(navigation image)
Home American Libraries | Canadian Libraries | Universal Library | Community Texts | Project Gutenberg | Children's Library | Biodiversity Heritage Library | Additional Collections
Search: Advanced Search
Anonymous User (login or join us)
Upload
See other formats

Full text of "Report of the Clerk of the House from .."

•^mmaamm mmm t antiun m mun m m mm mmt m maut msm 



Government 
Documents 



FEDERAL I 

PUBLICATION 

i'9999 06317 W6 




nrt i mrtmii ii mnt i nfrriHMMnririr* 



w*rmmwatmuti )um4uuMmttmuiimMUU»v mmtmmaaauammKm aiutf 9 l i i 



->»,?- ""^" "T r-T - 



I 



■. 







; 



! 1? 
















• >?.->] 



BWWRUtC j* tf^tSr. - 



95th Congress j HOUSE OF REPRESENTATIVES { 2° C S^* 

1st Session J \ No. 05-26o 



REPORT 



OF THE 



CLERK OF THE 
HOUSE 



FROM 



July 1, 1977, to September 30, 1977 




November 30, 1977.— Referred to the Committee on House Administration 
and ordered to be printed 



U.S. GOVERNMENT PRINTING OFFICE } P^ 3 " 
»»-600O WASHINGTON : 1977 



9r4?$. 



DtP° S 



KOR* 



LETTER OF SUBMITTAL 

November 30, 1977. 
Hon. Thomas P. O'Neill, Jr., 
The Speaker, 

U.S. House of Representatives, 
Washington, D.C. 

Dear Mr. Speaker: I have the honor to submit a quarterly report 
of the Clerk of the House of Representatives covering receipts and 
expenditures of appropriations and other funds for the period of July 1, 
1977, through September 30, 1977, in accordance with 2 U.S.C. 104a 
and the direction of the Committee on House Administration. 

This quarterly report of the Clerk includes: (1) the name of every 
person to whom any part of such appropriations has been paid; 
(2) if for anything furnished, the quantity and price thereof; (3) if for 
services rendered, the nature of the services, the time employed, the 
name, title, and specific amount paid to each person; and (4) a com- 
plete statement of all amounts appropriated, received, or expended 
and any unexpended balances. 

Reports required to be submitted to the House of Representatives 
under 2 U.S.C. 104a shall be printed as House documents. This report 
is submitted accordingly. 

With kind regards, I am 
Sincerely, 

Edmund L. Henshaw, Jr., 
Clerk, U.S. House of Representatives. 

Enclosure. 

(in) 



CONTENTS 



Allowances and expenses: Pa se 

Commission on Administrative Review 1236 

Computer and related services 1235 

Constituent communication expenses 1216 

Equipment 1211 

Equipment (purchase, lease, and maintenance) 1211 

Furniture 1223 

Government contributions 1216 

Miscellaneous items (gratuities, interparliamentary receptions, con- 
tested elections, and leadership automobiles) 1214 

Official employees' transportation expenses 1235 

Official expenses outside the District of Columbia 1232 

Official Member's transportation expenses 1235 

Telephone and telegraph expense 1233 

Postage 1236 

Rental of district office (private and Federal) 1225 

Salaries — House resolution 1216 

Stenographic reports 1216 

Supplies, materials, and services 1209 

Attending Physician 1207 

Attending Physician (revolving fund) 1365 

Capitol Police Board 1345 

Capitol Police — uniforms and equipment 1345 

Clerk hire, Members, Resident Commissioner, and Delegates 1201 

Committee empk>3 r ees 1201 

Consolidated working fund 1348 

Education of Senate, House, and Supreme Court pages 1348 

House Barber Shops (revolving fund) 1364 

House Beauty Shop (revolving fund) 1363 

House Leadership Offices 1196 

House Recording Studio (revolving fund) 1362 

House Restaurant (revolving fund) 1358 

Index of House employees 1367 

Joint Committee on — 

Congressional Operations 1343 

Defense Production 1343 

Taxation 1344 

Law Revision Counsel 1207 

Members' allowance and expenses 202 

Office of the Legislative Counsel 1206 

Official mail costs 1348 

Preparation of new edition of District of Columbia Code 1342 

Salaries and expenses — officers and employees: 

Attending Physician — technical assistant 1201 

Compilation of precedents of House of Representatives 1197 

Democratic Caucus 1199 

House Democratic Steering and Policy Committee 1199 

House Republican Conference 1199 

Majority and minority printing clerks 1200 

Minority employees 1198 

Office of the — 

Chaplain 1197 

Clerk 1197 

Doorkeeper 1197 

Parliamentarian 1197 

Postmaster 1197 

Sergeant at Arms 1197 

Official reporters of debates 1201 

Official reporters to committees 1201 

Salaries of officers and employees of the House of Representatives 1 

(V) 



VI 

Standing, Select, and Special Committees: 

Committee on — Pa£re 

Agriculture 1237 

Appropriations 1201 

Armed Services 1239 

Banking, Finance and Urban Affairs 1240 

Budget 1204 

District of Columbia 1247 

Education and Labor 1248 

Energy, Ad Hoc 1328 

Government Operations 1254 

House Administration 1256 

Interior and Insular Affairs 1270 

Internal Security 1276 

International Relations 1276 

Interstate and Foreign Commerce 1283 

Judiciary 1293 

Merchant Marine and Fisheries 1296 

Post Office and Civil Service 1300 

Public Works and Transportation 1303 

Rules 1308 

Science and Technology 1309 

Small Business 1316 

Standards of Official Conduct 1317 

Veterans' Affairs 1321 

Ways and Means 1322 

Select Committee on — 

Aging 1328 

Assassinations 1331 

Congressional Operations 1337 

Ethics 1338 

Intelligence 1339 

Narcotics Abuse and Control 1339 

Outer Continental Shelf, Ad Hoc 1342 

Stationery (revolving fund) 1348 

Suspense account 1365 

Travel of Committee on Appropriations paid by other Government 

agencies 1366 



REPORT OF THE CLERX OF THE HOUSE 

FROM JULY 1, 1977 TO SEPTEMBER 30, 1977 

STATEMENT OF ACCOUNTABILITY FOR APPROPRIATIONS AND OTHER FUNDS 

Unexpended balance, June 30, 1977 $119,715,485.62 

Appropriations and receipts: 

Current appropriations $55, 99A 300. UU 

Revolving fund and suspense account receipts: 

House Stationery revolving fund $328,221.93 

House Restaurant revolving fund 1, 161, 433. 12 

House Recording Studio revolving fund 45, 919. 56 

House Beauty Shop revolving fund 76, 833. 30 

House BarberShop revolving fund 17,481.91 

Attending Physician revolving fund 6, 603. 31 

House Records and Registration— suspense account "B"__ 85.00 

1, 636, 578. 13 

Receipts to be deposited in the general fund of the Treasury 134,815.23 

of, /oJ, oyj. ou 

Total funds available 177,479,178.98 

Expenditures and transfers: 

Disbursements for salaries and other expenses less refunds 

and canceled checks - -- -- 86 > 524 > °85.37 

Transfers: 

Lapsed appropriations transferred to the general fund of 

the Treasury — W840.09 

DepositedinthegeneralfundoftheTreasury 134, 815. ii (54754069 

Unexpended balance, Sept. 30, 1977 — - — 85, 831, 638. 29 

SUMMARY OF TRANSACTIONS BY APPROPRIATIONS 



Purpose 



Funds 
available 



Net 
disbursements 



Transfers 



Unexpended 

balance, 

Sept. 30, 1977 



House leadership offices: 

1975 

1976 

1977 - 

Salaries, officers and employees: 

1975 

1976 

1977... 

Clerk hire— Members, Resident Commissioner, 
and Delegates: 

1975 

1976.... 

1977.... 

Committee employees: 

1975... 

1976 

1977 

Committee on Appropriations: 

1975 

1976 

1977.... 

Committee on the Budget: 

1975 

1976 

1977 

Office of Legislative Counsel: 

1975 

1976 

1977 

Law Revision Counsel: 

1976 

1977 

Attending Physician: 

1975 

1976 

1977 



$54,021.80 

308,031.72 

877,068.42 $432,798.70 



801,585.96 

812,920.11 

6, 207, 907. 12 



$54, 021. 80 



801, 585. 96 



5,521,005.76 



$308,031.72 
444, 269. 72 



812,920.11 
686, 901. 36 



1,341,287.03 1,341,287.03 ...-..---- 

1 129 052 91 ---- 1,129,052.91 
28[ 521,' 071.' 03 ""25,"572,886.i6 2,948,184.87 

1,699,371.36 1,699,371.36 

5,762,328.38 5'^?' I??- 25 

7,659,680.86 5,241,623.89 2,418,056.97 

19, 435. 84 



20, 340. 29 

213,065.22 

1,073,416.86 

56, 843. 71 
244, 824. 97 
229, 824. 31 

318, 526. 13 
359, 443. 52 
512,334.89 

195,646.97 
161, 334. 90 

1,041.70 

1,318.63 

68, 556. 41 

(VII) 



904. 45 
86, 550. 64 
545, 249. 37 



126, 514. 58 
528, 167. 49 



56,843.71 



34,018.68 




318,526.13 . 






299 853.64 




79,046.05 .. 




1,041.70 







244, 824. 97 
195, 805. 63 



37, 405. 33 



359, 443. 52 
212,481.25 

195, 646. 97 
82, 288. 85 



1,318.63 
31,151.08 



VIU 



SUMMARY OF TRANSACTIONS BY APPROPRIATIONS— Continued 



Purpose 


Funds 
available 


Net 
disbursements 


Transfers 


Unexpended 

balance, 

Sept. 30, 1977 


Miscellaneous items: 
1975 


$417. 40 
3,142,212.82 

2, 257. 38 
167, 273. 10 

4,293.09 

1,018,665.52 

10, 977, 309. 24 

370, 937. 56 
253,900.48 

3, 783. 02 

13,218.31 
29,174.23 

80,913.65 
23,227,359.93 

12,019.31 
25, 149. 25 

4, 368. 17 
14,825.90 


$378. 13 
748,744.35 .. 


$39. 27 




1976 


$2,393,468.47 


Report of hearings: 
1975 




2, 257. 38 




1976 


7.80 .. 


167, 265. 30 


Special and select committees: 
1975 


(5.60) 
8, 964. 79 
8,490,771.99 .. 


4, 298. 69 




1976 -. 

1977 


1,009,700.73 
2,486,537.25 


Telephone and telegraph: 
1975 


12,499.24 .. 


370,937.56 




1976 


241, 401. 24 






3, 783. 02 
13,218.31 




Government contributions: 
1975 






1976 




29,174.23 


Preparation of New Edition of United States 






80,913.65 


Postage stamps: 
1975 


12,133,393.59 


34, 206. 41 
12,019.31 


11,059,759.93 


1976 




25,149.25 


Furniture: 
1975 


10, 744. 21 


4, 368. 17 




1976 


4,081.69 


1977 






Furniture (fiscal year 1975 supplemental) 

Preparation of new edition of District of Colum- 


7, 998. 00 

207, 484. 38 

36, 768. 35 

16.45 

597, 298. 65 

4, 298. 46 
1,765.41 

55, 532. 06 

137,037.60 

39, 297. 06 

280, 528. 09 

8,792.77 
7, 329. 63 

89, 049. 91 

23, 263. 02 

945,761.41 

2,353.76 

5, 468. 90 
406, 777. 00 

6, 500. 00 
8,125.00 
6, 500. 00 

4.00 
65,517.00 

23,767,006.42 
48, 926, 000. 00 

6,666.93 

3, 689. 72 

1, 686. 774. 82 

1,539,441.06 

290, 507. 05 

121,602.76 

41,559.49 

10, 520. 62 

118.48 

28, 085. 92 
134,815.23 






7, 998. 00 


8, 000. 01 




199, 484. 37 


Joint Committee on Internal Revenue Taxation: 
1975 


36, 768. 35 




1976 




16.45 


1977 


495, 439. 65 




101,859.00 


Joint Committee on Defense Production: 
1975 


4, 298. 46 




1976 




1,765.41 


1977 

Joint Committee on Congressional Operations: 
1975 


43,161.90 


137,037.60 


12,370.16 


1976 




39, 297. 06 


1977 


39, 490. 55 




241, 037. 54 


Leadership automobiles: 
1975 


8,792.77 




1976 




7, 329. 63 


Capitol Police Board: 
1975 




89, 049. 91 




1976 




23,263.02 


1977 


282,725.99 




663, 035. 42 


Uniforms and equipment— Capitol Police: 
1975 


2, 353. 76 




1976 




5, 468. 90 


1977 


179,609.87 




227,167.13 


Statement of appropriations: 
1975 


6,500.00 




1976 




8,125.00 


1977 

Education of Senate, House, and Supreme 
Court pages: 

1975 

1976 

Official mail costs: 
1976 and 1977 


27, 802. 00 

23, 767, 006. 42 
277, 048. 94 

6,666.93 

3, 689. 72 

833,199.03 

1,174,729.52 

10,454.17 

78, 396. 75 

32,969.73 

7,653.02 


4.00 


6, 500. 00 
37,715.00 


1977 and 1978 




48,648,951.06 


Mexico-U.S. Interparliamentary Group: 
1974 






1975 

House Stationery revolving fund 

House Restaurant revolving fund 

House Recording Studio revolving fund 

House Beauty Shop revolving fund 

House Barber Shop revolving fund 


(34,206.41) 


887, 782. 20 
364,711.54 
280, 052. 88 
43,206.01 
8,589.76 




2,867.60 






118.48 


House Records and Registration— suspense ac- 






28, 085. 92 


General fund receipts _-. 




134,815.23 . 








Total 


. 177,479,178.98 


86, 524, 885. 37 


5,122,655.32 


85,831,638.29 



rx 

SUMMARY OF GENERAL FUND RECEIPTS 

Sales of surplus property -- .. $348.71 

Sales of transcripts of hearings 4,537.60 

Transfer of profits from House Beauty Shop 1,875.07 

Transfer of unexpended balance, as of June 30, 1977, of House Barber Shops revolving fund. 24,076.58 

Reimbursement of salary of instructor personnel of U.S. Capitol Police... 3,763.44 

Reimbursement from Congressional Budget Office for services provided by House Information Systems. 82, 110.00 

Gifts to U.S. Treasury by House Members (salary): 

D'Amours, Norman E__ $2,408.00 

Fenwick, Millicent - 3,225.00 

Frey, Louis, Jr. 2,420.48 

Ginn, Bo 1,582.56 

Ireland, Andy 3,225.00 

Keys, Martha 1,029.00 

Luken, Thomas A 2,217.56 

Panetta, Leon E._ 1,421.33 

V,bn.S3 

Gifts to U.S. Treasury by House Member (constituent's donation): Murphy, John M 26. 17 

Miscellaneous receipts 100.00 

Miscellaneous refunds 448.73 



Total general fund receipts 134,815.23 



SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977 



OFFICE OF THE SPEAKER 

AtDDINO, KENNETH P 
BEJOIAN, JANES C 
BLACKBOOD,KRISTINE 
CATALOGNA.NARK L 
COHEN, ARNOLD 
COLVIN,RELENE D 
DIEHL.LEO E 
FEENSY, KEVIN T 
FERGUSON, ELLEN J 
FERRIS, CHARLES D 
FLORENCE, FAYE 
GODFREY, CARL FRANKLIN, JR 
GRADY, ROBERT A 
HANKINS.RITA HEROLD 
HARRIS, JONATHON A 
HOOD, KEITH A 
HOWARD, DESANIE L 
HYMEL.GARY G 
IACONE, PAMELA PATRICE 
JONES, HARY-ALYCE F 
KATZ, JENNIFER B 
KELLEY, ELEANOR. H 
KHOYLIAN,RIHA 
KILLEEN.JOHN J 
KIRKPATRICK, SIDNEY D,III 
LARSON, BILLIE GAY 
LEWIS, PATRICIA F 
HALONE, CHERYL ANN 
HCINTYRE.JOHN H 
HELCONIAN, LINDA JEAN 
aiETH, JENNIFER L 
HULKERRIN.PAUL F 
NIMOY.ADAH B 
OHEARA, GREGORY B 
SAIDNASEY, JEANNE J. 
SHANKEE,ADAH 
SIHONE, CHRISTINE M 
SULLIVAN, CHRISTINE E 
BEISS, STEPHEN ARIEL 



INTERN, TO JUL 31 $ 

STUDENT INTERN, TO JUL 31 

INTERN, FROM AUG 1 TO AUG 31 

INTERN, TO JUL 15 

INTERN, TO JUL 31 

FROM SEP 1 1, 

ADMINISTRATIVE ASSISTANT (STATUTORY) 13, 

INTERN, TO JUL 31 

CLERK, FROM JUL 15 TO SEP 5 

13, 

INTERN, TO JUL 31 

3, 

INTERN, TO JUL 31 

4, 

INTERN, TO JUL 31 

INTERN, FROM SEP 1 

2, 

EXECUTIVE ASSISTANT (STATUTORY) 13, 

3, 

4, 

INTERN, TO JUL 31 

SECRETARY 5, 

STUDENT INTERN, TO JUL 31 

3, 

INTERN, FROM AUG 1 TO AUG 31 

SECRETARY 3, 

INTERN, TO JUL 31 

INTERN, TO JUL 31 

MESSENGER-JANITOR (STATUTORY) 3, 

6, 

INTERN, TO JUL 31 

INTERN, TO JUL 31 

INTERN, TO JUL 31 

5, 

FROM AUG 1 TO AUG 31 

PAGE, FROM JUL 13 TO AUG 5 

INTERN, TO JUL 31 

3, 



500.00 
750.00 
500.00 
250.00 
500.00 
2 50.0 
125.00 
500.00 
850.00 
125.00 
500.00 
375.00 
500.00 
166.67 
500.00 
500.00 

944. m 

125.00 
316.67 
250.01 
500.00 
250.00 
500.00 
958.33 
500.00 
916.66 
500.00 
500.00 
909.30 
000.00 
500.00 
500.00 
500.00 
250.00 
590.00 
460.96 
500.00 
431.72 
000.00 



OFFICE OF THE MAJORITY FLOOR LEADER 



BROBN.ELZORA H 
KEYES,G ELIZABETH 
KLAUS, BARBARA L 
LYNAM, MARSHALL L 
HACK, JOHN P 
MCMULLEN, BADE H 
MCNEILL, MARY BETH 
MITCHELL, KATHEPINE 
OLSON, RICHARD C 
HADPE, CRAIG 



SECRETARY 4,366.67 

ASSISTANT LEGISLATIVE CLERK 3,248.88 

SECRETARY 4,366.67 

ADMINISTRATIVE ASST (STATUTORY) 13,125.00 

STAFF ASSISTANT, FROM AUG 1 2,666.66 

CLERK 2,825.01 

SECRETARY 4,366.67 

EXECUTIVE SECRETARY 7,500.00 

CLERK (STATUTORY) 9,500.01 

EXECUTIVE ASSISTANT (STATUTORY) 13,125.00 



OFFICE OF THE MINORITY FLOOR LEADER 



ANDERSON, JACK 
BALLARD, CHARLOTTE KAY 
BITTER, SUSAN K 
BROWNE, LUCY 
BRONER,MARY G 
CONNELL.JOHN HARRIS 
DILL, J MONTGOMERY 
FREEDHAN,SAH 
GRAHAH,DEBORAH J 
HAAS, MARILYN 
HOFFMAN, HARK DAVID 
KELLERMAN, DONALD 
HACAULAY, JOSEPH H 
MURPHY, MARY E 
NELSON, T CHASE 
PIER SON, JOANNE 
POSEY, CLARA BEFNICE 
PROUTY,PERRIE LEE 
REECE,R CHRIS 
TAYLOR, DENNIS J 
THOMAS, CAROLINE 
BILLIAMS.JOHN J 



STAFF ASSISTANT 8,124.99 

SECRETARY 4,500.00 

STAFF ASSISTANT, TO JUL 31 500.00 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 1,000.00 

SECRETARY 7,500.00 

STAFF ASSISTANT, TO JUL 31 500.00 

STAFF ASSISTANT, TO JUL 31 500.00 

STAFF ASSISTANT, TO JUL 31 500.00 

STAFF ASSISTANT 3,500.01 

STAFF ASSISTANT, TO JUL 31 500.00 

ASST LEGISLATIVE CLERK STAT 3,248.88 

STATUTORY 12,500.01 

ASSISTANT LEGISLATIVE COUNSEL 5,094.99 

STAFF ASSISTANT 4,625.01 

STAFF ASSISTANT, FROM JUL 6 TO AUG 5 601.25 

CLERK 4,625.01 

STATUTORY - STAFF ASSISTANT 8,750.01 

CLERK 4,625.01 

STAFF ASSISTANT, TO JUL 31 500.00 

LEGISLATIVE COUNSEL (STATUTORY) 12,000.0C 

STAFF ASSISTANT, FROM JUL 9 TO AUG 5 541.13 

STATUTORY 11,874.99 



(1) 



SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF THE MAJORITY SHIP 

BEAVERS, SHARON R 

BRIGGS,JDDITH N 

DEITZ, RANDOLPH B 

DOWLEY, JOSEPH 

FRIEDHAN, CHARLES TIMOTHY, JR 

FULTON, KENNETH 

GRIFFIN, JOAN H 

HEALEY, JAMES C,JB 

HEFFERNAN, SHEILA 

HOFFMAN, BURTON 

JACKSON, ALICE H 

MANDELIAN,MATTHEB DEE 

MCGEE, MARIE V 

MICALI,HARK A 

MOONEY, JAMES P 

MUESSEL.G H 

PETTY, THOMAS RICHARD 

PINKOS, MATTHEB A 

RICHERSON,LOIS 



SCHBARZ, KAREN A 
OELAND, BARBARA ANN 
BALSH, ANDBEB H 
BESTBROOK, LINDA 



RECEPTIONIST $ 3, 

SECRETARY 3, 

INTERN, TO AUG 26 

FROM ADG 1 2, 

FROM SEP 1 1, 

BRITER 10, 

CLERK, TO AUG 31 1, 

ADMINISTRATIVE ASSISTANT (STATUTORY) 11, 

TO JUL 31 

PRESS SECRETARY (STATUTORY) 11, 

SECRETARY 5, 

INTERN, TO AUG 5 

RESEARCHER 5, 

FBCM SEP 1 If 

ADMINISTRATIVE ASST (STATUTORY) 13, 

INTERN, FROM SEP 21 

FRCH AUG 1 TO AUG 31 

WRITER «» 

CLERK (STATUTORY), TO JUL 31 

CLERK, TO JUL 31 

CLERK (STATUTORY), FROM AUG 1 TO AUG 31 

CLERK, FROM AUG 1 TO AUG 31 

CLERK (STATUTORY), FROM SEP 1 

CLERK, FROM SEP 1 5, 

STAFF ASSISTANT "i 

STAFF ASSISTANT 3, 

INTERN, TO AUG 20 

TO JUL 31 1i 



500.01 
540.99 
808.89 
218.00 
000.00 
7U9.99 
200.00 
874. 99 
750.00 
874.99 
499.99 
505.55 
033.76 
000.00 
125.00 
114. 44 
600.00 
875.00 



499.99 
250.01 
176.62 
722.22 
180.00 



OFFICE OF THE MINORITY BHIP 

BARBER, ROBERT JULIAN 
DEARDEN, CAROL ANN 
DERSINSKI, MAUREEN 
DRAKE, LESLIE 
DYKHOUSE, DOROTHY J. 
GAVIN, WILLIAM F 
GOODWILLIE, CAROL B 
JANIS, VALERIE JANE 
KITZ MILLER, DAVID 
HCAULIFFE, KATHLEEN 
OBENS.BILLODEAN 
PITTS, BILLIAH R,JR 
SENESE, DONALD J 
THOMAS, ELEANOR C 
TIEBNEY,JOHN J,JR 
VINOVICH, RALPH 
YOUNG, PAMELA K 



CCMMUNICATIONS ASSISTANT , 

SECRETARY TO BHIP 

CLERK, TO AUG 31 

CLERK, FROM JUL 6 TO AUG 5 ... 

SECRETARY 

SPECIAL ASSISTANT 

SECRETARY 

LEGISLATIVE SECRETARY , 

CLERK, FROM JUL 6 TO AUG 5 .., 

SECRETARY, FROM SEP 1 

SECRETARY (STATUTORY) 

ASSISTANT TO BHIP 

RESEARCH ASSISTANT, FROM AUG 1 

CLERK 

RESEARCH ASSISTANT, TO JUL 31 . 
ADMINISTRATIVE ASST (STATUTORY) 
SECRETARY, TO AUG 31 



,750.00 
,500.00 
800.00 
601.2 5 
,500.01 
,249.99 
,000.00 
,249.99 
601.25 
933.33 
,750.01 
,249.99 
,666.66 
999.99 
833.33 
,999.99 
,916.66 



OFFICE OF THE CLERK 

ALEXANDER, CANDY 
ALEX IADIS, MAFIA 
ALLEN, PETER H 
ALLEN, ROBERT E 
ANDERSON, HARRY P 
AVNER, HARRISON BRUCE 
AYER, STANLEY H 
BABASHAK, JAMES V 
BAPTISTS, CHRISTINE A 
BARGAB,BILLIAM LEROY,JR 
SARRIERE, LAURA ALLISON 
BEITEL, MARCEL L 
BEJOIAN, LAURIE JAYNE 
BELCHER, APRIL H 
BELL, DANNY T 
BENNETT, ANTHONY G 
BERRY, DONNA S 
BERRY, ROBERT E 
BETHEM, RICHARD J 
BIAS, PATRICIA A 
BITTERMAN,LABRENCE 
BLACKBOOD, KRIS TINE 
BLAIR, MARVIN S 
BOCKORNY,JILL S 
BODINE, FREDERICK H 
BOGART, CHARLES GARY 



INTERN, TO JUL 31 661.83 

GENERAL CLERK 2,631.00 

CHIEF ADMINISTRATIVE SECTION 5,002.26 

ENROLLING DIGEST CLERK 6,652.26 

REPORTS EXAMINER 3,474.00 

SENIOR PAYROLL CLERK 3,474.00 

SUPPLY CLERK 3,288.51 

INTERN, TO AUG 27 1,257.48 

PAYROLL CLERK 3,028.26 

CARPENTER SERVICEMAN 3,839.25 

INTERN, TO JUL 31 661.83 

BILL CLERK 6,389.76 

INTERN, TO JUL 15 330.92 

SENIOR AUDITOR (ACTING), TO AUG 10 1,676.44 

APPRENTICE CABINET SHOP, TO JUL 31 1,140.17 

AUDITOF (ACTING), FROM AUG 5 TO AUG 31 760.07 

SENIOR ACCOUNTS CLERK (ACTING) 3,474.00 

READING CLERK 9,038.76 

CAMERAMAN 4,272.00 

CHIEF PUBLIC INSPECTION SECTION 4,073.76 

GENERAL CLERK-MESSENGER, TO AUG 12 1,227.80 

INTERN, TO JUL 31 661.83 

REPAIRMAN 4,419.24 

CLERK TYPIST 3,028.26 

CARPET TECHNICIAN 4,580.76 

ASSISTANT ENROLLING DIGEST CLERK 4,657.50 



SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF THE CLF8K -CONTINUED 



BOWIE, MICHAEL E 
BOWLES, GERALD ALLEN 
BRAND,STANLEY 
BHINSON, RONNIE 
BRUSS, RICHARD E 
BUCHANAN, KENNETH A 
BUCKLEY, NIKE 

BU IE, RICHARD 
BURKHOLD2R, BETTY JANE 
BURKS, GEORGE H 
BURNS, NERRILYNNE C 
BOSH, CLEVELAND 
BYRD, JACQUELINE DEAN 
CALGARO,JOHN 
CALLAHAN, ELIZABETH RITA 
CAMPBELL, ADELIA ANNE 
CAPOTO, DAVID A 
CASHDOLLAR, VIRGINIA L 
CAYLOR, CLARENCE C 
CELEBREZZE, SUSAN HARIE 

CHAMP, WILLIAM S 
CLAGETT.JOHN H.III 
CLARK, DOROTHY R 
CLARK, LINDA PRICE 
CLARK, PAUL H 
CLARKE, JAMES J 
CLARKE, WILLIAM B 
CLEMENT, TIFFANY L 
COLEMAN, ROBERT C 
COLLEY, WILFRED R 
COLTON,S DAVID 
COMBS, ROBERT LEE JR 
CONNER, PETEB T 
CONTI, THOMAS J 
COOK, CATHERINE 
COOKE, JOHN WILSON 
COPENHAVEH, ROGER D 
CRONE, JERRY J 
CROSBY, MARGARET MDKINNEY 
CRUDOP, WILLIAM D 
COSATI,ALESSANDRO 
DAVID, CONSTANCE A 
DA VIS, RICHARD L 
DEAL, ANNE MCLEAN 
DEANGELIS,DELORES 
DECKER, DONALD LEE 
DEESE, JEWELL W 
DEFILIPPO, LOUIS J 
DEPOLLAR, HARRY R 
DOLAN, PETER 
DOLAN, ROBERT 

DOLEN.JANNIE A 
DONLIN.ANMARIE 
!>OTCHIN,SHERYL ANN 
DOUGLASS, MICHAEL A 
DOYLE, JOHN P 
DUFFY, STEPHEN C 
DZIDUCH.JOHN F 
EDMISTEN, TERRY LEE 
EDWARDS, CARL RAY 
EHBREY,PAMELIA ANN 

EHHERT, BRUCE FRANKLIN 

ENDRES, STEPHEN H 
FEABN.HALDIS M 
FENSTERHACHEE.MARY R 

FERGUSON, FRANCIS X 
FIELDS, KIRK W 
FIRST, DAVID JACOB 
FITZ, ELIZABETH J 
FLETCHER, MARTHA 
FORBES, GEORGE 
FOSTER, FRANK E 
FOSTER, JOHN L 
FOWLER, AUBREY WAYNE 
FOX, MORTON E 



DELIVERYMAN $ 2,283.51 

INVENTORY CONTROL CLERK 3,172.42 

GENERAL COUNSEL TO THE CLERK 10,672.26 

LAEORER 2,635.00 

ASSISTANT JOURNAL CLERK 4,887.75 

STOCK CLERK 3,375.00 

ACCOUNTING CLERK (ACTING), TO AUG 31 

PERSONNEL CONTROL CLERK, FROM SEP 1 3,028.26 

LABORER 2,792.76 

PAYROLL SUPERVISOR 5,116.50 

CARPET LAYER 1,197.99 

ACCOUNTS AND BOOKKEEPING MACHINE CLERK 2,718.00 

REPAIRMAN (ELEC TYPEWRITER) 4,580.76 

SUPPLY ACCOUNTING CLERK 3,462.00 

SERVICE ASSISTANT 4,070.25 

CLERK TYPIST 3,114.24 

TELEPHONE OPERATOR 3,006.00 

ACCOUNTING CLERK 3,474.00 

BUDGET AND ACCOUNTING TECHNICIAN 5,175.24 

CARPET TECHNICIAN 4,530.76 

LIBRARY TICHNICIAN, TO AUG 26 

ASSISTANT CHIEP, FROM AUG 27 3,724.86 

DRAPERY TECHNICIAN 4,090.26 

LABORATORY MANAGER 4,772.76 

TELEPHONE OPERATOR 3,590.50 

TELEPHONE OPERATOR 2,755.50 

AUDIO SPECIALIST 4,764.99 

INTERN, FROM AUG 8 TO AUG 20 286.79 

ELECTRONICS TECHNICIAN 4,570.26 

INTERN, FROM AUG 8 TO SEP 9 705.96 

ASSISTANT CHIEF 6,816.33 

DEPUTY CLERK 12,500.01 

ACCOUNTS CLERK (ACTING), TO AUG 31 1,522.34 

PROCESSING CLERK, FROM SEP 14 496.97 

INTERN, FROM JUL 16 TO AUG 31 992.75 

SUPERVISORY SALES CLERK 3,114.24 

INTERN, TO AUG 6 794.20 

CARPET LAYER 3,990.67 

ASSISTANT BILL CLERK 5,116.50 

INTERMEDIATE UPHOLSTERY APPRENTICE, FROM JUL 15 2,989.54 

INTERN, TO AUG 27 1,257.48 

LAEORER 2,792.76 

ELECTRONICS TECHNICIAN, FROM JUL 25 2,914.08 

ASSISTANT REPORTS EXAMINER 3,028.26 

CARPENTER SERVICEMAN 3,839.25 

SUPPLY ACCOUNTING CLERK 3,288.51 

TELEPHONE OPERATOR 2,922.50 

REPAIRMAN (WORKING SUPERVISOR) 6,243.00 

GENERAL CLERK (ACTING), FROM JUL 5 2,182.02 

UPHOLSTERER 4,628.49 

LABORER 2,792.76 

INTERN, TO AUG 20 1,103.05 

LAEORER (ACTING), TO JUL 31 

INTERN, FROM AUG 1 TO AUG 20 1,236.55 

TELEPHONE OPERATOR 3,006.00 

SENIOR SERVICES CLERK 3,672.99 

CLERK-RECEPTIONIST 3,375.00 

DELIVERYMAN 2,382.17 

INTERN, TO AUG 27 1,257.48 

CHIEF 6,596.25 

LAEORER 2,792.76 

REPAIRMAN 4,251.75 

DATA PROCESSING SPECIALIST 5,291.76 

AUDITOR (ACTING), FROM AUG 1 TO AUG 10 

SR ACCOUNTS PAYABLE CLERK (ACT), FROM AUG 11 .. 2,316.00 

ACCOUNTS CLERK (ACTING), TO AUG 31 

SUPPLY ACCOUNTING CLERK, FROM SEP 1 2,631.00 

ACCOUNTS CLERK 3,028.26 

SUPPLY ASSISTANT 3,028.26 

TELEPHONE OPERATOR, TO AUG 31 

TELEPHONE OPERATOR, FROM SEP 5 3,111.77 

OFFICE APPLIANCE PEPAIRMAN 3,552.00 

OFFICE EQUIPMENT ATTENDANT, TO AUG 15 1,387.38 

LABORER 2,720.92 

ACCOUNTS CLERK 3,288.51 

TELEPHONE OPERATOR 2,755.50 

AUEITOR (ACTING), TO AUG 31 1,323.66 

FOREMAN DRAPERY SHOP 6,243.00 

ELECTRONICS TECHNICIAN 4,272.00 

ASSISTANT ENROLLING DIGEST CLERK 4,543.26 

INTERN, FROM AUG 1 TO AUG 20 441.22 



SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF THE CLERK -CONTINUED 



FOXX, RICHARD ALLEN 

FRANCIS, DOROTHY J 

FREDERICK, LEROY 

FREEMAN, RHEDA A 

FRENCH, MICHAEL S 

FRITZINGER, HARRY T 

GAMBLE, JAMES E,JR 

GARCIA, TONY E 

GARNER, JAMES I 

GASROTT, JAMES M 

GAVIGAN, ROBERT J 

GERVASIO, RALPH J,JR 

GIALLORETO,THEEESE ANN BONDI 

GILLENWATER, DENNIS S 
GLORIOS, NANCY C 
GLOSSON, JANICE L 
GORDON, GLADYS B 
GRAVES, JOSEPH DANIEL 
GRAY, JOHN L 
GREGORY, JOHN R 
GROGG, EDWARD RAY 
GROSSMAN, SHEAN M 
GOTHRIE, BENJAMIN J 
GUTHRIE, GAIL H 
HACKNEY, CHARLES B,JR 
HAKE, IVAN H 
HALLMAN, NELSON W 
HANBORY, VICTORIA DAMN 

HARRINGTON, LEE, III 

HARTNETT.JOHN 
HAPTNETT, WILLIAM W 
HAWKINS, MICHAEL 
HAYS, PAUL 

HELMER, STEWART ERWIN 
HENSHAW.EDBDND L,JR 
HENY,MICHAEL,JF 
HERDMAN,LANA GRAY 
HILL, FRANCIS WAYNE 
HILL, JACK D 
HIXSON,TODD 
HOLLIDAY, WILLIE 
HOLROYD, TIMOTHY J 
HOLSON, PATRICK GERARD 
HORNSBY,JON B 
HOUGH, WANDA ANN 
HOWARTH, JAMES C 
HOYE, FRANCIS P 
HUBER.ROYCE 
HUDSON, JAMES E 
HOESTER,BETTE W 
HOGHES, RICHARD N 
HOLTIN, JAMES C 
HUTTON.KATHRYN V 

INGE, CLAUDE 
INGE, EDWARD 
INGRAM, JOHN D 
JACKSON, C. ANDRE 
JACKSON, DENNIS CALVIN 
JACKSON, MC ARTHUR 
JACOBS, ROBERT B 
JAMES, CHARLES 
JEFFERY, ELLEN VIRGINIA 
JENKINS, JOHN P 
JERNIGAN, HELEN 
JOHANN, DONALD W 
JOHNSON, ERIC BRUCE 
JOHNSON, JEROME 
JOHNSON, MICHAEL E 
JONES, DAVID L 
JONES, DONNA R 
JONES, ESTELLE M 
JONES, FRANK H 
JONES, SHIRLEY L 
JOY, SHERMAN WILSCN,JR 
JURCIDKONIS, CYNTHIA A 
KANIEWSKI, EDWIN C 
KATZ.JACK L 



OFFICE EQUIPMENT ATTENDANT $ 3,235.26 

TELEPHONE OPERATOR 2,755.50 

ASSISTANT FOREMAN LABOR FORCE 3,683.76 

TELEPHONE OPERATOR 2,755.50 

GENERAL CLERK 2,631.00 

FOREMAN UPHOLSTERY SHOP , 6,243.00 

CLERK MESSENGER 2,631.00 

FINISHER 4,802.01 

APPRENTICE UPHOLSTERY SHOP 3,420.51 

LABORER 2,685.00 

INTERN, TO AUG 6 794.20 

OFFICE EQUIPMENT ATTENDANT 2,774.76 

SALES CLERK, TO AUG 31 

GENERAL CLERK, FROM SEP 1 2,763.42 

LABORER 2,685.00 

ASSISTANT CHIEF 5,406.99 

REPORTS EXAMINER 3,573.75 

CHIEF .' 6,992.76 

INTERMEDIATE APPRENTICE FINISHER 3,982.74 

CARPET CLEANER 3,288.99 

ASSISTANT TALLY CLERK (ACTING) 4,272.00 

FOEEMAN CARPET CLEANER 6,243.00 

SALES CLERK 2,718.00 

ASSISTANT TO CLERK 11,095.50 

AUDITOR (ACTING), TO JUL 31 877.00 

READING CLERK 9,038.76 

ASSISTANT FOREMAN CABINET SHOP 6,021.75 

ASSISTANT CHIEF 6,446.76 

TELEPHONE OPERATOR, TO JUL 23 

INTERN, FROM AUG 1 TO AUG 27 1,299.83 

SENIOR ACCOUNTS PAYABLE CLERK, TO AUG 10 

SENIOR AUDITOR, FROM AUG 11 3,973.75 

LABORER, TO JUL 31 859.17 

ASSISTANT TO CLERK 10,011.51 

TOOLS AND PARTS ATTENDANT 3,683.76 

ASSISTANT BILL CLERK 5,232.00 

FILM LAB TECHNICIAN 4,073.76 

CLERK OF THE HOUSE 13,125.00 

ASSISTANT CHIEF 6,596.25 

SENIOR PERSONNEL CON CLK (ACT) 3,028.26 

APPRENTICE CABINET SHOP 3,332.83 

UPHOLSTERER 4,461.00 

INTERN, FROM AUG 1 TO AUG 20 441.22 

CHIEF STOCKROOM UNIT 3,375.00 

INTERN, TO AUG 13 948.62 

LABORER 2,685.00 

INTERN, TO AUG 6 794.20 

INTERN, TO AUG 15 992.75 

ASSISTANT TALLY CLERK (ACTING) 3,771.99 

JOURNAL CLERK 9,038.76 

FILE CLERK, TO AUG 27 1,776.35 

SALES CLERK 2,631.00 

EMPLOYEES BENEFITS COUNSELOR 3,973.74 

AUDIO SPECIALIST 3,474.00 

CAMERAMAN 4,272.00 

EMPLOYEE EENEFITS CLERK, TO AUG 31 

EMFLOYEE EENEFITS CLERK, FROM SEP 5 3,225.00 

UPHOLSTERER 4,287.75 

SUPPLY CLERK 3,462.00 

LABORER 3,038.01 

INTERN, FROM JUL 21 TO AUG 31 882.44 

LABORER 2,685.00 

SUPPLY CLERK, FROM JUL 5 3,091.47 

COORDINATOR OF OPERATIONS 3,970.50 

LABORER 2,792.76 

TELEPHONE OPERATOR 2,755.50 

TALLY CLERK 7,572.51 

PAYROLL CLERK 3,635.76 

ASSISTANT COORDINATOR OF OPERATIONS 3,201.51 

CARPET CLEANER 3,288.99 

LABORER 2,685.00 

STOCK CLERK 2,581.74 

ASSISTANT FOREMEN FINISHING SHOP 5,806.50 

ACCOUNTS AND VOUCHERS CLERK 3,288.51 

EMPLOYEE EENEFITS CLERK (ACTING) 2,399.34 

UPHOLSTERER 4,114.26 

CLERK 3,065.49 

CAEINETMAKER 4,461.00 

CLERK TYPIST 2,631.00 

APPRENTICE UPHOLSTERY SHOP 3,552.00 

ACCOUNTS CLERK (ACTING) 2,631.00 



SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF THE CLERK -CONTINUED 



KEECH, GILBERT W 
KELLAHER, EDWARD T 
KENNEY, SUSAN 
KENT, RAYMOND R,JR 
KETNER,STEFANIE S 

KING, ERIC C 
KING, JANET S 
KIRKLAND, FRANKLIN E 
KIRKLAND,JOHN NEIL 
RISER, WAYNE RANDALL 
KLEIN, MARTIN A, III 
KNAPP, JOHN A 
KOSTELNICK,JOHN M 
KOVACS,AKOS 
KRAHER, ELLEN A 
LADD, THOMAS E 
LANDON, RICHARD JOSEPH 
LANHAM,LAWRENC* GREGORY 
LARRICK, CHARLES P 
LAWLER,JOHN E 
LAWRENCE, MICHELLE 
LEE, BILL R 
LEE, OBADIAH 
LEHNEH,LEE ANN V 
LEJK.TERESE MARIE 
LEWIS, EMANOEL B 
LISSCH,JOHN J 
LLOYD, MARY ANN 
LONG, PATRICIA A 
LONG, THOMAS V 
LONG, WILLIAM R 
LONIGAN,JOHN ARTHUR 
LOUGH2RY, BARBARA 
LUTHER, PATRICIA A 
MAHEUX, PATRICIA M 
MAITLAND, JACQUELINE E 
HA LLOY, TIMOTHY 
MARCUH, VINCENT L,JR 
MASLO, KAREN A 
MARTIN, ANTHONY C 
MAYER, RONALD 
MCCORMACK, JAMES S 
MCDANIEL,DWIGHT S 
MCDERMOTT,JOHN A 
MCFADDEN, AUSTIN A 
MCLEAN, JOSEPH W,JR 
HCVAY.ANN V 
H2DLOCK, ELIZABETH B 
MELVIN, GARFIELD D 
MENNE,KIRK D 
MENSAH, KINGSTON A 
MILES, CATHERINE J 
MILLER, BENNY BRANDT 
MILLER, GENERAL 
MIMS,GARY B 
MINNICK, DONNA GAIL 
MITCHELL, ARLEN V 
MOAKLER.MASY D 
MONK, EUGENE W 
MOODY, WILLIAM C 
MOONEY.JOHN P 
MOOSE, MICHAEL J 
MORGAN, GEORGE S 
MORRIS, ANDRE 
MORRIS, THERON E 
MORTON, JAMES H 
MURPHY, COLLEEN F 
MURPHY, LONZIE 
MURRAY, MICHAEL LEO 
NEEDHAM, LINDA 

NEILL, ROBERT J 
NELSON, DALE P 
NEVIUS.HARY PATRICIA 
NEWKIRK, JAMES K 
NEWMAN, WILLIAM B,JR 
NEWSOME, JAMES L 
NICKELSON.ELKAKIE 
NIXON, HARRISON C 
N03BIS, ROBERT LEE 



ACCOUNTING CLERK (ACTING) $ 3 

CHIEF 8 

INTERN, FROM AUG 18 TO AUG 31 

SENIOR AUDITOR 3 

SUPPLY ACCOUNTING CLERK, TO AUG 31 

ACCOUNTS CLERK, FROM SEP 1 2 

LABORER 2 

ACCOUNTS CLERK, FROM SEP 1 

DELIVERYMAN 2 

LABORER 2 

STOCK CLERK 2 

EMPLOYEE BENEFITS SUPERVISOR 4 

OFFICE EQUIPMENT ATTENDANT 2 

FOREMAN CABINET SHOP 6 

MASSEUR, TO AUG 31 2 

TELEPHONE OPERATOR 2 

ASSISTANT TO CLERK 10 

INTERN, TO AUG 31 1 

CARPET TECHNICIAN 4 

LOCKSMITH 4 

CHIEF 8 

INTERN, TO AUG 31 1 

REPAIRMAN 4 

CLERK DRIVER 2 

STOCK CLERK 2 

INTERN, FROM AUG 8 TO AUG 22 

CHIEF 6 

ASSISTANT FOREMAN CARPET SHOP 5 

ASSISTANT CHIEF TELEPHONE OPERATOR 4 

SECRETARY 3 

PURCHASING CLERK 3 

CHIEF ADMINISTRATION DIVISION 5 

VENETIAN BLIND TECHNICIAN 3 

TELEPHONE OPERATOR 2 

CLERK TYPIST, FROM AUG 1 1 

STENOGRAPHER 3 

INTEEN, TO JUL 15 

LABORER 2 

LAEORER 2 

ACCOUNTS PAYABLE CLERK (ACTING) 3 

CARPENTER SERVICEMAN 3 

CLERK 3 

CARPET LAYER 3 

ASSISTANT REPORTS EXAMINER 3 

SENIOR EMPLOYEE BENEFITS CLERK 3 

REPAIRMAN 4 

PROCESSING CLERK 2 

LEGISLATIVE RECORDS CLERK 3 

SENIOR ACCOUNTS CLERK 3 

LAEORER (GROUP LEADER) 3 

STOCK CLERK, TO JUL 31 

CABINETMAKER 4 

ACCOUNTING SUPERVISOR 4 

PERSONNEL CONTROL SUPERVISOR 5 

LAEORER 2 

SENIOR AUDITOR (ACTING) 3 

ASSISTANT REPORTS EXAMINER 3 

SENIOR ACCOUNTS CLERK 5 

TELEPHONE ORDERS CLERK 3 

LABORER (GROUP LEADER) 3 

DIRECTOR 7 

APPRENTICE UPHOLSTERY SHOP ...., 3 

ACCOUNTS CLERK 3 

REPAIRMAN 4 

LABORER, FROM AUG 1 TO AUG 31 

ASSISTANT BILL CLERK 5 

VENETIAN BLIND CLEANER 3 

TELEPHONE OPERATOR 2 

FOREMAN LABOR FORCE 4 

CHIEF REPORTS EXAMINING SECTION 4 

INTERN, TO SEP 6 

SALES CLERK (ACTING), FROM SEP 12 1 

CLERK TYPIST • 2 

STCCK CLERK 2 

SALES CLERK, FROM AUG 10 1 

LABORER 2 

ASSISTANT LIBRARIAN 3 

TYPEWRITER REPAIRMAN 4 

LAEORER (GROUP LEADER) 3 

INVENTORY CONTROL CLERK 3 

FINISHER 4 



028.26 
969.76 
286.79 
973.74 

763.1*2 
720.92 
877.00 
556. 83 
900.25 

775. an 

543. 26 
888.25 
243.00 
455.84 
755.50 
371.99 
323.66 
090.26 
251.75 
969.76 
323.66 
802.01 
891.25 
631.00 
330.92 
257.76 
376.00 
008.00 
462.00 
870.99 
175.24 
689.76 
755.50 
754.00 
114.24 
330.92 
792.76 
685.00 
028.26 
689.76 
412.26 
783.33 
722.49 
4 74.0 
580.76 
631.00 
771.99 
573.75 
235.26 
761.17 
628.49 
570.26 
576.25 
900.25 
672. 99 
114. 24 
169.99 
151.74 
081.67 
124.01 
157.50 
028.26 
628.49 
859.17 
002.26 
157.50 
755.50 
132. 26 
543.26 

938.10 
631.00 
357.25 
490.90 
900.25 
771.99 
132.26 
121.50 
065.49 
461.00 



SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF THE CLERK -CONTINUED 



OROS, JOSEPH JOHN.JR 
OVERST?EET,JOHN C 
PALMER, JOHN LOUIS 
PAPPANO, MARIA G 

PARKER, ODETTE 

PARKS, CHARLES R,JR 
PATTERSON, ROBERT T 
PATTON, DOUGLAS J 
PENDERGRAPH, NEKTON B 
PETERS, NANCY H 
PICKETT, DIANE BRUCE 
PIEKNIK.JEAN 
POLEN, EDWARD P 
POPE,JOSTINE KAY 
POPP, DANIEL HERBERT, JR 
POZZI, ERNEST R 
PRESTON, JACKIE 
PRICE, PATRICIA LYNN 
PRINS,LISBETH L 
PROPST, ROBERT L 
POTTERMAN, PETER B 
QOATTRONE, COSMO 
QUINLAN, THOMAS J,JR 
RADER, ROBERT LAURENCE 
RAINES, ROBERT FONZO 
PALEY, MARVIN A 
RANTANE, JEANNE V 
RANTANE, ROBERT AXEL 
RAYNER, ELLEN PAYNE 
REEDY, DONALD 9 
REESE, HOLLY DEAN 
RHODES, LUTHER D 
RICHMOND, THOMAS J 
RICHROATH,DOFOTHY W. 
RIVENBARK, ABNER 
ROBINSON, MEDFORD E 
ROCHE, CHARLES DAVID 
ROSS,DIANNE DOLEZAL 
ROSS, STEVEN R 
RUBLE, CARL R 
RUIT, THOMAS 
RUSSELL, DIANE FELICIA 
SAKERS, JAMES G 
SANDERS, KEVIN LEE 
SARTORI,JOAN ANN 
SAYERS, ALBERT, JR 
SCHIPPERS, KATHLEEN H 
SCHMAND, JAMES T,JR 
SCHULTZ, MARGUERITE S 
SCOTT, WILSON M 
SEPESY, RICHARD F 
SHADE, EUGENE 
SHEFFIELD, FRANK 
SINGER, DELLA KAE 
SLAIMAN.GARY 
SMALL, BOBBY R 
SNIROLDO.DENISE M 
SMITH, DONALD L 
SMITH, JAMES RALPH 
SMITH, MILTON A,4R 
SNOW, WILLIAM DONALD 
SNOWDEN,MAXINE W 
SOULEYRET.AVA MARIE 
STALBAUH,DANE 
STIMPSON, WILLIAM H,JR 
STOFEL ,OWEN 
STONE, GEORGE M,JR 
STONE, JOHN F 
STRINKO, GREGORY 
STRUBLE,JOHN 11 
STUKES .DOROTHY H 
SULLIVAN, RONALD E 
SWANN, HENRY L 
TAYLOR, BETTY SUE 
TAYLOR, CHARLES HENRY 
TEMPLETON, ROBERT A 
TEPANGO, MARCO 
TETLOW,KAYE I 
THOMAS, EDWARD A 



LABORER $ 2,685.00 

SENIOR REPORTS EXAMINER 3,973.7a 

VENETIAN BLIND CLEANER 3,552.00 

AUDITOR (ACTING), TO AUG 31 

SECRETARY (ACTING), FROM SEP 1 2,283.51 

AUDITOR, TO AUG 31 

ACCOUNTING CLERK, FROM SEP 1 4, 204. 99 

LABORER 2,685.00 

.SUPERVISORY INVENTORY CONTROL CLERK 3,970.50 

SPECIAL DEPUTY, FED ELECTION COMM 10.191.2U 

CLERK TYPIST (ACTING) 2,283.51 

SALES CLERK, TO AUG 8 1,110.87 

OFFICE MANAGER 5,175.2a 

ACCOUNTS PAYABLE CLERK 4,268.49 

ASSISTANT CHIEF 6,992.76 

DIGEST CLERK 3,870.99 

SENIOR CAMERAMAN 1,772.76 

ASSISTANT BILL CLERK (ACTING) 3,973.74 

REPAIRMAN 1,419.24 

GENERAL CLERK 2,631.00 

INTERN, TO AUG 12 '. 926.56 

REPAIRMAN 4,461.00 

LABORER, FROM SEP 12 544.14 

SERVICE ATTENDANT 3,639.91 

PAYROLL CLERK 3,028.26 

CARPET LAYER 4,042.50 

LABORER 3,008.01 

LABORER 2,900.25 

ASST DATA PROCESSING SPECIALIST 4,543.26 

APPRENTICE FINISHING SHOP 3,288.99 

EXECUTIVE SECRETARY 4,543.26 

FOREMAN CARPET CLEANER 3,624.00 

INTERN, FROM JUL 16 TO AUG 13 617.71 

APPRENTICE CARPET LAYER 3,420.51 

DELIVERYHAN 2,878.74 

STOCK CLERK, FROM AUG 1 TO AUG 8 202.98 

ASSISTANT FOREMAN DRAPERY SHOP 5,160.75 

HELPER 3,121.50 

LABORER 2,685.00 

PERSONNEL FILE CLERK 2,631.00 

ASSISTANT CHIEF 5,175.24 

SENIOR ELECTRONICS TECHNICIAN 5,116.50 

FOREMAN FINISHING SHOP 6,021.75 

INTERN, TO AUG 31 1,323.66 

ACCOUNTS PAYABLE CLERK 3,259.51 

SECRETARY, TO AUG 27 1,666.30 

TELEPHONE OPERATOR 3,006.00 

ASSISTANT CHIEF, TO AUG 26 2,534.78 

AUDITOR (ACTING), TO AUG 31 2,018.84 

PURCHASING CLERK 3,573.75 

GENERAL CLERK, TO AUG 31 2,134.34 

SENIOR AUCIO SPECIALIST 4,772.76 

CABINETMAKER 4,802.01 

FINISHER 4,287.75 

FOREMAN PHYSICAL CONTROLS SECTION 4,389.24 

TELEPHONE OPERATOR 2,755.50 

INTERN, TO JUL 31 661.83 

LABORER 2,792.76 

INTERN, FROM AUG 1 TO SEP 12 926.56 

LABORER 2,792.76 

LABORER (GROUP LEADER) 3,235.26 

EMELOYEES BENEFITS COUNSELOR 3,973.74 

UPHOLSTERER 4,802.01 

ASSISTANT TALLY CLERK 4,772.76 

INTERN, TO JUL 15 330.92 

LABORER 2,900.25 

DRAPFMAKIR 4,251.75 

CHIEF ENGINEERING SECTION 5,864.01 

REPORTS EXAMINER 3,474.00 

APPRENTICE FINISHER 3,420.51 

LABORER (CARPET TRAINEE) 2,649.17 

AUDIT 6 ACCOUNTING SUPERVISOR 4,543.26 

LEGISLATIVE RECORDS CLERK 3,771.99 

REPAIRMAN 4,090.26 

CARPET CLEANER 3,157.50 

ACCOUNTS CLERK 2,718.00 

PROCESSING CLERK 2,718.00 

CHIEF PROCESSING SECTION 4,272.00 

ACCOUNTS PAYABLE CLERK 3,028.26 

CLERK TYPIST, FROM JUL 25 TO JUL 31 175.40 

DRAPERY TECHNICIAN 4,090.26 



SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF THE CLERK -CONTINUED 



THOMAS 
TOLIVE 
TOVEN, 
TOWLES 
TREASU 
TURCH, 
TWOMBL 
VANDYK 
VANN.B 
VANN,D 
VANWIN 
VASS.A 
VENTUR 
VOGEL, 
WALKER 
WALKER 
WALLAC 
WALSH, 
WANAMA 
WARLEY 
WAPPSN 
WARREN 
HATERS 
WEAVER 
WEAVER 
WEED,H 
WELLS, 
WHITE, 
WHITE, 



, LEE 
R.JAMES 
PHILLIP L 
,DARRYL N 
PE.GEOEGE R 
DAVID N M 
Y, WENDELL EDWIN 
E.THOMAS WAYNE 
EN JAMES 
EVOH C 

RLE, RICHARD A 
LICE V 
A.JUDITH R 
DIANNE L 
.CHRISTIAN L 
.MARY ANN 
E, ALFONZA 
GERARD P.JR 
KER.ANNE L 
.WALTER A 
.JAMES F 
,JOHN P.JR 
.STEPHEN 
.DANIEL HAFT 
.WARD JOHN 
ENRY H 

BRENT DAINES 
ANN C 
JANELLE J 



WHITE, JOHN, JR 
WHITE, WALTER M 
WHITS, YVONNE Y 
WHITEHURST, SUZANNE 
WHITLEY, JACK LEE,SR 
WILEY, JSANETTE W 
WILEY, JEFFREY LATANE 
WILLIAMS, JAMES M,SR 
WILLIAMS, THOMAS C.JR 
WILLS, HAROLD JOSEPH 
WILSON, GARRETT E 
WINGARD.NEIL B 
WISE, THOMAS CLAYTON 
WITHERS III, RAYMOND H 
WOODBURN, WALTER A 
WORTMAN, STANLEY J 
YINGER, JAMES CHRISTOPHEE 
YOHE,JOHN ARTHUR 



YOONG.BRENDA KAY 
YOUNG, RAY H 

ZETTS.MASY CATHEFINE 
ZOECKLEP,GWENN L 



OFFICE OF THE SERGEANT A 

ABERNATHY, GILBERT H 
ABERNETHY, THOMAS F 
AEAMS, JAMES W 
s.GNER, DAVID W 
AKEES, JAMES EDWARD 
ALCORN, PAUL RAY 
ALEXANDER, DONALD E 
ALEXANDER, EDWARD R 
ALLWARD, DENNIS D 
ANDREWS, ROBEFT L 
ARMSTRONG, CHARLES R 
ARMSTRONG, RICHARD L 
ASHTON, WILLIAM HOWARD 
ATKINSON, JAMES M,JR 
AUSTIN, DONALD ELTON 
BAGIS, WILLIAM DENNIS 
BALL,DEBRA SUE WALKER 
BAPANSKA.JOHN PETER, JR 
BAPNETT, WILLIAM 
BARTRAM,FRED VERNON 
BASS,EVEPETT MITCHELL 
BAUER, JOSEPH J, III 



ASSISTANT JOURNAL CLERK $ 

SHOP LABORER 

APPRENTICE CABINET SHOP 

INTERN, TO AUG 27 

LIBRARY ASSISTANT 

DATA PROCESSING SPECIALIST 

LAEORER 

CABINETMAKER 

VENETIAN BLND TECHNICIAN 

LAEORER 

SENIOR ELECTRONICS TECHNICIAN 

EMPLOYEE EENEFITS CLERK 

SENIOR PROCESSING CLERK 

SECRETARY 

CHIEF PROEUCTION SECTION 

SALES CLERK 

LABORER 

FILE CLERK, FROM SEP 13 

PERSONNEL FILE CLERK 

PERSONNEL CONTROL CLERK 

VOUCHER CLERK 

LABORER (CARPET TRAINEE) 

OFFICE EQUIPMENT ATTENDANT, FROM SEP 12 

ASSISTANT ENROLLING DIGEST CLERK 

ASSISTANT FOREMAN UPHOLSTERY SHOP 

MACHINIST 

INTERN, TO AUG 20 

INTERN, FROM AUG 15 TO SEP 15 

PROCESSING CLERK, TO JUL 31 

PROCESSING CLERK, FROM AUG 12 

LAEORER 

LABORER 

STAFF ASSISTANT 

INTERN, TO JUL 31 

CABINETMAKER 

SENIOR AUEITOR 

AUEITOR (ACTING), TO JUL 31 

STOCK CLERK 

JANITOR-LAEORER, TO AUG 19 

MASTER LOCKSMITH COORD SURPLUS PROPERT 

CLERK TYPIST 

LIERARY AID 

PRINTING CLERK 

OFFICE EQUIPMENT ATTENDANT 

APPRENTICE FINISHER 

INVENTORY CONTROL CLERK 

CARPET CLEANER 

INTERN, TO JUL 31 

LABORER, FROM AUG 1 TO AUG 31 

STOCK CLERK, FROM SEP 1 

INTERN, FROM AUG 1 TO AUG 31 

CHIEF 

SECRETARY 

PROCESSING CLERK, TO SEP 5 

T ARMS 

CAPTAIN 

TECHNICIAN (SPECIALIZED) 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PEIVATE EIRST CLASS 

TECHNICIAN (SPECIALIZED) 

PRIVATE 

PRIVATE, TO SEP 15 

PRIVATE FIRST CLASS 

PEIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PEIVATE FIRST CLASS 

PEIVATE 

PEIVATE .' 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE 

PRIVATE FIRST CLASS 



7,413.99 
3,008.01 
3.U20.51 
1,257.48 
3,870.99 
3,474.00 
2,685.00 
U, 287. 75 
3,982.71 
3,008.01 
5,002.26 
(t, 156. 50 
3,028.26 
3,573.75 
6,126.99 
2,631.00 
3,008.01 

543.60 
4,367.76 
3, 114.24 
3,028.26 
2,685.00 

585.78 
4,811.09 
5,376.00 
4,628.49 
1,103.05 

683.90 

2,385.80 
2,900.25 
2,900.25 
5,002.26 

661.83 
4,628.49 
4,173.24 

761.17 
2,920.17 
1 ,403.31 
6,243.00 
2,631.00 
2,804.76 
3,771.99 
2,888.25 
3,552.00 
3,375.00 
3,288.99 



2,282.17 

661. 83 

6,860.25 

3,507.25 

1,900. 17 



,239. 16 
,003.68 
,510.62 
,351.77 
,105.47 
,674.01 
,428.74 
,245.87 
,991.71 
,758.73 
,089.51 
,083. 37 
,082.48 
,581.43 
,510.62 
,595.34 
,173.01 
,758.61 
,361. 16 
,896.40 
,831.81 
,674.01 



SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



FROM 



OFFICE OF THE SEBGEANT AT AHHS -CONTINUED 



BAYES, RONALD E 
BELL, HERBERT MILO,JR 
BELL, RUSSELL F 
BENNETTE,LAVAN T 
BENSON, HALTER E 
BERMAN, RONALD L 
BIBB, JOHN BENJAMIN, JR 
BISSETT,KENYON B 
BLACK, CLARENCE NANNIE 
BLAKE, CALVIN J 
BLAND, SHIRLEY 
BLCCHER,PAUL H 
BLODGETT, CLARENCE R, JR 
BOLDUC, LOUIS P 
BOND, GEORGE H 
BOONE, HELEN HARIE 
BOROWSKI, MICHAEL A 
BOWERS, ALLEN PRICE 
BOWERS, ALLEN S 
BOWLING, BENJAMIN F 
BOWN, JOSEPH R,JR 
BRADFORD, GRADY LARRY 
BRADSHAW, CHARLES M 
BR ASWELL, ROBERT, JS 
BREWSTSR,ROYCE ROLAND 
BRICE, MICHAEL LEWIS 
BRIERLY.LEE ALVA 
BROMELOW, GREGORY ALAN 
BROOKS, BARRY L 

BROWN, EDGAR, JR 
BROWN, HERBERT F 
BROWN, MICHAEL D D 
BRCWN, RICHARD F 
BRYAN, IVAN Q 
BRYANT, JAMES F 
BRYANT, MEREL STEVEN 
BRYANT, WILLIAM B,SR 
BOCK, DANIEL T,JF 
BUCKLEY, DESALES H 
BURGESS, L MICHAEL 
BURGOON, ROBERT D 
BURKE, JOSEPH M 
BURKHEAD, KENNETH L 
BURNS, JAMES S,JR 
BUTLER, MELVIN JEROME 
BYRD, ROBERT E 
CAINE,JOHN 
CAMERON, THEODORE S 
CAMPBELL, HARRY R 
CANNADY, WILLIAM E, JR 
CANNON, ERNEST LEE 
CAPPS, CECIL L 
CAHAVAGGIO, DANTE S 
CAERICO, BERNAD3TTE 
CARROLL, DONALD T 
CARROLL, GARY L 
CARVER, GEORGE BRYAN 
CASSIDY, MICHAEL D 
CAULFIELD, KEVIN G 
CELIA, FRANK R 
CHANIE.ALGIN 
CHAPIN, GEORGE H 
CHICK, ROLAND EVERETT 
CHRISTIAN, JOHN JOSEPH 
CLAPK, CHARLES R 
CLARK, JOE L 
CLEM, JOHN HENRY, JR 
CLINE, FLOYD FREDERICK 
CLINE, WILLIE PAUL 
CLINTON, KERMIT H 
COCHRAN, WILLIAM E 
COFFER, CHARLES BERNARD 
COLE MA N.GEORGE 
COLEMAN, NOBMAN M 
COLFACK, VERNON F,JR 
COLINET.DOMINICK 
CONKLING,JUANITA 
CONWAY, MICHAEL P 
COOK, JAMES APNET 
COOK, KENNETH 



PRIVATE FIRST CLASS 

SERGEANT 

PRIVATE FIRST CLASS 

LIEUTENANT 

PRIVATE FIRST CLASS 

SERGEANT 

PFIVATE 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE 

PRIVATE 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE 

PRIVATE FIRST CLASS 

CAPTAIN 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE 

PRIVATE FIRST CLASS 

PRIVATE, TO AUG 7 .' 

SERGEANT 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS, TO AUG 31 

TECHNICIAN (SPECIALIZED), FROM SEP 1 ... 

PRIVATE 

PRIVATE FIRST CLASS 

TECHNICIAN (SPECIALIZED) 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PLAINCLOTHESMAN 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE 

SERGEANT 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE 

SERGEANT 

TECHNICIAN (DOG HANDLER) 

TECHNICIAN (SPECIALIZED) 

PRIVATE FIRST CLASS 

PFIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

SERGEANT 

PRIVATE FIRST CLASS 

PRIVATE 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

CAPTAIN 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE 

PRIVATE FIRST CLASS 

ASSISTANT CASHIER 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

TECHNICIAN (DOG HANDLER) 

PRIVATE 

SERGEANT 

SERGEANT 

PRIVATE FIRST CLASS 

PRIVATE 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE 

SERGEANT 

ADMINISTRATIVE ASSISTANT TO BANK DIRECTO 

PRIVATE 

TECHNICIAN (SPECIALIZED) 

PRIVATE FIRST CLASS 



SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF THE SEFGEANT AT ARMS -CONTINUED 



COOKSEY,EOBEET H 
COON, DAVID LAWRENCE 
COOPER, ARTHUF L 
CORONEL,RICARDO N 
CORSETTI,STEVAN J 
COSGPOVE, PHILIP J 
COWARD, BARBARA E 
COYNE, MARTIN J,JR 
CROWELL,BETTINA L 
CORRIE,BROCE ALAN 
CURRY, DAVID A 
CURRY, MELFORD.JR 
CURTIS, MONTE E 
CUSHHAN, RONALD LEE 
CYPRESS, JOHN H 
DANBSON, JAMES GARY 
DANIELS, CARLSON B,JR 
DANIELS, JOHN E 
DAVIS, HAROLD G 
DA VIS, HUGH F 
DA VIS, JERRY LEROY 
DSAS,JOE,JR 
DELOCCA,JOHN J 
DIBENEDETTO, ANTONIO F 
DINGLE, RAYMOND I 
DIONNE, ROBERT LEE 
DITZLER, CLYDE WILNER 
DIXON, DONALD 
DOBBS, WILLIAM HAYO 
DODSON, GEORGE A 
DOGGETT, EDMUND C 
DONOVAN, DANIEL D 
DONZE, WILLIAM C 
DORFMAN, LOUIS E 
DOSS, HORACE SEAY 
DOUGHERTY, JOSEPH M 
DOWELL, RAYMOND R 
DOWLING, JOSEPH E,III 
DRAPER, GEORGE A 
DUNGAN, JOSEPH M 
DUNN, ARTHUR JOSEPH 
DWYER, JAMES THOMAS 
DYSON, SAMUEL LEE 
EADES, RODNEY C 
EADES, RONALD E 
EALY, HOWARD EYLAND 
EATON, CHARLES A, III 
EATON, RAYMOND E 
SLIG,GENE P 
ELLIOTT, GEORGE, JP 
EMORY, WILLIAM H 
ESCALA DA, BENITO 
ETHPIDGE, ARTHUR L 
EU ILL, JOHN W 
EVANS, ROBERT W 
PALLON, HAROLD G 
FAREWELL, CHARLES J 
FARRAR.DELBERT R 
F2REBEE, CYRIL ANDREW 
FIELDS, CAROLINE J 
PIELDS, GILBERT E 
FINGER, JOHN DEWITT 
FINN, RICHARD J 
FISCHER, DUAINE K 
FISHER, WILLIAM E 
FITCH, LANCE, JR 
FLEMING, THOMAS E,JR 
FOLEY, ROBERT T 
FORBES, HERBERT E 
FOFTNER, DEWEY L 
FOSTER, CHARLES D 
FOSTER, KELLY FREEMAN 
FRALEY, GERALD J 
PRICK, EDWARD G , JR 
FR IE SLANDER, FREDERICK 
FULGHUM, HENRY G 
GAINER, ROBERT LEE 
GALIFARO, THOMAS J,JB 
GARIFO, MICHAEL BOSS 
GARMAN, WILLIAM R 
GAERETT, ROBERT 











«, 331 . 55 


















3,532. 06 






5,553. 15 












3 , 3 1 9 . HI 












4,521. 21 






5,595.72 






4,055. 19 






3 ,674. 01 






3,173.01 






3,804. 36 






5,61 6. 90 






5,565. 69 






5,318. 71 






4,540.35 






4,934.22 




3,935.82 






4,521. 21 






3,949. 35 






4,051. 41 






4, 197. 81 






5 ,050.71 






3,991 .71 






3,831.81 






4,775. 37 






4,770.03 






4, 372. 95 






4,935.03 












4,500.03 












4,523. 94 


















5,262. 51 






3,217. 61 






3,695. 19 






3,769. 32 






3,423.51 






4,864. 73 






4,783.85 






3,818.31 






3,822. 27 






6 ,424. 62 






5,456.73 












4,415.31 






3,924. 51 






3,328. 56 




4,788.54 






5,511.00 






3,758.73 






4,578. 30 






4, 390.77 






4 ,849.50 






3,292. 81 




3 ,924.51 






3,173.01 






4,330. 59 






3 ,695.1 9 






4,213.11 




4, 175. 01 






3,978.21 






4,965.99 












4,854.66 






4,012.89 






2,<<S6.23 






5, 51 1 . OC 






4,012. 89 






3,282.81 






5, 168. 61 






3,991.71 






3,811 .68 






4,636. 87 






3 ,995.97 


PFIVATE FIRST 







10 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF THE SERGEANT AT ARMS -CONTINUED 



GASSER, CHARLES E 
GASSETT,EARL D 
GATES, BENSON W 
GEAR, JOSEPH PATRICK 
GIARDINO, RALPH A 
GIBBS, THOMAS V 
GILBREATH,JAHES E 
GILL, EDGAR, JR 
GILLUM, RANDALL LEE 
GIMELLI, CAROLYN L 
GITTIN,DENISE 
GIVENS, JAMES L,JR 
GLASCOE,LEO 
GOAD, OSCAR HERMAN 
GOETZ, RALPH W,JR 
GORMLEY, JAMES THOMAS 
GRANGER, GERALD J ' 
GRANT, JAMES J 
GRAY, ROBERT W 

GRAY, WILLIAM LESLIE 
GREEN, TOMMY JOE 
GREENLEE, MATTIE LOUISE 

GREGORY, SUSANNE S 
GRILLO, JOSEPH F 
GROVES, RICHARD C 
GRUBE, THOMAS E 
GUDITUS, STEVEN 
GURZELL, DONALD A,SR 
HALL, CALVIN B 
HALL, DAVID CHARLES 
HALL, HENRY 
HALL, JOHNNIE W 
HAMILTON, ROBERT E 
HAMILTON, TYRONE 
HANCE, DENNIS JOHN 
HANCOCK, GEORGE THOMAS 
HANNA, JOHN 
HANNELD, MICHAEL ROY 

HANSON, JOHN B 
HARDING, KENNETH R 
HARDMAN, GEORGE R 
HARDWICK, BRUCE A,SR 
HARRAH, WILLIAM M,J8 
HARRELL, FREDRICK H,SR 
HARRIS, RODNEY H 
HART, HOSES 
HAWKINS, WILLIAM J 
HAY, JACK E 
HAYES, KENNETH 8 
HEATH, GARY L 
HELTON, ROLAND E 
HENSLEY, FLOYD E 
HERBERT, DONALD J 
HERBST.MARK G 
HERPMAN.PAUL Z,JR 
HILL, CHARLIE R 
HINCHEY, CHARLES P 
HINES, HOWARD R 
HOLLOWELL, NATHAN S 
HOLMES, GEORGE LEE, JR 
HOOE, JAMES IRA 
HOWARD, JEHRY A 
HOWARD, RONALD L 
HOWARD, THOMAS F 
HOWE, ROBERT R 

HOWELL, HERBERT H 
HUDSON, LARRY 
HUFF, WILLIAM L 
HUFFMAN, LARRY ROEERT 
HUFFMAN, WILLIAM H 
HUGHES, JOSEPH A 
HUMPHREYS, EDWARD 0,111 
HUNT, JOHN O 
HUPP, MICHAEL E 
HURLOCK, WARREN L 
HYNES, JUERGEN 
IORIO.D THOMAS 



PRIVATE FIRST CLASS $ 3,959.94 

SERGEANT 4,972.57 

TECHNICIAN (SPECIALIZED), FROM SEP 1 1,308.17 

PRIVATE FIRST CLASS 4,489.44 

PRIVATE FIRST CLASS a, 885. 86 

PRIVATE FIRST CLASS 3,769.32 

PRIVATE FIRST CLASS 4,574.16 

DETECTIVE 4,655.19 

PRIVATE 3,767.76 

PRIVATE FIRST CLASS, TO JUL 11 191.63 

PRIVATE 2,981.52 

PRIVATE FIRST CLASS, TO JUL 31 1,299.09 

ASSISTANT CASHIER 5,175.21* 

SERGEANT 4,676.01 

PRIVATE a, 655. 31 

SEFGEANT tt,731.75 

PRIVATE FIRST CLASS, TO AUG 28 2,367.69 

PRIVATE 3,685.41 

TECHNICIAN (SPECIALIZED), TO JUL 31 

SEFGEANT, FROM AUG 1 4,643.34 

PRIVATE FIRST CLASS 4,531.80 

PRIVATE FIRST CLASS 3,423.51 

PRIVATE, TO AUG 31 

PRIVATE FIRST CLASS, FROM SEP 1 3,622.51 

PRIVATE, FROM SEP 16 748.43 

TECHNICIAN (SPECIALIZED) 3,924.51 

SERGEANT 4,676.01 

PRIVATE 3,327.41 

PRIVATE, TO AUG 2 1,320.33 

PRIVATE FIRST CLASS 3,737.55 

SERGEANT 4,808.31 

PRIVATE 3,895.86 

PRIVATE FIRST CLASS 3,778.83 

PRIVATE FIRST CLASS 4,838.91 

PRIVATE FIRST CLASS 5,336.64 

PRIVATE FIRST CLASS 3,660.39 

PRIVATE 3,758.61 

PRIVATE 3,484.11 

PRIVATE FIRST CLASS 4,831.33 

SERGEANT, TO JUL 31 

LIEUTENANT, FROM AUG 1 4,982.17 

PRIVATE FIRST CLASS 5,357.82 

SEFGEANT AT ARMS 13,125.00 

PRIVATE FIRST CLASS 4,521.21 

TECHNICIAN (DOG HANDLER) 4,535.25 

PRIVATE FIRST CLASS 3,864.63 

SERGEANT 4,425.51 

PRIVATE 4,481.46 

PRIVATE FIRST CLASS 4,627.65 

PRIVATE FIRST CLASS 3,423.51 

PRIVATE FIRST CLASS 4,884.27 

PRIVATE FIRST CLASS 4,309.41 

PRIVATE FIRST CLASS 4,245.87 

DETECTIVE 6,421.18 

PRIVATE FIRST CLASS 3,779.91 

PRIVATE FIRST CLASS 5,446.86 

PRIVATE 3,685.41 

PRIVATE FIRST CLASS 4,023.48 

SERGEANT 4,676.01 

PRIVATE FIRST CLASS 3,423.51 

TECHNICIAN (SPZCIALIZED) 4,105.47 

PRIVATE FIRST CLASS 4,320.00 

PRIVATE FIRST CLASS 3,502.47 

PRIVATE FIRST CLASS 3,551.82 

PRIVATE FIRST CLASS 4,153.89 

PRIVATE FIRST CLASS 4,034.07 

PRIVATE 3,850.11 

TECHNICIAN (SPECIALIZED), TO JUL 31 

SERGEANT, FROM AUG 1 4,806.32 

SEFGEANT 4,425.51 

PRIVATE 3,612.21 

PRIVATE FIRST CLASS 4,919.79 

PRIVATE 3,667.11 

PRIVATE 3,539.01 

PRIVATE FIRST CLASS 3,726.96 

PRIVATE FIRST CLASS 4,785.57 

GENERAL CLERK 2,878.74 

SERGEANT 5,280.43 

PLAINCLOTBESMAN 4,128.09 

PRIVATE FIRST CLASS 4,011.74 

PAIR CLERK TO THE MAJORITY 10,649.25 



11 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF THE SERGEANT AT 1RHS -CONTINUED 



IVEY, JAHES RAYMOND 
JACHIMOHICZ, ALFRED L 
JACKSON, CARL C,JR 
JACKSON, CLARENCE H 
JACKSON, GEORGE, JR 
JACKSON, NELDON R 
JACOBS, HENRY L 
JAHES, RICHARD T,SR 
JAHES, ROBERT A 
JANDROSITS.LOOIS HALTER 
JAEBOE, MICHAEL A 
JENKINS, ARCHIE B 
JENKINS, CARLETON C 
JENKINS, CECIL HARD 
JENKINS, HAROLD 
JENKINS, MICHAEL LARS 
JENKINS, THOMAS L,III 
JOBBER, CLADDE B 
JOHNSON, ARVA MARIE 
JOHNSON, CHARLES C 
JOHNSON, CHARLES H 
JOHNSON, CLINTON S,JR 
JOHNSON, JOSEPH ALLEN 
JOHNSON, OLIVER H 
JOHNSON, THOMAS 
JOHNSON, HALTER F 
JOHNSON, HILLIAM 
JOHNSON, HILLIE J 
JONES, FRANCIS X 
JONES, NAODAIN J,JR 
JONES, THEORTIS ERNEST 
JONES, HALTEB K 
KAHLSR.JACK H 
RAPTOR, RONALD J 
KAVAL,HILLIAH G,JR 
KELLY, GLEN RAY 
KELLY, TBOZELL A 
KENNEDY, MACK A 
KENNEDY, HANDA L 
KERAKOS, HILLIAM D 
KERRIGAN, FRANK ANDRE! 
KIELIGER, ROBERT H 
KIFER.JOHN HILLIAM 
KIHMEL, CHARLES B,SB 
KINDS V ATT ER, CHARLES 
KIRTZ, JAMES PHILIP 
KIRTZ.MABY ANNE 
KITCHEN, DENNIS HAYNE 
KITCHEN, SHIRLEY DAVID 
KLEAR, ROBERT H 
KLEIN, ELBERT LYNN 
KLEHP, CAROLINE 
KLINGLEB, RICHARD G 
KNIGHT, TERRY M 
KOELLEB, ARTHUR S 
KRDG,JOHN F 
KROGER, JOHN R,JH 
KF.OK.ANDREH 
LAMPSHIBE, BRADFORD G 
LANGFORD.PAOL F 
LANGSTON,EDHARD R,SR 
LANNIER.DELBERT DEAN 
LASSITEB, SYLVIA J 
LAOZIERE, JAMES EARL 
LEFFEBT, ANTHONY G 
LENAB, HALTEB A, SB 
LEO, RONALD STEPHEN 
LESCOVITZ,VICTOB J 
LINDSAY, ELHOOD H 
LINGENFELTER, JAHES F 
LINNEHANN, ROBERT B 
LIVERGOOD, JASON E 
LOCKHART.LARBT G 
LOOHIS,EARL F,JH 
LOPEZ, EDHABD F 
LOOVIERE, JOSEPH 
LOHHAN, DONALD 
LOCIOS.BEBNABD BOY 
LOCKEY,BRENDA C 
LOND.PAOL L 
LYNCH, JOSEPH ALAN 



















3,423. 51 






3 ,779. 91 






U, 065. 84 












4, 510. 62 






3,91*9. 35 






















4,425. 51 












3,674. 01 






14,997.51 












U, 987. 17 






4,542. 39 






3, 551. 82 












4, 3U1. 42 












3,841 . 01 


















i*, 629. 67 




1, 532. 51 






4 ,701.24 






3,775. 15 






4, 376. 91 






3,423.51 






3,319.41 






4,655. 19 












4,655. 19 






3,528.71 












4,321. 68 






3,173.01 












6,209.94 






4,134. 1 5 




4,026. 30 






3,854.04 






5, 196.3 1 






3,758. 61 






3,593.91 






4,604. 15 






3,737.55 






3,970.53 






4,015. 71 




3, 375.00 












4,399. 1 1 
























5,442.54 












5,029. 53 






3,896.40 












3,676.26 






4,267. 05 












4,023.48 






4,1 50.56 




3,995.42 






4,245.87 






4,275. 12 






5,114.25 










4,003.68 


















4,578.63 






5,167.20 






5,081.67 






3,712.86 








PBIVATE IIRST 







12 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF THE SERGEANT AT ARBS -CONTINUED 



LYNCH, TERRY WILLIAB 
LYNCH, WILLIAH T 
BALLON, CHARLES A 
HANGAN, JOSEPH PATRICK 
HANDEL, ROY H 
MARCOPULOS, RICHARD A 
MARSHALL, ROBERT L 
BARTIN, CLARENCE J. 
BARTIN, JANES T 
BARTIN, JOHN WAYNE 
BARTIN, ROBERT 
MASON, JEFFRY KYLE 
HATTALIANO, PETER F 
BATTINGLY, JOHN THOBAS 
HAYNOR, JAMES B 
MCCARTHY, BICHAEL G 
BCCORBICK, STEPHEN J 
BCCOY, PHILLIP L 
MCCREE, GEORGE, JR 
HCDERBOTT, WILLIAM 
BCDONALD, EUGENE D 
BCDONALD,WILBERT 
BCELWAIN,CARL S 
MCGAFFIN, CHRISTOPHER H 
MCGILL,PAUL R 
MCGRAW,CARL L 
MCKNEW, THOMAS G 
HCBAHAN, JAMES E 
MCNAIR, SAMUEL 
MCQUAY, EDWIN 
MEAD, WILBUR R 
MEERNAN, FRANCIS GERARD 
BEICHT, ROBERT L 
BELE, DANIEL, JR 
BERZ.CARL J 
MICER, RICHARD W 
BILLEH.ED 
MILLER, JUDSON P 
BILLER, LINDA H 
MILLS, CHARLES J 
MINNICK, STANLEY E 
MINNIX,0 J 
MOBBS,ROPERT ELTON 
MOHLER,CLAUCUS CLAY 
MOORE, BENJAMIN J,JR 
MOORE, THOMAS P 
MORALES, GUILLERMO 
MORELLI,JOHN J 
MORRIS, FRANCIS E,JR 
BORRIS, LINDER, JR 
BORRISON, BICHAEL P E 
BOSHIER,GARBY L 
BOSS, DICKIE LEE 
BOTLEY, DONALD RAY 
BOCKER, FLOYD K 
MULCAHY, MICHAEL G 
HOLLER, GEORGE BORTON.II 
MOLVEY, THOMAS J 
HURPHY.JOHN F 
MDRPHY,JOHN JOSEPH, JR 
SDRRAY, GERALD E 
HOTTER, GERALD WAYNE 
MYERS, FREDERICK J 
MYERS, RODRIC JACOB 
NASHWINTER, HOWARD L 
NEBEL, PAOL LEWIS 
NEVITT, RICHARD E 
NICHOLAS, FRANCIS 
NICHOLS, HAROLD E 
NISTON,JOHN R 
NIXON, BARRY G 
NOE, THEODORE J 
NOLAN, PATRICK JOSEPH, SR 
NOVAK, GERALD J 
NOWDEN, CLARENCE W 
OATIS, LOUIS A 
OCONNOR,JOHN P,SR 
OCONNOR, BARTIN A 
OKEEFE, JOSEPH E,JR 
OVERLY, LOWELL N 
PACE, FRANCESCO G 



PRIVATE FIRST CLASS $ 4 

PRIVATE 3 

ASSISTANT OPERATIONS OFFICER 6 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 3 

PRIVATE 3 

PRIVATE FIRST CLASS 3 

PRIVATE IIRST CLASS 3 

PRIVATE FIRST CLASS 3 

PRIVATE FIRST CLASS 4 

PLAINCLOTHESHAN 3 

PRIVATE 3 

LIEUTENANT 5 

PRIVATE FIRST CLASS 3 

PRIVATE FIRST CLASS 4 

PRIVATE 2 

PRIVATE 3 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 5 

GEN COUNSEL TO CHIEF US CAP POLICE 6 

PRIVATE 3 

INSPECTOR 8 

PRIVATE FIRST CLASS 3 

PRIVATE FIRST CLASS 4 

PRIVATE IIRST CLASS 4 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 3 

PRIVATE FIRST CLASS 3 

SERGEANT U 

PRIVATE FIRST CLASS 5 

PFIVATE FIRST CLASS 3 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 3 

PRIVATE FIRST CLASS 4 

SEFGEANT 4 

PRIVATE FIRST CLASS 4 

PRIVATE 2 

ASSISTANT DATA PROCESSOR 4 

SERGEANT 5 

PRIVATE FIRST CLASS 3 

SERGEANT 5 

PRIVATE 4 

DETECTIVE 4 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 3 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 5 

SERGEANT 4 

CAPTAIN 6 

PRIVATE 3 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 4 

TECHNICIAN (DOG HANDLER) 3 

PRIVATE 3 

SERGEANT 4 

PRIVATE FIRST CLASS 3 

PRIVATE 3 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 3 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 4 

PRIVATE 4 

LIEUTENANT 5 

LIEUTENANT 5 

ASSISTANT SERGEANT AT ARHS 4 

PRIVATE IIRST CLASS 4 

PRIVATE 4 

SERGEANT 4 

PRIVATE FIRST CLASS 4 

PRIVATE 4 

SERGEANT 4 

PRIVATE EIRST CLASS 4 

PRIVATE FIRST CLASS : 4 

PRIVATE FIRST CLASS 5 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 3 

PFIVATE FIRST CLASS 4 



13 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF THE SERGEANT AT ARBS -CONTINUED 



PADGETT, RICKY D 
PARISI, JOSEPH S,JR 
PARKER, HORACE LEE,JR 
PARKER, BELVIN F 
PARKS, CHARLES R 

PARKS, KENNETH DARREL 
PARKS, NATHANIEL, JR 
PASHKOVSKY.STEPHAN 
PASIERB, DAVID E 

PATRICK, JERRY D 
PATTERSON, RONALD 
PAYNE, WILBER ORION 
PEACOCK, BRUCE F 
PEACOCK, RAYMOND B 
PERLA, RONALD J 
PHELPS, DUVALL W 
PICCIONE, ANTHONY F 
PICKETT, BILLY JOE 
PICKETT, KEITH P 
PINNIX, JABES P 
PIPPIN, DOUGLAS W 
PITTBAN, KENNETH LLOYT 
PLODRDE.JOHN J 
POND, HOWARD F 
POSTON, DONALD J. 
POWELL, ALBERT D 
POIELL, JOSEPH L 
PRICE, HERBERT C 

PRICE, WILLIAH C 
PROCTOR, FREDERICK 
PRCCTOR, JABES W,JR 
PROVE NZA NO, CAR BINE 
PDNDAY, JAMES V 
PORDY, DONALD C 
PURVIS, DEAN C 
RAIDEN.ELWYN G 
RANDOLPH, RODNEY T 
RANDOLPH, WILLIE, JR 
RASH, KAREN GAIL 
RAUPE,CARL B 
REID.ROY E 
REID, VINCENT 
RENEHAN,JOHN RUSSELL 
REUSS, ROBERT JABES 
REUSS, ROBERT R 
REYNOLDS, KENNETH S 
SHOAD,JOHN D 
PHODEN, GERRY FRED 
RHDBOTTOH,THOHAS A. 
SICCI,DOBINIC PAUL 
RICE, SANDRA SUE 
2ICHARD, JOSEPH D 
RICHARDSON, VINCENT A 
RICHBOND.JOHN T,JR 
RIDDLE, ERNEST B,JR 
RINALDI, JOHN, JE 
RINALDI, PATRICIA K 
RING, STEPHEN H 
RIVET, CHARLES F 
ROBICHAUD, RONALD J 

ROBINSON, ROBERT LEE 
ROBINSON, THOflAS 
ROGERS, JOSEPH E 
ROHAN, JABES PATBICK 
POLLISON.OTIS LUTHSE 
POOD, JOHN A 
ROOKS, LEO 
?OONEY,REX C 
ROSE, THOMAS L 
ROSESBAUM, WILLIAM B 
ROSENC?.ANS, ROBERT S 
3CUP, HAROLD LESTER 
'UCCHIO, EUGENE J 
RUDD, LLOYD S 
ROFF, NELSON FRED,JR 
ROFFATTO, JOHN B 
RUFFIN,PZTER L 



PRIVATE FIRST CLASS $ 4 

PRIVATE fIRST CLASS 1* 

PRIVATE FIRST CLASS 4 

SERGEANT 4 

LIEUTENANT, TO JUL 31 

CAPTAIN, FROM AUG 1 6 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 5 

PRIVATE FIRST CLASS 3 

PRIVATE, TO JUL 31 

PRIVATE FIRST CLASS, PEOB AUG 1 4 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 4 

SFFGFANT 4 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 4 

PLAINCLOTHESMAN 3 

PRIVATE 4 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 3 

PRIVATE FIRST CLASS 3 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 3 

PRIVATE 3 

PRIVATE FIRST CLASS 3 

SERGEANT 4 

PRIVATE FIRST CLASS 5 

PRIVATE FIRST CLASS 4 

CAPTAIN, TO JUL 31 

INSEECTOB, FROM AUG 1 7 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 5 

PRIVATE 4 

PEIVATE 2 

PBIVATE 3 

PEIVATE FIRST CLASS 3 

PRIVATE 3 

DEPUTY SGT AT ARBS BANK DIRECTOR 11 

PRIVATE FIRST CLASS 3 

PEIVATE FIRST CLASS 4 

PRIVATE 3 

PEIVATE 3 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 4 

SERGEANT 4 

PEIVATE 3 

SPECIAL OFFICER 5 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 3 

TECHNICIAN (DOG HANDLER) 4 

PRIVATE FIRST CLASS 4 

PEIVATE FIEST CLASS 4 

PEIVATE 3 

PEIVATE 3 

PEIVATE 3 

PEIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 3 

LIEUTENANT 5 

PLAINCLCTHESBAN 3 

TECHNICIAN (SPECIALIZED) 4 

PRIVATE 3 

PRIVATE FIRST CLASS, TO AUG 31 

TECHNICIAN (SPECIALIZED), FROH SEP 1 3 

PRIVATE FIRST CLASS 4 

PEIVATE FIRST CLASS 4 

PEIVATE FIRST CLASS 3 

PRIVATE 3 

PEIVATE FIRST CLASS 3 

PRIVATE 3 

TECHNICIAN (SPECIALIZED) 6 

PRIVATE 3 

PRIVATE 4 

PEIVATE 4 

PRIVATE 3 

SERGEANT 4 

CAPTAIN 7 

PRIVATE FIRST CLASS 4 

PEIVATE FIRST CLASS 4 

SERGEANT 5 

PEIVATE FIEST CLASS 4 



084.80 
9 34.22 
863.24 
859.35 

534.31 
094.16 
198.97 
674.01 

929.47 
690.65 
468.26 
527.59 
139.97 
388.22 
924.51 
591.26 
351.29 
811.68 
917.58 
351.77 
690.65 
674.01 
438. 36 
928.17 
425.51 
135. 43 
580.49 

741.47 
045.32 
247.78 
518.06 
922.51 
685.41 
674.01 
758.61 
457.99 
472.86 
252. 59 
795.21 
501.26 
509.21 
706.61 
689.49 
621.36 
872.20 
097.61 
867.66 
365.60 
245.87 
444.77 
731.16 
612.21 
465.81 
531.80 
897.27 
585.13 
991.71 
118.79 
850. 11 

837.04 
637.52 
500.03 
758.73 
246.21 
896.40 
593.91 
299.61 
511.56 
655. 31 
106.31 
392.61 
425.51 
049.50 
574. 16 
251.92 
096.91 
854.66 



14 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF THE SERGEANT &T ARMS -CONTINUED 



PUGGIERI, ROBERT C 
RUPP, DOUGLAS E 
RDTHERFORD, RAYMOND 8 
RYMER, FLORENCE M 
SAILES, PAMELA JEAN 
SALYER, GEORGE R,JR 
SARGENT, PEMMIE LEE 
SAUNDERS, MICHAEL J 
SCALZO, RALPH R 
SCHAAP, JOSEPH R 
SCHAAP, PATRICIA ANN 
SCHORN,CARL B 
SCHWEINSBER3, LARRY ALAN 
SEAGLE, ROBERT T 
SETTLE, CHARLES F 
SEVERANCE, CHARLES F,JR 
SHACKLETTE, HOMER A 
SHAPIRO, JAMES A 
SHAH, GEORGE MERLE 
SHEA, JOHN B 
SHELTON,HUGH F 
SHOEMAKER, MELVIN R 
SHOOK, ELROY 
SHUGARS,JOHN HENRY 
SIKO, WILLIAM P 
SILMAN, ROBERT S 
SIMON, EDWARD J 
SIMON, HABVEY.JR 
SINGLETON, PAUL B 
SLEZAK, THOMAS J. 
SMALLHOOD, FRANK C 

SMITH, BRUNO WALTER 
SMITH, JAMES A 
SMITH, LEE A 
SMITH, LIDDELL 

SMITH, MAJOR J,JR 
SMOLARSKY, EDWARD E 
SPEIGHTS, PINKNEY 
SPOCK, WILLIAM HENRY 
SPRATT, ROBERT L 
STANKOWSKI, CHESTER S 
STARKEY,JACK W 
STCLAIR, GEORGE W 
STELLABOTTA.JOHN A 
STEPHENS, RICKEY L 
STEVENS, RUSSELL EDWIN 
STEVENS, WILLIAM E,JR 
STEWART, ROBERT E 
STOLTZ, FREDERICK B 
STONE, RONALD J 
STREET, CALVIN 
STUCK, ROBERT L 
SWAN, PAMELA S 
SWANN,JOHN B 
SWANSON.LENNART P 
SWARTZ,JOHN P 
TARRANCE,JACK R 
TAYLOR, ELMO H 
TAYLOR, LEROY GARFIELD 
TEDRICK, JEFFREY LINN 
TERI.ULDERIGO GINO 
TESTER, JACK G 
THOMAS, JAMES 
THOMPSON, ARTHUR JOHN 
THOMPSON, GARLAND CHARLES 
THOMPSON, MICHAEL J 
TILLER, JEAPLINE 
TOEPKE, CONRAD W 
TOMASKO, EDWARD A 
TOMLIN, KENNETH ALDEN 
TOMLIN,ZARA JEAN 
TORREGROSSA, GERALD J 
TOVEN, ALBERT P 
TRADER, DAVID A 
TREW, WILLIAM L,JR 
TROLLINGER, JAMES T 

TROTTER, PHILLIP S 
TURNER, HENRY L 



PRIVATE FIRST CLASS $ U 

PRIVATE 3 

PRIVATE FIRST CLASS 4 

PRIVATE 2 

PRIVATE 3 

SERGEANT 4 

EXECUTIVE ASSISTANT 5 

TECHNICIAN (DOG HANDLER) 4 

LIEUTENANT 6 

LIEUTENANT 5 

DATA PROCESSOR 4 

PRIVATE 3 

PRIVATE 3 

PRIVATE 3 

PRIVATE FIRST CLASS 5 

PRIVATE 4 

PRIVATE FIRST CLASS 4 

TECHNICIAN (SPECIALIZED) 4 

PRIVATE FIRST CLASS 3 

PRIVATE FIRST CLASS 3 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 3 

PRIVATE FIRST CLASS 4 

SERGEANT 4 

PRIVATE 3 

PRIVATE FIRST CLASS 3 

PRIVATE FIRST CLASS 3 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 5 

PRIVATE FIRST CLASS 3 

PRIVATE, TO JUL 31 

PRIVATE FIRST CLASS, FROM AUG 1 3 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 3 

SERGEANT 4 

TECHNICIAN (SPECIALIZED), TO JUL 31 

SERGEANT, FROM AUG 1 4 

PRIVATE FIRST CLASS 4 

PRIVATE 4 

PRIVATE FIRST CLASS 5 

PRIVATE FIRST CLASS 5 

PRIVATE FIRST CLASS 3 

PRIVATE FIRST CLASS 1 

PRIVATE FIRST CLASS 3 

PRIVATE FIRST CLASS 4 

PRIVATE, TO SEP 19 3 

DETECTIVE 6 

SIRCFANT, TO JUL 25 1 

TECHNICIAN (SPECIALIZED) 4 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 4 

PRIVATE 3 

PRIVATE 3 

SERGEANT 4 

PRIVATE 2 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 3 

PRIVATE 3 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 4 

SERGEANT 4 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 3 

SEFGEANT 4 

PRIVATE 3 

PRIVATE FIRST CLASS 5 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 3 

PRIVATE FIRST CLASS 5 

PRIVATE FIRST CLASS 4 

PRIVATE 3 

PRIVATE FIRST CLASS 4 

PRIVATE FIRST CLASS 4 

PRIVATE 4 

SERGEANT 4 

INSPECTOR, TO JUL 31 

DEPUTY CHIEF, FROM AUG 1 8 

PRIVATE 3 

PRIVATE FIRST CLASS 3 



15 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OPPICE OF THE SERGEANT AT ABMS -CONTINUED 



TURNER, JOHN E 
TURNER, ROBERT C 
TWOMBLI, DONALD P 
TSOHBLY, WARREN EDGENE 
OHLOR,ELWIN LEON 
USESICZ, JOSEPH A,JR 
VANETTEN.LAVALLE F 
VANFLEET, VIRGIL LEON 
VANHOOSER, WILLI AW R 
VANHOBN, WILLIAM R 
VANHAASTRICHT,DONALD F 
VARELA, RAYMOND J 
VARGO, FRANK A 
VAOGHAN, WILLIAM A 
VETH, THEODORE PHELPS 
VOIGT,30LAND FRANCIS 
WALCKER, RODGER T 
WALLACE, LI TTLETCN, JB 
WAPLE, KENNETH LEE 
WARNER, FRANCIS D 
HATERS, WILLIAM E 
WEBB, JAMES NELSON 
WEBER, PAOL 
WELCH, RALPH R 
WHEELER, RITA 

WHITE, CORTIS 
WHITE, ETSON D 
WHITEHORST, HOWARD G 
WHITLEY, CANDIS M 
WHITT, JAMES 
WHITTINGTON, JOSEPH L 
WIDO,PETER JOSEPH 
WIEDEMER, THOMAS R 
WILLHOIT, STERLING 
WILLIAMS, JOSEPH L , JR 
WILLIAMS, THOMAS JERROLD,JR 
WILLIE, EDWIN T 
WILLOUGHBY, CHARLES H 
WILSON, CHARLES C 
WILSON, DANIEL FREDERICK 
WILSON .EDWARD J 
WILSON, JOHNNY LEE 
WILSON, LLOYD E 
WINTON, KENNETH 
WOLD, DALE L 
WOLFE, LANDON EUGENE 
WOMACK, DOUGLAS M F 
WOMACK, PENNY CARLEEN 
WOMERSLSY,JOHN T 
WOODEN, DEAN BRUCE 
WYCOFF, CARROLL 0,JR 
YACONO.PAUL J 
YAWORSKE.ALAN J 
YORKMAN, CLIFTON E 
YOUNG, ROBERT W 
ZIEHBA, FRANK M,JP 
ZIMMERMAN, ALBERT F 



PRIVATE FIRST CLASS $ 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

TECHNICIAN (SPECIALIZED) 

PRIVATE 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE 

SERGEANT 

LIEUTENANT 

PRIVATE 

PRIVATE FIRST CLASS 

SERGEANT 

PFIVATE, TO JUL 31 

PRIVATE FIRST CLASS, FROM AUG 1 

PRIVATE 

ASSISTANT SERGEANT AT ARMS 

PRIVATE FIRST CLASS 

PRIVATE 

PRIVATE FIRST CLASS 

SEPGEANT 

PRIVATE FIRST CLASS 

PRIVATE 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE 

PRIVATE 

PRIVATE 

PRIVATE 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS, TO SEP 15 

PFIVATE FIRST CLASS 

PRIVATE 

PRIVATE 

PRIVATE FIRST CLASS 

SEP.GFANT 

PRIVATE FIRST CLASS 

PRIVATE FIRST CLASS 

PRIVATE 

PRIVATE FIRST CLASS 

LIEUTENANT , 

PFIVATE FIRST CLASS 

PFIVATE FIRST CLASS 



528.95 
298.82 
832.86 
928.17 
924.51 
225.26 
834.92 
108.20 
516.67 
319.41 
716.37 
420. 38 
118.79 
489.47 
436.49 
394.13 
267.05 
097.61 
840.96 
120.8 5 
712.21 
465.81 
213.11 
502.07 

044.89 
868.41 
543.26 
887.40 
162.71 
674.01 
356.99 
674.01 
746.81 
991.71 
361. 16 
612.21 
074.93 
404.72 
557.31 
435.71 
639.66 
492.11 
002. 30 
160.63 
459.55 
097.90 
209.61 
173.01 
569.18 
770.37 
674.01 
779.91 
996.51 
30 9.4 1 
012.00 
139.97 
690.00 



OFFICE OF THE DOORKEEPER 

ABRAHAM, STEVEN LOUIS 

ADAMS, GEOFFREY G 
AIKEN, JANE 
ALLEN, JAYVAN 
ALLEN, JOHN MERLE 
ALLEN, MORRIS 
ALSTON, KAY 
AMID.JEANINE 

ANDERSON, DONNALD K 
ASBURN, LAURIE 
ASHBA,PAUL OWEN 
BARBER, CHARLES A, IV 
BARNES, FRANK ALVERON 
BASAPAN,AYSEN 
BAYNARD, GEOFFREY M 
BEATTI5, JAMES M 



PAGE OVERSEER, TO JUL 10 

BENCH PAGE, FROM JUL 11 TO AUG 
BENCH PAGE, FROM JUL 5 TO AUG 
MACHINE ASSISTANT, FROM SEP 13 

SNACK EAR ATTENDANT (R) 

CHIEF EAREER LONGWORTH BLDG ... 

DOORMAN 

BENCH PAGE, FROM SEP 7 

TELEPHONE PAGE, TO AUG 14 

PAGE OVERSEER, FROM SEP 7 .... 

MAJORITY CHIEF 

PAGE, TO JUL 26 

MACHINE OPERATOR 

TFLEFHCNE PAGE, FROM SEP 7 ... 

GENERAL CLERK 

MACHINE OPERATOR 

DELIVEPYMAN 

DCCRMAN 



806.70 
581.21 
456.70 
,208.75 
,683.76 
,891.25 
481.00 

,519.23 
,099.75 

521.08 
,775.84 

481.00 
,655.51 
,978.01 
,331.06 
,357.25 



16 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF THE DOORKEEPER -CONTINUED 



BECHTEL, FRANK A 
BELL, CAMILLA I 
BELL, DAVID JOE 
BELL,GOLDA S 
8ENFTELD, JAMES C 
BENNETT, GERALD EDBIN 
BENNETT, MIKE 
BENSON, MELANIE L 
BETHEA, GASTON, JH 
BETHEA, GLENN 
BETHEA, TERENCE 
BISHOP, JIMMY 
BISHOP, WILLIAM J 
BISSELL, MOLLIE BRYDEN 
BJELLOS,ELI S 
BLOYER,JOHN HOLLIS 
BOKISH, BRUCE 

BOLDING, FRANCES CLARA 
BOLYARD, DAVID R 
BRAHAME,GARY WAYNE 
BRASWELL, ANDRE 
BRAUN, JOSEPH A, III 
BROOKS, BERNARD EUGENE 
BROWN, KATHLEEN GAYLE 

BROWN, MALCOLM S 
BROWN, MILDRED 
BRUE.JAN 

BUCHANAN, FRANK B 
BURLISON, JAMES D 

BURNESS, ROBERT A 
BURNETT, CARL 
BURY, JOSEPH G 
BUTLER, SYLVIA C 
CALLIS,LEON T 
CARTER, JAMES LEE 
CARTER, LILLIE INEZ 
CARTER, LUCILLE KETCHUM 
CASTILLO, MAYBELLE 
CAVINESS, HAROLD S 

CHANDLER, HORACE, JR 

CHAPPELL, CHRISTOPHER CLYDE 

CHARTAK, LOUISE M 

CHELLMAN,JOHN L 

CHIPOURAS,TOULA 

CHONKA,GARY THOMAS 

CHRISTAKOS.ANNA 

CLARK, CHRIS 

CLARK, MELBA MARIE 

CLAY, WILLIAM L 

CLEMENCE, BRYAN 

CLEMMEF, PUETT JENNINGS 

CLEMONS.LORI 

COFFEY, ROBERT H.JR 

COLES, MARK A 

COLLIER, ERICH E 

COLLINS, KEVIN 

CONNELLY, MAURA 

CONNORS, WILLIAM V 

CONYERS,DRAYNE 

COOPERSKITH, JEFFREY HASKELL 

CORRADO, CHRISTIAN 

COX, THOMAS PAUL 

CRAWFORD, LEARON L 

CRIPPEN, WILLIAM T 

CROSS, CARL E 

CROWE, TIMOTHY 

CUBEPO, FRANK 

CURRIE.ALYWIN D 

DALEY, ANIS MARGARET 

DANIELS, THOMAS TYLER 



DASTDGUE.CHERE 
DAVID, LEE ALAN 
DAVIS, HAROLD B 
DAVIS, LESTINE 



ASSISTANT CHIEF $ 7,388.25 

MANICURIST 2,685.00 

MACHINE ASSISTANT 2,432.01 

MACHINE OPERATOR 3,036.33 

ASSISTANT, TO AUG 8 1,677.80 

MECHANIC 4,132.26 

BENCH PAGE, FROM SEP 7 U81.00 

BENCH PAGE, FROM SEP 21 200. 42 

DOORMAN 2,891.25 

MACHINE ASSISTANT 1,953.67 

BENCH PAGE, TO AUG 7 741.54 

BENCH PAGE, FROM SEP 7 481.00 

MACHINE ASSISTANT 2,804.76 

MACHINE OPERATOR 3,065.49 

CHIEF 9,459.75 

ASSISTANT CHIEF 3,346.17 

BENCH PAGE, FROM JUL 11 TO AUG 7 

BENCH PAGE, FROM SEP 7 1,022.12 

INSERTER 2,581.74 

BAREER 3,456.51 

COUNTER 2,507.01 

MACHINE ASSISTANT, FROM SEP 14 431.33 

DOORMAN 3,209.92 

JANITOR 3,008.01 

EENCH PAGE, TO AUG 7 

PAGE OVERSEER, FROM SEP 7 1,378.94 

EARBERSHCP SUPERVISOR 4,132.26 

MACHINE OPERATOR 2,978.01 

PAGE, TO JUL 5 100.21 

INSERTER 2,507.01 

DELIVERYMAN, TO JUL 31 

INSERTER, FROM SEP 28 811.91 

JANITOR 2,416.50 

BENCH PAGE, FROM SEP 7 481.00 

CLERK, PPOM SEP 6 730.83 

WRAPPER 2,283.51 

ASSISTANT CUSTODIAN 3,235.26 

DOORMAN 3,239.01 

MACHINE OPERATOR 3,122.99 

CHECKROOM ATTENDANT 2,581.74 

MACHINE ASSISTANT 2,655.51 

ASSISTANT STOCK CLERK, TO JUL 31 

ASSISTANT STOCK CLERK, FROM AUG 5 2,762.75 

MACHINE ASSISTANT, TO AUG 6 862.66 

BENCH PAGE, TO JUL 10 200.42 

LEEGER CLERK 3,151.74 

PAGE, TO JUL 19 380.79 

ATTENDANT (LADIES ROOM) 2,655.51 

NIGHT SUPERVISOR CLERK 3,288.51 

ATTENDANT (LADIES ROOM) 2,655.51 

PAGE OVERSEER, FROM SEP 7 637.40 

MACHINE OPERATOR 3,122.99 

DOORMAN 2,232.76 

BENCH PAGE, TO AUG 7 741.54 

DOORMAN 2,978.01 

BENCH PAGE, TO AUG 7 741.54 

CLERK 2,660.00 

MACHINE ASSISTANT, FROM AUG 1 1,496.96 

INSERTER, TO JUL 31 735.79 

TELEPHONE PAGE, TO AUG 7 741.54 

PAGE OVERSEER, TO AUG 14 1,168.57 

CLERK 1,826.42 

CLERK 3,586.50 

PAGE, FROM JUL 11 TO AUG 10 601.25 

PAGE, FROM JUL 11 TO AUG 10 601.25 

MACHINE ASSISTANT, TO SEP 6 1,674.57 

BENCH PAGE, TO JUL 31 601.25 

MESSENGER CLERK 2,730.00 

MEMBERS LAV ATTENDANT AND BOOTBLACK 3,008.01 

BENCH PAGE, FROM SEP 7 481.00 

SUPERVISOR PAGES CLOAKROOM 3,543.51 

INSERTER 2,283.51 

BENCH PAGE, TO AUG 7 

TELEPHONE PAGE, FROM SEP 12 1,122.33 

BENCH PAGE, TO JUL 10 

PAGE OVERSEER, FROM JUL 11 TO AUG 14 

BENCH PAGE, FROM SEP 7 1,584.41 

BENCH PAGE, FROM SEP 20 220.46 

BENCH PAGE, TO AUG 7 741.54 

DOC8NAN 2,891.25 

DCOFMAN 2,308.09 



17 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF THE DOORKEEPER -CONTINUED 



DAY,JUDI LYNN 
DSLLASTATIOUS,DREH 
DEVANE, RAPHAEL 
DILLON, ANTHONT 
DIPAULA,SALVATORE J 
DIPESA, JOSEPH 
DIPOHPO, JOSEPH 
DOLIN, MITCHELL F 
DONOVAN, PETER T 
DRAKE, LESLIE 
DRISCOLL.JOHN C 
DONBAR.VERIAN R 
DOSHA, JOHN H. 
EARL, HALTER STANLEY 
ELBIN,HAX,JR 
ELIAS, HELEN ROSE 

FALCONETT, ANNETTE 
FALLS, EVERETT HOODS 
FANNING, MICHAEL S 
FARRELL, CATHERINE ANN 
FELIX, FRED PDRVIS 
FERGOSON.DAHN 
FISHER, JAMES D. 
FITZGERALD, JOHN H 

FLANAGAN, PATRICIA 
FLOYD, THERESA E 
PLOEGEL, NANCY 
FLYNN,JOHN J 
FOLEY, AILEEN N 
FOLEY, JOSEPH PATRICK 
FOLEY, KAREN Y 
FOLEY, KEVIN CORRAN 

FOX.THOHAS HARBEN 
FRAZIER, CHARLES E. 
FREEMAN, PATRICIA E. 
PRIEDHAN, CHARLES TIMOTHY, JR 
FRITTS,HILLIAH DOOGLAS 
FOTRELL, EDISON LEON 
FOTRELL, JOHN 
GALLAGHER, DAVID 
GALLEGOS, JERRY LYNN 
GILLEN,EOGENE H 
GIORDANO, COSIHO 
GLENN, HOLLY ELIZABETH 
GODDARD, FRANK H 
GOLDEN, PADL T 
GONZALEZ, FRANK H 
GRANARA,J RALPH 
GRAY, HARRY LEE 
GREENBLATT, EDITH L 
GRIFFIN, FOLTOB 
GRIFFIN, HARY 
GRIFFIN, PAUL HILLIAH 
GDICE,JOE R 
GOIFFRE, ROBERT E 
HALIB0RTON,BROCE E 
HAMILTON, LORENTZ CAHR.III 
HANSEN, BRADLEY S 
HARE, CATHERINE K 
HARKINS, DANIEL CONGER 
HARRIS, DOROTHY 
HARRIS, DOROTHY G 
HARRIS, LOGAN, JR 

HARRISON, ANNA 
HARROON, TIMOTHY J 

HAYES, CYNTHIA 
HAYNESHORTH, PEGGY L 
HEAD, DAVID JDSTIN 
HEUEB,GARY HAYNE 
HICKS, LDKE H 
HIGGINS, JEANNE H 
HILL, BESSIE B 
HINKS, KAREN A 
HOAG, CHARLES L 
HOHHADEL, HAROLD 
HOLBERT, HELEN ROTH 



BENCH PAGE, FROM JDL 11 TO AOG 7 $ 5141.12 

INSERTER 2,308.09 

STOCK CLERK 3,519.66 

HBAPPER 2,132.00 

CLERK 3,151.71* 

BENCH PAGE, FROM JUL 11 TO AOG 7 541.12 

EARBER 3,1*56.51 

DOORMAN 2,283.51 

BENCH PAGE, FROM SEP 7 481.00 

PAGE, TO JOL 5 100.21 

PAGE, TO JOL 12 240.50 

BENCH PAGE, FROM SEP 7 481.00 

CLERK, TO JOL 31 906.00 

DOORMAN 3,007.17 

TELEPHONE ASSISTANT, FROM AUG 6 2,340.09 

HRAPPER, TO AOG 2 

SECRETARY, FROM AOG 3 2,763.1*5 

PAGE, TO JOL 19 380.79 

DELIVERYHAN, FROM SEP 2 735.79 

BENCH PAGE, TO AOG 7 741.54 

MACHINE ASSISTANT 2,730.00 

CLERK 3,151.7** 

EENCH PAGE, FROM SEP 7 U81.00 

MACHINE ASSISTANT, TO AUG 22 1,1«1.75 

DOORMAN, TO JOL 31 

DELIVERYHAN, FROM AUG 1 2,283.51 

BENCH PAGE, FROM JUL 11 TO AUG 7 541.12 

COLLATING MACHINE OPERATOR 2,891.25 

BENCH PAGE, FROM SEP 7 481.00 

CLERK, FROM AUG 1 TO SEP 5 1,023.17 

SECRETARY 4,570.26 

DOORMAN 2,833.59 

MACHINE ASSISTANT 2,432.01 

INSEBTER, TO SEP 6 

DOORMAN, FROM SEP 7 2,283.50 

EARBER 3,456.51 

DOORMAN 3,065.49 

ASSISTANT CLERK 3,036.33 

DOCEMAN 2,332.67 

ASSISTANT MINORITY CHIEF, TO AUG 7 1,867.78 

MACHINE ASSISTANT, FROM SEP 1 761.17 

MACHINE ASSISTANT, TO AOG 25 1,370.10 

MACHINE ASSISTANT, TO JOL 10 253.72 

FOURTH ASST SUPERINTENDENT 3,991.26 

DOORMAN 2,283.51 

CLERK 1,803.75 

BENCH FACE, FROM SEP 12 380.79 

MACHINE ASSISTANT 2,258.13 

DELIVERYHAN 2,131.27 

INSERTER 2,232.76 

RECEPTIONIST PRAYER ROOM 1,202.01 

CLERK 2,718.00 

BENCH PAGE, FROM SEP 12 380.79 

MACHINE ASSISTANT, FROM SEP 1 761.17 

BENCH PAGE, TO AOG 7 741.54 

DOORMAN 2,978.01 

DELIVERYHAN, FROM SEP 1 735.80 

ASSISTANT CHIEF 3,346.17 

DOORMAN 2,283.51 

DELIVERYHAN, TO AUG 4 862.66 

BENCH PAGE, TO AUG 7 741.54 

MACHINE OPERATOR 2,804.76 

BENCH PAGE, TO AOG 5 701.46 

MACHINE ASSISTANT 2,630.92 

INSERTER 2,283.51 

ECCBHAN, TO AOG 31 

CHECKROOM ATTENDANT, FROM SEP 1 3,151.74 

MACHINE OPERATOR 2,724.88 

TELEPHONE ASSISTANT, TO AOG 7 

ASSISTANT MINORITY CHIEF, FROM AOG 8 4,309.12 

MACHINE ASSISTANT 2,357.25 

CHIEF PACKAGE ONIT 3,114.24 

DELIVERYHAN, FROM AOG 1 TO AOG 31 761.17 

DOORMAN 2,891.25 

STAFF ASSISTANT 5,232.00 

DELIVERYHAN, TO AOG 23 1,293.98 

HACHINE OPERATOR 3,065.49 

EOCRHAN 2,283.51 

DELIVERYHAN 2,581.74 

SUPERVISORY CLERK 4,371.51 

MACHINE OPERATOR 2,547.85 



18 



SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



FROM 



OFFICE OF THE DOORKEEPER -CONTINUED 



HOLDER, JONI 
HOLM, J D 
HOLHES, DAVID W 
HOWARD, ANDERSON R 
HOWARD, JAMES, JR 
HOBER,KENT 
HUGHES, JAMES 
HUGHES, JEFF 
HYMEL, MARGARET MARY 
HYNES, EDWARD JAMES 
ILLSLEY r THAYEB V 
INGLESBY,LEO C,JB 
JACKSON, JAMES E 
JACK SON, LINDA 
JENIFER, BARBARA J 
JENKINS, JAMES LOUIS 
JENKINS, RICHARD E, JE 
JERNIGAN, WARREN H 
JEROME, ANNE G 
JEWELL, WILL H 
JOHNSON, JOYCE J 
JOHNSON, KENNETH M 
JOHNSON, MARJORIE 
JOLLY, RONALD G 
JONES JB.LSROY 
JONES, ALISON DIANE 
JONES, KENNETH B 
JORDAN, SHARON 

KEATING, RICHARD FRANCIS 
KEEBLEB,KATHRYN M 
KELLAHER, DONALD T 
KELLER, MICHAEL JOSEPH 
KINEAVY.JOHN 

KING.MELODYLEE 

KIRKLAND, DOROTHY M 
KIRKLAND, HARRY M 
KIRKLAND, TIMOTHY 
KITZ MILLER, DAVID 
KNOBLA UGH, ERNESTINE 
KNOLL, KIM 

KOLZAK, SUSAN P 
KOEGE, ANDREW 
KOSMACKI, PHILIP D 
KOVARIK, JAMES S 
KRIZEK,PAUL E 
KUSER, EUGENE J 
LEE,REGINA 
LEVOCK, MICHAEL P,JR 
LEWIS, BETH E 
LINTELMAN, GLENN 
LITTLE, PAUL 
LOWE ,LORA 
LUBIN.EVE 

LUKASIEWICZ, DIANE S 
MACINNIS, WILLIAM J 
MAGPUDER, NATHANIEL E 
MAHEUX, GREGORY A 
MALOY,HARK G 
MALRY, CHARLES BILLY 
MARKUS,KENT 
MARSTON, CHARLES 
MARTIN, T FARRAR 
MARTINI, VINCENT ANTHONY 
MATHERNE, GRAHAM 
MATHIAS, ROBERT JOSEPH 
MATHIS, ANTHONY 
MATTOX, RICHARD A 
MAXWELL, PRENTICE 
MAYBEBRY, PETER 
MCARTHUR,JOHN B 
MCCLAIN, ADDIE M 
MCCOMB, DAVID F 
MCCOWN, GEORGE W 
MCKEON, MATTHEW 
MCMILLAN, WILLIAM PAUL 

MCMILLIAN, GARFIELD F 



BENCH PAGE, TO AUG 7 $ 741.54 

COUNTER 2,357.25 

CHIEF 6,816.33 

BARBERSHOP ATTENDANT 2,589.24 

DCCEMAN 2,978.01 

BENCH PAGE, TO AUG 7 741. 54 

DOORMAN 2,357.25 

BENCH PAGE, FROM SEP 7 481.00 

BENCH PAGE, TO AUG 7 741.54 

MACHINE ASSISTANT, TO AUG 24 1,319.35 

FIRST ASST SUPERINTENDENT 7,379.97 

DOORMAN, FROM SEP 7 608.93 

MACHINE OPERATOR 2,949.09 

BENCH PAGE, TO AUG 7 741.54 

MACHINE ASSISTANT, FROM SEP 19 304.47 

CHIEF 3,771.99 

GENERAL CLEBK 2,953.26 

CHIEF 4,566.51 

ASSISTANT CHIEF 4,140.08 

CHIEF DELIVERY UNIT 3,346.17 

INSERTER 2,182.02 

TELEPHONE PAGE, FROM AUG 1 TO AUG 31 601.25 

COUNTER, FROM AUG 3 TO AUG 3 25.37 

BENCH PAGE, TO AUG 7 741.54 

CLERK, FROM SEP 16 438.50 

BENCH PAGE, TO AUG 7 741.54 

MACHINE ASSISTANT, TO JUL 31 659.68 

TELEPHONE PAGE, TO AUG 7 

TELEFHCNE PAGE, FROM SEP 7 1,222.54 

DOORMAN 2,283.51 

BENCH PAGE, FROM SEP 7 481.00 

TELEPHONE CLEBK 3,028.26 

COUNTER, FROM AUG 26 888.03 

BENCH PAGE, FROM JUL 11 TO AUG 7 

BENCH PAGE, FROM SEP 7 1,022.12 

BENCH PAGE, TO AUG 7 

BENCH PAGE, FROM SEP 7 1,222.54 

MACHINE ASSISTANT 2,581.74 

BAPBERSHOP ATTENDANT 2,786.76 

EABEIRSBCP ATTENDANT 2,786.76 

PAGE, TO JUL 5 100.21 

INSEFTEB 2,655.51 

BENCH PAGE, TO AUG 7 

BENCH PAGE, FBOM SEP 7 1,222.54 

BENCH PAGE, TO AUG 7 741.54 

BENCH PAGE, FROM JUL 11 TO AUG 7 '. 541.12 

CLERK, TO AUG 23 1,549.37 

MACHINE ASSISTANT, TO AUG 31 1,496.96 

PAGE, TO JUL 19 380.79 

CHIEF EAEEER RAYBURN BLDG 3,683.76 

WBAPPER 2,283.51 

CLERK 2,978.01 

BENCH PAGE, FBOM JUL 11 TO AUG 7 541.12 

BENCH PAGE, TO AUG 7 741.54 

COUNTER 2,283.51 

BENCH PAGE, FROM SEP 7 481.00 

BENCH PAGE, FROM JUL 11 TO AUG 7 541.12 

COUNTEB, TO JUL 31 735.79 

CLEBK 3,586.50 

JANITOR 3,008.01 

WBAPPER, FROM SEP 13 456.70 

MACHINE ASSISTANT, FROM JUL 11 1,776.05 

MEMBERS READING ROOM ATTENDANT 3,008.01 

SPEAKERS PAGE, TO AUG 14 1,207.19 

2ND ASST SUPERINTENDENT 6,109.95 

DOORMAN, TO SEP 9 1,807.23 

DOOEMAN, FBOM SEP 26 126.86 

BENCH PAGE, FROM JUL 11 TO AUG 7 541.12 

DCCEMAN, TO SEP 6 1,674.57 

TELEPHONE PAGE, TO AUG 7 i 741.54 

CLERK, FBCM AUG 1 1,754.00 

SUPERVISORY CLEBK 4,57n.26 

BENCH PAGE, FROM SEP 7 481.00 

DOCEBAN, TO SEP 9 1,750.69 

CLEPK 2,630.92 

COUNTER, TO JUL 31 634.31 

INSERTER 2,829.42 

PAGE, FROM JUL 11 TO AUG 10 601.25 

TILEPHCNI PAGE, TO AUG 7 

TELEPHONE PAGE, FROM SEP 7 1,222.54 

CHIEF BAEBER CANNON BLDG 3,683.76 



19 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF THE DOORKEEPER -CONTINUED 



MCNALLY, THOMAS C 
MCNUTT, LINDA C 
MCVERRY, JAMES A 
MEADOWS, WILBERT 
SELENDSZ,KATHERINE CECILIA 
HELLER, RICHARD SAMUEL 
MELLODY,CHARLES JAMES 
METCALF, ERNEST 
MICHAELSON.MIKE 
MICHEL, CAROL 
MILLER, BARBARA P 
MILLER, JAMES B,JR 

MILLER, RAYMOND C 

MILLER, REBECCA S 
MINA, GEORGE ANDREW 
MITCHELL, BRIAN C 
MOBLEY,JACK D,JR 
MOLLOY, JAMES T 
MORRIS, YVONNE 
MORRISON, DOUGLAS J 
MOSS,MAFY LAURA 
MUESSEL,G H 
MUNSON, CAROLINE J 
NEBEL, FRANCES L 
NEIDERT, JAMES A 
NEIL, PAUL 

NEIL, PETER 
NELSON, MICHAEL 
NELSON, T CHASE 
NEWBOLD, CHARLES H 
NEWMAN, LAURA J 

NOLL, JOHN H 
NORTON, JOYCE M 
O'KEEFE.ROY D 
OAKES, JAMES M 
OBERHAN,IRVIN 
OBFIEN.JOHN 
OBRIEN.RUTH 

ODONNELL, THOMAS J,JR 
OEMICHEN, WILLIAM LEE,JR 
OHAFA, KATHLEEN CECILIA 

OLIVER, JAMES ALAN 
OHALLEY, ROBERT J 
ONEILL, SOPHIE C 
ORLANSKY, STEVEN D 
PAPPAS,MICHAFL GEORGE 
PARENT, RICHARD 
PARKER, HARRY F,JR 
PARKER, LAURA E 
PARKER, LAURIE JEAN 
PASKOW,ROY G 
PASTIS,GOS V 
PATTERSON , JOHN H,JR 
PAYNE, WILLIAM 
PETERSEN, ERNEST A 
PETERSON , RICHARD A 
PHELPS, LOUIS R,JF 
POPKEY,M C 
PORETZ.ELOISE 
PORTELLA,JOHN L 
PRATT, WITT GUISE 
PRELOH, ELLEN 
QUATTBONE, FRANK J 
QUATTRONE, JOSEPH P 
RAFFEPTY, JAMES 
RAMSEY, HANNA B 
RANDALL, LOU 
RAUSCH, RICHARD L 
REAGAN, THOMAS BRYANT 
FEECE, SIDNEY ROY, JR. 
REGAN, STEPHEN 
REIDY,MARY 
REYNOLDS, MARY LOU 
RINGUETTS, SCOTT W 
ROBINSON, CONSTANCE V 



MACHINE OPERATOR $ 2,891.25 

BENCH PAGE, TO AUG 7 741.54 

DCORMAN 2,283.51 

INSERTER 1,598.45 

MACHINE ASSISTANT, FROM AUG 16 1,091.00 

WRAPPER, FROM AUG 8 TO AUG 23 405.96 

ASSISTANT MAJORITY CHIEF 5,002.26 

LEAD JANITOR 3,456.51 

CHIEF 8,244.00 

PAGE, TO JUL 5 100.21 

TILEFHCNE PAGE, TO AUG 7 741.54 

BENCH PAGE, TO AUG 7 

BENCH PAGE, FROM SEP 7 1,222.54 

BENCH PAGE, TO AUG 7 

BENCH PAGE, FROM SEP 7 1,222.54 

TELEPHONE PAGE, FROM SEP 7 481.00 

BENCH PAGE, FROM SEP 7 481.00 

BENCH PAG^f, FROM SEP 7 481.00 

MECHANIC 3,982.74 

DCORKEEPER 13,125.00 

CHIEF POSTAL PATRON PROCESSING UNIT 3,519.66 

PAGE OVERSEER, TO AUG 7 932.66 

COUNTER 2,581.74 

COUNTER, TO SEP 10 1,674.56 

MACHINE OPERATOR 3,065.49 

CLERK 3,837.99 

TELEPHONE PAGE, FROM SEP 12 380.79 

BENCH PAGE, TO JUL 19 

BENCH PAGE, FROM AUG 1 TO AUG 31 982.04 

BENCH PAGE, FROM SEP 7 481.00 

TELEPHONE PAGE, TO JUL 31 601.25 

PAGE, TO JUL 5 100.21 

DOCUMENT? RIAN PAGE, FROM SEP 7 481.00 

PAGE OVERSEER, TO AUG 14 

PAGE OVERSEER, FROM SEP 7 1,805.97 

CHIEF OPERATIONS SECTION 6,257.76 

INSEETER 2,357.25 

ECORMAN, FROM SEP 8 583.56 

DOORMAN, TO SEP 6 1,674.57 

ASSISTANT 3,722.49 

MACHINE CPERATOR 2,543.30 

TELEPHONE PAGE, TO AUG 7 

TELEFHCNE PAGE, FROM SEP 7 1,222.54 

INSERTER, FROM SEP 12 482.07 

TELEPHONE PAGE, TO AUG 7 741.54 

TILEFHCNE PAGE, TO AUG 7 

TELEPHONE PAGE, FROM SEP 7 1,222.54 

SUPERVISOR MINORITY 3,474.00 

ADMINISTRATIVE ASSISTANT 7,255.50 

MACHINE OFERATOP 3,122.99 

EELIVERYMAN, FROM AUG 1 TO AUG 12 304.47 

PAGE, TO JUL 5 100.21 

BENCH PAGE, TO AUG 7 741.54 

CHIEF TELEPHONE CLERK 3,375.00 

BENCH PAGE, FROM SEP 7 481.00 

BENCH PAGE, TO AUG 7 741.54 

EENCH PAGF, FROM SEP 7 481.00 

DOORMAN 2,758.74 

DOORMAN, TO SEP 6 1,674.57 

MACHINE OPERATOR 2,718.00 

DOORMAN 2,332.67 

DELIVERYMAN 2,283.51 

DELIVERYMAN 2,278.68 

BENCH PAGE, FROM SEP 7 481.00 

ASSISTANT 4,657.50 

CLERK, TO JUL 10 302.00 

BENCH PAGE, FROM JUL 11 TO AUG 7 541.12 

TELEPHONE CLERK 3,635.76 

ASSISTANT CHIEF 4,772.76 

EAEEER 3,456.51 

DOORMAN, FROM AUG 1 1,522.34 

MACHINE ASSISTANT 2,357.25 

DOCRMAN 3,325.50 

DOORMAN 2,357.25 

CLERK, TO JUL 31 906.00 

MACHINE OPERATOR 2,687.80 

DELIVERYMAN, FROM JUL 19 TO JUL 31 304.47 

RECEPTIONIST-STATUARY HALL 2,804.76 

MACHINE OPERATOR 3,065.49 

MACHINE ASSISTANT 2,258.13 

MACHINE OPERATOR 3,065.49 



20 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF THE DOORKEEPER -CONTINUED 



ROCHFORD, THOMAS P 
ROEBUCK, RAYMOND H 
ROHAN, JAMES A 
ROOSEVELT, LAURA D 
ROOT, MICHELLE 
ROPER, HELEN STEIN 
RORLS, ELLEN A 
ROSENTHAL, EDWARD MARC 
ROSSIN, ALLEN 
ROTHSTEIN.GREG 
ROURKE,ANN 
ROUSH, ROBIN DOOGLAS 
ROYSTER,DENISE 
RUBENSTAHL, WILLIAM M 
RUSS, ERNEST J 
RUSSELL, ROBERT RAILEY 
SCHEIBEL, KENNETH H.JR 
SCHMALBACH,LEE A 
SCOTT, CHARLES L 

SCOTT, QUINCY 
SCOTT, RICHARD L 
SEIGEL.LEE B 
SEWELL, HELEN WINFIELD 
SHANKER,ADAH 
SHANKS, HERBERT ANDREW 
SHARP, JAMES B,JR 
SHEA, ANDREW B 
SHEPARD.KATHERINE C 
SHIELDS, URSULA C 
SIGDRSKI,MARK 
SILVERSTEIN, JON 
SIMMONS, MILES D 
SIMON, CHARLES F,JR 
SIMPSON, DONITA T 
SIMS, WILLIAM P 
SMALL, HERBERT 
SMIROLDO,ROSE 
SMITH, PATRICK J 



SMITH, SUNNY 
SOMMERS,CARL E 
SOULEYRET, ROBIN CAROL 
SOUTHERLAND,ELONZIA B 
SOWARDS, JAMES EVERETT 
SPENCER, EDNA E 
STALLINGS, ROBERT L 
STAFR, HELEN 
STEINER,PAUL J 
STEINERT,TIM 
STICKNEY, ETHAN 
STOLBERG, VERONICA C 
STDMPFF, ANDREW 
SUT, ROBERT THEODORE 
SVENDSEN, LANCE W 
TALBERT, JAMES NELSON 
TATE, RUTH M 
TAYLOR, DON 
TAYLOR, DUANE J 
TENAGLIA, NICOLA 
TERRY, ROSA L 
THOMAS, CAROLINE 
THOMAS, WARDELL G 
THOMPSON, WILLIAM B 
THORNBURG, ANN H 
THORSON, MICHAEL R 
TOLSON, WILLIAM H 
TONDCCI, DAVID 
TRAMMELL,JIM F 

TREADWAY,ALEX 

TRUAX, JAMES R 
TUCK, JOHN C 
TUCKER, ROBERT 
TURLEY, JONATHAN 

UDELL, GILMAN G 
UTTERBACK, MARSHALL T,JR 
UZZELL, GEORGE G 



CLERK $ 

SNACK EAR ATTENDANT (D) 

DOORMAN 

PAGE, FROM JUL 11 TO AUG 10 

BENCH PAGE, FROM SEP 7 

HOSTESS RECEPTIONIST CONGRESS WOMENS SUI 

INSERTER 

PAGE, TO JUL 19 

DOORMAN, FROM SEP 7 

BENCH PAGE, FROM JUL 20 TO AUG 7 

BENCH PAGE, TO JUL 10 

PAGE, TO JUL 12 

WRAPFER, FROM SEP 1 

DOORMAN, TO SEP 6 

SUPERVISOR MAJORITY 

CLERK 

MACHINE ASSISTANT, TO AUG 9 

CLERK 

BENCH PAGE, TO AUG 7 

BENCH PAGE, FROM SEP 7 

MACHINE ASSISTANT 

MACHINE OEERATOR 

BENCH PAGE, TO AUG 7 

SNACK BAP ATTENDANT (R) 

PAGE, TO JUL 12 

DEMOCRATIC CLOAKROOM ATTENDANT DOORMAN 

DOORMAN 

BENCH PAGE, FROM SEP 7 

CHIEF MACHINE UNIT 

BENCH PAGE, TO AUG 7 

BENCH PAGE, FROM SEP 7 

DELIVERYMAN, TO AUG 31 

CLERK 

CLERK 

MACHINE CFEHATOR 

DOORMAN 

WRAPPER 

DELIVERYMAN 

DCORMAN, FROM AUG 24 TO AUG 31 

CLERK, FROM SEP 1 TO SEP 6 

DOORMAN, FROM SEP 7 

BENCH PAGE, FROM JUL 11 TO AUG 7 

GENERAL CLERK 

BENCH PAGE, TO JUL 10 

BARBER 

MACHINE CFERATOR 

MACHINE ASSISTANT 

COUNTER 

ASSISTANT, FROM AUG 9 

CLERK 

PAGE, TC JUL 19 

BENCH PAGE, FROM JUL 11 TO AUG 7 

MACHINE ASSISTANT 

BENCH PAGE, FROM SEP 7 

BARBER 

MACHINE ASSISTANT, TO JUL 31 

3RD ASST SUPERINTENDENT 

FIRST ASSISTANT 

BENCH PAGE, FROM SEP 7 

BENCH PAGE, FROM SEP 7 

CLERK 

INSERTER 

PAGE, TO JUL 8 

EARBIRSHOP ATTENDANT (ACTING) 

INSERTER 

CLERK TYPIST 

BENCH PAGE, TO AUG 7 

CLERK 

TYPIST, TO JUL 5 

TELEPHONE PAGE, TO AUG 7 

TELEPHONE PAGE, FROM SEP 7 TO SEP 12 

BENCH PAGE, TO AUG 14 

SPEAKERS FAGE, FROM SEP 7 

BENCH PAGE, FROM JUL 11 TO AUG 7 

MINORITY CHIEF 

BENCH PAGE, FROM JUL 11 TO AUG 7 

TE1EFHONE PAGE, TO AUG 7 

TELEPHONE PAGE, FROM SEP 7 

DOCUMENT ROOM MANAGER 

MACHINE OPERATOR 

DELIVERYMAN 



2,631.00 

2,581.74 

3,065.49 

601.25 

481.00 

2,208.75 

2,283.51 

380.79 

608.93 

360.75 

200.42 

240.50 

761.17 

1,674.57 

6,389.76 

3,375.00 

995.29 

2,978.01 

1,222.54 
2,357.25 
2,537.88 

741.54 
2,953.26 

240.50 
2,900.25 
2,357.25 

481.00 
4,037.00 

741.54 

481.00 
1,522.34 
3,759.51 
3,065.49 
2,891.25 
2,357.25 
3,008.01 
2,357.25 



938.96 

541.12 
3,151.74 

200.42 
3,456.51 
2,827.01 
2,730.00 
2,283.51 
2,353.73 
2,631.00 

380.79 

541.12 
2,367.73 

481.00 
3,456.51 

761.17 
4,970."'0 
6,904.42 

481.00 

481.00 
2,718.00 
2,655.51 

160.33 
2, 164.50 
2,281 .10 
2,718.00 

741.54 
3,239.01 

126.86 

861.79 

1,519.23 
541.12 

5,252.92 
541.12 

1,222.54 
9,307.50 
2,891.25 
2,177.94 



21 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF THE DOORKEEPER -CONTINCED 



VILLA, RICHARD ROI 
VOELKE.R.KARL E 
HALLS, LORRAINE V 
WALSH, GERARD P,JR 
HALTER, KEN 

HARD, THOMAS H 
HEESE, JERRY S 
HELCH, KEVIN GRANT 
HELCOHE, GERALD H,JR 
HELLHON, REX RAFOLD 
BEST, BENJAMIN C 
HHITE,EDHAPD PAUL, III 
HHITE, ROBERT N 

HHITNEY, JOSEPH L 
HILKOHSKI, JAMES LEE 
HILLIAMS, DAVID A, III 
HTLLIAHS.EMMFTT S 
HILLSON, FRANK F,III 
HILSON, JAMES E 
HINSTON, MOSES BASSANIO.IV 

HIIHEBSPOON.FBED 
HOODS, ADGUSTDS T 
HOODS, IRVIN MCSHAIN 
HOODY, VIVIAN T 
BRIGHT, HILLIAM H,II 

YESH, ROBERT T 



OFFICE OF THE POSTMASTER 

ADAMS, SCOTT L 
ALEXANDER, CRAIG A 
ALLEN, DOZIER T.JB 
ALSTERDA,JOHN, JR. 
ANDERSON, ARTHDR JOB 
ANDERSON, RICARDO H 
AHCHBELL, JAMES B 
ATKINSON, TIMOTHY R 
BARB, DEAN E 
BARNES, DENNIS PAUL 

BAYLOR, ORLANDO 
BLAKEY, MICHAEL H 
BORSOS, CHARLES J 
BOHMAN,MARY C 
BOYD, STEVEN D 
BOYDSTON,C ELMO 
BRAITHHAIT,DELTON B 
BFOBN, HARVEY F 
BUCKLEY, THOMAS F,JR 
BORKE, JAMES G 
CANTU.JOAN M 
CHASTAK, ANTHONY M 
CICHY, CLARENCE N,II 
CLAIRE, THOMAS A 

CLEMONS, GARRY T 
COFFEE, MICHAEL 
COLEMAN, HERBERT TRENT 
CULHER, CALVIN 
DALTON,GENA ANN 
DANIEL, SAM 
DATCHER.TONI 
DAY,JODI LYNN 
DEBOYS, HARRY D 
DENNIE, ELIZABETH E 
DENNIS, DARRYL 
DEEFLEP, JAMES T 
DINNEZN, ROBERT M 
DOOLING, ELIZABETH B 
DHYER, MICHAEL J 
?AIGNANT,JOHN PAUL 
FLANAGAN, ROBERT G 
FORD, SEAN J 
FRANZEN, CHARLES R 
FREEMAN, HILLIAM B 



DOORMAN $ 

BENCH PAGE, FROM SEP 7 

CHIEF HANDAL PROCESSING UNIT 

CLERK, TC SEP 12 

CHECKROOM ATTENDANT, TO AUG 31 

DOOPMAN, FROM SEP 1 

MACHINE OPERATOR 

MACHINE OPERATOR 

BENCH PAGE, TO AUG 7 

DCO RM AN 

GENERAL CLERK 

SUPERINTENDENT 

MACHINE OPERATOR 

BENCH PAGE, TO AUG 7 

BENCH PAGE, FROM SEP 7 

HPAPPEF, FROM SEP 1 

BENCH PAGE, FROM SEP 7 

DELIVERYMAN, TO JUL 31 

INSERTER 

BENCH PAGE, FROM SEP 13 

HPAPPEP, TO AUG 5 

BENCH PAGE, TO AUG 7 

BENCH PAGE, FROM SEP 7 

GENEFAL CLERK 

MACHINE ASSISTANT 

DOORMAN 

MACHINE ASSISTANT 

EENCH PAGE, TO AUG 1U 

BENCH PAGE, FROM SEP 7 

TELEPHONE ASSISTANT 

COUNTER CLERK .- 

MAIL CLERK, FROM SEP 22 

MAIL CLERK, FROM JUL 7 

COUNTER CLERK, TO AUG 19 

MAIL CLERK 

MAIL CLEBK 

MAIL CLERK, TO AUG 15 

MAIL CLEBK, TO JUL 17 

LAEORER, TO SEP 9 

SUPERVISOR EVENING SHIFT, TO JUL 31 

MAIL SECURITY SCANNER, FBOM AUG 1 

MAIL CLERK, FROM AUG 27 

MAIL CLERK, FROM AUG 8 TO SEP 1 

MAIL CLERK, FROM JUL 25 

STAMP TELLER 

HAIL CLERK 

ASSISTANT POSTMASTER ■ 

COUNTER CIERK 

MAIL SECURITY SCANNER 

HAIL CLERK 

HAIL CLERK, TO JUL 11 , 

MAIL CLEBK, FROM SEP 23 

HAIL CLEBK 

HAIL CLERK 

MAIL SECURITY SCANNER, TO JUL 31 

SUPERVISOR EVENING SHIFT, FBOM AUG 1 

BAIL CLEBK, TO JUL 14 

HAIL CLEBK 

HAIL CLEBK 

MAIL CLEBK, FROM SEP 26 

MAIL CLEBK, TO AUG 7 

HAIL CLEBK, FROM AUG 5 TO AUG 8 

MAIL CLERK, FROM SEP 14 

HAIL CLEBK, FROH AUG 8 TO AUG 31 

HAIL CLERK 

COUNTER CLERK, TO AUG 17 

HAIL CLERK, TO AUG 3 

HAIL CLERK, TO JUL 19 

HAIL CLEBK, FROM SEP 8 

COUNTER CLERK, TO AUG 31 

HAIL CLERK, FROH JUL 28 

HAIL CLEBK 

HAIL CLEBK, TO JUL 31 

HAIL CLERK, FROH JUL 12 TO AUG 13 

HAIL CLEBK, TO AUG 16 

HAIL CLEBK, TO SEP 1 

LABOBEB, FROH SEP 2 



2,U07.09 

481 .OC 

3,288.51 

2, 174.40 

2,283.51 
2,631.00 
2,687.80 
741.54 
2,283.51 
2,804.76 
8,726.49 
2,718.00 

1,222. 54 
761. 17 
481.00 
761.17 

2,432.01 
360.75 
888.03 

1,222.54 

2,655.51 
2,283.51 
2,432.01 
2,432.01 

1,362.83 
4, 173.24 



,986.04 
228.35 
,131.27 
,668.99 
,793.00 
,R91.25 
,141.75 
529.79 
,750.69 



3,272.13 

811.91 

608.93 

1,623.82 

4,570.26 

2,357.25 

6,652.26 

3,375.00 

3,222.97 

2,308.09 

279.09 

202.98 

2,363.12 

2,029.78 

3,375.17 

389.98 

1,979.04 

2,357.25 

126.86 

938.78 

101.49 

431.33 

583.56 

2,891.25 

1 ,419.40 

761. 17 

456.70 

583.56 

1,754.00 

1 ,547.70 

2,479. 15 

583.56 

811.91 

1, 167. 13 

2,283.50 



22 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF THE POSTMASTER -CONTINUED 



FEITH, ALFRED LLOYD 
GEPNT, WALLACE B 
GIBBONS, JOSEPH F,JR 

GIBSON, ROBERT P 

GIBSON, ROBERT P,II 

GLEIBEHMAN,PAUL 

GOLDSTEIN, MARGARET SENATE 

GO0DNO2, WILLIAM B 

GRADY, ROBERT A 

GROW, HAROLD L 

HACKES, PETER QUINN 

HAMILTON, TRACY LYNN 

HARMON, MICHAEL C 

HARPER, JAMES T 

HARRIS, DAVID B 

HEFLIN, RICHARD F 

HERRON, KEVIN 

JOHNSON, JOSEPH E 

JOLLY, RONALD G 

KERWIN , ROBERT J. 

KINCHELOE.FAPON 

KUY KENDALL, CHARLEY 

LACY, JAY H 

LAWRENCE, PATRICIA 

LEA, MICHAEL KEVIN 

LEAR, RICHARD M 
LOZITO,PAOL F 

LOCIAN, ALFRED M 
MAIN, TODD D 
HARSH, MICHAEL D 
HCADAMS, MICHAEL J 
MCCARTY, WILLIAM A, II 
MCCOY, MOSE,JR 
MCDEVITT, JOSEPH 

MCDONALD, DAVID 
MCGEHEE,ALEX 
MCLAUGHLIN, FRANCIS X,JR 
MCLAWHORN,S WHIT 
NCRAE.JOHN G 
MELLODY, JEROME MICHAEL 
MEYERS, DAVID K 
MOORE, CHARLES E 
MOORE, STANLEY H 
HULQUIN, DAVID 
NANKERVIS, JAMES P 
NOLL, DENNIS 
ODONNELL, ROBERT J, JR 
OHARA, PATRICK J 
OHARA, THOMAS A 
OHORA, TIMOTHY 
OLCHAK,SEYHOUR 

OSULLIVAN.MARK D 
OVER, STEPHEN B 
PAYNE, LAWRENCE 
PERKINS, REATHA 
POTTER, EMMET B 
PRICE, GEORGE R 

RADKE, NARK 
REGAN, PAUL K 
REGAN, STEPHEN 
RESETARITS, JAMES F 
ROBERTSON, JAMES E A 
ROBLES.AL 
ROGAN, KIMBERLY 
ROGERS, LAWSON S 
ROTA, ROBERT 
RUBENSTEIN, JOYCE 
SARDEGNA, RICHARD B 
SAYLOR, PATRICIA ANN 
SCHNEIDER, LE NELL* 
SEYMOUR, DOUGLAS A 
SHEERIN, DANIEL P 
SIMALA, JEROME M 
SMITH, FREDERICK WILLIAM 
SBITH, JAMES C 



MAIL CLERK, TO AUG 24 * 1,370.10 

MAIL CLERK 2,283.51 

MAIL CLERK, TO SEP 12 

COUNTER CLERK, FROB SEP 13 2,412.00 

NIGHT SUPERVISOR 4,169.49 

BAIL CLERK, TO AUG 1U 1,116.38 

MAIL CLERK, TO JUL 15 380.58 

COUNTER CLERK, FROM SEP 12 555. 43 

MAIL CLERK 2,226.29 

MAIL CLERK, FROM AUG 17 TO AUG 31 355.21 

COUNTER CLERK 3,635.76 

LABORER, TO AUG 31 1,522.34 

BAIL CLERK, TO JUL 17 431.33 

MAIL CLERK 2,147.73 

MAIL CLERK, FROM SEP 18 329.84 

MAIL CLERK 2,200.11 

BAIL CLERK 2,827.00 

BAIL CLERK, FROM SEP 12 482.07 

MAIL CLERK, TO AUG 11 1,040.26 

MAIL CLERK, FBOB AUG 8 1,293.98 

BAIL CLERK, FROB JUL 11 TO AUG 5 583.56 

MAIL CLERK, TO AUG 31 1,522.34 

MAIL CLERK, FROM SEP 1 761.17 

BAIL CLERK, FBOB AUG 1 1,446.21 

BAIL CLERK 2,055.15 

COUNTER CLERK (ACTING), FROB JUL 11 TO JUL 17 . 

BAIL CLERK, FROB JUL 18 TO SEP 6 1,422.49 

LABORER, FROM SEP 13 471.45 

MAIL SECURITY SCANNER, TO JUL 10 

DAY SUPERVISOR, FROM JUL 11 3,443.72 

BAIL SECURITY SCANNER 3,114.24 

LAEORER, FROB SEP 1 TO SEP 9 228.35 

BAIL CLERK, FROB JUL 5 TO JUL 15 253.72 

BAIL CLERK, TO SEP 7 1,699.95 

BAIL CLERK, FROM JUL 15 1,928.30 

MAIL CLERK 3,180.83 

MAIL CLERK, TO SEP 12 

COUNTER CLERK, FROM SEP 13 2,327.63 

MAIL CLERK 2,105.11 

BAIL CLERK 2,080.52 

BAIL CLERK, TO AUG 15 1,141.75 

BAIL CLERK, FROB JUL 19 TO JUL 21 76.12 

BAIL CLERK, FROB JUL 19 1,826.81 

MAIL CLERK, FROB SEP 19 304.47 

BAIL CLERK 2,357.25 

MAIL CLERK, FROM AUG 10 1,293.99 

BAIL CLERK 2,308.09 

BAIL CLERK, TO JUL 31 761.17 

MAIL CLERK, FROM AUG 19 1,065.64 

MAIL CLERK, TO AUG 20 1,309.58 

MAIL SECURITY SCANNER 2,994.61 

HAIL CLEBK, TO AUG 18 1,217.87 

HAIL CLEBK, TO JUL 5 126.86 

HAIL CLERK 2,357.25 

DAY SUPERVISOR, TO JUL 10 

HAIL SECURITY SCANNER, FROB JUL 11 3,419.11 

HAIL CLERK, FROM JUL 21 1,750.68 

HAIL CLERK, FROH SEP 9 532.82 

HAIL CLERK, FROB SEP 14 431.33 

COUNTER CLERK 3,809.25 

BAIL CLERK, FROB SEP 13 456.70 

BAIL CLERK, FROB JUL 16 TO AUG 2 

HAIL CLERK, FROH SEP 9 938.76 

BAIL CLERK, FROB SEP 14 431.33 

COUNTER CLERK 2,631.00 

HAIL CLERK, FROH AUG 1 TO AUG 19 482.07 

BAIL CLERK 2,283.51 

BAIL CLEBK, FROH SEP 2 735.79 

HAIL CLERK, FROB SEP 15 405.96 

BAIL CLERK, TO AUG 31 1,496.96 

BAIL CLEBK 2,976.65 

POSTBASTEB H OF R 10,191.24 

BAIL CLERK, FROM SEP 12 482.07 

BAIL SECURITY SCANNER 3,346.17 

SECRETARY 3,606.67 

COUNTER CLERK, FROH SEP 16 438.50 

HAIL CLERK, FROB JUL 2 TO AUG 28 1,446.21 

BAIL CLEBK, TO AUG 31 1,522.34 

BAIL SECURITY SCANNER 3,085.58 

BAIL CLERK, FROB SEP 19 304.47 

COUNTER CLERK 3,412.26 



23 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF THE POSTMASTER -CONTINUED 



SMITH, PATRICK J 
SNITH,SHELLA R 
STEBART, SANDRA C 
STREETT, RICHARD 
TAYLOR, THOMAS G 
TBRANGO,LARRT 
THOHPSON, BILLIAH B 
TRACT, MARTHA SUZANNE 
VITALE.HARK D 
BALKEP, FRANKLIN S 
HARD, HARK L 
BAY, GEORGE L 
BELKER, RICHARD 
YOUNG, JOHN, JR 
YOUNG, JOSEPH H 



MAIL CLERK, FROM AUG 1 TO AUG 23 $ 583.56 

HAIL CLERK, TO JUL 31 761.17 

COUNTER CLERK 2,804.76 

HAIL CLERK 2,669.3U 

HAIL CLERK 2,432.01 

MAIL CLERK, FROM AUG 1 TO SEP 12 1,040.27 

HAIL CLERK 2,891.25 

COUNTER CLERK, TO SEP 14 2,163.27 

HAIL CLERK, TO AUG 31 1,671.34 

FOFEHAN HAIL PLATFORH 3,970.50 

LABORER, TO AUG 26 1,420.85 

MAIL CLERK, FROM AUG 27 862.66 

MAIL SECURITY SCANNER 3,028.26 

HAIL CLERK 2,182.00 

BAIL CLERK, FROH SEP 12 TO SEP 14 76.12 



OFFICE OF THE CHAPLAIN 
LATCH, EDWARD G 



CHAPLAIN 



5,908.55 



OFFICE OF THE PARLIAMENTARIAN 



BROBN, BILLIAH H,JR 
DENDY, DALLAS L,JR 
JOHNSON, CHARLES S,III 
KOACH.MOFTIAH M 
ROBINSON, PETER D 



PARLIAMENTARIAN 13,500.00 

CLERK 6,166.67 

ASSISTANT PARLIAMENTARIAN (#1) 13,125.00 

SECRETARY 3,188.55 

ASSISTANT PARLIAMENTARIAN (#2) 7,645.63 



COMPILATION OF PRECEDENTS 



EDDY, JOAN D 

FEE, JOHN THEODORE 
GERY, DAVID PAUL 
HOORNEHAN,EVAN ROBERT 
KHALILI, DEBORAH B 
MILLER, ROY H 
PORTER, PATRICIA C 
SCHBARZ,NOSAH ASCOLI 
SHOKOOB,HARY ANN 



RESEARCH ASSISTANT, TO AUG 31 

RESEARCH 6 ADHIN ASSISTANT, FROM SEP 1 5,865.24 

4,601.91 

5,705.20 

9,450.4 7 

CLERK-STENOGRAPHER 3,799.36 

10,495.16 

5,286.77 

TO JUL 16 792.05 

CLERK TYPIST 2,843.91 



OFFICIAL REPORTERS OF DEBATE 



GREENBOOD, RUSSELL G 
GUSTAFSOH, CHARLES 
HAMMER, VIRGINIA C 
HEIL, CHRISTOPHER A 
HENTERLY,JOHN R 
LEA, JAMES H 
LEAHY, FLORENCE H 
MAPES, HEATHER B 
MONTGOMERY, DAHRELL L 
HORSE, BILLIAH L 
MOYEH.EDNA C 
NEIL,FAYE G 
PENHEKAHP,BILLIAB B 
POHLCHUCK,HARGARET E 
RUSSELL, GEORGE L 
SPITZ, VIVIAN R 
VANALLEN, EDWARD J 
BHITE,EDBARD 



EXPERT TRANSCRIBER NO. 6 .... 

OFFICIAL BEPORTER NO. 2 

EXPERT TRANSCRIBER NO. 4 .... 

OFFICIAL REPORTER NO. 4 

OFFICIAL REPORTER NO. 7 

CLK, OFFICIAL REP OF DEB .... 
EXPERT TRANSCRIBER NO. 2 .... 

EXPERT TRANSCRIBER NO 

EXPERT TRANSCRIBER NO. 5 .... 

OFFICIAL REPORTER NO. 3 

CHIEF REPORTER OF DEBATES ... 
EXPERT TRANSCRIBER NO. 3 .... 

OFFICIAL BEPORTER NO. 6 

EXPERT TRANSCRIBER NO. 7 .... 

2ND ASSISTANT CLERK 

OFFICIAL BEPORTER NO. 1 

OFFICIAL REPORTER NO. 5 

1ST ASST CLK, OFF REP OF DEB 



,050. 
,610, 
,050. 
,610, 
,610, 
,290. 
,050. 
,0 50. 
,050. 
,610. 
,725. 
,050. 
,610. 
,050, 
,229. 
,610. 
,610. 
,982, 



OFFICIAL REPCRTERS TO COHHITTEES 



AHDREHS, CHARLES F,JB 
BROBNING, BETTY G 
BUSKIRK, BILLIAH S 
CANTOR, ROBERT G 
CARR.JOHN I.JB 
COCHRAN, ROBERT C 
COPELAND.BIKEL JCAH 



EXPERT TRANSCRIBER NO, 
OFFICIAL REPORTER NO. 
EXPERT TRANSCRIBER NO. 
OFFICIAL BEPORTER NO. 
OFFICIAL REPORTER NO. 
OFFICIAL REPORTER NO. 
OFFICIAL BEPORTER NO. 



1 

6 . 
11 

9 . 
10 

7 . 



5,050.68 
8,940.63 
5,050.68 
8,940.63 
8,940.63 
8,940.63 
8,940.63 



24 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICIAL REPORTERS TO COMMITTEES -CONTINOED 



DEMPSEY, SHIRLEY B 
HALTERHAN.GAY S 
HANBACK.SARA SUSAN 
HABDIN,RUTH W 
HOOKS, JO ANN 
HCHURRAY.E HOMER 
HILLS, ALVIN E 
RUDOLPH, GERALDINE C 
SHITH, STEWART R 
STAHL,HARY R 
TARTAHO, ANTHONY F 
TYNDALL, DOROTHY M 
WARD, BETTY DEWITT 
WEISSHEYER, JOSEPH . 
YOKOYAMA, THURSTON 1 



OFFICIAL REPORTER NO. 2 . $ 

EXPERT TRANSCRIBER NO. 2 . 

OFFICIAL REPORTER NO. <t 

EXPERT TRANSCRIBER NO. 6 

EXPERT TRANSCRIBER NO. 9 

CLERK 

OFFICIAL REPORTER NO. 8 

OFFICIAL REPORTER NO. 3 

EXPERT TRANSCRIBER NO. 3 

EXPERT TRANSCRIBER NO. 10 

OFFICIAL REPORTER NO. 5 

EXPERT TRANSCRIBER NO. 8 

EXPERT TRANSCRIBER NO. 7 

EXPERT TRANSCRIBER NO. 5 

EXPERT TRANSCRIBER NO. 4 



1,940.63 
i, 050. 68 
1,940.63 
.,050.68 
>, 050. 68 
.,33tt.62 
1,940.63 
8,940.63 
i, 050. 68 
i, 050. 68 
i, 940. 63 
i, 050. 68 
i, 50. 6 8 
i, 050. 68 
i, 50. 6 8 



MAJORITY 6 MINORITY PRINTING CLERKS 



LANKFORD, THOMAS J 
RANAGE, DAVID R 



PRINTING CLERK (MINORITY) 
PRINTING CLERK (MAJORITY) 



3,910.14 
3,910.14 



OFFICE OF THE ATTENDING PHYSICIAN 
MORAN, ROBERT FRANCIS TECHNICAL ASSISTANT 



7,169.52 



DEMOCRATIC STEERING COMMITTEE 



AVERY, J, JR 
BOURKE, STEVEN H 
CLANCY, PATRICIA CAROL 
COSDEN, JOSHUA SENEY 
FLEMING, PATRICIA 
JEWELL,K 
ONEILL,A D 
ONEILL, THOMAS 
SEELMEYER, BERTHA ARRETT 
SHORENSTEIN, DOUGLAS W 
SHITH, SPENCER H,JR 
SPRAGUE, IRVINE H 
VAUGHN, IRIS V 



CLERICAL 4,964.22 

ASSISTANT DIRECTOR 10,500.00 

SECRETARY 4,007.13 

CLERICAL 4,964.22 

SECRETARY 3,999.99 

CLERICAL 6,988.38 

CLERICAL 9,624.78 

CLERICAL 3,750.00 

CLERICAL 5,090.82 

OFFICE CLERK, TO JUL 31 500.00 

ECONOMIST 11,874.99 

EXECUTIVE DIRECTOR 13,125.00 

SECRETARY 2,177.25 



DEMOCRATIC CAUCUS 

BRANDT, WERNER W 
CORCORAN, KERI ANN 
EICHNER,BAMBI L 
FIRST, WILLIAM L 
VERKLER,GAIL F 
YOURMAN, HOWARD 



STAFF ASSISTANT (STATUTORY), FROM AUG' 1 7,716.66 

CLERK 2,525.01 

CLERK 1,299.99 

CLERK (STATUTORY), TO JUL 31 2,921.76 

CLERK, TO AUG 14 635.55 

STAFF ASSISTANT 6,500.01 



REPUBLICAN CONFERENCE 

ALEXANDER, LOUIS A 
BRUE,JAN 

CAMERON, ROBERT B 
CARLSON, VICTORIA JANE 
COLE, MICHELLE C 
FISHEH, PETER RYEBSON 
FRITTS, WILLIAM DOUGLAS 
FURNISS, WILLIAM E 
GOLDSTEIN, RICHARD 

KALIVODA, PAULA J 
LACAPRIA.SALVATORH A 
LILLY, SUSANNE B 
MACLEOD, MICHAEL F 
MACPHERSON, BRUCE J 
MADDY,DOREEN 
HAGILL, JAMES N 
MANN, TODD S 
MICHEL, CAROL 



RESEARCH ASSISTANT 

CLERK-INTERN, FROM JUL 6 TO AUG 5 

INTERN, TO AUG 12 

OFFICE MANAGER 

OFFICE MANAGER-LEG DIGEST 

INTERN, TO AUG 15 

FLOOR ASSISTANT, FROM AUG 8 

RESEARCH ASSISTANT 

INTERN, TO JUL 22 

INTERN, FROM AUG 1 TO AUG 20 

RESEARCH ASSISTANT 

PHCTOGRAPHER 

RESEARCH ASSISTANT, FROM SEP 12 .... 

EXECUTIVE DIRECTOR (STATUTORY) 

RESEARCE ASSISTANT 

INTERN, TO AUG 19 

RESEABCHER 

LEGISLATIVE RESEARCHER 

CLERK-INTERN, FROM JUL 5 TO AUG 5 



,820.83 
601.25 
345.21 
,562.51 
,124.99 
600.00 
,533.33 
,375.01 

242.67 
,499.99 
,250.00 

475.00 
,000.01 
,750.01 

438.83 
,249.99 
,125.01 

621.29 



25 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

REPUBLICAN CONFERENCE -CONTINUED 



MOORE, C J PHOTOGRAPHER $ 3,750.00 

PAPPAS, MICHAEL GEORGE CLEPK-I NTERN, FROM JUL 5 TO AUG 5 621.29 

RAINES, THOMAS N,JR DIRECTOR 7,650.00 

REED, JOAN B EDITOR LEGISLATIVE DIGEST 4,500.00 

REID,MARY M DARKEOOH AND PHOTO LAB AID 699.99 

RICHTER,RUTH ANN RESEARCHER 2,750.01 

ROUNTREE, WALTER J, III LAE TECHNICIAN 2,499.99 

RUSNAK, STEFAN L PHOTO LAB TECHNICIAN 2,499.99 

RUTH, EARL B RESEARCH CONSULTANT 1,500.00 

SEHLER, THOMAS J RESEARCH ASSISTANT 2,416.67 

SENKO, MICHAEL PHCTOGRAPHER 6,000.00 

SEVERSON,ALAN R RESEARCH ASSISTANT 2,437.50 

SULLIVAN, VICKY N OPFICE COORDINATOR 2,124.99 

SHEET, STUART TASK FORCE DIRECTOR 1,875.00 

TORRENNCE, JAMES H DARKROOM AND PHOTO LAB AID 699.99 

VANBUSKIRK, PATRICIA INTERN, TO JUL 29 370.23 

WALKER, ROBERT J RESEARCH ASSISTANT, FROM AUG 22 1,300.00 

WALTERS, JOHN P INTERN, TO SEP 17 2,352.78 

WILSON, PENDLETON L PHOTOGRAFHER 3,500.01 

YOUNG, STEVEN RESEARCH ASSISTANT, TO AUG 31 1,583.34 

SPECIAL AND MINORITY EMPLOYEES 

BARTLETT,JOE FLCOB ASSTTO MINORITY LEADER #1 11,250.00 

KENNEDY, WALTER P FLOOR ASST TO MINORITY LEADER *2 11,250.00 

LASCH, RONALD FLOOR ASST TO MINORITY LEADER #4 9,999.99 

LEPPERT, CHARLES, JR FLOOR ASST TO MINORITY LEADER #6 11,250.00 

LIPSON, GERALD FLOOR ASST TO MINORITY LEADER *5 9,249.99 

WINEBRENNER, TOMMY LEE FLOOR ASST TO MINORITY LEADER #3 11,250.00 

OFFICE OF THE LAW REVISION COUNSEL 

DIRECTOR, JSRALD JAY ASSISTANT COUNSEL 7,500.00 

DOWNES, GEORGE W PRINTING EDITOR 6,900.00 

GOUDELOCK,VERA AEHINISTR ATIVE SECRETARY 3,385.61 

MASTERSON, JAMES E SENIOR COUNSEL ;..... 11,874.99 

MILLER, JOHN R ASSISTANT COUNSEL 8,000.01 

MONACO, LAWSENCE A, JB SENIOR COUNSEL 11,874.99 

PARETZKY, KENNETH LAW ASSISTANT 4,749.99 

SCHOOR, MICHAEL M ASSISTANT COUNSEL 6,500.01 

SHAFER.SARA L ASSISTANT CLERK 3,375.00 

TICER,WILMEH R ASSISTANT COUNSEL 8,649.99 

BILLETT, EDWARD F.JR LAW REVISION COUNSEL 12,500.01 

OFFICE OF THE LEGISLATIVE COUNSEL 

BARROW, M POPE,JF ASSISTANT COUNSEL 11,874.99 

BEILIS,M DOUGLASS ASSISTANT COUNSEL 9,375.00 

BERGMAN, ROBERT ALAN LAW ASSISTANT 5,750.01 

BUCKLEY, JOHN LESTER ASSISTANT COUNSEL 8,124.99 

CHAPIN, CHRISTINE R ASSISTANT CLERK 2,925.00 

CIMKO,JOHN,JR ASSISTANT COUNSEL 8,750.01 

COPE, STEVEN A ASSISTANT COUNSEL 7,374.99 

COVER, ROBERT W ASSISTANT COUNSEL 6,500.01 

DOVEHHAN, ELIZABETH J LAW ASSISTANT, FROM SEP 1 1,666.67 

ELDRED, MICHAEL H LAW ASSISTANT, TO AUG 31 3,714.20 

FILSON, LAWRENCE E DEPUTY LEGISLATIVE COUNSEL 12,999.99 

GIBSON, BETTY L STAFF ASSISTANT 4,800.00 

GOFFINS,MARY T ASSISTANT CLERK 3,575.01 

GRIMM, STANLEY B ASSISTANT COUNSEL 6,500.01 

GROSSMAN, EDWARD G ASSISTANT COUNSEL 6,500.01 

GSCHEIDLE, MARIANNE J OFFICE ADMINISTRATOR 8,175.00 

HARHANN,JEAN L LAW ASSISTANT, FROM SEP 1 1,666.67 

HAVENS, ARNOLD I ASSISTANT COUNSEL 8,124.99 

HOLDER, JONI ASSISTANT CLERK, FROM SEP 6 729.17 

HUSSEY,WARD B LEGISLATIVE COUNSEL 3,155.92 

JOHNSTON, LAWRENCE A LAW ASSISTANT 5,750.01 

KOWALSKI.RENATE ASSISTANT CLERK 3,750.00 

MCCABE, CHRISTINE A ASSISTANT CLERK 3,125.01 

HCGAHAN, SAMUEL L OFFICE ADMINISTRATOR 8,175.00 

MEADE, DAVID E ASSISTANT COUNSEL 12,875.01 

MENDELSOHN, H DAVID ASSISTANT COUNSEL 6,500.01 

MOHRMAN, WILLIAM C ASSISTANT COUNSEL 7,374.99 

MONTAGUE, KATHLEEN H ASSISTANT COUNSEL 9,375.00 

HOWSON, ROBERT L,JR ASSISTANT COUNSEL 12,999.99 



26 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF THE LEGISLATIVE COUNSEL -CONTINUED 



PECKARSKY,LEE 

PIEBSON, TIMOTHY LELAND 

RICHARDSON, LTNNE 

SHEANE,WILLOUGHBY GEORGE, JR 

SILBEPTHAO.PADLA 

SIHANSKI,JOHN F,JR 

SMITH, PAUL C 

SMITH, SANDRA K 

STROKOFF, SANDRA LEE 

THOMPSON, MARY ELAINE 

TIBBETTS,CAHL A 

TODOR, SYBIL B 

WEINHAGEN, ROBERT F,JR 

WELLS, SDZANNE 

BILSON, CAROL ANN 

WOMACK, JOSEPH LESLIE 

WOODHAN, KENT 

WOODSON, MARY HOLT 

YOUNG, ROGER DONALD 



LAB ASSISTANT $ 5,753.01 

LAW ASSISTANT, FROHSEP 1 1,666.67 

STAFF ASSISTANT 5,000.01 

LAH ASSISTANT 5,750.01 

LAH ASSISTANT 5,750.01 

LAH ASSISTANT, FROH SEP 3 1,555.56 

ASSISTANT COUNSEL 8,750.01 

STAFF ASSISTANT 5,400.00 

ASSISTANT COUNSEL 6,500.01 

ASSISTANT CLERK 3,624.99 

LAH ASSISTANT, FROH SEP 1 1,666.67 

ASSISTANT CLERK 2,874.99 

ASSISTANT COUNSEL 10,250.01 

ASSISTANT CLERK 3,249.99 

ASSISTANT CLERK, FROH SEP 1 958.33 

ASSISTANT COUNSEL 8,124.99 

ASSISTANT COUNSEL 7,374.99 

ASSISTANT CLERK 3,800.01 

ASSISTANT COUNSEL 12,875.01 



OFFICE OP HON. JANES ABDNOR 

AMBOR.OWEN 
ANDERSON, SUSAN E 
BEACH, BAYARD 
BOCKORNY, DAVID A 
BOORMAN,JANE A 
CONAHAN, WALTER C 
DOUBRAVA, RICHARD J 
DRISCOLL, BARBARA A 
FISHER, CHARLES E 
FLESNER,M RUTH 
GUNDERSON,HARIAN B 
HAHRE.JOHN J 

KILL, NARY GWYNNE 
KLEIN, JEAN E 
KORTHOUR, ANDREA E 
LARSON, VERNON 
LEE, WANDA KAREN 

MITCHELL, KATHBYN A 
OBRIEN.SEAN 
PARKINSON, LARRY R 
RANDOLPH, R SEAN 
RUDDY, ROBERT E 
SCHADE, LINDA S 
URBAN, DANA KAY 



LEGISLATIVE ASSISTANT 4,650.00 

DIST FIFLL SERVICE SECTY 3,029.99 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

PRESS ASSISTANT 3,750.00 

PRESS SECRETARY 4,252.50 

ADMINISTRATIVE ASSISTANT 10,157.77 

PROGRAMMER 3,000.00 

FIELD SECRETARY, FROM SEP 19 418.83 

PUBLICATIONS ASSISTANT, TO JUL 31 1,000.15 

CASEWORKER 4,200.00 

FIELD SECRETARY, TO SEP 16 1,288.33 

CLERK, TO JUL 31 

RESEARCH ASSISTANT, FROM AUG 1 2,102.49 

SECRETARY 3,000.00 

RECEPTIONIST, FROH AUG 8 1,325.00 

FIELD SECRETARY, FROM AUG 1 TO AUG 31 527.12 

DIST FIELD SERVICE REP 2,832.21 

SECRETARY, TO JUL 31 

SECRETARY, FROH SEP 1 1,981.28 

RECEPTIONIST, TO AUG 7 , 1,798.33 

STAFF ASSISTANT 2,400.00 

STAFF ASSISTANT 3,249.99 

RESEARCH ASSISTANT, FROM AUG 1 TO AUG 31 500.00 

LEGISLATIVE COUNSEL, TO JUL 15 1,293.83 

SECRETARY, FROH AUG 1 1,500.00 

APPOINTMENT SECRETARY 3,399.99 



OFFICE OF HON. JOSEPH P ADDABBO 



BLEC HER, ABRAHAM 
BRETT, ISABELLA M 
BROMBERG,MARLYS L 
CONIGLIO, FRANCES H 
CONIGLIO, FRANK A 
COOPER, ESTELLE R 
COPP,F MARY 
EICHLER, HARRY 
FISHER, PATRICIA L 

GRAY, MARIE RUTH 
HOHMAN,MARY EILEEN 
LEITER,JERROLD S 
MACDONALD, HELEN T 
MANESS, IRVING 
MARAN, JULIE 
MOLE, MARION 
MORGAN, CELESTE L 
NEGLEY,HARY CHRISTINE 
NOCK, MABEL LEONA 
PERSONS, SANDFORD Z 
PICKETT, MADELINE D 
SANTAMARINA,CARHELA 
SEELMEYER, RICHARD H 
SGANGA,MARY V 
SHAPIRO, ESTELLE 



CLERK 

CLERK, TO JUL 31 

CLERK, FFCM SEP 1 

SECRETARY 

CLERK, FROM AUG 1 

CLERK, FRCH AUG 1 

CLERK, FRCM AUG 1 

AA DIST OFFICE 

SECRETARY, TO AUG 31 

CLERK, FRCH SEP 1 

SECRETARY 

SECRETARY 

CLERK, TO JUL 31 

ADMINISTRATIVE ASSISTANT, TO JUL 31 

RESEARCH ASSISTANT 

CLERK, FROM AUG 1 TO AUG 31 

CLERK, FRCH SEP 1 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

SECRETARY 

CLERK, FRCH SEP 1 

CLERK, FRCH SEP 1 

CLERK, TO JUL 31 , 

CLERK, TO AUG 31 

AEHINISTRATIVE ASSISTANT, FROM AUG 

SECRETARY i 

CLERK, TO JUL 31 



,540.44 
,000.00 
,000.00 
,250.00 
,666.66 
,823.64 
,833.34 
,883.06 

,166.66 
,333.33 
,416.67 
916.67 
,479.67 
,483.00 
762.50 
750.00 
590.00 
,333.33 
500.00 
762.50 
762.50 
,833.34 
,833.34 
,834.53 
916.67 



27 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HOD. JOSEPH P ADtAEBO -CONTINUED 

S0RICO,ANGELO H $ 5,022.00 

SOBICO, VINCENT P CLERK, TC JUG 31 2,000.00 

YOUNG, DORA HOOVER CLERK, TO AUG 31 1,000.00 

OFFICE OF HON. DANIEL K AKAKA 

APO.DOLORINNE K Y N STAFF ASSISTANT 2,699.99 

BUENCONSEJO.GERVACIO ADMINISTRATIVE ASSISTANT 6,000.00 

DUGGAN,HAILE V STAFF ASSISTANT, FROM JUL 17 TO JUL 31 350.00 

GANG,SHARON K STAFF ASSISTANT, FROM AUG 8 1,325.00 

HANSBROUGH, SHARON ANNE STAFF ASSISTANT, TO JUL 16 1*00.00 

HARRINGTON, DAVID H STAFF ASSISTANT, TO AUG 31 2,433.32 

HAYASHI,PRISCILLA JUNE STAFF ASSISTANT 3,549.99 

HIRATA.TIMMY T ADMINISTRATIVE COORDINATOR, TO JUL 31 

DISTRICT COORDINATOR, FROM AUG 1 a, 999. 99 

IKEDA,JOHN P STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT, FROM SEP 1 932. OC 

ISOBE, JASMINE Y STAFF ASSISTANT, FROM AUG 1 2,266.00 

THAMOTO, JOYCE P STAFF ASSISTANT, FROM SEP 1 100.00 

KOYANAGI, KAREN STAFF ASSISTANT, FROM SEP 11* 661.11 

LAURENCE, JEFFREY L STAFF ASSISTANT, FROM AUG 1 1,849.78 

HIKASA, MICHAEL J STAFF ASSISTANT, FROM AUG 1 TO AUG 31 

LEJ CONGRESSIONAL INTERN, TO JUL 31 684.00 

HORITA,JE«EL LYNN STAFF ASSISTANT 2,900.01 

NELSON, ORVIN L LEGISLATIVE ASSISTANT, TO JUL 11 720.55 

OGASA, ROBERT TADAO STAFF ASSISTANT 3,775.00 

REYNOLDS, DEBORAH ROTH STAFF ASSISTANT, TO AUG 19 2,390.00 

SAGUM, JULIETTE B.H.C. STAFF ASSISTANT 3,375.00 

SANDLER, DAVID STAFF ASSISTANT 3,775.00 

SHACKLEY,WILLA-HARLENE K. STAFF ASSISTANT 2,825.01 

SHAFFRAN.JOAN GLCRIA STAFF DIRECTOR, FROM AOG 18 TO AUG 31 500.00 

S0MIMOTO,AP.LENE A PERSONAL SECRETARY, TO JUL 31 

PEFSCNAL SECRETARY-OFFICE MGR, FROM AUG 1 .... 4,030.00 

UCHIMA.JOHN K ADMINISTRATIVE ASSISTANT 9,564.46 

YASODA, CATHY T STAFF ASSISTANT, TO JUL 31 774.64 

OFFICE OF HON. BILL ALEXANDER 



ARNOLD, NAOMI ANNETTE 
BASS, NANCY LOUISE 
BELL, RICHARD ALLEN 
BRANNUH,KATHY LYNN 
DEATON,RONNY 
HDSKEY,DEBRA D 
LARD,KATHY D. 
LUST EH, JACKIE 
MILES, SILLIAH JOSEPH 
NE«HAN,CATHLEEN HICKEY 
PITCOCK, JAMES D 
PRATT, BOBBYE 
SMITH, JULIA FOSE 
SNAPP, JAMES FUSSELL 
THILLIE.BARBARANETTE A 
T«YFORD,MARCELLA H 
HILirAMS,M JOYCE 
NILLIAMS, VICTOP K 
HOODS, HENRY LEE,JR 



LEGISLATIVE SECRETARY 2,499.99 

CONGRESSIONAL AIDE 1,966.67 

CONGRESSIONAL ASSISTANT, TO AUG 31 2,000.00 

CCNGFESSIONAL ASSISTANT, TO AUG 31 950.00 

RESEARCH ASSISTANT 5,333.34 

SECRETARY, TO JUL 31 150.00 

CCNGFESSIONAL ASSISTANT, FROM SEP 1 800.00 

SECRETARY 2,035.00 

ADMINISTRATIVE ASSISTANT 9,900.00 

RECEFTICNIST 2,227.50 

DISTRICT REPRESENTATIVE, TO AUG 31 5,916.66 

CONGRESSIONAL ASSISTANT 3,125.01 

EXECUTIVE SECRETARY 8,694.99 

CONGRESSIONAL AIDE, TO AUG 31 450.66 

CCNGFESSIONAL AIDE 1,470.00 

DISTRICT REPRESENTATIVE 2,075.00 

SECRETARY ' 2,375.01 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590. OC 

RESEARCH ASSISTANT 4,958.33 



OFFICE OF HON. CLIFFORD ALLEN 



BECK, VIRGINIA F. 
CARTER , JACQUELINE B 
CHAMBERLAIN, CHRISTOPHER 
COHAN, BONNIE 
COX,MATTYE P 
GENTRY, RENEE D 
HAMNSR, JAMES H 
HARRIET, EDITH 
HIGHTOWER.KATHERINE E 
KLEIN, BARBARA ANNE 
MARTIN, DOROTHY H 
MUELL, JAMES M 
SAGGESE, MICHELE A 
SHDHAKER.JOHN H,JR 
SPELMAN, HAROLD J, III 



FIELD REPRESENTATIVE 

RECEPTIONIST 

APPT SECRETARY , 

LEGISLATIVE ASSISTANT , 

SECRETARY 

SECRETARY 

OFFICE MANAGER 

EXECUTIVE ASSISTANT 

PEFSCNAL REPRESENTATIVE AND SECRETARY 

SECRETARY , 

CLERK TYPIST 

LEGISLATIVE CLERK 

LBJ CONGRESSIONAL INTERN, TO AUG 26 ., 

PRESS AIDE 

STAFF ASSISTANT 



600.0 
,950.00 
,000.00 
,666.66 
,653.00 
,550.00 
,291.67 

916.67 
,999.99 
,916.66 

800.0 
,166.67 
,101.33 

150.00 
,375.00 



28 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFPICE OF HON. CLIFFORD ALLEN -CONTINUED 



THOMPSON III, GEORGE H 
WARREN, CHARLES E 
WOODS, RILLA HORAN 



LEGAL COUNSEL & ADVISOR $ 5,791.67 

CONGRESSIONAL ASSISTANT 4,125.00 

PRESS SECRETARY, TO JUL 15 1,000.00 



OFFICE OF HON. JEROME A AMBFO 



ADKINSON, SUSAN L 
BARRY, THOMAS V 
BENTZ, LINDA KAY 
CHAPUHAS, SUSAN E 
COATES,E ANNETTE 
COE, CAROLYN J 
DRISCOLL, DANIEL J 
FROST, E DOUGLAS 
KAPLAN, DAVID A 
KOEHN, ELIZABETH M 
LONG, WILLIAM 
MACK, VIRGINIA SUE 
HOONEY, DANIEL C 
MULLEN, ROSEMARY 
PALEY, BARBARA 
PECK, DANA 

SMITH, CHARLOTTE ANN 
SULL IV AN, MAUREEN, HOPE 



LEGISLATIVE CORRESPONDENT 

CONGRESSIONAL AIDE 

LEGISLATIVE AIDE 

SECRETARY 

LEGISLATIVE CORRESPONDENT 

RECEPTIONIST, FROM AUG 3 

PRESS ASSISTANT 

STAFF ASSISTANT, TO AUG 31 

LBJ CONGRESSIONAL INTERN, TO AUG 

SECRETARY 

CASEWORKER 

SECRETARY 

DISTRICT OFFICE DIRECTOR 

CASEWORKER 

ADMINISTRATIVE ASSISTANT 

LEGISLATIVE AIDE 

OFF MGR-EXEC SECRETARY 

RECEPTIONIST, TO AUG 15 



,000.01 
,300.01 
,500.01 
,875.00 
,919.99 
,288.89 
,621.90 
,333. 34 
708.00 
,005.00 
,750.00 
,932.20 
,«99.99 
,3U0.00 
,218.U5 
,500.01 
,499.99 
,048.30 



OFFICE OF HON. JOSEPH S AHMERMAN 



BOYLE, LOUIS LAWRENCE 
BRUTZMAN,JOHN A 
BURNEY,DENISE K 
CALDWELL, GERALD 
CHAFFEE, DANIEL 
DEIBERT, RONALD E 
GORDON, ALAN F 
GOULART,MARY M 
HEALY, COLLEEN JO 
HOWMAN, SHERRY L 
KEAPNS,GARY P 
KEREM,MARY ETTA 
LAST, JOHN E 
LININGER, DORIS A 
MC NAUL, DAVID A 
MCAULIFF, CORNELIUS J 
MCKEOWN, RICHARD E 
MILES, JOHN R,JR 
O'NEAL, ELEANOR H. 
TABLER, LUCILLE M 
WILLIAMS, LINDA J 



STAFF ASSISTANT 

STATE COLLEGE OFFICE MANAGER 

SECRETARY 

PART TINE CLERK 

DISTRICT ASSISTANT 

CASE WORKER 

PRESS SECRETARY 

STAFF ASSISTANT 

EXECUTIVE SECRETARY 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 

STAFF ASSISTANT, FROM SEP 1 

SECRETARY 

LEJ CONGRESSIONAL INTERN, TO AUG 31 ... 

CLERK TYPIST 

STAFF ASSISTANT, TO JUL 31 

ADMINISTRATIVE ASSISTANT 

EXECUTIVE SECRETARY 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT 

OIL CITY MANAGER 

CLERK TYPIST 



625.00 
875.00 
625.00 
6 50.0 
249.99 
000.01 
000.01 
,500.00 
500.00 
,000.00 
590.00 
,000.00 
,180.00 
000.01 
250.00 
,677.90 
,750.54 
,500.00 
,625.00 
,166.67 
,495.00 



OFFICE OF HON. GLENN M ANDERSON 



BUTORAC, ROBERT L 
CLINTON, DARLENE 
CULLATHER.JOHN H 
CURRAN.EDNA MAY D 
DAVIDSON,DERO HELEN 

DAVIS, CHRISTOPHER 
ENGELBERG, BARRY LAWRENCE 
FERGUSON, ELIZABETH ANN 
GANDARA, CARMEN H 
GERARD, BESSIE H 
HYATT, DAVID F 
INGRAM, JOHN H 
PEARSON, EVELYN E 
PETERSON, N JEANNE 
QUINN,SUZAN L 

RABER, BRIAN A 
RAMIREZ, ANNA H 
ROBERTS, MYRON 
SCHLESINGER,PAUL 
STEARNS, DARREL H 
THEISEN,MARK A 
WEHRER.ADA 



RESEARCH ASSISTANT 

CLERK 

CLERK 

OFFICE MANAGER 

SECRETARY, TO AUG 31 

CLERK, FROM SEP 1 TO SEP 3 

CLERK, FROM AUG 1 TO AUG 31 

CLERK 

CLERK 

CLERK 

CLERK 

CLERK, FROM SEP 12 

CLERK 

CLERK 

CLERK, TO JUL 31 

CLERK, FROM SEP 1 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

CLERK 

CLERK 

CLERK, FROM SEP 1 

CLERK 

ADMINISTRATIVE ASSISTANT 

LEGISLATIVE ASSISTANT, TO AUG 31 ... 
CLERK 



,300.00 
205.00 
500.00 
155.00 

,130.00 
495.00 
,050.00 
,120.00 
,625.00 
,110.00 
321.10 
427.00 
,500.00 
495.00 

190.00 

300.00 
,375.00 

000.00 
,520.00 
,582.00 

340.00 
,450.00 



29 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. JOHN B ANDEESCN 



ANDERSON, STEVEN C 
BFOWN, PAULA G 
CROWLEY, ANNE TOWNSEND 
FOSTER, JUNE H 
HOSTETTER,JOHN R 
KOLNES,f1AE B 
MAST2FS0N,HICHAEL J 
HOSKOWITZ, JANICE R 
POST, BRUCE S 
RASHUSSEN,LISA A 
RESH.LUCY F 
RICHARDSON, MARTHA ANN 
SEELY, ROBERT N 
SHAH, HARK B 
SPANG, LISA H 
SHEET, STUART 
TURNER, ELLEN 
WALDER.KIBK E 
HOLFENSBERGER, DONALD 



SPEC ASST FOR CONSTITUENT SVCS $ 3,750.00 

LEGISLATIVE CORRESPONDENT 3,500.01 

STAFF ASSISTANT 2,250.00 

PERSONAL SECRETARY 4,250.01 

STAFF ASSISTANT, FROH AUG 2 1,118.89 

STAFF ASSISTANT 2,625.00 

ADHINISTRATIVE ASSISTANT 5,499.99 

INTERN, TO JUL 31 590.00 

LEGISLATIVE AIDE 3,999.99 

PRESS SECRETARY, FROM JUL 5 2,866.67 

CLEBK TYPIST (DISTRICT OFFICE) 2,000.01 

ADHINISTRATIVE SECRETARY 4,500.00 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

SPEECH WRITER, TO AUG 31 2,666.66 

LEGISLATIVE CORRESPONDENT 3,324.99 

DIR-REP TASK FORCE ON ECO POL, TO AUG 31 1,333.34 

RECEPTIONIST 2,625.00 

LEGISLATIVE RESEARCHER 3,125.01 

LEGISLATIVE ASSISTANT 2,000.01 



OFFICE OF HON. IKE F ANDREWS 



ASHWORTB, RALPH G 
ADHAN, ROBERT HEYER 
BATCHELOR, JERRY STATON 
BEAUCHAHP, CAROLE A 
BOICE,DONA 
BUHANN, JOYCE C 
CHEATHAH,ANNE W 
CONRAD, JAHES V 
DETTOR,JOHN P 
FLETCHER, BARBARA H 
FRIEDHAN, SUSAN L 
HAHLET,ANN T 
HARRISON, KATHARINE C 
HATHCOCK, AARON A 
HONEYCUTT, CAROLYN H 
IVEY, LOUISE C 
REID, BALDWIN HORN 
STILLEY, EVELYN H 
SUGG,HARGARET J 
TSUTRAS, FRANK G 



LBJ CONGRESSIONAL INTERN, JUL 5 - AUG 3 

RESEARCH ASSISTANT 

FRCH SEP 1 

TO JUL 29 

TO JUL 31 

FRCH JUL 18 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT, FROH JUL 5 

LEGISLATIVE ASSISTANT 

ADHINISTRATIVE ASSISTANT 

TO JUL 31 



570.33 
,799.99 

250.00 
,248.61 
,333.33 
,012.50 

400.00 
,838.90 
,525.00 
,100.00 
,750.00 
,899.99 
,000.00 
,374.99 
.981.07 
,045.68 
,800.01 
,999.99 
,250.01 

600.00 



OFFICE OF HON. HARK ANDREWS 

ALBRIGHT, ELIZABETH A 
BOND,HARY ANN 
CANDOR, ANN L 
CONHY,HARYALICE A 
COOPER, SALLY G 
FISHER, CHARLES E 
FORD.PAHELA J 
FOBD,HILLIAH D 
GOLDHAN, PATRICIA A 

GROSS, KAREN ANN 
GROVE, HEG C 
GWINN, DOROTHY F 
HILDAHL, ALMA B 
HOLT, JOYCE E 
HUGHES, ROBERT E,JB 
JOHNSON, CAROL BETH 
KNUDSEN.LELA H 
LARIVEE, HONICA E 
SCHAAN,HABY ANN 
SCHHIT, EARNEST N 
SEITB.DENISE G 
STANNARD, GEORGE W 
WENTZ, ELIZABETH J 



FBOH SEP 1 

ASSISTANT LEGISLATIVE CLEBK, FBOH AUG 

FBOH SEP 1 

INTERN, TO JUL 31 

FBOH AUG 1 TO AUG 31 

STAFF ASSISTANT, TO JUL 31 

FRCH AUG 1 TO AUG 31 

RECEPTIONIST 

INTERN, TO JUL 31 

SPECIAL ASSISTANT 

LEGISLATIVE ASSISTANT 

FRCH SEP 1 

FIELD ASSISTANT 

ADHINISTRATIVE ASSISTANT 

LBJ CONGRESSIONAL INTERS, TO JUL 31 .. 



180.00 
,140.00 
,300.00 
,791.67 
,895.00 
,000.00 
590.00 
900.00 

,201.41 
,100.00 

590.00 
,554.00 
,010.00 
,895.00 
,440.00 
,000.00 
,090.00 
,490.00 
,190.00 
,780.07 
,735.00 
,179.81 

590.00 



OFFICE OF HON. FRANK ANNUNZIO 



ALEXANDER, SHABYN BURRELL 
ALTIHABI, LEONARD 
AZHDEB IAN, ANNA 



STENOGBAPHEB 

STAFF ASSISTANT 

AEHINISTBATIVE ASSISTANT 



3,249.99 
3,801.00 
8,715.51 



30 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. FRANK ANNUNZIO -CONTINDED 



D' AMICO, MARIE A 

HEYDE, DONNA L 

HORNYAK,DANA H 

JACOBSON,SUZYN 

KENNEDY, HENINGHAM GEORGE 

KOTA, PATRICIA A 

LATO,HOSE 

LINDSEY, CYNTHIA 

NELSON, WILLIAM STEEN 

PARKER, JAHES S 

SALA HONE, JOHN 

SEELEY, SYLVIA ANN 

VAITEKONAS,NORA F 



CLERK, TO SEP 15 $ 

RECEPTIONIST 

STENOGRAPHER 

LBJ CONGRESSIONAL INTEEN, TO JUL 31 

SECRETARY 

CLERK 

SECRETARY 

CLERK HIRE, TO SEP 15 

RESEARCH ASSISTANT 

CLERK 

STAFF ASSISTANT 

SECRETARY 

CLERK-STENOGBAPHER, TO SEP 5 



500.00 
499.99 
000.00 
590.00 
249.99 
.801 .87 
742. 44 
083. 33 
571.30 
538.02 
125.00 
249.99 
625.00 



OFFICE OF HON. DOUGLAS APPLEGATI 



ALLEMAN, DEBORAH LEE 
CHAMPAGNE, CHRYSTAL L 
COHEN, HARRY S 
DACAR, EVELYN JEAN 
DAVIS, CARRIE J. 
EBERTS, MARGARET JUNE 
GARNER, DWIGHT E 
GEORGIAFANDIS, JOLIE H 
GOSTINIS, MARGARET 
HART, JAMES R 
JONES, JANET A 
KOHL,PETER E 
LEVINE, BARBARA W 
LEWIS, MARY ANN WALSH 
MARKS, EDWARD 

MASCOLINO.MARYANNE THERESA 
MORDOCK, PATRICIA L 
PEKAR,DEATRA IRENE 
TAYLOR, HELANIE D 
TOLONESE.CARMELLA ROSE 



TYPIST 

CLERK, FROM AUG 22 TO SEP 2 

CLERK, TO AUG 22 

SECRETARY 

DISTRICT OFFICE MANAGER 

OFFICE MANAGER 

ASSISTANT DISTRICT OFFICE MANAGER 

CASEWORKER, FROM SEP 19 

PRESS SECRETARY 

CLERK, FROM AUG 1 TO AUG 12 

LBJ CONGRESSIONAL INTERN, JUL 5 - SEP 

RECEPTIONIST 

LEGISLATIVE ASSISTANT, TO SEP 16 

CLERK 

PROJECTS PERSON 

OFFICE MANAGER/EXECUTIVE SECRETARY .... 

CLERK, FRCM SEP 19 

RECEPTICNIST 



,000.00 
183.33 
.022.67 
,368.49 
124.99 
.500.00 
499.99 
125.01 
416.67 
999.99 
200.00 
,180.00 
,499.99 
,155.69 
,250.00 
,999.99 
,250.00 
586.49 
266.67 
,124.99 



OFFICE OF HON. BILL ARCHER 

BENEFIELD, BRUCE S 
BREWER, VALERIE E 
CARLSON.DONALD G 
COOPER, CHAILLE LINN 
FIGURA, LINDA H 
HANSEN, DOUGLAS B,JB 
LOCKHAHT, ROBERT F,JR 
MATHER, RUSSELL N,JR 
MATTHEWS, ALLIE PAGE 
MC GEE, DOROTHY LYNNE 
MILLER, DAPHNE H 
HILLWARD.JANE U 
MOSELEY, PHILLIP D 
MURPHY, BRIAN J 
PIERSON, LLOYD 
POWERS, PAMELA A 
SCHWARZMANN,MARY L 
STEELE, DONNA H 
TINKER, JILL W 



TO JUL 31 

CLERK 

TO AUG 4 

CLERK TYPIST 

DISTRICT OFFICE MANAGER 

TO JUL 31 

RESEARCH ASSISTANT 

PRESS AIIE 

ADMINISTRATIVE ASSISTANT 

CASEWORKER 

LEJ CONGRESSIONAL INTERN, TO JUL 31 



,874.99 

500.00 
,875.00 
,024.99 
,024.99 

566.67 
,000.00 
,175.00 
,543.75 

500.00 
,499.99 
,125.01 
,124.99 
,874.99 
,500.00 
,700.00 
,987.50 
,499.99 

500.00 



OFFICE OF HON. WILLIAM L ARMSTRONG 



BERRY, PHYLLIS A 
BUTLER, WALTER C 
GILBEBTO, TERESA 
HATFIELD, SUSAN B 

HOPPE.JOHN DAVID 
KELLY, JOHN H 
KLECKNER, LINDA ANNE 
KLEIN, WALTER C 
LEWIS, KATHRYN S 
MACQUIDDY, SUSAN LYNN 
MODESITT.LELAND E,JR 
MORGAN, CATHERINE E 
NICHOLS, DIANE 



SECRETARY 

PRINTER 

SECRETARY 

SECRETARY, TO AUG 18 

CASEWORKER, FROM AUG 19 

RESEARCH ASSISTANT 

PRESS SECRETARY 

STAFF ASSISTANT 

ADMINISTRATIVE ASSISTANT 

INTERN, TO AUG 17 

CASEWORKER, TO AUG 31 

LEGISLATIVE ASSISTANT 

SECRETARY, FROM JUL 25 

LBJ CONGSESSIONAL INTERN, TO AUG 12 



,550.00 
,800.00 
,700.00 

,070.00 
,000.00 
,875.01 
,500.00 
,900.00 

924.33 
,166.66 
,500.01 
,320.00 

826.00 



31 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. WILLIAH L ARMSTRONG -CONTINUED 

SPAULDING,BABY H PERSONAL SECT-OFF HGR $ 4,899.99 

VINCELETTE.TABARA K RECEPTIONIST, FROM AUG 22 1,040.00 

WAGSTAFF,NELDA V RECEPTIONIST 2,700.00 

WAIDBANN, BRIAN LEGISLATIVE ASSISTANT 2,750.01 

ZIEBARTH, CHRISTOPHER H EESIARCB ASSISTANT, TO JOL 31 333.33 

OFFICE OF HON. JOHN 8 ASHBROOK 

ALMENDINGE3,RUTH ANN CLERK, FBOH AOG 1 3,333. 34 

ALHENDINGER, WILLIAH F DISTRICT ADMINISTRATIVE ASSISTANT 7,374.99 

ARMSTRONG, GEORGE C RESEARCH ASSISTANT 2,499.99 

BROWARSKY, HERBERT CLERK, FRCHSEP 1 500.00 

BROUN, W BERNICE RECEPTIONIST, FROM ADG 1 1,911».17 

BYRD.LORI SUSAN LEJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

EVANS, DONALD D LEGISLATIVE ASSISTANT 6,249.99 

GLUNT, CAROL L SECRET ARY -CL ERK, TO JOL 31 

SECRETARY, FROM AUG 1 2,500.00 

LONG, MARY JO SECRETARY 3,187.50 

MCDANIEL,PAUL H CLERK 2,250.00 

MILES, STEPHEN R. DISTRICT REPRESENTATIVE 3,000.00 

MILLER, LOIS ANN CLERK 2,375.01 

MONARCHI, SALLY SUE CLERK 1,749.99 

MOORE, NANCY L SECRETARY 1,875.00 

PEARSON, RONALD W ADMINISTRATIVE ASSISTANT 7,374.99 

RHODES, WILLIAB DALE.JR CLERK 2,U99.99 

SMITH, S NANNETTE SECRETARY 3,187.50 

ST2INBOWER, CHARLES G INTERN, TO JUL 31 750.00 

STOVER, SUSAN E RECEPTIONIST-SECRETARY., TO JUL 20 555.56 

THIBAUT, DONALD G RESEARCH ASSISTANT, TO JOL 31 1,470.36 

WELSH, GINGER H SECRETARY 3,999.99 

WHITAKER, ROBERT W RESEARCH ASSISTANT 3,999.99 

OFFICE OF HON. THOMAS L ASHLEY 

ANDERSON, JULIA CLERK-INTERN, TO SEP 16 1,583.33 

BIELSKI, CHRISTINA R SECRETARY, FROM AUG 15 1,150.00 

BROWN, GERALD R ASSISTANT 6,000.00 

CAMPBELL, AARON R ASSISTANT 1,741.23 

CLENDENING.JUNE G ADMINISTRATIVE ASSISTANT 9,000.00 

GRAHAM, KAREN B SECPETARY 3,433.33 

HECK, PATRICK GEORGE CLERK, TO AUG 31 1,500.00 

KENT,ILENE BARBARA RECEPTIONIST 2,533.33 

LOSEE, HELEN ELISABETH RESEARCH ASSISTANT 3,125.01 

NUNN, CHARLIE B SECRETARY 3,657.42 

RINCK, SANDRA LEE EXECUTIVE SECRETARY 6,733.33 

SKOW, WILLIAH J LEGISLATIVE ASSISTANT 6,500.01 

TOMSIC, BETTY SECRETARY 4,237.83 

ZULVER,DALENA LEGISLATIVE AIDE 3,375.00 

OFFICE OF HON. LES ASPIN 

BEHM, PATRICIA A LEGISLATIVE CORRESPONDENT 2,975.01 

BPOYDRICK, WILLIAH B SFICIAL ASSISTANT, FROB JUL 13 7,058.34 

CAMBRIA, LINA SPECIAL ASSISTANT, TO JUL 31 750.00 

COOPER, KATHLEEN GRECO OFFICE MANAGER 3,575.01 

DINE, SUSAN ELAINE CASP WORKER 2,874.99 

ELVSRMAN, TIMOTHY J CMBUDSMAN 4,299.99 

EPSTEIN, BARRY P SPECIAL ASSISTANT, FROB SEP 19 40.00 

GALVIS, CARLOS LEGIS 6 RESEARCH ASST 5,500.01 

GONZALES, CHARLES ADBINISTR ATI VE ASSISTANT 6,249.99 

LEWANDOWSKI, RICHARD J LEJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

LONG, DIANE C SECRETARY 2,000.01 

HCGRAW, DEBORAH S RECEPTIONIST-SECRETARY 2,250.00 

NELSON, WAEFEN L LEGISLATIVE ASSISTANT 6,800.01 

PHILLIPS, LORNA J SECRETARY 2,000.01 

PREIEH.KATALIN S SPECIAL ASSISTANT, FROM AUG 1 1,083.33 

SCHALLERT, EDWIN G LEGISLATIVE ASSISTANT 6,316.66 

STROHL, JOSEPH A HOHE OFFICE MANAGER 4,500.00 

WESLOSKI, CAROLE MARY SECRETARY 2,250.00 



32 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HOK. LES AUCOIN 



BEEG, REBECCA J 
CALL, MICHAEL L 
CONKLING.GARY L 
CONTI, BONNY A 
FERRIS, tISA B 
GEOGHEGAN, SUSAN 
GOHBEBG, DAVID 



GONZALEZ, DIANA L 
GOTTHARDT, SANDRA J 
HENDRICKS, CINDY JO 
HENICK, CATHY S 
MATHEWS, BARBARA E 
MAUDLIN, L E 
HC FARLANE, HEATHER J 
MCCORMICK, PATRICK C 
SCIOLLA,DAYLE A 
SHAUGHNESSEY,SHERYL 
SPICER,HARGABET NARY 
SUNSET, JULIE L 
WOODFORD, BARBARA ANN 



LEGISLATIVE ASSISTANT $ 

DISTRICT OFFICE AIDE 

LEGISLATIVE ASSISTANT 

SECRETARY 

OFFICE CLERK, FROH SEP 1 

ADMINISTRATIVE ASSISTANT 

STAFF ASSISTANT, FROH AUG 1 TO AUG 19 

ASSISTANT FIELD REPRESENTATIVE, FROH SEP 1 ... 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

RECEPTIONIST, FROH SEP 6 

DISTRICT AIDE 

SECRETARY 

SECRETARY-CASE BORKER, TO AUG 31 

CASEWORKER (DISTRICT) 

PRESS SECRETARY 

SECRETARY 

DISTRICT REPRESENTATIVE 

STAFF ASSISTANT 

RECEPTIONIST, TO AUG 31 

SECRETARY 

SECRETARY DISTRICT OFFICE, FROM AUG 22 

SECRETARY 



4,124.99 
4,749.99 
6,230.01 
3,250.01 
U33. 33 
7,250.01 



1,750.44 
625.00 
2,699.99 
2,291.67 
1,166.66 
3,125.01 
5,750.01 
1,l»25.00 
6,111.i»5 
3,363.86 
1,583. 3U 
1,637.97 
780.00 
2,625.00 



OFFICE OF HON. ROBERT E BAEHAH 



BETTCHER, NANCY L 
BURTON, JANET P 
COLLINS, KATHERINE 
HATHAWAY, BRAD HARDING 
KURILCHYK, DEBORAH 
MAC INNIS.KATE 
MC CRANN, KELLY J 
NELSON, ARGYLE S 
PERNA, KATHLEEN M. 
SEELYE, HOWARD 
TERZENBACH,DIANNE 
TIERNEY,JOHN J,JB 
BATHEN,KATHY MARIE 
WILLETT, LOUISE H 
WOOLSEY,MARY LEE 



DISTRICT ADMINISTRATOR 5,250.00 

CASEWORKER 2,700.00 

TYPIST/COMPUTER OPERATOR 1,350.00 

ADMINISTRATIVE ASSISTANT 8,124.99 

STAFF ASSISTAHT 4, 500. 00 

RECEPTIONIST 2,187.51 

LBJ CONGRESSIONAL INTERN, TO AUG 18 944.00 

LEGISLATIVE ASSISTANT 4,500.00 

COMPUTER OPERATOR 2,210.01 

DISTRICT REPRESENTATIVE 8,000.01 

EXECUTIVE SECRETARY 3,699.99 

RESEARCH ASSISTANT 1,500.00 

SECRETARY 3,000.00 

PEESCNAL SECRETARY 3,624.99 

CASEWORKER 3,000.00 



OFFICE OP HON. HERMAN BADILLO 



ALBANDOZ, VICTOR M 
BENZA, LOUIS C 

BUTHER.LUCY 
DOMBER, HARLAN 
GORDON, JOHN STEELE 
GRIFFIN, SELENA E 
LAWLER.MARY BETH 
LUY,MIRA F 
PAGAN, RAMON W 
PAUL, ALICE M 
POPS, JEANNE 
QUINONES,EDMEE 
REMENESKI, SHIRLEY 
SANTANA,JUAN RAMON 
STEPHENS, ESHE H 

STURGILL.KARIN H 

WEINER, ROBERTA 

WILSON, DENISE H 



ASSISTANT 3,854.17 

ASSISTANT, TO AUG 31 

COUNSEL TO THE CONGRESSMAN, FROH SEP 1 6,291.66 

STAFF ASSISTANT, TO AUG 31 1,166.66 

LEJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

PRESS SECRETARY 2,591.66 

STAFF ASSISTANT 1,166.66 

SPECIAL ASSISTANT 3,999.99 

ADMINISTRATIVE ASSISTANT 5,874.99 

SPECIAL ASSISTANT 3,687.51 

ASSISTANT 3,249.99 

ASSISTANT 3,312.49 

ASSISTANT 1,374.99 

DISTRICT ADMINISTRATOR 6,291.66 

STAFF ASSISTANT 4,020.84 

ASSISTANT, TO AUG 31 

STAFF ASSISTANT, FROH SEP 1 3,937.51 

APPOINTMENT SECRETARY 2,625.00 

ASSISTANT, TO AUG 31 

PRESS ASSISTANT, FROH SEP 1 4,341.67 

LEGISLATIVE AIDE 2,750.01 



OFFICE OF HON. L. 

ATWELL, BETTY ADAIR 
DECKER, ANN L 
FREUND, JANICE L 
HOLL I NGS HEAD, GREGORY 
KLING, BARBARA C 
HCCHAREN.B E,JR 
MCDAVITT.JOHN J,JR 
MCKINNON,GENEAN H 



COMMITTEE ASSISTANT 4,592.49 

SECRETARY 2,840.01 

RECEPTIONIST, TO AUG 15 1,107.50 

LEGISLATIVE CLERK 2,700.00 

LEGISLATIVE SECRETARY, FROM AUG 1 TO AUG 14 .. 186.67 

DISTRICT REPRESENTATIVE 5,265.00 

RESEARCH 6 PRESS ASST 8,874.99 

LEGISLATIVE ASSISTANT 4,670.01 



33 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. L. A. BAFALIS -CONTINUED 



HCLBNDON,B L 
MILLER, SUSAN C 
NRLSON, RICHARD T 
PARKS, RANDOLPH B 
PEASE, CAROLTN S 
STEPHANY, PAMELA L 
STONE, JOYCE L 
THIERER, SHARON SKAGGS 
UALLACE, SHEILA B 
BEBB, CHARLOTTE ANN 
ZECK, JANET H 



DISTRICT REPRESENTATIVE $ 5,265.00 

RECEPTIONIST, FROM AUG 29 610.00 

ADMINISTRATIVE ASSISTANT 10,050.00 

LBJ CONGRESSIONAL INTERN, AUG 15 - SEP 14 590.00 

FILE CLERK, FROM JUL 16 TO JUL 31 200.00 

FILE CLERK, FROM SEP 6 125.00 

EXECUTIVE SECRETARY 4, 719. 99 

SECRETARY 2,840.01 

LBJ CONGRESSIONAL INTERN, TO JUL 21 113.00 

CASE SECRETARY 4, 509. 99 

LEGISLATIVE SECRETARY 3,789.99 



OFFICE OF HON. ALVIN BALDUS 

CARTER, INEATER P 
COHEN, KAREN L 
COLLINS, JOAN E 
GBER, CHARLES R,JB 
GIBSON, MARGIE 
GULLICK.BYRL 
HILL, JAMES P 
JENKINS, DAVID J 
KANFER, RONNIE B 
M2IEB, BECKY R 
HONIZ, FRANK T. 
NILSESTU2N, RODNEY J 
ONEILL, JOSEPH E 
PALMER, CAROLYN 
PORGETT, ROBIN 
SELK, CHRISTINE 
SHOEMAKER, RICHARD A 
STUCKERT,JANE E 
TLUSTY,MARY L 
BHITFORD, MARGARET S 
ZEPP,ALAN P 
ZIEBACZ,JUDI K 



SECRETAR Y 

LEGISLATIVE CORRESPONDENT 

FIELD REPRESENTATIVE 

STAFF ASSISTANT, TO JUL 31 

SECRETARY 

FIELD REPRESENTATIVE, FROM SEP 1 .. 
FIELD REPRESENTATIVE, TO SEP 19 .... 

FIELD REPRESENTATIVE 

RECEPTIONIST 

SECRETARY, FROM SEP 1 

STAFF ASSISTANT 

HOME SECRETARY FIELD REP, TO AUG 31 

PRESS SECRETARY 

PRINTER, FROM AUG 1 TO AUG 31 

SECRETARY 

SECRETARY, TO AUG 31 , 

FIELD REPRESENTATIVE 

STAFF ASSISTANT, FROM SEP 1 

SECRETARY CASEBORKER 

PERSONAL SECRETARY 

LEGISLATIVE ASSISTANT 

ADMINISTRATIVE ASSISTANT 



250.00 
500.01 
874.99 
870.33 
750.01 
333.33 
823.61 
124.99 
250.00 
750.00 
250.00 
416.66 
161.99 
750.00 
708.33 
166.66 
625.01 
999.97 
2 50.0 
750.01 
250.01 
630.08 



OFFICE OF HON. DOUG BARNARD 

ANTHONY, ROBERT H,JR 
BAILEY, ANN C 
BELEB,JOE D 
COMOLLI, MARTHA H 
ELDER, DAVID MAYNE 
HAMMOCK, TED L 
LEONARD, GAIL 
MARBLE, MARTHA MEBBORN 
POWELL, CATHERINE J 
SCHEPER,JANE BILDER 
SPENCE, DAVID K 
SBANK, SANDRA MORGAN 
THORNTON, C.E. 
TOMLINSON, REBECCA MOORE 
TROUTHAN.LEE C 
BALLER, AMELIA C 
BALLER, JACKIE KAY 
BYCHE, BARBARA H 



OFFICE OF HON. MAX BAUCUS 



BROBN, SHARON B 
BROBNING,R S 
CAMPBELL, JUDY 



ANN 



CHING, ELIZABETH L 
FOX, LOLA J 
GUILLEN, JOSE 
JACKSON, ROBERT KAYLE 
KALECZYC, HOLLY J 
LEDING, CHRISTINE 

!1CCOLLOH,MARLENE K 
HEDALLIS, SANDRA JEAN 
NIHLOS,CARLENE L 
ORAN, DANIEL 



CLERK, TO AUG 31 

SECRETARY 

PRESS SECRETARY 

CASE BOEKER 

ADMINISTRATIVE ASSISTANT 

DISTRICT COORDINATOR 

DISTRICT AIDE 

OFFICE MANAGER (PART TIME), TO JUL 31 

STAFF ASSISTANT, TO AUG 31 

LEGISLATIVE ASSISTANT 

CLERK (PART TIME), TO AUG 31 

STAFF ASSISTANT 

DISTRICT ASSISTANT 

PRESS SECRETARY, TO JUL 31 

CLERK, FROM SEP 12 ; 

CLEHK, FROM JUL 11 TO AUG 15 

LEGISLATIVE AIDE 

SECRETARY 

DISTRICT ASSISTANT, FROM JUL 18 

ADMINISTRATIVE ASSISTANT, TO JUL 31 

STAFF ASSISTANT, TO AUG 31 

OFFICE MANAGER, FROM SEP 1 

SECRETARY 

PART TIME FILE CLERK, FROM AUG 1 TO AUG 31 

STAFF ASSISTANT 

STAFF ASSISTANT 

SPECIAL ASSISTANT 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

RECEPTIONIST 

STAFF ASSISTANT 

STAFF ASST-DISTRICT OFFICE 

LEGISLATIVE ASSISTANT, FROM AUG 1 



400.00 
125. OC 
374.99 
267.50 
650.00 
249.99 
799.99 
000.00 
400.00 
699.99 
400.00 
150.01 
366.66 
408.33 
443.33 
700.00 
437.75 
220.74 



,111.11 
,666.67 

,375.00 
,250.01 
,249.98 
,833.33 
,166.67 
,500.00 

,590.00 
,187.51 
,916.67 
,166.67 

,500.00 



34 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. HAX BAUCUS -CCNTINUED 



PARKER, CHRISTINE B 
PHOWITT, PETER D 
RICE,HAUREEN BRIDGET 
SCHMAUCH, DONNA L 
SCOTT, PALBER BARS 
SHIELDS, BICHAEL GERARD 
SBITH,THOBAS B 
STOSICH.STEPHAN H 
TILLETT, CHERYL SUE 
TINIANOW, JERRY C 



STAFF ASSISTANT { 2,275.53 

STAFF ASSISTANT, FBOB SEP 1 733.17 

RECEPTIONIST 2,999.99 

DISTRICT ASSISTANT 2,666.67 

DISTRICT ASSISTANT, TO JDL 1 100.00 

STAFF ASSISTANT 3,87<l.99 

LEGISLATIVE ASSISTANT, TO JUL 31 896. 45 

STAFF ASSISTANT DISTRICT OFF, TO SEP 15 3,274.99 

DISTRICT ASSISTANT 2,1*16.67 

STAFF ASSISTANT, TO JUL 31 875.00 



OFFICE OF HON. ROBERT E BAUBAN 



ANTHONY, WILLIAB D , JR 
ARHSTRONG, WANDA JEAN 
ARTHUR, EDITH B 
BROGAN,S0SANNE 
CARROLL, HARRIET S 
DAVIDSON, SANDRA W 
DOCKSAI, RONALD F 
GREINER, PHYLLIS A 
HORAH,JAHES C 
HOWARD, NANCY E 
ISENBERG,LYNN 
JENKINS, EUNICE G 
LONG,BBENDA L 
LUNA, LUIS A 
RIBBENTROP, RICHARD L 
RUDY, DEBORAH A 
TAPSCOTT, STANLEY HARCUS 
VAN WAGENINGEN.BETH G 
WHEALTON,ROSS LAHONTE 
WILKINSON, BICHAEL C 



SPECIAL ASSISTANT 

CASEWORKER 

SECRETARY 

LEJ CONGRESSIONAL INTERN, AUG 1 - AUG 31 

SECRETARY 

SPECIAL ASSISTANT 

LEGISLATIVE ASSISTANT 

SECRETARY 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

PERSONAL SECRETARY 

RECEPTIONIST 

SECRETARY 

SECRETARY 

RESEARCH ASSISTANT 

ADBINISTRATIVE ASSISTANT 

SECRETARY TO ADHIN ASST 

PRESS ASSISTANT 

RECEPTIONIST 

SPECIAL ASSISTANT, TO JUL 15 

SPECIAL ASSISTANT 



,121.67 

,499.99 
,833.33 

590.00 
,750.01 
,750.00 
,124.99 
,312.49 

590.00 
,249.99 
,124.99 
,312.49 
,874.99 
,000.01 
,500.01 
,500.01 
,250.01 
,250.00 
,041.67 
,750.01 



OFFICE OF HON. EDWARD P BEAR! 



BLENDER, BORTON 
CAPOBIANCO .JOSEPH 
CARTER, DIANE F 
CELLETTI, PATRICIA ANN 
CRAWFORD, NANCY A 
FRANCISCO, DONNA E 
GAVEGNANO, ELAINE F 
HAHPTON, CYNTHIA R 
HC SHANE, HURIEL A 
BCKENNA, KATHLEEN H 
BITCHELL,ANN E 
BOSS, BEVERLY L G 
ORLANDO, PAUL A 
PARENTE, JOSEPH B 
PESATURO,HABILYN 
RILEY, JOHN DANIEL 
SHOLLINS,JOHN F 
STPIERRE, NANCY H 
WEBSTER, ROBERT C 



PRESS SECRETARY 

CASEWORKER, FBOH AUG 1 

SECRETARY 

SECRETARY 

SECRETARY 

SECRETARY, TO AUG 31 

EXECUTIVE SECRETARY 

AIDE TO CONGRESSMAN 

RECEPTIONIST-APPT SECTY, FBOH SEP 7 

LEGISLATIVE ASSISTANT 

SECRETARY 

PERSONAL SECRETARY 

AIDE 

CASE WORKER 

SECRETARY 

ADBINISTRATIVE ASSISTANT 

ADHINISTBATIVE ASSISTANT 

SECRETARY 

AIDE 



,849.88 
320.00 
499.99 
,101.94 
,499.99 
,251.44 
,714.90 
026.97 
866.67 
,514.74 
101.94 
,959.91 
,026.97 
838.65 
,714.90 
017.93 
,860.09 
,026.97 
,101.94 



OFFICE OF HON. ROBIN L BEARD 



ALEXANDER, HARY FRANCES 
BAINE,CHARLENE V 
BAKER, DONNA F. 
BARNES, LISA C 
BOEHLERT,HARIANNE 
BROWN, JUDY A 
CALVERT, BARGE DAVIS 
DRING.JOHN P,JR 
GATES, CAROLYN K 
HABER,CHARLA L 
HIXON, FRANK P,JH 
HUCKABY,JOE STANLEY 
JENKINS, SUSAN B 
KI NZ HU BE R, PATRICIA 
BADSON, PATRICIA A 
BCNABARA,THOHAS J , JR 
MILLER, DAPHNE H 



RECEPTIONIST 

CLERK TYPIST, TO AUG 31 

DISTRICT STAFF ASSISTANT, FROH SEP 1 .... 
RESEARCH ASSISTANT, FROH AUG 1 TO AUG 31 

CASEWORKER 

DISTRICT STAFF ASSISTANT 

DISTRICT STAFF ASSISTANT 

LEGISLATIVE ASSISTANT, FROH AUG 1 

RESEARCH ASSISTANT, TO JUL 31 

PRESS ASSISTANT 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

STAFF ASSISTANT 

STAFF ASSISTANT 

LEGISLATIVE AIDE 

EXECUTIVE SECRETARY 

ADHINISTBATIVE ASSISTANT 

RESEARCH ASSISTANT 



696.66 
500.00 
316.00 
500.00 
324.50 
545.85 
227.65 
030.17 
500.00 
738.49 
590.00 
500.00 
317.55 
814.67 
781.14 
530.17 
311.00 



35 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. BGBIN L BEARD -CONTINDED 



PIERCY.BRENDA L 
PRATHER.PAOL E 
PROVO,SALLI A 
ROGERS, WILLIAM 
SWEENEY, DANIEL F 



DISTRICT STAFF ASSISTANT, TO JUL 31 $ 716. 34 

RESEARCH ASSISTANT, FROI1 ADG 1 TO AUG 31 200.00 

RESEARCH ASSISTANT, FROM SEP 1 500.00 

FIELD DIRECTOR 6,075.25 

STAFF ASSISTANT 2,750.01 



OFFICE OF HON. BERKLEY BEDELL 



BROWN, JANET J 
BOOL, DONNA J 
CENTER, JILL 

COOK, STEPHEN K 
DALSANTO, JOHN A 
ENDICOTT, WILLIAM T 
GALVIN, TIMOTHY 

GOODWIN, KAREN E 
GRAHAM, PATRICIA A 
HALVORSON, RODNEY 
HODGSON, CLAYTON E 
JASPER, DOROTHY LOOISE 
LOGAN, CHRISTOPHER C.JR 
HATHIS, GREGORY 
MITCHELL, DOROTHY E 
PAYNE, NANCY L 

RODSE, PETER H 
SIHS.SOSAN J 
TATHAH,JACK 
TEBRANOVA,KATHY A 
THOLKES, CYNTHIA S 
WHITHOHE, THOMAS H 
YAGER, MARIE E 



INTERN, TO JOL 31 500.00 

CASEWORKER 2,756.25 

LEGISLATIVE ASSISTANT, TO JOL 31 

LEGISLATIVE AIDE, FROM AOG 1 3,383.34 

PRESS SECRETARY 1,365. 54 

ROBO OPERATOR, FROM SEP 16 395.83 

LEGISLATIVE ASSISTANT 4,331.25 

INTERN, TO JOL 31 

STAFF ASSISTANT, FROM SEP 16 1,750.00 

CASEWORKER 2,250.00 

OFFICE MANAGER, TO SEP 15 3,016.55 

DISTRICT REPRESENTATIVE 4,410.00 

FARM REP 3,858.75 

DISTRICT AIDE 2,250.00 

PRINTER, FROM AOG 1 TO AOG 31 791.67 

RCBO OPERATOR, TO AOG 31 1,433.33 

LEGISLATIVE CORRESPONDENT 2,493.75 

SECRETARY, TO JOL 31 

PERSONAL SECRETARY, FROM AOG 1 3,595.84 

ADMINISTRATIVE ASSISTANT 7,031.74 

CASEWORKER 3,018.75 

DISTRICT REPRESENTATIVE, FROM SEP 1 1,125.00 

INTERN, FROM AOG 1 TO AOG 31 500.00 

RECEPTIONIST, FROM SEP 1 625.00 

DISTRICT REPRESENTATIVE 4,410.00 

SECRETARY, TO JOL 31 

LEGISLATIVE ASSISTANT, FROM AOG 1 3,383.34 



OFFICE OF HON. ANTHONY C EEILINSON 



BONFILIO, KATHLEEN 
CAMPAGNA,JONE 
CHECCA, MICHAEL P 
CHOSAK, SHEILA B 
EMERSON, JOYCE C 
FAOLSTICH, JANET K 
FRIEDMAN, LINDA J 
GADZOK, MARILYN W 
HATFIELD, VIRGINIA H 
KILLGORE, ROBERTA H 
LYKES, CONSTANCE E 
MARCOS, FELICIA A 
OSHERENKO,GAIL 
PLOT KIN, CAROL 
POLOYAC, MICHAEL, II 
PRINCE, STEPHANIE 
REDHOLTZ,VICKI DALY 
SCHWARTZ, MICHAEL D 
SHAFFRAN,JOAN GLORIA 
SLAVKIN,KAY M 
STOLL, CYNTHIA S 
STOCKERT.JANE E 



LEGISLATIVE ASSISTANT 

BESIARCH ASSISTANT, FROM SEP 1 , 

DISTRICT OFFICE REPRESENTATIVE 

CASEWORKER 

CASEWORKER/SPECIAL ASSISTANT , 

OFFICE MANAGER 

SPEC ASST PRESS 

RESEARCH ASSISTANT, FROM SEP 1 

CASEWORKER (DIST) 

LEGIS CORRESPONDENT , 

PERSONAL SECRETARY 

STAFF ASSISTANT, TO JOL 31 

LEGISLATIVE ASSISTANT 

SECRETARY CASEWORKER 

LEGISLATIVE ASSISTANT 

RESEARCH ASSISTANT, FROM SEP 1 

CASEWORKER 

LEJ CONGRESSIONAL INTERN, TO AOG 31 

RESEARCH ASSISTANT, FROM AOG 1 TO AOG 31 

CASEWORKER 

RECEPTIONIST 

RESEARCH ASSISTANT, FROM AOG 1 TO AOG 31 



500.00 
500.00 
624.99 
841.67 
2 50.00 
999.99 
800.01 
800.00 
200.00 
125.01 
375.00 
000.00 
500.00 
425.00 
999.99 
500.00 
999.99. 
180.00 
550.00 
249.99 
812.50 
000.00 



OFFICE OF HON. ADAH BENJAMIN JR 



BRINKHAN.FRANKLYN D,JR 
BYRON, RODY 
CHEEKS, LINNIE W 
EICHELBERGER, JOYCE 
FITZPATRICK, GEORGE P,JR 
IACCARINO, ROSEANN 
JAKOVICH, CECELIA R 
KAISER, KAREN J 
LONA, BENJAMIN T 
MALKASIAN.TOM Z 
MANONI.JOHN P 
MARIANES, WILLIAM B 



LBJ CONGRESSIONAL INTERN, TO JOL 31 

ASST DIST DIR 6 PROJECTS COORD , 

CASE WORKER-DISTRICT OFFICE , 

RECEPTIONIST-SECRETARY , 

LEGISLATIVE ASSISTANT 

OFFIC2 MGB-PERS SECTY , 

CHIEF LEGISLATIVE ASSISTANT 

SECRETARY 

DISTRICT EIBECTOB , 

WASHINGTON OFFICE INTERN, AOG 1 - AOG 31 

DISTRICT OFFICE ASSISTANT 

WASHINGTON OFFICE INTERN, FROM SEP 1 .... 



590.00 
,999.99 
,250.00 
,625.00 
,750.01 
,500.00 
,999.99 
,375.01 
,999.99 
750.00 
800.00 
,000.00 



36 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OPFICE OF HON. ADAB BENJABIN JB -CONTINUED 



MOLINARO, HELEN 
RASKOSKY, JENNIE 
RENSLOW, ALFRED L 
STARK, ELIZABETH I 
SULLIVAN, LINDA K 
TAYLOR, JULES B 
THOMPSON, EARL S 
WAXMAN,BARABRA 
WILANDER, NATALIE 



DIST OFF CASE WORKER $ 716.67 

CASE WORKER-DISTRICT OFFICE 2,250.00 

FEtERAL PROJECTS COORDINATOR 3,750.00 

LEGISLATIVE ASSISTANT 2,952.01 

DISTRICT OFFICE CORRESPONDENT, TO SEP 6 1,980.00 

DISTRICT OFFICE INTERN, TO JUL 31 1,000.00 

ADMINISTRATIVE ASSISTANT 8,750.01 

CASE WORKER-DISTRICT OFFICE 2,250.00 

DISTRICT OFFICE MANAGER 3,000.00 



OFFICE OF HON. CHARLES E BENNETT 



BISHOP, LAOFA 

DONALDSON, BRENDA CABLENE 
FARLEY, JOHN W 
GREENE, BETTY J 
JOHNSON, STEPHEN B 
LYLE, BARBARA C 
POLLARD, JOHN B,JR 
SCOTT, SARAH J 
SIEGEL, SHARON H 
STRINGFELLOW, AUDREY W 
YEGELLA , KAREN E 



CLEBK 

CLERK 

LEGISLATIVE ASSISTANT ... 

CLERK, FFCM AUG 1 

ADMINISTRATIVE ASSISTANT 

CLEBK 

CLEBK 

CLERK 

CLEBK 

CLERK, TO JUL 15 

CLEBK 



550.00 
1214.99 
750.01 
770.81 
375.01 
150.01 
000.00 
150.01 
150.01 
075.00 
233.33 



OFFICE OF HON. TOM BEVILL 

BEVIS.GBEGOBY STEPHEN 
BLACKHON,S KIH 
COCHBAN,MARY B 
EKERN,BARGABET KJY 
PILLIBGANE,LYNN BOSE 
FLEISHER, PATSY P 
FBATANTUONO, DONNA G 
HENSLEE,CUBI 
HOBNSBY.ISBELL A 
JOHNSON, BETTY S 
KELLER, MAVIS L 
KELLETT, JOANNE C 
BABB, SYLVIA SCHWAB 
BC COED, BOY O 
PHILLIPS, ANNE S 
PBESCOTT, LOUISE E 
SAUNDEBS, PATRICIA F 
SIMMONS, MARY ANN 
SWEITZER , HENRY B 
WATTS, CHABLES C,JE 



PBESS SECRETARY 

LBJ CONGRESSIONAL INTERN, TO JUL 5 

SECRETARY 

CASEWORKER 

SECRETARY 

CASEWOEKEB 

SECRETARY 

SECRET ABY 

CLEBK, FBCM JUL 8 TO AUG 5 

PERSONAL SECBETABY 

SECBETARY 

CLERK, TC JUL 5 

CASEWORKER 

LBJ CONGRESSIONAL INTEBN, JUL 6 - AUG 5 

CLERK, FROM AUG 8 TO SEP 9 

SECBETABY 

CASEWORKEB 

SECBETARY 

ADMINISTRATIVE ASSISTANT 

FIELD REPBESENTATIVE 



,750.01 
98.33 
,114.90 
,800.10 
,125.01 
,114.90 
,905.66 
,100.73 

166.66 

,324.13 

,111.90 

83.33 

,800.10 

590.00 

533.33 
,144.90 
,144.90 

550.35 
,874.99 
,709.14 



OFFICE OF HON. BABIO BIAGGI 

DOLAN, MARGARET M 
FUFIDIO.BICHAEL V 
HOWARD, EDWIN 
ILCHUK, PETER K 
KA7.MIERSKI, MADELINE 
LEVINE,RAY 
BABKHAB, ANGELINA T 
BABTIN, JOSEPH G 
HATZ,MOBTIBEB 
BEISTER.RUTH 
MILLER, JUDITH ANN 
BILLETICH,BARYANN 
NOLAN, CAROL 
PASCOCELLO, ROBERT F 
RYAN, RICHARD J 
SANTANGELO, CHARLES A 
SCALA, GLORIA R 
SPADONE, SUSAN L 
TRACY, JOHN D 
TURNER, JANE H 
WILKINSON, CYNTHIA B 
ZUCKEB, JULIET B 



CASE WORKER 

SPECIAL ASSISTANT, FROB SEP 1 

STAFF ASSISTANT, TO AUG 31 

ADMINISTRATIVE ASSISTANT 

STAFF ASSISTANT, TO JUL 31 

EXECUTIVE SECRETARY 

SECRETARY 

STAFF ASSISTANT, FROM AUG 1 

PRESS ASSISTANT ' 

CASEWORKER 

CASE WOBKEB 

STAFF ASSISTANT 

SPECIAL ASSISTANT 

EXECUTIVE ASSISTANT 

STAFF ASSISTANT, FBOB AUG 1 TO AUG 31 
LBJ CONGBESSIONAL INTEBN, TO JUL 31 ... 

CASEWORKEB 

BECEPTIONIST, TO SEP 2« 

EXECUTIVE ASSISTANT 

STAFF ASSISTANT, TO JUL 31 , 

EXECUTIVE SECBETABY 

SECBETABY 



,124.99 
,695.00 
,000.00 
,500.01 
525.00 
,000.00 
,250.00 
,000.00 
,624.99 
,499.99 
,000.00 
,625.01 
,500.01 
,250.00 
100.00 
590.00 
,250.00 
,983.33 
750.01 
500.00 
,750.00 
874.99 



37 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. JONATHAN B BINGHAM 



AGOVINO, PHYLLIS 
ALTMAN, PAULA 
BRANCH, PATRICIA C 
CARROLL, DOROTHY G 

COHEN, AMY B 
GRAY, JEFFERSON 
GR"ENBSRG, MARTIN J 
JENKINS, KAREN L 
KERR, GORDON C 
NEZIN,RUTH K 
OFFEN, EVELYN 

PERRY, SHEELAGH JEAN 
ROSENBERG, MICHAEL J 
SPADACINI, AGNES 
STABM,DIANE LINDA 
SUBBIONDO, LUCILLE 
TORELLI,LENOFE 
TREASH,ANYA P 
WARBURG, GERALD F,II 
WATSON, GERALYN 



$ 

CASEWORKER 

TC JUL 31 

FRCN SEP 1 

RESEARCH ASSISTANT, TO JUL 8 

FROM AUG 1 TO AUG 31 

TO JUL 31 

FRCM AUG 10 

LEGISLATIVE ASSISTANT 

RESIARCE ASSISTANT 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 



,52U. 00 
,904.99 
,417.50 

787.50 
,3U3.75 
213. 33 
220.00 
,599.99 
,037.50 
,679.99 

,055.00 
,856.25 
,449.99 
,760.01 
,350.01 
,691.24 
,952.51 
,643.75 
,125.00 
,079.83 



OFFICE OF HON. JAMES J BLANCHABD 



BHUEGER, KATHLEEN S 
CLEEK, LINDA ANN 
DITTENBEF, HARRY H 
GAINER, CELIA A 
GRAY, THOMAS OLIVER 
HOEMKE, CONSTANCE E 
KAUFFMAN, DONNA K 
KOSS, DAVID M 
LAIRD, SUSAN E 
LFNNON, NANCY H 

LIEBOLD, WILLIAM H,II 
MCINERNSY, KATHLEEN 
MORRIS, GREGORY R 
MYLER.MELVIN E,JP 
ROTHSCHILD, MARC 
SOLOMON, SHELBY 
SPIEGEL, JUDITH ANN 
THAL,DENISE ANN 
THAYER, RONALD J 
YORK,HALINDA G 



RECEPTIONIST 

RESEARCH ASSISTANT 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

PERSONAL SECRETARY OFFICE MGR 

LEGISLATIVE ASSISTANT 

STAFF AIDE 

ASSISTANT CASEWORKER 

INTERN, TO AUG 31 

ADMINISTRATIVE ASSISTANT 

RECEPTIONIST, TO AUG 31 

RECEPTIONIST-DISTRICT OFFICE, FROM SEP 1 

SPECIAL ASSISTANT/CASEWORK 

SECRETARY 

CASEWORK DIRECTOR 

AIIE, TO JUL 31 

LBJ CONGRESSIONAL INTERN, AUG 1 - AUG 31 

ASSISTANT CASEWORKER , 

DISTRICT AIDE 

INTERN, TO AUG 31 

SPECIAL ASSISTANT 

CLERK TYPIST/COMPUTER OPERATOR 



333. 3U 
174.99 
590.00 
550.01 
033.33 
250.01 
499.99 
591.67 
500.00 

833.34 
999.99 
123.34 
333.33 
200.00 
590.00 
124.99 
250.00 
6 50.0 
800.01 
749.99 



OFFICE OF HON. MICHAEL T BLOUIN 



ANDERSON, NANCY A 

BOYSE, DIXIE 
BRENNAN, KATHLEEN ANNE 
CAPEON, JOYCE A 
CUSHING, DAVID 
DAWSON, ADAM T 
DESENNE,G. CAROLE 
DRDMMOND, KATHLEEN A 
HATTEBERG, RANDY 
HAUER, JOSEPH L 
HEIAP.JANE H 

HEIDEN, DOUGLAS G 
HOULIHAN, DENNIS J 
HUPB, JAMES C 
LAB, MELODY BLISS 
LAMBPECHT,JILL M 
LE CLAIR, RENEE PARSONS 
MC CORMACK, THOMAS J 
MCCLIHON, THOMAS L 
MOONEY, SHEILA B 
SISK, REBECCA L 

SKINNER, JAMES CALVIN 
TALBOT, STEPHANIE 
THOMAS, MARTHA G 
WILLIAMS, CAROLYN D 
WOODS, ROGER D 



OFFICE M 
OFFICE M 
OFFICE H 
LEGISLAT 
COFRESPO 
PRESS AI 
PRESS AI 
ADMINIST 
CASEWORK 
FIELD RE 
DISTRICT 
CLERK TY 
CLERK TY 
FIELD RE 
DISTRICT 
LEGISLAT 
OFFICE S 
LEJ CONG 
PERSONAL 
CLERK, F 
FIELD R 
LEGISLAT 
OFFICE H 
OFFICE B 
LEGISLAT 
STAFF AS 
RESEARCH 
CLERK TY 
ADMINIST 



ANAGER, FROM JUL 15 TO AUG 14 

ANAGER, FROM SEP 15 1,433.67 

ANAGER 3,000.00 

IVE ASSISTANT 3,306.00 

NEENCE COORDINATOR 3,501.00 

DE, TO SEP 10 4,075.00 

It, FROB SEP 11 1,650.00 

RATIVE ASSISTANT., TO JUL 31 1,834.00 

EB 3,750.00 

FFESENTATIVE, TO AUG 31 1,670.00 

ADMINISTRATOR, TO SEP 10 3,970.00 

PIST., FROM JUL 15 TO AUG 14 

FIST, FROM SEP 15 2,045.47 

FFESENTATIVE, FROM AUG 1 2,420.00 

ADMINISTRATOR, FROB SEP 12 1,425.00 

IVE ASSISTANT 3,936.00 

ECRETARY 2,100.00 

FISSIONAL INTERN, TO JUL 31 590.00 

SECPETARY 3,000.00 

RCH AUG 15 TO AUG 31 300.00 

PBESENTATIVE 3,000.00 

IVE ASSISTANT 3,750.00 

ANAGER, TO JUL 14 

ANAGER, FROM AUG 15 TO SEP 14 2,200.00 

IVE ASSISTANT 4,500.00 

SISTANT, FROM AUG 5 TO AUG 14 500.00 

ASSISTANT, FROB SEP 1 512.00 

PIST, FROM JUL 5 TO JUL 8 93.33 

RATIVE ASSISTANT 5,250.00 



38 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. LINDY BOGGS 



CHAMBLISS, WILLIE D 
CHIPPEL,JEAN H 
DRUHMEY.G PATRICIA 
FAGOT, CARYL L 
GRIFFITH, MYRIAM G 
HEEBE.ADREA DEE 
INDERFORTH, MEREDITH ROOSA 
KAVALJIAN, MOLLIS P 
HAH0NY,L0RETTA C 
BAHONY, PATRICIA J 
HCGEOWN, NANCY M 
NICKENS, JAMES T 
PORTER, HENRIETTA R 
RATHE, BARBARA A 
STERNFELD, MICHELLE I 
VOELKER.EVA S 
BEGMAN, CHRISTINE M 
ZELDEN, KAREN 



CLERK $ 

SECRETARY 

LBJ CONGBESSIONAL INTERN, JUL 5 - AUG 4 

SECRETARY-DISTRICT OFFICE 

SECRETARY 

FFCM JUL 18 

EXECUTIVE SECRETARY 

LEGISLATIVE AIDE 

RECEPTIONIST 

APPOINTMENT SECRETARY 

TO JUL 31 



,316.66 
065.15 
,377.55 
,300.01 
344.96 
590.00 
,103. 74 
,662.52 
,3116.31 
,110.11 
,443.15 
,950.91 
,53U.73 
,493.50 
,852.51 
,104. 17 
,620.74 
500.00 



OFFICE OF HON. EDWARD P BOLANC 



BROMAN, MORGAN 
CAMPBELL, JOAN FAY 
DONNELLAN,MARY CABEY 
DONOGHUE, PATRICK J 
FAERELL, GALE ANN 
KEANEY.JOHN DAVID 
KEYES,G ELIZABETH 
LA ROSA, HARRIET 
MCALEAR, SANDRA L 

MCfARLIN, KATHLEEN ANN 
METZGER,MARY ELLEN 
MURRAY, SADIE L 
ODONNELL, JOHN WILLIAM 
POWERS, MICHAEL J 
PRATT, ROBERT LEONARD 
QUAST, NANCY E 
SHEEHY, MICHAEL W 
SULLIVAN, MARY BETH 
WINN, ELLEN ELIZABETH 



PRESS SECY-CLERK 3,750.00 

SECRETARY 6,399.99 

CLERK, FROM SEP 1 308.33 

ADMINISTRATIVE ASSISTANT 10,183.74 

SECRETARY 2,308.80 

ADMINISTRATIVE ASSISTANT 5,000.01 

SECRETARY 1,022.10 

CLERK, FROM SEP 1 715.00 

CLERK, TO JUL 31 

CLERK, FROM AUG 5 3,160.56 

LBJ CONGRESSIONAL INTERN, TO AUG 31 1,180.00 

CLERK 2,308.80 

SECRETARY 2,308.80 

LEGISLATIVE ASSISTANT 5,760.95 

CLERK 3,125.01 

LEGISLATIVE CLERK, TO JUL 31 2,250.00 

CLERK 2,312.50 

LEGISLATIVE ASSISTANT, FROM SEP 1 1,833.33 

CLERK, TO AUG 31 1,180.00 

CLERK 2,874.99 



OFFICE OF HON. RICHARD BOLLING 



BARNES, GARY DON 
BODINSON,LAUPENCE 
BROADAWAY, MARGARET E 
BROWN, DOLORES L 
DILLON, EMILY L 
GREER, PEGGY H 
HERNDON, NONA G 
HUDGENS.DEANNA DIXIE 
LEE, FREDERICK BROOKE 
LEVINE, KAREN SUSAN 
LOWE, NANCY R 
MYERS, JOYCE A. 
SNIEZEK, ROBERT A 
STOCK, PIER A 
SUMIDA,GLADYCE T 
WARREN, MYRNITH MAY 



SERVICE REPRESENTATIVE 

SECRETARY 

LEGISLATIVE ASSISTANT 

RECEPTIONIST 

LBJ CONGRESSIONAL INTERN, TO JUL 31 
AIDE 

CLERK-STENOGRAPHER 

AICE 

AIDE 

ADMINISTRATIVE ASSISTANT 

AICE 

SPECIAL ASSISTANT 

CASEWORKER 

EXECUTIVE SECRETARY 

CLERK 



,750.01 
,900.00 
,000.01 
,577.32 
590.00 
,302.16 
,302.16 
,689.73 
,572.45 
,300.01 
,774.99 
,100.00 
,638.90 
,000.00 
,019.63 
,751.78 



OFFICE OF HON. DAVID E BONIOR 



ATERNO, KATHLEEN 
BRULEY, EDWARD A 
CAMPBELL, AARON R 
DA VIS, FORREST L 

DEBE A USSAERT, KENNETH 
DUFENDACH, SARAH 
ELLIOTT, CLAUDIA ANNE 
GALLOP, STEVEN P 
HOSTETTLER,MARY B 
JAFFRAY, JANET ANN 
KEMP, STANLEY H 



OFFICE MANAGER 

SPECIAL PROJECTS COORDINATOR 

STAFF ASSISTANT, FROM AUG 16 TO AUG 31 . 

SPECIAL FROJECTS ASST, TO AUG 15 

SPECIAL PROJECTS ASSISTANT, FROM SEP 16 

CONSTITUENT SERVICES REP 

CONSTITUENT SERVICES REP 

LEGIS RESEARCHER 

CONSTITUENT SERVICES REP 

SPECIAL PROJECTS ASST 

SPECIAL PROJECTS ASSISTANT, TO SEP 15 .. 
LEGISLATIVE ASSISTANT 



,500.00 
,250.01 
500.00 

,224.99 
,125.01 
,125.01 
,500.01 
,125.01 
999.99 
,024.99 
,875.00 



39 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. DAVID E BONIOR -CONTINUED 



KOCH, CHRISTINE 
KOLLY, TIMOTHY S 
MARTIN, THOMAS D. 
NCCABE, WILLIAM MICHAEL 
HOOFE, BENNETT* A 
O'SULLIVAN.JANE E 
REDFERN, CRAIG S 

REDOUTEY,LADF» J 

VOLLMAN, JAMES B 
WHITE, NANCY H 



EDUCATION PROJECTS COORDINATOR $ 

LEGIS RESEARCHER 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT, FROB SEP 16 

OFFICE MANAGER 

CASEWORKER .' 

SPECIAL PROJECTS ASSISTANT, TO JUL 15 

SPECIAL PROJECTS ASSISTANT, AUG 16 - SEP 15 ... 
SPECIAL PROJECTS ASSISTANT, JUL 16 - AUG 15 ... 

SPECIAL PROJECTS ASSISTANT, FROB SEP 16 

ADMINISTRATIVE ASSISTANT 

BAILINGS COORDINATOR/ SECRETARY 



,250.01 
,500.01 
,500.01 
600.00 
, 125.01 
.125.01 



,074.99 
,000.00 
,250.01 



OFFICE OF HON. DON BONKER 

BELL, AMY DISTRICT OFFICE BANAGER 4,047.75 

BELLABY,ERIC D STAFF ASSISTANT, FROB SEP 1 500.00 

BLACK, BARBARA E CLERK/TYPIST, FROB SEP 1 436.67 

EVANS, DANIEL S LEGISLATIVE CORRESPONDENT 3,213.19 

EVANS, LUANDA H CLERK TYPIST., TO JUL 31 

RECEPTIONIST, FROM AUG 1 2,282.34 

HARDHAN, LOUISE D EXECUTIVE ASSISTANT 2,287.50 

HARRELL, JOYCE LINDSEY COMPUTER OPERATOR 2,750.01 

LAiSON,DIANNE LCNEVE SECRETARY-RESEARCH ASST, TO AUG 31 .. 2,118.75 

LESOURD, LINDA ANN BECEPTICN 1ST, TO JUL 31 

EXECUTIVE ASSISTANT, FROB AUG 1 3,491.17 

LUNDBERG, RONALD FAY LEGISLATIVE ASSISTANT, TO AUG 31 3,275.00 

HAPTIN,ARTHU? LEE LEGISLATIVE ASSISTANT 6,000.00 

MARTIN, MARY ELLEN C DISTRICT BANAGER 1,1*72. 49 

BULLINGS, KATHLEEN B CLERK TYPIST 2,799.68 

BUNGER,REX N LBJ CONGRESSIONAL INTERN, TO AUG 31 1,180.00 

BURRAY,OTIS SILLARD DISTRICT ASSISTANT 4,710.75 

NITSCHE, SUSAN K CLERK TYFIST (DISTRICT OFFICE) 2,300.01 

NYBAN, DAVID D DISTRICT OFFICE BANAGER 3,700.01 

PETERSON, CAROL R DISTRICT REPRESENTATIVE 336.75 

VAN EGBOND,ALAN E LEGISLATIVE ASSISTANT, FROB SEP 1 1,916.67 

VANNOSTRAND,JIB P PRESS ASSISTANT 6,700.01 

VEDELLA.AHN BARIE DIST RECEPTIONIST, FROB AUG 1 TO AUG 31 150.00 

YADEN, DAVID V ADMINISTRATIVE ASSISTANT 8,756.25 

OFFICE OF HON. DAVID R BOBEN 

FREDERICK, R GAY CASE BORKEE E RESEARCH ASST 4,175.01 

GOEHRING,HARY KIRK CASE WORKER/SECRETARY 3,750.00 

HAYDON, RICHARD B STAFF ASSISTANT, FROB SEP 22 75.00 

HENRY, JOHN HUGH AEBIN ISTR ATIVE ASSISTANT 8,750.01 

JEFFREYS, PETHA SLAY PEFSCNAL SECRETARY 3,750.00 

LAFORGE,BILLIAH N RESEARCH ASSISTANT 4,500.00 

LOVORN, BONNIE ESTELLE SECRETARY 2,375.01 

MATTOX,BILLIAH C LEGISLATIVE AIDE 5,166.67 

MERIDZTH, DAVID L LBJ CONGRESSIONAL INTERN, TO JUL 14 275.33 

BYLES, HENRY A FIF.Lt REPRESENTATIVE 5,199.99 

ORLANSKY, STEVEN D STAFF ASSISTANT, TO JUL 31 500.00 

PERKINS, JOHN B PRESS ASSISTANT 6,624.99 

SLEVIN, MICHAEL STAFF ASSISTANT 1,500.00 

STACY, BILLIAB B FIELD REPRESENTATIVE '. 8,499.99 

STONE, NORA F STAFF ASSISTANT, TO AUG 31 1,000.00 

THOMAS, LURLINE F SECRETARY 2,700.00 

THOMPSON, FRANCES ANN SECRETARY 3,375.00 

TUMLINSON,EVA T STAFF ASSISTANT, FROM SEP 1 500.00 

BILLMHS, DAVID A, III STAFF ASSISTANT, FROM AUG 1 TO AUG 31 500.00 



OFFICE OF HON. JOHN BBADEHAS 



3ANEY, SUSAN ANN 
BRENNAN, PATRICIA E 

BRODIE, JOSEPH E 
BYRD, PHYLLIS A 
GASEOR, FRANCES 
GILLESPIE, ELE8E 
GILLESPIE, MARY K 
GRIFFIN, JOAN M 
HOROBITZ, RICHARD ^ 
JACKSON, CHARLES B 



SECRETARY 2,250.00 

INTERN, FROM SEP 16 

LBJ CONGRESSIONAL INTERN, TO AUG 19 1,063.67 

INTERN, FROM SEP 1 433.33 

CASEBORKER 2,124.99 

INTERN, TO SEP 15 1,100.00 

CLEFK 3,125.01 

CASEBORKER 4,500.00 

INTERN, FROM SEP 16 100.00 

LEGISLATIVE ASSISTANT 5,625.00 

INTERN, TO AUG 31 750.00 



40 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. JOHN BRADEMAS -CONTINUED 



KATZ.MARLENE E ASSISTANT FIELD REPRESENTATIVE $ 3,367.50 

KERESZTESI, CHERYL A SECRETARY 3,132.00 

BEYERS, BRIAN D INTERN, TO JUL 31 350.00 

MOORE, DONALD A SPECIAL ASSISTANT 5,199.99 

NIMTZ, VICKIE JEAN ■ SECRETARY 3,750.00 

OCONNOR.JOHN JOSEPH, JR ' STAFF ASSISTANT 3,125.01 

OSANN, SUSAN M LEGISLATIVE SECRETARY 3,624.99 

RIGNEY.PAUL ROBERT, JR FIELD REPRESENTATIVE 5,000.01 

ROEMER, TIMOTHY J INTERN, FROM AUG 16 TO SEP 15 500.00 

SULLIVAN, FRANK, JR EXECUTIVE ASSISTANT 8,374.99 

TIM0NEY,J0AN M RECEPTIONIST 2,799.99 

VUCKOVICH, JULIE ANNE CASEWORKER 2,87U.99 

OFFICE OF HON. JOHN B BREAUX 

BOUDREAUX, JAN CLAIRE DISTRICT ASSISTANT 2,489.70 

BRANCH, SANDRA B PRESS SECRETARY, TO SEP 9 2,812.95 

CORDOVA, RAYMOND C DISTRICT ASSISTANT 6,499.86 

FITZGERALD, MILDRED P CASEWORKER 3,511.80 

GUIDRY,NARY D APPOINTMENTS/RECEPTIONIST 1,800.00 

HALL, JANE S . STAFF ASSISTANT 2,874.99 

HENAGAN, CLAUDIA L PERSONAL SECRETARY, TO AUG 16 2,172.23 

JONES, LLOYD G DISTRICT ASSISTANT 5,902.92 

MAHANEY.MARY E STAFF ASSISTANT, FROM AUG 3 1,611.11 

MANUEL, ROLAND A DISTRICT ASSISTANT 5,209.67 

MARMILLION.VALSIN A AEM IN 1ST R AT IV E ASSISTANT 9,000.00 

MCREE, DIANE B STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT, FROM AUG 5 4,324.23 

MOSES, NORMA F PERSONAL SECRETARY, FROM AUG 21 2,636.11 

PETERSON, ALICE MARIE LEGISLATIVE ASSISTANT 3,780.00 

ROSS, WENDY A STAFF ASSISTANT 3,038.20 

SHAHEEN, SHARON LEJ CONGRESSIONAL INTERN, TO JUL 31 500.00 

WALL,D KEITH STAFF ASSISTANT, TO JUL 31 500.00 

WHITE, VERONICA STAFF ASSISTANT, TO JUL 31 916.67 

ZAUNBRECHER.R L,JR LEGISLATIVE ASSISTANT 4,143.72 

OFFICE OF HON. JOHN BRECKINRIDGE 

BACHMAN, KATHRYN M TO AUG 14 1,266.62 

BARRETT, MARY P RECEPTIONIST, FROM SEP 3 976.33 

BURRELL, MARTHA ANN RESEARCH ASSISTANT 3,979.33 

CASHER, ROBERT E,JR 1,741.67 

CHANDLER, ALAN C PRESS ASSISTANT 3,375.00 

CHEATHAM, ANNE W FROM SEP 16 1,135.36 

CHWAT.JOHN STEVEN LEGISLATIVE ASSISTANT 4,374.99 

DANNENHAVER, MERCEDES SECRETARY, TO JUL 15 393.12 

DINSMORE, PATRICIA P FROM JUL 16 TO JUL 31 

FRCM SEP 1 3,000.00 

GARRISON, FLORIDA R FROM AUG 17 TO AUG 31 1,251.60 

GERDING, JANET STAFF ASSISTANT 3,100.01 

GIOLITO, CAROLYN H ADMINISTRATIVE ASSISTANT, TO JUL 31 

EXECUTIVE SECRETARY, FROM AUG 1 TO SEP 2 .... 3,249.73 

HAMILL, JANET RECEPTIONIST, FROM JUL 16 TO AUG 31 1,319.27 

HERIOT,LORENE E CASEWORKER 4,021.00 

INGRAM, PATRICIA SECRETARY 1,875.00 

MC CALL, MARY F SECRETARY, FROM AUG 15 1,520.00 

MCGLOTHLIN, PATRICIA ANN RECEPTIONIST, TO JUL 15 1,000.00 

MIRACLE, BRADY A DISTRICT DIRECTOR 3,840.43 

MORRISON, CHARLES DAVID LBJ CONGRESSIONAL INTERN, TO AUG 31 1,180.00 

MYERS, CHRISTOFHER A LEGISLATIVE ASSISTANT, TO JUL 22 

LEGISLATIVE ASSISTANT, FROM AUG 16 TO AUG 31 .. 1,397.75 

NOLLER,CARL W TO JUL 31 1,445.00 

0' NEILL, TIMOTHY P LEGISLATIVE ASSISTANT, FROM AUG 1 2,229.98 

PETTY, DUVORIA M SECRETARY 3,125.00 

QUINN, SHARON M SECRETARY 1,825.01 

WEISS, RANDY LEGISLATIVE CORRESPONDENT 2,750.00 

WEISSINGER, HELEN P STAFF ASSISTANT 3,499.99 

OFFICE OF HON. JACK BRINKLEY 

BIGGERS, CATHERINE P FILM LAB TECHNICIAN, FROM SEP 12 471.00 

CASON, SARAH ALICE SECRETARY (DISTRICT OFFICE) 2,146.41 

CHEEK, ANNE JUDSON RESEARCH ASSISTANT, TO SEP 11 

PRESS SECRETARY, FROM SEP 12 3,774.55 

CLARK, LYNN K SECRETARY 3,125.01 



41 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. JACK BBINKLEY -CONTINUED 



DUNCAN, SUSAN B 
FAIBBELL, BARBARA A 
FORT,R C 
HOBARD.ANGELINE 
JENKINS, GENE B 
MILES, DOROTHY H 
NAVE, NAN L 
PATE,JOANITA S 
PAYNE, JULIA H 
PEED,KIB L 
RAILEY, HILDA B 
REID,JOHN DANIEL, JB 
SBEENEY, ROBERT D 
BADE, ROBERT TISON 
BHEELER, LARBY H 
BUTE, ROTH A 
BRIGHT, CHARLES T 



INTERN, FROM AUG 8 TO SEP 8 $ 609. 6.6 

INTERNSHIP, FROM JUL 5 TO JUL 31 511.33 

PRESS LEGISLATIVE ASSISTANT., TO SEP 11 5,536.37 

SECRETARY 3,800.10 

LBJ CONGEESSIONAL INTEBN, TO JUL 3 59.00 

EXECUTIVE SECRETARY «,953.21 

SECBETABY, TO ADG 31 2,320.2« 

SECRETABY 2.6U1.71 

DIST COORDINATOR 2,641.71 

INTERN, FROM AUG 1 TO ADG 31 590.00 

SECRETARY-DISTRICT OFFICE 1,536.30 

STAFP ASSISTANT 2,6«1.71 

DISTRICT REPRESENTATIVE «, 953. 21 

SPECIAL ASSISTANT 3,000.00 

ADMINISTRATIVE ASSISTANT 10,183.75 

CASEWORKER U, 169. 67 

RESEARCH ASSISTANT, FROM SEP 1 1,160.08 



OFFICE OF HON. BILLIAH N BRODHEAD 



ANDERSON, MICHAEL 
BOXALL, JAMES A,JB 
BBICKE9, PAOL L 
BBODOBICZ.E IRENE 
CANTBELL,MARY FRANCES 
CLUGSTON, SUZANNE 
CRAYTON, THERESA 
DAMSKEY, DIANE C 
DEBOARD,MARY CABOLINE 
FOLTZ, MARGARET ELAINE 
JODRDAN,DANIEL J 
JOUBDAN,JOHN PHILLIP 
OGDEN.ANNA LOUISE 
SCHELBLE.JOHN D 
THORNTON, PATRICIA M 
VARGO, JUDITH C 
VILLENEUVE.THERESE A 
BIENER.BICHARD N 



STAFF ASSISTANT 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT 

SECRETARY, TO SEP 5 

SECRETARY 

STAFF ASSISTANT 

STAFF ASSISTANT 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

STAFF ASSISTANT, FROM SEP 1 

RESEARCH ASSISTANT 

INTERN, FROH SEP 1 

AEHINISTBATIVE ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

AEMINISTRATIVE ASSISTANT 

STAFF ASSISTANT , 

INTEBN 

STAFF ASSISTANT 



750.00 
,U99.99 
,«17.50 
,016.00 
,897.00 
,U00.00 
,751.00 

590.00 

663.00 
,500.00 

100.00 
,909.00 
,680.01 
,311.00 
,500.00 
,385.00 
,000.00 
,000.00 



OFFICE OF HON. JACK BROOKS 



BATES, HONIK1 I 

BBOBN, ELIZABETH METTS 
CAHVER,HABJOEIE C 
FLEISCHHANN.DRUENETTE 
HANSEN, JANE S 
HARDESTY, BRUCE R 
HEUER.GARY BAYNE 
HEUER,MARY VIRGINIA 
KING, JEAN COBBLE 
LEBIS,DORETHEA E 
HATTS, DOROTHY SHARON 
HAYS, PAMELA ANN 
PETEBSON,HABY CLABE 
ROSE, CHARLES ALAN 
SNOB,GEBARD C 
BESTERLAGE,SHEBBILL A 
WOZNIAK, PETEB 



TO JUL 31 .. 
FRCH AUG 5 

FBOH SEP 1 

CLEBK 

CLEBK 

TO AUG 31 .. 

FBOH SEP 13 



388.88 
000.00 
981.21 
675.00 
52U.16 
625.00 
628.98 
000.01 
750.01 
875.01 
U69.00 
750.01 
550.00 
260.00 
000.01 
12U.99 
91.00 



OFFICE OF HON. BILLIAH S BBOOHFIELD 



CHAPMAN, MARILYN 
COMER, NANCY G 
GAVITT, BARBARA A 
RAAN.EDBARD L 
JOHNSON, KATHLEEN I 
LOHAX, HELEN L 
LOHAI,BILLIAB L 
NAKAHUBA,KENNON H 
SINCLAIR, C GOBDON 
SINCLAIR, JOHN R 
TOHAN.THOHAS L 
TOPPING, LOUISE H 
BEBBER,JEANNETTE B 



SECBETABY 

PEESCNAL SECBETABY 

SECBETABY 

DISTBICT BEPBESENTATIVE . 

SECBETABY 

CASEBOBKER 

CLEBK 

LEGISLATIVE ASSISTANT ... 

CLEBK 

ADMINISTRATIVE ASSISTANT 
DISTBICT OFFICE MANAGER . 

SECBETABY 

LEGISLATIVE SECBETABY ... 



,596.03 
,U99.99 
,525.01 
,096.61 
,750.01 
,824.99 
590.97 
,750.00 
,625.01 
,375.00 
,7l»9.99 
,125.01 
,375.00 



42 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. CLARENCE J BECWN 

BOLTON, JOHN SOGER RESEARCH ASSISTANT, TO AOG 31 $ 

PRESS AIDE, FROM SEP 1 

GANO, VIRGINIA C RECEPTIONIST, TO AOG 31 

SECRETARY, FROM SEP 1 

HARPER, CAROLYN RENEE CASEWORKER, TO AOG 31 

SECRETARY, FROM SEP 1 

HARPSTER, MARGARET EXECOTIVE SECRETARY 

HASSETT, HOLLY RESEARCH ASSISTANT LEGISLATION, TO ADG 31 

LEGISLATIVE ASSISTANT, FROM SEP 1 

KING, WAYNE R DISTRICT SECRETARY 

LATSKO, SUSAN L INTERN, TC JUL 31 

L0NG,L0VEAUGHN P SECRETARY 

MCINTIRE, JAMES D ADMINISTRATIVE ASSISTANT 

MILLER, MARGARET K CASEWORKER 

MOORE, WILLIAM D CLERICAL ASSISTANT 

OLIVER, EVELYN M. INTERN, TO AUG 27 

STILLINGS,LISA ANN SECRETARY 

STOEBING, SUSAN G SCHEDULING SECRETARY 

TORNBOLL,LYNN SECRETARY 

WARBINGTON, FRANK DISTRICT SECRETARY 

ZAPPASODI, LINDA M SECRETARY 

OFFICE OF HON. GARRY BROWN 

BAKER, BETSY B LBJ CONGRESSIONAL INTERN, TO AUG 19 

BLANKENSHIP, LARRY S LEGISLATIVE CORRESPONDENT 

BBDNNER, MICHAEL E LEGISLATIVE ASSISTANT 

CROSS, PATRICIA LEE RECEPTIONIST 

DELONG,DEANNA LEE PERSONAL SECRETARY 

FABIANO,SOSANNE H DISTRICT OFFICE SECRETARY 

HARRISON, JOSEPH W RESEARCH ASSISTANT 

HART,SHERRIL PICCO CASEWORKER SECRETARY 

HOWARD, ALYCE V SECRETARY 

LAMPMANN,JOHN W. ADMINISTRATIVE ASSISTANT 

MANDRELL, JAMES B DISTRICT REPRESENTATIVE 

MAWBY, DAVID F CLERK, TO SEP 12 

MORAN, MARGARET JANE SECRETARY 

SHELL, GORDON H. PRCEUCTICN ASSISTANT, FROM AUG 1 

YOHN,SHELIA ANN CLERK TYPIST 

OFFICE OF HON. GEORGE E BROWN JR 

CARTER, WILMER D OFFICE MANAGER-DISTRICT 

FERRI, MARILYN ROSE CLERK 

GARCIA, PAULINE ALBISO COMMUNITY REPRESENTATIVE 

GOODWIN, LUTHER A LEGAL CONSULTANT 

GOMIENNY, PATRICIA A SECRETARY 

HESTER, PATRICIA C LEGISLATIVE ASSISTANT, TO AUG 31 

LEGISLATIVE ASSISTANT, FROM SEP 5 

HILINSKI, PAMELA DISTRICT REPRESENTATIVE, FROM AUG 3 TO AOG 31 

IVERSON, PORTIA RECEPTIONIST-CASE WORKER, TO AUG 10 

SECRETARY-RECEPTIONIST, FROM SEP 26 

JOHNSON, EDWARD R CONGRESSIONAL ASSISTANT 

KAKESAKO, SUSAN M S LEGISLATIVE ASSISTANT, FROM SEP 19 TO SEP 23 .. 

KIMBALL, JOHN A STAFF ASSISTANT 

LONDON, BONNIE ESCOBAR SECRETARY 

LONGVILLE,JOHN K,JR PRESS SECRETARY 

LYNCH, TIMOTHY B FIELD REPRESENTATIVE 

MEEK, ELSIE H AEMINISTB ATIVE ASSISTANT, TO AOG 2 

MINICK, BOBBY G DISTRICT ADMINISTRATOR 

MOSS, THOMAS H SCIENCE CONSULTANT 

STILES, WILLIAM A,JR LEGISLATIVE ASSISTANT 

TURNBULL, GEORGE JAMES LBJ CONGRESSIONAL INTERN, TO AUG 12 

WHEELER, PEGGY LEGISLATIVE AIDE 

ZARATE,JOHN FIELD REPRESENTATIVE 

OFFICE OF HON. JAMES T BROYHILL 

ASMUS,SOSAN ELIZABETH STAFF ASSISTANT 

BRYANT, DENISE CLERK TYPIST 

BORKE, SALLY J OFFICE MANAGER 

CLAYTON, MARY LYNN PERSONAL SECRETARY 

CLEMENTS, BARBARA A SECRETARY 

DAWSON, WILMA P SECRETARY 

FOREMAN, ROBERT DENNIS LEGISLATIVE ASSISTANT 



U, 625. 00 

3,179.93 

3,092.57 
8,903.40 

2,958.33 
6,694.41 
575.00 
3,406.98 
7,234.49 
3,144.90 
1,580.85 
1,223.60 
1,965.51 
2,958.33 
2,010.38 
6,401.43 
3,020.83 



963.67 
,750.00 
,049.99 
,525.01 
,500.01 
,075.01 

500.01 
,825.00 
,875.01 
,000.01 
,875.00 
,416.00 
,575.01 
,397.74 
,649.99 



3,300.00 
2,550.00 
2,100.00 
5,325.00 
2,400.00 

3,600.00 
300.00 

780.00 
2,775.00 

201.39 
2,343.51 
3,000.00 
3,600.00 
3,562.50 

593.89 
7,200.00 
8,775.00 
2,359.99 

826.00 
3,450.00 
4,575.00 



2,208.33 
2,227.65 
5,750.01 
4,586.31 
4,125.00 
1 ,437.51 
3,750.00 



43 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. JAMES T BROYHILL -CONTINUED 



GRENIER, CAROLYN E 
HILLINGS, JOANN 
HOGHET, ALICE LYN 
KIMBERLI N.JOSEPHINE 

KNIGHT, PATRICIA 
HAUNEY,HARY K 
O'CONNOR, DIANE MARIE 
RICHEY,DEENA HABIE 
ROSCOE, JERRY PIXLEY 
TRIMBLE, NARY H 
WILLIAMS, MARIANNE C 
WILSON, DONALD T 



STAFF ASSISTANT, FROH SEP 1 $ 

STAFF ASSISTANT 

STAFF ASSISTANT, TO ADG 13 

SECRETARY, TO AOG 31 

STAFF ASSISTANT, FROH SEP 1 TO SEP 26 

STAFF ASSISTANT 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

SECRETARY, TO AUG 24 

STAFF ASSISTANT, FROH SEP 19 

STAFF A I IE 

CASE WORKER 

SECRETARY 

ADMINISTRATIVE ASSISTANT 



708.33 
,499.99 
8U5.67 

,038.33 
,125.01 

590.00 
,<417.50 

283.33 
,750.00 
,800.10 
,345.58 
,352.13 



OFFICE OF HON. JOHN BUCHANAN 



APPLE, JAMES TERRY 
BOWERS, CURTIS R 
BOYD, ELIZABETH D 
BUTLER, WALTER C 
CARROLL, JUDY D 
CHRISTIE, MARTIN WILLIAM 
CLOHAN, WILLIAM C 
COTTON, JAHES A 
DAPT, THOMAS E 
DONINICK, VIRGINIA I 
GOLDEN, CAROLYN R 
HUNTER, LIS A LEE 
KIDD.OLEY C 
LEONARD, KA YE C 
NANN,JANEAN L. 
MCCABE, WILLIAM MICHAEL 
MITCHELL, KEVIN P 
MURPHY, KENNETH R 
PHILLIPS, ANNE S 
ROGERS, ED MAURICE 
SHACKLEPORD,KARLA S 
SHERRY, BARBARA A 
STEEN,KATHY A 
SULLIVAN, CATHY D 
SUMMERS, CORAL DENISE 
WILSON, MEREDITH 



ADMINISTRATIVE ASSISTANT 

STAFF ASSISTANT, FROM SEP 12 

STAFF ASSISTANT 

STAFF ASSISTANT 

SECRETARY 

LEGISLATIVE AIDE 

LEGISLATIVE ASSISTANT 

FIELD REPRESENTATIVE 

PRESS ASSISTANT 

STAFF ASSISTANT, FROH AUG 1 TO AUG 31 

EXECUTIVE ASSISTANT 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 

FIELD REPRESENTATIVE, FROM SEP 1 

RESEARCH ASSISTANT, TO ADG 31 

LEGISLATIVE COUNSEL 

STAFF ASSISTANT, FROM SEP 1 

STAFF ASSISTANT, FROM AOG 1 TO ADG 31 

STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT, TO JUL 31 

LBJ CONGRESSIONAL INTERN, TO JUL 31 ... 

STAFF ASSISTANT, TO JUL 31 

CHIEF CASE WORKER 

LEGISLATIVE AIDE, FROM SEP 6 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT, FROH AUG 1 TO AOG 31 
PERSONAL SECRETARY TO THE CONGRESSMAN . 



,926.68 

79.17 

,930.00 

874.92 

,109.92 

,499.99 

,250.00 

,888.86 

,776.00 

201. 17 

,289.55 

590.00 

250.00 

,601.47 

,026.74 

950.00 

590.00 

300.00 

590.00 

590.00 

590.00 

,192.92 

833.33 

,508.20 

590.00 

,249.99 



OFFICE OF HON. CLAIR W BURGENER 



BEYER, BARBARA H 
BOATRIGHT,REED H 
COHPTON, HARRY 
GILLENWATEBS,JAYNE E 
GREEN, MAXINE WISE 
HEALEY, BARBARA JEAN 
HELHER, ELIZABETH J 
KROGH- BERTS AH, LINDA 
LANG, MARGUERITE 
MC CRACKEN, DAVID E 
HILEY, SAMUEL ALLEN 

MIRIELLO, BARBARA A 
RANDOLPH, R SEAN 
RINALDI, PATRICIA V 
SCHNEIDER, BARBARA H 
SMITH, PATRICIA N 
STPASSBURGER, CAROL H 
THOMAS, STEVEN J 
WILLIAMS, JOANNA RUTH 



OFFICE OF HON. 

BELCHER, DAURENE 
BLACKBURN, LOIS 
CAMPBELL, GERALD L 
DEXTER, CAROL A 

FINK, BENJAMIN W 
GREENSPUN, DIANE 



CASEWORKER 4,283.76 

LEGISLATIVE ASSISTANT 6,249.99 

ADMINISTRATIVE ASSISTANT 10,183.74 

PERSONAL SECRETARY 4,364.25 

DISTBICT REPRESENTATIVE 6,465.99 

SECRETARY 3,770.01 

CLERK, FBCH JUL 5 TO AUG 14 933.34 

CLERK, FROM SEP 19 173.33 

SECRETARY 3,125.01 

CLERK, TO AUG 26 1,306.67 

CLERK, TO AUG 5 

LBJ CONGRESSIONAL INTERN, TO AUG 5 816.66 

CLERK, FROM SEP 19 173.33 

RESEARCH ASSISTANT 3,750.00 

SECRETARY 3,362.25 

SECRETARY 2,276.49 

SECRETARY 3,141.51 

SECRETARY 3,086.01 

CLERK, TO JUL 31 700.00 

SECRETARY 2,388.00 

HERBERT EUBKE 

RECEPTIONIST, FROH JUL 18 1,622.23 

ADMINISTRATIVE ASSISTANT 6,750.00 

LEGISLATIVE ASSISTANT, TO AUG 15 2,250.00 

SECRETARY, TO AOG 31 

DISTRICT SECRETARY, FROH SEP 1 2,216.66 

CLERK 725.01 

LBJ CONGRESSIONAL INTERN, TO AUG 12 826.00 



44 



SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



FROM 



OFFICE OF HON. 



HAMMOND, BARBARA ANN 

HOFFMANN, TAMARA L 

IDE, CHERYL DIANE 
KRAUSEF, ROBERT L 
LEBKICHER, MONICA C 
MCVEIGH, BETTY P 

MONDRES.GINA 
MORRIS,BETTY JANE 
PACKO,ANN MARIE 

PATTON, PENNY E 
PROBST, YVONNE M 
SWAIN, EDITH FRANCES 
TAYLOR, MARY ANN 
BISE, DOROTHY V 



HERBERT BURKE -CONTINUED 



LEGISLATIVE ASSISTANT, TO JUL 31 $ 

LEGISLATIVE SECRETARY, FROM AUG 1 3,416.67 

CLERK, TC AUG 31 

MAG CARE OPERATOR, FROM SEP 1 1,833.33 

SECRETARY-DISTRICT OFFICE 2,083.34 

PRESS AIDE, FROM SEP 19 500.00 

SECRETARY 2,666.67 

CLERK, TO AUG 31 

DISTRICT AIDE, FROM SEP 1 2,958.33 

CLERK, TO JUL 14 272.22 

CLERK, FROM JUL 28 1,137.51 

RECEPTIONIST, TO JUL 31 

APPOINTMENTS SECRETARY, FROM AUG 1 2,166.67 

RECEPTIONIST, TO JUL 26 613.89 

CLERK, TO AUG 31 1,333.34 

CASE80RKER 3,000.00 

CLERK, FROM AUG 15 830.56 

SECRETARY 3,249.99 



OFFICE OF HON. JAMES A. BURKE 



CARP, WILLIAM F 
CRAVEN, TIMOTHY M 
DAGOSTINO.YVETTE R 
DORFMAN,GAIL 
GIAMPA, MARIE R 
HERN, MAUREEN M 
HERRING, ROBERT E 
HINDLE, RONALD E 
KEENAN.JOHN FRANCIS 
KRUSE, KATHLEEN C 
MOORE, EDWARD J 
NEDDER, EDWARD T 
O'BRIEN, PETER A 
PARKER, JACQUELINE BOBBIE 
RYAN, JOHN F,JR 
SNARTZ, DEBORAH 
TUOHY,MARY J 
VAN WART, MARY PHYLLIS 
VENEZIA, STEVEN I 
WALSH, PHILIP P 



CLERK 

APPOINTMENT SECRETARY 

CLERK 

ASST LEGISLATIVE ASSISTANT 

CLERK 

CLERK 

SPECIAL PROJECTS 

CLJRK 

CLERK, TC JUL 15 

AGENCY COORDINATOR 

ADMINISTRATIVE ASSISTANT 

CLERK 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

LEGISLATIVE ASSISTANT 

VETS AFF COORD 

EXECUTIVE ASSISTANT 

ASST TO AEHIN ASST 

CLERK 

CLERK, FROM JUL 16 

CLERK 



,400.01 
,375.01 
,500.01 
,000.00 
,124.99 
,250.00 
,500.01 
,825.01 

145.83 
,750.01 
,750.01 
,750.01 

590.00 
,749.99 
,505.75 
,723.24 
,499.99 
,508.51 

7 29. 17 
,625.00 



OFPICE OF HON. YVONNE B BURKE 



ARCHIE, MARGUERITE J 
BABER, EVELYN M. 
BARMAZEL, STEPHEN W 
BEASLEY, GEORGE 
CONS, MANUEL L 
COWAN, FRANK, JR 
DANKS, MARILYN JOYCE 
DAVIDSON, GLENN K 
FLOWERS, PERCY M 
HILL, BARBARA 
HOWE, SHARON MCINTYRE 
KING, BEVERLY A 
MOODY, KATHLEEN 
MULVANEY, JULIE 
PARKS, PERRY C,JR 
SIMON, DAVID A 
SMITH, SHARON T 
TOMLIN.DELORES M 
YAGER, LYNETTE R 



DISTRICT ADMINISTRATIVE ASSISTANT .. 

SCHEEULING SECRETARY 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

FIELD REPRESENTATIVE 

LEGIS CASEWORKER 

ADMINISTRATIVE ASSISTANT 

CLERICAL ASSISTANT 

STAFF ASSISTANT 

ADMINISTRATIVE AIDE 

CASEWORKER 

LEGISLATIVE ASSISTANT 

PERSONAL SECRETARY 

LEGISLATIVE ASSISTANT 

ADMINISTRATIVE AIDE 

DISTRICT REPRESENTATIVE 

LEGIS ASST/PRESS ASST 

RECEPTIONIST/CLERK TYPIST 

SECRETARY 

SECRETARY/PRESS AIDE 



428.05 
830.41 
590.00 
500.00 
200.00 
500.00 
438.52 
124.99 
937.50 
115.73 
000.00 
126.02 
999.99 
717.35 
344.65 
750.00 
000.01 
100.00 
250.00 



OFFICE OF HON. OMAR BURLESON 



AUER,L0IS ANN 
BEATLEY.NOREEN 

CASALE.ROCCHINA 
CURTIS, JUDITH S 
GBUBBS, WALTER B 
HAUGEN,JOHN A 
HUGHES, LEVENIE ANN 
KING,ARMAN D 



SECRETARY 3, 

OFFICE PAGE, TO AUG 31 

CLERK, FRCM SEP 1 1, 

SECRETARIAL, FROM SEP 19 

ADMINISTRATIVE ASSISTANT 10, 

DISTRICT MANAGER 6, 

CASEWORKER 2, 

PRESS ASSISTANT 3, 

FIELD REPRESENTATIVE 3, 



225. 


00 


215. 


,34 


300, 


.00 


183, 


,74 


748, 


08 


791, 


,66 


3 99, 


,99 


572, 


,46 



45 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. OMAR BORLESCN -CONTINUED 

MAULSBY, PATRICIA A NN CASE BOHK ER/CLERK, FROM JUL 5 TO JUL 15 $ 317.78 

NUNEZ, LILLY TANAS SECRETAHY 3,500.01 

SCHNEIDER, MADELINE A TYPIST 445.53 

SENTENA, CAROL ANN CLERK/TTFIST, FROM SEP 26 111.11 

SIPE, CLAUDIA J SECRETARY 4,705.26 

TALLEY, DOROTHY ELAINE SECRETARY 2,199.99 

TICE, REBECCA CASEBORKER, TO AUG 15 1,375.00 

SALTER, KEN OFFICE AIEE 300.00 

BILSON, CAROL ANN SECRETARY, TO AUG 31 2,208.33 

OFFICE OF HON. BILL D BURLISCN 

BOND, FLORENCE E SECRETARY 2,215.56 

CRANK, JO ANN SECRETARY 1,71*9.99 

DIVERS, HINNA R CASEBORKER 11,083.12 

DRISKILL, JOSEPH L LBJ CONGRESSIONAL INTERN, TO JUL 5 98.33 

DUNSCOMBE, JAMES C FIELD SECEETARY 6,11*9.16 

EVANS, JACK HAMPTON CASEWORKER, TO SEP 5 1,975.33 

KISCHNER, DIANE C CASEBORKER 3,067.83 

PROSSER.LOIS L CLERK 2,170.74 

PRCSSER,HICHAL SUE ADMINISTRATIVE ASSISTANT 10,71*7.1*9 

RHYN2, MILDRED B. SECRETARY 2,573.91* 

TAYLOR, PEGGY SECRETARY 2,121*. 99 

TOOMBS, KAREN R CLEBK 2,221.59 

BALLS, QUEENIE SECRETARY 3,01*9.35 

WATKINS, ANDREW L CLERK-INTERN, TO JUL 31 

CLERK, FRCH SEP 1 1,326.67 

BHITEHURST, SUZANNE CLERK, EBCH AUG 1 1,333.34 

YATES, MARSHALL CASE BORKER 2,995.74 

OFFICE OF HON. JOHN L BURTON 

ANDERSON, SUSAN K STAFF ASSISTANT 2,750.01 

ARNSON, CYNTHIA J STAFF ASSISTANT, TO AUG 31 508.33 

BAGLEI,LYNN L STAFF ASSISTANT, FROM AUG 1 TO AUG 31 833.33 

BEALL, MIRIAM ASSISTANT 3,750.00 

CALVERT, SANDRA STAFF ASSISTANT, FROM JUL 5 6,186.11 

CASEY, CHARLES E STAFF ASSISTANT, TO JUL 31 1,000.00 

ELLIOTT, CHRISTINE, A ASSISTANT 2,400.00 

FURRMAN, JANICE STAFF ASSISTANT, TO JUL 31 1,200.00 

GONZAL3Z,LISA S STAFF ASSISTANT 3,249.99 

GREEN, MARCIA L STAFF ASSISTANT, FROM AUG 15 1,661.67 

HANBUBY, VICTORIA DABN STAFF ASSISTANT, FROM SEP 1 533.33 

JOSEPHSON,CLAUDETTE STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT, FROM SEP 1 4,000.00 

LANSING, MARY STAFF ASSISTANT 4,500.00 

LEE, CHRISTOPHER C STAFF ASSISTANT, FROM JUL 5 3,538.88 

LIM,JEANINE ANN STAFF ASSISTANT 2,400.00 

MAY, JOHN K STAFF ASSISTANT, FROM AUG 1 

LEJ CONGRESSIONAL INTERN, TO JUL 31 1,856.67 

OLMSTED, JOHN SHELDON STAFF ASSISTANT 3,000.00 

PENNESTRI,GINA ASSISTANT 6,300.00 

REED, WILLIAM R ASSISTANT 3,000.00 

ROBINSON, LORETTA STAFF ASSISTANT 3,999.99 

ROGALSKI.BEATRIZ E ASSISTANT 2,750.01 

SCHNEIDER, NARJORIE F. STAFF ASSISTANT, FROM SEP 1 2,800.00 

OFFICE OF HON. PHILLIP BURTON 

DYE, SHARON S STAFP ASSISTANT, TO JUL 31 1,025.00 

ERNSER, BRIDGET DOLORES ASSISTANT 300.00 

GERSH,MARK ASSISTANT 450.00 

GRAY, RAYMOND STAFF ASSISTANT 960.18 

HUMPHRIES, DERRICK A STAFF ASSISTANT, FROM AUG 1 2,000.00 

KENNEDY, SUSAN ASSISTANT 3,500.01 

KIELIGER, FRANK J ASSISTANT 8,750.01 

KIYOTA, ROBERT E ASSISTANT 3,000.00 

LEONG, NANCY B ASSISTANT 4,500.00 

MARTINEZ, HICOMEDES J ASSISTANT 5,049.99 

NAFBI, THERESA MARIE CLERK 2,499.99 

OCONNELL, JOSEPH A ASSISTANT 5,499.99 

ROBERSON,HARY J ASSISTANT 2,750.01 

STRUCK, MYRON STAFF ASSISTANT 3,500.01 

SULLIVAN, GARRETT S LEJ CONGRESSIONAL INTERN, TO AUG 31 1,180.00 

THOMAS, DORIS R ASSISTANT 8,750.01 



46 



SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. PHILLIP BURTON -CONTINUED 



THOMAS, WILLIAM G 
YAMANE, WANDA HABDMI 
YEE, JUDY 



ASSISTANT $ 6,249.99 

ASSISTANT 2,499.99 

ASSISTANT 2,499.99 



OFFICE OF HON. H CALDWELL BOTLER 



AHEKON, SUSAN LEE 
BARRIEB, PHYLLIS H 
BOWMAN, RANDAL RAY 
BROYHILL, JEANNE 
CALCAGNO, ALEXANDRA B 
CALLAN, SHELLY FLEMING 
COOPER III, WILLIAM LEE 
CROWDER, CAMELLIA H 
FOUNTAIN, SYLVIA YEASH 
GILLIS.MONA C 
GOODLATTE, ROBERT W 
HOOVER, MARLENE R 
IRVINE, MICHAEL S 
JAYSON, DONNA W 
JONES, GARY W 

LEWIS, GERALDINE 
MALKIEWICZ, COLLEEN 
MCBRIDE, PATRICIA ANN 
MCKENNA, JOYCE LEE 
MCNEILL, BONNIE GOMP 
RUBY, DONALD W 
SMITH, KATHARINE R 
TAYLOR, DREAMA A 
UNDERBERG,MARK A 
WHISSSN,MARY PRANCES 



PRESS ASSISTANT 4, 875. 00 

STAFF ASSISTANT, TO AUG 29 2,048.61 

STAFF ASSISTANT, FROM SEP 9 550.00 

STAFF ASSISTANT, FROM SEP 19 283.33 

STAFF ASSISTANT 2,250.00 

STAFF ASSISTANT, TO SEP 16 2,111.10 

STAFF ASSISTANT 2,424.99 

DISTRICT SECRETARY 3,187.50 

STAFF ASSISTANT 2,825.01 

LEJ CONGRESSIONAL INTERN, TO JUL 10 196.67 

STAFF ASSISTANT, FROM AUG 29 930.56 

STAFF ASSISTANT 3,875.01 

STAFF ASSISTANT, TO AUG 28 1,973.61 

DISTRICT SECRETARY 2,499.99 

STAFF ASSISTANT, TO JUL 10 

STAFF ASSISTANT, FROM AUG 11 TO AUG 27 621.67 

STAFF ASSISTANT 2,812.50 

STAFF ASSISTANT 2,850.00 

LEGISLATIVE ASSISTANT 4,437.51 

SECRETARY TO CONGRESSMAN 4,299.99 

STAFF ASSISTANT 3,000.00 

ADMINISTRATIVE ASSISTANT 9,000.00 

LBJ CONGRESSIONAL INTERN, JUL 11 - AUG 10 590.00 

STAFF ASSISTANT, FROM JUL 11 TO AUG 10 590.00 

STAFF ASSISTANT, FROM SEP 1 1,250.00 

DISTRICT OFFICE SECRETARY 2,750.01 



OFFICE OF HON. GOODLOE E BYR0^ 



ALONSO, SHIRLEY C 

AMOS, DEBORAH CATHERINE 

BALDWIN, MARTIN JOSEPH 
BARKMAN, MARGARET JANE 
BORLAND, ALBERT S. 
BOWSER, EM MA JANE 
FELDMAN, DEBORAH A 
FREESTONE, KAREN A 
GARDINER, MARY JO 
GOODMAN, SUE C 
MARTZ, BARBARA S 
MCNAMARA, MARGARET G 
PECKHAM, GARDNER G 
PRESBREY, MARTHA R 
PRICE, JOSEPH B,JR 
REID, SCHELLY J 
SCHMITZ,JOHN P 
SELDEN, DAVID A 
WAKEFIELD, KAREN E 
WITT, ROBERT B 



DISTRICT ADMINISTRATOR 

SECRETARY, TO AUG 31 

STAFF ASSISTANT, FROM SEP 1 TO SEP 23 ... 

CLERK 

DISTRICT ASSISTANT 

SPECIAL ASSISTANT 

DISTRICT ASSISTANT 

LBJ CONGRESSIONAL INTERN, AUG 1 - AUG 31 

STAFF ASSISTANT 

DISTRICT ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

DISTRICT ASSISTANT 

STAFF ASSISTANT, FROM SEP 1 

RECEPTIONIST 

FIELE REPRESENTATIVE 

STAFF ASSISTANT 

CLERK, TO AUG 5 

LEGISLATIVE ASSISTANT 

SECRETARY , 

SPECIAL ASSISTANT 



,881.95 
900.00 
,225.01 
,800.00 
,225.01 
590.00 
,583.33 
,261.49 
,624.99 
,250.00 
,882.76 
750.00 
.499.99 
,528.00 
,000.01 
,215.28 
,500.00 
,312. 50 
,500.01 



OFFICE OF HON. BRUCE F dAPDTC 



BONIFER,SHERYL L 
CAULFIELD, DEBORAH 
CHIERCO, PATRICIA 
DEIERLEIN.JOAN CLARE 
DIEFENDER FEB, WILLI AM 
EVANS, DAVID 
FERRANDINA, THOMAS E 
FORTUNE, SARAH 
GAVAGHAN,ANNE MARY 
GUILFOYLE,MARY E. 
GUNNER, JANET 
JACOBS, DEBORAH LEE 
JACONE,HARY E 
JEWETT, ELIZABETH B 
LEGGITT,R B . 
LUDEMAN.LORENA R 



AtHINISTBATIVE SECRETARY 

SECRETARY, TO JUL 31 

DISTRICT ASSISTANT 

DISTRICT OFFICE MANAGES 

COUNSEL/LEGISLATIVE ASSISTANT 

DISTRICT ASSISTANT 

DISTRICT MANAGES 

SECRETARY, FROM AUG 1 

LEGISLATIVE AIDE 

DISTRICT ASSISTANT 

LEGISLATIVE CORRESPONDENT, FBOM SEP 1 
LBJ CONGRESSIONAL INTERN, TO JUL 31 . . , 

SECRETARY 

LEGISLATIVE CORRESPONDENT 

AtHINISTBATIVE ASSISTANT 

PERSONAL SECRETARY 



-249.99 
875.00 
750.00 
,750.01 
,891.67 
,124.99 
,249.99 
500.00 
991.67 
,250.00 
750.00 
590.00 
,250.00 
350.00 
,109.83 
,249.99 



47 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF BON. BRUCE F CAPOTO -CONTINUED 



POWERS, HICBELE 
BEILLY.JANE FENNELL 
TORRET, CHRISTINE A 
TROVATO, LUCIA A 
WALSH, BORNA 



LEGISLATIVE CORRESPONDENT, TO AUG 31 $ 1,500.00 

DISTRICT ASSISTANT 2,250.00 

DISTRICT OFFICE BANAGEB 2,708.76 

DISTRICT ASSISTANT 2,250.00 

DISTRICT ASSISTANT 1,984.10 



OFFICE OF HON. CHARLES J CARNEY 



DURK IN, BRIDGET 
HALECKO, SHIRLEY ANN 
HOFFNANS, PATRICIA A 
JACKSON, RUTH A 
JAEGERHAN, PETERSEN N 
KEYES,THOHAS J.JR 
KIHBELBAN.JAY H 
KOLLAT,DEBRA LYNN 
HICHAEL, SANDRA A 
HICKELSON,KINBEB LEA 
OLA, PHILIP II 
PALHATEER, (CATHERINE A 
PETERSON, PATRICIA ANNE 
FAHP, STEPHEN R 

RYAN, ANN H 
RYAN, DOROTHY ? 
SHEEHAN.PETEE A 
STEVENS, PAUL E 
TILLBAN,JABES B 
HADSHORTH, BARBARA G 



DISTRICT CLERK 

DISTRICT OFFICE SECRETARY 

CASE WORKER 

CHIEF CASE WORKER 

LEGISLATIVE CORRESPONDENT 

ADMINISTRATIVE ASSISTANT 

DISTRICT OFFICE ASSISTANT, TO AUG 31 

DISTRICT OFFICE SECRETARY 

LEGISLATIVE SECRETARY 

SECRETARY 

LEGISLATIVE AIDE 

PERSONAL SECRETARY 

DISTRICT OFFICE SECRETARY 

CCHHUNITY AIDS CASEWORKER, TO AUG 31 

GRANTSHAN, FROB SEP 1 

CLERK TYPIST 

CONSULTANT-SR CITIZEN AFF, FROB SEP 
LBJ CONGRESSIONAL INTERN, TO JUL 31 . 

DISTRICT ADBIN AIDE 

BINORITY REPRESENTATIVE 

RESEARCH ASSISTANT, FROB SEP 1 



000.01 
625.00 
916.66 
249.99 
250.00 

,750.01 
000.00 

,000.01 

,493.05 
000.01 

,000.00 
500.01 
250.00 

291.67 
,374.99 
,000.00 

590.00 
,750.01 
,000.01 
,666.67 



OFFICE OF HON. BOB CARR 

ADDISON, BARY MARGARET 
ARNETT,BIKE 
BARRETT, BARK D 
BESON, BARIE A 
CARTWRIGHT,KENT W 
GLECKBAN, HOWARD 
GRABIAK, NANCY L 
HILLS, KATHERINE H 

KHAN, KATHLEEN L 
KING, JEAN A 
HC CANDLESS, MICHAEL R 
PENNINGTON, JILL A 
PEIJULA, SUSAN H. 
ROBISON,THOBAS C 
SANCHEZ, AHTONIETA 
SCHROEDER,H B W 
SHERBAN, ROBERT 
SIBS.BICHAEL J 
STALLWORTH, KEITH BERNARD 
SWAIN, BEVERLY B 
ZISCHKE.BICHAEL H 



DISTRICT ADMINISTRATIVE ASSISTANT 4,550.01 

PRESS SECRETARY 3,750.00 

LEGISLATIVE ASSISTANT, TO JUL 31 1,397.73 

RECEPTIONIST 2,000.01 

DISTRICT ADBINISTRATIVE ASSISTANT 4,550.01 

LEGISLATIVE ASSISTANT, TO JUL 8 293.52 

RECEPTIONIST 2,499.99 

SECRETARY, FROB AUG 1 TO SEP 6 

LBJ CONGRESSIONAL INTERN, TO JUL 19 1,473.67 

SECRETARY, TO JUL 31 917.26 

LEGISLATIVE CORRESPONDENT 3,302.16 

LBJ CONGRESSIONAL INTERN, AUG 1 - AUG 31 590.00 

OMBUDSMAN 3,000.00 

CASEWORKER 2,751.78 

CASEWORKER 2,857.05 

CASEWORKER 2,889.39 

ADBINISTRATIVE ASSISTANT 6,249.99 

LEGISLATIVE ASSISTANT , 4,957.08 

CASEWORKER 2,751.78 

CASEWORKEB 2,751.78 

PERSONAL SECRETARY 3,265.27 

LEGISLATIVE ASSISTANT, FROB JUL 9 3,008.63 



OFFICE OF HON. TIB LEE CABTER 



ABERNETHY, DAVID S 
ANDERSON, ROBERT E, IV 
ASCHENBACH, DANIEL J 
DEHNEL, KATHLEEN W 
FRANCISCO, ELIZABETH ! 
GOAD, GLENN D 
HABBER, DOYLE B 
HENDERSON, CHARLES V 
HIRES, BARY C 
KIATTA, LOUISE 
BILLER, PATRICIA C 
BORGAH, ROBERT I 
PERKINS, N B 
PETEBCHEFF, DORIS G 
PETERSON, ARLENE B 
PYLES, AARON 
BOBBINS, GDS 



LEGISLATIVE AIDE, FROB AUG 1 

AIDE, FROM SEP 1 

LEGISLATIVE AIDE 

EXECOTIVE ASSISTANT 

SECRETARY, TO JUL 31 

FIELD SECRETARY, FROB AUG 1 

DISTRICT SECRETARY 

SPECIAL ASSISTANT 

LEJ CONGRESSIONAL INTERN, TO AUG 31 

CASEWORKEB 

CASEWORKER 

FIELD SECBETABY 

FIELD SECBETABY 

FIELD SECRETARY 

CASEWORKEB, TO AUG 31 

FIELD SECRETARY 

FIELD SECEETABY, TO JUL 31 

FIELD SECBETABY, FBOB SEP 1 



,500.00 

658. 33 
,536.17 
,295.09 
,289.50 
,050.00 
,613.50 

958.33 
,180.00 

110.90 
,885.54 
,752.37 
,230.51 
,849.75 

870.34 
,427.49 



48 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. TIH LEE CARTER -CONTINUED 



SARTIN, LOUISE 

SCHRABBLING, JOHANNA 
SHARP, JOSH P 
SINCLAIR, KELLY K 
SLAUGHTER, JAMES 
WOOD, JAMES EARL 



FIELD SECRETARY, TO JUL 31 $ 

FIELD SECRETARY, FROM SEP 1 1,881.00 

LEGISLATIVE ASSISTANT 4,666.66 

FIELD SECRETARY, TO JUL 31 798.00 

LEGISLATIVE AIDE 3,166.66 

FIELE SECRETARY, FROM AUG 1 TO AUG 31 801.17 

FIELD SECRETARY 2,007.72 



OFFICE OF HON. JOHN J CAVANAUGH 



BRODERICK.MARK P. 
BROWN, DAVID G 
BURBACH, RICHARD C 
DYKEMA, RICHARD T 
FOGARTY, THOMAS A 
GREGORY, SHARON L 
HANBURY, SANDRA D 
HARPER, IVY 
JANKOVICH,DOREEN H 
KATSKEE, JERRY W 
LEAHY, LOUIS M 
LOFTUS, MICHAEL T 
LOOMIS.GWEN E 
MARQUIS, DEBORAH J 
OHABA.PAUL V 
PERRY, ANGELA E 
REESE, SHERWOOD 
SHAFFRAN,JOAN GLORIA 
TAYLOR, MARGARET A 
TENTINGER, PEGGY A 
THOMPSON, NANCY JANE 
BESSEL, DEBORAH MARIE 



LEGISLATIVE ASSISTANT 3,000.00 

LEGISLATIVE ASSISTANT 3,750.00 

STAFF ASSISTANT, FROM AUG 19 TO SEP 25 822.23 

COMPUTER OPERATOR 2,322.23 

PRESS ASSISTANT 4,500.00 

COMPUTER OPERATOR, FROM SEP 6 729.17 

OFEICE MANAGER 5,000.01 

RECEPTIONIST 3,000.00 

LBJ CONGRESSIONAL INTERN, TO AUG 31 1,180.00 

DISTRICT OFFICE MANAGER, TO JUL 31 1,250.00 

LOCAL DISTRICT REPRESENTATIVE 4,374.99 

STAFF ASSISTANT, TO JUL 31 541.67 

SECRETARY, TO SEP 15 1,812.50 

STAFF ASSISTANT 2,250.00 

ADMINISTRATIVE ASSISTANT 8,490.00 

CONSTITUENT AIDE , 2,000.01 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 500.00 

STAFF ASSISTANT, TO JUL 31 500. OC 

CASEWORKER 2,000.01 

PERSONAL SECRETARY 3,000.00 

STAFF ASSISTANT 1,925.01 

CLERK, FROM SEP 26 20.00 



OFFICE OF HON. ELFOHD A CEDERBERG 



BECKER, LARRY B 
BLEECKER,L¥NN G 
FIELDING, ELIZABETH H 
FORGASH, JUDITH L 
FORGASH, MICHAEL A 
PRANKEL, MARGARET L 
GRETHER.CATHLEEN H 
MARCK, MARGARET E 
HARKWOOD, JAMES S 
ORTIZ, BONADONNA 
ROSENBERG, RACHELLE 
SCHWEIGERT, ESTHER N. 
SMITH, ELIZABETH E 
SPARLING, TABRA 
STOLZ.DORATHA E 



CLERK 4,402.86 

SECRETARY 2,620.74 

SECRETARY 3,750.00 

CLERK 1,374.99 

ADMINISTRATIVE ASSISTANT 11,874.99 

PROJECT ASST 4,402.86 

CLERK 1,500.00 

CLERK, TO AUG 31 1,400.00 

CLERK 4,402.86 

SECRETARY 4,127.49 

EXECUTIVE SECRETARY 4,358.33 

CASEWORKER 4,127.67 

SECRETARY 1,651.08 

CLERK 2,499.99 

DISTRICT LIAISON 5,850.00 



OFFICE OF HON. BILL CHAPPELL JR 



ADAHICH.BARY 
ABES, LAURIE L 
BLAIR, RUTH K 
BOWMAN, BARBARA ANN 
DENSON,JOHN J 
DIMSEY.MAFY JULIET 
EDWARDS, TED 
HENLINE,RUTH ANN 
HINDS, KRISTIN G 
KEMP, BARBARA JOAN 
KINSEY, ROSEMARY B 
KLINZING, MELISSA 
BATTHEWS, HERBERT S 
NICHOLS, TODD C 
OTTO,BERTON R 
RHODES, BARGARET C 
STANSFIELD.MARY JO 
STOKLEY, CAROLYN 
STOUT, EDWARD N 
SULLIVAN, SALLIE KATHLEEN 
THAYER, BADALIN J 



SECRETARY 

LEGISLATIVE CORRESPONDENT 

SECRETARY 

LEGISLATIVE ASSISTANT 

FIELD REPRESENTATIVE 

CASE WORKER 

LBJ CONGRESSIONAL INTERN, TO AUG 31 ... 

PERSONAL AIDE, FROB AUG 22 

PUELIC RELATIONS ASST 

SECRETARY, FROM AUG 1 TO AUG 31 

SECRETARY 

RECEPTIONIST, FROM SEP 6 

ADMINISTRATIVE ASST/EXECUTIVE 

LEGISLATIVE CORRESPONDENT, FROB SEP 25 

PUBLIC RELATIONS RESEARCH ASST 

LEGISLATIVE ASSISTANT, TO SEP 24 

DIR-EAYTCNA BEACH DIST OFFICE 

DIRECTOR-OCALA DISTRICT OFFICE 

LEGISLATIVE AIDE 

RECEPTIONIST, TO SEP 5 

DIR-JACKSONVILLE DIST OFF, TO JUL 31 .. 
DIH-JACKSCNVILLE DIST OFF, FROB SEP 1 



625.00 
625.00 
075.01 
624.99 
325.00 
000.00 
180.00 
529.17 
999.99 
916.67 
375.01 
666.67 
183.74 
241.75 
500.00 
800.00 
325.01 
249.99 
476.99 
733.33 



49 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. BILL CHAPPELL JR -CONTINUED 



TOLLY, DIANA K 
WILLIAMS, CHARLES J,JR 



SECRETARY, TO AOG 21 $ 2,054.16 

LEGISLATIVE CORRESPONDENT 2,625.00 



OFFICE OF HON. SHIRLEY CHISHOIH 



BUTLER, HELEN C 
C0LE,E0PHE(1IA A 
DOREN.ARLENE E 
DUFTY,BEVAN 
GREEN, MARITA GAIL 
HARHON, ROSALIND C 
HARWELL, BRENDA RENEE 

HERON, BELITA A 
HOLDER, WESLEY « 
MURPHY, LAORA B 
OCONNOR, COLLEEN A 
PHILLIPS, JANICE R 
PUGH, MURIEL H 
ROBERTS, JOYCE R 
ROBLES, VICTOR L 
SIMMONS, ANDREA T 
SMITH, CAROLYN J 
STEFANIZZI, NICHOLAS 1 



GRANT SPECIALIST 

SECRETARY 

STAFF ASSISTANT 

SECRETARY, TO AOG 31 

CLERK, FRCH AOG 1 

CLERK, FRCH ADG 13 TO SEP 16 

LBJ CONGRESSIONAL INTERN, TO AOG 12 
LEGISLATIVE AIDE, TO SEP 6 

LEGISLATIVE AIDE 

LEGIS SECY PRESS, TO JOL 26 

CLERK 

LEGISLATIVE ASSISTANT, FROM SEP 12 . 

RECEPTIONIST 

ASST DISTRICT REPRESENTATIVE 

CASEWORKER 

EXECUTIVE ASSISTANT 

STAFF ASSISTANT 



,37U.99 
,500.01 
,500.01 
,999.99 
,096.60 
,833.33 

,494.67 
,841.67 
,683.76 
,500.01 
,300.00 
750.00 
,108.33 
,625.00 
,250.01 
,125.00 
,370.00 
,374.99 



OFFICE OF HON. DON H CLAOSEN 



BALL, SANDRA LEE 

BAEKSDALE, TRUDY MATTHES 
BOVARD,J0HN O 
COMST0CK,KATHRYN FIORI 
EDWARDS, JEAN R 
GRAVES, W LARRY 
BASKIN,ELNEE G,JR 
KING, LOIS E 
OSBORNE,DIANA J 
PRESKITT, CAROL W 
REITBAN, VALERIE H 
ROBERTS, JEFFREY B 
ROIH, CONSTANCE 
SCHLAX,KRISTA 
SETTLE, PETER H 
SHEA, CYNTHIA JO 
TIPPIT,OTIS GORDON 
YATES, NADINE SANDERS 
ZANDER, BELINDA 



PERSONAL ASST, TO JOL 31 

ASSISTANT, FROM AOG 1 

ASSISTANT 

ASSISTANT 

ASSISTANT, FROM SEP 26 

ASSISTANT 

ASSISTANT 

DISTRICT ASSISTANT 

ASSISTANT 

ASSISTANT 

ASSISTANT 

ASSISTANT, TO AOG 31 

LEJ CONGRESSIONAL INTERN, TO JOL 31 

ASSISTANT 

ASSISTANT 

ASS 1ST ANT , 

ASSISTANT • 

ASSISTANT i 

ASSISTANT 

ASSISTANT 



,a02.38 
,096.61 
,a01.32 

131.94 
,250.01 
,617.83 
,705. 1U 
,1*97.32 
,144.90 
,113.36 
,200.00 

590.00 
,898.98 
,500.00 
,499.99 
,8U9.99 
,21*9.99 
,828.59 
,100.00 



OFFICE OF HON. DEL CLAWSON 

BARBER, ROBERT JULIAN 
BISSET, KRISHNA 
BISSET, SHEILA M 
CHARLES, ANITA S 
COLLERAN, BETTY G 
FLORES, HAZEL SAHAGUN 
GLEASON, EUGENE A 
GREENAWALT,RUBY JANE 
H0DSON,NINA 
LOVELESS, CHERYL J 
MANICONE, MICHAEL 
NGUYEN, LOC THE 
SELL ECK, JEFFREY 
SMITH,VILDA B 
SWAIN, ANNE BENNETT 
THOMAS, PETER C 
WEBER, JUNE C 



COMMUNICATIONS ASSISTANT 3,000.00 

CLERK 3,000.00 

CLERK, TO SEP 12 1,300.01 

AEMINISTRATIVE ASSISTANT 10,183.74 

CLERK 2,795.46 

CLERK 2,349.99 

LEJ CONGRESSIONAL INTERN, JOL 13 - AOG 12 590.00 

3,462.51 

CLERK 2,625.00 

CLERK 2,250.00 

CLERK 3,511.80 

CLERK 3,275.94 

LEJ CONGRESSIONAL INTERN, TO JOL 12 236.00 

5,874.99 

CLERK 1,950.00 

CLERK, TO JOL 31 583.33 

CLERK 4,374.99 



OPFICE OF HCN. WILLIAM CLAY 

ALTEHUS.VICKI LESLIE 
BASS, JOHN F 
BOGDAHOVICH.MICBELE L 



OFFICE ASSISTANT 

DISTRICT REPRESENTATIVE , 

OFFICE ASSISTANT, FROM AUG 1 TO AUG 31 



1,299.00 
2,994.20 
1,000.00 



50 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. WILLIAH CLAY -CONTINUED 



EDWARDS, WILLIAB D 
EVANS, PEAELIE 
GILBERT, JOAN G 
GILES, CABLA G 
GILES, GWENDOLYN 
GILLESPIE, GLORIA J 
HATTON, BEATRICE AHELIA 
JODE, BADGE II 
BASSEY.EDWILLA L 
HCCALL/EDNICE P 
MOORE, PBILIP H 
PATTON, ERNESTINE 
SCHWARZ, BEVERLY J 
SEARCY, FREDERICK C 
TALTON.ALFREDA 
TATOB,ROSE 
TOLLETT, JACQUELINE S 
TYUS.HARIE H 
WALLACE, SHARON H 
WILLIABS,JEBOBE 



OFFICE ASSISTANT, FROB SEP 1 S 

DISTRICT ASSISTANT 

OFFICE ASSISTANT, TO JUL 31 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

OFFICE ASSISTANT, FROB AUG 1 

OFFICE ASSISTANT 

OFFICE ASSISTANT, FROB SEP 1 

OFFICE ASSISTANT 

CASEWORKER 

OFFICE ASSISTANT 

OFFICE ASSISTANT 

OFFICE ASSISTANT, FROB AUG 1 TO AUG 31 

OFFICE ASSISTANT 

OFFICE ASSISTANT, TO JUL 31 

OFFICE ASSISTANT, FROB JUL 5 

OFFICE ASSISTANT 

LEGISLATIVE ASSISTANT 

OFFICE ASSISTANT 

OFFICE ASSISTANT, TO AUG 31 

ADBINISTRATIVE ASSISTANT 



650.00 
,046.60 

800.00 

590.00 

932.35 
,550.00 

650.00 
,065.53 
,750.00 
,375.01 
,9*2.31 
,250.00 
,749.99 

764.94 
,475.00 
,732.50 
,250.01 
,029.12 

800.00 
,874.99 



OFFICE OF HON. JABES C CLEVELAND 



BERTOLABI,JONI B 
BURCH, KATHLEEN D 
BUTLER, JUDITH ANN 
CAMPBELL, DOUGLAS 
CRUDUP.JANE E 
DOVER, JOANNE T 
GROSS, WILLIAB WOOLF 
GUILFOY,KATHY E 
HARPER, BARJORIE C 
HUDSON, ROBBIN K 
JACKSON, HILDRED KATE 
JOSLIN, WILLIAB R 
KIDDER, LEE A 
BCINNES, SUZANNE P 
MICUCCI, SUZANNE B 
PORTER, GERALDINE R 
SHANNON, JOANNE 
TETLER, GEORGE W,III 
TURNER, ROBERT K 
ZEEB.BARVADELL C 



TO AUG 31 

LEGISLATIVE ASSISTANT 5 

SECRETARY 2 

1 

3 

SECRETARY 2 

LBJ CONGRESSIONAL INTERN, TO JUL 8 

3 

SECRETARY 3 

RESEARCH ASSISTANT 6 

ADBINISTRATIVE ASSISTANT 11 

LEGISLATIVE ASSISTANT 4 

3 

2 

3 

FROH SEP 1 

TO JUL 31 

DISTRICT REPRESENTATIVE 4 



866.66 
571.24 
310. 84 
331.67 
354.99 
,612. 49 
157.33 
,875.01 
,624.99 
750.00 
,687.51 
176. 2U 
,500.00 
,407. 49 
,250.00 
,543.75 
661.67 
537.92 
,725.00 
248.51 



OPFICE OF HON. THAD COCHRAN 

BAXTER, ELIZABETH REA 
CARTER, WILEY K 
CHRISTIE, CATHIE 
DEW,BARIANNA 
FLOWER S,NEHEHI AH, JR 
FOSTER, CHRISTINE A 
GERRY, BARTIN H 
GOLDBAN, PATRICIA A 
JABER,J DANIEL 
KEEL, CHRISTY 
LAIRD, CARRIE BLISS 
LOFLIN.ROY JABES, JR 
LOFTON, JABES H 
MC DANIEL, PEGGY A. 
BOUNGER, WILLIAB H,II 
NELSON, T CHASE 
NETTLE, WILLIE J 
RIGSBY, REGINALD D 
SOUTH, LYNDA J 
WAGLEY, DORIS ANN 



LEGISLATIVE SECRETARY 

AEBINISTRATIVE ASSISTANT 

RECEPTIONIST 

SECRETARY 

STAFF ASSISTANT 

DISTRICT OFFICE SECRETARY 

STAFF ASSISTANT, TO AUG 31 

STAFF ASSISTANT, FROB SEP 1 

STAFF ASSISTANT, TO AUG 19 

LBJ CONGRESSIONAL INTERN, TO JUL 22 . . . 

DISTRICT OFFICE BANAGER 

STAFF ASSISTANT 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT, TO JUL 9 

STAFF ASSISTANT, FROB SEP 6 

STAFF ASSISTANT, FROB JUL 6 TO AUG 5 

STAFF ASSISTANT, FROB SEP 1 

PRESS SECRETARY 

PERSONAL SECRETARY 



.249.99 
,000.01 
.500.01 
400.00 
,000.01 
,875.00 
416.66 
208.33 
963.67 
432.67 
250.00 
,124.99 
,250.01 
,499.99 
140.79 
250.00 
500.00 
300.00 
,750.00 
,499.99 



OFFICE OF HON. WILLIAH S COHEN 



AULT, DAVID R 
BRIGHT, THOBAS R 
COLLINS, SUSAN B 
CRAIG, LINDA GENE 
DAFFBON, THOBAS A 
DRYSDALE,BETH ELLEN 



SPECIAL ASSISTANT 3,300.00 

PRESS SECRETARY 4,500.00 

LEGISLATIVE ASSISTANT 3,125.01 

PERSONAL SECRETARY 3,999.99 

ADBINISTRATIVE ASSISTANT 11,874.99 

STAFF ASSISTANT, TO AUG 31 1,200.00 



51 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 

JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. BILLIAH S COHEN -CONTINUED 

FORD, CAROL H LBJ CONGRESSIONAL INTERN, TO JOL 31 $ 590.00 

GERRY, DALE F DISTRICT OFFICE REPRESENTATIVE 3,549.99 

HART.DABN E STAFF ASSISTANT 1,260.00 

HASTINGS, MICHAEL H LEGISLATIVE ASSISTANT 3,500.01 

HEYERDAHL.THCHAS F CHIEF LEGISLATIVE ASSISTANT 5,375.01 

HOLMES, NANCY L STAFF ASSISTANT 2,000.01 

JOHNSON, JANE S SFECIAL ASSISTANT, FROM SEP 1 1,141.67 

LOONSBORI.SARIANN CASEBORKIB 3,549.99 

LYONS, HELEN E CASE SORKER. , TO SEP 8 2,319.1*5 

HACDERMOTT, JACQUELINE R DISTRICT OFFICE SECRETARY 2, 625,. 00 

POTHOLH, CHRISTIAN P SPECIAL ASSISTANT 2, 871*. 99 

REAL,TERRENCE ROBERT STAFF ASSISTANT, FROM AUG 1 TO AOG 31 150.00 

STREETER,JEAN H LEGISLATIVE AIDE 2,375.01 

TYRER, ROBERT S STAFF ASSISTANT 1,691.67 



OFFICE OF HON. E THOMAS COLEMAN 



BRAND, HELEN E 
BORNS, BONNIE J 
CHAMBERS, CYNTHIA S 
CLIMER, JEROME F 
CROB, DAVID T 
DICKSON, JANET C 
DITTON, BEVERLEY JONE 
ERGANIAN.HABYLIN L 
GALL, MARY SHEILA 
HOLWICK, LINDA ANN 
HOLSE,R. ROBERT 
LAMBERT, DENNIS E 
HOSGRAVE, BILLY E.II 
SANDS, SARAH D 
SHAB, BARBARA E 
STILLEY, WILLIAM D 
THOMPSON, MARLENE K 

TOCKER.B. IHATENE 
WARNICK,JOHH A 
WELSH, BOBBY D. 
BHITE, CAROLYN A 



PERSONAL SECRETARY, FROM SEP 14 448.61 

CLERK, FRCH SEP 1 600.00 

SECRETARY 2,250.00 

CHIEF LEGISLATIVE ASSISTANT 7,500.00 

SFECIAL ASSISTANT 3,000.00 

RECEPTIONIST 2,000.01 

CLERK TYPIST 2,250.00 

SECRETARY, FROM SEP 13 436.00 

CASEWORKER 3,750.00 

SECRETARIAL, TO JOL 31 200.00 

DISTRICT ASSISTANT 6,000.00 

ADMINISTRATIVE ASSISTANT 8,700.00 

PRESS AIEE 5,775.00 

RECEPTIONIST, TO ADG 5 972.22 

OFFICE MANAGER 3,375.00 

L£J CONGRESSIONAL INTERN, TO JOL 31 590.00 

SECRETARY, TO AUG 31 

PERSONAL SECRETARY, FROM SEP 1 . . . .- 3,331.23 

STAFF AIEE 2,949.99 

LEGISLATIVE AIDE 3,937.50 

MOBILE VAN ASSISTANT 1,942.23 

SECRETARY, TO SEP 21 2,411.99 



OFFICE OF HON. CARDISS COLLINS 



BLAIR, CHESTER L 
BYRD, SANDRA L 
ELLIS, DBIGHT (I 
ELLIS, THEODORE, JR 
FRANKLIN, FLORENCE D 
GORDON, JEANETTE H 
HIHBERG, HARVEY A 
HORBITZ, MANNY 
HEZIER,ROZELIA 
HHOON, EVELYN B 
ROMANO, ARTHDH 
ROSS, DOROTHY MAE 
SKRAK, MICHAEL THCMAS 
SYLVESTER, ROBERT E 
TOUSANT,ALIESE 
BALKER, DEBORAH T 
BOOD, DIANA ELIZABETH 



DIST RESEARCH AIDE 

STENOGRAPHER 

ADMINISTRATIVE ASSISTANT., TO JOL 

DIST OFFICE AIDE 

SECRETARY 

CCNGEESSICNAL AIDE 

LEGISLATIVE ASSISTANT 

CONGRESSIONAL AIDE 

DISTRICT OFFICE SECRETARY 

SPECIAL ASSISTANT 

STAFF ASSISTANT, TO AOG 31 

LEGISLATIVE ASSISTANT 

OFFICE MANAGER 

SECRETARY, TO JOL 15 

LEGISLATIVE CORRESPONDENT 



,143.10 
,124.29 

555.56 
,056.27 
,310.12 
,193.19 
,875.01 

300.00 
,377.76 
,040.59 
,724.27 
,911.57 
,300.00 
,016.66 
,305.58 

458.33 
,919.05 



OFFICE OF HON. JAMES M COLLINS 



ANDREWS, SANDRA JO 
BISHOP, ANNE S 
BROOKS, BONNIE 
CONNER, MARY HAXBELL 
DASKAH,SOZANNE 
DECKER, JOHN 

DO0GLAS,JOHN K 
FRAZER, MARGARET B 
HERATH.PAHALA GAY 
KELLEY, SALTER DEKALB, JI 

KISHPAOGH, BEVERLY L 



CLERK 2,533.33 

CLERK ' 3,300.00 

CLERK 2,150.00 

CLERK 2,150.00 

CLERK, TO JOL 31 2,083.33 

RESEARCH ASSISTANT, TO JOL 31 

CLERK, FRCH AOG 1 4,699.99 

CLERK 5,100.00 

LEGISLATIVE ASSISTANT, FROM SEP 19 366.67 

CLERK 2,499.99 

PRESS, TO JOL 31 

CLERK, FECM AOG 1 2,875.00 

OFFICE HGB-CASE BORKER 5,000.00 



52 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. JIBES N COLLINS -CONTINUED 



LONG, BABY JOAN 
MACIAG.THADDEUS R 
MCGURN,KATRINA CLARE 
SANFORD,JEB 
SIMPSON, SHIRLEY ANN 
STAUFFER,LISA R 
SUELFLOHN, BONNIE 
THEODORE, PAMELA H 
TRAVIS, DEE 
BHITLOCK,KAHEN 



CLERK, TO AUG 10 $ 2,283.33 

ADMINISTRATIVE ASSISTANT 3,999.99 

CLERK 1,833.33 

LEJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

CLERK U, 07U. 99 

CLERK 2,150.00 

CLERK, FROM SEP 1 600.00 

CLERK 2,200.00 

CLERK 6,050.01 

CLERK, FECH AUG 1 1,575.00 



OFFICE OF HON. BARBER B CONABLE JR 



ALEXANDER, OLGA C 
BANSBACH.JOHN M 
BENTON, THOMAS R 
BLACKBORE, HELEN SHIRLEY 
GIBSON, VALERIE ANN 
KARL, JOHN F 
KNOX, JACQUELINE 
LOPEZ, DEBORAH B 
MCCABE,WILLIAH MICHAEL 
MCLAUGHLIN, LINDA J 
MORRIS, SUSAN S 
NICHOLAS, HABRY K 
OVERS, LAUREN L 
SBITH,LYNN KATHRYN 
VANDERBILT.HARJOEIE W 
WALLACE, MARIAN E 
BELLS, SHARON 



CLERK , 2,925.00 

LBJ CONGRESSIONAL INTERN, TO AUG 5 688.33 

CLERK. 1,228.714 

SECRETARY 2,700.00 

RECEPTIONIST-SECRETARY 2,400.01 

LEGIS 6 RESEARCH ASST 3,393.75 

STAFF ASSISTANT, FROB SEP 1 625.00 

LEGISLATIVE CORRESPONDENT 2,799.99 

STAFF ASSISTANT, TO JUL 31 1,300.00 

PERSONAL SECRETARY 1,493.76 

CASE WORKER 2,872.08 

ADMINISTRATIVE ASSISTANT 10,487.49 

CLERK, TO AUG 12 715.40 

STAFF ASSISTANT 2,925.00 

LEGISLATIVE ASSISTANT 4,059.59 

CASEWORKER 2,550.00 

SECRETARY-CASE WORKER 4,080.00 



OFFICE OF HON. SILVIO CONTE 



CARLSTROM,WARD B, II 
COUPE, KATHERINE D 
DECARLO.DALE ANNE 
DONDI,DELORES 
DONNER, SALLY SEARS 
GAUGHAN, SUSAN E 
GENOVESE, MARGARET 
GOGGINS, TIMOTHY J 
GOGGINS, WILLIAM M 
GOLDBERG, STUART M 
GROSSMAN, JOAN C 
JOSEFIAK, THOMAS J 
KAY, SUSAN 
KOSTANSKI, MARILYN 
MAGUIRE, FRANCES M 
MCCARTHY, JOANNE 
MICHELSON, ELENA 
MULLANEY, JOSEPH E,III 
OREILLY,BERNADETTE 
PRATT, ROBERT LEONARD 
SHUE.KENNA H 
SILVEIRA,BARI A 
TAYLOR, JANET PORTER 
VILLANI, PAULA S 
WEEKS, DEBORAH 
ZABOROWSKI, CLAIRE C 



STAFF ASSISTANT, FROM SEP 1 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT, FROM SEP 1 

STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT, FROM SEP 14 

STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 

STAFF ASSISTANT, TO AUG 31 

STAFF ASSISTANT 

STAFF ASSISTANT, TO JUL 31 

LBJ CONGRESSIONAL INTERN, TO JUL 31 ... 

STAFF ASSISTANT 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 

STAFF ASSISTANT, FROM SEP 1 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT, FROM AUG 1 

STAFF ASSISTANT, FROM SEP 1 

STAFF ASSISTANT 



,050.00 

,999.99 

,875.00 

,375.00 

,749.99 

,250.00 

,375.00 

,958.33 

,041.67 

750.00 

750.00 

850.00 

750.00 

600.00 

,000.00 

,708.34 

166.67 

590.00 

,025.00 

,250.00 

791.67 

,375.00 

,493.75 

,958.33 

,533.33 

,625.00 



OFFICE OF HON. JOHN CONYERS JR 



COOKE, MICHAEL 
CRAWFORD, HUBERT 
EDWARDS, ARTHURIE L 
EHRLICH, EVERETT H 
ELAYNE.MARCIA 
FEATHERSTONE, ARTHUR R 
FORD,ARGENIA CECILIA 
FRISHMAN, ROBERT J 
GWALTNEY.JOAN S 
KIRK, WILLIAM A 
KOTLEH,NEIL G 
LOPEZ, DIANA VILLABWOVO 
MOORE, WARFIELD ,111 



STAFF AIIE, TO JUL 31 

STAFF AIIE, FROM AUG 1 TO AUG 31 .. 

STAFF AIDE 

STAFF AIDE., TO JUL 31 

STAFF All! 

FIELD REPRESENTATIVE 

STAFF AIDE 

STAFF AIDE 

APPT SECTY RECEPTIONIST, TO JUL 17 . 

STAFF AIEE 

LEGISLATIVE AIDE 

STAFF AIDE, FROM AUG 1 TO AUG 31 .. 
LEJ CONGRESSIONAL INTERN, TO JUL 31 



300.00 
335.00 
822.94 
666.67 
,656.29 
,454.05 
,750.01 
,777.76 
566.67 
,002.30 
821.04 
800.00 
590.00 



53 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. JOHN CONYEBS JR -CCNTINOED 



NAPPEB,HYACINTHE T 
OLIVES, CATHY 
PARKS, BOSA L 

PATTON, MARCOS 
ROBINSON, KABL 
BODEK, ELIZABETH ANN 
SAONDEBS, NELSON N 
SCHOCHTER, ARNOLD 
STOBBLEFIELD, MYRTLE 
NILLIAHS.ABLENE 



ADMINISTRATIVE AIDE $ 6,478.98 

STAFF AIEE, FROB AOG 1 TO AUG 31 800.00 

RECEPTIONIST, TO JUL 31 

STAFF AIIF, FROM AOG 1 2,118.60 

STAFF AIDE, FBOM AOG 1 TO AOG 31 165.00 

STAFF AIDE, FROM SEP 1 1*92.31 

STAFF AIEE 2,484.40 

ADMINISTRATIVE ASSISTANT, FBOM JOL 5 4,010.63 

LEGISLATIVE ASSISTANT 9,999.99 

STAFF AIDE 3,750.01 

RECEPTICNIST-APPT SECTY, FROM AOG 15 1,533.33 



OFFICE OF HON. TOM CORCORAN 

ADAMS, LINDA S 
CAVANAGH,MABY 
DAVIS, FREDERICK GOT 
DINGHAN, RICHARD B 
FOSTER, DAVID S 
HARRIS, VICKI LEE 
HONHAN, SHERRY L 
HONT,KRISTEN LYNN 
JOHNSON, JEFF W 
HATTOON, DANIEL JAMES 
HCMORRAY, SCOTT E 

HEISENHELDER,JAY 
RYAN, ELIZABETH E 
SASYEB.CANDACE 
SCHHID,DEBOBAH ANN 
SHIELDS, PATRICIA LYNN 
STEPHENS, DONALD L,JR 
BADE,SOSAN C 
BELLEB, GERALD C 
WILSON, REED J 
BOLCOTT, JACKIE L 



CASE BOBKER 2,750.01 

PEFSCNAl SECRETARY 3,500.01 

LEGISLATIVE ASSISTANT 3,125.01 

RESEARCH ASSISTANT 1,500.00 

STAFF ASSISTANT, FROB JOL 11 TO SEP 9 1,160.33 

DISTRICT SECBETARI 1,749.99 

STAFF ASSISTANT, FROB SEP 1 400.00 

CASE BORKEB 2,750.01 

STAFF ASSISTANT, FBOB SEP 10 413.00 

LEGISLATIVE DIBECTOB 5,499.99 

STAFF ASSISTANT, FROB JOL 16 TO AOG 31 

LEJ CONGRESSIONAL INTERN, TO JOL 9 1,062.00 

COMMUNICATIONS DIBECTOB U, 062. 51 

RECEPTIONIST 2,874.99 

LEGISLATIVE ASSISTANT 2,874.99 

CLEBK TYPIST 2,250.00 

RECEPTIONIST-TYPIST 2,000.01 

AEBINISTBATIVE ASSISTANT 10,683.75 

DISTRICT OFFICE BA NAGER 3,000.00 

STAFF ASSISTANT, TO JOL 15 430.00 

DISTRICT DIBECTOB 3,624.99 

OFFICE MANAGER 4,250.01 



OFFICE OF HON. JAMES C COBBAN 



BARRETT, NELDA K 
BIESENBACH,BABY B 
CAPISTRANT,GARY FBAHCIS 
CAEEY, VIRGINIA E 
CASAS.LAOBA C 
DOEBFLEIN.BOTH H 
ETHEBEDGE,SABAH E 
GONZALEZ, LOOBDES L 
LABSOB,BOTH F 
MOLL, COLLEEN C 
BOBGENSTEBN, ELLEN A 
OBBAN,BICHEL 
SINDONE, MELVA E 
RUBEN, ROBERT C 
SLATES, IRENE B 
BALKER, CAROLE E 



LEGISLATIVE ASSISTANT 



STAFF ASSISTANT 



999.99 
,250.00 
,124.99 
,999.99 

133.33 
,500.01 
,383.33 
,400.00 
,793.75 
,500.01 
,999.99 
,999.99 
,375.00 
,569.83 
,374.99 
,249.99 



OFPICE OF HON. SOBEBT J COBNELL 



ANNABLE,SOSAN B 
CABLSON,KAT JONE 
DE LOBBE,DOANE J 
DE LOBBE.JABES 
DESOZIEB, KATHLEEN 
DOBSON,BABY E 
DOSSLIHG,JOHN F 
DYE, SHARON S 
GBOSZYNSKI,STAN 
JONES, KEBBY.L 
HARIANI, ANITA L 
MICHALSKI.RICHABD 
HONAGHAN, FRANCES 1 
NENNIG, DAVID S 
NICKELS, ILONA B 
STEVENS, THOHAS L 
SOFLA.H. GENE 



STAFF ASSISTANT, TO JOL 31 

DISTRICT OFFICE SECBETARY, PBOB SEP 27 .... 
DISTRICT OFFICE SECBETAEY, JOL 8 - AOG 26 

BOBE ASSISTANT, FBOB AOG 24 

DISTBICT OFFICE SECBETABY, TO JOL 6 

LEGISLATIVE ASSISTANT, TO AOG 5 

PBESS AICE 

STAFF ASSISTANT, FBOB AOG 1 TO AOG 31 .... 

HOBE ASSISTANT 

LEGISLATIVE ASSISTANT 

SECRETARY -RECEPTIONIST 

LBJ CONGRESSIONAL INTERN, JOL 9 - AOG 8 . 

CASE BORKEB 

STAFF ASSISTANT 

LEGISLATIVE ASSISTANT, TO AOG 31 

HONE ASSISTANT., TO AOG 31 

STAFF ASSISTANT, TO JOL 31 



375.00 
86.67 
156.95 
644.44 
150.00 
263.89 
,500.01 
,500.00 
125.00 
,875.01 
125.01 
590.00 
,375.00 
750.00 
,666.66 
,658.34 
,500.00 



54 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. ROBERT J CORNELL -CONTINUED 



TOEP.FER,HARCIA LYNN 
VANDENBBOEK, BETTY ANN 
VOGLER.BITA C 

WAHLERS,NARY L 
WETLAND, HAROLD P 
WINGER, ELIZABETH ANNE 
WITHNELL, ELIZABETH ROSS 



LEGISLATIVE ASSISTANT, FROH AUG 10 $ 2,125.00 

DISTRICT OFFICE SECRETARY 2,000.01 

LEGISLATIVE ASSISTANT 3,125.01 

DISTRICT OFFICE SECRETARY, FROH AOG 28 825.00 

HOHE ASSISTANT 3,875.01 

DISTRICT OFFICE SECRETARY, TO AUG 26 1,213.33 

ADHINISTBATIVE ASSISTANT 5,666.67 



OPFICE OF HON. DAVID L CORNBELL 



ADELHAN, HARTIE S 
AUSTIN, LO ANN 
BRENNAN, JANES 
CUNNINGHAM, BARBARA L 
EHRLICH, CHARLES 
ELLIOTT, MYRA BELLE 
FUHRER.ANNA 
KENT, BARBARA 
LOGAN, PATRICIA CAROL 
HATTOS.KATHERINE L 
MEYER, ALPHONSO C,JR 
MILLER, HATTIE S 
PALMER .CAROLYN 
RECHT, PHILIP B 
RIESS.MIRIAH H 
RIESTER, MARTHA 
SHAFFRAN,JOAN GLORIA 
STASEY, WALTER 
VON KAENEL.JANIE 
WALKER, A LAN LEE 
WEAVER, CHRISTOPHER L 

BILES, HARRY G,II 



LBJ CONGRESSIONAL INTERN, TO AUG 5 

CASEWORKER 

CASEWORKER 

STAFF ASSISTANT 

STAFF ASSISTANT 

CASEWORKER 

CASEWORKER 

STAFF ASSISTANT 

STAFF ASSISTANT 

RECEPTIONIST 

RECEPTIONIST 

STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT, FROM SEP 1 ........ 

LEGISLATIVE ASSISTANT 

CASEWORKER 

EXECUTIVE AIDE 

STAFF ASSISTANT, FROM SEP 1 

ADMINISTRATIVE ASSISTANT 

PRESS SECRETARY 

FIELD DIRECTOR, TO SEP 15 

STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT, PROM SEP 1 

CHIEF LEGISLATIVE ASSISTANT ........ 



688.33 
,l»99.99 
,624.99 
,250.00 
,166.67 
,«99.99 
,000.00 
,000.00 
,500.01 
.87U.99 

791.67 
,000.00 

750.00 
,000.01 
,999.99 
,000.01 

250.00 
,000.01 
,750.00 
,250.00 

900.00 
,2«9.99 



OFFICE OF HON. BALTASAR CORRAEA 



ALVAREZ, MARINATI 
CASTELLANOS, JESUS A 
DELVALLE,JOSE E 
GUTIERREZ, LINA 
NARQUEZ, JOAQUIN A 
NARVAEZ- SANTIAGO, ROSA RIO 

NE VERB Z-SPR AGUE, ANA 
OLIVER, CIRCE GONZALEZ 
PARKER, CANDITA C 

SECOLA.BLANCA A 
SHITH.GDY F 
TARONJI,MARY 
USERA.J ANDREB 
VINAS, SANTOS 
WEIGHT, GER MAINE 



SECRETARY-CASE BORKER 

LEGISLATIVE ASSISTANT 

LEGISLATIVE ASSISTANT 

SPECIAL ASS'T TO LEGIS AIDE, FROH SEP 1 . 

ADMINISTRATIVE ASSISTANT 

DIST OFF DIRECTOR, TO JUL 31 

DIST OFF DIHECTOR, FROM AUG 5 

EXECUTIVE SECRETARY 

SECRETARY-CASE WORKER 

PERSONAL SECRETARY-OFF MGR 

SECRETARY-CASE WORKER, TO AUG 31 

SPECIAL ASSISTANT 

PERSONAL SECRETARY S CASEBORKER 

LEGISLATIVE ASSISTANT 

DIST OFF DIRECTOR 

LBJ CONGRESSIONAL INTERN, AUG 1 - AUG 31 



,800.00 
,075.00 
,500.01 
,220.33 
,900.00 

,777.78 
, U99.99 
,250.00 
,825.01 
,U33. 3<i 
,7U9.99 
,900.00 
,1211.99 
,500.01 
590.00 



OFFICE OF HON. WILLIAM R CCTTER 



BRIGGS.DEIDRE ELIZABETH 
BRUNNER, SHIRLEY R 
CRONIN, TIMOTHY F. 
CUNNINGHAM, WILLIAM J 
DENTAMARO, JOSEPH J 
DIBELLA, ROBERT F 
DONNELLON, CATHERINE M 
FORNINO, THERESA A 
GALLO.SALVATORE P 
LANG, ANDREB G 
LUZZI, ANGELA A 
NCQOADE, DAVID J 
PRDCKER, MICHAEL J 
RIGNEY, ROBERT L. 
RIODX, ALFRED J. 
SMITH, WILLIAM R 
VALENTE, PAULA R 
VANFOSSEN, BARBARA J 
VECCHITTO, SARAH H 



LBJ CONGRESSIONAL INTERN, TO JUL 31 

STAFF AIDE 

DISTRICT AIDE 

ADMINISTRATIVE ASSISTANT 

DISTRICT AIDE 

DISTRICT ASSISTANT 

DISTRICT SECRETARY 

SECRETARY 

DISTRICT AIDE 

RESEARCH AIDE 

PERSCNAL SECRETARY 

DISTRICT AIDE 

SPECIAL AIDE, FROM SEP 22 

DISTRICT AIDE 

DISTRICT AIDE 

Alt 

LEGISLATIVE AIDE 

CASEWORKER, TO SEP 21 

DISTRICT CASE BORKER 



590.00 
,125.01 
,1*99.99 
,250.00 
,1*99.99 
,961.01 

300.00 

300.00 
,000.00 

750.00 
,250.00 
,371*. 99 

330.00 
,999.99 

71*9.99 

1*99.99 
,300.00 

970.00 
,625.01 



55 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. LAWRENCE COUGHLIN 

BAOHGARTNER, PEGGY R STAFF ASSISTANT $ 

BUCHANAN, ROBERT LEE STAFF ASSISTANT 

CASEY, CHARLOTTE H LEGISLATIVE ASSISTANT 

CROWFOOT, WILLIAM A STDDENT INTERN, TO JDL 31 

DONN, ELIZABETH J. DISTRICT OFFICE MANAGER 

FELDMAN, RACHEL A STDDENT INTERN, TO JDL 31 

PREELIN.JODITH MARIE STAFF ASSISTANT 

GLADECK, JOSEPH N,JR STAFF ASSISTANT 

GLAZER, SARAH JANE STAFF ASSISTANT, FROM ADG 1 

GOLDEN, LODIS MICHAEL, III LBJ CONGRESSIONAL INTERN, ADG 1 - ADG 31 

GOLDMAN, PATRICIA A STAFF ASSISTANT, FROM SEP 1 

HRITZ, CAROLE A STAFF ASSISTANT 

KENDALL, DAVID LBJ CONGRESSIONAL INTERN, TO JDL 31 

KENT, LINDA LEE STAFF ASSISTANT 

KNOX, JACQUELINE STAFF ASSISTANT, FROM ADG 1 TO ADG 31 

LEITER,PAOL ISAAC STDDENT INTERN, FROM ADG 1 TO ADG 31 

MOSES, ALEXIS MICHELE STAFF ASSISTANT 

MOYER, CHRISTOPHER G DISTRICT ADMINISTRATOR 

NOSBADH, NANCY STAFF ASSISTANT, FROM SEP 9 

PA VLOVITZ, GREGORY J STDDENT INTERN, TO JDL 31 

PRSSCOTT,HARY CORNELL STAFF ASSISTANT, TO JDL 31 

FOSENFELD, MITCHELL A AEMINISTR ATIVE ASSISTANT 

WALLACE, JANE MARCIA STAFF ASSISTANT 

WILLIAMS, DEBORAH KAY EXECDTIVE SECRETARY 

OFFICE OF HON. PHILIP M CRANE 

BRATHWAITE, PETER LEGISLATIVE ASSISTANT 

BROWN, SOSAN E CLERK 

CALDWELL, HELVIN J, JR CLERK, FFCHSEP 1 

CATLIN, SALLY C RECEPTIONIST-CASE WOPKER 

DINGHAN, RICHARD B RESEARCHER 

DDRFEE, LYNDA MARGARET LEGISLATIVE ASSISTANT 

EASTMAN, PENNY L LEGISLATIVE AIDE 

FOX, NANCY L OFFICE MANAGER 

GDY, ELIZABETH ANNE CLERK TYPIST, FROM SEP 1 

HOLDEN, CAROL THOMAS ADMINISTRATIVE AIDE 

KANSTEINER, WALTER H LEJ CONGRESSIONAL INTERN, ADG 1 - ADG 31 

LAFFLY, GENEVIEVE H LEGISLATIVE ASSISTANT 

LEWIS, EARL W DISTRICI REPRESENTATIVE 

LOEWY, STEVEN LEJ CONGRESSIONAL INTERN, TO JDL 31 

MILNE, EDWARD J,JR ADMINISTRATIVE ASSISTANT, TO JDL 31 

ADMINISTRATIVE ASSISTANT, FROM ADG 5 

REYNOLDS, ARTHDR B,III CLERK TYEIST, FROM AOG 1 TO AUG 31 

REYNOLDS, HADREEN M EXECUTIVE ASSISTANT, TO JDL 31 

EXECUTIVE ASSISTANT, FROM ADG 5 

ROMNEY, PATRICIA A CLERK TYPIST., TO JDL 31 

STEWART, DIANE S EXECUTIVE SECRETARY 

TYAHLA, MARTHA JOAN RECEPTIONIST 

WARNER, KATHRYN S LEGIS PRESS ASST 

WRIGLEY, PATRICIA ANN CASEWORKER 

OFFICE OF BON. JOHN E CUNNINGHAM 

ADDISON, BROCE LEGISLATIVE ASSISTANT 

BOTHELL,D L STAFF ASSISTANT, FROM JUL 11 

BRADSHAW.JOHH G SPECIAL PROJECTS INTERN, FROM AOG 15 TO ADG 29 

BURNETT, L.J. STAFF ASSISTANT, FROM SEP 6 

CANTO, MELISSA A RECEPTIONIST, TO AUG 26 

CHIECHI,VICKI RECEPTICNIST, TO AOG 5 

CHUECH.DIANNE V STAFF ASSISTANT, FROM SEP 6 

CLARK, ROBERT H SPECIAL PROJECTS INTERN, FROM SEP 15 

DORN, JANET L STAFF ASSISTANT, TO AOG 31 

STAFF ASSISTANT, FROM SEP 5 

EBERLE,K.F. CLERK TYPIST, FROM JDL 11 

GENERO, LAURA RESEARCH ASSISTANT 

HANBY.V.L. PROJECT INTERN, FROM JUL 11 TO AOG 1 

JACOBS, MERRILL R EXECUTIVE ASSISTANT 

JOHNSON, WILLIAM L, SR SENIOR FIELD REPRESENTATIVE, TO JUL 31 

DISTRICT MANAGER, FROM AUG 1 

KOHLER,KATHY TO JUL 22 

MACRAE, ANNE K PERSONAL SECRETARY 

MAXWELL, NANCY M STAFF ASSISTANT, FROM AUG 1 

PETERSON, BRADFORD T CASEWORKER, TO AUG 28 

RICKERSON, BROCE M LEGISLATIVE ASSISTANT 

TRUCKS, ALFRED E SPICIAL PROJECTS INTERN, FROM AUG 15 TO AUG 29 

VACINO.ANNE MARIE STAFF ASS 'T/ VOLUNTEER COORDINATOR, FHOM JUL 11 



750.00 
3,621.99 
3,875.01 

500.00 
4,625.01 

500.00 
3,000.00 
3,000.00 
1 ,66f .66 

500.00 
1,250.00 

750.00 

500.00 
3,000.00 
1,250.00 

500.00 
2,250.00 
5, 124. 99 

256.67 

500.00 
1,000.00 
9,900.00 
2,750.01 
5,375.01 



,000.01 
,698.14 

180.00 
,750.01 
,750.00 
,000.00 
,750.01 
,125.01 

666.67 
,041.67 

590.00 
,874.99 
,000.01 

590.00 



,083.23 
125.00 

,749.99 
683.33 
,000.00 
,392.41 
,500.01 
,666.67 



4,583.34 

3,200.00 

250.00 

437.50 

1,322.22 

816.67 

1,083.33 

1,066.67 

4,201.67 
1,733.33 

2,000.01 

840.00 

7,049.99 

7,049.99 
641.67 
3,545.00 
1,833.34 
1,933.33 
3,855.56 
250.00 
1,12 5.00 



5-500 O - 78 - 5 



56 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. JOHN E CUNNINGHAM -CONTINUED 



WILLIS, E 
WILLIS, R. 



FIELD COORDINATOR $ 7,049.99 

SPECIAL PROJECTS INTERN, FROH AUG 17 TO AUG 31 233.33 



OFFICE OF HON. NORHAN E DAHODES 



BEAOCHESNE, SUZANNE 
BENTAS, DEBORAH N 
BOISVERT, ROGER P 
BOURGOINE.ELLA 
CRAIG, ROBERT E 
DION,ESTELLE 
FREEDMAN, ANITA 
FREEDMAN, RICHARD 
GRADY, KATHLEEN 
HANNAWAY, JOHN F 
MCDERBY, LILLIAN C 
HORITZ, MARGARET E 
RADWAY, MICHAEL PORTER 
RICHARDSON, BRADLEY F 
ROUTHIER, DONALD ROLAND 
SEIFERT, JUDITH L 
SHANNON, JOANNE 
SILVER, DOUGLAS J 
STUCKERT,JANE E 
SULLIVAN, JACQUELINE L 
WOODWARD, BRADLEY E 



PERSONAL SECY OFC HGR 

RECEPTIONIST 

DISTRICT REPRESENTATIVE 

DISTRICT CASE WORKER 

SPECIAL REPRESENTATIVE 

DISTRICT CASE WORKER 

DISTRICT CASE WORKER 

LEGISLATIVE CORRESPONDENT 

CLERK TYPIST 

STAFF ASSISTANT 

DISTRICT CASEWORKER 

STAFF ASSISTANT, TO JUL 31 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT, FROH SEP 1 

STAFF ASSISTANT 

DISTRICT CASE WORKER 

STAFF ASSISTANT, FROH AUG 1 TO AUG 31 
LBJ CONGRESSIONAL INTERN, TO JUL 31 ... 

STAFF ASSISTANT, TO AUG 31 

LEGISLATIVE AIDE 

PRESS SECRETARY 



,2U9.99 
499.99 
.750.01 
,500.00 
,250.01 
,250.01 
750.01 
.U99.99 
,499.99 
,500.01 
.750.01 
,000.00 
,999.99 
500.00 
,999.99 
,275.00 
996.09 
500.00 
,000.00 
,249.99 
,500.01 



OFFICE OF HON. ROBERT W DANIEL JR 



ALFORD,WILLIAH A 

COOK, SANDRA S 

DARLING, W STUART 

DULANEY.MARY RUTH 

ERB,ROSANNE S 

FOSTER, DAVID H 

GAULDIN, WILLIAM W,JR 

JEHHISON, CAROLYN B 

HC CARTHY, KATHLEEN HEWITT 

MONTGOMERY, BARBARA J 

HURRAY, THAD S 

POYNTER, ANDREA 

SPAIN, GARLAND 

THURMAN, GWENDOLYN W 



PRESS AIDE 5,737.50 

LEGISLATIVE SECRETARY 2,929.16 

SPECIAL ASSISTANT 4,416.67 

SECRETARY 2,937.50 

DISTRICT SECRETARY 2,654.82 

LEGISLATIVE ASSISTANT 5,737.50 

SPECIAL ASSISTANT 4,940.13 

SECRETARY, FROH SEP 1 200.00 

LBJ CONGRESSIONAL INTERN, JUL 11 - JUL 29 373.67 

SECRETARY 5,390.91 

ADMINISTRATIVE ASSISTANT 11,874.99 

SECRETARY 2,924.99 

CLERK 3,859.83 

SECRETARY 4,575.00 



OFFICE OF HON. W C (DAN) DANIEL 



ANDERSON, VIVIAN 
BOTTS, MARGARET B 
BRUNSON, ANTOINETTE 
COGGIN, DIANE GAYLE 
DOVE, WANDA D 
FANGHEYER, ELLEN N 
FLETCHER, W FRED 
HOYE, DONALD CLARK 
HOYE, TERRY C 
NANCINI, MARIA J 
PEEBLES, CONSTANCE PALMER 
PRICE, FRANCES H 
ROYSTER.DENISE 
SLAYTON,JANE L 
STOTESBURY.HOONEY A 
WATKINS, MARGARET D 
WHITT.MARY KATHERINE 
WILLIAMS, JAMES B 
WILSON, JEAN E 



PERSONAL SECRETARY 4,725.01 

STAFF ASSISTANT, TO JUL 31 979.17 

SECRETARY, FROM SEP 22 237.50 

STAFF ASSISTANT 3,476.55 

STAFF ASSISTANT 2,937.51 

SECRETARY, TO SEP 15 1,770.83 

ADMINISTRATIVE ASSISTANT 10,183.74 

RESEARCHER 3,302.16 

LEGISLATIVE ASSISTANT 6,115.17 

STAFF ASSISTANT 3,227.58 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

DISTRICT OFFICE MANAGER 4,402.86 

CLERK, FROH AUG 2 TO AUG 31 580.00 

CLERK 699.99 

STAFF ASSISTANT, TO JUL 15 673.33 

STAFF ASSISTANT 2,773.26 

SECRETARY 1,950.00 

ANALYST 687.96 

STAFF ASSISTANT, FROM SEP 12 501.39 



OFFICE OF HON. GEORGE E DANIELSON 



ANDERSON, PATRICIA J 
BEAVERS, SUSAN GAIL 
CHAVEZ, THERESA ANN 
CLARK, CORALIE 
CONLON, RICHARD P 



PERSONAL SECRETARY 3,675.00 

SECRETARY 2,625.00 

LBJ CONGRESSIONAL INTERN, TO ADG 19 963.67 

SECRETARY 2,625.00 

RESEARCH ASSISTANT, FROM AUG 1 TO AUG 31 1,000.00 



57 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. GEORGE E DANIELSON -CONTINDED 



DOUGLASS, PAUL 
ELWOOD, NANCY C 
FELIKIAN, DIANE 
KAZARIAH, DENNIS SAB 
MONTALVO,ALEX L 
MORGAN, SUSAN BOSH 
NORTHERN, JAYNE 
PIGNATELLI, DONNA MARIE 
RIPLEY, JOAN 
SEBENS, RAYMOND I 
STICKNEY,SHENNAN 
TANNEB, SALLY NARCELLA 
YATES, LOOISE A. 



LEGISLATIVE ASSISTANT, TO SEP 9 $ 

SECRETARY 

CLERK, TO JUL 24 

ADMINISTRATIVE ASSISTANT 

DISTRICT REPRESENTATIVE 

SECRETARY 

SECRETARY 

SECRETARY, FROH SEP 13 

SECRETARY 

ADMINISTRATIVE ASSISTANT 

CLERK 

ADMINISTRATIVE ASSISTANT, TO AUG 12 

SECBETARY 



,680.00 
,763.89 

472.00 
,850.01 
,950.01 
,999.99 
,600.01 

U50.00 
,499.99 
,899.99 
,i»99.99 
,263.34 
,616.67 



OFFICE OF HON. MENDEL J DAVIS 



BEBLINSKY, BRUCE 
BESSENGER,«ARTHA D 
BULL,COBALEE K 
CBOSBY,TEBBY SEREECB 
DANE,L A 

DION YSOPODLOS,VA SI LIKE 
DOTTERER,SELBA T 
GENTZLER,DOREEN E 
GIBSOH,ELIZABETH G 
GOODWIN, WILLIS T 
HANE,HEYWABD T,JB 
JEFFERSON, JOSEPH H,JB 
KEYSEBLING, JONATHAN 
MCLEOD, W BULLINS 
PRICE, ALMA SCOTT 
RITTENBERG, CHARLES S 
SPELLEB, CYNTHIA 
TAYLOB, LINDA G 
THORNTON, PEGGY L 
WOODS, IBVIN BCSWAIN 
WORTHINGTON,KATHERINE 



CLERK, FROB SEP 1 

SECRETARY 

DISTRICT OFFICE BANAGER 

SECRETARY, TO AUG 12 

SPECIAL ASSISTANT 

SECRETARY 

CLEBK 

SECRETARY, TO AUG 31 

SECRETARY 

SPECIAL ASSISTANT 

SPECIAL ASSISTANT 

SPECIAL ASSISTANT 

ASSISTANT 

ADMINISTRATIVE ASSISTANT , 

CLERK TYPIST 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

LEGISLATIVE SECRETARY , 

PERSONAL SECRETARY 

AFPOINTMINT SECBETARY, FROB SEP 7 , 

SECRETARY 



200.00 
,1*89.70 
,229.97 

8U0.00 
,389.75 
,125.01 

683.69 
,200.00 
,000.00 
,719.87 
,833. 3U 
,250.01 
,750.00 
,900.00 
,250.00 

590.00 
,708.33 
,625.01 

806.67 
,250.00 
,11*4.90 



OFFICE OF HON. ELIGIO DE LA GARZA 



ALDRETE, PATRICIA ANNA 

ANDERSON, AVA G 
CAGIGAS.RENE 
CHERRY, DANA YSABEL 
CLERC, JANET E 
COLE, GAIL A 
DAVIDSON, GIRARD B 
FERGUSON, DIANNE 
GARZA, HARLA C 
GONZALES, JESSE 
HOFHANN, DIANE 
LLOYD, DOLORES ANNE 
BARFOQUIN.SALOBON S 
BARTIN, CECILIA HARE 
HCGDIRE.BERNICE 
PAPICH,GABY A 
WOODBBIDGE,MAHK 



STAFF, FBOM AUG 6 TO AUG 15 

LBJ CONGRESSIONAL INTEBN, TO AUG 5 885.00 

STAFF 2,11*6.41 

STAFF, TO JUL 31 786.23 

STAFF 2,833.31* 

STAFF MEMBER 2,5U1.66 

STAFF 2,058.75 

STAFF, FROB SEP 21 236.11 

STAFF 4,811.57 

STAFF, TO AUG 31 1,200.00 

STAFF 2,221.61 

CLERK 1,957.09 

STAFF 4,552.73 

STAFFER 3,605.17 

ADBINISTRATIVE ASSISTANT 10,353.41 

CLERK 4,811.67 

STAFF 3,634.59 

CLERK 2,541.66 



OFFICE OF HON. RON DE LUGO 

ANDERSON, LORI 
BOUGH, SAMUEL W 
BRESCH,JOHN E 
FOBDE.VELMA 
GARVER, CHARLOTTE C 
GOTTLIEB, ROY 
HIEBEBT, PETER N 
HODGE, JULIA H 
HADURO, BABEL J 
BARTINEZ.BLANCA 
BC ALPIN, LLOYD 
RODBIQUEZ, ENRIQUE 
SCHUNACHER, BARRY 
SILVEH,EBILY F 



CLERK, TO AUG 31 

CLERK 

CLEBK 

CLERK 

CLERK 

CLERK 

CLERK 

CLERK 

CLERK, TO AUG 31 

CLERK 

CLERK 

CLERK 

CLERK 

CLERK 



633.33 
,000.01 
,849.99 
,550.00 
,500.01 
,250.01 
,000.01 
,500.00 

400.00 
,325.01 
,416.67 
,291.67 
,500.01 
,125.01 



58 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. BOH DE LOGO -CONTINUED 



SMALLS, ADELE 
TURNBULL.LYNNETTE I 
SATLINGTON, JANET B 
BENNER,MARK D 
BEST, LEAH E 



CLERK , $ 2,700.00 

CLERK, TO JUL 31 100.00 

ADMINISTRATIVE ASSISTANT 11,874.99 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

CLERK 6,733.33 



OFFICE OF HON. JABES J DELANEI 



BUTLER, NARY H 
COOK, DOLORES D 
FOEIS, CAROLINE B 
GROH, ROBERT 
HILLEARY, FELICIA 
SCHNEIDER, MARY E 
BOOD, DENNIS P 



CLERK 1,661.94 

ADMINISTRATIVE ASSISTANT 8,382.27 

CLERK 1,250.01 

CLERK 3,125.01 

SECRETARY 3,249.99 

CLEBK 1,781.25 

LEGISLATIVE ASSISTANT 5,110.50 



OFFICE OF HON. RONALD V DELLUMS 



APPERSON.JOHN C 
BEAL.IDANELL H 
BRAUER, ROBERT B 
BROOKS, TERI ROBERTA 
DILLARD, MAMIE B 
DOBDY.JOCELYN I 
ELROD, MARILYN 
FLORES, CARMEN M 
GARZA, OZIEL 
HALTERMAN, HAROLD L. 
HOPKINS, DONALD BAY 
HUDSON, KARL 
KEMP, ALISON BROOKE 
LIH.LABS T 
SELLERS, NANCY SNOB 
SOLON, BARBARA T 
STEPHENSON, CHARLES C,JR 
SBANSON,SANDBE R 



ADMINISTRATIVE ASSISTANT 

SECRETARY 

SPECIAL COUNSEL 

ADMINISTRATIVE AIDE 

ADMINISTRATIVE AIDE 

ADMINISTRATIVE AIDE 

LEGISLATIVE ASSISTANT 

ADMINISTRATIVE AIDE 

ADMINISTRATIVE AIDE 

ADMINISTRATIVE AIDE 

DISTRICT ADMINISTRATOR 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

ADMINISTRATIVE AIDE 

ADMINISTRATIVE AIDE, TO AUG 31 

ADMINISTRATIVE AIDE 

ADMINISTRATIVE ASSISTANT 

CLERK TYEIST/RECEPTIOHIST 

ADMINISTRATIVE AIDE 



,040.14 
,499.98 
,215.56 
,874.99 
,684.77 
,320.70 

558.38 

169.21 
,198.36 
,284.77 
,815.19 

590.00 
,749.98 
,684.78 
,096.78 
,750.00 
,092.39 

749.99 



OPFICE OF HON. JOHN H DENT 

AHELIO,GABY ALAN 
ARMBBUST.MABLENE 
BERENBBOK, ALLAN R 
BLACK, ROSALIND M 
CAPRET TO, ADELINE 
FERACE, EUGENE 
GRANT, TONI J 
KACHILO, RHODA MAE 
LESHOCK,SANDRA LEE 
MALLINO, DAVID L 
MCCORNACK, GREGG C. 
MCLAUGHLIN, SUSANNE M 
MCLAUGHLIN, BILLIAM J,JB 
MOURIER, SCOTT R 
NARDIZZI ,NARY 
TANGRETTI, THOMAS A 
TRUXELL.ROMAINE S 
TSDTRAS, FRANK G 
TURK, FRANCES H 
YATES, JAMIE ANN 
YENICH,AILEEN 



SUMMER INTERN, TO JUL 31 

CLERK 

CLEBK, TO JUL 31 

LEGISLATIVE AIDE 

SUMMER INTERN, TO JUL 31 

CLERK 

STAFF ASSISTANT 

RECEPTIONIST 

CASEBORKER, FROM SEP 6 

RESEARCH ASSISTANT 

CASEBORKER 

CLERK TYPIST 

CLERK 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

CLERK TYPIST 

PROJECT OFFICER 

SECRETARY-DISTRICT OFFICE 

STAFF ASSISTANT, FROM AUG 1 

RESEARCH ASSISTANT 

CLERK 

SECBETABY-DISTBICT OFFICE 



500.00 
,499.99 

500.00 
,124.99 

500.00 
,358.69 

750.00 
,000.01 

500.00 
,931.14 
,562.49 
,499.99 
,525.00 

590.00 
,875.00 
,024.99 
,725.01 
,300.00 
,550.00 
,212.49 
,187.50 



OFFICE OF HON. BUTLEB DERRICK 



ANNABLE, SUSAN B 
BARR, LAURA B 
BAUMGARNEB, JOYCE 
BEEBE, CHARLES H 

BROBN, JOSEPH B 
CODDINGTON.LYNN 
DENT,CHABLOTTE B 
ENRICH, PATRICIA F 
GAINES, BARBARA C 



STAFF ASSISTANT, FBOM SEP 1 100.00 

AIDE, FROM SEP 1 217.84 

ASSISTANT, TO AUG 31 1,000.00 

BESEABCH ASSISTANT, TO AUG 31 

LEGISLATIVE RESEARCH ASSISTANT, FROM SEP 5 ... 5,502.85 

STAFF ASSISTANT, TO JUL 31 300.00 

STAFF ASSISTANT, TO JUL 31 276.00 

SECRETARY 3,302.16 

AIDE, FBOM AUG 15 1,213.89 

SPECIAL ASSISTANT 2,808.66 



59 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HCN. BUTLER DERRICK -CONTINUED 



GREGORY, JOHN D 
HALTIWANGER.HARY H 
IVESTER,HREN 
JOILY, MARGARET F 
JOLLY, HARY LYHSE 
MILLER, JUDITH ANN 
BURDOCK, AMN E 
NORHAN.ELESTINE S 
PEARSON, GRACE 
FITTHAN, MARSHA DIANE 
PBICE, NANCY JEAN 
RITCHIE, DONALD E 
TODD, ANN GARLINGTOH 
TRAMICK, JANICE 
THELLO,JOHN G 
TSOTRAS, FRANK G 
8iTKINS,lILLIAH 6 



ADMINISTRATIVE ASSISTANT $ 8,874.99 

LEGISLATIVE ASSISTANT 5,415.90 

LEJ CONGRESSIONAL INTERN, TO JDL 31 590.00 

AIDE, TO AUG 11 1,573.61 

AIDE 2,375.01 

STAFF ASSISTANT 3,975.51 

STAFF ASSISTANT, TO SEP 2 1,894.45 

SECRETARY 2,499.99 

RECEPTIONIST-STAFF ASST 3,000.00 

RECEPTIONIST-STAFF ASST, FROM SEP 3 738.89 

SECRETARY 300.00 

LBJ CONGRESSIONAL INTERN, AUG 1 - AOG 31 590.00 

PERSONAL SECRETARY 3,725.52 

CLERK TYPIST 3,332.40 

OFFICE MANAGES 6,000.00 

STAFF ASSISTANT, FROH AOG 1 TO AOG 31 570.00 

STAFF ASSISTANT, FROH AOG 1 TO AOG 31 300.00 



OFFICE OF RON. EDBARD J DEHBINSKI 



BLAND, MARION I 
BOLTON, ANN D 
BOLTON, JAMIE LYNN 
BOLTON, KEITH P 
BOCKLEY, PATRICIA H 
CHANCEY,HICHELE 
CHOHREK.JOAH P 
CLARK, SUSAN 
COOKE, CAROLYN L 
HIRST, BEATRICE H 
HOLCOHB, JUDITH OAKLEY 
HAGIEHA, STANLEY J 
HCHAHON, DEBORAH A 
MICHEL, LAURIE L 
ORTCIGER,HARJORIE B 
PARK, FRANCES L 
PETBICK.ELLEH D 
PIOTBOWSKI.HABJEAH E 
TIEBNEY.JOHN J,JR 
WILSON, KEITH NOBLE 



SECRETARY 2,856.63 

6,709.14 

CLERK TYPIST, FROH AOG 1 1,600.00 

CLERK, TO AUG 31 1,400.00 

SECRETARY 4,717.35 

SECBETARY, TO AOG 31 1,397.74 

CLERK, TO AUG 31 1,333.34 

SECRETARY 4,815.63 

LBJ CONGRESSIONAL INTERN, TO AUG 12 826.00 

LEGISLATIVE ASSISTAHT 4,540.44 

CASEHORKEB 4,455.27 

ADMINISTRATIVE ASSISTAHT 5,836.59 

SECBETARY 2,779.32 

CLEBK 2,583.33 

SECBETARY 1,782.12 

SECRETARY 2,831.10 

SECRETARY 2,856.63 

TYPIST 2,096.61 

RESEARCBER 3,000.00 

CLEBK, FBOH SEP 1 433.33 



OFFICE OF HOB. SAMUEL L DEVINE 



ALBEBTAZZIE, SALLY ANN 
BODIKEB, DAVID H 
BBADY,HABY JEAN 
BBANDT,EVALYH L 
CAMPBELL, JENNIFER JEAN 
CASEY, TERRY LEE 
GRIFFITHS, KAREB K 
HAYNES,LOIS J 
HO YT, JOHN S 
LEPESKA, SUSAN S 
LONCEFORD, LLOYD J 
MILLER, DAPHNE H 
OTTERSON .DEL05ES H 
SPAULDIHG,PAUL 
TAYLOB.HAHY K 
BOOD,TINA H 



SECBETABI 3,750.00 

MINORITY COUNSEL 3,714.90 

SECBETARY 2,437.50 

SECBETABI 3,406.98 

CLERK 1,641.67 

ADMINISTRATIVE AIDE 4,625.01 

LBJ CONGRESSIONAL INTEBH, TO AUG 19 963.67 

BECEPTIOHIST-SECBETABY 2,620.74 

ADMINISTRATIVE ASSISTANT 8,215.41 

STENOGRAPHER 3,439.74 

RESEARCH ASSISTANT., FBOH SEP 1 166.67 

RESEARCH ASSISTANT 786.24 

SECEETAEY 2,187.51 

BESEABCH ASSISTANT, TO AUG 31 333.34 

SECRETARY 1,965.57 

SECBETABY 2,375.01 



OPFICE OF HON. BILLIAH L DICKINSON 



BAMBERG, WALTER J 
BELCHER, JULIA R 
BELL,BELDEN HILL 
BROBN.ADELE B 
BUCKHALT,BOHALD B 
CABHON.COOBTHEY 
COOK, JAN 
DEBUTTS, LOUISE B 
DENT, BARBARA B 
FINLEY.D'LIHELL 
HARDY, ROBERT H,JR 
KIRK, SUSAN C 
LDCKIE,ANNE CLAIBE 



FIELD BEPBESENTATIVE 

SECBETABY, TO JUL 31 , 

BESEABCH ASSISTAHT 

SECBETABY 

PEESS-PB ASST, TO JUL 31 

INTERN, TO AUG 6. 

INTEBH, TO AUG 6 

SECBETABI 

DISTRICT SECBETABY 

INTEEN, TO JUL 15 

SPECIAL ASSISTANT, FBOH AUG 1 

SECBETABY , 

SECBETABY 



,700.00 

,212.50 

,000.00 

,749.99 

,625.00 

708.00 

708.00 

,800.01 

,799.99 

295.00 

,023.34 

,874.99 

,625.00 



60 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. BILLIAM L DICKINSON -CONTINUED 



MALLOY, LOUISE H 
MCHAHON, LINDA S 
PETERHAN, HELEN B 
PINCKARD.RONNY 
POSEY, JAMES C 
STEEN, JUNIUS C 
UNDERWOOD, EMMIE ALICE 
SAHBOUGH,BEENDA H 



SECBETABY, FROM AUG 22 $ 1,029.17 

LEGISLATIVE ASSISTANT 4,437.51 

SECHETABY, FBOM AUG 1 TO AUG 31 541.67 

INTEBN, TO JUL 31 590.00 

DISTBICT ASSISTANT 3,000.00 

ADMINISTRATIVE ASSISTANT 10,800.00 

DISTBICT SECBETABY 2,124.99 

PEESONAL SECBETABY 3,437.49 



OFFICE OF HON. NOBMAN D DICKS 



ABU BISH,CHABLA 

AYAZI, KAREN S 

BAPPER, NORMA J 

BB00KS,R0BEBT N 

COLIVER, LILLIAN S 

CZARNECKI, CRYSTAL 

FREESE .TERENCE L 

GRADY, KATHLEEN 

HOLLENBECK, MARGARET THOMSON 

HOHHAN.SHERBY L 

JACKSON, BARBIE B 

JAMES, PAMELA KEITHLEY 

KNUDSEN, COLIN B 

LUCIEN,DABN ELAINE 

MEBSEREAU,JANE B 

MONAHAN, DAN L 

MOSBARGER, WANDA M 

NELSON, SCOTT DOUGLAS 

POTTEB,JOHN A 

POWELL, SONJA C 

BICHABDSON, BOBBIE 

SCHEIDELMAN, RUSSELL L 

SEIDEL, PEGGY L 

STREGE, TIMOTHY M 

WILLIAMS, HARRIET A 



LBJ CONGBESSIONAL INTERN, TO JUL 

STAFF 

STAFF 

ADMINISTRATIVE ASSISTANT 

SECTY-TYPIST, TO AUG 10 

STAFF, FROM JUL 9 TO SEP 9 .... 

STAFF 

STAFF, FBOM AUG 11 TO SEP 10 .... 

STAFF 

STAFF ASSISTANT, FBOM SEP 10 .... 

STAFF 

STAFF, FBOM AUG 1 

STAFF, TO AUG 19 

STAFF 

STAFF, FBOH SEP 7 

STAFF 

STAFF 

STAFF 

STAFF 

STAFF, FBOM JUL 15 

STAFF, TO AUG 31 

STAFF, TO JUL 10 

STAFF ASSISTANT, FBOM JUL 11 .... 

STAFF, TO JUL 31 

STAFF, FROM SEP 1 



157.33 
,125.00 

,000.00 
874.99 
800.00 
,016.67 
,250.01 
800.00 
.749.99 
299.99 
874.99 
,000.00 
980.00 
,500.01 
480.00 
,500.00 
,000.00 
,200.00 
,506.24 
,189.57 
,000.00 
133. 33 
,066.67 
,958.33 
850.00 



OFFICE OF HON. CHABLES C DIGGS JB 



BAYLOR, MARGABET E 
CHICHESTER, ALEASE SABAH 
DUKES, OFIELD 
FORD, DEBORAH G 
GALLAGHER, BONNIE L 
HUMPHRIES, DERRICK A 
KOBNEGAY.FBANCIS A , JB 
MATLOCK, FELIX B 
MILLS, MABCIA A 
QDINN.LONGSORTH D 
RICHMOND, JERALEE 
ROBINSON, RANDALL 
ROX,RUTH A 
SIMMONS, ALMA WYDEN 
TERRELL, DAVID 
YOUNG, HALLISON 



STAFF ASSISTANT 4,743.75 

RECEPTIONIST 2,870.76 

DIBECTOB OF SPECIAL PROJECTS 3,144.90 

LBJ CONGRESSIONAL INTERN, TO AUG 12 826.00 

STAFF ASSISTANT 3,263.85 

STAFF ASSISTANT 5,096.64 

STAFF ASSISTANT 2,620.74 

FIELD REPRESENTATIVE 5,000.01 

SECBETABY 3,420.09 

5,571.30 

STAFF ASSISTANT 2,726.61 

AEBINISTBATIVE ASSISTANT 7,749.99 

SECRETARY 3,013.86 

STAFF ASSISTANT 3,999.99 

STIFF ASSISTANT 314.49 

SP COUNSULTNT-LEGL 6 FISC 2,927.91 



OFFICE OF HON. JOHN D DINGELL 



BARBIS, BRADLEY P 
BBENNAN, JUDITH A 
DAVIS, CATHEBINE E 
ENGLE.DOBOTHY 
GUENTHEB, CYNTHIA 
HANES, CYNTHIA A 
HIBEY, KAREN K 
HOWARD, ROBERT M 
KAHLEB, TERESA H 
KILROY.NELL H 
KOKAS, WILLIAM 
MAHAR, GREGORY 
MIKULICH, MARILYN NE 
PRATHER, CHARLES N 
STEBART, CHRISTINE ANN 
STOCKTON, PETEB D H 
SUCHER.HARK ALLAN 



LBJ CONGBESSIONAL INTERN, AUG 1 - AUG 31 

CLERK 

RESEARCH ASSISTANT 

CLERK 

CLFEK , 

CLERK 

CLEFK 

LEGISLATIVE ASSISTANT 

CLERK 

CLERK , 

CLERK, TO AUG 31 

CLERK , 

ADMINISTBATIVE ASSISTANT , 

CLERK 

CLEBK 

INVESTIGATOR , 

LEGAL CLEBK 



590.00 
,280.99 
,181.13 

438.42 
,625.79 
,568.33 
,617.67 

786.24 
,767.27 
,900.99 

160.00 
,406.98 
,443.01 

499.86 
,098.56 
,965.57 

400.00 



61 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30. 1977— Continued 



OFFICE OF HON. JOHN D DINGELL -CONTINUED 

WOOD, NARY ANN RE-EHPLCYED ANNUITANT, TO JUL 31 $ 

FROM AOG 1 

YOEBANS,KATHRYN H CLEBK 



1,030.15 
3,144.90 



OFFICE OF HON. CHRISTOPHER J DODD 



CARTER, GWENDOLYN F 
CONNOLLY, JOSEPH HICHAEL 
DOBINA,DALE H 
FEOERWERGER,HARVIH C 
GILHAN, DANIEL J 
GILHAN, HAUREEN E 
GW INN, HANSEL BRUCE 
HEFFERNAN, JOAN ANN 
ISRAELITE, STANLEY 
KAGAN,TAHARA B 
KANE, PATRICIA K 
KENNEDY, LISA H 

KEPPLE, NICHOLAS F 

LEVIN, JAY BENSON 
LEYKAH, NANCY J 
LOGAN, SHEILA FITZPATRICK 
HANN, EDWARD H 
HONSON, BARBARA L 
PELTZ.LOIS BETH 
FROVINSE, ELISABETH 
ROZANSKI, ROBERT CHARLES 
RUFFINO, JOHN J 
WALSH, ROSANNE D 
BAENER,HARK R 



RECEPTIONIST 

PRESS SECRETARY 

SECRETARY, FROM SEP 19 

LEGISLATIVE ASSISTANT, FROH SEP 1 

CASE HORKER 

RECEPTIONIST, TO ADG 8 

LEGISLATIVE ASSISTANT, TO ADG 31 

STAFF ASSISTANT 

SPECIAL ASST/COHH AFF 

STAFF ASSISTANT, FROH AOG 9 TO AOG 31 ... 

STAFF ASSISTANT 

LEGISLATIVE AIDE, TO ADG 9 

LEGISLATIVE ASSISTANT, FROH SEP 9 

STAFF ASSISTANT, TO JOL 31 

STAFF ASSISTANT, FROH AOG 5 

LEGISLATIVE ASSISTANT 

RECEPTIONIST, FROH SEP 26 

RECEPTIONIST-SECRETARY, TO SEP 18 

CASEWORKER 

LEGISLATIVE CORRESPONDENT, TO SEP 7 

LBJ CONGRESSIONAL INTERN, AOG 1 - AOG 31 

ADHINISTRATIVE ASSISTANT 

STAFF ASST-CASE WORKER 

CLERK TYPIST 

CASEWORKER 

LEGISLATIVE AIDE, FROH AOG 10 TO SEP 8 ., 



749.99 
750.00 
233.33 
416.67 
375.82 
,022.22 
,101.22 
,375.01 
,900.00 
,147.73 
,007.7« 



270.23 
,750.00 

125.00 

010. 11 
,635.17 
,675.00 

590.00 
,650.00 
,502.51 
,124.99 
,i»20.09 
,127.78 



OFFICE OF HON. ROBERT K DORNAN 



ANDERSON, DORIAN LOONSBORY 

BENNETT, BRIAN O'LEARY 

CASEY, HICHAEL PATRICK 

DRENICK,HARY V 

DREW, KATHLEEN J PERKA 

GAUER,BAYHOHD P 

HAIRAPETIAN,SHAHEN 

HARVEY, LYNN D 

HENDERSON, ELIZABETH RDTH 

JAHES,DORA L 

LOVE, LINDA 

HAHAN, ROGER 

HCCLELLAN.HARTHA DENVER 

RYAN, VINCENT J,JR 

STEINER,HARY B 

VOSBORGH II.KBISTIAN W 

WELLS, PAKE LA 

YODNG, BRIAN PHILIP 



RESEARCH AIDE 2,1*99.99 

LEGISLATIVE AIDE 3,375.00 

EXECUTIVE ASSISTANT 7,250.01 

SECRETARY/RECEPTIONIST 1,535.9a 

ADHIN SECTY/CASEWORKER 2,1*99.99 

DISTRICT ADHINISTRATIVE ASSISTANT 6,500.01 

LBJ CONGRESSIONAL INTERN, TO JDL 19 373.67 

SECRETARY-RECEPTIONIST 2, 121*. 99 

RECEPTIONIST 2,250.00 

SECRETARY CASEWORKER 2,750.01 

SPECIAL ASST/EXEC SECTY 3,750.00 

LBJ CONGRESSIONAL INTERN, JDL 20 - AOG 19 590.00 

LEGISLATIVE ASSISTANT 5,250.00 

AEHINISTBATIVE ASSISTANT 7,500.00 

DISTRICT OFFICE HANAGEB 3,000.00 

RESEARCH ASSISTANT 3,750.00 

CASEWORKER 3,000.00 

CASEWORKER/ LEGAL AIDE 2,750.01 



OFFICE OF HON. THOHAS J DOWNEY 



ABRILZ,SOLHA V 
BODENHILLER, FRANK F,JR 
BRADY, DOLORES A 
CIPOLLA, ROSALIE 
COLLINS, BBOCE D 
DEEBOSPO,JUDY 
DISALVO, RICHARD S 
KLITZHAN, ROBERT 
LANIER, ROBIN WEISS 
LAVIOLBTTE.ANNA C 
LIEBEB,JODY 

LOBENSTEIN, PATRICIA G. 
HADISON.ALAH H 
HEISEL,TOBY ANNE 
HITZHAN,NORHAN 
H03BAY, DAVID J 
POGLISI, CAROLE ANN 
SHEB HAN, ROBERT 
SPARKS, PHILIP LEE 



STAFF AIDE., FROH SEP 1 625.00 

STAFF AIIE 3,21*9.99 

STAFF AIDE 2,1*00.00 

DIRECTOR-IIST 5,000.01 

SPECIAL ASSISTANT 4,625.01 

STAFF ASSISTANT 3,024.99 

LEGISLATIVE AIDE 2,499.99 

LBJ CONGRESSIONAL INTERN, TO JOL 31 590.00 

LEGISLATIVE AIDE 3,329.99 

STAEF ASSISTANT 2,250.00 

OFFICE BANAGER 3,442.26 

STAFF AIIE 3,125.01 

PRESS/LEGISLATIVE AIDE, FROH AOG 1 2,156.22 

CASEWORKER 2,900.01 

STAFF ASSISTANT, TO AOG 31 2,333.34 

COHHONICATIONS ASSISTANT, TO AUG 1 496.86 

CASEWORKER 3,329.99 

RESEARCH ASSISTANT 3,335.99 

ADHINISTRATIVE ASSISTANT 6,000.00 



62 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OPPICE OF HON. THOMAS J DOWNEY -CONTINUED 



SULPIZIO, VALERIE, ANN 
TRAVAGLINI,CARLA B 



STAFF Altl S 1,250.01 

RECEPTIONIST 3,125.01 



OPPICE OF HON. ROBERT F DRINAN 



ANDERSON, MARY R 
BANKOWSKI, ELIZABETH 
CAHILL.HARY E 
CARLEO,ANNE M 
CICCOLINI, JOANNE C 
CURLEY, MAUREEN F 
DUGGAN,PAOLA C 
FRANK, DAVID 
GEARAN,HARK D 
HAY, ELIZABETH A. 
HOLBEIN, BROCE E 
LEVIN, JENNIFER 
MCDOWELL, JANE P 
MOULDER, EVELINA R 
PEICHARD, DOROTHY H 
SHERIDAN, PAUL J 
SHUHAN, FRANCES C 
SPENCER, H. BAILEY 
STECKER, HOWARD A 
WEBB, PATRICIA A 
WOLF, ARTHUR DOUGLAS 
ZIEGLER, CLARK L 



PERSONAL SECRETARY 

CASEWORKER 

RECEPTIONIST 

RECEPTIONIST 

SECRETARY 

RECEPTIONIST 

STAFF ASSISTANT, TO JOL 22 

PRESS SECRETARY 

LBJ CONGRESSIONAL INTERN, AUG 1 - AUG 31 

STAFF ASSISTANT 

SPECIAL ASSISTANT 

LBJ CONGRESSIONAL INTERN, TO JOL 31 

SECRETARY 

SECRETARY 

STAFF ASSISTANT, FROM SEP 1 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT, FROH AUG 1 TO AOG 31 ... 

LEGISLATIVE ASSISTANT 

RECEPTICNIST , 

SPECIAL COUNSEL 

LEGISLATIVE ASSISTANT 



,296.76 
250.01 
,375.01 
,343.00 
,871*. 99 
,124.99 
702.78 
1*99.99 
590.00 
177.1*9 
,000.00 
590,00 
500.01 
,229.17 
,000.00 
,083.33 
,086.76 
970.00 
916.67 
,107.01 
939.90 
,500.01 



OFFICE OF HON. JOHN J DUNCAN 



BAILEY, L EDGAR, JR 
BIRD, ROBERT JAMES, JB 
CANNON, HERMAN L 
COOK, SHERRY LYNN 
EASTON, JAMES C 
GARRETT, VELMA L 
GOEDARD, JULIA F 
GRAN, JESSIE B 
GROBB.GAIL P 
HIGDON, LINDA ADELL 
HILL, RAYMOND ELDCN 
JONES, JOHN MARVIN, II 
KENNEDY, CLAUDIA KRANZ 
KOELLA,LISA J 
LAMBERT, SHIRLEY RUTH 
LINDSEY,VICKI J 
LLOYD, LOUELLA A 
MANNERS, JANE E 
MAYNARD, WILLIAM H 
MCRAE, MILDRED B 
REID, CLARK L 
RIDENOUR, WILLIAM HENRY 
ROBINSON, PATRICIA D 
SMITH, RAYMOND 
VARLAN, THOMAS A 
WORKMAN, LEE D 



DISTRICT FIELD ASSISTANT 

CLERK, FROM SEP 1 

CLERK, TO JUL 31 

LEGISLATIVE ASSISTANT 

LEGISLATIVE ASSISTANT, TO JUL 31 

SECRETARY 

CLERK, FFCH SEP 1 

SECRETARY 

SECRETARY, FROH SEP 1 

SECRETARY 

CLICK, FROM AUG 1 TO AUG 31 

CLERK, TO JUL 31 , 

SECRETARY 

CLERK 

SECRETARY 

SECRETARY, TO AUG 31 

SECRETARY , 

SECRETARY, FROM AUG 1 

FIELD ASSISTANT 

DISTRICT SECRETARY 

PRESS SECRETARY, FROM AUG 1 

CLERK, FECM SEP 1 

ADMINISTRATIVE ASSISTANT 

FIELD ASSISTANT, FROM AUG 1 TO AUG 31 

CLERK, FROM AUG 1 TO AUG 31 

CLERK, TO JUL 31 



,399.99 
,175.00 
,200.00 
,650.01 
,550.00 
,399.99 

800.00 
,650.00 

700.00 
,800.00 

700.00 

900.00 
,900.01 
,1*00.00 
,250.00 
,700.00 
,099.99 
,400.00 
,500.00 
,149.99 
,833.31* 
,41*1.67 
,400.00 
,200.00 
,100.00 

900.00 



OFFICE OF HON. ROBERT DUNCAN 



AMSDEO, PATRICIA M 
BELANGY, BECKY ELLEN 
BROWN, MAXINE L 
BURTON, HELEN L 
CARLSON, G THELMA 
DANIELSON.DARLENE H 
EVERED, STEPHEN A 
FENTON, ELIZABETH M 
GAEDE.MARK 
GARVIE, PAMELA J 
HARRISON, ARDYCE E 
LOW,JONI T 
MCILVA IN E, STEVENSON 
OCONNOR, THOMAS » 
SHUPP,ROBBIN E 
SPENCER, ARTHUR C 



ADMINISTRATIVE ASSISTANT 

CONGRESSIONAL ASSISTANT 

OFFICE MANAGER 

EXECUTIVE SECRETARY 

CONGRESSIONAL ASSISTANT 

CLERK, TO SEP 2 

LEGISLATIVE ASSISTANT 

OFFICE MANAGER 

LEJ CONGRESSIONAL INTERN, TO AUG 21 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT 

RECEPTIONIST, FROM AUG 1 

ADMINISTRATIVE ASSISTANT 

CONGRESSIONAL ASSISTANT 

CLERK 

ADMINISTRATIVE ASSISTANT 



916.67 
416.67 
399.99 
749.99 
156.45 
842.83 
500.01 
2 50.01 
003.00 
812.50 
543. 14 
600.00 
749.99 
750.00 
552.28 
500.00 



63 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. EOBEBT DUNCAN -CONTINDED 

SBAN, STANLEY N ADHIN ASST-DIST OFFICE $ 5,124.99 

SNEENEY.ERNA J CLERK 1,650.00 

OFFICE OF HON. JOSEPH D EARLY 

ANDERSON, RAYMOND J CONGRESSIONAL AIDE 3,000.00 

BUCHANAN, LOUISE CASE DORK SUPERVISOR 5,375.01 

CASEY, MARTHA L LEGISLATIVE SECRETARY 2,375.01 

CONNOLLY, PADLA J LBJ CONGRESSIONAL INTERN, TO ADG 5 688.33 

DEHARCO, BEVEFLY S SECRETARY 2,625.00 

DOLAN, CHARLES H,JR LEGISLATIVE ASSISTANT 3,000.00 

FECELI, FREDERICK, III STAFF, FROM SEP 12 580.56 

FERRIS, HERBERT 8 LEGISLATIVE AIDE/CASEWORKER, FROM AUG 1 2,000.00 

GIBBONS, JAMES A LEGISLATIVE AIDE 2,750.01 

MANCINI, MARGARET H SECRETARY 2,427.79 

MARKARIAN,MELANIE A PERSONAL SECRETARY, TO JUL 31 1,291.67 

MATTHEWS, KIRWIN T,JB STAFF AIDE, TO SEP 9 2,300.00 

HCHICHAEL, ROBERT V LEGISLATIVE ASSISTANT 3,000.00 

MERCIER, BEVERLY A SECRETARY 3,500.01 

NORDBERG,PAUL C CONGRESSIONAL AIDE 6,999.99 

RHODES, FREDERICK L,JR CONGRESSIONAL AIDE 4,250.01 

RO0RKE,BILLIAH A At BINISTH ATIVE ASSISTANT 2,510.42 

SHEA, FRANK G CONSTITUENT AID 4,500.00 

SHEA, SALTER J CONGRESSIONAL AIDE 3,249.99 

SHEEHY,PAUL J LEGISLATIVE DIRECTOR, TO JUL 31 

EXECUTIVE SECRETARY, FROM AUG 1 5,212.50 

WALSH .PATRICIA SECRETARY 2,625.00 

OFFICE OF HON. BOB ECKHARDT 

BRAHLETT, JEFFREY RESEARCH CLERK, TO AUG 15 

LEGISLATIVE AIDE, FROM SEP 1 2,583.33 

BOTLER,ALHA L SECRETARY-CASE BORKER 3,875.01 

COCHRAN, GLORIA B STAFF ASSISTANT 3,875.01 

CONNOR, ROBERT J FIILD REPRESENTATIVE 4,125.00 

FLEISCHBANN, ARNOLD P RESIARCH ASSISTANT, TO AUG 16 1,331.44 

GANIK, MILAN RESEARCH CLERK, FROM SEP 1 479.17 

GRAY, FRANCES L OFFICE MANAGER 6,000.00 

GRAY.JOCELYN STAFF ASSISTANT 3,066.67 

HENDERSON, BRENDA J CASEBORKER 3,875.01 

HUTCHINS, JOYCE CLERK 1,812.51 

JACKSON, JUDY H CASEBORKER 3,875.01 

JACOBSON,DEBBA ANN LEGISLATIVE ASSISTANT 4,166.66 

LOBER.ANH K ADMINISTRATIVE ASSISTANT 6,000.00 

OZMORE, KEITH ENVIB FIELD COORDINATOR 5,250.00 

REYES, AUGUSTINA RESIARCH CLERK, TO AUG 13 

RESEARCH CLERK, FROM SEP 1 1,916.66 

SHEPARD, SUSAN R CLEBK TYPIST 2,279.86 

SHOFFIELD.LYNNA KAY FESIARCE CLERK, FROM AUG 1 TO AUG 31 479.17 

BHATLEY, THOMAS LEE LEGISLATIVE CORRESPONDENT, FROM SEP 1 1,083.33 

BHITNEY III, CLIFFORD C RESEARCH ASSISTANT 2,750.00 

BILLIAMS, FLOYD N,II RESEARCB CLERK, FROM AUG 1 

LBJ CONGRESSIONAL INTERN, TO JUL 31 1,548.34 

OFFICE OF HON. ROBERT B EDGAR 

BALLOU,CATHRYN DABN DIST COORD 6 APPT SECY 4,402.86 

BARDSLEY, AUDREY A CONGRESSIONAL ASSISTANT 3,439.74 

BERRY, LITA L SECRETARY, FROM JUL 6 2,475.15 

BRISCOE, JOHH A DISTRICT ADMINISTRATOR 5,000.01 

CAVALLI, RICHARD STAFF AIDE., FROM AUG 1 TO AUG 31 1,000.00 

GROBMAN,GARY H LEGISLATIVE ASSISTANT 3,407.01 

HAGGERTY,HARYANN TO JUL 31 1,000.00 

JONES, LOVELEAN STAFF ASSISTANT 2,750.01 

KEEL,KATHERINE E OFC MGR EXEC SECRETARY 3,852.75 

KENNEDY, JOHN F LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

KINARD, KAREN ANN STAFF ASSISTANT 2,665.92 

HCMULLAN, ROBERT L LEGISLATIVE ASSISTANT 3,983.76 

MIGLIACCIO, CATHARINE SECRETARY 2,375.01 

MURPHY, DOROTHY LEGISLATIVE ASSISTANT 3,446.01 

PHILLIPS, SALLIE B LEGISLATIVE ASSISTANT 3,407.01 

POWERS, ELLA P INFORMATION AIDE 4,193.25 

RODGERS.RDTH C RECEPTIONIST 3,014.01 

SHEETS, VAN ALAN LEGISLATIVE ASSISTANT 3,014.01 

SKILLHAN,PRISCILLA S ADMINISTRATIVE ASSISTANT 6,053.76 

BILLIAHSON, DAVID PROJECTS ASSISTANT 2,929.25 



64 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. DON EDWARDS 



BORQUEZ, CECILIA A 
BRYAN, KATHEBINE 
FAY, GARY DOUGLAS 
FISHER, SALLY 
HAEBERLE, ROBERTA L 
HARRIS, MINNIE G 
HELM.MARCY A 
KROUDVIRD, SUSAN S 
LOFGREN, SUSAN E 
LUHPKINS, DORIS B 
MEDEIROS, ANNE BRADLEY 
MILLER, BARK HENRY 
POCHE, THERESE K 
STICKNEY,AILSA J 
HEBBER, IRENE H 
WIECKOWSKI, ROBERT A 
WYLIE, KAREN S 
ZEIFHA N.JEROME M 



SECRETARY $ 3,699.99 

STAFF ASSISTANT, TO AUG 31 1,083.34 

LEGISLATIVE ASSISTANT 5,625.00 

PRESS Altl U, 749. 99 

STAFF ASSISTANT 3,924.99 

STAFF ASSISTANT, FROM SEP 1 „ 687.95 

CLERK 2,750.01 

STAFF ASSISTANT 3,750.00 

ADMINISTRATIVE ASSISTANT 5,625.00 

OFFICE MANAGER 5,176.32 

ADMINISTRATIVE ASSISTANT 4,402.86 

STAFF ASSISTANT 3,750.00 

DIST COORDINATOR 4,500.00 

ADMINISTRATIVE ASSISTANT 9,100.89 

STAFF ASSISTANT 2,427.09 

STAFF ASSISTANT, TO AUG 31 1,375.84 

STAFF ASSISTANT, FROM SEP 1 541.67 

CONSULTANT 315.00 



OFFICE OF HON. JACK EDWARDS 

BELL,BELDEN HILL 
BREVARD, ELIZABETH A 
DECK, ROBIN A 
DIXON, OTTIE,JR 
DOLAN, PHILIP 
GRAY, DOROTHY ANN 
GUY, ELIZABETH ANNE 
HAMER, EUGENE F,JR 
JACKSON, CHARLES E 
KASPER,DEBRA LYNN 
LUFKIN, JACQUELINE LOUISE 
MAY, MAJOR PHILLIP 
MORTON, JOANN NETTLES 
NORRIS, WILSON C 
OMALLEY, CHARLOTTE C 
PELHAM,HARC PHUITT 
PRINCE, MILDRED A 
PRUITT, DAVID C , III 
SMITH, LARRY HERRING 
SWANZY, HENRY CLAY.JB 
TIPPINS, NANCY 
WATSON, JAMES ANDREW 



RESEARCH ASSISTANT, FROM SEP 1 500.00 

CLERK, TO AUG 22 1,033.34 

CASEWORKER 3,624.99 

STAFF ASSISTANT, TO AUG 31 900.00 

CLERK, TO AUG 19 816.67 

SECRETARY 3,125.01 

CLERK, PROM JUL 11 TO AUG 31 833.33 

RESIARCH ASSISTANT, TO AUG 31 1,458.34 

FIELD REPRESENTATIVE 4,687.50 

LEGISLATIVE AIDE 3,500.01 

CLERK, TC JUL 31 500.00 

DISTRICT REPRESENTATIVE 3,875.01 

SECRETARY 1,275.00 

FIELD REPRESENTATIVE 5,612.49 

SPECIAL ASSISTANT 5,000.01 

STAFF ASSISTANT, FROM AUG 20 683.33 

SECRETARY 2,375.01 

ADMINISTRATIVE ASSISTANT 9,900.00 

RESIARCH ASSISTANT., FROM AUG 16 1,700.00 

PRESS ASSISTANT 6,249.99 

SECRETARY 3,125.01 

CLERK, FROM AUG 1 TO AUG IS 

LBJ CONGRESSIONAL INTERN, TO JUL 22 900.00 



OFFICE OF HON. MICKEY EDWARDS 



BALDAUF,JILL CHRISTINE 
BELL,BELDEN HILL 
BINGHAM, SUSAN L 
BLAYLOCK, LINDA KATHLEEN 
CAMPBELL, PEGGY J 
CRAFT, JANE G 
DAVIS, DIANE C 
EDENS, MARILYN HATTESON 
ELLIOTT, BENTLY 
ERKE,CANDI SUE 
FOLEY, JUDY W 
HC BRIDE, C SCOTT 
MEIER, GREGORY GDILBERT 
MENSER, SHERMAN 
NEAL, RICKEY JOE 
PARKS, CAROL E 
PENICK, BARBARA V 
REINHART, BARBARA ELAINE 
SMITH, RUBY MAE 
SNIPES, KAY CAROL 
VOELKER, LARRY JOE 
WERNER, JACKIE LYNN 



SECRETARY, PROM AUG 1 TO AUG 31 

RESEARCH ASSISTANT 

SECRETARY, FROM SEP 12 

OFFICE MANAGER 

SECRETARY, FROM SEP 1 

SECRETARY 

SECRETARY, TO AUG 4 

DISTRICT REPRESENTATIVE 

PRESS SECRETARY, FROM JUL 11 

OFFICE MANAGER 

SECRETARY, FROM AUG 5 TO AUG 31 

LBJ CONGRESSIONAL INTERN, JUL 6 - AUG 5 

CHIEF LEGISLATIVE ASSISTANT 

FIELD REPRESENTATIVE 

ADMINISTRATIVE ASSISTANT 

CASE WORKER-RECEPTIONIST 

SECRETARY CASEWORKER 

SECRETARY 

OFFICE MANAGER 

FIELD REPRESENTATIVE 

FIELD REPRESENTATIVE 

FIELD REPRESENTATIVE 



416.67 
250.01 
527.78 
250.00 
055.55 
624.99 
755.56 
924.99 
444.45 
250.00 
400.00 
590.00 
125.01 
574.99 
599.99 
4 99.9 9 
499.99 
624.99 
2 50.00 
425.01 
425.01 
425.01 



OFFICE OF HON. JOSHUA EILBERG 



ATIERNO, JANET CAROLYN 
DULD, CHARLES P 
DUNNE, MARY 



SECRETARY 

DISTRICT OFFICE MANAGER 
EXECUTIVE SECRETARY .... 



3,275.01 
5,500.76 
4,127.67 



65 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. JOSHUA EILBERG -CONTINUED 



EGBERT, KAREN L 
EPSTEIN, BILLIAB 
FINES, BILLIAB B 
GIES, PATRICIA ANNE 
HALL, KAREN A 
HUHA, BARBARA JEAN 
IZES,SELHA L. 
KAHPLER, NINA L 
NELSON, NANCY 
SCBEHBL,ANNE K 
SEREHBOS, ROSEMARY KELLEY 
SHITH, CAROLYN P 

STBIJEBSKI,ALFREDA V 
TORHAN, PHYLLIS J 

ZACK, EUGENE C 



LEGISLATIVE AIDE $ 3,166.67 

EXECUTIVE ASSISTANT 6,500.01 

SPECIAL ASSISTANT 3,550.99 

OFC HGB IXEC SECY 4,875.00 

LEGISLATIVE AIDE 3,16U.55 

SECRETARY 4,082.49 

SECRETARY 8 1 2 . 4 9 

LBJ CONGBESSIONAL INTERN, TO JUL 31 590.00 

SPECIAL ASSISTANT 1,241.67 

SECRETARY 2,935.23 

SECRETARY 1,800.00 

SECRETARY, TO AUG 31 

SECRETARY, FROB SEP 5 3,990.09 

SECRETARY 1,650.58 

SECRETARY 3,187.50 

AOHINISTRATIVE ASSISTANT 9,084.00 



OFFICE OF HON. DAVID F EMERY 



BASS, CHARLES F 
BATES, BELINDA 
BENNETT, BEREDITH 
BICKBORE,HATTIE B 
BUBB, PETER H 
CRAIG, BICHAEL T 
GARDINER, PHYLLIS 
GILBERT, CASS A 
GOGGIN.JABES GEOBGE 
GOODRIDGE, PAULA F 
LEUPOLD,KIB EILEEN 
BCBAHON.JABES K 
BOLLBB,B B COLLIN 
BORRELL, SANDRA 
NIGH TING ALE, CAROLYN 
SHITH, CHARLES H 
SBITH, GEORGE A 
STICKNEY, ELISABETH S 
TOBBACA,LAUBETTA 
WHALEN, ANNIE LAURIE 



ADMINISTRATIVE ASSISTANT 8,000.01 

STAFF ASSISTANT, TO AUG 31 1,666.66 

STAFF ASSISTANT 2,958.33 

CASEWORKER 3,249.99 

DISTRICT FIELD BEP 2,750.01 

PRESS SECRETARY 3,999.99 

LEJ CONGBESSIONAL INTEBN, TO JUL 31 590.00 

FIELD REPBESENTATIVE 2,750.01 

STAFF ASSISTANT, TO AUG 31 1,500.00 

STAFF ASSISTANT 2,499.99 

SECBETABY 2,625.00 

DISTRICT AEBINISTBATOR 4,833.34 

LEGISLATIVE ASSISTANT 3,500.01 

SECBETABY 2,750.01 

LEGISLATIVE ASSISTANT 3,500.01 

FIELD REPBESENTATIVE 3,000.00 

EXECUTIVE ASSISTANT 4,509.16 

LBJ CONGBESSIONAL INTERN, AUG 1 - AUG 31 590.00 

FIELD REPRESENTATIVE 2,499.99 

LEGISLATIVE AIDE 2,666.66 



OFFICE OF HON. GLENN ENGLISH 



ARCHER, DONNA COTTBELL 
BOUCK,GAIL P 
DAGE,GABY G 
DUTTEBEB, JUDITH B 
GOWDY,B CATHERINE 
HART,VEBDA I 
HENDERSHOT, LINDA BABY 
PARKEB,H TERECE 
PURSLEY, SHARON KAY 
REITZ.KEB 
BISTOH, STEPHEN F 
TROJAN, DAVID 
SEEKS, LOO ANNE DINGER 
iHITE, BETTY JOYCE 
WOLFE, PEGGY B 



LEGISLATIVE ASSISTANT 3,416.66 

LEGISLATIVE CORRESPONDENT 2,791.67 

AEBINISTBATIVE ASSISTANT 10,150.00 

PERSONAL SECBETABY 4,916.66 

CLEBK, TO JUL 31 550.00 

DISTRICT BEPBESENTATIVE. , TO SEP 9 1,437.50 

CLEBK 2,729.17 

RECEPTIONIST 2,166.67 

CASE WORKER 3,416.66 

CLERK 1,200.00 

PRESS ASSISTANT/STAFF DIBECTOR 7,433.34 

LEGISLATIVE ASSISTANT 4,749.99 

SECBETABY 2,466.67 

DISTRICT BEPBESENTATIVE 3,354.17 

DISTBICT BEPBESENTATIVE 2,533.34 



OFFICE OF HOB. JOHN N EBLENBORN 



BUBNEI, TERESA L 
CABHABT,BARY F 
CHAPIH, BICHAEL B 
GALEN, RICHARD A 
GARZA, DEBORAH ANN 
HANS, DOROTHY J 
HOEPPNER, CHARLES STEPHEN 
LOCKABD, LESLIE A 
BAXBELL, JOANNE D 
BCKENNEI, KATHLEEN 
BILLEB, JANICE 
BUBBAY,LOBNA C 
NOURNAN, CLAUDIA P. 
ROEDEBEB.JUDY ANN 
SLADEK, CAROLYN B 



SECRETARY-BECEPTIONIST 2,124.99 

SECRETARY 2,750.01 

PBESS SECBETABY 5,125.00 

PRESS SECRETARY, FROB SEP 22 437.50 

LEJ CONGBESSIONAL INTERN, TO JUL 31 590.00 

SECRETARY 3,625.00 

CLERK, TO AUG 18 944.00 

CLEBK TYIIST 2,750.01 

EXECUTIVE ASSISTANT 4,708.33 

CLEBK 2,100.00 

SECBETABY 2,499.99 

SECBETABY 625.00 

SECBETABY 2,375.01 

SECBETABY 3,375.00 

AEBINISTBATIVE ASSISTANT 6,916.67 



66 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HOB. JOHN N ERLENBCRN -CONTINUED 



TARRIS, BARBARA JOAN 
WOOD,BS0CE CHARLES 
ZEPP.RUTH GLENDA 



SECRETARY $ 3,000.00 

RESEARCH ASSISTANT 3,999.99 

EXECUTIVE SECRETARY 6,541.67 



OFFICE OF HON. ALLEN E ERTEL 



BLANEY.ANNNARIE P 
BROBST, WILLIAM L 
BRYANT, ARTHUR H 
ESHENBAUGH, REBECCA L 
KUTNEY,JOHN J 
PLFBANI, JOli WARREN 
RAKER, DAVID C 
RAWITSCHER.KATHERINE G 
RITTER, DOLORES H 
RODGERS, CAROLINE A.C. 
RORKE,JAHES T,JR 
ROSS, SHEILA H 
ROTONDI, PHILLIP W 

SHOENER,STEVEN ERIC 
SHUTT, BARRY LEE 
SMITH JR, JOSEPH OLIVER 
SPIELMAN, BEATRICE 
TONNELL, DANIEL ROBINSON 

SELLS, THOMAS M 
WHITE, JOSEPH ELDON 



STAFF ASSISTANT 3,775.00 

PRESS SECRETARY 5,578.73 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

STAFF ASSISTANT 1,899.99 

ADMINISTRATOR, FROM AUG 1 3,500.00 

ADMINISTRATIVE ASSISTANT 8,050.00 

STAFF ASSISTANT, TO AUG 31 3,199.92 

STAFF ASSISTANT, FROM SEP 6 763.89 

STAFF ASSISTANT 3,199.99 

STAFF ASSISTANT, FROM SEP 16 739.75 

STAFF ASSISTANT 2,966.67 

STAFF ASSISTANT » 2,975.00 

STAFF ASSISTANT, TO JUL 31 

LEGISLATIVE ASSISTANT, FROM AUG 1 5,266.67 

STAFF ASSISTANT, TO AUG 31 2,116.66 

STAFF ASSISTANT, FROM JUL 5 1,553.67 

STAFF ASSISTANT 2,900.01 

STAFF ASSISTANT, TO JUL 31 511.67 

ADMINISTRATIVE ASSISTANT, TO JUL 31 

STAFF ASSISTANT, FROM AUG 1 1,333.33 

ADMINISTRATIVE ASSISTANT, TO JUL 31 2,166.67 

STAFF ASSISTANT 750.00 



OPFICE OF HON. BILL LEE EVANS 



AMATO, CAROLYN HANSEN 
BARNES, WILLIAM T,JR 
BEALL, DENNIS J F 
BROWN, RUDOLPH OTIS 
CLARK, LEM JAY.JH 
DAY.ANGELINE 
ELLIS, KATHLEEN H 
JOHNS, CHARLES HAMILTON 

JOHNSON, ELSIE S 
LEE.S. V. 

MC KENDALL,KRISTIN F 
NIRENSTEIN,HARCIA 
PARKER, LAURA ROSS 
PARRISH, MARTHA B 
ROBERTS, REGINALD E 
SHAFFRAN.JOAN GLORIA 
WADE, PAUL CHRISTOPHER 
WRIGHT, WALLACE R 



PRESS AIDE 

SPECIAL PROJECTS AIDE 

DISTRICT CONSTITUENT AIDE 

DISTRICT AIDE 

LEGISLATIVE AIDE 

DIST OFFICE HNGR 

RECEPTIONIST 

DISTRICT CONSTITUENT AIDE., TO AUG 31 . 
DISTRICT CONSTITUENT AIDE, FROM SEP 5 

ADVISORY COMMITTEE SECRETARY 

DISTRICT AIDE 

LBJ CONGRESSIONAL INTERN, TO AUG 11 ... 

STAFF AIDE, TO SEP 15 

RECEPTIONIST 

PERSONAL SECRETARY 

DISTRICT CONSTITUENT AIDE 

STAFF ASSISTANT, TO JUL 31 

STAFP AIDE 

ADMINISTRATIVE ASSISTANT 



,999.99 
621.99 

750.00 
000.00 
124.99 
,550.00 
550.0.0 

,750.00 
500.00 

,350.00 
110.00 
2 50.0 

,683.31 
750.00 

,750.00 
100.00 
500.01 

,999.99 



OFFICE OF HON. DAVID W EVANS 



ADOLAY, BARBARA D 
BEACH, JOHN R 
CLEMENTS, BARBARA ANNE 
DOGAN.JOHN C 
EISENSTADT, LINDA 
ELLER,DEAN C 
GRABOWSKI.SUE 
GRADE, DENISE A 
HARRIS, NANCY I 
KERN, THOMAS J 

KEVITT,MARK B 
KIRKPATRICK, SALLY ANNE 
LAKIN, DAVID N 
MAPPES, STEVEN H 
MILLER, TIM 

MYERS, MARTHA JEANETTE 
PALMER, CAROLYN 
RINGER, DEBORAH J 

SCALES, CAMILLA JEAN 



CASEWORKER 

PRESS SECRETARY, FROM SEP 1 

STAFF ASSISTANT 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 

SECRETARY 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 

RESEARCH ASSISTANT., TO JUL 31 

CASEWORKER 

SECRETARY 

ADMINISTRATIVE ADVISOR, TO JUL 31 

ADMINISTRATIVE AIDE, FROM AUG 1 

STAFF ASSISTANT, FROM SEP 1 

RESEARCH ASSISTANT 

PRESS SECRETARY, TO AUG 15 

AREA REPRESENTATIVE 

ADMINISTRATIVE AIDE 

DISTRICT OFFICE MANAGER 

PRESS OPERATOR, TO JUL 31 

RECEPTIONIST, TO AUG 31 

STAFF ASSISTANT, FROM SEP 1 

SECRETARY, TO JUL 31 

STAFF ASSISTANT, FROM AUG 1 



,750.01 
916.67 
,633.33 
,200.00 
,250.00 
700.00 
,200.00 
,574.99 
,770.00 

,513.01 
,050.00 
,600.00 
,781.25 
,375.01 
,550.01 
,749.99 
750.00 

,350.01 

,383.33 



67 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. DAVID V EVANS -CONTINUED 



TOLOHEO, MARTIN E,JS 
VAN DE LOO, JOSEPH P 
WALTON, CHAHLENE 

WHALING, ROBERT E,JR 
BILHITE, CAROL LYNN 



LEGISLATIVE ASSISTANT $ U, 749. 99 

LEJ CONGRESSIONAL INTERN, JOL 15 - SEP 14 1,180.00 

CASEWORKER, TO JOL 31 

STAFF ASSISTANT, FROH AUG 1 1,999.99 

STAFF ASSISTANT, FROH SEP 1 700.00 

BECEPTIONIST-DISTRICT 2,199.99 



OFFICE OF BON. FRANK E EVANS 



BARRY, RACHEL 0. 
CAMPBELL, AARON R 
CIRULI, FLOYD 
DIAZ, MANUEL H 
DURIGON,VEBA LOU 
F2INTHEL, CAROL SUE 
GARCIA, MARTHA L 
GARDNER, EDWARD E,JR 
GIBSON, ARCH E 
HEALY, ROBERT L,JR 
HULSHIZER,R DALE 
LARSEN, BARBARA EWING 
LENTINI, ELIZABETH 
NAVARRO, ALBERTA L 
NELSON, JOHN BYFON,III 
0' DONNELL,KATHYLYNN 
STFICKLETT,JOHN R 
TALBOT, STEPHANIE 
TATNALL, CAROLYN LEA 
TURHAN, ROBERT L 



STAFF ASSISTANT 

STAFF ASSISTANT, FROM SEP 1 

STAFF 

ASSISTANT , 

CASEWORKER 

DISTRICT REPRESENTATIVE 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT 

ADMINISTRATIVE ASSISTANT 

SECRETARY 

TO JUL 31 

SECRETARY 

PRESS SECRETARY 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT, TO AUG 31 

SECRETARY 

LBJ CONGRESSIONAL INTERN, TO JUL 31 



900.00 
400.00 
,749.99 
,421.25 
,742.89 
,125.01 
,397.22 
,614.35 
,951.09 
300.00 
,225.00 
,609.24 
500.00 
,249.99 
,250.00 
600.00 
900.00 
800.00 
,807.19 
590.00 



OFFICE OF HON. THOMAS B EVANS JR 



ANDRUKITIS, BARBARA D 
AUTH,JUDY W 
BZDNARSKI, BONNIE FAYE 
CARMINE, FERRELL D 

COVER, VALERIE LEWIS 
ECKMAN,RICHAFD P 
GILES, JOHN RUSSELL 
KARBONIT, PEGGY J 
KENDALL, WILLIAM T 
KNEISLEY, EVELYN MARION 
KREUER, BARBARA J 
MANKIN,RUTH L 

HC CARTAN,A. SUSAN 

MC CRONE, CATHBYH L CARROLL 

MESSICK, NEIL TILDEN 

PARADISE, RITA K 

RANKEN.H TUCKER 

PATTE, KATHLEEN I 

TANSEY.JOAN N 

WYER, WILLIAM C 



PERSONAL SECRETARY 6,000.00 

LEGISLATIVE SECRETARY 3,249.99 

SECRETARY 1,875.00 

STAFF ASSISTANT, FROM AUG 1 

LBJ CONGRESSIONAL INTERN, TO JUL 31 1,721.67 

RECEPTIONIST 2,375.01 

RESEARCH ASSISTANT 4,166.67 

CLERK, TO AUG 31 800.00 

RESEARCH ASSISTANT, FROM AUG 1 TO AUG 31 500.00 

ADMINISTRATIVE ASSISTANT 7,311.67 

DISTRICT SECRETARY 3,624.99 

STAFF ASSISTANT, FROM SEP 1 583.33 

PRESS SECRETARY, TO JUL 31 

PRESS SECRETARY, FROH SEP 1 1,250.00 

RECEPTIONIST 2,250.00 

PRESS AIDE 2,499.99 

LEGISLATIVE ASSISTANT 6,099.99 

RECEPTIONIST, TO JUL 31 583.33 

CASEWORKER 2,625.00 

SECRETARY 3,125.01 

CASEWORKER 3,875.01 

EXECUTIVE AIDE 9,000.00 



OFFICE OF HON. JOHN G FARY 

ANDERSON, SANDRA LYNN 
BANKS, VICTORIA 
CAMPBELL, THOMAS J 
DESECKI, ALFRED C 
GSORGALAS, ELEANOR 
HEALY, MICHAEL T 
HOULIHAN, JOHN 
JDSKENAS.ALGIS 
KELLER, YVONNE A 
KOLLN, ANGELA T 
KOLOWSKI, PHILLIP 
LA FRANCA, BERNADETTE ANN 
BARQUEZ, DANIEL J 
MC INERNSY,JOHN E 
MOORE, JAMES A,JR 
PIZNCZAK,EDSARD J 
PRUCHA, PEARL ROSE 
SCHWAB, MICHAEL W 



CLERK 

CLERK, FROM AUG 1 

STAFF AIEI 

ADMINISTRATIVE ASSISTANT 

CLERK 

CLERK, TO JUL 31 

CLERK 

CLERK 

CLERK 

SECRETARY, FROM SEP 3 

CLERK 

RECEPTIONIST 

CLERK, FFCH SEP 1 

CLEBK, TO AUG 15 

CLERK, TO JUL 31 

ADMINISTRATIVE ASSISTANT-CHIC 

CLERK 

CLERK 



,375.01 
,683.34 
,991.66 
,741.66 
,839.21 
,048. 30 
,525.01 
,366.59 
,366.59 
731.11 
,000.00 
,049.75 
,000.00 
,187.50 
,048.30 
,598. 14 
,500.01 
,411.67 



68 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. JOHN G FARY -CONTINUED 



WALTER, REGINA ELIZABETH 
WYNNYK,ANNA 



CLERK, TC AUG 31 $ 1,616.66 

LBJ CONGRESSIONAL INTEBN, TO JUL 5 98.33 



OFFICE OF HON. DANTE B FASCELL 



BURRIS, BARBARA DIANE 
CALLESIS,SUE CLAIBE 
CLEMENT, NABIE D 
CORBETT,ANNE HAHER 
FISHEB,TAD P 
JOHNSON, OSCAB B 
KING, DENNIS J 

KINNALLY,CATHEBINE A 
KORGE,THOHAS J 
LEVIN, LEON 

HETZGER.CHBISTINE IBENE 
MILLS, BEVEBLY ANNE 
MOSS, PAH 

OBEGAN,CHABLES R 
SCHMITZ,MABCIA ALLEN 
SELVES, KATHLEEN LOGGAN 
SHAMES, SANA A 
TIDMAN,BEBECCA 



SPEC ASST PRESS 

DISTBICT OFFICE MANAGES 

LEGISLATIVE AIDE 

DISTRICT OFFICE SECRETARY.. .. 

CLERK, FBOH SEP 1 

LEGISLATIVE AIDE 

LEGISLATIVE AIDE, TO JUL 31 .. 
LEGISLATIVE AIDE, FROM AUG 5 

RECEPTIONIST 

STAFF ASSISTANT, TO JUL 24 ... 
DISTBICT OFFICE STAFF ASST ... 

STAFF ASSISTANT 

DISTRICT OFFICE SECRETARY .... 

CLERK 

ADMINISTRATIVE ASSISTANT 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT 

LEGISLATIVE AIDE 

STAFF ASSISTANT 



,500.00 
,750.00 
,450.00 
,000.00 
400.00 
,750.00 

,750.00 
,325.00 
,200.00 
,400.00 
,000.00 
,300.00 
,136.00 
,250.00 
,750.00 
,300.00 
,925.00 
,600.00 



OFFICE OF HON. WALTER E FAONTROY 



BANKS, JONETTA D 
BARNES, JOHNNY 

BLACK, ALMA E 
BUCKNEB, LLOYD 
DAVIS, JUNE E 
DinGS, WANDA P 
GREENE, YVONNE J 
HARBIS, JOYCE S 
HART,JUANITA R 
JACKSON, BARBARA C 
JOHNSON, WINNIE J 
KING, WAYNE PBESTOt 
LEE, HOWARD 
LESIS.JEFFBEY R 
MCCALL,LANDEN 

HCNEAL, BARBARA B 
PAIGE, THELMA 
PEBALES.JOSIE 
SELLERS, BRENDA C 
SMITH, CLIFTON B 
SMITH, PAMELA H 
SPEARMAN, ELDBIDGE 

TREADWBLL, JOYCE 



CASEWORKER 

LEGISLATIVE ASSISTANT, TO AUG 31 ... 
LEGISLATIVE ASSISTANT, FROM SEP 5 . 

RECEPTIONIST 

CASEWORKER, FROM SEP 1 

CLERK TYPIST, TO JUL 31 

CASEWORKER 

BECEPTIONIST 

OFFICE MANAGER 

CASEWORKER, FROM AUG 1 TO SEP 15 .. 

LEGISLATIVE SECRETARY 

RECEPTIONIST-TYPIST 

STAFF ASSISTANT 

LEGISLATIVE ASSISTANT 

CASE WORKER., FBOH AUG 1 

STAFF ASSISTANT, TO AUG 31 

CASEWORKER, FROM SEP 5 

CASEWORKER, TO JUL 31 

CLERK TYPIST., TO JUL 31 

CLERK TYPIST, FBOH AUG 8 

CLERK TYPIST 

DISTRICT OFFICE DIRECTOR 

LBJ CONGRESSIONAL INTERN, TO JUL 15 

STAPF ASSISTANT, TO JUL 31 

PRESS ASSISTANT, FROH AUG 1 

CLIBK TYPIST, FBOH SEP 16 



,624.99 
,250.00 
687.50 
589.58 
,249.99 
,026.97 
,109.15 
417.69 
,820.13 
,625.01 
,806.83 
,624.99 
,375.00 

,358.68 
880.57 
625.00 
,148.33 
,362.71 
,017.93 
295.00 

,531.72 

162.50 



OFFICE OF HON. HILLICENT FENWICK 



ALLEN, MARGARET ANNE 
ARMSTRONG, CATHERINE B 
BARROW, NATTIE H 
BENARDE, F ANDREA 
CANIS,WILLIAH 
DEMAREST, LEIGH 
GERVASIO,EMILIO J 
HEYEBDAHL, VIRGINIA A 
JOHNSON, VIRGINIA R 
KREITZBERG, ELLEN 
KROL.YOLANDA LOUISE 
LEWIS, ROBERT R,JR 
HCLOUGHLIN,HOLLIS S 
RILEY, KATHRYN W 
SCHMIDT, JOHN H 
SHEDD, JEFFREY T 

STEWABT, CAROLE ANN 
TENEYCK, SHIRLEY R 



LEGISLATIVE AIDE 3,749.99 

SECBETABY 4,455.27 

STAFF ASSISTANT 4,125.00 

BECEPTIONIST, TO AUG 31 1,583.34 

LEGISLATIVE ASSISTANT ,. 4,250.01 

RECEPTIONIST, FROH AUG 29 800.00 

DISTRICT ASSISTANT, FROM AUG 8 TO AUG 31 370.56 

STAFF ASSISTANT , 2,620.74 

DISTRICT STAFF ASSISTANT 3,302.16 

LEGISLATIVE ASSISTANT 3,624.99 

STAFF ASSISTANT 4,355.52 

INTERN, FROH JUL 5 TO AUG 31 1,101.33 

ADMINISTRATIVE ASSISTANT 6,875.01 

STAFF ASSISTANT, FROM AUG 22 975.00 

STAFF ASSISTANT 3,166.67 

INTERN, FROH JUL 9 TO JUL 15 

LEJ CONGRESSIONAL INTERN, TO JUL 8 295.00 

STAFF ASSISTANT 2,124.99 

DISTRICT STAFF ASSISTANT 2,499.99 



69 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. PADL PINDLBY 



BLEVINS, CATHY 
BORHAN,IAN DALE 
CINDBICH.KABEN 
GA CERT, CAROL J 
GINNBTT,SHERRILL A 
G0RNEY,HABIJ0 
GBEGG,E CLARK, JR 
HARBISON, PAOLA LETITIA 
LEKA,NIANA HELEN 
METER, KAREN 
NORTON, DONALD B 
RAPPS, DONNA MARIE 
RATHBON.ANNA B 
TEGEDEB, CHARLOTTE J 
TEBIO, VICKIE H 
SICHSSR, ROBERT J 



SECT TO LEGIS ASST $ 2,375.00 

SPECIAL ASSISTANT 6,550.01 

PERSONAL SECRETARY 3,581. 24 

CASEWORKER 2,875.01 

SECRETARY 2,625.00 

LEGISLATIVE ASSISTANT 3,706.25 

STAFF ASSISTANT 2, 604.16 

CLERK 1,358.34 

SECRETARY 3,312.50 

CASE NORKER 2,549.99 

AIBINISTRATIVE ASSISTANT 8,299.99 

SECRETARY 2,312.51 

SECBETABY 2,444.99 

STAFF ASSISTANT, TO JOL 31 1,000.00 

PEBSONAL SECBETABY 3,581.24 

ADMINISTRATIVE ASSISTANT 8,299.99 



OFFICE OF HON. HAHILTON FISB OB 



BARRY, JOHN D 
BAOGHN, PATRICIA J 
BUCHANAN , LAURIE JEAN 
CAVANAOGH, SHIRLEY J 
CLOi, MARIAN G 
DRAGO, CHARLES G 
ELLSWORTH, AOGOSTA H 
ELY,AYA H 

FRIEDMAN, MARY ELEANOR 
F0IHARELLO,HELEN 
HOFFHANN,SHELVA B 
JOHNSON, JEH CHARLES 
HABKOBITZ, HORRY B 
HOTZKIN, BARRY 
NACCARATO, JOHN J 
PEDERSON, DOROTHY B 
SCHINDLER,GERALDINE V 
TIEBNEY, PATRICIA H 
TRABER, JANICE ANN 



ADHINISTRATIVE ASSISTANT 10,075.26 

LEGISLATIVE AIDE - RESEARCH 2,964.33 

PRESS ASSISTANT 3,772.91 

CASEWORKER 4,988.50 

SECRETARY 2,015.04 

LEGISLATIVE ASSISTANT, TO AOG 8 2,111.11 

SECRETARY-DISTRICT OFFICE 2,470.87 

PERSCNAL SECRETARY 6,429.24 

RECEPTIONIST 2,774.33 

SECBETAHY-DISTRICT OFFICE 2,502.81 

SECRETARY 3,621.87 

CLERK, FROM AOG 1 TO AOG 31 150.00 

CLERK 3,152.01 

LEJ CONGRESSIONAL INTEBN, TO JOL 31 590.00 

DISTBICT ADBINISTHATOB 4,836.75 

SECRETABY-EISTBICT OFFICE 2,053.74 

CASE WCBKER DISTBICT OFFICE 2,129.49 

CASEHORKER (DISTRICT) 2,090.49 

PRESS SECRETARY 4,147.25 



OFFICE OF HON. JOSEPH L FISHER 



ATTKISSON, PATRICIA 
CANNON, GEOBGE R 
FABEB.ADELE 
GBABAH, ELIZABETH H 
GBAY,CABOLE V 
GREEN, ROBERT HARRY 
HUTCHINSON, CELENA V 
KANTER.HOTH F 
KERR, DAVID S 
KLIHK, MARIANNE B 
MCDONALD, JEAN K 
MILLIKEN, JOHN G 
0*DONNELL,KATHYLYNN 
ODDENINO,JODY A 
QOINTA, DONNA 
SILVER, JOY B 
STAAB.HIKKI 
STOWERS,BARCIA H 
RILE, DONNA M 
RILLIABS, JANICE CLAIRE 



RECEPTIONIST 

STAFF ASSISTANT 

LEGISLATIVE ASSISTANT 

CASEHORKER 

CASEWORKER 

TAX COUNSEL 

SECRETARY 

STAFF ASSISTANT 

LBJ CCNGBISSIONAL INTERN, TO JUL 31 ... 

LEGISLATIVE ASSISTANT 

PRESS SECRETARY 

ADHINISTRATIVE ASSISTANT 

STAFF ASSISTANT, FROH AOG 1 TO AOG 3 1 

STAFF ASSISTANT 

CASE WORKER 

LEGISLATIVE ASSISTANT 

CASEWORKER 

STAFF ASSISTANT, FBOH SEP 1 

RECEPTIONIST 

SPECIAL ASSISTANT 



075.18 
600.01 
000.00 
369.64 
047.00 
591.25 
214.98 
600.01 
500.00 
333.23 
913.89 
107.32 
300.00 
280.00 
600.01 
913.89 
774.09 
216.67 
415.00 
032.14 



OFFICE OF HON. FLOYD J FITHIAN 



ABBOTT, KEITH F 
AFFOLDEB,TAYA RENE 
BEERY, LELAND H 
BELLAHY.ERIC D 
BEBHY, NANCY LETA 
BOCKLET, BENDY A 
BDBKBABDT.VIBGINIA BEHIS 
DEVYAK,DEBRA J 
DOHETT.ARDIS 

ETTER,SOSAN CLARK 



ADHINISTRATIVE ASSISTANT 

BAILINGS COOBDINATOR/ SECBETARY 
DIRECTOR OF SPECIAL PROJECTS ... 

STAFF ASSISTANT, TO JOL 31 

RECEPTIONIST 

CASE WORKER., TO SEP 21 

SECBETABY, TO JOL 31 

SECBETABY, FROH AOG 1 

CHIEF CASE NORKER, TO JOL 31 . . . 
CHIEF CASEWORKER, FROH SEP 9 .. 
CASEWORKER, FROB AOG 15 



,000.00 
,562.51 
,300.00 

500.00 
,750.01 
,935.01 

812.00 
,541.66 

,625.00 
,022.23 



70 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. FLOYD J FITHIAN -CCBTINDED 



FRENGER, CYNTHIA SUE 
GREALY, CATHERINE 
HARRIS, RICHARD ALLAN 
KINAS.JOHN 

MONRO, EDITH H 
HUNRO,LORENA HAE 
NICE,MARJORIE H 
NICE, STAN 
PENMAN, AMY 
SMITH, REX W 
STICKLE, WARREN E,III 
VAN HORN, MARILYN A 



SECRETARY S 2,874.99 

LEGISLATIVE AIDE/ REQUESTS 2,625.00 

DISTRICT ASSISTANT 3,750.00 

INFORMATION DIRECTOR, TO AUG 31 

LEGISLATIVE AIDE, FROM SEP 5 4,125.00 

RECEPTIONIST 2,874.99 

REGIONAL OFFICE MANAGER, FROM ADG 1 TO AUG 31 1,375.00 

SECRETARY 2,250.00 

BOEILE OFFICE OPERATOR 3,750.00 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

PRESS SECRETARY 4,299.99 

LEGISLATIVE ASSISTANT 6,000.00 

CASEWORKER 2,950.01 



OFFICE OF HON. RONNIE G FLIPPO 



ARRINGTON, LAURA 
COLLINS, AMY DIANE 
DIMOND, ELIZABETH F 
HALE.JOCELYN 
HETTINGER, STEPHEN R 
JONES, JEFF 
JONES, OLIVER C 
JORDAN, LINDA S 
KENNEDY, JERRY W 
MADDEN, NANCY H 
MERROW, ANDREW THOMAS 
RASCO, WILLIAM EARL 
ROBERTS, LAORA 
TOOHEY,J FRANCIS 
WALLACE, VICKI P 
WEDIN, JULIE A 



SECRETARY 2,630.01 

SECRETARY 2,799.99 

DISTRICT SECRETARY 2,208.33 

SECRETARY, TO AUG 31 850.00 

DISTRICT REPRESENTATIVE 4,833.33 

CLERK, TO AUG 15 900.00 

EXECUTIVE AIDE 6,875.01 

PERSONAL SECTY TO MC, TO JUL 21 1,040.00 

RESEARCB/INFORMATION ASSISTANT, FROM AUG 1 ... 3,333.34 

PERSONAL SECRETARY, FROM JUL 11 3,111.12 

CLERK 2,416.67 

ADMINISTRATIVE ASSISTANT 10,292.20 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

LEGISLATIVE AIDE 8,750.01 

CASEWORKER 3,755.01 

LEGISLATIVE SECRETARY 3,504.99 



OFFICE OF HON. DANIEL J FLOOD 



AURON, MARSHAL S 
BAUMGARTNER, PEGGY R 
BELL, GEORGE T,III 
CASEY, LAWRENCE J 
CLARK, MICHAEL A 
GUPENIAN, EILEEN R S 
HANOVER, ROBERT D 
JONES, HUGH T 
KULICK, ROBERT JOHN 
MAKOWSKI, THOMAS A 
MASKIN,ARVIN 
MCDERMOTT,JOHN A 
PERRY, CATHERINE 
SHEERIN, SARAH MARIE 
THOMAS, DOUGLAS 
TOMASCIK, HELEN B 
WINKLER, LINDA M 
WYSOCKI.HARICLARE E 
YOURISHIN,LEONA M 



CLERK, TO AUG 31 

SECRETARY 

LBJ CONGRESSIONAL INTERN, TO AUG 14 

PRESS SECRETARY 

CLERK 

SECRETARY 

ADMINISTRATIVE SECRETARY 

SPECIAL ASSISTANT 

CLERK 

CLEEK 

CLERK 

CLERK 

CLERK 

ASSISTANT SECRETARY 

SPECIAL ASSISTANT 

EXECUTIVE SECRETARY , 

CLERK, TO AUG 12 

DISTRICT SECRETARY 

ASSISTANT SECRETARY 



000.00 
000.00 
865.33 
561.51 
571.30 
467.25 
230.21 
306.01 
000.00 
585.43 
250.00 
880.56 
249.99 
193.19 
415.81 
900.00 
700.00 
773.99 
787.22 



OFFICE OF HON. JAMES J FLORIQ 



DALTON, DANIEL J 
DOWLING, KEVIN PATRICK 
DOWLING, SARAH 
DUTY, GAY A 
GATTY, ROBERT C 

HIGHAM, DAVID WAYNE 
HILL, DORIS L 
HONER, CATHERINE A 
KDNZ, PHILIP E 
MADRACK, BERNARD C 
MANNELLA, CHARLES J 
MILLER, DONNA A 
HONDILE, MARIA A 
PARMELEE.KEN 
HAGSDALE, URSULA V 
SALEMA, JOSEPH C 
SALEMA, JOSEPH S 



DISTRICT AIDE 3,675.00 

SPECIAL ASSISTANT 2,499.99 

DISTRICT AIDE 3,624.99 

EXECUTIVE ASSISTANT 4,137.01 

ADMINISTRATIVE ASSISTANT, TO JUL 31 

ADMINISTRATIVE ASSISTANT, FROM AUG 5 8,804.49 

LEGISLATIVE ASSISTANT 3,375.00 

DISTRICT AIDE 2,100.00 

DISTRICT AIDE 2,375.01 

SPECIAL ASSISTANT, TO ADG 31 2,416.66 

STAFF ASSISTANT 2,175.00 

DISTRICT AIDE 3,675.00 

DISTRICT AIDE 2,150.01 

DISTRICT AIDE 2,250.00 

LEGISLATIVE ASSISTANT, FROM SEP 1 1,333.33 

RECEPTIONIST, TO AUG 12 1,050.00 

DISTRICT MANAGER 5,124.99 

DISTRICT AIDE 3,675.00 



71 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. JAHES J FLOBIO -CONTINUED 



S1NDERS, BALTER ALFRED 
THOHAS, PAOL E 
HATSON, JONE R 



LEGISLATIVE ASSISTANT S 3,2U9.99 

DISTRICT AIDE 2,175.00 

STAFF ASSISTANT, FROM ADG 15 1,150.00 



OFFICE OF HON. HALTER FLOWERS 



ARCHIBALD, KATHERINE 
BURNS, BEVERLY C 
CALLABAT, BETTY ALLEN 
DEARBAN,ANDBEB J,JB 
DELOACH.HARY B 
PLETCBER, ELISABETH H 
FORT,SAH B,JB 
GRIHES, THOHAS A 
HOOD, DERRICK B 
KEEFER, JOSEPH D 
LAKE, AUBREY B 
PORCH, BROOKS L 
SHITH,HILYN B 
SPENCER, BILLIE DABSON 
TBOHAS, CHARLES H 
BHITE, GEORGE PHILLIPS, III 
SOOD, BOBBY C 
HOODLET,«ART FRANCES 



CLERK 2,650.00 

EXECUTIVE ASSISTANT 7,125.00 

DISTRICT SECRETART 2,350.00 

DISTRICT REPRESENTATIVE 8,750.01 

SECRETARY 3,225.01 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

DISTRICT REPRESENTATIVE 3,000.00 

CLERK 1,500.00 

DISTRICT AIDE 1,500.00 

PRESS ASSISTANT 6,000.00 

CLERK 650.00 

SUBHER INTERN, TO JUL 14 280.00 

CASESOBKER 2,500.00 

DISTRICT REPRESENTATIVE 2,100.00 

DISTRICT REPRESENTATIVE 3,750.00 

SUHHER INTERN, TO AUG 6 720.00 

LEGISLATIVE ASSISTANT 5,625.00 

SUHHER INTERN, TO JUL 17 283.33 



OFFICE OF HON. JOHN J FLYNT JH 



BROBN, VIRGINIA SUSAN 
BURSON, CAROLYN B 
CARTER, THOHAS B 

GRANTHAM, flAFTHA CECIL 
GREY, THOHAS B 
HARRIS, BILLIAH CAHP 
HOOCK, LAURIE A 
JOINER, RAE C 
JONES, EDNA BOODS 
LEATHERS, CLARENCE L 
LONG.EDBARD L,JB 
LUCAS, NARY LOU 

PITTS, HARION 

PRUITT .CHRISTOPHER J 

SHANKS, DOLOBESE H 

SUTTON, VANESSA 
BARREN, ANN H 
YOHE, DONALD SCOTT 



CLERK 

SECRETARY 

STAFF ASSISTANT, TO JUL 31 

PRESS SECRETARY, FROH AUG 1 

STAFF HEHEER 

DISTRICT STAFF 

CLERK, TO SEP 6 

STAFF ASSISTANT 

DIST OFFICE HNGR 

CLERK 

ASST TO AtHIN ASST, TO JUL 31 

LBJ CONGRESSIONAL INTERN, TO AUG 5 

SECRETARY, TO JUL 31 

AEHINISTEATIVE ASSISTANT, FROH AUG 

LEGISLATIVE STAFF ASSISTANT 

CLERK, FRCH SEP 12 

STAFF ASSISTANT, TO JUL 31 

HANAGER-DIST OFFICE, FROH AUG 1 ... 

STAFF ASSISTANT 

SECRETARY 

STAFF ASSISTANT 



,724.91 
,782.12 

,020.83 
,358.69 
,550.00 
,320.00 
,400.00 
,208.33 
,669.06 
,833.33 
688.33 

,106.58 

,250.01 

126.67 

,166.67 
,375.01 
,193.19 
,325.01 



OFFICE OF HON. THOHAS S FOLEY 



BRANDT, BERNER B 
BDCKNER,HARGARET C 
CARROLL, HARSHALL E,JR 
DTE, SHARON S 
FEARING, GEORGE B 
FIRST, BILLIAH L 
GIBSON, DOROTHY L 
HANSEN, ARTHUR HICHAEL 
HEALY, ROBERT L,JR 
HELPER, LESLIE JEAN 
JARSBEGO,JOAN HARIE 
JOHNSON, JEAN H 
KRZESINSKI, RANDALL J 
KUNDANIS, GEORGE 

LIGHTFOOT, KAREN L 
LOBREY, BONNIE H 
HAUK,HARILYB D 
HCELVEY, SANDRA B 
PAZO,HIEVES TERESA 
PIERCE, DIANA GAIL 
ROBINSON, STEVEN DAVID 

SANDERS, PATRICIA A 
BEHDLANDT, NANCY 



RESEARCH ASSISTANT 

CLERK, TO JUL 14 

STAFF ASSISTANT, FROH AUG 1 

CLERK, FROH AUG 29 

LEGISLATIVE ASSISTANT 

CLERK 

DISTRICT ASSISTANT 

CLERK, FRCH SEP 3 

CLERK 

CLERK, TO SEP 2 

CLERK, TO SEP 2 

CLERK, TO SEP 9 

CLERK, TO JUL 31 

LEGISLATIVE ASSISTANT, FROH AUG 1 . 

CLERK, FECH SEP 12 

CLERK, FECH SEP 7 

CLERK 

CLERK 

CLERK 

CLERK 

CLERK, FEOH AUG 1 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

CLERK 

CLERK, TO JUL 31 



,221.76 
,124.99 

202.22 
,000.00 

675.55 
,143.52 
,000.00 
,064.46 
,244.44 
,583.34 
,823.75 

895.55 
,446.65 

,600.00 
527.78 
600.00 
,026.97 
,833.34 
,916.66 
,625.01 

,291.88 
,250.01 
433.33 



72 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. BABOLD E FOSD 



ALPEK IN, LINDA GAIL 
CHILDERS, ROBERT H 
CLARK, ALZADA A 
COHN, RICHARD G 
FARRIS.JAHES DAVID 
FOSTER. HARTIN C 
HOFFMAN, SHEREE L 
HOWARD, YVONNE 
HUGHES, BARBAPA D 
JACKSON, DEBOBAB 
JOHNS, PATRICIA H 
KILES, DRAIN J 
LEHIS, CHARLES E 
HCWILLIAHS.HINDY 

HILAR, LEONIA C 
HORRELL, GREGORY SCOTT 
OOTERBRIDGE, LINDA 
PARSON, LINDA KAY 
RICH, SARA A 
SCOTT-SCORRY.DARLENE PAY 

SHITH, CARROL ANNETTE 
TDCKER .CYNTHIA D 

HALTER, RONALD A 



SDHHER INTERN, TO JUL 31 $ 500.00 

FIELD REPRESENTATIVE 4,250.01 

DIST OFFICE HNGB 2,500.00 

LEGISLATIVE ASSISTANT, FROH AOG 16 1,875.00 

LEGISLATIVE ASSISTANT 2,499.99 

ADMINISTRATIVE ASSISTANT, TO JOL 31 2,208.33 

SDHHER INTERN, TO JOL 31 1,500.00 

AEHINISTBATIVE SECRETARY 3,000.00 

ACHINISTRATIVE SECRETARY 3,550.01 

CLERK TYflST 2,000.00 

ADMINISTRATIVE AIDE, FROH ADG 1 1,723.32 

SDHHER INTERN COORDINATOR, TO ADG 31 2,500.00 

FIELD REPRESENTATIVE 2,820.00 

PRESS SICBETABY/ADHIN ASST, TO AOG 31 

ADHINISTBATIVE ASSISTANT, FROH SEP 1 5,150.00 

DIST OFFICE HNGR 3,400.00 

LEGISLATIVE COONSEL 4,400.00 

COHPOTER SYSTEHS ANALYST 2,324.99 

LEGISLATIVE ASSISTANT 3,050.00 

LBJ CONGRESSIONAL INTERN, TO JOL 31 590.00 

LEGISLATIVE ASSISTANT, FROH AOG 1 TO AOG 31 .. 

SPECIAL ASSISTANT, FBOH SEP 1 3,266.56 

OFFICE COORDINATOR 2,975.00 

STODENT INTERN, FROH SEP 1 

LBJ CONGRESSIONAL INTERN, AOG 1 - AOG 31 990.00 

DIST DIBICTOR/ADHIN ASST 4,950.00 



OFFICE OF HON. ilLLIAH D FORD 



BLANK, JOANNA JONE 
BORELLIS, MARGARET A 
BOORASSA, VIRGINIA C 
BOYD,CANDACE A 
BRONNEB, HAROLD F 
CONLON .RICHARD P 
COOBIC,JOHN H,JB 
DBYEB.PATBICIA 
GALLAGHER, JOHN A 
HANLIN, DIANE B 
HOOVER, PATRICIA A 
HARGETICH, HANNAH B 
HCKEE, CONSTANCE H 
HODD.COBTIS A 
NICITA, ANGELA J 
RATHBON, FRANK H 
SCATTEBGOOD, ELIZA BETH 
STANLEY, BOBEBT A E 
TALLHADGE, PATRICIA 
VEBBY, CAROL ABIGAIL 
NAINIO, HELEN B 
BRIGHT, SHARON 



SECRET ABY 

CASEBOBKEB 

SPECIAL ASSISTANT 

SECBETABY 

SPECIAL ASSISTANT 

STAFF ASSISTANT, FBOH SEP 1 ....... 

LEGISLATIVE ASSISTANT 

SECBETABY 

DISTBICT BEPBBSENTATIVE 

SECBETABY, FBOH SEP 1 

SOHHEB INTERN, TO AOG 31 

OFFICE MANAGER, TO JOL 31 

SECBETABY 

LBJ CONGRESSIONAL INTERN, TO JOL 31 

SECBETABY, TO AOG 31 

AEHINISTBATIVE ASSISTANT 

COMPUTER SPECIALIST 

LEGISLATIVE AIDE, FBOH AOG 1 ...... 

SECRETARY 

LEGISLATIVE AIDE 

DISTRICT OFFICE HANAGEB 

SECBETABY 



,574.99 
,750.00 
,200.00 
,499.99 
,800.00 
,583.33 
,125.01 
,875.00 
,000.01 

816.67 
,400. OQ 
,250.00 
,800.00 

590.00 
,400.00 
,874.99 
,874.99 

791.66 
,874. 99 
,050.00 
,300.01 
,375.01 



OFFICE OF HON. EDNIN B FOBSYTBE 



BERKEY, JOSEPHINE A 
BOBB.JEANNETTE A 
BOHN,C SOZANNE 
BROHN, DOROTHY LEE 
CARPONTEB,CANDACE C 
CBYOR, DANIEL J 
DINTEBHAN.TED BOBEBT 
DIXON, PATBICIA 
HEBLICH, KABEN J 
HILDBETH,HABCIA J 

HODGSON, SHIBLEY L 
HOGHES, SHEILA C 
LODDEN, KENNETH H 
HCGANN,HABY B 
HORF.BABRETT ANN 
OKANE, KATHLEEN E 
OKELLY.JANE D 
BOBINSON, NANCY J 
STEPHENS, EABL N 



CLEBK 

CLEBK 

CLEBK, FBCH SEP 1 

CLEBK 

CLEBK, TO AOG 31 

EXECDTIVE ASSISTANT 

CLEBK 

CLERK, FECH JOL 18 

CLERK, TO AOG 31 

CLEBK, FBOH AOG 1 TO AOG 31 

LEJ CONGBESSIONAL INTERN, TO JOL 31 

CLEBK 

CLEBK 

LEGISLATIVE ASSISTANT 

SECBETABY 

CLEBK , 

CLEBK 

CLEBK 

CLEBK, FBCH AOG 1 

CLEBK 



,910.49 
,784.66 
500.00 
,441.26 
,626.66 
,090.00 
,500.00 
,622.23 
,180.00 

,180.00 
,873.76 
,004.26 
,600.01 
,616.75 
,918.75 
,978.25 
,001.51 
950.00 
,004.26 



73 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. L H FOUNTAIN 

BAYOL, MARGARET S 
E0YD,1NN WATSON 
CARR, NANCY GILLIAM 
DANIEL, TED L 
GUPTON, PATRICIA B 
MABROB, SUSIE T 
PITTHAN, SALTER J 
ROSNER, LINDA R 
STEPHENSON, JAHES B,II 

THOHAS, GORDON H 
TSOTRAS, FRANK G 
BADE, PEGGY H 
BEIHS, GLORIA E 
WILLIAMS, JANES B 
WILSON, CAROL H 



SECRETARY $ 5, 982. 18 

SECRETARY 1,834. 53 

SECRETARY, TO SEP 15 1,747.17 

EIECOTIVE ASSISTANT 7,719.72 

SECRETARY 3,302.16 

SECRETARY, TO SEP 7 1,488.90 

ADMINISTRATIVE ASSISTANT 8,781.99 

SUMMER INTERN, TO AUG 12 826.00 

CLERK, FBOH AUG 1 TO ADG 31 

LBJ CONGRESSIONAL INTERN, TO JUL 31 1,180.00 

LEGISLATIVE ASSISTANT 3,750.00 

LEGISLATIVE ASSISTANT, TO JUL 31 416.67 

SECRETARY 2,625.00 

SECRETARY 3,907.53 

ANALYST 1,310.37 

SECRETARY U,334.07 



OFFICE OF HON. WYCHE FOBLEB JR 



BECK, JAHES 
BENNETT, ALONZA 
BRADSHAB, ENGLISH 

CARTER, CATHERINE A 
DAVIS, M. TROY,JR 
DUGGAN,ERVIN S 
GAHBRELL,LUCK C 

HENNESSY, STEPHEN R 
JACKSON, CHARLES R 
JOHNSTONE, B. WILLIAM 
LEVIN, ANGELA 
LIVELY, ROBERT W 
MARTIN, HILL TORRAS 
MAXWELL, HART ANN 
MC HENRY, ROVILLA D 
MERRIDAY, BARBARA S 
NIEISON, MARGARET S 
NILES, SALLY C 
RIGGALL, CHRISTOPHER I 
RUDDER, CATHERINE E 
SPEECH, JULIE A 
TAYLOR, CHARLOTTE A 
BELTNER, ELIZABETH S 



LBJ CONGRESSIONAL INTERN, TO JUL 31 5.90.00 

STAFF ASSISTANT 3,090.74 

AIMINISTBATIVE ASSISTANT, TO JUL 31 

ADMINISTRATIVE ASSISTANT, FROM AUG 5 5,194.45 

SUMMER INTERN, FROM AOG 1 TO AUG 19 373.67 

STAFF ASSISTANT, TO JUL 31 1,666.67 

STAFF ASSISTANT, FROM AUG 10 TO AUG 31 2,531.67 

SUMMER INTERN, TO AUG 31 

STAFF ASSISTANT, FROM SEP 5 2,262.22 

SUMMER INTERN, TO JUL 31 590.00 

STAFF ASSISTANT 3,875.01 

STAFF ASSISTANT 4,116.67 

STAFF ASSISTANT 2,950.01 

STAFF ASSISTANT, FROM SEP 10 413.00 

SUMMER INTERN, FROM AOG 1 TO AUG 22 432.67 

STAFF ASSISTANT 3,033.34 

STAFF ASSISTANT 2,950.01 

STAFF ASSISTANT 3,987.50 

STAFF ASSISTANT 4,825.01 

STAFF ASSISTANT 3,283.33 

STAFF ASSISTANT 2,000.01 

STAFF ASSISTANT, FROM SEP 1 1,833.33 

STAFF ASSISTANT 2,975.00 

STAFF ASSISTANT, TO JUL 31 1,533.33 

LEGISLATIVE ASSISTANT, FROM JUL 15 2,744.44 



OFFICE OF HON. DONALD M FRASEF 



BENSON, ARTHUR C 
BINDER, LOIS 
ELLIOTT, GERALD H 
FIELD, LABRENCE JEFFREY 
FORESTER, JOAN C 
FRIEDMAN, ALAN G 
HARMON, DIANA K 
HENRICKS,SHABON K 
HERTZ, DOROTHY H 
JONES, ESTRELLITA 
KASSIM, ANTOINETTE B 
KURZ, NORMAN T 
LIFSON,MARY ELLEN 
NURPHY.KENNETH R 
HURRAY, MEAL A 
NATHANSON.IRIC 
NEBCOHER, CLAIRE SANDS 
OBRIEN, GEORGIA MARY 
OVERBY, PETER M 
PERSONS, SANDFORD Z 
RAPSON.RICHABD (BIP) 
BEINSCH, SUSAN P 
SHERBURNE, JANE C 
BONNEBERGER, ELSIE J 



STAFF 
STAFF 
STAFF 
STAFF 
STAFF 
STAFF 
STAFF 
STAFF 
STAFF 
STAFF 
STAFF 
STAFF 
STAFF 
STAFF 
STAFF 
STAFF 
STAFF 
STAFF 
STAFF 
STAFF 
STAFF 
STAFF 
STAFF 
STAFF 



ASSISTANT 

ASSISTANT 

ASSISTANT 

ASSISTANT, TO JUL 31 

ASSISTANT, TO JUL 31 

ASSISTANT, FROM SEP 1 

ASSISTANT 

ASSISTANT 

ASSISTANT 

ASSISTANT, TO JUL 31 

ASSISTANT 

ASSISTANT, FROM SEP 1 

ASSISTANT, FROM JUL 11 

ASSISTANT, FROM AUG 1 TO AUG 31 

ASSISTANT, FROM SEP 1 

ASSISTANT 

ASSISTANT 

ASSISTANT 

ASSISTANT 

ASSISTANT, FROM AUG 1 TO AUG 31 

ASSISTANT 

ASSISTANT, TO JUL 10 

ASSISTANT 

ASSISTANT 



953.26 
000.01 
227.50 
900.00 
000.00 
000.00 
604.17 
937.51 
999.99 
625.00 
287.49 
916.67 
374.92 
400.00 
320.00 
250.01 
687.51 
249.99 
750.00 
900.00 
249.99 
600.00 
549.99 
000.01 



74 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. BILL FRENZEL 

BROWNE, PATRICIA C 
CHRISTENSEN,MAYBETB A 
COLLINGS, ALICE H 
EVELAND, PATRICIA C 
KAEFEH, LINDA S 
KELLY, DANIEL K 
KNUTSON, MARGARET L. 
KRATTLI.VERNA KAI 
MC KIBBEN.LIZABETH A 
MCCSIGHT, KATHLEEN A 
NORTHCOTT,JOHN H 
OWENS, MARY JEAN 
RATNER,HARK A 
SALIN, DIANE L 
SA0NDERSON,A IRIS 
SCHALL, DAVID RICHARD 
THORPE, JOSEPHINE B 
BARNES, KABEN J 
WATKINS, BLANCHE D 
WILLOW, RICHARD D 



HEN SPECIALIST $ 

DISTRICT MANAGER 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

PERSONAL SECRETARY 

FFCM SEP 26 

INTERN, TC AUG 19 

CASEWORKER , 

STAFF ASSISTANT, TO JUL 31 

INTERN, FROM SEP 6 

EXECUTIVE SECRETARY 

RESEARCH DIRECTOR 

LEGISLATIVE AIDE, TO AUG 15 

RECEPTIONIST 

CLERK 

STAFF DIRECTOR , 



,621.99 
,249.99 

590.00 

,125.00 

83.33 

816.67 
,624.99 

683.33 

1*16.67 
,750.00 
,825.00 
,500.00 
, 199.99 
,750.01 
,999.99 
,100.00 
,500.01 
,100.00 

832.50 
,750.00 



OFFICE OF HON. LOOIS FREY JR 



ANGELIS.KRISTINE L 
CROSBY, JAMES PHILIP 
DITINICK, GLORIA PAULINE 
GOLDMAN, ALICE S 
JUAREZ, OSCAR F 
KTRWAN.GLENNA L 
LACY.HYRTLE H 
MARTIN, DONALD 
MIXER, RANDI H 
MORRIS, JOAN MARGARET 
PICKETT, ANNE CALDWELL 
SMITH, SARA HOPE 
SULLIVAN, DONALD D 

TURNER, KATHY E 
WELCH, ROBERT R 
WROBLESKI.ANN BARBARA 



2,124.99 

4,166.67 

2,249.99 

1,250.01 

, 10,749.9 9 

SECRETARY 5,499.99 

2,874.9 9 

1,025.01 

2,499.99 

3,750.00 

EXECOTIVE SECRETARY 6,249.99 

2,333.34 

SPECIAL ASSISTANT, TO JUL 31 

FROM SEP 1 1,916.67 

5,124.99 

FROM JUL 7 TO SEP 11 1,300.00 

3,750.00 



OFFICE OF HON. DON FUQUA 

BAKER, CARRIE B 
BARNES, CAROLYN J 
CAPELL, ROBBIE ANN 
CLARK, JOHN OWEN 
FARMER, JARVIS BERNARD 

FISHER, RUTH B 
GREVE, CECELIA C 
HALE, DONALD E 
HICKS, THOMAS P 
LAHBIASI, CAROL ANN 
MCCOY, JEAN J 
MCKAY, JOAN S 
MOORE, MICHAEL RANDOLPH 
MURPHY, MARTHA WILLIAMS 
PUGH, RALPH F 
ROSSI, WILLIAM H 
SCUDDER.ANN HAMILTON 
WADSWORTH .HERBERT , JR 



LBJ CONGRESSIONAL INTERN, TO JUL 31 

SUMMER INTERN, FROM AUG 1 TO SEP 15 

SPECIAL ASSISTANT 

SUMMER INTERN, FROM AUG 16 TO SEP 15 

LBJ CONGRESSIONAL INTERN, AUG 1 - AUG 15 

PERSONAL SECRETARY 

SECRETARY 

SUMMER INTERN, TO JUL 31 

SECRETARY 

SECRETARY DISTRICT OFFICE 

SPECIAL ASSISTANT 

SECRETARY 

SPECIAL ASSISTANT 

RESEARCH ASSISTANT 

ADMINISTRATIVE ASSISTANT 



590.00 
,832.42 

885.00 
,306.01 

885.00 
,836.59 
,718.27 

590.00 
,000.01 
,776.66 
,124.99 
,248.88 
,500.01 
,669.06 
,455.27 
,306.01 
,669.06 
,684.88 



OFFICE OF HON. BOB GAMHAGE 

AMOS, DEBORAH CATHERINE 

BROWN, JUDY 

CRAWFORD, CINDA MARIE 

DISCHINGEB, EDITH J 

DOUGLASS, TIB P 

GAGE, PETER B 

GLASS, STUART EVAN 

JOHNSON, JANE T 

KELLEY.ANN 

LORD, BARBARA G 



COMPUTER OPERATOR, FROM SEP 26 ... 

ASSISTANT, TO JUL 31 

CASE WORKER/SECRETARY 

OFFICE MANAGER 

LEGISLATIVE ASSISTANT 

COMPUTER OPERATOR, TO AUG 31 

ADMINISTRATIVE ASSISTANT 

CASEWORKER SECRETARY, FROM SEP 1 

STAFF ASSISTANT, FROM SEP 1 

CASE WORKER-RECEPTIONIST 



166.67 

500.00 
,499.99 
,749.99 
,675.00 
,666.66 
,049.99 
500.00 
833.33 
750.00 



75 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HOH. BOB GAHHAGE -CCNTINOED 



HOORB, TERESA L 
PENA, REBECCA 1 
HABOVSKI.HABYANN HC KINNEY 
REAGAN, HICHAEL E 
HIBNICK, AMELIA 
SANCHEZ, RAHONA 
SENTER.JEFF 
SIHIEN, CYNTHIA R 
STEVENSON, MARY 
STREUSAND.BEN E 
TALLEY, SANDRA JONES 
TAYLOR, JAN GEOFGIANNA D 
TARTER ESS IAN, PETER 
BALSETH.KBISTI E 



PERSONAL SECRETARY, FROH AUG 15 % 1,788.67 

SECRETARY-RECEPTIONIST, TO JUL 31 833.33 

PERSONAL SECRETARY, TO AUG 31 2,000.00 

HCBILE OFF HGR 6,375.00 

LBJ CONGRESSIONAL INTERN, TO JOL 31 590.00 

CASENORKER SECRETARY " 2, 499.99 

LEGISLATIVE ASSISTANT 3,750.00 

CASENORKER SECRETARY, FROH SEP 1 833.33 

SECRETARY 2,871.99 

STAFF ASSISTANT, FROH SEP 1 304.67 

CASE NOBKEH/SECRETARY, TO AUG 31 1,666.66 

PERSONAL ASST/SECRETARY 3,475.00 

DISTRICT AFFAIRS AIDE 3,375.00 

STAFF ASSISTANT 3,375.00 



OFFICE OF HON. JOSEPH H GAYDOS 



BLACK, MARTIN P 
CLOSSIN, RICHARD E 
CDRINGA, ANGELA 8 
DALE, BRIAN P 
DIHARCO, PATRICIA 
ECHOLS, SOSAN PAMELA 
ERNHARDT, BARRY J 
FROBOUCK.REAHETTE 
JONES, PHYLLIS SDSAN 
KINGERSKI.IRIS A 
LA CIVITA,LISA 
HANDELLA, BERNARD A 
HARINO, PATRICIA ANN 
OHENS,STE»ART E 
PAICH, CYNTHIA A 
PECORA,OHEN 
POGUE, BARBARA J 
STAISEY.BINIFRED H 
ZAJICEK, JOSEPH R 



LEGISLATIVE ASSISTANT/RESEARCH 

PRESS SECRETARY , 

SECRETARY 

CLERK, TO AUG 31 

DISTRICT OFFICE HANAGER 

RESEARCH/TERMINAL OPERATOR 

PUBLICATIONS ASSISTANT 

FIELD REPRESENTATIVE 

CLERK 

CLERK TYPIST , 

LBJ CONGRESSIONAL INTERN, AOG 1 - AUG 31 

ADMINISTRATIVE ASSISTANT 

CASENORKER , 

STAFF ASSISTANT 

CLERK TYPIST 

PUBLICATIONS ASSISTANT 

SECRETARY 

EXECUTIVE SECRETARY 

DISTRICT ADMINISTRATOR 



,250.01 
,375.01 
,375.00 
,800.00 
,999.99 
,874.99 
,500.01 
,250.00 
,499.99 
,574.99 

590.00 
,649.99 
,975.01 
,124.99 
,274.99 
,000.00 

924.99 
,750.00 
,499.99 



OFFICE OF HON. RICHARD A GEPHARDT 



CROSBY, JOHN B 
FEDERBOFER.RICKI 
FOGLEHAN,OLA B 
FOLEY, DONALD J 
FOLEY, HICHAEL G 
FRISELLA, DOLORES 
FRYE, CLAIRE TAYLOR 
HEJNA, HICHAEL J 
HIGGINS, CAROL 
KERRY, GEORGE 
KEYES JH,BILLIAH J 
KOHOREK,JAHES 
SELDEN,ANN H 
SHITH, FRANCES P 
SPECK, HELODY 
iATT,VICKI J 
YATES, HICHAEL 



ADHINISTRATIVE ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

LBJ CONGRESSIONAL INTERN, FROH SEP 1 

STAFF ASSISTANT 

STAFF ASSISTANT , 

STAFF ASSISTANT 

STAFF ASSISTANT 

SECRETARY 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

LBJ CONGRESSIONAL INTERN, TO JOL 31 .. 



,500.00 
,249.99 
,750.00 
,999.99 
,624.99 
,499.99 
,500.00 

590.00 
,750.00 
,750.01 
,000.01 
,249.99 
,874.99 
,124.99 
,750.01 
,874.99 

590.00 



OFFICE OF HON. ROBERT H GIAIHO 



ABSHIRE,CBARLENE HARIE 
ARONHALT,KAY A 
BEHEDETT I, EILEEN 
BROUN, HARY NELSON 
CONLON, RICHARD P 
FULLER, CAROLE L. 
GAHSEB, DIANA H 
KRENISKY,JOHN H 
LASSER.BARILYH 
HOORE, FRANCIS J 
HURRAY, SUSANNA H 
NIXON, D EILEEN 
OBERHEYER,BILLIAH T 
PINKER, HICHAEL J. 
PRATT, ROBERT LEONARD 
ROOHE, FLORENCE A 



SECRETARY 3,887.49 

SPECIAL ASSISTANT 3,120.00 

RECEPTIONIST 2,499.99 

CLERK TYPIST 1,281.25 

STAFF ASSISTANT, FROH AUG 1 TO AUG 31 2,958.33 

CASENORKER 4,374.99 

CLERK, TC AUG 5 688.33 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

STAFF ASSISTANT 5,499.99 

DISTRICT SECRETARY 5,081.46 

CLERK TYPIST, TO AUG 26 1,244.45 

ADHINISTRATIVE ASSISTANT 11,874.99 

CLERK TYPIST 2,375.01 

RESEARCH ASSISTANT 3,500.01 

STAFF ASSISTANT, FROH SEP 1 2,250.00 

CLERK 2,499.99 



76 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF BON. ROBERT N GIAIHO -CONTINUED 



STEWART, P II, JB 
VILLANO, PETER 



SPECIAL ASSISTANT $ 600.00 

PBESS SECRETARY 7,500.00 



OFFICE OF BON. SAN GIBBONS 

BATESON, LINDA HODGE 
BOTT.ALANA J 
DANIELS, HILDA H 
FIRMAN, JOLIA L 
HAGERTY.ROHAYNE L 
HARFORD, PATRICIA 
HASTINGS, PATRICIA A 

HENRY, ROBERT D 
JAFFE, JANES H 
JOHNSON, BETTY S. 
O'CONNOR, MARGARET 
ONEILL,MARY K 
STOOBZA, JANICE F 
SULLIVAN, FLORA L 
TAYLOR, EDNA V 
WONDERS, GREGORY F 



RESEARCH ASSISTANT .... 
SECRETARY 

CLERK 

STAFF ASSISTANT 

CLERK, TO ADG 31 

SECRETARY, FROH SEP 5 

CLERK, TC ADG 5 

CLERK 

STAFF ASSISTANT 

STAFF ASSISTANT 

CLERK 

CLERK , 



6,000.00 
2,499.99 
3,350.01 
2,366.67 
3,849.99 
5,571.30 

3,100.0 2 
583.33 
1,500.00 
2,600.01 
3,875.01 
3.8U9.99 
4,583.34 
U, 879. 58 
2,«99.99 
2,874.99 



OFFICE OF HON. BENJAMIN A GILMAN 



ADMICK,AMALIA T 

BECKER, ROBERT J 
COLANDREA, NANCY L 
FAY, ANITA ROSAIBE 

FSEY,LEE C 
GARON, RICHARD J,JR 
GEIS EN HEIMER, ROSALIND 
GILE, DAVID A 
GONBY, STEVEN H 
HARNETT, CATHERINE 
HINKLE, ALBERT S 
HDVANE,JOAN M 
LOMAX, WILLIAM L 
0DAY,HA0RE2N PATRICIA 

OLIANSKY, JOSEPH D 
PENTLAND, ELLEN 
ROSSO, RALPH A 
SHEFLETT.GERALDINE W 
SOTHERLAND, JOSEPH P 
VITARELLI, BEVERLY BIAND 
WEINTBADB,HANDA KAREN 
WILSON, AGNES P 
ZARDTSKIE, ANDREW 
ZELTNER, ROBIN LOD 



DISTRICT CLERK, TO JDL 31 

CLERK-DISTRICT OFFICE, FROH ADG 1 TO AOG 31 .. 1,831.67 

AIMINISTRATIVE ASSISTANT 8,507.01 

CASEWORKER 3,249.99 

CLERICAL ASSISTANT, TO JUL 31 

CLERK, FROH SEP 1 1,475.00 

DISTRICT CLERK 2,569.51 

LEGISLATIVE ASSISTANT 3,992.49 

PERSONAL SECTI-DISTRICT 3,725.01 

TEACHER INTERN, TO JDL 31 955.00 

LEJ CONGRESSIONAL INTERN, TO JDL 31 590.00 

LEGISLATIVE ASSISTANT 2,649.99 

CLEHK-DISTBICT OFFICE, FROH AOG 1 TO AOG 31 .. 1,000.00 

CLERK-DISTRICT OFFICE, FROH AOG 1 1,686.00 

SPECIAL ASSISTANT, TO AOG 31 1,500.00 

DISTRICT CLERK, TO JDL 31 

CLERK-DISTRICT OFFICE, FROH SEP 1 1,975.00 

CLERK-DISTRICT OFFICE, FROH ADG 1 TO AOG 31 .. 200.00 

SECRETARY 2,562.51 

DISTRICT MANAGES 5, 771*. 99 

OFFICE MANAGER 5,750.01 

PRESS ASSISTANT 3,849.99 

RECEPTIONIST SECRETARY ,. 2,312.49 

STAFF ASSISTANT 2,499.99 

CLEBK-DISTHICT OFFICE, FROH SEP 1 900.00 

ASSISTANT-DISTRICT 3,050.01 

CLERICAL ASSISTANT, FROH SEP 1 736.00 



OFFICE OF HON. BO GINN 

ARNSDORFF, GREGORY E 

CALHOON, KATHARINE 

CONNER, SEPTEMBER LYNNE 
CRAWFORD, GENE 
EDINGTON,WILLIAH H 
HEFNER, STACYE 
HOOKS, C JONES 
HORT, ROBERT H 
JACKSON, BOBBY LEE 
JOHNSON, CYNTHIA LEE 
JOHNSON, GRADY, JR 
LONG, KAREN FRANCINE 
MCCABE, WILLIAM MICHAEL 
HCELVEEN, BARBARA G 
MELLODY.SOSAN SHITH 
RABITSCH,BENJAHIN F 
WOODSIDE, MILTON H , JR 



STAFF ASSISTANT, FROH AOG 8 TO AOG 17 

LBJ CONGRESSIONAL INTERN, JDL 18 - AOG 7 590.01 

RECEPTIONIST-SECRETARY, TO JDL 31 

EXECDTIVE ASSISTANT, FROM AOG 1 TO SEP 11 .... 4,086.31 

LBJ CONGRESSIONAL INTERN, TO JDL 15 295.00 

DISTBICE OFFICE MANAGER 4,877.67 

RESEARCH ASSISTANT 6,351.90 

STAFF AICE.. TO ADG 12 700.00 

STAFF ASSISTANT 1,820.58 

LEGIS ASST-PRESS SECY 8,748.69 

DISTRICT REPRESENTATIVE 3,552.15 

SECRETARY 4,130.11 

EXECDTIVE SECRETARY 6,378.43 

SECRETARY 3,120.75 

STAFF ASSISTANT, FROM SEP 1 250.00 

SECRETARY 3,664.56 

CASEWORKER 3,664.56 

HGR-HILLEH OFFICE 5,290.44 

EXECDTIVE SECRETARY .., 5,152.86 



77 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. DAN GLICKNAN 

ANDERSON, EOGENE 
ANDEBSON, MARILYN SOE 
BAOHGAHTEN, WINNIE FEED 
BEACHY .WILLIAM 
BBANSON,HAET ESTHER 
BBOHLEY, ELLEN EPSTEIN 
COEN, KATHLEEN S 
FLEHING, SCOTT S 
FRAZIEB, GREGORY 
JAMES, KEITH 
JOHNSON, ELIZABETH B 
KELLY, NARY HELEN 
KETCHAM, LEWIS C 
MICHAEL, LINDA L 
MOORE, CYNTHIA LEIGB 

HOLLER, FRANCIS THOMAS, JR 
PFISTER, DANIEL H 
POLK, ANN KATHBYN 
POZNICH, CYNTHIA ANN 
ROE, JOYCE MYRNE 
STANFORD, CURTIS L 
VINES, HO NTE 
WILLIAMS, JACKIE N 



CASEWORKER S 3,000.00 

STAFF AIDE 1,687.50 

STAFF ASSISTANT 2,874.99 

LEGISLATIVE AIDE 5,666.66 

DISTBICT OFFICE MANAGER 2,450.01 

LEGISLATIVE AIDE., TO AOG B 1,319.45 

STAFF AIDE, FROM AOG 1 TO AOG 31 500.00 

LEGISLATIVE ASSISTANT, FBOH SEP 6 1,111.11 

STAFF AIDE 2,499.99 

STAFF AIDE, TO JOL 31 500.00 

CONGRESSIONAL AIDE 2,000.01 

OFFICE MGR-PERS SECTY 4,500.00 

PRESS AIDE , 3,875.01 

STAFF AIDE 2,124.99 

CONGRESSIONAL AIDE, TO JOL 31 

LEGISLATIVE CORRESPONDENT, FROM AOG 1 2,895.84 

LEGISLATIVE AIDE., TO AOG 31 2,000.00 

STAFF AIDE., FBOH AOG 1 TO AOG 31 500.00 

BECEPTIONIST, FROM AOG 29 888.89 

STAFF AIDE 774.99 

DIST OFC ADH ASST 8,375.01 

LBJ CONGRESSIONAL INTERN, TO JOL 31 500.00 

STAFF AIDE, TO JOL 31 500.00 

ADMINISTRATIVE ASSISTANT 8,375.01 



OFFICE OF HON. BARRY H GOLDBATER JB 



BAINE,CHARLENE V 
BELL, BELDEN BILL 
BLACK, KENNETH L 
DERBYSHIRE, HIBI ELIN 
DIAZ, JOHN A 
ELLEHTON,SIGNY S 
GAOL, EMMY LOO 
GRAY, VERONICA J 
HAVLICEK, JANE E 
JOHNSON, JEANNE 
JONES, BOFF LAOBIE 
KEY, BEN DAVID 
KING, AMY H 
MERRILL, PENNY 
MONAGHAN, JOYCE A 
OCOHNELL, JESSIE L 
OVERTON, JOSEPH A, III 
POLLEY, LAUREN DIANE 
R0THEBFORD,HABY F 
SMITH, BRADLEY I 



CLEBK TYPIST 

RESEARCHER 

ADMINISTRATIVE ASSISTANT 

BECEPTIONIST 

LBJ CONGRESSIONAL INTERN, AOG 1 - AOG 31 

PRESS ASSISTANT 

BECEPTIONIST 

FIELD SECRETARY 

PERSONAL SECRETARY 

EXECOTIVE ASSISTANT 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

FIELD REPRESENTATIVE 

LEGISLATIVE AIDE 

STAFF ASSISTANT, TO AOG 5 

LEGISLATIVE AIDE 

FIELD DEPUTY 

LEGISLATIVE ASSISTANT 

CASE WORKER 

LEGISLATIVE AIDE 

LEGISLATIVE ASSISTANT, TO AUG 31 



,146.41 

871.11 
,702.19 
,749.99 

590.00 
,462.74 
,048.87 
,438.34 
,470.33 
,449.03 

590.00 
,500.01 
,702.33 

583.3 3 
,302.16 
,166.29 
,319.44 
,356.26 
,449.04 
,000.00 



OFFICE OF BON. HENRY B GONZALEZ 



AZARKHISH.JOAHN 
BAISH.BDTTB 
BEAGLE, GAIL J 
CALDWELL, BERNADETTE ( 
CANTO, RAYMOND I,JR 
CLAYTON, CORA FAYE 
DONABUE, MILDRED J 
GARZA, EDDA C 
GONZALEZ, CONSOELO P. 

HARTIE,ARLETT L 
INMAN, ERNEST GARY 
OLIVABBI,ALEC L 
PATTON, LINDA S 
QUIBOGA.BAUL F 
BOQUE, MARY JESSIE 
TAHEZ.LUZ G 
WONG, ELLA H 
BONG, JESSE 



EXECUTIVE SECRETARY 

EXIC SECTY (PART-TIME) 

ADM G PRESS ASST 

LEGISLATIVE ASSISTANT 

CASESOBKEB, TO JOL 31 

CHIEF CASEWORKER-DISTRICT 

EXEC SECTY (PART-TIME) 

EXECOTIVE SECRETARY, TO JUL 31 

PART-TIME AIDE, TO JOL 31 

LEGISLATIVE CORRESPONDENT, FROM AOG 1 

CASEBOBK SECRET ARI 

FILE CLEBK-PRINTER -TYPIST 

LBJ CONGRESSIONAL INTERN, TO JUL 14 .. 

ASST (PART-TIKE) DIST OFFICE 

LBJ CONGBESSIOHAL INTERN, FBOH SEP 7 

ASSISTANT -DISTBICT OFFICE 

DIBECTOB DISTRICT OFFICE 

CASE WORKER PERSONAL SECRETABY 

FILE CLEBK DIST OFF TYPIST 



450.00 
300.00 
,900.00 
,895.83 
,375.89 
,571.30 
,749.88 
,250.00 

,666.67 
,552.15 
,208.33 
275.33 
,063.97 
472.00 
500.00 
,017.93 
,354.16 
,022.10 



OFFICE OF HON. BILLIAH F GOODLIHG 



BBENDLE, MURIEL P 
CAHPANELLA.HAUBIE J 
CORNELL JB, BILLIAH A 



DISTBICT SECRETARY 

LBJ CONGRESSIONAL INTERN, TO JUL 14 . . 
ADMINISTRATIVE ASSISTANT, TO AUG 31 .. 
ADHINISTHATIVE ASSISTANT, FBOH SEP 5 



1,875.00 
275.33 



5,928.33 



78 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. WILLIAM F GCODLING -CONTINUED 



DEFERRARI,LISA 
DEVANE, IRENE HEEOPOOLOS 
DUNN, MARK R 
EGGEE,REGINA ANN 
EISENHART,HARTIN P 
FETTER, LUCILLE F 
KENDBICK, PHYLLIS 
KHAN, KATHLEEN L 
KBUPA, DONNA JEAN 
HUMBERT, KATHRYN K 
NEWCOMER, NANCY A 
NOBBIS,JOHN CLABK 
SEDLAB, ROBIN 

SKEPABNIAS, LOUIS 
STAPLETON, MARILYN RAE 

STAUBACH,MELODIE LYNN 
SHANK, JOHN N 
TALLEY, KEVIN DAVID 
WALTERS, CHARLES H 



BESEABCH ASSISTANT, FROM AUG 1 TO AUG 31 $ 1,149.84 

SECRETARY/RECEPTIONIST 2,800.01 

STAFF ASSISTANT, TO AUG 31 833.34 

SECRETARY 3,283.33 

STAFF ASSISTANT 1,749.99 

DISTRICT SECRETARY 2,600.01 

SECRETARY-RECEPTIONIST 1,349.99 

SECTY-TYPIST, FROM AUG 1 1,875.00 

SECRETARY, TO JUL 31 791.67 

DISTRICT SECRETARY 2,499.99 

PERSONAL SECRETARY 6,050.00 

FIELD STAFF ASSISTANT, TO JUL 15 141.67 

LEGISLATIVE ASSISTANT, TO JUL 31 

LEGISLATIVE RESEABCHER, FROM AUG 1 3,033.34 

FIELD REPRESENTATIVE 2,791.67 

LEGISLATIVE SECRETARY, TO JUL 31 

LEGISLATIVE ASSISTANT, FROM AUG 1 5,549.99 

LEJ CONGRESSIONAL INTERN, JUL 15 - AUG 14 590.00 

RESEARCHER 4,550.00 

PBESS SECBETABY 5,174.99 

DISTRICT COORDINATOR 6,000.00 



OFFICE OF HON. ALBERT GORE JR 



BROWN, FREDA ANN 
BURKETT,QUINN OLA 
GONDER, DONNA T 
HAGAN, ANTHONY E 
HAILE, JAMES J 
HARRINGTON, JOSEPH L 

HIRSCH, ELIZABETH L 
JOHNSON, RAND D 
JOST, KENNETH WARREN 
KNIGHT, PETER 
MADDUX JR,JOHN JABED 
MOFIELD.MELINDA G 
NEEL.BOY M 
NOLAN, DONNA L 
SMITH, JUDY D 
TBIES, ANITA VAN 
WEBB,NARCIA JANE 
WINKLES, ALBERTA A 
WOFFORD, CAREY ALAN 



SECRETARY 

SECRETARY 

OFFICE MANAGER, FROM JUL 11 

FIELD REPRESENTATIVE, PROM SEP 1 

STAFF ASSISTANT 

LEGISLATIVE AIDE, FROM AUG 1 TO AUG 16 
LBJ CONGBESSIONAL INTERN, TO JUL 31 .... 

LEGISLATIVE AIDE 

LEGISLATIVE AIDE, FROM SEP 23 

LEGISLATIVE ASSISTANT 

ADMINISTRATIVE AIDE 

DISTRICT ADMINISTRATIVE ASSISTANT 

CONSTITUENT AIDE 

GRANTS COORDINATOR 

SECRETARY 

OFFICE MANAGER 

OFFICE MANAGER 

EXECUTIVE ASSISTANT 

DISTRICT STAFF ASSISTANT 

FIELD REPRESENTATIVE 



,899.99 
,499.99 
,688.88 
,666.67 
,325.00 

,301.11 
,425.01 
128.89 
,625.00 
,612.51 
,000.01 
,825.01 
,844.51 
,649.99 
,049.99 
,749.99 
,166.67 
,749.99 
,500.00 



OFFICE OF HON. WILLIS D GBADISCN JR 



ALLMAH, MARTHA P 
BARACH, MICHAEL 
BATES, DOUGLAS P 
BROWN, BONITA L 
BBOWN, KENNETH A 
CHERRY, BARBARA F 
CHOC KLEY, FREDERICK 
DWYER, KAREN M 
GREENER, CHARLES V 
HENRY, WILLIAM A 
KIRK, VICTORIA DAWN 
KLING, ANDREW 
LOMAX, WILLIAM L 
MCCABE, WILLIAM MICHAEL 
MEISEL, KAREN SUE 
MILLER, TIMOTHY P 
MUETHING, DAVID L 
HOETHING, ROBERT 
POWELL, LELA 
ROBERTS, RONALD R 
RUSCHE,MARCIA H 
SHOTT, ANDREW M 
TOTTEN, MARGARET P. 
WINTERS, LESLIE 
WISHARD, ANNETTE J 



SPECIAL ASSISTANT, FROM AUG 1 3,000.00 

LBJ CONGRESSIONAL INTERN, TO JUL 31 500.00 

LEGISLATIVE ASSISTANT, FROM SEP 1 1,439.00 

CASEWORKER 3,330.90 

LEGISLATIVE ASSISTANT, FROM SEP 19 283.20 

OFFICE MANAGER 3,714.90 

LEGISLATIVE ASSISTANT 3,074.66 

SECRETARY 2,250.00 

DISTRICT REPRESENTATIVE, FROM SEP 1 1,167.00 

LEGISLATIVE ASSISTANT, TO JUL 31 975.00 

SECRETARY, TO AUG 31 2,244.26 

SPECIAL ASSISTANT, TO JUL 31 750.00 

SPECIAL ASSISTANT 2,096.74 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 1,000.00 

SPECIAL ASSISTANT, TO AUG 31 1,500.00 

LEGISLATIVE ASSISTANT 4,500.00 

LEGISLATIVE ASSISTANT, TO AUG 31 2,301.43 

LEGISLATIVE ASSISTANT 3,850.00 

RECEPTIONIST 1,981.86 

ADMINISTRATIVE ASSISTANT 9,900.00 

CASEWORKER (DISTRICT) 2,875.66 

LEGISLATIVE ASSISTANT, FROM SEP 1 1,062.00 

RECEPTIONIST '. 2,374.66 

DISTRICT CASE WORKER 2,050.00 

DISTRICT OFFICE MANAGER 4,375.66 



79 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. CHARLES E GRASSLEY 



BELL, JOHN C,IV 
BENSKIN.JOAN H 
FOLTON, BARBARA J 
BRADSELL,EOBEBT H 
BURGER, BETTY. H 
CODDINGTON.LYNN 
CONROY, JANES B 
DEBASTOS, EVELYN B 
FREY,DI ANN 
GOODMAN, YVONNE R 
HOPPE,JOHN DAVID 
HOISINGA, WESLEY 
LIPOVAC, KATHLEEN A 
LOCHS, ROGER D 
BAXBELL.JOHN P 
PENALONA,THOHAS R 
SHITH, RANDALL P 

STOHP.JANE MERLE 

TAIT,BERNICE H 

VANDER HAY, RICHARD B,III 



STAFF $2,625.00 

STAFF 3,150.00 

STAFF INTERN, TO AUG 31 1,000.00 

STAFF, FPCI1 JOL 9 4, 555. 56 

STAFF 0,109.99 

STAFF ASSISTANT, FROM AOG 1 TO AOG 31 1,000.00 

STAFF 5,609.99 

STAFF 920.99 

STAFF INTERN, FROM SEP 7 000.00 

STAFF 5,000.00 

RESEARCHER, TO AOG 31 1,000.00 

STAFF INTERN, TO A.UG 5 583.33 

STAFF 2,870.99 

STAFF 2,281.25 

STAFF 5,250.00 

DISTRICT AIDE 0,062.51 

STAFF INTERN, TO JUL 19 

LBJ CONGRESSIONAL INTERN, JOL 20 - AOG 19 906.67 

STAFF 2,099.99 

STAFF 1,100.01 

STAFF 3,875.01 



OFFICE OF HON. LABAH GODGER 

ADAMS, THOHAS L 
ARNEY, LAURENCE H,JR 
BOBBOWSKI,TEBPIE B 
BRYAN, SOSAN SHEPARD 
CHAKALBS, CHARLOTTE K 
CHEPP, DOROTHY E 
DONAGAN, STOVER P,JR 
HARPE,SARA ELIZABETH 
HEDGECOCK, ROTH V. 
KITCHENS, BARBARA PHILLIPS 
LOWERY, THOMAS CLAODE 
HALLONEE, THOMAS L 
MC CRACKEN, LYNDA J 
MOFFITT, GARRY DALE 
OWENS, ANN NICHOLSON 
PEAKE, SUZANNE VOORHEES 
RAY,G. WILLIAM 
ROCAHORA,HEBBENE 
TOLLEY, LINDA B 
VAN DE VAART,HUBERTUS JAN 
BILHOT.BOLLY B 



EXECUTIVE ASSISTANT, TO AUG 31 

INTERN, FROB AOG 22 

ADMINISTRATIVE ASSISTANT 

BECEPTIONIST/BONICIPAL CASEWORKER .. 

STAFF ASSISTANT, FP.OH AOG 15 

LEGISLATIVE ASSISTANT 

PRESS ASSISTANT 

CASE WORKER-RECEPTIONIST, TO AUG 5 

SOCIAL SECORITY/VA CASEWORKER 

CASEWORKER 

FIELD REPBESENTATIVE 

DISTRICT ASSISTANT 

SECRETARY 

FIELD REPRESENTATIVE, TO AUG 25 .... 

AGENCY CASEWORKER 

RECEPTIONIST-CASE WORKER 

INTERN, FROH AUG 1 TO AOG 31 

STAFF ASSISTANT 

PERSONAL SECRETARY 

INTERN, TO JUL 31 

FRCB SEP 1 



,750.00 
767.00 
,750.00 
,625.00 
,175.56 
,500.00 
,000.00 
,166.67 
,750.00 
,175.01 
,000.00 
,500.00 
,625.00 
,062.50 
,750.00 
,620.99 
590.00 
,300.00 
,625.00 
590.00 
,000.00 



OFFICE OF RON. TENHYSON GOYEB 



BOWMAN, RICHARD E 
BOCHER,ANNE ELIZABETH 
HTNES,HABGABET W 
IRWIN, PEGG 

JANSEN, JOSEPH ANTHONY 
KLINE, GR2TCHEN ELLEN 
KOCK,BICHAEL E 
LEHHANN,HARCIA A 
MONROE, MARVIN ERLE 
HOMEY, ELAINE 
SANDAHL, VIRGINIA C 
WILLIAMS, ROBERT E 



LEGISLATIVE ASSISTANT 

SECRETARY 

EXECUTIVE SECBETARY 

LBJ CONGRESSIONAL INTEBN, TO AOG 19 

COMMUNICATIONS DIRECTOR 

SECRETARY 

STAFF ASSISTANT 

RECEPTIONIST 

ADMINISTRATIVE ASSISTANT 

SECRETARY 

CASEWORKER 

DISTRICT OFFICE BANAGER 



,237.50 
,750.01 
,370. 99 
963.67 
,975.01 
,109.99 
,000.00 
,753.61 
,070.99 
,150.00 
,237.50 
,750.01 



OFFICE OF HON. TOM HAGEDORN 

ANDERSON, BARJORIE JEAN 
BELL,BILLIE JEAN 
BERG, GEORGE L,JR 
BLAUCH, SANDRA L 
BROHN, PHYLLIS L 
CAHILL,GAIL 
CONNELLY, NEDRA 
ENRIGHT,JOHN STEVEN 
PENDER, JODITH A 

INNAHORATI, MARGARET ANDERSON 
JAHNZ, WENDY A 



SECRETARY 2,703.10 

SECRETARY 0,370.99 

ADMINISTRATIVE ASSISTANT 10,625.01 

SECRETARY 3,687.51 

SECRETARY 2,703.10 

SECRETARY 3,000.00 

SECRETARY 2,610.20 

PRESS ASSISTANT 3,037.09 

SECRETARY, TO AUG 31 

SECRETARY, FROB SEP 5 3,990.09 

SECRETARY, TO AOG 7 1,233.33 

SECRETARY 3,687.51 



80 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. TOH HAGEDOHN -CONTINUED 



JENNINGS, DAVID H 
LONCBFOB D.LLOYD J 
HARKMAN, STEPHEN J 
OWENS, BETTY J 
SPEAKES, LESLIE 

WILSON, DABYL G 



FIELD BEPRESENTATIVB $ 1,683.34 

RES1ARCB ASSISTANT 2,499.99 

LEGISLATIVE ASSISTANT 5,000.01 

SECBETABT, FBOH SEP 12 554.17 

SECBETABT, FBOH AOG 1 TO AOG 31 

LBJ CONGRESSIONAL INTEBN, TO JOL 31 1,180.00 

CLERK TTPIST ,. 2,000.01 



OFFICE OF RON. SAN B HALL JK 



ANDEBSON.ADBIENNE A. 
BBADDOCK, DENNIS B 
BYRD,NARK A 
COONCILL,DOBOTHY F 
COBBY JB, BISHOP 
DBIGGEBS,SOSAN E 
JORDAN, SOE K 
KING, NELL H 
LAMOTHE,CAHILLE 
LARSON, DAVID ALLEN 
HCKEE, LINDA H 
NERRITTS,HARY J CHEBBY 
MOCKLE ROY, JAKES H,JB 
OETKEN,ALBEBT A 
OBOOBKE, JOANNA G 
SHACKLETTE, BARON I 
THOMAS, ALICE B 
WRIGHT, DORIS E 



CLERK 2,874.99 

CLEBX 3,381.99 

CLERK, TO AOG 31 1,000.00 

SECRETARY 8,633.61 

CLERK 1,500.00 

CLERK 3,908.40 

SECRETARY 4,193.19 

, 1,200.00 

CLERK, TO ADG 31 1,000.00 

LBJ CONGRESSIONAL INTEBN, TO JOL 31 590.00 

CLERK 4,717.35 

CLERK 2,489.70 

LEGISLATIVE ASSISTANT 8,000.00 

CLERK 4,318.20 

BESEABCB ASSISTANT 5,306.01 

ADMINISTRATIVE ASSISTANT 4,974.33 

CLEBK 1,200.00 

CLERK 1,200.00 



OFFICE OF HON. LEE H HAMILTON 



BAKER, CABOLYN ANN 
BOYD, PHYLLIS J 

BOTTENHEIH,ANNE 
CHEBBY, GLORIA SWANN 
COX, THOMAS PAOL 
DBAITON,EO GENIE BABBOOB 
GOLDRING, EUNICE E 
GRAY, SHIRLEY 
HILGEMAN, LINDA K 
HOPPER, BERNICE L 
JESSE, SANDRA L 
JODSON, PAULA ANN 
HATCHETT, CHRISTOPHER D 
HCHORTRI,VANDA BBOCE 
MILLEB,DEBRA L 
MITCHELL, CATHERINE A 
RAINES, ANNETTA G 
ROSSELL.PATBICIA A 
SCHOLER, JANET C 
SCHOSSLER, JANE H 
STONER, RICHARD B,JE 
VANCE, WAYNE 
WATERS, STEPHEN 



DISTRICT SECRETARY, FROM SEP 10 197.55 

DISTRICT SECRETARY, TO AOG 15 

DISTRICT SECRETARY, FROM SEP 1 2,416.66 

LEGISLATIVE AIDE 3,590.01 

RECEPTIONIST SECRETARY 2,874.99 

OFFICE MANAGER, FROM SEP 7 719.44 

TERMINAL OPERATOR, FBOH AOG 9 1,288.67 

SECBETARY/TERHINAL OPERATOR 3,081.58 

DISTRICT OFFICE MANAGES 2,625.00 

DISTRICT CASE WORKER . 2,750.01 

CASEWORKER 2,124.99 

PRESS ASSISTANT 3,795.00 

SECBETARY/TERHINAL OPERATOR, TO AOG 8 1,199.11 

LBJ CONGRESSIONAL INTEBN, TO JOL 31 590.00 

LEGIS ASST (RESEABCH) 3,840.00 

EXECOTIVE ASSISTANT 4,107.51 

DISTRICT TEBMINAL OPEBATOR, AOG 1 - AOG 31 ... 1,350.00 

DISTRICT SECRETARY, FROM AOG 16 TO AOG 31 200.00 

DISTRICT OFFICE MANAGER 4,056.24 

DISTRICT OFFICE MANAGES . 2,000.00 

LEGISLATIVE ASSISTANT 3,500.01 

AIMINISTRATIVE ASSISTANT 7,250.01 

SPECIAL ASSISTANT 5,375.01 

POELICATIONS ASSISTANT, TO SEP 9 1,868.75 



OFFICE OF HON. JOHN PAOL HAHMERSCHHI ET 



BERGMAN, SOSAN ELLEN 
CAMNER, ELLEN M 
CANFIELD.ANNE C 
COLEMAN, CYNTHIA 
COMFORT, LORETTA M 
COOK, DIANE H 
ELLIS, GWENDA H 
FARROW, WENDY L 
FOBBEST,ALBEBTA SOE 
G0YTON,MOIRA 
HOWMAN, SHERRY L 
LANTZ, ARCHIE LEE 
PRICE, PEGGY E 
REID, RAYMOND T 
SHEA.REGINA VERONICA 
SOOTHWORTH, ELLEN G 
STEELE, VICKIE R 



STAFF ASSISTANT 

LEGISLATIVE AIDE 

STAFF ASSISTANT 

STAFF ASSISTANT, FROM AOG 8 
STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT, FROM JOL 25 
STAFF ASSISTANT, TO JOL 31 .. 

DISTRICT ASSISTANT 

TO JOL 10 

STAFF ASSISTANT, FROM AOG 8 



,124.99 
,300.01 
,000.00 
,325.00 
,398.61 
,308.33 

500.00 
,000.01 

300.00 
,558.33 

100.00 
,000.01 

319.44 
,949.99 

324.99 
,874.99 
,325.00 



81 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. JOHN PADL HAHHERSCHNIDT -CONTINUED 



STEEN,KATHY A 

WALKER, BETH ANN 
SEAVEB, SUSAN ANN 
BBHNEB, PAMELA ANN 



STAFF ASSISTANT, TO AUG 1 $ 

STAFF ASSISTANT 

RESEARCH ASSISTANT 



826.67 
2,750.01 
3,412. 50 
5,700.00 



OFFICE OF RON. JAHES H HANLEY 



AMBLER, THOHAS N 
COSTELLO,J DANIEL 
DEYDLIA.THOBAS B 
PBESHHAN,HABJOBIE B 
HILTEBBBICK,FAY C 

HOY, NARY B 
LAURENCE, JANES 8 
LOHN,ANN S 

HCAULIFFE.TEBBENCE B 
HCCALL, JULIE H 
HEEHAN, JULIE H 
NUNCY, BEVERLY JEAN 
HYEBS.LOIS G 
O'CONNOR, EDBARD J 
OCONNOR.JOBN M 
BY AN, JAHES P. 
SANDO,ABTHUB R 
THIBAULT.HABTIH 
WARNE, ROBERT A 



LBJ CONGRESSIONAL INTERN, TO JUL 31 
ADMINISTRATIVE ASSISTANT 

CASE WORKER., TO AUG 31 

CASEBORKER, FROM SEP 5 

LEGISLATIVE ASSISTANT 

FBCH SEP 12 

TO JUL 31 

PERSONAL SECY TO CONG 

SECBETARY 

STAFF ASSISTANT, TO JUL 31 

FIELD REPRESENTATIVE 

PBESS ASSISTANT 

LEGISLATIVE ASSISTANT 



590.00 
999.99 
,737.22 
,124.99 

,931.14 

882.82 
,953.21 
,931.14 
96.82 
,669.06 

325.00 

500.01 
,122.72 

590.00 
,1UU.90 
,71i». 90 
,000.01 
,62«.99 

624.99 



OFFICE OF HON. BABK B HANNAFORD 



CASTILLO, HINEBVA B 
CHOB.HABIA 
CLARK, PAUL T 
DEVINE.BILLIAH H 
DDRKEE,KINDE 
EVANS, RUTH DUHIRE 
GENDELL.CARIN GAYE 
GBAY, RICHARD B 
HORNER, ANETTA S 
HDTCHENS,BARY REBECCA 
LESSO,HABYANN C 
LORD, LINDA LEA 
LOVENDUSKY.BICHAEL 
MASTERS, DANIEL C 
MULLEN, R JAHES 
NELSON, BICHABD LAWRENCE 
SHTTH, SUSAN E 
STACK, ELIZABETH A. 
THOMPSON, CABY H 
BAGHER,DALE E 
BELLS, BADONNA J 
YOUNG, THOHAS DUBELL 



SPECIAL ASSISTANT 1,423.00 

SECRETARY 950.00 

LEGISLATIVE ASSISTANT, TO JUL 31 . . 1,192.50 

ADMINISTRATIVE ASSISTANT 5,685.99 

SECBETARY 2,333.33 

OFFICE MANAGES 3,657.49 

LEGISLATIVE CORRESPONDENT, TO AUG 31 1,400.00 

LBJ CONGRESSIONAL INTERN, TO JUL 31 500.00 

STAFF ASSISTANT 4,634.39 

RECEPTIONIST 2,541.66 

STAFF ASSISTANT 3,263.74 

LEGISLATIVE ASSISTANT 5,000.01 

LEGISLATIVE ASSISTANT 3,700.01 

STAFF ASSISTANT 3,083.33 

CONG DISTBICT ADHINISTBATOB 7,166.25 

PBESS ASSISTANT 3,730.01 

RECEPTIONIST, F80BSEP 1 810.00 

PEGSONAL SECBETARY 3,263.74 

STAFF ASSISTANT, FBOH AUG 1 TO AUG 31 500.00 

DISTBICT ADHINISTBATIVE ASSISTANT., FROH SEP 1 916.67 

SECY-OFFICE BGR 3,034,17 

STAFF ASSISTANT 2,441.67 



OFFICE OF HON. GEOBGE HANSEN 



ABSALOM, JOHN EDBARD, III 
ADAMS, GEOBGE M 
BBADFOBD, STEPHEN L 
BURTON, BARY MARGARET 
CHAFFIN,DEBB» L 
CHRISTENSEN,DALE H 
DAYLEY, THOMAS E 
DETHOHAS,ANNA HABIE 
HENDBICKS, RICHARD 
K5LKEB, BETTY P 
KELKEP.O A 
MARTIN, SORHAN D 
OSTLEB, JAHES G 
PARKER, CLEONE P 
PENLAND.T BEBIL 
SCHEIH.GUY D 
SEVERE, FOREST J 
STEINEB.TEDDIE LOU 
TUBBS.NELDA H 
BEBB,HABTSIE 



STAFF ASSISTANT, FBOH SEP 1 

CLEBK, TO AUG 31 

CLERK, FBOH JUL 18 TO AUG 31 

CLEBK 

CLERK, FBCH JUL 18 TO JUL 31 

CLERK, TO JUL 31 

CLEBK 

TO JUL 15 , 

FIELD REPRESENTATIVE 

CLERK 

CLERK 

AEHINISTBATIVE ASSISTANT, TO JUL 17 

CLEBK 

CLEBK 

CLEBK, FBCH JUL 21 

CLEBK 

CLEBK 



1,400.00 
4,000.00 

600.00 
3,100.00 

225.00 
1,000.00 
4,800.00 

500.00 
7,206.15 
2,400.00 

675.00 
1,605.31 
6,600.00 
1,800.00 
2,300.00 
4,300.00 
5,500.00 
3,300.00 
1,800.00 
3,000.00 



82 j 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. GEORGE HANSEN -CONTINDED 
WITHERS, LAWRENCE ARLEN 



CLIRK, TO AUG 31 S 

LEGISLATIVE ASSISTANT, FROH SEP 1 6,600.00 



OFFICE OF HON. TOH HARKIN 

BAKER, DIANNA J 
BENDER, RICHARD A 
BROWN, CLYDE 
FITZPATRICK.JOHN J 
FREEDMAN,FBANCINE S 
HADWIGER,CASIHIR DAVID 
LIEPA.DIANNE 
MOLQUEEN, ROBERT E 
NOON, ROBERT J 
PALMER, GEORGE LOOIS 
PIATT, BARRY E 
RACKOW SKI, CONSTANCE 
REYNOLDS, CHRISTIN TOVE 
SIBONS, BONNIE R 
SLATER, DONNA M 
SMITH, SUSIE KAY 
STAUBLE, PATRICIA ANN 
SWITZER, REBECCA 
THOMAS, RICHARD S 
TOBIN, TERRY B 
WILTGEN, JANET S 
WINNER, MARGARET L 
WYNJA, BRENT CALVIN 
ZAGNOLI, THERESA 



PERSONAL SECRETARY 3,150.00 

DISTRICT REPRESENTATIVE 4,100.00 

ADMINISTRATIVE AIDE 4,000.00 

ADMINISTRATIVE ASSISTANT 7,024.00 

SECRETARY 2,537.00 

INTERN, TO JOL 31 750.00 

CONGRESSIONAL AIDE, FROH AOG 1 2,100.00 

DISTRICT REPRESENTATIVE 2,775.00 

LEGISLATIVE ASSISTANT 4,500.00 

DISTRICT REPRESENTATIVE 4,200.00 

PRESS SECRETARY 3,246.00 

SECRETARY, FROB AUG 1 TO AOG 31 300.00 

CONGRESSIONAL AIDE 2,250.00 

CONGRESSIONAL AIDE, FROM SEP 1 1,400.00 

DISTRICT REPRESENTATIVE 3,525.00 

PROJECTS COORDINATOR 2,850.00 

CONGRESSIONAL AIDE, TO JOL 31 1,050.00 

CONGRESSIONAL AIDE, TO JOL 31 813.50 

DISTRICT REPRESENTATIVE, FfiOB AOG 1 3,450.00 

CONGRESSIONAL AIDE, FROM AOG 1 TO AOG 31 1,650.00 

LEGISLATIVE ASSISTANT, FROM SEP 12 712.50 

CONGRESSIONAL AIDE, TO JOL 31 1,400.00 

DISTRICT REPRESENTATIVE 3,000.00 

LBJ CONGRESSIONAL INTERN, TO JOL 15 295.00 



OFFICE OF HON. BICHAEL HARRINGTON 



BOWES, JUDITH A 
CARNEY, PATRICIA M 
CASTELLO, JAMES E 
COLTIN.LOOISE ANNE 
DA VEY, YVONNE J 
DEVILLARS,JOHN P 
DOWNEY, MARGARET KELLY 
FINKELSTSIN, CHERYL L 
FOSTER, ANNLEE 
HEALBY.JOHN DENNIS 
HOOKS, ANN MARIE 
LOONGO, HELEN 
MAZEL, LOOIS 

MCDONALD, JOHN L,JR 
BCINTYRE, VIRGINIA 
BORIABTY,JOHN S 
BOLCAHY.BARY 
O'CONNOR, CAROLYN H 
PEARLSTEIN, STEVEN R 
PIRAINO-MASSARO,JOANNE 
POTASH, DANIEL A 
POWERS, THOMAS J 
SCHORR, KURT ERICH 
TOMKINSON, IRENE B 
TURNER, NADINE 
YOFFEE,EBILY 



CLERK, FROM AUG 1 TO AUG 31 

CLERK 

CLERK, FROM JUL 2 

CLERK, TO JUL 31 

OFFICE MANAGER, FROH AOG 1 . 

CLERK, TO AUG 18 

CLERK, TO JUL 1 

CLERK, FROH SEP 12 

CLERK 

CLERK, TO AUG 6 

CLERK , 

CLERK 

CLERK, TO JUL 31 

CLERK, FROM SEP 1 

CLERK, FROM AUG 4 TO AUG 31 

CLERK 

CLERK 

CLERK, TO JOL 31 

CLERK 

CLERK 

CLERK 

LBJ CONGRESSIONAL INTERN .... 

CLERK, FROM AOG 1 

CLERK, FROM JUL 16 

CLERK, TO AUG 3 

CLERK 

CLERK, FROB SEP 1 



870.00 
833.33 
862.50 
833.33 

,666.66 

933.33 

33.33 

712.50 

.037.03 

,260.40 
386.66 

,666.66 

,166.67 
,200.00 
,020.83 
,000.00 
,000.00 
,999.99 
,826.67 
,458.33 
,770.00 
,937.50 
,208.33 
,016.67 
,458.33 
,020.83 



OFFICE OF HON. HERBERT E HARRIS II 



BARBOOR, NANCY R 
BOYD, MARY E 

BUDD.ENMA JEAN 
CHICK, VIRGINIA L 
COPPA, DEBORAH M 
DAVIS, CARRIE H 
DAVIS, DONNA E 
DIEGELMAN,HARY A 
EATON, SANDRA S 
GATTSEK,NORBA R 
KELLY, BRENDA C. 
KENNEY, JAMES JOSEPH 



STAFF ASSISTANT 

ADMINISTRATIVE SECRETARY, AUG 1 - AUG 31 

STAFF ASSISTANT, FROB SEP 1 

STAFF ASSISTANT 

ADMINISTRATIVE SECRETARY 

STAFF ASSISTANT 

STAFF ASSISTANT, TO AOG 31 

STAFF ASSISTANT, FROM SEP 1 

STAFF ASSISTANT 

STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT 

STAFF ASSISTANT 

DISTRICT ADBINISTRATOR , 



549.75 
476.62 

,489.70 
476.62 

,391.86 
521.99 
620.74 
777.49 
339.01 
345.58 

,503.59 



83 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF BON. BEBBEBT E BABBIS II -CONTINUED 



BCNEIL, 4LICB C 
BORPHT, ROBERT D,JR 
OREILLT,COBNELIA A 
PARTRIDGE, MICHAEL A 
SAUNDERS, BARBARA A 
SHOCKENCY,PA0LINE B 
SPANOS, CHRISTOPHER J 
SORLA.B. GENE 
SUROVELL,GLENDA 6 
SWEENEY, JOHN P 

TAIES,CHERTL LEE 



RECEPTIONIST $ 2,455.50 

LBJ CONGRESSIONAL INTERN, FROM JDL 5 1,691.33 

EXECUTIVE SECRETART 1,678.05 

LEGISLATIVE ASSISTANT, TO AUG 18 1,531.07 

LEGISLATIVE ASSISTANT, FBOB SEP 1 916.67 

STAFF ASSISTANT 2,339.01 

ADMINISTRATIVE ASSISTANT 7,254.2U 

ADMINISTRATIVE SECBETABT, TO JUL 11 288.28 

LEGISLATIVE ASSISTANT 5,090.82 

PBESS SECBETABT, TO JUL 31 

ADMINISTRATIVE SECBETABT, FHON AUG 1 6,153.75 

SPECIAL ASSISTANT, PROS JUL 11 1,972.22 



OPFICE OF BON. BILLIAB H BABSBJ 



ARBISTEAD.BART JEAN 
BAROtriCB,SBEILA K 
BASSETT,CTNTBIA JANE 
CAMPBELL, HART C 
COBEN, STEVEN ELLIS 
DEXTER, CHRISTINE H. 
ELSTUN, ELAINE P 
EBALD, MARGARET B 
PAULEY, WILLIAM 
FEBBELL, HICHAEL B 
MOWREY, CHARLES D 
NOBLIB, GEORGE R 
OTT, CHRISTINA G 
RICHARDS, PABELA JANE 
THOBPSON,BEBECCA JANE 
TBOLLINGEB, BARBARA A 



LEGISLATIVE ASSISTANT ... 

SECRETARY 

PERSONAL SECBETART 

SECRETART, TO AUG 8 .... 

CLERK 

CASE BOBKIR 

FIELD REPRESENTATIVE .... 
LEGISLATIVE SECRETABT ... 
DISTRICT BEPRESENTATIVE . 

RESEARCH ASSISTANT 

ASSISTANT 

PRESS ASSISTANT 

CASEWORKER 

ADMINISTRATIVE ASSISTANT 
FIELD BEPBESEHTATIVB .... 
SECBETABT 



,053.94 
,013.86 
,839.40 
,266.67 
,135.91 
,267.51 
,339.01 
,125.01 
,144.90 
,193.19 
990.63 
,953.21 
,576.98 
,072.49 
,072.43 
,926.24 



OFFICE OF HON. AUGUSTUS F HABKINS 



BRADBT, HELEN K D 
CRUHBLET, ANNETTE L 
DAVENPORT, RUBT B 
ELDBIDGE,DELOBES E 
HABKINS, ELSIE J 
HUHPHRIES, DERRICK A 
KEYSEBLIHG.LEON H 
KNOI, CHARLES E 
MARTINEZ, NEA A 
NCJIBSON.DARLENE STARR 
HOLLI, MASK J 
SAYLOB,JOCELTN A 
SCHWARTZ, SARALEE 
SMITH, JOHN BILLIAB 
TOB, SEBASTIAN 
TBITTT,BABT F 
WOODWARD, EDNA C 
BTNN, JANET T 



SECTT HECEPT OFFICE BOOKEEPER 5,729.04 

SECRETART 3,323.12 

RESEARCHER-LIBRARIAN 5,348.67 

LBJ CONGRESSIONAL INTERN, TO AUG 31 1,180.00 

CLERK 846.60 

ASSISTANT RESEARCH CLERK, TO JUL 31 1,166.67 

RESEARCB CHIEF 4,840.59 

SPECIAL ASSISTANT 9,900.00 

CLERK TYFIST 1,800.00 

SECBETART 2,295.78 

RESEARCH CLERK 1,809.24 

CLIBK 1,742.22 

LEGISLATIVE ASSISTANT 3,999.99 

ADMINISTRATIVE ASSISTANT 8,539.17 

OFFICE MANAGER, TO JUL 31 309.25 

CASEWORKER 5,117.76 

OFFICE HABAGEB 3,775.44 

ADMINISTRATIVE ASSISTANT 3,242.31 



OFFICE OF HON. HABGABET B EECKLEB 



BAOER, CAROL H 
BODDECKE, MARTHA L 
BTRNES, JOSEPH HICHAEL 
CABRAL, EDWARD 
DUFAULT, KENNETH 
EDBONDS, JANET B 
GBEEN, CAROL ANNE 
HANSON, J DOUGLAS 
BOBNER,JOHN B 
LEGGITT,GLENDA 
BEGEBI AN, VALENTINE 
NEALOB,BABJOBIE E 
NUTZHAN,DENISE H 
OBBAN, SUSAN ANNE 
OTTBAB.PETEB H 
POIRIEB,NEAL F 
BITTIHGER, KAREN 
SUPERIOB.ESTELLE C 
THADEO.HABY ANNE 
BESTERN,HARVEI JOSEPH 



EXECUTIVE ASSISTANT 6,310.68 

LEGISLATIVE ASSISTANT 5,500.01 

CASE BORKER 4,329.75 

1,176.24 

STAFF ASSISTANT 3,930.00 

STAFF ASSISTANT 2,050.26 

CASEBOBKEB, TO AUG 31 864.33 

STAFF ASSISTANT, FBOB AUG 1 TO AUG 31 333.33 

OFFICE MANAGER 5,750.01 

PERSONAL SECBETABT 3,500.01 

CASEBOBKEB 1,176.24 

LEGISLATIVE CORRESPONDENT 2,406.00 

RECEPTIONIST, FBOB SEP 5 500.69 

LBJ CONGRESSIONAL IHTEBN, TO JUL 31 590.00 

DISTRICT AIDE 6,000.00 

CASEBORKER, FROM JUL 18 2,918.88 

ADHINISTBATIVE ASSISTANT., TO JUL 31 1,750.00 

CASEBORKER 1,515.75 

CASEBORKEB 2,216.66 

PBESS SECRETARY, TO JUL 31 

ADHINISTBATIVE ASSISTANT/PBESS SECBETABT, FROB 7,383.33 



84 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. HABGARET H HECKLER -CONTINUED 



ZAFFINI, CHARLES B 



CASEWORKER, TO JUL 31 S 

CASEWORKER, FROM SEP 1 995.40 



OFFICE OF HON. W G (BILL) HEFNER 



ANDERSON, DIANE S 
COMBS, RANDALL RAY 
CROOK, CHARLES WILLIAM 
DOUGLAS, JODI B 
FINGER, PAUL EDWARD, III 
FISHER, JAMES PAEIS 
JACKSON, JESSE ELVIN 
JOCHEHS, VIRGINIA II 
LILES,COIT R 
LILLY, EMMA LOUISE 
MCEWEN, WILLIAM J 
NENSOH2, BETTY C 
PAYNE, PATRICIA L 
RABE, CAROL JEAN 
SHERRILL.JOHN CARLYLE 
SNIDER, KATHERINE K 
STOCKSTILL,JO HAY 
YOUNG, HADDIE L 



DISTRICT OFFICE MANAGER 

CLERK, TO JUL 8 

CLERK, FROM JUL 6 TO AUG 5 

LEJ CONGRESSIONAL INTERN, AUG 8 - SEP 7 

CLERK 

EXECUTIVE ASSISTANT 

DISTRICT ADMINISTRATOR 

DISTRICT OFFICE MANAGER 

RESEARCB ASSISTANT 

CLERK 

LEGISLATIVE ASSISTANT 

DISTRICT MANAGER 

CLERK 

LBJ CONGRESSIONAL INTERN, JUL 8 - AUG 7 

CLERK 

RECEPTIONIST-SECRETARY 

PRESS AIDE 

EXECUTIVE SECRETARY 



,1*17.08 

157.33 

590.00 

590.00 

,200.00 

,625.00 

.33U.67 

,700.37 

,125.00 

,000.00 

,000.01 

,l»17.08 

,000.00 

590.00 

,125.01 

,083. 34 

,250.01 

,625.01 



OFFICE OF HON. CECIL HEPTEL 

BAUGHM AN, ROBERT J 
CANTORNA, CARMEN H 
CARLSON, PAUL DOUGLAS 

DIEGO, MARILYN K 
FORBES, NANCY ANNE 
GIUGNI, HEATHER H 
HIGA, DAVIS DENNIS 
HOLROYD, SHARON ANN 
JONES, BETTY T 
KEMP, NANCY LEE 
KIRBY, MICHAEL G 
KIRK, JESSICA KUPAU 
LAM, VALERIE J 
BANWARRING,HAWLEY K 
MATZ, DOROTHY LAURA 
OYAMA, BEVERLY ANN 
SULLIVAN, KAREN LAU 
TAMAHOTO, BRIAN T 



ADMINISTBATIVE ASSISTANT 

SECBETABY 

PRESS SECRETARY, TO AUG 31 

PRESS SECRETARY, FROM SEP 5 

RECEPTIONIST SECRETARY 

PERSONAL SECRETARY 

RECEPTIONIST, FROM SEP 1 

FIELD REPRESENTATIVE 

LEGISLATIVE DIRECTOR 

CLERK RECEPTIONIST 

FIELD BEFBESENTATIVE 

STAFF ASSISTANT 

DIFECTOB OF FIELD OPERATIONS 

LEGISLATIVE ASSISTANT 

RECEPTIONIST, TO AUG 31 

STAFF ASSISTANT 

LBJ CONGRESSIONAL INTERN, TO AUG 12 

LEGISLATIVE ASSISTANT 

FIELD BEPBESENTATIVE 



985.50 
225.00 

500.01 
600.01 
999.99 
833.33 
624.99 
750.01 
100.00 
075.33 
365.51 
500.01 
500.00 
750.00 
999.99 
700.00 
999.99 
375.00 



OFFICE OF HON. JACK HIGHTOWER 



ARNOLD, SHARON L 
BIVINS,LEE,II 
BOHAR,BOY ANN 
BOX, CHARLOTTE ANN 
BRADDOX,HIAMAH T 
CRAIN.CLAIBORN HICKS 
EBBINGTON,HAEJOBIE E 
HIGGINS, BETTY J 
HOWARD, JANEL 
HUNT.BONITA I 
KALE,SHERRILL E 
KIRKMAN,JAY U.III 
LANCASTER, THELMA 
LEIFER.NOHMAN 
LOWREY, WILLIAM J 
MCMURTRY,LEE H,II 
ROBINSON, DIANA CEIL 
SIMS, IBIS A 
SINCLAIR, IVAN E 



STAFF ASSISTANT 1,732.50 

STAFF ASSISTANT 4,488.75 

STAFF ASSISTANT 3,937.50 

STAFF ASSISTANT 1,890.00 

STAFF ASSISTANT 2,100.00 

STAFF ASSISTANT 5,225.01 

STAFF ASSISTANT 2,775.00 

SECRETARY , 4,436.25 

STAFF ASSISTANT 2,546.25 

STAFF ASSISTANT 750.00 

STIFF ASSISTANT 4,121.25 

LBJ CONGRESSIONAL INTERN, TO JUL 7 137.67 

SECRETARY 2,428.26 

STAFF ASSISTANT 375.00 

LEGISLATIVE ASSISTANT 4,488.75 

DISTRICT ADMINISTRATIVE ASSISTANT 6,982.50 

LBJ CONGRESSIONAL INTERN, JUL 11 - AUG 9 570.33 

STAFF ASSISTANT 2,424.99 

ADMINISTRATIVE ASSISTANT 9,805.74 



OFFICE OF HON. ELWOOD HILLIS 



COOPER, JANE 
FARNSLEY, JONATHAN 
FINE, MARGARET 



SECRETARY 

CLERK TYFIST, FROM AUG 1 
LEGISLATIVE SECBETART .... 



2,949.99 

845.33 

3,125.01 



85 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. ELWOOD HILLIS -CONTINUED 



GARVEY, PATRICIA E 
GOSA,JEAN A 
GREENBERG,BETH 
GRIHSLEY,C CLOTELLE 
JUNK, ROBERT C 
KNOX, JACQUELINE 
HOORE, ALBERT L 
NORTON, DONNA K 
PETERS, CAROLYN D 
SAMPLE, HICHAEL H 
3EVERNS,BETSE 
SHAFER,JON C 
SMITH, RONALD E 
TAVEL, ANDREW G 
THOELKE, BARBARA A 
VANCE, ANNETTE I 
BAHPLER, BETTY J 
BILLIAHS, PATRICIA LEE 



LEGISLATIVE ASSISTANT $ 4,599.99 

CLERK 3,375.00 

COLLEGE INTERN, TO JUL 31 433.33 

CLERK 4,749.99 

ADMINISTRATIVE ASSISTANT 8,162.01 

STAFF ASSISTANT, FROH AOG 1 TO AUG 31 800.00 

COLLEGE INTERN, TO JDL 31 433.33 

EXECUTIVE ASSISTANT 4,437.51 

TYPIST 2,450.01 

FIELD REPRESENTATIVE 3,387.51 

COLLEGE INTERN, FROM AOG 1 683.33 

PRESS SECRETARY ' 6,249.99 

LEGISLATIVE ASSISTANT, FROH SEP 1 1,750.00 

COLLEGE INTERN, TO JDL 31 433.33 

PERSONAL SECRETARY 4,224.99 

DISTRICT OFFICE MANAGER 1,950.00 

FIELD OFFICE MANAGER 1,500.00 

FIELD OFFICE MANAGER 3,050.01 



OFFICE OF HON. KENNETH L HOLLAND 



ADAMS, ROBERTA T 
ARNOLD, JAMES T 
BALLINGER, BEVERLY KAY 
BETHEA, MARGARET EERRY 
BOCHANAN, ELLEN WALLACE 
CULP, ALLISON 
GRAY, WILLIAM N 
HEFFNER, JAMES E 
LANE, BETTY J 
LEVIS, DEBORAH J 
MAELOHE, DEBORAH ANN 
MURRAY, DEBRA LEA 
OAKLE*, CHRISTINE P 
SMITH, CHARLES H 
STSGALL, SHIRLEY S 
BILSON, PATRICIA A 
WINBTJRN,JOHN P 



RECEPTIONIST 

DISTRICT REPRESENTATIVE 

LEGISLATIVE AIDE 

ADMINISTRATIVE ASSISTANT, TO JDL 31 

SECRETARY 

LBJ CONGRESSIONAL INTERN, TO JDL 31 

PROJECT MANAGER 

INTERN, FROM AOG 1 TO ADG 31 

DISTRICT REPRESENTATIVE 

STAFF ASSISTANT, TO SEP 15 

INTERN, TO JOL 31 

CASENORKES 

DISTRICT ASSISTANT 

LEGIS. ASST 

DISTRICT REPRESENTATIVE 

PERSONAL SECRETARY 

CLERK, TO ADG 31 

LEGISLATIVE ASSISTANT, FROM SEP 1 . 



874.99 
346.60 
12 5.01 
291.67 
600.63 
500.00 
250.01 
500.00 
166.67 
250.00 
500.00 
000.00 
144.90 
791.66 
000.00 
250.01 



OFFICE OF HON. HAROLD C HOLLENBECK 



BABOT, MERCEDES 
BALDASSARE,HARK G 
BLACKHORE,SOSAN B 
BR IDGEMAN, JAMES D 
BYER, ALBERT 
DALY, CHRISTINE ANN 
DELSOH, MARGARET EVA 
FAHERTY, KATHLEEN ANNE 
GILLOOLY,BILLIAM L 
GREENBERG, KENNETH H 
GOABINO, SHARON K 
JACKSON, DEBRA ANN 
LAKE, JOAN NARY 
LICHTENBERGER,LEE S 
MAGGIANO, MARIA I 
MCLEAN, DAVID J 
MEEHAN, JEANNE M 
NEBHOOSE,NEIL S 
NICK2RSON,PADL M 
PATON, CAROL L 
PRICE, PEGGY E 
TERRILL.EDBARD A 
ZIEGLER,BILLIAH N 



SECRETARY 

CASE SPECIALIST 

EXECUTIVE ASSISTANT 

LEGISLATIVE AIDE 

LBJ CONGRESSIONAL INTERN, TO JDL 31 ... 

EXECUTIVE SECRETARY 

SECRETARY TO CONGRESSMAN 

RECEPTIONIST, FROH AUG 1 

SR COORDINATOR-GOVT LIASON 

STAFF ASSISTANT, FROM AUG 15 TO SEP 14 

DISTRICT MANAGER 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT, TO AUG 1 

ASSISTANT CASEWORKER 

STAFF ASSISTANT, FROM SEP 16 

CASEBORKER 

ADMINISTRATIVE ASSISTANT., TO AUG 15 .. 

PRESS SECRETARY 

SECRETARY 

SECRETARY 

EXECUTIVE ASSISTANT, FROM SEP 14 

STAFF ASSISTANT, TO JUL 15 

STAFF ASSISTANT, FROM AUG 16 TO SEP 15 



,875.00 
,249.99 
,250.00 
,999.99 

590.00 
,249.99 
,124.99 
,416.66 
,124.99 

826.66 
,541.67 
,000.01 
,499.99 
,550.00 
,000.00 

400.00 
,625.00 
,875.00 
,875.01 
,375.01 
,624.99 
,243.06 



OFFICE OF HON. MARJORIE S HOLT 



ADLAH, LESLIE EGEEERG 
BEBGEH, KEITH 
BOZEK, HELEN L 
CARTER, JOHANNA LACH 
CHAIN, HARJORIE P 
FREUNDEL, JOYCE H 



PEFSCNAL SECRETARY 3,456.48 

INTERNSHIP 2,625.00 

DIST COORDINATOR 3,027.66 

CLERK 4,245.36 

EXECUTIVE ASSISTANT 3,338.52 

SECRETARY 2,049.99 



86 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. HARJORIE S HOLT -CONTINUED 



GILL, RAYMOND S 
HALL, NORMAN PAUL 
HELMS, KAREN 
LOPARDO, ROBERT C 
MOREL, JILL M 
MORRAY, GEORGE T 
MURRAY, HEID J 
OWEN, MICHAEL ■ 
PRENDERGAST, RICHARD H 
SIMMS, BEVERLY CECELIA 
SMITH, MARSHA H 
STEADLEY.BINIFRED MELTON 
TIERNEY.JOHN J,JR 
WOMACK, JAMES HICHAEL 
WD, KENNETH 
ZIEBARTH, CHRISTOPHER H 



PRESS ASSISTANT $ 6,901.32 

CLERK 1,749.99 

RECEPTIONIST 2,062.50 

INTERN, TO JUL 15 250.00 

LBJ CONGRESSIONAL INTERN, TO JUL 31 500.00 

EXECUTIVE AIDE 5,541.66 

LBJ CONGRESSIONAL INTERN, AUG 11 - SEP 10 590.00 

RESEARCH ASSISTANT, FROM JUL 5 3,105.55 

ADMINISTRATIVE ASSISTANT 7,422.99 

TYPIST 2,375.01 

CLERK 1,890.00 

SECRETARY 2,400.00 

RESEARCH ASSISTANT, FROM SEP 1 708.33 

PRESS AIDE 2,499.99 

LEGISLATIVE ASSISTANT 6,249.99 

RESEARCH ASSISTANT, FROM AUG 1 TO AUG 31 708.33 



OFFICE OF HON. ELIZABETH HOLTZMAN 



AUGUST, WILLIAM 
CHEASTY, PATRICE ANNE 
COLLENDER, STANLEY E 
COLLINS, NEAL DAVID 
CUTHRELL, KAREN FRANCINE 
GORDON, JANE 
HARVEY, ANN P 
HEIDEHAN,LILA 
JANTZ, DEBORAH L 

KATZANDER, SHIRLEY 
LANG, ELIZABETH 
LERNER, SYLVIA 
NOBLE, THERESA 
REEVES, JO ANN 
SAMUELS, DONNA L 

SANTORO, MICHAEL A 
SCHWEITZER, JAMES J 
SMITH, RODNEY K 
SOLOWAY.JOAN 

SPIGONE, TERESA M 
STONE, ANNE J 

TROKAN,MIRI»H 
WILLKOH, SUSAN A 
WORTHAH,LEAH 
YESENOWSKI, DENNIS F 
ZALEN,VALARIE 



LEJ CONGRESSIONAL INTERN, TO JUL 7 

CLERK , 

TO AUG 20 

CLERK 

SECRETARY/RECEPTIONIST, TO JUL 31 

CLERK, TO AUG 15 

LEGISLATIVE CORRESPONDENT 

LEJ CONGRESSIONAL INTERN, JUL 8 - JUL 31 

SECRETARY, TO AUG 31 , 

FROM SEP 10 

FRCH AUG 16 TO SEP 15 

FROM SEP 1 

FRCH JUL 16 TO AUG 15 

FROM SEP 16 

FRCH SEP 16 

LEGISLATIVE ASSISTANT 

ADMINISTRATIVE ASSISTANT 

FRCH JUL 16 TO AUG 15 

FROM SEP 16 

SECRETARY 

TO JUL 15 

FROM AUG 16 TO SEP 15 

FROM AUG 1 

FROM AUG 16 TO SEP 15 



137.67 
,736.97 
,499.98 
,250.00 

750.00 
,437.50 
,499.99 

452.33 

,933.33 

,500.00 
,937.51 
,687.51 
,882.00 
,000.00 

,358.69 
300.00 
,249.99 
,249.99 

,253.84 
,500.01 

,625.00 
,250.00 
,570.00 
,250.00 
,499.99 
300.00 



OFFICE OF HON. FRANK HORTON 

BURGIN,MICHAELE 
CROWLEY, LINDA H 
DAVIS, ANDREA L 

FITZGERALD, MARY KRESS 

GOLDMAN, PATRICIA A 

GOLLIN, JAMES D 

HALL, JOAN C 

HAWKINS, JANICE M 

HOTSENPILLER, ANDREA GIAMBRONE 

KELLY, ARTHUR W 

KERNS, BARBARA JEAN 

LOVENHEIM, DAVID 

BOY, RUBY G 

ROSE, DOLORES J 

SCOVILL.GRETCHEN L 

SKINNER, CAROL ANN 

WHEELER, GORDON BISSELL 



EXECUTIVE ASSISTANT 6,000.00 

SECRETARY 2,484.40 

INTERN, FROM SEP 1 TO SEP 26 

LBJ CONGRESSIONAL INTERN, TO JUL 31 945.35 

DISTRICT OFFICE SECRETARY 2,874.99 

STAFF ASSISTANT, FROM AUG 1 550.00 

SUMMER INTERN, TO AUG 10 546.67 

STAFF ASSISTANT 5,000.01 

LEGISLATIVE AIDE 3,875.01 

PRCJECT ASST 3,624.99 

SPECIAL ASSISTANT 4,875.00 

LEGISLATIVE SECRETARY 2,874.99 

ADMINISTRATIVE ASSISTANT 10,183.74 

DEPUTY AEMIN ASST 6,999.99 

FEDERAL LIAISON ASST 4,625.01 

CLERK, FROM AUG 1 TO AUG 31 318.00 

FED LIAISON SECY 3,750.00 

LEGISLATIVE ASSISTANT 4,250.01 



OFFICE OF HON. JAMES J HOWARD 



BLADES, NANCY 
BRYSON,JOY BRISTOL 



LEGISLATIVE ASSISTANT 



5,4 99.99 
4,749.99 



87 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. JAMES J HOWARD -CONTINUED 



CODDINGTON,LYNN 
DUFFY, JOHN A 
EDWARDS, LILLIAN E 
HOFFMAN, GEORGEANN E 
HORNDNG, LESLIE 
MATSIEJOK, HELEN 
MESSING, DAVID J 
NORMAN, ANN B 
PASCARELLA, STEVEN H 
PHILLIPS, ANNETTE YVONNE 
RUSKIN, GLENN 
SEVIER, LISA 
SULLIVAN, TIMOTHY F 
THOMPSON, J CARROLL 
BEST, EDNA F 
BEST, JERRY B 
YDCHT.RHODA 



STAFF ASSISTANT 

RESEARCH SECRETARY, TO AUG 5 

LBJ CONGRESSIONAL INTERN, AOG 1 - AUG 31 

RECEPTIONIST 

RESEARCH ASSISTANT 

CASEWORKER 

LEJ CONGRESSIONAL INTERN, FROM SEP 1 .... 

SECRETARY 

RESEARCH ASSISTANT 

LEGISLATIVE AIDE, FROM SEP 1 

CASEWORKER 



300.00 
2,874.99 
2,375.01 

875.00 

590.00 
2,750.00 
3,750.00 
2,625.00 

590.00 
2,916.67 
2,333.33 
1,216.67 
9,900.00 
3,999.99 
3,249.99 
1,125.00 
2,375.01 



OFFICE OF HON. CARROLL HOBBARE JR 



AUSTIN, CLARA VIRGINIA 
BARBEE, BECKY 
BELL, TIMOTHY A 
DONCAN,MARY LEE 
FENDLEY, DORIS J 
FENDLEY, KENNETH C 
GRANT, LORRAINE 
HAMILTON, FRANCES V 
HARRISON, NEVA P D 
HOTCHKISS,DARRELL ALAN 
LAIRD, ROTH M 
LITTLE, ROBIN L 
HAGEE.AVA Y 
MERIWETHER, DIANE S 
MONTGOMERY, ALLEN KEN.JR 
PEARCE, ELIZABETH » 
POLLOCK, STEVEN RICHARD 
PRICE, VICKI LYNN 
STEPHENS, ERIKA J 
STORMENT, AMANDA LEIGH 
TAYLOR, CLAYTON C 

THOMPSON, LINDA KAY 



FIELD REPRESENTATIVE, TO JUL 31 

STAFF ASSISTANT 

LEGISLATIVE AIDE 

FIELD REPRESENTATIVE 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

FIELD REPRESENTATIVE, FROM AOG 1 

LEGISLATIVE SECRETARY 

LEGISLATIVE ASSISTANT 

FIELD REPRESENTATIVE 

STAFF ASSISTANT, FROM SEP 1 

ADMINISTRATIVE SECRETARY 

EXECUTIVE ASSISTANT 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 

PERSONAL SECRETARY 

STAFF ASSISTANT 

PRESS ASSISTANT 

OFFICE MANAGER, TO JUL 31 

ADMINISTRATIVE ASSISTANT, FROM AUG 1 , 
EXECUTIVE ASSISTANT 



583.33 
,249.99 
,000.00 
,250.00 
,500.00 
,500.00 
,875.01 
,000.00 
,000.00 
,500.00 
,499.99 
700.00 
,875.01 
,000.01 
590.00 
700.00 
700.00 
,400.01 
,000.00 
, U50.00 

,050.01 
,500.00 



OFFICE OF HON. JERRY HUCKABY 



BURNETT, LOU GEHRIG 
BURNHAM, TIMOTHY B 
COCHRAN, CHARLES WALTER 
COBLEY.CHRISTI A 
COTTON, HENRY C 
EKERN, CAROL LYNNE 
ELKINS.KATE S 
PREEMAN, VICKI K 
GUFFAIN, PAMELA D 
LABARBERA,BILLIE H 
MADDEN, MARTHA 
MANNING, JOHNNY EARL 
MARTIN, LAWRENCE R 
SHAFFRAN,JOAN GLORIA 
STONECIPHER.ALAN B 
TOOMBS, CLARA ETTA 
WILLIAMS, JAMES B 
WILSON .CAROL L 



AEMINISTEATIVE ASSISTANT 

LBJ CONGRESSIONAL INTERN, JUL 25 - AUG 24 

DISTRICT REPRESENTATIVE 

RECEPTIONIST 

DISTRICT REPRESENTATIVE 

LEGISLATIVE AIDE 

CASEWORKER 

PERSONAL SECRETARY, FROM AUG 15 

CASEWORKER .' 

EXECUTIVE SECRETARY, TO AUG 31 

LEGIS. ASST 

DISTRICT REPRESENTATIVE 

DISTRICT PRESS AIDE 

STAFF ASSISTANT, TO JUL 31 

PRESS SECRETARY 

SECRETARY-CASE WORKER 

ANALYST, FROM SEP 1 

BICE PTICN 1ST 



,899.99 
590.00 
,625.01 
,000.00 
,500.00 
,500.01 
, 50 . 1 
,916.67 
,125.00 
,000.00 
,500.00 
,750.00 
,750.00 
500.00 
,000.01 
,000.00 
166.67 
,400.00 



OFFICE OF HON. BILLIAH J HUGHES 



BALSON.JON CARL 
BLACK, SHARON B 
BROBN.HARK HOBARD 
GERKEN, ROBERT JAY 
GILL, JOYCE P 
GORSKI, DENNIS B 
HAINES, FRANK B 
HECK, PHYLLIS A 



STAFF ASSISTANT 3,531.99 

STAFF ASSISTANT, FROM ADG 1 TO AUG 15 500.00 

STAFF ASSISTANT 4,250.01 

STAFF ASSISTANT 4,658.91 

STAFF ASSISTANT 3,531.99 

STAFF ASSISTANT 2,700.00 

LBJ CONGRESSIONAL INTERN, AUG 1 - AUG 31 590.00 

STAFF ASSISTANT 2,361.12 



96-500 O - 78 - 7 



88 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. BILLIAN J HUGHES -CCNTINOED 



HENDERSON, FLORENCE E 
KATZ, PAMELA BAtt 
KEELEY,JOHN BARK 
KONOBITCH, MARIAN DAWN 
MANZOLILLO, DONNA HARIE 
MARRA, ELIZABETH JULIA 
MINUTES, NARY ELIZABETH 
SIMHONS, JESSIE 
SPEAR, JONATHAN BOYD 
MILLADSEN, ARNOLD F,JR 
YOUNG, EARL B.JR 



STAFF ASSISTANT $ 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

ADMINISTRATIVE ASSISTANT 

STAFF ASSISTANT, TO JUL 31 

RESIAECH ASSISTANT 



,249.99 
,833.37 
,739.45 
,124.99 
,352.63 
,500.01 
,500.00 
,499.99 
,228.36 
,083.33 
,919.05 



OFFICE OF HON. HENRY J HYDE 



COLLINS, ROBERT J,JR 
DURANTE, PATRICK J 
FOGARTY.JANE KUDLICH 
GLAZIER, JUDITH HOLVERTON 
GLINKA, ARLENE L 
HARPER, DONNA M. 
HO RSTMAN, ALICE HOAG 
JANTZE,MARK A 
KELLY, ANN WOODWARD 
KENNY, PAMELA ANNE 
LONGO, MICHAEL A 
MCANDREHS,LISSA 
MORAN, TERESA A 
SHORT, NANCY M 
SILVER, ANN FORISTEL 
SODARO.JEAN P 
STORINO,DOMINIC 
WESTNER, FRANCES C 



CLERK 

ADMINISTRATIVE ASSISTANT 

LEGIS ASST-OFC MG8 

DISTRICT OFFICE MANAGER 

DISTRICT OFFICE HANAGBH 

PRESS SECRETARY 

DISTRICT OFFICE MANAGER 

CLERK, FROM SEP 1 

APPOINTMENT SECRETARY 

SECRETARY 

SPECIAL ASST-DISTRICT 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

RESEARCH ASSISTANT 

SECRETARY 

LEGISLATIVE ASSISTANT 

CLERK 

SPECIAL ASSISTANT 

LEGISLATIVE ASSISTANT 



,749.99 
,402.86 
,539.06 
,905.00 
,456.24 
,455.27 
,706.25 
100.00 
,193.19 
,182.82 
,453.01 
590.00 
900.00 
,085.32 
,228.69 
,182.49 
,201.43 
,000.00 



OFFICE OF HON. RICHARD H ICHORD 



DICKHAN, DANIEL B 
HERZIG, NANCY G 
LANCASTER, KRIS 
LEBIS, ELIZABETH P 
LIVING STONE, SUSAN 
MASINO, VIRGINIA 
HCBRIDE, TERRY LEE 
MILLER, DORTHY L 
MOHRMANN, GEORGE F 
OLSEN, CLIFFORD C,II 
ONEILL,KATHRYN H 
PA TTIE, BETTY POGUE 
RANDOLPH, JOSEPHINE J 
SULLIVAN, AUBREY 8 
TAGGART,WILHA J 
TUNE, SHARON, KAY 
WHARTON, PATTY JO 



FIELD ASSISTANT 

SECRETARY 

LEGISLATIVE ASSISTANT 

CLERK 

ADMINISTRATIVE ASSISTANT 

SECRETARY 

SECRETARY 

EXECUTIVE ASSISTANT 

LEJ CONGRESSIONAL INTERN, TO AUG 5 

SECRETARY 

SECRETARY 

SECRETARY 

ADMINISTRATIVE ASSISTANT 

SECRETARY 

SECRETARY, TO AUG 12 

SECRETARY 



582.80 
324.99 
669.06 
930.22 
125.01 
013.86 
382.70 
651.08 
999.99 
688.33 
750.00 
874.11 
347.45 
878.83 
249.9 9 
840.00 
050.00 



OFFICE OF HON. ANDY IRELAND 

ALLEN, JOHNNY S 
CAREY, EDNA G. 
DORR, SARA H 

FINN, STEPHEN A 
FLEMING, JAMES P 
GEATHERS,LEMEL L 
HOMMEL, VIRGINIA 
HULSEY, SANDRA J 
KEIH, SHARON E 
KNOTT, JAMES H,JH 
MYERS, ALICE V 
PAPAJ, DIANE L 
PERRY, MITZI G 
POLLAK, PATRICIA PEBRIN 
POSTER, BETTYE 
PO BE RS, HALTER 
SARDEGNA,HARJORIE H 
SAULS, STEPHEN A 
ST. JEAN,JIHMIE E 



PRESS ASSISTANT 2,499.99 

STAFF ASSISTANT 2,649.99 

STAFF ASSISTANT, FROM AUG 7 TO AUG 31 

LBJ CONGRESSIONAL INTERN, JUL 7 - AUG 6 1,150.00 

LEGISLATIVE ASSISTANT, FROM AUG 16 2,883.33 

SPECIAL ASSISTANT 4,512.51 

SPECIAL ASSISTANT 4,012.50 

STAFF ASSISTANT 2,262.51 

STAFF ASSISTANT 1,500.00 

STAFF ASSISTANT, TO AUG 19 898.33 

STAFF ASSISTANT, TO AUG 31 3,200.00 

ADMINISTRATIVE ASSISTANT, TO AUG 15 4,131.25 

STAFF ASSISTANT, TO SEP 2 2,247.50 

ASSISTANT CASEWORKER 1,700.00 

LEGISLATIVE AIDE, FBOH SEP 1 791.67 

STAFF ASSISTANT, FROM SEP 1 666.67 

SPECIAL ASSISTANT 6,262.50 

STAFF ASSISTANT, FBOH AUG 23 t 696.67 

LEGISLATIVE ASSISTANT 6,425.01 

DISTRICT ADMINISTRATOR 5,516.66 



89 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. ANDY IBELAND -CONTINUED 



STREET EB, SILVIA 
WATTERS, WAYNE C 



STAFF ASSISTANT $ 3,150.00 

STAFF ASSISTANT 2,400.00 



OFFICE OF HON. ANDREW JACOBS JR 



ADARS,HICHELLE S 
ANDERSON, HART D 
BAKER, HAOBEEN 
BARNETT, STEVEN R 
BURRELL, WINIFRED 
COELHO, PHYLLIS E 
GUGGENHEIM, NARJORIE 
GUISE,THERESA C 
HAGAN, WILLIAM, II 
HIPPLE, THOMAS V 
HOFFMANN, NABGARET G 
HAHERN, CYNTHIA J 
RAIKES,LORETTA H 
RENNEBT,SHABON 
ROBER, JOSEPH D 
SEIDENSTICKER.JAHES 
STEWART, DONALD V 
STONE, LISA A 

TBADB,PATBICK J 



SECRETARY 

RECEPTION 1ST -SECRET ABY 

TO JUL 31 

ADMINISTRATIVE ASSISTANT 

SECRETARY 

CLERK 

CASEWORKER 

STAFF ASSISTANT, FBOH AUG 1 TO AUG 3 1 

LEGISLATIVE ASSISTANT 

LEGISLATIVE ANALYST 

SEC RET ABY 

OFFICE MANAGES ,. 

CONGRESSIONAL INTERN, TO JUL 31 

LEGISLATIVE COUNSEL 

STAFF ASSISTANT, FBOH AUG 1 TO AUG 31 

TO JUL 31 

LEGISLATIVE AIDE, FBOM SEP 1 

PRESS ASSISTANT 



2,750.01 
U, 125. 00 

500.00 
U, 212. 51 
7,500.00 
1,430.94 

330.21 
2,750.01 
2,000.00 
6,000.00 
4,455.27 
2,750.01 
6,249.99 

500.00 
6,21*9.99 
2,201.«3 

500.00 

1,125.00 
i»,212.51 



OFFICE OF HON. JAMES M JEFFORDS 



AOGUSTONI,LISA A 
AULD.JOHN H 
BENEDINI, LORRAINE F 
BBEAZZANO, DAVID JOHN 
CARLSON, STEPHEN T 
CURTIS, KATHI J 

DAHATO, CHARLES B 
DAVIDSON, SHEILA MAE 
DOBHS, MARGARET S 
GBAY, ROBERT JOHN 
HCGREEVY, KATHLEEN L 
HOBIABITY, FRANCIS J 
MDBPHY, PAMELA J 
HURRAY, BERNICE B 
POST.REY D 
PUGLIESE, PATRICIA A 
BOBBINS, HICHAEL BOY 
SLAYTON, DIANA LYB 
SHITH, CHARLES P 
SOHEBS, FREDERICK P 



STAFF ASSISTANT 

COOBDINATOB 

OFFICE HANAGEB 

STAFF ASSISTANT, TO JUL 31 

LEGISLATIVE POLICY ASSISTANT 

STAFF ASSISTANT, FROH AUG 1 TO AUG 31 
LBJ CONGRESSIONAL INTERN, TO JUL 31 ... 

LEGISLATIVE ASSISTANT 

LEGISLATIVE AIDE 

LEGISLATIVE ASSISTANT 

ASSISTANT 

CHIEF CASEWORKER 

CASEWORK IB 

STAFF ASSISTANT 

WESTERN DIST MGB 

STAFF ASSISTANT 

SECRETARY 

LEGISLATIVE ASSISTANT, FROH AUG 1 .... 

RECEPTIONIST , 

LEGISLATIVE ASSISTANT, TO JUL 31 

LEGISLATIVE ASSISTANT 



,291.67 
,950.00 
,601*. 17 
250.00 
,337.50 

,180.00 
,083. 31* 
,177.09 
,1*04.77 
,625.00 
,658.34 
,066.66 

625.00 
,066.66 

750.00 
,010.34 
,033.98 
,333.33 
,197.1*1 
,337.50 



OFFICE OF HON. ED JENKINS 

BALLEW,HARCHETA 
BARRETT, CARL T 
DILWORTH, ROBERT, JR 
DOBSON.ANN YOUNG 
DYER, ELLEN C 
FLEMING, ELIZABETH H 
HARRIS, JACKSON 
HOLLANDSWOBTH,J D.JR 
KINNEY, JAN G 
HCHULLAN,CHEBYL E 
HILLEB,TEBBY L 
PEEVY.DONN H 
REAGAN, RANDALL J 
REEVES, LINDA 
SHARP, ELIZABETH A 
SIHHONS, KATHERI1E D 
SMITH, SAMUEL F 



STAFF ASSISTANT 

STAFF ASSISTANT, FROH JUL 11 

CLERK, TO JUL 7 

SECRETARY 

STAFF ASSISTANT, FBOH AUG 1 

PEESONAL SECRETARY 

CLERK, TO JUL 19 

CLERK, FROH AUG 1 TO AUG 31 

CASEWORKER 

STAFF ASSISTANT, FROH SEP 1 

ADMINISTRATIVE ASSISTANT 

LEGISLATIVE ASSISTANT 

DISTRICT AIDE 

CLERK, FROH AUG 1 TO AUG 31 

STAFF ASSISTANT 

LBJ CONGRESSIONAL IBTERN, JUL 11 - AUG 10 
DISTRICT COOBDINATOB 



000.00 
!*<«<«. 1*5 
116.67 
800.00 
625.00 
1*99.99 
316.67 
500.00 
750.01 
708.33 
000.00 
500.00 
800.00 
500.00 
250.00 
500.00 
750.00 



90 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. JOHN W JENRETTE JB 



BARFIELD, ERNEST L 
CARPICK,WILLIAK A,JR 
CLARK, JOHN F.III 
CLARK, SHIRLEY 
DAVIS, RICHARD F 
GABBLE, CATHERINE C 
GREEN, SAONDRA CHRISTINE 
KEYSERLING, WILLIAM D 
KING, LISA 

LARSON, ELIZABETH A 
HAGLIONE, ANNETTE P 
MATTHEWS, R CDRTIS 
MCCLAH,VELA H 
MCGRAW, MARSHA M 
MCMILLAN, JOHN N 
HILLEB,JEANETTE M 
OHANESIAN, GREGORY HEATH 
PATES, JAMES M 
PEARSON, SHIRLEY G 
FADER, ELIZABETH HEALD 
RIDLEY, JOHN P 
ROBINSON, DIANNE REGINIA 
SKINNER, DONALD RAYMOND 
STEADMAN,ANNE W 
ZEIGLER, HELEN TOWNSEND 



STAFF ASSISTANT, TO JUL 31 $ 1,000.00 

STAFF ASSISTANT 3,792.51 

OFFICE MANAGES / LA 5,565.00 

DISTRICT SECRETARY 3,150.84 

STAFF ASSISTANT, FROM SEP 1 911.08 

STAFF ASSISTANT, FROM SEP 1 500.00 

CASEWORKER 2,973.99 

STAFF ASSISTANT 8,500.01 

STAFF ASSISTANT, FROM AUG 1 TO AOG 31 500.00 

STAFF ASSISTANT 3,511.26 

STAFF ASSISTANT, TO AUG 31 1,110.00 

STAPF ASSISTANT 1,500.00 

RECEPTIONIST 2,385.00 

STAFF AIDE, TO AOG 15 1,755.63 

LEGISLATIVE ASSISTANT, FROM SEP 1 699.99 

EXECUTIVE SECRETARY 4,374.99 

STAFF ASSISTANT, TO AUG 21 2,030.55 

LEGISLATIVE AIDE, FROM SEP 12 791.67 

CASEWORKER 2,183.49 

STAFF AIDE., TO AUG 31 1,855.00 

STAFF ASSISTANT, FROM SEP 1 1,166.67 

STAFF ASSISTANT 2,973.99 

STAFF ASSISTANT 1,250.01 

OFFICE MANAGER-DISTRICT 5,000.01 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 



OFFICE OF HON. HAROLD T JOHNSON 



ANDERSON, SCOTT 
BOOROS , JERRI LYN A 
BOSLEY, CHARLES E 
CAMPBELL, GEORGE A 
COLBURN, CAROLYN LOUISE 
GOSPODNETICH, ELLEN MAE 
HARNEST,KRISTINE S 
JASEPH.JOAN M 
KIDDER, CYNTHIA 
KOLICH,JANE C 
MORSE, GERTRUDE M 
MULLINS, PAMELA Y 
NUTTER, JOHN F 
POORE, BONNIE J 
TOOMA,INGEBORG A 
UPSON, DONALD 
WINDHAM, JUDITH C 



LBJ CONGRESSIONAL INTERN, TO AUG 31 

CL ERK 

ADMINISTRATIVE ASSISTANT 

FIELD REPRESENTATIVE 

CLERK 

EXECUTIVE SECRETARY 

SECRETARY 

EXECUTIVE SECRETARY 

RESOURCES SECRETARY 

CLERK-CASE WORKER 

CHIEF CLEBK-DIST OFF 

LEGISLATIVE SECRETARY 

RESEARCH ASSISTANT 

CLERK, FROM AUG 1 , 

CLERK 

CLERK . 

CLERK-RECEPTIONIST 



180.00 
250.00 
375.00 
563.30 
1*99.99 
678.05 
026.97 
374.99 
474.99 
624.99 
249.99 
474.9 9 
249.99 
666.66 
250.00 
770.00 
874.99 



OFFICE OF HON. JAMES P JOHNSON 



BINGHAM, PATRICIA L 
BRITTON, EDWARD C 
BURRIS,ROXANA D 
CASTEEL, CHARLES P 
CLEARY, WILLIAM H 
CRAM.HEGINA W 
DILZ, DIANE E 
GOLDMAN, PATRICIA A 
HARMS, PENELOPE J 
HARVEY, SHIRLEY REYBOLD 
HELLMER, VICTORIA LYNN 
HUSKA, JAMES B 
JAMESON, JOHN A. 
MCGRAW, KEITH L 
NESSELROAD.PADL EDWIN 
SCHARFEN, CATHERINE A 
TAYLOR, LENNY L 
WILSON, PATTI J 



LBJ CONGRESSIONAL INTERN, TO AUG 5 

STAFF ASSISTANT, FROM SEP 12 

STAFF ASSISTANT 

DISTRICT AIDE 

ADMINISTRATIVE ASSISTANT 

CLERK-DISTRICT OFFICE 

STAFF ASSISTANT 

STAFF ASSISTANT, FROM AOG 1 

STAFF ASSISTANT 

DIST OFF SECTY 

CLERK 

LEGISLATIVE AIDE 

DISTRICT AIDE 

DISTRICT AIDE 

PRESS ASSISTANT 

STAFF ASSISTANT 

DISTRICT AIDE 

STAFF ASSISTANT 



688.33 

527.78 
.951.26 

717.35 
,900.00 

524.16 
,874.99 
,333.34 
,150.01 
,886.94 

621.56 

306.01 
,415.22 

017.93 
,306.01 
,499.99 
,374.99 
,050.00 



OFFICE OF HON. ED JONES 

ADAMS, NULL F 
BUCKLEY, RENATA 
CRIHFIELD,TALMAGE L 
CROW, JAMES A 
EBERSOLE, ANITA HAMPTON 
FLEMING, JAMES F,JR 



FIELD REPRESENTATIVE, FROM SEP 1 1,500.00 

OFFICE PAGE, PROM AUG 1 TO AOG 31 533.33 

FIELD STAFF ASSISTANT 2,751.78 

FIELD SECRETARY 2,008.35 

SECRETARY 3,761.28 

OFFICE PAGE, TO JUL 31 533.33 



91 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. ED JONES -CONTINUED 



FULLERTON.PAUL H 
HAETZFELDT,VERNESSER 
RILL, JOE H 
JACKSON, JANIE 
LANCASTER, RAI H 
LIVINGSTON, MARGARET I 
MCCAFFREY, BETTYE J 
MOODY, CARTER 
PERRY, PATRICIA ANN 
SAVAGE, ISAIAH W 
SEIPERT, SUSAN E 
SHABBEL, KELLY H,JR 
SPILLAR.BILLIAH C 
STEELE, PHILLIP D 
TAYLOR, CAROLYN RAYE 
THOMAS, GEORGE C 
TRACY, MAaTHA SUZANNE 
TROELL, MARTHA H 
IALLING, VICKIE L 



OFFICE PAGE, FROM SEP 1 $ 

STAFF ASSISTANT DISTRICT OFFCE, AUG 1-AUG 31 . 

FIELD REPRESENTATIVE 

SECRETARY 

ADMINISTRATIVE ASSISTANT 

SECRETARY 

SECRETARY, TO JOL 31 

LEJ CONGRESSIONAL INTERN, JUL 12 - AUG 11 

STAFF ASSISTANT 

FIELD STAFF ASSISTANT 

SECRETARY 

LEGISLATIVE ASSISTANT 

OFFICE PAGE, TO JUL 31 

FIELD ASSISTANT, FROM AUG 1 TO AUG 31 

SECRETARY 

FIELD SECRETARY 

SECRETARY, FROM SEP 15 

SECRETARY 

SECRETARY 



533.33 
533.33 
,413.08 
,693.82 
,900.00 
,267.78 
725.60 
590.00 
,767.27 
,926.24 
,953.80 
,350.00 
533.33 
950.00 
,325.84 
,903.70 
400.00 
,958.31 
,791.71 



OFFICE OF HON. JAMES R JONES 



BRANCH, DEBORAH J 
CONREY, JERRY J 
DILL, JOHN C 
FINEGAN, PHILIP COLE 
GLASSCO,KURT G 
GOODWIN, ERIC G 
HARDY, CHARLES Z 
HENDERSON, SUSAN 
HODGES, J NEAL 
INFIELD, PAMELA G 
JACOBSON, RAYMOND H 
JONES, DONNA SUE 
LIVELY, SUSAN C 

LOVOI, ANNETTE M 
MASON, TWYLA KAYE 
ROBERTSON, LINDA 
SMITH, RUTH 
STEELE, PHI LIP T 
WEBSTER, SANDRA D 



STAFF ASSISTANT 

DISTRICT MANAGER 

STAFF ASSISTANT 

SUMMER INTERN, TO JUL 31 

SUMMER INTERN, TO JUL 31 

STAFF ASSISTANT 

ADMINISTRATIVE ASSISTANT 

SUMMER INTERN, TO JUL 31 

STAFF ASSISTANT 

SUMMER INTERN, TO JUL 31 

SPECIAL ASSISTANT 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT, FROM AUG 5 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT, FROM AUG 1 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT 



,375.00 
,999.99 
,000.00 

600.00 

400.00 
,168.74 
,500.00 

600.00 
,249.99 

200.00 
,999.99 

590.00 

,750.01 
,249.99 
,750.01 
,874.99 
,750.00 
,249.99 
,999.99 



OFFICE OF HON. SALTER B JONES 



ANDERSON, SUSAN JEAN 
CAVAS, BARBARA L 
CHEARS, NELSON POWELL 
COOLEY, HAROLD D 
CUHHING,ANN 
CURRY, GLORIA F 
EVERETT, JUDITH ANN 
HELBIG, JANET CLARA 
KINION,KEN 
LANG, NELLIE B. 
LEWIS, IRVING P 
LUPTON, FLOYD J 
MATTHEWS, KENNETH 
MILLS, LYDIA G 
OGLESBY,GENE H 
WELCR, EDMUND BURT 
WIESE, PATRICIA P 



SECRETARY 

SECRETARY , 

CLERICAL ASSISTANT, TO JUL 31 

CLERICAL ASSISTANT, TO JUL 31 , 

MILITARY6VET CASE WORKER , 

PERSONAL SECRETARY 

CASEWORKEB, TO JUL 31 , 

SECRETARY , 

CLERICAL ASSISTANT, TO AUG 31 , 

SECRETARY 

CLERICAL ASSISTANT, TO JUL 31 

ADMINISTRATIVE ASSISTANT 

CLERICAL ASSISTANT, FROM AUG 1 TO AUG 31 

SECRETARY 

DISTRICT OFFICE MANAGER , 

LEGISLATIVE ASSISTANT 

SECRETARY CASEWORKER 



,999.99 
,250.01 

800.00 

600.00 
,937.50 
,101.91 
,309.28 
,249.99 
,200.00 
,100.01 

600.00 
,337.26 

600.00 
,312.50 
,032.90 
,969.25 
.931.14 



OFFICE OF HON. BARBARA JOREAN 



ALCOCK, ROBERT M 
BASS, CHARLES H 
BLCONT, CORLISS R 
DOGGETT,EDNA DELORES 
FAWCETT, KENNETH J 
HARMON, ROSALIND C 
JENKINS, BENNIE PEARL 
LAKES, LESTINE 
MYERS, RUFUS H,JR 
RICKS, MARIAN G. 



LEGISLATIVE ASSISTANT 6,909.99 

STAFF ASSISTANT 3,125.01 

STAFF ASSISTANT, TO AUG 19 816.67 

STAFF ASSISTANT 2,250.00 

STAFF ASSISTANT 2,499.99 

STAFF ASSISTANT, TO AUG 31 , 1,333.34 

STAFF ASSISTANT DISTRICT OFF 2,165.01 

OFFICE MANAGER 3,825.00 

ADMINISTRATIVE ASSISTANT 8,199.99 

STAFF ASSISTANT 3,261.67 



92 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. BARBARA JORDAN -CONTINUED 



SENESIE, SHEILA 
SOLLI VAN, KEVIN J 
TEHHY,EVEB CAROL 
TREVINO,MARY LOO 
TUCKER, DEBI H 
WILLIAMS, WELDON D 



STAFF ASSISTANT, FROB SEP 1 $ 666.67 

STAFF ASSISTANT, TO JOL 31 1,583.33 

STAFF ASSISTANT 3,458.76 

STIFF ASSISTANT 2,776.05 

STAFF ASSISTANT 3,432.49 

STAFF ASSISTANT, TO AUG 21 2,259.59 



OFFICE OF HON. ROBERT W KASTEN JR 



BEAL,LYNN K 

BRAITHWAITE.MARY CATHERINE 
CONKLING,KATHERINE V 
CRANDALL,JANNA SEFCIK 
DA VIS, RICHMOND T P 
DOUGHTY, PATRICIA 
HARFF, JAMES 8 
MATTHEIS,ANN H 
MCCADLEY.JOELLE E 
MILLER, ROBERT C 
OBROKTA.ANN L 
POWERS, MARCIE 
SCHMIDT, DALE R 
SHANNON, MICHAEL S 
SHEAR, VERA 
SRAMEK, HELEN MARIE 
ZIMHERMANN, KATHLEEN E 



PERSONAL SECRETARY 

STAFF ASSISTANT , 

STAFF ASSISTANT 

ADMINISTRATIVE SECRETARY , 

RESIARCB ASSISTANT , 

SPECIAL ASSISTANT 

ADMINISTRATIVE ASSISTANT , 

STAFF ASSISTANT , 

STAFF ASSISTANT ADMINISTRATION ..... 

DISTBICT ASSISTANT , 

CASEWORKER , 

COMMDNICATIONS DIRECTOR 

SYSTEMS DIRECTOR , 

LBJ CONGRESSIONAL INTERN, TO JOL 31 

SECRETARY , 

LEGISLATIVE DIRECTOR , 

STAFF ASSISTANT DISTRICT OPFCE 



,125.00 
750.00 
,250.00 
,624.99 
,161.00 
,750.01 
,750.00 
,812.50 
,125.01 
,249.99 
,625.01 
,562.49 
,125.00 
500.00 
,750.01 
,000.01 
,375.01 



OFFICE OF HCN. ROBERT B KASTENNEIER 



APPLEBAOH, STEWART H 
CARR,JODITH A 
CAROSO,DOOGLAS J 
DONOHOE,ANNE MARIE 
FESTGE,OTTO 
FRANK, MATTHEW J 

FOLLERTON.JOLIA C 
HAYNESWORTH, RAYMOND C 
LANGILL,HARILY JEAN 
MYERS, SHIRLEY ANN 
NASHOLD, JULIE A 
OSHIKI,KAZ 
SCHOLTZ, CLAYTON 

SHOL.MAOREEN ALYCE 
SLAUGHTER, GENE K 
STRICKER, WALTER P 
VUKELICH, HELEN G 
WICKER, HOWARD JOSEPH 
WOLF.GERTRODE B 



CLERK 5,250.00 

CLERK 5,625.00 

CLERK 4,625.01 

CLERK 3,699.99 

HOME SECRETARY 6,750.00 

CLERK, TO JUL 19 

LBJ CONGRESSIONAL INTERN, JOL 20 - AUG 19 906.67 

CLERK » 1,350.00 

CLERK, TO JOL 5 16.67 

CLERK 4,175.01 

CLERK 2,250.00 

CLERK 1,449.99 

CLERK 10,091.81 

CLERK, FROM JOL 6 TO AUG 26 

LBJ CONGRESSIONAL INTERN, TO JUL 5 948.33 

CLERK 3,249.99 

CLERK 474.99 

CLERK, FROM SEP 8 115.00 

CLERK 3,249.99 

CLERK, TO SEP 5 1,625.00 

CLERK 3,424.99 



OFFICE OF HON. ABRAHAM KAZEN JR 



BENAVIDEZ.SOSANA L 
CASSO, ALFONSO I.JB 
CHIONI, KAREN A 
DURBANO, LILLIAN 
FLEMING, ROBERT H 
GRANT, DELLA M 
HENDERSON, WALLACE [ 
MADISON, NANCY P 
MARTINEZ, ALFONSO A 
MURRAY, PATRICIA A 
PITTMAN, STELLA T 
SO LI S.JOHN 
WOYNOSKI, MARION 



SECRETARY 2,412.12 

LBJ CONGRESSIONAL INTERN, TO JOL 31 590.00 

SECRETARY 2,199.35 

CASEWORKER 6,360.57 

ADMINISTRATIVE ASSISTANT 8,472.06 

CASEWORKER 4,367.61 

FIELD REPRESENTATIVE 3,559.02 

SECRETARY 1,920.00 

RESEARCH ASSISTANT 4,463.58 

EXECUTIVE SECRETARY 6,694.29 

DISTRICT OFFICE MANAGER 4,548.57 

ASST FIELD REP 1,919.13 

CASEWORKER 4,193.19 



OFFICE OF HON. RICHARD KELLY 



ABERNATHY, NANCY 
ALDERSON, NANCY LOU 
ARMSTRONG, FREDERICK H 



CASE WORKER 

CASEWORKER 

FROM JUL 8 TO AUG 31 

DISTRICT ADMINISTRATIVE ASSISTANT, FROM SEP 1 



2,250.00 
2,625.00 



6,466.66 



93 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. RICHARD KELLY -CONTINUED 



ARMSTRONG, WILLIAM S 
APOBOLA, DIANE 

BELASCO, ELIZABETH ANN 
BELL, CARBINE J 
BOSCEHI, BARBARA A 
COVERSTON, HARRY S 
DDRDALL, LINDA PATRICK 
FINN, STEPHEN A 
FISCHER, DOUGLAS P 
FLYNN,HICHAELA 
FRAAS, KERRY ALAN 
GARTLAND, JOHN C 
HETHERINGTON,BDTH 
HOPPE.JOHN DAVID 
KOSHGARIAN, DAVID H 
HCCORHICK, VALERIE B 
HORENO.DELORES A 
PURVIS, BILLIAH L 
SALMON, DOROTHEA 
SHITH.EFFIE HARLENE 
ST LAORBNT, GEORGES, III 
TRAOERNICHT, CATHERINE B 
TOBOLINO.ROSE HARIE 
WOLBAHSHT, JAMES L 
YOUNG, SHARON Y 



SPECIAL ASSISTANT $ 7,250.01 

STAFF ASSISTANT, FROH JUL 12 TO JUL 31 

SECRETARY, FROM AUG 1 1,399.92 

RECEPTIONIST-SECRETARY, FROM JUL 11 2,168.50 

PERSONAL SECRETARY, TO JUL 3 108.33 

SECRETARY 2,916.67 

LEJ CONGRESSIONAL INTEHN, TO JUL 31 590.00 

PERSONAL SECRETARY, FROH JUL 14 2,644.46 

LEGISLATIVE ASSISTANT, TO JUL 10 69a.UK 

SPECIAL ASSISTANT 1,770.00 

SECRETARY, TO JUL 11 244.44 

SPECIAL ASSISTANT, TO AUG 7 1,541.67 

AIHINISTRATIVE ASSISTANT, TO JUL 3 330.00 

DISTRICT ASSISTANT 1,800.00 

RESEARCH ASSISTANT, FROH AUG 1 1,000.00 

LEGISLATIVE ASSISTANT, FROH JUL 4 3,766.67 

CASE BORKER 2,874.99 

SECRETARY 1,875.00 

PRESS AIDE 6,249.99 

SECRETARY, TO JUL 21 455.00 

SECRETARY-CASE BORKER 4,050.00 

LBJ CONGEESSIONAL INTERN, AUG 1 - AUG 31 590.00 

LEGISLATIVE SECRETARY., TO JUL 8 244.44 

RECEPTIONIST-CASE BORKER, TO JUL 8 184.25 

LEGISLATIVE AIDE, FROH AUG 22 3,750.00 

LEGISLATIVE SECRETARY, FROH JUL 9 TO SEP 9 .. 2,274.99 



OFPICE OF HON. JACK F KEHP 

BARTLETT, BRUCE R 
BRUNNEH, PATRICIA A 
COLEHAN.THOHAS S 
DOHN, JANET L 
GROSSMAN, SHERYL J 
HEINZE,BERND G 
BIATT, LORRAINE KIRKER 
BOLBICK, LINDA ANN 
KIELICH, CHRISTINA M 
KNOX,JACQUELYN D 
LANDRUS, SHERRY LYNN 
LEBANDOBSKI,BRIAI N 
OGIONY, JOSEPH L 
ROTTERMAN, LOUIS J. 
RUTKOBSKI.EDBARD J. 
SHATTOCK, HARIE 
TEAGDE, RANDAL C 
ZELASKA, SHARON ANN 



LEGISLATIVE ASSISTANT 

DISTRICT STAFF ASSISTANT 

LEGISLATIVE AIDE 

PERSONAL SECRETARY, TO JUL 7 

CASEBORKER , 

STAFF ASSISTANT 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT, FROH AUG 8 TO AUG 31 ... 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT 

RECEPTICNIST-SECRETARY., FROH JUL 18 

LBJ CONGRESSIONAL INTERN, JUL 18 - AUG 17 

STAFF ASSISTANT 

EXECUTIVE ASSISTANT 

DISTRICT REPRESENTATIVE 

DISTRICT STAFF ASSISTANT 

ADMINISTRATIVE ASSISTANT 

EXECUTIVE SECRETARY 



,250.01 
,583.33 
,525.01 
291.67 
,750.00 
875.01 
999.99 
332.09 
,500.01 
,116.00 
,636. 10 
590.00 
,749.99 
,498.64 
189.16 
,583.33 
,338.76 
,374.99 



OFFICE OF HON. BILLIAH H KETCHDH 



BHYAHT, CYNTHIA E 
COOKE, STEPHEN D 
DEARHON, DONALD H 
DEAVER, BILLIAH H. 
DIGNAN, KATHLEEN H 
DINGHAN, RICHARD B 
PHASER, JAYE C 
GUSTINIS.HARGARET 
HASTINGS, VICKI LEE 
HDRFORD, SUSAN B 
LASSERE, REBECCA LYNN 
MAPLES, EULA H 
HAXSON, STEPHANIE 
HOORE, JAMES P,JR 
RICH, A MARGARET 
SEEGBR, CHRISTOPHER C 
SHEEHAN, KATHLEEN ANNE 
SHITH,HARY-TERESA E 
SOFFA, SUSAN S 
SBISCHER, DORIS R 
TOBSEHD.SUZAN ALICE 



STAFF INTERN, TO AUG 31 1,180.00 

LEJ CONGRESSIONAL INTERN, TO AUG 31 1,180.00 

RESEARCH ASSISTANT, TO AUG 31 1,500.00 

DISTRICT REPRESENTATIVE 6,999.99 

RECEPTIONIST 3,399.99 

RESEARCH ASSISTANT 2,400.00 

LEGISLATIVE CORRESPONDENT, FROM AUG 8 1,325.00 

CLERK TYPIST, TO SEP 16 2,132.23 

INYO COUNTY STAFF ASSISTANT, FROM SEP 19 266.67 

AIHINISTRATIVE SECRETARY, TO JUL 31 750.00 

COUNTY ASST, TO SEP 26 2,003.42 

DISTRICT SECRETARY 3,896.76 

RESEARCH ASSISTANT, FROH SEP 19 300.00 

LEGISLATIVE ASSISTANT 3,208.34 

LCS ANGELES COUNTY ASSISTANT 3,099.99 

ADHINISTRATIVE ASSISTANT 11,874.99 

LEGISLATIVE CORRESPONDENT 3,789.99 

PRESS ASSISTANT 4,250.01 

SECRETARY 2,000.01 

CASEBCRKER 5,160.00 

DISTRICT OFFICE SECRETARY 2,583.33 



94 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. MARTHA KEYS 

AITKEN,JODITH BOEBOS 
ALWARD, BARBARA DEAN 
BRISCOE, PRISCILLA M 
BUCHELE, JAMES P 
CASBER. SANDRA K 
CHAHBLIN,HARY SUSAN 
DOOLEY, BETTY P 
DUGGAN.HARY K 
HAMMAN,CATHRYN L 
HWANG, GRACE 
JACQOES,PAOLA RAE 
JOHNSON, DIANE M 
KABERLINE, MICHAEL J 
LENNEN, CHARLES MICHAEL 
MOORE, CARLA E 
NELSON, ROBERT RAY 
NICHOLS, ROBERTA J 
ODELL, GLORIA J 
PIDGWAY, MARTHA L 
ROGERS, KAREN T 
STEVENSON, RICHARD F 
VEGA, GEORGE D 
WATSON, GERALYN 
WILDES, DAVID SAYRE 



ADMINISTRATIVE ASSISTANT $ 8,025.00 

SECRETARY 2,400.00 

RESEARCH ASSISTANT 2,225.00 

DISTRICT ADMINISTRATIVE ASSISTANT., TO JUL 15 . 1,511.00 

LEGISLATIVE AIDE 5,717.00 

RESEARCH ASSISTANT 2,760.00 

STAFF ASSISTANT, FROM SEP 1 1,518.00 

RESEARCH ASSISTANT, FROM AUG 1 1,500.00 

STAFF ASSISTANT 1,100.00 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

RESEARCH ASSISTANT, FROM AUG 1 400.00 

STAFF ASSISTANT 2,625.00 

STAFF ASSISTANT, TO AUG 31 1,300.00 

DISTRICT ADMINISTRATIVE ASSISTANT 8,250.00 

STAFF ASSISTANT 2,805.00 

LEGISLATIVE ASSISTANT 3,630.00 

PERSONAL SECRETARY 3,480.00 

PRESS AIDE 4,002.00 

STAFF ASSISTANT, TO JUL 31 340.00 

STAFF ASSISTANT, TO JUL 31 350.00 

STAFF ASSISTANT, FROM SEP 1 950.00 

STAFF ASSISTANT 2,400.00 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 1,368.00 

LEGISLATIVE ASSISTANT 3,630.00 



OFFICE OF HON. DALE E KILDEE 



DONNELLY, BARBARA 

EPPS,JOHN M,JR 

HERRICK, DENNIS F 

LETHBRIDGE.HUGH J 

MCCOY, YVONNE G 

NEOROHR, HERMAN 

NOUHAN, DOLORES ANN 

OSTAHOWSKI,JEFFERY LAWRENCE 

PERRY, NORA G 

POWERS, FAITH E 

SMITH, ELIZABETH MARIE 

WAGAMON, THOMAS W 

WILHELM, SUSAN A 

WILKINSON, DEAN M 

YOUNG, JOSEPH F,JR 



STAFF ASSISTANT 

STAFF ASSISTANT 

PRESS SECRETARY 

STAFF ASSISTANT, FROM SEP 1 ..., 

STAFF ASSISTANT 

DISTRICT REPRESENTATIVE 

RECEPTIONIST SECRETARY 

STAFF ASSISTANT 

SECRETARY 

OFFICE MANAGER 

LEGISLATIVE ASSISTANT, TO AUG 31 

ADMINISTRATIVE ASSISTANT 

STAFF ASSISTANT, FROM SEP 1 .... 

STAFF ASSISTANT 

STAFF ASSISTANT 



,499.99 
,500.00 
,833.33 

833.33 
,499.99 
,250.00 
,750.00 
,625.01 
,499.99 
,124.99 
,000.00 
,750.01 

833.33 
,375.01 
,625.01 



OFFICE OF HON. THOMAS N KINDNESS 



ALF,LUCY 

ARTNER, STEPHEN J 
BRILL, VIVIAN R 
ECKERT,FAYE 
GENE" RO, LAURA 
GILLESPIE, ROGER WAYNE 
GUYER,ROSETTA KAE 
HEYDINGER,TED A 
HOPPE.JOHN DAVID 
JAMES, ROBYN LEE 
JONES, MARY ANN 
LISELLA, LOUIS A 
MCKENNEY, WILLIAM R 
NGUYEN, LOC THE 
OCONNELL, COLLEEN M 
RIDDLEBERGEH,JANE D 
SCOTT, NANCY SUE 
SEHLER, THOMAS J 
SNEED, SHAUNA S 
TIEBNEY.JOHN J,JR 
TURNBULL, ROBERT M 
WOOD, PAUL L,JR 



DISTRICT CLERK 

RESEARCH ASSISTANT, TO AUG 31 

DISTRICT SECRETARY 

DISTRICT CASEWORKER 

RESEARCH ASSISTANT, TO JUL 31 

DISTRICT REPRESENTATIVE 

LEGISLATIVE CORRESPONDENT 

LEGISLATIVE ASSISTANT 

RESEARCH ASSISTANT, TO JUL 31 

DISTRICT SECRETARY 

CASE WORKER 

DEPUTY DISTRICT REPRESENTATIVE 

COMMUNICATIONS ASSISTANT 

RESEARCH ASSISTANT, FROM AUG 1 TO AUG 31 

LEGISLATIVE CORRESPONDENT 

SECRETARY-CASE WORKER 

EXECUTIVE SECRETARY 

RESEARCH ASSISTANT, FROM SEP 1 

LBJ CONGRESSIONAL INTERN, TO AUG 5 

RESEARCH ASSISTANT, FROM AUG 1 TO AUG 31 

RESEARCH ASSISTANT 

DEP DIST REP 



,703.49 
,805.00 
679.34 
,588.64 
500.00 
,597.41 
,679.34 
,809.09 
,000.00 
,100.00 
,553.70 
,212.08 
,679.34 
300.00 
,873.33 
,538.02 
,809.09 
925.00 
688.33 
500.00 
,767.07 
,695.25 



OFFICE OF HON. EDWARD I KOCH 



ALTMAN,RUTH S 
ARNO, BENJAMIN J 
BOTNICK, VICTOR 
BRICKFIELD, ELIZA BETH 
CAUTHERS, EDWARD J 



STAFF ASSISTANT 4,318.74 

STAFF ASSISTANT, TO JUL 31 590.00 

STAFF ASSISTANT 3,362.22 

AUCINTHENT SECTY/STAFF ASST 320.83 

PRINTER, TO JUL 31 958.33 



95 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. EDWARD I KOCH -CONTINOED 



COFFEY, DIANE N 
DELRIVERO.NYDIA 
FLYNN, CHARLES W 
GARRIGAN.BARY J 
HAIR, ELISABETH RAEBORN 
HZNIGAN, ELLEN MILLER 
KAY, KENNETH R 
HATLAND,KIH Q 
HENSCHSL,RONAY ABLT 
NASH, DEBORAH H 
SIEGEL,ANN B 
SOODAK.IRIS 
STERN, LESLIE F 
VICKERY,ALAN B 
WATSON, GERALYN 
WEINBERGER, JAMES B 
WYCKOFF, BARBARA G 



DIRECTOR $ 5,345.00 

CASEWORKER 2,750.01 

STAFF ASSISTANT, TO AUG 31 1,750.00 

SECRETARY 2,750.01 

LEGISLATIVE CORRESPONDENT 2,625.00 

CASE WORKER/LEGISLATIVE PROJ, FROB SEP 26 173.61 

LEGISLATIVE ASSISTANT 5,050.01 

LEGISLATIVE RESEARCH ASSISTANT, FROM AOG 1 ... 1,133.28 

ADBINISTSATIVE ASSISTANT 2,083.33 

STAFF ASSISTANT, TO JOL 31 590.00 

CASE iORKER/LEGISLATIVE PROJ 3,166.67 

STAFF ASSISTANT 3,924.99 

CLERK, FRCB AOG 1 TO AOG 31 1,000.00 

STAFF ASSISTANT, TO AOG 31 1,204.14 

STAFF ASSISTANT, FROM SEP 1 1,500.00 

LBJ CONGRESSIONAL INTERN, TO JOL 31 590.00 

STAFF ASSISTANT 4,235.34 



OFFICE OF HON. PETER H KOSTHAYER 



BLASI, JOSEPH R,DR 
BRAONSTON.JODITH L 
BREWER, F HOLCOBB 
CAMPBELL, AARON R 
DONCAN, JANICE E 
EAGAN,DINA B 

EISENHOWER, JAB ES 
FISHER, THOMAS E 
HOCHBERG, DEBORAH R 

HOFFBANN,SOSAN R 
IRVINE, WALTER G 
ROBOT, JOHN J 

LESKO, MARILYN ADELE 

BAGIDA, STEVEN S 
NAPLES, HARK 
MCNABARA, PATRICK J 

BCNIFF, GERARD B 
MITCHELL, EDWARD, II 
PEYSER, PETEB A 

SEAGEB,JOHN 
SMITH, ETHEL J 
SiAHSON, MARGARET E 
TABAS, MICHAEL J 
VOYTKO, CATHERINE fl 
WILLISOH,KIEK G 



STAFF ASSISTANT, FROB AOG 1 TO AOG 31 2,400.00 

CASEWORKER 2,124.99 

LEGISLATIVE ASSISTANT 5,799.99 

STAFF ASSISTANT, TO JOL 31 275.56 

PERSONAL SECRETARY, FROB JOL 16 1,779.58 

SOMBER INTERN, FROM JOL 9 TO JOL 22 

LBJ CONGRESSIONAL INTERN, TO JOL 8 344.00 

SOBBER INTERN, TO JOL 31 750.00 

STAFF ASSISTANT, TO AOG 31 1,666.66 

STAFF ASSISTANT, TO JOL 15 

STAFF ASSISTANT, FROB AOG 16 874.99 

RECEPTIONIST 2,699.99 

STAFF ASSISTANT, FROB AOG 1 666.66 

SOBHIR INTERN, TO JOL 31 750.00 

STAFF ASSISTANT, TO JOL 31 

SECRETARY, FROM AOG 1 2,624.99 

LEGISLATIVE CORRESPONDENT, FROB SEP 1 1,312.50 

SOMMER INTERN, FROB JOL 16 TO JOL 31 200.00 

CLERK, TO JOL 31 

VAN OPERATOR, FROB AOG 1 2,166.67 

LEGISLATIVE CORRESPONDENT 3,300.00 

ADBINISTBATIVB ASSISTANT 10,099.81 

LEGIS CORRESPONDENT, TO AOG 8 

LEGISLATIVE ASSISTANT, FROB AOG 15 3,397.22 

DISTRICT OFFICE MANAGER 5,049.99 

SPECIAL ASSISTANT 5,324.99 

CLERK, FRCB AOG 1 1,583.34 

GRANTS COORDINATOR, FROB SEP 1 1,250.00 

OFFICE MANAGER 5,324.99 

LEGISLATIVE COBBESPONDENT, FBOB AOG 9 1,516.67 



OFFICE OF HOB. JOHt 

BRACKENBURY, PAMELA K 

CHOTT.JOHN W,JB 
ELIASON, ROBERT G 
?A BELLI, PAUL L 
FOX, JANICE W 
FREITAS, CAROLYN C 
GAAB, DENNIS H 
GINSBORG, BETTY ANN 
HOLLAND, IRWIN 
JELBINI, PEGGY A 
LONA, VIRGINIA 
HAGNOSON, ROBERT GARY 
PORDOMINSKY, AMANDA 

PRICE, VIVIAN BLANCHE 
STRICKLETT.JOHH E 
TALBOT, STEPHANIE 
TSOTRAS, FRANK G 
VANDEELEH, AGNES 
WILSON, JOHN W.JB 
WILSON, JOANITA ANN 



SECRETARY-RECEPTIONIST, TO AOG 31 

SECRETARY, FROM SEP 1 3,170.76 

LEGISLATIVE COBBESPONDENT 3,782.82 

LBJ CONGRESSIONAL INTERN, AOG 1 - AOG 31 590.00 

LEGISLATIVE ASSISTANT 4,374.99 

STAFF ASSISTANT, FBOM SEP 1 291.67 

CCNSTITOENT SEBVICES BEP 1,816.17 

ADBINISTBATIVB ASSISTANT 10,183.74 

STAFF ASSISTANT, FROM AOG 1 TO AOG 31 425.00 

DISTRICT REPRESENTATIVE 7,126.38 

SECRETARY-RECEPTIONIST, FBOB SEP 1 750.00 

CCNSTITOENT SEBVICES REP 3,459.39 

LEGISLATIVE ASSISTANT 4,717.35 

SECRETARY-MACHINE OPER, TO JOL 31 

E3CEC0TIVE SECRETARY, FROM AOG 1 2,999.99 

CONSTITOENT SERVICES REP 1,816.17 

STAFF ASSISTANT, FBOB SEP 1 250.00 

STAFF ASSISTANT, TO AOG 31 500.00 

STAFF ASSISTANT, PBOB AOG 1 TO AOG 31 500.00 

SECBETABY 2,987.67 

LEGISLATIVE ASSISTANT 3,969.06 

CCNSTITOENT SERVICES REP , 3,914.90 



96 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HCN. ROBERT KRUEGER 



AHBLER.JOHN 
CARDENAS, SARAI 
COX, SUSAN 

DDTKO, DANIEL A 
DUTKO,MARY 
GONZALEZ, ROSARIO 
GDINN,NINA J 
GUTIERREZ, LINDA 
HILBER,SARA E 
KROPP, ROBIN LOIS 
HA NN, LINDA 
MANN, ROBERT 
HAULSBY, PATRICIA ANN 
MAURO, GARRY P 
HCCABE, KAREN ANN 
HCGRATH,THOHAS H 
MCKAY, NIKE 
ROBERTSON, DAN 
ROOF, STEPHEN 
SLAUGHTER, BOB 
SBEARINGEN, SIDNEY H 
BHITE,B H 
WILSON, LINDA KAREN 



LBJ CONGRESSIONAL INTERN, FROM AUG 1 $ 1,180.00 

OFFICE MANAGER 2,436.51 

SECRETARY TO ADMIN ASST, TO JUL 31 

ADMINISTRATIVE SECRETARY, FROM AUG 1 3,600.00 

ADMINISTRATIVE ASSISTANT 7,437.51 

RECEPTIONIST 2,687.1*9 

STAFF ASST-CASE BORKER 2,166.67 

OFFICE MANAGER 2,750.00 

ADMINISTRATIVE SECRETARY 2,193.36 

PERSONAL SECRETARY, TO JUL 31 1,621.85 

OFFICE MANAGER 3,666.67 

LEGISLATIVE AIDE, FROM SEP 1 350.00 

PEESS SECRETARY 4,652.94 

SECRETARY, FROM AUG 9 1,444.44 

DISTRICT ADMINISTRATIVE ASST, TO JUL 31 2,916.67 

LEGISLATIVE AIDE 2,674.99 

CASE BORKER 1,620.24 

STAFF ASSISTANT 3,000.00 

OFFICE MANAGER 2,850.00 

LEGISLATIVE AIDE, FROM AUG 1 2,000.00 

LEGISLATIVE ASSISTANT 4,500.00 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

LEGISLATIVE, FROM AUG 1 2,400.00 

PRESS SECRETARY 2,700.00 



OFFICE OF HON. JOHN J LAFALCE 



ALDERFER, BARBARA C 
ARTZ, NANCY ANNE 
BARNES, LEDA K 
BLACK, EDWARD J 
COHABT, JUDITH N 
COLE,LYNNE D 
CORCORAN, PENELOPE J 
FITZGERALD, MARY E 
KRATTLI, VERBA KAY 
LEE, RICHARD T 
MANN, PAUL S 

MUSCOREIL,REBEKAH C 
NUGENT, TIMOTHY K 
PRIDDLE,ELVI H 
RANDELS, GEORGE D 

SKINNER, BOBIN ANNA 
TAECKER, BARBARA H 
TAYLOR ,EM HA JANE 
VINCENT, DOUGLAS T 
REAVER, DIANE H 
HENDROB,ALENE H 



STAFF ASSISTANT 3,200.00 

STAFF ASSISTANT 3,575.00 

STAFF ASSISTANT, PROM SEP 19 300.00 

ACHINISTRATIVE ASSISTANT 7,705.28 

LEGISLATIVE ASSISTANT, TO AUG 31 2,383.34 

STAFF ASSISTANT 2,444.54 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

STAFF ASSISTANT 2,743.58 

STAFF ASSISTANT, TO JUL 31 500.00 

STAFF ASSISTANT 5,799.99 

PRESS ASSISTANT, TO JUL 31 

PRESS ASSISTANT, FROH AUG 5 3,700.01 

STAFF ASSISTANT ,... 2,874.99 

STAFF ASSISTANT, FROH SEP 21 700.00 

STAFF ASSISTANT 2,324.57 

SPECIAL COUNSEL, TO JUL 31 

SPECIAL COUNSEL, FROH AUG 12 8,422.47 

STAFF ASSISTANT 3,549.99 

STAFF ASSISTANT 3,000.00 

STAFF ASSISTANT, TO JUL 10 263.89 

INTERN, FROM SEP 1 400.00 

STAFF ASSISTANT, FROM AUG 1 1,768.33 

STAFF ASSISTANT 2,594.34 



OFFICE OF HON. ROBERT J LAGOHABSINO 



BELL,BELDEN HILL 
CARTER, FRANCES H 
COKER,DELORES S 
DOHEHTY.JOHN IRBIN 
ELKINS,LUCY H 

GERBICK, SUSAN 
HARTEB.BETH 
JACKSON, KENNETH S 
KALLHAN, CAROL 
KEITH, KATHRYN M 
KELLEY, DIANE B 
BEYER, LORNA JUNE 
NOLTON .STEWART S,JB 
PROUSALIS,GAYLE LEE 
ROSNESS, BETTY JUNE 
SANCHEZ, ADOLFO,JR 
SCHMID, DEBORAH ANN 
STAFFEL, TIMOTHY J 
TALIANO, CYNTHIA B 
BINKLER, MONTGOMERY K 
BOOTTON, MICHAEL J 



RESEARCH ASSISTANT 808.05 

SECRETARY 2,568.24 

FIELD SECRETARY 1,500.00 

LEGISLATIVE ASSISTANT 8,360.51 

CLERK TYPIST, TO JUL 31 

PRODUCTION ASSISTANT, FHOH SEP 1 1,397.74 

PERSONAL SECRETARY 3,863.76 

LEGISLATIVE AIDE 2,814.51 

LEGISLATIVE AIDE 2,614.74 

LBJ CONGRESSIONAL INTEBN, FBOH AUG 1 1,180.00 

FIELD SECRETARY 2,621.01 

FIELD SECRETARY 2,995.26 

FIELD SECBETAEY 2,648.01 

FIELD ASSISTANT 4,431.99 

CASEWORKER 2,352.75 

DISTRICT AIDE, TO JUL 31 200.00 

DISTRICT AIDE 3,092.99 

PRODUCTION ASSISTANT, FROH AUG 1 TO AUG 31 ... 698.87 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

CASEBOBKER 2,187.51 

ADMINISTRATIVE ASSISTANT 10,183.74 

5,487.51 



97 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HOD. DELBERT L LATTA 



BIJAN,ESTELLE C 
BURCHELL,KAYE B 
COLBERT, SHEREE DENISE 
DAVIS, JOHN KENNERLY,JR 
FRIES, JEANETTE 
HOBBLE, BEVERLI KAT 
KLING, BARBARA C 
KRISEF,JILL ALLYSON 
SANS, JOYCE E 
SCHWESINGER, BETTY E 
SNYDER, SOSAN KAY 
SOHL, NANCY 
VAYDA, GENEVIEVE 
VENNER,LISA H 
WOELFFER, BARBARA ANN 



CLERK $ 3,302.16 

ADMINISTRATIVE ASSISTANT 6,964.14' 

CONGRESSIONAL AIDE, FROH SEP 9 488.89 

RESEARCH ASSISTANT 2,882.82 

DISTRICT SECRETARY 2, 450.58 

LEGISLATIVE AIDE 3,750.00 

CONGRESSIONAL AIDE, FROH AUG 15 1,597.23 

CLERK, FROH JUL 13 TO AOG 12 600.00 

RECEPTIONIST-SECRETARY 3,315.51 

CONGRESSIONAL AIDE 4,402.86 

CONGRESSIONAL AIDE 2,150.01 

CONGRESSIONAL AIDE 4, 127. 67 

CLERK, FRCH JOL 15 TO AOG 12 560.00 

CLERK 2,150.01 

CONGRESSIONAL AIDE, TO JOL 31 716.67 



OFFICE OF HON. JAHES A S LEACH 



ALLEN, KENTON L 
BOTLEB.JOHN L 
CHRISINGER, JAHES D 
COTTELL.JOHN D 
DONAHOE, CATHERINE A 
GOODELL.LEONA H 
HOLZH A RHER, MEREDITH 
HDRST.CHRISS 
KAMSTRA.ANNE F 
ROLLER, HARITA ANN 
KSOLOFP, ROBIN 
LOWRY.RITA R 
HADSEN, JEANETTE E 
HADSON,GARY K 
RIGDON, CHERYL A 
SPRONGER, CYNTHIA D 
VERSTEGEN, PETER E 
VESTAL, ALLAN 8 
SEEKS, LINDA H 
WHITAKER, CATHERINE I 



DISTRICT REPRESENTATIVE 

LEGISLATIVE ASSISTANT 

LBJ CONGRESSIONAL INTERN, TO JOL 31 

DISTRICT REPRESENTATIVE 

DISTRICT STAFF ASSISTANT 

PERSONAL SECRETARY-OFFICE HGR ...... 

DISTRICT STAFF ASSISTANT, FROH SEP 

PRESS AIDE 

SECRETARY 

SECRETARY 

SECRETARY 

DISTRICT STAFF ASSISTANT 

DISTRICT STAFF ASSISTANT 

ADHINISTRATIVE ASSISTANT 

DISTRICT OFFICE MANAGER 

LEGISLATIVE AIDE 

DISTRICT ASSISTANT 

DISTRICT STAFF ASSISTANT, TO AOG 31 

DISTRICT DIRECTOR 

SECRETARY 



900.00 
500.01 
590.00 
150.00 
750.01 
000.01 
158.33 
500.00 
000.00 
000.01 
250.00 
250.00 
374.99 
249.99 
000.00 
000.00 
750.01 
240.50 
000.01 
250.00 



OFFICE OF HON. RAYHOND F LIEEEER 



ALBERTINE, JAHES J 
BAILEY, THERESA DENISE 
BOSSE, GRACE ELLEN 
DIAMOND, ROBERT 
FOGARTY,JOAN 
HARKAVY, JONATHAN 
HELLEHBRAND.FRED 
JOHANSON,LOOIS,JR 
KILDOO.JOAN CARLEY 
LIEB.LAORA 
HARRARA, ALBERT J 
HCCALL.QUENZELL A 
MOPPHY, JOSEPH H 
O'CONNOR, BARBARA S 
O'CONNOR, VERONICA C 
SHAFFRAN,JOAN GLORIA 
SHUTTLEWORTH, KENNETH * 
STEWART, DONALD V 
SULLIVAN, ESTELLE T 
THOMAS, ROBERT P 
HRIGLEY, THOMAS R 
ZIEGENFUSS, JOYCE E 



CLERK , 

LBJ CONGRESSIONAL INTERN .... 

CLERK 

CLEBK 

CLERK , 

CLERK , 

CLERK 

CLERK 

CLERK 

CLERK, FROM SEP 1 , 

CLERK 

CLERK 

CLERK, TO JOL 31 

CLERK , 

CLERK, TO JOL 31 

CLERK, FFCM AOG 1 TO AOG 31 

CLERK, FRCH SEP 1 

STAFF ASSISTANT, TO JOL 31 .. 

CLERK 

CLERK 

CLERK 

CLERK 



,750.00 
,500.00 
,199.99 
,750.01 
,025.01 
,750.00 
,250.00 
,499.99 
,424.92 
541.67 
,000.01 
,200.0 1 
,375.00 
,049.99 
400.00 
200.00 
250.00 
200.00 
,801.16 
,625.00 
,299.99 
,100.00 



OFFICE OF HON. JOSEPH A LE FANTE 



BALDWIN, MARTIN JOSEPH 
BOTCHKO,JOHN C 
CALI, DOLORES H 
CARROLL, NEIL J 
DOLAN, JAHES H,JR 
DOWNING, ARTHUR 
GOOLD, JULIA ANNE 
GRUBE, KAREN F 
KINDEBEL, DOROTHY 



PRINTER, FROH SEP 1 583.33 

RESEARCH ASSISTANT 3,750.00 

STAFF AIDE 1,277.73 

SPECIAL ASSISTANT 4,500.00 

SPECIAL ASSISTANT 11,874.99 

INTERN, TO JUL 31 600.00 

STAFF ASSISTANT 2,750.01 

EXEC SECTY-OFFICE MGR 5,000.01 

SECRETARY (DISTRICT OFFICE) 2,366.55 



98 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OPPICE OP HON. JOSEPH A LE FANTE -CONTINUED 



KING, CAROLYN J 

LAWSON, ELIZABETH B 
HELONEY,BOSE HABIE 
MONTGELAS,RENEE N 
OBTA, DELIA 
SCANLON, MICHAEL J 
SCHMIDT, JOHN F 
STEPANSKI, SUSAN A 

YACHMETZ, PHILIP K 



STAFF AIDE $ 2,500.00 

PROJECTS SPECIALIST 3,675.00 

EXECUTIVE SECBETABY 4,645.89 

LEGISLATIVE ASSISTANT 5,000.01 

SECBETABI, FBOB JOL 11 1,666.67 

BESIEENT SECTY 4,586.31 

STAFF AIDE 1,277.73 

STAFF ASSISTANT, FBOH SEP 1 

LBJ COSGBESSIONAL INTEBN, TO JUL 31 1,440.00 

LEGIS COBBESPONDENT 2,750.01 



OFFICE OF HON. BOBEBT L LEGGETT 



ABEL, SALLY H 
ABODEO.ELSPETH ANN 
CHEEVER, EDWAPD B 
COAKLEY, JAMES J 
KUNKEL, JULIA A 
MINDEL.NILHA B 
MOSES, GEOBGE B 
NOBENE,KABEN 
OBBIEN,DOBOTHY C 
PFOLTZEB,LYNN 

RAWLINGS,HABJOBIE KATHEBINE 
BILEY, THOMAS NYHAN 
BOBINSON,SHIBLEY H 
SHAFFER, GREGORY S 
THOMPSON, MABSHA K 
TOIV,BABBY J 
WELCH, MICHAEL D 
WILLIAMS, URCEL T 



LBJ CONGBISSIONAL INTEBN, TO JOL 31 590.00 

SECBETAPY 3,127.50 

ADMINISTRATIVE ASSISTANT 6,750.00 

DISTBICT BEPBESENTATIVE 3,891.09 

SECRETARY 3,041.67 

SECBETABY 3,500.01 

LEGISLATIVE ASSISTANT 7,083.34 

CLEBK, TO AUG 31 400.00 

PABT TIME STAFF CONSULTANT 6,702.83 

SECBETABY 2,874.99 

SECRETARY 2,250.00 

DISTBICT DIBECTOB 9,900.00 

SECBETABY 2,882.82 

CLEBK, TO AUG 31 400.00 

SECRETARY 3,835.66 

CLEBK, TC AUG 31 400.00 

LEGISLATIVE ASSISTANT 4,083.34 

SECBETABY 2,620.74 



OFFICE OF HON. WILLIAM LEHMAN 



ARENAS, MARIA N 
BENDIXEN,SEBGIO 
BEBG,NADINE A 
BIDNEY,PETEB 
CALLAHAN, JOSEPH B,III 

COHEN, ANN MAUBA 
COOPER, ELLEN BETH 
FALLICK,SHABYN 
KOONCE,MABILYN G 
LEVIN, IDA D 
LISKOV,ADELE H 
HELL, JEFFREY 
OLHAN.HABK B 
PODLOS,MABJOBIE L 
BIVLIN, CATHY 
BOCKYMOBE,CABOLYN J 
BYAN, MABSHA ANNE 
SCHNEIDER, HARGABETE E 
SPOLTER, LOSING N 
STUPHAN, WARREN M 
THAXTON.ANNA 
THOMPSON, HELENA 
THORPE, PAT 



CASEWORKER 

DISTBICT BEPBESENTATIVE 

LEGISLATIVE SECBETABY 

STAFF AIDE, FBOH AUG 1 

STAFF ASSISTANT, TO JUL 31 

INTEBN, FBOH SEP 1 

INTERN, FBOH AUG 1 TO AUG 31 

STAFF ASSISTANT, FBOH AUG 1 TO AUG 31 

CASEWOBKEB 

STAFF ASSISTANT 

PEESONAL SECBETABY 

LEGISLATIVE SECBETABY, FBOM SEP 14 .... 

STAFF ASSISTANT 

PBESS ASSISTANT 

MOBILE OFF NGR 

SUMMER INTEBN, TO JUL 31 

EXECUTIVE SECBETABY 

LEGISLATIVE ASSISTANT 

LBJ CONGBESSIONAL INTEBN, TO JOL 31 ... 
SUHMEB INTEBN, TO JUL 31 

STAFF AIDE, TO AUG 31 



,000.00 
,033.34 
,500.01 
,958.33 

,200.00 
,200.00 

500.00 
,250.01 
,249.99 
,291.66 

566.67 
,791.67 
,124.99 
,750.01 
,000.00 
,458.33 
,250.01 
,166.66 

590.00 

500.00 
,874.99 

700.00 
.499.99 



OFFICE OP HON. NOBHAN F LENT 



BRAON, NORMA 
CARTAFALSA,JOHN B,JR 
HOGAN, LAWRENCE J 
JASPAN, ARTHUR W 
LORD, CHRISTOPHER D. 
HAFFEI.GARY A 
MALONE, DONNA MARIE 
MINOGUE.MARY JANE 
MORBIS.BARBABA ANN 
PBESTON.THOHA'S J.JB 
BE.CHBISTOPHEB H 
ROBERTS, JOHN W 
SPEAR, STEPHEN E 
STEPHENS, LUCILLE MAE 



DISTBICT OFFICE MANAGES 4,875.00 

CLEBK, FBOH AUG 1 TO AUG 31 1,000.00 

SPECIAL ASSISTANT 500.01 

LEGISLATIVE AIDE 1,175.01 

LEGISLATIVE ASSISTANT 4,749.99 

FIELD BEPBESENTATIVE 2,750.01 

SECBETABY TO CONGBESSMAN 3,000.00 

SPECIAL PROJECT ASSISTANT 3,950.00 

ADBINISTBATIVE ASSISTANT 9,824.99 

COMMUNITY BELATIONS ASST 3,924.99 

LBJ CONGBESSIONAL INTEBN, TO JUL 31 590.00 

PBESS ASSISTANT 7,875.00 

LEGISLATIVE ASSISTANT, TO SEP 9 2,012.50 

STAFF AIDE, TO JOL 31 

STAFF ASSISTANT, FBOM AUG 1 2,250.00 



99 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. NOBBAN F LENT -CONTINUED 



STRASSBURG, ROGER W,JR 
TAT,HARILYN CRAWFORD 
WAGNER, IBHA B 
WILLIAMS, LORI V 



LEGIS CORRESPONDENT $ 2,166.67 

CASEWORKER 4, 775. 01 

DISTRICT OFFICE SECRETARY 2,625.00 

RECEPTIONIST 2,287.50 



OFFICE OF HON. ELLIOTT H LEVITAS 



ABOGETI,JOEL STEVEN 



BELLAN 
8DLLAR 
CARTER 
CA7ALL 
FARLEY 
GRANT, 
HUGHES 
JONES, 
KELLEY 
LOFTOS 
BCARTH 
HOREY, 
POPE,W 
RHINES 



Y,ERIC D 

D, JAMES EDWARD 

.NANCY LEE 

0,GOY V 

, RONALD W 

RARONA 

.DEBORAH WREN 

MARY F 

.MARGARET HAHIAN 

,HAOREEN S 

OR, ELIZABETH H 

HELEN W 

ILLIAH B 

MITH, PAMELA R 



RONNENBERG,JCAN ANN 
SUMMERS, MARY ANNE 
THARPE,SOANNE W 
VOLLMER, MICHAEL F 
WALL, CYNTHIA E 

YORK, FRED H,JH 



STAFF ASS 
STAFF ASS 
STAFF ASS 
STAFF ASS 
LBGISLATI 
LEGISLATI 
STAFF ASS 
STAFF ASS 
STAFF ASS 
STAFF ASS 
STAFF ASS 
STAFF ASS 
STAFF ASS 
EXECUTIVE 
STAFF ASS 
STAFF ASS 
STAFF ASS 
LEGISLATI 
DISTRICT 
STAFF ASS 
STAFF ASS 
STAFF ASS 
LBJ CONGR 
SENIOR ST 



ISTANT, TO JOL 15 

ISTANT, FROM ADG 1 TO AUG 15 1,900.00 

ISTANT, FROM AOG 1 TO AUG 31 500.00 

ISTANT 4,124.99 

VE ASSISTANT 3,549.99 

VE ASSISTANT 3,024.99 

ISTANT 3,116.66 

ISTANT 2,625.00 

ISTANT, FROM AOG 22 1,083.33 

ISTANT 2,975.00 

ISTANT, TO JUL 31 750.00 

ISTANT, TO AUG 7 945.56 

ISTANT 2,675.01 

SECRETARY 4,337.49 

ISTANT 4,574.99 

ISTANT, TO SEP 1 

ISTANT, FROM SEP 6 4,505.00 

YE ASSISTANT ,...,. 3,349.99 

OFFICE DIRECTOR 4,924.99 

ISTANT 3,208.34 

ISTANT 3,191.67 

ISTANT, FBOd JOL 16 TO JUL 31 

ESSIONAL INTERN, TO JUL 31 1,090.00 

AFF ASSITANT 4,800.00 



OFFICE OF HON. B LIVINGSTON 

ABCENEAUX, MICHAEL J 
ARCENEAOX, SUSAN F 
BARHE,SALLIE H 
BUTKUS, HARRIET E 
CAHBON,PAUL F 
DOROCHER, JULIE D 
FORD, ALBION L 
JENKINS, NANCY S 
LAGRANGE, LISA H 
MARTIN, J ALLEN 
HAYLIE.ANN H 
SILLER, WILLIAH J 
NASS.THEODOBE W 
NED,HOSEA H,JR 
ROBINSON, BABY PRICE 
YOUNG, WILBEBT 



STAFF ASSISTANT, FROM SEP 1 200.00 

STAFF ASSISTANT, FROM SEP 1 1,052.00 

STAFF ASSISTANT, FROM SEP 1 2,152.00 

STAFF ASSISTANT, FROM SEP 1 725.00 

STAFF ASSISTANT, FROM AOG 27 1,727.78 

STAFF ASSISTANT, FBOM SEP 1 230.00 

STAFF ASSISTANT, FBOM SEP 1 100.00 

STAFF ASSISTANT, FBOM SEP 20 489.50 

STAFF ASSISTANT, FBOM SEP 1 725.00 

HOME OFFICE MANAGES, FROM AOG 27 3,027.78 

STAFF ASSISTANT, FBOM SEP 1 725.00 

STAFF ASSISTANT, FBOB SEP 1 1,352.00 

ADHINISTBATIVE ASSISTANT, FROM AOG 27 4,486.11 

STAFF ASSISTANT, FBOB SEP 1 , 1,100.0C 

STAFF ASSISTANT, FBOB SEP 1 200.00 

STAFF ASSISTANT, FBOB SEP 1 300.00 



OFFICE OF HON. JIB LLOYD 

BARBEE, RUDOLPH B 
CALNAN,SELHA DEWEY 
CETIN,RUTH ELENDEB 
COBILLOS,HEBHINIA L 
DAVIS, BRIGID H 
ESPITIA.HADBEEN B 
POX, LOLA J 

GIOVANIELLO,GEBARD N 
GITCHEN, RICHARD ALLEN 

HARBAN,HABSALEETE 
HERBEBA,SOSAN K 
LINDERANH, JEAN J 
MARTIN, DONNA 
ODONNELL,MABGUEBITE G 
PHILLIPS, LISA 
BOMER,THEBESA L 
VEBDEBAME,FBANK 
HAUNCH, D S 
WEST, HUGH WAEBEN 
BILLIABS, VIRGINIA KAY 



COBHUNITY AIDE 

CASEBOBKEB 

COMMUNITY AIDE 

CASEBOBKEB 

OFFICE MANAGER 

PRESS AICE, TO JUL 31 , 

OFFICE BANAGEB 

ADHINISTBATIVE ASSISTANT 

LEGISLATIVE AIDE, FROM AOG 1 TO AUG 31 
LBJ CONGBESSIONAL INTEBN, TO JUL 31 .... 

PERSONAL SECRETARY 

LEGISLATIVE AIDE, FBOM SEP 1 

OFFICE BANAGER 

TYPIST 

FIELD BEPBESENTATIVE 

LEGISLATIVE COBBES PONDENT 

SECRETABY 

LEGISLATIVE AIDE, TO AUG 31 

LEGISLATIVE ASSISTANT 

COBHUNITY AIDE 

CCBPUTEB SYSTEBS SPECIALIST 



199.99 
812.10 
675.01 
250.00 
349.85 
992.32 
046.62 
500.00 

340.00 
750.01 
083.33 
573.79 
850.01 
575.01 
900.00 
424.99 
500.00 
900.00 
625.00 
168.01 



100 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. MARILYN LLOYD 



BECKER, LAURA K 
CRUME, BARBARA PAYNE 
DANIEL, ELAINE B 
DAVENPORT,PAHELA C 
E8ERSOLE, RICHARD J 
ELLIOTT, HOWARD L 
FINDLEY, YVONNE C 
GEMHER, FRANCES A 
HARBISON, JACK 
HOWARD, ANDREA HINES 
JACOBS, RICHARD D 
KING, MICHAEL H 
HABEE, CHARLES DALE 
MCCASKILL, BONNIE S 
OBENSHAI N.ELIZABETH 
PARKER, GERALDINE 
PRICE, CAROL ROTH 
RICKETTS.MARY H 
ROGERS, SUSAN L 
SLATER, EILEEN 
STUART, MARY BELLE 
THOMAS, MARSHA B 
THURHAN, GLORIA FAYE 
WILSON, LUTHER ROY 



PERSONAL 
STAFF ASS 
FIELD REP 
CASE WORK 
ADMIN ISTR 
DISTRICT 
STAFF ASS 
LEGISLATI 
LBJ CONGF 
CASE WORK 
STAFF ASS 
PRESS ASS 
ADtflNISTR 
STAFF ASS 
LEJ CCNGE 
LBJ CONGB 
STAFF ASS 
CASE WORK 
RESEARCH 
STAFF ASS 
STAFF ASS 
CASEWORKE 
STAFF ASS 
DISTRICT 



SECRETARY $ 3,875.01 

ISTANT 2,062.50 

RESENTATIVE, FROM SEP 15 733.33 

IB 1,937.1)9 

ATIVE ASSISTANT 8,000.01 

ADMINISTRATIVE ASSISTANT 5,1*99.99 

ISTANT, TO JUL 23 602.77 

VE CORRESPONDENT 2,750.01 

ESSIONAL INTERN, JUL 15 - AUG 14 590.00 

ER 1,937.49 

ISTANT, FROM SEP 1 600.00 

ISTANT I»,500.00 

ATIVE ASSISTANT 5,250.01 

ISTANT 1,562.49 

ESSIONAL INTERN, TO JUL 14 275.33 

ESSIONAL INTERN, TO JUL 14 72.50 

ISTANT 2,263.92 

ER DIST OFC 2,375.01 

ASSISTANT 3,750.00 

ISTANT 2,625.00 

ISTANT, TO JUL 31 300.00 

R, FROM JUL 18 1,399.17 

ISTANT 2,375.01 

FIELD REP, TO AUG 10 2,262.59 



OFFICE OF HON. CLARENCE D LONG 



ASTON, MARTHA ROBINSON 
BLOOHFIELD.BETH SUSAN 
BOKISH, CYNTHIA S 
CIAMPORCERO,ALAN 
COLE, CHRISTY 
EIBERT,HARK D 
FINN, LAURIE J 
FOGARTY,JOHN P 
GLAZER, SARAH JANE 
GOLDBERG, MARJORY SHERBOW 
HANNA,CORINE B 
HUEY, REBECCA MACRAE 
LEWIS, HELEN R 
LICHT,MARK 
LUCAS, JAMES D,JR 
MADER, SUSAN S 

MCCARTHY, JAMES KENT 
NYBORG,JANET SUE 
0'NEIL,JEAN F 
PINSKY, LARRY IRVING 
RENO, BARBARA M 
RHODES, MARGARET C 
TUVIN,HONA 8 
UDVARHELYI,IAN STEVEN 
VALLIANTOS,E G 
WRIGHT, PHILIP A 
ZAWICKI, ALBERT JCSEPH 



CASE WORKER 

LEGISLATIVE ASSISTANT, TO JUL 15 

CASEWORKER 

LEGISLATIVE ASSISTANT, TO AUG 31 

PEFSONAL 6 APPT SECTY, TO SEP 5 

STAFF ASSISTANT, FROM SEP 6 

STAFF ASSISTANT, FROM AUG 1 TO AUG 3 1 

STAFF ASSISTANT, TO SEP 15 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 

CASEWORKER, TO JUL 31 

STAFF ASSISTANT 

CASEWORKER 

CASEWORKER 

LEGISLATIVE ASSISTANT, FROM SEP 6 .... 
DISTRICT REPRESENTATIVE, TO AUG 31 .... 
LEGISLATIVE CORRESPONDENT., TO AUG 31 . 
LEGISLATIVE ASSISTANT, FROM SEP 1 .... 

OFFICE MANAGER 

STAFF ASSISTANT 

PROJECT ASST 

APPOINTMENTS SECRETARY, FROM SEP 6 ... 

PRESS ASSISTANT 

LEGISLATIVE CORRESPONDENT, FROM SEP 16 

CASEWORKER, FROM AUG 1 

LBJ CONGRESSIONAL INTERN, TO JUL 31 ... 
LEGISLATIVE ASSISTANT, FROM SEP 6 .... 

STAFF ASSISTANT, FROM SEP 1 

APPOINTMENTS SECRETARY 



183.33 

645.83 

,916.66 
333.34 

,527.78 
694.44 
150.0 

,541.67 
300.00 
916.67 

,666.67 
666.67 

,750.00 
833.33 
416.66 

333.33 

,250.00 
119.44 

,499.99 
763.89 
749.99 
520.83 

,633.33 
590.00 

,250.00 
833.33 
749.99 



OFFICE OF HON. GILLIS W LONG 



BARNES, TERRIAN 
BAYNARD, SALLY ANN 
BLOCH.LEO I 
CHANEY.JANE E 
CICARDO, EUGENE P,JB 
COCO, LEO, JR 
DUPRE, BARRY J 
GEORGE, VIRGINIA B 
HILBUN,PAUL 
HULEHAN, MARGARET F 
JARRELL.FAHY 
KEEFE, SUSAN K 
KILLEN, CARSON K. 
HILBURN, NANCY ROYSTER 
PEREDNIA, JOHN D 
ROGERS, DAVID K 
SHELBY, LEANITA 
SPENCER, THELMA L 
TATE, GEORGE J 



STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT 

STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT 

STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT 

STAFF ASSISTANT, FROM AUG 1 

STAFF ASSISTANT 

LEJ CONGRESSIONAL INTERN, TO JUL 31 

STAFF ASSISTANT, TO AUG 31 

ADMINISTRATIVE ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 



250.00 
166.67 
000.00 
500.00 
600.00 
625.00 
816.67 
962.51 
166.66 
872.01 
590.00 
866.66 
666.67 
166.67 
124.99 
500.01 
750.00 
899.99 
875.00 



101 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. GILLIS B LONG -CONTINUED 



TYSON, PATH BIBGE 
BELLS, CAROL I 



STAFF ASSISTANT J 1,500.00 

STAFF ASSISTANT, FROM AUG 15 1,916.67 



OFFICE OF BON. TRENT LOTT 



ANDERSON, THOHAS H , JE 
BULLOCK, EVELYN 
BYNUH, JAMES L 
HATES, HARIB L 
HOFFMAN, KATHRYN H 
HUCKABI.JOE STANLEY 
JOHNSON, JABES H 
NEEKS, FRANK 
NEBTON, HOLLY B 
PARKER, NAN 
SAUCIER, ANNELL B 
SHITH, CHERYL S 
STANISLAUS, DOROTHY P 
THCHAS, BOBBIE S 
TRAVIS .RICHARD G 
TURNER, HARTHA RHODES 
BELLS, SUSAN LEE 
BILLIAMS, JOHN H 
YON, DOROTHY A 



ADHINISTBATIVE ASSISTANT 11,874.99 

SECRETARY, TO SEP 10 1,400.00 

PRESS ASSISTANT 4,374.99 

SECRETARY 2,265.57 

SECRETARY 3,838.02 

ACCOUNTANT, FROH SEP 1 1,379.25 

FIELD REPRESENTATIVE 2,227.65 

INTERN, TO JUL 31 1,000.00 

SECRETARY 3,174.99 

LBJ CONGRESSIONAL INTERS, TO JUL 31 590.00 

FIELD REPRESENTATIVE 1,571.49 

SECRETARY 3,714.90 

SECRETARY 1,950.00 

SECRETARY 2,607.75 

FIELD REPRESENTATIVE 3,773.88 

LEGISLATIVE ASSISTANT 4,350.00 

SECRETARY 3,500.01 

PAGE, FROM SEP 1 1,500.00 

SECRETARY ,. 4,573.86 



OFFICE OF HON. HANUEL LUJAN JR 



BECK, BETSY ANN 
CRANDALL.QUENTOR I 
DENNARD, WILLIAM J 
GBALTHEY,JOY R 
HARUCKI, NANCY ANN 
KERNS, DIARA C 
KERSRER, JUDITH D 
LONG, SYLVIA ANN 
LUCERO,LABEHENCE I 
HIRABAL, BEATRICE 1 
MORGAN, MARTHA B 
BOYA, STELLA A 
HUBSET, DIANA B 
NOSKIN.CARISA 
PAPP, PEGGY ANN 
SALAZAR,LUCY M 
VALDEZ,VALI8DA fl 



TO AUG 10 800.00 

AEBINISTHATIVE ASSISTANT 10,183.74 

5,625.00 

2,0 62.50 

3,000.0 

CLERK 3,624.99 

CLERK 4,125.00 

CASEBORKEE 3,125.01 

TO JUL 8 160.00 

3,249.99 

SECRETARY 3,249.99 

SECRETARY 3,308.76 

SECRETARY 5,625.00 

TO AUG 10 800.00 

LEGISLATIVE ASSISTANT , 5,021.76 

DISTRICT SECRETARY 3,624.99 

SUMMER INTERN, TO AUG 31 1,200.00 



OFFICE OF HON. THOBAS A LOKEN 



ANGUS, JULIE ANN 
BENNETT, NANCY 
BILIK, JABES 
COBBS,CIBDY B 
CORBETT, DENNIS P 
COLLBY, JOSEPH F 
DABLHAN, BARTIN 
FINNEY, CHARLES H 
GEOGHBGAN, KATHLEEN C 
GESSOB, EUGENE IRA 
GILLEH, NANCY H 
GINOCCHIO, BARIETTA 
HARPER, ERNESTINE 
HEFFER NAN, MAUREEN 
JOBANNIGHAN, ROGER 

LANE, ESTHER C 
LAUBANN,J HICHAEL 
MARA, TIMOTHY G 
HARGETICH, HANNAH B 
HEBBOULD, PETER E 
PALB, DEBBIE L 
ROSEN, HATTHEB A 
SCHEUREH, HELEN G 
SCHBINNEB, BETTY BOYLA! 
SEFTON.JOHN C,JR 
BAILER, ANDREB J 
BHEATON, VIRGINIA 



LEGISLATIVE ASSISTANT 

CLERK, FROH SEP 1 

CLERK, FROB AUG 1 , 

CLERK, TC AUG 31 

CLERK, TO JUL 31 

CLERK, FEOB AUG 1 TO AUG 31 

CLERK, FROB AUG 1 TO AUG 31 

CLERK, FRCB SEP 1 

CLERK, FRCB SEP 1 

LEGISLATIVE AIDE, FROH SEP 1 

CLERK, FEOB JUL 11 

DISTRICT OFFICE COORDINATOR, TO AUG 31 

DISTRICT OFFICE SECRETARY 

CLERK, TO JUL 31 

CLERK, FROH SEP 1 

LEJ CONGRESSIONAL INTERN, TO AUG 19 ... 

OFFICE BANAGER, TO JUL 17 

DISTRICT OFFICE REPRESENTATIVE 

LEGISLATIVE ASSISTANT 

EXEC SECTI-OFFICE BGR 

LEGISLATIVE CORRESPONDENT 

SECRETARY 

LEGISLATIVE CORRESPONDENT 

CASE BORKER 

RECEPTIONIST-PERSONAL SECTT 

DISTRICT OFFICE REPRESENTATIVE. ,. 

INTERN, FROB AUG 1 TO AUG 31 

CLERK, TO JUL 31 



,500.00 
,091.67 
,650.00 
,450.00 
,250.00 
400.00 
208.33 
,000.00 
,000.00 
,500.00 
,666.67 
,916.66 
,274.99 
541.67 

,880.34 
897.22 
.249.99 
375.01 
,500.01 
499.99 
,000.00 
666.66 
000.00 
000.00 
000.01 
724.51 
862.54 



102 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE .OF HON. STANLEY N LUNDINE 



BLACKSTONE, DAVID P 
CAUTHERS , EDWARD J 
COBLEY, THOMAS H 
FLUENT, JANET L 
GARFIELD, ELIZABETH 
GRONET,DEBOHAH ANN 
KINNEY, PATRICIA J 
KNIGHT, ROTH L 
LANDON, ELAINE LOUISE 
LEWIS, ANN F 
MCCARTHY, JOAN HABIE 
NEWELL, BARBARA F 
PAINTER, JANET S 
REINAUER, JOANNE 
RICHARDSON, HABY ANN 
RIEHLE, CYNTHIA A 
SCHOENEH.JILL H 
SHAGLA,THOH E 
SHAB, CATHERINE J 
SIBLEY, SARA S 
SPRAGOE,STEHPEN G 
SBANSON, SYLVIA E 
TICHANE, DAVID 



CLERK $ 2,349.99 

CLERK, FRCH AUG 16 1,916.66 

DISTRICT BANAGEH 5,772.53 

1 ,500.00 

CLERK, FROM JDL 16 TO JUL 31 291.67 

CLERK, TO JUL 15 450.00 

EXECUTIVE SECRETARY 3,249.99 

LEGISLATIVE ASSISTANT 5,571.30 

DISTRICT OFFICE MANAGER, TO JUL 15 611.51 

ADMINISTRATIVE ASSISTANT 8,137.67 

STAFF ASSISTANT 2,124.99 

CLERK-RECEPTIONIST 2,625.00 

CLERK, TO AUG 31 2,333.34 

CLERK 2,751.76 

LEGISLATIVE AIDE 3,500.01 

ADMINISTRATIVE CLERK 2,100.00 

SECRETARY, FROM SEP 1 783.33 

OFFICE MANAGER 2,800.60 

SECRETARY 2,200.00 

LEGISLATIVE ASSISTANT 4,357.82 

COMMUNICATION AIDE 4,717.35 

OFFICE MANAGER DISTRICT OFFICE, FROM AUG 16 ... 1,312.50 

CLERK, FROM JUL 16 TO JUL 31 

LBJ CONGRESSIONAL INTERN, TO JUL 31 881.67 



OFFICE OF HON. ROBERT MCCLCRY 



ALTHOFF, CATHERINE L 
BERGER,JOHN F 
BOBDEN, SHARON L 
BRAXTON, JUANITA D 
COLEVAS,GERALDEAN J 
DEHITTE, DOROTHY M 
DOBBIE, JEANNE C 
FORBES, JEREMY 
GOLDMAN, IRA H 
HURTT, MARTHA B 
HUTCHINSON, LOUISE ANN 
KAUB, KAREN 
KENNEY, VIRGINIA 
KLEBER.DALE E 
MCPHERSON, DEBORAH S 
MORRISON, MARTHA C 
MORROB,JEAN E 
PRATT, JENNIFER J 
RUNGE,LYNN C 
SCHOENGART, CAROL J 
SMITH, POLLY J 
SPBOUSE, CECILY E 
STONHAB, MARIETTA H 
UPRIGHT, LORI E 
VERDICK,JILL E 



INTERN, TO JUL 31 

STAFF ASSISTANT, FROM JUL 19 

DIST OFF SECTY 

SECRETARY -RECEPTIONIST 

EXECUTIVE ASSISTANT 

DISTRICT SECRETARY 

STAFF ASSISTANT, TO SEP 7 

LEGISLATIVE ASSISTANT 

SECRETARY 

LEGISLATIVE RESEARCH ASSISTANT 

COUNSEL 

ADMIN ASST KANE 6 MCHENRY CNTS 

LEJ CONGRESSIONAL INTERN, AUG 1 - AUG 31 

APPOINTMENT SECRETARY, FROM AUG 8 

PERSONAL SECRETARY, TO JUL 18 

EXECUTIVE SECRETARY 

SECRETARY RECEPTIONIST, FROM SEP 9 

SECRETARY 

INTERN, TO JUL 31 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

INTERN, FROM AUG 1 TO AUG 31 

STAFF ASSISTANT 

STAFF ASSISTANT, FROM SEP 9 

STAFF ASSISTANT 



590.00 
,600.00 
,620.74 
,624.99 
,956.58 
,250.00 
900.00 
721.52 
,500.01 
750.00 
,683.76 
,500.01 
900.00 
590.00 
355.55 
725.00 
,875.00 
550.00 
,500.01 
295.00 
590.00 
590.00 
749.99 
550.00 
,125.01 



OFFICE OF HON. PAUL N HCCLOSKEY JR 



ARNOLD, KRISTIN S 
CANNELL,KATHERINE S 
CHESSER.JUDT L 
CONSTANTINO, THOMAS L 
FARRAR,HICHELE L 
FOSKETT, KRISTIN L 
GLEASON, JUDITH I 
HOOPER, JOHN C 
KENRICK, ALFRED F,JB 
KNIGHT, VICTORIA L 
KOHLER.JOHN 
KROGH,EGIL,JR 
MEZA, SCOTT 

MILLER, LINDLEY H,III 
PARSONS, HEATHER 
PERSONS, SANDFORD Z 
PHILLIPS, DORCAS E 
PICKERING, HELEN D 
RASH,LAURETTE T 
ROSE, GARY 

RYAN, MAUREEN D 



STAFF ASSISTANT, TO AUG 31 2,300.00 

STAFF ASSISTANT, FROM SEP 1 590.00 

STAFF ASSISTANT, TO AUG 31 2,000.00 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 900.00 

STAFF ASSISTANT 2,100.00 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 700.00 

LEGISLATIVE STAFF ASSISTANT 4,200.00 

STAFF ASSISTANT, FROM SEP 1 1,450.00 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 590.00 

RECEPTIONIST 2,100.00 

STAFF ASSISTANT 2,683.33 

STAFF ASSISTANT, FROM SEP 1 832.00 

STAFF ASSISTANT, TO JUL 31 800.00 

STAFF ASSISTANT, TO AUG 31 1,600.00 

STAFF ASSISTANT, FROM SEP 1 850.00 

STAFF ASSISTANT, TO JUL 31 1,000.00 

RECEPTIONIST 3,150.00 

FIELD REPRESENTATIVE 4,700.00 

OFFICE MANAGER 4,500.00 

STAFF ASSISTANT, FROM SEP 1 

LBJ CONGRESSIONAL INTERN, TO JUL 31 1,180.00 

STAFF ASSISTANT, FROM SEP 1 1,450.00 



103 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICB OF HON. PAUL N HCCLOSKEY JB -CONTINUED 



SCHOLTZ, AMBER E 
SCHFECK, DANIEL W 
WILKS, DANNY 

WILLIAMS, DONNA J 
WILLIAMS, FRANCES JOAN 
WILLIAMS, HAEY T 



ADMINISTRATIVE ASSISTANT $ 7,83«.00 

STAFF ASSISTANT, TO AUG 31 1,500.00 

STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT, FROM SEP 1 2,600.00 

STAFF ASSISTANT 3,600.00 

STAFF ASSISTANT 3,600.00 

EXECUTIVE SECRETARY 3,550.00 



OFFICE OF HON. BIKE 8CCOHMACK 



ELLIS, JERRY ANN 
GEORGE,BBTTY J 

GILES, BETTY E 
GRAZOLIS, BARBARA E 

HOGHES, JOSEPH STEVEN 
INGELS,GAIL H 
JENSEN, SANDRA JOY 
LORD, MARY JEAN 
LOWRY,SUELLEN 
HCGRATH, PATRICIA H 
PANATTONI,DEBRA J 
PEYTON, JDDITH E 

SAWSON, WILLIAM RANDALL 
RE2VES.BENNAE INGHRAM 
ROBINSON, DON 
ROE, (1ASJOSIE A 
RUCCI, CHARLOTTE M 
SPELL, MARILYN GALGANO 
WALKER, BEVERLEY ANN 
BEGELEBEN, WILLIAM H 
WILSON JR. ,CDRTIS STANLEY 



DISTRICT AIDE 

CLERK, TO ADG 31 

DISTRICT AIDE, FROM SEP 5 

OFFICE MANAGER, TO JDL 31 

RESEARCH ASSISTANT, TO JUL 31 

RESEARCH ASSISTANT, FROM AUG 5 TO SEP 6 
SPECIAL ASSISTANT, FROM AUG 1 TO AUG 31 . 

SECRETARY 

DISTRICT STAFF ASSISTANT 

PRESS SECRETARY 

MEDIA CONSULTANT, FROM SEP 1 

STAFF ASSISTANT, TO JUL 31 

SECRETARY, TO JUL 31 

CLERK, FECM AUG 1 

LEGISLATIVE ASSISTANT 

DISTRICT REPRESENTATIVE 

RESEARCH ASSISTANT 

STAFF ASSISTANT 

SECRETARY 

SECRETARY, FROM SEP 7 

SECRETARY, FROM JUL 11 

DISTRICT REPRESENTATIVE 

CLERK 



,255.00 
,912.00 

230.77 

580.00 
,630.00 
,800.00 
,800.00 
,K00.00 
,500.00 
,200.00 

,200.00 
,750.00 
500.01 
,1*00.00 
800.00 
120.00 
766.67 
888.88 
,200.00 
,100.00 



OFFICE OF HON. JOSEPH M MCDADE 



BURKE, NANCY JANE 
CESARE, ELLEN RITA 
FRANCESKI, DAVID C,JR 
GROSEK, ELLEN 
KAPP, PATRICIA 
KNOX, JACQUELINE 
KOTT, PATRICIA A 
HADSEN.HARCIA G 
MOSER, GERTRUDE L 
REESE, ROBERT H 
ROM ANOVITCH, SHIR LEY 
RUSSEN, MICHAEL S 
RUTHERFORD, LINDA J 
SCRIPTURE, SARAH E 
SPANN, ELIZA V 
STRONG, SUSAN A 
BEATHERLY, DEBORAH ANN 

WRIGHT, MARY AGNES 



STAFF ASSISTANT 

CLERK 

LBJ CONGRESSIONAL INTERN, TO AUG 12 

CLERK 

STAFF ASSISTANT 

STAFF ASSISTANT, TO JUL 31 

CLERK -STENOGRAPHER 

LEGISLATIVE ASSISTANT 

EXECUTIVE SECRETARY 

PUBLIC RELATIONS ASST 

CLERK 

FIELD REPRESENTATIVE 

SECRETARY 

CASEWORKER 

RE C EFT ICN 1ST- ANALYST 

CLERK 

SECRETARY, TO AUG 31 

SECRETARY, FROM SEP 5 

OFFICE MANAGER 



2<*i*.96 
339.01 
826.00 
U99.99 
608.68 
1(51. 25 
3«i». 07 
999.99 
837.66 
521.09 
397.26 
726.30 
U45.10 
108.26 
020. U3 
608.68 

750.01 
037.02 



OFFICE OF HON. LARRY MCDONALD 



CAHARA,HARY J 
CARROLL, BARREN H 
DANIEL, LINDA LARISCY 
DUBERRIER.HILAIRE 
HENRICHS EN, COLLEEN 
HUCK, SUSAN L H 
LUCEY, SUSAN M 
MACKENZIE, KENNETH J 
MURDOCK,HARY H 
MYERS, BRENDA H 

PRICE, CAROLYN CLINE 
QUINN, KATHLEEN 
RAMIREZ, SUSAN H 
REES.S LOUISE 
P.OMERSTEIN, HERBERT 



CLERK, FROM AUG 1 TO AUG 31 . 
RESEARCH ASSISTANT, TO AUG 31 

CASEWORKER 

RESEARCH ASSISTANT 

PRESS AIIE 

RESEARCH ASSISTANT 

OFFICE MANAGER 

LEGISLATIVE ASSISTANT, TO AUG 

LEGISLATIVE AIDE 

DISTRICT CLERK, TO JUL 31 .... 
DISTRICT CLERK, FROM SEP 1 .. 

DISTRICT AIDE 

CLERK TYPIST 

CASEWORKER 

RESEARCH ASSISTANT 

RESEARCH ASSISTANT 



563.33 
873.58 
,086.37 
,310.37 
,999.39 
,550.60 
,9113.33 
,055.56 
,398.33 

,031.88 
,337.65 
,i»20.98 
,903.45 
,029.90 
,228. U8 



104 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30. 1977— Continued 



OPFICE OF HON. LARRY MCDONALD -COKTINOED 



SMITH, FREDERIC N 
TOLES.ANN C 
VICE, DONALD C 
WHITE, HiRT CATHERYH 
WILLIAMS, JAMES B 



ADMINISTRATIVE ASSISTANT $ 8,367.93 

DISTRICT AIDE 3,254.90 

PRESS ASSISTANT 8,829.54 

DISTRICT AIDE 2,337.65 

STAFF ASSISTANT, FROM SEP 1 100.00 



OFFICE OF HON. ROBERT C HCEWEB 



ALLEN, JEAN L 
BELL, DONNA K 
BOND, CHRISTINE 
BRICK, CART R 
CALKINS, JOHN T 
FOSCHIA,BRENDA THERESA 
GUTIERREZ, LINDA L 
HALLANAN, GEORGE B 
HUMPHRIES, JOANN D ELLIS 
LONG.G THOMAS 
HCFARLAND, SHIRLEY M 
MELLON, JOHN E 
VENEZIA.NARY K 
NIGHTMAN, JENNIFER L 



LEGISLATIVE ASSISTANT 

PERSONAL SECRETARY 

SECRETARY 

SPECIAL ASSISTANT 

AEMINISTBATIVE ASSISTANT 

SECRETARY 

SECRETARY 

SPECIAL ASSISTANT 

CASEWORKER 

LEGISLATIVE ASSISTANT 

EISTBICT OFFICE SECRETARY, FROM SEP 
ADMINISTRATIVE ASSISTANT, TO AUG 31 

SECRETARY, TO AUG 31 , 

LEJ CONGRESSIONAL INTERN, TO JUL 31 



,250.01 
,550.01 
,062.50 
,999.99 
,272.08 
,499.99 
,624.99 
,625.01 
,375.00 
,874.99 

941.67 
,916.66 
,605.84 

590.00 



OFFICE OF HON. JOHN J MCFALL 



ALBERTSEN.HABI C 
ANDERSON, BRENDA FAYE 
BAVARO.NICHOAS S 
DAMSON, ELIZABETH ANN 
DEANE, CURTIS C 
EDLUND, DAVID DENNIS 
JOST, STEVE J 
MABBY, SAMUEL A 
MADRID, JO ANN 
MURPHY, GEORGE DELHAS,JB 
OLHASSO.JOH* J 
PRITCHARD, MAUREEN 
RUFFIN,ROSETTA MARIE 
SHOWALTER.DELORES K 
STEVENS, ALICE K 
WILBEB.A LEE 
WING, JAMES KENNETH 
BINKLEB,PETEB 



CLEBK 

CLEBK 

CLEBK 

CLERK 

CLEBK 

CLERK 

CLERK 

ADMINISTRATIVE ASSISTANT 

CLEBK 

CLERK 

CLERK 

CLERK 

CLERK 

CLERK 

CLERK 

CLEBK 

CLEBK 

LBJ CONGEESSIONAL INTEBN, TO AUG 31 



537.51 
750.01 
171.24 
000.01 
999.99 
625.01 
799.99 
374.99 
875.00 
751.78 
000.01 
500.01 
249.99 
874.99 
000.00 
750.00 
524.99 
180.00 



OFFICE OF HON. MATTHEW F MCHUGH 



ALPERSON, PHILIP R 
ARTHUR, CHBISTOPHBR 
BESTE, PAULA K 
BOMBARDIER, GARY E 
CAHILL, ELEANOR JOAN 
COFFEY, MARGARET H 
COUDRIET, KATHLEEN 
KAJECKAS, GABRIEL G 
KERIVAN, DONNA MARY 
KLEIN, ANDREW IRVING 
LOEHR,JOAN H 
NOSHER, MARSHA L 
PARKHDRST, THOMAS H 
PERRY, DIANA MARIE 
RAPPAPORT, MARVIN S 
RICCIUTI, JAMES R 
ROACH, SANDBA G 
ROSENTHAL, KATE 
SEIBERT, PATRICIA T 
SOLOMON, DORIS B 
WARNER, SUSAN A 



STAFF ASSISTANT, FROM AUG 1 

STAFF ASSISTANT, FROM AUG 22 

PROJECTS COORDINATOR 

LEGISLATIVE ASSISTANT 

CASEWOBKEB 

STAFF ASSISTANT 

STAFF ASSISTANT 

DISTRICT REPRESENTATIVE 

SECRETARY 

STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT 

STAFF ASSISTANT 

DISTRICT REPRESENTATIVE 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 

ADMINISTRATIVE ASSISTANT 

STAFF ASSISTANT, TO AUG 31 

LEGIS CORRESPONDENT, TO JUL 15 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT, FROM SEP 1 

LEGISLATIVE AIDE, TO AUG 31 

LEGISLATIVE ASSISTANT, PROM SEP 1 .... 



250.00 
137.50 
000.00 
000.00 
095.00 
250.00 
999.99 
875.00 
375.00 
625.00 
374.99 
300.01 
750.01 
100.00 
000.01 
250.00 
416.67 
325.00 
490.00 
250.00 



OFFICE OF HON. GUNN MCKAY 



CANNON, MICHAEL 
CAPENER, COLE R 



PRESS REP 

RESEARCH ASSISTANT, TO JUL 12 



5,414.17 
280.00 



105 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30. 1977— Continued 



OFFICE OF HON. GDNN MCKAY -CONTINUED 



CARLILB.CBAIG 
CLARK, KSISTIE L 
FAUST, MARCUS 
FINDLAY.LOO JEAN 
FISHER, KATHY 
GALL EGOS, KATHLEENS 
HODGSON, DIANE 
HYHAS, RICHARD H 
JOHANSEN, NATALIE 
LEE, DAVID B 
HADSEN, STEPHEN R 
OLSEN.HACK B 
SCOTT, BANDA 
SMITH, JODT 
TANNER, NANCY B 
THOBOP,NANCI B 
BALSHflJABK 
BHITTIEB.FEBN H 
YOUNG, DOLLY G. 



RESEARCH ASSISTANT, FBOH JOL 15 TO AO G 15 S 723.33 

SECRETARY 2,676.99 

LEGISLATIVE ASSISTANT 6,123.01 

FIELD OFFICE MANAGER 3,1i»3.01 

RECEPTIONIST 2,515.01 

CASE BORK SDPERVISOB 3,999.99 

PESSCNAL SECRETARY, FBOH SEP 1 1,379.83 

RESEARCH ASSISTANT, TO AUG 31 1,400.00 

LBJ CONGRESSIONAL INTERN, JOL 15 - AUG 1U 590.00 

ADHINISTBATIVE ASSISTANT 9,961.67 

RESEARCH ASSISTANT, TO AUG 19 1,143.33 

LEGISLATIVE ASSISTANT 6,123.01 

PERSONAL SECRETARY 4,404.99 

FIELD ASSISTANT, TO AUG 31 910.00 

LEGIS STAFF ASST 2,695.58 

LEGISLATIVE CORRESPONDENT, FROM SEP 12 633.33 

LEGISLATIVE ASSISTANT, TO AUG 31 3,500.00 

FIILE ASSISTANT 1,389.17 

DISTRICT OFFICE HANAGEB..., TO JUL 31 874.17 



OFFICE OF HON. STEBABT B HCKINNEY 



ANDERSON, NINA H 
BARZELAY, MICHAEL A 
BOLSTER, SALLY H 
DANOBITZ.JANE P 
EBICKSOH,ANN R 
ERSKINE,HABJOBIE 
GERRY, MARTIN H 
GOLDMAN, PATRICIA A 
HALLOBAN,LABPENCE J 
KELLY, DOROTHY A 
LEHRHAN, LYNDA ANN 
LONG, BABY JEAN 
HASTRANGELO.LOIS J 
MC GEE, JOSEPH J 
HCKIERNAN, GERALD J 
OSBORN, ELIZABETH D 
PROPP, JONATHAN BRUCE 
RAHE,RODERIC B,JR 
SPRING, HENRY J,JB 
STONE, CATHERINE I 
ZIMMERMAN, JOAN E 



STAFF ASSISTANT, FROM SEP 1 

LBJ CONGRESSIONAL INTERN, TO AUG 31 ... 

ASST FOR COMMUNITY AFFAIRS 

STAFF ASSISTANT 

STAFF ASSISTANT, TO AUG 31 

STAFF ASSISTANT 

STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT, PROM AUG 1 TO AUG 31 

LEGISLATIVE AIDE 

DISTRICT OFFICE MANAGES BRDGPT 

STAFF ASSISTANT 

STAMFORD ASST 

STAFF ASSISTANT 

ADMINISTRATIVE ASSISTANT 

PRESS SECRETARY 

DISTRICT REPRESENTATIVE 

STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT 

STAFF ASSISTANT 

LEGISLATIVE CORRESPONDENT 

STAFF ASSISTANT 



875.00 
,180.00 
,538.02 
,374.99 

800.00 
,500.00 

416.66 

750.00 
,500.00 
,800.10 
,000.01 
,800. 10 
,000.01 
,859.33 
,746.02 
,538.02 

500.00 
,250.00 
,125.00 
,375.01 
,125.01 



OFFICE OF HON. EDBARD R HAEIGAN 



BAKER, NORA ANN 
BATES, MICHAEL J 
BLCUNT, JANET D 
DORAN, DANIEL F 
DUNGAN, JUDITH A 
GRACE, SOGER D 
GBOOT,KIPP COHOOH 
HARTTEB, SUSAN R 

KOESTER,LUANNE C 
LIESMAN, DIANE 
HAXFIELD, BENDY N 
MORGAN, LYLE C 
HUCK,KAELLYH 
PARKE, JACQUELINE ANN 
SELCKE,FREDRIC B 
SMITH, DEBBOBAH A 
SOELLE.SHERI L 
BAGONER, JEANNE ANN 
YOUNG, ERNA HELEN 



SECRETARY 2,250.00 

LEGISLATIVE ASSISTANT 4,749.99 

RECEPTIONIST 2,550.00 

ADMINISTRATIVE ASSISTANT 10,536.42 

SECRETARY, FBOH SEP 1 875.00 

DISTBICT ADHINISTBATIVE ASST, TO AUG 31 4,000.00 

LEGISLATIVE ASSISTANT 4,625.01 

OFFICE MANAGES, TO AUG 31 

DISTRICT CASE BOEKER, FBOH SEP 1 1,379.16 

CLERK 1,275.00 

OFFICE MANAGER 8,625.00 

SECRETARY 366.67 

CLERK 2,047.50 

CASEBORKEB, TO JUL 31 1,166.67 

CASEBORKER, FROH AUG 1 2,666.66 

CLERK 7,875.00 

SECRETARY , 2,874.99 

CLERK, TO AUG 5 775.33 

LEJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

SECRETARY-RECEPTIONIST 2,250.00 



OFFICE OF RON. ANDREB MAGUIRE 



BANKS, GLENN B 
BUCHICHIO.ADRIENNE 
DARAZIEN, STEVE 
DBISCOLL,JEAB 
DBTDEN, CECIL A 
ESPOSITO, ROBERT GREGORY 



LEGISLATIVE CORRESPONDENT, FROH AUG 1 1,599.24 

CASEBORKER, TO SEP 15 2,625.00 

PRESS SECRETARY 3,999.99 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

CLEBK 1,400.00 

STAFF AIDE, FROH SEP 1 1,633.33 



106 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. ANDHEH HAGUIRE -CONTINUED 



HENSZ, CAROL 
HERSCHEL, GLADYS B 
HOFF,EDHARD J 

HOLSTEIN,ELHOOD,JR 

KAYDEN.JOELLE 

KEEFE, CHARLES B 

KERR, ROBERT L 

LOUDEN, IAN KENNETH 

OROUHKE, BEATRICE ANN 

PEDERSEN, CRAIG D 

PISSOTT,ANN 

RYAN, CAROL J 

SCHMIDT, CONNIE WILLIAMS 

STARR, HABGARET ANN 

SUTHERLAND, ANN 

HOODLEY, HALTER 



SECRETARY OFFICE MANAGER $ 2,375.01 

SECRETARY /STAFF ASSISTANT 2,874.99 

LEGISLATIVE CORRESPONDENT, TO JUL 31 

LEGISLATIVE ASSISTANT, FROM AUG 1 TO SEP 15 .. 2,590.1*8 

LEGISLATIVE ASSISTANT 3,562.50 

RESEARCH-LEGISLATIVE ASST, FROM SEP 16 916.67 

LEGISLATIVE ASSISTANT 2,812.50 

ADHINISTRATIVE ASSISTANT 7,374.99 

TYPIST 2,900.00 

DIST OFFICE ADMINISTRATOR 4, 062. 51 

CASEHOBKEB 2,666.67 

TERMINAL OPERATOR 2,649.99 

STAFF AIDE, FROM SEP 16 733.00 

EXECUTIVE SECTY/OFFICE MANAGER 3,312.51 

INTER-GOVERNMENTAL LIAISON /GRANTS 3,562.50 

LEGISLATIVE ASSISTANT, TO AUG 31 1,875.00 

CASEHORKEB 1,875.00 



OFFICE OF HON. GEORGE H MAHCN 



ADAMS, S KAYE 
BARCLAY, DOSTHEA BELLE 
DIAZ, JUAN ANTONIO 
HARGBAVE, EUGENIA 
HENSLEY,D HURRAY 
HUNE,GAYE L 
HUNT, NANCY W 
LANGSTON, DAVID R 

MARTIN, DOROTHY S 
MCELROY, LAURA 
MORRIS, LANA KAY 
POTTS, DEBRA J 
RICH, NAOMI A 
STEPANEK, KAREN 
TINDALL.JUDY 

WALKER, SAVANNAH T 
YEAGER, ROBIN 



CLEBK, FROM SEP 26 

CLERK 1 

CLEEK 

CLERK 

CLERK •• 

CL ERK 

CLEBK 

RESEARCB ASSISTANT, TO AUG 31 

RESEARCH ASSISTANT, FROM SEP 5 

CLEBK , 

CLERK 

CLERK, TO AUG 31 

CLERK, TO AUG 31 

CLERK 

CLEBK 

CLEBK, TO AUG 18 

CLERK, FECM SEP 1 

CLEBK 

LBJ CONGRESSIONAL INTEBN, JUL 11 - AUG 10 



180.56 
,599.25 
,400.00 
,909.63 
,587.50 
,216.17 
,750.00 

,972.22 
,250.00 
,311.57 
,659.80 
,71(7.16 
,000.01 
,163.83 

800.00 
,250.00 
590.00 



OFFICE OF HON. JAHES R MANN 

ADKINS, NORMA FAYE 
BEALER, DONALD B 
BO HERS, HELEN 
BBYSON,HILLIAM J 
BYRD, ELIZABETH ANN 
CARIENS, PEGGY JOANNE 
DAISLEY, MICHEL C 
GIBARD, ANNETTE B 
GOSNELL, REBECCA ANN 
HUNT, WILLIAM H 
JONES, LEE 
KAUFHANN, JANET E 
KOZAR,KATHRYN G 
HCKEOHN, SAMUEL B 
MCNAMEE, NIKKI DIANE 
PARKS, DAVID L 
SEELEY, ELIZABETH A 
SMITH, DOROTHY LYNN 
HILSFORD, DAVID 



SECRETARY 

STAFP ASSISTANT 

CLERK 

FIELD BEPBESENTATIVE 

PERSONAL SECRETARY 

SECRETARY 

CLERK, TO AUG 31 

CLEBK, FROM AUG 1 TO AUG 31 

SECRETARY 

CLERK 

CLERK, TO JUL 31 

SECRETARY 

SECRETARY 

FIELD REPRESENTATIVE 

LEGISLATIVE ASSISTANT 

FIELD ASSISTANT 

OFFICE MANAGER 

STAFF ASSISTANT, TO JUL 31 .. 
STAFF ASSISTANT, FROM SEP 13 



620.74 
041.67 
215.50 
875.00 
050.01 
531.49 
200.00 
600.00 
700.00 
800.00 
600.00 
625.00 
583.33 
749.99 
250.00 
394.76 
245.25 
600.00 
525.00 



OFFICE OF HON. EDHARD J HABKEY 



BERNARDI, ELENA 

BURKHABDT, ELLEN 
CONFALONE, PERRY H 
FOLINO, KAREN H 
FORD.PAUL R 
GOLD, DAVID H 
GRKAVAC.OLGA 
HALE, CYNTHIA ROBEBTS 
HEINZ, THOMAS J 
HOFFMAN, DAVID J 



SFCBETABY, FROM JUL 16 TO JUL 31 

SECRETARY, FBOH SEP 16 450.00 

LBJ CONGBESSIONAL INTERN, TO JUL 31 590.00 

LEGISLATIVE AIDE 3,000.00 

SFCBETABY 2,000.01 

LEGISLATIVE ASSISTANT 3,812.49 

LEGISLATIVE ASSISTANT 3,999.99 

LEGISLATIVE STAFF ASSISTANT 5,250.00 

OFFICE MANAGER, TO SEP 15 2,750.01 

CONGRESSIONAL AIDE 2,250.00 

LEGISLATIVE ASSISTANT 4,250.01 



107 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. EDBARD J HARKET -CONTINUED 



KEEPE, RONALD, JR 
KELLEY.PADL R 
KOLIKOF, RICHARD 
LEARY, ELIZABETH R 
HCSBEENEY, JUSTIN 
NEILL. JAMES H 
O'CONNELL, DANIEL 
ROSENBERG, PAUL L 



EUSSELL, KAREN ANN 
SALEBBE, R GERARD 
SCHHIDT.BILLIAH H 
SLAVIN, PETER L 
SHITH, CLAIRE H 
SPITZER.ENILY 
SULLIVAN, KATHLEEN 
TOCCO,STEPHEH P 



LEGISLATIVE ASSISTANT, TO JUL 15 $ 

CONGRESSIONAL AIDE, FROH JUL 16 TO AUG 15 

LEGISLATIVE AIDE, FROB SEP 16 

LEGISLATIVE AIDE, FROB AUG 16 TO SEP 15 

LEGISLATIVE AIDE, FROB AUG 16 TO SEP 15 

CONGRESSIONAL AIDE 

ADBINISTRATIVE ASSISTANT 

LEGISLATIVE ASSISTANT, TO JUL 15 

LEGISLATIVE ASSISTANT, FROB AUG 16 TO AUG 31 .. 

LEGISLATIVE AIDE, FROB SEP 1 TO SEP 15 

LEGISLATIVE CORRESPONDENT 

LEGISLATIVE AIDE 

LEGISLATIVE ASSISTANT 

LEGISLATIVE ASSISTANT, TO JUL 15 

LEGISLATIVE ASSISTANT, FROB JUL 5 

LEGISLATIVE AIDE, FROB SEP 16 

CONGRESSIONAL AIDE 

CONGRESSIONAL AIDE, FROB JUL 16 TO AUG 15 

CONGRESSIONAL AIDE, FROB SEP 16 



550.00 

1,325.00 

250.00 

923.00 

850.00 

2,250.00 

5,177.49 



1,390.53 
2,750.01 
2,250.00 
3,000.00 
550.00 
2,415.08 
1,833.33 
3,000.00 

2,<»99.99 



OFPICE OF HON. BARC L BARKS 



ADABS, EUNICE L 
BLUB, DAVID S 
BRCOKHOUSER,SUE A 
CAMPBELL, ANY U 
CRCBWELL, JAMES H 
EPSTEIN, RICHARD 
GIESBANN.HYRNA 
GOLDBAN, PATRICIA A 
HILL, LARRY E 
JORDAN, REBECCA JANE 
KLINGER, JANET B 
LIPPY, DAVID N 
PROCTOR, BARY JANE 
RANDALL, BARTHA L 
RENDON,BARTIN 
SHAFRAH, JOSEPH E 
STACEY,JOHN B,JE 
TAFT, CHARLES B 
UNANGST,LOIS JEAN 
BHITLEY, ELIZABETH D 
YABNER,JOHN A 



SECRETARY 

CLERK, TO JUL 6 

SECRETARY , 

CASEBORKER 

ADBINISTRATIVE ASSISTANT 

STAFF ASSISTANT, FROB AUG 1 

CLERK 

STAFF ASSISTANT, FROH \0G 1 

DISTRICT FIELD REPRESENTATIVE 

SECRETARY 

EXECUTIVE ASST OFFICE HANAGER 

CLERK 

CAS EBORK ER 

LEGISLATIVE ASSISTANT , 

LEGISLATIVE ASSISTANT 

NEWS SECRETARY 

RESEARCH ASSISTANT , 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

SECRETARY 

LEGISLATIVE AIDE, TO JUL 6 

LEGISLATIVE ASSISTANT, FROH JUL 11 . 



,525.00 
100.00 
,000.01 
,800.00 
,900.00 
,116.66 
,11*9.99 
,187.01 
,050.01 
,500.00 
,674.99 
,499.99 
,774.99 
,624.99 
,650.00 
,625.00 
,375.00 
590.00 
,000.00 
208.33 
,777.78 



OFFICE OF HON. RON BARLENEE 

BBOBN, PATRICIA B 
COLLINS, BILLIAH P 
ETCHART, BRIAN 
FEIT,ALAN 
GILLIS, DIANE 
HALL.KATHRYB L 

HENSLEIGH, MARIE 
LABLER,JOAN ALBERT 
LEISTER, PAT 
OVERTON, HARK 
RICH, CLANCY 
ROBBIE, KATHBYN 
SNYDER.CHRISTINA B 

WILEY, BAEIAN J 
ZIEHER,BOB 



STAFF ASSISTANT, TO AUG 31 

ADBINISTRATIVE ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT, FROB JUL 14 

STAFF ASSISTANT 

STAFF ASSISTANT, TO JUL 31 

LEGISLATIVE ASSISTANT, FROH AUG 1 

SPECIAL ASSISTANT 

EXECUTIVE ASSISTANT 

STAFF ASSISTANT 

RESEARCB ASSISTANT 

CONG DISTRICT REP 

STAFF ASSISTANT 

LEGISLATIVE ASSISTANT, TO JUL 31 .. 
LEGISLATIVE DIRECTOR, FROH AUG 1 . 

STAFF ASSISTANT, TO JUL 31 

SPECIAL ASSISTANT 



,072.68 
,250.01 
,750.01 
,245.83 
,499.99 

,249.99 
,500.00 
,500.00 
,499.99 
,249.99 
,249.99 
,000.00 

,500.00 
,083.33 
,249.99 



OFFICE OF HON. DAN HARRIOTT 

ASHTON,PAUL H 
BAKALIAN, JULIE A 
BARLOW, J2SSELIE E 
BJORKLDBD,EBIC BAYNE 
CANNON, CARLA L 
COOHBS, BECKY B 
DEHILLE,JDLA ROSE 
GARRETT, LILLIAN G 
GESKE,D RICHARD 



LBJ CONGRESSIONAL INTERN, TO JUL 1 19.67 

RECEPTIONIST, TO SEP 23 2,536.12 

CONSTITUENT RELATIONS COORDINA 6,500.01 

LEGISLATIVE AIDE, TO JUL 31 186.85 

CASEWORKER 2,250.00 

OFFICE BACHINES SECRETARY 2,124.99 

CASEBORKER 2,100.00 

STATE ASST 4,250.01 

STAFF ASSISTANT 4,500.00 



108 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. DAN HARRIOTT -CONTINUED 



HANKS, JOHN D 
KNIBBE, DAVID S 
KOFOLOGOS.GREGORIA 
LUNDELL.CAMILLE 
HORAN, TERESA A 
NIELSEN, G BARRY 
STRIKE, PAMELA 
VALENTINE, CRISTINA 
WEBB, DENNIS R 
HINEBRENNER, CAROL 1 
YODNG, PATSY 



PRESS SECRETARY $ 5,270.92 

STAFF ASSISTANT 2,250.00 

STAFF ASSISTANT 3,249.99 

SECRETARY TO ADHIN ASST 2,124.99 

RESEARCH ASSISTANT 2,250.00 

ADMINISTRATIVE ASSISTANT 8,250.00 

LEGISLATIVE AIDE, FROM AOG 1 566.67 

PERSONAL SECY TO CONG 4,749.99 

STAFF ASSISTANT 3,500.01 

SECRETARY/OFF RECEPTIONIST 1,800.00 

2,750.01 



OFFICE OF HON. JANES G MARTIN 



BLALOCK, WILLIAM R 

BOBLES, LAURENCE L 

CLONINGER, DONALD B 

DECKELBAUH , RICHARD 

DORSETT,J DEBEY 

FREEMAN, RAYMOND R,JR 

FOLLER, DORIS MAE 

HOLLINGSHEAD.JUNE LINEBERGER 

JONES, G SHIRLEY 

j»ONES,PAUL BIRDON 

JONES,SYBIL 

KENT, NANCY S 

LOFTON, JAMES S 

HAAG, SUSAN A 

MALLISON,ALHETA 

MCCOORT, KEVIN P 

NADHOFF, ELIZABETH A 

POGH, SANDRA L 

RUTLEDGE,JOHN HONT 

TROUT, JANE B 

BELCH, SARAH L 



INTERN, FROM AUG 1 TO AOG 31 

LEGISLATIVE ASSISTANT 

SPECIAL ASSISTANT 

INTEEN, FROM JUL 5 TO JUL 31 

INTERN, TO JUL 31 

DIST OFFICE ASST 

CASE BORKER 

SECRETARY 

CASE BORKER 

COMMUNICATION AIDE 

LBJ CONGRESSIONAL INTERN, JUL 5 - JUL 31 

RECEPTIONIST 

ADMINISTRATIVE ASSISTANT 

INTERN, FROM JUL 17 TO AUG 12 

SECRETARY, TO JUL 31 

INTERN, FROM AUG 3 TO AUG 18 

PERSONAL SECRETARY 

RECEPTIONIST 

SUMMER INTERN, TO AUG 31 

RESEARCH 

RECEPTIONIST, FROM AUG 22 , 



500.00 

,6711.99 

,500.01 

U33.33 

500.00 

,515.00 

,825.01 

,191.66 

,775.01 

,712.51 

433.33 

,1*99.99 

,000.00 

433.33 

541.67 

266.67 

,549.99 

,310.00 

,083.34 

,624.99 

,029.17 



OFFICE OF HON. DABSON MATHIS 



BURNSIDE, JOSEPH E.III 

CANTRELL, THOMAS J.SR 
CLARK, RALPH TURNER 
DA VIS, JAMES A 
FAIRCLOTH.J KENNETH 
FRY, MARGUERITE L 
GILL.LEXINE R 
GRAY, RUBY NELL 
HOLLAND, BILEY J,JB 
JOHNSON, SUSAN G 
JOSEPH, SANDRA D 
MCKENNEY, KERRY B 
MCKENZIE, CATHERINE 
PICKLE, EARL F 
SPEARS, BONNIE 
BEST, ANNE PAINE 



STAFF ASSISTANT, FROM AUG 1 

LBJ CONGRESSIONAL INTERN, TO JUL 31 1,790.00 

ASST DIST COORDINATOR 4,625.01 

DISTRICT AIDE, FROM SEP 1 1,833.33 

PRESS ASSISTANT, FROM AUG 15 2,811.11 

DISTRICT COORDINATOR 6,549.99 

SECRETARY CASENORKEB 3,624.99 

OPFICE MANAGER 5,750.00 

SECRETARY-DISTRICT OFFICE 2,349.99 

LEGISLATIVE ASSISTANT 9,624.99 

LBJ CONGFESSIONAL INTERN, AUG 1 - AUG 21 413.00 

SECRETARY-RECEPTIONIST 3,624.99 

SECRETARY 2,908.34 

SECRETARY 2,000.01 

DISTRICT CLERK 900.00 

STAFF ASSISTANT, TO AUG 21 1,020.00 

SECRETARY 2,583.33 



OFFICE OF HON. JIM HATTOX 

ARNOLD, JOHN D 
BALDBIN, MARTIN JOSEPH 
BLAYDES, CAROLYN E 
CLARK, MARILYN 

CLAYTON, BARBARA L 

GALVIN, CHARLES, JR 
GRINDBERG, JENNIE 
GRINDBERG, LESLIE D 
HALL.FEBRELL S 
JAMES, DEBRA LEA 
KIMBROOGH, ROBIN J 
MCBILLIAHS, JAMES B 
NAEGLE, RICHARD A 
PERNA, JACQUE 
POOL.BESLEY JABES 
POWERS, JUDY K 



PRESS ASSISTANT 

STAFF ASSISTANT, TO JUL 31 , 

LEGISLATIVE ASSISTANT 

FIELD REPRESENTATIVE 

COMPUTER MANAGER, TO JUL 1 

COMPUTER MANAGER, FROM AUG 1 

STAFF ASSISTANT, TO JUL 31 

EXECUTIVE SECRETARY 

CLERK 

CASE BORKER 

STAFF ASSISTANT 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

DISTRICT COORDINATOR 

LEGISLATIVE ASSISTANT, PROM AUG 14 . 

RECEPTION IST-S ECRETARY 

CASE BORKER 

STAFF ASSISTANT, FROM SEP 1 



,469.01 
767.67 
,685.01 
,000.00 

,387.08 
800.00 
,125.01 
,749.99 
,540.00 
,700.00 
590.00 
,4 86.98 
,611.11 
,630.00 
,550.00 
,000.00 



109 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. JIN SATTOX -CCNTIN01E 



SHELBY, CURTIS 
TANKEBSLEY,LIZABETH 
THOBNE,JOHN R 
WILLABD, ROBERT S 
HOOD, SHERRY L 
NORM, FRED 



FIELD REPRESENTATIVE $ 3,375.00 

LEGISLATIVE ASSISTANT, TO AUG 9 1,130.00 

ADMINISTRATIVE ASSISTANT 8,000.01 

STAFF ASSISTANT, TO JDL 22 1,118. 89 

OFFICE MANAGER 3,519.99 

STAFF ASSISTANT 1,780.00 



OFPICE OF HON. ROHANO L HAZZOLI 



CHENG, STEVEN L 
DADDARIO, OLIVE J 
DELANEY, BARBARA J 
GAGLIARDI, VICTORIA A 
HOOPER, H DALE 
KILROY.JOHN L,JR 
LDNA,SARA L 
MATTINGLY, CHARLES B 
HORRAH, YVONNE DIANE 
NEUSTADT, JEFFREY B 
NEVENS,T BICHAEL 
NOEL, CECIL H 
NOBTHERN, RICHARD 
POLING, KAREN I 
PURCELL.JAYNE B 
SHARPE, ALICE P 
STOVALL, GRETA K 
SHEATT,BBENDA L 



STAFF ASSISTANT , 

EXECUTIVE SECRETARY, FBOH JUL 5 ... 

STAFF AIEI, TO JUL 31 

DISTRICT SECRETARY 

LEGISLATIVE ASSISTANT 

DISTRICT REPRESENTATIVE 

LEGISLATIVE ASSISTANT 

DISTRICT REPRESENTATIVE 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

ALMINISTBATIVE ASSISTANT 

DISTRICT OFFICE BEPRESENTATIVE 

LEGISLATIVE DIRECTOR 

CASE WORKER 

RECEPTIONIST, FROM JDL 5 

SECRETARY 

CLERK TYPIST, FBOH SEP 1 

CLEBK TYPIST 



,199.99 
,703.95 
500.00 
,000.00 
,836.56 
,227.65 
931.11 
.875.00 
,719.99 
500.00 
750.00 
,115.17 
219.99 
275.91 
,501.27 
381.88 
916.66 
318.76 



OFFICE OF HON. LLOYD HEEDS 



COCKER, RICHARD L 
DETSIS .GEORGE E 
ERICKSON.KATHRYN L 
LANGE.MARK 
LITTLE, JEANNE V 
MARTINEZ, MARY H 
MCDONALD, CLYDE B 
O'LEARY, JOHN 
PETRISH, MARIA 
PITTHAN.THOHAS A 
PBICE, JAMES S 
BADKE,HARK 
SCOTT, PATRICIA L 
SHIFT, ALLAN B 
THIESSEN, JANET E 
TUHINARO,BACHEL C 
WARD.LABBY MICHAEL 
HOOD, SUE ANN 
WEIGHT, GEBTBUDE L 
YEAGEB, KENNETH H 



LEGISLATIVE ASSISTANT 

LEGISLATIVE ASSISTANT 

PERSONAL SECRETARY 

MOBILE OFFICE OPEBATOB, TO SEP 15 .. 

SECRETARY 

OFFICE HANAGEB 

DISTBICT OFFICE DIBECTOB 

PBESS SECRETARY 

DIST OFF SECTY 

CCMFUTEB OPEBATOF, TO AUG 25 

DISTBICT OFFICE DIBECTOB 

LEJ CONGRESSIONAL INTEBN, TO AUG 31 

DISTBICT SECRETARY 

ADMINISTRATIVE ASSISTANT 

CASEHOBKEB 

SECBETABY 

MOBILE OFFICE OPEBATOB, FBOM SEP 16 

SECBETABY 

LEGISLATIVE ASSISTANT 

COMFOTEB ASSISTANT 



,500.01 
,500.01 
,799.99 
,000.00 
,625.00 
,073.70 
,500.00 
,050.00 
,050.00 
,711.1 1 
,500.00 
,180.00 
,871.99 
.750.01 
,811.99 
,375.01 
150.0 
,000.01 
,595.01 
,153. 33 



OFFICE OF HCN. BALPH H METCALFE 



ABBOTT, ANNIE H 
BAKEP.ANN C 
BLAKENEY,JEAN C 
CABTER, JOYCE E 
COLBUBN, KENNETH S 
CONBOY, COLEMAN J 
DANIELS, LCBNA T 
DIBBLE, CHYLA C 
HAGAN, WILLIAM, II 
JONES, BABBARA A 
KNIGHT, CHRISTINE C 
KOHRMAN, DANIEL B. 

PEPPY, LEN S 
PITTS, JUDY 
RUSSELL, LISA J 
SMITH, CLABENCE.SR 
SUBLA.H. GENE 
THOMAS, SYLVIA Y 
WALLACE, THOMAS D 
WESTON, BICHARD C 
HILBANKS, JOSEPH 



SECBETABY 

CLEBK TYPIST 

BECEPTIONIST-SECEETABY 

DEPUTY EXECUTIVE ASSISTANT 

STAFF ASSISTANT, FBOM SEP 1 

LEGISLATIVE ASSISTANT 

BESEABCB ASSISTANT, FBOM AUG 1 

RECEPTIONIST, TO AUG 31 

STAFF ASSISTANT, TO JUL 31 

EXECUTIVE SECBETABY 

SECBETABY, TO JUL 31 

STAFF ASSISTANT, FBOM AUG 1 TO AUG 19 
LBJ CONGRESSIONAL INTERN, TO JUL 31 ... 
LEGISLATIVE ASSISTANT, FBOH AUG 15 .... 

CONGRESSIONAL AIDE 

BECEPTIONIST/CLEEK TYPIST, FBOM AUG 21 

CLEBK 

STAFF ASSISTANT, FROM SEP 1 

RECEPTIONIST 

EXECUTIVE ASSISTANT 

DIB. PUBLIC BEL., ....; 

EXECUTIVE ASSISTANT 



,701.33 
,719.99 
,882.82 
,112.61 
,000.00 
,128.76 
,333.31 
,000.00 
,900.00 
,375.00 
,231.56 

906.67 
,852.77 
,199.99 

822.23 
,787.51 
,500.00 

381.88 
,250.00 
,500.00 

500.01 



110 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. RALPH H METCALFE -CCNTINOED 



WILLIAMS, KINBERLY 

WILLIAMS, YVETTE H 



RECEPTIONIST S 1,749.99 

STAFF ASSISTANT, TO JUL 31 100.00 



OFFICE OF HON. HELEN S HEYNER 



BERBIGAN,THOHAS 
BLAKE, DIANE E 
CAMPAGNA,JUNE 
CODDINGTON.LYNN 
DEAN, DANIEL P 
DOERR, THOMAS S 
DYKSTBA, PATRICIA 
GEPPERT.JOHN G,JS 
GOODWIN, FRANCES M 
HAUSMANN, MICHELLE t 

HOWELL, F WILLIAM 
KALICH, SHIRLEY A 
LOVAIN, TIMOTHY B 
NAPLES, RONALD J. 
O'NEAL, MICHAEL A 
ONEAL, CAROLYN R 
ROOKER,MARY ALBA 
SACKS, DEBORAH ANNE 
SHUHAN, DENNIS H 
SINGEL,MARK S 
SMITH, IRENE M 
VANHISE, TIMOTHY H 



PRESS SECRETARY 

STAFF ASSISTANT 

STAFF ASSISTANT, TO JDL 31 

STAFF ASSISTANT, TO JDL 31 

STAFF ASSISTANT 

DISTRICT STAFF ASSISTANT 

DISTRICT STAFF REP 

LBJ CONGRESSIONAL INTERN, AUG 1 - AUG 31 

STAFF ASSISTANT 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 ... 

LBJ CONGRESSIONAL INTERN, TO JDL 31 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 ... 

PERSONAL SECRETARY 

LEGISLATIVE ASSISTANT 

DISTRICT STAFF ASSISTANT, TO AUG 31 

STAFF ASSISTANT, FROM SEP -1 

DISTRICT STAFF ASSISTANT 

CASEWORKER 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT, FROM SEP 1 

ADMINISTRATIVE ASSISTANT 

DISTRICT REPRESENTATIVE 

DISTRICT DIRECTOR 



,750.01 
,874.99 
104.83 
500.00 
,500.01 
,125.01 
,750.01 
590.00 
,2U9.99 

890.00 
600.00 
,375.01 
,633.85 
780.00 
368.33 
,750.01 
,500.01 
,500.01 
368.33 
,875.00 
,299.99 
,250.00 



OFFICE OF HON. ROBERT H MICHEL 



CARLIN,EVALENA G 
CARR, CYNTHIA E 
COULSON, URSULA E M 
JOHNSON, MICHAEL 
MCMURRAY, THOMAS H 
MEINEN, BARBARA ANN 
NULL, VICKIE LEE 
REGAN, KAREN 
STEELE, LINDA L 
TAYLOR, MARY LEE 
WANLESS, ANNETTE L. 
YARD, SHARON G 



DISTRICT SECRETARY 

SECRETARY 

SECRETARY 

PRESS ASSISTANT 

LEGISLATIVE DIRECTOR (P) 

LEGISLATIVE ASSISTANT 

RESEARCH ASSISTANT 

SECRETARY 

SECRETARY 

DISTRICT SECRETARY 

LBJ CONGRESSIONAL INTERN, TO AUG 19 
EXECUTIVE SECRETARY 



,250.00 
,500.01 
,375.01 
,750.00 
,249.99 
,250.01 
,249.99 
,375.01 
,250.00 
,625.00 
963.67 
,750.00 



OFFICE OF HON. BARBARA A MIKULSKI 



AKERS, JOYCE A 
BARNES, CHRISTINE 

BOCKSHESTER, STEVEN A 
BROWN, ELLYN L 

BOCKNER, PHYLLIS H 
CHEATHAM, ANNE H 
CRUM, SIMON L 
DICE, DOROTHY G 
EVANS, LISA R 

FRIEDLAND, BARBARA I. 
GURTLER,DEBRA JEAN 
HANKEY, DAVID L 
HOWES, JOANNE 
KARAGEORGE, ETHEL A. 
LAWLER, ELIZABETH ANN 
LEVINE, KAREN SUSAN 
MAKOWSKE, ELIZABETH S 
SFIKAS, PERRY 
SPRAGUE, CHRISTINA RUTH 
STAFFORD, SANDRA G 
VEZERIS, STEPHEN J 



CLERK/TYPIST, FROM SEP 23 

STAFF ASSISTANT, TO SEP 13 

COMMUNITY LIAISON, FROM SEP 14 

LEGIS. ASST 

HEALTH 6 COMMUNICATIONS SPEC, TO SEP 14 
COMMUNICATIONS SPECIALIST, FROM SEP 15 . 

STAFF ASSISTANT 

STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT, TO SEP 13 

OFFICE MANAGER, FROM SEP 14 

STAFF ASSISTANT 

DISTRICT SCHEDULER 

STAFF ASSISTANT, FROM SEP 1 

LEGISLATIVE ASSISTANT 

DIST OFFICE MNGR 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

LBJ CONGRESSIONAL INTERN, TO JUL 31 .... 

LEGIS CORRESPONDENT 

EXECUTIVE ASSISTANT 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 . 



,589.47 
,250.01 

,872.23 
,533.05 
200.00 
,250.00 
,124.99 

,557.73 
,300.01 
,625.01 

900.00 
,125.00 
,159.95 
,534.12 
76.50 
,400.00 

590.00 
,750.01 
,000.01 

733.63 



Ill 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HOD. ABNER J HIKVA 



BIRO, BETH L 
ERHOYAN, EUGENIE 
GAIL, DANIEL BENJAMIN 
GRATSIAS,ZOE 
GBOSSHAN,ILENE K 
REALY, ROBERT L,JR 
HORBITT,SANFOBD D 
LIEBBRMAN.JOEL BRUCE 
LYONS, MIRIAM G 
HELTZER, RICHARD 
NATHAN, SALTER R 
NEBGEN,GAIL A 
NORCONK, JULIE A. 
OVERBY, PETER B 
PERKINS, ROBERT G 
RICE, RITA JEAN 
STEELE, BETTY L 
STEBART, DONALD V 
BHITE, DOROTHY G 
BICE, MARSHA NYE 



LEGISLATIVE CORRESPONDENT $ 2,625.00 

ADMINISTRATIVE ASSISTANT 9,750.00 

STAFF ASSISTANT, FROM SEP 1 2,000.00 

EXECUTIVE ASSISTANT 4, 100. 01 

CONGRESSIONAL AIDE 2,225.01 

STAFF ASSISTANT, FROM AOG 1 TO ADG 31 1,000.00 

RESEARCH ASSISTANT 5,512.50 

CONGRESSIONAL AIDE 2,158.33 

CONGRESSIONAL AIDE 2,075.01 

LEGISLATIVE ASSISTANT 4,516.67 

CONGRESSIONAL AIDE 3,500.01 

CONGRESSIONAL AIDE 2,375.01 

CONGRESSIONAL AIDE 2,075.01 

STAFF ASSISTANT, FROM AOG 1 TO AUG 31 1,890.00 

CONGRESSIONAL ASSISTANT 2,U16.6b 

CONGRESSIONAL AIDE 3,950.01 

CONGRESSIONAL AIDE 2,250.00 

STAFF ASSISTANT, FROM SEP 1 416.67 

CONGRESSIONAL AIDE 2,075.01 

CONGRESSIONAL AID3, FROM SEP 1 800.00 



OFFICE OF HON. DALE MILFORD 



BAIBES, JOYCE 
BLAIS, DAVID E 
BRADLEY, BILLIAH H 
CLARK, GARY KIM 
FERGUSON, DON 
FORD, CAROL BETH 
GIBSON, BETTY C 
HANS EN, SHIRLEY 
KERRY, ELIZABETH LADON 
HCDOBELL, MARIAN E 
MERRIHAN,PRISCILLA ANN 
MITCHELL, JANIE M 
MUNCY, STEVE A 
OBNBY,BESLEY CRAIG 
REYNOLDS, PATRICIA K 
SIBPKINS, JERRY B 
STAUB, KAREN CHUN 
STOVER, KATHLEEN SCOTT 
BHITE, RICHARD H,JR 



CLERK 2,257.50 

DISTRICT MANAGER 6,249.99 

STAFF ASSISTANT/RESEARCH 2,750.01 

DISTRICT AIDE 1,575.00 

FIELD ASSISTANT 3,549.99 

LEGISLATIVE ASSISTANT 3,675.00 

EXECUTIVE SECRETARY 4,973.25 

DISTRICT OFFICE MANAGER 3,042.81 

LEGIS CORRESPONDENT 2,736.42 

STAFF ASSIST-LEGISLATIVE/PRESS, FROM AUG 1 ... 2,000.00 

SECRETARY 1,200.00 

CLERK 2,572.50 

FIILD ASSISTANT 3,399.99 

FIELD ASSISTANT 3,500.01 

CLERK, TO JUL 31 840.00 

CASEBORKER 3,500.01 

COMPUTER OPERATOR, TO JUL 31 500.00 

CLERK 2,250.00 

ADMINISTRATIVE ASSISTANT 9,804.00 



OFFICE OF HON. CLARENCE E MILLER 



BRCBN, DAVID 
BRUCE, LOREN C. 
CARDIN, JULIE A 
CUSTER, CHRISTOPHER M 
DEGROOT, PATRICIA M 
GORDON, CHERYL L 
LAMCNT.HARY G 

NORRIS, JUDITH LOFRAINE 
PEINTSEHA, ROBERT A 
RODERICK, LINDA G 
ROGERS, MARGARET C 
STRAB, PHILIP KEITH 
STREAN, BEVERLY JO 
SBANSON, MARGERY H 
BAGONER,MARJORIE J 
BILLIAHS, JOSEPH E. 



ADMINISTRATIVE ASSISTANT 

LEGISLATIVE ASSISTANT 

RECEPTIONIST, FROM JUL 13 

DISTRICT REPRESENTATIVE 

SECRETARY 

RECEPTIONIST 

SECRETARY, TO AUG 31 

CASEBORKER, FROM SEP 1 

SECRETARY 

SPECIAL ASSISTANT 

EXECUTIVE SECRETARY 

SECRETARY, TO JUL 31 

RESEARCH ASSISTANT 

SPECIAL ASSISTANT 

CASEBORKER 

SECRETARY 

FIELD REPRESENTATIVE, FROM JUL 13 



,001.24 
,249.99 
,058.34 
,720.74 
,500.01 
,600.01 

,780.06 
,910.00 
,950.00 
,684.50 
,048.30 
,931.84 
500.04 
,333.51 
,310.75 
,816.66 



OFFICE OF HON. GEORGE MILLER 



BEVILACQU A, NICHOLAS 
CHEATHAM, ANNE B 
COFFEY, BERTRAM 
EDBARDS.REID A, III 
EVANS, ORDEAN 
HATCH, CAROL A 
HERNANDEZ, JUANITA L 
JACKSON, ERNESTINE 
JOHNSON, KAREN ANNE 
LAUFO,GRETEL 



FROM SEP 1 

STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 



,740.00 
,000.00 
,750.00 
,625.00 
,558.00 
796.00 
625.00 
.879.00 
,425.00 
751.00 



112 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFPICE OF HON. GEOBGE MILLER -CONTINUED 



LAWRENCE, JOHN A 

MAHONEY.MARY LOOIS! 
HOSZALSKI, SYLVIA 
O'SHEA, SHEILA ANN 
OCONNOR, PHILIP R 
POLLACK, CAROL S 
REARDON.TERRENCE J 
R0SS,MARJ0RIE A 

SMITH, ANITA LEE 
WALKER, NICHOLAS B 
YADEN, JANICE L 
YOONG, MELISSA 



LEGISLATIVE ASSISTANT, TO JUL 31 $ 

LEGIS/ADMIN ASSISTANT, FROM AUG 1 

STAFF ASSISTANT, FROM AUG 1 

STAFF ASSISTANT 

STAFF ASSISTANT, TO JUL 31 ...'. 

ADMINISTRATIVE ASSISTANT, TO AUG 31 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 

STAFF ASSISTANT 

STAFF ASSISTANT, TO JUL 31 

FROM SEP 1 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT, TO JUL 31 . 



,141.1)0 

,050.00 
,501.00 
600.00 
,840.00 
,050.00 
,225.00 

,575.00 
,225.00 
,725.00 
,500.00 
300.00 



OFFICE OF HO*. NORMAN Y HINETJ 



ANDERSON, KATHLEEN B. 
ANDREWS, KELLEY 
BIECHMAN,JOHN C 
BURKE, SUSAN C 
DAHICO,DARLENE H 
DEAN, STEPHANIE 
DURKIN, ANTOINETTE L I 
GUSS, PHYLLIS A 
HENDRICKS, JOHN H 
ISHIMARO.TOSHIKO B 
LEONE, SHELLY A 
NEWLAND,BLINORE M 
RATTIGAN, MICHAEL A 
SAGER,SHERRI ROTH 
SANDOVAL, MANUEL JOSE 
STANTON, FRANK X 
TIANO, MARGARET E. 
VACHON, KATHLEEN 
WOLFE, SARAH E. 
YAMADA, DEBORAH KAREN 



STAFF ASSISTANT, FROM JUL 23 1,900.00 

LEGISLATIVE ASSISTANT 5.U99.99 

STAFF ASSISTANT 3,937.50 

STAFF ASSISTANT, TO JUL 22 550.00 

STAFF ASSISTANT 2,250.00 

STAFF ASSISTANT 3,224.76 

STAFF ASSISTANT 3,979.95 

LEGIS 6 RESEARCH ASST 2,625.00 

ADMINISTRATIVE ASSISTANT 7,292.13 

STAFF ASSISTANT 2,750.01 

STAFF ASSISTANT 3,519.99 

PERSONAL SFCTY/OFFICE MANAGER 3,795.00 

STAFF ASSISTANT 3,150.00 

STAFF ASSISTANT 2,490.00 

STAFF ASSISTANT 2,512.50 

DEPUTY ADMINISTRATIVE ASST 6,999.99 

STAFF ASSISTANT 2,499.18 

STAFF ASSISTANT 1,995.00 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

RECEPTIONIST, TO JUL 31 

STAFF ASSISTANT, FROM AUG 1 2,315.00 



OFFICE OF HON. JOSEPH G MINISH 



BATZA, VALERIE A 
CITRINO, DIANE E. 
DICKSON, JANET Z 
DONADIO, BRIAN J 
FRIEDMAN, ROBERTA E 
KOREJWO,IDA L 
LIQUORI.LYNNE A 
MEYER, JANE F 
POLLARD, MARCIA H 
PUZO, JOSEPH 
STACK, MARGARET A 
SULLIVAH, KATHLEEN 



CLERK 

LBJ CONGRESSIONAL INTERN, TO JUL 12 

CLERK 

ASSISTANT 

LBJ CONGRESSIONAL INTERN, JUL 13 - AUG 12 

ASSISTANT SECRETARY 

CLERK 

SECRETARY 

CLERK 

EXECUTIVE SECRETARY 

SECRETARY 

CLERK 



724. 18 
236.00 
,732.64 
874.99 
590.00 
,554.70 
,375.01 
,727.74 
,658.71 
,542.22 
150.21 
,483.67 



OFFICE OF HON. DONALD J MITCHELL 



ABECKET, VICTORIA LEE 
ADAMS, ARLENE R 
BERGIN,JOHN W 
BLASK, KAREN E 
BOEHLERT, SHERWOOD L 
BOYLE, MARTHA B 
BROWN, JACQUELINE J 
CASALE, ANTHONY J 
DACK.PRISCILLA S 
DAVIES,D REGINALD 
DEVINE .JOANNE T 
DOWNEN, JEANNE F 
GOLACINSKI, DANIELLE 
JOHNS, AUDREY J 
KENHARD,JEANETTE I 
LARKIN, PETER JOHN 
HACKERT,PAUL G 
MEDLEY,VIRGINIA 
OWEN, CAROLE MARIE 



EXECUTIVE SECRETARY 

EXECUTIVE SECRETARY, TO AUG 31 ... 

LEGISLATIVE COUNSEL 

EXECUTIVE SECRETARY 

EXECUTIVE ASSISTANT 

ASSISTANT PRESS SECTY 

SECRETARY 

DISTRICT ADMINISTRATIVE ASSISTANT 

SECRETARY 

ASST ECONOMIC DEVELOPMENT 

SECRETARY, TO JUL 31 

HAIL COORDINATOR, FROM SEP 1 .... 

SECRETARY 

SECRETARY, TO JUL 31 

DISTRICE OFFICE MANAGER 

STAFF ASSISTANT, FROM AUG 1 

LEGISLATIVE ASSISTANT 

DISTRICT OFFICE MANAGER 

SECRETARY, FROM SEP 1 



,800.01 
,841.67 
,125.00 
,800.00 
,625.01 
,191 .66 
,025.01 
,375.01 
,850.01 
,200.00 
,500.00 

974.36 
,191.67 

483.33 
,083.33 
,083.34 
,499.99 
,674.99 
,266.67 



113 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. DONALD J HITCHELL -CONTINUED 



SAHRE,CARL ROBERT 
THIEL, CAROLYN 

TAN ATTA, LAURENCE B 
BILLIAHS, HITCHELL R 
ZIGA, PATRICIA E 



FIELD REPRESENTATIVE S 2,083.33 

CLERK TYPIST, TO JDL 31 

RECEPTIONIST, FROH AUG 1 2,166.67 

FIELD REPRESENTATIVE, FROM AUG 1 TO AUG 31 ... 2,791.67 

LBJ CONGRESSIONAL INTERN, AUG 1 - AUG 31 590.00 

LBJ CONGRESSIONAL INTERN, AUG 1 - AUG 31 275.33 



OFFICE OF BON. PARREN J HITCHELL 



BISHOP, CLARENCE T 
BRISCOE, LENORA I 
BROWN, SELHA CARTER 
CANNADY, VIVIAN A 
FREELAND, JOYCE L 
GOODE,CORALEEZE L 
RANNON,HABEL ARNITA 
HARVEY, HONIQUE 0. 
HICKS, BILLIAH A 
HOUSTON, GERALDINE 
LIPSCOMB, MICHAEL B 
LYHAS, JERRY C 
LYNN,DEVRA I 
HCALLISTER, SINGLETON B 
HINOB, GEORGE H 
RICH, EVA HAE 
TATE, CYNTHIA A 
THOHAS, FAITH E. 
BATSON, SADIE D 



SENIOR LEGISLATIVE ASSISTANT 

CLERK TIPIST 

STAFF ASST-CASE BORKEB 

LEGISLATIVE SECRETARY 

OFFICE MANAGER 

CLERK TYPIST 

LEGISLATIVE CORRESPONDENT 

CLERK, TC AUG 31 

MAINTENANCE MAN 

EXECUTIVE ASSISTANT 

STAFF ASSISTANT, TO AUG 31 

SPECIAL ASSISTANT 

FBCH SEP 1 

LEGISLATIVE ASSISTANT 

ADMINISTRATIVE ASSISTANT 

SECRETARY 

STAFF ASSISTANT 

LBJ CONGRESSIONAL INTERN, TO AUG 14 
CASE HORKER 



,255.22 
,084.23 
,554.55 
,406.98 
,678.05 
,201. 43 
,375.01 
330.00 
860.23 
,271.30 
,531.64 
,179.93 
,016.27 
,007.80 
,900.00 
,144.90 
,751.78 
865.33 
,l»01.75 



OFFICE OF HON. JOHN JOSEPH MOAKLEY 



ALUKONIS.ANNE B 
BEAN,ELISE J 
CARTER, MARTIN F 
CRABFOHD, REBECCA P 
DONOVAN, JOSEPH P,JR 
DOUGLASS, MARGARET F 
DRISCOLL, THOHAS F,JB 
HA MMELL, NELSON L,JB 
HA7EPJIAN,HARYANNE R 
HURLEY, HARGARET A 
KEATING, DORIS H 
KINEAVY, ROGER J 
KING, PAT RICK J 
OLEARY.JAHES F 
PAPAGNI, PAUL 
RAY, CAROLYN H 
SOULEYRET, FLOYDEN A 
TRAYBRS,PAUL E 
VALLELY, VICTORIA B 
BATTLES, KATHARINE SOPHIE 
BEINFOBTER,JOHN J 
BOODABD, JAMES B 



CLERK, TO AUG 31 , 

STAFF ASSISTANT, TO JDL 31 

CLERK , 

CASEBORKER , 

CONGRESSIONAL AIDE, FROH SEP 1 .... 

DISTRICT LEGISLATIVE ASSISTANT 

CONGRESSIONAL AIDE 

ADMINISTRATIVE ASSISTANT 

CLERK, FROM SBP 1 , 

SECRETARY 

SECRETARY 

DISTRICT MANAGER , 

CONGRESSIONAL AIDS 

LEGAL CCUNSEL 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

PCXEUF.Y OFFICE MANAGER 

SECRETARY , 

CONGRESSIONAL AIDE, FROM AUG 1 .... 

CONGRESSIONAL AIDE, TO AUG 31 

CLERK , 

PRESS SECRETARY 

ASST DIST MGR , 



666.66 
250.00 
749.99 
249.99 
833.33 
125.00 
000.00 
375.01 
833.33 
124.99 
625.00 
500.01 
499.99 
999.99 
590.00 
249.99 
000.00 
641.66 
666.66 
499.99 
999.99 
374.99 



OFFICE OF HON. ANTHONY TOBY MOFFETT 



BLACKLOB,BILLIAB B 
BOUCHER, ELIZABETH ANNE 
BUCKLEY, HORIA F 

GRIFFITH, CATHERINE ANN 
HARDEE, FELICITY 
HURBIT, CATHY 
JOHNSON, ANNE ELIZABETH 
JOHNSON, THOHAS B.,JR. 
KILGOBE, ELIZABETH H. 
LEICHTHAN,JEFFBBY H 
LOHBAHDO, PATRICIA J 
HCALLISTER, CANDIS K 
HORAN, BILLIAH P 
NEILSEN,KINBEBLY A. 
OSIROSKI,HOLLIE E 

PETRICONE,BILLIAH B.,JR. 
SADLER, KATHLEEN 



PRESS ASSISTANT 

STAFF AIDE, FROH AUG 1 TO AUG 31 

DISTRICT AIDE, TO AUG 31 

DISTRICT STAFF ASSISTANT, FROM SEP 1 . 

CASEBORKER 

STAFF AIEE, TO JUL 31 

LEGISLATIVE ASSISTANT 

STAFF SPECIAL PROJECTS AIDE 

DISTRICT COORDINATOR 

LEGISLATIVE CORRESPONDENT, TO JUL 31 .. 

STAFF AIIE, FROH SEP 15 

DISTRICT AIDE 

LEGISLATIVE AIDE 

DISTRICT SR CITIZEN LIAISON, TO JUL 15 

DISTRICT AIDE 

CASE BOBKER., TO JUL 31 

CHIEF CASEBORKER, FROH AUG 1 

LBJ CONGRESSIONAL INTERN, TO JUL 31 ... 
ADMINISTRATIVE ASSISTANT, TO JUL 31 ... 
STAFF ASSISTANT, FROH AUG 1 TO AUG 31 
ADMINISTRATIVE ASSISTANT, FROM SEP 1 . 



,749.99 
,000.00 

,474.99 
,625.00 
,200.00 
,000.00 
,499.99 
,244.08 
,687.50 
,096.49 
,499.99 
,000.00 
458.33 
,608.33 

,083.33 
590.00 



114 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. ANTHONY TOBY HOFFETT -CONTINUED 



SENESE.ANNE 
SKLAR, WILLIAM E 
S8ITZEB, REBECCA 
TURLEY, ELLEN H. 
WILLIS, WILLIAM F 
YEAGER.SHERRI A 



EXECUTIVE SECRETARY $ 

DISTRICT COUNSEL 

STAFF SICE, FROM AUG 1 

CASEWORKER 

DISTRICT ASSISTANT 

LEGISLATIVE CORRESPONDENT, FBOM AUG 1 



3,000.00 
5,250.00 
1,625.00 
2,049.99 
2,750.01 
2,250.00 



OFFICE OF HON. ROBERT H MOLLOHAN 



DAVOLI, GLORIA VICTOR 
DRAKE, W DEAN 
FRAZIER, JANET H 
FREED, CLEO S ' 
HDBER.SHERYL S. 
INGRAM, C. LOUISE 
JONES, DIANA N 
MCCARTY, MARY COLLEEN 
MCDONOUGH, TIMOTHY I 
POTTS, MARY JEAN 
QUERTINBONT.LUCILE H 
RICE, JOHN L. 
ROBB.HEBIDETH 
SCHNEIDER, THEBESA 
SHERIDAN, JULIANN 
SNODGRASS,KATHY A 
SOMERS, SUSAN 
WETZEL, JUDY S 



CLERK 

CLERK 

CLERK 

CLEBK 

CLERK 

CLEBK 

LBJ CONGRESSIONAL INTERN, AUG 1 - AUG 31 

CL ERK 

CLERK 

CLERK 

CLERK 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

CLERK 

CLERK 

CLERK 

CLEBK 

CLERK 

CLERK , 



550.00 
374.99 
750.00 
000.01 
650.00 
625.00 
590.00 
750.01 
750.01 
919.45 
550.00 
590.00 
500.00 

,374.99 
700.00 
500.00 

,650.01 
100.00 



OFFICE OF HON. G. V. (SONNY) MONTGOMERY 



ANDEBTON, DANNIE C 
AUSTIN, HEHBIETTA C 
BURNETT, FRANCES M 
CLEHANDOT, ANDRE, JB 
CURRAN, SUZANNE 
HAMPTON, THOMAS H.,JR. 
HANCHETT,JANE E 
JONES, ALISON DIANE 
KAHLDMS, TERESA E. 
KIMBROOGH.S D 
KNOTT, NANCY L 
HCGHEE.PATTI ANNE 
NOE,JEANETTE F 
ROSENBAUM.RUTH LAURIE 
BOSS, JANET KAY 
SH AM BUBGEB ,CHABLES , JH 
SINGLETABY,AWY C 
VANCE, HILTON R 



CLEBK-EISTRICT OFFICE 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT, TO SEP 9 

STAFF ASSISTANT DISTRICT OFF 

STAFF ASSISTANT 

CLERK, FBOH AUG 6 TO AUG 31 

LBJ CONGRESSIONAL INTERN, TO AUG 5 

DISTRICT BEPBESENTATIVE 

STAFF ASSISTANT, FBOH AUG 26 

STAFF ASSISTANT 

DISTRICT BEPBESENTATIVE 

INTERN, TO AUG 5 

STAFF ASSISTANT 

STAFF ASSISTANT 

DISTRICT CLERK 

STAFF ASSISTANT 



688.50 
,013.86 
,849.99 
,344. 14 
,878.34 
,751.78 
,088.37 

501.04 

583.33 
,500.01 

868.06 
,328.35 
,250.69 

583.33 
,754.99 
,324.99 
,250.00 
,500.01 



OFFICE OF HON. W HENSON MOORE 



ABCENEAUX.PAUL F,JR 
ARCENEAUX, SUSAN F 
BREAUD,JUDY S 
COBNICK, SUSAN ANN 
KAHPINSKI, JOSEPH 
LAFABGUE.ANN L. 
MCCABTHY,JOHN C 
MCCARTHY, MARGUERITE B 
MEANS, BARBABA ANN 
PESSON, BRADLEY WARD 
PURDIN, CHERYL F 
RATTIGAN.JANNELLE M 
BORDAM,CABOL L 
SHREAD.JERI H 
STONE, JOHN C 
TURPIN,KIH B. 
UHLENHOPP.CLETUS BAY 
WILSON, THERESA MABIE 



DISTRICT AIDE , 

SECBETARY, TO AUG 31 

SECBETARY, TO JUL 31 

EXECUTIVE SECRETARY , 

PRESS SECRETARY 

STAFF ASSISTANT, FROM JUL 5 

LEGISLATIVE ASSISTANT 

SECRETARY 

CASEWORKER , 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

SECRETARY 

CASE80BKEB 

LEGISLATIVE AIDE 

STAFF ASSISTANT, FROM AUG 1 

ADMINISTRATIVE ASSISTANT 

STAFF ASSISTANT, TO AUG 15 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT 



,937.50 
,600.00 

850.00 
,250.00 
,706.26 
,648.33 

624.99 
,400.00 
,749.99 

590.00 

874.99 
,818.74 
,375.00 
,150.00 

375.00 

885.00 
,499.99 

875.00 



115 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. CABLOS J HOORHEAD 



ANDERSEN, ALICE K 
CALVO, AHMED V 
CONLAN,JOHN B, JR 
CRAWFORD, VIRGINIA C 
DEAN, GERTRUDE HAXINE 
FREEMAN, MARTHA A. 
GARDNER, JUDITH ANN 
HACKET HAL, GREGG D 
HACKETHAL,OBETHA M 
HEYBOOD.KATHERINB E 
KELLEY, SALLY E 
MILLER, DAPHNE H 
NELSON, PAMELA J 
RICH, JAMES E,JB 
SABKISIAN.ROBEN N. 
SADER, LUCILLE B 
STEVENS, JOT S. 



ADMINISTRATIVE ASSISTANT $ 6,774.00 

LBJ CONGRESSIONAL INTERN, AOG 9 - SEP 8 590.00 

RESEARCH ASSISTANT 1,500.00 

CLERK, FRCM SEP 28 175.00 

EXECUTIVE SECRETARY <»,655.16 

STUDENT INTERN, TO JUL 7 137.67 

SECRETARY, FROM JUL 5 2,866.67 

CLERK 6,388.11 

CLERK 1,334.13 

CLERK 4,563.30 

CLERK 4,232.70 

CLEBK 1,048.29 

CLERK 3,616.65 

LEGIS ASST-PRESS ASST 4,749.99 

LBJ CONGBESSIONAL INTEBN, JOL 9 - AOG 8 590.00 

CLERK 2,787.54 

LEISLATIVE ASSISTANT/SECRETARY, TO JOL 31 

LEGISLATIVE ASSISTANT, FROM AOG 1 5,750.01 



OFFICE OF HON. BILLIAH S MOORHEAD 



BAUHGARTNER, PEGGY B 
BLOOM, ARNOLD STOABT 
BLUETT, FLORENCE V 
BRENER, LINDA 
COHEN, HOLLIE D 
CUDEN, CRAIG T. 
GONDELMAN, BICHABD F. 
JOHNSON, H'ENRI B 
KIER,HADALENE 
MADDOX,BETTT B 
MALONI, WILLIAM R 
HCCABE, BILLIAH MICHAEL 
RHODES, KATHLEEN A 
PISOLEO, JAMES F 

SHOBE, NATHANIEL 
STSBART, DONALD V 
BELLS, PEABL LOOISE 



FROM SEP 6 

ADMINISTRATIVE ASSISTANT 

LBJ CONGRESSIONAL INTERN, TO AOG 5 ... 
TO AOG 5 

SPECIAL ASSISTANT 

STAFF ASSISTANT, FROM AOG 1 TO AUG 31 

TO JOL 31 

FROM AUG 5 

ASS 1ST ANT -DISTRICT 

STAFF ASSISTANT 





750. 


00 




361. 


11 


i 


,958, 


,71 


5 


,100, 


.54 


9, 


,814. 


.50 




688, 


,31 




688. 


,33 


2 


,750, 


,01 


3 


,268, 


,56 


2 


,309, 


,04 


9 


,173, 


,19 


1 


,000, 


,00 


3 


,375, 


,00 


2, 


,250, 


,00 


9, 


,900, 


,00 




330, 


,00 


3, 


,000. 


,00 



OFFICE OF HON. JOHN E MOSS 



BENSON, KATHLEEN BARRY 
BBIDGMAN, LESLIE J 
BROBN, SHEILA E 
DELVECCHIO, ELIZABETH J 
FAITH, PATBICIA M 
FRIEDMAN, HARK L. 
KLABZUBA,BICEARD B 

KROHN,ELFRIEDA E 
LA ROCHE, PATRICIA H. 
LYNCH, PATRICIA ANN 
MADDEN, RITA F 
NAULDING, OLIVIA 
OLESZEK, JANET L 
PLASCHKO,PA0L K. 
RATLIF?,HOINA E 
SALMON, DICY M 
SILBEY, FRANKLIN R 
SPEAR, BICHABD S 
STUART, SANDBA K 
BYMOBE,A L 
YAHAMOTO.JUDY DEE 



ADMINISTRATIVE ASSISTANT 10,183.74 

SECRETARY 2,339.01 

LEGISLATIVE ASSISTANT, FROM SEP 21 33.33 

PERSONAL SECRETARY 3,556.74 

SECRETARY .' 2,901.78 

LBJ CONGBESSIONAL INTEBN, TO AUG 8 747.33 

CLEBK, TO JUL 14 

STAFF ASSISTANT, FBOH JUL 15 1,654.84 

SECBETABY 2,770.74 

DISTRICT SECRETARY 3,963.75 

LEGISLATIVE ASSISTANT 5,756.82 

FILE CLERK 1,216.89 

SECBETABY, TO AUG 31 2,751.78 

STAFF ASSISTANT 1,200.00 

STAFF ASSISTANT, TO JUL 15 475.52 

SECRETARY 4,155.21 

SECRETABY 2,476.62 

RESEABCH ASSISTANT 6,768.27 

STAFF ASSISTANT, FROM SEP 1 ..... 1,083.33 

STAFF ASSISTANT, FROM AOG 1 1,833.33 

DISTRICT REPRESENTATIVE 7,352.70 

SECRETARY 1,125.00 



OFFICE OF HON. BOHALD M MOTTL 



BBIANCESCO.LYNN MABIE 
DILUCIANO, BICHABD R 
FLANNEBY, JAMES J 
GABELL,KABL PETEB 
GRABER, RICHARD B 
GRASSI, CAROL A 
GUTHRIE, THOMAS R 
HORVATH, THOMAS D 



SECRETARY-CASE BORKEB 

RESEARCH DIRECTOR, FROM AUG 22 

ACCOUNT — ADVISOB 

STAFF ASSISTANT, TO AUG 31 

LBJ CONGBESSIONAL INTEBN, AUG 1 - AUG 31 

DISTRICT SECRETARY, FROM SEP 1 

STAFF AIDE 

LEGISLATIVE AIDE, TO SEP 23 



675.01 
491.67 
550.00 
000.00 
590.00 
791.67 
500.00 
227.78 



116 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. RONALD II HOTTL -CONTINUED 



ILSCHENKO,4NNELISE 
KAHOON,NARY 
KATONA, ALICE E 
KITCHEL, ROBERT C 
LATKOVIC, WILSON H,JR 
NINCH, HALTER E 
PENNINGTON, PATRICIA £ 
RYBKA, EDWARD R 
SABO.JEAN 

SARINGER, JANET ANNE 
SINCLAIR, BARBARA J 
SOT, DAVID JOHN 
TOHSA, CHRISTINA 
VACCARO, PATIENCE S 
VENTOHA, ROBERTA 



STAFF AIDE, FRON SEP 6 $ 

SECRETARY 

SECRETARY, TO AUG 31 

ADMINISTRATIVE ASSISTANT 

LEGISLATIVE ASSISTANT, PROH SEP 28 » 

ADMINISTRATIVE ASSISTANT 

RECEPTIONIST-SECRETARY 

STAFF AIEE, TO JUL 31 

DISTRICT SECRETARY, FROH SEP 1 

SECRETARY .. 

STIFF AIEI 

SPECIAL ASSISTANT 

STAFF AIDE, TO AUG 31 

SECRETARY CASEWORKER 

SECRETARY 



659.72 
675.01 
,783.34 
,000.01 
83.33 
,249.99 
,250.00 
5"90.00 
791.67 
,375.01 
,225.01 
,050.00 
,500.00 
,999.99 
,<I50.01 



OFFICE OF HON. AOSTIN J MORPHY 



AIKEN, DEBBIE JEAN 
CARUSO, GABY J 
CEISLER, REGINA H. 

CIALONE,HARY ANN 
DANYO, DEMISE L 
EPPS, YVONNE 
GALLO, GEORGE S 
GARCIA, FLORE NTINO H 
JACOBS, DIANE H 
JORACKO, ANDREW JAMES 
KOSANKO, JOSEPH A. 
LAIRD, KENNETH J 
HCKILLOP,HARK A. 
MCLOCKIE, FREDERICK P,JR 
MITCHELL, BARBARA CASASANTA 
MOLNAR, STEVE, JR 
MYERS, PAOL E. 
NIED, BARBARA J.B. 
PAWLOSKY.BARY SDSAN 
PERRY, PATRICIA C 
ROBERTS, RICHARD R 

RODGERS,MARTA K. 
SCHIFFBAUER,SOBERT 
SPENCE,J ALBERT 
TOLLEY,ROSEANN 
HAGNER, KATHLEEN L 



SECRETARY 1,500.00 

LEGISLATIVE AIDE 3,000.00 

INTERN, FROH AOG 1 TO ADG 31 

LBJ CONGRESSIONAL INTERN, TO JOL 31 1,190.00 

EXECOTIVE SECRETARY 2,250.00 

SECRETARY DISTRICT OFFICE, FROH SEP 1 500.00 

SECRETARY 2,750.00 

CASEWORKER, TO AOG 31 U, 400. 00 

CASEWORKER, FROM SEP 1 1,000.00 

SECRETARY 3,000.00 

PROJECTS COORDINATOR 4,500.00 

INTERN, TO JOL 31 900.00 

ACCOUNTS AND PAYROLL SOPERVISOR, FROM SEP 1 .. 2,700.00 

INTERN, TO JDL 31 1,000.00 

AEHINISTBATIVE ASSISTANT 7,500.00 

OFFICE MGR-CASE WORKER 2,100.00 

CASEWORKER, FROM SEP 1 1,000.00 

LEGISLATIVE AIDE, FROM AOG 1 TO AOG 31 900.00 

SECRETARY 2,100.00 

LBJ CONGRESSIONAL INTERN, AOG 1 - AOG 31 590.00 

SECRETARY 2,700.00 

PRESS SECRETARY, TO AOG 31 

ACM 6 PRESS ASST, FROH SEP 1 4,630.00 

INTERN, TO JOL 31 900.00 

OFFICE MGR-CASE WORKER 4,500.00 

OFFICE MGR-CASE WORKER 4,200.00 

SECRETARY 3,300.00 

SECRETARY, FROH AOG 1 TO AOG 31 900.00 



OFFICE OF HON. JOHN M MURPHY 



BECK, ROBERTA F 

BOYLE, CHARLES F 
CO RLEY, WILLIAM 
DENSON, KATHLEEN T. 
DOYLE, STEPHEN J. 
GAETA,OLGA T 
GRAO, JAMES 
MAGUIRE,JOHN A. 
MARKS, FLORA EMMA 
MCALLISTER, TADDY J 
NACKE,JANE H 
PAGNOTTA, BRENT 
ROWSE, MARGARET 
ROSSO, RITA YOLANDA 
SCALI, GLORIA 
SIMON, ROBERTO S. 
SOLOMON, MORRIS J 
WALDRON, SUZANNE J 
WEINBERGER, HEDY 
WE I SSG LASS, JEFFREY 
WONG,HAE 



■STAFF ASSISTANT, TO JOL 31 

STAFF ASSISTANT, FROH SEP 1 

ADHINISTBATIVE ASSISTANT 

LEGISLATIVE AIDE 

CLERK 

STAFF ASSISTANT, TO JOL 31 

STAFF ASSISTANT 

COMMUNITY REPRESENTATIVE 

CLERK 

STAFF ASSISTANT, FROM AOG 1 TO AOG 31 

PERSONAL SECRETARY 

ADMINISTRATIVE ASSISTANT 

STAFF ASSISTANT, FROM SEP 1 

LEGISLATIVE AIDE 

ADMINISTRATIVE ASSISTANT 

CLERK 

STAFF ASSISTANT, TO AOG 31 

COHHONITY REPRESENTATIVE 

LEGISLATIVE AIDE 

COMMONITY RELATIONS REP 

LBJ CONGRESSIONAL INTERN, TO JOL 31 ... 
CCHHONITY REPRESENTATIVE 



,250.00 
,750.00 

3 54.2 8 
,249.99 

500.00 
.125.01 
,848.35 
,375.00 
,500.00 
,416.67 

000.00 

416.67 
,083.33 

750.00 
,250.00 
,000.00 

666.67 
,750.00 

500.00 

590.00 
,000.00 



117 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. MORGAN F MOBPHY 



AGNEB, DONALD B 
BANKS, SILLIAH J P 
BEABD,CORINNE W 
BINSTEIN, MICHAEL FRED 
BOYLE, ROBERT J 
CALLAHAN, EOGENE G 



FITZGIBBONS, JAMES P 
FLETCHER, CYNTHIA A 
FORTIEB,FERNAND L, III 
PBYE,LDCILLE E 
GOREY, THOMAS H 
INNISS, JOSEPHINE 
JOHNSON, KATHLEEN D 
O'KEEFE.ROY D 
OGORHAN, EILEEN T 
PATEJDL, CAROL ANN 
PEERLESS, EILEEN 
BOSTEN.KRISTIE H 
SCOTT, OBYRIETTA GAMHETT 
SHEA, MARY HAYES 



CLERK $6, 

RESEARCH ASSISTANT 3, 

SECRETARY 3, 

CLERK, TO JDL 31 

CLERK, FBCH SEP 1 

ADMINISTRATIVE AIDE, TO JUL 31 

ADMINISTRATIVE ASSISTANT, AOG 5 - AUG 31 

ADMINISTRATIVE AIDE, FROM SEP 1 3, 

RESEARCB ASSISTANT 5, 

EXEC SECY £ OFF MANAGER 9, 

ADMINISTRATIVE AIDE 1, 

CLERK 

PRESS ASSISTANT 3, 

CLERK 2, 

CLERK 2, 

CLEBK, FBCH AOG 1 TO AOG 31 

CLERK 2, 

CLERK, TO AOG 31 1, 

CASEHOBKEB 3, 

CLERK 3, 

CLEBK, TO AOG 31 

LEJ CONGRESSIONAL INTERN, TO JOL 31 



000.00 
750.00 
150.0 
500.00 
791.67 



750.00 
116.66 
999.99 
875.00 
600.00 
583.33 
100.00 
170.05 
833.33 
176.62 
333.31 
806.25 
166.67 
166.66 
590.00 



OFFICE OF HON. JOHN P MUBTHA 



ALLEN, HILLIAH N 
ASHBY, VIRGINIA C 
BECKMAN, EVELYN J 
CR IV ELLA, BARBARA 
GIOMARISO, PHILIP 
KBINOCK,MARY ELLEN 
LOHR, HILLIAH A 
LOCAS, BLAINE A 
HACHAK,JOHNA L. 
HEDILE,N0NZIO A 
NOVAK, KIHBEBLY A 
OT ELL, HELEN D 
SCHBEIEB, MICHAEL C. 
SLAVICK, DEBORAH ANN 
STRANK, KAREN HABTHA 
TBESSLER, VIRGINIA L 
VOYTKO, JOSEPH F 
VOYTKO,HABY CATHERINE 
BISOB,BABBY F 
ZELHAN.BITA H 



LEGISLATIVE ASSISTANT 9,999.99 

SOPVB/SR CASE BOBKEB 5,000.01 

SECBETABY 2,215.89 

SECBETABY 3,621.99 

ADMINISTRATIVE ASSISTANT 10,183.71 

SECRETARY 2,215.71 

DISTRICT OFFICE MANAGER 1,173.30 

LBJ CONGRESSIONAL INTERN, AOG 1 - AOG 31 590.00 

CLEBK 2,250.00 

CLEBK 1,563.65 

CLEBK, IBCM JOL 23 1,622.23 

DISTBICT OFFICE REPRESENTATIVE 2,215.92 

PRINTING CLERK 1,831.53 

SECBETABY-RECEPTIONIST 2,711.10 

CLEBK, TO JOL 22 1,261.50 

DISTRICT OFFICE BEPBESENTATIVE 2,215.92 

SECBETABY 2,750.01 

CLEBK 1,355.01 

LEGAL COUNSEL 3,219.99 

CLERK 2,215.92 



OFFICE OF HON. GABY A HYEBS 

BIBES, DENNIS E 
BOTLEB,ELINOB A 
CAHMISA,PAOL A 
COCK, JOHN W 
DAVIBS, MARGERY 1 
DOEBR.H. SIDNEY 
FBY, DONNA J 
HOLBACH, ANNE COYNE 
HOFF, DIANA S 
KENLEY.LAOREN LEE 
KOOTOOLAKIS, NANCY K 
KOHDEB, JAMES B 
LODHICZAK.BOBERT J 
LOPTAK,F. DENISE 
HAZAB,JOY S 
HCCAPREH, PATRICIA H 
MCHAHON,MABY JO 
OHBINEB.JENIFEB A 
OSTROBSKI, KAREN A 
STEHHLER,HARALD B. 
HEIR, MARY ELLEN 



STODENT INTERN, TO JOL 31 500.00 

STAFF ASSISTANT, FROM SEP 12 501.39 

STODENT INTERN, FBOBSEP 1 500.00 

DISTRICT BEPBESENTATIVE 6,500.01 

STAFF ASSISTANT 2,350.01 

LBJ CONGBESSIONAL INTEBH, TO JOL 31 500.00 

PERSONAL SECBETABY 3,738.00 

CASE BORKER 3,950.00 

STAFF ASSISTANT, TO SEP 16 ». . . . 2,235.56 

STAFF ASSISTANT 1,155.10 

STAFF ASSISTANT 1,162.50 

LEGISLATIVE ASSISTANT 7,000.01 

AIB1N ASST (D C ) 9,299.99 

COMFOTEB OPEBATOB, FBOM JOL 5 2,727.78 

LEGISLATIVE ASSISTANT 5,300.01 

RECEPTIONIST 2,600.00 

STAFF ASSISTANT 2,600.01 

RESEARCB ASSISTANT, TO JOL 29 852.91 

SPECIAL ASSISTANT 3,950.00 

PRESS SECRETARY 3,100.00 

ERCH AOG 1 TO AOG 31 500.00 



OFFICE OF HON. JOHN T MYEBS 



CAMPBELL, BANDY L 
CAHPO,ANA MARIA 



CLEBK 

CLEBK, TO JOL 31 

SECRETARY, FROM AOG 1 



2,121.99 
2,221.99 



118 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. JOHN T HYERS -CONTINUED 



CONES, CAROLE KAY 
DAVIS,SALLIE S 
DUFENDACH.MARY E. 
HARDEN, CHERYL B. 
HARDMAN, RONALD L 
HENNIG, DAVID A 
LITTLE, DARYL RAY 
LOCK HOLLER, VIRGIN I A 
LUSCHEN, JANET KAY 
MCKNIGHT, CAROL JEAN 
MENDEL, JOHN E 
NICOSON, NANCY LYNN 
PALATIELLO,JOHN B 

ROBE, EUNICE MILDEED 
TORR.JOHN A. 



CASEWORKER 

PERSONAL SECRETARY 

CLERK 

RECEPTIONIST 

ADMINISTRATIVE ASSISTANT 

CLERK, FHOH SEP 7 

LEGISLATIVE ASSISTANT 

CLERK, FECH JUL 6 

CASEWORKER 

CLERK, TO JUL 9 

STUDENT INTERN, FROM SEP 12 

DISTRICT REPRESENTATIVE 

LEGAL ASSISTANT, TO JUL 31 

LEGISLATIVE ASSISTANT, FROM AUG 5 . 

EXECUTIVE SECRETARY 

INTERN, FROM JUL 1U TO JUL 27 

LBJ CONGRESSIONAL INTERN, TO JUL 13 



,375.00 
,875.01 

U95.00 
,020.01 
,825.00 

280.00 
,900.01 
,888.90 
,408.33 

277.50 

380.00 
,350.00 

,127.78 
,500.01 



OFFICE OF HON. MICHAEL "OZZIE" MYERS 



CORBETT.ANNA D 
CORBETT, MICHAEL T 
CUFFELD, JULIA H 
CURRAN.HARY MARGARET 
GOGEL, FREDERICK JOSEPH 
GRAESSLE,MARY I. 
HALIN, EDWARD N 
INEMER.JOHN M 
LOCKETT, BONNIE V 
LONEY, JOANNE B 
LYONS, FLOYD D 
MACCHI A VELLI, ANTHONY 
MACHAK, KAREN SUE 
MARTIN, ELEANOR M 
MCDONOUGH, DONALD A 
SCHWARTZ, RONA LEE 
SULLIVAN, MARY ELIZABETH 
VIGNOLA, JOSEPH C 



STAFF ASSISTANT 6,475.83 

ADMINISTRATIVE ASSISTANT 10,183.74 

STAFF ASSISTANT 3,125.01 

STAFF ASSISTANT 1,500.00 

STAFF ASSISTANT 3,249.99 

STAFF ASSISTANT 999.99 

STAFF ASSISTANT 4,374.99 

STAFF ASSISTANT 2,000.01 

STAFF ASSISTANT 4,250.01 

STAFF ASSISTANT 3,125.01 

STAFF ASSISTANT 2,750.01 

STAFF ASSISTANT 3,000.00 

STAFF ASSISTANT 2,400.00 

STAFF ASSISTANT 2,750.01 

STAFF ASSISTANT 900.00 

RESEARCH ASSISTANT 1,350.00 

STAFF ASSISTANT 4,250.01 

LEGISLATIVE ASSISTANT 5,750.01 



OFFICE OF HON. WILLIAM H NATCHER 



BEATTY, BARBARA ANN 
DENNISON, KAREN ROXANNI 

ERNST, ANN LOUISE 
FRANCIS, ANNE H 
GEOGHEGAN, JENNIE H 
KAFOGLIS,GINNY K 
HYERS, DOLORES T 
STEVENSON, KATHLEEN E. 
TOBIN, ALLISON A. 
WALDMER, R TIPTON 



SECRETARY 

SECRETARY, TO AUG 31 

SECRETARY, FROH SEP 5 

SECRETARY, FHOH JUL 5 

SECRETARY 

SECRETARIAL, FROH SEP 12 

SECRETARY 

SECRETARY, TO AUG 12 

SECRETARY, TO AUG 12 

SECRETARY, FROH AUG 22 TO SEP 23 



2 


,508, 


,33 


2 


,711. 


,10 


2 


,476, 


, 3 8 


2 


,201. 


,13 




422. 


,22 


2 


,499 


,99 


1 


,050, 


,00 




910. 


,00 




933, 


,33 



OFFICE OF HON. STEPHEN L NEAL 



ABERNETHY, DONALD D 
BRINCEFIELD,JAQUELYN E 
CHRISTHAN, CAROLYN JO 
COLLINS, N H,III 
CREECH, ALDENE E 
FELTON, ELBERT PILSTON 
GWYN, KENNETH H. 
HIGGS.HARIE ELAINE 
HOGGARD,G. D. 
HOLTON, BABEL Q 
HOUGLAN, LAURA J 
HUNT.JAHES L 
PORTER, LOLA K 
RIERSON, MICHAEL EAVID 
SEGERBLOM, MARILYN SHITH 
SBITH.JEPFREY DEE 
SHITH, NANCY CARROLL 
STONE, GAYLE RUSSELL 
SWEARINGEN, ELSIE C 
TAYLOR, JABES C 
WBIGLEY, ROBERT E 



ACHINISTRATIVE ASSISTANT 

EXECUTIVE SECRETARY 

STAFF ASSISTANT, TO JUL 23 , 

STAFF ASSISTANT, FROH AUG 1 

RECEPTIONIST 

DISTRICT OFFICE STAFF 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

STAFF ASSISTANT 

STAFF ASSISTANT, TO AUG 31 , 

STAFF ASSISTANT 

LEGISLATIVE SECRETARY 

DISTRICT ASSISTANT 

STAFF ASSISTANT, FROH SEP 1 

STAFF ASSISTANT 

STAFF ASSISTANT, TO JUL 31 

DISTRICT ADMINISTRATIVE ASSISTANT .. 

CASEWORKER 

STAFF ASSISTANT 

SECRETARY 

RESEARCH ASSISTANT , 

STAFF ASSISTANT 



498.70 
999.99 
337.33 
158.75 
375.01 
164.55 
500.00 
880.41 
132.02 
125.01 
275.94 
750.01 
025.00 
791.66 
083.33 
571.30 
120.71 
300.00 
625.00 
571.30 
127.60 



119 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HOH. LOCIEN H NEDZI 



BUIER, HELEN 
BOSHNELL, GEORGE E. 
CAPRON.HABGARET » 
CICETTI, PAMELA S 
DONAHUE, PAUL HICHAEL 
FLANAGAN, HART E 8 
rONTELLA, CAROLYN A 
HOLLIS, ELAINE 
HORNE,HARGARET C. 
HUDSON, HELEN CLARE 
KACZHAREK,ZYGHUND R 
PBZYSTUP.JAHES J 
PYRROS,JAHES G 
SHEAD, ELLEN JEAN 
STAVROS,KATAHINA 
SZADY, CYNTHIA A 



SECRETARY $ 1,972.02 

STAFF ASSISTANT 2,624. 99 

STAFF ASSISTANT 2,620.74 

STIFF ASSISTANT 3,291.66 

ACHINISTRATIVE ASSISTANT 5,807.88 

EXECUTIVE SECRETARY 4,250.01 

CLERK 1,625.01 

SECRETARY 1,542.81 

LBJ CONGRESSIONAL INTERN, TO AUG 12 826.00 

STAFF ASSISTANT, TO JUL 7 311.11 

ABHINISTBATIVE ASSISTANT 3,757.11 

STAFF ASSISTANT, TO AOG 31 2,333.34 

ADMINISTRATIVE ASSISTANT 11,150.01 

STAFF ASSISTANT 2,400.01 

STAFF ASSISTANT 1,362.78 

STAFF ASSISTANT 3,999.99 



OFFICE OF HON. BILL NICHOLS 



ADAHS, ELIZABETH 
CORBETT.JOAN A 
EILAND,THOHAS A 
HARD, BOB 
JEBELES.ERIE B 
LLOYD, ALICE C 
HCBRIDE, DEBORAH R. 
HCCARLEY, CATHIE H 
HCCULLARS,SUANNE F 
HERCHANT,FLORA 
PATRICK, DAVID S 
RICE,HARY ELVA 
RUSH.KATHRYN ANN 
SELDEN.JACK BRIGHT 
TAYLOR, PHYLLIS ANNE 
YOUNG, KENNETH B 



SECRETARY 

SECRETARY 

PRESS SECRETARY 

DISTRICT ADHINISTRATIVE ASSISTANT 

SECRETARY 

SECRETARY 

CASEWORKER 

SECRETARY 

SECRETARY 

CLERK 

ACHINISTRATIVE ASSISTANT 

PERSONAL SECRETARY 

LBJ CONGRESSIONAL INTERN, AOG 5 - SEP 4 

CLERK, TO AOG 5 

SECRETARY 

SPECIAL ASSISTANT 



749.99 
500.01 
615.00 
250.01 
374.99 
424.99 
750.00 
500.01 
424.99 
815.86 
250.00 
250.01 
500.00 
583.33 
050.00 
577.32 



OFFICE OF HON. ROBERT N C NIX 



BAOHGARTNER, PEGGY R 
HARDING, DELO IS 
JACKSON, RICARDO C 
JENIO0S,CYRILL OHARR 
JOHNSON, PRISCILLA VIOLA 
KEHP,LOCIOS L 
LAHE.OLYHPIA 
LLOYD, HAX T 
HCGOHAN,HARY E. 
HCINTYRE,MILLIAH J. 
HEADOBS.DENISE L 

SPANN, JOYCE LAVERNE 
STERN, HEDY 
THORNS, HILLIAfl L 
VASS,JUANITA 
HILLIAHS, HARRY T 
BIHBISH, GODE 



CLERK 

PERSONAL SECRETARY 

CLERK-SECRETARY., TO AUG 31 ... 
CLERK 

EXECUTIVE SECRETARY 

COHPOTER SPECIALIST, TO JOL 31 
COHPUTER OPERATOR, FROH AUG 1 

CLERK 

CASEWORKER 

CLERK 

CLERK 



,000.00 
,025.01 
,062.81 
,594.59 
,833.34 
,878.71 
,800.24 
,157.08 
,248.03 
,287.51 

,599.99 
,500.01 
,790.93 
,447.94 
,894.00 
,612.51 
628.98 



OFFICE OF HON. RICHARD NOLAN 



BAUHANN, ARCHIE V 
BERTRAM, JOSEPH LEO 
BONINE, SHIRLEY A 
DECHAINE.J A 
GRAEVE.JAHES J 
HENNINGSON,BERTON E,JR 
JOHNSON, STEVEN A 
JONES, CAROLYN B 
LARSON, HORHAN L 
LEGG, JANES P 
LINN, JOHN KENNETH 
HAHON, STANLEY A 
HCRONNEL, KAREN K 
HOLITOR, DORIS J 
OLSON, E VIANN 
PALADINO,HABY BETH 



FIELD REPRESENTATIVE 

ASSISTANT CASEWORKER 

FIELD BEPRESENTATIVE 

ACHINISTRATIVE ASSISTANT 

DISTRICT FIELD REP , 

LEGISLATIVE ASSISTANT 

PRESS SECRETARY 

LEGISLATIVE ASSISTANT 

AGRIC ADVISOR S CONG ADE 

STAFF ASSISTANT, FBOH SEP 1 

LBJ CONGBESSIONAL INTERN, AOG 1 - AOG 31 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT, TO AUG 31 

STAFF ASSISTANT 



,937.51 
,000.01 
,750.01 
,700.01 
,625.00 
,874.99 
,875.01 
,375.00 
,500.00 
250.00 
590.00 
,499.99 
,499.99 
,375.01 
500.00 
,874.99 



120 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. RICHARD NOLAN -CONTINUED 



VOLTIN,DARLENE C 
WINGEN, KATHLEEN TERESA 
WIRE,HARILYN 
YATES, IONE V 



STAFF ASSISTANT $ 3,125.01 

STAFF ASSISTANT, FROB SEP 1 250.00 

STAFF ASSISTANT 1,950.00 

PERSONAL SECRETARY OFFICE BGR 3,624.99 



OFFICE OF HON. HENRY J NOWAK 



ALESSI, DONALD A 
BAILEY, CHARLES C 
BURTON, HELEN C 
CARNEY, WANDA 
CLAY, JOYCE B 
COWAN, CHARILYN W 
DOBBROWSKI,BARY JO B 
FHANCZYK.ALINA B 
GODBY,E PLOHBER 
HARRIS, CANDACE DIANE 
BASELKA, RONALD J 
NITKOWSKI, ANTHONY J 
NOTARO, SHIRLEY A 
PORTILL,BARI ELIZABETH 
REAL,TERRENCE ROBERT 
REHAK,JOHN F 
SCHHIDT, JABES F 
SBIROLDO, DIANE BABIE 
TRIPPI,CARHELA 
YAVULLA.BARGARET 



CLERK , 

CLERK 

LEGISLATIVE ASSISTANT 

CLERK 

CLERK 

LEGISLATIVE SECRETARY 

CLERK, FROB AUG 1 TO ADG 31 

CLERK 

EXECUTIVE ASSISTANT , 

RECEPTION IST-SECRETARY 

AEBINISTBATIVE ASSISTANT 

RESEARCH ASSISTANT 

CLERK 

RECEPTION 1ST -SECRETARY 

STAFF ASSISTANT, TO JUL 31 

CLERK 

DISTBICT REPRESENTATIVE , 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

CLERK 

CASEWORKER , 



,785.00 

661.50 

i,288.00 

,102.50 

:,756.25 

,749.99 

491.67 

!, 330.01 

.,191.83 

!,499.99 

1,862.51 

.,900.25 

,102.50 

,499.99 

200.00 

900.00 

1,862.51 

590.00 

661.50 

.,447.25 



OFFICE OF HON. HARY ROSE OAKAB 



BAKER, LAURIE A 
CALANDRA.HARIE THEBESE 
COONEY, PATRICIA B 
ELLISON, RUTH 
FISHER, JOHN 
HADACEK, HELEN A 
JABO, CLAUDIA LEE 
KARAS, VIRGINIA F 
KNIPE, ELIZABETH A 
LANDAU, EARL E 
LAUDI, REGINA HARIE 
BCTAGGABT.WILLIAB E 
PAPEZ, JANICE A 
RICCIO, FANNY 
ROGERS, PATRICIA ANN 
SLIBAK, PAULA ANN 
VARGO,JOHN E 
VEGA, SYLVIA 
VIVOLO,JOAN F 
WAGER, HICHAEL K 
WATSON, JABES B 



CLERK, FROB SEP 1 

CLERK, TC SEP 15 

SECRETARY-CASE WORKER 

EXECUTIVE SECRETARY 

RECEPTIONIST 

SPECIAL ASSISTANT 

SECRETARY 

SPECIAL ASSISTANT 

LEGISLATIVE AIDE, TO JUL 15 

LBJ CONGRESSIONAL INTERN, TO ADG 12 

CONGRESSIONAL AIDE 

AIHINISTRATIVE ASSISTANT 

STAFF ASSISTANT 

CASEWORKER 

AEBINISTBATIVE ASSISTANT/PRESS 

LEGISLATIVE ASSISTANT 

FRCH SEP 26 

CASE WOEKER/LEGISLATIVE PROJ 

CCNGRESSIONAL AIDE 



666.67 
250.00 
.874.99 
,624.99 
,066.17 
,500.01 
,374.99 
,000.01 
,625.01 
770.83 
826.00 
,437.49 
,625.00 
,499.99 
,000.01 
,750.00 
,500.00 
900.00 
200.00 
,874.99 
,125.00 



OFFICE OF HON. JABES L OBERSTAR 



ALLEN, BARGARET L 
BEATTY,GILDA KAI 
BOBO.LUCINDA E. 
DANIELS, THOBAS B,JB 
FLAX, CHARLOTTE 
KAUCHICK, JOSEPH A. 
LEE, RIVA 

BORRIS,JACQUELYN D 
O'CONNOR, JOHN H 
0' DONNELL, KATHYLYNN 
REAGAN, TON 

SCHOENER,CHARBAINE L. 
STONE, BICHAEL HOWARD 
VOORHEES.EDNA H 
YARRINGTON,BARY JANE 
ZABINSKI.EDBABD B. 



STAFF ASSISTANT 

STAFF ASSISTANT 

CLEBK, FEOB JUL 25 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

PRESS SECRETARY (P) 

STAFF ASSISTANT 

ADHINISTRATIVE ASSISTANT .. 

STAFF ASSISTANT 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT, TO JUL 12 



,901.78 
,720.78 
,558.33 
,847.78 
,323. 35 
,103.21 
,156.14 
,489.01 
,500.01 

300.00 
,499.13 
,000.00 
,664.74 
,221.41 
,185.77 

400.00 



121 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OPFICE OF HON. DAVID B OBEY 



BARRY, RACHEL 0. 
CONLON, RICHARD P 

CONNALLY, PATRICIA A 
DAHL, LAURENCE E 
HANSON, HARTIN BILLIAH 
LARSON, BEATRICE C. 
HADIGAN, DENISE RENE 
HADISON, JERRY H. 
HADISON.NELDA J 
MARSHALL, HELANIE SDSAN 
HARTIN, KATHLEEN H 
PELLETT, EVELYN H 
POLLACK, RICHARD J. 

SCHUSTER, NOEHA JEAN 
SPENCER, WINIFRED A. 
STITT,LYLE H. 
STUCKERT,JANE E 
SUNTOH, ELEANOR A 
HALLS, CYNTHIA 
BATSON,GERALYN 



STAFF ASSISTANT, FROH SEP 1 $ 582.37 

STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT, FROH SEP 1 2,00«.00 

RECEPTIONIST 2,793.00 

DISTRICT REPRESENTATIVE 6,003.00 

FIELD BEPBESENTATIVE 2,75«.00 

CASEBOBKEB 5,371.00 

SECRETARY, TO SEP 7 1,161.33 

DISTRICT REPRESENTATIVE 6,099.00 

SECRETARY, FROH SEP 12 279.30 

LEGISLATIVE SECRETARY, TO AUG 31 2,033.84 

PRESS SECRETARY 4,574.00 

SECRETARY 2,292.00 

STAFF ASSISTANT, FROH AUG 7 

LBJ CONGRESSIONAL INTERN, TO AUG 5 2,088.33 

PERSONAL SECRETARY 14,886.00 

SECRETARY 3,003.00 

ADMINISTRATIVE ASSISTANT 7,«29.00 

STAFF ASSISTANT, F30H AUG 1 TO AUG 31 1,571.00 

SECRETARY 2,649.00 

SECBETARY ., 2,559.00 

STAFF ASSISTANT, TO JUL 31 1,11*2.00 



OFFICE OF HON. GEORGE H O'BRIEN 



BUDD, THERESA ANN 

BUPSON.MABION H 
CORHANEY, THEODORE H 
COSTEL YOU, BARREN P 
DUBOIS, ARLENE A 
FOX.JULIANNE F 
GARDNER, JANET L. 
GOLDHABEB,HABK 
HAGGEBTY, NAOMI RUTH 
HAYES, JOHN BILCOX 
KEIB,HARGARET TBADDLE 
KEIR, RICHARD D 
LEBIS, CAROLYN G 
SARKELZ, ROBERT A. ,JB 
HUBPHY.HARY ELIZABETH 
NSALE, PATRICIA A 
NEALE, ROBERT C 
POHELL, DOROTHY L 
F.OONEY, PATRICK J. 
SCHROEDER, DAVID C 
SPAITH, ALEXANDRA DOBB 
STENGELE, ROBERT P. 
HEINSR.B DAVID 



CLEBK, TO JUL 31 , 

STAFF ASSISTANT, FROH AUG 1 , 

ADHINISTRATIVE ASSISTANT 

PRESS ASSISTANT 

CLERK, FBCM SEP 1 , 

CASEWORK SECRETARY 

STAFF ASSISTANT, TO AUG 31 , 

SECBETARY 

STAFF ASSISTANT, FROH SEP 1 

ASSISTANT , 

ASSISTANT 

DISTRICT OFFICE MANAGER , 

CLERK, TO AUG 31 , 

SECBETABY 

LEJ CCNGBESSIONAL INTERN, TO JUL 31 

ASSISTANT 

ASSISTANT 

DISTBICT 5EPBESENTATIVE , 

PEBSONAL SECRETARY, FROH AUG 1 .... 

STAFF ASSISTANT, FROH SEP 1 

STAFF ASSISTANT, TO AUG 12 , 

OFFICE HANAGEB 

CLERK, TC AUG 12 

CLERK, TO JUL 31 



675.00 
058.00 
250.00 
320. HO 
850.00 
233. 3D 
500.00 
125.00 
999.99 
125.00 
500.00 
500.00 
750.00 
500.00 
999.99 
999.99 
374.99 
000.00 
100.00 
700.00 
375.00 
700.00 
500.00 



OFFICE OF HON. THOHAS P O'NEILL JR 



ABHISTEAD, LEWIS A,JR 
CABVER,JOHN J 
CLIFFORD, SUSAN fl 
D'APCY, HERBERT J 
EGAN, NANCY LEE 
FAHEY,HARY T 
GANNON, FRANCINE H 
GBADY.ROBEBT A 
GBEEN,HARY ANN 
GREGORY, BETTY L 
LA HKIN, LEONARD 
HASLEY,OBEN G 
HULLEN, THOHAS H 
PETERSON, KEVIN F 
RALPH, HICHAEL D 
ROBAN,JAHES P 
SAIDBABEY, JEANNE J. 
SCALFATI, JULIE H. 
SHANNON, JOANNE 
SNOB, DOLORES C 
STONE, JONATHAN 



SECRETARY , 

ASSISTANT, TO AUG 31 

ASSISTANT SECRETARY 

INTEBN, FBOH SEP 1 , 

SECRETARY 

SECBETABY , 

ASSISTANT , 

RESEARCH ASSISTANT, FBOH SEP 1 .... 

ASSISTANT , 

LBJ CONGBESSIONAL INTERN, TO JUL 31 

CLERK , 

SECRETARY, FROH SEP 1 , 

EXECUTIVE SECRETABY 

INTEBN, FBOH SEP 1 



,375.00 
,500.00 
,624. 99 

833.34 
,500.00 
,500.00 
,500.00 

500.00 
,750.00 
,375.00 
,250.00 
,500.00 
,666.66 

500.00 
,500.00 
,250.00 

590.00 
,636.00 
,150.00 
,375.01 

500.00 



122 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. RICHARD L OTTINGER 



CRCZIER, DOROTHY F 
CUNNINGHAM, CHARLES D 
DONOFRIO, ISABEL C 
FDELHAN, DEANE F 
FIDLEH,RHODA i 
GARFOHKEL, LINDA 

GASELL.KARL PETER 
GREEN, SARA 
HORTON,JOAN P 
KELLY, GAIL E 

HATHEBS, NANCY 
MERRILL, NANCY JO 
MOORE, ELIZABETH C. 
NARDOZZI, FRANK EDBIN 
OBRYON, MARGARET K 
ROGOWSKY, MARTIN L 
SLATES, JANE S 
TALBOT, ELIZABETH S. 
TEICHER,OREN J 
THOMAS, JOHN H 
TRADER, DORIS JEAN 
WADDELL,HARY D 
SALLQDIST,CYNTHIA A 



DISTRICT STAFF $ 2,124.99 

STAFF AIDE, TO ADG 15 1,625.00 

DISTRICT STAFF, FROM JUL 15 3,569.27 

STAFF, TO JUL 31 833.33 

DISTRICT STAFF, FROM AUG 1 1,733.34 

STAFF ASSISTANT, TO JDL 31 

DISTRICT STAFF, FROM SEP 1 1,033.33 

LEGISLATIVE AIDE, FROM SEP 1 1,166.67 

LEGISLATIVE CORRESPONDENT, TO JDL 31 833.33 

DISTRICT STAFF, FROM JUL 16 2,198.08 

LEGISLATIVE CORRESPONDENT, AOG 8 - AOG 31 .... 

LEGISLATIVE AIDE, FROM SEP 1 1,500.00 

LEGISLATIVE ASSISTANT 6,385.17 

LEGISLATIVE AIDE 3,999.99 

LEGISLATIVE ASSISTANT 3,000.00 

ASSISTANT, TO ADG 31 , 2,833.34 

STAFF ASSISTANT 3,541.66 

ADMINISTRATIVE ASSISTANT, TO JUL 15 520.83 

DISTRICT STAFF, TO AUG 15 900.00 

DISTRICT STAFF 2,375.01 

ADMINISTRATIVE ASSISTANT, FROM JUL 5 7,250.00 

STAFF 4,416.67 

OFFICE MANAGER 4,696.00 

SECRETARY 3,249.99 

STAFF 3,999.99 



OFFICE OF HON. LEON E PANETTA 



ALBERT, SUSAN L. 
BAUMAN, LARRY 
BOWERSOX,KIM C 
CAPRON, MARGARET V 
C0SS0L0TT0,HATTHE8 C 
ENGLUND, MARION Y 
FATA, EUGENE M 
FITTS, JANICE G 
FOLEY, MARTHA CHRISTINE 
FRANZEN, BYRON T 
GENTILLY, PENNY 
HARVEY, ALISON M. 
KOSATKA, BELINDA S 
LOUGHHAN, ROSEMARY 
MARINO, JOSEPHINE D 
MCQUILLAN, MICHAEL H 
NEDELLIN.H REGINALD 
MINICK, NANCY CAROL 
OSGOOD, DAVID P 
PAGE, STEPHEN 

PETERSON, ANN 
PLASCHKO,PADL K. 
REYES, ERNEST J 
HILDING.KATHERIN L. 



STAFF ASSISTANT, TO JUL 31 

PRESS AICE, TO AUG 2 

LEGISLATIVE CORRESPONDENT 

STAFF ASSISTANT, FROM SEP 1 

STAFF ASSISTANT, FROM SEP 19 

FIELD REPRESENTATIVE 

FIELD REPRESENTATIVE, TO JUL 31 

CHIEF CASE WORKER 

LEGISLATIVE AIDE 

ADMINISTRATIVE ASSISTANT 

LEGISLATIVE AIDE 

FIELD REPRESENTATIVE, TO AUG 6 

RECEPTIONIST, PROM JUL 5 

RECEPTIONIST, TO JUL 8 

PERSONAL SECRETARY 

LEGISLATIVE CORRESPONDENT, AUG 1 - AUG 26 

CORRESPONDENCE SECRETARY 

SECRETARY, TO AUG 18 

STAFF ASSISTANT, FROM AUG 17 

PRESS AIDE, FROM AUG 1 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

FIELD REPRESENTATIVE 

STAFF ASSISTANT, FROM SEP 1 

FIELD REPRESENTATIVE 

FIELD REPRESENTATIVE, FROM JUL 25 



590.00 
,066.67 
,750.01 
,666.67 

333.33 
,750.01 
,458.33 
,750.00 
,999.99 
,499.99 
,250.01 

950.00 
,347.22 

200.00 
,750.00 

794.44 
,416.67 
,266.67 
,161.11 

,256.66 
,624.99 
833.33 
,833.34 
,741.67 



OFFICE OF HON. EDWARD J PATTEN 



BARNES, PETER J. 
BEA,PAUL H 
BORRUS,AMY S. 
CALLAS, STEPHEN G 
COOPER, JUDITH P 
GIBBS, KAREN MARIE 
KELLY, BRIAN J. 
KESSELMAN, STEPHEN E. 
KUHN.HICHELE J. 
LEFKUS, LINDA ANN 
LOWENKOPF.LEO S 
MANNINA, SUSAN MARIE 
MEADE. PATRICIA ANNE 
OGRADY, CONSTANCE M 
OWEN, SAMUEL P. 
PAONE.JOHN PAUL 
PATTEN, ANNA Q 
SANDOR,JILL SUZANNE 
SHAFER, ANNETTE A 
STOUKAS,ANMARIE T 
WEITZEN.ERIC I. 



SUMMER INTERN, TO AUG 31 1,044.00 

RESEARCH ASSISTANT 4,500.00 

SUMMER INTERN, TO AUG 31 1,044.00 

ADMINISTRATIVE ASSISTANT 10,183.74 

DISTRICT AIDE, FROM SEP 1 365.06 

CLERK 5,250.00 

SOHMER INTERN, TO ADG 31 1,044.00 

SUMMER INTERN, TO AUG 31 1,044.00 

SUMMER INTERN, TO AUG 31 1,044.00 

SUMMER INTERN, TO AUG 31 1,044.00 

DISTRICT AIDE 2,462.34 

CLERK 4,042.26 

CLERK 2,360.01 

DISTRICT AIDE, FROM SEP 1 405.63 

DISTRICT AIDE, FROM SEP 1 396.80 

CLERK 1,500.00 

SECRETARY 4,086.57 

SUMMER INTERN, TO AOG 31 1,044.00 

CLERK 3,875.01 

DISTRICT AIDE, FROM SEP 1 586.41 

SUMMER INTERN, TO AUG 31 1,044.00 



123 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. JERRY H PATTERSCH 



BAEDARO,NAGALY 
8RISBIN, SANDRA L 
CASPERSON, CAROL J 
CODSINS, JAMES H 
GODINEZ, LINDA S 
HANNA,JOHN R 
JENSEN, DIANE 
JENSEN, VERLYN N 
KARNES, DAVID A 
MCCLURE.NARY KAY 
NEESE,NARY E 
REZA.H3LI0D0H0 
RUBPLER, DEBORAH I 
SCOTT, MICHAEL D. 
SHITH, ELIZABETH I 
STARKEY.LOIS 
THOMAS, SUE ANN 
HARD,LORA LEE 



SECRETARY $ 2,700.0C 

CASEWORKER 2,700.00 

CASEWORKER 3,150.00 

ADMINISTRATIVE ASSISTANT 9,000.00 

CASEWORKER 2,700.00 

STAFF ASSISTANT 3,000.00 

STAFF ASSISTANT 3,000.00 

DISTRICT REPRESENTATIVE 1,500.00 

STAFF ASSISTANT, FROM AUG 1 TO ADG 31 250.00 

EXECUTIVE SECRETARY 3,675.00 

LEGISLATIVE ASSISTANT 4,800.00 

PRESS ASSISTANT 5,100.00 

RECEPTIONIST 2,550.00 

DISTRICT ADMINISTRATIVE ASSISTANT 6,000.00 

STAFF ASSISTANT 3,450.00 

LEGISLATIVE ASSISTANT l»,200.00 

LEJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

STAFF ASSISTANT 3,150.00 



OFFICE OF HON. EDWARD W PATTISON 



ANNABLE, SUSAN B 
CHEATHAM, ANNE W 
CONLON, RICHARD P 
DYBDAHL, THOMAS L 
ERLANG2R, WENDY J. 
FAIRBANK,PRISCILLA A 
GIBSON, ANN TAYLOR 
GIBSON, SARAH JONES 
GOLDFARB,0 
GUTERHUTH, CAROL A 
HAGAN, WILLIAM, II 
HERMAN, RUTH R. 
HULBEHT, TIMOTHY P 
JONES, BARBARA A 
HACDONALD, LAURA LYNNE 
HILLIHGTON, DONALD J. 
HOCHON, MARGARET 
O'CONNOR, TRACY L. 
SHAW, DAVID JACKSON 
SORRENTO, YOLANDA T 
TATELY, DAVID H 
TURNBULL, SUSAN WOLF 
WINTER, NANCY A 



ASSISTANT, FROM AUG 1 TO AUG 31 ... 
ASSISTANT, FROM AUG 1 TO AUG 31 ... 

ASSISTANT, TO JUL 31 

COMMUNITY AIDE 

ASSISTANT, TO JUL 31 

FEDERAL AIDS ASST 

PERSONAL ASST 

LEGISLATIVE CORRESPONDENT 

ADMINISTRATIVE ASSISTANT 

SPECIAL PROJECTS AIDE 

ASSISTANT, FROM SEP 1 

CASEWORKER 

FIELD REPRESENTATIVE 

DISTRICT CASE WORKER 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

COMMUNITY REPRESENTATIVE 

DISTRICT REPRESENTATIVE 

LEGISLATIVE CORRESPONDENT, FROM SEP 

ASSISTANT 

DIST STAFF COORDINATOR 

FEDERAL AIDS ASST 

FEEERAL AIDS ASST 

ASSISTANT 



828.65 
000.00 
328.65 
875.01 
500.00 
519.99 
375.00 
375.01 
750.00 
947.91 
833.33 
250.00 
125.01 
750.00 
590.00 
000.01 
750.01 
666.67 
375.01 
125.01 
000.01 
249.99 
625.00 



OFFICE OF HON. DONALD J PEASE 



BILIDAS,BESS 
BROWN, FERRIS W 
CASBER, TRACY A. 
CODDINGTON,LYNN 
FISK,JOHN D. 
GATELY, SUSAN N 
GOOLD.J WILLIAM 
HAYS, KENNETH H 
HOLLAND, NANCY E 
LITMAN, DOROTHY W 
MALONEY, SALLY A. 

PATRICK, BETSY 

RENGEL,DALE J. 

ROTHSCHILD, HEIDI HCCLELLEN 

RULLI, ROBERT F 

STDDDS, CHERYL A 

TURNER ,JOEMHA 

WELCH, BETTE B 

WILSON, HIGNON J 

WOOD, MILDRED S 

YOOD, NANCY N 



SECRETARY 2,619.99 

STAFF ASSISTANT, FROM SEP 7 80.00 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

STAFF ASSISTANT, FROM SEP 1 1,000.00 

INTERN, TO AUG 31 1,180.00 

LEGISLATIVE ASSISTANT 3,375.00 

LEGISLATIVE ASSISTANT 3,750.00 

STAFF ASSISTANT, TO JUL 31 1,000.00 

RECEPTIONIST-SECRETARY, FROM SEP 19 300.00 

DISTRICT REPRESENTATIVE 5,124.99 

RECEPTIONIST-SECRETARY, FROM JUL 11 TO SEP 11 . 

SECRETARY-CASE WORKER, FROM SEP 12 1,794.45 

SECRETARY, TO JUL 31 833.33 

INTERN, TO AUG 31 1,180.00 

STAFF ASSISTANT 3,500.01 

DISTRICT REPRESENTATIVE 5,250.00 

SECRETARY, FROM AUG 1 TO SEP 9 1,300.00 

PEESCNAL SECRETARY 3,375.00 

ADMINISTRATIVE ASSISTANT 8,750.01 

STAFF ASSISTANT 2,874.99 

SECRETARY 4,687.50 

DISTRICT SECRETARY 1,833.33 



OFFICE OF HON. CLAUDE PEPPER 



ALZOLA, MARIA D 
BEDELL, ELIZABETH B 
CAMPBELL, FRANCES H 



SECRETARY-DISTRICT OFFICE 

RESEARCH ASSISTANT 

PERSONAL SECRETARY, TO JUL 31 .. 
PERSONAL SECRETARY, FROM AUG 5 



2,839.62 
5,676.60 



5,605.80 



124 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. CLADDE PEPPER -CONTINUED 



CHENAULT.MARY LILLIAN 
DICKSON, CHARLOTTE G 
DICKSON, MARGARET H 
FOBEHAN, WALTER J. 
FRENZEL, MARLA 
HAGGIO, ANITA SARAH 
(1ARSCH,REGINA 

NOLDE,H CHRISTOPHER 
PETIT, DONALD R 

SCHAPER, ELIZABETH W 
SCHEINER, MARTHA 
SOOTHERLAND, JAMES F 
SPULAK, THOMAS J 



SECRETARY $ It, 127. 67 

APPTS SECTY 6 OFF MGR 5,605.80 

RECEPTIONIST 2,921.67 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

LEGISLATIVE AIDE 2,776.62 

CLERK TYPIST 2,501.43 

CLERK, TO JUL 31 . . ., 

CLERK-DISTRICT OFFICE, FROM AUG 1 1,959.95 

STAFF AIDE 300.00 

DISTRICT REPRESENTATIVE, TO AUG 31 

DISTRICT AIDE REP., FROH SEP 1 6,512.65 

SECRETARY 3,055.02 

SECRETARY DISTRICT OFFICE 2,100.00 

ADMINISTRATIVE ASSISTANT 10,200.00 

DISTRICT AIDE 3,375.00 



OFFICE OF HON. CARL D PERKINS 



BRANHAH, LAURENCE 
CASTORO, ELSA R 
CORCELLA, ELLEN 

CROSBY, CONSTANCE F 

HARGETT, MARILYN L 
JEWELL, CHARLOTTE R 
MILLER, W KENNETH 
OHARA.MARY KATHRYN 
RIDGELY, RICHARD JOSEPH 
RUEHLING, MARGARET P 
ROSNAK, SHARON S 

SCALLAN,PAMELLA B 
STONE, MICHAEL B 
SWIFT, IVAN 
TEETS.ELNORA HELEN 
TODD, GERTRUDE D 
VICKERS, RICHARD D.,JR. 
WEST, PATTY SUE 
WILLIAMS, CAROLYN A 



CLERK FIELD REP 

SECRETARY 

FROM SEP 1 

LEJ CONGRESSIONAL INTERN, TO JUL 31 

OFFICE ASSISTANT, TO AUG 31 

PROJECTS ANALYST, FROM SEP 1 

SECRETARY 

CLERK 

ASSISTANT CLERK, TO AUG 31 

TO AUG 31 

OFFICE MANAGER, FROM SEP 1 

SECRETARY 

ASSISTANT CLERK, TO SEP 9 

ASSISTANT 

CLERK 

ASSISTANT CLERK, TO JUL 31 

FIELD OFFICE MANAGER 

SECRETARY 



, 161 . 1*5 

,070.8a 

747.33 

,796.63 
,642.67 
,961.17 
,521.32 
,100.00 
,666.67 
,359.27 

,629.97 
,900.41 
,725.00 
,424.98 
,683.33 
,294.82 
666.67 
,708.34 
,958.33 



OFFICE OF HON. SHIRLEY N PETTIS 



ALDERSON, FREDERICK K 
ALLEN, KATHRYN 
BAYNE, RICHARD JED 
BEATTIE,DELLA B. 
BERLIN, TRUDI A. 
BRANCH, LOIS H 
DONOVAN, DONALD F. 
GOLDMAN, PATRICIA A 
HOLT, LEE 
LEWIS, JEANNE R 
HEISELMAN.E ANNE 
MOORE, JANET L. 
SCBIPSKE, EVELYN G 
SCOTT, PAULA J 
SHELDON, SHARYN J 
SHUPP, BETTY L 
SKELDON,KARIN 
SMITH, SUSAN WOLGAMOT 
STARRELS.ROCHELLA SUE 
TOMPKINS, JACK D 
iOOLBERT.MAYBELLE S 
ZAMARIA,ROSE H 



SPECIAL ASSISTANT 7,875.00 

RECEFTICNIST-TYPIST 2,232.21 

PRESS ASSISTANT, FROH SEP 15 644.44 

CLERK, TO JUL 16 213.33 

CLERK TYPIST, TO JUL 31 200.00 

FIELD REPRESENTATIVE 3,931.14 

STAFF ASSISTANT 1,725.01 

STAFF ASSISTANT, TO JUL 31 2,500.00 

FIELD REPRESENTATIVE 4,127.67 

CASEWORKER 3,316.66 

PRESS LEGISLATIVE ASSISTANT, AUG 1 - AUG 31 .. 1,375.00 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 400.00 

LEGISLATIVE/PRESS AIDE, TO AUG 18 2,293.33 

LEGISLATIVE CORRESPONDENT 2,874.99 

CASEWORKER, FROM JUL 18 1,460.00 

CLERK TYPIST 2,864.37 

RECEPTIONIST/APPOINTMENT SECRETARY 2,874.99 

LEGISLATIVE ASSISTANT 4,133.33 

BOOKKEEPER 628.98 

FIELD REPRESENTATIVE 5,306.01 

SECRETARY 3,224.43 

ADMINISTRATIVE ASSISTANT 8,698.11 



OFFICE OF HOB. J J PICKLE 

ALLEN, TOM RANDOLPH 
BENDER, JOHN STEVEN 

BUSHELL, LINDA K 
BYRNE, ROBIN ANN 
ELLIOTT, DOROTHY J 
GRAHAM, PATRICIA JANE 



CLERK 3,144.90 

PRESS ASSISTANT, TO AUG 31 

PRESS LEGISLATIVE ASSISTANT, FROM SEP 1 3,566.66 

CLERK 2,000.01 

CLERK 2,195.01 

CLERK 3,118.68 

CLERK 2,625.00 



125 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. J J PICKLE -CONTINUED 



GREGORY, JANICE H 
KEELING, J HICHAEL 
LOPEZ, HERHINIA 
OLSEN,LABRENCB 
PAYTE.LORETTA H 
PEERY.SOSAN 

RUFFING, HARY THERBSE 
ROOD, BARBARA D 
SCHOLZE.JOBN B. 

SHUL HAN, HOLLY 
TODD, REGINALD E 
BARE,ELLEANOR HABREN 



CLERK $ 3,500.01 

ADHINISTBATIVE ASSISTANT 9,249.99 

CLERK 2,806.83 

LEGISLATIVE ASSISTANT U, 250. 01 

CASE BORKER/CLERK 5,376.30 

CLERK, TO ADG 31 

PERSONAL SECRETARY, FROH SEP 1 3,358.34 

CLERK, TO AUG 12 770.00 

RESEARCH ASSISTANT 3,711.90 

CLERK, FFCH AUG 6 TO AUG 31 

LBJ CONGRESSIONAL INTERN, TO AUG 5 800.83 

CLERK 4.277.U9 

DISTRICT ADMINISTRATOR 6,000.00 

CLERK 2,919.99 



OFFICE OF HON. OTIS G PIKE 



ANDERSON, BARBARA A 
BALL, CHARLOTTE I 
CONKLIN, BLANCHE A 
DONNEB, AARON B 
HARRIS, KATHLEEN 
HULL, ARTHUR B,JR 
HCNAHARA,REGINA H 
HENEGUS, EDITH HABIA 
ORR, BETTY L 
PURSIANO, DAVID T 
QUINN, JOSEPH R 
SHERATON, PAHELA D. 
SHALL, SHARON A 
TALBERT, JUDITH A 
VANTURE,PAUL S 
BALDBADEH, ROBERT T 



SECRETARY 3,999.99 

SECRETARY, FROH SEP 29 44.44 

SECRETARY 2,750.01 

FIELD REPRESENTATIVE 5,000.01 

SECRETARY 3,249.99 

FIELD REPRESENTATIVE 1,250.01 

INTERN 2,871.99 

SECRETARY 2,750.01 

OFFICE HANAGER 7,500.00 

LEGISLATIVE AIDE 3,249.99 

FIELD REPRESENTATIVE 2,121.99 

INTERN, TC AUG 5 729.17 

SECRETARY 1,625.01 

SECRETARY 3,999.99 

RESEARCH ASSISTANT 6,875.01 

AIDE 2,121.99 



OFFICE OF HON. B R POAGE 



BLAKE, CHARLES EDBABD 
ELLISON, HARK 
FALKE, LYNNS A 
HALIBURTON, BRUCE E 
HENINGTON, CLARENCE D 
HOLSTEAD,ELLA K 
JENNINGS, LEONA F 
JOHNSON, CHLOE H 
KINCHELOE,FARON 
LAIR, RUTH 
HCKEE.HATTIE HAE 
PATTERSON, JOHN TBOHAS 

PATTIE,LOVE H 
PUTTEET,TEENA L. 
SUTTER, JOHN BEN 
BEEKS, DEBORAH D 



TO AUG 31 

FRCH SEP 1 

FROH SEP 1 

FROH AUG 1 

TO JUL 22 

LBJ CONGRESSIONAL INTERN, TO JUL 22 

TO AUG 31 



6,375.00 

833.31 

708.33 

500.00 

6,375.00 

3,903.01 

3,650.01 

5,837.19 

880.83 

6,375.00 

5,219.99 

952.11 

1,877.74 
1,416.66 
3,000.00 
3,125.01 



OFFICE OF HON. LARRY PRESSLER 



BAAL, SHERRY LYNN 
BERINGER,JON H. 
COVIELLO,HABIE 
DVORAK, KAREN H 
EHGELHART.GERALDIHE F 
ERICKSOH, REBECCA I 
EBERT,JOHN H. 
FARRAB, JEANNE H 
FISHER, CHARLES E 
GEUNSETH,JOR B 

GUSTAFSON,RAHONA J. 
HALL.GEBRI L. 
HASCHE, BRUCE ALLEN 
HEEB, STEVEN K 
HOVEY, ARTHUR J 
LINK.PATRIC GRIFFIN 
OVIATT, JONATHAN JAHES 
PETERSON, HARGARET 



SECRETARY, TO JUL 31 750.00 

PRESS ASSISTANT, TO JUL 31 1,500.00 

SECRETARY 2,125.00 

FIELD ASSISTANT, FROH AUG 1 2,187.50 

SECBETAEY, FROH SEP 1 550.00 

SECRETARY, TO AUG 31 1,883.34 

SENIOR CITIZEN INTERN, TO JUL 31 400.00 

LBJ CONGBESSIONAL INTERN, TO JUL 31 590.00 

PUBLICATIONS ASSISTANT, FROH AUG 1 TO AUG 31 . 999.99 

AEHINISTRATIVE ASSISTANT, TO JUL 31 

ADHINISTRATIVE ASSISTANT, FROH AUG 5 8,375.01 

SECRETARY 2,375.01 

LEGISLATIVE SECRETARY 3,125.01 

LEGISLATIVE AIDE 3,125.01 

LEGISLATIVE AIDE 2,750.01 

PRESS SECRETARY, FROH SEP 16 666.66 

LEGISLATIVE ASSISTANT 4,136.97 

FIELD ASSISTANT, TO AUG 31 3,166.66 

RECEPTIONIST 2,683.33 



126 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. LARKY PEESSLEE -CONTINUED 



PETERSON, BARK A 
REILLY.ANN 
RHODES, BLEANOR F 
SCRIBNER, ALLAN KENT 
SITZ, TIMOTHY LEWIS 
WALLACE, BARBARA C 
WANBERG, BECKY JEAN 



FIELD ASSISTANT, TO AUG 22 S 1,805.56 

PRESS SECRETARY 3,750.00 

PERSONAL SECRETARY 6,249.99 

FULL ASSISTANT, FROB SEP 1 1,375.00 

COHPOTER OPERATOR 2,500.02 

CASEWORKER, TO AOG 31 1,974.83 

PRESS ASSISTANT, FROH AOG 1 1,666.68 



OFFICE OF HON. RICHARDSON PREYER 



ALBRIGHT, JOSEPH L 
BLADE, BETTY JEAN 
BORNESS, ANDREW IRVING 
COPELAND,DOOGLAS W,JB 
DEBRAGGA, HAZEL WHEELER 
DELANEY,H BOWLER 
HAWKINS, DANIEL L. 
KORNEGAY, BETTY LITTLE 
KRESS, ELEANOR D. 
LAMBETH, THOHAS W 
MCCBORY, PATRICK LLCYD 
POPE, ANN C 
PRUITT.BERNICE 
REICH, THOMAS G 
RUSSELL, JOHN SPOTSWOOD 
SCHECTER, IRENE D 
SIMMONS, CYNTHIA BHCWN 
TSOTRAS, FRANK G 
WEBSTER, MARY COMER 



SUMMER INTERN, FROM JOL U TO AOG 15 758.33 

SECRETARY 3,217.58 

RESEARCH ASSISTANT 3,124.99 

SPECIAL ASSISTANT 4,124.99 

DISTRICT ASSISTANT 3,908.70 

DISTRICT OFFICE AIDE 2,659.81 

SUMMER INTEBN, FROB JOL 4 TO AOG 15 758.33 

OFFICE MANAGER-DISTRICT 2,876.79 

INTERN, TO JUL 11 198.61 

ADMINISTRATIVE ASSISTANT 6,705.55 

DISTRICT OFFICE INTEEN, TO SEP 2 909.33 

CASE WOEKER 2,583.33 

APPOINTBENTS SECRETARY 4,796.76 

LEJ CONGRESSIONAL INTERN, JOL 4 - AOG 15 758.33 

CONGRESSIONAL INTERN, TO JOL 3 54.17 

LEGISLATIVE ASSISTANT 5,620.67 

RECEPTIONIST 6 SECTY 2,583.33 

STAFF ASSISTANT, FROM SEP 1 2,075.00 

COONTY ASST 2,788.83 



OFFICE OF HON. BELVIN PRICE 

ALLEN, MARK S 

ALTMAN, STEPHEN L 
BLOOD, CONNIE D 
COOK,BOBEBT CHARLES 
GREGOBY.COLT H 
HART, WILLIAM K - 
JOTTE, EUGENE T 
LAMB,HADELYN J. 
LONGHI, DEBORAH C. 
NORTHING TON, JAHESETTA 
OXLEY.MAEK 

SWITZER,ERWIN OLIVER, III 
WALLER, PAUL P. ,111 
WRIGHT, CAROLE L 
ZAJAC, DEBORAH C 



STAFF ASSISTANT, TO JOL 31 

LEGISLATIVE ASSISTANT, FROB AOG 1 . 

STAFF ASSISTANT, FROB AUG 15 

CLERK 

STAFF ASSISTANT, TO AOG 31 

ADMINISTRATIVE ASSISTANT 

DISTRICT SECRETARY 

INTERN - STAFF ASSISTANT, TO AOG 31 
CLERK 

STAFF ASSISTANT, TO AOG 31 

LEJ CONGRESSIONAL INTERN, TO JUL 15 
STAFF ASSISTANT, TO AOG 31 



,216.67 
,277.77 
,025.88 
,180.00 
,012.50 
,208.33 
,389.80 
,180.00 
,940.84 
,389.80 
,180.00 
295.00 
,180.00 
,024.88 
,010.25 



OFFICE OF HON. JOEL PRITCHARE 



ALBERTSON.BARJOHIE S 
BROWN, WILLIAB N. 
BONCE, LINDA F 
CANTO, DAVID 0. 
COE, STANLEY B. 
COHEN, ERLE S 
DAVIDSON, ROBERT W 
DOBRES.HABY LOU 
ELBERT, CARLA M. 
FLOWER, JOHN J 
GOLD, LESLIE J. 

HAUSHEER, MAURICE GREYDON 

HORGAN, CHARLES 
MORRIS, ISLA W 
PACKO,JEAN L 
SMITH, WENDELIN J 
STONE, HERBERT S 
TIPPETT, PATRICIA LEE 



STAFF ASSISTANT 3,233.34 

SENIOR INTERN - DISTRICT OFFICE 600.00 

CASEWORKER 3,000.00 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

COMMUNITY INTERN, TO JUL 31 100.00 

LEGISLATIVE ASSISTANT, TO AUG 31 2,083.34 

ADMINISTRATIVE ASSISTANT 10,450.00 

EXECUTIVE SECRETARY 3,958.33 

DISTRICT OFFICE INTERN 1,266.66 

STAFF ASSISTANT 3,449.99 

SUMMER INTERN, TO JUL 31 

STAFF RESEARCHER, FROM SEP 1 833.33 

STAFF ASSISTANT, TO JUL 31 

LEGISLATIVE ASSISTANT, FROB AUG 5 8,500.00 

INTERN, FROB SEP 19 400.00 

DISTRICT REPRESENTATIVE 3,000.00 

DISTRICT OFFICE BANAGER 6,375.00 

STAFF ASSISTANT 3,249.99 

STAFF ASSISTANT 10,625.01 

RECEPTIONIST . .' 1,833.33 



127 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. CAEL D PORSELL 



FLORA, STEPHANIE R 
GREENE, CONSTANCE 
HAOENSTEIN, THOMAS E 
HODGINS, CYNTHIA H 
KERANS, WILLIAM S 
KRETZSCH MAR, ALISON 
MANN, MARTIN D. 
NCERIDE, WILLIAM B 
NIRIDER,NANCY L 
0<CONNOR,CHERI LYNN 
BADTKE,DENISE 
SEHPLE, PATRICIA H 
SKEEL, SYLVIA 
STRATON,HARK C. 
SWIES, DIANE MARIE 
VASLO, FRANK 
VOZOBDLE, PATRICIA 
WEBBER, ROBERT J,JB 



STAFF ASSISTANT, FBOH SEP 1 * 600.00 

CONSTITUENT SERVICES REP 2,750.01 

STAFF ASSISTANT 1,200.00 

FIELD REPRESENTATIVE 3,500.01 

NEWS SECBETARY 8,1)99.99 

RECEPTIONIST 2,250.00 

LBJ CCNGEESSIONAL INTERN, TO JUL 31 590.00 

SPECIAL ASSISTANT 5,000.01 

STAFF ASSISTANT 3,000.00 

CCCBDINATOB 2,625.00 

FIELD BEPBESENTATIVE 3,750.00 

APPOINTMENTS SECBETABY 3,843.75 

CCNSTITOENT SEBVICES SEP 3,500.01 

STAFF ASSISTANT, TO ADG 31 1,333.34 

LEGISLATIVE ASSISTANT 3,750.00 

SPECIAL ASSISTANT 3,750.00 

C0NSTI10ENT SEBVICES REP 1,749.99 

AtMINISTRATIVE ASSISTANT 9,000.00 



OFFICE OF HON. J DANFORTH QUAYLE 



ANGEL, HARK A. 
BOYLE, DANIEL L. 
COATS, DANIEL R 
DAOOLAS, WILLIAM ABTHUB 
DUTCHER, CHARLES K 
FERNEAU, CYNTHIA LOVE 
FBOECHTENICHT,BARBABA C 
HOPPE, KAREN DAVIS 
LAGUNA, STELLA LOPEZ 
HCCAnLAY,JANET OLOFSON 
MORAN, BARBARA E 
NOVITSKY,LESLIE J 
RANDOLPH, B SEAN 
ROSEN, LESTEH L 
SAYER,HARCIA 
SHOPPY, HELEN E 
SMETHILLS.SUE ANNE 
STARKE, BEVEBLEIGH ANN 
SBEET, STOAET 
T0EBFF,HABION 
WITWER,VIOLETTE 



LBJ CONGBESSIONAL INTEBN, TO AOG 12 .., 

ACCOUNTANT, TO JUL 31 

DISTRICT BEPBESENTATIVE , 

CLEBK, TO JUL 31 

STAFF ASSISTANT 

PERSONAL SECRETARY 

PUBLIC AFFAIRS OFFICER 

LEGISLATIVE ASSISTANT 

RECEPTION IST-SECEETABY , 

CASEWORKER (DIST) 

SECBETABY 

RESEARCH AIDE, FBOH SEP 1 , 

STAFF ASSISTANT, FBOH AUG 1 TO AUG 31 

AEMINISTBATIVE ASSISTANT 

CASEWORKEB/LEG COBRES , 

EECEPT-SECTY/DIST OFFICE 

LEGISLATIVE COEBESPONDENT , 

CASEWORKER 

RESEARCH ASSISTANT 

PRESS SECBETABY , 

CLEBK-INTEEN, TO JUL 31 



700.00 
500.00 
,250.01 
400.00 
,300.00 
,299.99 
,750.00 
,750.00 
,750.01 
,600.01 
,100.00 
320.00 
500.00 
,000.00 
,425.01 
,274.99 
,750.01 
,066.67 
708.33 
,624.99 
,000.00 



OFFICE OF HON. ALBERT H QUIE 



ADAHS.SANDBA PICKENS 
BBADLEY.HABY C 
CHICOS,TEEESA H 
FETTE, EVELYN M 
HALL, KEITH E. 
JOHNSON, CABOL 
JOHNSON, BOGEB K 
KOEHPEL, MICHAEL LEE 
KBAHEB, CECELIA 
MCDONALD, BEBECCA H 
MINES, DARCY 
NAEUTA,ANNE P 
OTTMANN,ANNE MARIE 
REYLEK,KATHY B 
ROWE, JAMES J 
RUNNIN GEN, ROGER 
SKAAR,HABNA H. 



SECBETABY 2,625.00 

EXECUTIVE SECRETARY 4,062.51 

CONGRESSIONAL INTEBN, FBOH JUL 18 TO SEP 17 . . . 1,180.00 

DISTBICT OFFICE SECBETABY 3,375.00 

AEHINISTBATIVE ASSISTANT 9,975.00 

SECBETABY 4,374.99 

DISTRICT BEPRESENTATIVE 5,707.14 

LEGISLATIVE ASSISTANT 4,800.00 

SECRETARY 2,916.90 

CLERK 3,225.00 

CLERK 3,000.00 

CASEWOBKEE 4,562.49 

DIST OFF SECTY 3,312.51 

INTEBN, FBOH SEP 12 253.33 

CLFEK 2,790.00 

RESEARCH ASSISTANT 4,287.51 

LBJ CONGRESSIONAL INTEBN, TO JUL 31 590.00 



OFFICE OF HON. JAMES H QUILLEN 



BEAVER, HATILDA B. 
CUBBIE,FBANCES LIGHT 
DUNN, KATHLEEN SUE 
GBAZULIS, BARBARA E 
HOOVEB, BOGEB C 
LLOYD, S CABOLYN 
MASTEBS, BEBECCA C 
HILLER.JAHES EHILUS 
HONTGOHERY, DEBORAH C 
NORTON, DIANNE N 



SECBETABY 

ADHINISTBATIVE ASSISTANT .... 

SECBETABY, FBOH SEP 30 

SECBETABY, FBOH SEP 12 

PRESS REPRESENTATIVE 

SECRETARY 

PRESS SECBETABY, FBOH SEP 1 

FIELD REPRESENTATIVE 

SECBETARY 

SECBETABY 



,916.66 
,394.86 
34.72 
686. 11 
,164.55 
,228.94 
,458.33 
,249.99 
,149.02 
,688.02 



128 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OP HON. JAHES H QOILLEN -CONTINUED 



OLTERHAN, THOMAS W 
RILEY, IDA J 
SANCHEZ, ROBIN DAWN 

SHAFFER, LOUISE ANN 
SHEFFER, CAROL J 
TURNER, NANCY B 
VAOGHN, BETTY S 
WEBB, ANNA CHARLOTTE 
WHETSELL, POLLY DEANE 
WHITE, JOSEPH CLONINGEB 
WOOTEN,JANE CAROLINE 
ZARECOR.SOE ELLEN 



ASSISTANT FIELD REPRESENTATIVE $ 3,000.00 

EXECUTIVE SECRETARY 3,513.42 

SECRETARY, FROH AUG 10 

LBJ CONGRESSIONAL INTERN, TO AUG 9 2,254.50 

SECRETARY 2,124.99 

CASE WORKER., TO JOL 7 254.80 

SECRETARY, TO JOL 12 383.33 

SECRETARY 2,149.02 

SECRETARY 3,125.01 

SECRETARY 2,228. 94 

CLERK, FBOH AOG 1 TO AUG 31 500.00 

SECRETARY 3,624.99 

SECRETARY 2,935.23 



OFFICE OF HON. NICK JOE RAHALL II 



ALTIZER, EUNICE HARJORIE 
BONE, JANE E 
BOOTHE, ELAINE 
BROOKS III,LAWSON W 
BUSTO, FELICE E 
GONZALEZ, BETTY JEAN 
HENSLEY, TIMOTHY R 
KEYSEB, TIMOTHY KENT 
KUNKEL,JOAN B 
KUNKEL,JOHN A 
LA W.RUTH 

NICOLLS.ANNE STUART 
NOAH, J P 
PICKENS, WILHELH 
RIGGS, DAVID 
SCHNURR,t1ARY LYNN 
SERPE, MICHAEL E 
THORNHILL, LUCILLE W 
TOLER,DONA JEAN 
WEST,ALHA CHRISTINE 



COMMUNITY RELATIONS ASST 

CASEWORKER 

LEGISLATIVE CORRESPONDENT 

COMPUTER SPECIALIST 

STAFF ASSISTANT, FROM JUL 16 TO SEP 15 

FEEERAL PROJECTS ASST 

DISTRICT REPRESENTATIVE 

STAFF ASSISTANT, TO JUL 15 ....{. 

EXJC SECY 6 OFF MANAGES 

COMPUTER OPERATOR, FROH AUG 1 

SECRETARY 

CASE WORKER 

LEGISLATIVE RESEARCH ASSISTANT 

LEGISLATIVE ASSISTANT 

DISTRICT REPRESENTATIVE 

LEGISLATIVE CORRESPONDENT 

ADMINISTRATIVE ASSISTANT 

DISTRICT PROJECTS ASST 

OFFICE MANAGER, FROH SEP 16 

COMMUNITY RELATIONS ASST 



625.00 
133. 3U 
499.99 
499.99 
262.50 
225.01 
833.33 
500.00 
591 .67 
125.00 
749.99 
708.33 
624.99 
100.00 
258.34 
625.00 
649.99 
625.00 
641.67 
625.00 



OFFICE OF HON. TOM RAILSBACK 



BJERKE.HARY LYNN 
BORTH, ROBERT T 
CORWIN,DARLENE FAY 
EDWARDS, SUSANNE L 
FRISK, MILDRED D 
GALLAGHER, FLORENCE H 
HALW AX, JENNIFER 
HEWITT, ANNA D 
KALAHAR, PATRICIA ANN 
LA HOOD, RAY H 
LOMAX, WILLIAM L 
MAHSMAN, DAVID 
MOERSCHEL,THELMA W 
MURPHY, JOHN H. 
PRATT, PAULA L. 
STEPHENSON, LINDA G 
STREETER, CAROLYN A 
SYFERT, KEITH C 
UNDERWOOD, KAREN L 
WENZEL.RAELENE 
WICHSER, PATRICIA ANN 
YAGER, BRENDA LEE 



SECRETARY 

SPECIAL ASSISTANT, FROM AUG 1 TO AUG 31 

SECRETARY 

CASEWORKER, TO SEP 6 

SECRETARY 

LEGISLATIVE ASSISTANT, TO AUG 31 

RESEARCH ASSISTANT 

CASEWORKER, FROM SEP 6 

RECEPTIONIST 

DISTRICT REPRESENTATIVE 

SPECIAL ASSISTANT 

PRESS ASSISTANT 

SECRETARY 

SUMMER INTERN, TO JUL 31 

LBJ CONGRESSIONAL INTERN, JUL 5 - AUG <l 

EXICUTIVE ASSISTANT 

SECRETARY 

LEGISLATIVE ASSISTANT, FROH SEP 1 

RECEPTIONIST 

APPOINTMENT SECRETARY 

EXECUTIVE ASSISTANT 

RESEARCH ASSISTANT 



,874.99 
500.00 
,443.67 
,306.26 
,852.51 
,295.78 
,750.01 
625.00 
,250.00 
,750.01 
,096.61 
.000.01 
,036.93 
590.00 
590.00 
,750.01 
,250.00 
,666.67 
,250.00 
,125.01 
,750.01 
,013.86 



OFFICE OF HON. CHARLES B RANGEL 



BAKER, MICHAEL REUBEN 
BARNES, BENNIE M 
BECKETT, ALBERT 
BELLAMY, JAHES J 
BODDEN,MARK LELAND 
BONET.LUZ 

BRADLEY, PATRICIA 0. 
GIBSON, CLINTON S R,JR 
JEREZ, DENISE H 
JONES, CHERYL L 
JONES, VIVIAN E 



STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT, FROM SEP 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT, TO AUG 31 

STAFF ASSISTANT 

EXECUTIVI SECRETARY 



,207.39 
,876.79 

892.57 
,751.78 
,915.00 
,499.99 

999.99 

650.00 
,333.34 

207.39 
,749.99 



129 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HOB. CHABLES B RANGEL -CCNTINUED 



KARDEHAN,RITA 
KELLY, JOHN 
HCRAE, ERNESTINE 
NIGRO, ANNA 
SIGNER, WILLIAM A 
S«YGERT,BRENDA K 
VAZQUEZ, JULIO 
MILLIAHS, NANCY JEAN 



STAFF ASSISTANT $ 3,750.00 

STAFF ASSISTANT 2,l»99.99 

STAFF ASSISTANT 2,751.78 

STAFF ASSISTANT 1,499.98 

LEGISLATIVE ASSISTANT 3,750.00 

STAFF ASSISTANT 3,219.99 

STAFF ASSISTANT 3,750.00 

STAFF ASSISTANT 2,750.01 



OFFICE OF HON. RALPH S BEGULA 



BALDWIN, HARTIN JOSEPH 
BENNETT, PATRICIA A 
BORNEY, TERESA L 
DONAHUE, KATHY 
EHRINGHAOS, PEGGY C 
FABNSBOBTH,EVA H 
FISHER, LINDA J 
GRIFFIN, JEANNETTE H 
ICEANE, HELENA 
KOCH,HAXINE E 
MURPHY, GRACE ANN 
NICHOLS, ILA LOUISE 
OELSLAGEB.H SCOTT 
PBENDEBGAST,HILLIAH B. ,JH. 
SAVILLE, RUSSELL P 
SIHPSON, ALLAN B,JB 
STUTZ,SAHUEL B 
SBEABINGEN, CYNTHIA SUE 
THOMPSON, MICHAEL J. 



PRINTING CLERK, TO AUG 31 

CASEWORKER 

STAFF ASSISTANT, FBOH AUG 1 TO AUG 31 

LEGISLATIVE CORRESPONDENT 

SECRETARY 

SECBETABY-DISTBICT OFFICE 

STAFF ASSISTANT-1EGIS SECTY 

EXIC SECTY-DISTBICT 

SECRETARY 

PERSONAL SECRETARY 

SECRETARY 

SECRETARY-DISTRICT OFFICE 

INFOBHATICN ASST-DISTRICT 

AEHINISTBATIV2 ASSISTANT 

CLERK 

CCMHONICATIONS DIRECTOR 

AEHIN ASST-DIST OFFICE 

SECRETARY, TO JUL 31 

LEJ CCNGBESSIONAL INTERN, TO JUL 31 ... 



583. 34 
500.01 
500.00 
125.01 
376. 64 
817.05 
51*9.99 
725.01 
499.99 
975.00 
095.25 
625.00 
874.99 
249.99 
886. 9U 
800.00 
399.99 
700.00 
590.00 



OFFICE OF HON. HENRY S REUSS 



BEGUELIN, ROBERT DAYTON 
BLUHEHFIELD.BABBABA SUE 
BRADY, NICHAEL 
BUECHNEB, JUDITH A 
CHESBOBN,SANDI ANNE 

DEBUS, LYDIA 
ENRICH, VIVIAN L 
FRANCES, SUSAH 
GBISHAH,ALEASE V 
HANSEN, LAUBIE ELLEN 
HARRIS, TOBY 
LAMB,SUZANN 

MCCARTHY, MARGARET F 
HDRBELL.SEDINA YVONNE 
NELSON, ELLEN KATE 
SISK, JOSEPH H 
SYKES, RICHARD K 
SYLVESTER, ROSH ANN A 
TEHAN, ROBERT E,JB 
THALEB, LINDA BUTH 
BHEELEB.LYNNETTE L. 



STAFF ASSISTANT, FBOH JUL 16 TO AUG 31 1,416.66 

FIELD REPRESENTATIVE 2,625.00 

STAFF ASSISTANT 2,875.00 

PEBSONAL SECRETARY 5,603.42 

SECRETARY, TO AUG 31 

ASSISTANT PRESS AIDE, FROH SEP 1 2,583.33 

SECRETARY 2,499.99 

SECRETARY 1,858.33 

CASEWORKER 3,371.99 

CASEWORKER 4,583.34 

STAFF ASSISTANT, FBOH SEP 1 800.00 

FIELD BEPBESENTATIVE 2,750.01 

APEOINTHINT SECBETABY, TO JUL 31 

LEGISLATIVE AIDE, FROH AUG 1 3,541.66 

OFFICE MANAGER 5,490.50 

SECBETABY 2,174.99 

RECEPTIONIST 2,750.01 

LEGISLATIVE ASSISTANT 5,814.50 

FULL REPRESENTATIVE 5,534.34 

STAFF ASSISTANT, TO JUL 15 295.00 

DISTRICT OFFICE SECRETARY 825.00 

SECBETABY , 2,958.33 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 



OFFICE OF HON. JOHN J RHODES 



ANDEBSON, CATHY J 
BURNETT, SHELLI G 
COLLE.CARL H 
CORONADO, CAROLINE 
DANNENHAUEB,PITA A 
DECENZO,BITA H. 
FELTHAH, JAMES R 
HARTHANN, ROBERT T 
HAYES, PETER MADISON 
JOHNSTON, CAROLYN J 
LASSEN, LESILYN E 
LEHON, JANET J 
MOORE, CARNELLA J. 
HASHUSSEN, SHARON L 
SCANLAN.ROBEBT J 
SHELL, GORDON H. 



PBCCUCTION ASSISTANT, FROM AUG 9 

RECEPTIONIST, TO AUG 22 

CASEWORKER, FROM SEP 1 

SECRETARY 

SECRETARY 

RESEARCH ASSISTANT 

ADMINISTRATIVE ASSISTANT 

CONSULTANT 

LEGISLATIVE ASSISTANT 

SECBETABY 

SECRETABY, FROM SEP 19 

SECRETARY 

CASEWORKER, TO JUL 22 

CASEBORKEB, FROH AUG 22 

DISTRICT REPRESENTATIVE 

CLERK, TO JUL 31 



,155.56 
,444.44 

200.00 
,366.66 
,412.12 
,500.00 
,500.00 
,500.00 
,750.00 
,306.01 

280.00 
,740.00 

513.33 
,040.00 
,500.00 

666.67 



130 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. JOBN J RHODES -CONTINOED 



STEWART, ANN CECELIA 
THOHAS, NANCY 
WYMORE, JAMES F 



SECRETARY S 3,500.01 

SECRETARY, TO AUG 31 1,200.00 

DISTRICT REPRESENTATIVE, TO JUL 31 2,083.33 



OFFICE OF HON. FREDERICK B RICHMOND 



BERMAN, JUDITH A 
DAVIDSON.FRAZIEBITA 
DENAVE,SALVATORE 
GftLLO,JOHN N 
GORDON, LOOIS D 
GRIFFITH, DONALD L. 
HOCHSTEIN,ERIC 
KOENIG, KAREN S 
LAVIOLETTE, LINDA ANN 
LOTT, PATRICIA D 
MCVICKER, DEBORAH S 
MICHAELSON, BRADLEY IAN 
MIZGALSKI, ALFRED T 
MOW, LAURA 
NACHMAN, BEVERLY A 
NEWFIELD, EDNA H 
NICKELSBERG, BARRY 
STEIN, RICHARD M 
THOMPSON, WILLIAM C,JR 
SYMAN, TIMOTHY E 



RECEPTIONIST 

RESEARCH ASSISTANT 

SPECIAL ASSISTANT 

PRESS SECRETARY 

ASSISTANT PRESS SECTY 

TC JUL 31 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

FROM AUG 1 

SECRETARY 

PERSONAL SECRETARY 

LEGISLATIVE ASSISTANT 

TO JUL 31 

CLERK 

EXECUTIVE ASSISTANT 

SPECIAL ASST FOR ARTS 6 EDUC 

CASEWORKER 

AEMINISTRATIVE ASSISTANT 



1*99.99 
500.01 
362.50 
300.00 
410.00 
675.01 
225.00 
590.00 
333.34 
190.74 
500.01 
250.01 
134.51 
466.67 
208.33 
077.49 
250.01 
500.01 
500.01 
4 99.9 9 



OFFICE OF HON. MATTHEW J RINA1EC 



CAVANAUGH, DOROTHY K 
COOK, DOROTHY W 
DELAZARO, ROBERT D 
DUKES, HOMER F 
DOSTOW, CHARLES L 
GOORIN, KENNETH 
GROSHANS, MARIS 
LEWIS, PAUL M 
HARCELA.PAUL A 
MAUS, LOUISE 
PETERSON, SUSAN JANE 
RAUBA, JEANETTE M 
REDFIELD, REUBEN fi 
SCHARF.ELYSA L 
SCHELLHARDT, DONALD J 
SCHLEGEL,PAUL 
SHALL, MARY JANE 

SZYMANSKI, HEIDI M 
TOAS, CLAIRE 
VANDUYNE, HARRIET L J 
VYNER, PATRICIA H 
WHEELER, CAROL L 
WICKHAH,MARJORIE A 
WOLIN, ALFRED H 



AEMINISTRATIVE SECRETARY 

RECEPTIONIST, FROM SEP 26 

SPECIAL ASSISTANT 

FIELD REPRESENTATIVE 

PRESS SECRETARY 

INTERN, fBOH AUG 1 TO AUG 31 

INTERN, FROM SEP 20 

INTERN, PROM JUL 5 TO JUL 31 

LBJ CCNGBESSIONAL INTERN, AUG 1 - AUG 31 

CASEWORKER 

PERSONAL SECRETARY, TO SEP 28 

OFFICE MANAGER 

ACCOUNTANT 

INTERN, FROM AUG 1 

LEGISLATIVE COUNSEL, TO AUG 13 

ADMINISTRATIVE ASSISTANT 

CASEWORKER, FROM JUL 5 TO JUL 22 

CASEWORKER, FBOH AUG 1 TO AUG 31 

LEJ CONGRESSIONAL INTERN, JUL 5 - JUL 31 

DISTRICT OFFICE SECRETARY 

APPOINTMENTS SECRETARY, TO JUL 31 

RESEARCH ASSISTANT, FROM JUL 11 , 

STAFF ASSISTANT 

LEGISLATIVE ASSISTANT 

FIELD REPRESENTATIVE 



,499.99 
166.67 
,500.01 
450.00 
,000.00 
590.00 
58.67 
511.33 
590.00 
,187.49 
,300.00 
,000.00 
650.01 
824.67 
,911.11 
,499.99 

,733.33 
511.33 
,750.01 
,625.00 
,888.88 
,050.00 
,849.99 
450.00 



OFFICE OF HON. TED RISENHOOVER 



BENEFIELD.JACK 
BLAKE, MICHAEL E 

BORTHICK, JAMES A 
BURCHETTE,BETTYE 
CARTER, JOSEPH H 
DAVIS, PATSY JUNE 
FORKUM, AARON RONNIE 
FORKUH,RONDA L 
GAY, SANDRA K 
HAYNES,DELORES S. 
KALIL, JOSEPH FRANCIS 

LOOPER,FELDA K 
PITCHER, GREGORY P 
PLOTKIN, ELAINE M 
ROGERS, NORMAN L 
SMITH, LOERANZO D 



STAFF ASSISTANT 

FIELD DEPUTY, TO JUL 31 

STAFF ASSISTANT, FROM AUG 1 .. 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT 

ADMINISTRATIVE ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT, TO JUL 31 .... 

STAFF ASSISTANT 

STAFF ASSISTANT 

FIELD DEPUTY, TO JUL 31 

STAFF ASSISTANT, FROM AUG 1 .. 
STAFF ASSISTANT, FROM SEP 1 .. 

FIBLD DEPUTY, TO JUL 31 

APPOINTMENTS SECRETARY 

STAFF ASSISTANT 

STAFF DIRECTOR/PRESS SECRETARY 



966.66 

795.04 
,550.01 

900.00 
,875.00 
,299.99 
,000.00 
,700.00 

416.67 

,449.99 
583.33 
433.33 
,745.04 
,299.99 
,103.33 



131 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. TED RISENHOOVER -CONTINUED 



STEARNS, CAMILLE LOUISE 
TENNISON,JOHN C 

WILLIS, WILLIAM P,JR 



STAFF ASSISTANT, TO AUG 31 S 325.00 

STAFF ASSISTANT 7,500.00 

STAFF ASSISTANT 1,299.99 



OFFICE OF RON. RAY ROBERTS 

ALLEN, ELRY T,JR 
BOYER, LINDA A 
CARR, HAROLD R 
DENYES, SALLY LYNN 
FARNSBORTH, JANICE C 
GLOVER, MARTHA ANN 
HARDIN, JOHN CHARLES 
HOGHEY,GAYLOED T,JB 
JENKINS, YVONNE A 
HCCALEB,NARJORIE B. 
HEYER,KATHY M 
OLSEN, MARTHA L 
RICHARDSON, JEAN ANN 
STIFEL, STEPHANIE E. 
THOHPSON,PRISCILL» B. 
DARREN, GRACE E 
WILD,NADINE K. 



CLERK 

PRESS SECRETARY 

CLERK 

SECRETARY 

SECRETARY 

CLERK 

RESEARCH ASSISTANT 

LEGAL ASSISTANT, FROH SEP 1 

STAFF ASSISTANT 

CLERK 

CLERK 

SECRETARY 

CLERK 

CLERK, TO AUG 31 

CLERK 

SECRETARY 

SECRETARY 



,165.92 
,538.02 
,1H6.U1 
,750.01 
,500.00 
,883.35 
,125.00 
,500.00 
,250.00 
,468.09 
,250.00 
,075.01 
,975.01 
,200.00 
,500.00 
,081.26 
,599.99 



OFFICE OF HON. J KENNETH ROBINSON 



BEAN, MATILDA C 
BREHGLE, FRANCES L 
BOBKHOLDER, BETTY B 
CROBSON, FRANCES ELIZABETH 
DANIEL, BARBARA NOEL 
DINGHAN, RICHARD B 
FLEISHMAN, FLORENCE GATES 
GIBSON, NANCY L 
HILDEBRANDT, PAULINE J. 
HOBGOOD, JAMES L 
HUTCHINSON, HARVEY E 
LOVELESS, SCOTT B 
MARTIN, MARY RUTH 
MATHIS EN, CHRIS 
MESSICK, YVONNE K 
MURPHY, KENNETH R 
OLSEN, EVELYN F 
RUST, PAMELA D 
SIPE, JAMES R..JR 
BADDELL,ANN G. 
BILSON, PATRICIA A 



STAFF ASSISTANT 3,871.23 

SECRETARY 1,158.45 

STAFF ASSISTANT 3,275.94 

SECRETARY 1,500.00 

STAFF ASSISTANT 3,390.00 

RESEARCH ASSISTANT 1,800.00 

STAFF ASSISTANT 1,725.00 

STAFF ASSISTANT, FROH SEP 6 729.17 

SECRETARY, TO JUL 31 905.00 

STAFF ASSISTANT 4,385.01 

STAFF ASSISTANT 4,958.85 

SR STAFF ASST 5,175.99 

STAFF INTERN, FROH AUG 1 TO AUG 31 590.00 

ADMINISTRATIVE ASSISTANT 11,874.99 

STAFF ASSISTANT 3,538.02 

STAFF ASSISTANT, FROM SEP 1 500.00 

STAFF ASSISTANT 4,125.00 

STAFF ASSISTANT 3,515.35 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

STAFF ASSISTANT, TO JUL 31 590.00 

SECRETARY 2,715.00 



OFFICE OF HON. PETER B RODINO JR 



ADAMS, BURNEY LEE 
BOYD, THOMAS S,JR 
BROOKS, LILLIAN A 

BULLOCK, HACEY 
DENEV,EVA J 
DISALVO,0 JOHN 
FOGARTY,JOHN P 
SAENZA, ANDREA T 
HORAN, PETER 
POLS, BARBARA JANE 
ROSSONELLO,JOHN 
RYAN, KATHLEEN LOUISE 
STANGO, MARGARET A 
SURIANO, ANTHONY M 
TAYLOR, EMMA JANE 
THOMPSON, CAROLE LYNN 
TURNER, MARY ANN 

BEAVER, GARY H 



FIELD REPRESENTATIVE 

ADMINISTRATIVE ASSISTANT 

RECEPTIONIST, TO AUG 31 

APPOINTMENTS SECRETARY, FROM SEP 5 

FIELE REPRESENTATIVE 

LEGISLATIVE AIDE 

CLERK FIELD REP 

DATA PROCESSING ASSISTANT, FROM SEP 15 .. 

CLERK 

DISTRICT STAFF ASSISTANT, FROM SEP 1 ... 

PERSONAL SECRETARY 

PRESS SECRETARY 

SECRETARY 

DISTRICT SECRETARY 

COMPUTER OPERATOR, FROM JUL 9 TO AUG 29 

CLERK 

CASEBORKER, TO JUL 31 

CASEBORKEB, FROH AUG 5 

RESEARCH ASSISTANT 



,089.35 
,500.00 

,249.99 
754.53 
,250.00 
,306.02 
644.44 
,000.00 
,041.67 
,999.99 
,937.51 
,937.51 
,911.37 
,749.99 
,558.33 
,175.00 

,083.33 
,312.51 



132 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. ROBERT A HOE 

BASTOB, JANET LYNN 
BLAKE, PETER J,JR 
BORKE, WILLIAM V 
CARROLL, GWENDOLYN D. 
CASALE, MICHAEL 
CROWLEY, EVELYN 
DEROSA, ANGELA 
FERGDSON, SANDRA J 
GURISIC, GRACE A 
ITALIANO, THERESA L 
JOHNSON, GLENN D 
KAOFHAN, JULES P. 
HAHONY,JANE E. 
HANDELL,MONA 
HABAZZO,KATHRYN H 
MESSINEO, MARIANNE E 
NICKINSON,MERRITT LEE 
ORTIZ, VIRGINIA CLAIRE 
SILVER, THEODORE J 
WENTZ.OLGA S 



SECRETARIAL ASSISTANT $ 2,499.99 

RESEARCH ASSISTANT 6,950.01 

SPECIAL ASSISTANT 4, 010. 01 

CONGRESSIONAL INTERN, FROM AUG 1 TO ADG 31 ... 500.00 

SPECIAL ASSISTANT 3,474.99 

SECTY ASST 2,124.99 

SECRETARY 4,958.33 

SECRETARIAL ASSISTANT 2,797.50 

SPECIAL ASSISTANT 4,925.83 

SECRETARIAL ASSISTANT, TO AUG 31 1,000.00 

LEGISLATIVE ASSISTANT 4,277.49 

CONGRESSIONAL INTERN, TO JUL 31 500.00 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

CLERK 1,625.01 

ADMINISTRATIVE ASSISTANT 9,225.01 

SECRETARIAL ASSISTANT 2,499.99 

SECRETARIAL ASSISTANT 2,000.01 

SECRETARIAL ASSISTANT 3,367.50 

LEGISLATIVE AIDE 1,605.00 

SECRETARY 4,242.75 



OFFICE OF HON. PAUL G ROGERS 



BROWN, BARBARA 
BROWN, HARGARET A 
COLLINS, PAULINE V 
COOPER, SHARON D 
EDGE, HELEN H 
GLTDDEN, ROXANNE 
HENDRIX, LINDA C 
JOHNSON, CATHARINE L 
KING,W. CLAY 
KINNEY, JANE H 
LEPESKA, RICHARD G 
MICA, DANIEL A 
MORRIS, THOMAS W 
NEWMAN, CONSTANCE J. 
OCCNNELL, MAUREEN ANN 
ORE, ROBERT M,JR 
PRUDDEN,JEPFREY P. 
REED, CAROL D 
SIPKOV, MARGARET N 
STARKEY,BETTE A 
STUBER, JAMES A 
WOOD.KATHY SUE 



SECRETARY 2,333.34 

SECRETARY, FROM AUG 8 TO SEP 1 400.00 

SECRETARY 2,999.07 

SECRETARY 2,400.00 

SECRETARY 3,345.84 

SECRETARY 2,433.33 

DIST OFF SECTY, TO JUL 31 566.67 

SECRETARY 2,772.91 

ASSISTANT, TO JUL 8 133.33 

SECRETARY 3,468.60 

ADMINISTRATIVE ASSISTANT 6,768.29 

ADMINISTRATIVE ASSISTANT 8,009.56 

ASSISTANT, FROM SEP 6 500.00 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

SECRETARY 2,299.59 

ASSISTANT 3,077.08 

ASSISTANT, FROM JUL 11 TO ADG 5 416.66 

SECRETARY 5,830.09 

SECRETARY 2,250.00 

SECRETARY 4,321.44 

LEGISLATIVE ASSISTANT 4,591.66 

SECRETARY 3,201.46 



OFFICE OF HON. TENO RONCALIO 



ARCHULETA, R H JULIE 

CHESLEY, FRANCIS 

COHEN, BRENT R. 
COOK, MARY MEYER 

EARHART, DENNIS JAY 
FREDERICK, RICHARD E 
HALL, INEZ N 
HUIZENGA,JACK W 
JOHNSTON, LAWRENCE G 
MCDANIEL, RODGER E 

MEYER, FRANCES C 
MONTGOMERY, ADAIR F 

SPRAGU E.CHARLES 
STREEPER .BETTY 
SULLIVAN, ROSEMARY 

VINICH, MICHELLE M 
WALSER, LINDA GENE 
WHITE, KATHRYN ANN 



RESEARCH ASSISTANT, TO AUG 31 

LEGISLATIVE ASSISTANT, FROM SEP 1 . 

INTERN, FROM AUG 1 TO ADG 31 

RESEARCH ASSISTANT, FROM SEP 1 .... 
LBJ CONGRESSIONAL INTERN, TO ADG 5 
PERSONAL SECTY TO HC , TO JOL 31 .... 
EXECUTIVE SECRETARY, FROM AUG 1 ... 

ADMINISTRATIVE ASSISTANT 

FIELD REPRESENTATIVE 

SECRETAR Y 

PRESS SECRETARY 

FIELD REPRESENTATIVE 

DISTRICT ASSISTANT, TO AUG 31 

WYOMING REPRESENTATIVE, FROM SEP 1 

CLERK TYPIST 

STAFF ASSISTANT, TO AUG 31 

RESEARCH ASSISTANT, FROM SEP 1 .... 

RESEARCH ASSISTANT 

FIELE OFFICE SECRETARY 

OFFICE ASSISTANT, TO ADG 31 

CASEWORKER, FROM SEP 1 

STAFF ASSISTANT 

RESEARCH ASSISTANT 

RESEARCE ASSISTANT 



,983.34 
688.33 

,950.01 
,579.74 
,000.00 
,000.01 
,750.01 
,307.50 

,250.00 
,750.01 

458.34 
750.01 
349.99 

500.00 
458.34 
849.99 
249.99 



133 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 

JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. FRED B ROONEY 

ANTIGA.REGINA CLFRK $ 1,651.08 

BANKO,MARY ELLEN LEJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

BAURKOT, SUSAN G 5,000.01 

BREWER, JUDITH M 3,023.13 

GILBERT, VIRGINIA E LEGISLATIVE AIDE 2,199.99 

GODFREY, DIANE A 3,569.28 

GO (IB OS I, LOUIS 5,060.9a 

HAGAN, WILLIAM, II STAFF ASSISTANT, FROM AUG 6 TO AUG 31 1,631.91 

HIGGINS, SALLY ANN CLFRK HIRE 3,277.62 

HILL.VICKI ANN TO JUL 31 

CLERK, FROM AUG 5 3,023.13 

HUBER,RAY A 10,183.71 

JENSEN, FINN B FRCH SEP 1 500.00 

KEFALAS, DOLORES C 3,788. 91 

LONG, GERALD TO AUG 5 583.33 

MCKIE,MARY CLERK 2,861.25 

HULLINS, TERRY TO AUG 5 583.33 

NOIL, MARGUERITE D 7,500.00 

PASCAL, JILL LEGISLATIVE ASSISTANT 4,500.00 

SCHBARTS,ELI FRCH SEP 1 500.00 

SHIPMAN,MELLICK TO AUG 5 583.33 

THOMPSON, CHARLES K. TO AUG 5 583.33 

YORI.ANN MARIE 2,721.99 

OFFICE OF HON. CHARLES ROSE 

BARNES, KNOX MEREDITH STAFF ASSISTANT 1,719.99 

BONEY.ZNNETT H B LEJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

BRICKELL, MARION OFF HGR-EXEC SECRETARY 6,825.00 

BRICKELL, RUSSELL L STAFF ASSISTANT 2,000.01 

CAMERON, CHARLOTTE A LBJ CONGRESSIONAL INTERN, AUG 1 - AUG 31 590.00 

COLLINS, NORVIN H,JR ADMINISTRATIVE ASSISTANT 6,375.00 

COZEAN,JON D STAPF ASSISTANT, FROM AUG 1 816.33 

DESHIELDS, CHERRY W STAFF ASSISTANT 1,719.99 

DICKEY, GLORIA JEAN STAFF ASSISTANT 3,000.00 

DUNN, LYNN BODE STAFF ASSISTANT 2,199.99 

FORBES, CAROL JEAN CCUNS EL-BUR AL CAUCUS 2,133.75 

GADZUK, MARILYN S STAFF ASSISTANT 1,500.00 

HAGGERTY,JEFFERY J. STAFF ASSISTANT, TO SEP 15 2,252.50 

HARRINGTON, S REBECCA STAFF ASSISTANT 1,749.99 

KASTENS, ROYAL FREDERICK, JR. STAFF ASSISTANT 3,500.01 

KNIGHT, CATHARIN STAFF ASSISTANT 3,750.00 

LIPSEN, LINDA STAFF ASSISTANT 3,000.00 

HERRITT,JOHN DOUGLAS STAFF ASSISTANT 8,250.00 

NELSON, TONI LEE STAFF ASSISTANT 2,750.01 

TURNER, ANDREA L. STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT, FROM SEP 16 333.09 

WRIGHT, ANGELA STAFF ASSISTANT 2,199.99 

OFFICE OF HON. BENJAMIN S ROSENTHAL 



ARMSTRONG, GAIL S 

BERNSTEIN, SUSAN A 
BLOOMFIELD, DOUGLAS M 
DAVIS, MARY V 
GLANTZ, MARVIN 
GONZALEZ, CHERYL ANN 
HENNESSEY, ARLENE H 
HOFFER,JAY L. 
JOSEPHSON, MICHAEL 
KAUFMAN, ABIGAIL F. 
KRAMER, FLORENCE H 
MASSAR, BETSY J 
NOSEK, DEBORAH ANNE 
PADDOCK, KAREN L. 
PARMET, WENDY E. 
POLITI,JUNE E 
SHINDLER, MARILYN SUE 
SPIREB, JULIAN H 
WEIXL, SUSAN LYNN 



STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT, FROM AUG 5 3,502.78 

DISTRICT ADMINISTRATOR 1,625.01 

RESEARCH ASSISTANT .' 6,750.00 

ADMINISTRATIVE ASSISTANT 1,963.99 

STAFF ASSISTANT 3,999.99 

RECEPTIONIST SECRETARY 2,925.00 

EXECUTIVE SECRETARY 5,750.01 

STAFF ASSISTANT, TO AUG 31 1,122.92 

STAFF ASSISTANT 1,250.01 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

CASEWORKER 1,125.00 

LEGISLATIVE CORRESPONDENT 3,219.99 

STAFF ASSISTANT 2,871.99 

RECEFTIONIST-STAFF ASST 2,121.99 

STAFF ASSISTANT, TO AUG 31 1,022.92 

STAFF ASSISTANT, TO JUL 31 158.33 

STAFF/LEGIS ASST 1,125.00 

LEGISLATIVE ASSISTANT 9,500.01 

CASEWORKER, FROM SEP 1 1,000.00 



134 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30. 1977— Continued 



OFFICE OF HON. DAN BOSTENKOBSKI 



DEAN, LINDA 

DOSLEY, JOSEPH 

DRAGON, MICHAEL 

ESHELMAN, LOOISE CABTSBIGHT 

ETTEN, THOMAS A 

GABINSKI,LEO 

HOJNOWSKI,E0GENE 

HOLMES, ANN A MABIE 

KBOPIDLOBSKI .CELESTE 

LADFTER, JANICE 

LEVIN, LEONARD L 

HICALI,HAHK A 

NEGA, JOSEPH B 

NEGA, HALTER J. 

NETEBOHICZ,EVA N 

PANZKE, NANCY A 

PE1TY, THOMAS RICHARD 

PORVIS, CONSTANCE ANN 

ROSSO, ROBERT L. 

BARNICK, KATHLEEN JOY 



S 3 

5 

6 

2 

3 

5 

4 

FBOH AUG 1 TO ADG 31 

2 

2 

TO JOL 31 1 

3 

FGCH ADG 1 TO ADG 31 

10 

1 

4 

LEJ CONGFESSIONAL INTERN, TO JDL 31 

2 

FRCH SEP 1 1 

2 



,750.00 
,250.00 
,757.51 
,199.99 
,750.00 
,000.01 
,100.01 

750.00 
,025.00 
,675.01 
,500.00 
,175.01 

750.00 
,181.25 
,500.00 
,583.33 

590.00 
,250.00 
,188.39 
,100.49 



OFFICE OF HOH. JOHH H ROUSSELOT 



8LEECKEB, HARRY HARLAN 
BOHAN, BARBARA J 
GAGLIARDI,JODITH R 

H0CKABY,JOE STANLEY 
HUTTON, HELENA 
JAFFA, PHILIP BEHTBAH 
KANNENBERG, HOLLY A 
KARBONIT, PEGGY J 
KNODSON.KATHEBINE 
KBAUEL.KATHBYN A 
KYLE, JACK L 
MACLEAN, MALCOLM J,JR 
MINSKY.CONCEPCION C 
NELSON, JENNIFER J 
PEARSON, PATRICIA A 
REINKE,MARY LOOISE 
ROOSSELOT, VYONNE 
WEISEND,PAOL F 
BILLABD, LESLIE HOPKINS 
BOODIB, OLIVE ELIZABETH 



CLERK, FROM SEP 1 

LEGIS. ASST 

ASSISTANT, TO JOL 31 

STAFF ASSISTANT, FROM ADG 1 

BCCKKEEPIB 

CAS FHOBKEB 

LEGISLATIVE ASSISTANT 

LEGISLATIVE SECRETARY, TO SEP 15 ... 

SECRETABY 

LBJ CONGBESSIONAL INTEBN, TO AOG 12 

SECBETABY 

ASSISTANT 

SPECIAL ASSISTANT 

CASEWORKER 

SECBETABY 

CASEWORKER, TO AUG IS 

SECRETABY 

EXECUTIVE SECRETABY 

SPECIAL PROJECTS ASST 

STAFF ASSISTANT, TO JOL 31 

SECRETABY 



300.00 
,999.99 

,000.00 
,124.99 
,249.99 
,500.01 
,708.33 
,499.99 
826.00 
,560.33 
,625.00 
,375.01 
,750.01 
,050.01 
,500.00 
,999.99 
,306.01 
,250.00 
,083.33 
,750.01 



OFFICE OF HCN. EDBABD B EOYEAL 



APARICIO, CAROLINE B. 

CAMPOS, PAOLA 

ESPINOZA, KATHLEEN LOOISE 

FBANKEL, RAQOEL H. 

GRIEGO, VICTOR B. 

JAQOET, BRENT H 

LEBIS, DIANE L 

MORALES, LOPE A 

NAYLOR, NANCY ROSE 

RODRIGUEZ, CONSOELO E 

ROMERO, HELEN 

SALECKER.ANN 

SANDBIDGE, ELLEN M 

TIJERINA.MANOEL 

YANEZ,BALTAZAH P 



SENIOR CITIZEN'S CONSOLTANT 

BECEPTIONIST 

CLERK 

CLEBK 

LBJ CONGBESSIONAL INTEBN, TO JOL 31 

PBESS SECBETABY 

SECRETABY 

RECEPTIONIST 

LEGISLATIVE CORRESPONDENT 

LEGISLATIVE ASSISTANT 

FIELD REPRESENTATIVE 



675.00 

,886.94 
,208.33 
,499.99 

590.00 
,750.00 
,350.01 

675.00 
,500.01 
,952.24 
,825.00 
,675.00 
,174.99 
,075.00 
,067.01 



OFFICE OF HON. ELDON RODD 

ABRAHAM, ANDRES 
ARCHIBALD, GEORGE H 
BIANCHI.GENNABO P. 
BRADLEY, MICHAEL T 
COCKLIN,ANNA B 
CORBETT, MARGARET E 
FOOTE,BALTER,JB. 
FOBD,LISA L. 
HOPPE,JOHN DAVID 
MARTIN, HARJORIE LOCILLE 



LBJ CONGRESSIONAL INTERN, TO AOG 8 

ADMINISTRATIVE ASSISTANT 

STAFF BOOKKEEPER 

STAFF ASSISTANT, FROM JOL 26 TO AUG 31 .. 
DISTRICT FIELD REPRESENTATIVE, TO AOG 31 

CASEWORKER 

DISTBICT FIELD ASSISTANT 

LEGISLATIVE SECBETARY 

RESEARCH ASSISTANT, FROM SEP 1 

SECRETARY, TO JOL 7 



747.33 
,500.01 
,650.00 
,600.08 
,000.00 
,500.01 
,750.00 
,250.00 
666.67 
155.56 



135 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. ELDON RUDD -CONTINUED 



MEEK, MARGARET J 
NELBY, FLORENCE B. 

MOLINE,JILL A 
RAMSEY, CAROLYN K. 
RANDOLPH, R SEAN 
ROBILLARD,JEAN E 
SCHNOEBELEN.DERA E 
SHADEGG, STEPHEN C 
SLOVEK .FLORENCE J 
STIENTJES, MICHAEL 
STUBLER, MICHAEL J 
ZIEBARTH,R0TH HELH 



RECEPTIONIST-SECRETARY $ 2,750.01 

DISTRICT FIELD ASSISTANT, TO JUL 31 

DISTRICT FIELD REPRESENTATIVE, AUG 1 - AUG 31 «,237.19 

DISTRICT REPRESENTATIVE, TO JUL 22 1,222.22 

LEGISLATIVE CORRESPONDENT 3,875.01 

RESEARCH ASSISTANT, FROH AUG 1 TO AUG 31 666.67 

PERSONAL SECRETARY, TO JUL 15 604.17 

SECRETARY/RECEPTIONIST, FROH AUG 11 1,250.00 

DISTRICT ASSISTANT U, 500. 00 

PERSONAL SECRETARY 3,999.99 

LEGISLATIVE ASSISTANT 5,791.67 

DISTRICT REPRESENTATIVE, FROM JUL 13 4,283.34 

CASEWORKER 3,999.99 



OFFICE OF HON. HAROLD RUNNELS 



ALHANZA, MARIA AVITA 
BINDER, JOSEPH T. 
BIRKHOFER, LINDA J 
BYFORD,PATTI L. 
CHILDRESS, SHIRLEY C 
DICKES, SHIRLEY M 
GARNER, JO ANN 
GWALTNEY,JOY H 
JANECKA, SHARON S 
KOURY, GLORIA D 
MICHAEL, JAMES A 
MORGAN, LARRY L 
OLGOIN.H MICHAEL 
PENDLETON, JACKIE J 
RHEA.TONI G 
SIDES, CAROLYN R 
VALENCIA, RUDOLPH K 
BALLER, NANETTE L 
WILLIAMS, BETH ANN 



TYPIST 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

LEGISLATIVE ASSISTANT 

SECRETARY 

SECRETARY 

SECRETARY 

SECRETARY, TO JUL 31 

SECRETARY 

AREA REPRESENTATIVE 

SECRETARY, TO JUL 31 

AREA REPRESENTATIVE 

PRESS SECRETARY 

PRESS AIDE 

SECRETARY, FROM AUG 8 

RECEPTIONIST 

SECRETARY 

AREA REPRESENTATIVE 

SECRETARY 

SECRETARY 



,425.01 
590.00 
,299.99 
,800.00 
,800.01 
,299.99 
825.00 
,062.50 
,975.00 
758.33 
,275.00 
,049.99 
,925.01 
,111.39 
,325.00 
,000.00 
,175.01 
,01*9.99 
,150.00 



OFFICE OF HON. PHILIP E ROPPE 



ALEXANDER, JOHN S 
BBYCE, JOHNNY LEE 
EBICKSON, MICHAEL J. 
EVANS, JOHN G 
FORTIER.RUTH ANN 
GUSLER, DOROTHY J 
HILL, JAMES P 
HILLEGONDS,PAUL C 
HOFFMAN, KIHBERLY ANN 
JONES, GREGORY G. 
HCCABE, WILLIAM MICHAEL 
MILLER, KATHLEEN A 
NEWHOUSE, GERALD F 
NOETON,SHEREE MARIE 
PARKER, KAREN ELIZABETH 
RYAN, DONALD G 
STEEN, JAMES ERIC 
STOREY, JAMES H 

TOHPERT, JAMES E 
TREER, NANCY J 



STAFF ASSISTANT, FROM AUG 1 

STAFF ASSISTANT, TO JUL 31 

CCNGRESSICNAL INTERN, TO JUL 31 

PRESS ASSISTANT, FROM AUG 15 

CASEHORKER/LEG CORRES 

PROJECT ASST 

LEGISLATIVE RESEARCH ASSISTANT, FROM AUG 2 

AEMINISTRATIVE ASSISTANT 

CCNGBESSICNAL INTERN, TO JUL 31 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

STAFF ASSISTANT, TO JUL 31 

SECRETARY 

DISTRICT REPRESENTATIVE 

SECRETARY 

CASE WORKED 

DISTRICT REPRESENTATIVE, TO AUG 14 

LEGISLATIVE ASSISTANT 

PRESS ASSISTANT, TO JUL 31 

DISTRICT REPRESENTATIVE, FROM AUG 1 

STAFF ASSISTANT 

STAFF ASSISTANT 



,500.00 
750.00 
,000.00 
,912.78 
,600.00 
,225.01 
,097.22 
,291.67 
500.00 
500.00 
,000.00 
,100.01 
,625.00 
,675.01 
,100.01 
,959.70 
,750.00 

,841.66 
,799.99 
,799.99 



OPFICE OF HON. MARTIN A RUSSO 



CRONIN, CATHERINE 
DOWNS, MARGARET M 
DUFFY, GALE STECKER 
GIFFEY, CAROL A 
GREELEGS,ED 
GRIFFIN, CATHERINE M 
HALL, CAROL G 
HOCH, DOROTHEA H 
KHEZWICK, CHARLES W 
LONK, ELIZABETH ANN 
MACABI, ROBERT A 

HARINI,ROSANNE V 



SECRETARY 

RECEPTIONIST, TO AUG 31 , 

RECEPTIONIST, FROM SEP 12 

SECRETARY , 

LEGISLATIVE ASSISTANT 

CLERK, FRCH AUG 1 

STAFF ASSISTANT , 

STAFF ASSISTANT 

STAFF ASSISTANT 

SECRETARY 

ADMINISTRATIVE ASSISTANT, TO AUG 31 

STAFF ASSISTANT, FROM SEP 5 

CASEWORKER, TO JUL 31 

CASEBORKER, FROM AUG 5 



,250.00 
,200.00 
517.22 
,700.00 
,000.00 
,500.00 
,550.00 
,300.00 
,750.00 
,700.00 

,900.00 

,450.00 



136 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. BARTIN A ROSSO -CONTINUED 



BCELROY, EDWARD F 
MIFABELLI, ENRICO J. 
MORGAN, TISOTHY J 
PAGE, EDWARD H 
POINDEXTER, CATHERINE 
SCHDRING,LANA 
SHERMAN, JAMES W 
SKOBISZ, GREGORY R 



STAFF ASSISTANT 

LBJ CONGFESSIONAL INTERN, TO JDL 31 

LEGISLATIVE ASSISTANT 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT, TO AUG 31 

PERSCNAL SECRETARY-OFFICE MGR 

STAFF ASSISTANT 

STAFF ASSISTANT 



,2 50.00 
590.00 
,300.00 
,400.00 
,000.00 
,200.00 
,850.00 
,600.00 



OFFICE OF HON. LEO J RYAN 

CAGNEY .CHARLES JOSEPH 
CHILLORA, CHARLOTTE E 
DAVIS, EILEEN NANCY 
DAVIS.KAYE EDWARDS 
FRANKE, ELIZABETH A 
GREENWALD, CATHY E 
HOLSINGER, GALEN W 
KINSMAN, ANNETTE B 
KOHN, JOEL 
HARKOS, SANDRA K 

RAICH, JDLIANNA S. 
RYAN.KIMBERLY A 

SPEIER, KAREN 

SWETT.MARCIA KAY 
THOMPSON, JUDITH ANNE 
VALDEZ, KATHLEEN ELLEN 
WALKER, KRISTIN A 

WELLS, SHARON 
WEST, LINDA K 



STAFF ASSISTANT 

EXECUTIVE ASST OFFICE MANAGER 

CLERK TYPIST 

LEGISLATIVE AIDE 

STAFF ASSISTANT 

STAFF ASSISTANT 

ADMINISTRATIVE ASSISTANT 

STAFF ASSISTANT, FROM AUG 15 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

STAFF ASSISTANT, TO JUL 31 

CASEWORKER, FROM AUG 1 TO AUG 31 

STAFF ASSISTANT 

LBJ CONGRESSIONAL INTERN, AUG 1 - AUG 31 

STAFF ASSISTANT, TO JUL 31 

LEGISLATIVE COUNSEL, FROM AUG 1 

CLERK TYPIST 

RECEFTICNIST-SECRETARY, FROM SEP 26 

SECRETARY, TO SEP 21 

STAFF ASSISTANT, TO AUG 16 

CASEWORKER, FROM AUG 17 

RECEPTIONIST SECRETARY 

STAFF ASSISTANT, FROM SEP 19 TO SEP 23 ... 



,075.01 
,370.67 
,050.01 
,999.99 
,494.39 
,750.00 
,900.00 
,277.77 
590.00 

,983.33 
,000.00 
590.00 

,495.67 

,6U9.99 

116.67 

,979.99 

,846.67 

,000.00 

116.67 



OFFICE OF HON. FERNAND J ST GERMAIN 



BORGES, ARMANDO LOPES 
DIQUINZIO, DIANE 
FORTE, MARIA ANNE 
GALLAS, ELIZABETH L 
GIRARD, PAULINE J 
GREENE, JANET ANN 
LALIBERTE, GERARD 
LIARD, IRENE C 
MAURANO, RICHARD L 
MCKENNA,MARY 
PARTINGTON, WILLARD F 
SCANLON, JOSEPH 
SHERIDAN, MARY ELLEN 
SMITH, JEANNE C 
SYLVESTRE.J DONALD 
TERLEP, RICHARD 



ASSISTANT 

SECRETARY 

ASSISTANT, TO AUG 31 .... 

CLERK 

SECRETARY 

SECRETARY 

ASSISTANT 

SECRETARY 

ASSISTANT 

STAFF ASSISTANT 

EXECUTIVE SECRETARY 

ADMINISTRATIVE ASSISTANT 
SECRETARY, TO SEP 2tt .... 

SECRETARY 

ASSISTANT 

STAFF ASSISTANT 



,349.99 
,375.00 
,250.00 
,249.99 
,875.00 

641.49 
,124.99 
,034.59 
,407.01 
,411.10 
,100.00 
,173.19 
,030.20 
,779.43 
,274.99 

750.01 



OFFICE OF HON. JIM SANTINI 

ADDISON, CHARLENE 
ATCHESON.LYNN S 
BRODEUR,JOHN E 
BRODEUR,LISA B 
CHACHAS, JAMES C 
DRATTER, CONNIE RAE 
ENDRES, STACY K 
ESKIN, ANDREW D 
FOLEY, HELEN A 
HENRIE, ROBERT A 
HOLBROOK,NICOLINE G 
MARXEN.JOHN 
MERICLE, SHEILA ANN 
OWEN, JUDITH D 
PISTONE, DANTE C 
SABBATH, LAWRENCE ELLIOT 
SHORT, KIM M 
SIEBEN, JOYCE E 
SMITH, JOAN MADELINE 
WEINTRAUB, LAURIE C 
ZUNIO,KAY H 



STAFF MEMBER 2,745.83 

DISTRICT OFFICE MANAGER , 3,375.00 

ADMINISTRATIVE ASSISTANT 6,825.00 

SECRETARY 2,675.01 

RURAL REPRESENTATIVE 4,479.17 

DISTRICT OFFICE MANAGER 3,350.00 

LBJ CONGRESSIONAL INTERN, FROM SEP 1 590.00 

SPECIAL ASSISTANT, FROM SEP 1 900.00 

DISTRICT OFFICE STAFF 2,550.00 

LEGISLATIVE AIDE 4,374.99 

SPECIAL ASSISTANT 3,041.67 

REGIONAL REPRESENTATIVE., TO JUL 31 750.00 

CASEWORKER 2,850.00 

CONGRESSIONAL AIDB-DISTRICT REP 2,700.00 

PRESS SECRETARY 4,312.50 

LEGISLATIVE ASSISTANT 4,275.00 

SECRETARY 3,174.99 

SPECIAL ASSISTANT, FROB AUG 1 TO AUG 31 750.00 

CLERK 2,375.01 

LEGISLATIVE AIDE 3,174.99 

STAFF BEBEER DIST OFC 2,350.00 



137 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. RONALD A SARASn 



ALVAREZ, JUDY D 
BAZLEY,BBENDA JEANNE 
CHEW, ROBERTA 
CONBS, CHRISTOPHER 
FARREN,JOHN H 
FRITTS, CYNTHIA S 
JOHNSON-SMITH, KIM BEBLY 
JONES, DEBORAH LYNH 
KERR, KAY S 
KLINE, CHARLES T,JE 
LYOH.KATHEBINE B 
HASTROPIET30.JOHH A 
MCCARTHY, SOSAN R 
HCGRATH,JOHN F.JR 
FUSKIN, SUSAN E 
SOHHA.NORHA H 
STANLEY, MARC GENE 
STELHA,PETEB B 
VANNAIS, MIRIAM B 
HEATER, ELEANOR D 



STAFF ASSISTANT $ 2,687. U9 

STAFF ASSISTANT 2,199.99 

STAFF ASSISTANT 3,125.01 

STAFF ASSISTANT 3,125.01 

STAFF ASSISTANT, TO SEP 11 2,958.33 

STAFF ASSISTANT 2,874.99 

STAFF ASSISTANT 4,250.01 

STAFF ASSISTANT 2,499.99 

STAFF ASSISTANT 2,825.01 

PRESS SECRETARY 6,500.01 

STAFF ASSISTANT 2,625.00 

STAFF ASSISTANT, TO AUG 31 1,800.00 

STAFF ASSISTANT 2,400.00 

LEGISLATIVE ASSISTANT 3,500.01 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

STAFF ASSISTANT 2,199.99 

AEMINISTBATIVE ASSISTANT 8,625.00 

STAFF ASSISTANT., FROM SEP 12 712.50 

DISTRICT ADMINISTRATOR 5,750.01 

STAFF ASSISTANT, TO AUG 31 1,100.00 



OFFICE OF HON. DAVID E SATTEBFIELD III 



ABNISTEAD.R G 
BLANTON.HABT B 
CABPEN, DONALD 0,JB 
HAAB, MARGARET COLiELL 
HALL, ELIZABETH LANDON 
JEBETT.J J, III 
LOCKABD,ANNA M 
LOGAN, NAOMI JANE 
MARSHALL, MARILYN A 
HEADOBS,ANNE 
HILLS, LYDIA G 
ONEAL, RICHARD D 
PITNEB,BOBEBT N 
RASHUSSEN,JOHN C,JE 
HEIGHABD,GABY LEE 
ROBEBTS, HELEN « 
TROY, PHYLLIS H 
WILLIAMS, JAMES B 



ADHINISTBATIVE ASSISTANT 

CLERK 

RESEABCB ASSISTANT 

CLERK-LEGIS ASST 

CLERK, FBCH AUG 29 

LEGISLATIVE ASSISTANT ... 

CLEBK 

CLEBK, TO SEP 15 

CLERK 

CLEBK 

CLEBK 

CLERK, TO AUG 15 

CLEBK 

ASSISTANT 

CLEBK 

CLEBK 

CLEBK-PEBSONAL SECY 

CLEBK 



900.00 
458.34 
166.22 
147.08 
844.45 
374.99 
812.50 
979.17 
000.00 
375.01 
250.00 
358.68 
999.99 
000.01 
537.51 
250.00 
071.68 
250.01 



OFFICE OF HON. HAROLD S SAWYER 



BANFOBD, CONSTANCE M 
CALLAN, BARBARA J 
CHESTEB.LAVERBE 
COBTIS.CHBBIL 
DOEZEHA, BETSY A 
FRENCH, KATHRYN B 
HANSON, ILA FLO 
HORANBOBG, RICHARD C 
KUCI, ELIZABETH H 
LOBISCO.MAHY F 
HUNGER, LUCINDA MARIE 
BOBEBTS, SYLVIA A 
BOUBKE,BUSSELL A 
SCHUHACHEB, TERRY 
SWINEHART, LEONARD 
VAN ESSEN, DOUGLAS 8 
VIEBEGG, STEPHEN G 
WILSON, JANET L 



EXECUTIVE SECBETABY 

SECRETARY 

SECRETARY 

SECBETABY, TO JUL 31 

SECBETABY 

SECBETABY 

SECBETABY 

LEGISLATIVE ASSISTANT 

BECEPTIONIST 6 SECTY 

STAFF ASSISTANT 

SECBETABY, FROM AUG 1 TO SEP 9 ... 

PERSONAL SECBETABY 

ADHINISTBATIVE ASSISTANT 

LBJ CONGEESSIONAL INTEBN, TO JUL 31 

STAFF BESEABCH ASST 

STAFF ASSISTANT., FBOH SEP 1 

DISTBICT BEPBESENTATIVE 

BECEPTIONIST-SECBETABY, TO JUL 31 .. 



,500.00 
,500.00 
,749.99 

500.00 
,750.01 
,750.01 
,000.00 
,750.01 
,166.67 
,875.01 

650.00 
,500.00 
,874.99 

590.00 
,749.99 

500.00 
,499.99 

750.00 



OFFICE OP HON. JAMES H SCHEUER 



ALTHAN, DAVID 
3ABYAK, GREGORY BOGEB 
BBABHAH, JUDITH G 
BBOBN.BICHABD A 
COHEN, DAVID LOUIS 
EIN, HAHION 
FISCHHAN,SELHA 
GOSHAM, NANCY 
GOTTLIEB, JOSEPH P 
HALPEBIN.BOSE 



SPECIAL ASSISTANT, TO JUL 31 

LEGISLATIVE CORRESPONDENT, FBOM SEP 

EXECUTIVE ASST OFFICE MANAGES 

SPECIAL PBOJECTS 

ADHINISTBATIVE ASSISTANT , 

LEGISLATIVE ASSISTANT 

SECBETABY 

INTERN, FBOH AUG 1 TO AUG 31 

CASEBOBKEB, TO AUG 31 

COMMUNITY BEPBESENTATIVE, FBOM SEP 1 



700.00 

500.00 
,750.00 

600.00 
,750.01 
,649.99 
,787.75 

300.00 
,984.78 

550.00 



138 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFPICE OF HON. JAMES H SCHEOEE -CONTINUED 



LOSTIG, ESTHER HELEN 

PARKS, MARY CATHERINE 

PLANT, HARRIET 

POLLARA, WILLIAM 

QOINN, BETTY ! 

REIF, TIMOTHY 

RICE,DIANE M 

RIDLEY, JOHN P 

ROSNER,SIGM0ND 

SAVITZ,REOVEN 

SQUADRON, WILLIAM FREDERICK 

STIADMAN, MARTIN J 

TDBRIDY, DANIEL J 

TURNER, DEBORAH L 

WEAVER, BETTE 



DISTRICT REPRESENTATIVE S 3,900.00 

LEGISLATIVE SECRETARY 3,750.00 

CCMHONITY REPRESENTATIVE, AUG 1 - AOG 31 500.00 

COMMUNITY REPRESENTATIVE, FROM JOL 15 1,600.01 

SECRETARY 2,166.66 

INTERN, TO JOL 31 125.00 

LBJ CONGRESSIONAL INTERN, TO JOL 31 590.00 

SPECIAL ASSISTANT, TO AUG 31 2,333.34 

DISTRICT REPRESENTATIVE 1,800.00 

ADMINISTRATIVE ASSISTANT 8,749.98 

PRESS SECRETARY, FROM SEP 1 1,041.67 

SPECIAL PROJECTS 4,499.99 

COMMUNITY REPRESENTATIVE 2,200.00 

COMPUTER OPERATOR, FROM SEP 1 708.33 

DISTRICT SECRETARY 2,124.99 



OFFICE OF HON. PATRICIA SCHPOEDER 



ASCHKE NASI, DAVID 
ASHER,GRIEG 
BALAS,JOY A 
BUCK, DANIEL J 
CARTER, MARY 
COLLIER, PATRICE E 
DOWNS, NANCY A 
DUHAN.ROSLYN 

GERCKE, JUDITH ANNE 
GRAY, GEORGE W,III 
GREENEBAUM, NANCY 
KAHN,CYNDI 
KEENE, JANETTE L. 
HONDT.GARY H 
PACHECO, ROMAINE 
PAMFILIS, ANDREA 
RIEDMILLER, CHERYL H 
SANTISTEVAN, CARLOS A 
STACY, GERALD L 
STRONG, LILY G 

YOST, BARBARA J 



STAFF AIDE, FROM AUG 1 TO AOG 31 

STAFF AIDE, TO JOL 31 

STAFF AIDE , 

ADMINISTRATIVE ASSISTANT 

STAFF AIDE 

STAFF AIDE 

STAFF AIEE 

STAFF AIDE., TO JUL 31 

FROM SEP 1 

STAFF AIDE 

STAFF AIDE 

STAFF AIDE 

DISTRICT ADMINISTRATIVE ASSISTANT 
DISTRICT ADMINISTRATIVE ASSISTANT 

STAJF AIDE, FROM AUG 1 

STAFF AIDE 

STAFF AIDE 

STAFF SICE 

STAFF AIDE 

STAFF AIEE 

STAFF AIEE, TO JUL 31 

STAFF AIDE, FROM AUG S 

STIFF AIEE 



833.33 
,000.00 
,291 .67 
,112.57 
,841.66 
,000.00 
,500.01 

,808.34 
,741.67 
,541.67 
,750.01 
,416.67 
295.00 
,041.67 
,916.67 
,750.01 
,166.67 
,791.67 
,791.66 

,520.56 
,541.66 



OFFICE OF HON. RICHARD T SCHULZE 



BARRETT, SOSAN 
BRODERICK, LAURA ANNE 
BURROUGHS, HARRY F 
DARLINGTON, REBECCA 
FERGUSON, ROBERT E H 
GLEASON, KATHLEEN M 

GRAFTON, HARRY C,JR 
KOLTERMAN, WALTER STEPHEN 
MATTHEWS, JAMES A 
MCGOWAN,JOHN B,JR 
MCMAHON, BARBARA ANNE 
MORELLI, VINCENT L 
NEIFFER, GEORGE A 
ROWLAND, SAMUEL C,III 
SKINNER, MARGARET MARY 
SPEAKMAN, JAMES D 
WALDEYER, DONNA C 
WESTNER, JOSEPH 
WHITE, KAREN L 



RECEPTIONIST , 2 

COMMUNICATIONS DIRECTOR 3 

LEGISLATIVE CORRESPONDENT 2 

CASEWORKER 3 

RESEARCH ASSISTANT 4 

STAFF AIIE, FROM AUG 1 TO AOG 19 

LBJ CONGRESSIONAL INTERN, TO JOL 31 1 

7 

STAFF ASSISTANT., FROM SEP 1 

STAFF AIDE, TO AOG 19 1 

CLERK 1 

PERSONAL SECRETARY-OFFICE HGR 3 

RESEARCH ASSISTANT 3 

3 

TO JUL 31 

2 

TO SEP 6 4 

2 

ADMINISTRATIVE ASSISTANT 7 

SECRETARY 2 



,625.00 
,750.00 
,541.67 
,249.99 
,500.00 

,289.99 
,374.99 

833.33 
,361.11 
,350.00 
,750.00 
,249.99 
,249.99 

833.33 
,625.00 
,033.33 
,499.99 
,500.00 
,250.00 



OFFICE OF HON. KEITH G SEBELIDS 



BERGNER,JOHN F 
BIRD, DONALD L 
DEVLIN, MERRY M 
DODD, DIXIE LEE 
EASTIN, ROBERT I 
EDDY, CAROLYN 
FENTON, THOMAS 
FRICK.IDA MAE 



INTERN, TO JUL 31 600.00 

INTERN, TO JUL 31 600.00 

CLERK 1,500.00 

PRESS ASSISTANT 4,250.01 

DISTRICT ADMINISTRATIVE ASSISTANT 6,473.31 

RECEPTIONIST-CASE WORKER 3,000.01 

INTERN, TO JUL 31 600.00 

DISTRICT REPRESENTATIVE 3,302.16 



139 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. KEITH G SEBELIOS -CONTINUED 



JORGENSON, CHARLES HARK 
JORGENSON,JO ANN 
MILLER, RANDY 
OLIVER, CHLOE ELLYN 
REEDI, KAREN SUE 
ROBERTS, CHARLES P 
ROBINSON, NANCY J 
SULLIVAN, ANN ALGOTT 
HALLEB, HENRY JR 



CLERK, TO JDL 31 $ 1,041.67 

CLERK 1,375.89 

RESEARCH ASSISTANT 2,916.67 

SECRETARY 4,625.01 

SECRETARY 3,066.27 

ADMINISTRATIVE ASSISTANT 11,208.33 

RESEARCH ASSISTANT 4,500.00 

OFFICE MANAGER 6,249.99 

STAFF ASSISTANT 2,274.99 



OFFICE OF HON. JOHN F SEIEERLING 



BUBRESS, JAMES MARTIN 
CASSTEVENS,KAY 
CHTSOLH, HILDA E 
COTHBERTSON, BETSY A 
DAVIS, EDWIN 
DRISKILL, SHARON R 
EARHART, PHYLLIS K 
FOGARTY, WILLIAM 
GOLDSBOBO, THALIA E 
GOOLET, SUZANNE 
LOITZ.KATHRYN JO 
MANSFIELD, DONALD W 
MOSS, DOROTHY J 
ONIE, JULIE B 
PERSONS, SANDFORD Z 
SIMONDS, MIRIAM 
STRAIGHT, HICHAEL 8 
THEIL, LYNDA P 
WALSH, MABY ANNE 



LEGISLATIVE ANALYST 

LEGISLATIVE AIDE 

EXECUTIVE SECRETARY 

SENIOR CASE WORKER 

STAFF ASSISTANT 

STUDENT INTERN 

DIST OFF CASE WORKER 

CLERK TYPIST 

CLERK 

LEGISLATIVE CLEBK 

DISTRICT OFFICE SECBETABY 

ADHINISTRATIVE ASSISTANT 

CASEWOBKEB 

CLERK TYPIST 

RESEARCH ASSISTANT 

DISTRICT OFFICE HANAGER 

LEGAL AIDE 

CASEWORKER 

LBJ CONGRESSIONAL INTEBN, TO AUG 5 



375.00 
083.33 
562.49 
833.33 
166.66 
963.00 
501.75 
544.44 
625.00 
750.01 
636.49 
687.49 
749.51 
147.22 
291.66 
000.01 
750.01 
015.01 
688.33 



OFFICE OF BON. PHILIP R SHARP 



BONDEB,JOEL FREEMAN 
BBISKIE, CATHY ANN 
BBUNNER, BONALD D 
DOUGHTY, DIANE L 
FIDLER, SHELLEY NAN 
FOBL2NZA, CABIN 
FRAIZER, DONNA 
GANN, RICKEY 
GBADY,HABY E 
GYDBE, BONALD A 
HOGSETT, JOSEPH H 
HOSTETLEB, SALLY A 
KOPIL,THOMAS E 
LABGSDOBF, SUZANNE H 
LEWIS, BO YD 
MCGEE.LAWBENCE 
HERC HA NTHOUSE, HELEN 
BOBBING, GEOBGE I 
RAYMOND, PATRICIA M 
BIGGS, JOHN A 
SEWELL, CAROL ANN 
SHEPPARD,BILLIE LOUISE 
TRIMMER, CABOL L 
WANLEY, THOMAS E 



LEGISLATIVE AIDE 

CASEWORKER 

BESEARCH ASSISTANT, FBOM AUG 1 TO AUG 31 

STAFF ASSISTANT 

LEGISLATIVE ASSISTANT 

PRESS ASSISTANT 

CASE WOEKEB., TO AUG V 

STAFF ASSISTANT 

RECEPTIONIST 

DISTRICT OFFICE HANAGER 

SUMMER INTERN, FROM JUL 16 TO JUL 31 

STAFF ASSISTANT., FBOM AUG 5 TO AUG 31 .. 

STAFF ASSISTANT, FBOM SEP 1 

PEBSONAL ASST 

LEJ CCNGFESSIONAL INTEBN, TO JUL 31 

STAFF ASSISTANT, TO JUL 14 

CASEWOFKEB 

STAFF ASSISTANT 

LEGISLATIVE AIDE 

ADMINISTRATIVE ASSISTANT 

CASEWOBKEB 

CASEHOBKEB, FROM SEP 26 

STAFF ASSISTANT 

LEGISLATIVE AIDE , 



,500.01 

,000.00 

,250.00 

,375.01 

,874.99 

,200.00 

897.23 

,250.00 

,375.01 

,083.33 

410.00 

400.00 

424.67 

,624.99 

510.00 

427.78 

,750.01 

,729.47 

,874.99 

,125.01 

,625.00 

125.00 

875.01 

,500.01 



OFFICE OF HON. GEORGE E SHIPLEY 



BYRD,A DELORIS 
DUFFY, GALE STECKEB 
ECKL,GOLDIE MAE 
FRANK, PAULA LOU 
GIBSON, CHABLES L 
GIBSON, DOLOBES I 
HUNDY,JOHN W 
PUGLISI, JOANNE LOUISE 
BUSS, LESLIE V 
SCHUESSLER, DAVID 
SLAPE, DONNA 
WATSON, DONALD HUGH 



CLERK 3,984.42 

CLERK, TO AUG 31 2,000.00 

ADMINISTRATIVE AIDE 11,247.49 

RECEPTIONIST 2,396.61 

CLEBK 5,610.27 

SECRETARY 6,193.14 

CLEBK 7,957.50 

CASEWORKER 3,602.16 

SECBETABY 4,250.01 

CLERK, TO AUG 31 1,333.34 

CLERK 2,882.82 

ADMINISTRATIVE ASSISTANT 11,249.99 



140 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. E G (BUD) SHOSTER 



BOOTHE, EVELYN H 
BROWN, GARRY LYLE 
BUTLER, KENNETH U 
CLAY, LISA J 
EPPARD,ANN H 
GALLE, BYRON 
GOFORTH, GERALD GENE 
HAINSEY,GAIL V 
KADPP, GREGORY S 
LASALA, JOSEPH A 
LOESSY,ALAN R 
MCKEOUGH,MARY T 
MCKISSICK, CAROL ANN 
MEEKER, SUZANNE ELAINE 
NEWTON, HUGH C 
OVERBECK, PHYLLIS A 
RANDOLPH, R SEAN 
SLATON, JONATHAN 
SUMMERFELT, DIANE DROTOS 



CASEWORKER J 3,375.00 

CLERK 3,209.99 

LEGISLATIVE ASSISTANT 5,375.01 

ASSISTANT, FROM AUG 1 1,666.66 

ADMINISTRATIVE ASSISTANT, FROH JUL 5 9,819.99 

STAFF ASSISTANT, TO JUL 15 312.50 

STAFF ASSISTANT 2,I»99.99 

DISTRICT AIDE 2,1*99.99 

STAFF ASSISTANT 2,916.67 

AIDE TO CONGRESSHAN 3,875.01 

DISTRICT AIDE <t,390.28 

CASEWORKER 3,852.51 

STAFF ASSISTANT 5,000.01 

RECEPTIONIST, FROM AUG 15 1,150.00 

STAFF ASSISTANT., FROH AUG 1 1,500.00 

SECRETARY, TO JUL 15 500.00 

RESEARCH ASSISTANT, FROH AUG 1 TO AUG 31 400.00 

STAFF ASSISTANT 2,500.00 

EXECUTIVE SECRETARY 3,749.99 



OFFICE OF HON. ROBERT L F SIKES 



AHLFELD,NARY T 
ALEXANDER, HAZEL 
ALLEN, JOHN H 
BUTLER, ALHA D 
COPENHAVER,OCTAVIA T 

CRAWFORD, PATRICIA J 
DUDLEY, ELAINE MARIE 
FULLER, J W 
GREENHALGH.ELEASE V 
HEATH, ROBERT N JR 
HOLLOWAY, WILLIAM P,JR 
MCHONE, JENNY DELANE 
SPRACHER,SARA E 
TIBHONS, JEANNE 
WILLIAMS, JAHES B 
WRIGHT, JESSICA L 



SECRETARY 

SECRETARY 

LEGISLATIVE ASSISTANT 

ADMINISTRATIVE ASSISTANT 

CLERK, FROH JUL 8 TO AUG 7 

LBJ CONGRESSIONAL INTERN, TO JUL 7 

SECRETARY, FROM AUG 1 

SECRETARY 

AIEE 

PERSONAL SECRETARY 

LBJ CONGRESSIONAL INTERN, JUL 8 - AUG 7 

AIDE 

SECRETARY 

SECRETARY 

SECRETARY 

CLERK 

SECRETARY 



,485.61 
,484.41 
,234.54 
,900.00 

727.67 

,000.00 
,250.00 
,127.67 
,999.99 

590.00 
,400.00 
,127.67 
,127.67 
,475.01 

825.54 
,624.99 



OFFICE OF HON. PAUL SIMON 

BERGIN, MARGARET J 
BUSS,DWIGHT RAYMOND 
DAVENPORT, BERNICE NEILL 
GAYER, PAUL WILLIAM 
JOHNSEN.FAY V 
MARTIN, FAYE M 
MARTY, JOHN 
MICHAEL, TERRY P 
MORRILL, JULIA B 
OTTERSON, VIRGINIA 
PENNING, NICHOLAS J 
PINKNEY,GILL MICHELLE 
PYRROS, BETTY B 
ROSS, JAMES ALEXANDER 
SMITH, JACQUELINE M 
SOLOMON, DAVID H 
STEELE, KAREN J 
WAGNER, JUDITH L 
WILLIS, TRUDY D 



ADMINISTRATIVE ASSISTANT 

DISTRICT REPRESENTATIVE 

TYPIST-CASEWORKER 

REPRESENTATIVE AT LARGE 

OFFICE MANAGER 

CLERK TYPIST, TO AUG 31 

LBJ CONGRESSIONAL INTERN, TO JUL 11 

PRESS SECRETARY 

SECRETARY-CASE WORKER 

ASSISTANT 

LEGISLATIVE ASSISTANT 

CLERK TYPIST 

SECRETARY 

CLERK TYPIST., FROM SEP 15 

SECRETARY 

LEGISLATIVE ASSISTANT 

SECRETARY 

ASSISTANT 

SECRETARY 



,916.59 
,775.57 
,609.10 
,000.00 
,482.19 
,050.00 

216.33 
,423.46 
,055.00 

974.19 
,749.99 
,075.01 
,935.14 

377.78 

649.99 
,375.00 
,904.24 

711.93 
,790.66 



OFFICE OF HON. B F SISK 

ADAMS, LARRY DELBERT 
CHRISTIE, WILLIAM H 
CLARY, CHRISTINE LOUISE 
CLOUGH, BETTY L 
COELHO, ANTHONY L 
FOWLER, RICHMOND R 
GIBSON, ELLEN SHIRLEY 
GIBSON, SHIRLEY G 
GRADY, JOHN T 
GUINN, ELIZABETH L 
KNIGHT, BARBARA J 



CLERK 6,604.29 

CLERK 4,874.01 

CLEBK 4,125.00 

CLERK 3,650.01 

ADMINISTRATIVE ASSISTANT 10,183.74 

CLEBK 1,432.24 

CLERK 2,375.01 

CLEBK 2,750.01 

CLERK 300.00 

CLERK 4,431.85 

CLERK 4,625.01 



141 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. B F SISK -CCNTINOIE 



LUTY, GWENDOLYN H 
HANSUR,FRANCINE 
HILAH, LINDA G 
HILLS, ELNOBA Q 
NAHIGIAN, ARCHIE H,JR 
ROSE,* H 
STIRLING,KATHLEEN A 



CLERK $ 5,087.05 

CLERK 1,179.09 

CLERK 2,274.99 

CLERK 3,800.01 

CLERK 2.U99.99 

CLERK 1,179.09 

CLERK 2,384.52 



OFFICE OF HON. IKE SKELTON 

ASCHENBRENNEE, LISA ANN 
AOER.DENISE L 
B0NCH,FRED R 
COH£R,DWIGHT D L 

CORSE, WAHN ETA 
DBOBNY.GWENYTH P 
EDWARDS, GARY L 
HAGEDORN, ROBERT 
HODGES, LINDA L 

HOGAN.JALENA WILSON 
NIERHAN.BERNA DEAN 
O'BRIEN, DANIEL E 
POLLARD, JOHN J, III 
SCOTT, CAROL L 
SEITZ, WANDA JOY 
SHERIDAN, ANTCINETTE E 
ZARAFONETIS, ELAINE H 



STAFF ASSISTANT, FROH AOG 1 TO AUG 31 

CASEWORKER 

STAFF ASSISTANT 

STAFF ASSISTANT, FROH AOG 1 TO AOG 31 
LBJ CONGRESSIONAL INTERN, TO JUL 31 ... 

RECEPTIONIST, TO JUL 31 

LEGISLATIVE AIDE 

ADHINISTRATIVE ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT, TO SEP 18 

OFFICE HANAGER, FROH SEP 19 

STAFF ASSISTANT 

DISTRICT OFFICE STAFF 

COHHUNICATION AIDS 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

LEGISLATIVE CORRESPONDENT, FROH AUG 1 
PERSONAL SECRETARY 



500.00 
,125.00 
,999.99 

,090.00 
,000.00 
,250.01 
,400.00 
,750.00 

425.00 
400.00 
750.00 
374.99 
374.99 
145.00 
150.00 
916.66 
750.00 



OFFICE OF HON. JOE SKOBITZ 

CHAHBSRS, DEBBIE 

CLOOGH,GUY L 

COLLAR, JAHES T 

DESTEFAHO, JANET H 

ELLSWORTH, NANCY LEE SHITH 

GILHAN, GEORGIA L 

HILL, JON CARL 

KARR, DORIS VIRGINIA 

LEHERT.BOLA 

LEONARD, EVAH 

HCDARGH, DOROTHY R 

HOONEY, BOBBY A 

HORELAND,HARY K 

PENNINGTON, VIRGINIA L 
PERDUE, CHERYL A 
PIKE, CHARLES BEUFORD 
RINKEB.JAHES HOWARD 
SHUTE,WILLIAH H 
SHALL, CONNIE BELINDA 



INTERN, FROH JUL 11 TO AUG 19 

EXECUTIVE ASSISTANT , 

INTERN, FROH JUL 11 TO AUG 19 

EXICOTIVE SECRETARY 

RECEPTIONIST SECRETARY , 

INTERN, TO JUL 10 

INTERN, FROH JUL 11 TO AUG 19 

FIELD CLERK 

DISTRICT ADHINISTRATOR 

INTERN, TO JUL 10 , 

STENOGRAFHER 

STAFF ASSISTANT 

CLEBK, FROH AUG 1 TO AOG 31 , 

LBJ CONGBESSIONAL INTERN, TO JUL 31 

FIELI ASSISTANT 

LEGISLATIVE ASSISTANT 

ADHINISTRATIVE ASSISTANT 

PRESS-RESEARCH ASSISTANT 

KS ADHIN ASST 

INTERN, TO JUL 10 , 



780.00 
,249.99 

780.00 
,187.49 
,624.99 

200.00 

780.00 
,750.00 
,562.49 

200.00 
,200.00 
,175.00 

,190.00 
,562.49 
,750.00 
,500.00 
,750.00 
,249.99 
200.00 



OFFICE OF HON. JOHN H SLACK 

ABRAHAH, STEVEN LOUIS 
BAIL BY, JEWELL 
BECKER, PAUL H 
BCTSFORD.PHILLIS A 
DOUGLAS, HARSHA W 
FISHER, EARL P,JR 
FITCH, HICHAEL A 
HICKSON, JOYCE E. 
HODGES, BEBECCA S 
HUNTER, EVA LORRAINE 
HANKIN, NANCY ANN 
HCGINN, DANIEL G 
PAUL.STEPHANNIE STAEKS 

PEBBINE, LISA ANN 
SACKETT,HICHELLE E 
SILVEBSTEIN, ELIZABETH LEIGH 
SBANSON, BETTY ANNE 
WELCH, KEVIN GRANT 
WHITTINGTON,PAUL J. 



CLERK, FBCH JUL 11 TO AUG 5 663.96 

ASSISTANT 1,500.00 

ADHIN-LEGIS ASST 10,112.49 

CLERK, TC AOG 31 1,000.00 

SECRETARY 3,783.33 

LEJ CONGRESSIONAL INTERN, TO AUG 14 865.33 

CLEBK, TO AOG 31 1,000.00 

SECRETARY, TO AUG 31 2,458.34 

RECEPTIONIST 2,250.00 

SECRETARY 4,575.00 

OFFICE HANAGER 9,887.49 

CLERK 2,349.99 

ASSISTANT, TO JUL 31 

ASSISTANT, FROH SEP 1 800.00 

ASSISTANT, TO AUG 31 800.00 

ASSISTANT 5,699.99 

CLERK, FRCH AOG 1 TO AOG 31 500.00 

SECRETARY 4,500.00 

CLERK, FRCH AOG 6 TO SEP 6 ' 621.29 

ASSISTANT 2,750.01 



142 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. NEAL SMITH 

ANDERSON, HELENS F 
CARTES, ELIZABETH C 
COUPAL, JOSEPH, JB 
DAWSON, THOMAS H 
FITZGERALD, EILEEN 
FOX, STEPHANIE 
GLASGOW, HATTIE DIANE 
HA MILTON, NANCY J 
KOTISH, FRANCIS AUGUST 
MCCARTAN, GENEVIEVE 
SIMPLICIO, NANCY R 
STATES, CHERYL C 
VOSTINAR,JO ANN 



SECRETARY $ 2,035.10 

SECRETARY, FROM JOL 21 1,750.00 

SPECIAL ASSISTANT 11,750.01 

ADMINISTRATIVE ASSISTANT 8,750.01 

SECRETARY 2,871.99 

SECBETAEY, TO AUG 16 1,138.57 

SECEETARY 2,199.99 

SECRETARY, FROM JOL 11 2,215.83 

RESEARCH ASSISTANT 3,082.71 

SECRETARY 1,703.19 

SECRETARY 6,000.00 

SECBETAEY 2,100.00 

SECRETARY 2,199.99 



OFFICE OF HON. VIHGINIA SHITI 



BRAYTON, ROBERT O 
BOSH, VIRGINIA A 
DAVENPORT, ROBERT B 
EDWARDS, LOESJE 
FREBDRG, CHARLES E 
HOTTENMAIER, JAMES W 
LAMBRECHT, LINDA KAY 
MOODY, RANDALL J 
MOLLINS, BEVERLY J 
PARTINGTON, JOSEPH R 
BAEEE, RANDALL B 
REYNOLDS, RAND 
ROHRICK, MARTHA K 
SUNDBEEG, SUSAN 
TOVARAZ, BARBARA ANNE 



ADMINISTRATIVE ASSISTANT 

CLEBK, TO AOG 5 

ADMINISTBATIVE ASSISTANT 

CLERK, FEOH ADG 1 

EESEAECH ASSISTANT 

PEESS ASSISTANT 

APPOINTMENTS SECBETAEY .. 

SPECIAL ASSISTANT 

CLEBK 

SPECIAL ASST-DISTBICT ... 

SPECIAL ASSISTANT 

CLEBK, TO JUL 31 

SPECIAL ASST-DISTRICT ... 

RECEPTIONIST 

PERSONAL SECBETABY 



137.50 
972.22 
500.00 
666.66 
,999.99 
550.01 
,875.01 
999.99 
599.99 
,136.01 
999.99 
750.00 
,625.01 
,208.33 
,708.33 



OFFICE OF HON. GENE SNYDEB 

BELL, LISA E 
BOOTH, ANN D 
CLARENDON, SUSANNA E 
EVANS, DELLA A 
EVANS, JACK HAMPTON 
GEOGHEGAN, LINDA L. 
HARSHA, BRIAN 
JORDAN, MAXINE 
KEMEN, DEBBIE A 
KOONTZ.J D 
MAXWELL, NANCY M 
HEUBEB.BUTH M 
SEELEY.SHABON ANN 
STEVENS, DOBOTHY MAE 
TANNEB, WILLIAM E 
THOMAS, ELIZABETH GRAY 
YORK, DAVID A 



STAFF ASSISTANT 

STAFF ASSISTANT, TO AUG 31 

CLEBK 

STAFF ASSISTANT, FROM SEP 6 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

STAFF AIDE 

FIELD REPRESENTATIVE 

STAFF ASSISTANT, TO AUG 5 

DISTRICT OFFICE ASSISTANT 

CLEBK, FROM AUG 29 

CASEWORKER 

DISTRICT OFFICE HANAGBB 

RESEABCH AIDE 



179.91 
121.99 
096.60 
130.91 
798.61 
750.01 
590.00 
983.75 
500.00 
250.00 
972.22 
227.65 
755.55 
125.01 
900.00 
199.99 
155.27 



OFFICE OF HON. STEPHEN J SOLABZ 



ABBATE, PETER J,JR 
BUET,MARY JANE 
COBURNE,HELENE 
COOPEB,SONDRA 
DITTA,CABOL I 
FIOBE, JOSEPH 
GALLAGHEE, AUDEEY 
HOROWITZ, JOSHUA 
ISAACS, JOHN D 
KATZ, SHARON 
LEHNER, VIRGINIA L 
LEWAN, MICHAEL 
LOWENSTEI N.KENNETH 
PADOW, LILLIAN 
RENSHAW, KATHLEEN A 
EOSSAK.JACK 
SILBIGER, STEPHEN 
STOPER, EMILY 
STRICKLETT,JOHN R 
TANNENBAUH.RUTH 
WURF, SYLVIA 



SPECIAL ASSISTANT 3,252.00 

LEGISLATIVE ASSISTANT 3,000.00 

CASE SPECIALIST 600.00 

SECRETARY 2,625.00 

PERSONAL SECRETARY 3,252.00 

AIDE, TO JUL 31 792.00 

SECRETARY 2,625.00 

PRESS SECRETARY 3,750.00 

LEGISLATIVE ASSISTANT 5,709.00 

DISTRICT REPRESENTATIVE 2,081.00 

SECRETABY, FBOM SEP 1 500.00 

ADMINISTRATIVE ASSISTANT 6,252.00 

DISTRICT ADMINISTRATOR 6,000.00 

CASE SPECIALIST 3,000.00 

RECEPTIONIST 2,625.00 

AIDE, TO JUL 31 1,106.00 

LEGISLATIVE ASSISTANT, PROH AUG 1 3,581.00 

LEGISLATIVE ASSISTANT 3,750.00 

STAFF ASSISTANT, FROM ADG 1 TO AUG 31 106.00 

CASE SPECIALIST 3,000.00 

EXECUTIVE ASSISTANT 3,252.00 



143 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HOS. GLADYS NOON SPELLNAN 



BOOTH, KATIE C 
BHOOKS, ROSEBUD H 
DARHODY, BRIAN PAUL 
DA VIS, GWENDOLYN C 
DAVIS, NANCY 
DAVIS, BOTH G 
DOYLE, PETER H 
FRANCOIS, EILEEN H 

GARCIA, CECELIA H 
GBAHBS, PETER H 
GUSKY, DAVID 
HART, LOIS L 
KARTOFEL.HARY 
KAOFHANN.NARLENE H 
KENNEDY, EUGENE ALLEN 
HANION, JUDITH IRENE 
HCLELLAN.EDNA fl 
NISENOFF.FRANCINE K 
RICHARDSON, BETTY S 
RIETZKE, THERESA H 
SCHOETTE, TERRY H 
SEWELL, CHARLES B 
SHAPROTH, FRANK H,JR 
SLAVIN, JEFFREY ZANE 
TARLTON, ELAINE K 

TETLOW,KAYE I 
USILTON, LINDA DOLLY 



RECEETIONIST-DIST OFFICE $ 3,528.33 

RECEPTIONIST 2,372.50 

CASEWORKER AIDE, FROH SEP 1 700.00 

TO JUL 31 7U8.50 

SPECIAL AIDE, FROH SEP 1 400.00 

APPOINTHENT SECRETARY 3,577.33 

SPECIAL AIDE, FROM SEP 16 350.00 

CASEWORKER, TO JUL 31 

RECEPT/CASEWORKER/DIST OFF, FROH SEP 1 2,246.00 

SPECIAL AIDE, FROH AUG 1 TO AUG 31 400.00 

STAFF ASSISTANT, TO AUG 31 1,000.00 

COMMUNICATIONS SPECIALIST, TO JUL 31 786.00 

LEGISLATIVE CORRESPONDENT 4,076.00 

CASEWORKER, FROH AUG 1 TO AUG 31 1,123.00 

CASEWORKER IN CHARGE 4,113.67 

ADMINISTRATIVE ASSISTANT 6,248.64 

LEGISLATIVE ASSISTANT 3,791.17 

EXECUTIVE ASSISTANT 5,822.83 

SPECIAL AIDE, FROH SEP 1 400.00 

CASEWORKER 3,544.00 

CASEWORKER, TO AUG 31 2,100.00 

SPECIAL ASSISTANT 3,389.99 

SPECIAL ASSISTANT, TO SEP 15 2,083.33 

SPECIAL ASSISTANT 3,916.50 

CASE WORKER., FROH AUG 1 TO AUG 15 561.50 

SECRETARY, TO JUL 31 

SECRETARY, FROH SEP 1 1,400.00 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

SPECIAL AIDE, FHOH AUG 1 1,470.00 



OFFICE OF HON. FLOYD SPENCE 

BELL.BELDEN HILL 
BOBEN, FRANCES S 
BRUNSOR, BARBARA ELLEN 
COOK, WILLIAM A 
DEAN,ESTAH ANN 
DERRICK, CHARLES D,JS 
DRAFTS, REBECCA L 
FALLAB, BESSIE S 
HAJEC,ANN H 
HIXON, ELIZABETH F 
JAMES, JERRY PRESTON 
LOADHOLT.L REBECCA 
METZ, CRAIG H 
MORGAN, CHARLES KEITH 
OLSON, KATHARINE JOHNS 
ONEAL, SHIRLEY H 
POWELL, CHESSYE B 
PRICE, SUSAN ELIZABETH 
SANDERS, WALTER L 
SIMS, LAMA H,JR 
SHITH, SHARON LYNN 
UPRIGHT, LORI E 
WANNAMAKER, JULIA S 
WEEKS, KATHLEEN H 



RESEARCH ASSISTANT 1,749.99 

SECRETARY 2,400.00 

INTERN, 10 JUL 31 350.00 

ADMINISTRATIVE ASSISTANT 10,183.74 

INTERN, TO JUL 31 350.00 

ASST TO DIST REP 3,406.98 

SECRETARY 2,750.01 

DISTRICT SECRETARY 4,297.47 

CLERK, FROH AUG 1 960.00 

SECRETARY 3,500.01 

LEGISLATIVE AIDE, FROH JUL 11 4,444.45 

SECRETARY, FROH AUG 1 1,450.00 

INTERN, FROM AUG 1 TO AUG 31 350.00 

LBJ CONGRESSIONAL INTERN, AUG 1 - AUG 31 590.00 

SECRETARY, FROH SEP 12 506.67 

EXECUTIVE SECRETARY 6,750.00 

SECRETARY 3,249.99 

INTERN, TO JUL 31 350.00 

DISTRICT REPRESENTATIVE 5,783.55 

INTERN, TO JUL 31 350.00 

INTERN, FROH AUG 1 TO AUG 31 350.00 

INTERN, FROM AUG 1 TO AUG 31 350.00 

SECRETARY 1,950.00 

SECRETARY 2,975.01 



OFFICE OF HON. HARLEY STAGGERS 



AHBROSB,SHEILA ANN 
CHESHIRE, ALHEDA H 
CONNOR, JAMBS R 
FURFAR I, MARGUERITE 
GHONDALSKI, CATHERINE 
JOHNSOH, WILLIAM H 
JORDAN, PHILIP B,JB 
KUHN,SARA E 
HCELVAIM, CAROLE A. 
MEDLIB, LOUISE D 
NELSON, HARTHA SHARYN 
VARNER,JEAM G 



CLERK 3,013.86 

CLERK 2,172.12 

STAFF ASSISTANT 9,077.64 

ADMINISTRATIVE ASSISTANT 10,183.74 

CLERK 2,751.78 

CLERK 2,158.59 

CLERK 3,636.30 

CLERK 3,564.21 

EXECUTIVE SECRETARY 6,420.27 

CLERK 4,527.36 

CLERK 2,489.70 

CLERK 5,571.30 



144 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. ARLAN STANGELAND 



BAGNE, NANCY 
BEARD, EDWINA H 
CHRISTENSEN,NADA B 
CONNOR, LINDA MAE 
FAULKNER, SCOT MCDONALD 
FREER, LYLE LEROY 
GALL, MICHAEL 
GENERO,LAORA 
HAASSER, ANTHONY E 
HENNIGE, LUCILLE H 
KONZ, BELINDA A 
LEONARD, FRANK M 
LOMAX, WILLIAM L 
LONA,MARLENE 
MEEKS, JOHN 
MOEBIOS, GLORIA 
ONSGARD, PHYLLIS 
STEWART, JACK 
VAYDA,ANN 



CLERK TYPIST, TO JUL 31 $ 600.00 

PERSONAL SECTY/OFFICE MANAGER 3,833.33 

CASEWORKER 3,041.67 

LEGISLATIVE ASSISTANT 5,000.00 

LEGISLATIVE AIDE., FROM JUL 15 2,533.33 

FIELD REPRESENTATIVE 3,500.01 

LEJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

RESEARCH ASSISTANT 3,974.33 

FIELE REPRESENTATIVE 3,500.01 

SECRETARY - CORRESPONDING 3,000.00 

SECRETARY-RECEPTIONIST 2,416.66 

COMMUNICATIONS SPECIALIST 5,499.99 

SPECIAL ASSISTANT 2,250.00 

CASEWORKER 3,666.67 

SPECIAL ASSISTANT 4,874.99 

SECRETARY/RECEPTIONIST 2,416.66 

DISTRICT AIDE 4,749.99 

AEMINISTBATIVE ASSISTANT 7,091.67 

CLERK TYPIST 1,800.00 



OFFICE OF HON. J WILLIAM STANTOf 



aronson, harold l,jr 
b:*rgwall,carla 
boepple,lisa e 
connell,jean 0. 
court, evelyn l 
cross, jeffrey d 
day, trudy m 
gambal.alex 
gray,arlene a 
hardgrove, robert f 
klepek,mary ellen 
maxwell, jean 
mcgloon,shirlee e 
o'conor, william c 
reilly, patsy h 
rielley, susan 
stockdale, helen gray 
walker, bonnie marie 
whiteside, lillian r 



SMALL BUSINESS COMM STAFF ASST .. 

SECRETARY 

LEGISLATIVE ASSISTANT 

SECRETARY 

SECRETARY 

INTERN, FROM AUG 1 TO AUG 31 ... 

SECRETARY 

SECRETARY 

DEPARTMENTAL ASSISTANT 

LEGIS 6 PRESS ASST 

SECRETARY, FROM SEP 15 

LEGISLATIVE SECRETARY, TO AUG 12 

ADMINISTRATIVE ASSISTANT 

CLERK 

CASEWORKER 

SECRETARY/INTERN, FROM SEP 1 ... 

MANAGER, MANTUA DIST OFF 

SECRETARY 



,000.01 
,375.00 
,000.01 
,586.31 

750.00 

666.67 
,681.34 

333.33 
,504.70 
,875.00 

488.89 
,223.01 
,417.99 
,500.00 
,749.99 

666.67 
,275.94 
,886.94 
,708.05 



OFFICE OF HON. FORTNEY H (PETE) STARK 



BURR,JUSTYNA BECKWITH 

CARUTHERS, GLORIA V 

CAZENAVE, MARTHA JO 

CHATTHAN,QUINTELLA LORRAINE 

COPELAND, JAMES H,JR 

GAIL, DANIEL BENJAMIN 

GRAYKOWSKI,JOHN E 

HARRIS, KATHHYN 

HUNT, HARRIET G 

HYDE,GAYE C 

JANET, BERNADETTE J 

KIEFER, FRANK WALTON 

LIMON, TERESA RUTH 

HCCANN, ELIZABETH H 

HUMPHARD,ELLA M 

SIMON, NEIL A 

SMITH, CARLA DILLABD 

STONE, PEGGY A 

STONE, PEGGY ANN 

STOVER, BETSY ANN 

WILKIE, EDITH B 



LEGISLATIVE ASSISTANT 

SECRETARY 

DISTRICT REPRESENTATIVE 

AIEE, EBCH AUG 15 

EXECUTIVE ASSISTANT 

STAFF ASSISTANT, TO AUG 31 

LEGISLATIVE ASSISTANT 

PERSONAL ASST 

STAFF ASSISTANT 

CASE WORKER 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

PRESS ASSISTANT 

CASE WORKER 

PERSONAL ASST 

OFFICE MANAGER 

STAFF ASSISTANT 

AICE 

STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT., FROM SEP 1 

LEGISLATIVE AIDE 

ADMINISTRATIVE ASSISTANT 



,750.01 
,403.99 
,250.01 
,021.80 
,300.00 
,882.50 
,750.00 
,291.66 
,000.00 
,000.00 
590.00 
,500.00 
,750.01 
,249.99 
,075.00 
,625.00 
,250.01 
583.33 
750.00 
,000.00 
,583.34 



OFFICE OF HON. TOM STEED 

CARR, MYRTLE E 
CLARK, WILLIAM VAUGHN 
CLEMENCE, MARTHA 
FOGLEMAN,THELMA C 
GATEWOOD, HARRY D,II 
GREEN, ANNE RALLS 
LOGAN, JAMES 8 



OFFICE CLERK 641.91 

RESEARCH ASSISTANT 5,000.01 

CLERK 2,599.99 

SECRETARY 6,875.01 

STAFF INTERN 1,550.00 

CLERK 3,999.99 

STAFF ASSISTANT 4,500.00 



145 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. TOH STEED -CCNTINOEC 



LYNCH, KATHLEEN W 
MOKBIS, CECIL EOGENE,JR 
NELSON, JOHN B 
PIPES, KEVIN BLAKE 
RICHARDSON, TRUBAN 
TSOTRAS, FRANK G 



OFFICE CLERK $ 6,375.00 

INTERN, TC AUG 20 361.11 

STAFF ASSISTANT 999.99 

STAFF ASSISTANT 1,500.00 

ADHINISTRATIVE ASSISTANT 10.183.7U 

4,749.99 



OFFICE OF HON. NEBTON I STEEPS JR 



ALBERT, SOSAN M 
ABBRUSKO, DONNA HANSON 
A7ANCENA, ROBERTA J 
BLEE, DAVID COOPER 
BLCOD, BEVERLY F 
DICKERSON.LISA L 
FINEBAN, JONAS B 
GOLDMAN, PATRICIA A 
GRIGG.SILLIAB H 
JACOBS, STEPHEN IRA 
KLINE, HERBERT B 
KNIGHT, PETER EDWARDS 
LOKAX,BILLIAB L 
BALLEN,LISA RENEE 
BORPHY, KENNETH B 
OBRYON, DAVID S 
PERSONS, SANDFORD Z 
SANKIN, ANDREW C 
SCHISZIK, KEITH N 
SHAPIRO, GRACE 
SINGER, HARTIN H 
WIHS,B GREGORY 



CASE WORKER 

SECRETARY 

LEGISLATIVE ASSISTANT 

AICE 

CASE ASSISTANT 

LBJ CONGRESSIONAL INTERN, TO JOL 31 ... 

SPECIAL PROJECTS AIDE 

STAFF ASSISTANT, TO JUL 15 

ADHINISTRATIVE ASSISTANT 

LEGISLATIVE AIDE 

STAFF ASSISTANT 

LEGISLATIVE AIDE 

SPECIAL ASSISTANT 

RECEPTIONIST 

STAFF ASSISTANT, FROB AOG 16 TO SEP 15 

FIELD OFFICE DIRECTOR 

STAFF ASSISTANT., FROH SEP 16 

AICE, FRCH JOL 16 TO AOG 15 

SPECIAL FROJECTS ASSISTANT 

EXICOTIVE SECRETARY 

LEGISLATIVE AIDE 

FIELD REPRESENTATIVE 



,410.01 
,322.74 
,999.99 
,375.01 
,192.51 

590.00 
,675.00 
50.00 
,498.76 
,199.99 
,499.99 
,375.01 
,250.00 
,875.00 
,555.58 
,999.99 

500.00 
,000.00 
,571.51 
,500.01 
,541.66 
,543.75 



OFFICE OF HON. BILLIAB A STEIGER 



ANDRICH.HARK C 
BLOCK, BARK JON 
DR0MBY,BA0REEN 
DYKSTRA,JABES H 
ESSLINGER, PATRICIA A 
FARNSBORTH, KATHLEEN I 
FERGOT,LOA H 
FOSS,HARYALYCE R 
HALE, JOHN B 
HOGOE, PATRICIA W 
HOON.HICHASL JAHES 
HONNETTE.BARILYN G 
PATTON,LYNN B 
PEIGLER,SARA L 
SEEFELDT, FREDERIC A. 
SHAW, JACK 
STANTON, LOCI NDA 
VARGO,NANCYE S 



LEGISLATIVE AIDE 3,152.49 

LEGISLATIVE AIDE 2,874.99 

ADHINISTRATIVE ASSISTANT 6,448.77 

PRESS SECRETARY 5,340.75 

SECRETARY 3,249.72 

STAFF ASSISTANT 3,144.90 

ASST HOBE SECY 3,077.91 

SECRETARY 2,568.33 

CLERK 1,666.67 

LEGISLATIVE AIDE 3,593.24 

LEGISLATIVE ASSISTANT 5,390.76 

CLERK 3,013.86 

DISTRICT CFFICE ASSISTANT 1,441.41 

CASEWORKER 6,395.58 

HOBE SICFETABY 4,285.56 

LEGISLATIVE AIDE 4,125.00 

LBJ CONGRESSIONAL INTERN, TO JOL 31 590.00 

SECRETARY 3,649.41 



OFPICE OF HON. DAVE STOCKHAN 



ANDERSON, ELEANORA B 
ANGEL, BARK A. 
BJES,THERESE BABY 
BRIAND,BICHAEL KEITH 
DAVIS, B J 
GERSON, DAVID B 
GLOBENSKY, JANET LEE 
HABPTON, DAVID CHARLES 
KHEDOURI, FREDERICK N 
KLYCE, VIRGINIA 
LACKIE, RICHARD D 
BORAN, DONALD B 
BORPHY, ROBERT E,JR 

RYAN, BORA L 
STODDARD, SARAH K 
STPAYER.JOHH W 
SWEET, STUART 
SWINSON,LISE B 
TELLHAN,BARY K 



STAFF ASSISTANT, TO AOG 31 800.00 

STAFF ASSISTANT., FBOB AOG 1 TO AOG 31 200.00 

DISTRICT SECRETARY, FROB SEP 25 150.00 

LEGISLATIVE ASSISTANT, PROH SEP 26 166.66 

DISTRICT OFFICE BANAGER 6,500.01 

AEBINISTBATIVE ASSISTANT 7,357.57 

DISTRICT SECRETARY 2,124.99 

DISTRICT REPRESENTATIVE 3,000.00 

LEGISLATIVE DIRECTOR 6,000.01 

STAFF ASSISTANT, FROB SEP 19 316.67 

DISTRICT REPRESENTATIVE 4,749.99 

LEGISLATIVE ASSISTANT 4,961.10 

PRESS SECRETARY, TO JOL 31 

PRESS SECRETARY, FROB AUG 5 5,000.01 

LEGISLATIVE SECRETARY., FROB AOG 11 1,319.45 

SECRETARY, TO AOG 31 2,166.66 

LEGISLATIVE CORRESPONDENT 2,250.00 

DIR BEPB TASK FORCE/ECONOHIC POL, FROB SEP 1 . 500.00 

SECRETARY 2,124.99 

LEGISLATIVE ASSISTANT, TO SEP 9 2,012.50 



146 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. DAVE STOCKMAN -CONTINUED 



TEVOEDJRE,HARY ELLEN 
OPTON, FREDERICK S 
WALTHER,DEBOFAH R 



PERSONAL SECTY/OFFICE MANAGER $ 3,999.99 

PROJECT DIRECTOR 2,199.99 

SECRETARY, TO AUG 5 826.39 



OFFICE OF HON. LOOIS STOKES 

BENSON, EDITH 

BRACY-JONES.MABGUERITTE KEA 

CHATHAM, ANNA 

CLEMONS.LORI 

CONNER, JUANITA 

FANN, ERNEST L 

GILBERT, JEWELL 

GREEN, LYNNE 

HARPER, JAMES C 

HOBBARD, DEBORAH A 

HUTCHINSON, YVETTE 

JACKSON, LYDIA 

JENKINS, JACQUELYN R 

MATUSZEWSKI, EDWARD F 

MCHURRAY.JACQUETTA L 

QUA, PAUL B 

THOMAS, ALETHA 

THOMPSON, MARY HELEN 

WEEDEN,JOHN T 

WHEELER, AARON 

WHITE, MATTIE JOANNE 

WILLIAMS, KARLA G 



ADMINISTRATIVE ASSISTANT 1,113.62 

LEGISLATIVE ASSISTANT 1, 250. 01 

COMMUNITY AIDE 1,886.9a 

FECM SEP 1 266.67 

EXEC SECTY/SENIOR CASEWORKER 2,000.01 

CONGRESSIONAL AIDE, TO AUG 31 3,319.62 

SECRETARY 2,890.08 

3,106.98 

ADMINISTRATIVE ASSISTANT 10,183.71 

LEJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

LEGISLATIVE AIDE 2,750.01 

2,9 35.23 

2,7 51 .78 

MILITARY ASST 1,375.89 

RECEPTIONIST 2,199.99 

TO JUL 31 1,000.00 

ASSISTANT LEGISLATIVE CLERK, AUG 1 - AUG 31 .. 1,500.00 

PRESS AIDE 3,538.02 

1,021.0 2 

ADMINISTRATIVE AIDE, FROM AUG 7 3,000.00 

STAFF ASSISTANT 3,538.80 

INTERN, TO JUL 31 516.67 



OFFICE OF HON. SAMUEL S STRATTON 



BABBAROTTA, LINDA 
CROKEN.MARY E 
DEVITO, ELAINE T 
ELDRIDGE, ALEXANDER H 
HELFRICH,LANA R 
JACKSON, ALICE C 
JACOBS, BETH E 
KEHOE,DORTHI H 
LESLIE, MARY B 
MOTT, ROGER A 
QURESHI.HALIH 
SCIULLA, MICHAEL G 
SEEGER, KRISTIN L 
STEENBURGH,M BETH 
TEBBANO.MARK S 



DISTRICT SECRETARY 

CLERK 

LEJ CONGRESSIONAL INTERN, TO JUL 31 

CASE WORKER 

SECRETARY 

CLERK, TO AUG 6 

CLERK 

SECRETARY 

ADMINISTRATIVE ASSISTANT 

SECRETARY 

LEGISLATIVE ASSISTANT 

PERSONAL SECRETARY 

SECRETARY, FROM JUL 5 

DISTRICT REPRESENTATIVE 



625.00 
500.01 
625.01 
590.00 
669.06 
121.99 
708.00 
875.01 
875.01 
125.00 
150.00 
000.00 
500.00 
219.99 
150.00 



OFFICE OF HON. GERRY E STUDDS 



ALLIS, SAMUEL G 
BARATTA, CYNTHIA C 
BERLIN, TRUDI A. 
BLACKWOOD, KRISTINE 
BUTLER, MARY LOU 
CODDINGTON,LYNN 
CURBY, JUDITH A 
DAWSON, ISABEL A 
ELIOT, EDWARD E 
FLEISCHER, ROBERT PETER 
FTOHEK, SUSAN G 
GARDE, MAUREEN E 
HILLER,JULIA MYRL 
ROSA.DBONILDA M 
ROSS.AILEEN M 

SANDS, CHRISTOPHER H 
SASSO.JOHN R 
SEE, ALEXANDER H 
SKOLE8, ELAINE S 
TONASIA, MARIA A 
WELLS, LINDA 
WOODWARD, WILLIAM H 



ADMINISTRATIVE ASSISTANT , 

LEGISLATIVE AIDE, TO JUL 31 

SECRETARY, FROM AUG 1 , 

LEGISLATIVE AIDE, FROM SEP 1 

CASEWORKER 

STAFF ASSISTANT., FROM AUG 1 TO AUG 31 

ASSISTANT, TO JUL 31 

REGIONAL REPRESENTATIVE 

LBJ CONGRESSIONAL INTERN, TO JUL 31 .... 

PRESS SECRETARY 

CASEWORKER , 

CASEWORKER , 

SECRETARY 

CASEWORKER , 

SECRETARY, TO JUL 31 

LEGISLATIVE CORRESPONDENT, FROM AUG 5 , 

SPECIAL ASSISTANT , 

REGIONAL REPRESENTATIVE 

REGIONAL REPRESENTATIVE , 

CASEWORKER 

CASEWORKER 

SECRETARY , 

LEGISLATIVE ASSISTANT 



,801.19 
215.33 
,500.0 
666.66 
320.76 
918.00 
687.50 
679.51 
590.00 
,771.99 
,317.50 
,317.50 
,758.25 
,918.76 

,619.96 
,876.00 
,681.99 
,679.51 
173.75 
559.81 
,150.01 
712.19 



147 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. BOB STOMP 

BARTHOLOMEW, BETTY 
BIVONA,JO ELLEN 
BR00KS,RUTH ANN 
JACKSON, LISA ANN 
L« ECOYER, ROBERT ABEDEE 
LASSILA.ARLENE Y 
MCDONALD, EDNA H 
HERRITT, JABES BBENT 
BONOZ, DOROTHY J 
SEAL, BETTY B 
SHAFFBAN,JOAN GLORIA 
SDLLIVAN,TOH B. 
THOBPSON,CHABLES P 
TIEDE,HARSHA A 
YELVEBTON, LINDA DIANNE 
ZOTES, SPRING 



LBJ CONGRESSIONAL INTERN, TO ADG 5 S 688.33 

RECEPTIONIST-SECRETARY 3, 624.99 

SECRETABY, FBOB SEP 1 716.67 

LEGISLATIVE ASSISTANT 3,999.99 

SPECIAL BEPBESENTATIVE 5,416.67 

ASSISTANT 4,250.01 

DISTRICT REPRESENTATIVE 4,250.01 

SPECIAL ASSISTANT 3,000.00 

ASSISTANT U,250.01 

CASEWORKER 4,250.01 

STAFF ASSISTANT, TO JUL 31 250.00 

PROJECTS COORDINATOR 5,000.01' 

ADMINISTRATIVE ASSISTANT 8,750.01 

SECRETARY 3,366.60 

SECBETARY 3,083.33 

CLEBK INTERN, TO JOL 31 550.00 



OFFICE OF HON. STEVEN D SYBBS 



BENNETT, C GAYE 
BIEBEB.ALANE E 
CHENOWETH, HELEN 
CHIPBAN, BEVERLY DEE 
CORY, ROBERTA ROTH 
EDDINS, HAROLD B,JR 
FERGUSON, ROBERT E H 
GABBY, SANDRA F 
HENDERSON, ALFRED B 
INGRAB,SOLVEIG B 
LAURENCE, BABY E 
LAY, CHRIS D 
LONDY,BARGABET 
RIPLEY, DIIGHT W 
SHITH,ERALEEN G 
SBITH, ROBERT L 
SOTEBOP00LOS,RITA HAHIE 
TEWALT, SANDRA K 
WASEB,LABBY L 
YOUNG, PENNY B 



SECRETABY 

SECRETARY 

RESOURCE ASSISTANT, FROB SEP 1 .... 

SECRETARY, FBOB SEP 16 

LEJ CONGRESSIONAL INTERN, TO JOL 31 

RESEARCH ASSISTANT 

CLERK 

FIELD DIRECTOR 

SECRETARY 

SECRETARY . 

LEGISLATIVE ASSISTANT 

SECRETARY 

CERTIFIED ACCOUNTANT 

SECRETARY 

ADMINISTRATIVE ASSISTANT 

SECRETARY ■ 

SECRETARY i 

CASE WORKER., TO ADG 31 , 

PRESS ASSISTANT 



450.00 
158. 34 
000.01 
833.33 
300.00 
590.00 
100.00 
162.50 
999.99 
a99.99 
624.99 
000.01 
500.01 
1*50.00 
500.01 
7K9.99 
866.67 
000.00 
166.66 
200.00 



OFFICE OF HON. GENE TAYLOR 

ALLEN, KENNETH B 
BALDWIN, BARTIN JOSEPH 
BARBER, ROBERT JULIAN 
CRUME, BONNIE JEANE 
DONEGAN,HICHAEL P 
FSAZIEB, DEBORAH J 
HENSON, GERALD L 
HOBBS, DENNIS LEE 
BCDONALD,ANN 
NODLER,GARY W 
SBITH, JANIS F 
WATKINS, FRANCES A 
SHITE, 8EA 
BILL TABS, STEVEN 



LBJ CONGRESSIONAL INTERN, TO JOL 31 

PRINTING CLEBK, FROB SEP 1 

CLERK 

CLERK 

RESEARCH ASSISTANT 

CLERK HIRE, TO JOL 31 

ACHINISTRATIVE ASSISTANT , 

CLERK 

CLERK 

CLERK 

CLERK HIRE , 

EXECUTIVE SECRETARY 

CLEBK 

CLERK HIRE, FROB SEP 1 



590.00 

791.67 
,000.01 
,013.86 
,750.00 

590.00 
,251*. 13 
,597.82 
,022.85 
,586.31 
,1*99.99 
,125.00 
,100.00 

833.33 



OFFICE OF HON. OLIN E TEAGDE 



BALE, MARGARET J 
BROOKS, LEILA WINSTEAD 
COOPER, DON 
COLLINAH, GERALD 
DONOVAN, GEORGE J 
EDWARDS, T CHET 
FISHER, JULIA B 
FLETCHER, DIANE LYN 
GARRETT, ROY C 
GYOVAI, ROBIN B 
LOCKETT, AUDREY A 
LOCKETT, JABES D 
BARBA.KATHRYN GRACE 
HITCHELL, COLLEEN H 
PITNEB.BOBEBT N 
RIDEOUT,B0TH R 



SECRETARY 

SECBETARY 

CLERK 

CLERK, FRCH SEP 1 

CLERK, TO AOG 31 

RESEARCH ASSISTANT, TO SEP 15 

CLEBK, IHCH SEP 1 

CLEBK 

ADMINISTRATIVE AIDE 

SECRETARY 

SECBETARY 

CLERK, TO AOG 31 

CLERK, TO AUG 31 

CASEWORKER 

STAFF ASSISTANT 

CLERK 



308.01 
500.01 
121*. 99 
1*16.67 
250.00 
642.75 
625.00 
625.00 
337.51 
500.01 
000.01 
628.98 
033. 3U 
749.99 
048.29 
620.74 



148 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. OLIN E TEAGDE -CONTINUED 



SEIVERT, DORIS 

TOMME,PAUL 

WOODARD, DONALD MORRIS 



PRESS AIDE $ 3,632.37 

CLERK, TO AUG 31 1,250.00 

CLERK 943.17 



OFFICE OF HON. FRANK THOMPSON JR 



BROWN, DANIEL ROBERT 
CONNIFF, MARGARET R 
DEGASPERIS.REGINA 
DEITZ, WILLIAM T 
EDWARDS, CONLEY,JR 
GABERLAVAGE, GEORGE J 
GELMAN,JOANN K 
GOODE, CHERYL D 
INGELS,ANNA B 
LA MORA, MARIA 
PAMPLIN, HOWARD EDWARD, JR 
REVELES, ROBERT A 
RIOPEL, JOSEPH ADRIAN, JR 
SAAMS, VIRGINIA H 
SIMMONS, JUDITH H 
STONE, ELEANOR B 
SULLIVAN, KATHLEEN M 
WOODSON, S HOWARD 



ASSISTANT 2,897.61 

RECEFTICNIST-SECRETARY 3,750.00 

CLERK 4,204.74 

ADMINISTRATIVE ASSISTANT 10,738.08 

CLERK 1,572.45 

LEGISLATIVE AIDE 3,175.36 

CLERK 1,667.74 

RECEPTIONIST, FROM SEP 19 266.67 

3,658.33 

CLERK, TO JUL 15 175.00 

CASE WORKER 2,750.01 

EXECUTIVE SECRETARY, TO SEP 18 9,259.25 

LBJ CONGRESSIONAL INTERN, TO AUG 21 1,003.00 

CLERK 2,878.71 

SECRETARY-CASE WORKER 5,946.03 

2,670.6 

SECRETARY 3,902.16 

CLERK 2,725.36 



OFFICE OF HON. CHARLES THONE 



BRUCE, IHOGENE P 
BRUNKOW, BARBARA J 
DEITEHEYER.BAHONA W 
HANLON,JOHN R 
HARDEE, JAMES DUNWOODY JR 
HASSELBALCH, MARILYN J 
JENKINS, MICHAEL H 
JOHNSON, LOWELL C 
MUELLER, WILLIAM J 
MUFFLY, DANIEL C 
NOBLE, LOIS M 
PALMER, WILLIAM H 
PARDE,FRANCEIL M 
PECKHAM, VICTORIA B 
PIEPER, LINDA L 
ROCK, MICHAEL J 
SCHMIDT, MARGARET A 
SHAMBERG, LINDA 
SIMPSON, PAMELA W 
WALKER, LINDA CAROL 



DISTRICT OFFICE MANAGER 

CLERK TYPIST 

SECRETARY 

DIST OFF COORDINATOR 

STAFF ASSISTANT, FROM SEP 1 

ASSISTANT 

LBJ CONGRESSIONAL INTERN, TO AUG 5 

FIELD REPRESENTATIVE 

STAFF ASSISTANT, TO AUG 31 

STAFF ASSISTANT., TO AUG 31 

SECRETARY 

EXECUTIVE ASSISTANT 

SECRETARY, TO SEP 15 

RESEARCH ASSISTANT 

CLERK TYPIST 

STAFF ASSISTANT 

SECRETARY 

LEGISLATIVE CORRESPONDENT 

STAFF ASSISTANT 

LEGISLATIVE SECRETARY 



,248.76 
,000.01 
,090.00 
,837.50 

800.00 
,974.99 

688.33 
,524.99 
,200.00 
,333.34 
,498.76 
,121.24 
,518.75 
,322.49 
,499.99 
,049.99 
,062.49 
,000.00 
,500.01 
,625.00 



OFFICE OF HON. RAY THORNTON 

ADAMS, GRETCHEN 

CUNNINGHAM, JAMES PERCY 

DEGOSTIN, LUCILLE KELLY 

GLASGOW, RAMONA C 

HARRIS, JAMBS 

HEACOCK, MARIE B 

HENRY, BARBARA D 

JATKOWSKI,MARY C 

JOLLEY,ROSE 

LANCASTER, SUSAN MCMILLAN 

MCDONALD, JULIE W 

NASH, SUSAN 

PLASCHKO,PAUL K. 

RAYSOH, JOSEPHINE 

HUMPH, ALICE C 

SWEET, BARBARA A 

THOMPSON, CHARLES NICHOLAS 

TOOTHHAN.SANDEE 

WAGNON,TED W 



LEGISLATIVE COORDINATOR 

FROM SEP 1 

SPECIAL LEGISLATIVE ASSISTANT, TO AUG 31 

PRESS-RESEARCH ASSISTANT, FROM SEP 1 ... 

SECRETARY 

FECM AUG 1 

APPOINTMENTS SECRETARY 

DISTRICT OFFICE SECRETARY 

ADMINISTRATIVE ASSISTANT 

EXECUTIVE SECRETARY 

STAFF ASSISTANT, FROM AUG 1 TO AUG 31 .. 
FROM AUG 22 

CASE WORKER 

TO JUL 31 , 

PRESS-RESEARCH ASSISTANT, TO AUG 12 



624.99 
916.67 
666.66 
166.66 

,583.33 
937.49 
416.66 

,225.00 
687.51 

,875.01 
000.01 
975.01 
500.00 
408.33 

,270.83 

,374.99 
700.00 

,125.00 
391.66 



149 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. BICHAED A TONBY 



ALFONSO, JANICE D 
ASSVEDO,JERARD A 
BRCBNFIELD,NELWYN G 
CHRISTENSEN,DALE H 
COLOBBO.JOY B 
DAVIS, BETTY 
FEINGERTS, JANE E 
FIRBIN, GLORIA 
ISTPE,MELVIN PHI1LIP 
JACKSON, ABA JEAN 
HILLEB,SANDBA 
MOLERO,JEANNETTE N 
POPKIN, NATHAN S 
BEED.BROCE G 
BOIG, LINDA 
TAHDO,RON 
BILLIAMS, PATRICIA B 



RECEPTIONIST, TO AUG 27 $ 1,330.00 

BEGIONAL OFFICE MANAGER, TO AOG 27 3,800.00 

LEGISLATIVE COBBESPONDENT, TO AOG 27 1,900.00 

OFFICE MANAGER, TO AUG 27 2,533.33 

PERSONAL SECBETARY, TO AOG 27 2,375.00 

CLERK, TC AOG 27 1,520.00 

BECEPTIONIST, TO AOG 27 1,583.33 

FIELD REPRESENTATIVE, TO AOG 22 2,022.23 

CASE BOPKER., TO AOG 27 1,81*3.63 

CASE BORKER., TO AOG 27 2,375.00 

PBESS SECBETABY, TO AOG 27 1,900.00 

CLERK, TO AOG 27 1,520.00 

LEGISLATIVE ASSISTANT, TO AOG 27 4,275.00 

DIST OFFICE HNGR, TO AOG 27 2,850.00 

CLERK TYPIST.., TO AOG 27 950.00 

DISTRICT FIELD REPRESENTATIVE, TO AOG 27 5,953.33 

CLERK, TO AOG 27 1,472.50 



OFFICE OF HCN. ROBERT TRAXLEB 



BOHM.KATHRYN H 
BR HEN, SALLY JO 
COBBIN,BETH T 
GILBARTIH.BILLIAB J 
GILSON,HARLA 
HANSON,ANDBEB 
HABE, DONALD L 
HEBITT.ROBEN D 
JONES, ELLEN ELIZABETH 
BONDOL.RAJKOBARI 
PEASNEB, DEBABAH G 
ROGERS, THOBAS A 
ROSENTHAL, ELVA J 
SCHBABTZ, DENNIS B 
SHORE, MICHAEL S 
STORCK,JEAN THOHAS 
SZEBRAJ, ROGER E 
VOISINE.LOIS H 
VOISINE,BABJORIE A 
BOODFIN,JANE DEE 



CASEBOBKFB 

STAFF ASSISTANT 

STAFF ASSISTANT 

RESEARCH ASSISTANT 

STAFF ASSISTANT 

LBJ CONGRESSIONAL INTERN, TO JOL 31 ... 

DISTRICT REPRESENTATIVE 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STIFF ASSISTANT, TO JOL 31 

CASEBORKER 

STAFF ASSISTANT 

STAFF ASSISTANT, FROM AOG 1 TO AOG 31 

STAFF ASSISTANT 

RESEARCH ASSISTANT 

CASEBOBKER 

STAFF ASSISTANT, TO AOG 10 

LEGISLATIVE ASSISTANT 



971*. 99 
,250.00 

750.01 
.500.01 
,2U9.99 

590.00 
,950.01 
,627.78 
,375.00 
,500.01 
,375.00 

590.00 
,750.01 
,500.01 
,«16.67 
,250.00 
,500.01 
r 2K9.99 
,000.00 
,250.01 



OFFICE OF HON. DAVID C TREEN 



ARCENEAOX,HARY BETH 
BRINKBANN,EBILE J 
CARNEY, BILLIAB KIRK 
DAOGHEBTY, MICHAEL DENNIS 
D0BOND,LINDSEY L 
EDDIHGTON,HEBBEBT H 
GIANELLONI,V J, III 
GLASS, NAOMI 
HARDY, LAOFA E 
BOLLIRGSBOBTH, BARB ABA 
HOBNEHAN,BARIHELEN 
KING, ALICE B 
BCNEAL, ELIZABETH K 
BENVILLE, OLIVE C 
BILLEB, DAPHNE B 
BIVEBS.JOHN S 
3ENESE, DONALD J 
BOCDLEY,CLABICE E 
WOODWARD, KATHERINE F 



LBJ CONGRESSIONAL INTEBN, TO AOG 1tt . 

PUBLIC RELATIONS ASST 

DISTRICT ASSISTANT 

LEGISLATIVE ASSISTANT 

DISTRICT ASSISTANT 

SPECIAL ASST-DISTRICT 

DISTRICT REPRESENTATIVE 

EXECUTIVE SECBETARY (C) , FBOB JOL 18 

SECBETARY 

LEGISLATIVE SECRETARY 

EXEC SECTY 6 SPEC ASST 

DISTRICT ASSISTANT 

BECEPTIONIST-TYPIST 

SECBETABY 

RESEARCH ASSISTANT 

ADBINISTBATIVE ASSISTANT 

RESEARCH ASSISTANT 

SPECIAL ASSISTANT 

CASEBORKER 



865.33 
,000.01 
,1*99.99 
,1*99.99 
,050.00 
,200.00 
,750.01 
,258.33 
,350.00 
,000.00 
,250.00 
,800.00 
,900.00 
,950.00 
,000.01 
,750.00 
,666.66 

300.00 
,999.99 



OFFICE OF HON. PAOL S TRIBLE JB 



BERKOBITZ, LESLIE A 

BLACKBON.HOBABD 

BOBEM, ALICE B. 

DOERFLEIN, BEVERLY P 

EDBARDS III, RICHARD AOGOSTOS 

FASS, BENDY BETH 

FOEDE, IRENE B 

GOODSON.PAX A 

GORDON, SOSAN F 

GBEGOBY.CABLYLE 



SECRETARY 

CLEBK, FROB AOG I* TO SEP I* 

CLEBK 

SECRETARY 

ADBINISTBATIVE ASSISTANT 

CLEBK, TO AOG 15 

LEGISLATIVE EESEABCH ASSISTANT 

LBJ CONGRESSIONAL INTEBN, TO JOL 31 
LEGISLATIVE ASSISTANT, FBOB SEP 1 « . 
CLEBK 



,099.99 
516.67 
,000.00 
,371*. 99 
,21*9.99 
,22«. 25 
,000.00 
590.00 
1*95.83 
,750.01 



150 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. PAOL S TRIBLE JR -CONTINUED 



HEATER, ELIZABETH DUNN 
HOLLOHAN, ANGELA L 
JESSIE, RUTH P 
MILLER, JEANNE (1 
NOHEIKO, ELIZABETH C 
OBRIEN.MARY LOU 
PARKER, STEVEN CRAIG 
PECK, KENNETH ELDON 
POWELL, JAMES H 
RUSSELL, DENNIS GEOFFREY 
SHEPHERD, LORI JEAN 
STEPHENS, BENE ROARK 



ASSISTANT $ 

SECRETARY DISTRICT OFFICE 

ASSISTANT 

LEGISLATIVE SECRETARY 

CASE WORKER 

CASE WORKER 

LEGISLATIVE ASSISTANT, FROM SEP 7 

LEGISLATIVE ASSISTANT 

CLERK, TC AUG 31 

CLERK 

CLERK 

SECRETARY, TO AUG 3 



,U99.99 
,000.01 
,875.00 
,500.01 
,999.99 
,812.50 
866.67 
,374.99 
,600.00 
,499.99 
,100.00 
,375.00 



OFFICE OF HON. PAUL E TSONGAS 



ABBOTT, ELEANOR 
ARENBERG, RICHARD A 
BEZOLD .DEBORAH MARIE 
BRIAND, CHRISTINE A 
BROH, SUSAN M 
BUCKLEY, C RYAN 
COLANERI, JOSEPH L 
CORLISS, JOHN M 
DDEE, ELAINE MARIE 
FAUST, FRED 
FUIKS.VALLI F 
JONCAS, STEVEN 
KANIN, DENNIS H 
KEDDY, ELIZABETH A 
KIDALOSKI, ALEXANDER T,JR 
LEONARD, THEDA J 
MCHULLIN, MARSHA E 
PETRUZZIELLO, KATHLEEN D 
SCHIAVONE, LOUISE 
SHAPIRO, VALERIE EVE 
SIMONS, SHIRLEY R 
THEOBALD, THERESA A 



CONSTITUENT SERVICES REP, FROM JUL 16 2,074.66 

LEGISLATIVE ASSISTANT 5,1*1.67 

SECRETARY, FROM SEP 6 645.83 

CONSTITUENT SERVICES REP 2,774.00 

LEGISLATIVE ASSISTANT 4,275.34 

JOE RESOURCES ASST 3,532.34 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

CASEWORKER 3,549.99 

SECRETARY 2,750.01 

PRESS 6 LEGIS ASST 4,653.67 

SECRETARY, TO JUL 31 1,000.00 

JOB RESOURCES ASST 4,450.34 

ADMINISTRATIVE ASSISTANT 7,939.33 

CONSTITUENT SERVICES REP, TO JUL 15 100.00 

OFFICE MANAGER 3,884.00 

OFFICE MANAGER 2,750.01 

PERSONAL SECRETARY 3,549.99 

CONSTITUENT SERVICES REP 2,211.39 

PRESS & LEGIS ASST, TO SEP 5 2,798.62 

LBJ CONGRESSIONAL INTERN, AUG 1 - AUG 31 590.00 

CONSTITUENT SERVICES 2,150.01 

CASEWORKER 3,381.66 



OFFICE OF HON. JIM GUY TUCKER 



BROWN, ROBERT LAIDLAW 
COLLINS, THEDFORD 
DIETZ.J ELLEN 
FILES, JO ANNE 
GOSLIN, BEVERLY JAN 
KALB, CHRISTINE J 
KEARNEY, JUDE D 
KLINSCHOT.JOANN 
LEVITSKY.SHEREE 
MCCARTHY, JAMES 
NIVEN,JOHN W 
RANSOM, VESTA 
SHEAN, MARGARET 
SMITH, BARBARA A 
STAFFORD, MICHAEL A 
WILLIAMS, MAMIE RUTH 
YARBROUGH.ANALE 



ADMINISTRATIVE ASSISTANT 

STAFF ASSISTANT 

INTERN, TO AUG 31 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

LBJ CONGRESSIONAL INTERN, TO AUG 31 

LEGISLATIVE CORRESPONDENT 

STAFF ASSISTANT, FROM SEP 14 , 

LEGISLATIVE ASSISTANT 

DISTRICT DIRECTOR 

SPECIAL ASSISTANT 

EXECUTIVE ASSISTANT 

STAFF ASSISTANT 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 



,975.00 
,937.50 

530.00 
,150.00 
,200.00 
,258.30 
,180.00 
,412.50 

235.28 
,562.50 
,562.50 
,000.01 
,775.00 
,756.25 
,937.50 
,150.00 
,725.00 



OFFICE OF HON. MORRIS K UDALL 



ANDERSON, MICHAEL 

BLOOHINGDALE, RICHARD WALLACE 

BRESSLER, STEPHEN M 

BROOKS, MARY C 

CHAPA, ARTHUR ALBERT 

CODDINGTON.LYNN 

COEN, GRETA RUTH 

HELHRICH.JON BENTLEY 

HELMS, CHRISTOPHER L 

HIGGINS, JANET B 

JACKSON, DOLORES A 

KELL, BONNIE C 

LEWIS, ROGER K 

MONFORT, CHARLES ANTON 

MURDOCH, JOYCE M 



STAFF ASSISTANT 542.49 

STAFF ASSISTANT, FROM AUG 22 650.00 

LBJ CONGRESSIONAL INTERN, TO AUG 31 1,180.00 

SECRETARY 3,825.00 

STAFF ASSISTANT, FROM AUG 14 2,872.22 

STAFF ASSISTANT i 1,200.00 

STAFF ASSISTANT., FROM AUG 1 TO AUG 15 291.67 

STAFF ASSISTANT, FROM AUG 16 750.00 

SPECIAL ASSISTANT 5,000.01 

CASE WORKER., TO SEP 5 2,762.50 

SECRETARY 4,374.99 

LEGISLATIVE ASSISTANT 6,249.99 

ADMINISTRATIVE ASSISTANT 8,000.01 

CLERK 3,816.66 

STAFF ASSISTANT., FROH SEP 8 575.00 



151 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. HOBBIS K OCALL -CONTINUED 

NE0HAN,BOBEBT A STAFF ASSISTANT., FBOH SEP 1 $ 

0' BALLET, NANCY A SECRETARY 

POD0SKA,BRDCE J STAFF ASSISTANT, TO JUL 31 

PRAY, PRIOR DISTRICT REPRESENTATIVE 

ROGERS, LORRAINE G SECRETARY 

BOSMAN, BRIAN STAFF ASSISTANT, TO JOL 31 

SPENCER, JOAN CASE WORKER 

STEINHAN, STANLEY J RESEARCH ASSISTANT, TO JOL 31 

WILLIAMS, MARGARET ANN SECRETARY 

OFFICE OF HON. AL OLLMAN 

BEALL.JIH LEGISLATIVE COORDINATOR 

BEIMDIEK,DEBRA J INTERN, FROH AUG 1 TO AUG 31 

LBJ CONGRESSIONAL INTERN, TO JOL 31 

CHAVEZ, ADELENE C SECRETARY 

CONFORTI, PEGGY R SECRETARY 

EDIARDS, LINDA K SECRETARY, TO AOG 1 

GILHOOH,GAYLE W DISTRICT ASSISTANT 

GOLDBLATT, HOWARD I STAFF ASSISTANT 

GR0SS1ILER.R EDWARD PRESS SECRETARY 

HAIGHT,ISABELL H SECRETARY 

HOOKER, ALICE JANE LEGISLATIVE ASSISTANT 

JOHNSON, KAREN LOOISE SECRETARY, FROH AOG 1 

KNOTSON, DEBORAH KAY STAFF ASSISTANT 

LALLE, GENEVIEVE A SECRETARY, TO AOG 19 

LATIMER, JODY L SECRETARY, FROH SEP 19 

HOHBACK, MICHAEL STAFF ASSISTANT 

PRINCE, MAVIS E SECRETARY 

ROBERTSON, WILLIAM D,JR ADHINISTRATIVE ASSISTANT 

STAHH, DOUGLAS ALAN STAFF ASSISTANT, TO AOG 15 

WARNER, ANN H PRCJECTS COORDINATOR 

OFFICE OF HON. LIONEL VAN DEERLIN 

AKEBSTEIN, WILLIAM J RESEARCH ASSISTANT 

BLAIR, ANNE D SECRETARY 

CIAHPORCERO,ALAN SPECIAL RESEARCHER, FROH SEP 1 

DALE, DONALD R STAFF ASSISTANT 

DAVE, SHIRLEY E CLERK TYPIST 

DONLEY, JOHN RESIARCE ASSISTANT, TO AOG 31 

ELLIS, CYNTHIA LEE CLEBK TYPIST 

GRAY,RAYHOND STAFF ASSISTANT 

GRUNEWALD, RALPH LBJ CONGRESSIONAL INTERN, TO AUG 1U 

HICKS, GLORIA DEAN CLERK TYPIST 

KNIGHT, NONA DIANE SPECIAL RESEARCHER 

LABAO, ANAHARIA CHRISTINA CLERK TYPIST 

MCLAREN, JOHN H. LEGISLATIVE ASSISTANT 

MENDOZA,YOLANDA A CLERK TYPIST 

MORILLO,R0DY P ADMINISTRATIVE ASSISTANT 

PHAIR, WALTER T SPECIAL ASSISTANT, TO JOL 31 

PIENTA, LILLIAN L OFFICE MANAGEB 

RHODES, ROBERT FAHON FIELD REPRESENTATIVE 

STASZEWSKI,CARCL A CHIEF CLIRK-TYPIST 

YAROSH, VIRGINIA B CLERK 

OFFICE OF HON. GUY VANDER JAGT 

CROWTHER, LORRAINE D STAFF ASSISTANT 

CORRY, HILDA BELL TYPIST, TO JUL 15 

ELKINS,LUCY M CLERK TYFIST 

GIESON, JAMES F CLERK 

GUBACK, IRENE L SECRETARY 

LAUX,DENISE PEABCE STAFF ASSISTANT 

MARTIN, SABAH H SECBETABY 

HUBBY, ANN E SECRETARY 

NAGELVOORT, BERNARD C ADHINISTRATIVE ASSISTANT 

NEDEAO, BONNIE JEAN 

SCHRIER,JOHN CHRISTIAN DISTRICT REPRESENTATIVE 

SMITH, TIMOTHY HARTLEY STAFF ASSISTANT, FROM JUL 16 TO SEP 15 

LBJ CONGRESSIONAL INTERN, TO JUL 15 

SPARLING, JAMES M,JR ADHINISTRATIVE ASSISTANT 

SPENGER, MARTHA SECRETARY, FBOH AUG 26 

THEANOB, MARGARET PERSONAL SECRETARY 

YOHO, PAMELA JOYCE STAFF ASSISTANT 



200.00 
3,041.66 

250.00 
3,750.00 
3,000.00 
1,175.00 
2,775.00 
1,583.33 
2,750.01 



,180.00 
,611.25 
,744.99 

103.33 
,349.99 
,500.01 
,916.67 

076.26 
,312.91 
,083.34 
.U90.83 
,184.58 

333.33 
,733. 3U 
,266.67 
,208.33 
,500.00 
,750.00 



000.01 
250.00 
000.00 
250.01 
500.01 
000.00 
249.99 
300.00 
865.33 
062.49 
641.67 
999.99 
250.00 
62.4 9 
500.01 
708.33 
399.99 
250.00 
000.01 
062.51 



,013.86 
75.00 
,096.61 
,500.01 
,306.01 
,406.98 
,703.96 
,275.94 
,999.99 
,044.20 
,555.00 

,195.00 
,874.99 
272.22 
,597.82 
,324.23 



96-500 O - 78 - 11 



152 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. CHARLES A 7ANIK 



BAILEY, CAROLYN J 
DANELLO, DANIEL F 
DANIELS, CYNTHIA ELIZABETH 
DEITBICK, SALLY LYNN 
FISHKIN, LAURENCE 
GODDARD, CAROLE C 
HANSELL, DAVID ALAN 
HARRINGTON, H BRENDAN 
KASELAK, JOSEPH E 
MORRISON, EDHARD F 
MORRISON,MARIQUITA 

RILEY, JOHN 
ROBINSON, WILLIAM L 
SHERMAN, CHARNA EVE 
SIMON, ALICE H 
SIMONELLI.GENNARO 
TERNANSKY, STELLA N 
TOMASEK, DIANE E 
WEINBERGER, WILLIAM ED 
WOODRICH, ARNOLD C,JR 
YEN, DOMINIC 
ZLOTH,TOBI BRENDA 



STAFF ASSISTANT J 3,000.00 

LBJ CONGRESSIONAL INTERN, TO AUG 31 1,180.00 

INTERN, TO JUL 31 1,600.00 

STAFF ASSISTANT 2,87a. 99 

INTERN 1,650.00 

STAFF ASSISTANT 4,441.65 

INTERN, FROM SEP 1 600.00 

LEGISLATIVE ASSISTANT 2,883.34 

STAFF ASSISTANT 7,500.00 

LEGISLATIVE ASSISTANT, TO AUG 19 2,991.1m 

STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT, FROM AUG 5 2,499.96 

STAFF ASSISTANT 1,500.00 

STAFF ASSISTANT , 2,620.74 

INTERN, TO JUL 31 1,600.00 

INTERN, FROM AUG 1 TO AUG 31 1,700.00 

LEGISLATIVE ASSISTANT 3,624.99 

STAFF ASSISTANT 2,750.01 

STAFF ASSISTANT 3,500.01 

LEGISLATIVE ASSISTANT, FROM AUG 15 1,277.77 

STAFF ASSISTANT 5,000.01 

STAFF ASSISTANT., FROM SEP 1 2,000.00 

STAFF ASSISTANT 2,751.78 



OFFICE OF HON. BRUCE F VENTO 



BARRETT, MICHAEL 
BARRY, RACHEL O. 
DONNOHUE, SHIRLEY ANN 
GEFR, SHIRLEY H 
GLAZER, SARAH JANE 
HESS, ROBERT E 
KAHLENBERG.JOY 
KRUEGER, KEITH 
LALLIER.JAYNE C 
MARSHALL, JANE V 
NAUGHTON,HARY J 
PIRIUS, JAMES C 
RAYMOND, DORETTA L 
ROMANS, LAWRENCE JOSEPH 
SUKAVINA, STEVEN J 
SCHERTLER,MAHY THERESE 
TONAT, EDWARD 
WHITE, CISSIE J 
YOUNG, ROBERT E 



INTERN, TO JUL 31 600.00 

STAFF ASSISTANT . 1,500.00 

SECRETARY 3,276.00 

MEDIA ASST 5,750.01 

STAFF ASSISTANT '. 300.00 

ADMINISTRATIVE ASSISTANT 10,183.74 

INTERN, TO AUG 3 660.00 

INTERN 1,200.00 

INTERN, FROM SEP 1 650.00 

CASEWORKER 1,512.51 

CASEWORKER 3,399.99 

OFFICE MANAGER 5,000.01 

SECRETARY 3,800.01 

LEGISLATIVE AIDE 2,750.01 

INTERN, FROM SEP 1 650.00 

CONSTITUENT INFORMATION ASS'T 3,999.99 

LEGISLATIVE ASSISTANT 9,358.71 

SECRETARY 2,874.99 

CASEWORKER 1,825.32 



OFFICE OF HON. HAROLD L VOLKMEB 



CLARKSON, SCOTT C 
DAVIS, VALERIE HOPE 
DELAPORTE, CONNIE SUE 
EPPERSON, BRAD 
FREDERICK, JEANNE P 
GARDNER, LYNN 

GERWITZ.HINDY A 
GILLIAM, DORTHY E 
GLASSEN, JAMES 9 
GRANDSTAFF, MARTHA LOU 
GREWACH,LARRY DAVID 
HENDRICKS, JACQUELINE 
HERRE, MAUDE H 
HOWELL, KAREN R 
HUTCHISON, JANIE 
KLEIN, CHRISTIANN L 
LOTTMAN, PAMELA C 
PFAFF, BETTY LOU 
PHILLIPS, CAROL SUE 
PREISACK, CAROL ANN 
RIDGEWAY,B LUANN 
SBAFFRAN.JOAN GLORIA 
3URLA,H. GENE 
VIOREL,LEE J 



LEGISLATIVE AIDE 3,750.00 

ADMINISTRATIVE ASSISTANT 6,000.00 

DISTRICT SECRETARY 2,250.00 

LEGISLATIVE AIDE 3,800.00 

APPOINTMENTS SECRETARY, TO JUL 31 1,500.00 

SECRETARY, FROM AUG 1 TO AUG 22 

LBJ CONGRESSIONAL INTERN, TO JUL 31 1,470.00 

PROJECTS SECRETARY 4, 100.00 

SECRETARY (DISTRICT OFFICE), FROM AUG 1 2,000.00 

RESEARCH ASSISTANT, FROM JUL 5 3,900.00 

DISTRICT OFFICE SECRETARY, TO AUG 31 1,600.00 

PRESS AIDE 3,900.00 

SECRETARY, FROM JUL 5 4,600.00 

DISTRICT OFFICE SECRETARY, TO JUL 31 800.00 

CASEWORKER 2,400.00 

DISTRICT OFFICE SECRETARY, TO AUG 31 1,600.00 

LEGISLATIVE AIDE 3,850.00 

RECEPTIONIST-CASE WORKER 2,800.00 

SECRETARY (DISTRICT OFFICE), FROM SEP 1 1,000.00 

DISTRICT OFFICE SECRETARY 1,650.00 

DISTRICT OFFICE SECRETARY, FROM SEP 1 1,000.00 

INTERN, TO JUL 31 1,000.00 

RESEARCH ASSISTANT., FROM SEP 1 1,000.00 

RESEARCH ASSISTANT, FROM AUG 1 TO AUG 31 1,000.00 

DISTRICT OFFICE MANAGER 4,600.00 



153 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. JOE D WAGGONNEE JR 



AILLET, CYNTHIA C 
BATT, DAVID L 
BAIT, JOYCE D 
BERRY, RICHARD W,JR 
BOLCAO, DOUGLAS W 
FERGUSON, NANCY 
GIBSON, ETHEL FLORENE 
HICKS, NANCY B 
HOPPER, HATTIE 
JOYNEH,HENRY H 
KENT, DAVID 
KBAHER, CLAIRE E 
NOBLETT, CECILIA C 
PICKETT, TAMERA 
PITNER, ROBERT N 
RUTHEBFORD, JANICE B 
SIMMONS, PAT 
THOMAS, PATRICIA 
WAITS, SALTER E 



INTERN, TO AUG 15 $ 

ADMINISTRATIVE ASSISTANT 

CLERK 

SUMMER INTEBN, TO AUG 15 

LEGISLATIVE ASSISTANT 

INTERN, TO AUG 15 

CLEBK 

LEJ CONGRESSIONAL INTEBN, TO JUL 31 

CLERK 

PRESS ASSISTANT 

CLERK 

CLEBK 

CASE WORKER 

INTERN, TO AUG 15 

CLERK 

CLERK 

CLERK 

CLERK 

INTERN, TO AOG 15 



885.00 
008.47 
"78.60 
885.00 
500.00 
885.00 
110.1*7 
590.00 
,019.63 
,571.30 
809.88 
,046.10 
,500.01 
885.00 
,201.43 
,740.37 
,210.42 
,210.42 
885.00 



OFFICE OF HON. DOUGLAS iALGREN 



BRAIN, CHABLES H 
BBCBN,RON 

CORBIGAN,JOAN MABY 
DELANO, JONATHAN 8 
ELSON,BINOB B 
E0BANKS,FLOBBIE 
FARDELLA,RITA T 
GLICKHAN, SAUDI 
HOGAN, JANET B 
KIELEY,BICHARD A 
LONDEBERG,ERIK 
MILLEB, GLENN B 
MORRISON, ARTHUR FRANCIS 
0' NEILL,BOBERT 
TERRENCE, JEANNE L 
WEAVER, KAY F 
BHALEN, LORRAINE 
ZACCHERO,HABY JO 



LEGISLATIVE AIDE 3,375.00 

STAFF ASSISTANT, TO JUL 31 1,667.32 

CASEUOBKEB 2,750.01 

ADMINISTBATIVE ASSISTANT 7,500.00 

SPECIAL PBOJECTS AIDE 3,000.00 

PRESS SECBETABY 4,500.00 

CASE WOBKER 2,750.01 

PBESS SECRETARY 3,999.99 

OFFICE MANAGER 3,750.00 

LEGISLATIVE AIDE 3,750.00 

LEGISLATIVE AIDE, FROM SEP 1 666.67 

LEGISLATIVE AIDE 3,375.00 

FIELD REPBESENTATIVE < 5,000.01 

LEGISLATIVE AIDE 3,375.00 

CASE WOBKER 2,750.01 

RECEPTIONIST-SECRETARY 2,750.01 

DISTRICT MANAGER 3,500.01 

SECRETARY/AIDE 2,266.66 



OFFICE OF HON. ROBERT S WALKER 

BAUHGARTNEB, PEGGY B CLEBK 750.00 

BLANK, THOMAS B SPECIAL ASSISTANT 3,653.76 

COBB, THERESA M BECEPTIONIST-SECRETARY -. 2,812.50 

COFFHAN.HUGH B ADMINISTRATIVE ASSISTANT 5,750.01 

COLDREN,DALE H LEGISLATIVE ASSISTANT 3,656.76 

DIOSEGY,BOSEMARIE A CLEBK 1,425.00 

ELLIS, SHANNON E TYPIST, IBOB JUL 5 TO SEP 9 1,300.00 

GILLEY, SUSAN C SECBETABY CASEWOBKEB 4,437.51 

GBAYBILL,MARY ALICE SECRETARY 2,187.51 

HUNT,CANDACE S LEJ CC NGBESSION AL INTERN, TO JUL 31 590.00 

JACKSON, GEOBGE 8 DISTRICT ADMINISTRATIVE ASSISTANT 6,624.99 

BACBAE.CLABA D EXECUTIVE ASSISTANT 5,382.50 

BAPTINO,JOHS THOBAS SPEC ASST-FIELD EEPBESEN 3,999.99 

PHILLIPS, BABC T SPECIAL ASSISTANT 3,750.00 

BOSCOE, LINDA F LEGISLATIVE ASSISTANT 3,750.00 

BOUX, JOSEPH E CLERK INTERN, TO SEP 9 1,357.00 

STRICKLER, CATHERINE E SECRETARY 2,499.99 

BARNEB, NANCY B CASE WORKER 3,875.01 

OFFICE OF HOB. WILLIAM F WALSH 

BROWN, DIANE BOBEBTS LEGISLATIVE ASSISTANT 3,577.32 

DAHRISOH,F GIBSON, JB ADMINISTRATIVE ASSISTANT 11,874.99 

FOTI,HABY G SECRETARY 2,817.06 

HOESTBANN.RICHABD A EXECUTIVE ASSISTANT 6,313.23 

JOHNSON, JACQUELYN BARIE CASEWORKER 6 RESEARCH ASST, TO JUL 31 958.33 

JUTTON, ARTHUR A. DISTRICT BEPBES ENT ATIVE 7,412.01 

KOLLATH, GLORIA C SECRETARY, FROH SEP 6 555.56 

LAWTON, PATRICIA A SECRETARY RECEPTIONIST 2,625.00 

BERBIBAN, MARGARET A SECRETARY 2,841.71 

NORMAN, PAUL CHASE STAFF ASSISTANT 365.07 

O'HABA.MARY KAY SECRETARY 3,150.00 



154 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. BILLIAH F BALSH -CCNTINUED 



ODDI, JOYCE THERESA 
PAULINO, VIVIEN E 
PRESTON, SUSAN J 
THOMSON, JERALYN S 
VAGNOZZI, DOROTHY i 
VAN DOREN.BETH 



SECRETARY $ 1,198.50 

SECRETARY 1,706.10 

PRESS SECRETARY 4, 125. 00 

SECRETARY 2,851.78 

PERSONAL SECRETARY 5,292.75 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 



OFFICE OF HON. BILLIAH C SAMPLER 



COUNTISS, ARTHUR A,JR 
DAVIDSON, RIVERS D,JR 
DOTSON, JAMES RAY 
GILLENBATER, MARTHA J 
GILLESPIE, DONALD M 
GULLION, MARGARET ANN 
KIETH C,JEANNIE 
KILBOURNE, TEDDY L 
LINDAMOOD, GORDON B 
MILLER, JOSEPHINE L 
HULLINS, JAMES A 
0'DELL,TAHI MARIA 
OGDEN.MARILYNN L 
RASNICK,HYRNA C 
ROBINETTE, CECILIA SKEEN 
SHUHAKEH, PHYLLIS HAMILTON 
SIX, ALICE B 
TRITT, ELLEN KAY 



DISTRICT OFFICE MANAGER 5,114.85 

FIELD REPRESENTATIVE 2,250.00 

ADMINISTRATIVE ASSISTANT 10,133.74 

LEGIS ASST S PERS SECTY 3,595.32 

FIELD REPRESENTATIVE 4,125.00 

SECRETARY 1,875.00 

STAFF ASSISTANT 1,687.50 

CASEWORKER 3,216. 42 

6,000.00 

SECRETARY 1,875.00 

FIELD REPRESENTATIVE 4, 788. 12 

LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

SECRETARY 4,650.00 

SECRETARY 3,805.77 

SECRETARY 2,063.85 

SECRETARY 1,633.74 

SECRETARY 2,124.99 

SECRETARY, TO JUL 31 

SECRETARY, FROM AUG 5 1,791.67 



OFFICE OF HON. BES BATKINS 



ALLEN, LOLA ELIZABETH 
BAKER, MARY ELIZABETH 
COKER,SHIRLBY J 
COLLINS, JOHN R 
COOMBES,TED 
DELGROSSO,BAPBARA KAY 
DELOACH, DARITA 
HALES, CLAUDIA 
HART, LYNN S 
HATHCOTE, DONALD E 
JACKSON, LEROY V 
KREIS, PHYLLIS 
LALLI, STEVE F 
MCCLANAHAN.BANDA M 
PLADZIEBICZ, CYNTHIA S 
SLATEN .SUZANNE 
STORM, MARILYN J 
THOMPSON, LESLIE BOOLLEY 
TSUTRAS, FRANK G 



DISTRICE OFFICE MANAGER 

STAFF ASSISTANT 

DISTRICT OFFICE MANAGER 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT., FROM SEP 9 

LBJ CONGRESSIONAL INTERN, TO JUL 31 .... 

CASEWORK COORDINATOR, TO SEP 16 

STAFF ASSISTANT 

DISTRICT ADMINISTRATOR 

ADMINISTRATIVE ASSISTANT 

OFFICE MANAGER 

LEGISLATIVE CORRESPONDENT 

SECRETARY -RECEPTIONIST 

SUMMER INTERN (EBING FELLOW), TO JUL 31 

STAFF ASSISTANT 

EXECUTIVE ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT, TO JUL 31 



,625.00 
,500.00 
,700.00 
,225.00 
,200.00 

586.67 

590.00 
,166.67 
,100.00 
,000.00 
,300.00 
,150.00 
,950.00 
,000.00 

300.00 
,000.00 
,950.00 
,900.00 

500.00 



OFFICE OF HON. HENRY A WAXMAN 



BEEMAN, LINDA L 

BEFMAN, MICHAEL B 

BONIN, VIRGINIA RUTH 

COLLOFP, MARGERY A 

ELINSON, HOWARD 

FEIER,KIH J 

FORBES, E RIPLEY 

HOBMAN, SHERRY L 

KAIZER.EVAN JAI 

KESTENBADM,SARA E 

L0CEY,NORA 

HANDEL, JOSEPHINE H 

MARGOLIN, BURT 

MAYORKAS, HELENA CATHERINE 

NEWORTH,THELMA 
SHIHABUKURO,KEIKO 
SHORTER, KATHLEEN H 
SIEGEL, HELEN H 
STONE, NAOMI ROTH 
BOLPE, BRUCE C 



ASSISTANT 

CONSULTANT 

SPECIAL ASSISTANT 

LEGISLATIVE ASSISTANT 

ADMINISTRATIVE ASSISTANT 

LEGISLATIVE CORRESPONDENT 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT., FROM SEP 1 

LEGISLATIVE ASSISTANT, TO AUG 12 ... 

LEGISLATIVE ASSISTANT 

EXECUTIVE SECRETARY 

RECEPTIONIST 

ADMINISTRATIVE ASSISTANT 

RESEARCH ASSISTANT, FROM SEP 1 .... 
LBJ CONGRESSIONAL INTERN, TO JUL 31 

FIELD DEPUTY 

CCCRDINATOR 

RECEPTIONIST 

SECRETARY 

RESEARCH ASSISTANT, TO JUL 31 

LEGISLATIVE ASSISTANT 



,065.00 
,000.00 
,205.00 
,817.66 
,000.00 
,670.00 
,166.67 
200.00 
,283.34 
,533.33 
,500.00 
,220.00 
,000.01 

840.00 
480.00 
,387.90 
,840.00 
,457.00 
740.00 
,000.01 



155 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. JAMES BEAVER 

DEFAZIO, PETER A 
DUBIN, FAITH ANNE 
EACHUS, RONALD L 
EYBANN, RICHARD 
FARTHING, JOY 
FIDANQOE, DAVID JOSEPH 
JOHNSON, GILBERT 
LARSEN, STEPHANIE LYNNE 
BAZO.BOTH S 
BEYERS, DONALD H 
ROCK, PHYLLIS 
RUSSELL, JAMES 
ROTLEDGE, JOSEPH ROBERT 
RYAN, PEGGY ANN 
SAGE, PETER 
SCHALLER, SANDRA J 
SHOBALTER, NANCY LEE 
STRICKLETT, DEBORAH 
TRAINOR,J HONIQUE 
ULLHAN, BARBARA BALL 
VETTER, ROBIN E 
BARREN, JEFFREY S 
BOOTEN, CYNTHIA 



CASEBORKER $ 3,000.00 

RECEPTIONIST, FROM JUL 5 2,900.00 

LEGISLATIVE AIDE 5,500.00 

SPECIAL CCNSDLTANT 4,500.00 

STAFF ASSISTANT., FROM ADG 1 1,719.00 

PRESS AIDE, FROM SEP 1 1,000.00 

PRESS ASSISTANT 3,000.00 

LEGISLATIVE AIDE, TO AOG 31 2,250.00 

INTERN, TO JOL 31 1,000.00 

CASEBORKEB 3,100.00 

EXECUTIVE ASSISTANT 5,375.01 

CASEBORKEB , 3,500.01 

CONSULTANT, FROM AUG 1 TO AOG 15 833.33 

STAFF AIDE 2,100.00 

LEGISLATIVE ASSISTANT 3,891.67 

PERSONAL SECRETARY 3,500.01 

LEGISLATIVE ASSISTANT 3,375.00 

PRINTER, TO JUL 31 560.00 

STAFF ASSISTANT 2,250.00 

RECEPTIONIST, FROM SEP 9 611.11 

COMMUNICATIONS ASSISTANT 3,300.00 

LBJ CONGRESSIONAL INTERN, FROM AUG 1 1,000.00 

STAFF ASSISTANT 3,000.00 



OFFICE OF HON. THEODORE S BEISS 



ANCREB, RALPH K 
BRENIG.ISAK 
CHACONAS.STEPHANY 
GOTTLIEB, JAMES R 
HERMAN, NORMA 
HUNT,BRENDA 
KAGAN, JOYCE S 
KELLY, KEVIN J 

KOKOT, JOHN 
KRIEGBAN, BRUCE 
LOBE, ROBERT 
RAMSAY, MAUREEN 
SAHHABTINO.GERALYN M 
SANDERS, SUSAN 
SANTIAGO, PRO VIDE NCI A 

STEUER,GARY PAUL 
SULICK, MICHAEL J 
TIMMENY, MICHAEL D 
BALLACH, ELLEN 
BEISS, PAULA K 
BOODARD, BEVERLY 



ADMINISTRATIVE ASSISTANT 

INTERN ASST, FROM JUL 21 TO JUL 31 . 

EXEC SECTY-OFFICE MGR 

EXECUTIVE ASSISTANT 

ADMINISTRATIVE COORDINATOR 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF RESEARCHER, TO AUG 31 

PRESS ASSISTANT, FROB SEP 5 

STAFF ASSISTANT 

LEGISLATIVE ASSISTANT 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

STAFF ASSISTANT, FROB JUL 11 

STAFF ASSISTANT, TO JUL 20 

STAFF ASSISTANT 

STAFF ASSISTANT, TO AOG 31 

STAFF ASSISTANT, FROM SEP 5 

INTERN ASST, FROB AUG 21 

STAFF ASSISTANT 

LEGISLATIVE ASSISTANT 

CASEBORKER 

STAFF ASSISTANT 

LEGISLATIVE ASSISTANT 



,340.25 
165.00 
,999.99 
,625.00 
,624.99 
,125.01 
,175.01 

,208.34 
,624.99 
,874.99 

590.00 
,177.08 

700.00 
,985.17 

,975.01 
,350.00 
,974.99 
,500.01 
,500.01 
,375.00 
,485.15 



OFFICE OF HON. CHARLES B BHALEN JR 



BAKAHAUSKAS, ANDREA HARY 
BERGEN, BILLIAB B 
BERGEH, JAMES R 
BLACKISTONE, STEPHEN D 
BREEN.PADL BILLIAB 
CAHPAGNA, JUNE 
CLAYTON, JOANN 
FANGHEYER, ELLEN N 
FEISS, GEOFFREY 
GERRY, MARTIN H 
HENTZ, HARRIET L 
JOHNSON, CAHILLE S 
LONG, SUSAN GRAFELD 
LOBEEY, GEORGE B 
BOYER,JANIS L 
PANHELL, JACK J,JB 
PERSONS, SANDFORD Z 
ROSENBERG, BARC H 
STARKS, BEVERLY ANN 
STEPONKOS, BILLIAB P 
SBEARINGEN, BILLIAB VAN 
BIEDBAN,BANDA L 



SECRETARY, TO JOL 31 

LEGISLATIVE ASSISTANT 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

LEGISLATIVE SECRETARY 

PERSONAL SECRETARY, FROB SEP 20 

STAFF ASSISTANT 

STAFF ASSISTANT, FROB AUG 1 TO AUG 10 

SECRETARY 

SECRETARY 

PERSCNAL SECRETARY, TO AUG 14 

SPECIAL ASSISTANT 

SECRETARY/RECEPTIONIST, FROB AUG 15 ... 
LBJ CONGRESSIONAL INTERN, TO ADG 5 ... 

COUNSEL 

SPECIAL PROJECT DIRECTOR 

SECRETARY 

EXECUTIVE ASSISTANT 

LEGISLATIVE ASSISTANT 

DISTRICT SECRETARY 



810.42 
,499.99 

599.99 
,599.99 
,936.67 

624.75 
,856.25 

290.28 
,950.00 

200.00 

565.01 
,565.00 
,636.17 
,500.01 
,188. 33 

688.33 

553.08 
,299.99 

825.01 

183.74 
,599.99 

500.01 



156 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. RICHARD C BHITE 



ACOSTA, TERESA 
BOND.SOSIE A 
BORTON, IRENE 
CARR, MARGARET BELISSA 
CARTER, MARY LOO 
CAROTHERS, MARIE E 
DAFFRON, JESSE L 
DOESEY, KAREN OBERG 
FIERRO,ENRIQDETA G 
HAGAN, MARILYN K 
NAGEL.MAXINE K 
POTTER, BARBARA J 
RICHESON,HABLEY 
SANI,LOANNE GADD 
SCOTT, CINDY LOO 
SNOSDEN,H S 
STODER,JOAN EVELYN 
TAYLOR, OPAL LEATBICE 
THOMAS, PHILLIS 
TSOTRAS, FRANK G 



STAFF ASSISTANT $ 3,100.00 

STAFF ASSISTANT, TO AOG 19 1,<l97.23 

STAFF ASSISTANT 2,954.00 

STAFF ASSISTANT, TO JOL 31 926.67 

STAFF ASSISTANT 3,191.67 

STAFF ASSISTANT 2,700.01 

STAFF ASSISTANT 4, 250. 01 

LEGISLATIVE ASSISTANT 3,924.99 

STAFF ASSISTANT 3,693.75 

STAFF ASSISTANT., FBOH SEP 1 916.67 

PRESS SECRETARY 3,399.99 

SECRETARY 4, 025. 01 

ADMINISTRATIVE ASSISTANT 9,900.00 

SECRETARY, FROM AOG 1 1,541.67 

LEJ CONGRESSIONAL INTERN, AOG 1 - AUG 31 590.00 

STAFF ASSISTANT 6,125.01 

STAFF ASSISTANT 2,9I»9.99 

STAFF ASSISTANT 3,000.00 

STAFF ASSISTANT 2,250.00 

STAFF ASSISTANT, FROH AOG 1 TO AOG 31 300.00 



OFFICE OF HON. G BILLIAM BHITEHCRST 



BARTENSTEIN,JOHN C 
BOYLES, BLANCHE H 
DYER, JAMES EDGAR JR 
FAIRFAX, NATHANIEL B 
FITZPATRICK, CHARLES H 
HOWLE,HORLEY J 
LEE, EILEEN D 
LITALIEN, ROSEMARY S 
PETERSON, DAVID L 
POWELL, VICTOR D 
REDMOND, PATRICIA ANN 
ROBERTSON, ELIZABETH 
SHARP, WILLIAM E 
SPEER.GBENDLYN GALE 
SPORE, HELEN E 
SOLLIVAN, PATSY B 
TOHERS, KATHLEEN H 
BALKER, ELIZABETH TROY 
WASSERMAN,VERENA C 
BOLFE, EDWARD E 
BOOTEN, DONNA TOBERS 



STAFF ASSISTANT 624. 99 

DISTRICT OFFICE MANAGER 3,958.34 

PRESS ASSISTANT, FROM SEP 10 1,166.67 

STAFF ASSISTANT 3,125.00 

ADMINISTRATIVE ASSISTANT 10,351.66 

STAFF ASSISTANT 3,166.67 

SECRETARY 2,937.49 

OFFICE MANAGER 6,041.67 

INTERN, TO SEP 15 1,350.00 

PRESS ASSISTANT, TO SEP 5 4,556.87 

SECRETARY, FROH AOG 8 1,472.22 

INTERN, TO AOG 15 900.00 

INTERN, TO AOG 17 940.00 

CASE BORKEB 3,755.77 

STAFF ASSISTANT 3,166.67 

SECRETARY 2,437.51 

SECRETARY, TO JOL 31 1,179.34 

CLERK, FROM SEP 15 213.33 

DISTRICT OFFICE MANAGER 3,958.34 

INTERN 2,133.33 

CASEWORKER 3,645.83 



OFFICE OF HON. CHARLES BHITLEY 



BARKER, HOBARD R 

BELL, VIRGINIA H 
BOBEN,KATHRYN 

DENNING, DONNA LEE 
HEPLEB, DAVID B 

HINES, ANTHONY DECABISE 

KALEEL, ALBERT J,JR 

KNOBLES, RODNEY 
MORGAN, MARION MARTIN 
EENN, LEWIS 8 
SHIPHAN, JEROME B 
SPEARS, RACHEL B 
BHARTON, BETSY F 



OFFICE MANAGER 9,000.00 

DIST OFF SECTY 2,600.01 

SPECIALIST IN CASEBORK 5,300.01 

STAFF ASSISTANT 3,500.01 

RESEARCH AIDE 2,750.01 

CONGRESSIONAL INTERN, TO JOL 31 590.00 

LEGISLATIVE RESEARCH ASSISTANT, AOG 1-AOG 7 . 

LBJ CONGRESSIONAL INTERN, TO JOL 31 862.22 

DISTRICT REPRESENTATIVE 750.00 

SPICST IN LEGISLATION, TO AOG 31 2,708.34 

ADMINISTRATIVE ASSISTANT 9,375.00 

COORDINATOR 6,249.99 

PERSONAL SECRETARY 4,974.99 

STAFF ASSISTANT 3,249.99 



OFFICE OF HON. JAMIE L BHITTEN 



ALBERT, SHIRLEY M 

BALLARD, MARA BILNA 

BISHOP, MARION F 

COLLINS, SOPHRONA KATHERINE 

DECELL,HAL C.III 

DRINKBATER.OOIDA 

FLEMING, TERESA 

GEORGE, CHARLES H 

GODBIN, EVELYN P 

GORDON, NANCY B 

HOLLAND, D STEPHEN 



SECRETARY 5,625.00 

CLERK 2,575.01 

ADMINISTRATIVE ASSISTANT 9,671.26 

CLERK, FECM AOG 22 1,029.17 

PRESS ASSISTANT, FROM JOL 15 2,533.33 

RESEARCH ASSISTANT, TO JOL 31 1,000.00 

CLERK 3,000.00 

CLERK 750.00 

CLERK 3,750.00 

CLERK, FECM JOL 2 2,348.62 

LBJ CONGRESSIONAL INTERN, TO JOL 31 590.00 



157 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. JAMIE L WHITTEN -CONTINUED 



JENKINS, NANCY S 
LASSEN, CHARHIAN G 
MULLEN, CATHERINE 
SHALLWOOD.MARY H 
WATSON, ANN T 



CLERK, TO SEP 19 $ 3,511.10 

CLERK, TO JUL 31 791.67 

CLERK 2,575.01 

STAFF HEMEER 3,340.28 

DIST OFFICE ADMINISTRATOR 2,141 .01 



OFFICE OF HON. CHARLES E WIGGINS 

BLOHMER, MICHAEL W ADMINISTRATIVE ASSISTANT 9 

BUKATY, RAYMOND M,JR LEJ CONGRESSIONAL INTERN, TO JUL 29 

DRESSEN.JANE B EXECUTIVE SECRETARY 4 

KNAUFT,KILFOFD R,JR DISTRICT REPRESENTATIVE 4 

KNOOP.DARLENE A SECRETARY 2 

LEE, WENDY J SECRETARY 3 

1APSHALL, LESLIE C SECRETARY 2 

MCNAOGHTON, PATRICIA CASEWORKER 3 

MORGAN, JILL A SECRETARY 3 

RAY, PAULA L SECRETARY 2 

SHURTZ, DAVID L LEGISLATIVE ASSISTANT 3 

TDRHALA,JEAN T LEGISLATIVE SECRETARY 3 

WEST, MARK S INTERN, FROM JUL 6 1 

OFFICE OF HON. BOB WILSON 

BURWELL.BEULAK H CLERK 1 

CARROLL, ARLENE R SECRETARY 3 

CLINE, ALICE L 3 

DCRMINY,YOLANDE P SECRETARY 4 

DDFFIELD, PHYLLIS R SECRETARY 3 

HALL.JOELLE K SECRETARY 4 

HEATH, KARENS SECRETARY 5 

LYNCH, LOUISE CLERK 2 

MIDDENDOHP.AMY WARD LEJ CCNG SESSION AL INTERN, TO JUL 31 

MILLER, LYNN K CLERK, FRCM SEP 1 

ODONNELL,HARJORIE SECRETARY 6 

PARHAM, CATHERINE C SECRETARY 6 

TERRAR, EDWARD F,JR . 9 

WILBURN, JEROME DCDGLAS 4 

YOUNG, MAFGARET H SECRETARY 8 

OFFICE OF HON. CHARLES WILSON 

BARNHART, STEPHANIE R SECRETARY 1 

DONOHOE, TIMOTHY L SPECIAL ASSISTANT 1 

GOODNOE, SUSAN L CASEWORKER 3 

HARRIS, WILLIAM H.JR LEJ CONGRESSIONAL INTERN, TO JUL 31 

JAMES, DEBBA SECRETARY, TO AUG 31 2 

MURPHY, PLEASANT L LEGISLATIVE ASSISTANT 6 

ORS, PENELOPE ASSISTANT PRESS SECTY 2 

PHILLIPS, PEGGY ANN CASE WORKER 4 

SHEFFIELD, JAMES F RESEARCH ASSISTANT, TO SEP 9 1 

SHURMAN,LORI JEANNE RECEPTIONIST, TO AUG 31 1 

SHY,CANDICE J LEGISLATIVE ASSISTANT ENERGY 5 

SIMONS, CAROL SECRETARY, FROM JUL 5 1 

SIMPSON, CHARLES W ADMINISTRATIVE ASSISTANT 9 

SULLIVAN, LINDA L PEFSONAL SECRETARY 5 

TIMS, INEZ DISTRICT AIDE 4 

TRITES,AMY S SECRETARY, FROM SEP 1 1 

WALKER, DOROTHY ANN INTERN, FROM AUG 1 TO AUG 31 

WASHINGTON, ADRIAN G INTERN, TO JUL 12 

WEBB, KAREN SECRETARY 3 

OFFICE OF HON. CHARLES H WILSCN 

BEER, PAMELA M PRESS SECPETARY 3,500.01 

DALTON,GENA ANN CLERK, FROM AUG 1 TO AUG 31 503.58 

DEANS, RUTH C STAFF ASSISTANT 2,499.99 

DELEON,RUDY F RESEARCH ASSISTANT 3,000.00 

DIAZ, CARMEN SENKER STENOGRAPHER 2,700.00 

ELLIS, MAE A RECEPTIONIST 2,499.99 

FALLS, GLORIA F SECBETAFY 2,000.01 

FO?DIANI,0 ROBERT FIELD REPRESENTATIVE 8,250.00 

GEORGE, MYRTIS L DISTRICT OFFICE MANAGER 3,999.99 



,899.07 
570.33 
,414.98 
,107.51 
,782.50 
,464.88 
,782.50 
,249.99 
,375.84 
,124.99 
,000.00 
,578.85 
,671.67 



,012.92 
,358.59 
,424. 17 
,127.67 
,159.45 
,327.67 
,585.85 
,038.26 
590.00 
325.00 
,158.94 
,517.74 
,900.00 
,114. 17 
,787.05 



,400.00 
,899.99 
,375.00 
590.00 
,000.00 
,875.01 
,666.66 
,124.99 
,993.34 
,400.00 
,000.01 
,911.12 
,583.33 
,625.00 
,749.99 
,125.00 
590.00 
236.00 
,666.67 



158 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. CHARLES H WILSCN -CONTINUED 



HAMMER, PAT P 
MEYER, THOMAS J 



MINNEH.DOBIS ONEDA 
MOORE, H GREGORY 
PONTIUS, JOHN SAMUELS 
PSITCHETT.DEBRA ANN 
REINHART,GARY ALLEN 
SCANLAN, SUSAN P 
TEITGEN, ELIZABETH S 
WOLFRAM, MELANIE E 



DISTRICT OFFICE PRESS ASST $ 2,750.01 

CLERK, TO JUL 31 

CASEWORKER, FROM SEP 1 

LBJ CONGRESSIONAL INTERN, AUG 1 - AUG 31 2,013.83 

STENOGRAPHER 2,750.01 

STAFF ASSISTANT 3,000.00 

ACHINISTBATIVE ASSISTANT 8,750.01 

CLERK TYPIST, FROM SEP 1 500.00 

STAFF ASSISTANT 2,700.00 

RESEARCH ASSISTANT 4, 374. 99 

EXECUTIVE SECRETARY 6,000.00 

CASEWORKER, TO AUG 31 1,833.34 



OFFICE OF HON. LARRY WINN JE 



ANTHONY, VICTORIA L. 
BARR, STEPHANIE L 
BARR, WILLIAM G 
BERGMAN, EVALEE 
BOND, RICHARD L 
BUCHANAN, MARCIA A 
CLINGAN, SANDRA L 
ELDER, NAN ORR 
FLANDER,MARY ANN 
FRIDAY, LISA A 
GERSH, PAMELA 
GRESHAH.MARY ELIZABETH 
HOOPER, CORNELIA L 
LAMENDOLA,ANNA L 
MASONER, MEREDITH ANN 
NELSON, DIANNA SUE 
RUSSELL, LINDA MARIE 



CLERK 

CLERK 

LEGISLATIVE ASSISTANT, FROM JUL 5 . 
SECRETARY 

RESEARCH ASSISTANT 

LBJ CONGRESSIONAL INTERN, TO JUL 31 

CLERK, FECM SEP 1 

CLERK, TO JUL 31 

CLERK, FROM SEP 8 

CLERK 

CLERK 

LEGISLATIVE AIDE 

PRESS SECRETARY 

CLERK 

CLERK 



583.33 
846.67 
999.99 
166.67 
747. 49 
747.01 
590.00 
666.66 
833.33 
590.00 
184.00 
583.33 
300.00 
583. 34 
623.00 
147.17 
583.33 



OFFICE OF HON. TIMOTHY E WIRTH 



AYLWARD, DAVID KILLAM 
BRDNS,JUDSON LEROY III 
BURKE, DEBRA 
CATON.CAHY K 
CHAVEZ, PETER JAMES 
CHOATE, DIANE 
COOK, GREGORY D 
DICE, LOUISE R 
HAMLIN, LINDA E 
HERNON, BRIAN C. 
JACOBSON, MICHAEL R 
KNICKEL, WILLIAM BRUCE 
LANGFUR, SUSAN J 
LEACH, DAVID C 
LISKE, CRAIG 
LOE,JON D 
LOGAN, CHRISTOPHER C,JR 

MOORE, TIMOTHY X 
0' HAVER, JOY DOREEN 
RAUP, JAMES R 
ROWE, DAVID LEE 
SACHS, ROBERT J 
SANDERS, DAVID H 
SCHWARTZ, JOEL 
SEARS, BEVERLY C 
SHIMEL.LISA KAY 
SHORT, RANDALL K 
TORRES, PATRICIA 



LEGISLATIVE ASSISTANT, FROM SEP 1 

STAFF ASSISTANT., FROM SEP 1 

LEGISLATIVE CORRESPONDENT 

ADMINISTRATIVE ASSISTANT 

STAFF ASSISTANT, TO AUG 31 

STAFF ASSISTANT 

STAFF ASSISTANT., FROM AUG 1 

STAFF ASSISTANT 

STAFF ASSISTANT., FROM AUG 1 TO AUG 31 ., 

STAFF ASSISTANT, FROM JUL 6 

PRESS SECRETARY 

STAFF ASSISTANT., FROM SEP 1 

LBJ CONGRESSIONAL INTERN, AUG 1 - AUG 31 

LEGISLATIVE CORRESPONDENT 

DISTRICT REPRESENTATIVE 

STAFF ASSISTANT., FROM SEP 1 

PRINTER, TO JUL 31 

PRINTER, FROM SEP 1 

STAFF ASSISTANT 

RECEPTIONIST, FROM AUG 1 TO AUG 31 

INTERN, FROM AUG 1 TO AUG 31 

STAFF ASSISTANT, TO JUL 31 

LEGISLATIVE ASSISTANT, TO JUL 31 

STAFF ASSISTANT, TO AUG 31 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT 

LBJ CONGE ESS ION AL INTERN, TO JUL 31 

INTERN, TO JUL 31 

STAFF ASSISTANT 



,750.00 
,000.00 
,250.00 
,029.17 
,750.00 
,325.00 
,645.83 
,450.01 
,650.00 
,625.00 
,999.99 
500.00 
590.00 
,000.00 
,000.00 
,000.00 

,500.00 
,098.67 
933.33 
500.00 
,250.00 
,154.00 
,300.00 
,125.00 
,199.99 
590.00 
500.00 
,250.00 



OFFICE OF HON. LESTER L WCLFF 



BRCWN,JOY MAYES 
CARRO, RICHARD S 
CUTOLO, FRANK J 

DEMESQUITA,JEAN B. 
DULLAHAN, EILEEN C 
ELKINS.ANNE 
GEIZHALS.BENEK 
GOLDEN, RHODA 



STAFF ASSISTANT 4,794.00 

ADMINISTRATIVE ASSISTANT (D.C.) 4,807.00 

LEGISLATIVE ASSISTANT 3,000.00 

ADMINISTRATIVE ASSISTANT (DIST) 6,501.00 

CLERK 2,742.00 

CLERK 3,663.00 

STAFF ASSISTANT 3,000.00 

STAFF ASSISTANT 3,375.00 



159 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. LESTER L WOLFE -CONTINUED 

HARDESTY, SUSAN SOYKA STAFF ASSISTANT, FROH AUG 22 S 921.70 

HICKHAN, WILLIAM R,JR CLERK 3,120.00 

KIBBALL.ALBERT F EXECUTIVE ASSISTANT 6,501.00 

LAUFHAN, DIANE H RESEARCH ASSISTANT 2,668.00 

MARSHALL, CAROLYN D FUBLIC INFORMATION ASSISTANT 2,625.00 

HCKENNA, BARBARA FRANKLIN CLERK, FBCH AUG 1 TO AUG 19 449.03 

KILLER, GLORIA STAFF ASSISTANT 2,628.00 

HORAN.SARA S STAFF ASSISTANT., FROM SEP 1 709.00 

OSHAN, RICHARD H LEGISLATIVE ASSISTANT, TO JUL 31 917.00 

PALHER, EDWARD JOSEPH STAFF DIRECTOR (DC) 2,502.00 

POBELL,NINA B CLERK 3,507.00 

ROBINSON, BONNIE R STAFF ASSISTANT 3,975.00 

TUCKER, ABBY S LBJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

VINES, DEBORAH CLERK, TO AUG 31 1,334.00 

OFFICE OF HOB. ANTONIO BORJA SCN FAT 

ADELBAN, HELENA W SECRETARY 2,816.06 

BAMBA, JOSEPH G DISTRICT CASE WORKER 3,314.96 

BENAVENTE.BERNICE B STAFF AIDE INTEBN, TO JUL 31 590.00 

CHABFAUROS.JUANITA B STAFF ASSISTANT U, 617. 62 

CBISOSTOBO, BABY-LOU BOSABIO SECRETARY, FROH SEP 19 320.00 

EUSTAQUIO, GEORGE C AEBINISTB AT IVE ASSISTANT 8,833.33 

FOBD.C CHRISTOPHER STAFF ASSISTANT 5,000.01 

KUHLHANN, MICHAEL W RESEARCH ASSISTANT I*, 396. 92 

LARSON, NANCY L STAFF ASSISTANT 5,250.00 

PANGELINAN,IGNACIO J STAFF AIDE INTERN, TO JUL 31 600.00 

BABIBEZ.FLORENCIC T,JR ASST FCB COMMUNITY AFFAIRS 2,583.33 

SABLAN,GREGORIO G STAFF ASSISTANT 2,624.99 

SANTOS, FRANCIS A STAFF ASSISTANT 3,666.67 

SIENDO.ELSA F STAFF AIEE 3,314.96 

SPATZ.CARL HYIM STAFF ASSISTANT 4,163.37 

STILLWELL, ROGER G PRESS SECRETARY 6,246.38 

UNTALAN, RICHARD J LEJ CONGF ESSION AL INTERN, FROM SEP 1 590.00 

WHITENTON, MARSHALL B LEGISLATIVE ASSISTANT, TO AUG 11 2,153.67 

OFFICE OF HON. JIM WRIGHT 

BIABD, DOROTHY A LEGISLATIVE ASSISTANT 4,871.51 

BODIFORD, JIMHIE LEE TO AUG 31 

DISTRICT OFFICE MANAGER, FROM SEP 1 5,425.34 

COLLOH,JONASOE SECRETARY, TO AUG 31 

STAFF ASSISTANT, FROM SEP 1 2,874.99 

GBEEB, JAMES W RESEARCH ASSISTANT 6,791.01 

HALL, EDWIN L SPECIAL ASSISTANT 7,583.34 

HAWKINS, FAYE H SECRETARY, FROM AUG 4 TO AUG 19 334.00 

LENIHAN, NANCY B SECRETARY, TO AUG 31 

OFFICE MANAGER, FROH SEP 1 4,871.51 

LUHN,KATHY K SECRETARY, TO AUG 31 

STAFF ASSISTANT, FROH SEP 1 3,460.92 

HACK, JOHN P STAFF ASSISTANT, TO JUL 31 1,022.75 

MOORE, MARION J SECRETARY, TO AUG 31 

STAFF ASSISTANT, FROM SEP 1 2,358.69 

PAGE, ANNE M SECRETARY, TO AUG 31 

STAFF ASSISTANT, FBOM SEP 1 2,874.99 

PEBBY, PATRICIA A SECRETARY, TO AUG 31 

STAFF ASSISTANT, FROM SEP 1 3,846.34 

PETTY, JUDSON NAIL LEJ CONGRESSIONAL INTERN, TO JUL 31 590.00 

SHOSID.JOE L TO AUG 31 

STAFF ASSISTANT, FROH SEP 1 9,600.00 

STEVENS, LIBBY ANN STAFF ASSISTANT 3,000.00 

YOUNGBLOOD,HARJOBIE B SECRETARY, TO AUG 31 

STAFF ASSISTANT, FROM SEP 1 3,157.30 

OFFICE OF HON. JOHN W WYDLER 

BELTRONE, ARTHUR A.JB SPECIAL ASSISTANT, TO JUL 31 

SPICIAL ASSISTANT, FROH SEP 1 950.32 

COHEBFORD,HAUBA RECEPTIONIST 2,477.64 

DAUGHEBTY, EUGENIA H CASEWORKER 4,065.15 

DENNY, PATRICIA BYAN SECBETAEY, FBOM SEP 19 283.33 

GOEBTLEB,JOHN L 2,176.56 

GREGORY, ROBERT B ASSISTANT, TO AUG 31 901.47 

HOPPEL, ELIZABETH D ACBINISTB ATIVE ASSISTANT 9,815.67 

JOHNSON, VIBGINIA CLERK 2,124.99 



160 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

OFFICE OF HON. JOHN W WYDLER -CONTINOED 



KRCBBERG, ELIZABETH I 
HOBTENSEN, NANCY E 
NIEDRITIS.ERIK 
PERSHING, GLORIA I 
PORTER, ARIANNA 
PRESSON,LOIS R 
RAESLY,BARBO0RA G 
ROBENFELD, HENRIETTA 
SLOVER,LILA J 
SOLARI ,HARY V. 
SPARSHOTT, FRANCES L 
WEXLER, JEFFREY 
WILCOX, CONSTANCE B 



ASSISTANT, TO JUL 31 $ 

CLERK 

LBJ CONGRESSIONAL INTERN, JUL 5 - AUG 4 

SECRETARY 

CLERK 

CASEWORKER 

LEGISLATIVE ASSISTANT 

ASSISTANT, FROH AUG 1 

LEGISLATIVE AIDE 



500.00 
,221.59 

590.00 
.226.63 
,899.79 
,1*20.60 
,958.35 
,831.28 
-740.16 
,742.22 
.500.00 
,000.00 
,394.89 



OFFICE OF HON. CHAL8ERS P SYLIE 



BLOOM, WALLER C 
BOSSERHAN, BETTY LYNN 
CASTER, ELIZABETH C 
FELL, CAROLYN MAE 
FOULK,JACK H 
FRONCEK, THEODORE J,JR 

FUERST, BEVERLY ANN 
GRASSO, TERESA W 
GREENE, KATHLEEN A 
HAMILTON, JOSEPH G 
LARVA, PHYLLIS A 
BACDONALD,LISA P 

SANTORO, ANGELA J 
STERN, LINDA' 
VANBUSKIRK, MICHAEL H 

WEGNER, CHARLES W,JR 



DISTRICT REPRESENTATIVE 

SECRETARY 

SECRETARY, TO JUL 20 

CASEWORKER 

ALBINISTBATIVE ASSISTANT 

CLERK, FRCB JUL 15 TO AUG 5 

LBJ CONGRESSIONAL INTERN, TO JUL 14 

CLERK 

SECRETARY, TO JUL 15 

CLERK 

PRESS ASSISTANT 

SECRETARY 

CLERK, TO JUL 19 

LBJ CONGRESSIONAL INTERN, JUL 20 - AUG 18 

SECRETARY, FROH AUG 3 

SECRETARY, TO AUG 31 

EXECUTIVE ASSISTANT, TO AUG 31 

EXECUTIVE ASSISTANT, FROM SEP 5 

LEGISLATIVE ASSISTANT 



,494.00 
,086.50 
416.67 
,502.80 
,021.89 

688.33 
,325.00 

468.13 
,671.87 
,000.01 
,625.01 

944.00 
,256.67 
,551.50 

,041.00 
,617.50 



OFFICE OF HON. SIDNEY R YATES 



BAIN,MAHY ANDERSON 
BENDER, VERNETTE L 
BOGERT, CARROLL R 
DINGES, CHARLES V,IV 

EINSTEIN, LAURA F 
ELLIOTT, MARVA DANIEL 
ENGELHARD, NANCY J 
FISHER, JUDITH B 
GREENSTEIN.MARLA N 
KOVLER.PETEH B 

LINDNER, MARSHA 
MANSBACHER, URSULA 
MERLO.JOAN MARIE 
NADLIN,EDNA A 
SOLOMON, STEVEN ALLEN 
SQUITERO, PATRICIA A 
VANDUSEN, GEORGE 
WINPISINGER, VICKIE LEE 



ADMINISTRATIVE ASSISTANT 

CLERK 

CLERK, TO AUG 7 

CLERK, TO AUG 31 

LBJ CONGRESSIONAL INTERN, TO JUL 31 
RESEARCH ASSISTANT, FROM SEP 6 .... 

SECRETARY , 

CLERK, TO SEP 5 

STAFF ASSISTANT 

OFFICE INTERN, FROM SEP 15 

LEGISLATIVE ASSISTANT, TO JUL 28 . . . 
LEGISLATIVE ASSISTANT, FROM AUG 22 . 

CONGRESSIONAL AIDS 

STAFF SPECIALIST 

CONGRESSIONAL AIDS 

STAFF ASSISTANT 

OFFICE INTERN, FROH SEP 15 

RECEPTIONIST 

LEGISLATIVE ASSISTANT 

EXECUTIVE SECRETARY 



,975.00 
875.00 
801.67 

,380.00 
208.33 
,249.99 
,805.55 
,000.00 
53.33 

,343.41 
,363.30 
,324.23 
,750.01 
,090.82 
53.33 
,638.64 
,000.01 
,999.99 



OFFICE OF HON. GUS YATRON 

BADEN, SANDRA G 
BAMBERGER, BRENDA S 
BROAD, ELWOOD J 
CONSTANTELOS.JOHN 
DELVECCHIO, LAW PENCE 
FISHER, RODNEY B 
GEMMELL, JOSEPH P 
GITHAN, DAVID AARON 
GLENNON, EDWARD 
HOH, CHRISTOPHER JOHN 
PAULL, GEORGE 
PRITSCHER,ANN MCINTYRE 
SAUERS, LOUIS H 
SHEAR, KAREN J 



CASEWORKER, FROB SEP 6 625.00 

SECRETARY 2,562.49 

CLERK 2,183.33 

CLERK, TO AUG 31 1,500.00 

LEGISLATIVE AIDE 3,000.00 

AtBINISTRATIVE AIDE 3,875.01 

SPECIAL ASSISTANT 10,933.74 

CLERK, FROB AUG 1 TO AUG 31 750.00 

LEGISLATIVE AIDE 2,499.99 

LBJ CONGRESSIONAL INTERN, FROB SEP 1 590.00 

750.00 

CASEWORKER 2,625.00 

ADMINISTRATIVE AIDE 5,250.00 

CASEWORKER 2,499.99 



161 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. GUS YATRON -CCNTINOEt 



SPABLING,JANA SDE 
STEVENS, CONSTANTINE GUS 
STEVENS,VEBONICA T. 
TAVLABIDES,MABK 
WILSON, MIRIAM SCOGGINS 



CLERK J 2,750.01 

ADMINISTRATIVE AIDE., FROM AOG 1 2,500.00 

OFFICE MANAGER 3, 249.99 

LEGISLATIVE AIDE, TO AOG 31 1,500.00 

SECRETARY 3,174.99 



OFFICE OF HON. C W BILL YOONG 



ARNOLD, PAOLINE ANN 
CECCOLI, DEBORAH L 
CRETEKOS.GEOFGE N 
DICKS, LINDA E 
GLASS8AN, ELLEN JO 
GBEEN, DIANE C 
GREGORY, DOOGLAS H 
HALD,LAOREN CHASE 
KYLE, WILLIAM JAMES 
HILLEB, BARBARA H 
MITCHELL, THOMAS C 
NESBIT.HARY C 
RITCHEY,JODITH G 
SESSOMS, WILLIAM RICHARD 
SPITZIG, ANNIE ROTH 
NAHLER, ALICE S 



SECRETARY 3,075.00 

LBJ CONGRESSIONAL INTEBN, TO JOL 31 590.00 

CLEBK-STAFF ASSISTANT 4,899.99 

CLERK 2,625.00 

SECRETARY 2,750.01 

SECRETARY 3,000.00 

ADMINISTRATIVE ASSISTANT 7,050.00 

RESEARCH ASSISTANT 3,750.00 

SPICIAL ASSISTANT 3,900.00 

LEGISLATIVE SECRETARY. .'. 3,750.00 

CLERK 650.01 

SECRETARY 4,875.00 

SECRETARY 4,250.01 

OFFICE MANAGER 5,250.00 

SECRETARY 3,150.00 

CASE ASSISTANT 4,750.35 



OFFICE OF HON. DON YOONG 

ADISE, ROSSELL T 
AGER.LYNN PRICE 
ALHQOIST,BETTE L 
BRISLIN.CLEATOS J 
CHORCH.DIANNE V 
C0STEB,M CYD 
GREGG, WESLEY C 
H0CKABY,JOE STANLEY 
IRVING, A TORREY 
KENNEDY, ARTHOR 
LEXO, JAMES WH,JR 
LYNCH, ELEANOR A 
MEYER, PAMELA B 
MOORE, RODNEY H,JB 
HOLLINS,ANNE ■ 
0' MALLEY, WILLIAM T 
OBEBG, JACKIE B 
PERLES, RICHARD MARSHALL 
SHERMAN, DAVIS VAN R 
STANLEY, MAXINE 
VIVIAN.BDITB E 
ZANE,COBTIS J 



STAFF ASSISTANT, FROM SEP 1 1,600.00 

3,708.33 

STAFF ASSISTANT 1,050.00 

COHFOTER OPERATOR 3,124.99 

SPECIAL ASSISTANT, TO SEP 5 2,816.67 

STAFF ASSISTANT, TO AOG 31 1,200.00 

SPECIAL ASSISTANT 3,875.01 

OFFICE FINANCE MANAGER, FROM AOG 3 2,180.36 

RECEPTIONIST 2,750.00 

EXECOTIVE ASSISTANT 10,041.67 

EXECOTIVE ASSISTANT 8,250.01 

RECEPTIONIST-SECRETARY 1,483.33 

STAFF ASSISTANT 3,750.01 

LEGISLATIVE ASSISTANT, TO AOG 2 1,288.89 

PRESS ASSISTANT 4,050.01 

STAFF ASSISTANT, FROM SEP 1 517.55 

DISTRICT STAFF AIDE 1,800.00 

STAFF ASSISTANT, FROM AOG 1 TO AOG 31 954.80 

STAFF ASSISTANT., TO AOG 31 1,254.80 

STAFF ASSISTANT DISTRICT OFF 2,999.99 

EXECOTIVE SECRETARY 3,714.40 

STAFF ASSISTANT, TO JOL 31 1,300.00 



OFFICE OF HON. JOHN YOONG 

BO0GES,PATBICIA 
CADY.KELLEY 
CASTILLO, HELBA SUE 
GORDON, RONALD 
HARBOVER, REBECCA S 
HUGHES, GAIL F 
JORTA, PATRICIA M 
MAS0R,SH0RLEY 
NELSON, NAOMI H 
ONEIL.DOREEN 
PRENDEBGAST, JOSEPH T. 
TOWNSEND,CABELIA C 
WADLER,PAOL 
WOODARD, JAMES 



ADMIN SECTY - RESEARCH 

LEJ CONGRESSIONAL INTERN, TO AOG 12 

DISTRICT OFFICE MANAGER 

STAFF ASSISTANT 

SECRETABY-CASE WORKER 

SECTY-CASEWORKER-RECEPTIONIST 

STAFF ASSISTANT 

DISTRICT OFFICE MANAGER 

SECRETARY CLERICAL 

CLERK 

ADMINISTRATIVE ASSISTANT 

CLERICAL SECRETARY (TRANSLATOR) .... 

STAFF ASSISTANT, TO AOG 31 

PROJECTS G RESEARCH ASST 



,267.36 
826.00 
948.28 
,250.00 
,625.01 
,297.63 
,374.99 
,311.72 
,812.96 
,623.34 
,874.99 
,225.68 
,166.66 
,519.52 



OFFICE OF HON. BOBEBT A YOONG 



BANTE, MICHAEL J 
BBODSKY,NABK 
CAPSTICK, PEGGY D 
CONNINGHAH,GEBALDINE ROSE 



LBJ CONGBESSIONAL INTEBN, TO JOL 31 590.00 

STAFF ASSISTANT, TO AOG 19 «. 1,361.11 

STAFF ASSISTANT 3,000.00 

STAFF ASSISTANT, FROM SEP 26 187.50 



162 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



OFFICE OF HON. BOBEBT A YOUNG -CONTINUED 



HORAN, MATTHEW J 
KOENIG, BOBEBT LOUIS 
KYMAN,ALAN B 
L ABB, DEBORAH A 
MCDONNELL, BETH T 
MEYER, WALTER L 
NATHAN, DAVID A 
NOONAN.NABY ELLEN 
ROBINSON, TEBBY 
SAWYER, MICHAEL 
SILVERS, MABIE 
STEWART, JAMES L. 
STEWART, JOHN J 
TALISHIK, MICHAEL H 
VAN DILLEN,JEANNINE A 
WILSON, QUE NTIN 



STAFF ASSISTANT $ 2,499.99 

STAFF ASSISTANT 4,500.00 

STAFF ASSISTANT, TO JUL 31 500.00 

STAFF ASSISTANT , 4,500.00 

STAFF ASSISTANT 2,000.01 

STAFF ASSISTANT - DISTRICT MANAGER 6,249.99 

STAFF ASSISTANT 8,000.01 

STAFF ASSISTANT 3,500.01 

CLEBK TYPIST 2,250.00 

STAFF ASSISTANT 3,500.01 

STAFF ASSISTANT 4,500.00 

STAFF ASSISTANT, TO AUG 31 780.00 

STAFF ASSISTANT, FROM AUG 1 3,000.00 

STAFF ASSISTANT 3,500.01 

SECRETARY 1,925.00 

STAFF ASSISTANT 3,583.34 



OFFICE OF HCN. CLEMENT J ZABLCCKI 



AMIDZICH.GAIL M 
BENTO,REVA 
BRDNEB,KATHBYN H 
CALLAN, DEBORAH J 
EAKER.GERALDINE W 
EDWARDS, BRIDGET L 
JACOBY, PATRICIA ANN 
KISENAN, FRANCES B 
KOLCZYCKI, ALFRED S 
LANGE, KATHLEEN T 
MEREILL, DEBORAH J 
PSTEAS, DOLORES M 
SANTELLE, JAMES L 
SCHIERA, JUDITH A 
WALL EY, EILEEN 
WOZINSKI,LEONNE D 
ZIEBEBT,KATHBYN A 



RESEARCH ASSISTANT 

CLERK 

FILE CLEEK-TYPIST, FROM AUG 8 .... 

STAFF ASSISTANT - PART TIME 

PERSONAL SECRETARY AND CASE WOBKEB 

LEGIS COFBESPONDENT 

PART TIME SECRETARY 

CASE WORKER 

AEBINISTRATIVE ASSISTANT 

SUMMER INTERN, TO JUL 15 

STAFF ASSISTANT 

SECRETARY 

LBJ CONGFESSIONAL INTERN, TO AUG 5 

SF.CFETABY-EISTRICT OFFICE 

RECEPT S APPT SECTY, TO JUL 18 .... 

SECRETARY -DISTRICT OFFICE 

OFFICE ASSISTANT 



999.99 
096.61 
398.61 
293.33 
000.00 
293.33 
2 50.0 
K00. 28 
875.01 
250.00 
750.01 
874.99 
583.33 
725.00 
600.00 
856.63 
600.00 



OFFICE OF HON. LEO C ZEFERETTI 



BISNBAUM, MARILYN 
BLACK, MOBBIS 
BLAGHAN, DIANE 
BLOOM, NANCY L 
BRASCO, ARTHUR M 
CAVALLO, MARIA I 
COLEMAN, DOROTHY ANN 
COLEMAN, JAMES JOSEPH 
CURCIO, BOBEBT A,JB 
FAVALORO, JOSEPH J 
GALLOWAY, KATHLEEN 
HALEY, CAROL KURLANDER 
JOHNSON, KABEN E 
MATZ, JOYCE 
MCDERMITT, DAVID F 
MORGAN, JAMES K,III 
MORONESE, NICHOLAS 
NELSON, LULA BLACK 
RANIEBE, VINCENT 
ROCCO, IDA 
SABELLA, ANITA D. 
TASSO,MABIE J 



STAFF ASSISTANT, TO JUL 31 

STAFF ASSISTANT, FBOH AUG 1 

LEGISLATIVE AIDE, FROM SEP 1 

LEGISLATIVE CORRESPONDENT, TO AUG 31 

EXECUTIVE ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

LBJ CONGFESSIONAL INTEBN, TO JUL 31 . 

STAFF ASSISTANT 

STAFF ASSISTANT 

SECRET ARY 

APPOINTMENT SECRETABY/CASEBOBKEB .... 

LEGISLATIVE ASSISTANT 

PBESS SFCBETABY 

LEGISLATIVE ASSISTANT 

STAFF ASSISTANT 

STAFF ASSISTANT 

ADMINISTRATIVE ASSISTANT 

STAFF ASSISTANT, TO AUG 31 

STAFF ASSISTANT., FROM SEP 1 

STAFF ASSISTANT 

ADMINISTRATIVE AIDE 



890.77 
,781.54 

750.00 
,087.08 
,758.43 
,000.01 
,000.01 

590.00 
,134.39 
,250.01 
,087.13 
,150.00 
,659.39 
,000.01 
,583.29 
,614.99 
,750.00 
,063.75 
,916.66 

958.33 
,753.75 
,486.25 



OFFICE OF THE FORMER SPEAKERS 



BELOTE, BETTY GRAY 
BUTLER, LOISE 
LANE, SABA DEAN 
MANNING, MELVIN PAUL 
OKEEFE, ARTHUR J 
PAINTER, JANET SUE 



SECRETARY, TO AUG 31 1,572.46 

ADMINISTRATIVE ASSISTANT 3,909.30 

SECRETARY 3,909.30 

SECRETARY 3,909.30 

SECY TO FORMER SPEAKER 3,909.30 

SECRETARY, FBOH SEP 1 786.23 



163 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

MISCELLANEOUS ITEHS 

BROOKS, ROGER C DRIVER J 1,991.25 

FOBBS, MILLIE, JR CHADFFEDR 4,991.25 

NICKENS, GEORGE IRVIN CHADFFEDR 4,991.25 

COMMISSION ON ADMINISTRATIVE REVIEW 

BRCBN, BONNIE L SECRETARY, FROM JDL 20 2,366.67 

CAVANAGH, THOMAS E STAFF ASSISTANT 3,474.99 

CHENEY, CAROLYN MORROW OFFICE MANAGER 6,000.00 

CLANCY, PADL R SENIOR WRITER 7,250.01 

CLADS, TIMOTHY H STAFF ASSISTANT, TO JDL 31 100.00 

COOPER, JOSEPH STAFF DIBICTOR 11,000.01 

DAVIS, RICHARD D STAFF ASSISTANT, TO AUG 15 1,562.50 

DELLIGATTI,MARK STEPHEN STAFF ASSISTANT, TO JDL 31 202.50 

DEOFEL, DAVID B STAFF ASSISTANT, TO AOG 31 1,095.00 

EISENBERG, WARREN W 9,750.00 

FISCHER, VICTOR JOEL SURVEY RESEARCH DIRECTOR 6,500.01 

GARTH, MARJORIE GAY STAFF ASSISTANT, FROM ADG 15 1,533.33 

GOLDBERG, JEFFREY A 5,499.99 

HAMMOND, SDSAN B SENIOR STAFF MEMBER 3,099.99 

HEEGEPETH,JANE SECRETARY 3,041.67 

HDRBITZ, GEOFFREY B STAFF ASSISTANT, TO JDL 31 102.50 

KATZ, ALLAN J . GENERAL CCUNSEL 9,999.99 

KIEFFER.JAROLD A TASK FORCE DIRECTOR 7,711.76 

KIMPEL, DAVID C STAFF ASSISTANT 3,225.01 

KISK,JUANDA M TASK FORCE DIRECTOR, TO AOG 31 5,171.62 

KLOOS, SUSAN K SECRETARY, FROM AUG 1 2,200.00 

KNOLL, GINA D SECRETARY, TO JUL 19 643.89 

LANGSTON.DENIE SECRETARY 2,625.00 

LEVENSON, CAROLINE SETSUKO DOCUMENTS CONTROL OFFICER 5,874.99 

LEVINE, SHEILA SECRETARY, FROM JDL 19 TO AOG 26 1,266.67 

LIAPIS.TOOLA SECRETARY, TO AUG 31 

ASST OFFICE BGR, FROM SEP 1 3,583.33 

LISENBY, SARAH F SECRETARY 3,737.49 

MACKENZIE, G CALVIN SENIOR RESEARCH ANALYST 6,666.67 

MAISEL, LOUIS TASK FORCE DIRECTOR 8,307.24 

HALIN, JAMES W MANAGEMENT EVALUATION ACCOUNTANT 7,125.00 

MCCLUNG, ROBIN W STAFF ASSISTANT, TO AUG 12 1,808.34 

MCNDLTY, KATHLEEN B STAFF ASSISTANT, TO AUG 5 1,108.33 

MEIER, KENNETH J STAFF ASSISTANT, TO JUL 31 '. . 2,525.00 

MICHEL, LEO GABRIEL STAFF ASSISTANT, TO JUL 31 640.00 

0' DONNELL, THOMAS J RESEARCH ANALYST 3,999.99 

PARKER, GLENN R STAFF ASSISTANT, TO AUG 31 200.00 

QOANTIUS, SUSAN E STAFF ASSISTANT 1,500.00 

SCHOFEL, STEPHEN J STAFF ASSISTANT, TO JUL 31 157.50 

SMITH, HERBERT C STAFF ASSISTANT, TO AUG 31 400.00 

SWAIN, BEVERLY B SECRETARY, FROM AUG 1 TO AOG 31 100.00 

TUSA, JACQUELINE BALK MINORITY SENIOR ANALYST 6,249.99 

BATKINS, JOSEPH WESLEY TASK FORCE DIRECTOR, TO AOG 31 

SENIOR RESEARCH ANALYST, FROM SEP 1 7,757.43 

WEIL, MARTIN STAFF ASSISTANT, TO AOG 31 1,411.25 



COMMITTEE ON AGRICULTURE 

ABRAH, CHRISTINE D 
ADAMS, STEPHEN T 
ADAMS, THOMAS E,JR 
ARMANN, SHARON ANN 
ASHMORE, JAMES N 
BAIZE, JOHN 
BAUER, MARGARET L 
BELL, SUSAN 
BERRY, STEVEN K 
BOP, ROBERT H 
BROWN, ANITA R 
CASHDOLLAR, ROBERT A 
CESRI, ALISON B 
CHELLIS, EUGENE C 
COLE, ANN 

crapa, joseph r 
culver, james a 
disihone,r:ta l. 
dubahd, carol a 
dunsmore, george h 
fasley, loots t 
eu5e, stephen e 
farwell, charlotte holmes 



STAFF ASSISTANT 3,624.99 

STAFF ASSISTANT (P) 8,724.99 

STAFF CONSULTANT (P) 6,500.01 

STAFF ASSISTANT (P) 5,124.99 

STAFF ASSISTANT (P) 7,500.00 

SOBC STAFF CONS (LIVE 6 GRAINS) 6,249.99 

STAFF ASSISTANT 3,001.74 

STAFF ASSISTANT (P) 6,500.01 

STAFF ASSISTANT, TO AUG 31 1,733.34 

CCUNSEL (P) 11,874.99 

STAFF ASSISTANT (P) 6,000.00 

SUBCOMMITTEE STAFF CONSULTANT 7,837.50 

STAFF ASSISTANT (C) 6,166.66 

STAFF ASSISTANT, TO AUG 19 2,123.33 

STAFF ASSISTANT 3,916.66 

SUBC STAFF CONSULTANT 6,249.99 

STAFF ASSISTANT (C) 8,343.99 

STAFF ASSISTANT 6,249.99 

STAFF ASSISTANT 4,371.58 

STAFF ASSISTANT 6,683.76 

PRESS ASSISTANT (P) 9,500.01 

STAFF ASSISTANT 3,000.00 

SUEC STAFF CONS (TOBACCO) 5,228.40 



164 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

COMMITTEE ON AGRICULTURE -CCNTINUEI 



FOSBES, CAROL JEAN 
FRONCE,MARY ANN 
GRACE, ROGER D 
HAGEMAN, CYNTHIA KAI 
HICKEY, ESTHER S 
HOGAN,JOHN E 
IDE, LINDA 
IHHOF, WILLIAM A 
JABRATT.MARY CLAIBORNE 
JENNINGS, JAQDELINE L 
JORGENSEN, GERALD R 
KEYSER, DIANE M 
KOGDT, JULIA W 
KOLIOPOULOS, ANGELINA R 
KRAMER, JOHN R 
LANG.LEIGHTON W 
LEMASTER, DENNIS C 
MCLAUGHLIN, TERESA D 
MEADOWS, DOLORES C 
MILLER, LINDA J 
MOOS, EUGENE 
HURRAY, HYDE H 
MUSIL, ELMER LEE 
PECORE, PEGGY L 
PENA.HUMBEBTO RUBEN 
PRIMUS, WENDELL E 
ROSS, MARY L 
SHAB,MARY P 
SMITH, TIMOTHY B 
SPRINGFIELD, JAMES E 
SWIDEFSKI, JAMES W 

TAYLOR, PAMELA A 
TEMPLE, GLENDA LOUISE 
THEIS,PAUL A 
TRIGIANI, LUCIA ANNA 
VACIN,LYDIA 
WALSH, ELEANOR S 
WEST, FOWLER C 
WOHSHAM, WANDA MARIE 
WRIGHT, DAVID L 



SUBCOMMITTEE STAFF COUNSULTANT $ 7,749.99 

STAFF ASSISTANT 4,374.99 

STAFF CONSULTANT, FROM SEP 1 2,083.33 

STAFF ASSISTANT 2,874.99 

STAFF ASSISTANT (C) 4,749.99 

ASSOCIATE COUNSEL ( P) 1 1 ,124.99 

STAFF ASSISTANT, TO JUL 31 583.33 

ASSOCIATE COUNSEL (P) 11, 121*. 99 

STAFF ASSISTANT (P) 6,500.01 

STAFF ASSISTANT 4,250.01 

STAFF ASSISTANT 7,425.00 

STAFF ASSISTANT (C) 4,250.01 

STAFF ASSISTANT (C) 6,416.66 

STAFF ASSISTANT (C) 4,875.00 

SPECIAL COUNSEL 5,937.51 

SUBC STAFF CONS (OILSEEDS $ RICE) 6,737.22 

SUECCHHITTEE STAFF CONSULTANT 7,187.49 

STAFF ASSISTANT (C) 4,749.99 

STAFF ASSISTANT 3,972.99 

STAFF ASSISTANT 5,149.99 

STAFF ANALYST (P) 11,124.99 

COUNSEL (P) 11,874.9 9 

STAFF ASSISTANT 5,583.33 

STAFF ASSISTANT (P) 6,999.99 

SUEC STAFF CONS D3PT OP, INV, OVERS, 7,425.00 

STAFF ASSISTANT, TO JUL 23 2,605.21 

PRINTING EDITOR (P) 6,375.00 

STAFF ASSISTANT (C) 5,000.01 

STAFF ASSISTANT, TO AUG 5 680.55 

FCCD PROGRAMS SPECIALIST (P) 11,124.99 

SUBC STAFF CONS(FAH FMS.RU DEV) , TO AUG 31 .... 

SUBCOMMITTEE STAFF COUNSULTANT, FROM SEP 5 ... 6,249.99 

STAFF ASSISTANT 3,375.00 

STAFF ASSISTANT (C) 6,249.99 

STAFF CONSULTANT (P) 9,900.00 

STAFF ASSISTANT, TO JUL 31 800.00 

STAFF ASSISTANT 598.87 

STAFF ASSISTANT 4,250.01 

STAFF DIRECTOR (P) 11,874.99 

STAFF ASSISTANT (C) 5,850.00 

STAFF ASSISTANT (C) 9,375.00 



COMMITTEE ON APPROPRIATIONS 

ALLEN, GEORGE F 
ALTMAN, RICHARD H 
ANDERSON, CORNELIUS R 
ANDERSON, GRANT W,JR 
BACHULA,GARY R 
BAIKAUSKAS, PATRICK J 
BARBOUR, HENRY S 
BOBBITT, DOUGLASS E 
BON, MARGARET J 
BROTHER, DONNA M 
BROWNING, R S 
BURGESS, QUENTIN L 
CANNON, CHARLES A 
CASEY, GORDON E 
CAVAROCCHI, NICHOLAS G 
CHOUINARD, GERARD J 
CLANCY, MARTIN J 
CONROW, JAMES WILLARD 
DA VI S.DELACROIX, III 
DENTON, DONALD L 
DIXON, BETSY ANN 
DOBEK, ROBERT F 
DYER, JAMES W 
FAIRCHILD, JIMMY RAY 
FARMER, PAUL V 
FISHER, JOHN DONALD 
FORD, JACK T 
FOSTER, ROBERT B 
GABRIEL, ANTHONY J 
GARRITY.JOHN M 
GATEN,LEO P 
GILBERT, SANDRA A 
GUNNELS, AUBREY A 
HARDIN, CHARLES G 
HARDING, MARGARET K 



ASSOCIATE STAFF MEMBER (P) 8,250.00 

STAFF ASSISTANT 7,579.38 

CHIEF 11,874.99 

ASSOCIATE STAFF MEMBER (P) 6,875.01 

ASSOCIATE STAFF MEMBER .9,375.00 

ASSOCIATE STAFF MEMBER ( P) 3,999.99 

ASSOCIATE STAFF MEMBER 5,953.95 

ASSOCIATE STAFF MEMBER (P) 4,512.51 

STAFE ASSISTANT 3,249.99 

STAFF ASSISTANT 5,375.01 

ASSOCIATE STAFF MEMBER (P) , FROM AUG 1 6,250.00 

ASSOCIATE STAFF MEMBER 5,373.21 

ASSOCIATE STAFF MEMBER (P) 9,375.00 

STAFF ASSISTANT 8,158.89 

STAFF ASSISTANT 10,875.00 

ADMINISTRATIVE ASSISTANT 6,706.77 

ASSOCIATE STAFF MEMBER (P) 6,999.99 

ASSOCIATE STAFF MEMBER (P) 3,500.01 

STAFF ASSISTANT (P) , FROM JUL 17 5,138.88 

STAFF ASSISTANT 5,164.95 

ASSOCIATE STAFF MEMBER 4,250.01 

ASSOCIATE STAFF MEMBER 6,249.99 

ASSOCIATE STAFF MEMBER (P) 9,375.00 

CLERICAL ASSISTANT 7,579.38 

ASSISTANT EDITOR 7,610.61 

ASSOCIATE STAFF MEMBER (P) 7,837.50 

ASSOCIATE STAFF MEMBER (P) 6,999.99 

STAFF ASSISTANT 10,125.00 

ASSISTANT DIRECTOR 9,825.00 

STAFF ASSISTANT 9,769.59 

ASSOCIATE STAFF MEMBER (P) 5,750.01 

CLERICAL ASSISTANT 4,521.66 

STAFF ASSISTANT 11,874.99 

STAFF ASSISTANT 6,566.91 

ASSOCIATE STAFF MEMBER 6,750.00 



165 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



COMMITTEE ON APPROPRIATIONS -CONTINUED 

HARROLD, ROBIN CLERICAL ASSISTANT $ 3,502.14 

HAWES.MARY ASSOCIATE STAFF MEMBER 6,500.01 

HOLMES, NOEL D ASSOCIATE STAFF MEMBER (P) 5,000.01 

HUGO, FRANCIS H MINORITY CLERK 11.87U.99 

HILAND, JAMES BRIAN ASSISTANT DIRECTOR 11,225.01 

JACOB, DONALD G ASSOCIATE STAFF MEMBER (P) 6 , 4 9 9 . <4 7 

JACOBS, JEFFREY W ASSOCIATE STAFF MEMBER ( P) 5,000.01 

KEHL, DAVID K ASSOCIATE STAFF MEHBEF. (P) 7,500.00 

KEMP, PATRICIA ANNE CLERICAL ASSISTANT 3,716.73 

KENT, JONATHAN H ASSOCIATE STAFF MEMBER (P) 7,500.00 

KILLGORE, WILLIAM L,JR ASSOCIATI STAFF MEMBER 7,579.38 

KIMBALL, PHILIP H ASSOCIATE STAFF MEMBER (P) 3,249.99 

KINGFIELD, THOMAS J STAFF ASSISTANT 9,337.50 

KNISELY, ROBERT LYLE STAFF ASSISTANT 6,583.47 

KONEN, LOTTIE A SECRETARY 2,916.00 

KRAFT, KENNETH A ASSOCIATE STAFF MEMBER (P) 5,000.01 

KREPON, MICHAEL H ASSOCIATE STAFF MEMBER (P) 7,500.00 

KRIPOWICZ, ROBERT S STAFF ASSISTANT (P), FROM JUL 30 6,438.90 

LAKE.VALRIE L OFFICE MGR-HINORITY 3,375.00 

LEASOH,JENI CLERICAL ASSISTANT (C) 3,125.01 

LIEBEHMAN, KAREN J ASSOCIATE STAFF MEMBER (P) 4,470.46 

LOMBARD, EDWARD E STAFF ASSISTANT 11,124.99 

HABHY, SAMUEL A ASSOCIATE STAFF MEMBER 9,375.00 

MAINLAND, KEITH F CLERK AND STAFF DIRECTOR 12,249.99 

HALONEY, ROBERT HOWARD ASSOCIATE STAFF MEMBER (P) 6,000.00 

MALOW, RICHARD N STAFF ASSISTANT 9,385.59 

MANNING, ANNA L CLERICAL ASSISTANT 3,802.32 

MAREK, MICHAEL ASSOCIATE STAFF MEMBER (P) 5,333.34 

HAPINELLI, WILLIAM A STAFF ASSISTANT 8,873.70 

HATTS,HARCIA L CLERICAL ASSISTANT 3,917.49 

MAY, FRANCES SECRETARY 4,460.07 

MCCARTHY, SEAN ARTHUR ASSOCIATE STAFF MEMBER 6,500.01 

MEALY, GENEVIEVE A ADMINISTRATIVE ASSISTANT 4,429.08 

KICONI,AMERICO S STAFF ASSISTANT 7,893.33 

MILLER, LAURENCE C EDITOR 9,411.18 

MI2ELLE,DEMPSEY B STAFF ASSISTANT 10,125.00 

MOHRHAN, FREDERICK G STAFF ASSISTANT 11,124.99 

HOOK, REX WILLIAM ASSOCIATE STAFF MEMBER (P) 4,374.99 

MORRILL, JAMES A STAFF ASSISTANT 6,750.00 

MORRISON, B ENID STAFF ASSISTANT TO MINORITY 8,925.00 

MURPHY, CHARLES H ASSOCIATE STAFF MEMBER (P) 6,128.43 

MURPHY, PETER J,JR STAFF ASSISTANT 11,375.01 

NEIL, HENRY A.JR STAFF ASSISTANT 11,874.99 

NICHOLAS, ROBERT C,III STAFF ASSISTANT 8,342.10 

NIELSON, BYRON S STAFF ASSISTANT 6,937.03 

NOLEN.EDD ASSOCIATE STAFF MEMBER (P) - 9,375.00 

OLSON, DAVID RICHARD STAFF ASSISTANT 5,178.03 

ONEIL, MICHAEL J ASSOCIATE STAFF MEMBER, TO AUG 31 5,052.92 

ORAN, DANIEL ASSOCIATE STAFF MEMBER, TO JUL 31 2,526.46 

OSTHAUS,JOHH G STAFF ASSISTANT 8,161.47 

PERLA,TONI M CLERICAL ASSISTANT 3,552.15 

PFLDGER, FREDERICK F STAFF ASSISTANT 11,250.00 

PLASHAL,JOHN GALVIN STAFF ASSISTANT 6,098.79 

POTTS, ROBERT E ASSOCIATE STAFF MEMBER 6,500.01 

POWERS, EDWIN F STAFF ASSISTANT 8,712.48 

PRESTON, SAMUEL R SIAFF ASSISTANT 12,125.01 

RAY, KITTY L CLERICAL ASSISTANT 3,294.90 

RICHBOURG, DONALD E STAFF ASSISTANT 10,125.00 

BIHELY, DIANE ASSOCIATE STAFF MEMBER (P) 3,624.99 

SCHMIDT, DAVID A DIRECTOR 11,625.00 

SCHNEIDER, WILLIAM, JR ASSOCIATE STAFF MEMBER 7,579.38 

SCHOONMAKER.JAN ASSOCIATE STAFF MEMBER (P) 6,249.99 

SCIALABBA, CARMEN V ASSOCIATE STAFF MEMBER 9,000.00 

SEELMEYER, RICHARD B ASSOCIATE STAFF MEMBER (P), TO JUL 31 2,458.33 

SHULAW.DALE M CLERICAL ASSISTANT 4,907.76 

SIEGEL, LAWRENCE E ASSOCIATE STAFF MEMBER (P) 6,864.21 

SILSBY.EARL C STAFF ASSISTANT 11,375.01 

SMILEY, KATHLEEN ASSOCIATE STAFF MEMBER (P) 9,375.00 

SMITH, AUSTIN G CLERICAL ASSISTANT 5,599.59 

SMITH, CLAUDE WILLIAM, JF STAFF ASSISTANT 8,157.93 

SMITH, DONALD PAUL STAFF ASSISTANT 7,548.66 

SNODGBASS, CHARLES W STAFF ASSISTANT 8,922.66 

SPILLAN, HUNTER L STAFF ASSISTANT « 11,874.99 

STEPHENS, MICHAEL A STAFF ASSISTANT ( P) 6,340.68 

STEVENSON, EDWAPD T ASSOCIATE STAFF MEMBER (P) 6,249.99 

STOCKMAN, CHRISTINE CLERICAL ASSISTANT 4,011.36 

STOUT, EDWARD H ASSOCIATE STAFF MEMBER (P) 7,579.38 

STULL,ANN M SECRETARY 3,642.00 

TAYLOR, BETTY LOU CLERICAL ASSISTANT 4,074.78 

THOMAS, DOROTHY LAINE ASSOCIATE STAFF MEMBER 6,737.22 

THOMAS, RANDOLPH OFFICE ASSISTANT 4,238.01 



166 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



• COMMITTEE ON APPROPRIATIONS -CONTINUED 

THOMSON, PAUL E STAFF ASSISTANT $ 6,157.23 

TIMLIN, EILEEN C ASSOCIATE STAFF MEMBEE (P), FROM AUG 15 2,811.11 

URIAN, GEORGE A STAFF ASSISTANT 7,661.46 

VAGLEY, KAREN S CLERICAL ASSISTANT 6,267.72 

VANDEPSCHAAF, DEREK J STAFF ASSISTANT 11,250.00 

VISCLOSKY, PETER J ■ ASSOCIATI STAFF MEMBER ( P) 7,500. OB 

WALLIN,R D,J? ASSOCIATE STAFF MEMBER (P) 5,000.01 

WEINBERGER, MICHAEL S STAFF ASSISTANT 7,954.38 

WILLSON,J DAVID STAFF ASSISTANT 8,615.04 

SINTERS, JANE M CLERICAL ASSISTANT (C) 2,499.99 

ZACOFSKY, ELLEN CARCL CLERICAL ASSISTANT 3,248.34 

COMMITTEE CN ARMED SERVICES 

ARGENTA,RITA D SECRETARY (C) 3,609.42 

BATTISTA, ANTHONY R PROFESSIONAL STAFF MEMBER ( P) 10,749.99 

BAUSEP, EDWARD J PROFESSIONAL STAFF MEMBER 3,790.76 

BECK, ROSE C SECPETARY (C) , TO JUL 17 1,652.03 

BOVA, JOYCE C SECRETARY (C) 3,687.51 

BROUN, EMMA M FINANCIAL ASST (P) 4,474.99 

COFER,WILLISTON B,JR PRCFESSIONAL STAFF MEMBER, FROM JUL 18 6,590.27 

COOPER, THOMAS E PRCFESSICNAL STAFF MEMBER 7,500.00 

CROWELL,MAURITA L SECRETARY (C) 3,269.91 

DEAKINS, JAMES A CLERICAL STAFF ASSISTANT (C) 4,656.78 

ELLIS, L LOUISE SECRETARY (C) 6,158.43 

EMMERICHS, ROBERT M PRCFESSICNAL STAFF MEMBER (P), TO AUG 31 

PROFESSIONAL STAFF MEMBER, FROM SEP 1 6,125.00 

FORD, JOHN JOSEPH STAFF DIRECTOR (P) 12,500.01 

FROMM,MARCIA L SECRETARY 3,312.51 

GALANSS,MARY L SECRETARY 2,825.01 

GILAEDI, MONICA SECRETARY, FROM JUL 8 3,112.50 

GILLEECE,MARY ANN COUNSEL, TO AUG 31 

COUNSEL (P) , FROM SEP 1 7,125.00 

HAHN, THOMAS S PROFESSIONAL STAFF MEMBER ( P) 8,499.99 

HARDY, ISSIAH CLERICAL STAFF ASSISTANT (C) 3,747.66 

HOGAN, WILLIAM H,JR GENERAL CCUNSEL (P) 9,375.00 

HOLCOMB,GARY ALFRED PROFESSIONAL STAFF MEMBEP 5,503.59 

HUGHES, PETER C PROFESSIONAL STAFF MEMBER 8,750.01 

JON"S,BRENDA J SECRETARY 3,041.67 

JONES, NANCY SUE EXECUTIVE SECRETARY (P) 4,474.99 

KATZ.ILENE SECPETARY (C) , TO JUL 31 

CALENDAR CLERK (C), FROM AUG 1 3,302.16 

KLEIN, ADAM J COUNSEL (P) 7,274.99 

KRISER, LOUIS PRCFESSIONAL STAFF MEMBER (P) 6,719.53 

TALLY, JOHN F COUNSEL (P) 10,125.00 

LARSON, VALERIE PROFESSIONAL STAFF MEMBEP 4,500.00 

LAWRENCE, MARCIA A SECRETARY (C) 3,375.00 

MARSHALL, RALPH PROFESSIONAL STAFF MEMBER ( P) 9,814.52 

MOORE, ALMA B SECRETARY, TO JUL 31 

SECRETARY (C), FROM AUG 1 4,666.67 

NOFPIS, GEORGE COUNSEL ( P) 9,849.99 

OSTERMAN, GEORGIA C SECRETARY (C) 3,269.91 

POINDEXTEP, AMBER SECRETARY 2,959.33 

PRICE, WILLIAM PROFESSIONAL STAFF MEMBER ( P) 6,832.20 

SCOTT, MARCIA JONES SECRETARY 2,124.99 

SCRIVNEF, PETER C PROFESSIONAL STAFF MEMBEP ( P) 9,240.51 

SHORT, WILLIAM B,JR CLERICAL STAFF ASSISTANT (C) 5,061.72 

SHUMATE, J F,JR CCUNSEL ( P) 10,875.00 

SLEDGE, ALICE M DOCUMENTS CLERK 3,302.16 

SPENCE,LEROY J PRCFESSIONAL STAFF MEMBER 3,853.08 

TSOMPANAS.PAUL L PROFESSIONAL STAFF MEMBEP ( P) 10,749.99 

VANDECAR.LELA M SECRETARY, FROM JUL 25 2,291.67 

WEST, MICHAEL A RESEARCH ASSISTANT 4,678.0^ 

WHITE, JUSTUS P,JR PROFESSIONAL STAFF MEMBEF ( P) 8,000.01 

WILLETT,ANN R SECRETARY (C) 3,999.99 

WINCUP,G KIM CCUNSEL ( E) 8,250.00 

WOODS, RHONDA L SECRETARY 2,124.99 

COMMITTEE ON BANKING, FINANCE AND URBAN AFFAIRS 

ALEXANDER, RICHARD PESIARCH ASSISTANT, TO AUG 19 1,633.33 

ALT, DEBORAH A SECRETARY (C) 4,245.63 

AUERBACH, ROBERT D ECONOMIST (P) , TO AUG 31 

ECONOMIST, FROM SEP 1 7,920.86 

BARBASH, LOUIS ASSISTANT COUNSEL, FROM SEP 1 2,083.33 

BEERY, DIANA LEE SECRETARY, FROM AUG 29 1,244.45 

BEGUELIN, ROBERT DAYTON ASSISTANT CLERK, FROM SEP 1 70K.33 



167 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

COMMITTEE ON BANKING, FINANCE AND URBAN AFFAIRS -CONTINUED 

EELL, MICHAEL E FRCFESSIONAL STAFF MEMBER, FROM AUG 29 J 2,622.22 

BLACKSHEAR.JEWFL B CLERK TYFIST, FROM JUL 13 1,733. 3U 

BL"MFNTHAL,MTCHAFL LAWRENCE STAFF ASSISTANT, TO AUG 15 900.00 

BOBO.SALLIS ANNE SECRETARY (C) 3,721.47 

BOOTH, JEFFREY A PROFESSIONAL STAFF MEMBER 5,836.59 

BOUCHARD, ANNETTE M SECRETARY 3,931.14 

BSANAND,ROBEFT E MINORITY COUNSEL 6,533.33 

BROWN, JAMES W SUBCOMMITTEE COONSEL 3,999.99 

BROWN, VIRGINIA S ASSISTANT CLERK 3,957.33 

BROYDFICK, WILLIAM B PFCFESSIONAL STAF" MEMBER (P), TO JUL 8 800.00 

BUTLER, BARREN H MINORITY STAFF MEMBER 8,750.01 

CALDWELL, JAMES P,JP PFCFESSIONAL STAFF MEMBER 7,443.22 

CHAILLET.L MAFIE MINORITY SECPFTAPY (C) 5,571.30 

CLAPIDA, RILEY STAFF ASSISTANT, TO AUG 31 1,200.00 

CLEMENTS, FRANCES C SECRETARY 3,523.53 

COHEN, CARLA F PPCFESSICNAL STAFF MEMBER 5,306.01 

CPPELAND,JUNF A SECRETARY, FROM SEP 12 633.33 

COX, BRIDGET A ASSISTANT CLERK 2,750.01 

CRAIN.BEN W STAFF ECONOMIST 6,500.01 

CREWS, GPASTY, II COUNSEL ( P) 11,750.01 

DALE, EDWIN L,J? PRCFESSICNAL STAFF MEMBER 9,900.00 

DAPISTA,JANE B PPCFESSICNAL STAFF MEMBER (C) 6,351.72 

DEMCHUK.TANIA L PROFESSIONAL STAFF MEMBEP 4,500.00 

DESTEFANO, FRANK T PRCFESSICNAL STAFF ASSISTANT 9,60C.OO 

DIXON, WILLIAM P GENERAL COUNSEL ( P) 11,874.99 

DONAHUE, MAFILYN MINOPITY SECRETAFY 4,500.00 

DOREMUS,?HSOrOPE A,JR MINOFITY COUNSEL (P) - PROF ST 9,999.99 

DOETUS, DIANE E PRCFESSICNAL STAFF MEMBER 4,250.01 

DOTY, MARTHA M SECRETARY 4,625.31 

FARRI, DEBORAH JEAN SECRETARY 3,125.01 

FAXON, ROGER C PRCFESSICNAL STAFF MEMBEP 7,458.33 

FEINBERG, ROBERT S MINOFITY COUNSEL 7,500.00 

FELDMAN, LAWRENCE I ASST COONSEL TO MINORITY (P) 8,000.01 

FINK,OPMAN S ADVISER TO THE MINORITY 1,728.91 

FIORENTINO,MARK A STAFF ASSISTANT, TO AUG 22 1,040.00 

FLAHERTY, MICHAEL P EEFDTY GENERAL COUNSEL (P) 10,625.01 

GACDY, ANDES STAFF ASSISTANT, TO AUG 31 1,200.00 

GASPER, LOUIS C MINOFITY STAFF ECONOMIST 7,579.38 

•GELMAN, JUDITH REEECCA RESEARCH ASSISTANT, TO AUG 26 1,866.67 

GETLEIN, FRANK J DEPUTY STAFF DIRECTOR (P), FROM SEP 1 3,750.00 

GOINES, THOMAS K PRCFESSICNAL STAFF MEMBER 7,500.00 

GOLDSTEN,CHAFLCTTE L INV £ RESEARCH ASST 4,500.00 

HARE, CYNTHIA GALE SIAFF ASSISTANT, TO AUG 19 980.00 

HIGHTOBER, EMILY M ADMINISTRATIVE ASSISTANT 6,999.84 

HITZ, HELEN ADMINISTRATIVE ASSISTANT 8,034.0" 

HORBLTTT, STEPHEN A PROFESSIONAL STAFF MEMBEF 6,000.00 

HYSELL,TED LEGAL INTERN 2,499.99 

INMAN, LORRAINE G SECRETARY 5,128.77 

JACKSON, MERCER L,JR MINOFITY STAFF DIRECTOR (P) 11,250.00 

JOHNSON, GEORGE R,JR ASSISTANT COUNSEL (P) 4,749.99 

JONES, NORMAN H,JB SENIOR ECCNOMIST 9,900.00 

KAMM, SYLVAN J PFCFESSIONAL STAFF MEMBER (P) 7,352.13 

KAY, RICHARD MICHAEL ASSISTANT CLERK (C) 3,413.52 

KEANE, MARGARET M MINOFITY PFO STAFF MEMBER 6,249.99 

KELLY, MARY L STAFF ASSISTANT (C) 5,499.99 

KIERNAK, DAVID S MINOFITY STAFF ASSISTANT 5,750.01 

KINSFLLA, MICHAEL T PRCFESSIONAL STAFF MEMBER (P) 4,540.44 

KIFK,MARY E ASSISTANT CLERK (C) 4,219.41 

KL2PEK,MARY ELLEN SECRETARY, TO SEP 14 2,261.12 

KOTLSR.NEIL G FFCEESSICNAL STAFF MEMBER, TO AUG 31 3,334.00 

KUTCHE3, JAMES ALLEN SUBCOMMITTEE COUNSEL 6,046.80 

KWEIT, CATHERINE PRCFESSIONAL STAFF MEMBEF 6,249.99 

LAMB, JACKSON FRCFESSICNAL STAFF MEMBEF 9,900.00 

LAWPENCE, JUNE V SECPETARY, FROM AUG 15 1,725.00 

LAYTON,MARY W ADM ASST TO MINORITY 3,190.01 

LEWIS, JOSEPH C PRCFESSICNAL STAFF MEMBEF 9,900.00 

LEWIS, KEITH STAFF ASSISTANT, TO AUG 31 1,200.00 

LOFTUS, MAUREEN S SECRETARY, FROM A'JC, 8 1,693.05 

LOFTUS, ROBERT E SOECCMMITTEE STAFF DIRECTOR 7,588.38 

L05D,PAT-ICIA ANNE SECPETAPY 3,957.33 

MACHOL.MARGOT E RESEARCH ASSISTANT 4,400.01 

BAIN, TODD D ASSISTANT CLEPK, FPOM JUL 11 TO AUG 1 420. OC 

HCCLOSKEY,MAFGAEET E SECRETARY, TO SEP 2 1,753.96 

MCKEEVSR, BENJAMIN B COUNSEL, TO S EP 15 8,250.00 

MCMAHON, JAMES B MINOFITY COUNSEL 7,500.00 

MCMURRAY.GEPALD B STAFF EIRECTOR 11,166.67 

MEEK,KELSAY F FRCFESSIONAL STAFF MEMBER 9,900.00 

MILTICH, PA'IL A MIN DIRECTOR OF PUBLIC AFFAIRS 9,2"9.99 

MIN~Z,CARL A,JR RESEARCHER/STATISTICIAN 6,393.72 

MOLLENHOFF,C RAYMOND, JR INVESTIGATOR-RESEARCHER 5,306.01 

MOLLTCK, ANNETTE S PFESS ASSISTANT, FPOM JUL 25 TO AUG 31 1,000.00 



-500 0-78-12 



168 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

COMMITTEE ON BANKING, FINANCE AND URBAN AFFAIRS -CONTINUED 



NOOSE, TERESA L 
NELSON, PAUL 
NESBITT, NANCY J 
NORTHUP, GRAHAM T 
OLIVE?, DIANA T 
OP F.JAMES C 
PERRY, JEFFREY KEVIN 
PETERS, NANCY M 
PRICE, MARY ANN 
PKINS, CURTIS A 
RAUPACH, WANDA JEAN 
RAYHAWK, MARGARET L 
POCHE, WILLIAM J,JR 
ROCHE, WILLIAM W 
POLL, ANN L 
SECPESr, DAVID W 
SELIGSON, WENDY 
SHELLSNBERGER, JUDITH M 
SIMPSON, GAIL M 
SIVON, JAMES C 
SMITH, CATHEPINE M 
STABLEP, ELIZABETH 
S~!iN~ON, JOHN S 
STILL, RICHARD L 
STRATTON, DONALD J 
FTPICKER, WALTER P 
SULLIVAN, PEGINA ANNE 
THOMAS, JEAN L 
TOLAN, THOMAS L,III 
VALA NZANO, ANTHONY 
VAUGHN, DONALD G 
VEEDIER, STEPHEN J 
VETTEL, CONSTANCE ANN 
WALKS, SALLY LAHUE 
WALLICK,PUTH M 
WALSH, KATHY L ROHRIG 
WEBBER, EDWIN W 
WEIL, DAVID IRVING 
WEINTRAUB.POBEFT E 
WILSON, GREGORY P 
WYNN,JOHN P 
YOUNG, BONNIE S 
YOUNG, JUDITH A 



COMHITTEF CN THE BUDGET 

ALLEN, DAVID W 
AMYX, HILDA L 
AUSTIN, EUGENE T 
BAFP.IERE,BPENT B 
BEHAP, DIANE 
BELEW,M WENDFLL,JS 
BOISSEVAIN, HARPY J 
ROTTS, ELIZABETH E 
BROWN, CORNELIA E 
BUFFALINI, EILEEN A. 
CISSELL, ALLEN PAUL 
CLEAPY, WILLIAM J 
COLBY, VEP.GIE LEE 
COLLENDEP, STANLEY E 
CO^LE, FREDERIC W,II 
COVE, JOHN ? 
CPANDALL, DIANE C 
CR'IMPTON-BAWDEN, F C 
CULBREATH, CAROLYN 
DA TCHER, BERTHA M 
DEBAUN, SYLVIA S 
DOUGLAS, ALDA IRENE 
ELDER, LAURA F 
FREEDMAN, ANTHONY S 
GROMMST, ALLEN C 
GROSS, GEORGE 
GRHNOMAN, MARTHA 
HALE, RUSSELL D 
HARRIS, ALAIR TOWNSEND 
HAUPTMAN, ARTHUR M 
HEDLUND, JAMES BRADFORD 
KEDZIOR, DENNIS M 
KI NG, JOHN. J 



SECRETARY, TO JUL 29 $ 1 

CLERK 6 STAFF DIRECTOR (P) 12 

CLERICAL ASSISTANT (C) 3 

DEPUTY MINORITY STAFF DIFECTOS 11 

SECRETARY 3 

MINOFI"Y COUNSEL 7 

ASSISTANT CLERK, TO AUG 23 1 

ASSISTANT CLERK, FROM AUG 9 1 

SECRETARY 3 

SUBCOMMITTEE STAFF DIRECTOR 11 

EXECUTIVE SECRETARY 6 

RESEARCH ASSOCIATE 6 

RESEARCH ASSISTANT 4 

ASSISTANT CLERK, TO JUL 31 

SECRETARY, TO AUG 1 4 1 

PROFESSIONAL STAFF MEMBEF (F) 10 

ASSISTANT CLERK, TO JUL 31 

SUB OFFICE MANAGER 4 

STAFF ASSISTANT 3 

DIRECTOR, INV S RES-MINORITY 6 

MINORITY SECRETARY 3 

SUE/COMMITTEE STAFF DIRECTOR 9 

PROFESSIONAL STAFF MEMBER, TO AUG 31 2 

SUBCOMMITTEE STAFF DIRECTOR 9 

SPECIAL ASSISTANT 2 

ASSISTANT CLERK, FROM SEP 19 

ASSISTANT CLFRK, TO AUG 31 1 

SECRETARY 3 

PROFESSIONAL STAFF MEMBEF (P), TO AUG 31 3 

MINORITY COUNSEL 11 

ADMINISTRATIVE ASSISTANT (C) 6 

ASSISTANT COUNSEL (P) 5 

MINORITY SECRETARY 2 

MINOFITY SECRETARY (C) 3 

LEGAL ASSISTANT 7 

STAFF ASSISTANT ( C) 4 

SUBCOMMITTEE STAFF DIRECTOR 10 

SUEC STAFF DIR S COUNSEL 7 

SUBCOMMITTEE STAFF DIRECTOR 11 

MINORITY STAFF ASSISTANT 4 

STAFF ASSISTANT (MINORITY), TO JUL 1 

SECETARY 3 

RESEARCH ASSISTANT 3 

ASSOCIATE STAFF MEMBER (P) 8 

SECSFTAPY (C) 3 

COUNSEL (P) 8 

ASST TO THE EXEC DIRECTOR 3 

SECRETARY (C) 2 

CHIEF COUNSEL ( P) 8 

FCONOMIST 9 

SECRETARY (C) 3 

SECRETARY 3 

ADMINISTRATIVE ASSISTANT (C), FROM AUG 14 1 

ASSOCIATI STAFF MEMBER (P) 6 

ANALYST (P) 11 

ADMINISTRATIVE ASSISTANT (C) 4 

ASSOCIATE STAFF MEMBER (P) , FROM SEP 5 1 

ANALYST (P), FROM JUL 16 5 

SP ANALYST (P) 11 

RESEARCH SECRETARY ( C) 4 

BUDGET ANALYST (P) 8 

SECRETARY (C) 3 

SECRETARY (C) 3 

LIERARIAN 3 

RESEARCH SECRETARY 3 

SECRETARY 3 

ASSOCIATE STAFF MEMBER ( F) , TO SEP 3 5 

ANALYST (P) 7 

EXECUTIVE DIRECTOR (P) 12 

EUtCET ANALYST (P) 4 

EUIGET FRIORITIES ANALYST (P) 8 

SENIOR ANALYST 11 

ASSOCIATE STAFF MEMBER (P) 5 

DEPUTY MINORITY STAFF DIFECTOS 9 

CHIEF, BUDGET OPES (P) 8 

ALMINISTFATOF 7 



087.50 

500. 1 
0i3. 33 
000. 51 
125.01 

.250. '11 
060.0" 
227.77 

.375. 11 
374.99 
203. 9» 

,1*07.01 
038. JO 
791.67 

,910.08 
625.01 
433.33 
544.04 
249.99 

,000.0" 
990.09 
000. 0C 

,000.00 
900.00 
727.63 
266.67 
K16. 66 

,500.01 
083. 31* 
000.01 

,491.58 
087.01 

.37U.99 
21*9.99 
250.01 

,953.21 
875.00 

025. 1 
,374.99 

083.31* 

40. 8u 

750.00 

132.84 



,940.00 
,125.01 
,499.99 
,000.00 

,600.01 
,625.00 
,395.79 

,7^4.54 
,000.00 
,893.05 
,12 5.01 
,874.99 
,284.72 

,418. 1 J 

,933.31 
,874.99 
,12 5.00 
,912.4Q 
,825.00 
,937.51 

,414.69 
, 9 1 1 . 9 4 
,841 .77 
,750.00 

,500.00 

,500.01 
,550. '1 

,450.01 
,874.99 
,799.99 

,900. or 

,450. 01 
,394.91 



169 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30. 1977— Continued 



COHHITTEE ON THE BUDGET -CONTINUED 



KNOLL, GINA D 
LANE, ESTHER C 
LEONARD, ROBERT JAHES 
LEVENTHAL, KENNETH H 
LILLEY, WILLIAM, III 
LILLY, SCOTT 
LYDAY, JAHES H 
LYONS, PHILIP B 
BANES, JOSEPH 
HA STERS, NICHOLAS A 
HCDONALD, JOHN W 
HCLELLABD.LOCY 
HCNAUGHTON, SUSAN G 
HEREDITH, HILTON B 
NAILL, KATHLEEN NCEL 
NELSON, PAUL N 
PARKER, JANE I 
PECORAK.CAHILLE A 
PHILLIPS, CATHERINE R 
RAY, JAHES E 
RAYACK, BENDY L 
RIETHER, JANET A 
ROTHERHAH, JAHES A 
ROTUNDA, DONALD T 
ROYAL, GRACE S 
RUHE, SHIRLEY L 
SCHNEIDER, HAPY HARGA.RET 
SEGAL, JEROHE 
SENF, ELEANOR H 
SIHON, BENSON J 
STARR, EDWARD 
STINER, NANCY H 
STORH, PETER H 
TAYLOR, JANE P 
TEETERS, NANCY H 
TELSON,HICHAEL L 
THOHAS, CHARLES H,JB 
THOHAS, NATHANIEL W 
TINAJERO, DOROTHY R 
TUSAIE, PATRICIA C 
UNSHORTH, ALLEN 
WALKER, BRENDA C 
BENTZEL.KENDRICK B 
WIECKING, CHARLES W 
WILSON, NANCY C 
WOOD, BEATRICE C 



SECRETARY (C) , FROH JUL 20 $ 2,563.88 

ASSOCIATE STAFF HEHBER (P), FROH JUL 12 5,186.10 

ANALYST 3,577.32 

BUDGET PRIORITIES ANALYST 7,125.00 

HINORITY STAFF DIRECTOR (P) 10,625.01 

ASSOCIATE STAFF HEHBER (P) 8,750.00 

ECONOMIST 9,900.00 

HIN PROF STAFF CONSULTANT 5,783.55 

ANALYST (P) 11,228.25 

DIRECTOR, HAJ ASSO STAFF (P) 9,999.99 

SPEC ASST/PUBLIC INFOR DIR 11,871.99 

ASSOCIATE STAFF HEHBER (P) 6,000.00 

AEHINISTRATIVE ASSISTANT (C) 1,100. 01 

ASST DIRECTOR-BUDGET PRIORITS 11,871.99 

RESEARCH ASSISTANT 1,169.70 

CLERK-HESSENGEB 3,321.99 

STAFF ADMINISTRATOR (P) 5,625.00 

SECRETARY (C) 2,871.99 

SECRETARY (C) , TO JUL 31 1,610.93 

ASSOCIATE STAFF HEHBER (P) 6,200.01 

ECCNCHIST (P) 3,587.19 

RECEPTIONIST (C) , FROH SEP 23 211.11 

BUDGET PRIORITIES ANALYST (P) 10,625.01 

ASSOCIATE STAFF HEHBER (P) , TO AUG 21 3,157.07 

SECRETARY (C) 3,350.01 

CHIEF, EUEGET PROCESS (P) 6,099.99 

SECRETARY (C) , FROH AUG 1 1,333.31 

ASSOCIATE STAFF HEHBER (P) 6,219.99 

RESEARCH ASSISTANT 3,891.18 

SENIOR BUDGET PRIORITIES ANYST 10,625.01 

ASSOCIATE STAFF HEHBER (P) 8,187.51 

SECRETARY (C) 1,221.99 

BUDGET PRIORITIES ANALYST ( P) 10,625.01 

ANALYST (P), FROH JUL 13 7,691.66 

ASSISTANT DIRECTOR ECO ANALYSI 11,871.99 

BUDGET PRIORITIES ANALYST (P) 8,121.99 

SR ANALYST (P) 9,500.01 

ASSOCIATE STAFF HEHBER (P) 6,125.01 

ADHINISTRATIVE ASSISTANT (C) 1,100.01 

ANALYST (P) 3,525.00 

ECONOHIST (P) , FROH JUL 18 1,258.33 

RECEPTIONIST (C) 2,227.65 

ASSOCIATE STAFF HEHBER (P) 8,250.00 

SB ANALYST (P) 11,871.99 

ECCNOHIST (P) 7,100.01 

ADHINISTRATIVE ASSISTANT (C) 1,281.72 



COHHITTEE ON THE DISTRICT OF COLUHBIA 



ANDERSON, DOROTHY H 
BARTHWELL,JACK C,III 
BRAUER, ROBERT B 
CALKIN, HUGH B 
CHAVES, BARBARA COLE 
CLARK, JAMES T 
DALY, CHRISTOPHER J 
DEMAIO, GRACE H 
POISON, PATRICIA SUE 
FARR,JOHN D,III 
FLOYD, DOLORES C 
FRANK, ALFRED S,JR 
FREEHAN, DANIEL H 
GERALD, DIETRA L 
GRAS,HARGUERITE E 
HALL, DANIEL 
HARLEY.DONNIE H 
HOLHAN, KERRY G 

JACKSON, BARBARA ROBINSON 
JOSEH, MARIANNE 
MACIVER,DALE 
HANLEY,LAVONNE H 
MARTIN, RUBY G 
MCCORHACK, SUSAN T 
HILES, JOYCE A 
MOSBAEK,HARGI H 

NICKENS, BEVERLY E 
OTERO, HARIA L 



STAFF ASSISTANT (P) 5,081.25 

STAFF COUNSEL (P) 1,717.35 

STAFF ASSISTANT (C) 7,579.38 

STAFF ASSISTANT (P) 6,211.50 

HINORITY RESEARCH ANALYST (P) 5,132.01 

LEGISLATIVE COUNSEL (P) 9,891.99 

ASST MINORITY STAFF DIR (P) 6,999.99 

SECRETARY 3,695.25 

SECRETARY 2,869.50 

HIN LEGIS STAFF ASST (P) 5,750.01 

SENIOR SECRETARY 3,878.19 

HINORITY STAFF COUNSEL (P) 7,579.38 

STAFF COUNSEL ( P) , TO AUG 19 1,235.72 

STAFF ASSISTANT (P) 7,120.71 

SECRETARY 3,196.08 

STAFF COUNSEL (P) 6,219.99 

SECRETARY 3,026.76 

STAFF ASSISTANT (C) , TO AUG 31 

STAFF ASSISTANT, FROH SEP 1 1,500.00 

STAFF ASSISTANT 2,358.69 

MINOFITY RESEARCH ANALYST (C) 3,725.01 

STAFF COUNSEL (P) 9,291.75 

SECRETARY TO STAFF DIRECTOR (C 1,321.23 

GENERAL COUNSEL (P) 12,171.99 

HINORITY SECRETARY (C) , TO JUL 25 860.81 

SECRETARY 3,158.01 

STAFF ASSISTANT (C) , TO AUG 31 

STAFF ASSISTANT, FROH SEP 1 1,127.67 

SECRETARY 3,288.99 

OFFICE ADHINISTRATOR (C) 6,009.06 



170 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



COMMITTEE ON THE DISTRICT OF COLOMBIA -CONTINUED 



PATCH, DAVID C 
RAMOS-BATES, KAREN 

RICHARDSON, THEODORE 
RIMENSNYDER, NELSON F 
ROONDTREE,INEZ B 

SINGLETON, HARRY M 
SYLVESTER, EDWARD C,JR 
WASHINGTON, BARBARA C 
WELLS, JACQUELINE E 
WE STBR 00 K, LORRAINE 
WHITE, ERIC B 
WILLOUGHBY.JOAN T 
WINSTON, LOUISE H 
YAHNER,JOHN A 



MIN LEGIS STAFF ASST $ 4,625.01 

EXECUTIVE SECTY (MINORITY), TO AUG 31 

EXEC SECTY (MIN)(C), FROM SEP 1 3,500.01 

BILL CLERK 3,669.06 

STAFF ASSISTANT (P) 6,951.09 

STAFF ASSISTANT (C) , TO AUG 31 

STAFF ASSISTANT, FROM SEP 1 4,127.67 

DEPUTY MINORITY COUNSEL (P) 8,124.99 

STAFF EIRECTOR (P) ,... 12,500.01 

MINORITY -CHIEF COUNSEL (P) 9,900.00 

STAFF ASSISTANT (P) 7,1*59.08 

EXECUTIVE SECRETARY (C) 4, 258. 20 

INTERN, TO AUG 31 1,300.00 

STAFF ASSISTANT (C) 5,306.01 

INFORMATION ASSISTANT/RECEPTIONIST 3,722.01 

RESEARCH ANALYST (C) , TO JUL 8 266.67 



COMMITTEE ON EDUCATION AND LABOR 



ANDERS, MARY A 
ANDRINGA, ROBERT C 
ANSHELES, CAROLE J 
ASKIN, FRANK 
BAKER, DONALD H 
BALDWIN, GOLDIE A 
BAOM, EDITH CARTER 
BEAUMONT, JEUNESSE H 
BECK, CYNTHIA 
BELT,TERRE H 
BENOIT.MOYA D 
BERENS, DONALD F 
BERISH, KATHLEEN 
BIRCH, THOMAS L 
BLACKHON.S KIB 
BOWLEY, PATRICIA R 
BREATHITT, MARY FRAN 
BROCKMAN, PHOEBE 
BYRD.LORI SUSAN 
CARTLLO, FRANCIS XAVIER,JR 
CARROLL, DORIS P 
CARUTHERS, WILLIAM F,II 
CAUSEY, WILLIAM F 
CHANIN,JEFF TODD 
CLARK, KATHERINE K 
CLAY, BEATRICE RITTER 
COLLINS, PAUL R 
CORNETT, ELIZABETH A 
CROSS, CHRISTOPHER T 
DARGANS, LOUISE M 
DEAN, JOHN E 
DEMARCO, VINCENT 
DEMARF, SUSAN C 
DEROSE, THOMAS M 
DIDONATO,DALE L 
DO MENICK, JULIE 
DUFFY, HUGH G 
DUNCAN, JACK G 
DWYER,PAUL F 
EPPERSON, RUTH M 
FEINSTEIN, FREDERICK L 
FORKENBROCK.JOHN 
FOX, CYNTHIA L 
GABERLAVAGE, GEORGE J 
GAUL, WILLIAM F 
GENTRY, BARBARA A 
GILLETTE, ROBERT J,JR 
GLEASON, PATRICIA ANNE 
GLOVER, SANDRA J 
GODLEY.JOAN M 
GOODE, CHERYL D 
GOODMAN, BRUCE 
GRAY, MARSHA ANNE 
GRAYSON, SUSAN D 
GRENIER, NANCY L 
GRIFFITH, ROBERT Y 
GROOMES.TRACEY ANN 
HALL, MARILYN S 
HAMLIN, ROSE H. 
HAYS, SUZANNE 



STAFF ASSISTANT 3,450.00 

MINORITY STAFF DIRECTOR (P) 11,499.99 

SECTY 6 COMPUTER OPERATOR 4,749.99 

SPECIAL COUNSEL (P) 10,250.01 

CHIEF CLK-ASSOC COUNSEL (P) 12,500.01 

LEGISLATIVE ASSISTANT 4,053.06 

MINORITY COUNSEL FOR LABOR (P) 11,499.99 

CLERK 5,969.25 

RESEARCH ASSISTANT, FROM AUG 1 TO AUG 31 750.00 

RESEARCH ASSISTANT/WRITER 3,999.99 

SECRETARY 2,062.50 

SENIOB STAFF ASSISTANT (C) 9,443.01 

STENOGRAPHER 3,717.24 

LEGISLATIVE ASSOCIATE 5,062.50 

ASSISTANT CLERK, FROM JUL 6 TO AUG 15 793.33 

ADMINISTRATIVE ASSISTANT (C) 5,400.00 

RESEARCH ASSISTANT 2,850.00 

ASSISTANT CLERK, TO AUG 31 320.00 

ASSISTANT CLERK, TO AUG 31 320.00 

ASSISTANT CLERK, TO JUL 31 550.00 

STAFF ASSISTANT, TO JUL 14 233.33 

ASSISTANT CLERK, TO JUL 31 500.00 

COUNSEL 8,900.01 

ASSISTANT CLERK, TO AUG 22 1,031.33 

RESEARCH ASSISTANT (C) 6,750.00 

SECRETARY 3,800.10 

ASSISTANT CLERK, TO AUG 19 1,061.67 

AEHIN ASST AND SECRETARY (C) 7,650.00 

MINORITY LEGISLATIVE ASSOC (P) 11,499.99 

RESEARCH DIRECTOR (P) 11,874.99 

RESEARCH ASSISTANT 3,000.00 

ASSISTANT CLERK, TO AUG 11 813.17 

STAFF ASSISTANT 3,624.99 

ASSISTANT CLERK, TO AUG 31 1,000.00 

ASSISTANT CLERK 2,620.74 

CLERK E ADMINISTRATIVE ASSIST 6,249.99 

ASSOCIATE COUNSEL (P) 11,874.99 

COUNSEL 11,874.99 

COUNSEL 9,900.00 

SECRETARY 3,240.00 

COUNSEL 6,750.00 

STAFF ASSISTANT 5,499.99 

SECRETARY 3,375.00 

RESEARCH ASSISTANT 999.99 

ASSOCIATE GENERAL COUNSEL (P) 11,874.99 

STAFF ASSISTANT, FROM JUL 5 1,373.33 

ASSISTANT CLERK, TO AUG 12 700.00 

STAFF ASSISTANT 3,650.01 

STAFF ASSISTANT 3,650.01 

EXECUTIVE SECRETARY 4,125.00 

ASSISTANT CLERK, TO SEP 18 1,547.00 

RESEARCH ASSISTANT, TO AUG 6 960.00 

CLERK TYPIST 3,999.99 

STAFF DIRECTOR . 8,903.25 

MINORITY SECRETARY 3,350.01 

ASSISTANT CLERK, TO AUG 18 952.00 

RESEARCH ASSISTANT 786.24 

SECRETARY 3,459.39 

SECRETARY 3,444.90 

SECRETARY 3,592.26 



171 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

COBBITTEE ON EDUCATION AMD LABOR -CONTINUED 



HERON, BELITA A 
HO FN SBT, IS BELL A 
HOGGINS, JANES S 
JENNINGS, JOHN F 
JOLLY, THOMAS B 
JUNTILA, STEVEN 
KELLHAN, FRANKLIN SCOTT 
KEYSERLING,LEON H 
KLINE, S HOBARD 
KOBER, NANCT L 
KRUGHAN,NEIL B 
LARSON, MEREDITH A 
LAVOR,HARTIN L 
LEININGER, SHARON L 
LIPHAN,RUTH 
LOVESEE,ALAN BOBEBT 
HALLINO, DAVID L 
HANDELLA.BEBNAHD A 
MATEO, RYRNA A 
HCCAGDE,JOHN H 
HCFABLAND,S JEFFERSON 
HCNALLY,BABGABET BABY 
HILLS, SHIBLEY P 
BORRISOH,BABBARA E 
HORSE, PATRICIA B 
HOSSE, RICHARD H 
HOYE.HICHAEL LEE 
BUELLEB, EUSSELL J 
HORBAY,H L 
NASH, KENNETH C 
NEDZI,LDCIEN A 
OBTIZ, ABNULPO 
PAINTER, TONI E 
PAOL,HABY R 
PINKARD, DAVID 
POHL, ROBIN L 
PUTNAM, DAVID S 
RADCLIPFE, CHARLES B 
HALEY, GORDON A 
REED.HARTBELL DOVALL 
REEVES .BENJAHIN F 
RODRIGUEZ, SILVIA J 
SCHANZEB, CAROLE H 

SCHOTT, PETER 
SEHPLE, NATHANIEL H 
SHEINKHAN, JOSHUA 
SHIRE, HARK J 
SHDLEB.BARY L 
SHITH, YVONNE FRANKLIN 
STANFORD, KRISTIN 
STANLEY, ROBERTA E 
STEPHENS, FRANCES P 
STEPHENS, JAHES H 
STERN, BRUCE H 
STRONK, DOROTHY L 
SULLIVAN, PATRICIA A 
SWIFT, IVAN 
THOHSON, JEANNE E 
TRIBBLE.BILLIAH B 
TBOUP,LELIA B 
TUCKEB.SCHEBRI L 
VAGLEY, BOBEBT E 
VECCHIABELLI, ANNETTE H 
VEHAR, AUGUST RANDALL 
BARD, PAUL K 
BATSON.HILDRED L 
BHITSETT,HARY L 
BICKER, FLOYD B 
BOLANIR.THOHAS R 
BRIGHT, LOUISE B 
BTHAN, MARIAN RUTH 
BYSONG, JENNIFER D 



STAFF ASSISTANT, FROH SEP 7 $ 666.67 

ASSISTANT CLERK, FROH AUG 15 912.33 

RESEARCB ASSISTANT, FROH AUG 1 TO AUG 31 750.00 

COUNSEL 11.87U. 99 

COUNSEL 11, 871*. 99 

LEGISLATIVE ASSISTANT 4,125.00 

ASSISTANT CLERK, TO JUL 31 500.00 

STAFF ASSISTANT 3,316.62 

COUNSEL 6,249.99 

STAFF ASSISTANT 3,800.10 

ASSISTANT CLERK, TO JUL 31 500.00 

HINOFITY BESEARCH ASSISTANT, FROB SEP 6 1,770.83 

MINORITY LEGISLATIVE ASSOCIATE 10,71*9.99 

RESEARCH ASSISTANT 4, 875. 00 

RESEARCH ASSISTANT, TO AUG 6 1,200.00 

COUNSEL 7,71*9.99 

RESEARCH ASSISTANT U, 181. 13 

STAFF DIBECTOB 7,250.01 

MINORITY SECTY 3,125.01 

ASSISTANT CLERK, TO JUL 31 500.00 

RESEARCH ASSISTANT 3,600.00 

RESEARCB ASSISTANT, TO JUL 31 880.00 

SECRETARY 5,983.59 

SECRETARY TO GENERAL COUNSEL 5,300.01 

CLERK 5,750.01 

ASSISTANT HINORITY COUNSEL 9,154.17 

ASSISTANT CLERK 1,561.92 

ACTUARY 6 BIN LEGIS ASSOCIATE 11,000.01 

BUDGET SPECIALIST (P) 11,874.99 

ASSISTANT CLERK, TO JUL 27 600.00 

ASSISTANT CLERK, FROB AUG 1 TO SEP 19 1,143.33 

ASSISTANT CLERK, TO AUG 6 840.00 

SECRETARY 4,258.95 

SECRETARY 3,257.82 

ASSISTANT CLERK 1,689.99 

ASSISTANT CLERK, TO JUL 31 500.00 

STAFF ASST TO THE ASSOC GEN.C 3,277.98 

HINORITY COUNSEL (P) 11,499.99 

LEGISLATIVE ASSOCIATE 5,708.33 

GENERAL CCUNSEL (P) 12,500.01 

ASST TO CHB 6 ASST CHIEF CLK (P) 11,874.99 

STAFF ASSISTANT (C) 3,875.01 

CLERK G ADM ASST, TO AUG 31 

CLERK 6 ADMINISTRATIVE ASSIST, FROM SEP 5 .... 5,131.26 

STAFF ASSISTANT 3,600.00 

BINOBITY LEGISLATIVE ASSOCIATE 9,249.99 

ASSISTANT CLEBK, TO AUG 10 793.33 

ASSISTANT CLEBK, TO AUG 31 1,000.00 

SECRETARY (C) 4,797.84 

BINORITY STAFF INVESTIGATOR, TO JUL 5 338.19 

TYPIST 1,650.00 

LEGISLATIVE ASSISTANT 3,958.33 

BESEARCH ASSISTANT 3,624.99 

ASSISTANT LABOR COUNSEL 5,499.99 

RESEARCH ASSISTANT, FROH SEP 6 694.44 

BINORITY CLERK (P) 5,625.00 

SECY-OFFICE BGR 4,899.99 

LEGISLATIVE ASSISTANT 5,450.01 

LEGISLATIVE ASSISTANT (C) 6,900.00 

ASSISTANT CLERK, TO AUG 12 980.00 

ADBIN ASST AND SECRETARY (C) 6,750.00 

ASSISTANT CLERK 2,499.99 

DIRECTOR 11,874.99 

CLERK TYPIST 3,125.01 

BESEARCH ASSISTANT, FROB SEP 13 510.00 

ASSISTANT CLEBK, TO AUG 31 1,190.00 

ASSISTANT TO BUDGET SPECIALIST 4,088.37 

ASSISTANT CLEBK 3,590.01 

LEGISLATIVE ASSOCIATE 6,249.99 

DEPUTY STAFF DIRECTOR 9,173.19 

AEHIN ASST TO CHIEF CLERK (P) 9,600.00 

SPECIAL ASSISTANT TO CHRH (P) 11,874.99 

HINOBITY RESEARCH ASSISTANT 4,125.00 



COHHITTEE ON GOVERNBENT OPERATICNS 



ARHSTBONG, CLARA K 
BAPASH,PETEB S 
BARNES, RICHARD C 



HINORITY RESEARCH ASST (C) 6,320.01 

STAFF DIBECTOB 11,250.00 

PBCFESSICNAL STAFF HEBBER 7,500.00 



172 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

COMMITTEE ON GOVERNMENT OPERATIONS -CONTINUED 



BARNES, RICHARD LEE 
BECKLER, JOHN W 
BUNN,BETHANNA 
BUTTERWOPTH, BRUCE R 
CAMPBELL, CHARLES 
CARLSON, JOHN P 
CHAMBERS, JOY S 
CHESTNUT, JUDITH G 
CHUBB, LOUISE 
CLARK, JORDAN 
CLESNER,HERSCHEL F 
COHEN, SUSAN MEEHAH 
COOK, DANIEL 
COPENHAVER, WILLIAM H 
CORNISH, NORMAN G 
DANIELS, STEPHEN B 
DAVIS, STEPHEN H 
DOTY, RALPH T 
DRUSINE, HELEN 
DUGGER, ROBERT H 
DUNCAN, JOHN M 
FITZGERALD, GERALDINE J 
FLAHERTY, MAURA J 
FLORES, GUADALUPE R 
GEHRING.CRAIG J 
GEORGE, JAMES L 
GLSIMAN, EDWARD JAY 
GOLDBERG, DELPHIS C 
GOLDHAMMER, GILBERT S 
GOLDHAMMER, MARGARET M 
GRACE, E JEAN 
GRAWEY, RICHARD EUGENE 
GREEN, MARCIA L 
GYORY, JAMES L 
HALTERMAN, RACHEL 
HANLEY, PETER 
HENDERSON, ELMER W 
HIGGINBOTHAH,LYNNE 
HOLT, DAVID E 
HOUSTON, THOMAS F 
INGRAM, TIMOTHY H 
JARVIS, MARILYN F 
JONES, WILLIAM MARK 
KLEMPNER, RONALD A 
LEWIN, JAMES E.JR 
LUMAN, JOSEPH C 
MCINERNEY, JAMES L 
METZGER.EUPHON L 
MOORE, JOHN E 
MORA, CYNTHIA H 
MORTON, CECELIA T 
NAUGHTON, JAMES R 
NORWOOD, KATHRYN E 

PALUMBO, BENJAMIN L 
PAYNE, THOMAS J 
PERWIN,JEAN S 
PHILLIPS, LILIAN M 
PHILLIPS, SUSAN E 
RIEGER.EARL FRANCIS 
ROLLMAN, SUSAN 
ROMNSY, MILES Q 
RUEMPLER, HENRY C 
RUSSELL, LAWRENCE A 
SANDS, CATHERINE 
SCHUENKE, DAVID A 
SMITH, EMORY H 
SMITH, SHARON 
SNIDER, L BRITT 
STEPHENS ,C DON 
STEVENS, MAPJORIE J 
SULLIVAN, ANNE HUDGINS 
TAYLOR, DORIS FAYE 
THEIM, EILEEN W 
THOMPSON, RICHARD LEON 
TIPTON, RONALD J 
VANYO, ELEANOR M 
WASSERMAN, ELIZABETH L 
WELCH, PAMELA HORSHON 
WILLIAMS, CAROL DIANE 
WILLIAMS, JUDGE N 



PROFESSIONAL STAFF MEMBER $ 7 

PROFESSIONAL STAFF MEMBER (P) 7 

ACCOUNTING CLERK 3 

PROFESSIONAL STAFF MEMBER 3 

MINORITY FRO STAFF MEMBER 7 

MINORITY COUNSEL (P) 11 

PROFESSIONAL STAFF MEMBER 6 

MINORITY CLERICAL STAFF 2 

CLERK 3 

MINORITY FRO STAFF MEMBER 7 

CCUNSEL 9 

MINORITY SECRETARY (C) 3 

PROFESSIONAL STAFF MEMBER 5 

ASSOCIATE COUNSEL { P) 11 

STAFF DIRECTOR 9 

MINORITY ASSOCIATE COUNSEL 8 

PROFESSIONAL STAFF MEMBER 4 

STAFF MEMBER (C) 3 

PRCFESSICNAL STAFF 5 

PROFESSIONAL STAFF MEMBER 7 

MINORITY PRO STAFF MEMBER 8 

SECRETARY 3 

SECRETARY 3 

PROFESSIONAL STAFF MEMBER 4 

PRCFESSICNAL STAFF MEMBER 4 

MINORITY FROF STAFF MEMBER (P) 7 

PROFESSIONAL STAFF MEMBER, FROM AUG 1 6 

PROFESSIONAL STAFF MEMBER 11 

CONSULTANT 5 

CLERK 2 

SECRETARY 2 

ASSOCIATE COUNSEL 5 

PRCFESSICNAL STAFF MEMBER, TO AUG 12 2 

INVESTIGATOR 6 

MINORITY FRO STAFF MEMBER 6 

PROFESSIONAL STAFF MEMBER, TO SEP 6 3 

COUNSEL (P) 11 

STAFF MEMEER (C) 6 

PROFESSIONAL STAFF MEMBER 6 

MINORITY PRO STAFF MEMBER(P) 6 

STAFF CIRICTOR 9 

STAFF MEMBER (C) 5 

GENERAL CCUNSEL (P) 11 

PRCFESSICNAL STAFF MEMBER 7 

PROFESSIONAL STAFF MEMBER 6 

STAFF DIRECTOR 9 

MINORITY ASSISTANT COUNSEL 7 

SECRETARY, FROM SEP 27 

STAFF ADMINISTRATOR 11 

PROFESSIONAL STAFF MEMBER 5 

SECRETARY, FROM AUG 15 1 

CCUNSEL 11 

CLERICAL STAFF MEMBER, TO JUL 31 

STAFF MEMBER, FROM AUG 1 2 

PROFESSIONAL STAFF MEMBER 9 

INVESTIGATOR, TO AUG 13 2 

PRCFESSIONAL STAFF MEMBER a 

STAFF MEMBER (C) 4 

SECRETARY 2 

PROFESSIONAL STAFF MEMBER 8 

SECRETARY, TO JUL 31 1 

CCUNSEL 3 

MINOEITY PRO STAFF MEMBER 7 

PROFESSIONAL STAFF MEMBER 4 

MINORITY PRO STAFF MEMBEB 5 

COUNSEL 9 

PRCFESSICNAL STAFF MEMBER 5 

SECRETARY 3 

COUNSEL 8 

RESEARCH ANALYST 8 

STAFF MEMBER 2 

PROFESSIONAL STAFF MEMBER, FROM AUG 1 4 

CLERK 3 

STAFF MEMBER 3 

MINORITY PROF STAFF MEMBER (P) 10 

ASSISTANT COUNSEL 4 

SECRETARY 3 

CLERK 3 

CLERK-STENOGRAPHER 3 

CLERICAL STAFF 2 

CLERICAL STAFP 2 



173 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

COMMITTEE ON HOUSE ADMINISTRATE N 



ABERNATHY, JAMES D 
ADAHS, BILLIAH B 
ADEN,NOREEN B 
AJ HANI, MONICA 
ALEXANDER, BARBARA L 
ALEXANDER, BOYD L 
AHIGO,LUIS J 
ARMANN,NEIL R 
ASPARAGDS,DENISE L 
ATCHISON, BELVA R 
AOFIERO, RONALD ANTHONY 
BABCHAK,JOEL IRBIN 
BALL, MICHAEL J 

BARANOWSKI,BILLIAM X 
BARTLETT, MARGARET ANN 
BEADLE, GRACE A 
BELCHER, JACK B 

BEN, ALEXANDER J 
BERDINE, LINDA K 
BERG, JOE DAVID 
BESCHER, PHILLIP E 
BHATIA,M R 
BLACK, MARTIN P 
BLAI8,DELCI 
BOHO, GERALD L 

BOSHELL, MICHAEL A 

BOTOS, MICHAEL 
BOBMAN, MICHAEL B 
BRANDT, THOMAS D 
BRAZEAL, DAVID L 

BRICKHAN,MARK D 
BROWN, BRETT V 
BBOBN,CYNTHIA YVONNE 

BROBN, THOMAS C,JB 
BROSS, DAVID R 
BOENO, FRANKLIN A 
BURDA, BARBARA A 

BORDETTE.EARL B 
BUFKE, JUDITH H 
BURKE, SANDRA It 
BUTTS, ERNEST, JR 
BYE,KATHERINE J 
BYRD, FRANK B 
CANDLER, BENJAMIN R 
CAHFAGNO, RICHARD H 
CARPEMTER,JON RYAN 
CASTER, WAYNE 
CASEY, CONSTANCE E 
CAVANAUGH,JOHN TIMOTHY 
CHABOT, ELLIOT C 
CHARTRAND, KEVIN C 
CLEVELAND, JANE 
COATES, VINCENT C 
COHILAS, GRACE BANGS 
COLLIHS, HENRY F,JR 
COMPTON, TEDDY R 
CONRAD, JANET LOUISE 
COOPER, THOMAS J 
CORTESE, CYNTHIA K 
CRABFORD, ALFRED R 
CRIGLER, JEFFREY CHARLES 
CROOKSTON, NANCY A 
CUTLER, MAURICE B 
DALEY, JAMES C 
DAVEY,EDBARD J,JR 
DAWSON, DEBORAH A 
DELL,BILLIAH C 
DEL.108E, WILLIAM B 
DELOR ME, DONALD F 
DENNING, MARY ANN 
DIBONA.JOEL ANTHONY 
DOSTEB, ANTHONY H 
DOUGHERTY, MICHAEL S 
DOBLING, PATRICIA B 



CLERK (P) t 7 

SR COMPUTER SYSTEMS SPECIALIST 6 

ASST CLERK-MINORITY, TO AUG 31 2 

SR PROGRAMMER ANALYST 5 

ASSISTANT CLERK 1 

DIFECTOE OF HIS (P) 11 

SR PROGRAMMER ANALYST 5 

ASST DIRECTOR FOR PLANNING 9 

TAEE LIERARIAN 2 

TEXT PROCESSING SPECIALIST 3 

JR PROGRAMMER 3 

SECTION MANAGER 7 

JR COMPUTER SYSTEMS ANALYST, TO JUL 31 

CCMFUTER SYSTEMS ANALYST, FROM AUG 1 4 

ASSISTANT CLERK (C) 4 

CLERICAL AIDE, TO AUG 19 

JUNIOR PROGRAMMER 3 

SYSTEM FACTORS SPECIALIST, TO AUG 31 

SR SYSTEM FACTORS SPECIALIST, FROM SEP 1 4 

SR PRODUCTION CONTROL SPLST 2 

SECRETARY 2 

SR TECHNICAL AIDE 3 

SR COMPUTER SYSTEMS ANALYST 6 

SYSTEMS PROGRAMMER 5 

COUNSEL (C) 6 

PRODUCTION CONTROL COORDINATOR 3 

SYSTEMS PROGRAMMER, TO JUL 31 

SENIOR SYSTEMS PROGRAMMER, FROM AUG 1 5 

JR PROC CONTROL SPECIALIST, TO AUG 31 

ACTING JR COMPUTER OPERATOR, FROM SEP 1 2 

SYSTEM FACTORS SPECIALIST 3 

SYSTEM FACTORS SPECIALIST 3 

SUMMARY OF DEBATE CLERK 4 

SECTION MANAGER, TO AUG 31 

TECHNICAL ASST (II), FBOM SEP 1 6 

SR LEGISLATIVE INFORMATION SPEC 2 

TECHNICAL AIDE, TO AUG 25 1 

SR TYPIST, TO JUL 31 

SECRETARY, FROM AUG 1 2 

JUNIOR SECTION MANAGER 6 

JR COMMUNICATIONS TERMINAL OPR 2 

SR PRODUCTION CONTROL SPECIAL 2 

PROD CONTROL COORD (2ND SHIFT), TO JUL 31 

SR PROD CONTROL COORDINATOR, FROM AUG 1 3 

SECTION MANAGER 7 

JR LEGIS INFOR SPECIALIST, FROM AUG 8 1 

TECHNICAL BRITER 4 

SR PROGRAMMER ANALYST 5 

SR TECHNICAL SPECIALIST 4 

LATA PROCESSING COORDINATOR 4 

SENIOR PROGRAMMER ANALYST 5 

JR PROGRAMMER 3 

CLERK (F) 6 

COMPUTER OPERATOR 2 

INTERN, TO JUL 31 

SR COMPUTER SYSTEMS ANALYST 6 

TECHNICAL AIDE, TO AUG 5 

TECHNICAL AIDE, TO AUG 22 1 

TEXT PROCESSING SPECIALIST 3 

ASSISTANT CLERK, TO AUG 31 1 

ASSISTANT CLERK 3 

SECTION MANAGER 7 

SENIOR SYSTEMS PROGRAMMER '. . . 6 

LEGIS INFOR COORDINATOR 2 

ASSISTANT MINORITY COUNSEL (P) , TO JUL 10 

ASSISTANT CLERK 3 

PROGRAMMER 3 

ASSISTANT CLERK, FROM SEP 1 TO SEP 9 

EXEC ASST TO GEN COUNSEL (P) 5 

SR PROGRAMMER 4 

SR COMPUTER SYSTEMS ANALYST 6 

ASSISTANT COUNSEL (P) 6 

SR TYPIST 2 

SYSTEM FACTORS SPECIALIST 3 

SECTION MANAGER 7, 

PROGRAMMER 3 

ASSISTANT CLERK, TO AUG 31 1 

COMFUTER SYSTEMS ANALYST 5, 

COURIER, FROM SEP 26 

ASSISTANT MANAGER 7 

PROGRAMMER ANALYST 5, 



,416.67 
,077.01 
,201.44 
,621.25 
,750.01 
,874.99 
,451.00 
,420.56 
,880.75 
,297.00 
,190.74 
,181.25 

,827.01 

,749.99 

894.53 

,297.00 

,008.67 
,666.76 
,592.51 
,297.00 
,076.95 
,621.25 
,249.99 
,251.76 



072.34 
,881.01 
,881.01 
,717.50 

715.31 
,592.51 
,004.06 

,612.92 
,076.95 
, 148.24 
,583.51 

190.38 
,181.28 
224.30 
,010.25 
,621.25 
,263.99 
,315.59 
,576.12 
190.74 
,249.99 
,900.00 
500.00 
,279.51 
720.22 
,070.04 
340.92 
,200.00 
,399.63 
659.84 
,736.68 
,880.75 
589.56 
,999.99 
524.25 
180.00 
,250.00 
010.25 
482.01 
250.00 
480.76 
881 .01 
181.25 
524.25 
200.00 
451.00 
109.75 
420.74 
280.75 



174 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



COMMITTEE ON HOUSE ADHI NISTBATICN -CONTINUED 



EARLEY,JOJEAN L 
EARLY, ELOISE HABIE 
ELLIS, DOROTHY 
EPSTEIN, NAEILYN 

FELLENZ, DENIS 
FIELDS, RICHARD H 
FINK,BRDCE H 
FISHES, SAPAH A 
FLOHR, MARION H 
FORD, MARTHA A 
FORTUNE, FBANCIS C 
FOWLIE,LEA 

FOY, ELIZABETH 
FBAZIER.K MICHAEL 
FREEMAN, WILLIAM E,JR 
FRINK, CHRIS 
FRONTERA, MARIE A 

GADONAS.DEMETRIOS J 
GALE, RHONDA 
GALEN, EVAN H 
GARRETT, POBERT WILLIAM 

GABRISS.S E 
GAYDOS, DAVID THOMAS 
GFORGINE,ROB 
GIAIMO, BARBARA LEE 



GILLIAM, DELORIS 
GILLILAND, JACKIE J 
GRANT, TONI J 
GEASHICK,GAEY 
GREENBERG, AARON 
GRFGORY.CHELLIS 0,JR 
GRIEB, GERTRUDE P 
GBIEDEP,GAIL A 
GRCSBERG, SHELDON 
GUENOT, RICHARD W 
HAGA, JAMES B 
HAGGERTY, HALTER E 
HANNUH,VIVIENNE B 
HARMAN, THOMAS S 
HARNEY, CHRISTOPHER J 

HARNEY, MICHELE JOANN 
HART, HUGH GLEN,JF 
HAWK, THOMAS J 
HAWKINS, ELSIE J 
HEEALD.DELOEES 
HILL, WILLIAM K 
HILTON, AMOS, JR 
HOFMANN, RALPH WAYNE 
HOLLIES, ROBERT M 
HOLTON, SUZANNE L 
HOPE.JOHNIE WADE 

HOPKINS, RUBY 
HOUSTON, PATRICIA 

HOWELL, CHARLES T 
HUDDLESTON, WILLIAM L 
HUDSON, HELEN CLARE 
HUGHES, HELEN S 
HYLAND, MARGARET MARY 
JAMES, CURTIS EDWARD 
JABPELL, PATRICIA 

JAYNES,GURNEY S 
JENKINS, C WESLEY 
JOHNSON, C FREDERICK 

JOLLEY,SANDEA A 
JONES, PHYLLIS SUSAN 
KATSBDA, ROBERT 
KEECH, BELINDA L 

KELLER, KEITH EDWARD 



SR COMPUTER SYSTEMS ANALYST $ 

SEC8ETABY, COMPUTER POLICY GROUP 

SR tATA PREP COORDINATOR 

PROGBAHMEE ANALYST, TO AUG 31 

SB PBOGEAMHEE ANALYST, FROM SEP 1 

SB PEOGFABMER ANALYST 

MANAGER 

SYSTEM FACTOBS ANALYST 

PBOGBAHMEE ANALYST 

SECBETABY 

ASSISTANT CLEBK 

SUMMABY OF DEBATE CLEBK 

COMMUNICATIONS CONTROL COOED, TO AUG 31 

SE LEGIS INFOR COOBDINATOB, FROM SEP 1 

ASST CLERK-MINORITY, TO JUL 15 

SENIOR PROGRAMMER ANALYST 

SECTION MANAGES 

ASSISTANT CLEBK, TO AUG 31 

SENIOR SECRETARY, TO JUL 31 

EXECUTIVE SECRETARY, FROM AUG 1 

SUMMARY CF DEBATE CLERK 

ASSISTANT CLERK, TO AUG 5 

JR SYSTEMS PROGRAMMER 

GRCUP MANAGER, TO AUG 31 

DIVISION MANAGER, FBOM SEP 1 

PBOGBAHMEE ANALYST 

SECTION MANAGER 

ASSISTANT CLERK, TO AUG 15 

ASSISTANT CLERK (C), TO JUL 31 

ASSISTANT CLERK ( C) , TO AUG 31 

ASSISTANT CLERK (C) , FROM AUG 1 

ASSISTANT CLERK (C), FROM SEP 1 

COMPUTER OPERATOR 

SE PROGRAMMER 

STAFF DIRECTOR (C) 

TECHNICAL AIDE 

SENIOR SYSTEM FACTORS ANALYST 

COBP POLICY GROUP CLERK (P) 

COMPUTER SYSTEMS SPECIALIST 

SR CCBHUNICATIONS TERBINAL OP 

ASST DIRECTOR FOR ADBI NISTBATION 

PECGBAHHEB 

INFOBMATION SYSTEMS SPECIALIST 

SECTION MANAGER 

ASSISTANT CLEBK 

TECHNICAL AIDE, TO AUG 23 

COURIER, TO JUL 31 

JE EBOD CONTROL SPECLST, FROM AUG 1 

SR SECRETARY 

SUMMARY OF DEBATE CLERK 

SE DATA EBOC COORDINATOB 

CLEBK, PRINTING SUBC (C) 

JUNIOB DATA PREPARATION SPEC 

DIVISION MANAGER , 

JB COMPUTES OPERATOR 

JB SYSTEMS PROGRAMMER 

COMMUNICATIONS TERMINAL OPER 

SR ADMINISTRATIVE AIDE 

ASSISTANT BINORITY COUNSEL, AUG 17 - AUG 31 ... 
ASSISTANT BINORITY COUNSEL (P), FROM SEP 1 ... 

ASSISTANT CLERK 

TYPIST, TO JUL 31 

SR TYPIST, FROB AUG 1 

COUNSEL (P) 

SR LEGISLATIVE INFORBATION SPEC 

CLEBK, FRCB JUL 8 

ASSISTANT CLERK, TO AUG 31 

PROGE AMBER 

SR PBOGBABHEB 

JB TEXT PBOCESSING SPECIALIST, TO AUG 31 

TEXT PROCESSING SPECIALIST, FROM SEP 1 

ASSISTANT CLERK ( P) 

SR COMPUTER SYSTEMS SPECIALIST 

SYSTEMS PROGRAMMER, TO JUL 31 

SR SYSTEMS PROGRAMMER, FROM AUG 1 

PBOGBAMNEB 

CLEBK 

COMPUTER SYSTEMS SPECIALIST 

JUNIOR TYPIST, TO AUG 31 

TYPIST, FROM SEP 1 

PROGRAMMER ANALYST 



6,617.08 
2,250.00 
2,879.76 

4,687.03 
5,110.50 
8,1*47.16 
5,405.50 
4,263.99 
2,592.51 
2,408.25 
4,193.25 

2,993.50 
300.00 
5,110.50 
7,660.26 
1,200.00 

3,092.12 

4,193.25 

816.67 

4,263.99 

8,541.02 
4,308.77 
7,181.25 

900.00 



5,770.26 
2,894.88 
3,881.01 
5,124.99 
2,880.75 
6,482.01 
9,500.01 
5,621.25 
2,592.51 
9,907.26 
3,605.61 
6,482.01 
8,139.24 
3,823.62 
1,090.62 

1,944.67 
2,880.75 
5,306.01 
4,690.74 
5,181.12 
2,037.24 
8,447.25 
2,880.00 
4,263.99 
2,325.75 
3,190.74 

2,444.45 
3,187.50 

2,247.27 
8,291.67 
2,592.51 
3,919.45 
1,200.00 
3,524.25 
3,881.01 

2,984.08 
7,125.00 
6,684.51 

5,744.87 

4,003.98 

650.01 

5,280.75 

1 ,927.66 
4,970.25 



175 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



COMMITTEE ON HOOSE ADMINISTRATION -CONTINUED 



KENNY, SUSAN MARIE 

KEPPLER, JEAN E 

KEY, JANET 

KIM, PETER C 
KITE, SHARON L 
KNOTT, J GREGORY 
KNOI, MARILYN J 
KORZBEBG,R A 
LAGAKIS, CLAIRE L 
LAGER, FREDERICK L 
LAFKO, KATHLEEN 
LEONARDO, THOMAS C 
LEVITAS, STEPHEN F 
LINK, VICTORIA Z 

LONG, WAYNE E 
LOUGHHAN, EDWARD E 
LUCAS, YOHANNA 

MACOMBER, PAULA I 
MAGOULAS, PAULA 
MALASPINA, MARY 
MALFANI, SOMA 
HANG, JOHN, JR 
MA NNINO, ERNEST JCHli 



MARCOS, H 
MARX, KEN 
MATLOCK, 
MAYER, &L 
HAYNAHD, 
HCBRIDE, 
HCCALL,C 
MCCARTHY 
MCDONALD 
MCGARRY, 
HCGLYNN, 
MCGDIRE, 



ICHAEL B 
NETH H 
HELVIN C 
ICE H 
RICHARD G 
DENNIS R 
HARLES R,JR 
.ELLEN A 
,MARY 
JOHN BARREN 
WILLIAM J 
H GERALD 



HCGOIRE, ROBERT S 
HCINNIS,MARY 
MEARA, DANIEL J 
MERRICK, CURTIS L 
MERRILL, DARLENE 
MILASI, PRANK J 
HILLNER, RICHARD 
HONAHAN.JOHN LEO 
MOORE, PATRICE L 
MOREAO, DONALD W,JR 
HORETTI, RONALD V 
MORRIS, DONALD CHARLES 
MOSS, ROBERT E 
MUELLER, HELMUT J 
HUMHA, ROBERTS J 

MURPHY, GERALD M 
NAVE, LINDA GAIL 
NEIGH, MILDRED ANNETTE 
NEILL, SUSAN J 
NEWMAN, STEVEN B 

OBSIEN, JOSEPH A 
OBRIEN,HAEIANNA MAEVE 
ODT, THOMAS A 
OGDEN, ROBERT B 
OLENICK.BRENDA LOU 



OLESZEWSKI , RICHARD 

ORSILLY.EAHON 
OSHETSKI,DIANNE L 
PHILLIPS, WILLIAM G 
PICKENPAUGH, THOMAS E 
POGUE, BARBARA J 
POHETTO,JO ANN 
POSEY, FLORA ALBERTA 
PRATES, HETTIE KNIGHT 
PHESHLOCK, LINDA H 
PRITCHARD, HEATHER C 



SR LEGISLATIVE INFORMATION SPEC $ 2,592.51 

JR TEXT PROCESSING SPECIALIST, TO AUG 31 

TEXT PROCESSING SPECIALIST, FROM SEP 1 2,984.08 

SR DATA PREPARATION SPECIALIST, TO JUL 31 

SUPPLY CONTROL CLERK, FROM AUG 1 2,508.01 

JR PROGRAMMER 3,190.74 

ASSISTANT CLERK U, 625. 01 

TEXT PROCESSING SPECIALIST 3,524.25 

SECRETARY 2,592.51 

PROGRAMMER 3,524.25 

TEXT PROCESSING SPECIALIST 3,203.07 

JR LEGIS INPOR SPECLST, FROM AUG 1 1,386.00 

OFFICE MANAGER (P) 7,083.34 

SB COMPUTER SYSTEMS ANALYST 6,482.01 

SR PROGRAMMER ANALYST 5,110.50 

COMPUTER ASSISTANT, FROM AUG 25 TO AUG 31 

ASST CLERK-MINORITY, FROM SEP 1 1,250.00 

ASSISTANT CLERK (C) 5,703.96 

SR INFORMATION SYSTEMS SPEC 7,089.51 

ASSISTANT CLERK (P) 6,367.20 

SENIOR SECRETARY 3,168.75 

SR ADMINISTRATIVE CLERK, FROM JUL 27 TO AUG 24 806.55 

JR SYSTEM FACTORS SPECIALIST, FROM JUL 25 2,584.45 

SR COMPUTER SYSTEMS ANALYST 6,549.51 

SR COMPUTER SYSTEMS ANALYST 6,279.51 

ASSISTANT CLERK, TO AUG 31 •• 

ASST ACCOUNTING CLERK, FROM SEP 1 2,750.01 

SYSTEMS PROGRAMMER 5,110.50 

INFORMATION SYSTEMS SPECIALIST 6,279.51 

PROGRAMMER 3,524.25 

SECTY TO GENERAL COUNSEL 4,374.99 

ACTING DIVISION HGR 7,899.75 

ASSISTANT CLERK, TO AUG 15 900.00 

JR COMPUTER OPERATOR 2,592.51 

CALENDAR CLERK 3,624.99 

STAFF ASSISTANT (C) 4,974.75 

SPECIAL COUNSEL (P) 11,874.99 

JR COMMUNICATIONS TERMINAL OPR, TO AUG 31 1,386.00 

GROUP MANAGER, TO JUL 31 

ASST DIVISION MGR, FROM AUG 1 8,634.88 

AUDITOR (P) 9,000.01 

ASST CLERK (MINORITY) P, FROM AUG 15 3,066.67 

ASSISTANT CLERK, PROM SEP 12 211.11 

DIVISION MANAGER 9,010.26 

ADMINISTRATIVE SPECIALIST 3,881.01 

SENIOR PROGRAMMER, FROM AUG 1 2,587.34 

ASSISTANT CLERK, TO JUL 31 600.00 

ASST FOR FLOOR COMMUNICATIONS (C) 9,900.00 

SECRETARY 2,780.61 

LEGIS INFOR SPECIALIST 2,325.75 

SENIOR PROGRAMMER 4,268.76 

MANAGER 8,447.16 

GENERAL COUNSEL (P) 12,500.01 

COMPUTER SYSTEMS ANALYST 5,110.50 

DATA PROCESSING COORDINATOR, TO JUL 31 

SR DATA PROCESSING COORDINATOR, FROM AUG 1 ... 4,274.25 

SECTION MANAGER 7,660.26 

ASSISTANT CLERK-MINORITY ( P) 5,750.01 

SR LEGISLATIVE INFORMATION SPEC 2,592.51 

SR LEGISLATIVE INFORMATION SPEC, TO AUG 31 .... 1,728.34 

JR TECHNICAL SPECIALIST, TO JUL 31 

TECHNICAL SPECIALIST, FROM AUG 1 3,762.09 

TECHNICAL ASSISTANT 7,660.26 

JR SYSTEM FACTORS SPECIALIST 3,533.31 

PROGRAMMER, TO AUG 19 1,918.76 

SR PROGRAMMES ANALYST 5,110.50 

ASSISTANT CLERK (P) , TO JUL 31 

ASSISTANT CLERK ( P) , FROM AUG 5 TO AUG 31 .... 

ASSISTANT CLERK (C) , FROM SEP 1 5,255.55 

ASSISTANT CLERK, TO JUL 31 

STAFF DIRECTOR (C) , FROM AUG 1 6,166.67 

SR PROGRAMMER ANALYST 5,828.64 

ASSISTANT CLERK 3,624.99 

STAFF DIRECTOR (P) 12,125.01 

COMPUTER OPERATOR 3,200.01 

SECRETARY 3,051.75 

SR SECRETARY 2,880.75 

DATA PREPARATION SPECIALIST 2,148.24 

SR ADMINISTRATIVE SPECIALIST 4,690.74 

JR PROGRAMMER 3,190.74 

SR COMPUTER SYSTEMS ANALYST 6,077.01 



176 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



COMMITTEE ON HOUSE ADMINISTRATION -CONTINUED 



PROOT, MARTHA H 
PULAS, ELAINE COMER 
QUENNEVILLE, ALFRED C 



REARDON, ROBERT J 

REED, JOHN T 

REEDER, FRANKLIN S 
ROBERTS, CAROLE E 
ROBERTSON, JANICE K 
ROBINETTE, ELIZABETH A 
ROGERS, SAMUEL H 
ROGERS, TREVERA D 
ROLIZ,HEIDE R 
ROMANI,YARA NICOLETTE 
ROSE, DOUGLAS N 
ROSE, JAMES 
ROSS, DORIS R 
ROYER, ROBERT S 
RUBIN, JEFFREY I 
RUSSELL, LINDA 
RUSSELL, P SUZANNE 

RUSSELL, TOM HARDY 
SAFFOS.CONSTANTINE N 
SAMBOL, HERBERT H 
SAMUELS, SHIRLEY M 
SANDERS, HARRY 
SAVERCOOL,R PAUL 
SCHMIDT, CARL F 
SCHDLTIES, AUGUST 
SCHWAB, WILLIAM H 
SECHLER, STANTON 
SHARP, CYNTHIA L 
SHERARD, MEMORY F 
SHORT, JAMES B 
SHRIVER.NARK L 



SKAAR,WI 
SMITH, CH 
SMITH, EM 
SMITH, ST 
SMYTHE.P 
SOLOMON, 
SPENCE,D 
SPENCER, 
SPROUL,W 
STANLEY, 
STCLAIR, 
STEELE, M 
STEWART, 
STOFKO,S 
STOLLE.M 
STONEBER 
STUBBS,C 



LLIAM W 

ERYL T 

MA ELVIRA 

EVEN M 

ATHICK CHRISTIAN 

DAVID ROBERT 

AVID G 

DIXIE J 

ARREN G 

MARC R 

NOAH M 

ARGARET T 

LABELLA M 

TEPHEN J,JR 

ARY F 

G, CAROLYN S 

ANDACE B 



STUDLEY, ROBERT E 

SUKENIK,HILLEL H 
SUMMEHS,CATHERINE M 
SBART, BARBARA E 
SZELAG, FRANK P 
TERRILL, EDWARD A 
TIPPETT,DEBORA JEAN 
TOM, SEBASTIAN 
TOVAR, LAURA 
TOWERS, ROBERT H 
TSAI, JACKSON 
ULEP, PATRICIA ANN 
UNDERWOOD, DAVID P 
VANN, THOMAS ALLEN 
VENTURA, JOSEPH T 
WADE, WILLIAM E,JB 
WAGLIABDO, JASPER T 
WALKER, MICHAEL G 
WALKER, SYLESTENE T 
WALSH, CHARLES TYRE 
WALTERS, VERNON JCHN 
WALTON, LAURICE 
WARD, HUGH B,JR 



PROGRAMMER S 3,524.25 

PROGRAMMER ANALYST 4,263.99 

COMPUTER SYSTEMS SPECIALIST, TO JUL 31 

TECHNICAL ASST (ACTING), FROM AUG 1 TO AUG 31 

TECHNICAL ASSISTANT, FROM SEP 1 5,179.45 

SR SYSTEMS PROGRAMMER 6,887.01 

SS COMPUTER SYSTEMS ANALYST, TO AUG 31 

INFOR SYST SPEC (I), FHOM SEP 1 7,532.89 

DEPUTY DIR OF HIS (C) 11,605.74 

SR SYSTEM FACTORS SPECIALIST 4,975.26 

SR COMPUTER SYSTEMS ANALYST 6,279.51 

COMPUTER OPERATOR 2,880.75 

DATA PROCESSING COORDINATOR 4,311.24 

JR PROD CONTROL SPECIALIST 1,851.99 

TYPIST 2,217.51 

SYSTEM FACTORS SPECIALIST 3,881.01 

JR SYSTEM FACTORS SPECIALIST, FROM AUG 1 2,349.50 

COURIER, FROM JUL 25 1,448.70 

SR SECRETARY 3,072.75 

CLERK, TO JUL 7 330.56 

ASSISTANT CLERK, TO AUG 31 1,200.00 

SR DATA PREPARATION SPECIALIST 2,514.36 

ASSISTANT CLERK, TO AUG 5 

ASSISTANT CLERK, FROM SEP 5 2,033.34 

COMPUTER SYSTEMS SPECIALIST 5,110.50 

SR ADMINISTRATIVE CLERK, FROM AUG 23 1,167.65 

JR LEGIS INFOR SPECIALIST, FROM SEP 19 277.20 

LEGIS OFFICE SUPERVISOR 3,524.25 

COMPUTER SYSTEMS SPECIALIST 5,621.25 

SR PRODUCTION CONTROL SPLST 2,325.75 

SYSTEMS PROGRAMMER 5,485.77 

COMPUTER SYSTEMS SPECIALIST , 5,621.25 

COMMUNICATIONS TERMINAL OPRTR, TO JUL 5 129.21 

SUMMARY OF DEBATE CLERK 2,499.99 

SUMMARY OF DEBATE CLERK , 2,499.99 

PRODUCTION CONTROL COORDINATOR 2,880.00 

SR PROGRAMMER ANALYST 5,280.75 

COMPUTER OPERATOR, TO AUG 31 

SR COMPUTER OPERATOR, FROM SEP 1 3,383.58 

SECTION MANAGER (II) 7,181.25 

SYSTEMS FACTORS ANALYST 5,110.50 

SR COMPUTER OPERATOR 3,887.01 

SYSTEMS FACTORS ANALYST 5,110.50 

LEGIS INFOR SPECIALIST 2,325.75 

SUMMARY OF DEBATE CLERK 4,193.25 

ASSISTANT CLERK, TO AUG 31 1,200.00 

OFFICE MANAGER (C) 4,717.35 

PROGRAMMER ANALYST 4,406.25 

ASSISTANT CLERK 1,975.00 

SECTION MANAGER 7,420.74 

SECRETARY 3,999.99 

COMPUTER ASSISTANT, FROM JUL 5 TO AUG 5 620.00 

GROUP MANAGER 8,728.83 

ASSISTANT CLERK 1,781.00 

PROGRAMMER 3,524.25 

JR SYSTEM FACTORS SPECIALIST, TO JUL 31 

SYSTEM FACTORS SPECIALIST, FROM AUG 1 3,765.11 

SR COMPUTER SYSTEMS SPECIALIST, TO AUG 31 

INFORMATION SYSTEMS SPECIALIST, FROM SEP 1 ... 6,549.73 

SR COMPUTER SYSTEMS ANALYST 6,144.47 

ASSISTANT CLERK 3,062.49 

SR PROGRAMMER 3,881.01 

ASSISTANT CLERK, TO AUG 31 2,875.00 

ASSISTANT CLERK - MINORITY (C) , TO AUG 31 3,333.34 

SR COMMUNICATIONS TERMINAL OP 2,592.51 

GENERAL CCUNSEL, PRINT SUBC (C) , TO JUL 31 .... 2,291.67 

SR ADMINISTRATIVE CLERK, TO AUG 19 1,411.48 

SYSTEMS PROGRAMMER 5,110.50 

PROGRAMMER 3,641.76 

SR SYSTEM FACTORS SPECIALIST 4,263.99 

SR COMPUTER SYSTEMS ANALYST 7,292.01 

JR COMPUTER OPERATOR 2,787.00 

CLERK (P) 7,552.65 

COMPUTER SYSTEMS ANALYST, FROM SEP 6 1,466.88 

INFORMATION SYSTEMS SPECIALIST 7,420.74 

SR COMPUTER SYSTEMS ANALYST 6,684.51 

LEGIS INFO COORDINATOR 2,880.75 

SYSTEM FACTORS ANALYST 5,791.50 

SR COMPUTER SYSTEMS ANALYST 6,077.01 

SR PROGRAMMER ANALYST 5,147.31 

COMMUNICATIONS TERMINAL OPER, TO AUG 31 

LEGIS INFOR SPECIALIST, FROM SEP 1 2,414.67 



177 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



COBBITTEE ON BOOSE ADMINISTRATION -CONTINOED 



WARD, ROBERT C 
WASHINGTON, BEE TBI HE 
WASHINGTON, GLORIA J 
WELCH, WILLIAM 
WHITE, CLAHA VANN 
WHITING, ELBER B 
WIILIABS, MARIE V V 

WILLIAMS ,SCOTT ROSSELL 

WILSON, NOBMAN EDWARD 
WINTERS, GARY k 

HOOD, DONALD D 

WRIGHT, DOUGLAS K 
ZARECOR, CHARLOTTE L 



SDBHABI OF DEBATE CLERK $ 4,979.49 

DATA PREPARATION SPECIALIST 2,396.91 

SR DATA PREPARATION SPECIALIST 2,560.1*6 

PROGRAMMER 3,994.26 

SDMBARY CF DEBATE CLERK 2,499.99 

SR COBPDTEB OPERATOR 3,787.26 

SR INFOBBATION SYSTEBS SPEC, TO JUL 31 

INFORBATICN SYSTEBS SPECIALIST, FROM AOG 1 ... 6,617.12 

TECHNICAL AIDE, TO ADG 31 1,231.66 

DIVISION MANAGER 7,181.25 

SYSTEB FACTORS SPECIALIST, TO AOG 31 

SR SYSTEM FACTORS SPECIALIST, FROB SEP 1 4, 046.17 

PRCDOCTION CONTROL SPECIALIST 2,325.75 

COBPOTER OPERATOR 2,980.62 

ASSISTANT CLEBK, TO JOL 31 600.00 



COMMITTEE ON INTEBIOR AND INSOLAB AFFAIRS 



ALLWINE, CHRISTINE A 

ANDERSON, WILLIAM H.III 
BAKER, SCOTT 
BALL, ANDREW L 
BARBER, RICHARD P 
BERTOBELLO, EVELYN 
BOYD, NARY STONE 
BREEDLOVE,SARA W 
CASEY, JIB T. 
CAVANA0GH,THOBAS J 
COCKAYNE, SHARON 
CONKLIH, CHARLES R 
CBANDELL, HARRY B 
CRANE, DONALD A 
DA0H,JACK D 
DIEHL, FRANCES A 

DRAKE, NANCY GABBOTT 
DRAVO, ANDREA N 
DOCHENEA 01, FRANKLIN 

TONBIRE, THOMAS S 
FOSTEB,GOHILLA L 
GADDIS, EDWARD 
GERHABDSTEIN,BABTHA C 
GILLESPIE, JOLIA 
GLIDDEN,TIHOTHY W 
GNOFFO, JOSEPH D 
HENSON, JAMES W 
HILL,GBEGOBY S 
HORN, WILLIAM P 

HOBKIN.ENI F,JB 

JACKSON, MICHAEL D 

JONES, BOY, JB. 
KELLY, GAIL A 
KISH.CARLA E. 
KRAOSE, PATRICIA A 
LEHONS,J0DITH K 
LOITERER, STEVE 
BCELVAIN,LEE 
MCMILLAN, ELIZABETH 
METCALF, SANDRA MARIE 
MOORE, RODNEY H,JR 
MORGAN, PHEBE ANN 
HORFAT, PATRICIA ANN 
MYERS, HENRY B 
NEOMAN, ROBERT A 
NE0HANN,LORETTA FAY 
NEVITT, BETTY ANN 
NICHOLLS,DALE BILLIAH 
PARSHLEY,PAOL C 
PETERS, CLAY E 
PETERSON, JOHN E 
PINNIX, CLEVELAND F 
RADZIKOWSKI.BARY ELLEN 
REVELES, ROBERT A 
ROGERS, JAMES C,JR 
ROBIN, MICHAEL S 
SANTOCCI,AHY H 



SECBETABY TO MINORITY COONSEL, TO JOL 31 

SECTY TO HIN CONSOLTANTS, FROB AOG 1 3,583.33 

EOEGET ANALYST (P) 6,875.01 

STAFF ASSISTANT, TO AOG 5 583.33 

STAFF ASSISTANT 3,249.99 

LEGIS ASST,BINORITY (P) 7,166.67 

CLERK 4,599.99 

CALENDAR CLEBK 4,500.00 

SECBETABY 3,000.00 

COSSOLTANT (C) 10,749.99 

CCONSEL (P) 9,999.99 

STAFF ASSISTANT-CLEBK 4,283.33 

STAFF EIBICTOB (P) 11,499.99 

CCNSOLTANT (C) 8,274.99 

SPC CONSOLTNT-SORF BNG LEG (C) 8,874.99 

BINORITY CONSOLTANT (P) 8,034.05 

SECRETARY TO BINORITY COONSEL, TO JOL 31 

SECTY TO BIN CONSOLTANTS, FROB AOG 1 3,637.50 

CLERK 5,571.30 

STAFF CONSOLTANT 3,750.00 

SPEC COONSEL-INDIAN AFFBS (P) 9,999.99 

STAFF CCNS-BINORITY (P) 7,500.01 

STAFF ASSISTANT 4,283.33 

STAFF ASSISTANT 4,175.01 

SECRETARY 2,499.99 

RECEPTIONIST 2,750.01 

CCONSEL (C) 8,250.00 

PRINTING CLERK 6,500.01 

FINANCE CLERK 5,250.00 

STAFF ASSISTANT, TO JOL 31 500.00 

STAFF CCONSEL-MINOFITY (C) , TO JOL 31 

MINORITY CONSOLTANT (C) , FBOH AOG 1 7,166.67 

ASSISTANT COONSEL (P) 6,875.01 

HINOBITY CONSOLTANT (P) POB LD, TO JOL 31 

MINORITY CONSOLTANT (P) , FBOB AOG 1 7,166.67 

COONSEL 6,875.01 

SECBETARY TO MINORITY CONSOL 3,583.33 

STAFF CCNSOLTANT (C) 5,000.01 

CONSOLTANT (P) 8,499.99 

SECRETARY 4,500.00 

STAFF ASSISTANT, TO JOL 31 500.00 

GENERAL CCONSEL (P) 10,749.99 

CLERK 3,624.99 

SECRETARY-CLERK 5,124.99 

BINORITY CONSOLTANT, FBOB AOG 3 3,866.67 

CLERK 3,999.99 

CLERK 7,500.00 

SPECIAL CONSOLTANT ON NOC ENG (P) 9,999.99 

POELIC AFFAIRS DIRECTOR (C) 8,000.01 

CCNSOLTANT 6,000.00 

SECBETARY (C) -NATL PARKS 6 R EC SOBCOB 4,599.99 

BINORITY CONSOLTANT (C) , TO SEP 19 7,022.23 

STAFF CONSOLTANT 4,625.01 

BINCBITY CONSOLTANT ( P) 7,650.37 

STAFF ASSISTANT 2,499.99 

CCNSOLTANT (C) 9,999.99 

SECRETARY 3,000.00 

ASSOCIATE STAFF DIRECTOR, PROB SEP 19 1,433.33 

MINORITY CONSOLTANT 7,166.67 

STAFF ASSISTANT, FBOB SEP 12 913.06 

STAFF ASSISTANT, FROB AOG 1 TO AOG 31 ,. 500.00 



178 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

COMMITTEE OH INTERIOR AND INSULAR AFFAIRS -CONTINUED 



SCATES, KAREN T STAFF ASSISTANT $ 3, 

SCOVILLE, STANLEY E SPECIAL COUNSEL (P) 9, 

SHAFER, WILLIAM L CON HIN MIN 6 LAND (P) 10, 

SHEAN, MAURICE J CONSOLTANT (C) 9, 

SHEEHAN, FRANCIS E, JR STAFF CONSOLTANT 4, 

SLOSS, CHARLES STANLEY COUNSEL 6, 

STRIEGEL, LOUIS E MINORITY COUNSEL ( P) 9, 

TERRELL, ROBERT L MINORITY CONSULTANT (P) PUB LD, TO JUL 31 

MINORITY CONSULTANT (P), FROM AUG 1 7, 

TIJERINA, MARIO STAFF ASSISTANT, TO JUL 31 

TRAPKIN,DORA B CLERK 3, 

WADDELL, MIRIAM L SECRETARY-CLERK 5, 

WEINBERG, NAT CONSULTANT (P) , TO JUL 31 

CONSULTANT, FROM AUG 1 10, 

WHITTAKER,JOHN A, IV STAFF ASSISTANT U, 

HIESSNER, ANDRES F COUNSEL (C) 6, 

ZEISE,KIM STAFF ASSISTANT, FROM AUG 1 TO AUG 31 

COMMITTEE ON INTERNATIONAL RELATIONS 

ABBRUZZESE, PETER A. STAFF CONSULTANT 9, 

ANDERSON, HOWARD T INVESTIGATOR 6, 

ATWATER.ARLENE B STAFF ASSISTANT 4 

BAKER, EDWARD J, III INVESTIGATOR 5, 

BARTON, DAVID PAUL STAFF ASSOCIATE, TO JUL 31 

SUBC STAFF ASSOCIATE, FROM AUG 1 4, 

BERDES, GEORGE R STAFF CONSULTANT (P) 10, 

BIERMAN, EVERETT E MINORITY STAFF DIRECTOR (P) 11, 

BLUSH, STEVEN RESEARCH ASSISTANT 3 

BOETTCHER, ROBERT B STAFF DIRECTOR, TO JUL 31 

STAFF CONSULTANT, TO AUG 31 

SUBCOMMITTEE STAFF DIRECTOR, FROM AUG 1 9, 

BOYER, ROBERT KENT STAFF CONSULTANT (P) 10 

BRADY, JOHN J,JR CHIEF OF STAFF (P) 12, 

BRANIGAN, MICHELLE H STAFF ASSISTANT, FROM AUG 10 1, 

BRENNAN, KAREN P STAFF ASSISTANT 4 

BRENNER, ALISON L MIN SUBCOMM STAFF CONSULT (P) , TO JUL 31 

MIN STAFF CONSULTANT (P) , FROM AUG 1 6, 

BURY, ANDREW G,JR RESEARCH ASSISTANT, TO AUG 31 2 

CARMAN, NANCY H STAFF ASSISTANT (C) 4 

CHALLENOR.HERSCHELLE STAFF DIRECTOR, TO JUL 31 

SUBCOMMITTEE STAFF DIRECTOR, FROM AUG 1 9, 

CHESTER, JOHN CHAPMAN STAFF CONSULTANT (P) 10, 

CLIFTON, MARY H STAFF ASSISTANT 2 

COOKE, JASON STAFF ASSOCIATE, TO JUL 31 

SUBC STAFF ASSOCIATE, FROM AUG 1 3 

DAOUST, ELIZABETH MARY STAFF ASSISTANT (P) , TO JUL 31 

STAFF COORD/PROTOCOL (C) , FROM AUG 1 5, 

DECKER, ROSALIE S STAFF ASSISTANT 3, 

DDBROWA, DENNIS J CLERICAL ASSISTANT, TO JUL 31 

SPECIAL ASSISTANT, FROM AUG 1 3, 

FINLEY, ROBERT MICHAEL SUBCOMMITTEE STAFF DIRECTOR 9, 

FITE, WILLIAM H MIN STAFF CONSULTANT (P) 6, 

FORTIER, DONALD ROBERT STAFF CONSULTANT 8 

FOX, JAMES EDWARD MIN STAFF CONSULTANT (C) 6, 

FRANK, FORREST R SUECCMMITTEE STAFF ASSOCIATE 5, 

FREEDMAN, GORDON L,JR INVESTIGATOR 5 

GALEY, MARGARET E STAFF ASSOCIATE, TO JUL 31 

SUEC STAFF ASSOCIATE, FROM AUG 1 5, 

GARVELINK, WILLIAM JOHN RESEARCH COORDINATOR 4 

GLASSHAN, CAROL STAFF ASSISTANT, FROM SEP 1 

GOOD, RUTH L RESEARCH ASSISTANT 3, 

GOODMAN, MARGARET G STAFF CONSULTANT 6, 

GULICK, LEWIS STAFF CONSULTANT (P) 10, 

GUSTAFSON, SUSAN STAFF ASSISTANT 3 

HACKETT, CLIFFORD P SUBC STAFF ASSOCIATE, TO JUL 31 2, 

HARRIS, ELISA STAFF ASSISTANT, TO AUG 31 1, 

HARRIS, VIRGINIA S KEY-PUNCH OPERATOR/TYPIST 2, 

HERSHMAN, MICHAEL J DEPUTY STAFF DIRECTOR 8, 

HOLSTINE,JON D MIN STAFF CONSULTANT (P) 7, 

HOWIE, EMILY CLAIRE STAFF ASSISTANT 2, 

HYNDMAN, PAUL VANCE STAFF CONSULTANT (P) 6, 

ILLSLEY, JULIE A STAFF ASSISTANT 3, 

INGRAM, GEORGE M, IV STAFF CONSULTANT (P) 9, 

JEFFERSON, GARY H STAFF DIRECTOR, TO JUL 31 

SUECCMMITTEE STAFF DIRECTOR, FROM AUG 1 6, 

JOHNSON, VICTOR C STAFF ASSOCIATE, TO JUL 31 

SUEC STAFF ASSOCIATE, FROM AUG 1 4, 

JONES, ESTRELLITA RESEARCH ASSISTANT, TO JUL 31 

SUBC STAFF ASSOCIATE, FROM AUG 1 3, 



750.00 
999.99 
749.99 
999.99 
000.00 
037.50 
333.3U 

650.37 
500.00 
500.01 
000.01 

100.00 
2 50.01 
583.34 

500.00 



370.77 
750.00 
500.00 
499.99 

875.00 
250.01 
250.00 
125.01 



999.99 
2 50.01 
125.01 
062.50 
374.99 

875.01 
500.00 
374.99 

832.50 
250.01 
550.00 



124.99 
750.00 

999.99 
999.99 
249.99 
750.01 
875.01 
700.01 
250.00 

000.01 
500.00 
833.33 
000.00 
875.01 
2 50.0 1 
500.01 
500.00 
400.00 
124.99 
499.99 
500.00 
550.00 
999.99 
249.99 
750.00 

249.99 

500.00 

750.00 



179 

SAURIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

COMMITTEE ON I NTEBNATIONAL RELATIONS -CONTINUED 

KADANE, KATHLEEN INVESTIGATOR S 3,999.99 

KN0TTS,NARY ANN STAFF ASSOCIATE, TO JOL 31 

SDBC STAFF ASSOCIATE, FROM AUG 1 4,702.50 

LEWIN, MARTIN J INVESTIGATOR 6,500.01 

LIVINGSTON, SHELLY S STAFF ASSISTANT (C) 4,625.01 

LUMPKIN, BEVERLEY C ADMINISTRATIVE OFFICER 3,500.01 

MAJAK, RALPH ROGER STAFF CONSULTANT, TO JUL 31 

SUBCOMMITTEE STAFF DIRECTOR, FROM AUG 1 9,500.01 

HANDAKAS.ARTMAN J STAFF CONSULTANT, TO JUL 31 

SUBCOMMITTEE STAFF DIRECTOR, AUG 1 - SEP 15 .. 5,416.67 

MANN,JANEAN L. MINORITY STAFF CONSULTANT 6,875.01 

MATTAS, HELEN C STAFF CONSOLTANT 4,244.84 

MILLER, GEORGE K RESEARCB ASSISTANT, TO AUG 31 833.34 

NELSON, CHRISTOPHER STAFF ASSOCIATE, TO JUL 31 

SUBCOMMITTEE STAFF DIRECTOR, AUG 1 - AUG 31 .. 

SUBCOMMITTEE STAFF ASSOCIATE, FROM SEP 1 5,499.99 

NELSON, STEPHEN D MINORITY STAFF CONSULTANT 6,249.99 

NORTON, MAUREEN H STAFF ASSOCIATE, TO JUL 31 

SUBC STAFF ASSOCIATE, FROM AUG 1 4,500.00 

OBRIEN, MARY ANN STAFF ASSISTANT ' 2,250.00 

OHARA,RAY H CLERICAL ASSISTANT, TO AUG 31 1,500.00 

PADDOCK, MINA F STAFF ASSISTANT 3,000.00 

PALMER, EDiARD JOSEPH STAFF DIRECTOR, TO JOL 31 

SUBCOMMITTEE STAFF DIRECTOR, FROM AUG 1 6,249.99 

PERUGINO,MARY ROXANNE STAFF ASSISTANT (C) 3,999.99 

PI TCHFORD, GERALD EHILE STAFF CONSULTANT 8,250.00 

POPOVICH, THOMAS E MINORITY STAFF CONS (C) 6,000.00 

PRZYSTUP, JAMES J SUBCOMMITTEE STAFF ASSOCIATE, FROM SEP 1 1,666.67 

RAUPE, JOYCE STAFF ASSISTANT (C) , TO JUL 31 

BUDGET/FISCAL ASST (C) , FROM AUG 1 5,124.99 

RAYANO,FRED J INVESTIGATOR 7,500.00 

REINHARDT, SANDRA P STAFF ASSISTANT 4,250.01 

ROVNER, CAROL PAGE STAFF ASSISTANT, FROM SEP 21 277.78 

SALVIA, JEANNE M STAFF ASSISTANT (C) 4,833.33 

SALZBERG,JOHN P SPECIAL CONSULTANT, TO JUL 31 

STAFF CONSULTANT, FROM AUG 1 8,000.01 

SCHLUNDT, VIRGINIA MONA STAFF ASSOCIATE, TO JUL 31 

SUBC STAFF ASSOCIATE, FROM AUG 1 6,750.00 

SCHOLLAERT, JAMES T STAFF CCNSULTANT (P) 9,500.01 

SCBORK,KUBT ERICH SUBCOMMITTEE STAFF ASSOCIATE, TO JUL 31 1,250.00 

SHUBA, NANCY LYNN MINORITY STAFF ASSISTANT (C) 3,249.99 

SLOTNICK, SUSAN RESEARCH ASSISTANT 3,000.00 

SHEETON, THOMAS R MIN STAFF CONSULTANT ( P) 8,250.00 

SMITH, LILLIAN L STAFF ASSISTANT (C) , TO JUL 31 

MIN STAFF ASST (C) , FROM AUG 1 5,000.01 

SMITH, THYH S RESEARCH ASSISTANT, TO SEP 16 3,166.67 

SORIANO, RONALD L STAFF ASSOCIATE, TO JUL 31 

SUBC STAFF ASSOCIATE, FROM AUG 1 4,019.91 

SPALATIN,IVO JOSEPH SUECOMMITTEE STAFF DIRECTOR 8,950.00 

SPARKS, RAY EDITOR (P) 9,000.00 

STILL, LAVEBNE STAFF ASSISTANT 3,999.99 

STONER, DIANE LYH STAFF ASSISTANT (C) 4,374.99 

STONEB, ROBERT A PUBLICATIONS ASSISTANT (C) , TO JUL 31 

SPECIAL ASSISTANT (C) , FROM AUG 1 4,749.99 

STRAND, GWENDOLYN STAFF ASSISTANT 3,500.01 

SULC,LAHRENCE B MINORITY STAFF CONSULTANT 6,697.17 

TELL, LAURENCE J STAFF CONSULTANT, TO JUL 15 1,041.67 

TERRY, JUAHITA H STAFF ASSOCIATE, TO JUL 31 

SUBC STAFF ASSOCIATE, FROM AUG 1 4,250.01 

VANDUSEN, MICHAEL H SUBCOMMITTEE STAFF DIRECTOR 9,999.99 

BAITE,ROGENE M , SUBCOMMITTEE STAFF ASSOCIATE, FROM AUG 8 2,355.55 

BALLEBSTEIN, HARRIET S STAFF ASSOCIATE, TO JUL 31 

SUBC STAFF ASSOCIATE, FBOH AUG 1 3,000.00 

BEBER, JOSEPHINE STAFF ASSISTANT 4,374.99 

BYNN, DONNA GAIL STAFF ASSISTANT 4,437.51 

YESH, CONSTANCE LEE STAFF ASSISTANT 4,374.99 



COMMITTEE ON INTERSTATE AND FOREIGN CCHMEHCE 



AIN.ROSS DAVID 
ALLEN, KAREN AVNE 
ATKISSON,JOHN MCE 
BALITIS.ROSE H 
BARRETT, MICHAEL F,JR 
BAHTH, LAWRENCE 
BEAUCHAHP, DANIELLE M 
BECHTEL,DALE C 
BECK, CATHY 
BELL, JOANNE E 



PROFESSIONAL STAFF (P) 

OFFICE HAHAGER/SECRBTABY 

DEPUTY CHIEF COUNSEL 

CUBICAL ASSISTANT 

COUNSEL 

RESEARCH ASSISTANT, TO JUL 31 

RESIARCG ASSISTANT 

RESEARCH ASSISTANT 

STAFF ASSISTANT, TO AUG 5 ... 
CLERICAL-STENOGRAPHIC (C) .... 



,000.01 
,930.00 
,375.00 
,525.99 
,628.67 

500.00 
,258.71 
,089.24 

700.00 
,275.00 



180 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



COMMITTEE ON INTERSTATE AND FOREIGN COMMERCE -CONTINUED 



BERRY, LEWIS E, JR 
BILLINGSLEY, BECKY 
BFAON.HILLIAB D 
BROWN, LESTER 
BROHN, MOLLIS M 
BOLLARD, BARBARA L 
BDRKE,JQHN FRANCIS 
BYRD, SELENE H 

CASEY, KATHLEEN E 
CASSIDY.JUNE LENORE 
CHATMAN, CHARLES E 
COLEMAN, RONALD DICK 
CONNOLLY, STEPHEN J 
CORR, WILLIAM V 
COSSOLOTTO, MATTHEW C 
COWEN, JAMES S 
CROWE, VERONICA 
DAHL, KAREN E 
DALRYHPLE, DONALD W 
DANIELS, JANICE ELLEN 
DARROW, PETER V 
DAVIDSON, MARIANE 
DAVIDSON.BOSALYN 
DAVIS, RANDALL E 
DAVIS, SHARON EILEEN 
DEMAREST, WILLIAM F,JR 
DEPEYSTER, FRANCES LEE 
DINKINS, ELEANOR A 
DODGE, LOWELL 
DOWELL,EDWINA E 
DOX.BARY JANE 
DROHAN, WILLIAM T 
DONNE, CHRISTOPHER EOGENE 
DOVAL, VALERIE 
EASTMAN, ELIZABETH A 
FINNEGAN, DAVID B 
FLOES, BARBOORA C 
FOLDES,HARY TODD 
FOLEY, ELLEN A 
FORRESTER, PATRICK J 
FRANDSEN, RICHARD A 
FREEMAN, STANLEY 
FBY, SUSAN C 
GALLOWAY, JOHN 
GETTYS.SARA ELIZABETH 
GLISSON.JO ANNE 
GREENE, HENRY THOMAS 
GBEE'nE,J THOMAS 
HALSEMA, ALICE C 
HARDER III, GEORGE H 
HARRIS ON, ELIZABETH 
HELLEB, RICHARD A 
HENKE, BRUCE R 
HERRING, JOAN R 
HIGGINBOTHAM.EATHER H 
HIGGINS, JAN 
HOWARD, ROBERT B 
HUNT, PETER S 
JACKHON, STELLA MAE 
JACKSON, CHARLES L 
JETER, SHIRLEY 
JORDAN, ANNE L 
KAPLAN, THOMAS G 
KELLEY, JOSEPH T 
KINNEY, JANIE ANN 
KINZLER.PETEB 
KITZMILLER,0 H 
KLUCSIK,JOHN F 
KNIGHT, YVONNE P 
KON, VERONICA M 
LAMB, ROBERT HENLEY 
LAWTON,STEPHAN E 
LEAHY, PATRICIA C 
LEAL, MARIAN SOSAN 
LEMOV, MICHAEL R 
LEWIS, TERRY LEE 
LINDSAY, RICHARD D 
LITTLE, RICHARD N,JR 
LOWER, MILTON D 
BAASS,BOBB R 



PROF STAFF MEMBER-MINORITY (P) $ 5,984.66 

STAFF ASSISTANT, FROM JOL 11 TO AUG 15 826.39 

COUNSEL 8.7U9.99 

SPECIAL ASSISTANT 4,749.99 

CLERICAL ASSISTANT - M IN (C) 3,839.40 

ADMINISTRATIVE ASST - BIN (C) 5,564.67 

STAFF ASSISTANT, TO AOG 31 1,000.00 

CLERICAL ASSISTANT, TO JOL 31 

CLERICAL ASSISTANT, FROM AOG 5 3,395.12 

RESEARCH ASSISTANT 2,499.99 

CLERICAL ASSISTANT (MINORITY) 3,395.01 

COUNSEL 6,000.00 

PROF STAFF MEBBER-MINORITY (P) 11,250.00 

SENIOR STAFF ASSOCIATE 7,867.37 

ASSISTANT COONSEL 5,333.33 

RESEARCH ASSISTANT, TO AOG 19 816.67 

PROFESSIONAL STAFF MEMBER (P), FROB AOG 15 .... 2,555.56 

CLERICAL ASSISTANT 3,651.00 

STAFF ASSISTANT 3,133.33 

ASSISTANT COONSEL 6,911.52 

STAFF ASSISTANT 3,298.26 

RESEARCH ASSISTANT 2,958.33 

CLERICAL ASSISTANT, TO AOG 31 1,250.00 

STAFF ASSISTANT 2,985.94 

STAFF ASSISTANT (MINORITY) 6,375.00 

CLERICAL ASSISTANT (C) 3,425.01 

COUNSEL 9,999.99 

STAFF ASSOCIATE (MINORITY) 6,234.54 

ASSISTANT CLEBK (C) 6,624.99 

SPECIAL COUNSEL 8,750.01 

STAFF COONSEL, FBOM AUG 8 3,680.55 

SECBETARY 3,900.00 

STAFF DIRECTOR 11,874.99 

PBOFESSIONAL STAFF MEMBER (P) 5,750.01 

ADMINISTRATIVE ASSISTANT 5,703.96 

OFFICE MANAGER 4,777.26 

COUNSEL 9,999.99 

CLERICAL-STENOGRAPHIC 4,646.01 

COUNSEL 8,094.00 

STAFF ASSISTANT 2,935.74 

BESEAHCH ASSISTANT, TO JOL 31 500.00 

COONSEL 7,500.00 

STAFF ASSISTANT, TO SEP 2 1,240.00 

LEGAL ASSISTANT, TO SEP 6 2,717.88 

SPECIAL ASSISTANT 9,999.99 

CLEBICAL ASSISTANT (ACCOONTING) 3,573.74 

SENIOR STAFF ASSOCIATE 6,911.52 

PBCF STAFF BEBBER-BINORITY (P) 11,874.99 

COONSEL 10 THE CHAIRMAN 8,750.01 

STAFF ASSISTANT 2,499.99 

ASSOCIATI HINOBITY COONSEL 8,499.99 

PROFESSIONAL STAFF BEBBER ( P) 11,874.99 

COUNSEL 4,749.99 

STAFF ASSISTANT 5,874.99 

STAFF ASSISTANT 3,249.99 

STAFF ASSISTANT 3,806.49 

CLEBICAL ASSISTANT MINORITY 3,002.01 

BESEABCH ASSISTANT 7,963.77 

BESFABCH ANALYST 9,750.00 

LEGISLATIVE ASSISTANT/SECRETARY 3,750.00 

STAFF ENG-SUBC ON COBM 8,499.99 

LEG ASST-SECTY-SUBC ON COBM 3,750.00 

CLERICAL-STENOGRAPHIC 4,164.51 

COUNSEL, FROM AUG 22 2,979.17 

CLERICAL ASSISTANT - BIN (C) 3,302.16 

COONSEL/STAFF COORDINATOR 9,038.31 

COUNSEL 9,038.31 

PROFESSIONAL STAFF MEBBER (P) 8,250.00 

STAFF ASSISTANT, TO AUG 31 , 2,568.34 

STAFF ASSISTANT 3,198.24 

STAFF ASSISTANT, TO AUG 31 1,500.00 

ASSISTANT BINORITY COUNSEL (P) 9,500.01 

CHIEF COUNSEL 10,800.00 

STAFF ASSISTANT 4,125.00 

CCONSEL 4,250.01 

CHIEF COUNSEL 11,250.00 

RESEARCH ASSISTANT, TO AOG 5 700.00 

PBCFESSIONAL STAFF BEBBER (P), FROB AOG 1 .... 5,833.34 

COUNSEL 9,750.00 

ECCNCBIST 6,249.99 

CLEBICAL ASSISTANT, TO JUL 31 590.00. 



181 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



COMMITTEE ON INTERSTATE AND FOBEIGN COMMERCE -CONTINUED 



HAGID, KAREN N 
MAHER, ROBERT 8 
HAHON,FBANK V 
HARGESON, ANDREW JANES 
BARKS, LAURENCE H 
NCCULLOUGH, EDWARD A 
HCLAIN, PATRICK BATES 
BCLATGHLIN, JOHN P 
HC LEAN, JEAN 
BCLEOD.ROTH 
BCHANUS, ALLEGRA P 
BCBOLLEN,DARLENE G 
BEYERS, KATHERINE C 
BOIR, BRIAN R 
BOLLOT,J PAOL 
MORAN, BERNARD L 
BORBISS£TTE,PABELA R 
NOSHER, RUSSELL D 
NELLIGAN, JAKES L 
NELSON, KAREN 
NORD, NANCY ANN 
0'DONNELL,BICHELE 
OPPER, FRANZ F 
PAINTEB, KENNETH J 
PEARCE,ALAN 
PHILLIPS, JABES G 
POSSNER, KAREN B 
POTTER, FRANK H,JB 
PRODT, DEBORAH H 
QOINN, JUDITH ANN 
RAABE, BARK J. 
REID,RABION S 
RITCHIE, LINDA SOE 
ROSENBERG, BARK L 
ROSEN, HARVET A 
RYAN,THOBAS H 
SACHS, CAROLYN F 
SCHOOLER, DAVID 
SCHROEDER, SALTER W,III 
SCHWARTZ, JEFFREY H 
SZDDON.KATHRYN 
SEGAL, ELLIOT A 
SHAFFER, JAY C 
SHOOK, WILLIAM A 
SHOOSHAN III, HARRY H 
SIEVERS, WILLIAM K 
SIMS, STEPHEN F 
SHETHORST, BENJAMIN H 
SMITH, KIRK C 
SPARKS, CHERYL E 
SPEIR, CAROLYN G 
STOCKTON, PETER D H 
STROK.SOSAN HELEN 
TALLBAN, RICHARD L 
TAYLOR, MARGARET A 
THOHAS, EDWIN EARL 
TRAKAS, ERNEST A 
VALENTINE, BENDY GELL 
VANDERBURGH, CHARLES E 
VLCE K.JAN 
WALKEB, REBECCA B 
WATKINS, CHARLOTTE E. 
WELDON.DALE K 
WILES, LISA C 
WILLIAMSON, WALTER E 
WITMEYER, BARBARA H 
WONG, MARILYN J 
WOO,BICHAEL T 
WOOD, DAPHNE B 
WONDER, BERNARD J.JB 
YANCY, CORLISS L 
ZIHBERBAN, BURKE K 



STAFF ASSISTANT, TO AOG 19 $ 1,361.11 

DIRECTOR OF RESEARCH 6 PLAN 10,800.00 

PRINTING EDITOR (C) 7,325.01 

ECONOMIST 8,499.99 

STAFF ASSISTANT, TO AOG 26 1,555.55 

RESEARCH ASSISTANT, TO JUL 31 500.00 

CCONSEL .'.... 5,250.00 

LEGAL ASSISTANT 4,500.00 

CLERICAL ASSISTANT (C) 4,250.01 

STAFF ASSISTANT 3,083.33 

STAFF ASSISTANT 3,209.99 

LEGISLATIVE ASSISTANT-BIN (C) 4,533.90 

SPECIAL ASSISTANT 3,750.00 

PBOFESSICNAL STAFF MEMBER ( P) 10,500.00 

ASSOCIATE BINORITY COUNSEL (P) 11,250.00 

MINORITY STAFF ASSISTANT, TO AUG 5 758.33 

STAFF ASSISTANT 3,525.75 

STAFF ASST/INVESTIGATIONS 3,535.68 

OPERATIONS DIRECTOR 11,250.00 

PROFESSIONAL STAFF HEBBEE (P) 11,250.00 

CCUNSEL (BINORITY) 9,000.00 

FILE CLERK, FROB JUL 5 TO JUL 31 525.78 

CCUNSEL 9,033.25 

1ST ASST CLERK (C) 11,874.99 

ECONOBIST, TO JUL 9 1,025.00 

RESEARCH ANALYST, TO AOG 22 4,715.50 

STAFF ASSISTANT 8,499.99 

COUNSEL 11,874.99 

STAFF ASSISTANT 2,942.26 

CLERICAL ASSISTANT 3,875.01 

PROFESSIONAL STAFF BEMBER (P) 10,500.00 

CLERK-STENOGRAPHER 3,875.01 

STAFF ASSISTANT 2,941.67 

CCUNSEL, TO JUL 16 1,115.24 

SPECIAL ASSISTANT, TO AUG 28 6,380.00 

COUNSEL (C) 6,249.99 

STAFF ASSISTANT 6,249.99 

COUNSEL 5,874.99 

RESEARCH ANALYST 9,750.00 

PRCFESSIONAL STAFF HEHBER (P) 11,874.99 

LEGAL ASSISTANT 4,500.00 

SPECIAL ASSISTANT 11,000.01 

CCUNSEL, FROB SEP 25 500.00 

RESEARCH ASSISTANT 3,000.00 

STAFF DIRECTOR/COUNSEL 11,874.99 

RESEARCH ASSISTANT, TO AUG 31 600.00 

SPECIAL ASSISTANT 7,125.00 

SPECIAL ASSISTANT 9,999.99 

SPECIAL ASSISTANT 5,750.01 

SECRETARY 3,125.01 

STAFF ASSISTANT 3,125.01 

RESEARCB ANALYST 6,945.72 

STAFF ASSISTANT 3,416.67 

STAFF ASSISTANT 2,375.01 

BINORITY STAFF ASSISTANT, FROM JUL 11 5,000.00 

STAFF ASSISTANT (C) 5,250.00 

LEGISLATIVE ASSISTANT 3,624.99 

EXECUTIVE ASSISTANT 3,809.65 

STAFF ASST, BIN 9,000.00 

PROF STAFF BEHBER- MINORITY (P) 11,874.99 

ADMINISTRATIVE ASSISTANT 3,933.36 

CLERICAL ASSISTANT 3,875.01 

STAFF ASSISTANT 2,133.33 

SECRETARY TO CHIEF COUNSEL 4,133.49 

CHIEF CLK 6 STAFF DIR (P) 7,018.01 

STAFF ASSISTANT 3,399.99 

RESEARCH ASSISTANT, TO AUG 19 816.67 

STAFF ASSISTANT, TO AUG 31 1,500.00 

STAFF ASSISTANT, TO AUG 12 606.66 

MINORITY COUNSEL 8,750.01 

RECEPTIONIST-SECRETARY 2,458.34 

RESEARCE ASSOCIATE 7,166.67 



COMMITTEE ON THE JUDICIARY 

ALCOCK,LYNN 

APRILETTI, MARILYN 
BARTLSTT.RITA L 
BATES, ROBERT S 



CALENDAR CLEBK 4,749.99 

CLERICAL STAFF (C) 3,375.00 

CLERK 3,812.49 

PUBLICATIONS CLERK 2,625.00 



182 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

COBBITTEE OH THE JUDICIARY -CONTINUED 



BELSKY,BARTIN H 
BOGGS,TIBOTHY A 
BOYD, THOBAS H 

BEANDES, SHARON A 
BREEN,T P 
BKOWN, MARTHA K 
BUTLER, ANNE B 
BUTLER, DANIEL 
CHELLB AN, PEARL L 
CHRISTY, FRANCES 
CLARE, DINAH F 
CLINE, GARNER J 
COFFEY, ALAN F,JR 
COHEN, DANIEL L 
COOK, ALEXANDER B 
COOPER, JANICE E 
D'DVA,RAYBOND P 
DAHEHON, JANET L 
DANIELS, LIZZIE H 
DAVIS, IVY L 
DOHERTY,HADREEN A 
DOYLE, FLORENCE B 
ENDRES, ARTHUR P,JR 
FARR,JAHES B 
FREED, LESLIE E 
GALLO, THERESA H 
GLEASON, EUGENE U 
GORDON, LEO M 
GREGORY, HAYDEN W 
GREGORY, JOAN G 
HALL, LINDA C 
HftRLLEE, MILDRED J 
HART, TIMOTHY J 
HIGGINS,GAIL PATRICE 
HUTCHISON, THOBAS » 
KERN, CHARLES E,II 
KLEE, KENNETH NATHAN 
KLEIN, MARGUERITE B 
KNOTT, JUDY LYNN 
LARSON, TONI 
LEHMAN, BRUCE A 
LEBBO, ROBERT A 
LEROY, CATHERINE A 
LEVIN, RICHARD B 
HAGUIRE, BERNADETTE 
BARCDS, AUDREY K 
MCGRADY, FLORENCE T 
MOONEY, THOBAS E 
MURPHY, MICHAEL PATRICK 
NITTLE, ALFRED M 
PARKER, ALAN A 
PFAFF,ALBA T 
POLK, FRANKLIN G 
RAIKIN, STEVEN G 
RANSOM, ALAN A 
REGIS, PETER 
REMINGTON, BICHAEL J 
RUNGE,TOB S 
SALOPEK, SANDRA J 
SEDBAK,JO LYNNE C 
SHAHBON, LEONARD B 
SHATTUCK.HILLIAB P 
SINCAVITZ, SANDRA 
SIPPEL.WILLIAB L 
SBIETANKA,RAYBOND V 
SBITH, ALICE B 
STAR2K III,ROSCOE B 
STEVENS, PABELA J 
STOVALL,ROSCOE,JR 
STRAUBE, JOYCE BARIE 

TAYLOR, LAURENCE E 
THCBASON.LEE C 
TURNIPSEED,JAY T 
VALENTE,MARY MYERS 
VANCE, LOUIS S 
VANN, BARRY L 
VI LLARBAL, PATRICIA 
WADLEY, DOROTHY C 
WEBER, ANNELIE E 



COUNSEL (P) $ 7,860.09 

RESEARCH ASSISTANT 5,000.01 

ASSOCIATE COUNSEL, TO SEP 15 

ASSOCIATE COUNSEL (P) , FROB SEP 16 7,500.00 

CLERK 3,125.01 

COUNSEL (P) 8,750.01 

CLERICAL STAFF 3,026.97 

CLERK , 3,812.119 

CLERK 3,532.14 

CLERICAL STAFF (C) 5,000.01 

LEGISLATIVE ANALYST 9,000.00 

CLERK 2,874.99 

STAFF DIRECTOR (P) 12,000.00 

ASSOCIATE COUNSEL (P) 8,250.00 

COUNSEL (P) 9,000.00 

ASSOCIATE COUNSEL (P) 8,607.06 

ASSISTANT COUNSEL 6,249.99 

ASSISTANT COUNSEL, FROB SEP 6 1,354.17 

CLERK 3,249.99 

CLERK 3,300.00 

ASSISTANT COUNSEL, FROM JUL 5 5,375.00 

CLERK 3,750.00 

CLERICAL 3,624.99 

COUNSEL (P) 9,000.00 

CLERK 4,250.01 

COUNSEL , 6,249.99 

CLERK 4,125.00 

RESEARCH ASSISTANT 6,737.22 

ASSISTANT COUNSEL, FROB SEP 1 1,541.67 

COUNSEL (P) 9,750.00 

CLERICAL STAFF (C) 4,749.99 

CLERK, FROM JUL 5 3,225.00 

CLERICAL STAFF (C) 3,375.00 

ASSISTANT COUNSEL 6,249.99 

COUNSEL (P) 7,250.01 

CCUNSEL (P) 8,750.01 

ASSOCIATE COUNSEL (P) 9,000.00 

ASSOCIATE COUNSEL (P) , TO SEP 15 5,208.33 

CLERK (C) 3,624.99 

CLERK 3,125.01 

ASSISTANT COUNSEL 5,000.01 

CCUNSEL (P) 8,750.01 

ASSISTANT COUNSEL 5,000.01 

ASSISTANT COUNSEL 8,333.32 

ASSISTANT COUNSEL 5,000.01 

CLERK (C) 3,999.99 

CLERK 3,937.50 

CLERICAL STAFF (C) 5,000.01 

ASSOCIATE COUNSEL (P) 9,999.99 

CLERK 2,227.65 

COUNSEL 9,900.00 

GENERAL CCUNSEL (P) 12,000.00 

RESEARCH ANALYST 4,355.52 

ASSOCIATE COUNSEL (P) 11,250.00 

ASSISTANT COUNSEL, FROM AUG 11 2,673.61 

COUNSEL 8,750.01 

LEGISLATIVE ASSISTANT 7,298.67 

ASSISTANT COUNSEL 6,249.99 

COUNSEL 6,249.99 

CLERK 2,812.50 

CLERK 3,125.01 

COUNSEL 6,875.01 

CCUNSEL (P) 10,625.01 

CLERICAL STAFF (C) 4,625.01 

ASSISTANT COUNSEL 5,625.00 

ASSOCIATE COUNSEL 5,750.01 

CLERICAL STAFF (C| 5,000.01 

ASSOCIATE COUNSEL 6,999.99 

CLERK 2,349.99 

ASSOCIATE COUNSEL 6,624.99 

CLERK, TO JUL 31 

CLERK, FROB AUG 5 3,643.05 

EDITOR (C), TO JUL 10 958.33 

CLERK 2,750.01 

COUNSEL 6,249.99 

CLERICAL STAFF (C) 6,240.51 

BESSENGER 3,624.99 

ECONOBIST 4,334.07 

STAFF ANALYST, TO SEP 7 3,815.27 

CLERK 4,250.01 

CLERICAL STAFF (C) 4,250.01 



183 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



COMMITTEE ON THE JODICIABT -CONTINUED 



WERTH.NARICE C 
WINDSOR, ELIZABETH P 
HOLFE, JOSEPH V 
ZEEROWSKI, K&THY JEAN 
ZECCA,HARK R 



CLERK, TO AOG 31 $ 1,750.00 

CLERK 3,312.51 

ASSOCIATE COUNSEL, FROH SEP 16 750.00 

ASSISTANT COONSEL 0,625.01 

ASSISTANT COONSEL, FROH SEP 6 1,388.89 



COHHITTEE ON HERCHANT MARINE JNt EISEERIES 

ANDERS, RICHARD I INTERN, TO AOG 12 1,125.00 

BAFFA.SOSAN ASST CHIEF CLERK (C) 3,875.01 

BECK, JAMIE INTERN, TO AOG 31 1,375.00 

BEDELL, CHARLES ALLEN CEPOTY MINORITY COONSEL (P) 6,525.69 

BISCHOFF.VICKI L SECRETARY (C) 2,750.01 

BLOCKLIN, STEPHEN W INTERN, TO AOG 12 1,500.00 

BOTT,HARY JANE HINOEITY SECRET ARY-CLERK (C) 2,882.82 

BROWN, ANITA C SECRETARY-CLERK 3,500.01 

BR0CE,JOHN H HINOEITY PROF STAFF HEHBER (P) 7,625.01 

BOSER.LAORENCE J PROFESSIONAL STAFF (P) 11,874.99 

CASSANI, RODOLPH V PROFESSIONAL STAFF 7,500.00 

COKER, ELIZABETH A SOECOHHITTEE CLERK (C) 0,500.00 

COLLINS, JACQOELINE N. INTERN, TO JUL 31 500.00 

CONROY,COLEHAN J PROFESSICNAL STAFF ASSISTANT, FROH AUG 5 1,555.55 

CORRADO, ERNEST J CHIEF COONSEL (P) 12,500.01 

CROLL,HICHELLE D SECRETARY, FROH AOG 8 2,208.33 

DANIELS, THOHAS R INTERN, TO AOG 12 1,375.00 

DIBHL,LAOREH T RECEPTIONIST, FROH AOG 1 2,000.00 

E7ERETT.NED P COONSEL (P) 11,000.01 

FIRKIN, DONNA K SOECOHHITTEE CLERK 3,083.33 

FLING, JEAN C SECRETARY (C) 0,125.00 

GOLDINGER, SHARON I SECRETARY, TO AOG 31 

SOBCOHHITTEE SECRETARY, FROH SEP 1 2,583.33 

GOODRIDGE, EOGENIA F SECRETARY 3,750.00 

GORE.LAORENCE D INTERN, TO AOG 5 583.33 

GOTTING, RICHARD E,JR SOBCOHHITTEE COONSEL > 9,999.99 

HEIiARD, FRANCIS D COONSEL (P) 11,000.01 

HOFFHAN,ROTH I CLERK (C) 5,120.99 

HOWELL, HARTIN D PROFESSICNAL STAFF (P) 11,870.99 

INGRAO.HICHAEL A RESEARCH ASSISTANT 3,000.00 

JAEGER, NANCY G INTERN, TO JUL 31 500.00 

JORACKO.RODELLE A SOECOHHITTEE CLERK 3,000.00 

KANE, EDWARD J PROFESSIONAL STAFF 6,999.99 

KANTHAL, PATRICIA RECEPTIONIST 2,750.01 

KING,HARGOERITE V SECRETARY 3,000.00 

KITSOS, THOHAS R PROFESSIONAL STAFF HEHBER ( P) 9,000.00 

KYROS, PETER N COONSEL (P) 9,500.01 

LIPPINCOTT, DONALD F.III SOEC RESEARCH ASST, FROH AOG 1 2,000.00 

LOCKHART.GWEN H HINOFITY CLERK (C) 6,000.00 

LOSCH, RONALD K HINOFITY PRO STAFF HEHBER 7,500.00 

HALLON, LAWRENCE G PROFESSICNAL STAFF 7,500.00 

HANNINA, GEORGE J.JR MINORITY PRO STAFF HEHBER 8,750.01 

MARSHALL, CORTIS L MINORITY FRO STAFF MEMBER 5,625.00 

HIDBOE.KAI D HINOEITY PRO STAFF MEMBER 7,709.99 

HODGLIN,TEERENCE i PROFESSIONAL STAFF 6,209.99 

MOHLER, ELEANOR P ASSISTANT CHIEF CLERK (C) 5,099.99 

MORRIS, i PATRICK CHIEF BIN COONS 6 STAFF DIR (P) 11,870.99 

HOELLER,ANN H SECRETARY 3,875.01 

NONNENHACHER, NICHOLAS MINORITY PROFESSIONAL STAFF 6,125.01 

NORLING, RICHARD D PHCFESSICNAL STAFF (P) 7,500.00 

O'CONNOR, ELIZABETH A RECEPTIONIST 3,000.00 

OETTING,S0ZANNE A PROFESSIONAL STAFF 5,750.01 

OKEEFE, KAREN ANN STAFF MEMBER 3,500.01 

OSHINS, JEFFREY H PROFESSIONAL STAFF 6,000.00 

PAGNOTTA, BRENT INTEEN, TO AOG 5 1,125.00 

PEPIAN,CARL LEWIS CHIEF OF STAFF (P) 12,500.01 

PERIAN.JOLIA P ADMINISTRATOR (P) 8,250.00 

POLLOCK, HOWARD W MINORITY PRO STAFF HEHBER(P), FROM JUL 16 9,333.33 

ROBINSON, CAROLYN W SECRETARY (C) 0,262.10 

SANDS, JACK E DEPOTY MINORITY COONSEL (P) 7,625.01 

SHEA, ROBERT E PROFESSIONAL STAFF 6,000.00 

SHITH, GRANT WAYNE PROFESSICNAL STAFF 9,000.00 

STILL, FRANCES CHIEF CLERK (C) 5,260.08 

SOTTER, LEONARD L,JB COUNSEL (P) 11,000.01 

THEISZN,HABK A PROFESSIONAL STAFF MEMBER, FROH SEP 1 1,016.67 

THOMPSON, PAOL G MINORITY RESEARCH ASST (P) , TO AOG 31 1,583.30 

THORNTON, ROBERT E SOBCOHHITTEE COUNSEL 7,500.00 

TOBNSEND,JUDY A PROFESSIONAL STAFF 5,099.99 

WAGNER, JEAN E INTERN, TO AUG 31 1,333.30 

WATT, DONALD A EDITOR (P) 8,203.31 

WEINBERGER ,GAYLE E INTERN, TO AOG 31 1,000.00 



S-500 O - 78 - 13 



184 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



COMMITTEE ON MERCHANT MARINE AND FISHERIES -CONTINDED 



WESTCOTT.JACQUELYN H 
WINFIELD.W B 
NYHAN, BARBARA A 
ZEEB,MARVADELL C 



PROFESSIONAL STAFF MEMBER $ 5,871.99 

CLERK (C) 6,617.08 

ASSISTANT MINORITY CLERK (C) 1,125.00 

SOBCOMHITTEE CLERK (C) 1,371.99 



COMMITTEE ON POST OFFICE AND CIVIL SERVICE 



ANDERSON, CARL E,JB 
BAPRY, MARGARET R 
BARTON, RICHARD 
BEER, ALAN RICHARD 
BPEITENBERG,JOHN F 
BROZO, JAMES M 
CAROLINA, JAMES ARTHUR, JR 
CARROLL, EVELENA C 
CAVANAGH, MICHAEL F 
CIARAVELLA,JO ANN 
COHEN, MARTIN L 
CORBISHLEY, FRANCIS 
COFNETT,JILL F 
COOLTRAP,RAY H 
COYLE, EDWARD F 
DESROCHERS, NANCY K 
FELDHAN, CHARLES 
FERRELL, MICHAEL J 
FISHER, JOSEPH A 
FLEISHER, ELLEN-BETH 
FOX,LYDIA M 
GEURIN,J DARREN 
GILLIGAN,JEAN W 
GOLACINSKI, NANCY A 
GOODMAN, MARIAN S 
GOULD, GEORGE B 
GOSKY, DAVID 
HAROLD, ROBERTA A 
HAUGHT,REX ALAN 
HENDERSON, PHYLLIS N 
HICKS, HEIDI 
HOWARD, ALTON M. 
HUGLEB, EDWARD T 
ITTNER, LINDA A 
JAYNE, EDWIN S,JR 
JOHNSON, LLOYD A 
JOHNSON, PRISCILLA VIOLA 
KAZY, THEODORE JAMES 
KENNEDY, THOMAS R 
KNOLL, CHARLES H 
KOVALESKI.KANDY L 
KRAMER, KERRY 
LAGOANA, ROSEMARY P 
LAMOTTE,BETTIE J 
LAWRENCE, ANNE MARIE 
LOCK AHD, DAVID LEE 
LOCK HART, ROBERT E 
LYONS, MOLLY DAY 
MANOOGIAN, WILLIAM H 
HCCLOSKEY, RONALD P 
MCGOWAN, GREGORY E 
MEEHAN,JOLIE N 
MEEKS, FRANK 
.MINTON.ELI D 
MYERS, JAMES PIERCE 
NAPIER, MARGARET G 
NEWTON, PAOL W 
OLSON, SYDNEY J 
OMAS, GEORGE 
PELTIN,DEANNE Z 
PENDLETON, MARIA R 
PERDOE, PATRICIA A 

PETERS, DOROTHY L 
PRITCHETT.DEBRA ANN 
RAMLOW, BERTHA MARIE 
RAYMOND, ANTHONY JOHN 
REID, VANESSA Y 
ROBERTS, ROBIN A 
RODERICK, BEVERLEY J 
SCHLESINGER,LOOISE D 
SHACK, LINDA 



SOMMER INTERN, TO JOL 31 590.00 

EXECUTIVE SECRETARY (C) 3,999.99 

SUBCOMMITTEE STAFF DIRECTR (P) 9,975.00 

STAFF ASSISTANT 3,999.99 

STAFF ASSISTANT 5,871.99 

CLERK TYPIST 1,200.00 

STAFF ASSISTANT 1,500.00 

SECRETARY, TO AUG 31 2,116.66 

STAFF ASSISTANT 5.U99.99 

STAFF ASSISTANT 5,375.01 

RESEARCH ASSISTANT, FROM JUL 25 TO SEP 5 806.33 

SUMMER INTERN, TO AUG 31 1,180.00 

SUMMER INTERN, TO JUL 31 590.00 

STAFF ASSISTANT (C) 1,815.63 

STAFF ASSISTANT 5,375.01 

EXECUTIVE SECRETARY (C) 3,999.99 

INTERN, TO AUG 31 1,180.00 

SUECOMHITTEE STAFF DIRECTR (P) 7,137.51 

MINORITY SR STAFF ASST (P) 10,875.00 

SECRETARY 3,750.00 

SECRETARY 3,750.00 

INVESTIGATOR (P) 6,500.01 

ASST ACM CLERK (P) 2,080.58 

SECRETARY (C) 3,125.01 

SECRETARY 3,125.01 

SUECOHMITTEE STAFF DIRECTR (P) 9,975.00 

STAFF ASSISTANT, FROM AUG 1 1,750.00 

STAFF ASSISTANT 3,519.99 

SUMNER INTERN, TO AUG 12 826.00 

SECRETARY, FROM SEP 12 606.91 

CLERK TYPIST 1,200.00 

PRINTING EDITOR (C) 7,250.01 

INVESTIGATOR (C) 8,923.65 

STAFF ASSISTANT 1,500.00 

STAFF ASSISTANT, TO AUG 12 1,100.00 

SUBC STAFF DIRECTOR (P) 9,975.00 

RECEPTIONIST, FROM SEP 1 958.33 

MINORITY STAFF DIRECTOR (P) 11,750.01 

SUBCOMMITTEE STAFF DIRECTR (P) 9,375.00 

SUECOHMITTEE STAFF DIRECTR (P) 6,750.00 

SECRETARY 3,125.01 

SECRETARY 3,000.00 

RECEPTIONIST 2,871.99 

SECRETARY 3,577.32 

CLERK, FROM AUG 15 766.67 

RESEARCH ASSISTANT 3,000.00 

DEPUTY GENERAL COUNSEL (P) 11,871.99 

ASSISTANT EOCUMENT CLERK , 3,999.99 

ASSISTANT COUNSEL (P) 6,125.01 

SOB STAFF DIR 6 ASST CODN (P) 7,250.01 

STAFF ASSISTANT 1,125.00 

CLERK TYPIST 1,775.00 

INTERN, FROM AUG 1 TO AUG 31 590.00 

DEPUTY GENERAL COUNSEL (P) 11,871.99 

ASST GEN COUNSEL (P) ....< 9,975.00 

DOCUMENT CLERK (C) 6,621.99 

SENIOR STAFF ASSISTANT (C) , TO SEP 3 '. . 6,018.25 

STAFF ASSISTANT 6,000.00 

STAFF ASSISTANT 5,250.00 

SECRETARY 3,500.01 

ADMINISTRATIVE CLERK (C) 6,750.00 

SECRETARY, TO JUL 31 

SECRETARY (C) , FROM AUG 1 , 3,750.00 

ASST AEM CLERK (C) 6,000.00 

SOMMER INTERN, TO AUG 13 815.67 

SECRETARY 3,219.99 

STAFF ASSISTANT (P) 8,625.00 

SUMMER INTERN, TO JUL 31 590.00 

SUMMER INTERN, TO JUL 31 590.00 

SECRETARY 3,399.99 

SUMMER INTERN, TO JUL 31 590.00 

INTERN, TO AUG 31 1,180.00 



185 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



COMMITTEE ON POST OFFICE AND CIVIL SERVICE -CONTINUED 



SHECHTEL, ANDREW J 
SILBIGER, STEPHEN 
SKOLNIK, RICHARD 
SMIROLDO, VICTOR C 
STEINER, SALLY ROTH 
STOREY, ROSEHARY HERBERT 
THOMPSON, HERMAN G 
WEISS, GAIL ELLEN 
YAROS, NICHAELINE N 



INTERN, FROM AUG 1 TO AOG 31 $ 590.00 

SUBCOMMITTEE COUNSEL (C) , TO JUL 31 2,083.33 

SUMMER INTERN, TO JUL 31 590.00 

EXEC DIP 6 GENL COUNSEL (P) 12,500.01 

SUMMER INTERN, TO JUL 31 590.00 

STAFF ASSISTANT 4,749.99 

ASST GENERAL COUNSEL (P) 8,625.00 

STAFF ASSISTANT' 5,874.99 

CLERK 2,750.01 



COMMITTEE ON PUBLIC WORKS AND TRANSPORTATION 



ANDERSON, CYROS T,JR 
ASHWORTH, RICHARD A 
BANNISTER, BARBARA 
BARNETT, RICHARD C 
BARRON, EUGENE E,JR 
BEAM, DOROTHY A 
BETH UNE, PATRICIA 
BURTON, DEMETRA D 
CAMHETT, WILLIAM A 
CANNON, HOLLY 
CARROLL, STEBLYN B 
CLINEBORG,ANN D 
COPLEY, DOUGLAS H 
CORCORAN, WILLIAM H 
COSTELLO,RUTH S 
COX,N LINDA 
DAMICO,SALVATORE J 
DAWSON, ROBERT K 
DOWLING,MAPJORIE H 
DOWNIE, MARTHA E 
EDELHAN, LESTER 
EDWARDS, EDYTHE MAE 

ENCE, RONALD K 
EVANS, CATHERINE ANN 
EVANS, MARVIN B 
FORD, TIN C 
FORMAN,IRA N 
FRYER, JOHN F 
FUREY, ROGER PATRICK 
GANUN, AGNES H 
GILBERT, SHELDON S 
GRANVILLE, CAROL L 
HARRANT,JOHN D 
HEYMSFELD, DAVID 
HILL, PATRICIA A 
HOLM, CHARLES B,JB 
HOOBLER, JANET LEE 
HOWARD, ANNE L 
IRBY,HACHELE M 
ITALIANO, JOSEPH A 
JAMES, DEBRA 
KARSEBOOM, GEORGE P 
KEENEY.KATHRYN M 
K£LLN,MELINDA JANE 
KOPECKY, GEORGE M 
KOVALIC,JOAN MARIE 
KROUSE, CHARLES A 
LARISON, KAREN D 
LOFTOS, ROBERT F 
LOFENZ.CARL J,JR 
LOUGHLIN, ELIZABETH F 
LYNCH, MARIE MURPHY 
MADISON, HERBERT C 
MAHAN, DAVID L 
HARDEN, STEVEN H 
HAY, WALTER R 
HA ZAN, WALTER L 
MCKAY, ROBERT C 
MCKENZIE, THOMAS 
BEYERS, CHERYL A 
HI DDLEDORF, VIRGINIA 
NETHERTON,DARRELL L 
NOLEN, WILLIAM C 
NOVOTNY, SHIRLEY R 
OHARA.JOHN P 
ONEILL, JEFFREY S 



STAFF ASSISTANT 4,574.25 

ASSISTANT MINORITY COUNSEL (P) 8,750.01 

MINORITY STAFF ASSISTANT U, 693. 20 

MINOFITY STAFF ASSISTANT 6,849.99 

STAFF ASSISTANT, TO AUG 19 1,143.33 

EXECUTIVE STAFF ASST (C) 7,820.01 

STIFF ASSISTANT 4,389.75 

STAFF ASSISTANT 3,024.99 

STAFF ASSISTANT, TO AUG 16 1,073.33 

STAFF ASSISTANT, TO AUG 10 933.33 

STAFF ASSISTANT (C) , 7,110.90 

STAFF ASST SUBCOH ECON DEVEL 3,797.46 

MIN EBOF STAFF HBR-AVIATN (P) 9,900.00 

PROFESSIONAL STAFF MEMBER ( P) 7,500.00 

STAFF ASSISTANT (C) 6,415.20 

STAFF ASSISTANT 2,751.78 

CCDNSEL-SUBCOMH SURFACE TRANSP 9,900.00 

ADMINISTRATOR (P) 9,900.00 

STAFF ASSISTANT 3,399.12 

MINOFITY CLERK-SUB INV 6 REV 5,571.30 

COUNSEL (P) 10,625.01 

MINORITY STAFF ASSISTANT, TO JUL 31 

MIN FBOF STAFF HEMBER-EDA, FROM AUG 1 5,499.99 

MIN EBOF STAFF MBB-SUB SOB TR 7,425.00 

CALENDAR CLERK J 4,389.75 

STAFF ASSISTANT (C) 5,836.59 

ASSISTANT COUNSEL 8,633.61 

STAFF ASSISTANT, TO JOL 3 126.88 

ASSISTANT COONSEL (P) SFTR REG 9,848.31 

CLERK 2,601.09 

STAFF ASSISTANT 4,369.14 

ASSISTANT MINORITY COONSEL (P), TO JOL 14 1,540.00 

STAFF ASSISTANT 4,867.50 

MINORITY STAFF ASSISTANT (P) 5,375.01 

ASSISTANT COONSEL-AVIATION (P) 9,900.00 

STAFF ASSISTANT 5,292.75 

EXIC STAFF ASST TO SOBC CHAIBMAN 9,125.01 

STAFF ASSISTANT 2,882.82 

STAFF ASSISTANT 5,000.01 

STAFF ASSISTANT 3,756.84 

EDITOB (C) 7,500.00 

MINORITY STAFF ASSISTANT, FBOM AUG 15 1,725.00 

PROFESSIONAL STAFF HEMBEB 9,379.65 

CHIEF CLERK 6,475.83 

STAFF ASSISTANT, TO SEP 1 1,423.33 

CHIEF INVESTIGATOR 4,197.24 

STAFF ASSISTANT 6,683.76 

PBCF STAFF MBR-SOBCB INV 6 REV 9,379.65 

MINORITY STAFF ASSISTANT 4,181.13 

STAFF ASSISTANT (P) 9,112.77 

CCONSEL, SOBCOHH ECON DEVLPMNT 9,900.00 

MINORITY LIBRARIAN (C) 4,953.21 

CLERK, SUE ON WATER RESOURCES 5,090.82 

PROF STAFF ASST-SUB ON AVIATN 9,000.00 

ASSISTANT COUNSEL-AVIATION (P) 9,900.00 

STAFF ASSISTANT, TO AUG 12 980.00 

CHIEF COUNSEL 3,391.58 

STAFF ASSISTANT 8,932.80 

PROFESSIONAL STAFF MEMBER, TO JOL 17 792.05 

STAFF ASSISTANT, TO AOG 31 1,400.00 

MINORITY STAFF ASSISTANT 3,728.01 

STAFF ASST-SOB ON INVEST 6 REV 4,355.52 

STAFF ASSISTANT 3,800.10 

INVEST SOECOHH INV 6 REV 7,997.76 

STAFF ASSISTANT 4,218.09 

ASSOCIATE COONSEL 9,900.00 

MINORITY STAFF ASSISTANT 8,633.61 



186 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



COHHITTEE ON PUBLIC WORKS AND TRANSPORTATION -CONTINUED 



PAUL, ROBERT H 
PEYTON, ALISE P 
PFLANZ, HENRY S 
PRISK, CHARLES W 
PROLHAN, ROBERT S 
RAINEY, COLLEEN E 
RASZICK,ANNADELE 
REIDA, LARRY T 
RICHARDS, PAMELA JANE 
RINZLER, KENNETH L 
RIVARD, LLOYD A 
SCHENENDORF, JACK L 

SCHOLZ, NICHOLAS E 
SCHWARTZ, CARL H. , JR. 
SCOTT, JAMES E,JR 
SIMPSON, MARVIN B,III 
SPENCE, ROBERT F 
STEIN, TOBY J 
STONE, PATRICIA H 

STRATTON,JOHN N 
SULLIVAN .RICHARD J. 
TALBEBT, LANELLE D 
TONTI,SHERWIN 
TOOHEY, MICHAEL J 
TYLER, ERROL L 
VALENTINE, SUSAN DENISE 
VITALI, NANCY 

WEINSTEIN.KAY ANNE 
WHAN, STEVEN K 
WOOD, GORDON E 
WOODLE, CLYDE E,JR 
WYNNYK.OLGA 
YATES, PAUL R S 
YOUMANS,ERLA S 
ZIEGLER, CHARLES, C 



PROFESSIONAL STAFF HBB-EN 6 EC $10,500.00 

MINOFITY STAFF ASSISTANT 3,937.141 

MIN PROF STAFF HBR-SUB AVIATN 8,250.00 

STAFF ENG-SUBCOHM INV 6 REVIEW 1,732.83 

PROFESSIONAL STAFF MEMBER (P) 6,683.76 

MINORITY STAFF ASSISTANT 2,699.37 

MINORITY STAFF ASSISTANT 3,406.98 

MINORITY COUNSEL 11,250.00 

MINORITY STAFF ASSISTANT 5,703.96 

STAFF ASSISTANT, TO SEP 2 1,446.67 

CHIEF ENGINEER (P) 10,500.00 

PROFESSIONAL STAFF, TO JUL 31 

ASSISTANT MINORITY COUNSEL (P) , FROM AUG 1 ... 7,078.18 

STAFF ASSISTANT 3,406.98 

PROFESSIONAL STAFF MEMBER 976.92 

PRO STAFF MEMBER-BUDGET (P) 10,500,00 

PROF STAFF HBR-SUBCM INV & REV 6,683.76 

STAFF ASSISTANT 6,145.59 

STAFF ASSISTANT 3,406.98 

MINORITY STAFF ASSISTANT, TO AUG 31 

MINORITY STAFF ASSISTANT, FROM SEP 5 5,613.09 

MINORITY INVESTIGATOR-INV 6 RE 5,000.01 

CHIEF CCUNSEL (P) 11,250.00 

STAFF ASSISTANT 3,624.99 

STAFF ASSISTANT, TO AUG 31 1,400.00 

MINORITY PRO STAFF MEMBER 6,249.99 

ASSOCIATE COUNSEL ( P) , 9,900.00 

STAFF ASSISTANT 3,156.96 

CLERK SUECOHM BLDGS £ GROUNDS, TO JUL 31 

CLERK, FROM AUG 1 , 6,023.76 

MINORITY STAFF ASSISTANT, TO JUL 22 886.11 

STAFF ASSISTANT, TO SEP 2 1,446.67 

ASSISTANT MINORITY COUNSEL 10,625.01 

TRANSPORTATION ENGINEER (P) 7,500.00 

STAFF ASSISTANT 2,049.99 

MIN STAFF CIR SUBCOM 6 INVBEV 10,250.01 

MIN EXEC STAFF ASSISTANT (C) 7,312.50 

MINORITY PROF STAFF MEMBER (P) 6,225.71 



COHHITTEE CN RULES 

BALLEHGER, DOROTHY 

BATES, RICHARD H 
BATTLE .CYNTHIA L 
COLLINS, PHILIP R 
CROSBY, WILLIAM D,JR 
CROSS, JEAN H 

CULLEN.JONNA LYNNE 
DEAN.TREVIA A 
DOOLING,JOHN J 
DOWNS, SHIRLEY ANN 
GAMMON, NANNETTE 
GLEASON, DONNA SISS 
GWINN, HANSEL BRUCE 
HYNES, MICHAEL H 
KELLY, MAURA P 
LAMBLE, JAMES E 
LASSES, AMELIA T 
LENNON, PETER DEAN 
MAULDIN,BERLON MICHAEL 
MOORE, CLAUDIA G 
PETTUS.DREW D 
REGETS.J STEPHEN 
TYSON, PATTI BIRGE 
WAINWRIGHT, MICHAEL H 
WATTS, WINIFRED L 
WEAVER, LINDA L 
WILLKOMM,LAVERNE S 
NOLFENSBERGER, DONALD 



SECRETARY (C) , TO SEP 12 

STAFF ASSISTANT (C) , FROM SEP 13 5,571.30 

STAFF ASSISTANT (C) 5,063.28 

CLERK (C) , TO SEP 16 1,991.78 

CHIEF COUNSEL 6 STAFF DIHEC(P) 11,091.66 

MINORITY COUNSEL (P) 8,967.84 

SECRETARY (C) , TO JUL 31 

RESEARCH ASSISTANT (C) , PROM AUG 1 3,500.00 

ASSISTANT MINORITY COUNSEL (P) 6,905.64 

RESEARCH ASSISTANT (P) 6,900.00 

STAFF ASSISTANT (P) 6,533.34 

RESEARCH ASSISTANT (P) 6,750.00 

RESEARCH ASSISTANT (C) 4,599.99 

RESEARCH ASSISTANT (P) 6,900.00 

PROFESSIONAL STAFF (P) , FROM SEP 1 1,708.33 

MINORITY STAFF ASSISTANT (P) 6,249.99 

LEGISLATIVE ASSISTANT (P) 6,249.99 

RESEARCH ASSISTANT (C) 3,750.00 

RESEARCH ASSISTANT (C) , TO JUL 15 950.66 

RESEARCE ASSISTANT (P) , TO AUG 15 2,406.25 

MINORITY PROF STAFF ASST 6,249.99 

STAFF ASSISTANT (C) 5,750.00 

RESEARCH ASSISTANT (P) 6,500.01 

RESEARCH ASSISTANT (C) 4,500.00 

RESEARCH ASSISTANT (C) 6,900.00 

ASSISTANT COUNSEL (P) 6,249.99 

STAFF ASSISTANT (P) 7,500.00 

MINORITY STAFF ASSISTANT (C) 4,265.28 

MINORITY STAFF ASSISTANT (C) , TO JUL 18 1,125.00 

RESEARCH ASSISTANT (P) 6,900.00 



COMMITTEE CN SCIENCE AND TECHNOLOGY 



ANDELIN,JOHN P,JR 
APPLEGATE, APRIL V 
BABNETT, BONNIE EUGENE 



SCIENCE CONSULTANT (P) 

SECRETARY 

SECRETARY 



9,875.01 
3,399.99 
3,416.67 



187 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

COMMITTEE ON SCIENCE AND TECHNOLOGY -CONTINUED 



BLY,HARY S 
BOGLE,SARA B 
BOSBELL.TERESE H 
BRACKEN, DARCIA D 
BRADLEY, HELINDA A 
BRANSCOHE,DARRELL R 
BURLEY.CARRYE FAYE 
BYERLY, RADFORD, JB 
CAPELL, ROBBIE ANN 
CARTER, CYNTHIA SUE 
CARTEP,BILLIAH GARRETT 
CASEY, F ROBERTA 
CASSIDY, DANIEL E 
CLABSON, CAROL A 
CLEMENT, DAVID D 
CLEMENTS, JOHN G 
COX.ROYLA MARIE 
CRAWFORD, CAROLYN 
CROSSFIELD,A SCOTT 
DAVIS, REGINA A 
DIVVENS.PRISCILLA LJ 
DONEGAN, KAREN L 
DUGAN.JOHN V,JR 
EATON, CHARLES H S 
FISHER, GEORGE 8 
FISHER, GERALDINE L 
FLETCHER, HELEN LEE 
FLYNN, KEVIN F 
FORD, JO-ANN 
GALLAGHER, JAHES L 
GAHFINKEL, PATRICIA GAIL 
GAY, SARAH C 
GIBSON, SUZANNE H 
GOLD STEIN, ROBERT 
GOULD, HAROLD A 
HAMMILL, FRANK R.JR 
HINTON, LLOYD V 
HOGUE,RUTH G 
HOLMFELD,JOHN D 
HOSKINS, ALEXIS J 
HOWARD, HARY BEVERLY 
JEFFERY, DAVID S 
JENKS, GERALD E 
KETCHAH, ROBERT C 
KEZAR, CHARLES A 
KRAMER, THOMAS R 
KREBS-LEI DECKER, MARTH A 
LANES, STEPHEN J 
LEEDY, DANIEL B 
LITTLE .JULIA 
LOCKETT, TIMOTHY 
LOFLIN, LESLIE 
HOSHEB, CHARLES A 
HURRAY, ALBERT E 
NYBOP,KIHSTEN A. 
ORLEANS, DAVID B 
PESYNA,GAIL H 
POLLACK, CATHERINE JEAN 
POHPLIANO, CAROL JOYCE 
PRETORIUS,THOBAS H 
READ, RALPH N 
RODGERS, CAROL F 
ROODZANT, SHERMAN E 
SCHBARTZ, PATRICIA S 
SCOVILLE, ANTHONY 
SEEFELDT, BONNIE LEE 
SHACKNAI, JONAH 
SIHLEB, GEORGE B,JR 
SMITH, NANCY J 
SPENSLEY, JAHES B 
STAUB,H GERALD 
SUPERATA.HICHAEL A 
SBANSON, GERALD 
SBIGERT,JOHN L,JB 
TATE, THOMAS N 
TAYLOR, ANTHONY C 
TEEPLES, PAULA H 
TESSIEBI, VIVIAN A 
TRIPPETT, LILLIAN HCBEE 
TURNER, JAMES H,JR 
VANDER HYDE, PAUL A 



SECRETARY (C) S 4, 550. 01 

RECEPTIONIST, TO SEP 29 2,892.50 

SECRETARY 3,249.99 

SCIENCE CONSULTANT 6,375.00 

ADMINISTRATIVE CLERK 3,125.01 

TECHNICAL CONSULTANT (P) 6,999.99 

RECEPTIONIST 2,541.67 

SCIENCE CONSULTANT (P) 9,266.67 

SECRETARY, FROM SEP 26 145.83 

SECRETARY, TO AUG 3 1,100.00 

PUBLICATIONS CLEBK (C) 3,924.99 

MINORITY SECRETARY 4,250.01 

COUNSEL 8,649.99 

COMMUNICATIONS SPECIALIST 7,475.01 

TECHNICAL CONSULTANT 6,249.99 

RESEARCH ASSISTANT, FROM AUG 1 2,616.66 

RESEARCH CLERK, TO AUG 12 980.00 

SECRETARY 3,750.00 

TECHNICAL CONSULTANT 9,000.00 

CHIEF CLERK (C) 5,499.99 

SECRETARY 3,000.00 

SECRETARY, FROM JUL 18 2,433.33 

SCIENCE CONSULTANT (P) 9,400.01 

TECHNICAI CONSULTANT 3,999.99 

SPECIAL ASSISTANT TO CHAIRMAN 3,301.91 

SECRETARY (C) 3,500.01 

EXECUTIVE SECRETARY (C) 5,075.01 

RESEARCH CLEBK, FBOM JUL 18 TO AUG 5 390.00 

RESEABCH CLERK, TO AUG 19 1,143.33 

TECHNICAL CONSULTANT . . .' 6,900.00 

BRITER/F.DITOR 4,166.67 

SECRETARY (C) , TO SEP 9 2,913.34 

SECRETARY 3,800.01 

RESEARCH CLERK, TO JUL 11 238.33 

DEPUTY DIRECTOR (P) 10,824.99 

COUNSEL (P) 10,250.01 

TECHNICAL CONSULTANT 6,875.01 

SECBETARY (C) 3,800.01 

SCIENCE CONSULTANT (P) 8,700.00 

TECHNICAL CONSULTANT 3,500.01 

FINANCE CLERK (C) 3,800.01 

HINOEITY COUNSEL 6,125.01 

TECHNICAL CONSULTANT 6,125.01 

CCUNSEL (P) 10,500.00 

TECHNICAL CONSULTANT 8,124.99 

SCIENCE CONSULTANT 7,125.00 

TECHNICAL CONSULTANT 6,375.00 

TECHNICAL CONSULTANT, FROM AUG 1 6,300.00 

RESEARCH CLERK, FROM AUG 1 TO AUG 31 650.00 

RESEABCH CLERK, FROM JUL 11 TO AUG 16 780.00 

CLERK 1,850.01 

RESEARCB CLERK 3,000.00 

EXECUTIVE DIRECTOR (P) , FROM SEP 1 2,718.67 

SCIENCE CONSULTANT, FROM JUL 11 6,666.67 

BESEARCB ASSISTANT, FROM JUL 21 2,916.67 

RESEARCH CLERK, FROM JUL 5 TO AUG 20 996.66 

SCIENCE CONSULTANT .' 6,375.00 

RESEARCB CLEBK, FBOM JUL 18 TO AUG 12 583.33 

SECRETARY (C) 3,800.01 

TECHNICAL CONSULTANT, TO AUG 27 5,985.00 

TECHNICAL CONSULTANT (P) 10,500.00 

SECRETARY (C) 5,250.00 

TECHNICAL CONSULTANT 6,999.99 

SECRETARY 2,565.00 

TECHNICAL CONSULTANT, PROM SEP 21 611.11 

RESEARCH CLERK 4,291.66 

RESEARCH ASSISTANT 3,000.00 

CLERK, TO JUL 21 700.00 

SECRETARY 3,750.00 

COUNSEL (P) 9,708.33 

CCUNSEL (P) 6,375.00 

HINOEITY COUNSEL (P) , TO AUG 31 5,250.00 

SCIENCE CONSULTANT, FBOM JUL 11 5,555.55 

EXECUTIVE DIBECTOR (P) , TO AUG 31 7,250.00 

COUNSEL (P) 9,050.01 

TECHNICAL CONSULTANT 6,999.99 

ASST FINANCE CLERK 3,125.01 

MINORITY SECRETARY, FROM JUL 5 3,463.88 

LEGISLATIVE CLEBK (C) 3,375.00 

CCUNSEL 6,249.99 

HINOEITY STAFF DIBECTOB, FBOM AUG 15 5,750.00 



188 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



COMMITTEE ON SCIENCE AND TECHNOLOGY -CONTINUED 



BADSBOHTH, JEFFREY C 
WALLACE, A LEE, III 

WEINBLATT, BARBARA 
WELLS, WILLIAM G,JB 
WILLIAMS, R E 
BILSON, JANES E,JR 
WITZEL, MARGARET J 
TEAGER, PHILIP B 



RESEARCH CLERK, FROM JUL 5 TO ADG 31 S 1,306.67 

MINORITY COUNSEL, TO AUG 31 

CCUNSEL, FROM SEP 1 6,500.01 

RESEARCH ASSISTANT 3,683.31 

TECHNICAL CONSULTANT (P) 10,500.00 

TECHNICAL CONSULTANT (P) , 8,000.01 

TECHNICAL CONSULTANT (P) 10.7U9.99 

SECRETARY 3,575.01 

CCUNSEL (P) 10,749.99 



COMMITTEE ON SHALL BUSINESS 

ARONSON, HAROLD L,JB 
BACHHAN, KATHRYN M 
BAUERNFE I ND, GEORGE 
BUFPALINI, EILEEN A. 
CHANDLER, LEE ADDISON 
CINGEL, ELIZABETH B 
DAVIDSON, KENNETH H 
FOUTCH, MYRTLE HUTH 
FRANCISCO, DOUGLAS L 
GRAHAM, LYNN LORRAINE 
GRANT, GEORGE MCINVALE.JR 
HAYES, GORDON HALL,JR 
HICKS, LUCILLE C 
JENSEN, JERROLD S 
KNOTT, SHARON A 
KOERBER, TERESA H 
LAYNE, BERNARD 
LIBERTY, IRENE LOIS 
LYNCH, STEPHEN P 

MACINTYRE, MILES EYERETTE 
(1AGUIBE, FRANCES M 
HCLANE, BETTY L 
METZGER, DAVID 
BOLL, GEORGE E 
MORRISSEY,JAHES F 
NEIDICH, GEORGE A 
NEUMANN, EDWARD JCHN 
0'BEIRNE,JOHN B 
O'BRIEN, DONALD E 
PARKER, LINDA 
PARRISH, EMILIA E 
PHALEN, JANES 8. 
POBERS, THOMAS G 
RANDELS, GEORGE D 
RABLS,BILLA C 
SCOTT, PAMELA 
SHANNON, PATRICIA J 
SHUE,KENNA M 
SMITH, KEVIN H 
STEWART, ELMIRA R 
TAYLOR, LINDA K 
TOPPING, MARVIN B 
TRIMBOLI, THOMAS A 
BARD, MICHAEL JAMES 
BATSON, DONNA H 
BITTIG, RAYMOND S 
BULTICH, NICHOLAS 



SUBCOMMITTEE COUNSEL-MINORITY 

SECRETARY, FROM AUG 15 

TAX ANALYST (P) 

SECRETARY (C) , TO AUG 13 

SECRET ARY-HINORITY 

SECRETARY 

STAFF ASSISTANT (C) 

OFFICE MANAGER (C) 

MINORITY STAFF MEMBER 

SECRETARY, FROM AUG 1 

CCUNSEL (P) 

PROFESSIONAL STAFF MEMBER, TO JUL 31 

COMPUTER SPECIALIST 

SUECCHMITTEE COUNSEL-MINORITY 

SECRETARY, FROM SEP 6 

SECRETARY 

STAFF DIRECTOR (P) 

PUBLICATIONS SPECIALIST 

PROFESSIONAL STAFF MEMBER, TO SEP 8 

PROFESSIONAL STAFF MEMBER, FROM SEP 11 

SUBCOMMITTEE COUNSEL 

SECRETARY-MINORITY, FROM SEP 1 

SECRETARY, FROM SEP 28 

SUBCOMMITTEE COUNSEL 

INVESTIGATOR ( P) , TO SEP 25 

INVESTIGATOR, FROM SEP 6 

SUBCOMMITTEE COUNSEL, FROM AUG 13 

ASSISTANT MINORITY COUNSEL (P) 

INVESTIGATOR, FROM SEP 7 

SPECIAL CCUNSEL, FROM AUG 1 

SECRETARY 

SECRETARY 

MINORITY COUNSEL (P) 

GENERAL COUNSEL (P) 

SUBCOMMITTEE COUNSEL, FROM AUG 1 TO AUG 12 

MINORITY SECRETARY (C) 

MINORITY CLERK 

SECRETARY (C) 

SECRETARY, TO AUG 31 

STAFF ASSISTANT, TO AUG 31 

MINORITY SECRETARY 

SECRETARY, TO AUG 31 

MINORITY STAFF MEMBER 

SUECCHMITTEE COUNSEL 

SUBCOMMITTEE COUNSEL 

SECRETARY (C) 

SUBCOMMITTEE COUNSEL-MINORITY 

INVESTIGATOR, FROM SEP 12 



199.99 
341.67 
750.00 
505.00 
887.50 
150.00 
018.75 
900.00 
890.64 
150.00 
000.00 
968.75 
200.00 
000.00 
798.61 
125.01 
900.00 
775.00 

375.00 
249.99 
000.00 
87.5 
875.01 
350.00 
415.28 
333.33 
250.00 
647.47 
500.00 
000.00 
937.50 
450.00 
900.00 
187.50 
875.01 
000.00 
650.01 
583.34 
600.00 
275.01 
916.67 
750.01 
250.00 
875.01 
331.25 
425.00 
302.34 



COMMITTEE ON STANDARDS OF OFFICIAL CONDUCT 



ARBOGAST, WILLIAM P 
BAILEY, KARREN ANN 
BELKIN, DAVID H 
BERMINGHAM, ROBERT A 
BDCKNAM, ROBERT B 
DESMOND, JOHN H 
EBING, THOMAS M 
FOPTUIN, THOMAS H 
FRANCIS, SHARON A 
GOSSETT, HAROLD B 

GOVE, ELENA JANE 
HALTIBANGER, JAMES NANCE 
HARRIS, JEFFREY 



ASSISTANT STAFF DIRECTOR (P) 8,967.84 

SECRETARY (C) 3,125.01 

PROFESSIONAL STAFF MEMBER (P) 9,000.00 

PROFESSIONAL STAFF MEMBER (P) 5,321.75 

PRCFESSIONAL STAFF MEMBER (P) 5,000.00 

PROFESSIONAL STAFF MEMBER (P) 7,083.34 

CLERK (C) , FROM JUL 5 2,508.33 

PROFESSIONAL STAFF MEMBER (P) 7,749.99 

SECRETARY (C) , FROM AUG 15 1,469.44 

PRCFESSIONAL STAFF MEMBER (P) , TO AUG 31 

INVESTIGATOR, FROM SEP 1 7,250.01 

SECRETARY (C) 3,375.00 

PRCFESSIONAL STAFF MEMBER (P) 6,249.99 

PROFESSIONAL STAFF MEMBER (P) , 9,912.51 



189 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

COHHITTEE ON STANDARDS OF OFFICIAL CONDUCT -CONTINUED 

HOLMES, CHEBYL PROFESSIONAL STAFF HEHBEB (P) , FROH SEP 26 .... $ 307.22 

JAFFB,JAY II ASST TO TEE STAFF DIRECTOR (P) 7,768.80 

LONG, PATRICIA ANN ASSISTANT CLERK (C) , TO JUL 31 

SECRETART (C) , FROH AUG 1 2,875.00 

LOUGHRY.JAN SECRETARY (C) 5,659.13 

HULLIN, JUDITH A SECRETARY (C) , FROH ADG 15 1,597.23 

HDHPHY, PEGGY SECRETARY (C) 3,931.14 

NEHEC,JOHN GEORGE, JB PROFESSIONAL STAFF HEHBER (P) , FROH AUG 22 .... 2,037.50 

NIELDS.JOHN f,JB PROFESSIONAL STAFF HEHBER (P) 11,375.01 

OTIS, NANCY B ASSISTANT CLERK (C) , TO JUL 31 

SECRETARY (C) , FROHADG 1 2,880.58 

OXFORD, BILLIAH C PROFESSIONAL STAFF HEHBER (P) , TO SEP 25 0,072.23 

PAVELIC, STEPHANIE B SECRETARY (C) 0,125.00 

RENZI, PATRICK B STENOGRAPHER (C) , TO JUL 22 611.11 

ROBAN, BARBARA ANN PROFESSIONAL STAFF HEHBEB (P) , TO JUL 19 

PROFESSIONAL STAFF HEHBER (P) , JUL 28 - AUG 31 

COUNSEL, FROH SEP 1 8,769.13 

SHIIH.DBIGHT C,III CLERK (C) , FROH JUL 25 2,600.00 

STEINFELDT.GAIL C SECRETARY (C) , TO AUG 31 

SECRETARY, FROH SEP 1 3,399.99 

SBANNBR,JOHN H STAFF DIRECTOR (P) 12,500.01 

TALLEY,HARTHA PROFESSIONAL STAFF HEHBER (P) , TO AUG 31 

COUNSEL, FROH SEP 1 7,370.99 

TAIL, CHRISTOPHER L PROFESSIONAL STAFF HEHBER (P) 7,750.00 

BHALEH, ANDRES J, III PROFESSIONAL STAFF HEHBER (P) , TO AUG 15 3,125.00 

WHITE, SAONDBA J SECBETABY, FROH AUG 23 1,U77.78 

WISEBBAH, STEVEN E PROFESSIONAL STAFF HEHBER (P) 0,916.66 

COHHITTEE ON TETEBANS AFFAIRS 



BURNETT, AUDREY ARLENE 
CASTEEL, RALPH T 
DANIEL, BARBARA PRICE 
DISTEFANO, ANTHONY J 
DONOHUE, PATRICIA J 
ELD, BEATRICE ANN 

FLEHING, HACK G 
FORREST, ALBERTA SUE 
GILLIAH, VANCE L 
GOTTSCHALK, ARTHUR H 

GRAVES, CANDIS LEE 
H0LD2N,J0HN B 
KAUF HAN, BERNARD 
KIDD,HARJORIE J 
KIRKHAN, HELEN 8 
KITE, REBECCA J 
KNCRR, DEBORAH R 
LUNSFORD, ELIZABETH D 
HATTHEBS, ALICE V 
BOON, BILLIAH A 
PARKINSON, CHARLES B 
PORTER, BETTYE 
ROYCE, GLORIA L 
RUTH, JILL T 
SHOWS, B JOANNE 
SIEGBIST, ROBERT R 
SHITH, RONALD E 
SROKA, PETER S 
STONE, RICHARD JAHES 
STOVEB, FRANCIS H 
TOBNSEND, LOUIS A 
HAITE,HARGARET D 
WEBB, JAHES H,JB 
WILLIS, A H,JB 



ADHINISTBATIVE ASSISTANT (C) 0,709.99 

PBCFESSIOHAL STAFF HEHBER (P) 0,850.76 

CHIEF CLERK (C) 0,599.99 

COUNSEL . 6,209.99 

EXICUTIVI SECRETARY <C) 3,931.10 

CLERK-STENOGRAPHER, TO JUL 31 

STAFF ASSISTANT, FROH AUG 1 3,375.01 

COUNSEL (P) 11,150.01 

CLERK-STENOGRAPHER (C) 3,852.51 

BILL CLERK 3,375.00 

PROFESSIONAL AIDE (P) , TO JUL 31 

PROFESSIONAL STAFF HEHBER (P) , FROH AUG 1 .... 8,832.90 

STAFF ASSISTANT (C) 3,875.01 

BIN STAFF DIRECTOR 6 COUNSEL 11,150.01 

PROFESSIONAL STAFF HEHBER (P) , TO AUG 31 3,218.66 

STAFF ASSISTANT (C) 5,000.01 

CLERICAL AIDE (C) 7,017.93 

STAFF ASSISTANT 3,620.99 

CLERK-STENOGRAPHEB (C) 2,995.70 

COUNSEL-SUBCOH ON HOUSING 5,571.30 

CLFBK-STENOGBAPHER 2,200.11 

COUNSEL (P) 9,573.20 

HINOBITT COUNSEL-HOUSING SUBCOH 0,500.00 

CLIBK-STENOGBAPHEB, TO AUG 31 1,250.00 

STAPF ASSISTANT (C) 3,620.99 

ASSISTANT CLERK (C) 3,875.01 

CLERK-STENOGRAPHER, FROH SEP 1 750.00 

PROFESSIONAL AIDE (P) 8,098.70 

BIN CODNSIL-CEHETABIES SUBCOHH, TO AUG 31 3,078.20 

HINORITY COUNSEL 5,000.01 

CLEBK 2,882.82 

DEPUTY CCDBSEL 11,150.01 

COUNSEL (P) 3,100.08 

CLEBK-STENOGRAPHER (C) 3,000.00 

ASSISTANT HINORITY COUNSEL (P) 6,001.66 

STAFF DIRECTOR (P) 11,000.00 



COHHITTEE CN BAYS AND HEANS 

ALBERGER, BILLIAH B 
ARCHIBALD, JEANNE S 
ARNER, FREDERICK B 
ASKEY,THELHA JANE 
AUSTER,PADL H 
BAKER, JOHN PATRICK 
BAKER, HABEL COLLIER 
BAXTER, ANN E 



PROFESSIONAL ASSISTANT 8,250.00 

STAFF ASSISTANT 3,000.00 

PROFESSIONAL ASSISTANT (P) 11,870.99 

STAFF ASSISTANT (C) 0,500.00 

PROFESSIONAL ASSISTANT (P) 9,750.00 

PROFESSIONAL ASSISTANT (P) 11,870.99 

STAFF ASSISTANT 0,857.10 

STAFF ASSISTANT 3,577.32 



190 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

COMMITTEE ON WATS AND MEANS -CONTINUED 



BERNSTEIN, KENNETH 8 
BLOUIN, SUZANNE H 
BLOYEE, GLORIA J 
BLUMEL, MILDRED SUE 
BOWLER, H KENNETH 
BREDE, MABGARETTA W 
BRISENDINE.EHILY 
BUFKETT,FLORENCE U 
CALHOUN, MICHAEL J 
CARPENTER, CYNTHIA J 
CHRISSOS, LOUISE J 
COLHER, CONNIE SUE 
CORBIN, SYLVIA A 
COSTELLO, JAMES R,JH 
COX,LOREN CHARLES 
CZADOWSKI, EDWARD W 
DINSE, NANCY HELEN 
DUNBAR, GLORIA JEAN 
FLETCHER, VIRGINIA C 
FRANZ, WENDY LEIGH 
FRY, BARBARA ANN 
GOMLAK,MARCIA MCQUILLEN 
GORDON, ALICE B 
GRANGER, JULIAN P 
GREALY,NAHY R 
GREENE, HUGHLON 
HALL, JOSEPH W. ,JB. 
HARTLEY, PAMELA B 
HARVEY, PERCY H 
HAWLEY, JONATHAN P. 
HILL, CAROL D 
HILL, ROBERT B 
HUGHES, SHARON LYNN 
HYTNER.ERWIN 
JAFFE, JAMES M 
JENSEN, ALLEN C 
KAGAN, GRACE G 
KELLEY, JAMES W 
KREUTTER.CLYDIS H 
LAMAR, HAROLD T 
LAWLER, HARRIETT ANN 
LEHNHARD,HARY NELL 
LENNON,HAHY PAT 
LEONARD, ROBERT J 
LEW, LINDSAY HAROLD 
LITTLE, WALTEB B 
MALONE, EUGENE J 
MARTIN, JOHN M,JR 
MAYO, ROBIN 
MAYS, JANICE 
MCCLINTOCK, JANIS KAY 
MCGETTRICK, CAROLE H.V. 
MCQUINN,MYRA JO 
MEAGHER, JOHN K 
MOSELEY,NORAH H 
OCONNOH,MARY LOU 
PARNELL, ARCHIE W,JR 
PECARICH, PAMELA J 
PHILLIPS, MARTHA H 
PIES, HARVEY E 
POWELL, MARSHA 
PRIMUS, WENDELL E 
PRIOLEAU, FLORENCE 
RAST, CAROLYN 
RATLIFF, VIVIAN JEAN 
RETTIG.PAUL C 
RIORDAN,JOHN D 
ROHB, DAVID B 
ROSS, LAWRENCE J 
ROTHENBERG,ALAN 
ROME, LOU ANN 
RUHOWICZ,MARY E 
SALMON, JOHN J 
SAHOLIS.FBANK R 
SCOTT, CAROL D 
SENGER, LINDA GREY 
SHALETT, NANCY A 
SHAVER, GLORIA 
SHERMAN, JOHN 
SINGLETON, ARTHUR L,JR 
SKRABUT,HARJOBIE F 



PBCFESSIONAL ASSISTANT $ 5 

PBCFESSIONAL ASSISTANT 5 

STAFF ASSISTANT 3 

STAFF ASSISTANT 3 

PBCFESSIONAL ASSISTANT (P) 11 

PBOFESSIONAL ASSISTANT 3 

STAFF ASSISTANT 3 

STAFF ASSISTANT (C) 6 

STAFF ASSISTANT 8 

PBCFESSIONAL ASSISTANT, TO SEP 15 3 

STAFF ASSISTANT (C) 5 

STAFF ASSISTANT 3 

STAFF ASSISTANT 3 

PBOFESSIONAL ASSISTANT 7 

PROFESSIONAL ASSISTANT (P) 10 

PROFESSIONAL ASSISTANT 7 

STAFF ASSISTANT 3 

STAFF ASSISTANT 2 

STAFF ASSISTANT 7 

STAFF ASSISTANT, TO SEP 21 1 

STAFF ASSISTANT (C) , TO JUL 5 

STAFF ASSISTANT 3 

STAFF ASSISTANT 2 

PBOFESSIONAL ASSISTANT 8 

STAFF ASSISTANT, TO AUG 31 2 

STAFF ASSISTANT (C) 7 

STAFF ASSISTANT 5 

STAFF ASSISTANT 3 

PBOFESSICNAL ASSISTANT 8 

PROFESSIONAL ASSISTANT 10 

STAFF ASSISTANT, TO AUG 19 

PBOFESSIONAL ASSISTANT (P) 9 

STAFF ASSISTANT 3 

PBCFESSIONAL ASSISTANT 11 

PROFESSIONAL ASSISTANT 7 

PBOFESSIONAL ASSISTANT (P) 9 

STAFF ASSISTANT (C) 7 

PROFESSIONAL ASSISTANT (P) 11 

STAFF ASSISTANT 3 

PROFESSIONAL ASSISTANT (P) 11 

STAFF ASSISTANT 3 

STAFF ASSISTANT 6 

STAFF ASSISTANT., TO AUG 31 1 

PROFESSIONAL ASSISTANT (P) 9 

STAFF ASSISTANT, TO AUG 9 

STAFF ASSISTANT (C) 7 

PBOFESSIONAL ASSISTANT (P) 9 

CHIEF COUNSEL (P) 5 

STAFF ASSISTANT 3 

PBOFESSIONAL ASSISTANT 5 

STAFF ASSISTANT 3 

STAFF ASSISTANT (C) 5 

PBCFESSIONAL ASSISTANT 5 

PBOF STAFF-MINOBITY COUNSEL (P) 12 

PBOFESSIONAL ASSISTANT 3 

STAFF ASSISTANT (C) 3 

PROFESSIONAL ASSISTANT 6 

9 

PBOFESSIONAL ASSISTANT 9 

STAFF ASSISTANT 9 

STAFF ASSISTANT 3 

PBOFESSIONAL ASSISTANT, FROM SEP 19 1 

STAFF ASSISTANT « 

STAFF ASSISTANT 2 

STAFF ASSISTANT (C) U 

PBCFESSIONAL ASSISTANT (P) 11 

PBOFESSIONAL ASSISTANT « 

PROFESSIONAL ASSISTANT 11 

PRCFFSSIONAL ASSISTANT 9 

PROFESSIONAL ASSISTANT 11 

STAFF ASSISTANT 3 

STAFF ASSISTANT, TO AUG 31 1 

PROFESSIONAL ASSISTANT 9 

PBOFESSIONAL ASSISTANT » 

PBOFESSIONAL ASSISTANT, FROM SEP 7 2 

STAFF ASSISTANT U 

STAFF ASSISTANT, FROM SEP 12 

STAFF ASSISTANT (C) 7 

PROFESSIONAL ASSISTANT (P) 10 

PRCFESSICNAL ASSISTANT (P) 11 

STAFF ASSISTANT , 3 



191 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



COMMITTEE ON BAYS AND BEANS -CONTINUED 



SMITH, CARL EDWARD 
SPEARS, VICKI E 
STANZIONB, JANET E 
STEIN, ART HUH, III 
STENSON, KATHLEEN HELSEL 
STOKES, THOMAS A 
SULLIVAN, ANNE E 
SOPERATA, MICHAEL A 
VAUGHAN.BILLIAH K.JR 
MASSES, SARA J 
BEGENER, STUART S 
BIGNOT.HABY JANE 
BINCEK.NARX D 
BOODBOBTH, MELISSA M 
BRIGHT, MAUREEN A 



STAFF ASSISTANT, TO AUG 31 $ 1,500.00 

STAFF ASSISTANT 3,000.00 

STAFF ASSISTANT 3,262.50 

PROFESSIONAL ASSISTANT 5,750.01 

STAFF ASSISTANT, FROM SEP 21 305.56 

STAFF ASSISTANT, TO AUG 26 933.33 

PROFESSIONAL ASSISTANT 4,749.99 

STAFF ASSISTANT, FROM SEP 1 3,166.67 

PRCFFSSICNAL ASSISTANT 9,750.00 

STAFF ASSISTANT, FROM JUL 9 2,915.56 

STAFF ASSISTANT 2,241.66 

STAFF ASSISTANT 9,750.00 

STAFF ASSISTANT 3,958.33 

STAFF ASSISTANT, TO AUG 19 816.67 

STAFF ASSISTANT 4,127.67 



SELECT COMMITTEE ON AGING 

AHERN, ELLEN 
ANTHONY, CLEMENTINE 
APONTE.MASISOL 
BARCZAK, MARGARET J 
BLANCA TO, ROBERT B 
BRACKNELL, H LOUISE 
BBENNAN, JAMES A 
BRETSCH,ROBETTA ANN 
CAIRO, RICHARD J 
CONTREBAS, JOSEPH L 
CO RT HELL, KIM 
COVALL,HARK J 
CUNNINGHAM, MARIE H 
EDBARDS, HAZEL K 
GAGION.LEO V 
GARDNER, KATHLEEN T 
GARZA, JOSE S 
HAMILTON, MAUREEN B 
HILTON, CYNTHIA 
HOBBS, NANCY ELLEN 
HOLTON, DAVID L 
HOBARD,EDBARD F 
JACOBS, TRUDY E 
JAMIESON, KATHLEEN 
JIMEBSON,GAIL P. 
LABRENCE, PATRICIA 
MCCLAIN, LYLE 

MCDONALD, THOMAS FLETCHER 
MCDONNELL, MARY CLAIRE 
HURPHY, CHRISTINE 
MURRAY, MICHAEL B 
PENCE, E D,III 
POLLAK, MELISSA FAY 
REDDING, ANNE R 
BEIMEB.JODAH JOSEF 
RENNER, VALERIE A 
ROLLINS, AUDREY L 
BOTH,LOBBEN V 
RUCCHIO, ROSEMARY 
SCHEFMER,BETH 
SHEEHAN, KATHLEEN ANN 
SMYTHE, NANCY C 
STES ART, RITA 
STUART, ELIZABETH B 
TISCHLER.JOHN F 
WEINEB, ROBERT S 
WHEELER, KATHRYN A 



RESEARCH ASSISTANT, TO AUG 15 

SECBETABY 

SECRETARY-MAJORITY 

SECRETARY, TO AUG 1 

MAJORITY STAFF DIRECTOR 

MAJORITY STAFF DIRECTOR 

ASSISTANT TO CHAIRMAN 

MINORITY STAFF DIBECTOB 

BESEABCH ASSISTANT, TO AUG 10 

RESEARCH ASSISTANT, TO AUG 29 

RESEARCH ASSISTANT., TO JUL 25 

RESEARCH ASSISTANT 

EXECUTIVE SECRETARY 

SECRETARY-MAJORITY 

RESEARCH ASSISTANT, TO JUL 31 

BESEABCH ASSISTANT 

MAJOBITY STAFF DIRECTOR 

SECRETARY (FULL COMMITTEE) , FBOM AUG 22 

MINORITY STAFF DIRECTOR ,.. 

HINOBITY STAFF DIRECTOR SUB #1 

INVESTIGATOR 

GENERAL COUNSEL 

SECRETARY -HINOBITY 

PBCFESSIONAL STAFF ASSISTANT 

SECRETARY-MINORITY 

MINORITY STAFF DIRECTOR 

PROFESSIONAL STAFF 

MINORIIY STAFF DIBECTOR 

STAFF DIRECTOR 

BESEABCH ASSISTANT 

PBOFESSIONAL STAFF 

BESIARCH ASSISTANT, TO SEP 10 

RESEARCH ASSISTANT 

SECRETARY -MAJORITY 

BESEABCH ASSISTANT 

RESEABCH ASSISTANT, TO AUG 17 

SECBETABY 

SECBETARY, TO AUG 28 

ACCOUNTANT 

BESEABCH ASSISTANT, TO AUG 10 

RESEABCH ASSISTANT 

SECBETARY 

SECRETABY-BINOBITY 

BESEABCH ASST-MINOBITY, TO AUG 22 

PROFESSICNAL STAFF 

STAFF DIBECTOB 

SECBETABY (FULL COMMITTEE) , FBOM SEP 6 



650.00 
,249.99 
,U99.99 

947.23 
,725.01 
,999.99 
,750.01 
,750.01 

577.77 

786.67 

361.11 
,000.00 
,000.01 
,624.99 

500.00 
,000.00 
,500.00 
,083.33 
,249.99 
,717.34 
,750.01 
,000.01 
,499.99 
,500.01 
,666.66 
,000.01 
,500.00 
,575.00 
,575.00 
,000.00 
,818.75 

933.33 
,000.00 
,150.00 
,750.00 

678.89 
,127.67 
,039.38 
,000.01 

577.77 
,750.00 
,499.99 
,750.00 

751.11 
,431.41 
,750.01 

763.89 



SELECT COMMITTEE ON ASSASSINATIONS 



AKERS, JEREMY BAY 
BAETZ,CONBAD E 
BEESON.PETEB G 

BERLOB.LISA H 
BERNING, ELIZABETH I 
BLACKHEB.S JONATHAI 
BLAKEY,G BOBEBT 
BOLAND, COLLEEN T 
BROWN, CLAIRE L 



STAFF COUNSEL 5,000.01 

STAFF INVESTIGATOB, FBOM AUG 1 3,666.66 

STAFF COUNSEL, FBOB AUG 8 4,122.22 

BESEABCHEB 3,000.00 

SECBETABY 4,916.67 

STAFF COUNSEL 5,500.00 

CHIEF COUNSEL AND DIBECTOB 11,874.99 

BESEABCHEB, TO SEP 16 3,000.00 

BESEABCHEB, TO SEP 20 3,333.33 



192 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



SELECT COMMITTEE ON ASSASSINATIONS -CONTINUED 



BROWN, ELIZABETH METTS 
BROWN, WILLIAM 
BOEAS, ROBERT C,JR 
BURFORD, JUDITH E 
CHAMPION, OLIVER J 
CHAFDAK, BOSTON A 
CHENOWETH.JAHES H 
CONZELHAN.JAHES K 
COPELAND, EILEEN 

CORNWELL.GARY T 
CROSS, WILLIAH H 
COLLINGS, JEROME A 
DALY, MARTIN J 
DAY, CLARENCE J 
DELSA, LAWRENCE J 
DOYLE, KEVIN SEAN 

EAGLE, HA5JORIE A 
EBERHARDT, MICHAEL C 
ECCLES, FRANK L 
EMANUEL, CARYL H 
EVANS, EDWARD M 
FACT ER, JEFFREY 
FALLIS, STEPHEN JAMES 
FARMER, JOHN J,JB 
FENTON, CLIFFORD A,JB 

FLANAGAN, T MARK 
FONZI,GAETON J 
GAY, DONOVAN L. 
GENZMAN, ROBERT W 
GIANGBASSO.DOHINICK K 
GODFREY, JANE E 
GOLDSMITH, MICHAEL 
GONZALES, ALBERT 
GRANT, KENNETH G 
GRIMES, MARY SUSAN 
HACK, ALFRED S 
HA MILTON, GEBALD P 
HARDWAY.DAN L 
HAUSHAN.ALAN B 
HESS, JACQUELINE 
HINDLE, LOUIS H 

HOLT, LAURA MAE 

HORNBECK,JOHN W 
HOWARTH, THOMAS 
HUTTON.E MCK 
ISRAEL, MAURICE 
JACKSON, HA RGO E 
JOHNSON, ERNESTINE G 
JOHNSON, GENE R 

JOHNSON, LILLIAN B 
JOHNSTON, ALICE E 
JONES, DIANA N 
KELLY, JAMES P 
KILKER, ELIZABETH A 
KLEIN, KENNETH D 
KUHN, DOROTHY W 
LARKIN, JOYCE ANN 
LAWSON,BELFORD L.III 
LEE, SHEILA JACKSON 

LEHNER, ROBERT J 
LOCKE, RALPH C 
LOPEZ, EDWIN J 
MARS, MITCHELL A 
MARTIN, REBECCA W 
MASON,M C 
MATHEWS, ISIAH C 
MAXWELL, ALBERT 
MCPHERSON, VIVIAN L. 
MILLER, DAWNE C 
MISITA.ANNE B 
MORDANA, SARI 
MORIARTY,JOHN J 

MORRISON, ROBERT C 



STAFF ASSISTANT, FROM SEP 27 $ 144.44 

STAFF INVESTIGATOR, FROM AUG 15 3,066.67 

STAFF INVESTIGATOR, FROM AUG 15 3,066.67 

DOCUMENT CLERK 2,833.33 

CLERICAL ASSISTANT, FROM AUG 18 1,134.73 

PUBLIC INFORMATION OFFICER, TO JUL 31 2,833.33 

STAFF INVESTIGATOR, TO JUL 11 222.66 

RESEARCHER 3,533.33 

SECRETARY, TO AUG 31 

RESIARCHEB, FROM SEP 1 3,291.67 

DEPUTY CHIEF COUNSEL, FROM SEP 1 3,511.67 

ASST TO EIR OF SECURITY, FROM AUG 1 2,666.66 

STAFF INVESTIGATOR, FROM SEP 9 1,466.67 

STAFF INVESTIGATOR, FROH AUG 15 3,066.67 

STAFF INVESTIGATOR 6,000.00 

STAFF INVESTIGATOR, FROM JUL 5 5,733.33 

MESSENGER, TO JUL 31 

CLERICAL ASSISTANT, FROM AUG 1 TO AUG 16 1,172.22 

SECRETARY 3,375.00 

STAFF COUNSEL, FROH SEP 19 1,066.67 

STAFF INVESTIGATOR 6,000.00 

SECRETARY 3,237.51 

CHIEF INVESTIGATOR-KING 8,500.00 

STAFF COUNSEL LEGAL UNIT 6,416.67 

DEPUTY CHIEF COUNSEL, TO SEP 12 7,711.11 

CLERK, TC AUG 31 1,010.00 

CHIEF INVESTIGATOR-KENNEDY, TO JUL 31 

CHIEF INVESTIGATOR, FROH AUG 1 8,500.00 

RESEARCHER, FROM JUL 11 2,666.67 

STAFF INVESTIGATOR 7,500.00 

CHIEF RESEARCHER 8,500.00 

RESEARCHES, FROM AUG 29 1,600.00 

STAFF INVESTIGATOR, FROM SEP 6 1,666.67 

SECRETARY 3,833.33 

STAFF COUNSEL, FROM AUG 29 2,666.67 

STAFF INVESTIGATOR, FROH JUL 11 5,333.33 

STAFF INVESTIGATOR, FROH JUL 28 TO AUG 23 1,733.33 

RESEARCHER 5,250.00 

STAFF INVESTIGATOR, FROH SEP 6 1,666.67 

DEPUTY CHIEF RESEARCHER 6,333.34 

RESEARCHER, FROH JUL 11 2,666.67 

STAFF COUNSEL 7,333.33 

DEPUTY CHIE RESEARCHER 6,333.34 

CLERK, TO JUL 31 

SECRETARY, FROH AUG 1 3,416.67 

STAFF COUNSEL, TO JUL 31 

STAFF COUNSEL, FROH AUG 5 5,666.67 

STAFF COUNSEL, FROH SEP 19 1,133.33 

BUDGET OFFICER 8,916.66 

DEPUTY DIRECTOR 9,927.77 

STAFF INVESTIGATOR 6,000.00 

DOCUMENT CLERK 2,827.78 

STAFF INVESTIGATOR, FROH SEP 6 1,666.67 

ASST CHIEF COUNSEL-KING, TO JUL 31 

ASST DEPUTY CHIEF COUNSEL, FROM AUG 1 8,333.33 

SECRETARY, FROH AUG 29 1,155.55 

RECEPTIONIST 2,833.33 

SECRETARY 3,000.00 

STAFF INVESTIGATOR, FROM JUL 11 • 5,333.33 

SECRETARY 3,999.99 

STAFF COUNSEL 8,166.66 

RECEPTIONIST-TYPIST, FROM AUG 1 1,750.00 

SECRETARY 3,500.01 

STAFF COUNSEL 5,666.67 

STAFF COUNSEL-LEGAL UNIT, TO JUL 31 

STAFF COUNSEL, FROM AUG 1 5,916.67 

DEPUTY CHIEF COUNSEL 10,594.45 

RESEARCHER 3,750.00 

RESEARCHER, FROH JUL 11 2,666.67 

RESEARCHER, FROH SEP 8 1,150.00 

CHIEF CLERK 5,333.33 

TYPIST/SECRBTARY 3,500.00 

SPECIAL COUNSEL, FROH AUG 3 3,141.67 

STAFF INVESTIGATOR, FROH AUG 16 3,000.00 

EXECUTIVE ASSISTANT 3,999.99 

ADMINISTRATIVE ASSISTANT, FROH SEP 15 955.56 

SECRETARY, FROH SEP 6 833.33 

LAW ASSISTANT, TO SEP 15 3,687.50 

STAFF INVESTIGATOR/KENNEDY, TO JUL 31 

STAFF INVESTIGATOR, FROH AUG 1 7,000.00 

SECORITY/INVESTIGATION/AA, TO JUL 10 

DIRECTOR OF SECURITY, FROH JUL 11 4,888.89 



193 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30. 1977— Continued 

SELECT COHHITTEE ON ASSASSINATIONS -CONTINOED 



HORTON, CECELIA T 

HOSLEY, BARBARA L 
OBB, PATRICIA H 

ORB, PHOEBE COBTIS 

PALMER, ELIZABETH J 
PONDER, HART ELIZABETH 
FORTY, DONALD A,JR 
REEVES, PLOTD L 
RESNICK,GINA I 
RISINGER,HARLIN,III 
ROBERTS, ANTOINETTE HORRIS 
ROSE, HAROLD A 
ROSEN, NERETE HOFF 
ROSS, IDA JANE 
RODDER, MIRIAM 

SCHLICHTHANN.JAN B 
SCHOLTZ, NANCY P 
SELLECK, ELIZABETH K 
SISSON, BETTY LOO 
SMITH, JOHANNA LYNN 
STRICKLAND, ANN LYON 
SVENDSEN, LANCE 8 
TJNENEAUH, ROBERT K 
TAYLOR, ANN FDRNALD 

THOHAS, JOSEPH A 
TRIPLETT,HILLIAH K 

WAGNER, OLIVE E 
WALKER, ROBERT J 
WALSH, KEVIN 
WAXMAN,HEL 
BILANDER.ANNE PAOL 
WILLS, MARION H 
BIZELHAN, LESLIE H 
BOLF, ELIZABETH ANN 

WOLF.JAHES LEBEB 



SECRETARY, TO AOG 5 $ 1,083.31 

TYPIST/SECRETARY, FROM JUL 5 3,366.67 

SPEC ASST TO CHIEP CONSL 6 DIR, TO JOL 31 

SENIOR RESEARCHER, FROH AOG 1 4, 249.99 

DOCOHENT/FESEARCHEB, TO JOL 31 

DOCUMENT CLERK, FROM AOG 1 3,416.67 

RESEARCHER/DOCOHENT CLERK 4,500.00 

ADMINISTRATIVE ASSISTANT 3,500.01 

STAFF COONSEL 5,500.00 

STAFF INVESTIGATOR, FROH AOG 1 4,000.00 

DOCUMENT CLERK 2,833.33 

DOCOHENTS CLERK 3,333.33 

TO JOL 31 1,166.67 

STAFF INVESTIGATOR, FROH SEP 6 1,666.67 

RESEARCHER 3,583.33 

ADH SECTY/RECEPTIONIST 5,000.01 

CLERK, TO JOL 31 

HAIL/DOCOHENT CLEBK, FBOH AOG 1 2,208.34 

LAN ASSISTANT, FROH AOG 25 1,950.00 

SECRETARY 3,333.34 

STAFF INVESTIGATOR, FROH JOL 11 3,555.55 

SECRETARY, FROH AOG 22 1,516.67 

DOCOHENT CLERK 2,833.33 

SECRETARY 3,500.01 

XEFOX/HESSENGER, FROH AOG 1 1,583.34 

DEPOTY CHIEF COONSEL, TO JOL 31 3,511.11 

RESEARCHER, TO JOL 31 

SENIOR RESEARCHER, FROH AOG 1 4,416.67 

STAFF INVESTIGATOR, FROH SEP 9 1,466.67 

STAFF COONSEL, FROH JOL 17 6,166.67 

RECEPTIONIST, FROH SEP 9 672.22 

STAFF INVESTIGATOR, FROH SEP 6 1,666.67 

RESEARCHER, TO SEP 16 3,166.67 

STAFF INVESTIGATOR, FROH AOG 23 2,533.33 

STAFF ASSISTANT 3,416.67 

SECRETARY 3,458.34 

RESEARCHER, FROH JOL 1 1 2,666.67 

DCCOHENT/BESEARCHER, TO JOL 31 

DOCOHENT CLERK, FROH AOG 1 3,333.33 

STAFF COONSEL-LEGAL ONIT, TO JOL 31 

STAFF COONSEL, FROH AOG 1 8,416.67 



SELECT COHHITTEE ON CONGRESSIC NAL OPERATIONS 



ABNEY.NILSOH R 
ABRAHS,JAHES JOSEPH 
ADAHS,LOOIS BENTON 
ATTARDI,HARIANNE V 
BALANOFF,JAHES 
BRADDOX.BOY 
BRONS,ALLIS H 
BYRD.BILLIAH C 
CACCAVALE.FBFD A 
CALL, MARY S 
COPPOLA, MICHAEL A 
COX,LO0ISE C 
CRIGLER, JEFFREY CHARLES 
DWYER,HA3Y C 
ELLER,HARK A 
FRALIN,GAYLE D 
FREEDHAN,LABRENCE 
GIBSON, CAROLYN P 
GLENN, KAREN ANNE 
GRAY, JOY L 
JONES, ELLEN L 
KEENAN, FRANCIS J 
KELLEY, ROBERT J 
HANGOAL,BERNADETTE LEE 
HCCARTIN, GERALD P 
HCCARTIN, TERF.ENCE JOHN 
HOLLER, BOHNHART 
HOEPHY, KEVIN 
NORRIS.HICHAEL A 
PETERS, EOGENE F 
PETTEY,BRYCE H 
PICKERING, H DAVID, JB 
RADLER, DONALD H 
RAINES, BILLIAB F.III 
REILLY, FRANK 



STAFF ASSISTANT 

ADMINISTRATIVE OFFICER 

PLACEHENT ASSISTANT, FROH JOL 14 

SECRETARY-STENOGRAPHER, TO AOG 4 

STAFF ASSISTANT, FROH AOG 10 

PLACEHENT ASSISTANT, TO SEP 24 

CLERK TYPIST, FROM AOG 15 

TEHPOBARY STAFF ASSISTANT, TO AOG 31 

STAFF ASSISTANT 

SECBETARY-TYPIST, TO JOL 31 

PLACEHENT ASSISTANT, TO JOL 15 

PLACEHENT ASSISTANT, FROH SEP 16 

TEHPORABY CLERK, TO AOG 31 

PLACEHENT ASSISTANT, TO AOG 22 

STAFF ASSISTANT 

STAFF ASSISTANT 

TEHPORARY CLERK, TO JOL 20 

RECEPTIONIST-TYPIST I. 

ADMINISTRATIVE OFFICER 

PLACEHENT ASSISTANT, FROH SEP 8 

OFFICE HANAGER 

DIRECTOR CF PROJECTS 

DIRECTOR, OFFICE PLACE E OFC HGHT 

SECRETARY, FROH JOL 28 

TEHPORARY CLERK, TO AOG 12 

TEHPORARY CLERK 

STAFF ASSISTANT 

PLACEHENT CLERK, FROH SEP 16 

STAFF ASSISTANT 

EXFCOTIVE DIRECTOR 

STAFF ASSISTANT 

TEHFORABY CLEBK, TO JOL 17 

STAFF ASSISTANT 

TEHPORARY CLERK, TO AOG 12 

TEHPORARY CLEBK, TO AOG 5 



,499.99 
,624.99 
,138.88 

991.67 
,983.34 
,333.33 
,277.77 
,333.34 
,125.01 

833.33 

437.50 

416.67 
,166.66 
,444.44 
,875.01 
,624.99 

388.89 
,625.00 
,624.99 

511.11 
,000.01 
,750.01 
,000.01 
,749.99 

933.34 
,874.99 
,875.01 

189.58 
,125.01 
,500.01 
,500.00 

330.56 
,094.00 

816.66 

680.55 



194 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

SELECT COMMITTEE ON CONGRESSIONAL OPERATIONS -CONTINDED 



SADTLER, SUSAN L PLACEMENT ASSISTANT $ 2,750.01 

SECKLER, GRACE PLACEMENT ASSISTANT 600.00 

SHELTON, LINDA JO STAFF ASSISTANT 3,624.99 

THOMAS, DAWN L PLACEMENT ASSISTANT 2,625.00 

URIBE,PHILOMFNA FLACFMENT ASSISTANT, TO SEP 6 1,741.67 

WATKINS, CYNTHIA K STAFF A EM INIST R ATOP 8,000.01 

WHITE, JACOB W STAFF ASSISTANT 2,400.00 

WILLS, CYNTHIA C TEMPORARY CLERK, TO AUG 12 816.66 

AD HOC SELECT COMMITTEE ON ENERGY 

BROWN, LEWIS W CCMMONICATIONS DIRECTOR 6,000.00 

CHPISLEY.CLAFA E SECRETARY 3,750.00 

DAVIS, ELIZABETH CARROLL RECEPTIONIST 1,749.99 

HfJNTER, RODNEY LEE SECRETARY 3,750.00 

KROLIK, RICHARD STAFF DIRECTOR 9,999.99 

LEMOND, ELIZABETH SECRETARY 3,750.00 

NEDPY.XASY ANN OFFICE MANAGER 6,999.99 

SWANSON, DAVIE L MINORITY STAFF DIRECTOR 8,750.01 

SELECT COMMITTEE ON ETHICS 

BRODSKY, DONNA LEE OFFICE MANAGER 4,500.00 

CHFFTKOV,BORF,N CHIEF COUNSEL 9,500.01 

CHOPBAJIAN, ROSALIE SECRETARY 3,500.11 

DIXON, GE"F.Y PUCKETT SECRETARY 3,249.99 

DYE III, ROY AUGUSTUS PROFESSIONAL STAFF MEMBER 6,500.01 

GAMAGE,STEWAPT H PRCFESSICNAL STAFF MEMBER 5,250.00 

GKINN.NILLIAr" ROGER INTERN, TO JUL 22 366.67 

LOWREY.JOHN LANE SUMMER INTERN, TO AUG 5 583.33 

MERCER,JOHN EDWAPD MINOFITY COUNSEL 6,750.00 

STONE, PAUL C D STAFF ASSISTANT 3,249.99 

TERRY, DONALD ? STAFF DIRECTOR 10,625.01 

PERMANENT SELECT COMMITTEE ON INTELLIGENCE 

LATIMER, THOMAS K STAFF DIRECTOR, FROM AUG 15 6,069.44 

LEARY, SHARON DIANA SECRETAPY, FROM SEP 18 541.67 

MCNALLY, JEANNE M CLERK, FROM AUG 21 2,222.23 

ONEIL, MICHAEL J CHIEF COUNSEL, FROM SEP 1 3,750.00 

SELECT COMMITTEE ON NARCOTICS AECSE AND CONTROL 

ALVAFADO, DONNA MARIA RESEARCH ASSISTANT 4,374.99 

ANDERSON, CHARLES A STAFF COUNSEL 5,874.99 

ANDFEW?,KAFEN ELIZABETH RECEPTIONIST, FROM SEP 6 729.17 

BACHRACH.ALMA F INVESTIGATOR 5,375.01 

BADEY, CHERYL A SECRETAPY, TO AUG 31 

RESEARCH E FINANCIAL STAFF MEMBER, FROM SEP 1 3,549.99 

BAPTISTA, SAMUEL J RESEARCH ASSISTANT 3, 750. On 

BOSLEY.MATHILDE B SFCRETA»Y 3,324.99 

BROWN, ELLIOTT A PROFESSIONAL STAFF MFMBEP 5,375. 01 

COUFTNSY.JEANNINE G SECRETARY 3,324.99 

DUSKIE, ANDREW DONALD PROFESSIONAL STAFF MEMBEF 6,249.99 

E7ZELL,MARV ANNE SECRETARY, TO AUG 5 1,293.05 

FF?GUSON,LISA STAFF ASSISTANT, TO AUG 31 1,000.00 

FITZGIBBONS, KEVIN CLEPICAL ASSISTANT 2,499.99 

GARFINKEL,E?IC STAFF ASSISTANT, TO JUL 31 500.0." 

GERB'P, WENDY BETH STAFF ASSISTANT, TO AUG 12 700. 0'" 1 

GILE, DAVID A STAFF ASSISTANT, FFOM AUG 1 TO AUG 11 183.33 

HAFPE.SA^A ELIZABETH REC EFT IC N 1ST, FROM AUG 1 TO AUG 5 138.89 

LAWPENCF, WILLIAM G CHIEF OF STAFF 9,900.0' 

LEDEPER, SUZANNE P STAFF ASSISTANT, TO JUL 31 500.00 

LECNAPD, DANIEL F INVESTIGATOR 6,249.99 

MONAHAN, CLARE TULLY STAFF ASSISTANT, TO JUL 31 500.00 

MOYER, CAROL JEAN RESFARCF S FINANCIAL STAFF MEMBER, TO JUL 22 .. 1,100.00 

NELLIS, JOSEPH CHIFF COPNSEL 10,625.01 

ORQUE.JEAN MALIA SECRETARY, FFOM AUG 23 1,403.89 

PEFLOE,JOHN W INVESTIGATOR 5,625.00 

PICKENS, DAVID PROJECT OFFICES 6,817.44 

PEINDOP?, WANDA S STAFF ASSISTANT, TO JUL 31 500.00 

SANFORD, BONNIE G RESEARCH ASSISTANT, FROM SEP 26 222.22 

SHEPIDAN, ANTOINETTE E RECEPTIONIST, TO JUL 31 333.33 



195 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



SELECT COMMITTEE ON NARCOTICS AEUSE AND CONTROL -CONTINUED 

SNYDER, PAUL M CLERICAL ASSISTANT $ 2,199.99 

STEIN, DANIEL A STAFF ASSISTANT, TO JUL 31 

RESEARCH ASSISTANT, FFOB AUG 1 2,166.66 

5TPAUSS, THOMAS J STUFF ASSISTANT, TO JUL 31 500.00 

THOMPSON, DOEFSN STAFF COUNSEL 6,624.99 

UPBANSKS, CAROLS A SECRETARY, FROM AUG 8 1,958.05 

VOGEL, THOMAS HEPEE-T STAFF ASSISTANT 5,969.25 

WALLACH.S HOWARD STAFF COUNSEL 5,874.99 

WINKER, WENDY J SECRETARY, FROM AUG 15 1,699.41* 

WRIGHT,SHIPLEY J SECRETARY, TO JUL 15 554.73 

AD HOC SELECT COMMITTEE ON OCTEF CONTINENTAL SHELF 

ABLONDI.KIMC CLFRK 2,750.01 

BEDELL, CHARLES ALLEN MINORITY COUNSEL 2.093.U0 

BELSKY, MARTIN H COUNSEL 4.01U.90 

BONNER, KATHLEEN M CLERK 2,000.01 

BOTT,MARY JANE SECRETARY 600.00 

CAHN, DAVID L PPOFESSIONAL STAFF MEMBER, TO JUL 31 2,500.00 

CULLSN,PAT J CLERK 3.OC0.C3 

DICKINSON, MICHAEL K RESEARCH ASSISTANT 3,999.99 

DRAGO, CHARLES G STAFF MEMBER, FROM AUG 9 4, 333. 33 

DUNNE, MARTIN F STAFF MEMEER 5,250. OC 

FUSCO.MARY J SECRETARY u, 500.00 

GREENSPAN, SAFK RESEARCH ASSISTANT 3,900.0C 

GREGORY, H TIJUANA SECRETARY, FROM JUL 12 3,730.56 

HEYWARD, ELIZABETH B SECRETARY, TO JUL 31 

SECRETARY, FROM AUG 5 2,1*99.99 

KOSATKA,ARDEN EDITORIAL DIFECTOR 6.2U9.99 

MCGUTRE, WILLIAM STAFF MEMBER 3,000.00 

PERSHEY.DEBOPAH CLERK TYPIST 3,000.00 

TACKABEPRY, THOMAS H STAFF MEMBER 3,999.99 

JOINT COMMITTEE ON TAXATION 

ABELITIS, FRANCES V SEC°ETAFY, TO JUL 31 1,273.42 

ARNOLD, LINCOLN LEGISLATION ATTORNEY 5,926.19 

AYALA, JANICE L REFUND SECRETARY 3,00'.:':) 

BACON, RICHARD L LEGISLATION ATTORNEY 10,250.01 

BARTLETT,LYNN REFUND ATTORNEY, FROM JUL 3 7,577.7"? 

BATES, CARL E LEGISLATION ATTORNEY 8,750.01 

BEPLIANT, MARCUS COMPUTER PROGRAMMER, TO SEP 9 1,840.00 

BILLINGEP, JAMES L LEGISLATION ATTORNEY 9.C00.0C 

BIRD, MICHAEL D ECONOMIST 11,253. OC 

3ROCKWAY, DAVID H LEGISLATION ATTORNEY, TO AUG 31 

LEGISLATION ATTORNEY, FROM SEP 5 8,361.12 

BROWN, LAWRENCE R LEGISLATION ATTORNEY 7,125.00 

BOCKBErG, ALBERT ECCNCMIST 11,250.00 

BURKE, ROBERTA SECRETARY 3,125.01 

CHABOT, HERBERT L DEPUTY CHIEF OF STAFF 11, 971*. 99 

COOK, MICHAEL CHIEF CLERK «,350.00 

TALE, ELIZABETH A SECRETARY 4,050.00 

DALEY, JAMIE L SECRETARY 5,1214.09 

DAVIS, PETER J ECCNOMITRICIAN 6,999.99 

DSLCARMEN, AMELIA SFCRETARY 4,475.01 

DHUHHOND, MICHAEL L CLERK 2,124.99 

SEELSON, JOYCE A SEC°ETAPY 3,999.99 

FRAZISR, SHARON L SECFE'APY 3,500.01 

GAGE,ALEXA E SECPETAFY 4,599.99 

GALLAGHER, THOMAS J,JP LEGISLATION ATTORNEY 7,500.00 

GEOPGE, JACQUELINE S SECEETARY 4,950.0c 

GERMAN IS, JOHN J STATISTICAL ANALYST 10,71*9.99 

GESKE.ALVIN J LEGISLATION ATTORNEY 9,125.01 

GLASS, GARY A CLERK 2,375.01 

HALPEPIN,E?ROL R LEGISLATION ATTORNEY 11,250.00 

HART, THOMAS P ECC NCMIT F ICIAN 5, 871*. 99 

HTPSCH, HAROLD E LEGISLATION ATTORNEY 8,1*99.99 

ISAAC, GERALD D ACCOUNTANT 8,000.01 

JERZ.JAN'T ANN SECFETAPY 3,575.01 

KB5S ~:'!E5,NOFMA E SECEETAFY 4,1*25.01" 

KLI'D,LEON W ECCNCMIST 9,999.09 

LEPLSY,JOHN A STATISTICAL CLERK U, 500. 00 

LIEBER, WILLIAM M ASSISTANT LEGISLATIVE COUNSEL 10,71*9.99 

"\T'- J Z'»S ,J"NF K SECFETAPY 4,262.1*9 

MCCAWLEY,HAF?ISON B FIFIJND COUNSEL 11,000.01 

•>CC3SA3HY,?A.-CIA B HDHIBISTH STIVE ASSISTANT 5,750.01 

MCCONAGHY.MAFK L ASSISTANT CHIEF OF STAFF 11,874.99 



196 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

JOINT COMMITTEE ON TAXATION -CONTINUED 

MCEERMOTT, JOANNE B EXECUTIVE ASSISTANT $ 300.00 

MONTOSIO,LOIS A SECPETAEY 3,375.00 

NAGPO, BLANCHE F FEEUND SECRETARY 4,625.01 

OBE9ST,WICHAFL LEGISLATION ATTORNEY 10,625.01 

OOSTEPHUIS .PAUL W LEGISLATION COUNSEL 9,500.01 

PIRANEO, JOSEPHINE G SECRETARY, FROM JUL 11 2,733.33 

RICKETTS,DON LFON ASSISTANT LEGISLATION COUNSEL 10,749.99 

SING, RAYMOND J,JR ECONOMIST 6, 249.99 

ROLLINS, WILLIAM K ACCOUNTANT 8,000.01 

FUGE, RICHARD B LEGISLATION ATTOENEY 9,999.99 

SAVAGE, LINDA E SECRETARY 5,400.00 

SCHMITT, BERNARD STATISTICAL ANALYST 6,249.99 

SCOTT, MICHELLE P LEGISLATION ATTORNEY 7,875.00 

SHAPIRO, BEENABD M CHIEF OF STAFF 13,125.00 

SMITH, LINDEN C ECONOMIT RICIAN 6,999.99 

SPELLMAN, JOSEPH P REEUND ATTORNEY 8,625.00 

STRAUSS, FOBEPT P ECCNCMIST 9,999.99 

SYMONS, JAMES H STATISTICAL ANALYST 11,8714.99 

THOMAS, MSLVIN C,JR LEGISLATION ATTORNEY 8,750.01 

WARDEN, ROBERT A LEGISLATION COUNSEL 11,250.00 

WEISS, RANDALL D ECONOMIST 7,500.00 

WEIZLER, JAMES W CHIEF ECCNOMIST 10,250.01 

WILLIAMS, FLOYD L / ATTOFNEY 6,750.00 

XE, NGUYEN VAN ./ CLERK 2,358.69 

JOINT COMMITTEE ON DEFENSE FFCEUCTICN 

BPADDOCK, MARTHA PROFESSIONAL STAFF MEMBER 5,000.01 

CASTER, SHARON LYNN SECRFTARY, TO AUG 5 923.61 

CONCANNON,LORY B SECRETARY 3,000.00 

CUDAHY, RICHARD D,JR STAFF ASSISTANT, TO AUG 10 533.33 

EREEDENBERG,PAUL BIN PBOFESSIONAL STAFF MEMBEP 6,875.01 

KINCADE, WILLIAM H STAFF EIRECTOE, TO AUG 31 6,115.06 

^EED,LEON S SF PROFESSIONAL STAFF MEMBER 5,806.26 

TERZIAN, ROBERT PAUL COUNSEL, TO SEP 11 4,135.85 

WHITE, BLAINE A COUNSEL, FROM JUL 5 4,777.78 

WINSLOW.PAIJL R RESEARCH ASSISTANT 3,750.00 

OFFICE OF PLACEMENT AND OFFICE MANAGEMENT 

AHLERS.JOHN C SIAFF ASSISTANT 8,498.70 

FRANCIS, E LEE, III STAFF ASSISTANT 3,750.00 

GEPEAU, GERALD ROBERT STAFF ASSISTANT 7,500.00 

MCALLISTER, JAMES F ADMINISTRATIVE OFFICER 8,781.99 

MEPPICK, SAMUEL STAFF ASSISTANT 4,317.79 

MONTGOMERY, JOE B STAFF ASSISTANT 3,221.98 

URSICH,LARPY DALE STAFF ASSISTANT, TO JUL 10 416.67 



TOTAL 44,997,970.26 



197 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

HOUSE OF REPRESENTATIVES RESTAURANT 



ADMINISTRATIVE: 

Altieri, Anthony P. 
Ball, Lawrence P. 
Carroll, Marie R. 
Cavender, Caye A. 
Doss, Alice A. 
Hightower, Vada S. 
Johnson, Jr. James W. 
Lambiasi, Carol A. 
Zeller, Robert W. 



CONGRESSIONAL RESTAURANT: 

Allen, Madeline S. 
Alston, Dorothy M. 
Arrington, Ronald W. 
Atchinson, Catherine M. 
Beachem, Arlene R. 
Bell, Alphonso 
Braswell, Sr. Robert 
Brooks, Wendy L. 
Brooks, Wilma J. 
Brown, Sandralyn L. 
Brown, Yvonne M. 
Butler, Edward B. 
Butler, Ferdinand J. 
Campbell, Jonathan 
Clements, Jean 
Coleman, John R. 
Cook, Robin L. 
Corbin, Jon X. 
Crowe, Sarah 
Farazmand, Habibollah 
Funderburke, Zulee 
Gamble, James E. 
Gamer, Sareta L. 
Gross, Juanita H. 
Hines, Montelle M. 
Hughes, Cornell R. 
Johnson, Willie W, 
Kearney, Towana 
Kitt, Sharon A. 
Latson, Miriam A. 
Lucas, Hebert W. 
Lynch, Ann C. 
Minor, Barbara A. 
Minor, Patricia A. 
Mobley, Lizzy 
Moore, Marie 
Moy, Ellen 
Paul, Olander F. 
Phillips, James L. 
Plcwden, Renee H. 
Potter, Priscilla E. 
Robinson, Jr. Linwood 
Rogers, Doris 
Scott, Gerald E. 
Shepard, Grace 
Speller, Alton L. 
Stokes, Clement 
Thomas, Candy 
Trotter, Garfield 
Waltman, John H. 
Whitehead, James 
Wilson, George F. 
Wise, Mabel V. 



PURCHASING AGENT-RELIEF MANAGER S 4,416.16 

ADMTNISTRAnVE OFFICER 6,783.28 

ACCOUNTING CLERK 3, 581. 20 

ACCOUNTING CLERK, TO SEPTEMBER 24 1,764.30 

ACCOUNTING CLERK 2,724.40 

ASSISTANT ADMINISTRATIVE OFFICER 4,763.36 

ACCOUNTING CLERK 2, 928 . 24 

ACCOUNTING CLERK, FROM AUGUST 21 845.00 

ASSISTANT PURCHASING AGENT-RELIEF MANAGER 3,026.80 

ASSISTANT MANAGER 3, 472. 72 

WAITRESS 1,600.19 

KITCHEN UTILITY 936.52 

WAITRESS 1,145.95 

LEAD GRUX GIRL 2,581.35 

WAITER, TO JULY 28 300.81 

WAITER 457.06 

BUSGIRL 1, 354 . 26 

BUSGIRL 1,518.06 

KITCHEN UTILITY 1,810.85 

BUSGIRL 814.95 

KITCHEN UTILITY 1,102. 24 

WAITER 459 . 74 

KITCHEN UTILITY 1,640.89 

KITCHEN UTILITY 822. 98 

WAITER 533.67 

BUSGIRL, TO AUGUST 31 1,193.13 

HEAD WAITER 1,426.67 

CASHIER HOSTESS 3,417.12 

WAITER 581 . 63 

BUSGIRL 1, 536 . 99 

WAITER 658.53 

BUSGIRL 1,498.56 

BUSGIRL 1 , 546. 05 

BUSGIRL 1,606.84 

KITCHEN UTILITY 983.88 

BUSBOY 1,455.35 

BUSGIRL 1,501.23 

BUSGIRL 1,440.89 

BUSGIRL 740. 18 

KITCHEN UTILITY, TO JUNE 20 36.72 

BUSGIRL, FROM SEPTEMBER 11 109.94 

BUSGIRL 1,548.26 

BUSGIRL 941 . 35 

BUSGIRL 827.81 

COOK'S HELPER 1,446.32 

BUSGIRL 1,100.51 

KITCHEN UTILITY 1,671.23 

WAITER 555.59 

BUSGIRL 660.80 

BUSGIRL 1,254 .72 

WAITER 568.76 

SUPERVISOR-DINING ROOM 2,245.30 

WAITER 1, 325. 75 

FOOD CHECKER 1,809.54 

KITCHEN UTILITY 938.53 

KITCHEN UTILITY, TO JUNE 20 21.64 

CASHIER 1, 728 . 20 

WAITER, TO AUGUST 27 17.90 

CONGRESSIONAL RESTAURANT MANAGER 6,398.00 

KITCHEN UTILITY, TO JULY 29 629.66 

WAITER 643.45 

BUSGIRL 954 . 40 



198 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 

MEMBER'S DINING ROOM: 



Barnes, Rose P. 
Clark, Robert L. 
Dunne, Jessie E. 
Harris, Geraldine M. 
McCarty, Antonia T. 
Miller, Leonard J. 
Sanders, Zollie 
Thomas, Gregory L. 
White, Adell 



WAITRESS : $ 1,173.29 

GRILL MAN 1,778.42 

PANTRY SUPERVISOR 2,302.05 

WAITRESS 758.55 

KITCHEN UTILITY, FROM JULY 24 440.57 

WAITER 571.57 

WAITER, TO AUGUST 15 369.97 

KITCHEN UTILITY 1,532. 38 

BUSGIRL 1,080.10 



CONGRESSIONAL RESTAURANT KITCHEN: 



Batts, William E. 
Beli, Jr. Vernon O. 
Bonanni, Pasquale 
Chambers, Thomas F. 
Derr, Edward L. 
Galmon, Janie M. 
Herring Wilbert 
Howard, Marie A. 
Lewis, Melvin 
Loulou, Konstantinon 
Murphy, Joel 
Nickelson, Ben 
Shaw, Gregory W. 
Slye, Marie D. 
Smith, Florence 
Stanton, Mozell 
Williams, Connie R. 



CAPITOL CARRY OUT: 

Benefield, Jr. Eddie 
Duncan, Yvonne P. 
Jackson, Gloria 
Newman, Joann C. 
Price, Mildred 
Sanchez, Hilda V. 
War ley, Katherine 



LEAD KITCHEN UTILITY 

KITCHEN UTILITY, TO JULY 21 

CHEF 

UNIT STOREROOM MANAGER 

POT WASHER 

PANTRY SUPERVISOR 

UNIT STOREROOM MANAGER ASSISTANT. 

CHEF'S HELPER 

COOK'S HELPER 

KITCHEN UTILITY, FROM JULY 17 

FOOD SERVICE WORKER 

COOK 

KITCHEN UTILITY, FROM JULY 22 

GRILL GIRL 

LEAD KITCHEN UTILITY 

SALAD GIRL 

COOK'S HELPER 

KITCHEN UTILITY 

KITCHEN UTILITY, TO SEPTEMBER 12. 

COUNTER GIRL 

BUSGIRL 

ASSISTANT CARRY OUT MANAGER 

KITCHEN UTILITY 

CARRY OUT MANAGER 



,223.62 
454.43 
,225.52 
,490.88 
,670.22 
,039.31 
,673.23 
,554.19 
,393.42 
132.81 
,799.88 
,460.00 
663.67 
,406.29 
,609.15 
,035.46 
,089.85 



1,147.19 
575.76 
1,903.45 
1,553.64 
2,274.80 
1,754.68 
2,993.36 



LONGWQRTH CAFETERIA: 

Addison, Roger 
Barley, Charles E. 
Bellamy, Lizzie 
Bonner, Dorothy N. 
Boyd, Roberta 
Bradford, Linwood 
Burrow, Jacquelyn D. 
Cash, Mano^a T. 
Chaplin Math i as G. 
Cohbs, Catherine 
Cramer, Evelyn B. 
Culver, Pamela J. 
Edwards, Emma Jane 
Ferguson, Odessa 
Ford, Chester J. 
Forrest, Hattie P. 
Gordon, Fannie F. 
Hall, Joann 
Harris, Bruce L. 
Hubb, Albert 
Jemison, Charlotta A. 
Johnson, Jane R. 
Johnson, Mae F. 
Johnson, William H. 



KITCHEN UTILITY, FROM JULY 13 1,339.78 

KITCHEN UTILITY, FROM SEPTEMBER 8 346.68 

BUSGIRL 1,985.40 

CASHIER, TO JUNE 24 212.80 

COOK 3,349.02 

KITCHEN UTILITY 1,733.83 

BUSGIRL 868 . 32 

KITCHEN UTILITY 2,059.30 

KITCHEN UTILITY, TO AUGUST 27 974.95 

BUSGIRL 2 , 096 . 12 

BUSGIRL 1,908.83 

CASHIER, FROM JULY 5 TO SEPTEMBER 10 1,040.54 

KITCHEN UTILITY 2,124.68 

COUNTER GIRL SUPERVISOR 2,851.29 

COOK'S HELPER 2,041.12 

BUSGIRL 1, 043. 02 

COUNTER GIRL 2 , 257 . 54 

GRILL GIRL 1,482. 38 

KITCHEN UTILITY, TO JULY 8 481.05 

KITCHEN UTILITY, TO JULY 8 512.83 

CAFETERIA SUPERVISOR 3,057.12 

SALAD GIRL 2, 318. 19 

SALAD GIRL 2 , 374 . 54 

COOK'S HELPER 2,005.19 



199 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



LONGWORTH CAFETERIA, CONTINUED: 

Lutz, Annette 
Lynch, Cecelia G. 
Martin, Patricia 
Martin, Robert C. 
McCall, Deborah G. 
Mhcon, Odessa 
Moore, Rosa L. 
Perry, Territa 
Peterson, Keith E. 
Pickett, James L. 
Plight, Matthew 
Plight, Verlean 
Prater, Julia E. 
Richardson, Mary I. 
Richmond, Lillie J. 
Rodriguez, Gloria L. 
Shepherd, Esther D. 
Suggs, Ella 
Taylor, Margaret E. 
Taylor, Walter B. 
Thomas, Marjorie E. 
Walker, Anne W. 
Wallace, Minnie D. 
Wheeler, Linda L. 
White, Harlan T. 
Williams, Eddie M. 
Williams, Helen 
Wright, Mae G. 
Wright, Orlando D. 



COUNTER GIRL 

UNIT STOREROOM MANAGER 

BUSGIRL 

CASHIER 



BUSBOY 

COUNTER MAN 

KITCHEN UTILITY 

COUNTER GLRL 

COUNTER GIRL 

COOK 

•COOK 

COUNTER GLRL 



COUNTER GIRL 



CAFETERIA MANAGER- 

BUSGIRL : 

BUSGIRL 



BUSGIRL 

BUSGIRL 

UNIT STOREROOM MANAGER ASSISTANT 



2,162.34 
2,467.59 
2,227.60 
3,242.40 
1,943.27 
2,257.59 

703.80 
2,264.20 
1,624.66 
2,145.37 
1,909.48 

295.50 
2,164.75 
2,406.06 
3,4-15.83 
2,153.63 
1,013.73 
1,625.68 
2,090.55 
1,400.59 
2,145.27 
6,398.00 
2,161.05 
1,936.71 
1,282.80 
4,177.60 
1,959.32 
1,937.60 
2,476.02 



LONGWORTH CAFETERIA TOBACCO: 

Mulkey, Shirley L. 
Parks, Shelia R. 
Ross, Nellie 



CIGAR STAND SUPERVISOR 



2,630.07 
2,531.83 
2,782.00 



LONGWORTH CAFETERIA BAKERY: 

Maslona, Edmund J. 
Nesmith, Peter 
Richardson, Edna L. 
Stewart, Geneva 



BAKER'S HELPER 
BAKER'S HELPER 



3,939.04 
3,926.87 
2,599.93 
2,121.05 



LONGWORTH CARRY OUT: 

Anderson, Jeffery M. 
Byas, Doris A. 
Harris, Jr. Billy 
Kelly, Patrice 
Locke, Rachel 
Monk, T.indfl A. 
Toon, Betty A. 
Williams, Dorothy M. 



KITCHEN OTLLITY 



COUNTER GIRL 

CASHIER 

COUNTER GIRL 

BUSGIRL 

CARRY OUT MANAGER 



1,690.87 
1,782.19 
1,592.56 
1,455.10 
1,702.36 
352.37 
1,922.71 
2,312.80 



CANNON CARRY OUT: 

Allen, Jeanette 
Allen, Joyce E. 
Austin, Joyce 
Banks, Estelle 
Byrd, Lessie M. 
Dailey, Charlotte D. 
Dukes, Lucille 
Hughes, William O. 
Jones, Isaac 



COUNTER GIRL 

COUNTER GIRL 

BUSGIRL 

BUSGIRL 

GOOD CHECKER 

COUNTER GIRL 

COUNTER GIRL 

KITCHEN UTILITY 

KITCHEN WTLTTY, TO AUGUST 15 



1,907.60 
1,913.70 
1,680.45 
1,785.56 
2,479.68 
1,853.96 
1,865.78 
1,832.53 
479.54 



96-500 O - 78 - 14 



200 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



CANNON CARRY OUT, CONTINUED: 

Maynor, Jessie M. 
Rogers, Edna H. 
Watson, Carolyn G. 



CARRY OUT MANAGER 

BUSGIRL, FROM SEPTEMBER 6 - 
COUNTER GIRL, FROM JULY 17 



$ 2,688.88 

357.92 

1,312.72 



RAYBURN CAFETERIA: 

Butler, Aloysius J. 
Butler, Christophera 
Chambers, Alfred D. 
Cranford, Jr. Richard R. 
Edwards, Doris M. 
Engel, H. Dennis 
Fong, Don 
Fang, Mee Ngor 
Ford, Robert L. 
Green, Lucy F. 
Greene, Joan E. 
Gregory, Cleo 
Harris, Delores R. 
Harris, Leroy 
Harrison, Charloite 
Henderson, Eva 
Jackson, Robert S. 
Jones, Joseph 
Jones, Mary L. 
Jones, Ulysses S. 
Lse, Mildred 
Lewis, Annis M. 
Lewis Phyllis S. 
Lofton, Sheila 
Newkirk, Elsie M. 
Nickelson, Alex L. 

Oden, Janes E. 

Phillips, John W. 

Pooler, Betty 

Pooler, Mary A. 

Pooler, Melvin 

Reed, Barbara C. 

Robinson, Jacqueline 

Rodriquez, Rosa A. 

Rogers, Doris A. 

Rogers, Jerry C. 

Rogers, Luvenia 

Sanders, Bettie L. 

Smith, Grace H. 

Smith, James E. 

Smith, Judson B. 

Smith, Quentin R. 

Thompson, Peggy L. 

Walton, Beatrice 

Wheeler, Marshall A. 

Wilkerson, Barbara 

Williams, Eugene 

Williams, Geraldine 

Williams, Virgil T. 

Wright, Sheila D. 



UNIT STOREROOM MANAGER ASSISTANT 

KITCHEN UTILITY 

KITCHEN UTILITY, TO JULY 12 

UNIT STOREROOM MANAGER, FROM JULY 20 
COUNTER GIRL 



CAFETERIA MANAGER 

KITCHEN UTILITY, TO SEPTEMBER 2 

COUNTER GIRL 

KITCHEN UTILITY 



KITCHEN UTILITY 

COUNTER GIRL 

KITCHEN UTILITY, 
GRILL GIRL 



KITCHEN UTILITY 
KITCHEN UTrLTTY 
BUSGIRL 



COUNTER GIRL 
BUSGIRL 



COUNTER GIRL, TO JULY 22 
COUNTER GIRL SUPERVISOR - 

CHEF 

COOK'S HELPER 

GRILL MAN 

BUSGIRL 

BUSGIRL 

KITCHEN UnLTTY 

COUNTER GIRL 

COUNTER GIRL 

COUNTER GIRL 

BUSGIRL 

COOK'S HELPER 

BUSGIRL 



GRILL GIRL 

KITCHEN UTILITY 

UNIT STOREROOM MANAGER 

KITCHEN UTILITY 

GRILL GIRL ■ 

SALAD GIRL ■ 

KITCHEN UTILITY, FROM AUGUST 30 

CASHIER-RELIEF 

COOK'S HELPER 

BUSGIRL 

KITCHEN UTrLTTY 

CASHIER 



2,314.02 
1,861.98 
333.56 
2,179.94 
1,962.57 
3,819.76 
1,391.57 
2,094.40 
1,694.24 
2,419.74 
1,349.00 
2,027.78 
1,293.02 
976.66 
2,171.20 
1,670.25 
1,633.85 
1,779.15 
1,414.53 
2,826.21 
1,697.96 
1,398.77 
1,728.21 
518.45 
2,004.55 
4,908.40 
1,804.10 
1,884.23 
1,609.82 
1,909.92 
1,997.78 
1,612.68 
1,561.57 
1,792.82 
1,779.58 
1,953.19 
1,020.78 
2,062.90 
2,419.20 
1,123.45 
3,242.40 
1,540.64 
1,777.36 
1,920.80 
454.22 
1,615.13 
2,421.68 
1,734.18 
1,588.96 
1,048.94 



RAYBURN CAFETERIA TOBACCO: 

Bass, Shentonda K. 
Davis, Freda L. 
Kreger, Catherine J. 
Lavine, Joanne B. 
Sachs, Susan A. 



CASHIER-RELIEF, FROM SEPTEMBER 18 
CASHIER 



CASHIER, TO SEPTEMBER 10 
CASHIER, TO AUGUST 26 



120.90 

2,255.63 

1,897.36 

7.88 

1,651.68 



201 

SALARIES OF OFFICERS AND EMPLOYEES OF THE HOUSE OF REPRESENTATIVES FROM 
JULY 1 TO SEPTEMBER 30, 1977— Continued 



RAYBURN CATERING: 

Cassidy, Geraldine R. 
Charraan, Clarence E. 
Harris, Milton B. 
Lewis, Wilson 
Lynch, George E. 
McCormick, Joseph B. 
Penny, Plato 
Rosasoo, Frances S. 
Steward, Darryl K. 
Thompson, Eva 
Wright, Tillifi R. 



CLERICAL ASSISTANT 

KITCHEN UTILITY, FROM SEPTEMBER 19 

KITCHEN UTILITY. 

PORTER SUPERVISOR 

KITCHEN UTILITY 

CATERING MANAGER 

KITCHEN UnLTTY 



ASSISTANT CATERING MANAGER 

KITCHEN UnLTTY, TO SEPTEMBER 10 — 

SALAD KTrOlEN SUPERVISOR 

ASSISTANT SALAD KITCHEN SUPERVISOR 



$ 2,023.70 

- 128.00 

- 1,643.12 

- 2,604.59 

1,857.50 

4,210.64 

1,529.38 

2,917.60 

1,013.22 

2,728.40 

1,876.88 



RAYBUKJ CARRY OUT: 

Brcwn, Rosa L. 
Chandler, Katie M. 
Clark, Ester V. 
Hicks, Belinda R. 
Johnson, Denise R. 
Lyons, Louise 
McKnight, Mary 
Wood, Aundra 



COUNTER GIRL SUPERVISOR 

CARRY OUT MANAGER 

BUSGIRL 

BUSGIRL 

COUNTER GIRL 

GRILL GIRL 



COUNTER GIRL 

KITCHEN UTILITY 



2,395.44 
2,835.70 
1,248.23 
982.27 
1,771.13 
2,118.76 
2,049.54 
1,730.60 



HOUSE ANNEX t2: 

Coleman, Leonard D. 
Gams, Evelyn W. 
Gams, Juanita R. 
Jones, Julia T. 
Lynch, Darlene 
Magbie, Rosetta S. 
McCollough, Henry L. 
Taylor, Peggy 
Tranmell, Carrie 



KITCHEN UTILITY 

CASHIER 

BUSGIRL 

GRILL GIRL 

BUSGIRL, TO JULY 8 

GRILL GIRL 

GRILL MAN 



1,673.22 
2,181.11 
1,080.00 
1,933.73 
434.13 
1,782.27 
2,209.92 
2,465.90 
2,372.68 



5465,569.11 



HOUSE BARBER SHOPS: 

CAPITOL 

Malcom Brown 

Joseph Quat crone 

Wardell Thomas 

CANNON 

Garfield McMillian 

Robert Sutt 

Thomas Fox 

Anderson Howard 

LONGWORTH 

John Allen 

Joseph Dlpompo 

Camilla Bell 

Harry Klrkland 

RAYBURN 

Eugene Knser 

David Bolyard 

E. B. Southerland 

Timothy Kirkland 

TOTAL. 



770.50 
992.40 
186.50 



1,236.20 
828.45 

1,357.20 
192.55 



631.90 
575.20 
141.00 
90.75 



559.80 
830.20 
397.45 
103.05 



202 



— CO O — ' I 



— a. 

*2 x 

z w 

LU Q 

s z 

LU <* 



as u 

«2 Z 

a < 

o 

LU < 



a. 2 
=> o 
o e_> 



35£§ 

S£§S 

■< X ° o 
u. u- CJ O 
OOP 00 



_1 _l «t X 



■ a. z 
o z 

1 CJ o 



i— io «* f- ^ 
uj = cu <5 

OO CM ^ — I O 

uJ . $ co a. 
a- <2 « g s 

t- o a: z o 

^ 3? r^ ° *-U 

> S"-t- 

P- U > I" ti 

"* Z c- UJ "i 
^ LU qj ^ UJ 

cs; 2 z P z 



^ «t 



z z a ^ ^ 



> > Q. > > 
«* «t «t «I <t 

O O CE Q O 



ggg^Z 

ae oc o= tr 2 

O O uj uj ^ 

^ ,_<<ir 

^ ^ z 5? ° 

<r <jc uj S S 



o 



: to <: _j 



CO CO u. o o 



— * S «t Ht 

lilil 

> il w co oo 

<u-2<< 

Z o o o o 



— . r-- r- o — • 



O CsjfOO 

o o o 



-J 


m 


o — . ~ 


1 


1 


o o o 

1 1 1 


CD 


o 


o o o 






« CvJ — O 



(£(£tnr»«£U>LO(C^>vD 

CDOOOCDOCDOCDCD 







s« 


S" 


oc 








o 




II 


if 


a 


* 

o 


CD 


is 


is 


oo 


a: x 


cr x 








UJ o 











S o g o o o 

x.^. z. x. l 

| 55555 

« CO z CO CO CO 

o «c «c < <c <c 

K S S S Z £ 

3 o = o o o 



CO (^ 

11 

— ^ lujl 
" <_> • o " - 
Jo: . z cr • 

ZL • 8 CO U -.« 8 CO 

<C CO » Q W- 

^ Ijco °ij to 

UJ < uJ CO < LU 



d5« 

: a: co 

ECJU 

: => 3 oe 
o o °- 

O o o a: 
, _| z CD o => 

ur- u ^ O ^ CD 

ss u^o£<s§r s 
1 1 1 2 1 1 1 s t % 



Ct CL z 



S 5S§5 

3 O O CO CO 

=> r; ^ [> J^ 

e 
o 

en cd o o 

i< i-^. ob ob 

o O O o 



^-. ^-. CD 

' o o o o 



,_ O O CO O i 



tO uD <_D «X> ' 



n r*. OOOOi 



u. ooooo 



o o o o o 



op^oo 
oo oo oo cr> <r> 

ooooo 



X O O O - tOOOOOO 

ui «> «^>-<(m Nteietoto 

CTj en CT> CD CD CD CD CD CD CD 

Si oooooooooo 

e 

lD lD lO CSJ CNJ cm oo oo oo oo 

OOO-H-H^^^-H-H 

oooooooooo 



203 



en <t-> *r en i 



i O CT> O *Ti C3 O CO ' 



i o o o o • 



O O Ul o o 

m « w evi o 
— • o o*> *r o 






:°^ 



__ £2 o 

O O _ 

„ 2 ^ ' 

ft >- o_ i 



3?S 



CC UJ O 

uoo 



! d iz "^ £ ^ s! 
! 1 £ I z % 5 

XmQ. OUJ £ 



=V ce ;£ u. . 



> S5 



= = " ;r ic- 



CO o 

UJ — 
0<_= 

2 <-> 



ce o 



uj o 

*l 

=3 o: 

co o 

CO 

UJ OQ 



u. co uL I 

< w< uj 
UJUUU 1 

s > s 5 : 

t— "^ (— ' 



•" ; 



u 



o •< 

11 

a o 
o o 
—I o 



= uj . ; 5 "^ = o =3 

►— uj ;; <k-i- 



e ui n: » ± -i cc z z 

t— t— Or^«^OQ-UJ© 



UJ I 

CO UJ 



S a. z 



a_ uj 

_ o z 

i— <t «t o o 



"wjoJSSoz 

UJ ^ tj tl U_ «3" «5" C 5 (~! 



13 O =3 >- 

tstg 

o uj o a 



" Z Q 2 
UJ — O it 
Z QC O £ 

oa.u.< 



: =3 CC CC 

■ I— => _3 «e 

znn-hn: 
ir o: lu uj 3 



S .com'- 

CO . . o 

O -J >- >- CO 

LU — ' 

ce x o o <±t 

(5 3 = 5: 5 



O O Q O O 
CO 

21 z z z ,«- 

o o o o |2 

O O C5 O rf 
Z Z Z 2 lZ 

X Z X X x 
CO CO CO CO o 

<<<<o 
5S55w 



o o « o — o o o 



I O ~ O O O — ■ O < 



OOO O O « CM — < » 






O O O O i 



>oooooooooooo< 



•000000000000 



a> o «a- <x> o 



o o o o o 



<-> = ;> 

S pc £ o £2 



— CO 

s5 



guiD 



UJ CO 5 S °- CD £ 
u_ S co 52 «t CO CO 

nC LJ CC U UJ UJ 
W«t- JO h- J— 

3 f, cc o a. cc cc 

O uj o cc uj o O 

3Z a. z z cc z z 



z co 

«* o «* — 
cc co cc Q 
o ce o cc 

ce o ce o 



: z x uj 



o •< o 
ee co cc — 

UJ ZD uj O 



cc co ce ^J Lu <-> ce 



! uj g ce co 

.03,0 
:°cojet: 

£!££ 

=> o cc z 

O _E = UJ 
CO t— O CO 



— cc o uj 
_J UJ Se co 

= s = y 



' CO 

UJ uj 
O cc 

ce > 



1/5 CO o CO z 

o=> cc ££ 
z °- off 2 
z jc «, 55 

cc ce z « o_ 

S^3|ct 

°=Scx>oo 

UJ x 3 _c UJ 
co 1- 5 =t co 

3CC033 

o o or o o 



5£iSS 



01 C3 «= 

=> s => • 

££&" 

UJ r LU > 

ce >- ce cc 

to = 5^ °= z ~ 

ce z ce ce o 

J;Cca.;z 

ce 1— ce uj o- 



m . ce 1— ce uj o- 
j o itj u_ "> u_ ce uj 

: z Q wiuj 

• « O j2 *- •" 3Z 3Z 

:>< = o:3«l- 
> O UJ o O O -3 5 

:< jizhcu 



^ z ^ 

< UJ O 

ceg 


m 


ce 


UJ 

X 
cc 


=3 O Z Z Z 




y O CO CO CO 


SzS 


N A 

TER 
ESA 
ESA 
ESA 


O «t 3» 




£ s s s = 



5J555 






> O O CD O « 



100 f^n cn n ai 

-1 o o -h -^ -H -H 



OOOOOOi 



•000000000000000 



00000000 



o ~ ~ ~ — , ~ ~« ^ooooooooooooono 



O O O O O 1 



OOOOOOOOOOO 



'OOOOOOOOOOOOOOOOOOO 



204 



o 
ce 


Z 


u- 


UJ 

Q. 


t— 


X 

UJ 


UJ 


Q 


Z 


z 


UJ 


< 


oe 


l/» 


^ 


UJ 


00 


U 




z 
< 


u_ 


s 


o 


o 



UJ < 



O CD l~~ O O O 



ce ce ce ce ce 
=>=) = = =) 

UJ UJ UJ UJ UJ 

ce cc ce ce ce 

OQQQO 

z z z z z 

«t •< «i <r «t 

O Q O Q O 



^ «t «* <t <t 



ce cc z 

=> <t 

UJ S 

ce S 3 



2 iZ lZ ££ ut O C3 i 



lii 



D =3 Z) ^ D 

o o o o o 
w w v> to w 
oooooo o 

z" z z" z" z~ z" oo z 

OOOOOO—lO 
000000*XC3 



MMCOt/)WWWWWy)WWWW(/lWW(/)WWCOWW 

i o o «* o o o o 
izazzzi 

0.0.0.0.0.0.0.0.0.0.00.0.0.0. 



Q. Q. Q. U O. Q. Q. 













O r-~ 


S 


£~ 




UJ CT> 


CD O 


CD 

1 


o o 




O O 

1 1 


o u-> 


£ 


oo cr> 
CM o 


CO 
CD 


kT> (jO 

o .— < 


uD f^ 


r- 


r-~ cr> 


OC 


OO CD 



O O — • O O i 



O O CD O < 



CD CD CD CD CD CD CD 



300NWOOOOOOOOO 

ooooooooooooooooooooo 






ce if — — — 



O O O O Z LU UJ 

ooooggz 

uj uj uj s ^ -j- 
Z Z Z Z o Q- Cu 
O O O O <_> uj uj 
IIII -J-< 

a.a.a.a.xujujz, 

;OOO^WWliJQ.>-Ho 

IwwwulJjujujIJQ^ 1 






I o o a < 



ccccirccor-iurQ: 
ooooo~oo 

CjOOOOq^QO 
co co 03 co cd co co 

£ S 2 £ 2 £ 2E 2 

^rocNJOmroCMCM 

oo-«ooooo 

p-CDI^-OOUDCnCMCSJ 



UJ ocoo^-o 
o Z 9 Z 

* 5 ce °* O «B 



o o 

z z 



(jCD0DCDajyuO' :uujCDa:), "??i 



CC CC CC CC 



<Jaaa<<<5S5S<<<SJJSa:Q.fl.<< 

OX^UJ«tOOOXlXXjEOOOX3:X-CuJ«t«tOO 



Zj O ^ uj Z i 



1 ^ O O Q UJ ' 



<crujoouj<<<Q:a:o:Q:<<<a: ccq:q:^uJuj<< 
ooojr u JjCoocooo00oooooooooooo u J :jCjCc/5t/3 
cjzoSooouzzzzcjouzzzzSooou 



t> ^!_i;^^^«^^^«^«^^««^««^' 



^ f*^ oo oo en co ct> cr> 
oooooooo 



OOQ(NO-'---'-"''- | f r )n 



oooooooooooo 



' CD CD CD CD CD CD CD 



205 



LU Z 
O UJ 



ce ce a: ce ce 

UJ UJ UJ UJ UJ 

CO (/)(/>(/) (A 



o o o o o 

X X X X X 

Q. a. Q_ (X a- 



UJQ. u 
C_> O > 
5 uj a: 

te = s 

CO Q o 

_1 ■« o 



oo oo ao oo oo 

O O O O O 



r^ OO 0> 

o o o 



— — o 
( — aoo 



z z z 

<: « «* 

Q_ Q_ Q_ 



Cj CD CD CD CO 

5 z z z z 

5 ce ce ce ce 



<: 5 S S S 

O X X X X 

<f ce ce ce ce 



t: "* ^ 

k^ K» ^ 



^ Uj Uj Uj 



** t T 

^ ^ i^. 

S= 2=3= 
s> s> & 






q J 00 OD CD 

u * ttt 

*i^^ ~" m m m 



O Z «r Z 

j UJ 2C UJ 

—i c/) __ c/> 

* UJ ^ UJ 

_, o o o 

2 °2 o S2 

uj o £ o 



o o o o o 



Sf lT> f^ . 



ooooo 
ooooo 



» O O O 
r*. go cr» 



206 



o o o o o o 



O CD CD O CD 



— . *» — o 






LU O 
Z O 

5^ 



S2zi 
S "* <-> 

12 



C J 


I 
















=> 




Z 






■a. 


C3 




CT 




« 


^ 


2: 




?■ 



£ z 

z ^ 

LU Q 

z z 

LU < 



GO U 

*2 Z 

a < 

° O 

LU < 



z z z 

o: cr £r 

O X3 O 



ccccctccaiLtcruroraLLtccLtctiaia: 



«t <: «* <t «* 



0:0:0:0:0: ^ 

QQOOQ __, 

ZL Si Z. ^. Z. uj 

<t «t <* «t «t >. 



QiccQiQiccccccccccccccorcccrccQ: 
00000000000 " 



o: o: or a: o: 
OOOOO 

gggggggggggggggg 
zzzzzzzzzzzzzzzz 

OOOOOOOOOOOOOOOO 

0000000000000000 



O O O O O O O 1 



a Q o o o 



LU __j O ' 



OOOOOOOOOOOOOOOO 
OOOOOOOOOOOOOOOO 



XX xxxx 



O O O O 1 



II I II 



a: a: a: 

LU UJ LU 
GO GO to 



OOO 

XXX 

Q.O.Q. 



— (NJ CO OO OO OO VD 1 



O O <=> CD O 



OOOOOOOOOOO 



«t OOOOOOOOOOOO 

COCOCOCOCOCOCOCOCOCOCOCO^j 



* °- "- °- Z X 

a x x x 1- z 

■^ a. a. a. to £ 

« CO to & ^ ^ 



t «t «t «t «t ■ _ 

OOOOOOOOOOOOlu 
OOOOOOOOOOOOz 



XXXXXXXXXXXXt— z xx 
cuCLCLCL.a-a_a_ci_o_a_a_a_</)£a.a_ 

UJUUJLUUJUJIUUJLiJLiJUJUJZr]UJUJ 



•— ■ 

O00S 

S2u 
o <=> z 

►— >.i o 
UJ a. ^ o_ 

* £ «■ *- 

3 LU O a. 
_1 O. <t o 
« «* O >- 

z 2«tS 
J5 X to UJ 

2 o o z 



>ooooooooooooooo 



207 






o en OO uT< ■ 









O co *I3 co o O i 



g 2 



■ a. J" i- P 



a: 2 ** ^ 



. CO 



oo 



ULUUJUUUJUJLlIUUUJI 



uoooooooo<c<:**o 

^Q-Q-Q-Q-O-Q-Q-a-OOOQ- 

r UJ HI U UJ UJ UJ UJ U UJ LU U LU 

f^o-^-^ — ^-^-^-^ — .0-h« 
OOOOOOOOOOOOO 

1 I I I I I I I I I I I I 
0000000 000000 

«<Ors.rs.rvxaOOOf^oo<flrs,» 
OOOOOOOOOOOOO 



z Q- ■< z 

5 o E ° 

S ce •"" « 

u. o o ce 

°*^ 

z co z S 
uj a. o o 



CO CO = 




00°; 


CO 














00? 


xi >— 

i = 




z 


00^ 


s=> 






§°2 


S C£ 


000 








Sf> W = 


z S 






S S <r 


C£ CJ 






— . — . o 

r- OO CT> 
OOO 



gg^g 


10 

1 


- 


- 


CD 


- 


O O O O 

1 1 1 1 


CD 
1 


CD 


OO 

O 

1 


OO-- 


O 


O 


CD 


CD 


- 



OOOOOOOOO 



i§ 

O Q- 

O CjJ 



S £ S x 

000 a- 



s; ij «c ?c «t 



^oQZZZZQol^^^o 
uj^-^OOOOt-ujujuji- 



o o 
o o 

CO CO 

CO CO (_ _ 



0000 



J Jj|j<«8000 

u, ju u, ui z: — — — 



«a 



= 5 ^- * * * * ": s = => = I 

ZujOceaccecrOujZZZuj 

Cea_<0000«*a_Ct:Cecea_ 

-<0>->>>0<aJUJli J < 

^iwuwSljcoiw^cijx 
5oozzzzoo555o 



•^ 1 •t 

Z kiCuk, 
«t § 5 5 
J HI 



£= S 8= 

^^ 

O O Q 

c; C: fc 
5 5 5 

CO Co Co 



Sujuj^^ujujujuj 

2^ 00000000 ^ 

^ z ccfxcrKCtccirLcS 
j£ ^ m m ii iH m co cd in ' 

_i S 33^3333* 



O O -— — • -^ ' 






OOOOOOOO 



3 OOO 

a 

UJ 

— . _< o 

'*•- 06 cf> 
000 



O O O O 



208 



ONOOO 



— * OO r— kO — i i 



ownuioom 



■ (JD <£> <JP CM I 



*2 x 

UJ Q 

s z 

UJ «f 

ce •/> 

= IU 

oa U 

£ Z 

o < 

° O 



ce o t 

t? UJ LU UU 

U > _J CO 

z dl !# «"> 

o — 1 z 



UJ 5 

zi o 



2 ° 






06 2 

2j| 






O CO 

z cc 

«t =3 



0B O 5 UJ 21 oc - 



oc o- 
ujco 

OC UJ 

CO z 

CO o 



iSgS 

qhZ_ 



ii : 






o o i 



;£S! 






CO UJ CO 

= S => 



•- O co ; 



= 5 

CO p I 

oc o- ' 



3£ 



i < = 
ce oo 



O^^^S^HuJiruJCO 

ooqccccccSoccoco 



xZuuu 
i— o cc m ce 



ce e> ce 
Uu> 
z o 

< ^ ~ 5 

U-lZ j 

>■ o o lu 
o o I »— 



o o o o 



O O CM O — I CM CM — • O O 

O OO OO CD O O O O 

I II II I I I I I 

*J3 f^. O «) CM — KNCM^nCM^OOtDOOUJmPO 
^O^OCMO-*^OO^OCMOOOOO 

^ccinujknininin^rinu^csi^'iocMcoicu) 
oooooooooooooooooo 



UJ 



(- H «t •« H 
« uj cc ce rj 
t» £ o o £ 



l^Siljllj 
i ■"* i; io 



«* ce > 2 — ' 
S uj ce S — 



<lli Jo 



z => se = «s 



zmio" 



>* _ = >- = ce 



5: 

3« " e: 



o 2 
o o 






i=; o a: == i 



o ^ I 

z ■> i 

o cc ' 

o o 



z z 1 z * 

s as°22cc E 



O O O O O O O 



cr> o i 

O —■ 
CD CD I 



I CD O 
• CD CD 



ooom««' 



ac oo oo 



ii o CD o 



CD O O O CD CD O I 



lOOOOi 



i CD CD CD CD 



209 



o o •/> m O i 



i o <jD o o • 



ooooffioro^woooo' 



CD O U3 O i 






O K- 

X oo 

5§ 



o o 

5g 



|_" CD 



UJ O 

II 
_ i 
o go 



z 2 



CC Z CJ 
O UJ X 

kq: lj 
ujUjcc 

O o uj 



' O =3 «J 



GO Z Z > 



|55l 



c_> o 
°go" 

>— go «* 

GO = 3E 

QOq, 

°= 3* =» 
o 3 «t 
u_ o C3 



o o 

GO GO 

z a: 
o <_> I 

CC lE 
Z3 => 

a. a_ 



O tt: z o O O 

; i— <c ^» u_ u- u_ 



;ooiiii5 



= «t o 

— ) Q UJ 
JZU 
O « «£ 
Z -GO 

LU o O =3 

S 1 ?^ 



UJ UJ UJ UJ UJ I 



£ O 
£ GO CC 
Z CC < £ 

UJ GO £ 
UJ CD 

S => S o 



'«3 

- uj • £= 
5 o o o go a. 
2 uT t ut z 2 
o 

ccuo 
£ cc cc 

GO GO GO 
uj ° ° 
^ CC CC 



y y y k < 2 



GO GO GO o -=- CJ 



-- «t •— >— G- U. U- 



cc cc cc o o o 



uj uj CC uj uj ! 



up o — — a> o 



— _j£*TCCCCCC_l_l_lCC_l_lO— J< 



; CC UJ UJ 
: U_ Q_ Q_ 

„ a. a. 

: °£ = = 
;< w w 



. f- z "J «J — « _ 

uj = h- z cc z 3 
i uj i o = a. =j — 

i£ui j»Zj 



z2=9=z 
5 « « 5 

'S ** «* .5 

|oo| 

£ « 3: •« <t i 

w<<<<< 

UJ >• > 2» > > 

^ a_ o_ o_ a_ o_ 
S cc ce cc cc cc S 

O t— ►- t— h— t— o 
X C3 Q O Q Q I 



GO « 

So 
a. z 



S E 2c 

CC CC UJ 



IO = Q. = = = = = 00000 =)(= o — — ^ 
^2Z_|CCCCCCCCCC_I— <_|C300 






oooo 



~ CM O CNJ — 



o o o o o 



- O O rr - 






i-hoO COCOOi 






iryi^^inChOr^nnnvoiCNj 

oo-o-no-rM-o- 



'OOOOOOOOOOO' 



> O O O O < 



u3aOl0OO(0r-~.ooao~uoi 
OOOOOOOOOOi 



«3 us r~ r~- I 






OOOOOOOOCOOO 



« 



. . . a ■ . ■ 

g : J S : 

o : : go" : uj u 



o 5 oe cc ►= 



uj S fH i 

OOI' 



25 



2 => 



: o o o 

| CO GO GO 

! > > > 

■ O Q Q 



o o o 

^- ^ ^- ~r *■ ~ 

«t «t « 5 « "c 



5i2 

<;«'*zzz^i™ 

2_cc | - ,_ u:u:u:52q 



JJJJJio 



z <t £ «t «* 



t < «t < «t 



— uj 2 O l 

2 99 >• >■ _i ' 

O CC O O CC 



>"lfd 



r-4 -J S -I -■ < 



sicdq — ^**-x«*cc<x:«x:x 



QOQ<tCiQK-^— I I 



u-u-u-xxocogocqcc 

«t «t «" 5 5 > cc ?- cc £ 



55' 

«t « o 



> > > 

<x <x <x 

CC CC CC I 

Q G DQ 



S •< •< QO 

1 = ^ 

i « o o = 



* ' 3 5 5 3 3 ^ | ' ; 
53Mcf i 



zz3 

^ <t =3 
O O X 



x x x x a. < 



C.O (j0 t£) I^O (0 < 



,oo^_^-.^-,oooo, 



icnocno-^04fn^in<of^i 



O O O O i 



'C»OOOOOOC300CZ>OC300i 



• oooooooooooooo* 



OOOCSOOOO 



OOOOOCDOOOOO' 

oo co cd ao oo oo oo oo cc co co ■ 

ooooooocooo 



UIOOOOOOOOOCNNCNCNCNJNMCMI 
^C^C^C^C^CgC^<NjC^<NJCViC>JCNJCSlCNICNjeNICS|( 
' 0[> CT> CT> CT> CT> 0> C7> CT> CT» C7> CT> C7T) CT> CT» CT> C7> i 



oooooooo< 



OOOOOOOOi 



iCsimrorocncnr-oocDOO 
iCNjcNjCNjcstCNjcsicsicopncomfn 

'OOCDOOOC3000CJC3 



210 



a: ex. or cr. 



— a! 

£2 x 

z "* 

uj O 

se z 

UJ rf 

C/> ^ 

ae </> 

3 iu 

m U 

2 Z 

a < 

© o 

uj < 



«t «t «« «t 

x x x x 

=> 3 3 =3 

=3 =J =3 X) 

O O O O 
Z. X X ^ 

o o o o 

X X X X 

o o o o 
cj> o o o 

a Q Q Q 

z" z" z~ z" 
o o o o 

oouo 
zzzz 

X X X X 



KKKKa: 



ccaaaacrirQ: 



zzzzzcca-zzo-zzzz 

oooooo<oo<toooo 

xxxxx,,a:xxcexxxx 

(j-Q_o_a_a_ L HOa_a_00-a_0_a_ 



cc or 
co oo 



o o 

X X 

a. a. 



oooooooo 

I I I I I I I I 



o o o o 



O O CD CM 
to tO CO CO 
O O O O 






O O CD O O O I 



O O O O — . o ~ — «i 



oooooooooooooooo 



1 = 25 



^ <t Q O 



z •< <i z z 

o ^ ^ o o ! 

x Z X x x . 

o_ o o u_ a. 

UJ o o uj uj 



3 3 

-J O 





z 




z 




LU X 




o 


o 


o 


2 

o 


^2 




> 


<_> 


>■ 


c_> 




Q 

UJ 

o 


LU 
Z 

o 

T 


o 


z 
o 

X 


























« 


z 


(— J 




— J 




* 










JC => 


o 


a 


Z 


o 


z 


:,? 




«t 




<x 


































< 




-c 


















t'j 


E 


o 




o iS 


















































=> 




















cr» cr> 


co 


<=> 


CD 







z z z 
o o o 



O O O U0 I 



S £ 

o o 

o o 


o 

UJ 
UJ 


o 

UJ 
Z 

o 


CJ 
UJ 

z 
o 

X 


z° 
?3 


Uj 
O 


a 


























































3C Jf 


Zj 
















z 


z 


z a 


O 


rj 






< 


■« 


« •< 


«1 


■a 












i") 


O 


CO CO 















s s s < «* •« 



-^ o o o i 






O O O CD O CD O 



0O C*» C*> Ol CT> CT> O O O ' 



211 



to (A 


is 


u-> 


o-) 


o 


u-> 


uS 




m 


ro 








01 



OOlCO 

o o i^. 

--i CT> CT> 



I o o 
o — * 



i2t 



GO CO 00 


az q: 


UJUU 


«* Q y 


O O O 


g^E 


> > D> 


q: q;q; 


O U- _, 


UJUU 


— o £ 


CO 00 00 


u. z S 


CC CC CC 


o <: _> 


UJ LkJ UJ 
1— t— t— 
=> ^ ZD 


5?§ 


Q.Q.Q. 


*— »— O 


2 S 2 


2?o 


o o o 


a: cc ao 


o o o 


Q_ a. -- 






£ a: 

UJ 

</) o 



o <t 
2 ao 
a 2 
z o 



9; O 

I tf w - 
L JuK 

= £ - £ 

Sgwo 
cj a: o o 

^ o= 9- £ 

a£ «* 9= = 

<x_i o: 

Q. O O O. 



O O 

o o 



n or> — * — < 



o o o o 



t ** ** 

UJ K. J^ K. 
<-> % % % 

^ 111 

^ HJ %<J HJ 



<3 <3 <i 

tt Oc oe 
3 3 3 



** 1 "* 

^ i- x. 

s= s= S= 

Ill 

5 s> & 
c c: C; 
55 j 



z z z 

>* <t «t 



2 ? gig 



J 2 <<< 



* to O DC 
S' o: -; > 

I sis 



« 9? 



— C-0 o 

a: oe 



2 <ujzJ; 

<S» CD UJ < CD 



° _i _i 



_ o o o 

t ° ^ ^ 



* o oo 



O «*» o CD O 



Ck, «oo o 
x o — o — 

o-> o •»» ** 



oo «o U) ic 



Si o o o o 



'CMO O 

r^. ob ob 



CO CD 

CD CO 

ob cf» 

o o 



212 



oci^ooMtfKnoo-ofvrs 
o^o*roor^vocr>u->o<7>CT>or-~-«r<D 



CO o o — — " 






— . O CO — • CO — • — I 



Hi s 
£ 3 



— a. 

«£ X 

z m 

UJ Q 

s z 

UJ rf 



as U 

<£ z 

a < 

o 



a: a: a: or 









S 
















CO 


co 


CO 


CO 


CO 


CO 


CO 










CO CO 














































z z 


Z 


^ 






** 


«*" 


^ 


«r 


-' 


.*- 


n 


«' 


^ 


«' 


a 


«' 


S 


^ 


S 


<* 




a. z 


o o 


< 1 


c ) 




c ) 


c ) 


c ; 


c > 


c > 


<. J 


u 


1 


t ; 


O 


a 


<i 


o 


c. J 


C > 


<. > 


C > 


( > 


«* o 




X 


J- 




-I- 


-1- 


-J- 


J. 




X 


X 




X 


X 


j. 


C3 


X 


J- 


-I- 


-11 


-C 


-L 


CC X 




13 




















n 
































ro co 


CO 






























ro 




































■■n 
























CD cd 

1 1 


1 


1 


o 

1 




" 






" 


" 


I 


" 




1 


i 


CD 


CD 
1 


CD 
1 


O 
1 


I 




1 


CD CD 

1 1 


o o 




CD 


















CD 


CD 


o 


o 


o 


O 


CD 


CD 


CD 


CD 


CD 


o o 


CO i^> 


■o- 


— 


— 


UD 


■X' 


uD 


1X3 


r» 


id 


CO 


CO 


f- 


en 


CO 


r» 


1— 


r- 


CD 


CD 


CD 


CD 


CO ao 



— . « o 

en ro co 

r- oo CT> 

ooo 



• o o o o I 



O O CD O O O O 



o °- I 
x S ; 

, Q_ O I 

: o= ^° ! 

Z IUJUJII 

o : > *"~ tx. i 

> : S o 
Q j ^ o _tj ! 
lu uj «t k- UJ i 

* co z ^ = : 

— * < $ a: a. o: 

* ox < < u 

£2 <" d > u « I 

g CO O fc X tU ; 
H O CO OO O S i 



Z LU 

« z 



ZHXUc. 

ce 3 o= 



: [Ij iHj co co ce 5 w 
:•->-> >£o:f £ 
33d°°|^ol 
cd co as u u *" — ? 

ccc<o:55 <t 2° i1 ' 

uj u u s ± tr ^ „, ! 



x z 
a- o 

CJ cj uj uj 

! z .zz z 



s < 

XOOZUJ«EZXUJOXZ 
»— . -< ^ W rf h- I- . I— rf 

owooccyiccoywoo: 



z u 
«* z 
fe o 

UJ UJ 2 x 

z z o O- 
O O o UJ 
S if X UJ 

_,__j.32 = 
id id i-j -ti o 

Ul UJ LU UJ I— 
COCO CD* - O 

UJ UJ UJ z UJ 

S S S ce o_ 

X X X UJ «t 

Z3 -3 X> f> UJ 
OOO' 



So 



<-> * * Se- 
al ^j iy S*j 
■« ¥55 
* S £ S 

-j O 05 <Dj 

« V<< **J bi 



O O O « ^h -■ o 



O O CD O ' 



CD O CD O O CD < 



— . ~ CD 
r~- ab en 



213 



oo «— ~-> ~- o ■ 



5 * 



CC ac ac ac 5 

???? o 

cc (£ o: tr ^ 

aooQ _j 

z z z z UJ 



O O O I 



^oooozlooo 

>0000 > 000 
ZCVJOOOOzt/J ^ 00 

<t<t«i«a:«i:«*«* 
°SSJS°SJJ 

^oooo^ooo 

|— (— )— I— qI— I— I— 

_ z z z z .n ^. z. 






Xxxxxxxxx 
^■■z.z.^.z.^.^.7C-z. 









o 


O 


O 


r^ 


r-L 


ri 







































o o o o 



i ~-< O U"> CT> ^o 



ooooooooo 






oooooooo 



^ ^ ^ 

^ X i- 

9= P= f* 

III 



<<<<<<' 



B OOOOOOOOO 



OOOOOOOOO 



ii 

O Q- 



o oo 3 O CO o 

S S ?5 < S a 

O ° Zj O ° O ' 



Z oO<04<4<oS 

i—i <r <£ - <r ■ o- 

O Z uj O i 

<Ouj<0<i 
«* to . •— i/> _ to 

_ lii tf (O UJ < UU ' 

35 I CO ^ ^ co I i 
2 o o 5 cj> o o ' 



—i o.<a:a.<Q.<Q. 



^ o o o 



ooo— «ooooo 

<JD o o i — ^ r-. r- ^j- (^ 



o — — O — ' 



— . — . o 

r^. ob a> 



— * CSI Csl O ~ — <~ ■ CNJ CM 

■ooooooooo 



oooooooo 



214 



— Q. 

£2 x 

z m 

LU O 

E I 

ae «/) 

=5 111 

OD U 

<2 z 

o < 

o 



St/icoztocozSo 



OOOccOOceO 
OOOQ-OOQ.O 



O o t 

°- < UJ 

— 5 <£ 

£-"§ 

o: °. ro 
a. ir> — ■ 



— ■ — • m o i 



OOCDOOOOO 



U, Uj U) 



<J % % % 

s III 

•« ki ki ki 



s= s= s= 

s> & s 



* OC/Ot/oOOOOO 

-J "~. Z Z >S - - X 

" "> z z 25 <"<" £5 •" 

?J a-OOxa.Q_xa- 



* z 
o — 

i t o o 

* £ «* <t 
i <t S £ 

O DC <X- •< 

— oir a 

2 g Q=a: 

5 z > >• 

S a: t «t 

5 too 



3 o cd cd 



« cd o cd 



__ ~. o 



— . _ o 

fn po tn 
r>. ob en 



CD O O O CD CD i 



<X> CD est 
CD op csj 



215 



o o o oo o I 
o o o o o <=> 

OOtT) O O W* 



OCC^COO^OO 



O M CM U") 



. .— • 0"> •— •■— • 0"> O U"J O 



§| jl| 



o tr. o o ce o 

^ o ;z * o cz 

o >- £l o s- u. 

i±! £ UJ j±J £ UJ 



E n J v ' 

»"-o?°<t-i- 

LUuJ— |0, Jlfcl 

2S U "SS<->o:q: 

r^ OO _ OO Z O CO GO 

J><lil3Ll<33 

— auuKEiafi 



: a: -_ z 



. *- o 
: z q. o 



: o >■ 
: a z 

: z" >f 

o t 
I— o 

I ;_ O Z O O O 



z z z g o o ^ : a 
oooSzzg.z 

cececeozzog 2 

lOOK 
0£ O O CC O C3 O 



o 2 ° 

zaz 

oo tt; oo 

■< S ■* i 

s5j 



o o o 

O (J o 
-ZZZ 



— . O — ' 



O O O O O i 



O O O O O O 



oooooooo* 



OOO-WO'-'-O 
OOOOOOOOO 



o — * — • o o — 



ooooooooo 



o 



o 



* J^ <-> = Jj^ <-> = 

S UJ >- "* UJ >- * 

l^zit^z 

<=> _l « o 

c J S ^ £ 2 



_i < UJ QD < i ' 

^ ^r o o= ►- q ' 



go 



o5=o5= 



OO UJ 

UJ ~ jOUJf-J 

uj 5 = -oe°i- 

I isgciiu:? 

_J _. S o ^ X ^ °° 
,- LU o — I O UJ O T- 
*2 Z CO CO C_) CD X I— 






I^><0J30| 



o o o o o o 

ce en en cc or or 



OOOOOOqO™ 

uujuuujuj-lu^ 



u. o — • o — — o 



*"*-oor--oocr>ocNtco^-ijn^ocr>r-.ii">rtC\M 

OOmuii/HOCNJMMCSJNf^OinO^CT)' 
O— ^OOOO— •«•— « •— < .— i O O <— « O O < 

^OOOOOCNjeNCSJCgMcn^lDtO^i 



o o o o I 






O O O O < 



O O O O O < 



w» csj oo oo oo oo ~^ •— < -^ •— < -^-» o o o r-»» r-«. o o 
O«^^«^^««««rorocsjcsicsirr>ro 

oooooooooooooooooo 



OO oo oo r-» r^. r»«. 



O G OOO OO 



96-500 O - 78 - 15 



216 



-hOI OOi 



OO O CO *f o o 



LU Q 

3E Z 

as «/> 

=3 Ul 

00 u 

22 Z 

a < 

° O 



x o 

« 5 

5 z 
o 3: 



013 
o 5 o 



OKMOI 



S5 

Q >- 

oc z 

, = °~ 
C3 3 

3* 



o «t o 
z 0= z 

GO 7^ t>0 

§31 



OO O OJ CT> 



(rQ:Q:Q:Q:Q:a:0:Ct:Q:0:Q: 

zz:zzzzzzzzzz 

000000000000 
xxxxxxxxxxxx 

Q,Q_Q_0.0-0_Q_Q_Q_0_Q_Q_ 



O O O O 



OOOOOOOOOOOO 
^yDtf)<DtDrs.r>.ps.rvps.oooO 
OOOOOOOOOOOO 






t= * 



— ■ O 
' 0O CT> 



000 

r^ 000 

o o o 



o o 



CO o 



O CL Q_ ^- -r 

zuu<< 

^00: 



o o 



00 ■< «t 



o o 



000000 
tx tx oc tx cc cc 

rr\ m en rr\ rr\ m 



OOOOOO 



X I O X X , 



* 2 = ^'-: 

o rt —- 3£ 5E ' 

-1 O- «J O O 

<£ ij!<S J 

S X CO LU UJ 

2 O C3 z z 



O < < 3C 3C 

u UJ lu ac or 
J2 a- a- o o 
5= « « >- >■ 

«t UJ LU * S 
CO X X LU LU 

o o o z z 



t "* 'I 

«5 * * * 
JE Lu Lu Uj 
« % % % 

* £ £ £ 
3 O Q cs 



555 
So co eg 



iOO«-' 



> O O O — 1 



I o o o o 



1 o o co ro o cni 

1 00 00 CD CT> CT> CD 
OOOOOOOOOOOO 



— — O 

r^ ad) 
000 



217 



o I o ooooooooo 

iT> U~> OOOOOOOOO 

ix> (xi bu^bcicsio^>ooi 

CT> Cn O O <— i ^ID OO'-'ff 



OOO^OOOOOCOOCOO 

(T»r s -kf>ibc , jbf , JOtf> — — 

V ^ ^ fhiT) -^ ^CMOO 



O CO 

Z LU 
LU CO 

°=q: 

CO UJ 
LU I— 

o = 

II 

CO o 



: ae t= "J 

' I— CO — J 



2 o 



O — • — i ^ o 

0-1 z — - — - « ^ z 
2g< £ _i22 



: cq co 



o „ «t = 
— i a. rr 



_l = =i o 
O CO O I 



d °° — — 



s o? 



CO CD 

o o _ 

oe ce c3 

UJ LU — I 

_J_I -co w 






Ss2s 



I D < < OO ; 



O -* 2 — 



O O O O O OOOO 

I I I I ^ ^ ^ ^ ^ 

OOOOO OOOO 
r—. r-* r-- r-» r««. oo oo OO oo 

ooooooooo 



— . o — • 



O O O O O O I 



o o 

z z 

CO CO 



; or o 



"> * 



s «* o : "Zi z «t o 

* Ol-Ou-Soi-Ou. 

S <^LUSS<^U/C 

■>- co •« ° — i- CO «* ° 

— i CI ceou.^ or o 

LU OjII—lO^II 

OB O "* I— 1— O O <t I— f- 






» o5 

« LU<=> 

* DC H- 

O uj y "' S, "- 

-j co ce o z h- 

"". o £2 => S lu 



O CO 

<t o E ■*! z «t 

> IF 



s°^o! 



K NJ U — < 

t t-UJUZ 

1 O U < I DUJ 



U- OOOOOOOO- 



*T OOOOOOOOO 



3 oooo< 



o — — • 

CSI CSJ OO 



OOOO 



o o 

co en 
cb CT> 

o o 



O O O O O « 



CMCsjU->000000000 
f-. r~. OO CO OO OO OO CO OO OO OO OO 

oooooooooooo 



218 





0. 


»— 


X 

LU 


LU 


Q 


z 


z 


LU 


< 


ce 


t/> 


=> 


LU 


00 


u 


CD 


Z 
< 


U. 


S 


o 






Uj < 



CO CD CD CD i 



I CO CD r*- OO ' 



OCDOOOOOlOCD 

i^ooco* j r>r*»poo 



St 

oo° 

s 3 

z i±i 

o £ 

<2 

ce _j 



22 



= «2 it 



S o= _) 

uj Jr «t s* 



co^cz 
i - o= ! 

? CE O I 



— uj z o ce z i 



i o o 

!£&! 

ce ce • 

i co oo ! 
i co go : 



i Q_ CO Q. OO CO 



z 
z z <: 

wOgUJ 

UJ t" t" O 
o_ =: 
<tr_ 
a. o o =3 



z co co > 



: o ce 

: > uj 

£c ^ 

UJ cj 

CO — i 

M ce 

9 52 « 

ce <c uj 

< or _i 



Q_ CO 

a. co 

ZD =3 
00 oo 



— . CD ^ CD ^ — < 



O O CD O O 



o^^^o^o^^^! 









O CD CD CD O < 



. CT> CD 0~> (j0 co CO «"^ < 



aoooooewcnoocnooaoi 



>OOOOOOOOOOOOOOOOi 



> CD CD CD CD CD 



°- ce 55 
oo <r Lj 

lis 



2 z 5 
°- o o 



£" 






ce «t 
"J o 

« ce 



UJ ^ co 

cr o 

« => a. i 

z o ,. ■ 



o z 5 I 



!° = 



CJ $" 






'Qh-U 

; a co z _j o i 

, = lu SJ 
> ce 5 o x n i 



^2- 



: a: i 

r UJ CO 

: 2 S 
S' 5 tz i 

QMO.. 

S £,•--< 
H en S 

= o ° 

0O X CE 



cecececececececele 
ooooooooo, 



cecececececececece 



x.z.^^x.^.<^><£ 






£ • o 

LU <_> 
CE = l_ 



LU O 

^2 
ce ce 

co o 

cc >; "j 



CO oo to 

CO CO CO 



O O O O O O 



CECECECECECECECECE 



< = 3DJ3333D3iijDi- 



CE °- „ 

>- X ~ LU CE LU 

OM3h«1> 

z t ^ «" *. >; 

^JTK NZ W 

<" °- J3 •- => z 

LU CE CE Z SI 



CMintDrsoOOiOr-.aiO'-iNr^i 
O^OOOOOOOO- 



lO-.««OOO^i 



1 CO CO CO CO tD I 



OOOOOOOOOOOOO' 



oooooooo 



O O CD CD CD 



OOOOOOOOOOOOOOOOOOOOOOOOOOlICvICNICNiCMCVJ 
o^rocoro<^coc^co<^rococ\iC*iogcNjcNjCNJC\j 
obooc»o6obc^e»obobobo6abobobobcnc^o^ 



OOOOOOOOOOOOOOOOOOOOOO' 



219 



O U") <T> O i 



OOOO' 



**: o <t 



o <t o «* 



•^ C_J <*. c_j «*. t_j **. i_j **. w ■*. U **. t_> 
Q_ q Q_ O O- O Q_ i~> Q- e~\ Q- rt Q- f~\ 



>■ cj > C3 > o > 



o <c ri 



^ O 3 O 



= tz o — 



O . > O _j o 



O o f o <J o tJ 



^ oo ^ co ^ < 

fc>ir >k 

O o <-> o <-> ■ 



yss 



: y z S 2 " 
■ 3 O . O ^j 

> o S o > 



to — t: t: 
<c o ^ o ^ 
<t 3 i— <t i— «t 



wOOOO^OouuO 



O «J O <J 

o ^ o *"" o 

•— "S ►— <t I— 

o^o - - 

r Q uJ Q , 



-1 ? z" -1 z" -1 z" -J z" -J 



=*S ^i ■£ =i 



i— — = = = = : 

CO S (/} to CO (O (/) 



<: = =3 -J ! 



0>0>0>.0>0>.0>.0>. _0>.0>0>0>.0 
^■-iZujZujZujZljjZuj — IZujZujZtijZujZ 

J Ott;oOtt:oOQ:5 c/5 t^ 00 Qi 00 Q= GO Q£00 

3o3o3oSoSoSo5c_>u-5o3oSo3o3 



— o — -- I 



OOOOOOOOOO' 






O ~ — — • i 



o o o o o o < 



•OOOOOOOOO' 



=3 "> Q. 

o ^ cc 

ill 



j£8 j «5j5 



ocuLQCQcacQcacacacaLcc 



acacacocQcacacQc 



)UJ (Tl 

> i o ; 



: o a; g o_ Q _ u. 

• t— O O ►— QZ 5 t— 



<t<:«i:<t<£^<'<«*:<:<£<:<E«i«i«t<*t«t'<'«*<:«^ 

OOCOCOV7COOOC/>COOOCOV30000C^>*~COOOCOOOCOOOtOOOO 

:c:ca:^3:;E:x:r:r:i:x:E CD 

Q-Q.a._jCLQ.CLQ.CLQ.Q.G.'£ / 

oooooooooooooo^jooooooooo 






i o o o o i 



CMCNtronr-r-.r-.CJO' 



O O O O O i 



OOOOOOOOOOOOOO^ — ~« — « — «« 

ooooooooooooooooooooooo 



220 



Jt 


«/> 


O 


Z 


LL. 


in 

a. 


i— 


X 






UJ 


a 


Z 


Z 


UJ 


< 


a: 


</> 




Ui 


co 


U 


S2 


z 
< 


U. 


5 


o 


o 









o 


o o 




o o 






en 


cr> cr> 







MWOOV)COCOC/)COCOV)COCOW 

UJXUJUUJUJLLlUJUJUJliJUJLiJ 

z:a.z:zz:zzzzzzzz 

o«tooooooooooo 

Q_OQ_Q_Q_Q_Q_Q_Q_Q_Q_Q_Q_ 



** 5 
* *- 






o o o o o 





1 


\ 




1 


1 


1 


l 


1 










CD 


CD 


CD 


CD 


CD 


CD 


CD 


o 






CD 


o 


CD 


UD 


ud 


uO 


CO 


UD 


UD 


r^ 


r^ 


r*. 


en 


cn 


en 


en 



O O O O < 



O O O O ' 



o 

1 x 
a. a_ 



SS — — ° — — — 



t <: 
E E 

o o 



; i— o o o 
' a- x x 



_ z z «c 

<t «t 2 «t «t < 

o-o-S^x^;^ 



z z 
«t ** a. a. 



JT ac ac uj uj j 



— ' ^ o: o. < < o. i 

« o uj <t cr cc 

g UJ ^J X UJ UJ 

2 CD JOUC3 



OUCOCOOCOCCCD 



ro — • o — • — « 
o o o o o 



'~CMOOf»>ro^t^i 



• ooooooooo 



* 4: % 9: 

^ o <a o 

* ^ ^ ^ 

3 fcEifi: 



_ ^-, CD 

r^. oo en 



III 

So So So 



221 



O CD O r-** r-* CD O 



O O O O O O O 

i cm eg CM CM CNJ CNJ fsl 

i <T> oo in •— • o to •— « 

. oo cm r-» ro CD CO -^ 



r- Ol 0> U3 OO CD 



CM CD — ■ 






St o 



:<r p 

; lu •*- 

! & x 

■ < o 



o t3 «t i" 

-'«, Q 
O "" ° O 

i— z zz uj 
£ uj « rr 



Q O <t Q 

z" z~ o z 
o o o 

r— r— r— of- I— —" H- 

uuu o o s *9 



o o o <t 



i gj °° uj £ uj _■ 

^ ? t o > a 

5 lu z 5 5 o: z 
: z lu o * qj o 



?5 

I O o 



«* «* T ^ 
o o $ o 
q o o o o 

' y CO (/)" OO (/) 

I = UJ UJ U UJ 



z 5 



cj O O O 



a: a: cc cr. en ac 

UJ uj uj u UJ UJ 

CO CO CO CO CO CO 

LU LU UJ I UJ UJ 

Z Z Z Q_ Z Z 

o o o ** o o 

3: x n: cc x x 

Q_ Q_ Q_ O Q_ Q_ 






CD CD CD CD CD 



^^ CD -^ 
CO CO CO 

CD CD CD 



•— « ^^ en cn OO CD 



CD CD CD CD CD CD CD 



oooooooo 



CD — ■ — • CD CD CD 
— • to ro co UD r-» 
CD CD CD CD CD CD 



3 u o= ^ 

z u. oo £oo; 

* o >- t— , _, ! 

* >- =» <£ <* <c ; 

^ «t Q £ = S 



~^ — — » CD CD CD CD 



Z Z Z <c 



o o o : o o o 
co co co : CO CO CO 
or cc or • or or or 

UJ UJ UJ 

o o o 
z z z ^. 

<Xi*£.*t.j£<X.<<.*Z{x 

zzz — Z. Z. Z. >. 
z z z z z z z t- 

vuiOMoocnooo 
nn«rov^r*fO 
oooooooo 

U>(00(J3n^COO) 
OO^^uTiuDtOCOCO 



o 922°- o 

x t— t— S x 

o_ «t ^ O O- 

uj or or o ^ 



, SS«C„ = 



UJ CuyO^Q-^ 

3E ofl > > O <"cl < 

J UJ £ £ Z uj s 

* at co co => ^ 

o ** _J _j 2 <: - 

—J o.< <a Q.< 

< < ce cc ui<o 

!£ ui Z Z V) UJ < 

2 f-> cj o S o cj 

^ CD CD ^- CD O CD 

~ CT> CO ■* OO CO ««*■ 

3E en o o o - cm 



« CS^ !— I U-i \-> CM ~ 



CM CM CM CD CD CD UD 

« -h -. -. (») n -< 

f— » r«- r - ^. oo oo oo en 

CD CD CD CD CD CD CD 



CD CD CD CD CD CD CD 



O CD CD CD CD O 



222 



o 



o o 



— a. 

£ x 

z ^ 

UJ Q 

z z 

UJ «£ 



as U 

</> z 

a < 

o 



2 z 

UJ 2 



O O O 

x 3: x 
o_ a. o_ 



^- ^-. o 

rororo 
r^. oo cr> 
O O O 



Z Z UJ 
O O *"" 




-c -c -c 
Co Co Co 


Co Co CO 


>>1 




^1 


CO Co Co 

* * * 


O O o 




III 

co co co 


III 

Co Co Co 


"t « oB 




^ ^ ^ 


^ ^ ^ 








i~ :*- i^ 


u_ u_ x* 


CO 


% * * 


£5 £ £ 










O Q UJ 
«t <t a. 
O O «* 

« <f UJ 


o 


8; 9; 9; 
ft 5> 5> 


NCE 

TATION 
TATION 
TATION 


o o o 


« 


Uj UjLu 


■< Co to Co 

* — ^- 



^f Q-CL 
t/1 aO O0 






1 1 



223 



oo r) in oo 



O O O u"> o < 



tn tf t£ tn i 



oo o CD co co i 

r^ ro csi c\i ob < 

in oo 9 tn ' 



= = O 

o o ►— 

a: a: o 

£ £ £ 



CO CO 

UJ LU 

s s 

o o 



i— cr cc 

uj _d => 

^ tn ll 

<t O O 

_1 z z 

— «* <t 



o o 


4 


T) 


CD 


CO z 

_, o 


CC CD 


O 


or 




CO CO 


tt 


o 


C_> 


o £2 


z z 


° 


UJ 


"" 


~ CO 

o z 

CC < 


















CO CO 






rr 


ce ce 


CC 




o 


d» >■ 


o 










_, 


o 


^ 


z z 
























z 










UJ 


> 


•* 


<t « 



O C O C (J c c 



oooooooo 

OOOOOCDOO 



ce a: q: o: q: 



ooooooooooo 
xxxxxxxxxxx 

0-0-0-0-0-0-0-0-0-0-0- 



aocoo 



o — 

O O 



O O — O I 
O O O O i 







r-» er- 


UD 


— . — . r*. ^ cm 


as us 

1 1 


U3 

o 

1 


r-. r- oo <T> CD 

CD O O CD O 
1 1 1 1 1 






o — « 


IS 


O O O O O 



CD O CD CD CD O < 






U)r-.rvinio»»ps. 

OOOOOOO O 

I I I I I I I I 



' CD CD CD CD 



CJ <f <C 

X z z 

« «t "« 

* Z = 

2 so: 

_i cc cc 

2 ^ 2C 

£ (_> O 

UJ o o 

K CC CC 



z ■ 

3 z 



2o 

Sot 



o o 

CC z 



* o O < < •* 

© O „ CO CO CO 

5 " 2 z z z 

CO J5 3< ° ° ° 



ce VJcococoniLtlcoco 

uj ccccccceltfoccce 

CO ^UUiuf z UJUJ 

uj £ ^ ^ z -*r. z: z 

a Zcococo^Zcoco 

O D.ZZZID.ZZ 



O «C0 < CD - < < CO - < 

_l UJ I UJ O uj UJ O u 

_j q_CO«Cq_CO<j;q_0_CO«£q_ 

« <Co ce «*0 «^ <t O°"* 

CO =? UJ CO = .CO CO Si .CO 

2 udou^uuuduu 



s s 



Ik o o 



x o o — ■ — ■ o 



O <^> r^ « , 
O CD CD CD ■ 

o o o — - 



o— ««ooo«~ ■"-• I 



cj c^ « u; J^ ^; u; ] 



o o 

oo o- 
o o 



O O O O CD 



Oioxr^nfnfnooo 
OOOOOOOQO o 



224 



. O CT> tO ^-11 



poo o 



o o -w o 



OO W <£ OO OO ID 



3E >" 

a: ^ 

= s 

g 2 

LU Q 

</> ** 

ec «/> 

a, u 

*2 Z 

o < 

° o 



oo o-> 

I I 



<£ < —i CO <C 



c> — « — 



o o 

OO <T> 

o o 



O O CD O CD CD 



=3 ca ca 





I 


Z 

o 




o 

z 



s= P= f* 



K -*-*£ Ul OL 

« </> S2 ™ 5 — *- 

* a: a: z , z a: z 

O Q- Q. ^ — Q. "J 

— ' tfl03 a *(»(£ 

« £1 Jil ^ O £ ^ 

_J Z Z to X Z c/> 

« UJ UJ — O uj — 

3C UJ LjJ Z <t uj Z 

UJ U U < w UJ < 

OC HhffiUHffi 



s si 
1 si 



CO CO CO 

i^ obiji 



™ a) o ^ a> « in 
u. o -h o m «o 
u. o o o — o o 

O (£ <£ CM rx <£ (Si 

r-. rv a) n h. ao 

O £! ™ £i £? £! £! 

£j o o o o o o 

s 

ooo-oo 
oo oo oo ao en en 

O O O CD CD CD 



225 






o o **"> o 

_ c*j — « <x> ob 

o*n oo v oooo- 



^rooo>OTro^oi 



o o 

o o 
oo oo 






3 CO O 



« CO 

tt o°° 

O q CO 

£z = 

Sis 

U. ^ «t 

oirH 
u,Ou 
CO 52 o 

<;« 
^ 3^ 



cr <J o o o _ 

, Z <=> Z Z _3 



if 1 

o : 
o o 

o z 3: , 

. . O : 

Z 3- lu ' 

q o: j 

o o a: , 
5 o o : 



ex tx 
o o 



<* y y £ c 

lx a: 

St* 5 2 o o 
"^ o «t z z 

_c o z z 

" "> -r- -r-" -T-- 



O O _i _l _l 

1— I— <£ <£ f 

o u cc a ac 

— z o o o 



oSoo^oo^gooo 

z* o z" z" 9= z" z" o %, z" z" z" 
o>-oogooi— gooo 

i>-*iisii>-'|;iii 
cocecoco^cocoq:—!' 

5 «t : 



_-. — . o 



crirccQiuQfccirccir 



O O O O 1 



CO CO OO CT> 
O O O O 











m 2g^n^^^ 




PO CO CO 


in it (D 1^ r-. 00 ^ 00 
O O O O O O O O 

1 1 1 1 1 1 1 1 




1 


00 00 00 
000 

1 1 1 






000000000 





000 






00 00 00 



OOOOOOOOOOOi 



OU1 jO 

>— Z UJ I— 

O o 1— o 

UJ O. -r- _ O- 



s-1 
if" 

c*- 1 S^ S 

o?9 



-- ° P-. 

:z"iU 

Z J? I CJJ 

S 5 i •" 
> o o 5 



5" ■«ooooooooo<r«* 

* ,_ Z , _ ~ 

" £ * u. u 

**" QWuiuJuJujuu-iiJUJ^n 

UJ CX^i^^^i^^i£^2iX 



C_? O I 

z z 



—1 a.<o:a.<L<<<<<Q:Q. 



<=• UJ -J 

«* a_ <c 
o «t cc 

<f UJ z 

nlu 
000 



o a 

O O ' 

o o 1 



t 1: 

X kj Cu 

* £ £ 

_3 <3r o 






OOOOOCVIOO 






o o o o o 



00000 



000000 
0000000000 



226 





a. 


z 


X 

LU 


LU 


a 


3E 


z 




< 


oe 


CO 


=3 


LU 


OD 


U 


a 


z 
< 


Li. 


S 


o 


o 



UJ < 



O O O CD O i 



cr> to en i£i en 'jd 



r^ en 



o o o o o 



oo r- cr> ■** 



cc ce ce a: a: ce 



a: a: a: a: a: a: 



*rti o 



Z Ou 

a£ o 



q; O Z U- Q£ 

, CD u_ O i 



6 1' < a 6 



o o o o o o 



31/77 
30/77 
30/77 
30/77 


t: 


1/77-07 
1/77-09 
1/77-09 
1/77-09 


oo 

O 



ooooo 

r^" r-» r- r-. oo 
O O O O O 



cc ce ce 

s> s> s> 



o c_> o <_> o o 

Z " uj ° UJ ° UJ 

* . O - o . o 

3 s^s £ = £ 

ii o rfj o 15 o rtj 

3 cj> pr o p: cj ;rr 

.* =! a: d a: 3)0: 

00 S «s S «* S <t 

JJJ 000000 

BC r- 00 ^ 00 O - 

J** O O CD O r- r^ 



S 5 



z o o o z 



5 *££S* 

* z z 2: z z 

^j LU . LU 

* o S S § 5 



nooo> 

CD O O 



227 



o o o o 



> O O i 

I 06 — « I 



iddddq: J ^ 



> O en 

: o «* 



cc a: or z a; 

oa a o 

z z z o z 

«* «* «t z «t 

o o o -, o 



crce'ioocececrce—jcc: 

U.U.UCQL.U.U.Li.>U. 
OOOOOOOOOO 

OOOOOOOOOO 
OOOOOOOOOO 






o22<ui< 



OOOOOOOOOO 



' CO CO CO w w 



Q_ Q_ Q_ Q_ Q_ 1 



Q_ a_ a. a, o_ 



C7> O CT> CT> U"> ^O ^ , 
— — O O CM O — 


cni 00 in 

— CM O 


<X> r- r-*. r-. r- co en 
O O O O O O O 
1 1 1 ! 1 1 1 


en 00 cd 


1 1 1 






IV O -- cm m CN 
-rocnoMo^ 


S2S 



O O O O O < 



OOOOOOOOO 









cr> nronnnnnroconnnn 


n n n n 


CD OOOOOOOOOOOOO 

1 1 I 1 1 1 1 1 1 1 1 1 1 1 


cs a coco 
0000 

1 1 1 1 






000000000000000 


0000 



000 
to co co 

> > > 
^000; 



ce (_> cj — 1 ce cc 

1 LkJ ! , O O 

zt£ir M zz 



: S t £ 5 

IUJ ujOLJ 



1 » s 



I LU O UJ 
O Q o O Z O O 

zzozzzz 

«£«* LlJ o«t.<a : «£« t 

SEoSsSSS 



: o o o >— 
: co co co o 

■^J-UUJLUUJUujuujJ-UUJUujujuj 
'{j^COaiCDCDCDcjQQOmCOCDyQcj 

l<°8crQ:Q:Q:o:<<<««Q:Q:cE<<5 



o«ixix:niooo<:xxxooox 

1 o: o: cr cr cc <" < < lj a: cc cc < < < a 



— — ' O CS 1 



00 est O — r-» 1 
o o O O — 1 
O — O O — • 1 



■ r- r-. o r- iv 



lococoro 



00000 



_ 0000 



o o cm o o o 

CO CM CNJ CO CO CO 
O CD CS O O O 



, — 1— .— «COCOCOCOi£>tr>OCsjCNIC-gCNI 

1 OO OO OO OO OO OO 0~> C7> 0"> <T> CTi <J~> <J~> CTi 
OOOOOOOOOOOOOO 



228 



m 


ro 


^ 


oo 


■*r 










O") 


u-> 








CNj 



o o o 
poo 



»2 x 

z "* 

uj O 

z z 

uj «* 

« «/> 

3 111 

co u 

<£ Z 

a < 

° O 



o o o o 
3Z JZ 3Z j: 

Q.O.CLQ. 






UJ O 

z * 
o 5 



r>. 00 cr> 
o O O 

I I I 



uj o uj 



, a> oo 

i o o 

I I 



cz> o o o 



o o o 



555 

o o o 



■£ z Z Z Z 

cc 25 1 1 1 

Z uj o a o 

«r 5 « <c «* 

3Z O O O 



IVJ O cc 



"* i T 

** * $ $ 

S SSS 
3 a o o 

< Uj Uj Uj 



til 

^~ >- :w 
ft ft 0; 



5 



Q.<a. 



CsJ O O O 
CT> CT> CT> O") 



23 O O O 



UJ 

~ — . o 

CO CO PO 

f^ ob a> 
O O o 



u. o — ■ o 

S? ^* ct> a> 
& ooo 



229 



o o o o o o * 



iOOOOir>OOU">*/>i 






-H»U)»0) 



: oo 



«a. 

UJ o 
<: u. z 

¥** 

1 «t a: 

O Z UJ 

«'5< 
S M . 

go S K 
go" 

225 
= w ^ 

<-> H- — 1 

SIS 
<S GO X 

S go ce 
o «t ^1 

° UJ 

ce 2 z" 

"to 

<2t 

5 ►= i 
go it 

x' z <-> 
O — go 

CC S CD 
■ 1 O => 



«*«t<t«t«t«£«t«t; 



oooooooooooo 



oooooooooooo 
oooooooooooo 



oooooooooooo 

Z22ZZZZ2ZZZZ 
WC/) WW) (/) W( 



ce ce ce ce 



z z z o_ ce ce 



CeceCeCCCeceCeCeceCeCe 



<<<<IUJUJliJUJliJUJUJUJII 

cecececeo-zzzzzzzza. 
oooo**oooooooo<t 

ceirxililliiiiiiiirxcr 

u jUj U jLiJ oq _ _ q _ q _ q _q_ q _ q _ C j 



X «t 



oo- 

CT> GO CNI 

o o — 







a~> 




en 
o 








o 


CO 


OO 






o 
1 


a 


cz> 


1 


o 

1 


CO 

1 


CO 

1 


OO <T> 
O O 
1 1 


o 

1 


cx> 
to 

1 


CO 


s 


oo 


2 


5 


12 


g 


5 


<0 


d 


U3 


5 



UUJUJUJ<<<<<<! 
►_>_►_»— OOOOOOl 



O O O O O O O < 



30COOOOOO 

I I I I I I I I I I I I I I I I t I 



r-. oo oo a> i 
• o o o o o o 



OOOOOOOOOOOOCOCOOO 

;„„_ rHr Hfs. lDr ^i-v( i jrvaorsoooooo 

■ coooooooooooooooo 



o o 

N = N 

z or z 



V> oooooooooooo 



zzzzzzzzz 



u. <E<to:«s:<:<s:<:<:<t<c<:<: 
... orororororororororororor 



o o 



zzzzzzzzluuj 
<c<e<:«*«*«*:«*«s:zz 

0_Q_Q_Q_Q_Q_Q_Q_00 
OOOOOOOOQ-Q- 

ooooooo<j>t*J>-H 



Q_ Q_ Q_ Q_ 

; <: ** <t <3l 
: or or or or or or or 



^-a:^^**:*!^:*!^ 









oooo 

GO CO oo 

0CJ0000055>>>>! 

ujwujujujuiij||5555 ( 

UJUJUJUJLLlUUJ^- J— UJ UJ LU UJ I 

t— I— t— ►— t— I— I— PPoooo 
^S. Z. 'Z ^ \ 



O «fl 



aQ o"zzzzzzzz2ujOo"o~o" CQaD z2 

qOuJUUJIiJLlIIiJUU<<OOOOqqIU< 
Ub0UUUJUUJUUUxX(]0C^(O(/)-'-' UJ I 

=^oS^555S55oooooo^^So 



O — O O ' 



i o CO co — - cm po 

i ab ab ob en en en 
» CO CO o o o o 



rvtvrvr>.0<nnOOOOOOOO 

ooooooooooooooo 



230 



o o o o o « 



«2 x 

s z 

UJ «* 



CD U 

«2 Z 

o < 

o 

UJ < 



I— ° I 

z o I 



life 

: £ «t 

! GO CO — ' 00 

« £ y y £ y 

: :> i— 3 > >» =3 > 
:z ^cccecoo: 

I LkJ UJ UJ O LiJ 

) OC O CO to _J GO 

CC QC § ^ °£ Z. aL 



O0>-0000000 

ujgoPoogooogoo 



— — o 
co m co 
r*- oo CO 



O O <JP o 



O O O O I 



O O O O O 



s: **: ^ 

,** * 

<Oto Co 



* 9: S: C 
3 OOCj 

-X Uj Uj Uj 



Q- S c_> a. Z 



S 5 8= 8= 

O O g> 



o 5 z o cj 

uj « O " uj 
z o m z z 



3 s 



CJ Z z Q Z 

-J - O _i - 

S2 £ s 2 



<5 



OUl-O 



^-. — o 
m rn ro 



cp O O i 
O O O I 



231 



oootoo 



ooou^omooooooo 



<Cro^OOOO)i 



^r^- — _ — cr> — as 



^ _jrn • ^ _j co 

= _i y? : — — i vd 
oo 5 -^ cd v ^ •«■ 

:gi£ggg 

2«r5t°or 
5 5 uj 2 ~ 5 ii' 



CO «" I "! 



Q = = : ~ 



CO 

—J —I —J CO CD 



, or or or or rt 

=> = =3 => g 

LU LJ UJ Uf ^ 

or or or or 5 

! o o o a 2 

< z z z ? =i 

; « «t «* «t < 

o x * £ z rr! 



ss o--J s:g o.-j 

ooSwoo J w 



«t ^ «S •< «S 



;>>>>o M «>: 

«S •< «t «t = 2C •< • 

ororororr^oroori 

:>--'- 1- £ s: o h- , 

-i -i -i -i in S m -i 

OOOCJoCOZO' 

: L. u. u. l. u uj I u. I 

OOOOXZO-O 



z rd rd rd =i rd K " 



uuouuo 

Q O O O O O 



z: z: z: z: z: z: 



o o 
cr> o 



o o o o 

»— t— t— t— 
uuuu 



or or or 

LHUUI MMl/) 
CO CO CO r 5 5 



I— (— O CJ O I 





CO 


ro 


ro co 


ro 


o <=> o 

1 ( 1 


o 

1 


OO 
O 

1 


OO OO 

o o 

I t 


OO 

o 

1 


o o o 






CD O 


CD 


o o o 


o 


o 


OO OO 
CD CD 


OO 

o 



CD CD CD ^ 



— « co cn 



<£>iOr-.r*-oooooooooooocn 

ooooooooooo 







a> -h u-> 

—. «-H CSJ 


(DO CM 

OCM r^ 


vO r-« r- 
CD CD CD 

1 1 1 


CD CD CD 

1 1 1 




r-» CD CM 
~h n-> cm 


oo <x> cr> 

Cn* CD CD 



CD CD CD CD CD CD 



1 






1 


1 


1 




1 








CD 




CD 


CD 


CD 


CD 


CD 


— 


1X5 


<X> 


— 1 


— 1 


— • 


<£> 


■X) 


<X3 



I CD O CD CD CD 



> O 

— ' P — ' I ^ CD 



OO 



°5 



3 o a 3T 3 O Q 



, z o 



z o 
z or 



I 51,35 



. UJ UJ „ ^ , 

■ o_ q_ >". ^ 

■ "* "* iti > 

CO CO — I z 

535cj 

Sxdo| 
O O X ►= 



O^OQQOO 



"^ <i «* -a: <: «* < 

<•> CJ cj o O t3 o 

QC LU UJ UJ UJ UJ UJ 

m Q_ Q_ Q_ Q_ Q_ O. 

S? a_ o_ o_ a. o_ o_ 

2 «t <t <: *t «* <t 

v ty) tyj (/: vj to w 

» 353533 

g UOC3UOU 

E = =>=> = = => 

, o o o o o o 

"- O Q O O O O 






oB _i 



z: z: z: 

«s «t «* 
o_ o_ o_ 
ESS 

o o o 



or or or ' 



1 2^ 

3 o7 UJ UJ 

«t <GCQ UJUJLJ QDCDCD 

00 u22www222 

2 oooSSSooo 



U. — ■ — • CD U3 — > 



5 eft o*> 01 at cn cn i 

!T CD CD CD CD CD CD i 



^.O— — --OOO^ — 



■ oooooooo 



CD CD — ■ CD CD CD 

UD »^ r--. ^j- ^- *»■ 
CD CD — • vO KO MD 



1 O CD O CD 



_ ^- « , 






' CD CD O CD CD CD CD 



■ OO CT> OT> 0"> 



CD CD CD CD i 



CD CD CD CD CD < 



-500 O - 78 - 16 



232 



o 
cc 


z 


u. 


a. 


t/> 


x 


^ 








LU 


Q 


^ 


Z 


CO 


< 


ce 


u» 


=3 


UJ 


OS 


V 


O 


z 
< 


Li- 


s 


es 


O 



UJ < 



>>■>•>->>•>•>>■>>•>> 

ooooooooooooo 

xxxxxxxxxxxxx 

CLQ.Q.Q.a.CLCLQ-Q-CLCLQ.11. 
» — > — J — * — * — • — t — • — I — • — I — ■ — *-^ 

OO— ' — I -* .-* -N ,-* ~H ,— ■ « ~^ « 

ooooooooooooo 

I I I I I I I I I I I I I 

ooooooooooooo 

(£)U)IVNM^NNNOOOOOOOO 

ooooooooooooo 



f s 



11 



o 

UJ > 

a a: 



o o o 
a: x x 
o_ a- o- 



<f «t «t 
Z 2 Z 
o o o 



j-ac ae ae 

CD <j; <t ^CDOQQDq^CDQDq^CDCQ 

°i2!2ul°22z22z22 

XXXXXXXUJXXLUXX 

ooooooooooooo 



I O O O — ' ' 



OOOOOOOOOOO' 



at kjkjkj 
* 5 * 5 

4 i*J ^ ^J 



f*= f* p= 

O O S> 



O at «t . 

OS o ^ z 



233 



> o ~- o o ^ o 



— OO CD O <X> U~> OO 









-I == © == 



S5-iS 



S o. z o 
OZIOOU 

jziz 



^ oc < 
: "oo 
: <2 uj 



£°gSu, 
__ z q_ m ^ 



— 2 i 
o t- o 
z o_ «j: 
_,oc°£ 



CO 



p O- — 



8r ; 



> a. oc uj ul 



*tf>NOO 



a. o «t 

- ' = «t " 

I OO I CO cc 

OC u. 2 u. o 



<£ •« «t «t «t 



_ fH 3E 



OO OO 

a. o- 



5 z o. -a: oc 



<<<<<<<li-U. 



occoooooo 



o o 



CM r-^ co to 

— • o o o 

II II 



O O 
i oo en 
o o 



IOOOOOOOOOOOOOOOOOOOOOOO 



5 " 



=sM: 



* ° 

2 § 



2 5 

« OO 



a_ uj 

LU I— 

o oc 

£ a 

z z ;=: • 

uj «i o ; 

"2 55 1 

y oc > ! 

3 " ^ 
> s a : 

V « uj ; 
z n u 

i-3<: 

oo « z 

S « =C 3 u. r— 

S <°o<3o 
« i -i t it < 
J3 xiou-u 



UJ o o 

O UJ >_ I 



9= z oc 

£ = £ 
s s 2 
;£§« 
rS-fg 

i o oo S 

I X CJ o 



O O O CJ o o 

zzzzzz 

S o o o o o o 

oo >•=>>>■> > 
^ ac oc oc oc oc oc 
£ uj uj uj uj uj uj 
Jr OO CO oo OO OO OO 
OO _i _i _j _j _j _j 

>-«>:«;<:<<«»: 

rr ^ ^ ^ ^ X Z 

■5 UJ UJ UJ UJ uj uj 

3 oc oc oc oc oc oc 
^ o o o o o o 



o o 

OO OO 



z z 



= = !! 

CDLU ^ 



«x u. o o go 



a=J£xDzacxxDz!rx - - 

2»— ,ID=DID.=5^=>cece**** 

pr^«*****<t«*<:«£-«©© 

' WCD0DGO0DCDQQ 

>;©xxx:rxx-jH <:"«»:" 

00 — 



<<<<<COCDUO 



oooo 



— . -^ CD CD CD 



iCD— <— "CDOOCDCDCDCDCDOCb^-H 



i <o co to cn 



sr o o o « 



' O O O O O OO 



CD CD CD O O O 



U"> CSI Cs* CD O O -* iD ir> W> CD *jD to o c o 

^rs.ts.oocoooobcooooboba»<7)d>cf>cn 

OOOOOOOOOOOOOOOOOObOOOOQOO 



oooooooo 

CT> Cf> CF> CT» CT> Cft Cf> Cf) Cf> 



234 



cc at ac cc 



— a. 

{£ X 

z m 

uj o 

3E Z 

uj «< 



en U 

*2 Z 

a < 

° O 



o o o o 
I — I — I — I — 
CO CO oo oo 

D3 D D 

o o o 

1 IE I X 

o o o o 

t— h- t— t— 

o o o c_> 

O O CD O 

z" z" z~ z" 
o o o o 



CO CO < 

5 S 5 5 



<t <t >« <t 



u> o f at 

OCMOO 

oooo 0101 

O O O O 



o o 

> > 
qi ce 


ex 


or 


CJ 


o 
en 


O 


> 

en 


o 


C_> 

> 


en 


> 

a: 


O 

ra- 


OO CO 


co 


CO 


CO 


CO 


CO 


CO 


CO 


CO 


CO 


CO 


C/0 


z z 
o o 

x. x 


z 
o 


CJ 


z 
o 

x 


z 
o 


z 

O 
Q. 


z 
o 

X 


z 
o 

X 


z 
o 

X 


z 
o 

X 

a. 


z 
o 

X 


O 


UJUJ 


£ 


£ 


hJ 


UJ 


£ 


£ 


£ 


£ 


£ 


►— 


£ 


— . o 

ro co 


~ 


o 
m 


O 

rn 


o 


rr> 


r*^ 


CO 


™ 


rr> 


oo 


en 


1 1 


o 

1 


o 

I 


I 


o 

1 


1 


CD 

1 


U3 
CD 

1 


oo 

CD 

1 


CD 


° 


oo 


O O 


o 


o 


o 








o 




CD 






UO CO 


— 


UD 


<-o 


CD 


-^ 


1^ 


<X> 


r*» 


OO 


r~- 


oo 



r^ oo CD 



•CDOOOOOOOOOO 



a. z uj 

LU O "— 

te - < 



a. o_ z 

UJ LU O 
^ z Uj UJ J 
f— UJ o •" *" UJ 

< ►= > ■* * ^ 






00 a: a a: a: 



oooo 

cr en en en 



**i CD CD CD OQ 



" m ^ £ z 

5 if .— uj z 

9 £; "- a«: = 

S uj o" 2 r- 

-I J<L 

« I O •< 

.- H- - CO 

g owl 

2 co o o 



OgcDcjOcD 



<io< 



* "* CO 
O- Q- i 



O CO 
CO o 



CO »— 

I I o 



= Uj UJ 

k *" 3C *r 

„- "* f2 

O uj UJ 

2 °- * 

O «* I 

«t uj o 

CO l o 

ej o co 



* Uj Uj Cu 

< * * * 

* g S g 

•* ^J ^ ^J 



«o-oo 



« s S K — S S m i 



OOONO^^"H«^"^Nfn 

ooooooooooooo 



ooo 



235 



O O CD O ' 



O -" lO ff»OOi 



oo ; uj 
o J jc 



; oo oo 
, Q p 



O- O 

S > 
oce 



: cc a 

UJ CC — O C 

tJ ?a S •=> — 



—I o 
CC-* 



60 o 
Ixl O 
O •< 

P _J P « 0= _, 



to o 



O zu, uj 
— UJ t h 

' <" ° ? ? = i 
O _D 3= -= q; I 
» O O O O uj ' 
> «t OO O O >— I 



1-2 



o o o o 

;=! ^ °= 0= 
O O -3 -3 

U Ul < < 

go z z 
*c <c <c «t 

oo>> 

w to n < 
«t «* DZ 3Z 



* z 



lip 
u. ce o 

5 OO CO 



— cc 



, uj uj 

I >- D- 



Q- o 9h 

cc •- cc 

oo z oo 

m <t co 

"o5 



ZoOOZZZoo 
000000003' 



1^- oo oo 
o o o 

I I I 



oooooooooooooo 



IsMNCO 
O O O O 

I I I I 



O O CD O 

r-~ oo c~ oo 
oooo 



ooin« 



ooooo 



tj to <o 
cc ct Cc 
3 5 S 



^ "* ^ 

Dk. D^ V. 

Ill 

CSC: 
5S5 

vovosa 



ESS 

O O O I 
O O O < 



¥ o o o 

_* cc cc cc 



CC Z cc q; Q- ; 

<-> oo o o o ■ 

«r o o_ O- S 

UJ _. cc cc o 

— i 5 o o o 

O _. £ O O ^j 

z « o z z £ 



5 s 



cc cc ce ; 
<t «x <t 

O O O I 



II 



o o o 



i :£o 

: " £ « 

I cc « yi 

UJ p. Z 

I I 5 => ■ 

a E 

"^o 

0- DT f? 

_, a. 

« « uj 

zoo 

UJ r^ it 

z 3 

1— O 1— 

z z ce 

0(t< 



CD- - — pg (i5 rv - -• oo — — • oo in if f^ 
««N(MOO00«'-O'-'rxrvr^ 
OOOOOOOOOOOOOO 
PI nf^ N OOrv CD UD —< CD WO UD uo 
OOOO— — «(0(OWID(0<J>10 



UD CO CD CD r-~ CSJ 



i — f-— r-— c-~ oo oo oo oo oo oo oo oo 

oooooooooooo 



* UJUJ^ = 

H dc dc o o 

« O O I— I— 

, OOOO 

H O O -J -1 

5 o CD UJ UJ 

uj cc o; < < 

ec oooo 



O <JD <JD UD <X> 

g; oooo 

a 

O O O p 
OO OO OO CO 

oooo 



CD ^ ^ UJ 



" oo -J Si 

5 o p 1 ^ _: o £ o _j £ 

* Suio^gct J u 

-J o u r uj o ' * j uj 

« _Jr>|0^_ ,2o^r~j 

.- o«t£[iooo^<j: 

J2 oo— iSooccSo 

z 

UJ O-fMIOI^X — NO 

Q. — ' — • -~ UD CsJ Oj O O CO 

x oooo«-oo« 

UJ ^" ^ ^" UD CSJ CM CO CO r** 
COOOOOCDCnJCNJCMCNJCsJ 



sr o o . 



CD O O O O CD 



O O O O O < 



236 



onooi 



O O O O O O « 



GO OO OO OO OO ' 



£ x 

LU Q 

z z 

uj << 



*2 Z 

o < 

o 

UJ < 



u. <: 
2 o 



: 5a 

' ^ £ = z z • 
■ -s 2 o — o 

• J a ^ £ I & ! 

: ce a. ce ce 3; ce 1 

CD qo X CD 

> 2 => S 3 i 



— UJ O i 



uj u UJ 
Z X Z 

O UJ o 



ce x <r tr ce £ ; 



'Cc2< 2 737: 



cc cc cc cc cc cc cc 

1Z) => ZD ZD ZD ZD => 



o: ct cc cc cc cc cc _, 



OOOOOOO 
cc o£ ac o£ ce" oc of 



o o o o o o o 

O O Q Q O Q Q 



OOOOOOO 
OOOOOOO 



OrNrvrN n wo. 

OOOOOOO 

I I I I I I I 






fs25s?: 



I = O •< 



3u_ a: ^ 

o o S 00 

y uj u o to * 

O t CC „ UJ s uj 



o tr cc 



'itjoz 
u <i Q- 2 

— ' UJ UJ <=> 
UJ UJ 

. •< ^ I- ^ 

-3 _ CC >- 



O C5 CD O O 



oc oe cc cc cc 



CD ce cc cc cc 



IS = = S Z * £ 



— ' X ° X ce 



O "' O ii.' 1 2 o o 
O X> X O I— _J ~ 



CD O 
O O 

ce ce 



ce <<<<< 

£ — ! — ! — I — 1 — ! Q co 

"i JJJJJjo: 



O O O O I 



^ OO 1^ ^ ro ^1 O 

o o o o o o o 



237 



o O OO — I 



ooooo 



O — I o — 



CD t£3 CO CO I 























OO 




co 




OO 






OO 




X 



zzzzzzzzcororororoTZZZzzzzz z z z z z z 

OOOOOOO OO^SCJCJCJCJCJOOOOOOOOOOOOOO 

a.cwa.Q.a.Q.Q.Q.Q.u u j Li j u j^ u ja.Q.a.a.Q.Q.Q.Q.a.a.a.Q.Q.Q. 

I^UJ'jJLL'UJUUJUJllJlU^^^^JUUJUJUJtlJLiJUUUJUJUJUJUJUJ 

>— ►— H- t— t— t— t— t— t— t— OOOOOt— t— t— t— t— H- t— t— t— H- t— t— t— t— 



OOOOO 



1 CO CO CO CO o « 



nOU5<rnD<£H£r'.rsrvoOOO' 



OOOOOOOOO" 

I I I I I I - 






OOOOOOOOOO 

I 1 I t 1 I ' 



^- ^-. o 
r-* OO CD 

o o o 



OOOOO' 



OOOOOOOOOOOOOOOOi 



o o o 

r-. oo CD 
o o o 



>§3 

z £ °- uj z 

Q(TMO Q 

^ ^ o o ^ 

° S o £ H 

Z r_ <; Z 



a. o_ 

"> s e: 
ca o o ' 



z z z . 



I x x : 

Q_ Q_ Q_ I 

«t «t <t ' 

CC CH CC I 



_i o o 
t^ o o 



B a: z 

w<"55 

Z O > 



*r ~T~ — ' ' — ' — ' ' — — ' ' ' 



^ < 



- Q. <t 5 



—iZxoOOCO 

w < r - 
co <: ' 

z K I 



21 ffi LJ CD L , CD 



zujuj 
?£z 

?5 



o 

O o 

°UJ 

3- 

— UJ 

> -J 

O UJ •— 

oo •" o 

E£I 

<z« 



Z11Z 



z 2 2 

ce a. o_ 

IUI<< 
H WW 



— — O — O 



s'^^ssssssooes: 



» -r _j lu v vj i 

lS<KOOI 



CJ> 



S ? ? ? 

* Uj Uj Uj 

«t s ? * 

< Uj Uj Uj 



555 

Co ^ O 



^ ^ ^ 

^ i^ ^ 

S= B= 2= 

^ ^ ^ 



w r^r^r^rN.-uj^ijO^o-- ■ — - — — — — rom^T^TTr' 

= OOOOO- — • — • — --^OOOOOOOOOOOOi 

_ (nmmijuonnfroomcftcnoxDiOJflforonnroi 

« O^ CD CD CD 0*» O O O O O O O O O O ■"* U"> to <-0 <-£5 U3 tC < 

° Ji^ Ji^ p^; ^: J^: J^; p; f!^ p^ p^ j^ j!^ p^ j^ p; j^ p^ j^ p^ j^ p^ j^ ] 



3 O O O 



P o o o 






ooooo— « — ~ — « 

OOOOOOO OOOOOOOOOC20000 



OOOOOOOOOOOO 

CNICSICSJCsjCNiCNICNlCNJCNICNjCNJCO 

l^i OO CD CD CD CD CD CD CD CD CD CD CD CD CD 



O O o o 



238 



I - -r 



o~> CD CH cf> 



— Q. 

£ X 

z ^ 

uj O 

Z Z 

UJ rf 






=3 => Z3 3 O ; 

ce ce ce <r. cc ■ 

OQQOQI 

z z z z z < 

«* <t «t «t <* ! 
X X X X X i 

o o o o o 

= = 13 =3 ^ ' 
CD GO CD CO GO . 



= cc 

UJ o 

o= z 



z p z 


z 2 


ooooooo 
o o o o o = o 




oZ 


^ o{^ 




o o o o o o o 






= ce =3 
ce ^ ce 


=3 <£ 


ooooooo 


ce oo 


O O O O O Q O 



o Q oiog 
ce °£ ce ;£ ce u- 



o o o o o o o 

O O U O CJ o u 



to u 

2 z 

a < 

° o 



toto U> N- rv oo o- 
OOOOOOO 



o o 

r-» OO 

o o 



O O O O O ^-h 

corsN -»» 

o o o o o o 



o o o o o o 






S CC CC 

Zj cr or 

« o o 

_, 2 2 

£ CO QO 

W << 



z : z o £ 



o o o 2 o 

t^, a: a; or J7; qe t 

Zi > oo > > oo 

w UJ r ^ Z u -I 

2 o <: o o o ^ 



* z i z a- z z 

, _ UJ Q UJ UJ UJ — 

J2 j£ =; Jt:a: x:u 



* ^ ^ ^ i x i: i 

OO ooooooo 

cc ooooooo 

uj tr or or cc ac or ce 



<c <t *t <t 



xzzxzzx 
ooooooo 



£» — ■ o o oo — in 
x o o o — < — — 



O r- r^ 



— . — ir> o cm 
o o o o o 



^ «) o cnj 

■ csi cp en cni 

r^. oo ob cf> 

CD CD O O 



239 



O r-» CsJ <T> 



O O i 

o oo < 



i ^ co O <T> 0> r-» 



2 £ £ z 

°= ^ ^ < 

5 «* «s uj 

CD O O 



o o o 

o o o 
o o o 

z" z" z" 

o o o 



zzzzzzzzzzzzzzz 

ooooooooooooooo 

xxxxxxxxxxxxxxx 

Q_ Q_Q_Q_Q_Q_Q_Q-a.Q_Q-Q_Q_Q_Q_ 



— _-. o 
O O CD 






to r*- to r-~ oo oo oo f^ 
OOOOOOOO 

I I I I I I I I 



ocooocooooooo 
o cocccooooooo 



o o 

X X 



2 E 

o o 

O O : 

a. a_ ; 



O O 

X X 

o o 
o o 

Z Z L_ 

uj o <t <t o ' 

ifiir' 

X > o o 

a. O CJ C_> 

CJ Z Z (_ 

z o o z "- 

«X X X <X ag 



goo 

X X z X z 

O O o ° o 

u.u.Xu.1 
O O cu O Q- 



s s 5 s 5 



2 * 



O z o o 

X «S X X 
Q_ z Q_ Q_ 



^ X X a0 X a£ 



:<: — "■ _j 



_ i _ ) a£ _ i ic 



—i a. o_ <c , 
« <: «x o o 



S O O U- C3 => XI 



o <z ° o a <-> 

CO UJ UJ UJ , 

S5 x ^ - — 

C3 O 



XZOOZZXZX 



Z Uj kj Uj 



8= S= 2= 

& s> s> 



— — CM O — 



m r-. o 

cnj csj co 

o o o 



i& O O O ' 
~ Cnj CsJ CNI < 

O O O O < 



~-. — . CD 

co ro en 

r-^ ab <7> 

o o o 



240 



O — « (£> CO u-) o ir> ■— II 

oocNjooo-jcri oooocnj. 



uj O 

s z 

DC </> 

=3 UI 

m U 

«2 Z 

o < 

° O 



ac or o 



!2 i— lu z 

S 5 o 2 

£2 = x 

S = S" 

uj ►-: ac => 

oujS - 1 

z o- "- o 

= O J o 

Q I CD 5 



ce a: 
o a 

z z 
«* •< 

o o 
d o 

Q O 
UJ UJ 

o o 

o o 

>— t— 
o o 
q a 

z" z~ 
o o 

o o 



O O O O 



22222222222222 

ocacacacacacacacacacacacaccc 

UJUJUJUJUJUJUJUJUJUJUJUJUJUJ 
COOOC/iOOGOOOGOCOGOOOCOCOOOGO 
UUUJIUUJUI1UUI111UII1J 
ZZZO.ZZZO.ZZZZO.Z 

ooo«tooo«toooo«*o 

xxxacxxxorxxxxcex 

0.0.0.00.0.0.(50.0.0.0.00. 
UJUJUJUJUJUJUJUJUJUJUJUJUJUJ 

O — I oo— <— »~~-«— •»— — ' — I 

totn (fl(OKfsrvNoo» oooo 
O CD oooooooo oo 

II I I I I I l l I I I I 

OOOOOOOOOO^OOO 

^ i — i 10 vD to i — t — f~~ r-* oo oo o*> oo oo 

oooooooooooooo 



i_ O ,_ 

z <-> z 

<t o < 



3 wo: (fl 
UOfZK 
O uj ^ UJ 

2 = :> os > 

GO 5 P P 

> 2<g< 

5 gz^S 

S y §£££ 

m <-> uj uj ac uj 

<« 5 o cc o_ a: 

% 3 uj _, a- — a. 

* z o < >^J — t - J 



11 



ill 

o o. 



tj o <= 



ii 

O Q. 
<_> UJ 



O a 

in 

O «B S 



ill 

o o. 



« ° 

2 «: 
uj oo 



; o u. ^ "- 

* p: o 5 o 

o « uj a= uj 

3 z oo u- oo 

i o x 2 



22°° s <4 -Oao< 

2 <f uj 2 K uj < 2 55 !3 «t 2 

» OOXX^XGOXUJxoOX 

2 oooSoooSooo 



_i = * _j 
z uj o — j z uj d ' — { i 

CCO.^^OiQ.S^ 



X* OO — ir> r-~ c 
" O O — — I 



— • O r~ O — ' i 



oo oo ai cn 
o o o o 



OOOOOOOOO' 



241 



csi csi Csi 






cj> oo in (nj w </> - ■ — < 



«00(D 



CO OO 00 oo 



ooooooooooooSooS 
0:0:0:0:0:0:0:0:0: 



_ it=L_ 

q- . UJ i_u ZD 

2 t z S> <75 



z P ° 
— Q_ o 

o 00 5? 

. _i t uj 5: 

o o o o o 
00000 



H £ — °- o 

Z3 5 O C/3 , 







_ — — 


OOO 


r-L ri c-i. 


r-L r-L ri 



























OOOOOOOOO 



C/l ^" OO OO CO 
O — ■ — > O O 



O O O O O 



O o 

<J> CT> 



o o 
o o 



<o <J(J 
U| Uj Uj 



w % % % 

» III 



■^ T 1 

s*. x. i^ 

9= f? 5= 

III 

C> C Q 

SS3 

$2 kl %1 



Z ^ C3 

«g 3 Q. 5 O Q. 

^ * re =3 uj QC 

Ki uj fc « — »- 



5^i 



00000 
zzzzz 

CJ O O O" tD 

5 z. 5 5 £ 

zzzzz 

ace 0:0:0: 
Q_ Q_ Q_ Q_ Q_ 

CCCiCiCiCC 
UJ UJ UJ UJ UJ 

ttttc 

3 13 =3 =3 =3 

OOOOO 

0:0:0:0:0: 
<z «* <* ^ <: 

00000 



I Si 



— • ~-» — * O CD O ' 



O O O ~- -^ ■ 



lOO «« « r- 



9 OOO 



1 (D (£ (O U) 



« « O 

r^- ob <T> 
CD O O 



000000000 






242 



— a: 

«2 x 

z m 

LU O 

z z 

as «/> 

3 ui 

oo u 

S2 Z 

Q < 

o 



o o <i lu 
o o _i z 
a: oc o o 



a- _1 

E ^ OO Cj S , 

z uj o o S i- o i 
lu z o o lu o o : 
xoirmzxa:! 



5S > 2d £ 



a. o ; 

«t _, o ; 



i z o o £ S z 



it uj ° I _ 

OZ^^UJOOOi 

OOCNjOO£mCOOZOrO< 



^- O Oi 



O O — ' o 



CD — CD — ♦ CD ' 

^ in. in to lo 10 i 

CD CD CD CD CD ' 



. —« ~ CM — O I 
r-~ ud tn r- <jO ■-• IJD i 
CD CD CD CD CD CD O ' 



« ,- ^ OO ^ < 



« en » m -H -- r-« 



oooooooooooooo 



! cc 






v j Z O > _ 

: £ >-' =C - O Q ° 

: ^ 2 oc uj ^ o uj 

' 25 lu lu sF S £2 3: 

: =; cc or o _j o cj 



^£5^55 



53 



o S2 — a; 

5 5 * o £ 
,« 5 oo 



:§ESE 



t=s£: 



;yd 
;«5 

: tr o Q- 

: a: ►- S> 
■ o => » 
: S? - S 
:3s- 



S £2 



_l I— _i Q Z 



iooi_.c_>Su-u-oSao 



! 3 z "j •*■ e 

> ^ ^ ^ ir ^ 5 z 
■ lu z f- g= => o = 

O g =) uJ^ S O 

uScd-iZ<u 



oo cr> O — I 



CD CD O CD O i 



O O O O CD 



-.-.^.^^-.rHrHrHOOOO 



NNNNNNNOOi 






ooooooooooooooo 



O O CD CD CD t 



1 OO OO OO OO OO OO OO i 



243 



OOOOi 



^ 0) O l£ tn O) ro 



ictotc I » 



O O t-> 
O en r- 

oinv 



CC ZZ. cc cr. en cr. cr cr 
-3-3=3-3-3=3-3-3 



ssgssssss 



=3 3 



o o 
c_> cj 



77. =3 =3 =3 =3 =3 =3 

^ <XL «C «t ■< <* «t 



S S 2 2 E S 5 

S o o o o o o 



O O CJ O O CJ 

oo— oooooo 



o o 



CD CC 



o o o o o o 

u uuuo u 

5 __ __ 5 _E 5 _= 

§ 3= 3= 3= =c 3= 3= 

— «a: <t «t «* «t <: 

S S S S 5 s s 



O-Q-Q-O-Cco-a-Q-Q-Q-a-a-a-cc: 

y) w co w w w cocowtf)y)toc/iw 

X UJ U LULU U LUULULULUUXUl 

z z z z o. z 

o o o o «* o 

_iiixa:i 

.0_a.a-0-Q-Q-CL.CL.OQ- 



CT> — > 

—. o 


O r-. eg 


CO CM 


^r oo 


<4D (jP 
O O 

1 1 


o o o 

1 1 1 


O O 


oo a> 
o o 


O t£> 


o *— ~- 


0*> iT> 


— , to 



i-'00000^-h--<fh«^,h 



I O O O O O O i 



O O O O O O 



--HO 
NOOO> 



O O O O O 



1 


1 


1 


1 


1 


1 


1 


1 


1 


i 


l 


l 


1 


1 


























































c_> 


CD 


O 


O 


o 


o 


CD 


O 


CD 


o 


CD 


CD 


CD 


O 


tiO 


U^ 


UD 


tx> 


<X> 


<-D 


<-D 


i— 


r- 


r^ 


r^ 


r*. 


r~- 


OO 



O CD O O « 



ooooooooo 







u. 

z 
c 




rs 







—J _J Q_ Q- 



is 

o a. 



* c_> 
s l/ ,=__=z~z~zz 

* LuQ-O-Q-LLjQ-ujO-O- 

ftr _lCO«W_,CO_j(fltO 



u. «</, 
UJ g^ 



-J Cj _ 1 Cj _J _! 



2«_5 

-j o <=> 

UJ £ <-> 

O 3Z ^ 

Z O o8 <; 

5 ZLXJ§ 

* =3 -e "- 

_j ZuO 

-j c-a.< 

< LU < O 

a. B^ ■* 

2 S o o 



OOoO 



cj o cj cj 

o o 
o o 



o o 

LU =_ _C 

o o. a. 



_ Z Z =C LU 
O O CJ O Q- *— 



o o " " -i e 

Q_ Q_ CJ CJ ^ £^ 

cr! lt! S 3 o oo 



■-=--•<«>:---- 



<C Z Z CL. Q_ 



5: 5: I I 5: 5: 



_. O O Z LU 

z z *c *s: cr. ct_ 

O O ° Cj LU «t 

« ■« jj jjj S 2 

*£ -5 o o ;£ o 



<0 <o Co 

*: *: ^ 

3: ^ 5: 



^ ^ ^ 

^ s ^ 



* £ $ $ 

3 ^ <-i CS 

< hj kj kj 



^ ^ ^ 

jk X X 

S= 2= S= 
£££ 

£> 2> £> 



iOOOOOO-*- 
OOV«ON»fh« 



CM l£> CD OO OO CO 



tOfn<t»ooo 
1 T "T T T *"? °? 

' O CD O O O O 



t> „ IT, „ *_; _ 
uj t^, xjj — zz n. 



00000000000000 



3 CD O 1 



co ro co 

t^- 06 en 



244 



O O U"> **~i O i 



§ 5 



?= * 



z "• 

LU O 

z z 
< 

=> W 

ca U 

<£ Z 

o < 

fe * 

° 



►z o 






CO 



i/> >— oo ; 

= = = £rJss ? 

Q_ Q_ Q_ < Q- Q. a. 

E2S£:S;=) = S 
OOOluVOOO 
OOOC^ — UJUJO 



ZDtOC 

o a. (z 



g o °. o 

— ^ ° 

z oo q z 






LU < 



i o o o o 



« O I 

oooooo 



uj — uj — y oys 

aroaroooofr 
oooo<->ooo 

o< O < .... m m o 



_j « v « "' a: it a: n 



o<ro<coooo 



^ ooooooo 

* ** «c <c «* <t ** <* 
x 2 Z Z Z 2 £ £ 

o «c *t <: ^ ^ ** ^ 

— cc a a ct cr a a; 

* a o: a q: a: a: o: 



=: «* ** <t «* «* *i **: 

' OOOQOOO 



2 NOOO--i(MnOO 
«" OOOOOOOO 
2 0~CO^Ot£>^0«X)tO 



o o o o o o o 
co o to m u-> a") u-> 






oooooooo 



O O O O O O 



r*. rv oo oo (^ cn 



i O O O O i 



245 



o o o o 



r-f\JOfO«3l 



£-!F£ 



■ a. o= 9r 



t if 
"» ^ •_ 

i S2 v> 



; uj § 

5£p 



a. m or 

5«z 



'■Zj '• o 
i?3 :<5 






0:0:0:0:0: 

O Q Q O O 

z z z z z 

«t «t «t «I «S 

cc cr: o cc ca oc o ' 
O O O O O O O I 



z z z z 



<: <: «t -x 



o z o < 
z o z 

553 



1 o z 
z o 

1 3 5 



z z o a 
o o z z 



era: ^ 

Q Q _, 

Z Z UJ 

en o g 
o z' 



ooxoooxx^ooox 



— "" O cu S on ^ 



:gi=1 

- ° — 5 

? a. m 2 



u-» o o u_ uj 
z 3 1 u- »> 
o u. a. o — 



o a! 
z «c 

5: °- 

—J =3 



>oS 






-ummaoocL 



Q_ CO Q_ 1 

o 5 O I 



z o z ; 

O - O I 
K Q H 
O Z C3 I 

— 3 — 
x p: x 



o_ co 

2 s 



I o z 
: z «t 



or a: 
o o 

a_ q_ 1 

SJOOj 

2 2 o o 1 

l— ,— Q Q 1 

ce oe . . 



ZZUU' 
<<2Z 



w f) o: o: o: 



5 5 s: s s s a: 1 





r-- -^ cn 


<-o 


~-. — — . O CM O O -^ 




1 1 1 




i 


OOOOOOOO 

1 1 1 1 1 1 1 1 




— * — • 


£ 


O U~) CT> ifl 00 f*- N CT> 

mooooooo 



O O O O O I 



■ OOOOOOOOO 



(C ID U> <X> OO rv 1 
O O O O O O I 



w ^ 

a. z — 1 oc 
a- % m o a , 

~j — => Z -J 
(jK O. UJ< 

00 2 <±< z £ i 

so <2 X o 1 



co «t S 



y oo,,-! 



CD UJ 

z LU 

a: Q 

9: z 



Rtf£ 



o 



■ j? QC OD ; 
: O °° 

J uj Q. uj ( 
3 o: o: o: 
, ir o°- 
- —. " o 1 



O X <I 






Z _j UJ O UJ o 






X X u. O X 



o- o 

z-g 

"J «X 

3 S2 



£ <=> £ UJ £ ^ S=? =; O 

oc or oc t u-Suj 



P^g 



o " >- 



I- « O O u. 



5 oe => 

iuo 
O O X 



* *: x <=> 5 5 5 5 
£ £ £0 o o o ° 

* 8-"*yyyuj 
« >- 9E i? 2 2 «* 

"*■ %" 

Ul o 



■p ■ 

-! « o p: 






_l_i_lScOO_CO_l_>. 



WWW 
OOO 

O.Q.O. 






OO OO OO CO ■— ' 1 



O O O CD O 1 






I o o o — 



o o o o o • 



o o o o <x> • 
o o o o o < 



3 000 



S£ o o o o o o 



00000 



</> — • — • — - 



OOOOOOOOifiOOOOOfnrsNNO 

00 00 00 00 00 00 00 00 00 cr, cn cr> o*> cr> cr> ct> o> cr> cn 

0000000000000000000 



0000000000000 



246 



— a. 

«2 x 

z m 

lu Q 

S Z 

UJ «* 



*£ Z 
a < 

o 



o:ct:a:a:Q:a:>ci:Q:Q:a:Q:ci:Q:cca:Q:crci:irQ: 
j u uj uj u uj a: uuujujluuujuj r" ■■ 

)V3WOO(/)COUJWWWOOCOMOOCOi 



Q.a. a.a.a.o.a.a.Q.a.1 



0.0-0.0.0.0-0.0. 



00<J3 C0P0f , 0—t^'—'^*£>— 'CO— -OOtJD^tJO— •—•—«— ■ 
- -iOOMO^O-hNOCVJOOOO 
tD U3 ID r^ r^ (C oo n oo OO r^. n o~> r*». 
OOOOOOOOOOOOOO 



O O O 
O. O. Q_ 






>_j o o o 



_j — j *" 2 _1 _i 



2 _I — j -J 



^^yy 3 



CDCDS-CQCO-2 — COCQi 



• 000,_>_0 Q ,_j_ 



**J Si 5- a. o_ o- 5: £: I 



OOuK 



ofl<u<oa: 



X JaSoSl 



© Q -z<<< 

-J <c o o. O- o. 

■< o ^ <t ■< <r 



ujocccuJq^ccoc^w — cctroc 



2 CJ Q- o o o 



o O L » J *t o o • 



1 <t X X X .< «£ X 



o ^ 
to *t 

I O Q- 



o. o o o. S 



UJ 

«^HtDu3U3in0>^D^^- M '-*t y 5OOOOOOOO 

ooooO'-'-o^-*'-'- , '- , rvirs'tNc^t^^f y >fO 
rsNrNfN,fs.r»rvoooo»ooooo")OOiooioiO)OOi 
OOOOOOOOOOOOOOOOOOOOO 



i* ^ i* 

-E Uj Uj Uj 

< s 5 ^ 

* § 5 c 

^ ^5 Q Q 

< Uj Uj Uj 



= OOO 

a 

— — o 

r-^ 00 cf> 
o o o 



247 



cr> to oo cr> < 



o o o o o 



CD — < U"> O i 






uj o 



— i y 

=5 CC 



=> O 
O O 
O^coo 



cr> en 



i^2 

! isl 

: > Qt: 
- -Ice 
> ce . uj 

-uq:h 

; —1 UJ <L 

■ o o. 3 
: o •« 



u_cece°= 



j co 



ce ^ ce ' 



3 E o S 



: ,- ui ° °" 



u. O 

I* 
I UJ 13 
I ce >- 



L -H<ZZO.Z«D 



5 2- 
en cr> 



i Q. 
-J =3 
O CO 



> z •— o < 
1 £ x zi "J 

^ O ^ =3 

"J S o c 
5 o c= J 



oo <=> 

I uj UJ — o 

I u. O u. > I- 

■ u. _J u. ce O 

> O O O UJ O 

: o o o to co 



— i --. ^Oi 



O CD 

r~~ CO 

o o 



> — OOOOO — CSIO 
'00000C3000 



u 



u 



■"* ^ «* 

— J. — 
S= S= 3= 

III 

& £> & 



-*iZ<=>ZZ:<=>Z 
UJ — o u — O UJ O 

«z"t<z"5<E 

KoJicoJaJ 

o-co°o-co<?a_p 

uj ceo£ceog:ce&. 

* ~zu~zu"uj 
o £ O Z .£ O z s z 

l** rfQN^QNrfN 



S 0= 5 uj 



:<o Jt 
.. • t ^ t Q_ 
O ps ce 3 ce o= °? 
uj Egn-wcL^gjc, 

5 (jLJijjliJijZujI-ijj 

^ iiooPoQcj-oo 

< oztrwey ?<a: 

~* Q-Z<u<<Sco< 



I CO h= 

o o 



o o o o « 



yj uj i£ (D U3 rs i 



CD O O — ■ O O < 



5S o o o o < 



CD CD CD CD 



'OOOOOOOOOOO 



96-500 O - 78 - 17 



248 





0. 


e/» 


•x 


z 


UJ 


UJ 


o 


se 


Z 


UJ 


< 


cc 


m 


=> 


UJ 


CO 


U 


£2 

o 


Z 
< 


u. 


S 


O 






UJ < 



oi^ moocj) 



— • U"> uT) \ OO 



O — — 



oooooooooo 

OOCOO^OOOOCM 



UJ >_ oo 

o z 3 

^32- 



£z- 



£ ■* 

«t oc 

O uj 

,ct| 

=> s 



oq|¥' 



B3zz 



a: cc 

=} => 

ZKttl-l- 

£] <c t o o 

06 < < 1 5 

£3 t-> CJ 

1 CO to * " 



o u 



□ 3D 

o o o 

j- < «t U !* 



«i cj o «t -t 

<£ Z Z <C «* 

Z M l/J 2 Z 

< o o *t *t 
o o o o o 

OOOOO 
OOOOOOOO 



O O 
_ O O gf CO 

° ■«' <* £ -j 
" = = SW 

uj« < z S 
a: «t «t 5 o 

OMW*-J 

o o o g O 

O O O J* O 



'<Q- 



o o o o o 

O O O O o 



3<t u_ u- cv O ■ 
cc u. o «c o ' 
o o o o a- o : 



CC _ i UJ C3 o 

, Q. «t OS «t «t UJ 

* o ■* ^ ^ - 

i m — o £ S <-) 



x: °= z o a: 
i — S O! cc uT Q: 

O «X — — O g «t q_ u. <; 



o o o " o 

O O O o " 

ZZZ2Z 

IlKl 



GO CO OO 00 , 



r~ oo O r-~ Cn « — ' o f^ ootfi 



r — cc 00 00 00 00 

O OOOOO 



O CD O O O 



y)r-.o-' 



I <£> CO 00 ro 









£ 


ai^iflO'-' 


■"« CNJ 


C3 


O 
CT? 
1 



1 1 1 1 1 


O O 

1 1 


CO 

1 






tO *T CNJ O uT> 

-CM CM no 


££ 


s 


VD (J? 
CO CNt 


U3U)(C^irv 


r^ r~- 


r>* 


Cn OO 



0000000000000000000 



OOOOO' 



> O CD O O 



"* ^- _ ^ - 
O O Z «t CC 

— : r^ — t « 



to z 

o <c 



u_ cc cc p ^ e 

" $ S ^ < < 

o Q ° {2 ° 
HisSx 1 

CO CC CC Z O I— 



5T^ 
o z z 

x ,v * 

* 2 => 

cc o 



o 2 



— I o 0= < °- t 

^o^£2°° 

q CC CC cc X -I 



0000 



■t cc cc X 



|z«zO 



5i3 



z 2 ' 



a- cc cc a cc cc cc cc _i 
,-> ujuauj>ujiijujui>- 

lJT CDa3<CIjCtiUaDCDCDO 

ooaro^oooocc 

w o.£cmcc5cc(ca:ic< 



ooaoaoaoocr>— • ~* ~* \ 

OOOOO-^OOOOCDO' 






o — 
~- ~- o o o 

\£> r~~ r^. r-~ i-~. 



O O CD CD ■ 
CM i£) r-. r*. 1 
OOOO 



OOOOOOOO 



» o o o o o 






ooooooooo* 



OOOOOOOO 



^^0^0C3^OO0 



249 



5 S 



z z 

o o 

en oc 

CO CD 



ce ce ce ce 






oc cc oror^rororcccc 



co 



to (O « W r to W W CO w woo yi to 

UJLJLULU<UUJUJUJUUJLJXLJ 

oooooooooooo«*o 

0.0.0.0.^0.0.0.0.0.0.0.00. 



2 =3 
o o 
o o 



o o 

z z 

cc ac 

O CJ 

o o 



— . — ■ CDCOO— •— — — • — — < — — ' 



O O O O CD i 



I I I I I I 



r^. CO en 

O CD O 
I I I 



O O O < 
O CD CD < 



' CD O O O CD CD O I 



lis 

: o o. 



I- o o 

« ^ cc 



•- : o o o •- o o. 



cr. ^r t- <t ce 



2^ 



" SI" S o 

«-> 5 CC I 

—i o_ <c no: 

«t «* o — ■= '" 



■ z 

I O °3 



3C GO Z5 iC 



£5$ 



t 1 1 

1* !*:* 



3 * 



— co m ^ 
2 uu<o. 



_uj«i— "T' C3CD *^"T L '- I< ^ 



lmco<^I 



o — i <t <: i 
cococo x CO 



3oo.«s:oi3o«:3o 



* ft: 9= 9: 

S SSS 

3 Ci Cs Cs 

« ^j Hj l*j 



s= s= s= 

£> C> Q> 



■ — • O — — O i 



U. O CD 



W c^^ — «^C^ — ^ — -^CNJ-^-^i 



OO^INMO' 
O CD O O O CD i 



3 O <=> O 

a 

^* — . o 

r-^ ab en 
O O CD 



250 



ooooooo 



ooooooo ooo 

00W0000X00C090000C00000O0) 



OOCDOOOOO' 



o fr, -> -> 



O y 

uj Q 

3E Z 

UJ ^ 



co U 

<£ Z 

o < 

o 






5* 



i o </3 z 

« == ? 



O —J 



z z z z z 
o: £r a: cr o: 



It [L 



o o o o o 



ooooooo 



• >— ►— I — t— I— 
j uj uj Uj uj uj 
: cc ec ae. oc oc 
i o o o o o 
: z. z. 7C z. ^. 
:•«•<•<«*« 

> o >■ o >- >- 
i o z o z z 

■ == £" == £ £ 

> O ^ O fc t 

■ o o 



zootofctrtt 



o o 



iO=2 
z o «* 

«t ° C^J 

i o E2 



S 2 s ° L _ 

S o O UJ o o 

<£ >« u. Z «t «t 



y. i- ° 



juj^O 1 
^ Z <£ o , 

* 3 a- a- i 
oo S a. i 

< UJ< I 

O Z a. i 



cc t =i 



Is 

z o 



s s s s s 



ooooooo 

^. ^. ^. Z. ^. ^. ZL 

^' 3C ae ac" ae ae ac ac jZ ac 

OOOOOOOOzO 

>->->->->->->->- — >- 

UJ UJ UJ UJ UJ UJ UJ UJ ^ UJ 



>■ h= h= 

z 
o . o o 
o a 



SggagO 



>- >- 



O O 
O O 



O O 

o o 



o z o z. ^ z z 



I O O O — « — • 



CD O O O O O 

I I I I I I 



as o Q^ o o 
o z o z 
^x*" x^ 

u<ili<< 
z S z S S 



o o*> r*. oo i 



o o o o o 
I I I I I 



r-.mcMOOOtO'^-''— • <— « •— • •— • 

CNJOOCsJfO^-'OOOOO 

oooooooooooo 



i o o — — - 



o o o o o o « 



oo cr> o cr> oo i 



o o o o o o 



GO OO 

OOUJUOOOUJUUJUU 
— '— 'ZZ— '— '— JZZCJO„ 

aC <<UJLtl<<<LiJUJ<<rf 

*r cDaDccQrCQCDCQaaccirQ 
J zz^^zzz^i^ortr^ 

d S Z ^ --! Z Z 2 =| -H Q £ co 

wujiiujujujii<<0 

?2 XXCOCOXXXCOOOOOO 



ooooooooooooi 



OQQOOOOOOOOOZ 

<<<<<<<<<<<<u 



< <t < <c 

GC CC CC CH 



g Z Z Z Z Z Z Z z z z z z _ 
L»_ acEattaadautiraarCDCDcQaD 
•-■ x o o o o 



x i x x x 



ioktctq: 



X ooooooooo 



O O O O O < 



Q(£o oa> 



oo oo oo oo 



i — -h fO o 

I ao oo (D cr> 

CD (O <Z> <~j O 



»nn(flrsc7i0^wnT>nijpuji^ooo>o 
OCDCDCDC30C>OOOCDOOC3CD^CD 

ooooooooooooooooo 

un uo uo vo i/"> un un bT> u~> ^n lo lo oo uo uo uo oo 
OC3C3000C3000000CDOOO 



251 



o o o o • 






o o o o < 



O O CO O ' 






i o oo oo oo en 



tTJ r*! <& o O 



z => ? 

«ii 

o •* * 
z >- H 

■f z Q 



1^5 
5"S 



irixixKicixiriciiirKKKCixiEirii: 



oooooocjcj>ooooo>-ooo>- 
ooo oooooooooozoooz 



1 a o 
° — 

ill 
2zS 

•«•- z o 

ze>; 

o oo 5 
or 5 uj 
00 $ z 



ooooooooooooogooog 

OOO OCJOOCDUCOOOCrt>-COCricr»>- 

i :x i i i: 

oo oo oo oo oo < 

<t «£ « <t <t 



i i 3; :e 



ooooooooooooo, 



ororororororoeororororororcjorororcj 
ooooooooooooozoooz 

zzzzzzzzzzzzzSzzzS 



orororororarororccorororcroror 
oooooooooooooooooooooooooooo oo 

UJUJUJUJUJUJUJ^UJUJUJUJUJUJUJ 



m ^ oo o o — • r^~ oo cr> i 



CSI CM O CM CM — » 

oo OO r--. r~~ oo oo *■*- oo CT> 
OOOOOOOOO 



VON(n*ooo)0«rsooo)tM^inooifi*ooioio 

CM CO ~ • ~~ -~ -~ «NNNN(NOO^M<NON(Mfh 
OOOOOOOOOOOOOOOOOOOOO 



CL. Q- 


Q_ 


Q_ 


Q_ 


Q_ 


cu 


C3 


Q_ 


Q_ 


Q_ 


Q_ 


Q_ 


Q_ 


Q_ 


UJ UJ 






UJ 








UJ 








UJ 


UJ 






CD 


m 


m 


O 
m 


o 


m 


ro 


n 


CD 
CO 


en 


O 
CO 


co 


~ 


CD o 

1 I 


O 

1 


CD 

1 


1 


<JD 

o 

1 


<JD 

i 


1 


1 




1 


1 


<x> 

1 


CD 
1 


oo 
o 

1 


o o 


O 


o 


CD 


o 


CD 


CD 


O 


o 


CD 


CD 


o 


CD 





I •< Z Z Z I 



loooooooooooooe 



o o o a. 
o o o — | 



ooooaoooooooL*- 
«t a- 



£©©S522£ 

o ix cE 5 S S S 

(3 UJ UJ 00 00 00 oo 

w _J _l z z z z 
UJ «t «t <: «t 

MWWJUOZ2ZZ 
c=ICj '"_jOO0_a_0— O- 

ujujujfcess'jj'^j'^y 

<<<Otflo8 MMM(rt 



ju.«t«t«i«i<t«i<i:«t<t«i<:« 



«£ «t «t O 

O- Q_ Q_ 



SEceOrororceococceococococccco^^^P^^ce 

I-ujULjyyiuLjijujuyy07;-lll- 

ooSxzxzrrziczxxxxor^SooooooE 



_ x: I 3: i i 

<<ouuo 

— UJ UJ uj UJ UJ UJ 

or or or or 



rr; o o o z i 



S 3% 



2 ooooroooSooororororo 



tfioooooooocvjNCMCNCJCjCMCNjronm — 
ooooooooooooooooooooo 

^ni^in^uoiD^uiifiuiuOirnocoxooooocM 
n n m <nj (\i cn csicsiCNjcsjcstesicsicsjrofnPOfnroron 

to-'OOOOOoontnnPOfotoiowrxrsiN.o 

oo oo oo oo oo oo oo oo oo en en en en en en en en en en en en 

ooooooooooooooooooooo 



N^inrswaiOn' 

n - - ^ Tt ^ IT; o ' 

ooo^-^ — — > — i I 

O— •— «CNJCMCMCSJ^i 






— _ „ _ Q , 






oo oo oo OO ( _ 
O O O O CD ' 



ooooencncncncncncn 
- -poooooo 



252 



O ~ eg 



"V r^. o O r- 
<r> 06 uS u"> *» 
cr> cr> cr> —• o 



as ^ 

s z 

UJ rf 



CD U 

a < 
O 



•3 

in = 



uj 0= 



: <t — 

>• z z o £ 

z o K? uj a= 
o => ^ => ^ 

uj o: C R w 










-i S uj a= S 
— °- a! Q- °. 

10 10 y— ac *t 



:cs 



O O O O O 



OOO 

r-~ f-^ 00 

CD O CD 






tte <te <k 


555 


* * 3: 


O O O 




uuo 


* * * 


^ ^ ^ 


iii 


OOO 






"T *C T 


>- :*. ^ 


ft <k <fc 


Uj Uj Uj 


*: % * 


OOO 


t fc c; 


S J5 13 



000 



~ pH o 

r^- 00 CT> 
OOO 





00 

2 

>- 


CO 

Z 

00 

>- 

CO 


* 

e 
« 




a a 

O O 

z z 

53 


:r 

Q_ 

<t 

O 


Q 
O 

it: 

3 


CO 
CO 

oe 
a. 

X 
O- 

<C 
cr 


UJ 

M 
O 


ti- 
er: 






cc 

z 

Z u_ 
£Z O 





> 

•I 
>■ 


> 
> 





CO 


00 

5 


CL. 


00 

5 


5! 
2 


3 


3* 
















>- 







X 


z 


<f z 




z 


z 




:e 


x 


<t 


X 


UJ 


UJ 


ID 


CO ZD 


O 






z 






ae 


c/> 


O CO 


» 






O 












UJ 






oc 






O 








UD 






CD 


O — « 























cn 











z 





O 




CD 







CD 


« O 




C%l 




U3 


UD 











UD 


r-. <x> 




U3 


to 


3 


en 


cn 














1- 


s; 


K 


rC 


~ 


s 


^ 


£J 





^ 


CN» CSJ 
































00 


CO 


CD 


UD 


<X> 


up 




cn 


o> cn 



u 






O 
<-> 


CD 


O 


° 


O 








O 


CD CD 












<x> 


UD 


CD 










UP wmt 






Cvt 







O 




O 






CD 


T *? 




a^ 


en 










OO 


CO 




ab 


ab cn 







O 







O 


O 


O 


O 







CD 



253 



OOOifiOOUirvOi 



<7> CT1 O CT> ' 



i ~^ U"> w> Wi oo CT> 



^O U~> liP CT> l 



r-*« CMU) O 



• o z 

== s 

< z 



>• o 

O t— 



IE «" — 

;o: c_> 



: ° P P 
a. a. 



a co 

i Z CC 

^ «i «t «*. : < uj 

x" 3: 1" x" 3:' ^ tZ 
o o o o o § _ 
uj uj uj uj lu rz >— 

CD OD CO CD CD 2 < 

25SS2i° 
«£ «t «* «t «t rf 2 

a. o- a. 

CO CO 

ujuj 

o o 
o 



z 5 



CO CO CO o 5 

000 .s 
I — < — •— 3: > 

c_> o o y o 

OQ OS O 



_, o o 



uj o 1 

o- »— i 
o o_ 1 

X O 1 
O CO 1 

UJ => 
X CO 



<^ co co >- 

CO JQlU 

SO< Z 
CO h- u- O 



1 p O CO CO 

a. o cc cc 

I °= S UJ UJ 



cc o o 

>- o o 



CD C_> UJ UJ 

=> o z z 

CO <c o o 



O O O O O 5 o 

o o o u 5: o 
z. z. z. z. z. a. z. 



COCOCOCOCOCOCOqcCOCO 



ccirccQcccccccccircccccccrQ: 
cocococococococococococococo 

uujyuuuiuiuujiuiuiuj 

oooooo«tooooo«*o 
3:3:3:3:3:3:0:3:3:3:3:3:0:3: 
Q-a-o-a_a-o-Oo-o-o.a_a-coa_ 



ro CD O — 1 

U-> ^ CM GO 

o o — o 

I I II 

— • — •OlflOOO- — co — 
oocNtoo— -onoo 
mfstDfxNujc'ip^oo) 

0000000000 













cr> r— -1 




cr> -*r 




OO ljO 


CO 1--. r»». r-^ 
OOOO 

1 1 1 1 




00 00 


t 1 




cr> cr> 


1 1 


r-. ~ in a> 
— O — CxJ 


O 


00 u-> 


to 




to m 



OOOOOOOO 

I I I I I I I I 



~>000— 'O — OOO 



— ' O O — < 
<=> O O O O 



a. • 



CO 



co z ->- Q «t 
« CO UJ _| 5 



wSuj z -j 



SsS: 



: o o- o 

: x S x 
o_ o a. 



is 

O Q- 



HiShHZiri 



Z C/5 OO CD OQ ^ W QQ OO CO 

»*i 3 3 - - 3 3 ^ . 33 

o m m w w co qd t r 1 m co 



o 3 

- — . ■_" lj_i i_^ 
»— Z O I— Z ' 



_i O _j O z ' 



- uj a. 1 



uj CO UJ uj Z UJ CO UJ CO I 



_j cc h- uj cc 1— uj z uj ce 



dLujd t 

o z j= o z 



<UJ<Z 



UJ 3 t ^ t W Ld 

^.^ozoz^jz 

OOSOCQZjoOZjSO 



1 o o o o o ~ 



CMf-»CSJCO«OCNft©-^CMr-» 
0^00«CM«C3000rg' 
0000000~«CM 



cr> o o — • 



' « <o 00 CO 



t> _!;i_;^«^^^c^«^«-_;._;' 



ao oo cr> en 1 






o o o o o « 



• CD O O O 



«««JOO«)OntO(0(\tNOO 
OOOOOOOOOOOOOO 



254 





(/> 


o 


z 


Li. 


a. 


>— 
z 


X 

LU 


UJ 


a 


3C 


z 


UJ 


< 


Q£ 


w 


=3 


LU 


qo 


O 




z 
< 


Li- 


s 


CS 






I o*> o cr> o 



OOOONi 



t— Q_ 



p55 



^ = WJ == ' 






;°5 



! 3 jg 

i ^ a. ^ Co 
;co£jcog 

• O < " O "T 
U- C3 u- _, 

UJ to lu Q 

UUUJ 

«* o «t 

co a- co 2 

E <c £ a: 

cr: (— qi uj 

o «; o <r 

u. o u_ I— 



o o o 



o o o o o o 



Z UjUj Uj 

* S £ g 

s ass 



ft fte ce 

^^ 
C> Q Q 



^ - 



z : : z 
o : : o 



M? 



3 "J ^ ; 



<t O «S <* 



O Cp — CNJ CNJ 1 
O O O O O ' 



O O O 
i CSJ en CO 

OO O 



255 



o o o o 



—t — . —• u-> O 






= = ~- *■ & 



«3 



-5 

o5 



1« 



iii 



W ^ Q W 

sj3j 

uj £ I UJ 

z P o z 

o ^^ o 

O O O 

O O O O 

">~ § °- ™" 

— t£> — — " 



! 2 <: 



>■ « — ^ 
~ * n- ,-. — 
§ tt! ^ ce §£ 



J3~ 
>g"5 

r 2 => z 

r O «t <x 
iku J 



• o 2 o 



O uj 



-^^S 



■sT o 



CD CO 
ZD =5 
CO oo 



! o o S a. 



j OO CC 



• o o 

:£° 

■ a. 
a- o 

co «r 
cc o 

a_ o_ cj> ° 

CJ O uj _ 

3DD< 



cc en 



: o 



^ujiZu-zcrSozoo 



- a r: 



■ J uJ O O Z 

=; =: o_ o_ o 

002<5 

m 2 z z z 

=> r> — — «-^ 

o o 2 2 2 

o o o o o 

uooou 

00000 



o o o o o 



CO GO CO GO 



O O O O 



— — < O O — < — 

o o o o o o 



O O O O O O 

rv rv is. rv oo CO 
O O O O O O 



O — • OO — « 

ro O — • ro 

tx> iO en ao 

o o o o 

I I ^ I 

OOCNJCNJCNJOO-'OO-OO- ■ CNj 
— • r»- i-nu)inps<crN.oOfsPv(Tnoo>co 

ooooooooooooooo 









CT> 






o 






o 












o 
1 


CD 

1 


CD 

1 


CD 

1 


1 


in 








tx> 










o 














o 


CD 


o 


CD 



3 o o o o 

X S £ £ S 

o «t ■« «t <: 

^ kq:oc q: 



— O Q O O 

5 > > > > 

£ O O O O 



O O 

>>^ 
OO o 

" <-> -j ujlu "-; 

» >- — o o >- — 
5 E- => z z i— =>• 

3 q; «t U- U- q; «C 

< o Q- o o o °- 

. ce u. <t <t ce u. 
"S ** o o o «* o 

* ^ :►. - -^ s- 

Uj UiU (/I (AUJC 

_ o o o o o o 



£ LkJ 



OO 



5 5 £ o £ a: 

£ «* ^ < ^ fc! 

2 °° j^ 



-3 O O -3 , 
O Q_ O O . 



^2 



CD o CD CD 



<X. ■< 5 o v> 



cc z 2 co m 



OO 00 OO OO OO 

D3333 

o o o o o 
«t «t >« <c <t 



o 






Z 3- UJ > 



: i— «t S J « i- •< 






o CD o o 

CM <jD OO — 

CD — • c-g en 



Z O CD O O 



U_ CD CD — — • CD < 

O <jO <jO «^- r-^ <jD « 

CJ r^. r^. r-~ r^. r~~ i 

P" CT> CT> CD CD CT> i 

S CD O O O CD i 



oooooo«oooooo-h 

OOOOOOMni^miDQlOis 



en o o o 



CD CD CD CD CD ' 



•7 CD -;• <Nt 
is- 00 CO 00 
CD CD CD CD 



00 -^ « o o 
00 00 00 00 en en 

CD CD CD CD CD CD 



-^V^VOOOCnCNJiOtorsrsrso 

ooooooooooooooo 



menooo 
~? ~ en cct en 

CD CD CD CD O 



256 



• ** o i 

i O CD 



— a. 

£ X 

z •" 

s z 

as i/> 

3 Ui 

as U 

«2 Z 

a < 

° O 



ZZZZO-ZZZZZZZZZZZZZO.Z 

oooo<tooooooooooooo«*o 

a.o.aQ.UQ.Q.Q.Q.Q.na.a.Q.a.a.Q.a.UQ. 



o o o o o o 

I I I I I I 



' CO CO OO r-- OO GO CO 

' o o o o o o o 

I I I I I I I 



o o o o o 



' r- OO OO OO 



i O O O O O O I 



















o 


o o 


pj. 


r--. ri 
























oo cr> 



E oa: I uj 



OooO 



_ Z 2 



o — • ° 



2 oS E 3 



a_ Z 
.1 a. 
o22oooooo*~ o 

Ot/pcoOOOOlOl/jOO 

UJ>>UJUJUJLJ>>pUJ 

Z55Z3ZZ33^- 
o'-'oooo 
IUJUjiiii_ 
Q-OOQ.Q.Q.Q.OOS'Q- 
ujzzuj— jluujzz*^— j 

— <<-JUJ^ << ^,UJ 



° ° ° 



tiJ <t <t o o o 






SooSoo-Jo--Jiooc_>Q.io 



3"" 



* & i & 
3 SSS 



00 ~ CD — • i 



m ^)0 w n i 
— — O O — ' 



«-OOi 



o ,_; ^ ^ ^ ^ J 



3 ooo 



5 O 



OO ^- r- ■ csj cni o ~- ~- «— « ~— — ■CNicsirgCMCviCNjmro 
NfsNfvNrvXOOOOOOOOOiffi CT> CT> 0"» 0"> CT> 0*1 Cf> 
OOOOOOOOCPOOOOOOOOOOO 



ri co at 



257 



■ O IT O O i 



O ul O i£) O 



O r- r— o 




o o 

I 1 



o o o 

r^ oo ct> 

o <=> o 



o o 
o o 



-OO O O — OOOOOOOO— ■ OOOO— ' O O O — o 

<Oir>r^. ^t£iN«inrN.rvinioTrwoopsiow»cocooooioooo 
ooo oooooooooooooooooooooo 



52 

2 £C 



■«* t T 

— — — 
Cte cc ct 

& & ^> 



>"° <" 



O oo O 
O O Q 

= a = 



5 2 5 .S 
o S a a cj 



« p ce 






5S 



t ?:Q: t- o: q: 
cciSSujtujQ: 

Q3-,yiS CD 

z 2 w v uj 

- O O :> ►— 3IU.IO 



a: z 



5I29292SS 



= I S ce 

S t- s « 



a- 2 t^ 3 , 



-,<_><_>£<_>! 



CD <* 

15 



: y ^ z 

: C_3 t— o 

o ce 

5 = O 

,500 

, s ° "J 

o cc a: 

: Tr >- to 

: Q. => 

■ LU O O 



OO— * O — . -^ ~ ■ o O O 



CT> 00 CT) ^t m (D r^ 1 
SO O O — * CT> 0~> CT> 1 
O O O — « CD O O < 



K S 



O O O O O O O 



icnoooo-H^nnmMcyrsiMr^r^r^o 
ioQxoocoooooooaio)CT)(n<7>c'id)9td)a>?> 

'OOOOOCDOOCDOOOOCDOOOC3 



258 



o o o o 



m o ^n cn — oi oo i 



i r^ ao est oo 



z z z z z z 



oo o 



O O O O Q 

<f «t «jf <jf z 



u_ 


UJ 

a. 


«/> 


X 


^ 








UJ 


a 


2 


z 


UJ 
CO 


< 


as 


«/> 


=> 


UJ 


oa 


U 




z 
< 


Li. 


5 


o 






O O O O O O < 
_z> =3 =3 o o o : 
<:«<<<<«<' 
oo o o o o ' 
i — • — « — • — i — > — i 
oo o o o o 
oo o o o o 

z" z" z* z" z" z" 

oo o o o o 

o o o o o o 



I s . 

o <f 



ct < o; uj 
— H- Z O 

o «t o «t "*■ 
O O - o <c 

. - 3C . O 

z «* «: < 

!§!§? 

z « » < < 

<oooo 

s 1 - »- "- *" 

— o o o o 
°. o o o o 

?S Z Z 2= Z 
u o o o o 

<X O CD CD & 






0:0:0:0:11:0:0:0:0: 

COCOOOOOCOCOOOCOGO 
U UJ UJ UJ UJ UJ UJ I UJ 
ZZZZZZZO-Z 

ooooooo*so 
a_a_o_o_a_a_a_oo_ 



i-^. ^ ^ o — • « 



CO t£) co r-. r^ 1 
O O O O O 



O O O O 






OOOOOOOO' 



«T> -^ CM 

O O CNJ 

r^ 00 CT> 

000 



O— '— 'OOOOOO 

OOOOOOOOO 



or ^ ^ a: ^ =; =; 



; a: a: oc a: 



K -t-iZZZZZ^ZZZZ, 

UJ 0:0:0:0:0:0:0:20:0:0:0: 



«* <c «* <: <: «* ■ 



o ** «* ** <: >-^ 

uj CO CO 03 CO z 



a: a: a: 

oo 00 CO 

<: <t. *x. 



0000000<COOOO* 



o o o o o < 



,0000000 



OOZOOZZQ- 1 
>>^>>0_Q_0 

oo^oo^j^j^; 

^j oo* - o o ►- »— ►- ; 
3 zz_izz_i_>z 

S S^m — — mmzi 

* u -."-. a= u -. u -. a -z = 

13 DOCCOOCCCCZ 
_j <<uj<<ujujo: 
< OOlOOlIUJ 

|5 «* <t o -<" <c 

* 00 00 o CO CO . 

2 o o 00 o o t 



1 o o ' 



3 000 



O ^ ~* — • 






rsrsNrvco»i 



O O CNJ 

r^. ob CT> 
OOO 



259 



'KOOON 



O r-. » 



cr» en -«r — • o i 



OLCr.QZQZ.QC 



o o o o o 

x x x x x 

Q_ Q_ Q- Q_ Q_ 



; OZ ^j 



^S3 ziS 



f?-M 



O o 



si 

_. So y 
: £ >- z > 

. t= z ■* <*= ' 
' o o jr 1 z 



££zzz 

H H ^5 w? 



p ° ; 

to " I 

= o ; 



U. CO -^ < O 



o lu uj o o uj 

cc. >— >— cc cc >— 

Q- 3 => Q- Q- ... 

<; °- "- <t «t LU 



O ~ O — ~ 



O O O O O 



— o o o o 

O O O O O 



r^ OO <T> 
O O O 
I I I 



OOOOOOOOOOOi 
OOOOOOOOOOO' 



Z O O Z Z 



o o •— •— 

Z Z _/ _l 

<t «t — I — 1 

i z Z LU LU 

_ _ m QQ 



^ o : o • o ^ 

oc t— lu i— uj i— cc 

u < Z < Z<UJ 



£X O O Q£ Of 

UJ< <t UJUJ 

I O O I I 

=3 of «" => => 
CO O O i 



* fe ^ a. 

2 355 



S= E= 8= 
£> S> S> 



_ 2 & cc lu <£ ■ ■ 
3 * 2 O — I o 



5 z S S z z a. 



qcuq:uj£k<>><< 
-luu.es; 

O O _i _i I 



o o 



3 j=S°- 
22 °w 



OxOxOxOOO<_>OOC_> 



OOOOOOOOOO' 



O O O O C3 



' ob ob ob ob i 



O ooooooooooooo 



260 



O O O LT) C2 o 

-| oi n irt fn 
to oo — ^ 






or ^ 

uj O 

3E Z 

UJ < 



oo U 

«£ Z 

a < 

° O 



i a: uj 

(= o z 
S n j 

< a: z 
z uj o 

ess 
uj o t±i 

IrS 

o f h^ 

«-> 2 = 
,-, ° o- 

2 U £ 

~~ CO O 



C3COI- 

i35< 



' (/? GO Q 



i q a a c 

[ ec a: i S 



—i > 

O UJ 



p UJ LU 

P -i Si i 

U3£u 



52 



£ X 



CD a. 

UJ CC : 

ce o 



2 as t M 2 co 

2 s m s S s 

-.-400-- 

i — r^ oi en oo oo 
O O CD O O CD 

I I I I I I 



5g'< 
o p: o 

l-Ou 

co a: u. 

— a. o 



r- u-> UD 

o o o 

I I I 






O O CD O ' 



> o o o o o 



O CD CD CD CD CD 



.— . «t 



I i-u:< 

</» S!;3 

=D Q- « S 

O OC ^ 5» 



So 08 
X o o 



3 OOC3COCDUCDOOC3COOO 

X £££££££££££££ 

— czaLccacacacczccacccccacaz 

~ aooaaoooooooa 

5 =»>D»>D»>>D>D>D»3»D>D» 



* 

2 <* 



* 5 ' 



== «t <t <t ri. *•! 



Q O O 



ooooooooo 



O GO 00 

X =D =} 

« o o z 

X = => «* 

o << t 

_l CO CO o 

* SSI 

K S £ O 



I oo oo oo ~- — ■ ■ 



(/» to (O *J3 < 



• O O O O < 



•-O <JD UD U3 



>000*£»^O^OtJ3tO — « ~- CNJ CM 

rsrsNobobabobobobooTiO) 

'OOOOOOOOOOOO 



S U) CO O CsJ 1^ ff) 

U. O O — « *H O O 

<0 <jD 1^ r^ lO to 

O ^! ^ r- r- r— r- 

£ O O O O O O 

a 

^. ™ uo -Xt — — 

o o — -7" <=> o 

oo co co co en en 

o o o <z> o o 



UJ tJ3 CT> O 

a. on a) 

x o o o 

*|J o o o 

5£ o o o 



261 



u? o oo — > 



o o o co i 



*n(PO 



■« uj ^ 

a:<od 



_j o ^j o 
°- o IS M 

Q <« 

2 = ° 8- 

t .><o 
Sjiulg 

cc ce >— z 

CO ODD CO 

--> -i O «* 

CO S CE O 



" ^ 2 



EI-DDHDKa: 



Z O. Q Z O . 

Q <t z z <* z ! 



.u<<c3<l: . 
ujzzzzzEouj 

J_ y y y ,_ 

oooooooo 



>_ z z z oc 

,-, tu => = = i— oc 

5 5 HI LJ UJ tt (- 

< " K a: tt _ u; 

fc.goOOz'* 

i * r" Z Z Z <t Q 
.„- 1 < «* « i_ z 

2 2 . . .goz 

O «t «t «t C3 . 
>- o z Z Z Z UJ 
<• CO UJ LU UJ — : \— 

UJ go — i — I — i H >— 
a: — uj lu uj — =3 
o 2 31 3: x m m 
o o o o o o o 



ooooooooooooooo 
ooooooooooooooo 

z" z" z" z" z" z" z" z' z" z" z" z" z" z" z" 

ooooooooooooooo 

I— I— t— t— f— t>— ►— h— K-t— t~- t~ t— H- »— 
OOOOOOOOOOOOOOO 

zzzzzzzzzzzzzzz 

xxxxxxxxxxxxxxx 

GOGOCOGOGOGOGOGOGOCOCOOOCOI 



UJ UJ Ui UJ UJ Ui I 



C0G000C0G0C0C0GOG000G0G0GOC0CO 



0000000000<0000 

xxxxxxxxxxcexxxx 

0-0-0.0-0-0-0.0-0-0-00-0.0.0. 



CO <T> 


en 


OO — -3- CD 




-IDOONO) 


(0 to 
O CD 

1 I 


o 

1 


o o o o 

1 1 1 1 


o o o 

1 1 f 


r"* co oo co co 

ooooo 

1 1 1 1 1 




<-D ^ , 


5 


CO CO — * CM 

CM O O O 


CM CM CM 


CM O O O — « 


<X> <Xi 


CO 


to r- r-~ r^ 


to r-» r*» 


r-» OO OO OO CO 



O O O O 



OOOOOOOOOOOOOOO 



O O CM O CM — ■ i 



OOOOOOOO' 



O — OO — — ■ — ' 



00 ^j I 

x ac 



o o 

=> o 



— T; CD U' > CD CD 



UJ o o 



CO CD 



O O ; 

=> O , 

«t «* ' 



OO GO 
O O 

> o O 



o o o 

XXX 

a_ a. a. 



: «t <t <t c 
: S S S == 

: o o o o 

:oo o^ 
■ a. o. a. ^ 

=c < -i ojj ofl «g < _i 

S Z UJ Z UJ 

a _■ z «t <* «* _- z 

_j o — UJ UJ UJ O — 

— i «< < o_ a_ o_ «i 2 
„, . 5 go go go , z 



o o 
x x 

a_ a. 



2 2 
i o o 

i o o 



S 5 ° ^ = 



x 5 £ cc 5 2 S 



Q3 UJ UJ UJ 

2C 2£ iC 

Z «t <t «t 

— UJ UJ UJ 

2 O- O. Q. 

_ ^ <t «t «t 

ooSujoxxx 
ZESoSSEooo 



^1 in i/> oo 



O « — ID f^ OO td 

O ~ O O O O O I 
CNJ GO »^ U3 l£> <J3 — i 
CD O CD — — — CSI I 



O CD — < — ■ 



CD CD CD CD 



OO OO OO en 



^r^i^ooooobcoobobobobcocnaicn 
ooooooooooooooo 



' op CO 

CD CD 



id o 

CD CD CD i 



262 



- o 





Z 




UJ 




a. 


»— 


X 

uj 


UJ 


a 


3E 


z 


UJ 


< 


ee. 


i/> 


=> 


m 


CO 


U 




z 
< 


u. 


$ 


o 






OOCOOOCOC/)COCOC/3COCOOOCOCOCOtO 



Q_ Q_ Cu Q- Q- ( 



Q_ Q_ Q_ Q_ 



5 5 



I I I I I I 



ooooor^usooi 

h-isCOOOOOOOCOWi 
OOOOOOOOi 



^- ^_ o 

r*«. OO CT> 



o o o 

P-. OO CJ> 

o o o 



r- oo <n 

o o o 

I I I 



o o o 
r— oo O 

o o o 



o o o o o 



: o o o o c_> 

_,Z_|ZZZZZ_j_, 

_j<c_j<c<:«t<c<:_j_i_i^ 

LUZLlJZZZZZUJLiJLlJLiJ 



o o o o o ' 

' <f <c <c <c <*' 



OOOOOOOOOOOOOO 



K kj UjUj 

> gig 



« _ o 

r^- oo cr> 



^ ^ ^ 

i^ X. X. 
ft Jte <te 



5 5 S 
^ ^ ^2 



~- ~-, o 
l»i ob CT> 

o o o 



263 



ooo oooooo 



O O O O O O I 



to»n Mi/lt 



iS S ° 



£z<oo:o 



cc en 

=3 =3 
O O 



= = CD - = : 



U_Li_ z UJ li. > I- i 

O O q UJ o o o 



figfioi 



> z !- -! S 



OQ^DyQCl 



<c "J <«: _i <* « 



CO —I 
-» «t UJ 

CO UJ CD 



Z Z Z Z 2 t t 

22292<< 

o: a a: o: a: , _, 
oouooSS 
wco w toco > > 
tool m CD gd < < 

=5 =3 3 =3 =3 CC CC 



O CC 

^ ^ O 



O O O O O I 






=. = = CO . 



°=zO u _z^^£ tQ _£_ Q: . a:Q::Q , Q , 



_, ce ce cc 2 cc 



ce 5 => => : 
' h— 2; co co i 



<t <t <t «s 



CQUJUJUJI 



^ <-> 5 5 

CO CO £ z 

i ° °° _< o 

:_ cc « >_ 

i£2g£ 

. ) > >■ iZ > 
=£3uj = =i 



OOOOOZOO-^i 



o -* o 



.^O — , —. o O O -^ -^ •— • 



CO O CO ro ro O O 



O O O O O 



lo r-. ^r to <x> <x> <x> 
o o o o o o o 

I I I I I I I 



r- oo cr> 



O O O O O O O 



O O O O O O i 



> CD O O O O « 



• oooooooo 



3 o 
S 3 



o o 

OS «S 
O 13 

z z 
:> :> 

GO GO 

•* «t «t 

£ UJ UJ 
«K u_ u_ 

^ o o 



Z Z Z OS oB 

gegcoco 

a o o :> => 



— I — I ° ° _1 -J 



UJ P «" <_> 

Sg:££ 

a. „ :>■ it! 



' p= ==' 



>- «t «t <t >- >- 

O o GO GO GO o O 
_i -J C3 13 O -J -J 



gc , "*o^<JujGoo 

•> -*" Pr >- f^ ^ _j «* 

^^fez^io z 

<* 5 — OS< I o 
uSot— >— io.ee 



cc o o oc ti 
o o a. =3 — 



<c co 

—' cc 

CC •< 

= S cc o 



o- =) co cc 95 



uj CO c_) 



I z uj 

Q z £ =! =iz 
, -J «t cc o o =»■ 



cct_iZ2ZCc^2 

-■OliJZ jOO — 



xSxujco<:ujo£oo 



£u5^""=o 

ii; UJ l*j uj UJ UJ 
9t =5 ^ 3= ^ I 



;o<o: 

; z cc uj 

, <t O CO 

: CC tl CO 

; UJ z S 

! o <t £ 



Si o o o o o o o 



^ 0*>Cno*>cr>cy»CT>cr>0">cr>'-^.-^-- i « o « O O) O i 



O O i 



—^-^.— oooooo — 



o o o o 



O O O O O O 



o o o o o o o oooooooo 

OOO OO OO OOOOCDOOO 



OOOOOOOOOOC\JC\J 
aocccbccooo6ooooobo6cr.cn 

oooooooooooo 



96-500 O - 78 - 18 



264 



ocacocccacocacocccacccocccccccaccc 

00000000000000000 

zzzzzzzzzzzzzzzzz 

ooooooooooooooooo 

OOOOOOOOOOOOOOOOO 



ooooooooooooooooo 



<2 x 

uj Q 

s z 

UJ < 



CD U 

52 Z 

o < 

o 



I 3: x; 

GO GO OO 



xxxxxxxxx 



1 00 00 00 00 00 CO 00 



ooooooooooooooooo 



000000000000000 


E 





z z 



z 



z 



z 



z 






z 



z 



z 



z 



z z 



z 



z 



z z 



«c <t 


<t 


«I 


00 


3 


X 


<t 


<c 


00 


<£ 


00 


00 


<t 


00 


•< 


00 

1 



0:0:0:0:0: 



00000 
X z z X z 
a. a. o_ a. a. 



00000 



o o o o < 



zzzzzzzzzz; 



UJ OOOOOOOOOOOOOOOOO 
« COCOCQCOCDCOCOCOCQCQCDCO CD CD CO CO CO 



■ g- a. cl. 
; uj uj uj 



uu OOO 
ZZhhK 
O O O O O 
X X Q- Q_ CL 
°- °- - - - 



oe ccorccQ^ccccccccccccorcccccccccccc 

UUUJUJUJUJuJULiJUUIUJUJliJUuJU 

U EQQ3mmfnmmfif ) fnmfr>n^nftfffiff ) (fm 

■ OOOOOOOOOOOOOOOOO 

"^ cccccccccccccccccrcccccecccccccca: 






CnoOOOOOOOOO-^ ^-§ #-H 
OOOOOOOOOOOOOO 



2 o 



OOOOOOOOOOOOOOO' 



265 






X 

O.a.O.a.Q.Q.Q.Q.1 



II 



OOOOOOOOOCDOO 



.-^ ^ o 

r^OOO 



3CSOOOOOO 

ooooooooooooooooo 



o o o 
r-- oo en 

o o o 



o o o o o o o 
o o o o o c_> o 



o o o o o o 

x a: x x x x 
a. a. o_ o_ a. q_ 



<->0 000<_>00 

oo^ooooooo QO 
oooooooooo"*" 

0.0.10.0.0.0.0.0.0. 



o o o o o 

X X X X X 

a. a. a. a. a. 



O CJ O CJ> o 



35 



a: cc o: ct 



o0 oQ 



o o o 
o o o 



«: «c «* ^ «t «t 

UJ UJ W UJ u u 

Q_ Q_ O- Q- Cl. O. 

1 «c <: < ■ - 



«C <£ *t «* «* ^ 



x x >- x x x : 



O <-> o o o o o 



o o 

Q- Q_ 

cj c_> 



u- 

o o o_ a. 

a. o_ 

o o o o 



UJ UJ I 

a- a- a. 

C/3 OO I 



< < < < < 



X X X X X 



cstcsimooooo^- 

COOOOOOO" 

(CiACOOOONrstn 

en cr> o - — — — — ui 



— " o o o « 



<jD <jp cnj r- r- i 

O OCsi (N eg i 

O O O O CD 



ooooooooooooo 



I O O I 



^ ^ ^ 

UJ K* k k~ 
X U- Uj Uj 

< ^ ^ i 

2 ^^ ^ 

3 Cs C5 <Z3 



o o o 

— —. o 

r-L ob CT> 

ooo 



5K ^ •* 

P P F 

«o O to 



** ■<< ^ 

i- i. i. 

S= 9= 8= 

S5 Q 3 
C: C E; 

5o So 50 



«* O « 

i: <2 -c 

Q. > Q. 

UJ — u_. 

* pSp 

O GO rr CO 



UJ * 

UJ 

O u. o — o 

3C o io^«i 

U. 5 R R R 

O = i— f- >-- 



266 



OOOOOOOOOOi 
OOOOOOCDOOCD' 

O O O O O CD O O O O ' 



o o o o 
*»■ o o o 

r^ o O O 



cccccccccccccccccccccccccccc 



: u_. ° 

! O <j 

: uj S 
~ «" I 

-O <t 

cc^S 



°cc 

figs 



**- 0. 

«2 X 

z ^ 

LU Q 

aE z 

CO ^ 

(X U) 

=> u< 

OD U 

J2 Z 

o < 

£ * 

o 



< M 5 .- 



_ I CO CO O f— 

>Z<DH2 



d: o o dz <i o o 






























Ld 












cc 


cc 


cc 


CC 


CC 


cr 


cc 


cr 


CC 


cc 


CC 


CC 


CC 


cr 




QC 


CC 


CC 


Q 


a 


Q 


CD 


a 


o 


r-» 


a 


a 


o 


r~i 




o 


a 




O 


o 


O 


S 


^ 


«~ 


^ 


s- 


^ 


«•■ 


s- 


^ 


«' 


s 


«^ 


*- 


<r 




^ 


^ 


«?■ 


•a. 


<t 


<t 


1 


•a. 


«. 


•a. 


<c 


■a 


<l 


•tt 


•< 


■a. 


<i 




<. 


<x 


<1 


< 5 


o 


C ) 


c -> 


c > 


c > 


t > 


C J 


< > 


c:> 


< J 


CJ 


C ) 


cr 




C J 


c ) 


o 


CD 


Q 


a 


CA 


o 




o 




CD 


co 


o 


CD 


CD 


■ a 


CD 


o 






























<£ 








































O 


O 


o o 


o 


<_> 


o 


o o 


o 


o o 


<_) 


f 


- o o 


o 


























CD 


%2 






«^ 


^ 


«^ 


^. 


^ 


•?. 


«^ 


^. 


•^ 


«c 


z 


£- 


«fl 


Z 


«£ 


I 


I 


T 


T 


T 


X 


T 


T 


X 


X 


T 


T 


T 






T 


T 




























CC 
Q- 
O 








«J. 


<r 


< 


<t 


«J 


<* 


1 


<S 


1 


<1 


■a. 


■a. 


•a. 


i< < 


<X 


<I 


sssssssssssss 


WJJS 


o 


o 


o 


CD 


O 


o 


CD 


o o 


o 


O O 


O 


•too 


O 




































cc 


CC 


cc 


CC 


CT 


CT 


CC 


CC 


cr 


CC 


cr. 


CC 


cc 


Q 


— "£ 


CC 


CC 


<._> 


o 


<_> 


CJ 


<_> 


CD 


C) 


U 


c; 


c ) 


C 5 


o 


o 


O 


£= 


< > 


CJ 


^ 


^ 


«1 


^ 


*T 


*c 


«c 


*c 


«^ 


<? 


£L 


«c 


z 


13 


JL 


«^ 




o 


Q 


o 


2 


2 


2 


2 


CD 


o 


CD 


CD 


o 


Z 
DD 




O 










































< > 


I ) 


( ) 


< ) 


c > 


< 1 


< ) 


o o 


< 1 


C ) 


C ) 


< > 




<* o 


c 1 


< 5 


rr 


cr 


CC 
Cc 


rr 


rr 


CC 


CC 
Q- 


CC 


cr 

cr 


cr 

Cc 


CC 
Cc 


cr. 

a. 


cr 


5 


o a. 


CC 
Q. 


rr 




a_ 


a. 


a. 










ir> 








rsi 








CD 


CD 






UD 


en 








o 








CD 
















rsj 


























<n 
















O 


1 


i 


CD 


CD 
1 


CD 


CD 








1 


1 








i 



O— <CsJCDO— 'CSIOO -"(Sjcsj^no^^ 
C5C3CDOOOOOOOOOOOOOO 



S I ! i I ; z 



O O ^- O O Q_ Q 

, a: cc 2 ^ « 2 <t 



Z LiJ uj 2 i 



i OQ ao OQQ 

ccccccarccaicrtrQiCEicrct 

-*<:*c<t<c«*«£<:<: 



CC CC 



2 accJaaQtcaou: 



O Q ^ C3 O fj Ci 



Ql3lQt30QO' 



Q_ Q_ Q_ Q_ Q_ 

O O O Q O 
Cd cn cr. cc ct 

<«<£<:<:•< 
S S S S S 



Q. £L CL a. CL CL a. 
OQOCDOOO — 



z uj a: a: a: 
— ac <« <c *t 

p y CO CO CO 

5, iCLQ. 



ccccccccccccccccu-Li-'ccccra: 

ooooooo 00 ^ooo 



;g^2-g2s-: 



' o o o o o « 



267 



O O O O O O 



0>k^(0>f>l 



= o = > 



o o o ^ o 2 

3: 3: ^ O 3: o 
CO CO GO ~ CO ~ 

SSS o S o 
o o o ►— o t— 

!Z ^1 ^1 tJ ^1 o 
a: o: o; o o; o 

U U UZ LhJ Z 

c_> o o o o o 

O O O Z Q Z 

>• > >• I > =c 
o o o <2 o co 
0:0:0:5 tr5 

a- o_ a. 3: o_ 5£ 



0:0:0:0:0:0:0:0: 
cococogococococo 
luuxujujujujuj 
ZZO-ZZZZZ 

oo«tooooo 

a_CL.OQ-Q_Q_Q-Q_ 






Q. u 'J u. 



13 O UJ C_> 




ZD 




















< U >- LU 








en 

O 


CO 




















SSyS 


5 





O a: O 




ZD 



O O O. O CT> «* 



-h r»s M «o O^ in 

o o ~ — — — 
000000 






OOOOOOOO 

I I I I I I I I 



00000000 



~- « O 

r- 00 a> 

000 



O fx. —. OO — « 



0000 



ii 

o o- 



o o 

x x 

Q- Q- 



o 



o c; o o 
a: a: a: 0: 



Q o o o 



s§ 

00 Uj 

a. 03 
■ o z 
: o: o 
" «* >— 

So 



O <= !jj O 

z z 

- ^ — ' Z UJ g 

^ uj a z uj o 

—J Q_ <C CC Q_ <£ 
« <Ouj<0 

o» CO - >~~ CO 

_ UJ <£ CO u_i «r 

2 :-> o $ o o 



co£o 



CJ Z «_ — 

x 08 < o«a< 



^ ^ ^ 

o 5 *: S 

•x. kj kj Q 

«t i S ^ 

* g g § 

2 ^^ ^ 



i-- ^ o 1 
co 00 a: 1 
>- >- rsj . 



S= E* 9= 



>*ca £ iZ > 



1-- 00 »a- to — 
000—00 

1 00 KO CM CO — — 

O — r-. r- r^ rv 



O O O O O O 
O O O O O O 



— ^ ^o O O o < 

OOOOOi 



000 

~. -^ CD 
co co co 
r^. 00 &> 
OOO 



> o o o cn 

00 0000 x 

I O O CD O 



268 



U_ 


LU 

a. 


CO 


X 

LU 


LU 


a 


s 


7. 


LU 


< 


CC 


»/> 


=> 


LU 


00 


U 




z 
< 


u_ 


s 


o 


O 



O O CD O O i 



O O O O 



I— uj 

CC >] 

O u. 

CO K? 



3 <" 

^3 ; 



150.0 

: CL. OC ^ 

:{SE°" 

I w I- C3 



-5= GO ■= CD 



i535 



LU LU 
£C = cc = 

<f cr <t en 
=> ~, => oo 
o _; a „ 



o- 1— a. 1— 



= = S 

menu 

out 

tt° 

o o z 
zz° 

o o t- 



_i o o — ; 



s. z z > >■ : 

<rrSo:o6 



SCDCOLIirOOLuu. 
OZ3=>U_U_00 - 



=> > z z z z 
Q J2222 
£ °°£ £ £ £ 
^H cc oc ce ac 
ce tz o o o o 
■ 00 00 00 00 

CD CO CD 03 



1 O O CC OE O O CO 1 



OOOCSJ -"(SJOJ-««0000 
icrv uin CMrv.toLDtDu*)tOr^r>. 
OOOOOOOOOOOOO 



uj O uj 

> -J i? 

t— «* OO 

o UJ co 

x uj £ 

UJ CJ ro 

CD O — < 



* CC ° Q 

s lis 

z o <r <r ir o 

2 id J J zu, 

H- Q_ — ' ^ LU q_ 

« »- <t «t I p- 

z S E S o- <c 

= O O O «* C3 

i z 1— >- o z 



o o co o 



z g 



, Q- ^ Q_ 

5 >o>o 

i •" Q •» Q 

* CO O CO o 

£ LU Z LU Z 
uj OOOO 



O U) (£ U3U3 

5 oogg 



5s^ 

2 oc z 



*j o ir o Q Q 00 

E £ £ CC CC Z CC CC 

S ce^«*<:z«£'< 

5 — * ZlULU LULU 

* »o>cocd>.coco 

^ n ll. i.i CD CO tf CO CO I 

to i D ^29222' 

UJ K °° K 





< 






z 
c 


<_ 

z 
«* 

Q- 

c 

c_ 

■ 


<c 


CL 


Q 

«t 
CC 
LU 

in 



5 £ ^ o 



S LU S 

- LU ^ ,2 

CCOCCCCQ-OZl— _l 



269 



o o o o < 



— ■ cm — • co cr» — 



I O CD O **"> O ' 



— — • O — i 



o o ^ o I 



r- O CD r- 
CD CD CD irt i 






£si 



^o 



co a. 



O Z Z 

tz o o 
= 00 

_ or cc 

o££ 

00 ="■ > u 
... a: a: ii 



0:0:0:0: 
=> = =2 = 

UUJ UJU 

en en en en 
o o o o 
; Z ZZZ 



OO 



CO 



= = = «s — cr 
: cc or as _ ¥0 
1 o o o 9: <=> o 

1 CO WW 3 i_ h- 

' =3 => => UJ O X 

1 w ww ww a. 



!s!ttfc 

cu o O — 1 
' CC CO CO o 



LLJ t— 

w w u 

=5 Z g 

o o 2e 
00" 

_ "- UJ 

2ES 



cc 00 z 



= a. o 

5oC, 
a: o: o 1 



•I o o 



lg 
w — 

■< 3: 

c_>° 



X z Z X 
CO CO CO CO 

<t «t «t «t 
w z z z 
0000 

o o o o 

a o o Q 



H- o O 



5 co co 
uj «* <: 
ESS 



a -\ 

GO OO 

*z 



OOC5C5 



1X0:0:0:0:0:0:0:0:0:0:0: 

cococooocooogooooooococo 

UUJULUUJUJlUULiJULiJI 

ZZZZZZZZZZZQ. 

ooooooooooo< 
3:3:3:3:3:3:3:3:3:3:3:0: 

Q_Q_Q_Q.Q_Q^Q_Q_0_Q_CLO 



OO u") 
O CD 

I I 



O — . CM — • 
CD CD CD CD 



O O O O O O O 

I I I I I I I 



■rv — — — 00 1 



— ^ CD OO PO r— . — « ^-» CO — • 1 



OOOOOOO OOOO 






l CD O CD O O 



OOOOO 



OOOOOOOOOOOO 
OOOOOOOOOOOO 



: > z 
■ or uj 

J wo 
• ^ <r >. _i 



2 ^ en 

CO °" ° 
w >; o 



;o:z Jugccii:, Ozct 

. LJ (J O j_ UJ LU U . OUJ 

:al j o<'')ooJJjj3m 

:5?Ssi5?^5§z 

' CD CL_ Q;}T^COaizZo.CO 

:oww-tooujyiiJO 

ir o: x □ t (r tc 1- 2 a: a: 



a: 

o 

z 
<c 

■< 



a oooor^ooocu 

z ira:ocQ:5[rQ:o:t> 

5j lj u uj u < mm lu I 

S 5S55>-SSSo: 

u, a}comcoo:cococo< 

, , oooo«Eooox 

J*{ K IT I It S E It tt o 



! W O 
_j O o J o 

UuitrUkj 
co om 

t> -1 z ™- _> z 
v <c «* a£ <: «* 

5 a: z ccz 

i. z 2f = 

e uj ,_.- < uj _- 

3 "§£"§ 

« 3Z O «*: 3; O 

!2 =3 <f UJ ZD <f 
* OWIOM 
2 CO CJ O CO O 



O Q C3 j O CI ^ 



o: z z — 



«* O O 3; O O 1 

uj <f «t zd ^" «f ; 



OOOOOOOOO* 



I CD O — O CD O 






36 cn^i-^CM^-ooocsi 

O 00«00««-hQ 



CD CM CD CD — • 1 



r^ r^ 00 O 



• CD CD CD CD O 1 



O OOOO 1 

ao co 00 00 ao < 



r- r-. o O O 
1 csi cnj co m co 

iO OOOO 



NrsOnrvOOOO 
00-^-^CNICOCOCOCO 
r— r^. r^. 00 CT> CT> CD CT> CT> 
OOOOOOOOO 



« « U> O O 1 
O CD O < 

OOOOOOOOOOOO 



270 



d S 1 



3 £ 



g ^ 



£ z 

2 £ 

«2 x 

z uj 

LlJ Q 

z z 

UJ <* 

to ^* 



en oc ol cc ex. ac ac cr. 



oo U 

2 Z 

o < 

° o 



Q. Q_ Q_ Q_ Q. I 



O O O O O O O 

I I I I I I I 



s s s 

to to Co 



s s s 

to to to 



o o o o 
£? ^? ¥2 £? 
> 2 2 > 

UJ LUUJUJUJ UJLlJL4J 
— |ZZZZ_I_/_| 

z "7. "". "" "" z z z 
y a" o" o" o" H ^ "^ 

icooooorior 



O CO O CO I 



* a. 9- g 

s ass 



IT"* 

i» i^ ^ 

s= s= &= 
s> s> & 



O o 



I. *■»■ O o O O O O ' 

._ in oi o (ji en j) oi 

^ O O O O O O O i 



271 



< cnj to oo en cs» 

O O CM — U"> 



[ OO (0 ' 



o ~^ < 
en i 



5 5 
Si 



O- Z 
CJJ u. 



o 



(-> a: 

o -~~ ir <- -. 
°- £^^ 

s z a <2 

*= 2: o — == 

° o ° 5 JE 

°. kf> <X> UJ ■« 

r— o-> evi Z Q_ 



SJ! 



u. oe p 






i •"" -_ Q- UJ uj 

So""-'" 
£z£ 



o o 

UJ —I 

3: o 

t— z 

u- < 

i y £ 

"Jo: 
o"£ 

9= >; = 



^£ 



: ao 



oo 

UJ — ' 7= 

z oe cc 

£25 



J <3 o ' 



050S 
i < •* ^ fe u 1^ 

uj ,-.- uj ^ S *=f tz 
2 u 2 a. u. to 0= 



UUK 



££ 3 



o o 



O O O O 



^ o m — • ^ CO (JD 



O O O O O O O 



OOOOOOOO' 



OOOOO 



u. oo oo 

J™ UJ UJ 

* _ u. 



z 

o" : 
z j_ 

z 

cc 

Q_ 



or o 



* tr « •< t: •>* <t <t 

o if «* « " «t <t «i 

— _i ir tr _i K o: o: 

^ uj o: a: uj ir a: a: 

— k9Sk°99 

S z >■ ;> z ;> > :> 

* o o o o o a o 



a. :g£ 



~ o 

Z ^ , u- 

"J ac a. z o o 
" O UJ o o o 



Uj (JC UJ 

— ?* y o or Z 

OqO"uj j j> 



— 00 at 



,f Ql 



5 ttCsoopj-tzg-i-tcQ 
* g|oS|l o§^ 



, o <=» o $ x 

ZZ w Q_ ^ ►— 



iCDQ<y KO 



C o o o o 1 



OOOOO 



O O O CD 



~ o o o . 



o o o o o o 



I o o o - 



0000000 



272 



O — ■ CD O I 



■ o en — t o O r-* — . i 



p O O O uT) OOOOOOOCO 



«2 x 

z ^ 

uj O 

2 Z 

UJ rf 

CO ~ 

OS V) 

a ui 

ao U 

<£ Z 

a < 

o 



2 « 
W> Z >- UJ ' 

~ 2 2 — ' - 

°^^ ^^5 

2 5 uj o — a. 

" So "J 0£ _, 



: a. 2 






GO <C 

= s o±! 

!oI|| 

<r ec — " 

CD a_ uj 3 ce. 

5 ° 8 i •»" I 

? 2 3 •« — 

O o o o 

<<zu> 
ce -> o o ti! 

CO a. to o P 



O O — I CO Z 



/>" 2 P. 

3 O OO 



o- z — £ - 1 ~ z 



s 5 

a: or , 



? ^ S 



3 II 



Cd uj , 

UJ Q_ 



<2 :oo s 



■ UJ Q_ 



■ i— «-> 

,J3 

. CO Ou 



o 



uj c^ 5 rtj 
s oS - 



1*3 



: —i < 



S3 



= 0. 



uj""° : 



!hSSS<o§^ 



<t U. UJ 

, «t o ce 
ce se 

u^o£S 



> co S it! uj z o- ^ 



p o£S 

o t— >— i 

* 5 £ 



: => ce uj 2 



= 00:<<;<< 



UJ < 



o o n o ' 



O O — < O — — « — i i 



~-» CO — i oo est 



O O O O I 



' O O O O O O O I 



O O CD O 



z o = 



Z uj 



_j cc uj 

*£ uj ce 

C3I-H 



-U ^ ° 

iSog 

J <r o O 



!=fc£=i 



j " 2 o 
: -5 S « 



< Q C 



< k = S a. i 
m ^. o * ^ . 



^5¥=>°. 



,- £ Z« OH 



Z « <t O O g 



s>s" 



2^5 



SrfSLi gfa ) .^ ije. <~j- ~ — -^ ^ ►- uj ll. ^ e»z g m i 



>►— «tXO£IZ»-O0»-l— 



or > i 

OO O O i 



«csjo^r^wcBO^ro^in^or>jro^</)toi^< , )VCsi'Hr*jf , iro^csirocNJCOCJ)i 
^i^H^cnOO--'^— iMrHmiO^<jO<j3(jD CD <jO O O CD CO CD O O OO OO OO OO ■— < ~— i 
0000-"-.r-.«^-.-,^HOOOOOOOO^-'OOOOOOOO^OOi 

^Tr^ooicnoiOTajaic^Trvv^r^r'<fV^i v -'^'^c7iWci)inoococO'H(Nicsii 
ooot\icvjcvjc^csjf\jiNcsi(nnnnpn<*)( , nfornf»i^^r*fv««^^'^f s '' s ''^i 

OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOi 

^n^ocnoicno^cnoiaicsjcsjr^csiCNjcvj<\ic^oo^'-*'-''-- , t y )cO(jD<j3000« 
r^r— r^oooooooooooooboboboboboboboboboooooo oo oo oo u en en en cr> o-> o*i o*> « 

OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOi 



273 



ooooomo- 

uS ^ tf"> O OO f-- CT> 



oo o o 



r^. o> r- tf"> O 



>«— ' CNJ tO •— • O CSi (£ (A ' 



o£ 

tu *p o ca 

UJ ** h- z 

Z UJ X 

g*£x 

00 £.3 

UJ .Ofl; 

5 55 * 



' "" z =2 " H u - 

. — ij ^ "- o 

Z ,. SS LU OO 

r > £ ?? w «* 

ui^£ S o 

-^ °z o or 

£2 ujcS 3 



3 Z 3 o => 

o JtJ o o o 
z z z z 

•* o <t <t 1 

<!<<< 

' >■' >-" >-" >-" >-" 

tr fc t t_: t 
00000 

X X X X X 

OOOOO 

w w crt co to 
OOOO 



o o 
o o 



OOOO 



000000 



ccctct^ctctctacctracr: 



co>?p j 



OuJLU 



OOOOOO 



i CO CO CO CO 



2Z ^ ^. Z. ^ ^ ^ 

OOOOOOO 

n: 3: :n 1 1 n 1 

0.0.0.0.0.0.0.0.0.110.0. 






<X> 


a-- 


O 


CN* 


OO 



1 


<jd 


1 


O 
1 


O 

1 


O 

1 


O") 

CD 
1 





CM 


<JD 
O 


O 


T 


<-D 






CD O O O 



OOOOOO 



OOOOOO 
CD CD CD 



I I I I I 



OOOOOOOO 



OOO 
I I I 



is 
is 

Sg 



*5o5 

3 o o _, 

£t°Z< 
3 O «t ^ 

C£ 3 CJ> 



o o ju.' Zl ■a ~il 



*lZ^w»Z 



-E o O o -^ 



*u 

>- — O o UJ O (- 

uj iZ. ct ^ __i ciJ 

I — CO E-. O ~ CC 
t— O «t O X OC O. 



S O CD O CD 3 CD 
QC UJ CfcJ uj _1 o- —I 

u. Jo: jCctro: 

< UJ f- UJ uj UJ 
"J S m CO OD Cu CD 



■*Lu=e$ 



O O ( 

z z ; 



* oc z o 



;»_- ™^-zzzz 
:_^uj^uj^-u.u.u.u. 



— ►- _| UJ _l t- O 

uro<:a_«to«c«s«*<:a- 

<<cc<ii:<o- 



OOOOOO 



O O 1 

«t < ' 

O O 1 

<«f <f ■ 
o o 1 



* 5 ^ ^ 

* it $ § 



o CyJ 
^ o 



« o o^ — — o o 



CT> CD CD CD 1 



OOOOOOi 






3 OOO 



OOOOOOO 



10 en ix> rz> to o 

r-. r-». 00 ao o*> o*j 
CD CD CD CD O O 



OOOOOOOOOOOO 



— — CD 

co ro co 

r-^ ob cr» 



274 



i - 



o o o o o in o 

~ O O O O O OO 



m U 

2 z 

a < 

° o 



»— ^ CO 
CO UJ 

^SS 

LU CC ljJ 

§£§ 

!£ = 

2 OO Z 

o z o 

° ° on 

O z UJ 

oog 

Z oO — ' 

z £ rS 

S>. 
a. _) en 



O «* O 
■«»■ O •>» 

2 wo 2 



: o <S) o 

' ce ^ a: — 
o o £ o > 



>— — _ — o 



en — : co or 



m 



a. ce ij' or 5 

"£ ft; ££ ! 
oo £ S : 

CO UJ 5 UJ OO I 
=> Z UJ Z Z I 
00 O 3 O «t ' 



CD O O O 



O O CD 

i — oo en 
ooo 



iOOOOO 



•"* t ^ 

f* P= !* 



3 Soo 

00 * ^zi 

« § 353 

1 I III 
s » ill 

o 

V ** r~ OO en 
™ H- — O u-> 

^- £ CM *£> OO 

5 °-s 

O ►- r~ r~ r~. 
CO (0 tO (D 



* O z O 

S 3E E 3E 



2 ce .or 

B O «t O 

Lu UJ 00 UJ 

ce UUU 

u. 000 

O 10 CM JO 

5? en co en 

£ 000 



! s 

£ -oSz 



S uj — uj 5 g 



o ce 

z ce 



z 00 o uj 
3 - O 2 5 ce 

« £ z !±j £ £2 



S; o o o 1 



— ^ — . o 

en op co 

r* 00 en 



OOOOOOO 
O CD O O O O O 



275 



i O O lO O "X> CT> 

U3 O >N (M tC O 



O o o o 



CT» CTJ> 0*> O 



CNI — O OO tf"> CO ~- ' 

pg ro ^ m rs. i/> rv i 
n po v >/i c^ *n fst i 



O — 

51 



£l 5 i 
06 a s! i 

°= o S 
ooS; 



«c •- _i : 



I- O 

x{2 

co :n 

m z 
So 



o -J 






. {J Ul 

z : o 

uj : uj ^ 



o «: o o= Jfc 
z S: S " ° 
ujS^oI". 

ozn(oS 



O «* o 

Ij S» o 

< 3 z 



3 ?i 



"So 



uT o _i o z 






.0.00,- = 

>«y-z-i 

> S2e3"> £ 

.u.uj£nQ:s 

. u ID<U 

3 O UJ OO C_> Z 



o a: <-> 

3: 3 u. oo 
>. * o: o 

o- u. of: 
<t o u. O 

i- t o Q 

«t [r ce z 

2£ Z J5 UJ 

o o = > 

oo«g 



_i o j: 

< CO "^ 

CC CD UJ 



— ■ OO 

o co en 

co <x> ud 



no o O 

ooo 



conk r^ f^ 



, o> — ■ — ■ — • 



Z Z Z Z. 



o o o o 

CO CO CO CO 

o o o o 
z. z. z. z. 

«t «l «t «t 

CO CO CO CO 

o o o o 

o o o o 

o o o o 
o o o o 

z" z" z' z" 

o o o o 

o o o o 
zzzz 

i i 3: i 

CO CO CO CO 






— — • o — • 



oooo 






oo oo *— ~^ r-« •— • cnj co — < oo 
— •— ■mOOOOOO~ 



> O o O O O O O 






O O O O CD O 



ooo ooo 



— 'OOOOCVIOO 
co-^*ru~>r— tjDr^co 
OOOOOOOO 



: uj z 

> CO 



'05 e=o. 

1 -5 ; ?^ -> s : 



i °s 

CO «r 



UJ ° uj ^ 



! UJ «* co o- o ■« 



11 



z <t 
ce cc 

a. CO 

O o 

UJ z 

Si 51 
".srd 

"^ _1 ,« 

^ <: to 

S z uj „. 



cc Lti «" ' 



z o 

OC I 

" 3 



2 o 



<za 

uj ^ >- 

»y uj 



2^2 2 
coo s co 

i o > 



S^US^U" 1 



: ce "J 



co ^ uj pr 

|R5I 



* » z <-> 



z z o 



uj 2 I 



o <c <£ _j »— — coo. 



00 >- « VC 

!ti g a s° 

1 JC " o z 

2o!2d 
I co o > ^ 



ooo <2== 

p uu oo 3 
oo ^ ce o 
x cc O oo 
£ < z S 
o. o. 5 ° 
«t oo =! o 



o o- z 

>- >■ o 
oe uj o 



ea co co o co 

3E o o m o 

* zz^z 

OC O O Zj o 



mZ'O 

z o oo. 

< ? ? - 



s^ot^^ororoB 

iuuizuiuju 
.a u . cc uj uj ^ 



J •« Q- o < 

« O <c == O 

!£ «t uj o <t 

~ coi < w 

5 o o o. o 



% o >■ a^ 

Uj < I I 

_J Q- t— O 






r-» r-* o O O i 



o o o o 

CT» ^ O O 

oooooooo 






' & o ■ 

iu'jU1iI1U)(£I j 01£i'jO (fi (D (C 



ONoooonnfocsj 

C30C30C3000 
CT> O^ O^ CT» O O O ~^ 



o oooooo 



OO OO OO OO OO CTj o*> o*> o*> oS ctj o*> CT> o> or* o** ot oS 



« «3 OO » ■ 



O O C3 O O O O ' 



276 



5 5 



LU Q 

3E Z 

LU < 



oq U 

*/> z 

o < 

o 

LU < 



orQ^c^QrL^ccccQ^QicrQiQrccicca: 

UUJ U ujuJLlJUJLULlJUJUJUJUJLjJUJ 
OOC/)C/300COCOOOOOCOC/)C/5COCOGOCO 



ooo oooooooooo<co 

o_ a. o. a.CLaacLCLa.CLCLQ-UQ. 



— < CM O 



o o o < 



— ■ ^ o o 
o o o o 



■ *— "' i±; o o o 3: 



<o O <o 



:<<s i ■* ? 



. uj 3 "^ 



O O O ^ ►— *- O O Z uj 

O — «ct>-ooo^Q==:oOuj< 
it £o = !± - . . L r=>it . . t— c/j 



«* 3: 



T ^ ^ 

2 ? 3= ? 

Z Uj Uj Uj 

* S £ § 

s ^ ^ * 

^ O Q Cr 



555 
cq to So 



10000000000 



— . _-. o 
r^. cb CT> 



277 



o o — I 



O •— ■ C^O^iiJ^J'O^OOO' 



o o o o o o o 

ob oi ob c\i 06 r^ tc 



uj uj f^i 
5 5 o 
:> ;> z 



>- a- cc 

1 <t uj 

0.0.5 

UUJn 
* * o 

IjIjo 



3: o o S o o o 



5*B 



o it ■ 
>- ° s 

O " j= 



;*t 



CO C3 O" O" o o o 

> o: o: a: o: o: o: 

q <t <i <c <t <t <t 

<t JZ 3: 1 1 1 m 
1 _, o o o o o o 

; S S S S 2 Z 2 

g =3 =>=>=> = = , 

iojZZZZZZj 

ujSuj^^sSSISZSuj 

^aiitloOa^aictaiaia: 01 

q:ujii.3Zluujuiljiuujq: 
«t>ooo>>>:>:>;>*r 



a: ce ce a: cc en a: 
o o o a o o o 
z z z z z z z 
<: «< <: «t ^ <t ■"< 
o o o o o o o 
0000000 



o o 



IIIIII 



CJ CJ O Z 

111s 



5 s 

o o 



£ S £ c_> 

O O O Q 



00000000 



0000000 
o o o o o o z 

«* «C «S <S <t <t ^ 



000000^ 



CT> V£) <T> O r*. ^- *3" 

— CNJ O — — CVJ « 



o o o o o o « 



I I I I I 



000 

r-. »-» 00 

000 



1 — . o 
C> 1 

'OOOOOOOOOOO' 



55 UJ 

* z z o 
5 =J o o 

£ Z Z I- 



o o 

GO GO 

> > 
o o 

o o i 
z z t 

«! «t U. 



I4J GO GO Q 



ctccoooooo 

a: 2 £ £ x g: g; u: x c < 

_^0><25000000' 
SS Q -5«tSO-O.Q.Q.Q.O. 

oooc5-j=;o:q:o:o;q:o: 

** uj i 



_i — 1 o o 



--•Jxxxxxx' 

_ BC CC «t «t ( 

=><UJ<OOl 



OfCKCT' 



<q:q:o:q:q:q:q; 



<t «£ : 



„ EKirXKIE 

«/» o 

ec zzzzzzco 

m Z E 2 £ 55 £ % 

1 5 5 5 5 5 S o 

uj 2 2 2 2 2 2^ 



o o o o o o <r 

*t «* «l «* «t «« UJ 



— — CT> O O I 



^ o ~ * fvj r> «t m m 
o 0000000 

-^ O O O O O O — 



os Si ct> S> 
C; 000 



S o o o 1 



OOOOOOOOOOOOOOOO 



OOOOOOO 



278 



o o o o u-> , 

01 0"> -» -a- *T CVJ i 

' cnj r->' csj o 06 cri 



. o -» —* -^ 



u~t O ro f~1 O 1 



<_3mrooaoo»-*0 



O CT> CSi — 1 



— a. 

«2 x 

z "" 

uj O 

3E Z 

*_-l ~ 



co U 

_2 Z 

o < 

o 



z 


z 


z. 




z 




r- 


cc 




as 


cr. 








cr 




3 


— 1 


—> 


(.'J 




CJ 


■■> 




m 


l7i 


m 


Z 


z 


z 


m 


en 


cc 


en 


cr 




m 




cc 







£.1 











1—1 




Z 


f 


•^ 




* 




Z 





















C 3 


c 3 


C3 







_j 


— 





O 


£-1 





























«r 


«£ 


." 


cc 





cc 






< > 


fJ 


ci 


c ; 


C J 


















S 
















z 


Z 


Z 


1 


5 







cc 












c > 


t ) 




1 


< 












5 5 




<I 


t ) 


C ) 





O 


O 




r 1 - 


























=2 


^ 


=! 


=! 


=! 


si 


O 








O 








a 


O 







c- 


C3 


a 


CJ 






< 


<t 


<1 


<i 


«t 


1 






<_ 


CJ 


c_) 


<_> 


u 


l_> 
















nr 


«a 


■< 





CJ 


O 


<_> 





S 5 



^0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0: 

OCOCOCOCOCOtOCOCOCOCOCOCOtOCOCOCOtO 



a: z z z z z z 



3: 3: 3: 3: 3: 3: 



Q.a.a.a.a.a.a.Q.a.1 



o_ o_ a. a. o_ Q_a-a_o_o_a.c_.o- 



O-OO-^' 






O O O O I 



O O O O O 1 



I I I I I I 



OOOOOOOOO 



O O O O J 
O O O O I 



O O O O O 1 



o o j 

o O O 1 



■>->*>-; 

JZZZL _ 

<t <s <: < «« 3: 3: 



zzzzzzoo 



>- >- 
z z 



cc a: a: a: a: a: 



*x <c ■««-:<: ; 






<<<<<< 



a. o o o o o o 
c_i to S£_ _°. ^? _2 __? ' 

O >>>>>> ' 

H O O O O o o 



O CJ> O O O C-> 



OOOOOO:^ 

oooooo£__p_^£< 

WUJUJUJUJUJtjy^^l 

< ^ ^ ^ 



o < <t 



z z z sz 



1 o O O — 1 

' z z z uj 



* 5u-u.u-u.u_u_, 

S z ci 1 o 1 o" d id 1 flD CD £D £D m m m uj uj d i i" ™ "* o a a 
o:<:*t'<'<<:<x:'<<:<C'««*«<: , <o.Q,'<*«*x:*c^^^_ 

L_JOOOOOOZZZZZZZ*5«tOOZZOOOZ 

r* < ; « 5 •*" < -* i 



;(Dl-mai0Q(IlCD<< o - o -CDCD ( 

_i a:<:«a:<-<^-o:<:«t:<t*a:«*:«t<:o.a_'<«***«*f£*t«£^ 
- — zzzzzzz<:«s:oozz<^ 

2 S000000f=55__i-=-=-=0000-=5cj00__: 



CT) CT> CT> C7> CT* CT> O ' 
O O O O O O ■ 



'0-'C>- 



O O O O 



1 — OO 00 OO CO OO OO 00 OO 00 < 
OOOOOOOOOOi 



OOOOOOOOO 



0000 



279 

SI s 



5 S 



«* CO 

o »— 

QZ 

2§ 



t=-tt=t= 



o o 
a. a. 



63« 

«* -i — 

^ «: Q 

CO z q; 

«t o o 

z £; o 

° E2 °= 

? a lj 

K Z => 



O O 

oo *-~ 

o o 



o o o o o 



<o to <o 



tfe ce tfe 

« * ac 
<u o <o 



S ? ? ? 
* $ § § 






t ** ^ 
:*- i~ i~ 

^£ 

C^ ^ i^ 
5 15 5 

to Co <o 



o I 



11 

a. as 



t/» p _i cc _i 

rv — £E O £E 

« 3 §5-5 



o o 

z z 

i CJJ o 



cr ex 

o o 

ce ce 

z z 



tit 

z _l z 

z ^ .— 



O CQ 



CD 



U X 



00000 



3 Zj ce Zi 

^ ce o ce 

<c «t z <t 

.« I O I 

«2 000 



3 OOO 

a 

Ml 

— . — . C3 

^00 01 

OOO 



o S ° 

~ <x> o o 

O O CD O 



O O a-> 

r-C 00 ab 



3-500 0-78-11 



280 



o o o o o 



0)0)00 i^iOO 

oo cm o o co u-> un 



O CTJ « ^Hl 



=> =3 =3 E =3 rf 

ttfcgfc s 

DC a: oc °z oc o 

o a o 2 a -j 

z z z g z < 

< < «t "* «t _! 

&f i uL u - ut > 



£ X 

z "* 

LU Q 



ea U 

«2 Z 

Q < 

o 

LU < 



> > > > > 
Z.-Z. z. ^. z. 

o o o o o 

OO GO CO OO GO 
O O O O C_> 

« <c < < g 
o o o o o 
u u o u u 

Q Q O O Q 

z" z' z" z" z 
o o o o o 

I— K- }— t— H- 

z z zz z 

X I x 3: a: 

GO 00 GO GO 00 



w oo ^ « 
— 1 O CM O 


•*r 


IDNOOO) 

o o o o 

1 1 I 1 


en 
o 

1 


rvNcooo 


Csj 



o o o o o 



GOGOGOGOGOOOGOGOOOGOGOGOGOOOOOOO 

ooooooo«toooo<too«t 
xxxxxxxa:xxxxo:xxa= 

a.Q.a.Q.Q.a.Q.OQ-Q-Q-Q-OQ-Q-0 

oooooooooooooooo 
I I I I I I I I I I I I I I I I 

oooooooooooooooo 

©FHFH(0(OKMCrvr^oooorsoiO»(0 
OOOOOOOOOOOOOOOO 



O O o 

I I I 



: o o o 
: x x 
. a. a. i 



x x x x 



00 2Z X X X X 

ec x. x. x. x. x. 

LU LU LU LU LU LU 

S GO GO GO GO GO 

LU LU LU LU UJ 

* ~ ~ ~ ~ ~ 

u. «t «t «t «t «t 

. , x X X X X 

£ o o o o o 

»* —I \f> OO CVI o 

CO — • CNJ U3 U3 

O O — • O O O 

^ O O iT) to r-. 



OO O O O O GO ' 

=: «t «t «t «t = i 

a o o o o o 

" o p o p J^ ! 



P OL CL. 

O lu UJ ; — 
IUUZ> 
Q. t- I- o O 

JuomSJ 

° z s ^ ° 

IjOooS 

LU LU — O 
SC 3C "• I 

<«_■«. 

a. q. < ps 

<<o!J 

, - .»VI» V] . ^ r— OO GO . $ 

£ GOXXXXGOziiXXOOZ 

2 cj>ooooo«tiooej«£ 



uiu|oz 



CI uJ LU UJ I 

< a- a. a. 
p «t «t «t 



<w j;< 



LU LU O LU 

00 GO ^" GO 

!tl Z GO "J 

$ «t o S 



T t ^ 

S L? ?? 

2 III 



5H *jD ct» O ~^ CM CM CO ' 

w> ONWNNOO' 

= OOOOO^-^i 

~ -tf (O U) UJ (D (M CM i 

X CTl C/» «OT» — ihMM 



I CM ^- CM o <*t r>- © 
CD — — O — fi O 
, <jD o O O CO CO O 



VDLDUDUD 



» o o o 



■ — ■ <~& <•£> <-& <•& ■ — ' — « <X> i 



o o o o o 



I O O O O O O I 



© o o o o o 



281 



intend 
oo o cni oo 



s: ^ 



c/3 o 

O I— 

I— o 

O oz 



C/3 



: o: »— ec ce t t t— , 
o .-. o t_> i— t— — 

CO Q CD CD Z Z O 
O O O «t 



r-~ oo en 
O O O 
I I I 



-«oo« 



o o o o 



to to to to 
o o o o 



oooo 
o o o o 



O O O O O O O I 



<o to «o 
* ec «fe 

3 3 3 



3 3 3 



'C ** ** 

^- i^ X. 

fe ft ft 






ex. ^ 






3 ° ° 3 

«* «*•" «•" •< 



S^°z< 



Z <2 



°- « «-> H 
= rf . . . *J 



■ O UJ | 

'ZCO w 
: •< a= o 2 
I => O O o 
( O O X t— 



ooooooooo 

OOOOOOOOO 



J5 ct> o> <r> <j> 



_ ooooooooo 



O O O O 



OOOOOOOOO 



282 



O O ur> OO i 



O O O O ' 



cr> oo o uo oo 



— ■ o ' 



15 cr cc 

!~, <= <= ! 
£ z z : 
«r «t «t 

o _i _i ; 

z « <t 



— a 

uj O 

Z Z 

uj 4 



co U 

«2 Z 

a < 

o 



': u. z 

io 2 

z J2^S 

Z O i| LU O O O 

O <C "^ Z I I X 



2 O o 

-. "J X 

<t o 

Z ' 

O Q_ 2 



, zo 



£ 2 "* 



«* 2 2 X «t <t 
- 5 5 52 - - 

q- 2 S s °- °- 
Sxx5«« 

o o o o o o 

o o o o o o 
o a q a a o 

z" z" z* z' z" z" 

o o o o o o 

I— I— I— p— t— (— 

a o u u o o 

x i 3: i i x 
to to oo to CO oo 



— — . *J CD CO 



o o o o o o 

I I I I I I 



CJ o o o o 



^. ^. a. 2. ^. 

o o «t o o 
x x a: x x 
a. a. C3 a. a. 



f^OO- 



ooo o 



OOOODOOOOO 



eg o o o o 
O O O O O CD 






ooooo 



■j-. a. 



o «t 

X z 
a- o 



El 

rsj ~. 



tr o ' 

-«- CJ — ' 



" >• 5- 

< z Z I 

x 2 s ! 
. o o 

^ O O i 

zoo. 

=3 I — 1 — • 

OOO 
O X X 

°- °- 

££ 



z : tr : 
o o 






>2xooox = o 



=> o 

ooo 



o ™ to — 

ZZ3I 

o o o o 



uj ggg£to! 



«i £ 



yUluJUIH 

z «* < o « oo 

* "" Z =3 Z ^ 

* O I uj i <t 
.* . t — I — i— or> 

zL •<. O ^5 3 UJ 

J5 CO o ^ o x 

2 C5W JtflO 



O O O ~< O i 



moo-« 

o — — — 



O O O lO a") <X> 



2 r^ oo a> a> «r 

w ao oo O co O 

S o o — • o o 

* O CD O O O 



ooooooooo 



R 2 



c. S = = =1 



lOOOOOOOO 



m O O ID «5 CM 
p --• -- -^ « CNJ 

O O O O O O 



OO OO — « CM CM 
OOOOO 



283 



oo *jo co o-> — ■ < 



. o o ~ o f^ • 

I ro cr> oo O CO i 



o o o o 



oooo 



ir o: i a: i o: a: 1 i a: i i it 

LkJUJUJUJUJUJUJUJUJUJUJUJUJ 



— xxxxxxcecex 



0<r 

a: a. 

o LkJ 



z oo 
o <" 

o UJ 



oooo 
— ce or — 

^ CD CD ~ 

z ce ce z 

< o (j < 
r-acc- 



!— — — >- 

oo -j -J w 

r--t ^* ^ r-t 

, O O . 

.-. O O ■— 



t COCO 00 ^ CO 



O O O O O O O i 

I I I I I I I I I 



— . — . O 
m ro ro 
^ oo Co 



O O CD O 



ON^-OOO OOOOOO 
OOOOOOOOOOOOO 



O O O 
r-* oo en 
O O O 



: >- >- w 
zzu 

: « <t z 

: a. o. o 

:S Z x 

: o o a. 

o cj uj 

IXUI 
Q_ Q_ *— 

y <2 iy : : =2 Sy 

■ O O 2 

0°Lj^01j 1j1j1j11jjO 
O^COCDOcQmCQCQCCHkO 

°- z _,_■ °- _, Z _._._. z z °- 

«j<<<«B<<<<<oo«a 

ztra KZKIEKs — 

UJ , — K-K^Hrt-HI-ZZu 

uj g uj o z z g 
^OxiX^IXOxiXXUiuj^ 

CO .H t- CO H _ H- t— h- *— »— OO 

xooooxooooool^^x 



<o <o to 

Cc cc Oc 

533 



■<* ^ i 

i- i- i~ 

2= 8= 8= 

& & s> 






£ Q. cl 
O C£ CC 

— => =3 

Sop 



5 *t <c 



« o rf *r O 

5 ° — 1 ,— 1 ° 



3 f± «* « j± 



= ce ce = 



en cr> o — • oo o ro 

O — — — — CNiO — CD 
i ^t~> u"> iO , -C> tO tD r ^ *-^ ^ 



>- 53 55 ^ 



S5 r-* u-> to OO 

ib m in >n m 

u_ oooo 

o tO tO lO tO 



O — — — — — — Cs.rsiCNi.r»->coro 

OO OO OO OO 0*> 0*1 0*> 9) oS oS oS t7) o*> 
OOOOOOOOOOOOO 



sa ooo 

o 

UJ 

—. — . O 

i*^. cb cf> 
ooo 



P ooo 



lO ~-» 

T °? 
ob oo 






oooo 
oo oS en o"> 

OOOO 



284 





Z 


u. 


a. 


1— 
z 


X 


LU 


a 


£ 


z 


UJ 


< 


QE 


\s> 


3 


UJ 


00 


U 




z 
< 


If. 


S 


o 


o 



— "OOOOOuDO 



— ' ~ too 



oooooo o o o 



si 



CO o 



cc ac ac cc oc cc 



o o o o 
<c «t «t •« 



■ a: a. 
: a: o 



a: —j 

: lu <t 
:co S 



O t_> O CJ 



: ae ce as 5 

ttt 3 

o o o _i 

^. ^.^ UJ 

«t «* < > 

uuu 5 



ozoooozozoao 



: z cd 
• o o 
: f= s 
:9=q: 



la: zp z <x 
: lu = «t = «I 

:°= ~ ° ^ if 

, — , a: — cc >- 



?=£c3 

z 5 z 



a.za.ua.uOooz< 






OOOOQOOOOO 



z =£ zz 


Z Z 3C Z 3C 


^ ^.■z. 














C3 >- C3 C3 




uuu 


iCzi 


iisig 


z. z. n 


X X X 














S°JJSJOJ° 


5 55 


o o o 


° £o go 


o o o 


!—»—»— 






>->->- 


=■=.=■=■ 


=.z. z .=. x . 


X.^.^. 


ae £ ae se 


5£ SC H i< ° 


»£ 5£ 2C 


oeoeo: 


oe Q£ o oe o 


0:11:11: 


o z o o 


O O z o z 


o o o 




EW Y 
EW Y 
ASHI 
EWY 
ASHI 


>->->- 




z 5 z z 


^Z&ZLS 


x.^.^ 






r— r- r-~ 


»n cm to m 
























O O O O 

1 1 1 1 


O O 

1 1 


O o o 

1 1 1 










O CM C\J O 


o — o o — 


cnj cvj rg 



oooooooooo 



: ^ ^ o= o 



S to 



uj uif- 1 ! 

< co P z a: _j 
2 a. o o co o 






z co t>= J3 uj 

^ oc uj = C3 

— co ae ee 



OB 0UUtJJ000C30C3C3CJ 

Z OC3UUOOCUC30UCJCJ 

X aoaomcoaQcDcoaococDcoao 

06 222222222222 

2 LCozocoracacccccQcQeacQc 



X O O — ■ ~ o O I 



= o o o o • 



I — « o --■ — • 
O o o o 
*j"> Co co co 



UJ CO CO 

3 o o 



3 o o 



> — O O 0*> 

OOCDOCDOcboO' 



oooooooooooo 

oo ao oo oo oo oo oo oo oo ao oo oo 

oooooooooooo 



285 



CT? OO — ' — O U> O 9> OO CN O I 

^obworoo^ocTi^j'i 

r-^r-«tJD^-«\l«U">^OOi 



, n n> ^- w oo cvj i 
• ro r^. u> pg ' 

l en UD "*T r-~ 



r-OO -H 



WWWWWt/JMC/JWCOWWCOCOWlWWWWW C/3 w to 

UL.LiJLJLiJLiJXLUULJUXUJUJUUUJUJLLJliJ UJ UJ I 

ZZZZZZQ.ZZZZQ.ZZZZZZZZ Z Z O. 

oooooo^oooo^oooooooo oo< 

xxxxxxorxxxxcexxxxxxxx x x cc 

a£J.a.Q.Q.Q.aCLQ.Q. Q.adQ.a.Q-HCLCLQ. o. o_ o 

t— t— t— t— t— *— t— h- •— 1— 1— »— 1— »— t— >— t— t— t— t— 1— »— i— 

— OOOO 00~h~^ _o~^^^^-«^-* ^i ~^ 

IT (O (D (£ (£> ID ^t Nr*. rs-iflNNCOacOOOX r-». OO 

OOOOO OOOO 000000000 00 

1 I I I I I I I I I I I I I I I I I II 

ro— - — — — — — —.—.—. — ~-— < — --.—. — —. — — _> H _ i 

OOOOOOOOOOOOOOOOOOOO O O CD 

«tfllO««>lO<fi^rs.h.rvrs.iDtsN0O»00 0000 a> r»- CO 

OOOOOOOOOOOOOOOOOOOO 000 



n»- 00 a> 

000 
I I I 



000 
000 



iii 

: o a. 



•" o o 

s ^ ^ 

5 — _ —j — 
o <=> o z z 

►- UJ LU ° ° 
o „ „ x x 

uj a. Sr? ^ a- a. 

2 •» « «* _j iti 



2 ui a o (r or 

—j a- < «* o o 

« «t o o >- >- 

** Z V)»UJ UJ 

2 o o u z z z 



OOOOO — O— • 
CT>CT>CT>CT>OOOCJ 



a- O O 
S X X 
O Q. Q. 
; c_> UJ UJ 

O O. >— *— o O 



_j O Z Z <= _j O 



ujC3 




UJ UJ 


Z 3 




z z 









X — 





X X 




















£z 


UJ 


UJ uj 


















or or 


or 


a. 

















QJ UJ 




fiiS 


z * 


u 


z z 



— — 3 o °3 



o ° ' 

si 1 



1 at «t 
«t o 

: x S 
1 o 



o o 

X X 



-*: :*: 3C jC ' 



o or o or or 

«ca:a_a_«*«ro*coo 



< : * •«" S S 5 



s ? s= tf 
5 S £ £ 

13 ass 



* * * 

tj tj to 



Til 

Or Or Or 

S> S> S> 






— «o — — • o o ~ — '— ' < 



j£>f^oooooooo«cvj-'-HOOfnfn^'OoocNjcsi 000 

r-. r>^ r«— r-» r-» r-«. i-«. r-. OO OO OO OO CO Cn Cft OS 0"> CT> CT» CD CD CD CT* 
OOOOOOOOOOOOOOOOOOOOOOO 



OOO 



— . « CD 

^. 00 d> 

OOO 



286 



as 


JC 


u_ 


a. 




X 






LU 


a 


s 


z 


UJ 


< 


as 


*/» 


3 


Ul 


as 


U 


£2 


z 
< 


u. 


5 


o 


o 



O O t£> — ; O 

^- O esi ob u-> 



^ a> ro o « 






ce o 

y z . co z 
^ "J tlj «t 

S z St; «* 

2 O O uj 
Z co uj £ 
1 > «t 

z z 



GO 



^3 



CO . 



or: 



' co o ce 

llll 



» ?= 3 ; 



. "> 



<»> O 

en ~* 

to CO 

— . en 



oo 



i- — — ■ o 



— QC — CC 



!£ <-> S; o 

1— O I- o 

GO o "> o 

z o z o 

2 z o z 
tutu 

or co ce co 

<=° _ 00 „ 



o o o o 



CD o o o 



„ — : w 

•- ~uJ S= 

ago 1 

0E = > O 

a co o 

o: o>5 

£ = -I " 



">"0 

id * -o 

co Z z o. 
„ 5 NS. 



y y ^ s 

u. u. ce «* 
ooSg 
I- I- » o 
oujir 
ce DC z °- 
I— t— _-o 

CO CO o z 

QQOJ 

o _ o 

3 3 1 £ z 



«t •< Je o ' 
— J — < o . 

< < uj ' 

=> = O <=> 

oooin 



cd o *r 

(n p)(m 

CD CD CO 

o o o 

I I I 

CsJ dO (O — I CM 

— • CM *H CM O 

O O O CD O 



z * - 

CO ^ 



— «£ «* t= «t 

o z < «t S» < 

p >. a: a j a u 
J gee ocuJceS 

— U O O f Q ,[ 

* 2 o a o o a. 



z o o o o o o 
■ .I oo oo oo ^ cm n 



CD CD O O < 
to to i 



o o 

i a> oi 

CD CD CD O CD CD 





z 
■a: 


OL 


-*■ uj 

S 1 * 




£ 


CO 


2 co 




m 


z 


CO z 


UJ 


zd 


o 


= o 


<-> 


Ce 




ce _j 


* 


UJ 


s 


UJ =3 


CO 


CO CO 








o 


o 


cc 


o £ 


« 


UJ 

o 


z 

CO 


«S 




<*B 


«r 


«■* 5 


5 




i 


_, S 




CC 




cc UJ 


UJ 


<£ 


DZ 


s ^ 


ce 


o 




O h- 


UJ 








CD 


en 


^-, 


O CM 






to 


<£> VO 




o 


CD 


O C3 




to 


to 


(O UD 


















U 


















en 


cn 


CT> CT> 


to 


CD 


O 


O O 










a 


















CD 


CD 


O O 




OO 


ob 


a> CT> 



CD CD CD CD 



_ CO O 

« «t «I — o 
DZ DZ DZ S lT 
CO CO CO 5? 2C 

S3 ???5z 
S x.i.1.^ — 

J 5 < !< " 3E 
* z z z ■« o 



X O CD CD ~ — • 

UJ <*> it it r~~ tr> 

CD CD CD CSJ tD 



MSFV 00 Cft 



287 



o o o o 



rvfsf^vnnnrnotomnn 



z z z z 
a. cc o= a: 

o --> =3 --> 



ce a: a: a: 



zozzzzzozo 



z o z o 



^z^^^^^z^^S^z^z 

a-oa_a_a-a_a_oceo°o.o°=o 
o>— oooooi— Ot-ceof-OH- 

UlbJUJUULijXujX<UjXujZ 

050000050500505 

uPuuuouPuPouPu P 
0000000000 

._>- >- >- >- >- 

zzzz zzz z z z zz z z z 

0^.-00000^-0^,-00^0^- 

zozzzzzozozzozo 

x^xxxix > i > ix > "x > 

"< UJ ■( ^ ** ** "C LlJ ^ UJ ^ ^ UJ ^ UJ 

SzSSSSSzSzSSzSz 



: cc ce a.ct:a_a_o-aea-'.t:a.ac:cece 
WCO j«W towcototocowwvjtoww 

U)X< WUJ UUJUJUJIUUJUJUJUJXZUJ 

za.cezzzzzzzzzzza.a-Z 

o«tcrooooooooooo«t<to 

iKiiiiiiniiiirtti 
cl u ^ a. a. a_a_a_a.a-a-a_a_a.C30a. 

-j-tj^_tj--j_-j_-._-._-.-ti--j^iijl_j_-._-.!--i 



— < O CO O 1 






0000 



o o o o o o 



OOOOOOOOOO 



I I I I I I I 



O O O O I 



000000000 



O O O O 1 

00000 0000 



> O O O O o o o 



S 2£S22S2£_£-£ 

* <t««<c<-:«3:*««t«t<x;«t • «s «t «r «s_ 

« -c_c_c_c.c_c_c_c_c-i: : _c :c _c -c 

00 C3UUUUUUC.UU loaeic 

V CO CD CO DO CO CO CO CO CO CO u_ CO CO CO CO 

-1 <t«t«««*<t«j:"-:«t«t«j:z«t«i<:«t 

--, -c-c_c_c-i:-i:-i:_c_C-co3;_c-CI 



•^ >- 3- 

LU Z Z 

z «t «t 



•— a. a. 

o S < 
;ccc. 

jCJU^,. 

o__.__.zz 

O I— 1— _c _c 
a- _, __, a. a. 

•aoo-i_j 
ujz z jS m 



a. <i 

Z to § Z Z 5 ' 



—» a_ ce ce o o 



0000000000 






0000 



z z ce ce 
"'00 

>- >- 

UJ CO CO _£ ^ 

o _£ =£ z z 



z *-* 
co^J- 

-J i__ CO 

o z x 



O O m I— O O 

-c -E 

a- a- 

_tl -tl ? oa _tl 



-C -E I— I— O 



ce ce 1— 

*■ *~ 3 
s s = 



O a. ce a_ 



uj or ce z z 1 
~ ce ce 1 

=s jo ! 



zz_-><_5ZZ_S$c_3 



t T t 

UJ k_. »■_ U_ 

<-> «■ * i; 
< s s ^ 

» ££« 



'-< -1 DO Ol 

I —, o — , __ 

1 00 en cm CM 

> O O CM CM 



cn o CO r-~ 00 00 -o 1 

CO O -O CO CO CM GO 1 
— • CM ~ O O — • O 1 



0000000000(00000 
CO CO CO CO CO CO CO CO CO CO CD CO CO CO CO 

000000000000000 



3 OOO 

a 

UJ 

_-- — o 



COCOCOOOCOCT^CT>COCOCOCOCOCT>I 



00000000 



o o o o o o o 



288 



Cf» tO <-0 0"> (0 tO 

f*- to — r*. — — . 



«2 Z 
a < 

° O 



■ o «t 
oo o __, to 

UJ UJ ^ UJ 
> oo — > 

ff S ^ <* 

uj to a: uj 
oo Jo uj oo 

P=; 3: ~ <*. 



II 

^ cc 



I- Q 

<SjO0 

ujoJo 

O°to 
o cc 

k oq: 

o.i— 



1st 



: oo co 
•cc o 

= 5 5 

) o 

: ~ a a z 

uj^SSs 



9 S uj S= 

OC S "C °- 

< z z 2 
O o o — 



|>zS-zzS 

o uj uj o uj uj o 

OXKUZKU 



— i — ~ o o 



r^ 00 CD 

o o o 

I I I 



CD CD CD CD O O O 



OOQOO 



o o 

o o 



O O rf o 

uj uj cr uj i 

^ ^ UJ ^ 



111 

i. i- X. 

UJU.U, 

§§5 



So SQ SG 



a. a_ cc q. 

uj cr ce uj cc 

o o o °- o 

s o u _i o 

« z z <i z 

» ~ ~. £ -. 

g 5 z uj s 

H o o z o 
c_> o ^ o 

S S o ■* 



CE CC I 
UJ UJ 



C/> J oozozzo 



uuuo 
zzzz 

C3 C3 C3 C3 
ZZZZ 

zzzz 

cc tr cc cc 

cc cc cc ce 

UJUJUJU^UJ 

^ id => .3 5 
00005 

en en en en 

z z ae E 5 

<: <« < «* <« 

O O O O Q 



U Z O 

& en <x 



2 °5 



~i ~. CD 
ri 00 CT> 

000 



O) r*. 00 « o O* 00 

0000000 

O CT> ■— " CM CO tO tO 



00 00 to o cm o m 

OOO-NCSJN 

o o o o o o o 



_ mo 
u. 00 



(A to to to to to 

JE o o o o o 



r— • 00 OO CO CO 
O o o o o 



£ cn en 



289 



O O OO iD ui OO O « 



no 

— CO 



looo^ntco 



O O O O i 



^ -. a «) to <-« ^ 



tc 



Pi 

o P 

CO "- 



( — I ^ 

f CO m 

;£* 

— m,_>-i— lLZj>-i— 
oc «- t— — cj iTi . O 



cc Z 
a. pi 



~ — o 



CJ » " 3 

_tict!£o! 



Z. 3Z. Z. ZL ^ ^ ^ 

CE QC C£ OC QC QC C£ 



cc ac ac qc cc cc cc 



«t «t «t < <t «t «t 



£ £ £ £ 2 



o o 



X SC 

£ >- S ce 
cc S § 3: 

UjCii- o 






^[L £ E 



tral^^ee 



SSujSc 

OCCKLU 



00 CO 

O = tu- 
rn CO _J 



1 a. 
o ce 



=d Z O _ 

°Sij OQ: < 

— ce uj q, t o 

CC o Q UJ uj I- 

^u. ^_jCO 

uj co o — 1 o a: 

UJ O ro O 00 O 



OOOOOOO 

en: cc en ce cr. \— t— 
►— t— t— t— I— O O 

UU)UUU ZZ 

00000—— 

O O O O O CO CO 

t— t— ►— t— I— <c «t 

o o o o o S ■£ 

O O O O O q o 

z~ z~ zf z z" 

000002s 

O O O 03 o ,_* ■_* 

—————00 

CO CO CO CO co tr tz 

<< < < < u ul 



oc 00 

o O 

I 1 



OO CO OO OO 

00 OO CT> CT> 

O O O O 

I I I I 



oo~ooo^ooo< 



I O O O CM ~-» ~^ I 



lOOWCM rs. 



OOOOOOOOOOOOOOOO OOOOOOOOOO 



CnOJDrsrv 
-nrOO-HO 



OOOOOOO 



3- 
-J 00 



z «t o ^ 



« g§£*5 



H to cjj or ce 
« 3 z £ £ 



ce ;r o 

•< o °- 

* ^ ° ^ 

uj 5 »— O 

S Z u tf) 



= 50 



Pxojf: 



2 «t0S0Q>.u.l-0 



* O O 3C Q UJ 

uj 1- od <t > «t Zl 

u_ u_ O ►— <t 



1 ;? ^ «l 3 ,_ 
o_ Q- uj 1 a_ t 



o i2 

o ° 
a- tr 

3^ 

,_ uj 

<c o 



l2> 

uj £ ^ <t o 
£ a. J £ p° 
5 °= S g S 

> x o a 5 



o 5 



^ ce 



UJ CJ c_> o 

S ! 5 if o - ' 

* 333 cecc 

UJ CO CO CO «£ >_ 

OC co co co z o 

O kJLJUi<U 

"- £ £ £ <§ £ 

"J 555 co g . 






»OOOCT>Or^.OO^rcO rscDifitDNcTlOO- « in 

iv*ni/)iflOOtoo)OioooocsjfocsicMin 

>000«—"0000000000— <—<—•— 'OO—'—'O 

— ' — ' — est i*-. •"* f-. ■**■ ir> u") UO OO 00 CT> r-. r-. o"> tr> lo in O CT> — -1 — * CO 
ooooocjtNfnfOfOcorofn^kntrinijDUJtiJifitjor^r^rs. 



S 000 



OOOOOOOOOOO o 



iO« rt «CMO(ninMOOOOO«^ ^(fiMcgiNrvr^ooo 
o«-^*— "^cm^-— •CNjcofOcorococo— •— ■ •— «csiC*jcs(c\jeNjroroco 

NNP^OOOOOOOOOOOOOO OO CO <J~> <Ti 0*> CT> CTi CT> O^ CT^ O^ O^ O 



o o o o< 



'OOOOOOO' 



O O O G O i 



u") a> o <xi <o o o 

O O O CD O CD O 



290 



OO U3 OO O O O i 



i ^ ^ o 00 0> w 



— a. 
S Z 



oa U 

*2 Z 

a < 

o 



cc.ae.ccce. : : : : : icececececececececece 

UUJUJUJ<<<<<<UJIiJXUIUJUUliJUJU 

zzzzceceorcececezza-zzzzzzz 

000000000000<COOOOOOO 

x x z x , , ..xxeexxxxxxx 

CL.O-0_CL.^ Lu l j JJ , u j u jyCL.CL.OO-CL.a-CL.CL.a_CL. 



^ o 


^Sj^SJ^SJ^^jg^^jS 


O O 

1 1 


OOOOOOOOOOOOOOO 

1 1 1 1 1 1 1 1 I 1 1 1 1 1 1 


r^ r^ f^. 


r^r^r-r^r^f^^^r^r^^r^r^r^r-r-r^ 


o o o 


ooooooooooooooooo 


o o o 


ooooooooooooooooo 



««: «: <c «t <c <t 

Q.O.Q.Q.a.0. 

E E 2 E E E 
o o o o o o 

O O CJ o o o 

Z X X X X X X 

O CL. Q_ Q_ Q_ Q_ Q_ 
tt; <C «£ «£ <t «t «* 

-ace o: ct aa 
>OOOOOC3 



o o 

X X 

i a_ Q- 






z 


« 




•c 






* 


•c 


CD CO 


o 


<t 




« 




O C3 



5000000^50 



CD 31 31 31 31 31 31 

*x.cccececccccc\ 

O UJ UJ LU UJ UJ u ! 



o z 
<c or 

O LU 



2 oESoiiiSSSEoS 



£ E 
o o 

o o 

CL. Q. 

•xd; j j j 

UJ LU W — **< !*j "i 
3 ^ CO Li_ CO CO CO 

^ tt < «: •< "* •« 
« « <2 o <5 $5 S3 

M«I -XXX 

o O S E E S 



1 ■«« ^ 

UJ K. I-. ►- 

z* W Si S*J 

« S 5 5 



o o o o o o o < 



— . CD O O O O CNJ 



o o — — o o 
(O f^ OO f w 
in m (O l£ (O rv 



oo-< --< I 



I O CD O O O CD ' 



( — rt-OfnWIflN^NO 



OOOOOOOOO 



291 



co ~ ■ 

cb est I 

en «j- i 



o o o O 






o at 

i- UJ 

UJ O. 

3 * 

<t e 



■ 5 ° oc 
° £ * 5 ■» K 

5 j co Z ff So 



z Z Z 

uj o o 
cc o o 



o z 


§r 


o 


z 
























■55 


to ^ 

O ^ 


oo 


z 










O u_ 


CD 




OC CO 








Q- <C 


CM Z 




IX 



z S ^ z 

CM JO O CM 
CM O O CM 



«: z 
I— o 

Wr WW 

££ z z- 
„ or rn uj 

Z CO _J UJ 
« 00 => u. 
CO =3 OD Z 

UJ CO _ O 

— fle cj> 

as. oc uj 

«S ,C30<S ' 

^152 = 2 

ii cc a. Q O O u. 



£££ 



13 E 



p— oo o-> 

ooo 

I I I 



i — < m 

' oo oo 



— • ~- CT> — • CT> ~ 
CD CD CM CD CD CD 
ps.rs.rKis.0O0O 
CD CD CD CD CD CD 



-^ CD CD ~^ 
CD CD CD CD 



CD CD CD CD 
CD CD CD O 



CD CD CD CD CD 



T "* ^ 

x. x. ^. 

s= s= s= 
III 

52(2(2 



CO CO CO 

z z z 

ooo 

« •< «t 



Z Z Z 
Z Z Z 
ooo 

«* « « 

<t «t «t 



1 Z Z Z Z z 

?5 55 So 



u2 < < <° 
h- Z o o o a: 



o o 

CO CO 

:> > 

Q O 

o cj 

z z 

* o z z o 
o o iT iZ ° 

ri >- . . >- 

< uj o o ui 
. z <t <t z 

5 uj o o uj 

Z u < <C ^ 

S ^ co co o 
ae Z o o Z 





z 




UJ 


UJ 



it S <: ? 2 2 



V> CD O O 



— O O — O — • 



CD tO CD 

CD — > 
CD CD 



CM CM 
CO CD CO CO 






U. O CM — • CD 

P 6 CT> CT> CD CT> 
CD O CD CD 



IS* 



CD CD CD O CD CD 



O ~ ~< O 

X co ao Oi 
O CD O CD 



UJ CD CD — ■ tT> CO — -"CM 

(^ in to to P-. rs. m IN 
X O O CD CD CD — ■ — 

uj co co co co co ^r ^r 

££ ooooooo 

u. 

e 

co co co co co m co 
ooooo«« 
!-«. rs, r*-. p-L p-L ob ob 

CD CD CD CD CD CD CD 



292 



» O r-~ — • r~- O 



'OOOOOOOOO' 






O r^ o CM r~ - 



'°£ 



5 a. cc 

«t O O 

— z z 



uj O 

z z 

uj «< 

co ^ 

as «/> 

= ui 

co u 

£ Z 

a < 

o 



i£2 it to 

£ S £ "- = 



Q O Z ■< u- 



< — ! 



o jr « =: c 
: 5u_ 2 T u. 



=> UJ 

go z 

**J uj 


&oo< 


(J UJ 


co o 


ee uj ^j 
O 3 UJ 


UJ o 


" 1= 


CO Q_ U_ 




O- t— 




OD Q_ u_ 


«¥ 






= = O 


=3 1 


O O 


V)(/1U 


«t a. 


co a. 



:oo § 

CO 

<! o 
z o a. : J" q. 

uuilucCmjUJ J£ 
o_ a_ a- oo u_ . 



Q_ a_ a. CQ U- 2 

3 = => = o =; 

OO GO OO CO O u_ 



!=<<< 



Sou 
g z z 

Oil 

O g °. 
z"«t «S 



s o o 

I 13 => 

c/} CD CD 

5 Q Q 



UJ < 



^Hl/I^FHWfHFH-HF-^FriOOFHF-ir^tOOO^I 



'OOOOOOOOO 



I O O O O ~ O — • 



OOOOOOOOOOOOO" 



ooooooooooo 



ss 

«:«t 



i; =i± — oo : 



f3o 



■ S >• uj 

■ L J(Lu 



. OO GO 

: ►— »— 

■ o c_> 

: =3 s 

: o o 

: o o 

: ce cc 

. a. a. 



u- = ce o it O i 



5 = 5, 



a o i 



5x^: 



52S"«bz<23 



Q_ Q =^ C£ OZ O 



: z ^jOq 



h - -a: 
4/0 c t UJ 

5 O O ^ 



Ik O UJ UJ 



i r- OO Cn CD — ' ' 



OOOCDCDCDOCD^^i 



| o o o o — ■ — ' — 



CD O CD O i 



O O O CD 



OOOOOOOOOOOOOOOOi 
OOOOOOOr 



oooooooooo-Hfnmropi^uxD 
> oo oo oo oo oo oo oo <r- or> en oS Cf> en cr> 



o oo oooo< 



OOOOOOOOOOi 



293 



o — • o O I 
~l OO O O I 



— o> 



*r> — • o cm lo o> i 

r~. (U iT) U3 CO f-« i 

ao vX> ^r co co cm ■ 



I CD 10 (0 OO CD UD t/) CD U"> O u~> i-O 



' = 3, 



z 

ig 

01 z 



— . — . ° z 

=> = ? ^ 



r3uu 



_ S 
o° 



Q O ° I 



o o o = o o 

1 - Q O ! 

CO I 



o o 

o o . 

5 2 OS £: 



o a. 
>— «t 

to a: 

is 

CO CO CD CO CO CO o 



X X I <£ X I ID 



o i S 5 o 



o ^ ^ 

1 i — 

CO CO I 

«t < => UJ 

ji o o 






ooooooooooo 



o o 


CJ 


O 


O 


C 3 


( > 


C ) 


O 


CD O 


o 


c ) 


t ) 


C) 


C > 


C3 


O O 




































> D> 


> 


>• 


> 


> 


> 


> 






> 








> 


D* 




D> >• 


or or 


on 


or 


or 


or 


or 


or 


or 


or 


or 


or 


or 


or 


or 


or 


or 


or or 


00 OO 


CO 


CO 


CO 


CO 


CO 


CO 


CO 


CO 


CO 


CO 


CO 


CO 


CO 


CO 


CO 


CO 00 


z z 


z 


z 


J" 


z 


a. 


2 


Z 


z 


z 


Z" 


z 


Z 


z 


z 


Z 


z z 


o o o 


O 


O 


o «* 


c ) 


O 


( > 


r ) 


C3 


CI 


< ) 


< ) 


o o 


o o 


x i 


X 


X 


X 


X 


or 


X 


X 


X 


X 


X 


T 


X 


X 


X 


X 


X X 


Q- Q_ 


Q_ 


a. 


o_ 


a. 


o 


Q_ 


o_ 


a. 


*-i_ 


o_ 


a. 


o_ 


o_ 


Q_ 


Q_ 


a. o. 




































UJ UJ 




UJ 






UJ 






UJ 






UJ 




UJ 




UJ 


UJ UJ 


CD CM 




a 


O 




a 


o 
























O 








m 


PO 










PO 


P0 




P0 




CO CO 




































O CD 

1 1 


\ 


i 


CD 
1 


o 

i 


o 

i 


CD 

1 


o 

1 


CD 

1 


o 

i 


o 

1 


o 

1 


o 
1 


CD 


o 

1 


CD 

1 


CD CD 

1 1 


— CM 


m 
































CD CM 




CD 


O 


CD 


CD 


CD 


CD 


O 




o 


CD 




O 


o 




CD CD 


co en 


— 


CO 


CO 


CD 


CO 


UD 


r-. 


1^ 


r* 


1** 


r^ 


r^ 


<J5 


r^ 


T-. 


OO OO 



NflOOl 



>- >- 
z z 



z <c z z z 



Q_ o a. o- 



o o 

a- Q_ 



<=> zi o d <= o ^ § 



►— uj uj o o 

o rrj rr! co co 



>- >- 
z z 

a_ a_ 



o o 

a. a. z z 

_ uj o o 

,— > > 



o o 
o o 



,, = = = => = 
g o o o o o 

— co co cp oo go 

= J J J J J 

f uj UJ UJ UJ UJ 0C O QC U ^j 

>cjoooo_>_So 

? " = = = l2!£i 



UJUJ ljJUJ UJUJUJ U j tA j 
020Dc_>0 QDCDCD CJ>0 

oror55ccoror55 



-j <: iS o_ S <: o_ i 
* o dz «t x o <: i 



or «c uj oo uj uj i 



X X 

i or or 



Q s s s s s 



2 o z o z 



I X DT O O ' 



C3 O ^ O CJ O 



O O O CO i 



ZZlDZDZZZtDLD 



*< ^ ^ 

UJ K* K» ►*. 

^ ? ? ? 

* % % ^ 

2 ^^^ 

< W Mjj ^H 



OOOOOOOOOOO 



<ooooonioNKi 



CDCDOOOCDCDCDOOO 



o ^ 

-J CD 



ono^ ncNOintsjCMoo-^ro^oooo 

o o o o OOO-hOOOOOOOOOOO 
CO CO CD 0"> Cf> cO OO vO CO CD r-s r^. h^. fs. £T) CO OO OO OO 
0"> cr> CT> ty> 0">^^C\in">n">u")uOcn u^ u^ co r«^ r-«. r*^. r»- 
^^^^^^^^^^CNjCMC^CNICMCMCSICSICSICMCMCSJCSJCSI 

— — CNJ— — Csj — CNJCNJCsj — — — .__„ __, „ „ ,„ 
^-i— .CM^^— <CMCSJCS(CSICSI— ■— « — ^-.^-^^-^^^^_ 

000000-- — ,--.«^-.^-.-- 1 --,^-,-_,«„ ,__ 
OOOOOOOOOOOOOOOOOOO 



294 



a. 

*2 x 

z m 

uj O 

z z 

a: tst 

=3 Ui 

00 U 

*£ Z 

a < 

o 



O CO 

"uj 

>■ >• 
as p 

23 
§§z 

3o£ 



o to 



=> «* 



55 



ce o y 
5S> 

£ 2c S 

1— — I ce 
«i c_> o 



oio: 

O tt * 

Zu-J 
^ CO <£ 



o> en 
o o 
I I 



^ T t 

i- :*. i~ 

£ £ £ 

% * * 

o cs o 



300 
5 a. a- 
* 33 

5: a, cl. 

tj 00 



o o 

CO CO 

:> :> 



o o 

z z 



500 

x «* <: 

uj CO CO 
UJ 

£ on 

u. *r ^* 

u- ~ -~ 

O co 00 

5 i5£ 



o 

Z 1— 

ce ^ 

UJ o 

o ii 

|i 

U CO £ o 

JK O 2 1 
« O CO o 

* S CU <t 

J3 — ' o o. 

M 



o o 

o o ' 



295 



iOOOOOi 



o o o o 



i o o o o o <=> o 

i .— . o i-i — u-> ~- O 



> O O i 

I o o i 



^- CSI O 



Z CD Z O , 

° ?2P 



i CQ (-> r-» 



oto ! 



i CD o 

o _ => <_> 

* y ^ *' 

ue3u 

I- UJz i — 

o S z o 



ce ce ce ce 



o o 

z z 

33 



ce ce 
a o 
z z 

<: < 

33 



«t <c <£ < 



cc ce 
a a 
z z 

33 

CO* GO* 

z z 



cc cc cc 

= =3 =3 

ce ce cc 

o o o 

Z. Z. 7Z. 

«t •< < 

333£ 



CO 



O >- O 

pop 
5:55: 



co 2 CO 



cc ce ce ce ce cc 
o o o o o o 

S 5 JS s s 



gcec^z 

° O O I 



33g3 

CO* GO —" O0~ 

z.z.^.1^ 

«I •< p «t 

LU LLJ 3 UJ 

ce ce z ce 

o o i o 

ssSj 

uj uj > uj 
z.-z.^' z 
oo2 o 



• o oo 



«t z «t 
S o z lu z 



oooooopoof- 

ooooooooo3 

" . -co 

ZZZZZZZZZZ Z.Z. z. z. 

OOOOOOOOO"* 

OOOOC30C300 — ' 



: ce ce ce ce ce ce 



Z<<IffilCCOffiOV}0 



0000000000000000005 
SSSSSSSSSz 



. . 00 
_j z z ; 

o <c p 

1 I J. 
S S z 5 



zza.cecezza.zza- 
oo«*uuoo<too<: 



o o 1— t— 1— I— t— 1 





— 00 

CO — ■ 


CO CT> 
O Csj 


1 


OOOOOOOO 

1 1 1 1 1 1 1 1 




1 1 


<T> OO 
O O 

1 1 


CD 

O 
1 




-"^CMOO-«OCNJ 


CM O 


00 ^r 


O *£> 



-^OOfOPli 



000000000 



00000000000 



cococoM^Mnr^ivw ooooenco 
0000000000 0000 



O O CD O ' 



<-> — 

o <s. 
: ee o 
: o «t 
' u Z 
00 UJ <c 



: « «t ■« z 
: a. a. a. o 

; o o o a. 

; O O O OJ 

:zixui 
►— o a_ a. a_ ►— 
o 175 5 < < o 

§ > o o o § 
Q uj lu uj 



or.fo^H 



"BSOOOoflSOoBSO 



o otc o: o 2; i 
o o 2 ^ o ii Si 

CD CD 7 ^ 09 Q. Q. 
>- O 1 



_JUKO-IHt-(^H-l-l 



« ccctcsooojrooooo 1 

£ SSoOOOcTOOOcnCS' 

— — —oooo^ooo^o 

^ >->CDCDCDCDXCQCQCD2CQ 

■ 0<=, >->->->- >->->-S>- 

■*■ — 1 — > z z z z 



S 2 O." Z Z Z 2 

-j a. < ce ce ce a- 

« <OUUUJ< 

.» co . ►= ►= »r= 00 



o z uj o z 

< CC Q. < IT 



1 u < CO Lg < CO 
— j.m~~-|lw!»'lcoSi 
2 ocjjSSSooScjoS 



OOUOCOOO— 'CVI— 'iDoocncsi 
O— ' — OOOOOOOO 

OCMNfM(*)n9in<£UlC0 



O *T •— — • 



OOOOOOOOO 






OOOOOOOOOOO 



O O 
no 00 

OOOOOOOOOO OOOO 



N^rsrso^ooNO 



OOOOOO 



296 



O^-Qi 



O O O CD 



UJ O 

z z 



*2 Z 

a < 

o 



: uj = 



«t O I— i 

s °ri i 
lisi 

o= r-j ^ i 
uj«ui! 

!?! 

O LU ' 

CJ CJ o "* o 

UJ > y LU ^ LU 

S K o — o s 

jLULUgLU^ 



o_ > a. 
£ °= S 



■>= CO 

=! :Sio 
«* : P <r 
S n u< 

z a- x z 
lu o £ o 

z UJ P -" 

Ouz< 

°==5Eto 

C3 CO Q. o 

z co a. 

— LU o 

>- (K O O 

z m o 

Q.< WK 



LO CO — • — • 
O CM co O 

ICIOOOO) 

o o o o 





Q: Cc £fc 




t S S 




* * * 




to O to 








CO O <o 




* * a: 




lil 




O <o o 












1 ^ ■>* 


LU 




CJ 


* * * 




Ly Uj Uj 


"t 


JJ? 


o 


9; a. ?t 

=J S =i 




<S <S O 


s 


Uj Uj Ljj 


LU 




to 




2 


CO CO oo 




mnn 




O O O 



z • z 

o : o 

5 : ■< 



*>: •"t i 

>- ^~ ^ 
8= 8= 2= 

ill 

£> £> £> 



ri cc o o °£ o °c 

" O I I O X O 
2 CO Q. O. O Q. O 



LU "^ °- UJ °- LU 

iuuiui 



CO CO CJ CM ' 

oorjcsji 
CO CO ob en 
O CD O O I 



uuoo 

"t <t «£ «t 



« 


ct: 


oe 


a: 


QC 


o 


o 


o 


O 


■ 










:> 


>■ 


> 


> 


z 

z 

o 


«t 


<t 


<t 


<* 


Q 


Q 


Q 


o 










o 


oo 






oo 










CD 




CD 


CD 


CD 


UD 


<jD 






=3 


CT> 


CNJ 


<jO 


<JD 






















<•> 


UD 


UD 


<jD 


<X> 




CD 




CD 


CD 


o 










CJ 


<4D 

CD 


<jD 
CD 


S 


£1 






ob 


en 


en 






CD 


CD 





297 



OO O O O O LO — < it ~ 



0*> CT> ^T O 0~> 



CO LU 

z => 
UJ ■< 



5 «* « «* 
. S S 2 



O LU LU UJ 
ce CZ U- LU 

jtzzz 
Lt □= cc or 

<t Q- Q_ Q_ 
3. GO GO CO 

o o o o 
I — I — » — I — 

C_> <L-> C^> C_> 

O O Q Q 



UUUU 



ccccarcecectccccai 

SS2EGOCOCOCOCOGOCOGOCO 



<<<<uuiuuuuii 

cccccecczzo-;rzzi?:a-a_ 

>C300C300<COOOO«*«* 

, .iiitiiiiira: 

UjLUUJLU Q _Q_ C jQ_Q_ Q _ _ C3t3 



i i , crj cq aj CD 

UJ LU LU *S ^ ^ ^ i 
(— I— I— O CJ> O O I 






GO r~ r-~ 



O O o © 



OOO — — — — — 



cococor^r^oor^oo 
OOOOOOOO 



OOOOOOOOOOOCDOOOO 

OOOOOOOOOOOOOOOO 



ooo 



3- >->->- w 

Z Z Z Z UJ 
« «t «t <t z 
a. Q. Q. Q. o 
2 2 £ £ l 

O O O O O- 
O O O O UJ 



Oi^a-a-cua-i— oo- 1 
2! g cc k a o: S S2 a: 



u 5 _ 5 
x o z o 

« u- uj Q. 



« o o o o 

GO Z Z Z Z 

« 3533 

~ o o o o 

™ CO CO CO CO 

UJ Q- Cu Cu Q- 

SE o O CJ Q 

tt cc cc cc a: 

£ jj s s 

... oooo 



J X"- 



ooou. 



■ i- t- t- Q 



= ZZZZZujg 



>- >- 

z z 



C3 O 



'-3 



-j o_ «c z a: or: i 



^ UJ<JWCOOOWuj < ( 

2 ocjz J J J5uu 



' Zj O Q- O Q- _j _3 

I t— o — ' O — ' t— t— 
q. ujq. u 

z i— •- z z 

2 o8 q o8 o22 

Z lu Z uj Z Z Z 

■< — ' <t — ' 

ZuUujUZZ 
a: o_ — 

t— 00 _ C 

OO UJ _£ LU ■£ OO 00 

w I Cj I u w li: 



cco-<:Qia-za_zcci_c 



* ^ ^ S 

s ^^^ 

3 Qs C5 O 

« Sj ^-i kj 



— f- 






'(OtOrsN 



2 OOO 



V "7 °? 



> o o o 



3 OOO 

a 

UJ 

—. ~ o 
en co oo 
ri oo CT> 
OOO 



298 



W ^ o» W 



r>* c*> O) ~* i 



5 5 



UJ O 

z z 



en U 

£ Z 

o < 

o 



CO CO CO 

uou 
cc q: ct 
CO to 00 

a: cc ae 



: o co 
: u. UJ co 

: <3 = o 

' S^ 

. — ' :r ° 
!5o = 

; ^ uj Z 

£«o'f gs 

« Si £ fc S 

tu ^- ou Ul 

iT co — 5 m 

° £ « s s 

CD g CO O O 



= 

2 2 3 



r-- Co 00 
OOO 

I I I 



O CD 

r~~ ao 1 
O O 1 



OOO 
r-» r-~ 00 
OOO 



ft p= p= 

c> c> o 
i^ C: G 

Co Co Co 



CO CO CO 

LU UJ UJ 



« OOO 

S fi < 5 



o o 



o o 



z z 

. .0 - . 
00000 

5 5 o — — 

< cc cc - cc cc 
o a: cru a: a: 

-I LULU>UUJ 

i tcgtt 

g 00^00 

°f 0C CC (3 cc cc 

5 z z ~ z z 
= «* ■« £ « «t 

S O O Q O O 



O co o 

0^:0 

«£ > <t 

CO O CO 



030 



en o-> o — »-< 

O O O O O 

«) (\J CNJ tf) ^ 

CT> O O - ID 



U_ O — O 
O CNi OO CM 

00 r~~ co 



po co co 
r^. 00 <T> 



00000 



o ~ o 

cb 06 en 
o o o 



299 



ooonoo ooooo*>oovoo<o 

OOOrsOOOVUIOOOOfnOtfl 
CM -h OO* l^. fONNrt OD OJ OJ 



ui O 1 i\ O >r in 



to •«* — ' 



: ~ o 

00 I 

.: ^ o_ 

: o «* 

: => ^ 



GO — J Q- 

5|« 



o ^ <-> 
°zS 



o ce 

S £ & 

Q ° ^ 
Q t M 

> " = 



GO 

: go uj 

■ GO <£ 

: go 3: 
: UJ o 
: ce 
: co o 

:z5. 



I fE ce go 



Z5 

: ° =5 

;<J ►= : 

GO ( 



. go 



2 z K S "- "- 



CD GO 
GoS 



^ ^ £ 
O GO O 

5 cd — 1 1 

uj => \a i 

Z GO 5 



Z Q- ™ O O 5 



p§£ 



z ce 

UJ uj 
CC GO 



£ 5 = CD S 



: o o oo x: 

:>"-a:o. 
!ccO^«t 

! {£ go 3 o 2 

:Zo«o»o 

' ° < r~ ^ zw 

l SI >- yJ uj ° 
co S 5 — ' ce 

U. Z 5 GO 



DC CC 
UJ UJ 
GO GO 



ec ce cc ce ce ce ce 



<; UJ i 
ce z : 
oooooooo 



cc z z z z z 



,,111111^ 

"jQ-a-Q-a-Q-Q-Q- 
^UJUJUJUJUJUJUJ 

4 uj uj uj ul uj uj uj 



ooooooooocoooo 





o o — ' 
en en o 


CO CD 


o 


co" co" O £ co" 


o o o 

1 1 1 


O CD 

1 1 


oo 
o 
1 


CD CD CD CD CD 

1 1 1 1 1 






O O O 


IjO —• 

O CD 


O 


O CD CD CD CD 


tr> <x> — ■ 


~ to 


r-~- 


NOOWrvoO 



--. — . o 
CO PO PO 

i^ oo en 



'OOOOOOOOO 



0JZ5S 

uj 2 "J -J S 

5 UJ Z Ij £o 

* 2 •- o ce 5 
3 O O °= uj o 
3 o •— 5 «" °- 



2. z -j ° =? =i 
go Suj ce 5 ^ 



z o o £ z ce 
^ o z s — UJ 



go £; 
>- £ - 
P 6 . °o 

SgSSi 

o ^ o 



Cu o O. 

uj o uj 

UJ 3 UJ 

I— Q- •— 

°1jO "0 
o m o ^ o ! 
5 z z 

« tt«B OoB 



=: ^ J ss 



-j <t.£a-tt:Q_5«*"««Sn_i 






2 o 

<c __ . 
o 3: «x. 
-* . ►— go 1— V3 

I£ < 3 uj CO uj 

g 00 o 3: £ a: 
2 ei co o S c_) 



x o o 1 <t <: 



£ ? £ i? 

Z Uj Uj Uj 

< ^ ^ * 

* £ 5 £ 

^ Q C3 C3 

* HJ ^J ^4J 



O -^ CNJ CO O 

O O O O CM 



CD — — CD — • 1 



— O <X> OO 00 OO — 



I CD CD CD CD 



oooroc\tou>mni 
00000- «_,-,_ , 1 



0000000000000 



« U^^e^^e^^,,-^^^! 



3 OOO 



1 o o . 
' rC 00 1 






OOOCDCDOOOOCDCDO' 



iX> — ■ — ■ r-. 



1OOOOOO1 



300 



O O O O CD CD CD 



ooo c 



IT) CO QQ ~- <*D — I 



a U 

£ z 

o < 

o 

UJ < 



' GO 



-> UJ ^~ LU — i -> :>. 



£ 




o 


Lt 


S cc 








=5 O 


o 

C3 


<r 






cc "- 




1 






<■ 




£ 


ZlS 


OO 




33 
O 


2 


•< UJ 




X 



















; O Q. 

: uj o 
: x o 



: x l£ = 

1 => t- x O = 3 1 

I O ^ uj DT < UJ 

i o go »— o cd ac 



o — • o o — « 



UD r-. t£> (jO r-. 
O CD O O O 

1 1 1 1 1 






^h^j-*-!^— , ^ ^ ^ ^ m — . 

OCNlOOOOOOrocgO 


ssss 


r-<x>r~-(x><jD<jDP--cr>r^oooo 


oo en oo en 



oooooooooooo< 



z o o 
— o o ^ 



o z 



~ m S 2 ; 






o o 
q-q.q--,zzq:q-ol 

3^ <• 1 y O ^ ^ 



5°5 



o o 

X X 

o o 



O (X O 

: ii 

s ^£ 

— -J CD 



□ * 3 § § s§** 

^ X *— *C O O t— 



x x x oc 



OOOOOOOOi 
U3 <jD r— . r-» r— tJD — * OO < 

o»a>ooO'-Mioi 



OOOOOiCTi(7)LCOlD 
OOOOOOOO' 



o o 

i en _ 

iQOOOO 



o o 

ko en 

o ~- 
ri. en 

o o 



301 



O O I-* o o» o O > 



< 0"> ^ C7> ~^ ~-« o*> o O 



o cr< u? do en 



it 

i 

z 

! z 
couj 

ce __ 

co o 

UJ Ui 

z to 



co__ 



IS 



S £ IIS 



w> O O O ui 
OO Q_ Qu. Q- OO 



SfcE 



o z o o- 

■*- «t I- o 

; co ^ _5 •— 

z _j __ o_ z 

o o LTJ o o 

Sfcl-_ §2 2: 
ce uj 5 5 ae 

uj __ o uj 

uj z JJ UJ UJ 

ZOoZZujng^ 
OO— OOOu-O 



5 "-2 ^ 



x x __ 
co o ^ 
oof 

ot_ »■ 
o = UJ 

UJ a; 



5- 52 " 5 

O o u_ 

o o o «t 
J u. X »- O 

_j uj "J uj x 5 
a. <r £ M o i 

1 . . ? 3 tt! — ' 

, iT u. £ Z Z O 
! u_ r_j uj uj uj O 
i o u. ce co cc co 



§1 



° : ul 

zt°u 



o_o : c_ Z 3£ o Q- O 

o-fr :oogu:Q-p 

CO — CO "" 5 CD CO co — 

ce uj co z __ cu ac 

UJr>-Jt- — >jUJo 

[IfflQ.ZW_iQ.i2DQ 
-__3=5030 = u._3 

OcocoosCo-coOco 



I— o 

°i 

O CO 

(- «t 
oS 

<=> o 

z" _ 

° I— " 



~- O ~- O — 



r-N CT) c. (fl OO 
O O O O O 



^Hfrm*£)^(SiCM00OOCMP0f^^OVDO-^C0'-<^0^'-<-'00 

cd— ■ — — , o ._. o— • mrocMCMCM-— t^^esi— inooo- • o o «— « 

ID (O 10 (O <0 (O r» » — vo(jOr-^r-^toi--aOP-.oor^CT>aooOOOCTiOOCT> 
OOOOOOOOOOOOOOOOOOOOOOOOO 



■T4 O 

VD r»-- 
O O 



z z 



— — 

ae ac 

UJ UJ 
O O 



o O I 
CO CO < 



« z o O ( 
z S <c < 

UJ CC CO CO < 

oc UJ O o < 

UJ 

*» --roo. 

U. ^jD -D i_n ' 

u, O — i — . . 
O <-© co co < 

£ o o g! 

a 

- i£i u5 
O ~» -^ 

o o o 




Uj O O 

2 zz 

S o o 

e 29 

u. > > 



'OOOOOOOOOOOOOOOOOOO 






1 ? "? "7* *7 T *T *T* ' 

CO OO OO OO OO < 



OO co o*> o*i o*> o*> o*> oS 0"> oS oS ot> o*> 



OOOOOOOOOOOOOOOOOOOOCDCDOOC3 



302 



OOOOOOOOOOl 



CT)LOOOCs(LOCN*m— • oo cm oo 



>l£ oo O >n oo Nl — CM u: CO ro 



oc ae ae 

—.000 
; z Z ;ZZzZ^Zzzz 



^c-zezz^-uj — uJ — — ! 

OO— 1 O O O O O — 1 O _* O O O 



uj a 

z z 

uj ^ 



co U 

2 Z 

o < 

4r * 



HHOaHQCI-CO 
CJ u ,_ t— O t— O I— ,_ 

f § = Sf SfSli 

COC/OOOc/)OC/)00 



3= S o o^. 

O Q Q 1 

_I _ Z* 2* _ i 

. - .- o o ►_- o ^_- o o 
00 — — o — o — — 
Jzfrt-otofroo^ooc/O' 

LU uj < < UJ ^ UJ ^ ^ 



as o a: ce ae 

UJ I— UJ UJ UJ 

O Z O O Q 
OOOOO 

OOOOO 
OOOOO 

' z~ z" z~ z~ z" 

OOOOO 
OOOOO 



O —■ • CM O CSI 

r-^ r-» r-. 00 00 



^h — . en 00 



UJUJUJUJUJUUUJULU UJ U U LU UJ UJ 
COCOOOCOCOCOC/JCOCOCOCOOOCOOOCOCO 
UUJXUJXUUJUJUUJUJUJUJXXliJ 
00<0<£00000000<C<CO 

izo:xo:xzzxzixzq:o:x 
a_Q.oa-00-o-o-a-a_a-a_Q-000- 



~ • *-» CD 00 o o ~h 



o o o o o o 
I I I t I I 



uih.rHinu)(sjuiotNirsrsoir^(Nj 
O — • O -H(NNO(N(SIMOC\^r- 

<j3u3h.rs.rxrvoot»ooooooi s >c7ioo 
OOOOOOOOOOOOOO 



OCMOOOOCMOO— "OOOOOO 
OOOOOOOOOOOOOOOO 



£ _t! >- 



uj >Z Z •*" Z uj 
Z < < < <Z 



ill 

o_ 3e O 

u0 



uj a. 1— _ 



ill 
3E o Q- 
O o uj 
O -J 

U I w 

• 5 < o 

: $ °= « 

£S = 

|U jO 
■ UJu. o 



Szo^o^^^oooo-* 
oJ^ujQujHJ^. u u uj uj < 

s z > s> 

O UJ ** - 

uj ae o 



o o o ! 



o*t<i J f£55353 

oac^coooooo 



_j O «»0 _j o« 

CO — , if CO -^- 

z z 2 z 2 

T H W T (O 

5 £ o Z o 



Z Z 3: 

o o o_ 
o o ^j 



jjjJjOOoB 



00 o => a£ 

Z z 2 

ceo o. 



<: *t ■«* ^ -*■ 

O O o 

1 * I ■ r -^ ; 

y y y 5^ £££ 

ZZZoZSiSo 



o o o I 



> O O O CD O ' 



<J3(£ (£Ol 



itfOOOOO 



OO'-'O^O^O^' 



I <X> IjD <jD tjD r-. r- 



cr> cr> 00 00 < 



o o o CD i 



o CZ> — — 1 



lD (X) to OJ 1 



« rt^^^~*c3~*N«-4»--< •-**-*•-« .-. -— ! 



— — n-WWWOOWa)CJ)<7^ 

^rf OOOOOOQOOi 



O O O CD 



O O Csl i 
CD CD CD ' 



1 O O O O CD CD O I 



CD CD CD CD 
CD O O CD 



303 



o u? I in 









— . — oo 



^ m oo — « 



5 5 



: o s 

I Co => 
: o z 



"«Uj!i:LiJUJ««LULU«t 

zoooZooZw 

a: ce ~ cr o: q; o: a: a; a; 



5 S 



t ■* Si; o 

uj Q ° 

jJ I- O O 

« y — <r 

£ a: t i— 



Z — «*= <= 
g QQ -o 
o o o o 



^ <r 52 

UJ ^ ^ 
■ > Q_ UJ 



— . — . o 

ro m en 

r— oo or* 

o o o 



— • o o ~ 
o o o o 



O r-» r»- ~- -^ ^ i 



oooo oooooo 



O ro cm csj 
O O O O 



S UJ W I 
ID 5 P ' 



£ 8 s 3 s 8 s 

Z Uj Uj Ua 

2 ^ ^ ^ 

^ 05 C5 CS 



"* "^ ^ 

— —. — . 

^ $ § 

^o ^ ^2 



* o 



t_j o o 

Z S =) 



a: a: o z z o o 
o o o o o o cc 

2 2-55-S 






o o o 5 5 



en en en 
i— >^ Jid o 

'■' •« !£ 

o o 



t _^ - > o- 



73 QUUQ 

z z ° ° z 

« ° 5 5 ° 

S £ ^ c 5 

« — I O Q — I 
LU <t « UJ 

5 Z O O Z 



— _ o 

ri 06 C7) 



—• 00 01 o 1 



UlUXCOM 



tO to to tO ' 



u. o — — o 

O to OO 00 to 



5 a> w en 
K 0000 



o -. -. o 

OO GO OO CT> 

OOOO 



304 



O O O ~ I 



o o en <x> i 



— ■ r- oo o co ~- < 



i O O O O O — O I 

I o o o o p -V i 

i Csi CsJ r»I « W r-^ i 

i v — ffi <y> w 



— o. 

£ x 

z ^ 

LU a 

z z 

UJ <f 



oo U 

*2 Z 

a < 

o 

UJ < 



r-Z LfcJ O 

— o 
>- z = 

5 ° a= 

IS;, 



to & i 



°- o ? S 3 



^ _ J- ce 
±i-o< 

E2««c..r 



it* 



a too! 



5 CD u — v ' 
U- UJ < 5 o I 

' o o o s x 
t- uT -go' 

oc £ i 



Q= x , 



^ z s o o 



O UJ 

i a, <c 



Op" 1 

t— a- or : 

2: £ < ■ 



o: < o: o 



CO "j ^ 
o — O 



£= S£ — ' -*" 1= ■*■ ^ 

2 S o co o Q- Si 



►r _i 1j od do uj 



O Q. 
cr> O 



— _ a_ O 

O O O = 



o- UJ UJ UJ BS 
^ O O O C3 

O£to:5u.u. 






OOOOOO -" 

I I I I I I I 



i/O co •— • o ct> •—«•—" r*-. f-» oo i 

ocMmmoootsi-HMi 

OOOOOOOOOO' 



. — i — i (X> I — ■*J-CSJCSI<jD— « ~h ^fr —h ^ «— • OO CT> PO ■ 
«O(MMC4-"-NO0fMOt\OCM'-'O; 

iOOOOOOOOOOOOOOOOO» 



cc S o 

l— <r o 
^< 

S < ii 









CC Z u. - 



BE o — a- 

«t «* O UJ o 

u- o co z L": 

53 



CO <j 

55 



i><Z3<a>z 



' CO H CO O * Q " 
iSK CO W I£ 



O 



■ o ; 



oocexSckceOi— 



_ a- =» o 
C3 a- =e z 

<r => => :> S 
o _>•<<£ co 

u. O. O. CO «£ 



o o 
o o 

X X 

o- a. 

s s 5 S 5 

£ £ o= g z 

uolcc j 

ISi2 = z 

CflCflt-OO 
<C «t O X cc 



CO 



uj TMfn^insfNr^O'- | CM(nooco>nin^cO( r )^^co^csi(n^f'n«i)i 

«L CvJPOrH — rH(Sjf0O^^^--C0-^00«00»CMCNCNICNOOPOOOO 
X o — O O O — .^H-OOOOOOO — o — — • — ' ~ -- — . ~ ~- — . •-•--• 
uj ^f^rsirjCNrvf^ivsoooooooocnincocTimtn^-^-^^CNjrocsjCNrvjcvjCN 

ffiooOOOOcnmmfnM^ifiUlifiioiONMvrvpsrvrvNN^s 

Si ooooooooooooooooooooooooooooo 

u. 
e 

irtryWPJNOOOOOOO-'I'JCOlONNOOOOOOOOOOO 

Ort«r^^c\c\fO(»jro(vifon--^^(sicvjp>pop>nnin(nrtPin« 

l*~ fx r*. r^- r-- r*» r-» ob ob ob ob ob oo CT> CT> CT> CT> C71 CT> CT> CT> CT> CT> CT> C7> CT> CT> CT> CT> 

ooooooooooooooooooooooooooooo 



305 



_ _ „ lo tO O 



< to tO 0"> to <-0 I 

to oo — • eg i 



ac ac ac ac o °= 




Q o o Q 5 Q 




z z z z "■ z 




< «t « «t >- «t 
<t «t «* o z <t 


a: 


5 S S o ^ S 




aaagfa 






t£t|^t 










V)M(fliZ V) 




o o o 55 o o 
o o o o o 








a a o o a o 




z z z t z z 




o o o * o o 








o o o r o C3 




Z Z Z^ZlZ Z 




3C x a: t i i 








<: «: ■« S < < 




JJJ«JJ 





0:0:0:0:0:0:0:0:0:0:0:0:0: 0:0: 



"CO WW) W OO (/) 



a. a. o o. a. a. a. a. c: &■ a. a. 0.0. 



-^ 00 

« CM 


O 




to 





to to 

O O 

1 1 


O 

i 


00 
i 




1 




1 


0"> tO 

O CM 


CO 

O 


en 

CNJ 


en 


tO 


to to 


r> 


PS* 


00 


OO 



>r«.M3oars 



o o O O O I 



I I I I I 



O O O CD O O 



000 
I I I 







c 
cr 

C 


c 
z 
< 
ac 





is 

O O- 
O UJ 



_. o a- *- 

= uj r f. < 
— °0 — S S 

1— ° a p 

uj 00 UJ UJ 



_joo_;t^oo_; 



— J V) </> — J 



v; vt — 1 rrr vi vt 

^ =^ uj ?= ^ 5 



m ^ == co 



^ ^ _j 



2 E 

o o 



O ! 



o 1 



ac ac ac 3 £i tr 



o o o «t z o 



2 z z z 5 



_ z^.zz 

z «* I « o «0 

S r- a r- 2 UJ 



* 0J0 

£ <f o «t f> uj 

2 o o. o 5 o 



P UJ o o uj 1 



3C «t «* I O 



0<<0| 



. . ° 
o o' z 

«* "* o 

I O O ££ 

; «sf «* o 

w w < 

O O Q_ 



Ul UJ 

a- o_ 
00 00 

UJ UJ 

<wco<>JJy)v)< X 3: 



T 1 ^ 

" % % % 

s ^^^ 

3 C^ Q| c^ 

< ^ ^ ^ 



"* "* ^ 

1W X. X. 

s= f* s= 

^ Cj <S 

C: C: c; 

s s s 

<Q to $£ 



O O -h O O « 
000(0(0 1-^ 



5£ to co 

* o o I 

^ to cm « 

■ CT» O O O < 



1 to to to to (O ' 



**j ^_ ^- ^- CM CM ~ — -^ ^ CM — « — . ~^ 



000000 



00000000000 



306 



i ~ 



O CD CD O ' 



-Hinwv 



«2 x 

uj O 

3E Z 

UJ «* 



co U 

*2 Z 

o < 

o 



«» F2 o> p2 

fr5 oo rn oo 

2 w 5 « 

= Q = O 

|z|l 

|2|3 

o >• o => 



D 2 

Lo* 



a: u_ 



: o o 



>- cc 
2 co >— 



|±? co >if oo 

=^ — =j _ 

O o O CD 

cc — cc — « 



r^ r- oo oo 

o o o o 

I I I I 



UJ? z . 

oSzg; 

O _J CJ , 

• o "- ! 

CO *" LU J 

Zo z ' 
-<=> 2 i 

O ..I 

S: x o ? ' 

cc <? S z : 

sis* i 
g 2 £~ 



: 5 « 

• < o 

• <:£ 



^ ^ « oo" 

- q:o:z 

^"~§ 

CC O | 



cc ~ — cc cc 



cc o 
octoz 

Sou 
o co ! 



> Q 

1 UJ o 



£o! 



3*! 



i co o a: 3: i 
i uj a= 5 <2 | 

I uj Q_ CD 2 I 



IT Z O Z O — lOo^OO^ 



O©C0Ou»«XOO 



ooou-oroooo 



— • — ' — • — r-. O O ■ 



OOOOOl 



> o o o o o « 



2 
s 

gee 



; CC UJ O 

: oo<2 £ 



g 3 ir 

CO g o 

«=» - £ 



ac —icc—toc 

< o UJ o LU 

% z :* z 2C 

=i ^S«S 



Is 



?SS?£SSto 



^O^UJU^ 



y O uj uj 



o «X 



CDtOuimcQCDQ^QCDCDO 

£ 3 Q O SJ O Q O g UJ g o O g ! 
UJO>>5>->'>«t»i-Z>><C 

a:ic<:<:o^<t'-•' 



u. o o o o 



CD — — — — CD ( 
_i up — . — . 1 
CT> CT> CT> CTi O O 






55 O O O O O O O ' 



CD O O O O O O 



o o OO 
CD O CD CD 



tf «£ «X> U> 



O O O O O O I 



oooooooooo 



307 



oo ooo< 



o o o o 



> ^- CO O CO i 

; ^r O I"-; ■ 



^- f-- (M 0> fO <N( i 



o 55 



s 2 



: 3 ce 

I ' CC O 
1 & == P 



z°>st 
uj z ■« ^ ce 
<r •< g E S 

g 5 £ «Q; 
O u- «t c/1 P 



Z 2 ■« 

,« ,« <" 



S o ui= 
0000 

0000 
o o o o 



0000 



OO OO GO 00 



zzzzzzzo. 



ooo«*<:ooo«*ooooooo<: 

x x 3: Q= a: 3: ii^iiiiiiia: 
o_ q_ a_ o o a_ 0.0.00.0.0.0.0.(1110 



IH -00 - « — ">0- . « —« ^- • 



00000000000 

III I I I I I I I I 



r- 00 ai 



0000 



000000 0000 



I o o o o o o 



00 — 

r -zo 
-^ ,-, z <=> _. 

O ^ O o o 

CD Q CD u p 



CL. O. 
«* <t 

cr ce 

t3 CJ 

COOCQI-K 



-J _> _i 3 o o 



=> = fc" 

> «t o t 

o o a 3: •£ 



«* o «t o ! 



ee z z z t 

UJ UJUJ u ^ 

; jsj| 

Z 000^ 

UJ CD m go u 

* ctceccs 

o 999- 

u. > > =» ^ 

"J o o o 5 



<tQ0*toO*t***tO<»0oB' 



CD CD 



* z 5£ z = =) ; 



z => 5£ =£ z z 



z => 



to H- to I- I 

2 SSSss; 



<X XX X XI 



'D Z> D WWI 



3Z X o o o o o ' 



** ^ ^ 

UJ K. t>^ k* 

« % *: ^ 

* 5 ^ i 

* g £ g 
2 ^^ ^ 



o o o o ~- 



O « OO rv. 



o o o o ~ « 

ioo>n uoco< 

CT> CT> O O O < 



~ O — - — O — • 



-* O O O 









«j «c^^ — ««— i^u-;; 



HC CO — « (N -^ — "OPOCOr-vOOOOO 

>o -^ csj oj cm - * -.rn-^-H^tNpgfnnn 

• f*» r*- r-. r»*. r— . 00 00 00 0"> CT> ct> CT> CT> ct> CT> cr> 

• OOOOOOOOOOOOOOOO 



3 OOO 



308 





a. 


oo 


X 




LU 


LU 


O 


Z 


z 


LU 


< 


QC 


</> 


=) 


LU 


00 


u 




Z 
< 


LL- 


S 


CS 


o 



- 



1 J2 

: a. co 

: <2 _i a: 
S s o 

■ S z y o 

t— ui it ce 

°= 2 z ^ 

o •- o t ■ 
•^ it uj — 

Sglgi 

a: p * lu 

<x. <n <J3 cq 

"Bis 

in. hd 

:=>< — 

O O Q_ 



£^£ 



1 ^ ce o a= az as 

a. o uj o o o 

o o ° o o o 

CO I— _j I 



OZO«tOZGOOCC^3: 
- O => GO Q. ■' 



CO o ~- o o o 
= 3: =; i i i 

tOQ.$Q. Q.Q. 



CD O CM O O O <NJ O 

tontONUlMDrNi 
OOOOOOOOi 



O O O O ' 



•^ * * 



■a ae 

CO * °- 

< o cc 

LU •« P 



S= 8= 



x. oe 
o o 

ID Cc 
£g 

z x 

•« o 

O OS 



CO O O 



55°= z^ 

o o n: :> ct 



£ o ± 

— co Z 

5 o 



> 5: o o o 

JZZZ 

I^OOO 
: CO > => > 

: t— or ce cc 

^ CO CO CO 

eg o o o 

o o o o 
—"lis: 
-— a. a- o- 



u. tt — ■— . 
<=> o o £ 

Ja:<Q 



| o o o 



>o5<r<"co00o 
uj — ?;cu z ~« — — — 



LU oe V lu ►— 2 , 

I LkJ X «* C/> 

t— x a: oo z «c i 



S <: .< <c 

z s z 



to r^ m po m i 



O) r^ ao en ' 






"S O O O i 



O O O CD I 



309 



en r~ o o ' 



> O CD O CO O O 

I o o o oo o o 



I010-CM "i 



ccceccccccccfrce _i 

OOOOOOOO 4 



OOOOOOOO (— 



: oe z 
• o o 



£5 

ce Q- 

•< uj 

o- ce 

o ce' o o 

{= LU Z Z 
£ CO *t «* 

cc cc £ ce CE 
< 3 UJ UJ 

O CO — • CO CO 



s « 

CJ Z 



oooooooo 



OOOOOOOO 
QOO Q OQQO 

z" z" z" z z" z" z" z" 

oooooooo 

OOOOOCJOO 



r^ ^ o CNi cm -" n 

O CM — — • — CM — • 
(OIOMVISOOOO 
O O O O CD O CD 

I I I I I I I 

OOtNOOO^^H 



o 

>• 
ce 


o 
> 
ce 


U 

>• 
cr 


o 

>■ 
a: 


> 


o 

>• 


>• 
cc 


> > 
ce or 


o 
>• 
cc: 






CC 


O 
>■ 

ce 




o 
ce 


O 
>• 

ce 


O O 
D> > 
CE CE 


CO 


CO 


co 


CO 


CO 


CO 


CO 


CO 


CO 


CO 


CO 


CO 


co 


CO 


CO 


CO 


CO 


CO CO 


z 
o 


z 
o 


Z 
O 


z 
o 


z 
o 

JZ 


z 
o 

3Z 


z 
o 


z z 
o o 

X X 

o_ a. 


a_ Z 
■< O 

a: x 

O Q_ 


z 
o 

x 


z 
o 

x 

Q- 


z 
o 

X 
Q- 


z z 

O O 

X X 

q_ a_ 


z 
o 


z a. 

o <£ 

JC QC 

a. o 






UJ 












UJ 


UJ 














UJ 




o 


o 


m 




to 


O 

m 


o 

TO 


a 

TO 


CD 


m 


CD 
TO 


O 
TO 


TO 


ro 










1 


cd 

1 


i 


o 

: 


i 


to 

o 


CO 

o 

1 


CD 

O 
1 


1 


CD 
O 

1 


i 


LD 


CO 

O 

! 


CD 

1 


OO 


CD 


CD 

1 


O O 

1 1 


s 


m 

o 


o 


o 


o 


o 


o 


CD 


o 


O 


CD 


C 


CD 


CD 


CD 


CD 


O 


o o 



CD CD CD CD CD CD 



OOOOOOOO 



ooooooooooooooooooo 



o o 

z z 

o o 

z z 

UJ UJ 
CO CO 

X dz 
>— ►— 

O 3 

o o 

CO CO 

yoo 
_, o o 



OJCn« = = 
2 °, Z "8 O O 

■ ce o _, ce ce 
< i- E «t a. o. 

— i z $ o o 

J< 1 i»55 
oi^Iooco 
o 5 f= J «t «t 



o o z z 
a. a. a. a. 

uj uj s S 



"*«*??=; 



z >- 
o z 

DZ «t 



>- >- 

z z 



UJ I 

«* 5 



2 CECoOZcOqCCCE 

EC "^-'uj^-! 0000 

o ^. z. ^. ■£. =. % z. x. 

uj OfE ^feg 00 



«t CO 

a. •< 

1 z 



I O — > — 1 — I O ' 



<<<<<<CCQ. 
ZOZZZOuJ<C 



<t CD 
Q_ <£ 

<t z 

CO <: 



>||o 

o o o it! 

g ofl o9 O 

I ,- UJ u Z 
I 1 *" iC it D 

1 o *** ^ z 

- :< Q. CL CE 

Z Z Z O <C <* uj 

- . CO CO •— 



2 oo^^o^SSo5oo5^S=cjocjS 






tr> est a> o — • i 






c> o — — ■ 



NNWMOO« 



«— • u-> cD « 

OO O O ■ 

CSJ Csj CD 

CO CO r-. 



O O CD O O O 



o o o o o 



u">ii"iir>-^o*>cDc\jo 

OC3CSOOOOCD 



C3 CD O O O O i 



o o o o o o 

iOOOOOOOOOO 



310 



O O CO O UO i 



— — UD — O — 



*2 x 

z ^ 

uj o 

z z 

UJ ^ 

in ^* 



<2 Z 

a < 

° O 



:35 
tl <t <t 

l- i a: 
uj o o 



C7> <X> CD 

o o o 

I I I 



§2 



—I <t 



: <t z a. 

i2x . 

UJ (— "J C/0 «I 

= -i ^ o 2 

H r, > u o 

< t < K o 

• q: o fr °- 

e Q ofx 



9J «t 2: uj o 

SoaZz 



a. cc u. 
•< i- o 
gtccr 



OOOOCMOOO 
OOOOOOOO 






** t ^ 

i- i^ X. 

P= f* ft 

^ S> £> 



o o o 
z: z z 

<£ <£ <£ 



5 H ******** •— <H 

O ujCOGOOOGOOGOuj 



It ^ „ CD 



OOO^-H-H" 



^-t o 

co co 

ob oj 

o o 



co co en 
t*+ ob CT> 

o o o 






ZI OOOOOOOO 

Ik 

o 

(jO' — ■ — ■ cm un m en en 
OOOOOOOO 



311 



>OOU-> OOOOOOt£>< 



o o o o 



— o r-~ ■ 



O CO 

! OC uj 

>o z 



8 = £ 

« 2 fe 

gts 

5k? 



| = o 

: £ «j 

i z => 
> o go 



° o ac 
o 3: o 

z Q. u. 

J5 Q uj uj 



z «t 
a. (r 



35 



: cc oc 

: = ^ 

• UJ UJ 

: en <r 
a o 
z z 

: < «* 

333g 

to go" uj — - 

«I «t =) 2 

yyo5 

ccce ^ z 
o o z i 
=. » P go 



y"3 



,fcfc 

; ce ce or 

a o 

^ z. ^ 

:<<< 

53 



3333 



3 

O Z 

33 



ocoozoozocooooo 



z ;=: o z z 

o to ^ o o 
•■= ^ * : 



«t s I 



I ■« «* 



oo o ?; 

o o o 3 
o o o 



CO X Z CD GO 

O is o o o 

t» _ — 

o 2 o o o 



O Z Z Z CJ z z 

^ O O O z o o 
U<<<!<< 
Z CO GO CO GO CO CO 

o o o o S o o 



oocj>oooo°oo 



ac oo z z z ae ce 



2: i ¥2 o uj Q i 



<t _l _l 
<_> o o 

O 2 GO GO I 
GC ^ «t <t 

lu.UU< 



i 57 — ! < — ! 

%ujO^O 

"» _j ■« a! < ' 



o o o <t 

to to co -J 

— — — o 
III 

CO GO GO ^ 



2= o o o 

t— O »— »— h- 

to o- to to to 

££ZZZ 

1 UJ 1 IE I 
GO oc GO 

•« T <l - 
JwJJJ 



o o o o ^ o o 
z~ z" z" z" - 1 z" z" 

O O O O , ; O O 



ca cc oc ex. cc en 



Z Z Z O. Z O. 

o o o «t o <t 

Q_ Q_ Q_ CO O- to 



SxSS<SS<S 






—I t-^ OO 



-"NO« 






onro — oo^- — 



i/)inrsu>rs.coi£)oooo»ooxoooooo 

OCDOCDCDOCDCDCDCDCDCDCDCDO 



lO ID(C (C I — 1 — r~- Cn Cn 

CD CD CD CD CD CD CD OO 

I I I I III II 

o u-> ^r cn o-<^»ncNja>v-'rs.mxio-H 

^ — M O ->0(NI-H(\irsiOOOC\IC\l«0 
(£U?(C<£ tDfvrNhstN,r«.hsl^OOOOOOCT>(T) 
CD CD CD CD OCDCDCDCDCDCDCDCDOOCDCD 



: ^ ::::::**: * 

: S : z : : : z : : • : : s 

z ^ : 2 : : : 2 '■£ : 2 



!UOuJuJuJU^ZsuJUJ 

- . to * a a 

«. 5 ** m LU 

£g*iz§ 



:E Z ^ CJ 3T 



X X 

«* *t 
or a: 

CD CO 

z z 
o o 



^^^LuS^ce^^^ce^^ce^^jQ? 
Sujuj^^lu^Sljj**"***'"* 03 '" 1 **"'* 
ccccce<:**cc^cccc:ce2cccc^Qr:cc2 

CD CD GO q Z CQ Z CDCOGDzCQCD^COCDz 



o o o ; 



> °>°5?>?2a95> 



O O Q- *— I 

> > o 2 I 

Ij Ci O ^ o ! 

LU uj uj UJ ►— i 

CO t— O I 

_i z z z °- , 

<< <OoJ 



2 c/> o o 5 o 



u~) <jD ao oi o '-D 
ioo»n^csjo< 

' <=> O CD O — O < 
• O O O O CD Csi i 



• O O O O CD i 



CD CD CD CD CD — 



ooooooooo 



CO CT> C*J CD CD CD •— • •— < — « ^^ tX) CM CN< OJ CD 

oo oo oo oo oo oo co oo oo oo en en en en en 

ooooooooooooooo 



ifniflOnr^csjOO 

1 oo oo oo en en en en en 
oooooooo 



o ^; ^ « ^ c\4 ^ 



CD CD CD CD « 



96-500 O - 78 - 21 



312 



o 
ac 


Z 


u_ 


Ul 

a. 


CO 


X 


1— 
z 


UJ 


UJ 


O 


J5£ 


Z 


UJ 


< 


a: 


</» 


3 


UJ 


CD 


U 


«o 

a 


z 
< 


u- 


* 


o 


o 



, ^ O PO I**. 

d ab v0 n 
o o cr> co 





tjf> 


<X> 




lO 


<x> 










m 











ooooooooooooocjoo 

ctcccca:oiccctcn:ci:Q;cc:ccCE;crcECE; 

SacSSSzzzzza-zzzzzzzzza- 

CJ3 OO CjOOOOOO** ooooooooo** 

xxxxxtrxxxxxxxxxa: 

LxJUJ'jJLAJLiJ Q _ a _ Q _ CU Q_cj3Q_Q_Q-Q_Q-Q_Q_a.Q-0 

<<<<<UUJUJUUJUUUUUUUULJUiU 
OOOOOI— I— I— I— I— t— I— 1— t— I— I— 1— I— >— •— i— 



5 ^ 



UJ u 

ii 






iD co id r^. ^ r^ r^. i — co ' 



• o o o o 



^ ^ o 
en co co 

r- oo cr> 



I I I I I I I I I I I I l^^jJ.^rJ.^pipi 



oooooooooo* 

OOOOOOOOOO" 



oooooooooo 



>- >- w 

zzu 
<* *s z 



Q.ad CLQ- 1 



J-^ a: a: a: a: 

C_J O O CJ O 



o o o o 



<: z 

o a. 



> => <J 

UJ »— UJ UJ UJ qj uj I 

l-O0DCD o I- 

z -i -i z z z 

O ofl «t < < «t O 

^ tr. cc z z ^ 

z "J i— i— cr rr z 

= ac z z "- "- =» 



_l z z ,_ 
«t ^ ^ < 






«t o 

£z 
z = 



ce ac a: a: as a. 



t i at a. 



CO CO M 



I ■* X I O O UJ 

" 111 D 3 < < « 

3 o co co o u> $ 



"tXXXOOXXXUJ 

U333<<3S5" 
xooococoooosd 

(JWWCOC30WW V) J 



t •«* *c 

k Sjj iy is 

.» * 5 * 

* SgS 

3 ass 

a o o o 

5 HJ HJ HJ 



intor-sCOOOCNfO^i 
romcococococDcocO' 
OOOOOOOOO 
CT1CT>CT>C7iCT>COCnJ<NICNI 

OOOOO-hNNN 



U-) O OO 

NOO 
■■T CM 

co r»- 



— . >— CD -q- ^J 



t ** ** 

:>-. i- ^ 

p= p= p= 

^** 

c> o o 

C: C: fc 
SS5 

^2 to ^5 



>t o o o 






o o o o i 



, O —■—■•——' ro — —..— —. — — w (N n n 
^0000000000000 CT> 0"> CT> CT> tT> CT> CT> tT> CT> 



— — CZJ 
CO CO CO 

N oboi 



313 



• r-- CD O O ~-< I 
) CD O CD CD *=T 
i en OO O CD 0"> 



S "i z p _j 



- - > > 5 

= = q: ce £= 



OU.U.K 



•* ■* 5^ = 



k»q:q:ui 



CJ <t Q 

O uj o O O 

^ a wujw 
£!ceu-u-u-cece£! 
^LUOOOuJUJJr 
Oh— t— t— O 

a-a_2L*2a_a_ct_ 
- zzz 2 S a 



Uj OO 

O -> 
z => 
S>2 

OO -E 

o o 

«* CC 



O OO 

to 
5g 



00 



a: uj , 

= as < ! 



1 Q 

I ce 
<-> o 



o 

o 


o 


O 


o 

2 


o 
z 


ce <: 


X 




O 






z oo 
o ^ 
— ce 

OO [- 


o 






o 




z 


Z 


Z 


z 


o 
z 


o 




o 


o 




LU £ 












to "*■ 


Q- 












a: 

CD 


ce 
O 


ce 


o 
o 


z z 

° 5 

o 5 



=> =3 ^ 3= O 



tfHOicrvrvr^iooOOOOOOOOOOOf^ 

oooooooooooooo 



OO OO OO O" 

-. U) IC rs fv tD U) I _ 

OOOOOOOOCDCDOOOi 



i^^MCOOOK 



CD CD O O CD O CD 



CD 



u 



£ o uj £ ; 



5w^5o 



. «t ce 
^ Uj o o 



1— z <t «t 
«t o ct_ ct_ 






cc z ^ o- q, 
< O OO OO o o 

LU LkJ CC CC Z 

I o o 

O IT 

z cu 



UUS3^3; 



-J "^ozzo^^zzz 

« Cv O ^ fZ U ^ Q- ^ s pp 



o « <: 
C ce ce 

^ CC CC 



S E = E 



■*sSc5 
o o o o 



2:308.5, 



i 00 S S ' 



0*tO«ct— 00000 



i=l-J 

_J o UJ «l 

«t OO 2 o 

z « ^ cc o 
uj ce 5 Q= => _ 

£ g|y°§ 

< — > CO *~ uj ^ 

* q= is 5 5 5 

O uj ^ 5 ^ 
j ce o o t^ q_ 

*t => z 2 uj _, 

, _ O O UJ 3_- 



CD O O CD CD CD 1 



» CD CD CD CD 



UJ 00 0) N OCOI 

(^ n en uj v cm 1 

X — — OO—;' 



5S CD CD CD CD CD I 



'OOOOOOOOOOOOO 



CD CD CD CM CO (JD C\J 

CNJ CN. -- CSI --. --« CSJ 

r-» r^. 00 OO CD CT> CO 

CD O CD O CD CD CD 



314 



ov^oonflworo' 



or 


or 




Q- 




cc 


a: 


_l 






Q 




o 






**■ 


z 


z 


<t 


?- 


■< 


?- 


;»■ 




«i 


1 


«. 


«. 


<i 








X 




j: 






1 


2£ 


*: 


U 


ic 


u 


=t 






Z 


z 
o 


1 


Z 

o 


— 


z 


z 




O 


<L 


o 




















u 


t'J 




IS 


** 








z 


z 


O 


z 


CJ 


z 


z 





uj O 

z z 

UJ rf 



eo U 

*2 Z 

a < 

£ I 

o 



O O O O O O | 

o o o o o o 



O O O O O O z " 

o o o o o o 2 



__ _, ^_ , 



I I I I I I I 



ora_a:a:CE:ar.or:ar.arQrC£Cc a: or cc en 



Q- a. Q_ a. I 



X X X X L_ 

0-0.0.0-0-0-0-0. 






CD CD CD O O O 

I I I I I I 



eg o — > CD O i 
O O CD CD CD ' 



CD CD CD CD O O CD i 



O O O 
Q_ O. O- 



CJ3 O r-j o o o o 

99^9999 
or or or or en or or 



cc a: ^ a: oc ir oc 

00 CO CO GO CO CO 
CO CO ^ CO GO CO CO 

z z fc z z z z 

X X S X X X X 
O O i 



o'-oo° 

>5>>Z 

o o <= ° 2 



' O O I 

■ z z 
1 «t «* ! 



o o o o 



S o" S a o S 

_i «£ o. «r «* S 

^ O ^ O O o 

.- . CO . . o 

<£ <uj<<<^ 

x co x go 00 go 

2 o o o o «t 



GO O O O GO GO 

S S SE X — — 

Q O O O Q ° 

• o Pi? ?o o • 
J z jz Q - Q - Q -zz : j 

i tMl i < nfl pa oa < < lu 

CDflS 



o o 

LkJ UJ 



O u_ 



^^OuJUJUjOQ^OQ 

zzo**«t<toozoo 



UJ K* K. 



r-. OO CT> O oo •— •■* ' 

. o o O — • **"> en r» ' 

O O O O O O O 

' O O O O O -• ^ i 



2 *© i 

-1 "*■ 



« u: isj — ' 



^noo 



o o o o o o • 



(OOCDOOOOOO 



315 



o o o o 



O <D r^ —. CD O ' 






O -i S 7", 



o : • o 

S- 1 S3 

00 a m °° 

2 oc S 2 

«t 2 O «t 

a: «* o i 



HZZrU: 



S^i 






: oo >- 
« "J- 1 cc 
. m c_> S 



's^a=£ 



>S rv- — ' Q= 



O O O 

o o o 



o o o o 

f» r*. r»* oo 
O O O O 



oooooooooo 



■^ ^ ^ 

i- ^- i-. 

&= s= &= 

ill 

c; c: C; 
S5S 

*€> fe"> ^> 



* °°2 z°° 

P o C lZ <=> 

-TO: CE 

« $ O O 2 



Q C3 O O 






o « cc 

uj o o 

a: — o 

UJ o x 



« a: 2 => z a: => , 



: S3 : O « « 
! Q o 5! o 2 
> o: o z a: o 
. o z o o o 
o «r — o 



S 
o o x 



2 xoioxxoeoiji: 



K; o o o 

5 O O X 

gggg 

Q- t-JJ CJ> X 



UJ CTj O (X) — ■ 1 
^ N, ^ eg a» 1 
2 O — . — . O 1 



OO — OO 



££ CT> 0> CT) C7> 



Zf OOOOOOOOOOO 



OOOO 



O CT> CT> O ^-» f*— CNI CSI CS* CVI CNi o 

C7> Cf) CH Ch Ch CT> C7> 



O « CNJ — — • 
OOOO 



316 



- I 



E x 

uj Q 

z z 

at </> 

5 111 

m U 

«2 Z 

Q < 

° o 



I O O UD *H l 



to O O O i 



i O O O (O O) CD (^ O ^r 



auto: 
3D => 33 33 



n: ic o: x X n: x 
3 => 3> 33 33 33 



O O O O : 



ct ^ a; ct 

I D u O Q 

: z ee z z 
: «t «t «i 
^o«: 



a: ce o: o: cc 
O O O. O Q 

z z z z z 

«* <t <c ■< <t 

_ «* «c «c «£ <t 
o o o o o o o 



WO, 



CO GO GO CD 



o 



• => o z = 

o o ^ o 

o z ^ o 

• o S 5 o 



s s s s s 

3 3 z: 3 ^ 

o o o o o 



o o o o o o 
a o o o o o 



acccccccocGCGcccacocccGcccccaiGcar 
wu)WWWtf)y)wwcflv>wy)tf)trt(rt(/) 



o o o o «t 
0°: 



o o o o o 

O O O O O 



S Z S ^ 

: a: o S I 

<£ «l O «* 

5 E OS 



ZZZZO.O.ZZ 

oooo«t<too 

xx:cxcca:xxx 



x x x 3: x 
«t «t <* «* «t 
S 5 S S S 



oooo«t«iooooooooooo 
3:13:3:0:0:3:3: 

0.0.0.0.000-0.0.0.0-0-0.0.0-0-0. 



2? 2? 2? 21 ZZ ZZ 

- o O 1 
3: X X 



en 


'-O 


CD 




m 
































































CD 

1 


CD 

1 


CD 


CD 
1 


CD 

1 


CD 


O 




1 






O 






CD 








en 






m 










OD 














CD 







~ O O CD < 



m (£ i£ u> (C in to nxooi 
0000000000 



I I I I I 



000000000000 



OOOOOi 



OOOOOOOOOi 



D- >- w w 
Z Z UJ uj 
< «t z z 



000. 
w w 2 
> > o 
o o "j 



oozzzzzzz 



< « ^ ^ 



> > o. o_ o- 



o o 
3: 3: 
a. a. 



o o 

3: 3: 
a. a. 



uj a. 

** - ^ 



* x a: a: ir u < £ K x £ o: 

Qg CQC0O]C0xHO30QD0CD CO 

■*- oooo°S<:ooooo 



1 < <t o 

« uj^ zz z 

* Sz "•-"•- = 

2 uj a: o a z 

—1 a.Lj<<6: 

< «C X O O UJ 

!2 uj => *i <c y> 

g x o to 00 "J 

2 o m o o S 



UggQOUIUUlUUJIJUl 



OC O- o. ^ ** 



«t «t O O X X X 



5 o cJ o o 



CO 


CO 


CO 


CO CO 


CO CO 


Z 
X 


z 
a: 

X 


z 

QC 

X 


z z 
a: oc 

X X 


z z 
cc cc 

X X 


ID 
O 
OO 


ZD 
O 


=3 
O 
CO 


3) 33 
O O 
OO C/3 


3) 3) 
O O 
OO OO 



<t <C Z3 ZD =D ZD O 



S K £ £ ^ K K ! 



1 o o o o O " 



CM O O 
eg ro co 









iOOOOOOOOOOOOOO 



317 



*fi — CT> C> O 






5 •- 



GO C/5 GO 00 GO GO GO GO GO 00 GO 



a. 


Q- Q- 


a. o_ 


a_ 


IX 


IX 


Q- 


Q- X 


-j 


— i — 1 


— i — i 


-j 


-J 


— 1 


_i 


_J _l 


— 


1— t— 


t- P 


*~ 


^ 


H " 


k- 


^ *" 


pn 


co ro 


co ro 




o 


a 


a 




<=> 


1 I 


o o 




0) 

o 
1 


o 
1 


en 
CD 


o o 


a 


o o 


o o 


CD 


CD 


a 


a 


ao 



ct en en en or cr 

CO WCO OO W CO 

q: cc q: q:q: q: 

IZ> => => ZD Z2 => 

<X Q- X Q_ X Q_ 



it 



__ __. o 
i^ ao <T> 



OOOOOOOOO' 



ZZZOOZZZZZO 

xxx^^xxxxx^ 

UUJUqqUUUJUJUq 

•—>—>— oo 1- •— *—>—>— o 

_I_|_|ZZ_|_I_I_J_|Z 
— i — i— i«x«x— i— i_j_i_i«i 



ctriroaciriKrKO 

^ UJ UJ < < UJ UJ LXJ UJ LU *^ 
XXXOOXXXXXO 

X XI Xi ■*" «f X> X> Xi Xi XI «t 
O O O OO OO O ~ 
00 00 CO O CJ 00 



i oo o O O O O i 



S •>< •>* 

«* ^J W Lu 



o o o o o o 

<:<*<: «t <i <i 
cr cr cr cr cr cr 
o o o o o o 

Q_ Q_ O. a. Q_ Q_ 

cr cr cr cr cr cr 



<c <c <t <t 



tt 



— US oooooo 

^ 3 Q_ CX (X Q_ Q_ CL. 



<£> r^ oo co o o — • cm m ^ m 

OOOOO— ~~- — — — 



o o o o o 



CD O O O O O O ' 



3 O O O 

a 

~- — . o 
CO CO ro 

f^ ob tr> 



o o 

o o 



O O O O O O 



318 



— a: 

*2 x 

z m 

UJ Q 

s z 

UJ rf 



CD U 

£ z 

o < 

° O 

Uj < 



i-» co co oo r-. < 



OC OC QC OC CZ. 



a: cc 
o o 



2 ° 



—i o 

O — I 
at uu 



o o o o o 

Q Q Q O O 

z~ z" z~ z" z" 

o o o o o 

(J £3 £3 O <J 

z z z z z 

i i: i x 3: 



I I I I I 



cccc.Qc.ccoccc.ocac.ac.Qc.occc. 
zzza.zzza.zzzz 



ooo<rooo«*oooo 
xxia^iixiaijcxix 

0-0.0.00-0-0.00.0.0.0- 



OOOOOOOOCD 

I I I I I I I I I 



ooooooooooo 



CJ _l _l 

* z z 

o o o 



< CQ CO 
5 00 CO 



lb r-~ oo 






O o- 



uj : o Qiu 

—I • CJ —I 



<-> 



O O ' 

i SI 



~ o o 



ZZ ui 
O O — I 

o o oo 

OO Z OO CO ^ 

S o S Z o 

313BI 



w a. " i- _ o. 

u z i z 

K ••< jO"J 

_i UJ O ^ Z UJ < 

—I Q. < ' K Q. ' 

« <oS3u<) 

CM •*> - X St <" 

Jg Ul< y Wu, 

2 o o S 5 o < 



— .^ ^ =: 
^ t < r 1 S 



CO o o 
i ^ > x 3: 
i £ — a_ a_ 

oj'iuiuj 

i afl <: H 3 






O O O O O 



rv iv r^. ob ob ob ob i 
O CD O O O O O I 



319 



i= * 



or or 
o o 

Z ZL 



z z 

o o 

S 2 

=3 => 

<t <* 

UJ LlJ 

CD CO 

O O 



O O 
O C3 



or or or or or or 

UJ UJ UJ UJ UJ LU 
(/}(/}(/} CO (O CA 



a. a. a. a. a. 



LU 4 

m o 



O O 

rr> m 

en o> 

o o 



ooomncn 
oooooo 



o o 
to ir> 
o o 



t *s •>* 

uj K K K 

X Uj J*J i*J 

« % < % 



3 O O O 



3£ * 



z z 



o o o 

3: x x 

Q_ Q_ Q_ 



O O O I 

o o o ! 



£> S> S> 



lis 



-j o_ Q_ Q_ 4 S «c 



M V) . H- 



O UJ o 

«* S « 

O I o 

«jf => «t 



— r~~ o 



2 O O O C3 



O O O CD O O 



o o o - 
nL r-L r-L ob 
oooo 



320 





Z 


u_ 


UJ 

o. 




X 






UJ 


Q 


Z 


z 


UJ 


< 


CK 


«/> 


^j 


UJ 


CO 


U 




z 
< 



•i * 



*T CO tf-> UO 



— < co 



< 5 



UJ CC Q~ CC QC 

ac uj =j uj uj 

^ GO GO CO GO 

^ or err cr cr 

Z UJ UJ UJ UJ 
O I- I- I- ~ 
JZ => 3 ;j --> 

VT. CL. Q_ Q_ Q_ 

uj E E E E 

=5 O O O O 
O O C_> O O 



o o o 

f^- OO CD 
O O CD 



ooooo 



T3 77. "* 



o a- i 

^2: 



GO GO OO 

«E GO GO GO 

O GO GO GO 

S <_> O O 



</> <t O o« 



2 ? ? £= 

* uj uj uj 

* g S S 

s sss 



P= f* P= 

UjUjUj 
go go Go 



2 o 



^ GO I 

I u. 



LS « 



— -3 -3 => - 

joo eoai< 
E £ E £ •" 



OC (JO UO OO CO < 



nt£ (DIO o 



321 



o o o o o 



o o o oo 



o o o I 

oqo 

O O ro 



' z o 2 z 
5 _j _ 2 
S£. S S o= 



«* « < 
lis 



I — * -J O —J — J 

i- s ? >- s 

<"o a: "> q 

|o<|o 

2(D.. E ffl 



UJ Q q, ^ UJ 



: oo 



"> <* s! s! £ £ ^ 

UJ U UJ LU U (^ UJ 

i >- >- cc oc o or 

Ll, UJ cc cc o 2 cc 
ZZ<<ID< 
O O O O Q_ «* O 



O O O 

zr zf zf 
o o o 






aQ.Q.Q.Q.UaHQ.Q.Q.a.Q. 



. CD O ^ ~ 



000000 



O ~^ ~ — ■ 



*£> r«^ r-» 00 






O OG O O O 



O O O O O 1 



0000 



— 

N. OO (71 

000 



OOOOOOOO' 



0000 
0000 



z 
c 

— 

£ 
c_ 


z 
3 




z 
c 

cc 

£ 
< 


z 

3 



<^> ** o <: «« 



* z tt •- z it *~ 

2 CD Z .5 QD Z 5 

_, £> :>- O <£ ;>- O 

? S z o 3 z o 

jc * u a: * uj a 

UJ — 1 x «< _i x «c 

ce <a.Ko.i 



UJ g JQ. 

z 0= ° z 5 3 Z £ 

^ or °£ — 5 CO _ . 

< ujQCq_^Z^uj 

•2 IsS^Simi 



= CD — — 



z uj Zj °3 ^ Hj 

5 lTj i±^ lAJ it^ ^ 

^ uj QO ^ CO CO 

S ^z2 z z 

Ij ^ ** a. ** ** ! 



1 a ^ S < < a S 



S cj S S o o cj 



O O O O 1 

r^ ^ ^ ^ ^! ^ 

1 CD CD CD CD CD CD 

k: 000000 



O— '00«- . o — ■ o < 



Zi OOOOOOOOOO 



<JD WD CD CD < 



'^f^OP0tj0r-.0-00 






o o o o o o 



■ o o I 
» o o o O O CD 1 



— 1 --. ._. « (Si 
1 CD CD CD CD 

0000 



322 



ec 


Z 


LL. 


UJ 

a. 


OO 


X 

UJ 


UJ 


O 


Z 


z 


UJ 
CO 


< 


DC 


«/> 


3 


UJ 


oo 


U 


vo 

a 


Z 

< 


LL- 


s 


CS 


o 



UJ < 



o o <=> 



o OO 
a-i 00 uS 

« <fi oo 



oo ~ co *i *h 



or or or or 

UJ UJ UJ UJ 

oo oo oo oo 

U UJ x X 

z: z a. o_ 

o o <t <: 

3: 3: or or 

o_ o_ o o 



o z 
,_ «* 

o >- 

5> 

5^ 
tc o 
2 uj £t 

— * en 



■*■ o a> 

GO UJ 

gS^UJ 
*? Q C3 O 

iujS > 

Soap: 

^ ^ Z3 UJ 
O S Q O 

=; o « 3= 



£3! 



—. *-, o 

r- oo on 



O O I 
O O i 



t-- a> oo 
o o o 

I I I 



^ 29 oo co 

uj I UJ uj 
Z O Z £C 



CM eg 
o o 



o o o o 



QQ _J UJ O 

« rrl z 
CO °° (±rf => 



S •*.*■* 



3 & s & 



<JtjO 




to <o <o 


* «: * 


III 


ooo 






1 ** •"* 


^- ^ ^. 


o= <k tfc 


kl Uj lg 


* % * 


5 5 5 




555 


So V^ 52 


<T> — 1 o 




O O O 



~ — . O 

ro ro CO 

f^ COOi 



o o o 






<=> — • o 
oo oo en 
o o o 



o 
_ or 

J" 0O GO O CD 

* UJ UJ o UJ 

* O O CO O 

o z z z 
-j or or ^J or 

* 35§5 

52 o o or o 



sr o o o o 






323 



mooonuicno- 



— <r> ^r o i 



o o o 

<r <f z ~ 

Q: Q: Z 






tA tA ^ ^ tA tA 5 "i" 

iU CD t," -»" CO CD ^ CD 

SSooEEoS 

33££33£3 

oo<:<too<co 
oooooooo 



: z oc 

"*0 

3: z 
o <t 

y - = 
O I— O 



— °Z ° g 



OOOOOOOOOOOOO 



oooooooo^ 
ooooooooo 



111 

— « t^l 

O O «X 

o o S 



o o o 

z" as «* 
ooz 

torn 



I/O O "' 

Q. «t _l 



o <g o 

o * o 
o o o 



uu - 
z z z 

=: = o 



oooooooo 



S z z z 

Z. — — Z. 

i CO OO GO " 

: ce «* «* ^ 



ceocococaccecececececeara: 



O.ZZZO.ZZZ 



3: < i 

to CQ OO 

<a < 



oooo«tooo«:oooo 
xxxiceixxcexiix 

0-0.0.0-00.0-0-00-0.0-0. 



=> S 5 o 3 => S 



OOOOOOOOOOOO' 



M- OOO 
i UJ^f ^ n OO 
i O CD O O O 



UJ 


r 


LU UJ 


£££££ 


pj 


pi pi 


d 










o 






CD 

[ 


cd 

t 


o o 


o o o o o 


CD 
1 


CD CD 

t 1 


CD 


o 


O 


O CD 


O O CD CD O 


CD 


CD CD 


CD 



s s s 

ooo 
or oc oc 



ce ce ce 
ooo 



z 

■ c 


z 
3 
c 
cc 


z 

c 
cc 


z 
3 
c 
cc 


1 

C 
cc 


1 

cc 


z 
C 

CC 


z 
3 
c 

Cc 


z 
3 

e 

cc 


z 
3 
c 

cr 


Z 

3 
c 

CC 


z 
3 
c 

CC 


z 
3 
c 

CC 


z 
3 
c 

CC 


z 
3 

c 

CC 


1 

C 


Z 

3 

c 

CC 


z 
o 



CO 

7 


o 

z 

CD 

3 


t— CO 


CO CO 


CO CO 


CD GO CO CD 


m 


CD 


CO CO CD 


CO 


CO ^ 


UJ 

z 

ce 


<*¥ 


o o 


o o 


UJ UJ UJ UJ 

o o o o 


o 


u 


OOO 


o 


?<* 



uj Z 
z ■< 

Si 

o- o 



UJ o Zj 
Z 1— uj 
o O I- 



is 

O o. 



<2o££ 

> O o ^ 

OUJ^ o 



X^ccccccoTQcaccecececececececcceX 

^§33333333333333332 

GO— ,0000000000000000— , 



O 08 

Z UJ 



QOocectujGOoceujo: 00 ' 
2 oe?t3c_>5ocoo5oo< 



► CD CD CD CD ' 



OOOO-OOO-0000 



tj ^ ._;._; ^ « ^ „ ^ ^ ^ !_^ ,_; ,_; 



ab en en 



<ooooooooaoooxoooooocoi 



OOOOOOOOOOi 



1 00 00 00 06 en 



0000000 



r-» r-* r-— r^ i^» co 00 00 06 < 
OOOOOOOOO' 



324 






3 3 

_l i— 

< O 

>- * 

QC LkJ 

LU O 

H 

<t o 

I— -J 

CO ^ 



: q- q- 
: => => 
: o o 



: Q- a. 
: e s 
: o o 
; o o 
: o a 
: z z 
: •* «* 
: o o 
: o o 



«2 x 

z •" 

LU Q 

z z 

uj << 

ce «/» 

=» u 

CD u 

<2 Z 

a < 

o 



: o o 

: «t <t 
z z 
! O o 
00 <* < oO <s> uj 



a: t— t— a- <c i— 



> <: <t 9- > 
~ P- ? a- r- 

z z :? i 



I ^-. o 

■ oo ai 

> o o 



_-. ^-. o 

f^ O0 0~> 



o o o o o 3 

O £ S O U LU 



l~~ OO 00 



O O O O O 



1 "* 1 

X Uj Cj Lu 

" * * 5 

* egg 

3 535 



UJ £ 



gjlggj 
* * * 

£: C; C 
So «o oj 



m * 



3 = <J o = = : 

< m q q m m 

52 zooffiss: 



O eg ~^ 

o o o 



■ O ro CO tO 



—. « o 
CO CO rr> 

ri ob CT> 



^- ^ o 

r-^ oo CT> 

O O O 



i ~^ uo <x> cm 






325 



— o O P-. 
CT> CD tO CT1 



= cr 



0:0:0:0:0:0:0:0:0:0:0:0:0:0:0: 

UJ UJUJUJUJUJLiJUUJUJUUUJUJUJ 
CO GOCOCOCOCOCOGOCOGOGOGOCOCOCO 



£- 



£2 



O LU 

¥2 <t 



OOOOOOOOOOOOOOO 

0.0.0.0-0-0-0-0.0.0.0.0.0.0-0. 



O OOOOOOOOOOOOO 



o o 
o o 



o o 
o o 



OOOOOOOOOOOOOOO 

t£> -Hl/HDICNNNNNNOOWNO) 

OOOOOOOOOOOOOOO 



» - 



= 52 



o o 

q o 



5 S 

o o 

ac cc 






ji3<jo8jj<<8a< 









<l «* O. «* 



S<OS<iiSOO<OS2 

im - t f> a: 1 - -co . 

o O «t «* ^ < 



l;;o)Ml«r r "z 



2 SocjEoZSoooo 



CD 


CD 


u. 


CO 


S 


P" 


,_; 


z 


< 


1 




« 


O 










X 


T 




X 


l_i 


O 







E 


£ 





s 



■^ ^ ^ 

UJ K. K. K» 

■* ^ 5 ^ 

^ ^5 Qj 05 



_ "-C cr. 






5 0000000000 — -^-^ — "CSJ 

ti (X>a>cT>csj<x>esjesjc^cs(toc>c>oc3^9- 

» CTi CT> CT> O — ■ CNJ CNI CM CM U"> to ^O tO <^ t© 



~ o o 



« ~CM«^CM«^«^CNJ«~.^--i-^ 



o O O -7 p --. . 



1 06 cr* cr* cr> en o> cr» 

I o o O O O O O 



3 OOO 



-^ p-i CD 
r-L 00 cf) 



326 



in o o oo ^ m o 



:Ss 



— o. 

«2 x 

uj O 

z z 

oo ^ 

3 Ili 

00. U 

«2 Z 

a < 

° O 



:£a:> 

, O QC 

. — I Li- uj 



o q: a: => => o h- 
a: <c «* o c/> z z 



ZZu _u.^<xO 

Soooo^oujct 



r-. oo cr> 
o o o 

I I I 



<=> <=> o 
r— oo CT> 

<=> <=> <=> 



o o o o 

N.N » oo 

o o o o 



MOOr-r^CMM 

to r*. r^ cm vd *» co i 
O O O O O O O 



Cfc ct Cfc 



o ° ^ 



CO X 

e 
• cj _ 



_i o — i o 



„ CD u. O U. 



^ 2 



2 s£ 



z o 

2£ 



O O «r 

<2 S2 i 

> > £ 

; q o z 

:uu<g 

:C ^z- 

_ Z X 

it c: s 



OZi <<, 
UJ 3< C/)(0 s. 
o_ c/i or o o x i 



5? — Lt t— 



ts> 



u_ o> en ai 0"> 



o o o o 



^ ^ o 
ro co ro 

r*. ob CT» 



>< ^_^^^^-.^_ ^_ 
141 OOOOOOOOrO 

*£ OOOOOOOOO 

e 

CNJcsifMCMrvirg^oo 

OOOOOOOOO 



327 






CO u_> u~> CO UO 

OtOOOIDO 

^ co r-! o oo 
O — ' oo r»- r- *r> r» 



: cc z z z uj 

DCto: □; or 



• K LJ UJ UJ Z 



a: cc cc 

: z o o o 

: <?. ?i tz. 

<t «t <t 

- -? «t o o 

_tj j¥ Q o a a 



«* o o <: 

ozzzzoooo 



; "* <■» 



| — o £ — 



! ° 
!z'o 



O z z o 



y o o I 

O O ' 



■ o <t 






UJ o 

ct => O 
= M CO 



: uj O 



<: < 

n- uj 

£ >- o= 

E uj o 
«: z * 

OOP 



uj a 

^ " ^ 

Z UJ Q_ 

CC O CO 



z S 

2o 



ce a. uj " 
<c «t _» o 
o o «t — 



. cc <-> <-> 

1 ;"• o 5 

io _= z z z 
i o o 

I O fc- O O O 



1 O O o o 

: S " S o o 



O O Z S : 



<t _n -C <* 

3ss3 

o o O o 

Q O O Q 

z 12 [2 z 
o |jj _i_ o 

O o o o 

i= ^ ^ ^ 

_c •« •< _i_ 

Issl 



0^0:1^0:0:0:0:0:0:0:0:0:0; 



Q.Q.a.Q.Q.Q.UQ.a.Q.Q.Q.Q.a.Q. 



CJiiflOMOCSIfOOOi 
-^—•CMOCOCMO — < 













*t OO t (N ID 
CM O CM CM — 


s 


CD 




CM CM 


U)r^iO»rv 

o o o o o 


o 


oo 

CD 

1 




<T> CX> 
O O 
1 1 


^CSJ^Tf ^ 


2 


o 


o 


CO en 
CM O 



— — OOOO— ' — 



oooooo oooo 



o o o o o 



ooooooooo 



q; O z 



5 2 



u • 



UJ CO 

o ; s 



SijivZS, 
9pcti!^z! 



cc J^ ° ce g 



co <: 



o o °- 
3- 3- £ 

Q_ Q_ O 



z 
c 

c 




-I 
C 

__ 




C 

> 
C 








a: o_ (— 
uj >- r - 



<■->__ — * O S c. ,_ 

g-Q^ Q c5 SS^Sc* 
.ezzcoujox*— -j-uj^^ 

O =3 O UJ 3; i_ < ^lOu. 

UJ CO CO Q I— W I- a_ t— >— CC CO 



3 co o • • S • o o ; 

ce coccuj)— : ?=; • cc cc j 

« o co t— CO 3C o ' QD m ^ 

uj 2uj<<y uJ «uujC| 

■^ wu<s? tll Ouu- 

K «o'~-'Ss— soo=c 

o Z °= z 5 z . or cc z 

u. OO£^C0Z_r_OO£ 

_" ?o°sSS_ooS 



• ">0 oB O 3 



* 

3 o 

« <6<c3 w 

2 co «t CO «t X 

2 ua.uiu 



^ < U< uCv 



<uiO-0 JOj 

c*J ^ ««" o <:" o «t o 

I^CO<CO<IO< 

CjSOQ.C3Q.OQ_ 



O = 

«t o 

CO « 

O Q. 



<j __; u_; u^ s_; , 



O O O O O I 
O O O CD O i 



> o o o o 



C- o o o o o o 



i^ i — ■ r-~ oo co cr> cr> co oi a. oi d oi 

OOOOC.CDOOOOOCOO 



-500 O - 78 - 22 



328 



O* CTi 0"» «7> U"> ^-" <— i r— O^ (0 



— Q. 

«2 x 

z m 

Lkl Q 

£ Z 

LU «< 



m U 

*2 Z 

o < 

° O 



o => 
<E O 

a. o 

UJ CE 

a: a. 



- t 



— ; O O O 



ci- en en en 



UJQ. t >>£L 
>• Q- ^ £E £T Q_ 

z do: uuj d 



0:0:0:0: 



OOOO; 
0000 



O =) ID Z3 => 

Q_ Q_ Q_ Q_ Q_ 

2 E E S E 
00000 
OOOOO 



r^. 00 cr> 
000 
I I I 



~- ~- o 
000 



o o 

OO C71 

o o 



000 — ' — — • 



.—.^-O^-tCSj^O — 



OOOOOOOO 



—. O 

o o 



CO CO 
CO CO 

*"~ fj CC £T 



c_> a: oc o o 



OOoOO°_iOOO 

o:a:<<^a:-<a:Q: 
Q-Q-mfD^^Q-^mQ-Q- 



* ^ S: 9= 

-J O Or O 



h- S 55 



13 



53 



o o 



*" O O O O ' 



_ _ J OO C71 CTi CT» 
OOOOOOOOOO 



329 





o 


o 






oo 








o 








■«*- 





I t£> OO O — • < 



O CM — — • I 



in OO in. Tf <jd «X> i 



o z 
Jo 



^ tH ce 
- J ioh 

DSC 
UIUJJ 

° z ^ 
gog 



O °. CM 

- UJ 00 



<NI {J CVJ c_j 
O Z = 

z £ z « 
< o < o 
z z z z 

CO >— to )— 
<: co «* to 



=± o- ; 
—1 o I 



o ce 
.°=£ 

) ^ O O i O O 



><=> 2 z o 

«: "- "J co ,_ 
£o£ = o 

I- £ jo -I ^ 

- ° -J 5 ^ _i 

0E Z <t o Q ^ 

S^ it s m 



or or ^5 a: =5 



00 g. ■ 



<-> (r OLU- ujO C0LtJ^-' 

^p£gSo<g££uj 



: => 3 u. => uj 

CO j5 O CO CC I 



CDZuXZ 

3 UJ J UJ Ld 
CO OC LU CO cr 






•a. cj — «I — -i 

;cr^e^Lu £ 

'<3r zit< 
> 5 a co o o 3 



= z 5 z 5 

U LU U UJ LU 

£ £ Z £ £ 
OO^-OO 

0:0: 0^ cn 
** «* z «t «t 
iiidii 
o o _j o o 
00000 

00000 
00000 



00000 

00000 
z z z z z 

x x x x x 

CO CO CO CO CO 



f- r-. 00 OO 
OOOO 



' o o — o 



O O O O 1 



CD O O O 



000000 0000000000000 



=iS$d 



533 



«* «s «t 

2 2 2 
OOO 



* CO ^ CD 

S 2 D= 2 



5 ce cc cc a; 






cq o ^mu. [2 



3 CO 



J2 =:»= o=;oi 



CD rf nr O -J q; 

JC Ui Uj JC 5 



o «* or o —J ce z , O — «t l_ , 1 
Q— T uj Q_ LiJ 1j_i *r ~ Q_ CO *r "— 






« 00000 

X cr cr cr cr cr 

UJ CD CD CD CD CO 



— O —■—"—■" CD 



t» r^ r*. r-* 1 



OOOO 



CM CM CM CM CM 



-*» o o > 

—. CM — • 1 

OOO' 



OlO v3N rv.rs 
1 00 C7> CT> O o*> CD 

OOOOOO 



NFS N NOO 

CD CD CD CD CD 



330 



—I UO O CsJ — I 



no oo no o 



OS ^ 

£ X 

z m 

lu a 

s z 

LU < 



cs U 

<2 Z 

o < 

o 



o o 



o o 



o: tcair a: 



en en en en en en en 

LlJ LkJ UJ UJ UJ UJ 
OO GO OO OO OO OO 



z z z z z ce z ; 

I O I 
I I I I X X I 



ooooooooooooo 



I — ( — 1—1 — 1 — <_^ 1 — > 

~ CD CD O O ro O ' 

O m m el (*> -^ en i 

CD CD O CD O O O I 



i CD CD O O O ' 



X X 

O O 

or a: 

CO CO 



! S rrl o .a 3 



: oo y 
III 



_i uj or i 

—I Q_ I 



< IlO II 

3 3<3] 



< u a: a. < i 






<C O jE DC O <t I 
1 - t— h- - OO I— 
i <c _D => <C UJ 3) 



^ ^c ^: 

a£ a= 3c 

Uj kiUj 



£ ? ? ? 

z Uj Uj Uj 

* c s £ 

«: V-J t-J ^H 



to V2 



-j ° 



S£ — oo a> o cm < 

5 O O O O O < 



„« ^- ^- o 



i eg o ^ fn 
. r^ ob ob ob l _ 
oooooooo 



3 O O O 

O 
UJ 

~* *-. O 

op CO CO 

fi. OO CT> 



331 



I O U> ii-> OO tjO ' 



CO *t o 

■ O m r- oo rv 



£ 5 



UJ O 

1 1 






o z i — 
^u-C^S 



o 5 o 
•«!=:<: 

>o> 

2C U " 2C 

. * cc * 

U- Q. U. 

< ° £ ° 

Z Z — I z 

UJ uj < u 

n= S ?■ S 
0= 9: q 9r 

o oo u. oo 



o o < 

o o o 
zzz 

•x i E 

CO Wft; 
<t ■< — 

o o g 



«* «: o 

1 ^ in; 

o o <3 



UJLUUJUJUJUJUJUJUJ 

cowwwcowwtoto 



oooooo<c«to 

0.0.0.0.0.0.000. 



„HOO'--' 



O O O O < 






r- o *r> 

U5 1DN 



O O O O O O 

I I I I I I 



— 'CMOOOOOOO 

ooooooooo 



lu : • : 

o : : 2 : : 

> : :° : 

o: : : 2 : ■ 

UJ ; ; £; ; o; 



c 


c 






o 



*Z 2 Z <t <XL Z 

°- o o °- Q- o 

S z z S S z 

O O- Q_ O O Q- 

<_p uj uj o qj UJ 

X LU LJ X I LJ 

Q_ t— t— Q_ CL. »— 

< OO < < u 



2*1 

5 3 = 

OB _j « 



Z Z O z z z z 

<c <t z «t «t «t «t 

x ^ z ^ ^ ^ ^ 

<<r< << < 

IlSlIII 
1 o o r; o o o o 

=> => Ltl => => => => 

to CD fy CD CD CD tP 



gjjog^ggoo 



to ° •* ■« 

er oc z z 



I o o ~ ~ o 



C3 Lj Ij ' 

UJ uj i_ 
rroDcot— ook->— o 
z-j^z^zz - 

««<C-«OoOoOOOoC 



« E °= « z _ 

£ **■ == z = ^ 

O ■ uj u _ < 

« O I I UJ «t 



2 «t => => 
2 388' 



■ OO 00 t— t— 00 

1 OO oo uj 

UJ uj x 

S S o 



° S 5 

UJ &g <=> 



x o o o ' 



O O O O CD O O < 



^ OOOOOOO — ' O 

^ CMCVJCSJOOO>«300- ' <JO 

* o o o o o — -csi^ru-> 
Z csicvjcsjCNjCNjcNjcsjcstcg 

-^•-^«— »csjc\io-^co—< 
r^fCt^r^N.obobobor) 
OOOOOOOOO 



332 



2 


u> 


o 


Z 


u. 


UJ 

a. 


CO 


X 


►— 


UJ 






UJ 


a 


3E 


z 


UJ 
CO 


< 


oe 


t/> 


=3 


UJ 


OO 


U 


CO 

a 


Z 
< 


LL- 


$ 


CS 






O Q O 
CO CO 

O «* O 



^^ — . CD 

r^oo o-> 



_-« ^H O 

m ro m 

r^ Wffi 



OOO 
f^ OO CO 
OOO 



° ?: i* i* 

K Uj Uj Uj 

< S 5 5 



» OO o 



^ ^ ^ 

* * * 

O CJ tj 

Uj kj kj 



1 •<* "* 

i- i. i- 

fc ft fte 

O Q> C 

fc c C: 

5 5 15 

¥> ^2 ¥> 



« 1 g 

* Is 

UJ » 



; o|o 

* oe z oe 

o o_ — O- 

P jC - ac 

m ex ** <x 

uj o; c/> «t 

K Q_ C_? CL. 



u. a> ~- o> 



O u2 OO <X> 



CJ (-. r-- r- 



£ o o< 



— ~ o 
r^ ob cr> 



333 



0000(C-«MO 



~^ O CO O i — ' O O i — • O OO O HD r^ 



OOIOOO 



m a oi/i M 



ex ex ex cc 



o o o o o o: 



Z > 5 <" tx >• =» 
=> S 5 z 5 < < 
99^ 5 £o£2E: 

Qir -i^uao: 1 

3~ r 

00 o 



o o o o ^ 

z z z Z = 

C/> c/5 00 GO ^ 

o o o o S 

o o o c_> £5 

a o o o _ 



o o o o - 



ixixfxixixixixixcxixixfxfraeacceixcca: 

GOGOOOGOOOOOOOGOC/OCvOOOOOOOOOCvOOOCOCyOC/O 

zzzzzzzzzzzzzzzzzzz 

ooooooooooooooooooo 
xxxxxxxxxxxxxxxxxxx 

0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0. 



'iSoSod 



-in "fn-moi 



O O O CD O ' 






iOOO- 

oo lt-j oo oo oo cr, 
i O O CD O O O 



— o o — 

CD CD CD CD 



CD CD CD — « — 



00---00 oo — ~— — — • — — — . — 
n nm o o n n nrnpiroroncimnmn 
ic io in in m ^J to «3(X>r^r^r«-r«-r"*r^i — ao oo 

o o ooo oo ooooooooooo 

rir-lpi.riri.riri lllll 

ooooooooooooooooooo 
ooooooooooooooooooo 



or or or - a: 7 o: a: 7 a o= 

— — — : _ _ : — i _ l~ uj 

Zi ^. ^. !Z°ZZ°ZZ 



ooo 

a. o_ o_ 



o o o :± 



o o o o 

H t -i <: 

°S E S 

"J o o o 



=2 " : £ 



a. S a. a. ^ 

o o S S o o > 



Q O O O LtJ O — 



UJ ZrJcJOZtJ^OO^OO 

o "o:o:o:"o:So:o:£o:ir 

* JH => =3 => £ => P, => => P, = = 

< ^mCDCDgCD u CDCJO u a]CD 

§ uj S S S lu S °S 5 °5 S 

^ ^Gcota^^otc^atfxatfxcx 

* 53333 3S33S33 

J2 Zoocj>So:xooxc_>o 

M 

,< o ~ ~- o o o — « ooooo 



CE UJ q_ UJ UJ -= 

UJ V> ^ & <LD ^ 

CD cc ^ a: cc - 

z => g=> => s 

UJ CD '-' CD CO „ 

o 9= S 9= ge g 



oooozooozz 

! i a. o_ o_ i 



o o o o 
o. a. o. : 

<C oO a0 o0 



«E O 



o 



o o ^ 



—J ^ O — IUUU ^ — lUlltl^^DuJUJUJ (O* - 

— o5 <Q - Q - Q -o <; o-o-oo < o-Q-o- << o 

•« -Oa:<<<-Q;<<^^o<<<a:o^ 

* -<couj^^^<:ujxx^^c^xxi:uj^o^ 

s 0-oooooq-cjc_50q-q_oocj>ooc30_ 



— CD O O I 



w OOO 



o o o o 



« ~ CNJ CNJ ~- ~. — .CM 

— ^-CSJCSI — -. — CNJ' 






ooooooooo* 



o o o o o 



OOOO^CNJOO-*— ■ « CNj CN CNl CN ' 
r^ r-^ r--% ^. r-. r-^ oo ooooaooocr>cncncn 
OOOOOOOOOOOOOOO 1 



334 



o o> I —• 



a~> o * 

O O ' 



8 g 
£ - 



? 

LU Q 

3E Z 



cc cc cc 

LU UJ LkJ 

CO to CO 

a: a: a: 



CD co 

3UJ CO 
Q- LU 

S; > Cj 
o z > 



< co m 

U 55 



a, u 
«2 z 
a < 



Z CO o 

cc u-> en 

Q_ — ' CM 

O r^ co 

m rvj m 

o o o 

I I I 



ooo 
ir> r-~ oo 
ooo 



<■> * * * 

* |£S 

3 o o o 



9= 8 s 8= 



555 

Co CO CO 



^ CD CD CD 

* CO CO CO 

e z z z 

3 ooo 



S cc cc cc 
S ooo 

- iii 

g 555 



£ Z Z 2 
5 ooo 



o o o 



=D OOO 

a 

— . ^-. o 

pt ob CT> 
OOO 



335 



cc ac 

Q O 

z z 



O I— "- o 

O Z o o 
O "J o o 



: cc z 



!~ ; «* — i 

°= a: . 

°° O o 

r^ => o 

^ o £ 



o o o 
o o o 



o o o 
o o o 



Q; CC CCCCCtCECCCCCCCCCCCCCC 
UJUJ UUUJUJLUUUUJUJUJUJ 
OO C/3 O0O0C/0O0OOO0COO0O0COGO 
LULU UJnruJLUUJUJUJUJUJX^: 
ZZZZZZO-O- 



q_ a. a. o o_ . 



Q_ u_ Q. Q_ CL. O O 









OO O O O O O « 



o o 
o o 



O O O O I 



CD O O O 





o o 




















o o 


« 










«t «t 




cc cc 










cc 




u 


o ~ 










o 


lO (X> 



^ it £ : 

a: cci i 
^ => => z : 

" CC CD < 

5 ££^! 

» LkJ UJ OO I 

O CD CD <C i 

3 CC CCS 

^ UJ UJ i 



gj SSz-g 



cc cc cc 

cc cc cc 

cc cc cc 

III 



a- o o 
2 3: i 
o Q. o. 

QUU 

JIUU1 

O a. i- >- 
<2 2 ° ° 

O jOO 

uj uj S Jr 
Shoo 

o — J z z 

5 UJ CO ^ Z UJ UJ 
* 2C u- 3 C C 

"*i CC o z '"' 

_ uj <: cc _ 

<X. ZJZ O UJ <c 

D < " w 

o 5 c_> 



: o o o_ o_ 



-j a.ui < q:q. 

CO I— 

UJ ID 

^ o 



UJICOCCOOZZ 

q.uj<uj<<ccci: 
oidtoxooujuj 

UJ ZD <jf Z3 «xf «sf CO CO 

^oooocototjJiJJ 
c_>c/iogoc3o53 



t •■* "* 

Z kj Uj Lo 

« ? 5 $ 

* S £ £ 

4 Uj kj ^ 



O — I OO I 



<j £j ^ ^ ^ 



OOOCvj----.--.~-.cnji 
r~- r*- f» r-» ff) Ol d ff) oi 
OOOOOOOOO' 



_ — , o 

co CO CO 

r^. ob en 



336 



o o o o 



u~> en lO CD 



ll_ O 
_- O 



ce 


Z 


u_ 


UJ 

a. 


»— 


X 

UJ 






LU 


O 


Z 


z 


UJ 


< 


tr 


«/) 


=3 


UJ 


CO 


U 




z 
< 


u_ 


$ 


o 


o 



LU < 



S •* 2 o 

ES Eg 

1 >- - 1 - o? 



— . o ~~ — 

r^O>oo » 

o o o o 



o o o 
o o o 



o o o 

O O CD 



^. ce ce 



ai u_i a: en 

a- o q; uj 

«t z <t o 

u_ *t u- Q 



* "sz; 



crwao 



3 J2 uj uj 

lT -^ CO CO 

5 o o 
uj < £ £ 



u- O ~-> O ' 



p ~ o o 
oooo 



337 



OO — ' CM O ( 



Q-«OOM 






o o 

ob csi 

CJO r-. 



0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0:0: 0:0:0:0: 

CO CO OO C/5 C/D COCOCOC/JCOCOCOCOCOCOCOCOOOCOOO OOCOCOC/5 

UJUUUJUJUJUJUUJUUJUJUJUJUJUUUJUU UJ I I I 

zzzzz zzzzzzzzzzzzzzzzo.0.0. 

00000000000000000000 o <: -x <t 

iiiiiiiiiiii^ixx^^ih 3:0:0:0: 

0.0-0-0.0-0.0.0.0.0.0-0.0.0-0.0.0.0.0.0. 0.000 



00000 



OOOOOOOOOO 



I I I I I 



000 O — ' — • o 



I I I I I I 



r- cjo a> 



00000000000000000000 0000 
00000000000000000000 0000 



i 3 

3 o 



o o 



>* a. o 



a; ^ 5 

S 3 g s 3 «f 

2 z o a. z o 



: >• o= 
: z u 
: «* 00 



°- °- °- 2 1 
i 1 ijj !jj o 1 

UUUJUU; 

z o cj o z ' 

CD ^ «t ^ CD ' 

x 2 2 2 x 

Q- O O O Q- 

000—1 



"X O uj 

<r ** o 

UJ **- <: x: ; 



00 



ujg 

> F, z 



2 2 s 2 

2 o o o 



il! •£; a: a: (t 



« «t •« 

0-0-0- 

<t «i «: 

www 



iXOQ. 

: o z 

i„5 



3 "* a 

a: !±! lu 
<|u 
>- ° z 
uj x 5 

oc a. — 



.5 

O o 

o z 

OO-OZOOOZd-ZOOi 



UJ — o UJ — 



o °. e 2 

z z z z 

<DDD 

(J z z z 

z cc Q: q: 



3 3 I «t ! 



<-> <o <o 

Uj Uj Uj 



ill 

000 



* S= S= 9= 
3 ^ ^ ^ 



t •«* 1 

^ - - — 

Q> Q> O 



<zs v> z & ^ & 



5£ cOf^oocr>o~cNico^CNjcou^ — cvjco*3-iricor^o->^cDco*s- 
z -««-.-ipgCsiC\jCM(\l(t1POP^OOOOOOOO'-"OfOrO 
3 OOOOOOOOOOOOCNC\N(NM(NCM(M(MOOO 

J*J ^.-_ — — ,_^-,__^,CN,eNIC\J— • — « ~- — . ~- . « — .~CNI<NieNl 

UJ 

^— ^^«— i^^^^ ^_ ^^ ^^ ^^ pr^ (V) ro (O (O CD CO CD CO CD CO CD I"-. f-» r*-. 
000000000— " — .— 1--«---^-.«.-.«-^.— ,.— 1 __^_ 
r*- r«* r-«. r-» r-^ r^r^r-^r-^o^oo cr> cr> CD en cr> en cr> ffi cr> o"> cr> ch 
OOOOOOOOOOOOOOOOOOOO O O O O 



000 

— . r- CO 

1^. OO C7) 

000 



—. ~. o 
°? °? °? 

r-L 00 <T> 



338 



CTiOOOOOOlOOOOO 



° 3* 

lu Q 

z z 

LU ^ 



<2 Z 
a < 

o o 



: o o 
ilo 



iSS c z z = D 
. "> °r ;= ;= rz a. 
a. = 



; a. o o o 



ojEir- 



— co 

ce ai or ,,, u. u. u_ 

>< o o o 

CD CD 

i => Z2 

ooocococoooxcococo 



o »- s: 

Huju. _ 

u- Z O :=> = 3 I 



o ~ 
ro ro 
to I — 

o o 



-OOP^- 



OOOOOOOO' 



^Hrt Oco^- i 



oooooooo 



oe 3 



< s: 1- > > 

J~o:oddj J<z 



§1 

a s 

LU u- ° 5 fS o 

5 UJ LU .« 



! C/O o 



LU CD 



O V — 00 JV. Q_ 

O O t UJ o «* 

O O O Z -J >■ 



ov o o o < 

u< O O O I 



— • — ■< o o o — — — ~-» 



O O O O CNI ( 

Csi CNJ Cst —+ CNI i 

ri. r-L r^. ob ob i 

O O O O O ' 



OOOOC^OOOOO 



339 



ooooooo o 

^ tfS <X> l"-- <X> ^" OO u-> 

o 1*^0 o o u> n o 

^ co *r ^ ^r *c "J"> cm 






O --< M r>. «> o ' 



i — <«»■ i^. O O I 






COO^D ^ OO 



a: ce en cr. ca cr. cr ^ 

O => ZD O O O O g 

UJ UJ LkJ UJ UJ UJ LU 5 

0:0:0:0:0:0:0: O 

OOOOOOO ^j 

ZZZZZZZ <L 

«£ «£ ^ < «t «s < _, 
«t <s «* <c ** *s <: ljj 
OOOOOOO > 

00 co to co to" V) w °f 

<J <i2 O <^D Z3 <J <^ 

z z z z z z z 

«t ^ < "* ^ <t <£ 
CO CO CO to CO CO CO 
OOOOOOO 

OOOOOOO 



0:0:0:0:0:0:0:0:0: 



10:0:0:0:0:0:0:0:0:0:0:0:0: 



OOOOOOO 



CO to CO CO CO CO CO 

<t <: «t «* «* <: <c 



zzzzz zzo_zo:o:zzq_zzzzzzzzzq_ 

00000 00^00000^000000000^ 
111113=3:0:3:, Tittiiiniliia: 

0.0.0.0.0- O.O.OQ_^30_0-OQ_Q-0_0.0.0_Q_a.Q_0 

^^^^y^^y^o^aa^^j^^jijj^jlii^ijitjlljitj 





2 ^s 





— — ■ 


O O O 

1 1 1 






1 1 1 




<JD O CM 
— CO CM 


2 


in <u 01 
O — O 


<£> <x> r* 


00 


ao <r> &> 



po ro co O 



OOOO 



UD <JZ> <X) <~0 ■ 



NNCOrs.si 



00 00 00 00 00 



iOOOOOOOOO 



OOOOOOO 



• O O O O O 1 

00000 0000000000000000000 



(^ _ _ _- 

u 0: a: a: • a: a: o: 

as o :=> o ^ o o o 

v CD CD CO q CO CO CO 

C*J CO CO CO S CO CO CO 

* — 

* U LD UJ CO UJ UJ UJ 





> 


c 
t_ 

u- 
Z 

c 

Q. 


C! 

2 






Z 
< 
Q. 

2 

C 


>_ 



5 H 9 z 5 ?: 5 



>- >- >■ 



>■ o o o o o - 



2 — 

o £ 



Oo^>->>-0>00> 



CJ O S LU 



t— z: >— 1— o ; 



Q.UQ.UU' 



O «>0 ** ** ** 



OO' 

3= 3= : 

O. Q_ 



=* y 5 y 5fc ' 



Ik O O O > O O O 

**i >->->- o >->- >- 



^u^u^^Q-tjcco-^^^tj^otj^tt: 

0^u^uu<^uj<OOO^O^^Ouj 



«* <of / 'o! 



■£ < CO < I CO CO < 

H o_ o o_ o o -" 



cu^C^^CO^OO** 00 , 

oo_5q_SSoo_Sooooo-oo_q_oS 



000000 

NiOO*--h 






»n -. O f^- CM o o 
O O CO O O CD O 



o o p O 1 

0000 



o o ~ 1 

CM CNI CM 1 

000 



CM CM O CO CO < 

rv r^. obcbooi 
O O O CD CD I 



0000 



340 





Z 


Ll_ 


UJ 

Q. 


t<o 


x 


t— 


UJ 






UJ 


a 


z 


z 


UJ 


< 


ac 


t/> 


=5 


UJ 


OQ 


U 




Z 
< 


U_ 


£ 


o 


o 



f UJ 77, 
E or "jo; 

=! 2i- ° 

S o i- or 

§§Sg 

°- °. o Zi 



O CD 

— o 



<£> r^ (JD CO 



•* % % % 

* S £ S 



P= ?= P= 

c is c 
^ :? 5: 



S I 

t/J -J uj UJ UJ uj 

UJ ^ C3 O O O 

O — or a: a; or 

00 « or or or or 

q» — a o o a 

^ 5 >>•>>■ 

J£ * OOOO 



O UJ 



,- ^ er> 

0|) cr> CO 

r^. 00 O) 



341 



o o 

O "*T 
ID <£> 









UUJUJUiUJUJUJIlJUl 



5 o= 



5t 



Q. Q. Q. H CL Q. C 



O O O O O CD 



OO <7> 
O O 

I I 



ooooooooo 



Cj <J CO 
Cfe t Cc 

5 3 S 



i co : cj o 
;=■ : «t <t 

i ° j o o 

ig-££ 



OO jDj 



cc a: 

=> => 

CD CD 

cc ac 



3 UJ — ^ UJ UJ ; 
* 2C "- *T 2C 5C ' 

S 2d"<< ( 



5 I co o 3: 3: 
S o o co cj o 



< = <t = 
co o co o 



1 t ^ 

UJ ^ K_ K_ 

* sis 
2 ^ a s 

3 CJ CS <2> 

« kj W Cu 



*< 'S t 

i- ^ ^ 

s= s= a= 
III 

£> S> S> 



W 2 uuj 

2; z 2 Z 

S o «* <: 

GO C Q= ^ 

_, < cc a: 



ooooooo— ■ ~- 

CX> O O — • *i"> iTi in %£> ^O 



3 (£)(£(£> 



iC OO M U5 r, ■ 



' ^ M ~T T ' 
o o < 



« ^ O 
r-L CO CT> 

ooo 



342 



© © — ' ^ O ' 



^ CO r*. 

r^ no co 

oo — < oo 



— Ui 

° ? 

= s 

g 2 

LU Q 

* z 

UJ < 



«2 Z 
o < 

© o 



-31 

t— uj . 

"LU CO 

o o. >■ 
_ < cr 
— o o 



— > o o 

co co co 

^ CO CT> 

CD O O 

I I I 



z — >■ 

<=. <c a- 
z ^ o 

LU * 2 

t »S o 

I— =3 Z 
CO «t «t 

lis 

UJ LU O 

OO CO eg 



-< inoo 

o oo 

LO I"- OO 

CD O O 

I I I 



LU UJ LU 

cc ac a: 

o o o 

z z z 

< <t < 

O O z 



acccz 

= 3 => «t 

LU LU UJ O 

ceceir s 

O Q O - 

= ^ = B 

« < < LU 

O O O Q 

co" oo" co" 9= 



CO 



00 |233 I 



o o c_> o o o o 
o Q a o a a a 

z" z" z" z" z" z" z" 

o o o o o o o 

t— t— I— t— >— I— t— 

C_o CO CO O CO CO CO 

zzzzzzz 

IIIIIII 

CO CO CO CO CO CO CO 
«t «t «t <t <£ «t «t 

S S S S 5 S 5 



id cm m r> o -h ^ 

— < CM — ■ CM — < O CM 



o o o o o o o 

IIIIIII 



BC CC CE CC 
LU LU LU LU 
CO CO CO oo 



o o o o 

X X X X 

a. a. a. a- 



o o o o 



O CO CD 

ooo 



i •»* — • CM CO CM — < 

' uo co co co ir> oo 



or o o 

S co CO 

»a o o 

CO LU LU 



o — ' 

at =» '- - 



O <C <t 



i CO CD CO 






Of oooooocc 
cocococooocoo. 

Z o: a; cc a: oc b: o 

J" =) = 3=3=>=>oO 
X 00 CO CQ CD CD CO 

ac a o o. o a o «x 



UJ QO CO CO CO CO CO 2 



ooo 

XXX 

o- a- a. 



< 4 

z s 
o o : 

o o ! 



Z Z Z J 



1 22s| 

3 dduS 

* <: < -« x 

... WCOWH 

" LU LU LU =3 

X X X x o 

2 o o o co 






** ooo 



0"> O 
— < CO 

OO OG 



u ^ a 



oo oo oo oo oo oo cr> 

o o o o o o o 



i£U)(CO 



O O O O 



343 



ix> ^ oo u: a 1 



o 2 



p * 



cc a: a: q: o: 

CO CO CO CO CO 



o o o o 

1 I I X I 
Q_ Q_ Q_ Q_ Q_ 



O — « O — • O 
tO U"> tD f-» to 

ooooo 



o 

— I UJ O _i 

UJ £t Q O 



, o co z 

i X o o 

O.Q.O 



o o o o o 
o o o o o 



^ O CM < 

O O O l 



O O 

O O 



; o o 

: x x 



uj uj uj lu ^r 

CD CD CD CC J? 



co co co co ;? 

UJ UJ UJ UJ , . i 

s s s s at 



o o o o I 



OS ~ O ~ 



t ^ ^ 

u is? 

* £ £ £ 
^ O Q Q 



•"* ** '"t 

^ ^ ^ 

fc fc fc 



= o = => 
o H o o 



00 * g 



tJ a: u a a 



o : 



o o 



W oonrs.» 
z o O o o 



3 O O O 



0(D(£lCO 

rn <—■ --. -. < Csi 

o o o o o 



oo oo 



oooo 



96-500 O - 78 - 23 



344 



—> — > at o 



OU)K OPN 



o o o o o o 
u-> o u-> o o o 



OOOOU)IDOO«N-h« 



° ^ 

ui Q 

z z 

uj <; 



CO O 

«2 Z 

a < 

o 



:o ^ 

: i2 u_ ■ ;= 

: oo or a: 75 

: £ z 5 u 
: o z 

^ X Z O <C 

. uj o ce 

:^£-^ 
-. t o z 

iff uj a: or , 

UJZO 

*>■ = = 



_ 



a: e; uj o 4i 

o to u- z 

X O Q. S±! O- 

O o X — I UJ 

CD o UJ Q_ — ' 

u. "- z °" ¥ 

° o P. 3 * 



u 03i90 
CC _l _l O X ' 



2j3«z 
51*1 

|E < « * 

— «£ LU CD 

°- See = ,0. 1 

00 - «t or 1— => I 
or o o ** z co ' 

■= O 0C O CC Lr~ i 



Uj = ui 

Z " 2 
< O <x 



OOO 

o o o 



£2 uj — — — — 



or z or or cc ce 

u. < u. u. u. u. 

Z CO z z z z 

«* O «* «* «* <* 
CO I CO CO CO CO 

000000 

000000 
o o o o o o 

z" z" z" z" z' z" 



o _, «t 



o o 
o o 



000 

OOO 



usm r^ ic iv 
O O O O O 



OOMOO-Ortr^o 

0000000000 



x x x x x x 

CO CO CO 00 CO CO 



0000 ' 

1 ' i-i ri rv , 

— CM CT> «— • CO 1 
O O CM CO O ; 

r-v iv rs rv 00 1 
O O O CD O I 



ce ce ce ce 

CO CO CO CO 

UJ UJ UJ z 

z z z o. 

O O O «t 
X X X cc 
0.0.0.0 



OOOO 



0000 
u-> «■> « in 

OOOO 



UJ z z 
"j C; o o S 



, E= z z 5 z 



X 5 cc cc i 

S £=•=>- 

* cococoo 

2 £^§E 

« co x x ;*" ce 

to 3O g g o 



o o ] 
ce or 



; ° = cc « cc < 






M Jo 

oc z z z ^ JS z 

co S^g" 1 ^ 

X 2 ce or * ^ or 

UJ «33U D 

3E «t co co z co 

cc t-J-gSJ 

u. oc 1 x ?e z 1 

"j 3°9o«5 



o ~ 

!z p£ 



* =52 = 

S o^2z 
— 1 <oo.ee 

« Or<w 
... - — CO H- 

« S 3 x uj 

O UO.U J 



— 1 CD O O O 



OOO o — 



55 00 en en cm 

5 OOOO 

— * ix> up en co 

X en en cr> 



0000000000 



u ~ ~ k _ 



00000 



i/ii/iNooicnnino 
0000000000 



— ~ <£> -h 



o o o o o o 



345 



oooooo-^^— < o — • I 



o o o 

<T> ID (J3 

oorv f^ 



ocee 

[ ^ tO GO GO GO GO GO 

" 2 Z Z Z Z Z 



cc cc en en en en en 

GO GO GO GO GO GO GO 



GO GO GO 

o-ZzcccEcEGerraezzzzzzz 



— en en en en en en . _ 
<:ooc3<jcjc3CJc>ooooooo 

C3a.Q.y^yy5^Q.a.a.a.a.Q.o. 

t ^i t ^l^i0QCOCOCOCO0O L '_i L H L H L H LA i > *'H Lx i 

LU UJ UJ ^ < ^ <<<LUUJUJUUJLJUJ 
t— I— I— OOOOOOl— I— (—1— ►— I— t— 



O O CO PO PO PO ro PO PO 



OOOOOOOOO 



oooooooooo 



O O O 

o o o 



o o 
o o 



^ Z X *z z 

<t •« «t «t «t «t 

Q_ 0- Q_ Q_ Q_ Q_ 

: Z Z Z Z Z Z 

: o o o o o o 

o o o o o u 



a.a_a.a.a_a_oo 

«r<r,<I<t<t<t — — 

en en an en en i2 :2 



«t <c <c 
: Z Z Z 

■ o o o 

O O Q_ Q_ Q_ 



O « 



i222222SS 



Z^^JZZZZZZ=:p=^"JujLLjLU 

= u -.d = = = = = = u -. u -.dE!*5^ 

ZO>— ZZZZZZOO 1- •— luSllJ 
UO—UJUJIUUJIUUJOO— — <<< 
GO rf" ^ GO GO GO GO GO GO rf* rf c3 CJ l*J t*J HJ 

Si|GO«tiJyJiiJii|ii!!iJGOGoS<iii 



tit 

UJ ^ ^ >-. 

Si??? 



o>r*nn^in^oooiooaio-«fO« 
— oooooooooooo — — « 

oooooooooroofncunujia 



^ ^ ^ 

i^. i^ x. 

B= S= 5= 

C: C; C; 
5 5 S 
^i ^ *G 



< (X) <x? <x> 






£ » 



« Cnj CNJ rv rx rs. rvr^rs-oOOOnOO 
OOOOOOOOOOOOOOOO 



3 OOO 

a 

UJ 

— . — o 

f^- ao ct> 
ooo 



— « o 
rd ob CT» 



346 



OO«0 <£>i 






r*. uf> «* Csi •— ' 



O O 



"■ s 

«2 x 

uj Q 

z z 

MJ < 



m U 

*2 Z 

o < 

o 



£: 3 s 
£ 5. " 

£o5 

o o — 



z z 

<t <t 

CO CO 

o o 

o o 

z" z" 

o o 



I— I— I— CJ ►- I— I 



— < — . ~ o oo o ~ ~ 



in it m ^ (Ci£ 



o o o o 



o o ~- 
ooo 



o o 
o o 



oooooo oo 



CO O O CO 

— <: <r — 
O o < 

^5! 



o2 >> 



I Si 



r? o 

a <<* 

* «■ Si 

Sa'Si 

—J < Q. 

« O Si 

«2 < uj i 
S co z : 
2 o o i 



o8< o«B << 



CO UJ 

UJ z 



2 HI 



o oo 






= O O O 



OO-H 

o o o 



OOOOfsI-^CsJ 
OOOOOOOO 



347 



ooo 

UO OO Csj 

u? rr> u-> 



O OO M IN ^ CT> O 






ill 

: o S 
: 5 co 






: cc o 



O 2C 

5§ 



o o 
o o 
o o 



5 tr o 

-* o <r 



a: 5 



5x>- 
z i? - 
3£S 



i§° 

uj uj <: o uj ^ 

< < 1 1 < 3 o ; 
ssssz£:3r 



5^£ 



• (O (O r-» 



ooooo 



O OO o 



ooooooooooo 



^ ^ ^ 

^ X. X. 

a o <5> 
C: c c; 
5 5 15 
So to to 



Zi 2 2 

S °= <•= 

CO o o 

—I " o o 



s * 



S oS 

I 53 

< lOlO 

= o o 



ooo 
www 
> > > 
ooo 

ooo 
z z z 
«x <t <t 



ooo 

« ««f «£ 
OO CO 00 

ooo 



; o pi 



UJ Q-^ooSoo^coaD 
« ^O-J^-IO-J-j 






<C , LU o 2 

y £ 5 ^ * 

_ 3 ° 5 £ q 



o cc o g o O 



1 < «* 3 S2 ** 



o. 3 a: ^j o 

cc 3: o i 2 



O f» o o 



£ CD 0)0 
£ OOO 



« ^_ o 
fnnn 
fi. ob cj) 



_ OOOOOOOOOOOOO 

o 

mtnioiDvooomm^uio^ 
oooo«cnj« « -., ^ _ „« _^ 

ooooooooooooo 



348 



CD O CD O ■ 



iOOOO OOi 



00 oo 00 OO B f* oo po 06 r-* 00 00 



^ 

g 2 

uj Q 

3E Z 

UJ rf 



£ Z 

o < 

o 



^ o 



0:0:0:0: o: 

33333 



z z z z z 



a: a: a: a: a: a: 



> > o 3» > o => 



>o>>>>o>> 



o o t: o 
z z o z 
«t <: 2 < 
00^0 
0:0:3:0: 
o o •« o 

H- t- S (- 

o o 



:*: :*: cd ^ ^ ^: 



o a; o o o 1 



; :*: se sc ae 
0000 



000—0000 



cc _i cc; cc ex. 
OOOOO 



o iti y t- a: t ; 

<C — — «* <£ t ■ 

a: Z Z o o o : 



z z 
a! a! 



> >■ 
k a: 



o o 



00000 
000000 



2 < < < < 
— 0000 
3: a: a: Be o: 

< o o o o 
s i-h- h-i- 
,-,0000 
i= o o o o 



o o 

o z z 

|oo 

s^ 

«s o o 
r-, OO 



o o 
o o 



3: 3: z x 3: 3: 3: 
CO c/> «t 00 00 OO CO 

<i «t <; <t <r <t 



^"0000 

Sjj o o o o 

o ^ 5 ^ z 

Z 31 3: I X 

< CO to cot/) 

o <: <: < «* 

o: S S S S 



i" o o 

z x x 

< C/)CO 

"" o: 5 5 






o o o o — 

I I I I I 






o ooooo< 



§ 


f^ 


§ 


OO ~^ IT) 


02/77 
23/77 
01/77 
01/77 


^ 00 




<NI OO 







1 1 


O 

1 


O O CD 

1 1 1 


OO OO OO OO 
O CD O O 

fill 


00 00 


1 1 




en en 

CD CD 

1 1 




r— ro 






u*i en cm en — « 


en 00 


^ 


en to 


<x> 


CO CO 


(X> 


r- r-~ 1^ 


»KOONN 


00 00 


en 


en en 



OOOO' 



iQOOOOOOOOO 



c 


z 
< 

CI 

5 
*~ 

V 

a. 

> 
z 




cc 


en 


cc 



ctctctccctccctactcct 



-J aO>>>' 

LU uj O CC OC Lu ' 



f- a: r! zi d d 



Qg ' ' ' I —> —J ' ' ' ' _ 

■ ■ 1 CQCDCOCDCOCOCQCOCDCD ~ 



3 3 3 3 z : Z 
O O- 

d " S 



— ^OOOO 

_ _' , ;2 <t «t «i •* 

9t d3 E uuu 



O H ^ 3 «t ^ O 



: z x x o Z Z Z 



OOOOOOOOOO^uJ 
QC _J—1— !_!_*— *_J— I— J— *Z — 

u_ OOOOOOOCJCJOCOg 






OlC l^-HI 



1 m ^ ^r to 
1 — ■ ~* « CD 
1 cd to to m 



O OOOOOOOOOOOO 
-J eNicMtocsfcsjcNi^-LTJtninoocD 
J CDCDCDCNics*csicsjmfnu->^r>to 



OO r*. 00^ 
po ^- 00 00 — * 
O CD O O O 



to to to to I 



oooooocncncncncncncncn 

00000000000 



o -^ — « — • ^^ < 



OOOOOOOOI 



1 00 00 en en en en < 



00000000 



349 



• o o> o o • 



tr> cr> o — ■ ' 



P ? 



q:q:q:q:q:q:q:q:q:o£o:q:q:q:q:q:q: 

CO CrtWWWCOWMWVJWCOWt/JWOOW 

©ooooooooooooooo-* 

HQ.Q.£LClQ.ClQ.Q.Q.Q.Q.Q-ClQ.lLO 

t— t— I— *— t— t— ►— H- I— I— t— I— t— ►— t— I— h— 

— OOOO — — ^— ^^^^^«~~ 

iT> iCifl<i)tf)Nrsrsrsrvrv0OCO0O0O«0O 
O OOOOOOOOOOOOOOOO 

I I I I I I I I I I I I I I I I I 

ooooooooooooooooo 
o oooooooooooooooo 



















ooo 


ooo 


ri r-L r»L 


r-L r-L r-L 






















r- 00 CT> 




OOO 


OOO 



o o 

: a. a. 



—i : • o ■ 

uz • cr ' 
»- O >- o ' 
U»Z0Q| 

5 z o 2 

£ S ^9 

2 2 q ^ "■ 

_j a. «c H z 

■« <o"o 

*£ lij «c a. ^ 

** z »4^ 

S o u c_> o 



o o >- o o o o 



O O I 



o o >- 

:x 1 z 
a. o_ <: 



z z 



5 5 u u : 
" u uj z z ; 
ogglli 
£ o o "" "" : 

I UJ "" "- Q O , 

rj z z «t «* 1 
■ [r o o o o : 

; a. 1 1 «£ «r ( 



3 sag 



O O O O I 



CO "O CO 

Q: ce Cc 
5 5 3 



T t 3 

i-. i^ i~ 

? s= a= 
^* 
o ^ q 

fc C: fc 



£ 1 

^ a: 



5—0 



O O O O < 



O O 
O O 



'OOOOOOOO 



350 



oinoo 1 



S o 



<2 x 

z w 

uj O 

z z 

uj »< 



CD U 

£ Z 

a < 

o 



— s=? y 
s > > 

£r a a: 



oj ° 
Q CNJ 

E o 

,1 ill 

: o :£ o 
: o 

^§ 
2 o z ° o 

S Q o S Q 
£sd§S:I 






O O 

JS 

o o 

Q O 

> D> 

_j o o 



if °£ 

1— o • 

Z "J uj UJ UJ »- «^ 

w°>>><< 

2 > <t < «t ^ ^ 
hia E 2 £ ce ce 
SC z ° ° 

= <^^S5 

2 P o o o P P. 

= o iZ iZ iT <=> a 
uj = u.u.u-«*<t: — 

a; <t o o o en cc £ 



t > o 
oS=g 

g"ce 
u. ce o 

So: 



a. <5 z * 
— 7Z S: < o 

§£ = £1= 

• ■ < o 

5 CD 



> o < 

0-S?0 

•2-!l-0 
o p S — 

JZi<U 
tti 2 Q 3= S 

uj t z ce o 

QIT<Oq 

° = 2j t 5 



S2"!3.»i 



o z «* ct_ z 
5 S a- a. o 
" ° w o ;= 

° O ^ 5T 1 

u™o53 



r-~ r^. oo 
O CD O 

I I I 



31/77 
31/77 
30/77 
31/77 
31/77 


11/77 
28/77 
18/77 
25/77 
02/77 
30/77 
23/77 


C\i CD CNI 


— ~ ao 
CD CD CM 


o o o o o 

1 1 1 1 1 


UJ tj [D tr 1^ ID ID 
O O CD O CD O CD 

1 1 1 1 1 1 1 


mrMi — 
o — o 

1 1 1 


O O CD 

1 1 1 











OtNrH^(NNOOOr-OOCNJCvJOO« 

OOOOOOO oooooooooo 



II 



ce : : ce 

i/Jt- : Wh- 
UJ Z Z UJ z 

S o ^ S o 

O u ■; O mi 

S 3C — P * 

« ^UJ^UJ 

5 d P. z d P 

* SSS2S 

d are ii ^ are u. 

< P ° o p ° 

_, ce uj *t cc uj 

;- uj u o uj u 

S o «; -o <; 

JC UJ — «t UJ — 

uj ce =! co ce =i 

cc u_ >• o u_ > 

UJ 

« -r,oc« 
u_ o o to o o 

U. OOCMOO 



O CJ 

cc ce 



3 o ' 

uj p I 

CO «£ . 



= 000 
o o o o o 

UIUUI3 



ooooooo<c 



D= DZ O O O 



'2i5fc3 

1 S cc ce "J 

, ut a- o "> 

OO O UJ 

' o z x P 

' UJO> 

O O X CO 



CD CD CD CD CD 



OOCOOOOOOOOOOOOOOO 



351 



^ O CT> Ol < 



°9 ^ 

— O 



r^ o *r> ~ 



o in o o < 



ICOOO (O N ^ I 



0:0:0:0:0:0:0:0: 



*■ > —I 

*~ *~ « 
1— 1— tr 

OOH 

o: o: h- 

1— 1— o 

£3 £2 £ 

oqh 
uj < «t £2 
^0:0:0 

'£- -* 

co a: a: z 
_, o o — 
< "- "■ • 

-ujuuuu 
sooooo 
g «I «t «t « ;; 



z S S E S S ^ 



: cc en 
1 a o 
: z z 

: «* <t 
ooaoo 
2 Z 22 2 



z z z z 



uuuuu 
0:0:0:0:0: 

UJUIUI UJUJ 

0000a 

UJ UJUJ UJ UJ 

a: a: a: a: a: 



a: a: 
o o 

UJ LU 

a: a: 



a; P 

O «t _ O LU 

z „ 2 z a: 

«f O Z rf 

— ■ ^ o 
o z 
2 ■« 

5 """. -- Q 

O 2£ 

— »— o: — 
o: co *t o: _i 



0:0:0:0:0:0:0:0:0:; 

00=>000=>=>:3 



z. z. z z 



g = uj o ; 

" UJ "^ ° ' 

<2 a: o o ; 

W S 1 « ( 



2«* 



o a: 

£5Iu=3 
000000000000 



-to£- 
a: cl 

2 o 5= _ 



000000000 



uuu 
a: a: a: 
000 
a: a: a: 
OOO 
000 



^ 2c jc x: zl 
uoouu 
a: a: a: a: a: 

UJ UJ UJ UJ UJ 
O O O I 

a: o: o: 



LU £j I 

a: JJ 1 



000000, 



z 


O 



z 


cc 


z 

<£ 
O 
2 





cc 






z 




2 


<c 



z 
•x. 


g 


z 


z 


2: 


2 





O 





ic: 





*: 


p 


& 




* 





— 


! > 




a: 








CJ 














O 












n 


< 




«t 






CO 










O 


















O O O O O O , 



OOOOOOOOOOOOOOOOOO 



000000 000000 

ooooaooooaoo 



o o 
o o 



0000000000000000000 



OOOUOOOOO OOO 1 



xxxxaixxx: 



-X X -X X X . 



WWGOCOWWWWCOCOWMCOWCOWWWWCOi 



O — ' CT> 

m o o 

<£> OO tD 



O O O — ■ cni cni o 

N<0^ tf (ON ^ 

O CD O O O O O 



000^^«^^«CN^c\tNNCNI(NfNJiN(NCNnC\lOOrHC\lOO'--"NCVJrHCNCNI 

0000000000000000000000000000000000 



CjO 

_ o 

: o z 



«S2 

K Z U 

g° S o£ £ 

^ < ° UJ ° 

>- Q= 5 O Q£ 

LJ < j -I Ui 
„ =i O LU O CO 

9: 2 a: x o o 

— « o o o 

2 CO 13 3: 



z 
> c 


z 
c 


z 
c 


z 
c 


z 
c 


z 
c 


z 
c 










z 
c 


z 
c 


z 

c 


z 
c 


z 
c 


z 
c 


z 
c 


z 
c 


z 
c 





























cccecccccccccccc 



tttt 



CEQCCCOCCCacCCCearZZZZZZZZ 



CS CDCDCDCDCDCDCDCD^>?>COCDCDCDCDCDmCDCDOQaQOQaQO 



51 



o x x S <-> ° ° 



* 00000 

25 00000 
iZ 00000 



^SJJit 



o o o h- h- ►- ■— 

000 



cc cc or cc 

O O O 00 CD CO CD 



OOOOOOOOO 



OOOOOOO OOOOOOOOO^^**^****^ 

O O O or CC cc cc OOOOOOOOO ~ 



to to CO 
«* ^ «t 

000 

D> D> > 
<: «t < 
000 



to to to \ 

< «a: «t . 

OOO; 

> > > : 
•« <: ■< 

O O O 1 



o o 

o o 



z z z z 

0000 



«* ** -« «* 
0000 






"D to 1*-. ao en o — • cm — cm co ro^mujr^oooo^fn^ifliorvoocn •— > • 
— — — — — CMCMCMr^r^r^r-^cMCMCMCsicsiCMCMcoPO — — -^-— • -^ — . — « cm cm ' 
OOOOOOOOOOOOOOOOOOOOOOOOOOOOOCD' 
CMCMCMCMCMCMCMCM^<uOtOtocMCMCMCMCMCMCMCMCMcocococorococo ron^ 
00000000-^-1^ cmcmcvjcmcmcmcmcmcmcmcmcmcmcmcmcm cnicnji 



O O O O o o 



O CD CD CD « 






00000 



O O O O 1 



- -.OOOOOOi 



O O O O O ' 



352 



oo — o — rn — 



ccccccQjccarccccccarQ^cccECcoca: 



uj tZj tZ) p 



OOOOOOOOOO 



<t <t «t «£ • 



z *" 

uj O 

3E Z 

uj < 

oe «/» 

= iu 

co U 

2 Z 

a < 

£ * 

o 

UJ < 



oooooooooo 

UJUJUJUJLJLJUIUJLJUJ 

oooooooooo 

OOOOOOCJCJOO 



o o 
cc or 

o o 



ooou 
a: oc a: oc 

UJ UJ UJ Ul 
O O O O 
UJ UJ UJ UJ 

oc a: a: oc 
o o o p 
o o o o 



ooooooooooooooooo 
" z" z" z" z" z" z" 



ooooooooooo 

t— J— I— t— h- t— t— J— J— t— t— 

zzzzzzzzzzz 

iGOoo w www r "' 



o o 



o o o o 

CJ U O <-D 



ce Of oe a: oc 

UJ UJ UJ UJ uj uj 

OO 00 OO 00 00 00 

uuunu 

z z z o_ o_ z 

o o o «t «: o 

i x x oc oc I 

q. a. o_ o u a. 



O O O O O O O < 



OO <7> ~- ( 

ioooi 



o 


m 


O — O O 


o 

1 


O 

1 


<jD U"> tO UD 
CD CD CD CD 

1 1 1 1 


CD 


CD 


CD CD CD CD 


<JD 


a-; 


CjD U") UD tD 



CD O CD CD CD CD 



'■ z 
' c 


z 
c 


z 


z 
c 


z 


z 
c 


z 
c 


z 
c 


z 

a 


z 
a 


z 
c 


z 

a 


z 
c 


z 
c 


z 
c 


z 
o 



*3I zcrtCutirccirQCfrQrircrcctrcEaQ: 

CD uj>->->->->->->->->->->->->->_>->- 

OfflfflfflfflCDCOffiCDCOCQCOCDCDOOCOGO 

LiJ W WUUWUUUUIuJUJuJUUJLiJU 

O ooooooooooooooooo 



«soooooooooooooo< 

OOOOOOCJOOOOOOUO* 



ooooooooooooooooo 



g — In 

300 



ft ££ 



o csv a. ►— 

a o ° Jij H 2 

S ^ -2 = = ^ 

* O^S 00 - 8 

5 < « ^ z Z UJ 

* SI" = = J 

2 u. u. Q Z Z UJ 

—j o o « oc ac a. 

!2 am bm «c °° <*> uj 

2 uuuSsu 

*£ Cf> O — • Cn CD O-J 

K ^r ur> u-> ^ est «*r 

X 0O OO « O O ID 

x o o o « ^ — 



** t^ ^ ^ ^z « ! 

Uj _ M _ cvj CNi 1 



CD CD CD CD O CD < 

ooobobobobobobdii 



oooooooooo 






353 



->0 CSiO 


- 


g o o t 


UD 










TCMinOO 


in 



O O O O O 



q. uuu u 

^ UJ UJ Ul LU 
P > > > > 



to z o= 
o tr g 
5 o 



to" ^ )H 

|3t 
— ^ ^fi 

j^ JJ o= y 

co"^ t= « 

!2 -» \Ti "J 
ex" 8 a to 

o O CO IX 
Q- Z 5 UJ 

Btz£ 

° co ° rri 
cc c2 cc <£ 
Q. q. Q- S 



S to 
o ««■ 



tt o Q= 

*" OT Z 

s s= 9 



oo cr> 
O O 
I I 



« „, o 

f-» OO CO 
O O O 



o o o o en o o i 



O O O O O 



I I I I I 



O O O O o o o 






II 



^ ^ ^ 

X. X. i*. 

ct Cc Cc 

III 

C: ^ Ci 
So.So.So. 



s « « « « « 



JT o o o o o 

S Z 2 Z 2 Z 

3 «* «t «i «* «t 



* Q O Q 

S o — o o 

* z y z z 

S 5^35 

^ — . <t — . -^ 



3 OjOO 

o 

v o o o o 

2 oo oo oocn 

=Z o o o u-> 



"* JSor — ujj3or— uj 



li. oo-hwoo«io 

U. OOOOOOOO 



O CD 

— ■ CD 



CD CD CD CD 



— — CD 
ro r*> ro 
ri ob cf> 

CD O O 



<T> to ^ tO tO 
CD CD CD CD CD 



oooooooo 

— < « — . i^ — ■ — • » OO 

oooooooo 
oo oo oo oo en en oS oS 

oooooooo 



354 



u_ 


UJ 

a. 


CO 


X 






UJ 


a 


Z 


z 


LU 
CO 


< 


as 


</> 


=3 


UJ 


00 


U 


CO 

o 


z 
< 


u_ 


s 


o 


O 



O O fcT> O ■ 



i o o o o o © 



o o o o < 



ao no « ^ oo s 



I O r-. o o o 



^ (0 CO ^ 



o o • 

O O I 

O ao < 






° ° £ ° 

£ (7j >- 
52 => o 



II 



o I 



o «c o y 

» i e" :=: 



o z o 



ooo>g. 



C3 >- CJJ 

I UJ X 

« 2« 

S _ S 



z zf z 



; S^ OO O O O >- 
Q CO CZ uZ •< 0. 
1 <t 3 u. u- LU O 



°- zzzceoeoe 

OCC_I_I Z OOC_> 



i i = i > 



coooSceooooccoooSuuoi 



cc cj ce 
O z o 

LU^LU 

z S z 



M — . ^h o u-> *y ~h ~* o i 



OOOOOOOOOOOOOOOOOOOOOOOC300 



5 
o 
a 

z 



"I 



r! Rj ° 



51 os S: 

oe uj Zi 



^ -^ s ■« ^ 






2f 

§° 

;r o 

GO u_ 

o o 

? oe 

i Q it! 

rr to qc CD 

— ce o 2 
ce uj 2 «t 

z Q= L.J x 

O =5 O 

CO o cc 
<ZOD 



2 = 1 



°S = °z 



=: z 



• o 



uj 1 ,_ UJ O O. 



z ce 

a 

3 co 



>■ «£ ■ 



e o < <s ^ ^ 



5 °- 2 S 



e£25 



> ac 



^ ^ o ce z ^ 

00 00 5 W r) ft- 



£E £2 



y^zoxo^oi 



3 uJ ce o o 



OHZ< u <J 

sy okoJo 

•< 2 ce uj «t Cj — 
ce ce co i o. z S 



a- Q_ o_ 

«t «* «* 

o o o 

UJ UJ UJ 

o o o 

DDD 

ce ce cc 



2 SS! 



ao oq ao oo oo i 



I O O O O O I 



CO CO CO OO 



o o o o o 



O O O O O i 






O CZ> O CD O CD O 



Q O O O O O O 






oooo 



355 



o o o ^n o »_o o 



0)00lCOff>i 






o o o 

O CD O 

o oo> 



>o>-o>u o>> 
zozozoozz 



-c: 




-C 






z 


z 


_c; 


it 




















( ) 


















>- 


<0 




(0 




c> 


[9 






* 


-I 


* 


z 


^ 


z 


z 


* * 




















z 




z 


Kr 


z 


«£ 


<t 


z 


z 


o 


* 


o 


* 


o 


* * 






o 


o 


o 


o 


c_> 


o 


o 


o 


o 




>- 




>- 




>- 


^ 






Z 


z 


z 


z 


z 


z 


z 


Z 


z 












































o 


o 


o 


o 


o 






o 










































oo 


•* 


oo 


-5 


00 


■* 


< 
























* 


z 


* 


z 


* 


z 


z 


£ £ 



On^r^rs.orvOV 

ooooooooo 



> > 
or cc 


O O 

>■ > 

or cc 


-> 
a: 


D> >■ 


>• > 
cc a: 


o 
>• 
a_ 


D> 


O 

D> 


O 

D* 


O 

D- 


U 

_> 


>■ 

Q_ 


O O 

_> > 

ce ce 


<_> 
>• 
cc 


o o 

> > 


GO CO 


CO 


oo 


oo 


CO 


CO 


CO 


oo 


oo 


OO 


CO 


CO 


CO 


CO 


OO 


oo 


CO 


OO 


oo oo 


O- Z 

<! O 

ce 3: 
o cu 


z z 

o o 

X I 
a. o_ 


z z 
o o 

a- a- 


z 
o 

X 
Q- 


z z 

o o 

X I 
a- a. 


z 
o 

Q_ 


z 
o 

X 


z 
o 


Z 
O 

X 


z z 

o o 

X X 

a. a. 


z 
o 

a- 


z z 

o o 

a. Q_ 


z 
o 

Q_ 


z z 

o o 

-C IE 

a. q- 


UJ UJ 


LU 


Is 


£ 


UJ 


l_U 


LU 


!-. 


!-. 


£ 


£ 


UJ 


h- 


£ 


£ 


£ 


£ 


£ 


LkJ LU 


O CD 


s 


s 


o 

CO 


o 


CD 

en 


CD 

m 


ro 


o 


o 

CO 


o 


m 


rj 


r? 


m 


o 
on 


CO 


ro 


co co 


(X) UD 
CD CD 

1 1 


C3 


1 


>-_D 

o 

1 


UD 
O 

1 


UD 
CD 
1 


ud 

o 

1 


O 


CD 
1 


O 

1 


o 

1 


° 


o 

I 


[ 


o 
1 


UD 
O 


o 


O 


OO f^ 

o o 

1 1 


CD CD 


o 


o 


o 


CD 


O 


CD 


o 


O 


CD 


CD 


o 


o 


o 












ID (£3 


UO 


r^ 


UD 


UD 


ud 


'X' 


un 


"3- 


■C- 


-3" 


r— 


r-- 


i> 


_o 


UD 


r-» 


r- 


GO r-_ 



__ _ o 

fo en m 

r^ oo O) 



oooooooooooooooooo 



ooooooooo 
»—►—>—►->—>— I— H- I— 

-3-3-->-3-->-->-->-->-_! 

Q_0_Q_Q.Q_Q_Q_Q.Q_ 

OOOOOOOOO 

ooooooooo 
__>__)__>__>-_)__>:-.-_)-_> 

ccc_:q_c_;c_;_c:c_:__:_c: 

r-- r-_ r»_ r~ r-. r-~ ps as » 
OOOOOOOOO 



>- >- 

z z 
«* •< 

i z%i z ; 

5.°||°! 

S _2 o o __? ! 

o> llJ u J >: 

o-jujOO^ 

£ o5t_!_d§ 

< — Z uj uj Z 

* =^^- 

__i z o a. a. o 
—i o_ ^ o o ** 

« uo>>.a 

S 5 o z z --j 



o o 

_c _c 
a. a_ 



?=SS?== oo = 



>- >- 
z z 



o Z o o ' 

2 Q_ o_ a. \ 

<__«.-J: 



o o 

_2 _2 : o o _2 

" : LU UJ LU __: S LU LU 

i Z Z Z O o z z 
o o o ^ >- o o 



O O I 

z z 
z z 



■< _u -u " •« =o _j ' 



-_c <t <t 

o a. LU LU 

<c o Q_ o_ 

o><< 

<f_e ' 



O O O O O J- 3- 

«f <£ "* <"<"$; 
oo oo oo oo oo LU i 



o<> 



w o — 

*> CM i£> i_ _ 

-^ O O O O O i 

> O CD i 



CO CO CO CO CO CO i 



oouauoo 

CO OO CNI CO ■*»■ LO I 
O O CD O O O I 
LO -D OO LO LO LO I 



££ 





5E S£$ 




<^> <o o 








<o ^ t_> 




* * * 




§?? 




ooo 












•^11 






o 


S S £ 






* 


* * $ 


* 


9. a. J;. 








<3 C3 cs 


< 




UJ 








■* 


OO LO OO 
















—• ^r r-. 



t> ^i.;^!.;^!;^^^.;^ 1 



3 CD CD CD 



OOOOOOOOO 






O O CD CD CD ' 



356 



CD CD CD O O ' 



cr> cr» cr> o*> 0*» *W ' 



z z 



£ Z 

o < 

o 



cc a Ct CE £T 
3 ^ =3 => =D 

LiJ Gj Lj Lj UJ 



^ <C ^ «* «K 



let 



oooooo<coo 

0000000.00 



is 



o *= 



•-• CD 

ro PO 

OO CT) 

o o 

I I 

O CD 

oo cn 

CD CD 



_^ c/3 a: ,__ 

o ^ g o 



— CD CD ^ 

CD CD CD CD 

I I I I 

CD CD CD CD 
CD CD CD CD 



: z z z z z 


ze. z z. 


3 O O O O O 


goo 




goo 


3 O O O O O 


:zzzzz 


co z z 


: a: 3: 3: x x 


£ X X 


WCOM tf)W 


z oo oo 


c «* «s <: < <c 


=> < <t 


:JJJJJ 


°SS 


3 O O O O O 


<-> o o 




O,- h- 


: x x x x x 


<J ^ 3= 

goo 


3 O O O O O 


Z Z Z X Z 3Z 




:SSJJJ 


3 O O O O O 


poo 




o •— •— 


OO 00 OO 00 00 


5? oo oo 
— o o 


3 


1 Z Z Z Z 31 


J^ SI 31 


3 => =J = => => 


»32 


3 O O O O O 


5 o o 


->->->->->- 


5 3- >- 



o o 

cr cc 



o o 

X X 

a. a. 



ro o r-- *3- o 






— H <n (Nl CJ> VD o •— • ^" •— « 
OO--— «CM~CNICNIO0 

ooooooooo 



gj KG 

3 (j CO 

cr ct ce 

■5 5 5 



Q- 1 "=c 

UJ §§ 
2 to to 







CD O O 


>- 




^ OO oo 






goo 


cc 

< 


* 


o o o 

5 < « 


c/> 

UJ 


3j 


o , "" 


Q£ 


« 


goo 


«S 


X 


cc <f «t 



« >->->->->->->->-. 



** cccECeceorccccceor 
£ ocjoooocjoo 



WWWWWWWMW 



o orarororcecececect: 
u. < «c «t «t <c «t -* 



or co o o co 





LU O 








o O 








s <=> 




0<-> 




t- uj 


UJ 


°-o 


9 
* 


LU UJ 
3C -J 














« 


S £ 


■ 


-C Z 



© rs oooors 



^ CD O CD CD CD 






^ w a» D) tr» 
J5 CD CD CD CD 



— U3U3 — 

cp ~- ~-. o 
00 00 00 cr> 
0000 



rvisrvooi 



357 



s ? 



08 o 



■ S <" J, 
> ^ « 
5 2 != 



UUJUXUJUUJUJllJUlUlUJLiJUJX 

ooo«oooooooooo«t 

Q_Q-Q-OQ-Q-Q.Q.Q.Q.Q.Q_Q.Q_0 



"0 = 0, 



=5 a: 2 
O UJ o 

CO X « 



o => ■ 
O O 1 



OOOOOOOOOOOO' 



-h«oooo 

O O O O O O 



O O 1 

000000000000000 



000 

iv 00 CO 

o o o 



000 
000 



0000000 
o o o o o o o 



"*■ z ;=; 

Q- o O 

£ 3Z u_ 

00-0 

«y >- 

Z 3: UJ z Z 

o a_ >— «* o 

LU ^ fZ LLi LU 

o •"- g z o 
z z °- o z 
<0«8 I < 
z = a. z 



II 

« OS 



Z Z O 3Z 

to to o 2 

>>ou 

o o o y 



o o z ■- 

Z Z O z 

<* «t 3: o 
z z o. ^ 



z. : : z. : 

o : • o : 

oc : 2 ?= tu 

o : ^ o h- 



Q_ "- O Q_ "- Lfc O 

= o = == o o 2 

K uh tt U Q. h 



Q-|0'z2h0'-|0'2-|00'HZ 
O m OLj< Q O m O< ffl 00 w 

<2<wu t <"2<uj2<< tw 
toz»uxz»z»zziAv>z'i' 

00050Z>OOC3CJ0003)S 



^ t ^ 

Iftl V V K^ 

u s» %; J; 

* iy Sa is 
« * 5 * 

* £ £ £ 

s ass 



p= p= f* 

Ill 

C; C; C; 

to & to 



er * 



„ ° Q - 

- =!<°^<"° 
S |5 Q ir ;5 <=> ? cr 
* z — 1 o z — 1 -o 

O u < Uu< £U 

« £ 2 o £ 2 ^ o 



u ° 



JiraZo: 



> o o o o 



«» 0000000 



f-«- r-«. r-«. r-» 00 06 00 00 00 0*> Cft Cri cr> 0*> 0*1 
OOOOOOOOOOOOOOO 



» OOO 



--I —■ O 

Noba> 
o o o 



CD O O O CD O O 



358 



— a. 

«£ X 

z *" 

uj O 

z z 

UJ < 



OQ U 

£ Z 

a < 

° O 



o o o o 



o o o o 
o o o o 



o o 



£* 



S O O o; q; 1 



O-lOU 



Kircrcc 



go o °= g g g 

Z O = =5 3 =3 

; g= z a. o- 0- a. 
_ z = Z 2 E S 

UJ «t O O O O O 

00 o t_> o o 



77* lTj f 1 O Q_ 



2 to t 



Q. = X ! 



IsliPli 



— x 5 



' 0= S => 
=> °.o 



» o o o <= o 



O O O CD O O O 



= 35- 



00^0 
o o o o 



CO p 

ac ec 
o o 

Q- O- 

ce ce 

= 0^00 



o o 

"* «t 

CE CC 

o o 

Q- O- 
CC CC 

_ o o 
„_ g ° £ ° ° 
000. 
3^ ^ _J 

P-. P-. ■* 



= .— o<=> 



^2 =; =: </2 



■<=:=:< 



00 — 1 — 1 , 



t: = X = = £: 



I — X X O ' 



_ o o 

P o <-> " 

— 5 Be ^ =• 

LU O LU — — 
I— O X O Q 

r^ r^ o r^ l*~ 
OOOOO 



2 25"-33£5S 
< ir y^uoy ess: 
„i5zziz„ 

= >S--zz5z> 

5_5g3o 



at co 
o S 



CO r-~ (^ 
OOO 



a (j ■ 



00000000 

OOCNI-— 'CD — 

CNiCSICNI~-^«COCO 

OOOOOOOO 



2 > ' 

__ o o __ 

O UJ LkJ O 

poop 



S o LZ C o 

* zg'g'z 

3 goog 

tl ^ -r" -r* ^ 

S ° £ £ ° 



{T OOOO 



O O O O 



359 



oo in o O < 



oooo^ooooooooo^-^roooo 
10 ^ r-~ <x> to c0 to cr> to to (^ 



O O 

<: ** 

• ?: z o 

z5 oo 






§5 

«t CO 



O LU O ._ _l 

MBl^Ul'ZU;; 

<c «x z ce o uj z , 

IKO. 



or cc or en cc 

13 =3 =3 3 3 



: ce = _i 



<: «£ 



S S S 2 S 



35 



53 

o o 



CO — ' 

If 



< «t < 
iiiiil 

z z z z z z z 

CO GO CO CO GO GO CO 

z. z. z. ^. z. ^. ^. 

5555555 

o o o o o o o 

OOOCJOOOOOOO 
QQOOOOQOOOO 

zf 2= z~ z~ z* z" z" z: z" z" z" 

oooooo»—oooo 

►—!—►— I— J— >— Oh— h- t— t— 
OUOC30C300000" 



<£<t<t«i:«t<s:«s:<t<:<t<E 



ce oc en 
u ui UJ 
CO CO GO 



— • O O ^-* O O — * ~* 



O O O O O O CD 

I I I I I I I 



I CO tO ~^ ~^ CM O "^ i 



O O CM — — * — ' — ' O < 

^> if u> (£> ^ CM^-«3-u">cotocour>r-.oO' , --< 

OOOOO OOOOOOOOOOO* 







CO 














CO 




tsi 


" 


" 




CD 




CD 

m 






CD 


(.SJ 








CT> 




1 


1 


O 


O 

1 


CD 


CD 


CD 




1 


1 




























(O 




<m 










'■O 


n 




o 




Csj 

















O O O O O i 






o 9= 



ce cc 



BB 



^ <t -* <: 



<:«*<:«*** 



5 £ 



. a oz lu o_ a: oc ' 
w a: or — or ql ■ 

S g LU CO g g I 



<t «t <C «t «* <t < i 



«2 S5S222 



55 5Z2ZZZ25552Q: 1 

O O o ° ° O ! 



i^ii^CDI^CDCQb. 



QC ooooooo**^ 

O X * 

i. ODCQCOCDCDCOCDnm 

OOOOOOO^ 



X O O O O O O ' 



OOOOOOOOOOOO' 



tOOO»-^«^'^'J^ 



* (» — • o a-> • 

O O CNI CD — • - 

-J m r^ oo r— > 

-i O O OrH I 







s 


«t 




CO GO 






CO 




O O 
CO CO 


* 


o 

a. 


o 

O 


ils 










CD CM CVJ 








3 
Z 






« 













Si oooooooooooooooooo 






OO OO OO OO ^ ^ O O O ' 



oo ooo oo 



ocsicvjo^tM^^csimfn 
ooooooooooo 



— CM 
CD CD O 



96-500 O - 78 - 24 



360 



■ — * O CO O ro ■ 



0**OCT>CnJOOCsJO->0 

ro oo co m ud o ■**■ oo ^ n i 
■ u-> o u~> og «« n oooin i 



5 5 



►= * 



~ a. 

«2 x 



oa U 

S2 Z 

o < 

o 

LU < 






oooooooooooooooooo 
xxxxxxxxxxxxxxxxxx 

0-0-0-0.0.0-0.0-0-0-0-0.0-0.0-0.0-0- 



UJ 


LU 
















CO 


- 


- 


OOO-^ 


- 


5 


o -^ 


O — • -H ~-l ~-. 

co co co co co 


co ro 


1 


CD 

1 


1 


O CD CD CD 

1 1 1 1 






CO ro 
CD CD 

1 1 


WrsOOOOrs 
CD CD CD CD CD 

1 1 1 1 1 


oo oo 

CD O 

1 1 


o 


CD 


CD 


CD CD CD CD 






CD CD 


ooooo 


o o 


u-> 


m 


UD 


UD CO CO r- 


F-» 


r— 


co en 


(£>rsoOCON 


oo oo 



i CD O CD O I 



ooooooooo 



*- o o 



ocl <*0 _j oO oO ( 

^^OO^^GOU-U-OOLL. 



•« •« S3 «t «t S3 



= X X — 



o o 

o o loo 
z z • z z 

«£ « —J «t «t 

CO li. u. 
O" Q Z " Q " 

< S S «* < 
o o S3 o o 

- - X - - 

<c <c o <c ** 
oo oo ;J oo oo 
o o s e> o 



o •— o 

00 O 00 
O O <=3 

|£| 



00 o 

11 

S o. ri <* o_ *i ri 






OO X =J 00 _ 

o o S o o o 



r* o 



^ >" n "i " "t (J 
OO X ^ OO X oo ^ 



I r-~ oo — I — I 
— < — • CD O ' 



I CD ~ — *-< I 





Oc Oc Cfc 








ag 3g ae 




v>uo 












* * 5; 




S?5 




O O O 












•t *S •"T 




K* k* K. 




.*!*!* 






« 


* * ^ 


* 


^ q. a. 




883 


8 


W^ ^ ^. 










« 


OO oo oo 


-' 


o o o 



^ ^ sc 

? ? F 

O O Co 

L*j Uj C*j 



^ t 't 

X. i~ X. 

P= ft f* 

fc C; C; 
5 5 5 






C CD CD CD 
5 CM CNJ CM 

5 






361 



<J"> t*0 O O CNJ CT> ^ 

oo w o Ofnin -^ 

OO «— I ^" CD OO U"> o> 

t£> r-. ^-* id ~-» ^r 






CO CO 

I— I— 

CO CO 



o _, 



— t— 
> o 
coz 

2x 

O UJ 

o o 

H- t— 
U CO 

o o 
o o 

O C3 



kcx : a: <r a: 

uj m m M u Ul m 
CO CO CO Ig CO CO CO 

UJ UJ x < UJ UJ UJ 

z z a. oc z z z 

o o <: o o o o 



o o 

UJ UJ 
UJ UJ 

m m 



O- O "J i 

1 iuj uj =; i 



CO CO 
r^ oo 
O O 
I I 



u-> 


O (jD 


O 








ID 




O 


O o 


r-. r-L 


r-L ri. 














— O 


en — 






CNJ tj3 


t£> r- 


o o 


O O 



u"> ro ud <x> oo oo 

O O O O O O 

I I I I I I 

« tD -h in -< vd «) 

m uj co « to rv oo 

o o o o o o o 



-^ « O 

m n co 

NCOO) 



H X uj uj 

2 In 

UJ < a: a: 

LU UJ 

Itl Sc * x 

^ 5 <-> o 

z uj UJ 

3t uj uj uj 

UJ 

2 2 m = 

bb oo 

1 o J;^ 

£ men 

LU £ O o 



oc oe 
o c_> 



be era: 

UJ UJ UJ 

£ ceo: 

SI oo 



* CSJ 

O 3 
-J ° 



Q_ Q_ h- 

:<<o 

cc cc 5 

:oo| 

2 z ujui°! 
o o i— h^ o ! 



-J a_ <c cc o: o_ <: •< 
« < cc luui< cr a: 



UJ z co CO uj z z 

lUjUILUiuiLU 

uuj Juou 



O O O O — « O O 

cr> *«r oo CD io o »n 



*» cvj --I — — CSJ — — 






o oooooo 





Uj Uj Uj 
CJ CO Co 

0; ct ct 




Co CO CO 

ct tfe ct 




251 

CO Co Co 




p p p 

Co Co Co 




Uy Uj Cjj 

to Co Co 
«: «: % 




BSS 




III 




III 




co co o 
** ^t ^ 




CO Co CO 

•^ ^ ^ 








i-. i^ X. 


to 

a 


fj. 9- ft 

CO CS CO 


u 


9= P= P= 

$ co 5 

5 5 5 


UJ 


ijjUjUj 


* 


Q Q Q 


CO 




o 


















oooo 




*£> CO CJ3 


« 


co^^ 




O O O 




CD O O 



3 O O O 

a 

— . ~- o 
fi ob cf> 



362 






LU 


a 


s 


z 


UJ 


< 


ec 


l/> 


SS 


Ul 


CO 


U 


<•> 


7 


a 


< 



± z 



LU < 



i -^ 00 a> r«- r^ CO i 



5 5 



i= uj <-> uj 
; ii > z > 



°- r% — °- — 

o o ^ o f» 
"oo"o 
(J) o o o o 



.<o 



u3^ e 

o t <t 
— 0:0 
o?"z 



5Sg 

o y, o o 

0000 



2 ° < 2 sc ' 

o ae t— o t— 

o ui <t o < 1 

•a: x O «* o 



£ =5 oc 

5of 
_ o - 1 * ; 

U- CO Q O 

ompp 

z K 22 

= iti 

t < ce ac 

1— ft. o o 

co co co co 

Z 5 CD CO 
O Ul =3 3 
O Z CO CO 



if a.. 

> «* 

UJ o 
CO o 



a: u 



^3 



CO ^ w ^ 

„ UJ UJ g= 
9j CO => S£ 



1 o ^£ z o O en 
■ o 2 o o o — 



, „ ^H O ~* 



O O O O I 



000000000 
000000000 



c\joooo«-<ooooo 

lfl(£Hfll£>ICNU)-HNOOr-. 
OOOOOOOOOOO 



CD 



5 
at 

oc 




c 


u 

= 
cc 
c: 

z 

(X 

a 






u 


1( 





9. o 



s li 



a. cr co 

_i i? < 

« °- z 
5 oc <t 

- ° S 



«: z 9- z ^ Q- 



ri Q. uj 



ujui - 



« t— 01— t= 1— ot— E" 



r^ O I— 

i» §25 = 



O o 



tt Q- 2C 

?=, m O 



_ $ 



■■ s ° «; uj uj "■ 

_, i~ o j s c _. 

«t ir uj o u. tr <t 

co o Q^ ^ o o co 



u o x a c_> x 



2 co 

ae « 

UJ 

£» o 

o » 

« S; 

K ° 



<i«j;£Sz<:oio«tz 



Ul co *T »/"> *J3 CM ro 

Q_ OOOOOO 

X O O O O O O 



o o — ■ o o 



O O — ' <JP O O 

CO ro co fN cvj ro 

ao 00 00 o> n oi 

o o o o o o 



. r-~ 00 00 00 00 1 



o o 

CO CO 

00 00 



0000000 



363 



O o «r o o O 



o o o o o o o 



— r*~ CM CO CO 



OO-OiOO 






• : £ * ° * 



S o u o u u 



x x x x x ;* x 

s z z s s x s 

o o o o o o o 

o o o o o o o 

o o o o o o c_> 

O O Q O Q Q O 

z" z" z~ z' z" z" z" 

o o o o o o o 



tf) w w oo wto 



<r cc oe ct cr 

UJ LU UJ U Ul 
to CO CO CO CO 



o o o o o 

x x x x x 

Q_ Q. Q_ Q_ Q_ 






f^ r^ oo Pi » CT> 



O O O O O O 



O O O O O ' 

I I I I I 



» o ^ if) en tD (£ 

O CO CNJ « O CNJ — > 

r-— f— r«* 00 CT» OO CT> 

O O O O O O O 



~ o — I — • — I 

o o o o o 

I I I I I 



ooooo 
o o o o o 



cj ■> =» 
ZKMte 

°E OE . , 

lg;|ss 

OE o CO O 5 O 

mooeogo 

CO ^ !£ ,_ CL. uj 

=> £ 2 co __. Lz 

o <t z o — ' < 
x c_> o x ac o 



: >- o o o 
■(-=>=>=> 

2 5«t<tOE«t«« 

X < - , o° c/ ,ooo 
K o^><— .— .-, 

»»- xxgoiix 

uj oogxooo 



o o 

X X 

a. a. 



o o CO o CO 

o o Q o Q 

, o o Yi o W 

UJ Q_ Q_ U q_ O 

X o0 a0 < a0 < 

* ac 5C u - 2C u - 

© «* <: Q - <s - 

— i a. £ < i < 

« «* «t o <t o 

.. OO OO .CO . 



* &. &. &. 



<fc <*: <te 

^^ I 

Cb d Ci 

C£ C: C: 
5 5 15 
°o tQ °2. 



o o o o o 



OCOO^«-i 



■; o> <x> ct> ~-< — « 

v CT> ^- 0> OO ^- 
£ O O « O ~ 



C2 o o CD o o 



P O O O 



O — r^ r^ ^ o 

o o o o o o 



O CD O O O O O 



OOOOO 



— . — . o 

r-L OO <j> 



364 



o o o o 



2 2 

p ec 



%> X 

z m 

uj O 

z z 

uj 4 



*2 Z 
a < 

° o 



ii 

_J o 

CO fT 

5 ?> 



a. a: 

oe uj ! 



00 CO i 



SIS 

o o „ 

Q- o g , 

:gl«°.g 

i CO =3 Q Q I— 
CD — I O O O 
I ^ O o o ^ 
> co u u. u. a_ 



m ir w S 2 

1 3 «* <c o o 

Q_ OO O CJ O O 



<X> en ct) 
o o o 



O O O O 



1 










1 t 






1 




1 












o 










o 




C3 






IX) 


U3 


r*. 


to 


r- U 


a^ 


r» 


r— 


ID 


<JD 


P» 


r»- 


l»- 



tOOOOOOOOOOOOO 



» o o o 
3 o o o 



353 

to CO CO 

<: «t <t 

_ s s z 

c = ° ° ° 

Uj z >- >- •- 

e 

Z •* -- n tr, 

O i <=> o o 

O i- r-» r-~ i^ 

LU 3C O O O 

O g 

52 r- oo oo 

O o o o 



§?2S . 

;= p z i q 



! O CO p 
_i o o 
S 53=i 

ri ce o oc o 

z z z z 

«t o 3 o 3 

►— co i co 3: 

3K Q(J Ou 



u> o o o o 



CD O O O 



o o o o 



« o- tiJ :> o — 

o uj CO «t a- 



*— <t <t z ac 2 p: 

ZCQCQ <Or W 



; S C3 «s z 
a. go oo O >• 



E= C uj <• 
O O OC _J 



OWE<< 



go 



. o — « i 



q. OOOO*— •cocor-.^j-^r^uri O O 
>< o "-**-• — « •- • — o — — ~«oo 

OOOOOOOMINMCSfCNJCVJN 
Sf OOOOOOOOOOOOOO 

O 

CM CM CM CM 00 ~^ — • O O O O CO GD <J3 

r— r»«. r--. r-» r»«. r—. r-» oo oo oo oo oo oo oo 
OOOOOOOOOOOOOO 



365 



oo^ooo 



CD O O O O 



no *r> v c«j n 

to CNJ o « « 

i <\j « ui ob ro 

Cm Co r- o co 



z or 

If 



O z 
— O 



GO *" o" 

ujujo 
=> z o 
o o ir 



O O z Z O I 



s± o 
or o 



or or o o or 



O S± UJ !== 

oaHC 
-I o Q o 






•< O O Z Z o 
O O CJ O ~ 



UJ O I 

is; 



«00-0" 



^i co ~i ~i « ir> CD 



>oooooooo< 



£ Z 


2 2S 


. UJ 


£f 


5*° 


*£ 


o o 


0z 3 


z SjJ 


>- >- o 








CO CD 


^GOJS 


oo ►— 




CO o o 




1— 1— 






U O 


5 £_> o 


o o 


a a 


o o o 


a o 


z z 


_ z z 


z z 


O O 5 o o 


o o 








o u 


2z-£ 


o o 


z z 


z z 


X I 




X X 




5- CO CO 

is? 




< •* 


<t «t 


** 


£ £ 


oo oo 




— ■ ao 


— " CM 


co — « CD 










o o 

1 1 


CD CD CD 

1 1 1 


CD CD 

1 1 


CO CO 


ooo^ 


oo in 


— • CM 


OJ CO -^ 


O — 



i co to to en co 
CD O O O O O O 



ce cxl en oc en ql 

UJ UJ UJ UJ UJ UJ 
OO OO CO CO oo oo 



Q_ Q_ Q_ Q_ Q_ D_ 



— CD — 



CD CD CD CD CD i 



O -5 CD OO Z 



d> uj p ee z z 



z == ; 

z or go go or or j 
> o 5 o o Z x i 



OOOOOinr-incOOCOCDO — < CM 

o ~ — uo cm ^ ^NPicnnn 
oooo — ooo««ooo 

CO CO in r-» m ry N V ^ ^ CD CD CD 



CO CD : CD «f CO CO 

oo or or ■ or co or or 

CC UJUJN uj ff uj U) 

UJ o O ^ O 3 O O 



o o x o uj o o 

cc or ar t ce $ or or 

£ 0030x00 

ttj li o ij — li _j 

uj uuouZuu 



CD CD CD CD CD CD CD 
CD CD CD CD O lOis 



o : O 
o : o 

UJ - uj 



X ^ X ** I ** 

c£ S3 a. S3 at S3 



O UJ o I 
O O O I 



* £££| 





<t 








2 




< or < a: 






00 








uj z uj z 












a. 


0000 


* 




U3 


« 



CD CM n- in 






3 














CD — ■ CM 



UJ K. K*. 

« Uj kj 



000000000000 



W cn ^ cn — cn ~ 



<J3«)00(000(MCNjrsir>.r>.fs. 
^^coe^^cNCNC^csiCsicsicsiCNj 

0000000000000 



to to ^r to to csi o 

O O ^ M fSJ CM PO 
r-i. r^. ri rC ri. co en 

0000000 



O O O CD CD CD 



366 



5 5 



: od ^ 



«2 X 

z "* 

uj O 

SE Z 

UJ 4* 



m U 

<£ Z 

a < 

© 



: <c <t z _ , 



< < UJ U 
O Q LU -* 



X 5 



x 9= 



^ ^ o 

O CD CD 



H- G> _, f— O 

a Oulao 



*-. ~-. CZ> — "-H 

ro en en en en 

ooooo 



o o o o o 



O O CD CD O 
CD CD CD CD CD 



GO CO OO 

UJ UJ UJ 

> > > 



_ o E — 



ft ft ft 

£££ 
O O Q 



«* * 



o ^- °- S: 3- °- 

-< 5 o "- 5 o 



Z Z Z z z 

, _, a: oc tr — — 

W _j UJ UJ UJ (^ (^ 



2 «* 



ujOVljO 
-j :*: O _i 2C 



O f*^ ■ — i 

£ oo 



CD CD CD CD CD 



367 



C> O c> '"•" Ci OO I 



i O O O O CT» CT> C71 



tMOOOiDOWOiOOCi 
COUP — f^-OO^ — CMr^ 



ce ce 

22° 

z z £ 

: «* «£ o 

OOrJO 



: o - o u. u. 5 u. 



—i o O O O —i —i ' 
=T >- Z H- =Z ^ 



i— j: «t i 



- :cc :£ 
' co "* : ;=; 

= UJ X UJ g 

!>S>o 
: £ = £ _f 

JO?UZ 

; £S zuj 

Z2l c 

: ce >■ — i <»: 
c o- o o o 



1 1— i 
o co 



<t o 2 <t 

ZOO.Z 



S < ■ ° =! • 



i: O O £ 
^ «i o o ~ 
_J 2 o o o 



£000 

O Q Q 

2 a z z z 

1 CO — O O O 

«t z O O CJ 
i Soz z z 
ig^X x: x: 



"J « fc: t: « "H 

1j i±i o o Sri Zj 

— CQ ~ ~ CD — 

> -r — — «r > 

z 5 3: a: $ z 

O 5 "» "> S O 

CO O < «j; O c.0 

CJ >I -^ ^ ^ C_3 

o o; 



QOooOO 
zzSSzz 

O O CD CD O O 

CJ U < < OO 



cc en en en en 



cc ce en ce ce ce ce 



W CO t >- w w 
«t «£ <£ 5 •< "* 

S S Q o S S 































000000 


CD 


in u? 00 >n ^ o) u> u 




csjocnjcsjocs^oc; 


SJ CNJ 



> f-^ r-^ 00 



l — • cr> CD 00 






O O O O < 



OOOOOOOO 









OOOOOOOOO 



OOOOOOOOOOOOO 



z — • z 
o^ jo 
, , »— o • t— (_ t3 

. «i cc — 1 o_ ce __ — » 1 

. = O CC . O g CC 
) Q X u. CD X UJ u. 



ULJUJUCOLULJUJ1 
. Q_ Q_ 1 



Z Q_Q_a.Q_Q_Q_a_a_Q_ 

UJ Cua.a_Q_Q_Q-a.Q.a_^a_a-a-a- 

xxxxxxxxx~xxxx 
ce 00000000050000 



OOO 

X X Z _J ,,, z *z 

°- °- ** uj z 2 ** 

uj uj "- _ 3: => "- 

L_ ._ - Z Q- 

O CC „ Z Q 



<< < u (^ a < 

° ° O X '" 

ce ce d 

": ti 00 



o <t => co co •«' 
ii ii co o z ti co 
u- u. o co <t S o 



z z z iz 

0000 

X X X X 

a- o_ a. o_ 
o Ix 1 ix Sx tx 

q_ t— 1— r— »— 

ce o o o o 
•< «t «t «t 
S S S S 

0000 

0000 



Z t— «t <t «t <c 

S u- u- Q- Q- 
S •* «* «S «* 



CO u. o o o o 



O — I 



. r-^ o — < 
O O « irt o 



IOOOOOOOOO — — 



>oooo~— • ^.-h 



O O O O CD — — » ' 



O O O O O O ' 



1 CT> r-~ r~* r^ 



OOOOO 



aoaocoaooocDcDOmooooo 

OCSOOC30CDOCDOC3CDC30 






1 <o o O O O ' 



368 



ec 


Z 


u. 


in 

a. 




X 

UJ 


UJ 


Q 


Z 


Z 


UJ 


< 


QC 


«/> 


=> 


UJ 


CO 


U 


O 


z 
< 


u. 


5 


o 


o 



UJUUJUUJUJLLlUJUJLiJ 
COOOOOGOOOOOt/JCOOOC/) 



CL 0. Q_ Q- ■ 



.0.0.0.0.0. 



£ 5 



CNJ C\J £j 



o a 

a: ce 

o o 

o a 

UJ UJ 
CD CO 



O O O O O 



> O O O CD O O 





oo o~> 


■— ' 


o o 


ri. 


ri r-. 


























o 


o o 



~ ~ c^ 
co <d m 
r~ CO cr> 



O O O 

3: i i 
a. o_ a. 



< «t «t 
£ £ S 

o o o 



° 5 5 ° 
o 2 S o 



<t «t <t 
a. o_ a. 



o o o o 

JC _i I Z z I _i 

<: — i a. <c <c a. — ' 

z UJ uj z z UJ uj 

u "- z JJi "l "I £ a: 
3£<:§3«:uj 

o i e o o e i 

iiicoorjoocoSo 

OOOC3COU.CSOu.tO 



__o_o — — — o 



Uj Uj Uj 
Co CO CO 



■»* 1 1 

K Uj Uj Uj 

•a. 5 5$ 
* § S ff 

s ass 

3 C3 CS C5 



_ _ o 

fo en ro 

p^ ob cf> 

O O O 



CD CD CO 
Cc Cc Qc 

S 3 3 



8= 8= 8= 

s> s> & 



eg uj uj 

>■ « z s 

LU _, o o 



369 



OOOOOi 



i o o o o o « 



OO O CO o o < 



i cr> ctj ud oo ^r ' 






n j<< 

z £ o _i . 
v> 1— z <t • 

Z o= <o >- ul 

S UJ =3 Cu u- 

u>ooo 
Z O X o o 



z z 

i ° 



Si ce ^ ce JE ce 



.itira 
I a a a 
: z z z 

: «t «t «t 



>- o >■ Ce ce ce 
rj I- r-i O O O 
O ^r- O _ _ 



ce >- 
o ^ 

a: ce 



.^.>-o>-o>-o>- 2 

gZOZOZOZ f£ 



00s 



030000 
t_> 2 o o o o ; 

O Q O O Q 



o uj ce S 
■ a. od «2 

g g 5 






03030 
o g o Pu 



0:0:0:0:0: 



z^*-^*-^^^^ — ^z«- ^*-z*-^ 

OO ^ O z - OOOO^OO z ° z " ° z ° 
OO^O^CSOOO^OO*" o >~ O >" O 

S£^^£££^£^^ 5 3: ^ je 5 

XXOXOXXXX2XXOXOXOX 
{flWOMOWMWtOnMMO CO O CO O CO 

<t«to:«*o:«t«i<'<~«j:«to: «t a; •« ce «i 
3SmSmSSS5£sScD5cDSm5 



00000 
I I I I I 



(0tn vco o — 1 1 



00000 






'OOOOOOOOOi 



X 


CC 


X 


UJ 


UJ 


a: x: 


n: 


3: 3: 


IS 


UJ 


UJ 






IS 


is 


is 


gd 




O 
CO 


CO 


CO 


CO 


S 





B 


CO CO 




O 







1 


O 

1 


CO 

1 


O 
1 


O 

1 


00 r-. 
O 

1 1 


5 


O 








O 





^ 


O 


O 


<JD 


U} 


ui 


— 


— 


r~ 


<jD 


n» 


OO r-*. 



1 CD O O CO O O O 



^2o 

06 5 z 

Uj «t — 

" 300: 
5 o °= <-> 



> UJ c_> 

[G =» 

' uj ce 

; ce uj 

~ CO 



to 



: 5 


a 
c 


2 

c 
X 


2 
c 


5 

C 
37 






z 
c 
5 




cc 


a 

1 


2 
c 

T 


2 
C 


a 
c 


2 

c 

X 


2 
c 

X 


2 

c 

X 



o : : : o 



Z UJ Z Z Z UJ 

<t z < <t <; z 

Q- o CL O- Q. o 



2 UJ Z "■ 

3 ic oM o° 
* co ce = »- S 

2 O X 3= Z CO 



a ^cocococofo>->-2:>-^cococococococo 

X =xixi3zttZ'"t2x:xx;xxxx 

UJ 00OOOOO--J_j(— _j m OOCJOOOO 

* o>->->->->-oca« I oo>->-a->->.>->- 

K z ujujujujuj zz uj zz ujujujujujujuj 

£ j££J*S>>o>1j:?SS2J; 

„, ujxxxxxujujzujujxxxxixx: 

"i xcocococococaco«£cax:cococococococo 



o cu ►— o_ o_ 

52^2 2 

>OjUU 

!jj o ti ti 

Uj UJ J— UJ UJ 

uj o "" P •" •" 

o z z "- z z 

Z |0«800 

5 g Z U) z z 

* 25 = = 

S o'z "* 

<o: 

- .H Wl- 

52 *t co uj 00 co 

* co uj x: uj uj 



2 <-> v? to o 

^ 2 — — 2 

ijj o Q Q o 



O «>8 < ** «»0 



^ <kd.ccq:q:q.<<q. 



5 O O O o 



CT> i-O tO r~* OO O* CNI CO ^- CO ^— ^ <jO (jD f— 00 CT> CO 

f^.C7>CT>C7>cnCT>COCOCO^T^^OOOO OOOOOOOOCT) 

O.— ,»-i«^_0000O00 CD CD CD o o 

(jO^i^t^rvrvcnaiOininoo 00000 

OOOOOOOOOCSJtni£(£ (£ (A ID U) i£ 



ST CD o o o o 



csics)coa-)un-^cr>coa->c3 

ooooo<7>nin(£u3 

CSJCNiCSJCSICMCsJCNJCsJCNJCSI 
•— "CsjCSlCNlCN)CNJC*uJ^^^^CNJ 



O p i 



ooooooouatj 

pCSICNlCNJCNiCNJCNIC 

oooooooooob 



C71 CD CT> CT* CT> C7> cr> oS 

- — 00000 



00 — « eg r»- 1 — o «n iO O O 

— 'CSlCNICNlCMCO^^— "CNJCSJ 

OOOOOOOOOO 



370 



u_ 


UJ 

a. 


co 


•x 


t— 








LU 


a 


2E 


z 


UJ 

co 


< 


oc 


»/> 


=3 


Ul 


GO 


U 


CO 

o 


z 
< 


u_ 


S 


o 


o 



UJ < 



oo — ' 



OOOOOOOO* 












joj-u 



fS P «" ir <" 

x a: o •- o 
cc P o cc o 
o "- •< o «s 
u- co u_ u- u. 

ulgOuO 
t3 = _i O _, 

~ uj z ;r z 



UJ cc 



* UJ tt 
>- oo >- 

S£ o o £ o 



muErnS o zd or 



° « Si 

§|i 

"= x: u- c= 

2ujz^ 



^_ ^_ O 

r-. OO O") 



O O O 

r>- WCT) 
O O O 



CDOOOOOCDCDO 



ro ro 
O O 



O O 
O O 



c 


< 
a: 

u 




3 


= 





o o 



= o-- = o-: 



c-> ft: * e 

t 5 ^ s 

* sis 

< SJ kj W 



3 C3 O i 



"* t ** 

i. i. X. 

jj- Cc Cc 

sin 

s? s? s> 



■* cc 


UJ 


•a: 


UJ 


CC 


<t 


o 


O 


* 

O 


z z 


g o 


O- 


cr: 




O 


or 


<_j 


O 


z «t 


°- z 
a: — 


<t 


O 

Q_ 

or 


5: 


z 


o 
o_ 
or 


Z 


z 


— z 

5 = 


o - 


Z 


o 


z 




o 


o 


o 


« 


«S 


<-> Z 




CJ> 




S 


o 


cc 


cc 


o cj 


z 


o 


z 


o 
o 


X 

o 


« 


2S 


£ s 


z 


oc 


z 


<: 


or 


or 


cc 




UJ <£ 


o 


UJ 


o 




«t 


<t 




x <^ 


x a 


o 


X 


o 


o 


X 


o 


o 


OC 
UJ 


1— o 










oo 






ro 


u 


co r^ 












oo 


oo 


oo 










CD 


CD 








o 


e 


O CM 






































<j 




















<x 




2 2 


s 


2 


2 


2 


2 


2 


2 


o*> a* 

o o 



i O O O O i 



371 






i oo ro oo O 

on ^r p 



OOlOOOOOO 



•^ m <jo ^^ ^^ ■— • ^ h **" • «-" * p"- co oo co i 



£ r? UJ LU 



tO 

5E ° 

* K ^ 

* LU ^ 

2 or — 
!z £S> 

!S" = 

i a o >- 
'■ z >- £ 
: < ii £ 
i oo J CO 
«z? 



! 3 3 3 3 



St 



g 



O or lu «t o 

^ ° * « >: 
"* z o o if 
" « z . t 

_- «t < «£ " 



_ o or 
or or S 
2£S 

£§£ 

;? >— or 
o= ^ 

:§ll 



55, 

OT ID CC <£ IT 



o o o o o ooo 



*m z. z. zl 

* O O O O 

* 1— I— I— I— 
-O t3 U U 



O O O 



t IIII III 

5 w www www 



OT CC 
LU LU 
CO CO 



o o 
a. a. 



ea: : : : : : or or or or or or 

LJUJ wwwww UJUJUJUJUJUJ 
coco^'^'^^^wcowwww 

UJUJ<<<<<UIUUJUJUJUJ 

zzorarorararzzzzzz 

ooooooooooooo 

'^o-o-o-o-O-o. 



oo O CD CD u"> 
o o o o o 



OOr-~-.r-.~o — • i 



OOOOOOOOO 







CZ> — • CNI — ■ 


O ~^ CM 


m id to id 
OOOO 

1 1 1 1 


r-* on on 
o o o 

1 1 1 




-^ ^r ^r o — 


O ^ CM 


iT> U") tO tf> tO 


tO On CT> 









ro 


ununm^-cotOtOLOLOtouni/iinLT) 

OOOOOOOOOOOOOO 

1 1 1 1 1 1 1 1 1 1 1 1 1 1 


un 
o 

1 




OOOOOOOOOOOOOO 


o 



OOOOO (3i 



^ : MJ 



2 2 £ >< ° S ! 



oooo 

CJ O O O . 



zzzz«t«:«:«:-a: 

OOOOO-O-O-O-O- 



o_ o_ o_ a. o_ o 



■« •« < «r 

n a: o: o: L' 



O O O O g 

ooooiijliiit!"^ 
oooo^h^Sii^it! 



w£ 





^s*o-s;to 


X 








iis^os 1 ^ 


« 


ZS^uJorSZSa: 



WWW CO ^ www 

5535lu335 



OOOOlu ooo 
OOOOO- ooo 



« «t «t <£ «t I 



Z3 O => O 



or or oc or 



2 oooorESSii 



o >~ 

Z U. 

«t o 

z ,_ 
u. z 

- LU 

s? 

o or 

<t o- 
o o 



or w 
wwg 
w < co 
«t o > 

; uj J5j ° 
z o £ o 

X uj Z 

a- =: <; 
lu * z 






>< « — — OOOOO — 



CM CM OO OO li"J O IT> U") 
OOOOO OOO 

nmn ro io oo •-« — 
OOOOOU->r-^r- 



—. — — — oooooo 

OTi CTi On 0"> On On On On on CM 



on on on on i 



5; ooooooooo 



MCMO-h«NNO 
ICMCMrOrOCOCMCMCO 

1 oo oo oo oo oo on on on 

'OOOOOOOO 



CO CO o o 
' O -* CO ) 

OOOOO O CD < 



OOOOCNICMCMCMCM — — — — • — < — • 

Nr^r^r, ^^^r^r^cbcoabcccoob 
OOOOOOOOOOOOOOO 



372 



OOON 



~ u-> O O I 



ooq< 
CO — « 06 



5 2 

o CC 






— s 

£2 x 

z ^ 

z z 

LU rf 



CO U 

«2 z 

o < 

o 

LU < 



c_> 

> > 

CC CC 


> 


> 


> 




Cd 


O 

CC 


> > 

a: or 


O 
D» 
CC 


> 
CC 


O 
D> 
CC 


>■ > 
CC CC 




>■ > 

CC CC 


co CO 


CO 


(•o 


CvO 


00 


CO 


00 


00 


CO 


CO 


CO 


CO 


CO 


CO CO 


z z 


n n: 


z 


re 


Z G_ 

O <X. 

3: 0= 


Z 
O 
2C 


z 


3Z 

Q_ 


z z 


DZ DT 

a. o_ 


z z 



1 3: 
a. Q_ 


z 


zc 

CC 


z 

re 

Q_ 


CC 

C3 


z z 

IE n: 










UJ UJ 


►— 


LU 


|H 


£ 


£ 


£ 


£ 


£ 


£ 


£ 


UJ 


£ 


ujuj 




CO PO 


s 


£> 





CD 


CD 
m 


m 


~ 


ro 


PO 


ro 


no 


ro 


ro co 


CO <JD 

O O 

1 1 


UD 
O 

1 


UD 

1 



1 


O 

1 


ud 

CD 

1 


O 

1 



1 


O 
1 




1 


O 


CD 


CD 

I 




1 1 


O O 


CD 


CD 






O 


CD 


CD 


O 









CD 





UD CO 


UD 


UD 


cd 


UD 


UD 


r* 


lO 


F» 


r» 


r« 


15 


Ej 


p-. r^ 

















C-* 00 CT> 


O O O 




f-1 r-i ri 


rL r-L r-L 
























N»ff) 


OOO 


OOO 



ri <£ z z z z 
uj a. o o o o 

>£iiii 
ce O O- Q_ Q_ Q_ 

uj o ijj y y y 
££££ ££ 

< Joouo 
55 ■« * * < 

jj jOOOO 

, "5 ►- ° ° O o ; 
o a. a_ o_ a. 1 

5 O ofl 08 ofl »9 ( 



*5 z u u 



5 v 

o 



i <t «t «t «t 



i " > S 1 x: 
^ ce o cc a. 

: ^ uquj lj 

UJ CO —I —I 

■ coco J til £ 



V C3 Q. Q. 

JujZ 

— J «C Z UJ UJ 
U CO => ^ ^ 

^gzSS 

< a CC Q.O. 
J ~ t— CO CO 



Scjoooo-ozcoioo 



** "* t 

UJ h^ ^ ^ 

S ?? t? 
* £ £ £ 

-^ Ui U! Ui 



*s •«* ■"* 

• 3k. i*. S-. 

ct ce ct 

III 

& £> S> 

ui C t ic 



O O O O 1 



,— .^— .QOOOOt 



' o o —■ ~-> 






fOOromnrONNNtvrvoo 
00 x a) 01 Oi j) o*> o*> o*> cr> cy> o*> cr> 



^ _ CD 

co ro co 



373 



Ol N. «fi o 



o _ o _ 
a. Q > o 



z tr z a: 



Q. Ul Q. LJ 
o — . o — 
O CD O O 



O O > 

ce CC £T 



o- :3 j z 5 p 
2 oo co J*j m S: 
o o o °r o ce 

o S S ce S cj 
►— o o UJ o c/> 

Oh-t-t KtD 



<0<i 

CJ o CJ> i 



CO z* CO 
uj UJ 

C3 ^ O 

z e. z 

<t a: «l : 
cogcol 



o o ^j 

55^ 



o o 



Q <-> O 

OjO 
C3 £j O 

2 z z 

d; <•: dz 
5 "> ^ 

s°s 



O O o 

<t <t o 



=J =3 o 
o o ^ 

Z 2 5 

<t •< I 
CO CO S2 

o o S 



0:0:0:0:0:0:0:0:0:0:0:0: 
cocococococococococococo 

■z.-z.-z.a-^.^.-zi-z.^.^.^.3i 

ooo«*oooooooo 

xdzxcexxdzxxxxdz 

0.0.0.00.0.0.0.0.0.0.0. 



O CD O O 



0000 



O O O O CD O 











O 

1 




en 

CD 

1 




CD 


CD 


CD 


<j© 


CD 


<x> 


!*» 


00 


Ol 


r- 


OO 



~^ O") O < 



lOUSfsNi 



I I I I I 



OOOO 



-h 00 en -• -h « -■ 



O O -^ — ■ ~* — — ' 



000000 



lO UD UD UD 'JD ' 

o o o o <~ 



CD O CD O O O O 



* ° 



III 

311 

-J 9 o 

UJ z - 



J2 "E2o 

Z — J Z — J 

*" ~ ° ~ " 

cj Z o: z o: 

z o: uj o: uj 

* £ = t s 

—J O CD o o 

< aflflc«flo: 

_. > !±!> y 

2 « xgx 

cr o 5 o 5 

UJ 

*£ u-> r-~ CO 00 

u- OOOO 

o £; £■ £■ £; 

cj £! £i £! S 



>- >- 
z z 



CJ 

UJ • 

^ : 

0.000 

:£in 

•0 0-0-0. 

^i2o«^^oo«o 

OOUJ^JOOOOUJUJOUJ 

t-niZul- 1— >— ujZZ^Z 
0S0h000u00„0 



uj u, ^j UJ (/, 





zaao 






* 


UBLIC 
HUNT 
HUNT 
CLAW 


O 


-j 


< 


°- S S — ! 




o:zxa 


co 
















X 





2 O O O O X <£ 

«* CO CO CO CO t— X 

g uuuu< < 

"J o o o o > «t 



of ac 






S 2 0." _ 1 z _ 

—J Q.<<K(La.Q.<<<<< 

< <occu<<<OKiro(r 

,_ CO .UJ H GO CO CO .U U .LU 

!£ w<z^wwiiJ<2z<2 

* icyiu^iiityjuju wu 

2 ucjcjSoooooocje} 

— otfltDCM^aioonrnfnoooo 

— — • O O ~h O — « O — « — « -h O O 

ZI Crj^TjoCUjiT, iDCOCOCOiTl^ 



0000 



1- O-O cv 



00 00 00 00 cr, cr. 
O O O CD O O 



r>» O CM l£> ID O 
OOOOOO 



iooooo-HU>fnn«)(j3U)csji 

0-H« NO« «« -. «(NJ< 



OOOOOOOi 



■ OO CJ"> en en o*> CTl CT> o*> 



CD O CD O 



374 



^5 



ca U 

<£ 2 

Q < 

o 



JUl J 
LU I O 

o= s o 

t— ^3 O 

=> o o : 






o 2 — 
=a = i 

= °- < 

§2£ 



OO 00 

o o o 

~ > > 



o o 
>zz>> 

oo oo ' 



cc o o cc q; 



__. _^ o 
o o --• 
I — oo en 
o o o 



OOO CO O O O O 
OOOOOOOO 



c o or 
o ° o 



(/> UJ g 

or uj 



X kj Uj kj 

«t ^ $ 5 

* § £ £ 

S s> ^ =i 



a= ?= ?= 



Z 2 2 



3 ««*«*_i-j_j«a:« 

». £ ,__>-000.-.- 



P or 



* S2 



I O ^* l 
O O O O O O O ' 

^r ud ud i 



I o o o o 



375 



i in H"> U"> iT» ■^ f-» CT> CT> 

1 on micon^'- 



O "> 

UJ 

a: t— 

£3 



' ° 00 
<5 



o C z 
i3=uin: 

O- CC Q_ 






UJ => 



«: a. 

ess 

a- o 2 

c "" Sr 



: OO UJ 

: o. o ! 

: z z 1 

: ■< «t : 

: uj x : 

: ? 5 



020 
o 3 o 
00 — ' 00 
en t— co 



Z J>f J 



o ^0 

O 3 UJ 

ce _j cc 



- s p of ' 

UJ O CO S= 1 
I O UJ 5 
o cc 



zo.uk- 



1 s f> z 5 
cc _- P < 

ujoo°£i£ 

a. < ►- < uj < 

Q. a. Z O 1— C3 

DUUJUJ<U 

oo cc cc z o z 






•< o o o 

!= o o o 
Zflcoca 



« z 

O _j 
DZ —I 

a. <: 



o5 

z Q- 



uj cc cc 

cc = = 

C3 UJ UJ 

z cc cr. 
« a o 
o z z 



o 00 00 

<t 1— 1— 



000 

to to (J 



°= uj uj uj =" E 2 £ 

CCh-t— ►— OH— OtO 
•tOOOOUJouj 

uxxxatSaz 






00 OO I — CO CO CO CO CO CO 



O ~ O — — CM — • I 

' Ms (J3 MJ) iO U) 1 
OOOOOOOl 



I U3 — — ' Oi 



OO — ' — • O — « CM O — . — o O O 1 
OOOOOOOOOOOOOi 



rv is O s. — 1 



5 O Z O, 

* z 5 z 

o = — = 

« "■ o'^ 

-I 2 s z 

« S ° S 

je -j «»: Ij 

uj == <" := 



00: 



o >- 



2 to cc to ^ — ' >- 

-|JSS"j:S?,iH^S?.?-'.S l,, 5-'"- 1 



-j 2 



J_im"'oo:o:jo:_i ,l Jo:jLjJQru.a:Jj_ 1 
uJ3Euj^SCcccscc2^ujcc2uJujcc ccuj2 

Sdo s d>>d>^^ >d 2 g>g>g§d 

^SumSooScSn^oSiL^oxci^iiiJ 



' Z ** . 

"=ioc"I 
E uj ° z cc 

3: ^ >c iS o 



oc <: 2 <: 

p JO j 

**■ ^ oc ^ 

w S itf -S 



_ cr> <r> o 
u. o est o 



* CT> CT> C7> 



1 — . — . o ~ — . ~ ~- . ~ - O < 






O O O O I 



00 — O O O O O ' 



O O O O O < 



■U3MCSIOOO«---h' 

cexooaoooobobooxx' 
OOOOOOOOOO' 



' OS CT> CT1 0"> OS CT> OI CT> CT> 
OOOOOOOOO 



96-500 O - 78 - 25 



376 



£ 


UJ 


o 

__C 


Z 


U_ 


LU 

a. 


co 


X 


H- 


UJ 


UJ 


O 


3E 


z 


LU 
CO 


< 


__£ 


W1 


3 


Ul 


CO 


U 




z 
< 


u. 


5 


o 


o 



• o o o o o o 






o o o 

Csi Csj Csi 

o o o 



= = c 

^ p ce 

LU LU 

ce o= z 
o o < 
z z oo 
««5 
o o o 
S 2 -" 

52 £2 £ 

oog 



a: o_ cc cc cc 



oo g 



00 CO CO CO CO 

ID __>=>=> _3 
o o o o o 

o o o o o 

►— .— t— t— h- 

o o o o o 

o o __> a o 

z" z" z" z~ z" 
o o o o o 



o o 5 
55* 
_c _c 2 _c _c _c 



111 111 L.I ti J I 

1 o o o o o o 

.:_> _>_»_»_-• _> 
a__r:__:__:__:Q___:a_-_:c-: 

cocococococococococo 

LUIUJUIULiJllJliJI 
ZQ-ZZCZZZZOl. 

o«*oo«_:oooo«_: 
_ca-__:_c.-_:_c__:-_:--:o_: 

cloq_q_oci_cl.cl.q_o 



CO CO CO CO CO 



S _!■ 



■— ■ CM -- O i 



■ O O O O i 



I I I I I I I I 

NtNnio oioon 

or. - • O — ■ CM — C_> 
r-_. r-~ r~» oo CO oo oo O- 
OOOOOOOO 















oo 






oo 




oo 


o> 




OO 


cr. 


o 

1 


CD 

1 




1 


1 


1 


1 






1 


o 
1 


1 


1 


1 


1 


1 


































o 


o 


<o 


CD 




o 


o 






o 


o 


o 


o 


O 


o 


o 


































o 


o 


o 




o 












o 


CD 


CD 


CD 


o 


o 



} 


cr 








cs 





^ C-> ^ 



___ ° 2 • ^ ■ ^ 
o l±j o H o ^ ^ 



3 S3_2 

S — ° _o 



>- >• • 

3 3! 

o 



__; _* : 

— _d ! 



•Joji-o-); 



-_ q_-i-___l_-:q_5<:__:_c 

« <t--JX-<-U<C_CO_CL_J 

,- COh-h— COt— COt— . t— t— 

52 LUCO__)_iJ-Ouj_D__:__>CO 

2 c_._Ecoo_ec_>_oc_.co__: 



__l K_. I__ K. 

"_?_?_? 
■ i__ t__ t__ 

* III 

5 _u i*j _u 



_U _l_ Ci_ 



^ ^ 1 

_-___._-. 

f* P= 8= 

.fill 

c_> cc> o 
G: R C 
S 5 15 



CD ~- CD CD CD " 






Oro i 
i en cs. o 



<-< OO ^ O ul^ 
_p —. CD ^ CD <- - 

oo en to - ic go a) i 






o I^^^^.^.^^..^^.;.!..; 



h (£ (oonujN 



r; o cd o 



CD CD CD CD i 



377 



CO H"> o o oo 



' o o o o 



— i& r- — t& 



Q — 



UJ w ' 



O O- 
CC UJ 

a. a: 



UJ . <; 

ut o a: 
o z >- 

O o "J 

- O — ' 
OO o I 



«t l— u_ 

S </> o 

i ce uj 

i o =J 

t— u- m 

, o o 



og2 

GO ^ O 

CDQIO 

S3 

3! 



«* O «t 



i= O fT 

z < o 

u- O o 

O \— u_ 

oe *£ Zj ;c 



o = ; 
o o : 



<t z 



ogoo 

_- - z" z" 

5 z o o 

O O I— t- 



<t <* z * * o 



" o o 



z z o z *z ^ 

o o z o o o 

to oo 2 <^ S o 

O O uj o o z 

CD 02 CD CD -j. 

o o o o o tg 

O O O CJ o ^ 

Q O Q O O O 



I = O UJ — 



^ O o_ Q_ 

cu ce ce 



zzzoozzzzzz 



CD 00 

£g 



o — z z 

ww22 

o 5 uj UJ 
oo 5 _i _i 



o o o o o . 

CJOOU o 
— — — — — o 

00 OO C/0 00 CO OO 

<c <t <: <t « o 
JJJJJm 



— . — . CD — • — < 



ooooo 



OOOOl 
OOOOl 



O O O O O CD 



en UD 
> UD UD (JD 



CD CD CD CD CD < 



-J * o o 

UJ S ce ce 

J| 2 oo 

u ^ x2 

— . I z z 

o|55 

o 5 -• -■ 

Irt if << 

UJ x ? ? 

^ = 2 ° 



E2 

o z Z UJ z z 

2 O O O 

S uj 5 u. . uj 5 

« o ^ o o ^ 

_j S z Ssz 

2 55 g ° 55 ° 

* =- -> « 3- -• 



o o o 



QOOOOOOOOO 



3 uj uj uj 3 3 3 , 

UJ >*««>>> 

CJ uj 3 D D u uj uj 

* o *; ;*: >c: <-> o o 
3J Oj—t—t—oooi 
2 M a: a: a: M MCO 



m oo >>>>>>>:>>> 
uj ocoe<->oooocj>ooocj 



<c<:«t<:<i:«t«t<c<: 



o o o o 



O oo 



o o -^ o o 

oo oo oo o~> o*> 

O O O CD O 



U3 ~ ~ — . 

OOOOOOOCDOO 



378 



o mo o o i 



| CTl O") CT> CT» 



O O O r^ i 



oooo^ m © m o o i 



: z a: 
: or = 

: => r— 

. r- UJ 

: uj or 

;°=q 

: <=> z 
: z «t 



LU Q 



m U 

<£ Z 

a < 

° O 



i— o 
SI 



. zf Q cc" 

Z O z UJ 
I— o S o . 

— a: z 5 ! 

I oo t * : 



z o <: c_> o <c «t 
o Z Q Q E S 



z z z z z z 

O O O O o o 



: 5 <" fcf 

: s s 

• o * CJ 



• < •— ^ 

I 5 CO CO 






O o O o O O Q 

z " « «t z ~ z" 

o 5 5 o o 

I— * ^ I— I— 

U - - C3 C3 

zggzz 

£l X ^ H- X X 
CD "* O O ** ** 

m 5 m cd 5 5 



: WW WW Wl 



w w w w 



OOOOOOOOl 

xxxxxxxx, 



OOOOOOOOCJCJOOOOOOOOOOOO 

xxxxxxxx ,,,, .xxxxxxxxxxxx 

0.0.0.0.0.0.0.0.^^0.0.0.0.0.0.0.0.0.0.110. 
UJLJUJLJUJUJUJUJ^~LJUJLJLJtiJUJUJUJUJLJUJUJ 



~-0000~~-hi 



o o o o o o o 



' CD O O CD O O 

I I I I I I 



U)(£tCU>lO(D(DCJJ(DrvrvrN.0000 
IOOOOOOOOOOOOOO 

I I I I I I I I I I I I I I 



« ^ O CM — o o 
rv fv oo rv rs oo CT) 
CD CD CD CD CD CD CD > 



OOOOOOOOO' 
OOOOOOOOOl 



oooooooo 



3 CD Q O CD 
^ ZL Z. ^. 

£ 5553? 

UJ uj UJ UJ ^ 



o o ; 

X X ' 

o. o- ; 



_j 3 uj o 



5 « < < >■ 



a. a. 
O O ! 



O CD O 

z z z 

533 
> > > 



O CD 

z z 
33 



o o 
o o 



= £>> 

5uj oo 

O O UJ Lu 



°-. ►= ^ 

3 „ 3 

B 2 oe 

Jr z o i 



O. Z 



,33! 



■J OOOOocgOOOOOO 

CJ ooc_>(_>22 c - >0 c_>o<j>o 
S£ S S S S =|LU 2 = z s = z 



3t ac at: 
o < «t 

_J UJ UJ 



z ce o o 

5 z z 

s «o < «t 

UJ <t ^ ^ 



O CJ) 
or Z 
< uj z 

<t uj z 



o o 

X X 

a. a. 



•— t— o — ' — > : 



i"OOQ 



2 u o u o u o 



z <: uj 
•< a- ►= 

O.JW 

Sou; 
o o 5 



35 



uj uj uj 



= ^ '-' = ^ 
O o , ■ o o ' 
"Joz"Lo 

ziizi 

o cd a. o o < 

X uj U' X uj I 

3z^3z : 

O" - 5 CJ 

CC O CP CC CD i 

<<z<« 

CO O UJ to o 
cc - ~. ce 

<Sc5< 



555 

Ul o o 
a. z z 



Sozrzzaeozaeoozz 



O O O C3 o o o » 



o — — « ~-+ — ■ en o < 






ooooooooobCTicna^aii 



O O O O O O O > 



r--.r-.aooo ccooooaoaoaoaoo">< 
OOOOOOOOOOOOi 



379 



OO r-. OO ~- 






UJ <-> 

II 



Sso, 



oo 

go: 



CD C£ 

ce <t 

o a- 

oo ^ 
ce 25 



So o 



o o o 

x x x 

Q_ Q_ Q_ 



o o o 

I I I 



_ _-. o 

rvOOO) 



OO 00 
UJ O 

z o 


> 

cc 

GO 


cc 

CD 
O 


z 

o 


z 
o 


cc 

a. 
a 


OO 


: -c 

■ OO 

OO , 




cc 


o 


o 


z 




£ —i 


o o 




z 
z 




=) 


«* 




CO OO 

2C ^ 


z z 
t— 1— 

O Q 


=3 
Q_ 


o 
o 
cc 


o 

o 
cc 


z 

OO 


5 


Q_ 0. 


o 


cc 






UJ 




Z3 =3 


o 


Q_ 


cc 


cc 


o 


~- 






^ 




^ 




^ 


r- r^ 
















































CD ^ 






CM 








po 


PO PO 






^n 




OO 




^ 


cr> oo 






CD 




CD 




CD 


CD CD 


r-^ r- 


r^. 


r«i 


r^. 


r-. 


r-*. 


r-i 


r-L r-i. 


































CD ~-» 
























o 


CD 


CD 


o o 




















OO 






OO 


OO 




r-* oo 



CD CD CD CD 



a. o <= 



J o - 

o ce 9 

z « 3 

UJ oo O 

5Ses 



^ *^ ^t 

<o O «o 



u *: % *: 

* ;« iy S*j 

» III 

-J CJ O C5 

« Uj kj Uj 



S goo 

t- ^ :*: 



tfc Cc Cc 



3: 
o 
o 
o 


o 


OO 


oo OO 

UJ UJ 

> > 


z 

o 


CC 
Q_ 

en 


55! 

""" "* Q 
OO OO — j 




CD 


o" OO 

«* cc 






:z> 


3 ID 






2 2 x 




O UJ 


a 


«r 


u 


o o 




S 


S S 




. >■ 










:d 




o o -j 




5 


*£ S 


UJ 


2 


22 


Z 
Z 


* 


ffs 


cc 


3 


OO <; 

CJ J 










o 














cc 

UJ 






U 






o 


n 




o 




a> r-~ 




o 














o o 






O O O 


U- 




CO CD 








r-. cm 






oo fo ro 


o 








UJ 


s 


cm CM 


3 


2 


CNJ to <£> 




CT; 


rtl rtl 



— . -^ CD 

r^. ob cr» 



(JiifiO 

ri. OO CT> 
OOO 



380 



■ o m o _ . esi i 

. lo o o oo m i 

i Cm ro CT> CO r»«! i 

- (\ in -. o rs. i 



cdoooocdcdooo 

OOOOOr*.u->000 
CM Cf) CM CM CM CM OO CM CH ^ 

o^ oo cr> o*» cr> m **■ oo oo cj> 



or or a: or a: i 



: or or or or 



flO u 

<£ z 

a < 

o 



_ <£ °° 

i|Ol 

o ce 
5£ 



i 2 5 © 5 ?=; P 

■ oo <£ 

: <t ce 

i s 



■5°Eo5> 



: o ^ 

!5s 

. ce u„ 
. o o 

■ o. 

i ce t3 
i o z 

■ o o 

i£o 
: ce o 



> ° u_ UJ 
ce cr ° o 

I z ^ 



O O HT Cc O I 



r-~ oo cr> 



OOOOOOOO 



cecccccecececececece 



<«t<<«t<t<t<c<< 



000000<t<cOO 

HHI-l-l-hJj,-!- 

oqqqoq22oo 



o o 2 S o o 



oooo 



I I I X 
CO 00 CO oo 



cecccccecececece 
oooooooooooooooo 

UJUJUUJUJUJXUi 

: z z a. z 



oooooo«to 
xxxxxxcex 

0.0.0.0.0.0.00. 





r- CD 


~ 


oo 


-NOmsM 

O CM — ^ O ^ 


O O 

[ 1 


i 


o 

1 


O O O O O O 
1 1 I 1 1 1 




-<T U3 


o 


a 


wooooo 



o — — o . 
ro ro co en < 

O O CD O < 



oooooooooo 



NNlflN 



. . z Jf Z O z z o 

"J <t Q -<tce<:«j:ce 

Sf ce z cc o ce ce o 

5 x^xoxxo, 

5 O t_> O UJ <_> O UJ ! 

* o — ; o ce o o ce ( 

-J O =■ O <!20 O <2 

* "* P-. « 2 «* « 2 ' 
oo =c i" x o x x o , 



o o- 



o j ° o Q — 13o 

1-lUtijf-ujliJliJl- 

pao£p£co(-p 
^-.z^z^z " 

e0<<4<<O4 



"i oooooo! 

x o~- oooo?5^ ( 

_ O^CJOOO 



OQQQu ji 






2 2 

< x o «c o 



' <t o_ *t 



CO 



=: == -=. x 



2C O 



l<3V)U 



2 O GO C3 o o 



o ~ 
oooooooo 



r-. CD 
cm ro 

oo cr> cr> cr» o~> 



csi vn o in <y> kn — r-» cd 

OOCMOOOCDCDCD 

tnwfso^nininwca 
oooocvjtnminio 






— CD O O 

cn ^t -cr uD 
0100-- 



rHC>JO» 

CD CD O CD 

OO 00 OO tO 

CM CM (NJ «n 

CM CM CM CM 



« J^^^^^;^^! 



UDOOOO'X>iX><X><JDO-> 
OOOOOOOO 



381 



o o o o 



<X> -^ r- 
i U"> CT> O 



O — . — . 



cc a: a o; a: cc 

CO CO WW) V) CO 

UJ IUUU I 

z o_ z z z n_ 

o < o o o «* 

X CC x X X CC 

a_ o o_ a_ a_ o 






a SO 



°-" I 

UJUI ^ 

tvo IK 2 



2g 



■ CJ o 

-a a; 



S55 

JKE 

ce Q o 



g o 

UJ lT> O 

CC PQ p— 

Z O p 

O O <£ 

Q- a- O 



o o 
o o 
a: ce 
a. a. 



LU CC 



— ' = 

i- a 

LU OO 

LU LU 

<x or 



o _ S o 
CO — n- CO 






r*-. r*— 0O OO 0O 00 

o o o o o o 
I I I I I I 



o o o o o o 



noocti 
ooo 


NCOCT> 

ooo 


r! i-L i-L 


r-L r-l r-i. 


ooo 
N»cn 


ooo 

r-. OO CT> 



r- en 


r-. OO 


r— r-. CT> OO 


o o 


o o 


o o o o 


ri.r-.f-L 


r-l i-l 


r-l r-l r-l ri. 
















OO -XT 




OOO 


-h O 


o o o o 








rsOOU) 


r— OO 


r-. r-* r--. OO 


o o o 


o o 


o o o o 



8 

O UJ CD i 



to to to 

Cc Cc cc 

S 3 3 



tit 



U WD 
X LU 

t-> 5 oo 



§22 

GO C3 5 



" * % * 

Z Lu Lu ly 
< < 5 < 

* ££ £ 

s ass 



<o <o to 
o= * <*: 
5 5 3 



t t 1 

^. x. ^ 

8=8=8= 
III 

L^ t i^ 



co 5 * -= ■* 

S * l2l2lu 

* 2 >>> 

^ Ij P P P 

^ J2 cc cc cc 



» o o 

S ce ce 

S o o 

* II 

£ 33 



* HI 
S £, 



OOO 



CTJ O i 
o o • 
CO PO i 



Of) o*> oS CT> < 



** — ■ o 

CD O O 

O CN U) 



3 O O O 



OOOOOO 



— . — . o 

r-^. ob oS 
CD O O 



«/> to to 

X O o 

o 
u 

CO CD 

ob oS 

CD CD 



o £■ £- OO j 

O i-^ r-^ r- i 



o cp ~« o 
ob ob ob cr> 

CD CD O CD 



382 



lOOO Qi 



o — • u"> O t 



TOCDO.J->0000> 



— oo c-> — ' 



— a. 

£ X 

uj Q 

z z 

co ^ 

ce «/> 

=> "J 

ao U 

«£ Z 

a < 

o 

UJ < 



z 2 

o i— 
CO 9: 



— 2 tj =» 

•* UJ o oe 

uujq:>- 
uj ce a. 



>- H- u. O 
^ u- t o 



S= i= O X 

_l O CO o 



: A . S 



> 2 < 
2 5 = 

2 < o 



5 £ 

O co 
-I 



o £ z i fc 



z£ = 



< z :x S 

ce o a. £ 



tr O 

> <: 

o o 



UJ < {^ UJ O 

Za;<>< 



5 ce 



CO o CO CO 



O Q C_) CJ 

CO CO 

ao oo 

=> =3 

CO CO 

oe £ oe oe 

< u << 

>- Z >- >- 



II 



oztS 



| CC t3 • Z = 

o o _i 3 co 

£S£goo 
:^-23|co 

o 9- 



?u j??2 



>- z < z 



■< Z 3Z 1* z z 

t3 CO O O O O i 



en — *-* ,-* 



o o o o 



CO «t Z CO CO O I 



iSz^S 



OOOO— '~-"OOOOC\JOOCM~OOOC 

ooooooooooooooooooooooooooooooo 



o : : o 

> • • a 

oe : : 3 

co ; co 

>- or : en 



5 : > Q- 



"J o — . ^ i oe .— 



oe o 



co oe 

a 2 



52; 



°= d 3 



d S^ss: 



k|' 



o oe z oe z 

>- °- ° S 5 5 uj 

o o 5 * 

— ■ oo 2 co 



QWy 



1 



00 00 



Z 0= Z 

SJg 

,„ o H 



f?5< 



O 2 2 2 <_> 



xoi-jii-ttitjir* 



^P^Kg 



S = 



3 oe * 3 



S 
o2 



'o_i<<Q<<i^---!i;o 

O LU O CD UJ O O I 



5 S 





UJ 




















CNJ OO OO 














































U3 <X> UD 


£ 


< 
















CDCDCDOCDOOCDCDCDCDCDCDCDOOOCD 











CD CD CD O — < ~ i 
O CD O O CD CD 



ooobobobobobobobobabi 

CDOOOCDCDOOCD 



U5 r- CD O O 
CD O CD O CD 



383 



«0)^0i 



• z: 
: cc o 
: uj p: 

• ^ 9: 



ce p. ce j=; pi i 



QcqKoqq: 
c±!2:_z_z^-_. 



:0§ 

• 25 co 
:x o 

>9=s= 

:^lo° 

• < 25 ° 

: x: CD ce 

■ O -» ~ 



-C — r-C O 



3g3 



o <-> 3 3 o co 



«* < o ce o z x: . 



a. 5E co S 

"* ^ ce D 
ce 5 5 o 



o o cj> cj> o 

O O O O Q 



CO Q_ 

<Soo 
S o 



O O C_> CJ> <_> 



z z z z z 



cececeoecececece ce oe ce ce ce ce 
cocococococococo co co co co co co 



o o o o o 




-o o o o o 






O t— 1— t— t— H- 






2 o O CJ o o 


z z z z z 




<* z z z z z 

P- X i :x :r i 


:x dt z: :n ;x 




CO CO CO CO CO 




o: co co co co co 


<t <t <t <t <t 




o *« *c ** <t <: 


5 £ 5 S S 


CD 


£s ^ s sx 


cd en — « ^- to 


m 


oocsj « -h-h m 


■— CNJ CO CM — « 




— • — « CD co ~-» Csj 








O CD O O CD 
1 1 i 1 1 


CD 


oo oooo 

1 1 1 1 1 1 




«»ocvjm 


CO 


00 OO CD CD oo tr> 






— « CD co ro CD CM 









o. z z z ; 



z\ z. z. z z. z. z\ 



oo«tooooooooooo 
xxccxtxxxxxxxnxx 



Q_ 


CL. 


a 


o_ 


tv 


a. 


o_ 


o_ 


a. 


Q_ 


Q_ 


Q- 


D_ 


Q- 




































ro 


Cn 
O 


CD 




cn 
CD 


CD 
ro 


CD 

ro 




cn 






CD 


o 


O 

! 


CD 

1 


to 

CD 


CD 


CD 


O 
1 


O 
1 


1 




1 


to 

1 


o 


5 


a 


s 


s 


CD 


O 


5 


o 


CD 


CD 


OJ 


2 


- 


£ 



OOOOOOOOOOOO 



OOOOOOOOOOO 



o o 
9« 



«t —I 

is 



■ z 
• c 


2 

X 
C 


Z 

c 


z 
c 




a 

C 
x 

c 


Li. 




z 
c 

CC 

a 


z 

U. 
C 


Z 
X- 

o 



is 

o a. 



° ,- 1 i— ° .— ' — 1 o — ' 





c: 
<_ 

Z 

c 

CL 




z 


z 











UJ CO «t i 



= *^ 



S 5 2 2 15 co 



u- lj O _j 



j CC CO o O j j 



« sfssiSgSfS 



O-rvrvi 



5 o o o 

^ a. o- a_ 



z 


Q_ 


o 


z 


z 


U 


Z 


o 


o 


z 


Z 


z 


z 


c: 






O 


o 




C J 






c i 


< ) 


1 1 


C 2 








X 


r 




X 














U_ 


iTi 


o 


a. 


o_ 


O 


UJ 






Q_ 


Q_ 


a_ 


Q_ 


UJ 


>— 


o 


rri 


ijj 


o 




o 


U 




m 


m 


iTl 




























£-1 


o 


=6 


Q 


o 


<v3 


CJ 


<t 


•< 


O 


O 


a 


a 


Z 


z 




z 


z 




z 






z 


Z 


z 


z 


3 


3 


ai 


"i") 


iC 


3 






33 


<- 


z 




« 


S3 




I 'J 


a 


a 


(•3 


C) 


cs 


Cj 


z 






«* 


.«» 




z 




















UJ 


UJ 


«l 


UJ 














g 


£ 


x 


£ 


UJ 


X 


2 


< 

CO 


<c" 

CO 


ujg 


UJ 


g 



zzoz <jj <jd z: z: z: z. 



o o — • -^ « « 



oocD^rcnr-^ooesio— -• 

— CD — CD CD CD CD 
CD CD CD CD CD CD — • 



OO OO *T — — « ' 



CO m* v* , 



oooooooooo 



CD CD —. 
r~^ OO CT> 
CD CD CD 






ooooooooooooo 



384 



i OO kAO o 



o o o 





0. 


oo 


X 




UJ 


UJ 


Q 


3E 


Z 


UJ 


< 


QC 


»/> 


= 


UJ 


00 


U 




z 
< 


Ll_ 


$ 


o 


o 



0:0:0:0:0:0:0:0:0:0:0:0:0:0:11:0:0: 

UUJLlILJuJULlIUjUULlIUJUJUUUJU 





































z 




s: 


z 


J" 


^ 


J- 


z 


<r 


Z 


*z 


." 


z 


•» 


«» 


«r 




O 


«' 


a 


o o o 


1) 


o o 


o o 


i > 


o o o o o 




CC. 






T 


£ 


X 


I 


-L 


X 


X 


X 


X 


X 


X 


X 


X 


Q- 


O 


Q_ 


Q_ 


Q- 


Q- 


O- 


a. 


Q- 


Q- 


a. 














— | 


J-j 




rri 




rrl 


rrl 


iTi 


iTi 






rri 


iTi 


rri 


rri 


rri 


rri 


t— 


"" 




l_ 




i— 


•"" 


l_ 


•" 






l_ 






*" 




*" 














































CD 


m 


























O 






O 


o 




ro 




c^ 
































oo 




Ol 




m 


en 


o» 


m 


O 

I 


o 


O 

1 


O 

1 


o 


O 


o 
I 


I 


[ 


I 




i 


i 














£ * 



« ^ O 

r- oo cr> 



-^ ^ o 
roon 
r-» oo en 



r-lOOOOrH^MO-«00'-'0^^rH 

OOOOOOOOOOOOOOOOO 



::::::::: o 

>• : : I : i : i :° 

Z • • UJ 

<.:::::::: z 

i I ! i ! ! i ! IS 

o :::::::: Q- 
t-> :::::::: y 

x : : z : z : uj 



a_ _j a_ a. o a. 

UJ uj UJ uj ,,, UJ 



0050S 
x x =: x 2 
q. o_ o a_ o 



uSi 

0>0050 

1 S SP * S * 
cl o a. a. a a. 



o uj uj o i 



O ii o 

^ z: 3Z 

3 = 3 

o z o 

z: cc z: 

£ S * 

uj uj uj 

= & = 



■a 



t- Z I- 



i»- O Q O -^ O 

^ z z z |= z , 

^.3 3 3 "3: 

< Z Z Z <C Z O- 

OuuuOu< 

ooUjujuj&oujxCjooujujcouj 

ozzrzrozozozzejz 



z = z z £ z 

3 "3 3 ""-3 

CJ O O O O C3 

= 5 z z S 2: 



^T -* -tj <,D U0 r- PO CD — " — — U~> u-. 

~-.r-* — OOOOOOOOOO 
'0000O0CMCSJCNJCNlcr>O"> 0* CM CM CM 






1 06 CT) CX> CT> < 



OOO OOOOO 



> r-. r^. •-» O O CD 
OS CTi OS C7> CT> CO C7> Cf» d> T> CT> 



"^ ^ ^ 

* III 

5 HJ HJ Vn 



— — o 
rv OOO) 





cc ct cc 












Co Co Co 








Co O Co 




% ft % 




§11 




O Co Co 












T 1 ^C 




^ ^ i^ 












% % ft 




Co O Co 


UJ 






55J5 





^ ^ ^ 
















>- 






















« 


OOO 


K 










CO CO CO 




(NCOffl 



385 



>OOOi£i 






r-. V -h O OO "-"T i 



. — to r- — CT> 



i <X) CT) (J3 ■ 



O O O O i 



m (\ ^ ro i 



-2" 

: 3 O "" <JO 
: Q. „, I— O 

1 S O "~ . 



low 



!<o 



oe ] 



Q. .2 9= O O X q; a; 

>(O u UIU 



o uj 5 



;=:^rs;?obzr;-2 

So^SnoUo 



a. 5 

is 



™ So 

ZU^u, 

O — l •« to 

0C OC ^ = 
O UJ g ^ 

,, o oo 

o _, >c 



o u7 



§t= 



to o> 

uj £? - 
Q- q; «t . 

IIS 

So°Eo=i 



o 



£ oao "* 

ae - oe o 

O a. o a. a: 

2 UJ Z UJ Q. 

— a; — ce uj 

t D t «-, «>= 



Q. O Q. fO u . 



is 



o= lJ ^ «= 
^ ^ 2. =c 



uj c^ i 

l. CD ' <j CO 

O O i - 



) ^ o o 
: GO or 2 



~ -~ o — — • 



r- r- en oo i 
O O O O ' 



i o o o o o o 



i^ fx tc yj rv rs rx ( 






oooooooooooooooo o 



O O O CD O 



o o o 
(^ oo oo 

O O O 



> ; =r =e ST 



oo uj if if 



O O DC B ^ 



u ll.22Ull.l)lUU' _ 

zocoo_o=o«=zzo 

OOOO^OoOOOO 



(- o 
, •< o- 
ae ce 

O O ; 



o o 5 ^ o 



«K * 



o z ""■ °- ' 

*-* — 7 UJ I 

1 — » - i^ — ' 



uj _i ^. 
Sou 



S «£ <t uj = 



O I— o «t o 



i— ce ce 
o. £ t--. 

08 i2 Sc 
o X o 



foof 

"<UZ< 
Z O z = Q 

--I o z _l 



cc or ff! i 

UJ * uj 



» o oe o oc a: 
3 i o 3: o o 

— ' Q_ u- Q_ u_ u_ 



£<2£: 



<i<n 



a z g <= z 
£i »— a uj »— o 
| =§g"g 

3 GO U- ^ GO U_ 
O So "- 1 — S "- 1 

« i|gi| 

<« ^ co o i co 
je a= — ' «t ce — { 
uj o — co o — 

cc ZT CO U Z CO 



' ~^ OO CT> U"> CO r-. OO 

I CM CT> 0"» O O O O 

oooooo—---'--' — < 

i CO CO CO CD 



= aio t?> o - 
u. ro cnj cr> ^r cm 

U_ OO CNOO 



Z CD O O O O 



CD O O O CD 



0"> en ix> CO CO CD CO i 



coooooooo 



CM CNI O O O 
CD CD O O O 



1 O CD O O 



386 



-<O^OlOOO«Oi 



(O >-i m f io id ' 



iOO<NJ(T>r-*.ff>OOOOOOOCT> 
r^crio^'— • »-^ csi tfS u"> t^O to •— ' 



s z 

uj < 



00 U 

<£ Z 

a < 

o 



2 <t u z o 



■< z 5 z 

UJ U X 
O O O ^ 
z O ._ — 

ce r co co 1 

ujr <uj- 
00 o u cr i 



i<2u w = i 



!o -o 
o u 



ft" 5 - 

= 25^ 



sty<s 



co?= £ > 

-UJ CC od 

=! z o 

• z £ =>"- 

S « S - 1 x 

£r , "> =" 2 

U_ UJ UJ 

Q ^z 
z m S 

<|S 

CO 2 X 

UJ a, UJ 






"uis! 

CO of > 

if w 
uj Q 



*■ UJ 
Q 1. 



5cUuj2 



:coO<: ;o_ 

J ■?:> < to : J. 

>ss"i3S 
;£is§ 



O cc 



uj cr ^j co iTj 
2 S S ffi "■ 



o 5 ■= 2 , 5 



f=5! 

z o 

UJ o 

ex: _i 



co cr 



_i a o 
< cr 

Z U °5 CO CO 

Zug<y 

«t cr 5 u cr 



_i _j <o o 

2 CO 
X =• 

CO o 



cr .;- < uj 

°s s il 



-Eo« 

o o S 
o i- « 

s|l 

S>OuT 

9o°o 

' O. O CD 

'5=z° 

CO o * 

z cr i- oe 

oouo 

£ uj g z to 

^cr'o-og 
u « cr co o 

x o < 1 



co o 

83 



ujOS 

2; " o? 



uou.cruu.ua.Si 



0000 



00 ^-< 

O O CD O 



*■ — « e} in r*» ^ co ~— u"} ^ 01 CD 00 00 •— ■ ^ « 
OOOOOOOOOOOOOOOOOOOOOi 



CD 00 00 *J"> 



< CD CD CD CD 



=5 U 
SS 

z CC 

5£ 
uj cr 

« OUJ 

5 ait 

* cr o 

•» UJ •- 

-j ri: co 



U y UJ 



tr co co <; 

<-> H «£ — ' 

Si 

cox 



CO I 



a cr 



1 ° 77. x : 
co z £g co ; 

uj 5 uj uj : 

MS*! 

cocczco 

0000 

CO Z U CO 



u =* <t cr 

- m z £ 

= uj CO 

01 °- o if 

o cr " x x 3: 

UJ _, CO ^ CO CO 

06 < 2 < UJ UJ 

DP 1 Z CDCC 

o « h ~ >- o o 

umcD 



GO O 

o o 

UJ 

553: = 
5 S 1j -j 

_t _J UJ UJ 

a. z co co 



z a. 
o < 
u cr 



— uj uj U 



or x z 



co a Yn <s> 

r O K x 

- 1 - co u ■*■ ' 

CDZZCDCO-DCOuji— ZOD 

oooooooa:«*oo 
imuucocoxaou.zum 



! x _i a «3 



O. mnnP)OmrsfvrNrs00C0»O^OOO««"^^(MNN(fl©iOlOU)(N 
X 0000--'000000000'«000«^-^-<^000000000 

uj fff^"»^^u)iou)co«ooM — -'OOXoo — ' H -^' H - - >nin»noooooo^ 
OloioiooooooooootsiNNNNtnfnmnnmmminioujioujio 

— 00000000000000000000000000000000 



t^ ^ ^ « o o 



OOOOOOOOOOi 



0000000001 



OOOtOfsNsrsN 



387 



o _ ^ oi , 



r-. O OOOOOOOO 
O CT> H"> tO CT> CT> 0*1 0"> O** CT> 



z z z z z z 



OT 


OB 


k -r 


rr 


cr 


or 


or 


or 


or 


or 


z 












—i 


— > 


3 


-> 


J 
























'—j 
















LU 




or 


or 


OT 


or 


or 


or 


or 


or 


or 


or 


o 


Q 


o 


o 


Q 


o 


o 


o 


o 


a 


o 




.7- 


^ 


.i" 


«- 


^ r 


^ 


*' 


*"■ 


^ 


*» 


•a 


«t 


<t 


«x 


•«. 


<. 


<c 


«t 


■a 


•« 


1 




o o 


1 J 


o 


o 


o 


o o 


a 


O 




z 


2: 


o 


Z Z Z Z Z Z Z 


I 






z 








■>_ 




•>. 


->_ 


£: 






o 


















c_> 


o 




o 


o 


o 


o 


o 


o 


o 






























X 


< 


« 


« 


< 


< 


<t 


•1 
























«: 


r 


s 


z 


.- 


.?■ 


." 


«- 


." 


«" 




52 


2522SS5 




o o 


o 


o 


o o 


o 


o 


o 


o 




CJ o 


o 


u 


u 


u 


CJ 


CJ 


C.J 


a 




o 


o 


s 


o 


a 


en 


o 


o 


o 


o 




B" 


E 


£ 


-p- 


?- 


=- 


i" 


z 


i' 


i" 












< ) 


o 


o 


o 


r> 








CJ 


















u 


CT 


<T 


o 


CT 


CT 


n 


<T 


o 




<r 


*r. 


«I 


Z 


z 


«r" 


«» 


<r 


Z 


z 




T 


I 




i 


t 


X 


X 


T 


X 


























«t 


<1 


2 


«t 


«t 


<x 


<1 


<t 


•a 


< 




* * 


s s s s s s s 




en 


en 


CO 


o 


O 




a 






CO 












cr> 
















<x> 








oo 


CO 










o 


o 


o 


o 




o 
1 




CD 


f 


o 












m 






CT) 


m 












o 
















te 


^ 


Ol 


— 


^~ 


00 


I-. 


CO 


en 


en 





arcr:arortt:ccQra:ccL^ccccorQrcccccECECcQrarcc 



0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0.0. 



O O O ~-< ~^ « 



OOOOOOOO 



-H^^orsoOinrs»n«-.«««« 



oooooooooo 



O O O CN( — < 



O O O O O « 



I O ~-« O O O I 



' O O O O « i 



I O O O O O i 



Q z z z 

«» 2 £ r, 5 5 2 



a o3E**oooixo 
UJ f..««^coooJ5co 



LU O LU LU UJ UJ CD I 



000 

III 
a_ o. o. 



uj a. o. a. 



— 1 a. cc a. <c 



; o o o o o o 
; 1 a: ^ 1 1 1 

' o. a. a. a. o. a. 



000000 



00 

: ^ ^ « ^ ^ ^ 
£ 2 5 2: £ 5 

OOOOOO 

loommcopPPPPP 



: > > 
; q q -j ■ 



1 o ^ 



ce cr: cc 



<t «« <Z O ^ 



* ^ ^ ^ to o 
2 o o o o co 



tototo 3 '' 5 * 1 '^ 3 ^^^ 
qoluujlu22lulululu 

^<SSSO_Q_a_CuQ-CL. 

ooi^j:*^^-*^^:^: 
. .*— i— k-cocococococo 

<<3DDUUjLJUJLUUJ 

00400003^^X1X1 

oocococooooooo 



^ => «c <: uj ; 

O O CO CO X 1 
CO CO O O O 1 



000 



o o o o o o 



■ oo-^~~-.ooo 



^ ^*- ^ N rv 00 00 ao 00 00 CT^ en ct» ct> C7> C7> ct> ct> ct> CT> C7> ct> 

0000000000000000000000 



388 



p * 



ui O 

3E Z 

uj < 

to ^ 



• ce ce a: o 

: => => =j -J 

;•—•—•— 5- 

: oc ol or _l 

: o a o ^ 

Z Z Z «c 

: < « < ce 
<-> ^ ^ =d H " 
o . . . 

- o o o 
zooo 
p < < <t 

Z I I X 

— o o o 
00 o o o 



— o o o 
" (J o o 



oo U 

*£ Z 

O < 

o 



O O O 
r-v. OO O*) 
O O O 



o o a 
r- oo o"> 
o o o 





NT C» 




O ~« CM 








rs 0O0O 




o o o 


r-. 


ri r-L r-L 












— <o CM 




O O CM 








rv woo 



2 ass 

« Uj Uj tM 



i: ^ •"* 

j- :>-. i- 
^ P= f* 

5 5 5 

x S53 

< $o to So 



CO P °= 



<: «t «i «t 
■*• o o o o 



3 O O O 

a 
w 

— . — . o 

r-^- ab oS 

O O O 



O CD O O 



389 



o o o o 






2 * 
s « 

«' o 

>- *" 

en UJ 

uj o 

ii 

< O 



GO GO 00 OO 

LU UJ UJ UJ 

uuuu 
> > >• > 

0:0:0:0: 

UJ LU LU LU 

00 00 00 00 
or as a: os 



0000 



K 2 O _ 1 
o S "" "" 
S = o o 

5 _l LU LU 

oOUO 

£ o Q Q 
2 o o 

050:11 
a: f— a. a. 

a. LU LU 

lu^ctq: 

LU ° ° 

O Q£ O o 



3 « 

3 o 



5 < 



-J OO >< 

< o >- 
Jaw 

^ — ! 

CM EG 



r^. 00 CT> 


NCOO) 


OOO 


OOO 


r-L r-L r-L 


r-L r-L r*L 














OOO 


OOO 






rv 00 0» 


r*-* 00 0"> 


OOO 


OOO 



o ^ 



0000 



a>oo po id 



o o o o 



z «»_; 



^ ^ ^ 

UJ K. K. K. 

£ S= r? 3= 

i m 

* & & & 

* ^j ^<i (<j 



Lij Lu Lu 



•^ t 1 

^- :x. i- 

Cfc ct % 

III 

S> B <S 
1^ Ci ^ 



> UJ uj > 

ce 5 3 cr 



Q. I 

E LU 

■is 



* Q O O Q 

3 0000 

« a: i ^ x 

_ z z z z 

S 3553 



«t «t <t «t 

S Z 2 E 

OOOO 



lu |-° 

zf lu <: 

5 o 3 z 

* 2Z Z ^ 

O «* —, LT 

3 s =i - 

« uu o 

« S >- o 

z z 0= «t 

lu < o: co 

lx >mu 



< 00 00 00 






3 OOO 



UJ 1 ~~~-- 

££ S 

go to o o 

t O orocvj 

5S i^- 00 00 cn 

O 0000 



OOOO 



« r-^ 1-. r-^ 



00—. 
woboo 
o o o 



390 



o o o o 



i — CM *T O 



■ OOOuDOOCnOO 

' (£> in cni a? u3 oo ix> <x> 



O O O 
O CD O 

ooo 



«2 Z 

a < 

° O 



i5o 



: Q H (£ 
. UJ =J 

' I X <T 

<£ . ?f 
S £ - 

zo2« 



.J3 

: o «t 



' Lo p ° ° 

" <c cc i "~ »~ 
> ^ o o o 



en tn ci **- 



O O 



V)COC/)t/)MW(/)WOOV)tO(/)WOO 



Q.HO.HQ.11Q.Q.I1CLCLQ. 



: S Q o S S 



'-"OOOrH — r^rH^^H 



o o o o o i 



(SJrHO-"00^ 

o o o o o o o 



o o o o o o « 



o o o o o o o 



ooo 
r>- oo er> 
ooo 



o o 

a: 3: 
a. a_ 



Is 



« id 



fyy CO tfl CO * CO CO 00 

<k zzzinzzz 

« ooooooo 

£ 0000:000 

* SSES°°2SZ 



o 

z 

* 






««<^<ac«B«BKC$ 



CD CO 

z z 
cc cc 



. to 



CO I 



*2 i7 ) Q ^ u"* <"" > ^ ^ ■ '■i ' iTl U - J ^ r * > ' 

-* Q.<tSo_'«SSQ_Ci-SS<t: 

,- co _ ►— co . t— t— CO CO 1— »— .1 

fr xcoo^toooir^oocoi 

2 OOcOOOtOGOOOCOCOCJi 



"* ^ ■<*: 

UJ K. K. k^ 

o ^ %: %: 

< 5 ^ ^ 

* $£ £ £ 



1 ai — « CD 

I — • O CD O 



— « CD — • m <JD 
CD CD O CD CD 
CO u"> r— -«3- (JD 



<J csi IZ Uh 



O m — . — . 1 



I <JD U3 
OOOOOO 



CD CD CD 
— . ^ CD 



391 



UIO o o 
oo o vr> m 

— OO OO CM 



to 3: 

— ' o 



|= ° 

* 5 

: z => 

'* i 



UJ ce 

3t 



£ CO 



zS 



lu z 

|1 

z = 

!|S 

i OO O 

ill 



CO o 

_J d 



i q; O 

' a- °. 



S 08 



CO w„ z 
I 3: 5 o 

Q. Q. S — 
«I « a. £ 

&:□:<: — 

C3 C3 I — CC 
O O o o 

t— t— 2 co 

O O O CD 



z ce z 

cl P ot 

2 2 
; i— co •— 

|o°o 
ee o o o 
<: «t i «* 



CkCL.cccoa-Cc:o.cc 



_- _ o 

rv OO O) 

o o o 

I I I 



~- CT) -^ 



o o o o 



O -- O O 



oooo 



s= s= s= 
III 

^ C: C: 
$o So $o 



» oooo 
=T cc cc ce a: 
3 oooo 



« CO CO CO CO 

2 S S E s 

= oooo 



i 13 3 ^ CD 



ce cc x: cd 



£ o ^ 

O X: o 

cc o- cc 
o 2 o 
o 5 ° 

cc ^ cc 

f3 Z3 C3 

=> o_ => 

O uj O 

X CC I 



ft. £; ~ ~ ' 



OOOO 

O ID O O 



OO CM M O 



o o o o 



o o O 



96-500 O - 78 - 26 



392 



o 


Z 


u. 


Ui 

a 


i— 


X 

UI 


LkJ 


a 


z 


z 


UJ 
tSi 


< 


ac 


l/> 


S 


UI 


OQ 


U 


o 


Z 
< 



i * 



UJ < 



i!E £ 



ac ai ai 
Z3 => =3 

UJ UJ UJ 

ac ac ac 

o o o 



I&I 



UJ UJ UJ 

CO CO CO 

UJ UJ LkJ 

O O CJ I 

o o o 
ac ac ac i 
o o o 



z cc cc 

UJ UJ 

Q •"" •"" 

3 to to 



o o o c_> o c_> 
o o o o a o 



o o o 

>— I— t— 



O O O O CD O 

I I I I I I 

t£ (D ID r^l — P-. 

o o o o o o 



z a, z a. z z z 
o «t o «t o o o 
a: a: i oe x a: ac 

Q. C7 Q. U (L O. Q. 



CO 


O-h^O 


O ~-> 


1 


77-06 
77-07 
77-07 
77-06 


t*P oo 

o o 

1 1 



r- 00 CO 

o o o 

I I I 



ooooooo 



•X «x «x «x «c < 



o o o c_> o o 

a a: a; arced: 

cc cc cc a; oca: 

<t •< «t «t «* «t 



ocloi-o 
"cocjco 

— « =- 



!£ CC 



i o 5 

i -zizz^z 1 

* «o<o<«< 



* _ 
S 2 



z o z o 



-J o.ce«tcc"to.<t 



2, 

a. ' 

«t o 



2 uiujuuu 



"* ** ^ 

UJ ^ K. »^ 

*» .* .* .* 

z iy if if 

* III 

3 gSS 

2 yj yj yj 



S> S> S> 
C: C c; 

*2 $2 iq. 



o 


to 


o 


m 




no 


u-> 


CM 




to 


2 


m 


CO CO 










































o 








< 




S 












U") 




















U~> 


U"> 








































o 






































































oo 




uj 


















CD 


o o 


o 


















a 
















































rn 






















ro 






































oo en 








o 


CD 


<T> 


CD 


O 


o 


o 









393 



o o o o 



=> = «=> =3 
►— r— CO r— t— 
UJ UJ -J UJ UJ 
CZ OL **. 0C CC 
Q o eg Q Q 
Z Z. , Z Z 
1 «* 



LU ^ 

g£ 

UJ — 

= to 
05 

OC UJ 

Q- Z