Full text of "Vis Medicatrix Naturae: The Healing Power of Nature"

"Vis Medicatrix Naturae" 

-The Healing Power of Nature - 

Modern and Traditional Approaches Towards 
human Health Care 



by 
Nishad Jayasundara 




Thesis Submitted in Completion of the- Senior Project Requirement 

College of the Atlantic .., '^ ^ '<f 

May, 2005 ..^ # J 



/ 






Sfenior Project Director 
Dr. Nishanta Rajakaruna 



Academic Advisor 
Dr. Donald c4ss 



Digitized by the Internet Archive 

in 2011 with funding from 

Lyrasis IVIembers and Sloan Foundation 



http://www.archive.org/details/vismedicatrixnatOOnish 



~ Preface ~ 

Life has an inherent ability to maintain and restore its health. Role of a physician or 

a healer is to facilitate and enhance this ability in a patient, augmenting the healing 

power of nature. For thousands of years humans have taken a number of different 

approaches to maintain and restore their health, from spiritual healing to stem cell 

cloning. My senior project has explored two such approaches, a modern 

biomedical research approach and an indigenous medical approach using 

medicinal plants. Chapters One and Two describe my first-hand experiences 

participating in cutting-edge biomedical research in two of the world's leading 

molecular biology/biomedical research institutes. The Mount Desert Island 

Biological Laboratory and The Jackson Laboratory in Bar Harbor, Maine. Chapter 3 

describes my attempts to explore the role of indigenous medicine in treating 

diabetes in Sri Lanka, a country with a 2500-year-old tradition of using plants to 

maintain and restore human health. 



~ Table of Contents - 

Preface 1 

Table of Contents II 

Acknowledgements IV 

Chapter 1 : General Introduction: Quantitative analysis of hsp70 mRNA 2 

expression under salinity stress in the euryhaline shore crab 

Pachygrapsus marmoratus 

1.1 Abstract 03 

1.2 Introduction 03 

1.3 Materials and Methods 04 

1.4 Results 06 

1.5 Discussion 11 

1.6 Conclusion 13 

1 . 7 BibI iography 14 

Chapter 2: General Introduction: Effect of Leprdb-SJMutatin on 17 

JAK/STAT Pathway in NOD/LtJ and db 5j Mice 

2.1 Introduction 18 

2.2 Materials and Methods 19 

2.21 Plasnnid constructions, transfections 20 

and cell culture 

2.22 ^-^1- leptin Binding Assay 20 

2.23 Protein Extraction and Western blotting on ... 20 

COS 7 cells 

2.24 Protein Extraction and Western blotting on PECs 21 



2.3 Results and Discussion 20 

2.3 V-^l- leptin Binding Assay 21 

2.32 Wetern Blot Analysis on Transfected COS 7 cells 22 

2.33 Wetern Blot Analysis on Thioglycolate ... T7 

Induced PECs from NOD and db 5j mice. 

2 .4Conclusion 31 

2.5 Bibliography 32 

Chapter 3: Sri Lankan Indigenous Medicine: Diabetes as a case study 

3.1 Introduction 35 

3.2 History of Indigenous Medical Systems 36 

3.3 Use of Pant Extracts in Modern Medicine 37 

3.4 Diabetes in Allopathic Treatment 38 

3.41 Insulin Injections 41 

3.42 Oral Antidiabetic Drugs 44 

3.5 Sri Lankan Indigenous Medical Approach to the treatment 46 

of Diabetes or "Madumeha" 

3.6 Plants Used Against Diabetes in Sri Lankan Indigenous 49 

Medicine 

3.7 Experimental methods used to investigate anti-diabetic 79 

properties of traditional medicinal plants 

3.8 Current Medicinal Plant Conservation Efforts in Sri Lanka 81 

3.9 Conclusion 84 

3.10 Bibliography 85 



~ Acknowledgements ~ 

I must first thank my advisor Dr. Nishanta Rajakaruna for inspiring me to do this 
project and providing invaluable insight and guidance. 1 would like to thank my 
academic advisor, Anne Kozak, for being supportive throughout this project and 
editing my thesis even at the last minute. I appreciate the freedom they have given 
me to explore three distinct research projects and find a creative v^ay to 
incorporate them into my Senior Project. 

I must acknowledge the invaluable contributions of Dr. David Towie and Dr. 
Celine Spanings-Pierott during my project at the Mount Desert Island Biological 
Laboratory, ME (MDIBL). I would like to acknowledge Chris Smith and Michael 
McKernan at the MDIBL and Charmantier Laboratory at the University of 
Montpellier 11, France. My work at the MDIBL was supported by NSF Grant 
Number IBN-0340622 to DWT. 

I would like to thank Dr. Edward Leiter at the Jackson Laboratory, ME for giving me 
an opportunity to carry on a research project in his lab and guiding me through it. 
Many thanks to Dr. Huie-ju Pan, Darcy Darcy Pomerleau, Dr. Chul-Ho Lee for 
teaching and directing my research at all times. 1 would also like to acknowledge 
Jason Beckswith, Peter Ryfsnyder and Pam Stanley for their support during my time 
at the Leiter Lab. My work was supported by a grant from the American Diabetes 
Association and NIH grants DK36175 and DK27722 to EHL. 

Without the candid contributions from Sri Lanka Ayurvedic Department, Ministry 
of Indigenous Medicine, Institute of Indigenous Medicine Research Center and 
Indigenous Medicine Drug Corporation the study of medicinal plants in Sri Lanka 
may not be possible. I would like to give my special thanks to Dr. W. Liyanage for 
introducing me to indigenous practitioners throughout the country. Also, thanks to 
the support received from Dr. Dayangani Senasekara and Mr. Amarasri Dodangoda 
in contacting practitioners in Sri Lanka. All their efforts have been invaluable in 
completing Chapter 3 of my Senior Project. 

1 am indebted to Hannah Hastings for her valuable time in helping complete this 
project in a timely manner. Also, I owe much gratitude to the faculty and staff at 
The College of the Atlantic for helping me with many aspects of this project. 
Finally, I would like to thank my family and friends in Sri Lanka and Bar Harbor for 
their continuous support and friendship. 



CHAPTER 1 



Quantitative analysis of hsp70 mRNA 

expression under salinity stress in the 

euryhaline shore crab 

Pachygrapsus marmoratus 



Ion regulation is one of the most important biological functions in humans and other 
organisms. Severe health conditions as cystic fibrosis and heart disease result from failure 
to regulate ions across the cellular membranes. Scientists have considered using marine 
organisms as a model to study ion regulation, since these animals experience rapid salt 
changes in their natural habitats. Pachygrapsus marmoratus (Pm) is a crustacean found 
primarily along the Mediterranean coast. This species is subjected to physiological stress 
due to large and rapid fluctuations in seawater salinity. Such conditions may elicit 
changes in the gene expression in its gill tissue, as gills play an important role in their 
osmoregulation. Along with Dr. David Towle, senior scientist at the Mount Desert Island 
Biological Laboratory and Dr. Celine Spanings-Pierott, professor at University of 
Montpellier II, 1 have investigated the expression of three osmoregulatory genes, Na/K 
ATPase, Na/K/2C1 co-transporter and V-ATP ase, and Heat Shock Protein 70, a gene that 
is responsible for refolding/repairing damaged proteins. 

Through this research I hope to understand how a small crustacean such as Pm, living in 
the inter-tidal zone and experiencing rapid salinity fluctuations, maintains osmotic 
balance. A thorough understanding of the well-controlled osmoregulatory mechanisms of 
such organisms might lead to enhance or control diseases caused by defects in ion 
regulation. 

The research provided with me an opportunity to understand and learn cutting-edge 
molecular biology techniques and their use in modem biomedical research. I have also 
had an opportunity to travel to Montpellier, France to collect fresh tissue samples of Pm 
and to San Diego, CA to present my research at the Society for Integrated and 
Comparative Biology Conference. 



1.1 Abstract 

Marbled rock crabs {Pachygrapsus marmoratus) are subjected to physiological stress due 
to large and rapid fluctuations in seawater salinity. These conditions might elicit changes 
in the gene expression of heat shock proteins (hsps) in gills - the most important 
osmoregulatory organs. Through this study, hsp70 cDNA from Pm was sequenced and 
hsp70 mRNA expression in anterior and posterior gills was quantified. Under low (10 
ppt) and high (45 ppt) salinity at different time intervals, gills were extracted from Pm, 
following transfer from normal seawater (32 ppt). Real-time PCR analysis showed that 
hsp70 mRNA is expressed equally under control conditions in anterior (G5, G6) and 
posterior (G7, G8, G9) gills. Following the transfer to low salinity, hsp70 expression 
increased about 2-fold in G5, G6 and G9 at 24 and 48 h. However, in G7 and G8 it 
increased by 3 to 4-fold within the first 6 h and slightly decreased by 48 h. Following 
transfer to high salinity, G5, G6, and G9 did not show any significant change. However, 
G8 showed a 2-fold increase within 4 h and by 48 h decreased gradually to the level 
observed under control conditions. In G7, hsp70 expression increased about 3-fold within 
4 h and about 4-fold in 6 h, then slightly decreased at 24 and 48 h to a level that was still 
twice the amount expressed in controls. The expression of arginine kinase (AK), a 
putative housekeeping gene, showed nearly equal levels at all times. These results 
confirm that hsp70 is highly expressed under salinity-stressed conditions and that 
posterior gills, gill 7 in particular, play an important role in osmoregulatory adjustments 
of Pm. 

1.2 Introduction 

Organisms respond to enviroimiental conditions, such as salinity and thermal stresses 
through many physiological mechanisms. These mechanisms are regulated by rapid 
changes in gene expression under non-optimal conditions. Molecular responses to such 
stress situations normally involve the up-regulation of one or more heat shock proteins 
(Feder & Hofmann, 1999). 



Heat Shock Proteins (hsp) are molecular chaperons assisting in protein refolding under 
stress conditions. These proteins found in all organisms from prokaryotes to mammals 
are highly conserved throughout evolution (Feder & Hofmann, 1999). Expression of hsps 
under stress conditions is well-studied and documented in a number of organisms, 
including marine vertebrates (Specs et al. 2002; Boutet et ai, 2003). 

Marbled rock crabs {Pm) inhabit coastal regions of the Mediterranean Sea where they 
may be subjected to osmotic stress due to large and rapid fluctuations in seawater 
salinity. Studies have shown that the expression of genes encoding ion transport proteins 
in the gills of this species is responsive to salinity change (Mouneyrac et ai, 2001). 
Based on data from heat shock response to osmotic stress (Spees et ai, 2002), extremes 
of salinity might also induce changes in the expression of hsps in the gills of Pm. As 
noted, with differential ion transporter gene expression in gills there could be a possible 
variation in hsp expression in different gills. In this study, hsp70 cDNA of Pm was 
amplified and sequenced. Its expression was measured by quantitative PCR in anterior 
and posterior gills which were taken from animals exposed to a time course of dilute or 
concentrated seawater. 

1.3 Materials and Methods 

1.31 Acclimation and RNA isolation 

Crabs captured on the French coast and acclimated to 32 ppt seawater were transferred to 
either dilute (10 ppt) or concentrated (45 ppt) seawater. Controlled groups were 
maintained in 32 ppt seawater concentration. During the transfer, care was taken to 
maintain animals at natural habitat temperatures. At discrete time intervals following the 
transfer, from hours to 48 hours, anterior and posterior gills (5^ gill to 9* gill [G5 to 
G9]) were dissected individually. Extractions were preserved in RNA/a/er (Ambion, TX, 
USA) for shipment to Maine. Total RNA was purified from all the samples using RNA 
agents® Total RNA Isolation System from Promega, USA. Total RNA was analyzed for 
its purification and quantified by Agilent technologies 2100 Bioanalyzer. 



1.32 cDNA synthesis, PCR amplification and sequencing 

Poly- A mRNA in 2ng of total RNA per sample were reverse transcribed using oligo-dT 
and Superscript II reverse transcriptase (Invitrogen, NY, USA). The resulting cDNA was 
used for sequencing and quantitative PCR analysis. Hsp70 cDNA was amplified using 
species-specific primers based on a 600-bp hsp70 fragment serendipitously amplified 
fi-om Pm in an earlier study: 

Forward primer (1 13FN): 

5 '-TATTGACCTGGGAACCACCTAC-3 ' 

Reverse primer (486RN): 

5 '-CTTCGGCAGTCTCCTTCAATCTT-3 ' 

Amplification products were gel-purified and tested for molecular size. The gel bands 
were excised, purified, and extracted using the MinElute gel extraction protocol (Sigma- 
Aldrich, CA, USA). Purified products were sequenced by ABI Prism 3100 automated 
sequencer at the Marine DNA Sequencing Facility at the Mount Desert Island Biological 
Laboratory. Partial DNA sequences were edited and analyzed using Chromas software 
and confirmed by BLAST analysis. The complete hsp70 cDNA was obtained by 3'- 
RACE (Invitrogen, NY, USA) and 5 '-RACE (Clontech, NJ, USA), using primer walking 
as required. 

1.33 Real Time Quantitative PCR Analysis (RT-QPCR) 

Species-specific 1 13FN and 486RN primers and real-time quantitative PCR with SYBR 
green were used to measure the relative expression of hsp70 wRNA using the Stratagene 
MX4000 Multiplex Quantitative PCR System. Triplicate samples of cDNA prepared 
from equivalent of 0.1 micro gram of total RNA were used in RT-QPCR runs. Two sets 
of RT-QPCRs were run to compare the /wRNA expression in samples following transfer 



from 32 ppt seawater to either 10 ppt or 45 ppt seawater. The relative abundance of hsp70 
wRNA in test samples were compared to samples obtained from control animals. 

1.4 Results 

The Bioanalyzer revealed three closely-spaced peaks of rRNA (Fig. 1.1), the crustacean 
28S rRNA fragmenting to two smaller products, one or both of which may overlap the 
18S rRNA peak (Skinner, 1968). 



io- 


j 


1 


9- 


- 








8- 


\ 








7- 


1 








op 


: 










: 








2 


: 




/ 




-1 


E 


l^y\^^_____y^ 


CO 


L-^-^-^ 


O ~ 


^^ 


1 1 1 iT r^ 1 1 1 1 1 1 






1 1 1 


\ 


1 T 1 1 1 



34 39 -44 49 54 

"Time (seconds) 



Fig. 1.1: Electropherogram of total RNA isolated from gill tissue 
of the crab Pm, obtained by microfluidics electrophoresis with an 
Agilent Bioanalyzer. 

Gel electrophoresis of the PCR products using primers showed bands as estimated. 
Nucleotide sequence obtained from excising and purifying the bands produced a 2,189-bp 
cDNA encoding a 650-amino-acid protein {Fig. 1.2). Once assembled, the full sequence 
showed high homology to proteins identified as hsp70 in other arthropods as Litopenaeus 
vannamei (Ace. No. AAT46566), Penaeus monodon (Ace. No. AAQ05768), 
Macrobrachium rosenbergii (Ace. No. AAS45710), and Apis mellifera (Ace. No. 
XP_392933) {Fig. 1.3). 



atggcaaaggcacctgctgtcggtattgatctgggaaccacctactcctgcgtgggt 

MAKAPAVGIDLGTTYSCVG 
gtgttccagcatggcaaggtggagatcatcgccaacgaccagggcaaccgcaccacgccc 

VFQHGKVEIIANDQGNRTTP 
tcctacgtcgccttcacagacacagagcgtctgattggtgacgccgccaagaaccaggtg 

SYVAFTDTERLIGDAAKNQV 
gcgatgaaccccaacaacactgtattcgatgccaagcgactgatcggccgcaaattcgaa 

AMNPNNTVFDAKRLIGRKFE 
gaccacacagtccagagcgacatgaagcattggcccttcaccatcatcaacgagagcaca 

DHTVQSDMKHWPFTIINEST 
aagccaaagatccaggtggagtacaagggagacaagaagaccttctaccccgaggagatc 

KPKIQVEYKGDKKTFYPEEI 
tcctcgatggtgctcatcaaaatgaaggagaccgctgaggcttacctgggatccacagtg 

SSMVLIKMKETAEAYLGSTV 
aaggatgctgtagtcactgtgcctgcctacttcaacgattctcagcgtcaggccaccaag 

KDAVVTVPAYFNDSQRQATK 
gacgctggaaccatctcgggtctgaatgtgctgcgtatcattaacgaacctaccgctgct 

DAGTISGLNVLRIINEPTAA 
gccatcgcctacggcctcgacaagaaggttggcggtgagcgcaacgtcttgatcttcgat 

AIAYGLDKKVGGERNVLI FD 
cttggcggcggtaccttcgatgtgtccatccttaccatcgaggatggcatcttcgaggtc 

LGGGTFDVSILTIEDGIFEV 
aagtcaacagctggtgacactcacttgggcggtgaagacttcgacaaccgtatggtgaac 

KSTAGDTHLGGEDFDNRMVN 
cacttcatccaggaattcaagcgcaagtacaagaaggacccaagtgagaacaagcgctcc 

HFIQEFKRKYKKDPSENKRS 
ctgcgtcgcctgcgtactgcctgtgagcgtgcgaagcgtaccctgtcttcctcgacacag 

LRRLRTACERAKRTLSSSTQ 
gccagcgtggagatcgactccctcttcgaaggtatcgatttctacacctccatcacccgt 

ASVEIDSLFEGIDFYTSITR 
gctcgcttcgaggagctgtgcgccgatctgttccgtggcaccttggagcccgtggagaag 

ARFEELCADLFRGTLEPVEK 
tccctccgtgatgcgaagatggacaaggcccagatccacgacatcgtccttgtcggagga 

SLRDAKMDKAQIHDIVLVGG 
tccacccgtatccccaagatccagaagctcctccaggacttcttcaacggcaaggagctg 

STRIPKIQKLLQDFFNGKEL 
aacaagtccatcaaccccgatgaggctgtggcctacggtgccgccgtccaggccgccatc 

NKS INPDEAVAYGAAVQAAI 
ttgtgtggtgacaagtccgaggctgtgcaggacctgttgctgttggacgtgacccccttg 

LCGDKSEAVQDLLLLDVTPL 
tccctgggtatcgagactgccggtggtgtgatgaccgctctcatcaagcgtaacaccacc 

SLGIETAGGVMTALIKRNTT 
atccccaccaagcagactcagaccttcaccacctactctgacaaccagccaggtgtgctc 

IPTKQTQTFTTYSDNQPGVL 
atccaggtgtacgagggagagcgtgccatgaccaaggacaacaacctcctgggtaagttc 

IQVYEGERAMTKDNNLLGKF 
gagctgagtggcatcccacctgctcctcgtggcgtgcctcagatcgaggtcaccttcgac 

ELSGIPPAPRGVPQIEVTFD 
attgacgccaacggcatcctgaacgtatccgccgtggacaagtctaccggcaaggagaac 

IDANGILNVSAVDKSTGKEN 
aagattaccatcaccaacgacaagggtcgcctctccaaggaggagatcgagcgcatggtg 

KITITNDKGRLSKEEIERMV 
caggacgccgagaagtacaaggctgacgatgagaagcagagggaccgtatttctgccaag 

QDAEKYKADDEKQRDRISAK 
aactccctggagtcttactgcttcaacatgaagtcaacagttgaggacgagaagttcaag 

NSLESYCFNMKSTVEDEKFK 
gagaagatttctgaagaggaccgcaacaagattttggagacctgcaacgagactatcaag 

EKISEEDRNKILETCNETIK 
tggctggacatgaaccagctgggcgagaaggaagagtatgagcacaagcagaaggagatc 

WLDMNQLGEKEEYEHKQKEI 
gagcaggtgtgcaaccccatcattaccaagatgtatgctgctgctggtggtgctcctcca 

EQVCNPIITKMYAAAGGAPP 
ggtggcatgcccggcggcttcccaggtggtgccccaggtgccggcggtgctgctcccggt 

GGMPGGFPGGAPGAGGAAPG 
gctggtggttcctccggacccaccatcgaggaggtcgattaa 

AGGSSGPTIEEVD- 

Fig. 7. 2;. Amplified Nucleotide sequence from the PCR 
product and the Amino Acid sequence for hsp70 in Pm. 



Pac hyg rap sua 
Lit ope nae us 
Pen aeu s 
Mac rob rac hit 




Pac hyg rap s 
Li t ope nae \ 



Mac rob rac hit 
Apis 



140 



VL. KMK ETA EAjJlG ; 



1 60 * 




leo 






SQR QAT KDA GTI SGL n: L RI I NEP TAA -, 


SQR QAT KDA GT I SGL N 'L R 1 1 N! 


HsKfenys 


SQRQATKDAGTI SGLN^LRHNI 


:pt 


AA \ 


SQRQATKDAGTI SGI.N' LRIINI 


:pt 


jM 



Pac hyg rap 

Lit ope 

Pen 

Mac rob rac hi 




Pac hyg rap sus 
Li t ope nae us 
Pen aeu 3 
Mac rob rac hii: 
Apis 



:, CgD LFR GTL El . — _-, 

j C!?D LFR GTL EPVEK^jiLRD 



._._ VLVGGSTRIPKIQKLLQDFl 

KA QIH DIVLVG GST RIP KIQ KLL QDF FNG K 



Pac hyg rap su 
Li t ope nae us 
Pen aeu s 
Mac rob rac hi 
Apis 



! inpdeaval, gaavqaail igdkse : 

! inpdeavaggaavqaail" ^ 

; inpdeavap;gaavqaail 



jjMI 



^mSSS 



^iii 



m 



mss 






Mt 



m 



Pac hyg rap 

Li t ope 

Pen 

Mac rob rac hi 



Pac hyg rap 
Li t ope 
Pen aeu s 
Mac rob rac hi 



Ap 




Fig. 13: Multiple alignment of hsp70 amino acid sequences from four crustacean species and 
honeybee. Pachygrapsus marmoratus (present study), Litopenaeiis vanname (Ace. No. 
AAT46566), Penaeus monodon (Ace. No. AAQ05768), Macrobrachium rosenbergii (Ace. No. 
AAS45710), and Apis rnellifera (Ace. No. XP_392933). 



Relative expression levels of hsp70 wRNA were measured in the 5 to 9 gill (from 
anterior to posterior) of P. marmoratus in samples taken from dilute and concentrated sea 
water at each time interval. Hsp70 expression was evident in all the samples including the 
control. Amplification of a dilution series prepared from the most posterior gill (G9) 
produced a standard curve {Fig. 1.4) that was employed in analyzing relative transcript 
abundance in other gills. The relative abundance of hsp70 wRNA in test samples were 
compared to samples obtained from control animals. 







Fig. 1.4: Real-time PCR amplfication of hsp70 in a reference 
cDNA prepared from Pm gill diluted to give the equivalent of 1, 
0.1, 0.01, and 0.001 J (left to right) of the cDNA preparation (1 
1 cDNA = 0. 1 _g total RNA). Fluorescence is plotted as a 
function of cycle number. Inset: Standard curve derived by 
plotting threshold cycle (Ct) as a function of cDNA volume. 



Dissociation of the final amplification product revealed a single major meltinj 
temperature signifying the predominance of a single hsp70 sequence (Fig. 1.4). 




54 H M eo ei e4 



S3 S2 54 



Fig. 1.5: Second derivative of the thermal dissociation curve 
of the hsp70 amplification product obtained by real-time 
PCR of cDNA from Pm, plotted as a function of temperature. 



The hsp70 transcript abundance in individual gills of Pm at intervals following transfer 
from normal sea water to diluted and concentrated sea water were calculated and plotted 
as a function of time (Figl. 6A & 1.6B). 



10 




Hours In 10 ppt 



G7 
Gill number 




Hours in 45 ppt 



Fig. 1.6: Relative mRNA expression of hsp70, determined by quantitative PCR, in gills of 
Pm pooled from at least three animals per sampling interval, in relation to gill 9 after 48 
hours of exposure of crabs to 10 ppt and 45 ppt seaw^ater. 



1.5 Discussion 

Control experiments showed that the wRNA expression of arginine kinase (AK) - a 
putative housekeeping gene (Kotlyar et al. 2000) - was at nearly equal levels at all times 
under similar stress conditions (Fig. 1.7). Moreover, hsp70 mRNA was expressed equally 
under control conditions (zero time) in anterior (G5, G6) and posterior (G7, G8, G9) gills. 
It is known that measurable levels of hsp70 are not unusual in most organisms under 
unstressed conditions (Helmuth & Hofmann, 2001; Halpin et al., 2002). Following 
transfer to low salinity, hsp70 mRNA expression increased in all gills {Fig. 1.2A). The 
degree of increase was about 2-fold in G5, G6 and G9 at 24 and 48 h. However, in G7 
and G8 hsp70 mRNA s increased by 3 to 4-fold within the first 6 h then slightly 
decreased by 48 h. 



11 




Gilt Number 



Fig. 1.7: Relative mRNA expression of Argenine Kinase, 
determined by quantitative PCR, in gills of Pm pooled 
from at least three animals per sampling interval, in 
relation to gill 9 after 48 hours of exposure of crabs to 10 
ppt seawater. AK is equally expresses in each gill except 
for at 48 h. 

Following transfer to high salinity, G5, G6, and G9 did not show any significant change 
in hsp70 mRNA throughout the study period. However, G8 showed a 2-fold increase 
within 4 h and by 48 h decreased gradually to the level observed under control 
conditions. In G7, hsp70 mRNA expression increased about 3-fold within 4 h and about 
4-fold in 6 h, then slightly decreased at 24 and 48 h to a level that was still twice the 
amount expressed in controls. 

In the lower salinity, Pm effectively hyper-osmoregulates its hemolymph via increased 
ion uptake across the gills, mediated at least in part by induction of ion transporter gene 
transcription. In high salinity the crab is a hypo-osmoregulator, most likely by enhanced 
salt excretion across the gills (Pierrot, et al. 1995; Pierrot, et al. 2000). 



12 



The data, coupled with our observation of a dramatic induction of ion transporter gene 
expression in G7 under similar conditions (Eckhardt et al., 1995; Spanings-Pierrot & 
Towle, 2003) suggests that G7 plays an important role in the response to hypersaline 
conditions and G7 may indeed be primarily responsible for ion exchange during 
hyperosmotic stress. The results also implies that osmotic stress may lead to enhanced 
hsp70 expression in all gills, with a more rapid response in the two posterior gills that are 
believed to be most involved in ion uptake (Berlind & Kamemoto, 1977; Spanings- 
Pierrot & Towle, 2004). This data also confirms that hsps are not only expressed under 
thermal stress conditions (Somero, 1995; Frankenberg et al., 2000,; Halpin, et al., 2002), 
but play a vital role in organisms' ability to adapt to rapid salinity level changes in their 
envirormient. 



1.6 Conclusions 

Individual gills may be functionally distinct, particularly regarding osmoregulatory and 
stress-related responses to concentrated seawater and diluted seawater. RT-QPCR data 
confirms the induction of expression in hspTO gene under stress conditions and suggests 
the importance of it in adaptive responses of organisms. Highly homologous sequence of 
hsp70 gene in Pachygrapsus marmoratus to other organisms provides evidence for the 
conserved hsp genes throughout evolution. 



13 



1.7 Bibliography 



Berlind, A. and Kamemoto, F. I. 1977. Rapid water permeability changes in eyestalkless 
euryhaline crabs and in isolated, perfused gills. Comp. Biochem. Physiol. 58A: 383-385. 

Boutet, I., Tanguy, A., Rousseau, S., Auffret, M. and Moraga, D., 2003. Molecular 
identification and expression of heat shock cognate 70 (hsc70) and heat shock protein 70 
(hsp70) genes in the Pacific oyster Crassostrea gigas. Cell Stress Chaperones 8: 76- 85. 

Eckhardt, E., Pierrot, C, Thuet, P., Van Herp, F., Charmantier Daures, M., Trilles, J.-P., 
and Charmantier, G. 1995. Stimulation of osmoregulating processes in the perfused gill 
of the crab Pachygrapsm marmoratus (Crustacea, Decapoda) by a sinus gland peptide. 
Gen. Comp. Endocrinol. 99: 169-177. 

Frankenberg, M.M., Jackson, S.A. and Clegg, J.S. 2000. The heat shock response of adult 
Artemiafranciscana. J. Therm. Biol. 25: 481^90. 

Feder, M.E. and Hofmann, G.E., 1999. Heat-shock proteins, molecular chaperones, and 
the stress response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61, 

243- 282. 

Halpin, P.M., Sorte, C.J., Hofmann, G.E. and Menge, B.A., 2002. Patterns of variation in 
levels of hsp70 in natural rocky shore populations from microscales to mesoscales. 
Integr. Comp. Biol. 42: 815- 824. 

Helmuth, B.S.T. and Hofmann, G.E., 2001. Microhabitats, thermal heterogeneity, and 
patterns of physiological stress in the rocky intertidal zone. Biol. Bull. 201: 374- 384. 

Kotlyar, S., Weihrauch, D., Paulsen, RS., and Towle, DW. 2000. Expression of arginine 
kinase enzymatic activity and mRNA in gills of the euryhaline crabs Carcinus maenas 
and Callinectes sapidus J. Exp. Bio. 203: 2395-2404 

Mouneyrac C, Amiard-Triquet C, Amiard J.C. and Rainbow PS. 2001. Comparison of 
metallothionein concentrations and tissue distribution of trace metals in crabs 
(Pachygrapsus marmoratus) from a metal-rich estuary, in and out of the reproductive 
season. Comp. Biochem. Physiol. C. Toxicol. Pharmacol. 129:193-209. 

Pierrot, C, Pequeux, A. and Thuet, P. 1995. Perfusion of gills isolated from the hyper- 
hyporegulating crab Pachygrapsus marmoratus (Crustacea, decapoda): adaptation of a 
method. Arch. Physiol. Biochem. 103:401-409. 

Spanings-Pierrot, C, Soyez, D., Van Herp, F., Gompel, M., Skaret, G., Grousset, E., and 
Charmantier, G. 2000 Involvement of Crustacean Hyperglycemic Hormone in the control 



14 



of gill ion transport in the crab Pachygrapsus marmoratus. Gen. Comp. Endocrinol. 1 19: 
340-350 

Skinner, D.M., 1968. Isolation and characterization of ribosomal ribonucleic acid from 
the crustacean, Gecarcinus lateralis. J. Exp. Zool. 169: 347- 356. 

Somero, G.N., 1995. Proteins and temperature. Annu. Rev. Physiol. 57: 43-68. 

Spanings-Pierrot, C, and D.W. Towle. 2003. Expression of Na^,K*-ATPase mRNA in 
gills of the euryhaline crab Pachygrapsus marmoratus adapted to low and high salinity. 
Bulletin MDIBL 42: 44-46. 

Spanings-Pierrot, C, and D.W. Towle. 2004.Salinity-related expression of the 
Na*/K72Cr cotransporter and V-type ff-ATPase in gills of the euryhaline crab 
Pachygrapsus marmoratus. Bulletin MDIBL 43: 6-8. 

Specs, J.L., Chang, S.A., Snyder, M.J., and Chang, E.S. 2002. Osmotic induction of 
stress-responsive gene expression in the lobster Homarus americanus. Biol. Bull. 203: 
331-337. 

Voznesensky, M., Lenz, P.H., Spanings-Pierrot, C, and Towle, D.W. 2004.Genomic 
approaches to detecting thermal stress in Calanus finmarchicus (Copepoda: Calanoida). 
J. Exp. Mar. Biol. Eco. 311: 37-46 



15 



CHAPTER 2 



Effect of Leprdb-SJMutatin on 

JAK/STAT Pathway in 

NOD/LtJ and db 5j Mice 



Diabetes is one of the most common and severe health conditions throughout the world. 
Although diabetes is a widespread disease affecting people of all ages, gender or 
ethnicity, a permanent cure is yet to be discovered. There are two common types of 
diabetes, type 1 and type 2 (TID & T2D). Investigators have been using mouse models to 
test causes and effects of these types of diabetes for many years. With the advent of 
modem molecular biology techniques, diabetic research has taken a new direction, even 
the use of stem cells to cure diabetes is now a possibility. 

For the past two decades Dr. Edward Leiter and his research group at the Jackson 
Laboratory, ME, have focused on understanding the immune responses involved in TID. 
Recent studies suggesting leptin - originally characterized as a hormone governing 
satiety, hunger and body fat metabolism - is stimulating a certain type of immune 
responses have brought new direction to Dr. Leiters' research group. Dr. Leiter and 
colleagues hypothesized that by limiting leptin activity through its receptor might provide 
a novel method of down-regulating these immune responses. 

I joined Dr Leiter' s research group in Fall 2004 and have been working under the 
supervision of Dr. Huie-Ju Pan, Ms. Darcy Pomerleau and Dr. Chul-Ho Lee. My focus 
was to investigate the leptin response in the mutated and wild type mice to induce a 
certain biochemical pathway and to support the hypothesis of using the mutated mouse 
strain as a novel model to study leptin-mediated immune responses. My results indicate 
that manipulation of the leptin/leptin receptor axis may provide a novel means of down- 
regulating autoimmunity in TID and confirm a role for leptin as a mediator in the 
development of this disease in wild type mice. 

Through this experience, I have gained a thorough understanding of certain molecular 
biological techniques used in current biomedical research with direct applications 
towards human health care. 



17 



2.1 Introduction 

Type I diabetes (TID), also known as insulin-dependent diabetes mellitus, is 
characterized as an immunologically-mediated disease under endocrine control. In TID 
patients, the autoimmune destruction of pancreatic beta cells results in insulin deficiency 
and hyperglycemia (Soria et al, 2001). Immune responses in TID are thoroughly studied 
using Non Obese Diabetic (NOD) mouse strain as a model (Serreze & Leiter 2001). 
However, there has been little research done on its endocrine system of this mouse strain 
(Homo-Delarche, 2004). 

Leptin is 16-kDa protein secreted by adipose tissues. It is a member of the helicale 
cytokines family and has a structure similar to IL-2 (Interleukin 2) (Baumann, et al., 
1996). Leptin receptor (LR), a class I cytokine family receptor, due to alternative splicing 
has at least six isoforms with a common extra cellular domain (Tartaglia, 1997). Leptin 
binding to its' receptor elicits receptor dimerization and initiates accumulation and 
autophosphorylation of Janus Kinases (JAK 1 and JAK 2). This in turn acts as a docking 
site for phosphorylation of STATs (Signal Transducer and Activator of Transcription), in 
particular STAT 3 and STAT 5. STATs translocate to the nucleus and induce the 
expression of other genes, including negative regulators, such as suppressor of cytokine 
signaling 3 (S0CS3) (Bjorbaek et al, 1999) and the protein tyrosine phosphatase IB 
(Cheng e^ a/., 2002). 

Leptin's functional receptor isoform (Rb) is present in the hypothalamus where it 
regulates energy metabolism and neuroendocrine function (Lord et al, 1998). It is 
studied mostly for its association with regulation of energy metabolism, feeding behavior 
(Friedman, 1998), reproduction (Chehab et a/., 1996), and other biological functions. In 
recent studies the leptin receptor was also identified in immune cells of both humans and 
animals (Lord et al, 1998). This suggests that leptin could be an immunomodulatory 
molecule. For example, leptin promotes the proliferation and secretion of IL-2 by naive 
CD4+ T cells, but not memory T cells in both humans and mice (Lord et al, 1998, La 
Cava & Matarese, 2004). Conversely, when human memory T cells were examined. 



leptin was observed to inhibit IL-2 and IL-4 production while stimulating the secretion of 
IFN (Lord et al., 2000). Based on these results, limiting Leptin signals through its 
receptor might provide a novel means of downregulating a T helper- 1 (Thl)-biased 
immune response, hence delay the onset of autoimmune response causing TID. 
Supporting this hypothesis, postnatal administration of recombinant leptin precipitated 
early TID onset (by 7 weeks of age) in -85% of treated NOD female mice (Matarese et 
al, 2002). 

An unexpectedly produced point mutation on the extra cellular domain of NOD leptin 
receptor (designated Leprdbsj) has produced a way of limiting leptin signaling through it 
receptor. This strain has a very different phenotypic effect on the course of autoimmune 
diabetes development. NOD/LtJ mice of both sexes coisogenic for the Leprdbsj mutation 
developed juvenile obesity and type 2 diabetes (T2D) within two wk of weaning. Our 
research group has hypothesized that the mutation may have changed the receptor 
structure causing inhibition or reduction of leptin binding. Even if leptin is binding, it is 
possible that mutation may have an effect on the intracellular activity - JAK/STAT 
phosphorylation - of the receptor. Thus, the research described in this study aims to 
investigate: 

1. the '^^I-Leptin binding to short and long forms of wild type and mutated leptin 
receptor in COS 7 cells. 

2. the expression of short and long forms of lepin receptor 

3. the phosphorylation of JAK 2 and STAT 3 in transfected COS 7 cells and 
peritoneal exudate cells from wild type and mutated mice. 

2.2 Materials and Methods 

Invitro (using COS 7 cells - Green Monkey Liver cells) and Invivo (using Peritoneal 
Exudate Cells -PEC) studies were conducted to investigate the effects of the Leprab-sj 
mutation on leptin binding and downstream regulatory pathways. Experiments were 
designed to investigate the activity of wild type and mutated short form (Ra) and the long 
fonn/functional form (Rb) of the leptin receptor. 



19 



2.21 Plasmid constructions, transfect ions and cell culture. 

Wild-type and mutated Ra and Rb DNA were inserted in the BMHl site of a 
pcDNA3/CMV vector (Invitrogen, NY, USA) containing a modified polylinker. COS-7 
cells) were grown in DMEM (Hyclone Dulbecco's Modified Eagle Medium) 
supplemented with 10% (v/v) FBS, 0.1 mg/ml streptomycin, (all from Life Technologies, 
Gaithersburg, MD). Transient transfections were performed using Lipid (invitrogen 
lipofectamine cat 18324-012) according to manufactuer's instructions. 

2.22 '^^I- leptin Binding Assay 

Radioligand binding experiments were performed on COS 7 cells 48 h post transfection 
with Wild type (NOD) and mutated (db) DNA constructs. Cells plated in 6-well plates 
were washed twice with ice-cold PBS and incubated in binding buffer (DMEM, 1% 
BSA) containing 10^ cpm/well of '^^1-leptin (PerkinElmer life sciences, USA) in the 
absence or presence of 200 nM of cold leptin (PerroTech Inc, USA) for 4 h at 4°C. Cells 
were washed twice with ice-cold PBS, lysed in IN NaOH and the radioactivity was 
measured in a -counter. To determine the binding affinity, COS 7 cells (48 h post 
transfecction) were incubated for 4 h at 4°C with '^^1-leptin and varying concentrations of 
(0, lO'^- 10"^M) unlabeled human leptin. 

2.23 Protein Extraction and Western blotting on COS 7 cells 

COS 7 cells were transfected with NOD and db DNA constructs in duplicates. Forty- 
eight h post transfection, Zeosin (200 fil of Zeosin, DMEM, 10% FBS, 1% Pen-Strep) 
was added to COS 7 cells for selection of transfected vs non-trasnfected cells. One set of 
the selected cells was treated with 1 |ag/ml cold leptin (PerroTech Inc, USA), while the 
other set was left untreated. After 15 min at 37*^0, both sets of cells were homogenized in 
500 \i\ RIPA lysis buffer (50 mM Tris, pH 7.4; 1% Nonidet P-40; 150 mM NaCl; 1 mM 
EDTA; 1 mM phenylmethylsulfonyl fluoride, 1 ^g/ml aprotinin, 1 |ig/ml leupeptin, 1 
mM Na3V04, 1 mM NaF) and proteins were extracted using a 28G injecting needle. 
Protein concentrations were measured using a protein assay (Bradford protein assay, Bio- 
Rad, Hercules, CA, USA). Seventy five micrograms of protein ly sates with beta- 



20 



mercaptoethanol and a sample buffer were loaded onto polyacrylamide gels (Criterion, 
6% gradient Tris-HCl; Bio-Rad). Cells were then transfered onto nitrocellulose 
membranes (Protran, Schleicher & Schuell, Keene, NH, USA) using transfer buffer (50 
mM Tris, 20 mM glycine, 20% methanol). Membranes were blocked with 5% nonfat 
dried milk (20 mM Tris, pH 7.4; 0.9% NaCl; 0.05% Tween 20) and incubated with an 
anti-leptin receptor (1:2000, Upstate Reagents), anti-P-JAK2 (1:500) (Upstate Reagents) 
and anti-P-STAT 3 antibody (1:1000) overnight at 4° C. Membranes were then washed 
(TEST) and incubated with secondary antibodies (antirabbit-, 1:10,000; Bio-Rad), 
washed and developed by enhanced chemiluminescence (ECLplus, Amersham, NJ, USA) 
and x-ray films (Amersham). The developed images were scanned with Fuji Image 
Viewer and the band intensity was measured for each well. 

2.24 Protein Extraction and Western blotting on PECs 

NOD and db5j male mice (of 7 weeks age) were injected with thioglycolate to induce 
peritoneal macrophages. Four days post injection, PECs were collected from the mice in 
Hanks buffer (25mM HEPES/0.1 mg/ml DNase/HBSS). Cells were counted using a 
coulter counter, and an equal number of duplicates from each cell type (NODs and db5js) 
were plated in 10cm dishes. After serum starvation overnight, one set of cells were 
treated with cold leptin for 15 mins at 37°C. To investigate the expression of leptin 
receptor, P-JAK2 and P-STAT 3 same Western Blot analysis as mentioned above was 
used. 

2.3 Results and Discussion 

2.31 /- leptin Binding Assay 

CPM counts obtained from the -counter were plotted against a concentration gradient of 
cold leptin for each type of DNA construct. In general wild type leptin receptor showed a 
higher binding affinity than the mutated form. Wild type short form had a higher binding 
affinity than the long form as expected. Similar pattern was observed in mutated short 
form and long form (Fig. 1.1). 



21 



This data suggests that the mutated form of leptin receptor has an adverse effect on leptin 
binding which affects the downstream activity of leptin receptor. The long form of leptin 
also has a lower binding affinity than the shorter form. Although there is less binding in 
the long/functional form, it has been found to activate downstream JAK/STAT pathway 
(Tartaglia, 1997). Thus, less binding affinity of leptin to its mutated receptor may not 
affect the JAK/STAT phosphorylation. Lack of leptin activity efficiency due to low 
binding may well lead to delays in transduction and activation of transcription factors 
responsible for immune responses, possibly delaying the onset of TID. 



Leptin Binding 



Wt Ra 



Wt Rb 



db Ra 



db Rb 




0.0005 0.001 0.005 0.01 

Leptin Cono: ug/ml 



Fig. 1.1: Binding of '"l-leptm to transfected COS 7 cells with NOD Ra & Rb and db Ra 
& Rb DNA constructs. CPM Counts from the gama-counter are plotted as a function of 
added cold leptin concentration gradient in each plate. 

2.32 Wetern Blot Analysis on Transfected COS 7 cells. 

According to the intensity of the band obtained from the Western Blot, the expression 
levels of leptin receptor after transfection was determined. The primary antibody used 
was a nonspecific antibody to both forms of LR. Resuhs show that it identifies the long 
form of the receptor, but not the short form (Fig. 2. 2 A & 2.2BJ. 



22 








Leptin Receptor expression 


50 1 






45 






40 










|35 














« 30 
I20. 

X 














"" 10 - 














5 - 

- 


i 1 


n 1 — 1 










Control 


WT Ra db Ra WT Rb db Rb 






Receptor type 



Fig. 2. 2 A 



Fig. 2.2B 



Fig 2.2: The control is non transfected COS 7 cells, Ra and Rb are short and long 
forms and WT is wild type and db is mutated forms. 2.2A\ Expression of leptin 
receptor - pointed with the arrow compliments with the predicted size of the long 
form of the receptor. Short form is not identified. 2.2B : Expression levels 
determined from the band intensity for each DNA construct. 

Results confirm that the transfection was successful and the receptor was expressed in 
COS 7 cells. Multiple experiments were carried with varying conditions to obtain a band 
expressing the short form, but ended unsuccessfully. 

Data obtained for expression of phosphorylation of JAK 2 and STAT 3 pathways in 
transfected COS 7 cells suggests that the Leprdb-sj mutation has an adverse effect on the 
leptin activity. 



23 




Fig. 2. 3 A 




Fig.2.3B 
Fig. 2. 3 A : Phosphorylated JAK 2 expression in protein iysates from Control (non 
transfected COS 7 cells), WT Ra, WT Rb, db Ra, db Rb. (+) signs indicate that they were 
treated with leptin. (-) signs indicate untreated cells. Pointed by the arrow is the 
complementary size for a phosphorylated JAK 2 band. The Antibody used was anti- 
phospho-JAK2. Fig. 2.3B: Intensity of the bands was measured for each type of cells. (+) 
and (-) signs indicates leptin treated and untreated cells respectively. 

This data implies that the long form of leptin (Rb) is a better active site than the short 
form. As expected, cells transfected with DNA constructs have a significant difference in 



24 



JAK 2 phosphorylation compared to the controls. In WT Rb, addition of leptin lowered 
the expression of P- JAK 2 (Phosphorylated JAK 2) by three fold as opposed to those left 
untreated. WT Rb+ also had a 2 fold decrease of P- JAK 2 compared to dbRb+. WT Ra 
had almost no P-JAK 2, while db Ra+ had a higher expression of P-JAK 2 but less than 
the long forms (Fig.2. 3 A &2. 3B) 

STAT 3 was phosphorylated in all of the cell types. It is evident that there is another 
mechanism than leptin receptor that activates JAK/STAT pathways, as there is 
phosphorylation of STAT 3 in the control cells. However, this mechanism has is affected 
by the insertion of the leptin receptor. The short form of the leptin receptor does not have 
a STAT phosphorylation site (Uotani et al, 1999). Rather, the expression levels seen 
under WT Ra and db Ra seems to be due to another mechanism of STAT activation. As 
expected, the long form has a high expression of STAT 3 phosphorylation. In particular, 
the addition of leptin has increased the expression level in both WT Rb and db Rb. 
However, compared to the mutated form, the wild type has a low level of phosphoryated 
STAT 3. (Fig. 2.4A & 2. 4B) 




C+ C- WTRa dbRa WT Rb db Rb 

+ - + - + - + - 

Fig. 2.4 A. 



25 



Phosphorylated STAT 3 expression 



20 
18 
15 
14 

12 ^ 

10 
8 
6 
4 
2 



■ 


r- 


n,n 


■ 

— 


r- 


-1 


-^ 



.(^^ >' <j?>'' ,0^ <}3>'' <i> .<p'' ^ <}p'' ^ 



Leptin Receptor type 



Fig. 2.4.B. 

Fig 2. 4 A : Phosphorylated STATS expression in protein lysates from Control (non 
transfected COS 7 cells), WT Ra, WT Rb, db Ra, db Rb. (+) signs indicate that the 
samples were treated with leptin. (-) signs indicate untreated cells. Pointed by the arrow is 
the complementary size for a phosphorylated STATS band. The antibody used was anti- 
phospho-STAT S. Fig 2.4B: Intensity of the bands were measured for each type of cells. 
(+) and (-) signs indicate leptin treated and untreated cells respectively. 

The invitro experiments were carried out solely to confirm the differences of leptin action 
between the mutated and wild type long and short forms. Data obtained for 
phosphorylation of JAK and STAT S in transfected COS 7 cells are not conclusive for the 
leptin activity in NOD and db 5j mice. Cellular responses to the environment depend on 
the whole genome of the cell. Difference in the genetic makeup of COS 7 cells and NOD 
or db5j mice PECs might elicit a different response to leptin and in the downstream 
regulation of leptin receptor. 



26 



2. S3 Wetern Blot Analysis on Thioglycolate Induced PECs from NOD and db 5j mice. 
The data confirmed the previous Northern Blot resuhs (unpublished data) suggesting the 
expression of leptin receptor long form in PECs. Both, NOD and db 5j had similar 
expression levels of the long form {Fig. 2.5A & 2.5B). The antibody used did not 
recognize the short form of the leptin receptor, though its expression at wRNA level is 
confirmed by previous Northern Blot data. 




Fig 2. 5 A 



Leptin Receptor expression 


800000- 
700000- 

600000 

500000 
< 

400000 

300000 

200000 

100000- 


1 








































































































NOD NOO dbSj db5j+ 



Fig 2. 5 B 

Fig. 2. 5 A: leptin receptor expression in PECs from wild type and 
db 5j mice. NOD+ and db 5j + were treated with cold leptin for 
15 mins. Size of the band was the expected size for long form of 
leptin receptor. Antibody used did not recognize the short form. 
Fig. 2.5B: Measured band intensity for each sample. Long form 
leptin receptor is expressed equally. 



27 



Phosphorylated JAK 2 expression in PECs was leptin dependant, leptin treated NOD 
(NOD+) had no expression of P-JAK 2 and db 5j+ had a significantly decreased amount 
of P-JAk2 expressed compared to the untreated sample. Untreated db 5j had a high 
phosphorylation of JAK 2, but considerably lower than that of untreated NOD (Fig 2.6A 
&2.6B). 






Fig.. 


2. 5 A 














■o 

< 
o 

1 






JAK2 phosphorylation 




100 - 
80 - 
60 
40 - 
20 - 














































NOD 


NOD+ db 5j db 5j+ 





Fig. 2. 5 A: Expression of P-JAK2 in leptin treated (+) and untreated PECs from NOD and 
db 5j. Fig 2.5B: Measured band intensity for each sample representing the P-JAK 2 
expression levels. 

STAT 3 was phosphorylated in all the samples. Regardless of the leptin treatment, the 
wild type PECs had similar expression of P-STAT 3, while leptin treatment increased the 
STAT 3 phosphorylation in db 5j. Overall, P-STAT 3 has a higher expression in the wild 
type than in the mutated PECs. 



28 




Fig. 2. 6 A 



STAT 3 phosphorylation 


12 - 

10 
■n 
1 8 

k '- 

4 - 

2 - 


1 
























































NOD NOD+ db5j db 5j+ 



Fig. 2.6B 
Fig. 2.6A: Expression of P-STAT3 in leptin treated (+) and untreated PECs from NOD 
and db 5j. Fig. 2.6B: Measured band intensity for each sample representing the P-STAT 
3 expression levels. 

Data implies that the JAK 2 and STAT 3 phosphorylation differences in wild type and 
mutated mice. In NODs, without leptin JAK 2 and STAT 3 are both phosphorylated, 
probably by other mechanisms (Fig. 2. 7). The treatment of leptin changes this in NOD 
and dephosphorylates all the P-JAK 2, hence inducing STAT 3 phosphorylation. Protein 
extracted exactly at this time may have caused the absence of P-JAK 2 in NOD+ (Fig. 
2. 7). When compared to NOD, P-JAK 2 and P-STAT 3 both have low expressions in the 
db 5js, but the effect of leptin stays similar. The untreated db 5j sample had a higher 



29 



expression of P-JAK 2 than the treated sample and vice versa for P-STAT 3 {Fig. 2.7). 
This suggests that leptin have induced P-JAK 2 and elicited STAT 3 phosphorylation. 



Phosphorylated JAK2 and STAT 3 




^ 



■ JAK2 
D STAT 3 



dbSj 



db5j+ 



Fig.2. 7: Comparison of P-JAK 2 and P-STAT 3 expression levels in leptin treated and 
untreated PECs from NOD and db 5j mice. (+) sign indicates the leptin treated mice. 

Overall, this data suggests that the Leprdb-sj mutation has an adverse effect on leptin 
action and phosphorylation of JAK 2 and STAT 3. This could be due to reduced binding 
of leptin to its mutated receptor as shown in the invitro studies using COS 7 cells. Leprdb- 
5J mutation may have altered the dimerization or the folding of the leptin receptor causing 
this low binding affinity. Altered folding could also affect the down stream 
phosphorylation sites resulting low expression P-JAK 2 and P-STAT 3 (Fig. 2.7). As 
JAK 2/STAT 3 pathway is responsible for inducing immune responses, findings from this 
study might explain the development of juvenile obesity with T2D in db 5j mice instead 
ofTlD. 

However, adverse effects on JAK/STAT phosphorylation may not be the only reason for 
resulting development of juvenile obesity with T2D in db 5j mice because leptin is 
involved in other pathways. The MAPK, the insulin receptor substrate 1, and the 



30 



phosphatidylinositol 3 '-kinase (PI3'K) pathways (Martin-Romero et ai, 2001) are 
mediated by leptin to induce T cell immune responses. (Sanchez-Margalet et al, 2001). 
MAPK is involved in antiapoptotic effects in Periphderal Blood Mononuclear Cells 
(Najib et al, 2002), whereas the PIB'K pathway may be important in regulating glucose 
uptake (Bates et al., 2002). Leprdb-sj mutation on the leptin receptor might have an effect 
on such leptin mediated pathways. 

Studying the effects of Leprdbsj on MAPK and PIB'K using similar methods used in this 
study would provide more information on the limiting of leptin action through its 
receptor. Using db Ij mice - mice with a mutation on the intracellular region of leptin 
receptor - would be a negative control for the above experiments. The negative controls 
would confirm the observed reduction of JAK/STAT 3 phosphorylation by Leprdb-sj 
mutation. To further study the role of leptin in JAK/STAT 3 pathway is to investigate the 
expression of S0CS3. As SOCS 3 is down regulated by STAT 3 (Bjorbaek et ai, 1999), 
based on data from this study one could predict to observe a higher expression of SOCS 3 
in db 5j mice. 

2.3 Conclusion 

The data shows that Leprdbsj mutation has an adverse effect on JAK/STAT pathway, 
which could result in the abnormal conditions observed in db 5j mice compared to its 
wild type (NOD). Invitro data from '^^1-leptin binding to transfected COS 7 cells 
suggested that leptins' low binding affinity to the mutated receptor could have affected 
the JAK/STAT phosphorylation. The reduced phosphorylation of JAK/STAT may also 
have caused by the alterations in dimerization and folding of the mutated receptor. These 
results support the possibility of using db 5j mice as a novel way of studying leptin 
mediated immime responses. 



31 



2.4 Bibliography 

Bates, S. H., J. V. Gardiner, R. B. Jones, S. R. Bloom, and C. J. Bailey. 2002. Acute 
stimulation of glucose uptake by leptin in 16 muscle cells. Horm. Metab. Res. 34:1 1 1. 

Baumann, H., K. K. Morella, D. W. White, M. Dembski, P. S. Bailon, H. Kim, C. F. Lai, 
and L. A. Tartaglia. 1996. The full-length leptin receptor has signaling capabilities of 
interleukin 6-type cytokine receptors. Proc. Natl. Acad. Sci. USA 93:8374. 

Bjorbaek, C, K. El Haschimi, J. D. Frantz, and J. S. Flier. 1999. The role of SOCS-3 in 
leptin signaling and leptin resistance. J. Biol. Chem. 274:30059. 

Bouloumie A, Drexler H.C, Lafontan M. and Basse R. 1998. Leptin, the product of Ob 
gene, promotes angiogenesis. Circ. Res. 83:1059-1066. 

Chehab F, Lim M, and Lu R. 1996. Correction of the sterility defect in homozygous 
obese female mice by treatment with the human recombinant leptin. Nat. Genetics 
12:318-320. 

Cheng, A., Uetani, N., Simoncic, P. D., Chaubey, V. P., Lee-Loy, A., McGlade, C. J., 
Kennedy, B. P., and Tremblay, M. L. 2002. Attenuation of leptin action and regulation of 
obesity by protein tyrosine phosphatase IB. Dev. Cell 2:497. 

Ducy P, Amling M, Takeda S, Priemel M, Schilling AF, Beil FT, Shen J, Vinson C, 
Rueger J.M, and Karsenty G. 2000. Leptin inhibits bone formation through a 
hypothalamic relay: a central control of bone mass. Cell. 100:197-207. 

Friedman J.M. 1998 Leptin, leptin receptors and the control of body weight. Nutr. Rev. 
56:38-s46. 

Gainsford T, Willson T.A, Metcalf D, Handman E, McFarlane C, Ng A, Nicola N.A, 
Alexander W.S and Hilton D.J. 1996. Leptin can induce proliferation, differentiation, and 
fiinctional activation of hemopoietic cells. Proc. Natl. Acad. Sci. USA 93:14564-14568. 

Homo-Delarche F. 2004. Neuroendocrine immuno-ontogeny of the pathogenesis of 
autoimmune disease in the nonobese diabetic (NOD) mouse. J. liar. 45:237-258. 

La Cava A, and Matarese G. 2004. The weight of leptin in immunity. Nat Rev Immunol. 
4:371-379 

Lord, G. M., Matarese, G., Howard, J. K., Baker, R. J., Bloom, S. R. and Lechler. 1998. 
Leptin modulates the T-cell immune response and reverses starvation-induced 
immunosuppression. Nature 394:897. 



32 



Lord GM, Matarese G, Howard JK, Bloom SR, and Lechler RI. 2002. Leptin inhibits the 
anti-CD3-driven proliferation of peripheral blood T cells but enhances the production of 
proinflammatory cytokines. J Leukoc. Biol. 72:330-338. 



Martin-Romero, C., and Sanchez-Margalet, V. 2001. Human leptin activates PI3K and 
MAPK pathways in human peripheral blood mononuclear cells: possible role of Sam68. 
Cell. Immunol. 212:83. 

Matarese G, Sanna V, Lechler R.I, Sarvetnick N, Fontana S, Zappacosta S, and La Cava 
A. 2002. Leptin accelerates autoimmune diabetes in female NOD mice. Diabetes 
51:1356-1361. 

Najib, S., and V. Sanchez-Margalet. 2002. Human leptin promotes survival of human 
circulating blood monocytes prone to apoptosis by activation of p4 2/44 MAPK pathway. 
Cell. Immunol. 220:143. 

Sanchez-Margalet, V. and Martin-Romero, C. 2001. Human leptin signaling in human 
peripheral blood mononuclear cells: activation of the JAK-STAT pathway. Cell. 
Immunol. 21 1:30. 

Serreze D.V. and Leiter E.H. 2001. Genes and pathways underlying autoimmune diabetes 
in NOD mice. In Molecular Pathology of Insulin-Dependent Diabetes Mellitus von 
Herrath M, Ed. New York, Karger, p. 31-67. 

Soria B, Skoudy A, and Martin, M. 2001. From stem cells to beta cells: new strategies in 
cell therapy of diabetes mellitus. Diabetologia. 44:407-15. 

Tartaglia, L. A. 1997. The leptin receptor. /. Biol. Chem. 272:6093. 

Uotani, S., Bjorbaek, €., Tomoe, J. and Flier, J.S. 1999. Functional properties of leptin 
receptor isoforms: Internalization and degradation of leptin and Ligand-induced receptor 
down regulation. Diabetes. 48: 279-286 



33 



CHAPTER 3 



Sri Lankan Indigenous Medicine: 
Diabetes as a Case Study 



3.1 Introduction 

Human health care has achieved great heights through innovations and discoveries made 
by modem biomedical research. Having participated in such research, I am fascinated by 
the importance and value it brings towards human health care. However, I am also 
puzzled by the significance of such research to people living in developing countries such 
as Sri Lanka, my homeland. I was raised in a society where indigenous medicine plays a 
vital role in maintaining good health. Through this chapter I sought to expand my 
knowledge of the role of indigenous medicine in the Sri Lankan health care system. 

Since early history plant-based systems have played an essential role in human health 
care. In spite of steadily evolving modern medicine, there has been a growing interest 
towards traditional medicinal systems in the world, especially in the developed countries 
(Simpson & Ogorzaly, 2001: Levetine & McMahon 2003: Shultes & Reis, 2003). 
According to World Health Organization, about 80% of the population from the 
developing countries still depends on traditional medicine and its practitioners (WHO, 
1991). Many use only plant-derived medicine to prevent or cure minor and major health 
conditions. Directly or indirectly, the remaining 20% in developing countries along with 
several millions in the industrialized countries utilize plant-derived ointments or medicine 
for many health issues (WHO, 1991). 

In this chapter I have compared allopathic and indigenous approaches towards human 
health care using treatment of diabetes as a case study. I gathered information on the 
natural history, medicinal uses and pharmaceutical properties of plants used in Sri 
Lankan indigenous medicine with a special focus on plants used in the treatment of 
diabetes. I also discuss the current status of medicinal plant use and research in Sri Lanka 
and stress the importance of conserving medicinal plants and the knowledge of their use 
in traditional medicine. 



35 



3.2 EUstory of Indigenous Medical Systems 

Dating back to 2600 B.C. in Mesopotamia, people used plants or their extracts for 
medicinal purposes. Some of the plants they used, especially Cedrus (cedar). 
Commiphora (myrrh), Papaver somniferum (opium poppy), are still widely-utilized 
among many communities. Ebers Papyrus written by Egyptians in 1500 B.C., Chinese 
"Materia Medica" written in 11 00 B.C. and Indian Ayurvedic medicine books written in 
1000 B.C. include many plant-derived drugs and ointments for a number of diseases. 
Since 300 B.C., Greeks and Romans have developed herbal medicine and have promoted 
their use in the world. While Europe was in its Dark and Middle Ages, the Arabic empire 
not only helped to protect Greco-Roman medicinal knowledge but combined it with 
Chinese and Indian expertise. (WHO, 1991: Simpson & Ogorzaly, 2001: Levetine & 
McMahon 2003: Shultes & Reis, 2003) 

As in many other civilizations, Sri Lankans developed their own medical system with 
extracts from mostly endemic or indigenous plants (Jayaweera, 1981: Dassanayake 
1997). Indigenous medicine in Sri Lanka dates back to Pre- Aryan Era and was widely 
practiced until western colonization introduced allopathic medicine. One account, 
although controversial, notes that about 3000 years ago. King Rawana wrote the first- 
knovra books on indigenous medicine of Sri Lanka. In the capital city of Sri Lanka, 
historians and archeologists have found evidence of a hospital dating back to 400 B.C 
and recovered surgical instruments and other equipment used for medicinal purposes. 
(Ranasinghe, 1986). They have recovered evidence for well organized medi-care systems 
with hospitals, rest homes, herb gardens and conserved forests of medicinal trees and 
shrubs in all parts of the country (Mahindapala, 2004). Special rooms with specific 
architectural designs for labor provide evidence for the attention early practitioners paid 
on psychological condition of each patient during treatment. Another Sri Lankan king. 
King Buddhadasa, was also a physician with a vast knowledge on medicinal plants, and 
appointed a traditional practitioner for every ten villages (Mahindapala, 2004). This 
primarily Sri Lankan system of medicine was identified as "deshiya chikithsa" meaning 



36 



indigenous medicine, although it was later influenced by Ayurveda, Siddha and Unani 
medicine from other parts of the world (Serasinghe, 1994). 

Allopathic drugs are based on one chemical compound that targets a certain organ in the 
human body to stimulate a response. On the contrary, indigenous medicine fr)llows a 
more holistic approach toward treating the human body (Samarasinghe, 1994). Sri 
Lankan indigenous medicine (SLIM), unlike allopathic medicine, does not cure a disease 
just by giving a specific drug. It divides therapy into three segments: pretreatment, 
treatment and post-treatment. This ensures that the patient is frilly recovered without any 
side effects or other health issues (Samarasinghe, 1994). But it does have a disadvantage: 
it is a very long process that requires a longer time commitment from the patient. 
Recently pharmaceutical companies have shown more interest on traditional medical 
systems, particularly on their use of plants. Although some potentially-useful drugs may 
be developed, this interest may have negative impacts on indigenous medicine and 
communities unless care is taken at every step along the way, from field exploration to 
the development of a drug (Silva, 1984). In this regard, it is critical that pharmaceutical 
companies work with local governments and communities without exploiting the 
medicinal plants, their habitats, traditional knowledge and the communities that depend 
on them (Simpson & Ogorzaly, 2001) 

3.3 Use of Plant Extracts in Modem Medicine 

Scientists have discovered some of the most widely used drugs in allopathic medicine by 
examining medicinal plants used in indigenous communities. Aspirin, a commonly used 
drug throughout the world, is a compound extracted from white willow, Salix alba L. 
(Salicaceae). It is believed that Hippocrates, the father of modem medicine used 5. alba 
L., bark to treat fever few thousand years ago (Samarasinghe, 1994). Quinine, an anti- 
malarial drug was extracted from Chincona officinalis L. (Rubiaceae) and used to treat 
malaria patients in Europe. Historically, the plant has been widely used by the natives of 
the Amazon to treat fever. Artemisinin, extracted from Artemisia annua L. (Asteraceae), 
the most effective drug for malaria, was first identified by the Chinese practitioners 2000 



37 



years ago. One of the most frequently used anesthetics in modem medicine. Morphine, 
was extracted from Papaver somniferum (Papaveraceae). Indigenous communities had 
used this plant for about 4000 years as an analgesic. Probably the most important plant- 
derived drug discovery in the 20* century is Paditaxel (Taxol® Bristol-Myers Squibb). It 
is isolated from Taxus brevifolia Nutt. (Pacific Yew tree (E): Taxaceae), currently one of 
the best known anti-cancer agents in the world (WHO, 1991). Plant species used in SLIM 
have also contributed to the modern day drug discovery efforts. Vincristine and 
Vinblastine, two anti-cancer agents, are derived from two Sri Lankan medicinal plants, 
Rauvolfia serpentina (L.) Benth.ex Kurz (Ekaveriya(S): Apocynaceae) and Catheranthus 
roseus (L.) G. Don (Minimal(S): Apocynaceae). These plant extracts are used in 
allopathic medicine to treat leukemia (Samarasinghe, 1994). Over the last few decades 
more than 100 chemical compounds have been extracted from about 90 plant species. 
Most of them were discovered during attempts to isolate the active chemicals from a 
plant used in traditional medicines (WHO, 1991). 

The decline of indigenous medical knowledge is common throughout the world (Tissera, 
1994: Widanapathirana, 1994: Shultes & Reis, 2003). However, many native 
communities in Africa, South America and Eastern Asia still retain extensive knowledge 
about use of plants in medicine. This knowledge is threatened due to the wide use of 
allopathic medicine. Researchers along with organizations such as World Health 
Organization and Biodiversity Conservation Network have taken major steps towards 
rediscovering this knowledge. A careful study of these ancient medical systems could 
provide novel therapeutic methods to prevent or even cure severe health conditions such 
as diabetes, cancer and heart diseases. In this chapter, treatment of diabetes is used as a 
model to study and compare existing indigenous and allopathic approaches towards 
preventing or curing disease. 



3.4. Diabetes and Allopathic Treatment 

Allopathic medicine has identified several forms of diabetes. The most common is 
diabetes mellitus which occurs because of lack of insulin or resistance to its action. 



38 



There are three main types of diabetes mellitus. 

Type I Diabetes, also known as insuhn-dependent diabetes mellitus (IDDM) occurs 
when the pancreas produces none or very little insulin. This causes plasma glucose 
concentrations to elevate beyond the normal glucose concentration range (70-100 mg/dl) 
(Parker et al, 2000). IDDM is a resuh of an autoimmune destruction of pancreatic _ 
cells, which produces insulin, and the reason for this destruction is not yet known. 
Possibly there is a genetic link or predisposition for the degeneration of _ cells. However, 
since the type I diabetes incidence is only 50% in identical twins, it is believed that 
certain environmental factors may play a role (Brody et ai, 1998). Due to the 
hyperglycemic condition of an IDDM patient, the urine volume increases ultimately 
resulting in ketone bodies in the urine. Because of the loss of fluid from the body and 
inability to utilize nutrients properly, these patients suffer from severe weight loss. If 
diseased children are left untreated, they experience premature cessation of growth. 
Under severe conditions of IDDM, unconsciousness, also known as diabetic coma, may 
occur, and if appropriate therapies are not instituted, cardiovascular collapse and death 
could result (Cabellero, 2003). Approximately 10 percent of people with diabetes have 
type I diabetes (Bellazi, 2001). 

Type II Diabetes, also called noninsulin-dependant diabetes (NIDDM), is the most 
common form of diabetes and occurs when the pancreas does not produce adequate 
insulin or when the body does not effectively use the insulin that is produced. What 
causes NIDDM is still unknown, but a strong genetic component is likely involved 
(Brody et al. 1998). This type occurs at a later age and in contrast to type I diabetes most 
patients suffer from obesity and have a higher concentration of circulating glucose in 
blood. The reduction of the number of insulin receptors is associated with obesity; hence 
losing weight through exercise and diet could decrease insulin resistance (Derouich & 
Boutayeb, 2002). Ninety percent of those with diabetes have type II (Stratta & Alloway, 
1998). About one third of the diabetic population can use diet and exercise to control 
their glucose levels while about another one-third of diabetics are controlled by diet 



39 



together with oral anti^diabetic drugs. Type II conditions that cannot be controlled by 
either of the above methods require regular insulin injections (Sibenhofer et al., 2003). 

Gestational Diabetes: This type is a temporary condition that occurs during pregnancy. 
It affects two- to four-percent of all pregnancies and increases the risk of both mother and 
child developing diabetes (B6) 

Conditions that damage or destroy the pancreas, such as pancreatitis, pancreatic surgery, 
or certain industrial chemicals, can cause diabetes. Certain drugs can also cause 
temporary diabetes, while rare genetic disorders and certain hormonal disorders are 
associated with or increase the risk for diabetes (Cabellero, 2003) 



Insulin 



The body needs insulin to decrease the blood glucose concentration. Glucose homeostasis 
depends on several hormonal mechanisms to increase blood glucose (glucagons, 
catecholamines, growth hormone, etc.) but only insulin to decrease it. Insulin is 
synthesized, stored and released by -cells of Langerhans in the pancreatic islet, a 
neuroendocrine organ that result in subsequent and smooth release of insulin, glucagon, 
somatostatin and pancreatic polypeptide hormones (Soria et al, 2001). 

Insulin was isolated in 1921-22 by Dr. Fredrick Banting and Dr. Charles Best at the 
University of Toronto, Canada. On June 3, 1934, Banting, the co-inventor of insulin, was 
knighted for his medical discovery. Before the discovery of insulin in 1921, everyone 
with type 1 diabetes died within a few years after diagnosis. Although insulin is not 
considered a cure, its discovery was the first major breakthrough in treating diabetes. 

Insulin, a polypepetide contaning 51 amino acids, is arranged in two chains which are 
linked by disulphide bonds. Insulin is produced by proteolysis of a precursor called 
proinsulin in the granules of _ cells. After crystallization with Zn^^, insulin is stored in 
these granules until _ cells receive a stimulus for their secretion. Although insulin has a 



40 



highly conserved sequence across species, there are some differences in the amino-acid 
sequence of animal and human insulins (Brody et al, 1998). 

Release of Insulin 

With the increase of blood glucose, glucose concentration in _ cells increase. Glucose 
metabolism inside the cell increases the intracellular ATP, and this ATP will close the 
Katp channels in the _ cells. Katp channels are K"^ ion channels that are regulated by 
ATP. Due to the depolarization caused by the closing of these channels, _ cells initiates 
an influx of Ca^^ ions through voltage-gated Ca^"^ channels which results the release of 
insulin. 

Insulin receptors, which are membrane- spaning glycoproteins, contain two subunits; _ 
and _. The released insulin binds to the _ subunits of insulin receptors, and this activates 
the tyrosine kinase activity of the _ subunits. Activation of tyrosine kinase increases 
glucose and amino acid uptake to the cell. Additionally it results in some intracellular 
activities such as an increase in RNA, DNA, protein synthesis and glycogenesis 
(deposition of glycogens). Tyrosine kinase also promotes cell growth and has a 
decreasing effect on lipogenesis (normal deposition of fat or the conversion of 
carbohydrate or protein to fat) and lipolysis (Neal, 2002). 

When one of the steps in the above mechanism fails, diabetic conditions occur, and the 
two major treatments for this are insulin injections and administration of oral anti- 
diabetic drugs. Regular physical activity has been recommended to diabetes patients 
either to prevent and delay the onset of non-insulin-dependent diabetes or to assure good 
control of diabetes (Wasserman etal, 1991). 

Insulin Injections 

Insulin may be extracted from pork pancreas and purified by crystallisation; it may also 
be extracted from beef pancreas. Human sequence insulin may be produced 
semisynthetically by enzymatic modification of porcine insulin or biosynthetically by 



41 



recombinant DNA technology using bacteria or yeast (Sibenhofer et al., 2003). All 
insulin preparations are to a greater or lesser extent immunogenic in humans, but 
immunological resistance to insulin action is uncommon. Preparations of human 
sequence insulin should theoretically be less immunogenic, but no real advantage has 
been shown in trials (Brody et al., 1998; Sibenhofer et al., 2003). 

Insulin is required by all patients with ketoacidosis, and it is likely to be needed by most 
patients with rapid onset of symptoms, substantial loss of weight, weakness and 
ketonuria. Almost all diabetic children need insulin administration. It is also needed for 
type II diabetes when other methods fail to achieve good control (Sibenhofer et al., 
2003). 

Gastro-intestinal enzymes inactivate insulin, and must therefore be given by injection; the 
subcutaneous route is ideal in most circumstances (Sibenhofer et al., 2003). Once 
injected, the insulin binds to the insulin receptors and stimulates tyrosine kinase activity. 
In humans the half-life of circulating insulin hormone is about 8 minutes and insulin acts 
on glucose or lipid metabolism rapidly after it binds to the insulin sensitive cells. Hence, 
it is important to make insulin preparations with long duration time and a faster onset. 
This can be done by increasng the particle size of the preparation or by complexing the 
insulin with zinc or protamines (highly basic proteins) (Brody et al., 1998). 

There are 3 main types of insulin preparations: 

• Those of short duration have a relatively rapid onset of action. These can be 
administered at hyperglycaemic emergencies. One of the short-acting types is 
soluble insulin, which is a simple solution of insulin but has a very slow onset 
compared to what is releaed by _ cells. Newly-developed insulin lispro and 
insulin aspart, which are analogues of insulin, have a faster onset (O.Shrs) but a 
shorter duration (3 hrs) (Brody et al., 1998). 

• Those with an intermediate action, e.g. isophane insulin (a complex of protamine 
and insulin) and insulin zinc suspension (Sibenhofer et al., 2003). Due to the 



42 



excess of protamine, when zinc insulin suspension is injected it dissloves slowly 
resulting in a prolonged duration of insulin activity (24 hrs). This can be too long 
to achieve good control in reducing blood gucose. To overcome this problem 
isophane insulin, which has lower concentrations of protamine, was developed. 
After the isophane insulin injection protelytic enzymes degrade the protamine, 
insulin is absorbed into the cells (Brody et ai, 1998). 

• Those whose action is slower in onset and lasts for long periods (36 hrs), e.g. 
extended insulin zinc suspension and protamine insulin zinc suspension. The 
advantage of having protamine zinc insulin suspension is that it can be mixed in 
any proportion without harming its stability or activity. The smaller concentration 
of protamine avoids its' allergies while zinc helps to maintain the prolonged 
action. Extended insulin zinc suspension dissolves very slowly which results in a 
slow onset (6-lOhrs) and longer duration (36 hrs). due to its large particles (Brody 
et al, 1998). However, using the same mixture with smaller particles increases 
the solubility and the insulin preparation has a faster onset and longer duration. 
Semilente insulin is a smaller particle insulin suspension (Sibenhofer et al, 2003). 

Type I patients use regimens of insulin contaning a mixture of short-acting and 
intermidiate-acting insulin preparations. To achive normoglycemic levels, more intensive 
regimens are used (Neal, 2002), and insulin injections are the only effective drug used in 
treating type I diabetes. 

Hypoglycaemia is a potential problem for all patients receiving insulin and patients must 
be instructed carefully to prevent it. Very tight control of diabetes lowers the blood- 
glucose concentration that is needed to trigger hypoglycaemic symptoms (Sibenhofer et 
ai, 2003). Under sever hypoglycemic levels, coma (insulin coma) and death could occur 
if the patient is not treated with glucose (Wasserman, 1991). 



43 



3.41 Oral Antidiabetic Drugs 

Sulfonylureas 

Sulfonylureas, containing benzene and amide groups, are oral drugs that stimulate the 
pancreas to release insulin and enhance the insulin sensitivity. Both these actions require 
circulating insulin in blood or _ cells that are capable of producing insulin. Hence, 
sulfonylureas are only effective in type II patients. These agents bind to Katp channels 
and inhibit K^ release which depolarizes the _ cell membrane. This results in an incerease 
entry of Ca^^ ions into the cell through the voltage gated Ca^"^ channels. This enhances 
the insulin secretion from _ cells (Brody et al., 1998). Glybenclamide, tolbutamide, 
glipizide and glicazide are some of the sulfonylureas in use. Glipizide and glicazide are 
commonly used short-acting drugs which are tried first on patients. Glybenclamides has a 
prolonged diu'ation but may cause hypoglycemia. Thus the patients with higher risk of 
hypoglycemia should be given tolbutamide which has a very short duration. 
Combinations with small amounts of insulin or with other drugs (such as metformin or a 
thiazolidinedione) may extend their benefits (Ducobu, 2003). Sulfonylureas pose a lower 
risk for hypoglycemia than insulin does. However, the hypoglycemia produced by 
sulfonylureas may be prolonged and dangerous compared to insulin injections (Malik & 
Trence, 2003). 

Meglitinides 

These agents stimulate beta cells to produce insulin, although the exact mechanism is 
uncertain. These agents are rapidly metabolized and short acting, and if taken before 
every meal, they actually mimic the normal effects of insulin after eating. They may be 
good agents for people with potential kidney problems. The main side effects include 
diarrhea and headache (Ducobu, 2003). 

Metformin 

Metformin, a biguanide agent, appears to increase the glucose uptake and the reason is 
yet to be discovered (Neal, 2002). Since there is no increase in the release of insulin, 
metformin has a very little hypoglycemic action; hence it is also known as 



44 



antihyperglycemic drug. Combinations of metformin with insulin-secreting drugs, other 
insulin-sensitizing drugs, or insulin itself are proving to be particularly effective. Since it 
does not cause hypoglycemia or add weight, it is particularly well suited for obese type 2 
patients. Metformin also appears to have beneficial effects on cholesterol and lipid levels 
and may protect against heart diseases. Gastrointestinal problems including nausea, and 
diarrhea and reduced absorption of vitamin B12 and folic acid, which are important for 
protection against heart disease, are common side effects of metformin (Malik & Trence, 
2003) 

Thiazolidinedione 

Also called glitazones, Thiazolidinedione improves insulin sensitivity by activating 
certain genes involved in fat synthesis and carbohydrate metabolism. It not only binds to 
a member of a nuclear receptor super family of ligand-activated transcription factor, 
called PPAR-_, but also increases the expression of certain insulin-sensitive genes (Brody 
et al, 1998). Thiazolidinediones do not cause hypoglycemia when used alone, although 
they are usually taken in combination with sulfonylureas, insulin or metformin. 
Rosiglitazone (Avandia) and pioglitazone (Actos) are the currently approved 
thiazolidinediones. These drugs are usually taken once or twice per day. Since they only 
enhance insulin sensitivity indirectly, it may take several days before the patient notices 
any results from them and several weeks before they take full effect (Ducobu, 2003) 

It has recently been found that thiazolidinediones produce very favorable effects on the 
heart, including reducing blood pressure and improving triglyceride and cholesterol 
levels (Malik & Trence, 2003). They may also block a molecule called IIBest HSK-I 
that may play a significant role in the metabolic syndrome (a prediabetic condition that 
includes high blood pressure and obesity) as well as diabetes type 2. One study also 
suggested that they may even improve beta-cell function and so help prevent progression 
of diabetes (Ducobu, 2003). Thiazolidinediones can cause anemia and, as with other oral 
agents, can cause moderate weight gain (Neal, 2002) 



45 



Alpha-Glucosidase Inhibitors 

These drugs, acarbose and miglitol (Glyset), reduce glucose levels by interfering with the 
absorption of starch in the small intestine. It inhibits -gucosidases which are complex 
carbohydrate degrading enzymes. Acarbose tends to lower insulin levels after meals, a 
particular advantage, since higher levels of insulin after meals are associated with an 
increased risk for heart disease. The most common unpleasant side effects are flatulence 
and diarrhea (Neal, 2002). 

Potential Drug Treatments 

Investigations on the autoantigens that cause _ cell destruction in type I patients could 
lead to possible drug development to prevent the autoimmune activity. Also the research 
done on the relationship between glucokinase activity and _ cell stimulation to release 
insulin as well as the genetic component of type I and II diabetes could be helpful in 
developing new drugs to control diabetic conditions. The increasing understanding on 
insulin activity on obesity, diabetic conditions and other complication has opened many 
possible approaches towards designing new drugs (Soria et al, 2001). An understanding 
of approaches taken by indigenous medical systems, such as those practiced for 
thousands of years in Sri Lanka, can also help find cures for and methods of prevention 
of diabetes. 

3.5 Sri Lankan Indigenous Medical approaches to the Treatment of Diabetes or 
"Madumeha" 

Diabetes was identified by the ancient Indians as early as 6* century B.C. while the first 
description of diabetes mellitus in western medicine only came in 1675 A.C. (Perera, 
1993). The Indian practitioner Susruta described diabetes as "Madumeha" meaning "rain 
of honey." In ancient Hindu medicine, diabetes has always been treated with oral 
administration of herbal plant extracts (Chaudri & Vohra, 1993). 



46 



Charaka Sanhita written by Charaka in 5 century B.C. in India, is one of the most 
commonly used Ayurvedic books in SLIM. Charaka has identified diabetes as sweetness 
of urine (Chaudri & Vohra, 1993). Ayurveda identifies the pathology and therapeutics 
connected with urinary/kidney system diseases, while classifying them into 20 categories, 
or called "visiprameha." This classification includes hematuria, glycosuria and diabetes 
and mentions that diabetes can only be controlled or prevented but not fully cured. 
Charaka Sanhita and other Ayurvedic literature have clearly described not only the 
importance of glucose or "Sharkara" to the human body but also its activity and synthesis 
(Perera, 1993). 

Ayurveda mentions two diabetic conditions: release of urine with sweetened properties or 
excessive urination without any sweetened properties. The first condition is identified in 
modem science as Diabetic Mellitus and the latter as Diabetic Insipidus (Jinadasa, 1993). 

An ancient Ayurvedic book called Shushrutha Chikithsa Stana identifies two major 
categories of diabetes: Sthula (Obese) and Krusha (Thin) types. This book describes that 
these types should be treated differently. The symptoms described under Krusha and 
Sthula highly resemble what modern science identifies as type I and II diabetes, 
respectively (Wijekoon & senadheera, 1993) 

Ayurvedic literature has mentioned people who lack physical exercise, sleep excessively, 
and consume excessive amounts of food with high fat and sugar are highly prone to 
diabetes later in life. It has identified three causes of diabetes: inheritance, obesity and 
malfunctioning of certain hormones. Ayurveda further describes different symptoms that 
occur with either type of diabetes (Jinadasa, 1993: Perra, 1993). 

The principal and initial symptoms of having high blood glucose level indicate firequent 
urination, excessive thirst, extreme hunger, increased fatigue, blurry vision and 
numbness. These Ayurvedic books mention two symptoms that are specific to diabetes. 
They are increased acidity of urine (modem day known as ketoacidosis) and any amount 
of glucose in urine (Jinadasa, 1993: Perra, 1993, Ramanayake, 2002). They emphasize 



47 



that it is very important to consider all the symptoms very carefully. They also describe 
two other situations that could cause the presence of glucose in urine. In modem times 
they are known as renal glycosuria (nondiabetic glycosuriya) and melituria (such as due 
to kidney disfunctions) (Vidyathilake, 1993). 

Adopted from Indian Ayurvedic books, SLIM practitioners have treated diabetes for 
thousands of years. Because diabetes is becoming increasingly common in Sri Lanka, a 
large group of indigenous medicine practitioners are currently conducting clinical and 
animal research trials based on indigenous medicine to find a cure for diabetes (Jinadasa, 
1993: Perra, 1993: Karunadasa, 1993). Thier research has shed light on the reasons for 
high susceptibility of the current Sri Lankan population to diabetes and described 
necessary steps to be taken to avoid or control this disease. 

Dr. D.M. Jayasingha, a well-known practitioner and researcher, has experience with 
treating diabetic patients who were not cured by western methods of treatment. He 
describes the importance of understanding the type of diabetes as mentioned in 
Ayurvedic literature and using plant extracts accordingly (Jayasingha, 1993) 

There are about 35 medicinal plants used in Sri Lanka to prevent or control diabetes 
{Table 3. 1). Some of these plants have been investigated by modem scientists for their 
anti-diabetic properties, while many still remain unknown to the rest of the world. Most 
of these plants are also used in Indian traditional medicine to treat diabetes {Table 3.2), 
while others are only used in SLIM. 



48 



a 

"3 

o 


"3 
o 

GO 

- 2 
c 55 

o 

3 
T3 
O 

C 


Endemic to India, but 

cultivated in Sri Lanka & 

tropics 


o 

:s § 

O 00 

*^ ^ 

.a o 

E 
<u 

T3 

C 

W 


d3 
C 

'3 
O 

3 

a. 

Ph 

o 


Tropical Africa, Deccan o; 

India, Sri Lanka- common 

in drier areas 


India, Sri Lanka, Burma, 

Austrailia, Malaysian 

Islands 


Himalayan region in India 

and Hill country in Sri 

Lanka 


q_ >. 
o ^ 
(/) a 
a c 

<u .5 
fe PC 

Q 


ca 

C3 

'C 

GO 
O 

o 

E 

-8 

c 
w 


iy5 
• 2" 

^§ 

C OS 

PQ ^ 

CQ 
C 


A native of the old world 
tropics, but introduced to 

the new world as a 

vegetable. Cultivated in Sr 

Lanka, Malaysia, The 

Philippines, Asia Pacific 


an 

e 


1 

1 


2 


CO 

C/0 


1 


1/1 

(L) 


c 
-2 

"o 


o 
o 




2 

T3 
C 
a 

> 

cS 

<u 

H-1 




H-1 


i 


o 

1 

o 
a 

c 

<: 


o 

1 

o 

C 
< 


(U 

g 

o 

.2 
-3 

c 
< 


2 

< 


CO 

0) 

o 

on 
< 


-2 

o 

a. 

e 

o 
U 

s 

2 

< 


o 

2 

-e 


<L> 

a 

n 

C3 
O 

c 

s 


1 

-2 
U 


D 
C3 
1) 

S 
o 
U 


oi 
o 

03 

> 

> 

c 
o 
U 


a 

«5 


■5 

Co 


s 
1 


1 
o 

1 

S 


1 

<1 


1 

s 

1 


J 
1 




CO 

1 

§ 

Co 

1 

CO 


I) 

1 

5 




1 

1 
o 


0) 

a 

z 

a 
o 

a 
a 

o 


'S 

■g 

1 

< 


o 

03 

< 


3 
00 

c 

-i -- 


5^ 
o 


S 

"o 

■g-w 

(U ^^ 
n . en 

-^ O 

on O 
X) o 


■55 W 

CO ^^ 

C3 x> 

ca — ■ 

SO 

ll 


ca (U 

oa 
Q 


o 

k< 

a 
is 

Ph 


v^ 

•^ 

^ 


g 

c 

03 
OS 
X) 

2 
>. 

on 

3 

2 

< 


IS 
S o 



i 

2i 


Circumtropical, occurs 

from Arabia through 

tropical Asia, commonly 

on the beaches of the 

Indian Ocean 


< 

cd 

PJ 



on 
-0 

c 




'C 1, 

t^ > 

« n 
II 

C X 

- 

CS 

n c 
ca 


CU 

-^ 

'C 


S 

(U 
T3 

C 
P-l 


2 

a 

■c .2 
00 -o 

^ c 
—' 

0) 

c 
Q 


Native to Malaya, 

Andaman Islands and 

Introduced to Sri Lanka, 

India 


C/3 

2 

H 


03 

-^ 
c3 
hJ 

'C 

00 




s 

<u 
-0 

c 
W 


ca 
-a 

03 


South Asia, Arabia, 

Madagascar, Mauritius, 

Trinidad and South East 

Asia 


Endemic to Sri Lanka, but 

cultivated in Mauritius 

islands. 


a 
-a 

'<B 
^< 

2 ^ 

'5b rt 
H w 

2 '^ 




1) 


1 





Pi 

■| 

tin 


m 

c 

on 


u 
)- 

(U 


t: 

03 

< 


a, 

C3 

00 

B 
B 


1 


T3 

IZl 

-0 

<u 

00 


IZl 



Di 
T3 
§ 

e 

00 

1 

IJ-I 


S2 




on 




o 

o 

u 


<u 


X 

3 

3 

u 


m 


'■e 


-C 

3 
W 






a. 

3 
W 


0) 



CO 


1) 

03 


ID 

a 
1) 


03 
X 
03 

P-H 


03 

i 

3 


J 




CO 

2 

CX 




2 


(D 
CS 
(U 

2 

C3 

s 



2 


2 




L 
1 

1 


1 

s 



1 


1 

s 

1 


i 

1 


-2 
s 

a 


1 

1 

S 

1 
1 


1 

1 


^ • 



1 


1 


i 

'S 


"-3 

1 

6 


■5 




t/3 
g 

§ ^ 

s § 


1 







C/D X 

r 2 




<u 
H 

2 

^^ 1— 

03 H 

1 
03 




c 

c 
2 

"3 ^^ 
c W 

sl 

CS 

E 



c« 

"S. 

3 

C 

D 
c 
X 


"cib 

^^ 
-— ' 
a c 

s 


a 

3 

X 

S 
-2 




s 

•1= w 

2 


C3 

_>> 

'> 


CQ 

c 

X 


¥ 

C3 





Widely cultivated in the 

tropics, commonely in 

Southeast Asia and 

including Sri Lanka. 


Sri Lanka, India, Pakistan, 

Southern China, New 
Guinea, Eastern Austrailia 


Pakistan, India and wideh 

cultivated in other regions 

including Sri Lanka 




India, Sri Lanka, Southern 

China, Malaysia and Asia 

Pacific region 


Sri Lanka, Malaysia, The 

Philippines, Asia Pacific 

region 


A monotypic genus of 

India, Burma Sri Lanka 

and Indonesia 


Cultivated in Sri Lanka, 

native to India, Java, East 

Timor 


Cuhivated in tropical 

countries around the work 

including Sri Lanka 


Native to India, but grown 

in Sri Lanka & throughout 

the tropics 




5o 
o 

CO 

">< 

o 
o 

(U 
D 


1 

CQ 
g 


1 

S 
O 
N 




en 


(U 




o 

CO 

t! 
X 

S 
o 

N 

0< 


i 

X 

« 

e 

o 

N 


i 

2 


CO 
(D 

O 

2 


O 

2 


CO 
CO 

3 


s 

i 

2 


o 

CO 
1 


CO 

o 


CO 
00 


o 

CO 

'So 

c 

N 


C/5 

CO 

c3 
X> 
'5b 

c 

N 


s 


i 
1 




8 

1 
s, 

1 


o 

It 

i| 


.2 
t 

1 
1 




1 

1 

eg 


o 

1 

1 

N 


1 

! 


1 

[Jh 
CO 

Oh 
O 


P 

is 

CO S 

< 


c 

CO 

PQ 

1 ^ 

CO 

3 
Z 


1/1 

,c 
'S 
c 

_cO 

en 

3 
< 


¥ 

_3 

CO 
S 

c 

CO 

2 


3 

Is 

c 

3 
< 


1 

|Jh 

CQ 


li 
1 ^ 


c 
O 

H 

c 


@ 


H 

CO 



.J 

i 

SB 


♦ 


T3 

on 

O 


O 

c 


•» 


♦ 


3 

O 

C 


♦ 


« 


■s 

3 
O 

c 


* 


* 


1/3 

3 
O 

e 


1/3 

3 
O 

e 


C/3 

3 

O 
C 


1/3 

3 

O 
C 


♦ 


♦ 


* 


* 


1/3 

3 
O 

c 


C/3 

3 
O 

e 


a 


o 

C 

o 

< 


U 

o 

< 


c 

o 
O 

< 


'B. 
o 

< 


o 

'5. 
o 

on 
< 


o 

CO 


<u 
o 

3 
Q 

3 

u 


<U 
1 

3 
O 

3 

u 


c 

JO 




o 

X) 


c3 
O 

c 
S 

3 




en 

C 

'S 
2 


en 
C 

'c 


2 
o 


2 
o 


o 




.2 
1- 

3 
-a 
2 

o 

C/2 


'■£ 

3 
3 
O 

J 


s 


>3 

s 

1 
1 


si 
1 


c 

Co 

t 


> 

s 

c:3 


2 

I 

1 


5 
1 

-Si 

8 

1 


3 
1 

a 

1 


1 

o 
S 

1 


g 

I 
c 
o 
S 

1 


2 

1 


1 

1 

1 

o 


sf 

c 

1 

s 

i 

Co 


1 
1 


ex; 

t 

s; 
o 
o 

1 


a 

si 

1 
§ 

1 

5 


c 
.g 

i 

1 


<5 

1 
1 


si 
.g 

s 

1 

s 


s 

1 

o 

1 

.2 
s; 

1 


1 

! 

2 


5 

s 
.2 

i 



>~> I) 



R> Oh 

PL, 00 



hi B 



3.6. Plants Used Against Diabetes in Sri Lankan Indigenous Medicine 
Spondias dulcis Sol. ex Parkinson. (Anacardiaeeae) 

Common Names: Ambarella (S), Otaheite Apple (E) 

Distribution: Native to South and South East Asia 

Ecology: This plant is found in the wet zone of Sri Lanka. It is commonly grown in the 
central and Southern Provinces, but can be seen throughout the country. Spondias 
pinnata, a related species, is grown in the northeastern parts of Sri Lanka but not used in 
SLIM. This plant is closely related to Mangifera indica (mango), which is also used for 
diabetic treatment 

Use in diabetes: Cooked or uncooked fruits are recommended for diabetic patients. 
Liquid extract from bark is given to control hyperglycemic conditions. 

Other medicinal uses: Fruits are known to prevent heart disease. Fruits and bark extract is 
given to prevent urinary problems, throat infections and gastritis. It is also used to reduce 
phlegm produced in the lungs and thought to be good for asthma patients. Ripe fruit is 
considered to be cooling and could be used against tonsillitis. Women who suffer from 
leuchorroea are recommended to eat fruits. 

Cultivating and harvesting: The plants are cultivated mostly by planting the seeds, but 
roots and stem cuttings can also be used. Within a year, about 100 kg of fruit can be 
harvested from a mature tree. 

Pharmaceutical properties: Unknown 

Sources: 01,09, 18,30 & 31 



49 



Mangifera indica L. (Anacardiaceae) 

Common Names: Amba (S), Mango (E) 

Distribution: Native to India and naturalized in Sri Lanka 

Ecology: This plant can be found throughout the wet zone of Sri Lanka and is grown in 
many home gardens. Many different varieties of this plant are found around the country 
including M zeylanica, a species endemic to Sri Lanka. 

Use in diabetes: Although it is mentioned in Ayurveda, SLIM has not used any part of 
this plant to treat diabetes. 

Other medicinal uses: Ayurveda has described the different medicinal properties of ripe 
and unripe fruits, roots, leaves, bark and seeds of this plant. Extracts from some of these 
organs are used to control excessive sweating, prevent vomiting, and relieve sore throat. 
It is knovm to be good for patients with heart-related diseases. 

Ayurveda has specifically mentioned the side effects of consuming excessive amounts of 
these fruits. People believe leaves contain certain disinfectant properties and hang them 
outside the door way to purify the house. 

Cultivating and harvesting: Seeds are often used in cultivation. Because of the economic 
value of the fruit, many varieties of the same plant are developed via biotechnologies, 
such as tissue culture and genetic engineering. Modified varieties are developed and they 
are resistant to certain climatic conditions and diseases. Fruits and other organs can be 
extracted in a considerably shorter period of time from the modified varieties than from a 
regular plant. 

Other: One of the most common fruits in Sri Lanka. It is very popular among the general 
population. Fruits are used as a vegetable in Sri Lankan cuisine, leaves in Hindu religious 



50 



ceremonies and wood for construction. Flowers and fruits are involved in certain 
romantic myths in Asian history. 

Pharmaceutical properties: Known chemicals are inorganic ions, amino acids tannin, 
fattyacid stearic (46.3%), oleic (40.0%) , palmitic, linoleic, arachidonic, behenic acids, 
5,6,5',6'-diepoxy-b-carotene carotenoid .triterpenoids tetracyclic triterpenoids, 3- 
caraene, Et butyrate, butyric acid, a-pinene . stearic acid (48%) 

Sources: 03, 04, 05, 07, 09, 18, 30 & 31 

Lasia spinosa L. (Araceae) 

Common Names: Kohila (S) 

Distribution: Native to the region ranging from India to Papua New Guinea 

Ecology: This plant can be grown under any climatic condition and is commonly found in 
wetlands and moist soils. 

Use in diabetes: Leaf and tuber extracts are given to diabetic patients and are known to 
reduce blood glucose levels. 

Other medicinal uses: This plant is well-described in the Ayurvedic books where each 
part of the plant is categorized according to its medicinal properties. Flowers contain 
properties that aid gallbladder diseases. Leaves are known to prevent digestive system 
diseases and are good for the liver. The fibers of tuber and stems reduce constipation. 

Cultivating and harvesting: Mature stems are used for cultivation and within 4-6 months 
tubers and leaves can be harvested for medicinal purposes and food. 



51 



Other: It is consumed as a food more than a medicine and not many are aware of the 
great medicinal properties of its leaves and tuber. In Ayurveda and SLIM, it is divided 
into different varieties according to the size or starch content of the plant, leaf or tuber. 
Apart from medicinal values, this plant is also used in many mystic and religious 
activities. It is believed that by lying next to leaves brings a good night of sleep to 
patients wdth insomnia. 

Pharmaceutical properties: Recent studies at the University of Colombo, Sri Lanka, have 
shown that leaves, tuber and stems contain high levels of -carotenes and could be used 
as a source of vitamin A. Most of the nutrients are lost during the process of cooking, 
hence uncooked leaves are thought to be the best. Stems contain hydrocyanic acid. 

Sources: 01,09, 18, 30 & 31 

Sphaeranthus indicus L. (Asteraceae) 

Common Names: Mudumahana (S), East Indian Globe Thistle (E) 

Distribution: Native to India, Sri Lanka, Burma, Austrailia and Malaysian Islands 

Ecology: This plant is often found adjacent to rice fields in the Central and North Central 
Provinces of Sri Lanka. 

Use in diabetes: Extracts from all the organs of this plant are used in treating diabetes and 
related urinary system conditions in SLIM. 

Other medicinal uses: Leaves, flowers and fruits are used to treat skin infections, stop 
external bleeding and suppress cough. Traditional communities in Sri Lanka use plant 
extracts as a blood purifier to prevent skin diseases. It is also used in India, Malaysia, 
Afiica and China as a medicinal plant. 



52 



Cultivating and harvesting: Seeds are collected from dried fruits and used for cultivation. 
Currently about 1400 kg are used in Ayurvedic medicine factories in Sri Lanka. About 
60% is used in the dried form. 

Pharmaceutical properties: Known chemical components of this plant are diglucoside, I 
Eudesmanoids, 11 alpha, 13-dihydro, sesquiterpene glycoside, sphaeranthanolide, 7 a- 
hydroxyeudesmanolides, sequiterpenoids, cryptometidiol, 4-epicyptomeridiol 
Sesquiterpene lactones eudesmanolide, Bicyclic sesquiterpene lactone, 5-alpha-7- 
hydroxyeudesmanolide, 7-alpha-hydroxyfrullanolide, cytotoxic sesquiterpenoid lactone, 
Eudesmanolides, sesquiterpenoids, cryptomeridiol, 4-epicryptomeridiol 

Sources: 07, 09, 18, 25, 30 & 31 



Gymnema sylvestris (Retz.) R. (Asclepiadaceae) 

Common Names: Masbeddha (S), Peripolca of the Woods (E) 

Distribution: Native to tropical Africa, Deccan of India, Sri Lanka 

Ecology: This plant is commonly found adjacent to tall trees in the secondary forests of 
the Dry Zone in Sri Lanka. However, it is cultivated throughout the country. 

Use in diabetes: Leaf extracts are used as a cure for diabetes in SLIM. Only leaves 
contain anti-diabetic properties. 

Other medicinal uses: Leaf extract is given to patients with gallbladder and kidney 
problems. Seed extracts cure influenza and tuberculosis. Root bark is good for eye 
diseases. Certain traditional practitioners believe that the leaf extract can be used to 
increase fertility in both males and females. Roots of the vine induce vomiting; traditional 



53 



communities in India, Western Africa and Australia use roots to treat venomous snake 
bites. 

Cultivating and harvesting: This can be cultivated by planting seeds. Within a couple of 
years fruits and leaves can be harvested. Interestingly, a rather small quantity of G. 
sylvestris is used among traditional drug manufacturers while a larger amount is sold in 
local markets. 

Other: There has been confusion over the identity of this species, as communities in 
different regions of Sri Lanka identify different varieties of this plant The genuine plant 
mentioned in the SLIM is a strong vine with leaves that can numb taste buds in the 
tongue, particularly taste buds for sugar. 

Pharmaceutical properties: Studies have shown that the leaves can stimulate the -cells 
in the langerhans to secrete insulin and another unknown endocrine hormone. 

The chemical components are hentriacontane, pentariacontane, _ -chlorphylls, phytin, 
resins, tartaric acid, formic acid, butyric acid, anthraquinone, inositol, d-quercitol 
"gymnemic acid", quercitol, saponins, gymnemic acid III, IV, V, VIII and IX, 
dammarane-type saponins gymnemasides I- VII, gypenoside XXXVII, LV, LXII LXIII, 
Gymnema saponins I-V, Oleanane-type saponins ,triterpene saponins, Gymnemic acid 
tritepenoid saponins gymnemasins A, B, C and D. 

Sources: 07, 09 & 18 



54 



Berberis aristata DC (Berberidaceae) 

Common Names: Daruhidra (S) Indian Barberry (E) 

Distribution: Native to Himalayan region in India and the highlands of Sri Lanka 

Ecology: This plant grows in the cold high alatitude grasslands of Sri Lanka. Three other 
Berberis species are found in Sri Lanka, one of which is endemic. However they are not 
used in traditional medicine, hence medicinal properties are unknown. 

Use in diabetes: Fresh root and bark extracts of this plant are used in diabetic treatment. 

Other medicinal uses: Every part of this plant is used in medical treatments. It is known 
to be good for illnesses in digestive system, inflammatory bowel disease, mouth diseases, 
liver, stomach and intestinal diseases, eye irritations, and skin infections. 

Cultivating and harvesting: This can be cultivated via seeds or stem cuttings and grown 
only in the cold high alatitude areas. Once the plant is mature, stems are collected and 
dried in mild sun. They can then be stored in a dry area for a long period of time. They 
are sold in the local herbal markets and are considered as one of the most expensive 
herbal plant extracts. 

Other: This is not a commonly used plant in Sri Lanka, mainly because it is not widely 
found. It is a prominent medicine mentioned in the Ayurvedic medicine and is widely 
used in India. For over 1500 years, Sri Lankan traditional practitioners have been using a 
substitute plant called Coscinium fenestratum (Gaertn.) Colebr (Venival (S): 
Menispermaceae), which is believed to have similar medicinal values. 

Pharmaceutical properties: Unknown 

Sources: 01,03, 04, 05, 07, 09 & 18 



55 



Stereospernuim suaveolens DC (Bignoniaceae) 

Common Names: Pallol (S), Messenger of Spring (E) 

Distribution: Endemic to India, but naturalized in Sri Lanka 

Ecology: In Sri Lanka this plant is cultivated as a medicinal plant in different areas, 
especially in herbal gardens. 

Use in diabetes: Leaves have anti-diabetic properties and it is recommended that diabetic 
patients eat leaves with rice. Ground flowers or an extract made from the flowers are also 
given to diabetic patients to control blood glucose levels. 

Other medicinal uses: Roots, leaves, flowers and bark are used for a variety of purposes, 
and Ayurvedic books have described its medicinal properties for each organ. 
Flowers and leaf extracts are knovm to be good for heart, lung and kidney-related 
diseases. Roots are given to induce breast milk. Flowers are also known to contain a 
property that induces sperm production in infertile males. 

Cultivating and harvesting: Stem cuttings and seed are used for cultivation. In about 3 
years, plant parts can be extracted for medicinal purposes. 

Other: Traditional practitioners in Sri Lanka use this plant as a substitute for 
Stereospermum personum, which is mentioned in Ayurvedic books. 

Pharmaceutical properties: Unknown 

Sources: 01, 03, 04, 05, 07, 09, 16, 18, 25, 30 & 31 



56 



Kokoona zeylanica Thw. (Celastraceae) 

Common Names: Kokum (S) 

Distribution: Endemic to Sri Lanka 

Ecology: This rare plant is mainly found in the wet areas of forests in Sri Lanka 

Use in diabetes: In SLIM, the bark extract is used to reduce blood glucose levels in 
diabetic patients. 

Other medicinal uses: Bark extract is also used for snake bites, eye diseases, as a nasal 
inhaler to relieve headaches, to remove zits and gain soft, smooth skin. Bark extract is 
still used among women, even in the urban areas, to maintain a healthy and beautiful 
skin. The oil extracted from leaves and bark is used as an insecticide in rural areas of Sri 
Lanka. 

Cultivating and harvesting: Seeds obtained from fruits are used for cultivation. 

Other: Before the Europeans brought soap to Sri Lanka, finely-ground bark from this 
plant was mixed with water and sun-dried to make soap. It is still popular among women 
in Sri Lanka and India. 

Pharmaceutical properties: Known chemical components are demethylzeylasterone (5), 
6-oxophenolic, celastranhydride 

Sources: 03, 04, 05, 07, 09, 18,30 & 31 



57 



Terminalia chebula (Combretaceae) 

Common Names: Aralu (S), Myrobalan (E) 

Distribution: Native to India, Burma, Malaysia, Sri Lanka and Thailand 

Ecology: This plant is grown in dry grasslands and Savannas in Sri Lanka, certain areas 
in the Eastern Province are natural habitats for this plant. 

Use in diabetes: Fruits of this plant are used in almost every medicinal preparation for 
treating diabetes. 

Other medicinal uses: One of the most prominent medicinal plants in Ayurveda and 
SLIM. The fruit contains preventative qualities for many common diseases. It is known 
to prevent diseases occurring from three "doshas" (imbalance of phlegm, bile & air) 
known in Ayurveda. Fruits are commonly used to treat intestinal ulcers and digestive- 
related and gum diseases, as well as mouth ulcers. Traditional communities believe 
consuming the fruit aids in keeping one healthy. 

Cultivating and harvesting: This plant is cultivated by planting seeds. Seeds have a thick 
seed coat. In order to break dormancy either the seed coat is crushed or the seed is soaked 
in water. Communities in eastern parts of the country collect seeds from the tree and sun 
dry them before sending them off to local markets. 

Other: Mentioned as a medicinal plant in old Buddhist prayers and in mythical stories, 
this plant was thought to have evolved from drops of the drink of the gods fallen to Earth. 

In addition to medicinal uses, fruit extracts are used as a pesticide, mouth cleanser and 
food. The trunk is used as timber and dyes are made from seed extracts. 



58 



Pharmaceutical properties: The fruit contains many chemical components. Known 
chemicals are tannins (pyrogallol type) chebulagic acid, chebulinic acid corilagin, 
hebulic acid, 6-digalloylglycose, ellagic acid, gallic acid, glucogallin, terchebin, 3, 6- 
trigalloylglucose 1,2,3,4,6-pentagalloyl- glucose sugar. Glucose, sorbitol, fructose, 
sucrose, gentiobiose arabinose, maltose, rhamnose, xylose succinic, quinic, shikimic, 
dihydro dehydroshiimic acids, chebulin, Terminalic acid (l-0-galloyl-2,4-chebuloyl- 
b-D-glucopyranose), 9-(2-hydroxyethoxymethyl) guanidine 

Sources: 0)1,09, 18 

Ipomoea pes-caprae (L.) R. Br. (Convolvuiaceae) 

Common Names: Bimthamburu (S), Goats Foot Creeper (E) 

Distribution: Naturalized from Arabia through tropical Asia 

Ecology: This plant grows along the coasts in the wet zone of Sri Lanka. Practitioners 
have identified two varieties of the same species and have divided them according to their 
medicinal value. 

Use in diabetes: Ground leaves are used to cure wounds caused by diabetic conditions. 

Other medicinal uses: Leaf extract is used to relieve cramps, cure skin diseases, arthritic 
conditions and prevent bacterial infections in feet. Certain traditional communities use 
this plant to cure sexually transmitted diseases. 

Cultivating and harvesting: Stem cuttings from vines are used for cultivation. If grown 
under bright sun under proper soil conditions, leaves can be collected within a month. 
About 2000 kg of leaves are sold in local markets annually. 



59 



Other: It is also a commonly-used medicinal plant among natives in Australia, 
Madagascar and Brazil. 

Pharmaceutical properties: Extracted chemicals from this plant are fatty acid glycosides, 
designated pescaprosides A, B and E. Pescaproside Epentaglycoside of 11- 
hydroxyhexadecanoic acid. Mucilage, volatile oil (0.05%), resins (7.3%) bitter 
substances, red coloring matter, pentatriacontane, triacontane, sterol, behenic, melissic, 
butyric myristic acids, 2-hydroxy-4, 4,7-trimethyl-l (4H)-napthaleone, (-) mullein, 
eugenol, 4-vinyl guaiacol 

Sources: 01, 03, 04, 05, 07, 09, 16, 18, 30, 31 & 47 

Aporusa lindleyana (Euphorbiaceae) 

Common Names: Kaballa (S) 

Distribution: Endemic to Sri Lanka 

Ecology: It is found above 900 m altitude in the primary and secondary forests 
throughout the country and is widely cultivated along stream banks. 

Use in diabetes: In SLIM, the plant is identified as a blood and urine purifier. Traditional 
practitioners recommend that patients with diabetes or suffering from obesity eat salad 
made from its leaves. 

Other medicinal uses: Immature leaves are a remedy for digestive system illnesses, eye 
diseases and eating disorders. However, since this plant is endemic to Sri Lanka, none of 
the Ayurvedic books from India mentions it. 

Cultivating and harvesting: Seeds or stem cuttings are used for cultivation. Within a year 
leaves can be collected for food or medicine. 



60 



Pharmaceutical properties: Unknown 
Sources: 09, 3>0 8!.3\ 

Phyllanthus emblica L. (Euphorbiaceae) 

Common Names: Nelli (S), Emblic myrobalan (E) 

Distribution: Introduced to Sri Lanka, native to India. 

Ecology: This plant is commonly found in the forests in Sri Lanka, but is grown 
throughout the country. 

Use in diabetes: The extract from root covering of P. emblica is given with turmeric and 
bee honey to diabetic patients. 

Other medicinal uses: In SLIM the leaves, bark, roots, fruits, seeds and flowers are used 
for different medicinal purposes. In addition to curing the digestive system illnesses, 
fruits are used to increase the sperm count in males and prevent heart disease. Leaves and 
fruits are good for urinary infections. 

Cultivating and harvesting: Stem cuttings or seeds that are sun dried and soaked in water 
overnight are used for cultivation. In about five years fruit can be collected and used 
either fresh or dried. Fruits are sold in local markets for high prices. In order to meet the 
demand, the government recently imported dried fruit from India with an approximate 
cost ofUS$ 60,000. 

Other: This plant has been used as a medicine in Ayurveda and SLIM since early history. 
The fruit is mentioned in Sinhalese literature from 1500 years ago and known as the 



61 



medicine of gods. The fruit juice is thought to be as good as the drink of gods. Queens 
and women of the royal family use bark extracts to maintain a smooth skin. It is one of 
the famous triple (tripala) herbs used in Ayurveda. Because of the high percentage of 
vitamin C in the fruit, it is also recommended as a healthy fruit by the western doctors. 

Pharmaceutical properties: Known chemicals are triterpenoids, flavonoids, tannins, 
alkaloids, phenolic acides. Flavonoids, lupeol, lupenone, quercetin, kaempferol, 
kaempferol 3-0-glucoside (=astragalin), tannins, phyllembin, gallotannin as 1,2,3- 
trigalloylglucose, ellagitannins terchebin, corilagin, chebulagic acid, chebulinic acid. 
Vitamin C (470-1810mg/100g), trigalloylglucose, ellagic acid, corilagin, terchebin, 
phyllemblin, phyllemblic acid and emblicol. 16% oil, Linoleic acid (44%), oleic acid 
(28.4%) linolenic acid (8.8%), stearic acid (2.2%) palmitic acid (3.0%) myristic acid 
(1.0%)Ellagic acki,empferol, kaempferol-3-glycosideamlaic acid, lupeol, - 
sitosterol, ellagic acid. Lupeol (+)-leucodel-phinidun. Ester glycoside. Phyllaemblicins A, 
B, and C. Methyl ester of a highly oxygenated norbisabolane, phllaemblic acid (1). 
Tarmins, putranjivain Aquercetin. 

Sources: 01, 03, 04, 05, 07, 09, 18, 25, 30 & 31 



Pterocarpus marsupium (Fabaceae ) 

Common Names: Gammalu (S) Indian Kino Tree (E) 

Distribution: Native to Malaya, Andaman Islands and naturalized in Sri Lanka, India 

Ecology: This plant is often found in high altitude areas in the intermediate and dry zones 
of Sri Lanka. The damage done to the tree by unregulated collection of sap has caused 
this plant to decline in Sri Lanka. 



62 



Use in diabetes: In SLIM, the leaves, xylem, bark, and sap have been used to treat 
diabetes. It is believed that drinking water steeped overnight reduces the blood glucose 
levels. The sap collected from the tree is also known to have anti-diabetic properties. 

Other medicinal uses: Leaf, sap and bark extracts are also used to treat cystic fibrosis and 
are known to increase one's vision, reduce dental problems and prevent certain skin 
diseases. The sap increases red blood cell count in those suffering from anemia. 

Cultivating and harvesting: Seed can be extracted from mature fruits during May and 
June. To harvest the sap effectively, sap is collected only from 20-year-old trees. 
Collections take place before sunrise since sunlight solidifies the sap and turns it into 
glue. Collected sap can be stored in a bottle for long periods. Wood can be obtained from 
30-35 year-old trees. Only the reddish brown region (pith and wood) in the center of the 
trunk is used in SLIM. 

Other: This plant had been popular among the 17* century wood craftsmen. It is believed 
that Europeans brought this tree to Sri Lanka from India. However, there is a 
contradiction here since the free has been used to freat diabetic patients prior to the arrival 
of the Europeans. 

Pharmaceutical properties: Known chemicals are -epicatechin. Liquiritigenin, 
isoliquiritigenin, alkaloid (0.017%^sin (0.9%). Yellow colouring matter (5%) 
essential oil semi-drying fixed oil (0.5%). Non-glucosidal tannin, kinotarmic acid (5-8%), 
kinoin kino-redatecholpyi(ocatechin)yotocatechuic acid, resiigalljxECtkcid, 
kinotannic acid. 

Sources: 01, 03, 04, 05, 07, 09, 18, 25, 30 & 31 



63 



Cassia auriculata (Fabaceae) 

Common Names: Ranawara (S), Mature Tea Tree (E) 

Distribution: Native to Sri Lanka and India 

Ecology: This plant can be found by the coasts and forests in Sri Lanka. A related 
species. Cassia divaricata, is another common plant in Sri Lanka but is not used in 
SLIM. 

Use in diabetes: An extract made from the flower and the leaf buds contains anti-diabetic 
properties and is used as a refreshing drink in rural communities. Traditional doctors use 
the flower to maintain normal blood-glucose levels. Ground seeds are also used in 
treating diabetics. 

Other medicinal uses: All parts of this plant are used in SLIM, but leaf buds are known to 
be most effective. Certain plant parts are used to cure eye diseases and as a pain reliever. 

Cultivating and harvesting: Traditionally, the seeds from this plant are used for 
cultivation. In about three years, flowers, leaves and other parts can be harvested for 
medicinal purposes. All parts can be sun-dried and packaged for sale in the local markets. 
Aimually, about 6,000 kg of this plant are used in SLIM medical factories. Because of the 
strong local demand, the Sri Lankan government imports about 2,000 kg of this plant 
from India every year. 

Other: Prehistoric evidence indicates this plant has been used as a herbal medicine; 
among several African communities it is used to treat diabetes, eye disease and sexually 
transmitted diseases. 



64 



Apart from its medicinal purposes leaves of this plant are used in 1 ) Sri Lankan cuisine, 
2) as a source of nitrogen and potassium in rice fields and 3) treat leather due to its high 
tannin content. 

Pharmaceutical properties: Known chemical compounds are Anthraquinone glycoside, 
3-hydroxy-6-8-dimethoxy-2-methyl anthraquinone- l-o--D-galactoside. 20% catechol 
type tannins (-), auriculacacidin, rutin, polyphenol oxidase ascorbic acid oxidase. Keto- 
alcohols emodine, -sitosterol rutin. Auricassidin, kaempferol -sitosterol 

Sources: 01, 03, 04, 05, 07, 09, 18, 25, 30 & 31 

Desmodium trijlorum L. (Fabaceae ) 

Common Names: Hin Undupiyaliya (S) 

Distribution: Naturalized throughout the tropics 

Ecology: The plants have a prostrate growth habit and grow in open places. The species 
is wide-spread in Sri Lanka. 

Use in diabetes: A drink made from dried and ground leaves is given to diabetic patients. 

Other medicinal uses: Ayurveda has divided this plant into three categories according to 
the size of leaves and have identified their different medicinal values. Only the smallest 
leaves are used in SLIM. Leaf extracts induce breast milk production and aid digestion in 
infants. Leaves are applied to heal fractured bones of children and chewing leaves 
prevent dried and cracked lips. Leaf extract is used for urinary and eye diseases, digestive 
problems and venomous reptile bits. It is believed that applying a mix of leaves and 
dropping from a rabbit that ate these plants reduces swellings in humans. Another belief 
is that walking on a patch of these plants helps to maintain good vision. 



65 



Cultivating and harvesting: Seeds or roots are used for cultivation. A few kilograms of 
leaves can be collected within 3-4 months. 

Other: This plant is widely known as the food of the rabbits. 

Pharmaceutical properties: These leaves contain a high concentration of vitamin B; other 
extracted chemicals are -phenylethylamines indole-3- alkylanines. Trigonelline, 
stachydrine, betaine, choline, indole-3-acetic acid. Tyramine hypaphorine. Hypaphorine 
N-N-dimethyltryptophan. Alkaloids amino compounds D.gangaticum. Alkaloids 
nitrogen-hypaphorine, N.N-dimethyltrytryptamine, N-N-dimethyltryptamin-Nb-oxide, 5- 
methoxy-N,N-di-methyltryptamine, 5-methoxy-N,N-dimethyltryptamine-Nb-oxide Nb- 
nethyltetrahydroharman, 2-methyl-6-methoxy-_-carbolinium cation. Hordenine (=N,N- 
dimethyltyra-mine), N-methyltryramine, candicine, -phenylethylamine choline. 

Sources: 07,09, \S, 30 &3\ 

Hydnocarpus venenata Gaertn. (Flacourtiaceae) 

Common Names: Makulla (S), Tangli Armond (E) 

Distribution: Endemic to Sri Lanka 

Ecology: This plant is grown throughout the country often adjacent to stream banks up to 
2000 m altitude 

Use in diabetes: The fruit, peel, leaves and bark are used in SLIM and extracts from all 
these parts are mixed with milk to treat diabetes patients. 

Other medicinal uses: A seed extract is also used to treat skin diseases and leprosy. An 
extract made from the seeds is applied around the belly button of women having a 
miscarriage. 



66 



Cultivating and harvesting: Seeds are used for cultivation. 

Other: Ayurvedic books from India have mentioned another plant with similar effects 
including anti-leprosy properties. 

Fruits of this plant are poisonous to fish and used for fishing in rural communities. Wood 
is used to build household equipment. 

Pharmaceutical properties: Known chemicals are mangostin, betulinic acid, ursolic acid 
acetyl, betulonic acid and sitosterol. 

Sources: 03, 04, 05, 07, 09, 18, 30 & 31 

Salacia reticulata Wight (Hippocrateaceae) 

Common Names: Kothalahimbutu (S) 

Distribution: Native to India and Sri Lanka 

Ecology: This is a woody vine that is found in the forests over 1500 m altitude. 

Use in diabetes: Root and bark extracts are used to treat diabetic conditions. 
Consumption of high doses can cause hypoglycemia and result in cardiac arrest and 
death. 

Other medicinal uses: A lotion made from leaves is used for skin diseases and infections. 

Cultivating and harvesting: Seeds are used for cultivation. Traditional practitioners use a 
different method for cultivating this plant. Once they extract the roots or the bark, they 
leave a small cut on the surface of the plant to stimulate new growth. Once mature, roots. 



67 



leaves and wood are harvested. Wood is sliced, sun-dried for a few days and thoroughly 
ground before storing. Stored products can easily get contaminated with fungus and 
should always be kept under dry conditions. Currently, 17,000 kg of this plant material is 
used annually in the SLIM treatments. About 28,000 kg per year are sold in the local 
markets for a variety of purposes. 

Other: Because of the misbelief that this plant is endemic to Sri Lanka, exporting this 
plant caused a controversy a few years ago. Due to its well-known, internationally 
recognized anti-diabetic properties, it was one of the most exported medicinal plants from 
Sri Lanka, but unregulated collection for exporting caused a decline in its population. 
Currently conservation laws regulate its collection, transportation and merchandising. 
Observations on long-term side effects have also caused a recent reduction in the 
collection and utilization of this plant. 

Pharmaceutical properties: Known chemicals are D:A-friedooleanan-3-one, 28-hydroxy- 
D:A-friedooleanan-3-one, 3-oxo-D;A-friedooleanan-28-al, 3-oxo-D:A-friedooleanan-30- 
al, D; A-friedooleanan-3,21-dione, 30-hydroxy-D:A-friedooleanan-3-one, 21ahydroxy- 
D:A-friedooleanan-3-one, 3-oxo-D:A-friedooleanan-30-oic acid pristimerin. 

Sources: 01, 03, 04, 05, 07, 09, 18, 22, 30 & 31 



Woodfordiafruiticosa L. (Lythraceae) 

Common Names: Malitha (S), Fire Flame Bush (E) 

Distribution: Native to South Asia, Arab, Madagascar, Maritius (spelling), Trinidad and 
South East Asia. 

Ecology: This plant is found in the high altitudes of the wet zone in open grasslands and 
mountain tops, often under bright sun. The species is rare in Sri Lanka. 



68 



Use in diabetes: Flower extracts are used to treat diabetes. 

Other medicinal uses: Extracts from the flower have anti-cancer agents. Flower extract is 
given to patients with diarrhea, intestinal ulcers and long-lasting external wounds. 
Additionally it relieves menstrual pains and cramps. Leaf extract is applied on the 
forehead to relieve headaches and applied on snake bites to stop the spread of venom. 

The red flower of this plant has certain fermentation properties during the blooming 
season; thus flowers are used in many traditional medicines as a preservative. 

Cultivating and harvesting: Seeds are used for cultivation. Flowers are collected within 
about three years for medicinal use. They should be collected early in the morning, before 
insects or birds feed on the nectar. The collected flowers can be dried and stored in a dry, 
cold place. Usually, 43,000 kg of dried flowers are sold aimually in local markets and 
about 12,000 kg are imported from India. 

Other: There is confusion among the traditional practitioners about the medicinal uses of 
this species and Bauhinia racemosa (Fabaceae). Some believe both have the same 
medicinal values. However, certain Ayurvedic books specifically mentions confusing the 
two plants; confusion may result from the similarity in the common name "Malitha" and 
"Maila." 

In addition to medicinal uses, dyes are made from flowers. Wood is used to make canes 
and spoons, and plants are cultivated on slopes to control soil erosion on mountains. 

Pharmaceutical properties: Unknown 

Sources: 01, 03, 04, 05, 07, 09, 18 & 25 



69 



Xylocarpus rumphii (Kostel.) Mabb. (Meliaceae) 

Common Names: Konthalan (S) 

Distribution: A rare plant, native to the South and South East Asia. 

Ecology: This plant grows only in mangroves by the ocean. In Sri Lanka, there is only 
one tree, and it is found by the Roomassala beach in the southern coastal area and thought 
to be endemic to the area. Interestingly, Roomassala has many endemic species. 
Traditional communities believe that Roomassala was brought to Sri Lanka from India 
thousands of years ago during a war between an Indian and a Sri Lankan king. 

Use in diabetes: Fruits and its peels are used to treat diabetes. 

Other medicinal uses: There is not a significant amount of information on medicinal 
values of this plant in Ayurvedic books. SLIM has used the fruits to treat kidney-related 
disease, measles, chicken pox, mumps and certain digestive illnesses. It was also given to 
patients with food and alcohol poisoning. Certain practitioners have made a medicine 
called "gopalu guli" from the leaf extracts, and it was a regular household medicine for 
many different illnesses, but because of its rareness, it is no longer used in any 
medications. 

Cultivating and harvesting: Government can take certain steps to increase the population 
by educating people about its medicinal and economical values. 

Other: Fruit has certain poisonous properties and hence traditional practitioners followed 
a certain purification method before using it for any medicine. 

Pharmaceutical properties: Unknown 

Sources: 03, 04, 05, 07 & 09 



70 



Osbeckia octandra L. (Melastomataceae) 

Common Names: Hin Bovitiya (S), 

Distribution: Endemic to Sri Lanka 

Ecology: Found throughout the country, often in the secondary canopy layer of forests 
and in grasslands in low and high altitudes of the dry zone. The plant is also found in 
home gardens, mostly because of its beautiftil purple flowers. 

Use in diabetes: Immature leaves are recommended for diabetic patients to control their 
blood-glucose level. 

Other medicinal uses: Leaves, roots, flowers and bark have medicinal properties and are 
used to make refreshing drinks. It is thought to be good for liver-related disease. 

Cultivating and harvesting: Seeds and stem cuttings are used for cultivation. 

Other: A related plant, with a genetic polymorphism causing the flowers to be white is 
also mentioned in the SLIM and thought to have valuable medicinal properties. 

Pharmaceutical properties: Unknown 

Sources: 07, 09, 13, 18, 22, 29, 30, 31 & 48 



71 



Ficus racemosa L. (Moraceae) 

Common Names: Aththikka (S), Country Fig (E) 

Distribution: Native to Sri Lanka, India, Pakistan, Southern China, New Guinea, Eastern 
Austrailia 

Ecology: It is commonly grown adjacent to stream banks in low ahitudes of the wet zone. 

Use in diabetes: Phloem extract from the root or extracts from crushed seeds are given to 
diabetic patients. Liquid collected from boiling the bark and roots have anti-diabetic 
properties. 

Other medicinal uses: Leaves, bark, fruits, flowers and sap of this plant are used in 
SLIM. Leaves disinfect external wounds and remove scars and zits. Extracts from all 
parts can cure intestinal and stomach ulcers, other digestive system related conditions, 
urinary infections and gonorrhea. It is also given as a pain reliever during labor. 

Cultivating and harvesting: Ripe fruits are soaked in water and seeds are extracted for 
cultivation. Leaves and fruits can be collected within a few years. Fruits are collected 
from April through August to be sold in the local markets. Bark is only obtained from 
mature trees, while collecting the bark, sap can also be collected. Only fresh sap has a 
medicinal value. 

Other: In some villages fruits are eaten. Myths state that it is imfortunate to see the 
flowering of this tree. 

Pharmaceutical properties: The sap contains caoutchouc, and the bark has gluanol 
acetate, beta sitesterol, leucocyanidin-3-0-_-D-glucopyranoside, lupeol, ceryl behenate 
lupeol acetate, -amyrin acetate. Other known chemical contents are 4.0-7.4% 
caoutchouc 14% tannin calcium zih8% protein Lignin gluanol acetate, -sitesterol. 



72 



leucocyanidin-3-0_-D-glucopyranoside, Ieucopelargonidin-3-0_rhanmnopyranoside, 
lupeol, ceryl behenate lupeol acetate -amyrin acetate. 

Sources: 07, OS, 09, n & 13 

Syzygium Cununi Skeels. (Myrtaceae) 

Common Names: Madan (S), Black Plum (E) 

Distribution: Native India, Sri Lanka, Southern China, Malaysia and Asia Pacific region 

Ecology: Commonly grown in the forests in Sri Lanka, it is traditionally believed to be 
suitable for growing by river banks to purify water. They are also grown by the coast to 
reduce sand erosion. 

Use in diabetes: Juice extracted from the fruits controls blood glucose level. Extraction of 
seeds and bark is also known to have anti-diabetic properties. 

Other medicinal uses: Bark extract is used in mouth-related diseases and for dental 
problems. Leaf extract stops vomiting, and extractions from leaf buds are applied on 
external wounds. 

Cultivating and harvesting: Seeds are used for cultivation 

Other: Unknown 

Pharmaceutical properties: Known chemicals in this plant are Glucose, fructose, sucrose. 
Malic acid, Gallic acid, tannins, cyaniding diglycosides, sterol, essential oil and fixed oil 
linoleic acid. Oleanolic acid. Triterpnoids, acetyl oleanolic acid, eugenia-triterpenoid A 
eugenia-triterpenoid B. EUagic acid, flavonoids isoquercitrin, quercetin, kaempferol 
myricetin. Protein, calcium, tannin (c.19%), ellagic acid, gallic acid (1-2%), glycoside 



73 



(jamboline), starch (0.05%), essential oil, myricyl alcohol. Essential oil, terpenes, 1- 
limonene, dipentene, sesquiterpenes of cadalane type, sesquiteqjenes of azulene type, 
flavonoid glycosides, isorhamnetin-3-O-rutinoside, myricetin-3-O-glucoside myricetin - 
3-0-arbinoside. Betulinic acid, -sitosterol, friedelin, ester of epi-friedelanol fatty acid 
tannins, gallic acid, ellagic acid, myricetin resin 

Sources: 01, 03, 04, 05, 07, 09, 15, 18 & 25 

Morinda citrifolia L. (Rubiaceae) 

Common Names: Ahu (S), Indian Mulberry (E) 

Distribution: Native to Sri Lanka, Malaysia, The Philippines, Asia Pacific region 

Ecology: This plant is mostly grown close to the beaches and in backyards of houses in 
the Southern and Western Provinces of Sri Lanka. A related species, Morinda tinctoria, is 
grown in Sri Lanka. It is commonly found in the Northern Province, but is not used in 
SLIM. 

Use in diabetes: Liquid collected from boiled fruits is used in treatment of diabetes. 

Other medicinal uses: Extracts from all parts of the tree are used to treat digestive-system 
illnesses, diarrhea, liver and gallbladder. Liquid extracted by grinding leaves is used as a 
lotion for infections and wounds. Water taken from boiling fruits is used as a mouth 
cleanser and known to be good for gum diseases. 

Cultivating and harvesting: Unknown 

Other: Since early history, the fruit has been used in mystic and religious activities. 
Because of the unpleasant smell of the fruits, insects and birds tend to stay away from the 
trees. 



74 



Pharmaceutical properties: Fruits contain Hexanoic, Decanoic and Octaanoic acids; the 
&st two are in their inactive form while the latter is poisonous in higher doses. 

Known chemicals are Octanoic acid, Hexanoic acid, Decanoic acid, glycosides 
trisaccharide fatty acid. Rutin, asperulosidic acid. 2, 6-di-0-(beta-D-glucopyranosyl)-l- 
0-octanoyl-beta-D-glucopyranose, rutin, asperulosidic acid, digitolutein, rubiadin 1- 
methyl ether damnacanthal, iridoid lactone, morindolide, iridoid glucoside, 
morofficinaloside, Anthraquinones, Iridoid glucosides, monoterpene glycoside, 
phytosterols 

Sources: 03, 04, 05, 07, 09, 18,30 & 31 



Aegle marmelos L. (Rutaceae) 

Common Names: Beli (S), Bael Fruit (E) 

Distribution: A monotypic genus of India, Burma Sri Lanka and Indonesia 

Ecology: In Sri Lanka, this tree grows naturally in dry monsoon areas, but can also be 
found throughout the country. 

Use in diabetes: Leaf extract has anti-diabetic properties. 

Other medicinal uses: Every part - the roots, leaves, bark, fruits, sap, seeds, wood and 
thorns - are used in SLIM. In Ayurveda, this plant is divided into two categories 
according to the size of its thorns and fruits. Ayurveda has described the medicinal values 
of each part of the tree and have identified different medicinal values in unripe, partially 
ripe and ripe fruits. Roots prevent heart failures and other heart-related diseases. Fruit is 
commonly used in Sri Lankan households to cure digestive problems. Roots, bark and 



75 



leaves prevent vomiting and relieve stomach aches and digestive problems caused by 
bacterial infections. These extracts are also used as a pain reliever during labor. Extract 
collected from boiling roots and flowers is consumed as a refreshing drink in rural 
households and known to prevent urinary problems. 

Cultivating and harvesting: Usually the plant is cultivated via seeds. Fruits can be 
collected within five years. Trees that are about 10-15 years old yield -400 fruits per 
year. These fruits can be stored for long periods by slicing and sun drying them. In the 
year 2000, about 32,000 kg of fresh and dried fruits were sold in local markets for 
medicinal, religious and other purposes. 

Other: This plant had been used as a medicine in prehistoric communities in Sri Lanka. It 
is considered a precious tree once honored by a famous Hindu god. It is believed that 
growing this tree in the backyard brings peace and prosperity to the owner. 

Pharmaceutical properties: It is known to contain Oleiclinoleic acides (-56.5%). 
Luvangetin, pyranocoumarin. Coumarins, alkaloids, sterols, terpenes, flavonoids, 
anthraquinones, lignan-glucosided, tarmins volatile oils. Coumarins, furano coumarins, 
imperatorin (marmelosin) allo-imperatorin, xanthotoxin, xanthotoxol, marmesin, 
psoralen, hydroxyl counmriiBlliferone, scopoletin, 0-alkylated coumarins, 
aurapten, epoxyaurapten, marmin, 7-0-meltyl marmin, marminal, pyrano courmarin 
aegelinol, ciimamamide type alkaloidal amides, aegeline, marmeline, tembamide, N-4- 
methoxystyrylcinnamide. C-glucosylated propelargonidins. Anthraquinones, lyoniresinol, 
lignan-glucosides. Anthraquinones. 7, 8-dimethoxy-l-hydroxy-2-methylanthraquinone, 
6-hydroxy-l-methoxy-3-methylanthra-quinone. Monoterpene hydrocarbons, myrcene, 
oxygenated monoterpenes sesquiterpenes. Volatile oidK-linalool oxide, terpene 
alcohols,- ionones, terpene, gum polysaccharides. Protolimonoids, senecioate esters 
of C-21-_ C-21-_ glabretals , isovalerate esters of C-21_- C-21-_ glabretals, glabretane 
pentacyclic triterperes. 

Sources: 01, 03, 04, 05, 07, 09, 16, 18, 25, 30 & 31 



76 



Curcuma longa L. (Zingiberacease) 

Common Names: Kaha (S), Tumeric (E) 

Distribution: Native to India, but naturalized in Sri Lanka & throughout the tropics 

Ecology: This plant is found throughout the country. 

Use in diabetes: Rhizome and flower extracts are used to control diabetic conditions. 

Other medicinal uses: Rhizome extract prevents diarrhea, asthma and cystic fibrosis. 

Cultivating and harvesting: Rhizomes with shoots can be planted. In about nine months 
new rhizomes can be harvested. The traditional method of preservation is to boil the 
rhizomes and air dry them under mild sun for about 12 days. 

Other: Tumeric is one of the most commonly used spices in a Sri Lankan household. 
People of Hindu faith consider the liquid extract of tumeric to have disinfectant 
properties and believe it brings prosperity to a house. Buddhist monks use the rhizome 
extracts to dye their robes yellow. A widely used spice throughout the world, it has a high 
economic value in Sri Lanka. 

Pharmaceutical properties: The known chemicals extracted are a-turmerone (30-32%), 
arturmerone (17-26%), b-turmerone (15-18%), a-phellandrene (18.2%), 1,8-cineole 
(14.6%), p-cymene (13.3%), b-curcumene (32.2-14.5%), ar-curcumene (33.2-14.5%), 
xanthorrhizol (19.8-3.0%), germacrone (9.2-1 .2%)), curzerene (8.7-2.3%), curzerenone 
(6.9-0.8%), monoterpenes, camphor (14.3-2.6%), a-terpineol (1.6-0.9%), isobomeol (1.6- 
0.3%), and camphene (2.0-0.1%), sesquiterpenes, a-turmerone 18.9-24.2, b-turmerone 
11.4-35.6, ar-turmerone 4.0-13.7, zingiberene 1.1-3.3, b-sesquiphellandrene 1.7- 
2.3%monoterpenes, 1,8-cineole 0}3>^J4fidiaMie 0.3-3.4a-terpinolene, 0.1- 



77 



1.1% a-Turmerone, b-turmerone, ar-turmerone, b-sesquiphellandrene, a-phellandrene, 
a-terpinolene . 

Sources: 03, 04, 05, 07, 09, 16,18, 30 & 31 

Zingibera officinale Roscoe (Zingiberaceae) 

Common Names: Inguni (S), Ginger (E) 

Distribution: Cultivated in tropical countries around the world including Sri Lanka 

Ecology: Common throughout Sri Lanka. 

Use in diabetes: Rhizome extract has anti-diabetic properties. 

Other medicinal uses: This is another prominently used plant in SLIM. It is known as 
''Mahaushadd" - the king of medicine - in traditional communities. Ayurveda mentions 
that fresh rhizomes have different medicinal properties than dried rhizomes. Fresh 
rhizomes increase production of phlegm in lungs while dried rhizomes reduce it. A 
neuron stimulant, rhizome extracts are given to relieve headaches and other pains. They 
are also used to prevent digestive- related diseases and asthmatic conditions. In traditional 
communities it is believed that eating the rhizome increases one's ability to memorize. 
Women use it to maintain a constant menstrual cycle. 

Cultivating and harvesting: Mature rhizomes with shoots are used for cultivation. Grown 
rhizomes can be harvested within about 9 months. If only used for food, it can be 
harvested within 6 to 8 months, but should grow for full nine months if it is to be used in 
medicine. Traditionally, people used a specific method to preserve ginger rhizomes. After 
soaking the rhizomes in water for a day, they cover it with ash or CaCOs It is sun dried 
for about 10 days and stored in a cold dry place. 



78 



Other: In Sri Lankan households, rhizome is used when cooking high protein meals to 
help digestion. 

Pharmaceutical properties: The rhizome contains three types of dehydroshogaols. a- 
zingibirene, b-sesqui phellandrene, ar-curcumene, camphene, b-myrcene, a-phellandrene 
copaene, a-famesene, caryophyllene germacrene. 

Sources: 03, 04, 05, 07, 09, 1 8, 30 «& 3 1 

Further research on all these medicinal plants is critical and may even lead to the 
discovery of a novel drug to cure or prevent diabetes. 

3.7 Experimental methods used to investigate anti-diabetic properties of traditional 
medicinal plants 

Modem approaches to testing efficacy of anti-diabetic properties in traditional medicinal 
plants are usually carried under the following procedure. 



Collecting and identifying the plant material. 

Drying, pulverizing, sieving and storing of material. 

Performing preliminary qualitative chemical analysis. 

Testing in isolated organs and whole organisms. 

Conducting toxicity studies. 

Studying anti-diabetic properties on experimental animals. 

Performing clinical trials. 



Anti-diabetic activity is measured by the change in blood-sugar levels in animals induced 
with a test drug. The levels are measured before and after the administration of the drug. 

Experimental diabetes can be induced by any of the following methods: 
• Pancreactomy i.e. surgical method 



79 



• Hormone Injections: 

(i) Anterior pituitary extract 
(ii) Corticotropins 
(iii) Epinephrine 

• Chemical Methods: 

(i) Sodium cetoacetate 

(ii) Allozan (Choudry & Vohora, 1993) 

Most investigators have used mice, rats and rabbits as experimental animals. Alloxan 
induced diabetes has been the most commonly used methods in these animals. They are 
usually given about 150-200 mg of Alloxan per one kilogram of body weight by rapid 
intravenous injections; this partially degenerates beta cells in Langerhan islets. To 
prevent initial hyperglycemia in animals, 2.5 g/kg of glucose is fed. In about 4-7 days 
permanent diabetes is induced. 

Researches in South Asia have used various methods to investigate the blood-glucose 
level in diabetes-induced animals. Glucose uptake by Rat Diaphragm Method, a 
comparison with standard hypoglycemic agents and methods for Elucidation of 
Mechanism of Action are some techniques to measure bloods-glucose levels. Once 
traditional medicinal plant extracts are proven to be effective in controlling blood-glucose 
levels in experimental animals, clinical trials are conducted. These clinical trials are 
carried out under strict hospital supervision (Choudry & Vohora, 1993) 

Through carefully conducted research on SLIM, vast amount of knowledge can be gained 
on therapeutic methods for many illnesses such as diabetes. These investigations, apart 
from the benefit towards discovering new drugs, might lead to a wider recognition of 
SLIM locally and internationally. 



80 



3.8 Current Medicinal Plant Conservation Efforts in Sri Lanka 

Historical evidence shows that eariy kings in Sri Lanka, urged the cultivation of fruits 
vegetables and herbs for animals and humans (Silva, 1984). Thus from historic times Sri 
Lankans have recognized the importance of conserving plants and biodiversity. 

In 1998, with the encouragement from the CBD (Conservation of Biological Diversity), 
the Sri Lankan goverimient indicated interest in conservation and sustainable use of 
medicinal plants. These include: 

• In-situ conservation- the Sri Lankan government have established five 
medicinal plant conservation areas adjacent to existing natural forests that are 
habitats to certain threatened medicinal plants. These areas are Bibile and 
Ritigala (Dry Zone), Rajawaka and Naula (Intermediate Zone) and kanneliya 
(Wet Zone), each of which representing a different ecological zone of Sri 
Lanka. The project aims to involve communities living in these areas to 
promote conservation and sustainable use of plants. Each site contains a 
medicinal plant garden, a medicinal plant processing center for the use by 
local communities, an ayurvedic dispensary and an information center. 

• Ex-situ conservation - Promoting the establishment of nurseries, home 
gardens and plantations, and supporting propagation and agronomic research 

• By providing information and institutional support including promotion of an 
appropriate legal and policy environment (Mahindapala, 2004: Palliyagedara, 
2004: Mudalige, 2004) 

A Convention on International Trade in Endangered Species of Wild Fauna and Flora 
(CITES) revealed that the biggest threat to endangered spices including medicinal plants 
in Sri Lanka and other countries is the destruction of their natural habitats for industrial 
purposes (Joseph &, Mahindapala, 2004). CITES described commercial exploitations are 



81 



the second largest threat to the survival of these species. Certain medicinal plants species 
are prone to extinction due to unlimited exploitation, especially for exportation. For a few 
dollars, which is worth a lot of money in Sri Lanka, a villager may agree to collect any 
amount of medicinal plants from the forests. Another threat to these plants is the lack of 
public awareness about medicinal value of these plants (Pilapitiya, 1994) The 
government and the citizens must safeguard this heritage while providing a better health 
care system to the world (Samarasinghe, 1994). 

Currently almost all the medicinal plants used in SLIM are cultivated at Peradeniya and 
Haggala Botanical Gardens and at herbal gardens in Bandaranayake Ayurveda Research 
Center, Bathgoda, Pallekale, Girandurukotte and HaldummuUa (Joseph &, Mahindapala, 
2004). 

The best place to collect medicinal plants or plant material is the primary forest. 
Traditionally, these plants are believed to contain the best medicinal properties. 
Unregulated collection could be harmful to the natural growth cycle of the plant and its 
environment, especially if collected in mass quantities. While it is better to cultivate these 
plants, it is a concern that use of pesticides and herbicides could reduce medicinal 
properties (Mudalige, 2004). Hence organic farming may be better suited for the 
cultivation of medicinal plants. In Sri Lanka, unsupervised use of chemicals in farming 
has damaged many herbal medicinal plants. Some herbicides may eradicate certain 
plants, while some chemicals cause harmful effects. Currently, the Sri Lankan 
Agriculture Department combined with the Ayurvedic Department has introduced certain 
plans and procedures on cultivating and conserving medicinal plants. They have 
encouraged local farmers to follow some of the methods used in traditional Sri Lankan 
agriculture and not to disregard them simply because they are "traditional." For example, 
Ayurveda suggests collecting only the roots growing towards the west side of the plant. 
This actually reduces destruction since roots from other sides are still protected 
(Marasinghe, 2000: Gunasekara, 2002). 



82 



Most of the plants used in Ayurveda or SLIM have a high economic value due to their 
medicinal properties. However, the collection of material from these plants is very 
tedious and labor intensive. Since labor is much cheaper in India than Sri Lanka, India 
has been one of the major providers of certain medicinal plants to the international 
community (Gunasekara, 2002). 

Illegal exportation of medicinal plants is another unfortunate circumstance in the country. 
Sri Lankan customs have detected several times in which Salacia reticulata Wight 
(Kothala Himbutu (S): Hippocrateaceae) plants have been attempted to be smuggled out 
of the country. It is also believed that Coscinium fenestratum (Gaertn.) Colebr (Venival 
(S): Menispermaceae) and Rauvolfia serpentina (L.) Benth.ex Kurz (Ekaveriya (S): 
Apocynaceae), two protected endangered plants, are often smuggled out of the country. 
This situation poses a major threat to the economic value of medicinal plants of Sri 
Lanka, especially of those that are endemic (Marasinghe, 2000: Gunasekara, 2002: 
Mahindapala, 2004). 

Certain plants have become almost extinct from the uncontrolled collection due to the 
high demand from pharmaceutical companies in the western countries. There is also a 
huge revenue loss for the Sri Lankan government as some of these plants are sold in the 
black market. As the mass collection and exportation for very low prices to the foreign 
markets continue, it causes a detrimental environmental and economical effect to the 
country. Hence, there should be a carefully conducted cost and benefit analysis on the 
current situation and repay any damages caused to the traditional communities. 
Additionally, botanists believe that plants may have lost their medicinal properties 
because of the over-exploitation of their gene pool. They suspect that genetic drift and 
degradation of biodiversity will be the ultimate result of this over-exploitation 
(Marasinghe, 2000). Another major threat to the natural habitats of medicinal plants is the 
rapidly increasing human population. Most of the medicinal plants are found in the wet 
zone of the country, where most of the Sri Lanka's population is concentrated. Botanists 
fear that researchers or naturalists in disguise are collecting important and endangered 
plants even from the conserved areas for exportation. Even though there is pressure from 



83 



international and local organizations to conserve and protect medicinal plants, financial 
hardship in rural communities in Sri Lanka is a major obstacle to prevent over- 
exploitation of plants. The lack of knowledge on medicinal plants and their habitats 
among policy makers, conservationists, students and teachers, villagers, farmers and 
other general public is another obstacle that needs to be addressed by the government 
(Marasinghe, 2000: Gunasekara, 2002: Mahindapala, 2004: Ministry of Agriculture, 
1995). 

Enforcing the law, educating the public and regular monitoring of natural habitats for 
medicinal plants would provide a better future not only to the SLIM, but to the 
biodiversity of the country (Marasingha, 2000). It is also important to urge those who 
practice indigenous medicine in rural communities to pass their knowledge on plants to 
the next generation. 



3.9 Conclusions 

With the increasing attention from developed world towards ethnomedicine and 
ethnobotany, SLIM foresee a bright future as it carries a vast knowledge on plant 
medicine. Production of higher quality drugs and standardizing them under the 
supervision of Indigenous Medicine Drug Corporation of Sri Lanka would attract more 
people to use these medications. Collaboration of Western doctors and researchers with 
the traditional practitioners will develop this medication system to implement better 
human healthcare in the future (Simpson &. Ogorzaly, 2001). It is important to preserve 
the indigenous knowledge retained through generations while also conserving the plants 
for future medicinal use and research. 



84 



3.10 Bibliography 

1. Abeywardana, N., and Hettiaratchi, J.K.L.. 2001. Statistics on the National Demand for 
Medicinal Plants - Consultants Report. Sri Lanka Conservation and Sustainable Use of 
Medicinal Plants Project. 

2. Arseculeratne, S.N., Gunatilaka, A. A. L., Panabokke, G.R. 1985. Studies on medicinal 
plants of sri lanka. part 14: toxicity of some traditional medicinal herbs. Journal of 
Ethnopharmacology, 13:323-335 

3. Ayurveda Oushada Sangrahaya Vol I. 1979. Ayurvedic Department of Sri Lanka, 
Navinna, Maharagama. 

4. Ayurveda Oushada Sangrahaya Vol I. 1985. Ayurvedic Department of Sri Lanka, 
Navinna, Maharagama. 

5. Ayurveda Oushada Sangrahaya Vol I. 1976. Ayurvedic Department of Sri Lanka, 
Navinna, Maharagama. 

6. Chaudhury, R.R. and Vohora, S.B. 1993. Plants with possible hypoglycaemic activity. 
Ayurveda Sameekshawa. IV: 2 1 3-22 1 . 

7. Compendium of Medicinal Plants. A Sri Lankan Study. Volume I, II, III & IV. 2002. 
Ayurvedic Department of Sri Lanka, Deepani Publishers, Nugegoda, Sri Lanka. 

8. Crusz, H. 1973. Nature conservation in Sri Lanka (Ceylon Biological Conservation. 
5:199-208 

9. Dassanayake M.D., Clayton W.D. 1996. A Revised Handbook to the Flora of Ceylon, 
Vol. 1-XIV. Oxford & IBH Publishing Co. Pvt. Ltd. New Delhi 1 10001 

10. De Silva, P.T. 1984. A salute to tradition. Journal of the Ceylon College of 
Physicians. 17: 3-11. 

11. Fernando, M.R., Thabrew, M.I. and Karunanayake, E.H. 1987. Oral hypoglycaemic 
activity of the stem bark of Ficus benghalensis. Ceylon Journal of Medical Sciences. 30: 
73-77. 

12. Fernando, M.R. and Thabrew, M.I. 1989. Studies on the possible toxicity of 
Artocarpus heterophyllus. Ceylon Journal of Medical Sciences. 32: 1-7. 

13. Fernando, M. R., Thabrew, M. I., and E. H. Karunanayake. 1990. Hypoglycaemic 
activity of some medicinal plants in Sri-Lanka. General Pharmacology: The Vascular 
System. 2\:119-m 



85 



14. Gunasekera, S. 2002. Over-exploitation of endangered species. Sri Lanka Naturalist. 
11-15. 

15. Grover, J.K., Vats, V. and Rathi, S. S. 2000. Anti-hyperglycemic effect of Eugenia 
jambolana and Tinospora cordifolia in experimental diabetes and their effects on key 
metabolic enzymes involved in carbohydrate metabolism. Journal of 
Ethnopharmacology. 73 : 46 1 -470 

16. Indian Medicinal Plants, A Compendium of 500 spp. 1996. Vaidya Sala, Orient 
Longman Limited, India. V 

17. Jayasinghe, D.M. Madhumehaya pilibanda Athdakeem. Ayurveda Samikshawa. 1: 
209-212. 

18. Jayaweera D.M. A. 1981. Medicinal Plants (Indigenous & Exotic) used in Ceylon, 
Part I, II, III, The National Science Council of Sri Lanka, Colombo. 

19. Jinadasa, K.A. 1993. Madhumeha Deshiya Chikithsawa. Ayurveda Samikshawa. 1: 
192-193. 

20. Joseph, K.D.S.M. and Mahindapala, R. 2003. Research on conservation and 
cultivation of medicinal plants: scope and challenges. lUCN, Sri Lanka County Office. Sri 
Lanka Conservation and Sustainable Use of Medicinal Plants Project, Colombo. 

21. Karunadasa, C. 1993. Madhumehayata panchakarama chikithsawa balapana ayuru. 
Ayurveda Samikshawa. 1: 194-197. 

22. Karunanayake, E. H., Welihinda, J., Sirimanne, S. R., and Adorai G.N. 1984. Oral 
hypoglycaemic activity of some medicinal plants of Sri Lanka Journal of 
Ethnopharmacology. 1 1 : 223-23 1 

23. Levetin, E. and McMohan. 2003. Plants and society. Margaret J. Kemp, McGraw- 
Hill Higher Education. 3"^ Edition: Chap 17 & 19. 

24. Mahindapala, R. 2004. Medicinal Platns: Conservation and sustainable use in Sri 
Lanka. lUCN-The World Conservation Union, No. 53, Norton Place, Colombo 7, Sri 
Lanka. 

25. Manual of Standards and Identity of Medicinal Plants, , Government of Sri 
Lanka/UNDP/WHO Project, Development of Traditional Medicine, Ministry of 
Indigenous Medicine, Colombo. 1 . 

26. Marasinghe, P.A. 2000. Oushada palati wagwe idiri gamana. Vidurava. 12: 36-38 

27. Ministry of Agriculture, Lands and Forestry. 1995. An Overview of the Sri Lanka 
Forestry Sector Master Plan. Forestry Plaiming unit, BattaramuUa, Sri Lanka. 



86 



28. Mudalige, R.D.K. 2003. National demand for medicinal plants/herbal materials in Sri 
Lanka - A Study Findings. Medicinal Plants Project: 04, Woodland Ave., Nugegoda, 
Kohuwala. 

29. Nicholl, D.S., Daniels, H.M., Thabrew,M.I., Grayer, R.J., Simmonds, M.S.J, and 
Hughes, R.D. 2001. In vitro studies on the immunomodulatory effects of extracts of 
Osbeckia aspera. Journal of Ethnopharmacology. 78:39-44 

30. Osuthuru Visuthuru Vol I. 1985. Ayurvedic Department of Sri Lanka, Navirma, 
Maharagama. 

31. Osuthuru Visuthuru Vol I. 1994. Ayurvedic Department of Sri Lanka, Navinna, 
Maharagama. 

32. Palihawadsna, P. 1996. Traditional knowledge and its extension in forestry. 
Indigenous Knowledge and Sustainable Development.!: 79-83 

33. Pallegedara, C. 2003. Conservation and sustainable use of medicinal plants in Sri 
Lanka. Medicinal Plants Project: 04. Woodland Ave., Kohuwala, Nugegoda. 

34. Perera, D.L. 1993. Madhumeha wardana prawanathava ha varthamana poshana 
rai^y^a. Ayurveda Sam ikshawa. 1: 185-188. 

35. Pilapitiya. 1994. U. Multipurpose indigenous species for medicinal use. Vidurava. 17: 
38-43 

36. Ponnamperuma, A. 2003. Ayurvedaye Jeevana Darshanaya. Ayurvedic Department 
of Sri Lanka. 2"'' edition. 



37. Ramanayake, L. 2002. Prameha saha madumeha. Ayurveda Samikshawa. 11: 70-71 

38. Ranasinghe, L. 1986-1987. Ancient health facilities of Sri Lanka. Journal of the 
Ceylon College of Physicians. 19-20: 4-13. 

39. Samarasinghe, D. 1985. Patient's choice between Ayurveda and Allopathy. Journal 
of the Ceylon College of Physicians. 18: 23-27. 

40. Samarasinghe, S.l. 1994. Some chemical constituents of medicinal plants. Vidurava. 
17: 12-16 

41. Senadheera, H.M. and Wijekoon, A.S.B. 1993. Treating young patients with insulin 
dependent diabetes mellitus by traditional oral medicinal preparations — A preliminary 
report. Ayurveda Sameekshawa. IV: 222-226. 



87 



42. Seneviratne, B. 2004. Traditional belief system of health in Sri Lanka. A comparative 
study of the traditional health services of a new farm settlement (Mahaweli System C) 
and its respective home villages, Sri Lanka. 

43. Serasinghe, P. 1996. Research and development in the indigenous systems of 
medicine: An agenda for planning and practice. Indigenous Knowledge and Sustainable 
Development. 1:43-49. 

44. Simpson, B.B and Ogorzally, M.C.2001. Economic Botany. Michael D. Lange, 
McGraw-Hill Higher Education. 3"^ Edition: Chap 11, 12 & 19. 

45. Shults, R.E. and Von Reis, S. 2003. Ethnobotany: Evolution of a discipline. Timber 
Press Inc. Portland, Oregon, USA. 

46. Singh, S.N., Vats, P., Suri, S. Shyam, R., Kumria, M.M.L., Ranganathan, S. and 
Sridharan, K. 2001. Effect of an antidiabetic extract of Catharanthus roseus on enzymic 
activities in streptozotocin induced diabetic rats. Journal of Ethnopharmacology. 76: 269- 
277 

47. Sugandhika, T., Malalavidhane, S. M. D., Wickramasinghe, N. and E. R. Jansz. 
2000. Oral hypoglycaemic activity of Ipomoea aquatica Journal of Ethnopharmacology. 
72: 293-298 

48. Thabrew, M.I., Gove, CD., Hughes, R.D., McFarlane, R.G., and Williams, R. 1995. 
Potective effects of Osbeckia octandra against galactosamine and tert-butyl 
hydroperoxide induced hepatocyte damage. Journal of Ethnopharmacology. 49: 69-76 

49. Tissera, M.N. A. 1996. The way of propagation of the knowledge of indigenous 
medicine. Indigenous Knowledge and Sustainable Development. 1: 49-55 

50. Vidyathilaka, J. 1993. Madhumeha pilibanda pracheena prathicheena Matha. 
Ayurveda Samikshawa. 1: 185-188. 

51. Weragoda, P. B. 1980. The traditional system of medicine in Sri Lanka. Journal of 
Ethnopharmacology. 2:71-73 

52. Wijesinghe, L.C.A. de. S. 2000. Biological Diversity. Natural Resources of Sri 
Lanka. I'' Edition: 251-266. 

53. Wimalasiri, W.R. 1994. The bioavailability of trace elements in foods of Sri Lanka. 
Vidurava, 17: 19-23 



Thorndike LIbracv - COA 



3 5105 00084 7075