(ISSN 0161-8202)
fOL
1
Journal of ARACHNOLOGY
PUBLISHED BY THE AMERICAN ARACHNOLOGICAL SOCIETY
VOLUME 42
2014
NUMBER 3
THE JOURNAL OF ARACHNOLOGY
EDITOR-IN-CHIEF: Robert B. Suter, Vassar College
MANAGING EDITOR: Richard S. Vetter, University of California-Riverside
SUBJECT EDITORS: Ecology — Stano Pekar, Masaryk University, Czech Republic; Systematics — Mark Har- vey, Western Australian Museum and Jason Bond, Auburn University; Behavior — Elizabeth Jakob, University of Massachusetts Amherst; Morphology and Physiology — Peter Michalik, Ernst Moritz Arndt University Greifswald, Germany
EDITORIAL BOARD: Alan Cady, Miami University (Ohio); Jonathan Coddington, Smithsonian Institution; William Eberhard, Universidad de Costa Rica; Rosemary Gillespie, University of California, Berkeley; Charles Griswold, California Academy of Sciences; Marshal Hedin, San Diego State University; Marie Herberstein, Macquarie University; Yael Lubin, Ben-Gurion University of the Negev; Brent Opell, Virginia Polytechnic Insti- tute & State University; Ann Rypstra, Miami University (Ohio); William Shear, Hampden-Sydney College; Jef- frey Shultz, University of Maryland; Petra Sierwald, Field Museum; Soren Toft, Aarhus University; I-Min Tso, Tunghai University (Taiwan).
The Journal of Arachnology (ISSN 0161-8202), a publication devoted to the study of Arachnida, is published three times each year by The American Arachnological SocieO. Memberships (yearly): Membership is open to all those interested in Arachnida. Subscriptions to The Journal of Arachnology and American Arachnology (the newsletter), and annual meeting notices, are included with membership in the Society. Regular, $55; Students, $30; Institutional, $125. Inquiries should be directed to the Membership Secretary (see below). Back Issues: James Carrel, 209 Tucker Hall, Missouri University, Columbia, Missouri 65211-7400 USA. Telephone: (573) 882-3037. Undelivered Issues: Allen Press, Inc., 810 E. 10th Street, P.O. Box 368, Lawrence, Kansas 66044 USA.
THE AMERICAN ARACHNOLOGICAL SOCIETY
PRESIDENT: Charles Griswold (2013-2015), California Academy of Science, San Francisco, California, USA. PRESIDENT-ELECT: Marshal Hedin (2013-2015), San Diego State University, San Diego, California, USA. MEMBERSHIP SECRETARY: Jeffrey W. Shultz (appointed). Department of Entomology, University of Maryland, College Park, Maryland, USA.
TREASURER: Karen Cangialosi, Department of Biology, Keene State College, Keene, New Hampshire, USA. SECRETARY: Paula Cushing, Denver Museum of Nature and Science, Denver, Colorado, USA.
ARCHIVIST: Lenny Vincent, Fullerton College, Fullerton, California, USA.
DIRECTORS: Jonathan Coddington (20 1 3-20 15), Richard S. Vetter (20 1 3-20 1 5 ), Michael Draney (2014-20 1 6) PARLIAMENTARIAN: Brent Opell (appointed)
HONORARY MEMBERS: C.D. Dondale, H.W. Levi.
Cover photo: An adult male jumping spider, Hahronattiis pyrrithrix (Salticidae), displaying characteristic green forelegs, white pedipalps and red face during courtship (see page 268). Photo by Colin Hutton.
Publication date: 26 November 2014
©This paper meets the requirements of ANSI/NISO Z39.48-1992 (Permanence of Paper).
2014. The Journal of Arachnology 42:205-219
Troglomorphic pseudoscorpions (Arachnida: Pseudoscorpiones) of northern Arizona, with the description
of two new short-range endemic species
Mark S. Harvey and J. Judson Wynne^: 'Department of Terrestrial Zoology, Western Australian Museum, Locked Bag 49, Welshpool DC, Western Australia 6986, Australia; ^Research Associate, Division of Invertebrate Zoology, American Museum of Natural History, Centra! Park West at 79th Street, New York, New York 10024-5192, U.S.A; ^Research Associate, California Academy of Sciences, 55 Music Concourse Drive, San Francisco, California 94118, U.S.A; ‘‘Adjunct, School of Animal Biology, University of Western Australia, Crawley, Western Australia 6009, Australia; ^Adjunct, School of Natural Sciences, Edith Cowan University, Joondalup, Western Australia 6027, Australia; ^Department of Biological Sciences, Colorado Plateau Biodiversity Center, Landscape Conservation Initiative, Northern Arizona University, Box 5640, Flagstaff, Arizona 86011, U.S.A. E-mail: mark.harvey@museum.wa.gov.au
Abstract. This study reports on the pseudoscorpion fauna of the subterranean ecosystems of northern Arizona, U.S.A.
Our work resulted in the descriptions of two new species, Hesperochernes bradyhaughi sp. nov. and Tuberoclienies cohiii sp. nov. (Chernetidae) and the range expansion of one species, Larca cavicola (Muchmore 1981 ) (Larcidae). All of these species were cave-adapted and found within caves on Grand Canyon-Parashant National Monument in northwestern Arizona.
Based upon this work, the genus Archeolarca Hoff and Clawson is newly synonymized with Larca Chamberlin, and the following species are transferred from Archeolarca to Larca, forming the new combinations L. aalbid (Muchmore 1984),
L. cavicola (Muchmore 1981), L. guadaliipensis (Muchmore 1981) and L. welbourni (Muchmore 1981). Despite intensive sampling on the monument, the two new species were detected in only one cave. This cave supports the greatest diversity of troglomorphic arthropod species on the monument — all of which are short-range endemics occurring in only one cave. Maintaining the management recommendations provided by Peck and Wynne (2013) for this cave should aid in the long- term persistence of these new pseudoscorpion species, as well as the other troglomorphic arthropods.
Keywords: Nearctic, troglomorphy, troglobite, new synonymy, cave
urn:lsid:zoobank.org:pub: A 1 5CB9DB-5B36-4A7C-8052-08E2EC 1 F4D34
The pseudoscorpion fauna of North American caves is moderately well known, thanks largely to the efforts of J.C. Chamberlin, C.C. Hoff, E.M. Benedict, D.R. Malcolm and W.B. Muchmore who have characterized and described many different North American troglobites and troglophiles. There are currently 144 named species found in cave habitats across the United States including six species in five families from Arizona: Pseudogarypus hypogeus Muchmore 1981 (Pseudogarypidae), Albiorix anophthahmis Muchmore 1999 (Ideoroncidae), Chit- rellina chiricahuae Muchmore, 1996 (Syarinidae), Archeolarca cavicola Muchmore 1981, A. welbourni Muchmore 1981 (Larcidae) and Tuberochernes ubicki Muchmore 1997 {Cherne- tidae) (Muchmore 1996; Muchmore & Pape 1999; Harvey & Muchmore 2013). Only A. cmophthalmm and C. chiricahuae had troglobitic modifications including the complete lack of eyes and pallid body color (Muchmore 1996; Muchmore & Pape 1999; Harvey & Muchmore 2013), whereas the others are less obviously modified with only the slightly attenuated append- ages hinting at an obligate subterranean existence (Muchmore 1981, 1997).
Prior to this work, all of these cavernicolous species from Arizona occurred south of the Colorado River with P. hypogeus, A. cavicola and A. welbourni from northern Arizona (Coconino County) and A. anophtludmus, C. chiricahuae and T. ubicki from south-eastern Arizona (Pima, Cochise and Santa Cruz Counties, respectively). During biological inven- tories of caves on the Grand Canyon-Parashant National Monument (hereafter referred to as Parashant) in northwest- ern Arizona, one of us (J.J.W.) and colleagues found
representatives of three different pseudoscorpion species, which are the subject of this study.
Over the past several years, Parashant caves have yielded other significant and interesting arthropod species — many of which are restricted to the cave environment. These include two new genera (comprising two new species) — a book louse (order Psocoptera, family Sphaeropsocidae: Troglosphaerop- socus voylesi Mockford 2009 (Mockford 2009), and a cave cricket (family Rhaphidophoridae: cf Ceuthophilus n. gen. n. sp., Cohn and Swanson, unpublished data). This work also resulted in the identification of several cave-adapted and cave- limited species including a leiodid beetle, Ptoinaphagus parashant Peck and Wynne 2013 (Peck & Wynne 2013), an undescribed species of centipede (family Anopsobiidae; Wynne, unpublished data), an undescribed Isopod species, Brackenridgia n. sp. (S. Taiti, in litt.), and a recently described cave limited millipede, Pratherodesmus voylesi Shear 2009 (Shear et al. 2009). Additionally, three new species of trogloxenic beetles were reported from Parashant caves including Eleodes wynnei Aalbu, Smith, and Triplehorn 2012 (Tenebrionidae; Aalbu et al. 2012), an undescribed species of the carabid beetle genus Rhadine LeConte (Carabidae: the perlevis species-group; T.C. Barr, in litt.), and an undescribed carabid beetle species Pterostichus Stephens (Carabidae, K. Will, in litt.).
METHODS
The junior author and colleagues sampled caves on Grand Canyon-Parashant National Monument during 4-14 August
205
206
THE JOURNAL OF ARACHNOLOGY
2005, 1-6 May 2007, 16-25 August 2007, 12-21 May 2008, and 5-12 March 2009. They sampled all caves identified as having deep zone like conditions (/; = 10). Given the short duration of study (between two to four site visits), and potential seasonal effects, confidently identifying this zonal environment was not possible. The cave deep zone is required habitat for cave-adapted arthropods and is characterized by complete darkness, stable temperature, a near-water saturated atmosphere and limited to no airfiow (as in Howarth 1980, 1982). Parashant is located in northwestern Arizona, encom- passes approximately 4,451 km“, and is characterized by rugged terrain containing deeply incised canyons, mesas, and mountains. Vegetation zones include Mojave Desert contain- ing creosote bush (Larrea tridentata) and Joshua trees ( Yucca brevifo/ia) at lower elevations, gradating through Great Basin pinyon (Pinus edulis) and juniper (Jiiniperus spp.) woodlands to Colorado Plateau grasslands and Ponderosa pine (Piuiis pomlerosa) forest with aspen (Popidus tremidoides) groves on Mt. Trumbull (elevation 2,447 m). All of the caves referred to in this paper were located within the Supai, Kaibab, or Redwall limestone formations. Elevation for the caves that were studied ranges from 736 to 1,590 m.
Although we inventoried 10 Parashant caves, we provide descriptions for only the three caves (PARA- 1001, PARA- 2204 and PARA-3503) where pseudoscorpions were detected. PARA- 1001 Cave was the second most biologically diverse cave on Parashant (Wynne, unpublished data), and supports the largest known cricket roost in northern Arizona (Wynne & Voyles 2014). A small solution cave within the Kaibab limestone, it had a total surveyed length and depth of 76.2 m and 10.4 m, respectively. This cave had a small south-facing vertical entrance (135° aspect) at bottom center of a large sinkhole. Vegetation was characterized as juniper scrublands at 1,585 m elevation, and was located on the north side of the lower Colorado River along the western extent of the Grand Canyon. PARA-2204 Cave was the most biologically diverse cave on the monument (Wynne, unpublished data). The deepest extent of this cave contained active speleothem formations and supported a near-saturated water atmosphere year-round. Located within the Supai formation, this large solution cave (total surveyed length 175 m) was comprised of several sinuous phreatic passages. This cave has one horizon- tal entrance (330° aspect) and was situated within a canyon near the base of the canyon’s north-face. Located at 1,272 m elevation, this cave occurred within the vegetation transition zone of Mojave Desert scrub and juniper woodlands. PARA- 3503 Cave was a dry cave with no evidence of recent speleothem activity, and supported a summer roost of bats, Myotis sp. (Wynne, unpublished data). The cave had a large horizontal entrance (135° aspect) situated upon a high bench (1,102 m elevation on an exposed cliff face). This cave was situated along the south-face of one of the largest canyons draining into the Colorado River from the north. Occurring within the Redwall formation, this large solution cave contained 540 m of surveyed length with an estimated survey depth of 14.2 m. Vegetation was characterized as Mojave Desert scrub.
The work conducted in 2005 was part of a biological baseline study [refer to Wynne & Voyles (2014) for a description of sampling methods]. Later (between 2007 and
2009), these caves were systematically sampled to characterize the cave-dwelling arthropod communities. Interval sampling using baited pitfall traps, timed searches, and opportunistic sampling techniques were used. To apply these techniques, detailed maps for each cave were required. For interval sampling, we established up to 10 sampling intervals (which included a sampling station at either wall and one at cave centerline for a total of < 3 sampling stations per interval). We used 10% of the total cave length to establish the sampling interval (e.g., for a 1,000 m long cave, the sampling interval was every 100 m).
At each sampling station, we deployed live capture baited pitfall traps and conducted timed searches. For pitfall traps, we used two 907 g stacked plastic containers (13.5 cm high, 10.8 cm diameter rim and 8.9 cm base). A teaspoon of peanut butter was used as bait and placed in the bottom of the exterior container. At the bottom of the interior container, we made several dozen holes so the bait could “breathe” to attract arthropods (e.g.. Barber 1931). Attempts were made to counter-sink each pitfall trap within the cave sediment or rockfall. When this was not possible, we built ramps around each trap using local materials (e.g., rocks, wooden debris, etc.) so arthropods could access the trap and fall in (e.g., Ashmole et al. 1992). To discourage small mammals, we placed small rocks around the edges of the trap and then covered the mouth of the trap with a cap rock. Pitfall traps were deployed for three to four days (a three day deployment occurred once due to scheduling constraints). For timed searches, we established a 1 m radius around each sampling station (where the pitfall trap would be deployed) and searched for arthropods within that ~3 m circle. A one to three minute timed search (one minute if no arthropods were observed, three minutes if arthropods were detected) was conducted before pitfall trap deployment and prior to trap removal.
Opportunistic collecting was executed by two to three trained observers as they traversed the length of each cave. This technique was applied as the observers were in transit between sampling intervals while deploying and removing pitfall traps and conducting timed searches. Opportunistic collecting was not conducted while at sampling stations and was resumed only when the observers were in transit once again. This technique was used at least twice per cave (both during pitfall trap deployment and retrieval trips). For example, a cave containing 10 sample station arrays, there were 27 individual “random walks” per site visit (i.e., nine random walk samples times three observers collecting along their between stations). Because we conducted two site visits per cave, there would be a total of 54 samples. For one cave, PARA 1001 Cave, we had two observers conduct the opportunistic collecting.
An alpha-numeric coding system developed by the National Park Service (NPS) was used to safeguard the location of both caves and their resources. We only provide generalized latitude and longitude coordinates of the area to keep the precise location of the cave confidential. Parashant National Monu- ment headquarters in Saint George, Utah has the cipher table with cave codes. A copy of this paper with actual cave names is on file at both monument headquarters, National Park Service and the National Cave and Karst Research Institute, Carlsbad, New Mexico.
HARVEY & WYNNE— TROGLOMORPHIC PSEUDOSCORPIONS FROM ARIZONA
207
Specimens representing three species collected by one of us (J.J.W.) and colleagues form the basis of this study. All specimens were collected and stored in 70% ethanol. The holotypes of both new species and specimens of the known species are deposited in the Museum of Northern Arizona, Flagstaff, Arizona (MNA). Temporary slide mounts were prepared by mounting them on microscope slides with 10 or 12 mm coverslips supported by small sections of 0.25, 0.35 or 0.50 mm diameter nylon fishing line in a drop of lactic acid at room temperature for two or more days. After study the specimens were rinsed in water and returned to 75% ethanol with the dissected portions placed in 12 X 3 mm glass genitalia microvials (BioQuip Products, Inc.). All specimens were studied using a Leica DM2500 compound microscope and illustrated with the aid of a drawing tube. Measurements were taken at the highest possible magnification using an ocular graticule. Terminology and mensuration mostly follow Chamberlin (1931), with the exception of the nomenclature of the pedipalps, legs and with some minor modifications to the terminology of the trichobothria (Harvey 1992), cheliceral setation (Harvey & Edward 2007), cheliceral rallum (Judson 2007) and faces of the appendages (Harvey et al. 2012).
TAXONOMY
Family Larcidae Harvey 1992 Larcu Chamberlin 1930 Lorca Chamberlin 1930:616.
Arcbeolarca Hoff and Clawson 1952:2-3. Syn. nov.
Type species. — Lorca: Garypus lotus Hansen 1884, by original designation.
Archeolarca: Archeolarco rotunda Hoff and Clawson 1952, by original designation.
Remarks. — The genus Larca was created by Chamberlin (1930) for the type species L. Iota (Hansen) from Europe and L. gramilata (Banks 1891) from eastern U.S.A. Since then, other species have been added from Europe (Beier 1939a; Gardini 1983; Henderickx & Vets 2002; Zaragoza 2005) and North America (Hoff 1961; Benedict & Malcolm 1978; Muchmore 1981). Archeolarca was described for the type species A. rotunda which was collected from pack rat middens and porcupine nests in Utah (Hoff & Clawson 1952). Since then, four additional species have been described from other parts of western North America, all from cave ecosystems (Muchmore 1981, 1984), and A. rotunda has been found in New Mexico and Oregon (Hoff 1956a; Benedict & Malcolm 1978). Archeolarca only differs from Larca in the possession of four trichobothria on the movable chelal finger of adults, whereas species of Larca have only two or three trichobothria (e.g. Hoff 1961; Benedict & Malcolm 1978; Muchmore 1981; Gardini 1983; Muchmore 1984, 1990; Henderickx & Vets 2002; Zaragoza 2005). Most adult specimens from the Parashant have four trichobothria on the movable chelal finger (Fig. 12), consistent with being a species of Archeolarca, but one male has four on the right chela and three on the left (Fig. 11) raising the issue of whether the genera should be retained.
The maintenance of garypoid genera based solely on trichobothrial number has been abandoned for several other groups including the garypid genera Anagarypus Chamberlin
1930 with seven trichobothria on the fixed finger and one or two on the movable finger forming a pattern of 7/1-2 (Muchmore 1982), Eremogarypus Beier 1955, with a pattern of 5-8/1-3 (e.g., Beier 1962; Beier 1973), Synsphyronus Chamberlin 1930, with a pattern of 5-8/1-3 (e.g., Chamberlin 1943; Harvey 1987b, 2011) and Thaumastogarypus Beier 1947, with a pattern of 7-8/3^ (e.g. Beier 1947; Mahnert 1982), and the geogarypid genus Geogarypus Chamberlin 1930 in which adults normally have an 8/4 pattern, but G. hucculentus Beier 1955 and G. connatus Harvey 1987 have a 7/4 pattern (Harvey 1986, 1987a). Intra-specific variation in the number of trichobothria of the movable chelal finger has been reported in the genus Serianus Chamberlin 1930 (Garypinidae). Hoff (1950) found that a small series of specimens of S. nunutus Hoff 1950 (now known as 5. argent uiae Muchmore 1981 due to secondary homonymy of the original name) included adults with the normal four trichobothria on the movable chelal finger, as well as some with only two or three trichobothria. Similarly, Mahnert (1988) found that the type series of Paraserianus bolivianus Beier 1939 possessed three or four trichobothria on the movable chelal finger. Given that the main feature used to substantiate the genus Paraserianus by Beier (1939b) was the presence of only three such trichobo- thria (as opposed to four in Serianus), Mahnert (1988) placed Paraserianus as a synonym of Serianus.
Comparison of specimens of many species of Larca and Archeolarca by one of us (M.S.H.), including the type species of both genera, has revealed no other significant differences that could be considered to maintain distinct genera, and Archeolarca is here regarded as a synonym of Larca, resulting in the following new combinations: L. aalhui (Muchmore 1984), comb, nov., L. cavicola (Muchmore 1981 ), comb, nov., L. guadalupensis (Muchmore 1981) comb. nov. and L. welhourni (Muchmore 1981) comb. nov.
Larca cavicola (Muchmore) comb. nov.
(Figs. 1-14)
Archeolarca cavicola Muchmore 1981: 55-56, Figs. 11, 12.
Material examined. — U.S.A.: Arizona: Mohave County: 1 male, PARA-3503 Cave, Grand Canyon-Parashant Nation- al Monument, ca. UTM 0247400 N, 4020000 E, Zone 12S, baited pitfall trap lA, 20 May 2008, J.J. Wynne (MNA); 1 female, same data except baited pitfall trap 1C, 6 March 2009, J.J Wynne (MNA); 1 tritonymph, 1 deutonymph, same data except trap 2B, 10 March 2009, J.J. Wynne (MNA); 1 tritonymph, same data except trap 7A (MNA); 1 tritonymph, same data except opportunistic collecting in a possible deep zone (MNA); 1 male, PARA-2204 Cave, Grand Canyon-Parashant National Monument, ca. UTM 025100 N, 4041000 E, Zone 12S, M, baited pitfall trap 2B, 17 May 2008, J.J. Wynne (MNA); 1 female, same data except 20 May 2008 (MNA); 1 tritonymph, same data except trap lA (MNA); 1 male, same data except trap IB (MNA).
Diagnosis. — Larca cavicola resembles the other species previously included in the genus Archeolarca in possessing four trichobothria on the movable chelal finger, but occasion- ally this is reduced to three trichobothria. It differs from these species by having reduced eyes, especially the posterior pair, which are noticeably smaller than the anterior pair.
208
THE JOURNAL OF ARACHNOLOGY
Figures 1-5. — Lm-ca cavicola (Muchmore), male from PARA-2004 Cave: 1. Body, dorsal; 2. Body, ventral; 3. Carapace, dorsal; 4. Left chela, lateral; 5. Anal region, posterior.
Description. — Adults: Color: carapace, pedipalps and coxae deep red-brown, abdomen pale red-brown and legs pale yellow-brown.
Chelicera: with 4 setae on hand, with shs absent, and 1 subdistal seta on movable finger (Fig. 7); all setae acuminate; seta bs slightly shorter than others; with 2 dorsal lyrifissiires and 1 ventral lyrifissure; galea of S and 9 very long with 3 terminal rami, rami of male smaller than on female; rallum of 4 blades, the most distal blade with several serrations on leading edge, other blades smooth; serrula exterior with 14 (d), 16 (9) blades; lamina exterior present.
Pedipalp (Fig. 9): most surfaces of trochanter, femur, patella and chelal hand lightly and sparsely granulate, chelal fingers smooth; trochanter, femur, patella and chelal hand with prominent, curved, slightly denticulate setae arranged sparsely; patella with 3 small sub-basal lyrifissiires; trochanter 1.83-1.99 (d), 1.90-1.93 (9), femur 4.74-5.94 (d), 4.57-4.95 (9), patella 3.63-4.47 (d), 3.69-3.94 (9), chela (with pedicel) 4.47- 5.28 (d), 4.08^.54 (9), chela (without pedicel) 4.22-5.02 (d), 3.85-4.26 (9), hand (with pedicel) 2.17-2.49 (d), 1.94-2.08 (9) X longer than broad, movable finger (with pedicel) 0.96-1.01 (d), 0.99-1 .00 (9) X longer than hand. Fixed chelal finger with 8 trichobothria, movable chelal finger with 4 trichobothria (Fig. 12), although sh absent from left chela of one male (Fig. 1 1): eh, esh, ih and ist situated subbasally, est, isb and it SLibmedially, et subdistally, and est opposite it; h and sb situated subbasally, and st and t situated submedialiy, with st situated very close to t; patch of microsetae not present on external margin of fixed chelal finger near et. Venom apparatus present in both chelal fingers, venom ducts fairly short, terminating in nodus ramosus slightly distal to et in fixed finger (Figs. 11, 12). Chelal teeth pointed, slightly
retrorse, becoming rounded basally; fixed finger with 32 (d, 9) teeth; movable finger with 32 (d), 33 (9) teeth; accessory teeth absent.
Carapace (Figs. 3, 6): 0.77-0.86 (d), 0.74 (9) X longer than broad; anterior margin straight; with 2 pairs of rounded corneate eyes, tapetum present; with 31 (d), 32 (9) setae, arranged with 4 (d, 9) near anterior margin and 4 (d, 9) near posterior margin; with 1 deep, broad median furrow.
Coxal region: manducatory process rounded with 1 small sub-oral seta, and 9 (d), 12 (9) additional setae; median maxillary lyrifissure large, rounded and situated submedialiy; posterior maxillary lyrifissure rounded. Coxae I to IV becoming progressively wider. Chaetotaxy of coxae I-IV: d, 6: 6: 6: 14; 9, 6: 7: 9: 16.
Legs: femora I and II longer than patellae; junction between femora and patellae III and IV very ungulate; femora III and IV much smaller than patellae III and IV; femur -h patella of leg IV 5.92 (d), 5.27 (9) X longer than broad (Fig. 10); metatarsi and tarsi not fused; tarsus IV without tactile seta; subterminal tarsal setae arcuate and acuminate; claws simple; arolium much longer than claws, not divided.
Abdomen: tergites II-X and sternites IV-VIII of male and female with medial suture line fully dividing each sclerite, sternite IX partially divided. Tergal chaetotaxy: d, 4: 6: 10: 10: 11: 12: 11: 10: 10: 6 (arranged T4T): 7: 2; 9, 6: 5: 7: 9; 10: 11: 11: 13: 9: 6 (arranged T4T): 8: 2; tergites I-X uniseriate. Sternal chaetotaxy: d, 19: (0) 19 [3 3] (0): (0) 6 (0); 7: 9: 7: 8:
8: 6: 3: 2; 9, 14: (0) 8 (0): (0) 4 (0): 6: 7: 6: 8: 9: 6: 4: 2; sternites IV-X uniseriate; d and 9 sternite II and III with all setae situated near posterior margin. Spiracles with helix. Anal plates (tergite XII and sternite XII) situated between tergite XI and sternite XI, and surrounded by desclerotized region of
HARVEY & WYNNE— TROGLOMORPHIC PSEUDOSCORPIONS FROM ARIZONA
209
Figures 6-14. — Larca cavicoki (Muchmore), specimens from PARA-3503 Cave: 6. Carapace, dorsal, male; 7. Chelicera, dorsal, male; 8. Rallum, lateral, male; 9. Right pedipalp, dorsal, male; 10. Left leg IV, male; 1 1. Left chela, lateral, male; 12. Left chela, lateral, female; 13. Left chela, tritonymph; 14. Left chela, deutonymph. Scale lines = 0.1 mm (Figs. 7, 8), 0.2 mm (Figs. 1 1-14), 0.5 mm (Figs. 6, 9, 10).
210
THE JOURNAL OF ARACHNOLOGY
tergite XI and sternite XI; sternite XI with ca. 18 (d'), 24 (?) small lyrifissures. Pleural membrane finely wrinkled-plicate; without any setae.
Genitalia: male: very similar to that described for L. laceyi Muchmore, 1981 by Muchmore (1981). Female with 1 pair of lateral cribriform plates and 2 pairs of median cribriform plates; spermathecae absent.
Dimensions: male {PARA-3503 Cave) followed by other males (where applicable): Body length 2.40 (2.14-2.42). Pedipalps: trochanter 0.371/0.186 (0.351-0.387/0.192-0.207), femur 1.021/0.172 (0.923-0.976/0.187-0.206), patella 0.859/ 0.192 (0.768-0.832/0.200-0.229), chela (with pedicel) 1.220/ 0.231 (1.173-1.286/0.262-0.272), chela (without pedicel) 1.160 (1.106-1.216), hand length 0.576 (0.569-0.622), movable finger length 0.582 (0.547-0.595). Chelicera 0.200/0.115, movable finger length 0.130. Carapace 0.605/0.784 (0.621-0.656/0.763- 0.772); anterior eye diameter 0.059, posterior eye diameter 0.043. Leg I: femur 0.382/0.090, patella 0.249/0.092, tibia 0.350/ 0.067, metatarsus 0.252/0.042, tarsus 0.218/0.042. Leg IV: femur -I- patella 0.740/0.125, tibia 0.605/0.079, metatarsus 0.285/0.055, tarsus 0.270/0.048.
Female (PARA-3503 Cave) followed by other female (where applicable): Body length 2.85 (2.72). Pedipalps: trochanter 0.422/0.219 (0.408/0.215), femur 1.108/0.224 (0.978/0.214), patella 0.992/0.252 (0.822/0.223), chela (with pedicel) 1.394/ 0.307 (1.304/0.320), chela (without pedicel) 1.309 (1.232), hand length 0.640 (0.621), movable finger length 0.643 (0.616). Chelicera 0.240/0.131, movable finger length 0.150. Carapace 0.708/0.960); anterior eye diameter 0.049, posterior eye diameter 0.048. Leg I: femur 0.410/0.103, patella 0.289/0.117, tibia 0.382/0.075, metatarsus 0.261/0.059, tarsus 0.237/0.048. Leg IV: femur + patella 0.828/0.157, tibia 0.660/0.095, metatarsus 0.300/0.067, tarsus 0.282/0.058.
Tritonymph: Color: carapace, pedipalps and coxae red- brown, abdomen pale red-brown and legs pale yellow-brown.
Chelicera: with 4 setae on hand and 1 on movable finger; galea long and slender with 3 terminal rami.
Pedipalp: trochanter 1.97, femur 5.05, patella 3.90, chela (with pedicel) 4.58, chela (without pedicel) 4.32, hand (without pedicel) 2.17 X longer than broad, and movable finger 1.02 X longer than hand (without pedicel). Fixed chelal finger with 7 trichobothria, movable chelal finger with 3 trichobothria (Fig. 13): eb, esb, isr and ib situated basally; est and it medially; et distally, isb absent; b subbasally, st and t submedially, sb absent. Fixed chelal finger with 26 teeth; movable finger with 22 teeth.
Carapace: 0.85 X longer than broad; with 2 pairs of small rounded corneate eyes; with 4 setae near anterior margin and 3 near posterior margin; with deep median furrow.
Legs: much as in adults.
Abdomen: tergal chaetotaxy: 4: 4: 6: 7: 8: 7: 8: 6: 6: 6 (arranged T4T): 7: 2. Sternal chaetotaxy: 2: (0) 7 (0): (0) 3 (0): 4: 4: 4: 5: 6: 4: 2: 2.
Dimensions (mm) (PARA-3503 Cave): Body length 1.75. Pedipalps: trochanter 0.314/0.159, femur 0.768/0.152, patella 0.643/0.165, chela (with pedicel) 1.040/0.227, chela (without pedicel) 0.981, hand length 0.493, movable finger length 0.501. Carapace 0.544/0.640.
Deutonymph: Color: carapace, pedipalps and coxae pale red-brown, abdomen and legs pale yellow-brown.
Chelicera: with 4 setae on hand and 1 on movable finger; galea long and slender with 3 termiinal rami.
Pedipalp: trochanter 2.11, femur 5.16, patella 3.50, chela (with pedicel) 4.19, chela (without pedicel) 3.94, hand (without pedicel) 2.02 x longer than broad, and movable finger 0.97 X longer than hand (without pedicel). Fixed chelal finger with 6 trichobothria, movable chelal finger with 2 trichobothria (Fig. 14): eb, ist and ib situated basally; est and it medially; et distally; it subdistally, esb and isb absent; b subbasally, t submedially, sb and st absent. Fixed chelal finger with 24 teeth; movable finger with 21 teeth.
Carapace: 0.82 X longer than broad; with 2 pairs of small rounded corneate eyes; with 4 setae near anterior margin and 4 near posterior margin; with deep median furrow.
Legs: much as in adults.
Abdomen: tergal chaetotaxy: 4: 4: 4: 6: 6: 6: 6: 6: 6: 6 (arranged T4T): 4: 2. Sternal chaetotaxy: 0: (0) 2 (0): (0) 2 (0): 3: 2: 4: 4: 4: 4: 4: 2.
Dimensions (mm) (PARA-3503 Cave): Body length 1.49. Pedipalps: trochanter 0.278/0.132, femur 0.629/0.122, patella 0.514/0.147, chela (with pedicel) 0.850/0.203, chela (without pedicel) 0.800, hand length 0.410, movable finger length 0.397. Carapace 0.490/0.600.
Remarks. — Larca cavicola was described from a single female collected in Cave of the Domes, Grand Canyon National Park, Coconino County, Arizona (Muchmore 1981). The new specimens were taken from two different caves within the Parashant, PARA-3503 Cave and PARA- 2204 Cave, expanding the known range of this species some 160 km west of the type locality. Specimens from both cave localities have shorter and slightly thinner pedipalpal segments than the female holotype. In addition, the PARA-3503 Cave specimens have slightly longer and thinner pedipalps than those from PARA-2204 Cave. There do not appear to be any other morphological features that would warrant the recog- nition of more than one species amongst these specimens which are all here attributed to L. cavicola. As noted by Muchmore (1981), this species shows some obvious troglo- morphic features consistent with an obligate subterranean existence including long, slender pedipalps and legs, reduced posterior eyes, and fewer setae on the carapace. Given the findings of both Muchmore (1981) and the present study, we consider this species to be troglobitic. A useful measure of troglomorphic adaptation in larcid pseudoscorpions was proposed by Gardini (1983), who found that the ratio pedipalpal femur length/carapace length was lower in epigean species of Larca than in cavernicolous species. This pattern was also observed in two new Spanish species of Larca (Zaragoza 2005). A similar condition is found in the species formerly described in Archeolarca. The epigean L. rotunda has a low ratio of 1.20 (male), 1.36 (female) (Hoff & Clawson 1952), whereas the cavernicolous species generally have higher ratios: L. aalbui 1.57 (male), L. cavicola 1.44 (female), L. guadalupensis 1.34 (female) and L. welbourni 1.47 (female) (Muchmore 1981, 1984). The ratios of the new specimens of L. cavicola recorded here [1.69 (male), 1.56 (female)] are higher than the female holotype, but we ascribe this to individual variation.
Two of the three post-embryonic nymphal stages (deuto- nymph and tritonymph) are present in the samples, and they
HARVEY & WYNNE— TROGLOMORPHIC PSEUDOSCORPIONS FROM ARIZONA
21 1
exhibit the same trichobothrial pattern as illustrated for L. aalhiii (under the name Archeokuxa aalhid) by Harvey (1992).
Family Chernetidae Menge 1855 Subfamily Chernetinae Menge 1855
Hesperochernes Chamberlin 1924 Hesperochernes Chamberlin 1924:89-90.
Type species. — Hesperochernes laurae Chamberlin 1924, by original designation.
Remarks. — The genus Hesperochernes currently comprises 19 North American species, ranging as far south as the Dominican Republic and Mexico (e.g., Ellingsen 1910; Chamberlin 1924; Beier 1933, 1976) and as far north as Canada (Hoff 1945), and a single Japanese species (Sato 1983). Muchmore (1974) provided details on how to separate Hesperochernes from the morphologically similar genera Chernes Menge 1855 and Dinocheirus Chamberlin 1929, but admitted that the composition of the genus was not fully resolved due to uncertainties in the morphology of several species. Hesperochernes is currently diagnosed by the follow- ing combination of characters: rallum composed of 4 blades; tarsus III and IV without conspicuous tactile seta; setae of pedipalps and tergites not large and leaf-like; female spermathecae with long paired ducts terminating in rounded sacs; and cheliceral setae bs and sbs usually dentate or denticulate. Of these characters, Muchmore (1974) was only able to nominate the spermathecal morphology and the denticulate bs and sbs as features that distinguish it from Chernes. It appears, however, that some species currently assigned to Hesperochernes have an acuminate bs, including H. canadensis, H. holsingeri, H. molestiis, H. niontaniis, H. occidentalis and H. riograndensis (Chamberlin 1935; Hoff 1945; Hoff & Clawson 1952; Hoff 1956b; Hoff & Bolsterli 1956; Muchmore 1994). Moreover, the new species described below clearly demonstrates the labile nature of this feature, with the male having a strongly denticulate bs on both chelicerae, but the two females having an acuminate bs. It would seem that this feature should be used with considerable caution, and that the nature of the spermathecae is the only feature that can be reliably used to separate Hesperochernes from Chernes.
Although Muchmore (1974) was able to confirm the generic placement of several species from the U.S.A. and Canada [H. laurae, H. mimidus Chamberlin 1952, H. mirabilis (Banks 1895), H. molestus Hoff 1956, H. occidentalis (Hoff and Bolsterli 1956). H. riograndensis Hoff and Clawson 1952, H. tamiae Beier 1930, and H. iitahensis Hoff and Clawson 1952], he was not able to ascertain whether others were correctly placed [H. canadensis Hoff 1945, H. montanus Chamberlin 1935, H. pcdlipes (Banks 1893), H. paludis (Moles 1914), H. thomomysi Hoff 1948, and H. imicolor (Banks 1908)]. The same can be said of the Central American and Asian species currently included in Hesperochernes, H. globosus (Ellingsen 1910), H. twnidus Beier 1933 and H. inusitatus Hoff 1946 from Mexico, H. vesper tilionis Beier 1976 from Dominican Repub- lic, and H. shinjoensis Sato 1983 from Japan, as the morphology of the spermathecae has not yet been ascertained (Ellingsen 1910; Beier 1933; Hoff 1946a; Beier 1976; Sato 1983).
Species of Hesperochernes are frequently collected in caves or are associated with other animals. The cave-dwelling species
include three eyeless species that have long slender pedipalps consistent with strong troglomorphisms, H. holsingeri, H. mirabilis and H. occidentalis, as well as the new eyeless species described below that has long legs but has robust pedipalps. The species associated with rodents include H. mimidus, H. molestus, H. riograndensis, H. tamiae, H. thomomysi and H. utahensis (Beier 1930; Hoff 1945, 1946b; Chamberlin 1952; Hoff & Clawson 1952; Hoff 1956b), while H. vespertilionis was collected within a bat roost (Beier 1976). Hesperochernes laurae and H. imicolor were found within both wasp’s and ant’s nests (Banks 1908; Chamberlin 1924; Hoff 1947), respectively, H. montanus was found in a bird’s nest (Chamberlin 1935), and H. tumidus was collected “lying on the ground in pods of Inga sp.” (translated from the original German) (Beier 1933). The poorly described and most likely misplaced H. paludis was taken from both rotten poplar tree logs on the ground and live standing poplar trees (Moles 1914), and the only species recorded from outside of North America, H. shinjoensis from northern Japan, was collected from under tree bark (Sato 1983). The other species lack any habitat data.
Hesperochernes hradyhaughi sp. nov.
uni:lsid:zoobank.org:act:5419D319-EF22-4722-926F-lF8EC
080400B
Figs. 15-26
Material examined. — Types. U.S.A.: Arizona: Mohave County: holotype male, PARA- 1001 Cave, Grand Canyon- Parashant National Monument, ca. UTM 0264500 N, 4060700 E, Zone 12S, baited pitfall trap 3B, 20 August 2007, J.J. Wynne (MNA); 1 female, same data as holotype except baited pitfall trap 5 A (MNA); 1 female, same data as holotype except opportunistic, mid cave, 13 August 2005 (NMA).
Etymology. — This species is named for Jeff Bradybaugh, former superintendent of Grand Canyon-Parashant National Monument and an advocate for cave research, conservation and management both on Parashant and within the National Park Service.
Diagnosis. — Hesperochernes hradyhaughi most closely re- sembles three other species of the genus that are also completely eyeless and have long slender legs [e.g. femur + patella IV 5.19 (male), 5.37-5.56 (female) x longer than broad], H. mirabilis, H. holsingeri and H. riograndensis. Hesperochernes bradyhaughi lacks the slender pedipalps characteristic of H. mirabilis and H. holsingeri, and the male chela of H. hradybaughi is markedly swollen, especially on the dorsal face (Fig. 21 ), unlike the male of H. riograndensis which is not swollen. It is also substantially larger than H. riograndensis, e.g., chela (without pedicel) of H. riograndensis is 0.956 (male), 0.970 (female) mm, whereas H. hradybaughi is 1.434 (male), 1.502-1.510 (female) mm.
Description. — Adults: Color: pedipalps and carapace dark red-brown, legs light red-brown, tergites yellow-brown, sternites pale yellow-brown.
Chelicera: with 5 setae on hand and 1 subdistal seta on movable finger (Fig. 23); setae Is and is acuminate, es and bs dentate, sbs denticulate in female, acuminate in male; with 2 dorsal lyrifissures and 1 ventral lyrifissure; galea of <S and ? with 6 rami; rallum of 4 blades, the 2 distal blades with several
212
THE JOURNAL OF ARACHNOLOGY
Figures 15-20. — Hesperoclieriies hradybaiighi, sp. nov.: 15. Body, dorsal, male holotype; 16. Body, ventral, male holotype; 17. Carapace, dorsal, male holotype; 18. Body, dorsal, female paratype; 19. Body, ventral, female paratype; 20. Left chela, lateral, male holotype.
serrations on leading edge, other blades smooth; serrtila exterior with 18 (d), 17 (?) blades; lamina exterior present.
Pedipalp (Fig. 24): surfaces of trochanter, femur, patella and chelal hand coarsely granulate, chela fingers mostly smooth; patella with 5 small sub-basal lyrifissures; trochanter 1.84 (d), 1.86-1.88 (9), femur 3.17 (d), 2.95-3.09 (9), patella 2.62 (d), 2.54-2.66 (9), chela (with pedicel) 3.07 (d), 3.23-3.34 (9), chela (without pedicel) 2.83 (d), 2.98-3.09 (9), hand 1.49 (d), 1.34-1.64 (9) X longer than broad, movable finger 0.93 (d), 0.86-0.96 (9) X longer than hand. Fixed chelal finger with 8 trichobothria, movable chelal finger with 4 trichobothria (Figs. 21, 22): eh and esb situated basally, ib and ist subbasally, est and ish submedially, et and it subdistally, isb situated midway between ist and it, and et slightly distal to if, t situated subdistally, st situated closer to t than to sb. Venom apparatus only present in movable chelal finger, venom ducts long, terminating in nodus ramosus distal to st (Figs. 21, 22). Fixed finger with 2 large sensillae on retrolateral face, and 2 on prolateral face; movable chelal finger with sensilla slightly proximal to sh in male and slightly distal to sb in female, with 2 receptors. Chela of male without mound. Chelal teeth pointed and slightly retrorse, basal teeth more rounded; fixed finger with 44 (cJ), 48 (9) teeth, plus 1 1 (^), 9 (9) retrolateral and 10 (cJ), 7 (9) prolateral accessory teeth; movable finger with 46 (cJ), 50 (9) teeth, plus 9 (cJ, 9) retrolateral and 6 (<3), 4 (9) prolateral accessory teeth.
Carapace (Fig. 17): coarsely granulate, 1.15 {£), 0.98-1.10 (9) X longer than broad; without eyes or eyespots; with 100 (5), 83 (9) setae, arranged with 61 (cJ), 42 (9) (including 6 near anterior margin) in anterior zone, 25 ((J), 34 (9) in median zone, and 14 (13), 17 (9) in posterior zone; with 2 deep furrows, posterior furrow situated slightly closer to posterior carapace margin than to anterior furrow.
Coxal region: maxillae granulate; manducatory process somewhat acute, with 2 apical acuminate setae, 1 small sub- oral seta and 37 {<3), 32 (9) additional setae; median maxillary lyrifissure rounded and situated submedially; posterior max- illary lyrifissure rounded. Leg coxae smooth; chaetotaxy of coxae I-IV; <3, 18: 19: 23: ca. 60; 9, 18: 21: 25: ca. 65.
Legs: very slender; junction between femora and patellae I and 11 strongly oblique to long axis; junction between femora and patellae III and IV very angulate; femora III and IV much smaller than patellae III and IV; femur + patella of leg IV 5.19 (>3), 5.37-5.56 (9) X longer than broad; all tarsi with slit sensillum on raised mound; male leg I not modified; tarsi III and IV without tactile seta, but with paired subdistal setae; subterminal tarsal setae arcuate and acute; claws simple; arolium about same length as claws, not divided.
Abdomen: tergites 1-X and sternites IV-X of male and female with median suture line fully dividing each segment. Tergal chaetotaxy; 3, 1 1: 12: 1 1: 18; 19: 18; 20; 18: 17: 18: 13:2; 9, 12: 13: 13: 17: 17; 18: 19; 19: 21: 16: 14: 2; uniseriate, except
HARVEY & WYNNE TROGLOMORPHIC PSEUDOSCORPIONS FROM ARIZONA
213
Figures 21-26. — Hesperochernes hradyhaughi, sp. nov.: 21. Left chela, lateral, male holotype; 22. Left chela, lateral, female paratype; 23. Chelicera, dorsal, female paratype; 24. Right pedipalp, dorsal, male holotype; 25. Left leg IV, male holotype; 26. Spermathecae, female paratype. Scale lines = 0.1 mm (Fig. 23), 0.2 mm (Fig. 26), 0.5 mm (Figs. 21, 22, 24, 25).
for medial and lateral discal seta on tergites IV-IX; setae thickened and strongly dentate. Sternal chaetotaxy: <3, 30: (3) 22 [2 + 2] (3): ( 1 ) 8 ( 1 ): 1 9: 2 1 : 2 1 : 20: 20: 1 6: 8 (arranged T6T): 2; ?, ca. 40: (3) 10 (3): (1) 5 (1): 14: 21: 20: 20: 18: 16: 11 (arranged T9T): 2; uniseriate, except for lateral discal seta on sternites VII-X; setae of anterior sternites acicular, becoming progres- sively more denticulate on posterior sternites. Spiracles with helix. Anal plates (tergite XII and sternite XII) situated between tergite XI and sternite XI, anal setae not denticulate. Pleural membrane wrinkled and somewhat stellate; without any setae.
Genitalia: male of the chernetid type. Female (Fig. 26): with a pair of long thin-walled spermathecae terminating in rounded sacs.
Dimensions: Male holotype: Body length 3.11. Pedipalps: trochanter 0.518/0.282, femur 974/0.307, patella 0.824/0.314, chela (with pedicel) 1.552/0.506, chela (without pedicel) 1.434, hand length 0.756, movable finger length 0.704. Chelicera 0.322/0.165, movable finger length 0.252. Carapace 0.956/ 0.830. Leg I: femur 0.268/0.161^, patella 0.495/0.136, tibia 0.503/0.102, tarsus 0.495/0.079. Leg IV: femur + patella 0.883/ 0.170, tibia 0.778/0.107, tarsus 0.557/0.085.
Female (paratype lodged in MNA) followed by other female (where applicable): Body length 2.82 (4.21). Pedipalps: trochanter 0.552/0.294 (0.566/0.304), femur 1.034/0.335 ( 1.042/ 0.353), patella 0.904/0.340 (0.942/0.371), chela (with pedicel) 1.624/0.486 (1.635/0.506), chela (without pedicel) 1.502
214
THE JOURNAL OF ARACHNOLOGY
( 1.510), hand length 0.797 (0.698), movable finger length 0.768 (0.816). Chelicera 0.327/0.152, movable finger length 0.244. Carapace 1.040/0.944 (1.000/1.021). Leg I: femur 0.300/0.182, patella 0.540/0.146, tibia 0.56/0.108, tarsus 0.520/0.079. Leg IV: femur + patella 1.010/0.188 (1.000/0.180), tibia 0.83o7 0.121, tarsus 0.580/0.084.
Remarks. — As stated in the diagnosis, H. bradyhaughi appears to be most similar to H. riograndensis but differs in being substantially larger and with a markedly swollen male chela, especially on the dorsal face. The only known location of H. riograndensis is located 670 km ESE of Parashant, and the microhabitat of both species differs with H. bradyhaughi being found in a cave and H. riograndensis collected from the nest of a kangaroo rat (Heteromyidae: Dipodomys) (Hoff & Clawson 1952). Given the lack of eyes and eyespots, we consider H. bradyhaughi to be a troglobite.
Tuherochernes Muchmore Tuberochernes Muchmore 1997:206-207.
Type species. — Tuberochernes aalbui Muchmore 1997, by original designation.
Diagnosis. — Tuherochernes differs from all other chernetid genera by the combined presence of a distinct medium-sized mound on the prolateral face of the pedipalpal chela of males, and four blades in the cheliceral rallum.
Remarks. — The genus Tuherochernes was described by Muchmore (1997) for two species of cave-dwelling pseudo- scorpions from southwestern U.S.A., T. aalbui and T. uhicki, but the discovery of a third species, also from a cave in southwestern U.S.A., does not necessitate an alteration of the original description apart from the nature of the tactile seta of leg IV. Muchmore (1997) observed that the tactile seta of leg IV was “short, distally located” and “variably acuminate or finely denticulate”. Close examination of the posterior tarsi of the new species described below does not reveal a tactile seta of this nature, and we suggest this feature appears to be variable within the genus.
The most obvious feature that distinguishes Tuberochernes is the presence of a medium-sized mound on the prolateral margin of the chelal hand in males (Muchmore 1997). In this respect, it resembles several other chernetid genera, including males of Mirochernes Beier 1930 and Bituherochernes Much- more 1974, and both males and females of Interchernes Muchmore 1980 and Petterchernes Heurtault 1986, which were distinguished from Tuherochernes by Muchmore (1997). Bituherochernes further differs from Tuherochernes by a mound being also present on the pedipalpal patella. The function of the mound has not been ascertained, but the mound of T cohni has 5 small pores, which may be responsible for discharging fiiiids, possibly during sexual interactions with females.
Tuherochernes cohni sp. nov.
urn:lsid:zoobank.org:act:12896B35-DDlC-4E0B-B66F-F9B
30170D476
Figs. 27-37
Material examined. — Type: U.S.A.: Arizona: Mohave County: holotype male, PARA- 1001 Cave, Grand Canyon- Parashant National Monument, ca. UTM 0264500 N,
4060700 E, Zone 12S, the deeper extent of the twilight zone (near the dark zone), opportunistic collecting, 13 August 2005, J.J. Wynne (MNA).
Etymology, — This species is named for the late Dr. Theodore “Ted” Cohn. Cohn was an Orthopterist and the leading authority who identified the new genus of rhaphido- phorid cricket known from PARA- 1001 Cave. Dr. Cohn passed away in November 2013 at age 82. He was a passionate educator and entomologist.
Diagnosis. — Tuherochernes cohni differs from the other two species of the genus, T. aalbui and T. uhicki, by the more anteriorly positioned mound on the pedipalpal chela.
Description. — Adult male: Color: pedipalps and carapace dark red-brown, legs light red-brown, tergites yellow-brown, sternites pale yellow-brown.
Chelicera: with 6 setae on hand and 1 subdistal seta on movable finger (Fig. 32); setae es, sbs and bs dentate, Is and is acuminate; with 2 dorsal lyrifissures and 1 ventral lyrifissure; galea broken; rallum of 4 blades, the most distal blade with several serrations on leading edge, other blades smooth; serrula exterior with 17 blades; lamina exterior present.
Pedipalp (Fig. 33): surfaces of trochanter, femur, patella and chelal hand coarsely granulate, chela fingers mostly smooth; patella with 5 small sub-basal lyrifissures; trochanter 1.73, femur 2.83, patella 2.88, chela (with pedicel) 3.39, chela (without pedicel) 3.11, hand 1.40 X longer than broad, movable finger 1.23 X longer than hand. Fixed chelal finger with 8 trichobothria, movable chelal finger with 4 trichobo- thria (Fig. 31): eb and esb situated basally, ih and ist subbasally, est and isb submedially, et and it subdistally, ish situated midway between ist and it, and et slightly distal to if, t situated subdistally, st situated much closer to t than to sb. Venom apparatus only present in movable chelal finger, venom ducts long, terminating in nodus ramosus midway at level of St (Fig. 31). Fixed finger with 3 sensillae on retrolateral face, and 1 on prolateral face; movable chelal finger with sensilla slightly distal to sb, with 2 receptors. Chela with prominent, medium-sized mound on prolateral face (Figs. 30, 34), with 5 small pores. Chelal teeth pointed and slightly retrorse, basal teeth more rounded; fixed finger with 37 teeth, plus 7 retrolateral and 3 prolateral accessory teeth; movable finger with 42 teeth, plus 4 retrolateral and 0 prolateral accessory teeth.
Carapace (Fig. 29): coarsely granulate, 1.19 X longer than broad; without eyes or eyespots; with 96 setae, arranged with 54 (including 6 near anterior margin) in anterior zone, 28 in median zone, and 14 in posterior zone; with 2 deep furrows, posterior furrow situated closer to posterior carapace margin than to anterior furrow.
Coxal region: maxillae granulate; manducatory process somewhat acute, with 2 apical acuminate setae, 1 small sub- oral seta and 25 additional setae; median maxillary lyrifissure rounded and situated submedially; posterior maxillary lyr- ifissure rounded. Leg coxae smooth; chaetotaxy of coxae I-IV: 13: 12: 14: 34.
Legs (Figs. 35-37): junction between femora and patellae I and II strongly oblique to long axis; junction between femora and patellae III and IV very angulate; femora III and IV much smaller than patellae III and IV; femur -i- patella of leg IV 4.03
X longer than broad; all tarsi with slit sensillum on raised
HARVEY & WYNNE— TROGLOMORPHIC PSEUDOSCORPIONS FROM ARIZONA
215
Figures 27-30. — Tuherochernes cohni, sp. nov., male liolotype: 27. Body, dorsal; 28. Body, ventral; 29. Carapace, dorsal; 30. Right chela, dorsal.
mound; leg I modified with tibia thickened, tarsus slightly curved and ventral margins of patella and tibia with coarse granulation; tarsi III and IV without tactile seta, but with paired subdistal setae; subterminal tarsal setae arcuate and acute; claws simple; arolium about same length as claws, not divided.
Abdomen: tergites II-X and sternites V-X of with median suture line fully dividing each segment. Tergal chaetotaxy: 15: 20: 20: 20: 22: 22: 21: 21: 22: 17: 10: 2; uniseriate, except for medial and lateral discal seta on tergites IV-IX; setae thickened and strongly dentate. Sternal chaetotaxy: 51: (0) 8 [2 + 2] (0): (1)8(1): 12: 16: 17: 18: 17: 14: 8 (arranged T6T): 2; uniseriate, except for lateral discal seta on sternites IV-XI; setae of anterior sternites acicular, becoming progressively more denticulate on posterior sternites. Spiracles with helix. Anal plates (tergite XII and sternite XII) situated between tergite XI and sternite XI, anal setae denticulate. Pleural membrane longitudinally striate; without any setae.
Genitalia: of the chernetid type.
Dimensions: male holotype: Body length 3.38. Pedipalps: trochanter 0.576/0.332, femur 0.944/0.334, patella 0.910/0.316, chela (with pedicel) 1.390/0.410, chela (without pedicel) 1.276, hand length 0.573, movable finger length 0.704. Chelicera 0.333/0.134, movable finger length 0.240. Carapace 1.009/ 0.848. Leg I: femur 0.305/0.249, patella 0.560/0.253, tibia 0.621/0.174, tarsus 0.442/0.089. Leg IV: femur + patella 0.859/ 0.213, tibia 0.692/0.134, tarsus 0.533/0.954.
Remarks. — Tuherochernes cohni possesses some very slight modifications consistent with troglomorphic adaptations of
which the most prominent is the complete lack of eyes (Fig. 29) and the slightly elongated leg segments. Thus, this animal is considered a troglobite. It appears to bear a closer resemblance to T. ubicki from a cave in the Santa Rita Mountains, Arizona (610 km), than to T. aalhiii from a cave in the Inyo National Forest, California (415 km), due to the similarly expanded tibia I in males of the two Arizona species.
DISCUSSION
Our review of the pseudoscorpions detected within the caves of Grand Canyon-Parashant National Monument has re- vealed a modest fauna of three species: Larca cavicola (family Larcidae), Hesperochernes bradybuughi and Tuherochernes cohni (both in the family Chernetidae). All show modifications consistent with obligate existence in cave environments, but none show the classic signs of extreme troglomorphism found in many cave-adapted pseudoscorpions (e.g. Heurtault 1994; Flarvey et al. 2000). Both species of Chernetidae lack eyes and have long slender legs, which appear to be troglomorphic modifications due to their subterranean existence, although their pedipalps do not appear to be modified compared to epigean species of the genus. Other subterranean species of Hesperochernes with thin legs and no eyespots — H. holsingeri from Indiana, H. mirabilis from Alabama, Georgia, Indiana, Kentucky, Ohio, Tennessee and Virginia, and H. occidentalis from Arkansas, Missouri, Oklahoma and Texas — appear to be more highly modified as they have elongate pedipalps. Both new species described from the Parashant may represent short- range endemic species as defined by Harvey (2002) and Harvey
216 THE JOURNAL OF ARACHNOLOGY
Figures .^Tuherochemes colmi, sp. nov., male holotype: 31. Left chela, lateral; 32. Chelicera, dorsal; 33. Right pedipalp, dorsal; 34. Left chela, detail of mound, ventral; 35. Left tarsus IV; 36. Left I; 37. Left leg IV. Scale lines = 0.2 mm (Figs. 32, 34, 35), 0.5 mm (Figs. 31, 33, 36, 37).
HARVEY & WYNNE— TROGLOMORPHIC PSEUDOSCORPIONS FROM ARIZONA
217
et al. (2011) due to their highly restricted distributions. Although the junior author and colleagues sampled all known caves on Parashant, they detected these new species in only one cave (PARA- 1001 Cave).
Larca cavicola appears to be less cave-adapted than the others, as it retains eyes. However, the pedipalps are noticeably thinner than epigean species of the genus, suggesting moderate morphological modifications to the cave environment. Larca cavicola was found in PARA-3503 and PARA-2204 Caves and has been found in Cave of the Domes, a small cave situated within Grand Canyon National Park, Coconino County (Muchmore 1981). Although this cave is also located in the Grand Canyon region, it lies on the south side of the Colorado River some 160 km from the Parashant caves, and we suggest these populations are genetically isolated from each other.
The only known locality of Hesperochernes hradybaugln and Tiiherochernes cohni is PARA- 1001. This is the second most biologically diverse cave, and the most biologically significant cave on the monument. It supports the largest known cricket roost in Arizona, which represents an undescribed genus of rhaphidophorid cave cricket, cf Ceuthophilus n. gen. n. sp., Cohn & Swanson, unpublished data; (Wynne & Voyles 2014). Its population contributes significantly to the nutrient loading via cricket guano, cricket eggs and nymphs, as well as deceased individuals at various life stages. In other regions, the ecological importance of crickets on cave ecosystems is well documented (e.g., Barr 1967; Howarth 1983; Taylor 2003; Culver 2005; Poulson 2005). Given the size of the roost, we suggest that cf Ceuthophilus n. gen. n. sp. represents a keystone species with the presence of this animal supporting at least four cave-adapted species including a short-range endemic and troglomorphic leiodid beetle, Ptomaphagus parashant (Peck & Wynne 2013), an undescribed species of troglomorphic centipede (family Anopsobiidae; Wynne, unpublished data), and the two pseudoscorpion species described here. To date, P. parashant, the anopsobiid centipede, and the two new pseudoscorpion species have been detected only in PARA- 1001 Cave. Two other caves on the monument, with similar deep zone like conditions, were sampled using the same systematic sampling design are within a 9.7 km radius of PARA- 1001; neither of these new pseiidoscorpions species were detected at these caves.
Management Implications. — We recommend the same man- agement strategies proposed by Peck & Wynne (2013) be maintained for PARA- 1001 Cave. This cave should not be gated given its south-facing entrance and entrance structure, and it should remain closed to recreational use. PARA- 1001 is considered the second most biologically diverse cave on the monument and supports the greatest diversity of troglo- morphic arthropod species. Presently, all of these animals (including the two new pseudoscorpion species described here) are known to occur only within PARA- 1001 Cave. Maintain- ing the management strategies suggested by Peck & Wynne (2013) should aid in the long-term persistence of these presumed short-range endemic arthropods.
ACKNOWLEDGMENTS
Special thanks to Jennifer Eox, Eathan McIntyre, Ray Klein and Rosie Pepito of Grand Canyon-Parashant National
Monument, Danielle Nelson and Matt Johnson with the Colorado Plateau Research Station, and Neil Cobb of the Colorado Plateau Museum of Arthropod Biodiversity for administrative and logistical support. Tama and John Cassidy, Michael Gowan, John Kalman, Ty Spatta and Kyle Voyles assisted with fieldwork. The San Bernardino Cave Search and Rescue Team, Jon Jasper and Kyle Voyles, remained on emergency stand-by during field operations. Dave Decker and Kyle Voyles provided descriptions regarding the geological and structural characteristics of the study caves. Dale Pate and two anonymous reviewers provided suggestions leading to the improvement of this manuscript. The Explorers Club recog- nized two of these research trips as flag expeditions. Fieldwork was funded through a Colorado Plateau CESU cooperative agreement between the National Park Service and Northern Arizona University.
LITERATURE CITED
Aalbu, R.L., A.D. Smith & C.A. Triplehorn. 2012. A revision of the Eteodes {subgenus Cavenieleodes) with new species and notes on cave breeding Eleodes (Tenebrionidae: Amphidorini). Annales Zoologica 62:199-216.
Ashmole, N.P., P. Oromi, M.J. Ashmole & J.L. Martin. 1992. Primary faunal succession in volcanic terrain: lava and cave studies on the Canary Islands. Biological Journal of the Linnean Society 46:207-234.
Banks, N. 1908. The pseudoscorpions of Texas. Bulletin of the Wisconsin Natural History Society 6:39M2.
Barber, H.S. 1931. Traps for cave inhabiting insects. Journal of the Mitchell Society 46:259-266.
Barr, T.C. Jr. 1967. Observations on the ecology of caves. American Naturalist 101:475-491.
Beier, M. 1930. Die Pseudoskorpione des Wiener Naturhistorischen Museums. III. Annalen des Naturhistorischen Museums in Wien 44:199-222.
Beier, M. 1933. Pseudoskorpione aus Mexiko. Zoologischer Anzeiger 104:91-101.
Beier, M. 1939a. Die Pseudoscorpioniden-Fauna der iberischen Halbinsel. Zoologische Jahrbiicher, Abteilung fiir Systematik, Okologie und Geographie der Tiere 72:157-202.
Beier, M. 1939b. The Pseudoscorpionidea collected by the Percy Sladen Trust Expedition to Lake Titicaca. Annals and Magazine of Natural History (11) 3:288-290.
Beier, M. 1947. Zur Kenntnis der Pseudoscorpionidenfauna des siidlichen Afrika, insbesondere der siidwest- und si'idafrikanischen Trockengebiete. Eos, Madrid 23:285-339.
Beier, M. 1962. Pseudoscorpioniden aus der Namib-Wiiste. Annals of the Transvaal Museum 24:223-230.
Beier, M. 1973. Weiteres zur Kenntnis der Pseudoscorpioniden Siidwestafrikas. Cimbebasia, A 2:97-101.
Beier, M. 1976. Pseudoscorpione von der Dominicanischen Republik (Insel Haiti). Revue Suisse de Zoologie 83:45-58.
Benedict, E.M. & D.R. Malcolm. 1978. Some garypoid false scorpions from western North America (Pseudoscorpionida: Garypidae and Olpiidae). Journal of Arachnology 5:113-132. Chamberlin, J.C. 1924. Hesperochernes laurae, a new species of false scorpion from California inhabiting the nest of Vespa. Pan-Pacific Entomologist 1:89-92.
Chamberlin, J.C. 1930. A synoptic classification of the false scorpions or chela-spinners, with a report on a cosmopolitan collection of the same. Part II. The Diplosphyronida (Arachnida-Chelonethida). Annals and Magazine of Natural History (10) 5:1-48, 585-620. Chamberlin, J.C. 1931. The arachnid order Chelonethida. Stanford University Publications, Biological Sciences 7(1): 1-284.
218
THE JOURNAL OF ARACHNOLOGY
Chamberlin, J.C. 1935. A new species of false scorpion (Hesper- ochernes) from a bird's nest in Montana (Arachnida — Chelo- nethida). Pan-Pacific Entomologist 11:37-39.
Chamberlin, J.C. 1943. The taxonomy of the false scorpion genus Synsphyrofuis with remarks of the sporadic loss of stability in generally constant morphological characters (Arachnida: Chelonethida). An- nals of the Entomological Society of America 36:486-500.
Chamberlin, J.C. 1952. New and little-known false scorpions (Arachnida. Chelonethida) from Monterey County, California. Bulletin of the American Museum of Natural History 99:259-312.
Culver, D.C. 2005. Species interactions. Pp. 539-543. In Encyclopedia of Caves. (D.C. Culver & W.B. White, eds.). Elsevier, Burlington, Massachusetts.
Ellingsen, E. 1910. Die Pseudoskorpione des Berliner Museums. Mitteilung aus dem Zoologischen Museum in Berlin 4:357-423.
Gardini. G. 1983. Ltirca ilalica n. sp. cavernicola dell’Appennino Abruzzese (Pseudoscorpionida, Garypidae) (Pseudoscorpioni d’lta- lia XV). Bollettino della Societa Entomologica Italiana 1 15:63-69.
Harvey, M.S. 1986. The Australian Geogarypidae, new status, with a review of the generic classification (Arachnida: Pseudoscorpio- nida). Australian Journal of Zoology 34:753-778.
Harvey, M.S. 1987a. Redescriptions of Geogarypiis hncculentus Beier and G. pustiilatiis Beier (Geogarypidae: Pseudoscorpionida). Bulletin of the British Arachnological Society 7:137-141.
Harvey, M.S. 1987b. A revision of the genus Synsphyrontis Chamberlin (Garypidae: Pseudoscorpionida: Arachnida). Austra- lian Journal of Zoology. Supplementary Series 126:1-99.
Harvey, M.S. 1992. The phylogeny and classification of the Pseudoscorpionida (Chelicerata: Arachnida). Invertebrate Taxon- omy 6:1373-1435.
Harvey, M.S. 2002. Short-range endemism in the Australian fauna: some examples from non-marine environments. Invertebrate Systematics 16:555-570.
Harvey, M.S. 2011. Two new species of Synsphyroniis (Pseudoscor- piones: Garypidae) from southern Western Australian granite landforms. Records of the Western Australian Museum 26:11-22.
Harvey, M.S. & K.L. Edward. 2007. A review of the pseudoscorpion genus Ideoblothnis (Pseudoscorpiones, Syarinidae) from western and northern Australia. Journal of Natural History 41:445^72.
Harvey, M.S. & W.B. Muchmore. 2013. The systematics of the pseudoscorpion family Ideoroncidae (Pseudoscorpiones, Neobi- sioidea) in the New World. Journal of Arachnology 41:229-290.
Harvey, M.S., P.B. Ratnaweera, P.V. Randeniya & M.R. Wijesinghe. 2012. A new species of the pseudoscorpion genus Megachernes (Pseudoscorpiones: Chernetidae) associated with a threatened Sri Lankan rainforest rodent, with a review of host associations of Megachernes. Journal of Natural History 46:2519-2535.
Harvey, M.S., M.G. Rix, V.W. Framenau, Z.R. Hamilton, M.S. Johnson, R.J. Teale, G. Humphreys & W.F. Humphreys. 2011. Protecting the innocent: studying short-range endemic taxa enhances conservation outcomes. Invertebrate Systematics 25:
1 10.
Harvey. M.S., W.A. Shear & H. Hoch. 2000. Onychophora, Arachnida, myriapods and Insecta. Pp. 79-94. In Subterranean ecosystems. (H. Wilkens, D.C. Culver & W.F. Humphreys, eds.). Elsevier, Amsterdam.
Henderickx, H. & V. Vets. 2002. A new Larca (Arachnida: Pseudoscorpiones: Larcidae) from Crete. Bulletin of the British Arachnological Society 12:280-282.
Heurtault, J. 1994. Pseudoscorpions. Pp. 185-196. In Encyclopaedia biospeologica. (C. Juberthie & V. Decu, eds.). Vol. I. Societe de Biospeologie, Moulis and Bucarest.
Hoff. C.C. 1945. Ile.sperochernes canadensis, a new chernetid pseudo- scorpion from Canada. American Museum Novitates 1273:1-4.
Hoff. C.C. 1946a. New pseudoscorpions, chiefiy neotropical, of the suborder Monosphyronida. American Museum Novitates 1318:1-32.
Hoff, C.C. 1946b. A study of the type collections of some pseudoscorpions originally described by Nathan Banks. Journal of the Washington Academy of Sciences 36:195-205.
Hoff, C.C. 1947. The species of the pseudoscorpion genus Chelanops described by Banks. Bulletin of the Museum of Comparative Zoology 98:471-550.
Hoff, C.C. 1950. Pseudoescorpionidos nuevos o poco conocidos de la Argentina (Arachnida, Pseudoscorpionida). Arthropoda, Buenos Aires 1:225-237.
Hoff, C.C. 1956a. Diplosphyronid pseudoscorpions from New Mexico. American Museum Novitates 1780:1-49.
Hoff, C.C. 1956b. Pseudoscorpions of the family Chernetidae from New Mexico. American Museum Novitates 1800:1-66.
Hoff, C.C. 1961. Pseudoscorpions from Colorado. Bulletin of the American Museum of Natural History 122:409^64.
Hoff, C.C. & J.E. Bolsterli. 1956. Pseudoscorpions of the Mississippi River drainage basin area. Transactions of the American Microscopical Society 75:155-179.
Hoff, C.C. & D.L. Clawson. 1952. Pseudoscorpions from rodent nests. American Museum Novitates 1585:1-38.
Howarth, F.G. 1980. The zoogeography of specialized cave animals: a bioclimatic model. Evolution 34:394^06.
Howarth, F.G. 1982. Bioclimatic and geological factors governing the evolution and distribution of Hawaiian cave insects. Entoniologia Generalis 8:17-26.
Howarth, F.G. 1983. Ecology of cave arthropods. Annual Review of Entomology 28:365-389.
Judson, M.L.I. 2007. A new and endangered species of the pseudo- scorpion genus Lagynochthonius from a cave in Vietnam, with notes on chelal morphology and the composition of the Tyrannochthoniini (Arachnida, Chelonethi, Chthoniidae). Zootaxa 1627:53-68.
Mahnert, V. 1982. Die Pseudoskorpione (Arachnida) Kenyas, IV. Garypidae. Annales Historico-Naturales Musei Nationalis Hun- garici 74:307-329.
Mahnert, V. 1988. Zwei neue Garypininae-Arten (Pseudoscorpiones: Olpiidae) aus Afrika mit Bemerkungen zu den Gattungen Serianus Chamberlin und Paraserianus Beier. Stuttgarter Beitriige zur Naturkunde (A) 420:1-11.
Mockford. E.L. 2009. Systematics of North American species of Sphaeropsocidae (Psocoptera). Proceedings of the Entomological Society of Washington 11:666-685.
Moles, M. 1914. A pseudoscorpion from Poplar trees. Journal of Entomology and Zoology, Pomona College 6:81-83.
Muchmore, W.B. 1974. Clarification of the genera Hesperochernes and Dinocheirus (Pseudoscorpionida, Chernetidae). Journal of Arachnology 2:25-36.
Muchmore, W.B. 1981. Cavernicolous species of Larca, Archeolarca and Pseudogarypiis with notes on the genera, (Pseudoscorpionida, Garypidae and Pseudogarypidae). Journal of Arachnology 9:47- 60.
Muchmore, W.B. 1982. The genus Anagarypus (Pseudoscorpionida: Garypidae). Pacific Insects 24:159-163.
Muchmore, W.B. 1984. New cavernicolous pseudoscorpions from California (Pseudoscorpionida, Chthoniidae and Garypidae). Journal of Arachnology 12:171-175.
Muchmore, W.B. 1990. Pseudoscorpionida. Pp. 503-527. In Soil biology guide. (D.L. Dindal, ed.). John Wiley and Sons, New York.
Muchmore, W.B. 1994. Some pseudoscorpions (Arachnida: Pseudos- corpionida) from caves in Ohio and Indiana, U.S.A. Transactions of the American Microscopical Society 113:316-324.
Muchmore, W.B. 1996. A remarkable new genus and species of Pseudoscorpionida (Syarinidae) from a cave in Arizona. South- western Naturalist 41:145 148.
Muchmore, W.B. 1997. Tnherochernes (Pseudoscorpionida, Cherne- tidae), a new genus with species in caves in California and Arizona. Journal of Arachnology 25:206-212.
HARVEY & WYNNE— TROGLOMORPHIC PSEUDOSCORPIONS FROM ARIZONA
219
Muchmore, W.B. & R.B. Pape. 1999. Description of an eyeless, cavernicolous Alhiorix (Pseiidoscorpionida: Ideoroncidae) in Ar- izona, with observations on its biology and ecology. Southwestern Naturalist 44:138-147.
Peck, S.B. & J.J. Wynne. 2013. Ptomaphagus parashcmt Peck and Wynne, new species (Coleoptera: Leiodidae: Cholevinae: Ptoma- phagini): the most troglomorphic cholevine beetle known from western North America. The Coleopterists Bulletin 67:309-317.
Poulson, T.L. 2005. Food sources. Pp. 255-264. In Encyclopedia of Caves. (D.C. Culver & W.B. White, eds.). Elsevier, Burlington, MA.
Sato, H. 1983. Hesperochemes shinjoensis, a new pseiidoscorpion (Chernetidae) from Japan. Bulletin of the Biogeographical Society of Japan 38:31-34.
Shear, W.A., S.J. Taylor, J.J. Wynne & J.K. Krejca. 2009. Cave millipeds of the United States. VIII. New genera and species of
polydesmidan millipeds from caves in the southwestern United States (Diplopoda, Polydesmida, Polydesmidae and Macrosterno- desmidae). Zootaxa 2151:47-65.
Taylor, S.J. 2003. America, North: Biospeleology. Pp. 45^9. In Encyclopedia of Caves and Karst Science. (J. Gunn, ed.). Fitzroy Dearborn, New York, NY.
Wynne, J.J. & K.D. Voyles. 2014. Cave-dwelling arthropods and vertebrates of North Rim Grand Canyon, with notes on ecology and management. Western North American Naturalist 74:1-17.
Zaragoza, J.A. 2005. Two new cave-dwelling Lavca species from the south-east of Spain (Arachnida, Pseudoscorpiones, Larcidae). Revue Suisse de Zoologie 112:195-213.
Manuscript received 25 May 2014, revised 10 July 2014.
2014. The Journal of Arachnology 42:220-232
A new genus and a new species of scorpion (Scorpiones: Buthidae) from southeastern Mexico
Oscar F. Francke', Rolando Teruel- and Carlos Eduardo Santibanez-L6pez‘: ’Coleccion Nacional de Aracnidos,
Departamento de Zoologia, Instituto de Biologia, Universidad Nacional Autonoma de Mexico, Apto. Postal 70-153, C. P. 04510, Mexico, D. F., Mexico. E-mail: offb@ib.unam.mx; -Centro Oriental de Ecosistemas y Biodiversidad (BIOECO), Museo de Historia Natural “Tomas Romay”; Jose A. Saco # 601, esquina a Barnada, Santiago de Cuba 90100, Cuba
Abstract. Chaneke fogoso gen. nov. et sp. nov., are described based on specimens collected near the coast in southeastern Guerrero, Mexico. The genus is characterized by the peculiar rhomboida! shape of the subaculear tubercle, and the lack of at least one trichobothrium on the femur, patella and chela of the pedipalp, which make it the second known buthid genus with decreasing neobothriotaxy on those three pedipalpal segments, together with Alayotityus Armas 1973. Tityopsis ciliciae Armas & Martin-Frias 1998, from Oaxaca, Mexico, is transferred to the new genus, resulting in Chaneke aliciae (Armas & Martin-Frias 1998), comb. nov. A cladistic analysis including all other New World “microbuthids” with decreasing neobothriotaxy, with 30 morphological characters, indicates that Chaneke is monophyletic, clearly distinct from Alayotityus Armas 1973 (from eastern Cuba) and Tityopsis Armas 1974 (from western Cuba).
Keywords: Decreasing neobothriotaxy, femur, patella, chela
The scorpion family Buthidae C. L. Koch 1837 contains approximately 90 genera (Ove-Rein 2014), approximately two- thirds of which have the (3 trichobothrial pattern on the pedipalp femur, and a third of which have the a trichobothrial pattern (Vachon 1975). In the New World, there are 1 1 buthid genera represented, one with the P pattern and the remaining 10 with the a pattern. Six of those genera are orthobothrio- taxic: femur with 11 trichobothria ( = t), patella with 13 t, chela with 15 x; and four genera have decreasing neobothrio- taxy ( = less than the “full” compliment noted above) on some or all of their species. Alayotityus Armas 1973 lacks femoral x
and patellar x r/-.; Mesotityus Gonzalez-Sponga 1981 lacks patellar x ch and chela x Eby Microtityus Kjellesvig-Waering 1966 has variable femoral and chelal trichobothrial numbers, but the patella is always orthobothriotaxic (x r/? present); Zahiiis Thorell 1893 lacks femoral x d? and chela x esb, but its three species have patellar x dj present, although reduced in size ( = petite), and chela x Ebj present.
The genus Tityopsis Armas 1974 has two species from western Cuba that are orthobothriotaxic, and a Mexican species that, although it was originally described as being orthobothriotaxic (Armas & Martin-Frias 1998), was recently redescribed and shown to be neobothriotaxic (Vidal-Acosta & Francke 2009). Another neobothriotaxic species was recently collected in the state of Guerrero, Mexico (Figs. 1, 2), which is undoubtedly congeneric with Tityopsis aliciae Armas & Martin-Frias 1998, from the state of Oaxaca (Fig. 3); these two Mexican species differ from Tityopsis in being neobo- thriotaxic. The objectives of this contribution are: (a) to analyze the phylogenetic relationships of the two neobothrio- taxic Mexican species with other New World buthids which have an a trichobothrial pattern on the femur, (b) to describe a new genus for those two Mexican species, and (c) to describe the new species from Guerrero.
METHODS
Specimens. — The specimens used in this study are lodged in the following institutions: American Museum of Natural
History, New York, USA (AMNH); Centro Oriental de Ecosistemas y Biodiversidad, Santiago de Cuba, Cuba (BIOECO); Coleccion Nacional de Aracnidos, Univ. Nacional Autonoma de Mexico, Mexico, D. F. (CNAN); Laboratorio de Entoniologia, Instituto de Diagnostico y Referenda Epidemiologicos, Secretaria de Salud, Mexico, D. F (IN- DRE); private collection Rolando O. Teruel, Cuba (ROT).
Specimens examined are listed in Appendix 1 , including the first known male of T aliciae. Nomenclature and mensuration for the most part follow Stahnke (1970), with the following exceptions: metasomal carinal terminology after Francke (1977), carinal terminology of pedipalp femur and patella after Acosta et al. (2008) and trichobothrial terminology after Vachon (1974, 1975). Observations, measurements and
drawings were made using a Nikon SMZ800 stereomicroscope fitted with lOX ocular micrometer and camera lucida; photographs were made using a Nikon Coolpix SIO adapted to the same microscope.
Taxon sampling. — The cladistic analysis presented is based on 25 temiinal taxa (Appendix 1). Trees were rooted using the out-group method (Watrous &. Wheeler 1981; Farris 1982; Nixon & Carpenter 1993). The in-group includes all New World genera of the family Buthidae with non-imbricated rows of denticles on the pedipalp chela fingers and which lack supernumerary denticles along those rows. Three taxa which have supernumerary denticles are used as out-groups: Rhopa- liinis jimceus (Herbst 1880); Centruroides exilicauda (Wood 1863), type species of the genus; and Centruroides gracilis (Latreille 1804), a rather divergent taxon from the type species of the genus. The tree was rooted with Ananteris platnicki Lourenpo 1993, which is the New World genus of buthids with a femoral P trichobothrial pattern and thus distantly related.
Character matrix. — Character data were edited using WinClada, version 1.00.08 (Nixon 2002). The character matrix (Appendix 2) comprises 30 characters, eight coded into multistates and 22 coded into binary states. All characters (Appendix 3) are informative and are included in all the analyses and statistics. Multistate characters were treated as
220
FRANCKE ET AL.— NEW GENUS OF BUTHIDAE FROM MEXICO
221
Figure 1. — Habitat at type locality of Cliaiieke fogoso gen. nov. et sp. nov.
unordered/noii-additive (Fitch 1971), defended by invoking the principle of indifference, which asserts that if there is no apparent reason for considering one event to be more probable than its alternatives, then all should be considered equiprobable (Wilkinson 1992).
Cladistic analyses. — Analyses were conducted with parsimo- ny and equal weighting or implied weighting with six values of the concavity constant (k) = 1, 3, 10, 30, 60 and 100, to assess the effect of weighting against homoplasious characters (as in Prendini et al. 2010). All analyses were conducted with TNT ver 1.1 (Goloboff et al. 2008), using a driven search combining three of the new technology algorithms (excluding ratchet) using a script file modified from Dimitrov et al. (2013) and Santibanez- Lopez et al. (in press): hold 90000; rseedl; xm: noverb nokeep: rat: it 0 up 4 down 4 an 0 man 36 give 99 ecpia; dri: it 10 fit 1.00 rfi 0.20 ant 0 man 36 give 99 xfa 3.00 ecjiia: sect: slack 20: sec: mins 45 maxs 45 self 43 incr 75 minf 10 god 75 drift 6 glob 5 dglob 10 rou 3 xss 10- 14+2 noxev noeq; tf: roii 5 minf 3 best ke nochoo swap: xm : level 10 nochk rep 50 fn.se 3 dri 10 rss c.ss no.wss mult nodump conse 5 conf 75 nogive notarg iipda aiitoc 3 xmix; xm; xmult:;. The relative support for each node was calculated in TNT using 1000 Jackknife pseudoreplicates (for equal weight- ing) and symmetric resampling (for implied weighting) with heuristic searches, consisting of ten random addition sequences, followed by ten iterations of tree bisection-reconnection, retaining one tree at each iteration (Dimitrov et al. 2013), and
Figure 2. — Live habitus of Clianeke fogo.so gen. nov. et sp. nov.. dorsal view, paratype = (CNAN).
Bremer support (Bremer 1994), searching suboptimal trees up to six steps longer, retaining 1000 trees at each iteration. A preferred hypothesis was selected among the alternative topologies recovered by the analysis with equal weighting.
RESULTS
Cladistic analyses. — The analysis with equal weighting produced two most parsimonious trees (strict consensus tree shown in Fig. 4, Table 2). The monophyly of Chaneke gen. nov. was recovered by high jackknife and Bremer support values, and it was placed as sister group of the genus Alayotityus. Chaneke gen. nov. was supported by the following characters: (1) the lateral ocelli small and hidden from dorsal view by a crest (char. 2); (2) carapace without keels (char. 4); (3) one tergal carinae (char. 5); (4) male genital papillae without a distinct, fleshy point (char. 7); (5) subaculear tubercle trapezoidal, with two granules (char. 18); (6) males with basal lobe on movable finger (char. 20); (7) femoral i i3 petite (char. 25) and (8) by the absence of chela x Eb^ (char. 27; see figure 1 1 ). Genus Tityopsis was recovered monophyletic with high jackknife and Bremer support values, and it was placed as sister of the clade formed by genera Zabins, Microtityns, Chaneke and Alayotityus (see Fig. 4).
The analyses with implied weighting under four values of the concavity constant (k = 10, 30, 60 and 100) recovered two trees.
THE JOURNAL OF ARACHNOLOGY
Figure 3. — Map of Oaxaca and Guerrero area plotting known locality records for the two species of Cluineke gen. nov.: Chaneke fogoso, sp. nov. (circle), Chaneke aliciae (Armas & Martin-Frias), comb. nov. (square).
with the same topologies as in the analysis with equal weighting (Table 2). However, analyses with implied weighting under two values of the concavity constant (A' = 1 and 3) recovered three most parsimonious trees (strict consensus shown in Fig. 5; Table 2). The monophyly of Chaneke gen. nov. was recovered with high jackknife and Bremer support values, and it was placed as a sister group of the clade formed by genera Tityopsis, Microtityus, Zahhis and Alayotityus as follows: (Chaneke gen. nov. (Tityopsis (Microtityus (Zahius + Alayotityus)))). Under those two analyses (k - 1 and 3), Chaneke gen. nov. was supported by the following characters (1) the trapezoidal shape of the carapace (char. 0); (2) the lateral ocelli small, dorsally covered by a crest, visible in frontal aspect (char. 2); (3) carapace without keels (char. 4); (4) male genital papillae without a distinct, fleshy point (char. 7); (5-6) males and females with a whitish patch on sternite (chars. 10; 14); (7) males with basal lobe on movable finger (char. 20).
None of these analyses recovered Chaneke gen. nov. as sister group of Tityopsis, and the creation of this new genus, along with the transfer of Tityopsis aliciae ( = Chaneke aliciae, new combination) to the new genus, are well supported. The
preferred tree is the strict consensus from the analyses without weighting and those recovered with concavity values of k = 10, 30, 60 and 100 (Fig. 4), which place Chaneke as sister group of Alayotityus. These two genera share: (1) males with whitish patch on sternite III (char. 10); (2) females with whitish patch on sternite III (char. 14); (3) femoral t (3 petite (char. 24); and (4) patella i d? absent (char. 26). However, the position of Chaneke gen. nov. within the family remains unresolved pending a further study with the inclusion of more genera of buthids.
SYSTEMATICS
Family Buthidae C.L. Koch 1837 Genus Chaneke, gen. nov.
Tityopsis (in part): Armas & Martin-Frias 1998:45; Vidal-
Acosta & Francke 2009:338.
Type species. — Chaneke fogoso. sp. nov.
Other included species. — Chaneke aliciae (Armas & Martin- Frias, 1998), comb. nov.
Etymology. — “Chanekes” are legendary creatures in Mex- ican folklore, dating to Aztec times. They are conceived as
FRANCKE ET AL.— NEW GENUS OF BUTHIDAE FROM MEXICO
223
Figure 4. — Strict consensus tree from two equally parsimonious trees (length, 69; Cl, 0.652; RI, 0.878; Fit, 24.55) obtained by the analysis of 30 morphological characters for 25 species in 1 1 buthid scorpion genera, with equal weighting, and with weighting concavity values of k= 10, 30, 60 and 100. Unambiguous morphological synapomorphies optimized on branches: black squares indicate synapomorphies, white squares indicate homoplasies; numbers above squares indicate characters, numbers below indicate states (see Appendix 3). Jackknife values greater than 50% indicated above branches. Bremer support values indicated below branches.
small, sprite-like beings, elemental forces and guardians of nature. It is used as a noun in apposition, and is considered masculine in gender.
Diagnosis. — Relatively small-sized buthid scorpions (adults approx. 2 cm long — Table 1) with decreasing neobothriotaxy
A ot: pedipalp femur lacking x rA, patella lacking x ch, chela lacking x Ebs- The eight known species of Alayotityus lack femoral x d2 and patellar x d2, but have chelal x Ebs\ the three known species of Zabius lack femoral x d2, but have patellar x r/2 and chelal x Eby, the two known species of Tityopsis are
224
THE JOURNAL OF ARACHNOLOGY
— Ananteris platnicki
“ Tityus bahiensis
18 19 21
1 1 1
— Centruroides exilicauda
19 24
^ — Centruroides gracilis
1 18
3 0
Rhopalurus junceus
13 15
— Tityus columbianus — Tityus clathratus
11.
' Mesotityus vondangeli
99
0 2 4 7 10 14 20 I — Chaneke aliciae
28
Chaneke fogoso Tityopsis inaequalis Tityopsis inexpectata Microtityus (M.) rickyi Microtityus (P.) jaumei Zabius birabeni Zabius gaucho Zabius fuscus
Alayotityus delacruzi Alayotityus granma Alayotityus juraguaensis Alayotityus sierramaestrae Alayotityus feti Alayotityus lapidicola Alayotityus nanus Alayotityus pallidus
Figure 5. — Strict consensus tree from three most parsimonious trees (length, 71; Cl, 0.634; RI, 0.867; Fit, 24.35; Adjusted Homoplasy, 5.65) obtained by the analysis of 30 morphological characters for 25 species in 1 1 buthid scorpion genera, with weighting concavity values of L = 1 and 3. Unambiguous morphological synapomorphies optimized on branches: black squares indicate synapomorphies, white squares indicate homoplasies; numbers above squares indicate characters, numbers below indicate states (see Appendix 3). Jackknife values greater than 50% indicated above branches. Bremer support values indicated below branches.
9S
10 12 13 14 24 Z
“Q H H OOO”
12 2 10 0
0.50
28
0
orthobothriotaxic. Tergites with a single, median longitudinal Carina; whereas Alayotityus and Zabius have three carinae, Tityopsis only one, and Microtityus three or five. Metasomal segment V without lateral carinae; Zabius and Microtityus also lack such carinae, Alayotityus and Tityopsis always have well defined lateral carinae. Subaculear tubercle very large and
rhomboid in lateral view, considerably deeper than wide; Alayotityus, Tityopsis and Zabius all have a subaculear tubercle which may be obsolete to moderately developed, but is always blunt conical. Fixed finger of the pedipalp chela with 9-10 slightly imbricated rows of denticles; Alayotityus also has 9-10, Zabius and Tityopsis have 1 1-12. Dentition on
FRANCKE ET AL.— NEW GENUS OF BUTHIDAE FROM MEXICO
225
Table 1. — Measurements in mm of Chaneke fogoso sp. nov. L = length, W = width.
|
Holotype |
Paratype |
Paratype |
Paratype |
||
|
male |
male |
female |
female |
||
|
Total |
L |
19.7 |
20.6 |
21.3 |
20.2 |
|
Carapace |
L |
2.8 |
2.9 |
3 |
2.9 |
|
W |
2.4 |
2.3 |
2.5 |
2.4 |
|
|
Mesosoma |
L |
6.5 |
6.7 |
7.3 |
7.3 |
|
Metasoma |
L |
10.4 |
II |
11 |
10 |
|
I |
L |
1.5 |
1.6 |
1.6 |
1.5 |
|
W |
1.7 |
1.7 |
1.7 |
1.6 |
|
|
II |
L |
1.9 |
2 |
2 |
1.8 |
|
W |
1.6 |
1.5 |
1.5 |
1.4 |
|
|
III |
L |
2 |
2.1 |
2.2 |
2 |
|
W |
1.5 |
1.5 |
1.5 |
1.3 |
|
|
IV |
L |
2.3 |
2.4 |
2.4 |
2.2 |
|
W |
1.5 |
1.5 |
1.4 |
1.3 |
|
|
V |
L |
2.7 |
2.9 |
2.8 |
2.5 |
|
W |
1.5 |
1.5 |
1.4 |
1.3 |
|
|
Telson |
L |
2.4 |
2.5 |
2.6 |
2.3 |
|
W |
1 |
1.1 |
1.1 |
1.1 |
|
|
Pedipalp |
L |
9.4 |
9.7 |
10.3 |
9.7 |
|
Femur |
L |
2.3 |
2.4 |
2.5 |
2.4 |
|
W |
0.8 |
0.9 |
0.9 |
0.9 |
|
|
Patella |
L |
2.7 |
2.7 |
3 |
2.8 |
|
W |
1.1 |
1.2 |
1.2 |
1.2 |
|
|
Chela |
L |
4.1 |
4.6 |
4.8 |
4.5 |
|
W |
1.5 |
1.6 |
1.3 |
1.3 |
the fingers of the pedipalp chela without supernumerary denticles flanking the primary rows (Figs. 9B, C).
Distribution. — Known only from the Mexican states of Guerrero and Oaxaca, along the southern Pacific Coast (Fig. 3).
Chaneke fogoso, sp. nov.
Figures 1-6, 8-11 Table 1
Type data. — MEXICO: Guerrero: Municipio de Copala: Holotype adult S, Microondas Fogos (approx. 15 km ESE Copala), 16° 33.992'N, 98° 53.301 'W, 103 m, 31 Aug 2008, U.V. detection, O.F. Francke, H. Montano, C. Santibahez & A. Valdez (CNAN T-0630). Paratypes: 19 adult <3, 1 subadult 3, 3 adult ?, 3 subadult ?, 2 juveniles, same data as holotype (1 3, 1 $ each at AMNH and BIOECO; remainder at CNAN T- 0631); 1 adult 3 (U.V.), 1 adult ? (sifting leaf litter), same locality, 6-7 July 2008, O.F. Francke, C. Santibanez & A. Quijano (CNAN T-0632); 1 subadult 3 (U.V.), same locality, 26 June 2007, O.F. Francke, L. Escalante, J. Ballesteros & H. Montano (CNAN T-0633).
Diagnosis. — Chaneke fogoso has 10 primary rows of denticles on both fixed and movable fingers of the pedipalp chela, whereas Ch. aliciae has only nine. Pectinal tooth count on males 9-1 1 (mode = 10), on females 8-9 (tied); C/;. fogoso lacks T Esh on the manus and x esb on the fixed finger of the pedipalp chela, whereas Ch. aliciae has x Esh and x esb present. In addition, Ch. fogoso is in general smaller and has a less robust metasoma than Ch. aliciae (Figs. 6, 7), but also possesses the smooth, whitish patch of sternite V remarkably larger and bulkier in adults of both sexes.
Table 2. — Tree statistics for phylogenetic analysis of 25 species in 10 New World buthid scorpion genera. Length, consistency index (Cl), retention index (RI), Fit and adjusted homoplasy (AH) of most parsimonious trees (MPTs) obtained by the analyses of the morphological under equal weighting (EW) and implied weighting (IW), with six concavity values (k).
|
MP |
L |
Cl |
RI |
FIT |
AH |
||
|
EW |
2 |
69 |
0.652 |
0.878 |
24.55 |
||
|
IW |
o O II |
2 |
69 |
0.652 |
0.878 |
29.76 |
0.24 |
|
IW |
O SO II |
2 |
69 |
0.652 |
0.878 |
29.61 |
0.39 |
|
IW |
o II |
2 |
69 |
0.652 |
0.878 |
29.24 |
0.76 |
|
IW |
k=10 |
2 |
69 |
0.652 |
0.878 |
27.91 |
2.09 |
|
IW |
k=3 |
3 |
70 |
0.643 |
0.872 |
24.6 |
5.4 |
|
IW |
k=l |
3 |
70 |
0.643 |
0.872 |
24.6 |
5.4 |
Etymology. — The specific name is a noun in apposition, “fogoso” in Spanish means “fiery”, “feisty” or “lit-on-fire”, befitting the generic name; in addition, it alludes to the type locality.
Description. — Holotype male (Figs. 6A, B): Coloration: Base color light yellow (straw-colored). Prosoma: carapace with dense, variegated fuscosity (Figs. 6A, C); venter pale yellow (Figs. 6B, D). Mesosoma: tergites I-VI with two complete, transverse fuscous bands — one on all of pre-tergite, the other on distal one-half of post-tergite; tergite VII with pre-tergite infuscate, and post-tergite with middle, posterior and lateral areas infuscate; ventrally pale yellow. Metasomal segments I-IV faintly, uniformly infuscate on ventromedian, posterior one-halves of ventrolateral and lateral inframedian, and distally on lateral supramedian intercarinal spaces; segment V and telson straw colored. Chelicerae not infuscate. Pedipalps with diffuse, uniform fuscosity, dorsally on tro- chanter, femur and patella; fingers on chela pale reddish brown, feebly infuscate. Legs infuscate on prolateral regions.
Carapace: Coarsely, densely granulose throughout (Fig. 8 A). Anterior margin bilobed, with shallow median notch; with four short, blunt-tipped setae. Three subequal ocelli on each side. Median eyes slightly anterior to one-half the carapace length. Two moderately strong, longitudinal, submedian carinae on posterior one-fifth. Ventrally with numerous reddish setae of various sizes, some pointed, some blunt.
Mesosoma: Tergites with pre-tergite densely, minutely granulose; anterior one-half of post-tergite sparsely granulose, shiny; posterior one-half densely, coarsely granulose, matte. One coarsely granulose median carinae present on distal one- half of post-tergites I-VI. Tergite VII paramedian and lateral carinae well-developed, coarsely granulose. Sternum subpen- tagonal (Figs. 6B, D); with deep indentation posteromedially; three pairs of setae. Genital opercula completely separated, with five and six setae respectively; genital papillae without sharp, pointed end. Pectinal basal piece wider than long, with shallow anteromedian notch; posterior margin straight (Fig. 8B). Pectinal tooth count 9-10. Sternites moderately granulose, with scattered reddish setae throughout; stigmata small, oval-elongate. Sternite III with two anterolateral depressions underneath the pectines (where these structures presumably fit when the animal is at rest). Sternite V with a conspicuous, circular, white, shiny patch medially along posterior margin (Fig. 6B). Sternite VII submedian carinae
226
THE JOURNAL OF ARACHNOLOGY
Figure 6. — Chaneke fogoso gen. nov. et sp. nov., habitus, dorsal aspect (A, C) and ventral aspect (B, D). A, B. Holotype S (CNAN); C, D. Paratype ? (CNAN). Scale bar = 5 mm.
FRANCKE ET AL.— NEW GENUS OF BUTHIDAE FROM MEXICO
227
Figure 7. — Chaneke aliciae (Armas & Mardn-Frias 1998), comb, nov., habitus, dorsal aspect (A, C) and ventral aspect (B, D). A, B. <3 (CNAN); C, D. $ (CNAN). Scale bar = 5 mm.
granulose, well-defined and reaching posterior margin; lateral carinae barely discernible as short row of five granules submedially, absent on basal and distal thirds.
Metasoma; Segments I-FV with dorsolateral, lateral supra- median, ventrolateral and ventral submedian carinae strong, crenulate; lateral inframedian carinae complete, crenulate on I-II, absent on III-IV; intercarinal spaces moderately granulose. Segment V (Fig. 9A) dorsolateral, ventrolateral and ventromedian carinae strong, granulose; lateral carinae
absent; intercarinal spaces densely, coarsely granulose. Telson globose; ventrally weakly to vestigially granulose; subaculear tubercle flat, crest-like, its width same as that of base of aculeus, ending in a small finger-like projection that points towards middle of aculeus (Fig. 9A).
Chelicera: Fixed finger with three dorsal teeth; on right side basal tooth is a bicusp, on left side a sharp monocusp; ventrally with a single small tooth at level of middle dorsal tooth. Movable finger with distal tines subequal; dorsally with
228
THE JOURNAL OF ARACHNOLOGY
Figure 8. — Cluineke fogoso gen. nov. et sp. nov., holotype 3 (CNAN). A. Carapace, dorsal aspect; B. Pectinosternal region. Scale bars = 0.5 mm.
a basal bicusp characteristic of the family; ventrally with two small teeth.
Pedipalp: Femur with prodorsal, retrodorsal, anteromedian and proventral carinae strong, granulose; intercarinal spaces moderately to densely granulose, with few clavate setae distally. Neobothriotaxia A alpha: r/j absent, /? and 4 petite (Fig. lOA). Tibia heptacarinate, all carinae strong, granulose; dorsal intercarinal spaces densely granulose, others moderate- ly to sparsely so, with scattered clavate setae throughout. Neobothriotaxia A: absent, no petite trichobothria
(Figs. IOC, D). Chela with nine carinae, smooth to feebly crenulate; intercarinal spaces with moderately dense, small granulation; with moderately dense, clavate setae throughout, including both fingers. Movable finger with 10 imbricated principal rows of granules, fianked by 1 1 inner and nine outer accessory granules (Fig. 9B), the apical subrow (excluded from counts) is composed by four granules located just basal to the terminal denticle. Fixed finger with 10 imbricated principal rows of granules, flanked by 1 1 inner and nine outer accessory granules (Fig. 9C). Neobothriotaxia A: lacking Ebj, Esh and esh (Figs. 1 1 A, B).
Legs: Tibial spurs absent on all legs; prolateral and retrolateral pedal spurs present on all legs. Patellae and tibiae with scattered clavate setae; tarsi with moderately dense, pointed setae.
Variability, — Pectinal tooth counts varied as follows: on males three combs with nine teeth (7.5%), 22 with 10 (55.0%)
and six with 1 1 (37.5%); on females six combs with eight teeth (50%) and six with nine (50%).
Variation, — Pedipalp finger dentition was analyzed on six males and six females (both right and left fingers checked for each specimen). The number of denticle rows on the fixed finger was 10 on the 24 fingers checked; the number of inner accessory granules was 10 on females (10 fingers with 10 granules, two fingers with 11) and 11 on males (two fingers with 10 granules and 10 fingers with 11 granules), and the number of outer accessory granules was 10 with no apparent sexual dimorphism (three fingers with nine granules and 21 fingers with 10). The number of denticle rows on the movable finger was 1 1 on the 24 fingers counted; the number of inner accessory granules was 1 1 on females (nine fingers with 1 1 granules and three fingers with 12) and 12 on males (12 out of 12), and the number of outer accessory granules was 11 with no apparent sexual dimorphism (20 fingers with 1 1 granules, four fingers [two male, two female] with 12 granules).
Distribution. — This species is only known from the type locality in the state of Guerrero (Fig. 3).
Remarks. — The locality where the new species was collected is a well-conserved, land-locked area; it is a small isolated hill (approx. 200 m high) along the coastal plains and has a microwave relay station on top. It is in private property, surrounded by pasture-land and scattered cultivation plots. The original vegetation on the plain and lower slopes is tropical deciduous scrub forest, whereas the upper reaches
FRANCKE ET AL.— NEW GENUS OF BUTHIDAE FROM MEXICO
229
Figure 9. — Chaneke fogoso gen. nov. et sp. nov.: holotype cJ (CNAN). A. Lateral aspect of distal portion of metasoma; B. Pedipalp chela movable finger showing dentition pattern; C. Pedipalp chela fixed finger showing dentition pattern. Scale bars = 0.5 mm.
Figure 10. — Chaneke fogoso gen. nov. et sp. nov.; holotype <3 (CNAN). A. Dorsal aspect of pedipalp femur, showing trichobothria (d2 missing); B. Frontal aspect of pedipalp femur; C. Dorsal aspect of pedipalp patella; D. Posterior aspect of pedipalp patella. Scale bars = 1 mm.
230
THE JOURNAL OF ARACHNOLOGY
Figure ! 1 . — Clumeke fogoso gen. nov. et sp. nov.: holotype <3 (CNAN). A. External aspect of pedipalp chela showing trichobothria; B. Ventral aspect of pedipalp manus. Scale bars = 1 mm.
receive more moisture and have a mixed tropical lowland forest component. The upper habitat contains numerous large boulders, and in protected places the leaf-litter can reach 0.3- 0.4 m in depth (Fig. 1). Most of the specimens were collected after abundant rains.
Chaneke aliciae (Armas & Martin-Frias 1998), comb. nov.
Figures 3-5, 7
Tityopsis aliciae Armas & Martin-Frias 1998:45-49; Santiba- nez-Lopez & Ponce-Saavedra 2009:321; Vidal-Acosta & Francke 2009:333-339.
Type data. — MEXICO: Oaxaccr. Municipio de Santo Domingo Tehuantepec: Holotype subadult $, [16.31°N, 95.23°W], 30 June 1938, no collector (CNAN-T0173); 1 adult ?, Tehuantepec, Cima street #61, under bricks [16.31°N, 95.23°W], 12 Jan 2006, no collector (INDRE); 1 adult d, alrededores de Colonia Emiliano Zapata, 16.32026°N, 95.27899°W, 80 m, R. Paredes, C. Santibahez, A. Valdez (CNAN); 1 adult ?, 2 subadult $, km 23.5 road Salina Cruz to La Ventosa, 16.39754°N, 95.10094°W, 20 m, C. Santibahez, R. Monjaraz, A. Valdez, M. Puentes (CNAN).
Diagnosis. — Chaneke aliciae has nine primary rows of denticles on both fixed and movable fingers of the pedipalp chela, whereas Ch. fogoso has ten. Pectinal tooth count on males 10-11, on females 8-9; Ch. aliciae bears x Esh on the manus and x esh on the fixed finger of the pedipalp chela, whereas Ch. fogo.so lacks x Esh and x esh. The sexual secondary dimorphism is slight (as usual for the other closely-related genera): adult males can be recognized by their
more distally incrassate pedipalp chelae and metasoma, smaller mesosoma (Pig. 7), presence of genital papillae, and slight but consistently higher pectinal tooth counts.
Distribution. — This species is only known from the Santo Domingo Tehuantepec area, in the state of Oaxaca (Fig. 3).
ACKNOWLEDGMENTS
We are grateful to the owners of the ranch surrounding Microondas Pogos for permission to camp and collect on repeated occasions on their property. We thank H. Montano, J. Ballesteros, A. Valdez, A. Quijano, R. Paredes, R. Monjaraz, M. Fuentes and L. Escalante for their efforts in the field. Diego Barrales assisted with the photography. Finally, the Associate Editor and two anonymous reviewers made valuable recom- mendations to improve this contribution. Collections were done under “Scientific Collector pennit” FAUT-0175, to OFF from the SEMARNAT, Mexico.
LITERATURE CITED
Acosta, L.E., D.M. Candido, E.H. Buckup & A.D. Brescovit. 2008. Description of Zahius gaiicho (Scorpiones, Buthidae), a new species from southern Brazil, with an update about the generic diagnosis. Journal of Arachnology 36:491-501.
Armas, L.F. de & E. Martin-Frias. 1998. Presencia del genero Tityopsis en Mexico y descripcion de una especie nueva (Scor- piones: Buthidae). Anales de la Escuela Nacional de Ciencias Biologicas, Mexico 43:45-49.
Bremer, K. 1994. Branch support and tree stability. Cladistics 10:295-304. Dimitrov, D., L. Lopardo, G. Giribet, M. Arnedo, F. Alvarez-Padilla & G. Hormiga. 2013. Tangled in a sparse spider web; Single origin of orb weavers and their spinning work unravelled by denser
FRANCKE ET AL.— NEW GENUS OF BUTHIDAE FROM MEXICO
231
taxonomic sampling. Proceedings of the Royal Society B 279:1341-1350.
Farris, J.S. 1982. Outgroups and parsimony. Systematic Zoology 31:328-334.
Fitch, W.M. 1971. Toward defining the course of evolution: Minimum change for a specific tree topology. Systematic Zoology 20:406-416.
Francke, O.F. 1977. Scorpions of the genus Diplocentrus from Oaxaca, Mexico. Journal of Arachnology 4:145-200.
Goloboff, P.A., J.S. Farris & K.C. Nixon. 2008. TNT, a free program for phylogenetic analysis. Cladistics 24:774-786.
Nixon, K.C. 2002. WinClada, Version 1.00.08. Computer software and documentation. Online at http://www.cladistics.com [Accessed on July 2009]
Nixon, K.C. & J.M. Carpenter. 1993. On outgroups. Cladistics 9:413^26.
Ove-Rein, J. 2014. The Scorpion Files. Trondheim: Norwegian University of Science and Technology. Online at http://www. ntnu.no/ub/scorpion-fiies/
Prendini, L., O.F. Francke & V. Vignoli. 2010. Troglomorphism, trichobothriotaxy and typhlochactid phylogeny (Scorpiones, Chactoidea): more evidence that troglobitism is not an evolution- ary dead-end. Cladistics 25:1-24.
Santibaiiez-Lopez, C.E. & J. Ponce-Saavedra. 2009. A new species of Centruroides (Scorpiones: Buthidae) from the northern mountain range of Oaxaca, Mexico. Revista Mexicana de Biodiversidad 80:321-331.
Santibanez-Lopez, C.E., O.F. Francke & L. Prendini. In Press. Phylogeny of the North American scorpion genus Diplocentrus Peters, 1861 (Scorpiones: Diplocentridae) based on morphology, nuclear and mitocondrial DNA. Arthropod Systematics and Phylogeny.
Stahnke, H.L. 1970. Scorpion nomenclature and mensuration. Entomological News 81:297-316.
Vachon, M. 1974. Etude des caracteres utilises pour classer les families et les genres de Scorpions (Arachnides). 1. La trichobo- thriotaxie en Arachnologie, Sigles trichobothriaux et types de trichobothriotaxie chez les Scorpions. Bulletin du Museum National d’Histoire Naturelle, Paris, (3), 140 (Zool. 104), mai-juin 1973:857-958. (Date on the cover 1973, published January 3i, 1974; see footnote on p. 958).
Vachon, M. 1975. Sur I’utilisation de la trichobothriotaxie de bras des pedipalpes des Scorpions (Arachnides) dans le classement des genres de la familla des Buthidae Simon. C. R. Academie des Sciences Paris, Ser. D 281:1597-1599.
Vidal-Acosta, V. & O.F. Francke. 2009. Redescripcion de Tityopsis aliciae Armas y Martin-Frias (Scorpiones, Buthidae). Revista Mexicana de Biodiversidad 80:333-339.
Watrous, L.E. & Q.D. Wheeler. 1981. The out-group comparison method of character analysis. Systematic Zoology 30:1-11.
Wilkinson, M. 1992. Ordered versus unordered characters. Cladistics 8:375-385.
Manuscript received 8 May 2013, revised August 11 2014.
Appendix 1. — Specimens examined and/or references consulted during the construction of the character matrix.
1. Ananteris platnicki Lourengo 1993. COSTA RICA: Provincia Puntarenas: Quepos: El Silencio: Sendero Las Cataratas, 50- 100 m, 6 Sept 2000, L. F. de Armas, C. Viquez, 1 <? (RTO: Sco- 0446). Peninsula de Osa: Puerto Jimenez: Rio Agujas: Estacion Agujas: Sendero Zamia, 300 m., 2-4 Oct 1997, A. Azofeifa, 1 ?
(RTO: Sco-0189). Provincia Liinou: Reserva Vegetal Hitoy Cerere: Valle de la Estrella, 4 March 1999, W. Arana, 1 $ (RTO: Sco-0190). Isla Uvita, May-July 2000, A. Berrocol, 1 ? (RTO: Sco-0191).
2. Alayotityus delacruzi Armas 1973. CUBA: Santiago de Cuba: Playa Siboney: Cueva de Los Majaes, 27 March 1998, R. Teruel, N. Navarro, 10 3, 3 9, 6 juv. topotypes (RTO). 18 May 2002, R. Teruel, M. Sobrino, 2 d, 4 9 topotypes (CNAN).
3. Alayotityus feti Teruel 2004. CUBA: Santiago de Cuba: La Socapa, 26 March 1999, R. Teruel, 1 3 holotype, 6 d, 8 9 paratypes (RTO).
4. Alayotityus granma Armas 1984. CUBA: Granma: Niqiiero: El Guafe, 2 km al norte de Cabo Cruz, 9-1 1 July 2000, R. Teruel,
L. Montano, Y. Cala, R. Escalona, 8 16 9, 3 juv. topotypes
(RTO).
5. Alayotityus juraguaensis Armas 1973. CUBA: Santiago de Cuba: Playa Juragua, 6-7 March 1992, R. Teruel, 1 d, 1 9, 8 juv. topotypes (RTO). Same data except 3 July 1992, R. Teruel, R. Ermus, 1 <3, 2 9 topotypes (RTO).
6. Alayotityus lapidicola Teruel 2002. CUBA: Santiago de Cuba: Tercer Frente: La Pimienta, 20 April 2000, R. Teruel, R. Vina, A. Fong, 1 3 holotype, 5 9 paratypes (RTO).
7. Alayotityus nanus Armas 1973. CUBA: Santiago de Cuba: Puerto Boniato, 9 March 2003, R. Teruel, Y. Perez, 2 3, 5 9 topotypes (BIOECO). Santiago de Cuba: 300 m N El Cobre, 9 Sept 2000, R. Teruel, Y. Perez, 2 3, 5 9 (CNAN).
8. Alayotityus pallidus Teruel 2002. CUBA: Santiago de Cuba: Julio A. Mella: La Cantera, II March 1999, R. Teruel, 1 3 holotype, 2 3, 1 9, 1 juv. paratypes (RTO). 26 Sept 2003, R. Teruel, L. F. de Armas, 6 3, 3 9, 8 juv. topotypes (RTO).
9. Alayotityus sierramaestrae Armas 1973. CUBA: Santiago de Cuba: Guama: Rio La Mula, 15 June 2003, R. Teruel, Y. Perez, 2 9 (CNAN). 12-21 June 2005, R. Teruel, K. Blanco, A. Pupo, 6 3, 8 9, 7 juv. (RTO)
10. Centruroides gracilis (Latreille 1804). CUBA: Santiago de Cuba: Santiago de Cuba city, 28 April 2000, R. Teruel, Y. Perez, 3 3, 3 9 (CNAN).
11. Centruroides exilicauda (Wood 1863). MEXICO: Baja Cali- fornia Sur: Loreto, 13 km W to San Javier, provisional dirt road, 25° 58.817'N, 111° 27.21 1'W, 26 June 2008 (H. Montano, E. Gonzalez). 17 3, 14 9 (CNAN).
12. Chaneke aliciae (Armas & Martin-Frias 1998). [see material studied above]
13. Chaneke fogoso Francke, Teruel & Santibaiiez-Lopez 2014. [see original description above].
14. Mesotityus vondangeli Gonzalez-Sponga 1981. VENEZUELA: Aragua Estate: Henry Pittier National Park: Rio Cata (± 100 m a.s.L), night search with UVL, upstream from the dam, 6 April 2006, F. J. M. Rojas-Runjaic, 2 3 (lES).
15. Microtityus ( Microtityus) r/c/cj/ Kjellesvig-Waering 1966. [see Kjellesvig-Waering, 1996].
16. Microtityus ( Parvabsoniis) jatimei Armas 1974. CUBA: Santiago de Cuba: Playa Siboney, 18 May 2002, R. Teruel,
M. Sobrino, 3 3, 3 9 (CNAN). CUBA: Santiago de Cuba: Playa Verraco, 4 May 2006, R. Teruel, F. Cala, 9 3, 6 9, 1 juv. (RTO).
17. Rhopalurus jimceus (Herbst 1800). CUBA: Camagiiey: Siba- nicii, 20 Feb 1996, R. Teruel, 2 3, 2 9, 10 juv. (CNAN). Same data except 2 Jan 1997, R. Teruel, A. Basulto, 6 3, 7 9, 5 juv. (RTO).
18. Tityopsis inaequalis (Armas 1974). CUBA: Pinar del Rio: San Cristobal: Mameyai, 16 Feb 1981, L. F. de Armas, 1 3 (RTO). CUBA: Pinar del Rio: Vinales: Hoyo de Fania, 6 Dec 1984, L. V. Moreno, J. Novo, 1 9 (RTO).
232
THE JOURNAL OF ARACHNOLOGY
19. Tityopsis uiexpectata (Moreno 1940). CUBA: Ciudad de La Habaiia: Bosque de La Habana. 8-20 Jan 2005, R. Teriiel, D. Ortiz, 1 d, 4 9, 2 juv. (RTO).
20. Tityiis hahiensis (Perty 1833). BRASIL: Sao Paulo: Sao Paulo, no date (no colector). 1 cJ, 3 9 (CNAN).
21. Tityus dathratiis C.L. Koch 1844. VENEZUELA: Bolivar Estate: Cedeno: Gtianiamo (6°05'N-66°02'W, 150 m a.s.l.), no further data, 4 3, 1 9 (RTO: Sco-0508).
22. Tityus coliiitihiaiius (Thorell 1876). COLOMBIA: Boyacd Department: Chiquinquira (2,550 ni a.s.l.), under rocks, in sandy soil, 3 March 2007, L. F. Garcia, 10 3, 9 9, 1 juv. (RTO: Sco-0372).
23. Zahius biraheni Mello-Leitao 1938. [see Acosta et al. 2008].
24. Zabiiis gauclio Acosta, Candido, Backup & Brescovit 2008 [see Acosta et al. 2008].
25. Zabius fiiseiis (Thorell 1876) ARGENTINA: Cordoba: La Cumbre, February 1997, L. Coronel, I 3 (RTO: Sco-0192). [see also Acosta et al. 2008].
Appendix 2. Distribution of 30 morphological characters (0-29) scored for a cladistic analysis of 25 species in 1 1 new world buthid scorpion genera with a trichobothrial pattern. Characters states are scored 0-5. ? (unknown). Refer to Appendix 1 for material examined and Appendix 3 for character descriptions.
Allan teris platnieki 0200100010
Mesotityus vondangeli 0101000010
Tityus hahiensis 0101000000
Tityus colunihianus 0101000010
Tityus clathratus 0101000010
Centruroides 0101000000
exilicauda
Centruroides graeilis Rhopalunis juneeiis A layotityus delacruzi Alayotityiis feti A layotityus grannui Alayotityiis
0101000000
0301000000
0002011000
0002011000
0002011000
0002011000
jiiragiiaensis Alayotityiis lapidlcola Alayotityiis nanus A layotityus pallidus Alayotityiis
0002011000
0002011000
0002011000
0002011000
sierraniaestrae
Clianeke alieiae Clianeke fogoso Microtityiis ( M. } rickyi
Microtityiis ( P. ) jaiiniei
Tityopsis inaequalis Tityopsis inexpectata Zahius birabeui Zahius gauclio Zahius fuscus
1112101100
1112101100
1102021001
1102011001
0102001010
0102001010
0002011000
0002011000
0002011000
1010000040
0011011054
0000000024
0011010024
0011010054
0000000011
0000000012
0000000001
1122111132
1122111132
1122111132
1122111132
1122111132
1122111132
1122111132
1122111132
111111105
1111111052
0031011042
0011011042
0133011133
0133011133
0111011134
7171011134
0111011134
0011111110
0001010010
1011011110
0011011110
0011011110
1111011110
1111111110
1111011110
0010020111
0010020101
0010020111
0010020111
0010020101
0010020101
0010020101
0010020111
21010010011
1010010001
0001121111
0000121111
0011121111
0011121111
1010121111
7010121111
1010121111
Appendix 3. — List of 30 morphological characters scored for 21
species of New World buthids with a trichobothrial pattern.
Prosonia
0. Carapace shape: trapezoidal (0), triangular (1).
1. Lateral ocelli: two pairs (0), three pairs (1), five pairs (2).
2. Lateral ocelli large, prominent, clearly visible in dorsal aspect (0), lateral ocelli small, dorsally covered by a crest, visible in frontal aspect (1).
3. Anterior margin: straight (0), V-notched (1), bilobed (2).
4. Carapace with distinct keels present (0), absent (1).
Mesosonia
5. Tergal carinae: one (0), three (1), five (2).
6. Distal granules on tergites: do not exceed posterior margin (0), do exceed posterior margin (1).
7. Males with genital papillae with a terminal fieshy, sharp, distinct point present (0), absent (1).
8. Females with basal intermediate lamella of pectines: normal
(0) , dilated ( 1 ).
9. Females with basal pectinal plate with posterior margin: normal (0), expanded ( 1 ).
10. Males with whitish patch on sternite III: absent (0), present (1).
1 1. Males with posteromedian area of sternite HI: level (0), raised and granular ( 1 ).
12. Males with whitish patches on sternite V: absent (0), one posteromedian, usually oval or heart-shaped ( 1 ), two, trans- verse and oval (2), three, one posteromedian heart-shaped and two smaller laterally (3).
13. Females with whitish patch on sternite V: absent (0), one posteromedian, usually oval or heart-shaped ( 1 ), two, conical and widely separated (2), three, one posteromedian heart- shaped and two smaller laterally (3).
14. Females with whitish patch on sternite III: absent (0), present
(1) .
15. Lateral carinae on sternites IV-VI: absent (0), present [two or four] (1).
16. Respiratory stigmata: long and narrow (0), oval to round (1).
Metasonia
17. Lateral carinae on segment V: absent (0), present (1).
18. Subaculear tubercle: absent (0), smooth spine (1), spinoid with granules (2), conical (3), crest-like, (4), trapezoidal, with two granules (5).
Pedipalps
19. Number of denticle rows on pedipalp fingers: eight (0), nine or ten (1), eleven or twelve (2), thirteen or more (3).
20. Males with basal lobe on movable finger: absent (0), present (1).
21. Supernumerary denticles on fingers: absent (0), present (1).
22. Terminal macrochaeta on fingers: absent (0), present (1).
23. Femoral i d2: absent (0), present (1).
24. Femoral t 13: petite (0), normal (1).
25. Femoral i 4: absent (0), petite (1), normal (2).
26. Patella i d2 : absent (0), present (1).
27. Chela t Eb3 : absent (0), present (1).
28. Fixed finger t esb: absent (0), present (1).
29. Throughout body, hollow macrochaetae with truncated apex: absent (0), present (1).
2014. The Journal of Arachnology 42:233-239
Description of Samx buxtoni (Gravely 1915) (Arachnida: Amblypygi: Charinidae) and a new case of
parthenogenesis in Amblypygi from Singapore
Michael Seiter' and Jonas WolfF: 'Group of Arthropod Ecology and Behavior, Division of Plant Protection,
Department of Crop Sciences, University of Natural Resources and Life Sciences, Peter Jordan StraBe 82, 1 190 Vienna, Austria. E-mail: michael.seiter@boku.ac.at; -Zoological Institute, Functional Morphology and Biomechanics, University of Kiel, Am Botanischen Garten 9, 24118 Kiel, Germany
Abstract. The type material of Samx buxtoni (Gravely 1915) cannot be located and has to be considered as lost. Therefore, a description compiled from a population in Singapore is provided, including morphological and taxonomical details presented for the first time. Comparisons with closely related species are supplied. Furthermore, we describe the occurrence of parthenogenesis in a population of S. buxtoni, representing the first case of asexual reproduction in a member of the genus Samx Simon 1892.
Keywords: Whip spiders, asexual reproduction, Southeast Asia
Amblypygi, popularly called whip spiders, are characterized by their dorso-ventrally flattened body and strong, raptorial pedipalps armed with spines. The first pair of legs is extremely elongated and antenniform. These body appendages serve important multisensory functions and play important roles during mating, hunting, and antagonistic behavior (Weygoldt 2000). According to Prendini (2011), recent Amblypygi currently include five families, 17 genera and 161 species. Harvey (2013) mentioned 186 species and at the last count (Seiter & Horweg 2013), the group expanded by two newly described species of the genus Heterophrynus Pocock 1894 (Giupponi & Kury 2013) and one species of the genus Phrynus Lamarck 1801 (Armas et al. 2013), elevating the number to 189 species. In Southeast Asia, the whip spider fauna includes four families (Charinidae, Charontidae, Phrynidae and Phrynichi- dae), with Sarax Simon 1892 (Charinidae) being the most diverse genus. Its 17 species are distributed in continental and insular Southeast Asia and Oceania with Papua New Guinea as the most eastern occurrence and India at the most western (Harvey 2003, 2013; Giupponi & Miranda 2012). Harvey (2003) further listed Sarax mediterraneus Delle Cave 1986 from Greece which is still included in Harvey (2013) and would, therefore, represent the most western distributed species of the genus Sarax Simon 1892. However, Weygoldt (2005) wrote about this doubtful record “[...] Therefore 1 suppose that somebody confused specimens and labels and erroneously replaced three Charinus specimens by three Sarax specimens (Weygoldt 2005: 12-13). Since then, nobody discovered the error and correctly identified these specific specimens, which are held in the SMF (Senckenberg-Museum, Frankfurt am Main, Germany). If S. mediterraneus is a valid species, the genus would contain 18 species.
Parthenogenesis in Amblypygi is reported from two species, both belonging to the family Charinidae: Charinus acosta (Quintero 1893) and Charinus ioanniticus (Kritscher 1959) (Armas 2000, 2005; Weygoldt 2005, 2007). Charinus acosta occurs in Cuba and is reported from, different places through the country (Teruel 2011). Charinus ioanniticus is distributed around parts of the eastern border of the Mediterranean and represents the sole amblypygid occurring in Europe, if the reported occurrence of S. mediterraneus is truly due to a
misidentification. The European populations of C. ioanniticus are located on the Greek islands of Rhodes, living in subterranean passages of the ancient city of Rhodes, and Kos (Kritscher 1959; Weygoldt 2005). The population on Rhodes is an all-female population that reproduces parthe- nogenetically (Weygoldt 2007). Charinus ioanniticus has also been reported from Turkey (Kovafik & Vlasta 1996; Weygoldt 2005; Seyyar & Demir 2007), Israel (Rosin & Shulov 1960) and Egypt (El-Hennawy 2002), however all these reported populations reproduce sexually and males are present.
Sarax buxtoni (Gravely 1915) was first described under the name Phrynichosarax buxtoni with the type locality in Kubang Tiga cave, Perlis, Malaysia. Weygoldt (2000) considered Phrynichosarax to be a junior synonym of Sarax and transferred P. buxtoni to Sarax. Harvey (2003) transferred all of the remaining taxa from Phrynichosarax to Sarax. The diagnostic characters of the family Charinidae and the genus Sarax are discussed and revised in Rahmadi et al. (2010). In Singapore, two species of the genus Sarax occur: S. buxtoni and Sarax singaporae Gravely 1911, the latter distributed in Malaysia and Singapore (the type locality is the Singapore Botanic Garden) (Harvey 2003). Weygoldt (2002) described the spenn transfer and the mating behavior of S. buxtoni collected in Singapore, but without clear description of the locality (“outskirts of Singapore” mentioned as the collection site). Furthermore, the author used the moderate description and poor figures of Gravely (191 1, 1915) to identify the species. The type material of this study could not be found, and the former identification is unreliable because of the incomplete description of S. buxtoni by Gravely (1911, 1915). Considering the incorrectly identified material of Weygoldt’s study about the sexual reproduction of this species and our data about asexual reproduction in this species, here we provide (i) a detailed description of Sarax buxtoni from Singapore and (ii) a report of the first case of parthenogenesis in a Sarax species, which is the first known case of asexually reproducing amblypygids in Southeast Asia.
METHODS
Specimens of Sarax buxtoni were collected in Singapore, North West District, near Turf Club at 1° 19' 29.47"N, 103° 47' 25.97"E in a small park within the city. The specimens were found under an artificial stone cairn next to a small runlet.
233
THE JOURNAL OF ARACHNOLOGY
234
Figure 1. — Photographs of living adult Sarax individuals in standard plastic terraria. A: S. buxtoni, female. B; S. singaporae, female right, male left (NHMW 21893). Note the sexual dimorphism in the length of the pedipalps.
This was the only stony place in an area of one square kilometer. Here, within half of a square meter, many female specimens were found living next to each other, sitting on the underside of stones in a very humid environment, protected from the sun and rain by the vegetation. Sarax singaporae was found in similar microhabitats in Singapore, South West District, on the outskirts of Singapore, Jurong Bird Park at 1° 19' 7.34"N, 103° 42' 23.19"E. Nevertheless, this species was not found in high densities like S. buxtoni and was found to live mainly under stones and also in the leaf litter.
In the laboratory, we reared both species in plastic terraria of different sizes using standard methods. The enclosures contained a 2 cm deep layer of soil and pieces of bark in which the specimens could hide. Food consisted of cricket nymphs, Acheta domestica (Linnaeus 1758) and fruit flies, Drosophila melanogaster Meigen 1830. We kept all individuals under the same conditions (T = 26- 27°C; RH = 65-75%) and fed them at the same intervals every seven days. Offspring were separated just after leaving the backs of the females and were raised under the same conditions as adults. All dead individuals were stored in 70% ethyl alcohol. Specimens were studied, measured and photographed under a stereomicro- scope (Leica M205A) equipped with a Leica DFC420 camera, and digital images were processed using Adobe Photoshop 8.0.
The specimens were identified using the key and description of Gravely (1911, 1915) and compared with the voucher material from Weygoldt (2002). Nomenclature of the pedi- palpal spines follows Quintero (1983a), modified according to Shultz (1990): pedipalps are divided into trochanter, femur, patella, tibia and tarsus (distitarsus+pretarsus or claw).
Abbreviations. — NHMW = Natural History Museum Vienna, SMF = Senckenberg Museum Frankfurt, SMNS = Staatliches Museum fiir Naturkunde Stuttgart, leg. = legit (collected), det. = determinavit (determined), syn = synony- mized, d = male / ? = female.
Material examined. — Sarax buxtoni: Holotype of Sarax hatuensis Roewer 1962: Malaysia: 3 ?, 6 juveniles, Selangor,
Batu caves (in different parts of the cave), 1959/60, leg. H.E. McClure (SMF 9913906 - RII/13906/51 - 68). Republic of Singapore: 4 $ adult (wild caught), 1 $ juvenile (wild caught), Singapore, North West District, near Turf Club, 1° 19' 29.47"N, 103° 47' 25.97"E, 14 September 2010, leg. and det. M. Seiter (NHMW 21891);! ? adult (captive bred), 3 9 juvenile (captive bred), same data (NHMW 21892).
Sarax singaporae: Republic of Singapore: 1 d adult (wild caught), Singapore, South West District, outskirts of Singa- pore, near Jurong Bird Park, 1° 19' 7.34"N, 103° 42' 23.19"E, 14 September 2010, leg. and det. M. Seiter (NHMW 21893); 2 9 adult, 1 d adult (wild caught), same data except 2009, leg. S. Huber, det. M. Seiter (NHMW 21894); 3 9 adult, 2 d adult, 2 juveniles (wild caught), same data except 27 June 1992, leg. S. Huber, det. M. Seiter (SMNS).
SYSTEMATICS
Family Charinidae Quintero 1986 Genus Sarax Simon 1892 Sarax buxtoni (Gravely 1915)
(Figs. lA, 2-3)
Phrynichosarax buxtoni Gravdy 1915: 439-440, Fig. 4; Mello- Leitao 1931: 52 (as Phrynicosarax [sic] buxtoni); Speijer 1937: 173; Weygoldt 1994: 244.
Sarax batiiensis Roewer 1962: 519-520, Figs. 3a-b (syn. by Kraus 1970: 178).
Sarax buxtoni (Gravely): Harvey 2003: 8.
Diagnosis. — Sarax buxtoni can be distinguished from the closest geographical and morphological related species Sarax singaporae by the following characters: (i) chelicera: dorsum with five fine lateral setae in S. singaporae and none in S. buxtoni (Figs. 21, L); (ii) moveable hand on the chelicera: in S. singaporae with three highly cuspid teeth not equal in size, instead of equal size and rounded (Figs. 21, L); (iii) sternum
SEITER & WOLFF— PARTHENOGENESIS IN SAHAX BUXTONI
235
Figure 2. — A-D, H, I, J: Sarax buxtoni, female; E-G, K, L, M: Sarax singaporae (F, G, L male; K, M female). A: habitus, dorsal. B, F: pedipalp, dorsal. C, G: pedipalp, ventral; dorsal spines of femur and patella numbered, tr: trochanter; fe: femur; pa: patella; ti: ibia; ta: tarsus. D, E: Basitibia and distitibia of walking leg IV, dorsal; trichobothria marked; basitibia (bt = basitibial), distitibia (bf: basofrontal; be: basocaudal; sbf: subbasofrontal; scl-x: series caudal and trichobothria, sfl-x: series frontal and trichobothria). H, K: prosoma, ventral; sternae numbered in H. I, L: chelicera. J, M: pedipalp, distal parts, prolateral. Arrowheads indicate diagnostic characters in 5. singaporae, ti: tibia; dta: distitarsus; pta: pretarsus (claw). Arrowheads indicate diagnostic characters; scale bar: A-C, F, G: 1 mm, D, E, H, I: 0.5 mm.
236
THE JOURNAL OF ARACHNOLOGY
Figure 3. — Images of the distal pedipalp in Sai ax hiixtoni, adult female. Scale bars; I mm. A: An individual with normal spination on the right pedipalp tibia and distitarsus (SMF 9913906 - RII/13906/51 - 68). B: Another individual with an anomaly on the right pedipalp, indicated by arrow.
ventrally: with three visible sternites (second and third one rounded with apical paired setae) in S. siugaporae instead of four (Figs. 2H, K); (iv) pedipalp tibia spination on the antero dorsal margin: proximal spine only 1/3 longer than distal one in S. siugaporae, and without clear shared basin (Figs. 2J, M); and (v) pedipalp tarsus spination on the antero dorsal margin: about equal in size in S. siugaporae instead of the proximal one more than half of the length of the distal one (Figs. 2J, M).
Description of adult female (from Singapore). — Coloratiou ( iu alcohol): Chelicerae, pedipalps and carapace yellowish. Legs light colored (Fig. 2D); iu life: Pedipalps and carapace light reddish. Opisthosoma light brown with light lines. Legs light brown to reddish.
Carapace (Figs. lA, 2A).' Carapace ratio width to length about 2:1.4; surface finely granulated without setiferous tubercles; median sulcus present with three sulci laterally on each half of the carapace reaching to the edge of the flange; fiange wide and bend upward; anterior margin rounded, with six fine large frontal setae and several small ones. Median eyes without setae, tubercle black, arranged more or less in an oval form with prominent fovea; eyes facing antero-laterally.
Figure 4. — Sarux siugaporae (SMNS): adult female, pedipalp distitarsus. Arrow indicates diagnostic character, illustrating the typical spination. Scale bar: 1 mm.
Lateral eyes close to the lateral margin of carapace, distance between lateral eyes about diameter of lateral eye, normal pigmentation. Frontal process triangular, visible from above.
Prosouial steruiiui (Fig. 2H).- First sternite (tritosternum) elongated with paired apical, median and strong basal setae; second sternite less elongated but more than the following ones, with paired apical setae and one median seta; third sternite rounded and flattened with paired apical setae; fourth sternite (metasternum) visible with 1 seta in the middle.
Opisthosoma (Figs. lA, 2A).- Light brown, each tergite with a marginal yellow line, light-brown spots on either side of middle line.
Chelicera (Fig. 21).' Dorsum smooth with one fine frontal seta. Basal segment with four teeth. Lowennost tooth largest, and uppennost tooth is bicuspid, with upper cusp larger than lower one. Outer surface with small blunt tooth opposite bicuspid tooth; moveable hand with three teeth about equal in size.
Pedipalp: short and stout. Trochanter (Figs. 2B, C) with several small setiferous tubercles on antero-dorsal margin, one spine and nine setiferous tubercles ventrally; ventral anterior apophysis equipped with several prominent setiferous tubercles. Femur (Fig. 2B, C) with four major spines antero-dorsally (length F3 > FI > F2 > F4), one minor spine between F2-F3, one minor spine between F3-F4, several setiferous tubercles and small tubercles; femur with four major antero-ventral spines (length FI > FII > Fill > FIV), small tubercles present. Patella (Fig. 2B, C), antero-dorsal face with four major spines (length PI > P2 > P3 > P4), with two minor spines, several setiferous tubercles and small tubercles; patella with three major spines (length PI > PII > Pill > PIV), several setiferous tubercles and small tubercles. Tarsus (Fig. 2J) with two major spines on antero-dorsal margin, length of proximal spine more than half length of distal one, one minor spine proximally, several setiferous tubercles and small tubercles; antero-dorsal margin with one major spine, several setiferous tubercles and small tubercles; distitarsus (dta) and claw (pta) divided, with two denticles on antero-dorsal margin, proximal denticle more than half length of distal one, distal one more curved towards the base as the proximal one; cleaning organ ventrally with around 30 modified hairs, several blunt setae on inner surface of tarsus, apotele present.
Legs: Tibiae II and III 4-segmented; basitibia IV 3- segmented; fourth segment with ht close to distal margin, he in middle of /^/’and .y/7/’(Fig. 2D), pulvilli present.
SEITER & WOLFF— PARTHENOGENESIS IN SARAX BUXTONl
237
Table 1. — Reproductive events, dated, of consecutively numbered, wild-caught, female Sarax huxtoni and, in the cases of #2/1 and #2/2, captive-born female progeny of #2. Shaded entries indicate hatches of individuals from brood sacs produced after the parent had molted. Individuals #5-#9 produced brood sacs but it cannot be guaranteed that these individuals had not been previously inseminated. Most of the captive-hatched offspring died several days after molting, but two of them ultimately produced progeny without first being inseminated (#2/1 and # 2/2). E = brood sac visible; M = molted; H = hatched; iiD = no data available.
|
Female ID |
Sequence of events |
||||
|
#1 |
E 09.12.2011 |
M 24.03.2011 |
E 02.06.2011 |
H |
24.07.2011 |
|
#2 |
E 09.12.2011 |
H 22.01.2011 |
|||
|
#2/1 |
M 16.04.2011 |
M 16.07.2011 |
iiD |
H |
03.01.2014 |
|
#2/2 |
M 22.04.2011 |
M 30.07.2011 |
nD |
H |
12.12.2013 |
|
#3 |
M 02.01.2011 |
E 03.04.2011 |
H 25.05.2011 |
||
|
#4 |
E 29.10.2010 |
||||
|
#5 |
E 05.11.2010 |
H 06.01.2011 |
E 04.03.2011 |
||
|
#6 |
E 13.11.2010 |
||||
|
#7 |
E 19.11.2010 |
H 12.01.2011 |
|||
|
#8 |
E 17.11.2010 |
||||
|
#9 |
E 09.12.2010 |
Genitalia: Covered ventrally with genital operculum slightly concave apically, paired with two tubes projecting medially.
Measurements. — Largest female (n=J): Body length 7.29 mm. Carapace length: 2.78 mm, width: 4.07 mm. Median eyes to anterior margin of carapace 0.18 mm. Distance between lateral eyes 2.17 mm. Pedipalps: femur 2.49 mm, patella 2.58 mm, basitarsus 1.28 mm, distitarsus and pretarsus (claw) 1.71 mm.
Remarks. — The largest specimen of the nine specimens of S. buxtoni from Batu Cave (SMF 9913906 - RII/1 3906/5 1-68) has a notable anomaly. The pedipalp spination has been used extensively for systematic research and is an important character. Therefore the special spination of the right tarsus should be mentioned (Fig. 3B). Usually S. buxtoni has two spines on each distitarsus: large and conspicuous, the distal one about twice as long as the proximal one, the distal one is more curved near its base than is the proximal one (Fig. 3A). This especially large female bears three spines on the right pedipalp finger instead of two. The distal spines are about twice as long as the proximal one and the intermediary spine is one fifth smaller than the proximal one (length Till > I > 11). All three spines are equally curved. The rest of the spination is similar to the Singapore all-female population described here.
Parthenogenesis. — Nine adult females were used for this study. All of them produced at least one brood sac but only three of them can be guaranteed not to have been inseminated prior to brood sac production (Table 1). However, the possibility that only females were selectively caught is very low and can be disregarded. Three of the wild caught females molted and then produced a fertile brood. Of the hatching praenymphs (Table 1: #1, #2, #3), two individuals reached adulthood and reproduced independently, completely isolated from other individuals since birth. It should be mentioned, that several brood sacs were dropped and eaten by the females over time. Many of the praenymphs died during the first days, or did not eat Drosophila or small cricket nymphs.
DISCUSSION
The following discussion is subdivided into the three major parts of this paper.
Description. — Gravely (1911) reported the discovery of a new subspecies of Sarax sarawakensis: S. s. singaporae, from
Singapore. Later Gravely (1915) elevated this taxon to species rank under the generic name Phrynichosarax singaporae. In the same paper, based on two individuals (one adult female, one immature), Gravely (1915) described a new species, Phrynichosarax huxtoni, with the type locality in Kubang Tiga cave, Peiiis, Malaysia. The original description is rather basic with a poor figure of the distitarsus spination intended to distinguish it from other species. For the description of S. huxtoni, we wanted to guarantee the validity and acceptance of the specimen used here. However, since the type specimen cannot be located, we decided to provide a detailed description. As the type locality is located in mainland Malaysia, we have limited our description to our specimen from Singapore. Here, we present for the first time a complete description of S. buxtoni with a demonstration of basic differences from the closely related S. singaporae.
Parthenogenesis. — Parthenogenesis is well known among arachnids, including: mites (Acari), harvestmen (Opiliones), true spiders (Araneae: Araneomorpliae), pseudoscorpions (Pseudoscorpiones) and scorpions (Scorpiones). However, so far, parthenogenesis in whip spiders has only been reported in two species: Charinus acosta and C. ioanniticus (Armas 2000; Weygoldt 2007). It is reported that during molting whip spiders lose all stored spermatozoa (Weygoldt 1999). Yet to insure that sperm storage during molting events can be ruled out, we raised S. huxtoni specimens for two generations isolated from one another. Based on the observation of newly collected female specimens raised in captivity for two generations, we found that S. buxtoni is capable of partheno- genetic reproduction. The description of sexual reproduction in S. singaporae [misidentified by Weygoldt (2002) as S. buxtoni\ from Singapore is now established. We argue that the specimens used by Weygoldt (2002) were wrongly identified based on our diagnosis above (Fig. 4). So the former described sexual behavior in this study belongs to S. singaporae and not S. buxtoni. Thus there is no male known from S. huxtoni populations because the type material cannot be found and is unavailable for study. However, our data do not allow us to determine whether this population is facultatively or obligately reproducing asexually. The type material consisted of two specimens: one adult female and one immature specimen not sexed. This sample size is rather low, though we cannot say if
238
THE JOURNAL OF ARACHNOLOGY
the type locality is also a parthenogenetic population or not. Nevertheless, it could be possible that the population described here is facultatively reproducing asexually with a low prevalence or absence of males. Because of the location of the presumed all-female population in a small park, com- pletely isolated by the city and concrete roads, a possible restriction to parthenogenetic reproduction could be compa- rable to the “insular parthenogenesis” described by Cuellar (1977, 1994).
Testing if females from this population can reproduce with males from other populations would verify if these females are obligately parthenogenetic or not. Conversely, it would be interesting to check if isolated females of other S. buxtoni populations, in which both sexes occur, are able to give birth without insemination to determine if facultative parthenogen- esis is a common trait of S. buxtoni. Of interest is the fact that many of the praenymphs died during the first few days after emergence. We can argue that it is usually very tricky to raise and breed such small species over several generations, so this case is unlikely to be associated directly with possible deficiency caused by all-female brood resulted from non- fertilized eggs (as it is usual for thelytokous parthenogenesis).
Anomaly. — A similar case of asymmetrical spine transfor- mation in the genus Sarax was yet unknown and, therefore, can be considered as very uncommon. Only a few asymmetries and anomalies are documented in recent literature, e.g. Paraphrynus aztecus (Pocock 1894) (as P. azteca [sic]) has bifid spines (Quintero 1983b). Here an adult male from Oaxaca, Mexico exhibited a transformation of spines III and V of the right pedipalp patella into bifid apophyses. In contrast the left pedipalp showed normal spination. Rowland (1973) reported an unidentified Paraphrynus Moreno 1940 species from Mexico with different length of spines on the pedipalp. Another case was documented by Baptista & Giupponi (2002) where asymmetry in the number of pseudo- articles of the basitibia in Charinus troglobius Baptista & Giupponi 2002 (four in general, but five in the right leg of two males) occurred. Armas & Gonzalez (2001) showed different examples of anomalies in the pedipalps of Phrynus eucharis Armas & Gonzalez 2001, P. hispaniolae Armas & Gonzalez 2001 and P. marginemaculatiis C.L. Koch 1840 from the Dominican Republic. The first author (MS) observed a Paraphrynus species, most likely P. mexicanus (Biliniek 1867) from Mexico, with bifid spines similar to the documented single P. aztecus specimen. Nevertheless, the anomaly observed in the S. buxtoni specimen is very uncommon and even deviates from the basic definition of the genus Sarax: pedipalp tibia with two spines, the distal one larger than the proximal one (Fig. 3B).
ACKNOWLEDGMENTS
First, we are greatly indebted to Rolando Teruel (BIOECO, Cuba) for his kind continuous support. We also thank Siegfried Huber (Oberuhldingen, Germany) and Peter Wey- goldt (Freiburg, Germany) for their lifelong contribution on whip spiders and their support whenever we ask for it. Stanislav Gorb (University of Kiel, Germany) is acknowl- edged for giving us access to microscopy devices. Further, we thank Frederic Schramm (Marburg, Germany) and an anonymous reviewer for their detailed peer-review.
LITERATURE CITED
Armas, L.F. de. 2000. Parthenogenesis in Amblypygi (Arachnida). Avicennia 12/13:133-134.
Armas, L.F. de. 2005. Notas sobra la biologi'a reproductiva del amblipigido partenogenetico Charinus acosta (Quintero, 1983) (Amblypygi: Charinidae). Boletin de la Sociedad Entomologica Aragonesa 36:271-273.
Armas, L.F. de. & A.P. Gonzalez. 2001. Los amblipigos de Republica Dominicana (Arachnida: Amblypygi). Revista Iberica de Aracno- logia 3:47-66.
Armas, L.F. de., C. Viquez & R.E. Trujillo. 2013. Nueva especie de Phrynus Lamarck, 1801 (Amblypygi: Phrynidae) de Guatemala y Honduras. Revista Iberica de Aracnologia 23:25-31.
Baptista, R.L.C. & A.P. Giupponi. 2002. A new troglomorphic Charinus from Brazil (Arachnida: Amblypygi: Charinidae). Revista Iberica de Aracnologia 6:105-110.
Cuellar, O. 1977. Animal parthenogenesis. Science 197:837-843.
Cuellar, O. 1994. Biogeography of parthenogenetic animals. Biogeo- graphica 70:1-13.
El-Hennawy, H.K. 2002. The first record of Amblypygi from Egypt. Journal of Arachnology 30:452M53.
Giupponi, A.P. & A. Kury. 2013. Two new species of Heterophrynus Pocock, 1894 from Colombia with distribution notes and a new synonymy (Arachnida: Amblypygi: Phrynidae). Zootaxa 3647: 329-342.
Giupponi, A.P. & G.S. Miranda. 2012. A new species of Sarax Simon, 1892 from the Philippines (Arachnida: Amblypygi: Charinidae). Anais da Academia Brasileira de Ciencias 84: 165-173.
Gravely, F.H. 1911. Notes on Pedipalpi in the collection of the Indian Museum. 1. New Pedipalpi from Ceylon. Records of the Indian Museum 6:33-36.
Gravely, F.H. 1915. A revision of the Oriental subfamilies of Tarantulidae (order Pedipalpi). Records of the Indian Museum 11:433-455.
Harvey, M.S. 2003. Catalogue of the smaller arachnid orders of the world: Amblypygi, Uropygi, Schizomida, Palpigradi, Ricinulei and Solifugae. CSIRO Publishing Huntingdon, Collingwood, Victoria, Australia.
Harvey, M.S. 2013. Whip spiders of the World, version 1.0. Western Australian Museum, Perth. Online at http://museum.wa.gov.au/ catalogues-beta/whip-spiders [accessed 06 March 2014],
Kovarik, F. & D. Vlasta. 1996. First record of Amblypygi (Charinidae: Charinus ioanniticus) from Turkey. Klapalekiana 32:57-58.
Kraus, O. 1970. Genitalmorphologie und Systematik der Amblypygi (Arachnida). Bulletin du Museum National d’Histoire Naturelle, Paris 41:176-180.
Kritscher, E. 1959. Ergebnisse der von Dr. O. Paget und Dr. E. Kritscher auf Rhodes durchgefuhrten zoologischen Exkursionen, II Pedipalpi (Amblypygi). Annalen des Naturhistorischen Muse- ums Wien 63:453M57.
Mello-Leitao, C. 1931. Pedipalpos do Brasil e algumas notas sobre a ordem. Archives do Museu Nacional 33:7-72.
Prendini, L. 2011. Order Amblypygi Thorell, 1883. In Animal Biodiversity: an Outline of Higher-level Classification and Survey of Taxonomic Richness. (Z.-Q. Zhang, ed.). Zootaxa 3148:154.
Quintero, D. Jr. 1983a. Revision of the amblypygid spiders of Cuba and their relationships with the Caribbean and continental American amblypygid fauna. Studies on the Fauna of Curasao and other Caribbean Islands 65:1-54.
Quintero, D. Jr. 1983b. Bifid spines in Paraphrynus azteca (Pocock) (Amblypygi: Phrynidae). Journal of Arachnology 11:99-100.
Rahmadi, C., M.S. Harvey & J. Kojinia. 2010. Whip spiders of the genus Sarax Simon, 1892 (Amblypygi: Charinidae) from Borneo Island. Zootaxa 2612:1-21.
SEITER & WOLFF^PARTHENOGENESIS IN SAMAY BUXTONI
239
Roewer, C.F. 1962. Einige Arachniden aus den Batu Caves in Malaya. Pacific Insects 4:517-520.
Rosin, R. & A. Shulov. 1960. Representatives of the order Amblypygi (Arachnida) found in Israel. Bulletin of the Research Council of Israel 9B: 167-168.
Rowland, J.M. 1973. Two new troglobitic Amblypygid of the genus Tarantula from Mexican Caves (Arachnida). Bulletin of the Association for Mexican Cave Studies 5:123-128.
Seiter, M. & C. Horweg. 2013. The whip spiders collection (Arachnida, Amblypygi) held in the Natural History Museum Vienna, Austria. Arachnologische Mitteilungen 46:47-53.
Seyyar, O. & H. Demir. 2007. A new locality for Charinus ioanniticus (Kritscher, 1959) (Amblypygi: Charinidae) in Turkey. Serket 10: 109-111.
Shultz, J.W. 1990. Evolutionary morphology and phylogeny of Arachnida. Cladistics 6:1-38.
Speijer, E.A.M. 1937. A collection of pedipalps from the Raffles Museum. Bulletin of the Raffles Museum 13:171-175.
Teruel, R. 2011. Nuevos registros de Charinus acosta (Quintero, 1983) en Cuba (Amblypygi: Charinidae). Boletin de la Sociedad Entomologica Aragonesa 49:345-346.
Weygoldt, P. 1994. Amblypygi. Pp. 241-247. In Encyclopaedia Biospeologica. (C. Juberthie & V. Decu, eds.). Societe de Biospeologie: Moulis and Bucarest.
Weygoldt, P. 1999. Spermatophores and evolution of female genitalia in whip spiders (Chelicerata, Amblypygi). Journal of Arachnology 27:103-116.
Weygoldt, P. 2000. Whip Spiders: Their Biology, Morphology and Systematics. Apollo Books, Sternstrup.
Weygoldt, P. 2002. Sperm transfer and spermatophore morphology of the whip spiders Sarax buxtoni, S. brachydactylus (Charinidae), Charon cf. grayi, and Stygophrynus brevispina nov. spec. (Charonti- dae) (Chelicerata, Amblypygi). Zoologischer Anzeiger 241:131-148.
Weygoldt, P. 2005. Biogeography, systematic position, and repro- duction of Charinus ioanniticus (Kritscher 1959), with the description of a new species from Pakistan (Chelicerata, Ambly- pygi, Charinidae). Senckenbergiana Biologica 85:43-56.
Weygoldt, P. 2007. Parthenogenesis and reproduction in Charinus ioanniticus (Kritscher, 1959) (Chelicerate, A^mblypygi, Charinidae). Bulletin of the British Arachnological Society 14:81-84.
Manuscript received 7 March 2014, revised II August 2014.
2014. The Journal of Arachnology 42:240-247
The new spider genus Arctenus^ an afrotropkal representative of the Calocteninae (Araneae: Ctenidae)
Daniele Polotow' and Rudy Jocque-: 'Bill and Maria Peck Research Fellow, Arachnology, California Academy of Sciences, San Francisco, CA 94118, USA. E-mail: danielepolotow@gmail.com; -Royal Museum for Central Africa, Tervuren, Belgium
Abstract. Arctenus gen. nov. is proposed to include the type species A. taitensis sp. nov. from the Taita Hills in Kenya.
This ctenid species appears to be the first representative of the Calocteninae in the African continent. Results of a parsimony analysis of morphological and behavioral characters indicated that the new species cannot be placed in any known genus and therefore validated the creation of the new genus whose autapomorphies are considered hypotheses for the genus synapomorphies. The phylogenetic relationships of the new genus are discussed and a distribution map of the unique species is presented.
Keywords: Kenya, systematics, Taita Hills, taxonomy, cladistic analysis, phylogenetic analysis
The family Ctenidae Keyserling 1977 is composed of small to large sized spiders (total body length of 4-40 mm), which do not build a snare web to catch prey. They are wandering and active predators, usually found in the litter layer, on tree trunks and in lower vegetation. Most of them are nocturnal, hiding during the day in the litter or in small cracks in the soil or on tree trunks. To date, the family comprises more than 480 described species in 40 genera (Platnick 2014) and are distributed mostly in tropical and temperate forests all over the world. Ctenidae can be diagnosed by the ocular arrangement 2-4-2 (Silva 2003).
The Afrotropical region holds 132 Ctenidae species, distrib- uted in ten genera: Africacterms Hyatt 1954, Anahita Karsch 1879, Apolania Simon 1898, Ctenus Walckenaer, 1805, Peta- loctenus Jocque & Steyn 1997, Thoriosa Simon 1910, Trogloc- tenus Lessert 1935, Viridasius Simon 1889 and Viilsor Simon 1889 (Platnick 2014). Ctenus contains the largest number of species (more than 70). The recent redescription of the Neotropical type species, Ctenus dubius Walckenaer 1805, by Brescovit & Simo (2007), and results of several cladistic analyses (Silva 2003; Polotow & Brescovit 2009, 2014) indicated that the genus is polyphyletic as currently delimited.
Recent collecting expeditions in the Kenyan Taita Hills, the northernmost part of the Eastern Arc, yielded several specimens identified as Ctenidae. The species was mentioned by Jocque (2009) as a possible member of the genus Pseudoctenus Caporiacco 1949, but that genus proved to belong to the Zoropsidae Bertkau 1882.
The specimens collected in the Taita Hills cannot be assigned to any of the Afrotropical Ctenidae genera. The presence of several elongated spines on tibiae and metatarsi I and II and the absence of a pair of terminal spines on tibiae I and 11 suggested a relationship of the Taita Hills species with Africactenus, Anahita, or Petaloctenus. However, the diagnostic characters of the male palp and epigynum of these three genera prove otherwise. So far, only five Ctenidae species have been described from Kenya: Ctenus elgonensis Benoit 1978 (Benoit 1978: Fig. 2a-c), C. holmi Benoit 1978 (Benoit 1978: Fig. 3a-b), C kenyamontanus Benoit 1978 (Benoit 1978: Fig. la-c), C modestus Simon 1897 (Benoit 1978: Fig. 3c; Benoit 1979: Fig. 24) and C. noctuabundus Arts 1912 (Benoit 1979: Fig. 10). The species collected in the Taita Hills is clearly different from all these type specimens.
Here we describe this species and include it in the most recent cladistic analysis based on morphological characters of Ctenidae (Polotow & Brescovit 2014), to test the relationships with the remaining species of the family. As a result, we propose a new genus, Arctenus gen. nov., to accommodate Arctenus taitensis sp. nov., and we discuss its phylogenetic placement in Ctenidae.
METHODS
Morphological observations and illustrations were made using Wild MIO and M5 microscopes. Photographs of the habitus were taken with a Leica MZ16 binoclar microscope using the LAS automontage software. For SEM, specimens were cleaned ultrasonically, gold coated, and then examined and photographed with a JEOL 6480 LV scanning electron microscope at the Royal Museum for Central Africa, Tervuren, Belgium (MRAC). We detached the epigynum from the abdomen and submerged it in methyl salicylate to clear the internal structures. All measurements are in millimeters. The material examined belongs to the MRAC (curator R. Jocque).
The morphological matrix comprises 72 species and 89 characters described in detail in Polotow & Brescovit (2014). For the present analysis, we added one terminal taxon: A. taitensis sp. nov., male and female from Mbololo Forest, Taita Hills, Kenya, VI. 1999, D. Van den Spiegel coll. (MRAC 228739). Mesquite, version 2.75 (Maddison & Maddison 201 1) was used to build and edit the character matrix. Non- applicable and unknown states are presented as and ‘?’, respectively. All characters were equally weighted and all multistate characters were coded as non-additive. Character coding for the new species was as follows:
Arctenus taitensis: 0000 1001100100011100011 00000000- 000000 1211 000000000 1 1 00000 110105011 00023 1 4 1 000000 1 ? 1 ? ??0?
The parsimony analysis was performed with the same methodology described in Polotow & Brescovit (2014). The Diva-GIS version 5. 2. 0.2 (http://www.diva-gis.org) was used to make the maps.
The following abbreviations were used: ALE, anterior lateral eyes; AME, anterior median eyes; C, conductor; CD, copulatory ducts; CO, copulatory opening; Cy, cymbium; E,
240
POLOTOW & }OCQlJE—ARCTENUS, A NEW AFROTROPICAL SPIDER GENUS
241
Tengella radiata
Zoropsis spinimana
Nothroctenus marshii
Acanthoctenus spiniger
Viracucha andicola
Acanthocteninae
Celaetycheus flavostriatus
Arctenus taitensis
Caloctenus gracilitarsis
Toca bossanova
Gephyroctenus philodromoides
31
0.12 I 63
0,14
Calocteninae
0.05
53
0.17
0,02
99
Acantheis laetus
Enoploctenus inazensis
12 I Enoploctenus miserabilis
Enoploctenus cyclothorax Viridasius fasciatus Vulsor Isaloensis Asthenoctenus borellii
Asthenoctenus tarsalls
Asthenoctenus bulimus
Leptoctenus aff agalenoides
— Anahita centralis
0,07
Acantheinae
Viridasiinae
Cteninae
0.09
0 04
Anahita aff mamma
Anahita blandini
Ctenus curvipes Ctenus sinuatipes Ctenus erythrochelis
Ctenus velox
Ctenus Immortalis
Ctenus fallax Ctenus eminens Ctenus pergulanus
Ctenus villasboasi
Ctenus satanas
A
0,29
Phoneutria fera Phoneutria nigriventer Ctenus rectipes
Ctenus pauloterral
— Ctenus nigritus — Ctenus manauara
■ Ctenus villasboasi • Ctenus satanas
Ctenus fallax • Ctenus eminens ■ Ctenus pergulanus -Phoneutria
- Ctenus
E;
Ctenus dubius Ctenus crulsi
Ctenus amphora
Ctenus minor
Ctenus medlus
Ctenus paubrasil
Ctenus fernandae
66 I Ctenus ornatus
- Ctenus vehemens
51
0.04
0,14
Ctenus inaja
Leptoctenus paradoxus
Leptoctenus byrrhus
Ohvida modestus
90 I Ohvida vernatis
Ohvida fulvorufa
■f
0.13
0.05
40
0 14
0.32
Thoriosa sp.
Thoriosa taurina Trogloctenus faget Amauropelma trueloves Amauropelma torbjorni
Ctenus lejeunei
Ctenus amanensis
Centroctenus ocelliventer
Centroctenus acara
99 I Africactenus decorosus
Africactenus monitor
Petaloctenus bossema
Petaloctenus songan
Ctenus longipes
Ctenus similis
66 I Parabatinga brevipes
- Parabatinga sp. nov.
- Isoctenus coxalis
- Isoctenus folliifer
0.52
54
0.19 91 I
0.25
Figure 1. — Consensus tree under implied weights for constant of concavity k; = 3. Rectangle shows Cteninae clade. Support values for groups expressed as GC frequency differences (top) and Bremer support in units of fit X 100 (bottom).
242
THE JOURNAL OF ARACHNOLOGY
64 66 82 83 84 5 1111
Celaetycheus flavostriatus
8 9 17 23 62 71 73 74 85 86
'-<><K>0-«-«hCK>-0-#H
111112 14 11
Calocteninae
Caloctenus gracilitarsis
40 64
3 1
Toca bossanova
Gephyroctenus philodromoides
Figure 2. — Calocteninae clade of the consensus tree under implied weights for constant of concavity k=3. Character changes mapped on branches. Black circles indicate non-homoplastic synapomorphies. White circles indicate homoplastic synapomorphies.
embolus; FD, fertilization ducts; LP, lateral process; LS, lateral sector; MA, median apophysis; MS, median sector; MTP, membranous tegular process; PLE, posterior lateral eyes; PME, posterior median eyes; RCP, retrolateral cymbial process; RTA, retrolateral tibial apophysis; S, spermathecae; TF, transversal furrow; Ti, tibia; VTA, ventral tibial apophysis; VTP, ventral tibial process.
PHYLOGENETICS
The parsimony analysis under equal weight resulted in 141 most parsimonious trees, with 235 steps (Cl = 50; RI = 83). In the strict consensus, 14 nodes collapsed, resulting in a tree with 295 steps (Cl = 40; RI = 75). The implied weighting analyses with concavity values from 1 to 6 were performed in the data set, and we obtained the same two trees in each analysis, with 235 steps (Cl = 50; RI = 83). The strict consensus of the two trees obtained by the concavities analysis resulted in one collapsed node and the same tree of 236 steps (Fig. 1; Cl = 50; RI = 83).
These results are congruent with the phylogeny of Polotow and Brescovit (2014), except for the position of two clades at the base of the clade F (Polotow & Brescovit 2014: Fig. 3), with the clade formed by Ctemts fallax Steyn & Van der Donckt 2003, C. eminens Arts 1912, and C. pergukmus Arts 1912 in the basal part of the clade (Fig. lA). Arctenus taitensis sp. nov. appears as a representative of Calocteninae, sister
group of the clade formed by Caloctenus Keyserling 1877, Toca Polotow & Brescovit 2009 and Gephyroctenus Mello- Leitao 1936 (Fig. 1). The strict consensus of the two trees obtained by the implied weighting analysis with k = 3 was chosen as the working hypothesis and these results are described below (Fig. 1). Here, we describe only the phyloge- netic relationships of the Calocteninae Simon 1897 clade (Fig. 2). For detailed results of the remaining subfamilies see Polotow and Brescovit (2014).
Calocteninae (Fig. 2) is supported by three non-homoplas- tic synapomorphies: labium wider than long (character 66), reduced posterior median spinnerets (character 82) and presence of a row of thick anal setae (character 84). This clade is also supported by two homoplastic synapomorphies: presence of five retromarginal teeth (character 64) and posterior median spinnerets with three or fewer cylindrical gland spigots (character 83). Celaetycheus Simon 1897 appears as the basal clade, sister group of the remaining caloctenines (Fig. 2) and is supported by two homoplastic synapomor- phies: conductor laminar and folded (character 40) and five pairs of ventral spines on tibia I and II (character 72). The clade formed by Arctenus gen. nov., Caloctenus, Gephyrocte- nus and Toca is supported by three non-homoplastic synapomorphies: reduced ALE lenses (character 62), the presence of three or more prolateral spines on femur I (character 71) and presence of leaf-shaped setae on the
Figures 3, 4. — Arctenus — taitensis sp. nov.: 3. Habitus; 4. Frontal view of the carapace. Scale bars = 1 mm.
POLOTOW & JOCQVE— A RCTENUS, A NEW AFROTROPICAL SPIDER GENUS
243
abdominal dorsum (character 86). The clade is also supported by seven homoplastic synapomorphies: presence of ventral tibial apophysis (character 8), bifid RTA (character 9), median retrolateral cymbial process (character 17), embolus fixed by membranous region (character 23), distal pair of spines on tibia I at a distance from the apical margin of the tibia (character 73), presence of four or more ventral spines on metatarsus I and II (character 74), and presence of modified abdominal setae (character 85).
Arctenus gen. nov. appears as sister group of the clade formed by Calocteniis, Gephyroctenus and Toca. Arctenus taitensis sp. nov. presents three homoplastic autapomorphies: cymbium with scopulae (character 18), conductor laminar, wider than long (character 40) and presence of a membranous tegular process (character 41). Arctenus is the first represen- tative of the Calocteninae in the African continent.
The clade formed by Caloctenus, Gephyroctenus and Toca is supported by four homoplastic synapomorphies: loss of ventral tibial process (character 12), loss of lateral sector processes of epigynum (character 52), cephalothorax divided into a pars tlioracica and a pars cephalica by a V-shaped depression (character 63), and four retromarginal teeth (character 64).
The Caloctenus clade is supported by the absence of a membrane connecting the embolus and tegulum (character 23). The sister group relation of Gephyroctenus and Toca is based on the unique single folded epigynum configuration (character 42) and four homoplastic synapomorphies: conical or rounded retrolateral tibial apophysis (character 9), retro- basal cymbial process (character 17), cylindrical embolus (character 22) and abdominal dorsum with club-shaped setae (character 87).
The Gephyroctenus terminal branch is supported by the presence of a unique retrolateral cymbial process, covering the retrolateral surface as a laminar process (character 17) and a homoplastic membranous tegular process (character 41). The terminal branch formed by Toca species is supported by a unique conductor, partially covering the tegulum (character 40) and the presence of five retromarginal teeth (character 64).
TAXONOMY
Ctenidae Keyserling 1877 Calocteninae Simon 1897 Arctenus new genus
Type species. — Arctenus taitensis sp. nov.
Etymology. — The generic name is a combination of “arc,” referring to the Eastern Arc Mountains, and ""CtenusT
Diagnosis. — Males of Arctenus gen. nov. can be distin- guished from the other Calocteninae by the long hairs on the base of the RTA, the large and thick embolus with a subdistal projection and bifid tip, and presence of a dorsal cymbial scopula (Figs. 11,12) on the male palp. Females of Arctenus gen. nov. can be distinguished from the remaining Calocteni- nae by the median field with an anterior transverse furrow (Fig. 13).
Description. — Ecribellate ctenids. Total body length (males and females) 5.90-7.20. Carapace pale brown with longitudi- nal lighter stripe from eyes to posterior carapace margin; chelicerae, labium, endites, sternum and legs pale brown;
chelicerae with longitudinal dark markings and femur of legs with dark spots (Figs. 3,4); posterior median and lateral eyes on black tubercles (Fig. 4). Dorsum of abdomen with longitudinal white stripe (Fig. 3), venter pale brown. Eyes arranged in ctenoid pattern, 2-4-2 (Fig. 4). Chelicerae with five retromarginal teeth (Fig. 5) and three promarginal teeth. Labium short, wider than long. Fovea short, positioned in posterior third of carapace. Tarsal claws with eight teeth, four proximal teeth short and four distal teeth elongated and slight sinuous (Fig. 9). Trichobothrial base with two transversal grooves (Fig. 7). Tarsal organ rounded, projecting, with drop- shaped aperture (Fig. 8). Legs I and II with numerous pairs of elongated spines on femur, tibia, and metatarsus. Trochanters slightly notched. Abdomen oval. Male palp: tibia with RTA, ventral tibial process and additional ventral tibial projection; RTA with two distal projections and elongated hairs at base; cymbium with retrolateral median projection and dorsal scopulae; subtegulum prolateral; median apophysis hook- shaped; embolus with subdistal projection and bifid tip; hyaline projection at base of embolus; conductor short, its tip covering embolus (Figs. 6,11,12). Epigynum: divided into median field and two lateral fields; median field with anterior transverse furrow; lateral field with short lateral process; broad copulatory ducts and spermathecae rounded, situated posteriorly; fertilization ducts short, emerging from base of spermathecae (Figs. 13,14). The specimens were found with an epigynal plug covering the copulatory opening (Fig. 10).
Composition. — Only the type species, Arctenus taitensis sp. nov.
Distribution. — Kenya (Figs. 15,16). The calculated expected distribution of the species (Diva GIS) is restricted to the Taita Hills. Extensive collections in other parts of the Eastern Arc (Usambara, Ulugura and Uzungwa Mts., mainly in the Zoological Museum of the University of Copenhagen, courtesy of N. Scharff) did indeed not reveal the presence of the species there.
Arctenus taitensis new species Figs. 3-16
Type material. — Male holotype from Mbololo Forest, Taita Hills (1580 m), 03°19'S 38°27'E, Kenya, 22.VL1999, D. Van den Spiegel coll., (MRAC 208839); female paratype from Chawia Forest, Taita Hills (1850 m), 02°29'S 38°29'E, Kenya, 7.XIL1999, D. Van den Spiegel & J.P. Michiels coll., deposited in MRAC 209161; male and female paratypes from the same locality as the holotype (1800-1900 m), 23.VL1999, D. Van den Spiegel coll. (MRAC 228739).
Additional material examined. — KENYA. Coast Province: Taita Taveta District, Taita Hills, Mbololo Forest, 03°19'S 38°27'E, 4 females, 23.VL1999, D. Van den Spiegel coll. (MRAC 208808); Ngangao Forest, 03°20'S 38°22'E, 1 female, 19.VL1999, D. Van den Spiegel coll. (MRAC 208813); Same locality, 1 female, 1 7-1 8.VL 1999, D. Van den Spiegel coll. (MRAC 208831); Same locality, 1 female, 19.VL1999. D. Van den Spiegel coll. (MRAC 208840); Same locality, 2 females, 24.111.2000, C. Warui & R. Jocque coll. (MRAC 209568); Fururu Forest, 1 female, 9.XIL1999, D. Van den Spiegel & J.P. Michiels coll. (MRAC 209160); Taita Discovery Center, 03°25'S 38°46'E, 1 female, 27.111.2000, C. Warui «& R. Jocque coll. (MRAC 209546).
244
THE JOURNAL OF ARACHNOLOGY
Figures 5-10. — Arctemis taitcusis sp. nov.: 5. Left chelicera, detail of the five teeth on retromargin; 6. Male right palp: 7. Trichobothrium. female, tarsus I; 8. Tarsal organ, female, tarsus I; 9. Tarsal claws, male, leg !1; 10. Epigynum, with epigynal plug.
POLOTOW & JOCQUE— A NEW AEROTROPICAL SPIDER GENUS
245
RTA
VTA
Eigures 1 1-14. — Arctemis laitensis sp. nov.; 1 1-12. Male left palp; 1 1. Ventral view; 12. Retrolateral view; 13-14. Epigynum; 13. Ventral view; 14. Dorsal view. Abbreviations; C, conductor; CD, copulatory duct; CO, copulatory opening; Cy, cymbium; E, embolus; ED, fertilization ducts; LP, lateral process; LS, lateral sector; MA, median apophysis; MS, median sector; MTP, membranous tegular process; RCP, retrolateral cymbial projection; RTA, retrolateral tibial apophysis; S, spermatheca; TF, transverse furrow; VTA, ventral tibial apophysis; VTP, ventral tibial process.
Etymology. — The species epithet is an adjective derived from the type locality.
Diagnosis. — As for the genus.
Description. — Male (MRAC 208839).- Total length 5.90. Carapace 2.90 long and 2.50 wide. Clypeus 0.11 high. Eye
diameter: AME 0.15, ALE 0.12, PME 0.20, PEE 0.23. Leg measurements; I: femur 3.70/ patella 1.10/ tibia 3.95/ metatarsus 4.10/ tarsus 2.00/ total 14.85; II: 3.60/ 1.20/ 3.50/ 3.50/ 1.40/ 13.20; III: 3.20/ 1.10/ 2.70/ 2.90/ 1.10/ 11.00; IV: 3.90/ 1.10/ 3.30/ 4.30/ 1.45/ 14.05. Leg formula: 1423. Leg
246
THE JOURNAL OF ARACHNOLOGY
Figures 15, 16. — Distribution map of Arctenus taitensis sp. nov. 15. African continent; 16. Detail of southern Kenya and northeast Tanzania.
spination: tibia I with eight pairs of ventral spines; tibia II with seven pairs of ventral spines; metatarsi I and II with five ventral pairs of spines; tibia III-IV 2-2-2v 1-lp 1-lr; metatarsi III-IV 2-2-2v 1-1- Ip 1-1-lr. Coloration and palp: as in genus description.
Female (MRAC 228739).' Total length 7.20. Carapace 3.10 long and 2.60 wide. Clypeus 0.14 high. Eye diameter: AME 0.18, ALE 0.12, PME 0.28, PLE 0.28. Leg measurements: I: femur 3.00/ patella 1.30/ tibia 3.00/ metatarsus 2.60/ tarsus 0.95/ total 10.85; II: 3.00/ 1.30/2.60/2.30/0.90/ 10.10; III: 2.60/
I. 10/ 2.10/ 2.30/ 0.90/ 9.00; IV: 3.20/ 1.00/ 2.60/ 3.20/ 1.15/
II. 15. Leg formula: 4123. Leg spination: tibia I and II with eight ventral pairs of spines; metatarsi I and II with five ventral pairs of spines each; tibia III 2-2-2v 1-lp 1-lr; tibia IV 2-l-2v 1-lp 1-lr; metatarsi III-IV 2-2-2v 1-1-Ip 1-1-lr. Coloration and epigynum: as in genus description.
Distribution. — Kenya (Figs. 15,16).
DISCUSSION
The results indicate that Arctenus taitensis, from East Africa, is closely related to the Neotropical Calocteninae spiders, in a well supported clade (Fig. 1). Here we describe Arctenus taitensis as the first true Calocteninae from the African continent, although there is currently another species described from Ethiopia, Caloctenus abyssinicus Strand 1917, which was placed as incertae sedis within Ctenidae by Silva (2004: 13). The type specimen is lost and the original description (Strand 1917: 41) is based on an immature female, with somatic features unusual for the family. Another species, described from the Seychelles islands, Apolania segnientata Simon 1898, is also regarded as belonging to the Calocteninae according to Silva (2003: 30). Until the identity of Caloctenus abyssinicus is revealed, Arctenus taitensis and Apolania segnientata remain the only two Afrotropical Calocteninae species.
The majority, 24 out of the currently 32 species of Calocteninae (in seven genera, Caloctenus, Gephyroctenus, Toca, Apolania, Diallonnis Simon 1897, Celaetycheus and Arctenus), were described in the last 10 years and most of the specimens were collected recently (Silva 2004; Polotow & Brescovit 2008, 2009, 2013). This is remarkable, as the shelf life between discovery and description of new species is on average 21 years (Fontaine et al. 2012, Miller et al. 2014), and
because it concerns medium sized to large spiders. It shows that at least the Neotropical and Afrotropical regions, from which these animals originate, have only superficially been inventoried even for larger invertebrates. This is particularly true for members of the family Ctenidae and a fortiori for the subfamily Calocteninae. Since these spiders are strictly nocturnal they were overlooked for a long time (Steyn et al. 2002). Only in recent inventories that made use of pitfalls but mainly of headlamps for night collecting, have these spiders become common in collections. That Calocteninae appear to be rare and are apparently restricted to areas with character- istics of refuges (Seychelles and Eastern Arc for Africa), is concordant with their basal position in the phylogeny of the family (Polotow & Brescovit 2014).
ACKNOWLEDGMENTS
Financial support and a doctorate fellowship for this study were provided by the Funda^ao de Amparo a Pesquisa do Estado de Sao Paulo — FAPESP (06/55230-7), the Belgian National Focal Point to the Global Taxonomy Initiative at the Royal Museum for Central Africa, and a Bill and Maria Peck Research Fellowship at the California Academy of Sciences. We would like to thank all curators who kindly lent essential specimens for this research. We also thank Matjaz Kuntner, Charles Haddad and an anonymous reviewer for comments that led to improvements in the manuscript.
LITERATURE CITED
Benoit, P.L.G. 1978. Especes est-africaines du genre Ctenus Walck- enaer (Araneae, Ctenidae). Revue de Zoologie africaine 92:525- 532.
Benoit, P.L.G. 1979. Etudes sur les Ctenidae africains (Araneae) VIII. Gen. Ctemis Walck.-groupe abditus. Revue de Zoologie africaine 93:425M44.
Brescovit, A.D. & M. Simo. 2007. On the Brazilian Atlantic Forest species of the spider genus Ctenus Walckenaer, with the description of a neotype for C. cluhius Walckenaer (Araneae, Ctenidae, Cteninae). Bulletin of the British Arachnological Society 14:1-17. Fontaine, B., A. Perrard & P. Bouchet. 2012. 21 years of shelf life between discovery and description of new species. Current Biology 22:943-944.
Jocque, R. 2009. A redescription of Pseiuloctenus ineneghetlii Caporiacco, 1949 (Araneae: Zoropsidae), a poorly known Afro- tropical spider taxon, with description of a new enigmatic species. Contributions to Natural History 12:707-721.
POLOTOW & iOCQVE—ARCTENUS, A NEW AFROTROPICAL SPIDER GENUS
247
Maddison, W.P. & D.R. Maddison. 2011. Mesquite: a modular system for evolutionary analysis. Version 2.75. Online at http;// mesquiteproject.org
Miller, J., M. Schilthuizen, J. Burmester, L. van der Graaf, V. Merckx & M. Jocque, et al. 2014. Dispatch from the field: ecology of ground-web-building spiders with description of a new species. Biodiversity Data Journal 2:1076.
Platnick, N.I. 2014. The world spider catalog, version 14.5. American Museum of Natural History. Online at http://research.amnh.org/ entomology/spiders/catalog/index. html DOI: 10.5531/db.iz.0001 (accessed in April, 2014).
Polotow, D. & A.D. Brescovit. 2008. Revision of the Neotropical spider genus Gephyroctemis (Araneae; Ctenidae: Calocteninae). Revista Brasileira de Zoologia 25:705-715.
Polotow, D. & A.D. Brescovit. 2009. Description of Toca, a new neotropical spider genus (Araneae, Ctenidae, Calocteninae). Journal of Arachnology 37:243-245.
Polotow, D. & A.D. Brescovit. 2013. New species of the Neotropical spider genus Celaetycheus Simon, 1897 (Araneae: Ctenidae). Zootaxa 3637:139-157.
Polotow, D. & A.D. Brescovit. 2014. Phylogenetic analysis of the tropical wolf spider subfamily Cteninae (Arachnida, Araneae, Ctenidae). Zoological Journal of the Linnean Society 170:333-361.
Silva, D. 2003. Higher-level relationships of the spider family Ctenidae (Araneae: Ctenoidea). Bulletin of the American Museum of Natural History 274:1-86.
Silva, D. 2004. Revision of the spider genus Caloctemis Keyserling, 1877 (Araneae, Ctenidae). Revista Peruana de Biologia 11:5-26.
Simon, E. 1897. Histoire naturelle des araignees. Librairie encyclo- pedique de Roret, Paris 2:1-192.
Simon, E. 1898. Etudes arachnologiques. 29e Memoire. XLVI. Arachnides recueillis en 1895 par M. le Dr. A. Brauer (de rUniversite de Marburg) aux lies Sechelles. Annales de la Societe Entomologique de France 66:370-388.
Steyn, T.L., J.-F. Van der Donckt & R. Jocque. 2002. The Ctenidae (Araneae) of the rainforests in eastern Cote d'Ivoire. Annales du Musee royal de I’Afrique centrale (serie Zoologie) 290:129-166.
Strand, E. 1917. Arachnologica varia XXI-XXIV. Archiv fiir Naturgeschichte 82:39^4.
Manuscript received 14 April 2014, revised 17 June 2014.
2014. The Journal of Arachnology 42:248-256
Chemical defenses in the opilionid infraorder Insidiatores: divergence in chemical defenses between Triaenonychidae and Travunioidea and within travunioid harvestmen (Opiliones) from eastern and
western North America
W. A. Shear', T. H. Jones-, H, M. Guidry-, S. Derkarabetian^"', C. H. Richart"*"*, M. Minor^ and J. J.
Lewis^: 'Department of Biology, Hampden-Sydney College, Hampden-Sydney, VA 23943, USA. E-mail; wshear@hsc.edu; -Department of Chemistry, Virginia Military Institute, Lexington, VA 24450, USA; ^Department of Biology, San Diego State University, San Diego, CA 92182, USA; ''Department of Biology, University of California, Riverside, Riverside, CA 92521, USA; ^Ecology Group, Institute of Agriculture & Environment, Massey University, Private Bag 11222, Palmerston North 4442, New Zealand; '’J. Lewis & Associates Biological Consulting, 217 W. Carter Avenue, Clarksville, IN 47129, USA
Abstract. Live whole specimens of two species of the harvestman Stiperfamily Travunioidea Absolon & Kratchovil 1932 from the eastern United States, eight species from the western United States, six morphospecies of the family Triaenonychidae Sorensen 1886 from New Zealand, and specimens of the phylogenetically early-diverging North American triaenonychid Fwmmtaiia dejvchoidor Shear 1977 were extracted in methanol, and the solvent analyzed for components from their'defensive secretions. The components were then mapped on a recent phylogeny of the taxa. In both eastern cladonychiid species, Erehonuister flavescens Cope 1872 and Theronuister bnmneus (Banks 1902), the major component found was anabaseine, an alkaloid related to nicotine. In the western species, Parcmonyclms hrunneus (Banks 1893), Cryptonuister leviathan Briggs 1969, Speleoniaster lexi Briggs 1974, S. pecki Briggs 1974, Speleonychia sengeri Briggs 1974, Metanonychiis idahoensis Briggs 1971, Briggsus flavescens (Briggs 1971) and Sclerohiinus nondiniorphicus Briggs 1971, the major component was N,N-dimethylphenylethylamine, implying that the travunioids from the two regions represent different phyletic lines. The secretions of the triaenonychid species, members of the genera Soerensenella Pocock 1903 and Nnncia Loman 1902, were dominated by 4-methyl-3-hexanone, and that of F. depreliendor by phenol. The completely different chemistry of the two taxa, Travunioidea and Triaenonychidae, implies significant phylogenetic differences, and the presence of phenol in F. depreliendor may suggest a long period of separate evolution for this species.
Key words: Nicotine, benzothiazole, 2-3' dipyridyl, salicyl alcohol, mellein, N,N-dimethylphenylethylamine, 4-methyl-3-hexanone
Harvestmen, arachnids of the order Opiliones (also known in North America as daddy-long-legs) defend themselves chemi- cally with secretions from paired glands in the prosoma, which open through pores on either side of the body. Information on the chemical composition of these secretions has accumulated since the initial studies of Estable et al. (1955) that identified gonyleptidine, the first defensive substance from a harvestman to be chemically determined. Developments in the field have been ably summarized in a chapter by Gnaspini & Hara (2007), which revealed that research on defensive chemistry in Opiliones has focused disproportionally on South American gonyleptids and their relatives (see also Ebttinger et al. 2010). Since the 2007 review, information has been added regarding more disparate taxa for which the chemistry of the secretions was previously unknown. Raspotnig et al. (2005) published the first report on the chemistry of sironids (Cyphophthalmi Simon 1879), and Jones et al. (2009) added data for a stylocellid. Raspotnig et al. (2010) provided the first report of secretion chemistry among Dyspnoi, from Panineimistoma quadripiinctatum (Perty 1833), and Shear et al. (2010a, b) studied two North American phalangodids, Bishopella laciniosa (Crosby & Bishop 1924) and Texella hifiircata (Briggs 1968), and a stygnopsid, Cltiiuptepello- hiiinis nuuHae (Goodnight & Goodnight 1967). These more recent developments have been summarized by Raspotnig (2012 [2013]), who also mentioned preliminary results for many additional harvestman species. Thus while progress has been made filling taxonomic gaps in our knowledge of harvestman defensive secretions, much remains to be done.
While these studies focused primarily on reporting the composition of secretions from individual species, some recent work has been more analytical. Rocha et al. (2013) discussed possible chemical pathways for the synthesis of secretion components. Attempts at a phylogenetic analysis of the distribution of defensive secretions include those of Caetano & Machado (2013) and Raspotnig et al. (2014). The hope has frequently been expressed that data on defensive secretions may be of value in the phylogenetics and taxonomy of Opiliones (Hara et al. 2005; Jones et al. 2009; Shear et al. 2010a, b, Fdttinger et al. 2010, Raspotnig 2012 [2013]), but we see an emerging picture that may be blurred by a great deal of homoplasy. Indeed, the results of the analyses of the same data by Caetano & Machado (2013) and Raspotnig et al. (2014) came to opposite conclusions concerning the polarity of chemical transformations in Grassatores.
Traditional Opiliones taxonomic groups have now been robustly supported with genomic data sets (Hedin et al. 2012), and include the mite-like suborder Cyphophthalmi as sister to remaining harvestmen, the Phalangida Latrielle 1796. Within Phalangida, the raptorially-pedipalped Laniatores Thorell 1876 are sister to the Palpatores Thorell 1876, comprised of the often long-legged suborder Eupnoi Hansen & Sorensen 1904 and the suborder Dyspnoi Hansen & Sorensen 1904. The division of the suborder Laniatores into two infraorders, Insidiatores Loman 1900 and Grassatores Kury 2003, was proposed by Kury (2003) to taxonomically recognize two divergent phyletic lines of harvestmen. Insidiatores includes
248
SHEAR ET AL.— CHEMICAL DEFENSE OF INSIDIATORES
those taxa presently grouped as Triaenonychidae Sorensen 1886, Synthetonychiidae Forster 1954, and a group of species of unsettled family-level taxonomy presently referred to as Travunioidea Absalon & Kratchovil 1932. It is not clear that Insidiatores as composed is monophyletic (but Grassatores almost certainly is). Representative Insidiatores examined here can be seen in Fig. 1.
Synthetonychiidae is a poorly studied but probably monophyletic taxon including minute harvestmen limited to New Zealand (Forster 1954, Kury 2007). In some recent phylogenies, synthetonychiids have been resolved as an outgroup to the remaining Laniatores (Giribet et al. 2010). Triaenonychidae is composed of numerous genera and species that are important, if not dominant, elements of the harvestman fauna of the southern hemisphere (Australia, New Zealand, Madagascar, South Africa, and southern South America [Kury 2007]), but one species, Fumontami deprehen- dor Shear 1977, is known from the southern Appalachian Mountains in North America (Shear 1977, Thomas & Hedin 2008). Triaenonychid taxonomy is somewhat problematical (Mendes & Kury 2008). No triaenonychids had been examined for the chemistry of their defensive secretions prior to this study, and synthetonychiids remain unstudied.
Genera and species of the “superfamily” Travunioidea have been recorded from Europe (Kury & Mendes 2007) and Japan, but North America appears to host the most diverse and probably the best understood fauna (Fig. 1; Shear & Derkarabetian 2008, Derkarabetian et al. 2010, 2011). Only a single North American species from this phylogenetically important taxon has been examined from the viewpoint of chemical defense. Specimens from New Mexico were studied by Epka et al. (1984); at the time they referred their material to Sclerobumis rohustiis (Packard 1877), but recent work (Derkarabetian et al. 2010, 2011; Derkarabetian & Hedin 2014) has shown that at least three additional species occur in New Mexico, so the exact identity of their specimens is now unclear. Epka et al. (1984) found an extraordinary array of molecules in the secretion of S. robustus: N,N-dimethylphe- nylethylamine, nicotine, bornyl acetate, bornyl propionate, camphene and limonene.
Raspotnig et al. (2011) examined four species in the European travunioid genus Holoscotolemon Roewer 1915; H. jaqueli (Corti 1905), H. oreophUum Martens 1978, H. lessiniense Martens 1978 and H. imicolor Roewer 1915. They found that the secretions of H. jacpwti and H. oreophUum were dominated by nicotine, while that of H. lessiniense primarily consisted of the similar alkaloid anabaseine. No results were obtained from adults of H. unicolor.
For this study, we analyzed extracts from 15 species of Insidiatores from North America and New Zealand. While our findings for the North American species might have been predicted from the earlier examinations of Sclerohunus ?robustus and the European species of Holoscotolemon, the chemistry of the New Zealand forms was quite unexpected.
METHODS
Specimens studied were collected alive and dropped in the field into vials containing less than 1 ml of USP methanol; the vials had Teflon-lined caps. Collection localities for the specimens studied are given in Table 1. All specimens will be
249
placed as vouchers in the collection of the Virginia Museum of Natural History, Martinsville, Virginia.
Although when it was possible to extract more than one specimen of a species separately, the results were consistent, in most cases we were restricted to a single specimen by the rarity of the species involved and the difficulties in collecting them, or analyzed extracts from several specimens collected into the same vial. For this reason, some of our results must be regarded as preliminary, and we are working to follow up with additional specimens. However, at the level we are studying, simply characterizing components without detailed quantita- tive analysis, previous studies have shown little variation within species in the composition of their secretions, though relative amounts of components may differ.
The analysis of the extracts was performed by HMG and THJ. Gas chromatography-mass spectrometry was carried out in the El mode using a Shimadzu QP-5000 or QP-2010 GC/ MS equipped with an RTX-5, 30 m X 0.25-mm i.d. column. The instruments were programmed from 60 ° C to 250 ° C at 10 7min. Identification of components was accomplished using NIST/EPA/NIH mass spectral library on CD-rom, version 1.7 (1999) and the NIST/EPA/NIH mass spectral library version 2.0d (2005).
All chemicals were mapped onto a modified phylogeny based on the molecular phylogenetic analysis of Derkarabe- tian et al. (2010), trimmed to include only those genera with chemical data presented here. An ultrametric tree was used for character mapping, which was conducted in Mesquite 2.75 using the ancestral state reconstruction module using parsimony. Additionally, we mapped chemicals onto a phylogeny including triaenonychids analyzed here and the genus Holoscotolemon. The taxa were added according to their placement in the maximum likelihood phylogeny of Giribet et al. (2010).
RESULTS
Results of the analysis are presented in Tables 2M, and structural formulae of detected components are shown in Fig. 2. As seen in Table 2, the major component of the secretion in both eastern North American travunioid species {Erebomaster Jlavescens Cope 1872 and Theromaster briinneus (Banks 1902)) was the alkaloid anabaseine. Minor or trace components were anabasine (a related alkaloid), phenol, benzothiazole, salicyl alcohol, 2,3'-dipyridyl and mellein. Four individuals of T. brunneus were analyzed; no significant differences were found between individuals, except that salicyl alcohol was not found in two of the specimens. A specimen of E. Jlavescens from Indiana was analyzed separately, and six specimens of the species from Ohio were extracted and analyzed as a group. The results for E. jlavescens differed from those for T. brunneus in that trace amounts of 4- hydroxybenzine-ethanol were found in the E. Jlavescens extract, and that phenol, anabasine and mellein were minor components (1-10%) rather than traces (< 1%).
Table 3 summarizes the results from the analyses of extracts from eight species of travunioids from western North America. Components in common with the eastern species were phenol and benzothiazole, and as with the eastern species, these compounds were present only in trace amounts. The major component in all western species was N,N-
250
THE JOURNAL OF ARACHNOLOGY
1 mm
0.5 mm
1 mm
1 mm
1 mm
1 mm
1 mm
0.5 mm
1 mm
Figure 1. Representatives of North American Insidiatores. High resolution images for all specimens figured here are available on Morphbank under publication ID 835667 {http://www.morphbank.net/835667). A. Briggsiis flavesceiis, B. Cryptomaster leviatium, C. Paranoiiychus hriinneiis, D. Metanoiiycinis ulcilioeitsis, E. Fitmontaiia deprehendor, F. Erehomaster sp., G. Speleomaster lexi, H. Speleomaster pecki, I. Speleoiiychia sengeri.
SHEAR ET AL.— CHEMICAL DEFENSE OF INSIDIATORES
251
Voucher
Species number
Cryptomaster leviathan 07-177
08-188
07-176
Erebomaster flavescens 07-179
07-180
07- 181 12-336
Theromaster bnmneus 08-211
Speleomaster lexi 08-172
08- 178
Speleomaster pecki 08- 1 74
Speleonychia sengeri 08-175
08-176
08-177
08-179
Paranonychus bnmneus 07-174
07-175
Metanonyclms idahoensis 09-248
Briggsus flavescens 08-190
Nimcia sp. 10-275
Nimcia sp. 10-278
Nimcia sp. 10-279
Soerensenella sp. 10-271
Soerensenella prehensor 10-272
Table 1. — Collecting localities.
Collection localities
OR: Lane Co., Willamette Nat. For., Clark Creek Organization Camp, 28 May 2007, A.Richart, C.Richart (CHR 1354)
OR: Coos Co., Golden and Silver Falls St. Pk., 4 April 2008, S.Derkarabetian, C.Richart (CHR 2029) OR: Lane Co., Willamette Nat. For., Clark Creek Organization Camp, 28 May 2007, A.Richart, C.Richart (CHR 1335)
IN: Crawford Co., Sibert’s Well Cave (near Wyandotte Cave), 3 mi NE Leavenworth, 19 Nov 2007, J. Lewis
IN: Harrison Co., Devils Graveyard Cave, 7 mi SW Corydon, 19 Nov 2007, J. Lewis
IN: Harrison Co., Devils Graveyard Cave, 7 mi SW Corydon, 19 Nov 2007, J. Lewis
OH: Adams Co., Edge of Appalachia Preserve, 8 June 2011, W. A. Shear
NC: Haywood Co., Cullowhee Mtn. Road at Wolf Creek, 22 October 2008, W. A. Shear
ID: Lincoln Co., Tee Cave, 30 June 2007, A.Richart, C.Richart (CHR 1577)
ID: Lincoln Co., Gwinn Cave, 29 June 2007, A.Richart, C.Richart (CHR 1568)
ID: Butte Co., Beauty Cave, 30 June 2007, A.Richart, C.Richart (CHR 1581)
WA: Klickitat Co., Cheese Cave, 9 June 2007, N.Richart, C.Richart (CHR 1621)
WA: Skamania Co., Cave #27, 9 June 2007, N.Richart, C.Richart (CHR 1622)
WA: Skamania Co., Big Cave, 8 June 2007, N.Richart, C.Richart (CHR 1588)
WA: Skamania Co., Slime Cave (Cave #39) 8 June 2007, N.Richart, C.Richart (CHR 1607)
OR: Lane Co., Willamette Nat. For., Clark Creek Organization Camp, 28 May 2007, A.Richart, C.Richart (CHR 1356)
OR: Lane Co., Willamette Nat. For., Clark Creek Organization Camp, 28 May 2007, A.Richart, C.Richart (CHR 1357)
ID: Shoshone Co., Hobo Cedar Grove, 25 July 2008, C.Richart (CHR 2361)
OR: Clatsop Co., Saddle Mt. Rd. near U.S. 26, 3 April 2008, S.Derkarabetian, C.Richart (CHR 2016)
NZ: South Island, Westland, Dancing Creek, Haast Pass, 11 February 2010, M. Minor
NZ: South Island, Buller, Aratika, 9 February 2010, M. Minor
NZ: South Island, Buller, Springs Junction, 5 February 2010, M. Minor
NZ: North Island, Wanganui, Totara Reserve, 28 March 2010, M. Minor
NZ: North Island, Taupo, Whakapapa Bush, 4 April 2010, M. Minor
dimethylphenylethylamine, with nicotine and N,N-dimethyli- soamylamine as minor or trace components. An exception was Briggsus flavescens (Briggs 1971), in which the major component was phenol, with N,N-dimethylphenylethyIamine as a minor component and a trace amount of benzothiazole. This unexpected result came from one small specimen and requires confirmation.
Table 4 shows results from the analyses of extracts of triaenonychids. Three small specimens of F. deprehendor were extracted and analyzed together. Fumontana deprehendor had phenol as a major component, with traces of salicyl alcohol. Each record of a New Zealand triaenonychoid represents
either one or two specimens. The major components of the New Zealand triaenonychoids were quite different from both F. deprehendor and the travunioids. While the travunioids and F. deprehendor were dominated by cyclic compounds fre- quently containing nitrogen, the New Zealand triaenony- choids showed linear aldehydes, alcohols and ketones. The secretions were also much less complex, with only one or two minor or trace components in Nimcia sp.
Results of the character mapping analyses including the triaenonychids and Holoscotolemon are shown in Fig. 3. This analysis indicates that if Insidiatores is monophyletic, the ancestral state for all species is phenol, with changes to 4-
Table 2. — Compounds present in eastern North American travunioids and species of Holoscotolemon (data on Holoscotolemon from Raspotnig et al. 2011). Plus sign indicates major component, “o” a minor component (<10%) and “t” a trace component (<1%). The “Unknown” is an undetermined component at m/z = 174.
|
Fig. 2 |
Component |
Erebomaster flavescens |
Theromaster bnmneus |
Holoscotolemon jacpietf |
Holoscotolemon lessiniense‘ |
Holoscotolemon oreophilum’ |
|
1 |
Phenol |
o |
t |
|||
|
2 |
Benzothiazole |
t |
t |
|||
|
3 |
Salycyl alcohol |
t |
t |
|||
|
4 |
4-Hydroxybenzenethanol |
t |
||||
|
5 |
Anabasine |
o |
t |
|||
|
6 |
2,3'-Dipyridyl |
t |
t |
t |
||
|
7 |
Anabaseine |
+ |
+ |
+ |
||
|
8 |
Mellein |
0 |
t |
|||
|
10 |
Nicotine |
+ |
+ |
|||
|
Unknown* |
t |
Table 3. — Compounds present in western North American travunioids. Plus sign indicates major component, “o” a minor component (<10%) and “t” a trace component (<1%).
252
THE JOURNAL OF ARACHNOLOGY
+
^ O
+ o ^
+ o o
o
a.
o
o
c
o
a
S
o
o
Cl,
’O
c
c3
N
a>
z
o
-C
p,
o
p:
’2
+
+
+
+
+
o
a
£
5
U
x:
Oh CQ Z Z Z
— ri O
§ ^
^ s
<U O ^ Cl
- s
Q. o
C/5 ^
'O 1) c o
:3
o i:
a ^
o
u r
I. ^
a
<u
5
2 = X Cl
(U OJ
O O
o _ .
^ -i. -L
"o "S ^ ’£ 'S
c o •£ <u a>
e- oo ^
t S
PO ■q' IT)
SHEAR ET AL.— CHEMICAL DEFENSE OF INSIDIATORES
14 15
Figure 2. — Compounds identified in this study. I. Phenol, 2. Benzothiazole, 3. Salycyl alcohol, 4. 4-Hydroxybenzenethanol, 5. Anabasine, 6. 2,3'-dipyridryl, 7. Anabaseine, 8. Mellein, 9. N,N- dimethylphenylethylamine, 10. Nicotine, 11. N,N-dimethylisoaniyla- mine. 12. 4-methyl-3-hexanone, 13. Methylhexanoate, 14. 4-methyl-3- hexanol, 15. 4-methyl-3-heptanone.
methyl-3-hexanone in New Zealand triaenonychids and to N,N-dimethylphenylethylamine in travunioids.
DISCUSSION
The qualitative near-identity of the extracts from E. flavescens and T. brunneus supports the close phylogenetic relationship hypothesized on the bases of morphology and genetics by Derkarabetian et al. (2010). The strong differences between the secretions of this “eastern clade” and that of the hypothetical “western clade” of travunioids supports that distinction.
Raspotnig et al. (2011) found anabaseine as the major component in the secretion of Holoscotolemon lessiniense, but nicotine dominated that of H. jaqueti and H. oreopliilimi (Table 2). These three species appear to be closely related from morphological evidence and numerous characters, especially genitalic, place them close to Erehomaster Cope 1872 and Theromaster Briggs 1969 (Martens 1978). Trace components in these three species were pyridines with the same core structure as anabaseine and nicotine. Both chemical and morphological evidence, therefore, argue for a closer relation-
253
ship of the eastern North American genera with European Holoscotolemon than with the travunioid genera from western North America.
For the western travunioids, N,N-dimethylphenylethyla- mine was the major component in all species except Briggsus flavescens. Metanonychus klahoensis Briggs 1971 and Scler- ohunus nondimorphiciis Briggs 1971 had nicotine and N,N- diethylisoamylamine as minor components, as well as two unidentified compounds not shown. For the other species, phenol was present as either a minor component or a trace, and benzothiazole was found as a trace in Parammyclnis brunneus (Banks 1893) and Speleonychia .sengeri Briggs 1974. The complex mixtures found in the eastern cladonychiids and in S. ?robustus (Epka et al. 1984) were not recovered from the western species we studied. The complexity of the secretion extracted from the two eastern cladonychiid species is similar to that found by Epka et al. (1984) for Sclerobimus ?robustus, but quite different chemically. New Mexico Sclerobimus Banks 1893 require re-examination.
Both the complexity and the diversity of chemical compo- sition within Insidiatores is unusual among opilionids, because in previous studies, similar classes of compounds (though different molecules) have been found in large taxonomic groupings. For example, sclerosomatids utilize a variety of ketones and alcohols, and many Grassatores produce alkyl- phenols and hydroquinones (Hara et al. 2007, Raspotnig 2012 [2013], Gaetano & Machado 2013, Raspotnig et al. 2014). In some cases the secretion consists of a single compound (Shear et al. 2010a, b). However, in the case of the cyphophthalmids, the two species so far studied show as diverse an array of molecules as do the travunioids or even more so (Raspotnig et al. 2005, Jones et al. 2009, Raspotnig 2012 [2013]). Because cyphophthalmids are sister to all remaining Opiliones, the scanty data collected so far could be construed to suggest that early-evolving defensive secretions were complex mixtures, later winnowed down to only a few, or to single, components. Evidence against this view is that gonyleptoids, a derived group, also have complex mixtures, though the compounds are nearly all methylated and/or ethylated benzoquinones or alkylphenols (Fottinger et al. 2010, Raspotnig 2012 [2013]). However, the question that remains unexamined so far is the extent to which the method of collecting the secretions and the processing for analysis may have influenced the results; it is possible that chemical changes in some of the components could be induced during study, and this could account for the mixtures obtained.
Results of the character mapping for Travunioidea are shown in Fig. 4. The various compounds are represented by numbers that correspond to those in Fig. 2. Two major findings are seen in the parsimony reconstruction regarding the chemicals that constitute the major components. First, the major component N,N-dimethylphenylethylamine (9) was recovered as the ancestral state for all travunioid genera included in this analysis. Second, there is a transition from N,N-dimethylphenylethylamine (9) to anabaseine (7) as the major component on the branch leading to the eastern Cladonychiidae (Erebonuister and Theromaster). In addition, these two genera also possess many other minor or trace elements that are unique to this lineage, namely salycyl alcohol (3), anabasine (5), 2,3'-dipyridyl (6) and mellein (8). Also,
254
THE JOURNAL OF ARACHNOLOGY
Phenol
rnFumontana
sSoerensenella prehensor aSoerensenella sp. aNuncia sp. Springs Junction 1 aNuncia sp. Springs Junction 2 uNuncia sp. Dancing Creek sNuncia sp. Aratika tCryptomaster leviathan rnSpeleomaster pecki mSpeleomaster lexi rnErebomaster flavescens tTheromaster brunneus aHoloscotolemon lessiniense aHoIoscotolemon oreophilum aHoloscotolemon jaqueti mBrigssus flavescens tSpeleonychia sengeri aParanonychus brnnneiis aMetanonychus idahoensis aSclerobunus nondimorphicus
2. Benzothiazole
Fumontana
Soerensenella prehensor Soerensenella sp.
Nuncia sp. Springs Junction 1 Nuncia sp. Springs Junction 2 Nuncia sp. Dancing Creek Nuncia sp. Aratika Cryptomaster leviathan Speleornaster pecki Speleomaster lexi Erebomaster flavescens Theromaster brunneus Holoscotolemon lessiniense Holoscotolemon oreophilum Holoscotolemon jaqueti Brigssus flavescens Speleonychia sengeri Paranonychus brunneus Metanonychus idahoensis Sclerobunus nondimorphicus
9. N,N-dimethylphenylethylamine
sFumontana
^Soerensenella prehensor ^Soerensenella sp. sNuncia sp. Springs Junction 1
sNuncia sp. Springs Junction 2
[ ^ Nuncia sp. Dancing Creek
I ■ Nuncia sp. Aratika
Cryptomaster leviathan Speleomaster pecki Speleomaster lexi Erebomaster flavescens Theromaster brunneus Holoscotolemon lessiniense
^Holoscotolemon oreophilum
I [I nHoloscotolemon jaqueti
l^-am^mBrigssus flavescens ’’“tmm^.mSpeleonychia sengeri
aParanonychus brunneus mMetanonychus idahoensis aSclerobunus nondimorphicus
Fumontana
Soerensenella prehensor Soerensenella sp.
Nuncia sp. Springs Junction 1 Nuncia sp. Springs Junction 2 Nuncia sp. Dancing Creek Nuncia sp. Aratika Cryptomaster leviathan Speleomaster pecki Speleomaster lexi Erebomaster flavescens Theromaster brunneus Holoscotolemon lessiniense Holoscotolemon oreophilum Holoscotolemon jaqueti Brigssus flavescens Speleonychia sengeri Paranonychus brunneus Metanonychus idahoensis Sclerobunus nondimorphicus
6,7. 2,3’Dipyridyl and Anabaseine
rnFumontana aSoerensenella prehensor sp.
uNuncia sp. Springs Junction 1 aNuncia sp. Springs Junction 2 uNuncia sp. Dancing Creek uNuncia sp. Aratika 3 Cryptomaster leviathan aSpeleomaster pecki ttSpeleomaster lexi rnErebomaster flavescens aTheromaster brunneus rnHoloscotolemon lessiniense aHoloscotolemon oreophilum uHoloscotolemon jaqueti a Brigssus flavescens aSpeleonychia sengeri aParanonychus brunneus aMetanonychus idahoensis aSclerobunus nondimorphicus
c
10. Nicotine
uFumontana
aSoerensenella prehensor aSoerensenella sp. aNuncia sp. Springs Junction 1 aNuncia sp. Springs Junction 2 aNuncia sp. Dancing Creek aNuncia sp. Aratika 1 Cryptomaster leviathan aSpeleomaster pecki aSpeleomaster lexi nErebomaster flavescens iTheromaster brunneus aHoloscotolemon lessiniense rnHoloscotolemon oreophilum aHoloscotolemon jaqueti aBrigssus flavescens aSpeleonychia sengeri aParanonychus brunneus aMetanonychus idahoensis aSclerobunus nondimorphicus
Figure 3. — Results of chemical character mapping for Insidiatores. Only those chemicals with 2 or more steps are shown. Black = presence, white = absence.
SHEAR ET AL.— CHEMICAL DEFENSE OF INSIDIATORES
nioidea. Numbers correspond to the chemicals listed in Tables 1 and 2. Boxed numbers above a branch are character gains, those below are losses. Bold boxes are major components and regular boxes are minor/trace components. Dashed boxes represent those chemicals that are equally parsimonious (present/absent) along the branch; but branches with definite gains for these chemicals are also included. Boxes with asterisks indicate a change in component concentration (e.g., change from major to minor).
Erehomaster is the only taxon known to possess 4-hydro- xybenzenethanol (4). The sclerobunines (Sclerobiiuus and Metanonychus Briggs 1971) have lost phenol (1) as a component but have gained both nicotine (10) and N,N- dimethylisoamylamine (11). Interestingly, two species of Holoscotolemon also produce nicotine.
Raspotnig (2012 [2013]) discussed at length the possible phylogenetic and systematic implications of the diversity of defensive compounds in Opiliones. Overlooking some disso- nant results, it appears that the suborder Cyphophythalmi can be characterized by methyl ketones, naphthoquinones and related compounds. Benzoquinones appear in phalangiid Eupnoi, and “sclerosomatid compounds" (noncyclic ketones, alcohols and aldehydes, such as 4-methyl-3-hexanone) are found in sclerosomatid Eupnoi. Few Dyspnoi have been examined, but naphthoquinones and anthraquinones have been found. Grassatores produce predominantly phenols, benzoquinones and hydroquinones. Insidiatores, up to the findings of this study, were characterized by nitrogen- containing alkaloids. Raspotnig (2012 [2013]) is quick to point out that taxonomic sampling within the Opiliones has been erratic and many taxa remain unsampled, or known only from unpublished or preliminary results.
Raspotnig (2012 [2013]) proposed a number of phylogenetic hypotheses that may be summarized as follows: 1) complex mixtures of secretions are plesiomorphic compared to uniform or less diverse mixtures; 2) naphthoquinones and methyl ketones, as found in cyphophthalmids, are basal; 3) naphtho- quinones are synapomorphic for a clade Cyphophthalmi + Palpatores; 4) acyclic compounds in Cyphophthalmi and Sclerosomatidae may have a common origin; 5) “sclerosoma- tid compounds” may represent a synapomorphy for Palpa- tores; 6) a deep chemical divergence separates Insidiatores and Grassatores; and 7) a link between the chemistry of Cyphophthalmi -i- Palpatores and Laniatores remains to be found.
But the phylogenetic signal is not so clear as that. The dissonant results mentioned above seem to significantly
255
disrupt the characterizations given. Among the anomalies Raspotnig (2012 [2013]) mentions which require explanation are the presence of naphthoquinones in some putative sclerosomatids (Gy as sp.), ketones in some Gonyleptidae (Grassatores), and now, as a result of our work, methyl ketones (“sclerosomatid substances”) in Triaenonychidae and phenol in Fumontana deprehendor, a species that consistently is recovered in phylogenies as sister to remaining triaenonychids. At least these latter two make possible a tentative link between Laniatores and some Palpatores.
Caetano & Machado (2013) conducted a phylogenetic analysis of the distribution of scent gland chemistry in Grassatores, and concluded that benzoquinones were ances- tral, with alkylphenols evolving independently many times. Using the same data, but a different method of analysis and a different outgroup, Raspotnig et al. (2014) concluded the opposite — that benzoquinones were derived and alkylphenols ancestral. Based on the methods used and the fact that Raspotnig et al. (2014) used a more appropriate outgroup, we agree with the latter conclusion. Our finding that phenol is probably ancestral in Insidiatores (see Fig. 3) reinforces this, although exact phylogenetic relationships between Insidiatores and Grassatores remain unclear.
Raspotnig (2012 [2013]) did not attempt to map the known characters on any established phylogenetic tree of Opiliones. However, study of his Table 2 (pp. 9-10) and our Fig. 3 seems to indicate that at least at the present state of knowledge, there is a great deal of homoplasy present, with various types of compounds being lost and then regained, or evolving independently.
In our results for Insidiatores, the most divergent observa- tion is the presence of 4-methyl-3-hexanone as the major component in all of the New Zealand triaenonychids we studied. If we consider Fumontana as a plesiomorphic outgroup, we have the problem of getting from phenol to these noncyclic ketones. The travunioids stand alone with the predominant secretion of either N,N-dimethylphenylethyla- mine or tobacco alkaloids like nicotine and anabaseine. A major question, which by extension could be applied to the entire phylogenetic scheme of this character, is how one gets from one compound or set of compounds in a supposed plesiomorphic taxon to a chemically completely different compound further up in the tree. In other words, is it reasonable to assume a transition from phenol to 4-methyl-3- hexanone?
ACKNOWLEDGMENTS
Analysis facilities were provided by the Department of Chemistry at Virginia Military Institute. WAS thanks Dr. Fred Coyle for hospitality and guidance in western North Carolina, and Chris Bedel and the staff of the Edge of Appalachia Preserve, West Union, Ohio. Participation of WAS was supported by a grant from the Professional Development Committee of Hampden-Sydney College. Field- work in western North America was supported by grants from the American Arachnological Society Vincent Roth Fund for Systematic Research. Adrienne Richart, Nicholas Richart, and William P. Leonard helped secure specimens. Alexa R. Feist imaged specimens and accessioned images to MorphBank.
256
THE JOURNAL OF ARACHNOLOGY
LITERATURE CITED
Caetano, D. & G. Machado. 2013. The ecological tale of Gonylepti- dae (Arachnida, Opiliones) evolution: phylogeny of a Neotropical lineage of armoured harvestmen using ecological, behavioural and chemical characters. Cladistics 2013:589-609.
Derkarabetian, S. & M. Hedin. 2014. Integrative taxonomy and species delimitation in harvestmen: a revision of the western North American genus Sclerohimus (Opiliones: Laniatores: Travunioi- dea). PLOS ONE 9:el()4982. doi:10.1371/journal.pone00104982.
Derkarabetian, S., D.B. Steinmann & M. Hedin. 2010. Repeated and time-correlated morphological convergence in cave-dwelling har- vestmen (Opiliones, Laniatores) from montane western North America. PLOS ONE 5:el0388. doi:10.1371/journal.pone.0010388.
Derkarabetian, S., J. Ledford & M. Hedin. 2011. Genetic diversifi- cation without obvious genitalic morphological divergence in harvestmen (Opiliones, Laniatores, Sclerohimus robustus) from montane sky islands of western North America. Molecular Phylogenetics and Evolution 61:844-853.
Epka, O., J.W. Wheeler, J.C. Cokendolpher & R.M. Duffield. 1984. N,N-dimethyl- phenylethylamine and bornyl esters from the harvestman Sclerohimus robustus (Arachnida: Opiliones). Tetrahe- dron Letters 25:1315-1318.
Estable, C., M.I. Ardao, N.P. Brasil & L.F. Fieser. 1955. Gonyleptidine. Journal of the American Chemical Society 77:4942.
Fottinger, P., L.E. Acosta, H.J. Leis & G. Raspotnig. 2010. Benzoquinone-rich exudates from the harvestman Paclirlus paes- sleri (Opiliones: Gonyleptidae: Pachylinae). Journal of Arachnol- ogy 38:584-587.
Forster, R.R. 1954. The New Zealand Harvestmen (Sub-order Laniatores). Canterbury Museum Bulletin 2:1-329.
Giribet, G., L. Vogt, A. Perez Gonzalez, P. Sharma & A.B. Kury. 2010. A multilocus approach to harvestman (Arachnida: Opi- liones) phylogeny with emphasis on biogeography and the systematics of Laniatores. Cladistics 26:408-437.
Gnaspini, P. & M.R. Hara. 2007. Defense mechanisms. Pp. 374-399. Ill Harvestmen, the Biology of Opiliones. (R. Pinto-da-Rocha, G. Machado & G. Giribet, eds.). Harvard University Press, Cam- bridge, Massachusetts.
Hara, M., A. Cavalheiro, P. Gnaspini & D. Santos. 2005. A comparative analysis of the chemical nature of defensive secretions of Gonyleptidae (Arachnida: Opiliones: Laniatores). Biochemical Ecology and Systematics 33:1210-1225.
Hedin, M., J. Starrett, S. Akhter, A.L. Schonhofer & J.W. Shultz. 2012. Phylogenomic Resolution of Paleozoic Divergences in Harvestmen (Arachnida, Opiliones) via Analysis of Next-Gener- ation Transcriptome Data. PLOS ONE 7(8):e42888. doi:10.1371/ journal. pone. 0042888.
Jones, T., W.A. Shear & G. Giribet. 2009. The chemical defense of a stylocellid (Arachnida, Opiliones, Stylocellidae), from Sulawesi, with comparisons to other Cyphophthalmi. Journal of Arachnol- ogy 37:147-150.
Kury, A.B. 2003. Annotated catalog of the Laniatores of the New World (Arachnida, Opiliones). Revista Iberica de Aracnologia, volumen especial monografico 1:1-337.
Kury, A. 2007. Synthetonychiidae Forster, 1954; Travuniidae Absalon and Kratchovil, 1932; Triaenonychidae Sorensen 1886. Pp. 235-243. In Harvestmen, the Biology of Opiliones. (R. Pinto-
da-Rocha, G. Machado & G. Giribet, eds.). Harvard University Press, Cambridge, Massachusetts.
Kury, A.B. & A. Cruz Mendes. 2007. Taxonomic status of the European genera of Travuniidae (Arachnida, Opiliones, Lania- tores). Munis Entomology & Zoology 2:1-14.
Mendes, A.C. & A.B. Kury. 2008. Intercontinental Triaenonychi- dae— the case of Cenitonioiitici (Opiliones: Insidiatores). Journal of Arachnology 36:273-279.
Raspotnig, G. 2012 (2013). Scent gland chemistry and chemosyste- matics in harvestmen. Biologia Serbica 34:5-18.
Raspotnig, G., G. Fauler, M. Leis & H.J. Leis. 2005. Chemical profiles of scent gland secretions in the cyphophthalmid opilionid harvestmen, Siro duricorius and S. e.xilis. Journal of Chemical Ecology 31:1353-1368.
Raspotnig, G., V. Leutgib, M. Schaider & C. Komposch. 2010. Naphthoquinones and antrhroquinones from scent glands of a dyspnoid harvestman, Parcmeinastoma quadripimctatimi. Journal of Chemical Ecology 36:158-162.
Raspotnig, G., M. Schaider, P. Fottinger, C. Komposch & 1. Karaman. 2011. Nitrogen- containing compounds in the scent gland secretions of European cladonychiid harvestmen (Opiliones, Laniatores, Travunioidea). Journal of Chemical Ecology 37: 912-921.
Raspotnig, G., M. Bodner, S. Schaffer, S. Koblmiiller, A. Schonhofer & 1. Karaman. 2014. Chemosystematics in the Opiliones (Arach- nida): a comment on the evolutionary history of alkylphenols and benzoquinones in the scent gland secretions of Laniatores. Cladistics 2014:1-8.
Rocha, D., F. Wouters, D. Zampieri, T. Brocksom, G. Machado & A. Marsaioli. 2013. Harvestman phenols and benzoquinones: characterization and biosynthetic pathways. Molecules 18: 11429-11451.
Shear, W.A. 1977. Fimiontana deprelieiidor, n. gen., n. sp., the first triaenonychid opilionid from eastern North America (Opiliones: Laniatores: Triaenonychidae). Journal of Arachnology 3:177-183.
Shear, W.A. & S. Dekarabetian. 2008. Nomenclatorial changes in Triaenonychidae: Sclerohimus parvus Roewer is a junior synonym of Parammychus hrimiieus (Banks), Mutsimonyclius Suzuki is a junior synonym of Parmumychus Banks, and Kaolinonychidae Suzuki is a junior synonym of Paranonychinae Briggs (Opiliones: Triaenonychidae). Zootaxa 1809:67-68.
Shear, W.A., T.H. Jones & A.J. Snyder. 2010a. Chemical defense of phalangodid harvestmen: Bisliopella laciniosa and Texella hifurcata produce 2-inethyl-5- ethylphenol (Opiliones: Grassatores: Phalan- godidae). Bulletin of the British Arachnologica! Society 15:27-28.
Shear, W.A., A.J. Snyder, T.H. Jones, H.M. Garaffo & N.R. Andriamaharavo. 2010b. The chemical defense of the Texas cave harvestman ChimptipeUohimus madlae: first report on the family Stygnopsidae and on a North American troglobiont harvestman (Opiliones: Gonyleptoidea). Journal of Arachnology 38:126-127.
Thomas, S.M. & M. Hedin. 2008. Multigenic phylogeographic divergence in the palaeoendemic southern Applachian opilionid Fimiontana deprelieiidor Shear (Opiliones, Laniatores, Triaenony- chidae). Molecular Phylogenetics and Evolution 46:645-658.
Manuscript received / July 2014, revised 4 September 2014.
2014. The Journal of Arachnology 42:257-267
Species differences and geographic variation in the communal roosting behavior of Priomostemma
harvestmen in Central American rainforests
Gregory F. Grether*, Theresa L. AlJer^ Nicole K. Grucky', Abrahm Levi’, Carmen C. Antaky* and Victor R. Townsend, Jr,-: ‘Department of Ecology and Evolntionary Biology, University of California, Los Angeles, California 90095, USA. E-mail: ggrether@ucla.edu; -Department of Biology, Virginia Wesleyan College, 1584 Wesleyan Drive, Norfolk, Virginia 23502, USA
Abstract. Many species roost communally but the proximate causes and ultimate functions of this widespread behavior remain poorly understood. We studied the communal roosts of two undescribed species of harvestmen in the genus Prionostemma Pocock 1903 at a Caribbean rainforest site in southeastern Nicaragua. The species are quite similar in gross morphology but differ in body coloration, male genitalia, and roosting behavior. One species roosts primarily on spiny palms while the other species, which is darker in coloration, roosts inside buttress root cavities. In a mark-recapture study, the cavity-roosting species had higher levels of individual site fidelity than found previously in the spiny palm-roosting species, perhaps because suitable cavities are scarcer than spiny palms. The tree cavity aggregations were strongly male- biased, which our review of the literature suggests is unusual for harvestman roosts. The overall sex ratio of the spiny palm aggregations was 1:1, but some roost sites were strongly male biased while others were strongly female biased. Removing all harvestmen from 10 spiny palm roost sites shifted the overall sex ratio toward males on subsequent days, but the sites with skewed sex ratios remained skewed in the same directions despite complete turnover in roost membership. These results are discussed in relation to mechanisms of roost formation and possible sex differences in vagility, microhabitat preferences and sensitivity to disturbance. Both species also occur at La Selva Biological Station in Costa Rica but neither forms roosting aggregations in spiny palms or tree cavities there. A possible explanation for the geographic variation is that roosting patterns change over time through cultural drift.
Keywords: Aggregation, conspecific attraction, mark-recapture, Opiliones, sex ratio
Animals in diverse taxonomic groups congregate for the inactive period of the diurnal cycle, a behavior referred to as communal roosting (Eiserer 1984; Mallet 1986; Devries et al. 1987; Vulinec 1990; Alcock 1998; Bijleveld et al. 2010). Communal roosts may offer protection from predators through dilution or group defenses (Holmberg et al. 1984; Alcock 1998; Eisner 2004; Willemart & Gnaspini 2004). In some taxa, communal roosts may also provide thermoregula- tory benefits (Beauchamp 1999), mating opportunities (Blanco & Telia 1999), opportunities for food sharing (Wilkinson 1984), or information about the location of food patches (Beauchamp 1999; Kerth & Reckardt 2003; Bijleveld et al. 2010). Harvestmen (Opiliones) are generally active at night and roost during the day (reviewed in Machado & Macias- Ordonez 2007). Some species roost solitarily while others form aggregations ranging in size from a few individuals to hundreds (Holmberg et al. 1984; Cockerill 1988; Coddington et al. 1990; Machado et al. 2000; Willemart & Gnaspini 2004; Machado & Macias-Ordonez 2007; Wijnhoven et al. 2007; Wade et al. 2011). The communal roosts of harvestmen can be dense aggregations, in which most individuals are clinging to other individuals, or loose aggregations in which most individuals are in contact with the substrate (reviewed in Machado & Macias-Ordonez 2007). Some species roost in caves or other dark places (Holmberg et al. 1984; Willemart & Gnaspini 2004; Chelini et al. 2011), while other species roost on the exterior surfaces of rocks or vegetation exposed to sunlight (Coddington et al. 1990; Grether et al. 2014). The most frequently proposed functions of Neotropical harvest- man roosting aggregations are safety from predators, through dilution and/or chemical defenses, and protection from desiccation (Coddington et al. 1990; Machado et al. 2000;
Willemart & Gnaspini 2004; Machado & Macias-Ordonez 2007; Grether & Donaldson 2007; Wade et al. 2011; Chelini et al. 2011).
Studies of intra- and interspecific variation can provide insights into the proximate causes and ultimate functions of communal roosts (Chelini et al. 2012). In this paper, we compare the roosting aggregations of two syntopic species of Prionostemma Pocock 1903 (Eupnoi: Sclerosomatidae: Ga- grellinae) harvestmen at Refugio Bartola, a lowland tropical rainforest site in southeastern Nicaragua. One of the species usually aggregates on the fronds and trunks of spiny palms (Arecaceae: Bactris spp., Astrocaryum spp.) in the forest understory (Fig.l; Donaldson & Grether 2007; Grether & Donaldson 2007), while the other species aggregates in cavities at the base of trees (e.g., Fabaceae: Dipteryx panamensis) that have buttress roots (Fig. 2). Both species form loose aggrega- tions (Holmberg et al. 1984; Machado & Macias-Ordonez 2007) in which most individuals’ legs are in contact with the substrate and the legs are flexed. The species are quite similar in body size and anatomical proportions, but the cavity- roosting species is notably darker in coloration (Fig. 3). Based on scanning electron micrographs of male genitalia (Fig. 4), the same two undescribed species occur at La Selva Biological Station in Costa Rica (69 km to the SE), although neither is known to aggregate in spiny palms or tree cavities at La Selva (see Discussion). Following Proud et al. (2012), we refer to the species that aggregates in tree cavities at Refugio Bartola as Prionostemma sp. 1 and to the species that aggregates in spiny palms as Prionostemma sp. 2.
The population of Prionostemma sp. 2 at Refugio Bartola has been the subject of several short studies focused on clarifying the mechanisms of roost formation. Mark-recapture studies
257
258
THE JOURNAL OF ARACHNOLOGY
Figure 1. — Prioiiosteniina roosting aggregations underneath a frond (A) and along the trunk (B) of spiny palms.
established that individual harvestmen are not roost-site faith- ful (Grether & Donaldson 2007; Teng et al. 2012), and yet aggregations have formed in the same locations for over 10 years (Teng et al. 2012; Grether et al. 2014). The long-term use of specific sites does not appear to be a product of habitat limitation. Most spiny palms do not attract harvestman aggre- gations, and those that do are not distinctive in the characteristics of the palms themselves or microclimate (Grether & Donaldson 2007; Teng et al. 2012). Based on roost site manipulations and experimental translocations, it has been deduced that these harvestmen preferentially settle in sites marked with conspecific
scent (Donaldson & Grether 2007; Teng et al. 2012). Thus, the location of the communal roosts appears to be traditional in that some sites are used in preference to others only because conspecifics roosted there in the past (Donaldson & Grether 2007). While the mechanism of roost site selection in Prionos- temma sp. 2 may result in the repeated use of particular roosting sites for multiple years, the same mechanism could also cause populations to drift in roosting microhabitat over longer time scales. Our finding that the same species is present but does not roost in spiny palms at La Selva Biological Station provides tentative support for this cultural drift hypothesis (see Discussion).
GRETHER ET AL.— -VARIATION IN HARVESTMAN COMMUNAL ROOSTING BEHAVIOR
259
Figure 2. — Distant (A) and close-up (B) photographs of a tree cavity with a Prionostemma roosting aggregation.
The aggregations of Prionostemma sp. 1 in buttress root cavities were first discovered at Refugio Bartoia in February 2013 and have not been described previously. To begin to characterize the roosting behavior of this species, and to compare it to that of Prionostemma sp. 2, we made structured behavioral observations and conducted a mark-recapture study. Comparable data have already been published for Prionostemma sp. 2 (Donaldson & Grether 2007; Grether & Donaldson 2007; Teng et al. 2012), so we did not duplicate this work. Instead, we carried out a removal experiment at spiny palm aggregation sites (see Grether et al. 2014). In the context of the species comparison, the primary relevance of the removal experiment is that it yielded data on Prionostemma sp. 2 roost sex ratios, which have not been reported previously. To help place our findings into a broader context, we also analyze data on harvestman roost sex ratios reported in the literature.
METHODS
Study area. — This study was carried out in primary lowland rainforest at Refugio Bartoia in southeastern Nicaragua (10.973°N, 84.339°W) from 2-20 February 2013. This private reserve is contiguous with Indio Maiz Biological Reserve, the largest remaining tract of primary rainforest in Central America (ca. 4500 km^). The climate is wet tropical, with about 4 m of rainfall per year, peak precipitation in June- August, and a dry season from February-Aprii during which about 15% of the annual precipitation is recorded (Cody 2000). Approximately 69 m.m of rain fell at Refugio Bartoia during the study period.
Operational definitions. — We use the term roosting aggre- gation to refer to groups of two or more individuals resting in the same “site”. In the case of spiny palm roosts, we consider all of the spiny palms within 1 m of each other to belong to the same site (spiny palms tend to grow in clusters with broadly overlapping fronds). In the case of tree cavity roosts, we consider a single cavity to be a site. While roosting individuals of both study species are often close enough together to have overlapping legs (Figs. 2, 3), we did not use leg overlap as a criterion for determining aggregation membership (cf. Willemart & Gnaspini 2004).
Roost measurements and behavioral observations. — Using flashlights, we searched for harvestman roosts at the base of 1 14 buttressed trees. At the first seven tree cavities in which Prionostemma roosting aggregations were found, we measured air temperature, surface temperature, and percent humidity both within the cavity and outside the cavity using a hygro- thermometer and infrared thermometer (Extech Instruments Waltham, MA USA). In addition, we measured the height, width, depth and compass orientation of the cavity, and the tree’s circumference at breast height. To characterize the behavior of the harvestmen in the cavity roosts, we used scan sampling (Altmann 1974). Under red light, we observed six of the cavity roosts used in the mark-recapture study for 15 minutes, recording at 1 -minute intervals the number of harvestmen that were stationary or engaged in the following behaviors: walking within the cavity; bobbing (moving body up and down, a likely anti-predator behavior; Holmberg et al. 1984; Grether and Donaldson 2007); ventral rubbing (pressing
260
THE JOURNAL OF ARACHNOLOGY
Figure 3. — Photographs of two Prionostemma species at Refugio Bartola, Nicaragua. Two female specimens are each shown in dorsal (A, B), ventral (C, D), and lateral (E, F) views. The female on the left was found in a tree cavity roost (Prionostemma sp. 1) and the female on the right was found in a spiny palm roost (Prionostemma sp. 2). Prionostemma sp. 2 is more uniform and lighter in coloration than Prionostemma sp. 1. The black coxae (I-III) and red and black patches on the abdomen of the Prionostemma sp. 1 specimen are typical of this species. Scale bar = 5 mm.
against substrate and moving body forward, a possible scent- marking behavior; Donaldson and Grether 2007; Wiilemart and Hebets 2011); and leg threading (moving leg through mouth parts, a self-grooming behavior; Edgar 1971; Pereira et al. 2004; Teng et al. 2012).
Mark-recapture study. — To measure daily turnover in the tree cavity aggregations, and to check for movement between nearby tree cavity and spiny palm roosts, we marked and recaptured harvestmen at seven tree cavity roosts (two other tree cavity roosts were found too late in the study period to be included in the mark-recapture study). All harvestmen in a cavity were captured by hand between 0900 and 1630 h and placed in a mesh cage (Bioqiiip Products). Individuals that initially were too deep inside the cavity to be captured were ilushed out with a stick. The harvestmen were sexed, inspected for ectoparasitic larval mites, marked on the dorsal surface of
the abdomen with small dots of paint (Marvy Decocolor, ‘ Uchida of America, Torrance, CA) in color combinations i corresponding to the capture date and location, and then released in their original cavities. This procedure was carried out on three consecutive days at each aggregation site and a jj final recapture was done on the fourth day. On all four days at | each site, we also searched for marked harvestmen on all j
buttress roots and spiny palms within a 10 m radius. 1
Recaptured individuals were given additional paint dots ! corresponding to the location and date of recapture. During this study, we marked 257 harvestmen.
Removal experiment. — Concurrent with the mark-recapture !, study, we captured and removed all of the harvestmen from 10 spiny palm roosts on at least four consecutive days and for up ! to six consecutive days if the site continued to attract new harvestmen. The animals were captured by hand and held temporarily in a mesh cage. Individuals that initially were too i high to be captured were chased down with a wooden pole. I, The harvestmen were sexed, marked on the dorsal surface of the abdomen with small dots of paint identifying the capture ' location, and released at least 50 m away from the aggregation site on the trunk of another spiny palm. During the j experiment, we removed 989 harvestmen (37-224 per site).
At each removal site, we took a standard set of ro.easure- | ments, including canopy cover, crown height, spine density, | and trunk diameter (the first three factors have been found to correlate with the size of Prionostemma sp. 2 aggregations; Teng et al. 2012). Canopy cover was measured with a concave spherical densiometer (Forestry Suppliers Inc, Jackson, MS, USA). Crown height was measured with a graduated pole, and trunk diameter was measured with a ruler, on all of the spiny palms at a site. Spine density was measured by placing a 4 cm^ wire quadrat on the trunk of the palms and counting all spines ; originating within the quadrat. The quadrat was placed at f three different heights above the ground (0.8, 1.15, and 1.55 m) in the four cardinal directions around the trunk. If a site had '!
more than five spiny palms within 1 m of each other, spine j
density was measured on half of the trees chosen at random. Il
One observer made ail measurements of a particular type. Site ||
averages for spine density, crown height and trunk diameter i|
were used in the analysis. ji
Analysis of harvestman communal roost sex ratios from j|
the literature. — We searched the primary literature for reports i
of the sex ratio of harvestman communal roosts. For inclusion li
in our statistical analysis, a report needed to contain one of the l|
following kinds of data on the sex ratio at communal roosts: |
the number of individuals of each sex, the total number of ,
individuals and the sex ratio, or the sex ratio and its standard j
deviation. We did not impose our operational definitions of terms such as aggregation and roosting site (see above) on I
other studies but instead accepted the definitions used in the original studies. For example, some researchers define aggregations as groups of three or more individuals with overlapping legs (e.g., Wiilemart & Gnaspini 2004). However, j
we do not believe this compromised the validity of our ||
literature review. In cases of multispecies aggregations (e.g., )
Machado & Vasconcelos 1998; Chelini et al. 2012), we :
analyzed the data for each species separately. Because a [
sample size of five is the minimum required to establish ji
whether a sex ratio deviates significantly from 1:1 with a
GRETHER ET AL.— VARIATION IN HARVESTMAN COMMUNAL ROOSTING BEHAVIOR
261
Figure 4. — Scanning electron micrographs of male genitalia. The genitalia of the species of Prionosteimna that typically roosts in spiny palms at Refugio Bartola, Nicaragua (A, B) is very similar to that of Prionostemma sp. 2 (Proud et al. 2010) at La Selva, Costa Rica (E, F) in both shape and proportion. There is a small difference in the shape of the stylus - in panel F the stylus attenuates but in panel B it does not. Nevertheless, these are probably the same species. The curling of the alates (winglets) just before the glans on the Nicaraguan specimen (A) is an artifact. The species that roosts in tree cavities at Refugio Bartola (C, D) is undoubtedly the same species as Prionostemma sp. 1 at La Selva (G, H). The large structure at the base of the penis (best seen in panel H), the lateral expansions (alates), and the stylus are identical in size and shape, as viewed from both dorsal (C, G) and ventral perspectives (D, H), to Prionostemma sp. 1 at La Selva. Scale bar = 50 /mi.
binomial test, we excluded sex ratios based on sample sizes smaller than five. We also excluded sex ratios based on samples that likely included solitary roosting or non-roosting harvestmen (e.g., Tsurusaki 2003). Because harvestmen can live for years as adults (Gnaspini 2007), we did not pool data from repeated visits to the same sites and instead analyzed
data from different months and seasons separately. In the case of the study of Mestre and Pinto-da-Rocha (2004), we chose one month per season that best represented the average sex ratio of all the months in that season. In the case of the study of Willemart and Gnaspini (2004), we pooled data from different aggregation sites but analyzed each collection date
262
THE JOURNAL OF ARACHNOLOGY
Table 1. — Summary of mark-recapture study results. From left to right: the day of the study, the total number of harvestmen captured, the number that were unmarked until that day {i.e., not captured previously), the number that were marked from any previous capture, the percentage that were marked from any previous capture, the number returning on the next day, and the percentage returning on the next day.
|
Day |
Total |
Unmarked |
Marked |
% Marked |
Returning |
% Returning |
|
1 |
172 |
172 |
_ |
- |
96 |
55.8% |
|
2 |
141 |
45 |
96 |
68.1% |
69 |
48.9% |
|
3 |
108 |
25 |
83 |
76.9% |
30 |
27.8% |
|
4 |
57 |
15 |
42 |
73.7% |
- |
- |
separately because the sex ratio varied significantly within seasons.
Statistics. — Wilcoxon signed-rank tests were used to com- pare the microclimate inside and outside of cavities, because these data are paired by site. Skillings-Mack tests (nonpara- metric equivalents of repeated measures ANOVAs) were used to compare the change in harvestman numbers over time, because there were more than two time points. Binomial tests were used to compare the observed sex ratios to 0.5. Fisher exact tests were used to test for associations between nominal variables (e.g., sex and mite presence). Spearman rank correlations were used to test for correlations between continuous variables (e.g., roost sex ratio and canopy cover). For comparisons involving small sample sizes (e.g., number of roosts), we computed the P-values by permutation. All reported F-values are two-tailed. Ranges, means and standard deviations are provided to facilitate comparisons to other studies. Stata 12.1 (StataCorp, College Station, TX, USA) was used for the computations.
RESULTS
Roost characteristics and behavioral observations. — We
found Prionostemma sp. 1 aggregations in nine (7.9%) of 114 buttressed trees examined. Solitary harvestmen of Cosmetidae species (e.g., Cynorta spp. Koch 1839, Eucynorta spp. Roewer 1912) were often found on the surface of the roots and in the gaps between them, but the Prionostemma aggregations were found only in cavities (i.e., holes) just above ground level. The cavities with Prionostemma aggregations seemed relatively narrow (mean ± sd, 0.34 ± 0.15 m, n =1) and deep (0.58 ± 0.12 m, n =7), compared to unused cavities. Trees with cavity roosts ranged in circumference from 1.25-8.14 m (mean ± sd, 3.72 ± 2.38 m, n = 7). Canopy cover readings taken at the base of the trees ranged from 92.7-96.7% (mean ± sd, 94.4 ± 1 .4%, n = 7). The daytime surface temperature was consistently 1-2 °C lower inside the roosting cavities (mean ± sd, 25.0 ± 0.8 °C) than immediately outside (mean ± sd, 26.3 ± 1.4 °C; Wilcoxon signed-rank test, T — Q,n — 1, P = 0.018). There were no significant differences in daytime air temper- ature or humidity inside the roosting cavities (air temperature, 27.0 ± 0.8 °C; humidity, 86.1 ± 6.0%) compared to immediately outside (air temperature, 27.0 ± 0.8 °C, Wilcoxon signed-rank test T - 2, n = 1 , P — 0.29; humidity, 88.7 ± 10.3%, T = \, n = 1, P ^ 0.08). During behavioral observations made at the aggregation sites during the day.
Table 2. — Numbers of females (Nj) and males (N,„) and the sex ratio, calculated as the proportion female (Pj), at tree cavity roosts on the first day of the mark-recapture study, sorted from the most male- biased to the least male-biased. Binomial tests (BT) compare the observed sex ratio to 0.5. Two-tailed F-values are shown for samples with n > 5. With a sequential Bonferroni correction for multiple tests (Holm 1979), across the six T-values in the table, the criterion for statistical significance at a = 0.05 is P < 0.05.
|
Tree cavity |
Nr |
N,„ |
Pf |
P |
|
I |
2 |
18 |
0.1 |
0.0004 |
|
2 |
1 |
8 |
0.11 |
0.04 |
|
3 |
3 |
16 |
0.16 |
0.004 |
|
4 |
10 |
44 |
0.19 |
< 0.0001 |
|
5 |
8 |
28 |
0.22 |
0.001 |
|
6 |
8 |
23 |
0.26 |
0.01 |
|
7 |
1 |
2 |
0.33 |
- |
most individuals were either stationary (mean of the site scan sampling means, 77.5%) or bobbing (19.2%). Some individ- uals were walking within the cavity (2.0%), but no leg- threading, ventral rubbing, foraging, or reproductive behav- iors (e.g., mating, egg laying) were observed.
Mark-recapture study. — The maximum daily return of Prionostemma sp. 1 to the cavity roost where they were marked (i.e., from one day to the next) ranged from 44.4- 77.4% per site (n — 7; mean ± sd, 59.4 ± 12.1%). Marked harvestmen were recaptured on 221 occasions and always in the same cavity where they were originally marked.
Despite the relatively high return rates, capturing and marking Prionostemma sp. 1 evidently reduced their likelihood of returning. The total number of Prionostemma found in the cavity roosts decreased from 172 on the first day to 141 on the second day, 108 on the third day, and 57 on the fourth day (Table 1). The change over time in harvestmen numbers was highly significant (Skillings-Mack test, SM = 15.3, simulation P < 0.0001). As the total number of harvestmen declined, the proportion of harvestmen that carried marks from any previous day’s capture remained relatively stable but the proportion of harvestmen returning on the next day declined over time (Table 1).
Because recaptured individuals were given new marks on each day, we were able to infer that some individuals returned repeatedly to the same cavity. Of the 57 harvestmen found in the final recapture, 42 (73.7%) were present on a prior day, 32 (56.1%) were present on at least two prior days, and 17 (29.8%) were present on all three prior days.
Within the 10-m radii of the seven cavity roosts in the mark- recapture study, there were 35 other buttressed trees and 40 spiny palms. Prionostemma aggregations were found in one (2.8%) of these buttressed trees and two (5%) of the spiny palms. Only two harvestmen in the mark-recapture study were found away from the buttressed tree where they were marked. One was found on the trunk of another buttressed tree and the other was found in a spiny palm aggregation. In both cases, the marked individuals were within the 10-m radius of the cavity where they were marked (as opposed the 10-m radius of a different roost cavity).
The sex ratio at cavity roosts was strongly male-biased both overall (50 females, 207 males, proportion female = 0.24; binomial test P < 0.0001) and at all seven of the mark- recapture sites (Table 2; proportion female among all animals
GRETHER ET AL.— VARIATION IN HARVESTMAN COMMUNAL ROOSTING BEHAVIOR
263
Table 3. — Numbers of females (N/) and males (N,„) and the proportion female {P/) at spiny palm roosts prior to the first removal and after the first removal. Roost sites are sorted by Pf prior to the first removal, from the most male-biased to the most female-biased. Binomial tests (BT) compare the observed sex ratio to 0.5. Fisher’s exact tests compare the pre-removal sex ratio to the post-removal sex ratio. Two-tailed F-values are shown. With a sequential Bonferroni correction for multiple tests (Holm 1979), across all 30 P-values in the table, the criterion for statistical significance at oc = 0.05 is P < 0.003.
|
Spiny palm |
Prior to first removal |
After first removal |
Fisher 's exact P |
||||||
|
Nr |
N,„ |
Pf |
P |
Nr |
N,„ |
Pi |
P |
||
|
1 |
1 |
24 |
0.04 |
< 0.0001 |
3 |
9 |
0.25 |
0.14 |
0.09 |
|
2 |
5 |
37 |
0.12 |
< 0.0001 |
1 |
18 |
0.05 |
0.0008 |
0.65 |
|
3 |
15 |
91 |
0.14 |
< 0.0001 |
11 |
107 |
0.09 |
< 0.0001 |
0.30 |
|
4 |
8 |
34 |
0.19 |
< 0.0001 |
6 |
30 |
0.17 |
0.0007 |
1.0 |
|
5 |
17 |
14 |
0.55 |
0.72 |
28 |
50 |
0.36 |
0.02 |
0.09 |
|
6 |
58 |
36 |
0.62 |
0.03 |
13 |
46 |
0.22 |
<0.0001 |
< 0.0001 |
|
7 |
43 |
25 |
0.63 |
0.04 |
11 |
30 |
0.27 |
0.004 |
< 0.0001 |
|
8 |
31 |
7 |
0.82 |
0.0001 |
17 |
2 |
0.89 |
0.007 |
0.70 |
|
9 |
56 |
7 |
0.89 |
< 0.0001 |
41 |
17 |
0.71 |
0.002 |
0.02 |
|
10 |
16 |
2 |
0.89 |
0.001 |
15 |
7 |
0.68 |
0.13 |
0.15 |
marked, range 0.10-0.28). There was no significant variation among roost sites in the sex ratio of harvestmen marked during the first capture (Fisher’s exact test, P = 0.77) or across all of the harvestmen marked during the study (P = 0.27), nor did the overall sex ratio change significantly over time from the first capture to the last recapture (Fisher’s exact test, P - 0.53). Of the 221 recaptures, 50 (22.6%) were female, which did not differ significantly from the overall sex ratio (binomial test P = 0.69). Thus, males and females exhibited similar levels of individual site fidelity.
Figure 5. — Variation in, and effects of the removal treatment on, the sex ratio at spiny palm roosting sites. Each point represents the sex ratio (proportion female) before and after the removal treatment commenced at 10 established aggregation sites. The dashed line has a slope of 1 and thus points below the line indicate that the sex ratio decreased after the removal treatment began. See text for statistical results.
Red ectoparasitic larval mites were found on 21 (8.2%) of the 257 individuals marked in cavity roosts. The maximum number of mites per individual was three and most mites (24 of 26) were attached to legs. There was no significant sex difference in mite prevalence ( 1 6 of 207 males and 5 of 50 females; Fisher’s exact test, P - 0.57). Mite prevalence varied significantly among sites (Fisher’s exact test, P < 0.0001). No mites were found infesting harvestmen at four of the seven sites. At the site with the highest mite prevalence, 14 of 45 individuals (31.1%) had at least one mite. By comparison, mites were rare at the Prionostemma sp. 2 spiny palm aggregations during this study (fewer than 1 in 50 individuals; G.F.G et al., pers. obs.).
Removal experiment. — The removal treatment had an unexpected effect on the sex ratio at Prionostemma sp. 2 roosts. While the overall sex ratio was approximately 1:1 at the first removal (Table 3; 250 females, 277 males, proportion female = 0.49; binomial test P = 0.26), it was significantly male-biased in subsequent removals (total count: 146 females, 316 males, proportion female = 0.37; binomial test P < 0.0001). A sex ratio shift of this magnitude is very unlikely to have occurred by chance (Fisher’s exact test, P < 0.0001). Seven of the 10 sites had strongly skewed sex ratios (female biased, n = 3; male biased n - 4), and despite complete turnover in roost membership, the initial and subsequent (i.e., post-removal) sex ratios were strongly correlated across sites (Fig. 5, Spearman rank correlation r^ = 0.79, n = \0 sites, P - 0.008). As shown in Fig. 5, three sites that initially had weakly female-biased sex ratios all shifted to having male-biased sex ratios, three sites that initially had strongly female biased sex ratios remained strongly female-biased, and four sites that initially had strongly male-biased sex ratios remained strongly male-biased. None of the measured site characteristics correlated significantly with the initial roost sex ratio (canopy cover I's = 0.22, u - 10, F = 0.53; spine density r^ = -0.02, P - 0.95; crown height r, = 0.44, P = 0.20; trunk diameter r, = -0.52, P = 0.14).
All 989 of the harvestmen removed during this experiment were marked and released on other spiny palms. For the duration of the study, none of the marked harvestmen returned to the site where they were initially captured.
264
THE JOURNAL OF ARACHNOLOGY
However, six marked individuals, from three different release sites, were found inside the same tree cavity in the mark- recapture study. The distance between the release sites and this tree cavity ranged from 28-^5 m and the harvestmen were found there 1-2 days after they were released.
Harvestman communal roost sex ratios from the literature. — We found data on the sex ratios at communal roosts of 12 harvestman species in the published literature. Most of the reported communal roost sex ratios did not deviate signifi- cantly from 1:1 (Tabled). Significantly female-biased com- munal roost sex ratios were found in Goniosoma albiscriptiim Mello-Leitao 1932 at one of seven sampling dates in 2000 (Willemart & Gnaspini 2004) and in a multi-year study of Goniosoma longipes Roewer 1931 (Machado et al. 2000), both at caves in southeastern Brazil. Tsurusaki (2003) reported significantly male-biased sex ratios in general collections of two harvestman species in Japan, but whether these species form roosting aggregations was not stated. Prinostemma sp. 1 appears to be the only known example of a harvestman with strongly male-biased communal roost sex ratios.
DISCUSSION
Roosting behavior (Mestre & Pinto-da-Rocha 2004; Will- emart & Gnaspini 2004), sex ratios (Chelini et al. 2012), and mite infestation levels (Townsend et al. 2006) are all known to vary seasonally in harvestmen, so it cannot be assumed that the species differences that we observed hold year round. With that caveat, the preferred roosting microhabitats of the two Prionostemma species at Refugio Bartola during the dry season could scarcely be more distinct. All of the Prionos- temma sp. 1 aggregations that we found were inside cavities at the base of buttressed trees, while Prionostemma sp. 2 aggregations are usually found several meters above the ground in spiny palms (Grether & Donaldson 2007). Some marked individuals were found moving between tree cavity and spiny palm aggregations, however, and a review of photos taken of roosting aggregation in previous years yielded three additional cases of individuals with the coloration of Prionos- temma sp. 1 in spiny palm aggregations (G.F.G., pers. obs.). The extent to which these species intermingle at roost sites remains to be quantified. Solitary individuals of Cosmetidae harvestmen (e.g., Cynorta, Eucynorta) are often found in Prionostemma aggregations as well (unpublished data).
In mark-recapture studies, Prionostemma sp. 1 showed much higher daily return rates (up to 11%) than Prionostemma sp. 2 (up to 26%; Grether & Donaldson 2007). A likely explanation is that suitable tree cavities are scarce compared to spiny palms. Another possible explanation is that cavity roosts are easier for the harvestmen to relocate.
We found ectoparasitic larval mites on 8% of the Prionostemma sp. 1 and on less than 1 % of the Prionostemma sp. 2. Whether this is causally related to the species difference in roosting habitat is unknown but seems possible. Species differences in larval mite infestation rates have previously been linked to species differences in foraging habitats (Townsend et al. 2008).
We have found evidence for handling effects in both species (see Grether & Donaldson 2007 for the Prionostemma sp. 2 evidence), but the rapid decrease over time in the number of Prionostemma sp. 1 at the mark-recapture sites leaves little
doubt that capturing these animals makes them less likely to return to the same site. Harvestmen have been shown to have spatial associative learning ability (dos Santos et al. 2013) and may avoid sites where they have previously been disturbed. Another possible explanation is that captured harvestmen release defensive chemicals (Machado 2002; Machado et al. 2002; Eisner 2004; Rocha et al. 2013) that persist at the site of disturbance and make it less attractive for roosting. In any case, the decreasing return rate over time (Table 1) suggests that these harvestmen would rapidly abandon a site where they were disturbed repeatedly.
Perhaps the most interesting species difference found in our study at Refugio Bartola is the difference in roost sex ratios.
The Prionostemma sp. 1 aggregations were strongly male biased (76% male), which may be rare in harvestmen. The communal roosts of some insects are male biased (Alcock 1998; Switzer & Grether 1999), but our review of the literature turned up no other harvestman examples (Table 4). Most harvestmen aggregation sex ratios reported in the literature do not differ significantly from 1:1, but female biases have been reported in several Laniatores species (Table 4). In some cases, the sex ratio at communal roosts may merely reflect the population sex ratio (Chelini et al. 2012), and female-biased population sex ratios may be indicative of facultative parthenogenesis (Tsurusaki 1986, 2003). Willemart and Gnaspini (2004) found that the communal roosts of Gonio- soma albiscriptum (Laniatores: Gonyleptidae) were more female-biased than the population sex ratio and hypothesized this is because males are more aggressive and less gregarious [ than females. Goniosoma albiscriptum roosting aggregations break up during the peak reproductive season, perhaps because females become intolerant of conspecifics while guarding their eggs and males become intolerant of all other males (Willemart & Gnaspini 2004). A similar mechanism j could potentially account for male-biased roost sex ratios, if ! males continued to roost communally while females roosted j away from aggregation sites to guard their eggs. We did not encounter egg-guarding females during our study, however. i Thus, the male-bias of Prionostemma sp. 1 communal roosts is a mystery that merits further study.
Although the overall sex ratio of Prionostemma sp. 2 roosts did not differ from 1:1, most of the aggregation sites were strongly sex biased. In the removal experiment, sites that initially had weakly female-biased sex ratios became male- biased while sites with strongly skewed sex ratios remained , skewed in the same directions despite complete turnover in roost membership (Table 3, Fig. 5). A possible explanation for the shift in the overall sex ratio is that males are more vagile than females, as has been reported for other species of harvestmen and for arachnids generally (reviewed in Will- emart and Gnaspini 2004). If removing the harvestmen from an aggregation site temporarily depletes the local pool of potential recruits, males may move into the area first, resulting in a temporary male bias in the roost sex ratio. But why would some sites attract mainly females? Sex differences in roost-site preferences could potentially explain the pattern, but none of the roost characteristics that we measured were predictive of the sex ratio. Another possible explanation is that the sexes differ in their scent-marking chemicals and are most strongly [ attracted to same-sex scent. The latter hypothesis could be
Table 4. — Sex ratios of harvestman roosting aggregations reported in the literature. Abbreviations in column titles: Mo., month; Nag_ number of aggregations sampled; number of females; N„„ number of males; P/, proportion female; Sig., significance level of statistical test versus Pf = 0.5; Ref., source of data. Country codes: BR, Brazil; NL, Netherlands; NI, Nicaragua; US, United States. Season codes: Sp, spring; Su, summer, W, winter; F, fall. F-values for 2-tailed tests: NS P > 0.1; % P < 0.1; *P < 0.05; **P < 0.01, ***p < 0.001. Reference codes: 1, Machado and Vasconcelos 1998; 2, Mestre and Pinto-da-Rocha 2004; 3, Willemart and Gnaspini 2004; 4, Machado et al. 2000; 5, Machado 2002; 6, Chelini et al.
GRETHER ET AL.— VARIATION IN HARVESTMAN COMMUNAL ROOSTING BEHAVIOR
c. c
:3 -o
oooooooooooooodooooooo
— (N — I I m (N ^ ^
I I I I I
>. >.
o
O- 3
D. ■
3^0 5
TD
? =
^ is < S
= g-^l
< M Q S
O
I
JO ^
- s->
C 3 3 >5
|
c |
sJ Q2. |
cC |
||
|
3 0 0 |
s pq S c.' |
CQ 3 |
CQ 3^ |
i22 3*^ |
|
] |
.v C |
C |
C |
C |
|
'O ^ |
3 Un |
3 S.H |
3 u. |
u
S3 3
a, e-
c4
£Q
O
i§ «;
s ®
. e
.£■ is
U 0-
c/5 C/3 c/5
ea 02
-2" ^ =3 3
eu cu
o o
?c3
00 02
CiC
ca 00
3 3 3 3 CL Pu
O O j3 ?3
cci CsC 20 02
o o
/3 /3 C/D GO
c/3 c/5 C/)
ua.)a)DD(D<i>a>
O
r2 .-S
L -
U 3 3
M u u
3 O
r£ .-S
3 3
u u
^ —
^ r ^
^ U
Ox) Dm Om Cl Oh Oh
o o
j3 /3
O O /3 ?3
•U D O D D
r2 r£
5 5
:£ :2 5 5
rS rS
5 5
DC ca - C4 .2 02 3 .
3 O
a. -3 o 3 (3 Oh
^ O ^ ^ j3 ^
.S o' 3''
tr: ^ c
a.2 £
5 ^ 3 0:; 3 0.
_ u -
3 3
3; O .£3
iS -a -o:
o 3 i2
2 J3 3
U
c4 oi oa 02
^ k: oi m m oa
Uh
3 3 ^ X)
^33
CL Oh
3 O O u- »3 <3 3 GO (X 0« . .
3 X 3 ■X >
(U (D
u. Ui (U
3 3 3
U CJ U .S ^
s. 5- S-
.s.
p. h
L L) S.J
O
5 -a -a -a -a q Q Q Q Q
s
Q,
sj So i>5 *>5 =>5
O O O
:3
2
5
>5
,0
•I ^
s: s*-
^ C)
L L L L
^
A Co Co
1^D(DQ.)DiDa.)<liD(L><Uil>iU(L/<l.><UDDO(D(Ui3J
3333333333333333333333
CLD^Cl,a.D-a,Cl.Q.CLCLCLCLCua-a< (Uaja.>Cl><L)aj(D(L>D<D<U<U(U^^
Gccccccccccccccncccccc
0000000000000000000000
0000000000000000000000
r-* 00 o^ o^
G2 GO * Z tjcn Z *
Leiobunidae Leiobimum townsendi Austin, Texas, US Sep (Su) 1 157 167 0.48
Leiobunidae Leiohwnmi sp. NL - - 349 304 0.53
Sclerosomatidae Prionostcmma .sp. 2 Refugio Bartola, Rio San Juan, NI Feb (W dry) 10 250 111 0.47
Sclerosomatidae Prionostemnui sp. I Refugio Bartola, Rio San Juan, NI Feb (W dry) 7 33 139 0.19
266
THE JOURNAL OF ARACHNOLOGY
tested with single-sex group translocations. If females are more strongly attracted to female scent than are males, sites where only females are released should attract more female than male recruits on subsequent days.
In contrast to the sharp habitat distinction that we found at Refugio Bartola, at La Selva Biological Station both Prkmostemma species are typically found on the vertical surfaces of medium to large tree trunks or buttresses and nearby shrubs (Proud et al. 2012). Harvestman roosting behavior can change seasonally (Holmberg et al. 1984; Chelini et al. 2011), so it is important to consider whether the reported differences between sites could be an artifact of the timing of the research conducted at the two sites. At Refugio Bartola, Prionosteninia sp. 2 has been studied between the months of January and May, which includes the dry season (February- April) and parts of the wet season. Spiny palms are used as roosting sites throughout this period, and the observation that the locations of the communal roosts are stable from one year to the next (Teng et al. 2012; Grether et al. 2014), combined with what is known about the mechanism of roost formation (Donaldson & Grether 2007), indicates that spiny palms are used as aggregation sites year-round at this site. That is, if the communal roosts were abandoned for part of the year, they would presumably form in different spiny palms in different years, because individuals are not roost-site faithful and suitable spiny palms are not limiting (Donaldson & Grether 2007; Grether & Donaldson 2007; Teng et al. 2012). At La Selva Biological Station, harvestmen have been studied in both the dry and wet seasons, and one of us has searched for Sclerosomatidae aggregations in spiny palms and the but- tresses of large trees during both seasons and encountered none (V.R.T., pers. obs.). Thus, we are confident that Prionosteninia roosting behavior differs between the sites.
How might population differences in roosting patterns arise? We first consider a sort of null model of the roost formation process. If individual harvestmen had no micro- habitat preferences and roost formation was based solely on conspecific attraction (including scent-mark detection), then the locations of roosting sites would be expected to drift randomly over time through chance colonization events. Under this null model, we would expect communal roosts to form repeatedly at the same locations but not exclusively in a specific microhabitat. Aggregations would be expected to persist longer at sites where the harvestmen survived at higher rates, however, and this could lead to a pattern in which, at any given time, most aggregations formed in microhabitats that offered protection from predators, desiccation, etc. Thus, geographic variation in roosting patterns could arise simply through chance events and variation in the factors that intluence survival rates in different microhabitats (predator species, climate, etc.). A more realistic model would have individuals searching for roosting aggregations in the micro- habitats where they are most likely to form, either because of associative learning or because microhabitat preferences evolve to track roosting patterns, or some combination of these mechanisms. Nevertheless, the sort of cultural drift envisioned in the null model seems likely to play some role in population differentiation.
One way to investigate the relative importance of habitat preferences versus conspecific attraction would be to seed new
Prionosteninia aggregations in different kinds of vegetation, using the group translocation method (Teng et al. 2012), and follow their fate. At Refugio Bartola, Prionostemma sp. 2 aggregations occasionally form on non-spiny understory plants (e.g., Rubiaceae: Psychotria) but not in the same places in different years (G.F.G., pers. obs.). The aggregations in spiny palms may persist longer than those in other types of vegetation simply because palm spines offer protection from predators, such as anoline lizards (Grether & Donaldson 2007). There is also evidence, however, that these harvestmen prefer spiny palms per se. When spines were experimentally removed from established roosting sites, the aggregations shifted rapidly over to previously unused spiny palms, if any were nearby (Donaldson & Grether 2007). Thus, it would be interesting to examine whether a tradition of roosting in spiny palms, once introduced, would spread through the Prionos- teinma sp. 2 population at La Selva Biological Station.
ACKNOWLEDGMENTS
We thank D.N. Proud and two anonymous reviewers for helpful comments on previous drafts of the manuscript. This study was carried out through the Field Biology Quarter program, with financial support from the Office of Instruc- tional Development and the Department of Ecology and Evolutionary Biology, at the University of California Los Angeles. AL was supported by Epperson and Holmes O. Miller scholarships. We thank R. Chock, J.P. Drury and D.M. Shier for help in the field and the owners and staff of Refugio Bartola for service and hospitality. Voucher specimens will be deposited in the natural history collection at the American Museum of Natural History in New York.
LITERATURE CITED
Alcock, J. 1998. Sleeping aggregations of the bee Idiomelissodes diiplocincta (Cockerel!) (Hynienoptera: Anthophorini) and their possible function. Journal of the Kansas Entomological Society 71:74-84.
Altmann, J. 1974. Observational study of behavior: sampling methods. Behaviour 49:227-267.
Beauchamp, G. 1999. The evolution of communal roosting in birds:
origin and secondary losses. Behavioral Ecology 10:675-687. Bijleveld, A. I., M. Egas, J.A. van Gils & T. Piersma. 2010. Beyond the information centre hypothesis: communal roosting for information on food, predators, travel companions and mates? Oikos 119: 277-285.
Blanco, G. & J. Telia. 1999. Temporal, spatial and social segregation of red-billed choughs between two types of communal roost: a role for mating and territory acquisition. Animal Behaviour 57:1219-1227. Chelini, M.C., R.H. Willemart & P. Gnaspini. 201 1. Caves as a winter refuge by a Neotropical harvestman ( Arachnida, Opiliones). Journal of Insect Behavior 24:393-398.
Chelini, M.C., R.H. Willemart & P. Gnaspini. 2012. Gregarious behavior of two species of Neotropical harvestmen (Arachnida: Opiliones: Gonyleptidae). Journal of Arachnology 40:256-258. Cockerill, J.J. 1988. Notes on aggregations of Leiohummi (Opiliones) in the southern U.S.A. Journal of Arachnology 16:123-126. Coddington, J.A., M. Horner & E.A. Soderstrom. 1990. Mass aggregations in tropical harvestmen (Opiliones Gagrellidae Prio- iwsteinnia sp.). Revue Arachnologique 8:213-219.
Cody, M. 2000. Antbird guilds in the lowland Caribbean rainforest of southeast Nicaragua. Condor 102:784-794.
Devries, P.J., J. Schull & N. Greig. 1987. Synchronous nocturnal activity and gregarious roosting in the neotropical skipper butterlly
GRETHER ET AL.— VARIATION IN HARVESTMAN COMMUNAL ROOSTING BEHAVIOR
267
Celaenorrhinus fritzgaertneri (Lepidoptera: Hesperiidae). Zoologi- cal Journal of the Linnean Society 89:89-103.
Donaldson, Z.R. & G.F. Grether. 2007. Tradition without social learning: scent-mark-based communal roost formation in a Neotropical harvestman (Prionostemmci sp.). Behavioral Ecology and Sociobiology 61:801-809.
dos Santos, G.C., J.A. Hogan & R.H. Willemart. 2013. Associative learning in a harvestman (Arachnida, Opiliones). Behavioural Processes 100:64-66.
Edgar, A.L. 1971. Studies on the biology and ecology of Michigan (Opiliones). Miscellaneous Publications, Museum of Zoology, University of Michigan 144:1-64.
Eiserer, L. 1984. Communal roosting in birds. Bird Behavior 5:61-80.
Eisner, T. 2004. Chemical defense of an opilionid (Accmthopachylus aculeatus). Journal of Experimental Biology 207:1313-1321.
Gnaspini, P. 2007. Development. Pp. 455^72. In Harvestmen: The Biology of Opiliones. (R. Pinto-da-Rocha, G. Machado & G. Giribet, eds.). Harvard University Press, Cambridge.
Grether, G.F. & Z.R. Donaldson. 2007. Communal roost site selection in a Neotropical harvestman: habitat limitation vs. tradition. Ethology 113:290-300.
Grether, G.F., A. Levi, C. Antaky & D.M. Shier. 2014. Communal roosting sites are potential ecological traps: experimental evidence in a Neotropical harvestman. Behavioral Ecology and Sociobiol- ogy 68:1629-1638. DOT 10.1007/s00265-014-1771-2.
Holm, S. 1979. A simple sequentially rejective multiple test procedure. Scandinavian Journal of Statistics 6:65-70.
Holmberg, R.G., N.P.D. Angerilli & L.J. Lacasse. 1984. Overwinter- ing aggregations of Leiohiimuu paessleri in caves and mines (Arachnida, Opiliones). Journal of Arachnology 12:195-204.
Kerth, G. & K. Reckardt. 2003. Information transfer about roosts in female Bechstein’s bats: an experimental field study. Proceedings of the Royal Society B: Biological Sciences 270:511-515.
Machado, G. 2002. Maternal care, defensive behavior & sociality in neotropical Goniosoma harvestmen (Arachnida, Opiliones). In- sectes Sociaux 49:388-393.
Machado, G. & R. Macias-Ordonez. 2007. Social behavior. Pp. 400-413. In Harvestmen: The Biology of Opiliones. (R. Pinto- da-Rocha, G. Machado & G. Giribet, eds.). Harvard University Press, Cambridge.
Machado, G. & C.H.F. Vasconcelos. 1998. Multi-species aggregations in Neotropical harvestmen (Opiliones, Gonyleptidae). Journal of Arachnology 26:389-391.
Machado, G., V. Bonato & P.S. Oliveira. 2002. Alarm communica- tion: a new function for the scent-gland secretion in harvestmen (Arachnida: Opiliones). Die Naturwissenschaften 89:357-360.
Machado, G., R.L.G. Raimundo & P.S. Oliveira. 2000. Daily activity schedule, gregariousness & defensive behaviour in the Neotropical harvestman Goniosoma longpipes (Opiliones: Gonyleptidae). Jour- nal of Natural History 34:587-596.
Mallet, J. 1986. Gregarious roosting and home range in Heliconiiis butterflies. National Geographic Society Research 2:198-215.
Mestre, L.A.M. & R. Pinto-da-Rocha. 2004. Population dynamics of an isolated population of the harvestman Ilhaia cuspidata (Opiliones, Gonyleptidae), in Araucaria Forest (Curitiba, Parana, Brazil). Journal of Arachnology 32:208-220.
Pereira, W., A. Elpino-Campos, K. Del-Claro & G. Machado. 2004. Behavioral repertory of the Neotropical harvestman Ilhaia cuspidata (Opiliones, Gonyleptidae). Journal of Arachnology 32:22-30.
Proud, D.N., B.E. Felgenhauer, V.R. Townsend, D.O. Osula, W.O. Gilmore & Z.L. Napier et al. (2012). Diversity and habitat use of Neotropical harvestmen (Arachnida: Opiliones) in a Costa Rican rainforest. ISRN Zoology 2012:1-16.
Rocha, D.F.O., F.C. Wouters, G. Machado & A.J. Marsaioli. 2013. First biosynthetic pathway of l-hepten-3-one in Iporangaia pustidosa (Opiliones). Scientific Reports 3:3156.
Switzer, P.V. cS: G.F. Grether. 1999. Characterictics and possible functions of traditional night roosting aggregations in rubyspot damselfiies. Behaviour 137:401-416.
Teng, B., S. Dao, Z.R. Donaldson & G.F. Grether. 2012. New communal roosting tradition established through experimental translocation in a Neotropical harvestman. Animal Behaviour 84:1183-1190.
Townsend, V.R., K.A. Mulholland, J.O. Bradford, D.N. Proud & K.M. Parent. 2006. Seasonal variation in parasitism by Lcptus mites (Acari, Erythraeidae) upon the harvestman, Leiohimutn fornwswu (Opiliones, Sclerosomatidae). Journal of Arachnology '34:492-494.
Townsend, V.R., D.N. Proud, M.K. Moore, J.A. Tibbetts, J.A. Burns & R.K. Hunter et al. (2008). Parasitic and phoretic mites associated with Neotropical harvestmen from Trinidad, West Indies. Annals of the Entomological Society of America 101:1026-1032.
Tsurusaki, N. 1986. Parthenogenesis and geographic variation of sex ratio in two species of Leiohunwn (Arachnida, Opiliones). Zoological Science 3:517-532.
Tsurusaki, N. 2003. Phenology and biology of harvestmen with some taxonomical in and near Sapporo, Hokkaido, Japan, with some taxonomical notes on Nelinia suzukii n. sp. and allies (Arachnida: Opiliones). Acta Arachnologica 52:5-24.
Vulinec, K. 1990. Collective security: aggregation by insects as a defense. Pp. 251-288. In Insect Defenses: Adaptive Mechanisms and Strategies of Predators and Prey. (D.L. Evans & J.O. Schmidt, eds.). State University of New York Press, Albany.
Wade, R.R., E.M. Loaiza-Phillips, V.R. Townsend & D.N. Proud. 2011. Activity patterns of two species of Neotropical harvestmen (Arachnida: Opiliones) from Costa Rica. Annals of the Entomo- logical Society of America 104:1360-1366.
Wijnhoven, H., A.L. Schonhofer & J. Martens. 2007. An unidentified harvestman Leiohunum sp. alarmingly invading Europe (Arachni- da: Opiliones). Arachnologische Mitteilungen 34:27-38.
Wilkinson, G.S. 1984. Reciprocal food sharing in the vampire bat. Nature 308:181-184.
Willemart, R. & P. Gnaspini. 2004. Spatial distribution, mobility, gregariousness & defensive behaviour in a Brazilian cave harvest- man Goniosoma alhiscriptum (Arachnida, Opiliones, Gonylepti- dae). Animal Biology 54:221-235.
Willemart, R.H. & E.A. Hebets. 2011. Sexual differences in the behavior of the harvestman Leiohunum vittatum (Opiliones, Sclerosomatidae) towards conspecific cues. Journal of Insect Behavior 25:12-23.
Manuscript received 25 April 2014, revised 2 September 2014.
2014. The Journal of Arachnology 42:268-276
From spiderling to senescence: ontogeny of color in the jumping spider, Hahvonattus pyrrithrix
Lisa A. Taylor' --^, David L. Clark^ and Kevin J. McGraw^: 'Florida Museum of Natural History, University of Florida, Gainesville, FL 3261 1 USA. E-mail: LAT12@cornell.edu; -Department of Entomology and Nematology, 1881 Natural Area Drive, Steinmetz Hall, University of Florida, Gainesville, FL 3261 1 USA; ^School of Life Sciences, Arizona State University, Tempe, AZ 85287 USA; ''Department of Biology, Alma College, Alma, MI 48801 USA
Abstract. The diverse colors of animals serve a variety of purposes, from acquiring mates to avoiding predators. Often, color patterns are not static throughout life, but change drastically during development, maturity, and senescence. While recent work has focused on the signaling value of vibrant colors in jumping spiders (Salticidae), we know very little about how colors change as spiders age; such information can provide a context for understanding the functions of and constraints on colorful traits. Focusing on Hahronaftiis pyrrithrix Chamberlin 1924, our goals were to examine (1) the microscopic morphology of the colored body regions that males display to females during courtship (i.e., males’ red faces, green legs, and white pedipalps), (2) how the colors of these regions as well as dorsal color patterns change during development prior to sexual maturity, and (3) how male condition-dependent red facial and green leg coloration changes as males age beyond sexual maturity. Although the bright white pedipalps and green legs of males appeared only upon sexual maturity, the sexes began to differentiate in facial coloration and dorsal patterning, with males developing red faces and conspicuous black and white dorsal patterning as young juveniles (ca. 2.5 mm in body length, or ca. 45% of their total mature adult body size). Even after maturity, color was not static; a male’s green legs (but not red face) faded with age.
Results are discussed in the context of potential functions of and constraints on color in salticids, and how they may change throughout an individual’s lifetime.
Keywords: Juvenile coloration, Salticidae, sexual dichromatisni, sexual dimorphism, sexual selection
Animal colors and patterns can serve a variety of functions. During courtship, they can aid in species recognition or convey information about the quality of an individual as a mate (see reviews in Andersson 1994; Hill & McGraw 2006). They also frequently keep animals hidden (i.e., camouflage) or protected (i.e., aposematism, mimicry) from predators (see reviews in Cott 1940; Ruxton et al. 2004). In many animals, color patterns are not static throughout life, but change dramatically during development, maturity, and senescence, as well as seasonally (Booth 1990). When color patterns differ between the sexes, examination of ontogenetic color change is particularly interesting because the timing and extent of sexual color differentiation can provide clues to the costs and benefits of different color patterns and their functions and constraints across contexts throughout life.
Color change from development to adulthood is typically thought to represent shifts in selection pressures as individuals change in size, mobility, vulnerability to predation, habitat use, or reproductive status (Booth 1990). In animals where bright male colors have evolved via sexual selection, sex-specific color patterns often appear suddenly upon sexual maturity, presum- ably because they are costly and unnecessary for juveniles (Andersson 1994). When sexually selected colors appear before sexual maturity, they are particularly interesting because they may hint at previously overlooked functional roles (e.g., Kilner 2006; Kapun et al. 2011). When the sexes differ in color due to different ecological selection pressures (e.g., Slatkin 1984), the timing of color pattern divergence can help us understand shifting selection pressures. For example, in the lizard Erettuas htgiihris, adults and older juveniles are tan and cryptic, whereas young juveniles have highly conspicuous markings, mimicking noxious oogpister beetles (Huey & Pianka 1977); in this system, subtle and changing functional roles of color would be missed by limiting study to adult stages.
Adult organisms can also change color as they age beyond sexual maturity (Booth 1990). In many birds, colors used to attract mates do not appear immediately upon sexual maturity, but are delayed until after the first breeding season (reviewed in Hawkins et al. 2012). Animals may also decline (more subtly) in color with senescence; colorful pigments or structures contained within dead tissue (e.g., feathers, scales) can fade with age as a product of abrasion, soiling, or photobleaching (Ornborg et al. 2002; McGraw & Hill 2004; Delhey et al. 2006; Kemp 2006). If maintaining colors is costly, age-based fading can have important consequences for signaling, with the ability to maintain bright colors (i.e., the ability to resist tissue/pigment damage) acting as an indicator of quality (e.g., Delhey et al. 2006). Alternatively, color fading may provide direct information about an individual’s age (Manning 1985). Such information could help individuals identify more mature, viable mates (reviewed in Kokko & Lindstrom 1996). Alternatively, if older individuals are more likely to carry disease or parasite infection (e.g., Tarling & Cuzin-Roudy 2008) or if they are more likely to accumulate deleterious mutations in their germ-line (Beck & Promislow 2007), age-based color variation might enable individuals to select younger mates. A deeper understanding of how, and ultimately, why colors change with age will enable us to generate informed hypotheses about their potential signal content and evolution.
Jumping spiders (Salticidae) are an excellent group in which to examine ontogenetic color change from development through senescence. In many species, adult males are more colorful than females and display these colors to females during courtship or to other males during competitive interactions (e.g., Peckham & Peckham 1889, 1890; Lim & Li 2004; Girard et al. 2011). In addition, sexual dichromatism in dorsal color that is not displayed during courtship may
268
TAYLOR ET AL.— ONTOGENY OF COLOR IN HABRONATTUS PYRRITHRIX
269
reOect different predator-avoidance strategies of males and females (LAT, iinpub. data). To date, only three jumping spider species have had their colors quantified using modern color measurement techniques (i.e., spectrophotometry) (Cos- mophasis unihratica Simon 1903 (Lim & Li 2006), Phintella vittata (C.L. Koch 1846) (Li et al. 2008a), and Habwuattiis pyrrithrix Chamberlin 1924 (Taylor et al. 201 1)), and in only one study were juvenile colors measured (Lim & Li 2006). To our knowledge, no study has documented age-based changes in salticid colors as they develop from spiderlings through sexual maturity. Because species descriptions and dichoto- mous keys typically include details on only adults, with anatomy of mature genitalia required for proper identification (e.g., Ubick et al. 2005), the salticid literature includes few, even qualitative, descriptions of juvenile color patterns (but see Nelson 2010 for an exception).
The genus Hahronattus F.O.P. Cambridge 1901, containing approximately 100 species, is one of the most highly ornamented groups; males are typically elaborately colored whereas females are cryptic (Griswold 1987; Maddison & Hedin 2003). Furthermore, patterns of juvenile coloration also vary across the genus (LAT, pers. obs.). For example, in H. hirsutus (Peckham & Peckham 1888) juveniles of both sexes are indistinguishable from one another to the human eye and resemble cryptic adult females until sexual maturity (LAT, pers. obs.). In H. hallani (Richman 1973) juveniles of both sexes are indistinguishable from one another but have striking dorsal color patterns unlike either adult males or females (LAT, pers. obs.). In H. pyrrithrix, juvemle males and females exhibit color patterns similar to those of sexually mature adults; males have red faces and striped dorsal patterns, whereas females are drab and cryptic throughout their life (LAT, pers. obs). This diversity in ontogenetic color change suggests that the costs, benefits, and functions of juvenile colors might be just as interesting as those of adults. Additionally, there is evidence that, after reaching maturity, adult male ornamental colors in H. pyrrithrix continue to undergo additional age-related changes, which could have important implications for sexual signaling (Taylor et al. 2011).
In this study, we focused on Hahronattus pyrrithrix', males of this species are adorned with red faces, green front legs, and white pedipalps that they display to females during courtship. Our goals were to ( 1 ) examine the microscopic morphology of the elaborately colored body regions that males display (i.e., red faces, green legs, and white pedipalps), (2) examine how the colors of these regions as well as dorsal color patterns change during development leading up to sexual maturity, and (3) examine how male condition-dependent red facial and green leg coloration changes as males age beyond sexual maturity. The red facial and white pedipalp colors of H. pyrrithrix are contained within modified setae, or scales (e.g.. Hill 1979), while the green leg coloration is present on the surface of the cuticle of the femur (e.g., Parker & Hegedus 2003; Ingram et al. 2011), which is further adorned with white scales (LAT, pers. obs.). Recent work on H. pyrrithrix suggests that adult male facial and leg colors are correlated with body condition in the field (Taylor et al. 2011). The red (but not green) coloration is variable among males of the same age and is positively correlated with the quality of a male’s diet
(Taylor et al. 2011), and the presence of red coloration improves courtship success in certain contexts (Taylor & McGraw 2013); however, we know nothing about the role of red facial coloration in juvenile males. We have hypothesized elsewhere that the conspicuous dorsal coloration in sexually mature adult males (combined with characteristic leg-waving behavior and high movement rales associated with mate searching) provides protection from predators through imper- fect mimicry of bees and/or wasps (see Taylor 2012), yet we know nothing about the potential factors that might shape color differences in sexually inactive juveniles. Even after maturity, male colors do not appear to be static (Taylor et al. 201 1). Throughout the mating season, the scales that produce the colors may undergo natural wear and degradation, which may result in predictable, post-maturity, age-related deterio- ration of color (e.g., Kemp 2006; Kemp & Macedonia 2006); this may allow females to use color to assess a male’s age during courtship (e.g.. Manning 1985).
To our knowledge, this will be the first study to quantify ontogenetic color changes throughout development in any of the more than 5000 species (Platnick 2013) of jumping spiders. Standard portable spectrophotometers used in animal color- ation studies (reviewed in Andersson & Prager 2006) typically have a minimum reading area of 1 mm (e.g., Lim & Li 2006; Moreno et al. 2006; Galvan & Moller 2009); thus, precise quantification of color can only be done on relatively large body regions (>1 mm). Thus, using standard equipment makes the study of minute patches of color on small species of spiders challenging and makes the detailed study of color on particular body regions of juvenile salticids (e.g., faces, legs, pedipalps) impossible. Here we use a custom-designed microspectrophotometer (see Methods and also Taylor et al. 2011), allowing us to carefully measure minute patches of color on juveniles and compare colors with those same precise areas on adult spiders.
METHODS
Study %^tQ.iQ%. -Hahronattiis pyrrithrix is found throughout southern California and Arizona, USA, south to Sinaloa, Mexico (Griswold 1987). In Phoenix, Arizona, they are quite common and found at high densities in riparian areas, grassy backyards, and agricultural fields (LAT, pers. obs.). Geo- graphic variation in coloration is common within the genus Hahronattus (see Griswold 1987) and thus some subtleties of color pattern described in the present study for Phoenix, AZ animals may vary across the species range. Voucher specimens from our study population have been deposited in the Florida State Collection of Arthropods, Gainesville, FL, U.S.A. Additional details on the biology and courtship display behavior of H. pyrrithrix are provided elsewhere (Taylor et al. 2011; Taylor & McGraw 2013). Most temperate spiders live only one year in the field (see Foelix 201 1); to our knowledge, nothing is known about how long H. pyrrithrix, in particular, live under natural conditions.
Scale morphology of adult male ornaments (Study 1). — Using five sexually mature adult specimens, we imaged the color patches on the males’ red face, green front legs, and white pedipalps that they display to females, using a Leica-Cam- bridge Stereoscan 360 field emission scanning electron microscope (SEM) (Leica Microsystems, Wetzlar, Germany)
270
THE JOURNAL OF ARACHNOLOGY
at an acceleration voltage of 2 kV. Prior to imaging, we allowed frozen specimens to air-dry overnight and then mounted the carapace, legs, and pedipalps onto standard SEM stubs using conductive graphite paint.
Ontogenetic color change in juveniles (Study 2). — To examine how male and female coloration changes during juvenile development in the field, we collected spiders {n — 135) from a range of developmental stages (i.e., size classes) between May and October 2008 from a single, dense popula- tion within an agricultural area in Queen Creek, Arizona, USA (Maricopa County, 33.224744° N, 1 1 1.592825° W). This population was chosen because, in contrast with other sites where multiple species are abundant and interact (LAT, unpub. data), the only species of Hahronattus that we have ever seen at this site in five years is H. pyrrithrix. This allowed us to be confident that all spiderlings and juveniles included in the present study were H. pyrrithrix. Specifically, we collected spiderlings (before they are able to be sexed, ca. 1. 5-2.0 mm in length, n - 15), small juveniles (ca. 2.5 mm, // = 15 males, u = 15 females), large juveniles (ca. 3 mm, /? = 15 males, /; = 15 females), subadults (ca. 4-6 mm, /? = 15 males, /? = 15 females) and sexually mature adults (ca. 5-7 mm, n = 15 males, /? = 15 females). Immediately after collection, we froze spiders ( — 80° C) for later color analysis.
Post-maturity age-related changes in condition-dependent male ornaments (Study 3). — To examine how adult male color changes with age post-maturity, we collected 12 gravid adult females in July and August 2008 from the same population described above, brought them back to the lab and allowed them to lay eggs. Spiderlings were housed together until they were large enough to be sexed (ca. 2.5 mm in length), at which point the first three males from each female’s egg sac were removed, housed separately in clear plastic containers (6x6 X 13 cm), and fed a constant diet of small crickets (Acheta domesticus) three times per week. Spiders (n — 36; three from each of 12 egg sacs) were checked daily to determine if they had molted; within each clutch, as males reached their final molt to maturity, they were randomly assigned to one of three different age groups (0, 60, and 120 days post-maturity). These age ranges were chosen because they likely represent the difference in ages of males in the field during the most active part of the mating season at this site (approximately May- August; LAT, pers. obs.). When males reached the appropri- ate randomly assigned age (0, 60, or 120 days post-maturity), we euthanized them and placed them in the freezer ( — 80° C) for later color analysis.
Color measurement and analysis. — Body colors were quan- tified following methods described in Taylor et al. (2011). Briefiy, we used a refiectance spectrophotometer (USB2000, Ocean Optics, Dunedin, FL, USA) coupled to a modified Leica DMLB2 fluorescence light microscope with a 40x quartz objective lens (Leica Microsystems, Wetzlar, Germany) and illuminated with a full-spectrum Leica 75 W xenon arc lamp (Leica Microsystems, Wetzlar, Germany). This setup allowed us to quantify the minute color patches of all size classes of these spiders that are too small to measure accurately with standard spectrophotometry equipment. Unfortunately, the optics of the microscope cut out a portion of the UV spectrum, so this instrument only provides spectral data from 375-700 nm. In some jumping spider species, UV
reflectance appears to be important in communication (Lim et al. 2007, 2008; Li et al. 2008b), and thus we must use caution when excluding UV wavelengths from our analyses. However, in a previous study (Taylor et al. 2011), we confirmed that, though reflectance does extend into the UV for the green legs and white pedipalps of H. pyrrithrix, there are no UV peaks in either region, so the benefit of using an instrument that allows precise and repeatable measures on minute color patches of these tiny spiders far outweighs the disadvantage of excluding UV.
For Study 2, where we were interested in color changes of the faces, front legs, and pedipalps of males and females that occurred during juvenile development through maturity, we took the average of two reflectance measures of each of these three body regions. The colored areas that we measured on each specimen were 0.25 mm in diameter. For facial coloration, both measurements were taken from the same region of the face (just below the anterior median eyes). For leg coloration, one measurement was taken from the ventral side of each (right and left) femur. For pedipalp coloration, one measurement was taken from the distal segment of each (right and left) pedipalp. From these spectral data, we calculated the single color variable that captured the most sex- and age-related variation for each body region scored. Specifically, because face color among the different sex/age classes varied from white to red, the metric that captured most of this variation was ‘red chroma’ (i.e., the proportion of total ■ reflectance in the red region of the spectrum, between 600 and 700 nm). Similarly, because the front legs varied from white to green, the metric that captured most of this variation was ‘green chroma’ (the proportion of total reflectance between 450 and 550 nm). Finally, because the pedipalps varied in coloration from gray to bright white, brightness (total reflectance over the entire spectrum) was the metric that captured most of this variation. For a detailed discussion of ! the rationale behind selecting relevant color variables, including those used here, see Montgomerie (2006). In addition, we qualitatively characterized the dorsal color pattern of individuals as either (1) tan and cryptic in ’
coloration, similar to the dorsal coloration of adult females, or (2) consisting of black and white stripes and chevrons characteristic of adult males; all individuals examined fit clearly into one of these two categories (see Results). Because these categorizations were based on pattern rather than
reflectance properties of the colors, we did not quantify dorsal coloration spectrophotometrically.
For Study 3, where we were interested in more subtle, age- based fading of display colors in adult males, we limited our
analysis to the coloration of the red face and green legs, j
because previous studies showed that these two color patches ' were correlated with body condition in the field, presenting the possibility that such condition-dependence could be explained in part by the fading of colors as males age (Taylor et al.
201 1). We took the average of two reflectance measures from each region and used these spectral data to calculate three color variables that were previously found to be correlated with body condition in the field: ( 1 ) the hue of the red face (the wavelength corresponding to the inflection point of the red , curve), (2) the red chroma of the face (the proportion of total reflectance between 600 and 700 nm), and (3) the brightness ,
TAYLOR ET AL.— ONTOGENY OF COLOR IN HABRONATTUS PYRRITHRIX
271
Figure 1. — Morphology of the colored body regions of adult male Habronattus pyrrithrix. a-b. Red scales on the face showing ridged protrusions; c-d. White spatulate scales ornamenting the green front leg (femur); e-f. Flat white pedipalp scales.
(mean reflectance) of the green front legs, following the methods described in Taylor et al. (201 1). We also determined the relative size of the male’s red facial patch; because larger males had larger red faces, we used the residuals of a regression of patch area on carapace width, which provides a ‘relative patch size index’ that is uncorrelated with body size and has previously been found to be correlated with body condition in the field (Taylor et al. 2011). Three males died
over the course of the study for unknown reasons and were thus excluded from our analyses.
Statistical analysis. — For Study 2, we used analyses of variance (ANOVA) to examine effects of developmental stage (i.e., size class), sex, and their interaction on face color (red chroma), front leg color (green chroma), and pedipalp color (mean brightness). Data did not meet normality and equal-variance assumptions and thus were rank-transformed
Ill
THE JOURNAL OF ARACHNOLOGY
Table I . — Results of ANOVA examining the effect of sex, age (i.e., size class), and their interaction on color metrics associated with the face, legs, and pedipalps during development in H. /nTn7/;)7'.v jumping spiders. Df = degrees of freedom.
|
Red chroma of face |
Df |
F |
P |
|
sex |
1,140 |
304.96 |
<0.001 |
|
age |
4,140 |
6.30 |
<0.001 |
|
sex X age |
4,140 |
20.27 |
<0.001 |
|
Green chroma of legs |
Df |
F |
p |
|
sex |
1,140 |
0.28 |
0.60 |
|
age |
4,140 |
9.37 |
<0.001 |
|
sex X age |
4,140 |
5.10 |
<0.001 |
|
Brightness of pedipalps |
Df |
F |
p |
|
sex |
1,140 |
1.43 |
0.23 |
|
age |
4,140 |
41.54 |
<0.001 |
|
sex X age |
4,140 |
3.33 |
0.01 |
(Conover & Iman 1981) prior to analysis. For Study 3, we used ANOVA to examine the effects of age on the hue, red chroma, and the relative size of a male’s red face and on the brightness of his green legs. Because we used three males from each clutch (one assigned to each age category), we included the clutch (i.e., mother’s identity) as a random factor in the model. Following ANOVA, we compared the colors among age classes using Tukey-Kramer pairwise comparisons with an alpha level of 0.05. All data from Study 3 met the assumptions of parametric statistics. All statistical analyses were conducted using SAS 9.2 (SAS Institute, Cary, NC, USA).
RESULTS
SEM analyses revealed varied scale structure on the three different colorful body regions of males (Fig. 1). On the red face, we found ridged protrusions covering the surface of each scale (Figs, la, b). The green legs were ornamented with long spatulate scales, the flattened ends of which were covered with fine ridges (Figs. Ic, d). The white scales on the pedipalps were similar in size and shape to the red facial scales, but were relatively smooth by comparison (Figs, le, f).
In Study 2, we found a significant effect of the age X sex interaction on all three color metrics examined (Table 1), indicating that colors developed differently between the sexes. Although spiderlings of both sexes had sparse red scales around their anterior median eyes (Fig. 2a), development of red coloration on the face was apparent in small juvenile males and increased into adulthood, whereas small juvenile females developed white facial scales (Figs. 2, 3a). Similarly, the conspicuous dorsal color pattern of males was also fully developed in small juveniles (ca. 2.5 mm), whereas spiderlings of both sexes and juvenile females had a cryptic, tan dorsal color pattern similar to adult females (Fig. 4). In contrast, the green coloration of the legs and the bright white pedipalp coloration typical of adult males showed a sudden onset at sexual maturity (Fig. 3b, c).
In Study 3, the green leg coloration of adult males was brighter (lighter) with increasing age (F2.21 = 4.17, T* = 0.03; Fig. 5d), but we found no effect of age on any aspect of red facial coloration (hue: F2,2i = 0.37, P = 0.69; red chroma:
Figure 2. — Ontogenetic changes in coloration in males and females 'j as spiders develop from spiderlings through sexual maturity, a. ; Spiderling stage (where sexes are indistinguishable); b. Small juvenile male; c. Small juvenile female; d. Large juvenile male; e. Large juvenile female; f. Subadult male; g. Subadult female; h. Sexually mature adult male; i. Sexually mature adult female. Scale bars ; represent 0.5 mm.
^2,21 = 0.53, P = 0.60; size of red facial patch: F2.21 = 1-97, P = 0.17; Figs. 5a-c).
DISCUSSION
Here we document the scale morphology associated with the three colored body regions in male Hahronattus pyrrithrix that are prominently displayed to females during courtship. We also show how the colors of these three regions (i.e., red face, green front legs, and bright white pedipalps) develop as individuals grow from spiderlings through sexual maturity. Finally, given that the colors of two of these body regions (i.e., red faces and green front legs) were previously found to be correlated with body condition in the field (Taylor et al. 2011), we examined the possibility of age-related fading of these traits
TAYLOR ET AL.— ONTOGENY OF COLOR IN HABRONATTUS PYRRITHRIX
273
males
females
spiderlings (cannot be reliably sexed)
Figure 3. — Ontogenetic changes in coloration in males and females as spiders develop from spiderlings through sexual maturity (mean ± SEM). a. Facial coloration; b. Front leg coloration; c. Pedipaip coloration.
in adult males and show that green leg coloration, but not red facial coloration, fades (i.e., becomes lighter) with age.
In examining color development, we found that both the bright white pedipalps and green leg coloration of males
Figure 4. — Sexual dichromatism in dorsal coloration in juvenile and adult male and female H. pyrrithrix. a. Juvenile male; b. Juvenile female; c. Adult male; d. Adult female.
appeared only at sexual maturity. This is typical of many animal ornaments used in mating or aggressive competitions over access to mates; moreover, because such colors typically incur costs, it is not surprising that these ornaments are not expressed in juvenile stages (Andersson 1994). In contrast, males and females began to differentiate in red facial coloration and dorsal patterning as young juveniles (ca. 2.5 mm). During these stages, young males began to develop red facial scales and conspicuous black and white dorsal patterning typical of sexually mature adult males. The red coloration of adult males is prominently displayed in courtship and has been shown to improve courtship success in certain contexts (Taylor & McGraw 2013), yet it is unclear whether this coloration might have any functional role for juvenile males who do not engage in courtship. Red coloration has been shown to have important effects on receivers in a variety of taxa (reviewed in Pryke 2009); it could be that juvenile males use their red face for signaling in non-sexual contexts, either with conspecifics, potential predators, or prey. Regard- ing conspicuous dorsal patterning in adult males, this appears to be linked to higher movement rates associated with mate- searching, compared with cryptic females who spend more time at rest. Presumably, the higher movement rates of males render cryptic coloration ineffective; the pairing of conspicu- ous body patterns with false antennation (i.e., leg waving behavior) may help adult males avoid predators by imperfectly mimicking wasps and/or bees (Taylor 2012). Again, it is unclear what benefits, if any, this dorsal coloration might provide to young juvenile males. It is possible that, even as juveniles, males and females might face different ecological selection pressures (e.g., different dispersal or movement rates) that may drive such sex-differences in juvenile dorsal patterning (Booth 1990); in future work, such ideas should be examined in more detail. Finally, it is possible that juvenile sexual dichromatism does not have a functional role (e.g., Johnston 1967); it may simply indicate relaxed selection pressure for crypsis, compared with other species in which
274
THE JOURNAL OF ARACHNOLOGY
0 60 120
Age (days post-maturity) Age (days post-maturity)
Figure 5. — Effect of adult age (post-maturity) on male display colors that were previously found to be correlated with body condition in the field (mean ± SEM). Aspects of red facial coloration (a-c) did not change with age, yet the brightness (lightness) of male green leg coloration increased as males aged (d). Different letters indicate significant differences at P <0.05.
males are cryptically colored until maturity. It is interesting, however, that this species is an exception to the general pattern of salticid color development, where juveniles of both sexes typically resemble females in color pattern until reaching maturity (LAT, pers. obs.). To date, studies of any aspect of the biology of juvenile jumping spiders are rare (e.g., Nelson et al. 2005; Bartos 2008), yet they have revealed interesting aspects of life history that would have been missed by simply focusing on adults, as most studies do. H. pyrrithrix is a particularly good system in which to examine sex differences in juveniles because, unlike most salticid species, color patterns allow small juveniles to be accurately sexed well before reaching maturity.
In addition to age-related changes that occur during development prior to sexual maturity, our study also uncovered post-maturity, age-based color change. Previous studies have suggested that structural coloration in jumping spiders may be linked to male age (Lim & Li 2007; Taylor et al. 2011), yet both of these studies used comparisons of two groups of spiders, one that had been collected from the field and measured immediately and a second that was field- collected and measured after a certain period of time in the lab. While differences in the two groups may be due to age, we cannot rule out confounding effect of diets and captivity; in both cases, the first group experienced a field-based diet/ environment for its entire life while the second group was collected from the field and then switched to a lab-based diet/ environment prior to color measurement. Here we remove these confounding effects of diet and captivity to show that, even when spiders are raised entirely in the lab, the green leg coloration of adult males fades (i.e., increases in mean brightness) with age. This is also consistent with correlational
findings from a previous study (Taylor et al. 2011); this same aspect of male leg color (brightness) was correlated with body | condition in the field, suggesting that younger males in better condition have darker legs, while older males in poorer | condition have lighter legs. j
Interestingly, this pattern of age-based fading did not hold for the males’ red facial coloration, which is also correlated with body condition in the field (Taylor et al. 2011). Previous j studies have shown that red facial coloration is positively j correlated with the quality of a male’s juvenile diet (Taylor et al. 2011). Collectively, these studies support the idea that I the two different colors (red faces and green legs) have the ' potential to signal different aspects of male quality (reviewed in Hebets & Papaj 2005). A male’s red facial coloration j potentially signals a male’s nutritional status and foraging ability (but not his age), while green leg coloration may signal j age while containing no information about his diet or foraging ability. An interesting next step will be to examine how the mechanisms of coloration (e.g., specific pigments, structures, etc.) for these jumping spiders might facilitate or constrain the ll information content of a specific color and how they influence ; receivers (e.g., McGraw et al. 2002). Work with butterflies suggests that structural colors are more likely to fade with age ! than pigmentary colors (Kemp 2006). A better understanding | of the detailed mechanisms of color production in H. i| pyrrithrix, including the specific pigments and structure types, j will allow us to test the generality of these ideas.
Our examination of the morphology of the males’ green legs offer preliminary insight into the mechanisms of age-based fading observed in our study. The green leg coloration is produced in the cuticle, while additional white light is reflected '
TAYLOR ET AL.— ONTOGENY OF COLOR IN HABRONATTUS PYRRITHRIX
275
off of the long, fragile spatulate scales (LAT, pers. obs., see Fig. 1 c,d). Fading of leg color could thus be a result of the breakdown of structures in the green cuticle, or alternatively, could be a result of damage to white spatulate scales, causing them to reflect more light. Males use these front legs in prey capture (LAT, pers. obs.), and thus damage to their scales over time may be difficult to avoid. Closer examination of the morphological changes that occur with age may help to elucidate the mechanisms behind age-based fading in H. pyrrithrix leg color.
Here we show that, in addition to sexually dichromatic miale display colors that show a sudden onset at maturity (e.g., brilliant green legs, bright white pedipalps), males also have bright sexually dimorphic colors that begin to develop when males are still small juveniles (e.g., red faces and conspicuous black and white dorsal patterning). Furthermore, these colors are not all static at maturity; in particular, the green front legs of males are subject to age-based fading. As this is the first study to quantify age-based changes in juvenile coloration of any species of jumping spider, this work provides an important first step towards understanding the costs, benefits, and potential functions of juvenile coloration. Recent work on salticid coloration has provided some interesting and prom- ising systems to examine general questions about color communication and evolution (Lim et al. 2007, 2008; Li et al. 2008a; Taylor et al. 2011; Taylor & McGraw 2013). Examination of ontogenetic changes in spider coloration, particularly in groups such as Habronattus, may help us elucidate some of the more subtle costs and benefits of color expression and change throughout an animal’s life.
ACKNOWLEDGMENTS
We thank K. Domke, J. Grieco, L. Hall, A. Lopez, and M. Ponce for assistance in the field and lab. B. Sharp, R. Roberson, and D. Lowry provided valuable training and assistance with SEM. J. Alcock, C. Johnson, and R. Rutowski provided discussion on study design as well as helpful comments on early versions of this manuscript. We thank M. and C. Sclinepf for permission to collect spiders on their property. This work was supported by research grants from the Animal Behavior Society, Sigma Xi, and the Arizona State University Graduate and Professional Students’ Association, as well as a National Science Foundation Graduate Research Fellowship to LAT.
LITERATURE CITED
Andersson, M. 1994. Sexual Selection. Princeton University Press, Princeton, NJ.
Andersson, S. & M. Prager. 2006. Quantifying colors. Pp. 41-89. In Bird Coloration: Mechanisms and Measurements. (G.E. Hill & K.J. McGraw, eds.). Harvard University Press, Cambridge, MA. Bartos, M. 2008. Alternative predatory tactics in a juvenile jumping spider. Journal of Arachnology 36:300-305.
Beck, C.W. & D.E.L. Promislow. 2007. Evolution of female preference for younger males. PLoS ONE 2:e939.
Booth, C.L. 1990. Evolutionary significance of ontogenetic colour change in animals. Biological Journal of the Linnean Society 40:125-163.
Conover, W.J. & R.L. Iman. 1981. Rank transformations as a bridge between parametric and nonparametric statistics. American Statistician 35:124—129.
Cott, H.B. 1940. Adaptive Coloration in Animals. Methuen, London, UK.
Delhey, K., A. Peters, A. Johnsen & B. Kempenaers. 2006. Seasonal changes in blue tit crown color: do they signal individual quality? Behavioral Ecology 17:790-798.
Foelix, R.F. 2011. Biology of Spiders. Oxford University Press, New York.
Galvan, I. & A.P. Moller. 2009. Different roles of natural and sexual selection on senescence of plumage colour in the barn swallow. Functional Ecology 23:302-309.
Girard, M.B., M.M. Kasumovic & D.O. Elias. 2011. Multi-modal courtship in the peacock spider, Maratus volans (OP-Cambridge, 1874). PLoS ONE 6:e25390.
Griswold, C.E. 1987. A revision of the jumping spider genus Habronattus F.O.P. Cambridge (Araneae: Salticidae), with phe- netic and cladistic analyses. University of California Publications in Entomology 107:1-344.
Hawkins, G.L., G.E. Hill & A. Mercadante. 2012. Delayed plumage maturation and delayed reproductive investment in birds. Biolog- ical Reviews 87:257-274.
Hebets, E.A. & D.R. Papaj. 2005. Complex signal function: developing a framework of testable hypotheses. Behavioral Ecology and Sociobiology 57:197-214.
Hill, D.E. 1979. Scales of salticid spiders. Zoological Journal of the Linnean Society 65:193-218.
Hill, G.E. & K.J. McGraw. 2006. Bird Coloration: Function and Evolution. Harvard University Press, Cambridge, MA, USA.
Huey, R.B. & E.R. Pianka. 1977. Natural selection for juvenile lizards mimicking noxious beetles. Science 195:201-203.
Ingram, A.L., O. Deparis, J. Boulenguez, G. Kennaway, S. Berthier & A.R. Parker. 2011. Structural origin of the green iridescence on the chelicerae of the red-backed jumping spider, Phidippus johnsoni (Salticidae: Araneae). Arthropod Structure & Development 40: 21-25.
Johnston, R.F. 1967. Sexual dimorphism in juvenile house sparrows. Auk 84:275-277.
Kapun, M., A. Darolova, J. Kristofik, K. Mahr & H. Hoi. 2011. Distinct colour morphs in nestling European Bee-eaters Merops apiaster. is there an adaptive value? Journal of Ornithology 152:1001-1005.
Kemp, D.J. 2006. Heightened phenotypic variation and age-based fading of ultraviolet butterfly wing coloration. Evolutionary Ecology Research 8:515-527.
Kemp, D.J. & J.M. Macedonia. 2006. Structural ultraviolet ornamentation in the butterfly Hypolimiuis bolina L. (Nymphali- dae): visual, morphological and ecological properties. Australian Journal of Zoology 54:235-244.
Kilner, R. 2006. Function and evolution of color in young birds. Pp. 201-232. In Bird Coloration: Function and Evolution. (G.E. Hill & K.J. McGraw, eds.). Harvard University Press, Cambridge, MA.
Kokko, H. & J. Lindstrom. 1996. Evolution of female preference for old mates. Proceedings of the Royal Society Biological Sciences Series B 263:1533-1538.
Li, J.J., M.L.M. Lim, Z.T. Zhang, Q.Q. Liu, F.X. Liu & J. Chen, et al. 2008a. Sexual dichromatism and male colour morph in ultravio!et-B reflectance in two populations of the jumping spider Phintella vittata (Araneae: Salticidae) from tropical China. Biological Journal of the Linnean Society 94:7-20.
Li, J.J., Z.T. Zhang, F.X. Liu, Q.Q. Liu, W.J. Gan & J. Chen, et al. 2008b. UVB-based mate-choice cues used by females of the jumping spider Phintella vittata. Current Biology 18:699-703.
Lim, M.L.M. & D.Q. Li. 2004. Courtship and male-male agonistic behaviour of Cosmophasis umbratica Simon, an ornate jumping spider (Araneae: Salticidae) from Singapore. Raffles Bulletin of Zoology 52:435M48.
Lim, M.L.M. & D.Q. Li. 2006. Extreme ultraviolet sexual dimor- phism in jumping spiders (Araneae: Salticidae). Biological Journal of the Linnean Society 89:397-406.
276
THE JOURNAL OF ARACHNOLOGY
Liin, M.L.M. & D.Q. Li. 2007. Effects of age and feeding history on structure-based UV ornaments of a jumping spider (Araneae: Salticidae). Proceedings of the Royal Society Biological Sciences Series B 274:569-575.
Lini, M.L.M., M.F. Land & D.Q. Li. 2007. Sex-specific UV and fluorescence signals in jumping spiders. Science 315:481-481.
Lim, M.L.M., J.J. Li & D. Li. 2008. Effect of UV-reflecting markings on female mate-choice decisions in Cosmophasis iimhratica, a jumping spider from Singapore. Behavioral Ecology 19:61-66.
Maddison, W. & M. Hedin. 2003. Phylogeiiy of Habronattiis jumping spiders (Araneae: Salticidae), with consideration of genital and courtship evolution. Systematic Entomology 28:1-21.
Manning, J.T. 1985. Choosy females and correlates of male age. Journal of Theoretical Biology 116:349-354.
McGraw. K.J. & G.E. Hill. 2004. Plumage color as a dynamic trait: carotenoid pigmentation of male house finches (Carpodacus mexicanus) fades during the breeding season. Canadian Journal of Zoology 82:734-738.
McGraw, K.J., E.A. Mackiliop, J. Dale & M.E. Hauber. 2002. Different colors reveal different information: how nutritional stress affects the expression of melanin- and structurally based orna- mental plumage. Journal of Experimental Biology 205:3747-3755.
Montgomerie, R. 2006. Analyzing colors. Pp. 90-147. In Bird Coloration: Mechanisms and Measurements. (G.E. Hill & K.J. McGraw, eds.). Harvard University Press, Cambridge, MA.
Moreno, J., E. Lobato, J. Morales, S. Merino, G. Tomas & J. Martinez-de la Puente, et al. 2006. Experimental evidence that egg color indicates female condition at laying in a songbird. Behavioral Ecology 17:651-655.
Nelson, X.J. 2010. Polymorphism in an ant mimicking jumping spider. Journal of Arachnology 38:139-141.
Nelson, X.J., R.R. Jackson & G. Sune. 2005. Use of Anopheles- specific prey-capture behavior by the small juveniles of Evarcha ciilicivora, a mosquito-eating jumping spider. Journal of Arachnol- ogy 33:541-548.
Ornborg, J., S. Andersson, S.C. Griffith & B.C. Sheldon. 2002. Seasonal changes in a ultraviolet structural colour signal in blue tits, Pams caenileus. Biological Journal of the Liniiean Society 76:237-245.
Parker, A.R. & Z. Hegedus. 2003. Diffractive optics in spiders. Journal of Optics A — Pure and Applied Optics 5:S1 1 1-Sl 16.
Peckham, G.W. & E.G. Peckham. 1889. Observations on sexual selection in spiders of the family Attidae. Occasional Papers of the Wisconsin Natural History Society 1:3-60.
Peckham, G.W. & E.G. Peckham. 1890. Additional observations on sexual selection in spiders of the family Attidae, with some remarks on Mr. Wallace’s theory of sexual ornamentation. Occasional Papers of the Wisconsin Natural History Society 1:117-151.
Platnick, N.I. 2013. The World Spider Catalog, Version 13.5. American Museum of Natural History, New York. Online at http://research.amnh.org/iz/spiders/catalog
Pryke, S.R. 2009. Is red an innate or learned signal of aggression and intimidation? Animal Behaviour 78:393-398.
Ruxton, G.D., T.N. Sherratt & M.P. Speed. 2004. Avoiding Attack: the Evolutionary Ecology of Crypsis, Warning Signals and Mimicry. Oxford University Press, Oxford, UK.
Slatkin, M. 1984. Ecological causes of sexual dimorphism. Evolution 38:622-630.
Tarling, G.A. & J. Ciizin-Roudy. 2008. External parasite infestation depends on moult-frequency and age in Antarctic krill (Euphausia superba). Polar Biology 31:121-130.
Taylor, L.A. 2012. Color and communication in Habronattus jumping spiders: tests of sexual and ecological selection. Ph.D. Dissertation, Arizona State University.
Taylor, L.A., D.L. Clark & K.J. McGraw. 2011. Condition dependence of male display coloration in a jumping spider (Habronattus pvrrithrix). Behavioral Ecology and Sociobiology 65:1 133-1146.
Taylor, L.A. & K. McGraw. 2013. Male ornamental coloration improves courtship success in a jumping spider, but only in the sun. Behavioral Ecology 24:955-967.
Ubick, D., P. Paquin, P.E. Cushing & V.D. Roth. 2005. Spiders of North America: An Identification Manual. American Arachno- logical Society.
Manuscript received 11 November 2013, revised 7 August 2014.
2014. The Journal of Arachnology 42:277-283
Scavenging throughout the life cycle of the jumping spider, Phidippus audax (Hentz) (Araneae: Salticidae)
Michael E, Vickers', Marianne W. Robertson' \ Casey R. Watson- and Travis E. Wilcoxen': 'Department of Biology, Millikin University, Decatur, IL 62522, USA; -Department of Physics and Astronomy, Millikin University, Decatur, IL 62522, USA
Abstract. Phidippus audax (Hentz 1845), a common North American jumping spider, is a visual predator that uses its highly developed eyesight to detect and forage actively for prey. We demonstrate that P. audax can survive throughout its life cycle as a scavenger. We separated 600 spiderlings into eight treatments examining all combinations of three different variables: live versus dead prey, substrate present versus substrate absent, and large versus small arenas. Over the course of the study, we recorded survival rates, instar durations, and carapace widths. Our results indicate that P. audax can survive solely on a diet of dead prey, but at significantly lower survival rates and with longer instar durations than spiders fed on live prey. Scavenging spiders, however, exhibited no significant difference in carapace widths when compared to predators.
Choice tests conducted on adults indicate that spiders raised as either predators or scavengers exhibit no significant differences in prey choice when given the option of live or dead prey.
Keywords: Dead prey, mortality, habitat complexity, development
Jumping spiders (Salticidae) are active predators that feed on a wide variety of prey. Their enlarged anterior-median eyes and secondary eyes provide them with heightened sensitivity to visual stimuli (Land 1971 ). Individuals first orient toward prey, then stalk or actively chase it to within a few centimeters, and then attempt a strike (Forster 1982a; Foelix 1996). Active predation is the strategy most widely studied in salticids (Givens 1978; Hill 1979; Forster 1982a; Freed 1984; Nyffeler et al. 1990; Richman & Jackson 1992; Jackson & Pollard 1996), however, alternative types of feeding behaviors do occur in this family. These alternative behaviors include araneophagy (Harland & Jackson 2000; Jackson 2000; Rienks 2000; Jackson et al. 2002; Penney & Gabriel 2009), herbivory (Meehan et al. 2009), indirect vertebrate blood feeding (Jackson et al. 2005), myrmecophagy (Jackson et al. 1998; Clark et al. 2000), nectivory (Ruhren & Handel 1999; Jackson et al. 2001), and prey stealing (Jackson et al. 2008). Our study focuses on scavenging in the salticid Phidippus audax (Hentz 1845).
Scavenging by spiders is not widely reported in the field; however, it has been demonstrated in the laboratory. For example, wolf spiders (Lycosidae) preferentially feed on aged, dead prey items over live prey when given the choice (Knost & Rovner 1975). Female Theridion evexum Keyserling 1884 (Theridiidae) collect and store dead prey in their webs, and when spiderlings emerge, they feed upon both old and newly acquired dead prey items (Barrantes & Weng 2008). The brown recluse spider, Loxosceles reclitsa Gertsch & Mulaik 1940 (Sicariidae), also feeds on dead prey items (Sandidge 2003; Cramer 2008; Vetter 2011).
Scavenging in Jumping spiders has also been demonstrated. Wolff (1986) starved 13 adult Salticus scenicus (Clerck 1757) females for five days and then presented them with dead house flies as prey. House fiies given to starved spiders had significantly lower post-trial weights than house flies given to well-fed spiders, indicating that the starved spiders fed on the dipteran prey. Although Wolff (1986) demonstrated that starved salticids have the potential to feed on dead prey,
^Corresponding author. Email: mrobertson(gmillikin.edu
scavenging has never been demonstrated throughout the life cycle of any spider species. We examined scavenging in a jumping spider, P. audax, to determine if a highly visually- oriented predator could survive solely on dead prey through- out its life cycle.
In the present study we examined three possible variables: prey type, habitat complexity (presence or absence of substrate), and arena size. We predicted that spiders raised as scavengers would have lower survival rates than predators due to the lack of visual cues provided by dead prey. As a corollary, we hypothesized that scavengers would exhibit longer instar durations and smaller carapace widths than predators due to reduced prey consumption. We predicted that the addition of substrate and increased arena size would further hinder scavengers’ ability to detect dead prey and thus further reduce their survival rate. Because the combination of added substrate and increased foraging area better reproduces the spiders’ natural environment, adjusting these conditions enabled us to test the prospect of scavenging in the field, and the effects that changes within an environment might have on scavengers.
METHODS
We collected eleven gravid female jumping spiders, P. audax, from the Rock Springs Center for Environmental Discovery in Macon Co., Decatur, IL USA (39.817713° N, 89.00932° W) in the spring of 1998. We housed each gravid female individually in a petri dish (15 cm diameter X 1.5 cm height) until oviposition. Eight females successfully oviposited in the lab. We removed 600 spiderlings (mean = 75, SE = 14.87, range = 6-104) and housed each in a separate petri dish (10 cm diameter X 1.5 cm height) until spiderlings were randomly separated into groups.
We randomly separated the 600 spiderlings into eight groups of 75 with the following treatments: live versus dead prey, large (15 cm X 1.5 cm) versus small (10 cm X 1.5 cm) arena size, and substrate present (10 g of peat moss in large arenas and 4.5 g of peat moss in small arenas) versus substrate absent.
277
278
THE JOURNAL OF ARACHNOLOGY
Table 1 . — Feeding regime for Phidippus tiudcix in instars 2-8. Note that instar 1 is spent within the egg sac.
|
Instar |
No. of prey introduced |
Prey species |
|
2 |
2 |
Drosophila nielauogaster |
|
3 |
4 |
D. nielauogaster |
|
4 |
6 |
D. nielauogaster |
|
5 |
1 |
Musca doniestica |
|
6 |
2 |
M. doniestica |
|
7-8 |
3 |
M. doniestica |
Spiders were kept at room temperature under a 12:12 photoperiod regime. We fed spiders three times per week, removed uneaten prey, and supplied fresh water via soaked cotton balls. We introduced prey at an approximate distance of 13 cm from the spider in large arenas and 8 cm away in small arenas. For prey, we used fruit flies, Drosophila nielauogaster, or house flies, Musca domestica, depending on spider instar (Table 1). For scavenging treatments, we killed prey immediately prior to feeding. We lightly crushed fruit flies, and we killed house flies by applying pressure to the prothorax with forceps. We used organic, sphagnum peat moss as a substrate to simulate a more natural environment. The peat moss was kept dry during the course of the study and not replaced.
Throughout the life cycle of each spider, we recorded the date of every molt and the date of death when applicable. At the end of each instar, we removed exuviae and preserved them in 80% ethanol for later measurement of carapace widths. Carapace widths were recorded using a Meiji microscope fitted with an ocular micrometer. Five of the spiders were removed from the study because of unrecorded molt dates. Voucher specimens were deposited in the Millikin University Arthropod Collection.
When spiders reached maturity, we conducted a choice test to determine which prey type (live versus dead house fly) spiders would select. For these choice tests, we introduced two prey items simultaneously > 7.0 cm in front of the spiders’ cephalothorax in a large (15 cm X 1.5 cm) arena. We ran choice tests for approximately 20 min or until capture, and then recorded prey choice. We tested a total of 226 spiders: 144 raised as predators and 82 raised as scavengers.
Statistical analysis. — To determine the effects of scavenging on P. aiidax, we recorded survival rates, instar durations and carapace widths throughout their development, and choice of live versus dead prey as adults. To isolate differences arising from each of the 3 environmental variables (prey type,
presence or absence of substrate, and arena size), we used a Cox Regression survival analysis with survival (yes or no) as the dependent variable and prey type (live or dead), substrate (yes or no), arena size (large or small), their three-way interaction and their two-way interactions as independent predictor variables.
To determine the effects of the prey type, substrate, and arena size on instar duration, we completed a General Linear Mixed Model (LMM) with instar duration as the dependent variable and instar, prey type, substrate type, arena size, and all two-way and three-way interactions as independent variables. Spider identity was included as a random variable.
Choice test results were analyzed within each group, predators and scavengers, using the chi-square goodness-of- fit test against a null expectation of 50:50. In addition, we used a chi-square contingency test to determine whether the proportion of predators that chose live prey differed from the proportion of scavengers that preferred live prey. In all cases, R-values of less than 0.05 were considered statistically significant.
RESULTS
Of the initial sample of 600 spiderlings, we successfully raised a total of 226 P. audax to maturity, with 144 raised as predators on live prey and 82 as scavengers on dead prey (Table 2; Fig. 1 ).
Survival. — There was a statistically significant three-way interaction among prey type, substrate type, and arena size with regards to survival (/i = 0.951, Wald = 4.714, df = 1, (exp) /i = 0.386, P = 0.030). The /i is the logistic coefficient for each predictor variable (i.e. arena size, substrate type, or prey type) and represents the expected amount of change in survival when changing from one condition to the other within the predictor. The Wald test (and accompanying R-value) is useful in evaluating whether or not the logistic coefficient (^) is different from zero. Finally, the (exp) fi represents the instantaneous relative risk of death, at any time, for a spider with one treatment for one variable compared with an individual with the other treatment for that variable. To gain an understanding of the nature of the interaction, we ran separate Cox Regression analyses within each of the two arena sizes.
Within the small arenas, differences in survival between spiders fed different prey types were dependent upon substrate type (two-way interaction of prey type and substrate type; (i = -1.173, Wald x‘ = 15.527, df = 1, (exp) p = 0.310, P < 0.001 ). Because of the significant interaction term within small
Table 2. — Total number of Phidippus audax assigned to each treatment, total number of spiders raised to maturity, and percent survival in each of the eight treatments.
|
Prey type |
Substrate type |
Arena size |
^Assigned to treatment |
#Raised to maturity |
% survival |
|
Live |
Empty |
Large |
75 |
43 |
57 |
|
Live |
Empty |
Small |
75 |
34 |
45 |
|
Live |
Substrate |
Large |
75 |
32 |
42 |
|
Live |
Substrate |
Small |
75 |
35 |
46 |
|
Dead |
Empty |
Large |
75 |
28 |
37 |
|
Dead |
Empty |
Small |
75 |
42 |
56 |
|
Dead |
Substrate |
Large |
75 |
2 |
0.02 |
|
Dead |
Substrate |
Small |
75 |
10 |
13 |
VICKERS ET AL.— SCAVENGING IN PHIDIPPUS AUDAX HENTZ
279
1.0
0.8
rt!
>
i 0.6
D
Ut
01
>
^ 0.4
3
e
3
u
0.2
0.0
Figure 1. — Survival curve based on Cox Regression for Phidippus aiidax raised on live prey (predator) or dead prey (scavenger). There was no significant main effect of prey type on survival {P = 0.944).
arenas, we ran a separate Cox Regression within small arenas with substrate and small arenas without substrate. Within small arenas with no substrate, there was greater survival to subsequent instars with dead prey (/? = 0.578, Wald x“ = 8.36,
-Predator -Scavenger P = 0.944
4 5
Instar
df = \, P = 0.004, (exp) /f = 1.783; Fig. 2a). Conversely, within small arenas with substrate, there was greater survival to subsequent instars with live prey (/i = —0.564, Wald x“ = 6.320, df= \, P = 0.012, (exp) /? = 0.569; Fig. 2b).
Within the large arenas, differences in survival on different prey types were dependent upon substrate type (two-way interaction of prey type and substrate type; /i = 1.797, Wald x“ = 28.077, df = 1, (exp) /i = 6.032, P < 0.001). Because of the significant interaction term within large arenas, we ran a separate Cox Regresssion within large arenas with substrate and large arenas without substrate. Within large arenas with no substrate, there was no significant difference in survival between spiders with live prey or dead prey (/( = 0.231, Wald X- = 1.285, df ^ 1, P = 0.257, (exp) p = 1.260; Fig. 2c). Within large arenas with substrate, however, there was greater survival to subsequent instars among spiders with live prey (/( = -1.736, Wald x" = 34.916, df = \, P < 0.001, (exp) p = 0.176; Fig. 2d).
Sex comparisons in mature predators and scavengers: Of the 595 spiderlings used in this study, 117 males and 99 females successfully reached maturity. However, adding the variable ‘sex’ resulted in poorer models in all cases, and there was no difference in survival between males and females in the presence of the other three variables (P > 0.198 in all cases).
Instar duration. — There were significant three-way interac- tions of instar, prey type, and substrate type (Pi.isgs = 13.682, P < 0.001; Table 3) and instar, prey type, and arena size
Instar ipsta,.
Instar 'nstar
Figure 2a-d. — Differences in survival for Phidippus audax raised on live prey (predator) or dead prey (scavenger) in a) small arenas without substrate (P = 0.004); b) small arenas with substrate (P = 0.012); c) large arenas without substrate (P = 0.257); and d) large arenas with substrate (P< 0.001).
280
THE JOURNAL OF ARACHNOLOGY
Table 3. — Results from a General Linear Mixed Model with instar duration as the dependent variable and spider identity as a random variable. Random variable (Spider ID): Wald Z = 28.249, P < 0.001 (retained in all models).
|
Variable |
df |
F |
P |
|
Instar |
5. 1595 |
148.863 |
<0.001 |
|
Prey type |
1, 1595 |
81.492 |
<0.001 |
|
Habitat |
1, 1595 |
45.681 |
<0.001 |
|
Arena size |
1, 1595 |
4.351 |
0.178 |
|
Instar*Prey |
5, 1595 |
18.913 |
<0.001 |
|
Instar* Habitat |
5, 1595 |
3.835 |
0.137 |
|
Instar*Arena |
5, 1595 |
1.083 |
0.247 |
|
Prey* Habitat |
1. 1595 |
53.919 |
<0.001 |
|
Prey*Arena |
1, 1595 |
2.352 |
0.577 |
|
Habitat*Arena |
5. 1595 |
6.799 |
0.146 |
|
Instar*Prey*Hab |
1, 1595 |
13.682 |
<0.001 |
|
Prey*Hab*Arena |
5, 1595 |
0.149 |
0.7 |
|
Instar*Prey* Arena |
5, 1595 |
6.006 |
<0.001 |
(^5.1595 = 6.006, P < 0.001; Table 3). The significant three- way interactions of instar and prey type with substrate type and arena size indicate that instar duration is dependent upon multiple variables; therefore, to determine the nature of the interactions, we used subsequent LMM’s to analyze the effects of instar and prey type as well as the two-way interactions of instar and prey type within each of the possible combinations of arena size and substrate type. The random variable, spider identity, was also significant (Wald Z = 28.249, P < 0.001), therefore, it was used in all subsequent analyses.
Within small arenas and no substrate, there was a significant interaction between instar and prey type (T5 511 = 6.473, P < 0.001); therefore, we ran a separate LMM within those with dead prey and found a significant difference in instar duration among instars with a general pattern of increasing instar duration from instar 2 (14.94 days) to instar 7 (63.95 days; Fig. 3a). The second LMM, within live prey, revealed a similar pattern, with an increase in instar duration from instar 2 (12.46 days) to instar 6 (52.6 days), however, instar 7 was slightly lower than instar 6 (51.7) creating the significant interaction term. In general, instar duration is shorter with spiders given live prey within small arenas and no substrate (Fig. 3a).
Within small arenas with substrate, there was again a significant interaction between iiistar and prey type, and a subsequent LMM within spiders given dead prey revealed a significant difference in instar duration among instars, with a general pattern of an increase in instar duration from instar 2 (23.6 days) to instar 7 (91.5 days; Fig. 3b). Exceptions were an increase in instar duration in instar 4 to 64.59 days, followed by a decrease in duration to 52 days in both the 5'’’ and 6*'’ instars. The second LMM, within live prey, again showed a general increase in instar duration from instar 2 (13.8 days) to instar 7 (47.15 days; Fig. 3b). The interaction term, then, is a product of the increase in instar duration to 64.59 days in the dead prey group’s 4‘'’ instar. Again, overall, spiders given live prey had shorter instar durations than those given dead prey within small arenas with substrate (Fig. 3b).
Within large arenas without substrate, there was a significant interaction between instar and prey type, and a subsequent LMM within spiders given dead prey revealed
a significant increase in instar duration from instar 2 (17.46 days) to instar 4 (43.68 days). However, there was a plateau in instar duration for the subsequent instars (Fig. 3c). From an LMM within spiders given live prey, we found a significant increase in instar duration from instar 2 (1 1.2 days) to instar 7 (51.85 days). Again, spiders given live prey, in general, had shorter instar durations than those given dead prey (Fig. 3c).
Within large arenas with substrate, there was another significant interaction between instar and prey type. There- fore, we ran a separate LMM within spiders with dead prey and found a significant increase from instar 2 (17.34 days) to instars 4 and 5 (89.25 days and 76.5 days, respectively). Only one spider in this group survived to instar 6 (instar duration of 37 days) and no spiders in this group survived to instar 7. From the second LMM within spiders given live prey, there was a significant increase from instar 2 (14.76 days) to instar 7 (70.64 days; Fig. 3d). Again, overall, spiders given live prey consistently had shorter instar durations than those given dead prey (Fig. 3d).
Sex coiuparisous: We initially used a LMM that included sex as an independent variable, but there was no significant interaction between other independent variables and sex {P > 0.114 in all instars) nor was there a significant difference | between males and females with regards to instar duration {P > 0.182). Given the low percentage of spiders surviving to an instar where sex could be determined and that there were no 1 significant interactions or main effects of sex, adding sex to the LMM substantially reduced the power of the analysis. Therefore, sex was not included in the final analyses of the differences in instar durations.
Carapace widths. — Overall, as spiders matured, carapace j widths were not significantly different among the eight treatments in any of the instars (P > 0.05 in all cases).
Choice tests. — Whether raised as predators or scavengers, I spider choice of prey type differed from random (i.e., 50:50). Among predators, 117 chose live prey, while 27 chose dead prey (/" = 56.25, df = P < 0.001). Among scavengers, 62 j chose live prey, while 20 chose dead prey {'/~ — 38.03, df — I, P ] < 0.001 ). There was no significant difference in the proportion of predators (117/144) and scavengers (62/82) that preferred live prey {y~ = 0.283, df = 1, P = 0.595).
DISCUSSION
Spiders can survive on dead prey alone but face costs, such as lower survival rates and longer instar durations. Addition- ally, the two independent variables of substrate/no substrate and large/small arenas had significant effects on scavenging spiders.
Survival. — With the addition of substrate in both small and large arenas, scavengers exhibited lower survival rates. Our results are consistent with those of previous studies. Phidippus aiidax has been observed to hunt mainly on upper, well-lit areas of vegetation, such as leaves and branches, as well as on the sides of houses and fence posts (Givens 1978; Carducci & Jakob 2000). It therefore stands to reason that the dark j substrate color and the lack of visual stimuli from dead prey ' hindered the spiders’ ability to find dead prey items and would both have a significant, negative impact on the spiders’ survival rates and instar durations. This indicates a low '
VICKERS ET AL.— SCAVENGING IN PHIDIPPUS AUDAX HEHTZ
281
Instar
Instar
Instar Instar
Figure 3a-d. — Differences in instar duration for Phidippus aiidax raised on live prey (predator) and dead prey (scavenger) in a) small arenas without substrate; b) small arenas with substrate; c) large arenas without substrate; and d) large arenas with substrate.
probability of successful scavenging by P. audax in nature, where the foraging area is substantially larger and substrate is varied and abundant. In the smaller foraging area, spiders had a greater likelihood of finding dead prey by chance.
We found an interesting exception to the trend of lower scavenger survival rates for treatments involving empty arenas. While predators and scavengers in large, empty arenas had statistically similar survival rates, scavengers had signif- icantly greater survival to subsequent instars than predators in small, empty arenas. These results are somewhat counterintu- itive, but a possible explanation is that scavenger P. audax, within a smaller foraging area, could have encountered and began feeding upon dead prey items more quickly than predator P. audax could capture and begin feeding on live prey. In accord with our results, when predatory waterbugs Microvelia macgregori Kirkaldy (Hemiptera: Veliidae) held in water-filled arenas, were given dead prey items, D. mekmoga- ster, the waterbugs began feeding when they came across a dead prey item (Jackson & Walls 1998). Wolf spiders often
took dead prey as a meal if given the option, even if live prey items were present (Knost & Rovner 1975). The jumping spider. Trite planiceps Simon 1899 fed on freshly killed squashed flies, if left overnight in their arenas (Forster 1982b). In the latter case as well as in our study, the scavenging spiders may have detected minor residual move- ments from the freshly killed Hies that prompted them to attack and feed.
Instar duration. — On average, scavengers had longer instar durations. Scavengers raised in substrate-filled arenas, both large and small, exhibited the longest instar durations, presumably due to difficulty in finding prey. Our results are consistent with the literature. Pholcid spiders, Holoaieuuis pluchei (Scopoli 1763), developed significantly faster and often underwent fewer molts when they were given a prey diet that allowed them to reach their satiation point (Jakob & Dingle 1990). Alternatively, when prey were limited, the orb-weaving Zygiella-x-notata (Clerck 1757), had longer instar durations, a correspondingly longer development time, and reduced adult
282
THE JOURNAL OF ARACHNOLOGY
weight (Mayntz et al. 2003). In addition, spiders reduce their metabolic rates during long periods of food deprivation and consequently survive longer (Anderson 1974; Greenstone & Bennett 1980), which in turn may result in longer instar durations.
Although P. aiu/ax are naturally active predators feeding on a wide variety of live prey, we have shown for the first time that these spiders are capable of surviving from egg sac emergence to maturity solely on a diet of dead prey, albeit with lower survival rates and longer instar durations. In addition to acquiring nutrients from the dead prey, spiders raised as scavengers may have also used metabolic defense mechanisms to survive. For example, in a time of prey shortage, spiders will exhibit a high tolerance to starvation by lowering metabolic rates and using their abdomens to store large quantities of lipids that can be used slowly until the prey shortage ends (Anderson 1974; Greenstone & Bennett 1980; lida 2005). Further research should be conducted to better understand the types of nutrients being obtained from freshly killed or desiccated prey items. Whatever the nutrients are, our results indicate that at least some jumping spiders were able to survive by further breaking down dead prey items (Givens 1978; Cohen 1995; Foelix 1996; Morse 1998).
Carapace widths. — Overall, as spiders matured, we found that carapace widths were not significantly different among the eight treatments from instar to instar. Predators and scavengers grew comparably, regardless of their prey type. With regard to scavenging, these results may indicate that even though we reported significant differences in mortality and instar duration, individuals were able to reach average size. Correspondingly, the orb-weaver, Zygiella x-notatci, experienced longer instar durations when prey was limited, but these prey shortages did not negatively impact growth within an instar. Additionally, spiders fed low quality prey experienced higher instar growth ratios by utilizing the longer instar durations to gain more weight (Mayntz et al. 2003). The wolf spider Pardosa prativaga (L. Koch 1870) experienced longer instar durations when food restricted or fed nutritionally insufficient prey items. However, when available prey was more abundant, spiders were able to catch up on any lack in growth and development (Jespersen & Toft 2003). Although the ability to stay within an instar for longer periods of time to grow to average size may be beneficial in the long run, in the short run it would make scavengers more susceptible to predators in the wild.
Choice tests. — Because spiders raised both as predators and scavengers preferred live prey as adults, P. audax exhibited its instinctive predatory behavior regardless of the diet on which it was raised. However, it is important to note that 47 spiders did choose dead prey. This result could simply be due - at least in part - to spiders finding and feeding on dead prey before detecting live prey. Corroborating this hypothesis, wolf spiders (Knost & Rovner 1975) and jumping spiders (Forster 1982b) will feed on dead prey if they happen to come into contact with it while foraging.
Our results indicate that P. audax can be reared as a scavenger throughout its entire life cycle, but at certain costs to the organism. Whether or not scavenging occurs in the field is largely unknown. Much of the research conducted on scavenging has been carried out in a controlled laboratory setting (Knost & Rovner 1975; Wolff 1986; Cramer 2008),
where many of the variables can be restricted to much narrower ranges than those that prevail in the natural world. Because P. audax is a highly visual predator that actively hunts for prey, scavenging may be a way to supplement food intake during times of prey shortage. Further research should also be conducted to determine the effects of a multi-prey diet on scavenging as an alternative feeding strategy.
ACKNOWLEDGMENTS
We would like to thank Rock Springs Center for Environmental Discovery for allowing us to collect spiders. In addition, we would like to thank Denise Slane for helping us maintain spider colonies in the laboratory. We thank the Millikin Summer Undergraduate Research Fellowship and the Millikin Biology Department for funding this research.
LITERATURE CITED
Anderson, J.F. 1974. Responses to starvation in the spiders Lycosa lenfa Hentz and Filistata hibenuilis (Hentz). Ecology 55:576-585. Barrantes, G. & J. Weng. 2008. Carrion feeding by spiderlings of the cob-web spider Theridkm evexiim (Araneae, Theridiidae). Journal of Arachnology 35:557-560.
Carducci, J.P. & E. Jakob. 2000. Rearing environment affects behaviour of jumping spiders. Animal Behaviour 59:39M6.
Clark. R.J., R.R. Jackson & B. Cutler. 2000. Chemical cues from ants influence predatory behavior in Hahrocestum piilex, an ant-eating jumping spider (Araneae, Salticidae). Journal of Arachnology 28:309-318.
Cohen, A.C. 1995. Extra-oral digestion in predaceous terrestrial Arthropoda. Annual Review of Entomology 40:85-103.
Cramer, K.L. 2008. Are brown recluse spiders, Loxosceles reclusa (Araneae, Sicariidae) scavengers? The influence of predator satiation, prey size and prey quality. Journal of Arachnology 36:140-144.
Foelix, R. 1996. The Biology of Spiders, 2"^ ed. Oxford University Press, New York.
Forster, L.M. 1982a. Vision and prey-catching strategies in jumping spiders. American Scientist 70:165-175.
Forster, L.M. 1982b. Non-visual prey-capture in Trite planiceps, a jumping spider (Araneae, Salticidae). Journal of Arachnology 10:179-183.
Freed, A.N. 1984. Foraging behaviour in the jumping spider Phidippus audax: bases for selectivity. Journal of Zoology 203:49-61.
Givens, R.P. 1978. Dimorphic foraging strategies of a salticid spider (Phidippus audax). Ecology 59:309-321.
Greenstone, M.H. & A.F. Bennett. 1980. Foraging strategy and metabolic rates in spiders. Ecology 61:1255-1259.
Harland, D.P. & R.R. Jackson. 2000. Cues by which Portia fimbriata, an araneophagic jumping spider, distinguishes jumping-spider prey from other prey. Journal of Experimental Biology 203:3485-3494. Hill, D.E. 1979. Orientation by jumping spiders of the genus Phidippus (Araneae: Salticidae) during the pursuit of prey. Behavioral Ecology and Sociobiology 5:301-322. lida, H. 2005. Trade-off between hunting ability and starvation tolerance in the wolf spider. Pardosa pseudoamndata (Araneae: Lycosidae). Applied Entomology and Zoology 40:47-52.
Jackson, R.R. 2000. Prey preferences and visual discrimination ability of Brettus, Cocalus, and Cyrba, araneophagic jumping spiders (Araneae: Salticidae) from Australia, Kenya and Sri Lanka. New Zealand Journal of Zoology 27:29-39.
Jackson, R.R. & S.D. Pollard. 1996. Predatory behavior of jumping spiders. Annual Review of Entomology 41:287-308.
Jackson, R.R. & E.l. Walls. 1998. Predatory and scavenging behaviour of Microvelia luacgregori (Hemiptera: Veliidae), a
VICKERS ET AL.— SCAVENGING IN PHIDIPPUS AUDAX HENTZ
283
water-surface bug from New Zealand. New Zealand Journal of Zoology 25:23-28.
Jackson, R.R., R.J. Clark & D.P. Harland. 2002. Behavioural and cognitive intluences of kairomones on an araneophagic jumping spider. Behaviour 139:749-775.
Jackson, R.R., X.J. Nelson & G.O. Sune. 2005. A spider that feeds indirectly on vertebrate blood by choosing female mosquitoes as prey. Proceedings of the National Academy of Sciences 102:15155-15160.
Jackson, R.R., K. Salm & S.D. Pollard. 2008. Snatching prey from the mandibles of ants, a feeding tactic adopted by East African jumping spiders. Journal of Arachnology 36:609-61 1.
Jackson, R.R., S.D. Pollard, X.J. Nelson, G.B. Edwards & A.T. Barrion. 2001. Jumping spiders (Araneae: Salticidae) that feed on nectar. Journal of Zoology, London 255:25-29.
Jackson, R.R., D. Li, A.T. Barrion & G.B. Edwards. 1998. Prey- capture techniques and prey preference of nine species of ant- eating jumping spiders (Araneae: Salticidae) from the Philippines. New Zealand Journal of Zoology 25:249-272.
Jakob, E.M. & H. Dingle. 1990. Food level and life history characteristics in a pholcid spider {Holocnemiis pluchei). Psyche 97:95-102.
Jespersen, L.B. & S. Toft. 2003. Compensatory growth following early nutritional stress in the wolf spider Pardosa prativaga. Functional Ecology 17:737-746.
Knost, S.J. & J.S. Rovner. 1975. Scavenging by wolf spiders (Araneae: Lycosidae). American Midland Naturalist 93:239-244.
Land, M.F. 1971. Orientation by jumping spiders in the absence of visual feedback. Journal of Experimental Biology 54:119-139.
Mayntz, D., S. Toft & F. Vollrath. 2003. Effects of prey quality and availability on the life history of a trap-building predator. Oikos 101:631-638.
Meehan, C.J., E.J. Olson, M.W. Reudink, T.K. Kyser & R.L. Curry. 2009. Herbivory in a spider through exploitation of an ant-plant mutualism. Current Biology 19:R892-R893.
Morse, D.H. 1998. The effect of wounds on desiccation of prey: Implications for a predator with extra-oral digestion. Oecologia 115:184-187.
Nyffeler, M., R.G. Breene & D.A. Dean. 1990. Facultative monophagy in the jumping spider, Plexippiis paykiiUi (Audouin) (Araneae: Salticidae). Peckhamia 2:92-96.
Penney, D. & R. Gabriel. 2009. Feeding behavior of trunk-living jumping spiders (Salticidae) in a coastal primary forest in the Gambia. Journal of Arachnology 37:1 13-1 15.
Richman, D.B. & R.R. Jackson. 1992. A review of the ethology of jumping spiders (Araneae, Salticidae). Bulletin of the British Arachnological Society 9:33-37.
Rienks, J.H. 2000. Extended nest residence and cannibalism in a jumping spider (Araneae, Salticidae). Journal of Arachnology 28:123-127.
Ruhren, S. & S.N. Handel. 1999. Jumping spiders (Salticidae) enhance the seed production of a plant with extrafloral nectaries. Oecologia 119:227-230.
Sandidge, J.S. 2003. Scavenging in brown recluse spiders. Nature 426:30.
Vetter, R.S. 2011. Scavenging by spiders (Araneae) and its relationship to pest management of the brown recluse spider. Journal of Economic Entomology 104:986-989.
Wolff, R.J. 1986. Scavenging by jumping spiders (Araneae: Salt- icidae). Great Lakes Entomologist 19:121-122.
Manuscript received 27 April 2013, revised 22 August 2014.
2014. The Journal of Arachnology 42:284-292
Removal of genital plugs and insemination by males with normal and experimentally modified palps in
Leucaitge mariana (Araneae: Tetragnathidae)
Vivian Mendez' •’ and William G. Eberhard' ^': 'Escuela de Bioiogia, Universidad de Costa Rica, Ciudad Universitaria, Costa Rica; -Universidad Nacional Autonoma de Mexico; -’Department of Biological Sciences, Macquarie University, Sydney, NSW 2109, Australia; ■’Smithsonian Tropical Research Institute, Biological Sciences, Louisiana State University, Baton Rouge, LA. E-mail: william.eberhard@gmail.com
Abstract. Both males and females of the spider Leiicaiige mariana (Taczanowski 1881) contribute material to the plugs that often occlude the genital openings of females in the field. Males were sometimes unable to remove or penetrate these plugs, but overcame others using three different mechanical mechanisms: snag the plug and pull it off; break and penetrate through it; and break its adhesion to the epigynum by injecting material under it. They used their genitalia to accomplish these tasks, despite the fact that the genital bulb lacks muscles and innervation, thus limiting the male’s ability to guide genital movements precisely. The effects of two male genital structures, the conductor tip and the conductor hook on sperm transfer and genital plug removal were tested by direct observations of their morphology and behavior, and by experimental removal of structures from one but not the other palp of the same male. Removal of the conductor tip reduced sperm transfer, while removal of both the hook and the conductor reduced plug removal. A preliminary characterization of palp movements and their sequences did not reveal any behavior that seemed especially designed for removing plugs, as opposed to inseminating the female.
Keywords: Copulatory plugs, genitalic function, cryptic female choice, plug removal
Genital plugs in female genitalia occur in many animals, and are generally formed from male seminal products or parts of the male’s own genitalia (Smith 1984; Birkhead & Moller 1998; Simmons 2000; Uhl et al. 2010). Some plugs prevent subsequent males from gaining access to the female’s reproductive tract, and plugs are often included in lists of sperm competition devices of males (Parker 1970; Thornhill & Alcock 1983; Smith 1984; Birkhead & Moller 1998; Simmons 2000). Active female participation in making plugs occurs, however, in some spiders (Knollach 1998; Uhl et al. 2010; Aisenberg & Barrantes 2011) and insects (Markow & Ankney 1988; Hosken et al. 2009).
In several groups, plugs do not consistently exclude subsequent males (reviewed in Eberhard 1996; Uhl et al. 2010), and males of some species remove at least some copulatory plugs from the female (Milligan 1979; Masumoto 1993; Eberhard 1996; Knoflach 1997). The male’s genitalia often seem to be active during the process of plug removal, but details of the mechanisms by which plugs are removed have been little studied. Most data involve only extrapolations from the probable mechanical properties of male genital structures. For instance, penile spines in microtine rodents and eversion movements of the hemipenes in lizards have been hypothesized to function to remove plugs (Milligan 1979; In den Bosch 1994), but direct observations and experimental evidence are lacking. The thin pointed shape of the distal portion of the aedeagus of a papilionid butterOy has been hypothesized to allow the male to tunnel through or to slip past soft, recently formed or small plugs (Matsumoto & Suzuki 1992). The male of the linyphiid spider Duhiaranea (?) apparently dissolves plugs in situ, perhaps with liquid from either his mouth or his palps, and he then removes the pieces with undetermined portions of his palps (Eberhard 1996). Male Agelena limbata Thorell 1897 spiders also use unspecified portions of their palps to pry plugs from the female (Masumoto 1993). To our
knowledge, no male morphological structure has ever been i| demonstrated experimentally to be specialized for plug removal. ,,
Given the selective importance to males of gaining access to * internal female genitalia, it seems likely that male structures I specialized for plug removal exist. Male genitalia seem ; particularly likely to have plug removal structures, as they probably often contact plugs. Plug removal devices could evolve under sexual selection by male-male competition |i
(sperm competition), female choice (if females influence plug j deposition, the necessity for plug removal, or the effectiveness of removal attempts), male-female conflict (if the female’s best ji interests involve maintaining a plug), or combinations of these ; factors (e.g. Wiley & Posten 1996; Arnqvist & Rowe 2005; Eberhard 2010). ;[
The present study documents female effects on plug i deposition and removal, and a male genital structure whose form, mechanical properties and behavior suggest that it represents an adaptation to remove plugs in the tetragnathid spider Leucaiige mariana (Taczanowski 1 88 1 ), a member of the large cosmopolitan genus Leucauge White 1841 (>150 species; Platnick 2013) that is abundant in early second growth and secondary forest in the Central Valle (San Jose Province) of Costa Rica. Copulation and sperm transfer have been studied in detail in this species (Eberhard et al. 1993; Eberhard & Huber 1998a; Mendez 2002; Aisenberg 2009; Aisenberg & Eberhard 2009; Barrantes et al. 2013), but nearly exclusively in virgin females. '
As in other spiders (Eberhard & Huber 2010), the sperm of L. mariana are encapsulated when they are transferred from the male’s palp to the female’s internal spermathecae in a ^ viscous liquid matrix (Figs. 1, 2c). Once inside the female, the sperm emerge from their capsules (Eberhard & Huber 1998a), as in the related Nephila clavipes (Linnaeus 1767) (Brown 1985). Sperm precedence patterns are not known in L.
284
MENDEZ & EBERHARD— REMOVAL OF PLUGS BY MALE GENITALIA
285
Figure 1. — Epigynum without a plug (left) and with a partial, asymmetrical plug (right).
Figure 2. — Ventral and microscopic views of plugs of L. mariana. a) a yellow plug containing spheres (arrows) but no sperm; b) a large mixed white and yellow plug overflowing the central cavity, with an irregular surface; c) contents of a plug stained with acetocarmine which contained both encapsulated sperm (right arrow) and decapsulated sperm (left arrow); d) a white plug covering the lower portions of one side of the epigynum (arrow indicates a portion of the epigynal curved ridge that was not covered; e) a yellow-orange plug with a granular surface; 0 a small yellowish plug with a smooth surface at the anterior corner of the left side of the central cavity (arrow); g) a white plug with a smooth surface that covers most of the central cavity.
mariana, but the fact that males in the field occur preferen- tially with penultimate iestar females rather than mature females (Eberhard et al. 1993), indicates that the first male to mate with a female often sires at least some of her offspring. On the other hand, the following combination of observations indicates that first male sperm precedence is not complete: males mate with non-virgin females both in the field and in captivity (Mendez 2002; W. Eberhard unpub. obs.); distinctive behavior of the male’s genitalia results in deposition of one component of the plug during the latter stages of copulation (Eberhard & Huber 1998a); females in some cases add a second component to the plug (Eberhard & Huber 1998a; Aisenberg 2009; Aisenberg & Eberhard 2009); and males push and scrape at some plugs with their genitalia without dislodging them, but dislodge others and then apparently succeed in inserting their genitalia in the female (Mendez 2002; the present study). Mixed first and last male paternity has been observed in the related genus Tetragnatha Latreille 1841 (Danielson-Frangois & Bukowski 2005).
The female’s epigynum, where all male insertion, plugging, and unplugging attempts occur, is a sclerotized plate on the ventral surface of her abdomen, with a central cavity that is bounded anteriorly by an overhanging wall (Fig. 1); access to the entrance of each of the two insemination ducts, which lead to the two spermathecae, is through slits at the base of the rounded lateral wall of the central cavity. Plugs consist of masses that vary in size, shape, consistency and texture that are located at variable sites on the epigynum (Figs, lb, 2b, d-g) (Mendez 2002).
During copulation, the palps are extended, and contact the female’s abdomen in alternation. The subapical cymbium of the palp (Fig. 3) is first placed on a featureless region of the ventral surface of the female’s abdomen just anterior to her epigynum. Then the basal hematodocha inflates (“primary inflation”), causing the distal bulb to rotate so that its terminal portion, which includes the intromittent embolus and the tip and hook of the conductor sclerite, moves ventrally away from the cymbium and then dorsally toward the entrance of the insemination duct on the female’s epigynum. If the entrance is unobstructed and the palp is correctly aligned, the conductor hook sweeps antero-laterally across the female’s epigynum until it is arrested by the anterior wall, and the basal hematodocha then swells further (a “secondary inflation”), causing further rotation that drives the conductor tip and the
286
THE JOURNAL OF ARACHNOLOGY
Figure 3. — Movements (small arrows) of embolus base and tegulum that resulted from inflation of the basal hematodocha (partially collapsed in this preparation; the approximate position of the cymbium in life is indicated by the dotted lines). The tegulum rotated against the paracymbitim, whose tip slid along the groove in the tegulum as the expansion of the basal hematodocha drove the embolus distally from the conductor (from Eberhard & Huber 1998a).
embolus into the insemination duct (an “insertion”) (Eberhard & Huber 1998a). Substantial force is applied to the female during primary and secondary inflations, sometimes displac- ing her entire abdomen laterally.
Two types of palpal insertion occur in copulations with virgin females (Eberhard & Huber 1998a). “Long” insertions (when sperm transfer probably occurs, at least in copulations with virgin females) last on the order of 1 min. Repeated secondary intlations of the basal hematodocha alternate with brief collapses; each inflation drives the embolus tip into the insemination duct. “Short” insertions last on the order of Is and involve only a single secondary inllation, and both the embolus and conductor are then pulled away from the epigynum when the basal hematodocha collapses. Short insertions usually occur in bouts, and later in copulation. A small mass of white material emerges from the tip of the embolus and is deposited on the surface of the epigynum during many short insertions. Many apparent insertion attempts fail (44% in copulations with virgin females; Eberhard & Huber 1998a), when the conductor tip and or the hook snag the epigynum only momentarily or miss it completely during a primary inllation (“flubs” in the terminology of Watson 1991). On average, copulation with virgin females lasted 17.3 ± 6.1 min; there were 3.5 ± 2.0 long
insertions, averaging about 108-120 s in duration, and 6.2 ± 5.2 bouts of short insertions with a mean of 14.6 ± 7.0 indations per bout. Copulations with unplugged non-virgin females were shorter (9.9 ± 13.3 min), and had fewer long insertions (0.2 ± 0.6).
It is important to keep in mind that insertion attempts by male L. mariana are “blind” in two senses. The male’s eyes are on his dorsal side, so he cannot possibly see his palps, copulatory plugs, or the female’s genitalia during copulation. In addition, his palpal bulb is not innervated (Eberhard & Huber 1998b, 2010), so he has no direct sensory feedback from the bulbal structures (conductor tip, hook, embolus) that contact the female’s genitalia. Movements of bulb sclerites are produced by changes in internal pressure and expansion of hematodochal membranes, rather than by contractions of muscles. The only sensory feedback that may be available to the male is from more basal structures such as his cymbium, which is innervated and has abundant setae on its surface that contact the female’s abdomen during intromission attempts, or other segments of his palp.
METHODS
Spiders were readily induced to copulate ventral side upward under a dissecting microscope, where details of the
MENDEZ & EBERHARD— REMOVAL OF PLUGS BY MALE GENITALIA
287
Figure 4. — SEM images of the distal portions of the male palpal bulb of L. markma. a) intact palp; b both the hook and the conductor tip removed; c only the tip of the conductor removed; d) close-up of embolus tip at the site where the conductor tip was cut off.
behavior of the male’s palps and their mechanical interactions with the female’s epigynum were observed and recorded. An orb of a mature female in the field was mounted on the raised edges of a plastic plate about 30 cm in diameter, and the female to be observed and then the male were induced to climb onto the web. The plate was then placed under a microscope. We captured each mature male in the field the day he was observed. All spiders were collected on the campus of the Universidad de Costa Rica in San Pedro de Montes de Oca, San Jose Province, Costa Rica (el. 1100 m).
Each palp introduces sperm into only one of the female’s two spermathecae, so paired tests were possible to test for effects of modifying one of the male’s palps but not the other on plug removal, sperm transfer, and palp behavior (see Discussion for limits on details of the replications). We modified the palps of some males experimentally by first clamping the male gently between the foam-rubber covered tips of a fine forceps with one palp exposed, then cutting palpal sclerites with a fine scissors under a dissecting microscope (Fig. 4). We made two types of cut: both the conductor tip and the conductor hook of one palp were cut near the tip of the conductor lobe (Fig. 4d); or the conductor tip was cut leaving the hook intact (Fig. 4b). The tip of the male’s intromittent organ (the embolus) (Fig. 4c) was enclosed in a slot in the conductor tip, basal to the tip of the lobe; it was thus not affected by cuts at the level of the hook, and little affected by more basal cuts. No fluid was seen to leak from these injuries, either when the cuts were made or subsequently during copulation. Incidental contact with the sclerites during these operations revealed that the tip of the conductor was
flexible and bent easily when contacted; the hook, in contrast, was more rigid and bent little if at all.
We left the male’s other palp intact as a control. Thus, in contrast to other well-known tests of the effects of experi- mental modifications of male morphology on female respon- ses (e.g. Andersson 1982; Moller 1988; Basolo 1990), we controlled at least partially for the possibility that modifica- tion of the male’s morphology affected him in additional ways (e.g., his courtship behavior) that could affect his reproductive success. The asymmetric nature of some plugs (e.g., Fig. lb) meant, however, that the conditions encountered by the male’s two palps were not always identical (see Discussion). The plugs in all plugged females that were mated to males with modified palps were white and apparently hard. Nearly all operated males were observed copulating with only one female; one male was observed with one female with a plug and another female that was virgin.
We checked insemination success in matings with virgin females by dissecting the epigynum and the spermathecae from the female, placing the pair of spermathecae on a microscope slide in a drop of saline and squashing them under a coverslip. The areas of the separate sperm masses that were expelled from each of the membranous first spermathecal chamber (where sperm are deposited by the male; Eberhard & Huber 1998a) were compared for the spermatheca that corresponded to the experimentally modified palp versus the spermatheca that was inseminated by the control palp. While the pressure of the squash with the cover slip was not standardized, the two spermathecae were squashed simulta- neously and with enough pressure to extrude whatever sperm
288
THE JOURNAL OF ARACHNOLOGY
they contained, so meaningful comparisons of their contents could be made.
Sperm from the male genitalia, complete plugs, and white masses that we collected from the male’s palp on the tip of a fine needle without allowing the material to contact the epigynum were mounted on microscope slides and stained with acetocarmine, a DNA stain that colored the sperm nuclei bright red while leaving the other material relatively transpar- ent (Fig. 2c). We assessed plug consistency by gently poking and prying at plugs on the epigyna of live spiders with a small needle under a dissecting microscope.
We captured plugged females in the field, and obtained virgin females by allowing field-captured penultimate instar females to molt in isolation in captivity. We recorded copulation behavior using a Sanyo VDC-2950 video camera that was attached to a dissecting microscope and focused tightly on the female’s epigynum, so that its width occupied about 75% of the width of the screen. Male palp behavior was classified in video recordings as follows: flub with a brief snag on plug or epigynum; flub without a snag; reposition cymbium on female abdomen; secondary inflation without insertion (of at least the conductor - see below); secondary inflation with insertion; palp immobile (motionless for > 1 s); and withdraw palp from abdomen (usually to change palps).
RESULTS
Origin and composition of genital plugs. — Genital plugs on the epigyna of mature field-collected females varied in size, color, surface texture, site, and contents (Fig. 2). Yellowish plugs (Fig. 2e) were rare (2.5% of 200 females checked in January 2007), and often lacked sperm (56.7% of 33), but sometimes contained spheres (Fig. 2a) (39.4% of 33). All broke easily into flakes when poked with a needle. Silvery- white plugs (Fig. 2b, d, f, g), in contrast, all contained sperm (100% of 57) (Fig. 2c), never contained spheres (0% of 57), were hard, did not break into flakes when poked (although they occasionally broke into large chunks), and adhered more tightly to the epigynum than did yellowish plugs. Some field- collected genital plugs were heterogeneous, possibly the result of the mixture of new plug material and partially dislodged previous plugs; mixing of this sort occurred in matings in captivity. Plugs that were not disturbed by subsequent matings were long-lasting. Each of ten wild-caught females that were kept isolated from males for 22 days in captivity had the same type of plug at the end that she had had when captured.
All sperm inside the palpal bulbs of two males were encapsulated (right arrow in Fig. 2c). The small masses of white material deposited by the male on the epigynum and collected directly from the palps also contained abundant sperm that were almost exclusively encapsulated (all sperm in ten masses were encapsulated; all but a single sperm among many sperm in one other mass were encapsulated). No spheres were present in the material collected directly from the palps or the white masses.
We confirmed previous suggestions that females contribute material to plugs (Eberhard & Huber 1998a; Aisenberg 2009; Aisenberg & Eberhard 2009) in three ways. Direct observa- tions of copulating pairs under the dissecting microscope showed, in a few cases in which visibility was good, that liquid welled up into the atrium from inside the female’s insemination
duct during copulation, replicating previous observations (Eberhard & Huber 1998a). This liquid appeared to cause the white masses from the male to dissolve or disperse, forming a I silvery-white or transparent plug. In two cases, a plug that was J composed of both new material and parts of a previous i plug that was not completely dislodged apparently hardened f rapidly and blocked further insertion attempts; but more often | the male easily penetrated the apparently liquid plug repeatedly during copulation. Some females may have also added liquid i soon after copulation ended and the spiders separated, as the ; material on the epigynum generally acquired a more liquid i appearance following the end of copulation. When no liquid emerged from the interior of the female during copulation, as | was common in copulations with virgin females in captivity | (Eberhard & Huber 1998a; Aisenberg & Eberhard 2009), the J male removed nearly all or (more often) all of the white masses ' that he deposited; the small masses adhered to his palps during ; subsequent insertions, and were withdrawn adhering to them and then fell or were lost. i
Plug composition gave a second indication of active female participation in the formation of both yellow and white plugs. ;; Of 57 white plugs, 18 contained multiple decapsulated sperm ; (left arrow in Fig. 2c). Because sperm in the spermatheca 1 become decapsulated following insemination (Eberhard & I Huber 1998a), while all or nearly all of the sperm in the male’s I genitalia prior to copulation and in the white mass that he i deposited on the female epigynum were encapsulated (above), \ the abundant decapsulated sperm in these plugs suggest that i the plugs contained material from the female, probably from f her spermatheca. Yellow plugs, on the other hand, are ! probably often produced by only the female; 56.7% of 33 |:
contained no sperm at all. In contrast, all material we collected ' from male palps, as well as material seen in sections of the i| distal portions of the sperm ducts inside intact palps j (Eberhard & Huber 1998a) contained numerous sperm (all [; of which were encapsulated). j
Finally, the sites of some small plugs that did not cover the entire central cavity were consistent with female contributions, j: They were along the sides of the cavity or at its anterior-lateral : corners, and covered the lower rather than the more salient f portions of the epigynum (Fig. 2, d f, g); these are sites where '' liquid ejected from the insemination ducts would be expected [ to first accumulate. This evidence does not clarify which sex i produced the plug substance because male contributions could not be ruled out, but they are compatible with female participation. t
Copulations that fail to result in plugs may be common in ; the field. Of 64 females collected with no plugs, 82.8% i nevertheless had sperm in their spermathecae. Plug removal by j the female with her legs could not be ruled out in these cases, but only infrequent removal is seen in captive females (above) i so this is probably not the sole explanation. Field populations of L. mariana showed strong seasonal peaks of abundance, ; and unplugged females were more common in the field early in ' population peaks than later (Mendez 2002).
Plug removal — Intact males attempting to copulate with a I' female with a white plug were only sometimes (68% of 28 !
pairings) able to dislodge it enough to allow insertion of the ; conductor into at least the outer portion of the insemination : duct on at least one side of the epigynum (“plug removal” f
MENDEZ & EBERHARD— REMOVAL OF PLUGS BY MALE GENITALIA
289
hereafter) (in these and other “insertions” described below, direct determination of whether deeper penetration by the embolus occurred was not possible, because the tip of the conductor was out of sight). Plugs were dislodged by the palps in three different ways. In each case removal occurred after the palp had “snagged” against the plug (its movement was interrupted at least briefly by contact with the plug). In 21 pairs, the mechanism of removal was determined: pulling or prying the plug away as a single piece from the epigynum (14%); breaking the plug and then either prying away the pieces or penetrating past them (33%); and injecting material under the plug and then pulling it off as a unit (53%). In pulling a plug off as a unit, the conductor tip or hook scraped across the surface of the epigynum, snagged the plug, and then pulled or pried it free. No material emerged from the palp during these movements. In perforating or inserting the tip of his palp through a crack in the plug, the male apparently drove the conductor tip toward or into the insemination duct. Some broken pieces of these plugs were pulled from the epigynum during subsequent inflations. In removing a plug by injecting material under it, the conductor tip and probably the hook (it was not possible to resolve this detail in direct observations) penetrated through the plug, but did not appear to enter the insemination duct. The palp ejected materia! that accumulated between the plug and the surface of the epigynum and broke the plug free from the epigynum; it was then pulled away during subsequent inflations. We did not discern differ- ences in the movements of the male’s genitalia that seemed to be specially designed to utilize these different mechanisms.
In some cases, when the plug consisted of more than one mass or was broken into pieces but not all the pieces were removed, the male nevertheless succeeded in inserting one or both of his palps into at least the entrance of the female’s insemination ducts. In some video sequences it was clear that the conductor tip was bent back sharply as it scraped across the surface of the plug, suggesting that the more rigid hook was more effective than the conductor tip in applying force to the plug. In all copulations in which a plug was removed the male subsequently deposited new plug material.
The basic movements of the palp before and after the plug was dislodged were compared in ten intact males that were paired with females with white plugs. Cymbium placement, and primary and secondary basal hematodochal expansions that swung the conductor tip and hook across the epigynum were at least qualitatively similar before and after the plug was dislodged.
Effects of experimental modifications on plug removal and sperm transfer^ — The frequency of plug removal was only barely significantly reduced when both the hook and the conductor tip of one palp were removed compared with intact males (41% of 17 pairs) {P = 0.04 with one-tailed there was no significant reduction when only the conductor tip was removed (52% of 21 pairs (P = 0.27 with x“)- Comparisons between the modified and unmodified palps of the same male gave more dramatic differences in some respects. Of seven cases in which a plug was broken by a male that had lost both hook and conductor tip, all breaks were produced by the intact rather than the modified palp (x^ = 7.0, df = 1, P = .008); in contrast, of 20 cases in which the plug was broken when the male had lost only the conductor tip, half were produced by the intact palp and half by the modified palp. Of
five cases in which a plug was removed as a unit from both sides of the epigynum at once in experiments in which both the hook and the conductor tip were removed, the trend was in the expected direction: the intact palp removed the plug in four of them (x^ = 1.8, df = 1, one-tailed P = 0.09). Summing the two modification experiments, the plug was dislodged as a unit by the intact palp in seven of eight cases (x^ = 4.50, df = 1, one tailed P = 0.017).
In contrast, both modified and control palps were effective once a plug was broken. When the plug was broken and at least one piece was removed, the intact palp removed a piece of the plug on its side of the epigynum in eight cases and the modified palp in seven. The frequency with which a palp snagged the plug at least once was not altered (59% for palp lacking both the hook and the conductor tip, 76% for palp lacking only the conductor tip, 71% for the intact palp).
Insemination of virgin females was reduced when the palps were modified. The spermatheca on the side into which the intact palp v/as inserted (the “control” spermatheca) was full in all 19 females that were dissected after being mated to males with both conductor tip and hook removed, while the “experimental” spermatheca (into which the modified palp was inserted) was uninflated and apparently empty of sperm in 53% of these females (x^ = 13.6, df = 1, P = 0.0002, comparing empty and non-empty spermathecae). The control spermatheca was more full than the experimental in 17 (90%) of these females (X^ = 13.5, df = 1, P = 0.00024). Corresponding data when only the conductor tip was removed were 11 of 1 1 control spermathecae full, and 64% of the experimental spermathecae not inflated (x^ = 10.3, df = 1, P = 0.0014, comparing empty and non-empty spermathecae). The control spemathecae contained a greater amount of sperm than the experimental spermatheca in nine of 11 (82%) cases (x“ = 4.45, df = 1, P = 0.035). The differences in the frequency of uninflated spermathcae between the two experimental treatments with respect to the control spermathecae were not significant (P = 0.71 with a two-tailed Fisher Exact Test).
The total durations of attempts to intromit (including both primary and secondary inflations) in 39 matings with modified males were not significantly shorter than in 29 matings with intact males {P = 0.39 with Wilcoxon/Kruskal Wallis Rank Sums Test). The total numbers of primary inflations (with and without subsequent secondary inflations) of control and modified palp were nearly equal in 37 copulations (2056 inflations by control palps, 2098 by modified palps; respective means = 69.4 ± 59.3 and 69.3 ± 58.5; P — 0.92 with Mann- Whitney U Test). The proportion of fiiibs in which control and modified palps snagged at least briefly on the plug or the epigynum also did not differ (respective means = 55 ± 34% and 58 ± 34%; P = 0.99 with Mann-Whitney U Test).
The female pushed the male’s palp away from her genital opening with her legs in two pairs in which the male lacked both conductor tip and hook, but also pushed the male’s palp away in two matings with intact males; in one additional case, the female pushed the plug material out of her epigynum with her leg.
DISCUSSION
Some genital plugs impeded subsequent mating attempts, and such exclusion presumably benefits the male that made
290
THE JOURNAL OF ARACHNOLOGY
the plug. Females also participated actively in the formation of successful plugs, so they presumably also benefit, but their benefits are less clear. One possible female benefit is biasing the paternity of her offspring in favor of males with certain traits (cryptic female choice). By helping some males but not others to form a plug, the female could favor paternity for subsequent males better able to remove plugs. Other female behaviors, such as pushing the male’s palp or plug material from her epigynum with her tarsus, may also influence paternity. It is not known in most of these cases, however, whether these cooperative or resistant processes of the female are biased toward males with certain traits. An exception is the association between larger numbers and durations of bursts of one type of male copulatory courtship (gentle pushing with his legs on those of the female) and a greater frequency of plug production (Aisenberg & Eberhard 2009). Thus cryptic choice involving plug production and removal is feasible, but so far strong support has been demonstrated only with respect to male leg pushing.
Females also apparently occasionally formed some epigynal plugs without male participation. These yellowish and orange plugs crumbled easily when poked with a pin, and it seems very unlikely that they could exclude forceful intromission attempts by subsequent males. Presumably they have some other, as yet undetermined function.
Despite the limited mobility of genital sclerites in the male palpal bulb and their inability to provide the male with sensory feedback, male L. mariana frequently penetrated or dislodged even hard, firmly-attached epigynal plugs. They were also able to insert their genitalia at least in the entrance of the insemination duct, even when the contours of the epigynal surface were substantially altered by remaining pieces of plugs. The male’s ability to adjust to striking variations in female morphology contrasts strongly with the tight mechan- ical fit between male and female morphology that is typical of many other spiders (Gering 1953; Grasshoff 1973; Huber 1995; Eberhard & Huber 1998b, 2010). The relative simplicity of the morphology of the male genitalia of Leiicaiige and other tetragnathids is apparently derived (Griswold et al. 1998); perhaps this simplicity (especially of the relatively small fraction of the Leucaiige palp that physically contacts the female) increases this ability to adjust. Similar flexibility, in the form of an ability to inseminate both sides of the female with a single palp, has been demonstrated in two other, distantly related spiders (Costa et al. 2000; Knoflach & van Harten 2000), one which also has a very simple palp design. Tetragnathid spiders have changed the sides of the female that are inseminated by the male palps (Huber & Senglet 1997), also suggesting fiexibility at some point in their evolutionary history.
Male genital movements in a species like L. mariana may be under two types of selection — to couple mechanically with the female genitalia in order to inseminate (and perhaps stimulate) her, and to remove plugs that impede such coupling. Nevertheless, male L. mariana used the same or similar basic genitalic movements in copulations with plugged and un- plugged females. The relative frequencies of different types of palp movement changed, but it was uncertain whether these changes were simply consequences of greater difficulty in mechanically engaging the palp with the epigynum when it was
plugged, or the changes in male behavioral tactics were designed to remove plugs. Our behavioral categorizations were ■ only general, however, and more detailed observations might reveal differences. It is at least possible that a male could sense the presence of a plug. The more frequent withdrawal of the : palpal bulb following a flub seen by Eberhard & Huber ^ (1998a) suggests that a male obtains enough sensory feedback '' from his palps to sense whether mechanical coupling has occurred. Males of some other spiders appear to use their i palps to search for the female’s genitalic openings (Huber ■ 1995), also implying some sensory feedback. |
The conductor hook may be especially important for plug | removal. Its rigidity combined with its hooked design probably improves its ability to snag and pull or pry off plugs, and perhaps also to perforate them. The results of j copulations when the hook was experimentally removed, however, showed only a weak trend toward less frequent plug 1 removal. The plugs in L. mariana vary in many ways, however, | that could affect removal, including composition, size, the J portion of the epigynum that is covered, left-right asymmetry, i' and the roughness of the outer surface; none of these traits was '| standardized in these experiments. Thus even in comparisons i between the intact and modified palps of the same male, the experimental results can at best be only suggestive. Our ability ! to determine whether it was the modified or unmodified palp i| that originally dislodged the plug may also have been ' imperfect. Many plugs consisted of a mass of material that 1 extended to both sides of the epigynum, and it was not always possible to eliminate the possibility that a minor, difficult to 1 perceive preliminary dislodgement with one palp could have led to a subsequent removal by the other. In sum, the intra- ' male differences observed in plug removal by intact and modified palps are compatible with the hypothesis that the ; hook functions to remove plugs, but are not conclusive. !
The fiexibility of the conductor tip makes it poorly designed to remove plugs by hooking and prying, but well designed to j slip along the curved external wall of the epigynum and of the ^ insemination duct. We speculate that it may facilitate deeper i intromission by the embolus, slipping between the plug and the epigynum wall to inject material below the plug, allowing ' the male to dislodge the plug as a unit. This facilitation of ; embolus insertion could explain its positive effects on sperm I, transfer documented here. Our experimental modifications of ' palpal morphology were crude, however, and cannot illumi- nate the functional significance of details of their forms. [
Details of the forms of both hooks and conductor tips vary interspecifically in Leucauge. Hooks that are similar in shape : to that of L. mariana occur in L. veinista (Walckenaer 1841) (Levi 1980), L. wiilingensis Song & Zhu 1992 (Song & Zhu 1992), and L. argentata (O.P. -Cambridge 1869) (Chrysanthus |: 1975). In contrast, the hooks have quite different forms in L. decorata (Blackwall 1864) (Chrysanthus 1975; Tanikawa 1990) f and L. tessellata (Thorell 1887) (= termistica) (Song & Zhu 'i 1992), while conductor hooks are missing in still others, such as Opadometa ( = Leucauge) grata (Guerin 1838) (Chrysanthus 1963), L. ( — Plesiometa) argyra (Walckenaer 1841) (Barrantes et al. 2013), and possibly Tylorida (= Leucauge) mornensis (Benoit 1978) (Benoit 1978). Epigynal plugs occur in at least ^ one of the species (L. argyra) in which the conductor hook is ' missing (Barrantes et al. 2013). The genus Leucauge has '
MENDEZ & EBERHARD— REMOVAL OE PLUGS BY MALE GENITALIA
291
apparently never been revised, and no phylogeny is available which could clarify the order in which different forms and functions for the hook and conductor tip evolved. It seems likely that the hook was favored by sexual selection, but the data do not permit discrimination among possible (non- exclusive) types of selection such as sperm competition, cryptic female choice, or sexually antagonistic coevolution.
This is to our knowledge the first experimental demonstra- tion of effects on plug removal for any particular male genitalic structure, and also the first demonstration of multiple functions for genitalic structures and the behavior patterns which they execute. The evolutionary interactions between male and female genitalia in Leucauge are obviously complex and merit further study.
ACKNOWLEDGMENTS
We thank Kenji Nishida for photographs, Maribelle Vargas for help producing SEM images, and Anita Aisenberg, Phil Taylor, Bernhard Huber, and an anonymous reviewer for comments on previous drafts. VM was supported by a Short Term Fellowship from the Smithsonian Tropical Research Institute; WGE was supported by STRI and the Universidad de Costa Rica.
LITERATURE CITED
Aisenberg, A. 2009. Male performance and body size affect female re-mating occurrence in the orb web spider Leucauge luariana (Araneae, Tetragnathidae). Ethology 115:1127-1136.
Aisenberg, A. & G. Barrantes. 2011. Sexual behavior, cannibalism, and mating plugs as sticky traps in the orb weaver spider Leucauge argyra (Tetragnathidae). Naturwissenschaften 98:605-613. Aisenberg, A. & W.G. Eberhard. 2009. Possible cryptic female choice in a spider: female cooperation in making a copulatory plug depends on male copulatory courtship. Behavioral Ecology 20:1236-1241.
Andersson, M. 1982. Female choice selects for extreme tail length in a widowbird. Nature 299:818-820.
Arnqvist, G. & L. Rowe. 2005. Sexual conflict. Princeton University Press, Princeton, New Jersey.
Barrantes, G., A. Aisenberg & W.G. Eberhard. 2013. Functional aspects of genital differences in Leucauge argyra and L. mariana (Araneae: Tetragnathidae). Journal of Arachnology 41:59-69. Basolo, A.L. 1990. Female preference predates the evolution of the sword in swordtail fish. Science 250:808-810.
Benoit. P.L.G. 1978. Contributions a I’etude de la faune terrestre des iles granitiques de farchipel des Sechelles (Mission P. L. G. Benoit - J. J. Van Mol 1972) Tetragnathidae et Araneidae-Nephilinae. Revue Zoologique Africaine 92:663-674.
Birkhead, T.R. & A.P. Moller. 1998. Sperm competition and sexual selection. Academic Press, New York, New York.
Brown, S.C. 1985. Mating behavior of the golden-orb weaving spider, Nephila clavipes. II. Sperm capacitation, sperm competition and fecundity. Journal of Comparative Psychology 99:167-175. Chrysanthus, Fr. 1963. Spiders from South New Guinea V. Nova Guinea, Zoology 24:727-750.
Chrysanthus, Fr. 1975. Further notes on the spiders of New Guinea II (Araneae, Tetragnathidae, Theridiidae). Zoologische Verhandelin- gen 140:1-50.
Costa, F.G., F. Perez-Miles & S. Corte. 2000. Which spermatheca is inseminated by each palp in Theraphosidae spiders? A study of Oligoxystre argeutinensis (Ischnocolinae). Journal of Arachnology 28:131-132.
Danielson-Frangois, A.M. & T.C. Bukowski. 2005. Female mating history influences copulation behavior but not sperm release in the
orb-weaving spider Tetragnatha versicolor (Araneae, Tetragnathi- dae). Journal of Insect Behavior 18:131-148.
Eberhard, W.G. 1996. Female control: sexual selection by cryptic female choice. Princeton Univ. Press, Princeton, New Jersey.
Eberhard, W.G. 2010. Evolution of genitalia: theories, evidence, and new directions. Genetica 138:5-18.
Eberhard, W.G. & B.A. Huber. 1998a. Courtship, copulation, and sperm transfer in Leucauge mariana (Araneae, Tetragnathidae) with implications for higher classification. Journal of Arachnology 26:342-368.
Eberhard, W.G. & B.A. Huber. 1998b. Possible links between embryology, lack of innervation, and the evolution of male genitalia in spiders. Bulletin of the British Arachnological Society 1 1:73-80.
Eberhard, W.G. & B. Huber. 2010. Spider genitalia. Pp. 249-284. In The evolution of primary sexual characters in animals. (J. Leonard & A. Cordoba-Aguilar, eds.). Oxford University Press, New York, New York.
Eberhard, W.G., S. Guzman-Gomez & K.M. Catley. 1993. Correla- tion between spermathecal morphology and mating systems in Spiders. Biological Journal of the Linnean Society 50:197-209.
Gering. R.L. 1953. Structure and function of some American agelenid spiders. Smithsonian Miscellaneous Collections 121(4):l-84.
Grasshoff, M. 1973. Konstruktions-und Funktionanalyse an Kopu- lationsorganen einiger Radnetzspinnen. Senckenbergischen Nat- urforschenden Gesellschaft 24:129-151.
Griswold, C.E., J.A. Coddington, G. Hormiga & N. Scharff. 1998. Phylogeny of the orb-web building spiders (Araneae, Orbiculariae: Deinopoidea, Araneoidea). Zoological Journal of the Linnean Society 123:1-99.
Hosken, D., P. Stockley & T. Tregenza. 2009. Monogamy and the battle of the sexes. Annual Review of Entomology 54:361-378.
Huber, B.A. 1995. Genital morphology and copulatory mechanics in Anyphaena accentuata (Anyphaenidae) and Cliibiona pallidula (Clubionidae: Araneae). Journal of Zoology, London 235:689-702.
Huber, B.A. & A. Senglet. 1997. Copulation with contralateral insertion in entelegyne spiders (Araneae: Entelegynae: Tetragnathi- dae). Netherlands Journal of Zoology 47:99-102.
In den Bosch, H.A.J. 1994. First record of mating plugs in lizards. Amphibia-Reptilia 15:89-93.
Knoflach, B. 1997. Zur Taxonomic, Verbreitung und Sexualbiologie von Theridion adrianopoli Drensky (Arachnida: Araneae, Theridi- idae). Berichte des naturwissenschaftlichen-medizinischen Verein Innsbruck 84:133-148.
Knoflach, B. 1998. Mating in Theridion variana Hahn and related species (Araneae: Theridiidae). Journal of Natural History 32:545-604.
Knoflach, B. & A. van Harten. 2000. Palpal loss, single palp copulation and obligatory mate consumption in Tidarren cuneola- tuin (Tullgren, 1910) (Araneae, Theridiidae). Journal of Natural History 34:1639-1659.
Levi, H.W. 1980. The orb-weaver genus Mecynogea, the subfamily Metinae and the genera Pachygnatlia, Glenognatha and Azilia of the subfamily Tetragnathinae North of Mexico (Araneae: Aranei- dae). Bulletin of the Museum of Comparative Zoology 149:1-74.
Markow, T. & P.F. Ankney. 1988. Insemination reaction in Drosophila', found in species whose males contribute material to oocytes before fertilization. Evolution 42:1097-1 101.
Masumoto, T. 1993. The effect of the copulatory plug in the funnel- web spider, Agelena linihata (Araneae: Agelenidae). Journal of Arachnology 21:55-59.
Matsumoto, K. & N. Suzuki. 1992. Effectiveness of the mating plug in Atrophaneura alcinous (Lepidoptera: Papilionidae). Behavioral Ecology and Sociobiology 30:157-163.
Mendez, V. 2002. Comportamiento sexual y dinamica de poblacion en Leucauge marina (Araneae: Tetragnathidae). Msc. Thesis, Universidad de Costa Rica.
292
THE JOURNAL OF ARACHNOLOGY i
Milligan, S.R. 1979. The copulatory pattern of the Bank vole (Clethriu)wniys glareolus) and speculation on the role of penile spines. Journal of Zoology, London 188:279-283.
Moller, A.P. 1988. Female choice selects for male sexual tail ornaments in the monogamous swallow. Nature 332:640-642.
Parker, G.A. 1970. Sperm competition and its evolutionary conse- quences in the insects. Biological Reviews 45:525-567.
Platnick, N. 2013. The world spider catalog, version 14.0. American Museum of Natural History. Online at http://research.amnh.org/ entomology/spiders/catalogS 1 -87/index. html
Simmons, L.W. 2000. Sperm competition and its evolutionary consequences in the insects. Princeton University Press, Princeton, New Jersey.
Smith, R.L. 1984. Sperm competition and the evolution of animal mating systems. Academic Press, New York, New York.
Song, D. & M. Zhu. 1992. Notes on six species of the genus Leucauge (Araneae: Tetragnathidae) of China. Sinozoology 9:111-117.
Tanikawa, A. 1990. Two newly recorded spiders, Tetragnatha cluiuliodus (Thorell, 1890) and Leucauge decorala (Blackwall, 1864) (Araneae: Tetragnathidae) from Japan. Atypus 95:1-12.
Thornhill, R. & J. Alcock. 1983. The evolution of insect mating systems. Harvard University Press, Cambridge, Massachusetts.
Uhl, G., S.H. Nessler & J.M. Schneider. 2010. Securing paternity in spiders? A review on occurrence and effects of mating plugs and male genital mutiliation. Genetica 138:75-104.
Watson, P.J. 1991. Multiple paternity as genetic bet-hedging in female Sierra dome spiders, Linyphia litigiosa (Linyphiidae). Animal Behavior 41:343-360.
Wiley, R.H. & J. Posten. 1996. Indirect mate choice, competition for mates, and coevolution of the sexes. Evolution 50:1371-1381.
Manuscript received 14 September 2013, revised 13 June 2014.
2014. The Journal of Arachnology 42:293-298
Burrow structure and microhabitat characteristics of Nesiergus insulanm (Araneae: Theraphosidae) from
Fregate Island, Seychelles
Gregory Cannmg’, Brian K. Reilly* and Ansie S. Dippenaar-Schoeman^: 'Department of Nature Conservation, Tshwane University of Technology, P. Bag X680, Pretoria OO'Ol, South Africa. E-mail: gregcan@absamail.co.za; -Agricultural Research Council - Plant Protection Research Institute, P. Bag X134, Queenswood, 0121 Pretoria, South Africa & Department of Entomology and Zoology, University of Pretoria, 0001, Pretoria, South Africa
Abstract. The burrow structure and microhabitat variables of the little known theraphosid Nesiergus insidanus Simon 1903 were determined on Fregate Island, Seychelles. The species constructed burrows in fossorial substrates, including rocks, leaf litter and bare soil as well as on the trunks of decaying trees, both recumbent and standing. The majority of burrows were predominantly found in sandy loam soil with partial protection from the sun. The density of burrows was determined to be weakly positively correlated to soil and substrate type and strongly negatively correlated to degree of exposure to the sun. The pH of the soil in which burrows are found was not significantly related to burrow sites, and variability in burrow structure was revealed. Burrow aggregations vary from single burrows to aggregations exceeding 100, distributed randomly.
Keywords: Tarantula, habitat, generalist
Little is known of the theraphosids of the Seychelles archipelago and published reports consist of little more than taxonomic descriptions and brief observations of their natural history (Simon 1903; Hirst 1911; Benoit 1978; Guadanucci & Gallon 2008; Saaristo 2010). More generally, despite numer- ous recently published papers on the behavior of tarantulas (Kotzman 1990; Fernandez-Montraveta & Ortega 1991; Costa & Perez-Miles 1998, 2002; Quirici & Costa 2005), the biology and ecology of many tarantulas is poorly known (Carter 1997; Yanez et al. 1999; Machkour M’Rabet et al. 2005).
Three species of Nesiergus are recognized and are likely endemic to Seychelles. Nesiergus insulanus Simon 1903 is the type species for the genus and is known from Fregate and L’ilot Fregate Islands (Canning et al. 2013), with anecdotal and photographic evidence from naturalists on Cousine Island indicating that it may be more widely distributed than currently recognized. Nesiergus halophilus Benoit 1978 is known from Fregate, Recife, Silhouette and Curieuse; Nesiergus gardineri Hirst 1911 is known from Mahe, Felicite, Praslin, Silhouette and The Sisters (Guadanucci & Gallon 2008).
The burrows of these spiders, as with other members of the family, are used for protection against predators and parasites, for the protection of eggs and developing spiderlings, protection during ecdysis, for the capture of prey and for the control of thermal stress (Dippenaar-Schoeman 2002). Studies of habitat use by spiders have found that there are strong associations with abiotic factors such as structural features, temperature, wind, rain and humidity. Temperature and humidity have been shown to be critical factors influencing microhabitat selection for a number of spider species (Norgaard 1951; Williams 1962; Cherrett 1964; Sevacherian & Lowrie 1972; Riechert & Tracy 1975) and similar associations have been found with areas of high prey availability (Riechert & Gillespie 1986). Spiders are known to select high quality habitats (Morais-Filho & Romero 2008), and the structure of the burrows and the environmental parameters necessary for their construction must be known to
provide a better understanding of a poorly known species, its role in the community, and even as a potential indicator of habitat change.
METHODS
Study site, — Fregate Island (04° 35' 19"S, 55° 56' 55"E) is the most isolated of the Seychelles granitic islands (Ferguson & Pearce-Kelly 2004) and is situated 55 km east of Mahe Island (Skerrett et al. 2001). It is 219 ha in area, has an altitude of 125 m at its highest point and overlies oceanic basalt. Phosphatized granite and phosphate-cemented sandstone are associated with guano deposits on the plateau. The low-lying areas of the island were marshy in the past and are now characterized by sediments of fine clay and quartz (Braithwaite 1984). However, these marshy areas have been replaced, to the detriment of many species, by cultivated fields, gardens and a marina development.
Field methods. — Field sampling sites were determined by initially conducting a pilot study. The island was stratified into habitat types based on the vegetation map of Henriette & Rocamora (2009). Vegetation types were clearly distinguish- able as a result of large-scale anthropogenically-induced vegetation changes. Ground truthing determined the precise location of these various habitats and in each described habitat an extensive search was conducted on three separate occasions. In each habitat type, we extensively searched leaf litter, overturned rocks and logs and searched all other litter to find burrows. This allowed us to determine the habitat types in which spider burrows occurred. These sites were exhaustively searched to ensure that burrows or signs of spiders were not missed. The habitat types that were found in the pilot study to support these spiders were the following (with number of sample sites per habitat type determined by random selection in parentheses): Coconut-dominated woodland (8), Ficus benghaknsis (3), Mixed exotic woodland (7), Native woodland (6), Replanted native woodland (6), Hotel area native planted (4), Exotic scrub (8), Grassland (3) Coconut woodland planted with natives (3). Those habitats in which no burrows or other
293
294
THE JOURNAL OF ARACHNOLOGY
signs of spiders were found included bamboo, coconut plantations with grassland, cultivated areas, orchards and Scaevola; these sites were not sampled further.
Subsequent to the pilot study, the island was stratified into numbered quadrats, each measuring 100 X 100 m. From these quadrats, a random integer generator (www.random.org) was used to obtain random sample quadrats in each vegetation type in which spiders were found in the pilot study, ensuring that approximately 25% of the island was represented. Sampling sites within these quadrats consisted of a 100 m x 2 m transect at right angles to the contour. Those vegetation types in which no burrows were found in the pilot study were excluded from the selection of sampling quadrats. Forty-eight quadrats were generated in this way and sampled, of which 38 sites contained burrow aggregations. We define an aggrega- tion as a cluster of burrows within a distance of less than one meter from one another.
Burrow structure: Burrows were examined at the 38 sample sites. At each sample site, an individual spider was extracted from a burrow to confirm the identification of the species. This was completed after data from the particular burrow had been quantified. At each sample site in which burrow aggregations were found, we measured the diameter of the largest burrow and determined the orientation of all burrows. We noted whether each burrow’s entrance was flush with the ground and whether debris was incorporated in the burrow entrance. The depth of the burrow could not be accurately determined without digging them up due to their varying shapes. To determine dimension and shape, five burrows were randomly selected, spiders were extracted and Plaster of Paris was poured down burrows to create an impression of the burrow. The volume of each of these burrows was determined by immersing the casts in a measuring cylinder of water and measuring the displacement. The dimensions and shape of burrows were also established by actively seeking burrows adjacent to rocks or other objects, such as coconuts or large fallen branches. At ten of these sites, objects were removed to expose a cross section of the burrow. These burrows were closely examined, measured and photographed to confirm shape, number of chambers, number of spiders within each burrow, use of silk and dimensions.
Microhahitat characteristics: Each sample site was visited in the early morning, at midday and late afternoon on at least three separate occasions only on sunny days for a three-month period to determine the temporal exposure of burrows to the sun. Burrows were considered to have full protection from the sun if they were in shade at each visit, partially protected if they were in sun on at least one visit and having no protection if they were exposed to the sun on each visit. We recorded a description of the habitat surrounding the burrow aggrega- tion. The substrate was characterized as leaf litter, bare soil, woody vegetation, grass or other. Leaf litter (Fig. la) consisted of soil substrate covered with a complete layer of leaf litter with minimal or no soil exposed. The leaf litter varied from a single layer of leaves covering the soil to three to four layers of leaves. Bare soil (Fig. lb) consisted of a substrate of exposed soil, with leaves sporadically scattered over the substrate, but not to the extent that they entirely covered the substrate. Woody vegetation represented burrow sites where the burrow had been constructed in living plant
material such as roots. Grass (Fig. Ic) consisted of the substrate being covered in a layer of living grass. Other i represented burrows were constructed in rocks (Fig. Id), coral : remnants or decaying tree trunks (Figs, le, f). Ij
Ambient and burrow temperature and humidity were |
recorded using a thermistor digital instrument with penetra- tion probe. Soil characteristics were determined by collecting j| three soil samples of approximately 500 grams each from each site and the basic soil texture, pH, soil type and soil moisture j!
were determined. Soil texture was determined by using the 't
United States Department of Agriculture soil triangle (online j;
at http://www.nrcs.usda.gov/wps/portaI/iircs/detail/soils/edu/ |
?cid = nrcsl42p2_05431 1). Soil moisture was determined by i
using the soil moisture content standard test method of the ;
Australian Department of Sustainable Natural Resources. j
Each soil sample was weighed, dried in an oven at a constant >
temperature of 110 °C for 4 hours and then weighed again after cooling. The moisture content was determined as weights ■ compared before and after drying expressed as a percentage.
Soil sampling was conducted in the dry season to discount the i'
influence of rain on moisture content. The pH of the soil i
samples was determined with the use of a Bluelab combometer )
calibrated to pH 7.0 before the testing of each soil sample.
Spiders were also observed under captive conditions. r
Twenty females, including four mature specimens, were kept j
in a confined situation in a communal polystyrene box (63 X !j
29.5 X 17 cm) and with a layer of soil 8 cm deep. The top of j;
the box was covered with a glass sheet to prevent escape and i|
for observation purposes. Spiders were provided with fresh i
water daily and food once a week. Burrowing behavior was f
observed under these conditions. |,
Analyses: One-way ANOVA was used to compare the ||
number of burrows found in the sample sites with the ■
microhabitat characteristics to determine whether there were 1 any statistically significant differences. The analyses included those sample sites in which no burrows were found in the (
habitat types that were found to include burrows in the pilot ^
study. Correlations were used to determine relationships t
between burrow densities and various microhabitat variables. | Nearest neighbor analysis was adapted for this study to j determine the patterning of burrows within an aggregation. As 3 the method eliminates the effect of scale, the patterning within 3 the distribution of the burrows in a cluster was determined 3 (Rossbacher 1986). The formula used to determine aggrega- ! tion distribution was Rn = 2d\/n/a where the value of Rn j‘ represents the degree to which an observation departs from a predicted random distribution and d = the mean distance between the nearest neighbors, ii = total number of points and 3 a = area under study. Rn ranges between 0 for a clustered |, distribution, 1.00 for a random distribution and 2.15 for a |1 regular distribution (Clark & Evans 1954). Nearest neighbor ' analysis was used only at sites where there were more than 30 3
burrows in the aggregation (n = 15 sites). A Rayleigh test was 3 used to determine whether the direction of the burrows was
random or non-random. 3
3
RESULTS f
3
Microhabitat characteristics. — The number of burrows m ,| each sample site varied between habitats from no burrows to [| 134 burrows in aggregations. The mean aggregations and i'
II
CANNING ET AL.— BURROW STRUCTURE OF NESIERGUS INSULANUS
295
Figure la-f. — Substrate types in which burrows of Nesiergus insulamis are found on Fregate Island, Seychelles, a. Leaf litter; b. Bare soil; c. Grass; d. Rock; e. Tree trunk with arrows indicating position of burrows approximately 1.5 and 1.7 m above ground level; f. Recumbent rotting log.
densities per square meter combined from sample sites in each habitat type were as follows: Exotic scrub 8.4 at 0.042/m", native woodland 36 at 0.1 8/m^, coconut-dominated woodland 11.4 at 0.057/m", Ficus benghalensis 36.5 at 0.1825/m", mixed exotic woodland 6.5 at 0.01/m", grassland 3.5 at 0.0175/m", hotel area native planted 15.4 at 0.0775/m", coconut woodland planted with natives 1.7 at 0.0085/m^ and replanted native woodland 21 at 0.105/m". Microhabitat variables varied between sample sites (Table 1) with the mean ambient temperature found to be 2.13°C higher than the temperature within the burrows across habitat types. In contrast, the humidity within the burrows was found to be an average of 9.93% higher than the ambient humidity. Open grassland was the only habitat in which at least some burrows were found to be fully exposed to the sun. The mean ambient temperature for grassland was 2.5° C warmer than the mean across all habitat types. The mean seasonal change in temperature is in a very narrow band and this is reflected in the mean temperature across habitat types.
An ANOVA showed a significant difference in number of burrows between substrates across sample sites (F3, 32 = 3.42,
P = 0.03) with leaf litter and bare soil being preferred over other substrates. A follow-up test to determine differences between these two substrates showed that there is no significant difference in choice between bare soil and leaf litter (F|_ jg = 0.09, P = 0.77) as the more frequently used substrates. Few burrows were found in grass-covered areas and in the cracks and holes of rocks. Those burrows dug in bare soil were found among vegetation and often close to rotting logs that provided protection and a supply of prey in the form of termites or other invertebrates. There was a significant difference in soil types in which burrows occurred (Fi. 64 = 5.66, P <0.0001) with the majority being found in sandy loam. Protection from full exposure to the sun was statistically highly significant (Fo, 24 = 1 1.13, F = 0.0003) with spiders preferring partial protection from the sun. There was a non-significant correlation between the soil types and the density of burrows (Spearman Rank correlation, r - 0.167, P - 0.157), a significant correlation between choice of substrate and burrow density {r = 0.357, P = 0.013) and a very strong correlation between protection from the sun and burrow densities {r = 0.9995, P = 0.001). The soil pH varied
296
THE JOURNAL OF ARACHNOLOGY
Table 1 . — Summary of microhabitat variables across habitat types for burrows of Nesiergus insukmus on Fregate Island. Figures given are the percentages of the total number of burrows displaying that particular variable for the habitat type. Moisture content, pH and temperature measurements are from the lowest to the highest recorded measurement at each site in the specific habitat. FB = Ficus benglialensis, CWPWN = coconut woodland planted with natives, MEW = mixed exotic woodland, ES = exotic scrub, NW = native woodland, RNW = replanted native woodland, HANP = hotel area nativeplanted, CDW = coconut dominated woodland, GL = grassland.
|
FB |
CWPWN |
MEW |
ES |
NW |
RNW |
HANP |
CDW |
GL |
|
|
Sampling sites (IS) Wind Protection |
3 |
3 |
7 |
8 |
6 |
6 |
4 |
8 |
3 |
|
none |
66 |
50 |
|||||||
|
partial |
33 |
33 |
57.1 |
25 |
80 |
50 |
37.5 |
50 |
|
|
full |
66 |
100 |
42.8 |
75 |
20 |
50 |
62.5 |
||
|
Sun Exposure |
|||||||||
|
none |
33 |
75 |
14.2 |
25 |
50 |
||||
|
partial |
100 |
66 |
25 |
85.7 |
75 |
100 |
100 |
50 |
50 |
|
full |
50 |
||||||||
|
Substrate |
|||||||||
|
bare soil |
33 |
33 |
50 |
71.4 |
60 |
50 |
37.5 |
||
|
leaf litter |
66 |
33 |
50 |
14.2 |
100 |
50 |
37.5 |
||
|
grass other( vegetation) |
33 |
14.2 |
40 |
25 |
100 |
||||
|
Soil Characteristics |
|||||||||
|
silt loam loam |
25 |
28.5 |
100 |
12.5 |
50 |
||||
|
loamy sand silt |
33 |
33 |
25 |
14.2 |
40 |
25 |
|||
|
sandy loam |
33 |
66 |
50 |
42.8 |
20 |
62.5 |
50 |
||
|
sandy other (rock) |
33 |
20 |
|||||||
|
moisture Content |
10-71% |
5-6% |
6-23% |
3-23% |
12-27% |
1-25% |
10-15% |
^25% |
6-10% |
|
pH |
4.2-4.9 |
6. 1-8.9 |
5. 7-8.2 |
3. 7-7. 4 |
4.9-8. 5 |
5. 1-8.3 |
5.2-8.4 |
5.7-8.9 |
7.3-8.2 |
|
Ambient Temp. (°C) |
30.8-32.9 |
30.4-30.5 |
27.1-30.4 |
30.1-34.1 |
29.9°-31.8° |
29.5°-31.5° |
31.6°-32.r |
29.8°-31.5“ |
32.9°-33.5° |
|
Burrow Temp. (°C) |
28.0-31.2 |
27.9-29.1 |
25.7-27.3 |
27.6-32.3 |
27,i°-28.7° |
27°-30.8° |
28.4°-30.4° |
26°-29.7° |
31.8°-32.2° |
considerably between habitat types and between sample sites, from 3.7 to 8.9 with a mean of 6.45 (UCL = 6.92, LCL = 5.98). A linear regression analysis determined that the relationship between pH and spider densities was non- significant (r = 0.9815, P = 0.33) and therefore plays no role in burrow site selection.
Burrow structure. — Nearest-neighbor analysis showed that the distribution of burrows within an aggregation was random, (average Rn = 1.17). These spiders make use of both fossorial substrates (Figs, la-c) and the trunks of decaying trees. The trunks of rotting trees, both standing (Fig. le) and recumbent (Fig. If) were used. The decompos- ing wood likely provides a regular supply of food to prey on such as termites and other invertebrates as well as providing a stable microclimate. Hollows and cracks in rocks were exploited on occasion (Fig. Id). Spiders were also found under rocks where either a silk-lined depression or a burrow was constructed.
Captive specimens of N. insulamis were able to excavate their own retreats and were able to burrow through wood and roots, despite lacking a rastelluni. When disturbed or if their burrow was damaged or destroyed, they excavated a new burrow. Chelicerae were used in loosening the soil and the first pair of legs was used to pass the soil to the side of the burrow entrance or under the body where the third and fourth pairs of
legs pushed the soil from the burrow. The first one-third to one-quarter of the inside of the burrow was lined with silk. There were no silk mats or trip lines around the burrow entrance for prey detection. Silk was used in bends in burrows to support the walls at these bends (Fig. 2).
The majority of the burrow entrances lay flush with the surface and had no debris, although some debris in the form of small stones, sticks and millipede droppings were on occasion attached to the silk around the lip of the burrow. Burrows in the cracks of rocks were fully constructed of silk with debris, including feathers, attached along the full length of the burrow. A single entrance was observed at all burrows. These entrances were closed with silk with soil attached when the spider was in the process of ecdysis, incubating, when there were pre-emergent spiderlings in the maternal burrow, or under adverse weather conditions, such as during heavy rain. The entrances were completely camouflaged with soil during this period.
The largest burrow diameter found at sample sites was 13.59 mm with a mean diameter for all sampled burrows of 6.42 mm. Orientation of the burrow entrance of 116 burrows in ail habitat types was determined and a Rayleigh test indicated that there was no particular prevailing orientation of burrow entrances (Z = 0.282, P = 0.50). Burrow shape was widely diverse and a single distinguishing shape cannot be
CANNING ET AL.— BURROW STRUCTURE OF NESIERGUS INSULANUS
297
Figure 2. — Burrow of N. insiikmus with resident spider in first chamber. Arrows indicate use of silk below burrow entrance, at curve above first chamber and on roof of second chamber.
attributed to this species. Burrows were J-shaped, U-shaped and V-shaped with variations of these basic profiles. Variations included additional chambers or shafts. Variations were sometimes due to an obstruction that the spider could not burrow through or around and sometimes appeared to be random. U-shaped variations included burrows recumbent with an extended burrow entrance. V-shaped burrow varia- tions included additional horizontal arms or supplementary arms giving the burrows a Y-shape, and the dimensions of observed burrows varied widely (Fig. 3). The displacement volume of the five burrow molds were 22 ml, 41 ml, 53 ml, 10 ml and 7 ml.
DISCUSSION
Nesiergus insukmiis makes use of a number of available substrate types including soil, tree trunks and cracks in rocks in which to create burrows. The exploitation of these substrates indicates adaptability that allows the species to exploit a wider range of habitats than would be available to more specialized species. This behavior could be considered an obligatory adaptation to their occurrence on small and isolated islands with limited resources, thus restricting their ability to occupy a more specialized niche.
Machkour M’Rabet et al. (2007) found that densities of the tarantula Bracliypelma vagans Ausserer 1875 were dependent on soil type. This study also found significant associations with soil types, the type of soil apparently being important in burrow construction because of the possibility of collapse when these spiders only partially line their burrows with silk. The variation in burrow structure from simple, single- chambered structures to fairly complex constructions that are found in high densities in suitable habitat has also been recorded in B. vagans (Machkour M’Rabet et al. 2007).
Figure 3. — Burrow shapes of N. msukmiis indicating diverse shapes, including basic burrow shapes, as well as variations thereof, with additional chambers and shafts.
The combination of a number of suitable microhabitat variables appears to be necessary to support a population of these spiders and where these variables are absent, so too were the spiders. They were commonly found adjacent to rocks and decaying logs, as well as on pathways. These logs and rocks as well as roads and pathways provide ecotones that support increased biodiversity and productivity (Risser 1995). Arthro- pods have been found to be greatly innuenced by changes in temperature and humidity (Cady 1984) and we found that sites of burrows that were at least partially protected from sun exposure, thus limiting fluctuations, were preferred over sites that offered little protection from the elements. Burrows found in exposed areas were few in number and even these were offered a degree of protection close to the ground.
The disturbance and alteration of natural habitats and the introduction of alien plant species is detrimental to the distribution of the species. Large-scale changes to the native vegetation on the island limits the opportunity for dispersal to new habitats and is cause for concern for a species with a limited distribution. Fregate Island has been severely degraded and large areas of the island are covered in alien species. In particular, monospecific stands of coconuts. Cocos nucifera. cover vast areas of the island, severely reducing available native habitat. The occurrence of these spiders in such degraded habitats is limited or absent and is of concern for the long term welfare of the species. As tarantulas do not balloon as a means of dispersal (Jankowski-Bell & Horner 1999) and spiderlings do not wander greatly if a suitable patch is found in which the spiderlings are able to burrow (Cutler & Guarisco 1995) their dispersal capabilities are reduced. The restoration of habitat and the creation of corridors between restored habitat and habitats in which this species is to be found are essential for the long term viability of the species.
298
THE JOURNAL OF ARACHNOLOGY
LITERATURE CITED
Benoit. P.L.G. 1978. Contributions a I’etude de la faune terrestre des lies granitiques de Farchipel des Sechelles Araneae Ortliognatha. Revue de Zoologie et de Botanique Africaines 92:405-420.
Braithwaite, C.J.R. 1984. Geology of the Seychelles. Pp. 17-79. In Biogeography and Ecology of the Seychelles. (D.R. Stoddart, ed.). Dr. W. Junk Publishers, The Hague, Netherlands.
Cady, A.B. 1984. Microhabitat selection and locomotor activity of Schizocosa ocveata (Walckenaer) (Araneae, Lycosidae). Journal of Arachnology 11:297-307.
Canning, G., B.K. Reilly & A.S. Dippenaar-Schoeman. 2013. First description of the male of Nesiergus msidcmus (Araneae: Ther- aphosidae: Ischnocolinae) from the Seychelles archipelago. African Invertebrates 54:241-244.
Carter, N. 1997. Who’s on CITES and why? Forum of the American Tarantula Society 6:172-173.
Cherrett, J. 1964. The distribution of spiders on the Moor House Reserve, Westmoreland. Journal of Animal Ecology 33:27-48.
Clark, P.J. & F.C. Evans. 1954. Distance to nearest neighbour as a measure of spatial relationships in populations. Ecology 35: 445-452.
Costa, F.G. & F. Perez-Miles. 1998. Behavior, life cycle and webs of Mecicohothriimi thorelli (Araneae, Mygalomorphae, Mecicobo- thriidae). Journal of Arachnology 26:317-329.
Costa. F.G. & F. Perez-Miles. 2002. Reproductive biology of Uruguayan theraphosids (Araneae, Mygalomorphae). Journal of Arachnology 30:571-587.
Cutler, B. & H. Guarisco. 1995. Dispersal aggregation of Sphodros fitchi (Araneae, Atypidae). Journal of Arachnology 23:205-206.
Dippenaar-Schoeman, A.S. 2002. Baboon and Trapdoor Spiders of Southern Africa: An Identification Manual. Agricultural Research Council, Pretoria, South Africa.
Ferguson, A. & P. Pearce-Kelly. 2004. Management Guidelines for the Welfare of Zoo Animals. The Fregate Island giant tenebrionid beetle Polposipus hercideainis. The Federation of Zoological Gardens of Great Britain and Ireland, United Kingdom.
Fernandez-Montraveta, C. & J. Ortega. 1991. Owner-biased agonistic behavior in female Lycosa tarentula fasciiventvis (Araneae, Lycosidae). Journal of Arachnology 19:80-84.
Guadanucci, J.P.L. & R.C. Gallon. 2008. A revision of the spider genera Chaetopelma Ausserer 1871 and Nesiergus Simon 1903 (Araneae, Theraphosidae, Ischnocolinae). Zootaxa 1753:34-48.
Hirst, S. 1911. The Araneae, Opiliones and Pseudoscorpiones. Transactions of the Linnean Society of London 14:379-395.
Jankowski-Bell, M.E. & N.V. Horner. 1999. Movement of the male brown tarantula, Aphonopelma hentzi (Araneae, Theraphosidae), using radio telemetry. The Journal of Arachnology 27:503-512.
Kotzman, M. 1990. Annual activity patterns of the Australian tarantula Selenocosmia stirlingi (Araneae, Theraphosidae) in an arid area. Journal of Arachnology 18:123-130.
Machkour M'Rabet, S., Y. Henaut, R. Rojo & S. Calme. 2005. A not I so natural history of the tarantula Brachypelma vagans: interaction { with human activity. Journal of Natural History 39:2515-2523. Machkour M’Rabet, S.M., Y. Henaut, A. Sepulveda, R. Rojo, S. Calme & V. Geissen. 2007. Soil preference and burrow structure of f an endangered tarantula, Brachypelma vagans (Mygalomorphae: i Theraphosidae). Journal of Natural History 41:1025-1033. I
Morais-Filho, J.C. & G.Q. Romero. 2008. Microhabitat use by ' Peucetia flava (Oxyopidae) on the glandular plant Rhyncanthera dichotoma (Melastomataceae). Journal of Arachnology 36: il 374-378.
Norgaard, E. 1951. On the ecology of two lycosid spiders (Pirata piraticus and Lycosa pidlata) from a Danish sphagnum bog. Oikos 3:1-21. ’ 1
Quirici, V. & F.G. Costa. 2005. Seismic communication during courtship in two burrowing tarantula spiders: an experimental s' study on Eupcdaestrus weijenberghi and Acanthoscurria sidna. j: Journal of Arachnology 33:159-166. |:
Riechert, S.E. & R.G. Gillespie. 1986. Habitat choice and utilization j in the web spinners. Pp. 23-48. In Spiders-Webs, Behavior and J Evolution. (W.A. Shear, ed.). Stanford University Press, Stanford, jj California. }
Riechert, S.E. & C. Tracy. 1975. Thermal balance and prey j
availability: Bases for a model relating web-site characteristics to i[ spider reproductive success. Ecology 56:265-284. !|
Risser, P.G. 1995. The status of the science: examining ecotones. i BioScience 45:318-325. |j
Rossbacher, LA. 1986. Nearest-neighbour analysis: a technique for quantitative evaluation of polygonal ground patterns. Geografiska | Annale 68A: 101-105.
Saaristo, M.I. 2010. Araneae. Pp. 8-306. In Arachnida and Myriapoda of the Seychelles islands. (J. Gerlach & Y. Marusik, | eds.). Siri Scientific Press, Manchester, United Kingdom.
Sevacherian, V. & D. Lowrie. 1972. Preferred temperatures of two species of lycosid spiders Pardosa sierra and P. ramulosa. Annals of the Entomological Society of America 65:111-114.
Simon, E. 1903. Histoire Naturelle des Araignees. Roret, Paris i
2:669-1080. |
Skerrett, A., 1. Bullock & T. Disley. 2001. Birds of Seychelles. I Christopher Helm Ltd., London. !
Williams, G. 1962. Seasonal and diurnal activity of harvestmen j' (Phalangida) and spiders (Araneida) in contrasted habitats, t
Journal of Animal Ecology 31:23-42. |
Yanez, M., A. Locht & R. Macias-Ordonez. 1999. Courtship and ' mating behavior of Brachypelma klaasi (Araneae, Theraphosidae). J
Journal of Arachnology 27:165-170. |
Manuscript received 5 August 2013, revised 18 August 2014.
2014. The Journal of Arachnology 42:299-302
Thermal preference of Dysdera crocala C. L. Koch 1838 (Araneae: Dysderidae)
Rita Sepulveda', Andres Taucare-Rios', Claudio Veloso' and Mauricio Canals'-'^--^: 'Departamento de Ciencias Ecologicas, Faciiltad de Ciencias, Universidad de Chile; E-mail: mcanals@uchile.cl; -Programa de Salud Ambiental, Escuela de Salud Publica, Facultad de Medicina, Universidad de Chile; -^Departamento de Medicina, Facultad de Medicina, Universidad de Chile
Abstract. Body temperature is the most important ecophysiological variable affecting all aspects of the performance of ectotherms. However, thermal preferences and tolerances of spiders have been studied only in 0.1% of spider species. Knowledge of thermal preferences and tolerances is necessary to describe the ecology of these animals, defining the preferred foraging sites or preferred shelters and reproductive sites. In this study we report for the first time the preferred temperature of Dysdera crocata C.L. Koch 1838 in the laboratory. This is an epigean spider of Mediterranean climates with large temperature fluctuations. The preferred temperature was low: 9.12° ± 5.12 °C, and actively searched. It did not vary throughout the day.
Keywords: Woodlouse spider, micro-environments, Chile
Spiders are ectothermic animals; their energetic processes are highly correlated with the temperature of their surround- ings, which has consequences in energy conservation, repro- duction and prey capture. However, thermal preferences and tolerances of spiders have been studied only in 0.1% of spider species (Humphreys 1987; Schmalhofer 1999; Hanna & Cobb 2007). Knowledge of thermal preferences and tolerances is necessary to describe the ecology of these animals (Hertz et al. 1993), defining the preferred foraging sites or preferred shelters and reproductive sites (Hanna & Cobb 2007).
By analyzing thermal preferences and tolerances we can estimate the themal niche, which is one of the niche dimensions. This may be assessed by means of mechanistic biophysical ecological methods not using the environment per se but rather the state of the organism, for example body temperature (Tb). Tb drives an organism’s physiological state; thus it is crucial to quantify patterns of body temperature if we are to link controlled laboratory conditions with those in the field. The principles of these models provide a robust approach to determining niches of organisms mechanistically (Kearney 2006; Kearney & Porter 2009; Kearney et al. 2010; Kearney 2012).
Spiders of the genus Dysdera Latreille 1804 (Family Dysderidae) are ground dwellers characteristic of xerothermic forests of the Mediterranean and adjacent areas. During the day, they shelter in gravel covered by organic material or under stones, and it has been reported that at night these wandering nocturnal hunters search for woodlice (terrestrial isopods), their principal prey (Cooke 1965; Bradley 2013).
The woodlouse spider, Dysdera crocata C. L. Koch 1838 is originally from the Mediterranean and eastern European region (Cooke 1965) but has spread throughout the world. There are over 240 species of Dysdera (Platnick 2013) however only D. crocata is cosmopolitan. It is amenable to a wide spectrum of environmental conditions, being a common spider in regions with cold temperatures and winter snow cover (e.g., Illinois, Ohio, Great Britain, Tasmania) as well as regions of hot, dry summers and mild winters of a Mediterranean climate (e.g., southern California, Greece) (Southcott 1976; Roberts 1995; Bradley 2004; Bosmans & Chatzaki 2005; Vetter & Isbister 2006).
In Chile, D. crocata is mostly limited to urban areas in the central region (Mediterranean climate); it is considered to be a synanthropic spider (Taucare-Rios et a!. 2013). It is an epigean species which can be captured under stones, rocks and rotting logs that also support isopods; it is active throughout the year in a micro-environment practically isolated from light, and with constant high humidity. The temperature in this environment is affected by the fluctuations characteristic of the Mediterranean climate, varying in the year more than fifteen degrees at a depth of 10 cm in the soil (Villaseca 1990). There are no studies of the thermal biology of D. crocata. Because body temperature is the most important ecophysio- logical variable affecting all aspects of the performance of ectotherms, including locomotion, immune function, sensory input, foraging ability, courtship and rates of feeding and growth (Angilletta et al. 2002; Fortner et al. 2006; Angilleta 2009; Hazell et al. 2010), the objective of this study was to determine the preferred temperature of this species.
METHODS
Animals and study area. — Twenty individuals of D. crocala were collected in the peri-urban zones of Santiago, Chile (32°S, 70° 40' W). They were transferred to the laboratory in the Faculty of Science of the University of Chile. Each spider was introduced into a plastic box with moist soil and isopods obtained in the capture site and maintained for one week at room temperature (20° ± 5 °C, 60 ± 5% RH) and at lOL (8:00-18:00): 14D (18:00-8:00) photoperiod. All experiments were conducted in this laboratory during March 2012- October 2012.
Preferred temperature. — After a week of acclimation, twenty individuals (11 females and nine males; nib= 102.29 ± 60.88 mg) were exposed to a temperature gradient between 2° ± 2.56 °C and 50° ± 0.89 °C established in a plastic cylinder oriented horizontally with the extremes halfway submerged in a thermoregulated chamber 1.20 m long X 0.25 m wide X 0.25 cm high. This chamber had a thermoregulated heater in one end and a cold point in the other, generating a thermal gradient between the end points (Fig. 1). The gradient was closely linear with a temperature of 19.3° ± 5.10 °C in the
299
300
THE JOURNAL OF ARACHNOLOGY
A
Lamp
Cold end Hot end
Figure 1. — Experimental temperature gradient apparatus used to measure preferred temperatures of Dysdera crocata. Thermoregulated water baths in grey. Infrarred lamp at 2.5 m.
center. Prior to the beginning of the experiments, the thermal gradient was calibrated with thermocouples installed every 5 cm. The hot/cold ends of the gradient were always switched between trials to account for potential side biases.
The spiders were exposed individually for 65 min. This was repeated twice in the morning (09:00, 12:00) and twice in the twilight-night period (18:00, 20:00). The experiments were conducted in an isolated room illuminated with artificial light in the two morning experimental hours and with only an infrared lamp positioned perpendicular to the gradient at a distance of 2.5 m in the two twilight-night periods. Individuals were deposited in the center of the chamber and allowed five minutes of settling. Then the temperature of the spiders was measured at the midpoint of the cephalothorax with an infrared thermometer every five minutes for one hour. Prior to the experimental trial, the body mass of spiders was measured with an analytical balance (Shimadzu, AUX 220, ± 1 mg).
For each individual a record of the 12 temperatures chosen by the spiders (tf. one every 5 minutes) in the periods was obtained. These were recorded starting at 9:00, 12:00, 18:00 and 20:00. With these temperature records, frequency histograms of the chosen temperatures were constructed. For each individual the mean preferred temperature (Tp) in each hour was calculated (the average of the 12 values).
Analysis and statistics. — The temperatures chosen by the spiders (tj) were characterized with frequency histograms. The normality of the distributions was tested with the Shapiro- Wilks test (W). The initial and tj temperatures were compared using the Friedman test (Fr), with a posteriori multiple comparisons. Sex differences were analyzed with the Mann- Whitney test (U), and the correlation between initial temperature and the temperature at the end of the trials were evaluated with the Spearman correlation coefficient (R).
To analyze differences in thermal preferences of the species, the temperatures chosen were averaged for each hour so that each experimental time was represented by a single value (Tp). Considering that each individual was studied at four different hours (repeated measures design) and the non-normal distribution of the data, a non-parametric Friedman test for dependent samples was performed, with Tp the response
0 5 10 15 20 25 30 35 40
Temperature (°C)
Figure 2. — Frequency histogram of preferred temperatures for Dysdera crocata.
variable and the four experimental times (9:00, 12:00, 18:00 and 20:00) as the factors.
RESULTS
The preferred temperature over all individuals and exper- imental hours was 9.12° ± 5.12 °C, with median and mode 8.0° and 6.0 °C, respectively. This was not related to sex (U = 35, P = 0.29) or to the body mass of the spiders (R = 0.1 1, R > 0.05). The distribution had a skewness of 1.47 and a kurtosis of 0.32 (Fig. 2) and was different from a normal distribution (W = 0.884, P « 0.001). The body temperature at the end of the experiment was correlated with the body temperature at the beginning of each experimental trial (R = 0.299, F < 0.05), but the variance explained was very small (R^ = 0.09) and preferred temperatures changed quickly with respect to the initial preference. Initial body temperature was different than temperatures chosen in the following minutes in the experimental trials (FrgQ jg — 146, P 0.001) (Fig. 3). There was a mean displacement of 5.9 ± 5.7 cm every five minutes.
No differences among Tp were found comparing the four experimental hours (Fr 20,3 — 5.82, p = 0.121) (Fig. 4).
DISCUSSION
Thermal preferences facilitate the description of the ecology of a species and assessment of the suitability of the habitat (Hertz et al. 1993). According to Sevacherian & Lowrie (1972), individual limits and physiological processes determine the conditions in which an organism can survive and adapt successfully to a particular environment.
Preferred temperatures for D. crocata were low compared to the range described for other araneomorph species. For example these temperatures are between 23° and 23.5 °C in Agelenidae (Pulz 1987), between 16° and 22.3 °C in Clubionidae (Almquist 1970) and between 19.2° and 26.2 °C in Lycosidae (Almquist 1970; Sevacherian & Lowrie 1972; Pulz 1987). However there are reports of low preferred temperatures in other species. For example, preferred temper- atures of some species of Linyphiidae have been reported; 4. 1
SEPULVEDA ET AL.— THERMAL PREFERENCE OF DYSDERA CROCATA
301
25
20
O
0
1=.
D
2
0
Q.
E
0
15 -
10
0 -* — A—* — At-* — AA — AA — A-^ — A— ^ — AA — A— ^ — A-^ — A—^ — A-^ — A—^ — A—^ — A—^ — 0 5 10 15 20 25 30 35 40 45 50 55 60 65
Time (min)
Figure 3. — Changes in body temperature over time in all experimental series. The asterisk indicates that the initial temperature was different than all others in a posteriori multiple comparisons.
°C in Bolephthyphantes ( = Bolyphcmtes) index (Thorell 1856) (Pulz 1987) and 1.2 °C in Macrargus riifus (Wider 1834) (Almquist 1970). The preferred temperature of D. crocata is probably associated with temperatures that are usually found in their habitat under stones, dried leaves and organic material.
In Santiago, Chile, in the location where the specimens were captured, the soil temperature can vary more than 15 °C, with the lowest temperatures in the months of April to September (winter), where temperature at 10 cm depth can reach 8 °C. The lowest temperatures are reached at night, which coincides with the activity period of D. crocata. Also, this time range of low temperatures coincides with the time when the experi- ments were performed. It has been reported that this species feeds on the isopods with which they coexist (Cooke 1965, Bradley 2013). In Chile, it is common to find D. crocata sharing its habitat with the common woodlouse PorceUio laevis, which would be its usual prey. A study of preferred temperatures of this isopod demonstrated that it is variable at different locations in Chile and according to the time spent in the measurement system (Castaneda et al. 2004). Interestingly, the preferred temperature for specimens of P. laevis in Santiago was 9.4° ± 1.1 °C using a measurement period similar to the time that we ran our experiments, and varied between 9.4° ± 1.1 °C and 12.2° ± 1.1 °C in the total experimental range of this study, which is fully consistent with our results. Thus two species that share a habitat in the field, one a predator and the other its prey, have similar preferred temperatures. A similar result was reported for the spider Loxosceles laeta (Nicolet 1849) and its predator Scytodes glohida Nicolet 1849 (Canals 2004; Canals & Solis 2013), in which the preferred temperatures, the critical temperatures and desiccation tolerances have a large overlap (Alfaro et al. 2013; Canals et al. 2013). The body temperature of D. crocata varied from an initial temperature of 15.6° ± 5.6 °C to 9.6° ± 4.6 °C in 5 minutes, and afterwards remained close to their preferred temperature (Fig. 3), with an average displacement
Hour
Figure 4. — Preferred temperatures of Dysdcra crocata at different times of the day (mean and standard deviation).
of about 6 cm in 5 min suggesting that spiders actively sought their preferred temperature.
D. crocata did not present hourly variations in preferred temperature throughout the experimental hours, contrasting with those reported in other arthropods (Canals et al. 1997), mygalomorph spiders with crepuscular and nocturnal activity (Alfaro et al. 2012), and other nocturnal araneomorph spiders (Alfaro et al. 2013).
Regarding thermal preferences, D. crocata had a standard deviation of ±5.12 °C, a value that is nearly 1 °C low than other spiders such as L. laeta and S. glohida, suggesting a more narrow range of thermal microenvironment preference than these species. The election of low temperatures and a relatively narrow range may be explained by phenotypic plasticity as an adaptation to the particular environmental conditions present in Chile. This plasticity in preferred temperatures has been reported in Paraphysa parvida Pocock 1903 and Graniniostola rosea (Walckenaer 1837), two mygalomorph spiders of central Chile (Alfaro et al. 2013). Species from different environments typically also have different thermal preferences (Pulz 1987; Schmalhofer 1999) and these may vary seasonally (Schmalho- fer 1999), with the breeding season (Hanna & Cobb 2007; Veloso et al. 2012) or during the day, as in other ectotherms (Canals et al. 1997; Alfaro et al. 2013).
The woodlouse spider, Dysdera crocata, originated from the Mediterranean and eastern European region (Cooke 1965) but has spread throughout the world; it is considered to be a cosmopolitan spider. Its distribution is mainly in the holartic region and it is more common near the coast. It is a common spider in regions with cold temperatures and winter snow cover (e.g., Illinois, Ohio, Great Britain, Tasmania) as well as in regions with the hot, dry summers and mild winters of a Mediterranean climate (e.g., southern California, Greece) (Southcott 1976; Roberts 1995; Bradley 2004; Bosnians & Chatzaki 2005; Vetter & Isbister 2006). The projection of our results from the micro scale to the temperature conditions associated with its world distribution would be not correct because preferred temperatures indicate the suitable environ- ments for D. crocata. These preferred temperatures may be
302
THE JOURNAL OF ARACHNOLOGY
different in hotter environments (phenotypic or physiologic plasticity), or this spider has a great ability to find its preferred microenvironments, probably associated with its prey: isopod populations.
ACKNOWLEDGMENTS
We thank Lafayette Eaton for his useful comments on the manuscript. Funded by FONDECYT 1 1 10058 grant to MC.
LITERATURE CITED
Alfaro, C., D.P. Figueroa, H. Torres-Contreras, C. Veloso, F. Venegas & M. Canals. 2012. Effect of thermal acclimation on preferred temperatures in two mygalomorph spiders inhabiting contrasting habitats. Physiological Entomology 38:20-25.
Alfaro, C., C. Veloso, H. Torres-Contreras, R. Solis & M. Canals. 2013. Thermal niche overlap of the brown recluse spider Lo.xosceles laeta (Araneae; Sicariidae) and its possible predator, the spitting spider Scytodes glohuhi (Scytodidae). Journal of Thermal Biology 38:502-507.
Almquist, S. 1970. Thermal tolerances and preferences of some dune- living spiders. Oikos 21:230-236.
Angilletta, M.J.J. 2009. Thermal Adaptation: a Theoretical and Empirical Synthesis. Oxford University Press, Oxford.
Angilletta, M.J.J. , P.H. Niewiarovski & C.A. Navas. 2002. The evolution of thermal physiology in ectotherms. Journal of Thermal Biology 27:249-268.
Bosnians, R. & M. Chatzaki. 2005. A catalogue of the spiders of Greece. Newsletter of the Belgian Arachnological Society 20 (2, Suppl.):l-124.
Bradley, R.A. 2004. Ohio’s Backyard: Spiders. Ohio Biological Survey Backyard Series #4.
Bradley, R.A. 2013. Common Spiders of North America. University of California Press, Berkeley.
Canals, M. & R. Solis. 2013. Is the tiger spider Scytodes glohida an effective predator of the brown recluse spider Lo.xosceles laetcil Revista Medica de Chile 141:805-807.
Canals, M., C. Alfaro, C. Veloso, H. Torres-Contreras & R. Solis. 2013. Tolerancia a la desecacion y sobreposicion del nicho termico entre la arana del rincon Lo.xosceles laeta y un posible control biologico, la arana tigre Scytodes glohida. Parasitologia Ibero- Latinoamericana 72:52-60.
Canals, M., M.E. Casanueva & M. Aguilera. 2004. Cuales son las especies de arahas peligrosas en Chile? Revista Medica de Chile 132:773-776.
Canals, M., R. Solis, J. Valderas, M. Ehrenfeld & P.E. Cattan. 1997. Preliminary studies on temperature selection and activity cycle of Chilean vectors of the Chagas disease. Journal of Medical Entomology 34:1 1-17.
Castaneda, L.E., M.A. Lardies & F. Bozinovic. 2004. Adaptative latitudinal shifts in the thermal physiology of a terrestrial isopod. Evolutionary Ecology Research 6:1-15.
Cooke, J.A. 1965. A contribution to the biology of the British spiders belonging to the genus Dysdera. Oikos 16:20-25.
Hanna, C.H.J. & V.A. Cobb. 2007. Critical thermal maximum of the green lynx spider Peiicetia viridaiis (Araneae, Oxyopidae). Journal of Arachnology 35:193-196.
Hazell, S.P., C. Groutides, B.P. Neve, T.M. Blackburn & J.S. Bale. 2010. A comparison of low temperature tolerance traits between closely related aphids from the tropics, temperate zone, and arctic. ' Journal of Insect Physiology 56:1 15-122.
Hertz, P., R. Huey & R. Stevenson. 1993. Evaluating temperature regulation by field-active ectotherms: the fallacy of the inappro- priate question. American Naturalist 142:796-818. i
Humphreys, W.F. 1987. Behavioral temperature regulation, f Pp. 56-65. In Ecophysiology of Spiders. (W. Nentwig, ed.). |
Springer Verlag, Berlin.
Jaksic, F. & L. Marone. 2007. Ecologia de Comunidades. 2nd ed.
Ediciones Universidad Catolica de Chile, Santiago. ;
Kearney, M. 2006. Habitat, environment and niche: what are we i modeling? Oikos 1 15:186-191. i
Kearney, M. 2012. Metabolic theory, life history and the distribution of a terrestrial ectotherm. Functional Ecology 26:186-191.
Kearney, M. & W.P. Porter. 2009. Mechanistic niche modeling: combining physiological and spatial data to predict species’ range. !; Ecology Letters 12:334-350.
Kearney, M., S.J. Simpson, D. Raubenheimer & B. Helmuth. 2010. Modelling the ecological niche from functional traits. Philosoph- ical Transactions of the Royal Society B 365:3469-3483.
Platnick, N.l. 2013. The World Spider Catalog. Version 14.0 American Museum of Natural History. Online at http://research. ' amnh.org/entomology/spiders/catalog/
Portlier, H.O., A.F. Bennett, F. Bozinovic, A. Clarke, M.A. Lardies & R.E. Lenski et al. 2006. Trade-offs in thermal adaptation: in ,■ need of a molecular to ecological integration. Physiological and ji Biochemical Zoology 79:295-313. |
Pulz, R. 1987. Thermal and Water Relations. Pp. 26-55. In ' Ecophysiology of Spiders, (W. Nentwig, ed.). Springer-Verlag, Berlin. J
Roberts, M.J. 1995. Spiders of Britain & Northern Europe. Harper s Collins Publishers, London.
Schmalhofer, V.R. 1999. Thermal tolerances and preferences of the | crab spiders Misuinenops asperatiis and Misumenoides forniosipes (Araneae, Thomisidae). Journal of Arachnology 27:470M80. Sevacherian, V. & D. Lowrie. 1972. Preferred temperature of two j species of lycosid spiders, Pardosa sierra and P. ranmlosa. Annals ( of the Entomological Society of America 65:111-114.
Southcott, R.V. 1976. Arachnidism and allied syndromes in the Australian region. Records of the Adelaide Children’s Hospital 1:97-186. i
Taucare-Rios, A., A. Brescovit & M. Canals. 2013. Synanthropic | spiders (Arachnida: Araneae) from Chile. Revista Iberica de Aracnologia 23:49-53.
Veloso, C., D. Luhr, R. Marfull, H. Torres-Contreras, D. Figueroa &
P. Sabat et al. 2012. Characterization of the thermal micro- i environment of Paraphysa parvida Pocock 1903 (Araneae, Ther- aphosidae), a spider from Chilean Andes. Journal of Arachnology 40:34-38.
Vetter, R.S. & G.K. Isbister. 2006. Verified bites by the woodlouse spider, Dysdera crocata. Toxicon 47:826-829. '
Villaseca, S. 1990. La temperature del suelo. Agricultura Tecnica 50:155-160.
Manuscript received 9 December 2013, revised 2 September 2014.
2014. The Journal of Arachnology 42:303-310
Natural history of Phoneulria hoUviemis (Araneae: Ctenidae): habitats, reproductive behavior,
postembryonic development and prey-wrapping
Nicolas A. Hazzi: Seccion de Entomologia, Programa Academico de Biologia, Universidad del Valle, Cali, Colombia. Email: nicolashazzi@hotmail.com
Abstract. Phoneutria boliviensis (F.O.P.-Cambridge 1897) is a medically important wandering spider distributed from Central America to northern South America. This study is the first description of the natural history of this species, and presents data on several aspects of its natural history: reproductive and prey wrapping behavior, postembryonic development, and habitats in the departments of Valle del Cauca and Quindio, Colombia. Prior to copulation, the male did not engage in any courtship from a distance, but instead climbed onto the female, adopting the typical copulation position of “modern wandering spiders” (position III). Females laid up to four egg sacs; between 430-1300 hatchlings emerged after 28-34 days. After hatching, spiderlings had a third claw on all their legs and built an irregular web, where they remained until the next molt. Sexual maturity occurred after 14-17 molts, and spiders matured 300^65 days after emerging from the egg sac. The species was found in disturbed habitats associated with both dry and wet tropical forests, usually on the ground with little litter. Spiders wrapped prey in silk, moving in a stereotypically circular pattern around the prey without manipulating threads with their legs. Attachments to the substrate involved rapid movements of the anterior spinnerets, while the others remained immobile.
Keywords: Mating, maternal behavior, Colombia, banana spider
The family Ctenidae is well represented in the Neotropics by medium to large wandering spiders that usually inhabit the forest floor and low vegetation; few are arboreal. In this family, the genus Phoneutria currently comprises eight large (17^8 mm) nocturnal wandering spider species that are widely distributed in Central America (Costa Rica) and South America east of the Andes into northern Argentina (Simo & Brescovit 2001; Martins & Bertani 2007). They are generally known as “banana spiders” because they often inhabit this crop. They are considered aggressive, and among the most medically important spiders in the world (Foelix 2010). Their venom has a neurotoxic action (Foelix 2010) and many researchers have analyzed its components and the epidemiol- ogy of bites (Biicherl 1953a, b, 1956; Cruz-Hofling et al. 1985; Marangoni et al. 1993; Pineda & Florez 2002; Florez et al. 2003; Garcia et al. 2008; Maguina et al. 2008).
The natural history of several species in the genus Phoneutria has been examined in some studies. Biicherl (1969), Ramos et al. (1998), and Almeida et al. (2000) presented data on the development, activity, reproduction seasonality, and habitat use of Phoneutria nigriventer (Key- serling 1891). Simo & Bardier (1989) described the postem- bryonic development of P. keyserlingi (F.O.P.-Cambridge 1897). In the Amazon region, Gasnier et al. (2002) and Torres & Gasnier (2010) offered data on the adult size, sexual dimorphism, habitat use, and temporal changes in body size structure of P. fera Perty 1833 and P. reiciyi (F.O.P.- Cambridge 1897). Dias et al. (2011) modeled the potential geographical distribution of P. hahiensis Simo and Brescovit 2001, a threatened species endemic to Brazil.
Phoneutria boliviensis (F.O.P.-Cambridge 1897) is widely distributed in Central America (Costa Rica) to northern South America (Simo & Brescovit 2001). Except for the brief mentions by Valerio (1983) and Hazzi et al. (2013) on geographical distribution expansions, Florez et al. (2003) on the epidemiology of bites and Jager & Blick (2009) on the
introduction into other countries via commerce in banana products, nothing is known regarding its general biology. The following study presents data about the natural history of Phoneutria boliviensis: reproductive and prey wrapping behav- ior, postembryonic development, and habitat. It is based on animals kept in captivity and on complementary field observations.
METHODS
Habitat. — Collections and nocturnal observations were made in localities in the Quindio and Valle del Cauca departments in Colombia (Fig. 1). With the help of a headlamp, I located spiders by the rellection of the light in their eyes. Daylight observations were also performed by turning over rocks and tree trunks and by visual searches of the vegetation.
Reproductive behavior. — Six females and three males col- lected from Cali, Aguacatal (Table 1, Fig. 1) were kept about 200 m from the collection locality in 30 X 20 cm terraria, with soil as substrate and wet cotton wool moistened daily. The spiders were maintained under ambient conditions of temperature (day/night approximately 27/25°C), humidity, and lighting. The spiders were fed cockroaches, Periplaneta americana, two times a week. This methodology allowed observations of egg sacs, time of the emergence of spiderlings, maternal care, and spiderling behavior in the first days. In addition, one female found with an egg sac was left in the field and was monitored daily to compare her maternal and spiderling behavior with those observed in captivity. This female was found in a cleft formed by two rocks at the side of a road.
Matings were observed at night involving three males and four females (two females were immatures that were raised to maturity, and thus virgins) in the same terraria and conditions describe above. For each encounter, I carefully introduced the male into the larger container housing the female’s terrarium
303
304
THE JOURNAL OF ARACHNOLOGY
• MON
30 kilometers
|
• study areas |
|
|
ElevatioD (m) |
|
|
1 |
0-1000 |
|
1 |
1001 - 2000 |
|
1 |
2001 - 3000 |
|
3001 - 4000 |
|
|
>4000 |
f
Figure 1. — Study areas in the Valle del Cauca and Quindio departments in Colombia. RSC = Reserva Natural San Cipriano; PNR = Parque j' Natural Regional "El Vinculo”; CEA = Cali “El Aguacatal”; LT = La Tebaida; MON = Montenegro. I
about 20-25 cm from the female. I performed 12 male-female pairings in all combinations, and both males and females were given four possible mating opportunities. Male pre-copulatory and copulatory courtship behavior and copulation are defined as in Eberhard & Huber ( 1998). Male courtship refers to those behaviors that induce the female to respond in a way that favors the male’s reproduction (Eberhard 1996). Copulation consists of all genitalic contact between a particular male- female pair, including the insertion of the embolus into the epigynal opening (Eberhard & Huber 1998).
Post-embryonic development. — In order to determine inter- I molt period in each instar and number of molts and necessary time to reach to sexually maturity, I raised 43 spiderlings taken at random from two egg sacs obtained from two of the six | females. The spiderlings were housed individually in plastic ' cylinders (4 cm diameter X 6 cm high) until the fifth instar, when they were transferred to larger plastic cylinders (10 cm diameter X 15 cm high). A moistened cotton ball was supplied weekly. Juveniles up to the fifth instar were fed with Drosophila nielanogaster larvae and adults raised in the j:
Table 1. — General characteristics of the areas studied and ctenids living sympatrically with P. boUviensis. Forest types were classified follow Holdridge’s life zone. A.M.T. = annual mean temperature; A.M.P. = annual mean precipitation.
|
Locality |
Forest type |
Coordinates (Lat. N; Lon. O) |
Elevation range (m) |
A.M.T. (°C) |
A.M.P. (mm) |
Sympatric ctenids |
|
Reserva Natural San Cipriano |
Tropical rainforest (bp-T) |
3° 50' 20"; 76° 53' 52" |
0-80 |
26 |
5200 |
Acanthoctemis sp, Aucylometes hogoteusis. and Ciipieiinitis granadensis |
|
Parque Natural regional “El Vinculo” |
Tropical dry forest (bs-T) |
3° 50' 23"; 76° 18' 07" |
950-1 100 |
25 |
1400 |
Ciipieiiniii.s binuiadatus |
|
Cali “El Aguacatal” |
Tropical dry forest (bs-T) |
3° 27' 31"; 76° 33' 45" |
1000-1100 |
25 |
1300 |
C. bimcicidatiis |
|
La Tebaida |
Premontane wet forest (bh-PM) |
4° 26' 59"; 75° 48' 01" |
1200-1300 |
22 |
1700 |
Ciipieiiniiis bimacukitus and C. coccineiis |
|
Montenegro |
Premontanewet forest (bh-PM) |
4° 33' 13"; 75° 43' 03" |
1300-1400 |
21 |
2100 |
Cupienniiis binuicukitus and C. coccineus |
HAZZI— NATURAL HISTORY OF PHONEUTRIA BOLIVIENSIS
305
Figure 2. — Mating position of P. boliviensis.
laboratory. Older spiderlings were fed field-collected crickets and juvenile Periplaneta americana raised in the laboratory. Spiderlings were fed and checked for molting three times a week. I consider spiderlings that recently emerged from the egg sac as second instar individuals (Foelix 1996).
Vouchers specimens are deposited in the arachnological collection of Museo de Entomologia de la Universidad del Valle (MUSENUV), Cali, Colombia.
Prey-wrapping behavior. — Previous studies have shown that wrapping behavior varies both qualitatively and quantitatively depending on prey size and species (see references in Barrantes & Eberhard 2007). In this study, I focused on determining whether or not Phoneiitria boliviensis exhibited a given general behavior pattern, rather than whether or not this behavior was omitted under certain conditions. I always used adults of Periplaneta americana, a difficult prey for the spiders. In four of the six females collected, I observed eight prey-wrapping episodes (two for each female). Video recordings were made with a digital Canon PowerShot ELPH 100 HS camera.
Behavioral and postembryonic developmental data are presented as mean ± SD (range: min-max). Because of the small samples, they are meant only to provide general descriptions of magnitudes, rather than to characterize the behavior of this species.
RESULTS
Habitat observations. — Sixty-nine individuals were found in remnants of dry forests, premontane wet forests transformed into banana plantations and rain forests (Table I). In the dry and wet premontane forest, spiders were always associated with synanthropic environments. I also observed the spiders in forest edges or adjacent habitats (roadsides). During the day, I found spiders (n = 20) under rocks, piles of banana leaf litter, and building rubble (tiles and bricks) near the forests or banana plantations. At night, I observed spiders (n = 49) on the ground with scattered litter (n — 40) and a few in low vegetation, usually below 40 cm above the ground (n = 9).
Mating behavior. — Mating occurred in four of 12 couples that were placed together. In no case did the male court the female from a distance. The males reacted to contact with female silk using palpal movements and began to search for the female by keeping their palps near the substrate, maintaining contact with female silk and slowly tapping in different directions with their first legs. When the male contacted the female, he turned until they were head-to-head, and touched her very quickly (less than 2 s) with his forelegs. If the female was not receptive (n = 8), she rapidly ran away. However, if she was receptive (n = 4), the male climbed over her so that they faced opposite directions and she drew in her legs close to her body so that the patellae of all her legs almost touched each other above her carapace. The male moved laterally to the sides of the female’s body and contacted her epigynum with one palp. The mating position was type HI, as in Eoelix (2010) (Fig. 2). Copulation lasted less than 15 s and the male’s extended palp moved rapidly to touch the epigynum briefly. In three pairs, it was possible to record palpal insertions; in two, there was only one insertion and in the other there were two, one on each side of the epigynum. In the video recording, I observed that the spines on the male’s legs became erect momentarily at the beginning of each palpal insertion. After mating completion, the male ran away.
Post-embryonic development. — Five of the six females attached egg sacs (n = 10) to the terrarium wall, always above the ground. Egg sacs were white, with a flat face of an average diameter of 28 mm ± 4 (range 22-33, n = 10) against the wall and a convex face (Fig. 3). Spiderlings emerged on average 30 ± 2 days (range 28-34, n = 5) after the egg sacs were produced. The average number of offspring per egg sac was 836 ± 436 (range 430-1300, n = 5). Before hatching, females only left the egg sacs for short periods, moving down in the terrarium to drink. However, they still preyed on food that was placed in the terrarium away from the egg sacs. They were more aggressive while guarding, lifting their first pair of legs, opening their fangs, and making lateral movements of the body as is characteristic of the genus (Simo & Brescovit 2001 ) (Fig 4.).
Twice 1 observed the emergence of spiderlings, one hour after the females began to bite the egg sac with her chelicerae repeatedly in different parts about once per minute. After hatching, spiderlings emerged and built an irregular web where they remained until their second molt (Figs. 5, 6). Spiderlings began to leave the communal web 15 days after emerging from the egg sac when all had molted, and they then began to feed.
Spiderlings in the second instars had a third claw on all their legs that in the following instars was lost and replaced by a dense claw tuft.
The mother and offspring behaviors just described were also observed in the field. The female stayed near the egg sac, while the spiderlings built the irregular web; when they dispersed a day after their second molt, she was still nearby. After the spiderlings had dispersed, the female also vanished.
When the communal web made by the spiderlings was disturbed by strong vibrations applied with a brush, most of them moved away a short distance, but returned to the web after 10 min. When some spiderlings were removed from the communal web and placed in another terrarium, they soon formed a group. This behavior ceased within a few days after the second molt.
306
THE JOURNAL OF ARACHNOLOGY
Figure 3-6. — Maternal behavior and communal web of the spiderlings. 3, Female above the egg sac protecting it, white arrow indicates attachment threads; 4, female defending the egg sac; 5, Communal web of the spiderlings, white arrow indicates the group of spiderlings; 6, Detail of the communal web.
Number and duration of the molts. — Four females reached maturity after 14, 15, 16 and 17 molts respectively. There was no pattern of increase or decrease in the instar duration (Table 2). However the duration of the first instar was always the shortest and presented less variation than the others. The mean time from emergence of the spiderlings until maturity was 396.7 ± 72 days (range 300^65).
Table 2. — Duration (days) of Phoneiitria holiviensis nymphal instars.
|
Instar |
11 |
Mean ± SD |
Range |
|
II |
43 |
1 1 ± 3.0 |
7-16 |
|
III |
35 |
20 ± 2.7 |
16-26 |
|
IV |
26 |
21.1 ± 9.5 |
9-47 |
|
V |
19 |
26 ± 8.3 |
14-39 |
|
VI |
16 |
30 ± 11.7 |
17-53 |
|
VII |
6 |
31 ± 13.8 |
16-52 |
|
VIII |
6 |
25 ± 2.4 |
22-28 |
|
IV |
6 |
23 ± 3.7 |
20-29 |
|
X |
5 |
24.2 ± 2.6 |
21-28 |
|
XI |
4 |
23.7 ± 4.2 |
18-28 |
|
XII |
4 |
27.5 ± 3.3 |
23-30 |
|
XIII |
4 |
41.2 ± 13.2 |
29-60 |
|
XIV |
4 |
28.2 ± 5.6 |
23-34 |
|
XV |
3 |
39.3 ± 10.8 |
27^7 |
|
XVI |
2 |
39 ± 15.5 |
28-50 |
|
XVII |
1 |
29 ± 0 |
29 |
Prey-wrapping behavior. — When a spider captured and bit a cockroach, it waited a few minutes until the insect finished moving. If the spider was on the floor, she climbed the terrarium wall (no more than 15 cm) and turned to face down (Fig. 7A) after the cockroach stopped moving (the antennae sometimes still moved). The spider inclined her abdomen toward the wall to attach silk, and then turned in a semicircular path around the prey keeping the cockroach in her chelicerae (Fig. 7B), while she made a third attachment to the surface. The silk from the first attachment still remained on the spinnerets so that a sheet of silk covered the prey (Fig. 1C). Holding the cockroach in her chelicerae, the spider continued this stereotyped circular motion, adding more silk to the prey. As the cockroach became more tightly attached to the substrate, the spider sometimes released its hold with the chelicerae while continuing to wrap it. The attachments disks were never on the prey, but on the surface around on it. Throughout this process, the palps repeatedly contacted the prey. The average number of attachments per turn was 2.4 ± 0.7 SD (range 1-3) and the average total number of attachments was 9.6 ± 2.1 SD (range 7-13). At the conclusion of prey wrapping, the spider lifted the cockroach with its chelicerae and moved slightly forward, causing the threads to the substrate to tighten. The mean duration of the prey wrapping was 81 s ± 13 SD (range 65-100).
While the spiders fed, they sometimes repeated prey wrapping several times, but with shorter durations and fewer attachments than the initial wrap. In seven of the eight observations, the wrapping lines formed from the first two
HAZZI— NATURAL HISTORY OF PHONEUTRIA BOLIVIENSIS
307
Figure 7. — Prey wrapping behavior sequence of Phonentria holiviensis (the numbers indicate the order of the attachments). After the third attachment, the cockroach is fixed to the substrate.
attachment disks that the spider made did not contact the cockroach. The general pattern of attaching wrapping lines on prey was in one direction (Fig. 9). When the spider began to make this circular motion, it was always performed in a clockwise direction without changing course. I observed that the silk was slack and consisted of numerous threads. In no
case did any leg hold any line which was being produced or to which the spider was attaching.
Because the spiders wrapped the prey while on the vertical glass wall of the terrarium, it was possible to observe the movement of the spinnerets as they produced silk. Silk emerged from all three pairs of spinnerets. Only the anterior
Figure 8. — Patterns of attachments of wrapping lines by two individuals of Phoneutria holiviensis (the numbers indicate the order of the attachments and arrows the direction taken by the spider). The silk is slack and due to the circular movement of her body, the threads do not pass straight over the prey as schematized, but instead are curved around it.
308
THE JOURNAL OF ARACHNOLOGY
spinnerets moved when an attachment was made in alternated fashion. The immobile posterior lateral spinnerets (PLS) were usually in an asymmetric position, depending on the direction taken by the spider in the circular motion pattern; for instance, if the spider was moving to the left, the right PLS was always raised and the left PLS was lowered touching the substrate. These asymmetric positions of the spinnerets created the silk sheet shown in Fig. 7D.
DISCUSSION
Plioneiitria holiviensis has been associated with wet and very wet forest ecosystems with annual precipitation > 2500 mm. Valerio (1989) indicates that in Costa Rica this species is restricted to wet and very wet forests in tropical life zones system (Holdridge system) and altitudes not exceeding 600 m; Florez et al. (2003) recorded this species in the Uraba region, Colombia, an area known for its high precipitation; Martins & Bertani (2007) consider it to be a typical species of the Amazon region. In this study, I also found F. holiviensis in rainforests, and also in remnants of dry forests with annual precipitation of 1300-1400 mm and at elevations of up to 1400 m. Thus this species is not restricted to lowland rainforests.
In the mating process, male P. holiviensis made palpal movements when contacting female silk. These movements apparently are similar to those described in some species of lycosids (Tietjen & Rovner 1980), and allow the male to locate the female by following her silk (Tietjen 1977; Tietjen & Rovner 1980). Male P. holiviensis did not court from a distance prior to mating. Folly-Ramos et al. (2002) found that P. nigviventer also lacks courtship. It appears that the female recognizes the male when he contacts her because if the female is receptive, she adopts a passive posture when touched. In contrast, Ciipienniiis spp. Simon 1891 and Ancyloinetes hogotensis (Keyserling 1877) have elaborate courtship before mating, involving rhythmic movements of the first pairs of legs and palpal drumming which sends vibrations through the substrate (Merrett 1988; Barth 2002). In addition, A. hogotensis and C coccineus F.O. Pickard-Cambridge 1901 are unique among ctenids in wrapping the legs of the female with silk during mating (Merrett 1988; Schmitt 1992). Other ctenid species like Cteniis niecliiis Keyserling 1891 and Isoctenus sp. Bertkau 1880 have less elaborate courtship involving only vibrational motions of the first pair of legs (Folly-Ramos et al. 2002; Pellegati-Franco 2004). The erection of the leg spines at the beginning of each palpal insertion by the male is due to increased body pressure during insertion and expansion of the hematodocha (Foelix 2010).
The mating position of P. holiviensis was type III (Foelix 2010), typical of the “modern wandering spiders” such as Anyphaenidae, Clubionidae, Lycosidae, Pisauridae, Saltici- dae, Tengellidae, Trechaleidae and Thomisidae (Sierwald & Coddington 1988; Costa 1993; Huber 1995; Barrantes 2008; Foelix 2010). The ctenids species mentioned above, except C. niecliiis, use this same mating position. Thus this behavior could be a tentative synapomorphy as families sharing this trait belong to the monophyletic RTA (retrolateral tibial apophysis) clade.
According to my observations made of this species both in captivity and in the field, P. holiviensis demonstrated effective
maternal care, consisting mainly of her remaining with the egg sac and defending it until the spiderlings emerged and dispersed within a few days after molting. This behavior by i mothers could prevent predation on spiderlings because j: females were more aggressive during this period. Toyama i (1999) reported a similar maternal behavior in Cheiracanthiwn j japonicum, which greatly improved survival and development of eggs as well as spiderlings in the field.
The shape of the egg sac, maternal behavior, the construc- tion of a communal web by the spiderlings, and dispersal following the second molt are all traits shared with some other ctenids such as Phoneutria keyserlingi (Simo 1989); Pam- hatinga hrevipes (Keyserling 1891); Asthenoctenus borellii ! Simon 1897 (Simo et al. 2000); Cteniis inedius (Folly-Ramos et al. 2002); Cteniis fasciatm Mello-Leitao 1943 and Enoploc- teniis cyclothorax (Bertkau 1880), however C. fasciatiis usually ^ put grains of dirt on the egg sac, apparently for camouflage (Pellegatti-Franco 2004). Other ctenids, such as Ciipienniiis spp., differ by carrying the egg sac on spinnerets (Barth 2002) or with the chelicerae, as in Ancyloinetes hogotensis, Cteniis amphora Mello-Leitao 1930 and C. crulsi Mello-Leitao 1930 (Merrett 1988; Hofer et al. 1994).
It is well known that the middle claw is important for web spiders because they use it to catch hold of the silk threads of their webs (Foelix 2010). In Phoneutria holiviensis and maybe other ctenids mentioned above, the presence of this claw in i early instars is necessary because the spiderlings build a , communal web after emergence. Homann (1971) also men- I tioned the presence of a middle claw in early instars of Cteniis f niecliiis, Ciipienniiis salei (Keyserling 1877), and Phoneutria j keyserlingi. Others ctenids species of Ancyloinetes and Cupien- | niiis, also have a third claw. The Ciipienniiis adults have a much reduced middle claw (Barth 2002; H5fer & Brescovit 2000). According to Silva (2004), the occurrence of a middle claw ^ could be an ancestral condition for the ctenoid spiders.
There are two general contexts in which the spiders wrap their prey: to restrain active prey and prevent their escape ' (“immobilization wrapping”) and to form more compact and : manageable packages (“post-immobilization wrapping”) i' (Eberhard 1967; Robinson et al. 1969; Rovner & Knost i 1974; Barrantes & Eberhard 2007). Phoneutria holiviensis performed only “post-immobilization wrapping.” The cock- roach became more compact during the wrapping process, and became more securely fastened to the vertical substrate. This allowed the spider to occasionally release the prey with her chelicerae and chew on another part without falling. The i circular pattern of wrapping and the movement of the anterior [ spinnerets of P. holiviensis was similar to observations of , Rahiclosa ( = Lycosa) rahiila (Walckenaer 1837) and R. piinctulata (Hentz 1844) (Rovner & Knost 1974), which also perform this behavior while above the ground (in vegetation).
While wrapping, P. holiviensis does not manipulate threads with any legs, but rather attaches threads to the substrate through body movements. Pulling wrapping silk using movements of the body is ancestral in araneomorph spiders and its homology is supported by the similarity in their [ asymmetrical use of PLS described in several families j (Barrantes & Eberhard 2007). Such asymmetry alters the i distribution of lines on the prey package from that expected if the spinnerets were used symmetrically. In the case of the prey-
HAZZI— NATURAL HISTORY OF PHONEUTRIA BOLIVIENSIS
309
wrapping behavior of P. boliviensis, the asymmetric position of the PLS create a silk sheet that encases the prey more efficient than if the PLS were in a symmetric position, creating only a swath of lines.
In Rabidosa rahida, Rovner & Knost (1974) sealed each pair of spinnerets separately with paraffin to identify the functions of the types of silk they produced during prey wrapping. The anterior spinnerets produced attachment discs with lines from the pyriform glands. In addition, the anterior spinnerets produced drag lines from the ampullate glands. The median and posterior spinnerets produced wrapping silk from the aciniform glands. The movements of the anterior spinnerets of P. boliviensis while attaching lines to the wall presumably resulted in the zigzag pyriform lines typically seen in attachment discs.
ACKNOWLEDGMENTS
I am grateful to William Eberhard (Smithsonian Tropical Research Institute) for his help in improving this manuscript and Carlos Valderrama (Universidad Icesi, Colombia) for his valuable comments throughout the development of the project. I also thank Miguel Simo (Universidad de la Republica, Uruguay) for corroborating the identification of the species and providing literature; Carmen E. Posso (MUSENUV) for making available the colony of cockroaches for feeding the spiderlings and behavioral observations of prey-wrapping; Marcela Delgado (Universidad Icesi, Colom- bia) for helping me on some occasions with the maintenance of the spiderlings; and Jairo A. Moreno (Seccion Entomologia, Univalle, Colombia) for processing Figure 2.
LITERATURED CITED
Almeida, C.E., E.F. Ramos, E. Gouvea, M. Carmo-Silva & J. Costa. 2000. Natural history of Ctenus niedius Keyserling, 1891 (Araneae. Ctenidae) I: observations on habitats and the development of chromatic patterns. Revista Brasileira de Biologia 60:503-509. Barrantes, G. & W.G. Eberhard. 2007. The evolution of prey wrapping behaviour in spiders. Journal of Natural History 41:1631-1658.
Barrantes, G. 2008. Courtship behavior and copulation in Teiigellu radiatci (Araneae, Tengellidae). Journal of Arachnology 36:606- 608.
Barth, F.G. 2002. A Spider's World: Senses and Behavior. Springer, Berlin.
Biicherl, W. 1953a. Dosagem comparada das atividades dos extratos glandulares e do veneno puro de Phoneutria nigreventer. Memorias do Instituto Butantan 25:1-22.
Biicherl, W. 1953b. Novo proceso de obtencao de veneo seco, puro de Phoneutria nigreventer e titulacao da LD5Q em camundongos. Memorias do Instituto Butantan 25:153-176.
Biicherl, W. 1956. Studies on dried venom of Phoneutria fera Perty, 1833. Venoms 44:95-97.
Biicherl, W. 1969. Biology and venoms of the most important South American spiders of the genera Phoneutria, Loxosceles, Lycosa and Latrodectus. American Zoologist 9:157-159.
Costa, F.G. 1993. Cohabitation and copulation in Ixeuticus nuirtius (Araneae, Amaurobiidae). Journal of Arachnology 21:258-260. Cruz-Hofling, M.A., S. Love, G. Brook & L.W. Duchen. 1985. Effects of Phoneutria nigriventer spider venom on mouse peripheral nerve. Quarterly Journal of Experimental Physiology 70:623-640. Dias, M.A., M. Simo, 1. Castellano & A.D. Brescovit. 2011. Modeling distribution of Phoneutria hahiensis (Araneae: Ctenidae): an
endemic and threatened spider from Brazil. Sociedade Brasileira de Zoologia 28:432-439.
Eberhard, W.G. 1967. Attack behavior of diguetid spiders and the origin of prey wrapping in spiders. Psyche 74:173-181.
Eberhard, W.G. 1996. Female Control: Sexual Selection by Cryptic Female Choice. Princeton University Press, Princeton, New Jersey.
Eberhard, W.G. & B.A. Huber. 1998. Courtship, copulation, and sperm transfer in Leucauge niariaua (Araneae, Tetragnathidae) with implications for higher classification. Journal of Arachnology 26:342-368.
Florez, E., A. Ortiz & M. Montoya. 2003. Accidentes por mordedura de la arana de las bananeras Phoneutria boliviensis (Araneae: Ctenidae) en la region de Uraba, Colombia. Entomologo 96:1-4.
Foelix, R. 2010. Biology of spiders. 3rd ed. Oxford University Press, New York.
Folly-Ramos, E., C.E. Almedia & J. Costa. 2002. Natural history of Ctenus niedius Keyserling, 1891 (Araneae, Ctenidae) II: Life cycle and aspects of reproductive behavior under laboratory conditions. Revista Brasileira de Biologia 62:787-793.
Garcia, L.F., L.E.A. Pedrosa & D.R.B. Rosada. 2008. An easy method for handling the genus Phoneutria (Araneae. Ctenidae) for venom extraction. Journal of Arachnology 36:604-605.
Gasnier, T.R. & H. Hofer. 2001. Patterns of abundance of four species of wandering spiders (Ctenidae: Ctenus) in a forest in Central Amazonia. Journal of Arachnology 29:95-103.
Gasnier, T.R., C.S. de Azevedo. M.P. Torres-Sanchez & H. Hofer. 2002. Adult size of eight hunting spider species in central Amazonia: temporal variations and sexual dimorphisms. Journal of Arachnology 30:146-154.
Hazzi, N.A.. C. Valderrama, A.D. Brescovit, D. Polotow & M. Simo. 2013. New records and geographical distribution of ctenid spiders (Araneae: Ctenidae) in Colombia. Zootaxa 3709:243-254.
Hofer, H. & A.D. Brescovit. 2000. A revision of the neotropical spider genus Ancylometes Bertkau (Araneae: Pisauridae). Insect System- atics and Evolution 31:323-360.
Hofer, H., A.D. Brescovit & T. Gasnier. 1994. The wandering spiders of the genus Ctenus (Ctenidae: Araneae) of Reserva Ducke, a rainforest reserve in central Amazonia. Andrias 13:81-98.
Homann, H. 1971. Die Augen der Araneae: Anatomic, Ontogenie und Bedeutung fiir die Systematik (Chelicerata, Arachnida). Zeitschrift fur Morphologie der Tiere 69:201-272.
Huber, B.A. 1995. Genital morphology and copulatory mechanics in Anyphaena accentuate (Anyphaenidae) and Cluhiona pallidula (Clubionidae: Araneae). Journal of Zoology 235:689-702.
Jager, P. & T. Blick. 2012. Zur Identifikation einer nach Deutschland eingeschleppten Kammspinnenart (Araneae: Ctenidae: Phoneu- tria). Arachnologische Mitteilungen 38:33-36.
Maguina, V.C., L.A. Soto, A.B. Juarez, M.A. Bruno, A.C. Villon & F.O. Plengue. 2008. Primer reporte de Phoneutrismo en el Peru. Presentacion de dos casos. Revista Medica Herediana 19:128-133.
Maragoni, S., N.C. Borges, R.A. Marangoni, E. Atunes, C.A. Viera & J.C. Novello et al. 1993. Biochemical characterization of a vascular smooth muscle contracting polypeptide purified from Phoneutria nigriventer (armed spider) venom. Toxicon 31:377.
Martins, R. & R. Bertani. 2007. The non-Amazonian species of the Brazilian wandering spiders of the genus Phoneutria Perty, 1833 (Araneae: Ctenidae), with the description of a new species. Zootaxa 1526:1-36.
Merrett, P. 1988. Notes on the biology of the neotropical pisaurid, Ancylometes hogotensis (Araneae: Pisauridae). Bulletin of British Arachnological Society 7:197-201.
Pellegatti-Franco, F. 2004. Biologia e Ecologia populacional de Ctenus fasciatus Mello-Leitao e Enoploctenus cyclothora.x (Bert- kau) em cavernas do alto Riberira, Iporanga, sp (Araneae: Ctenidae). Ph.D. thesis, Instituto de Biociencias da USP, Sao Paulo, Brazil.
310
THE JOURNAL OF ARACHNOLOGY
Pineda, D. & E. Florez. 2002. Mordeduras de aranas. Pp. 71-88. In Accidentes por animales venenosos. (D. Pineda, ed.). Instituto Nacional de Salud, Bogota.
Ramos, E.F., C.E. Almeida, E. Gouvea & M. Carmosilva. 1998. Considerapoes sobre a atividade de locomo^ao, preferencia por ecotopos e aspectos territorials de Phoneutria nigriventer (Keyserling, 1891), (Araneae, Ctenidae). Revista Brasileira de Biologia 58:71-78.
Robinson, H.M., H. Mirick & O. Turner. 1969. The predatory behavior of some araneid spiders and the origin of immobilization wrapping. Psyche 76:487-501.
Rovner, J.S. & S.J. Knost. 1974. Post-immobilization wrapping of prey by lycosid spiders of the herbaceous stratum. Psyche 81:398-414.
Sierwald, P. & J.A. Coddington. 1988. Functional aspects of the male palpal organ in Dolomedes tenebrosiis, with notes on the mating behavior (Araneae, Pisauridae). Journal of Arachnology 16:262-265.
Silva, D. 2004. Higher-level relationships of the spider family Ctenidae (Araneae: Ctenoidea). Bulletin of the American Museum of Natural History 274:1-86.
Simo, M. & G. Bardier. 1989. Desarrollo postembrionario de Phoneutria keyserlingi (Pickard-Cambridge) 1897 (Araneae, Cte- nidae). Boletin de la Sociedad Zoologica del Uruguay 5:15-16.
Simo, M. & A.D. Brescovit. 2001. Revision and cladistic analysis of the Neotropical spider genus Phoneutria Perty, 1833 (Araneae,
Ctenidae), with notes on the related Cteninae. Bulletin of the British Arachnological Society 12:67-82.
Simo, M., V. Vazquez & U. Gonzalo. 2000. Estudio comparativo de la I fenologia y el habitat de Ctenus taeniatus KEYSERLING 1891 y Asthenoctenus horellii SIMON 1897 en el Uruguay (Araneae, ■ Ctenidae). Boletin de la Sociedad Zoologica del Uruguay, 2° epoca 1, 12:32M0. " I,
Schmitt, A. 1992. Conjectures on the origins and functions of a bridal 1 veil spun by the males of Cupiennius coccineus (Araneae, Ctenidae). Journal of Arachnology 20:67-68.
Tietjen, W.J. 1977. Dragline following by male lycosid spiders. Psyche 84:164-178. " j
Tietjen, W.J. & J.S. Rovner. 1980. Physico-chemical trail-following i behaviour in two species of wolf spiders: sensory and etho- j ecological concomitants. Animal Behaviour 28:735-741. Torres-Sanchez, M.P. & T.R. Gasnier. 2010. Patterns of abundance ' and body size structure of Phoneutria reidyi and P. /era (Araneae: Ctenidae) in the Central Amazonian rainforest. Journal of j Arachnology 38:433-440. '
Toyama, M. 1999. Adaptive advantages of maternal care and matriphagy in a foliage spider, Chiracanthium japoniciini (Araneae: Clubionidae). Journal of Ethology 17:33-39.
Valerio, C.E. 1983. Sobre la presencia de Phoneutria boUviensis (F.O.P Cambridge) (Araneae, Ctenidae) en Costa Rica. Journal of Arachnology 11:101-102.
2014. The Journal of Arachnology 42:31 1-314
SHORT COMMUNICATION
The mechanism behind plasticity of web-building behavior in an orb spider facing spatial constraints
Thomas Hesselberg': Smithsonian Tropical Research Institute, Apartado 0843-03092, Balboa, Ancon, Republic of Panama. E-mail: thomas.hesselberg@zoo.ox.ac.uk
Abstract. Orb spiders demonstrate an impressive ability to adapt their web-building behavior to a wide range of environmental and physiological factors. However, the mechanisms behind this plasticity remain poorly understood. Behavioral plasticity can be categorized as either developmental, where new neural pathways arise from learning, or activational, which rely on more costly pre-existing neural pathways. Here 1 argue that orb spiders and their webs in general and their response to spatial constraints in particular make an ideal model system in which to explore these two mechanisms further. I show that the spider Eiislala illicita (O. Pickard-Cambridge 1889) immediately modifies its first orb web after being placed in spatially confined experimental frames without showing subsequent improvements in design of the second web. Thus, these data are in accord with the hypothesis that this spider relies on activational behavioral plasticity, which might be linked to its preferred habitat in the wild.
Keywords: Behavioral flexibility, learning, experience, web geometry, Eiistaki illicita
The ability of an animal to rapidly adapt its behavior to changes in its environment, so-called behavioral plasticity or behavioral fiexibil- ity, has been described from a wide range of vertebrate and invertebrate taxa. Phenotypic plasticity in general, and behavioral plasticity in particular, has previously been recognised as arising either from an innate pre-programmed pathway or from internal physiological or external environmental changes including develop- mental changes and learning (West-Eberhard 2003; Mery & Burns 2010). Most studies focus on the interaction between environmental change and the evolution of learning. Initially it was assumed that learning was always favored in variable environments, but more detailed experimental and theoretical studies show that learning is only favored when the environment changes relatively little within an individual lifetime and shows predictable changes between genera- tions (so-called coarse-grained environmental variation). Innate behavior is favored when the environment changes randomly and unpredictably within generations (so-called fine-grained environmen- tal variation) (Stephens 1991; Dunlap & Stephens 2009).
The above and similar studies have significantly increased our understanding of the evolution of learning, but the relationship between behavioral plasticity and learning remains poorly defined. However, this relationship has recently been the subject of a review by Snell-Rood (2013), in which she defined two different kinds of behavioral plasticity based on separate costs and benefits. Develop- mental behavioral plasticity is the slower process that requires a physical re-organisation of the underlying neural pathways caused by, for example, learning, which is hypothesised to be favoured in environments that show coarse-grained variation. Activational behavioral plasticity, which is an immediate reponse that relies on pre-configured neural pathways, is favoured in environments that show fine-grained variation. Both require significant initial invest- ment in costly neural tissue, but developmental behavioral plasticity allows animals to prune and optimize the neural network over time, while activational behavioral plasticity relies on a constant amount of neural tissue (Snell-Rood 2013). However, the two mechanisms do not necessarily operate completely separately. What may look like activational behavioral plasticity in the adult animal may have arisen through interactions between the genes and the environment including learning processes in the juvenile animal. Thus activational
‘Current Address; Department of Zoology, University of Oxford, South Parks Road, Oxford, 0X1 3PS, United Kingdom
behavioral plasticity that does not involve any learning in the present may be the result of neural pathways that were fixed through developmental behavioral plasticity in the past. More experimental data is required to investigate the prevalence and interaction of these two types of behavioral plasticity.
Here I propose that orb spiders and their webs constitute an ideal model system in which to study behavioral plasticity. Orb spiders show an impressive ability to modify their webs to a range of environmental and physiological factors including temperature (Vollrath et al. 1997), wind (Vollrath et al. 1997; Liao et al. 2009), prey size and type (Nakata 2007; Blamires et al. 2011), silk availability (Eberhard 1988; Vollrath et al. 1997), leg loss (Pasquet et al. 2011) and spatial constraints (Ades 1986; Vollrath et al. 1997; Harmer & Herberstein 2009). However, the majority of these studies tested either only the first web or allowed the spiders a week or more to acclimatize to experimental conditions before testing them, and so do not allow us to unravel whether spiders immediately adapt their webs to the new condition (i.e., activational behavioral plasticity) or improve their webs gradually as they gain more experience with the condition (i.e., developmental behavioral plasticity). Given that inexperienced spiders build perfectly normal webs (Reed et al. 1970) and that spiders do not improve webs with age or size (Eberhard 2007; Hesselberg 2010), a reliance on developmental behavioral plasticity is perhaps less likely. However, orb spiders readily learn to avoid dangerous and distateful prey (Henaut et al. 2014); gradually alter their sticky spiral mesh size, web size and web asymmetry based on recent prey capture experiences (Heiling & Herberstein 1999; Vernier et al. 2000); improve the size, planarity and verticality in subsequent webs built at the same site (Zschokke & Vollrath 2000; Nakata & Ushimaru 2004); and also seem to gradually improve their locomotory and web-building skills under weightless conditions in space (Witt et al. 1977).
Here I propose that spiders' adaptation to building webs in spatially constrained spaces is particularly useful for studying behavioral plasticity as it is ecologically relevant and has been studied in a number of different species (Ades 1986; Vollrath et al. 1997; Krink & Vollrath 2000; Harmer & Herberstein 2009; Barrantes & Eberhard 2012; Hesselberg 2013). I re-analysed previously collected data on behavioral fiexibility in Eiistala illicita (O. Pickard-Cam- bridge 1889), which successfully built webs in size-limited experimen- tal frames (Hesselberg 2013). Late instar female spiders were collected in a dry tropical rain forest in Panama City, Panama (9°N, 80°W) and
311
312
THE JOURNAL OF ARACHNOLOGY
!
f
i
Figure 1. — Differences in area utilization (A) and shape (B) between first (dark grey bars) and second (light grey bars) webs of Eustala illicita built in experimental frames (Control (N = 5): 30 X 30 cm; Vertical (A = 8): 15 X 30 cm; Horizontal (A=6): 30 X 15 cm; Small (A = 10): 15 X 15 cm). The error bars indicate the standard error of the mean. The inset on figure B gives an interpretation of the numerical shape values with a value of 0 indicating a perfect circle. Shape was calculated using the following equation (dh - dv)/(dh + dv), where dh and dy is the horizontal and vertical diameter of the web.
were given a week to acclimatize to building webs in standard frames (30 X 30 X 5 cm) in the laboratory during which they were watered and fed fruit flies regularly after which their webs were cut into a single strand with a soldering iron (see Hesselberg 2013 for a more detailed description of methods). Spiders that built normal-looking webs nearly daily were included in the experiment, which consisted of transferring spiders to experimental frames (control frames: 30 X 30 X 5 cm, vertical frames: 15 X 30 X 5 cm, horizontal frames: 30 X 15 X 5 cm and small frames: 15 X 15X5 cm), where they were kept for three days with any webs being photographed and subsequently destroyed with a soldering iron as described above. Spiders were given water but not fed throughout the three-day experimental period. In the present study I used the spiders that built multiple webs in the three day period to compare the first web built on day 1 with the second web built on day 2 or day 3. As only about half the spiders built three webs, I decided to compare only web 1 and 2. A range of web parameters were measured from digital photographs using ImageJ (vl.41. National Institute of Health, USA) and were analysed with IBM SPSS V. 20 (IBM Corporation 2011) using a significance level of 5%. The tests performed were either a repeated measures ANOVA with web number as the within-subject factor and experimental frame as between-subject factor or a paired t-test.
The main parameters of interest were the area utilization (i.e. the proportion of the available area in the frame taken up by the capture spiral) and the shape of the web (Vollrath et al. 1997; Krink & Vollrath 2000; Hesselberg 2013). As shown in Fig. lA, this study found only minor and non-significant differences in area utilization between first and second webs across all four experimental treatments (repeated measures ANOVA: F(i,25) = 0.12, P = 0.915) but, as expected, spatially constrained spiders utilized a significantly higher proportion of the available area than the control spiders (repeated measures ANOVA: F(3_25) = 5.56, P = 0.005). Similarly, there were no differences in shape between the first and the second web across the different experimental frames (repeated measures ANOVA: F(|,25) = 2.17, P — 0.153) but, as expected, there were significant differences in shape between webs in the different treatments (repeated measures ANOVA: F(3,25) = 173.39, P < 0.001), with control and small frames resulting in almost round webs while the vertical frames had vertically elongated webs and the horizontal frames had horizontally elongated webs (Fig. 1 B). The repeated measures ANOVA found no significant interactions between web number and frame shape for either area utilization or shape (test results not shown). The similarity of first and second webs across all the experimental frames was further supported by the lack of differences between first and second webs in a range of web parameters for all four treatments (Table 1), except that mesh height in the horizontal frame was slightly larger in the second web.
In conclusion, the data presented here suggest that E. illicita immediately adjusts its first orb web to match the experimentally
constrained space with no improvements in shape or area utilization in the second webs built under the same conditions. Although the present lack of statistical differences could be attributed to the relatively small sample size, none of the measured parameters show any consistent trends towards better adapted, larger or denser second webs. Eustala illicita therefore appears to rely on activational behavioral plasticity to adapt its web to spatial constraints, which the spider probably frequently encounters in its natural habitat. It is almost exclusively found in relative high densities within the branches ; of the ant acacia Acacia collinsii, which might give rise to competition for available space (Hesselberg & Triana 2010; Styrsky 2014). As the individual spiders grow larger, they are therefore likely to be subject to fine-grained environmental variation as they move around on the } acacia in search of suitable web-building sites. Since the spiders used i in this study were caught in the wild, however, it is possible that the present behavior is the result of earlier developmental behavioral j plasticity that has resulted in fixed neural pathways for dealing with spatial constraints. In this regard the present behavior can be viewed as an example of context-dependent behavior in that spiders utilize : earlier learning to adapt their web-building behavior when facing i similar constraints. Such context-dependent learning has previously i been found in spiders (Skow & Jakob 2006), although the two very s different contexts in this study in terms of learning in the complex ; natural environment and using this learning in the much simpler artificial environment in the laboratory renders this less likely. I Finally, there is also the possibility that no learning or plasticity takes place and that the ability to adapt their webs to spatial constraints is a passive emergent property of the spider’s web-building behavioral rules. This, however, is unlikely for the following reasons: the spiders in this experiment and in others (Vollrath et al. 1997) readily adapt their webs to many different types of spatial constraints; orb spiders in general match the size and shape of their webs to their available silk I resources (Eberhard 1988) and therefore probably gather information during their exploratory behavior relevant to the size and shape of | their future webs (Vollrath 1992); and other species of orb spiders, likely using similar behavioral rules, are unable to adapt their webs to limited space (Hesselberg 2013). Given the discussion above and because the present study only investigates learning over a short period of time for only one situation, that of web-building behavior in spatial constraints, this study provides a relative weak test for the role of learning in behavioral plasticity of web-building behavior generally. However, the activational behavioral plasticity hypothesis is further supported by the strong either-or response in web-building : frequency between spiders that match their webs to available space | (Vollrath et al. 1997) and those that do not (Hesselberg 2013) as well j as the immediate response in web parameters observed in Cyclosa octotuherculata (Karsch 1879) to feeding and prey detection ' experiences (Nakata 2007, 2012).To determine whether orb spiders
HESSELBERG— WEB-BUILDING PLASTICITY AND SPATIAL CONSTRAINTS
313
Table 1. — A comparison between first and second webs of Eustala illicita facing spatial constraints. Measures are given as mean ± standard error.
|
First web |
Second web |
Paired r-test |
P -value |
|
|
CONTROL FRAME |
||||
|
Number of webs |
5 |
5 |
||
|
Number of radii |
28.8 ± 3.3 |
31.0 ± 2.2 |
-1.77 |
0.151 |
|
Number of spirals |
32.5 ± 4.7 |
33.1 ± 4.4 |
-0.58 |
0.591 |
|
Mesh height (cm) |
0.25 ± 0.03 |
0.24 ± 0.04 |
0.37 |
0.733 |
|
Vertical assymetry' |
-0.51 ± 0.04 |
-0.54 ± 0.02 |
0.82 |
0.458 |
|
VERTICAL FRAME |
||||
|
Number of webs |
8 |
8 |
||
|
Number of radii |
31.4 ± 1.6 |
33.1 ± 1.5 |
-1.07 |
0.320 |
|
Number of spirals |
31.9 ± 1.7 |
29.2 ± 1.8 |
1.52 |
0.173 |
|
Mesh height (cm) |
0.20 ± 0.01 |
0.20 ± 0.01 |
-0.73 |
0.487 |
|
Vertical assymetry' |
-0.44 ± 0.03 |
-0.40 ± 0.06 |
-0.70 |
0.506 |
|
HORIZONTAL FRAME |
||||
|
Number of webs |
6 |
6 |
||
|
Number of radii |
33.5 ± 1.4 |
35.7 ± 1.7 |
-1.23 |
0.273 |
|
Number of spirals |
33.9 ± 2.4 |
31.7 ± 1.4 |
1.49 |
0.193 |
|
Mesh height (cm) |
0.18 ± 0.01 |
0.19 ± 0.01 |
-3.10 |
0.027* |
|
Vertical assymetry' |
-0.45 ± 0.02 |
-0.47 ± 0.04 |
Z = -0.67 |
0.500 |
|
SMALL FRAME |
||||
|
Number of webs |
10 |
10 |
||
|
Number of radii |
29.2 ± 1.4 |
29.4 ± 1.3 |
-0.12 |
0.907 |
|
Number of spirals |
25.4 ± 1.6 |
24.7 ± 1.3 |
0.49 |
0.639 |
|
Mesh height (cm) |
0.17 ± 0.01 |
0.18 ± 0.01 |
-1.44 |
0.184 |
|
Vertical assymetry' |
-0.42 ± 0.05 |
-0.37 ± 0.07 |
-0.85 |
0.419 |
' Vertical asymmetry was calculated using the following equation: (ru — ri)/(ru + n), where ru and q are the upper (above hub) and lower (below hub) web radii. The Wilcoxon Signed Rank test (Z) was used where data could not be normalized.
generally rely exclusively on activational behavioral plasticity, or on a combination of the two behavioral plasticity mechanisms, to adapt their behavior to changes in the environment requires further comparative studies in a range of situations including naturally occurring ones such as leg loss and experimental ones such as changes in the magnitude or direction of gravity.
ACKNOWLEDGMENTS
The collection of the original data upon which this study was based was funded by a Smithsonian Institution Postdoctoral Fellowship. The author would like to thank William Eberhard for his useful comments on an earlier version of this paper as well as the very valuable comments from two anonymous reviewers.
LITERATURE CITED
Ades, C. 1986. A construpao de teia geometrica como programa comportamental. Ciencia e Cultura 38:760-775.
Barrantes, G. & W.G. Eberhard. 2012. Extreme behavioral adjust- ments by an orb-web spider to restricted space. Ethology 118:438-449.
Blamires, S.J., Y.-C. Chao, C.-P. Liao & I.M. Tso. 2011. Multiple prey cues induce foraging flexibility in a trap-building predator. Animal Behaviour 81:955-961.
Dunlap, A.S. & D.W. Stephens. 2009. Components of change in the evolution of learning and unlearned preference. Proceedings of the Royal Society of London. Series B 276:3201-3208.
Eberhard, W.G. 1988. Behavioral flexibility in orb web construction: effects of supplies in different silk glands and spider size and weight. Journal of Arachnology 16:295-302.
Eberhard, W.G. 2007. Miniaturized orb-weaving spiders: behavioural precision is not limited by small size. Proceedings of the Royal Society of London. Series B 274:2203-2209.
Harmer, A.M.T. & M.E. Herberstein. 2009. Taking it to extremes: what drives extreme web elongation in Australian ladder web spiders (Araneidae: Telaprocera maiidae)! Animal Behaviour 78:499-504.
Heiling, A.M. & M.E. Herberstein. 1999. The role of experience in web-building spiders (Araneidae). Animal Cognition 2:171-177.
Henaut, Y., S. Machkour-M’Rabat & J.-P. Lachaud. 2014. The role of risk-avoidance strategies during spider-ant interactions. Animal Cognition 17:185-195.
Hesselberg, T. 2010. Ontogenetic changes in web design in two orb- web spiders. Ethology 116:535-545.
Hesselberg, T. 2013. Web-building flexibility differs in two spatially constrained orb spiders. Journal of Insect Behavior 26:283-303.
Hesselberg, T. & E. Triana. 2010. The web of the acacia orb-spider Eustala illicita (Araneae: Araneidae) with notes on its natural history. Journal of Arachnology 38:21-26.
Krink, T. & F. Vollrath. 2000. Optimal area use in orb webs of the spider Araneus diadematus. Naturwissenschaften 87:90-93.
Liao, C.-P., K.-J. Chi & I.-M. Tso. 2009. The effects of wind on trap structural and material properties of a sit-and-wait predator. Behavioral Ecology 20:1194-1203.
Mery, F. & J.G. Burns. 2010. Behavioral plasticity: an interaction between evolution and experience. Evolutionary Ecology 24: 571-583.
Nakata, K. 2007. Prey detection without successful capture affects spider’s orb-web building behaviour. Naturwissenschaften 94: 853-857.
Nakata, K. 2012. Plasticity in an extended phenotype and reversed up- down asymmetry of spider orb webs. Animal Behaviour 83:821-826.
Nakata, K. & A. Ushimaru. 2004. Differences in web construction behavior at newly occupied web sites between two Cyclosa species. Ethology 110:397^11.
314
THE JOURNAL OF ARACHNOLOGY
Pasquet, A., M. Anotaux & R. Leborgne. 201 1. Loss of legs; is it or not a handicap for an orb- weaving spider? Naturwissenschaften 98:557-564.
Reed, C.F., P.N. Witt, M.B. Scarboro& D.B. Peakall. 1970. Experience and the orb web. Developmental Psychobiology 3:251-265.
Skow, C.D. & E.M. Jakob. 2006. Jumping spiders attend to context during learned avoidance of aposematic prey. Behavioral Ecology 17:34-40.
Snell-Rood. E.C. 2013. An overview of the evolutionary causes and con- sequences of behavioural plasticity. Animal Behaviour 85:1004-101 1.
Stephens, D.W. 1991. Change, regularity, and value in the evolution of animal learning. Behavioral Ecology 2:77-89.
Styrsky, J.D. 2014. An orb-weaver spider exploits an ant-acacia mutualism for enemy-free space. Ecology and Evolution 4:276-283.
Vernier, S., A. Pasquet & R. Leborgne. 2000. Web-building behavior in the orb-weaving spider Zygiella \-notata: influence of experi- ence. Animal Behaviour 59:603-611.
Vollrath, F. 1992. Analysis and interpretation of orb spider exploration and web-building behavior. Advances in the Study of Behavior 21:147-199.
Vollrath, F., M. Downes & S. Krackow. 1997. Design variability in web geometry of an orb-weaving spider. Physiology & Behavior 62:735-743.
West-Eberhard, M.J. 2003. Developmental Plasticity and Evolution. Oxford University Press, New York.
Witt, P.N., M.B. Scarboro, R. Daniels, D.B. Peakall & R.L. Cause. 1977. Spider web-building in outer space: evaluation of records from the skylab experiment. Journal of Arachnology 4:115-124.
Zschokke, S. & F. Vollrath. 2000. Planarity and size of orb-webs built by Araneus diadematus (Araneae: Araneidae) under natural and experimental conditions. Ekologia 19:307-318.
Manuscript received 10 January 2014, revised 7 July 2014.
2014. The Journal of Arachnology 42:315-317
SHORT COMMUNICATION
Development of novel microsatellite markers for the spider genus Loxosceles (Sicariidae) using
next-generation sequencing
Enrfc Planas, Laia Bernaus and Carles Ribera: Institut de Recerca de la Biodiversitat (IRBio) and Departament de Biologia Animal, Facultat de Biologia, Universitat de Barcelona, Diagonal 643, 08028, Barcelona. E-mail; cribera@ub.edu
Abstract. We report the step-by-step process of developing de novo microsatellite (SSR) loci in two Loxosceles spider species. We used reads obtained with next-generation sequencing (Roche 454) to select hundreds of potentially-amplifiable SSRs. After testing amplification and cross-amplification, we characterized 18 SSRs, 11 of which were polymorphic in Loxosceles rufescens (Dufour 1820) and seven of which were polymorphic in L. sp. Fuerteventura - Lanzarote. This method is a relatively fast and economic procedure for the development of fast-evolving nuclear markers in spiders.
Keywords: 454, nuclear markers, cross-amplification, Mediterranean, Canary Islands
Microsatellites (SSRs: simple sequence repeats) are popular codominant genetic markers used in many areas of research, including molecular ecology and population genetics. They consist of tandem repeats of very short nucleotide motifs (1-6 bases long). One property that makes SSRs attractive for evolutionary studies is their high mutation rate (Guichoux et al. 2011). However, the technical and economic effort required for developing de novo SSRs in organisms for which no or few genomic resources are available (the so-called non-model organisms) has, until recently, prohibited wide implemen- tation. The recent emergence of next-generation sequencing technol- ogies has reduced the economic and technical difficulties associated with developing SSRs (Santana et al. 2009), and has boosted their usage in a wide range of organisms, including spiders (Esquivel- Bobadilla et al. 2013; Parmakelis et al. 2013), a group in which the development and application of microsatellites has been limited (Brewer et al. 2014),
In this study, we focused on spiders of the genus Loxosceles Heineken & Lowe 1832 (Araneae: Sicariidae) from the Mediterranean Basin and the Canary Islands. Loxosceles rufescens (Dufour 1820) is considered cosmopolitan (World Spider Catalog 2014), but is native to the Mediterranean (Gertsch 1967; Duncan et al. 2010; Planas et al. 2014). In this region, several deep mitochondrial lineages have been detected (Duncan et al. 2010; Planas et al. 2014), some of which lack geographic structure as a consequence of the confounding effects of human-mediated transportation. Recently, Planas and Ribera (2014) discovered an endemic group of seven lineages of Loxosceles spiders in the Canary Islands. The two easternmost islands in this archipelago, Fuerteventura and Lanzarote, harbor one of these identified lineages. Despite the relatively impoverished fauna of Fuerteventura and Lanzarote, these two islands, together with the surrounding islets, have been shown to be ideal systems to study phylogeographical processes (i.e., Bidegaray-Batista et al. 2007; Macias-Hernandez et al. 2013). Here, we acquired fast-evolving nuclear loci for the study of fine-scale evolutionary processes in the Loxosceles species endemic to Fuerteventura - Lanzarote (hereinafter Loxosceles sp. FV-LZ), and for contrasting the mitochondrial patterns observed within L. rufescens across the Mediterranean Basin (Planas et al. 2014).
We used next-generation sequencing to obtain SSRs and describe the step-by-step process from DNA extraction to characterization of selected markers. Genomic DNA was extracted from the legs of three specimens of Loxosceles, two of which belong to two different evolutionary lineages (A6 and B3; Planas et al. 2014) within L.
rufescens, and a third belonging to Loxosceles sp. FV-LZ, using the SpeedTools Tissue DNA Extraction Kit (Biotools) following manu- facturer’s protocols. We conducted pyrosequencing on a Roche Life Science 454 GS-FLX System at the University of Barcelona's Scientific-Technical Services. Roche 454 is a next-generation sequenc- ing technology that obtains larger average fragment sizes, thus increasing the probability that the fragments containing SSRs have flanking regions to enable primer design. We pooled samples using individual multiplex identifiers (MIDs), together with an Echimister sepositus sample (Garcia-Cisneros et al. 2013), within half a plate because physical separation decreases the overall number of sequences obtained. We acquired a total of 143,708 reads with a mean length of 341.86 bp for Loxosceles sp. FV-LZ, 45,377 (mean length 313.91 bp) for L. rufescens A6, and 195,081 (mean length 346.24 bp) for L. rufescens B3.
Raw data were processed with the Roche’s 454 pipeline using default settings for quality control and with seqclean (https:// sourceforge.net/projects/seqclean/) to remove low quality sequences and contaminants. Sequence reads from duplicated loci and mobile elements were identified in iQDD (Meglecz et al. 2010) using default parameters and were excluded from further analyses. We searched for reads with SSRs using iQDD, and retained those meeting a series of requirements suggested by Guichoux et al. (2011). Specifically, we looked exclusively for SSRs with perfect motif repetition, improving the probability that the SSRs follow a stepwise mutation model. We searched for SSRs with a minimum of 1 1 repeats in dinucleotides and eight repeats in tri-, tetra-, penta- and hexanucleotides, but no more than 16 repeats in both cases. Primers for selected SSRs were designed with the software PRIMER 3 (Rozen & Skaletsky 2000) included in iQDD. We avoided designing primers in flanking regions containing short repeats (e.g., nanosatellites), and we selected putative PCR products between 90 and 500 bp in length. Among all possible primer combinations for each SSR, we kept those with better evaluation based on the penalty score of the primer pairs after applying stringent parameters to ensure amplification (i.e., no primer-dimer interaction, similar annealing temperature, GC primer end content, and primer end stability). The number of reads containing SSR and the number of those with suitable Hanking PCR-primer sites are shown in Table 1. Dinucleotides were the most frequent SSR, followed by tri-, tetra-, penta- and hexanucleotides (Table 1 ). Even after applying stringent parameters for SSR selection, we obtained over 800 SSRs that met the requirements specified above. We should note that relaxed selection criteria rigor (e.g., allowing for a minimum number
315
316
THE JOURNAL OF ARACHNOLOGY
Table 1. — Number of reads containing SSRs and number of potentially ampiifiable SSRs. Individual cells in the table record the number of reads obtained from each individual (Loxosceles sp. FV-LZ / L. nifesceiis A6 / L. rufescens B3).
|
Dinucleotides |
Trinucleotides |
Tetranucleotides |
Pentanucleotides |
Hexanucleotides |
|
|
Reads containing SSRs Reads with potentially |
3525/961/4261 |
334/141/673 |
38/34/181 |
3/0/6 |
0/0/1 |
|
ampiifiable SSRs |
327/107/206 |
37/21/87 |
1/1/7 |
1/0/5 |
0/0/0 |
of eight tandem repeats) would have increased substantially the number of yielded SSRs. We selected 58 among the hundreds of candidate SSRs, considering the length of the expected PCR product. We then tested their amplification and cross-amplification success in eight individuals, four from L. rufescens and four from L. sp. FV-LZ. That is, we tested SSRs obtained from reads of L. rufescens for amplification in L. sp. FV- LZ individuals and vice versa. Of the 58 SSRs tested, 40 were rejected because PCR amplification was unsuccessful.
We retained the 1 8 SSR loci with higher amplification success and labeled the forward primers with fluorescent dye. We tested for polymorphism using 38 L. rufescens individuals from four different localities, and 16 Loxosceles sp. FV-LZ individuals from four
different localities. We conducted PCR reactions in a final volume of 10 pL using Biotools Pfu DNA Polymerase (Biotools). Annealing temperatures ranged between 42° and 58° C for all primer pairs. We pooled PCR products according to dye type and expected allele size ranges, and genotyped them in an ABI 3730XLs automated sequencer at Macrogen (Seoul) with the internal size standard 500 LIZ. We used the Microsatellite Plugin 1.3 in Geneious 6.1.6 (Biomatters) for allele calling. For each locus, the primer sequences, number of alleles (Na), and observed (Hq) and expected (He) heterozygosity are listed in Table 2.
All but one SSR were polymorphic for at least one of the two species analyzed. One SSR (ME083) obtained from L. rufescens reads
Table 2. — Characteristics of 18 microsatellite loci, tested with 38 samples of Loxosceles rufescens from four different localities, and 16 samples of Loxosceles sp. FV-LZ from four different localities. Locus name, accession number, repeat motif and primer sequences (F: forward, R: reverse) are listed for each locus. In the last four columns of the table, L. rufescens data are presented in the first row for total number of alleles, allele size (bp), expected heterozygosity (He) and observed heterozygosity (Ho), and Loxosceles sp. FV-LZ in the second row.
|
Locus |
Accession number |
Repeat motif |
Primer sequence (5 '-3') |
Total number of alleles |
Allele size (bp) |
Ho |
He |
|
ME0I2 |
KM879453 |
(AGAT) |
F: GTGGGTGGTCCATTGATAGG |
8 |
137-165 |
0.57 |
0.77 |
|
R: TTTAACAAGACGCAGCGAAA |
- |
- |
- |
- |
|||
|
ME031 |
KM879448 |
(AAAT) |
F: AAACTTCGATTTATTTTGTTTCTTG |
4 |
89-109 |
0.19 |
0.66 |
|
R: AAATGTCTGGCGGATCAGAA |
- |
- |
- |
- |
|||
|
ME034 |
KM879450 |
(AAAT) |
F: CGTCTGCAGTGTGAACGG |
6 |
93-149 |
0.47 |
0.71 |
|
R: ATATGTGCTTTTGCGCCTGT |
- |
- |
- |
- |
|||
|
ME064 |
KM879451 |
(AAAT) |
F: TCTGTAAATGGATTCTCATCTGTTG |
2 |
151-155 |
0.13 |
0.12 |
|
R: TCGTCCAACCATCCTCTTTC |
- |
- |
- |
- |
|||
|
ME067 |
KM879446 |
(AGAT) |
F: TGTGATGTACCTGCGTTCGT |
4 |
142-160 |
0.11 |
0.10 |
|
R: GCAAGATCAACCCACAACCT |
- |
- |
- |
- |
|||
|
ME077 |
KM879454 |
(AAACT) |
F: TATGTAATCACCGGGGTTGG |
3 |
152-177 |
0.21 |
0.55 |
|
R: CGTGCAATCTGGTTAACTTCG |
- |
- |
- |
- |
|||
|
ME083 |
KM879445 |
(ACACT) |
F: TAGGGAATGGAATGGCAGAC |
1 |
160-160 |
0 |
0 |
|
R: TTTGCAGATTTGATCTGGGAC |
1 |
163-163 |
0 |
0 |
|||
|
ME088 |
KM879449 |
(AAAT) |
F: AGCGTTGATACAGGTGGTCC |
3 |
208-254 |
0.10 |
0.59 |
|
R: TCACTGCACAGTGTAAAGCCA |
- |
- |
- |
- |
|||
|
ME103 |
KM879452 |
(AAT) |
F: TTAGCGACCTTCCCTGTCAC |
6 |
262-280 |
0.34 |
0.73 |
|
R: TGGTAAACGGGAGGACTAGG |
- |
- |
- |
- |
|||
|
ME113 |
KM879447 |
(AAT) |
F: AACCTGAAGGGCTGATGAAT |
6 |
75-96 |
0.37 |
0.78 |
|
R: CAGGAGCAGGATGCCATATT |
- |
- |
- |
- |
|||
|
CAOOl |
KM879461 |
(AAT) |
F: ATGTATCACGCGCCTTTTG |
- |
- |
- |
- |
|
R: GTTGTCTGGAGCAAACAGCA |
5 |
75-93 |
0.60 |
0.72 |
|||
|
CA003 |
KM879460 |
(AAT) |
F: TGTACCAGGGGCTGGTCTAA |
- |
- |
- |
- |
|
R: CATACGTGGTGGCAGCATAC |
5 |
66-92 |
0.28 |
0.73 |
|||
|
CA027 |
KM879457 |
(AAGTG) |
F; TACCACAAGGGGAGAATCCA |
3 |
103-113 |
0.39 |
0.32 |
|
R: AAGCCAGAGGTGCAATTGTT |
10 |
132-182 |
0.40 |
0.79 |
|||
|
CA030 |
KM879462 |
(AAT) |
F: AGGTGTGGCACTACCGTTTT |
- |
- |
- |
- |
|
R: CAAATGAGCATTCAACCTCG |
7 |
133-157 |
0.46 |
0.70 |
|||
|
CA038 |
KM879458 |
(AAT) |
F: ATGTTTGAGGGGTCTCGTTG |
- |
- |
- |
- |
|
R: ACATGATGCCCCACGATAAT |
4 |
272-284 |
0.93 |
0.69 |
|||
|
CA105 |
KM879455 |
(AC) |
F: TAAATAACCTGATATCGGATCTATGAC |
- |
- |
- |
- |
|
R: AAAGTATATCGGACAAACATCCAACC |
5 |
255-267 |
0.75 |
0.75 |
|||
|
CA238 |
KM879459 |
(AG) |
F: GGCACCCCAGACTAACAAGA |
1 |
233-233 |
0.00 |
0.00 |
|
R: ACCTCTGGCACGAATACACC |
4 |
221-231 |
0.93 |
0.69 |
|||
|
CA243 |
KM879456 |
(AT) |
F: AATAACGGAGACCGTGCAAC |
5 |
225-279 |
0.68 |
0.64 |
|
R: CCTCCAGTATCCGAAGACGA |
- |
- |
- |
- |
PLANAS ET AL.— MICROSATELLITE MARKERS FOR LOXOSCELES
317
amplified successfully in Loxosceles sp. FV-LZ individuals, although it was monomorphic in both species. Three SSRs obtained from L. sp. FV-LZ reads amplified successfully in L. rufescens, and was monomorphic in one locus (CA238) and polymorphic in the other two loci (CA027 and CA243). In total, 11 polymorphic SSRs were developed for L. rufescens and seven for L. sp. FV-LZ.
Results from this study suggest that next-generation sequencing is an efficient and cost-effective procedure for the fast development of microsatellite loci in spiders. Despite the close phylogenetic relation- ship of the two species used in this study {Planas & Ribera 2014), the cross-amplification rate for the microsatellites was low. The few SSRs that cross-amplified successfully were found to be monomorphic or less polymorphic in the species from which they were not initially obtained (except for CA243). Thus, we advise developing specific microsatellites for each target species. We obtained thousands of reads by sequencing three Loxosceles specimens in half a Roche 454 plate, and we used a fast bioinformatic pipeline applying stringent selection criteria to identify hundreds of potentially amplifiable SSRs. Although 454 sequencing was preferred for the longer read lengths obtained which facilitates the design of PCR primers, a similar approach for SSR development has been successfully implemented using alternative, more cost-effective sequencing technologies (i.e., Illumina) (Castoe et al. 2012, but see Drechsler 2013).
ACKNOWLEDGMENTS
We are grateful to B. Fuste, A. Garcia-Cisneros and R. Perez- Portela for providing advice during the initial steps of the study, and M. Metallinou and E.E. Saupe for reviewing language usage. Funding for this research was provided by CGL2008-03385 Project (Ministerio de Ciencia y Tecnologia, Spain). E.P. was supported by a FPI grant from the Ministerio de Ciencia y Tecnologia, Spain (BES-2009- 015871).
LITERATURE CITED
Bidegaray-Batista, L., N. Macias-Hernandez, P. Oromi & M.A. Arnedo. 2007. Living on the edge: demographic and phylogeo- graphical patterns in the woodlouse-hunter spider Dysdera kmcerotensis Simon, 1907 on the eastern volcanic ridge of the Canary Islands. Molecular Ecology 16:3198-3214.
Brewer, M.S., D.D. Cotoras, P.J. Croucher & R.G. Gillespie. 2014. New sequencing technologies, the development of genomics tools, and their applications in evolutionary arachnology. Journal of Arachnology 42:1-15.
Castoe, T.A., A.W. Poole, A.P.J. de Koning, K.L. Jones, D.F. Tomback & S.J. Oyler-McCance et al. 2012. Rapid microsatellite identification from Illumina paired-end genomic sequencing in two birds and a snake. PloS One 7:e30953.
Drechsler, A., D. Geller, K. Freund, D.S. Schmeller, S. Kiinzel & O. Rupp et al. 2013. What remains from a 454 run: estimation of success rates of microsatellite loci development in selected newt species (Calotriton asper, Lisso triton helveticus, and Tritiirus cristatus) and comparison with Illumina based approaches. Ecology and Evolution 3:3947-3957.
Dufour, L. 1820. Descriptions de cinq arachnides nouvelles. Amiales Generales des Sciences Physiques 5:198-209.
Duncan, R.P., M.R. Rynerson, C. Ribera & G.J. Binford. 2010. Diversity of Loxosceles spiders in Northwestern Africa and molecular support for cryptic species in the Loxosceles rufescens lineage. Molecular Phylogenetics and Evolution 55:234-248.
Esquivel-Bobadilla, S., O.A. Lozano-Garza, F.J. Garcia-De-Leon, I.D.L.A. Barriga-Sosa & M.L. Jimenez. 2013. Development and characterization of 14 microsateliite loci in the beach wolf spider [Arctosa littoralis), using next-generation sequencing. Conserva- tion Genetics Resources 5:261-263.
Garcia-Cisneros, A., C. Valero-Jimenez, C. Palacin & R. Perez- Portela. 2013. Characterization of thirty two microsatellite loci for three Atlanto-Mediterranean echinoderm species. Conservation Genetics Resources 5:749-753.
Gertsch, W.J. 1967. The spider genus Loxosceles in South America (Araneae, Scytodidae). Bulletin of the American Museum Natural History 136:117-174.
Guichoux, E., L. Lagache, S. Wagner, P. Chaumeil, P. Leger & O. Lepais et al. 2011. Current trends in microsateliite genotyping. Molecular Ecology Resources 11:591-611.
Lowe, R.T. 1832. Descriptions of two species of Araneidae, natives of Madeira. The Zoological Journal 5:320-323.
Macias-Hernandez, N., L. Bidegaray-Batista, P. Oromi & M.A. Arnedo. 2013. The odd couple: contrasting phylogeographic patterns in two sympatric sibling species of woodlouse-hunter spiders in the Canary Islands. Journal of Zoological Systematics and Evolutionary Research 5:29-37.
Meglecz, E., C. Costedoat, V. Dubut, A. Gilles, T. Malausa & N. Pech et al. 2010. QDD: a user-friendly program to select microsateliite markers and design primers from large sequencing projects. Bioinformatics 26:403-404.
Parmakelis, A., K. Balanika, S. Terzopoulou, F. Rigal, R.R. Beasley & K.L. Jones et al. 2013. Development of 28 polymorphic microsateliite markers for the endemic Azorean spider Sancus acoreensis (Araneae, Tetragnathidae). Conservation Genetics Resources 5:1133-1134.
Planas, E. & C. Ribera. 2014. Uncovering overlooked island diversity: colonization and diversification of the medically important spider genus Loxosceles (Arachnida: Sicariidae) on the Canary Islands. Journal of Biogeography 41:1255-1266.
Planas, E., E.E. Saupe, M.S. Lima-Ribeiro, A.T. Peterson & C. Ribera. 2014. Ecological niche and phylogeography elucidate complex biogeographic patterns in Loxosceles rufescens (Araneae, Sicariidae) in the Mediterranean Basin. BMC Evolutionary Biology 14:195.
Rozen, S. & H. Skaletsky. 2000. Primer3 on the WWW for general users and for biologist programmers. Methods Molecular Biology 132:365-386.
Santana, Q.C., M.P. Coetzee, E.T. Steenkanip, O.X. Mlonyeni, G.N. Hammond & M.J. Wingfield et al. 2009. Microsateliite discovery by deep sequencing of enriched genomic libraries. Biotechniques 46:217-223.
World Spider Catalog. 2014. World Spider Catalog, Version 15.5. Natural History Museum Bern. Online at http://wsc.nmbe.ch
Manuscript received 19 December 2013, revised 17 September 2014.
2014. The Journal of Arachnology 42:318-321
SHORT COMMUNICATION
Pre-ballooning in Ummidia Thorell 1875 (Araneae: Ctenizidae) from the Interior Highlands, USA: second accoont from the region and review of mygalomorph ballooning
J. Ray Fisher, Danielle M. Fisher, Michael J. Skvarla and Ashley P. G. Dowling: Department of Entomology, University of Arkansas, Fayetteville, Arkansas, 72701, USA. Email: jrfisher@uark.edu
Abstract. The present study represents the second record of pre-ballooning behavior in Arkansas Ummidia Thorell 1875 (Ctenizidae). Mygalomorph ballooning is discussed and our observations are compared with previous authors’ observations. Photographs and video of the behavior are included. Images and discussion are provided detailing genus- level identification of the spiderlings.
Keywords: Trapdoor spider, aerial dispersal, videography
Although most non-araneomorph spiders do not disperse aerially like many araneomorphs, ballooning has been recorded from mygalomorphs in three families. Bel! (2005) reviewed ballooning accounts across arthropods and listed five mygalomorph ballooners: Missulena insignis (Cambridge 1877) (Actinopodidae); Atypus affinis Eichwald 1830 and Sphodros atkmticus Gertsch & Platnick 1980 (Atypidae); and Conothele malayana (Doleschall 1859) and Ummidia Thorell 1875 (Ctenizidae). This list combined accounts of confirmed ballooning (M insignis [Main 1976, 1981; Brunet 1994]; 5. atlanticus [Coyle 1983, Coyle et al. 1985]; and an unidentified Ummidia [Coyle 1985]), as well as pre-ballooning accounts without observed ballooning (A. affinis [Enock 1885; Bristowe 1941]; S. rufipes (Latreille 1829) [Muma & Muma 1945]; C. malayana [Main 1957, 1976]; and U. carabivora (Atkinson 1886) [Baerg 1928]). Additionally, Eberhard (2005) described ballooning in Costa Rican Ummidia. Main (1981) noted the oddity that Missulena Walckenaer 1805 and Actinopus Perty 1833 have similar distributions across Australia, even though Actinopus was not known to balloon. Solving this mystery and adding to the list of ballooning mygalomorphs, Ferretti et al. (2013) confirmed ballooning in an unidentified Actinopus. Most of these species have in common large ranges that cross water barriers, including accounts on islands (e.g., Ummidia from St. Vincent [Simon 1891]; Conothele from Pacific Islands and Seychelles [Pocock 1898; Berlaiid 1938; Roewer 1963, Saaristo 2002]).
The present study provides information for Ummidia, which are the most common ctenizids in the eastern U.S. They are immediately identifiable by a dorsal saddle-shaped indention on the third tibiae, which has been suggested to aid in securing them in the burrow (Coyle 1981). There are 25 described species of Ummidia, with 18 in the New World (10 USA, five Centra! America, three South America) and seven in the western Mediterranean (Platnick 2014). However, perhaps as many as 100 (Platnick, via Bond & Coyle 1995) are left undescribed (Bond & Hendrixson 2005). The trans-Atlantic distribu- tion has traditionally been considered the result of human introduc- tion, but this hypothesis was recently rejected with molecular evidence (Opatova et al. 2013). Instead, Ummidia were likely widespread in Laurasia, rendering Old World species much older than previously suspected. Interestingly, unlike other organisms, New and Old World lineages diverged later than the breakup of Laurasia, which the authors attributed to gene flow on either side of the newly opening Atlantic ocean due to the ability of Ummidia to disperse by ballooning. A related genus, Conothele, has a non-overlapping Australasian distribution and the characters differentiating Conothele from Ummidia are variable (Main 1985), leaving geography and burrow construction as the best distinguishers (Haupt 2005; Decae
2010). Further, the molecular analyses of Opatova et al. (2013) ji showed only a small amount of divergence between Conothele and j
Ummidia. In short, there is great need for a revision of New World jj
Ummidia, as well as phylogenetic investigation of the generic complex [ {Conothele -t Ummidia), at which point, Conothele will likely be ! lumped with Ummidia. Ballooning by Conothele spiderlings is currently unknown.
Field photographs and video were taken with an iPhone 4S, which ' was the only camera available at the time, highlighting an example of ' such technology used for natural history. Video taken of this behavior can be found at https://www.youtube.com/watch?v=gleB4sIrDQw. [ The video was compiled with Adobe Premiere Pro CS6. Morpholog- E ical images were montaged from many stereomicrographs (20-30 for t habitus and 8-14 for appendages) using Helicon Focus 6. !|
Following the accounts of Baerg (1928), this study presents the i|
second record of pre-ballooning behavior of Arkansas Ummidia. On i[
the afternoon (15:00-16:00) of 22 March 2014, on a trail that | paralleled a paved road (100-200 m away) at Devil’s Den State Park, Arkansas (35° 46' 51.54"N 94° 15' 22.74"W; elev. 395 m), six Ummidia \ spiderlings were observed climbing an oak (Qiiercus, Diameter at | Breast Height (DBH) approx. 24 cm) on a vertical 2-6 mm wide silk band. The silk band rose approximately 6 m along the trunk and then continued along a horizontal limb where it bifurcated several times and was eventually lost after about 2 m (Fig. lA, C). The observation spanned approximately 30 min, although all six spiderlings were discovered in the first 5 min. The oak was atop a steep slope that overlooked a valley and was therefore exposed to wind gusts *
(Fig. IB). Other conditions were as follows: 13°-15°C; wind 1.8- j
4.5 m/s; recently turned cloudy, prior to light rain. At the base of the j.
tree the silk band apered to a few strands, where it was soon lost; not j
even single-strands could be found (Fig. IE). Although we have I
previously found Ummidia burrows on steep slopes in the area, careful examination of the area surrounding the ballooning tree failed to uncover either the maternal burrow, or ground silk trails. Ballooning spiderlings were not directly observed, but this silk [
band-making behavior as an antecedent to ballooning in Ummidia is [
well known (Coyle 1985, Eberhard 2005). [
Most of these observations conform to what has been previously ^ described for Ummidia by Baerg (1928) and Coyle (1985). Compared with most observations of mygalomorph ballooning, the pre- ; ballooning bands observed by Baerg (1928) in Arkansas were much | longer both horizontally on the ground leading from the maternal burrow to the ballooning tree (3-21 m; 8.5 m avg.) and vertically along the ballooning tree (4-9 m). For example, the band observed by [ Coyle (1985) was only 0.9 m vertically on a tombstone and 1.5 m |
318
FISHER ET AL.— PRE-BALLOONING IN UMMIDIA SPIDERS
319
Figure 1. — Ballooning site. A. south-facing view of ballooning tree overlooking the valley; B. east-facing view of ballooning tree depicting steep slope; C. pre-ballooning silk band on trunk, leading to horizontal limb; D. spiderling climbing pre-ballooning band; E. base of tree showing pre-ballooning band diffusing quickly into litter. Red arrows indicate ballooning limb.
horizontally on the ground. Our observations are similar to Baerg's in the following ways; emergence date (15-22 March); silk band width (2 mm) and height (4-9 m); silk band ending on a horizontal limb; and tree size (not less than 15 cm DBH). The present observation occurred in the afternoon and Baerg (1928) described primarily morning activity ending mid-day. However, given the sparse activity and well-developed silk band, we suspect these individuals represent- ed the last members of a ballooning event.
Steep slopes of sparsely wooded, disturbed habitats are commonly noted as preferred Unimidia habitat. Baerg (1928) made many pre- ballooning observations over several years on the University of Arkansas (UA) campus, which certainly was disturbed and sparsely wooded, but lacked steep slopes. Despite continued searching over five years, we failed to find either burrows or ballooning spiderlings in the area surrounding campus, which suggests a significantly
diminished population since 1928. However, we have found many Unuuidia burrows on steep slopes in second-growth oak/hickory forest of northwestern Arkansas, including at Devil’s Den State Park. The presence of pre-ballooning behavior similar to Baerg’s observa- tions (i.e., long silk trails) in naturalized forest, which is much less open than UA’s campus, confirms the use of this method outside of an urbanized setting. That said, because of the position of the ballooning tree (Fig. lA, B) and time of year (i.e., pre-bud-break), once acquiring their position on the horizontal limb, the spiderlings were functionally in an open area for ballooning.
With regard to identification, Baerg (1928) suggested that U. carahivora, known from the east coast, was actually widespread in the U.S. and identified his Arkansas specimens as this species. Indeed, as discussed above, aerial dispersal does enable large distributions. However, several pieces of evidence suggest that the spiderlings we
320
THE JOURNAL OF ARACHNOLOGY
Figure 2. — Spiderling genus-level identification. A. dorsal habitus; B. lateral prosoma (right appendages removed), note ocular tubercle (arrow); C. pedipalp, note single clavate trichobothriimi (dotted arrow) and ventral curvy spines (arrows); D. leg III, note trochanteral apophysis (dotted arrow) and tibial depression (arrow); E. eye group. Not to scale.
observed may not be U. carabivora. First, Ummidia is already suspected to contain considerable undescribed diversity. Second, specimens from this region exhibit longer pre-ballooning bands than what has been previously described for the genus. And third, the Interior Highlands are known to have a high rate of endemism (Redfearn 1986; Allen 1990; Robison & Allen 1995; Skvarla et al. 2013), but these endemics are often overlooked by surveys and specimens from the region are rarely included in phylogenetic analyses. Ultimately, a large-scale, integrative investigation of the genus in the New World is needed before confidence in species identification is warranted. Therefore, we refrain from suggesting species identification at this time, but offer the following discussion on genus-level identification of juvenile Ummidia.
Juvenile morphology in most animals (including spiders) is regularly overlooked, despite juveniles of certain taxa being frequently noticed and collected. This is evidenced by the prevalence of amateur naturalists not only photographing spiderlings, but also documenting pre-ballooning behavior in Ummidia on websites like Flickr.com and Bugguide.net. However, we are not aware of primary literature containing useable information on the identification of Ummidia immatures.
Decae (2010) lists five characteristics that differentiate ummidiines {Ummidia -h Conothele) from other ctenizids as follows: 1) proximal dorsal glaborous depression on tibia III; 2) sharp apophysis on dorsolateral trochanter III; 3) dorsal clavate trichobothria on tarsi; 4) lateral curvy spines on distal podomeres of leg I, II, and pedipalps; and 5) compact eye-group (Fig. 2E) on an ocular tubercle (Fig. 2B). Each of these characters is apparent in the spiderling, although the trochanteral apophysis (Fig. 2D) and curvy spines (Fig. 2C) are not fully developed. Additionally, clavate trichobothria are absent from the legs, but a single clavate trichobothrium (Fig. 2C) is present on pedipalpal tarsi and is proportionally larger than on adult specimens. Noteworthy are the readily apparent tibial depressions commonly implemented as a diagnostic character for adults (Fig. 2D).
LITERATURE CITED
Allen, R.T. 1990. Insect endemism in the Interior Highlands of North America. Florida Entomologist 73:539-569.
Baerg, W.J. 1928. Some studies of a trapdoor spider (Araneae: Aviciilariidae). Entomological News 39:1^.
FISHER ET AL.— PRE-BALLOONING IN UMMIDIA SPIDERS
Bell, J.R., D.A. Bohan, E.M. Shaw & G.S. Weyman. 2005. Ballooning dispersal using silk: world fauna, phylogenies, genetics and models. Bulletin of Entomological Research 95:69-1 14.
Berland, L. 1938. Araignees des Nouvelles Hebribes. Annales de la Societe Entomologique de France 107:129-131.
Bond, J.E. & F.A. Coyle. 1995. Observations on the natural history of an Ummidia trapdoor spider from Costa Rica (Araneae, Ctenizi- dae). Journal of Arachnology 23:157-164.
Bond, J.E. & B.E. Hendrixson. 2005. Pp. 43^4. In Spiders of North A,merica: an identification manual. (D. Ubick, P. Paquin, P.E. Cushing & V. Roth, eds.). American Arachnological Society.
Bristowe, W.S. 1941. The Comity of Spiders. Ray Society, London.
Brunet, B. 1994. The Silken Web. Reed Books, Sydney.
Coyle, F.A. 1981. Notes on the behaviour of Ummidia trapdoor spiders (Araneae, Ctenizidae): burrow construction, prey capture, and the functional morphology of the peculiar third tibia. Bulletin of the British Arachnological Society 5:159-165.
Coyle, F.A. 1983. Aerial dispersal by mygalomorph spiderlings (Araneae, Mygalomorphae). Journal of Arachnology 11:283-286.
Coyle, F.A. 1985. Ballooning behavior of Ummidia spiderlings (Araneae, Ctenizidae). Journal of Arachnology 13:137-138.
Coyle, F.A., M.H. Greenstone, A-L. Hultsch & C.E. Morgan. 1985. Ballooning mygalomorphs: estimates of the masses of Sphodros and Ummidia ballooners (Araneae: Atypidae, Ctenizidae). Journal of Arachnology 13:291-296.
Decae, A.E. 2010. The genus Ummidia Thorell 1875 in the western Mediterranean, a review (Araneae: Mygalomorphae: Ctenizidae). Journal of Arachnology 38:328-340.
Eberhard, W.G. 2005. Dispersal by Ummidia spiderlings (Araneae, Ctenizidae): ancient roots of aerial webs and orientation? Journal of Arachnology 34:254-257.
Enock, F. 1885. The life-history of Atypus piceus, Sulz. Transactions of the Entomological Society of London 1885:389-420.
Ferretti, N., G. Pompozzi, S. Copperi & L. Schwerdt. 2013. Aerial dispersal by Actimpus spiderlings (Araneae: Actinopodidae). Journal of Arachnology 41:407^08.
Haupt, J. 2005. On the taxonomic position of the East Asian species of the genus Ummidia Thorell, 1875 (Araneae: Ctenizidae). European Arachnology. In European Arachnology 2005. (C. Deltshev & P. Stoev, eds.). Acta Zoologica Bulgarica, Supple- mentum 1:77-79.
Main, B.Y. 1957. Occurrence of the trap-door spider Conothele malayana (Doleschall) in Australia (Mygalomorpha: Ctenizidae). Western Australian Naturalist 5:209-216.
321
Main, B.Y. 1976. Spiders. Collins, Sydney.
Main, B.Y. 1981. Australian spiders: diversity, distribution and ecology. Pp. 808-852. In Ecological Biogeography of Australia. (A. Keast, ed.). Junk, The Hague.
Main, B.Y. 1985. Further studies on the systematics of ctenizid trapdoor spiders: a review of the Australian genera (Araneae: Mygalomorphae: Ctenizidae). Australian Journal of Zoology, Supplement 108:1-84.
Muma, M.H. & K.E. Muma. 1945. Biological notes on Atypus bicolor Lucas (Arachnida). Entomolgical News 56:122-126.
Opatova, V., J.E. Bond & M.A. Arnedo. 2013. Ancient origins of the Mediterranean trap-door spiders of the family Ctenizidae (Ara- neae, Mygalomorphae). Molecular Phylogenetics and Evolution 69:1135-1145.
Pocock, R.I. 1898. Scorpions, pedipalpi and spiders collected by Dr. Willey in New Britain, the Salomon Islands, Loyalty Islands etc. In Willey A. Zoological results based on material from New Britain, New Guinea, Loyalty Islands and elsewhere, collected during the years 1895, 1896 and 1897, by Arthur Willey. Vol. I. University Press, Cambridge.
Platnick, N.I. 2014. The world spider catalog, version 15. American Museum of Natural History, Online at http://research.amnh.org/ entomology/spiders/catalog/index.html DOI: 10.553 1/db.iz. 0001 .
Redfearn, P.L., Jr. 1986. Bryogeography of the Interior Highlands of North America: taxa of critical importance. Bryologist 89:32-34.
Robison, H.W. & R.T. Allen. 1995. Only in Arkansas. A Study of the Endemic Plants and Animals of the State. The University of Arkansas Press, Fayetteville, Arkansas.
Roewer, C.F. 1963. Araneina: Orthognatha, Labidognatha. Insects of Micronesia 3:104-132.
Saaristo, M.I. 2002. New species and interesting new records of spiders from Seychelles (Arachnida, Araneaea [sic]). Phelsuma 10, Supplement: A 1-31.
Simon, E. 1891. On the spiders of the island of St. Vincent. Part 1. Proceedings of the Zoological Society of London 1891:549-575.
Skvarla, M.J., J.R. Fisher & A.P.G. Dowling. 2013. On some mites (Acari: Prostigmata) from the Interior Highlands: descriptions of the male, immature stages, and female reproductive system of Pseiidocheylus ameri twins (Ewing, 1909) and some new state records for Arkansas. Zootaxa 3641:401-419.
Manuscript received 15 July 2014, revised 11 September 2014.
2014. The Journal of Arachnology 42:322-323
INSTRUCTIONS TO AUTHORS
(revised November 2014)
General: The Journal of Arachnology publishes scientific articles reporting novel and significant observations and data regarding any aspect of the biology of arachnid groups. Feature articles and short communications must be scientifically rigorous and report substantially new infomiation. Submissions that are overly narrow in focus (e.g., local faunal lists, descriptions of a second sex or of a single species without additional discussion of the significance of this infomiation), have poorly substantiated observational data, or that present no new information will not be considered. Book reviews will not be published.
Manuscripts must be in English and should be prepared in general accordance with the current edition of the Council of Biological Editors Style Manual unless instructed otherwise below. Use the active voice throughout. Authors should consult a recent issue of the Journal of Arachnology for additional points of style. Manuscripts longer than three printed journal pages (12 or more double-spaced manuscript pages) should be prepared as Feature Articles, shorter papers as Short Communications. Review Articles will be published from time to time. Suggestions for review articles may be sent to the Managing Editor. Unsolicited review articles are also welcomed. All review articles will be subject to the same review process as other submissions.
Submission: Submissions must be sent electronically in Microsoft Word foraiat (not PDF) to the Managing Editor of the Journal of Arachnology: Richard S. Vetter, Managing Editor, Department of Entomology, University of California, Riverside, CA USA 92521 [E-mail: rick.vetter(@ucr.edu]. The entire manuscript should be submitted as one Word document. Figures, included in the Word document, should be at low resolution for the initial review.
The Managing Editor will acknowledge receipt of the manuscript, assign it a manuscript number and forward it to an Associate Editor for the review process. Correspondence relating to manuscripts should be directed to the Associate Editor and should include the manuscript number. If the manuscript is accepted, the author will be asked to submit the final copy electronically to the Associate Editor. Submission of final illustrations is detailed below. Authors are expected to return revisions promptly. Revised manuscripts that are not returned in a reasonable time period (no longer than six months for minor revisions and one year for major revisions) will be considered new submissions.
Voucher Specimens: Specimens of species used in your research should be deposited in a recognized scientific institu- tion. All type material must be deposited in a recognized collection/institution.
FEATURE ARTICLES
Title page. — The title page includes the complete name, address, and telephone number of the corresponding author; a FAX number and electronic mail address if available; the title in sentence case, with no more than 65 characters and spaces per line in the title; each author’s name and address; and the running head.
Running head. — The author’s surname(s) and an abbreviat- ed title should be typed in all capital letters and must not i: exceed 60 characters and spaces. The running head should be placed near the top of the title page.
Abstract. — Length: < 250 words for Feature Articles; <150 ■
words for Short Communications.
Keywords. — Give 3-5 appropriate keywords or phrases following the abstract. Keywords should not duplicate words in the title.
Text. — Double-space text, tables, legends, etc. throughout. ; Except for titles and headers, all text should be left-justified. |' Add line numbers, continuous from the first page. Three levels ! of heads are used.
• The first level (METHODS, RESULTS, etc.) is typed in i
capitals and centered on a separate line. '
• The second level head begins a paragraph with an indent :i
and is separated from the text by a period and a dash. ■
• The third level may or may not begin a paragraph but is ■
italicized and separated from the text by a colon. "
Use only the metric system unless quoting text or refe- '' Fencing collection data. If English measurements are used when I referencing collection data, then metric equivalents should also j be included parenthetically. All decimal fractions are indicated i by a period (e.g., —0.123). Include geographic coordinates for collecting locales if possible, using one of the following formats: I
0°12'32"S, 29°52'17"E or 0.2089°S, 29.8714°E. i
Citation of references in the text: Cite only papers already published or in press. Include within parentheses the surname of the author followed by the date of publication. A comma separates multiple citations by the same author(s) and a semicolon separates citations by different authors, e.g., (Smith j
1970), (Jones 1988; Smith 1993), (Smith & Jones 1986, 1987; 1
Jones et al. 1989). Include a letter of permission from any |
person who is cited as providing unpublished data in the form :
of a personal communication. ;
Citation of taxa in the text: Include the complete taxonomic citation (author & year) for each arachnid taxon when it first appears in the abstract and text proper. For example, Araneus diadematus Clerck 1757. For Araneae, this information can be found online at www.wsc.nmbe.ch. Citations for ,
scorpions can be found in the Catalog of the Scorpions of the S
World (1758-1998) by V. Fet, W.D. Sissom, G. Lowe & ^
M.E. Braunwalder. Citations for the smaller arachnid orders (pseudoscorpions, solifuges, whip scorpions, whip spiders, i;
schizomids, ricinuleids and palpigrades) can be found at museum. wa.gov.au/catalogues-beta/. Citations for some species of Opiliones j can be found in the Annotated Catalogue of the Laniatores of the li New World (Araclmicki, Opiliones) by A.B. Kury. |
Literature Cited. — Use the following style and fonnatting exactly as illustrated; include the full unabbreviated journal i title. Personal web pages should not be included in Literature Cited. These can be cited within the text as (John Doe, pers. ! website) without the URL. Institutional websites may be 1 included in Literature Cited. If a citation includes more than ,
322
INSTRUCTIONS TO AUTHORS
323
six authors, list the first six and add “et al.” to represent the others.
Binford, G. 2013. The evolution of a toxic enzyme in sicariid spiders. Pp. 229-240. In Spider Ecophysiology. (W. Nentwig, ed.). Springer-Verlag, Heidelberg.
Cushing, P.E., P. Casto, E.D. Knowlton, S. Royer, D. Laudier, D.D. Gaffm et al. 2014. Comparative morphology and functional significance of setae called papillae on the pedipalps of male camel spiders (Arachnida, Solifugae). Annals of the Entomological Society of America 107:510-520.
Harvey, M.S. & G. Du Preez. 2014. A new troglobitic ideoroiicid-pseudoscorpion (Pseudoscorpiones: Ideoroncidae) from southern Africa. Journal of Arachnology 42:105-1 10. Platnick, N.I. 2014. The World Spider Catalog, Version 15.0. American Museum of Natural History, New York. Online at http ://research . amnh . org/iz/spiders/catalog/
Roewer, C.F. 1954. Katalog der Araneae, Volume 2a. Institut Royal des Sciences Naturelles de Belgique, Bruxelles. Rubio, G.D., M.O. Arbino & P.E. Cushing. 2013. Ant mimicry in the spider Myrmecotypus iguazu (Araneae: Corinnidae), with notes about myrmecomorphy in spiders. Journal of Arachnology 41:395-399.
Footnotes. — Footnotes are permitted only on the first printed page to indicate current address or other infomiation concern- ing the author. All footnotes are placed together on a separate manuscript page. Tables and figures may not have footnotes.
Taxonomic articles. — Consult a recent taxonomic article in the Journal of Arachnology for style or contact the Subject Editor for Taxonomy and Systematics. Papers containing original descriptions of focal arachnid taxa should be listed in the Literature Cited section.
Tables. — Each table, with the legend above, should be placed on a separate manuscript page. Only horizontal lines (no more than three) should be included. Tables may not have footnotes; instead, include ail information in the legend.
Illustrations. — Original illustrations should be sent electron- ically as part of the Word document when the_ manuscript is submitted. Distribution maps should be considered figures and numbered consecutively with other figures. (Authors wishing to submit figures as hard copies should contact the Editor-in-Chief for specifications.) At the submission and review stages, the resolution should be low while still allowing editors and reviewers to view figures effectively. Final illustrations must be submitted to the Editor-in-Chief, typically by e-mail or on a CD, to ensure that the electronic versions meet publication standards and that they match the printed copy. All figures should be 10-18 cm (4-7 inches) wide and no more than 23 cm (9 inches) high. The resolution should be at least 300 dpi (or ppi) for halftone or color figures and 1200 dpi for line drawings. A Guide to the Digital Art Specs for Allen Press is available as a PDF online at: http://allenpress.com/resources/library. At the discretion of the Editor-in-Chief, a figure can be rendered in color in the online version but in monochrome in the journal’s printed version, or in color in both versions if warranted by the figure’s context and content. Most figures will be reduced to single-column width (9 cm, 3.5 inches), but large plates can be printed up to two- columns width (18 cm, 7 inches).
Address all questions concerning illustrations to the Editor- in-Chief of the Journal of Arachnology: Robert B. Suter, Editor-In-Chief, Biology Department, Vassar College, 124 Raymond Ave,, Poughkeepsie, NY 12604-0731, USA [E-mail: siiter@vassar.edu]
Legends for illustrations should be placed together on the same page(s) and also with each illustration. Each plate must have only one legend, as indicated below:
Figures 1^. A-us x-us, male from Timbuktu. 1, Left leg; 2, Right chelicera; 3, Dorsal aspect of genitalia; 4, Ventral aspect of abdomen. Scale = 1.0 mm.
The following alternate Figure numbering is also acceptable:
Figures la-e. A-us x-us, male from Timbuktu, a. Left leg; b. Right chelicerae; c. Dorsal aspect of genitalia; d. Ventral aspect of abdomen. Scale = 1.0 mm.
Assemble manuscript. — The manuscript should appear in separate sections or pages in the following sequence: title page, abstract, text, tables with legends, figure legends, figures. Send entire manuscript, including figures, as one Microsoft Word document. Note: please downsize the figures if the document is too large to conveniently send by e-mail.
Supplemental materials. — Authors may submit for online publication materials that importantly augment the contents of a manuscript. These may be audio files (e.g., .mp3, .m4a, .aif, .wav), video files (e.g., .mov, .m4v, .flv, .avi), or Word documents (e.g., .doc, .docx) for large tables of data. Consult with the Editor in Chief if you are considering submitting other kinds of files. Audio and video files should be carefully edited before submission to eliminate leaders, trailers, and other extraneous content. Individual files may not exceed 10MB; no more than five files may be included as supplemental materials for a manuscript. Supplemental materials will be considered by reviewers and therefore must be submitted at the time of manuscript submission. Supplemental materials are published online at the discretion of the editors.
Page charges, proofs and reprints. — Page charges are voluntary, but non-members of AAS are strongly encouraged to pay in full or in part for their article ($75 / journal page). The author will be charged for excessive numbers of changes made in the proof pages. Hard copy or PDF reprints are available only from Allen Press and should be ordered when the author receives the proof pages. Allen Press will not accept reprint orders after the paper is published. The Journal of Arachnology also is available through www.bioone.org and www.jstor.org. Therefore, you can download the PDF version of your article from one of these sites if you or your institution is a member. PDFs of articles older than one year will be made freely available from the AAS website.
SHORT COMMUNICATIONS
Short Communications are usually limited to three journal pages, including tables and figures (1 1 or fewer double-spaced manuscript pages including Literature Cited; no more than 2 small figures or tables). Internal headings (METHODS, RESULTS, etc.) are omitted. Short communications must include an abstract and keywords.
COVER ARTWORK
Authors are encouraged to send high quality color photographs to the editor-in-chief to be considered for use on the cover. Images should be at least 300 dpi.
CONTENTS
Journal of Arachnology
Volume 42
SMITHSONIAN LIBRARIES
3 9088 01788 6649
Number 3
Featured Articles
Troglomorphic pseudoscorpions (Arachnida: Pseudoscorpiones) of northern Arizona, with the description of two new
short-range endemic species
by Mark S. Harvey & J. Judson Wynne 205
A new genus and a new species of scorpion (Scorpiones: Buthidae) from southeastern Mexico
by Oscar F. Francke, Rolando Teruel & Carlos Eduardo Santibanez-Lopez 220
Description of Sarax buxtoni (Gravely 1915) (Arachnida: Amblypygi: Charinidae) and a new case of parthenogenesis in Amblypygi from Singapore
by Michael Seiter & Jonas Wolff 233
The new spider genus Arctenus, an afrotropical representative of the Calocteninae (Araneae: Ctenidae)
by Daniele Polotow & Rudy Jocque 240
Chemical defenses in the opilionid infraorder Insidiatores: divergence in chemical defenses between Triaenonychidae and Travunioidea and within travunioid harvestmen (Opiliones) from eastern and western North America by W. A. Shear, T. H. Jones, H. M. Guidry, S. Derkarabetian, C. H. Richart, M. Minor &
J. J. Lewis 248
Species differences and geographic variation in the communal roosting behavior of Prionostemma harvestmen in Central American rainforests
by Gregory F. Grether, Theresa L.Aller, Nicole K. Grucky, Abrahm Levi, Carmen C. Antaky & Victor R. Townsend, Jr. 257
From spiderling to senescence: ontogeny of color in the jumping spider, Habronattus pyrrithrix
by Lisa A. Taylor, David L. Clark & Kevin J. McGraw 268
Scavenging throughout the life cycle of the jumping spider, Phidippus audax (Hentz) (Araneae: Salticidae)
by Michael E, Vickers, Marianne W. Robertson, Casey R. Watson & Travis E. Wilcoxen 277
Removal of genital plugs and insemination by males with normal and experimentally modified palps in Leucauge mariana (Araneae: Tetragnathidae)
by Vivian Mendez & William G. Eberhard 284
Burrow structure and microhabitat characteristics of Nesiergus insulanus (Araneae: Theraphosidae) from Fregate Island, Seychelles
by Gregory Canning, Brian K. Reilly & Ansie S. Dippenaar-Schoeman 293
Thermal preference ofDysdera crocata C. L. Koch 1838 (Araneae: Dysderidae)
by Rita Sepulveda, Andres Taucare-Rios, Claudio Veloso & Mauricio Canals 299
Natural history of Phoneutria boliviensis (Araneae: Ctenidae): habitats, reproductive behavior, postembryonic development and prey-wrapping
by Nicolas A. Hazzi 303
Short Communications
The mechanism behind plasticity of web-building behavior in an orb spider facing spatial constraints
by Thomas Hesselberg 311
Development of novel microsatellite markers for the spider genus Loxosceles (Sicariidae) using next-generation
sequencing by Enric Planas, Laia Bernaus & Carles Ribera 315
Pre-ballooning in Ummidia Thorell 1875 (Araneae: Ctenizidae) from the Interior Highlands, USA: second account from the region and review of mygalomorph ballooning
by J. Ray Fisher, Danielle M. Fisher, Michael J. Skvarla & Ashley P. G. Dowling 318
Instructions to Authors 322
USERNAME: leachH
PASSWORD: nephilal4