
the locality. In Bohemia only populations con- 
sisting of black-banded individuals were found 
(Fig. 1). 

Habitats 

The vegetation cover of localities occupied 
by C. vindobonensis populations changes with 
latitude. In south Moravia (< 49°10'N), half of 
the populations lived in open or closed forb 
stands (Fig. 3). The latter were in most cases 
the patches of stinging nettles {Urtica dioica L.) 
growing on eutrophic soils surrounding human 
settlements. As a consequence, the occurrence 
of С vindobonensis was largely synanthropic. 
By contrast, in the north Moravia and Bohemia 
about 80% of populations occupied closed or 
open grassy stands. Thus, the preferred sites 
changed from ruderal to steppe localities. 

The relationship between plant cover and fre- 
quency of shell color morphs was investigated 
for 59 localities of south Moravia. The popula- 
tions with faint-banded and brown-banded 



136 



HONEK 



100% 




Moravia S 



Moravia N 



Bohemia 



FIG. 3. The proportion of С vindobonensis 
localities covered by different types of vegetation 
In the southern Moravia (left), northern Moravia 
(middle), and Bohemia (right). The localities of 
Moravia were partitioned into south and north 
by 49°0'N parallel (northern edge of a common 
occurrence of the faint-banded morph). The 
patterns filling the columns represent types of 
vegetation cover: FO: forb open, FC: forb closed, 
GO: grassy open, GC: grassy closed. 



morphs were significantly more represented at 
localities with grassy stands than in forb stands 
(Table 1). By contrast, populations consisting 
only of black-banded morphs were frequently 
found at localities grown with forb stands. 

Climatic Correlates of Morph Distribution 

In Moravia, the geographic distribution of 
shell- band color morphs was correlated with 
climatic characteristics of the localities. The 
faint-banded morph was present (with few ex- 
ceptions) at localities situated south of the 1 7°C 
isotherm of mean June temperature (Fig. 1). 
The northern limit of the area where populations 
of brown-banded morph were found was ap- 
proximately the 15°C isotherm of mean April- 
September temperature (Fig. 1). In Bohemia 
there exist small areas where mean April-Sep- 
tember temperatures also exceed 15°C (Fig. 
1 ). However, the brown-banded shells were not 
found at the Bohemian localities. 

The increase of the frequency of black- 
banded morph was parallel to the geographic 
trend in the change of climate (Table 2). As one 
moves from south to north average April Au- 
gust temperature decreased only slightly by 
about 1 °C. A consistent trend was found in the 
decrease of sunshine hours with a total of 



TABLE 1 . The frequency of south Moravia (below 
49°10'N) populations containing particular shell- 
band color morphs in relation to plant cover at 
the locality. Above: populations where faint-banded 
morph was present vs. populations where only 
brown and/or black-banded (not faint-banded) 
morphs were present. Below: populations where 
only black-banded morph was present vs. 
populations where faint- and/or brown-banded 
morphs were present. Expected frequencies for 
each category are in brackets. 



Plant cover 
Forb Grass Total 



Not faint- 
banded 

Faint-banded 
Total 



22 

(17.7) 

7 

(11.3) 

29 



14 
(18.3) 

16 

(11.7) 

30 



36 



23 



59 < 0.05a 



Black-banded 


11 
(6.4) 


2 

(6.6) 


13 




Brown- or 


18 


28 


46 




faint-banded 


(22.6) 


(23.4) 






Total 


29 


30 


59 


< 0.01b 



a: G-test on 2x2 contingency table 
b: Fisher exact test 



TABLE 2. Mean temperature and mean monthly 
sunshine duration in April-August at seven 
meteorology stations situated inside the area of 
С vindobonensis distribution (Fig. 1), Veiké 
Pavlovlce (48°50'N; 180 m a. s. I.), Kucharovice 
(48°50'N; 300), Brno (49°10'N; 230), Olomouc 
(49°40'N; 220), Praha (50°00'N; 260), Hradec 
Králové (50°10'N; 240), Doksany (50°20'N; 160). 
Both climatic characteristics were calculated as 
means of 1961-1990 data. 





Temperature 


Sunshine 




(°C) 


duration (h) 


1 Velké Pavlovlce 


16.1 


223 


2 Kucharovice 


15.1 


219 


3 Brno 


15.3 


212 


4 Olomouc 


15.4 


208 


5 Praha 


15.7 


202 


6 Hradec Králové 


14.9 


203 


7 Doksany 


148 


190 



> 1 0% smaller in northern than southern areas. 
There was a highly significant regression of 
arcsin transformed percentage of black-banded 
morph on average sunshine hours of the near- 
est meteorology station (bg= 53.89, b^ = 0.5959, 
b = 0.00155, R2= 0.3817, p< 0.001). 



BAND COLOR POLYMORPHISM IN CEPAEA VINDOBONENSIS 



137 



DISCUSSION 

This study demonstrates a latitudinal trend in 
the frequency distribution of shell banding 
morphs of C. vindobonensis near the edge of 
its range. It confirms, in more detail, the earlier 
finding that shells are all dark-banded at the 
northwestern extreme of distribution (Schilder 
& Schilder, 1957; Honek, 1995b), whereas more 
southerly populations contain proportions of 
brown or pale-banded individuals. Where 
polymorphism is usual (Moravia, south of 
49°10'N), populations living in open, grassy 
habitats are more likely to include pale morphs, 
and to hold them at higher frequencies, than 
those in dense stands of forbs. The frequency 
of black-banded forms also increases with 
altitude, although this is a much smaller trend, 
and the range of altitude slight. 

These trends all suggest the operation of cli- 
matic selection in response to both macro- and 
microclimatic differences. However, some prob- 
lems should be discussed before such a con- 
clusion is accepted. Over the whole range of 
the species, the effects of local microclimatic 
differences seem to be more consistent than 
any response to regional macroclimates. Thus, 
pale morphs are rare in northern Italy (Sacchi, 
1984), but abundant in some populations of the 
Balkan Peninsula. In Croatia, populations in 
valley bottoms subject to temperature inver- 
sions are black-banded, whereas those on 
insolated slopes nearby have up to 50% of pale- 
banded shells (Jones, 1973, 1974). Asimilar as- 
sociation, reinforced by altitude, was found in 
northern Greece (Staikou, 1999). Only in one 
study in Romania was no association found 
(Jones, 1975). 

In the closely related C. nemoralis and С 
hortensis, there is also evidence for climatic 
selection (Jones, 1973; Vicario et al., 1988; 
Stine, 1989). In these species, however, sys- 
tematic differences between regions of con- 
trasting climate are clearer than associations 
with local microclimates (Cook, 1998). There 
exist large-scale geographic trends between 
shell color (Jones, 1973; Jones et al., 1977) or 
body color (Cowie & Jones, 1985) and local cli- 
mate. Studies of shell color (e.g., Falniowski et 
al., 1993; Gardner et al., 1995) or body color 
(Cowie, 1990) of other species also demon- 
strated association between climate and snail 
color. 

Local differences in morph frequencies as- 
sociated with habitats are more usually ac- 



counted for as a product of visual selection for 
crypsis by predators (Cain & Sheppard, 1954; 
Cook, 1998). In this context, there is, as yet, no 
direct evidence on the selectiveness of préda- 
tion on С vindobonensis. It is worth noting, 
however, that at the northwestern extremity of 
its range, black-banded shells dominate in popu- 
lations confined to open grassy habitats, 
whereas further south, they are most frequent 
in shadier places, and decline in the open habi- 
tats. This is not consistent with strong selec- 
tion for crypsis, but it is with climatic selection. 

Genetic drift and the history of colonization 
may also be significant, especially in small iso- 
lated or marginal populations (Honek, 1995a; 
Cameron et al., 1998). Monomorphy of marginal 
populations (e.g., in Bohemia) could derive from 
small founding populations. 

Studies on the possible mechanisms of cli- 
matic selection, however, strengthen the case 
for its operation in this case. In other species, 
variation in thermal equilibria and/or rate of heat- 
ing in sunshine is related to the degree of mela- 
nism in the shell (Etter, 1 988; Honek, 1 993), and 
such morphs may also differ in resistance to 
desiccation (Arad et al., 1993a, b). There is 
evidence that this applies to С vindobonensis. 
The thermal equilibrium of the black-banded 
morph under sunshine has twice been shown 
to be about 1°C higher than that of paler mor- 
phs (Jones, 1973; Staikou, 1999), and in the 
latter case, the rate of desiccation in the black- 
banded morph was also higher. In Staikou's 
study, however, differences between popula- 
tions were greater than differences between 
morphs. Other factors clearly affect the bal- 
ance, and help to explain why local differences 
in the proportion of morphs are more consis- 
tent than regional ones. 

The consequences of these differences need 
further study. Snails are generally nocturnal 
(Bailey, 1981; Blanc et al., 1989; Lorvelecetal., 
1991 ), as is С vindobonensis, with activity usu- 
ally ceasing in the morning, later in pale-banded 
individuals than in those with dark bands 
(Staikou, 1999). We have no evidence to dis- 
tinguish between selection due to increased 
activity of dark forms under cool conditions and 
that due to superior survival of pale forms un- 
der insolation (Jones, 1 974). Resting snails are 
sometimes exposed to direct sun when resting 
on plants, rocks or walls. Despite these gaps 
in our knowledge, the evidence overall indicates 
that climate has a strong influence on visible 
variation in this snail. 



138 



HONEK 



ACKNOWLEDGEMENT 

I thank R. A. D. Cameron for helpful comments, 
particularly very important improvement of the 
discussion, and perfection of the English. 

LITERATURE CITED 

ANONYMOUS, 1958, Atlas Podnebi Cesko- 
slovenske Republiky (Atlas of the Climate of 
Czecfioslovakia). Sprava Geodesia a Karto- 
grafie, Praha. 

ANONYMOUS. 2001 , Statistical Yearbook oftfie 
Czech Republic 2001. Cesky Statisticky Urad, 
Praha, 

ARAD, Z., S. GOLDENBERG, T. AVIVI & J. 
HELLER, 1993a, Intraspecific variation in 
resistance to desiccation in the land snail 
Theba pisana. International Journal of 
Biometeorology, 37: 183-189. 

ARAD, Z., S. GOLDENBERG & J. HELLER, 
1993b, Intraspecific variation in resistance to 
desiccation and climatic gradients in the 
distribution of the bush-dwelling land snail 
Trochoidea simulata. Journal of Zoology, 229: 
249-265. 

BAILEY, S. E. R., 1981, Circa annual and 
circadian rhythms in the snail Helix aspersa 
and the photoperiodic control of annual activity 
and reproduction. Journal of Comparative 
Physiology, 142: 89-94. 

BLANC, A., R. PUPIER & B. BUISSON, 1989, 
Evolution en laboratoire du cycle d'activité de 
deux mollusques gastéropodes {Helix pomatia 
L. et Helix aspersa Müller) en situation de 
cohabitation sous différentes photoperiodes. 
Hal lotis. 19: 11-21. 

CAIN, A. J. & R M. SHEPPARD, 1954, Natural 
selection in Cepaea. Genetics. 39: 89-116. 

CAMERON, R. A. D., R. W. ARNOLD, P J. DILLON 
& L. JAMES, 1998, Cepaea nemoralis (L.) in 
the Channel Islands: island histories and 
genetic variation. Journal of Molluscan 
Studies, 64: 161-172. 

COOK, L. M., 1998, A two-stage model for 
Cepaea polymorphism. Philosophical Trans- 
actions of the Royal Society of London B, 353: 
1577-1593. 

COWIE, R. H. & J. S. JONES, 1985, Climatic 
selection on body color in Cepaea. Heredity, 
55: 261-267. 

COWIE, R. H., 1990, Climatic selection on body 
color in the land snail Theba pisana (Pulmo- 
nata: Helicidae). Heredity, 65: 123-126. 

ETTER, R. J., 1988, Physiological stress and 
color polymorphism in the intertidal snail 
Nucella lapillus. Evolution, 42: 660-680. 

FALNIOWSKI, A., A. KOZIK, M. SZAROWSKA, M. 
RAPALA-KOZIK & I. TURYNA, 1993, Morpho- 
logical and allozymic polymorphism and 
differences among local populations in 
Bradybaena fruticum (O.F.Müller, 1777) 
(Gastropoda: Stylommatophora: Helicoidea). 
Malacologia, 35: 371-388. 



GARDNER, M. G, R B. MATHER, I. WILLIAMSON 
& J. M. HUGHES, 1995, The relationship be- 
tween shell-pattern frequency and microhabi- 
tat variation in the intertidal prosobranch, 
Clithon oualaniensis (Lesson). Malacologia, 
36: 97-109. 

HONEK, A., 1993, Melanism in the land snail 
Helicella candicans (Gastropoda, Helicidae) 
and its possible adaptive significance. 
Malacologia, 35: 79-87. 

HONEK, A., 1995a, Geographic distribution and 
shell color banding polymorphism in marginal 
populations of Cepaea nemoralis (Gas- 
tropoda, Helicidae). Malacologia, 37: 111-122. 

HONEK, A., 1995b, Distribution and shell color 
and banding polymorphism of the Cepaea spe- 
cies in Bohemia (Gastropoda, Helicidae). Acta 
Societatis Zoologicae Bohemicae, 59: 63-77. 

JONES, J. S., 1973, Ecological genetics and 
natural selection in molluscs. Science, 182: 
546-552. 

JONES, J. S., 1974, Environmental selection in 
the snail Cepaea vindobonensis in the Lika 
area of Yugoslavia. Heredity, 32: 165-170. 

JONES, J. S., 1975, The genetic structure of some 
steppe populations of the snail Cepaea 
vindobonensis (Pf.). Genetics, 45: 217-225. 

JONES, J. S., B. H. LEITH & R RAWLINGS, 1977, 
Polymorphism in Cepaea. a problem with too 
many solutions? Annual Review of Ecology and 
Systematics, 8: 109-143. 

KERNEY, M. R & R. A. D. CAMERON, 1999, 
Escargots et Limaces d'Europe. Delchaux et 
Niestlé, Lausanne, Paris. 

LISICKY M., ^99^, Molluscs of Slovakia [Mollusca 
Slovenska]. Veda, Bratislava. 

LORVELEC, O., A. BLANC, J. DAGUZAN, R. 
PUPIER & B. BUISSON, 1991, Etude des 
activités rythmiques circadiennes (locomotion 
et alimentation) d'une population bretonne 
d'escargots Helix aspersa Müller en 
laboratoire. Bulletin de la Société Zoologique 
de France 116' 15-25 

LOZEK, V., Î956, Key of Czechoslovak Mollus- 
ca [Klic ceskoslovenskych mekkysu]. Vydava- 
telstvo Slovenskej Akademie Vied, Bratislava. 

SACCHI, С R, 1984, Population ecology of 
Cepaea nemoralis and С vindobonensis along 
the north Adriatic coasts of Italy. Malacologia, 
25: 315-323. 

SCHILDER, R A. & M. SCHILDER, 1953, Die 
Bänderschnecken. Eine Studie zur Evolution 
der Tiere. Gustav Fischer Verlag, Jena. 

SCHILDER, R A. & M. SCHILDER, 1957, Die 
Bänderschnecken. Eine Studie zur Evolution 
der Tiere. Schluss: Die Bänderschnecken 
Europas. Gustav Fischer Verlag, Jena. 

STAIKOU, E. A., 1998, Aspects of life cycle, popu- 
lation dynamics, growth and secondary produc- 
tion of the pulmonate snail Cepaea vindo- 
bonensis (Férussac, 1821) in northern Greece. 
Journal of Molluscan Studies, 64: 297-308. 

STAIKOU, E. A., 1999, Shell temperature, activ- 
ity and resistance to desiccation in the poly- 
morphic land snail Cepaea vindobonensis. 
Journal of Molluscan Studies, 65: 171-184. 



BAND COLOR POLYMORPHISM IN CEPAEA VINDOBONENSIS 



139 



STATSOFT, 1994, Statistica for Windows (Vol- 
ume I): General Conventions and Statistics I. 
StatSoft, Inc., Tulsa. 

ST! NE, О. С, 1989, Cepaea nemoralisUovn Lex- 
ington, Virginia: the isolation and charac- 
terization of their mitochondrial DMA, the 
implications for their origin and climatic selec- 
tion. Malacologie, 30: 305-315. 

VICARIO, A., L. I. MAZON, A. I. AGUIRRE, A. 
ESTOMBA & С M. LOSTAO, 1988, Variation 
in populations of Cepaea nemoralis (L.) in 
North Spain. Biological Journal of the Linnean 
Society, 35: 217-227. 

ZIMMERMANN, F., 1919, Untersuchungen über 
die Häufigkeit verschiedener Bändervari- 
ationen von Tachea nemoralis L., T hortensis 
Müll, und T. austriaca Mühlf. Verhandlungen 
des Naturforschenden Vereins in Brtjnn, 66: 
105-116. 



Revised ms. accepted 17 September 2002 



APPENDIX 

Proportion of shell-band color morphs at lo- 
cal С. vindobonensis populations considered 
in this study. For each locality the information 
is provided as: 

Nearest village (geographic latitude of the col- 
lection site [degrees and minutes N], geo- 
graphic longitude [degrees and minutes E], 
altitude [m above sea level], black-banded [no. 
individuals]-brown-banded [no. individuals]- 
faint-banded [no. individuals]) 

Localities in Moravia 

Lanzhot (4843, 1658, 160, 4-3-1); Úvaly 
(4844, 1642, 230, 6-10-12); Úvaly (4844, 
1642, 220, 21-21-12); Hevlín (4846, 1626, 
1 80, 7-10-2); Naceratice (4848, 1 606, 230, 5- 
0-0); Suchovské MIyny (4848, 1 735, 360, 7-0- 
0); Zajecí (4853, 1647, 220, 5-3-0); Stráznice 
(4853, 1723, 180, 14-0-0); Cejkovice (4855, 
1655, 270, 4-3-6); Troskotovice (4855, 1625, 
190, 5-8-11); Hustopece (4855, 1644, 200, 9- 
6-0); Kurdèjov (4856, 1646, 250, 8-7-3) 
Horní Bojanovlce (4857, 1647, 200, 1-8-1) 
Vlasatice (4857, 1628, 180, 10-10-36) 
Vlasatice (4857, 1628, 180, 20-41-55) 
Hovorany (4857, 1700, 220, 15-1-0) 
Hostèradice (4857, 1615, 220, 20-5-0) 
Pouzdfany (4858, 1638, 180, 7-7-10); Mistfín 
(4858, 1705, 200, 14-1-0); Bzenec (4858, 
1717, 190, 8-1-0); Brumovice (4858, 1654, 
200, 62-7-0); Morasice (4858, 1613, 270, 26- 
0-0); Diváky (4900, 1649, 220, 10-23-7); 



Cvrcovlce (4900, 1632, 180, 47-37-8); 
Zeravice (4900, 1715, 230, 25-4-0); 
Olbramovice (4900, 1623, 220, 13-0-0); Hluk 
(4900, 1731, 240, 7-0-0); Zidlochovice 
(4902, 1636, 180, 28-13-3); Jezefany (4902, 
1626, 220, 6-2-0); Lodènice (4902. 1628, 
200, 4-3-0); Zeletice (4902, 1 700, 1 90, 48-5- 
0); Archiebov (4903, 1703, 200, 14-7-1); 
Trbousany (4903, 1627, 210, 18-11-1); 
Blucina (4903, 1640, 200, 6-12-2); 
Hrusovany u Brna (4903, 1635, 220, 28-13- 
3); Némcicky (4903, 1630, 190, 81-13-5); 
Násedlovice (4903, 1658, 190, 25-2-0); 
Moravsky Krumlov (4903, 1620, 260, 23-0- 
0); Lovcice (4904, 1703, 240, 5-14-2); 
Bohuslavice (4904, 1708, 210, 55-6-4); 
Bohuslavice (4904, 1708, 210, 30-9-0); 
Rokytná (4904, 1620, 270, 40-0-0); Otnice 
(4905, 1650, 230, 15-14-3); Zdánice (4905, 

1702, 230, 18-0-0); Moheino (4906, 1611, 
360, 14-0-0); Rasovice (4907, 1653, 240, 64- 
5-0); Silüvky (4908, 1628, 280, 32-42-9); 
Nesovice (4908, 1705, 240, 61-3-0); 
Brankovice (4908, 1708, 260, 26-8-0); 
Vícemilice (4908, 1702, 230, 31-25-0); 
Krizanovice (4909, 1656, 230, 40-2-0); 
Slavkov (4909, 1653, 220, 80-4-0); Hajany 
(4909, 1634, 260, 11-6-0); Nesovice (4909, 

1703, 260, 69-9-0); Bucovice (4909, 1659, 
220, 126-15-0); Slavkov (4909, 1652, 220, 
10-0-0); Milonice (4910, 1705, 260, 38-2-0); 
Lísky (4910, 1714, 320, 63-0-0); Napajedla 
(4910, 1731,210, 18-0-0); Rost'outky (4911, 
1703, 290, 51-1-0); Kozlany (4911, 1702, 
310, 24-0-0); Strabenice (4912, 1714, 320, 
42-8-3); Rost'outky (4912, 1703, 270, 19-3- 
0); Holublce (4912, 1650, 280, 19-4-0); 
Rousinov (4912, 1653, 250, 26-8-0); 
Rousínov (4913, 1653, 270, 24-2-0); 
Zdounky (4914, 1717, 230, 22-2-0); 
Morkovice (4914, 1714, 280, 19-2-0); 
Kvasice (4914, 1730, 200, 8-4-0); Skrzice 
(4915, 1720, 210, 16-1-0); Netcice (4915, 
1717, 240, 61-4-0); Rosténice (4915, 1658, 
260, 5-8-0); Zborovice (491 5, 1 71 6, 260, 30- 
0-0); Vyskov (4917, 1701, 240, 49-0-0); 
Heroltlce (4918, 1704, 240, 18-2-0); Tésice 
(4918, 1710, 210, 60-0-0); Pustimér (4919, 
1702, 290, 44-7-1); Krenovice (4919, 1715, 
200, 48-2-0); Dfevnovice (4920, 1709, 240, 
27-36-2); Nezamysiice (4920, 1 800, 250, 64- 
4-0); Zelec (4921, 1704, 340, 121-15-0); 
Tisnov (4922, 1623, 290, 44-22-0); Brodek u 
Prostèjova (4921, 1705, 290, 64-0-0); 
Brodek u Prostèjova (4922, 1 705, 280, 22-0- 
0); Pivín (4923, 1710, 280, 20-2-0); 
Poikovice (4923, 1719, 200, 74-0-0); 



140 HONEK 

Vranovice (4924, 1706, 250, 11-0-0); Henclov 
(4926, 1723, 200, 17-1-0); Prostéjov (4930, 
1705, 240, 24-5-0); Kostelec na Hané (4930, 
1704, 250, 30-7-0); Zdètin (4930, 1659, 350, 
13-0-0); Ptení (4930, 1658, 340, 14-0-0); 
Celechovice (4931, 1706, 280, 11-15-0); 
Celechovice (4931, 1704, 280, 14-0-0); 
Smrzice (4931, 1709, 250, 45-0-0); Blatec 
(4932, 1715, 230, 57-0-0); Blatec (4932, 1715, 
230, 51-0-0); Slatinice (4933, 1 706, 250, 28-0- 
0); Cechy pod Kosírem (4933, 1701, 290, 18- 
0-0); Péncín (4934, 1701, 330, 11-0-0); 
Olomouc (4935, 1717, 210, 17-0-0); 
Drahanovice (4935, 1705, 250, 53-0-0); 
Ludérov (4935, 1703, 280, 25-0-0); Ludérov 
(4935, 1703, 330, 25-0-0); Cholina (4940, 
1702, 270, 26-0-0); Bílá Lhota (4946, 1658, 
290,16-0-0) 

Localities in Bohemia 

Mala Lecice (4950, 1422, 280, 10-0-0); 
Srbsko (4957, 1408, 260, 39-0-0); Karlstejn 
(4957, 1410, 260, 1 7-0-0); Vysoké Myto (4957, 
1610, 270, 20-0-0); Kostenice (5000, 1554, 
240, 20-0-0); Uhersko (5000, 1602, 240, 20-0- 
0); Platenice (5001, 1557, 240, 20-0-0); Praha 
(5002, 1420, 300, 40-0-0); Dasice (5002, 
1556, 230, 20-0-0); Hradcany (5009, 1517, 
250, 20-0-0); Podmoráñ (5010, 1420, 290, 24- 
0-0); Blsany (5014, 1327, 280, 15-0-0); 
Mécholupy (501 6, 1 333, 290, 1 5-0-0); Veltrusy 
(5016, 1420, 180, 20-0-0); Kly (5018, 1433, 
220, 60-0-0); Nova Ves (5020, 1418, 200, 20- 
0-0); Roudnice (5025, 1417, 210, 9-0-0); Rana 
(5025, 1347, 380, 40-0-0); Libochovice (5026, 
1403, 170, 11-0-0); Charvatce (5026, 1348, 
350, 25-0-0); Charvatce (5026, 1349, 330, 25- 
0-0); Stétí (5027, 1423, 170, 20-0-0); Vrbice 
(5028, 1417, 160, 36-0-0); Chcebuz (5029, 
1423, 230, 72-0-0); Vrutice (5030, 1417, 160, 
20-0-0); Polepy (5031 ,1419, 160, 20-0-0) 



MALACOLOGIA, 2003, 45(1): 141-148 

KARYOTYPES OF EUROPEAN SPECIES OF RADIX 

(GASTROPODA: PULMONATA: LYMNAEIDAE) 

AND THEIR RELEVANCE TO SPECIES DISTINCTION IN THE GENUS 

Alexandr V. Garbar^ & Alexei V. Korniushin^* 

ABSTRACT 

Karyotypes of Radix auhcularia (Linnaeus, 1758) and three disputable taxa considered by 
different authors as distinct species or assigned as forms of Radix peregra (IVIüller, 1774), 
sensu lato - R. labiata (Rossmässler, 1835), R. baltiiica (Linnaeus, 1758), and R. ampia 
(Hartmann, 1821) - were studied with preparations obtained from gonad tissues by the air- 
drying method. The studied taxa have the same diploid number (2n = 34), but are character- 
ized by different morphology of some chromosome pairs. In particular, R. labiata (traditionally 
identified as R. peregra. s. s.) and R. balthica (= R. ovata in traditional understanding) differ 
in the number of subtelocentric chromosomes (1 and 5, respectively), species status of 
these taxa being also supported by pronounced differences in centomeric indexes of chro- 
mosome pairs 4 and 16. Species distinctness of R. ampia is supported by differences in 
three chromosome pairs, and karyological similarity between this taxon and R. balthica is 
also noted. FN values varied among the studied taxa from 56 in R. ampia to 66 in R. labiata. 
The known karyological characters are traced on phylogenetic trees suggested by recent 
molecular reconstructions. This study demonstrates that karyology can be an effective tool 
for aiding taxonomic distinctions of historically problematic groups of molluscs. 

Key words: Radix, karyotypes, taxonomy, species distinctions. 



INTRODUCTION 

The group of lymnaeid species bearing the 
name Radix Montfort, 1810, is defined mainly 
by its thin-walled fragile shell with a relatively 
large aperture (Falkner, 1990; Glöer & Meier- 
Brook, 1998; Jackiewicz, 1998; Glöer, 2002). 
The distinctive karyological character of Radix, 
namely its chromosome number (n = 17) devi- 
ating from the other members of the family (typi- 
cally n = 18, or in some taxa n = 16 or 19), has 
also been known for a long time (Inaba, 1969; 
Choudharyetal., 1992). 

Despite intensive research by different meth- 
ods (Hubendick, 1951; Inaba, 1969; Patterson 
& Burch, 1978; Kruglov & Starobogatov, 1983, 
1 993; Remigio & Blair, 1 997; Jackiewicz, 1 998; 
Bargues et al., 2001), many taxonomic prob- 
lems of Radix remain unresolved. In particular, 
the rank of the group is alternatively defined as 
subgeneric within Lymnaea (Hubendick, 1 951 ; 
Kruglov & Starobogatov, 1983, 1993; 
Jackiewicz, 1998; Kerney, 1999) or generic 



(Patterson & Burch, 1 978; Falkner, 1 990; Glöer 
& Meier-Brook, 1998; Bargues et al., 2001; 
Falkner et al., 2002). A distinct subgenus 
Pereghana was recognized in Lymnaea along- 
side Radix by Kruglov & Starobogatov (1983). 
Still uncertain also is the number of species 
within this group. Stressing the lack of distinc- 
tive anatomical characters and existence of in- 
termediate shell morphotypes, British (Kerney, 
1999) and Polish (Jackiewicz, 1998) authors 
recognized only two European species, namely 
Lymnaea (Radix) auriculaha (Linnaeus, 1758) 
and L. (R.) peregra (Müller, 1 774), distinguish- 
ing in the latter up to four ecological forms: L. 
peregra s. s. (= f. typica, sensu Jackiewiecz, 
1998), f. ovata (Draparnaud, 1805), f. lagotis 
(Schrank, 1803), and f. ampia (Hartmann, 
1821). Evidence for species distinctness of 
Radix ovata was provided by Glöer & Meier- 
Brook (1998), whereas Falkner (1990) also rec- 
ognized R. ampia as a full species. Five 
European taxa are supported by recent molecu- 
lar studies (Bargues et al., 2001 ) and have been 



'Department of Natural Sciences, Zhitomyr Pedagogical Institute, I. Franko Str., Zhitomyr, Ukraine 

-1.1. Sctimalhausen Institute of Zoology, The National Academy of Sciences, B. Khmelnitsky Str. 15, 01601 Kiev, Ukraine 

'Corresponding auttior: root@iz.freenet.kiev.ua 



141 



142 



GARBAR &K0RNIUSH1N 



Od 



11 

'- (Л 

"о (Л 
. 0) 

о t" 



X! 


оо 




CD 


X) 


СО 


Ф 




Ъ 


■ 


_2 


ГО 


"(Л 


JD 



¿О 



£^0 

■D "-^ 

3 ГО 
(Л ^ 

"со го 
¿О 



тз ^^ 

2 го 

(Л хз 
"со го 



ел 2 



о 



W 



(Г 



-2 
"3 
о 

с 

CD 
03 
О) 
CD 

с 
Б 



го 
^ --^ 

го "5 

^^ 

¿CD 
О) г: 

^ч 

го> 

(Л !- 

с > 

.iE 
> 



о (Л 



CD N 

*-; ^ .у .у 
о о 9- 5 

CD CD .^ 

m "^ о 

CD m CD го 
05 D) Di ' 

ï s 9Í ^ 

Q) CD 0) с 
Q. C5. Ci. 03 

ce ~J ~J 



QC 



CD i^ 

^ w 

-Q СЛ 

CD О 



a: 



a: 



N > 

^' -e E 
^ о - 

о ^ 



о .0^ 



s го CD Ol -, 

^ Q--ÎD £ Й 

> 2 > CD с 

о Q о Cl Ol 

ce -1 -J 



5: CD 



Ф 
d) T3 

I- 3 

ф Ф 
> > 

ir ir 



el 

О ГО 



N 



S 5 

CD ^ 



CD С 
Ci. CD 



ce 



CD ro 
CD -j- 



T3 

Ф 

Ф 



KARYOTYPES OF EUROPEAN RADIX 



143 



included as species in the latest European 
checklists (Falkner et al., 2002; Glöer, 2002) 
with the following names: Radix auhcularia, R. 
labiata (Rossmässler, 1835) (substituting R. 
peregra, s. s. of previous authors), R. balthica 
(Linnaeus, 1758) (= R. peregra of Müller, = R. 
ovata. auctt.), R. ampia, and R. lagotls. An even 
more profound subdivision was suggested by 
Kruglov & Starobogatov (1983, 1993) but not 
supported by any of the later studies. 

Until now, chromosome numbers were 
mainly involved in discussions about taxonomy 
and relationships among freshwater gastro- 
pods. However, interspecific differences in chro- 
mosome morphology were recently found in 
Viviparus (Barsiene et al., 2000). Furthermore, 
preliminary investigations of Garbar (1998, 
2000) on Radix and on Stagnicola (Garbar & 
Korniushin, 2002) have shown that morphologi- 
cal characters of chromosomes may be also 
helpful by species distinction in lymnaeids. This 
paper summarizes results of karyological in- 
vestigation in four European taxa of Radix, des- 
ignated in modern reviews as R. auhcularia, R. 
labiata, R. balthica and R. ampia. 










FIG. 1. Shells of the studied species: A. Radix 
auhcularia (Linnaeus, 1758); B. R. labiata (Ross- 
mässler, 1835); С. R. balthica (Linnaeus, 1758); 
D. R. ampia (Hartmann, 1821). Scale bar, 5 mm. 



MATERIAL AND METHODS 

Material was collected by the first author in 
1997-2000 in western and central Ukraine 
(Table 1 ). In order to minimize the influence of 
local factors, each species was sampled in two 
remote (at a distance of at least 1 50 km) locali- 
ties; the sampled populations inhabit different 
river systems (of the Danube, Yuzhny Bug, and 
Dnieper drainages) and live under somewhat 
different climatic conditions. Some populations 
included in the earlier karyological studies 
(Garbar, 1998, 2000) were re-sampled. Species 
identification was based on traditional concho- 
logical and anatomical characters (Glöer & 
Meier-Brook, 1998; Jackiewicz, 1998). The 
studied group is treated in our work as a genus 
and the studied forms as species, following the 
latest systematic and phylogenetic works 
(Remigio & Blair, 1997; Bargues et al., 2001; 
Falkner et al., 2002). Nomenclature of the latest 
European monographic review (Glöer, 2002) is 
used herein; in order to avoid misunderstanding, 
we provide the list of the studied taxa with syn- 
onyms used in the cited publications (Table 1 ). 

Pictures of shells are provided in Figure 1. 
Voucher specimens have been deposited in the 
mollusc collection of the Museum für Natur- 
kunde, Humboldt Universität zu Berlin, Ger- 
many. 

Chromosome preparations were obtained 
from the gonad tissue according to the recom- 
mendations of Barsiene et al. (1 996) and Garbar 
(1998). Molluscs were placed for 17 h in a 
0.002% solution of colchicine. Pieces of gonad 
were fixed in a mixture of ethanol and acetic 
acid (3:1). The cell suspension was prepared 
by maceration in a mixture of concentrated ace- 
tic and 60% lactic acids (30:1) and dispersed 
with a capillar pipette on microscopic slides 
heated at 50°C. Dried preparations were 
stained 10-15 min in 10% solution of azur- 
eosine after Romanovski, prepared on 0.01 M 
phosphate buffer. Stained preparations were 
placed for short time in xylol and embedded in 
Canada Balsam. These preparations were stud- 
ied under a Biolam-L-212 microscope with mag- 
nification 10 x 90. The plates with a good 
dispersion of chromosomes and moderate de- 
gree of spiralization were selected for photo- 
graphing and measuring. The relative length and 
centromeric index were then calculated for 
each chromosome. Chromosomes were clas- 
sified according to Levan et al. (1 964). The Fun- 
damental Number (FN) was calculated as the 
number of autosome arms in haploid comple- 
ment, with a value of 4 given to metacentric and 



144 



GARBAR &KORNIUSHIN 



submetacentric chromosomes, and a value of 
2 to subtelocentric chromosomes (no telocen- 
tric chromosomes were found in the studied 
taxa). Quantitative data from the most numer- 
ous samples were processed statistically us- 
ing standard methods. 



RESULTS 

Descriptions of Karyotypes 

Radix auhcularia. 2n = 34. Chromosomes of 
adjacent pairs similar in size, their relative length 
varies between 9.21% and 4.15% (Table 2). 
Karyotype includes 11 pairs of metacentric, four 
pairs of submetacentric, and two pairs of 






4v 



в 



t ■ -V — A ^ < 

|C M n MVn Э! II it 
II II IÄ II »^ *« »^ •» с 
>i|l li II II «^^ IX It ti 



il jkt 1Я ift it • « «• «> D 

10mkm 




FIG. 2. Chromosomes of Radix auhcularia: 
A. Mitotic metaphase of a specimen from Zhito- 
myr; B. The same of a specimen from Vinnitsa; 
C, D. Karyotypes of specimens from Zhitomyr and 
Vinnitsa region, respectively; E. Ideogram (based 
on data from Table 2). Scale bar, 10 ¡.im. 



subtelocentric chromosomes (Fig. 2, Table 2). 
FN = 64. 

Radix labiata. 2n = 34. Chromosomes of ad- 
jacent pairs similar in size, with relative length 
between 9.69% and 3.74% (Table 2). Karyotype 
includes 12 pairs of metacentric, four pairs of 
submetacentric, and one pair of subtelocentric 
chromosomes (Fig. 3, Table 2). FN = 66. 

Radix balttiica. 2n = 34. Chromosomes of 
adjacent pairs similar in size, with relative length 
between 9.29% and 3.95% (Table 2). Karyotype 
includes eight pairs of metacentric, four pairs 
of submetacentric, and five pairs of subtelo- 
centric chromosomes (Fig. 4, Table 2). FN = 58. 

Radix ampia. 2n = 34. Chromosomes of ad- 
jacent pairs similar in size, with relative length 
of chromosomes between 9.32% and 4.05% 
(Table 2). Karyotype includes eight pairs of 
metacentric, three pairs of submetacentric, and 
six pairs of subtelocentric chromosomes (Fig. 
5, Table 2). FN = 56. 









в 



|{ IS 51 IX и è% ИЪ ?.П IX 

XX 1Л НХ 4« Mi хж «• кл С 

И il il и и ии I&II 

S8 Ü ШХ «« *• It «s *« О 

10 mkm 



10 



¡Вопив 



FIG. 3. Chromosomes of Radix labiata: 
A, B. Mitotic metaphases of specimens from 
Zhiomyrand Vorokhta, respectively; C, D. Karyo- 
types of specimens from Zhitomyr and Vorokhta, 
respectively; E. Ideogram (based on data from 
Table 2). Scale bar, 10 цт. 



KARYOTYPES OF EUROPEAN RADIX 



145 



Comparisons 

All studied taxa are characterized by the same 
chromosome number (2n = 34). Morphological 
similarity is demonstrative also in some Indi- 
vidual chromosome pairs, that is, pairs 1 , 3, 5, 
7, 9, 11, 12 and 15, belonging to one and the 
same type in all these taxa. On the other hand, 
distinctive features of chromosome morphol- 
ogy were noted not only for the doubtless spe- 
cies Radix auhculaha, but also for three taxa of 
disputable status - R. labiata, R. balthica, and 
R. ampia. The karyotype of R. labiata (= R. 
peregra, aucff.) differs from that of R. balthica, 
and R. ampia in morphological type in seven to 
nine pairs. The higher rate of subtelocentric 
chromosomes in two latter species (five to six 
out of 17 pairs) is also reflected in the lower 
values of FN (58 and 56, respectively), com- 



pared to FN of R. labiata (66). In some cases, 
such as in the pairs 2, 6, and 13, mean values 
of centromeric indexes in the compared spe- 
cies were close (Table 2), and assignment of 
chromosomes to different types might be influ- 
enced by individual variation. However, that was 
not the case in chromosome pairs 4 and 16, 
for which interspecific differences were the most 
pronounced. Taking into account that chromo- 
somes adjacent to the mentioned pairs in the 
ideograms (Figs. 2-5) were morphologically 
similar among the studied taxa, we conclude 
that observed differences could not be caused 
by errors in identification of individual chromo- 
somes. Therefore, they are further referred to 
as taxonomic characters. 

Similarity in chromosome morphology be- 
tween R. labiata and R. auriculaha is notewor- 
thy: only two pairs (4 and 6) were assigned to 






«f -^%% 



^ % 



* 
'*^-* 






- -r^ Ч в 



Il II Ы П II II &| H II 

<| «А Ai К% tS Ле !• кА С 

Il IX П Ы 11 11 П 11 II 




FIG. 4. Chromosomes of Radix balthica: 
A, B. Mitotic metaphases of specimens from 
Olevsk and Kiev, respectively; C, D. Karyotypes 
of specimens from Olevsk and Kiev, respectively; 
E. Ideogram (based on data from Table 2). Scale 
bar, 10 |.im. 



^ « A •• • «^ В 

^i и Ч n K}i II XI M »ä 

** 'Ä 141 »# К« Hh til л* с 

Il >1 IUI II II II II }| 

Il It Cl II II II li «f D 



10 mkm 




FIG. 5. Chromosomes of Radix ampia: 
A, В. Mitotic metaphases of specimens from 
Zhitomyr and Kharkiv, respectively; C, D. Karyo- 
types of specimens from Zhytomyr and Kharkiv, 
respectively; E. Ideogram (based on data from 
Table 2). Scale bar, 10 цт. 



146 



GARBAR &KORNIUSHIN 



il 

щ 

<D Е 
Ф СО 

Е-Й 
I £ 

Еш 

«_• 

Фи: 
|-° 

о с 
Й го 

g¿ 
ЕЕ 
•со 

¿•1 
ON 

■Il 

ro*t 

о CD 

"I 
ся -Q 

Í5-S 

ill 
с ф 

.st 

> Ф 
ф > 
Q(f 

'S L.- 
CO >» 

■? ^ 

wß 

Q| 
w 2 

_4— 

X CO 

T3 CO 
.2 g 

E^ >■ 

H g '- 
с tt3 о; 

фСС ,ф 
о ч- I— 

.-° Ф 
О Ф > 
¿ЕСТ 
■Во.' 

ф 2 -^ 

i? о Е 
2ь о 

-j g та 

II 1 

t 1 -о 
ф *- с 

^ (Л 03 
ел о ^' 

Ф -5:: > 
^ ф Oí 

• о о 

CNJ CD . 

Шф с 
-1 Е .2 

ÛQ о СП 
< 3 <^ 



•2 

s 

CD 

ce 



ce 



\- 



О n 



en -H 



о 4i 



a? Q 
_jCO 

q: -h 



?8 

О ^ 



^ Q 



CD 


^9, 


3 
О 




С 


' " 


3 




CD 




et 






^ Q 




_¡(Л 




Cd -H 



Q- 



EfeEwEwEwE^coE'oobEwE 



-c--<--^-^T-T-T--^-^0000-^0^ 
+1 -H +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 



со -^ 



т-ОСЗ^ОСОЮСЛОО-^-^ОООСХ) 
■^CNCOCNJOOOOT-COCNJCOnCMCO 



ooooooooooooooooo 

+1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 -H +1 -H 



СПГ~~-1^СОСОСОСОиПЮ1ЛЮЮ-^'^'^'^'^ 

e£e1?5EÍoE«EE1?5E1?5Ee|Í 



0O0O-^CDCMCNCDr--0OT-CJ)0OCNjT-T3-(M-^ 

h~cor^T-ooT-cöor--oocn-^nh~co-r- 

О-^От-О-^СЭт -O-r-T-Ö-^T-Ö-^-^ 
+1 +1 +1 +1 +1 +1 +1 -H -H -H +1 +1 +1 +1 +1 +1 +1 
COCOinCNjr--Lnr-LnT-CJ)CDr-C7)Ln-^'^00 
CNCO-^CNOCOa)CDOCDCpLnOr^-^OC35 

T-r^OJCNJCri'^cbCNiÖcbcNCDCOun-r-'r-cO 
■^CO-^CNCOCNJ-^CNi-^-^CN-^CNCO-^COCO 



Ю 



ooooooooooooooooo 
+1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 

CJ)r---^T-CJ)COCOr--'^CJ)t^OLnt^CO-^Lr) 
CMOCOOLD-^T-CXDCD-^CNJOCOCD-^CNJCJ^ 

crioot^r^cbcocciLhihihiriLri-^-^-^M-ro 

eeeeeEeíee^e^eeee 



CJ)CDOCJ)CJ)r^'^-^r^ 
CDCJ)OOCDCDOr--OOCD 

сЬсЬсЬсЬсэ-^сэсЬсэ 

+1 +1 +1 +1 +1 +1 -H +1 +1 
т-СЗ^О-г-ЮСХЭСООО-^ 
СХЭЮСО^-СОСОООСЧСГ) 

T-crirocNcoufJcocbcNi 

■^ГО-^'^'^СМ'^СМ'^ 



СХЭГМГ^Г^СМСХЭСОт- 
CDOCDOCNI^COCN 
CD-r-ÖT--^ÖÖ-^ 

+1 +1 +1 +1 +1 +1 +1 +1 

CDCNII^h-OinOCJ) 
OLnCDCNJLrîtn'^OT 
СОСОСОЮСХ)С\1сОСО 
■^CN-^CNJCO'^'^CNJ 



СХЗ C3í Г-- CD ' 

о о о о с 
ööööööcDÖööcböcDcbcböcb 
+1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 

C7)OCOCD■^CNOCNЮC^IЮт-OOC35ЮЮ^Г 
CDOCOOOLD-^CNOr^LnoOOt^incOT-r^ 

cjicor^cDCDCDcûCDaSLhLriLriTj-Tf'^'^co 
EEEÍEoÍE^EEoíÍE^eEEE 



т- CD О) о ^- со (Л 

т- in -^ т- -^ -^ со 

+1 +1 +1 +1 +1 +1 +1 

со г- го со ^- т- о 

см о г^ тг '^ ср СЗ) 

сЬ об c\J 1Г> c\i CD со 

^í со •^ CNJ ■^ т- Tt 



CDCJíCOOO'ÍCOOO-^ 
■^■^CD-^-^-^COCNJ'^ 



+1 +1 +1 +1 +1 +1 +1 +1 +1 



r^■^cooo^ncoю■^cDLOCD^~-cocDLncncJ> 

ГМ-^ООООООООООООСЭОО 

öocbcböööcbcDÖöcbööcboö 

+1 +1 +1 +1 +1 +1 +1 -H -H +1 +1 +1 +1 +1 +1 +1 +1 

т-00C0ЮЮO^Л^-•C^J^ЛЮ^ЛOCD00CDЮ 
CNCOCXJCD-^CO'^Or^LD'^CNlOr^Ln'^T- 

CTit^cbcbcbcbcDLnLriLOLriiriih'^-^-^-^ 



CNCO-^LncDt^OOCD 



о-^смсо-^юсог^ 



KARYOTYPES OF EUROPEAN RADIX 



147 



different types in these two taxa, and values of 
FN were also close. The karyotype of R. ampia 
is close to that of R. balthica, differing in mor- 
phological type of three chromosome pairs; 
presence of one more subtelocentric pair (16) 
is the most characteristic feature of the former 
taxon. 



DISCUSSION 

Diploid numbers of all studied species (2n = 
34) agree well with the published literature on 
the genus Radix (Inaba, 1969; Patterson & 
Burch, 1978; Coudhary et al., 1992; Barsiene 
et al., 1996; Garbar, 1998, 2000). No cases of 
hypodiploidy or polyploidy were observed by our 
study, this result being in contrast with data on 
Spanish populations identified as R. peregra 
(Barsiene et al., 1996). The presence of telo- 
centric (t) chromosomes in the karyotype of R. 
auhcularia from the Zhitomyr population reported 
by Garbar (1998) was also not confirmed by 
this study. In all probability, this work dealt with 
an artifact caused by very profound spiralization 
of chromosomes. At the same time, our present 
observations on R. labiata and R. balthica 
agree with the data of Garbar (2000) on these 
species (for correspondence of nomenclature: 
Table 1 ). The karyotype of R. ampia has been 
studied here for the first time. 

Differences in the chromosome morphology 
(most pronounced in the pairs 4 and 16) sup- 
port species status of R. balthica (= R. ovata) 
and R. labiata (traditionally referred to as R. 
peregra) - two taxa considered conspecific by 
many taxonomists dealing with shell and ana- 
tomical characters (Hubendick, 1951 ; Jackiewicz, 
1998; Kerney, 1999). However, karyological dis- 
tinction between R. labiata and R. balthica 
shown by this study should be checked on the 
representative material taken throughout their 
distributions. Noteworthy, chromosome pair 4 
is apparently of the same type in the karyotype 
of Spanish R. peregra shown by Barsiene et al. 
(1996) and Ukrainian specimens of R. labiata 
included in this study, but similarities/differences 
in other chromosome pairs cannot be evalu- 
ated, because centromeric indexes for the 
Spanish specimens were not provided. 

Species status of R. ampia is also supported 
by this study, but the karyological differences 
between this taxon and R. balthica were appar- 
ently less pronounced than those reported for 
R. balthica and R. labiata. Furthermore, the 
karyotype of L. (Pereghana) fontinalis (Studer, 



1 820), as described by Garbar (2000), is similar 
to that of R. ampia (especially in having 
subtelocentric chromosome pair 16), with mod- 
erate (about 6%) difference in mean values of 
centromeric indexes of chromosome pair 2. This 
result is surprising, because L. fontinalis (in the 
understanding of Russian authors) corresponds 
in its conchological and anatomical characters 
(Kruglov & Starobogatov, 1983: fig. 2, 3; Garbar, 
2000: fig. 1) to f?. balthica of modern western 
European reviewers (Glöer, 2002) and is appar- 
ently different from R. ampia. Thus, correlation 
between chromosome morphology and the other 
characters in the R. balthicalR. ampia complex 
should be checked by further studies. 

The observed pattern of karyological differ- 
ences in Radix is consistent with the phyloge- 
netic trees based on ITS-2 sequences (Bargues 
et al., 2001 ), supporting the following topology 
in the clade of European Radix species (no- 
menclature as used here): {R. labiata, {R. au- 
hcularia, {R. lagotis, R. ampia, R. balthica))). In 
particular, the peculiar karyotype of R. labiata 
and the karyological similarity between R. ampia 
and R. balthica corroborate this phylogenetic 
hypothesis. In particular, the overwhelming 
prevalence of meta- and submetacentric chro- 
mosomes characterizes the basal taxa R. 
labiata and R. auricularia, whereas the high 
number of subtelocentric chromosomes is a 
common feature of R. balthica and R. ampia, 
which belong to the terminal clade. Thus, the 
state of the karyotype of the former may be in- 
terpreted as pleslomorphic, and the latter as 
apomorphic within the analysed group. The re- 
sults of our investigation are also consistent with 
the molecular analysis (Bargues et al., 2001) 
in suggesting, that R. ampia is a valid species 
alongside R. balthica. Neither karyological nor 
molecular characters support the subgenus 
Pereghana of Kruglov & Starobogatov (1983, 
1993) as including, among other species, R. 
labiata, R. balthica, R. lagotis and R. ampia, but 
not R. auricularia. Broad understanding of Lym- 
naea peregra (Jackiewicz, 1998) also contra- 
dicts both data sets. 

The results of this work, as well as earlier 
observations on other freshwater gastropods 
(Barsiene et al., 2000; Garbar & Korniushin, 
2002), show that the study of chromosome 
morphology may provide additional characters 
for species diagnosis and phylogenetic analy- 
sis. Karyological study of Lymnaeidae should 
be continued, given the parasitological impor- 
tance of this group and remaining uncertainty 
about its species-level taxonomy. 



148 



GARBAR &KORNIUSHIN 



ACKNOWLEDGEMENTS 

The authors are grateful to Dr. Valentina 
Manilo (Kiev) for the help by processing and 
interpreting chromosome preparations, and to 
the anonymous reviewers for their helpful cor- 
rections and suggestions on the manuscript. 



LITERATURE CITED 

BARGUES, M. D., M. VIGO, P. HORAK, J. 
DVORAK, R. A. PATZNER, J. P POINTIER, M. 
JACKIEWICZ, С MEIER-BROOK & S. MAS- 
COMA, 2001, European Lymnaeidae (Mol- 
lusca: Gastropoda), intermediate hosts of 
trematodiases, based on nuclear ribosomal 
DNA ITS-2 sequences. Infection, Genetics and 
Evolution, 1: 85-107. 

BARSIENE, J., G TAPIA & D. BARSYTE, 1996, 
Chromosomes of mollusks inhabiting some 
mountain springs of eastern Spain. Journal of 
Molluscan Studies, 62: 539-543. 

BARSIENE, J., G RIBI & D. BARSYTE, 2000, 
Comparative karyological analysis of five spe- 
cies of Viviparus (Gastropoda: Prosobranchia). 
Journal of Molluscan Studies, 66: 259-271. 

CHOUDHURY, R. C, R. K. PANDIT & T SAHU, 
1992, Cromosomes of a freshwater gastropod 
Lymnaea luteola Lamarck (Lymnaeidae, 
Basommatophora). Cytologie (Tokyo), 57 (1): 
143-147. 

FALKNER, G, 1990, Binnenmollusken. Pp. 112- 
280, in: R. FECHTER & G. FALKNER, Weichtiere. 
Europäische Meeres- und Binnenmollusken. 
Steinbachs Naturführer, Mosaik Verlag, 
München. 288 pp. 

FALKNER, G, T E. J. RIPKEN & M. FALKNER, 
2002, Mollusques continentaux de France. 
Liste de référence annotée et bibliographie. 
Publications Scientifiques du Museum National 
d'Histoire Naturelle, Paris. 350 pp. 

GARBAR, A. V., 1998, A karyotype of Lymnaea 
auricularia (Gastropoda, Pulmonata, 
Lymnaeidae) from central Polissya. Vestnik 
Zoologii, 32 (5-6): 137-138 [in Russian, with 
English summary]. 

GARBAR, A. v., 2000, Description of karyotype 
of three species of genus Lymnaea (Gas- 
tropoda, Pulmonata, Lymnaeidae) of the Fauna 
of Ukraine. Vestnik Zoologii, Suppl. 14: 40-47 
[in Russian, with English summary]. 

GARBAR, A. V. & A. V. KORNIUSHIN, 2002, 
Karyotypes of two European species of the 
genus Lymnaea with disputable taxonomic sta- 



tus (Gastropoda: Pulmonata: Lymnaeidae). 
Malakologische Abhandlungen Staatliches 
Museum für Tierkunde Dresden, 20 (1): 235- 
246. 

GLÖER, P., 2002, Mollusca I. Süßwasser- 
gastropoden Nord- und Mitteleuropas. 
Bestimmungsschlüssel, Lebensweise, Ver- 
breitung. ConchBooks, Hackenheim. 327 pp. 

GLÖER, P. & С MEIER-BROOK, 1998, 
Süsswassermollusken. Ein Bestimmungs- 
schlüssel für die Bundesrepublik Deutschland. 
Deutscher Jugendbund für Naturbeobachtung, 
Hamburg. 136 pp. 

HUBENDICK, В., 1951, Recent Lymnaeidae, their 
variation, morphology, taxonomy, nomencla- 
ture, and distribution. Kungliga Svenska 
Vetenskapakademiens Handlingar, 3 (1): 
1-223. 

INABA, A., 1969, Cytotaxonomic studies of 
lymnaeid snails. Malacologia, 7 (2/3): 143-168. 

JACKIEWICZ, M., 1998, European species of the 
family Lymnaeidae (Gastropoda: Pulmonata: 
Basommatophora). Genus, 9 (1): 1-93. 

KERNEY, M. P, ^999, Atlas of the land and fresh- 
water molluscs of Britain and Ireland. Harley 
Books, Great Hockersley, Colchester. 264 pp. 

KRUGLOV, N. D. & Ya. I. STAROBOGATOV, 
1983, A contribution to the morphology and 
taxonomy of European representatives of the 
subgenus Peregriana {Lymnaea, Gastropoda, 
Pulmonata). Zoologicheskij Zhurnal, 62 (10): 
1462-1473 [in Russian, with English sum- 
mary]. 

KRUGLOV, N. D. & Ya. I. STAROBOGATOV, 
1993, Guide to Recent molluscs of northern 
Eurasia. 3. Annotated an illustrated catalogue 
of species of the family Lymnaeidae (Gas- 
tropoda, Pulmonata, Lymnaeiformes) of 
Palaearctic and adjacent river drainage areas. 
Part 1. Ruthenica, 3 (1): 65-92. 

LEVAN, A., K. FREDGA & A. SANDBERG, 1964, 
Nomenclature for centromeric position on 
chromosomes. Hereditas, 52: 201-220. 

PATTERSON, С M. & J. В. BURCH, 1978, 
Chromosomes of pulmonate molluscs. Pp. 
171-217, in: V. FRETTER & J. PEAKE, eds., 
Pulmonales. Vol. 2a. Systematics, evolution 
and ecology. Academic Press, New York, 
London, etc. 540 pp. 

REMIGIO, E. A. & D. BLAIR, 1997, Molecular 
systematics of the freshwater snail family 
Lymnaeidae (Pulmonata: Basommatophora) 
utilising mitochondrial ribosomal DNA 
sequences. Journal of Molluscan Studies, 63: 
173-185. 

Revised ms. accepted 28 December 2002 



MALACOLOGIA, 2003, 45(1): 149-166 

USE OF MICROSATELLITE VARIATION AND RAPD-PCR TO ASSESS 
GENETIC POLYMORPHISM IN BIOMPHALARIA GLABRATA SNAILS 
FROM A SINGLE LOCALE IN A SCHISTOSOMIASIS ENDEMIC AREA 

Christopher Rowe', Wannaporn Ittiprasert^, Carolyn Patterson\ Claudia Eliff\ Kristen 
Page^ Susan Bandoni", Thomas Wilke^ Dennis Minchella^, Fred Lewis^ & Matty Knight'* 

• ABSTRACT 

Genetic variation was assessed in Biomphalaria glabrata snails using variations in 
microsatellite loci and by RAPD-PCR analysis. Populations of snails examined were field- 
collected isolates from a small pond in a schistosomiasis endemic region in Brazil, after 
standard conditions were developed for analyzing snails from two laboratory-maintained 
stocks. The analyses were performed using a total of 60 microsatellite primer sets and, for 
RAPD-PCR, a total of 19 random primers. We show that genetic diversity can readily be 
detected by both molecular methods among the field-collected snails from this small site. 
In addition, RAPD-PCR bands that were found in another study to segregate with parasite 
resistance were not detected in any of the field-collected snails analyzed. 

Keywords: Biomphalaria glabrata, RAPD-PCR, microsatellites, genetic diversity, AMOVA, 
schistosomiasis. 



INTRODUCTION 

Schistosomiasis is a parasitic disease of glo- 
bal significance. Nearly every stage of the 
schistosome's life cycle, which alternately in- 
volves mammalian and snail hosts, has been 
the target for intervention, but often these con- 
trol efforts result in short-term success. 
Although combined efforts to reduce transmis- 
sion, for example by mollusciciding and mass 
chemotherapy, are initially effective, rapid 
recolonization by the snails and reinfection in 
the human population make long-term control 
difficult to achieve. Developing an effective vac- 
cine against schistosomes is a challenging 
task (Bergquist, 1998), making it even more 
important to explore other control measures. 
The strategy of replacing susceptible snails in 
schistosomiasis-endemic areas with parasite- 
resistant snails is a suggested form of 
biological control (Hubendick, 1958). Implemen- 
tation of these control methods and the need to 
better understand the epidemiology of schisto- 
somiasis has stimulated interest in better 



characterizing the population genetic struc- 
tures of both the snail hosts and parasites 
(Bandoni et al., 1990; Johnston et al., 1993; 
Hoffman et al., 1998; Langand et al., 1999; 
Curtis & Minchella, 2000; Sire et al., 2001 ). 

Some degree of genetic diversity in snail field 
populations has been noted using a variety of 
methods, including allozyme analysis, RAPD- 
PCR, and variations in microsatellite loci 
(Bandoni et al., 1990; Vidigaletal., 1994; Jones 
et al., 1999; Bandoni et al., 2000; Mavares et 
al., 2000; Charbonnel et al., 2000). Applying 
RAPD-PCR and microsatellite analysis to 
study snail population structure is relatively 
new, but both methods have found wide use for 
examining the frequency of genotypes in rela- 
tion to disease, genetics and ecology in nu- 
merous species of medical and agricultural 
importance. Over the last several years, how- 
ever, less frequent use has been made of 
multi-locus molecular markers, such as 
RFLPs and RAPDs, than of microsatellites for 
population genetic studies (review: Jarne & 
Theron, 2001 ). This has occurred even though 



'Biomedical Research Institute, 12111 Parklawn Drive, Rockville, Maryland 20852, U.S.A. 

^Department of Microbiology and Immunology, Faculty of Tropical Medicine, Mahidol University, Bangkok, Thailand 

^Wheaton College. Wheaton, Illinois, U.S.A. 

"Department of Biology, SUNY-Geneseo, Geneseo, New York, U.S.A. 

^Department of Microbiology and Tropical Medicine, The George Washington University, Washington, D.C., U.S.A. 

^Department of Biological Sciences, Purdue University, West Lavayette, Indiana, U.S.A. 

'Corresponding author: mknight@afbr-bri.com 



149 



150 



ROWE ET AL. 



RAPD-PCR has some obvious advantages, 
notably the ability to identify genetic loci 
(scored as the presence or absence of 
bands) without prior cloning or sequencing 
steps (Williams et al., 1993). Detecting micro- 
satellite loci, on the other hand, depends on 
initial time-consuming cloning and sequencing 
steps to identify the simple sequence repeats 
(SSR, or microsatellite loci), and the design of 
primers flanking SSRs for amplification and 
detection of polymorphic loci (Jame & Lagoda, 
1996). 

Most of the studies on snail hosts have ana- 
lyzed the genetic structure of Biomphalaria 
glabrata populations, the major intermediate 
host for Schistosoma mansoni in South 
America and several Caribbean islands. Re- 
cently, this species was also found in Egypt, 
where it could complicate the extensive con- 
trol efforts that have been in place there for 
the last several years (Yousif et al., 1996). 
Vidigal et al. (1994) showed that snails in a 
population in one geographic region were 
more homogeneous (based on RAPD-PCR 
analysis) than snails from different geographic 
regions. However, for the African species B. 
pfeifferi, Hoffman et al. (1998) found consider- 
able heterogeneity in populations even within a 
few hundred meters along a river system. As- 
sessing genetic diversity in S. glabrata by tar- 
geting polymorphic SSRs in the genome is 
less established (Jones et al., 1999; Mavares 
et al., 2000), but has been shown to be a pow- 
erful tool for linkage analysis for certain traits 
in other species. The purpose of this study 
was to use RAPD-PCR and microsatellite 
variation in assessing the genetic diversity 
among B. glabrata snails collected in a single, 
small field site. Our goal was to determine the 
sensitivity of each method to detect genetic 
diversity in a single population. We have be- 
gun by examining genomic polymorphisms on 
a small scale in order to better understand 
patterns of variation where geographic dis- 
tance is not a complicating factor. By begin- 
ning on a small scale before applying these 
methods to analyze snails from a broad geo- 
graphic region, we will be better able to choose 
markers and sampling protocols for larger- 
scale analyses. Furthermore, the occurrence 
of previously identified RAPD markers that 
segregate with resistance to S. mansoni infec- 
tion in laboratory maintained snails (Knight et 
al., 1999) was assessed in field collected 
snails for the first time in this study. 



MATERIALSAND METHODS 



Snails 



Initial standardization of techniques was per- 
formed on laboratory-maintained ß. glabrata 
snails from two well-established stocks: (1 ) the 
BS-90 snails, a pigmented, parasite-resistant 
stock that was isolated from Salvador, Brazil 
(Paraense & Correa, 1963), and (2) the M-line 
snails, an albino stock highly susceptible to S. 
manson/ infection (Newton, 1953). 

Field-collected ß. glabrata snails were ob- 
tained from a schistosomiasis endemic area in 
Corrego de Melquíades, Governador Valadares 
municipality, Minas Gerais, Brazil. The epide- 
miology of schistosomiasis in this area has 
been documented by others (Kloos et al., 2001 ; 
Bethony et al., 2001). Snails (> 5 mm shell 
dia.) were collected from a single fishpond 
(approx. 40 m^ surface area) fed by a single 
small stream. Before being transferred to the 
laboratory, the snails were maintained in plas- 
tic jars containing water collected from their 
respective sites and fed lettuce or decaying 
aquatic vegetation. To detect trematode infec- 
tion in field-collected snails, the snails were 
placed individually in water in 24-well plates 
and exposed to incandescent light for 1 -2 hr at 
room temperature. The water was then exam- 
ined under a dissecting microscope for the 
presence of cercariae. Snails exhibiting signs 
of trematode infection were excluded from the 
DNA analysis. 

DNA Isolation 

Snails were placed overnight in water con- 
taining 0.1 mg/ml of ampicillin for preparation 
for DNA extraction. The shells were removed 
after gently crushing the snails between two 
glass slides and, in the case of field-collected 
snails, the tissues further examined micro- 
scopically for evidence of trematode infections. 
The headfoot of individual snails was severed 
from the posterior region of the body with a 
sharp scalpel blade, then the headfoot either 
used immediately for DNA extraction, or frozen 
in liquid nitrogen and stored at -70°C until re- 
quired. DNA was extracted as described previ- 
ously (Knight et al., 1998). Genotypes of 
individual laboratory and field-collected snails 
were initially established by RAPD-PCR using 
the 10-mer primers OPM-04 and OPZ-11, as 
described by Knight et al. (1999). 



GENETIC VARIATION IN BIOMPHALARIA GLABRATA 



151 



Construction of Small Insert Genomic Library 

Small insert genomic DNA libraries were con- 
structed either by using restriction enzyme Sau 
ЗА! to generate small fragments (0.5 2.0 kb), or 
by multiple enzyme digestions, as described by 
Ostrander et al. (1992). Restriction enzyme di- 
gestions were performed using 10 ¡.ig genomic 
DNA from an individual BS-90 snail according to 
manufacturer's instructions (Life Technologies). 
DNA concentration was determined by spotting 
samples (1 pi) on agarose plates impregnated 
with ethidium bromide (0.2 pg/ml) and com- 
pared with DNA samples of known concentra- 
tion under UV light. The DNA fragments 
generated by Sau 3AI digestion were ligated into 
Bam HI linearized pUC-18 vector (Amersham 
Pharmacia Biotech) under standard conditions. 
In the case of DNA fragments generated by 
multiple enzyme digestions, blunt-ended frag- 
ments, filled in by a standard method using the 
Klenow fragment of DNA polymerase, were li- 
gated into the Sma I site of pUC-1 8. 

Transformation of heat-inactivated ligation re- 
actions into E. CO// strain DH5a was performed 
according to manufacturer's instructions (Life 
Technologies). Libraries were plated on LB agar 
(Invitrogen) containing ampicillin, X-gal, and 
IPTG and stored with 15% glycerol at -70°C 
until required. For screening, libraries were 
thawed, diluted and plated at a density of 2,000 
colonies/plate (180 mm dia.) onto LB agar con- 
taining ampicillin, and colonies screened by lift- 
ing onto nitrocellulose filters according to 
manufacturer's instructions (Schleicher & 
Schull). 

Baked filters were hybridized under moderate 
to low stringency conditions (Benton & Davis, 
1977) using ypP] labeled oligonucleotides con- 
taining -[AT] 10, -[GTJio- and -[ААТ]^ repeats 
(Pharmacia). Positive colonies were detected 
by autoradiography on Kodax X-Omat film at - 
70°C for 2 days using intensifying screens. 
Plasmid DNA was isolated from positive clones 
using the Wizard plasmid DNA kit (Promega) 
from overnight cultures grown in LB medium 
containing 0.1mg/ml amplicillin. Nucleotide se- 
quences of recombinant plasmids were deter- 
mined using M13 primers (forward and reverse) 
by the dideoxy-chain termination Sequenase 
Kit (Amersham). From this information, primers 
flanking potential microsatellite sites were de- 
signed and obtained commercially (Genosys). 
University of Wisconsin Genetics Computer 
Group (UWGCG) software (Deveraux et al., 
1987) was used to mine existing sequences of 



potential B. glabrata microsatellite loci from 
EST sequences in GenBank (dbEST). 

Detection of Microsatellite Variation and RAPD- 
PCR Analysis 

Genetic diversity between snails was as- 
sessed by RAPD-PCR analysis, using 19 arbi- 
trary primers, and by variations in microsatellite 
loci. Variations in microsatellite loci were evalu- 
ated by PCR using primer sets flanking either 
15 previously described loci (Jones et al., 1999; 
Mavares et al., 2000) or 45 new loci identified 
for this study. Genomic DNA was amplified us- 
ing 'touchdown' PCR (Don et al., 1991) with 
oligonucletide primer pairs (17-19 mers) ob- 
tained from Sigma-Genosys Ltd. The negative 
control was sterile distilled water. PCR was per- 
formed in a total volume of 5.0 pi containing 5 
ng of DNA template, 0.5 ц! of 10X PCR buffer 
(same as in 10X RAPD buffer), 1.0 pi of 1mM 
dNTPs, 0.25 pi a-35S dATP (Specific Activity, 
lOOOCi/pmol Amersham Pharmacia Biotech, 
U.K.) and 0.002 units of Taq DNA polymerase 
(Promega, Wisconsin). "Touchdown" PCR was 
performed as follows: denaturation, 30 sec at 
95°C; annealing, 30 sec (temperature was de- 
creased by 1 °C every two cycles from an initial 
temperature of 10°C above optimal Та as deter- 
mined from the manufacturers for the new 45 
primer pairs or as previously published by 
Jones et al. (1999) and Mavares et al. (2000), 
then held at optimal annealing temperature for 
20 cycles; extensions were at 72°C for 30 sec. 
Stop buffer (1.0 |.il, 0.1% xylene cyanol 0.1% 
bromophenol blue, lOmM EDTA in 95% deion- 
ized formaldehyde) was then added to each re- 
action. Amplified alleles were separated by 
electrophoresis on 6% urea/polyacrylamide se- 
quencing gels in conjunction with known stan- 
dards: (1) a 25 bp DNA ladder (Invitrogen) 
end-labelled with y-^^P; and (2) a sequencing 
ladder of pUC-1 9 generated using the universal 
M13 (reverse) primer. Gels were fixed in 10% (v/ 
v) acetic acid and 10% (v/v) methanol for 15 
minutes at room temperature prior to drying at 
80°C. Dried gels were set up for autoradiogra- 
phy on X-ray film (X-OMAT, Kodak) overnight at 
room temperature without intensifying screens. 
RAPD-PCR using 25 ng of genomic DNA was 
performed as previously described (Larson et 
al., 1996). The control was distilled water, and 
amplified samples were resolved by gel electro- 
phoresis on agarose gels (1.2% w/v). The 
bands were stained by ethidium bromide and 
visualized by UV transillumination. 



152 



ROWE ET AL. 



AMOVA Analysis 

Phenotypic variation of RAPD products 
(primers OPX-6, OPM-19, OPAW-07) was in- 
vestigated by analyses of molecular variance 
(AMOVA; Excoffieretal., 1992) implemented in 
the computer package ARLEQUIN Ver. 2.001 
(Schneider et al., 2000). Only those bands that 
could be unequivocally scored across all 
samples were included in the analysis. Subse- 
quent AMOVA analysis proceeded with 13 
markers for three BS-90 snails, three M-line 
snails and 36 field-collected snails. A matrix of 
Euclidian square distances was computed us- 
ing the pairwise difference method. This matrix 
was used for the analysis of genetic structure 
including partitioning of variation (A) within the 
three populations, (B) among the three popula- 
tions, and (C) among groups of populations 
(i.e., lab strains versus field strain). Statistical 
significance of variance components was as- 
sessed with 10,000 random permutations. 



RESULTS 

Assessing Genetic Differences Between Labo- 
ratory Snails from Two Different Stocks 

Before embarking on the analysis of field 
population snails, we tested our ability to detect 
genetic differences, by variations in micro- 
satellite loci and RAPD-PCR analysis, be- 
tween laboratory-maintained snails. DNA 
profiles of two well-established laboratory 
stocks of B. glabrata were used as reference 
samples to test all RAPD-PCR primers and 
microsatellite primer sets for consistency in 
amplification. These snails, from stocks BS-90 
and M-line, are fully resistant or susceptible, 
respectively, to the NMRI strain of S. mansoni 
used in our laboratory. Previously, we have 
shown considerable genetic homogeneity be- 
tween individuals within each stock by RAPD- 
PCR with numerous primers (Knight et al., 
1999; Ittiprasert et al., 2003). Here we deter- 
mined the occurrence of polymorphisms be- 
tween them by examining variations at 60 
microsatellite loci and by RAPD-PCR using 19 
random primers. The new loci were identified 
either by screening a small insert library, or in 
silico by mining for simple sequence repeats 
(SSR) from B. glabrata sequences deposited 
in GenBank. 

Primer sets and annealing temperatures (Ta) 
used for the present study for all 60 micro- 



satellite loci are given in Table 1. Variations in 
the microsatellite loci examined between the 
two laboratory maintained snails, listing the 
number of alleles and their observed sizes, are 
shown in Table 2. Of the six loci previously de- 
scribed by Jones et al. (1999), null alleles (N/A) 
were observed for three of these (pBgl, BgpIO 
and Bg|j16) in both snails, and unscorable mul- 
tiple products (MP) were detected in both 
stocks with primer sets flanking locus Bgp8. 
For the two other loci ([jBg2 and Bgp15) single 
alleles that were polymorphic between the two 
laboratory snails were identified. Allelic size 
ranges observed were more consistent with 
the size seen in the BS-90 stock compared to 
M-line stock. For locus Вдр15, the single allelic 
band of 178 bp (previously reported) appeared 
as two bands (176 bp and 178 bp) in the BS- 
90 snail, and a single band of 161 bp in the M- 
line snail. 

For the nine microsatellite loci reported pre- 
viously by Mavares et al. (2000), two (BgE2, 
BgE3) were undetected (null alleles), and 
primer sets corresponding to locus BgC8 pro- 
duced multiple products in both snail stocks. 
Of the remaining six loci, all except one (locus 
BgE5) were detected in both stocks. The 
primer set corresponding to the BgE5 locus 
produced no detectable band in the M-line 
snail, but produced two allelic bands of 204 bp 
and 234 bp in the BS-90 snail, thus demon- 
strating polymorphism in this locus between 
the two laboratory strains. Similarly, genetic dif- 
ferences between the two stocks were de- 
tected with the primer sets corresponding to 
loci BgC7, BgEI, BgE4 and BgE6. For these 
sites, the allelic size range detected fell within 
the expected size range as previously de- 
scribed (Mavares et al., 2000), with the BS-90 
snail showing better correspondence in size 
expected than the M-line stock. 

Data in Table 2 describe the presence of the 
45 previously unreported, potential micro- 
satellite loci (BGMSCA series, BGMSAT se- 
ries, and BGMSGATA series). Included are the 
number of alleles and observed sizes amplified 
from the two laboratory stocks using primers 
flanking these loci. Of these, variations were 
detected in 20 of the sites between the two 
laboratory snails. Null alleles were ob- 
served with 14 primer sets (combined data 
from BS-90 and M-line snails), and multiple 
products were detected with primer sets corre- 
sponding to four sites. 

The results of the RAPD-PCR comparison, 
using 19 random primers, are summarized in 



GENETIC VARIATION IN BIOMPHALARIA GLABRATA 



153 



TO -^ 
CÛ с 
с о 

^'R '¡л 

CD w 

0) 

о 



W 



II 

Ш CO 



Ш 



о 



<Wa5 

(Л (J) 
0) T- 



2Í о 
го <м 





■^ 


.,— 


т- 


га 




о 


см 


1^ 


'í 


га 


со 


со 


см 


■í~ 


со 


1 


1 


1 


1 




CNJ 


Г-- 


СП 


со 




о 
со 


со 


CD 

CNJ 


со 



о о 

< t о 

9 ^ •- 

< ÍÍ о 

h "^ < 
I- о п 

5 о н 

Я >- ^ 

I- о о 
о<о 
о: ú- ос: 



о 



ooog 

I- ü о < 

о < < о 

I- < о н 

н о I- о 

о I- < - 

Ь- < о 



Li. ce LL о: Li. 




< I- О < 
оо о < 

о < h- о 

< н о н 

О 1- Н о 

-^1-1-1- 
7- о I- I- 
н о < < 

с.оь< 
c¿ ùl a¿ ú. 



< h 



gc.o 

í^ 

< < o 

o o < 

o ü o 

< < o 
o o o 

o o < 
o ü < 

o < o 
c¿ LL a: 



s 

m 

sit 

Sí 



o 



I- < 

^^ 

o ^ 



< -, 
o < 

LL C¿ LL 



il 

^ o o 

o 

< 

Htl=5g 

I- H H < ^ 

o o C) o ^ 

< < ü < ^ 

< o < o < 
o o H I- o 
o o b- o < 
c¿ 11. q: u_ q: 




o H o 

HÜüO 

o ь < < 

•- "^ o h 
o Üo p 
o I- < П 

< и I— (T) 



o 



o 

r- I- t- ^ 

o<<o 

OQOO 

o I- o o 

< o < < 
o I- o o 

u. a: u. ct: 



o 



CD 



o 



(D 



o 



< 

o 

I- 
o 

< 
o 

h- 



< 

o 
< 

C5 
CD 
CD 

< 

CD 
CD 

о 
< 



< 

CD 
CD 

о 
< 



CD 



< 

CD 

< 

(D u. 

ílí 

^< 

< CD 

CD ^ 



CÛ 



CÛ 



T- 


CD 


h- 


ra 


H 


() 


O 


О 


CD 


Q) 


en 


Dl 


CÛ 


CÛ 


m 


CU 



CÛ CÛ 



CÛ 



< 

I- 
< 

CD 



154 



ROWE ET AL. 



il 

Cû с 
с О 

CD (Л 

0) 

о 
о 
< 



СО 



Ш W 



Q. 


















m 


СО 


О) 


С» 


to 
со 


ю 


CD 


(J) 


оо 
со 



о 



о: 



er 



Li. CL 



cu 



ü 
m 

DL 



OL 



h- 




CM 


со 


00 






00 


ю 


^ 


00 




1Л 


00 


с 55 


I 


< 


СП 


СЗ) 


ü~> 




со 


со 


со 


о 


z 




г- 




ш 




< 


< 


< 


er 











о 


00 


о 


ю 


о 


LT) 


00 


о 


по 


LT) 


^ 


ю 


ю 


ю 


ю 


^ 


ю 


'í 




< 

о 



< 

о 
(/) 

о 
m 



о 
< 



LO 
О 

< 
о 

СО 

О 

CÜ 



< 

О 



о 



о 
< 

CD *< Ю 



H < 

< о 

I- H 

о I- 



о ^ 



о 



О 



< 

О 

со 

о 

CÛ 



< 

о 






о 



о 



< 
о 
со 

о 

ÛQ 



GENETIC VARIATION IN BIOMPHALARIA GLABRATA 



155 



CD (Л 



[^ 


CO 


CD 


[^ 


о 


m 


(У) 


CJ) 


00 


^ 


Ю 


N- 


U1 


CO 


(Ю 


О 


о 


ro 


CD 


(35 


(J) 


о 


о 


o 


C) 


OO 


CO 


■^ 


'í 


•^ 


t^ 


r^ 


,f-- 


r- 


г^ 


N- 



o 

CNJ 


LT) 


со 
eg 


CD 


u_ 


U- 

1- 


1- 


r\j 


r\i 


■^ 


^ 


T — 


ГМ 




o 


o 


o 


o 


'^ 


со 


CD 


'^ 


'í 


'í 


'í 


< 


< 


CJ 


g 


1 


g 


r^ 


m 


m 


CD 


< 


< 


< 


<• 


{Г 


er 


a: 



(Л 



и tz. 
Ш W 




О 



О 
о < 
о о 

I- о 

о о 

it 

о < 
о о 
о 



< 

о С) 
ü о 
о: U. 



о 

I- 
Ü 
I- 
о о 

< о 

< о 
51: 

^i 

< о 
оо 
о: и_ 





СП т- 
CD со 


со 




:аатс 

TTGTG 
ATGAG 




и 




1- 
1- 


о 


о 


С) 


<^^о\- < 


о\-<<< 


1- 


(Т 


о < Р <ç о Ö 


i 


О ,^ < О О 
О Я "^ Ь гп 


\- 


н и< < 


(• 1 


h h 5 5 ^ 

о 1- < < н- 


< 


< о С5 о < 


О 1- О < < 


о 
1- 
< 

< 


1- О 1- < О 


<ÜÜ< 1- 


о 


ü < О О 


и 


ЬО< 1- 


<- 


о о о о 


1- 


U 


1- < о 1- 


f •) 


1— 


О h- < н 


<г 


о 


о о о о 


f •) 


о 


< коо 


1- 


о: 


LL [Г LI. о: 


Ll_ 



о 
о ^ 



Ou 

"í о 
о о 
о о 

tr Ll_ 



I- 

о о о о 
оооо 

о 



о 



о 



о 



ö^ot 



о 



о 



о р оо 
о Ü о I- 



о о 
о < о 

< о I- 
о о о 
I- о о 

< < н 

< I- о 

о о h- f_ 
Ь- о о < 
о < < о 
о о о Ь 
о о о ь 
t 5 < 5 

о ^ г ' 



t:;; о о о 
< < < < 

' < < 



1я 



H о о < о 
Р ооо < 
о < < о I- 



< < о < 
,^ооо 
о < < о 
<оьо 

OüOü 
о h- I- I- 

ct: U. er u_ о; u_ 






^^ v^ ^ч, i_ 

o < к г 

i- < о t 

o o o < 

I- < I- H 

< o o < 

o o I- o 

o: LL ce: LL 



§o 



ь < 



o 



o o o o o 
a: ü_ ce Li_ q: 














O 




























































o 






























o 


















^ 




1^ 






h^ 








N- 


CJ) 


œ 


CD 


r^ 


<D 


T- 


О) 


< 


o 


1- 


1- 


1- 


< 


< 


1- 


o 


O 


< 


< 


< 


1- 


<" 


o 


H 


O 


O 


o 


O 


O 


O 


< 


к 


o 


O 


H 


< 


H 


со 


r- 


00 


en 


o 




CN 


со 


^ 


en 


со 


r^ 




og 


со 


T — 


T — 


T — 


T — 


CNJ 


CN 


CNJ 


CNJ 


CNJ 


СЧ 


Csj 


Csl 


o 


O 


о 


< 


< 


< 


< 


< 


< 


< 


< 


< 


< 


< 


< 


1- 


1- 


1- 


o 


o 


o 


O 


O 


O 


o 


O 


O 


C) 


o 


O 


<r 


< 


<r 


C/J 


СЛ 


w 


w 


W 


СЛ 


(Л 


СО 


со 


СО 


СО 


СО 


со 


СО 


СО 


^ 


^ 


s 


s 


^ 


^ 


^ 


S 


^ 


2 


^ 


2 


2 


s 


2 


o 


o 


o 


o 


O 


C9 


O 


C9 


o 


o 


O 


o 


o 


о 


о 


cu 


CÛ 


m 


Dû 


m 


Cu 


CÛ 


Ш 


CQ 


CÛ 


CQ 


00 


CQ 


CQ 


СО 



156 



ROWE ET AL. 



m с 



CD ся 



W 



rt -Q 



Ü 

Q. 
X - 

Ш w 



(D 



о 



u. LL a: 



cr 



1- 


\- 


[- 


CD 


,— 


h- 


.,— 


m 


CJ 


O) 


■^ 


^ 


о 


Г0 


N- 


m 


1^ 


CD 


CD 


O) 


о 


о 


O) 


CD 


L.1 


U. 


(') 


n 


^ 


■^ 


00 


со 


Cû 


Ü 

m 


m 

01 


r^ 




r- 

^ 


1 


1 


Cd 


q: 


< 


< 


< 


< 


< 



1- 


1- 


1- 


h- 


\- 


vr 


n 


o 


CD 


ГО 


en 


r^ 


C3> 


00 




о 


Q 


C) 


c; 


Cû 












о 


О 


О 


о 


W 


m 


m 


m 


m 


Ш 


cu 


q: 


Cd 


Cd 


a: 



CD 


Cû 


(O 


00 


CD 


ГО 


CD 


со 


CM 


■!— 


T— 


00 




о 



о 



о 







о 


^ 




о 






о 










о 


о 


(D 


íD 




со 


h~ 




г^ 


ю 


■^ 


<D 


CD 


LO 


ю 


1- 


о 


< 


< 


Р 


< 


1- 


Р 


1- 


1- 


ь 


< 


< 


h- 


< 


< 


1 


H 


к 


< 


н 


< 


< 


< 


< 


< 


ь 


к 


< 


ь 


H 




























о 


CN 

о 


^r 


ю 


CD 


Г-- 


00 


аз 


о 


.^ 


см 


оо 


■^ 


ю 


CD 


< 

1- 


< 

1- 


о 


о 


О 


о 


о 


о 


т — 


т — 


т — 


т — 


т — 


т — 


т — 


1- 


1- 


1- 


к 


1- 


Ь 


1- 


1- 


1- 


1- 


1- 


1- 


1- 


< 


< 


< 


< 


< 


< 


< 


< 


< 


< 


< 


< 


< 


< 


< 


о 


ü 


со 


W 


W 


(Л 


(Я 


СО 


со 


со 


со 


со 


со 


со 


со 


со 


со 


s 


s 


S 


2 


^ 


^ 


^ 


s 


^ 


^ 


s 


^ 


^ 


^ 


s 


о 


о 


О 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


о 


ш 


Gû 


m 


СО 


со 


со 


со 


со 


со 


со 


со 


со 


со 


со 


со 



GENETIC VARIATION IN BIOMPHALARIA GLABRATA 



157 



Table 3 (column 3). All but one primer (OPV-20) 
revealed polymorphisms between strains. In all 
cases, the polymorphisms detected were ma- 
jor and readily observed by ethidium bromide 
staining of agarose gels. Representative ex- 
amples of the DNA profiles from RAPD-PCR 
using two random primers are shown in Figure 
1 A and B. Major differences could be detected 
with both primers in the RAPD profiles of both 
the BS-90 and M-line snails. For example, 
primer OPAW-07 reveals a major band of 700 
bp that is absent from the M-line snail. Using 
primer OPZ-05 a band of 1 .0 kb was detected 
only in the M-line snail. 

In summary, it was clear that both micro- 
satellite variation and RAPD-PCR analysis 
were adequate in assessing polymorphisms 
between snails from the two laboratory stocks. 
Of the microsatellite sites analyzed, 26 loci 
were found to be polymorphic, while 8 sites 
were monomorphic between the two stocks. 
With RAPD-PCR, all but one primer revealed 
polymorphisms between the two lab stocks. 

Assessing Genetic Diversity in Field-Collected 
Snails from a Single Locality 

After conditions were optimized, DNA poly- 
morphisms were evaluated following the estab- 
lished procedure among field isolates of 



B. glabrata. Results in Table 4 describe micro- 
satellite variations (observed allelic sizes and 
number of alleles) between 20 different indi- 
vidual field collected snails for 26 primer sets. 
The primer pairs used for field evaluation were 
those that gave consistent results either when 
amplifications were performed at different 
times or by different investigators on the same 
field-collected snail DNA template. Primer sets 
that failed to show amplified products (null alle- 
les) when laboratory snail stock DNA was used 
as template were omitted from the field study. 
In addition, 24 primer sets that produced mul- 
tiple products when field collected samples 
were analyzed have not been included in Table 
4. In comparison to the laboratory snails, field- 
collected snails showed significant variations 
for several of the loci examined. For example, 
for two loci previously identified by Mavares et 
al. (2000) (BgE1 and BgE5), we detected more 
intrastrain variation at these loci compared to 
the laboratory stocks, where only one allele 
was detected. Correspondence in the observed 
size range to the expected size was consistent 
between laboratory-maintained and field-col- 
lected samples, although the number of alleles 
varied between them for the majority of loci 
analyzed. Invariant alleles (in size and number) 
between the laboratory snails and field isolates 
were found with only two loci (BGMSCA05 and 



TABLE 2. Observed allelic sizes and number of alleles for 60 microsatellite loci in resistant 
(BS-90) and susceptible (M-line) laboratory-maintained snails. 





BS-90 (R) 




M-li 


tne(S) 






Observed 


Number of Alleles 


Observed 


Number of Alleles 


Locus 


Sizes (bp) 




Sizes 


'(bp) 






mBg1 


N/A 


N/A 


N/A 






N/A 


mBg2 


249 


1 


259 






1 


Bgm8 


MP 


MP 


MP 






MP 


Bgm10 


N/A 


N/A 


N/A 






N/A 


Bgm15 


176, 178 


2 


161 






1 


Bgmie 


N/A 


N/A 


N/A 






N/A 


BgC6 


N/A 


N/A 


N/A 






N/A 


BgC7 


321 


1 


325 






1 


BgC8 


MP 


MP 


MP 






MP 


BgE1 


131, 137 


2 


103, 


135 




2 


BgE2 


N/A 


N/A 


N/A 






N/A 


BgE3 


N/A 


N/A 


N/A 






N/A 


BgE4 


205 


1 


177 






1 


BgE5 


204, 234 


2 


N/A 






N/A 


BgEB 


539 


1 


289 






1 



{Continues) 



158 






ROWEETAL 








(Continued) 


















BS-90 (R) 




M-l 


ne(S) 




Observed 


Number of Alleles 


Observed 


Number of Alleles 


Locus 


Sizes 


(bp) 




Sizes 


(bp) 




BGMSCA01 


126, 


128 


2 


MP 




MP 


BGMSCA02 


N/A 




N/A 


N/A 




N/A 


BGMSCA03 


158, 


160 


2 


166, 


168 


2 


BGMSCA04 


135, 


164 


2 


164 




1 


BGMSCA05 


152 




1 


152 




1 


BGMSCA06 


152,154 


2 


152,154 


2 


BGMSCA07 


149 




1 


153 




1 


BGMSCA08 


N/A 




N/A 


N/A 




N/A 


BGMSCA09 


155 




1 


171 




1 


BGSMCA10 


N/A 




N/A 


N/A 




N/A 


BSMGCA11 


MP 




MP 


MP 




MP 


BGMSCA12 


N/A 




N/A 


N/A 




N/A 


BGMSCA13 


N/A 




N/A 


N/A 




N/A 


BGMSCA14 


199 






193, 


195 


2 


BGMSCA15 


224 






190 






BGMSCA16 


334 






334 






BGMSCA17 


N/A 




N/A 


N/A 




N/A 


BGMSCA18 


162 






162 






BGMSCA19 


151 






151 






BGMSCA20 


162 






164 






BGMSCA21 


203 






N/A 




N/A 


BGMSCA22 


154 






154 






BGMSCA23 


112 






112 






BGMSCA24 


180, 


182 


2 


185, 


187 


2 


BGMSCA25 


134 






138 






BGMSCA26 


151 






153 






BGMSCA27 


196 






204, 


212 


2 


BGMSAT01 


N/A 




N/A 


N/A 




N/A 


BGMSAT02 


130 




1 


N/A 




N/A 


BGMSAT03 


N/A 




N/A 


N/A 




N/A 


BGMSAT04 


N/A 




N/A 


N/A 




N/A 


BGMSAT05 


140, 


146 


2 


140, 


146 


2 


BGMSAT06 


MP 




MP 


MP 




MP 


BGMSAT07 


MP 




MP 


MP 




MP 


BGMSAT08 


220, 


230 


2 


224, 


234 


2 


BGMSAT09 


307 




1 


332 






BGMSAT10 


136 




1 


136 






BGMSAT11 


MP 




MP 


MP 




MP 


BGMSAT12 


335 




1 


N/A 




N/A 


BGMSAT13 


319, 


333 


2 


333 






BGMSAT14 


N/A 




N/A 


N/A 




N/A 


BGMSAT15 


431 




1 


431 






BGMSAT16 


232 




1 


185, 


233 


2 


BGMSGATA01 


MP 




MP 


MP 




MP 


BGMSGATA02 


372 




1 


374 







GENETIC VARIATION IN BIOMPHALARIA GLABRATA 



159 



TABLE 3. Detection of polymorphisms (+/-) by RAPD-PCR analysis among 
laboratory stocks and among field-collected snails. 



RAPD Primers Sequence 5' to 3' 



Lab Interstrain 
Variation (+/-) 



Field Intrastrain 
Variation (+/-) 



OPAL-10 


AAGGCCCCTG 


+ 


OPAJ-17 


ACCCCCTATG 


+ 


OPAV-1 1 


GACCCCGACA 


+ 


OPT-11 


TTCCCCGCGA 


+ 


OPS-04 


CACCCCCTTG 


+ 


OPV-12 


ACCCCCCACT 


+ 


OPAQ-09 


AGTCCCCCTC 


+ 


OPX-04 


CCGCTACCGA 


+ 


OPM-18 


CACCATCCGT 


+ 


OPAJ-08 


GTGCTCCCTC 


+ 


OPAP-08 


ACCCCCACAC 


+ 


OPAW-07 


AGCCCCCAAG 


+ 


OPV-20 


CAGCATGGTC 


- 


OPM-19 


CCTTCAGGCA 


+ 


OPX-06 


ACGCCAGAGG 


+ 


OPV-15 


CAGTGCCGGT 


+ 


OPZ-20 


ACTTTGGCGG 


+ 


OPZ-05 


TCCCATGCTG 


+ 


OPAH-04 


CTCCCAGAC 


+ 




OPAW-07 



В 



OPZ-05 



FIGURE 1. RAPD-PCR amplification of BS-90 (B) and M-line (M) snail DNA 
with random primers (A) OPAW-07 and (B) OPZ-05. For molecular weight mark- 
ers (MW), a 100 bp ladder was used. 



160 ROWEETAL. 

TABLE 4. Observed allelic sizes and number of alleles for 44 microsatellite loci 
of field-collected B. glabrata snails. 





Number of 


Observed Allelic Sizes 




Locus 


Snails 


(bp) 


Number of Alleles 


mBg2 


19 


275 


1 




1 


259, 275 


2 


Bgm15 


13 


175 


1 




5 


175, 176 


2 




1 


176 


1 




1 


N/A 




BgC7 


4 


326, 327 


2 




15 


327 


1 




1 


N/A 




BgEI 


2 


99, 103 


2 




3 


99, 107 


2 




1 


99 


1 




7 


103 


1 




7 


N/A 




BgE4 


14 


181 


1 




6 


181,209 


2 


BgE5 


4 


230 


1 




1 


230, 234 


2 




1 


230, 242 


2 




4 


234 


1 




4 


234, 242 


2 




6 


N/A 




BGMSCA01 


20 


126, 128 


2 


BGMSCA03 


19 


166, 168 


2 




1 


N/A 




BGMSCA05 


20 


152 




BGMSCA14 


18 


197 






2 


197, 198 


2 


BGMSCA18 


20 


162 




BGMSCA19 


19 


160 






1 


N/A 




BGMSCA20 


20 


N/A 




BGMSCA22 


20 


152 




BGMSCA23 


20 


N/A 




BGMSCA25 


20 


144 




BGMSCA26 


20 


N/A 




BGMSCA27 


17 


200 






3 


N/A 




BGMSAT05 


14 


130, 136 


2 




6 


N/A 




BGMSAT08 


10 


230 






5 


230, 231 


2 




3 


231 






2 


N/A 




BGMSAT10 


20 


154 




BGMSAT12 


12 


335 






8 


N/A 




BGMSAT15 


4 


429 






1 


429, 437 


2 




2 


437 






13 


N/A 




BGMSAT16 


11 


184 






6 


184,211 


2 




3 


N/A 




BGMSGATA02 


19 


520, 521 


2 




1 


N/A 





bp 

200 
190 



GENETIC VARIATION IN BIOMPHALARIA GLABRATA 

В M ^ Field isolates 



161 



It Nil liai iiipii «iiii4HHipi 



виг— «^— nil — ЮИиШШЩ 



FIGURE 2. Microsatellite variation of locus BGMSCA14. Sequencing ladder of pUC-19 was used as 
standard. В and M represent lanes showing allelic bands amplified at this locus for the BS-90 and M- 
line laboratory stocks, respectively. Amplification at the same locus for DNA from 29 field-isolated 
snails, isolated from a single site, is shown. Note the difference in number and size of alleles between 
the lab stocks and among the field-collected samples. 



BGMSCA18), where single allelic size bands of 
152 bp and 162 bp, respectively, were detected 
with all DNA samples analyzed. 

In several cases, multiple products were ob- 
tained for the same loci in snails from both 
laboratory and field, that is, Bgp8 and BgC8. 
Although null alleles were infrequent for the 
majority of loci, these were associated more 
with the M-line snail than with either the BS-90 
or field-collected snails. A representative ex- 
ample of microsatellite variation in the locus 
BGMSCA14 is shown in Figure 2. As can be 
seen, polymorphisms in this locus were de- 
tected between the laboratory-maintained 
snails, manifested by differences in sizes of 



allelic bands in the BS-90 (199 bp) compared 
to the M-line snail (193 bp and 195 bp). Diver- 
sity within this locus for field-collected snails 
was also clearly visible. In this case, most 
samples examined from this population (29 
snails) either displayed allelic size bands of 
197 bp and 198 bp or, as seen in one snail 
from this population, a single allelic band of 198 
bp was detected. 

A summary of the results obtained using 
RAPD-PCR to assess genetic diversity among 
the field-collected snails is shown in Table 3 
(column 4). Of the 19 random primers utilized, 
we observed intra-strain variation with nine of 
them. Figure 3 shows a representative ex- 



MW ^ 



Field isolates 




A 



OPAW-07 



MW *- 



Field isolates 




600 — 



В 



OPZ-05 



FIGURE 3. RAPD-PCR amplification of DNA from individual field isolates of B. glabrata snails, using 
random phmers (A) OPAW-07 and (B) OPZ-05. For molecular weight markers (MW), a 100 bp ladder 
was used. 



162 



ROWE ET AL. 



ample of RAPD-PCR analysis of field-collected 
snails, using random primers OPAW-07 and 
OPZ-05. Of the 19 DNA samples analyzed, 
both primers revealed major intrastrain variation 
among them. For primer OPAW-07, two bands 
(doublet) of 700 bp and 750 bp were present in 
most snails analyzed, but a single 750 bp band 
was seen in five snails examined. Also, with this 
primer, a major 500 bp band seen in most 
snails was absent in two analyzed (lanes 1 and 
2). Variations with primer OPZ-05 were clearly 
visible in several bands. For example, polymor- 
phisms were detected in bands at 550 bp and 
750 bp in these field-collected snails. 

Assessing Population Structure Based on 
RAPD Data 

The analysis of molecular variance (AMOVA) 
showed that most of the variation resides within 
populations (68%) and the permutation tests 
indicated that the within-population differences 
are highly significant (P < 0.00001). The varia- 
tion among populations accounts for 54% of 
the total variation (P = 0.0283). However, the 
difference between the two lab-strain popula- 
tions and the field-strain population (-22% of the 
total variation) is not significant (Table 5). A 
pairwise AMOVA differentiation test between 
populations showed that all three comparisons 
were significant (BS-90 snails vs. M-line snails 
0.02712; BS-90 snails vs. field-collected snails 
0.00157, and M-line snails vs. field-collected 
snails 0.00161). 



DISCUSSION 

The genetics of both the snail host and the 
parasite determine the outcome of the mollus- 
can stage of parasite development. For this rea- 



son, more is being done to understand how the 
genetic structures of the parasite and snail host 
populations affect transmission and epidemiol- 
ogy of this complex disease. In this study, we 
have compared the relative sensitivities of two 
DNA fingerprinting methods to assess genetic 
heterogeneity among snails from a single, re- 
stricted field site in a schistosomiasis-endemic 
area. This analysis was done following estab- 
lishment of the profiles of representative snails 
from two well-established laboratory stocks that 
are either resistant or susceptible to parasite 
infection, and on which considerable molecular 
profile data already exist (Knight et al., 1999; 
Ittiprasert et al., 2003). The genome wide scan- 
ning tools we used in this study (microsatellite 
variation and RAPD-PCR) are particularly use- 
ful for studying organisms in which only limited 
molecular information is available. From our 
results it was clear that both methods showed 
significant polymorphisms between snails in 
this restricted field site. 

In previous work, we showed by RAPD-PCR 
the segregation of two markers (1 .2 kb and 1 .0 
kb) with the inheritance of adult resistance 
(Knight et al., 1999), a known Mendelian single 
gene trait in B. glabrata (Richards, 1984). In- 
cluded in our study here was the first analysis 
to assess the potential frequency of these 
markers in field-collected snails from a known 
endemic area for schistosomiasis. We had 
hoped that by extending these studies to the 
field, the presence, if any, of resistant snails 
and their role in the dynamics of transmission 
can start to be evaluated. However, neither 
marker was detected in any of the field-isolated 
snails we analyzed. Whether these markers 
universally segregate with resistance in all ß. 
glabrata populations, or whether resistant 
snails were absent from the present population 
studied is not known. 



TABLE 5. Summary of AMOVA analysis. Statistics include: degrees of free- 
dom (df), sum of squares (SSD), variance-component estimates (CV), and 
percentages of the total variance (% Total) contributed by each component. 



Source of Variation 



df 



SSD 



CV 



% Total 



within populations 
among populations 
among groups 



37 


14.500 


0.39189 


68.15 


1 


1.625 


0.30828 


53.61 


1 


1.750 


-0.12511 


-21.76 



*not significant after 100172 permutations; the negative value reflects that this statistic 
is actually a covariance where negative values can occur when the actual values are 
close to zero (Excoffier et al., 1992). 



GENETIC VARIATION IN BIOMPHALARIA GLABRATA 



163 



Several explanations may account for the 
absence of the 1 .2 kb and 1 .0 kb markers In 
our field population. One possible explanation is 
that the markers do not universally segregate 
with resistance in all S. glabrata populations. 
Differences between the M-line, BS-90 and the 
field population may also reflect intraspecific 
diversity in B. glabrata as a whole. Previously, 
Paraense (1959) found reduced infertility 
among some populations of ß. glabrata, sug- 
gesting there may be considerable genetic het- 
erogeneity in this species. A second 
explanation that might account for the absence 
of the 1 .2 and 1 .0 kb markers in the field popu- 
lation would be evolution in the laboratory 
stocks. It is possible that when these stocks 
were founded that alleles that were rare in 
natural populations became more common, 
either by chance or because of the removal of 
selection against them. Laboratory stocks can 
be extremely useful for working out patterns 
that are difficult to see in natural populations 
because there may be more pronounced and 
less variable responses, that is, a more favor- 
able ratio of signal to noise. However, a poten- 
tial pitfall of using laboratory stocks is that they 
may not be reflective of what actually happens 
in nature. Our findings therefore point to a criti- 
cal need for further comparisons of laboratory 
and field populations of ß. glabrata. Our results 
also show that not all microsatellite primer sets 
that were developed using laboratory stock 
DNA were useful when field collected snails 
were analyzed, thus indicating that more work 
needs to be done on field collected snails in 
developing more representative markers. 

Finally, it is possible that the markers of resis- 
tance were simply absent from the sample we 
examined. Experimental studies suggest that 
resistance may be costly to snails (Minchella & 
LoVerde, 1983). Mulvey & Vrijenhoek (1984) 
have also proposed that genetic drift in popula- 
tions of ß. glabrata might produce patchy sus- 
ceptibility and resistance over time and space. 

For population genetic analysis of schisto- 
some snail hosts by RAPD-PCR, evidence for 
the existence of both inter- and intrapopulation 
diversity has been reported. Vidigal et al. (1994), 
using four primers, showed that diversity be- 
tween snail populations can readily be as- 
sessed by this method, but it was not as 
revealing among snails from the same geo- 
graphic region. With another Biomphalaha spe- 
cies, however, Hoffman et al. (1998) reported 
that this method could reveal a high frequency 
of genetic diversity in ß. pfeifferi populations 



that resided only a short distance apart in the 
same river. Likewise, studies examining 
Bulinus snails involved in transmission of S. 
haematobium have shown similar intrapopula- 
tion genetic diversity by RAPD-PCR (Davies et 
al., 1999). Our study clearly shows that RAPD- 
PCR analysis can be a legitimate tool to reveal 
polymorphisms between snails collected from a 
single site, in which mating would presumably 
be restricted, and to study population structure 
of groups of populations. 

As stated earlier, limitations to the RAPD- 
PCR method for population studies exists, es- 
pecially because it allows for the detection of 
only dominant alleles. In earlier studies on labo- 
ratory snail stocks, we detected reproducible 
polymorphisms between schistosome-resis- 
tant and -susceptible snails with 90% of the 
primers utilized in the RAPD-assay. In the 
present study, we found that by using RAPD- 
PCR a somewhat higher frequency of diversity 
is seen between our laboratory stocks, com- 
pared to variation observed in the field isolated 
snails - a not altogether unexpected finding. 
This may reflect the fact that, compared to the 
field snails, the two laboratory snails used here 
originated from very different geographic lin- 
eages; the albino M-line was derived by a 
cross between Puerto Rican and Brazilian iso- 
lates (Newton, 1953), whereas the wildtype 
BS-90 snails are descendents of an original 
field collection from Brazil (Paraense & Correa, 
1963). 

In addition to the ß. glabrata microsatellite 
loci previously described by others (Jones et 
al., 1999; Mavares et al., 2000), we now show 
results of genetic variation in 45 new 
microsatellite loci. Population genetic studies 
with microsatellites for other schistosome 
transmitting species have been carried out, 
especially for Bulinus sp., measuring param- 
eters such as mating systems and geneflow 
(Viardetal., 1996; Stothard et al., 2001). Invari- 
ant loci detected were further evaluated by 
SSCP to determine the unequivocal evidence 
of homoplasy (Angers et al., 2000). Our study 
shows that two loci (BGMSCA05 and 
BGMSCA1 8) appear to be fixed between both 
laboratory stocks and in field snails. Whether 
the same size bands are identical by descent 
remains to be seen, but nucleotide sequence 
analysis of the same sized bands should re- 
veal their relationship. 

The value of data mining for SSRs in ex- 
pressed sequence tags (ESTs) is evident from 
the results of our study, allowing us to generate 



164 



ROWE ETAL. 



44 microsatellite primer sets. This data mining 
strategy for SSRs has also been used with 
success in plant molecular biology for identifi- 
cation of potential microsatellite loci in barley, 
maize, rice, sorghum and wheat (Kantety et 
al., 2002). With current interest in a genome 
project for B. glabrata, it is anticipated that the 
availability of more sequence information from 
this snail will increase the output of micro- 
satellite markers, thus benefiting high density 
mapping efforts. It is envisaged that high 
throughput analysis of B. glabrata DNA will fa- 
cilitate the development of other modern ge- 
nome analysis tools, such as single nucleotide 
polymorphisms (SNPs), another useful tool for 
studying the diversity of complex genomes 
(Wangetal., 1998). 

It is not known what role SSRs play in mRNA 
transcripts, because one would expect the 
gene coding region of the transcript to remain 
neutral. Polymorphisms, manifested by the ex- 
pansion of tri-nucleotide repeats in the coding 
region of mRNA, have been shown, however, 
to play a role in certain human genetic disor- 
ders, such as Huntington's disease and mus- 
cular dystrophy (Maat-Kievit et al., 2001; 
Margolis et al., 2001). In humans, the most 
abundant di-nucleotide repeat motif found is the 
CA/GT repeat (Weber, 1990). In the new sites 
described in this study, 15 repeat motifs were 
CA/GT, but most were AT/TA rich. Compound 
and interrupted repeats were also detected. 

We found that null alleles were infrequent for 
most microsatellite loci examined. In the case 
of the loci described by Jones et al. (1999), 
amplification of our laboratory snails showed no 
product for three out of the six loci reported by 
these investigators. We likewise observed null 
alleles with several of the loci described by 
Mavares et al. (2000) in BS-90 and M-line 
snails. With the newly described loci we ob- 
tained in silico, we were surprised to observe 
null alleles for some of them, since these se- 
quences reside in functional transcripts of the 
snail. One explanation for this could be that 
these sequences may not be readily detected 
using the amplification conditions employed in 
this analysis. 

We found that several loci were non- 
scorable, and amplification of these showed 
multiple bands with sizes that deviated signifi- 
cantly from the size expected. Because 
microsatellites have been defined as highly 
polymorphic single locus regions in the ge- 
nome, we omitted primers that produced these 
multiple products from our study. It is likely. 



however, that these may constitute hyper- 
variable sites in the B. glabrata genome. Nucle- 
otide sequence analysis should help to clarify 
the nature of these repetitive bands. 

In summary, we found that RAPD-PCR is a 
practical method for assessing population 
structure of lab- and field-collected strains of 
Biomphalaria glabrata. In addition, variations in 
previously described and newly identified 
microsatellite loci are useful for assessing ge- 
netic differences between two laboratory main- 
tained snails, and among snails collected from 
a single field site. With the substantial variation 
shown by microsatellite analysis in the field- 
collected snails, however, it will be important to 
select only those primer sets that do not dis- 
play hypervariability for detailed population 
studies. Before settling on primer sets to use 
for studying snail population structure in other 
geographic regions, it may be important to pre- 
screen representative snails from that region. 
The extensive variation in snails we showed 
through microsatellite analysis may be magni- 
fied by geographic distance, revealing even 
more profound differences than what we dem- 
onstrated even in this very restricted field col- 
lection site. 



ACKNOWLEDGMENTS 

This work was supported in part by NIH 
Grants AI-27777 and 42768. We thank Helmut 
Kloos and Rodrigo and Andrea Correa-Oliviera 
for coordination of snail collections in Brazil, as 
well as Nithya Raghavan and André Miller for 
their molecular help and critique of the manu- 
script. We also gratefully acknowledge the lo- 
gistical and administrative support from Jeff 
Bethony and Phil LoVerde. 



LITERATURE CITED 

ANGERS, В., A. ESTOUP & P JARNE, 2000, 
Microsatellite size homoplasy, SSCP, and 
population structure: a case study in the fresh- 
water snail Bulinus truncatus. Molecular and 
Biochemical Evolution, 17.- 1926-1932. 

BANDONI, S. M., M. MULVEY, D. K. KOECH & E. 
S. LOKER, 1990, Genetic structure of Kenyan 
populations of Biomphalaria pfeifferi (Gas- 
tropoda: Planorbidae). Journal of Molluscan 
Studies, 56: 383-391. 

BANDONI, S. M., M. MULVEY & E. S. LOKER, 
2000, Population structure and taxonomic dis- 
crimination among three species of 
Biomphalaria Preston, 1910 (Gastropoda: 



GENETIC VARIATION IN BIOMPHALARIA GLABRATA 



165 



Planorbidae) from Kenya. Zoological Journal 
of the Linnean Society, 129; 387-401. 

BENTON, W. D. & R. W. DAVIS, 1977, Screening 
Xg\ recombinant clones by hybridization to 
single plaques in situ. Science, 196: 180. 

BERGQUIST N. R., 1998, Schistosomiasis vac- 
cine development: progress and prospects. 
Memorias do Instituto Oswalde Cruz, 93: 95- 
101. 

BETHONY, J., A. GAZZINELLI, A. LOPES, W. 
PEREIRA, L. F. ALVES-OLIVEIRA, S. WILL- 
lAMS-BLANGERO, J. BLANGERO, P T 
LoVERDE & R. CORREA-OLIVEIRA, 2001, 
Genetic epidemiology of fecal egg excretion 
during Schistosoma mansoni infection in an 
endemic area in Minas Gerais, Brazil. 
Memorias do Instituto Oswaldo Cruz, 96: 49- 
55. 

CHARBONNEL, N., B. ANGERS, R. RAZA- 
TAVONJIZAY, P BREMOND & P JARNE, 2000, 
Microsatellite variation in the freshwater snail 
Biomphalaria glabrata. Molecular Ecology. 9: 
1006-1007. 

CURTIS, J. & D. J. MINCHELLA, 2000, Schisto- 
some population genetic structure: when 
clumping worms is not just splitting hairs. Para- 
sitology Today, 16: 68-71. 

DAVIES, С M., J. P WEBSTER, O. KRUGER, A. 
MUNATSI, J. NDAMBA& M. E. J. WOOLHOUSE, 
1999, Host-parasite population genetics: a 
cross-sectional comparison of Bulinus 
globosus and Schistosoma haematobium. 
Parasitology, 119: 295-302. 

DEVEREUX, J., R HAEBERLI & O. SMITHIES, 
1987, A comprehensive set of sequence 
analysis programs for the VAX. Nucleic Acids 
Research, 12.- 387-395. 

DON, R. H., R T COX, B. J. WAINWRIGHT K. 
BAKER & J. S. MATTICK, 1991, Touchdown' 
PCR to circumvent spurious priming during 
gene amplification. Nucleic Acids Research, 
19: 4008. 

EXCOFFIER, L., R SMOUSE & J. QUATTRO, 
1992, Analysis of molecular variance inferred 
from metric distances among DNA haplotypes: 
application to human mitochondrial DNA re- 
striction sites. Genetics, 131: 479-491. 

HOFFMAN, J. I., J. P WEBSTER, J. NDAMBA& 
M. E. J. WOOLHOUSE, 1998, Extensive ge- 
netic variation revealed in adjacent popula- 
tions of the schistosome intermediate host 
Biomphalaria pfeifferi from a single river sys- 
tem. Annals of Tropical Medicine and Parasi- 
tology, 92: 693-698. 

HUBENDICK, В., 1958, A possible method of 
schistosome-vector control by competition be- 
tween resistant and susceptible strains. Bulle- 
tin of the World Health Organization, 18: 
1113-1116. 

ITTIPRASERT W., С ROWE, С PATTERSON, 
A. MILLER, N. RAGHAVAN, S. BANDONI, F. 
LEWIS & M. KNIGHT 2003, Assessment of ge- 
netic heterogeneity within laboratory main- 
tained Schistosoma mansoni resistant stocks 
of Biomphalaria glabrata snails by RAPD- 
PCR. Malacologia, 45: 101-108. 



JARNE, R & R J. L. LAGODA, 1996, Micro- 
satellites, from molecules to populations and 
back. Trends in Ecology and Evolution, 11: 
424-429. 

JARNE, R & A. THERON, 2001, Genetic struc- 
ture in natural populations of flukes and 
snails: a practical approach and review. Para- 
sitology, 123: S27-S40. 

JOHNSTON, D. A., E. DIAS NETO, A. J. G 
SIMPSON & D. ROLLINSON, 1993, Opening 
the can of worms: molecular analysis of schis- 
tosome populations. Parasitology Today, 9: 
286-291. 

JONES, С S., A. E. LOCKYER, D. ROLLINSON, 
S. B. PIERTNEY & L. R. NOBLE, 1999, Isola- 
tion and characterization of microsatellite loci in 
the freshwater gastropod, Biomphalaria 
glabrata, an intermediate host for Schisto- 
soma mansoni. Molecular Ecology, 8: 2141- 
2152. 

KANTETY R. v., M. La ROTA, D. E. MATTHEWS 
& M. E. SORRELLS, 2002, Data mining for 
simple sequence repeats in expressed se- 
quence tags from barley, maize, rice, sorghum 
and wheat. Plant Molecular Biology, 48: 501- 
510. 

KLOOS, H., С de SOUZA, A. GAZZINELLI, B. S. 
S. FILHO, R D. С TEMBA, J. BETHONY K. 
PAGE, С GRZYWACZ, R LEWIS, D. 
MINCHELLA, R LoVERDE & R. CORREA- 
OLIVEIRA, 2001, The distribution of 
Biomphalaria spp. in different habitats in rela- 
tion to physical, biological, water contact and 
cognitive factors in a rural area in Minas 
Gerais, Brazil. Memorias do Instituto Oswaldo 
Cruz, 96: 57-66. 

KNIGHT M., A. N. MILLER, N. S. M. GEOG- 
HAGAN, R A. LEWIS & A. R. KERLAVAGE, 
1998, Expressed sequence tags (ESTs) of 
Biomphalaria glabrata, an intermediate snail 
host of Schistosoma mansoni: use in the iden- 
tification of RFLP markers. Malacologia, 39: 
175-182. 

KNIGHT M., A. N. MILLER, С N. PATTERSON, 
С G. ROWE, G MICHAELS, D. CARR, С S. 
RICHARDS & R A. LEWIS, 1999, The identifica- 
tion of markers segregating with resistance to 
Schistosoma mansoni infection in the snail 
Biomphalaria glabrata. Proceedings of the 
National Academy of Sciences (USA), 96: 
1510-1515. 

LANGAND, J., A. THERON, J. P POINTIER, B. 
DELAY & J. JOURDANE, 1999, Population 
structure of Biomphalaria glabrata, intermedi- 
ate snail host of Schistosoma mansoni in 
Guadeloupe Island, using RAPD markers. 
Journal of Molluscan Studies, 65: 425-433. 

LARSON, S. E., R L. ANDERSON, A. N. MILLER, 
С E. COUSIN, С S. RICHARDS, R A. LEWIS & 
M. KNIGHT 1 996, Use of RAPD-PCR to differ- 
entiate genetically defined lines of an interme- 
diate host of Schistosoma mansoni, 
Biomphalaria glabrata. Journal of Parasitol- 
ogy, 82: 237-244. 

MAAT-KIEVIT J. A., M. LOSEKOOT & R. A. 
ROOS, 2001 , From gene to disease; HD gene 



166 



ROWE ET AL. 



and Huntington disease. Ned Tijdschr 
Geneeskd, 145: 2120-2123. 

MARGOLIS, R. L., E. O'HEARN, A. ROSEN- 
BLATT, V. WiLLOUR, S. E. HOLMES, M. L. 
FRANZ, С CALLAHAN, H. S. HWANG, J. С 
TRONCOSO & С A. ROSS, 2001 , A disorder 
similar to Huntington's disease is associated 
with a novel CAG repeat expansion. Annals of 
Neurology, 50: 373-380. 

MAVAREZ, J., M. AMARISTA, J. R POINTIER & R 
JARNE, 2000, Microsatellite variation in the 
freshwater schistosome-transmitting snail, 
Biomphalaria glabrata. Molecular Ecology, 9: 
1009-1011. 

MINCHELLA, D. J. & R T LoVERDE, 1983, Labo- 
ratory comparison of the relative success of 
Biomphalaria glabrata stocks which are sus- 
ceptible and insusceptible to infection with 
Schistosoma mansoni. Parasitology, 86: 335- 
344. 

MULVEY, M. & R. С VRIJENHOEK, 1984, Ge- 
netics of Biomphalaria glabrata: linkage analy- 
sis and crossing compatibilities among 
laboratory strains. Malacologia, 25: 513-524. 

NEWTON, W. L., 1953, The inheritance of sus- 
ceptibility to infection with Schistosoma 
mansoni in Australorbis glabratus. Expehmen- 
tal Parasitology, 2: 242-257. 

OSTRANDER, E. A., R M. JONG, J. RINE & G, 
DUYK, 1992, Construction of small-insert ge- 
nomic DNA libraries highly enriched for 
microsatellite repeat sequences. Proceedings 
of the National Academy of Sciences (USA), 
89: 3419-3423. 

PARAENSE, W. L., 1959, One-sided reproduc- 
tive isolation between geographically remote 
populations of a planorbid snail. American 
Naturalist, 93: 94-101. 

PARAENSE, W. L. & L. R. CORREA, 1963, 
Variation in susceptibility of populations of 
Australorbis glabratus to a strain of Schisto- 
soma mansoni. Revista do Instituto de 
Medicina Tropical de Sao Paulo, 5: 15-22. 

RICHARDS, С S., 1984, Influence of snail age 
on genetic variations in susceptibility of 
Biomphalaria glabrata for infection with Schis- 
tosoma mansoni. Malacologia, 25: 493-502. 

SCHNEIDER, S., D. ROESSLI & L. EXCOFFIER, 
2000, Arlequin: a software for population ge- 
netics data analysis. Ver 2.000. Genetics and 
Biometry Lab, Dept. of Anthropology, Univer- 
sity of Geneva. 



SIRE, C, J. LANGAND, V. BARRAL & A. 
THERON, 2001, Parasite {Schistosoma man- 
soni) and host {Biomphalaha glabrata) ge- 
netic diversity: population structure in a 
fragmented landscape. Parasitology, 122: 
545-554. 

STOTHARD, J. R., R BREMOND, L. 
ANDRIAMARO, B. SELLIN, E. SELLIN & D. 
ROLLINSON, 2001, Bulinus species and 
Madagascar: molecular evolution, genetic 
markers and compatibility with Schistosoma 
haematobium. Parasitology, 123: S261-S275. 

VIARD, R, R BREMOND, R. LABBO, R JUSTY, 
B. DELAY & R JARNE, 1996, Microsatellites 
and the genetics of highly selfing populations 
in the freshwater snail Bulinus truncatus. Ge- 
netics, 142: 1237-1247. 

VIDIGAL, T H. D. A., E. D. NETO, О. D. S. 
CARVALHO & A. J. G. SIMPSON, 1994, Biom- 
phalaria glabrata: extensive genetic variation 
in Brazilian isolates revealed by random ampli- 
fied polymorphic DNA analysis. Experimental 
Parasitology, 79: 187-194. 

WANG, D. G, J.-B. FAN, C.-J. SIAO, A. BERNO, R 
YOUNG, R, SAPOLSKY G. GHANDOUR, N. 
PERKINS, E. WINCHESTER, J. SPENCER, L. 
KRUGLYAK, L. STEIN, L. HSIE, T TOPALO- 
GLOU, E. HUBBELL, E. ROBINSON, M. 
MITTMANN, M. S. MORRIS, N. SHEN, D. 
KILBURN, J. RIOUX, С NUSBAUM, S. ROZEN, 
T J. HUDSON, R. LIPSHUTZ, M. CHEE & E. S. 
LANDER, 1998, Large-scale identification, 
mapping, and genotyping of single-nucleotide 
polymorphisms in the human genome. Sci- 
ence, 280: 1077-1082. 

WEBER, J. L., 1990, Informativeness of human 
(dC-dA)n(dG-dT),, polymorphisms. Genomics, 
1: 524-530. 

WILLIAMS, J. G. K., M. K. HANAFEY, J. A. 
RAFALSKI & S. V. TINGEY, 1993, Genetic 
analysis using random amplified polymorphic 
DNA markers. Methods in Enzymology, 218: 
704-740. 

YOUSIR R, N. HAROUN, A. IBRAHIM & S. EL- 
BARDICY, 1996, Biomphalaria glabrata: a new 
threat for schistosomiasis transmission in 
Egypt. Journal of the Egyptian Society of 
Parasitology, 26: 191-205. 



Revised ms. accepted 27 March 2003 



RESEARCH NOTES 



MALACOLOGIA, 2003, 45(1): 169-174 



A NEW PANAMIC SPECIES OF THE BIVALVE GENUS SEMELINA (SEMELIDAE) 

Eugene V. Coan* 

Department of Invertebrate Zoology and Geology 

California Academy of Sciences, Golden Gate Park, 

San Francisco, California 94118-4599, U.S.A.; gene.coan@sierraclub.org 



ABSTRACT 

A new species of Semelina, S. campbellorum, is described from the Panamic province, 
differing from S. subquadrata (Carpenter, 1857) in having a longer, more tapered posterior 
end, orthogyrate rather than opisthogyrate beaks, more lamellar commarginal ribs with fine 
commarginal threads between the larger lamellae, and a longer, more confluent palliai sinus 
that reaches the anterior adductor muscle scar. Semelina subquadrata is very similar to the 
western Atlantic S. nuculoides (Conrad, 1841). An internal ligament has probably evolved 
more than once within the Tellinoidea, and the Semelidae is probably polyphyletic. The 
genus Semelina is one of several genera that are of somewhat uncertain position. 

Key words: Semelina, Semelidae, Panamic province. 



INTRODUCTION 

In identifying material in connection with 
preparation of a manual on the Panamic Bivalvia, 
it was realized that there are two tropical eastern 
Pacific species of the genus Semelina. Study of 
Carpenter's type material of "7Montacuta" 
subquadrata was necessary to be certain which 
of the two species he described. 

As first suggested by Maxwell (1991 ) in a talk 
and accompanying abstract, the Semelidae as 
presently constituted is probably polyphyletic. 
He cited several pairs of genera with similar 
external shell morphology, differing chiefly in 
the presence of only an external ligament 
(Tellinidae) or also having an internal resilifer 
(Semelidae). Whereas some examples that he 
cited may actually represent convergence in 
general shell morphology, it is likely that an in- 
ternal ligament has evolved more than once 
among taxa now allocated to the Semelidae. 
Indeed, Kamenev & Nadtochy (1999) demon- 
strated that juvenile Macoma have a small in- 
ternal ligament and are not very different from 
species allocated to Abrina in the Semelidae. 
Gustav Paulay (personal communication, 19 
December 2002) has pointed out that some 
IndoPacific species, mostly as yet unde- 
scribed, now allocated to the tellinid genera 
Exotica and Semelangulus actually have both 



an external and an internal ligament, and some 
of these are similar to the New World genus 
Semelina, although only the three taxa dis- 
cussed in this paper have been allocated to 
Semelina in the literature. Additional studies are 
clearly much needed to sort out the clades 
within the Tellinoidea. 

The following institutional abbreviations are 
used here: BMNH, British Museum of Natural 
History collection. The Natural History Mu- 
seum, London, England; CAS, California Acad- 
emy of Sciences, San Francisco, California, 
U.S.A.; LACM, Natural History Museum of Los 
Angeles County, Los Angeles, California, 
U.S.A.; USNM, United States National Museum 
collection. National Museum of Natural History, 
Smithsonian Institution, Washington, D.C., U.S.A. 



SYSTEMATIC TREATMENT 

Semelina Dall, 1900: 986, 994 

Type species (original designation): Amphi- 
desma nuculoides Conrad, in Hodge, 1841: 
347; Conrad, 1845: 73, pi. 41, fig. 7. Natural 
Well, Duplin County, North Carolina; Duplin 
Formation {sensu stricto), 3.2 Ma, late 
Pliocene. Synonyms: Semele nuculoidea, 
auctt., nom. null.; "Semele?" virginiana 



'Mailing address: 891 San Jude Avenue, Palo Alto, California, 94306-2640, U.S.A.; also Research Associate, Santa 
Barbara Museum of Natural History and the Natural History Museum of Los Angeles County. 



169 



170 



COAN 



Meyer, 1888: 143; S. nuculoidea lirulata Dall, 
1900: 994; S. sirulata Dall, auctt., nom. null. 

Diagnosis 

Small, longer anteriorly; internal ligament in a 
short to elongate resilifer, not produced ven- 
trally beyond the hinge plate; external ligament 
in a narrow groove; right valve with elongate 
anterior and posterior lateral teeth, the left 
valve fitting into the grooves between them and 
the dorsal margin; lunule and escutcheon 
present; right valve with a narrow, inconspicu- 
ous anterior cardinal and a large posterior car- 
dinal; left valve with a large anterior cardinal 
and a narrow posterior cardinal that defines the 
posterior edge of the resilifer; palliai sinus 
large, deep. Sculpture of fine, dense 
commarginal ribs. 

This genus first appears in the early Miocene 
Chipóla Formation of Calhoun County, Flohda, 
with Semelina cythereoidea Dall, 1900 (p. 994, 
pi. 44, fig. 5). The eastern U.S./western Atlantic 
Semelina nuculoides is treated by Campbell 
(1993: 42, pi. 17, fig. 156), Diaz M. & Puyana H. 
(1994: 97, pi. 28, fig. 268), Gardner (1944: 102- 
103, pi. 17, figs. 18-21), Lamy (1915), Redfern 
(2001: 231-232, pi. 99, fig. 948), and Rios 
(1994: 275, pi. 94, fig. 1352). It now occurs 
from North Carolina to the West Indies and 
Brazil, and is recorded as early as the early 
Pliocene (3.8 Ma) in the southeastern U.S.A. 

Semelina subquadrata (Carpenter, 1857) 
Figures 1-4 

"7Montacuta" subquadrata Carpenter, 1857a: 

248, nom. nud.; Carpenter, 1857b: 113; 

Brann, 1966:35, pi. 10, fig. 162 
"?Mysella" subquadrata (Carpenter) - Dall, 

1899:881 
Rochefortia subquadrata (Carpenter) - Hertlein 

& Strong, 1947: 135 [in part; their specimen 

from Bahía Santa Inez, Baja California Sur, is 

a Mysella- CAS 162714; Loc. 17746] 
Semelina nuculoides Conrad, non Conrad, in 

Hodge, 1841 - Hoffstetter, 1952: 41 
Mysella subquadrata (Carpenter) - Keen, 

1958: 107 
Semelina subquadrata (Carpenter) - Olsson, 

1961: 375, pi. 66, fig. 11; Keen, 1968: 395, fig. 

1 1 , 400; Keen, 1 971 : 259, 260, fig. 661 

Description 

Ovate-elongate, evenly inflated; beaks al- 
most at posterior end, opisthogyrous; posterior 



end subtruncate; surface with fine, even, 
rounded commarginal ribs, some of which be- 
come lamellar on posterior slope, while others 
die out before reaching the posterior slope; pal- 
lia! sinus ending well short of anterior adductor 
muscle scar and confluent with the palliai line 
for only about a third of its length; shell white, 
sometimes with a pinkish flush. Length to 
6.6 mm. 

Type Material & Locality 

BMNH 1857.6.4.503/1, lectotype herein, the 

larger specimen, a right valve, length = approxi- 
mately 3.2 mm (Fig. 4); BMNH 1857.6.4.503/2, 
paralectotype, a smaller left valve measuring 
approximately 1.2 mm. Both specimens re- 
main glued to Carpenter's original glass slide. 
Mazatlán, Sinaloa, México (32.2°N); Frederick 
Reigen. A lectotype is designated because the 
small glue-covered left valve is too small to be 
reliable identified. 

Distribution 

Bahía Magdalena, Pacific coast of Baja Cali- 
fornia Sur (24.5°N) [LACM 49-234.1], into the 
Golfo de California as far north as Isla 
Danzante, Baja California Sur (25.8°N) 
(Skoglund Collection), and Estero Soldado, 
Sonora (27.9°N) [LACM 73-5.45], México, to 
Manglaralto, Guayas, Ecuador (1.9°S) [CAS 
162257]; probably as far south as Punta Santa 
Elena, Guayas, Ecuador (2.2°S), where it has 
been recorded as a subfossil (Hoffstetter, 1952: 
41); Isla Marchena, Islas Galápagos, Ecuador 
(0.3°N) [LACM 34-285.5]; from the intertidal 
zone to 220 m (mean = 43.1 m; n = 17); no 
bottom types noted on labels. I have seen 20 
lots; Carol Skoglund provided data for 4 addi- 
tional lots. 

Referred Material 

Stations in México: LACM 49-234.1 - Bahía 
Magdalena, Baja California Sur - 33 m; 
Skoglund Collection - Isla Danzante, Baja 
California Sur - 30-45 m; Skoglund Collec- 
tion - Los Frailes, Baja California Sur- 50- 
66 m; LACM 73-5.45 - Estero Soldado, 
Sonora - intertidal zone; Skoglund Collection 
- Bahía San Carlos, Sonora - 15-30 m; 
BMNH 1857.6.4.503 - Mazatlán, Jalisco - 
type lot; CAS 161375 - Mazatlán, Jalisco - 
"dredged"; Skoglund Collection 
Cuastecomate, Jalisco - 12-30 m; LACM 
38-263.1, CAS 164336 - Black Rocks, 



A NEW PANAMIC SEMELINA 



171 




FIGS. 1-4. Semelina subquadrata. FIG. 1. External view of left valve; length, 4.6 mm. SBMNH 348120; 
Balboa, Panamá; commercial dredgings; ex Skoglund Collection. FIG. 2. Same specimen; close-up of 
sculpture on border between central and posterior slopes; width of ribs approximately 60 pm. FIG. 3. 
Sketch showing hinge, adductor muscle scars, palliai sinus, palliai line, and cruciform muscle scars 
of right valve; CAS 161375; Mazatlán, Sinaloa, México; length, 5.1 mm. FIG. 4. Lectotype of 
'^Montacuta" subquadrata Carpenter; BMNH 1857.6.4.503/1, right valve approximately 3.2 mm long. 
FIG. 5. Semelina nuculoides. External view of left valve; length, 4.5 mm. SBMNH 348121; 40 miles SE 
of Charleston, South Carolina; 60 m; ex Campbell Collection. 

FIGS. 6-7. Semelina campbellorum. FIG. 6. Holotype; external views of left and right valves; SBMNH 
348119; Bahia de Santiago, Colima, México; length, 4.4 mm. FIG. 7. Paratype; SBMNH 348119; external 
view of left valve; same station; length, 3.7 mm. 




FIGS. 8, 9. Semelina campbellorum. FIG. 8. Same specimen as Fig. 7; close-up of sculpture on 
border between central and posterior slopes; distance between higher ribs approximately 100 pm. 
FIG. 9. Sketch showing hinge, adductor muscle scars, palliai sinus, palliai line, and cruciform muscle 
scars of right valve; LACM 37-218.2; Bahía San Ignacio, Sinaloa, México; length, 5.0 mm. 



Jalisco - 37 m; LACM 65-16.18 - Bahia 
Banderas, Jalisco; LACM 33-136.1 - 
Petatlán, Guerrero- 11 m; LACM 34-241.1 - 
Petatlán, Guerrero - 183-256 m; LACM 
38.9.12 - Bahía Guatuico, Oaxaxa - 73-128 m 

Stations in Nicaragua: CAS 164337 - Corinto, 
Chinandega - no depth recorded; CAS 
164338 - Corinto, Chinandega - no depth 
recorded 

Stations in Costa Rica: LACM 72-19.39 - Bahía 
de Salinas, Guanacaste - 1.5-11 m; LACM 
80-60.17 - Cabo Santa Elena, Guanacaste - 
intertidal zone; LACM 86-26.33 - Playa 
Nancite, Guanacaste - beach drift; Skoglund 
Collection - Playa Tamarindo, Guanacaste - 
6-15 m; LACM 84-152.5 - Bahía Ballena, 
Puntarenas- 15-21 m. 

Stations in Panamá: LACM 39-259.2 - Isla 
Ladrones, Chiriquí - 99 m, Skoglund Collec- 
tion - Balboa, Panamá 

Stations in Ecuador: CAS 162257 - 
Manglaralto, Guayas - no depth recorded; 
LACM 34-285.5 - Isla Marchena, Islas 
Galápagos - 37 m 

Discussion 

As pointed out by OIsson (1961: 375), this 
species is very similar to the western Atlantic 
Semolina nuculoides (Conrad, in Hodge, 1841 ), 
and the two may be indistinguishable. Resolution 
of this question would require more abundant 
material of Semelina nuculoides from its type lo- 
cality in the Pliocene of North Carolina than was 
at my disposal. (Conrad's type material was not 
located in the Academy of Natural Sciences of 



Philadelphia by Moore, 1962: 80.) Eastern Pa- 
cific material of S. subquadrata differs from Re- 
cent specimens from North Carolina identified as 
S. nuculoides (Fig. 5) in having higher, more 
pointed, more posteriorly placed beaks. 

Semelina campbellorum Coan, 2002, 
new species 
Figures 6-9 

Description 

Subthgonal; anterior end more inflated; beaks 
about two-thirds of way to posterior end, 
orthogyrous; posterior end tapered, slightly 
sinuous, subtruncate ventrally; surface with 
lamellar commarginal ribs, becoming broader 
ventrally, and with fine commarginal threads 
between them; major lamellar ribs more higher 
near and on posterior slope, whereas some of 
them become thread-like and end anterior to 
posterior slope; palliai sinus just touching ante- 
rior adductor muscle scar, and confluent with 
the palliai line for most of its length; internal liga- 
ment in a short to elongate resilifer, not pro- 
duced ventrally beyond the hinge plate; 
external ligament in a narrow groove; right 
valve with elongate anterior and posterior lat- 
eral teeth, the left valve fitting into the grooves 
between them and the dorsal margin; lunule 
and escutcheon present; right valve with a nar- 
row, inconspicuous anterior cardinal and a 
large posterior cardinal; left valve with a large 
anterior cardinal and a narrow posterior cardi- 
nal that defines the posterior edge of the 
resilifer. Length to 7.0 mm. 



ANEW PANAMIC SEMELINA 



173 



Type Material & Locality 

SBMNH 348118, holotype; length, 4.4 mm; 
height, 3.3 mm; width, 2.0 mm (Fig. 6); SBMNH 
3481 1 9, paratypes, 7 pairs, including the two fig- 
ured herein (Figs. 7, 8); USNM 1008293; para- 
type, 1 pair. Skoglund Coll., paratypes, 5 pairs. 
Off Punta de Juluapan, Bahía de Santiago, Coli- 
ma, México (19°5'N, 104°23'W); 30-60 m; Paul 
& Carol Skoglund; December 1975 and later. 

Distribution 

In the Golfo de California as far north as Bahia 
de los Angeles, Baja California (29. rN) [LACM 
86-195.5], and Bahia San Ignacio, Sinaloa 
(25.4°N) [LACM 37-218.2], México, to Islas Lo- 
bos de Afuera, Lambayeque, Perú (6.9°S) 
[LACM 35-161.1]; Isla Socorro, Islas Revillagige- 
dos, México [LACM 34-246.3, 34-247.5]; Isla 
Marchena, Islas Galápagos, Ecuador (0.3°N) 
[LACM 34-285.6]; 5-100 m (mean = 44 m; n = 
29). The only bottom type noted on labels is 
sand. I have seen 28 lots, and Carol Skoglund 
provided data for an additional lot. 

Referred Material 

Stations in México: LACM 86-195.5 - Bahia de 
Los Angeles, Baja California -5 m; Skoglund 
Collection - Bahia Concepción, Baja Califor- 
nia Sur - 8-15 m; LACM 39-99.10 - Bahia 
Coyote, Baja California Sur - 4-5 m; LACM 
37-185.5- Isla Ildefonso, Baja California Sur- 
91 m; LACM 49-238 1 - Bahia San Francisco, 
Baja California - 46 m; LACM 78-1 20.20 - Isla 
Danzante, Baja California - 43-55 m; LACM 
36-144.3 - Isla San Francisco, Baja California 

- 42 m; LACM 49-237.1 - Bahia Frailes, Baja 
California Sur - 91 m; LACM 34-247.5 - Isla 
Socorro, Islas Revillagigedos - 7-18 m; LACM 
34-246.3 - Isla Socorro, Islas Revillagigedos - 
37 m; LACM 37-218.2 - Isla San Ignacio, 
Sinaloa - 42 m; SBMNH 348118, 348119, 
USNM 1008293, Skoglund Collection - Punta 
de Juluapan, Bahia de Santiago, Colima - 30- 
60 m - Type lot; LACM 38-265.4 - Bahía 
Chacahua, Oaxaca - 75 m 

Stations in Costa Rica: LACM 72-1 3.30 - Bahia 
Juanilla, Guanacaste - 37 m; LACM 72-7,31 

- Bahia Santa Elena, Guanacaste - 1.2-11 
m; LACM 72-30.26 - Punta Santa Elena, 
Guanacaste - 12-15 m; LACM 72-57.37 - 
Punta Quepos, Puntarenas - 21 m; LACM 
72-66.38 - Isla del Caño, Puntarenas - 56 m. 

Stations in Panamá: LACM 39-259.1 - Isla Lad- 
rones, Chiriqui - 99 m; LACM 38-184.2 - Islas 



Secas, Chiriqui - 22 m; LACM 34-251 .5 - Islas 
Secas, Chiriqui - 34-146 m; LACM 34-252,9 - 
Bahia Honda, Veraguas - 55-64 m; LACM 34- 
114.17- Isla Jicarita, Veraguas -44 m 

Stations in Colombia: LACM 35-179.5 - Bahia 
Octavia, Choco - 82 m; LACM 38-224.2 - Isla 
Gorgona, Nariño- 18-37 m 

Stations in Ecuador: LACM 33-180.1 - Bahia 
Santa Elena, Guayas -46 m; LACM 34-307.4 
- Isla Santa Clara, Guayas - 64 m; LACM 34- 
285.6 - Isla Marchena, Islas Galápagos - 37 m 

Station in Perú: LACM 35-161.1 - Bahia Norte, 
Islas Lobos de Afuera, Lambayque - 22 m 

Discussion 

This species differs from S. subquadrata 
(Carpenter, 1857) in having a longer, more ta- 
pered posterior end, orthogyrate rather than 
opisthogyrate beaks, more lamellar commarginal 
ribs with fine commarginal threads between the 
larger ribs, and a more elongate palliai sinus. It 
differs from small specimens of Semele, such 
as S. yames/ Coan, 1988 (pp. 33-35, figs. 62, 
63), which never attains a large size, in having 
more prominent lateral teeth, especially the ante- 
rior lateral, in the right valve and in having a less 
conspicuous posterior cardinal in the left valve. 

Etymology 

This species is named for the Campbell clade 
of Spartanburg, South Carolina, U.S.A., all of 
whom have studied and published on the Mol- 
lusca - Lyie D. Campbell, Sarah С Campbell, 
David С Campbell, Matthew R. Campbell, and 
Andrew С Campbell. 



ACKNOWLEDMENTS 

LyIe D. Campbell kindly provided Pliocene and 
Recent specimens of Semelina nuculoides for 
examination. Kathie Way of The Natural History 
Museum, London, loaned Carpenter's type ma- 
terial of Semelina subquadrata; Lindsey Groves 
of the Natural History Museum of Los Angeles 
County, California, and Elizabeth Kools of the 
CaliforniaAcademy of Sciences, San Francisco, 
California, loaned material from those collec- 
tions. Carol Skoglund made material and data 
from her collection available to me, including the 
specimens that became the type lot of S. 
campbellorum. Gustav Paulay provided informa- 
tion about systematic relations in the Tellinoidea. 
Yolanda Camacho took the SEM photographs, 
and Daniel L. Geiger prepared the plates. 



174 



COAN 



LITERATURE CITED 

BRANN, D. C, 1966, Illustrations to "Catalogue 
of the collection of Mazatlan shells" by Philip 
P. Carpenter. Ithaca, New York (Paleontológi- 
ca! Research Institution). Ill pp., 60 pis. 

CAMPBELL, L. C, 1 993, Pliocene molluscs from 
the Yorktown and Chowan River formations 
in Virginia. Virginia Division of Mineral 
Resources Publication, 27: vii + 259 pp., incl. 
43 pis. 

CARPENTER, P. P., 1857a, Report on the 
present state of our knowledge with regard to 
the Mollusca of the west coast of North 
America. Report of the British Association for 
the Advancement of Science, 26[for 1856]: 
159-368 + 4, pis. 6-9. 

CARPENTER, P P., 1857b, Catalogue of the 
collection of Mazatlan shells, in the British 
Museum: collected by Frederick Reigen. Lon- 
don (British Museum), xii + 552 pp. [some as 
i-iv + ix-xvi] [also published simultaneously as 
Catalogue of the Reigen collection of 
Mazatlan Mollusca, in the British Museum. 
Warrington (Oberlin Press), viii + xii + 552 pp.] 
[reprinted by Paleontological Research Insti- 
tution, 1967]. 

COAN, E.V., 1988, Recent eastern Pacific spe- 
cies of the bivalve genus Semele. The Ve- 
liger 31(1/2): 1-42. 

CONRAD, T A., 1841. See Hodge & Conrad 
(1841). 

CONRAD, T A., 1845, Fossils of the {medial 
Tertiary or) Miocene formation of the United 
States, no. 3. Philadelphia (Dobson). Pp. 57- 
80, pis. 30-32. 

DALL, W. H., 1899, Synopsis of the Recent and 
Tertiary Leptonacea of North America and the 
West Indies. Proceedings of the United States 
National Museum, 21(1177): 873-897, pis. 87, 
88. 

DALL, W. H., 1900, Contributions to the Ter- 
tiary fauna of Florida, with especial reference 
to the silex beds of Tampa and the Pliocene 
beds of the Caloosahatchie River, including 
in many cases a complete revision of the ge- 
neric groups treated of and their American 
Tertiary species. Part V. Teleodesmacea: 
Solen to Diplodonta. Transactions of the 
Wagner Free Institute of Science of Philadel- 
phia, 3(5): 949-1218, pis. 36-47. 

DIAZ M., J. M. & M. PUYANAH., 1994, Moluscos 
del Caribe Colombiano. Un catálogo ilustrado. 
Santafe de Bogota (Colciencias & Fundación 
Natura Colombia). 291 pp., [12] + 78 pis. 

GARDNER, J., 1944, Mollusca from the Miocene 
and lower Pliocene of Virginia and South Caro- 
lina. Part I. Pelecypoda. United States Geo- 
logical Survey Professional Paper, 1 99A: iv + 
178 pp., 23 pis. 

HERTLEIN, L. G. & A. M. STRONG, 1947, East- 
ern Pacific expeditions of the New York Zoo- 
logical Society. XXXVI. Mollusks from the west 
coast of Mexico and Central America. Part V. 



New York Zoological Society. Zoológica, 31 (4): 
129-150, pi. 1. 

HODGE, J. T., with an appendix by T. A. 
CONRAD, 1841 , Observations on the Second- 
ary and Tertiary formations of the southern 
Atlantic states. American Journal of Science 
and the Arts, 41(2): 332-348, pi. 2 [Conrad 
appendix: pp. 344-348, pi. 2]. 

HOFFSTETTER, R., 1952, Moluscos subfósi- 
les de los estanques de sal de Salinas (Pen. 
De Santa Elena, Ecuador). Comparación con 
la fauna actual del Ecuador. Boletín del 
Instituto de Ciencias Naturales, 1(1): 3-79. 

KAMENEV, G. M. & V. A. NADTOCHY 1999, Spe- 
cies of Macoma (Bivalvia: Tellinidae) from the 
Pacific coast of Russia, previously described 
as Abrina (Bivalvia: Semelidae). Malacologia 
41(1): 209-230. 

KEEN, A. M., 1958, Sea shells of tropical w/est 
America; marine mollusks from Lower Califor- 
nia to Colombia, 1st ed. Stanford, California 
(Stanford University Press), xii + 624 pp., 10 
pis. [repr.: 1960]. 

KEEN, A. M., 1 968, West American mollusk types 
at the British Museum (Natural History), IV. 
Carpenter's Mazatlan collection. The Veliger, 
10(4): 389-439, pis. 55-59. 

KEEN, A. M., 1971, Sea shells of tropical west 
America: marine mollusks from Baja Califor- 
nia to Peru, 2nd ed. Stanford, California 
(Stanford University), xiv + 1064 pp., 22 pis. 
[repr., 1984 with only 12 pis.]. 

LAMY, E., 1915, Note sur le Semele nuculoides 
Conrad. Bulletin du Muséum d'Histoire 
Naturelle 21(1): 17-18. 

MAXWELL, PA., 1991, Clades vs. grades in bi- 
valve classification - some examples from the 
Tellinacea. American Malacological Union, 
Program and Abstracts, 1991: 42. 

MEYER, О., 1888, On Miocene invertebrates 
from Virginia. Transactions of the American 
Philosophical Society 2Ъ{^21)■. 135-144, 1 pi. 

MOORE, E. J., 1962, Conrad's Cenozoic fossil 
marine mollusk type specimens at the Acad- 
emy of Natural Sciences of Philadelphia. Pro- 
ceedings of the Academy of Natural Sciences 
of Philadelphia, 114(2): 23-120, 2 pis. 

OLSSON, A. A., 1961, Mollusks of the tropical 
eastern Pacific particularly from the southern 
half of the Panamic-Pacific faunal province 
(Panama to Peru). Panamic-Pacific 
Pelecypoda. Ithaca, New York (Paleontologi- 
cal Research Institution). 574 pp., 86 pis. 

REDFERN, С, 2001, Bahamian seashells: a 
thousand species from Abaco, Bahamas. Boca 
Raton, Florida (Bahamianseashells.com). x + 
280 pp., 124 pis. 

RIOS, E. de С, with the collaboration of, M. 
HAIMOVICI, J. A. ALVARES PERES & R. 
AGUIAR DOS SANTOS, 1994, Seashells of 
Brazil, 2nd ed. Rio Grande (Universidade do 
Rio Grande). 368 pp., 113 pis. 

Revised ms. accepted 13 January 2002 



MALACOLOGIA, 2003, 45(1 ): 1 75-1 78 

A FIELD STUDY OF THE LIFE HISTORY 
OF AN ENDEMIC HAWAIIAN SUCCINEID LAND SNAIL 

Susan G. Brown, B. Kalani Spain & Karen Crowe!! 

Social Sciences Division, University of Hawaii at Hilo, 
200 W. Kawili Street, Hilo Hawaii 96720-4091, USA; susanb@tiawaii.edu 



The Hawaiian land snail fauna is noted for its 
diversity and liigh level of endemism (Cowie, 
1995). Almost nothing, however, is known of the 
ecology of any of the species, with the excep- 
tion of the life histories of a few achatinelline tree 
snail species (Hadfield et al., 1 993). The Hawai- 
ian Succineidae comprise about 42 species 
found in diverse habitats from arid coastal dune- 
land to rainforest (Cowie et a!., 1995), but the 
only published work on their ecology is a labora- 
tory study of growth and reproduction in Succinea 
thaanumi Ancey, 1899, and Catinella rotundata 
(Gould, 1846) (Rundell & Cowie, in press). 

Here, we report a field study of the life history 
of S. thaanumi. Unlike many Hawaiian land snail 
species, S. thaanumi remains relatively com- 
mon. It occurs on the eastern side of the island 
of Hawaii, the largest in the Hawaiian chain. The 
study was conducted in the Pu'u Maka'ala Natu- 
ral Area Reserve in two areas (10 m^ and 2 m^ 
about 12 m apart) at an elevation of 1,067 m. 
The under-story consisted of native plants of 
the following genera: Cyanea, Broussaisia, 
Pipturus, Straussia, Freycinetia, and Cibotium. 
The over-story consisted primarily of the Ha- 
waiian endemic tree Metrosideros polymorpha. 
Snails and their egg clutches were found on all 
plants but mostly on Broussaisia, one of the 
most common under-story plants in the study 
site. Data were collected, usually twice weekly, 
from 22 February 2000 to 4 June 2001 , a total 
of 104 occasions. In addition, rainfall was re- 
corded on 88 occasions with a rain gauge 
placed in a clearing on the perimeter of the study 
site, temperature on 68 occasions, and humid- 
ity on 37 occasions. 

Each plant in the study site was examined for 
the presence of snails and egg clutches. Egg 
clutches consisted of transparent, viscous 
material containing developing embryos and 
were laid primarily attached to leaf tips but also 
occasionally on the stems and other parts of 
the plants. This contrasts with other land snails, 
which lay their eggs primarily in moist soil 
(Tompa, 1984), and with Succinea putris 



Linnaeus, 1 758, which lays its eggs among the 
roots of rushes (Rigby, 1965). Maximum shell 
length of each snail was measured with cali- 
pers, with a minimum amount of contact and 
without moving the snail. The number of em- 
bryos in each clutch was recorded. In addition, 
the location of the snail on a plant (e.g., on the 
top, bottom, or petiole of a leaf, or on the stem) 
and whether the snail's body was retracted into 
the shell or not were recorded. 

Average snail size(F(ii 92)= 19.6; p< 0.0001) 
and the number of new egg clutches (F(ii 44^ = 
2.8; p < 0.008) varied through the year. In Feb- 
ruary and March of 2000 and 2001, the size- 
frequency distribution was unimodal, with the 
highest numbers in the 5-6 mm range (Fig. 1 ). 
Few egg clutches were observed in February, 
but by March, the number of clutches had in- 
creased (Fig. 2). By April of both years, mean 
snail size had increased but the size-frequency 
distribution remained unimodal. In May, how- 
ever, the distribution became bimodal, with the 
appearance of large numbers of very small 
(1 mm) snails, which we interpret as the off- 
spring of the snails in the larger size-class (Fig. 
1 ). Numbers of egg clutches also increased in 
April (Fig. 2). The distributions remained bimo- 
dal through August, but by this time fewer large 
snails were observed, presumably because 
they were dying off. The numbers of egg 
clutches increased from April to August (Fig. 2). 
From September through November, the size 
distribution became skewed by the increased 
numbers of newly emerged snails. These snails 
appeared to be growing about 1 mm per month 
because the modal size of this size-class in- 
creased from 1 mm in September to 3 mm in 
November. Growth continued through Decem- 
ber and January (Fig. 1). Numbers of egg 
clutches decreased from September through 
January (Fig. 2). The number of embryos found 
in a clutch ranged from 1 to over 16. In most 
months, the average was 6-8, except for Feb- 
ruary and March when it averaged 1-2. This 
difference is significant (F(ii 33) = 6.3; p < 0.001 ). 



175 



176 



BROWNETAL. 




I.^jL I 



August 00 





1 2 3 4 5 6 7 8 9 10 11 121314 



10 11 121314 12 3 4 



y 1011121314 123456739 1011121314 



FIG. 1. Monthly size-frequency distributions of snail size. The Y-axis is the number of snails of a 
particular size, averaged over data collecting occasions. The X-axis is snail size. 



In 2000, copulations were first observed on 
13 June and in 2001 on 30 May. Most copula- 
tions were between pairs of snails (succineids 
are hermaphrodites) with the top snail acting 
as the male, mating by "shell mounting" (Asami 
et al., 1998). In one case, we observed three 
snails with the middle one acting as both a male 
and a female. We observed one snail laying an 
egg clutch. The viscous material containing the 
eggs was exuded from the snail's genital pore. 
The completed clutch was about three times 
larger than the snail, which may be explained if 
the viscous material absorbed moisture from 
the air, as reported for Ovachlamys fulgens 
(Gude, 1900) (Barrientes, 1998). We interpret 
these patterns as representing an annual, 
semelparous life-cycle, which agrees well with 
the results of the laboratory study of S. thaanumi 



of Rundel! & Cowie (in press). Reproduction is 
primarily in the May-November period, but 
snails of all sizes and some egg clutches were 
observed throughout the year. Therefore, at least 
some snails were growing and reproducing out 
of synchrony with the overall population. 

Snail behavior was related to the microclimate 
of the study area. Numbers of snails recorded 
were negatively related to temperature (r = 
-0.44; F(i65) = 15.8; p < 0.0001), suggesting 
that the snails moved into a different part of the 
habitat as the temperature increased. However, 
temperature did not vary significantly through 
the year (F(ii,55) = 0.86; p = 0.59), possibly be- 
cause the study site was in the interior of an 
upland rainforest. The number of new clutches 
dropped to essentially zero when the humidity 
was below 80% (Fig. 3). Regression analyses 



LIFE HISTORY OF ASUCCINEID SNAIL 



177 



30- 



20- 



10- 




JFMAMJJASOND 



showed that the percent of snails observed on 
the tops of leaves (F(3 30) = 9.4; p < 0.0001 ) and 
the bottoms of leaves (F(3 30) = 33.6; p < 0.0001 ), 
and the percent of snails observed with their 
bodies extended out of their shells (F(3 30) = 32.5; 
p < 0.0001) were significantly related to tem- 
perature and humidity. In low humidity, the snails 
tended to be on the bottoms of leaves; as hu- 
midity increased, especially if it was raining, they 
tended to be on the tops. When humidity 
reached 80%, nearly all of the snails' bodies 
were extended out of their shells. Snails on the 
bottoms of leaves were usually retracted into 
their shells, whereas snails on the tops of leaves 
were usually extended. Presumably this behav- 
ior is related to one of the major problems faced 
by terrestrial snails, desiccation (Riddle, 1983). 



ACKNOWLEDGMENTS 



FIG. 2. Frequency distribution of the number of 
egg clutches observed during a month, averaged 
over the two years of the study. The letters on 
the X-axis are the first letters of the month. Bars 
are standard errors of the means. 



We thank Judy Spain and Johnnie Murphy for 
help in collecting data, and Judy Spain for help in 
reviewing the manuscript. We also thank the re- 
viewers for their thoughtful and helpful comments. 



50 



40 



Ф 30 i 
о 

_g 
Ü 



J2 



20 



10 













T 




























TT 








T ' 

T 
















T 


























▼ 


T 




J 












T 




T T 












T 


T 


T ^ 










▼ 


T 

T 






TT 




T 


T 

T 


T 


T 

T 




T 



60 



70 



80 
Humidity 



90 



100 



FIG. 3. Scatterplot of the relationship between number of new clutches re- 
corded on an observation occasion and humidity. 



178 



BROWNETAL. 



LITERATURE CITED 

ASAMI, T, R. H. COWIE & K. OHBAYASHI, 1998, 
Evolution of mirror images by sexual asymmet- 
ric mating behavior in hermaphroditic snails. 
The American Naturalist, 152: 225-236. 

BARRIENTOS, Z., 1998, Life history of the ter- 
restrial snail Ovacliiamys fulgens (Stylom- 
matophora: Helicarionidae) under laboratory 
conditions. Revista de Biologie Tropica, 46: 
369-384. 

COWIE, R. H., 1995, Variation in species diver- 
sity and shell shape in Hawaiian land snails: in 
situ speciation and ecological relationships. 
Evolution, 49: 1191-1202. 

COWIE, R. H., N. L. EVENHUIS & С С. 
CHRISTENSEN, 1995, Catalog of the native 
land and freshwater molluscs of the Hawaiian 
Islands. Leiden, Backhuys Publishers, vi + 
248 pp. 



HADFIELD, M. G., S. E. MILLER & A. H. 
CARWILE, 1993, The decimation of endemic 
Hawai'ian [sic] tree snails by alien predators. 
American Zoologist, 33: 610-622. 

RIDDLE, W. A., 1983, Physiological ecology of 
land snails and slugs. Pp. 431-461, in: w. D. 
RUSSELL-HUNTER, ed.. The Mollusca. Volume 
6. Ecology. New York, Academic Press. 

RIGBY, J., 1965, Succinea putris: a terristrial 
opisthobranch mollusc. Proceedings of the 
Zoological Society of London, 144: 445-486. 

RUNDELL, R. J. & R. H. COWIE, in press. Growth 
and reproduction in Hawaiian succineid land 
snails. Journal of Molluscen Studies. 

TOMPA, A. S., 1984, Land snails (Stylomma- 
tophora). Pp. 47-140, in: A. s. TOMPA, ed., The 
Mollusca Volume 7. Reproduction. New York: 
Academic Press. 

Revised ms. accepted 16 January 2003 



MALACOLOGIA, 2003, 45(1): 179-184 

DRY SEASON SURVIVAL IN A FLORIDA APPLE SNAIL 
{POMACEA PALUDOSA SAY) POPULATION 

Philip C. Darby, Patricia L. Valentine-Darby & H. Franklin Percival 

Department of Biology, University of West Florida, 11000 University Parkway, 
Pensacola. Florida, USA - 32514; pdarby@uwf.edu 



ABSTRACT 

Previous reports concluded that Florida apple snails (Pomacea paludosa Say) have 
little tolerance to dry conditions, which stands in contrast to other Ampullariidae studied to 
date. Given that inconsistency, and the fact that we do find snails in wetlands that periodi- 
cally dry down, we were interested in elucidating dry season survival patterns in this spe- 
cies. We conducted a field study in 1995 in which snails with miniature radio transmitters 
were monitored weekly in flooded and dry marsh. Snails from this same wetland were 
collected during the 1996 dry season and monitored during a laboratory study designed 
to simulate a marsh in dry down conditions. We found that apple snails die at a rate of 
approximately 10-15% per week in May and June regardless of water levels. Dry condi- 
tions exacerbated snail mortality in the laboratory study (x^ = 6.53, df = 1, P = 0.011), but 
not in the field (/^ = 0.48, df = 1 , P = 0.49). The mean size of snails still alive at the end of 
the laboratory study were significantly smaller than those that had died during the study 
(T = 2.25, 9 df, P = 0.025), indicating they were young of the year. Our data support 
previously unsubstantiated reports that Pomacea paludosa is essentially an annual spe- 
cies that experiences a post-reproductive die-off near the end of the dry season. It ap- 
pears previously reported apple snail deaths attributed to dry conditions were confounded 
by an annual post reproductive die-off. Florida apple snails may be well equipped to sur- 
vive in these fluctuating wetland environments, but how drying events affect their popula- 
tion demography remains largely unanswered. 

Key words; Pomacea paludosa, apple snail, survival, water level, wetland, Florida. 



INTRODUCTION 

Estimates of survival are critical to under- 
standing population dynamics and the relation- 
ship between population density, environmental 
gradients, and the impacts of environmental 
fluctuations. Freshwater snails of the genera 
Pila and Pomacea (Caenogastropoda: Am- 
pullariidae) commonly referred to as apple 
snails. Inhabit tropical and subtropical wet- 
lands, some of which are subject to periodic 
drying events (i.e., the water table falls below 
ground level). Pila and Pomacea species stud- 
ied to date can survive dry conditions for 3 to 
25 months (Cowie, 2002), although direct com- 
parisons of survival under wet versus dry con- 
ditions have not been made for any apple snail 
species. Apple snails have drawn attention be- 
cause of their critical role as prey items for 
wetland vertebrate fauna (e.g., Snyder & 



Snyder, 1969; Donnay & Beisinger, 1993) and 
because they are considered pests in rice and 
taro agriculture (Cowie, 2002). Information link- 
ing survival with hydrology is fundamental to 
understanding apple snail autecology and the 
potential impacts of water management prac- 
tices on snail populations. 

The research described here was prompted 
by several reports about the inability of Florida 
apple snails, Pomacea paludosa Say, to toler- 
ate drying events, in contrast to other Pila and 
Pomacea species. Florida wetlands experi- 
ence a dry season that generally extends from 
November through May or June (Chen & 
Gerber, 1990), and in some years culminates 
in a dry down (Kushlan, 1990; Duever et al., 
1 994). Despite the persistence of snail popula- 
tions in these wetlands, one field study 
(Kushlan, 1975) and two lab studies (Little, 
1968; Turner, 1994) concluded that Florida 



179 



180 



DARBY ETAL. 



apple snails were intolerant to dry downs, even 
those less than one month in duration. How- 
ever, there is also indirect evidence (accumula- 
tions of empty shells in the field) of an annual 
spring adult die-off that would typically coincide 
with the May-June drying events (Manning, 
1979). If Florida apple snails were an annual 
species, previous reports of dry down intoler- 
ance may have been confounded by a coinci- 
dental adult die-off. The objective of this study 
was to compare survival of P. paludosa in wet 
versus dry marsh in order to address the con- 
tradictory available information on dry down tol- 
erance in this species. 



METHODS 



Field Study 



We conducted a field study in 1995 in the 
easternmost portion of the Blue Cypress Water 
Management Area (BCWMA), a wetland unit 
that is part of the Upper St. Johns River Basin, 
Indian River County, Florida. Darby et al. (2002) 
described the study site, which had the highest 
ground elevation of the basin wetlands and was 
therefore most likely to dry out. Areas that even- 
tually went dry were adjacent to areas that re- 
mained inundated (Darby et al., 2002). 

We studied the same snails from BCWMA 
for which movements were monitored (Darby 
et al., 2002). Snails were located weekly via 
miniature radio transmitters affixed to their 
shells. Maximum transmitter battery life was 
60 d. We documented weekly survival for four 
months by releasing transmitters in a stag- 
gered fashion (six in March, four in April, 26 in 
May, nine in June). We skewed transmitter re- 
lease in May to maximize the probability of the 
snails encountering a dry down. We also moni- 
tored six snails that were initially found in May 
via hand searches in dry marsh (the 45 snails 
described above were found in flooded marsh). 
Snails in dry marsh do not move (Darby et al., 
2002), so we could monitor them without trans- 
mitters by flagging their location. Snail survival 
was assessed first by tapping the shell to look 
for the behavioral response of retracting the 
operculum and, if there was no response, gen- 
tly prying one corner of the operculum away 
from the aperture to inspect the soft body tis- 
sue. If an empty shell was found, evidence of 
prédation was noted as described by Snyder & 
Snyder (1969). We measured water depth and 
temperature throughout the study, as described 
by Darby et al. (2002). 



Laboratory Study 

In 1996, we assessed survival for stranded 
snails in tanks designed to simulate a dry 
down. A laboratory setting permitted control 
over moisture conditions and eliminated factors 
(e.g., precipitation, prédation) that confounded 
interpretation of field data. 

Snails were collected from eastern BCWMA 
via wire traps (Darby et al. 2001 ) from 29 April 
through 10 May 1996 (n =232). Snail shell 
widths were 22-42 mm (mean ± SD = 34.1 ± 
3.2 mm). Based on size/maturation relation- 
ships reported by Manning (1 979) and our own 
observations of snails mating and laying eggs, 
snails > 30 mm were considered adults. Ap- 
proximately 10% of our lab study population 
were juveniles. 

On 12 May, a total of 18-24 snails were 
placed in each of twelve 1 20 cm L x 61 cm W x 
46 cm M polyethylene tanks. All tanks started 
with 15 cm (above the substratum) of filtered, 
aerated well water. The substratum consisted 
of a 5 cm layer of stone in a size gradation (di- 
ameter) from 1.9 cm to 0.6 cm (upper layer) 
and topped by a 1 3 cm layer of either sand (n = 
6 tanks) or unprocessed commercial peat (n = 
6). Two substrata were included in order to see 
if peat, with its greater moisture holding capac- 
ity, would enhance survival for stranded snails 
relative to sand. Tank locations were random- 
ized for substratum type and water regime. 

Water was replaced every 3 to 7 days during 
the experiment. Snails were fed Utricularia sp. 
in excess of demand. Uneaten food and waste 
were removed every 3 days. The tanks were 
outdoors and therefore subject to ambient tem- 
peratures, but covered to prevent rain from en- 
tering. Well water was allowed to reach 
ambient temperature prior to tank distribution. 

For each substratum (peat and sand), we 
had three control tanks with continuous 15 cm 
water depths and three dry down tanks 
wherein water was dropped from 15 cm to 
cm over 28 days. The water withdrawal rate 
approximated the 28 d period prior to dry down 
conditions in BCWMA in 1995. Water depths 
reached cm on 10 June. On 11 June all the 
water was drained and the substratum began 
drying. 

We measured water and substratum tem- 
peratures three times weekly. Substratum 
moisture levels were measured three times 
weekly in three locations per tank as percent 
saturation using a moisture meter (Lincoln In- 
dustries, NE) inserted 5 cm below the surface. 
Snail survival was checked weekly as de- 



DRY SEASON SURVIVAL INA FLORIDA APPLE SNAIL POPULATION 



181 



scribed for the telemetry study. All tanks con- 
taining water were inspected daily to remove 
dead snails. 

Statistical Analyses 

Cumulative survival for the laboratory snails 
was estimated at weekly intervals using the 
Kaplan & Meier procedure (1958). A variation of 
this procedure to accommodate staggered 
transmitter release and failed transmitters was 
used to estimate survival in the telemetry study 
(Pollock et al. 1989). We used the approach 
described by Bennetts et al. (1999) to accom- 
modate situations in which animals previously 
found in one condition (e.g., flooded marsh) 
were subsequently found in another (e.g., dry 
marsh). The hypothesis that survival for snails 
in dry down conditions (19 May-7 July) was 
lower than in flooded conditions over the same 
period was tested using a log-rank test (Pollock 
et al., 1989). We tested for sex differences and 
tank effects using the same approach. In all 
cases we report the most conservative -/^ val- 
ues of the three log-rank tests described in 
Pollock et al. (1989), but for all tests the con- 
clusions were the same regardless of how y} 
was calculated. 



tanks, respectively), despite the fact that mois- 
ture levels in the peat substratum remained 3- 
5 times higher than the sand substratum (data 
not shown). The peat and sand tank survival 
data were therefore pooled to examine the 
overall effects of drying. Survival for all labora- 
tory snails declined approximately 10-15% per 
week by late May, prior to the 11 June dry 
down. The simulated dry down did, however, 
appear to exacerbate death rates {~f - 6.53, 
df = 1, P = 0.011). Tank water temperatures 
ranged from 23°C to 30°C over the study pe- 
riod. 

At the end of the lab study, it appeared that 
surviving snails were smaller than those that 
had died. We used a T-test for groups with un- 
equal variance (F-test: F = 0.27, P = 0.0002) to 
test for size differences between surviving and 
dead snails. The mean (± SD) size of the ten 
snails living at the end of the lab study was sig- 
nificantly smaller (30.1 ± 3.1 mm) than that of 
those that had died (34.3 ± 5.9 mm) (T = 2.25, 
df = 9, P = 0.025). Sizes were similar for the 
47 dead (35.9 ± 2.4 mm) and four living snails 
(34.9 ± 2.5 mm) at the end of the field study 
(T = 0.70, df = 3, P = 0.27). At the end of both 
studies, aestivating snails were removed from 
their dry conditions and placed in water. They 
became active within 2 to 24 h. 



RESULTS 

Snail survival in both the field and the labora- 
tory studies declined to less than 1 0% (Fig. 1 ), 
regardless of water levels. Survival in the field 
study remained at 100% for the initial six-week 
period through mid-April before declining at an 
average rate of 14% per week through June. 
Water levels declined steadily (Darby et al. 
2002) and water temperatures rose from 23°C 
in March to a peak of 38°C (afternoon mea- 
surements) in late May. Nine of these snails 
were eaten by predators (snail kites and 
limpkins). [There may have been more preyed 
upon, but for several dead snails the evidence 
for prédation was not clear]. Survival for males 
(n = 24) did not differ from females (n = 27) 
(x' = 0.048, df = 1 , P = 0.83). Survival of the 
twelve snails stranded in dry down was not dif- 
ferent from snails remaining in flooded marsh 
over the same period {■/} - 0.48, df = 1, P = 
0.49). The mean survival time in dry down con- 
ditions was 3.9 ± 2.2 weeks. 

Substratum type had no effect on survival 
(x' = 0.121, df = 1, P = 0.73 and x' = 0.08, 
df = 1, P = 0.78, for controls and dry down 



DISCUSSION 

Florida apple snails, regardless of hydrologie 
conditions, exhibit a steady decline in survival 
late in the dry season (May-June). Dry down 
conditions exacerbated mortality in these 
snails, but dry down intolerance clearly was 
not the primary cause of mortality for snails 
observed in the lab or the field. Our data from 
both the field and lab studies support previously 
unsubstantiated estimates of a 1-1 .5 year life 
span for P. paludosa (Manning, 1979; Ferrer et 
al., 1990). Itappears that the life cycle of apple 
snails terminates in a post-reproductive die-off. 
Egg cluster surveys by Manning (1979), Odum 
(1957) and Darby et al. (1999) consistently 
show an April-May peak in egg production. In 
our study, steepest declines in survival oc- 
curred in May and June. The telemetry study 
was initiated early in the breeding season, so 
this would explain the six-week period of high 
survival prior to the May-June die-off. Snails 
alive at the end of the lab study were likely 
young of the year that had reached sufficient 
size to be captured in the wire traps. 



182 
a) 



DARBY ETAL. 



1.00 



0.80 



re 

> 0.60 

> 

3 

to 

040 



0.20 



0.00 




Snails in flooded marsh 
Snails in dry marsh 



3/3 3/17 3/31 4/14 4/28 5/12 5/26 &9 6/23 7/7 7/21 



b) 



1.00 



0.80 



(0 

> 0.60 

t 

3 
(0 

0.40 



0.20 



0.00 



3/3 



Sand Control 
Sand Dry Down 
Peat Control 
Peat Dry Down 




3/17 3/31 



4/14 



4/28 5/12 5/26 



6/9 



6/23 



7/7 



7/21 



FIG. 1. Cumulative survival for apple snails monitored in wet and dry conditions in a) the 1995 field 
study and b) the 1996 laboratory study. Dashed vertical lines indicate the date on which snails first 
became stranded in dry conditions. 



DRY SEASON SURVIVAL INA FLORIDA APPLE SNAIL POPULATION 



183 



Bearing transmitters could influence survival. 
However, the staggered entry design meant 
that snails in any given week had carried trans- 
mitters for a range of different times. For ex- 
ample, in the first week of June, eight snails 
that died had worn transmitters from 1 to 8 
weeks and 11 snails still alive had worn trans- 
mitters 1 to 9 weeks. Four of the snails were 
initially found via hand searches in dry marsh, 
demonstrating that snails do get stranded with- 
out bearing transmitters. 

We also considered that high water tempera- 
tures (33-38°C) we measured in the field in 
May 1995 might have contributed to the steep 
decline in survival. In the lab study, however, 
we found that a similar survival pattern 
emerged even when water temperatures 
stayed < 30°C. Lethal temperatures of 35°C to 
45°C have been reported for other apple snail 
species (Cowie, 2002). 

It appears previously reported apple snail 
deaths attributed to dry conditions (Little, 1968; 
Turner, 1994) were confounded by an annual 
post reproductive die-off. Apple snails may be 
well equipped to survive in these fluctuating 
wetland environments, but how drying events 
affect Florida apple snail population demogra- 
phy remains largely unanswered. 



ACKNOWLEDGEMENTS 

This work was funded under a joint contract 
by the South Florida Water Management Dis- 
trict (WMD) (Contract No. C-E6609) and the St. 
Johns River WMD (Contract No. 95D1 59) and 
conducted under the auspices of the Florida 
Cooperative Fish and Wildlife Research Unit - 
Florida Fish and Wildlife Conservation Com- 
mission (FFWCC), University of Florida, U. S. 
Geological Survey, and Wildlife Management 
Institute, cooperating - through cooperative 
agreement #1434HQ97RU01 544. This is con- 
tribution No. R-08977 of the Florida Agricultural 
Experiment Station Journal Series. 

We thank Patrick Dean (FFWCC) and family 
and Steve Darby for help during the lab studies. 
We also thank Rob Bennetts (USGS-BRD) 
and two anonymous reviewers for suggestions 
on draft manuscripts. 



LITERATURE CITED 

BENNETTS, R. E., V. J. DREITZ, W. M. KITCH- 
ENS, J. E. HINES & J. D. NICHOLS, 1999, An- 



nual survival of snail kites in Florida: radio te- 
lemetry versus capture-resighting data. The 
Auk, 116: 435-447. 

CALOW, P., 1978, The evolution of life-cycle 
strategies in fresh-water gastropods. Mala- 
cologie, 17: 351-364. 

CHEN, E. & J. F. GERBER, 1990, Climate. Pp. 
11-34, in: R. L MEYERS & J. J. EWEL, eds., Eco- 
systems of Florida. University of Central 
Florida Press, Orlando, Florida. 

COLES, G. C, 1968, The termination of aestiva- 
tion in the large fresh-water snail Pila ovata 
(Ampullariidae)-I. changes in oxygen uptake. 
Comparative Biochemistry and Physiology, 25: 
517-522. 

COWIE, R. H., 2002, Apple snails (Ampullariidae) 
as agricultural pests: their biology, impacts 
and management. Pp. 145-192, in: G M 
BARKER, ed., Molluscs as crop pests. CABI 
Publishing, Wallingford, New Zealand. 

DARBY, P C, R. E. BENNETTS, J. D. CROOP 
P L. VALENTINE-DARBY & W. M. KITCHENS, 
1999, A comparison of sampling techniques 
for quantifying abundance of the Florida apple 
snail {Pomacea paludosa Say). Journal of 
Molluscan Studies, 65: 195-208. 

DARBY P C, P L. VALENTINE-DARBY, H, F. 
PERCIVAL & W. M. KITCHENS, 2001 , Collect- 
ing Florida applesnails {Pomacea paludosa) 
from wetland habitats using funnel traps. Wet- 
lands. 21: 308-311. 

DARBY P C, R. E. BENNETTS, S. J. MILLER & 
H. F PERCIVAL, 2002, Movements of Florida 
apple snails in relation to water levels and dry- 
ing events. Wetlands, 22: 489-498. 

DONNAYT J.&S, R. BEISINGER, 1993, Apple 
snail {Pomacea doliodes) and freshwater crab 
{Dilocarcinus dentatus) population fluctua- 
tions in the llanos of Venezuela. Biotropica, 25: 
206-214. 

DUEVER, M. J, J. F MEEDER, L. С MEEDER & 
J. M. McCOLLOM, 1994, The climate of south 
Florida and its role in shaping the Everglades 
ecosystem. Pp. 225-248, in: s M. DAVIS & J С. 
OGDEN, eds., Everglades: the ecosystem and 
its restoration, St. Lucie Press, Delray Beach, 
Florida. 

FERRER, J. R., G PERERA & M. YONG, 1990, 
Life tables of Pomacea paludosa (Say) in 
natural conditions. Florida Scientist, Supple- 
ment 53: 15 pp. 

HANNING, G W., 1979, Aspects of reproduction 
in Pomacea paludosa (Mesogastropoda: 
Pilidae). Master's Thesis, Florida State Univer- 
sity, Tallahassee, Florida, USA. 

KAPLAN, E. L. & P MEIER, 1958, Nonparametric 
estimation of incomplete observations. Journal 
of the American Statistical Association, 53: 
457-481. 

KUSHLAN, J. A., 1975, Population changes of 
the apple snail {Pomacea paludosa) in the 
southern Everglades. Nautilus, 89(1): 21-23. 

KUSHLAN, J. A., 1990, Freshwater marshes. Pp. 
324-363, in: R. L MEYERS, & J. J. EWEL, eds.. 
Ecosystems of Florida, University of Central 
Florida Press, Orlando, Florida. 



184 DARBY ETAL 

LITTLE, С, 1968, Aestivation and ionic regula- 
tion in two species of Pomacea (Gastropoda, 
Prosobranchia). Journal of Experimental Biol- 
ogy, 48: 569-585. 

ODUM, H. T., 1957, Trophic structure and pro- 
ductivity of Silver Springs, Florida. Ecological 
Monographs, 27: 55-112. 

POLLOCK, K. H., S. R. WINTERSTEIN, С. M. 
BUNCK & P D. CURTIS, 1989, Survival analy- 
sis in telemetry studies: the staggered entry 
design. Journal of Wildlife Management, 53: 
7-15. 

SCIENCE SUBGROUP, 1996, South Florida 
ecosystem restoration: scientific information 
needs. Report to the Working Group of the 
South Florida Ecosystem Restoration Task 
Force, http://everglades.fiu.edu/taskforce/ 
scineeds/index.html. 

SNYDER, N. F. & H. A. SNYDER, 1969, A com- 
parative study of mollusk prédation by 
limpkins, everglade kites, and boat-tailed 
grackles. Living Bird, 8: 177-223. 

TURNER, R. L., 1994, The effects of hydrology 
on the population dynamics of the Florida 
apple snail {Pomacea paludosa). Florida Insti- 
tute of Technology. Final Report for the St. 
Johns Water Management District. 

USFWS, 1999, South Florida multi-species re- 
covery plan. US Fish and Wildlife Service, De- 
partment of the Interior, Atlanta, Georgia, USA; 
http://verobeach.fws.gov/Programs/Recovery/ 
vbms5.html. 



Revised ms. accepted 7 March 2003 



MALACOLOGIA, 2003, 45(1 ): 1 85-1 87 

LUNTIA /A/S/G/V/S SMITH, 1898, IS A SYNONYM OF 

STREPTOSTELE (TOMOSTELE) MUSAECOLA (MORELET, 1860) 

(GASTROPODA: STREPTAXIDAE) - AN AFRICAN TRAMP 

AND ITS DISTRIBUTION IN AMERICA 

Bernhard Hausdorf^ & Clara Inés Medina Bermúdez^ 



Smith (1898) described Luntia insignis as a 
new genus and new species of the family 
Stenogyridae (= Subulinidae) from Trinidad. 
This species has been recorded as probably 
introduced in Aruba (Hummelink, 1940a, b), 
Guyana (Morrison, 1943), Suriname (van 
Regieren Altena, 1960, 1964, 1975), Nicaragua 
(López & Pérez, 1996), and in a greenhouse in 
the Netherlands (Meeuse & Hubert, 1949, as 
Varicella clappi [non Pilsbry, 1907]; see van 
Regteren Altena, 1964). It has also been re- 
corded from Saba (Haas, 1962) and Barbados 
(Chase & Robinson, 2001). 

Thiele (1931) included Luntia Smith, 1898, as 
a subgenus in Leptinaha Beck, 1837 (Subulini- 
dae), whereas Baker (in van Regteren Altena, 
1975), who examined the radula of the species, 
transferred it to Varicella L. Pfeiffer, 1856 
(Oleacinidae). 

Pilsbry ( 1 930) was the first to record the Afri- 
can Streptostele (Tomostele) musaecola 
(Morelet, 1860) (Streptaxidae) as an introduced 
species in Panama. The native range of 
Streptostele musaecola extends in western Af- 
rica from Guinea to the Congo (Pilsbry, 1919). 
Pilsbry (1930) recognized that this might be a 
"tramp" species carried around on bananas, on 
which it was originally discovered (Morelet, 
1860). Later, Streptostele musaecola has been 
recorded as introduced in Bermuda (Bieler & 
Slapcinsky, 2000), Vanuatu (= New Hebrides) 
(Solem, 1989), American Samoa (Solem, 
1989; Cowie, 1998, Cowie & Rundell, 2002; 
Cowie et al., 2003), and the Society Islands 
(Solem, 1989). 

We have examined the holotype of Luntia 
insignis Smith (The Natural History Museum, 
London, NHM 1898.12.5.18; Fig. 1) and three 
specimens labelled as syntypes of Achatina 
musaecola Morelet in The Natural History Mu- 
seum (NHM 1893.2.4.276-8; Fig. 2). As locality 
of the putative syntypes of A. musaecola, 
"Gabon" is given in Morelet's handwriting, 



whereas Morelet (1860; 190) gives Guinea as 
type locality. However, Ancey (1885) also said 
that A. musaecola is from Gabon. It is unclear 
whether this was an error or whether Ancey 
knew that the type locality actually was Gabon 
and not Guinea. 

A comparison of these type specimens, new 
material from Colombia (Zoologisches Mu- 
seum der Universität Hamburg, ZMH 2918; Fig. 
3), and figures of shells identified as Luntia 
insignis (Meeuse & Hubert, 1949; Haas, 1962) 
and Streptostele musaecola (Pilsbry, 1919, 
1930; Solem, 1989; Bieler & Slapcinsky, 2000), 




FIGS. 1-3. Streptostele (Tomostele) musaecola 
(Morelet). FIG. 1. Trinidad: Port of Spain (holo- 
type of Luntia insignis Smith, NHM 1898.12.5.18). 
FIG. 2. Gabon (syntype? of Achatina musaecola 
Morelet, NHM 1893.2.4.276-8). FIG. 3. Colombia: 
Finca Torreblanca near Silvania (ZMH 2918). 
Scale bar = 1 mm. 



^Zoologisches Museum der Universität Hamburg, Martin-Luther-King-Platz 3, D-20146 Hamburg, Germany; 

hausdorf@20ologie.uni-hamburg.de 

^Universidad Militar Nueva Granada, Facultad de Ciencias: Biología Aplicada, Cra. 11 No 101 - 80, Bogotá, Colombia 

185 



186 



HAUSDORF & MEDINA BERMUDEZ 




FIG. 4. Distribution of Streptostele {Tomostele) musaecola (Morelet) in America 
(1°-grid). 



Show that Luntia insignis Smith, 1898 is a syn- 
onym of Streptostele (Tomostele) musaecola 
(Morelet, 1860). Consequently, Luntia Smith, 
1898, is a synonym of Tomoste/e Ancey, 1885, 
of which Achatina musaecola Morelet, 1860, is 
the type species. 

Streptostele musaecola is known from the 
following American localities (Fig. 4): Bermuda: 
Hamilton, 32°18'N, 64°47'W (Bleler & 
Slapcinsky, 2000). Nicaragua: Masatepe, El 
Arenal, El Pochote, 455 m altitude, 11°55'N, 
86°08'46"W (López & Pérez, 1996); Masatepe, 
El Arenal, El Mango, 455 m altitude, ir55'N, 
86°08'46"W (López & Pérez, 1996). Costa 
Rica: La Lola, 28.3 miles W of Puerto Limón, 
10°N, 83°W (Florida Museum of Natural His- 
tory FLMNH 211842). Panama: Mount Hope, 
9°20'N, 79°54'W (Pilsbry, 1930); Colon, 
9°22'N, 79°54'W (FLMNH 211843). Colombia, 
Departamento Cundinamarca: Finca Torre- 
blanca near Silvania, 1560 m altitude, forest, 
4°24'14"N, 74°23'12"W (ZMH 2918). Aruba: 
Fontein, 12°30'N, 69°54'W (Hummelink, 1940a). 
Saba: Road to Bottom, 17°38'N, 63°15'W 
(Haas, 1962). Saint Lucia: Grande Anse, 
14°00'N, 60°54'W (FLMNH 281110). Barbados: 
Holetown, Porter's House, 2-4 m altitude, 
13°ir44"N, 59°38'18"W (Chase & Robinson, 
2001); Holetown, hill NE of Royal West- 
moreland Landscape Garden Centre, 10 m 



altitude, 13°12'01"N, 59°38'04"W (Chase & 
Robinson, 2001); Bathsheba, Andromeda 
Botanic Gardens, 60 90 m altitude, 
13°12'25"N, 59°3r04"W (Chase & Robinson, 
2001); 200 m S of Harrison Point Lighthouse, 
30 m altitude, 13°18'23"N, 59°38'58"W (Chase 
& Robinson, 2001). Trinidad: Port of Spain, 
10°39'N, 6ГЗГ\Л/ (holotype of Luntia insignis 
Smith, NHM 1898.12.5.18). Guyana: Kyk over 
AI Island, 6°23'N, 58°4Г\Л/ (Morrison, 1943). 
Suriname: Jodensavanne, 5°25'N, 54°59'W 
(van Regieren Altena, 1964, 1975); Albina, 
5°30'N, 54°03'W (van Regieren Altena, 1975); 
Paramaribo, 5°50'N, 55°10'W (van Regieren 
Altena, 1964, 1975); Tambaredjo, 5°50'N, 
55°33'W (van Regieren Altena, 1960). 

The newly discovered occurrence near 
Silvania in Colombia represents probably the 
highest locality from which Streptostele 
musaecola has been recorded. However, we 
do not know whether a stable population has 
been established there or whether there was 
only an unsuccessful introduction. 

Streptostele musaecola is widespread 
throughout tropical America. Its impact on the 
native fauna should be monitored, especially 
because it is a carnivorous species. Actually, it 
might have been implicated in the extinction of 
a native species in American Samoa (Miller, 
unpublished report, quoted in Cowie, 1998). 



STREPTOSTELE MUSAECOLA\N AMERICA 



187 



ACKNOWLEDGEMENTS 

We thank Dr. Peter Mordan (NHM) for lending 
as the relevant type material, Dr. F. Thompson 
(FLMNH) for communicating additional records 
and Dr. R. H. Cowie and two anonymous re- 
viewers for helpful comments on the manu- 
script. 



LITERATURE CITED 

ANCEY, С F., 1885, Nouvelles contributions 
malacologiques. Bulletins de la Société 
Malacologique de France, 2: 113-146. 

BIELER, R. & J. SLAPCINSKY, 2000, A case 
study for the development of an island fauna: 
Recent terrestrial mollusks of Bermuda. 
Nemouria, 44: 1-99. 

CHASE, R. & D. G. ROBINSON, 2001, The un- 
certain history of land snails on Barbados: Im- 
plications for Conservation. Malacologia, 43: 
33-57. 

COWIE, R. H., 1998, Catalog of nonmahne 
snails and slugs of the Samoan Islands. 
Bishop Museum Bulletin in Zoology, 3: l-VIII, 
1-122. 

COWIE, R. H. & R. J. RUNDELL, 2002, The land 
snails of a small tropical Pacific island, Aunu'u, 
American Samoa. Pacific Science, 56: 143- 
147. 

COWIE, R. H., R. J. RUNDELL, F. MIKA & P 
SETU, 2003, The endangered partulid tree 
snail Samoana thurstoni on Olosega and the 
land snail diversity of the Manu'a Islands, 
American Samoa. American Malacological Bul- 
letin, 17: 37-43. 

HAAS, F., 1962, Caribbean land molluscs: 
Subulinidae and Oleacinidae. Studies on the 
Fauna of Curaçao and Other Caribbean Is- 
lands, 13: 49-60, pis. 7-11. 

HUMMELINK, P W., 1940a, A survey of the mam- 
mals, lizards and mollusks. Studies on the 
Fauna of Curaçao, Aruba. Bonaire and the 
Venezuelan Islands, 1: 59-108, pis. 9-16. 

HUMMELINK, P W., 1940b, Zoogeographical re- 
marks. Studies on the Fauna of Curaçao, 
Aruba, Bonaire and the Venezuelan Islands, 1 : 
109-130. 



LÓPEZ, A. & A. M. PÉREZ, 1996, Nuevos 
registros de caracoles terrestres "ad- 
venedizos" en Nicaragua: Leptinaria insignis, 
Bothriopupa conoidea y Caecilioides iota 
(Mollusca: Gastropoda). Revista de Biología 
Tropical, 44: 302-303. 

MEEUSE, A. D. J. & B. HUBERT 1949, The mol- 
lusc fauna of glasshouses in the Netherlands. 
Basteria, 13: 1-30, 3 pis. 

MORELET A., 1860, Description de nouvelles 
espèces de l'Afrique occidentale, rapportées 
par M. le capitaine Vignon. Journal de 
Conchyliologie, 8: 189-191. 

MORRISON, J. P E., 1943, A new type of fresh- 
water clam from British Guiana. Nautilus, 57: 
46-52, pi. 8. 

PILSBRY, H.A., 1907, Manual of Conchology. 
Second Series: Pulmonata. 19 (74): 65-128, 
pis. 11-20. Academy of Natural Sciences, 
Philadelphia. 

PILSBRY, H.A., 1919, A review of the land mol- 
lusks of Belgian Congo chiefly based on the 
collections of the American Museum Congo 
Expedition, 1909-1915. Bulletin of the Ameri- 
can Museum of Natural History, 40: 1-370, 
pis. 1-23. 

PILSBRY, H. A., 1930, Results of the Pinchot 
South Sea Expedition - II. Land mollusks of 
the Canal Zone, The Republic of Panama, and 
the Cayman Islands. Proceedings of the Acad- 
emy of Natural Sciences of Philadelphia, 82: 
339-354, pis. 28-30. 

SMITH, E. A., 1898, On some land shells from 
Trinidad. Journal of Conchology, 9: 27-29. 

SOLEM, A., 1989, Non-camaenid land snails of 
the Kimberley and Northern Territory, Australia. 
I. Systematics, affinities and ranges. Inverte- 
brate Taxonomy, 2: 455-604. 

THIELE, J., 1929-1931, Handbuch der syste- 
matischen Weichtierkunde. G. Fischer, Jena, 
1: 1-376 [1929]; 377-778 [1931]. 

VAN REGTEREN ALTENA, С О., 1960, On a 
small collection of land Mollusca from Surinam 
(Dutch Guyana). Basteria, 24: 48-51. 

VAN REGTEREN ALTENA, С. О., 1964, Notes 
on some Surinam land snails. Zoologische 
Mededelingen, 40: 139-141. 

VAN REGTEREN ALTENA, С. О., 1975, Land 
Gastropoda of Suriname, with description of a 
new species of Nesopupa. Basteria, 39: 29- 
50. 



Revised ms. accepted 24 March 2003 



MALACOLOGIA 



International Journal of Malacology 



Vol. 45(1) 2003 



Publication dates 

Vol.34, No. 1-2 9 Sep. 1992 

Vol.35, No. 1 14 Jul. 1993 

Vol.35, No. 2 2 Dec. 1993 

Vol.36, No. 1-2 8 Jan. 1995 

Vol.37, No. 1 13 Nov. 1995 

Vol.37, No. 2 8 Mar. 1996 

Vol.38, No. 1-2 17 Dec. 1996 

Vol.39, No. 1-2 13 May 1998 

Vol. 40, No. 1-2 17 Dec. 1998 

Vol.41, No. 1 22 Sep. 1999 

Vol.41, No. 2 31 Dec. 1999 

Vol.42, No. 1-2 18 Oct. 2000 

Vol.43, No. 1-2 20 Aug. 2001 

Vol. 44, No. 1 8 Feb. 2002 

Vol. 44, No. 2 30 Aug. 2002 



VOL. 45, NO. 1 MALACOLOGIA 2003 

CONTENTS 

SUSAN G. BROWN, B. KALANI SPAIN, & KAREN CROWELL 

A Field Study of the Life History of an Endemic Hawaiian Succineid Land 

Snail 175 

LAURE CHEVALIER, MARTINE LE COZ-BOUHNIK, & MARYVONNE CHARRIER 
Influence of Inorganic Compounds on Food Selection by the Brown Garden 
Snail Cornu aspersum (Müller) (Gastropoda: Pulmonata) 125 

EUGENE V.COAN 

A New Panamic Species of the Bivalve Genus Semelina (Semelidae) .... 169 

ROBERT H. COWIE & SILVANA С. THIENGO 

The Apple Snails of the Americas (Mollusca: Gastropoda: Ampullariidae: 
Asolene, Felipponea, Marisa, Fornácea, Pomella): A Nomenclatura! and 
Type Catalog 41 

PHILIP С DARBY, PATRICIA L.VALENTINE-DARBY & H. FRANKLIN PERCIVAL 
Dry Season Survival in a Florida Apple Snail [Pomacea paludosa Say) 
Population 179 

ALEXANDR V. GARBER & ALEXEI V. KORNIUSHIN 

Karyotypes of European Species of Radix (Gastropoda: Pulmonata: 
Lymnaeidae) and Their Relevance to Species Distinction in the Genus ... 141 

MATTHIAS GLAUBRECHT THOMAS VON RINTELEN, & 

ALEXEI V. KORNIUSHIN 

Toward a Systematic Revision of Brooding Freshwater Corbiculidae in 
Southeast Asia (Bivalvia, Veneroida): On Shell Morphology, Anatomy and 
Molecular Phylogenetics of Endemic Taxa from Islands in Indonesia 1 

BERNHARD HAUSDORF & CLARA INÉS MEDINA BERMÚDEZ 

Luntia insigáis Smith, 1898, Is a Synonym of Streptostele {Tomostele) 
musaecola (Morelet, 1860) (Gastropoda: Streptaxidae) — An African Tramp 
and Its Distribution in America 185 

ALOIS HONEK 

Shell-Band Color Polymorphism in Cepaea vindobonensis at the Northern 

Limit of Its Range 1 33 

WANNAPORN ITTIPRASERT CHRISTOPHER ROWE, CAROLYN PATTERSON, 

ANDRÉ MILLER, NITHYA RAGHAVAN, SUSAN BANDONI, FRED LEWIS, & 

MATTY KNIGHT 

Assessment of Genetic Heterogeneity within Laboratory-Maintained 
Scliistosoma manson/'-Resistant Stocks of Biomptialaria glabrata Snails by 
RAPD-PCR 101 

PARIDE MANTECCA, GIOVANNI VAILATI, LETIZIA GARIBALDI, & 

RENATO BACCHETTA 

Depth Effects on Zebra Mussel Reproduction 109 

ARMINDO S. RODRIGUES, REGINA T CUNHA, & BENJAMIN J. GÓMEZ 

The Egg of Oxychilus (Drouetia) atlanticus (Pulmonata: Zonitidae): Surface 
Structure and Carbohydrate Composition 121 

CHRISTOPHER ROWE, WANNAPORN ITTIPRASERT CAROLYN PATTERSON, 

CLAUDIA ELIFF KRISTEN PAGE, SUSAN BANDONI, THOMAS WILKE, 

DENNIS MINCHELLA, FRED LEWIS, & MATTY KNIGHT 

Use of Microsatellite Variation and RAPD-PCR to Assess Genetic Poly- 
morphism in Biomptialaria glabrata Snails from a Single Locale in a 
Schistosomiasis Endemic Area 149 



MALACOLOGIA 

SUBSCRIPTION ORDER FORM 

Name: 

Address: 



Send U.S. $56.00 for a personal subscription (per volume) or U.S. $70.00 for 
an institutional subscription. VISA and MASTERCARD are accepted for an addi- 
tional $2.00 fee. Checks must be drawn on an American bank and made payable to 
MALACOLOGIA. 

Address: Malacologia 
RO. Box 385 

Haddonfield, NJ 08033-0309 
U.S.A. 

fax: (856) 854-0341 

e-mail: malacolog@jersey.net 



MALACOLOGIA ADDRESSES 

* * * 

BUSINESS-SUBSCRIPTIONS 

1ST CLASS MAIL INCLUDING AIR, CERTIFIED, REGISTERED, ETC.: 

MALACOLOGIA 

RO. Box 385 

Haddonfield, NJ 08033-0309 

U.S.A. 

EXPRESS MAIL ONLY : 

MALACOLOGIA 

Attn: Caryl Hesterman 

210 W. Crystal Lake Ave. 

Apt. 216-A 

Haddonfield, NJ 08033-3198 

U.S.A. 

e-mail: malacolog @ jersey.net tel/fax: (856) 854-0341 



MANUSCRIPTS 

1ST CLASS MAIL INCLUDING AIR, CERTIFIED, REGISTERED, ETC.: 

MALACOLOGIA 

RO. Box 1222 

West Falmouth, MA 02574-1222 

U.S.A. 

EXPRESS MAIL ONLY : 

MALACOLOGIA 

Attn: George Davis/Roger Hanlon 

7 MBL Street 

Woods Hole, MA 02543-1015 

U.S.A. 

e-mail: georgedavis99@hotmail.com tel/fax: (508) 457-0810 
CO to mtmgmd@gwumc.edu 



45 NO. 1 



MALACOLOGIA 



2003 



INSTRUCTIONS FOR AUTHORS 



1. MALACOLOGIA publishes original re- 
search on the Mollusca that is of high quality 
and of broad international interest. Papers 
combining synthesis with innovation are par- 
ticularly desired. While publishing symposia 
from time to time, MALACOLOGIA encour- 
ages submission of single manuscripts on 
diverse topics. Papers of local geographical or 
systematic interest should be submitted else- 
where, as should papers whose primary 
thrust is physiology or biochemistry. Nearly all 
branches of malacology are represented on 
the pages of MALACOLOGIA. 

2. Manuscripts submitted for publication 
are received with the tacit understanding that 
they have not been submitted or published 
elsewhere in whole or in part. 

3. Manuscripts must be in English, but 
may include an expanded abstract in a foreign 
language as well as the usual brief abstract in 
English. Both American and British spellings 
are allowed. 

4. Unless indicated otherwise below, con- 
tributors should follow the recommendations 
in the Council of Biology Editors (CBE) Style 
Manual, the latest edition (November 1994, 
ISBN #0521-471-540) of which is available 
for U.S. $39.95 plus $4.00 shipping from 
Cambridge University Press, Order Depart- 
ment, 110 Midland Avenue, Port Chester, NY 
10573, U.S.A. 

5. Be brief. 

6. Manuscripts must be typed on one side 
of good quality white paper, double- spaced 
throughout (including the references, tables 
and figure captions), and with ample margins. 
Tables and figure captions should be typed on 
separate pages and put at the end of the man- 
uscript. Make the hierarchy of headings within 
the text simple and consistent. Avoid internal 
page references (which have to be added in 
page proof). 

7. Choose a running title (a shortened 
version of the main title) of fewer than 50 let- 
ters and spaces. 

8. Provide a concise and informative Ab- 
stract summarizing not only contents but re- 
sults. A separate summary generally is super- 
fluous. 

9. Supply between five and eight key 
(topic) words to go at the end of the Abstract. 

10. Use the metric system throughout. 
Micron should be abbreviated |xm. 



1 1 . Illustrations are printed either in one 
column or the full width of a page of the journal, 
so plan accordingly. The maximum size of a 
printed figure is 1 3.5 x 20.0 cm (preferably not 
as tall as this so that the caption does not have 
to be on the opposite page). 

12. Drawings and lettering must be dark 
black on white, blue tracing, or blue-lined 
paper. Lines, stippling, letters and numbers 
should be thick enough to allow reduction by 
V2 or V3. Letters and numbers should be at 
least 3 mm high after reduction. Several draw- 
ings or photographs may be grouped together 
to fit a page. Photographs are to be high con- 
trast. High contrast is especially important for 
histological photographs. 

13. All illustrations are to be numbered 
sequentially as figures (not grouped as plates 
or as lettered subseries), and are to be 
arranged as closely as possible to the order in 
which they are first cited in the text. Each fig- 
ure must be cited in the text. 

14. Scale lines are required for all nondi- 
agrammatic figures, and should be conve- 
nient lengths (e.g., "200 |хт," not "163 |xm"). 
Magnifications in captions are not accept- 
able. 

15. All illustrations should be mounted, 
numbered, labeled or lettered, i.e. ready for 
the printer. Be professional. Sloppy illustra- 
tions, labels, borders will not be accepted. If 
assistance is required of Malacologia's office, 
the author will be charged for services ren- 
dered. 

All computer-generated graphics must be 
submitted on a CD-Rom. Submit such graph- 
ics as TIFF files. Black and white graphics 
must have a final resolution of 1200 dpi, gray- 
step and color graphics, 300 dpi. In line draw- 
ings, the minimum line width of 0.2mm (i.e. 
0.567 pt) is required (as measured by final 
size). For half-tone illustrations (gray-step), 
final letter size should be 3mm; for black and 
white line drawings, at least 2mm. 

16. A caption should summarize what is 
shown in an illustration, and should not dupli- 
cate information given in the text. Each let- 
tered abbreviation labeling an individual fea- 
ture in a figure must either be explained in 
each caption (listed alphabetically), or be 
grouped in one alphabetic sequence after the 
Methods section. Use the latter method if 
many abbreviations are repeated on different 
figures. 

17. Tables are to be used sparingly, and 
vertical lines not at all. 



18. References cited in the text must be in 
the Literature Cited section and vice versa. 
Follow a recent issue of MALACOLOGIA for 
bibliographic style, noting especially that seri- 
als are cited unabbreviated. Supply pagina- 
tion for books. Supply information on plates, 
etc., only if they are not included in the pagi- 
nation. 

19. In systematic papers, synonymies 
should not give complete citations but should 
relate by author, date and page to the Litera- 
ture Cited section. 

20. For systematic papers, all new type- 
specimens must be deposited in museums 
where they may be studied by other scien- 
tists. Likewise MALACOLOGIA requires that 
voucher specimens upon which a paper is 
based be deposited in a museum where they 
may eventually be reidentified. 

21. Submit each manuscript in triplicate. 
The second and third copies can be repro- 
ductions. Also submit with the paper copies, a 
computer disk in Microsoft Word (PC version) 
containing the manuscript including all tables 
and illustrations. A manuscript that has been 
revised must be re-submitted on computer 
disc in Microsoft Word (PC version). 

22. Authors who want illustrations returned 
should request this at the time of ordering 
reprints. Otherwise, illustrations will be main- 
tained for six months only after publication. 

23. An author's address should include an 
e-mail address. 



REPRINTS AND PAGE COSTS 

24. When 100 or more reprints are 
ordered, an author receives 25 additional 
copies free. Reprints must be ordered from 
the Business Office at the time proof is re- 



turned to the Copy Editor. Later orders cannot 
be considered. For each authors' change in 
page proof, the cost is U.S. $4.00 per word. 

25. Page costs must be paid prior to publi- 
cation. Page cost recovery is required as fol- 
lows. 

Regular subscribers * 
Non-student: 10 pages free; $30.00 for 
each additional page (EAP) 
Student:** 15 pages free; $20.00 EAP 

Non-subscribers * 
Non-student: 8 pages free; $60.00 EAP 
Student:** 15 pages free; $30.00 EAP 

A reduction in the cost per page may be 
possible under certain circumstances for 
papers exceeding 40 pages. 

*Regular subscribers are those who have 
paid-up subscriptions for the current issue 
and the following issue. 

**Students (including individuals submitting 
dissertations) must identify themselves at the 
time of manuscript submission and also pro- 
vide the e-mail address of their advisor. 



SUBSCRIPTION PURCHASE 

26. Effective Apr. 2001 , personal subscrip- 
tions are U.S. $56.00. Students will receive a 
discount and be charged $30.00. Institutional, 
agency or dealership subscriptions are U.S. 
$70.00. Back issues and single volumes: 
$56.00 for individual purchaser; $70.00 for 
institutional or agency purchasers. There is a 
$4.50 handling charge per volume for all pur- 
chases of single volumes. Address inquiries 
to the Subscription Office. 



SMITHSONIAN INSTITUTION LIBRARIES 




3 9088 01097 0424 

VOL. 45, NO. 1 MALACOLOGIA 2003 

CONTENTS 

MATTHIAS GLAUBRECHT THOMAS VON RINTELEN, & 

ALEXEI VKORNIUSHIN 

Toward a Systematic Revision of Brooding Freshwater Corbiculidae in 
Southeast Asia (Bivalvia, Veneroida): On Shell Morphology, Anatomy and 
Molecular Phylogenetics of Endemic Taxa from Islands in Indonesia 1 

ROBERT H. COWIE & SILVANA C.THIENGO 

The Apple Snails of the Americas (Mollusca: Gastropoda: Ampullariidae: 
Asolene, Felipponea, Marisa, Pomaces, Pomella): A Nomenclatural and 
Type Catalog 41 

WANNAPORN ITTIPRASERT CHRISTOPHER ROWE, CAROLYN PATTERSON, 

ANDRÉ MILLER, NITHYA RAGHAVAN, SUSAN BANDONI, FRED LEWIS, & 

MATTY KNIGHT 

Assessment of Genetic Heterogeneity within Laboratory-Maintained 
Schistosoma manson/'-Resistant Stocks of Biomphalaria glabrata Snails by 
RAPD-PCR 101 

PARIDE MANTECCA, GIOVANNI VAILATI, LETIZIA GARIBALDI, & 

RENATO BACCHETTA 

Depth Effects on Zebra Mussel Reproduction 109 

ARMINDO S. RODRIGUES, REGINA Т CUNHA, & BENJAMIN J. GÓMEZ 

The Egg of Oxychilus (Drouetia) atlánticas (Pulmonata: Zonitidae): Surface 
Structure and Carbohydrate Composition 121 

LAURE CHEVALIER, MARTINE LE COZ-BOUHNIK, & MARYVONNE CHARRIER 
Influence of Inorganic Compounds on Food Selection by the Brown Garden 
Snail Cornu aspersum (Müller) (Gastropoda: Pulmonata) 125 

ALOIS HONEK 

Shell-Band Color Polymorphism in Cepaea vindobonensis at the Northern 

Limit of Its Range 1 33 

ALEXANDR V GARBER & ALEXEI V KORNIUSHIN 

Karyotypes of European Species of Radix (Gastropoda: Pulmonata: 
Lymnaeidae) and Their Relevance to Species Distinction in the Genus ... 141 

CHRISTOPHER ROWE, WANNAPORN ITTIPRASERT CAROLYN PATTERSON, 

CLAUDIA ELIFF KRISTEN PAGE, SUSAN BANDONI, THOMAS WILKE, 

DENNIS MINCHELLA, FRED LEWIS, & MATTY KNIGHT 

Use of Microsatellite Variation and RAPD-PCR to Assess Genetic Poly- 
morphism in Biomplialaria glabrata Snails from a Single Locale in a 

Schistosomiasis Endemic Area 149 

RESEARCH NOTES 

EUGENE V. COAN 

A New Panamic Species of the Bivalve Genus Semelina (Semelidae) .... 169 

SUSAN G. BROWN, B. KALANI SPAIN, & KAREN CROWELL 

A Field Study of the Life History of an Endemic Hawaiian Succineid Land 

Snail 175 

PHILIP С DARBY PATRICIA L VALENTINE-DARBY & H. FRANKLIN PERCIVAL 
Dry Season Survival in a Florida Apple Snail {Pomacea paludosa Say) 
Population 179 

BERNHARD HAUSDORF & CLARA INÉS MEDINA BERMÚDEZ 

Luntia insignis Smith, 1898, Is a Synonym of Streptostele (Tomostele) 
musaecola (Morelet, 1860) (Gastropoda: Streptaxidae) — An African Tramp 
and Its Distribution in America 185 




ÄLACOLOGIA 




International Journal of Malacology 



>l. 45(2) 






I 




/ 



2004 



MALACOLOGIA 
http:\\malacologia.f mnh.org 



EDITOR-IN-CHIEF: 
GEORGE M. DAVIS 



Editorial Office 

Malacologie 

P.O. Box 1222 

West Falmouth, MA 02574-1222 

Copy Editor: 

EUGENE COAN 

California Academy of Sciences 

San Francisco, CA 



Managing Editor: 

CARYL HESTERMAN 
Haddonfield, NJ 



Graphics Editor: 

THOMAS WILKE 

Justus Liebig 

University Giessen 

Germany 



Business & Subscription Office 

Malacologia 

P.O. Box 385 

Haddonfield, NJ 08033-0309 

Associate Editor: 

JOHN B. BURCH 

University of Michigan 

Ann Arbor 

Assistant Business Managers: 

KEVIN ROE & STAFF 

Malacology Department 

Delaware Museum of Natural History 

Wilmington, DE 



MALACOLOGIA is published by the INSTITUTE OF MALACOLOGY, the Sponsor Members 
of which (also serving as editors) are: 



RÜDIGER BIELER 
Field Museum, Chicago 

JOHN BURCH 

MELBOURNE R. CARRIKER 
University of Delaware, Lewes 

GEORGE M. DAVIS 
Secretary and Treasurer 

CAROLE S. HICKMAN 

President 

University of California, Berkeley 



ALAN KOHN 

Vice President 

University of Washington, Seattle 

JAMES NYBAKKEN 

President Elect 

Moss Landing Marine Laboratory, California 

CLYDE F E. ROPER 

Smithsonian Institution, Washington, D.C. 

SHI-KUEI WU 

University of Colorado Museum, Boulder 



Participating Members 



EDMUND GITTENBERGER 

Secretary, UNITAS MALACOLOGICA 

Rijksmuseum van Natuurlijke 

Historie 

Leiden, Netherlands 



JACKIE L. VAN GOETHEM 
Treasurer, UNITAS MALACOLOGICA 
Koninklijk Belgisch Instituut 
voor Natuurwetenschappen 
Brüssel, Belgium 



Emeritus Members 



J. FRANCES ALLEN, Emérita 
Environmental Protection Agency 
Washington, D.C. 

KENNETH J. BOSS 

Museum of Comparative Zoology 

Cambridge, Massachusetts 



ROBERT ROBERTSON 

The Academy of Natural Sciences 

Philadelphia, Pennsylvania 

W. D. RUSSELL-HUNTER 
Easton, Maryland 



Copyright 



2004 by the Institute of Malacology 
ISSN: 0076-2997 



2004 
EDITORIAL BOARD 



APR О 9 2004 



J.A.ALLEN 

Marine Biological Station 

Millport, United Kingdom 

jallen@udcf.gla.ac.uk 

E.E.BINDER 

Museum d'HIstoIre Naturelle 

Geneve. Switzerland 

P. BOUCHET 

Museum National d'Histoire Naturelle 

París. France 

bouchet@cimrs1 .mnhn.fr 

P. CALOW 

University of Stieffield 
United Kingdom 

R. CAMERON 

Sheffield 

United Kingdom 

R.Cameron@sheffield.ac.uk 

J.G.CARTER 

University of North Carolina 

Chapel Hill. U.S.A. 

MARYVONNE CHARRIER 
Université de Rennes 
France 
Maryvonne.Charrier@univ-rennes1.fr 

R. H.COWIE 
University of Hawaii 
Honolulu. HL. U.S.A. 

A. H.CLARKE, Jr. 
Portland. Texas. U.S.A. 

B.C.CLARKE 
University of Nottingham 
United Kingdom 

R.DILLON 

College of Charleston 

SC U.S.A. 

C.J.DUNCAN 
University of Liverpool 
United Kingdom 

D. J. EERNISSE 
California State University 
Fullerton. U.S.A. 

E.GITTENBERGER 
Rijksmuseum van Natuuríijke Historie 
Leiden. Netheríands 
sbu2eg @ rulsfb. leldenuniv. de 

F. GIUSTI 

Universlta dl Siena. Italy 

giustif@unlsl.it 



A. N. GOLIKOV 
Zoological Institute 
St. Petersburg. Russia 

A.V. GROSSU 
Unlversitatea BucurestI 
Romania 

T. HABE 

Tokai University 

Shimizu. Japan 

R. HANLON 

Marine Biological Laboratory 
Woods Hole. Mass., U.S.A. 

G. HASZPRUNAR 

Zoologische Staatssammlung Muenchen 

Muenchen, Germany 

haszi@zl.blologle.unl-muenchen.de 

J. M. HEALY 

University of Queensland 

Australia 

jhealy @ zoology, uq. edu. au 

D. M.HILLIS 
University of Texas 
Austin. U.S.A. 

K. E. HOAGLAND 

Council for Undergraduate Research 

Washington. DC. U.S.A. 

Elaine@cur.org 

B. HUBENDICK 
Naturhlstoriska Museet 
Göteborg. Sweden 

S.HUNT 
Lancashire 
United Kingdom 

R.JANSSEN 

Forschungsinstitut Senckenberg. 
Frankfurt am Main. Germany 

M.S.JOHNSON 
University of Western Australia 
Nedlands. WA. Australia 
msj@cyllene.uwa.edu.au 

R. N.KILBURN 
Natal Museum 
Pietermarltzburg. South Africa 

M. A. KLAPPENBACH 

Museo Nacional de Historia Natural 

Montevideo. Uruguay 

J. KNUDSEN 

Zoologisk Institut Museum 

Kobenhavn, Denmark 



с. LYDEARD 
University of Alabama 
Tuscaloosa. U.S.A. 
clydeard@biology.as. ua.edu 

C.MEIER-BROOK 
Tropenmedizinisches Institut 
Tubingen. Germany 

H.K. MIENIS 

Hebrew University of Jerusalem 

Israel 

J. E. MORTON 
The University 
Auckland. New Zealand 

J. J. MURRAY, Jr. 
University of Virginia 
Charlottesville. U.S.A. 

R. NATARAJAN 

Marine Biological Station 

Porto Novo. India 

DIARMAIDO'FOIGHIL 
University of Michigan 
Ann Arbor U.S.A. 

J.OKLAND 
University of Oslo 
Norway 

T.OKUTANI 
University of Fisheries 
Tokyo, Japan 

W. L. PARAENSE 

Instituto Oswaldo Cruz. Rio de Janeiro 

Brazil 

J. J. PARODIZ 
Carnegie Museum 
Pittsburgh, U.S.A. 

R. PIPE 

Plymouth Marine Laboratory 
Devon. United Kingdom 
RKPI @ wpo. nerc.ac. uk 

J. P POINTIER 

Ecole Pratique des Hautes Etudes 
Perpignan Cedex. France 
pointier@gala.univ-perp. fr 

W. F. PONDER 
Australian Museum 
Sydney 

Ql Z.Y 

Academia Sinica 

Qingdao. People's Republic of China 



D.G.REID 

The Natural History Museum 
London, United Kingdom 

S. G.SEGERSTRÂLE 
Institute of Mahne Research 
Helsinki. Finland 

A. STANCZYKOWSKA 
Siedlce. Poland 

F. STARMÜHLNER 

Zoologisches Institut der Universität 

Wien, Austria 

Y I. STAROBOGATOV 
Zoological Institute 
St. Petersburg, Russia 

J. STUARDO 
Universidad de Chile 
Valparaiso 

C.THIRIOT 

University P. et M. Cune 

Villefranche-sur-Mer France 

thiriot@obs-vlfr.fr 

S.TILLIER 

Museum National d'Histoire Naturelle 

Paris, France 

J. A.M. VAN DEN BIGGELAAR 
University of Utrecht 
The Netherlands 

N. H.VERDONK 
Rijksuniversiteit 
Utrecht. Netherlands 

H.WÄGELE 

Ruhr-Universität Bochum 

Germany 

Heike. Waegele@ruhr-uni-bochum.de 

ANDERS WAREN 

Swedish Museum of Natural History 

Stockholm. Sweden 

B.R.WILSON 

Dept. Conservation and Land Management 

Kallaroo. Western Australia 

H.ZEISSLER 
Leipzig, Germany 

A. ZILCH 

Forschungsinstitut Senckenberg 

Frankfurt am Main, Germany 



MALACOLOGIA, 2004, 45(2): 195-440 

CLASSIFICATION OF THE HELICINIDAE: REVIEW OF MORPHOLOGICAL 

CHARACTERISTICS BASED ON A REVISION OF THE COSTA RICAN SPECIES 

AND APPLICATION TO THE ARRANGEMENT OF THE CENTRAL AMERICAN 

MAINLAND TAXA (MOLLUSCA: GASTROPODA: NERITOPSINA) 

Ira Richling 

Zoologisches Institut, Christian-Albrechts-Universität zu Kiel 
Olshausenstraße 40, 24098 Kiel, Germany; ira@ñchling.de 

ABSTRACT 

The present study combines a taxonomical revision of the poorly known Costa Rican 
Helicinidae, with a detailed investigation of certain morphological structures with respect 
to their relevance for systematics, culminating in a discussion of the arrangement of the 
Central American mainland species. 

The revision of the Costa Rican species is based on the examination of nearly all type 
material, coupled with extensive field work and investigations of the collections of the 
Instituto Nacional de Biodiversidad de Costa Rica and the Florida Museum of Natural His- 
tory, Gainesville, along with perusal of additional historical material. With minor exceptions, 
all these species were investigated with respect to the features of shell, operculum, surface 
sculpture of embryonic shell and teleoconch, internal shell structures, radula, and female 
reproductive system. In addition, analyses of morphometry and sexual dimorphism were 
carried out. Faced with a limited amount of material, it became necessary to develop a new 
preparation method to separate the soft body from the shell without damaging either. 

For the higher classification and comparative analysis of the different morphological char- 
acteristics, similar examinations emphasizing formerly poorly studied or neglected charac- 
teristics, such as embryonic shell and female reproductive system, were carried out for 17 
additional species representing the most important related Central American supraspecific 
taxa using their type species when available. For taxa with inaccessible material, data from 
the available literature were critically incorporated. 

For Costa Rica, 15 species were recognized, among them seven new species, partially 
published in Richling (2001) - Helicina echandiensis, H. talamancensis, H. monteverdensis, 
H. chiquitica, H. escondida, Aleadla (Microalcadia) hojarasca, and A. (M.) boeckeleri - and 
two new subspecies - H. punctisulcata cuericiensis, and H. beathx riopejensis. Other pre- 
viously subspecifically separated taxa (H. funcki costahcensis Wagner, 1905; H. tenuis 
p/ff/er/ Wagner, 1910) were shown to fall within the range of intraspecific variability. Records 
of the Guatemalan and Mexican species Helicina oweniana L. Pfeiffer, 1849, and subspe- 
cies, H. amoena L. Pfeiffer, 1849, as well as those of H. fragilis Morelet, 1851 , were proven 
to be based on faulty identifications and were therefore excluded from the Costa Rican 
fauna. This fact, together with the recognition of the several new species, shows that the 
faunal composition of Costa Rica is much more distinct from that of the northern areas than 
previously assumed. The transitional zone of Nicaragua, however, still remains widely 
uninvestigated. Only Helicina tenuis L. Pfeiffer, 1849, being ecologically very tolerant, 
Lucidella lirata (L. Pfeiffer, 1847), and Pyrgodomus microdinus (Morelet, 1851) are wide- 
spread, extending from Mexico to Costa Rica, perhaps even farther south. The distribution 
of the typical Costa Rican species follows the topographical subdivision created by the 
Central Cordilleras, along with its corresponding effects on the climate. 

Contrary to former assumptions, certain features of the female reproductive system 
proved very useful for the classification of the Helicinidae. For the first time, monaulic con- 
ditions have been recognized for Helicina and Eutrochatella, necessitating the correction 
of previous descriptions in this respect. Furthermore, the monaulic or diaulic state is char- 
acteristic of the genera and is paralleled by consistent changes in the embryonic shell struc- 

195 



196 RICHLING 

ture. Because primitive members of the Helicinidae possess a diaulic system, the monaulic 
condition is regarded as the derived state. The Central American genera Helicina, Alcadia, 
Eutrochatella, Lucidella and Schasicheila were properly distinguished and described by this, 
as well as by other differences in the female reproductive system. The anatomies of the type 
species of Helicina and Alcadia were examined for the first time, and earlier descriptions 
of Eutrochatella and Lucidella were corrected in major points. On the basis of this new 
evidence, the assignment of traditional subgeneric units of Helicina and Alcadia, previously 
based mainly on vague radula and shell characteristics, was especially reassessed. The 
subgenera Sericea and Analcadia were transferred to Helicina, as well as the mainland land 
species summarized under the preoccupied taxon "Gemma". Tristramia, Oxyrhombus, 
Pseudoligyra, Oligyra, Succincta, "Cinctella" [also preoccupied] and Punctisulcata were 
confirmed in their association with Helicina. Due to its monaulic condition, the former ge- 
nus Ceochasma is reduced to a subgenus of Helicina. In addition, exemplary non-type 
Antillean species were studied, including Helicina jamaicensis Sowerby, 1841, which had 
to be shifted to Alcadia s.l., and Alcadia {Analcadia) platychila (von Mühlfeldt, 1816), which 
is now assigned to Helicina s.s. On one hand, the new arrangement excludes Alcadia as 
previously known from the Central American mainland, but, on the other hand, examination 
of the newly discovered Costa Rican species Helicina hojarasca and H. boeckeleh required 
the establishment of a new subgenus of Alcadia, Microalcadia n. subgen. on the mainland, 
based mainly on the features of the female reproductive system and embryonic shell struc- 
ture. The occurrence of Alcadia with only a few diminutive species on the mainland of Cen- 
tral America corresponds to the distribution of the genera Eutrochatella/Pyrgodomus and 
Lucidella. 

The Central American mainland species of Helicina seem to show a closer relationship 
among each other than to the northern South American subgenera Analcadia and Sericea. 
The Brazilian taxon Angulata, previously a subgroup of Helicina, deviates remarkably in 
embryonic shell structure and shows differences in anatomy that still require final 
confirmation, and it thus deserves recognition as a separate genus. 

Contrary to the well-supported differentiation at the generic level, the attempt to 
characterize subgroups of the Central American mainland species o^ Helicina has been only 
partially successful. Certain similarities in teleoconch surface structure, relative development 
of the accessory structures of the female reproductive system, and the degree of sexual 
dimorphism become obvious and are discussed to some extent, but intermediate 
characteristics complicate a satisfactory solution. Besides Ceochasma, three Central 
American mainland subgenera are recognized: Oligyra, Tristramia most closely resembling 
Helicina s.S., and "Gemma". The latter preoccupied name is tentatively retained, because 
the proposal of a new name seems inappropriate at this stage. 

Investigation of the morphological features other than the embryonic shell sculpture and 
the female reproductive system revealed the following additional results, mainly based on 
the Costa Rican species of Helicina: 

Characteristics of teleoconch, operculum, and radula, previously regarded as substantial 
for classification, were repeatedly demonstrated to be subject to convergent development, 
thus limiting their value for systematics. Different examples are given, such as the T-shaped 
lateral of the radula or periostracal hairs, and further evidence is provided by the necessary 
re-arrangements outlined above. Nevertheless, these features play a supplementary or 
supporting role. 

The mantle pigmentation of arboreal Helicinidae is closely related to the transparency of 
the shell and functionally replaces shell color in thin shells. The physiological possibility of 
an obviously adaptable mantle pigmentation could provide the opportunity for survival with 
thin, transparent shells as adaptation to the limited availability of calcium carbonate. 
Whereas varying and patterned mantle color are characteristic for arboreal thin-shelled 
species, the color of the head and foot is seldom species specific. 

Size differences of the embryonic shell have not previously been studied for Helicinidae. 
Embryonic shell size is shown to increase with the shell size within a group of related 
species and also altitude within different populations of a species. Furthermore, it may show 



CLASSIFICATION OF HELICINIDAE 197 

a certain species specificity. Preliminary data on Lucidella and Eutrochatella/Pyrgodomus 
suggest a consistently smaller embryonic shell size than in Helicina or Alcadia. 

Internal shell structures - axial cleft and muscle attachments - seem characteristic for 
certain systematic units, for example, Lucidella and Schasicheila. The length of the axial 
cleft is confirmed to be constant within a species, but, contrary to former assumption, it is 
not related to the whorl count. 

The data on sexual dimorphism given in this study represent the most comprehensive 
approach to date to analyze this phenomenon for Helicinidae. The sexual dimorphism may 
manifest itself in differences in volume, a male's size being only about 62-70% of that of 
the female's, but formerly assumed deviations in shape could not be proved to be of 
significance for species of Helicina. A certain value for the degree of differences in 
uncovering systematic affinities is indicated. 

Keywords: Helicinidae, Costa Rica, Central America, classification, reproductive system, 
radula, embryonic shell, new species. 

RESUMEN 

El presente estudio combina una revisión de los poco conocidos helicínidos de Costa 
Rica con un análisis detallado de varias estructuras morfológicas y su utilización para 
resolver preguntas sistemáticas. Con base en esto se discute a profundidad la clasificación 
de las especies continentales de Centroamérica. 

La revisión de las especies costarricenses se basa en un exhaustivo trabajo de campo, 
en el análisis de casi todo el material tipo, de las colecciones del Instituto Nacional de 
Biodiversidad de Costa Rica y del Museo de Historia Natural de Gainesville, asi como de 
material histórico. Con pocas excepciones se estudiaron para todas las especies los 
caracteres de la concha, del opérculo, de la estructura superficial de la concha embriónica, 
asi como de la teleoconcha, estructuras internas de la concha, la rádula, y el tracto 
reproductor femenino. También se efecturon estudios sobre morfometria y dimorfismo 
sexual. Considerando la escacéz de material, para efectuar un estudio a gran envergadura, 
fue necesario desarollar una metodología de disección para separar el cuerpo blando de 
la concha sin ningún detrimento. 

Para efectuar una clasificación más amplia y una comparación de las diferentes 
estructuras morfológicas se tomaron los mismos datos de otras 17 especies, que 
representan los taxa supraespecificos emparentados más importantes de Centroamérica. 

Énfasis se puso en las estructuras poco estudiadas hasta ahora como la concha 
embriónica y el tracto reproductor femenino. Hasta donde se pudo se trabajo con material 
de especies que corresponden a los tipo. En donde no se pudo obtener material anatómico 
para estudiar se interpretaron cuidadosamente los datos de la literatura. 

Para Costa Rica se determinaron 15 especies, entre las cuales siete son nuevas, y en 
parte publicadas en Richiing (2001) - Helicina eciíandiensis, H. talamancensis, H. 
monteverdensis, H. chiquitica, H. escondida, Alcadia (Microalcadia) hojarasca y A. (M.) 
boeckeleri, además dos nuevas subespécies H. punctisulcata cuericiensis y H. beatrix 
hopejensis. Los taxa subespecificos, hasta ahora separados, H. funcki costaricensis 
Wagner, 1905, y H. tenuis pittieri\Nagner, 1910, caen dentro de la variación intraespecifica. 
La presencia de las especies mejicanas y guatemaltecas Helicina oweniana L. Pfeiffer, 
1849 con sus subespécies, H. amoena L. Pfeiffer, 1849 y H. fragilis Morelet, 1851 no fue 
confirmada ya que el material estaba mal identificado y por esto se las elimina del listado 
faunistico de Costa Rica. Debido a este hecho y al descubrimiento de algunas nuevas 
especies se puede distinguir la fauna de Costa Rica más claramente de otras regiones más 
al norte de lo que se suponía hasta ahora. Nicaragua que es el territorio de transición está 
casi inexplorado. Solamente las especies Helicina tenuis L. Pfeiffer, 1849, que presenta 
una gran tolerancia ecológica, asi como Lucidella tirata (L. Pfeiffer, 1847) y Prygodomus 
microdinus (Morelet, 1851) se distribuyen desde México hasta Costa Rica y también más 
hacia el sur. La distribución de las especies tipleas costarricenses sigue la subdivisión 
topográfica de las cordilleras centrales y sus efectos correspondientes al clima. 



198 RICHLING 

Contrario a supociciones anteriores, se pudo demostrar que los caracteres del tracto 
reproductor femenino son muy útiles en la clasificación de los helicinidos. Por primera vez 
se pudieron reconocer condiciones monáulicas en Helicina y Eutrochatella por lo que 
descripciones previas se deben corregir a este respecto. Además la condición monáulica 
o diáulica son característicos para cada género y paralelamente hay cambios consistentes 
el la estructura de la concha embriónica. Ya que los miembros primitivos de los helicinidos 
poseen un sistema diáulico, la condición monáulica es considerada como derivada. Los 
géneros centroamericanos Helicina, Alcadia, Eutrochatella, Lucidella y Schasicheila se 
distinguen claramente y son descritos por estos y otros caracteres de la genitalia femenina. 
La anatomía de las especies tipo de Helicina y Alcadia se estudiaron por primera vez y las 
descripciones anteriores de Eutrochatella y Lucidella se debieron corregir en varios puntos 
importantes. Sobre esta nueva base, especialmente la asignación de las tradicionales 
unidades subgenéricas de Helicina y Alcadia, que estaban previamente basadas en 
caracteres vagos de la rádula y la concha, fueron reordenaron. Los subgéneros Sericea 
y Analcadia se transfirieron a Helicina asi como las especies continentales comprendidas 
bajo el taxón preocupado "Gemma". La pertenencia a Helicina de Trístamia, Oxyrhombus, 
Pseudoligyra, Oligyra, Succincta, "Cinctella" (también preocupada) y Punctisulcata se 
confirma. Debido al tracto genital monáulico, el género Ceochasma se ordena como 
subgénero de Helicina. Especies de la Antillas solo se estudiaron ejemplarmente, Helicina 
jamaicensis Sowerby, 1841, se incluyó dentro de Alcadia s.l. y Alcadia (Analcadia) 
platychila (von Mühlfeldt, 1816) se le asigna a Helicina s.s. Por una parte estos datos 
excluyen al género Alcadia del continente centroamericano, por otra parte el análisis de las 
nuevas especies costarricenses encontradas de Helicina hojarasca y H. boeckeleri 
requirieron la instauración del subgénero Alcadia, Microalcadia n. subgen., para el 
continente basándose mayormente en los caracteres del tracto reproductor femenino y de 
la concha embriónica. La presencia de Alcadia con solo unas cuantas pequeñas especies 
en el continente corresponde a la distribución de Eutrochatella/ Pyrgodomus y Lucidella. 

Las especies continentales centroamericanas de Helicina parecen estar más 
emparentadas entre si, qué con los subgéneros Analcadia y Sericea del norte de 
Suramérica. El taxón brasilero Angulata, subordinado a Helicina, posee una estructura de 
la concha embriónica claramente distinta y diferencias anatómicas todavía por corroborar, 
por esto se le considera como un género aparte. 

Contraria a la clara diferenciación a nivel genérico, el intento de agrupar las especies 
continentales de Helicina ha sido solo en parte exitoso. Algunas similitudes en la estructura 
superficial de la teleoconcha, el desarrollo relativo de las estructuras accesorias del aparato 
reproductor femenino, y el grado de dimorfismo sexual son obios y se discuten en parte, 
pero estadios intermedios complican la solución satisfactoria de este problema. Además 
de Ceochasma, se reconocen tres subgéneros centroamericanos continentales: Oligyra, 
Tristramia muy parecido a Helicina s.s. y "Gemma". Este último está preocupado pero se 
le retiene tentativamente, ya que proponer un nuevo nombre a este nivel no se considera 
apropiado. 

El estudio de otros caracteres morfológicos diferentes a la estructura de la concha 
embriónica y del aparato reproductivo femenino revelan los siguientes resultados 
adicionales, basados especialmente en las especies costarricenses de Helicina: 

Se demostró repetidamente que las características de la teleoconcha, opérculo y rádula, 
previamente considerados fundamentales para la clasificación, son objeto de desarrollos 
convergentes, limitando asi su valor sistemático. Diferentes ejemplos son dados como el 
diente lateral en forma T de la rádula o los filamentos del perióstraco. Evidencia adicional 
es dada en la reorganización requerida mencionada anteriormente. Sin embargo estos 
caracteres juegan un papel suplementario o de soporte. 

La pigmentación del manto de los helicinidos arbóreos está fuertemente relacionada con 
la transparencia de la concha y reemplaza funcionalmente la coloración de la concha en 
conchas delgadas. La posibilidad fisiológica de la pigmantación del manto se considera 
como una adaptación obla que permite la supervivencia con conchas delgadas, en 
ambientes con poco calcio. Mientras que los patrones de coloración del manto son 



CLASSIFICATION OF HELICINIDAE 



199 



característicos para las especies arbóreas con conchas delgadas, la coloración de la 
cabeza y el pié son raramente característicos a nivel de especie. 

Las diferencias del tamaño de la protococnha no se hablan estudiado previamente en los 
helicinidos. Se demuestra que el tamaño de la concha embriónica aumenta con el tamaño 
de la concha en un grupo de especies relacionadas y con la altitud de la localidad de 
différentes poblaciones de una especie. En algunos casos el tamaño de la concha 
embriónica puede ser característico para una especie. Primeros datos de Lucidella y 
Eutrochatella/Pyrgodomus muestran constantemente una concha embriónica más pequeña 
que en Helicina o Alcadia. 

Las estructuras internas de la concha - apertura axial e inserción de los músculos - 
parecen ser característicos para algunas unidades sistemáticas, e. j. Lucidella y 
Schasicheila. La longitud de la apertura axial es constante dentro de las especies, pero, 
contrariamente a lo que se suponía, no está relacionada con el número de vueltas. 

Los datos sobre dimorfismo sexual dados en este trabajo representa la aproximación más 
amplia hasta la fecha para analizar este fenómeno en los helicinidos. Este estudio muestra 
diferencias significativas en el volumen, en donde los machos en casos extremos 
solamente alcanzan aproximadamente entre el 62 y el 70% del tamaño de las hembras. 
Contrariamente a las suposiciones anteriores no se pudieron comprobar diferentes formas 
en el género Helicina. El grado de dimorfismo sexual parece tener también valor al 
determinar las relaciones de parentesco. 



INTRODUCTION 

The Helicinidae and a few related families 
belonging to the Neritopsina represent the 
earliest branch of gastropods evolved to ter- 
restrial existence from as-yet unknown 
diotocardian marine ancestors. Their recent 
distribution encompasses two main regions - 
the subtropical and tropical zones of North 
and South America and the Indopacific and 
Pacific islands and small areas of the Asian 
and Australian continents. A particular high 
diversity has developed on the Caribbean Is- 
lands and on the Philippines. The family is 
comprised of approximately 550 species, of 
which a little more than half occur in the New 
World. Most species are small, with only the 
largest representatives reaching nearly 3 cm. 

Early classifications of the Helicinidae were 
based on shell characters only (e.g., L. 
Pfeiffer, 1850-1853). Later, Wagner (1907- 
1911) provided the still most extensive, but 
much criticized (e.g., Fulton, 1915; Solem, 
1959: 166-167) monograph on the family 
worldwide, incorporating features of the oper- 
culum for his systematic arrangement. At 
about the same time, a very detailed, compre- 
hensive anatomical investigation of several 
New and Old World species of different gen- 
era, including histology, was published by 
Bourne (1911). His study demonstrated a con- 
siderable uniformity of the morphological 
structures within the Helicinidae, indicating 
their very limited value for revealing system- 



atic affinities, especially with respect to the 
reproductive system. In conclusion. Bourne 
(1911) favored radular characteristics as the 
safest feature for a classification. Baker 
(1922a, 1923) followed this concept to clarify 
the relationships of the American mainland 
taxa (United States to northern South 
America) and nomenclaturally corrected, 
modified and consolidated the system of 
Wagner (1907-1911) through radula charac- 
teristics that were believed to provide system- 
atically relevant information. Subsequent 
anatomical studies on the same group of spe- 
cies with emphasis on the reproductive sys- 
tem (Baker, 1926, 1928) did not allow similar 
conclusions to be drawn due to the uniformity 
of the structures and the limited material. Later 
authors interpreted the results in the sense of 
Bourne (1911) and stated that the "... general 
uniformity of the genitalia of the Helicinidae 
makes them useless for diagnostic purposes" 
(Boss & Jacobson, 1974: 6). The radula char- 
acteristics were partly accepted, but other 
authors questioned their value for certain taxo- 
nomical units (Rehder, 1966; Boss & 
Jacobson, 1973). The most recent contribu- 
tion to systematic issues of Helicinidae by 
Thompson (1982) highlights the conservative 
character of embryonic shell sculptures as a 
criterion for determining relationships, but its 
further application was beyond the scope of 
his study on a species-group from the West 
Indies. The few publications dealing with the 
classification of the Australasian and Pacific 



200 



RICHLING 



species are based on shell structures or 
vague differences in the radula, respectively. 
In conclusion, it can be stated that the system- 
atics within the Helicinidae still remain contro- 
versial, and due to the fact that the studies of 
the different structures were mostly based on 
different taxa, they are not comparable and 
any interpretation is, at the very least, partially 
questionable. 

Faced with the absence of a detailed inves- 
tigation of the applicability of different features 
to reveal affinities within the Helicinidae and a 
comparison of all these characteristics for one 
and the same group of species, this study tries 
to bridge this gap. Furthermore, preliminary 
studies on the female reproductive system of 
a Costa Rican species showed deviations 
from the previous results, rendering these or- 
gans more informative than described above. 
Therefore, the present study intends to inves- 
tigate several morphological characters for 
their value in determining relationships on the 
species level (rather highly adaptable) and in 
higher systematics (rather conservative). The 
chosen characteristics will encompass widely 
applied aspects, such as shell in general, 
operculum and radula, but will also focus on 
less investigated or neglected structures, such 
as teleoconch surface structure, embryonic 
shell, internal shell structures, female repro- 
ductive system, and the phenomenon of 
sexual dimorphism. 

Because single structures can only partially 
be assessed in their possible adaptability by 
their complexity and functionality alone, they 
also have to be discussed within the context of 
the best possible, well-founded synthesis of all 
possible characteristics, that is, the proposed 
classification. Therefore, the analysis of struc- 
tures is based on revision of one group of 
closely related species (species level) and 
study of other related supraspecific taxa 
(higher systematics, e.g., type species of re- 
spective genera and subgenera). This will re- 
sult in a new proposal for the classification of 
the taxa studied, which is compared with pos- 
sibly deviating previous concepts. 

This study will be based on the Costa Rican 
representatives of Helicinidae, which encom- 
pass a reasonable number of species for de- 
tailed analysis. According to Wagner 
(1907-1911) and Baker (1922a, 1926), most 
of the species belong to one or two genera, 
Helicina or Helicina and Aleadla. Single spe- 
cies of Lucldella and Pyrgodomus represent 
relatives of genera with otherwise Antillean 
distributions. Two newly discovered species 



(Richling, 2001) still await proper classifica- 
tion. Thus, a fairly wide scope of systematic 
units is included and, with respect to the Costa 
Rican species, part of the Central American 
mainland fauna has been chosen for which 
the most data for comparison, mainly from the 
works of Baker, are available. 

The focus on the Costa Rican species pro- 
vided the opportunity to carry out a revision of 
the Helicinidae of a poorly investigated area 
as well. Because von Martens (1901: xii) still 
has characterized the molluscan fauna as 
"one of the best known within Central 
America", a few scattered publications in the 
1930s (e.g., Pilsbry) remained in complete 
neglect until recently, when the growing inter- 
est in tropical biodiversity, spearheaded by the 
foundation and work of the Instituto Nacional 
de Biodiversidad de Costa Rica (INBio), re- 
sulted in a new approach. The cooperation 
with the Zaidett Barrientes of the Malacology 
Section of INBio in providing access to the 
comprehensive collection of national molluscs 
greatly ameliorated the disadvantage of the 
unfavorable geological conditions of Costa 
Rica for collecting terrestrial snails which re- 
sult in extremely low abundances and there- 
fore present practical difficulties for obtaining 
sufficiently large numbers of specimens for 
certain aspects of the study. 



MATERIALS AND METHODS 
Area of Investigation 

Costa Rica is situated in southern Central 
America adjacent to Nicaragua to the north 
and Panama to the south (about 8° to 
11°15'N). Located between the Pacific Ocean 
and the Caribbean Sea, small area of just 
51,100 square kilometers rises up to 3,820 m 
above sea level. The central mountain chain, 
northwest to southeast in orientation, sepa- 
rates a larger Caribbean from a hilly Pacific 
plain. The mountains are subdivided into the 
northern Cordillera de Guanacaste, the Cordil- 
lera de Tilarán, and the Cordillera Central, a 
chain of volcanoes, some of them still active, 
and the southern Cordillera de Talamanca 
which has been uplifted as a result of the sub- 
duction of the Cocos Ridge (Fig. 1). 

The climate is characterized by a dry and a 
rainy season, with the dry season lasting from 
about December to May. Whereas the north- 
western and central parts of the country really 
experience a dry period, the southern Pacific 



CLASSIFICATION OF HELICINIDAE 



201 



side as well as the Caribbean side always 
have humid conditions. This is reflected in the 
variation of the vegetation, the tropical dry for- 
est only being found in the northwestern area 
in the transition to the Peninsula de Nicoya. 
The vegetation of the remaining part of the 
country is classified as moist, wet or rain for- 
est (Tosi, 1969), with the humidity mainly in- 
creasing with the altitude (Fig. 2). The distribution 
of the annual precipitation is given in Fig. 3. 

Materials 

Fieldwork: 
Costa Rica. The field work was carried out 
on five visits of about 4 to 9 weeks each to 



Costa Rica between 1998 and 2001. With 
one exception during the rainy season of July 
to September, the field trips were carried out 
during the dry season in February and March. 
Several localities scattered around the coun- 
try were investigated for distributional data. 
Selected areas were visited several times in 
order to gather sufficient material of certain 
populations for comparative studies, because 
their abundance in the tropical rain forests is 
very low. Due to the arboreal life-style of most 
of the Costa Rican species, manual searches 
had to be conducted. The detailed material 
and localities are listed under each species. 
Main collecting sites are shown on the gen- 
eral map (Fig. 1). 



86° \ y'-^ 


^85° 

--_^^ NICARAGL 


- - \ 




83° 


~^ ^ Orosi 

■'¿^Esración Góngora 

Estaciorí^an Cr 
(Rincón 

^ GU 


■ %иял,^..= r=i^ ^-^/ ^Estación 
»Ca^o !^ • ^-"^ •Playuelas 
• CL Santa Clara •Caño Negro 

de la Vieja ^^jJ^Cg, 
'-eria % 4,,,,^,„ ALAJl 

^NACASTE ^^=;^^^= 


'4 

JELA 


: • Barra №l Colorado 

Cerro Cocori • V!.,. . 

•Tortuguero 


ir 


\ • 

\ Diria 
\ Pei 


^^ Volcán Arer 

-^ Finca Ecológica ij Quanta Ele 
»^ Monteverde <g, <3Jj, 

• ^--^ \-^ 
Bana ^°"^\-~^/^\ ■^ 

linsula ^ Í 'tl'J îxPF-'-lAo 'ly. 


al 

rdo 

na 

С 


Fincà Montat^a Grane» 
t La Selva »RitJA^as frías 
HERÉDIA \ 

L / LIMÓN \ 

■^J SiquirreseeRioPacuafto 

G. « eRioBarBvIla „ . , 
<5^ Guayacàn Щ' \ Puerto Limón 


"" 


de '"^^^^f *^ 
Ч. Nicoya 'X \ 

\ C-' /C^rar; 

v^ Cabo Blanco 'v 


• Turrübares 

SAN JC 


'V -- 

• San José »Turrialb 
1 »Cartago 

33 É |V_ <q, 


--, Ф TwislaUvita 

< •. MéxicoX 
' Rio Peje Ч 

TéCatiuit 

y. Hitoy Cerere^ ^ ^~— i 

■%. Shiroles* 1йЬ-тМаг 

Oí. Amubfie S Ч, 


10° 
za«iito 

7^ 










• Riç Naranjo 
^~""^v.^ eSan Isidro 


*> 

rnpo 'V 


AI 


3 Tararía' 


p 

A 
















3500 - 4000 m 

3000 - 3500 m 

2500 - 3000 m 

2000 - 2500 гл 

1500- 2000 гл 

1000 -1500 m 

500-1000ГЛ 

100 -500 m 

0- 100 m 


X 






•AnnfelBd 






Ikr^t 


INiAKtlNAo -s 

r, n * A •San Vito 


A 

M 
A 








^ S^ 4_» •FXadeCal 
l ! \ ^^^'^4V Neily 
^^ Peninisuten»— . V, 
\ de ^ Г 










^^] ) ^ 


- 






Ч^.— 






чГ^ 














l 



FIG. 1. Map of Costa Rica, including the most important collecting sites, the central mountain chains, 
and the provinces. 



202 



RICHLING 




FIG. 2. Vegetation zones of Costa Rica (based on Tosi, 1969). 




FIG. 3. Annual precipitation in Costa Rica [mm/year] (based on 
Ministerio de Agricultura y Ganaderia & Instituto Meteorológico 
Nacional, 1985). 



CLASSIFICATION OF HELICINIDAE 



203 



Jamaica/United States. Because the type 
species of the most important Central Ameri- 
can genera {Helicina, Alcadia, Lucidella, 
Eutrochatella) occur in Jamaica, and pre- 
served material was not available in collec- 
tions, supplementary research was carried 
out during two weeks in May/June 2001. 
Specimens of Helicina orbiculata (Say, 
1818) were collected in Gainesville, Florida, 
in May 2001. 

Museum Collections: Material of the following 
institutions has been studied, subsequently 
only the abbreviations will be used: 

ANSP Academy of Natural Sciences of 
Philadelphia, Philadelphia, USA 
(Dr. Gary Rosenberg, Dr. Igor 
Muratov) 

APHIS- Malacological Collection of United 
PPQ States Department of Agriculture, 
USDA Philadelphia, USA (Dr. David G. 
Robinson) 

BMNH The Natural History Museum, Lon- 
don (formerly British Museum, 
Natural History), Great Britain (Dr. 
Fred Naggs, Richard Williams) 

HNC Haus der Natur Cismar, Germany 

(Dr. Vollrath Wiese) 

INBio Instituto Nacional de Biodiversidad 
de Costa Rica, Santo Domingo, 
Costa Rica (Dr. Zaidett Barrientes) 

IR Material collected by Ira Richling, 

partially deposited as vouchers at 
INBio, otherwise accessible 
through the collection of the HNC; 
a few of the numbers refer to field 
observations only 

MHNN Musée d'Histoire Naturelle, 
Neuchâtel, Switzerland (Dr. Jean- 
Paul Haenni) 

MIZ Museum and Institute of Zoology 

of the Polish Academy of Sci- 
ences in Warszawa, Poland 
(Prof. Dr. Adolf Riedel) 

NMBE Naturhistorisches Museum Bern, 
Bern, Swiss (Dr. Margret Gosteli) 

RMNH Nationaal Natuurhistorisch Mu- 
seum, Leiden (formerly 
Rijksmuseum van Natuurlijke 
Historie), The Netherlands (Wim 
Maassen) 

SMF Naturmuseum und Forschungs- 

institut Senckenberg, Frankfurt a. M., 
Germany (Dr. Ronald Janssen) 



UF Florida Museum of Natural His- 

tory, Gainesville, USA (Dr. Fred 
G. Thompson, John Slapcinsky) 

USNM United States National Museum, 
Washington, D.C., USA (Dr. Rob- 
ert Hershler) 

ZMB Museum für Naturkunde, Humboldt- 

Universität, Berlin, Germany (for- 
merly Zoological Museum Berlin) 
(Dr. Matthias Glaubrecht) 

ZMH Zoologisches Museum, Universität 

Hamburg, Hamburg, Germany (Dr. 
Bernhard Hausdorf) 

INBio: Within a context of considerable re- 
cent efforts towards an inventory of the 
biodiversity of Costa Rica, the institute 
houses a very extensive collection of mol- 
luscs. All available specimens of Helicinidae 
from this material were studied, partially dur- 
ing personal visits in Costa Rica, partially by 
loans to Germany. 

UF: This institution houses probably one of 
the most comprehensive collections of Cen- 
tral American terrestrial molluscs. During a 
two-week visit, about 1,100 lots of 
Helicinidae were studied with the emphasis 
on the mainland species yielding consider- 
able distributional data. 
ZMB/MHNN: The only important historical 
collections in Costa Rica were made by the 
Swiss naturalists Biolley and Pittier at the 
end of 19"" century. Their material ended up 
in different collections, parts of it in the ZMB 
and MHNN respectively, other parts re- 
mained in the Museo Nacional in San José, 
Costa Rica (see under Helicina pitalensis). 
The ZMB collection was visited personally, 
whereas material in the MHNN was 
searched for by J. -P. Haenni, Neuchâtel, 
and kindly loaned to the author. According to 
J. -P. Haenni, an up-to-date catalogue of the 
mollusc collection does not exist and the 
materials of Pittier and Biolley are scattered 
throughout the collection, which has never 
actually been catalogued and which was 
moved in the past, and it is possible that 
some of the material has not yet been found. 
A detailed list of material studied is given 
under each species. 

Locations/Maps: During the field work, coordi- 
nates of the localities were registered using 
the Global Positioning System (Magellan 
GPS 3000) whenever possible, otherwise 



204 



RICHLING 



they were taken from maps in 1:50,000 
scale produced by the Instituto Geográfico 
Nacional, San José, Costa Rica, in different 
editions, but all based on data from between 
1961 and 1966. The staff of INBio uses the 
same maps. All Costa Rican records from 
literature or other sources without exact data 
were localized as accurately as possible and 
coordinates were estimated based on the 
map: Los Parques Nacionales y otras areas 
protegidas de Costa Rica. - Fundación 
Neotrópica, San José, 1993, I Réimpression 
1995. Information on some historical collect- 
ing sites was provided by Zaidett Barhentos 
and Maribel Zuñiga, INBio. All further expla- 
nations that were subsequently added are 
given in brackets. 

The map of Costa Rica used throughout this 
study is based on: Costa Rica. Mapa fisico- 
politico 1:500.000 - Instituto Geográfico 
Nacional, San José, edition 1987. 

Methods 

Measurements: The following linear measure- 
ments (Fig. 4) were used, when measure- 
ments of single species given, the following 
sequence is given, separated by 7" (unless 
otherwise stated): 

height 

major diameter 
greatest diameter 
minor diameter 
expansion of outer lip 



height of last whorl 
height of columellar axis 

Because some helicinid species display 
variation in the development of the outer lip 
which mainly influences the measure of the 
greater diameter, measurement of "major 
diameter" has been introduced. This mea- 
surement was taken just behind the reflec- 
tion of the outer lip (F^ig. 4). For the height, 
this modification was not applied, because it 
is not affected as much and is furthermore 
not uniformly practicable. 
The greatest diameter is usually included 
only in measurements given for single speci- 
mens to comply with traditional measure- 
ments. 

Measurements were taken with a microme- 
ter gauged on 0.01 mm scale. In view of the 
deviation shown below that were minimized 
by personal experience, values given to 
characterize single specimens were 
rounded to a 0.1 mm scale. Deviations are 
mainly due to effects of an imperfect perpen- 
dicular orientation of the shell with respect to 
the measuring axis, a problem that can be 
minimized with experience if the same per- 
son carries out the measurements. How- 
ever, errors probably cannot be excluded in 
globular shells, but their range is tolerable. 
To check the average deviations, three 
shells of different shapes were measured 
the different times and the mean value, the 
standard deviation and absolute deviations 
were analyzed (Table 1). 



height 




expansion 
of outer lip 




height of 
columellar axis 




FIG. 4. Measurements and counting of postembryonic whorls. 



CLASSIFICATION OF HELICINIDAE 



205 



ф 

I 

о 
ш ел 

з'х 

о го 
о = 



3 " 
1Л II 

с _^ 

',« о 



о ^-' 

га m 



ТЗ .5 
ч_ ТЗ 
О ,_ 
(Л О 
СЛ - 

>'Е 
го "î: 
с: о 

< 'го' 
^ Е 
Ш II 

¿Е 

< га 
\-'-о 



CD 

fc со 

О) -^ 
СУ)т— 



-S о 



Сю 



Ü со 



'^ ГУ 

-Q ~ 
стз о 

.с ~ 
.о 



го 


о 


•о 

с 


го 


го 


> 




ф 


со 


"О 


с 


ф 


го 


3 


ф 


го 

> 




J_ 




ф 




JD 




Е 




3 




Z 




X 




го 




^ 




с 




^ 


■о 


с 


го 


о 


■о 


го 


го 


> 




ф 


со 


73 


с 


ф 


го 


3 


ф 


го 


5 


> 



о о о 
о о о 



см со -^ 
Г-- -^ -^ 
о CN го 



о о о о 



■^ о со CNJ 
Г-- CT) О) CNJ 

ю со -^ ю 



ю со •^ ю 



о о о о 



т- со h- 

СО т- ^ 


CJ) СО -^ СО 
СО 00 CD т- 


CD CD со 


Ю СО -^ Ю 



О О О О 



о см со т- 



^ t^ 00 оо 



■^ СУ> со 
о о о 


r\J Гч| 

о о 


о 


Ю 
О 


о о о 


о о 


о 


О 


00 со CD 

г^ со •^ 






Г^ 



О CNJ СО т- 



о о о о 



со го т- ОС СП 00 о 

со -íí 00 о ОО т- со 



оо t^ г^ 


г^ 


•^ со со 


Г-- -^ о 
гм со г^ 


CNJ 

о 


'^ о со 

Г-- т- ^ 



1^ -^ со со 



гм со со с\| со го со 
о о о о о о о 
сЬ сэ о о Ö Ö о 



г- -^ со со 



Е "55 а) Е Q. о (Л 

^ .^ Ф Ф .га — -с >< 

-&^ га Е^ шВ "^ 

f го 2^:§.Ç 3-^0 



206 



RICHLING 



In addition to the linear measurements, the 
weight and volume of empty shells were 
analyzed. Sartorius scales (scale 0.001 g) 
were used. The volume was measured as 
the difference of weight of the shell filled with 
distilled water and the weight of the empty 
shell. To obtain comparable data, shells 
were always filled until the water showed a 
plain surface in the aperture. In the weight 
measurements, the hole caused by the 
preparation procedure did not influence the 
results, because the wall at the beginning of 
the last whorl is thin and the amount of ma- 
terial removed was below the scale of reso- 
lution. 

Except for the specimens studied with the 
SEM, the diameter of the embryonic shell 
was measured under a stereomicroscope 
(scale 20 pm). Otherwise, measurements 
were taken from photographs, which are 
much more exact. Whorls were counted ac- 
cording to Fig. 4. 

Fixation: The preservation of the live collected 
material was carried out in two ways: 

(1) Collections until 1999: Specimens were 
relaxed in water for several hours and sub- 
sequently transferred to isopropanol (about 
80%). 

This method has disadvantages: It is difficult 
to find the right time to stop the relaxation 
process, because it depends on so many 
factors, such as specimen size, water vol- 
ume and temperature. Under the conditions 
of field work and travel by bus, it is difficult to 
carry out lengthy procedures. Furthermore, 
the shocks received during transport also 
influence timing. As a result, the specimens 
may be badly preserved or contracted. In 
case they close their opercula again, there 
remains the risk that the alcohol will not pen- 
etrate into the shell. 

Beginning in 2000, I developed the new 
method to remove the body from its shell 
described below, which allowed another 
preservation method mitigating these disad- 
vantages. 

(2) Collections after 1999: Specimens were 
removed from the shell alive and immedi- 
ately dropped in isopropanol. 

It has the advantage that specimens can be 
preserved immediately and with a constant 
result. The problem of the closure of the 
operculum becomes irrelevant. If a relax- 
ation is required for subsequent investiga- 
tions, the body can still be dropped in water 
or other solutions and will be anaesthetized 



much faster due to the greater unprotected 
surface for medium exchange. For the 
present study and due to the need of a fast 
working method, a relaxation process has 
usually not been applied, because retrac- 
tions are limited to the foot and the two por- 
tions of the retractor muscle and do not 
greatly affect other organs. 

Preparation and Storage of Material: Against 
the background of the low abundance of 
Helicinidae in Costa Rica and the various 
aims of the study (e.g., aspects of anatomy, 
sexual dimorphism), two requirements had 
to be met at the same time: the shell and the 
animal had to be separated and they had to 
be kept as intact as possible. 
When normally pulling a more or less re- 
laxed animal out of its shell, in most cases 
the head-foot and the anterior palliai portion 
will be released, but the remaining part will 
be torn off within the shell. This is due to the 
fact that in the Helicinidae, contrary to most 
other gastropods, by the dissolution of the 
inner whorls of the shell, the visceral mass 
forms one large complex, which has a 
greater diameter than the remaining part of 
the last whorl or aperture respectively, 
through which it has to pass. Furthermore, 
air cannot penetrate to allow the body to be 
released. Besides the obvious disadvan- 
tages, the resulting rupture of the body di- 
rectly divides the palliai gonoduct at an 
important section and often makes its study 
impossible. 

In a newly developed method, a small hole 
is made on the periphery within about the 
second quarter of the last whorl (Fig. 5, ar- 
row) with a nail file or insect needle of differ- 
ent size, depending on the shell thickness. 
This can be performed without injury to the 
animal when applying the method to live in- 
dividuals. Subsequently, a needle, curved if 
necessary, is carefully inserted between 
shell wall and body and the two retractor 
muscles are detached. Afterwards, the ani- 




/ 



FIG. 5. Hole for removal of the body. 



CLASSIFICATION OF HELICINIDAE 



207 



mal can easily be removed by pulling the 
operculum (live animals) or by a needle in- 
serted in the foot (preserved animals). One 
must be careful to allow air to enter the hole. 
Live animals can then be fixed. In preserved 
specimens, it is usually more complicated 
during the final removal to avoid the damage 
described above, because the visceral mass 
is no longer very flexible or may suffer from 
poor preservation. By the aid of the needle 
(through the hole), the visceral mass then 
has to be squeezed through the remaining 
part of the last whorl. The success in pre- 
served specimens greatly depends on the 
shell shape (relation of shape and volume of 
visceral mass to the diameter of the aper- 
ture) and the prior fixation. During the 
present study, the method seldom failed. 
In my own material, shells were separated 
from the bodies in all adult and live collected 
specimens. They were individually stored, 
enumerated and labeled. 

Sex Determination: The determination of the 
sex was done by external inspection of the 
soft body. According to Baker (1926) and 
personal experience, in most cases and 
many species a dissection is not necessary. 
Females are recognized by the compara- 
tively small lobes of the ovary, widely 
spaced, regular constrictions of the palliai 
gonoduct (not in all species), and the dark 
color of a distinct portion of the distal palliai 
gonoduct. Males are characterized by the 
comparable larger lobes of the testis, the 
absence of the distinct dark color, a very 
densely lobed apical, and smooth distal part 
of the pallia! gonoduct. In some cases, the 
shiny white vas deferens may shimmer 
through the visceral mass. Normally not all 
these features are visible in one and the 
same specimen, but each one may be un- 



equivocal. It mainly depends on the body 
pigmentation, the species and the individual 
development. In ambiguous cases, the 
specimen was dissected. 

Reproductive System: Dissections were made 
in 70% isopropanol or ethanol. For the in- 
vestigation of the reproductive system, the 
mantle cavity was opened along the left side 
of the intestine, with the latter remaining 
along the palliai gonoduct. A second cut was 
made between the palliai gonoduct and the 
right retractor muscle, along or through the 
hypobranchial gland up to the apical part of 
the palliai portion of the reproductive system 
(Fig. 6). 

Histology: The separated female reproductive 
system was dehydrated through a series of 
ethanol, transferred to paraffin via acetone 
(100%) and embedded in paraffin. Serial 
sectioning was done at 5-7 pm with a sliding 
microtome. The tissue was subsequently 
stained with a sequence of paraldehyde 
fuchsin solution, nuclear fast red and orange 
G/ light-green. 

Preparation of Shells for SEM: In order to re- 
duce lasting effects to the shell by gold coat- 
ing, the specimens were usually mounted on 
aluminum specimen stubs using adhesive 
conductive tape. Subsequently, they were 
tightly covered with laboratory film (Parafilm 
"M"®), which adhered to the remaining sur- 
face of the adhesive conductive tape. Fi- 
nally, the embryonic shell or other areas of 
interest were uncovered and coated. After 
the SEM investigation the laboratory film can 
easily be removed and the shell extracted. 

Preparation of the Radula: The radula was re- 
moved from the buccal mass. It was cleaned 



digestive 
gland 

ovary 




right retractor 
muscle 



operculum 



hypobranchial gland 

pallia! reproductive system 
intestine 



mantle cavity 




stomach 

kidney 

heart and pericard 

digestive gland 

ovary 

left retractor 
muscle 

operculum 



FIG. 6. General anatomy of the Helicinidae. 



208 



RICHLING 



from remaining tissue in NaOH-solution (1 
N) for about 24 h at 50X. Subsequently the 
radula ribbon was washed in distilled water 
several times and dehydrated through a se- 
ries of ethanol (70%, 80%, 96%, 100%). Af- 
ter the pure alcohol, it was dried and 
arranged to the final mounting position with 
the marginal teeth turned up by using prepa- 
ration needles. Finally, the radula was 
mounted with conductive carbon cement on 
the aluminum specimen stubs for SEM ex- 
amination. Only a few radulae were studied 
with the light microscope. For light micros- 
copy, the radulae were transferred to the 
slides directly after removal. 

SEM Investigation of Shells and Radulae: 
Samples were sputtered with gold for 140 
sec by using a BALTEC SCD 050 Sputter 
Coater. Investigations were carried out with 
a LEO 420 scanning electron microscope 
(LEO V 02.04). Radulae had to be studied 
under low voltage conditions (about 2.5 kV), 
because the structure of the rhipidogloss 
radula causes extremely high charge distri- 
butions, rendering adequate studies and 
exposures under high voltage conditions 
impossible. 

Figures: Unless otherwise stated, all draw- 
ings, maps and photographs in the study 
were made by the author. Drawings were 
made at a LEICA MZ 8 stereomicroscope by 
the aid of a camera lucida. Except for Fig- 
ures 140, 228, 249, 257, and all live animals 
photographed with a 35 mm SLR camera, all 
shells were digitized with a Sony Digital Still 
Camera DSC-F505V. 

Addditional Abbreviations: 
ad. /ads. - adult/s 
coll. collection 
juv./juvs. - juvenile/s 
SEM - scanning electron microscope 



RESULTS 

The results are presented into two parts: (1) 
Revision of all Costa Rican species of 
Helicinidae including the investigation of the 
shell - general aspects, internal structure, 
surface structure, embryonic shell, morphom- 
etry and sexual dimorphism - the radula, the 
soft body color, the female reproductive sys- 
tem, and data on the habitat and distribution. 



(2) The morphological characters of the 
supraspecific taxa relevant for the classifica- 
tion of the Central American mainland 
Helicinidae. 



GENERAL ASPECTS 

The discussion under each species will fo- 
cus on the species-relevant data. Aspects of 
the morphological characteristics will be dis- 
cussed in context with the classification sub- 
sequent to the Results, as will some general 
results for the Costa Rican fauna and the clas- 
sification of the Helicinidae. The account for 
each species has the following outline, in 
which I have here included an overview of the 
morphological characters. 

Literature Records (without heading): All litera- 
ture records of the respective species are 
listed. In some cases of questionable deter- 
minations, attempts to re-examine the origi- 
nal material were made. Some citations 
nevertheless remained uncertain, those are 
marked by a "?". 

Synonymy: For clarity, the synonyms are 
reitterated from the Literature Records. This 
includes only synonyms that were proved 
and accepted during this study. 

Original Description: Complete citation of the 
original description. 

Type Material: This exclusively includes the 
type material of the respective species. 

Type Locality: Only the type locality of the re- 
spective species is given under this heading. 

Type Material of Synonymous Taxa or Similar 
Species: If necessary for comparison, infor- 
mation on the type material of synonymous 
taxa or similar species is also provided, be- 
cause for many Central American taxa ad- 
equate figures cannot be found in the 
literature. For those species, the type local- 
ity is given here. 

Examined Material: For a better finding of the 
data of the lots, the material is arranged ac- 
cording to the collections (leg. I. Richling, 
collection INBio, other sources) and, only 
secondarily, according to localities (Costa 
Rica: different provinces; other countries). 



CLASSIFICATION OF HELICINIDAE 



209 




FIG. 7. Changes in shell surface structure exemplary shown for Helicina gemma. A. I: Ennbryonic shell; 
II: Transitional structure; III: Oblique diverging grooves; IV: Smooth surface with fine growth lines. 
B. Enlarged view of the transitional structure (section II). С Pattern of oblique diverging grooves with 
transformation of section II. D. Enlarged view of the smooth surface with fine growth lines (section IV); 
scale bars 500 pm (A); 100 |jm (B-D). 



210 



RICHLING 



To shorten the descriptions of the localities 
and to facilitate the search for the complete 
locality data mentioned in the text, the fol- 
lowing typological convention is used for the 
Richling and INBio material. In the case of a 
single locality for lot(s), only a shortened 
name of the locality is set in italics. In the 
case of several lots from sublocalities, the 
entire general description is in italics, fol- 
lowed by a colon; the colon is then followed 
by further specifications in italics applying to 
the lots following the second colon. In some 
cases, there is a further subdivision, such as 
altitude, given in the same format. Locality 
data in roman type refer only to the subse- 
quent lot. 

Description: 
Shell: General description of the species. 
Internal Shell Structures: Contrary to most 
other gastropods, Helicinidae dissolve the 
inner parts of their shells so completely that 
only a septum of a certain length subdivides 
the shell internally. This septum extends 
from the remains of the columella to the su- 
ture of the last whorl. The length of the sep- 
tum or, referring to the soft body, of the axial 
cleft is figured here. Additionally, the posi- 
tions of the attachments of the retractor 
muscles are shown. In Helicinidae, the col- 
umellar muscle in separated in two portions, 
one attaching somewhere in the umbilical 
area, the other in the upper part of the shell, 
often close to the beginning of the axial cleft. 
Teleoconch Surface Structure: During 
growth, the Helicinidae produce different 
shell surface structures. A possible se- 
quence of different patterns is shown for 
Helicina gemma (Fig. 7) covering the varia- 
tions among in Costa Rican helicinids. 
The embryonic shell (Fig. 7A: I) is sharply 
distinguished from the teleoconch by a dis- 
tinct pattern and a more or less clear growth 
mark. The subsequent part exhibits an ir- 
regular, coarse and wrinkled surface ("tran- 
sitional structure") (Figs. 7A: II, B). It 
changes continuously with pits elongating to 
grooves to a pattern consisting of groups of 
parallel grooves that diverge acutely with 
other obliquely orientated groups of grooves 
(Figs. 7A: III, C). The grooves follow two 
main orientations (this structure will subse- 
quently be referred to as "pattern of oblique 
diverging grooves"). Finally, this pattern is 
predominated by fine growth lines forming 
an otherwise smooth, shiny surface (Figs. 



7A: IV, D). Only a vestige of the oblique 
grooves may still be visible. This surface 
structure is maintained to the aperture. 
This general scheme is not completely real- 
ized in all Costa Rican Helicinidae, certain 
sections may be absent, for example, the 
pattern of oblique diverging grooves contin- 
ues for the rest of the postembryonic shell 
and the smooth surface is absent. Apart 
from differences in detail, the pattern of the 
major part of the postembryonic shell does 
not change again and starts at the latest at 
the beginning of the second whorl (Fig. 7A, 
lll-IV). Therefore, a section of this whorl is 
preferably described for species compari- 
sons. 

Embryonic Shell: If available, at least three 
specimens of each species or subspecies 
respectively were investigated for embryonic 
shell structures. Individuals were chosen 
randomly and depending on the preserva- 
tion. Especially in cloud forest areas, the 
embryonic shell seems to erode very 
quickly. 

Unless otherwise stated, relative descrip- 
tions refer to the structures of Helicina 
funcki. 

Operculum: The operculum of most species 
of the Helicinidae is concentric and consists 
of two plates, an inner horny plate (attached 
to the foot) and an outer calcareous plate. 
The horny plate projects beyond the margins 
of the calcareous plate. In all Costa Rican 
species except for Pyrgodomus, the calcar- 
eous plate is thin and becomes thickened 
only towards the columellar edge, determin- 
ing the shape of this margin, whereas the 
palatal margin is shaped by the further ex- 
tending horny layer; the calcareous layer 
becomes indistinguishable and normally 
does not reach this margin. 
Animal: Expecting species-specific differ- 
ences in the mantle color of certain species, 
as many specimens as possible were docu- 
mented as to their color, but due to consid- 
erable variation, especially among different 
populations, the comparison did not reveal 
many species-specific differences. A gener- 
alized description will be given for each spe- 
cies. 

Radula: The helicinid radula consists of 
three groups of teeth: the centrals, the later- 
als and the marginals (Fig. 8). The central 
field is composed of an unpaired central or 
rhachidian tooth (R), which is flanked by 
three paired teeth, called A-, B-, and C-cen- 



CLASSIFICATION OF HELICINIDAE 



211 





FIG. 8. Part of radula ribbon (shown in Helicina 
funcki): "A"-"C": respective central teeth, ар: 
accessory plate, cl: comb-lateral, R: rhachidian 
tooth; scale bar 100 pm. 



tral with the A-central aside to the rhachidian 
tooth (some authors such as Keen, 1960; 
Thompson, 1980, but not 1982; Stanisic, 
1997, include the three paired teeth into the 
laterals). The laterals, also called the 
capituliform complex, are formed by two par- 
tially fused teeth, the inner comb-lateral (cl) 
and the accessory plate (ap). Within the 
Helicinidae, the comb-lateral is developed in 
two main types: (1 ) the true "comb"-lateral: a 
broad tooth with numerous cusps at the cut- 
ting edge (Fig. 8) or (2) a very strong tooth 
T- or mushroom shaped (also called T-lat- 
eral) without cusps (Fig. 246B). The 
marginals encompass numerous long, slen- 
der teeth in oblique rows that bear a varying 
number of accuminate cusps. The terminol- 
ogy follows Baker (1922a). 
The radulae of the Costa Rican species of 
Helicina do not show many differences 
among the individual species, but within 
populations of the species themselves, there 
is some variation, especially regarding the 
number of cusps on the central teeth. A cer- 
tain number of cusps is usually not ex- 
ceeded, but the cusps are often vestigial or 
absent, forming a crenulate margin at the 
cutting edge. Throughout each radula, the 
different teeth are very uniformly developed 
with a very constant numbers of cusps. 
The rhachidian tooth is triangular to trap- 
ezoid shaped and lacks cusps. The A- and 
B-centrals project laterally, with broad faces 
forming an oblique cutting edge. The C-cen- 
tral narrows towards its face and represents 
the outer tip of the central cutting edge. 



The two teeth of the capituliform complex 
were always observed to be fused, and, un- 
der the conditions and the magnifications 
studied with the SEM, the demarcation line 
between the teeth was not visible. The 
cusps on the comb-lateral only show in- 
traspecific fluctuations of one or two, but 
aberrant developments do occasionally oc- 
cur (e.g., many more cusps or lacking any at 
all). The relative size of the cusps appears to 
be constant. In most species, the cusps 
slightly decrease in length towards both 
ends of the edge, with the inner a little 
longer. The accessory plate is usually 
slightly smaller than the comb-lateral and 
projects laterally. 

With the occasional exception of the inner- 
most tooth, the marginals increase in num- 
ber of cusps outwards starting with 2-3 to 
more than 10. Two tendencies were recog- 
nized: (1) slowly and (2) rapidly increasing 
number of cusps; in the first, there are re- 
markably more teeth with 2, 3 and 4 cusps, 
that is, also more teeth with pronounced ter- 
minal cusps, whereas in teeth with more 
cusps the latter tend to arrange themselves 
laterally along the tip which is therefore 
turned sidewards to bring the cutting edge 
into action. 

In the account on the radula for the species, 
only the distinguishing features are outlined 
in addition to the figures. 
Unless otherwise stated, the radulae of at 
least three specimens of each species and 
in some cases also of different populations 
were investigated. For Helicina funcki and H. 
beatrix riopejensis n. subsp. eight speci- 
mens were studied to check for intraspecific 
variability. 

Female Reproductive System: Parts of the 
reproductive system of the Helicinidae show 
several peculiarities for which authors have 
introduced special terminology (Bourne, 
1911; Baker, 1925 & 1926). Because terms 
were exchanged and confused, a summary 
is given, and the present use is indicated 
(Table 2, Fig. 9). The terminology implies 
certain functional aspects, but the function 
has been controversially discussed for differ- 
ent taxa (e.g.. Bourne, 1911) and still re- 
mains partially doubtful, especially with 
respect to the structures for sperm storage. 
The terms used in this study follow the tradi- 
tional usage and strike a balance between 
possible confusions, but will not be modified 
for functional correctness to avoid any fur- 



212 



CD 
ГО 


О) 


'с 


ir 


'о 


ш 




i¿ 


ф 


< 


I 


со 


Ç. 




Е 




ш 





с > 

-f= о 

8 ^ 

о го 
Ü.E 







RICHLING 






^ 




i3 




0) 




Е 




Е 


t5 


О) 

с 


8 


го 
Ü 

с: 


тз 
> 

о 


с 


о. 


g 


^ 


о 
ел 

0) 
"О 




а. 

8 


70 

Q. 



о г; — 



О) 

о 
> 

Е 



■о 

CL 



О 3 

**- с 
с о 
го ^ 
р.9 ^ 
о Ь ш 

¿if 

о о го 

о -Sí с 
t го о 

о Ç -í: 
CL О) Q- 
— ГО Ф 
ГО > О 

Й ^ "■ 
ГО — 

со 



с ш 



Ь го 

Е "5. 

О) ф 

со о 
ф 



0) 

Е 

ГО 



Е 


TD 
О 


m 


С 


^ 


о 


о 


О) 


с 
о 


^ 




го 


го 


тз 


.Ы 


с 


■Е 


о 
о 


^ 


ф 



Ф W 

с 

Z3 Ol 

Р о 



.2 о 
О f^ 

о. 



b 



t 
ф 

Q. 
(Л 
р>ч О 


Е 

3 

о 
го 


(Л 

с 
Е 


Е 
ф 
о 
о 


о. 


ф 


ф 


(Л 


ф 


ел 


CL 



ф 




ф 


CL 




CL 


(Л 




(Л 


^ 


о 
го 


>, о 
^ го 


о 


ел 


о (Л 


(Л 




(Л 


ел 




(Л 


ф 




ф 


о 




о 



о 
<л 



О Ç 
CL ф 

Ф сл 



ф — 
о Ф 
со Ü 

ф^ 

с CL 



ф 




Q. 


-2 


(Л 




^ 


-с 


О 


.о 


(Л 


сл 


со 

8 

о 
го 


ст: 

-с 



го í^ 
v. о 



СП 

с 1_ 
iZ ф 
Ф JD 

С Е 
ф го 



о 



-й го 



8 2 rä 



a 




о 


jd 




го 


l_ 


X 


со 


о 






го 
о 
ф 


^ 

3 


го 
с 

О) 


го 


Q. 

8 


го 

> 
о 


Е 








Q. 


ф 






о. 






(Л 







Е 


ф 

Q. 


го 


=3 


>, 


с 


о 
ф 
го 
о 


о 
о 


О) 

го 
> 

о 

Q. 



Х) 

го' Е 

Ф о 
> 



ф bJ 
ф тз 



> S' 



^" Е 



о о 

Q 



CLASSIFICATION OF HELICINIDAE 



213 




enlarged: 



descending 
limb 

reception 
chamber 



В 




V-organ - ascending limb 

receptaculum seminis 
pedicel of V-organ 



bursa copulatrix 

provaginal 
sac 



oviduct 



provaginal duct 
and vagina 



opening near 
mantle edge 



FIG. 9. Female reproductive system in Helicinidae {Helicina orbiculata), ovary to slender portion of the 
oviduct omitted, ventral view. A. Organs in natural position. B. Apical complex enlarged and artificially 
arranged to show the different organs and their connections (modified after Baker, 1926). 



ther confusion until these aspects have been 
finally clarified. Furthermore, the term "pal- 
liai" only refers to the topographical position 
and not to ontogenetic origin. 
The reproductive system of female 
Helicinidae consists of a folliculous ovary 
that discharges into a thin-walled spherical 
structure, which continues as the slender 
primary oviduct. This oviduct is curved 
anteriad before it enters the V-organ. The V- 
organ is subdivided in an ascending limb, a 
descending limb, and a pedicel and leads 
into the reception chamber. The oviduct con- 
tinues as an elongated palliai part parallel to 
the intestine and opens near the mantle 
edge. The descending limb of the V-organ 



may receive the duct of a receptaculum 
seminis, or is associated with sac-like struc- 
tures (accessory sperm sac) at its very be- 
ginning (e.g., Lucidella). Besides the oviduct 
(pedicel), the reception chamber is con- 
nected with a ventral bursa, a dorsal 
provaginal sac, and a provaginal duct that 
opens into the mantle cavity. Because of the 
two openings, the female system is called 
diaulic. 

Because the general structure is similar in 
Costa Rican Helicina, it is described as fol- 
lows, and only specific deviations are added 
under each species. 

The ascending limb of the V-organ is straight 
and a little longer than descending limb and 



(Continued from opposite page) 

■ The caecum of the ootype and the provaginal sac sensu Bourne (1911) were differently interpreted by Baker. In 1925, 
he assigned the organs correctly as given in my Table, whereas in 1926, he exchanged this assignment of the terms, 
regarding his former interpretation as wrong. He pointed out that in Bourne's figure (1911; pi XXXV, fig. 25) the caecum 
would clearly be located dorsally (as only is the provaginal sac) with respect to the oviduct. Actually, he disregarded the 
accurate description of the position of the organs He was probably misled by the fact that in Alcadia palliata (C. B. Adams, 
1849) the general appearance of this apical complex with both ventral bursa and provaginal sac elongated and without 
lobes differs somewhat from the mainland species that he had dissected. 

'■ Thompson misinterpreted the pedicel (term introduced by Baker, 1926) as the whole descending limb of the V-organ. 
In Helicinidae, it is demarcated by an invaginated constriction and subsequent distal swelling before entering into the 
reception chamber, also histologically differentiated. In the Ceresidae and Proserpinidae, which Thompson studied, the 
descending limb and a pedicel are not externally demarcated, but since histological data are lacking, the identification of 
the "descending" limb with the pedicel only (and absence of the "non-pedicel" part) is not verified for the two families. 
■" Thompson intended to comply with other prosobranch terminology, but because both Latin and English terms were used 
(e.g,, bursa copulatrix and copulatory bursa) for the same organ, "seminal receptacle" would be synonymous with 
"receptaculum seminis", a term being already in use for an accessory structure. Furthermore, as far as it is known just the 
reception chamber is not a place for sperm storage, i.e. a receptaculum seminis. 



214 



RICHLING 



pedicel together, and in natural position it 
approximately reaches the transition of the 
reception chamber to the pallia! oviduct. 
Situated between the limbs of the V-organ, a 
comparatively small, always simple sac- 
shaped receptaculum seminis enters the 
descending limb with a slender duct. The 
ventral bursa copulatrix is always lobed, but 
to a different extent. The provaginal sac is 
well developed, but rather simple shaped, 
and possesses a fairly long stalk as connec- 
tion to the reception chamber. Contrary to 
the general scheme given above and the 
descriptions of other Central American spe- 
cies of Helicina by Baker (1926), the 
provaginal duct or vagina does not exist and 
the system is monaulic. The thick walls of 
the palliai oviduct are always variously 
folded, which is reflected in surface constric- 
tions. A short, distinct portion just before the 
distal opening is dark brownish, whereas the 
remaining part of the reproductive system is 
whitish-opaque if not otherwise stated. 
If material was sufficient the reproductive 
system of at least three females of each 
species or population were dissected. In 
addition, serial sections were studied for 
Helicina funcki, H. tenuis, H. beatrix 
confusa, H. beatrix ríopejensis п. subsp., H. 
gemma, Alcadia hojarasca, and Lucidella 
tirata to confirm the results of the dissec- 
tions. 

In the drawings, the reproductive system is 
normally shown from the ventral side and 
the accessory organs of the apical part were 
artificially separated to allow an adequate 
presentation of this complex structure (Fig. 
9B). If not otherwise stated, relative descrip- 
tions refer to the structures of Helicina 
funcki. 



For the comparison with populations of un- 
known sex (e.g., INBio material, type mate- 
rial) the sex-independent mean value is 
always indicated in the diagrams by shad- 
ing, it is given as the average of the mean 
values of both sexes. In this way, it more 
closely approaches the theoretical 1:1 distri- 
bution of females and males than the mean 
value of the total population. 
When relations of the shell size of the differ- 
ent populations of one species to other pa- 
rameters will be analyzed, the minor 
diameter is preferred over the shell height, 
because it is better correlated to the volume 
(shown for Helicina funcki. Fig. 30). The lat- 
ter would display the size best, but the vol- 
ume is normally not available for all 
populations. 

Habitat: The description of the habitat is nearly 
exclusively based on the author's own field 
observations. 

Distribution: In addition to the description, for 
the distribution within Costa Rica a detailed 
map is provided based on all records criti- 
cally revised and the material studied. The 
sources of the localities will be indicated di- 
vided into recent collections (IR, INBio), and 
literature records and the other material ex- 
amined. 

Discussion: Here, mainly the taxonomical 
problems of each species will be discussed. 
For broader aspects, see the general Dis- 
cussion. 



REVISION OF THE COSTA RICAN 
HELICINIDAE 



Morphometry and Sexual Dimorphism: Due to 
the paucity of material, the number of speci- 
mens of each population/species studied 
could not be standardized, but, as far as 
possible, maximized; the number of speci- 
mens is indicated in each case. The follow- 
ing measurements were analyzed: height, 
minor diameter, height of last whorl and col- 
umellar axis, extension of outer lip, volume 
and weight, if available. The major diameter 
is given only for comparison, but it is not in- 
cluded in diagrams, because the shells in- 
crease regularly in size, and it is therefore 
correlated with the minor diameter, which 
can be measured more exactly. 



The following species are recognized for 
Costa Rica: 

Helicina (Tristramia) funcki L. Pfeiffer, 1849 
Helicina {Tristramia) pitalensis Wagner, 1910 
Helicina (Tristramia) tenuis L. Pfeiffer, 1849 
Helicina (Tristramia) echandiensis n. sp. 
Helicina (Tristramia) punctisulcata 

cuericiensis n. subsp. 
Helicina ("Gemma') beatrix beatrix Angas, 

1879 
Helicina ("Gemma") beatrix confusa (Wagner, 

1908) 
Helicina ("Gemma") beatrix ríopejensis n. 

subsp. 



CLASSIFICATION OF HELICINIDAE 



215 



Helicina {"Gemma') talamancensis (Richling, 

2001) 
Helicina ("Gemma") gemma Preston, 1903 
Helicina {"Gemma") monteverdensis п. sp. 
Helicina {"Gemma") escondida п. sp. 
Helicina {"Gemma') chiqultica (Richling, 2001 ) 
Pyrgodomus microdlnus (Morelet, 1851) 
Aleadla {MIcroalcadIa) hojarasca (Richling, 

2001) 
Aleadla {MIcroalcadIa) boeckelerl (Richling, 

2001) 
Lucldella {Perenna) llrata (L. Pfeiffer, 1847) 
Questionable: 
Helicina {Oligyra) flavlda Menke, 1828 

Helicina {Tristram I a) funcki 
L. Pfeiffer, 1849 

Helicina funcki L. Pfeiffer, 1849: 121 (not fig- 
ured) 

Helicina funcki - L. Pfeiffer, 1850: 33, pi. 9, 
figs. 1, 2 

Helicina funcki - L. Pfeiffer, 1852a: 361 

Helicina tuncki [sic] L. Pfeiffer, 1852b: 261 
262 

Helicina funckll [sic] Sowerby, 1866: 288, pi. 
273, fig. 271 

Helicina funcki ~ Bland, 1866: 9 

Helicina funcki - Reeve, 1874: pi. 17, fig. 152 

Helicina funki [sic] -Angas, 1879: 484, pi. XL, 
fig. 7 (living animal): Costa Rica: Talamanca, 
all the coast region, and to the lower hills 
(Gabb) 

Helicina funcki - von Martens, 1890: 33: 
Costa Rica: Talamanca, all the coast region, 
and to the lower hills (Gabb); Cache [Cachi? 
09°50'N, 83°48'W, Cartage Province] 
(Rogers) 

Helicina funcki var. a, b - Biolley, 1897: 4-5: 
Costa Rica: San Miguel, Sarapiqui, 200 m 
[about 10°19'N, 84°ir30"W, Alajuela Prov- 
ince], Tuis, 600 m [about 09°5ГМ, 83°35'W, 
Cartago Province] 

Helicina funcki var. c, d - Biolley, 1897: 4-5: 
Costa Rica: Azahar de Cartago, 1,500 m, 
Tarbaca, 1,600 m [09M9'25"N, 84°06'39"\/V, 
San José Province] 

Helicina funcki - Ancey, 1897: 87: E-Nicara- 
gua: Greytown, N-Panama: Monkey Hill, 
near Colon (leg. Aillaud) 

Helicina funcki -von Martens, 1900: 603-604: 
E-Nicaragua: Greytown; NE-Costa Rica: 
San Miguel, valley of the Sarapiqui, 200 m 
[about 10°19'N, 84°ir30"W, Alajuela Prov- 
ince]; Puerto Viejo [about 10°28'N, 
84°00'30"W, Heredia Province] (Biolley), on 



the borders of the Rio San Juan [along bor- 
derline to Nicaragua in Alajuela, Heredia, 
Limón provinces, cannot be specified] 
(Pittier), E-Costa Rica: Tuis, 600 m [about 
09°5rN, 83°35'W, Cartago Province] 
(Biolley, Pittier); Turrialba, 750 m [about 
09°54'30"N, 83°41'W, Cartago Province] 
(Biolley), central Costa Rica: Azahar de 
Cartago [not clear, if referring to the town 
Cartago, ?about 09°52'N, 83°55'W, Cartago 
Province] and Tarbaca, 1,500-1,600 m 
[09°49'25"N, 84°06'39"W, San José Prov- 
ince], only the smaller varieties (Biolley); N- 
Panama: Monkey Hill, near Colon [in part] 

Helicina {Retorquata) funcki - Wagner, 1905: 
232-233 

Helicina {Retorquata) funcki costaricensis 
Wagner, 1905: 233, pi. XIII, fig. 12 a-c: 
Costa Rica ("von San José [14 km NW of 
Upala, about 10°58'N, 85°08'W, Alajuela 
Province] in Costarica besitze ich 
Exemplare dieser Form, welche größer und 
einfarbig weiß sind, ferner % bis У2 Umgang 
mehr aufweisen") 

Helicina fucki [sie] Wagner, 1910a: 306307, 
pl. 61, figs. 11-15: Neu Granada (obviously 
only in part of Panama), Costa Rica: 
Azachar Centajo, Tarbaca 

Helicina funcki costaricensis - Wagner, 
1910a: 307, pl. 61, fig. 16: Costa Rica: St. 
José [see above] and Sta. Clara [7.5 km NW 
of Upala, about 10°56'N, 85°05'W, Alajuela 
Province]; "eine ähnliche Form, jedoch mit 
deutlicher Kante am letzten Umgang und 
höherem Gewinde liegt in meiner Sammlung 
mit der Fundartsangabe Ylalag in Mexico" 

Helicina funcki - Pilsbry, 1910: 503: Panama: 
Canal Zone: Tabernillo (Brown) 

Helicina funcki- Pilsbry, 1920a: 3: Costa Rica: 
Guapiles, 980 ft. [about 10°14'N, 83°47'W, 
Limón Province] (Calvert) 

Helicina deppeana parvidens Pilsbry, 1920a: 3 
(not figured): Costa Rica: Juan Viñas, farther 
waterfall, 3300 ft., also on the road to Rio 
Reventazón, 3000 ft. [about 09°54'N, 
83°44'30"W, Cartago Province] (Calvert) 

Helicina {Tristramia) funcki funcki - Baker, 
1922a: 51 

Helicina {Tristramia) funcki parvidens - Baker, 
1922a: 51 

Helicina {Tristramia) funcki costaricensis - 
Baker, 1922a: 51 

Helicina funcki - Pilsbry, 1926a: 59, 69, 71, 
fig. 3C: Panama: Escobal on Gatun Lake 
(Chapin), Bocas del Toro Province: Mono 
Creek (Olsson), Gatun (Harrower), Canal 



216 



RICHLING 



Zone: Barro Colorado Island and near 
Darien (Zetek) 

Helicina funcki - Pilsbry, 1926b: 127: Costa 
Rica: Talamanca Valley, < 100 ft. [approxi- 
mately 09°34'N, 83°W, not specified, Limón 
Province] (Olsson) 

Helicina (Tristramia) funcki - Baker, 1926: 42: 
Panama: Gatun, Canal Zone (Narrower), pi. 
V fig. 8, pi. VI, fig. 9 (female and male repro- 
ductive system) 

Helicina funcki - Pérez, 1994: 746: Costa 
Rica: La Selva [about 10°26'N, 84°W, 
Heredia Province] 

Helicina funki [sic] Monge-Nájera, 1997: 
113: Costa Rica 

Helicina funcki -^ Robinson, 1999: 434: USA: 
sometimes mistakenly imported 

Synonymy 

Helicina funcki costaricensis Wagner, 1905 
Helicina deppeana parvidens Pilsbry, 1920 

Original Description 

"Hel. testa conico-subglobosa, tenuiuscula, 
sub lente tenuissime oblique striatula, vix 
nitidula, flavida, roseo-nebulosa; spira 
conoidea, obtusiuscula; anfractibus 5,5 
planiusculis, ultimo utrinque convexiore, obso- 
lete angulato; apertura obliqua, semiovali; 
columella subarcuata, linea impressa verticali 
notata, basi subnodosa, in callum sensim 
tenuiorem retrorsum ablente; peristomate late 
expanse, margine supero subrepando. 
Diam. 13,5, altit. 9 mill. 
From San Yago, New Granada (Funck)." 

Type Material 

BMNH 20010497.1-4: Santiago, New 
Granada, Funk, H. Cuming collection 



The type lot contains four similar specimens. 
The shell that is slightly larger than the other 
three is herein selected as lectotype of 

Helicina funcki (Fig. 10). It shows the traces of 
some lead pencil painting which could have 
been applied to the specimen as a drawing 
aid, probably reflected in the dark shading vis- 
ible in the figure in L. Pfeiffer (1850: pi. 9, figs. 
1 , 2). Furthermore, it is the only specimen that 
attains 13.5 mm in its greatest extension (not 
perpendicular to the shell axis). The height 
given in the original description cannot be at- 
tributed to a conventional adjustment of the 
shell. The specimen is yellowish, and the red- 
dish tinge is barely visible, whereas it is well 
developed in the three paralectotypes in the 
second half of the body whorl between suture 
and the periphery. 
Dimensions: 
Lectotype BMNH 20010497.1: 

10.6/11.9/13.2/10.7/7.9/8.8/8.2 mm 
Paralectotypes BMNH 20010497.2-4: 
10.1/11.5/12.6/10.2/7.3/8.3/7.7 mm 
10.0/11.0/12.4/10.0/7.1/8.2/7.6 mm 
10.0/11.1/12.4/10.1/7.4/8.2/7.9 mm 

Type Locality 

"San Yago, New Granada", this most prob- 
ably refers to Santiago, which today belongs 
to Panama, Veraguas Province. 

Type Material of Synonymous Taxa or Similar 
Species 

Helicina funcki costaricensis Wagner, 1905 

Type Material: MIZ 8989: Costa Rica, Sta. 
Clara, 250 m alt., Biolley legit 
In the original description Wagner gives Costa 
Rica as the origin of the new subspecies and 
mentions additional specimens from San 




FIG. 10. Helicina funcki, lectotype, BMNH 20010497.1, height 10.6 mm; scale bar 5 mm. 



CLASSIFICATION OF HELICINIDAE 



217 



José, which are said to be of greater size and 
of uniformly white color, the description being 
obviously based on further unspecified mate- 
rial. In his collection stored in the MIZ, there 
are two lots: the typical one with the locality 
mentioned later (Wagner, 1910a), as given 
above and the one from San José. The 
syntypes MIZ 8989 consist of two specimens, 
a yellowish-greenish one and a reddish tinged 
one. In comparing the figures in Wagner 
(1 905, 1 91 Oa), it is obvious that different speci- 
mens were illustrated: the later figure shows a 
yellowish-greenish specimen somewhat more 
elevated and with a more strongly developed 
denticle at the transition of the outer lip into the 
columella. Thus, the reddish specimen was 
first to be depicted and has therefore been 
selected here as lectotype (Fig. 11). It dis- 
plays a slight crack in the last whorl which, 
however, did not result in any deformation or 
damage in the shell. The specimen was dead 
collected, whereas the paralectotype was col- 
lected alive, complete with its operculum. 
Dimensions: 
Lectotype MIZ 8989a: 
12.0/13.2/14.6/11.8/8.7/9.7/9.3 mm 
Paralectotype MIZ 8989b: 
12.3/13.1/14.6/11.9/8.9/10.1/9.5 mm 

Type Locality: "Costa Rica"; restricted by type 
selection to Sta. Clara, 250 m a. s. I. [7.5 km 
NW of Upala, about 10°56'N, 85°05'W, 
Alajuela Province] 

"Santa Clara" is a name used for various lo- 
calities in Costa Rica. Biolley mentions it 
several times as a collecting site, also 
"Delicias near Santa Clara" and a "San 
José" (see "Discussion" for Helicina funcki 



costahcensis) that is definitively not the capi- 
tal. This combination suggests the identifica- 
tion with the village of Santa Clara near 
Upala, because Las Delicias and San José 
are nearby. The exact altitude of Santa Clara 
is 40 m, but it is known that in former times 
(personal communication with Zaidett 
Barrientes) the whole region was called 
"Llanuras de Santa Clara" [plains of ...]. 
Therefore, in case it was not just an inaccu- 
rate measurement of the altitude, it is likely 
that the specimens were collected a little to 
the southeast of the village approaching the 
Cordillera de Guanacaste. 

Helicina deppeana parvidens Pilsbry, 1920 

Type Material: Holotype ANSP 105286 (Fig. 12), 
Paratype ANSP 105252 (original designation) 

Type Locality: Costa Rica: "Juan Viñas, farther 
waterfall, 3300 ft." [about 09°54'N, 
83°44'30"W, Cartage Province] 

Examined Material 

Leg. I. RiCHLiNG 

Guanacaste: N Santa Elena: Reserva Sta. 
Elena, Sendero Rio Negro, about 
10°20'31"N, 84°47'53"W, 1,550 m a. s. I.: 
14.08.1999: (IR 924); Sendero at Mirador 
Gerardo, 10°22'19"N, 84°48'25"W, 1,450 m 
a.s.l.: 14.08.1999: (IR 928); 19.02.2000: (IR 
1230) 

N of Nuevo Arenal: area of primary rain for- 
est, 10°33'32"N, 84°51'40"W, 800 m a.s.l.: 
05.03.1999: (IR 737); "Las Pavas" (private 
reserve in preparation), secondary rain for- 




FIGS. 11-12. Helicina spp. FIG. 11. Helicina funcki costahcensis, lectotype, MIZ 8989a, height 12.0 
mm; scale bar 5 mm. FIG. 12. Helicina deppeana parvidens, holotype, ANSP 105286, height 10.0 mm; 
scale bar 5 mm (photograph: D. Robinson). 



218 



RICHLING 



est about 10°33'30"N, 84°5Г53"\А/, 800 m 
a.s.L, to 10°33'26"N, 84°5Г57"\А/, 760 m 
a.s.l.: 05.03.1999: (IR 742); 17.08.1999: (IR 
952): 24.02.2000: (IR 1273); (IR 1331); 
03.2001: (IR 1637) 

NW Nuevo Arenal, "Eco Lodge", Sendero 
Cabana, about 10°34'37"N, 84°55'35"W, 750 
m a.s.l., 18.08.1999: (IR 955) 
Parque Nacional Rincón de Vieja: trail from 
Aquas calientes to Las Pailas, about 
10°46'00"N, 85°19'13"W, 800 m a.s.L: 
20.08.1999: (IR 972); E Casona Sta. Maria, 
trail to Canal, 10°45'57"N, 85°17'06"W, 750 
ша.з./.: 21.08.1999: (IR 979) 

Alajuela: Near Volcán Arenal, trail along vol- 
cano In rainforest, about 10°29'07"N, 
84°42'55"W, 720 m a.s.l.: 24.02.1998: (IR 
390); 01.08.1999: (IR884); on Heliconiaceae, 
25.02.2000: (IR 1286) 

Heredia: S Puerto Viejo de Sarapiqui, Zona 
Protectora La Selva, near OTS-Station, about 
10°25'53"N, 84°00'18"W, 60 m a.s.l., 
05.09.1999: (IR 1061); 06.09.1999: (IR 
1062); 13.02.2000: (IR 1182); (IR 1184) 

Limón: Parque Nacional Cahuita, trail from 
Cahuita to Puerto Vargas, coastal forest with 
coco palms and swampy areas: 09°44'01"N, 
82°49'48"W, 1-5 m a.s.l.: 11.03.1997: (IR 
107); (IR 106); (IR 108); about 09°43'27"N, 
82°50'28"W, 4 m a.s.l.: 10.03.1999: (IR 757); 
07.08.1999: (IR 897); 08.08.1999: (IR 898); 
04.03.2000: (IR 1312); 14.03.2001: (IR 
1555), (IR 1630), (IR 1639); 15.03.2001: (IR 
1557), (IR 1648); 09°4313"N, 82°50'39"W, 4 
m a.s.l.: 13.09.1999: (IR 1095); near Puerto 
Vargas, 09°42'49"N, 82°49'20"W, 1 m a.s.l.: 
08.08.1999: (IR 907) 

Refugio Nacional de Fauna Silvestre 
Gandoca-Manzanillo, S Manzanillo, trail 
along coast line to S, coastal forest, about 
09°38'06"N, 82°38'26"W, 50 m a.s.l., 
14.9.1999: (IR 1096); 5.3.2000: (IR 1320); (IR 
1322); (IR 1642) 

Near Cruce Pensfiurt, mouth delta of Rio 
Estrella, Aviarios del Caribe, about 
09°48'30"N, 82°54'W, 20 m a.s.l., 
09.08.1999: (IR 912) 

About 9 km W of Matina, road Limón to 
Siquirres, a little stream up Rio Barbilla, small 
banana plantation, about 10°03'29"N, 
83°22'24"W, 70 m a.s.L, 12.03.2001: (IR 1545) 
S Siquirres, road Limón to Siquirres, along 
footpath stream up Rio Pacuarito, 
10°05'38"N, 83°28'ir'W, 110 m a.s.l., 
18.03.2001: (IR 1612); (IR 1613) 
Siquirres, along footpath stream up Rio 
Siquirres and along a southern tributary. 



10°05'37"N, 83°30'32"W, 100 m a.s.l., 
11.03.2001: (IR 1623); 19.03.2001: (IR 1617) 
WGuayacán, abandoned banana plantation, 
10°0r53"N, 83°32'14"W, 520 m a.s.l., 
03.09.1999: (IR 1079); (IR 1080); 
12.09.1999: (IR 1090): 17.03.2001: (IR 1608) 
W Liverpool, Mexico: near Rio Blanco, 
09°56'37"N, 83°09'41"W, 35 m a.s.l.: 
13.03.1997: (IR 150); near Rio Blanco, 
abandoned area with bananas and some old 
trees, 09°58'32"N, 83Ю8'32"\А/, 35 m a.s.l.: 
14.02.1998: (IR 274): 21.02.1999: (IR 627); 
footpath along small creek and through 
bush, 09°59'04"N, 83°08V4"W. 40 m a.s.l.: 
16.02.2000: (IR 1191); 22.02.2001: (IR 
1406); (IR 1408) 

S Liverpool: near Rio René, swampy area 
and forest, 09° 57 '33" N, 83°08'15"W, 20 m 
a.s.l.: 13.03.1997: (IR 148); (IR 140); along 
Rio Victoria, 09°56V1"N. 83°10'24"W, 80 m 
a.s.l.: 05.03.1998: (IR 465) 
SW Liverpool: fRio Quito, at bridge, 
09°57'11"N, 83°10'37"W, 40 m a.s.l.: 
04.03.1998: (IR 448); E of Rio Peje, forest 
on little hill, 09° 57 '46" N, 83°13'26"W, 270 m 
a.s.l.: 12.03.1997: (IR 131); Rio Peje and 
small tributary, 09°56'35"N, 83°14'01"W, 110 
m a.s.l.: 12.03.1997: (IR 126); (IR 127); Rio 
Peje, bordering forest, 09°56'23"N, 
83°14'06"W, 160 m a.s.l.: 09.03.1999: (IR 
753); along Rio Peje, bordering forest with 
palms, 09°55'46"N,83°13'15"W. 135 m a.s.l.: 
04.03.1998: (IR 441); 09.03.1999: (IR 751); 
03.03.2000: (IR 1300); (IR 1302); 
13.03.2001: (IR 1552) 
N Shi roles: along Quebrada Kirio 
09°35'38"N, 82°57'20"W, 100 m a.s.l. 
12.03.1999: (IR 763); 09.08.1999: (IR 911) 
16.03.2001: (IR 1596); (IR 1644); Cerro 
Mirador along trail, 09°36'37"N, 82°57'43"W, 
430 m a.s.l.: 16.03.2001: (IR 1599) 
W Bribri, road to Uatsi, about 09°38'11"N, 
82°5Г48"\А/, 30 m a.s.l.: abandoned field 
with Heliconiaceae and Eucalyptus: 
12.03.1999: (IR 766); 15.09.1999: (IR 1114); 
wooded valley within banana plantation, 50 
m a.s.l.: 15.3.2001: (IR 1572); at crossing 
with Rio Carbon, 30 m a.s.l.: 17.3.1997: (IR 
183); 

W Uatsi, along Rio Uatsi, 09°37'30"N, 
82°53'30"W, 60 m a.s.l., 15.03.2001: (IR 
1632) 

Zona Protectora Tortuguero, near 
Tortuguero, about 10°34'N, 83°31'W, 10 m 
a.s.l.: Sendero Ranita: 10.3.2000: (IR 1348); 
Л/ of village: 16.03.2001: (IR 1620); 
21.03.2001: (IR 1653) 



CLASSIFICATION OF HELICINIDAE 



219 



Cartago: W Turrialba, near Catie, forest along 
road Turrialba to Siquirres, 09°53'01"N, 
83°39'17"W, 610 m a.s.l., 15.03.2000: (IR 
1350) 

Puntarenas: Near Monteverde, about 
10°17'24"N, 84°48V4"W: small piece of for- 
est along road to reserve, 1,330 m a.s.l.: 
27.02.1997: (IR 22); 1 km before entrance 
on road to reserve, 1,500 m a.s.l.: 
26.07.1999: (IR 826); 1999: (IR 1391); 
13.8.1999: (IR 927); Bosque de los Niños, 
10°17'59"N, 84°48'44"W, 1,380 m a.s.l.: 
29.07.1999: (IR 860) 

Zona Protectora Arenal-Monteverde: 
Reserva Biológica Bosque Nuboso 
Monteverde (about 10°18V8"N. 84°47'41"W, 
1,500-1,650 m a.s.l.): 27.07.1999: (IR 843) 
18.02.2000: (IR 1194); (IR 1199); (IR 1627) 
Sendero Bosque Nuboso: 25.02.1997: (IR 
14); 24.02.1999: (IR 628); Sendero Roble: 
18.02.1998: (IR 301); Sendero Chomogo: 
25.02.2001: (IR 1435) 
Monteverde, Cerro Plano, Finca Ecológica, 
Sendero Mirador, 10°18'47"N, 84°49'30"W, 
1,330 m a.s.l., 25.02.1999: (IR 651); 
28.07.1999: (IR 859); 15.08.1999: (IR 946); 
20.02.2000: (IR 1246) 
About 4 km N Santa Elena, Skywaik, 
10°18'33"N, 84°49'42"W, 1,330 m a.s.l., 
20.02.1998: (IR 332) 

INBio Collection 

Guanacaste: Zona Protectora Arenal- 
Monteverde: Santa Elena, sendero Encantado, 
10°2Г57"М, 84M7'27"W, 1,200 m a.s.l., leg. 
Kattia Martínez, 21.06.1996: 8 ads. (INBIo 
1498638) 

Zona Protectora Tenorio: Río San Lorenzo, 
Tierras Morenas, 10°36'38"N, 84°59'42"W, 
1,050 m a.s.l., leg. Gladys Rodríguez, 
28.10.1995: 1 ad. (INBio 1485411); Tenorio, 
Alrededores de la estación, 10°36'51"N, 
85°00'07"W, 900 m a.s.l., leg. Gladys 
Rodriguez, 18.09.1996: 1 ad. (INBio 
1498593) 

Parque Nacional Rincón de la Vieja: Sector 
Las Pailas: 4.5 km SW del Volcán Rincón de 
la Vieja, 10°46'36"N, 85°21'07"W, 800 m 
a.s.l., leg. nnalacological staff of INBio, 
09.12.1992: 1 ad. (INBio 1466644); sendero 
Pailas, 10°46'36"N, 85°21'07"W, 800 m 
a.s.l., leg. Karla Taylor, 23.08.1995: 3 ads., 
1 s.ad. (INBio 1498739); Sector Santa 
Maria: 10°45'58"N, 85°18'19"W, 800 m 
a.s.l., leg. Dunia García, 14.10.1995: 1 ad. 
(INBio 1487945); sendero Bosque 
Encantado, 10°46'36"N, 85°2Г07"\Л/, 800 m 



a.s.l., leg. Karla Taylor, 23.08.1995: 1 ad. 
(INBio 1498744) 

Parque Nacional Guanacaste: Estación 
Góngora, 10°53'22"N, 85°28'33"W, 580 m 
a.s.l.: leg. Zaidett Barrientes, 11.02.1994: 2 
ads. (INBio 1480300); leg. Dunia Garcia, 
20.10.1994: 1 juv. (INBio 1478682); 2 juvs. 
(INBio 1478739); 2 ads. (INBio 1483409); 
leg. Dunia Garda, 28.10.1994: 1 ad. (INBio 
1480475); leg. Dunia Garda, 08.03.1995: 1 
ad. (INBio 1488083); leg. Dunia Garda, 
28.06.1995: 1 ad., 3 juvs. (INBio 1484993); 
Sector Góngora [rio Góngora], 10°53'22"N, 
85°28'33"W, 580 m a.s.l.: leg. Kattia 
Martinez, 26.05.1995: 1 juv. (INBio 1498514) 
Parque Nacional Guanacaste: Sector Orosi 
(antes: Maritza), sendero Casa Fram, 
10°57'40"N, 85°29'45"W, 600 m a.s.l., leg. 
Zaidett Barrientes, 15.07.1996: 3 ads. (INBio 
1494681); Río Tempisquito, 10°57'45"N, 
85°29'05"\/V, 600 m a.s.l., leg. Dunia Garda, 
08.03.1996: 1 juv. (INBio 1488078) 
Parque Nacional Guanacaste: La Cruz, 9 
km S de Santa Cecilia, Estación Pitilla: 
10°59'25"N, 85°25'38"W, 700 m a.s.l.: leg. 
Petrona Ríos, 09.12.1994: 1 ad. (INBio 
1480289); Lado S del Río Orosi, leg. Calixto 
Moraga, 16.08.1994: 3 ads. (INBio 
1480319); leg. Calixto Moraga, 23.08.1994: 
1 ad. (INBio 1480318); 10°59'33"N, 
85°25'46"W, 700 m a.s.l.: leg. malacological 
staff of INBio, 08.01.1993: 1 ad. (INBio 
1463787); leg. Calixto Moraga, 10.07.1993: 
1 juv. (INBio 1467560); Sendero Nacho, 
10°59'33"N, 85°25'46"W, 700 m a.s.l.: leg. 
malacological staff of INBio, 13.10.1993: 1 
ad. (INBio 1463946); Sendero Mena, 400 m 
W de la Estación Pitilla, 10°59'25"N, 
85°25'51"W, 700 m a.s.l.: leg. Calixto 
Moraga, 09.01.1994: 1 ad. (INBio 1480043); 
Fila Orosilito, 1 °59 '02 "N, 85°26'01 "W, 900 
m a.s.l.: leg. Calixto Moraga, 20.04.1994: 1 
ad. (INBio 1480329); Finca del Estado: 
Casa de Roberto, ir00'09"N, 85°25'33"W, 
600 m a.s.l.: leg. Calixto Moraga, 
22.08.1994: 1 s.ad. (INBio 1480342) 
La Esperanza, 6 km E de Santa Cecilia de la 
Cruz, ir00'42"N, 85°22'45"W, 400 m a.s.l., 
leg. Calixto Moraga, 09.01.1994: 1 ad. 
(INBio 1480050) 
Alajuela: Reserva Biológica Los Angeles, 7 
km NE de los Angeles Norte de San Ramón, 
10°12'12"N, 84°29'10"\/V, 1,100 m a.s.l., leg. 
Zaidett Barrientes, 06.11.1995: 1 ad., 2 
s.ads. (INBio 1482570) 
Reserva Biológica San Ramón, 10°13'30"N, 
84°35'17"W, 800 m a.s.l.: leg. malacological 



220 



RICHLING 



staff of INBio, 15.02.1994; 1 ad. (INBio 
1477816); leg. Gerardo Carballo, 
10.07.1994: 1 ad. (INBio 1476150); Sendero 
Liz, leg. Gerardo Carballo, 08.08.1994: 1 ad. 
(INBio 1476214) 

Sector Colonia Palmareña, 10°14'09"N, 
84°33'15"\/V, 700 m a. s. I., leg. Eida Fletes, 
13.04.1995: 1 ad. (INBio 1485385) 
Zona Protectora Arenal-Monteverde: Sector 
Alemán, Finca dos Ases, 10°17'56"N, 
84°46'08"W, 1,140 m a.s.l.: leg. Zaidett 
Barrientos, 13.10.1994: 1 ad. (INBio 
1468276); leg. Kattia Martinez, 04.12.1995: 2 
ads. (INBio 1485227); Sendero Alemán, 
10°17'59"N, 84°45'38"W, 1,080 m a.s.l.: leg. 
Kattia Martinez, 18.08.1994: 1 ad. (INBio 
1480101); 19.08.1994: 1 ad. (INBio 
1478523); Sector Peñas Blancas, Estación 
Alemán, 10°18V9"N, 84°44'52"W, 900 m 
a.s.l.: leg. Kattia Martinez, 11.10.1994: 2 
ads. (INBio 1498802); 11.12.1994: 1 ad. 
(INBio 1480605) 

Parque Nacional Guanacaste-Rincón de la 
Vieja, Estación San Cristóbal, 10°52'55"N, 
85°23'26"\A/, 600 m a.s.l.: leg. Dunia Garda, 
08.01.1995: 5 ads., 2 s.ads. (INBio 1488065); 
leg. malacological staff of INBio, 18.08.1995: 
8 ads., 5 s.ads. (INBio 1498494) 
Sector las Cubas, Bosque Urbina, 
10°53'41"N, 84°47'20"W, 40 m a.s.l., leg. 
Kattia Martinez, 25.04.1994: 1 ad. (INBio 
1466940) 

Caño Negro: Veracruz, 10°50'22"N, 
84°52'52"W, 35 m a.s.l.: leg. Kattia Flores, 
14.02.1997: 1 juv. (INBio 1487125); Finca 
Delicias. 10°54'01"N, 84°47'20"W, 35 m 
a.s.l.: leg. Kattia Flores, 14.12.1996: 1 ad. 
(INBio 1487043); 01.11.1997: 1 ad. (INBio 
1487611); en el Pueblo, 10°53'38"N, 
84°47'20"W, 35 m a.s.l.: leg. Kattia Flores, 
09.10.1994: 1 ad. (INBio 1480029); 
07.04.1995: 5 ads. (INBio 1501040) 
Refugio Nacional de Vida Silvestre Caño 
Negro: Caño Negro, San Antonio, Finca 
Juan Cubano 2, 10°54'50"N, 84°45'12"W, 
35 m a.s.l., leg. Kattia Flores, 16.11.1996: 1 
ad. (INBio 1487878) 

Monte Cele, sendero La Tepezcuintle, 
10°57'27"N, 85°24'20"W, 700 m a.s.l., leg. 
Dunia Garcia, 09.09.1995: 4 ads. (INBio 
1488042) 

Estación Playuelas, 50 m del Rio Frió, 
10°57'29"N, 84°44'55"W, 40 m a.s.l., leg. 
Kattia Martinez, 08.01.1994: 4 ads. (INBio 
1479506) 

Sector Playuelas, 10°57'29"N, 84°45'15"W, 
35 m a.s.l.: leg. Kattia Martinez, 21.08.1996: 



2 ads. (INBio 1498571); leg. Kattia Flores, 
08.11.1996: 1 ad. (INBio 1487809) 

Heredia: Frente al bosque de la hoja, 
1 0°04'1 3"N, 84°05'40"W, 1 ,800 m a.s.l., leg. 
Zaidett Barrientos, 14.05.2000: 1 ad. (INBio 
3562231) 

Limón: Reserva Indígena Talamanca: Sector 
Amubri, 09°30'53"N, 82°57'19"W, 70 m 
a.s.l.: 14.06.1994: 1 ad. (INBio 1477585); 
15.06.1994: 1 ad. (INBio 1477569); 
26.09.1994: 1 ad. (INBio 1483302); 4 s.ads. 
(INBio 1483303); 1 juv. (INBio 1483376); 1 
ad. (INBio 1483382); 1 s.ad. (INBio 
1483388); 2 ads. (INBio 1483392); 1 ad. 
(INBio 1483407); 2 s.ads. (INBio 1483408); 
27.09.1994: 1 ad. (INBio 1483381); 1 ad. 
(INBio 1483389); 2 s.ads. (INBio 1483402); 
29.09.1994: 2 s.ads. (INBio 1483403); 1 ad. 
(INBio 1483394): 30.09.1994: 2 s.ads. 
(INBio 1483395); 2 s.ads, (INBio 1483401); 
18.10.1994: 1 ad. (INBio 1483390); 1 ad. 
(INBio 1483386); 19.10.1994: 1 s.ad. (INBio 
1483383); 1 ad. (INBio 1483387); 1 s.ad. 
(INBio 1483396); 27.11.1994: 1 ad. (INBio 
1483398); 28.11.1994: 1 s.ad. (INBio 
1483378); 1 s.ad. (INBio 1483385) 
29.11.1994: 1 s.ad. (INBio 1483397) 
30.11.1994: 1 ad. (INBio 1483400) (all leg 
Gerardina Gallardo); Amubri, Sendero Soki 
09°30'53"N, 82°57'19"W, 70 m a.s.l.: leg 
Angela Mora Maroto, 17.04.1995: 1 ad 
(INBio 1484735); leg. Gerardina Gallardo 
17.05.1994: 4 ads. (INBio 1467294); 4 ads 
(INBio 3395382); leg. Angela Mora Maroto 
22.04.1995: 3 ads. (INBio 1485382); leg 
Angela Mora Maroto, 04.08.1995: 1 ad 
(INBio 1485365); leg. Gerardina Gallardo 
27.11.1996: 3 ads., 1 s.ad. (INBio 1493444) 
Reserva Indígena Talamanca: Cerca Río 
Lan, 09°32'57"N, 82°58'25"W, 80 m a.s.l. 
leg. Gerardo Carballo, 17.06.1994: 1 ad 
(INBio 1476073); Suiri, orillas del Rio Telire 
09°33'56"N, 82°55'50"W, 30 m a.s.l.: leg 
Gerardina Gallardo, 25.11.1996: 1 ad., 2 
s.ads. (INBio 1487336) 
Reserva Biológica Hitoy Ce re re: Sector 
Miramar: 09°38'03"N, 83°00'45"W, 300 m 
a.s.l.: leg. Zaidett Barrientos, 08.10.1994: 1 
ad. (INBio 1475720); 1 ad. (INBio 1475725); 
Senderos a Rio Moin, 09°37'44"N, 
83°00'32"W, 150 m a.s.l.: leg. Zaidett 
Barrientos, 08.11.1994: 2 juvs. (INBio 
1475228); 1 ad. (INBio 1475234); Hitoy 
Cerero, 09°37'50"N, 83°00'52"W. 300 m 
a.s.l.: leg. Gerardo Carballo, 12.05.1994: 3 
ads., 1 s.ad. (INBio 1476376); leg. Gerardo 
Carballo, 13.06.1994: 4 ads. (INBio 



CLASSIFICATION OF HELICINIDAE 



221 



1476490); leg. Gerardo Carballo, 
04.07.1994: 2 ads. (INBIo 1475694); leg. 
Marianella Segura, 07.12.1994: 1 ad. (INBIo 
1480272); Sendero Moin, 09°37'50"N, 
83°00'52"W, 300 m a.s.l.: 14.01.1994: 3 ads. 
(INBIo 1475930); 27.02.1994: 1 ad. (INBIo 
1476687); 1 ad. (INBIo 1476688) (all leg. 
Gerardo Carballo) 

Reserva Biológica Шоу Ce re re: Cruce entre 
Sendero Revienta Pectios y Sendero 
Espavel, 09°39'12"N, 83°00-58"W, 600 m 
a.s.l.: leg. Alexander Alvarado Méndez, 
24.04.1999: 1 ad. (INBio 1497851); Sector 
IHitoy Cerero, Sendero Catarata, 
09°40'18"N, 83°01'45"W, 100 m a.s.l.: leg. 
Gerardo Carballo, 22.02.1994: 1 ad. (INBio 
1476262); Sendero Tepezcuintle, 

09°40'22"N. 83°01'40"W, 140 m a.s.l.: 
25.04.1999: 2 ads. (INBio 1497862); 2 ads. 
(INBio 3090624); 05.07.1999: 1 ad. (all leg. 
Alexander Alvarado Méndez) (INBio 
1497905); Sendero Bobócara, 09°40'31"N, 
83°00'31"W. 200 m a.s.l.: leg. malacological 
staff of INBio, 10.01.1993: 1 ad. (INBio 
1466444); Sendero Toma de Agua, 
09°40'31"N, 83°0r36"W, 100 m a.s.l.: 
20.04.1994, leg. Zaidett Barrientes: 2 ads. 
(INBio 1473832); leg. Gerardo Carballo: 1 
ad. (INBio 1476246); leg. Zaidett Barrientes, 
08.09.1994: 1 ad. (INBio 1475438); Estación 
Hitoy Cerero, 09°40'35"N, 83Ю1'36"\А/, 100 
m a.s.l.: leg. malacological staff of INBio, 
15.11.1993: 3ads. (INBio 1463392); 400 m 
NE de la Estación de Hitoy Cerero, Sendero 
la "Finca", 09°40'35"N, 83ЮГ26"\А/, 110 m 
a.s.l.: 03.06.2000: 1 ad. (INBio 3098418); 
20.07.1999: 1 s. ad. (INBio 1497844); 
27.09.2000: 2 ads. (INBio 3091789) (ail leg. 
Alexander Alvarado Méndez); Sendero 
Chato: 09°40'41"N, 83°0r26"W, 100 m 
a.s.l., leg. Marianella Segura, 14.07.1994: 1 
s.ad. (INBio 1478197) 
Refugio Nacional de Vida Silvestre Gandoca- 
Manzanillo: Sector Gandoca, Camino a 
Gandoca, 09°38'04"N, 82°38'37"W, 10 m 
a.s.l.: 28.04.1999: 5 juvs. (INBio 3097941); 
Sector Manzanillo: 1 km S de la escuela, 
09°37'31"N, 82°39'36"W, 4 m a.s.l., 
02.02.2000: 2 ads. (INBio 3097906); 
Camino a Gandoca, 09°38'13"N, 
82°38'40"W, 1 00 m a.s.l., 28.01 .2000: 2 ads. 
(INBio 3097895); Sendero a Gandoca, 
09°38'04"N, 82°38'43"W, 8 m a.s.l., 
04.02.2000: 2 s.ads. (INBio 3097899) (all 
leg. Alexander Alvarado Méndez) 
1 km S de Punta Codes, 09°38'17"N, 
82°43'25"W, 40 m a.s.l., leg. Zaidett 



Barrientes, 20.08.1996: 1 ad., 1 juv. (INBio 
1487850) 

Parque Nacional Cahuita: Sector Cahuita: 
800 m E de la Casetilla, 09°44'00"N, 
82°49'57"W, 10 m a.s.l., 05.11.1999: 1 s.ad., 
1 juv. (INBio 3096430); Sector Puerto 
Vargas: Sendero a Cahuita, 09°43'43"N 
82°49'11"W, O m a.s.l., 01.09.1999: 3 ads 
(INBio 3095846); 600 m E de la Casetilla 
09°42'54"N, 82°48'58"W, 8 m a.s.l. 
27.09.2000: 1 juv. (INBio 3091796) (all leg 
Alexander Alvarado Méndez) 
Isla Uvita, frente al muelle de Limón, 
09°59'45"N, 83°00'50"W, 5 m a.s.l., leg. 
Alexander Alvarado Méndez, 11.10.2000: 2 
ads., 1 juv. (INBio 3315386) 
Zona Protectora Rio Pacuare: 1.3 km NW 
de la Estación Barbilla, 09°59'25"N, 
83°28'04"W, 500 m a.s.l., leg. Alexander 
Alvarado Méndez, 02.11.2000: 1 ad. (INBio 
3315302) 

Reserva Indígena Barbilla-Dantas: Sector 
Colonia Puhscaleña, 10°00'17"N, 

83°23'02"W, 300 m a.s.l., leg. Alexander 
Alvarado Méndez, 03.03.2000: 2 juvs. 
(INBio 3098016) 

Sector Guápiles: 10°11'51"N, 83°5r22"W, 
300 m a.s.l., leg. Alexander Alvarado 
Méndez, 08.03.2000: 2 ads., 1 s.ad. (INBio 
3097950) 

Orillas del rio Aguas Frías, 10°24'05"N, 
83°35'60"W, 10 m a.s.l.: leg. Elias Rojas, 
29.11.1996: 3 ads. (INBio 1487980) 
Finca Montaña Grande, 10°31'39"N, 
83°43'33"W, 10 m a.s.l.: 400 m N de la 
estación, a orillas de la quebrada: 
13.09.1993: 3 ads. (INBio 1498610); 300 m 
N de la estación: 2^. 09. ^996: 1 ad. (INBio 
1 501 097); 600 m N de la estación Cedrales: 
13.11.1996: 2 juvs. (INBio 1501055); 
14.12.1996: 1 juv. (INBio 1498623) (all leg. 
Elias Rojas) 

Finca Toty Castro, 1.7 km S de la estación 
Cedrales, 10°31'39"N, 83°43'33"W, 10 m 
a.s.l., leg. Elias Rojas, 16.10.1996: 1 ad. 
(INBio 1501098) 

Refugio Nacional de Vida Silvestre Barra del 
Colorado: Pococi, Colorado, Sector Cerro 
Cocori, 30 km N de Cariari, 10°35'39"N, 
83°42'59"W, 160 m a.s.l.: leg. malacological 
staff of INBio, 10.12.1993: 6 ads. (INBio 
1465446); leg. malacological staff of INBio, 
04.10.1994: 3 ads. (INBio 1478061); leg. 
Elias Rojas, 10.05.1994: 5 ads. (INBio 
1483360); leg. Elias Rojas, 24.08.1994: 1 
ad., 1 s.ad. (INBio 1480255); leg. Elias 
Rojas, 10.09.1994: 1 ad. (INBio 1483208); 1 



222 



RICHLING 



juv. (INBio 1483209); leg. Elias Rojas, 
13.09.1994: 2 ads. (INBio 1480261); 1 juv. 
(INBio 1480281); leg. Elias Rojas, 
10.10.1994: 1 ad. (INBio 1483017); leg. Elias 
Rojas, 05.12.1994: 1 ad. (INBio 1467174) 
Refugio Nacional de Vida Silvestre Barra del 
Colorado: Barra del Colorado, Estación 
Sardinas: 10°38'52"N, 83°43'52"W, 50 m 
a.s.l.: 05.01.1994: 1 ad. (INBio 1478283) 
10.02.1994: 4 ads. (INBio 1484010) 
12.05.1994: 1 ad., 1 s.ad. (INBio 1484585) 
5 ads., 1 s.ads. (INBio 1484587); 6 ads. 
(INBio 1484589); 24.05.1994: 1 s.ad. (INBio 
1478305); 11.07.1994: 4 s.ads., 2 juv. 
(INBio 1484432); 25.07.1994: 1 ad. (INBio 
1478294); 28.08.1994: 1 ad. (INBio 
1480051); 12.10.1994: 3 juv. (INBio 
1484372); 3 ads., 1 s.ad., 2 juv. (INBio 
1484372); 12.10.1994: 3 ads., 1 s.ad., 2 
juv. (INBio 1484374); 16.10.1994: 3 ads. 
(INBio 1484013); 22.10.1994: 2 ads. (INBio 
1484991); 7 ads., 1 s.ad. (INBio 1485284); 
5 ads., 1 s.ad., 2 juvs. (INBio 1485285); 7 
ads., 1 s.ad., 2 juvs. (INBio 1485289); 2 juvs. 
(INBio 1485290); 09.11.1994: 2 s.ads. 
(INBio 1480044); 09.12.1994: 1 ad. (INBio 
1480041); 01.02.1995: 1 ad., 1 s.ad. (INBio 
1485145); 02.06.1995: 1 ad. (INBio 
1484748); 4 ads. (INBio 1484749) (all leg. 
FlorAraya); 10°39'11"N. 83°44'21"W, 15 m 
a.s.l.: leg. malacological staff of INBio: 
13.01.1994: 1 ad. (INBio 1478017); 
16.04.1994: 1 ad. (INBio 1477915); 800 m N 
de la Estación Sardinas, Sendero Tono, 
10°39'05"N, 83°44'31"W, 50 m a.s.l.: leg. 
malacological staff of INBio, 21.11.1993: 1 
juv. (INBio 1465699); 1 ad. (INBio 1465700) 

Cartago: Parque Nacional Tapanti-Macizo de 
La Muerte: Sendero Oropéndola, 
0945'09"N, 83°47V8"W, 1,260 m a.s.l.: leg. 
Rosa Guzman, 03.10.1997: 1 ad. (INBio 
1488194); Estación Quebrada Segundo, 
09°45'45"N, 83°47'18"W, 1,360 m a.s.l.: leg. 
Roberto Delgado, 18.10.1994: 1 ad. (INBio 
1479646); leg. Roberto Delgado, 
03.07.1995: 1 ad. (INBio 1487842) 
Monumento Nacional Guayabo: Turrialba, 
Santa Teresita, 09°58'26"N, 83°41'42"W, 
1,000 m a.s.l., leg. Zaidett Barrientes, 
16.12.1994: 1 ad. (INBio 1476052) 

Puntarenas: Quebrada Chanchera, 800 m W 
de la Playa, 08°37'26"N, 83°26'39"W, 1 m 
a.s.l., leg. Socorro Avila, 08.12.1996: 1 ad. 
(INBio 1486976) 

San Luis, Finca Buen Amigo, 10°16'36"N, 
84°47'48"\/V, 1,100 m a.s.l., leg. Zobeida 
Fuentes, 26.06.1995: 1 ad. (INBio 1484382) 



Zona Protectora Arenal-Monteverde: 
Reserva Biológica Bosque Nuboso 
Monteverde: Sendero Brillante, 10°17'59"N, 
84°47'10"W, 1,520 m a.s.l.: leg. Kattia 
Martinez, 17.06.1994: 2 ads. (INBio 
1466835); Sendero Bosque Nuboso, 
10°17'59"N, 84°47'36"W, 1 ,600 m a.s.l.: 
24.05.1994: 5 ads. (INBio 1466884); 3 
ads. (INBio 1466954); 2 ads. (INBio 
1467003); 25.05.1994: 1 ad. (INBio 
1466842); 1 ad. (INBio 1466870); 2 ads. 
(INBio 1466891); 1 ad. (INBio 1466905); 1 
ad. (INBio 1467024); 14.06.1994: 3 ads., 2 
sads. (INBio 1467031); 15.07.1994: 2 ads. 
(INBio 1479528); 16.07.1994: 2 ads. 
(INBio 1479539); 25.09.1995: 1 ad. (INBio 
1498806); 28.10.1995: 1 ad. (INBio 
1498590); 20.10.1996: 4 ads. (INBio 
1498828) (all leg. Kattia Martínez); Sendero 
Bosque Nuboso, 10°17'59"N, 84°47'36"W, 
1,520 m a.s.l.: leg. Zaidett Barrientes, 
14.10.1994: 1 s.ad., 1 juv. (INBio 1468141); 
1 ad. (INBio 1468211); 1 ad. (INBio 
1468212); Sendero el Camino, 10°18'03"N, 
84°47'15"W, 1,560 m a.s.l.: 23.05.1994: 5 
ads., 1 s.ad. (INBio 1466912); 1 s.ad. (INBio 
1466947); 23.05.1994: 1 s.ad. (INBio 
1466996); 2 ads. (INBio 1467010); 
25.05.1994: 1 ad. (INBio 1466863); 1 s.ad. 
(INBio 1466968); 10.06.1994: 7 ads. (INBio 
1480426); 14.07.1994: 2 ads., 1 s.ad. (INBio 
1480126); 2 ads. (INBio 1480128); 5 ads. 
(INBio 1480129); 1 ad. (INBio 1480149); 
08.08.1994: 3 ads. (INBio 1479517); 2 ads. 
(INBio 1479550); 1 juv. (INBio 1479838); 
16.09.1994: 1 ad. (INBio 1480098); 
10.10.1994: 1 ad. (INBio 1485422); 
26.09.1995: 1 ad. (INBio 1498807) (all leg. 
Kattia Martinez); Sendero el Roble, 
10°18'16"N, 84°47'27"W, 1,600 m a.s.l.: leg. 
Kattia Martinez, 08.11.1994: 1 ad. (INBio 
1480132); Sendero Chomogo, 10°18'22"N, 
84°47'23"W, 1,640 m a.s.l.: 13.08.1994: 1 
ad. (INBio 1480152); 10.10.1994: 1 ad. 
(INBio 1485426); 08.12.1994: 1 ad. (INBio 
1477521); 15.12.1994: 1 ad. (INBio 
1484687); 06.03.1995: 1 ad. (INBio 
1485441) (all leg. Kattia Martinez); Sendero 
Bosque Eterno, 10°18'22"N, 84°47'40"W, 
1,600 m a.s.l.: 09.06.1994: 1 ad. (INBio 
1480119); 06.08.1994: 1 s.ad. (INBio 
1466793); 28.10.1995: 1 ad. (INBio 1498581) 
(all leg. Kattia Martinez); Sendero el Rio, 
10°18'29"N, 84°47'37"W, 1,600 m a.s.l.: 
15.07.1994: 1 juv. (INBio 1479353); 
08.12.1994: 3 ads. (INBio 1480127); 1 ad. 
(INBio 1480130); 1 ad. (INBio 1480131); 



CLASSIFICATION OF HELICINIDAE 



223 



04.07.1995: 1 s. ad. (INBIo 1485234); 1 ad. 
(INBio 1485235) (all leg. Kattia Martinez); 
Estación la Casona, 10°18'11"N, 
84°47'50"W, 1,520 m a.s.l.: 08.09.1994: 1 
ad. (INBIo 1479451); 22.09.1995: 3 ads. 
(INBio 1498804); 28.10.1998: 3 ads. (INBIo 
1498632) (all leg. Kattia Martinez); 
10°18'15"N, 84°47'46"W, 1,520 m a.s.l., 
leg. malacological staff of INBio, 
28.07.1994: 5 ads. (INBio 1477749) 
Finca tomas, por Casa Boby, 10°18'12"N, 
84°48'22"W, 1,520 m a.s.l., leg. Kattia 
Martinez, 24.10.1995: 1 s. ad. (INBio 
1498808) 

Cerro Plano, 10°18'58"N, 84°49'09"W, 1,300 
m a.s.l., leg. Kattia Martinez, 02.09.1996: 1 
ad. (INBio 1498652) 

Other Sources 

COSTA RICA 

Guanacaste: Tilaran [about 10°28'30"N, 

84°58'30"W], leg. Univ. Alabama, M. Smith 

coll.: 6 ads. (UF 95283) 

1.7 mi S Tilaran on road to Quebrado 

Grande [about 10°27'N, 84°58'W], leg. R.W. 

McDiarmid, 28.08.1971: 2 ads., 1 s. ad. (UF 

214166) 

10 mi W Tilaran [about 10°26'N, 85°06'W], 

leg. Ronald Heyer, 06.08.1964: 1 ad. (UF 

214163) 

Monte Verde [about 10°18'N, 84°47'W], leg. 

Savage & Scott, 13-16.05.1964: 6 ads., 3 

s.ads. (UF 214170) 
Alajuela: San Carlos [about 10°20'N, 

84°26'W], leg. McGinty coll., ex Preston & 

Tomlin: 3ads. (UF 160150) 

Cariblanca [about 10°17'N, 84°12'W], 

Sarapiqui, 600 m a.s.l., P. Biolley (#267): 5 

ads. (MHNN) 

Chemin de Sarapiqui, S. Miguel [about 

10°19'N, 84°11'30"W], leg. P. Biolley: 11 

ads. (MHNN) 

Tesalia [Tetsalia?, about 10°2rN, 84°24'W], 

leg. R. W. McDiarmid, 18-20.07.1971: 1 ad. 

(UF 214164) 
Heredia: Puerto Viejo [de Sarapiqui, about 

10°28'N, 84°00'30"W], leg. P. Biolley: 2 ads. 

(ZMB 103242) 

Rio Frio, Standard Fruit Co., 10°20'N, 

83°53'W, 300 ft., leg. Michael J. Corn, 

21.11.1969: 1 ad. (UF 214160); 22.11.1969: 

2 s.ads. (UF 214172) 

[not: "Alajuela"], Rio Frio [about 10°20'N, 

83°53'W], leg. Michael J. Corn, 05.05.1970: 

1 ad. (UF 214161); 15.05.1970: 1 ad. (UF 

214171) 



Limón: Los Diamantas Farm, 11.08.1971: 1 
ad. (UF 69846); Los Diamantes Farm, 12 mi 
SE Guapiles [about lO^II'N, 83°37'W], leg. 
R.W. McDiarmid, 13.08.1971: 1 ad. (UF 
214167) 

Moin, hill #1 [about 10°N, 83°04'W], leg. С 
Little, 29.09.1967: 1 ad. (UF 214158) 
Cueva Castil, near Limon [about 10°N, 
83°02'W], leg. Colin Little, 30.08.1967: 5 
ads. (UF 214165) 

Puerto Limon, football field adjacent to Stan- 
dard Fruit Box Factory [about 10°N, 
83°02'W], leg D.G. Robinson (TU-954), 
19.05.1984: 1 ad. (UF 155820) 
Along road cut, along south side of Rio 
Banano, opposite La Bomba, 09°54'49.7"N, 
83°03'56.4"W, leg. D.G. Robinson & J.M. 
Montoya, 21.09.1998 (APHIS PPQ USDA) 
Pandora [about 09°43'N, 82°58'W], leg. Jay 
Savage, 01.05.1964: 1 ad. (UF 214156); leg. 
R G. Thompson (FGT-100), 05.08.1964: 3 
ads. (UF 214157) 

3.2 km N Pandora [about 09°45'N, 
82°58'W], leg. RG. Thompson (FGT-98), 
04.08.1964: 8 ads, 1 s.ad. (UF 214155) 

1 km NWof Cahuita, 09°44.5'N, 82°50.9'W", 
leg. RG. Thompson (FGT-5616), 
25.02.1996: lad. (UF 258427) 
Trib[utary] to Rio Moin [Valle de 
Talamanca!], 572 500 E, 397 600 S, 430 m 
a.s.l. [09°37'45"N, 83°00'18"W], leg. E.L. 
Raiser (ELR-082), 10.08.1994: 1 ad. and in 
alcohol (UF 41438) (UF 41437); leg. R 
Alvando (ELR-087), 11.08.1994: 2 ads. (UF 
41442) 

Amubre [about 09°32'N, 82°57'30"W], leg. 
Norman Scott, 16.03.1964: 1 ad. (UF 
214168) 
San José: Tarbaca [about 09°49'25"N, 
84°06'39"W], leg. P. Biolley: 2 ads. (ZMB 
103246) 

2 lots mixed: Cartago: 1 . Azahar de Cartago 
[not clear, if referring to the town Cartago, 
?about 09°52'N, 83°55'W], San José: 2. 
Tarbaca [about 09°49'25"N, 84°06'39"W], 
leg. R Biolley: 10 ads. (MHNN) 

Cartago: 2 lots mixed: Cartago: 1. Azahar de 
Cartago [not clear, if referring to the town 
Cartago, ?about 09°52'N, 83°55'W], San 
José: 2. Tarbaca [about 09°49'25"N, 
84°06'39"W], leg. R Biolley: 10 ads. (MHNN) 
Tapanti, 4300 ft. [about 09°47'N, 83°48'W], 
leg. R G. Thompson (FGT-23), 26.06.1963: 
1 ad. (UF 214169) 

Turrialba [about 09°54'30"N, 83°41'W], ex 
coll. S.G.A. Jaeckel: 2 ads. (HNC 39842); 



224 



RICHLING 



coll. Bosch, ex Rolle, ex Wagner: 6 ads. 

(SMF 180790/6); Turrlalba, versant de 

l'Atlantique, 750 m [about 09°54'30"N, 

83°41'W], leg. P. Biolley (#146), 07.1893: 4 

ads. (MHNN) 

Valleé de Tuis [about 09°51'N, 83°35'W], H. 

Pittier, 9.1893 ex coll. Wiegmann: 1 ad. 

(ZMB 70633) 

Cartage?: Cache [Cachi?, about 09°50'N, 

83°48'W], leg. Roger, ex Godwin & Salvin: 1 

ad. (ZMB 40836) 
Puntarenas: 1.5 mi NE Monte Verde [about 

10°19'N, 84°47'W], leg. R.W. McDiarmid 

(RWM-11), 17.02.1966: 6 ads. (UF 214162) 
Costa Rica, without locality further specified: 

leg. Beal-Maltbie coll., ex W. F. Webb coll.: 4 

spec. (UF 237539); leg. H. G. Lee, ex G.D. 

Robinson, W.F. Webb: 1 ad. (UF 166943); 

leg. Univ. Alabama, Т.Н. Aldrich coll. (THA- 

8213), ex Webb: 1 ad. (UF 95254); 1 ad. 

(UF 214110); leg. P Biolley: 4 ads. (MHNN); 

leg. Carmiol: 2 ads. (ZMB 103244); ex 

Fulton: 3 ads. (ZMB 64488); 1 ad. (ZMB 

103245) 

NICARAGUA 

Not further specified: Sumichrast: 2 ads. (UF 
214108) 

PANAMA 

Bocas Del Toro: Colon Island, leg. McGinty 
coll.: 2 ads. (UF 185608); Isla Colon, ca. 12 
km NNW of Bocas del Toro, 09°25'00"N, 
82°16'23"W, leg. F.G. Thompson (FGT- 
4726), 19.09.1990: 1 ad. (UF 167537); Isla 
Colon, limestone knoll along E coast, 5 km 
NNE of Bocas del Toro, 09°23'05"N, 
82°14'09"W, leg. F.G. Thompson (FGT- 
4727), 20.09.1990: 1 ad. (UF 167538) 
N end of Isla San Cristobal, 09°17'28"N, 
82°15'51"W, leg. F.G. Thompson (FGT- 
4730), 21.09.1990: 1 ad. (UF 167541) 
Isla Bastimentos, 0.5 km NE of Bastimentos 
Town on trail to Wizard Beach, 09°20'59"N, 
82°12'15"W, 60 m a. s. I., leg. F.G. Thompson 
(FGT-4731), 22.09.1990: 1 ad. (UF 167544) 
Ojo de Agua, Filo Almirante, 09°17'32"N, 
82°27'43"W, 300 m a.s.l., leg. F.G. Thomp- 
son (FGT-4733), 24.09.1990: 6 ads. (UF 
167551) 

Colón, Canal Zone: 0.5 mi SE Achiote, S. R. 
Telford, 12.1969, 1 ad. (UF 214173); 4.8 km 
SE Achiote, leg. F.G.Thompson (FGT-1130), 
27.04.1969: 20 ads. (UF 214154) 
0.8 km SW Madden Dam, leg. F.G. Thomp- 
son (FGT-1131), 02.05.1969: 1 ad. (UF 
214159) 



N bank Chagres River, 6 km NNE Gamboa, 

leg. S.R. Telford, 22.04.1969: 1 ad. (UF 

214174) 
Canal Zone, not further specified: leg. Univ. 

Alabama, M. Smith coll., ex Clark 5 ads., 1 

s.ad. (UF 95284); leg. Univ. Alabama, M. 

Smith coll.: 11 ads. (UF 95285) 
Panama, without locality further specified: leg. 

Beal-Maltbie coll., ex W. Webb coll. (UF 

237401) 

Description 

Shell (Fig. 335A-C): Conlcal-subglobose, 
solid, relatively large sized and dull to 
slightly shiny. Color: basic color yellowish to 
whitish-opaque, towards apex and on upper 
half of whorls often a more or less intensive 
tinge ranging from reddish-brown to flesh 
colored, in some specimens involving the 
whole shell with exception of outer lip. The 
color is slightly overlapped with fine light to 
transparent patches and lines giving the 
shell a special ornamentation. Surface tex- 
tured with fine growth lines and oblique 
grooves of different individual orientations 
but of same general direction (Fig. 14), 
causing the dull appearance. Embryonic 
shell of about 1 whorl; 4-4^/g (lectotype: ЛУг) 
subsequent whorls nearly straight and only 
very slightly convex; last whorl with a touch 
of angulation on the periphery; whorls 
equally extending in size, forming a very 
regular, blunt spire. Suture very slightly im- 
pressed. Aperture oblique and nearly 
straight, last whorl only very slightly de- 
scending, inserting exactly at periphery or 
just below it. Outer lip independent of color 
of whorls, always yellowish-whitish, remark- 
ably thickened and broadly expanded, upper 
palatal region slightly sinuate. Reflection 
nearly rectangular to the whorl; transition to 
columella with a more or less pronounced 
denticle. Columella slightly curved, its tran- 




FIG. 13. Axial cleft and muscle attachments of 
Helicina funcki, IR 757; scale bar 5 mm. 



CLASSIFICATION OF HELICINIDAE 



225 





FIG. 14. Teleoconch surface structure of Helicina funcki. A. On 1=' whorl. В. On 2"^' whorl. С. 
On З^'' whorl. D. On 4^^ whorl (inset same magnification as in C); scale bar 100 pm. 



sitien to body whorl marked with a perpen- 
dicularly impressed line or even a groove. 
Basal callus weakly developed and nearly 
completely smooth or very slightly granu- 
lated. 

Juvenile specimens exhibit a roundly cari- 
nated periphery sometimes bearing 
periostracal spiral lines. 



Internal Shell Structures: (Fig. 13) 

Teleoconch Surface Structure: In Helicina 
funcki, the transitional structure is followed 
by a pattern of oblique diverging grooves, 
which is maintained in all whorls (Fig. 14B- 
D). The grooves only increase in length and 
become more widely spaced. 



226 



RICHLING 



Embryonic Shell: The surface is structured 
with pits arranged in concentric lines (Fig. 
15A). The diameter of these pits is approxi- 
mately equal to the interspacial distance 
between the pits in a line as well as between 
the lines of pits themselves, although the 
arrangement is somewhat irregular. This is 




the typical structure for Helicina funcki, but 
deviations also occur (Fig. 15B). The "com- 
pressed" pattern obviously results from ir- 
regularities experienced during growth (in 
the present case, during the younger part) 
which caused a different form of the embry- 
onic shell and more closely spaced growth 
lines resulting in a reduction of the diameter 
(Fig. 15A: 1040 pm. Fig. 15B: 930 pm)- 
Concerning the size of the embryonic shell, 
the type material falls within the range of 
Costa Rican lowland populations (e.g., 
Cahuita), whereas specimens from higher 
altitudes of Monteverde consistently develop 
a much larger embryonic shell. 
Diameter: 954 pm (± 41) (870-1,040) (n = 
16) (IR 1630, IR 1639, IR 1642, IR 1648, 
Cahuita); 1,160 pm (± 43) (1,060-1,240) (n 
= 20) (IR 843, Monteverde); 980 pm (± 40) 
(940-1,040) (n = 4) (BMNH 20010497.1-4, 
type lot, lectotype: 1 ,000 pm); 970 pm (± 50) 
(9201,020) (n = 2) (MIZ 8989, type lot of 
Helicina funcki costaricensis, lectotype: 
1020 pm). 

Operculum (Fig. 16): Only slightly calcified, 
calcareous plate not fully extended over 
horny plate, leaving a free margin, thickened 
towards columellar side. Color dark reddish- 
brown to nearly black, only the margin trans- 
parent. Columellar side slightly S-shaped, 
upper end acute and pointed or nearly rect- 
angular, lower end rounded, but slightly trun- 
cated towards the columella. 

Animal (Fig. 337A, B): The color of the animal 
does not show any great variation, either at 
different sites or within the populations. Sole 




FIG. 15. Embryonic shell of Helicina funcki, A. 
Typical. B. Irregularities during growth; scale bar 
100 pm. 



FIG. 16. Operculum of Helicina funcki, IR 757; 
scale bar 2.5 mm. 



CLASSIFICATION OF HELICINIDAE 



227 




and sides of the foot are whitish-yellowish 
changing gradually to dark brown-greyish 
towards the upper side and head. The ten- 
tacles are also dark brown-greyish with a 
light tip. The mantle has a whitish-greenish 
pigmentation shining through the shell, thus 
providing the live specimens with a some- 
what greenish appearance. The mantle only 
bears a dark color in juvenile specimens 
(Fig. 337B), being sometimes spotted with 
yellow, thus causing those juvenile individu- 
als to appear darker. 

Radula (Fig. 17): The cusps on the A- and C- 
central are vestigial, only the B-central with 
4-5 more or less-well developed cusps. 
Comb-lateral with 7-9 cusps, cusps on 
marginals slowly increasing in number. 
Radula with about 70-105 rows of teeth. 

Female Reproductive System (Figs. 18, 19): 
The receptaculum seminis enters at the 
middle of the inner side of the descending 
limb of the V-organ. It is a cylindrical, slender 




FIG. 17. Radula of Helicina funcki. A. Centrals. B. 
Comb-lateral. С Marginals; scale bar 50 fjm (A, 
B), 100 ^Jm (C). 



FIG. 18. Female reproductive system oí Helicina 
funcki, IR 1312; scale bar 2 mm. 



228 



RICHLING 




FIG. 19. Variability of the female reproductive sys- 
tem of Helicina funcki, IR 1 31 2; scale bar 2.5 mm. 

sac. The bursa copulatrix consists of numer- 
ous remarkably elongated lobes, some of 
which are always further subdivided. The 
provaginal sac is irregularly shaped, dors- 
oventrally flattened and bears lobe-struc- 
tures at its distal side. The stalk is 
comparatively long and deeply curved ante- 
riorly, as is the adjacent part of the reception 
chamber. The palliai oviduct is relatively long 



and shows mainly transversal constrictions. 
In Figure 19, the right drawing shows the 
genital for a slightly immature specimen. The 
main difference consists in the much less 
thickened palliai oviduct, in which, except for 
a slight enlargement, the final shape of the 
accessory structure is already developed. 

Morphometry and Sexual Dimorphism 
(Tables 3-4, Figs. 21-28) 

From my own material, all adult specimens 
of known sex and populations with at least a 
few specimens of each sex were compared. A 
few populations with scanty material were in- 
cluded because of their otherwise undocu- 
mented origin. 

The measurement of the weight is especially 
difficult in Helicina funcki, because a consider- 
able part of the weight results from the 
strongly developed, broadly expanded outer 
lip. In Fig. 20, the increase of weight during 
growth is illustrated for the population from 
Cahuita (juveniles were studied from lot IR 
1312). An additional non-mature shell from 
Rio Peje is included as an example for heavy- 
shelled specimens to demonstrate that the 
increase of weight during juvenile growth pe- 
riod continues at about the same rate. Shells 





Cahuita adult 


о 


1 




1 


1 1 






weight 


„ Cahuita juvenile 


+ 














[g] 


Rio Peje adult 


D 








° о 
□ а D 


D 
D 




0.3 










п 
а 


D 

п а 






0.25 










П 


D 

D 

+ 

П 


D 




0.2 


- 








D 
+ + + 

+ а 


+ + + 

+ + 
.. . - ^ 




+ 


0.15 


" 




+ 






+ 

+ + + 


+ 


í - 


0.1 


- 






t 


+ +t + 


+ + 

+ + 

О 




- 


0.05 


о 




00 




Оо juvenile 




- 








о 


о 












о о ^ 


















о 
















n 


лО 1 1 




1 


1 


1 


1 1 







0.4 0.5 0.6 07 volume [ml] о. 9 



FIG. 20. Increase of weight during growth of Helicina funcki from Cahuita 
(juveniles IR 1312), compared also with adults from Rio Peje (one juvenile 
included); arrows indicate "thin-lipped" adults; juvenile - shells without 
expanded lip. 



CLASSIFICATION OF HELICINIDAE 



229 



TABLE 3. Measurements of different populations of Helicina funcki horn material collected by the 
author, given as mean value with standard deviation, minimum and maximum value (min, max), and 
number of specimens (min. /max. diam. = minor/major diameter, col. axis = columellar axis); linear 
measurements [mm], weight [g], volume [ml]. 







"Rincón de la Vieja" (a 


Ititude 800 m) 


"Mirador Gerardo" (altitude 1450 


m) 








lots IR 972, IR 979 




lots IR 924 


, IR 928 


, IR 1230 








Mean 










Mean 












Sex 


value 


Deviation 


Min 


Max 


Number 


value 


Deviation 


Min 


Max Nl 


imber 


Height 


f 


11.14 


033 


10.80 


11.52 


4 


11.05 


0.48 


10.55 


11.74 


4 


Height 


m 


10.60 


032 


10.22 


11 04 


4 


10.17 


0.11 


10.04 


10.34 


4 


Maj. diam. 


f 


12.02 


0.31 


11.57 


12.63 


4 


12.42 


0.36 


11.96 


1296 


4 


Maj. diam. 


m 


11.56 


0.69 


10.66 


12.36 


4 


11.90 


0.12 


11.67 


12.07 


4 


Mm diam. 


f 


10.84 


0.23 


10.53 


11.22 


4 


11.19 


0.31 


10.78 


11.67 


4 


Min. diam. 


m 


10.39 


0.56 


9.58 


11.05 


4 


10.48 


0.08 


10.36 


10.65 


4 


Outer lip 


f 


7.95 


0.20 


7.56 


8.11 


4 


8.17 


0.14 


7.92 


8.36 


4 


Outer lip 


m 


7.83 


0.52 


7.13 


876 


4 


7.83 


026 


7.49 


8.25 


4 


Last whorl 


f 


9.08 


0.17 


878 


9.30 


4 


9 15 


027 


8.82 


9.48 


4 


Last whorl 


m 


8.86 


0.27 


8.43 


9.30 


4 


8.61 


0.06 


8.49 


8.68 


4 


Col. axis 


f 


8.73 


0.17 


8.50 


8.97 


4 


8.62 


0.32 


8.08 


9.10 


4 


Col. axis 


m 


8.14 


0.13 


796 


8.29 


4 


7.89 


0.11 


7.67 


8.09 


4 


Weight 


f 


0.078 


0.008 


0.066 


0.094 


4 


0.137 


0.025 


0.117 


0.187 


4 


Weight 


m 


0093 


0.032 


0.032 


0.132 


4 


0.142 


0.015 


0.125 


0.162 


4 


Volume 


f 


0.471 


0.031 


0.435 


0.515 


4 


0.491 


0.031 


0.452 


0.553 


4 


Volume 


m 


0.409 


0.053 


0342 


0.471 


4 


0.400 


0.005 


0.390 


0.408 


4 





"Monteverde - Finca Ecológica" 

(altitude 1330 m) 

lots IR 859, IR 946, IR 1246 



"Monteverde" (altitude 1500 m) 

lots IR 843, IR 927, IR 1194, IR 1435, 

IR 1627 







Mean 










Mean 












Sex 


value 


Deviation 


Min 


Max 


Number 


value 


Deviation 


Mm 


Max 


Number 


Height 


f 


10.96 


0.22 


10.65 


11.31 


4 


11.31 


0.33 


10.24 


12.17 


18 


Height 


m 


10.03 


0.22 


9.70 


10.32 


3 


10.29 


0.38 


9.71 


11.55 


15 


Maj. diam. 


f 


11.91 


043 


11.33 


12.54 


4 


12.73 


0.36 


11.70 


13.38 


18 


Maj. diam. 


m 


11.09 


0.44 


1043 


11.70 


3 


12.10 


0.34 


11.54 


12.98 


15 


Min. diam. 


f 


11.16 


0.36 


1045 


11.72 


4 


11.45 


0.34 


10.25 


12.35 


18 


Mm. diam. 


m 


9.94 


0.33 


9.45 


10.34 


3 


10.77 


0.37 


10.19 


11.55 


15 


Outer lip 


f 


8.04 


0.21 


7.75 


8.30 


4 


8.16 


0.20 


7.40 


8.65 


18 


Outer lip 


m 


7.65 


0.30 


7.34 


8.09 


3 


7.85 


0.23 


7.15 


8.54 


15 


Last whorl 


f 


902 


0.25 


856 


930 


4 


9.39 


0.25 


8.57 


10.09 


18 


Last whorl 


m 


8.32 


0.30 


7.88 


8.55 


3 


8.71 


0.32 


8.26 


9.74 


15 


Col. axis 


f 


8.55 


0.19 


8.16 


8.86 


4 


8.82 


0.27 


8.14 


945 


18 


Col. axis 


m 


7.88 


0.27 


7.58 


8.28 


3 


7.98 


0.26 


7.62 


8.81 


15 


Weight 


f 


0.156 


0.037 


0.105 


0.198 


4 


0.174 


0.018 


0.137 


0.235 


18 


Weight 


m 


126 


0.046 


0.057 


0.177 


3 


0.132 


0.024 


0.075 


0.188 


15 


Volume 


f 


0.444 


0.028 


0.407 


0.490 


4 


0.521 


0.039 


0.385 


0.653 


18 


Volume 


m 


0.345 


0.020 


0.315 


0.365 


3 


0.420 


0.035 


0.368 


0.518 


15 



230 










RICHLING 












{Continues) 




























"1 


-as Pavas 


i" (altitude 800 m 


) 


"Tortuguero 


(altitude 0-10 m) 








lots IR 952, IR 955, IR 1273, IR 1637 


lots IR 1348 


, IR 1620, IR 1653 








Mean 










Mean 












Sex 


value 


Deviation 


Min 


Max Number 


value 


Deviation 


Min 


Max Number 


Height 


f 


12.12 


0.22 


11.81 


12.75 


7 


12.22 


1.13 


11.09 


13.34 


2 


Height 


m 


11.11 


0.48 


10.15 


12.08 


5 


11.73 


0.21 


11.52 


11.94 


2 


Maj. diam. 


f 


13.38 


0.32 


12.93 


14.08 


7 


14.08 


0.78 


13.31 


15.25 


3 


Maj. diam. 


m 


12.30 


0.35 


11.85 


13.00 


5 


13.27 


0.09 


13.17 


13.36 


2 


Min. diam. 


f 


12.11 


0.18 


11.61 


1244 


7 


12.66 


0.77 


11.84 


13.82 


3 


Min. diam. 


m 


11.03 


0.34 


10.60 


11.60 


5 


11.78 


0.16 


11.62 


11.93 


2 


Outer lip 


f 


8.74 


0.23 


8.32 


9.23 


7 


9.40 


0.85 


8.55 


1025 


2 


Outer lip 


m 


8.40 


0.28 


7.99 


8.75 


5 


8.81 


0.01 


8.80 


8.82 


2 


Last whorl 


f 


10.14 


0.10 


10.00 


10.40 


7 


10.36 


0.86 


9.50 


11.22 


2 


Last whorl 


m 


9.31 


0.32 


8.76 


9.96 


5 


9.69 


0.03 


9.66 


9.72 


2 


Col. axis 


f 


9.33 


0.13 


9.17 


9.75 


7 


9.24 


0.48 


8.52 


9.81 


3 


Col. axis 


m 


8.49 


0.40 


7.51 


9.23 


5 


8.72 


0.08 


8.64 


8.80 


2 


Weight 


f 


0.152 


0.035 


0.103 


0.233 


7 


0.147 


0.081 


0.061 


0.268 


3 


Weight 


m 


0.151 


0.020 


0.128 


0.197 


5 


0.177 


0.062 


0.115 


0.239 


2 


Volume 


f 


0.636 


0.035 


0.593 


0.703 


7 


0.731 


0.089 


0.602 


0.865 


3 


Volume 


m 


0.473 


0.042 


0.404 


0.549 


5 


0.568 


0.003 


0.565 


0.570 


2 



"La Selva" (altitude 60 m) 
lots IR 1061, IR 1062, IR 1182 



"Guayacán" (altitude 520 m) 
lots IR 1079, IR 1090, IR 1608 



Mean 
Sex value Deviation 



Min Max Number 



Mean 

value Deviation Min 



Max Number 



Height 
Height 
Maj. diam. 
Maj. diam. 
Min. diam. 
Min. diam. 
Outer lip 
Outer lip 
Last whorl 
Last whorl 
Col. axis 
Col. axis 
Weight 
Weight 
Volume 
Volume 



12.65 

11.62 

14.06 

13.37 

12.88 

12.00 

9.56 

9.08 

10.58 

9.86 

9.77 

8.93 

0.236 

0.219 

0.729 

0.580 



0.29 

0.36 

0.21 

0.23 

0.14 

0.18 

0.24 

0.29 

0.19 

0.27 

0.17 

0.21 

0.036 

0.044 

0.037 

0.041 



12.16 

10.92 

13.56 

12.78 

12.51 

11.51 

9.03 

8.30 

10.21 

8.98 

9.38 

8.37 

0.134 

0.141 

0.652 

0.505 



13.06 
12.26 
14.37 
13.82 
13.09 
12.32 
10.18 

9.47 
10.95 
10.22 
10.00 

9.35 
0.277 
0.278 
0.783 
0.638 



12.14 

11.50 

13.18 

12.70 

11.97 

11.41 

8.73 

8.52 

10.14 

9.61 

9.34 

8.76 

0.191 

0.175 

0.615 

0.534 



0.34 

0.31 

0.36 

0.17 

0.27 

0.10 

0.11 

0.04 

0.29 

0.07 

0.24 

0.11 

0.032 

0.004 

0.040 

0.001 



11.47 

11.19 

12.69 

12.45 

11.65 

11.27 

8.48 

8.48 

9.66 

9.54 

8.88 

8.63 

0.138 

0.171 

0.533 

0.533 



12.55 

11.80 

13.62 

12.89 

12.42 

11.56 

8.88 

8.55 

10.43 

9.68 

9.56 

8.92 

0233 

0.179 

0.669 

0.534 



(Continues) 



CLASSIFICATION OF HELICINIDAE 



231 



{Continues) 









"México" 


(altitude 40 m) 




■ 


'Rio Peje'' 


' (altitude 160 m 


) 






lots IR 274 


, IR119- 


1, IR 1406 




lots IR 751, 


IR 1300, IR 1552 






Mean 










Mean 












Sex 


value 


Deviation 


Min 


Max Number 


value 


Deviation 


Min 


Max 


Number 


Height 


f 


11.22 


0.23 


10.92 


11.68 


4 


12.54 


0.33 


11.56 


13.64 


17 


Height 


m 


10.40 


0.16 


10.15 


10.62 


6 


11.68 


0.40 


10.88 


12.55 


20 


Maj diam 


f 


13.21 


0.30 


12.82 


13.64 


4 


13.91 


0.32 


13.17 


14.65 


17 


Maj. diam 


m 


12.11 


0.37 


11.32 


12.55 


6 


13.13 


0.31 


12.61 


13.97 


20 


Min. diam. 


f 


11.98 


0.29 


11.59 


12.40 


4 


12.74 


0.29 


11.93 


13.27 


17 


Min. diam. 


m 


10.90 


0.28 


10.36 


11.29 


6 


11.80 


0.24 


11.34 


12.44 


20 


Outer lip 


f 


8.68 


0.15 


8.49 


8.98 


4 


945 


0.28 


8.75 


9.98 


17 


Outer lip 


m 


8.01 


0.26 


7.41 


8.41 


6 


8.98 


0.28 


8.42 


9.87 


20 


Last whorl 


f 


9.70 


0.24 


9.43 


10.08 


4 


10.61 


0.28 


9.84 


11.47 


17 


Last whorl 


m 


890 


0.13 


8.65 


9.09 


6 


9.97 


0.25 


9.54 


10.66 


20 


Col. axis 


f 


8.67 


0.16 


8.49 


899 


4 


9.59 


0.32 


8.86 


10.66 


17 


Col. axis 


m 


8.05 


0.09 


7.93 


8.17 


6 


8.95 


0.29 


8.13 


9.78 


20 


Weight 


f 


0.200 


0.030 


0.175 


0.260 


4 


0.259 


0.036 


0.142 


0.344 


17 


Weight 


m 


0.200 


0.034 


0.130 


0.238 


6 


0.249 


0.040 


0.131 


0.331 


20 


Volume 


f 


0.574 


0.030 


0.542 


0.624 


4 


0.703 


0.050 


0.548 


0.820 


16 


Volume 


m 


0.432 


0.036 


0.371 


0.494 


6 


0.562 


0.038 


0.452 


0.686 


19 








"Rio Barbill 


la" (altitude 70 m) 






"Uatsi" 1 


(altitude 


30 m) 










lotIR 1545 




lots IR 766, 


IR 1114, IR 1632 






Mean 










Mean 












Sex 


value 


Deviation 


Min 


Max Number 


value 


Deviation 


Min 


Max 


Number 


Height 


f 


12.22 


0.00 


12.21 


12.22 


2 


12.61 


0.18 


12.28 


12.79 


6 


Height 


m 


11.32 


0.50 


10.75 


12.12 


5 


11.94 


0.18 


11.59 


12.15 


5 


Maj. diam 


f 


13.93 


0.00 


13.93 


13.93 


2 


14.04 


0.15 


13.78 


14.33 


6 


Maj. diam. 


m 


12.73 


0.47 


11.97 


13.61 


5 


13.36 


0.60 


12.64 


14.35 


5 


Min diam. 


f 


12.60 


0.02 


12.58 


12.62 


2 


12.68 


0.19 


12.45 


12.97 


6 


Min. diam. 


m 


11.37 


0.43 


10.73 


12.09 


5 


12.05 


0.44 


11.52 


12.98 


5 


Outer lip 


f 


9.29 


0.02 


9.27 


9.30 


2 


9.50 


0.19 


9.16 


9.95 


6 


Outer lip 


m 


8.57 


0.29 


8.04 


8.95 


5 


9.19 


0.35 


8.32 


9.68 


5 


Last whorl 


f 


10.31 


0.10 


10.21 


1041 


2 


10.51 


0.20 


10.04 


10.81 


6 


Last whorl 


m 


9.60 


0.45 


8.78 


10.30 


5 


9.98 


030 


9.56 


10.57 


5 


Col. axis 


f 


9.41 


025 


9.16 


9.66 


2 


9.53 


0.12 


9.36 


9.81 


6 


Col. axis 


m 


8.62 


0.35 


8.11 


9.32 


5 


8.89 


0.16 


8.71 


9.11 


5 


Weight 


f 


0.240 


0.012 


0.228 


0.251 


2 


0.263 


0.036 


0.219 


0.335 


6 


Weight 


m 


0.157 


0.041 


0.089 


0.219 


5 


0.148 


0.049 


0.087 


0.226 


5 


Volume 


f 


0.688 


0019 


0.669 


0.707 


2 


0.708 


0.021 


0.681 


0.744 


6 


Volume 


m 


0547 


0.073 


0.442 


0.695 


5 


0.631 


0.074 


0.546 


0.764 


5 



(Continues) 



232 

(Continues) 



RICHLING 



"Shiroles" (altitude 100 m) 
lots IR911, IR 1596, IR 1599, IR 1644 



"Cahuita" (altitude 0-10 m) 

lots IR 107, IR 757, IR 897, IR 898, IR 

907, IR 1095, IR 1312, IR 1555, IR 

1557, IR 1630, IR 1639, IR 1648 







Mean 












Mean 












Sex 


value Deviatior 


1 Min 


Max 


Number 


value Deviation 


Min 


Max 


Number 


Height 


f 


12.54 


0.57 


11.97 


13.10 


2 




11.31 


0.53 


10.21 


12.73 


63 


Height 


m 


12.04 


0.30 


11.67 


12.50 


4 




10.66 


0.54 


9.20 


12.08 


51 


Maj. diam. 


f 


14 16 


0.63 


13.53 


14.79 


2 




12.76 


052 


11.59 


14.55 


63 


Maj. diam. 


m 


1349 


025 


13.14 


13.82 


4 




12.26 


0.53 


10.85 


14.43 


51 


Min. diam. 


f 


12.81 


0.29 


12.52 


13.10 


2 




11.67 


0.46 


10.62 


13.26 


63 


Min. diam. 


m 


12.21 


0.19 


11.82 


12.41 


4 




11.04 


0.45 


9.88 


12.67 


51 


Outer lip 


f 


9.24 


0.06 


9.18 


9.30 


2 




8.63 


0.41 


7.76 


9.89 


63 


Outer lip 


m 


9.16 


0.21 


876 


9.48 


4 




8.37 


0.41 


7.39 


9.73 


51 


Last whorl 


f 


10.63 


0.40 


10.22 


11.03 


2 




9.56 


0.47 


844 


1071 


63 


Last whorl 


m 


10.27 


0.13 


10.10 


10.45 


4 




9.05 


0.44 


8.17 


10.19 


51 


Col. axis 


f 


953 


0.30 


9.23 


982 


2 




8.68 


0.43 


7.93 


9.91 


63 


Col. axis 


m 


924 


0.15 


9.07 


9.49 


4 




812 


0.41 


7.11 


9.18 


51 


Weight 


f 


0.298 


0.030 


0.268 


0.328 


2 




134 


0.026 


0.077 


0.224 


63 


Weight 


m 


0.292 


0.014 


0.274 


0.306 


4 




0.141 


0.039 


0.057 


0.282 


51 


Volume 


f 


0.718 


060 


0.658 


0.777 


2 




0.564 


0.070 


0.437 


0.817 


60 


Volume 


m 


0.622 


0.025 


0.572 


0.656 


4 




0.471 


0.058 


0.329 


0.662 


51 




































"Manzanillo' 


(altitude 0-10 


m) 










- 




lots IR 1096 


, IR 1320, IR 1642 










Mean 




















Sex value Deviation 


Min 


Max 


Number 










Height 


f 11.81 


0.43 


10.43 


12.45 


10 








Height 


m 11. 


17 


0.34 


10.44 


12.45 


19 












Maj. 


diam. 


f 13.43 


0.43 


12.39 


14.43 


10 












Maj. 


diam. 


m 12.79 


0.45 


12.01 


13.70 


19 












Min. 


diam. 


f 12.11 


0.40 


11.25 


12.96 


10 






-: 






Min. 


diam. 


m 11.48 


0.33 


10.99 


12.25 


19 












Outer lip 


f 9.11 


0.47 


7.97 


9.76 


10 












Outer lip 


m 8.66 


0.28 


8.03 


9.23 


19 












Last whorl 


f 9.97 


0.33 


9.28 


10.55 


10 












Last whorl 


m 9.31 


0.24 


8.79 


10.03 


19 












Col. 


axis 


f 8.93 


0.34 


7.91 


9.57 


10 












Col. 


axis 


m 8.56 


0.27 


7.96 


9.29 


19 












Weight 


f 0.180 0.018 


0.132 


0.217 


10 












Weight 


m 0.168 0.031 


0.128 


0.257 


19 












Volume 


f 0615 0.053 


0.486 


0.719 


10 












Volume 


m 0.522 0.043 


0.452 


0.630 


19 









still lacking their thickened outer lip but other- 
wise being fully grown weigh from approx. 50 
to 100 mg depending on the size, with adults 
ranging up to 344 mg. Thus, the weight is 
mainly influenced by the thickness of the outer 
lip, which not only depends on the age of the 
individual but also on size. A recently devel- 



oped outer lip is probably thinner than the one 
of a truly fully grown individual, a factor that 
cannot be differentiated in field collections, al- 
though the attempt was made to at least ex- 
clude non fully grown adult shells In 
populations with sufficient material. The ar- 
rows in the figure exemplary indicate such 



CLASSIFICATION OF HELICINIDAE 



233 



"thin-lipped" adults. In fact, this may have re- 
sulted in too low measurements, thereby re- 
ducing the mean value. 

In the diagrams, the populations are roughly 
grouped according to their locations: Rincón 
de la Vieja to Monteverde (NW-Costa Rica: 
mountain chains of Guanacaste and Tilarán), 
Las Pavas to La Selva (western and northern 
Caribbean plain), Guayacán to Barbilla 
(middle Caribbean plain), and Uatsi to 
Manzanillo (southern Caribbean plain). 

Because the sex of the additional popula- 
tions from the INBio material could not be de- 
termined, they have to be compared to the 
average value of both sexes. 



Morphometry: The comparison of the popula- 
tions showed that they differ in all character- 
istics. Except for weight, these differences 
between the populations exhibit a similar 
pattern in each characteristic (Figs. 21-28); 
that is, "Monteverde - Finca Ecológica" al- 
ways has the smallest dimensions, sug- 
gesting that relations between the 
measurements at each locality are constant. 
In fact, several relations were tested and, 
except for the size, no significant differences 
were found at the different locations. The 
individual data can diverge remarkably from 
the mean value and as may be expected, 
due to the fact that as more specimens are 



Rincón de la Vieja (п=4/4) 



7/: 



Mirador Gerardo (n=4/4) 



7/: 



Monteverde - Finca Ecológica (n= 



7/: 



■■jl3l 



Monteverde {n=18/15) 



7t 



Las Pavas (n=7/5) 



7/: 



Tortuguero (n=2/2) 



7/: 



La Selva (n=9/9) 



7/: 



Guayacán (n=5/2) 



uay. 



México (n=4/6) 



7/: 



Rio Peje (n=1 7/20) 



7t 



Barbilla (n=2/5) 



7/: 



Uatsi (n=6/5) 



7/: 



Shiroles {n=2/4) 



7/: 



Cahulta(n=63/51) 



7/: 



Manzanillo (n=10/19) 



7t 



Rincón de la Vieja (n=4/4) 



7/= 



Mirador Gerardo (n=4/4) 



7/: 



Monteverde - Finca Ecológica (n=4/3) 



7/= 



Monteverde (n=18/15) 



7/= 



Las Pavas (n=7/5) 



7/: 



Tortuguero (n=2/2) 



7/: 



La Selva (n=9/9) 



7/: 



Guayacán (n=5/2) 



7Í 



México (n=4/6) 



7/: 



Rio Peje (n=1 7/20) 



7t 



Barbilla (n=2/5) 



7/: 



Uatsi (n=6/5) 



:/C 



Shiroles (n=2/4) 



7/: 



Cahuita (n=63/51) 



7/: 



Manzanillo (n=10/1í 



7t 



10 11 [mm] 12 



FIG. 21. Shell height of different populations of 
Helicina funcki in Costa Rica according to Table 3; 
on each line: mean value, standard deviation, 
absolute range; number of individuals given as "n 
= females/males"; upper line: females, lower line: 
males; in between and shaded: average of both 
for comparison with populations of unknown sex. 



FIG. 22. Expansion of outer lip of different 
populations of Helicina funcki in Costa Rica 
according to Table 3; for explanations see Fig. 
21. 



234 



RICHLING 



included in the investigation, the wider the 
range of the data can become. 
Regarding these size differences, the vol- 
ume appears to illustrate them best, espe- 
cially because it is the only measurement 
directly reflecting the actual living conditions 
of the animal. The extrema: the biggest indi- 
vidual from Tortuguero (0.865 ml) had a shell 
with 2.75 times the volume of the smallest 
from Monteverde - Finca Ecológica (0.315 
ml); the mean value of the population of 
Shiroles is 1.7 times higher than that of 
Monteverde - Finca Ecológica. At the upper 
four locations in Fig. 27 (mountain chains of 
Guanacaste and Tilarán), representing the 
highest altitudes, consistently smaller- 
shelled populations are found, as well as at 
two far distant localities in the Caribbean 
plain (México and Cahuita). Shells from Las 



Pavas, Guayacán and Manzanillo are of in- 
termediate size (Fig. 29). 
Additional populations from the collection of 
INBio were subsequently compared only in 
the minor diameter, because the volume 
could not be measured and - as previously 
demonstrated - other characteristics varied 
in the same way. The minor diameter was 
chosen instead of the height, because it can 
be measured more exactly and it is better 
correlated with the volume (Fig. 30, Cahuita 
population). The populations show similar 
differences in size at different sites (Figs. 24, 
29). The two individuals of Isla Uvita repre- 
sent the smallest Helicina funcki measured 
in this study. The few corresponding locali- 
ties (Monteverde, Manzanillo, Rincón de la 
Vieja, Mirador Gerardo - Santa Elena, 
Shiroles close to Hitoy Cerere) agree sur- 



Rincón de la Vieja (n=4/4) 



Mirador Gerardo (n=4/4) 
ai 



Monteverde - Finca Ecológica (n=4/3) 



Monteverde (n=18/15) 

=7/ 



Las Pavas (n=7/5) 



Tortuquero (n=3/2) 



La Selva (n=9/9) 

=7/ 



Guayacán (n=5/3) 



uay. 



México (n=4/6) 
a/ 



Rio Peje (n= 17/20) 
a i 



Barbilla (n=2/5) 
ai 



Uatsi (n=6/5) 

ai — 



Shiroles (n=2/4) 

ai 



Catiuita (n=63/51) 

ai 



Manzanillo (n=10/19) 

a i 



Santiago (type lot BMNH) (n=4) 



Santa Clara (type lot H. funcki costaricensis (n=2) 
^=f l I 



Estación Góngora (n=6) 



Estación San Cnstóbal (n=12) 



Rincón de la Vieja (n=6) 



Tenorio (n=2) 



Santa Elena (n=fi 



Peñas Blancas (n=3) 



Monteverde (n=92) 



Pitilla (n=S 
=11= 



Monte Cele (n=4) 



Estación Playuelas (n=7) 



Caño Negro (n=£ 



Barra del Colorado (n=59) 



Cerro Cocori (n=19) 
=1 / 



Finca Montaña Grande (n=4) 



Rio Aquas frias (n=3) 
=1 1 — - 



Isla Uvita (n=2) 

=Î I ! 



Hitoy Cerere (n=13) 



Hitoy Cerere - Miramar (n=1f 



Amubn (n=23) 



Manzanillo (n=4) 



13 [mm] 14 



FIG. 23. Minor diameter of shell of different 
populations of Helicina funcki in Costa Rica 
according to Table 3; for explanations see Fig. 21 . 



FIG. 24. Minor diameter of shell of different 
populations of Helicina funcki in Costa Rica, 
INBio collection, according to Table 4, and type 
material of Helicina funcki and Helicina funcki 
costaricensis; for explanations see Fig. 21. 



CLASSIFICATION OF HELICINIDAE 



235 



prisingly well In their mean values, although 
this is often not supported by very extensive 
data in my ow/n material or INBio's, respec- 
tively. This even agrees with the results of 
the analysis of "non-statistical" numbers of 
specimens. 

Following up the fact that the highest locali- 
ties always had the small-shelled popula- 
tions, the average minor diameter of the 34 
populations (Isla Uvita excluded) was plotted 
against the elevation (Fig. 31). A constant 
decline of the maximum values with increas- 
ing elevation is clearly visible, suggesting an 
influence by elevation. Furthermore, all the 
data scattered below this decline in maxi- 
mum size indicate that altitude is not the 
only important parameter. The range of pos- 
sible influences is too wide, and Helldna 
funcki, although widely distributed, occurs at 



very scattered locations so that very detailed 
and local studies of environmental condi- 
tions would be required to trace any further 
correlation. 

Sexual Dimorphism: Besides weight, females 
in all measurements and in all populations 
are clearly bigger than males, although the 
range of measurements overlaps widely, as 
exemplified for Cahuita by the minor diam- 
eter-height-relation (Fig. 32). Even with a 
small sample size of sometimes as few as 
two individuals, this result is always con- 
firmed. Furthermore, the range of the differ- 
ences is often about the same as in the 
more extensively supported data of the 
populations from Cahuita, Rio Peje and 
Monteverde. The males have a volume of 
about 81% of females. 



Rincón de la Vieja {n=4/4) 



:/C 



Mirador Gerardo (n=4/4) 
-=11 



Monteverde - Finca Ecológica (n-4/3) 



lí: 



Monteverde (n=18/15) 



zm 



Las Pavas (n=7/5) 



://: 



Tortuguero (n=3/2) 



^L 



La Selva (n=9/9) 



:7/: 



Guayacán (n=5/3) 



iuay; 



México (n=4/6) 



7/: 



Rio Peje (n= 17/20) 



^L 



Barbilla (n=2/5) 



zm 



Uatsi (n=6/5) 



:7t 



Shiroles (n=2/4) 



7/: 



Cahuita (n=63/51) 



:7/: 



Manzanillo (n=10/19) 



7t 



9 10 11 [mm] 12 



Rincón de la Vieja (n=4/4) 



7/: 



Mirador Gerardo (n=4/4) 



-ци 



Monteverde - Finca Ecológica (n=4/3) 



7t 



Monteverde (n=18/15) 



^L 



Las Pavas (n=7/5) 



7t 



Tortuguero (n=2/2) 



7t 



La Selva (n=9/9) 



IL 



Guayacán (n=5/2) 



lUay. 



México {n=4/6) 



7/: 



Rio Peje (n=1 7/20) 



7t 



Barbilla (n=2/5) 



7/: 



Uatsi (n=6/5) 



7t 



Shiroles (n=2/4) 



-JL 



Cahuita (n=63/51) 



7t 



^ 



Manzanillo (n=10/19) 



7t 



11 [mm] 12 



FIG. 25. Height of last whorl of different 
populations of Helicina funcki in Costa Rica 
according to Table 3; for explanations see 
Fig. 21. 



FIG. 26. Height of columellar axis of different 
populations of ¡Helicina funcki in Costa Rica 
according to Table 3; for explanations see 
Fig. 21. 



236 



Rincón de la Vieja (n=4/4) 

=7/ il' 



Mirador Gerardo (n=4/4) 
a i I I ' 



Monteverde - Finca Ecológica (n=4/3) 

=7 / I 1 ^ 



Monteverde (n=18/15) 



Las Pavas (n=7/5) 

ai 



Tortuquero (n=3/2) 

a i 



La Selva (n=9/9) 

ai 



Guayacán (n=5/2) 



il 



México (n=4/6) 

ai 



Rio Peje (n=16/20) 

ai 



Barbilla (n=2/5) 

ai 



Uats I (n=6/5) 



Shiroles {n=2/4) 

ai 



Cahuita(n=60/51) 

ai 



Manzanillo (n=10/19) 

ai 



RICHLING 

Rincón de la Vieja (n=4/4) 



Mirador Gerardo (n=4/4) 



Monteverde - Finca Ecológica (n=4/3) 



Monteverde (n=18/15) 



Las Pavas (n=7/5) 



Tortuguero (n=3/2) 



La Selva (n=9/9) 



Guayacán (n=5/2) 



México {n=4/6) 



Rio Peje (n=1 7/20) 



Barbilla (n=2/5) 



Uatsi (n=6/5) 



Shiroles (n=2/4) 



Cahuita{n=63/51) 



Manzanillo (n=10/19) 



0.05 0,10 0,15 0,20 0,25 



[g] 



FIG. 27. Shell volume of different populations of FIG. 28. Shell weight of different populations of 
Helicina funcki in Costa Rica according to Table Helicina funcki in Costa Rica according to Table 
3; for explanations see Fig. 21 . 3; for explanations see Fig. 21 . 

TABLE 4. Minor diameter measurements [mm] of different populations of Helicina funcki from the 
INBio collection and type material, given as mean value with standard deviation, minimum and 
maximum value (min, max), and number of specimens. 



Locality 



Mean Devi- 
value ation Mm Max Number 



Lots 



Santiago (type lot 
BMNH) 



10,24 0.22 9.95 10.67 



BMNH 20010497.1-4 



Santa Clara (type lot H. 11.84 0.02 11.82 11.86 
funcki costaricensis) 



Estación Góngora 

Estación San 
Cristóbal 

Rincón de la Vieja 

Tenorio 

Santa Elena 



11.42 0.34 10.80 11.85 6 

11.09 0.38 10.26 11.68 12 

10.95 0.47 10.34 12.27 6 

11.37 017 11.20 11.54 2 

10.81 0.30 10.13 11.48 8 



MIZ 8989 



INBio 1480300, 1480475, 1483409, 
1484993, 1488083 
INBio 1488065, 1498494 



INBio 1466644, 1487945, 1498739, 

1498744 

INBio 1485411, 1498593 

INBio 1498638 



(Continues) 



CLASSIFICATION OF HELICINIDAE 



237 



(Continued) 



Locality 



Mean Devi- 
value ation 



Min 



Max Number 



Lots 



Peñas Blancas 
Monteverde 



10.82 0.44 10.45 11.48 



11.13 045 989 12.08 92 



Pitilla 

Monte Cele 
Estación Playuelas 
Caño Negro 
Barra del Colorado 



11.94 0.49 11.22 13.08 8 
10.91 0.22 10.58 1126 4 
10.49 044 9.53 11.32 7 



1220 0.47 11.18 12.78 



12.39 0.35 11.09 13.97 



Cerro Cocorí 

Finca Montaña 
Grande 

Río Aguas frías 

Isla Uvita 

Hitoy Cerere 



Hitoy Cerere 
Miramar 

Amubri 



59 



12.67 0.34 11.98 13.25 19 

1308 0.53 12.53 14.15 4 

1316 0.50 1241 13.66 3 

8.95 0.09 8.86 9.03 2 

1272 0.44 11.82 13.55 13 

12.73 0.39 11.91 13.81 17 

11 13 0.28 1032 1181 24 



Manzanillo 



11.86 0.39 1108 12.33 



INBio 1480605, 1498802 

INBio 1466835. 1466842, 1466863, 
1466870, 1466884, 1466891, 
1466905, 1466912, 1466954, 
1467003, 1467010, 1467031, 
1468211, 1477521, 1477749, 
1479517, 1479528, 1479539, 
1479550, 1480098, 1480119, 
1480126, 1480127, 1480128, 
1480129, 1480130, 1480131, 
1480132, 1480149, 1480152, 
1480426, 1484687, 1485422, 
1485426, 1485441, 1498581. 
1498590, 1498632, 1498804, 
1498806, 1498807, 1498828 
INBio 1463787. 1463946, 1480043, 
1480289, 1480318, 1480319 
INBio 1488042 

INBio 1479506. 1487809. 1498571 

INBio 1466940. 1480029. 1487043. 
1487611, 1487878, 1501040 
INBio 1465700, 1477915, 1478017, 
1478283, 1478294, 1480041, 
1480051, 1484010. 1484013. 
1484372. 1484374. 1484585, 
1484587, 1484589, 1484748, 
1484749, 1484991, 1485145, 
1485284, 1485285, 1485289 
INBio 1465446, 1467174, 1478061, 
1480255, 1480261, 1483017, 
1483208, 1483360 
INBio 1498610, 1501098 



INBio 1487980 

INBio 3315386 

INBio 1463392, 1466444, 1473832. 
1475438. 1476246. 1476262. 
1497862. 1497905.3091789 
INBio 1475234, 1475694, 1475720. 
1475725. 1475930. 1476376. 
1476490. 1476687. 1476688. 1480272 
INBio 1467294. 1477569, 1477585, 
1483302, 1483381, 1483382, 
1483386, 1483387, 1483389, 
1483390, 1483392, 1483394, 
1483398, 1483400, 1483407, 
1485365, 1485382, 1493444 
INBio 3097895. 3097906 



238 



RICHLING 




FIG. 29. Size variations in Costa Rican populations of Helicina funcki: shell 
height in figures reflects the mean value of the respective females; each shell 
originates from the respective locality and is randomly chosen according to 
the approximation of the mean value. 





1 1 1 


1 1 

height <> 


[mm] 




minor diameter + 

+ 


13 


~ 


+ 

о о 




о 


+ + 




+ 


+ 


12 


,o^^\.;oo^ о ^ 




* ++++ +0 






^ "^++0 o*" 






* о л 












iL о о 






% +0 о о 




11 


о о 




10 
q 


1 1 1 


1 1 



0.3 



0.6 



0.7 volume [ml] о.э 



FIG. 30. Relation of shell height and minor diamater respectively to the volume 
in Helicina funci<i exemplary for the females of the population from Cahuita. 



CLASSIFICATION OF HELICINIDAE 



239 



13.5 

min. 
diam. 
[mm] 











1 




1 1 1 

material leg. RICHLING о 


+ 












material INBio + 


+ 
+ 


+ 












о 

о 

+ 














- о 

+ 






ф 


+ 








о 






+ 




о 


+ 


- 


+ 




+ 


+ 


4- 


+ 


о + 
+ 


- + 

1 


1 


1 




о 

1 






1 1 1 



400 



600 



800 



1000 elevation [m] leoo 



FIG. 31 . Relation of minor diameter of shell to elevation of locality of different 
populations of Helicina funcki in Costa Rica; sex-independent mean values 
were used. 




height [mm] 



FIG. 32. Range of measurements in females and males exemplary for height 
and minor diameter in the population from Cahuita. 



240 



RICHLING 







1 


1 1 1 1 


female <> 


eight 


Cahuita 






male + 


[g] 










0.3 


- 




+ 


- 


0.25 


- 




+ 

+ 


- 


0.2 

0.15 

0.1 


- 


+ 
+ 
+ 


о о 

+ . ^^ о 
+ + о о 

4.СЧ- ОО О 

+ + о 

+ + ^ + 


о 
о 


0.05 


1 1 


1 


+ 

1 1 1 1 


1 



о 0.1 0.2 0.3 0.4 0.5 0.6 0.7 volume [ml] 0.9 

FIG. 33. Relation of weight to volume in females and males of the population 
of Helicina funcki from Cahuita (material according to Table 3). 



weight 

[g] 



0.15 



1 1 1 


I 1 


I 


female <> 


Manzanillo 






male + 


- 


+ 


+ 


- 


- 


0+ 

+ + + 





■0 










\o- 


+ + 




1 1 1 


1 1 


1 


1 1 



0.1 0.2 0.3 0.4 0.5 0.6 0.7 volume [ml] 0.9 



FIG. 34. Relation of weight to volume in females and males of the population 
of Helicina funcid from Manzanillo (material according to Table 3). 



CLASSIFICATION OF HELICINIDAE 



241 



weight 

[g] 



0.3 







lili 

female <> 


Río Peje 




male + 

о 
+ о 


- 


+ 


+ + ^ о 

+ + 

+ 

о о 

+ о о ' 

+ 
+ 






о 

+ 




1 


1 1 1 1 



0.3 



5 0.6 0.7 volume [ml] о.э 



FIG. 35. Relation of weighit to volume in females and males of the population 
of Helicina funcki from Rio Peje (material according to Table 3). 





I 1 1 


1 1 


1 


1 1 

female <> 


weight 


La Selva 






male + 


[g] 










0.3 


- 






- 






+ 
+ 


+ 




о 
о 


0.25 




+ 
+ 


о 


о 

о 


0.2 


- 




+ 
+ 


о 


0.15 


- 


+ 


+ 


о 


0.1 


'- 






- 


0.05 


1 1 1 


1 1 


1 


1 i 



0.5 0.6 0.7 volume [ml] о.э 



FIG. 36. Relation of weight to volume in females and males of the population 
of Helicina funcki from La Selva (material according to Table 3). 



242 



RICHLING 



weight 

[g] 



0.25 - 



0.2 



0.15 











female <> 


Monteverde 








male + 


- 











- 


- 


+ 
+ 

о + 

+ 
+ 


Oo^ 

Of 

<>■ + 


о 


- 




+ 

+ 


+ 






1 1 1 








1 



0.1 0.2 0.3 0.4 0.5 0.6 0.7 volume [ml] 0.9 

FIG. 37. Relation of weight to volume in females and males of the population 
of Helicina funcki from Monteverde (material according to Table 3). 



weight 

[g] 



0.3 - 



0.25 



0.05 - 



1 


1 1 


-0^ 

0^ 











- 








\-o 0^^ : 









- 




oOo 
A 

o^* 


oO 












* Й л "^0^ о ^ 
0^ о<ЦЖ ox. 
oo of **o 
,Vo%*^ooj4^ ^^- 













" «'o^^^^ ^ I'^^.'^ 
























- 









- 







\ :%»"» \ ' 








1 





1 1 




1 1 1 1 









0.5 0.6 0.7 volume [ml] o.i 



FIG. 38. Relation of weight to volume in adults of Helicina funci<i in Costa Rica 
(all material listed in Table 3 included). 



CLASSIFICATION OF HELICINIDAE 



243 



Considering the problems connected with 
the weight measurements, the data (Fig. 
28) indeed show contrary results even in 
otherwise rather similar populations (e.g., 
upper rows: Rincón de la Vieja to 
Monteverde). When only looking at the bet- 
ter-supported data - namely Monteverde, 
La Selva, Rio Peje, Cahuita, Manzanillo - 
the difference between males and females 
is greater in the population at Monteverde 
than in La Selva, Rio Peje and Manzanillo, 
whereas at Cahuita this relationship is even 
reversed. Taking into account the greater 
size of all females, it seems that in the low- 
land populations the males invest more 
material in their shells than females of the 
same volume do. To test this assumption, 
the relation of weight to volume is plotted 
for these populations (Figs. 33-37). Be- 
cause the mathematical relation between 
weight and volume is unknown and males 
and females fall into a different range, the 
data of all specimens of Helicina funcki 
used in the morphometric analysis were 
plotted as an adjustment for comparison 
(Fig. 38). As expected, the latter measure- 
ments are widely scattered, but a linear 
approximation or a function of greater de- 
gree would better match the data. A higher 
volume should result in a higher weight. 
The Monteverde population clearly demon- 
strates this relation for both sexes (Fig. 37), 
whereas the males of the lowland popula- 
tions on average weigh the same as fe- 
males with a higher volume (Figs. 33-36). 
For other localities, the deviations ex- 
plained above seem to be interposed with 
the actual results. 

Habitat 

Biolley (1897) found the species on the 
trunks of trees, the stems of plantains (Musa) 
and also on the ground. Except for the last 
habitat, these observations could be con- 
firmed during the field work for this study. 
Moreover, Helidna funcki often crawls and 
aestivates on the underside or more seldom 
on the upper side of different kind of leaves. 
The recognized plants belong not only to 
Musaceae, Heliconiaceae, and palms, but 
also to various herbs of the undergrowth. 
Helicina.funcki may even be found on climbing 
species such as the Araceae Monstera spec. 
Probably because of the relatively large size 
of the species, it is found on plant species with 



large leaves. But it lives on trunks, branches 
and twigs of trees, bushes and tree ferns as 
well. Helicina funcki not only crawls on live leaf 
surfaces, it was also found in the dead, dried 
and curled-up leaves, especially those of ba- 
nanas. In areas of human influence speci- 
mens were observed on concrete walls of 
buildings or wooden fences. Thus, H. funcki is 
a typical arboreal species, having been ob- 
served up to 7 m or more above the ground. 
With regards to alimentation, it was definitely 
found feeding on the surface of trunks and on 
living and dead leaves. 

Distribution 

Helicina funcki is confined to southern Central 
America. Although for Nicaragua it has thus far 
only been recorded by Ancey (1897) from 
Greytown at the mouth of the Rio San Juan, 
with a further unspecified lot in the collection of 
the UF and a site somewhere along the south- 
ern border of the Rio San Juan (von Martens, 
1901), the distribution range extends at least 
from southern Nicaragua to the Canal Zone in 
Panama. It most probably occurs in the eastern 
Caribbean lowlands further north in Nicaragua 
as well, because the habitats do not change 
greatly. Furthermore, the wide distribution in 
northern Costa Rica and the morphometric 
data suggest that in this area H. funcki has not 
come close to its distribution limit. 

Due to the lack of literature records for the 
better investigated countries, such as Hondu- 
ras, Guatemala and Belize, and due to the 
absence of H. funcki in the extensive Central 
American collection of the UF (checked per- 
sonally) any occurrences north of Nicaragua 
can be excluded. The relatively large size fur- 
thermore renders the species unlikely to be 
overlooked. The records from Ylalag (Mexico: 
Oaxaca) by Wagner (1910a) therefore seems 
very questionable. 

In Costa Rica, the species is fairly widely 
distributed throughout the Caribbean plain 
and on the mountain slopes (Fig. 39). The dis- 
tribution is mainly influenced by the central 
mountain chains subdividing the country. 
Helicina funcki crosses the northern volcanic 
mountains (Cordillera de Guanacaste and 
Tilarán, Cordillera Central), where the upper 
Pacific slopes are connected to the Caribbean 
side by various valleys between the separate 
volcanoes. According to the present data, the 
species is known to occur up to 1,800 m. A 
limitation by altitude is furthermore supported 



244 



RICHLING 



by the decline of the shell size with increasing 
elevation of the localities. In fact, the southern 
Cordillera de Talamanca, highly elevated as a 
continuous mountain chain (approximately 
3,000 m), forms a clear barrier in the distribu- 
tion of H. funcki. The exact occurrence on the 
Caribbean slope of this Cordillera is known 
only fragmentarily because the area is difficult 
to reach and has not been investigated. Con- 
tinuing downhill towards the northern Pacific 
and in the Valle Central the climate becomes 
drier (Figs. 2, 3), therefore appearing to be the 
most important factor limiting the distribution. 
Except for the most southern Caribbean plain, 
H. funcki does not occur in areas of less than 
2,000 mm annual precipitation. On the more 
humid southern Pacific plains and slopes, H. 
funcki is replaced by H. pitalensis. 

The single record of H. funcki on the 
Peninsula de Osa (INBio 1486976) seems to 
contradict the otherwise continuous distribu- 
tion. Upon request, the data were confirmed 
by INBio. The specimen is small (9.4/12.1/9.5 



mm). There is no reason to question the find- 
ing, despite the fact that several collecting ef- 
forts of INBio up to now have yielded only one 
specimen, because species of Helicinidae are 
extremely rare on Peninsula de Osa. 

Biolley in 1897 reports the species as the 
most common land snail of the country. Nowa- 
days due to the extreme change of the land 
use (e.g., deforestation in large areas), it prob- 
ably will be shown that synanthropic snails like 
Subulina octona (Bruguière, 1789), the intro- 
duced Ovachlamys fuigens (Gude, 1900) 
(Barrientes, 2000) and Succinea costaricana 
von Martens, 1898, the latter known as pest 
species in agriculture (Villalobos et al., 1995), 
are now much more common. 

Discussion 

The differences of IHelicina funcki 
costaricensis to the nominal species men- 
tioned by Wagner (1 91 Oa) can be summarized 
as differences in size and in a more strongly 




FIG. 39. Records of Helicina funcki in Costa Rica. 



CLASSIFICATION OF HELICINIDAE 



245 



developed outer lip. The original description of 
the subspecies does not include any compari- 
son with H. funcki. Astonishingly, Wagner 
(1910a) gives higher dimensions (12-15/15- 
18/12-14 mm) than in his publication in 1905 
(11.0/13.3/11.3 mm), which on one hand 
clearly are exaggerated, on the other hand the 
indeed higher values from specimens from 
San José were most likely included in his 
measurements. The morphometric investiga- 
tions of different populations of H. funcki sug- 
gest that the size depends on environmental 
factors and is not suitable for the separation of 
a subspecies in absence of other differentiat- 
ing characters. The type lots of both the nomi- 
nal form and the subspecies fall in the range 
of the Costa Rican specimens (Fig. 24). 
Helicina funcki reaches maximum sizes in 
lowlands to which the type locality of 14. funcki 
costaricensis belongs. The nominal species is 
described from close to the southern limit of its 
distribution (Fig. 39), which makes it likely that 
environmental conditions of this area are less 
favorable for the species, such as perhaps at 
high elevations, which may result in smaller 
shells. Therefore, H. funcki costaricensis is 
regarded as a synonym of H. funcki. Regard- 
ing the comparably large shells mentioned by 
Wagner (1905, 1910a) (checked: MIZ 8990: 2 
ads.: 13.4/16.0/13.2 mm; 13.9/15.7/12.9 mm) 
from San José, the locality given without com- 
ment is misleading, because one would imme- 
diately think of San José, capital of Costa Rica 
(in the historical times of Wagner a possible 
locality). But considering the relation of shell 
size to elevation of the locality (Fig. 31), the 
site appears to be in contradiction to the shell 
size because San José is located at about an 
altitude of 1,160 m. Biolley (1897) reported a 
small form of H. funcki from Cartago (close to 
San José, at a similar elevation). A closer ex- 
amination of the map of Costa Rica reveals a 
second San José in the Alajuela Province, 
close to Santa Clara, which is here suggested 
to be the locality "San José". It also supports 
the localization of "Santa Clara". Under H. 
funcki costaricensis, Wagner (1910a) men- 
tions a somewhat dubious form from Ylalag, 
Mexico in his collection, which is said to be 
more elevated and remarkably angulated at 
the periphery. It could not be checked and 
therefore cannot be discussed any further, 
especially because of ihe outstanding locality 
for Helicina funcki. 

The description of ¡Helicina deppeana 
parvidens has to be discussed in the context 



of material in the ZMB, Helicina deppeana von 
Martens, 1863, was described from Mexico 
(locality unknown) and was figured later (von 
Martens, 1865, 1890) together with a variety 
from Yalalag (State of Oaxaca, Mexico). The 
study of the original material of the figures 
stored in the ZMB revealed the following: the 
typical /-/. deppeana (syntypes ZMB 4571 ) are 
not conspecific with H. funcki, for example, 
they do not have the typical ornamentation of 
lighter patches, and are more solid and 
unicolored. The specimens of the variety from 
Yalalag (ZMB 1743) look exactly like speci- 
mens of H. funcki and thus are specifically dif- 
ferent from H. deppeana, an observation 
already remarked on the label by Wagner: 
"nach meiner Ansicht stellen die vorliegenden 
Exemplare nur Helicina funcki dar" [= in my 
opinion the specimens only represent H. 
funcki]. Interestingly, Wagner (1910a) com- 
pletely avoids any comment on this in his 
monograph, although it is certain that he had 
seen the collection prior to his publication, 
because various types of newly described 
species (e.g., H. pitalensis, H. tenuis pittieri) 
are in the ZMB collection. The singular Mexi- 
can locality of H. funcki is discussed in the 
paragraph "Distribution". Returning to H. 
deppeana parvidens, it is very likely that when 
Pilsbry (1920a) published his work on Costa 
Rican land molluscs, he used the Biología 
Centrali-Americana (von Martens, 1890- 
1901), representing the only comprehensive 
contribution for the area even today. It there- 
fore appears probable that Pilsbry was misled 
by this figure and classified part of his Costa 
Rican material of H. funcki as a new subspe- 
cies of the Mexican /-/. deppeana. 

Helicina [Tristramia) pitalensis 
Wagner, 1910 

Helicina funcki -yon Martens, 1900: 603-604: 
Costa Rica: SW-Costa Rica: Bay of Torraba 
[mouth of Rio Terraba, about 09°00'N, 
83°36'W, Puntarenas Province], Tocori in the 
valley of the Rio Paquita [NE of Quepos, 
canton Aguirre, 09°29'43"N, 84°04'52"W, 10 
m a. s. I., Puntarenas Province], middle part 
of the Rio Saveque [now: Rio Savegre, 
about 09°29'N, 83°56'W, San José Prov- 
ince] and lower part of the Rio Pacuare [now 
Rio Pacuar south of San Isidro de Et Gen- 
eral [not Rio Pacuare on Atlantic slope!], 
about 09°16'N, 83°39'W, San José Prov- 
ince] (Pittier); El Pital, in the valley of the Rio 



246 



RICHLING 



Naranjo [near Londres? (about 09°27'N, 
84°05'W, Puntarenas Province], some 
specimens banded and others more el- 
evated (Pittier) [in part] [non L. Pfeiffer, 1849] 

Helicina pitalensis\Nagner, 1910a: 308, pi. 61, 
figs. 17-19 

Helicina amoena - Monge-Nájera, 1997: 113: 
Costa Rica [non L. Pfeiffer, 1 849] 

Original Description 

"Gehäuse kegelförmig mit gewölbter Basis, 
festschalig, leicht glänzend, zitrongelb mit 
undeutlichen weissen Flecken und Punkten, 
sowie einer schmalen rotbraunen Binde über 
der Naht und dem Kiel. Die Skulptur besteht 
aus feinen, etwas ungleichmässigen Zu- 
wachsstreifen, auch erscheint die Epidermis 
unter der Lupe sehr fein gerunzelt. Das 
regelmässig spitzkegelförmige Gewinde 
besteht aus S-SV^ leicht gewölbten, langsam 
zunehmenden Umgängen, welche durch eine 
hell berandete, schwach eingedrückte Naht 
geschieden werden; der letzte ist beiderseits 
gleichmässig gewölbt, an der Peripherie 
deutlich kantig bis stumpf gekielt und steigt 
vorne nicht herab (unmittelbar vor der 
Mündung ein wenig hinauf). Die abgerundet 
dreieckige Mündung ist schief, innen gelb mit 
durchscheinender Binde. Der leicht ver- 
dickte, gelbliche Mundsaum erweitert; der 
Oberrand schmal und an der Insertion 
vorgezogen, der Aussen- und Basalrand breit 
umgeschlagen. Die kurze, abgerundete 
Spindel ist senkrecht oder leicht nach links 
gebogen; am Uebergange derselben in den 
Basalrand der Mündung eine zahnartig 
vorspringende Ecke. Der sehr dünne, fein- 
gekörnelte Basalkallus nur im Umkreise der 



Spindel deutlich. Das Grübchen in der 

Nabelgegend undeutlich. 

D = 14, d = 11,5, H = 13,5 mm. 

Deckel birnförmig mit seitlich gekrümter [sie] 

Spitze schwarzbraun bis pechschwarz mit 

lichterem Streifen entlang der Sigmakante; die 

dünne, feingekörnelte Kalkplatte nur am 

Spindelrande etwas leistenartig verdickt; in 

den übrigen Verhältnissen typisch. 

Fundort: El Pital im Tale des Rio Naranjo im 
südwestlichen Costarica. Da abgebildete Ex- 
emplar im k. Museum zu Berlin. 

Von der ähnlichen Helicina funcki Pfeiffer 
unterscheidet sich vorstehende neue Art 
durch die lebhafte Färbung mit deutlicher 
Binde, die glänzende Oberfläche mit deut- 
licheren Zuwachsstreifen, das höhere 
Gewinde mit deutlich gewölbten langsam und 
regelmässig zunehmenden Umgängen, den 
weniger erweiterten, aber deutlich kantigen 
bis stumpfgekielten letzten Umgang, sowie 
besonders die abweichenden Verhältnisse der 
Mündung und des Mundsaumes." 

Type Material 

ZMB 103240 "El Pital, 200 m, 111.1893, 
Vallée du Rio Naranjo, leg. Madame Pittier de 
Fahega" (the lot contains one specimen) 
Because the original description refers to one 
specimen in the ZMB which matches the fig- 
ure, it is the holotype (Fig. 40). 
Dimensions: 
Holotype: 13.0/12.5/14.0/11.2/9.1/10.6/10.0 mm 

Type Locality 

"El Pital im Tale des Rio Naranjo im 
südwestlichen Costarica"; El Pital could not be 




FIG. 40. Helicina pitalensis, holotype, ZMB 103240, height 13.0 mm; scale bar 5 mm. 



CLASSIFICATION OF HELICINIDAE 



247 



localized on recent detailed maps. The Rio 
Naranjo leads into the Pacific Ocean at the 
southern border of the Parque Nacional de 
Manuel Antonio, a little south of Quepos. By 
the elevation given in the data remaining with 
the original material, the type locality can be 
assumed to be located near Londres [about 
09°27'N, 84°05'W], Puntarenas Province. 

Examined Material 

Leg. I. RicHLiNG 

Puntarenas: S San Vito, Wilson Botanical 
Garden, Las Cruces, sendero a Rio Jaba, 
08M6'57"N, 82°57'40"W, 1,160 m a. s. I., 
27.08.1999: (IR 1013); 28.08.1999: (IR 
1016) 

N Neily, road from Ciudad Neily to San Vito, 
open area with a few trees, 08°40'23"N, 
82°56'44"W, 180 m a. s. I., N Neily, 
23.03.1997: (IR 209) 

Fila de Cal, road from Ciudad Neily to San 
Vito, S Campo Dos, burned area, 
08°41'00"N, 82°56'29"W, 630 m a. s.!., 
23.03.1997: (IR 191) 

Fila Costeña, north of Bajo Bonito (locally 
called Llano Bonito), N of Rio Claro, rain for- 
est, 08°44'41"N, 83°02'09"W, 980 m a. s. I., 
24.03.1997: (IR 221); 15.02.1999: (IR 579); 
29.08.1999: (IR 1028); 06.03.2001: (IR 
1485) 

INBio Collection 

Puntarenas: Parque Nacional Corcovado: 
Estación Sirena, 08° 28' 52" N, 83°35'32"W. 
5 m a.s.l.: leg. Mario Chinchilla, 
23.03.1995: 1 juv. (INBio 1485050); 
Sendero los Espaveles, Sirena, 
08°28'49"N, 83°35'42"W, O m a.s.l.: leg. 
Annia Picado, 25.03.1995: 1 ad. (INBio 
1482837); 1 ad. (INBio 1482842); Sendero 
Espaveles, 08°29'05"N, 83°35'29"W, O m 
a.s.l.: leg. Socorro Avila, 23.03.1995: 1 ad. 
(INBio 1482627); Sendero Espaveles, 
08°29'22"N, 83°35'14"W, O m a.s.l.: leg. 
Billen Gamboa R., 03.12.1995: 1 ad. (INBio 
1485173); Estación Sirena, Sendero Las 
Ollas, 08°28'47"N, 83°35'40"W, 5 m a.s.l.: 
leg. Alejandro Azofeifa, 25.03.1995: 1 juv. 
(INBio 1484670); Estación Sirena, Sendero 
Las Ollas, 08°28'57"N, 83°35'20"W, 20 m 
a.s.l.: leg. Francisco Alvarado, 25.03.1995: 
1 s.ad. (INBio 1484221); Sendero los 
Patos, 3.5 km al N. de la Estación Sirena, 
08°30'46"N, 83°35'56"W, O m a.s.l.: leg. 
Ramon Ángulo, 26.08.1994: 1 juv. (INBio 



1480506); Rio Pavo, 08°30'51"N, 
83°35'44"W, 20 m a.s.l.: leg. M. Madrigal, 
03.04.1996: 2 ads. (INBio 3542542) 
Reserva Forestal Golfo Dulce: Cerro La 
Torre, Finca La Purruja, 08°32'04"N, 
83°25'53"W, 400 m a.s.l.: leg. Javier 
Quesada, 05.05.1994: 1 s.ad. (INBio 
1477485); Agujas, alrededores de la 
estación, 08°32'13"N, 83°25'33"W, 300 m 
a.s.l.: leg. A. Berrocal, 01.11.1998: 1 ad. 
(INBio 3397130) 

Fila Cal: 24 km de San Vito hacia Ciudad 
Neilly, 08°41'36"N, 82°56'36"W, 780 m 
a.s.l.: 29.08.1995: 1 ad. (INBio 1485456); 
29.08.1995: 1 s.ad., 1 juv. (INBio 3121204) 
(all leg. Marianella Segura); 24.5 km S en 
la carretera de San Vito hacia Ciudad 
Neilly, 0840'55"N, 82°56'23"W, 600 m 
a.s.l.: leg. Zaidett Barrientes, 21.11.1995: 1 
juv. (INBio 1485120) 

4.5 km NW de Ciudad Neily, Camino 
Paralelo al Rio Caño Seco, Colectado en 
hojarasca en heléchos, 08°40'50"N, 
82°57'25"W, 180 m a.s.l.: leg. M. Chinchilla, 
22.11.1995: 1 ad. (INBio 3542525) 
Linda Vista, Rio Claro: 3 km NE de la 
Escuela de Llano Bonito, 08°44'54"N, 
83°02'04"W: 920 m a.s.l., leg. Socorro 
Avila, 24.03.1997: 1 s.ad., 1 juv. (INBio 
1494393); 950 m a.s.l., leg. Alexander 
Alvarado Méndez, 15.02.1999: 1 s.ad., 1 
juv. (INBio 3091134) 

Other Sources 

COSTA RICA 

Alajuela: La Paz, Chemin du rivière Sarapiqui 
[not localized, near Isla Bonita?, about 
10°15'30"N, 84°11'W], Biolley, ex Godet, 
12.1892 received: 1 ad. (ZMB 45501) 

Description 

Shell (Fig. 335D-E): Conical-subglobose, 
solid, relatively large, slightly shiny to dull. 
Color: basic color lemon yellow, sometimes 
less bright, with slender reddish-brown band 
between sutures or suture and the periphery 
respectively, in some specimens very light or 
obsolete. On account of this band, the upper 
whorls may appear darker. The periphery is 
always lighter. As in Helicina funcki, the color 
is overlapped by fine white patches and lines 
giving the shell a special ornamentation. 
Surface textured with fine, irregular growth 
lines and oblique grooves of different indi- 
vidual orientation but of same general direc- 



248 



RICHLING 




FIG. 41. Axial cleft and muscle attachments of 
Helicina pitalensis, IR 579; scale bar 5 mm. 





FIG. 43. Embryonic shell of Helicina pitalensis; 
scale bar 100 |jm. 

tion (Fig. 42), causing the dull appearance. 
Embryonic shell with about 1 whorl; 4Vg-4^/g 
subsequent whorls slightly convex; periph- 
ery remarkably angulated; whorls equally 
extending in size and slightly descending, 
only towards aperture slightly ascending; 
spire very regular. Suture slightly impressed 
and marginally lighter in color. Aperture ob- 
lique and nearly straight, inserting a little 
above periphery. Outer lip yellowish-whitish, 
very thickened, broadly expanded, only in 
the upper palatal part a little less strongly 
developed. Reflection nearly rectangular to 




FIG. 42. Teleoconch surface structure of 
Helicina pitalensis. A. On 2"^^ whorl. B. On 
4'" whorl; scale bar 100 |jm. 



FIG. 44. Operculum of Helicina pitalensis, IR 
579; scale bar 2.5 mm. 



CLASSIFICATION OF HELICINIDAE 



249 



the whorl; transition to columella with a re- 
markably protruding denticle. Columella 
short, slightly curved, umbilical area without 
any groove or impressed line. Basal callus 
only close to columella present, thin, slightly 
granulated. 




Juveniles are roundly angulated, and in 
some cases a few rows of periostracal hairs 
are present at the periphery. 

Internal Shell Structures: (Fig. 41) 

Teleoconch Surface Structure (Fig. 42): The 
transitional structure is developed, but as in 
Helicina funckithe pattern of oblique diverg- 
ing grooves continues up to the aperture. In 
the shell illustrated, the grooves remain finer 
than in H. funcki (see 4"^ whorl), but this as- 
pect is subject to individual variation. 

Embryonic Shell (Fig. 43): The embryonic 
shell of Helicina pitalensis is very similar to 
that of Helicina funcki. The specimens mea- 
sured came from altitudes of nearly 1 ,000 m. 
In comparison with the H. funcki-popu\a- 
tions, the intermediate size therefore sug- 
gests equal dimensions, assuming a similar 
dependence on altitude. 
Diameter: 1,089 pm (± 23) (1,040-1,150) 
(n = 10) (IR 579, IR 1013, IR 1028, IR 1485). 

Operculum (Fig. 44): Slightly calcified, calcar- 
eous plate leaving a free margin, thickened 
towards columellar side. Color dark reddish- 
brown to even black, only non-calcified mar- 
gin transparent. Columellar side regularly 
S-shaped, upper end acute and pointed, 
lower end well rounded. 

Animal (Fig. 337C): Only specimens that were 
very similarly colored from Bajo Bonito were 
studied. The foot is whitish-yellowish 




FIG. 45. Radula of Helicina pitalensis. A. 
Centrals. B. Comb-lateral. С Marginals; 
scale bars 50 |jm (A, B), 100 pm (C). 



FIG. 46. Female reproductive system of Helicina 
pitalensis, apical complex enlarged, IR 579; 
scale bars 2 mm (left), 1 mm (right). 



250 



RICHLING 



Bajo Bonito (n=2/3) 



Itl 



Rio Naranjo (type) 



=//= 



San Vito (n=3) 



=/t 



Fila de Cal (n=4) 



=ít 



Bajo Bonito, all (n=8 



=//= 



Peninsula de Osa (n=6) 



O 8 9 10 11 12 13 [mm] 14 

FIG. 47. Shell height of different populations of 
Helicina pitalensis in Costa Rica, according to 
Table 5; on each line: mean value, standard 
deviation, absolute range; number of individuals 
given as "n = females/males or total"; upper line: 
females, lower line: males if separate; in 
between and shaded: average of both for 
comparison with populations of unknown sex. 



throughout, the head region, especially 
around the black eyes and occasionally the 
upper part of the snout, is distinctly white. 
The tentacles become gradually darker to- 
wards their tips. The mantle has a whitish 
pigmentation. 

Radula (Fig. 45): Only two specimens were 
Investigated. The cusps on the A- and C- 
central are vestigial, only the B-central bears 
5 to 9 cusps. Comb-lateral with 6-8 cusps, 
cusps on marginals slowly increasing in 
number. Radula with about 95-99 rows of 
teeth. 

Female Reproductive System (Fig. 46): Only 
three female specimens were available for 
dissection. The palliai reproductive system 
closely resembles that of Helicina funcki. 

Bajo Bonito (n=2/3) 



:/C 



Rio Naranjo (type) 



=/t 



San Vito (n=3) 



=it:: 



Fila de Cal (n=4) 



=11= 



Bajo Bonito, all (n=8) 



::íl= 



Peninsula de Osa (n=6) 



=//= 



O 8 9 10 11 12 13 [mm] 14 

FIG. 48. Minor diameter of shell of different 
populations of Helicina pitalensis in Costa Rica 
according to Table 5; for explanations see Fig. 47. 



The bursa copulatrix differs In that it Is as 
elongated as the whole organ, and the lobes 
project from a central axis and are much 
shorter, similar to those in the other species, 
although they are occasionally further subdi- 
vided. The provaglnal sac seems to be 
smaller than in Helicina funcki. 

Morphometry and Sexual Dimorphism 

Despite the number of lots of Helicina 
pitalensis, the material for morphometric 
analysis is scant because of a high proportion 
of juvenile shells. 

Individuals from the lowlands of the 
Peninsula de Osa differed from the typical 
specimens in having a more prominent aper- 
ture. The few individual records summarized 
as "Peninsula de Osa" originate from the 
same region near Estación Sirena and were 
compared to populations from "San Vito", 
"Bajo Bonito" and "Fila de Cal", which are lo- 
cated close to each other in the mountainous 
country on the southern Pacific side (Fig. 52). 
The only specimens whose sex was deter- 
mined belong to the population of Bajo Bonito. 
Any comparisons in this species can only hint 
at possible tendencies because of the scanty 
data. 

Morphometry: The different populations show 
remarkably little differences in their minor 
diameter (Table 5, Fig. 48), which therefore 
provides a good reference for the pattern of 
differences among the populations for other 
measurements (Figs. 47, 49-51). The popu- 
lation "Peninsula de Osa" displays the high- 
est deviations; the shells are relatively less 
elevated in every respect (height, height of 
last whorl and columellar axis), but the aper- 
ture and outer lip is much more expanded. 
This confirms the observations noted above 
(Fig. 52). In general, the "Bajo Bonito" popu- 
lation best matches the type in proportions 
and size. This excludes a correlation of the 
differing shell shape of the "Peninsula de 
Osa" specimens to the altitude, because the 
type lot also originates from lowlands (200 
m) whereas the other sites are located at 
700 to 1 ,160 m (San Vito). Thus, the special 
shell shape of the population "Peninsula de 
Osa" seems to be a local peculiarity. Fur- 
thermore, current data do not support a cor- 
relation of shell size and altitude as for 
Helicina funcki. 



CLASSIFICATION OF HELICINIDAE 



251 



TABLE 5. Measurements of different populations of Helicina pitalensis given as mean value with 
standard deviation, minimum and maximum value (min, max), and number of specimens; only 
population in last column separated in females and males, these individuals are also included in "Bajo 
Bonito, all" (min./max. diam. = minor/major diameter, col. axis = columellar axis); linear measurements 
[mm], weight [g], volume [ml]. 



"San Vito" (altitude 1160 m) 
lots IR 1016 



"Fila de Cal" (altitude 600-780 m) 

lots IR 191, 209, INBio 1485456, INBio 

3542525 





Mean 










Mean 












value 


Deviation 


Min 


Max 


Number 


value 


Deviation 


Min 


Max 


Number 


Height 


12.48 


0.47 


11.78 


12.89 


3 


12.12 


0.30 


11.75 


12.72 


4 


Maj. diam. 


12.34 


0.37 


11.78 


12.65 


3 


12.31 


0.19 


11.96 


12.58 


4 


Min. diam. 


11.04 


0.34 


10.53 


11.31 


3 


11.13 


0.30 


10.81 


11.60 


4 


Outer lip 


8.46 


0.08 


8.39 


8.58 


3 


8.48 


0.27 


7.93 


8.82 


4 


Last whorl 


1002 


0.31 


9.56 


10.33 


3 


9.84 


0.25 


9.36 


10.14 


4 


Col. axis 


945 


0.40 


8.85 


9.79 


3 


9.39 


0.48 


8.91 


9.88 


4 





"Bajo Bonito, all" (altitude 920-980 m) 
lots IR 221, IR 579, IR 1028, IR 1485 



"Peninsula de Osa" (altitude 0-20 m) 
lots INBio 3542542, INBio 1482627, INBio 
1482837, INBio 1482842, INBio 1485173 





Mean 








Mean 












value Deviation 


1 M 


in Max 


Number value Deviation 


Min 


Max 


Number 


Height 


12.64 0.45 


11.96 13.70 


8 


11,69 


0.50 


10.78 


12.44 


6 


Maj. diam. 


12.49 0.33 


12.07 13.12 


8 


11.95 


0.43 


11.30 


1262 


6 


Min. diam. 


11.13 0.27 


10.33 11.66 


8 


10.93 


0.40 


10.35 


11.54 


6 


Outer lip 


8.51 0.27 


7.85 9.08 


8 




8.78 


0.42 


8.25 


9.25 


6 


Last whorl 


10.21 0.29 


9.68 10.78 


8 




9.77 


0.39 


9.27 


10.30 


6 


Col. axis 


9.50 0.33 


8.75 10.48 


8 




8.89 


0.52 


7.91 


9.67 


6 


















- 












"Baje 


) Bonito" (altitude 980 t 


n) 










lots IR 579, 


IR 1028, IR 1485 


- 










Mean 
















Sex 


value Deviation 


Min 


Max 


Numbe 


r 








Height 


f 


13.26 


0.44 


12.82 


13.70 


2 






Height 


m 


12.41 


0.16 


12.29 


12.65 


3 










Maj. diam. 


f 


13.09 


0.04 


13.05 


13.12 


2 










Maj. diam. 


m 


12.34 


0.19 


12.17 


12.63 


3 










Min. diam 


f 


11.64 


0.02 


11.62 


11.66 


2 










Min. diam. 


m 


11.08 


0.07 


10.98 


11.18 


3 










Outer lip 


f 


8.81 


0.28 


8.53 


9.08 


2 










Outer lip 


m 


8.61 


0.18 


8.35 


8.88 


3 










Last whorl 


f 


10.67 


0.12 


10.55 


10.78 


2 










Last whorl 


m 


10.21 


0.15 


10.07 


10.43 


3 










Col. axis 


f 


9.95 


0.53 


9.42 


10.48 


2 










Col. axis 


m 


9.43 


0.10 


9.27 


9.54 


3 










Weight 


f 


0.074 1 


0.000 


0.Ü74 


0.074 


1 










Weight 


m 


0.121 1 


0.024 


0.091 


0.156 


3 










Volume 


f 


0.603 1 


0.000 


0.603 


0.603 


1 










Volume 


m 


0.507 1 


0.027 


0.476 


0.547 


3 









252 



RICHLING 



Bajo Bonito {n=2/3) 



:Jli 



Rio Naranjo (type) 



=/t 



San Vito (n=3) 



=^/= 



Fila de Cal (n=4) 



=//= 



Bajo Bonito, ai! (n=8) 



=//= 



Peninsula de Osa (n=6) 



=//= 



10 [mm] 11 



Bajo Bonito {n=2/3) 



^L 



Rio Naranjo (type) 



=/t 



San Vito (n=3) 



^1^ 



Fila de Cal (n=4) 



=/t 



Bajo Bonito, all (n=8) 



=/t 



Peninsula de Osa (n=6) 



=//= 



10 [mm] 11 



FIG. 49. Expansion of outer lip of different 
populations of Helicina pitalensis in Costa Rica 
according to Table 5; for explanations see Fig. 47. 



FIG. 51. Height of columellar axis of different 
populations of Helicina pitalensis in Costa Rica 
according to Table 5; for explanations see Fig. 47. 



Sexual Dimorphism: Although not weW sup- 
ported, the data for only two females and 
three males (Table 5, Figs. 47 51, upper 
row) suggest that females are bigger. The 
clear differences between both sexes for 
height, minor diameter, and height of last 
whorl may be only a coincidence. 

Habitat 

My live material came from two localities, 
near Bajo Bonito and near San Vito. They are 
characterized by steep mountain forests, prob- 
ably primary rain forests, the first bordered by 
secondary growth and small manually tended 
agricultural areas. Helicina pitalensis lives in 
arboreal environments mainly on the underside 
of leaves of palms and Heliconiaceae. It was 
also found in the dried and curled-up leaves of 
abandoned banana trees. It thus has a very 
similar habitat as H. funcki. 

Distribution (Fig. 53) 

According to the relatively few records, 
Helicina pitalensis Is confined to the southern 



Bajo Bonito (n=2/3) 



7/: 



Rio Naranjo (type) 



=it 



San Vito (n=3) 



=//= 



Fila de Cal (n=4) 



=/t 



Bajo Bonito, all (n=8) 



=//= 



Peninsula de Osa (n=6) 



=/t 



FIG. 50. Height of last whorl of different 
populations of Helicina pitalensis in Costa Rica 
according to Table 5; for explanations see Fig. 47. 



Pacific slopes and coastal lowlands in Costa 
Rica. On the Peninsula de Osa and in the Fila 
de Cruces it is found at various localities. 
From the area around the type locality and the 
connecting area to the southern localities 
there are no recent records. This may be ex- 
plained by lack of investigations in these areas 
and the relatively low abundance of the spe- 
cies on one hand, and the fact that the Pacific 
plains were transformed into agricultural plan- 
tations to a large extent starting in the 1950s. 

The records of Pittier date back to the end of 
the 19"" century when the areas where largely 
unexplored and under closed forest cover. 
Assuming that the interpretation of the records 
listed in von Martens (1900) is correct, H. 
pitalensis at least was well distributed over the 
area of the southern Pacific plain, replacing H. 
funcki in this region. In the Fila Cruces area 
and on Peninsula de Osa, H. pitalensis is 
found sympatrically with H. talamancensis. 

A typical specimen (ZMB 45501) of H. 
pitalensis is labeled as originating from La 
Paz, a location at the Rio Sarapiqui north of 
the Cordillera Central on the Caribbean slope. 
This location seems to contradict the assumed 
distribution. Pending better knowledge, it Is 
considered here to be erroneous. 

Discussion 

The species most resembles Helicina funcki, 
which is of about equal size and shows the 
same shell ornamentation. Helicina pitalensis 
is relatively higher and has more convex 
whorls. All specimens of H. funcki studied 
show neither banding nor the distinct angula- 
tion of the periphery. The strong denticle at the 
transition of the basal outer lip to the columella 
is characteristic for H. pitalensis, whereas it 
lacks the groove or angulation in the transition 
from the columella into the body whorl. Fur- 



CLASSIFICATION OF HELICINIDAE 



253 




FIG. 52. Variations in Costa Rican Helicina pitalensis: shell height in figures reflects 
the nnean value (enlarged), each shell originates from the respective locality. 




FIG. 53. Records of Helicina pitalensis in Costa Rica. 



254 



RICHLING 



thermore, the soft body color differs and is 
constantly lighter in H. pitalensis. 

The interpretation of the additional records 
of H. funcki listed in von Martens (1900) in 
SW-Costa Rica is difficult, because one of 
these locations became the type locality of H. 
pitalensis with description of this species by 
Wagner. Von Martens (1900) remarked: 
"some specimens banded and others more 
elevated", obviously for the specimens from El 
Pital. As here, Wagner saw only the holotype 
from the ZMB. If the remark of von Martens 
(1900) also referred to the specimens from the 
other locations, it would render their identifica- 
tion as /-/. pitalensis very likely. Although other 
material of Pittier is kept in the ZMB or the 
MHNN respectively, these lots could, unfortu- 
nately, not be found in either of the collections 
and thus could not be verified. According to 
personal information of Zaidett Barrientes 
(INBio), those parts of the historical collections 
in Costa Rica in the Museo Nacional in San 
José could not yet be found when she 
searched for this material. The museum had 
passed through several crises and the where- 
abouts of the material is uncertain. Regarding 
the fact that, according to the present data, H. 
funcki and H. pitalensis do not occur sympat- 
rically and the latter species has not been re- 
corded from the southern Pacific plain (except 
the one doubtful record from the Peninsula de 
Osa, see: under H. funcki) and the question- 
able interpretation of von Martens' remark, it 
seems more appropriate, until better knowl- 
edge comes along, to refer the records from 
"Bay of Terraba, Tocori in the valley of the Rio 
Paquita, middle part of the Rio Saveque and 
lower part of the Rio Pacuare (Pittier)" also to 
H. pitalensis. 

The record of Helicina amoena L. Pfeiffer, 
1849, for Costa Rica by Monge-Nájera (1997) 
was based on the material in the INBio collec- 
tion. The subsequent revision of the material 
revealed one lot of H. amoena (INBio 14851 73) 
collected and determined before 1997, on the 
basis of which the publication must have been 
based. This specimen can clearly be referred to 
H. pitalensis in its typical form from the 
Peninsula de Osa. Helicina amoena is distin- 
guished from H. pitalensis by its less elevated 
shell, which is more strongly angulated at the 
periphery and marked with distinct spiral stria- 
tions. The color is also different. Except for one 
doubtful record from Panama by von Martens 
(1890) {"Helicina amoena var. b" from Cham- 



pion) H. amoena has not yet been reported 
south of the Mosquito Coast of Nicaragua 
(Fluck, 1906: Mosquito Coast: NW Kukallaya, 
Wounta River; Jacobson, 1968: Bonanza). The 
original material of this doubtful record was 
assumed to be in the collection of the ZMB, as 
is other material of Champion, but it remains 
lost, although it was also searched for under 
other possible designations. It was later cited 
by Pilsbry (1910, 1926a), but who claimed not 
to have seen the specimen. 

All recent records of H. pitalensis refer more 
to the south than the type locality. The speci- 
mens from the area of the Fila Cruces (Linda 
Vista, Fila Cal, San Vito) at higher altitudes 
(about 6001,000 m) are very similar to the 
type material. Only the basic lemon-yellow 
color is sometimes replaced by light orange- 
brownish. Specimens from the Peninsula de 
Osa sometimes lack the band and show cer- 
tain deviations in shape and a stronger infla- 
tion of the whorls immediately below the 
suture. But because other characteristics do 
not differ (e.g., color, development of columel- 
lar region, protruding denticle at the transition 
of outer lip to columella, roundly angulated pe- 
riphery) and adult material from other loca- 
tions on the Peninsula de Osa is not available, 
a separation of this form is not yet warranted. 

Helicina (Tristramia) tenuis 
L. Pfeiffer, 1849 

Helicina tenuis L. Pfeiffer, 1849: 124-125 (not 

figured) 
Helicina vernalis Morelet, 1849: 20 (not fig- 
ured) 
Helicina tenuis - L. Pfeiffer, 1850: 40, pi. 7, 

figs. 33, 34 
Helicina tenuis - L. Pfeiffer, 1852a: 372 
Helicina vernalis - L. Pfeiffer, 1852a: 372 
Helicina tenuis - L. Pfeiffer, 1852b: 269 
Helicina vernalis -L. Pfeiffer, 1852b: 269-270 
Helicina vernalis -L. Pfeiffer, 1853: 71, pi. 10, 

figs. 12-14 
Helicina chiapensis L. Pfeiffer, 1856: 237 (not 

figured); 1857: 380 (not figured) 
7Helicina lindeni - Tristram, 1862: 5: Guate- 
mala: neighbourhood of Dueñas [according 
to Tristram, 1864] (Salvin) [non L. Pfeiffer, 
1849] 
7Helicina lindeni - Sowerby, 1866: 288, pi. 

272, figs. 258260 [non L. Pfeiffer, 1849] 
Helicina chiapensis - Sowerby, 1866: 288, pi. 
272, figs. 255-257 



CLASSIFICATION OF HELICINIDAE 



255 



Helicina vernalis - Sowerby, 1866: 288, pl. 
273, fig. 273 

Helicina tenuis - Bland, 1866: 9 

Helicina vernalis - Bland, 1866: 9 

Helicina chiapensis - Bland, 1866: 9 

Helicina vernalis - Reeve, 1874: pl. 18, flg. 
156 

Helicina chiappensis [sie] Reeve, 1874: pl. 
13, fig. 110 

Helicina vernalis - von Martens, 1875: 649: 
Guatennala: Coban, Vera Paz 

Helicina vernalis - von Martens, 1876: 259: 
Guatemala: Coban 

Helicina lindeni - Angas, 1879: 484: Costa 
Rica [non L. Pfeiffer, 1849] 

7Helicina lindeni var. minor - Ancey, 1886: 
258-259: Honduras, Atlantic coast (smaller 
specimens) 

Helicina tenuis von Martens, 1890: 34-35: 
Central Mexico: Sayula in Jalisco, Irapuato 
near Guantajuoto; E-Mexico: Soledad, be- 
tween Cordova and Orizaba; SE-Mexico: 
Chiapas; Teapa and San Juan Bautista in 
Tabasco, Tapinapa; Yucatan; N-Guatamala: 
Peten Province; Cubilguitz, valley of the 
River de la Pasión; Coban; San Gerónimo 
and the neighbouring mountains in Vera 
Paz; Panzos; Chacoj; San Juan (all in the 
valley of the Polochic River); Purula; S-Gua- 
temala: Totonicapam mountains 8,500 to 
10,500 feet (small variety); El Reposo 800 
feet; Las Mercedes 3,000 feet; Cerro Zunil 
4,000 feet; San Isidro 1,600 feet, all on Pa- 
cific slope; Zapote, on the slope of the 
Volcan de Fuego; Nicaragua: Toro Rapids?; 
Costa Rica 

Helicina tenuis var. chiapensis - Pilsbry, 1892: 
339: Mexico: Tabasco: Poana (Rovirosa) 

Helicina (Oligyra) lindeni - Fischer & Crosse, 
1893: 416-420, pl. LVI, figs. 1-3: same data 
as von Martens (1890) [non L. Pfeiffer, 1849] 

Helicina tenuis - Biolley, 1897: 5: Costa Rica: 
Turrubares, 200 m [San Pablo de 
Turrubares, about 09°55'N, 84°27'W, San 
José Province] and La Paz, 900 m, en el 
camino del Sarapiqui [along the River 
Sarapiqui] [not exactly localized, near Isla 
Bonita?, about 10°15'30"N, 84°11'W, 
Alajuela Province] 

Helicina tenuis - von Martens, 1900: 604: SE- 
Mexico: Poana, Tabasco; Honduras: East 
Coast - smaller spec; NE-Costa Rica: La 
Paz , on the road to the Rio Sarapiqui 
Sarapiqui [not localized, near Isla Bonita?, 
about 10°15'30"N, 84°11'W, Alajuela Prov- 
ince] (Biolley); Central Costa Rica: Alajuela, 



900-1 ,000 m [town or province?, town about 
10°0r30"N, 84°13'W] (Orosco), SW-Costa 
Rica: Turubares, 200 m [San Pablo de 
Turrubares, about 09°55'N, 84°27'\/V, San 
José Province] (Biolley); along the Rio de 
los Platanales and the Golfo Dulce [correct: 
Río de los Platanares, S of Puerto Jiménez, 
Península de Osa, about 08°3r30"N, 
83°18'W, Puntarenas Province] (Pittier) 

Helicina vernalis - Wagner, 1905: 233-234, 
pl. Xlli, fig. 13a-c: Guatemala: Petén; 
Verapaz: Rio Polochic 

Helicina vernalis verapazens/s Wagner, 1905: 
234, pl. XIII, fig. 14: Guatemala: Verapaz 

Helicina tenuis pittieri \Nagner, 1910a: 303- 
304, pl. 60, fig. 24 

Helicina tenuis -Wagner, 1910a: 302-303, pl. 
60, figs. 15-23, 25: S-Mexico to Panama: 
Mexico: Tabasco and Chiapas; Guatemala: 
Coban, Totonicapan, St. Isidoro, Río 
Polochic, Mercedes and Vera Paz; Costa 
Rica: Turrubares [San Pablo de Turrubares, 
about 09°55'N, 84°27'W, San José Prov- 
ince] and Alajuela [town or province?, town 
about 10°0r30"N, 84°13'W] 

Helicina tenuis yar. lindeni - Hinkley, 1920: 49, 
52: Guatemala: Jocolo plantation on north 
side of Lake Isabal; Alta Verapaz: Chama 
between Rio Tsalbha and Rio Negro [non L. 
Pfeiffer, 1849] 

Helicina {Tristramia) tenuis - Baker, 1922a: 
50, pl. Ill fig. 7, pl. IV, fig. 14 (radula) 

Helicina (Tenuis) tenuis - Baker, 1922b: 35- 
36: Mexico: S Vera Cruz, near Hacienda de 
Cuatolapam (Rio San Juan - Arroyo 
Hueyapam, canton of Acayacan (Michigan- 
Walker-Expedition) 

Helicina tenuis - Pilsbry, 1926a: 59, 71: 
Panama: Los Santos Province: Tonosi 
(Olsson) 

7Helicina tenuis var. - Pilsbry, 1930: 339: 
Panama: Barro Colorado Island (Pinchot- 
Expedition) 

Helicina (Tristramia) lindeni - Bequaert & 
Clench, 1933: 543: not found again in 
Yucatán [non L. Pfeiffer, 1849] 

Helicina tenuis - Goodrich & van der Schalle, 
1937: 12, 15, 32: Guatemala: Petén: region 
of headwater of Río San Pedro de Mártir, 
lower Río de la Pasión; Alta Verapaz: upper 
part of Río de la Pasión 

Helicina tenuis - van der Schalle, 1940: 6, 9, 
10: Guatemala: Alta Verapaz: Pacala and 
Chama, 290 m a.s.l., Samac, 1,300 m a.s.l. 
[W of Coban], Panzamala, 1 ,250 m a.s.l. [S 
of Lanquin] (Stuart) 



256 



RICHLING 



Helicina {Heliana) tenuis - Haas, 1949: 137- 
138: Guatemala: Chimaltenango: Yepocapa, 
4800 ft.; Zacapa: Santa Clara, valley in the 
interior of the Sierra de las Minas, N of 
Cabanas, 5500 ft. (Wenzel &Mitchell) 

Helicina tenuis - Bequaert, 1957: 207: 
Chiapas: Selva Lacandona: Monte Líbano, 
600 m, El Real, 600 m 

Helicina tenuis tenuis ~ Thonnpson, 1967: 
228-229: Mexico: Campeche: 10.2 mi E 
Escárcega, rare (1 spec, dead), Chiapas: 
15.8 mi NW Ocozocoautia 

Helicina tennuis [sic] - Pérez & Lopez, 1993: 
27: Nicaragua 

Helicina oweniana - Monge-Nájera, 1997: 113: 
Costa Rica [in part] [non L. Pfeiffer, 1849] 

Synonymy 

Helicina vernalis Morelet, 1849 
Helicina chiapensis L. Pfeiffer, 1856 
Helicina vernalis verapazensis Wagner, 

1905 
Helicina tenuis pittieri \Nagr\er, 1910 

Original Description 

"Hel. testa, turbinata, tenuissima, vix 
striatula, pellucida, corneo-albida, rubro obso- 
lete trifasciata; spira cónica, acuta; anfractibus 
6 vix convexiusculis, ultimo basi planiusculo; 
apertura fere verticali, triangulari-semiovali; 
columella brevi, basi retrorsum subdentata, 
superne in callum nitidum, circumscriptum, 
dilatata; peristomate tenui, angulatim 
expanse, margine basali cum columellae basi 
angulum formante. 
Diam. 11, altit. 87^ mill. 
From Yucatan." 



Type Material 

BMNH 20010496.1-7 "Yucatan & 
Barbadoes, coll. Hugh Cuming" 
The type lot contains seven specimens, la- 
beled as originating from Yucatan and 
Barbadoes. The latter locality is not given in 
the original description. In fact, the lot is a mix- 
ture of two species, and only five specimens 
agree with the description of Helicina tenuis. 
The other two exhibit a less elevated spire, 
less convex whorls and the first whorls in- 
crease more rapidly in size. Furthermore, the 
shells, lacking the spiral color bands, are col- 
ored uniformly whitish, except for a broken 
nearly transparent thin spiral line above the 
periphery. Finally, the characteristic denticle of 
H. tenuis at the basal outer lip is less strongly 
developed. Thus, these specimens (BMNH 
20010496.6-7) are excluded from the syntype 
lot of Helicina tenuis, because they do not 
agree with the original description and the 
later given figure. It is very likely that the lot 
was mixed subsequently to the studies of L. 
Pfeiffer. 

The largest specimen is here selected as 
lectotype (Fig. 54), because it best agrees 
with the figure in L. Pfeiffer (1850). It is the 
only specimen in the lot with banding, without 
operculum and about the size given in the 
description. In comparison with the ftgure the 
bands are faded, but it may be an exaggera- 
tion in the drawing since they are described as 
"rubro obsolete trifasciata". 
Dimensions: 
Lectotype BMNH 20010496.1: 

9.8/9.8/10.8/8.9/6.5/7.7/7.6 mm 
Paralectotypes BMNH 20010496.2-5: 

9.6/9.1/10.4/8.4/6.4/7.5/7.2 mm 




FIG. 54. Helicina tenuis, lectotype, BMNH 2001496.1, height 9.8 mm; scale bar 2.5 mm. 



CLASSIFICATION OF HELICINIDAE 



257 



8.9/8.7/9.4/8.1/5.6/6.8/7.0 mm 

9.8/9.0/10.0/8.3/6.0/7.2/7.5 mm 

8.7/7.9/8.7/7.3/5.4/6.4/6.7 mm 

It is remarkable that even the type lot shows 
a comparatively great variation in size and 
shape (e.g., lectotype and smallest 
paralectotype). 

Type Locality • 

"Yucatán" [Not clear, whether it refers to the 
Mexican State of Yucatán or to the whole 
Yucatán Peninsula, shared by Mexico, Guate- 
mala, and Belize. The present data of distribu- 
tion suggest its origin rather in the Mexican 
State of Campeche or the Guatemalan Peten 
Department.] 

Type Material of Synonymous Taxa or Similar 
Species 

He lie i na vernalis M о re I et, 1 849 

Type Material: BMNH 1893.2.4.1991-1993: 
Morelet coll., purchased from H. Fulton 
The Morelet collection was bought by H. 
Fulton and later purchased by the BMNH. 
Fischer & Crosse (1893) studied the origi- 
nal material in the Morelet collection and 
figured a shell that can be identified by the 
mark of a "x" and the clear similarity to the 
figure. This shell is here selected as lecto- 
type of Helicina vernalis (BMNH 
1893.2.4.1991) (Fig. 55), because it is un- 
certain whether Fischer & Crosse's com- 
ment in the figure caption (pi. LVI, fig. 1,1a, 
lb: "premier type de Г Helicina vernalis") 
can be regarded as a type selection. The 
lectotype is colored uniformly whitish and 



still possesses its operculum, whereas the 
paralectotypes are whitish below the pe- 
riphery and above tinged reddish-brownish 
or yellowish with two reddish-brownish 
bands respectively. 
Dimensions: 
Lectotype BMNH 1893.2.4.1991: 

9.9/9.9/10.8/8.9/6.5/7.7/7.5 mm 
Paralectotypes BMNH 1893.2.4.1992- 

1993: 

9.4/9.4/10.3/8.3/6.3/7.5/7.2 mm 

9.2/9.2/10.0/8.2/6.2/7.3/7.0 mm 

Type Locality: "Petenensis sylvas" [Guate- 
mala, Peten Department] 

Helicina chiapensis L. Pfeiffer, 1856 

Type Material: Syntype ZMB 65624: leg. 
Ghiesbreght, ex coll. L. Pfeiffer (Fig. 56) 
The description of Helicina chiapensis was 
published in two journals. In the earlier pub- 
lication (December 1856), L. Pfeiffer stated 
that he had received specimens from Hugh 
Cuming, leg. Ghiesbreght, which he prob- 
ably kept in his collection. The second pub- 
lication (May 1857) refers to material in the 
collection Hugh Cuming, leg. Ghiesbreght. 
Thus additional syntypes are possibly in the 
collection of the BMNH housing the main 
collection of Hugh Cuming, although they 
have not yet been found in the type collec- 
tion. 

Dimensions (height/greatest diameter/minor 
diameter): 
Syntype: 10.2/11.4/9.4 mm 



Type Locality: "Mexico, Chiapa" 
of Chiapas] 



léxico, State 




FIG. 55. Helicina vernalis, lectotype, BMNH 1893.2.4.1991, height 9.9 mm; scale bar 2.5 mm. 



258 



RICHLING 



Helicina lindeni L. Pfeiffer, 1849 



Examined IVIaterial 



Helicina lindeni L. Pfeiffer, 1849: 123 (not fig- 
ured) 

Helicina lindeni - L. Pfeiffer, 1850: 52, pi. 8, 
figs. 25, 26 

Material Studied: Helicina lindeni var. BIVINH 
20010757: Mexico, Hugh Cuming coll., three 
specimens 

The type material could not be located in the 
collection of the BMNH, although it was listed 
in the catalogue of the BMNH collection by L. 
Pfeiffer (1852b: 282) as coming from the type 
locality Tapinapa, Mexico (leg. Linden). 
The specimens in BMNH 20020757 defi- 
nitely do not belong to Helicina tenuis, but 
rather agree well with the original description 
of Helicina lindeni, especially, because in 
contrast to H. tenuis it is slightly angulated at 
the periphery and less elevated. None of the 
shells shows a trace of spiral color bands. 
The outer lip is more reflexed. 

Helicina tenuis pittieri \Nagner, 1910 

Type Material: Holotype ZMB 103241: leg. 
Pittier 

Because the original description refers to one 
specimen in the ZMB which also matches the 
figure it is the holotype (Fig. 57). 
Dimensions: 
Holotype: 9.2/8.6/9.4/8.0/6.0/7.4/7.1 mm 

Type Locality: "Costa Rica, Rio de los 
Plutunales, Golfo Dolce" [correct: Rio de los 
Platanares, S of Puerto Jiménez, Península 
de Osa, about 08°31'30"N, 83°18'W, 
Puntarenas Province! 



Leg. i. Richling 

Guanacaste: 3 km E Nuevo Arenal, 
10°3r53"N.84°52'50"W, 640 m a.s.l.: prop- 
erty of pension Villa Decary, rain forest 
03.03.1997: (IR 52); 01.03.1999: (IR 715) 
02.03.1999: (IR 722); 31.07.1999: (IR 880) 
23.02.2000: (IR 1266); along small creek E 
of Villa Decary: 04.03.1999: (IR 730) 

Heredia: S Puerto Viejo de Sarapiqui, Zona 
Protectora La Selva, near OTS-Station, 
about 10°25'53"N, 84°00'18"W, 60 m a.s.l., 
05.09.1999: (IR 1057); (IR 1058); 
12.02.2000: (IR 1181) 

Puntarenas: Reserva Natural Absoluta Cabo 
Blanco. 09°35'16"N, 85°05'45"W, 30 m 
a.s.l.: Sendero Danes and trail from en- 
trance: 25.08.1999: (IR 1001); (IR 1002); 
27.02.2000: (IR 1289); (IR 1291): Sendero 
Sueco: 02.03.2001: (IR 1481) 

INBio Collection 

Guanacaste: 500 m E de la Estación 
Almendros, ir02'04"N, 85°31'10"W, 280 m 
a.s.l., leg. Elba Lopez, 01.08.1994: 1 ad. 
(INBio 1477167) 

Parque Nacional Barra Honda, Los 
Mesones: 10°10'12"N, 85°21'03"W, 300 m 
a.s.l., 29.05.1993: 2 ads. (INBio 1463476); 
10°10'12"N, 85°20'50"W, 100 m a.s.l., 
31.05.1993: 4 ads., 1 s. ad. (INBio 1463452) 
(al! leg. malacological staff of INBio) 
Refugio Nacional de Vida Silvestre Bosque 
Diriá, Sector Diña: Sendero Espavel, 
10°10'19"N, 85°35'44"W, 220 m a.s.l.: leg 
Alexander Alvarado Méndez, 13.05.1999: 6 
ads., 4 juvs. (INBio 3096450); 200 m a.s.l.: 
leg. A. Berrocal, 22.11.1998: 2 ads. (INBio 




FIG. 56. Helicina chiapensis, syntype, ZMB 65624, height 10.2 mm; scale bar 2.5 mm. 



CLASSIFICATION OF HELICINIDAE 



259 



3435759); Camino a Esperanza, 10°10'32"N, 
85°35'11"W, 260 m a.s.l.: 14.05.1999: lad., 1 
s.ad., 2JUVS. (INBio 1498286); 2 ads. (INBIo 
1498287) (all leg Alexander Alvarado Méndez) 
Puntarenas: Parque Nacional Carara: 
Quebrada Bonita, 09°46'29"N, 84°36'34"W: 
50 m a.s.l., 03.06.2000: 4 s. ads. (INBio 
3324332); 100 m a.s.l., 02.07.2000: 3 ads. 
(INBio 3129469); Carara, sendero Laguna 
Meandrica, 09°48'20"N, 84°35'02"W, 100 m 
a.s.l.: 15.07.2000: 1 s.ad. (INBio 3395010) 
(all leg. malacological staff of INBio) 
Parque Nacional Corcovado: Rio Sirena, 
08°30'25"N, 83°29'23"W, 545 m a.s.l.: leg. 
Enia Navarro, 24.05.1995: 1 ad. (INBio 
1484663); 2 /(m SW del Mirador, 08°32'30"N, 
83°30'57"W, 200 m a.s.l.: leg. Socorro Avila, 
22.05.1997: 1 ad. (INBio 1487810) 
Reserva Forestal Golfo Dulce: Fila Casa 
Loma, 1,600 m S de la Escuela de Rincón, 
08°41'33"N, 83°29'17"W, 170 m a.s.l.: leg. 
Socorro Avila, 10.10.1996: 2 ads. (INBio 
1487328); Península de Osa, Instalaciones 
de IDA, 08°4r38"N, 83°29'07"W, 60 m 
a.s.l.: leg. Ramon Ángulo, 07.06.1994: 1 ad. 
(INBio 1480502) 

Reserva Natural Absoluta Cabo Blanco: 
Sector Balsitas, Sendero Central, 
09°35'02"N, 85°07'26"W, 120 m a.s.l.: 
18.05.1994: 6 juv. (INBio 1473990); 2 ads. 
(INBio 1475801); 1 ad. (INBio 1475805) (all 
leg. Zaidett Barrientes); Sector Cabuya, 
Sendero Sueco, Río Arlólo, 09°35'16"N, 
85°05'41"W, 20 m a.s.l.: leg. Ulises 
Chavarria, 08.11.1994: 1 ad. (INBio 
1480012); Sector San Miguel, Sendero Ma- 
ven, 09°35'09"N, 85°08'12"W, 200 m a.s.l.: 
leg. Zaidett Barrientes, 17.05.1994: 1 ad. 
(INBio 1474149) 



Cóbano, Estación Cabo Blanco, 09°35'30"N, 
85°05'45"W, 15 m a.s.l., leg. malacological 
staff of INBio, 09.01.1993: 4 ads., 5 s.ads., 
3JUVS. (INBio 1465481) 
Sendero Camino Maven, orilla de quebrada 
San Miguel, 09°35'18"N, 85°08'12"W, 100 m 
a.s.l., leg. Alexander Alvarado Méndez, 
21.01.1999: 2 ads. (INBio 1498272); 2 ads. 
(INBio 1498276) 

Quebrada San Miguel, 09°35'15"N, 
85°08'15"W, 100 m a.s.l., leg. Socorro Avila, 
05.10.1995: 1 ad. (INBio 1484853) 
Alajuela: San Ramón, 10°05'19"N, 84°29'18"\/V, 
1,060 m a.s.l., leg. malacological staff of 
INBio, 16.09.1993: 1 ad. (INBio 1464319) 
Estación Playuelas, 50 m del Rio Frío, 
10°57'29"N, 84°44'55"W, 40 m a.s.l., leg. 
Kattia Martinez, 08.01.1994: 1 ad. (INBio 
1479297) 

Other Sources 

CQSTA RICA 

Guanacaste: Las Cascadas, Quebrada San 

Diego, 10°10'59.5"N, 85°20'18.5"W, leg. 

D.G. Robinson & J.M. Montoya, 20.09.1998 

(APHIS PPQ USDA) 

Karst exposure, Cerro Barra Honda, approx. 

10°10'10"N, 85°22'10"W, leg. D.G. Robinson 

& J.M. Montoya, 19.09.1998 (APHIS PPQ 

USDA) 

Nicoya [about 10°08'30"N, 85°27'30"W], leg. 

H. G. Lee, ex G.D. Robinson, W.F. Webb: 1 

ad. (UF 166944) 

Federal de Nicoya [about 10°08'N, 

85°26'W], leg. Univ. Alabama, M. Smith coll. 

(MS-15277): 12 ads. (UF 95336) 

2.2 mi SE Nicoya [about 10°07'30"N, 

85°26'W], 500 ft., leg. F.G. Thompson (FGT- 

106), 10.08.1964: 1 ad. (UF 214333) 




FIG. 57. Helicina tenuis pittieri, holotype, ZMB 103241, height 9.2 mm; scale bar 2.5 mm. 



260 



RICHLING 



3.8 mi S Nicoya [about 10°05'N, 85°28'W], 
leg. F. G. Thompson (FGT-111), 11.08.1964: 
1 ad. (UF 35511) 

1.2 mi E Caimital [about 10°04'N, 85°27'V\I], 
leg. F.G. Thompson (FGT-109), 11.08.1964: 

1 ad. (UF 214332) 

Monte Alto conservation area, near 
Pilangosta, Canton Hojancha, 10°00'48.1"N, 
85°24'08.1"W, leg. D.G. Robinson & J.M. 
Montoya, 19.09.1998 (APHIS PPQ USDA) 
Alajuela: "Alajuela" [city or province?, town 
about 10°0Г30"М, 84°13'W], Orosco (ZMB 
103247) 

La Paz (Chem. du Sarapiqui) [not exactly 
localized, near Isla Bonita?, about 
10°15'30"N, 84°11'\A/], leg. P. Biolley (#90): 

2 ads. (MHNN) 

"San José Prov.:" San José [really San José, 
capital of Costa Rica?, or province later 
added and originally referring to San José in 
Alajuela Province, here preferred: 14 km 
NW of Upala, about 10°58'N, 85°08'W, 
Alajuela Province], leg. McGinty coll., ex 
Preston & Tomlin: 1 ad. (UF 160158) 

San José: Turubares, Versant du Pacifique 
[San Pablo de Turrubares, about 09°55'N, 
84°27'W], 500 m a.s.l., leg. P Biolley (#140), 
06.1893: 21 ads., 1 s.ad. (MHNN) 

Cartago: Turrialba [about 09°54'30"N, 
83°4rW], coll. С Bosch, ex coll. Rolle, ex 
Wagner: 4 ads. (SMF 180786/4); coll. Rolle: 
12 ads. (ZMB 103802) 

Puntarenas: Golfito [about 08°39'N, 83°10'W], 
leg. F.G. Thompson et al., 14.06.1964: 1 ad. 
(UF 35510) 

Costa Rica, without locality further specified: 
leg: McGinty coll.: 1 ad. (UF 263576); 1 ad. 
(UF 214331) 

GUATEMALA 

El Peten: S of Sayaxche, beyond L 
Petexbatun, leg. J. Polisar, 31.08.1994: 4 
ads. (UF 234127) 

Huehuetenango: Cave below Finca Chiblac, 
ca. 5 km W of San Ramon, 15°52'45"N, 
9ri4'34"W, 700 m a.s.l., leg. F.G. Thomp- 
son et al. (FGT-4828), 05.03.1991: 5 ads. 
(UF 190327); (UF 190329: 1 of 6 spec.) 

Alta Verapaz: 2 km WNW of Lanquin, 
15°34'38"N, 89°59'19"W, 300 m a.s.l., leg. 
S.P. Christman (FGT-4791), 21.02.1991: 2 
ads. (UF 190068) 

4 km W of Lanquin, 1 5°34'37"N, 90°01 '06"W, 
330 m a.s.l., leg. F.G. Thompson (FGT-4793), 
21.02.1991 (UF 190093: 1 of 5 spec.) 
9 km W of Lanquin, 15°35'03"N, 
90°03'20"W, 690 m a.s.l., leg. F.G. Thomp- 



son et al. (FGT-4787), 20.02.1991: 1 ad.(UF 
190036); (UF 190045: 2 of 4 spec.) 
11 km W of Lanquin, 15°33'29"N, 
90°04'02"W, 1,000 m a.s.l., leg. F.G. Thomp- 
son et al. (FGT-4801), 22.02.1991: 2 ads. 
(UF 190142) 

6.5 km SE of Lanquin, 15°32'52"N, 
89°57'22"W, 400 m a.s.l., leg. F.G. Thomp- 
son (FGT-4796), 21.02.1991: 2 ads. (UF 
190108) 

8 km SE of Lanquin, 15°32'43"N, 
89°56'49"W, 350 m a.s.l., leg. F.G. Thomp- 
son et al. (FGT-4797), 21.02.1991: 1 ad. (UF 
190116) 

2 km ESE Cojaj, 15°33'25"N, 90°06'56"W, 
1,250 m a.s.l., leg. F.G. Thompson (FGT- 
4783), 20.02.1991: 3 ads. (UF 190006) 
8 km by road N of Coban, 15°31'30"N, 
90°23'11"W, 1,340ma.s.l.,leg. F.G. Thomp- 
son et al. (FGT-4776), 18.02.1991: 3 ads. 
(UF 189950) 

4 km E of Coban, 1,260 m a.s.l., leg. F.G. 
Thompson et al. (FGT-4803), 23.02.1991 
(UF 190156: 1 of 2 spec.) 

Coban, Sumichrast: 2 ads. (UF 214336); leg. 
Univ. Alabama, TH. Aldrich coll. (THA-8198), 
ex Mohr coll.: 2 ads. (UF 095334) 
Limestone knoll 11 km S of Coban, 
15°24'57"N, 90°24'09"W, 1,350 m a.s.l., 
leg. F. G. Thompson et al. (FGT-4805), 
04.02.1991: 1 ad. (UF 190163) 
2.5 km by road NE of Puente Chixoy, 
15°2r32"N, 90°39'10"W, 810 m a.s.l., leg. 
F.G. Thompson (FGT-4781), 19.02.1991 (UF 
189988) 

Limestone knoll 17.5 km NW of Tactic, 
15°2r29"N, 90°25'25"W, 1,330 m a.s.l., leg. 
F.G. Thompson et al. (FGT-4764), 
16.02.1991: 3 ads. (UF 189840) 
10.5 km SE of El Tactic, 15°16'59"N, 
90°18'11"W, 1,460 m a.s.l., leg. S.P. 
Christman (FGT-4810), 26.02.1991: 2 ads. 
(UF 190204) 

E of Finca el Volcan, leg. J. Schuster, 
22.07.1984: 1 ad. (UF 114090) 

Izaba!; Rio Tameja, 12.9 km SSW Livingston, 
leg. F.G. Thompson (FGT-54), 04.07.1964: 1 
ad. (UF 214330) 

Zacapa: La Union, Cerro Mona (N), 1,350- 
1,500 m a.s.l., leg. E.N. Smith, 20.06.1994: 
1 ad. (UF 244447) 

Retalhuleu: Retalhuleu, leg. Univ. Alabama, T. 
H. Aldrich coll. (THA-8197) ex Mohr coll.: 2 
ads. (UF 95335) 

Guatemala, without locality further specified: 
La Paz [localization?: perhaps Verapaz or in 
Honduras?], ex coll. S. G. A. Jaeckel: 3 ads. 



CLASSIFICATION OF HELICINIDAE 



261 



(HNO 39843); leg. Beal-Maltbie coll., ex W. 
Webb coll.: 1 ad. (UF 237376); leg. Beal- 
Maltbie coll., ex W. Webb coll.: 1 ad. (UF 
237377) 

EL SALVADOR 

Ahuachapán: 6 km W of Atiquizaya, on road to 

Ahuachapán, leg. A. Zilch, 21.09.1951: 4 

ads. (SMF) 

HONDURAS 

Colón: Limestone ridge, 2.6 km SW of La 
Brea, 15°45'39"N, 86°00'08"W, 100 m a.s.l., 
leg. F.G. Thompson (FGT-5253), 
22.10.1993: 1 ad. (UF 212023) 

Olancho: Vicinity of Magua Cave, ca. 15 km 
SSWof Gualaco, 14°56.5'N, 86°07.5'W, 940 
m a.s.l., leg. F.G. Thompson et al. (FGT- 
5216), 11.03.1993: 4 ads. (UF 194339) 

MEXICO 

Guerrero: 1 km E Petaquillas, 1158 m a.s.l., 

leg F.G. Thompson (FGT-1 584), 03. 1 1 . 1 970: 

9 ads. (UF 217551) 

2.2 mi NNE of Mazatlan, 4800 ft., leg. F.G. 

Thompson (FGT-672), 14.06.1966: 1 ad. 

(UF 77607) 

Limestone hill, 1 km NW of Naranjito, 

18°05'03"N, 10r50'45"W, 675 m a.s.l., leg. 

F.G. Thompson (FGT-5087), 04.11.1992: 1 

ad. (UF 200647) 
Oaxaca: Lagunas, 259 m a.s.l., leg. F.G. 

Thompson, 18.07.1966: 2 ads. (UF 214337) 

Limestone ridge, 4 km W of Cuauht, moc, 

17°05'56"N, 94°54'25"W, 100 m a.s.l., leg. F. 

G. Thompson et al. (FGT-5271 ), 02.08.1993: 

1 s. ad. (UF 211326) 

Limestone knoll, 13 km ENE of Sarabia, 

17°05'54"N, 94°56'34"W, 125 m a.s.l., leg. F. 

G Thompson et al. (FGT-5269), 02.08.1993: 

3 ads. (UF 211316); leg. F. G. Thompson 

(FGT-5280), 03.08.1993: 2 ads. (UF 

211427) 
Veracruz: 5 km ENE of Cuauht, moc, Oaxaca, 

17°06'59"N, 94°51'10"W, 75 m a.s.l., leg. 

F.G. Thompson et a!. (FGT-5273), 

03.08.1993: 1 ad. (UF 211337) 

7 km S, 7 km E of Catamaco, 350 m a.s.l., 

leg. F.G. Thompson et al. (FGT-4608), 

03.01.1990: 4 ads. (UF 159375) 

Laguna Encentada, 20.08.1962: 1 ad. (UF 

214338) 

Limestone knoll, 2 km SW of Plan Arroyo, 

17°14'15"N, 94°37'36"W, 100 m a.s.l., leg. 

F.G. Thompson et al. (FGT-5278), 

03.08.1993: 2 ads. (UF 211398) 



Tabasco: 3 km N of Vicente Guerrero, 
17°3r09"N, 92°56'00"W, 160 m a.s.l., leg. 
F.G. Thompson (FGT-4873), 03.04.1991: 3 
ads. (UF 190725) 

6.8 km W Teapa, leg. F.G. Thompson (FGT- 
427), 08.07.1965: 2 ads. (UF 214344) 

Campeche: 16.4 km E Escárcega, leg. F.G. 
Thompson (FGT-406), 19.06.1965: 1 ad. 
(UF 19296) 

Chiapas: 15.1 km W San Cristobal, 2469 m 
a.s.l., leg. F.G. Thompson (FGT-446), 
15.07.1965: 1 juv. (UF 214335); 1 ad. (UF 
214340) 

18.3 km N Tuxtia Gutierrez, 1372 m a.s.l., 
leg. F.G. Thompson (FGT-465), 22.07.1965: 

1 juv. (UF 214341) 

12.9 km N Tuxtia Gutierrez, 1158 m a.s.l., 
leg. F.G. Thompson (FGT-459), 19.07.1965: 
3ads. (UF 214343) 

4.8 km SSE Tuxtia Gutierrez, 823 m a.s.l., 
leg. F.G. Thompson (FGT-763), 25.07.1966: 

2 ads. (UF 214345) 

7.5 km NNE Huixtia, 183 m a.s.l., leg. F.G. 
Thompson (FGT-757), 23.07.1966: 1 ad. 
(UF 214346) 

21.3 mi NW Huixtia, 300 ft., leg. D.R. 
Paulson et a!., 31.07.1965: 2 ads. (UF 
214339) 

Stream, 44.4 km NW Ocozocoautia, 610 m 
a.s.l., leg. F.G. Thompson (FGT-464), 
21.07.1965: 1 ad. (UF 214342) 

25.4 km NW Ocozocoautia, 823 m a.s.l., leg. 
F.G. Thompson (FGT-462): 20.07.1965: 1 
ad. (UF 19295) 

34.1 km E, 16.4 km S Comitan, 1524 m 
a.s.l., leg. F.G. Thompson (FGT-441), 
14.07.1965: 1 ad. (UF 214145) 
Ruins of Palenque, leg. H.W. Campbell, 
04.05.1970: 3 ads. (UF 214334) 
Mexico, without locality further specified: leg. 
Univ. Alabama, TH. Aldrich coll. (THA-81 95): 
2 ads. (UF 95291) 

Description 

Shell (Figs. 58, 335F-I): Conical-globose, 
semi-fragile to thin, sometimes semitrans- 
parent, medium sized and only slightly shiny 
to dull. Color: basic color yellowish to whit- 
ish-opaque to horncolored, with up to three 
indistinct reddish bands on body whorl: one 
between suture and periphery and one or 
two below the periphery. The lower band 
only very weakly developed or obsolete. 
Surface textured with fine irregular growth 
lines and oblique grooves of different indi- 



262 



RICHLING 




FIG. 58. Helicina tenuis. A-C. Cabo Blanco, IR 1001. A. Height 8.3 mm. B. Height 7.3 mm. С Height 
8.5 mm. D. La Selva, IR 1057, height 8.7 mm; scale bar 2.5 mm. 



vidual orientation but of the same general 
direction (Fig. 60), causing the dull appear- 
ance. Embryonic shell with about 1 whorl, 
4%-5 (lectotype: 4%) subsequent whorls 
well inflated, remarkably convex, the last 
whorl regularly rounded or sometimes with a 
slight angulation at the periphery, under the 
suture slightly shouldered; whorls equally 
extending in size, forming a very regular 
conical, pointed spire. Suture deeply im- 
pressed. Aperture oblique and nearly 
straight, last whorl regularly descending and 
inserting exactly at the periphery. Outer lip 
always yellowish-white, slightly thickened 
and broadly expanded. Reflection nearly 
rectangular to the whorl; transition to col- 
umella with a remarkably protruding den- 
ticle. Columella short. Basal callus weakly 
developed and nearly completely smooth or 
very little granulated, umbilical area without 
groove. 

Internal Shell Structures: (Fig. 59) 

Teleoconch Surface Structure (Fig. 60): The 
transitional structure extends about half a 



whorl, the subsequent pattern of oblique di- 
verging grooves continues up to the aper- 
ture. 

Embryonic Shell (Fig. 61): The structure re- 
sembles that of Helicina funcki, occasionally 
the pits are somewhat smaller. The embry- 
onic shell size of the Costa Rican specimens 
agrees fairly well with the larger shells (see 
"Morphometry") of the type lot of H. tenuis 
which came from the Peninsula de Yucatán. 
Diameter: 838 pm (± 28) (780-900) (n = 25) 
(IR 1001 , IR 1002); 834 pm (± 27) (800-860) 




FIG. 59. Axial cleft and muscle attachments of 
Helicina tenuis, IR 1001; scale bar 5 mm. 



CLASSIFICATION OF HELICINIDAE 



263 








FIG. 60. Teleoconch surface structure of Helicina 
tenuis on 2"'' whorl; scale bar 100 |jm. 





FIG. 61 . Embryonic shell of Helicina tenuis; scale 
bar 100 |jm. 



FIG. 62. Operculum of ¡Helicina tenuis, IR 1001; 
scale bar 2 mm. 



(n = 5) (BMNH 20010496.1-5, type lot, lec- 
totype; 860 pm); 813 pm (± 9) (800-820) (n 
= 3) (BMNH 1893.2.4.1991-1993, type lot of 
Helicina vernalis, lectotype: 820 pm). 

Operculum (Fig. 62): Very slightly calcified, 
calcareous plate leaving a free margin, 
thickened towards the columellar side. Color 
reddish horny-amber, only the central area 
yellowish-transparent. Columellar side 
nearly regular S-shaped, upper end acute 
and pointed, lower end continuously chang- 
ing into outer margin. 

Animal (Figs. 337D, E): Foot and head are 
greyish and become darker towards the 
dorsal side; tentacles are greyish too. The 
mantle pigmentation shows a high variabil- 
ity: seldom unicolored light or dark, often 
basic color light yellowish with two (or sel- 
dom one) brown distinct but irregular bands 
on the last whorl above and below the pe- 
riphery and more or less irregularly brown- 
ish spotted throughout the mantle. The few 
specimens from Arenal were only brownish 
spotted with small dots. The pattern is al- 
most always clearly visible through the 
shell. 

Radula (Fig. 63): A-central without well-de- 
fined cusps, B-central in most cases with 3- 
4, C-central only occasionally with up to 6 
small cusps. Comb-lateral with 8-9 cusps, 
cusps on marginals slowly increasing in 
number. Radula with about 66-86 rows of 
teeth. Description agrees with Baker (1922a: 
pi. Ill, fig. 7, pi. IV, fig. 14). 

Female Reproductive System (Figs. 64, 65): 
The receptaculum seminis is a small, simple 
drop-shaped sac, the bursa copulatrix pos- 



264 



RICHLING 





FIG. 64. Female reproductive system oi Heiicina 
tenuis, IR 1001; scale bar 1 mm. 



sesses few rather large simple lobes and is 
of moderate size. The provaginal sac is ob- 
long and well inflated, its distal end bears a 
few small processes. It has a slightly grey- 
ish-brownish pigmentation. The stalk is 
shorter than in Helicina funcki and rather 
stout. 




FIG. 63. Radula of Helicina tenuis. A. Centrals. 
B. Comb-lateral. С Marginals; scale bar 50 pm 
(A, B), 100 pm (C). 



FIG. 65. Variability of the female reproductive 
system of ¡Helicina tenuis, IR 1002; scale bar 2.5 
mm. 



CLASSIFICATION OF HELICINIDAE 



265 



TABLE 6. Measurements of different populations of Helicina tenuis given as mean value with standard 
deviation, minimum and maximum value (min, max), and number of specimens; only population from 
"Cabo Blanco" and "La Selva" were determined for the sex (min./max. diam. = minor/major diameter, 
col. axis = columellar axis); linear measurements [mm], weight [g], volume [ml]. 







"Cabo Blanco" (altitude 30 i 


m) 




"La Selva 


" (altitude 60 m) 








lotsIR 1001 


, IR 1002, IR 1289 




lots IR 1057, IR 1181 








Mean 










Mean 












Sex 


value 


Deviation 


Mm 


Max 


Number 


value 


Deviation 


Min 


Max Number 


Height 


f 


8.12 


0.36 


728 


898 


54 


- 


- 


- 


- 


- 


Height 


m 


7.34 


0.25 


6.71 


7.92 


30 


823 


0.27 


7.83 


8.67 


4 


Maj. diam. 


f 


7.93 


0.29 


7.18 


8.69 


54 


- 


- 


- 


- 


- 


Maj. diam. 


m 


7.33 


0.19 


6,90 


7.72 


30 


8.06 


021 


7.75 


8.36 


4 


Mm. diam 


f 


7.31 


0.27 


6.67 


8.03 


54 


- 


- 


- 


- 


- 


Min. diam. 


m 


6.68 


0.18 


6.33 


7.00 


30 


7.38 


0.14 


7.15 


7.55 


4 


Outer lip 


f 


5.39 


0.24 


4.81 


6.05 


54 


- 


- 


- 


- 


- 


Outer lip 


m 


5.03 


0.16 


4.49 


5.99 


30 


5.53 


0.16 


5.37 


5.70 


4 


Last whorl 


f 


6.43 


0.29 


5.64 


7.24 


54 


- 


- 


- 


- 


- 


Last whorl 


m 


5.83 


0.21 


5.47 


6.24 


30 


639 


0.23 


6.15 


6.67 


4 


Col. axis 


f 


6.37 


0.26 


5.65 


7.12 


54 


- 


- 


- 


- 


- 


Col. axis 


m 


5.74 


0.19 


5.01 


6.23 


30 


6.50 


0.18 


6.13 


6.73 


4 


Weight 


f 


0.030 


0.009 


0.015 


0.092 


54 


- 


- 


- 


- 


- 


Weight 


m 


0.027 


0.007 


0.013 


0.048 


30 


0053 


0.011 


0.037 


0.065 


3 


Volume 


f 


0.159 


0.018 


0.119 


0.207 


54 


- 


- 


- 


- 


- 


Volume 


m 


0.117 


0.010 


0.100 


0.136 


30 


162 


0.011 


0.145 


0.172 


3 








" 


Dina" (altitude 220-260 m) 


"Barra Honda" 


(altitude 100-300 


m) 






lots INBio 1498286, 1498287, 3096450 


lots INBio 1463452 


1463476 






Mean 










Mean 














value 


Deviation 


Min 


Max 


Number 


value 


Deviation 


Min 


Max Number 


Height 




7.89 


0.30 


7.15 


843 


8 


848 


036 


7.67 


9.02 


6 


Maj. diam. 




7.91 


0.22 


7.61 


8.32 


9 


8.11 


0.29 


7.59 


8.68 


6 


Min. diam 




7.14 


0.20 


6.82 


748 


9 


7.55 


0.26 


6.98 


7.98 


6 


Outer lip 




5.19 


0.18 


5.00 


5.85 


8 


5.50 


0.21 


5.23 


5.43 


6 


Last whorl 




5.99 


0.19 


5.66 


636 


8 


6.42 


0.41 


5.60 


6.93 


6 


Col. axis 




6.27 


0.20 


573 


668 


9 


6.88 


0.36 


603 


7.34 


6 





"Cabo Blanco, INBio" (altitude 15-120 m) 

lots INBio 1465481, 1475801, 1475805, 

1480012, 1484853, 1498272, 1498276, 

IR 1481 



"Turrubares" (altitude 500 m) 
lotMHNN 





Mean 










Mean 












value 


Deviation 


Mm 


Max 


Number 


value 


Deviation 


Min 


Max 


Number 


Height 


7.94 


0.39 


6.92 


8.68 


22 


7.88 


0.50 


6.91 


9.00 


21 


Maj. diam. 


7.95 


0.35 


7.00 


8.60 


22 


7.90 


0.41 


7.20 


8.80 


21 


Min. diam. 


7.22 


0.33 


6.32 


7.73 


21 


7.11 


0.36 


6.49 


7.97 


21 


Outer lip 


5.30 


026 


465 


5.85 


22 


5.22 


0.21 


4.85 


5.80 


21 


Last whorl 


6.23 


0.32 


5.30 


6.78 


22 


6.05 


0.35 


5.40 


6.84 


21 


Col. axis 


6.25 


0.34 


529 


6.90 


22 


6.09 


041 


5.30 


7.15 


21 



(Continues) 



266 

{Continued) 



RICHLING 



'Carara" (altitude 100 m) 
lot INBio 3129469 



"Osa" (altitude 60-545 m) 

lots INBio 1480502, 1484663, 1487328, 

1487810 





Mean 










Mean 












value 


Deviation 


Min 


Max 


Number 


value 


Deviation 


Min 


Max 


Number 


Height 


8.08 


0.52 


7.31 


8.68 


3 


7.55 


0.83 


6.70 


8.68 


4 


Maj. diam. 


7.60 


0.28 


7.18 


7.93 


3 


6.98 


0.58 


6.35 


806 


5 


Min. diam. 


7.10 


0.39 


6.51 


7.60 


3 


6.54 


0.57 


5.88 


7.35 


4 


Outer lip 


5.28 


0.39 


4.70 


5.67 


3 


4.95 


0.38 


4.51 


5.74 


5 


Last whorl 


6.21 


027 


5.81 


6.60 


3 


5.99 


0.58 


5.44 


6.86 


5 


Col. axis 


6.22 


0.46 


5.53 


6.88 


3 


6.00 


0.69 


5.24 


6.85 


4 



Morphometry and Sexual Dimorphism 

Although Helicina tenuis is widely distributed, 
only data from Costa Rica and the type lot or 
those of type lots of synonyms, respectively, 
were included, because the lots studied from 
other areas consisted of only a very few speci- 
mens. Except for "La Selva", the Costa Rican 
populations originated from the Pacific side. 
The only southern specimens are those sum- 
marized as "Peninsula de Osa" and the holo- 
type of H. tenuis pittieri (Table 6, Figs. 66-70). 



Cabo Blanco (n=54/30) 



7/: 



La Selva (n=0/4) 



ZIL 



Yucatán (type lot) (n=5) 



=//= 



Yucatán'' (non tenuis) (n=2) 



=/t 



Peten (type lot H. vernalis) (n=3) 



=/t 



Osa (type H. tenuis pittieri) 



=//= 



DIriá (n= 



=^/= 



Barra Honda (n=6) 



=/fc 



Cabo Blanco (INBio) (n=22) 



=//= 



Turrubares (n=21) 



=^/= 



Carara (n=3) 



=/t 



Peninsula de Osa (n=4) 



=/t 



4 5 6 7 8 9 [mm] 10 

FIG. 66. Shell height of different populations of 
Helicina tenuis in Costa Rica according to Table 
6; on each line: mean value, standard deviation, 
absolute range; number of individuals given as 
"n = females/males or total"; upper line: females, 
lower line: males If separate; in between and 
shaded: average of both for comparison with 
populations of unknown sex. 



Morptiometry: Regarding the type lot of 
Helicina tenuis, the non-conspecificity of all 
specimens is confirmed in the measure- 
ments, especially in the height-diameter-re- 
lation. Helicina tenuis pittieri closely 
approaches the mean value of the type lot In 
all characteristics. The same is true for the 
type lot of H. vernalis, which is larger, but 
otherwise shows similar relations between 
the different measurements, additionally 
supporting the status as a synonym. 
Except for "Peninsula de Osa", the Pacific 
populations are remarkably similar to each 
other in all characteristics. The specimens 
from Barra Honda have a bigger shell, which 
is more highly elevated (height, columellar 



Cabo Blanco (n=54/30) 



7£: 



La Selva (n=0/4) 



://! 



Yucatán (type lot) (n=5) 



=//= 



Yucatán'' (non tenuis) (n=2) 



=//= 



Peten (type lot H vernalis) (n=3) 



=//= 



Osa (type H. tenuis pittieri) 



=//= 



Dirlá (n=9) 



=yt 



Barra Honda (n=6) 



=//= 



Cabo Blanco (INBio) (n=21 ) 



=11= 



Turrubares (n=21) 



=//= 



Carara (n=3) 



=//= 



Peninsula de Osa (n=4) 



=//= 



4 5 6 7 8 9 [mm] 10 

FIG. 67. Minor diameter of shell of different 
populations of Helicina tenuis in Costa Rica 
according to Table 6; for explanations see Fig. 66. 



CLASSIFICATION OF HELICINIDAE 



267 



Cabo Blanco (n=54/30) 



:7t 



La Selva (n=0/4) 



^L 



Yucatán (type lot) (n=5) 



=//= 



Yucatán'' (non tenuis) (n=2) 



=í/= 



Peten (type lot H vernalis) {n=3) 



=//= 



Osa (type H, tenuis pittieri) 



=//= 



Diriá (n=8 



:^A: 



Barra Honda (n=6) 



=//= 



Cabo Blanco (INBio) (n=22) 



=/t 



Turrubares (n=21) 



=//= 



Carara (n=3) 



=//= 



Peninsula de Osa (n=5) 



=/t 



Cabo Blanco (n=54/30) 



:/L 



La Selva (n=0/4) 



Yucatán (type lot) (n=5) 



=^/= 



Yucatán'' (non tenuis) (n=2) 



=;//= 



Peten (type lot H, vernalis) (п=3) 



=//= 



Osa (type H. tenuis pittien) 



Diría (n= 



=//= 



Barra Honda (n=6) 



=^t 



Cabo Blanco (INBio) (n=22) 



=//= 



Turrubares (n=21) 



=//= 



Carara (n=3) 



=//= 



Peninsula de Osa (n=4) 



=//= 



FIG. 68, Expansion of outer lip of different 
populations of Helicina tenuis in Costa Rica 
according to Table 6; for explanations see Fig. 66. 



FIG. 70. Height of columellar axis of different 
populations of Helicina tenuis in Costa Rica 
according to Table 6; for explanations see Fig. 66. 



axis). Besides the small sample size, the 
comparatively high deviations among the 
specimens from Peninsula de Osa presum- 
ably reflect the fact that they originate from 
different sites on the Peninsula and cannot 
be considered as a real population the same 
as the others. Contrary to their small size the 
type of H. tenuis pittieri, collected about 100 



Cabo Blanco (n=54/30) 



:IC 



La Selva (n=0/4) 



7t 



Yucatán (type lot) (n=5) 



=//= 



Yucatán'' (non tenuis) (n=2) 



r/= 



Peten (type lot H vernalis) (n=3) 



=/í 



Osa (type H. tenuis pittieri) 



=//= 



Diriá (n=8) 



:^/= 



Barra Honda (n=6) 



=//= 



Cabo Blanco (INBio) (n=22) 



=//= 



Turrubares (n=21) 



=/i= 



Carara (n=3) 



=/i= 



Peninsula de Osa (n=5) 



=/t 



years ago on the same peninsula, is excep- 
tional big for the Pacific populations. It sug- 
gests that /-/. tenuis displays greater size 
variation in this area, but the scanty material 
does not allow further conclusions. 
Considering the sexual dimorphism, the av- 
erage shell height of Caribbean specimens 
from "La Selva" can be estimated approxi- 
mately 8.6 mm, thus being bigger than the 
Pacific populations. This may be caused by 
the drier climate on the northern Pacific side 
as compared to the Caribbean plain. 
In general, the average of the type lot of H. 
tenuis appears to be typical for the Mexican 
and Guatemalan areas, since many single 
specimens from this region were measured 
and approach a similar size. Nevertheless, 
smaller specimens were also present, as 
was the case for the type lot that also may 
have consisted of specimens from various 
localities in Yucatán. Goodrich & van der 



Cabo Blanco (n=54/30) 



-HL 



La Selva (n=0/3) 



l/t 



41- 



0.05 0.075 0.1 0.125 0.15 [ml] 0.2 



FIG. 69. Height of last whorl of different 
populations of IHelicina tenuis in Costa Rica 
according to Table 6; for explanations see Fig. 66. 



FIG. 71. Shell volume of different populations of 
¡Helicina tenuis in Costa Rica according to Table 
6; for explanations see Fig. 66. 



268 



RICHLING 



Cabo Blanco (n=54/30) 



La Selva (n=0/3) 



0.025 0.05 0.075 



[g] 



FIG. 72. Shell weight of different populations of 
Helicina tenuis in Costa Rica according to Table 
6; for explanations see Fig. 66. 



Schalie (1937) state for Peten and North Alta 
Verapaz, northern Guatemala, that shells 
from the southern region are a little smaller, 
unfortunately without giving any measure- 
ments. In conclusion, it can be assumed that 
the shell size of H. tenuis varies throughout 
the whole range of distribution, obviously 
depending on environmental factors. Near 
its southern limit of distribution in Costa 
Rica, the average size is smaller. 

Sexual Dimorphism: The 84 specimens of the 
Cabo Blanco population show clear differ- 
ences with the average size of females 
larger than males. The measurements over- 
lap, as shown for height and minor diameter 
in Fig. 73, but to a smaller degree than in H. 



funcl<i (Fig. 32). As may be expected, the 
volume (Fig. 71) best reflects the differ- 
ences, the average volume of male amounts 
only 73.6% of the females. The shell weight 
of both sexes is nearly equal (Fig. 72), there- 
fore males possess relatively heavier shells 
(Fig. 74). 

Habitat 

During this study, Helicina tenuis was only 
found in comparatively high abundance during 
the rainy season in the Cabo Blanco reserve. 
During the daily rains, the snails were seen 
crawling on and under living and dead leaves 
of bushes and palms and on stems. None 
were collected on the ground. In the same 
place, H. tenuis was nearly "absent" during the 
dry season, except for very few specimens 
that were aestivating in folded palm leaves. 
Two of these seven specimens found were 
visibly parasitized by larvae of trematodes, 
whereas no other helicinids ever were found 
to be infected in this obvious way. It is not 
clear where the majority of specimens retreat 
to during the dry period. In addition to the ar- 
boreal habitats, searches were conducted in 
the leaf litter and around the stems of bushes 



a 


1 




1 




1 


1 1 1 


1 

female <> 


















male + 




mm. 


















diam. 


- 














- 


[mm] 


















8 


- 










Ф 

^ - о ^ 

$ о 




- 


7.5 












0^ 4«^ 






7 






+ 


CO 

+ 


о о '^ 

+ 


0-И- 
+ 






6.5 


+ 


+ 

+ 
+ 


+ 
+ 


+ 


1 


1 1 1 


1 





6.5 



7.5 



9 height [mm] io 



FIG. 73. Range of measurements in females and males exemplary for height 
and minor diameter in the population from Cabo Blanco. 



CLASSIFICATION OF HELICINIDAE 



269 



weight 

[g] 



0.03 - 



о о 
о _, о ^8 

*■ + о<1 ^ о 



female 

male 

juvenile 



о ox 



'+ + 



о о 



0.1 



volume [ml] 



0.25 



FIG. 74. Relation of weight to volume in females and males of the populations 
from Cabo Blanco. 




FIG. 75. Records of Helicina tenuis in Costa Rica. 



270 



RICHLING 



and palms on the ground but without success. 
In other areas without such contrasting sea- 
sonal changes (e.g., near Nuevo Arenal, La 
Selva), H. tenuis was only found occasionally 
during the dry as well during the rainy season. 
There it was additionally found on the under- 
side of leaves of Musaceae or Heliconiaceae, 
respectively, which are absent in the drier 
Cabo Blanco area. 

These habitats correspond to those ob- 
served by Biolley (1897) for Costa Rica and 
Baker (1922b) from southern Veracruz in 
Mexico, who additionally found the species 
"on the ground and on leaves of shrubs and 
cacti in the savannah forests". Van der Schalle 
(1940) reported H. tenuis from Alta Verapaz in 
Guatemala as common and as being found 
near Panzamala "moving about on the vegeta- 
tion at night". 

With its occurrence on the Peninsula de 
Nicoya, H. tenuis tolerates the highest level of 
dryness among the Costa Rican Helicinidae 
and is the only species that can withstand the 
regular extended dry period during the year. 
As cited above, it also inhabits the Savannah 
in association with cacti. This comparatively 
high ecological tolerance of Helicina tenuis 
among the Helicinidae provides a possible 
explanation for its remarkably wide distribu- 
tion. 

Distribution 

The species reaches its northern limit in 
southern Mexico (states of Guerrero, Oaxaca, 
Veracruz) and occurs throughout Guatemala, 
Honduras, El Salvador, Nicaragua, Costa Rica 
to western Panama. Even more northern sites 
in Central Mexico (states of Jalisco and 
Guantajuato) were listed by von Martens 
(1890-1901), but the specimens have not 
been re-examined. The most southeastern 
record comes from the Tonosi, Los Santos 
Province, Panama (Pilsbry, 1926a). The 
specimens from Isla Barro Colorado in the 
Canal Zone of Panama (Pilsbry, 1930) seem 
to belong to another species (see "Discus- 
sion"). Helicina tenuis is found on the Carib- 
bean as well as on the Pacific side of the 
central mountain chains. Except for Lucidella 
lirata, it is thus probably the most widely dis- 
tributed species of Helicinidae of the Central 
American mainland. 

In Costa Rica, the species is not common, 
but was nevertheless found at several distinct 
localities (Fig. 75). According to the collec- 



tions, it seems to occur in relatively greater 
numbers in the Pacific plain, where it also ap- 
pears to be more widely distributed. Com- 
pared with areas investigated and inhabited by 
other helicinids (e.g., see H. funcki), the ap- 
parent lack of H. tenuis on the Caribbean side 
at many localities is remarkable, because the 
species is found in a similar habitat and is 
comparatively large. In fact, it is completely 
absent throughout the large province of Limón 
stretching along the entire Caribbean coast of 
Costa Rica. La Selva and Turrialba represent 
the most southeastern localities. 

Discussion 

The nomenclatural discussion of Helicina 
tenuis is complicated because several confu- 
sions have arisen and been maintained in lit- 
erature. 

First, it is important to note that Helicina 
tenuis is not preoccupied by Helicina tenuis С 
В. Adams, 1849 (now Stoastomops adamsi 
Baker, 1934) from Jamaica, because the latter 
name was published in September 1849 
(Baker, 1934a) and not as stated by von Mar- 
tens (1890) or Bequaert & Clench (1933) in 
1840. 

Traditionally, Helicina tenuis and H. lindeni, 
both described by L. Pfeiffer in the same pa- 
per, the second one page before the other, are 
regarded as synonyms or varieties of one spe- 
cies. Sowerby (1866) only mentions H. lindeni, 
and his drawing probably represents H. tenuis, 
but both figure and the very short paragraph 
on the species do not provide sufficient infor- 
mation to assess the status. Von Martens 
(1890: 34-35) proposed the synonymy with- 
out further explanation, except for a statement 
about the figure of H. lindeni in L. Pfeiffer 
(1850) "not good", and he used H. tenuis as 
the valid name, which also would have estab- 
lished priority because von Martens was the 
first revising author. Fischer & Crosse (1893) 
agreed upon the conspecificity, but claimed 
that H. lindeni had page priority and H. tenuis 
became a variety. None of these authors men- 
tions an investigation of the original material 
(Fischer & Crosse did so for H. vernalis), nor 
did they give reasons for their opinion. Inter- 
estingly enough, von Martens (1900: 604) re- 
plied in his supplemental part to the French 
authors, regarding tenuis as the most appli- 
cable name and remarked on the rather great 
distinctness L. Pfeiffer attributes to these spe- 
cies (see below). Because both publications 



CLASSIFICATION OF HELICINIDAE 



271 



are standard contributions on terrestrial mol- 
luscs for Central America, subsequent authors 
used the one or other name, but commonly 
adopted the synonymy. 

L. Pfeiffer (e.g., 1852a: 372, 388) assigned 
his two species to different higher groups ("§. 
8. Ecarinatae" [H. tenuis] and "§. 10. 
Subcarinatae" [H. lindem]). The descriptions 
and the subsequently published figures (L. 
Pfeiffer, 1850) (reprinted here in Fig. 76) are in 
fact not similar enough to support the syn- 
onymy. Obvious differences can be summa- 
rized in a less elevated shell in H. lindeni 
("globosa-conica" instead of "turbinata"; "spira 
acutiuscula" instead of "acuta" and the mea- 
surements). Furthermore, H. lindeni is slightly 
angulated and does not bear color bands, the 
outer lip is "breviter expanse, reflexiusculo" 
instead of "tenui, angulatim expanse". L. 
Pfeiffer's descriptions are short, but very pre- 
cise in certain details. Regarding the literature, 
the conclusions of von Martens and Fischer & 
Crosse can thus not be understood, especially 
the "not good" figure of H. lindeni, because it 
perfectly matches the written description. 
Since the type material of H. lindeni is still 
unavailable, possible deviations of the original 
material (perhaps seen by other authors) from 
the description that could have explained 
those conclusions, remain subject to specula- 
tion. A variety of H. lindeni from the Cuming 
collection (BMNH 20010757) fits well to the 
description and figure of H. lindeni. In conclu- 
sion, H. tenuis, for which a lectotype could be 
chosen in full agreement with the description 
and the current interpretation, is regarded as 
specifically distinct from H. lindeni. The Costa 
Rican specimens clearly belong to H. tenuis. 
According to comments and figure H. lindeni 
sensu Fischer & Crosse (1893) is synony- 
mous with H. tenuis. 

The type material of Helicina vernalis and H. 
chiapensis was investigated and the species 
are confirmed as synonyms of H. tenuis. The 
taxon H. vernalis verapazensis proposed by 
Wagner (1905) was included into the syn- 
onymy of H. tenuis by himself. 



The present status of Helicina tenuis pittleh 
is doubtful, because comparable material from 
the Peninsula de Osa is very scarce and the 
few specimens available show a high variation 
in size, are always not only smaller, but also 
belong to different sites. A common feature is 
the whitish band at the periphery, which is 
lacking in other Costa Rican populations. Con- 
sidering the high variation of the widespread 
H. tenuis and the lack of further distinguishing 
characteristics, H. tenuis pittieri is tentatively 
regarded as a synonym. Wagner (1910a: 
303), judging H. tenuis as variable and even 
not constant in local forms, presents only the 
new subspecies at the southern limit of the 
distribution as a "auffallender unterschiedene 
und anscheinend konstante Form" [strikingly 
different and apparently constant form]. Ac- 
cording to the original description and as far 
as it could be traced in collections (ZMB, SMF, 
MIZ [Wagner coll.]), it seems very likely that 
he only knew a single specimen, the holotype 
of the so-called "constant form". More north- 
ern records in Costa Rica Wagner included in 
the nominal form. 

Several records of H. tenuis from high eleva- 
tions (e.g.. Cerro Zunil) given by von Martens 
(1890-1901) likely refer to H. punctisulcata 
zunilensis, in one example cited it is very likely 
that the record exactly originates from the 
specimen on which Wagner (1910a) based his 
new subspecies. The record from the Canal 
island of Panama (Pilsbry, 1930) seems to be 
based on another species, because the size of 
the specimen (5/5.4 mm) is clearly beyond the 
range of /-/. tenuis. 

The record of H. oweniana for Costa Rica by 
Monge-Nájera (1997) was checked in the 
INBio collection. The lots INBio 1463452 and 
1464319 clearly determined before 1997, 
have to refer to H. tenuis. H. oweniana is fi- 
nally distinguished from H. tenuis by its or- 
ange colored outer lip, a more solid shell, a 
less impressed suture with its lower margin 
whitish. Helicina oweniana lacks the typical 
denticle at the transition from the outer lip to 
the columella. 




z^. 



Helicina (Tristramia) echandiensis 
Richling, n. sp. 

Type Material 



FIG. 76. Reproduction of the figures from L. Pfeiffer 
(1850) of A. Helicina tenuis. B. Helicina lindeni. 



Holotype: INBio 3542520, female (leg. 
Alexander Alvarado Méndez, 14.11.2001) 



272 



RICHLING 




FIGS. 77, 78. Helicina echandiensis n. sp. FIG. 77. Holotype, INBio 3542520, height 7.2 mm. FIG. 78. 
Paratype 1 , INBio 3542521 , height 6.5 mm; scale bar 2.5 mm. 



Paratype: INBio 3542521 , male (same data as 

holotype) 
Additional paratypes: INBio 3428246: 6 ads., 

1 s.ads., 9 juvs., INBio 3574064: 1 s.ad. 

(same data as holotype) 
Dimensions: 

Holotype: 7.2/6.8/7.3/6.2/4.4/5.3/5.4 mm 
Paratype 1: 6.5/6.1/6.5/5.7/3.9/4.8/5.1 mm 

Type Locality 

S-Costa Rica, Puntarenas Province, Parque 
Nacional La Amistad, Sector Las Alturas, 
Southern Cordillera de Talamanca, S of Cerro 
Echandi, campamento Echandi, 09°01'33"N, 
82°49'12"W, 2,840 m a. s.l. 

Etymology 

The name refers to the origin of the species, 
the Cerro Echandi. 

Examined Material 

INBio Collection 



Puntarenas: Zona Protectora Las Tablas, sec- 
tor Las Alturas, campamento de los 
nacientes del Rio Vella Vista, 08°59'39"N, 
82M9'18"W, 2,100 m a. s.l.: leg. E. Alfaro, 
13.11.2001: 1 ad. (INBio 3505804) 

Description 

S/?e//(Figs. 77, 78, 335J-K): conical, thin and 
fragüe, medium to small sized, only slightly 
shiny to dull. Color: basic color light orange- 
brownish; apex and upper whorl unicolored, 
only lighter towards the suture, about the 1 .5 
last whorls above periphery with a pattern of 
irregular, mostly parallel distinct white stripes 
in the same orientation as growth lines, 
about as wide as interspaces; stripes start- 
ing at suture and all ending at the same level 
a little above periphery. Surface textured 
with irregular growth lines and oblique 
grooves of different individual orientation but 
of same general direction (Fig. 80), causing 
the rather dull appearance. Embryonic shell 
with about 1 whorl; 37g (ЗУ2-4) subsequent 
whorls very straight; last whorl also straight 



CLASSIFICATION OF HELICINIDAE 



273 




FIG. 79. Axial cleft and muscle attachments of 
Helicina echandiensis n. sp., INBio 3542520; 
scale bar 2.5 mm. 



above and round at periphery and below; 
whorls equally extending in size, forming a 
very regular, pointed spire. Suture very 
slightly impressed. Aperture slightly oblique 
and straight, last whorl very slightly ascend- 
ing towards the aperture and inserting just 
below the periphery. Outer lip of a bright or- 
ange, thickened, moderately and equally 
expanded. Reflection nearly rectangular to 
the whorl; transition to columella forming a 
blunt edge with a very small denticle. Col- 
umella oblique and rather straight, transition 
to the body whorl smooth. Basal callus 
weakly developed, at the base more pro- 
nounced and granulated. 

Internal Shell Structures: (Fig. 79) 

Teleoconch Surface Structure: Helicina 
echandiensis n. sp. seems to lack the tran- 
sitional pattern (Fig. 80A), the whole 
teleoconch exhibits a structure of oblique 
diverging grooves (Fig. 80B). About the up- 
per half of the beginning of the 1^' whorl is 
occasionally sculptured with fine wrinkles 
parallel to the growth lines. Overlapping 
equally spaced periostracal spiral ridges 
also begin immediately at the teleoconch 
(Fig. 80A, arrow). 

Embryonic Shell (Fig. 81 ): Faced with the pau- 
city of material for Helicina echandiensis n. 
sp., only one specimen was studied under 
the SEM (INBio 3574064). The younger part 
of the embryonic shell appears compressed, 
as if it developed in slower growth, but this is 
not likely to be a typical feature. It is prob- 
ably not related to living conditions at high 
altitudes where the species is found, because 
the embryonic shell of H. punctisulcata 




FIG. 80. Teleoconch surface structure of Helicina 
echandiensis n. sp. A. Embryonic shell and 
begin of 1^' and 2""^ whorl, arrow indicates 
exemplarly an early spiral ridge. B. З''^ whorl; 
scale bars 500 pm (A), 100 |jm (B). 



274 



RICHLING 




FIG. 81. Embryonic shell of Helicina echandiensis 
n. sp.; scale bar 100 pm. 

cuericiensis n. subsp. Is normally developed. 
The arrangement of the pits is less regular 
than in the previous species, and the pits are 
relatively smaller. The embryonic shell size 
is much larger than in H. escondida n. sp. of 
equal shell size and even exceeds that of 
specimens of H. funcki from the lowlands. 
Diameter: 1,026 pm (± 36) (960-1,120) (n = 
9) (INBio 3428246, INBIo 3542520, INBio 
3542521). 





FIG. 82. Operculum of Helicina echiandiensis n. 
sp., INBio 3542520; scale bar 1 mm. 



FIG. 83. Radula of ¡Helicina echandiensis n. sp. 
A. Centrals. B. Comb-lateral. С Marginals; scale 
bars 50 |jm (A, B), 100 pm (C). 



CLASSIFICATION OF HELICINIDAE 



275 



Operculum (Fig. 82): very slightly calcified, 
calcareous plate covering only part of outer 
surface. Color horny-amber to orange, only 
near the columella whitish or transparent. 
Columellar side slightly irregular S-shaped, 
upper end acute and pointed, lower end con- 
tinuously changing into outer margin. 

Animal: In the preserved specimens, the soft 
body is greyish-blackish throughout. Only 
towards the sides and underside of the foot 
does the color become lighter. The sides of 
the foot and parts of the mantle are occa- 
sionally only spotted greyish. 

Radula (Fig. 83): Due to the lack of material, 
the radula of only one specimen was inves- 
tigated. Cutting edges in centrals rather 
crenulate than bearing cusps, comb-lateral 
with 10-11 cusps, cusps on marginals slowly 
increasing in number. Radula with 72 rows 
of teeth. 

Female Reproductive System (Fig. 84): The 
receptaculum seminis is long and slender 
and joins the descending limb of the V-organ 
at the middle of its inner side. The bursa 




FIG. 84. Female reproductive system of Helicina 
echandiensis n. sp., INBio 3542520; scale bar 
1 mm. 



copulatrix is moderately lobed, the flattened 
provaginal sac is of about equal size. It is 
clearly demarcated from its short and stout 
stalk, the distal side is irregularly subdivided. 
The pallia! oviduct is mainly transversally 
constricted. 

Morphometry and Sexual Dimorphism (Table 
7, Fig. 85) 

The material available is very limited, but 
because the sex of all these eight adult speci- 
mens could be determined (two by removal 
from the shell, the rest by external inspection 
enabled by the transparency of the shells), it 
seems worthwhile including them in the data. 

The measurements show a range of devia- 
tions that is higher than in the populations of 
the similarly sized Helicina escondida n. sp. 
for which a comparable number of specimens 
was analyzed. A sexual dimorphism is indi- 
cated with the females being bigger than the 
males, but the data overlapping slightly. The 
differences for height and minor diameter in 
females and males amount less than in such 
species as H. gemma and H. beatrix and re- 
semble those of H. escondida n. sp. In inter- 
polation from the minor diameter, males have 
a volume of about 75% that of females. 

Habitat 

The type locality is located in an area charac- 
terized by montane rain forest. The field notes 
of Alexander Alvarado Méndez state that the 
specimens were found in very humid, primary 



height (n=5/3) 



H Î 



minor diameter (n=5/3) 



outer lip (n=5/3) 



last whorl (n=5/3) 



columellar axis (n=5/3) 



12 3 



5 6 [mm] 7 



FIG. 85. Measurements of Helicina 
echandiensis n. sp. according to Table 7; on 
each line: mean value, standard deviation, 
absolute range; number of individuals given as 
"n = females/males "; upper line: females, 
lower line: males; in between and shaded: 
average of both. 



276 



RICHLING 



TABLE 7. Measurements of Helicina echandiensis n. sp. 
given as mean value with standard deviation, minimum 
and maximum value (min, max), and number of 
specimens (min. /max. diam. = minor/major diameter, col. 
axis = columellar axis); linear measurements fmml. 







"Cerro Echand 


i" (altitude 2840 m) 






lots INBio 3428246, 3542520, 3542521 






Mean 












Sex 


value 


Deviation 


Min 


Max 


Number 


Height 


f 


6.75 


0.34 


6.28 


7.18 


5 


Height 


m 


6.24 


0.22 


5.92 


6.53 


3 


Maj. diam. 


f 


6.40 


0.23 


6.02 


6.81 


5 


Maj. diam 


m 


5.78 


0.21 


5.50 


6.10 


3 


Min. diam. 


f 


5.87 


0.22 


5.59 


6.15 


5 


Min. diam. 


m 


5.34 


0.23 


5.08 


5.68 


3 


Outer lip 


f 


4.27 


0.19 


4.00 


4.55 


5 


Outer lip 


m 


3.75 


0.16 


3.52 


3.92 


3 


Last whorl 


f 


5.09 


0.25 


4.78 


5.45 


5 


Last whorl 


m 


4.62 


0.14 


4.41 


4.79 


3 


Col. axis 


f 


5.15 


0.22 


4.86 


5.44 


5 


Col. axis 


m 


4.79 


0.23 


4.50 


5 13 


3 




FIG. 86. Records of Helicina echandiensis n. sp. in Costa Rica. 



CLASSIFICATION OF HELICINIDAE 



277 



forest on black soil. The undergrowth mainly 
consisted of Heliconiaceae. Considering the 
shell color and the habitats of comparable spe- 
cies, it seems likely that Helicina echandiensis 
n. sp. was also found on these plants. 

Distribution (Fig. 86) 

Helidna echandiensis n. sp. is known only 
from the southern slopes of Cerro Echandi a 
little below the summit, from altitudes of 2,100 
to 2,840 m. The area is part of the central 
mountain chain of the Cordillera de Talamanca. 

Discussion 

Helicina eciiandiensis n. sp. is unique in its 
combination of characteristics. It can be distin- 
guished from the other species with a bright 
reddish-orange outer lip - H. gemma, 14. 
beatrix riopejensis n. subsp. - by the straight 
and uncurved form of the latter and the surface 
structure of oblique diverging grooves. Among 
helicinids of this shape and shell surface tex- 
ture it is comparable in size only to H. 
escondida n. sp., which has a light yellowish 
outer lip, a less pronounced surface structure, 
and more convex whorls. Furthermore /-/. 
escondida n. sp. lacks the characteristic diagonal 
white stripes and seems to be restricted to the 
Caribbean side of the central mountain chains. 

Helicina (Tristramia) punctisulcata 
cuehciensis 
Richling, n. subsp. 

Type Material 

Holotype: INBio 3542622 (leg. A. Picado, 

19.01.1996) 
Paratype: INBio 3542541, female (09°33'19"N, 

83°40'13"W, 2,600 m a. s. I.: colectado 



mediante sombrereta [collected by beating 
vegetation], leg. B. Gamboa, 29.10.1995) 
Dimensions: 

Holotype: 5.9/6.5/6.8/5.8/4.1/4.4/4.8 mm 
Paratype: 7.9/7.3/7.7/6.8/4.5/5.6/6.5 mm 

Type Locality 

Central Costa Rica, San José Province, 
Cordillera de Talamanca, Estación Cuerici, 4.5 
km E de Villa Mills, Sendero el Mirador, 
09°33'28"N, 83°40'13"W, 2,700 m a. s. I. 

Type Material of Relevant Taxa 

Helicina punctisulcata von Martens, 1890 

Helicina punctisulcata von Martens, 1890: 36- 
37, pi. I, fig. 10 

Type Material: Lectotype ZMB 103326a: leg. 
H. H. Smith, additional paralectotypes ZMB 
103326b, ZMB 103326c, ZMB 103325 
Von Martens based the description on mate- 
rial collected by H. H. Smith, which is in the 
collection of the ZMB. Four specimens from 
ZMB 103326 were marked to be figured by 
von Martens, of which only one matches the 
measurements given in the original descrip- 
tion, the other being much smaller (about 1.3 
to 1.8 mm smaller in the greater diameter). 
Furthermore, it best fits his upper right basal 
view, with a minute groove in the columellar 
region. This specimen is herein selected as 
lectotype (Fig. 87). 

Dimensions (height/greatest diameter/minor 
diameter): 
Lectotype: 7.2/8.9/7.8 mm 

Type Locality: "W Mexico: Omilteme, 8000 ft. 
on the Sierra Madre del Sur, State of 
Guerrero, Pacific side of the main cordillera" 




FIG. 87. Helicina punctisulcata, lectotype, ZMB 103326a, height 7.2 mm; scale bar 2.5 mm. 



278 



RICHLING 




FIG. 88. Helicina punctisulcata zunilensis, holotype, ZMB 103324, height 9.2 mm; scale bar 2.5 mm. 



Helicina punctisulcata zunilensis Wagner, 
1910 

Helicina punctisulcata zunilensis Wagner, 
1910a: 295, pi. 59, fig. 9 

Type Material: Holotype ZMB 103324 
Because the original description refers to 
one specimen in the museum in Berlin, the 



single specimen matching the figure is the 

holotype (Fig. 88). 

Dimensions (height/greatest diameter/minor 

diameter): 

Holotype: 9.2/10.2/8.7 mm 

Type Locality: "Vulkan Zunil in Guatemala" 
[Guatemala, at border of Quezaltenango and 
Solóla departments, volcano Volcán Zunil] 




FIGS. 89, 90. Helicina punctisulcata cuericiensis n. subsp. FIG. 89. Holotype, INBio 3542622, height 
5.9 mm. FIG. 90. Paratype, INBio 3542541, height 7.9 mm; scale bar 2.5 mm. 



CLASSIFICATION OF HELICINIDAE 



279 




FIG. 91. Axial cleft and muscle attachments of 
Helicina punctisulcata cuericiensis n. subsp., 
INBIo 3542622; scale bar 2.5 mm. 

Etymology 

The name refers to the origin of the species, 
the Cerros Cuerici. 

Examined Material 

INBio Collection 

San José: Estación Cuerici: Sendero el 
Mirador 4.5 ¡<mE de Villa Mills, 09°33'28"N, 
83°40'13"W, 2,700 m a.s.l.: leg. A. Picado, 
19.01.1996 (INBio 3542622); 19.01.1996 
(INBio 3542527); colectado en una planta 
[collected on a plant] 26.06.1996, leg. В 
Gamboa (INBio 3544828); 2J50 m a.s.l. 
leg.A. J.Mora, 27.11.1995 (INBio 3542528) 
09°33'19"N, 83°40'13"W, 2,600 m a.s.l. 
colectado mediante sombrereta [collected 
by beating vegetation], leg. B. Gamboa, 
29. 1 0. 1 995 (INBio 3542541 ); recolectado en 
una rubiaceae caminando [collected crawl- 
ing on a Rubiaceae], leg. A. Picado, 
26.08.1995 (INBio 3542539) 

Description 

Shell (Figs. 89, 90, 335L-M): Conical, solid, 
medium to small sized and only slightly 
shiny to dull. Color: apex and upper whorl 
dark yellow, becoming lighter with growth 
and increasingly whitish spotted, towards 
the aperture changing to whitish with small 
yellowish spots. Surface textured with ir- 
regular growth lines and oblique grooves of 
different individual orientation but of the 
same general direction (Fig. 92), causing the 
dull appearance; last two whorls with 3-4 
equally spaced spiral grooves. Embryonic 



] 




/7 




y 



FIG. 92. Teleoconch surface structure of Helicina 
punctisulcata cuericiensis n. subsp. A. 2""^ whorl, 
partly eroded. B. 4"" whorl; scale bar 100 pm. 



280 



RICHLING 




FIG. 93. Embryonic shell of Helicina punctisulcata 
cuericiensis n. subsp.: scale bar 100 pm. 



shell with about 1 whorl; 3% (3%-4У2) sub- 
sequent whorls straight, the last whorl very 
slightly angulated at the periphery and 
rounded below; whorls equally extending in 
size, forming a very regular, pointed spire. 
Suture moderately impressed. Aperture ob- 
lique and straight, last whorl slightly de- 
scending towards aperture and inserting 
below the periphery. Outer lip yellowish, re- 





FIG. 94. Operculum of Helicina punctisulcata 
cuericiensis n. subsp., INBio 3542622; scale bar 
1 mm. 



FIG. 95. Radula of Helicina punctisulcata 
cuericiensis n. subsp. A. Centrals. B, Comb- 
lateral. С Marginals; scale bar 50 pm. 



CLASSIFICATION OF HELICINIDAE 



281 



markably thickened and equally expanded, 
edge appearing rounded. Transition to col- 
umella protruding, forming a blunt edge with 
a denticle. Columella very short and curved, 
transition to the body whorl with sharply im- 
pressed line. Basal callus well developed, 
very pronounced in umbilical area and finely 
granulated. 

Internal Shell Structures: (Fig. 91) 

Teleoconch Surface Structure (Fig. 92): In all 
of the few available specimens, the begin- 
ning of the teleoconch is eroded. On the 
second whorl, the surface is sculptured with 
oblique diverging grooves continuing 
throughout the whole teleoconch. This pat- 
tern is interposed with distinct, irregular 
growth lines (Fig. 92B) and spiral grooves, 
which are characteristic for Helicina 
punctisulcata cuehciensis n. subsp. 

Embryonic Shell (Fig. 93): Only a single speci- 
men could be studied. The structure is simi- 
lar to that of Helicina funcki. As in H. 
echandiensis n. sp. the diameter is relatively 
very large. 

Diameter: 1 ,038 pm (± 1 5) (1 ,000 1 ,060) (n = 
5) (INBio 3544828, 3542541, 3542539, 
3542528, 3542622). 




FIG. 96. Female reproductive system of Helicina 
punctisulcata cuehciensis n. subsp., INBio 
3542528; scale bar 1 mm. 



Operculum (Fig. 94): Very slightly calcified, 
calcareous plate covering only part of the 
outer surface. Color horny-amber, at 
nucleus nearly transparent. Columellar side 
slightly regularly S-shaped, upper end acute 
and pointed, lower end rounded, but slightly 
truncated. 

Animal: In preserved specimens, the soft body 
is greyish-black throughout, only towards the 
sides and underside of the foot the color 
becomes lighter to whitish-yellowish. The 
dark color of the mantle gives the shells of 
live specimens a greenish tinge. 

Radula (Fig. 95): Only two specimens were 
investigated. The B-central bears 8 well de- 
fined cusps, whereas A- and C-central may 
be a little crenulated. Comb-lateral with 8 11 
cusps, cusps on marginals slowly increasing 
in number. Radula with about 60 rows of 
teeth. 

Female Reproductive System (Fig. 96): The 
V-organ is comparatively slender, the oblong 
receptaculum seminis joins its descending 
limb about the middle of the inner side. The 
bursa copulatrix is relatively large and com- 
pact, it is subdivided in a few simple lobes. 
The provaginal sac is oblong and finely ir- 
regularly lobed at its distal side, a stout, 
short duct continues to the reception cham- 
ber. The sac is blackish pigmented. 

Morphometry and Sexual Dimorphism 

The amount of material is too limited to be 
analyzed. The shape of the holotype is repre- 
sentative for all other specimens except for 
the paratype, which is higher elevated and 
more evenly rounded at the periphery. The 
holotype is the smallest specimen, whereas 
the paratype is the largest. 

Two specimens dissected for anatomical 
studies are females, of which one is the 
paratype. The other specimen represents the 
smallest of the four live-collected individuals. 

Habitat 

The field notes from the collectors of INBio 
indicate that the species climbs on vegetation, 
where it was found "en una rubiaceae 
caminando [crawling on a Rubiaceae]" or by 
beating vegetation. The type locality is situ- 
ated in a transitional zone of montane rain for- 
est to paramó vegetation. 



282 



RICHLING 



Distribution (Fig. 97) 

Helicina punctisulcata cuericiensis n. subsp. 
is only recorded from the main ridge of the 
northern Cordillera de Talamanca west of the 
Cerros Cuerici. 

Discussion 

The specimens were tentatively classified as 
a new subspecies of Helicina punctisulcata 
because of the resemblance to this species 
and its subspecies H. p. zunilensis in the shell 
surface structure, color, shell thickness, and 
development of the outer lip, with a protruding 
denticle and the impressed line near the col- 
umella. In fact, differences are only shell 
shape, size, and color detail. The compara- 
tively widely spaced spiral grooves are the 
most remarkable common feature that also 
distinguishes the "punctisulcata'-group from 
other species of Helicinidae of similar size. 
The only exception is H. raresulcata L. Pfeiffer, 
1861, differing in a more globose, slightly 



angulated and shouldered shape of the shell 
(rather similar to H. merdigera see under H. 
monteverdensis n. sp.), which furthermore 
occurs on the Caribbean side of Mexico in 
Veracruz, whereas the subspecies of the 
"punctisulcata"-group all originate from high 
altitudes in the Pacific or Central mountains. 
Besides the types of H. punctisulcata, similar 
spirally grooved specimens come from El Sal- 
vador (Laguna de las Ranas, 1,730 m a. s. I., 
leg. A. Zilch, 16.7.1951, SMF), Guatemala, 
Huehuetenango Department (5 km W of 
Aguacatan, 15°20'44"N, 9Г23'03"\Л/, 1,910 m 
a.s.l., leg. F. G. Thompson et al.UF 190472, 
UF 190225), and Honduras, Santa Barbara 
Department (Cerro Santa Barbara, ridge 
above El Cedral, 14°54'55"N, 88°07'30"W, 
2,800 m a.s.l., leg. J. Polisar, UF 242644). As 
can be seen, all these specimens also come 
from high elevations. 

Helicina p. cuericiensis n. subsp. is smaller 
and has a more intense yellow color. Contrary 
to /-/. p. zunilensis, the spiral grooves are re- 
stricted to the upper half of the whorls. The 




FIG. 97. Records of Helicina punctisulcata cuericiensis n. subsp. in Costa Rica. 



CLASSIFICATION OF HELICINIDAE 



283 



nominal subspecies appears to be consis- 
tently less elevated (broader than high), and 
the lower margin of the outer lip is less pro- 
truding. The few Costa Rican specimens vary 
remarkably in the relation of height and diam- 
eter. But lacking more material for either of the 
subspecies, the extent of variations, the distri- 
bution and ecological data remain only 
fragmentarily known, which is why the sub- 
specific classification is maintained, although 
H. p. punctisulcata diverges more strongly 
from the two southern subspecies. Assuming 
a restriction to higher altitudes, the three sub- 
species are separated by the low elevations at 
the Isthmo de Tehuantepec and the Nicara- 
guan depression respectively. 

An additional single specimen from Costa 
Rica (San José Province, Parque Nacional 
Chirhpó, Fila Cementeho de la Máquina, 4 km 
E de San Gerardo, 09°27'49"N, 83°33'40"W, 
2,200 m a. s. I-, leg. Alexander Alvarado 
Méndez, 08.10.2001 , INBio 3428245) is larger 
than H. punctisulcata cuericiensis n. subsp. 
and is similar to H. punctisulcata zunilensis, 
but, due to the lack of sufficient material, its 
proper determination must await further com- 
parative data. 



(Pittier & Biolley); Santa Clara, 200 m [7.5 
km NW of Upala, about 10°56'N, 85°05'W, 
Alajuela Province] (Biolley); Valley of Alta 
Coca, near Talamanca, 1,000 m (Pittier) 
[probably referring to Alto Coén, recently 
called San José Cabécar, about 09°30'35"N, 
83°08'22"W, 500 m a.s.l., Limón Province]; 
between Uiskur and Mokri [not localized], 
Alta Talamanca, further in Alta Dren [Alto 
Urén: 09°23'50"N, 82°59'02"W, 900 m a.s.l.. 
Limón Province], and between Ukatschka 
and Bruschik, in Alta Taruria [Alto Tararla, 
about 09°14'30"N, 83°00'30"W, 2,500 m a.s.l. 
or downstream. Limón Province] (Pittier) 

Aleadla {Leialcadia) beatrix - Wagner, 1908: 
83-84, pl. 14, figs. 19-22 

Oligyra {Succincta) beatrix beatrix - Baker, 
1922a: 45 

Hellclna (Oligyra) beatrix- Pilsbry, 1926a: 59, 
69, fig. ЗА, 71: Panama: Bocas del Toro: 
Mono Creek (Olsson) 

?Hellclna beatrix - Pilsbry, 1926b: 127: Costa 
Rica: La Emilia, < 100 ft. [not localized] (Rehn) 

Hellclna beatrix Monge-Nájera, 1997: 113: 
Costa Rica [in part] 

Original Description 



Hellclna {"Gemma") beatrix beatrix 
Angas, 1879 

Hellclna beatrix Angas, 1879: 484, pl. XL, fig. 13 
Hellclna beatrix - Pilsbry, 1891: 332 
Hellclna flavlda var. - von Martens, 1890: 39 
Hellclna beatrix - Fischer & Crosse, 1893: 435 
Hellclna flavlda var. beatrix - von Martens, 

1900: 606: E-Costa Rica: Talamanca (Pittier); 

Valley of Tuis [about 09°51'N, 83°35'W] 



"Shell conical, solid, shining; as seen through 
the lens, very finely transversely striated; 
whorls 6, very slightly convex, the four upper- 
most chestnut, the fifth dark red, with an 
opaque whitish band below the suture, the last 
pale olive-green, with a similar opaque band at 
the suture; outer lip thickened, a little expanded 
and reflexed; aperture quadrately semilunate. 
Var. Smaller and straw-coloured thoughout. 
Diam. 4V2, alt. 5 lin. 




FIG. 98. Hellclna beatrix, lectotype, BMNH 1879.7.22.29, height 10.1 mm; scale bar 2.5 mm. 



284 



RICHLING 



Very few specimens. "Found only on the hills 
up to an elevation of 2,500 feet. Animal dark 
grey above, sides and foot white" (Gabb). Ap- 
proaches H. heloisae, Sallé, but larger and 
much more conical." 

Type Material 

BMNH 1879.7.22.29-31 (leg. Gabb) 
Angas (1879: 475) stated that his type mate- 
rial would be placed in the collection of the 
British Museum, the lot is labeled with "type". 
Of the three specimens, one represents the 
dark red opaque whitish banded typical form, 
the other two the straw colored variety sepa- 
rated by the author. Therefore, the latter two 
specimens are not regarded as syntypes. The 
remaining specimen (BMNH 1879.7.22.29), 
also perfectly matching the figure in the origi- 
nal description, is here selected as lectotype 
of Helicina beathx (Fig. 98). It still bears its 
operculum and was probably collected live. 
The two other specimens (one with operculum 
inside) are much smaller and show a whitish 
to slightly yellowish color (perhaps faded since 
the description of Angas), and in one a slight 
whitish subsutural banding is visible. They are 
regarded here as H. beatrix confusa. 
Dimensions: 
Lectotype BMNH 1879.7.22.29: 

10.1/8.3/8.9/7.7/5.3/7.1/8.2 mm; 

BMNH 1879.7.22.30 31 Helicina beatrix var. 

sensu Angas, now referred to H. beatrix 

confusa: 

7.3/6.9/7.2/6.3/4.3/5.5/5.7 mm 

7.0/6.3/6.6/5.9/4.1/5.4/5.6 mm 



Type Locality 

"Costa Rica, only on the hills up to an eleva- 
tion of 2,500 feet". 

Type Material of Synonymous Taxa or Similar 
Species 

Helicina beatrix nicaraguae (Wagner, 1908) 

Aleadla (Leialcadia) beatrix nicaraguae 
Wagner, 1908: 84, pi. 14, figs. 23-24 

Type Material: MIZ 8408: "Nicaragua" 
Wagner did not refer to any type material, 
but his collection contains only one lot with 
two specimens. It is labeled to be figured 
and the larger shell perfectly matches the 
drawing. It is here selected as lectotype 
(Fig. 99). The paralectotype (MIZ 8408b) is 
not fully grown. 
Dimensions: 
Lectotype MIZ 8408a: 
10.2/8.7/9.1/8.1/5.3/7.3/8.1 mm 

Type Locality: Nicaragua 
Unfortunately, the locality Nicaragua is not 
further specified on Wagner's rewritten label, 
and an original label is lacking, therefore, it 
cannot be traced further. 

Examined Material 

Leg. I. RicHLiNG 

Limón: W Guayacán, abandoned banana 
plantation, 10°0r53"N, 83°32'14"W, 520 m 




FIG. 99. Helicina beatrix nicaraguae, lectotype, MIZ 8408a, height 10.2 mm; scale bar 2.5 mm. 



CLASSIFICATION OF HELICINIDAE 



285 



a. s. I., 03.09.1999: (IR 1078); (IR 1081): 
12.09.1999: (IR 1087); 15.03.2000: (IR 
1360); 17.03.2001: (IR 1606) 

INBio Collection 

Limón: Suerre de Jiménez, 10°11'31"N, 
83'44'49"W, 330 m a.s.l., leg. Richard 
Helling, 26.02.1994: 1 ad. (INBio 1467201) 
Reserva Biológica Hitoy Cerere, Sendero 
Bobócara, 09M0'53"N, 83^^04'09"W, 798 m 
a.s.l., leg. Alexander Alvarado Méndez, 
17.06.1999: 1 ad. (INBio 3542522) 

Cartago: (determination uncertain) ?Parque 
Nacional Barbilla, bosque secundario, 
09°57'52"N, 83^^26'59"W, 400 m a.s.l., leg. 
malacological staff of INBio, 12.01.2001: 1 
ad. (INBio 3324279) 

?Zona Protectora Rio Pacuare, Sector de la 
Estación de Barbilla, 09'58'50"N, 
83°27'08"W, 500 m a.s.l., leg. Alexander 
Alvarado Méndez, 05.09.2000: 1 s.ad. 
(INBio 3542905) 

Zona Protectora Rio Pacuare, Las Brisas de 
Pacuarito, 10^^02'00"N, 83'^28'00"W, 400 m 
a.s.l., leg. malacological staff of INBio, 
29.04.2001: 1 ad. (INBio 3418572) 

Other Sources 

COSTA RICA 

Limón: Finca Los Diamantes, 1,000 ft. [about 
lO^MI'N, 83°37'W], leg. A. Starrett, 
22.08.1963: 1 ad. (UF 243509) 
Entre Ukatschka et Brushik, Haut Tararia 
[about 09'^14'30"N, 83^^00'30"W. 2,500 m 
a.s.l. or downstream, Limón Province], leg. 
H. Pittier, IX.98 (ZMB 103251) 



San José: Carillo [?about 10°09'N, 83°57'W], 
coll. E.R. Sykes (BMNH) 

Cartago: Turrialba [about 09°54'30"N, 
83°4rW], coll. H. Jaeckel: 1 ad. (SMF 
209575/1); coll. H. Rolle, coll. С Bosch: 3 
ads., 1 s.ad. (SMF 180668/4); coll. Rolle: 3 
ads. (ZMB 103812); Plattino, Turrialba 
[about 09'54'30"N, 83°41'W], leg: University 
of Alabama, M. Smith coll. (MS-15183): 4 
ads. (UF 95337) 

Tuis [about 09^^51 'N, 83^^35'W], leg. H. 
Pittier: 1 ad. (ZMB 103252) 

Costa Rica, without locality further specified: 
coll. Wagner (MIZ 8407); leg. R Biolley: 3 
ads., 1 s.ad. (MHNN) 

Description 

Shell (Figs. 100, 336A): Conical-globose, 
solid, medium sized and shiny. Color: upper 
whorls chestnut to reddish-brown, getting 
darker from apex down, towards last whorl 
changing to pale olive-green-greyish, to- 
wards aperture even opaque, in 2.5 last 
whorls an opaque whitish band directly be- 
low suture. Periostracum very thin, shiny 
and smooth, except for very fine growth 
lines. Embryonic shell with about 1 whorl; 
4%-5 (lectotype: 5) subsequent whorls very 
slightly convex; last whorl equally rounded at 
periphery; upper whorls more rapidly ex- 
tending in size; whorls rapidly descending, 
forming a high spire. In the area of the band 
surface more inflated. Suture slightly im- 
pressed. Aperture oblique and in its middle 
part remarkably curved backwards. Outer lip 




FIG. 100. Helicina beatrix beatrix, Guayacán, IR 1087, height 9.4 mm; scale bar 2.5 mm. 



286 



RICHLING 




FIG. 101. Axial cleft and muscle attachments of 
Helicina beatrix beatrix, IR 1087; scale bar 5 mm. 



always whitish-opaque, similar to the band, 
thickened and very narrowly reflexed; tran- 
sition into columella continuous without any 
notch or only a very small one. Basal callus 
weakly developed and nearly completely 
smooth or very little granulated. 

Internal Shell Structures: (Fig. 101) 

Teleoconch Surface Structure (Fig. 102): The 
section of the transitional structure encom- 
passes about the first half whorl. A very short 
zone structured with oblique diverging 




FIG. 103. Embryonic shell of Helicina beatrix 
beatrix; scale bar 100 \jn\. 





grooves a replaced by fine growth lines con- 
tinuing up to the aperture. 

Embryonic Shell (Fig. 103): The spirally ar- 
ranged pits are consistently much smaller 
than in Helicina funcki, and the interspacial 
distance exceeds the diameter of the pits. 
The pattern appears much finer, the smooth 
surface is more prominent. 




FIG. 102. Teleoconch surface structure of Helicina 
beatrix beatrix, 2"'^ whorl; scale bar 500 |jm. 



FIG. 104. Operculum of Helicina beathx beatrix, 
IR 1087; scale bar 1 mm. 



CLASSIFICATION OF HELICINIDAE 



287 












Diameter: 963 |jm (± 33) (900-1010) (n = 
15) (IR 1078, IR 1081, IR 1087, IR 1360, IR 
1606); 1,040 piTi (BMNH 1879.7.22.29, lec- 
totype). 

Operculum (Fig. 104): Very slightly calcified, 
calcareous plate covering only part of the 
outer surface, thickened towards the col- 
umellar side. Color horny-amber, only near 
the columella whitish, but still somewhat 
transparent. Columellar side slightly S- 
shaped, both ends acute, upper end 
pointed, lower slightly rounded. 

Animal (Fig. 338A): The soft body is 
unicolored, whitish yellow throughout, only 
the tentacles may show a tinge of grey, the 
mantle is whitish pigmented. There is no 
trace of any dark spots. 

Radula (Fig. 1 05): Because the radulae of the 
different subspecies are very similar, they 
are treated under Helicina beatrix beatrix. 
Central A to С may occasionally bear a few 
cusps, the B-central most frequently. Comb- 
lateral with 6-8 denticles, only two aberrant 
forms with a plain edge or 13 cusps respec- 
tively. Cusps on marginals rapidly increasing 




FIG. 105. Radula of Helicina beatrix beatrix. A. 
Centrals. B. Comb-lateral. С Marginals; scale 
bars 50 |jm (A, B), 100 pm (C). 



FIG. 106. Female reproductive system oí Helicina 
beatrix beatrix, IR 1087; scale bar 1 mm. 



288 



RICHLING 




Guayacán {n=7/5) 



uayi 



Rio Peje (n=92/61) 



:7t 



Uatsi (n=11/13) 



ZIC 



Shiroles (n=18/10) 



-^L 



Hitoy Cerere(n=10/6) 



7£: 



HItoy Cerere - Miramar (n=2/1) 



://: 



Turnalba (n=10) 



=//= 



Lectotype (H beatrix) 



=/t 



BMNH 1879.7.22,30-31 (n=2) 



=/t 



Brushik (type H Ь. confusa) 



^t^ 



H. beatrix beatrix , 



H. beatrix riopejensis 



H beatrix cor)fusa 



H. beatrix beatrix 



H beatrix confusa 



FIG. 107. Variability of the female reproductive 
system of Helicina beatrix beatrix, IR 1087; scale 
bar 2.5 mm. 



Guayacán (n=7/5) 



luay 



H beatrix beatrix , 



Rio Peje (n=92/61) 



-JL 



H beatrix riopejensis 



Uatsi(n=11/13) 



7t 



H beatrix confusa 



Shiroles (n=18/10) 



:IC 



Hitoy Cerere (n=10/6) 



:JC 



Hitoy Cerere - Miramar (n=2/1 ) 



:IL 



Turrialba (n=10) 



H beatrix beatrix 



::/!= 



Lectotype ( H beatrix) 



::lt= 



BMNH 1879.7.22.30-31 (n=2) 



H beatrix confusa 



=//= 



Brushik (type H b. confusa) 



=//= 



4 5 6 7 8 9 [mm] 10 

FIG. 108. Shell height of different populations 
and subspecies of Helicina beatrix in Costa Rica 
according to Table 8; on each line: mean value, 
standard deviation, absolute range; number of 
individuals given as "n = females/males or total"; 
upper line: females, lower line: males if separate; 
in between and shaded: average of both for 
comparison with populations of unknown sex; 
sex of individuals from Hitoy Cerere and Hitoy 
Cerere - Miramar not determined anatomically 
(see text). 



FIG. 109. Minor diameter of shell of different 
populations of Heliciria beatrix beatrix and 
subspecies in Costa Rica according to Table 8; 
for explanations see Fig. 108. 

in number, only in nominal subspecies does 
a change to more denticles a little more out- 
wards take place, perhaps caused by of the 
larger size of this form. The same is true for 
the number of rows of teeth: about 91 -1 38 
in H. b. beatrix, in the other two subspecies 
only about 66-79. 



=7/= 



Guayacán (n=7/5) 



uay 

Ж 



H beatnx beatrix , 



Rio Peje(n=92/61) 



:IL 



14 beatrix riopejensis 



Uatsi(n=10/13) 



H beatrix confusa 



^L 



Shiroles (n=18/10) 



Hitoy Cerere (n=10/6) 



1С 



Hitoy Cerere - Miramar (n=2/1 ) 



IL 



Turrialba (n=10) 



H beatrix beatrix 



:://= 



Lectotype (H beatnx) 



^t^ 



BMNH 1879,7.22.30-31 (n=2) 



H beatrix confusa 



=il= 



Brushik (type H Ь. confusa) 



=lt:^ 



7 [mm] 8 



FIG. 110. Expansion of outer lip of different 
populations and subspecies of ¡Helicina beatrix in 
Costa Rica according to Table 8; for explanations 
see Fig. 108. 



CLASSIFICATION OF HELICINIDAE 



289 



Guayacán (п=7/5) 



lUay; 



H beatrix beatrix , 



Rio Peje (n=92/61) 



Ж 



H beatrix riopejensis 



Uatsi(n=11/13) 



H beatrix confusa 



:JC 



Shiroles (n=18/10) 



://: 



HltoyCerere(n=10/6) 



:JL 



Hitoy Cerere - Miramar (n=2/1 ) 



^L 



Turrialba (n=10) 



H beatrix beatrix 



:Î/= 



Lectotype(H beatrix) 



=//= 



BMNH 18797 22.30-31 (n=2) 



H beatrix confusa 



=/t 



Brushik (type H b. confusa) 



=//= 



FIG. 111. Height of last whorl of different 
populations and subspecies of Helicina beatrix 
in Costa Rica according to Table 8; for 
explanations see Fig. 108. 

Female Reproductive System (Figs. 106, 
107): The ascending limb of the V-organ is 
relatively short and stout. The receptaculum 
seminis is rather large. The bursa copulatrix 
consists of a few irregularly shaped lobes; 
the provaginal sac is sonnewhat inflated and 
shows a simple outline, the stalk is short. 
The palliai oviduct is strongly constricted. 



Guayacán (n=7/5) 



luay 



H beatnx beatrix , 



Rio Peie (n=70/49) 



It- 



Hbeatnx riopejensis 



Uatsi (n=11/13) 



H beatrix confusa 



:;/= 



Shiroles (n=17/9) 



:JL 



Hitoy Cerere (n=10/6) 



HC 



Hitoy Cerere - Miramar (n=2/1 ) 



HC 



Turrialba (n=10) 



=/t 



H beatnx beatnx 



Lectotype (H beatnx) 



=/t 



BMNH 1879.7.22 30-31 (n=2) 



lit 



H beatnx confusa 



Brushik (type H b. confusa) 



=//= 



Guayacán (n=7/5) 






H tjeatrix beatrix 


1 1 


Rio Peje (n=91/61) 






l-i beatrix riopejensis 


_u 1 ' 


Uatsi (n=1 1/13) 






H. beatrix confusa 


1 


Shiroles (n=18/10) 













0.12 0.16 0.2 



FIG. 1 1 3. Shell volume of different populations and 
subspecies of Helicina beatrix in Costa Rica 
according to Table 8; for explanations see Fig. 108. 



Morphometry and Sexual Dimorphism (Table 
8, Figs. 108-114) 

For comparison, the different subspecies are 
all discussed in conjunction with the nominal 
subspecies. The material available for 
Helicina beatrix beatrix remains very scanty, 
although during the field work several efforts 
were made to find the species in greater abun- 
dance and at different localities. The only 
specimens studied anatomically are those 
from Guayacán. Because the "Turrialba" 
population is united from lots of three different 
collections, they may originate from different 
localities around Turrialba. 

The specimens of H. beatrix confusa included 
from the INBio collection (Hitoy Cerere, Hitoy 
Cerere - Miramar) could not be analyzed for 
their sex by dissection. To make them never- 
theless available for morphometric comparison, 
the degree of sexual dimorphism found in the 
dissected populations was used to attribute the 
probable sex to the specimens in reverse con- 
clusion (see below). These data cannot prima- 
rily be used to investigate sexual dimorphism. 



Guayacán (n=7/5) 



H. beatrix beatrix , 



Rio Peje (n=91/61) 



H beatrix riopejensis 



Uatsi (n=11/13) 



H beatrix confusa 



Shiroles (n=18/10) 



0.02 0.04 0.06 0.( 



[g] o.v 



FIG. 112. Height of columellar axis of different 
populations and subspecies of Helicina beatrix in 
Costa Rica according to Table 8; for explanations 
see Fig. 108. 



FIG. 114. Shell weight of different populations 
and subspecies of Helicina beatrix in Costa 
Rica according to Table 8; for explanations see 
Fig. 108. 



290 



RICHLING 



TABLE 8. Measurements of different populations and subspecies of Helicina beatrix given as mean 
value with standard deviation, minimum and maximum value (min, max), and number of specimens; 
sex of individuals from Hitoy Cerere and Hitoy Cerere - Miramar not determined anatomically (see 
text) (min. /max. diam. = minor/major diameter, col. axis - columellar axis); linear measurements [mm], 
weight [g], volume [ml]. 



Helicina beatrix beatrix 

"Guayacán" (altitude 520 m) 

lotsIR 1078, IR 1087, IR 1081 



IHelicina beatrix riopejensis n. subsp. 

"Rio Peje" (altitude 135 m) 
lots IR 440, IR 752, IR 1303, IR 1550 







Mean 










Mean 












Sex 


value 


Deviation 


Mm 


Max 


Number 


value 


Deviation 


Min 


Max 


Number 


Height 


f 


9.59 


0.16 


9.31 


9.88 


7 


7.72 


0.26 


6.95 


8.53 


92 


Height 


m 


8.39 


0.13 


8.26 


8.71 


5 


6.51 


0.20 


6.10 


7.17 


61 


Maj diam. 


f 


8.67 


0.22 


8.33 


9.08 


7 


6.89 


0.19 


6.00 


7.93 


92 


Maj. diam. 


m 


7.75 


0.08 


7.64 


7.88 


5 


5.97 


0.15 


5.46 


6.33 


61 


Min. diam 


f 


8.12 


0.21 


7.78 


8.57 


7 


6.39 


018 


5.75 


7.00 


92 


Min. diam. 


m 


7.15 


0.10 


702 


7.32 


5 


5.50 


0.14 


5.20 


5.97 


61 


Outer lip 


f 


5.61 


0.12 


5.31 


5.77 


7 


4.45 


0.12 


3.75 


4.90 


92 


Outer lip 


m 


5.13 


0.07 


5.03 


5.22 


5 


3.98 


0.13 


3.68 


4.40 


61 


Last whorl 


f 


7.45 


0.13 


7.23 


7.65 


7 


5.83 


0.18 


5.25 


6.42 


92 


Last whorl 


m 


6.58 


0.06 


6.49 


669 


5 


5.03 


0.19 


4.53 


5.47 


61 


Col. axis 


f 


7.83 


0.13 


7.56 


801 


7 


6.28 


0.22 


5.59 


6.88 


70 


Col. axis 


m 


6.88 


0.15 


6.75 


7.24 


5 


5.24 


0.19 


4.85 


5.78 


49 


Weight 


f 


0.069 


0.014 


0.046 


0.092 


7 


0.035 


0.005 


0.018 


0.051 


91 


Weight 


m 


0.053 


0.018 


0.034 


0.082 


5 


0.027 


0.003 


0.018 


0.044 


61 


Volume 


f 


0.232 


0.014 


0.212 


0.253 


7 


0.115 


0.009 


0.084 


0.147 


91 


Volume 


m 


0.156 


0.006 


0.145 


0.169 


5 


0.071 


0.005 


0.058 


0.089 


61 





¡Helicina beatrix confusa 

"Uatsi" (altitude 30 m) 

lotsIR 1112, IR 1113, IR 1567 



Helicina beatrix confusa 

"Shiroles" (altitude 120 m) 

lots IR 910, IR1327, IR 1594, IR 1600, 

IR 1646 







Mean 










Mean 












Sex 


value 


Deviation 


Min 


Max 


Number 


value 


Deviation 


Min 


Max 


Number 


Height 


f 


8.17 


0.28 


7.59 


8.60 


11 


7.76 


0.17 


7.40 


8.37 


18 


Height 


m 


7.10 


0.17 


6.72 


7.50 


13 


6.35 


0.17 


6.07 


6.67 


10 


Maj. diam. 


f 


7.33 


0.07 


7.20 


7.58 


11 


7.08 


0.16 


6.77 


7.37 


18 


Maj. diam. 


m 


6.63 


016 


630 


6.94 


13 


6.03 


0.13 


5.80 


6.22 


10 


Min. diam. 


f 


6.93 


0.10 


6.75 


7.16 


11 


6.63 


0.17 


6.35 


6.96 


18 


Min. diam. 


m 


6.14 


0.11 


5.93 


637 


13 


5.61 


0.12 


5.43 


5.88 


10 


Outer lip 


f 


4.81 


0.08 


4.61 


5.03 


10 


4.67 


0.12 


4.47 


5.00 


18 


Outer lip 


m 


4.42 


0.12 


4.25 


4.63 


13 


4.04 


0.10 


3.87 


4.25 


10 


Last whorl 


f 


6.35 


0.16 


6.10 


6.66 


11 


6.09 


0.14 


5.72 


6.48 


18 


Last whorl 


m 


564 


009 


5.42 


5.84 


13 


5.05 


0.18 


4.72 


5.43 


10 


Col. axis 


f 


6.68 


0.25 


6.30 


7.08 


11 


6.32 


0.16 


5.90 


6.96 


17 


Col. axis 


m 


5.77 


0.15 


5.47 


6.06 


13 


5.07 


0.17 


4.79 


5.50 


9 


Weight 


f 


0.050 


0009 


0.040 


0.067 


11 


0.047 


0.008 


0.031 


0.064 


18 


Weight 


m 


0.038 


0.004 


0.024 


0.048 


13 


0.027 


0.004 


0.019 


0.034 


10 


Volume 


f 


0.143 


0.007 


0.126 


0.156 


11 


0.124 


0.010 


0.095 


0.150 


18 


Volume 


m 


0.097 


0.006 


0.087 


0.110 


13 


0.073 


0.004 


0.063 


0.079 


10 



{Continues) 



CLASSIFICATION OF HELICINIDAE 



291 



(Continued) 



Helicina beatrix confusa 

"Hitoy Cerere" (altitude 100-798 m) 

lots INBio 1473618, 1473833, 1473837, 

1475069, 1498277, 1543340, 3096421 



Helicina beatrix confusa 

"Hitoy Cerere - Miramar" 

(altitude 150-300 m) 

lots INBio 1475230, 1475695, 1476494 







Mean 










Mean 












Sex 


value 


Deviation 


Min 


Max 


Number 


value 


Deviation 


Min 


Max 


Number 


Height 


f 


7.68 


0.34 


7.09 


843 


10 


7.97 


0.26 


7.71 


8.23 


2 


Height 


m 


6.56 


0.21 


6.10 


6.78 


6 


6.73 


0.00 


6.73 


6.73 


1 


Maj diam. 


f 


6.93 


0.20 


6.47 


7.65 


10 


7.01 


0.04 


6.96 


7.05 


2 


Maj diam. 


m 


6.04 


0.25 


5.50 


646 


6 


6.04 


0.00 


6.04 


6.04 


1 


Min. diam. 


f 


6.56 


0.18 


6.32 


7.23 


10 


6.68 


0.08 


6.60 


6.76 


2 


Min. diam. 


m 


565 


0.18 


5.31 


5.94 


6 


5.70 


0.00 


5.70 


5.70 


1 


Outer lip 


f 


4.57 


0.17 


4.22 


4.90 


10 


4.64 


0.04 


4.60 


4.67 


2 


Outer lip 


m 


3.96 


0.21 


3.69 


430 


6 


4.09 


0.00 


4.09 


4.09 


1 


Last whorl 


f 


5.95 


0.23 


5.18 


6.68 


10 


6.07 


0.11 


5.96 


6.18 


2 


Last whorl 


m 


5.04 


0.21 


4.74 


5.31 


6 


5.52 


0.00 


5.52 


5.52 


1 


Col. axis 


f 


6.30 


0.25 


5.64 


7.17 


10 


6.54 


0.33 


6.21 


6.86 


2 


Col. axis 


m 


5.26 


0.12 


5.01 


5.46 


6 


5.59 


0.00 


5.59 


5.59 


1 



























¡Heliana beatnx beathx 

"Turnalba" 

lots SMF 209575/1, SMF 180668/4, UF 

95337, ZMB 103812 



Mean 

value Deviation 



Min Max Number 



Height 
Maj diam. 
Min. diam. 
Outer lip 
Last whorl 
Col. axis 



8.81 
7,96 
7.39 
5.24 
6.75 
7.11 



0.47 
0.42 
0.38 
0.11 
0.27 
0.55 



8.06 
7.43 
6.68 
494 
6.19 
5.82 



9.70 
8.62 
8.00 
5.41 
7.08 
7.90 



10 
11 
11 

9 
10 

7 



Morphometry. The typical Helicina beatrix 
beatrix clearly possesses the largest shells 
among the Costa Rican subspecies of H. 
beatrix. Its shells have a similar size at all 
three localities. The lectotype is more highly 
elevated, reflected mainly in height and 
height of the columellar axis, whereas the 
specimens from Turrialba have relatively the 
largest minor diameter. Single specimens of 
H. beatrix beatrix not included in the dia- 
grams fall within the same size range. 
The populations of the subspecies H. beatrix 
confusa and H. beatrix riopejensis n. subsp. 
show a very constant pattern of differences 
between the populations for the different 
measurements, displaying the same rela- 
tions of the measurements. The specimens 



of Uatsi have the biggest shells. But they all 
exhibit a smaller size than the nominal sub- 
species. The relative constancy within the 
populations and the nearly equal size of the 
individuals from Shiroles and Hitoy Cerere 
(Hitoy Cerere - Miramar) suggest a relation 
to the distribution, because these localities 
are closer to each other than Uatsi (Fig. 1). 
Whereas in measurements the two speci- 
mens of H. beatrix var. sensu Angas match 
the two subspecies well, the lectotype of H. 
beatrix confusa is much smaller. For the 
subspecies, the lack of material from addi- 
tional localities still prevents any investiga- 
tion of a possible correlation of the size to 
the altitude which could help to relate the 
small size of the lectotype (from a much 



292 



RICHLING 




9 height [mm] 10 



FIG. 115. Range of measurements in females and males of Helicina beathx 
beatrix exemplary for height and minor diameter in the population from 
Guayacán. 



a 










' 


I 


1 1 




1 


1 1 

female <> 




mm. 




















male + 




diam. 


- 




















- 


[mm] 
























8 


- 




















- 


7.5 


- 




















- 


7 


- 
















« 










- 


6.5 


- 












<> <b 

^ 
00 








- 


6 


+ 






+ 


+ 


++ 










- 


5.5 




\ 


+ 
+ 






1 


1 1 




1 


1 1 





9 height [mm] 10 



FIG. 116. Range of measurements in females and males of Helicina beatrix 
confusa exemplary for height and minor diameter in the population from 
Shiroles. 



CLASSIFICATION OF HELICINIDAE 



293 



mm. 
diam. 
[rnml 









7.5 



female 
male 



9 height [mm] io 



FIG. 117. Range of measurements in females and males of Helicina beathx 
riopejensis n. subsp. exemplary for height and minor diameter in the 
population from Rio Peje. 



min. 
diam. 
[mml 



7.5 



6.5 



- 




1 


1 1 






- 








Ф 


- 


- 




^\ "^ 




о 



females 




- 






^v 

о \ 


/ 






- 


о 


' / 


\ 




- 


о 


1 


/ 

males 

1 


\ 

1 1 


1 1 


1 



9 height [mm] ю 



FIG. 118. Plot of measurements for height and minor diameter for individuals 
of Helicina beathx confusa of unknown sex, exemplary for the population of 
Hitoy Cerere and the separation proposed. 



294 



RICHLING 



higher altitude) to the recently collected 
material. For H. beatrlx beathx, the present 
data do not corroborate a correlation of size 
with altitude. Within a range from elevations 
of 330 m (Suerre de Jimenez) to 800-1 ,000 
m (Turrialba) or even up to 2,500? m (Alto 
Tararla), the size remains nearly constant. 

Sexual Dimorphism: All populations and even 
all measurements show a very clear differ- 
ence between females and males, in many 
cases not only within the range of the stan- 
dard deviation but also for the whole range. 
This is shown for a population of each sub- 
species (Figs. 115-117) in data for height 
and minor diameter, which best separates 
the sexes. In populations with many indi- 
viduals (e.g., Rio Peje), high extrema are 
more likely and result in a little overlap. In 
volume, the males are only about ^/3 of that 
(61% to 68%) of females. 
The clear difference between both sexes 
can be used to plot measurements (e.g., 
minor diameter to height) of specimens of 
unknown sex (Fig. 118, Hitoy Cerere) in or- 
der to attribute them to their most likely sex. 
But the differences between the populations 
also demonstrate that this method will only 
work for specimens from one and the same 
locality, and the lot from "Turhalba" could not 
be separated (Fig. 119) because it does not 
represent a single population. 
The differences of the specimens of H. 
beatrix var. sensu Angas to the lectotype of 
H. beatrix are out of the range of sexual di- 
morphism, supporting their exclusion from 
typical H. beatrix. 

Habitat 

Helicina beatrix beatrix was found by the au- 
thor at only one locality at Guayacán. There it 
inhabits a small abandoned banana field on a 
steep hillside surrounded by secondary growth 
and partly swampy meadows for cattle. Speci- 
mens were aestivating or on the underside of 
green banana leaves or crawling in curled, 
dried leaves. Originally the area was covered 
by rain forest, and it seems to be a relic occur- 
rence of the species. All negative records and 
the few specimens in collections suggest that 
H. beatrix beatrix is a rare subspecies. 

Distribution (Fig. 120) 

Although records are scarce, the occurrence 
shows a remarkable pattern. As already ob- 



served by Gabb and cited in the original de- 
scription, the species is said to occur only on 
hills up to an elevation of 2,500 feet. In fact 
¡Helicina beatrix inhabits the Caribbean moun- 
tain slopes of the Cordillera Central and the 
Cordillera de Talamanca. The localities can be 
attributed to the slopes of three regions: the 
valley between the volcanoes Barva and 
Irazú/Turhalba, the Caribbean side of the Valle 
Central along the Rio Reventazón between 
the Volcán Irazú and northern Cordillera de 
Talamanca, and the Valle de Talamanca. The 
verified range of altitude is from about 330 m 
to 1 ,000 m or even up to 2,500 m depending 
on the exact location of "Alto Tararla". The 
most northern record from Santa Clara near 
the frontier to Nicaragua is uncertain. 

Discussion 

Helicina beatrix beatrix is understood as the 
large whitish-opaque form with reddish-brown 
upper whorls. The determination of two of the 
three lots from the Barbilla/Rio Pacuare area 
(INBio 3324279, INBio 3542905) is uncertain; 
the size of the adult specimen is similar to the 
nominal subspecies; the color approaches that 
of H. b. confusa. A common feature of H. 
beatrix beatrix and the other subspecies is the 
general shape as described above and the 
subsutural opaque band. Furthermore, the 
outer lip is typically strongly curved backwards, 
especially in females. Against the background 
that intermediate forms of the subspecies are 
lacking and a sympathcal occurrence implying 
a specific separation is uncertain, the status of 
subspecies is tentatively maintained or sug- 
gested for the population from Rio Peje. But 
certain hints for a sympathcal existence of H. 
beatrix beatrix and H. b. confusa have to be 
mentioned. The type locality of H. beatrix 
confusa (Brushik, Alto Taraha) is probably close 
to "between Ukatschka and Brushik, Alto 
Tararla" recorded for H. beatrix beatrix, al- 
though the exact location is uncertain (see be- 
low). Furthermore, a recently collected lot in the 
collection of INBio from the Sendero [= trail] 
Bobócara in the reserve Hitoy Cerere contains 
both subspecies, and the very top of the moun- 
tain Cerro Bobócara is given as locality, but is 
most likely not the source of all specimens. In 
the extremely mountainous and steep terrain, a 
short distance of the trail probably already en- 
compasses different habitats at different alti- 
tudes. Therefore, the data do not contribute to 
an assessment of the status of H. beatrix and 
subspecies. 



CLASSIFICATION OF HELICINIDAE 



295 




9 height [mm] ю 



FIG. 119. Plot of measurements for height and minor diameter for individuals 
of Helicina beathx beathx of unknown sex, exemplary for the specimens from 
"Turrialba" (probably not single populations) for which a separation is not 
possible. 




FIG. 120. Records of Helicina beatrix beatrix in Costa Rica. 



296 



RICHLING 



The type lot of H. beathx is of unknown ori- 
gin and most likely it is also composed of 
specimens from different localities, because 
the smaller two belong to a different subspe- 
cies. The knowledge of well-localized records 
of H. beathx is very limited, but among those, 
the lot ZMB 103251 from high up in the moun- 
tains from the Valle de Talamanca (southern 
Caribbean side) most closely resembles the 
lectotype in having a high, elevated shell. Ac- 
cording to recent and previous findings, popu- 
lations at Guayacán, Turrialba and Tuis are 
characterized by more globular shells, thus 
suggesting that the lectotype probably was not 
collected in the area of the Rio Reventazón 
and its tributaries between Turrialba and 
Siquirres, which was comparatively easily ac- 
cessible at the end of the 19'*^ century as the 
most direct connection between San José and 
Puerto Limón on the Caribbean. 

The record from Santa Clara remains doubt- 
ful, because it is far out of the verified distribu- 
tion and the original material has not been 
found. A confusion with H. gemma which oc- 
curs in this region, can be excluded for three 
reasons: (1) Biolley (1897) and von Martens 
(1900) also reported this species for the area 
as H. oweniana anozona and von Martens 
(1900) as H. oweniana coccinostoma, (2) von 
Martens (1900) characterized the specimens 
as no less than 10 mm in diameter and 9 in 
height, whereas H. gemma displays a remark- 
ably constant size of about 5 to 7 mm in 
height, and (3) the orange outer lip of H. 
gemma would rather suggest an identification 
as H. oweniana than H. beathx, exactly as von 
Martens obviously treated H. gemma in his 
publication. Except for the doubtful record of 
H. beathx nicaraguae, the species has not 
been reported from the adjacent Nicaragua. In 
the face of absence of the original material 
and the limited knowledge on Nicaraguan 
Helicinidae, it still remains doubtful. 

In Helicina beathx nicaraguae, the whorls 
very evenly increase in size, forming a regu- 
lar spire, which is less inflated than in H. 
beathx beathx. The whorls are more convex, 
therefore the suture is more deeply im- 
pressed. The whitish band under the suture 
is less distinct and more slender. The basic 
color is yellowish, with a tendency to green- 
ish, towards the aperture lighter and chang- 
ing to opaque. 

On account of the poorly investigated Nica- 
raguan terrestrial molluscan fauna, it is impos- 
sible to render any judgement about the 
possible origin or distribution. According to the 



Costa Rican records, H. beathx and subspe- 
cies are confined to the southern Caribbean 
slope and coastal plain with its most northern 
record verified at about Guápiles (10°13'N), or 
with uncertainty near the Nicaraguan border at 
Santa Clara. The only record for Nicaragua is 
that of Wagner (1908) of his new subspecies. 
Supposing that the record from Santa Clara is 
attributed to another species and considering 
that H. beathx and subspecies seem to be 
absent from the very lowlands, that is, the 
southern Nicaragua, there appears to be a 
gap in the distribution towards Nicaragua. 
Otherwise, specimens from Isla Colón (Isla 
Colon, Las Gratas, 5 km NNW of Bocas del 
Toro, 09°23'25"N, 82°16'15"W, 70 m a.s.l., 
leg. F.G. Thompson (FGT-4724), 17.09.1990: 
2 ads. (UF 167532); interior of Colon Island, 
leg. McGinty coll., 28.03.1953; 1 s. ad. (UF 
185607) (Fig. 121), Bocas del Toro Province, 
Panama, adjacent to the Costa Rica distribu- 
tion, show a surprising similarity in shape and 
color. With a height of 9.6 mm, the largest 
shell nearly reaches the size of the lectotype. 
An investigation of the Nicaraguan malaco- 
fauna would be required to prove whether the 
type locality of H. beathx nicaraguae is in this 
country, or whether the lectotype in fact came 
from Panama. 

Von Martens (1890-1901) misinterpreted H. 
beathx as a variety of H. flavida because he 
had not seen original specimens. Subsequent 
authors (Pilsbry, 1891; Fischer & Crosse, 
1893) stressed the distinctness of H. beathx, 
and von Martens agreed with this in his 
supplement. 




FIG. 121. IHeiicina beathx nicaraguae, 
Panama, Isla de Colón, UF 167532, 
height 8.9 mm; scale bar 2.5 mm. 



CLASSIFICATION OF HELICINIDAE 



297 



Pllsbry (1926a) twice mentions H. beatrix 
from Bocas del Toro Province, Panama: speci- 
mens agreeing in size with the nominal sub- 
species from a certain locality and additional 
individuals not further specified in their origin 
that are remarkably smaller, thus resembling 
H. beathx confusa in size. Furthermore, the 
identification and localization of the Costa 
Rican record by Pilsbry (1926b) remains 
doubtful, because altitudes of less than 100 
feet would be exceptional for the nominal sub- 
species. 

Helicina {"Gemma") beatrix confusa 
(Wagner, 1908) 

Helicina beathx var. - Angas, 1879: 484, pi. XL, 

fig. 13 [non Helicina beathx Angas, 1879] 
Aleadla (Leialcadia) beathx confusa Wagner, 

1908: 84, pi. 14, fig. 25 
Oligyra {Succincta) beathx confusa - Baker, 

1922a: 45 
Helicina beathx - Monge-Nájera, 1997: 113: 

Costa Rica [in part] [non Angas, 1879] 

Original Description 

"Gehäuse viel kleiner [als Aleadla beathx], 
dünnschaliger, gelbgrün mit rötlichem 
Gewinde; das niedrigere, konvexe Gewinde 
besteht nur aus 44^ deutlicher gewölbten 
Umgängen, der letzte ist unten weniger 
abgeflacht. 




FIG. 122. Helicina beathx confusa, lectotype, 
MIZ 8409, height 5.6 mm; scale bar 2.5 mm. 



D = 7.3, H = 7.2 

Deckel wie bei der typischen Form. 

Fundort: Costarica." 

Type Material 

MIZ 8409: "Brusik [sie] Ht. Tararia" 
Wagner did not refer to any type material, but 
his collection contains only one specimen he 
singled out as type material. It is labeled "to be 
depicted" and agrees very well with the illus- 
tration. The specimen is therefore here se- 
lected as lectotype (Fig. 122). 
Dimensions: 
Lectotype: 5.6/5.3/5.7/4.9/3.4/4.2/4.4 mm 

Type Locality 

"Costa Rica" (figure caption erroneously 
Nicaragua); restricted by the type selection to 
Brushik, Alto Tararla [about 09°14'30"N, 
83°00'30"W, 2,500 m a. s. I. or downstream. 
Limón Province] 

Unfortunately, Wagner used to rewrite most 
of the labels and only occasionally retained 
the original, thereby not always preserving all 
information (Riedel, 2000). In the present 
case, it can be referred to "Brushik, Haut 
Tararia" [Spanish: Alto Tararla], a source also 
named by von Martens (1900) for material 
collected by Pittier. At that time, Pittier was the 
only one intensively studying the region of the 
Valle de Talamanca and its adjacent mountain 
slopes. Despite an intensive search for the 
locality, it is difficult to rediscover it. It is known 
that Pittier maintained good relations with the 
indigenous Cabécar and Bribri, which inhabit 
the Valle de Talamanca and settle along the 
four main rivers - Rio Telire, Rio Coén, Rio 
Lari and Rio Urén - and their tributaries high 
up in the mountains. Throughout this region, 
neither Brushik nor Alto Tararla or related 
names could be found on detailed maps. 
Much further south a Cerro Tararia ["cerro" = 
"mountain", 09°09'03"N, 82°58'27"W, 2,690 m 
a. s. I.] exists, which most likely is not the local- 
ity mentioned, because it forms a part of the 
very central mountain chain and lacks any 
access route. Furthermore, "Alto" followed by 
a name of a river usually refers to a main 
settlement along the river in the mountains, for 
example, Rio Lari - Alto Lari. Therefore, Alto 
Tararla may mean the upper part of the Rio 
Tarana [about 09°14'30"N, 83°00'30"W, 2,500 
m a. s. I. or downstream], which really exists 
southeast of Cerro Kamuk. Again, it is difficult 



298 



RICHLING 



to gain access to the region, settlements or 
trails are not shown on maps. From Valle de 
Talamanca, it means following the river Rio 
Lari or Rio Urén to their headwaters and to 
cross the Cerro Kamuk to reach the high re- 
gion of Rio Tararia draining towards Panama. 
Because other Pittier localities are very reli- 
able, this appears to be the best interpretation, 
because the material also may have been 
given to Pittier by indigenous people and prob- 
ably not all indigenous names and trails were 
incorporated in maps, and some may even 
have been forgotten or lost. 

Examined Material 

Leg. I. RicHLiNG 

Limón: Southern road from Bhbri to Shiroles, 
small banana plantation near creek, 
09°35'17"N, 82°52'46"\/V, 50 m a. s. I., 
15.03.1997: (IR 170) 

W Bribri, road to Uatsi, about 09°38'11"N, 
82°5Г48"\А/, 30 m a. s. I.: abandoned field 
with Heliconiaceae and Eucalyptus 
17.03.1997: (IR 182); 12.03.1999: (IR 765) 
15.09.1999: (IR 1112); (IR 1113) 
1 5.03.2001 : (I R 1 567); wooded valley within 
banana plantation, 50 m a. s. I.: 15.03.2001: 
(IR 1585) 

N Shiroles: along Quebrada Kirio 
09°35'38"N, 82°57'20"W: 120 m a.s.l. 
15.03.1997: (IR 161); 700 m a.s.l. 
12.03.1999: (IR 764); 09.08.1999: (IR 910) 
06.03.2000: (IR 1327); (IR 1329) 
16.03.2001: (IR 1594); (IR 1646); Cerro 
Mirador along trail. 09°36'37"N, 82°57'43"W, 
430 m a.s.l.: 16.03.2001: (IR 1600) 



INBio Collection 

Limón: Parque Nacional La Amistad, 
Quebrada Cachabri (toma de agua), 
09°29'29"N, 82°59'37"W, 360 m a.s.l., leg. 
Gerardina Gallardo, 26.11.1996: 1 ad. 
(INBio 1488199) 

Reserva Biológica Hitoy Cerere: Sendero 
Toma de Agua, 09°40'31"N, 83°0r36"W, 100 
m a.s.l.: 20.04.1994: 5 ads. (INBio 1473837); 
1 ad. (INBio 1473618); 2 ads., 1 juv. (INBio 
1473833); 13.08.1994: 3 ads., 2 s.ads., 13 
juvs. (INBio 1475069) (all leg. Zaidett 
Barrientes); Sendero Toma de Agua, 
0940'22"N, 83°0r35"W, 160 m a.s.l.: leg. 
Marianella Segura, 14.07.1994: 1 s.ad. 
(INBio 1478208); 1 juv. (INBio 1478209); 
Sector Miramar Hitoy Cerere, 09°37'50"N, 
83°00'52"W, 300 m a.s.l.: 13.06.1994: 1 ad. 
(INBio 1476494); 04.07.1994: 1 ad. (INBio 
1475695) (all leg. Gerardo Carballo); Sector 
Miramar, 09°38'03"N, 83°00'45"W, 300 m 
a.s.l.: leg. Zaidett Barrientes, 08.10.1994: 1 
ad. (INBio 1475716); Sendero a Captación 
de Agua, 09°39'59"N, 83°01'31"W. 200 m 
a.s.l.: leg. Alexander Alvarado Méndez, 
28.04.1999: 3 ads., 2 s.ads. (INBio 1498277); 
Sendero Tepezcintle, 09°40'18"N, 

83°01'43"W, 140 m a.s.l.: leg. Alexander 
Alvarado Méndez, 28,04.1999: 1 s.ad. (INBio 
1496288); Sendero Bobócara, 09°40'53"N, 
83°04'09"W, 798 m a.s.l.: leg. Alexander 
Alvarado Méndez, 17.06.1999: 1 ad., 1 s.ad. 
(INBio 1543340) 

Reserva Indígena Talamanca, Sector 
Amubri, 09°30'53"N, 82°57'19"W, 70 m 
a.s.l.: leg. Gerardina Gallardo, 14.06.1994: 1 
ad. (INBio 1477505); 1 ad. (INBio 1477553); 




FIG. 123. Helicina beatrix confusa, Shiroles, IR 910, height 7.8 mm; scale bar 2.5 mm. 



CLASSIFICATION OF HELICINIDAE 



299 



Sector Miramar, Senderos a Rio Moin, 
09°37'44"N, 83°00'32"W, 150 m a.s.l.: leg. 
Zaidett Barrientos, 08.11.1994: 1 ad., 1 
s. ad., 3JUVS. (INBio 1475230) 
Reserva Indigena Tayni, Sendero 
Tepezcuintle, 09°40'22"N, 83°0Г46"\Л/, 180 
m a.s.l., leg. Alexander Alvarado Méndez, 
22.04.1999: 1 ad. (INBlo 3096421) 

Other Sources 

COSTA RICA 

Limón: N of Río Moin [Valle de Talamanca!], 
572 000 E, 397 600 S [09°37'45"N, 
83°00'38"W], 220 m a.s.l., leg. E.L. Raiser 
(ELR-086), 11.08.1994: 1 ad., 2 s.ads. (UF 
41440) 

Costa Rica, without locality further specified: 
leg. Gabb: 2 spec. (BMNH 1879.7.22.30- 
31) 

Description 

Shell {F\gs. 123, 336B, C): Conical-globose, 
rather thin, small sized, shiny. Color: upper 
whorls yellowish-red, horny changing con- 
tinuously to yellow at the beginning of body 
whorl and getting nearly white towards aper- 
ture. The opaque whitish band directly below 
suture very slender. Shell surface shiny and 
smooth, except very fine growth lines. Em- 
bryonic shell with about 1 whorl; 4-5 (lecto- 
type: ЗУл) subsequent whorls very slightly 
convex; last whorl equally rounded at the 
periphery; upper whorls slightly more rapidly 
extending in size; whorls regularly descend- 
ing, forming a nearly blunt spire. Suture 
slightly impressed. Aperture oblique and in 
its middle part remarkably curved back- 
wards. Outer lip whitish-opaque similar to 
the band, slightly thickened and very nar- 
rowly reflexed; transition into columella con- 



tinuous without a very little notch. Basal cal- 
lus weakly developed and nearly completely 
smooth or very little granulated, umbilical 
area whitish. 






FIG. 124. Axial cleft and muscle attachments of 
Helicina beatrix confusa, IR 1113; scale bar 
2.5 mm. 



FIG. 125. Teleoconch surface structure oí Helicina 
beatrix confusa. A. Changes in the apical part. B. 
2"^" whorl; scale bars 500 |jm (A), 100 |jm (8). 



300 



RICHLING 



Internal Shell Structures: (Fig. 124) 

Teleoconch Surface Structure (Fig. 125): Simi- 
lar to Helicina b. beatrix, but the relation be- 
tween the transitional structure and the 
pattern of oblique diverging grooves is re- 
versed, the former nearly disappearing. 

Embryonic Shell (Fig. 126): Among the speci- 
mens investigated, the spiral lines are less 
numerous than in the nominal subspecies. 
Otherwise, the embryonic shell structure is 
similar. The diameter is smaller. 
Diameter: 889 pm (± 32) (800-950) (n = 21) 
(IR 1113, IR 1567); 840 pm (MIZ 8409, lecto- 
type); 900 pm (n = 2) (BMNH 1879.7.22.30- 
31, Helicina beathx confusa). 

Operculum (Fig. 127): Very slightly calcified, 
calcareous plate covering only part of the 
outer surface. Color horny-amber, only near 
the columella whitish, but still somewhat 
transparent. Columellar side slightly S- 
shaped, both ends acute, upper end 
pointed, lower slightly rounded. 





FIG. 127. Operculum of Helicina beatrix confusa, 
IR 1113; scale bar 1 mm. 

Animal (Figs. 337F, G): The body color is simi- 
lar to Helicina beatrix beatrix, especially 
within the yellow-shelled population from 
Uatsi. In some specimens from Shiroles 
(more frequently in individuals with orange- 
brownish tinged shells), the dorsal part of 
the head region including eyes and tentacles 
and the foot is more of less grey-blackish 
and the mantle is greyish pigmented as well. 

Radula: See Helicina beatrix beatrix. 

Female Reproductive System (Figs. 128, 129): 
The structures are similar to the nominal sub- 
species; the bursa copulatrix bears even 
fewer lobes. 




FIG. 126. Embryonic shell of Helicina beathx 
confusa; scale bar 100 \^m. 



FIG. 128. Female reproductive system o\ Helicina 
beatrix confusa, IR 1113; scale bar 1 mm. 



CLASSIFICATION OF HELICINIDAE 



301 




FIG. 129. Variability of the female reproductive 
system of Helicina beatrix confuse, IR 1113; 
scale bar 2.5 mm. 

Morphometry and Sexual Dimorphism 

See Helicina beatrix beatrix. 

Habitat 

The population "Uatsi" inhabits an appar- 
ently abandoned agricultural area surrounded 



by small banana fields. The vegetation con- 
sists mainly of Heliconiaceae and some bam- 
boo (Poaceae). ¡Helicina beatrix confusa was 
found on the underside of the leaves of 
Heliconiaceae and occasionally on Monstera 
spec. (Araceae) climbing the few big trees left 
of the previous forest. By way of contrast, the 
main site at Shiroles is a small creek in what 
seemed to be primary forest. Snails were 
crawling and aestivating on the leaves of vari- 
ous small-leafed plants of the undergrowth 
along the creek. Two specimens were discov- 
ered in the leaf litter. Additionally specimens 
were found on leaves of lower branches of big 
trees within the forest. Near Shiroles, H. 
beatrix confusa lives sympatrically with H. 
funcki and H. escondida n. sp. 

Distribution (Fig. 130) 

Helicina beatrix confusa is confined to the 
southern Caribbean mountain slopes of the 
northern Cordillera de Talamanca and adja- 
cent hilly areas, namely in the Valle de 
Talamanca and Valle de Estrella. Like the 
other subspecies, it seems to be absent near 
the coast. A more northern occurrence is 
questionable, a record from the Rio Pacuare- 




FIG. 130. Records of Helicina beatrix confusa in Costa Rica. 



302 



RICHLING 



Barbilla area at altitudes of 400 to 500 m has 
tentatively been attributed to the nominal sub- 
species. The foothills of the Talamanca have 
otherwise only been poorly investigated, not 
only because they are difficult to access, but 
also because the very local and patchy distri- 
bution renders the snails difficult to find. There 
is evidence for a more northerly absence, at 
least at lower altitudes, because several less 
elevated sites at Rio Siquirres, Rio Pacuarito, 
Rio Barbilla, near the road between Siquirres 
and Limón, were checked with negative re- 
sults although other Helicinidae at other 
places inhabiting the same habitats - H. 
funcki, H. escondida n. sp., H. chiquitica, H. 
gemma - were found. 

Discussion 

The description given above applies to the 
lectotype. The specimen is adult, but the outer 
lip is still not fully developed. The less el- 
evated shell renders is likely to be a male, al- 
though it cannot be concluded with certainty 
due to the lack of comparative material from 
the same locality. If this assumption is correct. 



the average size of Helicina beatrix confusa 
would be bigger than indicated by the lecto- 
type. Nevertheless, all specimens studied are 
clearly bigger. But because the specimens 
morphometrically studied originate from lower 
altitudes of sites not far from each other, al- 
though comparatively far away from the type 
locality at presumably higher altitudes, and the 
shape and the mode of color is similar, they 
are attributed to this subspecies. The lecto- 
type looks like a reduced form. The distribu- 
tion within the Valle de Talamanca and 
adjacent slopes additionally supports this clas- 
sification. 

In the specimens recently collected, the 
whitish band is like in the nominal subspecies 
broader, but occasionally it can also be as 
slender as in the lectotype. The color of the 
whorls varies within the populations and 
among them, but the outer lip and umbilical 
area are constantly whitish-opaque. The indi- 
viduals from Uatsi possess shells with brown- 
ish whorls at the apex that during growth 
change more or less quickly to a pale or more 
often bright yellow color above the periphery. 
At least the beginning of the last whorl is yellow 




FIGS. 131, 132. Helicina beatrix hopejensis n. subsp., Rio Peje. FIG. 131. Holotype, INBio 3542625, 
height 7.8 mm. FIG. 132. Paratype 1, INBio 3542626, height 6.6 mm; scale bar 2.5 mm. 



CLASSIFICATION OF HELICINIDAE 



303 



below the subsutural whitish band. Towards the 
aperture the color fades to pale yellowish-whit- 
ish. Specimens from Shiroles may display a 
similar color, but in many the brownish-reddish- 
orange of the upper whorls does not change up 
to the aperture. Similarly the color becomes 
lighter below the periphery. In general, the yel- 
low form seems to be more frequent. 

Helicina {"Gemma") beatrix riopejensis 
Richling, n. subsp. 

Type Material 

Holotype: INBio 3542625, female (leg. I. 

Richling, 09.03.1999, ex IR 752) 
Paratype 1: INBio 3542626, male (same data 

as holotype) 
Paratype 2: ZMB 103882, female (same data 

as holotype) 
Paratype 3: ZMB 103883, male (same data as 

holotype) 
Dimensions: 

Holotype: 7.8/7.0/7.4/6.5/5.9/4.6/6.4 mm 
Paratype 1: 6.6/6.0/6.5/5.6/5.0/4.1/5.3 mm 
Paratype 2: 8.1/6.8/7.3/6.5/6.1/4.6/6.7 mm 
Paratype 3: 6.3/5.9/6.5/5.5/5.2/4.1/5.1 mm 

Type Locality 

SE-Costa Rica, Limón Province, SW of 
Liverpool (about 24 km W of Puerto Limón) 
along Rio Peje, 09°55'46"N, 83°13'15"W, 135 
m a. s. I. 



per whorls light yellowish-horny-amber, be- 
coming darker from apex down, especially in 
the course of the last whorl changing to bright 
orange. A small but very distinct opaque whit- 
ish band directly below the suture, color of 
whorl most intensive towards the band. Shell 
surface shiny and smooth, only structured 
with very fine growth lines. EmtDryonic shell 
with about 1 whorl; 4^/g (ЗУ^-ЛУг) subsequent 
whorls very slightly convex; last whorl equally 
rounded at the periphery; upper whorls 
slightly more rapidly extending in size; whorls 
rapidly descending, forming a high spire. Su- 
ture slightly impressed. Aperture oblique and 
remarkably curved backwards, last whorl 
regularly descending and inserting exactly at 
periphery. Outer lip always bright orange In 
continuation of last whorl, thickened and very 
narrowly reflexed; transition into columella 
continuous with a little notch. Basal callus 
very weakly developed and nearly completely 
smooth or very little granulated. 

Internal Shell Structures: (Fig. 133) 

Teleoconch Surface Structure (Fig. 134): Simi- 
lar to Helicina b. beatrix, but the zone of ob- 
lique diverging grooves is more pronounced. 

Embryonic Shell (Fig. 135): The structure is 
similar to that of Helicina beatrix confusa. 
Figure 135B shows a common phenomenon 
also seen in other species: a few spiral lines 
of pits become indistinguishable. 



Etymology 

The subspecies is named after its origin, the 
Rio Peje. 

Examined Material 

Leg. I. Richling 

Limón: SW Liverpool: Rio Peje and small 
tributary, 09°56'35"N, 83°14'01"W, 110 m 
a.s.l.: 12.03.1997: (IR 125); along Rio Peje, 
bordering forest with palms, 09°55'46"N, 
83°13'15"W, 135 m a.s.l.: 04.03.1998: (IR 
440); 09.03.1999: (IR 752); 03.03.2000: (IR 
1303); (IR 1305); (IR 1306); 13.03.2001: (IR 
1550) 

Description 

Shell {F\gs. 131, 132, 336D): Conical-globose, 
rather solid, medium sized, shiny. Color: up- 




FIG. 133. Axial cleft and muscle attachments of 
Helicina beatrix riopejensis n. subsp., INBio 
3542625, 3542626; scale bar 2.5 mm. 



304 



RICHLING 




FIG. 134. Teleoconch surface structure of Helicina beatrix riopejensis n. subsp. A. Embryonic shell to 
2"" whorl. B. 1"' whorl, zone of transitional pattern and begin of transformation to next structure. С 1^' 
whorl, pattern of oblique diverging grooves. D. 2"^^ whorl, smooth surface with growth lines; scale bars 
500 Mm (A), 100 pm (B-D). 



CLASSIFICATION OF HELICINIDAE 



305 





FIG. 135. Embryonic shell of Helicina beatrix 
hopejensis n. subsp.; scale bar 100 [jm. 



FIG. 1 36. Operculum of Helicina beatrix hopejensis 
n. subsp., INBIo 3542625; scale bar 1 mm. 

Diameter: 878 pm (± 31 ) (800-940) (n = 22) 
(IR 1303, IR 1550). 

Operculum (Fig. 136): Very slightly calcified, 
calcareous plate covering only part of the 
outer surface, thickened towards the col- 
umellar side. Color orange to dark red, only 
at columellar side and in the area of the 
nucleus yellowish-transparent. Columellar 
side slightly S-shaped, both ends acute, 
upper end pointed, lower slightly rounded. 

Animal (Fig. 337H): As with other subspecies, 
Helicina beatrix hopejensis n. subsp. lacks 
any spotted pattern on the mantle. But the 
dorsal and upper lateral sides of head and a 
median stripe on the posterior foot are black. 
Only on the middle of the head there is a 
lighter area. The tentacles are black as well. 
A greyish-blackish mantle pigmentation 
gives the semitransparent shell a greenish- 
brownish appearance, making the white 
band even more prominent. 

Radula: See Helicina beatrix beatrix. 

Female Reproductive System (Figs. 137, 
138): The structures are similar to the nomi- 
nal subspecies, except for the bursa 
copulatrix, which is more regularly and 
deeply lobed; the receptaculum seminis ap- 
pears consistently smaller. 

Morphometry and Sexual Dimorphism 

See Helicina beatrix beatrix. 



306 



RICHLING 




FIG. 137. Female reproductive system of Helicina beatrix 
riopejensis n. subsp., apical complex in natural position, dorsal 
and ventral view, IR 752; scale bars 1 mm (left), 0.5 mm (right). 



Habitat 

At the type locality, this subspecies is rela- 
tively abundant. The undergrowth of the 
vegetation of the banks of the creek is 
mainly composed of Heliconiaceae, different 
palm species, and Araceae. During wet 
weather, Helicina beatrix riopejensis n. 
subsp. was found crawling nearly every- 
where on the leaves with no obvious prefer- 
ence for any particular plants. A higher 
abundance on leaves of palms and Heli- 



coniaceae may have resulted from the much 
larger surface of the leaves and the easier 
search. When aestivating, the specimens 
were found mainly on the underside of the 
leaves close to the middle rib. On palms, 
individuals were observed up to about 5-6 
m above the ground. Along the Rio Peje, the 
subspecies lives sympatrically with H. 
funcl<i, but it was not discovered at several 
other localities in the area along Rio 
Victoria, Rio Blanco, Rio René or Rio Quito, 
where H. funcl<i also occurs. 






FIG. 138. Variability of the female reproductive system of ¡Helicina beatrix riopejensis n. subsp., IR 752; 
scale bar 2.5 mm. 



CLASSIFICATION OF HELICINIDAE 



307 



Distribution (Fig. 139) 

Up until now, the subspecies has only been 
found along the upper part of the Rio Peje and 
a few small tributaries around the type locality. 
The site belongs to the hilly Caribbean low- 
lands close to the northeastern foothills of the 
Cordillera de Talamanca. 

Discussion 

Few specinnens exhibit a dark red spot at the 
apex. The tinge of orange towards the aper- 
ture may be paler or even bright red. Other- 
wise, the color is very constant within the 
population investigated. 

Helicina beatrix riopejensis n. subsp. differs 
from the nominal species and other subspe- 
cies in the color of the outer lip, which in the 
other subspecies is consistently whitish, inde- 
pendently of the varying color of the whorls. 
Furthermore, in H. beatrix beatrix, H. b. con- 
fusa, and H. b. nicaraguae the color of the 
whorls becomes lighter towards the aperture 
(normally whitish at least in the umbilical 



area), whereas in H. b. riopejensis n. subsp. it 
turns darker, even in the umbilical area. In 
general, the whitish band is more slender in 14. 
b. riopejensis n. subsp. 

With respect to the orange outer lip, the sub- 
species closely resembles /-/. gemma, but the 
latter consistently lacks the distinct whitish 
band under the suture. Its suture seems 
somewhat more strongly impressed, and the 
whorls appear to be more convex. Whereas 
/-/. beatrix beatrix is very clearly distinguished 
from H. gemma, H. beatrix riopejensis n. 
subsp. seems to represent a somewhat inter- 
mediate form showing several similarities to 
both species. Besides the aspects of the shell 
color, the length of the axial cleft equals the 
conditions of /-/. gemma and deviates from the 
other subspecies of 14. beatrix. On the other 
hand, H. beatrix riopejensis n. subsp. com- 
pletely lacks the spotted mantle pigmentation 
of H. gemma and, with respect to the mor- 
phometry, it would clearly represent the popu- 
lation with the largest specimens. According to 
all investigated populations of /-/. gemma, the 
species is much more constant in size than 




FIG. 139. Records of Helicina beatrix riopejensis n. subsp. in Costa Rica. 



308 



RICHLING 



the other species. At the same locality at the 
Rio Peje, it reaches its largest sizes, but in 
Tortuguero, where H. gemma occurs sympatri- 
cally, the population has a smaller shell size 
than H. beatrix riopejensis n. subsp., making a 
comparison with the conditions of other species 
contradictory. With the present state of knowl- 
edge, ''riopejensis" is tentatively referred to H. 
beatrix, but further data may reveal closer affini- 
ties to H. gemma. Nevertheless, the differences 
between "riopejensis" and both species justify 
a recognition at subspecific level. 

Helicina {"Gemma") talamancensis 
(Richling, 2001) 

Helicina oweniana - Monge-Nájera, 1997: 113: 
Costa Rica [in part] [non L. Pfeiffer, 1849] 

Helicina beatrix - Monge-Nájera, 1997: 113: 
Costa Rica [in part] [пол Angas, 1879] 

Oligyra talamancensis Richling, 2001: 3-5 
(text figure) 

Original Description 

See "Description". 

Type Material 

Holotype: INBio 3404978, female (leg. I. 
Richling, 24.3.1997) (Fig. 140) 

Paratype 1: INBio 1494509, female 
(Puntarenas, 3 km NE de la Escuela de Ll- 
ano Bonito, 08°44'54"N, 83°02'04"W, 920 
m a.s.l., leg. Socorro Avila, 24.03.1997) 

Paratype 2: INBio 3389580 (same data as 
paratype 1) 

Paratype 3: ZMB 103368, male (same data as 
holotype) 



Paratype 4: ZMB 103385, probably female, 
empty shell (from type locality, leg. I. 
Richling, 29.8.1999) 

Paratypes 5 12: INBio 1494642: 7 adults, 1 
juvenile (same data as paratype 1) 

Paratypes 13-14: INBio 1487761: 2 juveniles 
(Puntarenas, 3.5 km de la Escuela de Llano 
Bonito Carretera a San Vito, 08°44'37"N, 
83°02'04"W, 840 m a.s.l., leg. Socorro Avila, 
24.03.1997) 

Dimensions (height/greatest diameter): 

Holotype: 9.2/9.2 mm 

Paratype 1: 9.1/8.7 mm 

Paratype 2: 9.2/8.8 mm 

Paratype 3: 8.2/8.3 mm 

Type Locality 

SW-Costa Rica, Puntarenas Province, Fila 
Costeña, north of Bajo Bonito (locally called 
Llano Bonito), north of Rio Claro, 8°44'41"N, 
83°02'09"W, 980 m a.s.l., probably primary 
rain forest bordered by secondary growth. 

Type Material of Synonymous Taxa or Similar 
Species 

Helicina terryae Rehder, 1940 

Helicina terryae Rehder, 1940: 350, fig. 16 

Type Material: USNM 536026 (not USNM 
539026 as given in Rehder, 1940): holotype 
(Fig. 141) 

Dimensions (given in original description, 
height/greatest diameter): 
Holotype: 8.2/9.8 mm 

Type Locality: Panama, Chiriqui Province. 




FIG. 140. Helicina talamancensis, holotype, INBio 3404978, height 9.2 mm: scale bar 2.5 mm. 



CLASSIFICATION OF HELICINIDAE 



309 



Examined Material 

Leg. I. RiCHLiNG 

Puntarenas: S San Vito, forest opposite the 
Wilson Botanical Garden, Las Cruces, 
08°46'57"N, 82°57'40"W, 1,160 m a.s.l., 
29.08.1999: (IR 1018) 
N Neily, road from Ciudad Neily to San Vito, 
open area with a few trees, 08°40'23"N, 
82°56'44"W, 180 m a.s.l., N Neily, 
23.03.1997: (IR210) 

Fila Costeña, north of Bajo Bonito (locally 
called Llano Bonito), N of Rio Claro, rain for- 
est, 08°44'41"N, 83°02'09"W, 980 m a.s.l. 
24.03.1997: (IR 222); 15.02.1999: (IR 580) 
29.08.1999: (IR 1029), (IR 1661); (IR 1030) 
06.03.2001: (IR 1487); (IR 1489) 
Refugio Nacional de Fauna Silvestre Golfito, 
rain forest, 08°39'26"N, 83°10'50"W, 100 m 
a.s.l., 14.02.1999: (IR 567); 10.02.2000: (IR 
1166) 

INBio Collection 

San José: San Isidro, Area de Conservación la 
Amistad, Parque Nacional Chirripó, Estación 
Santa Elena, Finca del Gringo, 09°23'31"N, 
83°35'42"W, 1 ,300 m a.s.l.: leg. A. M. Maroto, 
29.09.1995: 1 ad. (INBio 3542536) 

Puntarenas: Reserva Forestal Golfo Dulce: 
Cerro de Oro, 08° 33' 46" N, 83°29'24"W, 
150 m a.s.l.: leg. Eida Fletes, 30.10.1995: 
1 ad. (INBio 1498769), 1 ad. (INBio 
1498766); Cerro de Oro, Quebrada 
Terranosa, 08°34'11"N, 83°30'15"W. 140 m 
a.s.l.: leg. Ronald Villalobos, 05.10.1995: 1 
ad. (INBio 1485176); Rancho Quemado, 
08°40'35"N, 83°34'33"W, 250 m a.s.l.: leg. 
Zaidett Barrientes, 18.03.1994: 1 juv. 
(INBio 1475394) 



Playa Blanca, 08°38'18"N, 83°26'16"W, m 
a.s.l., leg. Gillermo Mena, 04.09.1995: 1 juv. 
(INBio 1479918) 

Fila Cal: 24 km de San Vito hacia Ciudad 
Neilly, 08°41'36"N, 82°56'36"W, 780 m 
a.s.l.: 14.01.1995: leg. Luis Ángulo, 2 ads., 

1 juv. (INBio 1480714); leg. Angela Mora 
Maroto: 2 ads. (INBio 1481246); leg. 
Socorro Avila: 4 ads., 2 juvs. (INBio 
1481353); leg. Marcos Moraga: 1 ad., 1 juv. 
(INBio 1481564); leg. Alejandro Azofeifa: 1 
ad. (INBio 1482605); leg. Francisco 
Alvarado: 3 s.ads. (INBio 1495690); 
29.08.1995: leg. Marianella Segura, 3 ads., 

2 s.ads. (INBio 3121201); 740 m a.s.l.: leg. 
Ronald Villalobos: 4 juvs. (INBio 1481514); 
24. 5 km S en la carretera de San Vito hacia 
Ciudad Neilly, 08°40'55"N, 82°56'23"W, 
600 m a.s.l.: leg. Zaidett Barrientes, 
21.11.1995: 4 ads., 1 juv. (INBio 1485120); 
leg. A. Picado, 21.11.1995: 2 ads., 2 s.ads., 
1 juv. (INBio 3542530); leg. M. Segura, 
21.11.1995: 2 ad., 1 s.ad. (INBio 3542545) 
4.5 km Л/И/ de Ciudad Neily, Camino 
Paralelo al Rio Caño Seco, Colectado en 
hojarasca en heléchos, 08°40'50"N, 
82°57'25"W, 180 m a.s.l.: leg. M. Chinchilla, 
22.11.1995: 4 ads., 1 s.ad. (INBio 3542526) 
Jardin Botánico Wilson, Sendero a Río 
Jaba, 08°47'13"N, 82°58'04"W, 1,160 m 
a.s.l., leg. Zaidett Barrientes, 10.03.1995: 1 
ad. (INBio 1485093) 

Estación Pittier: 09°01'32"N, 82°57'46"W, 
1,660 m a.s.l.: leg. Angela Mora Maroto, 
15.01.1995: 1 ad., 2 juvs. (INBio 1481397); 
Sendero Pittier, 09°0ri1"N, 82° 57' 54" W, 
1,540 m a.s.l.: leg. malacological staff of 
INBio, 06.11.1995: 4 ads., 1 juv. (INBio 
1488141 ); Sendero Rio Gemelo, 09°01'36"N, 




FIG. 141. Helicina terryae, holotype, USNM 536026, height 8.2 mm; scale bar 2.5 mm (photograph: 
R. Marshier). 



310 



RICHLING 



Q2°57'2Q"V\/, 1,640 m a.s.l.: leg. Annia 
Picado, 13.01.1995: 1 juv. (INBio 1481168) 
Parque Nacional La Amistad, Coto Brus, 
sendero a Cerro Pittier, 600 m NW de la 
Estación, 09°0Г44"М, 82°57'54"W, 1,750 nn 
a.s.l., leg. Marcos Moraga, 06.11.1995: 1 ad. 
(INBio 1484619) 

Parque Nacional La Amistad, Estación 
Pittier. Sendero a Cerro Pittier. 09°02'05"N, 
82°57'39"W, 1,800 m a.s.l.: leg. Luis 
Ángulo, 06.10.1995: 1 juv. (INBio 
1485495); 09°01'43"N, 82°57^4"W, 1,750 
m a.s.l.: leg. M. Moraga, 19.06.1996: 1 ad. 
(INBio 3542538); Sendero a Altamira, 900 
m NW de la estación, 09°0r52"N, 
82°58'05"W, 1,760 m a.s.l.: leg. Evello 
Alfaro, 15.01.1995: 1 ad. (INBio 1480719), 
1 ad. (INBio 1480725); leg. Angela Mora 
Maroto: 2 ads. (INBio 1481219), 1 ad. 
(INBio 1481236); 1 ad. (INBio 3542544); 
Sendero a Río Canasta, 09° 01 '51 "N, 
82°58V5"W, 1,740 m a.s.l.: leg. M. Moraga, 
14.06.1996: 1 ad. (INBio 3542540) 
Parque Nacional La Amistad, Estación 
Altamira, Sendero a Estación Blolley: 
09°0r59"N, 83°00'39"W, 1,340 m a.s.l.: leg. 
Marianella Segura, 13.10.1994: 1 ad. (INBio 
1485516); 09°01'47"N, 83°0r07"W, 1,300 m 
a.s.l.: leg. Alexander Alvarado Méndez, 
10.09.2001: 1 ad. (INBio 3394313) 
Parque Nacional La Amistad, Cerro Blolley, 
09°02'25"N, 83°00'39"W, 1766 m a.s.l., leg. 
Roberto Delgado, 17.06.1994: 1 ad. (INBio 
1467066) 

Parque Nacional La Amistad, Cabagra, 
Puesto Altamira, Sendero a Cerro Biolley, 
09°02'12"N, 83°00'39"W, 1,600 m a.s.l., 
13.06.2001: 1 s.ad. (INBio 3318186); 3 ads. 
(INBio 3318194) (ail leg. Alexander Alvarado 
Méndez) 

Puntarenas, Parque Nacional La Amistad, 
Pittier, Puesto Altamira, sendero Casa Coca, 




09°02'25"N, 82°59'24"W, 1,800 m a.s.l., leg. 
Alexander Alvarado Méndez, 12.05.2001: 1 
ad., 1 s.ad. (INBio 3317088) 

Other Sources 

COSTA RICA 

San José: determination uncertain? 4.3 mi 

SW of San Isidro del General on Road to 

Dominical [about 09°20'N, 83°44'W], 

01.08.1971: 2 ads. (UF 69848) 
Puntarenas: Rincón [about 08M2'30"N, 

83°29'30"W], R. Casebeer, 28.06.1963: 1 

ad. (UF 243510) 

Etymology 

The species is named after the southern 
central mountain chain in Costa Rica, the Cor- 
dillera de Talamanca, which forms the greatest 
remaining undisturbed area of primary forest 
in the country. 

Description 

Shell {F\gs. 140, 336E): conical-globose, rather 
solid, medium sized, shiny. Color: yellowish to 




Ч 



FIG. 142. Axial cleft and muscle attachments of 
Helicina talamancensis, IR 1030; scale bar 5 mm. 



FIG. 143. Teleoconch surface structure of Helicina 
talamancensis, 2"^* whorl; scale bar 100 |jm. 



CLASSIFICATION OF HELICINIDAE 



311 



whitish-opaque (holotype); in some speci- 
mens the last whorl yellowish-white and the 
upper whorls with a more or less strong ten- 
dency to a pale orangish-red color. 
Periostracum very thin, shiny and smooth, 
except very fine growth lines. Embryonic shell 
with about 1 whorl; 4Vg-4V^ subsequent 
whorls slightly convex; last whorl equally 
rounded at periphery; upper whorls more rap- 
idly extending in size, so that shell (especially 
the female's) appears somewhat rounded 
and less pointed in apical part. Suture slightly 
impressed. Aperture oblique and in its middle 
part remarkably curved backwards. Outer lip 
always whitish, thickened, very narrowly re- 
flexed, appearing somewhat rounded at 
edge; transition into columella continuous, 
with a slight notch. Basal callus weakly de- 
veloped and nearly completely smooth or 
very little granulated. 

Internal Shell Structures: (Fig. 142) 

Teleoconch Surface Structure (Fig. 143): The 
transitional pattern covers only about % of a 
whorl; the structure is weakly developed. 
The smooth zone with just the fine growth 
lines follows directly. 



Embryonic Shell (Fig. 144): In comparison 
with Helicina beatrix, the pitted pattern is 
even less prominent in H. talamancensis. 
The embryonic shell appears nearly smooth. 
Diameter: 933 pm (± 40) (840-1,000) (n = 
18)(IR222, IR 1028, IR 1030). 

Operculum (Fig. 145): Very slightly calcified, 
calcareous plate covering only part of the 
outer surface. Color horny-amber, only near 
the columella whitish, but still somewhat 
transparent. Columellar side S-shaped, both 
ends acute, upper end pointed. 

Animal (Fig. 338B): The appearance of living 
Helicina talamancensis is striking: the body 
is whitish-yellow throughout, the mantle pig- 
mentation is also whitish; only the tentacles 
are deep black. This characteristic color is 
present in all live and preserved specimens 
studied. 

Radula (Fig. 146): Cutting edge of the centrals 
smooth or crenulated. Comb-lateral with 8-9 
cusps, cusps on marginals rather rapidly in- 
creasing in number, but with a similar effect 
as in Helicina beatrix beatrix. Radula with 
about 60-75 rows of teeth. 




Female Reproductive System (Figs. 147, 
148): Compared to Helicina beatrix the as- 
cending limb of the V-organ is elongated, the 
receptaculum is drop-shaped. The bursa 
copulatrix is very irregularly lobed, the elon- 
gated provaginal sac shows a simple out- 
line. Its stalk is short and stout. The palliai 
oviduct is marked by a longitudinal furrow 
and various transversal constrictions. 




FIG. 144. Embryonic shell of 
talamancensis; scale bar 100 pm. 



Helicina FIG. 145. Operculum of Helicina talamancensis, 
holotype, INBio 3404978; scale bar 2 mm. 



312 



RICHLING 





FIG. 147. Female reproductive system oí Helicina 
talamancensis, IR 1030; scale bar 1 mm. 



Morphometry and Sexual Dimorphism (Table 
9, Figs, 149-155) 

Helicina talamancensis could not be found in 
high numbers, the only specimens studied 
anatomically are those I collected at Bajo Bo- 
nito. Populations included from the collection 
of INBio with sufficient individuals (Fila de Cal, 
Neily, Amistad, Bajo Bonito) that could not be 
analyzed for sex were separated as in H. 
beatrix to avoid artificial high deviations of 
measurements with mixed sexes. 




FIG. 146. Radula of Helicina talamancensis. A. 
Centrals. B. Comb-lateral. С Marginals; scale 
bar 50 |jm. 



FIG. 148. Variability of the female reproductive 
system of Helicina talamancensis, IR 1030; 
scale bar 2.5 mm. 



CLASSIFICATION OF HELICINIDAE 



313 



TABLE 9. Measurements of different populations of Helicina talamancensis given as mean value with 
standard deviation, minimum and maximum value (min, max), and number of specimens; sex of 
individuals from Fila de Cal, Nelly, Amistad and Bajo Bonito INBio not determined anatomically (see 
text) (min. /max. diam. = minor/major diameter, col. axis = columellar axis); linear measurements [mm], 
weight [g], volume [ml]. 



"Bajo Bonito" (altitude 980 m) 
lots IR 1018, IR 1029, IR 1030, IR 1487 



Mean 
Sex value Deviation 



Min Max Number 



Height 
Height 
Maj. diam 
Maj. diam. 
Min. diam. 
Min. diam. 
Outer lip 
Outer lip 
Last whorl 
Last whorl 
Col. axis 
Col. axis 
Weight 
Weight 
Volume 
Volume 



903 

7.81 

8.54 

7.46 

7.95 

6.97 

5.61 

5.12 

7.05 

6.17 

7.34 

6.29 

0.087 

0.066 

0.199 

0.130 



0.33 

0.18 

0.27 

13 

0.20 

0.11 

0.15 

0.17 

0.15 

0.18 

0.26 

19 

0.010 

0.007 

0.017 

0.008 



8.48 

7.50 

8.02 

7.16 

7.60 

6.75 

5.46 

4.80 

6.58 

5.88 

6.77 

6.03 

0.056 

0055 

0.172 

0.115 



9.61 

8.22 

8.92 

7.72 

8.31 

720 

5.91 

5.41 

7.47 

6.46 

7.87 

6.68 

0.102 

0.085 

0.224 

0.145 



"Fila de Cal" (altitude 600-780 m) 

lots INBio 1480714, 1481246, 1481353, 

1481564, 1482605, 1485120, 3121201, 

3542530, 3542545 



"Neily" (altitude 180 m) 
lot INBio 3542526 







Mean 










Mean 












Sex 


value 


Deviation 


Min 


Max 


Number 


value 


Deviation 


Min 


Max 


Number 


Height 


f 


7.73 


0.17 


7.35 


7.98 


10 


7.75 


0.33 


7.42 


8.08 


2 


Height 


m 


6.80 


0.21 


5.82 


7.17 


11 


6.43 


0.04 


6.38 


6.47 


2 


Maj. diam. 


f 


7.14 


0.14 


6.95 


7.42 


10 


7.42 


0.09 


7.33 


7.50 


2 


Maj. diam 


m 


6.69 


0.11 


6.45 


6.96 


11 


6.60 


0.06 


6.54 


6.65 


2 


Min. diam. 


f 


6.75 


0.11 


6.55 


6.98 


10 


6.90 


0.17 


6.73 


7.06 


2 


Min. diam. 


m 


6.23 


0.12 


6.08 


6.50 


11 


5.95 


0.10 


5.85 


604 


2 


Outer lip 


f 


4.71 


16 


4.41 


487 


10 


478 


0.02 


4.75 


4.80 


2 


Outer lip 


m 


4.46 


0.08 


4.26 


4.62 


11 


4.38 


0.11 


4.27 


4.48 


2 


Last whorl 


f 


6.01 


0.16 


570 


6.38 


10 


6.02 


0.15 


5.87 


6.17 


2 


Last whorl 


m 


5.50 


0.12 


5.10 


5.83 


11 


5.15 


0.20 


4.95 


5.35 


2 


Col. axis 


f 


6.37 


0.29 


5.95 


7.31 


10 


6.23 


0.23 


6.00 


6.45 


2 


Col. axis 


m 


5.65 


0.20 


5.29 


6.27 


11 


5.17 


0.06 


5.11 


5.23 


2 



(Continues) 



314 

(Continued) 



RICHLING 



"Amistad" (altitude 1340-1800 m) 

lots INBio 1467066, 1480719, 1480725, 

1481219, 1481236, 1481397, 1484619, 

1485516, 1488141, 3317088, 3318194, 

3542538, 3542544, 3542540 



"Bajo Bonito INBio" (altitude 920 m) 
lots INBio 1494509, 1494642, 3389580 







Mean 










Mean 












Sex 


value 


Deviation 


Min 


Max 


Number 


value 


Deviation 


Min 


Max 


Number 


Height 


f 


8.50 


0.33 


8.06 


9.18 


11 


9.11 


0.05 


9.00 


9.15 


4 


Height 


m 


7.26 


0.17 


6.88 


7.67 


9 


8.10 


0.13 


7.88 


8.28 


5 


Maj. diam. 


f 


8.16 


0.26 


7.78 


8.68 


11 


8.47 


0.10 


8.33 


8.62 


4 


Maj. diam. 


m 


7.20 


021 


6.38 


7.50 


9 


7.67 


0.17 


7.25 


7.88 


5 


Min. diam. 


f 


7.53 


0.23 


7.20 


7.95 


11 


788 


0.09 


7.77 


8.02 


4 


Min. diam. 


m 


6.58 


0.15 


5.94 


6.74 


9 


7.08 


0.12 


6.77 


7.22 


5 


Outer lip 


f 


5.37 


0.19 


5.08 


5.81 


11 


5.62 


0.10 


542 


5.79 


4 


Outer lip 


m 


4.76 


0.20 


4.10 


5.15 


8 


5.14 


14 


4.88 


5.40 


5 


Last whorl 


f 


6.55 


0.19 


6.15 


6.92 


11 


7.12 


0.07 


7.02 


7.20 


4 


Last whorl 


m 


5.80 


0.16 


5.49 


6.07 


9 


6.25 


10 


6.09 


648 


5 


Col. axis 


f 


6.94 


0.29 


6.36 


763 


11 


7.29 


0.13 


7.12 


7.55 


4 


Col. axis 


m 


5.93 


0.15 


5.67 


6.20 


9 


6.51 


0.08 


6.41 


6.64 


5 








"Peninsula de Osa" (altitude 140- 


-150 m) 


' 


Chirripó" (altitude 1300 n- 


1) 






lots INBio 1485176, 1498766, 1498769 




lot INE 


10 3542536 








Mean 










Mean 












Sex 


value 


Deviation 


Min 


Max 


Number 


value 


Deviation 


Min 


Max 


Number 


Height 




8.06 


0.61 


7.15 


8.82 


3 


8.16 


- 


- 


- 




Maj. diam. 




8.04 


0.65 


7.07 


8.77 


3 


8.21 


- 


- 


- 




Min diam. 




7.42 


0.62 


6.50 


7.96 


3 


7.64 


- 


- 


- 




Outer lip 




5.26 


0.41 


4.65 


566 


3 


5.27 


- 


- 


- 




Last whorl 




6.36 


0.45 


5.69 


6.77 


3 


634 


- 


- 


- 




Col. axis 




6.61 


0.56 


577 


7.15 


3 


666 


- 


- 


- 





Morphometry: The populations show remark- 
able differences in size with the individuals 
from Fila de Gai and Neily being smallest. For 
each characteristic, the differences between 
the populations are similar, implying that the 
relations are about the same. Although from 
different altitudes and from localities relatively 
close to each other, the specimens from Neily 
and the Fila de Gal are of about the same 
size, which suggests rather a relation to the 
sites than to altitude. The few specimens from 
the lowlands of Peninsula de Osa approach 
the shells from "Amistad" at much higher al- 
titudes more closely in size than those from 
Neily or Fila de Gal. 

In comparison with Helicina beathx beatrix, 
the shell volume of the Bajo Bonito popula- 



tion is smaller, but the weight is significantly 
higher. It confirms the impression of more 
solid shells in H. talamancensis. 

Sexual Dimorphism: As in /-/. beatrix the sexes 
clearly diverge in all measurements, in most 
cases even without an overlap of the ex- 
trema (Fig. 156). The females are much big- 
ger than the males, in volume the males are 
only 2/3 of the females. This divergence al- 
lows the separation of individuals of un- 
known sex (Fig. 157), as explained under H. 
beatrix beatrix. Although containing only 
three specimens, the lot from Pe