Skip to main content

Full text of "Phytologia"

See other formats




PHYTOLOGIA 



A journal to expedite publication in plant systematics, evolution, 
phytogeography and vegetation ecology 

www.phytologia. org 



Vol. 91, No. 3, pp 359-586 



December, 2009 



PHYTOLOGIA 

(ISSN 00319430) 
Phy(ologich a journal for rapid publication in plant systematics, 
phytogeography, and vegelalion ect)logy, is published three times a 
year. Manuscripts on plant genetics, plant breeding, plant physiology, 
and fungal biology and taxonomy will be considered if they are 
explicitly related to topics in plant systematics. 



Managing hditor 

micro-Molecular, Phytochemical 

and Multivariate Systematics 

Robert P. Adams 

Baylor University 

Baylor-Gruver Lab 

Gruver, TX 79040 

Robert_Adams(a!baylor.edu 

Assoc 
Nomenclature 

Guy Nesom 

2925 Hartwood Drive 

Fort Worth, TX 76109 

www.guynesom.com 



Macro-Molecular and 
Phylogenetic Systematics 
Andrea E. Schwarzbach 
Univ. of Texas at Brownsville 
Dept. of Biol. Sciences 
Brownsville, TX, 78520 
andrea.schwarzbach(aiutb.edu 



Executive Editor 
General systematics 
and evolution 
Billie L. Turner 
University of Texas at Austin 
Austin, TX 78705 
billie(a^uts.cc. utexas.edu 

ate Editors 

General Systematics 
A. Michael Powell 
Dept. of Biology 
Sul Ross State University 
Alpine, TX, 79832 
ampowell(^sulross.edu 

Ethnobotany 
Martin Terry 
Dept. of Biology 
Sul Ross State University 
Alpine, TX, 79832 
mterry@sulross.edu 



Secretary-Treasurer - Subscriptions 

Robert P. Adams 

Phytologia, Box 727, Gruver, TX 79040 

Robert_Adams(S:bay lor.edu 

Copyright 2009 Phytologia. Texensis Publishing, Gruver, TX 



Phytologia (December 2009) 91(3) 



359 



Phytologia 

Contents 



R. P. Adams, R. P. Chaudary, R. N. Pandey and L. Singh. Jiiniperus 
recurva var. imcinata, the hooked branchlet juniper, a new variety from 
Nepal 361 

D. B. Ward. Keys to the flora of Florida: 23, Opiintia 
(Cactaceae) 383 



B. L. Turner. Convolvulus carrii, a localized endemic from 
southernmost Texas 394 

L. R. Phillippe, M. A. Feist, R. L. Larimore, D. T. Busemeyer, P. B. 
Marcum, C. J. Carroll, J. L. Ellis and J. E. Ebinger. Composition and 
structure of the ground layer vegetation at Iroquois County 
Conservation Area, Northeastern Illinois 40 1 

B. L. Turner. A new name for Ageratina pochutlana B. L. Turner.. .439 

B. L. Turner. Recension of the Mexican species of section Uliginosae 
of Salvia (Lamiaceae) 440 

G. L. Nesom. Taxonomic overview of Ligustrum (Oleaceae) 
Naturalized in North America north of Mexico 467 



X 



H. Robinson. Additions to the genus Orbivestus H. Rob. (Asteraceae: 
Vernonieae) and neotypification of Vernonia teitensis O. Hoffm 483 

J. R. Spence. Nomenclatural changes in the Bryaceae (Bryopsida) for \o 
North America III 494 '^ 



Cover Photo: Convolvulus carrii B. L. Turner, a new species from 
Texas. Rear Cover Photo: Plecostachys serpylUfolia, naturalized in 
California. 



LIBRARY 



ULU 'I ~ VHrtg 



NEWYOKiv 



360 riwioloi^ici (December 2009) 91(3) 



G. L. Nesom. Taxonoinic notes on acaulcscent Oxalis (Oxalidaccae) in 
the United States 50 1 / 

G. L. Nesom. Notes on O.xalis sect. Corniciilatese (Oxalidaceae) in the 
southwestern United Stales 527 

H. Robinson. The generic disposition of the African Vernonia biafrae 
OHv. & Hiern (Vernonieae: Asteraceae) 534 

J. L. Panero. Chucoa ilicifolia, a spiny Onoseris (Asteraceae, 
Mutisioideae: Onoserideae) 537 

R. E. Riefner, Jr. and G. L. Nesom. Plecostachys serpyllifolia ^/^ 
(Asteraceae) naturalized in California 542 

S. L. Broich. A new combination in North American Lathyrus 566 

J. L. Panero and V. A. Funk. New tribes in Asteraceae 568 ' 

R. P. Adams. Variation among the smooth leaf margin Junipenis of ^^ 
Mexico: Analyses of nrDNA, 4CL, ABB and petN-psbM SNPs 571 

Index to names in Volume 91 581 



Phytologia (December 2009) 91(3) 361 



JUNIPERUS RECURVA VAR. UNCINATA, THE HOOKED 
BRANCHLET JUNIPER, A NEW VARIETY FROM NEPAL 

Robert P. Adams 

Biology Department, Baylor University, Waco, TX 76798 
Robert_Adams@baylor.edu 

Ram P. Chaudhary 

Central Department of Botany, Tribhuvan University, Kirtipur, 
Kathmandu, Nepal 

R. Naresh Pandey 

Cincinnati Children Hospital, Cincinnati, OH 45229 

Ram Lakhan Singh 

Biology Department, Baylor University, Waco, TX 76798, USA 
Robert_Adams@baylor.edu 

ABSTRACT 

Routine field work in Nepal led to the discovery of a new variety 
of J. recurva (J. recurva var. uncinata R. P. Adams), the hooked 
branchlet juniper, a shrub with short leaves and hooked or recurved 
branchlet tips, growing at 3900 m. Analyses of sequence data from 
nrDNA and cpDNA (petN-psbM) of Jimipenis indica, J. i. var. 
caespitosa, J. i. var. rushforthiana, J. recurva and J. squamata 
confirmed the distinct nature of the new variety. Analyses of leaf 
terpenoids from the parents, and several intermediates between J. 
recurva and J. r. var. uncinata support hybridization. Phytologia 91(3): 
361-382 (December, 2009). 

KEY WORDS: Jimiperus indica, J. i. var. caespitosa, J. i. var. 
rushforthiana, J. recurva, J. recurva var. uncinata R. P. Adams, var. 
nov., J. squamata, SNPs, nrDNA (ITS), petN, psbM, sequences, 
terpenoids, taxonomy, hybridization. 



The junipers of the central Himalayans consist of 7. communis 
L. var. saxatilis Pall., J. indica Bertol. var. caespitosa Farjon, J. i. var. 



362 Phytotogia (December 2009) 91(3) 



imlica Bertol., J. i. var. rushforthicuui R. I'. Adams, J. recnrva Buch.- 
Ham. ex D. Don, and J. sqiuinuihi Buch.-Ham. ex D. Don (Adams, 
2008). While collecting specimens of J. recnrva in Nepal, wc 
discovered a shrub that differs from typical J. recnrva in having 
branchlet tips that are hook-shaped, having shorter leaves, and branching 
near the base. In addition, several plants were found that appear to be 
intemiediate between typical J. recnrva and the newly discovered 
'hooked-tip' plants. 

The purpose of this paper is to report on analyses of 7. recnrva, 
the newly discovered hooked-tipped shrubs and compare these with 
closely related species {Juniperus indica, J. i. var. caespitosa, J. i. var. 
rnshforthiana, J. sqnamata) using nrDNA (ITS) and cp petN-psbM 
SNPs. In addition, the volatile leaf terpenoids from the J. recnrva plants 
and putative hybrids were analyzed. 

MATERIALS AND METHODS 

Specimens (GenBank nrDNA, petN-psbM) used in this study: 
J. indica var. indica, Adams 8775-8777, (GQ 118641, GQ 118648), L. 
Singh, Dumpa, Jomson, 2900 m, Nepal; J. indica var. caespitosa, Adams 
7625-7627 (GQI18642, GQl 18649), R. Chaudhary, between Kyangjin 
Gompa and Langtang Glacier, 4000 m, Nepal; J. indica var. 
rnshforthiana, Adams 8140, 8141, (GQl 18643, GQl 18650), K. 
Rushforth, Soe Tajitang, 3000 m and Lingshi, 3480 m, Bhutan, J. 
recurva var. recurva, Adams 7210, 7211, 7215, 7217-7219 (GQl 18644, 
GQl 18651), between Sing Gompa and Cholan Pati lodge, 3360-3570 m, 
Nepal; J. recnrva var. nncinata, Adams 7212-7214 (GQl 18645, 
GQl 18652) Lauri Binayak, 3900 m, Nepal, J. sqnamata var. sqnamata, 
Adams 6796, (GQl 18646, GQl 18653) Xian Botanical Garden, China, 
7012, Kunming Botanical Garden, China, J. sqnamata f wilsonii, Adams 
5521 (GQl 18647, GQl 18654), Arnold Arboretum, acc.l010-64A. 
Voucher specimens are deposited at BAYLU. 

One gram (fresh weight) of the foliage was placed in 20 g of 
activated silica gel and transported to the lab, thence stored at -20" C 
until the DNA was extracted. DNA was extracted from juniper leaves 
by use of a Qiagen mini-plant kit as per manufacturer's instructions. 



Phytologia (December 2009) 91(3) 363 



Amplification and sequencing 

ITS (nrDNA) and petN-psbM amplifications were performed in 
30 )nl reactions using 6 ng of genomic DNA, 1.5 units Epi-Centre Fail- 
Safe Taq polymerase, 15 )il 2x buffer E or K (final concentration: 50 
mM KCl, 50 mM Tris-HCl (pH 8.3), 200 ^iM each dNTP, plus Epi- 
Centre proprietary enhancers with 1.5 - 3.5 mM MgCl2 according to the 
buffer used) and 1 .8 |iM each primer. 

Gene Primers 2x buffer annealing program size bp 

nrDNA ITSA-42F/ ITS B+57R K 50^ (94-50x30) 1106-141 
petN petN5F/psbMlllR E 50°C (94-50x30) 741-825 

Primers (5'-3'): 
ITS: ITSA = GGA AGG AGA AGT CGT AAC AAG G; 

ITSB = CTT TTC CTC CGC TTA TTG ATA TG. 
ITSA and ITSB primers from Blattner (1999). 

additional ITS primers (based on Juniperus sequences): 
ITSA-42F = GAT TGA ATG ATC CGG TGA AGT 
ITSB+57R = ATT TTC ATG CTG GGC TCT 

petN - psbM: 

petN5F = AAC GAA GCG AAA ATC AAT CA 
psbMl 1 1 R = AAA GAG AGG GAT TCG TAT GGA 

petN and psbM primers were based on conserved sequences from 

Juniperus species. 

The following PCR conditions were used: MJ Research 
Programmable Thennal Cycler, 30 cycles, 94°C (1 min.), 50''C (2 min.), 
72°C (2 min.), with a final step of 72'^ (5 min.). The PCR reaction was 
subjected to purification by agarose gel electrophoresis (1.5% agarose, 
70 V, 55 min.). In each case, the single band was excised and purified 
using a Qiagen QIAquick gel extraction kit. The gel purified DNA band 
with the appropriate primer was sent to McLab Inc. for sequencing. 
Sequences for both strands were edited and a consensus sequence was 
produced using Chromas, version 2.31 (Technelysium Pty Ltd.). 
Alignments were made using MAFFT ( http://align.bmr.kyushu- 
u.ac.jp/mafft /), manually corrected, and re-analyzed using NJ with 1000 
bootstrap replications ( http://align.bmr.kvushu-u.ac.ip/mafft /). 



364 



Plivi(>l<>,i^ia (December 2009) 91(3) 



Isolation and analysis of Oils - sec Adams el a!. (2009). Daia 
Analysis - Terpenoids (as per cent total oil) were coded and compared 
among the taxa by the Gower metric (Gowcr, 1971). Principal 
coordinate analysis was performed by factoring the associational matrix 
using the formulation of Gower ( 1966) and Veldman ( 1967). 

RESULTS AND DISCUSSION 

The hooked branchlet junipers were found at 3900 m on a south 
facing slope at timberline at Lauri Binayak (Fig. 1). A large population 
ofy. reciirva grew just west of Sing Gompa (Fig. 1) and other individual 
J. recurva plants were found between Sing Gompa and Cholan Pati 
lodge (Fig. 1). Plants morphologically intermediate between J. recurva 
and the hooked branchlets junipers were found around Cholan Pati 
between 3400 and 3600 m (Fig. 1). The small elevation change between 
Sing Gompa (3400 m) and Lauri Binayak (3800 m) appears sufficient to 
cause habitat differences that support typical J. recurva and the hooked- 
tip juniper, as well as intermediate habitats around Cholan Pati. 




3400 \ "\ 
Sing Gompa 



2800 

3000 



2200 



3400 + 

3200 *4:^ 

3000 ,- x^ X 
2400 2600 2800 



3200 
3400 ' ' 

O Cholan Pati 




3600 



3800 



♦ J. recurva 
+ intermediate / 

# var. uncinata 



Lauri Binayak 
J3 




4200 



2000 m 



Figure 1. Site map of juniper collections between Sing Gompa and Lauri 
Binayak, Nepal. 



Phytologio (December 2009) 91(3) 365 



The hooked branchlet junipers near Lauri Binayak are 
recognized as a new variety of 7. recurva: 

Juniperus recurva var. uncinata R. P. Adams, var. nov. TYPE: Nepal, 
100 m s of Lauri Binayak, N 28 05.537', E 85 22.879', 3900 m, on south 
facing slope, 0.5 m x 0.5 m shrub, 1 Nov 1993, Adams 7212 
(HOLOTYPE: BAYLU, TOPOTYPES: Adams 7213, 7214, BAYLU), 
Fig. 2). 

Jiinipero recurvae similis sed dijfert habitu friiticoso, apicibiis 
ramidorum iinciformibus vel recurvatis, et folds brevibus (20-28 mm). 

Similar to Juniperus recurva, but differing in that the branchlet 
tips are hooked or recurved, the leaves are short (20 - 28 mm) and it 
grows as a shrub. 

The temiinal branchlet tips of var. uncinata are striking as they 
form a hook at their tips (Fig. 2), in contrast to var. recurva that has lax 
tips that are not hooked (Fig. 3). The leaves of uncinata are 20 - 28 mm 
long, compared to 35-50 mm in var. recurva (Figs. 2, 3). In addition, 
var. uncinata is multi-stemmed at the base whereas var. recurva has a 
strong central axis, even when appearing as a shrub. 

It appears that the two varieties hybridize in the area around 
Cholan Pati. A putative hybrid {Adams 721 1) is shown in Fig. 4. Note 
that the hooked branchlets are like those of var. uncinata, but the longer 
leaves are like var. recurva; this plant was a shrub, branched at the base, 
1 m wide x 1 m tall. Due to the cutting of limbs for use as incense, 
many of the trees in this area appear as shrub-like. 

In addition to hybrids, individuals were found that appear to be 
back-crossed, or of a F: generation. Adams 7210 is from a shrub, 4 m 
wide X 0.7 m tall, with very small leaves, but the branchlet tips are 
scarcely hooked (Fig. 5), suggesting the presence of some genes from J. 
recurva var. recurva in an otherwise typical J. r. var. uncinata 
individual. 



366 



Phytolofiia (December 2009) 91(3) 




Fig. 2. Jiiniperus recurva var. iincinaia, Holotypc, Adams 7212. 




Fig. 3. Juniperiis recurva var. recurva. Adams 7219. 



Phytologia (December 2009) 91(3) 



367 




Fig. 4. Putative hybrid between Juniperus recurva var. recurva and 
J. r. var. imcinata, Adams 721 1. 




Fig. 5. Putative backcross of J. recurva var. recurva to J. r. var. 
uncinata, Adams 7210. 



368 



Phyfoloiiia (December 2009) 91(3) 



To gather additional information on the relationships within the 
J. recurva complex and other related taxa, the nrDNA (ITS region) was 
sequenced. This resulted in 1 106 \o 1141 bp of sequence data, with 19 
mutational events that included 5 indels. A 29 bp deletion was found in 
all samples oiJ. recurva vars. recurva and uncinaui. A 4 bp deletion 
was found in all var. uncinara and ./. .\c/uamaia samples. l:ight of the 
mutational events were single occurrences and not deemed of taxonomie 
interest. This resulted in 1 1 events (simply noted as SNPs for 
discussion) that were used for analysis. An associational matrix was 
constructed using these 1 1 SNPs; the resulting minimum spanning 
network is shown in figure 6 (left). No variation was found among J. 
recurva var. recurva and only one SNP was found in J. r. var. uncinaia 



nrDNA(ITS) 


11 SNPs petN-psbM 24 SNPs 


indica v. 
indica 

V 


^\ indica (;^ 
S-^ var rush^K 


5^7211 


( 


/T^ indica v_y 


\ 

4 
4.7218 


indica v. 


A 


_ yy var. caesp. 


indica 


squamata \ 


/ 






■■\- 


7210 
3 


7 




2 \J 








J 


\' 7211 






^ 


A 


2^ 


\ \ squamata 


^ 


f7218 ^ 


^^7210'. \4\ 




4t J. recun/a 


'". y- 




+ intermediate 




#var. uncinaia 





Figure 6. Left: Minimum spanning network based on 1 1 nrDNA SNPs. 
Right: Minimum spanning network based on 24 petN-psbM SNPs. The 
numbers next to the links are the number of SNPs. Dashed line (7210- 
721 1) is the second nearest link. 



Phytologia (December 2009) 91(3) 369 



(Fig. 6, left). No variation was found among the three J. sqiiamata 
samples. However, the three varieties of 7. indicci showed considerable 
differences. 

Sequencing the cp petN-spacer-psbM region resulted in 741- 
825 bp with 35 mutational events that included 9 indels. Five of the 
indels and 6 of the nucleotide mutations were single occurrence events 
(autapomorphics) and eliminated, leaving 24 infomiative mutational 
events that were utilized (herein called SNPs). An associational matrix 
was constructed using these 24 SNPs, and the resulting minimum 
spanning network is shown in figure 6 (right). Interestingly, again, no 
variation was found within J. recurva var. uncinata or among J. r. var. 
recurva (Fig. 6, right). However, the three J. squamata samples showed 
considerable variation. The three varieties of J. indica, as before, 
showed considerable differences, with J. recurva var. recurva being 
placed in the midst of the three J. indica varieties (Fig. 6, right). 

The intermediate plants (7210, 7211, 7218) are plotted 
differently in each data set. Plant 7210 has 3 nrDNA mutations that 
separate it from all J. recurva plants (Fig. 6, left), but its cp petN-psbM 
sequences are identical to J. recurva var. uncinata (Fig. 6, right) 
suggesting that the male (pollen and cp transmitting) parent was J. r. var. 
uncinata. Plant 72 1 1 is identical in its nrDNA to two of the J. recurva 
var. uncinata plants (Fig. 6, left), whereas, its cp petN-psbM sequence is 
identical to J. recurva var. recurva plants (Fig. 6, right), suggesting that 
the male parent was J. r. var. recurva. If this is correct, then gene flow 
seems to be bi-directional. Plant 7218 is intermediate in its nrDNA 
between J. r. var. recurva and var. uncinata (Fig. 6, left) and has 4 SNPs 
separating it from J. r. var. recurva (Fig. 6, right). 

A minimum spanning network based on combining the 1 1 
nrDNA and 24 petN-psbM SNPs shows that J. recurva var. recurva is 
well separated from J. r. var. uncinata (Fig. 7). The varieties of J. 
indica are nearly equidistant. The accessions of J. squamata show 
considerable differences. 

The intermediate individuals largely follow the cp petN-psbM 
differences in that each are associated with either J. r. var. recurva 
(72 1 1 , 72 1 8) or J. r. var. uncinata (72 1 0) (Fig. 7). Although J. r. var. 



370 



rii\!(>l,>,i;lci (Dcccinhcr 2009) 91(3) 



Combined nrDNA + petN-psbM, 35 SNPs 
•— :, indica^ar. 



, rushforthiana 



indica var 
caespitosa 




squamata 



♦ J. recurva 
+ intermediate 

# var. uncinata 



squamata f. 
wilsonii 



squamata 



Figure 7. Minimum spanning network based on 1 1 nrDNA and 24 cp 
petN-psbM SNPs. The dotted lines show the 2nd nearest link. Numbers 
next to the links are the number of SNP differences. 

uncinata appears to be as distinct from J. r. var. recurva as other species. 
However, due to the likely hybridization and intergradation, it seems 
unwise to recognize it at the specific level at this time. 



Phytologia (December 2009) 91(3} 



371 



NJ nrDNA + 
petN-PsbM 



85 



100 



58 



22 



64 



"}_ J. indica var. 
caespitosa 



62 



J. indica var. 
94 u rushfoiihiana 

intermediate 
7211 

J. recun/a var. 
recurva 



intermediate 
7218 



60 



]_ J. indica 
var. indica 



47 




rf 



34 



100 



£ 



J. recurva 
var. uncinata 

intermediate 
7210 

J. squamata 

J. scopulorum 
J. virginiana 



Figure 8. NJ tree based on nrDNA and cp pctN-psbM sequences. The 
numbers on the branches are bootstrap probabilities (1000 reps.). 

Another method to examine the sequence differences is by 
adding an outgroup {J. scopulorimh J. virginiana) to the data set and 
computing a NJ tree. Figure 8 shows a NJ tree based on combined 
nrDNA and petN-psbM sequences. Notice, although the species group 



372 PhMolo^iia (December 2009) 91(3) 



into cladcs, these clades are generally not well supported. The 
intermediate plants grouped with J. r. var. rccurva (721 1 ) or 7. r. var. 
uncinahi (7210). reflecting the male chloroplast donor. Intermediate 
plant 7218 is not closely associated with any clade. 

There is weak support tor J. recurva var. uncinnta and J. 
squamaia as a clade (Fig. 8, 47). Examination of the leaves of the taxa 
concerned, show (Fig. 9) that the leaves of 7. rccurva \ar. uncinata are 
very similar to those of 7. recurva var. recurva and not like those of 7. 
squamaia. In addition, the gene-flow between var. recurva and var. 
uncinata suggest a very close relationship. It is also noteworthy that the 
leaves of J. indica and its varieties are scale-like and differ from the 
decurrent leaves of J. recurva var. recurva (Fig. 9) such that the 
placement of var. recurva within the J. indica clade is inconsistent with 
leaf morphology. Perhaps there are ancestral gene-patterns of 7. indica 
that are still expressed in 7. recurva var. recurva for the two gene 
regions sequenced. 

Incomplete lineage sorting and gene coalescence 

Degnan and Rosenberg (2009) define incomplete lineage 
sorting as "the failure of two or more lineages in a population to 
coalesce, leading to the possibility that at least one of the lineages first 
coalesces with a lineage from a less closely related population." Syring 
et al. (2007. Table 6) suggest that the number of years for monophyly to 
be more likely than paraphyly in Pinus may be from 1 .7 to 24 Myr and it 
may take from 5.4 to 76 Myr for a species to attain a complete genome- 
wide coalescence. The oldest known fossil of Juniperus is from Europe 
(dated at 35 m yr bp, Kvacek, 2002). The Himalayas began to fomi with 
the collision of the Indian and Eurasian plates about 40-50 m yr bp 
(USGS, 2009). It may be that 7. indica and 7. recurva have had 
insufficient evolutionary time to fully complete lineage sorting (at least 
for the two gene regions sequenced in this study). 

Leaf terpenoids and analysis of hybridization 

A more detailed examination of 7. r. var. recurva, J. r. var. 
uncinata and putative hybrids was undertaken by examining the volatile 
leaf terpenoids. Table 1 shows the compositions of the oils of 7. recurva 
from the study area (Fig. 1). The oils of var. recurva are high in a- 
pinene, sabinene, 8-3-carene, limonene, p-phellandrene and elemol 



Phytohgia (December 2009) 91(3) 



373 







1 cm 

J. indica var. indica 




J. indica var. caespitosa 




J. indica var. rushforthiana 



J. recun/a var. uncinata 




J. recurva var. recurva J- squamata var. squamata 

Figure 9. Leaves and female cones of ta.xa in this study. 

with moderate amounts of myrcene, terpinolene. terpinen-4-ol, 
pregeijerene B, y-eudesmol and abietadiene (Table 1). 



374 Phvioloi^ia iDccciuhcr 2009} 91(3) 



The leaf oils of var. uncinciui arc very high in 5-3-carene (27.0 - 
37.0%) and high in tcipinolciic, trans-imuiri)la-4( 14),5-dicnc, cubcbol, 5- 
cadincne, with niodcralc amounts of a-pincnc, sabincnc, limoncnc, (3- 
phcilandrcnc, cis-muurola-3,5-diene, and trans-cadina-l(6),4-dicnc 
(Table 1). Several compounds were present in var. reciirva, but absent 
in var. uncinaia: a-thujcne, cis-sabinene hydrate, trans-sabinenc hydrate, 
hexenyl isovalerate, linalyl acetate, germacrcne B, humulene epoxide II, 
and y-eudesmol. Two compounds were found in all var. uncinata oils 
but were absent in var. reciirva oils: cis-Iimonene oxide and P- 
oplopenone (Table 1). 

The intermediate plants (7210, 7211, 7218) often had 
intemicdiate values in their composition. Note a-thujene, a-pinene, 5-3- 
carene, terpinen-4-ol, cis-muurola-3,5-diene, trans-cadina-l(6),4-diene, 
trans-muurola-4(14),5-diene, 5-cadinene, elemol, y-eudesmol, and 
abietadiene (Table 1). Two of the compounds exhibited a 'gigantism' in 
being markedly higher concentration in some of the intermediate plants: 
myrcene and p-phellandrene (Table 1). 

Thirty eight of the terpenoids that were larger than trace 
amounts, and displayed fidelity within the taxa (boldface in Table 1), 
were used to compute an association matrix. Factoring the matrix 
resulted in two eigenroots that were larger than the average diagonal 
value, and likely biologically significant. 

The first three eigenroots (47.3, 16.0, 10.3 % of the variance) 
were used to plot the individuals (Fig. 10). Jimipenis recurva var. 
reciirva individuals fonned a looser cluster than those of var. uncinata. 
Two of the intermediate plants (7211, 7218) form the classical U 
triangle between parents and hybrids, exactly the ordination position that 
is expected for hybrids (sec Adams, 1982, for a detailed examination of 
multivariate analysis of both synthetic and putative hybrids). The third 
intermediate plant (7210) is much closer to J. r. var. uncinata and 
behaves as a back-cross or F2 generation plant in this ordination 
(Adams, 1982). It is interesting to note that none of the analyses of 
sequence data had the sensitivity to detect these hybrids, and/or back- 
crossed, individuals. 



Phytologia (December 2009) 91(3) 



375 



Pleines, Jakob and Blattner (2008) state "As tree-based 
methods are mostly insuftlcient to depict relationships within species, 
network approaches are better suitable to infer gene or locus 
genealogies. Problematic for phylogeographic studies are alleles shared 
among multiple species, which could result from either hybridization of 
incomplete lineage sorting." The results from the present study show 
that analysis of hybridization and introgression using multivariate 
statistical methods of quantitative data is more infonnative than the tree- 
based method utilized. 





^(16%) 


PCO 

38 terpenoids 


J. recurva var 
recurva 

.26/ 


.21 




1 


J. recL 
var. ur 

(L 


irva 
icinata 

') 23 
' 7210 


I 


r . _ 








.27- 




J 


/ 


/ 40 


15, 

72,i' '^y 


y 1(4/ 7o) 


3(10%) 



Figure 10. PCO of 7. recurva individuals based on 38 terpenoids. The 
dashed line is the minimum spanning network and the values next to the 
links are the distance values between OTUs. 



In summary, the recognition of the new variety, J. recurva var. 
uncinata, is supported by morphology, terpenoids and DNA sequence 
data. Additional research is needed to clarify the variation found in J. 
squamata. 



376 rh\i(>l(>!^i(i {December 2009) 91(3) 



ACKNOWLEDGEMENTS 

Thanks to Guy Ncsom lor the Latin dcscriptit)n and to Andrea 
Schwarzbach, Randall Terry and Billie Turner for manuseript reviews. 
Thanks to Tonya Yanke for lab assistanec. This researeh was supported 
in part w ith funds from Baylor University. 

LITERATURE CITED 

Adams, R. P. 1975. Statistical character weighting and similarity 

stability. Brittonia 27: 305-316. 
Adams, R. P. 1982. A comparison of multivariate methods for the 

detection of hybridization. Taxon 3 1 : 646-66 1 . 
Adams, R. P. 2000. Systematics of smooth leaf margin Jiiniperus of the 

western hemisphere based on leaf essential oils and RAPD DNA 

fingerprinting. Biochem. Syst. Ecol. 28: 149-162. 
Adams, R. P. 2008. Junipers of the World: The genus Junipenis. 2nd 

Ed., Trafford Publ., Vancouver, B. C. 
Adams, R. P., B. R. Ruiz, M. Nogales and S. S. Fontinha. 2009. 

Geographic variation and systematics of Junipenis phoenicea L. 

from Madeira and the Canary Islands: Analyses of volatile leaf 

oils. Phytologia 91(1): 40-53. 
Blattner, F. R. 1999. Direct amplification of the entire ITS region from 

poorly preserved plant material using recombinant PCR. 

BioTechniques 27: 1 1 80- 1 1 86. 
Degnan, J. H. and N. A. Rosenberg. 2009. Gene tree discordance, 

phylogenetic inference and the multispecies coalescent. Review. 

Trends in Ecol. and Evol. (in press). 
Gower, J. C. 1966. Some distance properties of latent root and vector 

methods used in multivariate analysis. Biometrika 53: 326-338. 
Gower, J. C. 1971. A general coefficient of similarity and some of its 

properties. Biometrics 27: 857-874. 
Kvacek, Z. 2002. A new juniper from the Palaeogene of central Europe. 

Feddes Repert. Ill: 7-8. 
Pleines, T., S. S. Jakob and F. R. Blattner. 2008. Application of non- 
coding DNA regions in infraspecific analyses. Plant Syst. Evol. On- 
line Review, 1 Aug 2008, 

http://www.springlerlink.com/content/k68500n3525r637h/ . 



Phytologia {December 2009) 91(3) 311 



Syring, J., K. Farrell, R. Businsky, R. Cronn and A. Listen. 2007. 

Widespread genealogical nonmonophyly in species of Finns 

subgenus strobiis. Syst. Biol. 56: 161-181. 
USGS. 2009. The Himalayas: Two Continents Collide. 

http:/7pubs. usgs.gov/gip/dynamic/himalaya. html 
Veldman D. J., 1967. Fortran programming for the behavioral sciences. 

Holt, Rinehart and Winston Publ., NY. 



378 



Phyioloi^ia {December 2009} 91(3) 





"^ 






^. 


OS 


f<-> 


r^i 








-t 


rr, 


sC 








>c 








r^i 


o 


1 


r-^ 


^ 


' d 


d 


«J 


r^ 


*- 


d 


d 


d 


♦- 


1 


1 


■^ 


1 


1 — 




r- 
















fN 






















2 ~ 
















































































'Tj r] 


r-i 


„ 




«^ 


r^i 


— -^ 


r«~> 


1; 


o 




sO 


so 


so 








f^i 






o ~ 










































rj 


o 


' 


f^ 


fN 


d d 


d 


^m 


r-* 


*" 


d 


r^t 


«^ 


** 


' 


' 


•/■] 


' 


' 


u 


r- 
















r*"i 






















O \-^ 
















































































.E > 


r-j 


_ 




oc 


00 


Tt 


rsi 


fN 


,. 


.. 


>/-i 


O 


M 








00 




r^i 


c 

CO 


fN 


o 


1 


fs 


^ 


' d 


d 


^ 


r4 


d 


d 


f*^ 


f^ 


•fc* 


' 


' 


•^ 


' 


' d 


r- 
















f*^ 






















2 
















































































is c/^ 


o 


— 




fS 


<N 


_ so 


r--! 


<N 


— 


— 


— 


o 


— 


fN 






r-_ 




ri 


■^ ^ 


ri 


o 


** 


yr, 


^ 


d d 


d 


r^ 


^ 


d 


d 


sd 


sd 


d 


*" 


■" 


r^i 


' 


' d 


i; _ra 


r-~ 
















rs 






















S c 








































§ 1 


ri 


.^ 


o 




00 

d 




.„ 




00 

d 


d 


^ 


o 

sC 


On 


d 


^ 


, 




, 


♦- -^ 


o 


r-~ 














-" 


— 








'-■ 






































































































































^; 5 


— 




fs 


fN 


■^ 


a^ 


— 


r~ 


00 


» 




o 


fvj 


fS 


^ 


— 


r-; 




r-, 


? c 


ri 


1 


o 


'^* 


d 


' d 


d 


00 


vd 


d 


■— 


r-^ 


Tf 


d 


d 


d 


rS, 


•>- 


— d 


C "" 


r- 
























w^ 






























































































's_/ 








































^ 


>/"i 




'T 


»S 


•^ 


'it 




r-; 


■^^ 


so 


— 


o 


r-; 


o 


rn 




fS 




rn 


lJ _- 


rsi 


1 


o 


r^ 


d 


' <^ 


■^ 


^ 


00 


d 


d 


r^ 


00 


^ 


d 


1 


>-I 


' 


■" d 


!i 


r^ 










" 












'" 
















2 ^ 


t^ 




so 


-. 


fN 


-. 


ri 


o 


^ 


r- 


r^, 


<N 


fN 


— 


Wi 




sC 




n (-<■, 


>» ^ 


ri 


■^ 


o 


■^* 


va 


' r^i 


d 


ri 


so 


d 


d 


sd 


sd 


— 


d 


' 


fN 


' 


d d 


^ i- 


r- 










— 




— 






















.^ ra 








































~- > 








































S 


o 




<N 


o 


<N 


^ 


(-'■; 


r~; 


^. 


rTi 




r^ 


r*^i 


•^ 


fN 




SO 




— — 


'^4-^ 


ri 


■^ 


o 


r^ 


^ 


' \r, 


o 


r<^ 


00 


d 


*- 


r-^ 


d 


d 


d 


' 


r^i 


" 


d d 


./j 


r^ 
















"~ 








"■ 














^— 








































'o 








































u- 








































c^ 








































o 
































^,— ^ 








"^ 
































-o 








o 








































































'o 








'^ 
































c 








« 






























a> 


rt 






OJ 


o 
> 






























« 

u 


j3 




o 


2 


o 


























o 






o 




o 

o 


>. 

^ 


c 
o 
^2 




















u 








0^ 


c 

IE 
« 

1 

'3 


>< 

o 


o 




c 


a. 

E 
o 
U 


-a 
c 
- 
o 
c 

E 

o 
O 


o 
o 


c 

1 


c 
"S. 

1 


c 


o s 
o c 

-e s 


O 
O 

'c. 


c 
E 


c 

1 

CO 


c 
c 
'q. 

o 
1 

e 


o 
c 
o 


0^ 

c 

o 


c 

a. 
ca. 


c 
c 
'E. 

o 


"5 


s 

o 
s 

"5. 


X 

o 
o 

1 
sC 


c 
m o 


o 










Wi 


^ so 
OS OS 


'^ 


00 
00 
OS 


00 


■rt 


O 


Tt 


IT* 


■^ 


1/-/ 


r^ 


so 


o 


sO sO 


x> 




^^ 


■^ 


r^ 


o 




(^4 


fS 


fS 


•Ti 


so 


sO 


00 


OS 


OS OS 




< 




OS 




as 




o 


o 


O 


o 


o 


o 


o 


o 


o 


o 


o o 



Phytologia (December 2009} 91(3) 



379 



'^ 


r-j 




r) 




n 




ri 










nC 

















f^i 




r-j 


d 




d 


' 


d 


' 


d 


■" 


*- 


' 


' 


d ' 


' 


' 


1 


d 


' 


' 


' 


d 


*- 


t^ 












































r^ 






fNl 


















so 














■^ 


«^ 


^ 




















•^^ 


























(N 


' 




d 


1 


•" 


' 


■" 


■" 




1 


' 


d ' 


' 


' 


1 


1 


1 


' 


d 


o 


o 


t^ 












































CnI 






__ 












fN 






*r> 














Tt 




fN 


rsi 


' 




d 


1 


■" 


I 


■" 


■" 


d 


1 


' 


d ' 


1 


1 


' 


1 


■^ 


' 


d 


1 


d 


r- 












































o 


^^ 








<N 




__ 


r) 


■* 






«N 




r-i 






_ 






IT) 


■<i- 


(N 


d 




*- 


■" 


d 


1 


d 


d 


d 


— 


•" 


d *- 


♦-- 


d 


' 


■" 


d 


1 


** 


d 


d 


r- 












































oo 


















•^ 






^« 






^^ 












fN 


fN 


' 




-^ 


■" 


1 


*- 


■^ 


■" 


d 


1 


1 


d ' 


' 


1 


d 


' 


' 


1 


1 


-4-1 


d 


t^ 












































— 


o 




_^ 








__ 




■^ 






fN 






r^ 






fN 






fN 


CnI 


d 




d 


■" 


1 


*- 


d 


*-• 


d 


*- 


♦-' 


d ' 


' 


' 


d 


■" 


■" 


d 


1 


-W 


d 


r- 












































lA) 


(N 




rs| 


__ 






__ 




-^^ 






00 






fN 






ir> 




ON 


fN 


o4 


d 




d 


d 


' 


*-' 


d 


■^ 


fN 


■" 


■^ 


d ' 


1 


' 


d 


■" 


1 


d 


1 


■^ 


d 


r-- 












































i^ 


(N 




en 


(N 




r^ 


^^ 


__ 


yri 




(N 


'^ 






«^ 






rn 




o 


fN 


<N 


d 




d 


d 


' 


o 


d 


d 


fN 


■" 


d 


d ' 


1 


' 


d 


1 


1 


d 


1 


--T 


d 


r- 












































ON 






m 






fN 




'^ 


„_ 


r-) 


rs! 


fN 






rn 






fN 




yrt 


r^ 


r^i 


1 




d 


■" 


1 


d 


-" 


d 


^ 


d 


d 


d ' 


> 


1 


d 


1 


1 


d 


' 


f^* 


d 


r- 


o 

rt 






1 


o 


"o 




oo 

c 

_u 

'-5 

C 

E 














o> 


O 






a; 






3 
C 

5 
U 


> 

o 
c 

O 

Q. 

O 


c 
o 

3 

E 


O 
c 

B 
3 
X) 

">. 

o 


a 

o 

T 

Q. 

C 


."2 
'>< 
o 
o 

c 
o 

c 
o 

'a 


c 

1 
r< 

JZ 

c 

E 
a. 

;/) 
'o 


o 
o 

o 

C 


"o 
4 

c 

O) 

"5. 


"5 

c 

E 

o 


o^ 
c 

E 

o 


1 ^ 

.£ o 

^ -E 
i ^ 


1 

'G 


c 
o 

c 

C 

2 


> 
o 
;« 

c 
o 
;«< 


P 

"o 
o 
> 

O 


o 
c 
o 

D. 

'5. 




_2 

c 
o 

*o 
E 


02 s^ 
on c 

U O 

a. ^ 


_aj 


^ 


fN 




ON 


Csl 


f^ 


r~~ 


vO 


-^ 


ON 


"^ 


VO '^ 


m 


to 


^ 


_ 


ON 


'* 


r^ 


Tt 


1^ 


X) 


O 


— « 




^— 


r*^ 


m 


m 


^ 


i~- 


t^ 


o 


00 o 


rg 


rn 


•^ 


^ 


^ 


ITi 


ITj 


1^ 


00 


r3 


^^ 


^« 




^^ 


^^ 




^— 


^^ 


^M 


^^ 


OJ 


— ri 


CnI 


r-1 


fN 


(-Nl 


rs 


fN 


fN 


fN 


fN 


H 


— 


— 







— ' 


— 


— 


— 


— 


— 


















— 







380 



Fhyioloiiia (December 2009) 91(3) 



tT 






r^, 




■^^ 




ri 


vC 




rg 


^_ 


r'". 




f*-, 






3^_ 




^ 


vC 


ir, (H", 


n 




*- 


o 


' 


d 


' 


o 


d 


1 


d 


•*' 


o" 


— 


t' 


-- 


— 


d 


' 


>^ 


d 


iri \d 


r- 


































^" 










m 




<S 


ro 




■^ 






IT/ 






r~; 






<*"< 






sC 




^C 


w, 


ON 1- 


(N 




o 


O 


' 


d 


' 


1 


d 


' 


■-' 


r^* 


" 


1 


r*~i 


— 


' 


a^' 


' 


d 


d 


-r 'T 


t^ 












































(^4 




fN 




, , 


TT 




(^) 


IT, 




r^. 


^ 


r^. 




tr. 






r^/ 




r-; 


r~; 


— T 


ra 




o 


• 


o 


d 


' 


o 


d 


' 


o 


r^' 


o 


— 


f"! 


— 


— 


a^ 


' 


d 


d 


vC sC 


r^ 












































o 




IT. 


ri 




»N 




rj 


■^_ 




(^ 


f<^ 


rj 





s 




r\ 


ir. 




ac 


>c 


-T fN 


o-i 




d 


o 


— 


d 


1 


o 


sj 


' 


d 


r-i 


o 


o 


*N 


— 


o 


sC 


' 


d 


d 


ir, tr. 


r^ 












































oc 










■^^ 




__ 


tr, 




, 


f^j 






X 






*". 




•/-I 


o 


O; Wi 


rj 




1 


1 


1 


d 


' 


o 


d 


1 


d 


f<^ 


— 


' 


fN 


^ 


' 


3C 


' 


d 


•^i 


ir< r*^, 


r- 












































— 










•^ 


(N 


<N 


sC 




(N 


^a 


(^ 




ac 


, 


__ 


ac 


o 


•/■j 


o 


ac r-; 


(^1 




*- 


^ 


1 


d 


O 


O 


d 


' 


d 


f<^ 


o 


' 


fs 


d 


d 


•/ 


ro 


d 


«^ 


vC r*^ 


r- 












































1/1 






(^J 




r^ 







f^i 


r) 


r^i 


-^ 


rj 




„_ 






3C 


>C 


<^< 


^. 


ac r^ 


(N 




1 


o 


' 


^ 


1 


o 


d 


d 


d 


^ 


o 


' 


w^ 


— 


' 


rsi 


o" 


d 


d 


^ ^ 


r- 












































r- 






_ 
















rs| 






„_ 










m 


m 


r^< r*-, 


(^j 




1 


o 


' 


' 


' 


1 


1 


' 


' 


d 


■^ 


' 


d 


"- 


' 


' 


' 


d 


d 


d -^ 


r- 












































o^ 






<N 
















r* 












„_ 




r^ 


sC 


«^ 


r^i 




" 


o 


1 


1 


' 


1 


' 


*- 


— 


d 


' 


' 


*- 


♦- 


' 


d 


' 


d 


d 


1 ^ 


r^ 


o 






o 

ra 




o 








o 


c 
■5 




o 
c 
o 


C 

"5 
•4 

3" 






c 
















"S 




CZ 






^— 


o 






^^ 


^rt 






S3 












c 


'S 

Q. 




o 

TO 
t 

C/j 

C 
C3 


c 

X! 

3 
1 

S 


c 

'1- 

o 
a 


rj 
c 
o 

c. 
o 
o 

a 


= 

3 


Q 

o 
o 

o 


"a. 


3 

T 


a 


'J 
G 


1 

C 
« 


£ 


Q 
o 

E 
o 


O 
3 

C 


-C 

'5. 
o 


c 

1 

a 


1 


c 
c = 

11 


o 


r- 




OC 


O 


ITj 


^ 


'^ 


t^ 


r<-, 


r^ 


9C 


rj 


^ 


IT, 


DC 


o 


f^< 


r^, 


o 


f, 


r*-, r^ 


X! 


90 




CN 


r^ 


■^ 


■^ 


t^ 


3C 


^ 


. — 1 


'^ 


ly", 


\C 


1^ 


r^ 


DC 


o^ 


C^ 


o 


•^ 


— <s 


a 


<N 




r^ 


c^ 


f^ 


r^i 


rn 


<^< 


^ 


^ 


■^ 


'^ 


^ 


T 


^ 


'i- 


TT 


^ 


ir, 


ITi 


ir, ir, 


h- 














— 


"" 


















*" 


— 


^" 


^* 


^" ^* 



Phytologia (December 2009) 91(3) 381 



^ 


^t 


r~- 


, 


w. 






ri 




r- 


„_ 






o 




q 


o 


(^1 


(^ 


o^_ 


Os_ 


ri 


— .' 


o 


o 


^ 


■^ 


I 


— ' 


' 


d 


d 


1 


' 


(^ 


' 


-J 


—' 


d 


d 


o 


o ' 


[^ 










































r^ 


-^ 


sC 




W-j 






DC 




iy~i 


fs 






rsj 




sO 


\C 






'^r 


u^ 


(N 


— ^ 


o 


1 


C5 




1 


d 


1 


d 


d 


1 


1 


c^ 


1 


d 


d 


•" 


■" 


d 


d ' 


r^ 










































(N 


OO 


vO 






1 




OO 




rn 








\o 




OO 


oc 


rvi 




so 


so 


<N 


o 


o 


*-' 


*• 


d 


1 


^ 


■" 


— i 


*- 


1 


' 


<-^ 


1 


d 


d 


d 


1 


d 


d ** 


r- 










































o 


o^ 


>r^ 




fS 














f<^ 






rj 


_ 


, 


q 


r^ 


_ 


o) 


__ 


OJ 


o 


o 


*- 


^ 


■" 


' 


r^ 


— 


— i 


d 


' 


■^ 


r-i 


d 


— '. 


— .' 


d 


d 


— .' 


— .' *" 


t^ 










































00 


r-j 


vO 




1/^ 






__ 




(^) 




M 




u-i 




sC 


i/~> 






ro 


^ 


(N 


-J 


O 


1 


o 


1 


1 


— '. 


-" 


r>i 


1 


d 


1 


^ 


-ktf 


d 


d 


■" 


*^ 


d 


d ' 


r- 










































— 


rn 


VO 


<N 


r-; 




^a 


o_ 


__ 


rn 




rn 




OC 


iTi 


t^ 


OO 


r-i 


m 


r~ 


[^ (^ 


rvi 


^ 


o 


d 


wm 


1 


O 


'. 


d 


r«-I 


1 


d 


1 


us 


d 


d 


d 


d 


d 


d 


d d 


1^ 










































w-^i 


m 


(N 


, 1 


■^ 




f^l 


OO 




m 








'^. 


fs 


vC 


in 




rn 


<:> 


O '^ 


r^ 


o 


o 


d 


l/^ 


1 


o 


d 


•" 


d 


1 


** 


1 


_,' 


^ 


d 


(3 


■>-- 


.' 


d 


— d 


r^ 










































r- 




rj 




w% 




rn 


__ 








r*^ 






o 


m 


uo 




ri 


r- 


t^ ^ 


n 


1 


o 


1 


vd 


1 


d 


r^ 


1 


' 


1 


d 


1 


1 


«^ 


d 


d 


*- 


_l 


d 


d d 


i^ 










































o^ 








1^ 




rn 


LT) 








^_ 






If) 


OO 


OO 




W-) 


p 


q so 


r^i 


1 


' 


1 


s6 


1 


d 


i 


■<— 


•— 


1 


d 


1 


1 


^ 


d 


d 


■I-- 


.' 


! 


— d 


r~~ 




o 

c 
o 






"q 












Ol 
























'■5 






V 




"o 




C 




;o 






















1 






iy-1 




'^ 


o 


o 




'S 


o 
'E. 


















-o 
o 

3 


o 


'■3 






1 


CQ 

c 
o 


9 




3 


c 
c 
c 

a. 


o 
a. 

c 


c 
o 


"o 
E 

t/5 


"o 
c 

'■5 


"o 

3 


o 


3 




"o — 
c o 


u 


o 

c 
o 




a 
O 


E 


•y) 


« 

g 

u 
u 


O 

C 
O 


1 


y. 


o 

Q. 
C 


s 

E 

s 


^ 


'5. 
o 


3 




'E. 


£ 




' 3 


— 


N 


C5 


o 


'J 


0X1 


M 


CJ 


ca. 


f 


— 


— 


?- 


o 


o 


e 


(n. 


w 


a X! 


_o 


oc 


m 


r- 


oc 


a^ 


Ov 


Tf 


(^1 


I^ 


r- 


oc 


00 


r- 


o 


OC 


00 


'^ 


o^ 


rsi 


CnI o 


JD 


CnI 


m 


<-<-) 


'^ 


ir-i 


IT* 


I^ 


oc 


OC 


o 


o 


^« 


r-j 


rn 


c^ 


r^ 


^ 


^ 


un 


lo r^ 


73 


l/~l 


lA) 


i/^ 


iTi 


■A) 


trt 


IT) 


•J-^ 


ly-^ 


sO 


sC 


vC 


vC 


so 


vC 


sC 


o 


sC 


sC 


so SO 


f- 


~~ 


— 


— 


"" 


-~ 


"■ 


~~ 


— 


— 

























382 



Phyfoloi^ia (December 2009) 91(3} 



tT 




rj 


n 









r) 


"/"i 


r,i 


' 


d 


c 


<N 


** 


1 


d 


d ' 


r~- 


















r^i 




































OX 


' 


-^ 


■" 


S 


*" 


' 


-' 


-^ 1 


r^ 


















r-^ 









fN 


fN 




r\ 


r\ 


o\ 


1 


' 





^ 


^ 


1 





' 


r^ 


















o 




'^ 


'^ 


O^ 


Tt 




c-, 


rj 


fN 


' 


d 


d 


f^l 


«J 


1 


d 


d ' 


r^ 


















CXD 






r^, 


. 


f*^l 




r<-i 


r^ 


(^1 


' 


1 





d 


d 


1 


d 


' 


r- 


















- 


r-i 




CnI 


^ 


»/^ 


_ 


00 


OS 


n 


o 




d 


d 


d 


d 


d 


d ■" 


t^ 


















ir, 




r^i 


_ 


^_ 


3C 






ro 


ri 


1 


ri 


d 


d 


^ 


' 


' 


d ' 


(^ 


















r^ 




>r-, 


r*-, 


„_ 







__ 


yz 


ri 


1 


rj 


^ 


d 


^ 


1 


d 


d ' 


r~- 


















ON 




Q\ 


r'-, 


. 


»^. 




— 


tT) 


(-Nl 


■^ 


rsi 


d 


d 


fN 


■" 


d 


d ' 


r^ 
















"o 


"3 


















c 


o 


-5 










c 

.Si 








1 I" 

r3 i- 


O 





2 




"0 

c 


"5 


> 







C ^O 


— 


X 


DC 




= 


s 


y. 


'^ 


i: i: 


o 


zc 


rj 


ir^i 


sC 


r- 


CnI 


oc 


'^ — 


Xi 


oc 


QV 


m 


ur, 


2S 


oc 


ON 


■ — r*~, 


c^ 


\C 


t^ 









ri 


rj 


r^i r^, 


r*"" 


""■ 


— 


ri 


r^ 


r^ 


ri 


rj 


n ri 



Phytologia (December 2009) 91(3) 383 



KEYS TO THE FLORA OF FLORIDA: 23, 
OPUNTIA (CACTACEAE) 

Daniel B. Ward 

Department of Botany, University of Florida 
Gainesville, Florida 3261 1, U.S.A. 

ABSTRACT 

Opuntia (Cactaceae) is represented in Florida by 9 species, one 
of which has 2 varieties. All but one iO. cochenillifera) are native. 
Two species [O. corallicola, O. triacantha) are rated as endangered, 
one species {O. stricta) as threatened. Nine additional species have 
been reported for the state, but are believed not to persist outside of 
cultivation. An amplified key is given to the Florida taxa. Phytologia 
91(3): 383-393 (December, 20091 



KEY WORDS: Opuntia, Cactaceae, Florida flora. 



The genus Opuntia (Cactaceae) has many acquaintances but 
few friends. If the abundant needle-like spines did not inhibit close 
contact, the innumerable minute glochids served as a reminder that one 
intimate experience is sufficient. And even for the dedicated botanist, 
the fleshy pad-like stems invariably lose much of their diagnostic 
character when prepared for the herbarium. Thus, it is inevitable that 
only a few resolute students of the prickly pears would determine the 
species to be recognized and the features by which they are 
distinguished. 

Four authors, in three major publications, have attempted to 
bring understanding to the Florida cacti. Nathaniel Lord Britton and 
James Nelson Rose produced an illustrated and descriptive study of the 
plants throughout the Americas (The Cactaceae. 1920). John Kunkel 
Small, a colleague and employee of Britton's. brought a close focus 
with detailed descriptions and keys to the cacti of the Southeast (Jour. 
N.Y. Bot. Card. 22: 20-39. 1919; Manual S.E. Flora. 1933). Small 



384 Phytoloi^ia (Decemhcr 2009) 91(3) 



later expanded his floristic treatment by discussion of biogeographic 
implications (Jour. N.Y. Bol. Card. 36: 1-11, 25-36. 1935). And 
Lvman Benson, a lifelong student of the family, duplicated and updated 
Britton & Rose's pioneer work (Cacti of the United States and Canada. 
1982). 

More recent studies have added detail in narrower fields: 
Barry L. Snow (Cactus & Succ. J. 53: 177-182. 1981), a history of the 
discovery and naming of southeastern cacti; and Daniel F. Austin, 
David M. Binninger & Donald J. Pinkava (Sida 18: 527-534. 1998), an 
analysis of the Florida semaphore cactus, O. corallicola. A thesis by J. 
D. Doyle (Univ. of North Carolina. 1990) has addressed the O. 
humifiisa complex, though recognizing only a single taxon. Richard P. 
Wunderlin & Bruce F. Hansen (Guide to the Vascular Plants of Florida. 
2003) have given a brief synopsis, closely patterned after Benson, of 
the Florida species. 

The philosophies of Small and Benson, as measured by the 
numbers of species they recognized, could scarcely be more different. 
The indefatigable Small (1933) recorded 28 species within the state, 
uhile the California-based Benson (1982) found only 10. These 
differences are partly based on Small's practice of describing in detail 
and then naming as species each population he found to differ, while 
Benson treated Small's novelties as minor variations or hybrids 
unworthy of specific recognition. 

But the time spent in the field by these two men was also very 
different. Small, for three decades, made almost annual trips to Florida, 
traveling throughout the state and studying its flora, while Benson is 
not documented as having made more than a single exploratory visit. 
Often Benson (1982) cited his examination of Small's own specimens 
(NY) as the basis for his assignment of taxa to hybrid status, not his 
own study of Florida populations. And Benson often included non- 
native species in the state, based solely on early Small collections, 
without himself bavins found them extant. 



Phytologia (December 2009) 91(3) 385 



During the 1910s and 1920s Small and his friends gathered 
and cultivated numerous selections of Opuntia from throughout the 
state in the "cactus garden" of the Charles Deering estate, Dade Co. 
(See Small (1919) for photographs and descriptions made at "Buena 
Vista.") Small's observations of these plants, under uniform conditions 
of cultivation, give weight to the conclusions of his published studies. 

But neither the detailed records of Small, nor the modern but 
abbreviated treatment by Benson (or the synopsis by Wunderlin & 
Hansen), permit a satisfying understanding of these Florida cacti. 
Perhaps the most disquieting indication to the visiting northern botanist 
that all is not yet resolved within Florida Opuntia is a visit to the quiet 
"pine islands" of the Ocala National Forest, in the north-central 
peninsula, where he sees sturdy tree-like cacti, to 1.5 meters or more in 
height, and is told that they are the same species as the obscure, wholly 
prostrate O. luimifusa that he knew in the northern states. 

This single observation is a direct introduction to the most 
intractable problem involving taxonomy of the Florida Opuntia. 
Within the Southeast the complex centered around O. humifusa was 
divided by Small into several species. Opuntia humifusa s.s. — its type 
was from Kentucky — is widespread across the northern states, but by 
Small was found to extend into the Southeast only along the 
Appalachian highlands. In contrast, on the southeastern and gulf 
coastal plains and across northern Florida, he recognized one 
widespread species, O. pollardii. (His O. lata, endemic to the lime sink 
region of northern peninsular Florida, appears indistinguishable.) 
Southward in the peninsula. Small encountered more variability. He 
found a tall plant, "with a stem 1-2 m. tall or more, becoming 1-2.5 dm. 
in diameter" (1919), best developed on the sands (now the Ocala 
National Forest) on the west side of Lake George, Volusia Co.; this he 
named O. ammophila. From the central peninsula southward. Small 
recognized something intermediate between O. pollardii and O. 
ammophila, with stems more diffused, not forming a trunk; he named it 
O. austrina. 



386 Phytoloi^ia ( December 2009) 91(3) 



Of these four taxa, Benson (1982) recognized throe. He gave 
no consideration to the differences separating the coastal plain plant 
from the northern plant; he treated both as O. hunii/usa. But within 
Florida, though he seenis to have had little understanding of O. 
amniophila (he limits its height to 30 cm.), he granted it varietal rank 
under O. hunii/usa. Likewise, separating O. austrina by its elongate 
joints, he accorded it similar varietal rank. (Wunderlin & Hansen 
(2003) were even less discerning. Under their aggregate O. Iiumifusa 
they assigned 14 names, essentially folding all the variability reported 
by Small into a single undivided species.) 

A modest transplant experiment has been run by the present 
author. In 2001, plants from a robust colony (Fort Wool, at the mouth 
of the James River, Eastern Virginia) of undoubted O. hunii/usa s.s. 
were transplanted to Florida (Alachua Co.) and placed among local 
plants identified as O. pollardii. Competion was avoided by regular 
weeding. Year by year the northern plants declined, first losing their 
few spines (the Florida plants were far more spiny), then their dark 
green coloration, then dying. None flowered nor fruited, nor produced 
any further joints. The last northern plant disappeared in 2008. The 
Florida plants prospered, in some years beset by woolly aphids, but 
flowering and fruiting annually. 

The ease with which Benson (and others) has accepted the 
unity of the northern O. hunii/usa with the appreciably different coastal 
plain O. pollardii may lie in the similarity of the characteristic prostrate 
habit of O. hunii/usa with the prostrate or scarcely erect posture of 
young O. pollardii. If only vegetative characters are seen, the 
differences may be overlooked. The spines of O. hunii/usa are few or 
lacking (less than 1 cm. long) [vs. 2-3 cm. long with O. pollardii]. If 
leaves have not been shed, they are much smaller (2-3 mm. long) [vs. 
6-8 mm. long]. Most striking, prostrate but mature plants of O. 
hunii/usa fruit abundantly, while young prostrate plants of O. pollardii 
never bear fruit. When present, the fruits of O. hunii/usa are 
significantly smaller ( 1-1.5 cm. long) [vs. 2-2.5 cm. long]. 



Phytologia (December 2009) 91(3) 387 



But even with Opuntia pollardii. adequately distinguished, the 
differences between that species and O. ammophila and O. aiistrina 
remain unclear. Solitary individuals may easily be mistaken one for the 
other. Indeed, with further study, specific rank may be found 
unmerited. But for the purposes of the field taxonomist, recognition of 
these taxa as discrete species seems preferable than to disregard their 
apparent differences. 

All names used for Florida Opuntia have been addressed here, 
usually by assigning those thought to be redundant to the accepted 
species they most resemble. Clearly, if hybridization is present, such 
assignments are deceptive in part, for a second parent must also be 
involved. There is much room for future investigation, where close 
observation — or controlled hybridization - will permit more exact 
matching of these names with their true allegiances. 

One name especially merits further examination. On the 
Middle Cape of Cape Sable, Monroe County, Small (1919) found a 
cactus with "finely banded" and "closely spirally twisted" spines; he 
appropriately named it O. zehrina. Benson (1982) has dismissed this as 
a synonym of O. stricta (as did Wunderlin & Hansen, 2003). But 
George Avery (pers. comm.. Mar 1965) reported finding plants that 
matched Small's description on Big Pine, Boot, and Sugarloaf keys. 
One is always reluctant to accept species of the Keys as endemic, 
because of the brief time span the land has been emergent. But here, 
for simple convenience, O. zebrina is merely noted under O. stricta var. 
dillenii. 

An issue has arisen that may well cast much of the present 
information regarding Opuntia into irrelevance. This is the appearance 
in Florida of an Argentine phycitine moth (Cactoblastis cactorum) 
whose larvae feed exclusively and voraciously on the larger plants of 
this genus (D. H. Habeck & F. D. Bennett, Ent. Circ. 333, Fla. Dept. 
Agric. & Cons. Serv. 1990). Opuntia stricta, once a common east 
coast species, is now greatly reduced, as are other Florida cacti, by the 
large orange and black larvae who burrow within the succulent pads 
and stems. Plants on Merritt Island, Brevard Co., seemingly little 



388 Phytoloi^ia {December 2009) 91(3) 



afflicted in Feb 2000, were almost entirely destroyed by July 2000. 
Curiously, the fruits had matured and seemed normal even as the 
supporting pads were hollowed out by the rapacious larvae. 



Phytologia (December 2009) 91(3) 389 



OPUNTIA Mill. ' 

1. Petals orange-yellow to bright red; plants erect, tree-like, much- 
branched; seeds with bristly hairs on side surfaces, 
(subgen. Consolea) 

2. Spines several per areole, diffusely spreading; petals small (1-1.5 
cm. long), appressed to stamens, orange-yellow in bud, soon 
turning red; flowers ±2 cm. dia. Erect tree-like shrub, to 3 m., 
with lateral spreading (semaphore-like) joints. Tropical 
hammocks. Florida Keys (Monroe Co. - Little Torch, formerly 
Key Largo, Big Pine); very rare (<12 plants in 1994). All year. 
Endemic. ENDANGERED (State listing). [Consolea coraUicola 
Small; Opiintia spinosissima, misapplied] 
FLORIDA SEMAPHORE CACTUS. 

Opuntia corallicola (Small) Werderm. in Backeb. 

2. Spines few or none; petals larger (2-2.5 cm. long), erect, bright 
red; flowers ±3 cm. dia. Erect tree-like shrub, to 2 m. Dooryards, 
waste areas. South peninsula (north along east coast to Brevard 
Co. - Merritt Id.); rare. All year. Joints readily detach and 
become rooted. [Nopalea cochenillifera (L.) Salm-Dyck] 
COCHINEAL CACTUS. 

* Opuntia cochenillifera (L.) Mill. 

1 . Petals yellow; plants erect to decumbent or prostrate, relatively little 
branched; seeds without bristly hairs, (subgen. Opuntia) 

3. Spines yellow, at least when young, stout (to 1 .5 mm. thick). 

4. Joints broad (6-12 cm. broad); mature spines terete at base, 
yellow until aged. Coastal dunes, shell middens. Robust erect 
or diffuse shrub, to 2 m. South and central peninsula (north to 
Nassau, Levy cos., disjunct to panhandle (Wakulla, Walton 
COS.); formerly abundant. Spring-summer. Threatened (State 
listing). Once, the abundant fruits were an important food for 
the Florida natives. In the late 1990s the larvae of a foreign 
moth destroyed a great majority of this species (as well as other 



390 Phxiolo^ia (December 2009) 91(3) 



species of Opuntia); only isolated plants now remain. 
SHELL-MOUND PRICKLY PEAR, TUNA. 

Opuntia stricta (Haw.) Haw. 

a. Spines few. \Opiintia Bentonii Griffiths; Opuntia keyensis 
Britt.& Small] var. stricta 

a. Spines abundant, prominent. [Opuniia airocapensis Small; 
Opuntia Dillenii (Ker-Gawl.) Haw.; Opuntia nitens Small; 
Opuntia tenuijlora Small; Opuntia tunoidea Gibbes] Opuntia 
zebrina Small [spines banded], on the lower Keys, may be 
distinct. var. dillenii (Ker-Gawl.) Benson 

4. Joints narrow (3-6 cm. broad); mature spines often flattened at 
base, gray in 2nd year (yellow when young). Low shrub, to 0.8 
m. Openings and edges of tropical hammocks. Florida Keys 
(Monroe Co. - Big Pine, Ramrod, Grassy); rare. All year. 
[Opuntia ochrocentra Small in Britt. & Rose] 

Opuntia cubensis Britt. & Rose 

3. Spines brown to gray, relatively slender (<1 mm. thick). 

5. Joints (=pads or stem segments) readily detaching. 

6. Joints elliptic to subcylindric (1.0-1.5 cm. broad); fruit with 
apex plane or shallowly concave. Prostrate creeping sub-shrub, 
to 0.1 m. Coastal dunes, dry pinelands. Panhandle coast (east 
to Jefferson Co.), disjunct to northeast Florida (Nassau to St. 
Johns COS.), further disjunct to lower gulf coast (Sarasota Co.); 
infrequent. Summer. The joints famously detach from the 
plant and adhere (via their retrorsely barbed spines) to innocent 
passers-by. [Opuntia Drummondii Graham; Opuntia impedita 
Small in Britt. & Rose; Opuntia pisciformis Small in Britt. & 
Rose; Opuntia Tracy i Britt.] 
JOE-JUMPER. Opuntia pusilla (Haw.) Haw. 



Phytologia (December 2009) 91(3) 391 



6. Joints obovate to suborbicular (3-4 cm. broad); fruit with apex 
(umbilicus) deeply concave. Prostrate shrub, to 0.2 m. Rocky 
hammocks. Florida Keys (Monroe Co. - Long, Big Pine); rare. 
Spring. ENDANGERED (State listing). [Opiintia abjecta 
Small in Britt. & Rose] 
KEYS JOE-JUMPER. Opuntia triacantha (Willd.) Sweet 

5. Joints firmly cohering. 

7. Stem stiffly erect, lower trunk subcylindric and unbranched, 
branched above. Tree-like shrub, to 1.5 m. Dry pinelands, 
both Longleaf {P. palustris) and Sand Pine (P. clausa). 
Central peninsula (Marion, Lake - Ocala N.F.); locally freq. 
Spring. Endemic. [Opuntia humifusa (Raf.) Raf. var. 
ammophila (Small) Benson] 
OCALA PRICKLY PEAR. Opuntia ammophila Small 

7. Stem branched from base, not tree-like. 

8. Joints elongate (length 2-3x width); stem sprawling, often 
ascending on adjacent vegetation. Sprawling or erect shrub, 
to 1 m. Thickets, brushy dunes, mangrove edges. South 
peninsula (north to Hillsborough, Brevard cos.); infrequent. 
Spring-summer. Endemic. [Opuntia compressa (Salisb.) 
Macbr. var. austrina (Small) Benson; Opuntia cwnulicola 
Small; Opuntia humifusa (Raf.) Raf. var. austrina (Small) 
Dress; Opuntia polycarpa Small; Opuntia turgida Small in 
Britt. & Rose] A catch-all taxon, very probably including 
numerous hybrids. 
HAMMOCK PRICKLY PEAR. Opuntia austrina Small 

8. Joints broadly orbicular to obovate (length 1.2-1. 8x width); 
stem prostrate or briefly ascending. Semi-prostrate to 
spreading shrub, to 0.3 m. Sandy waste areas, roadbanks, dry 
pastures. Panhandle and north Florida, south to mid- 
peninsula (Highlands Co.); common. Spring-summer. 
[Opuntia lata Small] 
COASTAL PLAIN PRICKLY PEAR. 

Opuntia poliardii Britt. & Rose 



392 Fhytolom {December 2009) 91(3) 



Excluded names: 

Opuiitia brusiliensis (Willd.) Haw. 
Brasiliopuntia brusiliensis (Willd.) Bergcr 

Distinctive "polelike trees." Reported by Britton & Rose (1919) 
who noted, "Dr. Small has found this plant established after 
planting on shell mounds and waste places in southern Florida"; 
by Small (1919), to "5 m. tall or more," from "woods, eastern 
peninsular Florida," specifically from "a shell mound south of 
Daytona," Volusia Co.; and by Long & Lakela (1972). Small's 
identification of this distinctive non-native species was probably 
correct, though no specimen was preserved. But the plants, as 
well as habitat, are long gone. The photos of Britton & Rose were 
of Cuban plants. 

Opuntia eburnispina Small in Britt. & Rose 
A Cape Romano, Monroe Co., plant, apparently not re-collected 
(Britton & Rose, 1923; Small, 1933). Perhaps close to O. 
cubensis. Benson (1982) suggested it to be a hybrid involving O. 
"humifusa" {=0. ausirinal) or perhaps O. stricta. though the 
similarities are not apparent. 

Opuntia ficus-indica (L.) Mill. Indian Fig 

Reported as naturalized by Small (1919; 1933), and by Wunderlin 
(1998). Widely cultivated as a door-yard novelty and persisting 
short-term. The fruits are abundant and are often scattered, but 
seedlings have not been reported, and the pads do not detach 
readily. No naturalized populations are known. 

Opuntia humifusa (Raf.) Raf. Northern Prickly Pear 

Opuntia compressa (Salisb.) Macbr. 
Opuntia Opuntia (L.) Karst. 

Exclusion of this northern species from Florida is dependent upon 
the judgment that plants of typical O. humifusa do not occur 
within the state, most plants so assigned being the more robust, 
upright, larger-fruited O. pollardii. Dress (1975) pointed out that 
Salisbury's basionym is superfluous, and that O. humifusa, though 
later, is correct. 

Opuntia leucotricha DC. Aaron's-beard Cactus 

Reported by Small (1925; 1933) as naturalized near Rio, south of 
Ft. Pierce, Martin Co., with the suggestion it was introduced by 
"pioneers during Seminole War times." Benson (1982) confirmed 



Phytologia {December 2009) 91(3} 393 



Small's spm.. as collected in 1918. Retained by Wunderlin 
(1998), without further data. The station has long since been 
obliterated by de\elopment. 

Opuntia lindheimeri Engelm. 
A western species, perhaps once introduced. Small (1927: 1933) 
reported it west of Hallandale. Brow ard Co.. "especially about old 
settlements and homesteads." Not seen by later observers. 

Opuntia magnifica Small 
Described by Small (1925) from the south end of Amelia Id., 
Nassau Co. A large plant, to 2 m. in height, with very slender, 
flexible spines. Small suspected it to be an introduction, but 
Benson (1982) placed it with O. stricta. Not found in recent 
search. 

Opuntia turbinata Small 
Described by Small (1933) from Ft. George Id.. Duval Co. 
Benson (1982) indirectly placed it with O. stricta var. dillenii. 
But the small, near-globose berries suggest some other alliance. 
Apparently never recollected. 

Opuntia vulgaris Mill. 
Opuntia monacantha (Willd.) Haw. 

South American; reported by Benson (1982) as introduced in Polk 
(Crooked Lake. Lake .Alfred) and Highlands cos., but only as 
hybrids w ith O. ammophila. Since O. vulgaris itself is unknown 
in the state, a correct identification (from herbarium materials!) is 
unlikely. 



This paper is a continuation of a series begun in 1977. The "amplified key" format 
employed here is designed to present in compact form the basic morphological 
framework of a conventional dichotomous key. as well as data on habitat, range, and 
frequency. Amplified keys are being prepared for all genera of the Florida vascular flora; 
the present series is restricted to genera where a new combination is required or a special 
situation merits extended discussion. 



394 riixioloi^ia (December 2009) 91(3) 



CONVOLVULUS CARRIL A LOCALIZED ENDEMIC FROM 
SOL 1 HERNiMOS T TEXAS 

B. L. Turner 

Plant Resources Center 

The University of Texas at Austin 

Austin. Texas 78712 

billie@uts.cc.utexas.edu 

ABSTRACT 

A new Convolvulus species is described from fine Holocene 
sands in southern Texas: Convolvulus carrii B. L. Turner, sp. nov. 

The ecology and possible speciation is discussed. Fhyioloi^ia 91(3): 
394-400 (December, 2009). 

KEY WORDS: Convolvulus carrii. Convolvulus equitans, taxonomy. 



Routine identification of Texas plants has revealed the following 
novelty: 

CONVOLVULUS CARRII B.L Turner, sp. nov. Figs. 1, 2 

Convolvulus equitati Benth., similis sed differt foliis incrassitis valde 
venosis dense argento-pilosis et seminibus laevibus vel paene laevibus 
(vs papulosis). 



Prostrate perennial or twining vine. Stems densely pilose with 
silvery hairs, the vestiture ca 1 mm high. Leaves 3-7 cm long, 2-3 cm 
wide, pubescent like the stems; petioles 1.0-2.5 cm long; blades 
thickened subhastate to subcordate, markedly venose, the margins 
irregularly dentate. Flowers mostly solitary (rarely not) on bracteate 
peduncles 5-7 cm long. Sepals 5, subequal, 9-1 1 mm long, their apices 
broadly rounded and minutely apiculate. Corollas white, ca 3 cm long, 
ca 4 cm across the extended petals, the throat "maroon" or wine- 
colored," occasionally not. Stamens 5. the anthers ca 4 mm long. 
Styles ca 2 cm long; the shafts glabrous, or rarely pilose at the apex 



Phytologia (December 2009) 91(3) 395 



(Correll & Correll 38844), the linear branches ca 2 mm long. Seeds 3- 

5 mm long, ca 2mm wide, smooth or nearly so. 

TYPE: U.S.A. TEXAS: HIDALGO Co., East side of Hwy 181, 7 mi 
N of San Miguel in deep, finely grained, white-sandy soils. 

Prostrate perennials arising from ligneous roots, the stems up 
to 8 ft long; corollas white with a purple eye at base of throat. At least 

6 very uniform populations were seen over a '/^ mi stretch of the 
highway (6.5-7.0 mi N of San Miguel), 20 Apr 2009, Billie L Turner & 
Jana Kos 09-03 (Holotype: TEX; isotypes, to be distributed). 

After the above observations, my colleagues, Richardson and 
King visited the type locale a second time and noted that while most of 
the populations had the typical purple centers, "2 or 3 of them had 
much smaller purple centers, and 3 or 4 of them were all white." 
Nevertheless, the syndrome of characters (described below) appears to 
hold for most of the populations concerned, and I still believe the taxon 
worthy of specific rank, the character perturbations not withstanding. 

ADDITIONAL SPECIMENS EXAMINED: U.S.A.: Brooks Co., S 

side of R. M. 755. ca 3.6 road-miles NE of Starr County line, "locally 
common in sparse vegetation on fine sand... on level upland underlain 
by eolian sand of Holocene," 26 47 45.4 N, 98 23 3 1 .9 W, 230-240 ft, 9 
Apr 2008, W.R. Carr 26646 [with D. Benish] (TEX); several mi SE of 
Falfurrias, "near gypsum quarry," 10 Jul 1957, Correll &. I.M. Johnston 
17811 (LL); 6 m^i S of Falfurrias, 4 Jun 1970, D.S. & Helen Correll 
38884 (LL). Hidalgo Co., northern part of county along highway 281, 

15 Oct 2005, Richardson & King 3337 (TEX); "Hwy 281, northbound, 
7.0 miles north of intersection with hwy 186," 15 Nov 2008, 
Richardson & King 3397 (TEX); same as previous location, 22 Mar 
2009, Richardson & King 3405 (TEX); "north edge of Hidalgo Co.," 

16 Jul 1925, Riinyon 590 (TEX); near San Manuel along highway 281, 
4 May \94\, Rimyon 2627 (TEX). 

The novelty is closely similar to Convolvulus equitans but can 
be distinguished by a syndrome of characters, including thickened, 
markedly venose, silvery-pubescent, markedly dentate, deltoid leaves 
(vs thin, sparsely pubescent, and highly variable as to shape and 
marginal dentation); flowering peduncles 5-7 cm long (vs. shorter); 



396 f'h\!<>h>,i;i(i (Di'd'nihcr 2009) 91(3) 



large white corollas with maroon or purplish throats, rarely not (vs. 
smaller and white to pale pink, the purple throats only rarely present); 
and seed coats smooth or nearly so (vs. mostly papillose). The smooth 
seeds of C. carrii are especially striking, this not observed in the large 
number of collections of C. equitaiis from southern-most Texas on file 
at LL-TEX, although nearly smooth seeds may occur elsewhere over 
the range of the species. 

Because of the extraordinary fact that only two species of 
Convolvulus are native to North America, one reviewer of the present 
paper suggested that C carrii might be an introduced species, either of 
Convolvulus or the closely related Calystegia. The relatively large 
flowers suggest the latter, but the slender style branches and yet other 
characters are clearly those of Convolvulus. Indeed, Correll, Runyon, 
and yet other knowledgeable taxonomists, have identified the plants 
concerned as C. equitans, in spite of the combination of characters that 
mark the species. 

Might the laxon be an exotic introduction to southern Texas? 
Not, in my opinion, since it is confined to a particular sand type, and is 
remarkably uniform from population to population over the area 
concerned. I have also examined a large suite of specimens of 
Convolvulus and Calystegia from throughout the world on file at LL- 
TEX and could detect no close fits. 

My own conjecture as to its origin follows: the fine Holocene 
sands, to which it seems confined, are derived from ancestral dunes, 
estimated at ca 10,000 years old (Carr, 2009). Over this time the 
characters of C. carrii must have evolved out of the more widespread, 
highly variable C. equitans. In short, a combination of characters 
selected out of C. equitans, with the evolution of yet others affecting its 
reproductive success, led to its existence. Verification must await DNA 
and experimental studies. 

According to label-data {Carr 26646), and personal 
observation, C. carrii is a prostrate perennial or else found "climbing 
over shrubs" {Correll & Johnston 1781 1). Carr states that the taxon is 
locally common on deep eolian sands of the Holocene. 



Phytologia (December 2009) 91(3) 397 



The type locality site was called to my attention by Al 
Richardson, for which I am most grateful. In spite of the seemingly 
regional drought at the time, plants at this locality were vigorous and in 
full flower. Interestingly, no plants of C. equitans were found in the 
deep sandy soils to which C. carrii is restricted, although it is 
exceedingly common elsewhere in the state of Texas and Mexico (Figs. 
2, 3). Similar sandy soils of the Holocene reportedly occur in adjacent 
Kenedy Co., and it is likely that the novelty will be found to occur in 
that area as well. 

The novelty is named for William R. Carr, exceptional 
botanical systematist working for the Nature Conservancy of Texas, 
who first called my attention to the plants concerned. 

ACKNOWLEDGEMENTS 

I am grateful to Guy Nesom for the Latin diagnosis; he also 
reviewed the paper, for which I am grateful. Al Richardson, My 
Academic Son (having obtained his doctorate under my supervision in 
1975) and his close field companion, Ken King, provided considerable 
input into the venture, especially in the procurement of mature seeds. 
Jana Kos was a field companion during my own study of the plants 
concerned, having to tolerate an excess of ohs and ahs upon seeing this 
or that population. 

LITERATURE CITED 

Carr, W.R. 2009. Plants of the South Texas Sand Sheet. [4 pages] 
biosci. utexas.edu/pre/DigFloraAVRC/Carr-SandSheet.html 

Correll, D.S and M.C. Johnston. 1970. Manual of the Vascular Plants of 
Texas. Contrib. Texas Res. Foundation 6: 1-1881. 



398 



rhxioloi^ia (December 2009) 91(3) 




Fig. 1 . Convolvulus carrii (holotype). 



Phytologia (December 2009) 91(3) 



399 




Fig. 2. Field plants of C. carrii (Carr 26646, TEX). 




CONVOLVULUS 
carrii 



Fig. 3. Distribution of C. carrii. 



400 



Phxioloiila (December 2009) 91(3) 




Fig.4. Distribution of C. eqidtans in Texas (based upon specimens at 
SRSC and LL-TEX). 




Fig. 5. Distribution of C. eqidtans in Mexico (based upon specimens at 
LL-TEX). 



Phytologia (December 2009) 91(3) 401 



COMPOSITION AND STRUCTURE OF THE GROUND LAYER 

VEGETATION AT IROQUOIS COUNTY CONSERVATION 

AREA, NORTHEASTERN ILLINOIS 

Loy R. Phillippe, Mary Ann Feist, Richard L. Larimore, Daniel T. 

Busemeyer, Paul B. Marcum, Connie J. Carroll, James L. Ellis, 

and John E. Ebinger* 

1816 South Oak Street, Illinois Natural History Survey. Champaign, 

Illinois 61820 
corresponding author: jeebinger@eiu.edu 

ABSTRACT 

The 7.8 km" Iroquois County Conservation Area in 
northeastern Illinois contains many of the plant communities found at 
this site during pre-settiement times. A sedge meadow, about 2.5 km" in 
size was dominated by Carex haydeniilstricta. The shrub sand prairie 
was dominated by Carex haydeniilstricta, but nearly 50 species 
encountered in the plots. In the wet-mesic sand prairies, Rubiis 
hispidus, Euthamia graminifolia, Potentilla simplex and Sorghastrum 
nutans dominated, while in the dry-mesic sand prairies Rubiis hispidus, 
Schizachyrium scoparium, Vaccinium angustifolium and Sorghastrum 
nutans were dominant. The ground layer vegetation of the sand 
flatwood communities was sparse with few species present, Vaccinium 
angustifolium and Carex haydenii being the most common. The sand 
savanna communities associated with the dunes had high species 
diversity. Here the ground layer vegetation varied, depending upon 
available moisture and shading. In the dry-mesic sand savanna 
Vaccinium angustifolium, Pteridiurn aquilinum and Carex pensylvanica 
were dominant, while in the dry sand savanna Carex pensylvanica, 
Rhus copallina, Rubus allegheniensis and Schizachyrium scoparium 
were the important species. This base line data will be used to 
determine management practices on the conservation area and 
surrounding nature preserves. Phytologia 91(3) 401-438 (December, 
2009). 

KEY WORDS: Vegetation, Iroquois County Conservation Area, 
Illinois, ecology, plant communities. 



402 Phxtoloiiui (December 2009) 91(3) 



At the time of European settlement prairie vegetation covered 
about 607c of Illinois (Iverson el al. 1991). Most was "black soil" tall- 
grass prairie of the prairie peninsula (Transeau 1935), though sand 
prairies were relatively common (Schwegman 1973). These sand 
prairies occur in the northern half of Illinois on glacial outwash plains 
associated with erosional events of Wisconsin glaciation (Willman and 
Frye 1970, King 1981). One of the most extensive in the state is the 
Kankakee sand deposit in northeastern Illinois in parts of Iroquois and 
Kankakee counties and adjacent Newton County, Indiana. 

Until relatively recently, no detailed studies of the vegetation 
of the Kankakee sand deposits had been undertaken. The pre-settlement 
vegetation of Iroquois County was studied by Hedborn (1984) while 
McDowell et al. (1983) described the composition and structure of the 
savanna communities of the Iroquois County Conservation Area. More 
recently, Johnson and Ebinger (1992, 1995) studied the effects of fire 
on the vegetation of the sand savannas at Hooper Branch Nature 
Preserve, Iroquois County, Illinois. The present study was undertaken 
to determine vascular plant species composition and structure, and the 
floristic quality of the ground layer vegetation of the major plant 
communities at the Iroquois County Conservation Area (ICCA). 

DESCRIPTION OF THE STUDY SITE 

The ICCA, which encompasses 7.8 knr, is located in extreme 
northeastern Iroquois County about 6 km northeast of the town of 
Beaverville (S22. 23, 24 T29N RllW) in the Kankakee Sand Area 
Section of the Grand Prairie Natural Division of Illinois (Schwegman 
1973)(Figure 1). Purchased by the Illinois Department of Conservation 
in 1944 as a prairie chicken sanctuary, the ICCA is now used 
principally as a hunting area, particularly a permit pheasant hunting 
area. When purchased most of the area had been heavily grazed and 
attempts had been made to drain the sedge meadow and marsh 
communities (White and Madany, 1978). 

The ICCA is situated at the edge of former glacial Lake 
Watseka, drained about 14,500 years ago during the Kankakee Torrent, 
leaving sandy beaches and near shore sand deposits (Willman 1973). 
These sands were reworked by wind, creating the dune and swale 



Phytologia (December 2009) 91(3) 403 



topography present today. The characteristic sand savanna, sand prairie, 
and sedge meadow vegetation became established during the 
Hypsithermal period about 8,000 years ago (King 1981). The soils of 
the ICCA are not diverse (Wascher et al. 1951, Kiefer 1982). The 
marshes, sedge meadows, shrub prairies, wet-mesic sand prairies, and 
flatwood communities that occur in depressions between the dunes are 
situated on Watseka loamy sands, Granby fine sandy loams, and 
Moracco fine sands. These soils, derived from sandy outwash 
sediments, are acid, peaty sand with a dark-brown to black surface 
horizon that are poorly drained. The soils on the dunes are Oakville fine 
sands that developed from sandy sediments that have a dark grayish 
brown surface horizon and are vvell drained (Kiefer 1982). 

Climate at the ICCA is continental with warm summers and 
cold winters. Based on weather data from Kankakee, 30 km to the 
northwest, mean annual precipitation is 98.0 cm, with May having the 
highest rainfall (1 1.5 cm). Mean annua! temperature is 9.9"C with the 
hottest month being July (average of 23.6''C), and the coldest January 
(average of -5.7"C). Frost free days range from 141 to 206, with the 
average being 174 days per year (Midwestern Regional Climate Center 
2007). 

MATERIALS AND METHODS 

During the growing seasons of 2000 through 2003 the ICCA 
was visited numerous limes, although many trips dating back to 1970 
were made by one of the authors (JEE). On the trips the plants species 
encountered were collected, their habitat recorded, and voucher 
specimens deposited in the Stover-Ebinger Herbarium of Eastern 
Illinois University, Charleston, Illinois (EIU), or the herbarium of the 
Illinois Natural History Survey, Champaign, Illinois (ILLS). Criteria for 
designating non-native species followed Mohlenbrock (2002), and 
Gleason and Cronquist (1991). Nomenclature follows Mohlenbrock 
(2002) while Herkert and Ebinger (2002) was used for listing the 
Illinois endangered and threatened species. 

Between 2001 and 2003 the ground layer vegetation of the 
major plant communities found at the ICCA was sampled by randomly 
locating two to four 25m transects throughout the best quality example 



404 riivfoloi^ia {December 2()(}9) 91(3) 



of each community type (White and Madany 1978). Along each 
transect m" plots were located at 1 m intervals (n=25/lransect), odd- 
numbered plots to the right, even-numbered to the left. A random 
numbers table (0-9) was used to determine the number of m the plot 
was placed from the transect line. Cover of each species was 
determined using the Daubenmire cover class system (Daubcnmire 
1959) as modified by Bailey and Poulton (1968). Importance value (IV) 
was determined by summing relative cover and relative frequency. 

The Sorensen Index of Similarity (ISs) was used to determine 
the degree of vegetation similarity between the areas surveyed 
throughout the ICCA (Mueller-Dombois and Ellenberg 1974). This 
index utilizes binary data (presence/absence) to measure the similarity 
in species composition between sites and is represented by the 
following equation: [ISs = 2C/A+B x 100], A equals the number of 
species in the first community, B equals the number of species in the 
second community, and C equals the number of species common 
between the two communities. Pairwise comparisons were made 
between each of the seven community types. 

RESULTS 

Floristic Assessment: A total of 562 taxa representing 303 genera and 
97 families were documented for the ICCA (Appendix I). Fern, fern- 
allies and gymnosperms were represented by 17 taxa in 10 families. Of 
the remainder, 155 were monocots in 17 families and 72 genera, and 
390 were dicots in 70 families and 220 genera. Of this total 78 non- 
native species were encountered (14% of all taxa), mostly in disturbed 
habitats. The predominant plant families were the Asteraceae with 79 
taxa, the Poaceae with 67 taxa, and the Cyperaceae with 49 taxa. State 
endangered taxa included Carex cumulata, Carex physorhyncha, 
Hypericum adpressum, Persicaria careyi, Scleria pauciflora, 
Vaccinium corymhosum, and Viola primulifolia were vouchered as 
were the state threatened Drosera intermedia, Hymenopappus 
scabiosaeus, Platanthera flava var. herbiola, Rubus schneideri, 
Sisyrinchiiim atlanticum and Veronica scutellata (Herkert and Ebinger 
2002). 



Phytologia {December 2009) 91(3) 405 



Marsh: The marsh community at the ICCA was extremely small, 
degraded, and retained little of the original natural quality. When first 
observed in 1983 by one of the authors (JEE), four vegetation zones 
were present in this marsh: Typha latifolia zone; Shoenoplectus 
tabernaemontani zone; Bolboschoenus fluviatalis zone; and a mixed 
vegetation zone. The mixed vegetation zone lacked a major dominant 
with Glyceria septentrionalis, Veronica scutellata, Thelypteris 
palustris, Spartina pectinata, and Persicaria hydropiper dominating 
this zone. The other zones were dominated by a single species, few 
other taxa were present. Presently, due to the lowering of the water 
table, few of the marsh species are present at this site and the entire area 
is overgrown with Phalaris arimdinacea. This area was not surveyed 
during the present study. 

Sedge Meadow: Very homogeneous in structure and relatively low in 
species diversity, the sedge meadows had well developed hummocks 
created by the dominant species Carex stricta and C. haydenii (IV of 
113 out of 200). Both species were common, and as they were not 
blooming when the survey was conducted, no attempt was made to 
distinguish them (Table 1). Some small sedge meadows were present at 
the ICCA, occurring in the areas between the dunes. In addition, a 2.5 
km^ sedge meadow exists in the southwestern quarter of the ICCA and 
was the one surveyed during the present study. Besides Carex 
strictalhaydenii, only two species were relatively common, 
Calamagrostis canadensis and Persicaria coccinea. Only 29 species 
were encountered in the plots, more than half with IVs of less than 1.0 
(Table 1). 

Shrub Sand Prairie: Only a few small examples of this community 
type were found at the ICCA. The ground layer of the wet-mesic shrub 
prairie was dominated by Carex stricta/haydenii (IV of 19.7) followed 
by Potentilla simplex (18.8), Spiraea tomentosa (14.7), Eitthamia 
graminifolia (13.1), Riibus hispidus (12.5), Schizachyrium scoparium 
(10.8) and Liatris spicata (10.3) (Table 1). This community had high 
species diversity with 52 taxa recorded in the plots. 

Wet-mesic Sand Prairie: A few wet-mesic sand prairies occurred at 
the ICCA, most being located adjacent to the sedge meadow 
community but on slightly higher ground. All of the wet-mesic prairies 



406 Phytoloiiia (December 2009) 91(3) 



examined show indications of disturbance, but species diversity was 
relatively high with 42 taxa occurring in the plots (Table 2). Eight 
species had IVs exceeding 10.0; Ruhiis hispidits (IV of 20. 1 ), Euthamia 
iiraiuinifoHa (18.3), Potentilhi simplex (18.2), and Sori^hastrnm nutans 
(18.1) being the most important (Table 2). 

Dry-mesic Sand Prairie: Few examples of this community were 
found, the only one large enough to study was located along the north 
edge of the ICCA. At this site, located on a lower dune slope, Riibus 
hispidus (IV of 32.8) and Schizachyrium scoparium dominated (31.3) 
followed by Vaccinium angustifoliiim (22.4), Sorghastnim nutans 
(13.3), Aster simplex (13.1), and Carex pensylvanica (13.1) with 30 
other taxa found in the plots (Table 2). 

Sand Flatwoods: A few small flatwoods communities occurred on the 
ICCA, all in depressions between dunes. Quercus pahistris dominated 
the overstory of these flatwoods. The ground layer vegetation was 
sparse and much of the area lacked vegetation altogether as indicated 
by the average bare ground and litter being 87.10% (Table 1). Common 
species encountered were Vaccinium angustifolium, Carex 
stricta/haydenii, and Rubus hispidus with only 12 other taxa in the plots 
(Table 1). 

Dry-mesic Sand Savanna: This community was relatively common on 
the lower slopes of the many dunes at the ICCA, some being of high 
natural quality. In this community Quercus velutina was the dominant 
overstory species but Quercus alba was also present, accounting for 
one-third to nearly half of the IV. The ground layer of this community 
was extremely variable depending upon past disturbances, time since 
the last fire, and the extent of shading. The present survey was 
undertaken in a dry-mesic sand savanna that had been burned in the fall 
of 2001 (two years prior to the survey), creating an open understory. 
Vaccinum angustifolium was the dominant species with an IV of 43.7, 
followed by Pteridium aquilinum (29.2), and Carex pensylvanica 
(24.6). Numerous seedlings of Quercus velutina and Q. alba were 
present accounting for these species being fourth and fifth in IV. Also 
various species of shrubs were common, mostly sprouts from 
individuals that had been top-killed by the fire (Table 3). 



Phytohgia (December 2009) 91(3) 407 



Dry Sand Savanna: Common on the ridges and upper slopes of the 
many dunes, this community was dominated by Querciis velutina to the 
almost total exclusion of other tree species. Carex pensylvanica (IV of 
27.7) and Schizachyryium scoparium (13.2) were the dominant 
herbaceous species. Shrubs and tree seedlings were also important in 
the ground layer, Rhus copallimi (24.4), Rubus allegheniensis (22.1) 
and Quercus velutina (12.5) were among the top five species in IV 
(Table 3). The ground layer of this community was diverse with 52 taxa 
recorded for the plots. 

Sorensen Index of Similarities: The communities studied were 
dominated by sand prairie species with as many as 15 species in 
common (Table 4). The wet-mesic and dry-mesic sand prairies had 
relatively high species similarity (ISs = 43.59), and were similar in 
species composition to the sand shrub prairie (ISs = 46.80 and 50.00, 
respectively). Most of the communities examined show little similarity 
to the sedge meadow, the highest being the shrub prairie (Table 4). We 
expected that the dry-mesic and dry savanna would have similar species 
composition and a relatively high similarity index. The dry-mesic sand 
savanna, however, was located near the base of a dune, the soil being 
slightly organic. Many of the species encountered in this dry-mesic 
savanna were associated with the ground layer vegetation of sand 
flatwoods. 

DISCUSSION 

The ICCA contained good quality examples of many of the 
sand communities that are known to occur in Illinois (McDowell et al. 
1983). Some of these communities are large, the sedge meadow 
exceeds about 2.5 km'^, the dry and dry-mesic savanna exceeds 2 km^. 
Based on the surveys results, species richness was high, few exotic 
species were encountered in the high quality natural areas of the ICCA, 
and 13 Illinois endangered and threatened species were vouchered. In 
the communities studied sand prairie species dominated, and usually 
with as many as 15 species in common (Table 4). 

Though 78 non-native (exotic) taxa were collected on the 
ICCA, few were encountered in the natural communities. Most were 
found alone the road on the south, west, and north sides of the ICCA, 



408 Fhvfoloiiia (Dcccmhcr 2009) 91(3) 



on trails and dirt roads throughout the ICCA, or in the cultural areas 
associated with food plots, staging areas, and roadside parking areas 
associated with the hunting activities at the ICCA. Among the non- 
native species that were found in the natural communities, Poa 
pratensis was the most common, being encountered in the sedge 
meadow (IV of 0.3), wet-mesic sand prairie (2.7), and dry mesic sand 
prairie (1.1). Other non-native species found in a few communities with 
very low IVs included Achillea niillejolium and Riunex ucetosella. In 
other glacial sand deposits of Illinois similar results were encountered 
with one to four exotics species found, most with low importance 
values (Handel et al. 2003; Phillippe et al. 2004, 2008; McClain et al. 
2005, 2008; Ebinger et al. 2006) 

The size of the ICCA, and the many examples of these 
communities, should allow different management practices to be tested. 
The present management consists of occasional burns (Johnson and 
Ebinger 1992, 1995). These have been sufficient to keep the dry sand 
savanna communities open, but have not been sufficient to keep most 
of the tree saplings from stump sprouting and shading the ground layer 
vegetation (McDowell et al. 1983). Also, the sand prairie communities 
have numerous tree seedlings and saplings and the size of the 
communities are becoming smaller due to the shade of surrounding 
trees. Fire frequencies should be increased, and possibly the season of 
the year that fire is used should be varied. 

Probably the major problem now facing the ICCA is the loss 
of ground water due to draining efforts on the surrounding farmland 
and the increased use of central pivot irrigation systems. Drainage 
ditches are presently along the east boundary of the preserve and in the 
southwest corner. The de-watering of the site by these ditches has 
resulted in the loss of the marsh communities along the east edge of the 
ICCA. Also, the large sedge meadow in the southwestern part of the 
preserve is becoming drier, with the potential loss of some of the 
typical wetland species. 



Phytologia (December 2009) 91(3) 409 



ACKNOWLEDGMENTS 

The authors would Hke to thank Dr. Gordon Tucker, Eastern 
Illinois University, for help with identification of the Cyperaceae, the 
staff at the ICCA for the their help, and Eric Smith of the Illinois 
Department of Natural Resources for his help and advice. 

LITERATURE CITED 

Bailey. A.W., and C.E. Poulton. 1968. Plant communities and 

environmental relationships in a portion of the Tillamook bum, 

northwestern Oregon. Ecology 49:1-13. 
Daubenmire. R. 1959. A canopy coverage method of vegetation 

analysis. Northwest Sci. 33:43-64. 
Ebinger, J.E.. L.R. Phillippe. R.W. Nyboer, W.E. McClain. D.T. 

Busemeyer. K.R. Robertson, and G.A. Levin. 2006. Vegetation and 

flora of the sand deposits of the Mississippi River Valley in 

northwestern Illinois. Illinois Nat. Hist. Survey Bull. 37:190-238. 
Gleason, H. A., and A. Cronquist. 1991. Manual of vascular plants of 

northeastern United States and adjacent Canada. Second Edition. 

The New York Botanical Garden, Bronx. New York. 
Handel, W.C, L.R.Phillippe, and J.E. Ebinger. 2003. Floristic 

assessment of sand prairie and sedge meadows. Lee County, 

Illinois. Prairie Naturalist. 35:33-46. 
Hedborn, E.A. 1984. The vascular flora of Iroquois County, Illinois. 

M.S. thesis. Northeastern Illinois University, Chicago, Illinois. 
Herkert, J.R. and J.E. Ebinger, 2002. (eds). Endangered and threatened 

species of Illinois: Status and distribution. Volume 1. Plants. 

Illinois Endangered Species Protection Board, Springfield, 111. 
Iverson, L. R., G. L. Rolfe, T. J. Jacob, A. S. Hodgins, and M. R. 

Jeffords. 1991. Forests of Illinois. Illinois Council on Forest 

Development, Urbana, and Illinois Natural History Survey, 

Champaign, Illinois. 
Johnson, K.C. and J.E. Ebinger. 1992. Effects of prescribed burns on 

the woody vegetation of a dry sand savanna. Hooper Branch 

Nature Preserve, Iroquois County, Illinois. Trans. Illinois St. Acad. 

Sci. 85:105-111. 
Johnson, K.C. and J.E. Ebinger. 1995. Effects of different fire regimes 

on the ground layer vegetation of a dry sand savanna. Hooper 



410 riivtoloiiia (December 2009) 91(3) 



Brunch Nature Preserve, Iroquois County, Illinois. Erigenia 14:37- 

40. 
Keifer, L. M. 1982. Soil survey of Iroquois County, Illinois. United 

States Department of Agriculture, Soil Con.servation Service, in 

cooperation with the Illinois Agricultural Experiment Station, 

Champaign, III. 
King, J.E. 1981. Late Quaternary vegetational history of Illinois. Ecol. 

Monogr. 51:43-62. 
McCIain, W.E., L.R. Phillippe, and J.E. Ebinger. 2005. Floristic 

assessment of the Henry Allan Gleason Nature Preserve, Mason 

County, Illinois. Castanea 70: 146-154. 
McCIain, W.E., J.E.Schwegman, T.A. Strole, L.R. Phillippe, and J.E. 

Ebinger. 2008. Floristic study of Sand Prairie-Scrub Oak Nature 

Preserve, Mason County, Illinois. Castanea 73:29-39. 
McDowell, B., J. Newman, and J. Ebinger. 1983. Survey of the woody 

vegetation of the Kankakee Sand Area Section of Indiana and 

Illinois. Proc. Indiana Acad. Sci. 93:187-193. 
Midwestern Regional Climate Center. 2007. http:/mcc.s\vs. uiuc.edu 

(accessed June 2008). 
Mohlenbrock, R. H. 2002. Vascular flora of Illinois. Southern Illinois 

University Press, Carbondale and Edwardsville. III. 
Mueller-Dombois, D. and H. Ellenberg. 1974. Aims and methods of 

vegetation ecology. John Wiley and Sons, NY. 
Phillippe, L.R., D.T. Busemeyer, P.B. Marcum, M.A. Feist, and J.E. 

Ebinger. 2008. Prairie and savanna vegetation of Braidwood Dunes 

and Savanna Nature Preserve, Will County, Illinois. Castanea 73: 1 - 

15. 
Phillippe, L.R., M.A. Feist, J.E.Ebinger and W.E. McCIain. 2004. 

Vascular flora of Long Branch Nature Preserve, Mason County, 

Illinois. Trans. Illinois St. Acad. Sci. 97:197-2008. 
Schwegman, J.E. 1973. Comprehensive plan for the Illinois nature 

preserves system. Part 2. The natural divisions of Illinois. Illinois 

Nature Preserves Commission, Rockford, III. 
Transeau, E.N. 1935. The prairie peninsula. Ecology 16:423-437. 
Wascher, H.L., R.S. Smith, and R. T. Odell. 1951. Iroquois County 

Soils. University of Illinois Agricultural Experiment Station Soil 

Report 74:1-66. 
White, J., and M.H. Madany. 1978. Classification of natural 

communities in Illinois, in Illinois Natural Areas Inventory. 



Phytologia (December 2009) 91(3) 



411 



Technical report. J. White, ed. Illinois Natural Areas Inventory, 

Urbana, 111. 
Willman, H.B. 1973. Geology along the Illinois waterway - a basis for 

environmental planning. Illinois St. Geol. Survey Circular 478. 

Urbana. 
Willman, H.B. and J.C. Frye. 1970. Pleistocene stratigraphy of Illinois. 

Illinois St. Geol. Survey Bull. 94:1-204. 



'vrxn 





CHAMPAIGN 



■' .ff"~." si"..- ^; Iroquois Countv jjs.vi 

f jj ■' » -■■?---;■-■. Conservation Arcaji"^ 



I i; 

- -i i 
I i 




Figure 1. Location of Iroquois County Conservation Area located about 
6 km northeast of the town of Beaverville, Iroquois County, Illinois. 



412 



Phyioloiiia (December 2009) 91(3) 



O <f. 


































_ ^ n 






































1 the 

is tl 
peei 








U-. 






nD 
















1 <^ 












> 


CT-' 


I 


1 


1 ^ 


I 


1 


I 


I 


i 


1 1 


1 


' Tf 


1 


{ 


I ! I ! I 


= 4j ;7r 








(^1 






fN 






















ill 




-5 


































ounte 
or eac 
y IncI 




•: 




(^1 






1 '^' 


, 


. 


1 


. 


1 


, , 


, 


oc 
1 ^ 


, 


, 







^ 


2 


— ; 


' 


' 


— 


' 


' 


' 




' 






d 








C _ O 




k. 


































U = W) 




■^ 


































•y, ^ o 




^ 


































peci 
so g 
rs c; 




^ 




(^1 


1 


1 


I >c 


1 


1 


1 


1 


1 


1 1 


1 


1 "^ 


1 


; 


; ; 1 ; ; 


y. — 1> 






LL 
































u. < ■£ 




































^ xO 




































r3 •" * 




































ndl 
Ilim 
lot. 








r~ 


oc 


r~- 


— u-1 


(» 


r«^ 


NO 


r~ 


nO 


— r-^ 


f. 


r^> O 


ir, 


o 


r- vO f. — C 






>' 


s^ 


oc 


-1-" 


r-i rj 


d 


d 


ON 


oc 


OC 


nD >/"1 


>/~i 


iri trl 


t' 


-f 




3 — C 




^ 


1—^ 


— 


— 


— 


^- — 


— " 


^ 




















£ - ■- 




[C 


































|< S 




i 




r<-, 


^ 


ON 


O nC 


nD 


^ 


ON 


r*~, 


ri 


oc r<-, 


^ 


-f O 


On 


^ 


r^, ON oc 0< '/-, 




ri 


r^, 


oc 


q nc 


rl 


r~^ 


oc 


^ 


o 


nC O 


o 


O r^ 


U", 


r^ 


I^ I/-, u", — O 


C 5 -'3 

o .2 o 




■§ 




d 


c^■ 


ri 


3 — 


2 


oc 


o^ 


OC 


oc 


fi ■^' 


nC 


ri — 


^ 


'^' 


rJ r^i — — — 


— o. 




K 








































































Si -3 




^ 


































■ . y u- 






































., C O 






































a O X) 






d- 
































— U E 






u. 


00 


Tf 


•^ 


nO r^ 


ri 


cc 


X 


r 1 


^ 


•^ nC 


ri 


vC vO 


oc 


rf 


oc oc ri ri ri 


> i- 1 






S7- 


ON 


ON 


ON r- 


nC 


nC 


-t 


I/". 


I/", 


>/-- -r 


r~j 


>/", U", 


>r^, 


O) 


n — r^, f, r<-, 


rtance 
Coun 
erage 






> 


^. 




, 




, 


, 


X 


^. 


, 


sC , 


, 


, 1 


, 


I 


J 1 . 1 1 


c ± > 






M 


~~ 






























c c - 








"" 






























P 3 O 




'— 


































• = a- j: 




^ 


































■o £ JU 




"5 


































c — ^ 




? 


c 


ir^, 













n 


— 




3; 












■? "2 ii 




§ 


1 ^ 


oc 


I 


! 


^ ' 


■ 




i/~, 
t' 


'^; 


' 


^. 1 


' 


i '• 


i 


' 


1 1 1 1 1 


^ '^ c 




1/ 


r~ 






























- ? "5. 




~5 








































































^ r^ ^ 




^ 


































^^ = 






































over 
id san 
ered i 






d- 
,2i ^ 


2 


: 


1 


- 1 


1 


1 




sO 


1 


(N ] 


1 


1 1 


1 


I 


1 ; 1 ! 1 






u. 


— 


































































5 =:! 




































o .5i ° 




































E -^ c 














~ 




t^. 


















- ii '-» 














^ 




j^ 


















cy (%) 
hrub p 
pecies 












^ 


.^ 




^ 










_^ 








c 




^ 




., 


^ 


i. 




1 


^ 


g 






1 




;£ 


5 S -2 


Table 1 . Frequen 
sedge meadow, s 
total number of s 


> 


;! 


2 


1 


^ 


1.2 :£ 




C 

5 


L> 




>5 


3: 5 


:« 


•2 ^ 




5 


^ Uj C 2 CO 



Phytologia (December 2009) 91(3) 



413 





















l/~. 






-* — 








I I 


I 


J 


[ 


[ 


i/S 


^ 


r-' 


r^' 


^' 


r-' 


^ 


■*' (^ 


3 
















^ 
















O 
















^ 


r^, 


u-i 


3v 


'^ 


'y~i 




r^. i/~ 


c^ 


,^ 




• 1 


1 


1 




t 


r- 


O 


r<". 


r- 


r-; 


O 


r*-. 


O O 


vC 


^ 














rJ 
















oc 


00 


i?. 


1 1 


t 


1 


1 




^ 


r\| 


^ 


ri 


r^J 


^ 


^ 


c; 1 






tr, _; 












rsi 




(N 




















rr 






rsi 


p 


r-; 


c> 










^ r»~. 


^ 






' ' 




' 






r-i 


^ 


^^ 


' 


^ 




' 


d ^' 


i 








-J, 






X 


-, 


rj 


3C 




vg 






— O 


ir~, 


vC 




j ; 


— 


; 


; 




<y~i 


^ 


'^ 






1 


[ 


O oc 


vC 


Ov 




























d '^ 


00 


vC 


ri 


1 1 


00 


1 


1 


vC 


t 


\C 


OC 


1 


r-j 


1 




(^j 1 






(^1 Tt 




~ 






~ 






















i/~, — 


U-) >/~, 


^ 




^ 


^^ 
















'^^ 


o 






sd cK 


cK 


oc 


^ 


^' 
















1 r^l 


g 






r^. r<-, 


3 


1^ 


,^ 


r~i 
















00 


^^ 


vO 




r^, r^ 




r^ 


— 


— 




1 


1 


1 


1 


1 


t 


1 1/^. 


— 


O^ 






























§ 


r-' 


f J 


r~~ rr^. 


— 


r*~. 


sC 


U-; 






















O ==. 


1/-, r--. 


r^. 


(^1 






s 






s 








^ 




u 


CnI r^. 


j! 




t 


S 


S 


>^ 


C" 




w 


;^ 


S 


.s^ 


^ 




■5 


■^ "S. 


































2« Lj 


-5 


:£■ 


-J' 




:^ 




? -5 
c5j 5 


c 

i 

t 

Q 


:§ 

4 

>- 


J 


-S * 

§ o 




Ml 

o 

si) 

:3 

-J 

> 

< 


■- .Q 



414 



Phxtologia (December 2009) 91(3) 



Table 2. Frequency (%), mean cover {% of total) and importance value 
(I.V.) of the ground layer species encountered in the wet-mesic sand 
prairie and the dry-mesic sand prairie, Iroquois County Conservation 
Area, Illinois. Also given for each site is the total number of species 
encountered in the plots and the average number of species per plot. 
*Others category Include species with IVs less than 2.0. 





Wet-mesic Sand Prairie 


Dry-i 


Tiesic Sand Prairie | 


i Species 


Freq. % 


Mean 
Cover 


I.V. 


Freq. 

% 


Mean : 
Cover 


I.V. 


1 Rubus hispidus 


92 


22.90 


20.1 


100 


16.72 


32.8 


\ Euthamia 

' i^raiiiinifolia 


98 


18.69 


18.3 


50 


2.06 1 


8.0 


Fuientilla simplex 


98 


18.57 


18.2 


58 


1.14 


7.7 


\ Sorghastruin nutans 


84 


20.26 


18.1 


72 


4.32 


13.3 


\ Rubus schneideri 


84 


16.84 


15.8 


— 


— 


- 


\ Carex pensylvanica 


98 


11.71 


14.2 


70 


4.36 


13.1 


\ Schizachyrium 
! scoparium 


84 


12.87 


13.8 


92 


16.43 1 


31.3 


\ Solidago canadensis 


78 ; 


9.59 


11.5 


~ 


~ 1 


- 


1 Liatris spicaia 


52 \ 


8.58 


8.9 


— 


- 


~ 


\ Spiraea tomentosa 


66 ! 


5.85 


8.4 


~ 


- 


- 


1 Coreopsis tripteris 


42 \ 


5.26 


6.3 


~ 


- 


- 


1 Solidago giganiea 


56 : 


2.74 


6.0 


- 


~ 


- 


\ Bartonia virginica 


46 i 


0.23 


3.6 


~ 


- 


- 


\ Pycnanthemum 
I virginianum 


30 1 

I 


1.28 


3.0 


~ 


~ 


— 


\ Andropogon 
\ gerardii 


18 1 


2.69 


3.0 


26 


1.30 


4.5 


\ Poa pratensis 


28 i 


0.97 


2.7 


— 


- 


- 


1 Spiraea alba 


30 1 


0.75 


2.7 


— 


— 


- 


\ Panicum virgatum 


22 i 


1.14 


2.4 


28 


1.75 


5.3 


\ Spartina pectinata 


24 \ 


1.10 


2.4 


— 


- 


~ 


\ Aronia 

\ melanocarpa 


10 1 


2.66 


2.3 


— 


— 


— 


Achillea millefolium 


24 i 


0.66 


2.2 


— 


— 


- 


Galium obtusum 


22 \ 


0.55 


2.0 


— 


— 


- 


\ Vaccinium 
angustifolium 


-- 1 


— 


— 


40 


13.89 1 


22.4 


Aster simplex 


14 i 


0.61 


1.5 


82 


3.35 1 


13.1 



Phytologia (December 2009) 91(3) 



415 



i Scleria triglomerata 




~ 


56 1.43 1 7.8 


Salix humilis 


.. 


~ 


40 2.59 1 7.6 


Populus tremuloides 


.. \ 


- 


28 1.27 i 4.7 


Solidago nemoralis 


10 0.30 


0.9 


26 1.26 : 45 


Baptisia alba 


.- 


- 


26 : 0.68 : 3.7 


Quercus palustris 


-. 


~ 


18 i 0.87 3.0 


Viola sagittata 


18 0.14 


1.5 


20 1 0.30 2.5 


Gentiana saponaria 


~ 


- 


- 


18 i 0.19 2.1 


Rhus copallina 


- 


- 


- 


10 1 0.78 2.1 


Others* 


- 






~ i 


Totals 




171.43 


200.0 


i 76.29 200.0 


Average bare 
ground/litter 




6.90 




1 24.33 


Total species in 
plots 


42 






36 1 


Average 
species/plot 


13.24 






9.42 



416 



P/iyioloiiia (December 2009) 91(3) 





y 






































Cfl 




































' 


3 






































k. 




































o 


u 




































fe< 


> 

C3 










^ 




r^ 


>/~, 







-T 


r^. 




Tt; 


r- 


v". 


r 1 O 


^ c: 


O 








> 


-J 


' 


r-' 


ri 


' 


r\ 


-r 


^ 


' 


tr, 


DC 


^ 


1^. cK 


"^ -^ 


.1^ 














rj 


— 




n 


r 1 












— 


. ^ 






































■^ n 


"3 




'■^ 






































































— > 












































































C "j 






































CL H 


y. 




> 




u. 


— 




~v 


Q^ 




DC 


-^ 


sC 




^ 


r~- 


r^ 


(^ — 




^ 


. ; 


(r. 


o 


> 


DC 


] 




ir, 


1 


W-, 




p 


! 


ri 


-r 
ri 


^. 


•c r-_ 


w '^ 


tj 


(^i 


"§ 


2 


u 






— 






— 


"" 














— >. 


~ 


,_ 


:C 
































C ^ 




n 


c/: 
































^^ 3 


c 


i= 


> 
































> ^ 


-a 

o 


y. 




p- 




'^ 


, 


, , 


,.^ 


, 


^^ 


^ 


rJ 


, 


CnI 


(N 


'^ 


O sC 


■ — ' ./: 


iZ 


O 




£i 


».C1 




' 


-™* 


ir, 


' 


^s 


DC 




' 


rr 


^C 




>/-. r-~ 


O •- 


o 


"~ 




PL, 


^ 






— 






















— -^ 




'X. 


































_::; :: 


^ 


> 


































— "T" 




































"* ^ 






































> £ 


o 


_r- 


































CJ — 


c^ 


— 


































'.J _' 


o 


^ 


_ 




> 


r--; 


fN 


nC 


^. 


c^ 


^ 


■^ 


C^ 


r- 


>c 


ir. 


•^ 


<^. -r 


"t c 


:/-. 

U 


y. 


c 




r^l 


^ 


Tt 


(N 


d 


r-; 


(N 


iri 


r*S 


r^; 


r-; 


(N 


— ' 3 


■r£ c 


c 




•"" 


'^ 


(N 


rsi 


(N 


Csl 


— 


— 














^ r3 


U 




































;=s > 


o 


o 


> 
































E >- 






!>^ 
































-:2 


'-^ 




_ 




u- 


(N 


^ 


O 


r- 


c^ 


(N 


r^ 


O^ 


— 


r~, 


^ 


r- 


r<-, — 


= 1 




JJ 


c 


o 


CJ 

> 




rsi 








r<-] 




vC 


r-4 


^. 




'^. 


d 5 


ii 


^ 


U 




s 


u 




























■^ ^ 


~ 


~~ 


'^ 
































^ M 


^ 




o 






































































"^ *— ' 


r3 


>^ 


•" 
































£l 






> 
Q 








00 




r^ 


LT, 


tr. 


/-<-, 


DC 


o 


£ 


DC 


DC 


vC ri 


1- u 


O 




u. 






























> i 


-y. 


y. 


































^ ^ 






































u = 


O 


r^ 


































= .>^ 


'^ 


v-/ 


































.J — 




* 


































u — 


r* 


































§ 


zz o 


U 


^ 








2; 




























































f— 






































»■ — 






































, — . ^^ 


-J 


CI. 








1^ 
























■■^ ~ 


^ - 


'■J 


y. 






y. 


t 


1 


;2 


^ 




^ 






■s 




~s 




|--| 


— o 


> 


'■J 






O 


iC 


-^ 


■^ 


^ ■*- 




^ 


-., 


>-_ 


^ 




,^ 


^ 


_^ •*• 




Zh 










s 


^ 


^ 


J 


5 


-^ 


J 


:| 


■^ 


~ 


H 


■~ 


1 § 










































y. 


y. 


































— '-( 










:yT 




























X c: 


< 


'~ 








C- 


^ 


^ 


>-_ 


>; 


~5; 


~^ 


'~ 


^ 


i^ 


..^ 


,' 


•^ 2 




k. 








~ 


^ 


."^ 


? 


^ 


-< 


-"^ 


>-. 


i 


-^^ 


^ 


"sT 


^ ^ 


o .Si 










i; 


? 


1 


1 


1 


1 


5 


-§ 


"1 


>; 


^ 


^ 


■§' ^ 


~. ^ 


1^ 


^ 








::S 


^ 


s-i 


^ 


C^ 


^ 


^ 


^ 


»o 


:S 


•ii 


-J 


^ v^ 


'— ~r 






































J- 




*~ 



































Phytohgia {December 2009) 91(3) 



417 



I~^ o 


r^j 


'^ 


OC 


r~^ 


r-; 


<^ 


"^ 


rj 


OC 


OC 


r-, 






, , 


, , 


, , 






r-' r^ 


i/^i 


'tt-' 


r-i 


r^] 


r^, 


r^] 


r^] 


r-] 


rj 


ri 


rJ 


ri 


ri 


ri 


u-i 








r- r^, 


r^, 


t^ 


ir^i 


)£. 


n 


r<~, 




r") 


'^ 


, ^ 





»r-, 


, 






>n 


r<\ 




^ (^1 


1 — 


DC 


r-~- 






(-<", 


'^ 


^ 




r-J 


n 




ri 


r^t 


f^ 




rJ 




r-i r^i 








! 


ri 






3 






3 






r^i 




































OC 




OC 


o o 


^ 


^ 


(^) 


sC 


'^ 


ri 


rj 


sO 


OC 


vC 


r) 


^ 


OC 


^ 


1 






r) d 


m ■rt 


r<-j 


(N 


as 


(N 





CnI 


1 
2 


1 


fN 




2: 
00 


CnI 


! 




d 


s 

ri 


ri 


00 
OC ^. 

rJ ir, 


^' 15 







.1 








-5 




















ZJ 






























_ So 












■^ ^*^ 




? 


■5 








i; 










^3 










-a 


y. ■•— 


S "^ 


1 


i 


f5 






-| 


Zr 


^ 


s 


■r- 


1 


1 


^ 


1 






5 
^ 


1.1- 

r- ^ 


^ ^ 


'1 


5 


~ 


:i 


:s 


> 


~ 


^ 


^ 


|- 


^ 


1^ 


"1 


•^ 






00 






1-:^ 




C 


^*^ 
5 





1 


V 

^ 

^ 
^ 






c 

^ 

^ 

u 






5^ 







x: 





si) 

> 

< 


.2 ^ 

c > 
H < 



418 



Phyiologia (December 2009) 91(3} 



Table 4. Sorensen Index of Similarity of the ground layer vegetation of 
the seven communities examined. Iroquois Count) Conservation Area. 
Illinois. 





Area 
1 


Area 
2 


Area 
3 


Area 
4 


Area 
5 


Area 
6 


.A.rea 1 - Sedge 
Meadow 












Area 2 - Shrub 
j Prairie 


27.16 












.Area 3 - Wet- 
! mesic Prairie 


20.00 


46.80 










Area 4 - Dr> - 
. mesic Prairie 


6.15 


50.00 


43.59 








Area 5 - Sand 
: Flatwoods 


4.55 


26.87 


21.05 


27.45 






.Area 6 - Dr\ - 
mesic Savanna 


0.00 


17.50 


14.29 


25.00 


18.60 




.Area 7 - Dn. 
Savanna 


0.00 


11.54 


10.64 


11.36 


8.96 


30.00 



APPENDIX 1: The vascular laxa encountered and collected at the 
Iroquois County Conser\ation .Area are listed below b\ major groups. 
Pteridophytes (ferns and fern-allies ) and Sp>ermatophytes (seed plants), 
the latter divided into Monocois and Dicols. The families, genera, and 
species are alphabetically arranged within each group. Non-native 
species are indicated by an asterisk (*). After the binomial and 
authority, the communities where the species was observed is given (I 
= marsh. 2 = sedge meadow. 3 = sand flatwoods. 4 = wet sand prairie. 5 
= mesic sand prairie. 6 = dn.-mesic sand prairie. 7 = dr\ sand prairie. 8 
= shrub prairie. 9 = dry-mesic sand savanna. 10 = dr\ sand savanna. 1 1 
= cultural). FoUowins the communitv number(s). collecting numbers 



Phytologia (December 2009) 91(3) 4 1 9 



or date collected (when collecting number not assigned) preceded by 
the initial of the collector's name are given (E for John E. Ebinger, Ev 
for Robert A. Evers, F for Mary Ann Feist, H for Fran Harty, M for 
Michael H. Madany, and P for Loy R. Phillippe). 

PTERIDOPHYTES 

ASPLENIACEAE 

Asplenium planneiiron (L.) Oakes: 9: E21827 

DENNSTAEDTIACEAE 

Pteridium aqiiilinum (L.) Kuhn var. latiiiscidum (Desv.) Undervv.: 7, 
10;E21277 

DRYOPTERIDACEAE 

Dryopteris cartluisiana (Villars) H.P. Fuchs: 3; P33033 
Dryopleris cristata (L.) Gray: 3; P33036 

EQUISETACEAE 

Equisetiim arvense L.: 2, 3, 4, 12; E21630 
Ecpdsetiimflitviatile L.: 3, 1 1; E22008 
Eqidsetiim hyemale L.: 7. 9, 10; E22649 
Equisetiim laevigatwn A. Br: 7, 9, 10, 11; E21957 

LYCOPODIACEAE 

Lxcopodiiim hickeyi Wagner, Beitel & Moran: 8; HI 1 October 2001; 

P33825 

ONOCLEACEAE 

Onoclea sensibdis L.: 2; E22332 

OPHIOGLOSSACEAE 

Botrychhim dissectiim Spreng.: 1 1 ; P36267 
Botrychhim virginianiim (L.) S\v.: 3; P33038 
Ophioglossiim pusdliim Raf.: 2, 3, 4, 5; P32965 

OSMUNDACEAE 

Osmunda cinnamomea L.: 3; P33276 

Osmimda regalis L.: 3, 8; E21240 



420 rhxtoloiiia {Ikccmher 2009) 91(3) 



THELYPTERIDACEAE 

Thclxpu'iis pahisiris Schott: 2, 8; E22276 

SPKRiMAIOPH^IKS: (JVMNOSPERMS 

PINACEAE 

*Pinus banksiana Lamb.: 1 1 ; P33826 

SPERMA TOPHYTES: ANGIOSPERMS 

DICOTS 

ACERACEAE 

Acer negundo L.: II; E2 1944 

Acer sacchariniDU L.: 11; E21939 

AMARANTHACEAE 

Amanmthus alhus L.: 11; Ev84994 

Amaranthus tuberculatus (Moq.) J. Sauer; 1 1 ; E22633 

ANACARDIACEAE 

Rhus copal Una L.: 6, 7, 9, 10; E2 1250 

Rhus glabra L.: 6, 7, 9, 10, 1 1 ; E2 1 289 

Rhus lurta L.: 6, 7, 9. 10, 1 1; E2 1920 

Toxicodendron radicans (L.) Kuntze: 1 1 ; P30985 

Toxicodendron vernix (L.) Kuntze: 5; P33630 

APIACEAE 

Cicuta bidbifera L.: 2; P36259 

Ciciita macidata L.: 2; E22000 

*Daucus carota L.: 11; Killed 

Eryngiiim yuccifolium Michx.: 4, 5, 8; E22302 

Osmorhiza claytonii (Michx.) C.B. Clarke: 1 1; E21623 

Osmorhiza hngistylis (Torr.) DC: 10; P33643 

Oxypolis rigidlor (L.) Raf.: 8; E22587 

*Pastinaca saliva L.: 11; E21945 

Sanicula canadensis L.: 11; E21932 

Sium suave Walt.: 1 1 ; E22264 



Phytologio (December 2009) 91(3) All 



APOCYNACEAE 

Apocynum androsaemifolinm L.: 9, 10; E21968 

AQUIFOLIACEAE 

Ilex verticillata (L.) Gray: 3, 9; E2 15 16 

ASCLEPIADACEAE 

Asclepias amplexicaulis Small: 7, 10; E21276 
Asclepias hirtella (Pennell) Woodson: 8; E22326 
Asclepias incanuita L.: 2, 1 1; E22278 
Asclepias syriaca L.: 11; E22294 
Asclepias tuber osa L.: 9, 10; E21270 
Asclepias verticillata L.: 6, 7, 8, 9, 10, 1 1 ; E21253 

ASTERACEAE 

''Achillea millefolium L.: 5, 6, 7, 8, 9, 10, 1 1; E21287 

Ambrosia artemisiifolia L.: 11; E22404 

Ambrosia trifida L.: 11; P33647 

Antennaria neglecta Greene: 5, 6; P32960 

Antennaria plantaginifolia (L.) Hook.: 7, 9, 10; E21588 

Arnoglossum plantagineum Raf.: 2, 4, 5; E2201 1 

^Artemisia absinthium L.: 11; P33660 

Aster dumosus L. var. strict ior Torrey & Gray: 2, 3, 9: E22464 

Aster ericoides L.: 8; sight record only 

Aster lanceolatus Willd. var. simplex (Willd.) A.G. Jones: 3, 5, 6, 

E22578 

Aster novae-angliae L.: 2, 5. 8; E22571 

Aster oolentagiensis Riddell: 7, 9, 10, 1 1; E21502 

Aster parviceps (Burgess) Mack. & Bush: 6; E2241 1 

Aster praealtus Poir.: 8, 11; E22632 

Bidens aristosa (Michx.) Britt.: 3, 1 1 ; E22591 

Bidens cermia L.: 1 , 1 1 ; E22503 

Bidens comosa (Gray) Wieg.: 1,11; EllAlA 

Bidens coronata (L.) Britt.: 4, 1 1 ; Ev85010 

Bidens frondosa L.: 1 1; P36270 

Bohonia asteroides (L.) L'Her.: 1 1; E22645 

*Cichorium intybus L.: 11; E30035 

*Cirsium arvense (L.) Scop.: 1 1; E21947 

Cirsium discolor (Muhl.) Spreng.: 1 1; E22407 



422 Phytohi^ia (December 2009) 91(3) 



Cirsiiim imti'uiim Michx.: 2; E22446 

Ccmyza caiuulensis (L.) Cronq.: 8, 9, 10, 1 I ; F336I7 

Coreopsis pahmiki Null.: 7, 9, 10, 1 1; E2 1278 

Coreopsis tripteris L.: 5, 6, 8; E22575 

Doellingeria iiinhellata (Mill.) Nees: 2, 4; P33627 

Erechtites hieracifolia (L.) Raf.: 1 1 ; E22467 

Erigeron annuiis (L.) Pers.: 1 1 ; E21962 

Erigeron strigosus Muhl.: 6, 7, 8, 9, 10; E21257 

Eiipatoriadelphus macidatus (L.) R.M. King & H. Rob.: 2; E22343 

Eupatorium aliissimum L.: 5, 1 1; P33661 

Eiipatoriuni perfoliatum L.: 1, 8; E22492 

Eupatorium seroiiiuim Michx.: 1,3; E22491 

Eupatorium sessilifolium L.: 9; P33634 

Euthamia graminifolia (L.) Null.: 2, 5, 6, 8; E2 151 2 

Euthamia gymnospermoides Greene: 1 1 ; Ev85037 

Helenium autummde L.: 4, 8; E22574 

Helianthus divaricatus L.: 7, 10, 1 1; E22290 

Helianthus giganteus L.: 2, 11; E22348 

Helianthus grosseserratus Martens: 5; P33625 

Helianthus mollis Lam.: 7, 8, 9, 10; E21499 

Helianthus occidentalis Riddel!: 7, 8, 9, 10; E22274 

Helianthus strumosus L.: 8; E22583 

Hieracium gronovii L.: 7, 8, 9, 10; E22325 

Hieracium longipilum Ton.: 6, 1 1; E22284 

Hieracium scabrum Michx.: 7, 9, 10; P33620 

Hymenopappus scabiosaeus L'Her.: 6, 9, 11; E21282 

lonactis linariifolius (L.) Greene: 7, 9, 10; E22514 

ATr/^/a biflora (Walt.) Blake: 2, 8; E21813 

Krigia virginica (L.) Willd.: 6, 1 1; E2 1244 

Lactuca canadensis L.: 5, 6, 7, 10; E22419 

Lactuca floridana (L.) Gaertn.: 9; P33652 

* Lactuca serriola L.: 11; E22350 

L/arm spicata (L.) Willd.: 5, 6, 8, 9, 10; E22328 

* Matricaria discoidea DC: 1 1 ; E21953 
Oligoneuron riddel Hi (Frank) Rydb.: 5; P33629 
Parthenium integrifolium L.: 8; E21233 

Pseudognaphalium obtusifolium (L.) Milliard & Burtt: 5, 7, 9, 10; 
E22511 

Rudbeckia hirta L.: 8; E 21237, E21840 



P Into log ia (December 2009) 91(3) 423 



Riidheckia siihtomentosa Pursh: 5; P33653 

Rudbeckia triloba L.: 11; P33464 

Senecio paupercidiis Michx.: 5; P32948 

Senecio plattensis Nutt.: 1 1 ; E2 1 633 

Silphium integrifoliiim Michx.: 8; E22301 

Solidago canadensis L.: 5, 8; sight record only 

Solidago gigantea Ait.: 2, 5, 8, 1 1 ; E22428 

Solidago missouriensis Ait.: 5, 8, 9; E22318 

Solidago nemoralis Ait.: 5, 6, 8, 9, 10, 1 1; E22417 

Solidago rugosa Mill.: 3, 9; P36249 

Solidago speciosa Nutt.: 6, 7, 10; E22504 

*Sonchus arvensis L. var. glabrescens Grab. & Wimm.: 1 1 ; P33404 

*Taraxacum officinale Weber: 1 1 ; E21607 

*Tragopogon diibiiis Scop.: 1 1; E21889 

Vernonia fasciculata Michx.: 2; P33667 

Vernonia gigantea (Walt.) Trel.: 6, 8; E22551 

Vernonia missurica Raf.: 4; P33482 

Xanthiitm stnimarium L.: 11; E22457 

BALSAMINACEAE 

hnpatiens capensis Meerb.: 3, 9, 11; P33636 

BETULACEAE 

Betida nigra L.: 3. 9, 1 1 ; E21926 

BORAGINACEAE 

Hackelia virginiana (L.) I.M. Johnston: 1 1; P33639 
Lithospermiim croceum Fern.: 6, 7, 9, 10; E21268 
Myosotis verna Nutt.: 1 1 ; E2 1 87 1 

BRASSICACEAE 

*Alliaria petiolata (Bied.) Cavara & Grande: 1 1 ; P33044 
^Arabidopsis thaliana (L.) Heynh.: 9, 1 1 ; E21271 
Arabis lyrata L.: 9, 10; P32941 
*Barbarea vulgaris R. Br.: 1 1; E21625 
*Capsella biirsa-pastoris (L.) Medic: 1 1; E2 1616 
Cardamine bulbosa (Muhl.) BSP.: 2; E21594 
Cardamine parviflora L.: 11; E21208 
Cardamine pensylvanica Muhl.: 1 1; E21632 



424 rhxtolo^ia (Dcccuhcr 2009) 91(3) 



Draba reptans (Lam.) Fern.: 1 1 ; E2I610 

*Lepidiiiin campcstrc (L.) R. Br.: I I ; F974 

Lepidiiini viriiiniciim L.: 1 1; I£2I()1() 

Ni'ohi'ckia aquaiica Eaton: 1 , 2; E2 1 8 1 7 

Rorippa palustris (L.) Besser wdT.fenuilcIiana (Butlcr.s & Abbe) 

Stuckey:2, 11;E21808 

Rorippa palustris (L.) Besser var. hispida (Desv.) Rydb.: 6, I 1 ; 

Ev87557 

*Sisynihriiiiii aliissiniuni L.: 11; Ev875Sl 

CAESALPINACEAE 

Chamaecrista fasciculata (Michx.) Greene: 6, 7, 9, 10; E22269 
Chamaecrista niciikin.s (L.) Moench: 7, 9, 10; E21495 

CALLITRICHACEAE 

Callitriche heterophylla Pursh: 1 1 ; E2 1 600 
Callitriche terrestris Raf.; 1 1; E21950 

CAMPANULACEAE 

Campanula aparinoides Pursh: 2; E22270 

Campanulastrum americaniim (L.) Small: 9; P33637 

Lobelia cardinalis L.: 11; E22631 

Lobelia siphilitica L.: 11; E2247 1 

Lobelia spicata Lam.: 6, 7, 8, 9, 10; E21262 

Triodanis perfoliata (L.) Nieuvvl.: 1 1; E21877 

CAPRIFOLIACEAE 

*Lonicera maackii (Rupr.) Maxim.: 1 1 ; E30036 
*Lonicera morrowii Gray: 2, 11; P32968 
*Lonicera tatarica L.: 11; E2 16 17 
Sambuciis canadensis L.: 11; E2 1948 
^Viburnum opuliis L.: 11; P33633 

CARYOPHYLLACEAE 

*Cerastium fontnum Baum: 1 1; E21612 
*Dianthus armeria L.: 11; E21295 
*Holosteum umbellatum L.: 11; P32966 
Moehringia lateriflora (L.) Fenzl: 7, 10; E21591 
Paronychia canadensis (L.) Wood: 3, 9, 10; P33397 



Phytologia (December 2009) 91(3) 425 



*Saponana officinalis L.: 11; E22295 

Silene antirrhina L.: 11; E2 1888 

*Silene pratensis (Spreng.) Godron & Gren.: 1 1; E21925 

Silene stellata (L.) Ait. f.: 7, 10. 1 1; E22285 

CELASTRACEAE 

Celostrus scandens L.: 10; P36271 

CERATOPHYLLACEAE 

Ceratophyllwn demersum L.: 11; P33657 

CHENOPODIACEAE 

Chenopodiinn desiccatum A. Nels.: 7. 9, 10; E22516 
Chenopodiiim simplex (Torr.) Raf.: 1 1 ; P33280 
Cyclonui citriplicifolium (Spreng.) Coult.: 1 1; E22406 

CISTACEAE 

Helianthemwn hicknellii Fern.: 7, 9, 10, 11; E2 1507 
Helianthemum canadense (L.) Michx.: 7, 9, 10; E21263 
Lechea mucronata Raf.: 7. 9, 10; P33471 
Lechea pidchella Raf.: 5, 6, 9; E22347 

CONVOLVULACEAE 

Calystegia sepium (L.) R. Br.: 1 1; E2 1940 

CORNACEAE 

Cornus obliqua Raf.: 2, 4; E21825 

Cornus racemosa Lam.: 2, 3, 4, 8, 11; P33059 

CORYLACEAE 

Corylus americana Walt.: 7. 9, 10; E2 1285 

CUSCUTACEAE 

CiiscHta glomerata Choisy: 2, 4; P33670 
Cuscitta gronovii Willd.: 1.11; E22472 

DROSERACEAE 

Drosera intermedia Havne: 3. 5. 8; P33405 



426 Phyiohiiia (December 2009) 91(3} 



ELAEAGNACEAE 

*Elaeagniis iiinhelUua Thuiib.: 1 1 ; E21924 

ERICACEAE 

Gayhisscicia baccata (Wang.) K. Koch: 9; P33270 
Vacciniitni angiistifoimm Ait.: 3, 6, 8, 9; E 1586 
Vaccinium corymbosum L.: 6; P33819 
Vaccinium pallidum Ait.: 3, 9; E22553 

EUPHORBIACEAE 

Acalypha gracilens Gray: 9, 1 1; P33621 

Acalypha rhomboidea Raf.: 1 1 ; EllAdl 

Cluimaesyce maculata (L.) Small: 1 1 : P33665 

Chamaesyce nutans (Lag.) Small: 1 1 : P33662 

Euphorbia corollata L.:^6, 7, 8, 9, 10, 1 1 ; E21231 

Poinsettia dentata (Michx.) Kl. & Garcke: 1 1 : E30039 

FABACEAE 

Amorpha canescens Pursh: 7, 9, 10; E21274 

Baptisia alba (L.) Vent.: 6, 8, 9; E21267 

Desmodium canadense (L.) DC: 5; P33626 

Desmodium obtusum (Muhl.) DC: 7, 10; E22518 

Desmodium paniculatum (L.) DC: 7, 10; E22412 

Desmodium sessilifolium (Torr.) Torr. & Gray: 7, 9, 10; E22548 

Lxithyrus palustris L.: 2, 6, 1 1; E21896 

Lespedeza capitata Michx.: 6, 1, 9, 10; E21508 

Lespedeza hirta (L.) Hornem.: 7, 9, 10; P33623 

Lespedeza hirta (L.) Hornem. X L. longifolia DC: 9; P33624 

Lespedeza virginica (L.) Britt.: 9; P33699 

Lupinus perennis L.: 10. 1 1; E2 161 3 

*Medicago lupulina L.: 11; P33260 

*Medicago sativa L.: 1 1 ; E2 1 860 

*Melilotus albus Medik.: 1 1 ; E30040 

*Melilotus officinalis (L.) Pallas: 1 1; E2 1874 

*Robinia pseudoacacia L.: 11; E2 1927 

Tephrosia virginiana (L.) Pers.: 7, 9, 10, 11; E21306 

*Trifolium pratense L.: 1 1 ; E2 1 882 

*Trifolium repens L.: 11; E21858 

*V/da villosa Roth: 1 1; E30041 



Phytologia (December 2009) 91(3) All 



FAGACEAE 

Querciis alba L.: 6, 9; E21264 

Querciis palustris Muenchh.: 3, 6, 8; sight record only 

Quercus veliifina Lam.: 6, 7, 9. 10; E2 1 307 ■ 

GENTIANACEAE 

Bartonia virginica (L.) BSP.: 3, 5, 6, 8, 9; P33402 
Genriana sapoiiaria L.: 6, 8; E2 15 10 

HALORAGIDACEAE 

Proserpinaca palustris L.: 3,11; P32958 

HYPERICACEAE 

Hypericum adpressum Bart.: 4, 5, 8; E22321 
Hypericum canadense L.: 8, 1 1; E21288 
Hypericum gentianoides (L.) BSP.: 6, 7, 11; E22566 
Hyperiucm mutilum L.: 8. 1 1; E22293 
^Hypericum perforatum L.: 11; E30038 
Hypericum punctatum Lam.: 1 1; P36268 
Hypericum sphaerocarpum Michx.: 2, 4; P33216 
Triadenum fraseri (Spach) Gl.: 2; E22330 



JUGLANDACEAE 

Juglans nigra L.: 1 1 ; E21941 

LAMIACEAE 

Hedeoma hispida Pursh: 1 1; P33265 

*Leonurus cardiaca L.: 11; E21928 

Lycopus americanus Muhl.: 1,2, 11; E22445 

Lycopus virginicus L.: 1,2; E2233 1 

* Mentha orvensis L.: 1,2; E22436 

Monardafistulosa L.: 11; E22283 

Monarda punctata L.: 6, 7, 10; E21272 

*Nepetea cataria L.: 11; P33279 

Physostegia virginiana (L.) Benth.: 6, 8; E22430 

Prunella vulgaris L.: 11; P33644 

Pycnanthemum virginianum (L.) Dur. & B.D. Jacks.: 2, 5; E22279 

Scutellaria galericulata L.: 2; E22014 



428 Phyioloi^ia {December 2009) 91(3) 



Scutellaria laierijlora L.: 1, 2, 3; E22494 
Staehys tenuifolia Willd.: 1, 2, 8; E22323 
Teiurium canadense L. var. canadense: 9, 10, 11; P33264 

LAURACEAE 

Sassafras albidiim (Nutt.) Noes: 9, 10, 1 1; E2I615 

LINACEAE 

Linum medium (Planch.) Britt.: 1 1 ; P33400 

LYTHRACEAE 

Lythrum alatum Pursh: 2, 8, 1 1 ; E21239 
Rotala ramosior (L.) Koehne: 1 1 ; E22310B 

MELASTOMACEAE 

Rhe.xia viri^inica L.: 5, 6, 8, 1 1 ; E22319 

MOLLUGINACEAE 

*Mollugo verticil lata L.: 6. 1 1; E22418 

MORACEAE 

* Madura pomifera (Raf.) Schneider: 1 1; E21937 

* Moras alba L.: 11;E21943 

NYCTAGINACEAE 

*Mirabilis nyctaginea (Michx.) MacM.: 1 1; E21876 

NYSSACEAE 

Nyssa sylvatica Marsh.: 3, 4; P32954 

OLEACEAE 

Fraximis pennsylvanica Marsh.: 1, 2, 3; P29930 

ONAGRACEAE 

Circaea lutetiana L.: 3; P33277 
Epilobium coloratum Biehler: 2; Ev85008 
Epi labium leptophyllum Raf.: 2; E22448 
Ludwigia alternifolia L.: 8, 1 1; E2 12971 
Ludwigia palustris (L.) Ell.: 11; E22289 



Phytologia (December 2009) 91(3) 429 



Liidwigia polycarpa Short & Peter: 1 1 ; E2248 1 

Oenothera biennis L.: 11; E22346 

Oenothera clelandii W. Dietr., Raven & W.L. Wagner: 7,9,10: E21260 

Oenothera pi lose I la Raf.: 4, 5, 8; E2 1 843 

OXALIDACEAE 

Oxalis fontana Bunge: 1 1; E21936 
Oxalis stricta L.: 5,^1 1; E2 1868 

PHRYMACEAE 

Phryma leptostachya L.: 9, 10; P33638 

PHYTOLACCACEAE 

Phytolacca americana L.: II; P33262 

PLANTAGINACEAE 
Plantago aristata Michx.: 1 1 ; P33263 
*Plantago lanceolata L.: 11; E21883 
Plantago patagonica Jacq.: 7, 9, 10; E21977 
Plantago rugelii Decne.: 1 1 ; E21946 

POLEMONIACEAE 

Phlox bifida Beck: 7, 9, 10; E21582 
Phlox glaberrima L.: 2, 4. 8; E21232 

POLYGALACEAE 

Poly gala cruciata L.: 3, 8, 1 1; E21518 
Polygala polygama Walt.: 8, 1 1; E21905 
Poly gala sanguinea L.: 5; P30002 

POLYGONACEAE 

Antenoron virginianiim (L.) Roberty & Vautier: 1 1 ; P33650 
*Fallopia convolvulus (L.) A. Love: 1 1; E21963 
Fallopia cristata (Engelm. & Gray) Holub.: 1 1 ; P33648 
Persicaria amphibium (L.) S.F. Gray: 2. 4; P33705 
Persicaria careyi (Olney) Greene: 3,11; P33477 
*Persicaria cespitosa (Blume) Nakai: 1 1; E22286 
Persicaria hydropiperoides Michx.: 1,2, 11; E22344 
Persicaria lapathifi^lia (L.) S.F. Gray: 2, 1 1: E22454 



430 P/nioloj^ia (December 2009) 91(3) 



Persicaria opeUnisanu (Riddell) Small: 2, 12; P33484 
Persicaria pensylvanica (L.) Small: 1 1 ; E22639 
Persicaria punciata (Ell.) Small: 2, 3; E22440 
Persicaria setacea (Baldw.) Small: 1,11; E22473 

* Persicaria vulgaris Webb & Moq.: 1 1 ; E30043 
Polygonella articiilata (L.) Meisn.: 7, 10; E22450 

* Polygonum aviculare L.: 11; E22305 
Polygonum ramosissimum Michx.: 2; P33666 
Polygonum tenue Michx.: 7, 9, 10; P33470 
*Rumex acetosella L.: 6, 7, 9, 10, 1 I ; E21252 
*Rume.x crispus L.: 1 1 ; E2 1 866 
Tracaulon sagittatum (L.) Small: 2; E22435 

PORTULACACEAE 

Claytonia virginica L.: 9, 10; E21583 

*Portulaca oleracea L.: 11; E22266 

Talinum rugospermum Holz.: 7, 9, 10; P33406 

PRIMULACEAE 

Lysimachia hybrida Michx.: 2; P33479 
Lysimachia lanceolata Walt.: 2, 8, 9; E22327 
Lysimachia quadriflora Sims: 2, 4; P33274 
Lysimachia terrestris (L.) BSP.: 4; E22006 
Lysimachia ihyrsiflora L.: 1,2; E21826 

RANUNCULACEAE 

Anemone canadensis L.: 11; E21898 
Anemone cylindrica Gray: 7, 9, 10; E21273 
Anemone quinquefolia L.: 9; E21578 
Ca///?fl palustris L.: 2; E21596 
Ranunculus abortivus L.: 11; E21627 
Ranunculus flabellaris Raf.: 1 1; E2 1599 
Ranunculus longirostris Godr.: 1 1 ; P32968. 1 
Ranunculus pusillus Poir.: 1 1; P32957 
Thalictrum revolutum DC.: 8. 1 1 : E21861 

RHAMNACEAE 

Ceanoihus americanus L.: 7, 9, 10; E21266 
*Frangula alnus Mill.: 2; P33669 



Phytologia (December 2009) 91(3) 431 



*Rhamnus cathartica L.: 11; P33278 

ROSACEAE 

Agrimonia parviflora Sol.: 2, 5; E22434 

Aronia melanocarpa (Michx.) Ell.: 5, 8, 9, 1 1; E2 1301 

Fragaria virginiana Duchesne: 1 1; E21606 

Geum aleppicum Jacq.: 1 1 ; E2 1 897 

Geum canadense Jacq.: 1 1; P33649 

Geum lacin latum Murr.: 1 1; E21959 

Malus ioensis (Wood) Britt.: 1 1 ; E21620 

*Malusprunifolia (Willd.) Borkh.: 1 1; P33654 

Physocarpus opulifolius (L.) Maxim.: 1 1 ; E2 1 9 1 7 

Potentilla norvegica L.: 11; E30044 

Potentilla simplex Michx.: 2, 5, 6, 8, 9, 10, 1 1; E2 1602 

Primus americami Marsh.: 1 1 ; E21622 

Primus serotina Ehrh.: 9, 10, 1 1; E2 1300 

Primus virginiana L.: 11; P36266 

Rosa Carolina L.: 7, 8, 9, 10, 1 1; E2 1275 

*Rosa multiflora Thunb.: 1 1 ; E21866 

Rosa palustris Marsh.; 2, 4, 5, 8; P33217 

/?wZ?;/5 allegheniensis Porter: 6. 9, 10, 1 1; E21292 

Rubus flagellaris Willd.: 2, 8, 9, 10, 1 1; E2 1290 

Rubus hispidus L.: 5, 6, 8, 1 1 ; E21901 

Rubus occidentalis L.: 9, 10, 1 1; P32967 

Rubus sclmeideri Bailey: 4, 5, 8; F990 

Spiraea alba Du Roi: 2, 3, 5, 8, 1 1 ; E22268 

Spiraea tomentosa L.: 5, 6, 8, 9; E2 15 17 

RUBIACEAE 

Cephalanthus occidentalis L.: 1; E22337 
Galium aparineL.: 11;E21624 
Galium boreale L.: 1, 2, 4; Ev87573 
Galium circaezans Michx.: 9, 10; P33642 
Galium obtusum Bigel.: 1, 2, 4, 5, 8; E22496 
Galium pilosum Ait.: 9; E21501 
Galium tinctoriiim L.: 2; P33480 
Houstonia caerulea (L.) Hook.: 1 1 ; E21603 



432 I'hxtolo^ia (Dfccnihcr 2009) 91(3) 



RUTACEAE 

Pu'li'u [ri/oliauiL.: 1 1; P3322() 

SALICACEAE 

Populiis deltoides Marsh.: 2, 1 1 ; E21915 

Popitliis i^randidcntatu Michx.: 3, 9, 1 1 ; E2I93() 

Popidus tremuloides Michx.: 6, 8, 9, 1 1 ; E2 1 286 

Salix bebbiana Sarg.: 2; M 8 July 1977 

Salix discolor Muhl.: 8; E21998 

Salix humilis Marsh.: 6, 8, 9, 10, II ; E2 1 579 

Salix interior Rovvlee: 2; E21824 

Salix nigra Marsh.: 1 1 ; E2 1938 

Salix petiolaris Sm.: 5; Ev87568 

Salix rigida Muhl.: 1 1 ; E21609 

Salix sericea Marsh.: 5, 8; E21838 



SANTALACEAE 

Comandra lunbellata (L.) Nutt.: 6; E21581 

SAXIFRAGACEAE 

Heuchera americana L.: 9; E21831 
Heiichera richardsonii R. Br.: 7 ; Ev87528 
Penthoriun sedoides L.: 1; E22333 
Saxifraga pensylvanica L.: 4, 5; P32962 

SCROPHULARIACEAE 

Agalinis purpurea (L.) Pennell: 6, 8, 11; E22541 

Agalinis tenuifolia (Vahl) Raf.: 1 1 ; E22468 

Aureolaria pedicularia L.: 6, 9, 10; E22525 

Gratiola neglecta Torr.: 1 1 ; E21908 

Leucospora multifida (Michx.) Nutt.: 1 1; Ev85065 

Lindernia anagallidea (Michx.) Pennell: 1 1 ; E22458 

Mimulus ringens L.: 1, 11; E22335 

Nuttallanthus canadensis (L.) D. Sutton: 7, 8, 9. 10; E21248 

Pedicularis canadensis L.: 8; E2I992 

Pedicularis lanceolata Michx.: 2; E22576 

Penstemon digitalis Nutt.: 1 1; E21865 

Scrophularia lanceolata Pursh: 9, 10; E21265 



Phytologia (December 2009) 91(3) 433 



*Verbascum thapsiis L.: 3, 1 1; E30045 
* Veronica arvensis L.: 11; E21629 
Veronica peregrina L.: 1 1 ; E2 1 628 
Veronica sciitellata L.: 1.2,4, 1 1 ; E2 1 8 1 6 
Veronicastnim virginiciim (L.) Farw.: 8, 1 1; E22265 

SOLANACEAE 

Physalis heterophylla Nees: 1 1; E21942 
Physalis virginiona Mill.: II; E21965 
Solaniim carolinense L.: 11; E21933 
*Solanum dulcamara L.: 2; E21810 
Solannm pnchanrhiim Dunal: 2, 3; P33616 

ULMACEAE 

Celtis occidentalis L.: 11; P33659 
Ulmiis americana L.: 2. 1 1; E22001 
""Vlmiis pumila L.: 11 ; E30046 

URTICACEAE 

Boehmeria cylindrica (L.) Sw.: 1,2. 11; E22334 
Parietaria pensylvanica Muhl.: 1 1 ; E2 1 304 
Pilea pumila (L.) Gray: 9; P36269 

VERBENACEAE 

Phyla lanceolata (Michx.) Greene: 1 1 ; E22303 
Verbena bracteata Lag. & Rodr.: 1 1 ; E2 1302 
Verbena hastata L.: 2,^8; E22282 
Verbena urticifolia L.: 11; P33646 

VIOLACEAE 

Viola lanceolata L.: 5. 6. 8; E21593 

Viola pedata L.: 7. 9, 10; E21585 

Viola pratincola Greene: 9, 1 1 ; E2 1589 

Viola primulifolia L.: 3, 5, 6. 8, 1 1; E2 1988 

Viola sagittata Ait.: 5, 6, 7, 8. 9. 10; E21580 

Viola sororia Willd.: 8, 9, 10; E21592 

VITACEAE 

Parthenocissus quinquefolia (L.) Planch.: 1 1; E21934 



434 riiYioloiiia iDcccmhcr 2009) 91(3) 



Vitis ripana Miclix.: 3, 9, 10; P337()l 

MONOCOTS 

ACORACEAE 

Acorns amcricanus (Raf.) Raf.: 4, I 1; P33062 

ALISMATACEAE 

Alisina siibcordatum Raf.: 1 ; E22340 

Sagittaria latifolia Willd.: 1 1 ; P33655 

AMARYLLIDACEAE 

Hypoxis hirsuta (L.) Coville: 6, 7; Ev87576 

COMMELINACEAE 

Commelina erecta L.: 6, 7, 10, 1 1 ; E21243 
TradescantUi ohiensis Raf.: 6, 7, 9, 10, 1 1; E2 1256 

CYPERACEAE 

Bulbostylis capillahs (L.) C.B. Clarke: 6; P33821 

Carex behbii Olney: 6; E2 1 26 1 

Carexbkmda Dewey: 9, 10; P32956 

Carex brachyglossa Mack.: 5; F981 

Carex brevior (Dewey) Mack.: 5, 1 1 ; E2 1 9 1 2 

Carex buxbaiimii Wahlenb.: 2, 3, 4; E21597 

Carex cephalophora Muhl.: 3, 9, 10; P33051 

Carex crawei Dewey: 5, 1 1; E2 1881 

Carex cunndata (L.H. Bailey) Fern.: 3; P36256 

Carex envnonsii Dewey: 3,5; P32943 

Carex festucacea Schk.: 3; P33053 

Carex foenea Willd.: 9; E21590 

Carex haydenii Dewey: 2, 3, 4, 5; P32946 

Carex interior L.H. Bailey: 4, 5; P32951 

Carex lupidiformis Sartw.: 2; E22341 

Carex molesta Mack.: 4; P33055 

Carex miihlenbergii Schk.: 7, 10, 11; E21255 

Carex normalis Mack.: 5; F975 

Carex pellita Willd.: 2; E21595 

Carex pensylvanica Lam.: 7, 9, 10; E21584 

Carex physorhyncha Liebm.: 7, 8, 9, 10, 1 1; E2 1851 



Phytologia (December 2009) 91(3) 435 



Carex sartwellii Dewey: 2; P3296I 

Carex scoparia Schk.: 2, 1 1 ; E2 1 822 

Carex striata Lam.: 2; E2 1 598 

Carex suberecta (Olney) Britt.: 2, 3, 4, 5, 9; P32955 

Care.v swanii (Fern.) Mack.: 6, 9; E21247 

Carex umbellata Schk.: 5, 6; P32963 

Carex vesicaria L.: 4; P33063 

Carex vulpinioidea Michx.: 1 1 ; E2 1 880 

Cyperus bipartitus Torr.: 1 1 ; E22643 

Cyperus erythrorhizos Muhl.: 1 1 ; E22478 

Cyperus liipulinus (Spreng.) Marcks: 6, 7, 10; E21246 

Cyperus schweinitzHTon.: 6. 7, 10; E21242 

Cyperus squarrosus L.: 11; E22636 

Cyperus strigosus L.: 11; E22461 

Eleocharis acicularis (L.) Roem. & Schultes: 12; E22637 

Eleocharis erythropoda Steud.: 1, 2; E21822 

Eleocharis ovata (Roth) Roem.: 1 1; E21298 

Eleocharis verrucosa (Svenson) Harms: 1, 2, 4, 5, 8, 12; E21895 

Eleocharis wolfii Gray: 2, 3, 4; P33048 

Fimbristylis autumnalis (L.) Roem. & Schultes: 1 1 ; E22455 

Fimbristylis puberula (Michx.) Vahl: 1 1; Ev87587 

Hemicarpha micranthus (Vahl) Pax: 1 1 ; E22309 

Rhynchospora capitellata (Michx.) Vahl: 3, 5, 8, 1 1; E21291 

Schoenoplectus acutus (Muhl.) A. Love & D. Love: 1; E21972 

Scirpus cyperimis (L.) Kunth: 2, 4, 11; P33615 

Scirpus pemhdus Muhl.: 1 1; E2 1885 

Scleria pauciflora Muhl. var. caroliniana (Willd.) Wood: 6, 9; P33403 

Scleria triglomerata Michx.: 5, 6, 8, 10; P33401 

HYDROCHARITACEAE 

Elodea canadensis L.C. Rich.: 1 1 ; E30047 

IRIDACEAE 

Iris shrevei Small: 2, 5; E21807 
Sisyrinchium albiduni Raf.: 6, 1 1 ; E2I576 
Sisxrinchium atlanticum Bickn.: 5, 8; E21986 



436 rhxtolosiia (December 2009) 91(3) 



JUNCACEAE 

J uncus acuminatus Michx.: 2, 1 1 ; 1'2 I 296 
Juncus brachycarpus Engeliii.; 1 1 ; 1:\ S5() 14 
Juncus bujonius L.: 11; F973.2 
Juncus canadensis J. Gay: 1 , 8; E22487 
Juncus dudleyi Wieg.: 2, 5, 6; E21K()6 
Juncus i^reenei Oakes & Tuckerm.: 6; E2 1 235 
Juncus nuirginalus Rostk.: 8; E21993 
Juncus nodosus L.: 11; Ev81372 
Juncus tenuis Willd.: 9. 10. 1 1 ; E21952 

LEMNACEAE 

Lemna minor L.: 11; E30048 

Spirodela polyrliiza (L.) Schleiden: 1 1 ; E22291 

LILIACEAE 

Aletris farinusa L.: 4, 5, 6, 8, 9; E21234 

* Asparagus officinalis L.: 11; E2 1949 

Maianthemum canadense Desf.: 3; P33488 

Polygonatum commutatum (Schult.) A. Dietr.: 9, 10; E21284 

Smilacina racemosa (L.) Desf.: 9, 10; E21305 

Smilacina stellata (L.) Desf.: 9, 10; E21280 

ORCHIDACEAE 

Liparis liliijolia (L.) Rich.: 3; P33034 

Liparis loeselii (L.) Rich.: 3; F985 

Platantherajlava (L.) Lindl. var. herbiola (R. Br.) Luer: 4; P33049 

Platantlwra lacera (Michx.) G. Don: 8; E21982 

Spiranthes cernua (L.) Rich.: 5, 8; E22648 

POACEAE 

*Agrostis gigantea Roth: 5, 1 1 ; E2 1 236 
Agrostis hyemalis (Walt.) BSP.: 3, 4, 5, 8, 1 1 ; E21902 
Agrostis scabra Willd.: 3, 4, 6, 7, 9, 10; E22413 
Alopecurus carolinianus Walt.: 1 1; E21894 
Andropogon gerardii Vitman: 5, 6, 7, 8, 9, 10; E22556 
Andropogon virginicus L.: 8; P36273 
Aristida basiramea Engelm.: 7, 10; E22415 
Aristida purpurascens Poir.: 7, 10; E21503 



Phytologia (December 2009) 91(3) 437 



Aristida tuberculosa Nutt.: 7, 10; E224I6 

Bouteloua curtipendula (Michx.) Torr.: 1 1 ; E22506 

*Bromus commutatus Schrad.: 1 1; E21872 

*Bromus inermisLeyss.: 10, 11;E21862 

*Bromusjaponicus Thunb.: 1 1; Ev 102859 

Bromus latiglumis (Shear) Hitchc: 1 1; P33467 

*Bromus tectorwn L.: 1 1 ; E21621 

Calamagrostis canadensis (Michx.) P. Beauv.: 2, 8; E2 181 1 

Cenchrus longispinus (Hack.) Fern.: 1 1 ; E22297 

*Dacnlis glomerata L. : 1 1 ; E2 1 6 1 8 

Danthonia spicata (L.) Roem. & Schultes: 9. 10; F989 

Dichanthelium lindheimeri (Nash) Gould: 3, 6, 7, 10, 11; E21259 

Dichanthelium meridionale (Ashe) Freckm.: 1 1 ; E21954 

Dichanthelium oligosanthes (Schult.) Gould: 7, 9, 10, 1 1; E2 1258 

Dichanthelium perlongwn (Nash) Freckm.: 7. 9. 10; E21853 

Dichanthelium villosissimum (Nash) Freckm.: 7, 9, 10, 11; E21249 

Digitaria filiformis (L.) Koel.: 9, 1 1; P33697 

*Digitaria ischaemum (Schreb.) Schreb.: 1 1; E22299 

* Digitaria sanguinalis (L.) Scop.: 1 1 ; E22300 

*Echinochloa crus-galli (L.) P. Beauv.: 2, 1 1 ; E21497 

Elymus canadensis L.: 1 1 ; P33656 

Elymus virginicus L.: 11; E22262 

*Elytrigia repens (L.) Desv.: 1 1 ; E21869 

*Eragrostis cilianensis (All.) Vign.: 1 1 ; E22534 

Eragrostis hypnoides (Lam.) BSP.: ! 1 ; E22480 

Eragrostis pectinacea (Michx.) Nees: 1 1; E22308 

Eragrostis spectabilis (Pursh) Steud.: 7, 9, 10; E22510 

Glyceria septentrionalis Hitchc: 1 ; E21974 

Glyceria striata (Lam.) Hitchc: 2; E22003 

Heterostipa spartea (Trin.) Barkworth: 7, 9, 10; E21281 

Hierochloe odorata (L.) P. Beauv.: 5; F988 

*Hordeumjubatum L.: 1 1 ; E21884 

Koeleria macrantha (Ledeb.) Spreng.: 7, 9, 10, 11; E21269 

Leersia oryzoides (L.) Swartz: 2, 1 1 ; E22641 

Leersia virginica Willd.: 3, 9; P33651 

Leptoloma cognatum (Schult.) Chase: 7, 10; E21245 

Muhlenbergia mexicana (L.) Trin.: 2, 3, 5, 9; P33476 

Muhlenbergia schreberi J.F. Gmel.: 1 1 ; P33640 

Panicum capillare L.: 11; Ev85024 



438 rinioloi^ia {December 2009) 91(3) 



Paniciiiu dichotoinijlorum Miclix.: 1 1 ; E22564 

Panicum rii>idulum Bosc: 3, 8, 9. 10; E21496 

Panicnm vir^afum L.: 5, 6, 8, 9, 10. 1 1 ; E22550 

Paspalum hiishii Nash: 7, 10; E 21511. E22260 

Paspaliiin laeve Michx.: 1 1; P33645 

*Phalaris arimdinacea L.: 2. 3; E2 18 14 

*Phleum pratense L.: 1 1 ; E2 1 299 

*Poa compressa L.: 9. 10. 1 1; E2 1923 

*Poapratensis L.: 2. 5. 6, 7, 8, 9, 10, 11; E216()4 

Scluzachyriiim scopariiiin (Michx.) Nash: 5. 6. 7, 8, 9, 10; E21506 

*SelariaJahen R.A.W. Herrm.: 1 1 ; E22298 

*Setaria viridis (L.) P. Beauv.: 1 1; E30()34 

Soriiluistriiin nutans (L.) Nash: 5. 6. 8; E22561 

Spanina pectinata Link: 1, 3, 5, 8; E22342 

Sphenopholis obtusata (Michx.) Scribn.: 2, 1 1; E21879 

Sporobohis clandestimis (Biehler) Hitchc: 7. 9. 10; E21500 

Sporobohis cryptandrus (Torr.) Gray: 1 1 ; E22405 

Tridens jlavits (L.) Hitchc: 6, 7, 9, 10. 1 1 ; E22546 

Triplasis purpurea (Walt.) Chapm.: 7, 9, 10; E22409 

Vulpia octoflora (Walt.) Rydb.: 7, 9, 10; E21855 

POTAMOGETONACEAE 
*Potamogeton crispus L.: 1; P30046 
Potamogeton foliosus Raf.: 1 1; P33663 
Potamogeton nodusus Poir.: 1 1; P33658 

SMILACACEAE 

Smilax lasioneuron Hook.: 1 1; E21873 

SPARGANIACEAE 

Sparganium eurycarpum Engelm.: 1; E21970 

TYPHACEAE 

Typha latifolia L.: 1, 2, 1 1; P33486 

XYRIDACEAE 
XyristortaSxn.-.'i, 11;E22315 



Phytologia (December 2009) 91(3) 439 



A NEW NAME FOR AGERATINA POCHUTLANA B.L.TURNER 

B. L. Turner 

Plant Resources Center 

The University of Texas at Austin 

Austin, Texas 78712 

billie@uts.cc.utexas.edu 

Phytologia 91(3): 439 {December, 2009). 

The recently described Ageratma pochittlana B.L. Turner 
(Phytologia 90: 359. 2008) is illegitimate because of the earlier A. 
pochutlami B.L. Turner (2006). This is a lapse, no doubt occasioned by 
my aging forgetfulness. The two taxa are both from the Distrito 
Pochutla, but belong to different subgenera of Ageratina: the earlier to 
subgenus Neogreenella, the latter to subgenus Ageratina. 

The following is proposed for the superfluous name: 

Ageratina lapsensis B.L. Turner, nom. nov. 

Based upon Ageratina pochutlana B.L. Turner, Phytologia 90: 359. 

2008. 

Not Ageratina pochutlana B.L. Turner, Lundellia 9: 3. 2006. 

It should be noted that the day of collection on the type 
specimen of A. lapsensis should be 1 1 Mar instead of 3 Nov (a 
misrepresentation of 3/1 1 in my original reading). 



440 Phxtolo^ia (DeccHihcr 2009} 91(3) 



RECENSION OF THE MEXICAN SPECIES OF SECTION 
UUGINOSAE OF SALVIA (LAMIACEAE) 

B. L. Turner 

Plant Resources Center 
The University of Texas at Austin 

Austin, Texas 787 12 
billieCa^ uts.cc.utexas.edu 

ABSTRACT 

Salvia sect. Uliginosae of Mexico is treated as having 28 
species, five of these described as new: Salvia chazaroana B.L. 
Turner, sp. nov., from Veracruz; Salvia galloana B.L. Turner, sp. nov., 
from Guerrero; Salvia novoleontis B.L. Turner, sp. nov., from Nuevo 
Leon; Salvia textitlana B.L. Turner, sp. nov., from Oaxaca; and Salvia 
pauhvalleri B.L. Turner, sp. nov., from Durango. Photographs of the 
holotypes are provided, along with a simplified key to the 28 species, 
and maps showing their distributions. Phytologia 91(3): 440-466 
(December, 2009)^ 

KEY WORDS: Salvia, Lamiaceae, Mexico, sect. Uliginosae 



13. SECT. ULIGINOSAE 

Perennial rhizomatous or stoloniferous herbs to 1 m high, rarely shrubs 
or subshrubs 1-3 m high. Leaves highly variable, linear to lanceolate to 
oblanceolate, ovate to deltate, or rarely cordate, markedly petiolate to 
sessile. Capitulescence a terminal, elongate, spike, the floral bracts 
soon deciduous. Calyces relatively small, the upper lip 5-7 veined. 
Corollas mostly blue, blue-black or rarely white, the tubes relatively 
short. Gubernaculum more or less deltoid, dentate. Stylar shafts pilose 
apically, the upper branches linear, 2-3 times as long as the lower, 
deltoid, branches. 
TYPE: Salvia iiliginosa Benth., of South America 

As well-noted by Epling (1939), a very large highly variable 
section, largely recognized by its relatively small, blue or white, 



Phytohgia (December 2009) 91(3) 441 



flowers having 5-7 veined upper calyces, gubemacula deltoid, and 
stylar branches pilose. 

KEY TO SPECIES 

1. Plants widespread in Mexico, not in Chi. Coa (3) 

1 . Plants of Chi and Coa (2) 

2. Plants mostly 30-50 cm high, arising from thick rhizomes 

S. arizonica 

2. Plants mostly 10-30 cm high, arising from slender rhizomes 

S. forreri 

3. Plants with leaves all basal or essentially so. their blades mostly 
3-6 cm wide; stems arising from a tuberous root S. nana 

3. Plants not as described in the above (4) 

4. Blades of mid-stem leaves lanceolate, ovate, to deltoid or subcordate, 
mostly 2-5 times as long as wide (7a) 

4. Blades of mid-stem leaves linear, mostly 6-12 times as long as wide 
(5) 

5. Plants eglandular along the rachis, mostly 20-30 cm high...S. laevis 

5. Plants slandular-pubescent alone the rachis. mostly 10-40 cm hish.. 
r r 46) 

6. Blades not reticulate-veined beneath, having but a single prominent 
mid-rib; northeastern Mexico S. unicostata 

6. Blades paripinnate or reticulate-veined beneath; Nay. Jal....S. firma 

7a. Plants not as described below (8) 

7a. Plants mostly 10-30 cm high, the stems with slender rhizomes 
and/or stolons rooting at the nodes; leaf blades mostly 10-30 mm 
long; Nue. Tarn. San, Ver (7b) 

7b. Plants mostly 10-20 cm high, the stems sprawling, arising from 

slender rhizomes; Sierra Magdalena, Ver S. chazaroana 

7b. Plants mostly 20-30 cm high, the stems erect, arising from tap roots 
or woody corms; Nue, Tarn, San (7c) 



442 rinioloiiia (December 2009) 9/(3) 



7c. Leaf blades ovate-lanccolale, 2-3 times as k)iig as wide; 

corollas 10-15 mm long S. novoleontis 

7c. Leaf blades subdeltoid, 1-2 times as long as wide; 

corol las 1 5-20 mm long S. villosu 

8. Leaves cordate-apiculate; corollas blue, the tubes 1 1-15 mm long; 
Gue S. hamulus 

8. Leaves and tlowers not as described in the above (9) 

9. Flowers white; leaves widest near the middle; petioles 1-6 mm long; 
Mic S. a.s.surgens 

9. Plants not as described in the above (10) 

10. Stems prostrate; leaves 1.0-2.5 cm long; petioles 1-2 mm long; 
Hid S. iozani 

10. Plants not as described in the above (11) 

1 1. Blades of leaves mostly over 3 cm long (17) 

1 1. Blades of leaves mostly 1-3 cm long (12) 

12. Calyces ca 10 mm long; Gue S. galloana 

12. Calyces 4-7 mm long; Dur. Jal, Oax (13) 

13. Leaves decidedly deltoid, thickened, the margins glandular- 
pubescent; San S. villosa 

13. Plants not as described in the above (14) 

14. Calyx 6-7 mm long; stems pubescent with shorter, softer, hairs 0.2- 
1.0 mm long or less (16) 

14. Calyx 4-5 mm long; stems pubescent with stiffly-spreading 
glandular hairs 1-2 mm long (15) 

15. Blades of leaf more nearly ovate, the margins ciliate with hairs 

ca 2 mm long; Jal S. veronicif olia 

15. Blades of leaf more nearly deltoid, the margins vv/o elongate cilia; 
Dur S. paulwalleri 



Phytologia (December 2009) 91(3) 443 



16. Petioles 1-4 mm long; Jal S. manantlanensis 

16. Petioles 10 mm long, or longer; Oax S. tricuspidata 

17(11). Blades of leaves more nearly ovate or lanceolate (22) 

17. Blades of leaves more nearly deltoid (18) 

18. Calyces and stems glandular-pubescent; leaves thickened; San 

S. villosa 

18. Plants not as described in the above (19) 

19. Calyces and/or floral bracts to some extent setulose with stiff 
spreading hairs; Mic, Mex, Mor, Cue?. Oax S. setulosa 

1 9. Plants not as described in the above (20) 

20. Corolla tubes 3-5 mm long; calyces glandular-pubescent; Oax 

S. pusilla 

20. Corolla tubes 6-8 mm long; calyces not glandular-pubescent (21) 

21. Corollas lavender, ca 1.5 cm long S. oreopola 

21. Corollas blue, ca 2 cm long S. glechomifolia 

22. Calyx and rachis densely pubescent with white, glandular or 
eglandular, hairs 1 .0- 1 .5 mm long; Mic S. assurgens 

22. Plants not as described in the above (23) 

23. Leaves sessile or nearly so; Gue S. epiingiana 

23. Leaves decidedly petiolate (24) 

24. Leaves markedly reticulate-venose and densely white-tomentose 
beneath; Mic S. indigocephala 

24. Leaves not as described in the above (25) 

25. Blades of leaf deltoid, about as long as wide; petioles 1-3 mm long; 
Sin S. pauhvalleri 

25. Plants not as described in the above (26) 



444 Ph\u>l(>}'iu (Dc'ccmher 2009) 91(3) 



26. Shrubs 1-3 m high; corollas blue-black; leaves lustrous, glabrous 
and markedly glandular-punctate beneath; Guc S. hintonii 

26. Plants not as described in the above (27) 

27. Blades of leaves lanceolate to t)blanceolale, widest near the middle; 

rachis glandular-pubescent, rarely not; Sin, Dur, Nay, Jal 

S. sinaloensis 

27. Blades ovate, widest near the base (28) 

28. Plants in Nay. Jal (30) 

28. Plants not in Nay, Jal (29) 

29. Plants not in Oax S. forreri 

29. Plants in s Oax S. tcxtitlana 

30. Rachis of spike glandular-pubescent; calyx 5-6 mm long; Jal 

S. rostellata 

30. Rachis of spike eglandular; calyx 8-9 mm long; Nay. Jal 

S. firma 



SALVIA ARIZONICA A. Gray, Syn. Fl. N. Amer. 2: 370. 1886. 
Map 1. 

Salvia arizonica var. huachucana M.E. Jones 

s Chi, n Coa, and sw U.S.A., montane habitats in oak- conifer 
forests of the Chihuahuan Desert , 2000-2600 m; flowering: Aug-Oct. 

Closely related to S. forreri and distinguished from that 
species largely by habit, as noted by Epling (1939). So far as known, 
the two taxa do not grow together or intergrade, unless one accepts the 
isolated populations of S. arizonica from southern Coa and Chi, 
referred to by Epling. I treat the latter as part of the S. forreri complex, 
largely on the basis of geography. Were the two taxa to be combined, 
the earliest name, by two years, is that of 5. arizonica. 

SALVIA ASSURGENS Kunth, Nov. Gen. Sp. PI. 2: 293. 1817. Map 2. 

Mic, oak or pine-oak forests, 2000-2200 m; flowering: Jun- 
Aug. 



Phytologia (December 2009) 91(3) 445 



Perennial herbs with decumbent or sprawling stems; leaves highly 
variable as to size but the blades usually widest near the middle with 
very short petioles; flowers arranged in strict or interrupted spikes, the 
corollas white. 

This is a relatively common species in central Mic, to judge 
from assembled collections (LL-TEX). Because of the variation in leaf 
size, it is keyed in two places in the above key. Epling (1939) notes 
that "Save for the more lax inflorescence there is apparently little to 
suggest segregation of S. sinaloensis;'' he goes on to note that S. 
pninifolia is scarcely separable from S. assurgens, the former largely 
separated by its longer petioles. Salvia assurgens is readily 
distinguished from S. sinaloensis by its white flowers, but I treat S. 
pninifolia as synonymous with S. sinaloensis. 



SALVIA CHAZAROANA B.L. Turner, sp. nov. Fig 1, Map 3. 

Salviae forreri Greene similis sed differt plantis minoribus, 
caulibus decumbentibus vel prostratis ad nodos radicantibus, foliis 
minoribus, petiolis brevioribus (3-6 mm vs. 8-25 mm), et calycibus 
glandulosi-pubescentibus. 

Prostrate perennial herbs to 20 cm high, abundantly rooting at the 
nodes. Leaves glabrous beneath or nearly so, mostly 1.0-2.5 cm long, 
0.7-1.1 mm wide; petioles 3-6 mm long; blades broadly ovate to 
subdeltoid, upper surfaces minutely spotted with an array of flattened, 
branched, white trichomes, the lower surfaces markedly glandular- 
punctate throughout, the margins crenate. Spikes terminal, ca 4 cm 
long, the flowers arranged ca 4 to a node, the axis pubescent with 
spreading glandular-trichomes ca 0.6 mm high. Floral bracts ovate, 5- 
6 mm long, 2.5-3.5 mm wide, soon deciduous. Pedicels 1-2 mm long. 
Calyces 5-7 mm long, the upper lip 7-nerved, trifid at the apex, the 
lower lobes apiculate, ca 2.5 mm long; tubes 3.5-4.0 mm long, hispid 
below, the upper margins glandular-pubescent. Corollas ca 10 mm 
long, papillose in lines within, but mostly smooth, "blue with a white 
stripe in the lower lip;" tubes ca 7 mm long; upper lip ca 4 mm long; 
lower lip ca 7 mm long. Anthers blue, nestled within the upper lip, the 
gubernaculum narrowly deltoid. Styles flattened apically, densely 



446 PhMolo^ia {Dcccniher 2009) 9l{.l) 



pilose dorsally, the lower stigmatic branches ca 0.8 mm long, the upper 
branches 3 times as long or more. Nutlets (immature) glabrous. 

TYPE: MEXICO. VERACRUZ: Mpio. Toiiayan, Sierra de la 
Magdalena. "unpaved road from Tonayan to Monte Real, and then a 
trail to Cerro de la Magdelena," pine-oak cloud forests, 1600-2500 m, 
20 Dec 1989. M. Chazaro B. et al. 6050 (holotype WISC!; isotypes 
TEX!). 

ADDITIONAL COLLECTIONS: MEXICO. VERACRUZ: Mpio. 
Coactzintla, Cerro de la Magdalena, 19 43 43 N, 95 59 00 W, 2600- 
2650 m, 1 Nov 2008, P. Carillo-Reyes et al 5444 (IBUG). [not 
examined; info from collectors]. Mpio. TIacolulan. "cerca de la Cima 
del Cerro de la Magdalena, subiendo por el Epazote," 2500 m, 22 Jul 
1984, M. Chazaro B. 3121 (MEXU). 

Because of its low prostrate habit and small foliage, this taxon 
is readily recognized. 

According to Flores (1938), the Cerro de la Magdalena is 
formed from an isolated volcano at the junction of the Sierra Madre 
Oriental and the Trans-Mexican volcanic belt. The summit (ca 2700 m) 
is exposed to strong winds, with frequent rains and mists. The 
vegetation consists of montane grasslands (mainly Muhlenbergii spp.) 
and pine-oak forests. 

Ramamoorthy (by annotation) independently found this taxon 
to be new, proposing the name S. inargiteritiana. The latter name was 
also proposed by Ramamoorthy for several other taxa of Salvia, one of 
which I had already taken up (in prep.) when a photograph of the 
MEXU sheet (cited above) was examined. 

It is a pleasure to name this remarkable herb for my equally 
remarkable colleague, Miguel Chazaro B., indefatigable collector and 
spirited systematist of the old school: he walks wayward trails to gather 
his botanical booty (unlike the more modern workers who tend to 
gather their plants along paved highways). 



Phytologia (December 2009) 91(3) 447 



SALVIA EPLINGIANA Alziar, Biocosme Mesogeen 5: 86. 1988. 
Map 8. 

Salvia tricuspis Epling ( 1940). not Salvia triciispis Franchet (1891 ) 

Gue. Distr. Mina, pine-oak forests, 1700-2100 m; flowering: 
Nov-Mar. 

Perennial herbs 1-2 m high, readily recognized by its relatively large, 
lanceolate, tapering, nearly sessile leaves and glandular calyces. Alziar 
also notes that it "'May be distinguished from S. rostellata [of Jal] by 
the glandular inflorescence." 



SALVIA FIRMA Fernald, Proc. Amer. Acad. Arts 35: 502. 1900. 
Map 8. 

Nay and Jal, oak forests on volcanic slopes, ca 1200 m; 
flowering: Sep-Oct. 

Perennial herbs 20-40 cm high, the lower stems glabrous to 
eglandular, the upper stems and rachis glandular-pubescent (rarely not); 
leaves linear-lanceolate to linear-oblanceolate; spikes 20-30 cm long, 
much interrupted; corollas blue, ca 1.5 cm. long. 

A poorly collected taxon but readily recognized by its rather 
reticulate, glabrous, mostly lanceolate to oblanceolate, nearly sessile, 
leaves. 



SALVIA FORRERI Greene, Pittonia 1: 156. 1888. Map 1. 
Salvia parrasana Brandegee 

s Chi, s Coa, s Nue, s Tarn, Sin, Dur, Zac. San, Que? and Hid, 
pine-oak forests, 1800-3000 m; flowering: Jul-Aug. 

A relatively common, widespread, very variable, taxon, 
closely related to S. arizonica and perhaps not sufficiently distinct to 
warrant specific status, as noted under the latter. 



448 Phxiolo^ia (Dcccmhcr 2009) 91(3) 



SALVIA GALLOANA B L. Turner, sp. iiov. Fig 2, Map 4. 

Salviac liinlonii Epiing siniilis scd toliis miiu)ribus siiblcr 
leticulati-venosis (vs. non reticulato-veno.sis), corollis caciulcis (vs. 
caesio-nigribus), et calycibus 4-7 mm longis (vs. ca. 10 mm). 

Surtrutescent perennial herbs to 1.5 m high. Mid-stems pubescent 
with arcuate, up-turned, hairs. Leaves mostly 2-3 cm long, 1.0-1.5 cm 
wide; petioles 2-5 mm long; blades ovate, markedly reticulate-venose 
with surfaces glandular-punctate, their margins serrulate. Flowers 
arranged in terminal interrupted spikes 6-12 cm long; peduncles 3-5 cm 
long; rachis glandular-pubescent, the tloral bracts (if any) deciduous. 
Calyces (flowering) ca 10 mm long, glandular-pubescent, the upper lip 
with 5-7 ribs, the lower lip bifid, .somewhat longer than the upper. 
Corollas blue, ca 2.5 cm long, the tube ca 2 cm long, the upper lip 5-6 
mm long, somewhat shorter than the lower. Stamens 2, inserted at the 
throat; anthers purple, ca 2 mm long. Styles pilose above, the upper 
branches ca 3 times longer than lower. Nutlets ovoid, pale tan, ca 2.5 
mm long, 2 mm across. 

TYPE: MEXICO. GUERRERO: Mpio. Chichihuaico, "32 km al NE 

de Puerto del Gallo, camino Atoyac-Filo de Caballo," pine forests, ca 
2580 m, 23 Nov 1983, E. Martinez S. & F. Banie 5678 (Holotype: 
TEX). 

The species is named, in part, for Puerto del Gallo, from 
which a road takes one to the type locality. 



SALVIA GLECHOMIFOLIA Kunth, Nov. Gen. Sp. PI. 2: 290. 1817. 
Map 3. 

Salvia lentiginosa Brandegee 
Salvia reticulata Mart. & Gal. 

San, Gua, Mic, Mex, Pue and Oax, pine-oak forests, 2000- 
3200 m; flowering: May-Oct. 
Perennial, rhizomatous, herbs to 40 cm high. 

This is a widespread highly variable species, especially in leaf 
shape. 



Phytologia (December 2009) 91(3) 449 



SALVIA HAMULUS Epling, Repert. Spec. Nov. Regni Veg. Beih. 
110:72. 1938. Map 2. 

Gue (Distr. Mina), pine and fir forests, 1500-2500 m; 
flowering: Sep-Nov. 

Perennial rhizomatous herbs to 40 cm high, readily distinguished from 
related taxa by its cordate leaves. 



SALVIA HINTONII Epling, Repert. Spec. Nov. Regni Veg. Beih. 
110:73.1938. Map 9, 

Gue, pine-oak forests, 1700-2500 m; flowering: Oct-Mar. 
Shrub 1.5-3.0 m high; leaves 3-8 cm long, glabrous beneath or nearly 
so, and described as having "blue-black" corollas. 



SALVIA INDIGOCEPHALA Ramamoorthy, Taxon 32: 466. 1983. 
Map 1. 

Salvia cyanicephala Epling (1940), not Salvia cyanocephala Epling 
(1936, from Colombia) 

Mic, vicinity of Coalcoman, oak woodlands, 2400 m; 
flowering: Dec. 

Perennial herbs to 1 m high; because of the distinctive leaves, a readily 
identified taxon. 

In his original description, Epling notes "Very similar to S. 
setiilosa with which it may prove to be conspecific." He goes on, 
however, to call to the fore several seemingly valid characters that 
serve to distinguish between them. 



SALVIA LAEVIS Benth., Lab. Gen. Sp. 251. 1833. Map 5. 
Salvia comosa var. hypoglauca (Briq.) Fernald 
Salvia hypoglauca Briq. 
Salvia pseudocomosa Epling 

Tarn, San, Que, Mic, Mex, Tla, Ver and Pue, pine-oak forests, 
2000-2500 m; flowering: Jun-Aug. 



450 PhxioloKio {Dcccuhcr 2009) 91(3} 



Closely related to S. imicosiaia but readily distinguished by 
the characters brought to the fore in the above key. 

Epliiig (1939) distinguished his S. pseudocomosa from 5. 
laevis largely by leaf pubescence: pubescent in the former, glabrous in 
the later. He commented further his novelty "Suggests strongly a 
hybrid between 6". prunelloides or S. i^lechomifolia and S. laevis," 
which it well might be. Passes imperceptibly into S. Uievis and S 
prunelloides. 



SALVIA LOZANI Fernald, Proc. Amer. Acad. Arts 43: 64. 1907. 
Map 2. 

Hid, known only from pine forests in the vicinity of Trinidad, 
ca 2000 m; flowering: Jul-Aug. 

Because of its small, nearly sessile, leaves and prostrate stems 
which root at the nodes, an easily identified species, not likely to be 
confused with another. 

SALVIA MANANTLANENSIS Ramamoorthy, Bull. Mus. Nation. 
Hist. Nat., B, Adansonia, Ser. 4, 9: 173. 1987. Map 7. 

Jal, pine-oak forests. Sierra de Manantlan, 2200-2400 m; 
flowering: Dec-Jan. 

Sprawling perennial herbs 30-40 cm high, readily rooting at the lower 
nodes; blades of leaves ovate, mostly 2-4 cm long, the petioles 2-7 mm 
long; calyces 6-7 mm long, pubescent with glandular hairs; corolla blue 
or rarely white, ca 1.6 mm long, the tube ca 8 mm long. 



SALVIA NANA Kunth, Nov. Gen. Sp. PI. 2: 289. 1817. Map 4. 
Scdvia prunelloides Benth.. not S. prunelloides Kunth 

Dur. Zac. San, Gua, Oax and Guatemala, pine and pine-oak 
forests, 1800-3500 m; flowering: Jun Oct. 

Because of its broad, mostly basal leaves, an easily identified 
species. 



Phytologia (December 2009) 91(3) 45 1 



SALVIA NOVOLEONTIS B.L. Turner sp. nov. Fig. 3, Map 6. 

Salvia villosae Fernald similis sed differt plantis minoribus, 
laminis foliorum plerumque ovati-lanceolatis 2-3plo longioribus quam 
latioribus (vs. subdeltoideis, l-2plo longioribus quam latioribus), et 
corollis minoribus (10-15 mm longis vs. 15-20 mm). 

Perennial herbs 20-40 cm high, the stems arising from lignescent tap 
roots or woody corms 2-3 cm long. Stems moderately pubescent with 
erect, glandular trichomes 0.5-1.0 mm high. Leaves mostly 1.5-3.0 cm 
long; petioles 2-6 mm long; blades mostly ovate, 2-3 times as long as 
wide, pubescent above and below with mostly glandular hairs, 
especially along the margins. Inflorescence a terminal interrupted 
spike 10-30 cm long; peduncles 5-10 cm long; bracts small, ovate, 3-4 
mm long, soon deciduous. Flowers mostly 2 to a node, the pedicels 1- 
4 mm long. Calyces (flowering) 5-6 mm long, glandular-pubescent, 
the two lips ca equal in length, the upper lip with 5-7 well-defined ribs. 
Corollas blue. 10-15 mm long; tubes 5-6 mm long, the lower lip ca 6 
mm long, twice as long as the upper. Stamens attached at the throat, 
the anthers white, ca 2 mm long, not exserted. Styles (upper portion) 
densely pilose, the upper style branches purplish, 2-3 mm long, sigmoid 
or twisted, the lower branches arcuate, ca 1/3 as long as upper. Nutlets 
ovoid, smooth, tan to dark brown, ca 2 mm long, 1.5 mm wide. 

TYPE: MEXICO. NUEVO LEON: Mpio. Zaragosa, 1 1 km al E de 

San Antonio Pena Nevada, "Bosque de Pinoneros con Juniperus, Pinus, 
Rhus y Arctostaphylos.'" 2000-2500 m, 23 50 N, 99 58 W, 24 May 

1992, L. Hernandez S. 2681 [with M. Martinez y J. Jimenez] 
(Holotype: TEX). 

ADDITIONAL COLLECTIONS EXAMINED: MEXICO. NUEVO 
LEON: Mpio. Aramberri, "La Escondida-Zamora. 1795 m, 23 Jul 

1993, Hinton et al. 22994 (TEX); Mpio. Doctor Arroyo, ca 30 km 
ENE Doctor Arryo, "W base of Cerro Pena Nevada, large area of 
gypsum outcrops, 6600 ft, " on exposed gypsum (only on gyp)" 3-5 
Aug 1981, Nesom 4274 (TEX); road between Matahuela and Doctor 
Arroyo, 17 Jun 1992, Villarreal s.n. (TEX). SAN LUIS POTOSI: 
Mpio Charcas, 6 km al de Miguel Hidalgo, 7 Jul 1985, Tenorio L. 
9203 (TEX). 



452 riiy!<>l<>i:i(i (Dccanhcr 2009 > 91(3) 



Salvia novoleontis presumably occurs only in gyp soils, this 
documented by Nesoin 4274 (cited above). The closely related, .V. 
villosii. is known to me only from two areas in San Luis Fotosi, the type 
itself (a Schaffer collection from Minas de San Rafael, San Miguelito) 
and seven sheets (TEX) from the vicinity of Guadalcazar where it is 
said to occur in limestone soils {Barric 379 and Simpson 7032). 

SALVIA OREOPOLA Fernald. Proc. Amer. Acad. Arts 35: 517. 
1900. Map L 

Mex, Mor, Gue and Oax, pine-oak forests, 2000-2600 m; 
flowering: Aug-Oct. 

Perennial herbs to 1 m high; leaves with deltoid blades, the petioles 
mostly 1 -3 cm long. 

SALVLA PAULWALLERI B L Turner, sp. nov. Fig. 4, Map 8. 

Salviae veronicifoliae A. Gray ex S. Wats, similis sed differ! 
foliis fere deltoideis (vs. ovatis) marginibus minute pubescentibus (vs. 
ciliatis trichomatibus ca. 2 mm longis). 

Perennial (rhizoniatous?) herbs to 30 cm high. Stems seemingly 
recumbent, pubescent with both glandular and eglandular hairs ca 1 mm 
high. Leaves mostly 2-3 cm long, 1.5-3.0 cm wide; petioles 2-3 mm 
long; blades broadly ovate to subdeltoid, sparsely pilose above and 
below, lower surfaces densely glandular-punctate, the margins serrulate 
and minutely pubescent. Spikes terminal, interrupted, 25-35 cm long; 
peduncles 7-8 cm long, the rachis with glandular-trichomes 1-2 mm 
long. Floral bracts ovate, soon deciduous. Flowers mostly arranged 6 
to a node, the nodular gaps 2-6 cm long. Calyces (flowering) ca 5 mm 
long, glandular-pubescent, the upper lip 5-nerved. Corollas blue, 10- 
12 mm long; tubes 6-8 mm long; upper lip ca 3 mm long, sparsely 
pubescent apically with minute hairs, the lower portion essentially 
glabrous. Stylar shaft flattened, densely pilose apically, the upper 
branches 2-3 times as long as the lower, deltoid, branches. Mature 
nutlets not observed. 

TYPE: MEXICO. DURANGO: Mpio. El Salto, El Salto, pine-oak 
forests, 8250 ft, 4 Aug 1970, Kathy Shannon 94 (Holotype: TEX). 



Phytologia (December 2009) 91(3) 453 



T.P. Ramamoorthy (by annotation) was the first to suggest 
novelty status for the present collection. I originally identified the plant 
as 5. priinifolia Fernald (= 5. sinaloensis in the present account), but 
additional study has led me to concur with the observation of my 
erstwhile colleague, Ramamoorthy, who has moved on to non-botanical 
pursuits. 

The species is named for Dr. Paul Waller of Austin, Texas, 
loving mate of my son. Matt Turner, who accompanied me on a trip to 
Puerto Vallarta to collect the taxon. Unfortunately, time did not permit 
the venture concerned, mainly because our time was expended in 
collecting material of Verhesina jimrobbinsii B.L. Turner (Phytologia 
90: 52-62. 2008), the latter eponym honoring the previous partner of 
my son Matt, the four of us enjoying a four-day trip to the area 
concerned. 



SALVIA PRUNELLOIDES Kunth, Nov. Gen. Sp. PI. 2: 289. 1817. 
Map 6. 

Salvia rhombifolia Sesse & Moc. 
Salvia trichandra Briq. 

Mic, Mex, Mor and Pue, pine-oak forests, 1500-3400 m; 
flowering: Sep-Oct. 

Perennial rhizomatous herbs to 30 cm high, having terminal interrupted 
eglandular spikes 20-30 cm long. 

According to Epling (1938), This taxon "Passes almost 
imperceptively into S. laevis and S. pseiidocomosa on the one hand and 
5. glechomifolia on the other." 



SALVIA PUSILLA Fernald, Proc. Amer. Acad. Arts 35: 495. 1900. 
Map 6. 

Oax and Cps, pine-oak forests, 1200-2500 m; flowering: Jul- 
Sep. 

Perennial, rhizomatous, sprawling herbs 10-30 cm high; leaves ovate to 
subdeltoid, the petioles 2-15 mm long; readily recognized by its short 
corolla tubes and glandular-pubescent stems and calyces. 



454 I'hMoloi^ia (I)ccniihcr 2009) 9I{3) 



SALVIA ROSTKLLATA Hpling. Report. Spec. Nov. Regni Veg, 
Beih. 110:66. 1938. Map 2. 

Jul. vicinity of San Sebastian, ca 1500 m; flowering: Jan. 
A poorly known laxon, perhaps not separable from S. shialocnsis. 

SALVIA SKTULOSA Fernald, Proc. Ainer. Acad. Arts 36: 499. 1901. 
Map 7. 

Mic, Mex, Mor, Cue? and Oax, pine-oak forests, 2000-3000 
m; flowering: Jul-Oct. 

Perennial, rhizomatous, herbs to 60 cm high. A widespread, highly 
variable, species, best recognized by its elongate spikes, large floral 
bracts, and setulose pubescence. 



SALVIA SINALOENSIS Fernald, Proc. Amer. Acad. Arts 35: 502. 

1900. Map 9. 

Salvia pruiiifolia Fernald 

Sin, Dur, Nay and Jal, pine-oak forests, 1 200-2000 m; 
flowering: Aug-Sep. 

Sprawling or semi-prostrate perennial herbs to 60 cm high; leaves 
highly variable, ovate to oblanceolate, the petioles mostly 2-10 mm 
long; calyces glandular-pubescent, the corollas blue. 

I follow the suggestions of Epling (1939), that S. prunlfolia is 
possibly a synonym of the present taxon. See additional comments 
under S. assurgens (above). It is also likely that S. rosiellata is part of 
the fabric of S. sinaloensis, as noted under the latter. 

SALVIA TEXTITLANA B.L. Turner, sp. nov. Fig. 5, Map 8. 

Salviae triciispidatae Mart. & Gal. similis sed differt foliis 
longioribus majoribus laminis ovatis 3-7 cm longis (vs. laminis 
subdeltoideis 2-3 cm longis) subter valde pubescentibus et tubis 
corollarum 5-6 mm longis (vs. 7-8 mm). 

Perennial herbs 50-100 cm high. Mid-stems pubescent with arcuate, 
down-turned white hairs. Leaves mostly (4)5-8 cm long, 2-3 cm wide; 



Phytologia (December 2009) 91(3) 455 



petioles 1.5-3.0 cm long. Capitulescence a terminal interrupted spike 
1-30 cm long: peduncles 2-3 cm long; rachis pubescent with both 
glandular and eglandular hairs. Flowers 4-10 to a node, the nodal gaps 
1-3 cm long. Floral bracts broadly oxate, soon deciduous. Calyces 
(flowering) 3-4 mm long, glandular-pubescent, the upper lip 5-7 
nervate. Corollas reportedly blue or "morado:" tubes 5-6 mm long, the 
lower lip ca as long as the upper, both lips markedly beset with amber 
globules. Stamens inserted at the throat; stamens purple, ca 1 m long. 
Stylar shafts flattened, densely pilose apically, the upper branch 2-3 
times as long as the lower, deltoid, branch. Nutlets ovoid, ca 2 mm 
long. 1.5 mm across, the coats smooth, pale tan. 

TYPE: MEXICO. OAXACA: Mpio. Santiago Textitlan, "Paraje 
abajo de El Portillo." 16 43 52 N. 97 24 57.6 W, pine-oak forests, ca 
1199 m, 8 Jan 2007. Idalia Tnijillo Olazo 1334 (Holotype: TEX; 
isotype: MEXU). 

ADDITIONAL SPECIMENS EXAMINED: MEXICO. OAXACA: 
Mpio. Santiago Textitlan, "La Cueva." 16 45 1 1.5 N, 97 12 44.8 W, 
ca 2148 m, 7 Sep 2006, Marcos 474 (TEX); "Paraje Tierra Morada." 16 
43 44.3 N, 97 25 2.2W, ca 1792 m, 8 Jan 2007. Olazo 1286 (TEX); 
Tierra Blanca." ca 2299 m, 22 Jan 2007, Salinas 1492 (TEX). 

This novelty is clearly closely related to the more northern 
Salvia tricuspidata. to which it is compared in the above diagnosis. It 
differs in having larger, lanceolate, leaves which are densely pubescent 
beneath, mainly along the major veins (vs smaller, more nearly 
subdeltoid blades which are glabrous beneath or nearly so). In addition, 
the flowers are somewhat smaller. 

The species is named, in part, for the Mpio. Santiago 
Textitlan. whence the type. 

SALVIA TRICUSPIDATA Mart. & Gal., Bull. Acad Brux. 11: 78. 
1814. Map 8. 

Oax, pine-oak forests. 2500-3000 m; flowering: Aug-Nov. 
Suffruticose herbs 30-70 cm high, the leaves broadly ovate to 
subdeltoid; calyces purple, glandular-pubescent, 5-6 mm long; corollas 
blue, 12-16 mm long. 



456 Phxioloiiia (Dcceniher 2009) 91(3} 



SALVIA UNICOSTATA Fernald. Proc. Amer. Acad. Arts 35: 501. 
1900. Map 5. 

Nue, Tarn and San. pine and pine-oak fore.sts, 2500-3600 m; 
flowering: May-Jul. 
Small herbs with slender rhizonies, mostly 10-30 cm high. 

According to Epling ( 1939), "save in the glandular pubescence 
of the inflorescence," this species scarcely differs from some narrow 
leafed forms of 5. laevis. 

SALVIA VERONICIFOLIA A. Gray ex S. Wats., Proc. Amer. Acad. 
Arts 22: 144. 1887. Map 4. 

Jal, known only from the vicinity of Guadalajara, oak forests, 
mainly in granitic or sandy soils, 1000-1200 m; flowering: Jul-Aug. 
Perennial herbs 10-30 cm high; readily recognized by its small ovate 
leaves with short petioles, and especially by its pubescence: stiffly 
spreading, glandular, trichomes ca 2 mm high. 

SALVIA VILLOSA Fernald, Proc. Amer. Acad. Arts 35: 518. 1900. 
Map 9. 

San, known only from the vicinity of Guadalcazar, dry oak 
forests, ca 1800 m; flowering: Jul-Sep. 

Rhizomatous herbs to 30 cm high, the stems markedly \illous with 
glandular hairs. 

Because of its distinctive pubescence and deep blue flowers, a 
very distinct species, not likely to be confused with another. 

ACKNOWLEDGEMENTS 

Guy Nesom provided the Latin diagnoses and reviewed the 
paper, for which I am beholden. Jesus Gonzales and Pablo Carrillo 
Reyes of GUADA provided helpful input with respect to S. 
chazaroana. I am also grateful to Jim Robbins, Paul Waller, and my 
son Matt Turner for assistance on field work in Mexico during the fall 
of 2007. 



Phytologia (December 2009) 91(3) 



457 



LITERATURE CITED 

Epling, C. 1939. A revision of Salvia subgenus Calosphace. Repert. 

Spec. Nov. Regni Veg. Beih. 1 10: 1-383. 
Flores, T. 1938. La zona carbonifera de Tlacolulan, Veracruz Bol. Soc. 

Mex. Geogr. 10: 189-202. 



,-.^. 



'L 



"S.,,X 



-..r 



H 



-M 1 ? 



h.. jJ. I 



• rrTr 



W \ 



w 



SALVIA 

if arizonica 
c indigocephala 
• forreri 
O oreopola 



Map 1 



I ri 












458 



Ph\t(>l(>i>ia {December 2009) 91(3) 




SALVIA 
• assurgens 
H hamulus 
O rostellata 

•k lozani 



Map 2 



1MI% 




'->>-'- 




SALVIA 

* chazaroana 

• glechomlfoiia 

Map 3 



Phytologia (December 2009) 91(3) 



459 




460 



Phytoloi^ia (December 2009) 91(3) 




SALVIA 

ic manantlanensis 
• setulosa 



Phytologia (December 2009) 91(3) 



461 




462 



riivioloi^ia (Dcci'inhcr 2()<N) 9/(.?j 




Fig. 1. Salvia chazaroana (Isotype: TEX). 



Phytologia (December 2009) 91(3) 



463 




Fig. 2. Salvia galloana (Holotype: TEX). 



464 



Phxioloi^ia (Dcccmhcr 2009) 91(3) 




Fig. 3. Salvia novoleontis (Holotype: TEX). 



Phxroloqia (December 2009) 91(3) 



465 



tf 




•lU MeX(CA-VA 



mil 111! I 



Fig. 4. Salvia pauhvalleri (Holotype: TEX). 



466 



Plwtoloiiia (December 2009) 91(3) 




Fig. 5. Salvia textitlana (Holotype TEX). 



Phytologia (December 2009) 91(3) 467 



TAXONOMIC OVERVIEW OF LIGUSTRUM (OLEACEAE) 
NATURALIZAED IN NORTH AMERICA NORTH OF MEXICO 

Guy L. Nesom 

2925 Hartwood Drive 

Fort Worth, TX 76109, USA 

www. guynesom.com 

ABSTRACT 

A key, morphological descriptions, and basic synonymy are 
provided for the eight species of Ligustrum known to be naturalized in 
North America north of Mexico: L. japonicum, L. lucidum, L. 
obtusifoliwn (including L. amiirense), L. ovalifolium, L. quihoui, L. 
sinense, L. tschonoskii, and L. vulgare. Identifications have been 
inconsistent particularly between L. sinense and L. vulgare and between 
L. japonicum and L. lucidum. The occurrence of L. quihoui outside of 
cultivation in Arkansas, Mississippi, and Oklahoma is documented. 
Phytologia 91(3): 467-482 (December, 2009). 

KEY WORDS: Ligustrunu Oleaceae, North America, naturalized, 
taxonomy 



The lustrous, mostly evergreen leaves and masses of white, 
fragrant flowers make privets popular for landscaping and hedges. 
Many of the species, however, have become naturalized in the USA and 
Canada and already have proved to be destructive colonizers, especially 
in the Southeast. Among the naturalized species, European privet 
{Ligustrum vulgare) is native to Europe and northern Africa; all the rest 
are native to Asia, mainly China, Japan, and Korea. 

Many new species and varieties of Ligustrum have been 
described since overviews of Koehne (1904), Lingelsheim (1920), and 
Mansfield (1924). The genus in eastern Asia has recently been studied 
by Chang & Miao (1986), and Qin (2009) has provided a taxonomic 
overview of the whole genus that recognizes 37 species - divided into 
five sections based primarily on fruit and seed morphology. In Qin's 
arrangement, among the North American species, sect. Ligustrum 



468 Plwtoloiiia (December 2009) 91(3) 



includes L. obtusifoHitm. L. ovalifoHiiin, L. ischonoskii, and L. vulgare; 
sect. Liicida X.K. Qin includes L. Imiduin and L. quilumi; and sect. 
Sinensia X.K. Qin includes L. japonic iiiii and /,. siiwnse. 

Hardin (1974) provided a key covering essentially the same 
species treated here but his couplets emphasized floral characters, 
which are often unavailable, and descriptions were not given. 
Characters of leaf persistence in Ligustrum also are difficult to evaluate, 
since almost all of the species are evergreen to some extent, at least in 
the southeastern USA. Leaves of some species are unambiguously 
evergreen, e.g., Ligiistrum japonicum and L. lucidiun. In others, leaves 
are thinner, though they may remain green and persistent through the 
winter, and are characterized here as "deciduous to half-evergreen" or 
"half-evergreen to evergreen." Some of the variability in leaf 
persistence, as well as in other features, within species may reflect 
genotypic variation among cultivars of different provenance, especially 
within L. sinense (see comments below). Variegated leaves occur in 
some of the species and many of these forms have been named as 
varieties or forms or given horticultural designations. 

The present overview is provided toward clarification of 
identifications, nomenclature, and geographical ranges prior to 
publication of the FNANM treatment of Oleaceae. Citations of states 
are records from specimens studied, except as specifically noted. 
Citations of phenology, ecology, and distribution generally follow FNA 
format. Without having studied types, the synonymy given here 
reflects apparently unambiguous consensus in literature, unless noted 
otherwise. The synonymy here is not complete, but no comparable 
summary appears to be available. Synonymy in Chang & Miao ( 1986) 
and Qin (2009) is minimal. 

KEY TO LIGUSTRUM SPECIES NATURALIZED IN NORTH 
AMERICA NORTH OF MEXICO 

1. Leaves (3-)4-13(-15) cm long. 

2. Leaves mostly (3-)4-8(-9) cm, primary lateral veins 3-5 pairs, 
apex acute to abruptly acuminate, abaxial midvein covered by 



Phytologia (December 2009) 91(3) 469 



epidermis; flowers short-pedicellate on pedicels 0.5-2 mm; corolla 

tube hardly exserted from calyx and ca. equal lobe length 

1 . Ligustrum japonicum 

2. Leaves (4.5-)6-13(-15) cm, primary lateral veins (5-)6-8 pairs, 
apex usually long-acuminate, abaxial midvein not covered by 
epidermis; flowers subsessile on pedicels 0-0.5 mm; corolla tube 
distinctly exserted from calyx and ca. 2 times longer than lobes 
2. Ligustrum lucidum 

1. Leaves 1.5-6(-6.5) cm long. 

3. Branchlets completely glabrous, usually glossy 
6. Ligustrum ovalifolium 

3. Branchlets minutely hirtellous, hirsute-hirtellous, or hirsutulous, 
dull. 

4. Leaf blades sparsely to moderately hirsutulous to hirsute- 
strigose on both surfaces, sometimes only along the veins, 
sometimes mostly near the margins, margins appressed-ciliate, 
primary lateral veins (5-)6-8 pairs, apices sharply acute and 
usually at least slightly acuminate, rarely obtuse 

8. Ligustrum tschonoskii 

4. Leaf blades glabrous on both surfaces or sometimes sparsely 
hairy along the abaxial midvein, sometimes minutely and 
indistinctly hirtellous adaxially, margins glabrous to glabrate, 
primary lateral veins (2-)3-6 pairs, apices obtuse to acute [L. 
viilgare) or obtuse to rounded, rarely slightly retuse. 

5. Leaf blades narrowly oblong-elliptic to oblanceolate- 
elliptic, oblanceolate or narrowly obovate, usually broadest 
slightly above the middle; inflorescence usually of stiffly 
spreading, narrowly cylindric branches, flowers sessile to 
subsessile in verticil-like clusters 

3. Ligustrum quihoui 

5. Leaf blades variously shaped; inflorescence broadly 
cylindric to pyramidal, flowers sessile to pedicellate in 
columnar to broadly cylindric or narrowly pyramidal to open- 
pyramidal panicles of cymes. 



470 Plixtoloi^ia (Dcccmher 2009) 91(3) 



6. Inflorescence diffuse and open panicles terminal and on 
lateral branches interspersed with non-tlovvering 
branches; corolla tube slightly shorter than lobes, usually 
barely exserted from the calyx tube. 4. Lij^ustrum sinense 
6. Intlorescence terminal, mostly a coiiii)act panicle; 
corolla tube equal or longer than tlic lobes, distinctly 
exserted from the calyx tube. 

7. Branchlets hirsute-hirtellous with hairs of uneven 
length; leaf blade apices asdfasdf; corolla tube 1.5-3 

times longer than the lobes 

7. Ligustrum obtusif'olium 

7. Branchlets glabrous to evenly and minutely 
hirtellous to hirsutulous with straight to upcurved hairs 
of relatively even length; leaf blade apices obtuse to 
acute; corolla tube equal the lobes or slightly shorter 
5. Ligustrum vulgare 



1. Ligustrum japonicum Thunb., Nova Acta Regiae Soc. Sci. Upsal. 

3:207. 1780. 

Ligustrum Japonicum var. rotundifolium Blume, Mus. Bot. Lugd.-Bat. 

1:313.1850. 

Ligustrum coriaceum Carriere, Rev. Hort., 418, plate 56. 1874. 

Ligustrum lucidum var. coriaceum (Carriere) Decne., Fl. Serres 22: 8. 

1877. 

Ligustrum japonicum war. pubescens G. Koidzumi, Bot. Mag. (Tokyo) 

30:82. 1915. 

Ligustrum japonicum var. crassifolium Hisauchi, J. Jap. Bot. 1 1: 848. 

1935. 

Ligustrum japonicum var. pricei (Hayata) T.S. Liu & J.C. Liao, Quart. 

J. Taiwan Mus. 31: 292. 1978. 

Shrubs or small trees 1^ m. Branchlets usually glabrous or 
sometimes minutely puberulent. Leaves evergreen; blades broadly 
ovate to elliptic-ovate, (3-)4-8(-9) cm x 22-50 mm, glabrous, primary 
lateral veins 3^(-5) pairs, abaxial midvein covered by epidermis, apex 
acute to abruptly acuminate, margins glabrous. Inflorescence terminal, 
broadly pyramidal, 6-15 cm. Flowers short-pedicellate, pedicels 0.5-2 
mm, glabrous; calyx glabrous; corolla tube equalling or slightly longer 



Phywlogia (December 2009) 91(3} 47 1 



or shorter than lobes, lobes reflexing and not reaching calyx or barely 
so. Drupes globose to oblong or slightly ellipsoid. 7-8 mm; seeds 1-2, 
endocarp stony, not channeled. 2n = 22. 44. 46. Japanese Privet 

Flowering Apr-Jun. Fencerows, lots, woods edges; 10-300 
m: Ala.. Ark.. Fla.. Ga.. La., Miss., S.C, Tenn., Tex., Va.: native to 
Japan and Korea; introduced also in West Indies (Puerto Rico), Africa, 
Australia. Pacific Islands (Hawaii). The PLANTS Database (USDA, 
NRCS 2009) shows L. japoniciim in Md. and N.C., and Calflora 
(wvvw.calflora.org) has records for California. 

Ligiistrum japonicum occasionally establishes itself outside of 
cultivation, but it is not nearly as common or invasive, or as fecund, as 
L. liicidwn. As noted by Jefferson (1976), L. japonicum is hardy into 
New England, while L. hicidum usually is not hardy north of 
Washington. D.C. 

2. Ligustrum lucidum W.T. Alton. Hort. Kew. (ed. 2) 1: 19. 1810. 
Ligustrum japonicum var. macrophyUum Decne.. Fl. Serres 22: 8. 1877. 

Shrubs or small trees 2-5+ m. Branchlets glabrous. Leaves 
evergreen; blades ovate to elliptic-ovate, ovate-lanceolate, or elliptic, 
(4.5-)6-13(-15) cm x 25-55(-62) mm, glabrous, primary lateral veins 
(5-)6-8 pairs, abaxial midvein not covered by epidermis, apex long 
acute-acuminate or less commonly acute (in smaller leaves), margins 
glabrous. Inflorescence terminal, broadly pyramidal. 7-16(-20) cm. 
Flowers sessile to subsessile. pedicels 0-0.5 mm. glabrous; calyx 
glabrous; corolla tube about equal or slightly shorter than the lobes. 
Drupes globose to depressed-globose, sometimes curved-obovoid or 
reniform. 5-9(-10) mm; seeds l-2(-3), endocarp stony, with several 
longitudinal channels. 2n = 46. Glossy Privet, Broad-leaf privet 

Flowering Apr-Jun. Fencerows, lots, waste areas, deciduous 
woods, woods edges; 10-300 m; Ala., Ark., Calif., Fla., Ga., La., Md., 
Miss., N.C., S.C, Tex.; native to China; introduced also in Mexico 
(Coahuila, San Luis Potosi, Veracruz), West Indies (Puerto Rico), 
South America (Brazil), Europe (Portugal), Africa, Asia, Australia, 
Pacific Islands (Hawaii). 

In Texas, Louisiana, and southern Arkansas, at least, 
Ligustrum lucidum is becoming a highly invasive weed, commonly 
seen as multi-stemmed clumps, in Texas commonly up to 4 or 5 meters 



472 rhyioloi^id {Dcccnihcr 2()()^Jj y/(.?j 



tall. Jefferson ( 1976) included a photo of an arboretum plant in Areata. 
California, that appears to be about \5 meters. Collections with small 
leaves sometimes are misidentified as L. Japonlcuni, but blades of 
smaller leaves of L. lucidum are usually more ovate with 5(-6) pairs of 
lateral veins. Smaller leaves commonly are produced on plants bearing 
much larger ones. 

A recently described variety of Ligusiniiii lucidum from China 
(var. xidci'iisc J.L. Liu; Liu 2004) is said to differ from typical plants in 
its narrower (0.6-3.7 cm wide), lanceolate to elliptic-lanceolate leaves 
with fewer pairs of primary lateral veins (2-5(-6) pairs). 

3. Ligustrum quihoui Carriere, Rev. Hort. 1869: 377. 1869. 
Ligusirum hnuhystachyum Decne., Nouv. Arch. Mus. Hist. Nat. Ser. 2, 
2: 34. 1879. 

Shrubs 1-3 m. Branchlets below the inflorescence minutely 
puberulent to hirtellous in 2 lines, or evenly puberulent to hirtellous 
proximally and distally. Leaves half evergreen to evergreen; blades 
narrowly elliptic, rhombic-elliptic, oblanceolate-elliptic to obovate- 
elliptic, oblanceolate, or narrowly obovate, mostly commonly broadest 
slightly above the middle, often slightly falcate, (1.5-)2^.5(-5.5) cm x 
5-15(-25) mm, glabrous or rarely puberulent along the abaxial 
midvein, primary lateral veins 2-A{-5) pairs, very rarely (5-)6-8(-9) 
pairs, abaxial midvein not covered by epidermis, apex usually acute but 
obtuse to rounded or slightly retuse in broadest blades, margins 
glabrous. Inflorescence terminal on stiffly spreading, narrowly 
cylindric lateral branches, 4-15(-22) cm, less commonly with sessile 
flowers on short branches spreading from a central axis and the whole 
inflorescence appearing narrowly pyramidal and terminal, 8-20 cm. 
Flowers sessile to subsessile, usually in verticil-like clusters along the 
inflorescence axis, pedicels 0-0.5(-l) mm, puberulent; calyx glabrous; 
corolla tube ca. equal the lobes. Drupes obovoid or ellipsoid to 
subglobose, 4-7(-9) mm; seeds 1-2, endocarp stony, with several 
longitudinal channels. 2n = '? Waxy-leaf Privet 

Flowering May-Jul. Fencerows, lots, waste areas, roadsides, 
deciduous woods, woods edges, thickets, creek banks; 10-300 m; Ark., 
Fla., Md., Miss., N.C., Okla., Tex., Va.; native to China. 

Ligustrum quihoui is recognized by its stiffly spreading 
branches, narrowly cylindric inflorescence branches with flowers in 



Phywlogia (December 2009) 91(3) 473 



verticil-like clusters, and relatively thick, deep green, rhombic-elliptic 
to oblanceolate-elliptic or obovate-elliptic leaves. It is not often 
misidentified. At least in Travis, Tarrant, and Dallas counties, Texas, it 
is an extremely aggressive colonizer capable of forming dense thickets. 
First records for the species naturalized in Mississippi and 
Oklahoma are recorded here: 

Mississippi. Pike Co.: beside US Hvvy 98 at McComb, 20 Jun 1969, 
R.D. Thomas 74779 (NLU). 

Oklahoma. Cleveland Co.: [Norman], Sutton Urban Wilderness Park, 
edge of larger lake, edge of low woods, common, 5 Jun 1996, Folley 
1830 (OKL). The Arkansas record is documented here: Pulaski Co.: 
Allsopp Park - south unit, naturalized in mixed pine-oak-hickory forest 
on shale and sandstone substrate, especially along trails, T. Witsell 03- 
0007 with J. Peck (UARK). Good photos of Arkansas plants of 
Ligiistrum qiiihoiii, as well as other privets, are shown by Serviss 
(2009). 

4. Ligustrum sinense Lour., Fl. Cochinch. 1:19. 1790. 

Shrubs l-3(-6) m, aggressively colonial from root sprouts. 
Branchlets minutely hirtellous to hirsutulous or substrigose with 
straight or upcurved hairs sometimes of uneven length. Leaves half 
evergreen to evergreen; blades broadly elliptic or ovate-elliptic to 
oblong-ovate, elliptic-lanceolate, or suborbicular, (1.5-)2-4 cm x 10- 
20 mm, glabrous except for sparsely hirsutulous to puberulent abaxial 
midvein, sometimes minutely and indistinctly hirtellous adaxially, 
primary lateral veins (3-)4-5 pairs, abaxial midvein not covered by 
epidermis, apex obtuse to rounded or retuse, margins glabrous to 
glabrate. Inflorescence diffuse and open-pyramidal, 4-1 1 cm, usually 
numerous on lateral branches commonly leafless or few-leaved at base, 
flowering lateral branches interspersed with non-flowering branches. 
Flowers pedicellate, pedicels 1-5 mm, glabrous; calyx glabrous to 
sparsely puberulent; corolla tube slightly shorter than lobes, usually 
barely exserted from the calyx tube. Drupes subglobose to obovoid, 
(4-)5-7 mm; seeds 1, endocarp stony, not channeled. 2n = 46. 
Chinese Privet 

Flowering Apr-May(-Jun). Open and shaded disturbed areas, 
fencerows, river and stream floodplains, bottomland forests, lake 
shores, swamp and marsh edges, upland hammocks, pinelands; 10-300 
m; Ala., Ark., Conn., Fla., Ga., Ky., La., Md., Mass., Miss., Mo., N.J., 



474 Phvioloiiid (December 2009) 91(3) 



N.C., Okla., R.I., S.C., Tenn., Tex., Va.; native to China. Vietnam, and 
Laos; introduced also in West Indies, Mexico (Veracruz), Europe, 
Africa, Indian Ocean Islands, Australia, Pacific Islands. 

At least in North Carolina and Missouri, some plants 
identifiable as Liy,ustruni sinense have with elliptic-lanceolate leaf 
blades with acute apices and mostly terminal inflorescences, apparently 
lacking the numerous lateral tlowering branches. Vestiture on these 
plants is characteristic of the species elsewhere. In Louisiana and 
Texas, some populations produce leaves variably broadly to narrowly 
elliptic (tapering at both ends) and that also are variable in thickness. 

Following Hao and Zhang (1993), Chang et al. (1996) 
recognized 8 varieties of Ligiistrum sinense based on variation in 
vestiture, leaf shape and other foliar features, and position and leafiness 
at base of the inflorescence. The biological reality of these taxa is not 
clear, however, since all except var. coryanum (W.W. Smith) Hand.- 
Mazz. appear to be sympatric with the widespread var. sinense. Plants 
in the USA appear to have a mixture of features characterizing var. 
myrianthum (Diels) HoefTcer (panicles axillary or rarely terminal, not 
leafy at base, or rarely leafy; leaf veins usually not sunken adaxially; 
calyx glabrous) and var. sinense (branchlets and inflorescence rachis 
usually densely pubescent or pilose; leaf blades ovate to oblong or 
suborbicular, sparsely pubescent or glabrescent abaxially). 

5. Ligustrum vuigare L., Sp. PI. 1: 7. 1753. 

Shrubs 1.5-5 m. Branchlets glabrous to evenly and minutely 
hirtellous to hirsutulous with straight to upcurved hairs of relatively 
even length. Leaves half evergreen to evergreen; blades elliptic- 
lanceolate to elliptic-ovate, 3-5.5(-6) cm x 10-25 mm, glabrous except 
for the abaxial midvein sometimes with a few scattered hairs, primary 
lateral veins 4-6 pairs, abaxial midvein not covered by epidermis, apex 
obtuse to acute, margins glabrous to glabrate. Inflorescence terminal, 
compactly narrowly pyramidal to broadly cylindric, 4.5-5.5 cm. 
Flowers short-pedicellate, pedicels 0.5-1 mm, minutely hirtellous; 
calyx glabrous; corolla tube equal the lobes or slightly shorter. Drupes 
globose, 4-6 mm; seeds 2^, endocarp membranaceous, not channeled. 
2/7 = 46. Common Privet, European Privet 

Flowering (May-)Jun-Jul. Fencerows, thickets, roadsides, 
disturbed sites, open woods; 50-500(-1600 in western states) m; B.C., 



Phytologia (December 2009) 91(3) 475 



Ont.; Ark.. Calif., Conn., Ga., Idaho, 111., Ind., Ky., Me., Md., Mass., 
Mich., Mo., N.H., N.J., N.Y, N.C., Ohio, Oregon, Pa., R.I.. Vt., Va., 
W.Va.; native to Europe and northern Africa; introduced also in South 
America (Ecuador), Asia (Japan), Africa, Pacific Islands (New 
Zealand), Australia. The PLANTS Database also records the presence 
of L. vulgare in (eastern USA) Ala., Del., D.C., 111., Iowa, La., S.C, 
Tenn., Tex., and Wis. and (western USA) Colo., Mont., Nebr., N.Mex., 
and Utah. In the present study, no collections of L. vulgare have been 
seen among many of the genus studied from Alabama, Louisiana, 
Tennessee, and Texas, and it is unlikely that the species is naturalized 
in those states. 

6. Ligustrum ovalifolium Hassk., Cat. Hort. Bot. Bogor. 1 19. 1844. 
Ligustrum japonicum var. ovalifolium (Hassk.) Blume, Mus. Bot. 

Lugd.-Bat. 1:313. 1850. 
Ligustrum californicum Decne., Fl. Serres 22: 5. 1877. 
Ligustrum medium Franch. & Sav., Enum. PI. Jap. 2: 437. 1878. 

Shrubs 2-5 m. Branchlets glabrous-shiny, rarely hirtellous 
in lines. Leaves half evergreen to evergreen; blades ovate to elliptic- 
ovate, broadly elliptic, or elliptic, 2.5-5(-6.5) cm x 15-33 mm, 
glabrous, primary lateral veins (2-)3-6 pairs, apex acute to abruptly 
acuminate, margins glabrous. Inflorescence subcylindric to narrowly 
to broadly pyramidal, 4-7 cm. Flowers short-pedicellate, pedicels 0.5- 
1 mm. glabrous; calyx glabrous; corolla tube 2-3 times longer than 
lobes. Drupes ovoid. 6-8 mm; seeds l(-2), endocarp stony, not 
channeled. 2n = 22, 46. California Privet 

Flowering (Dec)Apr-JuI. Fencerows, thickets, roadsides, 
disturbed sites; 100-600 m; Ala., Fla., Ga.. Ky., Md., Mich., Mo., N.J., 
N.C., Ohio, Pa., Tenn., W.Va., Va.; native to Japan and Korea; 
introduced also in West Indies (Puerto Rico), Europe, Africa, Australia, 
Pacific Islands (New Zealand). The PLANTS Database also records 
the presence of L. ovalifolium in Ont., Calif., Conn., Del., D.C., Mass., 
and Tex. The record for Ontario is from a plant apparently persisting 
from cultivation (fide Luc Brouillet, 2009). I have not seen a voucher 
from Texas and its occurrence there outside of cultivation is unlikely. 

Three varieties within Ligustrum ovalifolium were recognized 
by Noshiro (1985). each restricted in native range to Japan. Var. 
hisauchii (Makino) S. Noshiro has leaves sparsely hairy along the 



476 Phyioloiiia (December 2009) 91(3) 



abaxial midvein; var. pacificnin (Nakai) Mi/iishiina is an insular entity 
with slightly larger leaves and shorter corolla tubes. 

Ligiistnim ovalifoliuni, L. ohtusifoliiim and L. tschonoskii are 
the species naturali/.ed in the USA with corolla tubes longer than the 
lobes. Lii>ustn(in vuli>are also apparently is closely related to this 
group, although its corolla tubes are somewhat shorter. These four 
species can be distinguished by the following key. 

a. Branchlets glabrous, rarely hirtellous in lines, glossy; leaf blades with 
(2-)3-6 pairs of primary lateral veins Ligustrum ovalifoliuni 

a. Branchlets evenly hirsute-hirtellous or puberulent to pilosulous, dull; 
leaf blades with 4-8 pairs of primary lateral veins. 

b. Leaf blades sparsely to moderately hirsutulous to hirsute-strigose 
on both surfaces, sometimes only along the veins, sometimes mostly 
near the margins, margins appressed-ciliate; blade apices sharply 
acute and usually at least slightly acuminate, rarely obtuse; 

inflorescence terminal Ligustrum tschonoskii 

b. Leaf blades usually glabrous on both surfaces or sometimes 
sparsely hairy along the abaxial midvein, sometimes minutely and 
indistinctly hirtellous adaxially, margins glabrous; blade apices 
obtuse to rounded (L. obtusifolium) or obtuse to acute (L. viilgare); 
inflorescence terminal (L. vulgare) or terminal and axillary, 
commonly on lateral shoots (L. obtusifolium). 

c. Blade apices obtuse to acute; branchlets glabrous to evenly and 
minutely hirtellous to hirsutulous with straight to upcurved hairs 
of relatively even length; inflorescence terminal, compactly 
narrowly pyramidal to broadly cylindric 

Ligustrum vulgare 

c. Blade apices obtuse to rounded, sometimes slightly retuse; 
branchlets hirsute-hirtellous with hairs of uneven length; 
inflorescence terminal or terminal and axillary, commonly on 
lateral shoots, columnar to narrowly pyramidal 
Ligustrum obtusifolium 

7. Ligustrum obtusifolium Sieb. & Zucc, Abh. Math.-Phys. C. 

Konigl. Bayer. Akad. Wiss. 4: 168. 1846. Ligustrum ibota 



Phytologia (December 2009) 91(3) All 



var. obtiisifoUiim (Sieb. & Zucc.) G. Koidzumi. Bot. Mag. 

(Tokyo) 40: 342. 1926. 

Shrubs 2-3 mm. Branchlets hirsute-hirtellous with hairs of 
uneven length. Leaves deciduous to half evergreen; blades elliptic to 
ovate-elliptic, oblong-ovate, or elliptic-obovate, 2.5-6 cm x (8-) 12-26 
mm, glabrous or uncommonly sparsely puberulent to villous, primary 
lateral veins 4-7 pairs, abaxial midvein not covered by epidermis, apex 
obtuse to rounded, sometimes slightly retuse, margins glabrous to 
glabrate. Inflorescence terminal or terminal and axillary, commonly 
on lateral shoots, short-columnar or subcapitate to narrowly pyramidal, 
1.5-5 cm. Flowers subsessile to short-pedicellate, pedicels (0-)0.5-2 
mm. glabrous to hirtellous; calyx glabrous to hirtellous; corolla tube 
1.5-3 times longer than lobes. Drupes subglobose to broadly ellipsoid, 
5-8 mm; seeds 1, endocarp stony, not channeled. 

1. Leaf blades usually sparsely villous abaxially; calyx and pedicels 
densely to moderately or sparsely hirtellous, occasionally nearly 
glabrous; corolla tube 2-3 times longer than the lobes 

7a. L. obtusifolium var. obtusifolium 

1. Leaf blades usually glabrous abaxially; calyx and pedicels glabrous 
to very sparsely hirtellous; corolla tube 1.5-2 times longer than the 
lobes 7b. L. obtusifolium var. suave 

7a. Ligustrum obtusifolium \ ar. obtusifolium 

Ligustrum ohtusifoliitm var. leiocalyx (Nakai) H. Hara. J. Jap. Bot. 20; 
329. 1944. Ligustrum tschonoskii var. leiocalyx Nakai. Trees 
Shrubs Jap., 276. 1922. Ligustrum ibota var. leiocalyx (Nakai) 
Nakai, Trees Shrubs Jap. (prop. rev. ed.) 1: 365. 1927. 
Ligustrum obtusifolium f. leiocalyx (Nakai) G. Murata, Acta 
Phytotax. Geobot. 19: 71. 1962. 

Ligustrum regelianum Koehne in Urban et al., Festschr. Ascherson 192. 
1904 (non Lemoine ex Dippel [pro syn.], Handb. Laubholzk. 
1: 133. 1889). Ligustrum ibota var. regelianum {Koehne) 
Rehder in Bailey, Cycl. Amer. Hort. 2: 912. 1900. Ligustrum 
obtusifolium var. regelianum (Koehne) Rehder, Moller's 
Deutsche Gartn.-Zeit. 14: 218. 1899. 

Ligustrum obtusifolium var. velutinum (Blume) H. Hara, J. Jap. Bot. 20; 
329. 1944. Ligustrum obtusifolium f. velutinum (Blume) G. 



478 rhxroloi^id iDccvmhcr 2009) 9!(3) 



Murata, Acta Phytotax. Geobol. 19:72. 1962. Ligustrum ibota 

var. vi'luiiniini Blunic, Mus. But. Lugd.-Bat. 1: 312. 1850. 

Leaf blades usually sparsely villous abaxially; calyx and 
pedicels densely id moderately or sparsely hirtellous, occasionally 
nearly glabrous; c(.)rolla tube 2-3 times longer than the lobes. 2/7 = 46. 
Border Privet 

Flowering May-Jun. Fencerows, woods edges, roadsides, old 
home sites, disturbed sites; 100-600 m; Conn., 111., Ky., Md., Mass., 
Mich., Mo., N.J., N.Y., N.C., Ohio, Pa., R.I., Tenn., Va., W.Va.; native 
to Japan and Korea. The PLANTS Database also records the presence 
of var. ohtiisifoliiim in D.C., Iowa, Ind., N.H., N.J., and Vt. 

7b. Ligu.struiii ubtusifulium var. suave (Kitagawa) H. Hara, J. Jap. 

Bot. 20: 329. 1944. Ligiistnim ibota Sieb. & Zucc. var. suave 

Kitagawa, Bot. Mag. (Tokyo) 48: 612. 1934. Ligustmm 

obtiisifolium subsp. suave (Kitagawa) Kitagawa, J. Jap. Bot. 

40: 134. 1965. Ligustrum suave (Kitagawa) Kitagawa, Neo- 

Lineam. Fl. Mansh.,510. 1979. 
Ligustrum amurense Carriere, Rev. Hort. 1861: 352. 1861. Ligustrum 

ibota var. amurense (Carriere) Mansf., Bot. Jahrb. Syst. 59, 

132:65. 1924. 

Leaf blades usually glabrous abaxially; calyx and pedicels 
glabrous to very sparsely hirtellous; corolla tube 1.5-2 times longer 
than the lobes. In = 46. Amur Privet 

Flowering May-Jun(-Jul). Fencerows, old home sites, 
disturbed sites; 100-600 m; 111., Md., Mass., Tenn.; native to China and 
at least the Amur region of southeastern Russian. The PLANTS 
Database also records the presence of var. amurense in Ala., Ark., Ky., 
Md., Maine, N.J., N.Y., N.C., Pa., S.C, Tex., Va., and W.Va. 

Chang and Miao (1986) restricted the concept of native var. 
obtusifolium to Japan, var. suave to China, mostly as in the key above. 
They noted that typical L. obtusifolium is variable in calyx vestiture and 
recognized glabrous and hairy calyces within var. obutsifolium. In 
Japan, plants of L. obtusifolium with glabrous calyces occur with the 
typical (hairy) form and were identified by Ohwi (1965) as L. 
obtusifolium var. leiocalyx. In Madison Co., Kentucky, calyx vestiture 
in L. obtusifolium-Wke plants varies from glabrate (Taylor & Thompson 
1504, NLU) to minutely hispidulous {Taylor & Thompson 1504, NLU; 



Phytologia (December 2009) 91(3) 479 



Taylor 1446, NLU); in Oldham Co., Kentucky, a collection has hirsute 
calyces {Duncan 22754, NLU). 

Var. suave has generally been recognized at specific rank (as 
Ligustrum amurense) in the United States, differing from L. 
obtusifoliuni by its glabrous calyx and thicker, more persistent leaves 
(Bailey 1950; Hardin 1974; Gleason & Cronquist 1991). But because 
the density of calyx vestiture in typical L. obtusifolium is variable and 
assessment of leaf thickness usually is subjective and inconsistent, 
many identifications of L. obtusifolium and L. amurense probably have 
been confused. Chang and Miao (1986) noted that variation occurs in 
the Chinese populations and some plants of var. suave approach var. 
obtusifolium in corolla proportions and leaf vestiture. 

Ligustrum amurense was treated in the Flora of China (Chang 
et al. 1996) as L. obtusifolium subsp. suave, because of the recognition 
of yet another infraspecific taxon — L. obtusifolium subsp. 
microphyllum (Nakai) P.S. Green {L. ibota var. microphyllum Nakai), 
which occurs in China, Japan, and Korea. The plants are small shrubs 
with leaf blades 0.8-3 x 0.4-1.3 cm and have corolla tubes 2.5 times 
longer than the lobes. 

The status of Ligustrum ibota Sieb. & Zucc. of Japan and 
Korea is unresolved. Mansfeld (1924) treated L. obtusifolium and L. 
ibota as synonymous. When maintained as distinct from L. 
obtusifolium (e.g., Rehder 1940; Chang & Miao 1986; Qin 2009), L. 
ibota is said to differ in its shorter, nearly capitate inflorescence 
(flowers 4-8). Both species have variably hairy calyces. All or almost 
all of the GH collections originally identified as L. ibota are L. 
obtusifolium. 

a. Inflorescence 1.5-5 cm long; leaf blade apices usually obtuse; corolla 
tubes 6-7 mm long, lobes 2-3 mm long; calyx glabrous to hirsute 

Ligustrum obtusifolium 

a. Inflorescence 1.5-2 cm long; leaf blade apices usually acute; corolla 
tubes 5-6 mm long, lobes 1.5-2.5 mm long; calyx hirsute 

Ligustrum ibota 

Ligustrum ibota Sieb. & Zucc, Abh. Bayer. Akad. Wiss., Math.- 

Naturwiss. Abt. 4(3): 167. 1846. 

Ligustrum ciliatum Sieb. ex Blume, Mus. Bot. Lugd.-Bat. 1: 312. 1850. 

Ligustrum ibota var. ciliatum (Sieb. ex Blume) Decne., Nouv. 

Arch. Mus. Paris ser 2, 2: 18. 1878. Ligustrum ibota Sieb. ex 



480 Phxtoloi^ia (Pcccnihcr 2009 ) 91(3) 



Sieb. & Zucc. (Verh. Batav. Gen. 12: 36. 1830, nomcn nudum) 
is a synonym of L. obtusifoliiim (fide Rehder 1921 (p. 50); 
Chang & Miao 1986; Green 1995), in contrast to /.. ihota Sieb. 
& Zucc. 1846. In the Flora of Japan, Noshiro (1993), treated 
L. ibota Sieb. ex Sieb. & Zucc. (including L. cilialuni as a 
synonym) as a distinct species but nt)t L. ibota Sieb. & Zucc. 
8. Ligustrum tschonoskii Decne., Nouv. Arch. Mus. Hist. Nat. Ser. II, 
2: 18. 1879. Lii^itsiruni ibota var. ischonoskii (Dccne.) Nak'd'i, 
Fl. Kor. 2: 89. 1911. Ligiistrum ibota f. tschonoskii (Decne.) 
Nakai, Bot. Mag. (Tokyo) 32: 124. 1918. Ligustritm ciliatum 
var. tschonoskii (Decne.) Mansf., Bot. Jahrb. Syst. 59, 132: 67. 
1924. 
Ligiistrum acuminatum Kochne in Urban & K. Graebncr, Festschr. 
Ascherson, 201. 1904. 

Ligustriim macrocarpum Koehne in Urban & K. Graebner, Festschr. 
Ascherson, 201. 1904. Ligustrum acuminatum war. 
macrocarpum (Koehne) C.K. Schneid., 111. Handb. Laubholzk. 
2: 807. 1911. Ligustrum ciliatum var. macrocarpum (Koehne) 
Mansf., Bot. Jahrb. Syst. 59, 132: 68. 1924. 
Ligustrum tschonoskii var. glabrescens G. Koidzumi, Bot. Mag. 

(Tokyo) 30: 82. 1916. Ligustrum tschonoskii f. glabrescens 
(G. Koidzumi) G. Murata, Acta Phytotax. Geobot. 25: 35. 
1972. 
Ligustrum yesoense Nakai. Trees & Shrubs Jap., 278. 1922. 
Ligustrum kiyozumianum Nakai, Trees & Shrubs Jap. (rev. ed.), 376, 
fig. 177. 1927. 

Shrubs l-3(^) m. Branchlets puberulent to pilosulous. 
Leaves deciduous to half evergreen; blades elliptic to broadly elliptic, 
elliptic-obovate, or ovate-lanceolate, 2-5(-6) cm x 13-30 mm, sparsely 
to moderately hirsutulous to hirsute-strigose on both surfaces, 
sometimes only along the veins, sometimes mostly near the margins, 
primary lateral veins (5-)6-8 pairs, abaxial midvein not covered by 
epidermis, apex sharply acute and usually at least slightly acuminate, 
rarely obtuse, margins appressed-ciliate. Inflorescence terminal, 
broadly cylindric to pyramidal, 3-5 cm. Flowers subsessile to 
subsessile, pedicels 0-0.5(-l) mm, pilosulous; calyx glabrous; corolla 
tube 1.5-2 times longer than lobes. Drupes ovoid to globose, 6-8(-12, 
rarely) mm; seeds I (-2). endocarp stony, not channeled. 2n = 44, 46. 
Tschonosky Privet 



Phytologia {December 2009) 91(3} 481 



Flowering Jun-Jul. Deciduous woods; ca. 100 m; D.C.; native 
to Japan and Korea. 

Ligustriim tschonoskii is known in North America only from 
the woods along the bank of Rock Creek in Rock Creek Park (Shetler & 
Orli 2000). Two varieties within the species were recognized by 
Noshiro (1985), distinguished by slight and overlapping size 
differences. Var. tschonoskii is restricted in native range to Japan; var. 
kiyozKniianiim (Nakai) Ohwi occurs in Japan and Korea. 

ACKNOWLEDGEMENTS 

All North American collections were studied from BRIT- 
SMU. GH. MO. NLU, OKL, OKLA. TENN. TEX-LL. and VDB. 
Study of Asian specimens at GH and MO was especially helpful. Brent 
Baker provided the data on the Arkansas collection oi Ligustriim 
qiiihoui. I am grateful to Jim Zarucchi and the library staff at MO and 
to Dave Boufford and the library staff at the Arnold Arboretum for help 
with obtaming literature. I am grateful for a grant from the Hesler 
Fund, University of Tennessee at Knoxville, in support of study at 
TENN. This study was done as part of the work under contract for the 
Flora of North America Association, in conjunction with preparation of 
the FNA treatment of Ligustriim. 

LITERATURE CITED 

Bailey, L.H. 1949. Manual of Cultivated Plants (rev. ed.). The 

Macmillian Co., New York. 
Bailey. L.H. 1950. The Standard Cyclopedia of Horticulture. The 

Macmillan Co., New York. 
Chang, M.C. and B.M. Miao. 1985. New taxa of the genus Ligustriim 

(Oleaceae). Acta Phytotax. Sinica 23: 53-56. 
Chang, M.C. and B.M. Miao. 1986. Studies of the genus Ligustrum 

(Oleaceae) in East Asia. Invest. Stud. Nat. 6: 22-1 16. 
Chang, M.C, L.Q. Qiu, and P.S. Green. 1996. Ligustrum (Oleaceae). 

Flora of China 15:299-307. 
Gleason, H.A. and A. Cronquist. 1991. Manual of vascular plants of 

northeastern United States and adjacent Canada (ed. 2). New 

York Botanical Garden, New York. 
Green, P.S. 1995. Taxonomic notes relating to Ligustrum (Oleaceae). 

Kew Bull. 50: 379-386. 



482 Phxiolo^ia {Dcci'iuhcr 2009) 9/(3) 



Hao, S.J. and M.Z. Zhang. 1993. A taxononiic study of the 

intraspecific taxa of Ligiistrum sinense Lour. Guihaia 13: 

331-341. 
Hardin. J.W. 1974. Studies of the southeastern United States flora. IV. 

Oleaceae. Sida 5: 274-285. 
Jefferson, R.M. 1976. Differences between Ligustrum japonicum and 

L. lucidum. Amer. Nurseryman 144: 22, 72, 74, 76, 78. 
Kochnc, E. 1904. Ligustriini sect. Ihoiu. Mitt. Deutsch. Dendr. Ges. 

13:68-76. 
Lingelsheim, A. 1920. Olcaceae-Oleoideae-Fraxineae, Syringeae. 

Pflanzenr. IV, 243 (Heft 72): 1-125. 
Liu, J.L. 2004. A new variety of Ligustrum lucidum (Oleaceae) from 

Sichuan Province. Bull. Bot. Res. (China) 24: 130. 
Mansfeld, R. 1924. Vorarbeiten zu einer Monographic der Gattung 

Ligustrum. Bot. Jahrb. Syst. 59. Bcibl. 132: 19-75. 
Noshiro, S. 1985. Variations of Ligustrum ovali/olium and Ligustrum 

tschonoskii (Oleaceae) in the Southern Kanto District, Honshu, 

Japan. J. Jap. Bot. 60: 213-221, 239-242. 
Noshiro, S. 1993. Ligustrum, in Flora of Japan, Vol. 3 A 

(Angiospermae, Dicotyledoneae, Sympetalae): 131-135. 
Ohwi, J. 1965. Flora of Japan. Smithsonian Institution, Washington, 

D.C. 
Qin, X.-K. 2009. A new system of Ligustrum (Oleaceae). Acta Bot. 

Yunnanica 31: 97-1 16. 
Rehder, A. 1921. New species, varieties and combinations from the 

herbarium and the collections of the Arnold Arboretum. J. 

Arnold Arb. 3: 11-51. 
Rehder, A. 1940. Manual of Cultivated Trees and Shrubs (ed. 2). The 

Macmillian Co., New York. 
Serviss, B.E. 2009. Non-native woody plants of Arkansas. 

<http://www.hsu.edu/default.aspx?id=2543> 
Shetler, S.G. and S.S. Orli. 2000. Annotated checklist of the vascular 

plants of the Washington-Baltimore Area. D.C. Flora 

checklist <http://botany.si.edu/dcflora/Checklist/> 
USDA, NRCS. 2009. The PLANTS Database. National Plant Data 

Center, Baton Rouge, La. 

<http://plants.usda.gov> 
Wilson, K.A. and C.E. Wood, Jr. 1959. The genera of Oleaceae in the 

southeastern United States. J. Arnold Arb. 40: 369-384. 



Phytologia {December 2009) 91(3) 483 



ADDITIONS TO THE GENUS ORBIVESTUS H. Rob. 

(ASTERACEAErVERNONIEAE) AND NEOTYPIFICATION OF 

VERNONIA TEITENSIS O. HOFFM. 

Harold Robinson 

Department of Botany, MRC 166, National Museum of Natural 
History, P.O. Box 37012, Smithsonian Institution, Washington DC, 

20013-7012 

ABSTRACT 

Orbivestus H. Rob. is redefined as having divaricately seriate- 
cymose branching in the inflorescence. Eleven species are included, 
and five species, O. catumbensis (Hiem) H. Rob., O. leopoldii Vatke, 
O. teitensis (Hoffm.) H. Rob., O. titrbinata (Oliv. & Hiem) H.Rob., and 
O. unionis (Sch.Bip. ex Walp.) H. Rob. are added to the genus while V. 
undulata Oliv. & Hiem is provisionally rejected. Neotypes are selected 
for Vernonia teitensis Hoffm., V. johannis O. Hoffm. and V. pilgeriana 
Muschl., whose types were destroyed in Berlin. Phytologia 91(3): 483- 
493 (December, 2009). 

KEY WORDS: Orbivestus, Vernonia teitensis, neotypes, Africa, 
Vemonieae, Asteraceae. 



Previous attempts by the author to resolve the relationships of 
African Vemonieae have resulted in some over simplications 
(Robinson 1999) and left many of the species unresolved. The most 
recent efforts, presented here, have relied on a character previously 
noted mostly in Westem Hemisphere members of the tribe but rare in 
the Eastern Hemisphere. A related group of species is here recognized 
based on divaricately seriate-cymose branching of the inflorescence. 

The divaricate seriate-cymose branching of the ultimate 
branches of the inflorescence is almost unique in the tribe to New 
World members of the Vemonieae. As illustrated by Cabrera (1944), 
the seemingly sessile lower heads are not sessile, they are actually 
immediately subtended by lateral branches bearing successive heads. 
This particular form of inflorescence, referred to as subdichasioid by 



484 f'hyioloi^ia {December 2009) 91(3) 



Adams (1956). is unknown in all but the present group among Old 
World members of the Vernonieae. For purposes of comparison, the 
superficially similar Neotropical Vemondnihtira H. Rob. (1902) is the 
best choice. The African species studied here with divergent seriately 
cymose inllorescence branches differ from Vernonaniliura by the 
mostly membranous rather than centrally coriaceous involucral bracts, 
having a narrow median ridge instead of a broad shield, and having 
irregularly denticulate rather than entire margins. Internally, the corolla 
lobes of the African material totally lack the marked longitudinal 
resinous cells that are evident in Vernonanthura and its closest 
relatives. The achenes are 5-costate rather than 8-10 costatc. The 
raphids of the achene wall are narrowly rhomboid rather than 
subquadrate or shortly oblong. A final character of seemingly primary 
importance is in the sweeping hairs of the style. These hairs in the 
African species are almost totally restricted to the style branches. This 
is similar to other Old World Vernonieae and unlike the New World 
Vernonieae that have sweeping hairs clearly present on the upper style 
shaft below the branches. In this respect, the African group is like most 
other Old World Vernonieae that have sweeping hairs nearly or 
completely restricted to the style branches. Thus, in spite of the 
superficial similarity, the African and American entities are not here 
considered close relatives. 

Regarding the generic placement of the African group studied 
here, a more recently described African genus, Orbivestus H. Rob. 
(1999), as typified by Vernonia karagiiensis Oliv. & Hiem, shows the 
divergently cymose structure of the branches of the inflorescence that is 
characteristic of the present group. This characteristic was not 
appreciated at the time of the description of that African genus. 

The relationship Orbivestus to other African Vernonieae is not 
certain. Recent efforts have shown that many of the Tropical African 
Vernonieae are individually distinctive, and their generic dispositions 
remain to be established. One of the species included here, Vernonia 
leopoldii Vatke, was placed in the genus Hilliardiella H. Rob. by 
Robinson (1999). That is now seen as a mistake. Hilliardiella is from 
farther south in Africa, while V. leopoldii and its relatives are mostly 
central African, especially Ethiopian and Eritrean. Hilliardiella also 
lacks the branching in the inflorescence from immediately below the 
older heads. It has only 3-4 series of involucral bracts rather than 5-7, 
its corollas have numerous T-shaped hairs distally, the anthers lack tails 



Phytologia (December 2009) 91(3) 485 



at the bases of the thecae, while Orbivestus has well-developed tails, 
and the pappus bristles of HilUardiella are not flattened on the outer 
surface as they are in Orbivestus. 

Even more highly developed seriate cymes are known in one 
other African member of the Vernonieae that is not recently introduced, 
Manyonia H. Rob., also of Central Africa. In the latter case, the genus 
seems to have close relatives in tropical America, especially 
Dipterocypsela S.F. Blake (Robinson 1999) of Colombia. 

Evidently, an African lineage of the Vernonieae has separately 
evolved seriately cymose heads that are immediately subtended by 
lateral branches bearing further heads. These are not directly related to 
the New World members of the tribe with similar inflorescences. Such 
inflorescences have also evolved in more remote members of the 
Asteraceae such as some species of Clibadiiim L. in the Heliantheae. 

There is more uniformity in the form, texture and coloration of 
the involucral bracts in Orbivestus than in many of the other genera of 
the Vernonieae. The tips are more acute in many specimens of O. 
karaguensis under the name Vernonia cistifolia O. Hoffm. in Engl., and 
at least one specimen of O. unionis (Sch.Bip. ex Walp.) H. Rob. Other 
unifying characteristics are the area of the sweeping hairs extending 
downward slightly onto the area where the style branches join, the T- 
shaped hairs, and the erect, rather than recoiled, lobes of the corolla. 



Orbivestus H. Rob., Proc. Biol. Soc. Wash. 1 12(1): 230. 1999. Type: 

Vernonia karaguensis Oliv. & Hiem 
Vernonia subg. Orbisvestus S.B. Jones. Rhodora 83: 60. 1981. Type: 

Vernonia karaguensis Oliv. & Hiem 

Subshrubs to small shrubs with erect stems from a woody 
base, not or sparsely branched between base and inflorescence; hairs T- 
shaped. Leaves alternate, usually decrescent upwardly, sessile or short 
petiolate, blades elliptical or ovate to oblanceolate, mostly 4-9 cm long, 
2-5 cm wide, base short-obtuse to acuminate, margins scarcely repand - 
dentate, apex short-acute, upper surface with small spinules and few 
small hairs, lower surface paler, grayish with slender hairs and partially 



486 Phxioloiiia (December 2009) 91(3) 



sunken glandular dots, venation pinnate with up to 6 or 8 lateral veins 
each side, spreading at 45-6U" angles. Intltjrescences with leaves of 
main axis only somewhat to greatly reduced, with only minute 
bracteoles on branches. Inflorescence shape broadly corymbifonn or 
cylindrical with rounded to tlattened top, with lower heads appearing 
sessile as result of proliferation by immediately subtending branches, 
branches of inflorescence tomentose with T-shaped hairs. Heads 
broadly canipanulate, 4-14 mm high and wide; involucral bracts mostly 
persistent, innermost somewhat deciduous, ca. 50-100 in 5-7 series, 
strongly gradate, 1-8 mm long, 1.0-1.5 mm wide, ovate to oblong, 
subacute and mucronate to apiculate at tip, innennost acute, tips 
appressed, margins membranous and irregularly denticulate distaily, 
often reddish, with dark median keel extending to apex, scarcely 
thickened and greenish near keel, with numerous small T-shaped hairs 
except at margins. Receptacle epalcate, tubcrculatc. Florets 15- ca, 50 
in a head; corollas purplish, narrowly funnel form, 4-8 mm long, with 
sparsely scattered glandular dots, tube slender, 2-3 mm long, throat 1.5- 
2.5 mm long, lobes 1.0-2.5 mm long, linear-lanceolate, erect, not 
recurving, sparsely glanduliferous to distinctly or minutely scabridulous 
outside, without longitudinal internal ducts filling lobe; anther thecae 1- 
2 mm long, without glandular dots, calcarate and with long tails at base, 
endothecial cells short, usually with 2-3 nodes on transverse walls; 
apical appendage 0.5-1.0 mm long, narrowly lanceolate, often sharply 
acute; style base with distinct expanded node; sweeping hairs on style 
branches and scarcely extending on to upper style shaft, slender and 
narrowly acute. Achenes 1-5-2.0 mm long when mature, 5-costate, 
with few to many setulae when young, often glabrous at maturity, often 
with numerous glandular dots on sides between costae, surface with 
numerous idioblasts that are not joined in series, with narrowly 
rhomboid raphids internally; carpopodium stopper-shaped to slightly 
turbinate, with many series of small thick-walled cells; inner pappus of 
25-30 slender capillary bristles, rather flattened outside and barbellate 
on sides, tips only slightly narrowed, outer pappus of narrow scales 0.5- 
1.5 mm long. Pollen grains ca. 50 \im in diam in fluid, type A, 
sublophate, tricolporate, echinate, with perforated tectum continuous 
between colpi. 

As presently known, the genus contains the following eleven 
species. Vernonia liomilantha S. Moore and V. undulata Oliv. & Hiem, 



Phytologia {December 2009) 91(3) 487 



placed in the genus by Robinson (1999) do not have the seriate-cymose 
condition now seen as characteristic of Orbivestus. In the case of 
Orbivestus homcmtha (S. Moore) H. Rob., the species does have the T- 
shaped hairs and the acute tips of the sweeping hairs and some of the 
overall aspect of Orbivestus, and the species is not at this time rejected 
from the genus. In the case of Vernonio undulata, the inflorescence is 
of a completely different, laxly branching form, and the species is 
excluded here. It should be noted that many specimens under the name 
V. undulata seem to belong to the still unplaced V. biafrae Oliv. & 
Hiem. 

Recently added to the genus, but not seen in this study, are 
Orbivestus albocinerascens (C. Jeffrey) Isawumi, O. bamendae (CD. 
Adams) Isawumi, and O. blumeoides (Hook, f) Isawumi (Isawumi 
2008). Also not seen in this study, and not included in the genus, is 
Vernon ia brachtrichoides C. Jeffrey of Tanzania, which Jeffrey (1988) 
placed close to V. karaguensis, but which he distinguished by its larger 
heads with involucral bracts to 10 mm long, corollas 10.5 mm long and 
pappus bristles 7.5-8.0 mm long. 

Key to the species of Orbivestus as constructed from limited 
material, previous keys, and descriptions. 

1. Heads with involucres 4-5 mm high and wide 2 

1. Heads with involucres 7-1.5 mm high and wide 5 

2. Erect herbs O. karaguensis 

2. Weakly to distinctly shrubby, scrambling plants, or small trees 3 

3. Leaf blades remotely dentate on margins; all heads appearing shortly 

pedunculate; involural bracts rounded at tips....O. homilanthus 

3. Leaf blades subentire to undulate or minutely denticulate on 

margins; many heads appearing sessile with subtending lateral 
innovations; involucral bracts with pointed to mucronate tips. 4 

4. Corollas white O. albocinerascens 

4. Corollas purple, mauve, or blue O. cinerascens 



488 Phxt(>l<>i>ia (December 2009) 91(3) 



5. Leaf blades densely tomentose on abaxial surface O. leopodii 

5. Leaf blades with pubescence not totally covering green abaxial 

surface 6 

6. Leaf margins with distinct serrations 7 

6. Leaf margins subentire, undulate, minutely denticulate, or with 

small callus-mucronations 8 

Leaf blades oblanccolate O. catumbensis 

Leaf blades ovate O. unionis 

Leaf blades auriculate near base O. bamendae 

Leaf blades not auriculate near base 9 



Leaf blades acuminate into pctiolate base O. turbinata 

Leaf blades subsessile 10 



10. Heads ca. 1.3 cm long O. hliimeoides 

10. Heads ca. 7-8 mm long O. leitensis 

The species of Orbivestus 

Orbivestiis albocinerascens (C. Jeffrey) Isawumi, Comp. News!. 46: 
36. 2009. Vernonia albocinerascens C. Jeffrey, Kew Bull. 
43(2): 222. 1988. 

Orbivestus bamendae (CD. Adams) Isawumi, Comp. Newsl. 46: 36. 
2008. Vernonia bamendae CD. Adams, W. African Science 
Assoc. 3: 116. 1957. 

Orbivestus blumeoides (Hook.f.) Isawumi, Comp. Newsl. 46: 35. 2008. 
Vernonia blumeoides Hook.f., J. Linn. Soc. Lond., Bot. 7: 198. 
1864. 

Orbivestus catumbensis (Hieron.) H. Rob., comb. nov. basionym: 

Vernonia catumbensis Hiem, Cat. Welw. Afr. PI. 1: 524. 1898. 



Phytologia (December 2009) 91(3) 489 



Orbivestiis cinerascens (Sch.Bip. in Schweinf.) H. Rob., Proc. Biol. 
Soc. Wash. I 12(1): 211. 1999. Vernonia cinerascens Sch.Bip. in 
Schweinf., Beitr. Fl. Aeth. 162. 1897. 

Vernonia tephrodoides Chiov., Fl. Somal. 2: 255. 1932. 

Orbivestiis homilanthus (S. Moore) H. Rob., Proc. Biol. Soc. Wash. 
1 12(1): 230. 1999. Vernonia homilantha S. Moore, J. Bot. 41 : 138. 
1903. 

Vernonia sennii Chiov., Fl. Somal. 2: 256. 1932. 

Orbivestiis karaguensis (Oliv. & Hiem) H. Rob., Proc. Biol. Soc. 
Wash. 1 1 2( 1 ): 23 1 . 1 999. Vernonia karaguensis Oliv. & Hiem, Trans. 
Linn. Soc. Lond. 29:91. 1873. 

Vernonia johannis O. Hoffm. in Engl., Pflanzw. Ost-Afr. C 405. 1895. 

Type: Tanzania, Ugueno, Vol kens 467 {B, destroyed). 

Neotype: Ruanda Region du Mutara, envirens dc Mimuli, 

reserve IRSAC, colline Bibale, 27/3/1959, Troupin 11.636 

(US). 
Vernonia cistifolia O. Hoffm. in Engl., Pflanzw. Ost-Afr. C 404. 1895. 
Vernonia elliotii S. Moore, J. Linn. Soc. Bot. 35: 315. 1902. 
Vernonia bothrioclinoides C.H. Wright, Bull. Misc. Inf 1906: 106. 

1906. 
Vernonia porphyroplepis S. Moore, J. Bot. 54: 251. 1980. 
Vernonia midtiflora De Wild., Feddes Repert. 13: 208. 1914 (non 

Less.). 
Vernonia pilgeriana Muschl., Bot. Jahrb. Syst. 46: 78. 1911. Type: 

Tanzania, Ngare Olmotony, Ulding 208 (B, destroyed). 

Neotype: Ruanda Regiom du Mutara, envirens de Mimuli, 

reserve IRSAC, colline Bibale, 27/3/1959, Troupin 11.636 

(US). 
Vernonia campanea S. Moore, J. Bot. 54: 251. 1916. 
Vernonia nwlanacrophxlla Cufod., Nouv. Giom. Bot. Ital., n.s. 50: 102. 

1943. 

Vernonia nniltiflora is added to the synonymy, and two 
synonyms whose types were destroyed in Berlin are neotypified to 



490 Fliyl(>loi;ia (December 2009) 91(3) 



firmly fix their identity as members of this species. The synonymy 
follows the provisional synonymy given by Jeffrey (1988) plus 
evidence from the limited descriptions. Some specimens under the 
name V. cistifoUa seem unlike other members of Orhivestus in the 
fewer rows and long tips on the involucral bracts. 

The species may be interpreted too broadly. Material in the 
herbarium under the name Vernonia cisiififolia from Malawi seems 
distinctive, with denser inilorescences and often dense tomcntum on the 
aba.xial surfaces of the leaves. One of the existing names in the 
synonymy, such as Vernonia hoihriodinoides C.H. Wright from 
Malawi, may represent this entity. 

Orbivestus leopoldii (Sch.Bip. ex Walp.) H. Rob., comb. nov. 
Basionym: Cyanopis leopoldi(i) Sch.Bip. ex Walp., Repert. Bot. Syst. 
2: 949. 1843. Vernonia leopoldii (Sch.Bip. ex Walp.) Vatke, Linnaca 
39: 478. 1875. Hilliardiella leopoldii (Sch.Bip. ex Walp.) H. Rob., 
Proc. Biol. Soc. Wash. 112(1): 230. 1999. 

Cyanopis hypoleuca Sch.Bip. ex Walp., Repert. Bot. Syst. (Walpers) 6: 

98. 1846, not Vernonia hypoleuca DC. 
Vernonia hipontinii Vatke, Linnaea 39: 478. 1875. 

The species shows the weakest development of seriate cymes 
of any of those here added to the genus, but such branching is present, 
and other characters and geography all fit with Orhivestus. 

Orbivestus teitensis (O. Hoffm, in Engl.) H. Rob., comb. nov. 
Basionym: Vernonia teitensis O. Hoffm. in Engl., Ptlanzenw. Ost-Afr. 
C: 404 (1895). Type: Kenya, Teita, Hildehrandt 2466a (B, destroyed); 
Neotype: Kenya: Muthaiga, near Nairobi, alt. 1 700 m, June 28- July 4 
1927, Piemeisel & Kephart 11 (US). 

The species is presently known from Congo, Kenya, and 
Uganda in Central Africa as indicated by the three specimens cited 
below. Among the herbaria possibly having duplicates o^ Piemeisel & 
Kephart material are A, BM, MO, and NY. 

Repeated attempts to key three specimens labeled as Vernonia 
from Kenya, Congo and Uganda in the treatment of Vernonia in East 
Tropical Africa (Jeffrey 1988) have failed. However, that same 



Phytologia {December 2009) 91(3) 49 1 



publication provided a probable answer to the problem in a list of taxa 
insufficiently known. The description of Vernonia teitensis Hoffmann 
(Engler 1895) from Kenya, as far as it went, matched the unidentified 
material perfectly. The description as given by Hoffmann (Engler 
1895) was, "V. teitensis O. Hoffm. n. sp.; suffruticosa; ramis junioribus 
villosis; foliis ellipticis breviter petiolatis vel subsessilibus repando- 
dentatis plerumque obtusis, basi angustatis, supra scabris, subtus 
puberulis et glanduloso-punctatis; capitulis parvulis 20 floris 
corymbosis; involucri late campanulati bracteis appressis acutis; 
achaeniis 5 costatis subglabris." The Hoffmann name apparently has 
not been associated with any more recent collections until now. The 
original type was cited as from Kenya: Teita, Hildebrandt 2466a 
(deposited at Berlin). The type material in Berlin was evidently 
destroyed during WWII, but the name has a potential priority dating 
from 1895. Thus, in order to avoid any future confiision, the identity of 
the species is fixed here by neotypification using one of the specimens 
in the U.S. National Herbarium. 

The three available specimens are as follows: KENYA: 
Muthaiga, near Nairobi, alt. 1700 m, June 28-July 4, 1927, R.L. 
Piemeisel & I.W. Kephart 11 (US); BELGIAN CONGO: Foothills of 
mountains west of Katana, Lake Kivu, 6300 ft. disturbed vegetation at 
roadside, on top of bank; 6/7/59. 1959 Cambridge Congo Expedition 29 
(US), woody stem, purple flowers very conspicuous, visited by bees; 
UGANDA PROTECTORATE: Ilipayo, grass bank, flower purplish, 
March 1914, R. Dimmer 207 (US). The specimen chosen here as 
Neotype is the one from Kenya where the original type was collected, 
Piemeisel & Kephart /7. Piemeisel & Kephart 11 (neotype US). It 
remains possible that an older name exists for this reasonably 
widespread central African species, but it seems unlikely since the 
present concept dates from 1895. In any case, the conclusions in this 
study are based on the preceding neotypification. 

Orbivestus turbinata (Oliv. & Hiem) H. Rob., comb. nov. Basionym: 
Vernonia turbinata Oliver & Hiem ex Oliver, Trans. Linn. Soc. 29: 90, 
t. 56. F. B. 1873. 

Orbivestus unionis (Sch.Bip. ex Walp.) H. Rob., comb. nov. 
Basionym: Vernonia unionis Sch.Bip. ex Walp., Repert. 2: 345. 1843. 



492 Phytoloi^ia {Dccemhcr 2009) 9/(.?j 



ACKNOWLEDGEMENTS 

I wish to thank Ingrid Pol-yin Lin of the Department of Botany 
for the scan of the Neotype of Vernonia teiieiisis O. Hoffm. 1 also 
thank Vicky Funk and Guy Nesoni tor reviewing the manuscript. 

LITERATURE CITED 

Adams, C. D. 1957. New records of Flowering Plants in West Africa. 
J. West African. Science Assoc. 3: 1 1 1-122. 

Cabrera, A. L. 1944. Vernonieas Argentinae (Compositae). 
Darwiniana 6(3): 265-379. 

Englcr, A. 1895. Die ptlanzenwelt Ost-Afrikas und der 

Nachbergebiete. 3 vol., 28 pi., Berlin, D. Reimer 

Isawumi, M.A. 2008. The status of generic revision in the African 
Vcrnonieae (Asteraceae). Compositae Newsletter 46(2): 27-48. 

Jeffrey, C. 1988. The Vemonieae in East Tropical Africa. Kew Bull. 
43(2): 195-277. 

Robinson, H. 1992. A new genus Vernunanthura (Vemonieae, 
Asteraceae). Phytologia 73(2): 65-76. 

Robinson, H. 1999. Revisions in Paleotropical Vemonieae 
(Asteraceae). Proc. Biol. Soc. Washington 1 12(1): 220-347. 



Phytologia {December 2009) 91(3} 



493 




Figure 1. Orbivestus teitensis (O. Hoffm.) H. Rob. Neotype of 
Vernonia teitensis Hoffm. in Engl., Piemeisel & Kephart 11 (US) 



494 PInioloiiia (December 2009) 91(3) 



NOMKNCLATIK AI. rHAN(;ES IN Till: HRVACEAE 
(BRVOPSIDA) FOR NORTH AMERICA III. 

John R. Spence 

National Park Service, Glen Canyon National Recreation Area, 

P.O. Box 1507, Page, AZ 86040-1507, U.S.A. 

Email: John_Spence(a^nps.gov 

ABSTRACT 

The family Roelliaceae is newly described for the western 
North American monotypic endemic Roellia roellii. The new section 
Genunabryuni section Tuherihryuni is described and typified by 
Gemmabryum violaceum. Bryiim section Cladodiiiin is transferred to 
Ptychostoinum, and Bryiiin section Caespiiibryuni is transferred to 
Gemmabryum. Nine species are transferred to the genera 
Gemmabryum, Leptostomopsis and Plagiobryoides for the Flora of 
North America. Phytologia 91(3): 494-500 (December, 2009). 

KEY WORDS: mosses. North America, Bryaceae, Roelliaceae 



This paper represents the final installment of nomenclatural 
changes in the moss family Bryaceae for the Bryophyte Flora of North 
America (BFNA) project. New genera and combinations were 
described in the previous two papers (Spence 2005; Spence 2007) and 
in Spence and Ramsay (2005). Since the publication of the last 
installment, new species have been documented from the BFNA region, 
and the classification of the family has been finalized, necessitating 
new sectional names and transfers. In addition, due to its unusual 
morphology and complex peristome, the enigmatic western North 
American endemic Roellia roellii (Brothcrus in Roll) Andrews e.\ Crum 
is placed in its own family. 

Roellia K'mdherg, 1897 

Roellia roellii has had a long confused history since it was first 
described. Brotherus originally described it as Mnium roellii, as it is 
morphologically similar to members of the Mniaceae. Following this, 



Phytologia (December 2009) 91(3) 495 



E.G. Britton moved it to Bryiim as B. liicidum. However, this name 
was already taken by another earlier species, so Holzinger described it 
as Bryiim sandbergii in 1895. Other names the species has been given 
include Mniiim simplex, Roellia simplex, and Roellia lucida, all 
Kindberg names. The oldest basionym is Mnium roellii Brotherus & 
Roll. Crum transferred the species to Roellia Kindberg in 1967 (Crum 
1967). The complete synonymy is found below. 

Mnium roellii Brotherus in Roll, Bot. Centralbl. 44: 420. 1890.; Roellia 

roellii (Brothems in Roll) Andrews ex H. Crum, The Bryol. 70: 107. 

1967. 
Bryum liicidum Britton, Bull. Torrey Bot. Club 16: 34. 114. f 1--17. 

1891, horn. Illeg.; Mnium lucidum Brotherus, Hedwigia 32: 293. 

1893; Roellia lucida Kindberg, Eur. N. Amer. Bryin. 2: 345. 1897. 
Bryum simplex Kindberg in Macoun, Cat. Canad. PI., Musci 133. 1892, 

hom. Illeg.; Mnium simplex Kindberg, Rev. Bryol 23: 22. 1896; 

Roellia simplex Kindberg, Eur. N. Amer. Bryin. 2: 346. 1897; 

Rhodobryum simplex Paris, Index. Bryol. 1121. 1898. 
Bryum sandbergii Holzinger, Contr. U.S. Natl. Herb. 3:271. 1895; 

Roellia sandbergii (Holzinger) Paris, Index Bryol. (ed. 2) 4: 

223.1905. 

The species is unusual in several respects. First, although 
superficially similar to Rhodobryum, it lacks the stolons of that genus, 
and also does not produce micronemata on the stem. The leaves are 
large, pale green, and the surface is finely wrinkled. The laminal cells 
are extremely large, but otherwise conform to the Rliodobryum-type 
areolation. The most unusual features are those of the peristome (Shaw 
1985), which has a unique formula of 4:2:10-14 and up to 6 nodose 
cilia. Because of its morphology, intermediate between the Bryaceae 
and Mniaceae, and several unique characters of both the gametophyte 
and sporophyte, it is best placed in its own family, near the Mniaceae. 
Vitt (1993) has mapped the distribution of the species in North 
America. It is restricted to cool or cold temperate oceanic subalpine 
and low alpine environments, where it occurs on litter under shrubs and 
trees (Spence 1986). 



496 Phyioloiiia {December 2009) 91(3) 



Roelliaceae JR. Spence fam. nov. 

Planiac ad species Mniacearum accedcntcs; caulibus rosulatis, 
microncmatibus nuUis, macronematibus sparsis, foliis obovatis, tenuiter 
rugosis, marginibus distalibus scrratis, ccllulis laminae magnis, 90-150 
X 30-50 (im limbidio nullo, costa in sectione transversali strato 
stereidarum reducto vel nullo, structuris asexulalibus reproductivis 
nullis; dioicae; capsulis cyclindricus, peristomio perfecto, in fomiulam 
4:2:10-14 disposito, ciliis nodosis 3-6, sporis parvis 10-15 |im. 

Plants with affinities to the Mniaceae; stems rosulate, micronemata 
lacking, macronemata sparse; leaves obovate. finely rugose, distal 
margins serrate, laminal cells large. 90-150 x 30-50 )im, limbidium 
lacking, costa cross-section with reduced or absent stercid band, 
asexual reproductive structures lacking; dioicous; capsules cylindrical, 
peristome perfect, formula 4:2:10-14, with 3-6 nodose cilia, spores 
small, 10-15 fim. 

Type genus: Roellia Kindberg. Gen. Eur. & North Amer. Bryin. 37. 
1897. 



Gemmabryum J.R. Spence & H.P. Ramsay, 2005 

The group of tuber-bearing Gemmabryum species, informally 
known as the Erythrocarpa sensu Crundwell and Nyholm (1964), 
requires a valid sectional name. All sectional names used for this group 
of species are apparently invalid. 

Gemmabryum section Tuberibryum JR. Spence. sect. nov. 

Caules aequaliter foliati, foliis laxe positis, in statu sicco leviter tortis, 
tuberibus rhizoidalibus vulgaribus. sphaericis vel pyriformibus vel raro 
stellatis, (40-) 60-200 (-250) |im in latitudine maxima, ccllulis planis 
vel tumescentibus, dioicae vel raro synoicae, capsulis pyriformibus vel 
cyclindicis, peristomio maximam partem perfecto. sporis parvis 10-20 
|im. 



Phytohgia (December 2009) 91(3) 497 



Stems evenly foliate, leaves loosely set, slightly twisted when dry; 
rhizoidal tubers common, spherical to pyriform or rarely stellate, (40-) 
60-200 (-250) |.mi in widest dimension, cells flat to bulging; dioicous 
or rarely synoicous; capsules pyriform to cylindrical, peristome mostly 
perfect, spores small, 10-20 f.im. 

Type species: Gemmabryum violaceum (Crundwell & Nyholm) JR. 
Spence. 

The discovery and verification of rhizoidal tubers in Bryiim 
caespiticiiim (Zolotov 2002) combined with the elongate distal laminal 
cells, shorter proximal cells and lack of a leaf limbidium, suggest that 
the species is better placed in Gemmabryum than in Ptychostomum, 
where I originally placed it and its allies. Tubers are unknown in 
Ptychostomum. There are 5-6 species in the section typified by B. 
coespiticium, two others of which also occur in North America. The 
section is transferred to Gemmabryum along with the three species 
found in North America. 

Gemmabryum section Caespitibryum (Podpera) J.R. Spence, comb, 
nov. Basionym: Bryum subsect. Caespitibryum Podp., Rozpr. Ceske 
Akad. Ved, TY. 2,'Vedy Mat. PYir. 10(2): 52. 1901; Bryum section 
Caespitibryum (Podpera) J.J. Amann, Fl. Mouss. Suisse 2: 226. 1918 

Gemmabryum badium (Bruch ex Bridel) J.R. Spence, comb. nov. 
Basionym: Bryum coespiticium var. badium Bruch ex Bridel, Bryol. 
Univ. 1:850. i827. 

Gemmabryum coespiticium (Hedwig) J.R. Spence, comb. nov. 
Basionym: Bryum coespiticium Hedwig, Sp. Muse. Frond. 1801. 

Gemmabryum kunzei (Hornschuch) JR. Spence, comb. nov. 
Basionym: Bryum kunzei Hornschuch, Flora 2(1): 90. 1819. 



498 rhvioloiiia (December 2009) 91(3) 



Ptyclwstomum Hornschuch, 1822 

Ffycho.sioiniiin includes two major groups, the type subgenus 
and Clculodiiiin. which is liere translerred to Prycho.stoniiiiii troni 
Bryuin. 

Ptychostomum subgenus Cladodium (Bridel) JR. Spence, comb. nov. 
Basionyn: Cladodium Bridel, Bryol. Univ. 1: 620. 1826. 



Leptostonwpsis (Mull. Hal.) J.R. Spence & H.P. Ramsay, 2005. 

The recent discovery of Brdchymeniiim niveum Bescherelle in 
the Bryophyte Flora of North America region, which will be 
documented elsewhere (Spence in prep.), requires a transfer to 
Leptostomopsis to which it belongs. 

Leptostonwpsis nivea (Bescherelle) J.R. Spence, comb. nov. 
Basionym: Brachxmenimn niveum Bescherelle, J. Bot. (Morot) 15: 383. 
1901. 



Plagiobryoides J.R. Spence, 2005 

Recent field work and herbarium studies have documented the 
presence of several species in North America that are morphologically 
close to Plagiobryoides incrassatolimbata (Cardot) J.R. Spence. 
Plagiobryoides is characterized by very large and lax laminal cells and 
capsules that often have a long well-developed hypophysis. Although 
the type, P. incrassatolimbata, has a unique multi-stratose border, it is 
otherwise very similar to the other species listed below. Recently, I 
have also found that some species produce extremely large rhizoidal 
tubers, with diameters of nearly 0.5 mm. The following five species are 
transferred to the genus. Originally, I had transferred the widespread 
pantropical Bryum celhdare to Plagiobryum for the Flora of Australia, 
as it is closer to that genus than to Bryum. However, it is better placed 
in Plagiobryoides, emphasizing the significant sporophytic differences 
between that genus and Plagiobryum. 



Phytologia {December 2009) 91 {3} 499 



Plagiobryoides brachyneura (Kindberg) J.R. Spence, comb. nov. 
Basionym: Brxiim brachxneuron Kindberg, Ottawa Naturalist 5: 179. 
1892. 

Plagiobryoides cellularis (Hooker) J.R. Spence, comb. nov. Basionym: 
Brxiim celliilare Hooker, Sp. Muse. Frond., Suppl. 3: 1(1): 214: a. 
1827. 

Plagiobryoides limbata (Miill. Hal.) JR. Spence, comb. nov. 
Basionym: Brxiini limhatuiu Mull. Hal., Syn. Muse. Frond. 2: 573. 
1851. 

Plagiobryoides renauldii (Roll ex Renauld & Cardot) J.R. Spence, 
comb. nov. Basionym: Brxiim renauldii Roll e.x Renauld & Cardot. 
Bull. Soc. Roy. Bot. Belgique 38(1): 13. 1900. 

Plagiobryoides vinosiila (Cardot) J.R. Spence, comb. nov. Basionym: 
Brachxmenium vinosulum Cardot, Rev. Bryol. 38: 6. 1911. 



ACKNOWLEDGEMENTS 

I thank Patricia Eckel for generously supplying the Latin 
diagnoses and suggesting gender endings. Dan Norris, Marshall 
Crosby, Jim Shevock and Richard Zander kindly reviewed an early 
draft of the manuscript. Marshall Crosby was instrumental in 
compiling the complete synonymy for Roellia. Discussions with Ken 
Kellman were instrumental in my decision to move Bryitm caepsiticium 
and its allies to Gemmabrxum. 

LITERATURE CITED 

Crum, H. 1967. Studies in North American Bryaceae I-II. Bryologist 
70: 106-110. 

Crundwell, A.C. and E. Nyholm. 1964. The European species of the 
Brxiim erxthrocarpiim complex. Trans. Brit. Bryol. Soc. 4: 596- 

637. 



500 Phxtolo^ia (December 2009) 91(3) 



Shaw, J. 19S5. The correlation between taxonomy and peristome 
structure in the Br>'aceae. .1. Hattori Bot. Lab. 59: 79-100. 

Spcncc, J.R. 1986. The montane moss flora of southwestern British 
Columbia and northwestern Washington State. J. Hattori Bot. Lab. 
62:417-483. 

Spence, J.R. 2005. New genera and combinations in Bryaceae (Bryalcs, 
Musci) for North America. Phytologia 87: 15-28. 

Spence, J.R. 2007. Nomenclatural changes in the Bryaceae (Bryopsida) 
for North America 11. Phytologia 89: 110-114. 

Spence, J.R. and H.P. Ramsay. 2005. New genera and combinations in 
the Bryaceae (Bryales, Musci) for Australia. Phytologia 87: 61-72. 

Vill, D.H. 1993. The distribution of North American bryophytes. 
Roellia roellii. Evansia 10: 112-113. 

Zolotov, V.L 2002. The genus Bryiini (Bryaceae, Musci) in the middle 
European Russia. Arctoa 9: 155-232. 



Phytologia (December 2009) 91(3} 501 



TAXONOMIC NOTES ON ACAULESCENT OXALIS 
(OXALIDACEAE) IN THE UNITED STATES 

Guy L. Nesom 

2925 Hartwood Drive 

FortWorth,TX 76109, USA 

www.guynesom.com 

ABSTRACT 

A key to species and typification summaries with descriptions, 
notes on variation, and geography are presented for 10 acaulescent 
Oxalis species occurring in the USA, both native and naturalized: O. 
articulata, O. caerulea, O. debilis, O. decaphyila, O. drummondii, O. 
intermedia, O. latifolia, O. metcalfei, O. triangularis, and O. violacea. 
Oxalis metcalfei (previously identified in the USA mostly as O. alpina) 
occurs in Arizona, Colorado, New Mexico, and Texas. Oxalis latifolia 
occurs in Arizona, New Mexico, and Texas, at the northern extremity 
of its range. Oxalis intermedia, native to the West Indies, has 
previously been known to be naturalized in the USA in Florida and is 
reported here from. Louisiana and Texas. Oxalis debilis (including O. 
corymbosa) occurs across seven coastal states of the southeastern USA 
and is reported here for California by a voucher and for Washington by 
a sight record. Phytologia 91(3): 501-526 (December, 2009). 

KEY WORDS: Oxalis sect, lonoxalis, Oxalis latifolia, Oxalis 
articulata, Oxalis debilis, Oxalis intermedia, taxonomy, distribution 



Oxalis sect. lonoxalis (Small) R. Knuth includes bulb- 
producing, acaulescent species with white to blue, purple, or pink 
flowers. The North American representatives were monographed by 
Denton (1973). who provided usefijl insights into a taxonomically 
difficult group, but problems have remained and identifications have 
been inconsistent. In Arizona and New Mexico, particularly, where 
Denton recognized the presence of O. alpina, O. latifolia, O. 
drummondii, "aff O. drummondii,"' and O. violacea, the present study 
identifies the same plants as O. metcalfei and O. latifolia. Oxalis 
caerulea has been a poorly understood and apparently under-collected 



502 Phvioloyia {December 2009) 91(3) 



species. In the southeastern USA, adventive species of sect, lonoxalis 
from subtropical and tropical regions are ambiguous in some points of 
identity and nomenclature. The present study attempts to clarify 
species identities, nomenclature, and geographic distribution of a 
number of the North American taxa of sect. lonoxalis. The acaulescent 

0. articulata also is included in the account here, although a member of 
sect. Anicitlaiac R. Kunth. 

in the present study, all citations of localities in the USA and 
Mexico are from specimens examined, unless otherwise specifically 
noted. Collections were studied from ARIZ. ASU, BRIT-SMU-VDB, 
GH, MO, NLU,andTEX-LL. 

Keytospfxies 

1. Leaflets mostly 4-1 1, rarely 3. 

2. Leaflets mostly 4(-5), obtriangular to obcordate, lobed 1/5-1/2 
length, 5-22 mm long; bulb scales (3-)5-7)-nerved 
1 . Oxalis caerulea 

2. Leaflets mostly (4-)5-l 1, mostly narrowly oblong-oblanceolate 
to narrowly oblong or linear, lobed (l/5-)I/2-2/3(-9/10) length, 
(10-)12-38(-72) mm long; bulb scales 9-I5+-nerved 
2. Oxalis decaphylla 

I. Leaflets 3. 

3. Leaflets with oxalate dots around the margins or evenly over the 
lamina, or both. 

4. Plants arising from a thick, woody, irregularly nodulate- 
segmented rhizome often with persistent, thickened, and 
lignescent petiole bases; tlowers 3-12 in umbellifonn cymes, 
less commonly in irregular cymes 9. Oxalis articulata 

4. Plants arising from a dense cluster of sessile bulblets; flowers 
(3-)8-14(-28) in irregular cymes 7. Oxalis debilis 

3. Leaflets without oxalate dots or tubercles, or with marginal 
tubercles only on both sides of the notch. 

5. Plants arising from scale-clad rhizomes; leaflets purple 



Phytologia (December 2009) 91(3) 503 



9. Oxalis triangularis 

id bu 
clad rhizomes; leaflets mostly green. 



5. Plants arising from bulbs or bulbs and bulblets, without scale 



6. Leaflets obtriangular to broadly obtriangular, lobes apically 
nearly flat; plants arising from a dense cluster of sessile 
bulblets; southeastern USA (expected in California) 
8. Oxalis intermedia 

6. Leaflets obtriangular to obcordate, lobes apically rounded to 
convex; plants arising from a single bulb or a dense cluster of 
sessile bulblets; eastern to southwestern USA. 

7. Plants arising from a dense cluster of sessile bulblets; 

bulb scales 3-nerved; southwestern USA 

3. Oxalis metcalfei 

7. Plants arising from a single bulb, rarely producing 

bulblets at the ends of slender rhizomes; bulb scales 3- 

nerved or (5-)7-9(-l l)-nerved; eastern USA to 

southwestern USA. 

8. Bulb scales (5-)7-9(-l])-nerved; southwestern USA 

4. Oxalis latifolia 

8. Bulb scales 3-nerved; primarily eastern USA. 

9. Leaflets without oxalate deposits, obtriangular to 
obcordate, (6-) 14-34 mm, lobes divergent, tubercles 
of sepal apices 2 or 3-6, linear and prominently 
thickened, apically confluent... 
5. Oxalis drummondii 

9. Leaflets consistently with oxalate deposits at the 
base of the notch, rounded-obcordate to obreniform, 
(5-)8-15(-20) mm, lobes geminate; tubercles of 
sepal apices 2, linear and narrow, apically confluent 
6. Oxalis violacea 



504 Fhyloloi^ia (Dcccmhcr 2009} 91(3) 



1. Oxalis caenilea (Small) R. Knuth, Notizbl. Bot. Gart. Bcrlin- 

Uahlcm 7: 316. 1919. lonoxalis caerulea Small, N. Amcr. Fl. 25: 
33. 1907. Type: USA. New Mexico. Lincoln Co.: Ciray, ca. 6000 
ft, 7 Jun 1898, J. Skehan 112 (holotypc: NY-digital image!; 
isotypcs: GH!, MO!, NY-digital image!, US-digital image!). The 
NY and US sheets were annotated by Lourteig in 1988 and 1989 as 
O. luiuilata Zucc. 

Plants perennial, acaulesccnt, glabrous, arising from single, 
brownish bulbs; bulb scales (3-)5-7-nerved. Leaves all basal; leaflets 
(3-)4(-5), obtriangular to obcordate, 5-22 mm, lobed 1/5-1/2 length, 
lobes apically rounded, green above, slightly paler green to purplish 
beneath, oxalate deposits absent or as a few punctate tubercles near the 
leaflet lobe apices, petioles 3-10(-13) cm. Flowers (l-)2-7 in 
umbelliform cymes, distylous; scapes 6-12(-15) cm; sepal apices with 
a pair of linear, orange tubercles; corollas 8-10 mm; petals red to 
pinkish-lavender. Capsules ellipsoid, 3.5-6 mm. In = unknown. 

Flowering Jun-Sep. Stream beds, creek sides, meadows, 
pinyon-juniper, pine-oak-juniper, pine-aspen; ( 1 800-)2000-2600 m. 
Native to Arizona (Apache, Coconino, Graham, Navajo, Pima, and 
Yavapai cos.), Colorado (Fremont Co.), New Mexico (Catron, Colfax, 
Grant, Lincoln, San Miguel, and Valencia cos.; Mexico (Chihuahua, 
Durango, Sonora). 

Among the bulb-forming species of the southwestern USA, 
Oxalis caerulea has the smallest plants and leaves. If 4 obtriangular to 
obcordate leaflets are observed, the identity as O. caerulea is fairly 
secure, although 3 and 4 leaflets may sometimes be produced on a 
single plant. Oxalis decaphylla also produces more than 3 leaflets, but 
if only 4 leaflets, they are larger and differently shaped and the plants 
generally grow at higher elevations than O. caerulea. Denton's key to 
species (1973, p. 491) emphasized the relative extension of flanges at 
petiole bases in separating O. caerulea and O. lunulata Zucc. from 
other species — this feature, however, is difficult to interpret and the 
flanges often are damaged or apparently missing. 

Type specimens of Oxalis caerulea at NY and US were 
annotated by Lourteig in 1988 and 1989 as O. lunulata, and she 



Phytologia (December 2009) 91(3} 505 



included O. caerulea as a synonym of O. lunulata (Lourteig 2000). 
Denton (1973. p. 575) noted that "The closest ally to O. lunulata is O. 
caerulea which occurs in northern Mexico and southwestern USA. 
O.xalis caerulea is intermediate in morphology between O. lunulata and 
O. divergens but is not sympatric with either of those two species." 
Denton (Fig. 6) mapped O. caerulea in Mexico in Durango and 
Chihuahua. O. lunulata from central Zacatecas southward to 
Guatemala. 

Sivinski (2005) noted that O.xalis caerulea "is either rare in 
NM or \er\' difficult to accurately identify." The small size of the 
plants, perhaps missed in sur\eys and general collecting, might also 
contribute to the apparent paucity of the species. Because this species 
has been poorly known, the following collections are cited, all 
examined in the cun-ent study. 

Arizona. Apache Co.: ca. 5.5 road mi N of Nutrioso and 1.3 
mi N on Apache Co. Rd 2116, pinyon-juniper-ponderosa. at hilltop. 
7200 ft, 9 Aug 1991, Christ}- 824 (ASU). Coconino Co.: Coconino 
Natl. Forest. Upper West Fork Canyon of Oak Creek, ca 10 mi NNE of 
Sedona. short ways down Femow Draw from Forest Ser\ice Rd 231, 
first confluence, within northern section of Red Rock Secret Mt. 
Wilderness, open field. 6500 ft. 2 Sep 2001, Gilbert 830 (ASU); 
Coconino Natl. Forest. Upper West Fork Canyon of Oak Creek, canyon 
mouth located 15 km N of Sedona. ca. 0.5 mi down Casner Cabin Draw 
from wilderness boundars', seasonal stream bed, 6600 ft, 10 Aug 2002, 
Gilbert 948 (ASU): Flagstaff. 7000 ft. 26 Sep 1923. Hanson 729 (MO); 
Flagstaff. 10 Aug 1910. Irish 10155 (ARIZ); Houston Draw, open 
meadow in coniferous forest, 2194 m, 3 Aug 1989. Knight 369 (ASU); 
Flagstaff. 6900 ft. 5 Aug 1936. Sneddon s.n. (ARIZ); Flagstaff, 12 Aug 
190^7. Thornber s.n. (ARIZ); Flagstaff. 20 Jul 1930. Thornber s.n. 
(ARIZ. SMU): Flagstaff, near Museum. 7100 ft. 11 Aug 1935, Whiting 
756/1466 (ARIZ). Graham Co.: Coronado Natl. Forest, Soda Water 
Spring Canyon, Madrean oak \\ oodland along creek, Q. hypoleucoides, 
Q. emoryi, Pinus cembroides. Juniperus deppeana, Arctostaphylos 
pungens. NE aspect, 5900 ft, 2 Aug 1999. Buegge 1005 (ASU). 
Navajo Co.: White Mt. Apache Reservation, ca. 12 mi E of Seven Mile 
School at Crooked Creek, pine-aspen, boggy area along stream. 27 Jul 
1975, Uine 1610 (ASU). Pima Co.: Rmcon Mts., 7900 ft, 20 Sep 



506 Phyroloyia {December 2009) 91(3) 



1909, Blunier 33SI (MO). Yavapai Co.: near Prcscott, 8 Aug 1926, 
Peebles ei al. 2657 (ARIZ). COLORADO. Fremont Co.: Texas Cr., 
Aug 1879, Brandegee 875 (MO). NEW MEXICO. Catron Co.: 7 mi W 
of Red Hill, ponderosa pine forest, 7000 ft, 12 Aug 1964, Krai 21844 
(VDB). San Miguel Co.: near Peeos, 6700 ft, 19 Aug 1908, Siandley 
5099 (MO). Valencia Co.: no other locality information, 22 Aug 1939, 
Vestal 94 (GH). County unknown: 1847, Fendler 91 (GH-3 sheets, 
MO). Denton (1973) also cited the following collections of typical O. 
caerulea from New Mexico: Catron Co.: near Luna, Egglesion 20254 
(NY, US). Colfax Co.: vicinity of Ute Park, Standley 13754 (US). 
Emshwiller et al. (in press) record McKinley Co., N.M., in the range of 
the species. 

Denton (1973, pp. 507-508) identified and cited some 
collections as "aff. O. caerulea," "a subtle variant which is a putative 
hybrid between O. drummondii and O. caerulea. The leaves have 3-4 
leaflets which may be abnormally trilobed. Practically all of the pollen 
was shriveled, only 1-2 percent was normally shaped and accepted the 
stain in an aniline blue pollen preparation." She cited these: NEW 
Mexico. Colfax Co.: vie. of Ute Park, 2 Sep 1916, Standley 14255 
(US). Grant Co.: Santa Rita del Cobre, copper mines, Aug 1851, 
Wright 908 (GH, NY). San Miguel Co.: near Pecos, 19 Aug 1908, 
Standley 5099 (NY, US). Some of the collections examined in the 
present study from around Flagstaff (Coconino Co., Arizona) and 
elsewhere apparently are similar in leaf morphology to these "variants," 
but neither the present study nor Denton's has recognized the 
occurrence of O. drummondii in New Mexico or northern Arizona, and 
it is unlikely that genes of that species arc involved. The pollen 
inviability and putatively abnormal leaf morphology probably are 
related to something other than hybridization. 

2. Oxalis decaphylla Kunth in A. Humboldt et al., Nov. Gen. Sp. 

5(qto.): 185. 1822. TVPE: MEXICO. "Crcscit in planitie Mexicana, 

prope rupem El Peiion, alt. 1 170 hex.,'' Bonpland 4170 (holotype: P; 

isotype: P). Fide Denton (1973). 
lonoxalis grayi Rose, Contr. U.S. Natl. Herb. 10: 112. 1906. O.mlis 

grayi (Rose) R. Knuth, Notizbl. Bot. Gart. Berlin-Dahlem 7: 317. 

1919 (non Tidestrom 1923). Type: USA. New Mexico. No other 



Phytologia (December 2009) 91(3) 507 



locality data, 1851, C. Wright 909 (holotype: US, digital image!, 
fragment NY; isotype: GH!). 

Plants perennial, acaulescent, rarely without leaves, glabrous, 
arising from brownish, heavily fibrous bulbs; bulb scales 9-1 5+- 
nerved. Leaves all basal; leaflets (3-)5-ll, mostly narrowly oblong- 
oblanceolate to narrowly oblong or linear, (10-)12-38(-72) mm, lobed 
(l/6-)l/2-2/3(-9/10) length, lobes apically subacute, bright green 
above, slightly paler green to purplish beneath, oxalate deposits absent, 
petioles 7-32(-^6) cm. Flowers (2-)6-l 1(-15) in umbelliform cymes, 
distylous; scapes 7-35 cm; sepal apices with thick, linear, orange 
tubercles; corollas (7-)9-17(-22) mm, rose-purple or lavender to pink, 
rarely white. Capsules ellipsoid, 3-1 1 mm. 2n = 28, 56 (counts from 
Mexico; Weller & Denton 1976). 

Flowering Jun-Aug. Sycamore-walnut, oak, pine-oak, 
ponderosa pine, pine-spruce-aspen, spruce-fir, canyons, meadows, 
seeps, streamsides; (1700-)2200-3000(-3200) m. Native to Arizona 
(Apache, Cochise, Coconino, Gila, Greenlee, Navajo, Pima, Santa 
Cruz, and Yavapai cos.). New Mexico (Catron Co.), and Mexico (south 
to southwestern and central states). 

Leaflets oiOxalis decaphylla are heteroblastic (Denton 1973), 
changing form from juvenile to mature stages of a single plant, and also 
variable in adult form, especially in width and number of lobes. 

3. Oxalis metcalfei (Small) R. Knuth, Notizbl. Bot. Gart. Berlin- 
Dahlem 7: 314. 1919. lonoxalis metcalfei Small in N.L. Britton et 
al., N. Amer. Fl. 25: 39. 1907. TYPE: USA. New Mexico. [Socorro 
Co.]: Mogollon Mountains, Mogollon Creek, ca. 7500 ft., 23 Jul 
1903, O.B. Metcalfe 299 (holotype: NY-digital image!; isotypes: 
ARIZ!, GH!, MO!, US-digital image!). 

lonoxalis monticola Small, N. Amer. Fl. 25: 42. 1907 [non Arechav. 
1900]. Oxalis neomexicana R. Knuth [nom. nov.], Notizbl. Bot. 
Gart. Berlin-Dahlem 7: 315. 1919. Type: USA. New Mexico. Grant 
Co.: in and around the S end of the Black Range, Iron Creek, 
hillside, ca. 7800 ft, 12 Aug 1904, O.B. Metcalfe 1220 (holotype: 
NY, digital image!; isotypes: GH!, MO!, digital image!, US, digital 
image!). 



508 Phxtoloi-ia (December 2009) 91(3) 



Oxalis htilhosa A. Nelson, Anicr. J. Bot. 23: 269. 1936. Typk: USA. 
Now Mexico. [Sandoval Co.j: on the gravelly soils otcreek banks, 
the Univ. Camp, Jcmcz Springs, [silt soils adjacent to the Jemcz 
River], 20 Aug 1931, /\. Nelson 11609 (holotype: RM, digital 
image!). 

Plants perennial, acaulescent, glabrous, arising from a primary 
bulb (sometimes not evident) 5-10 mm long and a cluster of ovoid 
bulblets 3-4 mm long; bulb scales 3-nervcd. Leaves all basal, leaflets 
3, obtriangular-obcordate, 11-25 mm, lobed 1/6-1/3 length, lobes 
rounded to shallowly convex, green on both surfaces, oxalate deposits 
in a thin, marginal band 0.5-1.5 mm long on both sides of the notch 
base, sometimes evident on one surface but not the other, rarely 
apparently absent; petioles 7-15 cm. Flowers 3-7 in umbelliform 
cymes, tristylous and distylous; scapes 7-22 cm, peduncles 15-25 cm, 
pedicel 20-30 mm; sepal apices with a pair of orange, narrow-elongate, 
non-contluent tubercles; corollas (9-) 12- 16 mm, petals purplish to 
lavender or pink. Capsules cylindric, 6 mm. 2n = 28 in Arizona and 
New Mexico, 2/? = 42 only in New Mexico (Weller & Denton 1976). 

Flowering Jun-)Jul-Sep(-Oct). Stream sides, wet meadows, 
canyon bottoms, talus, rocky banks, crevices, juniper-chaparral, 
Cercocarpus, pine, yellow pine-doug fir-oak, douglas fir-aspen, pine- 
white fir-douglas fir, spruce-fir, spruce; 1 800-3 100(-3400) m. Native 
to Arizona (Apache, Cochise, Coconino, Gila, Graham, Greenlee, Pima, 
Santa Cruz, and Yavapai cos.), Colorado (La Plata Co.; also Archeluta, 
Hinsdale, and Mineral cos., fide Emschwiller et al. in press). New 
Mexico (Bernalillo, Catron, Grant, Otero, Sandoval, Sierra, Socorro, 
and Taos cos.; also Colfax Co., fide Welle & Denton 1976), Texas (Jeff 
Davis Co.), and Mexico (Chihuahua, Durango, Sonora, Zacatecas). 

Oxalis metcalfei is common in Arizona and New Mexico but 
in Texas is known from only two collections: Jeff Davis Co.: Davis 
Mts., N slope and summit of Mt. Livemiore, moist soil of ledges, 29 
Jun 1946, Cory 13523 (SMU); Mt. Livemiore, 22 Sep 1934, Hinckley 
s.n. (TEX). 

In Nelson's description of Oxalis bulbosa (1936), he described 
the habit: "bulblets 50 or more crowded in a subspherical mass 12-20 



Phytologia (December 2009) 91(3) 509 



mm in diameter and largely concealing the crown scales; bulblets small, 
easily detached at maturity, ovoid to subspherical, 2-4 mm in diameter, 
very compact." In the southwestern USA, the presence of bulblets on a 
montane O.xalis provides an unequivocal identification as O. metcalfei, 
in distinction to O. latifolia, the only other 3-foliolate species in the 
area with a similar aspect. If only the primary bulb (or a single small 
bulb/bulblet) is present, the bulb scales of O. metcalfei are 3-nerved (vs. 
5-7(-l l)-nerved in O. latifolia). If the specimen does not include 
below-ground parts, observation of oxalate deposits on the leaves can 
confirm the identification as O. metcalfei — the narrow oxalate 
deposits sometimes are difficult to discern or perhaps even absent, but 
they are never produced on leaves of O. latifolia. Specimens from 
ARIZ annotated as O. metcalfei and O. latifolia are shown in the 
database at ARIZ Herbarium (2009); those from ASU will be shown on 
SEINET (2009). 

O.xalis metcalfei has mostly been identified as O. alpina 
(Rose) Rose ex R. Knuth (e.g., Denton 1973; numerous publications by 
Weller and collaborators; Omduff & Denton 1998; Emshwiller et al. in 
press). The type of O. alpina is from south-central Mexico (see citation 
below), and I have not seen evidence that the species reaches 
northwestern or northeastern Mexico. Denton's map (1973, Fig. 5) 
shows a wide hiatus in distribution between her records in the 
southwestern USA and northern Chihuahua and Sonora (O. metcalfei) 
and those mostly in central and southwestern Mexico {O. alpina sensu 
stricto). 

The similarity of O.xalis metcalfei to O. alpina is confirmed in 
the present study, but morphological differences are shown in the 
following contrast. 

a. Leaflets with dot-like oxalate deposits scattered through lamina, 
concentrated near margins, or as continuous, filiform marginal 
bands around the lobe apices, sometimes apparently absent; corollas 
mostly white Oxalis alpina 

a. Leaflets with oxalate deposits as a filiform, marginal band 0.5-1.5 
mm long on both sides of the notch base, rarely apparently absent; 
corollas mostly purplish to lavender or pink Oxalis metcalfei 



510 Fhyloloi^la {December 2009) 91(3) 



The significance ot these features in recognizing O. alpina was 
emphasized by Denton (1973, p. 503), who noted that O. jacquiniana 
Kunth is usually distinguished from O. alpina by the lack of oxalate 
deposits on the leaflets and that "in western Mexico, a few populations 
of O. galeoitii [Turcz.] resemble O. alpina by having white llowers ... 
Denton's identification of some collections of O. metcalfei in 
Arizona as O. violacea perhaps reflected their similarity in producing 
oxalate deposits at the base of the leaflet notches. In view of their 
morphological distinction and their geographical separation, O. 
metcalfei and O. alpina are justifiably treated as distinct species. 

Weller (1976, p. 124) described Oxalis alpina as having "the 
most extensive natural distribution of any species in section lonoxalis'' 
and he viewed the northwestern population system (treated here as O. 
metcalfei) as having attained its present distribution by northward 
migration from ancestral populations in southern Mexico. He more 
recently has noted (Weller et al. 2007, p. 974) that "Cytogeographic 
studies, which have shown that the haploid chromosome number varies 
from 7 to 42, suggest that O. alpina is not monophyletic (Weller and 
Denton, 1976). In contrast, populations in the Sky Island region of 
Arizona, New Mexico, and Sonora arc likely to be monophyletic based 
on similar morphology, uniform tetraploidy (Weller and Denton, 1976), 
and production of viable hybrid seed (Weller, 1978)." Regarding the 
recent statement, evidence does not appear in any of Weller's 
publications to support his observation that O. alpina is non- 
monophyletic, unless it is simply the occurrence of polyploidy, nor 
have his studies provided any morphological comparison between 
typical O. alpina in south-central Mexico and the northern "O. 
metcalfei'' variants. Nor is the observation of "uniform tetraploidy" 
true, since both tetraploids and hexaploids of O. metcalfei occur in the 
Mogollon Range of southeastern New Mexico (Catron and Grant cos.), 
part of the "Sky Island" region. Hexaploids in O. metcalfei apparently 
occupy the far-eastern portion of the range, compared to the more 
widely distributed tetraploids, and their morphological identity with the 
tetraploids suggests that they arose from the latter. 

Tristyly appears to be primitive in Oxalis, based on the 
predominance of that condition in diploid endemic species of southern 
Mexico and the occurrence of distyly mostly in species with broader 



Phytologia (December 2009) 91(3) 511 



distributions and higher ploidy levels (Weller & Denton 1976). 
Populations of Oxalis metcalfei in Arizona, New Mexico, and 
Chihuahua are tristylous, distantly separated from the closest tristylous 
populations of any species in Mexico (see Weller & Denton 1976, Fig. 
1). Based on success of inter-populational crossing, Weller (1978) 
hypothesized that distylous populations of O. metcalfei are derived 
from tristylous ones in the same region. The distylous populations 
apparently are restricted to Arizona (Weller 1979; Weller et al. 2007), 
in the region where only tetraploidy has been reported. 

Oxalis alpina (Rose) Rose ex R. Knuth, Notizbl. Bot. Gart. Berlin- 
Dahlem 7: 315. 1919. lonoxalis alpina Rose, Contr. U.S. Natl. 
Herb. 10: 110. 1906. TYPE: Mexico. Edo. Mexico. Sierra de las 
Cruces, fir woods, 10,000 ft, 13 Aug 1896, C.G. Pringle 6439 
(holotype: US-digital image!; isotypes: GH!, MO!, NY-digital 
image!, US-digital image!). 

4. Oxalis latifolia Kunth in Humboldt, Bonpland & Kunth, Nov. Gen. 
Sp. 5[qto.]: 237, plate 467. 1821 [1822]. Acetosella violacea subsp. 
latifolia (Kunth) Kuntze, Rev. Gen. PI. 1: 90. 1891. lonoxalis 
latifolia (Kunth) Rose, Contr. U.S. Natl. Herb. 10: 113. 1906. 
Type: Mexico: crescit prope Campeche, no date, Humboldt and 
Bonpland s.n. (holotype: P fiche!; possible isotype: B-Willdenow 
8975 fiche!). The leaves of the B-Willdenow specimen are folded 
but appear to be different in shape from the holotype. 

Oxalis divergens var. amplifolia Trel. in A. Gray, Synopt. Fl. N. Amer. 
1(1): 368. 1897. Oxalis amplifolia (Trel.) R. Knuth, Notizbl. Bot. 
Gart. Berlin-Dahlem 7: 314. 1919 (non [Trel.] Tidestrom 1923). 
lonoxalis amplifolia (Trel.) Rose, Contr. U.S. Natl. Herb. 10: 110. 
1906. Lectotype (Denton 1973, p. 532): USA. Arizona. [Pima 
Co.]: Santa Rita Mts., 1828 m, 9 Jul 1881, C.G. Pringle 300 (GH!). 
In the 1897 description of var. amplifolia, Trelease regarded it as "n. 
comb." and cited as a synonym "O. latifolia, Trelease, [Mem. 
Boston Soc. Nat. Hist. 4: 91. 1888], t. 11, f. 12, not HBK," but in 
the 1888 publication he had identified the taxon as "10. O. latifolia, 
HBK., Nov. Gen., v. 237, PI. 467, VAR." If he intended to describe 
a new variety in 1888, it was an illegitimate attempt since he did not 
provide an epithet. Thus, the name in Gray's treatment is regarded 
as a new variety, not a comb. nov. or a nom. nov., and the name "O. 



512 Fhxtoloiiia (Decern her 2009) 91(3) 



laiifolia Treleasc" has no standing. Denton's Icctotypit'ication 
remains valid, but for O. divergens var. amplijoliu. 

Plants perennial, aeaulescent, glabrous, from a single bulb, 
bulb seales (5 -)7-9(-l l)-nerved, inner thiekened and white with 
hyaline margins. Leaves all basal; leaflets 3, obtriangular to obcordate, 
(15-)25-40 mm, lobed 1/5-1/2 length, lobes apieally rounded, green on 
both surfaees. oxalate deposits absent; petioles (6-) 10- 25 em. Flowers 
(3-)6-10(-12) in umbelliform cymes, tristylous, rarely homostylous; 
scapes (7-)10-20(-30) cm; pedicels (5-)10-20(-35) mm; sepal apices 
with a pair of short to elongate, non-confluent, orange tubercles; petals 
9-12 mm, purple to lavender or pink. Capsules cylindric, 4-6 mm, 
glabrous. In = 14, 28, 42 (all counts from Mexico, tide Weller & 
Denton 1976). 

Flowering Jun-Sep(-Oct). Rocky slopes, ledges and crevices, 
ridge tops, canyons, sandy washes, floodplains, mesquite-baccharis, 
mesquite-acacia, hackberry-willow, oak-juniper-pinyon, oak-maple, 
pine-oak woodlands; (1 100-)1300-2200(-2800) m. Native to the 
southwestern USA — Arizona (Cochise, Navajo, Pima, and Santa Cruz 
COS.), New Mexico (Colfax, Otero, San Miguel, and Taos cos.), and 
Texas (Brewster, Culberson, and Jeff Davis cos.), Mexico (Chihuahua, 
Coahuila, Durango, Nuevo Leon, San Luis Potosi, Sonora, Tamaulipas, 
Zacatecas, and southward to Chiapas), and Central America; reported to 
be naturalized in California and on other continents, but identities of 
these plants all need to be verified. 

Collections of Oxalis latifolia Kunth (as identified here) from 
northern Mexico, southwestern Texas, eastern New Mexico, and 
southern Arizona were identified by Denton (1973) as O. alpina, O. 
drummondii, and "O. aff. drummondii.'''' Oxalis drummondii as mapped 
by Omduff and Denton (1998, Fig. 2B) almost certainly is O. latifolia. 
Oxalis latifolia sensu stricto occurs widely in Mexico north to all states 
bordering the USA. Populations in northern Mexico and the USA tend 
to have more rounded leaflets and apparently do not produce bulblets - 
- they perhaps ultimately may be better identified by a different name, 
but they are neither O. alpina (with bulblet production) nor O. 
drummondii (with 3-nerved bulb scales and different leaf morphology). 
Denton (1973, p. 572) observed that O. latifolia 'is probably composed 



Phytologia (December 2009) 91(3) 513 



of a number of races and perhaps includes a number of introgressants 
with other species." 

Lourteig (2000) recognized four subspecies of O.xalis latifoUa 
— her concept of subsp. latifolia restricted it to South America and the 
West Indies (even though the type was collected in Mexico); subsp. 
schraderiana (Kunth) Lourteig is entirely South American; subsp. 
vespertilionis (Zucc.) Lourteig occurs in montane Mexico south to 
Guatemala; subsp. galeottii (Turcz.) Lourteig is the expression that she 
recognized as occurring into the USA. In contrast, most others, 
including Denton (1973), have treated O. galeottii Turcz. as a distinct 
species of central and southern Mexico, broadly sympatric with O. 
latifolia. 

5. Oxalis drummondii A. Gray [nom. nov.], Smithsonian Contr. 
Knowl. 5(6): 25. 1853. Oxalis vespertilionis Torrey & A. Gray, Fl. 
N. Amer. 1: 679. 1840 (non Zucc. 1834). TYPE: USA. Texas. No 
other locality data, T. Drummond III. 8 (holotype: NY, NY-digital 
image!). Oxalis latifolia subsp. vespertilionis (Zucc.) Lourteig 
(Bradea 7: 591. 2000), a South American taxon, is heterotypic with 
O. drummondii. 

Plants perennial, acaulescent, arising from a scaly bulb, 
glabrous: bulb scales 3-nerved, margins villous-ciliate on distal 1/3- 
1/2. Leaves all basal; leaflets 3, obtriangular to obcordate, (6-)14-34 
mm, lobed 1/4-4/5 length, lobes apically convex to nearly truncate, 
green on both surfaces, sometimes adaxially with red splotches in an 
irregular medial band, oxalate deposits absent, petioles 5-16 cm. 
Flowers 3-10 in umbelliform cymes, distylous or rarely homostylous; 
scapes (7-)ll-23 cm; sepal apices with a pair (or 3-6) of orange, 
thickened, apically confluent tubercles; petals (8-) 15-23 mm, pink to 
violet or purple-violet. Capsules cylindric, 4-12 mm, pubescent. 2n = 
14. 

Flowering Mar-Nov; sandy-gravelly soil, limestone soil, 
disturbed areas, prairies, limestone hills, open woodlands, chaparral; 
20-300 m. Native to Texas and Mexico (Chihuahua, Coahuila, 
Durango, Nuevo Leon, Sonora, Tamaulipas). 

Oxalis drummondii is recognized by the production of a single 
bulb with 3-nervcd scales, obtriangular leaflets, large flowers, and thick 



514 HInroloiiia { December 2009) 91(3) 



tubercles at the sepal tips. Attributions of this species to Arizona and 
southern New Mexico apparently are based on identifications by 
Denton (1973) of plants from those states as O. drummondii and "aff. 
O. drummondii.'" These collections are identified here mostly as O. 
laiijolia. Denton (1973) cited, but did not map, a historical collection 
(NY) from Oklahoma as O. drummondii, significantly disjunct 
northward from its main range. Recent accounts of the flora of the state 
have not included the species. 

O.xalis madrensis Rose (= O. lean is R. Knuth), listed by 
Denton (1973) as a synonym of O. drummondii, is instead a distinctive 
species (bulblets numerous, bulb scales 5-9-nerved, flowers large, blue, 
8-12 per scape), apparently restricted to high elevation habitats in 
northeastern Mexico and probably closely related to O. alpina (Nesom 
in prep). 

6. Oxalis violacea L., Sp. PI. 1: 434. 1753. Aceiosella violacea (L.) 
Kuntze, Revis. Gen. PI. 1: 90. 1891. lonoxalis violacea (Linnaeus) 
Small, Fl. S.E. U.S. 665, 1332. 1903. Lectotype (Reveal in Jarvis 
2007, p. 717). Kalm s.n.. Herb. Linn. No. 600.12 (LINN). The 
protologue noted "Habitat in Virginia, Canada." 

Plants perennial, acaulescent, arising from a single bulb, rarely 
producing slender, scale-leaved rhizomes with a bulblet at the tip of 
each, glabrous, rarely without leaves; bulb scales 3-nerved, margins 
villous-ciliate on distal 1/3-1/2. Leaves all basal; leaflets 3, rounded- 
obcordate to obreniform, (5-)8-15(-20) mm, lobed 1/4-1/3 length, 
lobes apically convex, bright green above, often with a purplish, lateral 
band, slightly paler green to purple beneath, oxalate deposits along the 
margins only at the base of the notch, petioles (4-)7-13(-24) cm. 
Flowers (l-)2-8(-19) in umbelliform cymes, distylous; scapes (6-)9- 
23(-31) cm; sepal apices with a pair of narrow, orange, apically 
confluent tubercles; petals 10-18 mm, rose-purple or lavender to pink 
or white. Capsules ovoid, 4-5 mm. 2n = 28. 

Flowering Apr-May(-Jul) (with leaves) and Aug-Oct (usually 
without leaves, following rains). Sandy soil, gravelly soils, prairies, 
limestone glades, hills of granite, limestone, and rocky-clay, rock 
outcrops, bluffs, bottomland, oak-pine, oak-hickory, live oak, juniper 
woodland, cutover pine, roadsides, disturbed sites, abandoned fields; 



Phxtolo^ia (December 2009) 91(3) 5 1 5 



50-400(-1000) m. Native to the eastern USA (Alabama. Arkansas, 
Connecticut. Delaware. District of Columbia, Florida, Georgia, Illinois, 
Indiana. Iowa. Kansas. Kentucky, Louisiana, Massachusetts. Marviand, 
Michigan. Minnesota. Missouri, Mississippi. Nebraska. New Jersey, 
New York, North Carolina, North Dakota. Ohio. Oklahoma, 
Pennsylvania. Rhode Island, South Carolina. South Dakota. Tennessee, 
Texas. \'irginia. X'ermont. West \'irginia. and Wisconsin) and Mexico 
(Coahuila). 

Oxalis violacea is restricted in its native range to the eastern 
USA (barely into Mexico, see below), reaching wesnvard as far as the 
line of states from North Dakota to Texas. Plants identified by Denton 
(1973) as O. violacea and "aff O. violacea'' from Arizona and New 
Mexico are identified here as 0. metcalfei and O. latifolia. It is 
possible that her identifications were influenced by an emphasis on the 
oxalate deposits in the leaflet notches, which occur in O. violacea and 
in O. metcalfei. although there is a distinct difference in the 
morphology and placement of the deposits. Similarly, reports of 
naturally occurring O. violacea in Colorado are based on 
misidentifications (see counts- citations from Colorado. abo\e; CU 
Museum 2009: Emshwiller et al. in press). In noting its occurrence in 
Wyoming (Dom 2001. p. 259) obser\'ed that it has been "collected only 
once, in 1881 or 1882" in Yellowstone National Park — if correctly 
identified, this record surely was from a planting. Denton (1973. p. 
606) cited the collection: "Wyoming: Park Co: [not mapped, probably 
introduced] Yellowstone Nat. Park. S. 188I-I882. Fonvood VS-317388 
(US)." 

^'oung ( 1958. p. 63) noted that "There is no e\idence that 
[Oxalis violacea] has ever occurred in Britain as a wild plant, and it 
should be removed from the British list. Chevalier (1940, p. 682) was 
likewise of the opinion that French records for it were erroneous." 
Liogier ( 1988) reported that Oxalis violacea is "cultixated and escaped 
in Puerto Rico" — collections have not been seen in the present smdy 
to confirm or dispute that. 

Denton (1973) did not report Oxalis violacea in Mexico, but 
two collections unequivocally identified as that species have been made 
from northern Coahuila along the Rio Grande, immediately across the 
river from eastern Brewster County. Texas. These two sites are only 



5 1 6 Phxloloiiia (December 2009) 91(3) 



slightly southwest from an apparently disjunct locality at the 
southwestern extremity of the USA range of O. violacea. Texas. Val 
Verde Co.: ca. 10 mi W of Comstock on U.S. Highway 90, floor of 
Seminole Canyon, ca. 0.5 mi above its conlluence with Presa Canyon, 
Seminole Canyon State Historical park, 16 Oct 1988, Lnhus 379 (TEX). 
Mexico. Coahuila. In hills just across the river from mouth of 
Maravillas Creek, Black Gap Wildlife Management Area (Brewster 
Co.), 29° 33' 29-34"N, 102° 45-46'W, steep Imiestone slopes of Rio 
Grande canyon and tributaries, 500-950 m, Dasylirion, Agave, Acacia, 
Larrea, 6 Apr 1973, Johnston et al. W589'/2N (TEX); one of the 
deepest parts of Boquillas Canyon, below (downstream from) Cave of 
the Blessed Virgin, 29° 13'N, 102° 54' 30"W, very steep limestone 
slopes, 770 m, Dasylirion, Agave, Karwinskia, Hechtia, 19 Oct 1973, 
Johnston et al. 12359 (TEX). 

7. Oxalis debilis Kunth in A. Humboldt et al., Nov. Gen. Sp. 5(qto.): 
236. 1821. Acetosella debilis (Kunth) Kuntze, Rev. Gen. PI. 1: 92. 
1891. Type: Venezuela. Inter La Venta Grande et urbem Caracas, 
alt. 550 hex, Jan 1800, Hwnholdt & Bonpland [681] (holotype: P 
fiche!). 

Oxalis martiana Zucc, Dcnkschr. Konigl. Akad. Wiss. Munchcn 9: 
144. 1825. lonoxalis martiana (Zucc.) Small, Fl. S.E. U.S. 665. 
1903. Type: Brazil. Rio de Janeiro, prope Sebastianopolis, Martins 
s.n. (holotype: M). Fide Denton ( 1 973) and Lourteig (2000). 

Oxalis corymbosa DC, Prodr. 1: 696. 1824. Oxalis debilis var. 
corymbosa (DC.) Lourteig, Ann. Missouri Bot. Gard. 67: 840. 1980 
[1981]. Oxalis debilis subsp. corymbosa (DC.) O. Bolos & Vigo, 
FI. Paisos Catalans 2: 286. 1990. Lectotype (Lourteig 1981): 
Insula Borbona etc. (G-DC fiche!). The protologue noted "in ins. 
Borboniae et Mauritii" — Bourbon Island, now called Reunion, is a 
volcanic island cast of Madagascar and southwest of Mauritius. 
Marais (1987) noted that O. debilis occurs on three of the 
Mascarene Islands (La Reunion, Maurice, Rodrigues) and is an 
"Espece Sud-americaine, anciennement introduite et naturalisee (un 
echantillon de Commerson du Gol a La Reunion, de 1771)." 

Plants perennial, acaulescent, moderately villous to glabrate, 
arising from a dense cluster of sessile bulblets; bulb scales 3-nerved. 
Leaves all basal; leaflets 3, rounded-obcordate, 17^0(-50) mm, lobcd 



Phytologia (December 2009) 91(3) 517 



1/6-1/5 length, lobes apically convex, adaxially hirsute, green to 
yellowish-green on both surfaces, oxalate deposits usually tiny, often 
dark, distributed at least around margins of distal 1/3 and often evenly 
over whole surface, petioles 10-25 cm. Flowers (3-)8-14(-28) in 
irregular cymes, mostly homostylous in North Ameica or infrequently 
tristylous; scapes 15-28 cm; sepal apices with a pair of orange 
tubercles; petals 10-16(-20) mm, violet to lavender or rose-purple. 
Capsules not observed, apparently sterile in North America. 2/? = 14 
and 28, 35 rarely, and dysploids reported (see Luo et al. 2006 for a 
summary; no counts known from North America). 

Flowering Dec-May, rarely again in the summer. Fencerows, 
yards, flower beds, roadsides, disturbed areas, hammock margins, 
sandy live oak woods, mesic woods, creek and river terraces; 5-100 m. 
Native to South America. Naturalized in California and Washington 
and in the southeastern USA (Alabama, Florida, Georgia, Mississippi, 
Louisiana, South Carolina, and Texas); naturalized also in Mexico, 
Bahamas, West Indies, Central America, Europe, southeastern Asia, 
Australia, and various Pacific Islands. 

The range O.xalis dehilis in the USA is extended here to 
include California: Marin County: Bolinas, weed in Dennis 
Breedlove's garden, 3 May 1993, Best 1459 (CAS). In August 2008, I 
observed O.xalis debilis growing in a garden, apparently without 
cultivation, at the University of Washington Botanical Gardens in 
Seattle, Washington. As I was looking closely at the plants, a Seattle 
resident told me that this species was an abundant weed in and around 
his home there. The occurrence of the species in Washington, however, 
apparently has not been documented by a voucher. 

O.xalis debilis is known as a naturalized element of the USA 
flora primarily in coastal states of the Southeast, from South Carolina to 
Georgia and Florida and westward to Texas. It usually can be 
unequivocally identified by its acaulescent habit, the plants arising from 
a cluster of small, sessile bulblets, its large, rounded leaflets with tiny, 
dark, oxalate deposits scattered evenly over the surface and/or crowded 
near the margins, and its purplish to violet flowers in an irregularly 
cymose inflorescence. In addition to those in the basal cluster, bulblets 
apparently also can be formed at the tips of filiform roots or rhizomes. 



5 1 8 Phxlolo^iia {December 2009) 91(3) 



Plants can form large, dense colonies and the species appears to be 
aggressively spreading in the USA. Lourteig (19S1, p. X41) noted that 
"This is a South American species widespread in the whole world, 
occasionally fruiting but reproducing through abundant bulbils 
developing simultaneously." 

Oxalis dehilis most commonly has been identified as O. 
corymhosa or O. dehilis subsp. coryinhosa. in expanding O. dehilis to 
include O. corymhosa at varietal rank, A. Lourteig (1981) provided no 
comment in explanation, but as later described by her (2000), the two 
taxa are differentiated primarily by the distribution of oxalate deposits 
in the leaf lamina. In O. dehilis, the dot-like deposits are crowded 
along the margins and absent to distinctly less abundant elsewhere. In 
O. corymhosa, the deposits arc evenly distributed over the whole 
lamina. In their native range in South America, the two expressions are 
broadly sympatric and intcnnediatcs are common, as they are in the 
USA. Oxalis corymhosa sensu stricto appears to be the more 
commonly naturalized form, but the O. dehilis expression occurs at 
least in North America, Asia, Africa, and Central America (collections 
at MO). Intermediates have the oxalate "dots" along the margins as 
well as over the whole surface or sometimes mostly on the outer third 
of the blades, near the margins. Annotations by Lourteig tend to 
identify both expressions as "O. dehilis var. corymhosa^ Without 
more convincing evidence that the variation is not populational in 
nature, all plants are identified here simply as O. dehilis. An analogous 
pattern of variability in distribution of foliar oxalate 'dots' occurs at 
least in O. alpina (Rose) Rose ex R. Knuth of central Mexico and in the 
more widely distributed O. tetraphylla Cav. 

8. Oxalis intermedia A. Rich., Hist. Phys. Cuba, PI. Vase. 315. 1841. 
lonoxalis intermedia (A. Rich.) Small, N. Amer. Fl. 25: 43. 1907. 
Type: Cuba, no date, de la Sagra s.n. (holotype: P; isotype: P). 

Plants perennial, acaulescent, rarely without leaves, glabrous 
or sparsely pubescent, arising from a cluster of brownish sessile- 
appearing bulblets or a bulb producing numerous slender stolons with 
bulblets at the apices; bulb scales (3-)5-7-nerved. Leaves all basal; 
leaflets 3, obtriangular to broadly obtriangular, 20-50 mm, lobed 1/5- 
1/3 length, lobes apically truncate, bright green above, paler beneath, 



Phytologia (December 2009) 91(3) 519 



oxalate deposits absent; petioles 10-22 cm. Flowers 3-12(-18) in 
umbellifoim cymes, semi-homostylous; scapes 7-30 cm; sepal apices 
with a pair of orange tubercles; petals 8-12 mm, usually lavender to 
purple, less commonly pink or white. Capsules ellipsoid, 3-8 mm, 
glabrous, usually seed-sterile and without fruit. 2n = unknown. 

Flowering Apr-Sep. Gardens, lawns, fields, orchards, 
roadsides, fencerows, moist waste areas; 5-100 m. Native to the West 
Indies. Naturalized in California, Florida, Louisiana, and Texas; 
naturalized also in Mexico (Chiapas, San Luis Potosi, and Veracruz). 
Adams (1988) described the Caribbean range as "Bahamas, Cuba, 
Puerto Rico, Virgin Is. and southwest to Martinique, also in Trinidad." 

The type collection of O.xalis intermedia was made in Cuba 
and the native range of the species is in the West Indies. It previously 
has been known as a naturalized member of the USA flora from Florida 
(Small 1933; Wunderlin & Hansen 2009; USDA, NRCS 2008). The 
range of the species in the USA is extended here by reports of 
collections made from California, Louisiana, and Texas. It also has 
been collected from Massachusetts, but it has not been confirmed as 
naturalized since the original collection. The species (as O. latifolia 
Kunth) is reported by Wunderlin and Hansen (2009) to occur in 14 
additional counties of Florida; a representative collection is cited below 
for the state. In addition to its naturalization along the Gulf Coast of 
the USA, O. intermedia also grows outside of cultivation in Veracruz 
(Denton 1973) and San Luis Potosi (SMU!), Mexico. 

California. Marin Co.: garden at Ross Station, 3 Jun 1934, 
Eastwood s.n. (GH); weed in garden at [Ross] Station, 5 Aug 1934, 
Rose 34459 (GH). Florida. Alachua Co.: locally common in shaded, 
rich loamy soil of hammock just NE of state park office bldg., Alachua 
Sink — Paynes Prairie State Preserve, on SSE side of Gainesville, 27 
Jun 2000, Anderson 19359 (MO). Louisiana. East Baton Rouge Par.: 
[city of Baton Rouge]: infrequent in oak woods 1 mi S of Louisiana 
State University on Nicholson Drive, plants never observed flowering, 
22 Feb 1975, McReynolds s.n. (MO); in a ditch at the intersection of 
Acadian Thruway and 1-12, 24 Sep 1974 [sterile], McReynolds s.n. 
(MO); Concordia Par.: Haphazard Plantation, off La. 566, 1 1 Aug 
1971, Thomas et al. 24560 (NLU). Massachusetts. Essex Co.: 



520 HIiYloloi^ia (December 2009) 91(3) 



Ncwburyport, around greenhouses, subhardy, Oct 1940, McGregor s.n. 
(GH). Texas. Webb County: Laredo, sandy soil, 23 Feb 1964, 
Arizinendi 33 (LL); Laredo, sandy loam, 24 Nov 1962, Solis 102 
(TEX); Laredo, Sanders Street, hard-packed loam, 27 Nov 1961, Vega 
and Hilariu s.n. (THX). 

Oxalis intermedia is recognized by its large, green, 
obtriangular leaves (usually with acute angles), numerous, small, 
purplish flowers, and clusters of bulblets. It "reproduces chiefly by 
bulblets as all of the collections arc seed sterile except for two 
specimens from Veracruz" (Denton 1973, p. 556). Oxalis intermedia 
has been treated as a synonym of O. latifolia by Lourteig ( 1 980), 
Howard (1988), Liogier (1988), and Wunderlin and Hansen (2008), but 
in the assessment here, and following Adams (1972), Denton (1973), 
Correll & Correll (1982), and Ward (2004), they are different species. 
The native range of O. latifolia is Central America and Mexico, 
reaching into Arizona, New Mexico, and Texas of the southwestern 
USA (see discussion above); compared to O. intermedia, it generally 
has smaller, difterently shaped leaves and ditTers in its reproductive 
biology and ecology. 

\. Leaflets obtriangular to broadly obtriangular, (20-)30-50 mm long, 
1.5-2.5(-3) times wider than long; stems and leaves arising from a 
cluster of small sessile bulblets; capsules and seeds rarely formed; 
flowers semi-homostylous; West Indies, and Veracruz, Mexico, 
introduced in southeastern USA Oxalis intermedia 

\. Leaflets obcordate to obtriangular, 15^0 mm long, l.l-2(-3) times 
wider than long; stems and leaves usually arising from a single bulb, 
rarely producing additional sessile bulblets; capsules and seeds often 
formed; flowers tristylous, rarely homostylous; southwestern USA, 
Mexico, Central America south to Panama Oxalis latifolia 

9. Oxalis triangularis A. St.-Hil., Fl. Bras. Merid. (qto. ed.) 1: 102. 

1825. Type: Brasil. Rio de Janeiro, inter saxa ad ripas fluvii uba, 

alt. circiter 600 p., Voyage 1816-21,5/. Hilaire A J 585 X (holotype: 

P; isotype: P). Fide Lourteig (2000). 
Oxalis triangularis A. St.-Hil. subsp. papilionacea (Hoffmannsegg ex 

Zucc.) Lourteig, in L.B. Smith, Fl. 111. Catarin., Oxalidaceae 101. 

1983. Oxalis papilionacea Hoffmannsegg ex Zucc, Akad. Wiss. 



Phyio login (December 2009) 91(3) 521 



Wien, Math.-Naturwiss. Kl., Denkschr. 9: 148. 1825. TYPE: Brasil. 

Para, im unbrosis, Hoffmannsegg e.\ herb. Martii 18 (holotype: M). 

Fide Lourteig (2000). 
Oxalis paliistris A. St.-Hil., Fl. Bras. Merid. (qto. ed.) 1: 127. 1825. 

Type: Brasil. Minas Gerais, Desert du Rio S. Francisco, contendas, 

marais apres Olho d'Agua, in paludosis. Voyage 1816-21, St. 

Hilaire (holotype: P; isotype: P). Fide Lourteig (2000). 
O. regnelUi Miq., Linnaea 22: 545. 1849. Type: Brasil. Caldas, 

Regnell 1143 (holotype: S; isotype: P). Fide Lourteig (2000). 
O. cathorinensis N.E. Br., Gard. Chron. ser. 3, 1: 140. 1887. Oxalis 

regnellii var. catharinensis (N.E. Br.) Norlind, Ark. Bot. 14: 10. 

1915. Type: Brasil. Santa Catarina, cult, in Kew Gard., 1887, N.E. 

Brown (holotype: K). Fide Lourteig (2000). 

Plants perennial, acaulescent, arising from short, branching 
rhizomes ca. 1 cm in diam. and covered with thickened, overlapping 
scales, sometimes with a cluster of bulblets at the rhizome base, rarely 
without leaves; rhizome and bulb scales (l-)3-ner\ed, glandular along 
the margins. Leaves all basal; leaflets 3, obtriangular to obovate- 
triangular, (20-)30-50(-60) mm, lobed ca 1/10 length or apex merely 
notched, lobes apically truncate to slightly convex, dark purple on both 
surfaces, commonly with lighter violet splotches adaxially, radiating 
from the midvein, oxalate deposits absent or as short, filiform, marginal 
lines on both sides of the notch, petioles 12-20 cm. Flowers (l-)2-5(- 
9) in umbelliform cymes, heterostylous; scapes 15-35 cm; sepal apices 
with a pair of orange tubercles; petals 15-22 mm. white to pinkish or 
pale purple. Capsules o\oid-ellipsoid, 12-18 mm. 2/z = unknown. 

Flowering Apr-May. Disturbed sites, near gardens; 5-100 m. 
Native to South America (Argentina, Boli\ia, Brazil, Paraguay, Peru?). 
Introduced in Florida and Louisiana. 

In East Feliciana Parish, Louisiana, north of Baton Rouge, 
Oxalis triangularis has spread from a planter pot into adjacent woods 
(Gerald Guala. pers. comm.). In Leon County, Florida, a population is 
growing and slowly spreading at the edge of a woodland remnant 
within the city of Tallahassee (Loran Anderson, pers. comm.). 



522 Phylologia (December 2009} 91(3} 



Lourtcig (2000) recognized two subspecies closely sympatric 
over much of their native ranges (as cited, subsp. triangularis in 
Argentina, Bolivia. Brasil, and Paraguay, subsp. papilionacea in 
Bolivia, Brasil, Paraguay, and Peru) and differing by the tbllowing 
contrasts. 

a. Sepals acute, oxalate tubercles small or absent; petals white to 

purplish, 3-4 times longer than the sepals... 

Oxalis triangularis subsp. triangularis 

a. Sepals obtuse to subacute, o.xalate tubercles thickened; petals pink 

to purplish, rarely white, about 2-2.5 times longer than the sepals... 

Oxalis triangularis subsp. papilionacea 

I have seen relatively few collections of O. triangularis in this 
study, but with these subtle differences and broad sympatry, it seems 
probable that only a single evolutionary entity exists, in any case, the 
few North American cultivated collections studied here would be O. 
triangularis sensu stricto. Forms of O. triangularis are sometimes 
recognized as ""atropurpurea" but this apparently is a horticultural 
name. 

10. Oxalis articulata Savigny in Lam., Encycl. 4: 686. 1797 [1798]. 
Uruguay. Montevideo, in pascuis. May 1767, Commerson s.n. 
(holotype: P-Juss.; isotype: P). Fide Lourteig (1982, 2000). 

Oxalis rubra A. St.-Hil., Fl. Bras. Merid. (quarto ed.) 1: 124. 1825. 
Oxalis articulata subsp. rubra (A. St.-Hil.) Lourteig, Phytologia 50: 
137. 1982. Type: Brazil. "Inveni ad ripas rivulorum prope pagulum 
Freguesia Nova, in parte australi provinciae S. Pauli quam dicunt 
Campos Geraes. Floret Martio, Voyage 1816-21, St. Hilaire C^ J 587 
(holotype: P; isotype: P). Fide Lourteig (1982, 2000). 

Plants perennial, acaulescent, sparsely strigose, arising from a 
thick, woody, irregularly nodulate-segmented rhizome often with 
persistent, thickened, and lignescent petiole bases. Leaves all basal; 
leaflets 3, rounded-obcordate, 18-20 mm. lobed 1/5-1/3 length, lobes 
apically convex, bright green above, slightly paler green to purplish 
beneath, evenly strigose-villous to strigose-hirsute on both surfaces, 
oxalate deposits concentrated mostly toward the margins or over the 
whole surface, margins densely loosely ciliate, petioles 11-30 cm. 



Phytologia (December 2009) 91(3) 523 



Flowers 3-12 in umbelliform cymes (often up to 100 inflorescences 
per plant), less commonly in irregular cymes, heterostylous; scapes 12- 
28 cm; sepal apices with a pair of orange tubercles; petals 10-14 mm, 
purplish rose to red, sporadically white. Capsules ovoid, 4-8 mm. 2n 

= 42. 

Flowering Mar-Jul. Disturbed places, especially near gardens, 
lawns, fields, roadsides; 5-250 m. Native to South America 
(Argentina, Brazil, Uruguay). Naturalized in Alabama, Arkansas, 
California, Florida, Georgia, Louisiana, Mississippi, North Carolina, 
Oklahoma, Oregon, South Carolina, Texas, and Virginia; naturalized 
also in Europe, Australia, Pacific Islands (New Zealand). Lourteig 
(1982) also cited collections from Arizona, Maryland, Pennsylvania, 
and Washington; among these, the collection from Washington perhaps 
was from a naturalized population, the others surely cultivated. 

This species in the USA commonly has been identified as 
Oxalis rubra. Oxalis rubra was treated as a subspecies of O. articulata 
by A. Lourteig (1982, 2000), but in her specimen citations and range 
descriptions, subsp. articulata and subsp. rubra have essentially the 
same native range and occur in similar habitats. Lourteig identified 
both subspecies in the USA, noting in her key that vestiture is reduced 
and the sepals are broader in subsp. rubra, but I am unable to 
distinguish two entities in the USA and evidence appears weak for 
recognizing more than a single entity. She recognized only O. 
articulata, without infraspecific taxa, in the Flora of Panama (Lourteig 
1981). 

The inclusion of Oregon in the naturalized range of Oxalis 
articulata is based on the following collection: Coos Co.: E end of 
Brandon, 3rd St. SE near Michigan Ave. SE, lawn weed, 25 m elev., 17 
May 2004, Zika 19622 (MO). 

ACKNOWLEDGEMENTS 

I am grateful to Andy Sanders at UCR and Rebecca Peters and 
Debra Trock at CAS for providing images of specimens, to Ron 
Hartman at RM for information and images of the type of O. bulbosa 
and information on the collection from Wyoming identified as O. 
violacea, staff at BRIT-SMU-VDB, GH, MO, NLU, and TEX-LL for 



524 Phytologia (December 2009) 91(3) 



their hospitality, and to ARIZ and ASU for loans (sent to MO). This 
study was done as part ot the work under contraet tor the Flora of North 
America Association in conjunction with preparation of the FNA 
treatment of O.V(///,s. 

LITERATURE CITED 

Adams, CD. 1972. Flowering Plants of Jamaica. Univ. of the West 

Indies, Mona, Jamaica. 
ARIZ Herbarium. 2009. Specimen collection database and search 

engine. University of Arizona Herbarium, Tucson. 

<http://ag.arizona.edu/herbarium/> 
Chevalier, A. 1940. Revision de quelques Oxalis utiles ou nuisables. 

Rev. Bot. Appl. 20: 657-694. 
Correll. D.S. and H.B. Correll. 1982. Flora of the Bahama 

Archipelago (including the Turks and Caicos Islands). J. Cramer, 

Vaduz. 
CU Museum. 2009. Specimen Database of Colorado Vascular Plants. 

Univ. of Colorado Museum of Natural History, Boulder. 

<http://cumuseum.coIorado.edu/Research/Botany/Databases/> 
Denton, M.F. 1973. A monograph of C>.va//5, section /o/3ava//5 

(Oxalidaceae) in North America. Publ. Mus. Mich. State Univ., 

Biol. 4 (10): 455-615. 
Dom, R.D. 2001. Vascular plants of Wyoming (ed. 3). Mountain 

West Publishing, Cheyenne, Wyoming. 
Emshwiller, E., K. Heil, and J.M. Porter. In press. Oxalidaceae. In K. 

Heil, S. O'Kane, L. Reeves, and A. Clifford (eds.). Flora of the Four 

Comers Region (Utah, Colorado, Arizona, New Mexico). Missouri 

Botanical Garden Press, St. Louis. 
Howard, R.A. 1988. Flora of the lesser Antilles. Vol.4, 

Dicotyledoneae-Part I. Oxalis, pp. 538-542. Harvard University, 

Arnold Arboretum, Jamaica Plain, Mass. 
Jarvis, C. 2007. Order out of chaos. Linnaean plant 

names and their types. Linnean Society of 

London in association with the Natural History 

Museum, London. 
Liogier, H.A. 1988. Descriptive Flora of Puerto 

Rico and Adjacent Islands. Vol. II, Leguminosae 



Phytologia (December 2009) 91(3) 525 



to Anacardiaceae. Editorial de la Univ. de Puerto 

Rico, Rio Piedras. 
Luo, S.X., D.X. Zhang, and S.S. Renner. 2006. Oxalis debilis in 

China: distribution of flower morphs, sterile pollen and polyploidy. 

Ann. Bot. 98: 459^64 
Lourteig, A. 1980 [1981]. Flora of Panama: part 4, Family 84. 

Oxalidaceae. Ann. Missouri Bot. Gard. 67: 823-850. 
Lourteig, A. 1982. Oxalidaceae extra-Austroamericanae. IV: Oxalis L. 

SqqXxo Aniculatae Y.n\iX\\. Phytologia 50: 130-142. 
Lourteig, A. 2000. Oxalis L. subgeneros Monoxalis (Small) Lourt., 

Oxalis y Trifidus Lourt. Bradea 7: 201-629. 
Marais, W. 1987. 62. Oxalidacees (incl. 63. Averrhoacees). Flore des 

Mascareignes 62: 1-9. 
Nelson, A. 1936. Rocky Mountain Herbarium studies. IV. Amer. J. 

Bot. 23:265-271. 
Omduff, R. and M.F. Denton. 1998. Oxalidaceae, Oxalis family. J. 

Ariz.-Nev. Acad. Sci. 30: 1 15-1 19. 
SEINET. 2009. Southwest Environmental Information Network. 

Created by P. McCartney, C. Gries, and collaborators. Global 

Institute of Sustainability (GIOS), Arizona State Univ., Tempe. 

<http://swbiodiversity.org/seinet/index.php> 
Sivinski, R. 2005. New Mexico Rare Plants. New Mexico Rare Plant 

Technical Council. 

<http://nmrareplants.unm.edu/droplist/oxacae.htm> 
Small, J. K. 1933. Manual of the Southeastern Flora. Univ. of North 

Carolina Press, Chapel Hill. 
USDA, NRCS. 2009. The PLANTS Database. National Plant Data 

Center, Baton Rouge, Louisiana, <http://plants.usda.gov> 
Ward, D.B. 2004. Keys to the flora of Florida— 9, 0.va//5 

(Oxalidaceae). Phytologia 86: 32^1. 
Weller, S.G. 1976b. The inheritance of tristyly in 0.va//5 section 

lonoxalis. Heredity 37: 387-393. 
Weller, S.G. 1978. Dispersal patterns and the evolution of distyly in 

Oxalis alpina. Syst. Bot. 3: 1 15-126. 
Weller, S.G. 1979. Variation in heterostylous reproductive systems 

among populations of Oxalis alpina in southeastern Arizona. Syst. 

Bot. 4:57-71. 



526 rin-roloi^ia (December 2009) 91(3) 



Wcllcr, S.G. 1980. The incompatibility relationships of tristylous 
speeies of O.xalis section lonoxalis of southern Mexico. Canad. J. 
Bot. 58: 1908-1911. 

Weller, S.G. 1981a. Fecundity in populations oi" O.xalis alpiiui in 
southeastern Arizona. Evolution 35: 197 200. 

Weller, S.G. 1981b. Pollination biology of heteromorphic populations 
ofO.xali.s alpina in southeastern Arizona. Bot. J. Linn. Soc. 83: 
189-198. 

Weller, S.G. 1986. Factors influencing frequency of the mid-styled 
morph in tristylous populations ofOxalis alpina. Evolution 40: 
279-289. 

Weller, S.G. 1992. Evolutionary modifications of tristylous breeding 
systems. Pp. 247-272 in S.C.H. Barrett [ed.]. Evolution and 
function of heterostyly. Springer- Verlag, Berlin, Germany. 

Weller, S.G. and M.F. Denton. 1976. Cytogeographic evidence for the 
evolution of distyly from tristyly in the North American species of 
O.xalis section lonoxalis. Amer. J. Bot. 63: 120-125. 

Weller, S.G., C.A. Dominguez, F.E. Molina-Frcaner, J. Fomoni, and G. 
LeBuhn. 2007. The evolution of distyly from tristyly in 
populations ofOxalis alpina in the Sky Islands of the Sonoran 
Desert. Amer. J. Bot. 94: 972-985. 

Wunderlin. R. P. and B. F. Hansen. 2009. Atlas of Florida Vascular 
Plants. [S. M. Landry and K. N. Campbell (application 
development). Florida Center for Community Design and 
Research.] Institute for Systematic Botany, Univ. of South Florida, 
Tampa, <http://www.plantatlas.usf.edu/> 

Youne, D.P. 1958. Oxalis in the British Isles. Watsonia 4: 51-69. 



Phytologia (December 2009) 91(3) 527 



NOTES ON OXALIS SECT. CORNICULATAE (OX ALIO ACE AE) 
IN THE SOUTHWESTERN UNITED STATES 

Guy L. Nesom 

2925 Hartwood Drive 

Fort Worth, TX 76109, USA 

vvwvv.guynesom.com 

ABSTRACT 

O.xolis californica, O. pilosa, and O. albicans are distinct 
species of the southwestern USA and Mexico. Geographic summaries 
are provided and a species key includes these as well as O. corniculata, 
O. dillenii, and O. stricta, which also occur in the area. Oxalis 
californica is documented from south-central Arizona by collections 
from closely adjacent sites in Pinal and Maricopa counties in the 
Superstition Wilderness Area. Outside of its native range in California, 
and Arizona, and southwestern New Mexico, O. pilosa is reported from 
probable adventive occurrences in Nevada, Utah, and Oregon. Oxalis 
albicans is documented as an adventive in southern California. 
Phytologia 91(3): 527-533 (December, 2009). 

KEY WORDS: Oxalis albicans, Oxalis californica, sect. Corniculatae, 
southwestern USA 



Eiten (1963) treated Oxalis albicans Kunth, O. pilosa Nutt. ex 
Torr. & A. Gray, and O. californica (Abrams) R. Knuth as subspecies 
within a single species (O. albicans), emphasizing their similarities and 
putatively close evolutionary relationship. Lourteig (1979) subsumed 
both O. albicans and O. pilosa within the nearly cosmopolitan O. 
corniculata L., maintaining O. californica as a separate species. As at 
least implicitly recognized by both Eiten and Lourteig, and as 
emphasized here, O. albicans and O. pilosa are sympatric in Arizona 
and northeastern Mexico and O. pilosa and O. californica are sympatric 
in southern California. Considerable variability exists in O. albicans 
and O. pilosa, but the variation does not appear to be chaotic and where 
they are sympatric, intermediates between O. albicans and O. pilosa 
and between O. pilosa and O. californica appear to be relatively 



528 Phxtoloi^ia (Dccemhcr 2009) 91(3) 



uncommon. All (apparently) who have studied Oxalis in Arizona, 
uhcre both the "albicans" and "pilosa" expressions occur widely and 
are represented by many collections, have agreed thai two taxa are 
present. Evidence thus suggests that these taxa are rcproductively 
isolated and that each of the three is appropriately treated at specific 
rank. The aim of the present report is primarily to document the major 
outlines of the geographic distribution of these species and to provide a 
guide toward their identification. 

Oxalis dillenii Jacq. and O. stricta L., species native to the 
eastern USA, occur sporadically in western localities (Nesom 2009), 
presumably as adventives. In the southwestern USA, where plants of 
the O. albicans group occur, the PLANTS Database (USDA-NRCS 
2009) records O. stricta from Arizona and New Mexico but I have not 
seen vouchers from those states; Ornduff and Denton (1998) cited 
Coconino Co. and Maricopa Co. for O. stricta. 

Oxalis corniculata in the USA is recognized by its sparsely 
hairy stems creeping and rooting at nodes, all procumbent and radiating 
from the taproot, and its well-developed stipules with broad, free 
margins and auricled apices. Peduncles and l(-3) leaves are produced 
at the nodes, short erect stems rarely. In the southwestern USA, it is an 
adventive that occurs sporadically as a lawn weed and in the vicinity of 
other horticultural endeavors. A form of O. corniculata (as collected 
and identified by George Eiten. numerous specimens at SMU) is 
common in central Mexico (collections seen from Hidalgo, Jalisco, 
Edo. Mexico, Michoacan, Morelos, and Queretaro) — these plants 
produce large, prominent stipules and nearly glabrous stems, but the 
habit varies from procumbent to ascending and the stems rarely root at 
the nodes. This expression apparently is a native form and perhaps has 
not been formally named. 

Key to species of Oxalis sect. Corniculatae in the southwestern USA 

I . Flowers usually (3-)5-7(-15) in regular or irregular cymes; stems 
with septate hairs on stems and petioles, sometimes few and 
concentrated at nodes, sometimes only on petioles.... Oxalis stricta 

1. Flowers I or 2-3 in umbelliform cymes; stems with only non-septate 
hairs. 



Phytologia (December 2009) 91(3) 529 



2. Stems (at least on the proximal halO usually densely strigose with 
stiff, antrorsely closely appressed hairs Oxalis dillenii 

2. Stems glabrous to glabrate, puberulent to hirsutulous-puberulent, or 
pilose. 

3. Stems mostly prostrate, often rooting at the nodes, mostly radiating 
from a central point, taproot rarely becoming thick-woody; stipules 
with wide, free margins and apices Oxalis corniculata 

3. Stems erect or erect and decumbent to prostrate, sporadically rooting 
at the nodes or not; stipules obsolescent or with very narrow, free 
margins, apices completely truncate, obsolescent. 

4. Stems glabrous to very sparsely puberulent; peduncles 2-9 cm; 
sepals glabrous; stipules at midstem with narrow, free margins; 
flowers 1 (-3) Oxalis californica 

4. Stems pubemlent or pilose; peduncles 1.5-5 cm; sepals strigose to 
hirsute-strigose; stipules at midstem obsolescent or with narrow, free 
margins; flowers l-2(-3). 

5. Stems puberulent to hirsutulous-puberulent, hairs usually upcurved 
or crisped, sometimes straighter, longer hairs 0.2-0.3(-0.8) mm; 
stipules at midstem obsolescent or with very narrow, free margins 
Oxalis albicans 

5. Stems sparsely to densely pilose, hairs spreading, irregularly oriented 
to somewhat regularly deflexed, longer hairs mostly 0.6-1.2 mm; 
stipules at midstem consistently with very narrow, free margins 
Oxalis pilosa 

Oxalis californica (Abrams) R. Knuth, Notizbl. Bot. Gart. Berlin- 

Dahlem7:300. 1919. 

Xanthoxalis californica Abrams, Bull. Torrey Bot. Club 34: 264. 1907. 

Oxalis albicans subsp. californica (Abrams) Eiten, Amer. Midi. 

Naturalist 69: 303. 1963. 

Oxalis californica var. subglabra Wieg., Rhodora 27: 1 19. 1925. 

Flowering (Dec-)Feb-Apr(-Jun). Slopes and flats, brushy 
ridges, roadside banks, canyon bottoms, rock outcrops, grassland, oak 
chaparral, coastal sage scrub; (5-)30-800 m; Arizona, California; 
Mexico (Baja California). 



530 Phxtoloi^hi (December 2009) 91(3) 



O.xdiis cdlifornica is recognized by its caulescent stems with 
reduced \estiture (glabrous to very sparsely short-puberulent), l(-3) 
yellow flowers on long peduncles and pedicels, the corollas often 
drying u ith a blue or purplish tinge, and relatively wide, glabrous, and 
usually purplish- or pinkish-tinged sepals. 

In California, Oxalis califomica is known to occur in Los 
Angeles (including Santa Catalina Is.), Orange, Riverside, San 
Bernadino, San Diego, Santa Barbara (including Santa Cruz Is.), and 
Ventura counties. Plants of typical O. califomica also have been 
collected in natural habitats at two sites in south-central Arizona, about 
450 kilometers east of the closest localities in its previously known 
range in southern California and northern Baja California. 

Maricopa Co.: Tonto National Forest, Superstition 
Wilderness Area, Fish Creek Canyon, ca. 2 mi from Tortilla Trailhead 
on Ariz Hwy 88, associated with Populiis fi-emontii Plataniis wrightii, 
Cephalanthus occidentalism Morns niicrophylla, growing on steep, 
rocky slope, 2800 ft, 15 Mar 1993, Rice I604\aSV). Pinal Co.: Tonto 
National Forest, Superstition Wilderness Area, Massacre Grounds, 
Forest Rd 78, ca. I mi to turnoff, TIN R9E S5SE, associated with 
Ambrosia, Dodonea viscosa, Encelia farinosa, Lycium, Qiiercus 
rurbinella, 2400 ft, 5 May 1992, Rice 1209 (ASU). Lourteig (1979) 
also recorded a collection of O. califomica from Arizona: Maricopa 
Co., Mesquite Creek, ca. 1 mi E of Tortilla Flat, ca. 1500 ft, 31 Mar 
\962>, Halverson 54 {BM). 

Oxalis pilosa Nutt. is similar in habit to O. califomica and 
occurs abundantly in the Superstition Wilderness Area in localities 
close to those of O. califomica: Maricopa Co. — Rice 1425 (ASU); 
Pinal Co.— Rice 249, 356, 729, 1695, 1698 (all ASU). It is 
distinguished from O. califomica by its pilose stems, shorter peduncles 
and pedicels, and narrower, strigose, gray-green sepals. 

Oxalis pilosa Nutt. ex Torr. & A. Gray, Fl. N. Amer. 1(2): 212. 

1838. 

Oxalis albicans subsp. pilosa (Nutt. ex Torr. & A. Gray) Eiten, Amer. 

Midi. Naturalist 69: 303. 1963. 



Phytologia (December 2009) 91(3} 531 



O. corniculata subsp. pilosa (Nutt. ex Torr. & A. Gray) Lourteig, 

Phytologia 42: 134. 1979. 

O. corniculata var. pilosa (Nutt. ex Torr. & A. Gray) B.L. Turner, 

Phytologia 77: 4. 1994. 

O. wrightii A. Gray var. pilosa (Nutt. ex Torr. & A. Gray) Wieg., 

Rhodora27: 120. 1925. 

Flowering (Feb-)Mar-Jun(-Oct). Juniper-grassland, pinyon- 
juniper, oak-juniper, oak, oak-pine, rocky and grassy hillsides, riparian 
woods (sycamore-walnut, cottonwood- willow), canyons, streamsides, 
washes, gravel bars: (700-)900-1900(-2000) m; Arizona, California, 
New Mexico, Nevada, Oregon. Utah; Mexico (Baja California, 
Chihuahua. Coahuila. Durango, Nuevo Leon. Sonora). 

The native distribution O.xalis pilosa is primarily in Arizona, 
southern California, and northwestern Mexico — it occurs as a 
probable adventive in peripheral localities, documented here. 
Nevada. Washoe Co.; Reno, sidewalk weed, 6 Jul 1980, Tiehm 6142 
(MO). New Mexico. Hidalgo Co.: Peloncillo Mts., Guadalupe Cyn, 7 
Apr 1979, Spellenberg 5072 (NMC, as reported by Spellenberg et al. 
1986). Oregon. Benton Co.: Corvallis, weed in garden, 7 Oct 2005, 
Halse 6888 (ASU). Utah. Washington Co.: St. George, lawn of 
McQuarrie Memorial Hall, 2800 ft, 9 Sep 1947, Gahvay 2215G (SMU). 
Turner's view of O. corniculata var. pilosa as widespread through 
Mexico (1994) is not corroborated in the present study, which indicates 
that it primarily occurs in northwestern Mexico, with scattered 
localities to the east in Nue\o Leon. 

OXALIS .\LBICANS Kunth, Nov. Gen. Sp. 5(qto.): 244. 1822 

O.xalis corniculata subsp. albicans (Kunth) Lourteig. Phytologia 42: 

137. 1979. 

O.xalis wrightii A. Gray, Smithsonian Contr. Knowl. 3(5): 27. 1852. 

O.xalis corniculata var. wrightii (A. Gray) B.L. Turner, Phytologia 77: 

3. 1994. 

O.xalis pilosa var. wrightii (A. Gray) Wieg., Rhodora 28: 67. 1926. 

Flowering Apr-Aug(-Oct). Desert scrub, grasslands, 
mesquite-acacia, pinyon-juniper. oak-pine-juniper, oak-buckthorn, 
riparian woodland (sycamore-hackberry-walnut-ash-willow), creek 



532 rh\t(>l(>_^la (December 2009) 91(3) 



sides, nicadows, washes, hillsides, ravines, canyons, disturbed sites; 
(600-)700-1900(-2100) m; Arizona, California, New Mexico, 
southwestern Texas; widespread in Mexico. 

O.xalis albicans is uncommon in California, documented by 
the following collection: Los Angeles Co., foothills of San Gabriel 
Mts., West Debris Basin, Brown School for Girls, rocky S slope, 1500 
ft, 21 Mar 1968, Wheeler s.n. (ASU). 

Turner's concept of O.xalis corniciilata var. wrightii, judging 
from his map (1994, Fig. 1) appears mostly to comprise western 
populations of O. dillenii Jacq., although O. wrightii sensu stricto 
(typified by a collection from Jeff Davis Co. in trans-Pecos Texas) is a 
synonym of O. albicans. The morphological concept here of O. 
albicans is essentially similar to that of Eiten (1963) and of Lourteig 
(1979, mostly from the geographical range circumscribed by her 
specimen citations). 

ACKNOWLEDGEMENTS 

I am grateful for a loan of specimens (to MO) from ASU and 
to the staffs of BRIT-SMU-VDB, GH, MO, and TEX for their 
hospitality and help while studying at those institutions. Conversations 
with Jim Henrickson about species concepts and other topics in O.xalis 
have been interesting and helpful. This study was done as part of the 
work under contract for the Flora of North America Association in 
conjunction with preparation of the FNA treatment of O.xalis. 

LITERATURE CITED 

Eiten, G. 1963. Taxonomy and regional variation of O.xalis section 

Corniciilatae, I. Introduction, keys and synopsis of the species. 

Amer. Midi. Naturalist 69: 257-309. 
Lourteig, A. 1979. Oxalidaceae extra-austroamericanae: 2. Oxalis L. 

Sectio Corniciilatae DC. Phytologia 42: 57-198. 
Nesom, G.L. 2009 (in press). Again: taxonomy of yellow-flowered 

caulescent Oxalis (Oxalidaceae) in eastern North America. J. Bot. 

Res. Inst. Texas. 



Phytologia (December 2009} 91(3) 533 



Omduff. R. and M.F. Denton. 1998. Oxalidaceae, 0.vfl//5 family. J. 

Ariz.-Xev. Acad. Sci. 30: 1 15-1 19. 
Spellenberg. R.. R. Worthington, P. Knight, and R. Fletcher. 1986. 

Additions to the flora of New Mexico. Sida 1 1 : 455-470. 
Turner. B. L. 1994. Regional variation in the North American 

elements of Oxalis corniciilara (Oxalidaceae). Phytologia 77: 1-7. 
USDA. NRCS 2009. The PLANTS Database. National Plaint Data 

Center. Baton Rouge. La. <http://plants.usda.gov> 



534 rinroloi^ia (December 2009) 91(3) 



THE GENERIC DISPOSITION OF THE AFRICAN VERNONIA 

lilAI RAE Oliv. .Jw Hiern 

(VERNONIEAE: ASTKRACEAE). 

Hurold Robinson 

Department of Botany, MRC 166, NMNH 

P.O. Box 37012, Smithsonian Institution 

Washington, DC. 20013-7012 

robinsoh@si.edu 

ABSTRACT 

Vernonia hiafrae of West and Central tropical Africa is 
transferred to the genus Disiephaniis. Pliyiologia 91(3): 534-536 
(December, 2009). 

KEY WORDS: Africa, Vemonieae, Asteraceae, Vernonia biafrae, 
Distephanus. 



Two points are important regarding the Vernonieae of Africa. 
First, none of the native species that has been called Vernonia in Africa 
truly belong to that genus (Robinson 1999a, b); and second, the 
alternative taxonomy remains incomplete. For the present, only some 
of the needed segregates have been properly established or defined 
(Robinson 1999a, 2007, 2009). One other author. Isawumi (2008),vvho 
has direct access to many of the species, has been able to make some 
further changes. A disposition is provided here for one additional 
species. Vernonia biafrae Oliv. & Hiern. 

Vernonia biafrae has been described as shrub or small tree, 
occurring in West and Central tropical Africa from the areas of Nigeria, 
Kameroon, Gabon, Equatorial Guinae, Sudan, Ethiopia, Kenya, 
Uganda, Tanzania, Zambia, and Malawi. In the most general way, its 
habit resembles plants of the Vernonia zanzibarensis Less, relationship, 
but details, such as the acute-tipped sweeping hairs on the styles and 
structure of the achene wall, belie any close relation. No attempt was 
made to place the species by Robinson (1999a) in the first effort to 
realign the African Vemonieae. 



Phytologia (December 2009) 91(3) 535 



In Jones (1981), Vernonia hiafrae was placed in Vemonia 
subsection Pawekianae S.B. Jones. This subsection was typified by 
Vernonia angiilifolia DC. 

Jeffrey (1988), in the text of his study, placed Vernonia 
biafrae in his ''Vernonia group 2 subgroup B, third aggregate" with 
mostly persistent inner involucral bracts, ca. 5-ribbed achenes, and 
ovate to cordate leaves. This "aggregate" included subsection 
Pawekianae of S.B. Jones, In a comment under the species, Jeffrey 
suggested that V. biafrae might be conspecific with the South African 
V. angulifolia. In fact, V. angulifolia, though superficially very similar, 
differed by having trinervate or triplinervate leaves, and was already 
placed in Distephanus Cass, by Robinson & Kahn (1986). An 
examination of V. biafrae shows that it has little in common with other 
species in the "aggregate" in which it was placed by Jeffrey (1988), an 
aggregate consisting primarily of V. zanzibarensis Less, and its close 
relatives. However, the papery, persistent, blunt involucral bracts with 
a median dark line, and the multiply pseudodichotomous branching of 
the inflorescence are almost identical to the condition in Distephanus 
angulifolia (DC.) H. Rob. & Kahn, and some of its close relatives such 
as D. anisochaetoides (Sond.) H. Rob. & Kahn. Thus, Jeffrey's 
placement of the species in his treatment was incorrect, but his 
comment under the species seems to have identified the correct 
relationship. 

A problem still remains in the placement of V. biafi-ae. 
Distephanus is mostly defined by its trinervate or triplinervate leaf 
venation and by its yellow florets. The leaves of V. biafrae are strictly 
pinnately veined, and its florets are reddish to purplish, as in most of 
the other genera of the Vernonieae. There are exceptions to these 
characters in some Distephanus, especially in those species in 
continental Africa, species that often lack yellow corollas. Proof will 
await DNA sequencing, but for the present, it seems that the placement 
of Jones (1981) and the comment by Jeffrey (1988) have proven 
essentially correct. The transfer is as follows. 

Distephanus biaferae (Oliv. & Hiern) H. Rob., comb. nov. Basionym: 
Vernonia biafrae Oliv. & Hiern, in Oliver, Fl. Trop. Afr. 3: 270. 

1877. 
Vernonia tufiielliae S. Moore, J. Bot. 46: 292. 1908. 



536 PhMoloiiia i December 2009) 91(3) 



Vernonia leptolepis O. Hoffm. in Engl., Pflanzenw. Osl. — Afr. C. 405. 
1895. As indicated by Jeffrey (1988), neotypification is needed. 
Such neotypification awaits more appropriate material. I follow 
Jeffrey ( 1988) in his doubt about this synonym. The Hoffmann 
(Engler 1895) description of the involucral bracts, "oblongis 
obtusis pallidis, nerve obscuriore percursis . . ." certainly applies, 
but description of the leaves as, "lanceolatis vel ovato-lanceolatis 
plerumque obtusis . . ." seems wrong unless the word "obtusis" 
applied to something other than the leaf apex. 

Vernonia verschuerenii De Wild., Bull. Jard. Bot. Brux. 5: 94. 1915. 

Vernonia rhodocalymma Chiov., Atti Reale Accad. Ital. Mem. 

Rendiconti della Classe di scienze fisiche, matematiche e natural! 
1 1 (PI. Nov. Aethiop.): 36. 1940. 

Literature Cited 

Engler, A. 1895. Die Pflanzenwelt Ost-Afrikas und der 

Nachbergebiete, 3 vol. 28 pi. Berlin. D. Reimer 
Isawumi, M. A. 2008. The status of generic revision in the African 

Vernonieae (Asteraceae). Comp. Newsl. 46: 27-48. 
Jeffrey. C. 1988. The Vernonieae in East Tropical Africa. Kew Bull. 

43(2): 195-277. 
Jones, S. B. 1981. Synoptic classification and pollen morphology of 

Vernonia (Compositae: Vernonieae) in the Old World. Rhodora 

83: 59-75. 
Robinson, H. 1999a. Revisions in paleotropical Vernonieae 

(Asteraceae). Proc. Biol. Soc. Washington 1 12(1): 220-247. 
Robinson, H. 1999b. Generic and subtribal Classification of American 

Vernonieae. Smiths. Contrib. Bot. 89: i-iv, 1-116. 
Robinson, H. 2007 [2006]. Tribe Vernonieae Cass. (1819). Pp. 165- 

192 in J. W. Kadereit and C. Jeffrey eds., Families and Genera of 

Vascular Plants, Vol. VIII. Flowering Plants -- Eudicots - 

Asterales, 740 pp. 131 illus. Part of series by Kubitzki, K. ed. 

Kubitzki's Authoritative Encyclopedia of Vascular Plants, 

Springer- Verlag. 
Robinson, H. and B. Kahn. 1986. Trinervate leaves, yellow flowers, 

tailed anthers, and pollen variation in Distephanus Cassini 

(Vernonieae: Asteraceae). Proc. Biol. Soc. Washington 99: 493- 

501. 



Phywlogia (December 2009) 91(3) 537 



CHUCOA ILICI FOLIA, A SPINY ONOSERIS ( ASTER ACEAE, 
MUTISIOIDEAE: ONOSERIDEAE) 

Jose L. Panero 

Section of Integrative Biology, I University Station, C0930, 

The University of Texas, Austin, TX 78712, USA 

panero@mail.utexas.edu 

ABSTRACT 

Molecular phylogenetic studies of several members of 
Mutisioideae show that the type species of the genus Chucoa of 
northern Peru is a member of the genus Onosehs. The combination 
Onoseris ilicifoUa is proposed. The disposition of the second species 
of Chucoa awaits molecular studies. Phytologia 91(3): 537-541 
(December, 2009). 

KEY WORDS: Chucoa, Onoseris, Onoserideae, Mutisioideae, Andes, 
Peru. 



Mutisioideae, a taxon first circumscribed based on molecular 
phylogenetic analysis (Panero and Funk 2008), includes approximately 
44 genera and 630 species. The subfamily contains three main lineages 
recognized at the tribal level: Mutisieae, Nassauvieae and Onoserideae. 
The monophyly of Mutisioideae has not been confirmed, as a few 
genera that share morphological features found in this taxon have not 
yet been included in molecular analyses, and hence our understanding 
of their relationships remains tentative. Among these unsampled taxa is 
the genus Chucoa, a seldom-collected species endemic to the Santiago 
de Chuco region of La Libertad Department in northern Peru. 

Chucoa was described by Cabrera (1955), who allied the 
genus to Gochnatia and Stijftia. The same year, Ferreyra named the 
genus Weberbaueriella to accommodate an unusual specimen of 
Asteraceae originally identified as an Onoseris. Ferreyra (1955) allied 
his new genus Weberbaueriella to Gochnatia, Onoseris and 
Chuquiraga. Chucoa and Weberbaueriella were published in the same 
year but Ferreyra (1980) acknowledged the priority of the genus 



538 P/ivfoloi-ia (December 2009) 91(3) 



Chiicoa by placing Weherhaiierlella in its synonymy. Both Ferreyra 
and Cabrera speculated that Chucoa is closely related to Gochnaiia. 
However, morphological studies of Gochnaiia and related genera 
suggested that Chucoa, because of its pubescent styles and acute anther 
appendages, is not closely related to Gochnaiia (Freire et al., 2002). 
Katinas et al. (2008, Fig. 2) placed Chucoa in an informal group of 22 
genera within their concept of tribe Mutusieac, which includes all 
members of Mutisieae and Onoserideae. sensu Panero and Funk (2008), 
but did not speculate further as to the sister taxon. Included in this 
group, because they share a similar style and anther morphology, were 
also the genera Catamixis, Oldenhuri>ia, Hyaloseris and Dinoseris. 
However, these four genera have been shown to belong to other 
lineages of Asteraceae (Panero and Funk, 2008; Panero, 2008). 

Given these multiple hypotheses of relationship based on 
morphological studies, we decided to include Chucoa ilicifolia in a 
phylogenetic analysis of Mutisioideae using chloroplast DNA so as to 
provide molecular evidence bearing upon the phylogenetic relationship 
of Chucoa. 

MATERIALS AND METHODS 

DNA was extracted from 0.25g dried leaf material of Chucoa, 
Onoseris onoseroides and Urmenetea using Qiagen's DNeasy Plant 
Mini Kit following the manufacturer's protocol for dried leaf material. 
Efficacy of the DNA extract was tested empirically using standard 
polymerase chain reaction (PCR) protocols and primers detailed in 
Panero and Crozier (2003) and Panero and Funk (2008) for the 
following chloroplast loci: ma/K, ndhD, ndh¥, rbcL and rpoB. PCR 
reactions were screened using agarose gel electrophoresis. Reactions 
with visible results were cleaned using QIAquick PCR purification 
columns and 4 microliters of each used as template DNA in cycle 
sequencing reactions following the protocols of the ABI Big Dye 
Terminator 3.1 Cycle Sequencing Kit. Cleaning of the sequencing 
reactions using the Millipore MultiScreen 96-Well Filtration Plate and 
sequencing was performed by the University of Texas ICMB Core 
DNA Facility on an ABI 3730 DNA analyzer. Raw sequence data 
were proofread using Sequencher 4.8 (Gene Codes Corporation). 
Chucoa, Onoseris onoseroides and Urmenetea sequences were aligned 



Phytologia (December 2009) 91(3) 539 



by eye with a subset of 19 taxa of Mutisioideae of the 108-taxon marK, 
ndhD, ndh¥, rbcL and rpoB alignments used in previous phylogenetic 
studies (Panero and Funk, 2008). 

Phylogenetic trees were constructed for the 22-taxon matK, 
ndhD, nd/iF, rbcL and rpoB data sets in combination using the 
maximum parsimony criterion implemented in PAUP*4blO. Branch 
support was assessed using a full heuristic bootstrap analysis with 1000 
replications. The genus Acicarpha (Calyceraceae) served as outgroup. 

RESULTS AND DISCUSSION 

Parsimony analysis of the multi-locus data matrix produced a 
single tree (Fig. 1) that placed Chucoa ilicifolia neither close to 
Chiiqidraga nor Stijftia nor Gochnatia. Instead, Chucoa was found 
sister to Onoseris onoseroides (Mutisioideae-Onoserideae) with strong 
(100%) bootstrap support, highlighting Ferreyra's observation. 

The Onoseris clade, including the type species of Chucoa and 
Onoseris, is also statistically supported (100% bootstrap), warranting 
the inclusion of Chucoa in the genus Onoseris. To formalize this 
transfer, the following combination is proposed: 

Onoseris ilicifolia (Cabrera) Panero, comb. nov. Basionym Chucoa 
ilicifolia Cabrera, Bol. Soc. Argent. Bot. 6: 40. 1955. Type: Peru: La 
Libertad, Prov. Santiago de Chuco, Angasmarca-Tulpo, A. Lopez 
Miranda 1090 (holotype: LP). 

A second species of Chucoa, C. lanceolata, has been recently 
proposed (Sancho et al., 2005). The placement of this taxon awaits 
molecular studies. 

ACKNOWLEDGMENTS 

I thank M. Dillon of the Field Museum for material of Chucoa 
ilicifolia and Tom Wendt, TEX-LL herbarium curator, for locating 
specimens of Chucoa. I thank Bonnie S. Crozier and B. L. Turner for 
reviewing the manuscript and B. Leon and A. Cano for copies of R. 
Ferreyra's publications and photos of the holotype of C. lanceolata. 



540 



Phxtolo^ia {December 2009) 91(3) 



Sequencing of the nialK, ndliD, ndliF, rhcL and rpoB genes was funded 
bvizrantNSF DEB 03441 16. 



50 changes 



Bfachyciados 

' CMaptaiia 



. Adenocauion bicokx 
— Mutisia 



PacPyiaena 



Perezia 

Trixis 



Lop^opappus 

100 



. Onosens (Chucoa) iitofoiia 
.Onosens onoseroifles 
— Onosens hasiaia 



Lycosens 



■ AphyikxJadus 



, ._.! Cnicothamnus 

I GocI 



Gochnatia riypoJeuca 

\MjndeMichia 



■ Chuquiraga 



- DasypMyllum 



■ Aacarpha 



Fig.l. Single most parsimonious tree based on the MP analysis of five 
concatenated chloroplast genes. 422 of the 13,209 nucleotide sites 
were parsimony informative. Numbers above branches indicate percent 
bootstrap support values. 

LITERATURE CITED 

Cabrera, A. L. 1955. Un nuevo genero de Mutiseas del Peru. Bol. Soc. 
Argent. Bot. 6: 40-44. 



Ferreyra, R. 1955. Weberbaueriella, un nuevo genero para las 
compuestas del Peru. Bol. Soc. Peruana Bot. 5: 1-6. 



Phytologia (December 2009) 91(3) 541 



Ferreyra, R. 1980. Notas sobre especies peruanas de los generos 
Arnaldoa. Chucoa (Compositae) y Monnina (Polygalaceae). 8: 
106-109. 

Freire, S. E.. L. Katinas. and G. Sancho. 2002. Gochnatia (Asteraceae: 
Mutisieae) and the Gochnatia complex: taxonomic 
implications from morphology. Ann. Missouri Bot. Card. 89: 525- 
550. 

Katinas, L., J. Pruski, G. Sancho and M. C. Tellerfa, 2008. The 
subfamily Mutisioideae (Asteraceae). Bot. Rev. 74: 469-716. 

Sancho, G., S. E. Freire, L. Katinas and M. C. Tellerfa. 2005. A new 
combination and a new species of Andean Mutisieae 
(Asteraceae). Taxon 54: 85-90. 

Panero, J. L. and B. S. Crozier. 2003. Primers for PCR amplification of 
Asteraceae chloroplast DNA. Lundellia 6: 1-9. 

Panero, J. L. 2008. Shared molecular signatures support the inclusion of 
Catamixis in subfamily Pertyoideae (Asteraceae). Phytologia 
90:418-424. 

Panero, J. L. and V. A. Funk. 2008. The value of sampling anomalous 
taxa in phylogenetic studies: major clades of the Asteraceae 
revealed. Mol. Phylogenet. Evol. 47: 757-782. 



Appendix 1. Voucher information and GenBank Accession numbers 
for sequences of Onoseris ilicifolia, Onoseris onoseroides, and 
Unnenetea. Voucher information listed in the following order: taxon 
name, collection, country of origin, herbarium. Genbank numbers listed 
in the following order: matK, ndhD, ndliF, rhcL, rpoB. Onoseris 
ilicifolia (Cabrera) Panero, Sagastegui et al. 16626, Peru. F. GQ890332, 
GQ890335, GQ890338, GQ89034r, GQ890344. Onoseris onoseroides 
(H.B.K.) B. L. Rob., McVaugh 22341, Mexico, TEX. GQ890333, 
GQ890336, GQ890339, GQ890342, GQ890345. Urmenetea 
atacamensis Phil., Panero & Crozier 8446, Chile, TEX. GQ890334, 
GQ890337, GQ890340, GQ890343, GQ890346. 



542 rhxtoloii'ui (December 2009) 91(3) 



PLECOSTACHYS SERPYLIAFOIJA (ASTKRACEAE) 
NATURALIZED IN CALIFORNIA 

Richard E. Ricf'ner, Jr. 

Rancho Santa Ana Botanic Garden 

1500 North College Avenue 

Claremont, California 91711-3157, U.S.A. 

niefncr(a/earthlink.net 

Guy L. Nesom 

2925 Hartwood Drive 

Fort Worth, Texas 76109, U.S.A. 

www.guynesom.com 

ABSTRACT 

Plecostachys serpyilifolia, a small, sprawling shrub endemic to 
South Africa, is reported as naturalized for the first time for California. 
Plecostachys serpyilifolia is widely cultivated and likely escaped from 
residential gardens, commercial landscape plantings, or other sources. 
In southern California, it behaves as a facultative halophyte and a 
facultative wetland species that has naturalized in alkaline wetlands and 
moist sandy to rocky alkaline to saline sites mostly along the immediate 
coast (see photo on rear cover). Accordingly, we propose that P. 
serpyilifolia be added to the National List of Plants that Occur in 
Wetlands. We provide voucher documentation, and also review its 
distribution, ecology, and mode of introduction. Phytologia 91(3): 
542-565 (December, 2009). 

Key Words: Plecostachys serpyilifolia, California, halophyte, 
hydrophyte, naturalized, wetlands 



Plecostachys serpyilifolia (P.J. Bergius) Milliard & B.L. Burtt 
has not been reported previously in treatments of the Asteraceae that 
address nonnative species growing outside of cultivation in California 
(Hickman 1993; Bossard et al. 2000; Hrusa et al. 2002; DiTomaso & 
Healy 2003; Roberts et al. 2004; Rebman & Simpson 2006; Bossard & 
Randall 2007; Clarke et al. 2007; DiTomaso & Healy 2007; Riefner & 



Phytologia (December 2009) 91(3) 543 



Boyd 2007; Grewell et al. 2007; Dean et al. 2008; Roberts 2008; Jepson 
Flora Project 2009). Plecostachys serpyllifolia was not included in the 
recent Flora of North America treatment of Gnaphalieae (Nesom 2006), 
nor has it been reported at all for North America (USDA, NRCS 2009). 

Voucher specimens: U.S.A.: CALIFORNIA: Los Angeles Co., 

City of Malibu, Zuma Lagoon at Westward Beach Rd., UTM (NAD 83) 
1 IS 0331907E 3765293N, elev. 3 m, rare, moist sand around lagoon, 6 
Aug 2004, Riefner 04-367 (TEX), same locality, 10 Nov 2007, Riefner 
07-494 (RSA); City of Malibu, ocean bluff W of El Matador State Beach, 
UTM (NAD 83) 1 IS 0326052E 3768035N, elev. 2-6 m, local, seep on sea 
cliff with evaporate salt crust, 27 Dec 2008, Riefiwr 08-385 (RSA, TEX); 
City of Malibu, ocean bluff W of El Matador State Beach, UTM (NAD 
83) lis 0326009E 3768041N, elev. 2-6 m, locally common on sea cliff 
ledges and seep with evaporate salt crust, 27 Dec 2008, Riefiier 08-387 
(RSA, TEX); City of Malibu, ca. 0.2 mi E of La Piedra State Beach, UTM 
(NAD 83) 03259 12E 3768075N, elev. ca. 3-6 m, common and invasive 
on coastal strand and bluff slope wetlands, 9 Jun 2009, Riefiier 09-108 
(CDA, RSA, SBBG, SD, TEX, UC, UCR); City of Malibu, ca. 0.25 mi W 
of La Piedra State Beach near El Pescador State Beach, UTM (NAD 83) 
0325662E 3768092N, elev. ca. 3-9 m, common and invasive on sea cliffs, 
mesic coastal bluff scrub, and slope wetlands, 9 Jun 2009, Riefiier 09-113 
(CDA, RSA, SBBG, SD, TEX, UCR); City of Malibu, vicinity of La 
Piedra State Beach, UTM (NAD 83) 0325663E 3768090N, elev. ca. 4^6 
m, common, mesic coastal bluff scrub, 9 Jun 2009, Riefner 09-118 (RSA, 
TEX). Orange Co.. City of Lake Forest, Aliso Creek, S side of Portola 
Pkwy. and W of El Toro Rd., UTM (NAD 83) 1 IS 0439205E 37246 13N, 
elev. 225 m, uncommon, seepage area on sandy alluvial terrace with 
evaporate salt cmst, 9 Sep 2005, Riefiier 05-654 (RSA), same location, 
16 May 2009, Riefiier 09-57 (RSA); City of Irvine, N side of Irvine Blvd. 
at SR-133 on-ramp, UTM (NAD 83) 0431786E 3728837N, elev. 64 m, 
rare, growing in sandy roadside wash, 26 Jul 2006, Riefiier 06-319 (RSA), 
not persistent in 2009; City of Newport Beach, Dover Beach, Newport 
Bay, vicinity of Morning Star Ln. and Polaris Dr., UTM (NAD 83) 
04I6290E 3720550N, elev. 3 m, rare, growing in coastal bluff scrub 
above high tide zone, 18 Mar 2007, Riefiier 07-153 (CDA, RSA); City of 
Laguna Beach, ocean bluff vicinity of West St. and Pacific Coast Hwy., 
UTM (NAD 83) US 0430540E 3707490N, elev. 4 m, local, coastal 
strand and bluff seep, 22 Oct 2008, Riefner 08-308 (RSA, TEX); City of 



544 P/ivfoloi^ia {December 2009) 91(3) 



Laguna Beach, viciniw of West St. and Pacific Coast Hwy., UTM (NAD 
83) lis 04304181: 3707700N, elcv. 5 m, locally common, coastal bluff 
ledges, seep, and coastal strand, 30 Dec 2004, Riefner 04-681 (RSA), 
same locality, 22 Oct 2008, Riefner OS-312 (RSA, THX); City of Dana 
Point, beach near Salt Creek, vicinity of Ritz Carlton Resort, UTM (NAD 
83) lis 0432734E 3704750N, elev. 2.5 m, uncommon, coastal strand- 
lagoon edge, 18 Jul 2009, Riefner 09-151 (CDA, RSA, UC, UCR). 
Riverside Co., City of Temecula, Vine St. at Peach Tree St., UTM (NAD 
83) lis 0491837E 3701394N, elev. ca. 341 m, rare, roadside ditch in 
sandy soil, 22 Aug 2006, Riefner 06-395 (CDA, RSA, TEX), not 
persistent in 2009; City of Temecula, Wolf Valley Rd. at Wolf Creek 
Rd., UTM (NAD 83) 1 IS 0490 185E 3702408N, elev. ca. 341 m, local, 
roadside ditch at edge of field, 22 Aug 2006, Riefner 06-397 (CDA, 
RSA), not persistent in 2009; City of Temecula, Pechanga Pkwy. at 
Pechanga Resort Dr., UTM (NAD 83) IIS 0490557E 3701614N, elev. 
338 m, weed in parking lot garden, 16 Dec 2008, Riefier 08-369 (RSA, 
TEX). San Diego Co., Leucadia, vicinity of Moonlight Beach, ca. 0.25 
mi N of B St., UTM (NAD 83) 1 IS 0471954E 3657223N, elev. 2 m, 
uncommon, moist sand in perennial bluff seep with evaporate salt crust, 
20 Apr 2009, Riefiier 09-31 (RSA, TEX). Santa Barbara Co., City of 
Carpinteria, vicinity of Padaro Ln. at 101 Fwy., UTM (NAD 83) US 
0265278E 3810619N, elev. ca. 4 m, uncommon weed in hedgerow, 30 Jan 
2009, Riefner 09- J 1 (CDA, RSA, TEX, UCR). Ventura Co., City of 
Oxnard, Mandalay Bay, vicinity of Chesapeake Dr. and Viewpoint PI., 
UTM (NAD 83) 1 IS 0294330E 3785 124N, elev. 2 m, local, open sandy 
scrub along inlet channel and adjacent irrigated landscapes, 9 May 2009, 
Riefier 09-50 (RSA, TEX). 

Plecostachys serpyllifolia has in the past been placed in 
Helichrysum, but it now resides in a separate genus created for it and its 
close relative P. polifolia (Thunb.) Hilliard & B.L. Burtt. Molecular 
studies (Bayer et al. 2000) have confinned the distinctiveness of 
Plecostachys and have shown it to be most closely related to the 
monotypic genus Tenrhynea of South Africa. 

Both species of Plecostachys are native to the coastal regions of 
southern Africa. Plecostachys serpyllifolia is restricted to South Africa 
and grows on sandy coastal flats or damp slopes mostly near the sea. It 
has also been documented from an alkaline fen, where it is apparently rare 



Phytologia (December 2009) 91(3) 545 



(Martin 1960). Plecostachys polifolia occurs mostly in South Africa but 
also barely reaches into Swaziland - it grows mostly in mountainous 
regions and usually in damp places along streams or cliffs near forests 
(Hilliard 1983; Goldblatt & Manning 2000). 

Plecostachys serpyllifolia is a small to medium, straggling or 
mounded, much-branched shrub with white-tomentose stems and leaves, 
white to often pink-tinged phyllaries, and is known by the common names 
of Clipped Lime or Vaaltee [Afinkaans] (Bond & Goldblatt 1984). It 
differs from P. polifolia in having suborbicular or broadly elliptic leaves, 
3-8 staminate florets, and involucral bracts with pure white petaloid tips 
that exceed the flowers (Hilliard 1983). Helichrysum serpyllifolium (P.J. 
Bergius) Less, and H. orbiciilare (Thunb.) Druce both are synonyms of P. 
serpyllifolia (Hilliard 1983; Bond & Goldblatt 1984). 

Widely cultivated in California, P. serpyllifolia was first 
introduced in the late 1 980s as ''Helichrysum petiolatum microphyllum"'' or 
"Nana" (San Marcos Growers 2009). However, it is best known in the 
horticultural industry as ''Helichrysum petiolare petite''' or "Petite 
Licorice." Other common names include Straw Flower or Trailing 
Licorice. Owmg to the content of volatile oils, the leaves of P. 
serpyllifolia are lightly aromatic (Tucker & Maciarello 1996), hence the 
references to "licorice" for its common names. Because it is drought- 
tolerant, easy to establish, and tolerates poor quality or recycled water 
used for irrigation, P. serpyllifolia is frequently planted in southem 
California (Costello & Jones 1994; UCI 2000; Los Angeles Unified 
School District 2007; ASLA 2008; California Friendly Plants 2008; 
County of Riverside 2008; Santa Barbara County 2008). Plecostachys 
serpyllifolia is also cultivated in South Africa where it is recommended for 
landscaping of coastal areas, alkaline sites, and wetlands (New Plant 
Nursery 2007; New Hope Nursery 2009). 

Confusion with Other Species 

Plecostachys serpyllifolia resembles Helichrysum petiolare 
Hilliard & B.L. Burtt, which is also naturalized in California. The leaves 
of H. petiolare are similarly aromatic, but much larger (10-20 mm long), 
the heads are larger, and the achenes are smooth-surfaced (vs. glandular- 
papillate in Plecostachys). 



546 FhxtoUyiiia {December 2009) 91(3) 



Plecostachy.s serpyUifolia is well-established in southern 
California, but has apparently not been detected by botanists because it 
occupies a relatively narrow range of specialized habitats. It may have 
also been overlooked because it superficially resembles Eriogonum 
cinereiiin Benth. (Coastal or Ashy Leaf Buckwheat), which co-occurs with 
P. serpyUifolia in the northern part of its range. Eriogonum cinereum is a 
rounded 1.5 m tall shrub found on beaches and coastal bluffs that has 
grayish-tomcntose oval leaves and white to pink perianth lobes. The 
horticultural industry, however, has recognized the ability of P. 
serpyUifolia to escape gardens and naturalize in native wetland habitats 
(sloughs and salt marshes), and recommend that it not be planted in 
landscapes that interface wildland areas (San Marcos Growers 2009). 
Plecostachys serpyUifoUa has also naturalized in Portugal (Almeida & 
Freitas 2006; GCW 2009), likely in coastal environments. Owing to its 
widespread use in the horticultural industry, natural adaptation to coastal 
habitats, and its establishment outside of cultivation in another 
Mediterranean climate region, it is therefore not surprising to find P. 
serpyUifoUa naturalized in coastal southern California. 

Occurrence as a Hydrophyte 

In southern California, P. serpyUifoUa occurs from San Diego 
County to Santa Barbara County. It is an occasional weed of irrigated 
gardens and roadside habitats where it is rarely persistent. This species 
has naturalized in native habitats, including moist sandy flats and open 
scrub around bays and lagoons, in alkaline seeps and wetlands, on 
rocky sea cliffs, coastal bluff scrub, the coastal strand, and alkaline 
streamside terraces. With the exception of rocky cliff and coastal bluff 
scrub habitats, most of these sites support hydrophytic vegetation, 
hydric soils, and hydrological conditions characteristic of wetlands. 
Plecostachys serpyUifolia is also reported to occur in salt marshes (San 
Marcos Growers 2009), but we have not located any populations 
naturalized in this habitat. Away from the immediate coast, plants 
migrating from gardens may not persist in dry upland habitats through 
the summer drought, but may naturalize if dispersed to summer-moist 
urban environments or native perennial wetland habitats. 

Much like its behavior in South Africa, P. serpyUifolia is most 
abundant in mesic sandy to rocky seashore habitats and alkaline 
wetlands in coastal southern California. Many nonnative species 



Phytologia (December 2009) 91(3) 547 



recently established in southern California have been identified as 
facultative or facultative wetland plants based on frequency of 
occurrence in wetlands (Reed 1988) and the "individualistic concept of 
a hydrophyte" (Riefner and Boyd 1997). The individualistic concept 
recognizes that a plant species may exhibit considerable plasticity or 
ecological amplitude in its adaptations to wet environments, which may 
represent the entire population of the species or only a subset of 
individuals (Tiner 1991). Identification of hydrophytes is important 
since the determination of the presence or absence of hydrophytic 
vegetation is needed to delineate the jurisdictional (legal) boundaries of 
wetlands, which requires the use of wetland indicator plant status 
ratings, species abundances, and several mathematical formulas (Reed 
1988; Tiner 2006; USAGE 2006). Therefore, it is critical that a species 
be accurately assigned a wetland indicator status; especially when an 
unlisted hydrophyte like P. serpyllifolia might be confused with upland 
species such as E. cinereum and H. petiolare. 

The known distribution of P. serpyllifolia in coastal southern 
California is shown on Figure 1. Thirteen sites of the 18 known 
populations were chosen for field study, which represent the diversity 
of habitats, substrates, moisture conditions, and vegetation communities 
occupied by persistent, reproducing populations of P. serpyllifolia in 
southern California. The five California sites reported as garden weeds 
or from roadside habitats (Fig. 1), where the plant is rarely persistent, 
were not included in the field evaluations. A formal jurisdictional 
wetland delineation was not conducted as part of this study. Field 
evaluations at each of the 13 P. serpyllifolia data sites, however, 
incorporated summary findings of the presence or absence of the three 
attributes of hydrophytic vegetation, hydric soils, and hydrology 
implicit to characterizing wetland communities; see USACE Wetland 
Delineation Manual and Arid West Regional Supplement (USACE 
1987, 2006) and USDA, NRCS (2006) for technical guidance and 
procedures. 



548 



riiYloloi^ia {December 2009) 91(3) 



T- 




1 1 




F I--- •■ 










T u 1 a r ■ 






CALIFORNIA 




Kern 








- B 






- 






Santa 














Barbara 




Ventura 




Carpnlena 

L 


s Angeles 


-oOxnard 
Matxlaiay Bay' 




Robert H. Meyer Memorial 

State Beach Zuma Lagoon 


c. Los Angeles 




Orange 

Riverside 




Irvine qD 




Newport Bay* °Lake Forest 

Ug<inaBeach°y oTe^uU. 




Daia Point 




San Diego 




LeucadtaS 


- jr 




-«■ 


';•■ San Diego o ;■ 



Fig. I. Known distribution of Plecostachys serpyllifolia in southern 
California; a solid circle (•) identifies the locations of naturalized 
populations, and an open square (n) identifies locations of garden 
weeds or plants collected from roadside habitats. 



Phytologia (December 2009) 91(3) 549 



Qualitative field examinations of hydrology, soils, frequency 
of occurrence, and associations with known facultative wetland species 
were conducted between June and August, 2009, to 1) determine iff. 
serpyllifolia functions as a hydrophyte in southern California, and 2) 
provide documentation to specify a wetland indicator status for addition 
to the National List of Plants that Occur in Wetlands (National List). 

Several editions of the National List are available for use, 
including an approved list (Reed 1988) and a revised list compiled by 
USFWS (1998). Each species on these lists is assigned an indicator status 
reflecting its frequency of occurrence (not degree of wetness) in wetlands, 
which includes: obligate [OBL, >99% found in wetlands]; facultative 
wetland [FACW, 67-99% found in wetlands]; facultative [FAC, 34-66% 
found in wetlands]; facultative upland [FACU, 1-33% found in wetlands]; 
and upland [UPL, <1% found in wetlands]. 

Field examinations determined that naturalized populations off. 
serpyllifolia (i.e., populations reproducing spontaneously outside of 
cultivation in wildland habitats) grow in close association with a 
predominance (greater than 50 percent) of plant species typical of 
wetlands. Plant species that comprise the hydrophytic vegetation 
community closely associated with P. serpyllifolia are listed in Table 1. 
Compiling lists of species with assigned ratings can serve an important 
role in evaluating the wetland indicator status of plants that occupy 
uplands or wetlands and species that grow in highly specialized 
habitats, such as saline environments (Lichvar and Dixon 2007). 



550 



Phxroloi^ia (Dccvmhcr 2009) 91(3) 



Table 1. Hydrophytic plants found growing with or in close proximity 
to naturalized populations of Plecostachys serpyllijolia in coastal 
southern California. The facultative wetland indicator status of each 
plant is based on the Reed (1988) and USFWS (1998) lists. An asterisk 
(*) indicates a tentative assignment that requires further review, a plus (+) 
or minus (-) designation indicates the higher or lower part of the 
frequency range for a particular indicator (respectively), and a long 
dash ( — ) indicates the plant is not included on the list. 



ASSOCIATED PLANT 
SPECIES 


REED (1988) 

INDICATOR 

STATUS 


USFWS (1998) 

INDICATOR 

STATUS 


Acacia cxclops 


— 


— 


Acacia longifolia 


— 


— 


Agrostis stolonifera 


FACW 


FACW 


Agrostis viridis (syn., A. 

semiverticillaia, Polypogon 

viridis) 


OBL 


OBL 


Ambl\opappiis pusilliis 


FACW- 


FACW- 


Anagallis arvensis 


FAC 


FAC 


Apium graveolens 


FACW* 


FACW* 


Artemisia californica 


— 


— 


Arundo donax 


FACW 


FAC+ 


Aster siibidatus var. ligidatiis 


FACW 


FACW 


Atriplex californica 


FAC 


FAC 


Atriplex glaiica 


— 


— 


Atriplex lentiformis 


FAC 


FAC 


Atriplex prostrata 


— 


FACW* 


Baccharis salicifolia 


FACW 


FACW 


Bassia hxssopifolia 


FAC 


FAC 


Cakile maritima 


FACW 


FACW 


Carpobrotus chile nsis (C. 
aequilaterus of early floras) 


— 


FAC* 


Carpobrotus edulis 


— 


— 


Chenopodiiun ainbrosioides 


FAC 


FAC 


Chenopodiiim glaucum 


FACW* 


— 


Chenopodiiun rubrum 


— 


FACU 


Cortaderia selloana 


— 


— 



Phytologia (December 2009) 91(3) 



551 



ASSOCIATED PLANT 
SPECIES 


REED (1988) 

INDICATOR 

STATUS 


USFWS(1998) 

INDICATOR 

STATUS 


Cotyledon orhiculata 


— 


— 


Cotiila coronopifolia 


FACW+ 


FACW+ 


Distichlis spicata 


FACW 


FACW 


Eriogonum parvifoliiim 


— 


— 


Heliotropiiun curassavicum 


OBL 


OBL 


Isocoma menziesii var. 

vernonioides (syn., Haplopappus 

venetus) 


FACW* 


FAC+ 


Isolepis cernua (syn., Scirpus 
cernuus) 


OBL 


OBL 


J uncus acutus subsp. leopoldii 


FACW 


FACW 


Juncus hufonius 


FACW+ 


FACW+ 


Limonium arborescens 


— 


FAC* 


Limonium perezii 


— 


— 


Limonium ramosissimum 


— 


— 


Matthiola incana 


— 


UPL 


Medicago polymorph.a (syn., M. 
hispida) 


— 


FACU- 


Melilotus alba 


FACU+ 


— 


Melilotus indica 


FAC 


FAC 


Myoporum laetum 


— 


FAC* 


Plantago major 


FACW- 


FAC 


Pluchea ordorata (syn., P. 
purpurascens) 


OBL 


FACW 


Polypogon monspeliense 


FACW+ 


FACW+ 


Pulicaria pahidosa 


— 


FACW* 


Rhus integrifolia 




— 


Ricinus communis 


FACU 


FACU 


Rumex crispus 


FACW- 


FACW- 


Rume.x maritimus 


OBL 


FACW+ 


Sali.x lasiolepis 


FACW 


FACW 


Stenotaphrum secundatum 


FAC+ 


FAC+ 


Typha domingensis 


OBL 


OBL 


Typha latifolia 


OBL 


OBL 


Xanthium strumarium 


FAC+ 


FAC+ 



552 Phytologia (December 2009) 91(3) 



Several of the species listed above lack an assigned wetland 
indicator status, which include Carpobrotiis edulis (L.) N.E. Br., 
Cortaderia selloana (Schultes) Asch. & Gracbner, Limonium perezii 
(StapO Hubb.. and Limonium ramosissimum Maire. These species, 
however, are well-known invasive plants of California's estuarine 
wetlands (Grewell et al. 2007) and should be evaluated for the next 
revision of the National List. Accordingly, as a result of this 
evaluation, P. serpyllifolia frequently grows in close association with a 
predominance of hydroph>iic plant species typical of wetlands in 
southern California. Outside of cultivation, P. serpyllifolia is 
occasionally found growing on mesic rocky cliff and coastal bluff scrub 
habitats that are influenced by ocean spray and fog-drip moisture, but 
do not support hydrophvtic vegetation. Plecostachys serpyllifolia. 
howe\er, has not established in dr\ upland communities such as coastal 
sage scrub, chaparral, grasslands, or in oak woodlands. 

Indicators of hydrophviic vegetation and hydric soils generally 
provide reliable evidence that the timing, duration, and frequency of 
wet conditions are sufficient to support wetland communities (USACE 
2006). Therefore, indicators of hydric soils and wetland hydrology 
were also recorded during this study to establish a frequency of 
occurrence of P. serpyllifolia in w etlands in order to specify a \\ etland 
indicator status for potential addition to the National List. Indicators of 
wetland hydrology summarized by US.ACE (2006) that are present at 
the 13 data sites includes Indicators Al. Surface Waters, A3. Soil 
Saturation, Bl. Water Marks (stained rocks), Bl l.Salt Crusts (on rocks 
and alluvial surfaces). B12.Biotic Crusts (including green algal mats), 
and evidence of recent soil saturation such as C3. Oxidized 
Rhizospheres. and C4.Recent Iron Reduction. Landscape positions 
conducive to development of wetlands associated with these sites 
include a streamside terrace, fringe of lagoon or bay. toe-of-slope along 
coastal bluffs, and occurrences within or adjacent to high tides along 
ocean beaches. Hydric soil indicators (USD.A. NRCS 2006) documented 
at the data collection sites includes Indicators S4. Sandy Gleyed Matrix, 
S5. Sandy Redox. F2. Loamy Gleyed Matrix, and F3. Depleted Matrix. 



Phytologia (December 2009) 91(3) 



553 



Table 2. Wetland attributes of hydrophytic vegetation, hydric soils, 
and hydrology associated with naturalized populations of Plecostachys 
serpyllifolia in coastal southern California. 



DATA 

COLLECTION 

SITES 


HABITATS 


ATTRIBUTES OF 
WETLANDS PRESENT 


Mandalay Bay, 
Ventura Co. 


Bay Inlet 
Channel 


Yes: Hydrophytic vegetation 
No: Hydric soils 
Yes: Hydrology 


ElPescador(R.H. 

Meyer) State Beach, 

Los Angeles Co. 


Slope 
Wetland 


Yes: Hydrophytic vegetation 
Yes: Hydric soils 
Yes: Hydrology 


La Piedra (R.H. 

Meyer) State Beach, 

Los Angeles Co. 


Coastal 
Strand 


Yes: Hydrophytic vegetation 
Yes: Hydric soils 
Yes: Hydrology 


La Piedra (R.H. 

Meyer) State Beach, 

Los Angeles Co. 


Coastal 
Bluff Scrub 


Yes: Hydrophytic vegetation 
No: Hydric soils 
Yes: Hydrology 


La Piedra (R.H. 

Meyer) State Beach, 

Los Angeles Co. 


Slope 
Wetland 


Yes: Hydrophytic vegetation 
Yes: Hydric soils 
Yes: Hydrology 


La Piedra (R.H. 

Meyer) State Beach, 

Los Angeles Co. 


Splash Zone 

on Cobbly 

Seashore 


Yes: Hydrophytic vegetation 
Yes: Hydric soils 
Yes: Hydrology 


El Matador (R.H. 

Meyer) State Beach, 

Los Angeles Co. 


Bluff Seep 


Yes: Hydrophytic vegetation 
Yes: Hydric soils 
Yes: Hydrology 


Zuma Lagoon, Los 
Angeles Co. 


Lagoon 


Yes: Hydrophytic vegetation 
Yes: Hydric soils 
Yes: Hydrology 


Lake Forest, Aliso 
Creek, Orange Co. 


Alluvial 
Stream 
Terrace 


Yes: Hydrophytic vegetation 
Yes: Hydric soils 
Yes: Hydrology 


Laguna Beach, 
Orange Co. 


Rocky 

Coastal 

Bluff Scrub 


No: Hydrophytic vegetation 
No: Hydric soils 
No: Hydrology 


Laguna Beach, 


Coastal 


Yes: Hydrophytic vegetation 



554 



Phxtolo^ia (December 2009) 91(3) 



DATA 

COLLECTION 

SITES 


HABITATS 


ATTRIBUTES OF 
WETLANDS PRESENT 


Orange Co. 


Strand 


Yes: Hydric soils 
Yes: Hydrology 


Dana Point, Salt 
Creek, Orange Co. 


Coastal 

Strand- 
Lagoon 


Yes: Hydrophytic vegetation 
Yes: Hydric soils 
Yes: Hydrology 


Leucadia, San 
Diego Co. 


Bluff Seep 


Yes: Hydrophytic vegetation 
Yes: Hydric soils 
Yes: Hydrology 



Based on qualitative field observations of wetland hydrology, 
hydric soils, frequency of occurrence, and associations with known 
facultative wetland species, P. serpyllifolia functions as a hydrophyte at 
several locations in southern California. Accordingly, we believe P. 
serpyllifolia should be added to the National List and propose a FAC* 
wetland indicator status. Additional regional review may be needed to 
specifically define its frequency of occurrence in wetlands as the 
species undergoes further expansions of range and colonization of non- 
hydrophytic vegetation communities on sea cliffs and coastal bluff 
scrub habitats or mesic urban environments as a garden waif. 



Occurrence as a Halophyte 

Plecostachys serpyllifolia has not been identified previously as 
a halophyte on any of the databases listing salt-tolerant plants known 
from around the world (Aronson 1989; Menzel & Lieth 2003). 
However, it has always been difficult to characterize plant responses to 
salinity in a way that is meaningful for extrapolation from species to 
species, from one set of environment conditions to another, or whether 
the plant is a facultative or an obligate halophyte (Chapman 1975; 
Koyro 2003). These issues are certainly exacerbated for species 
introduced to new regions. Additionally, unlike the national list of 
wetland plants, which defines facultative (FAC), facultative wetland 
(FACW), and obligate wetland (OBL) plant indicator ratings, little 
research has been conducted to classify obligate halophytes, i.e., plants 
that are exclusive to saline habitats versus facultative halophytes, i.e., 
plants that occupy saline and non-saline environments. 



Phytologia (December 2009) 91(3) 



555 



In southern California, numerous species identified as 
halophytes by Aronson (1989) and Menzel & Lieth (2003) frequently 
occupy saline and non-saline riparian and freshwater wetland habitats, 
and are therefore best characterized as facultative halophytes. A few 
examples include Agrostis stolonifera L., Arimdo donax L., 
Chenopodium ambrosioides L., Cot u la coronopifolia L.. Cypenis 
odoratiis L., Eleochahs palustris (L.) Roemer & Schultes, Isolepis 
cernua (Vahl) Roemer & Schultes, Jiincus bufonius L., Leptochloa 
uninervia (J. Presl) A. Hitchc. & Chase, Paspalum disticimm L., 
Plantago lanceolata L., Plantago major L., Polypogon monspeliensis 
(L.) Desf., Riime.x crispus L., Schoenoplectiis {Scirpus) californicus 
(C.A. Meyer) Sojak, Typha angustifoUa L., Typha domingensis Pers., 
and T. latifolia L. Many of these plants grow with or in close proximity 
to P. serpyllifolia. Therefore, it is important to document known 
halophytes that grow in close association with P. serpyllifolia in 
southern California, which are shown in Table 3. 

Table 3. Halophytic plants found growing with or in close proximity to 
naturalized populations of Plecostachys serpyllifolia in coastal southern 
California. Halophyte status is based on the Aronson (1989) and 
Menzel & Lieth (2003) databases. A long dash ( — ) indicates the plant 
is not included on the respecti\e list. 



ASSOCIATED PLANT 
SPECIES 


ARONSON 

(1989) 
HALOPHYTE 


MENZEL & 
LIETH (2003) 
HALOPHYTE 


Acacia cyclops 


Yes 


Yes 


Acacia longifolia 


— 


— 


Agrostis stolonifera 


Yes 


Yes 


Agrostis viridis (syn., A. 

semiverticillata, Polypogon 

viridis) 






Amblyopappus piisillus 


Yes 


Yes 


Anagallis arvensis 


Yes 


Yes 


Apium graveolens 


— 


Yes 


Artemisia californica 


— 


— 


Arundo donax 


Yes 


Yes 


Aster siibulatus var. ligulatiis 


— 


— 



556 



Phxroloi^ia (December 2009) 91(3) 



ASSOCIATED PLANT 
SPECIES 


A RON SON 

(1989) 

HALOPHYTE 


MENZEL& 
LIETH (2003) 
HALOPHYTE 


Atriplex californica 


Yes 


Yes 


Atriplex glauca 


Yes 


Yes 


Atriplex lentiformis 


Yes 


Yes 


Atriplex prostrala 


Yes 


Yes 


Baccliaris salicifolia 


— 


— 


Bassia hxssopifolia 


Yes 


Yes 


Cakile nuiritima 


Yes 


Yes 


Carpobrotus chilensis (C. 
aeqiiilatenis of early floras) 


Yes 


Yes 


Carpobrotus edidis 


Yes 


Yes 


Chenopodiiim ambrosioides 


Yes 


Yes 


Chenopodiitm glaucum 


Yes 


Yes 


Chenopodiiim riibriim 


Yes 


Yes 


Cortaderia sellouna 


— 


— 


Cotida coronopifolia 


Yes 


Yes 


Cotyledon orbicidata 


Yes 


Yes 


Distichlis spicata 


Yes 


Yes 


Eriogoniim parvifoliiim 


— 


— 


Heliotropiiim ciirassavicum 


Yes 


Yes 


Isocoma menziesii var. 

vernonioides (syn., 
Haplopappiis venetiis) 






Isolepis cerniia (syn., Scirpus 
cernnus) 


Yes 


Yes 


Juncus aciitiis subsp. leopoldii 


Yes 


Yes 


JiincLis bufonius 


Yes 


Yes 


Limoniiim arborescens 


Yes 


Yes 


Limonium perezii 


Yes 


Yes 


Limoniiim ramosissimiim 


Yes 


Yes 


Matthiola incana 


— 


— 


Medicago polymorpha (syn., 
M. hispida) 





Yes 


Melilotiis alba 


— 


Yes 


Melilotus indica 


— 


Yes 


Myoporiim laetiim 


— 


— 



Phytologia (December 2009) 91(3) 



557 



ASSOCIATED PLANT 
SPECIES 


ARONSON 

(1989) 

HALOPHVTE 


MENZEL & 
LIETH (2003) 
HALOPHVTE 


Plantago major 


Yes 


Yes 


Pliichea ordorata (syn.. P. 
piirpiirascens) 


Yes 


Yes 


Polypogon monspeliense 


Yes 


Yes 


Piilicaria pahidosa 


— 


— 


Rhus inregrifolia 


— 


— 


Ricinus communis 


— 


— 


Rumex crispus 


Yes 


Yes 


Rume.x maritimus 


Yes 


Yes 


Salix lasiolepis 


— 


— 


Stenotaphrum secundatum 


Yes 


Yes 


Typha domingensis 


Yes 


Yes 


Typga latifolia 


Yes 


Yes 


Xanthium strumarium 


— 


— 



Based on obsenations of naturalized, persistent populations in 
wildland habitats, P. serpyllifolia apparently functions as a facultative 
halophyte in southern California. It is nearly always closely associated 
with substrates ha\ing a conspicuous e\aporate salt crust, grows within 
the salt-spray and splash zones along the seashore, and it most often 
grows with or in close proximity to a predominance of well-known 
halophytes. Haloph>tes are plants capable of completing their life 
cycle in saline environments where the salt concentration of soil 
solution measures at least 5 g/'l total dissolved solids or 85 mM NaCl 
(Aronson 1989; Koyro 2003). Electrical conductivity (EC) of a soil 
saturation extract (ECe) expressed as deciSiemens/meter (dS/m), 
however, is the preferred index of measurement used to classify saline 
soils and to identify halophytes (U.S. Salinity Laborator>' Staff 1954; 
Aronson 1989). Accordingly, soil samples were collected and analyzed 
for pH and salinity to further clarify the potential halophyte status of P. 
serpyllifolia in southern California. 



Soil samples to determine pH and salinity were collected from 
the same 13 wetland attribute study sites that represent the diversity of 
habitats, substrates, moisture conditions, and vegetation communities 



558 



Phxlolo^Ui {Dccemhcr 2009) 91(3) 



occupied by P. serpyllifolia in southern California. Soil samples were 
collected in early June or in late August, 2009, from a depth of - 10- 
inches within the root-zone of Plecosiachys plants, mixed to produce a 
composite sample, cataloged, and then shipped to Wallace Laboratories 
(El Segundo, California) for analysis. The five California P. 
serpyllifolia populations reported as garden weeds or from roadside 
habitats, where the plant is rarely persistent, were not sampled for 
analysis. 

Table 4. Results of pH and salinity analysis of soil samples collected 
from sites that represent the diversity of habitats typically occupied by 
Plecostachys serpyllifolia in southern California; pH and ECe dS/m 
measured in a saturation paste extract. The higher the ECe the more 
salts are in the soil. 



DATA COLLECTION 
SITES 


HABITATS 


pH 


ECe 
dS/m 


Mandalay Bay, Ventura Co. 


Bay Inlet Channel 


6.92 


63.20 


El Pescador(R.H. Meyer) 
State Beach, Los Angeles Co. 


Slope Wetland 


7.51 


43.20 


La Piedra (R.H. Meyer) State 
Beach, Los Angeles Co. 


Coastal Strand 


7.76 


2.23 


La Piedra (R.H. Meyer) State 
Beach, Los Angeles Co. 


Coastal Bluff 
Scrub 


6.97 


43.60 


La Piedra (R.H. Meyer) State 
Beach, Los Angeles Co. 


Slope Wetland 


7.15 


4.52 


La Piedra (R.H. Meyer) State 
Beach, Los Angeles Co. 


Splash Zone on 
Cobbly Seashore 


7.31 


39.00 


El Matador (R.H. Meyer) 
State Beach, Los Angeles Co. 


Bluff Seep 


7.26 


11.70 


Zuma Lagoon, Los Angeles 
Co. 


Lagoon 


7.08 


10.30 


Lake Forest, Aliso Creek, 
Orange Co. 


Alluvial Stream 
Terrace 


7.41 


14.60 


Laguna Beach, Orange Co. 


Rocky Coastal 
Bluff Scrub 


7.55 


35.80 


Laguna Beach, Orange Co. 


Coastal Strand 


7.68 


6.87 


Dana Point, Salt Creek, 


Coastal Strand- 


7.70 


3.51 



Phytologia {December 2009) 91(3) 



559 



DATA COLLECTION 
SITES 


HABITATS 


PH 


ECe 
dS/m 


Orange Co. 


Lagoon 






Leucadia, San Diego Co. 


Bluff Seep 


7.50 


5.36 



The Soil Survey Division Staff (1993) defines classes of soil 
salinity based on electrical conductivity as follows: non-saline (0-2 
dS/m); very slightly saline (2-4 dS/m); slightly saline (4-8 dS/m); 
moderately saline (8-16 dS/m); and strongly saline (>16 dS/m). The 
minimum criterion used to determine if a plant behaves as a halophyte 
is an EC of at least 7-8 dS/m (Aronson 1989). Accordingly, based on 
preliminary analytical data, and its consistent occurrence with known 
halophytes, P. serpyllifolia appears to fiinction as a facultative halophyte 
in southern Califomia. Since salinity tolerance of plants is affected by 
many accessory factors (spring moisture, late season evapotranspiration 
that concentrates salts, drainage, nutrition, etc.), additional research to 
gain detailed knowledge regarding the salt tolerance of P. serpyllifolia 
and the mechanisms that enable this plant to grow in saline 
environments is warranted. 

Competition with Native Species 

Based on information available in the literature, P. 
serpyllifolia is not an aggressive colonizer in its native South Africa, 
nor does it appear to be invasive in Portugal. However, under optimal 
conditions of moisture, pH, and m.ild coastal environments in southern 
Califomia, P. serpyllifolia can grow to nearly 1.5 m tall and form a 
dense colony of coalescing shrubs that can displace native species. 



Plecostachys serpyllifolia has been observed to compete for 
space with Jiincus acutus L. subsp. leopoldii (Pari.) Snog., which is a 
rare species of interest to the Califomia Native Plant Society (CNPS 
List 4). Other rare plants, including Eleocharis parvula (Roemer & 
Schultes) Link ex Bluff, Nees & Schaurer (CNPS List 4), Lycium 
californicum Nutt. (CNPS List 4), Malacothrix saxatilis (Nutt.) Torrey 
& A. Gray var. saxatilis (CNPS List 4), and Suaeda taxifolia (Standley) 
Standley (CNPS List 4) were also observed growing in proximity to P. 
serpyllifolia. With the exception of Malacothrix saxatilis, each of these 
plants has been identified as a halophyte by Aronson (1989) and 
Menzel & Lieth (2003). Accordingly, the side-by-side comparisons of 



560 Phxtolo^ia (December 2009) 91(3) 



halophytcs versus the wetland indieator status of each plant shown in 
Tables 1 & 3 and the pH and salinity ranges shown in Table 4 may help 
identify rare native plant assemblages and natural communities that 
may be most susceptible to colonization by P. serpyllifolia. 

CONCLUSION AND RECOMMENDATIONS 

Although P. serpyllifolia is widespread in coastal southern 
California, most populations are small and non-invasive. Preliminary 
observations made during field investigations suggest that it can 
compete for space and displace native plants, especially in alkaline 
wetlands and in mesic to wet saline habitats along the immediate coast. 
Based on the occurrence of this species with acknowledged 
hydrophytes growing on hydric soils, P. serpyllifolia should be added at 
a minimum to the national list of wetland plants with a facultative 
(FAC*) indicator status. We believe that the frequency of occurrence 
of this species in wetlands, its associated species in California, and the 
distribution of the plant in its native land, the indicator status may quite 
possibly be facultative wetland (FACW). 

Results of preliminary laboratory analysis indicate that P. 
serpyllifolia occupies very slightly saline to strongly saline soils 
throughout its known range in coastal southern California. Based on the 
occurrence of this species with acknowledged halophytes, its 
association with salty substrates, tolerance to recurrent wetting by high 
tides and salt sprays along the seashore, and the coastal distribution of 
the plant in its native land, P. serpyllifolia should be considered for 
addition to future revisions of the world-wide halophyte database. 

Finally, there is concern about the possible invasiveness of this 
species. Plecostachys serpyllifolia apparently becomes invasive only in 
a narrow range of seashore habitats, which support numerous small 
native forbs and several rare species that might be displaced by this 
shrub. Given that, it is recommended that urban landscape programs 
discourage planting of P. serpyllifolia in coastal regions in order to 
deter its spread and establishment elsewhere in southern California. 



Phytologia (December 2009) 91(3) 561 



ACKNOWLEDGEMENTS 

We appreciate the assistance of staff at MO for providing 
access to herbarium specimens, the Library of the Rancho Santa Ana 
Botanic Garden for document retrie\aK and to Gam Wallace (Wallace 
Laboratories) for helpful discussion and interpretation of data. We are 
especially grateful to George W. Cox (San Diego State University), 
Roy Shlemon (R.J. Shlemon & Associates), and Ralph W. Tiner (U.S. 
Fish and Wildlife Ser\'ice) for providing pre-submission reviews and 
comments that greatly improved this manuscript. This research was 
funded, in part, by a grant awarded to the senior author from the 
International Foundation for Applied Research in the Natural Sciences 
(IFARNS) to study alkaline alluvial habitats in coastal southern Califomia. 

LITERATURE CITED 

Almeida, J. D. De and H. Freitas. 2006. Exotic naturalized flora of 

continental Portugal - a reassessment. Bot. Complut. 30: 1 17-130. 
American Society of Landscape Architects (ASLA). 2008. San Diego 

County invasive ornamental plant guide. San Diego Chapter, San 

Diego, CA. 
Aronson, J. A. 1989. Haloph: a data base of saU tolerant plants of the 

world. Office of Arid Land Studies, University of Arizona, Tucson, 

AZ. 
Bayer, R.J., C. F. Puttock. and S.A. Kelchner. 2000. Phylogeny of 

South African Gnaphalieae (Asteraceae) based on two non-coding 

chloroplast sequences. Amer. J. Bot. 87: 259-272. 
Bond, P. and P. Goldblatt. 1984. Plants of the Cape flora: a descriptive 

catalogue. J. of South African Bot., supplementary Vol. 13. 
Bossard, C. C. J. M. Randall, and M.C. Hoshovesky. 2000. Invasive 

plants of California's wildlands. University of Califomia Press, 

Berkeley. 
Bossard, C. C. and J. M. Randall. 2007. Nonnative plants in 

Califomia. in M. G. Barbour, T. Keeler-Wolf, and A. A. 

Schoenherr, eds. Terrestrial vegetation of Califomia, ed. 3. 

University of Califomia Press, Berkeley. Pp. 107-123. 
Califomia Friendly Plants. 2008. Landscape plants and trees; listed 

alphabetically by botanical name. Available: 



562 Phytoloi^ia (December 2009) 91(3) 



http://wwvv.thcgarden.org/siteDocs/CAFriendIyList-botunical.pdf 

[accessed May 2009]. 
Chapman, V.J. 1975. The salinity problem in general, its importance, 

distribution with special reference to natural halophytes. in A. 

Poljakoff-Mayber and J. Gale, eds. Plants in saline enviroments. 

Springer- Verlag, New York-Heidelberg-Berlin. Pp. 7-24. 
Clarke, O.F., D. Svehla, G. Ballmer, and A. Montalvo. 2007. Flora of the 

Santa Ana River and environs. Heyday Books, Berkeley. 
County of Riverside. 2008. County of Riverside guide to California 

friendly landscaping. Transportation and Management Agency, and 

Planning Department, Riverside, CA. 
Costello, L.R. and K.S. Jones. 1994. Water use classification of 

landscape species (WUCOLS): a guide to the water needs of 

landscape plants. University of California Cooperative Extension, 

San Francisco and San Mateo County Office, CA. 
Dean, E., F. Hrusa, G. Leppig, A. Sanders, and B. Ertter. 2008. 

Catalogue of nonnative vascular plants occurring spontaneously in 

California beyond those addressed in The Jepson Manual-Part II. 

Madrono 55: 93-1 12. 
DiTomaso, J.M. and E.A. Healy. 2003. Aquatic and riparian weeds of the 

West. U.C. Agriculture and Natural Resources Publication 3421, 

Oakland, CA. 
DiTomaso, J.M. and E.A. Healy. 2007. Weeds of California and other 

western states. Vol. 1, Aizoaceae-Fabaceae. U.C. Agriculture and 

Natural Resources Publication 3488, Oakland, CA. 
Global Compendium of Weeds (GCW). 2007. Plecostachys 

serpyllifolia (Asteraceae). Available: 

http://www.hear.org/gcw/species/plecostachys_serpyllifoliay 

[accessed January 2009]. 
Goldblatt, P. and J. Manning. 2000. Cape plants: a conspectus of the Cape 

flora of South Africa. Strelitzia 9. National Botanical Institute, Cape 

Town, South Africa & MBG Press, Missouri Botanical Garden, St. 

Louis, MO. 
Grewell, B.J., J.C. Callaway, and W.R. Ferren, Jr. 2007. Estuarine 

wetlands, in M.G. Barbour, T. Keeler-Wolf, and A. A. Schoenherr, 

eds. Terrestrial vegetation of California, ed. 3. University of 

California Press, Berkeley, Los Angeles, London. Pp. 124-154. 
Hickman, J.C. (ed.). 1993. The Jepson manual: higher plants of California. 

University of California Press, Berkeley. 



Phytologia {December 2009) 91(3) 563 



Hilliard, O.M. 1983. Plecostachys. in O.A. Leistner, ed. Flora of 
Southern Africa, Vol. 33, part 7, fascicle 2 Gnaphaliinae (first part). 
Botanical Research Institute, Department of Agriculture, South Africa. 
Pp. 49-51. 

Hrusa, F., B. Ertter, A. Sanders, G. Leppig, and E. Dean. 2002. 
Catalogue of non-native vascular plants occurring spontaneously in 
California beyond those addressed in The Jepson Manual-Part I. 
Madroiio 46: 61-98. 

Jepson Flora Project. 2009. Index to taxa recorded from California 
since The Jepson Manual (range extensions from outside California 
and new naturalizations). Available: 

http://ucjeps.berkeley.edu/interchange/l_index_newrange.html 
[accessed January 2009]. 

Koyro, H. 2003. Study of potential cash crop halophytes by a quick 
check system: determination of the threshold of salinity tolerance and 
the ecophysiologicai demands, in H. Lieth and M. Mochtchenko, 
eds. Cash crop halophytes: recent studies. Kluwer Academic 
Publishers, Dordrecht. Pp. 5-17. 

Lichvar, R. and L. Dixon. 2007. Wetland plants of specialized habitats 
in the arid West. U.S. Army Engineer Research and Development 
Center, Cold Regions Research and Engineering Laboratory, 
ERDC/CRREL TR-07-8, Hanover, NH. 

Los Angeles Unified School District. 2007. School design guide. City 
of Los Angeles, Los Angeles, CA. 

Martin, A.R.H. 1960. The ecology of Groenvlei, a South African fen: 
Part II. The secondary communities. J. Ecol. 48: 307-329. 

Menzel, U. and H. Lieth. 2003. Halophyle database version 2.0. in H. 
Lieth and M. Mochtchenko, eds. Cash crop halophytes: recent 
studies. Kluwer Academic Publishers, Dordrecht. Pp. 221-250. 

Nesom, G.L. 2006. Anaphalis, Eiichiton, Facelis, Gamochoeta, 
Gnaphalium, Omalotheca, Pseudognaphalium, Xerochrysum 
(Gnaphalieae). Flora of North America North of Mexico, Vol. 19. 
Oxford University Press, New York and Oxford. 

New Hope Nursery. 2009. Wetland species catalogue. Cape Point, 
South Africa. Available: 

http://capepoint. com/index. php?option=com_content&view=article 
&id=62:wetland&catid=34:retail-plant-categories&Itemid=77 
[accessed May 2009]. 



564 Fhytoloi^ia (December 2009) 91(3) 



New Plant Nursery. 2007. Catalogue: new plants for your indigenous 

palette. George East, South AtViea. 
Rebman, J. P. and M.G. Simpson. 2006. Checklist of the vascular plants 

of San Diego County, ed. 4. San Diego Natural History Museum, 

San Diego, CA. 
Riefner, R.E., Jr. and S. Boyd. 2007. New records of wetland and 

riparian plants in southern California, with recommendations and 

additions to the National List of Plant Species that Occur in 

Wetlands. J. Bot. Res. Inst. Texas 1: 709-730. 
Roberts, P.M., Jr. 2008. The vascular plants of Orange County, 

California: an annotated checklist. P.M. Roberts Publications, San 

Luis Rey, CA. 
Roberts, P.M., Jr., S.D. White, A.C. Sanders, D.E. Bramlet, and S. 

Boyd. 2004. The vascular plants of western Riverside County, 

California: an annotated checklist. P.M. Roberts Publications, San 

Luis Rey, CA. 
San Marcos Growers. 2009. Plecostachys serpyllifolia. Available: 

http://www.smgrowers.com/products/plants/plantdisplay.asp7plant 

_id=1295 [accessed April 2009]. 
Santa Barbara County. 2008. Initiation draft Mission Canyon community 

plan. Santa Barbara County Planning and Development, Office of 

Long Range Planning, Santa Barbara, CA. 
Soil Survey Division Staff 1993. Soil survey manual. U.S. 

Department of Agriculture, Agricultural Handbook No. 18, 

Government Printing Office, Washington, D.C. 
Tiner, R.W. 1991. The concept of a hydrophyte for wedand identification. 

BioScience 41: 23^247. 
Tiner, R.W. 2006. Lists of potential hydrophytes for the United States: a 

regional review and their use in wetland identification. Wetlands 26: 

624^634. 
Tucker, A.O. and M.J. Maciarello. 1996. Volatile leaf oil of 

Plecostachys serpyllifolia (Berg.) Billiard & B.L. Burtt. J. Essential 

Oil Research 8: 557-558. 
U.S. Army Corps of Engineers (USAGE). 1987. Environmental 

Laboratory, Wetlands Delineation Manual. Technical Report Y- 

87-1, U.S. Army Engineer Waterways Experimental Station, 

Vicksburg, MS. 



Phytologia {December 2009) 91(3) 565 



U.S. Army Corps of Engineers (USAGE). 2006. Interim regional 
supplement to the Corps of Engineers wetland delineation manual: 
arid west region. J.S. Wakeley, R.W. Lichvar, and C.V. Noble, eds. 
U.S. Army Engineer Research and Development Center, ERDC/EL 
TR-06-16, Vicksburg, MS. 

USDA, NRCS. 2006. Field indicators of hydric soils in the United States, 
version 6.0. G.W. Hurt and L.M. Vasilas (eds.). USDA, NRCS in 
cooperation with the National Technical Committee for Hydric Soils. 

USDA, NRCS. 2009. The PLANTS Database. National Plant Data 
Center, Baton Rouge, LA. Available: http://plants.usda.gov [accessed 
June 2009]. 

U.S. Fish and Wildlife Service (USFWS). 1998. National list of 
vascular plant species that occur in wetlands: 1998 national 
summary. Washington, D.C. Available: 

http://www.fws.gov/pacific/ecoservices/habcon/pdf/1998%20Nation 
al%201ist.pdf [accessed June 2009]. 

U.S. Salinity Laboratory Staff. 1954. Diagnosis and improvement of 
saline and alkali soils. Agricultural Handbook No. 60, USDA, U. 
S. Government Printing Office, Washington, D.C. 

University of California Irvine (UCI). 2000. University of California, 
Irvine, green and gold plan: a summary of campus landscape planning, 
implementation, and management goals for the UCI Campus. Office of 
Campus and Environmental Planning, Irvine CA. 



566 riivioloi^ia {Dvccmher 2009) 91(3) 



A NEW COMBINATION IN NORTH AMERICAN LATHY RVS 

S. L. Broich 

OSU Herbarium, Department of Botany & Plant Pathology 

Oregon State University Corvallis, OR 97331-2902, USA 

Steven. L. Broich ^i' state. or.us 

Phytologia 91(3): 566-567 (December, 2009). 

A proposal (#1396) by Reveal (1999) to conserve Lathyrus 
polymorphus Nutt. was not recommended by the nomenclature review 
committee (Brummitt 2000; McNeil et al. 2006) leaving L. decaphylliis 
Pursh to stand as the name for the native Lathyrus of the central Great 
Plains. Lathyrus decaphyUus ranges from northern Texas north to 
southwestern South Dakota, west to eastern New Mexico and Colorado 
and east to eastern Oklahoma, Kansas, and Nebraska. It is found in two 
forms: glabrous - which is most common in the eastern part of the range 
- and villous-pubescent, which is more often found in the west- 
southwest part of the range. Hitchcock (1952) made a nomenclatural 
distinction between these two populations. I believe this distinction is 
appropriate and propose the following combination for the pubescent 
form of the species: 

Lathyrus decaphyllus var. incanus (J. G. Smith & P. A. Rydberg) S. 
L. Broich, comb.nov. 

Lathyrus ornatus var. incanus J. G. Smith & P. A. Rydberg 
Fl. Neb., Rosales 64. 1895. L. incanus (Smith & Rydberg) Rydb., Bull. 
Torrey Bot. Club 33:144. 1906. Lathyrus stipulacea var. incanus 
(Smith & Rydb.) Butters & St. John Rhodora 19:163. 1917. Lathyrus 
polymorphus ssp. incanus (Smith & Ryd.) C. L. Hitchcock Univ. 
Wash. Publ. Biol. 15:35. 1952. 

TYPE: Nebraska: Sheridan County, Smith & Pound. 49, 1892. (NEB 
177806). 

ACKNOWLEDGEMENTS 

I am grateful to Dr. Robert Kaul for his help in tracking down the type 
of L. ornatus var. incanus at NEB, Drs. Laura Morrison and Kanchi 



Phytologia (December 2009) 91(3) 567 



Gandhi for reviewing the manuscript and Drs. Michael Vincent and Jay 
Raveill from the Flora of North America staff for their support of my 
work on Lathyrus and Vicia for the FNA project. 

LITERATURE CITED 

Brummitt, R. K. 2000. Report of the Committee for Spermatophyta: 50. 
Taxon 49(4):799-808. 

Hitchcock, C. L. 1952. A revision of the North American species of 
iMthyrus. Univ. Wash. Publ. Biol. 15:1-104. 

McNeill, J., S. A. Redhead, and J. H. Wiersema, eds. 2006. Proposals 
to conserve or reject. Report of the General Committee: 9. Taxon 
55:795-800. 

Reveal, J. L. 1999. (1399) Proposal to conserve the name Lathyrus 
polymorplms (Leguminosae) with a conserved type. Taxon 48:169. 



568 PhxtoloiiUi (December 2009) 91(3) 



NEW TRIBES IN ASTERACEAE 

Jose L. Panero 

Section of Integrative Biology, 1 University Station, C0930, 

The University of Texas, Austin, TX 7X712, USA 

panero@mail.utexas.edu 

V. A. Funk 

US National Herbarium, Department of Botany, P.O. Box 37012, 
Smithsonian Institution MRC 166, Washington, DC 20013-7012, USA 

ABSTRACT 

The tribal names Corymbieae, Gymnarrheneae, 
Hecastocleideae, Pertyeae, and Wunderlichieae were not validly 
published for lack of Latin descriptions. We validate these names here 
with short Latin descriptions. Phytologia 9J(3):568-570 (December, 
2009). 

KEY WORDS: Compositae, Corymbieae, Gymnarrheneae, 
Hecastocleideae, Pertyeae, Wunderlichieae. 



The original publication of tribes Corymbieae, 
Gymnarrheneae, Hecastocleideae, Pertyeae and Wunderlichieae shared 
Latin diagnoses with their corresponding subfamilies Corymbioideae, 
Gymnarrhenoideae, Hecastocleidoideae, Pertyoideae and 

Wunderlichioideae (Panero and Funk, 2002; 2007). It has been brought 
to our attention that a Latin description cannot be used to validate two 
names. We herein include a Latin diagnosis for the tribal names. 

Corymbieae Panero & V.A. Funk, tribus nov. Type: Corymbium L. 
Corymbieae Panero & V.A. Funk, Proc. Biol. Soc. Wash. 115: 910. 
2002, mnn. mtd. 

Tribus subfamiliae Corymbioideae, plantae in foliis sessilibus 
et in laminis conduplicatis. Capitula uniflora, bracteis involucri 
biseriatis, dimorphis, bracteis interioribus 2, involutes; limbis 
corollarum salverformibus. 



Phytologia (December 2009) 91(3) 569 

The tribe is monogeneric. 



Gymnarrheneae Panero & V. A. Funk, tribus nov. Type: 
Gymnarrhena Desf. Gymnarrheneae Panero & V. A. Funk, Proc. Biol. 
Soc.Wash. 115:912. 2002, ATom.m/^. 

Tribus subfamiliae Gymnarrhenoideae, herbae perennes rosettiformes. 
Capitulis subterraneis et aeriae; achaeniis dimorphis. 

The tribe is monogeneric. 



Hecastocleideae Panero & V.A. Funk, tribus nov. Type: Hecastocleis 
A. Gray. Hecastocleideae Panero & V. A. Funk, Proc. Biol. Soc. 
Wash. 115:914, 2002, now. n;/^. 

Tribus subfamiliae Hecastocleidoideae, capitulescentiis biordinatis in 
capitulis solitariis in bracteis spiniferis. 

The tribe is monogeneric. 



Pertyeae Panero & V.A. Funk, tribus nov. Type: Pertya Schultz-Bip. 
Pertyeae Panero & V.A. Funk, Proc. Biol. Soc. Wash. 1 15: 915. 2002, 
nom. nud. 

Tribus subfamiliae Pertyoideae, corollis lobis profunde dissectis 
variabiliter connatis distinctae 

The tribe contains six genera: AinsUaea DC, Catamixis Thorns, (see 
Panero, 2008), Diaspananthus Miq. (sometimes included in AinsUaea, 
see Freire. 2007), Macroclinidium Maxim., Myripnois Bunge, and 
Pertya Schultz-Bip. 



570 Phytoloiiia (December 2009) 91(3) 



Wunderlichieae Pancro & V.A. Funk, tribus nov. Type: 

Wundeiiichia Riedel ex Benth. & Hook. 1'. Wunderlichieae Pancro & 
V.A. Funk, Phytologia 89: 357. 2007, nam. luul. 

Tribus subl'aniiliac Wundcrlichioidcac (in conibinatione) foliis 
crasse coriaceis aut deciduis, corollis grandibus tubis antherarum 
exsertis, corollis plerumque actinoinorphis, capitulis phyllariis 
multiseriatis, stylis brachiis papillalis aut laevibus, et cypselis 
plerumque cylindricis 10-nervatis. 

The tribe contains four genera: Chimantaea Maguire, Steyerm. 
& Wurdack, Stenopadus S.F. Blake, Stomatochaeta (S.F. Blake) 
Maguire & Wurdack, and Wunderlichia Riedel ex Benth. & Hook. f. 

ACKNOWLEDGEMENTS 

We thank James L. Reveal for bringing this nomenclatural 
issue to our attention. We thank B. S. Crozier, J. L. Reveal and B. L. 
Turner for reading the manuscript and providing helpful suggestions. 

LITERATURE CITED 

Freire, S. E. 2007. Systematic revision and phylogeny of Ainsliaea DC. 

(Asteraceae, Mutisieae). Ann. Mo. Bot. Card. 94: 79-191. 
Panero, J. L., and V. A. Funk. 2002. Toward a phylogenetic subfamilial 

classification for the Compositae. Proc. Biol. Soc. Wash. 1 15: 909- 

922. 
Panero, J. L., and V. A. Funk. 2007. New infrafamilial taxa in 

Asteraceae. Phytologia 89: 356-360. 
Panero, J. L. 2008. Shared molecular signatures support the inclusion of 

Catamixis in subfamily Pertyoideae (Asteraceae). Phytologia 90: 

418-424. 



Phytologia (December 2009) 91(3) 571 



VARIATION AMONG THE SMOOTH-LEAF MARGINED 

JUNIPERUS OF MEXICO: ANALYSIS OF nrDNA, 4CL, ABI3 

AND petN-psbM SNPs 

Robert P. Adams 

Biology Department. Baylor University, Waco, TX 76798, USA 
Robert_Adams@baylor.edu 

ABSTRACT 

Analyses of sequence data from three nuclear genes and one 
chloroplast gene region for Jiiniperus blancoi, J. b. var. huehuentensis, J. 
mucronota, J. scopulorum and J. virginiona revealed that the J. blancoi - 
huehuentensis - mucronata complex is closely allied but distinct from J. 
scopulorum and very distinct from J. virginiana. The combined DNA 
data support J. mucronata as a sibling species to J. blancoi or as a variety 
of J. blancoi. Considerable differentiation was found in the J. blancoi 
population from El Oro (Carmona) and additional sampling is needed to 
resolve that variation. Phytologia 91(3): 571-580 (December, 2009). 

KEY WORDS: Juniperus blancoi, J. b. var. huehuentensis, J. b. var. 
mucronata, J. mucronata, J. scopulorum, J. virginiana, nrDNA(ITS), 
4-coumarate: CoA Ligase, Abscisic acid-insensitive 3, petN, psbM, 
SNPs, taxonomy. 



The smooth-leaf margined junipers of Mexico consist of 
Juniperus blancoi Mart. J. b. var. huehuentensis R. P. Adams et al., J. 
mucronata R. P. Adams and J. scopulorum Sarg. (Adams. 2008). 
These junipers are difficult to key out and their similarities in 
morphology are probably indicative of their close relationship. 
Juniperus mucronata was named for its mucronate tip leaves found on 
plants in a single population (Adams, 2000). Farjon (2005) reduced it 
to J. blancoi var. mucronata (R. P. Adams) Farjon without comment. 
The leaf essential oils of the aforementioned taxa differ mainly 
quantatively (Adams, 2000; Adams et al., 2006). 

RAPD analyses (Adams et al., 2006) indicated (Fig. 1) that J. 
mucronata is closely allied with J. blancoi and that J. blancoi var. 



572 



Phytohm (December 2009) 91 (3) 



huehuentensis is very closely allied with J. hlancoi. The volatile leaf 
oils and RAPD data supported the recognition of J. niucronaia at the 
species level. In addition, the heartwood of J. miicronata is bright 
purple, which is quite distinct from the other smooth-leaf margined 
junipers. 



Minimum spanning neiwork 
93 RAPD bands 



83 



91 



-c. 



scopulonjrn 



-c 



J blancoi 
ElOro 



'J blancoi 
El Salto 



J blancoi 
"Huehuento 



J mucronata 



1 



Figure 1. Minimum spanning network based on 93 RAPD bands. 
Adapted from Adams et al. (2006). 

In an effort to better understand the affinities of these taxa, 
sequence data has been obtained from three nuclear gene regions: 
nrDNA, 4-coumarate CoA ligase (4CL) and abscisic acid-insensitive 3, 
(ABB) and a cpDNA region, petN-spacer-psbM. The 4CL and ABB 
genes have been recently utilized in the Cupressaceae (Adams et al., 
2009). 

Peng and Wang (2008) utilized 4CL sequences to study Thuja 
species and Tliujopsis dolabrata\ they found the 4CL gene to be 
composed of 4 exons and 3 introns. Intron 2 was reported as 640 bp 
(EU 183423). Aligning the GenBank sequences for Thuja plicata 
(EU 1834 18, EU 1834 17) and Thujopsis dolabrata (EU 183423) enabled 



Phytologia {December 2009) 91(3) 573 

us to design primers to span intron 2, and resulted in 708 - 709 bp of 
sequence data. 

Lazarova, Zeng and Kermode (2001) reported on the 
occurrence of an abscisic acid-insensitive 3 (ABI3) gene homologue 
from Chamaecyparis nootkatensis (CnABI3). The ABB gene is 
composed of six exons and five introns, with the intron sizes of 105, 
113, 110, ca. 1000 and 142 bp. Primers were designed in exon 4 and 
exon 5 to amplify intron 4 (see Materials and Methods below) and 
resulted in 1483-1485 bp of sequence data. 

The cp region petN-spacer-psbM was used in phylogenetic 
studies of the Cupressaceae (Adams et al., 2009). This region resulted 
in 846-856 bp of sequence data. 

The purpose of the present study is examine new sequence 
data to further clarify the nature of differentiation among the smooth- 
leaf margined junipers of Mexico. 

MATERIALS AND METHODS 

Specimens used in this study (GenBank accessions: nrDNA, 
petN-psbM): J. blancoi, Adams 6849-6851, 2 km El Oro, s of 
Carmona, Mexico, MX (GUI 20309, GUI 203 12); J. b. var. 
hiielmentensis, Adams 10247-10249, Cerro Huehuento, Durango, MX 
(GUI 203 10, GUI 203 13); J. mitcronata, Adams 8701-8703,10 km w of 
Yepachic, Chihuahua, MX on hwy 16; J. scopiilonim, Adams 10895- 
10897, 11 km e of Kamas, UT, U.S.A. on UT 150 (EF608963, 
EF608988); J. virginiana, Adams 6753-6755, 135 and Hewitt exit, 
Hewitt, TX, U.S.A. (EF6088980, FJ46734) Voucher specimens are 
deposited at BAYLU. 

One gram (fresh weight) of the foliage was placed in 20 g of 
activated silica gel and transported to the lab, thence stored at -20° C 
until the DNA was extracted. DNA was extracted from juniper leaves 
by use of a Qiagen mini-plant kit as per manufacturer's instructions. 



574 Phyioloiila {December 2009) 91 (3) 



Amplificutioii and sequencing 

ITS (niDNA), 4CL and petN-psbM amplifications were 
performed in 30 //I reactions using 6 ng of genomic DNA. 1.5 units 
Epi-Centre Fail-Safe Taq polymerase, 15 //I 2x buffer E or K (final 
concentration: 50 mM KCl, 50 mM Tris-HCl (pH 8.3), 200 /^M each 
dNTP. plus Epi-Centre proprietary enhancers with 1.5 - 3.5 mM MgCh 
according to the buffer used) 1.8 /<M each primer (see Adams, Bartel 
and Price, 2009 for buffer enhancers used). 

Primers (5'-3'): 
ITS: ITSA-42F GAT TGA ATG ATC CGG TGA AGT 

ITSB+57RATT TTC ATG CTG GGC TCT 
These primers are modified from Blattner (1999). 

4CL: 4CL49F AAAGAGCTCATCAAATACAA 
4CL814R GAAGAGCTTCCAGCTCAG 

4CL primers are from conserved sequences in exon 2 and exon 3 of 
Thuja plicata (EU 1834 18, EU 18341 7) and Thujopsis dolabrata 
(EU 1834232) and span intron 2. 

CnABI3: CnABIllF AACAATAAGAGCAGGATGTA 
CnABI357R CCAGTTTTGGTATCAGAGTA 

Additional internal primers utilized: 

CnABIint533R CAATATTATCACGCATTTG 
CnABIint54 1 R CACAGGAGCAATATTATCAC 
CnABIint74 1 R TTACTTGAAACAATCTATTTATGT 

CnABI3 primers are from sequences in exon 4 and exon 5 of 

Chamaecyparis nootkatensis (AJ131 1 13) and span intron 4. 

petN - psbM: 

petN5F: AAC GAA GCG AAA ATC AAT CA 
psbMl 1 IR: AAA GAG AGG GAT TCG TAT GGA 

petN and psbM primers were based on conserved sequences from 
Juniperus species. 

The PCR reaction was subjected to purification by agarose gel 
electrophoresis (1.5% agarose, 70 v, 55 min.). In each case, the band 
was excised and purified using a Qiagen QIAquick gel extraction kit. 
The gel purified DNA band with the appropriate primer was sent to 



Phytologia {December 2009) 91(3) 



575 



McLab Inc. (San Francisco) for sequencing. Sequences for both 
strands were edited and a consensus sequence was produced using 
Chromas, version 2.31 (Technelysium Pty Ltd.). Alignments were 
made using MAFFT ( http://align.bmr.kyushu-u.ac.jp/mafft /). 
Minimum spanning networks were constructed from SNPs data using 
PCODNA software (Adams et al., 2006). 

RESULTS AND DISCUSSION 



Sequencing the nrDNA (ITS region) resulted in 1 139 to 1 140 
bp of sequence data with 14 mutational events that included 2 indels 
consisting of a single bp each. A minimum spanning network is shown 
in figure 1. Jiiniperus virginiana is the most distinct taxon with 9 SNPs 
separating it from J. scopuloriim (Fig. 2). The J. scopulorum 
individuals are separated by 3 SNPs from the J. blancoi - mucronata - 





^ 


P 


Minimum Spanning Network 
14 SNPs. nrDNA 

% = J. blancoi 

@ = J. b. var. huehuentensis 

O = -^ mucronata 




9 




^ = J scopulorum 
□ = J. virginiana 

El Oro Q^ 


\ 


' / 


V 


,V^^^(^ 


3 ^^ 


s/ 


V 


■j^;'~-EISalto 



Figure 2. Minimum spanning network based on 14 SNPs from nr 
DNA. 



576 



Phytoloi^ia (December 2009) 91 (3) 



hiiehuentensis complex (Fig. 2). Within the J. blancoi - mucronata - 
huehuentensis complex there is minor variation. Notice that there is 
some diversity between J. blancoi from El Salto and El Oro. Overall, J. 
blancoi, J. mucronata and J. huehuentensis are essentially 
indistinguishable in their nrDNA data. 

Sequencing the petN-psbM region of cp DNA resulted in 846 
to 847 bp of data with 17 SNPs found that included 7 indels. A 
minimum spanning network again shows (Fig. 3) J. viry,iniana to be the 
most distinct taxon. 





4 


P 


Minimum Spanning Network 
17 SNPs, cp petN-psbM 

%- J. blancoi 

@ - J b. var. huehuentensis 

Q = J mucronata 




10 




^ = J scopulorum 
Q = J virginiana 

El Salto 


o^ 


3 C 


D 


2 yj"^^ 




r 








'• / ;' '•— El Oro 



Figure 3. Minimum spanning network based on 17 SNPs from the cp 
petN-psbM region. 



Phytologia (December 2009} 91(3) 



577 



All the indels were single bases except a 7 bp deletion in J. 
blancoi individuals 6850 and 6851 from El Oro, MX (but not in 6849 
from El Oro nor in the two plants from El Salto). The taxa are very 
uniform, except for the J. blancoi individuals. Two individuals of J. 
blancoi from El Oro had 4 SNPs that differentiated these plants from 
another J. blancoi plant from El Oro. 

Analyses of the 4-coumarate: CoA ligase intron 2 (4CL) 
region resulted in 708 to 709 bp of sequence data that contained only 5 
SNPs. A single indel (1 bp deletion) was found in one J. virginiana 
sample. The minimum spanning network shows little variation (Fig. 4, 
left) except for the separation of J. virginiana by 4 SNPs from other 
taxa. 



^ 



A 



4CL. 5 SNPs 



Minimum Spanning Networks 

J. blancoi O 

(§) = J. b. var. 

huehuentensis 
O = J. mucronata 

^ = J scopulorum 

d = ^- virginiana 




ABI3, 9SNPS 



Figure 4. Minimum spanning networks using SNPs from 4CL and 
ABI3. 



Sequencing the abscisic acid-insensitive 3 (ABO) gene, intron 
4 was difficult, but yielded 1483 - 1488 bp of data with 9 SNPs. The 9 
SNPs include 4 indels and each indel occurred in all 3 plants of each 



578 



Phxioloi^ia (Dcccmhi'r 2009) 91 (3) 



taxon. A minimum spanning network based on the 9 SNPs (including 
indeis) reveals (Fig. 4, right) a different pattern than found in any of the 
other data sets. Each of the taxa are separated by 2 - 3 SNPs. ABI3 in 
J. virginiuna has its greatest affinity to ABI3 from J. mucronata and J. 
b. var. huehueniensis. 



An analysis using the SNPs from nr DNA, petN-psbM. 4CL 
and ABB sequences (4,182 bp of data) yielded 45 SNPs. The analysis 
gave 3 major groups: J. virginiana, J. scopulorum and the blancoi - 
hiiehuentensis - mucronata complex (Fig. 5). Notice that J. blancoi is 
more distinct from J. b. var. huehueniensis (8 SNPs) than from J. 
mucronata (5 SNPs). These data support the treatment of J. mucronata 
as a variety of 7. blancoi or as a sibling species to J. blancoi. 



Minimum Spanning Netv^^ork nn 
45 SNPs from nrDNA, Lj 

petN-psbM.4CL,ABI3 
(4,182 bp) 



27 



23 



= J blancoi 

@- J. b var. 

huehueniensis 
Q = J mucronata 
^ = J. scopulorum 
Q = J virginiana 




Figure 5. Minimum spanning network based on 45 SNPs from nr DNA, 
petN-psbM, 4CL and ABB sequences. 



The diversity found in the El Oro samples (5 SNPs) is 
sufficient to warrant additional studies of J. blancoi populations. 



Phytologia (December 2009) 91(3) 579 



ACKNOWLEDGEMENTS 

Thanks to Andrea Schwarzbach and Billie Turner for 
manuscript reviews. Thanks to Alicia Mastretta for making available a 
copy of her thesis for examination. Thanks to Tonya Yanke for lab 
assistance. This research was supported in part with funds from Baylor 
UniversitN'. 

LITERATURE CITED 

Adams. R. P. 1975. Statistical character weighting and similarity 

stability. Brittonia 27: 305-316. 
Adams, R. P. 2000. Systematics of smooth leaf margin Juniperus of the 

western hemisphere based on leaf essential oils and RAPD DNA 

fingerprinting. Biochem. Syst. Ecol. 28: 149-162. 
Adams, R. P. 2008. Junipers of the World: The genus Juniperus. 2nd 

Ed., Trafford Publ., Vancouver, B. C. 
Adams. R. P. J. A. Battel and R. A. Price. 2009. A new genus, 

Hesperocyparis. for the cypresses of the new world. Phytologia 

91(1): 160-185. 
Adams, R. P., M. S. G. Elizondo, M. G. Elizondo and E. Slinkman. 

2006. DNA fingerprinting and terpenoid analysis of Juniperus 

blancoi var. huehuentensis (Cupressaceae), a new subalpine 

variety from Durango, Mexico. Biochem. Syst. Ecol. 34: 205-21 1. 
Adams, R. P., A. E. Schwarzbach, and R. N. Pandey. 2003. The 

Concordance of Terpenoid, ISSR and RAPD markers, and ITS 

sequence data sets among genotypes: An example from Juniperus. 

Biochem. Syst. Ecol. 31:T75-387. 
Adams, R. P., E. von Rudloff, L. Hogge and T. A. Zanoni. 1980. The 

volatile terpenoids of Juniperus monticola f. monticola, f. 

compacta and f. orizabensis. J. Nat. Prods. 43: 417 - 419. 
Blattner, F. R. 1999. Direct amplification of the entire ITS region from 

poorly preserved plant material using recombinant PCR. 

BioTechniques 27: 1180-1186. 
Farjon, A. 2005. World checklist & Bibliography of Conifers, ed. 2., 

Kew Press, London. 



580 P/nioloi^ia (December 2009) 91 (3) 



Lazarova, G., Y. Zeng and A. R. Kermode. 2001. Cloning and 
expression of an ABSCISIC ACID-INSENSITIVE 3(abi3) gene 
honiologue from yellow-cedar (Chamaecyparis nootkatensis). J. 
Exp. Bot. 53: 1219-1221. 

Peng, D. and X-Q. Wang. 2008. Reticulate evolution in Thuja inferred 
from multiple gene sequences: Implications for the study of 
biogeographical disjunction between eastern Asia and North 
America. Molec. Phylogenetics Evol. 47: 1 190-1202. 



Phytologia (December 2009) 91(3) 581 



INDEX TO ARTICLE TOPICS AND SCIENTIFIC NAMES IN 

VOLUME 91 
(New scientific names and combinations printed in bold face.) 

Ageratina lapsensis, nom. nov 438 

Agerafina pochiitlana 438 

Arctium minus 325 

Asclepias hirtella 308 

Asclepias longifolia 308 

Asteraceae: Corymbieae, tribus nov 566 

Asteraceae: Gymnarrheneae, tribus nov 567 

Asteraceae: Hecastocleideae, tribus nov 567 

Asteraceae: Pertyeae, tribus nov 567 

Asteraceae: Wunderlichieae, tribus nov 568 

Bryaceae, nomenclatural changes 493 

Carduus acanthoides 326 

Carduus pycnocephahts 326 

Carminatia papagayana, sp. nov 88 

Carthamus tiiictoria 327 

Cedarvvood oils of Juniperus 117 

Chamaesaracha arida, sp. nov 186 

Chamaesaracha texensis, sp. nov 186 

Crataegus in Florida 18 

Callitropsis nootkatensis 141 

Centourea benedicto 327 

Chucoa ilicifolia 536 

Convolvulus carrii, sp. nov 393 

Cotula austral is 327 

Delwiensia, gen. nov 92 

Delwiensia pattersonii, comb, nov 92 

Dicerandra of Florida 270 

Dicerandra frutescens var. christmanii, comb, et stat. nov 272 

Dicerandra frutescens var. cornutissima, comb, et stat. nov 272 

Dicerandra frutescens var. immaculata, comb, et stat. nov 272 

Dicerandra frutescens var. modesta, comb, et stat. nov 273 

Dicerandra frutescens var. savannarum, comb, nov 273 

Distephanus biaferae, comb, nov 534 

Echiochloa holciformis 347 

Essential oils of Juniperus 31 



582 riiyiolosiia {December 2009} 91(3) 



Euthamia caroliniana 69 

Frui^ula heinlifolia 300 

Fraguia obovata, comb, et stat. nov 300 

Fragula xblumeri 304 

Gemmabryum sect. Tuberibryum, sect, nov 495 

(Jemmabryum sect. Caespitibryum, comb, nov 496 

Gemmabryum badium, comb, nov 496 

Gemmabryum caespiticium, comb, nov 496 

Gemmabryum kunzei, comb, nov 496 

Hesperocy paris, gen. nov 1 79 

Hesperocyparis abramsiana, comb, nov 180 

Hesperocyparis abramsiana var. butanoensis, comb, nov 287 

Hesperocyparis arizonica, comb, nov 180 

Hesperocyparis arizonica 244 

Hesperocyparis bakeri, comb, nov 180 

Hesperocyparis benthamii, comb, nov 181 

Hesperocyparis forbesii, comb, nov 181 

Hesperocyparis glabra, comb, nov 181 

Hesperocyparis glabra 244 

Hesperocyparis goveniana, comb, nov 181 

Hesperocyparis goveniana 277 

Hesperocyparis guadalupensis, comb, nov 181 

Hesperocyparis lusitanica, comb, nov 181 

Hesperocyparis macnabiana, comb, nov 1 82 

Hesperocyparis macrocarpa, comb, nov 182 

Hesperocyparis montana, comb, nov 182 

Hesparocyparis nevadensis, comb, nov 182 

Hesperocyparis pygmaea, comb, nov 182 

Hesperocyparis pygmaea 277 

Hesperocyparis sargentii, comb, nov 183 

Hesperocyparis stephensonii, comb, nov 183 

Illinois: Iroquois Co., Ground layer vegetation 400 

Iva asperifolia var. angustifolia, stat. et comb, nov 79 

Iva asperifolia var. latior, comb, nov 80 

Juniperus blancoi 570 

Juniperits durangensis 353 

Juniperus phoenicea 40 

Juniperus recurva 359 

Juniperus recurva var. uncinata, var. nov 365 



Phytologia (December 2009) 91(3} 583 



Koanophyllum coixtlahuacum, sp. nov 312 

Koanophyllum concordianum, sp. nov 312 

Koanophyllum revealii, sp. nov 316 

Koanophyllum solidaginoides 316 

Koanophyllum solidaginoides var. filicaulis, comb. & stat. nov..316 

Lathyrus decaphyllus var. incanus, comb, nov 564 

Leontodon hispidiis 328 

Leptostomopsis nivea, comb, nov 497 

Ligustnim in North America, North of Mexico 406 

Ligustriim ibota 478 

Ligiistrum japonicum 469 

Ligustrum liicidum 470 

Ligiistrum obtusifolium 475 

Ligustrum ovalifolium 474 

Ligustrum quihoui 47 1 

Ligustrum sinense 472 

Ligustum tschonoskii 479 

Ligustrum vidgare 473 

Logfia arvensis 328 

Madia elegans 328 

Matricaria courrantiana 329 

Maytemis phyllanthoides in Louisana 69 

Morus murrayana, sp. nov 106 

Non-native Asteraceae in Texas 325 

Onoseris ilicifolia, comb, nov 538 

Opuntia. in Florida 383 

Orbivestus 482 

Orbivestus catumbensis, comb, nov 487 

Orbivestus leopoldii, comb, nov 489 

Orbivestus teitensis, comb, nov 489 

Orbivestus turbinata, comb, nov 490 

Orbivestus unionis, comb, nov 490 

O.xalis in the United States 500 

O.xalis Sect. Comiculatae 526 

O.xalis albicans 530 

O.xalis articulata 52 1 

O.xalis caerulea 503 

O.xalis californica 528 

O.xalis debilis 515 



584 Phyiolo^ia (December 2009) 91(3) 



Oxalis decaphylla 505 

O.xalis drummomlii 512 

Oxalis iiitennedia 517 

Oxalis latijolia 510 

Oxalis metcalfei 506 

Oxalis pilosa 529 

Oxalis triangularis 519 

Oxalis violacea 513 

Plagiobryoides brachyneura, comb, nov 498 

Plagiobryoides cellularis, comb, nov 498 

Plagiobryoides limbata, comb, nov 498 

Plagiobryoides renauldii, comb, nov 498 

Plagiobryoides vinosula, comb, nov 498 

Plecostachys serpyllifolia 54 1 

Point of View: Nesom 62 

Panicum coloratum 347 

Ptychostomum subgenus Cladodium 497 

Rhynchosia in Alabama 3 

Rhynchosia cytisoides 8 

Rhynchosia difl'ormis 12 

Rhynchosia minima 9 

Rhynchosia reniformis 6 

hynchosia tomentosa 10 

hynchospora chapmanii 70 

Roellia 493 

Roeiliaceae, fam. nov 493 

Romiilea rosa 73 

Salvia, Sect. Scorodonia 256 

Salvia, Sect. Ulignosae 439 

Salvia aequidistans 258 

Salvia arizonica 443 

Salvia assurgens 443 

Salvia boegei 259 

Salvia breviflora 259 

Salvia chazaroana, sp. nov 444 

Salvia eplingiana 446 

Salvia firma 446 

Salvia forreri 446 

Salvia galloana, sp. nov 447 



Phytologia (December 2009) 91(3) 585 



Salvia glechomifolia 447 

Salvia hamulus 448 

Salvia hintonii 448 

Salvia indigocephala 448 

Salvia keerlii 259 

Salvia laevis 448 

Salvia lozani 449 

Salvia manantlanensis 449 

Salvia melissodora 259 

Salvia nana 449 

Salvia novoleontis, sp. nov 450 

Salvia occidua 260 

Salvia oreopola 45 1 

Salvia pannosa 260 

Salvia paulwalleri, sp. nov 451 

Salvia paupercula 260 

Salvia pericona, sp. nov 260 

Salvia prunelloides 452 

Salvia pusilla 452 

Salvia ramosa 261 

Salvia rostellata 453 

Salvia rupicola 262 

Salvia semiatrata 262 

Salvia setulosa 453 

Salvia sinaloensis 453 

Salvia tenorioi sp. nov 262 

Salvia tepicensis 264 

Salvia textitlana, sp. nov 453 

Salvia tricuspidata 454 

Salvia unicostata 455 

Salvia veronicifolia 455 

Salvia villosa 455 

Sanvitalia angustifolia 329 

Sanvitalia procumbens 329 

Schraderanthus 54 

Schraderanthus viscosus, comb, nov 55 

Scorzonera lacinata 329 

Senegalia. new combinations 26 

Senegalia guarenssis, comb, nov 27 



586 Fhytologia {December 2009) 91(3) 



Senejjalia laeta, comb, nov 27 

Seiiejjalia latifoliola, comb, et stat. nov 27 

Seiiegalia lowei, comb, nov 28 

Senegalia rhytidocarpa, comb, et stat. nov 28 

Senegalia riograndcnsis, comb, nov 28 

Senegalia skleroxyla, comb, nov 28 

Senegalia stenocarpa, nom. nov 29 

Solidago dispersa 25 1 

Solidago ludoviciana 251 

Solivia anthemifolia 330 

Sonchiis arvensis 330 

Thymophylla hartwegii 342 

Thymophylla pentacluieta 340 

Thymophylla puberula 342 

Thymophylla tenuiloba 336 

Thymophylla wrightii 336 

Trixis jaliscana, sp. nov 84 

Zamia floridana 95 



New York Botanical Garden Library 



3 5185 00275 8611 



SUBSCRIPTION INFORMATION 

PHYTOLOGIA is published three times a year. Annual 
domestic individual subscription (3 issues): $30.00. Annual domestic 
institutional subscription (3 issues): $90.00. Foreign individual 
subscription $50, Foreign institutional subscriptions $110, send 
subscription checks to Robert P. Adams, Mgr. Ed., P. O. Box 727, 
Gruver, TX 79040, USA. Please make checks payable to Phytologia. 

INFORMATION FOR AUTHORS 

Articles on botanical systematics and ecology, including 
biographical sketches, critical reviews, and summaries of literature will 
be considered for publication in PHYTOLOGIA. Manuscripts on plant 
genetics, plant breeding, plant physiology, and fungal biology and 
taxonomy will be considered if they are explicitly related to topics in 
plant systematics. Authors should arrange for two workers in the 
appropriate field to review the manuscript before submission. Copies of 
reviews should be forwarded to the editor with the manuscript. 
Additional review may occur for articles proposing significant 
nomenclatural changes and or revisions to established taxa. Effort will 
be made to locate a reviewer for author(s) if he/she desires. Language 
of manuscripts is English. Format of articles should follow past issues 
of PHYTOLOGIA (preferably single spaced and Times New Roman in 
10 point font. Please visit www.phvtologia.org for detailed computer 
file instructions. 

Cost of publication is currently $15.00 US per final page for 
publication without reprints. PDF files of papers will be made available 
to authors at www.phytologia.org. Page charges are due with 
manuscripts. No extra charges are made for line drawings or grey scale 
photos. Extra fees will be charged for color photos, the charge will be 
detemiined on an individual basis. 

All manuscripts should be submitted digitally, either by 
3.5"disk, CD, DVD or email to Robert_Adams(«: baylor.edu. 
or, if mailed, 

Phytologia, Dr. Robert Adams 
P. O. Box 727 
Gruver, TX 79040, USA 




Plecostachys serpyllifolia, the light green plant in the center of the 
photo, naturalized in California, see Riefner and Nesom, p. 541. 



TITl COMrs <»r Ml \K o 
ijnttmmlt .4frwtuu mfA* F^mtlf Atmrma 
ICkipur *: Smblmmit} Mill lillni| 



New! Volume 1 4 of Phytologia Memoirs 
B. L. Turner. The Comps of Mexico. 
A systematic account of the family 
Asteraceae (Chapter 9: Subfamily 
Mutisioideae). 130 pgs., 2009. S25. 

Also available: 

B. L. Turner. The Comps of Mexico: Chapter 
8: Liabeae and Vemonieae. Phytologia 
Memoirs Vol. 12. 144 pgs. 2007 S25. 



B. L. Turner and Tom Watson. Taxonomic 

revision of Gai/lardia (Asteraceae). Phytologia Memoirs Vol. 13. Ill 

pgs. 2007. S25 

Send check to Phytologia (see address inside cover) or see 
wwv^.phytologia.org