57?

SMITHIANA

Publications in Aquatic Biodiversity

Bulletin No. 9, November 2008

Published by the South African Institute for Aquatic Biodiversity

SAIAB

Margaret Mary Smith (1916-198 7),
James Leonard Brier ley Smith (1897-1968)
with their dog Marlin

The publication series (Monographs, Bulletins & Special Publications) of SAIAB
(formerly the JLB Smith Institute of Ichthyology), in its new format, honours James
Leonard Brierley Smith and Margaret Mary Smith with the name Smithiana, in
recognition of their many years of devoted service to African aquatic biology. Their
life's work, a team effort, established modern ichthyology in southern Africa and laid
the groundwork for the expansion of aquatic biology throughout the region.

All contents of this publication © 2007, The South African Institute for Aquatic Biodiversity, Grahamstown
Front cover photograph: Left pectoral fin of a preserved coelacanth specimen by Wouter Holleman. © SAIAB, 2006.

SMITHIANA BULLETIN NO. 9

CONTENTS

Reviewers for Bulletin 7, 8 & 9 . 2

John E. Randall, Jeffrey T. Williams & Luiz A. Rocha. The Indo-Pacific tetraodontid fish Canthigaster
coronata, a complex of three species . 3

John E. Randall & Jennifer K. Schultz. Cirrhitops mascarenensis, a new species of hawkfish from the
Mascarene Islands, southwestern Indian Ocean . 15

John E. Randall & Phillip C. Heemstra. Ammodytoides xanthops, a new species of sandlance (Perciformes:
Ammodytidae) from Mozambique . 21

ERRATA SMITHIANA BULLETIN 9

Page 3 ff - Randall et al.: all references to C. axiologa should read C. axiologus

Page 5 — Table 1: C. axoliogia should read C. axiologus

Page 15 — Fig. 1 caption: Mauritius should read Hawaian Islands

Please note that SAIAB's url has changed from www.saiab.ru.ac.za to www.saiab.ac.za

Smithiana Bulletins and Monographs are publications of the South African Institute for Aquatic Biodiversity, for
original scientific articles in the fields of taxonomy, systematics, ethology, ecology, biogeography and conserva¬
tion of the fishes of Africa and its surrounding waters. Priority will be given to papers by staff and associates of
the Institute. Manuscripts from outside the Institute will be considered if they are pertinent to the work of the
Institute or use the Institute's collections.

Editor: Mr Wouter Holleman

SAIAB: Scientific Publications, Private Bag 1015, Grahamstown, 6140 South Africa
w.holleman@ru.ac.za

For instructions to authors, please see the publications page at http:/ / www.saiab. .ac.za

The publi
(formerly

Leonard E _ , —

recognitior _ _ iy ycms or ae voted service to African aquatic biology. Then-

life's work, a team effort, established modem ichthyology in southern Africa and laid
_ the groundwork for the expansion of aquatic biology throughout the region.

All contents of this publication © 2007, The South African Institute for Aquatic Biodiversity, Grahamstown
Front cover photograph: Left pectoral fin of a preserved coelacanth specimen by Wouter Holleman. © SAIAB, 2006.

SMITHLANA BULLETIN NO. 9

CONTENTS

Reviewers for Bulletin 7, 8 & 9 . 2

John E. Randall, Jeffrey T. Williams & Luiz A. Rocha. The Indo-Pacific tetraodontid fish Canthigaster
coronata, a complex of three species . 3

John E. Randall & Jennifer K. Schultz. Cirrhitops mascarenensis, a new species of hawkfish from the
Mascarene Islands, southwestern Indian Ocean . 15

John E. Randall & Phillip C. Heemstra. Ammodytoides xanthops, a new species of sandlance (Perciformes:
Ammodytidae) from Mozambique . 21

Smithiana Bulletins and Monographs are publications of the South African Institute for Aquatic Biodiversity, for
original scientific articles in the fields of taxonomy, systematics, ethology, ecology, biogeography and conserva¬
tion of the fishes of Africa and its surrounding waters. Priority will be given to papers by staff and associates of
the Institute. Manuscripts from outside the Institute will be considered if they are pertinent to the work of the
Institute or use the Institute's collections.

Editor: Mr Wouter Holleman

SAIAB: Scientific Publications, Private Bag 1015, Grahamstown, 6140 South Africa
w.holleman@ru.ac.za

For instructions to authors, please see the publications page at http:// www.saiab. .ac.za

Reviewers for Bulletin 7, 8 & 9

Those listed below reviewed manuscripts submitted for publication in Smithiana Bulletins 7,

8 and 9. By giving of their time — and they are all busy people — they contributed not only to
the quality of the manuscripts submitted but to the quality of the journal. Their contribution is
hereby gratefully acknowledged.

Gerry Allen - Conservation International

Colin Buxton - Tasmania Aquaculture and Fisheries Institute, Hobart
Leonard Compagno - Iziko South African Museum, Cape Town
Marcelo de Carvalho - Instituto de Biociencias, Univesidade de Sao Paulo
Guy Duhamel - Museum Nationale Histoire Naturelle, Paris
John L. Earle - Bishop Museum, Honolulu

Phillip C. Heemstra - South African Institute for Aquatic Biology, Grahamstown
Brett Human - Adelaide

Bruce Mann - Oceanographic Research Institute, Durban
Peter Moller - Zoological Museum, University of Copenhagen
Randy Mooi - Manitoba Museum
Hiroyuki Motomura - Kagoshima University
Bernard Seret - Museum Nationale Histoire Naturelle
Malcolm Smale - Bayworld, Port Elizabeth

David G Smith - National Museum of Natural History, Smithsonian Institution
Jos Snoeks - Afrikamuseum, Tervuren

Jim Tyler - National Museum of Natural History, Smithsonian Institution
Richard Vari - National Museum of Natural History, Smithsonian Institution
Mark Westneat - Field Museum of Natural History, Chicago
Jeff Williams - National Museum of Natural History, Smithsonian Institution

The Xndo-Pacific tetraodontid fish Canthigaster coronata,
a complex of three species

John E. Randall1, Jeffrey T. Williams2, and Luiz A. Rocha3

'Bishop Museum, 1525 Bernice St., Honolulu, HI 96817-2704, USA,
e-mail jackr@hawaii.rr.com

2Division of Fishes, Department of Vertebrate Zoology,

National Museum of Natural History, 4210 Silver Hill Road,
Suitland, MD 20746, USA, e-mail williamsjt@si.edu
3Hawai'i Institute of Marine Biology, University of Hawai'i, P.O. Box 1346,
Kaneohe, HI 96744, USA, e-mail rochal@hawaii.edu

Submitted 7 November 2007, accepted 17 December 2007

Abstract. The tetraodontid fish Canthigaster coronata (Vaillant & Sauvage), formerly with a distribution of
Hawaii and Tonga to the east coast of Africa and the Red Sea, is divided into three species: C. coronata,
endemic to the Hawaiian Islands, C. axiologa Whitley from the rest of the Pacific west of the Hawaiian Islands,
and C. cyanospilota, sp. nov. from the Indian Ocean and Red Sea (type locality. Gulf of Aqaba). In addition
to being distinguishable at the control region of their mitochondrial DNA, the three species differ in the
following characters: C. coronata is distinct in having numerous small yellow spots, but no blue markings
(except around the eye), modally 17 pectoral rays (16 in C. axiologa from the North Pacific), the origin of the
anal fin below or anterior to the rear base of the dorsal fin (below or posterior for the other two species),
and a broader gill opening, 3.7-4.75 in head length, compared to 4.8-5.55 for C. axiologa and 5.4-6.5 for C.
cyanospilota. Canthigaster axiologa ranges from Japan to New South Wales, east to the Marshall Islands and
Tonga. It has bright blue spots associated with yellow spots or lines along the edges of the saddle-like brown
bars, as well as elsewhere on the body and head, modally 16 pectoral rays in the North Pacific, and modally
17 in the South Pacific, and a broad interorbital space (3.75-4.4 in head length). Canthigaster cyanospilota has
numerous small bright blue spots and lines, but no bright yellow spots, the dark saddle-like bars do not reach
below the level of the upper end of the gill opening (extend below in C. axiologa and C. coronata ), and a narrow
interorbital space (4.25-4.85 in head length). Divergence of the northern Red Sea population of C. cyanospilota
from that of the Indian Ocean is discussed.

Keywords: taxonomy, Tetraodontidae, Canthigaster, new species, Indian Ocean

INTRODUCTION

The 33 species of the fish genus Canthigaster Swainston,
popularly known as tobies or sharpnose puffers, have
been classified by some authors, such as Tyler (1967),
as a separate family, the Canthigasteridae, but by most
authors as a subfamily of the Tetraodontidae. The
study of the order Tetraodontiformes by Tyler (1980)
and Alfaro et al. (2007) clearly shows that the genus
should not be regarded as a distinct family.

The genus Canthigaster is differentiated from the
remaining genera of the Tetraodontidae by a laterally
compressed body, elongate pointed snout, erectile
ridge of skin middorsally and midventrally, small gill
opening, inconspicuous lateral line, 17 vertebrae, and
small size. The bright colour patterns of the species
probably serve to advertise their repelling skin toxin.
The first author tried to feed a small one to a snapper
(Lutjanus kasmira) at the MidPacific Research Laboratory

at Enewetak Atoll in the Marshall Islands. It was seized
by the snapper and quickly ejected.

Tyler (1967) wrote that the species of Canthigaster
are the most uniform of the tetraodontiform fishes.
He added, "Proportional measurements of the species
tend to be the same" and "with few exceptions, the
species are distinguished mostly on the basis of colour
pattern." He noted that previous authors failed to
distinguish C. coronata (Vaillant & Sauvage) from C.
valentini (Bleeker), both with saddle-like black bars on
the body. He provided a detailed account to separate
the two.

Allen & Randall (1977) reviewed the genus for
the Indo-Pacific region, recognizing 22 species. Since
their review, C. flavoreticulata Matsuura (1986) was
described from the Tonga Submarine Ridge in 98-111
m, C. cyanetron Randall & Cea Egana (1989) from Easter
Island, C. punctata Matsuura (1992) from the Mascarene
Submarine Ridge in 92 m, and C. papua (Bleeker) was

Smithiana Bulletin 9: 3-13

4 Randall, Williams & Rocha

removed from the synonymy of C. solandri (Richardson)
(Anderson et al., 1998).

Allen & Randall gave the distribution of Canthigaster
coronata as the Hawaiian Islands (type locality) to the
east coast of Africa and the Red Sea; in the western
Pacific from Japan to New South Wales. We have
noticed that the species is different in colour in the
Hawaiian Islands from elsewhere in the Pacific, and
even more different in the Indian Ocean, including the
Red Sea. In the present paper we restrict the name C.
coronata to the population in the Hawaiian Islands and
Johnston Island, C. axiologa Whitley, type locality Great
Barrier Reef, for the species in the North Pacific west
of Hawaii and in the South Pacific from Tonga to the
west, and we describe the Red Sea and Indian Ocean
species as new.

At first, we experienced difficulty finding
morphological differences to distinguish the species
of these three areas of the Indo-Pacific, so we obtained
tissue samples and tried to differentiate them by DNA.
The mitochondrial DNA differences were not very large,
but support significant phylogenetic breaks among
species. On renewing our efforts to find something
morphologically diagnostic to correlate with colour
and DNA, we were able to distinguish the Hawaiian
species by modal differences in pectoral and anal ray
counts (Table 1) and in a few measurements (Table 2).

MATERIALS AND METHODS

Specimens of the new species are deposited in the
Academy of Natural Sciences of Philadelphia (ANSP);
the Natural History Museum, London (BMNH);
Bernice P. Bishop Museum, Honolulu (BPBM); Hebrew
University, Jerusalem (HUJ); National Museum of
Nature and Science, Tokyo (NSMT); South African
Institute for Aquatic Biodiversity, Grahamstown
(SAIAB); and the National Museum of Natural History,
Washington, D.C. (USNM). Other specimens for this
study have been sent on loan from the Australian
Museum, Sydney (AMS); Academy of Natural Sciences
of Philadelphia (ANSP); California Academy of
Sciences, San Francisco (CAS, SU); the University of
Guam, Mangilao (UG); and the Royal Ontario Museum,
Toronto (ROM).

The length of specimens is given as standard
length (SL), measured from the median anterior end
of the upper dental plate to the base of the caudal fin
(posterior end of the hypural plate); body depth is the
slightly oblique measurement from the origin of the
dorsal fin to the origin of the anal fin (maximum body
depth is too variable in species of Canthigaster); body
width is measured at the base of the pectoral fins; head
length is taken from the front of the upper dental plate
to the dorsal end of the gill opening; orbit diameter is
the greatest diameter of the unpigmented skin over the
eye, and interorbital width the least bony width; snout
length is measured from the upper dental plate to the

nearest unpigmented cutaneous edge of the eye; length
of the gill opening is taken by inserting divider tips
and spreading for the maximum firm edges; caudal-
peduncle depth is the least depth, and caudal-peduncle
length the horizontal distance between verticals at the
rear base of the anal fin and the caudal-fin base; lengths
of fins are the length of the longest rays.

Morphometric data were taken for specimens 47 mm
or more in standard length. The measurements for the
new species are presented in Table 3 as percentages of
the standard length; in the descriptions as proportional
measurements of the standard length or head length,
rounded to the nearest 0.5. Some specimens are
too misshapen for measurements but were used for
counts.

The counts of pectoral rays include the short
uppermost ray.

Meristic and morphometric data in parentheses
refer to paratypes.

Genomic DNA was extracted from fin clips. In order
to address differentiation at the species level, two new
primers (CANT-CR-F: 5' CCA AAG CCA GCA TTC
TCA AT 3'; and CANT-CR-R: 5' CTC GGG GGT TTC
CTG TTT C 3') were used to amplify the mitochondrial
DNA (mtDNA) control region of Canthigaster. These
primers were constructed based on the alignment of
the entire mitochondrial DNA sequences of C. coronata
and C. rivulata (Genbank accession numbers AP006743
and AP006744 respectively). PCR conditions and
sequencing protocols are described in detail by Rocha
(2004).

Canthigaster coronata (Vaillant & Sauvage)
(Plate 1A, B; Tables 1, 2)

Tetraodon (Anosmias) coronatus Vaillant & Sauvage,
1875: 286 (type locality, Hawaiian Islands).

Canthigaster cinctus (non Solander) Jordan & Evermann,
1905: 433, fig. 189 (type locality, Hawaiian Islands).

Diagnosis. Dorsal rays 9-11 (usually 10, rarely 9); anal
rays 9 or 10 (usually 10); pectoral rays 15-18 (usually
17); gill rakers 7-9; body depth between origins of
dorsal and anal fins 2.8-3.25 in SL; head length 2.3-
2.55 in SL; interorbital width 3.9-4.45 in head length;
gill opening 3.7-4.75 in head length; origin of anal fin
below or anterior to rear base of dorsal fin, the preanal
length 1.35-1.4 in SL; longest dorsal ray 2.2-2.S in head
length; colour in alcohol pale grey to pale tan with
three triangular dark brown saddle-like bars dorsally
on body, progressively more oblique posteriorly, the
first extending narrowly to ventral edge of gill opening,
the second to level of lower edge of pectoral-fin base
and enclosing base of dorsal fin posteriorly, and the last
ending at upper base of caudal fin; a dark brown band
across posterior interorbital and anterior occiput; a dark
brown spot below base of pectoral fin; many small pale
spots (most about half pupil diameter) on head and
body, faint or absent on paler parts of body but very

Smithiana Bulletin 9: 3-13

The Canthigaster coronata species complex

5

evident on edges, within dark bars, and on head where
ground colour darker; narrow pale bands and spots
around eye; lips pale, encircled with a narrow dusky
band; a thin dark brown line midventrally on abdomen
and chest present or absent (may be broken to long
segments); fins pale, the upper and lower margins of
caudal fin with a broad brown band, darker at base;
colour when fresh as in Plate 1 A; colour in life shown in
Plate IB (noteworthy are the many small yellow spots,
and the lack of blue spots — blue only between yellow
markings around eye). Largest specimen examined,
111 mm SL.

Remarks. Vaillant & Sauvage (1875) described
Canthigaster coronata from the Hawaiian Islands in a
brief but diagnostic description. They did not list their
material, but Tyler (1967: 63) examined the holotype,
MNHN 9006, 103.2 mm SL.

Jordan & Evermann (1905: 433) believed that
Tetrodon cinctus Solander in Richardson (1845: 125)
is an older available name for the species and used
it in their volume on Hawaiian fishes. However, the
name cinctus was merely mentioned in Richardson's
description of Canthigaster solandri (then in Tetrodon ) as
seen on a drawing by Sydney Parkinson of a species
from Tahiti obtained during Captain Cook's first
circumnavigation. Since the species was not described
by Richardson, Jordan & Evermann became the authors
of the name cinctus for a Hawaiian species. Tyler (1967:
61) explained that Gunther (1910: 466) saw the drawing
by Parkinson and realized it was the young of the puffer
Arothron stellatus. Jordan & Seale (1906: 373) used the
name Canthigaster cinctus in their volume. The Fishes of
Samoa, and placed Tropidichthys valentini Bleeker and
Tetraodon coronatus Vaillant & Sauvage in the synonymy
of C. cinctus. Tyler showed that C. valentini is a valid
species similar to C. coronata and that C. cinctus Jordan
& Evermann is a synonym of C. coronata. He listed no
specimens of C. coronata from the South Pacific but

examined specimens of C. valentini east to the Society
Islands and Tuamotu Archipelago.

We first suspected that Canthigaster coronata was
endemic to the Hawaiian Islands when we noticed that
it lacks blue spots on the body, including those along
the edge of the dark saddles, as seen on fish identified
as C. coronata elsewhere; also there is no solid, curved
orange-yellow stripe on the lower side of the head. We
then found a strong modal count of 17 pectoral rays,
compared to 16 in specimens from the North Pacific
to the west of Hawai'i, and a higher percentage of
specimens with 10 anal rays (see Table 1). The modal
count of 17 pectoral rays in our few specimens from
the southwest Pacific is an independent divergence (see
account of C. axiologa below). We made 12 morphometric
measurements of our specimens as percentages of the
SL (Table 2). The gill opening is longer in C. coronata
(9.2-10.7% SL compared to 6.4-8. 6% SL), the dorsal fin
is higher (17.0-18.8% SL, compared to 14.0-17.6%), and
the preanal length is shorter on the average, 70.6-74.8%
SL, compared to 72.5-78.8% SL). This was evident when
we noticed that the origin of the anal fin is directly below
or anterior to the rear base of the dorsal fin (below or
posterior on the other two species).

No specimens of C. coronata have been collected at
Johnston Island, an outlier of the Hawaiian Archipelago,
but the species was reported as a sight record for the
island by Kosaki et al. (1991: 196), and it was illustrated
by Lobel (2003: 120, middle fig.) from an underwater
photograph.

Canthigaster coronata generally occurs at depths of 12
m or more; however, it has been collected in as little
as 6 m. When shallow, it is usually found in lagoons
or bays. The usual habitat is sand or sand and rubble
bottom or algal flats, often in the vicinity of coral
reefs. Gilbert (1905: 626) listed specimens from trawl
stations in 79-165 m off Moloka'i, Maui, and Kaua'i.
Struhsaker (1973: 141) obtained 7-48 individuals per
station in three trawl hauls on the Penguin Bank in the

Table 1. Fin-ray counts of species of the Canthigaster coronata complex.

Dorsal rays

9 10 11

Anal rays

8 9 10

Pectoral rays1

15 16 17 18

C. coronata (Hawaiian Islands)

1 33 3

23 14

9 61 4

C. axoliogia (NW Pacific)2

4 23

2 25

11 32 11

C. axoliogia (SW Pacific)3

11 1

10 2

6 14 4 '

C. cyanospilota (Indian Ocean)4

17 1

17 1

13 15

C. cyanospilota (Red Sea)5

6 2

1 7

4 12

^oth sides counted

2Marshall Is, Caroline Is, Palau, Japan, Taiwan, Philippines and South China Sea
Queensland, New South Wales and Tonga

4Somalia (including Gulf of Aden coast), Kenya, KwaZulu-Natal, Reunion and Mauritius
5Gulf of Aqaba

Smithiana Bulletin 9: 3-13

6

Randall, Williams & Rocha

Table 2. Range in proportional measurements of the species of the Canthigaster coronata complex as
percentages of the standard length.

Standard

length

Body

depth

Head

length

Snout

length

Eye

diameter

Interorbit
-al width

Gill

opening

Predorsal

length

Preanal

length

Dorsa!»fin

length

Anal-fin

length

Caudal
fin length

Pectoral-
fin length

C. coronata (n=17)

50-102 mm

30.8-35.9

39.4-44.0

26.1-30.5

7.8-10.9

9.0-10.7

9.2-10.7

71.3-74.0

70.6-74.8

17.0-18.8

12.2-15.5

28.1-33.0

15.0-17.7

C. axiologa (n=13)

50-101 mm

30.5-33.1

39.9-43.7

25.2-28.1

6.9-11.6

9.6-11.2

7.4-8. 6

72.3-74.7

73.8-78.8

14.2-17.6

13.1-15.4

25.7-32.2

13.9-17.1

C. cyanospilota (n=17)

41-111 mm

27.4-33.3

40.6-45.3

23.9-30.3

7.0-10.3

8. 5-9.6

S.4-7.8

70.1-75.0

72.5-78.5

14.0-17.4

11.6-16.2

27.2-34.8

13.0-16.6

Kaiwi Channel (between O'ahu and Moloka'i). The first
author speared nine in a single tank dive for food-habit
study off Waimea Bay, O'ahu at a depth 12-15 m. Five
individuals of the endemic Canthigaster jactator were
sighted during the same dive. Allen & Randall (1977:
487) listed the stomach and gut contents of 12 specimens
of C. coronata from O'ahu as 13% algae and detritus,
11.9% gastropods, 10.0% crabs, 9.7% pelecypods, 8.9%
polychaetes, 7.7% sponge, 7.0% sipunculids, 6.7%
ophiuroids, 5.9% bryozoans, 4.7% tunicates (mostly
didemnids), 3.3% echinoids, 2.4% foraminifera, 1.7%
amphipods, 0.7% shrimps, 0.1% isopods, and 6.6%
unidentified.

Material examined. Hawaiian Islands: O'ahu, BPBM
8497, 73 mm; BPBM 9045, 92 mm; BPBM 11484, 9: 50-85
mm; SAIAB 2374, 3: 81-86 mm. Moloka'i, BPBM 24019,
9: 66-102 mm. Midway, BPBM 35367, 83 mm. Middle
Bank (22°44'N, 161°4'W), BPBM 24903, 50 mm; BPBM
24908, 2: 74-85 mm; BPBM 24918, 8: 67-91 mm; BPBM
24928, 69 mm.

Canthigaster axiologa Whitley
(Fig. 1; Plate 1 C-l H, Plate 2 A, B; Tables 1, 2)

Canthigaster axiologus Whitley, 1931: 333 (type locality,
near Capricorn Group, Great Barrier Reef).

Diagnosis. Dorsal rays 9-11 (usually 10, rarely 11); anal
rays 9 or 10 (usually 9); pectoral rays 15-18 (modally 16 in
the North Pacific and 17 in the South Pacific); gill rakers
7-9; body depth between origins of dorsal and anal fins
3 . 0-3.3 in SL; head length 2.3-2.S in SL; interorbital width
3.75-4.4 in head length; gill opening 4.8-5.55 in head
length; origin of anal fin below or posterior to rear base
of dorsal fin, the preanal length 1.25-1.35 in SL; longest
dorsal ray 2.4-2.9 in head length. Colour in alcohol pale
grey to pale tan with three saddle-like, dark brown bars
on body as described above for C. coronata, the edges
of bars with close-set, small, pale-edged dark spots or
short lines, irregularly alternating with unpigmented
pale spots or lines; ventral part of body with or without
small pale spots or pale-edged dark spots; a broad dark
brown band across posterior interorbital and anterior
occiput; a dark brown spot below base of pectoral fin;
a narrow curved pale band edged in small dark spots
from chin to below gill opening; a pale area around
eye with radiating dark brown lines (except adjacent
interorbital band); a mid ventral dark brown line on
head and abdomen varying from faint to conspicuous;

lips pale, usually rimmed by a dusky band; fins pale
grey, the upper and lower edges of caudal fin with or
without a broad dark marginal band. Colour when
fresh shown in Plate 1 C from Japan and Plate 1 E of a
juvenile from Palau with yellow spots within the dark
brown bars; colour in life in Plate 1 D and F-H from the
Ogasawara Islands, Taiwan, Indonesia, and the Great
Barrier Reef. Largest specimen examined, 101 mm SL,
from Japan.

Remarks. McCulloch (1922: 245, Plate 14, fig. 1)
identified a specimen of Canthigaster 131 mm long

Fig. 1 . Holotype of Canthigaster axiologa Whitley,

QM 1.3549, 100 mm (after McCulloch, 1922).

from near the Capricorn Group of the southern Great
Barrier Reef as C. cinctus (Richardson) Jordan &
Evermann. Whitley (1931: 333) realized that C. cinctus
is not a valid name, so he proposed the new name C.
axiologus for McCulloch's fish (changed to axiologa
because Canthigaster is feminine). The holotype, QM
1.3549, is in the Queensland Museum, Brisbane. It now
measures 127.5 mm total length and 100 mm SL (Jeffrey
W. Johnson, pers. comm.). We reproduce McCulloch's
figure here as Fig. 1.

We are applying the name C. axiologa to specimens
we have examined from the Marshall Islands,
Caroline Islands, Mariana Islands, Palau, mainland
Japan, Ogasawara Islands, Ryukyu Islands, Taiwan,
Macclesfield Bank (South China Sea), Philippines,
Vietnam, Great Barrier Reef, New South Wales and
Tonga. Allen & Swainson (1988: 156, Fig. 1043) recorded
the species for Western Australia from Exmouth Gulf
northwards; Kuiter (1992: 276, Fig. C) from Flores,
Indonesia, and Laboute & Grandperrin (2000: 470,
upper fig.) from New Caledonia, all as C. coronata.

Canthigaster axiologa is distinct from C. coronata in
having a narrower gill opening (7.4-8. 5% SL, compared

Smithiana Bulletin 9: 3-13

The Canthigaster coronata species complex

7

to 9.2-10.5% for C. coronota), a shorter dorsal fin (14.2-
17.6 % SL vs. 17.0-18.8%), a longer preanal length (73.8-
78.8% SL vs. 71.6-74.7% SL), and in colour, principally
in having blue spots or short lines associated with
yellow spots or lines along the margins of the dark
saddles on the body, scattered small blue spots mixed
with yellow spots on the ventral part of the body,
especially posteriorly (these spots may be pale), and a
distinct curved orange-yellow band bordered by small
blue spots on the lower side of the head. In addition,
specimens from the North Pacific west of Hawai'i
have modally 16 pectoral rays, compared to 17 for C.
coronata, and 8 or 9 (rarely 8) instead of 9 or 10 anal rays
(Table 2).

Individuals of C. axiologa from Japan and Taiwan
tend to have more small blue spots scattered with the
yellow on the ventral half of the head and body, often
broadly rimmed by yellow as shown by our Plate 1 G
from Taiwan, and more extremely in Shen & Lim (1974:
18, Fig. 2), Masuda et al. (1984: Plate 332, Fig. I), and
Masuda & Kobayashi (1994: 426, Fig. 3).

Specimens in the South Pacific have modally 17
pectoral rays, compared to 16 for those from the North
Pacific. We could find no morphometric or colour
differences to link with the pectoral-ray count. We
should add, however, that we have examined only
11 specimens from the South Pacific, all but two less
than 53 mm SL. It should also be noted that the colour
photograph identified as Canthigaster coronata in the
book on the fishes of the Great Barrier Reef and Coral
Sea (Randall et al., 1990: 476, upper fig.) was taken in
Bali (Roger C. Steene, pers. comm.).

Canthigaster axiologa inhabits the same sheltered
habitat as C. coronata, often on open sand and rubble
bottom near reefs. It appears to be far less common
than C. coronata.

Material examined. Marshall Islands: Kwajalein Atoll,
BPBM 18436, 50 mm. Caroline Islands: Ifalik (Ifaluk)
Atoll, CAS 15424, 54 mm. Mariana Islands: Guam,
UG 6557, 55 mm. Palau: Ngeruktabel Island, ROM
79420, 33 mm. Japan: Ogasawara Islands, Chichi-jima,
NSMT-P 31917, 84 mm. Haha-jima, NSMT-P 32799, 3:
22-101 mm. Izu Islands, Miyake-jima, NSMT-P 22211,
2: 36-48 mm; NSMT-P 22287, 32 mm; NSMT-P 30678,
59 mm. Honshu, Wakayama Prefecture, BPBM 7287,
52 mm. Shizuoka Prefecture, NSMT-P 19081, 2: 41-43
mm. Chiba Prefecture, NSMT-P 60320, 50 mm. Ryukyu
Islands, Okinawa, BPBM 19159, 24 mm (bad condition).
Taiwan: BPBM 23280, 65 mm. Philippines: Negros, SU
68574, 2: 76-77 mm. Siquijor, USNM 227245, 2: 67-68
mm. South China Sea: Macclesfield Bank, USNM
387502, 107 mm; USNM 387503, 69 mm; USNM 387505,
76 mm; USNM 387508, 84 mm. Vietnam, BPBM 40492,
68 mm. Australia: Great Barrier Reef, AMS 1.15681-061,
27 mm; AMS 1.18268-001, 52 mm; BPBM 40489, 2: 58-
67 mm; ROM 38231, 86 mm. New South Wales, AMS
1.15573, 37 mm; AMS 1.16952-001, 29 mm; AMS 1.19500-
001, 47 mm; AMS 1.41268-022, 24 mm; AMS 1.41273-040,

23 mm; AMS 1.41846, 27 mm. Tonga: BPBM 37938, 65
mm; USNM 334535, 78 mm.

Canthigaster cyanospilota sp. nov.

(Plate 2 C-H; Tables 1-3)

Canthigaster coronata (non Vaillant & Sauvage) Tyler,
1967: 62, Figs. 1-5 (Seychelles, Gulf of Aqaba, and
Somalia).

Holotype: BPBM 13898, 85.0 mm. Red Sea, Gulf of Aqaba,
Israel, off the Interuniversity Institute of Eilat, 12 m,
spear, J. E. Randall, 7 June 1972.

Paratypes: BMNH 1951.1.16.700, 63.9 mm. Red Sea,
Gulf of Aqaba, Jordan, 18 m, fish trap, "Manihine"
Expedition, N.B. Marshall, 1949/1950; HUJ 16669, 48.5
mm. Gulf of Aqaba, Israel, Eilat, North Beach, near
Jordanian border, coral reef and adjacent sand, 1-4 m,
rotenone, E. Clark, 5 September 1960; USNM 191710,
54.5 mm, same data as preceding; USNM 387501, 85.1
mm, northern Gulf of Aqaba, Israel, G. Kissil, 1970;
NSMT-P 77636, 41.3 mm, and SAIAB 79818, 82.8 mm,
same data as holotype; HUJ 9393, 104.0 mm. Gulf of
Aqaba, Israel, Sinai Peninsula, Nuweiba, A. Baranes, 16
October 1976.

Diagnosis. Dorsal rays 9-11 (modally 9 in the Red Sea);
anal rays 8-10 (modally 9); pectoral rays 15-17 (rarely
15); gill rakers 9-10; body depth between origins of
dorsal and anal fins 3.15-3.6 in SL; head length 2.2-2.5
in SL; interorbital width 4.25-4.85 in head length: gill¬
opening length 5.4-6.5 in head length; origin of anal fin
below of posterior to rear base of dorsal fin, the preanal
length 1.25-1.35 in SL; longest dorsal ray 2.6-2.95 in
head length; colour in alcohol pale grey to pale tan
with three oblique, saddle-like, brown bars on body,
not extending below level of upper end of gill opening;
a broad dark brown band across posterior interorbital
and anterior occiput; dark brown dots and short lines
on head and body, including ones radiating from eye
and margins of brown saddles (also within saddles on
Red Sea specimens); dark lines on snout behind mouth
vertical; a dark brown spot below base of pectoral fin; a
midventral brown line on head and abdomen; fins pale
yellowish. In life the dark dots and lines are bright
blue; the caudal fin is conspicuously marked with
longitudinal blue lines or rows of small blue spots and
short lines; the snout is often green dorsally.

Description. Dorsal rays 9 (six paratypes with 9, and
two with 10); anal rays 9 (one of 7 paratypes with 8,
the rest with 9); dorsal and anal rays branched, except
the first; caudal rays 11, uppermost and lower two
unbranched; gill rakers 9 (8-9); vertebrae 17.

Body depth between origins of dorsal and anal fins
3.4 (3.15-3.6) in SL; body moderately compressed, the
width 1.4 (1.25-1.45) in depth; head length 2.45 (2.2-2.5)
in SL; snout long, 1.45 (1 .4-1.7) in head length; dorsal

Smithiana Bulletin 9: 3-13

8 Randall, Williams & Rocha

profile of snout straight to slightly concave; eye small,
the diameter 4.55 (3.8-5.75) in head length; interorbital
space slightly concave, the least width 4.35 (4.25-4.85)
in head length; mouth small, oval, and terminal,
exposing about terminal half of upper dental plate; lips
fleshy and papillose; gill-opening length 5.4 (S.4-6.5)
in head length; caudal-peduncle depth 2.5 (2.5-2.95) in
head length; caudal-peduncle length 2.05 (2.0-2.45) in
head length.

Predorsal length 1.4 (1.35-1.4) in SL; dorsal-fin base
4.95 (4.65-6.0) in head length; third dorsal ray usually
longest, but adjacent rays nearly as long, 2.6 (2.7-2.95)
in head length; origin of anal fin below or posterior to
rear base of dorsal fin, the preanal length 1.3 (1.25-1.35)
in SL; anal-fin base 5.75 (5.95-6.75) in head length;
second or third anal rays usually longest, but adjacent
rays nearly as long, 3.0 (3. 1-3. 4) in head length; caudal
fin slightly rounded, 3.3 (3.05-3.55) in SL; upper half of
pectoral fins slightly rounded, the lower half slightly
emarginate; third or fourth pectoral rays usually
longest, 2.9 (2.85-3.2) in head length.

Skin with numerous small spinules that are directed
posteriorly, each fitting into a longitudinal groove;
skin smooth when stroked posteriorly, but spinules
apparent when stroked anteriorly; veiy few spinules

on flat ventral part of body between anal and caudal
fins (only three found on holotype).

Colour of holotype in alcohol pale tan with three
triangular, saddle-like, brown bars on upper two-fifths
of body that are progressively more oblique posteriorly,
the first bar ending above base of pectoral fin, the second
extending slightly more ventral and enclosing base of
dorsal fin at its posterior end, and the third bar covering
most of space between dorsal and caudal fins, its lower
edge nearly horizontal; a transverse brown band across
posterior interorbital and anterior occipital; pale space
between saddle-like brown spots and transverse brown
band varying in width from pupil to eye diameter;
a horizontally elongate brown spot below base of
pectoral fin; a midventral brown line (on a low ridge in
some paratypes) extending forward from origin of anal
fin, and dividing to two lines on anterior half of snout
that join at base of lower lip (some paratypes with dark
line extending to chin, others with line interrupted by
vertical brown lines); three dark brown lines extending
posteriorly from rear edge of eye, the uppermost linked
by a dark brown line over upper edge of eye to a dark
brown line extending anteriorly from eye; two dark
brown lines directed obliquely anterior from ventral
edge of eye; a dark brown line encircling lips except

Table 3. Proportional measurements of the type specimens of Canthigaster cyanospilota as percentages of the
standard length.

Holotype

Paratypes

BPBM

13898

NSMT-
P. 77636

HUJ

16669

USNM

191710

BMNH

1951.1.16

SAIAB

79818

USNM

387501

HUJ

9393

Standard length (mm)

85.0

41.3

48.5

54.5

63.9

82.8

85.1

104.0 ;

Body depth

29.5

30.5

28.8

30.2

28.9

28.0

31.1

31.7

Body width

21.1

21.7

23.3

23.6

20.9

21.5

22.8

22.1

Head length

40.6

45.1

45.0

45.0

42.2

43.1

40.9

40.3

Snout length

28.4

27.4

26.5

30.3

26.6

29.2

27.3

28.4

Orbit diameter

8.9

11.8

10.3

9.2

9.8

8.6

8.1

7.0

Interorbital width

9.3

9.4

9.5

9.6

9.4

9.5

8.4

9.5

Gill-opening length

7.5

7.3

7.3

6.9

7.8

7.8

7.1

6.8

Caudal-peduncle depth

16.2

15.2

16.2

16.7

15.2

16.3

16.5

15.4

Caudal-peduncle length

19.8

20.6

19.3

21.0

17.7

17.6

20.3

19.4

Predorsal length

71.8

72.4

71.8

73.4

73.7

73.2

72.2

72.5

Preanal length

76.0

78.5

74.0

75.2

750

77.2

74.3

75.2

Dorsal-fin base

8.2

8.9

8.1

7.6

8.0

7.2

8.8

7.0

Dorsal-fin length

15.5

16.8

15.3

16.0

14.9

14.5

15.2

14.1

Anal-fin base

7.1

7.2

7.1

7.3

7.2

6.7

6.8

6.0

Anal-fin length

13.5

14.5

13.5

14.1

13.1

13.4

13.1

11.8

Caudal-fin length

30.4

32.6

30.7

31.8

29.1

32.0

31.8

28.1

Pectoral-fin length

14.0

14.6

14.3

14.4

14.0

13.9

14.3

12.6

Smithiana Bulletin 9: 3-13

The Canthigaster coronata species complex

9

dorsally, with parallel shorter lines behind; many small
dark brown spots and short lines on head and body,
including within and along edges of dark saddles; fins
pale yellowish; a hemispherical brown spot centred
ventrally on caudal-fin base; upper caudal-fin base
with posterior end of third saddle-like brown bar.

Colour of holotype when fresh shown in plate 2
C. Plates 2 D and 2 E are underwater photographs of
individuals from the Gulf of Aqaba, the type locality.
The small dark brown spots and short lines of preserved
specimens are bright blue in life, and there are no yellow
spots. The spaces between the blue lines radiating from
the eye on some individuals are yellow, and the brown
saddle-like bars may be yellowish along the edges.

Etymology. We name this species cyanospilota from
the Greek meaning blue-spotted, in reference to the
numerous small bright blue markings.

Remarks. We have long known that Canthigaster coronata
in the Indian Ocean is different in colour from the form
in the Pacific — most obviously the many blue markings
and lack of yellow spots. In a book on the fishes of the
Maldives, Kuiter (1998: 243) wrote, "Indian Ocean and
Pacific populations slightly different and both forms
occur in Bali, Indonesia." Preserved specimens can be
distinguished by the blue markings that persist as dark
brown dots and lines. Also, the dark saddle-like bars do
not extend as far ventrally on Indian Ocean and Red Sea
specimens. As mentioned, initial efforts to find some
morphological or DNA difference to correlate with the
colour were not successful. We finally determined that
the bony interorbital space is narrower in the Indian
Ocean species than in C. axiologa of the western Pacific,
8.5-9.6% SL, compared to 9.6-11.2% for C. axiologa.
This is the measurement that can be taken with greatest
accuracy in the species of Canthigaster. We are now
confident to describe the Indian Ocean fish as the new
species C. cyanospilota.

We noticed from our underwater photographs
that Red Sea individuals of Canthigaster cyanospilota
have blue markings within the dark saddle-like bars,
whereas those from the east coast of Africa and islands
of the Indian Ocean (Plate 2 F-H) do not, at least as
adults, and Red Sea fish tend to have more blue lines
than small blue spots on the body and caudal fin than
in the Indian Ocean. Also, the Red Sea specimens have
modally one fewer dorsal rays than the Indian Ocean
specimens and fewer average number of pectoral rays
(see Table 1) . We have only eight specimens from the Red
Sea, all from the Gulf of Aqaba. We found no obvious
differences in morphometries, so these specimens are
included with those from the Indian Ocean in Table 2.
The seven specimens we have from the Somali coast of
the Gulf of Aden all have 10 dorsal rays like specimens
from the rest of the Indian Ocean, but all have small
dark brown spots within their brown saddle-like bars,
although fewer than specimens from the Gulf of Aqaba
(one had only a single small spot, and another only

three). Therefore, the Gulf of Aden specimens appear
to be intermediate to the Gulf of Aqaba specimens and
those in the rest of the Indian Ocean. Although we
regard all as C. cyanospilota, we have designated only
the Gulf of Aqaba specimens as type material, and list
the Indian Ocean specimens below as non-types.

Colour photographs of C. cyanospilota have been
published (as C. coronata ) by Randall (1983: 175, upper
fig., from the Red Sea); Smith & Heemstra (1986: 899,
plate 140, Fig. 268.11, from Mauritius); Allen & Steene
(1987: plate 134, Fig. 4, from Mauritius); Randall &
Anderson (1993: 44, Plate 8, Fig. H, from the Maidive
Islands); Kuiter & Tonozuka (2001: 838, Figs. D and E,
from Java); and Lieske & Myers (2004: 221, lower fig.,
from the Gulf of Aqaba).

Genetic Comparisons. In order to determine if there
were any genetic differences among the three species,
a 678 base-pair mitochondrial DNA fragment of the
control region was sequenced for two individuals
from Oahu, one from Australia (Great Barrier Reef)
and two from Reunion. In addition, the control region
sequences of individuals of C. axiologa and of C. rivulata
from Japan were obtained from Genbank (accession
numbers AP006743 and AP006744) for comparative
purposes.

Even though the genetic difference in the
control region was small, it was well supported in a

Fig. 2. Phylogenetic tree of relationships among
Canthigaster species constructed using the
minimum evolution (distance) criterion; maximum
parsimony and maximum likelihood analyses
resulted in identical tree topology. Support for the
resulting tree was evaluated using 500 bootstrap
replicates with the software PAUP* version 4.0b10
(D. L. Swofford, Sinauer, Sunderland, MA, 2002,
unpubl.) and is shown as percentages above
branches.

Smithiana Bulletin 9: 3-13

10 Randall, Williams & Rocha

phylogenetic analysis (Fig. 2), reinforcing the validity
of the species. As pointed out by Rocha et al. (2007),
species start to differentiate in morphology and colour
before their neutral genes start to diverge. The pygmy
angelfishes of the genus Centropyge in the Atlantic are a
classic example. The three recognized species there, C.
argi (Bloch), C. aurantonotus Burgess, and C. resplendens
Lubbock & Sankey, maintain color differences despite
no genetic difference on the same DNA region
analysed in this study and some range overlap in the
southern Caribbean (Bowen et al. 2006). The pattern
of slow mtDNA evolution relative to colour evolution
is also evident in another pair of closely related
species of Canthigaster. Alfaro et al. (2007) detected
almost no difference between the Hawaiian C. jactator
(Jenkins) and the Indo-Pacific C. janthinoptera (Bleeker).
Moreover, a genetic analysis also revealed no difference
for three similar Atlantic species, C. rostrata (Bloch), C.
figueiredoi Moura & Castro, and C. supramacula Moura
& Castro (L. A. Rocha, unpublished data), reinforcing
our hypothesis that this group undergoes fast colour/
morphological differentiation combined with slow
mtDNA evolution.

Non-type material examined. Somalia: Gulf of Aden,
USNM 306624, 4: 70-88 mm; USNM 306628, 78 mm;
USNM 306634, 67 mm; USNM 306641, 54 mm. Indian
Ocean, ANSP 103616, 65 mm. Kenya: BPBM 40488,
49 mm. South Africa: KwaZulu-Natal, Sodwana Bay,
SAIAB 10018, 111 mm; Aliwal Shoal, SAIAB 57318, 41
mm; SAIAB 57355, 39 mm. Reunion: BPBM 20022, 64
mm. Mauritius: BPBM 18070, 65 mm; BPBM 40515, 3:
96-103 mm. Seychelles: Mahe, ANSP 99949, 81 mm;
ANSP 99950, 74 mm.

ACKNOWLEDGEMENTS

We thank the following for the loan of specimens:
Mary Burridge of the Royal Ontario Museum, David
H. Catania of the California Academy of Sciences, Terry
J. Donaldson of the University of Guam, Dani Golani of
the Hebrew University, Ofer Gon of the South African
Institute for Aquatic Biodiversity, Keiichi Matsuura
and Koichi Shibukawa of the National Museum of
Nature and Science in Tokyo, Mark A. McGrouther of
the Australian Museum, James McLaine of the Natural
History Museum in London, and Marc H. Sabaj of the
Academy of Natural Sciences of Philadelphia. Thanks
are also due Robert F. Myers and Richard Winterbottom
for their photographs of Canthigaster axiologa , and John
L. Earle, D. Ross Robertson and Hiroyuki Tanaka for
tissue samples. We are especially grateful for the gifts of
specimens to the Bishop Museum from Fenton Walsh of
Northern Barrier Marine Life, Queensland and Tran Thi
Hong Hua of the Institute of Oceanography, Vietnam.
Financial support for L. A. Rocha was provided by
the HIMB-NWHI Coral Reef Research Partnership
(NMSP MOA 2005-008/66882 to Brian Bowen), and the

National Science Foundation (grant OCE-0453167 to
Brian Bowen). The manuscript was reviewed by Gerald
R. Allen and James C. Tyler.

LITERATURE CITED

Alfaro, M., F. Sandtini & C. D. Brock. 2007. Do reefs
drive diversification in marine teleosts? Evidence
from the pufferfish and their allies (Order
Tetraodontiformes). Evolution 61: 2104-2126.

Allen, G. R. & J. E. Randall. 1977. Review of the
sharpnose puffers (subfamily Canthigasterinae) of
the Indo-Pacific. Records of the Australian Museum
30(17): 475-517.

Allen, G. R. & R. C. Steene. 1987. Reef Fishes of the Indian
Ocean. T.F.H. Publications, Neptune City, NJ. 240

pp.

Allen, G. R. & R. Swainston. 1988. The Marine Fishes
of North-Western Australia. Western Australian
Museum, Perth, vi + 201 pp.

Anderson, R. C, J. E. Randall & R. H. Kuiter. 1998.
New records of fishes from the Maidive Islands,
with notes on other species. Ichthyological Bulletin
67: 20-32.

Bowen, B. W., A. Muss, L. A. Rocha & W. S. Grant. 2006.
Shallow mtDNA coalescence in Atlantic pygmy
angelfishes (Genus Centropyge) indicates a recent
invasion from the Indian Ocean. Journal of Heredity
97: 1-12

Gilbert, C. H. 1905. The aquatic resources of the
Hawaiian Islands. Part II.— The deep sea fishes.
Bulletin of the United States Fish Commission 23 (for
1903): xi + 713 pp.

Gunther, A. 1873-1910. Andrew Garrett's Fische der
Stidsee. Journal des Museum Godeffroy, parts 3, 6, 9,
11, 13, 15, 16, and 17 in vols. 2, 4 and 6, Hamburg, iv
+ 515 pp., 180 pis.

Jordan, D. S. & B. W. Evermann. 1905. The aquatic
resources of the Hawaiian Islands. Part I. The shore
fishes. Bulletin of the United States Fish Commission 23
(for 1903): xxviii + 574 pp.

Jordan, D. S. & A. Seale. 1906. The fishes of Samoa.

Bulletin of the Bureau of Fisheries (1905) 25: 273-488.
Kosaki, R. K., R. L. Pyle, J. E. Randall & D.K. Irons.
1991. New records of fishes from Johnston Atoll,
with notes on biogeography. Pacific Science 45(2):
186-203.

Kuiter, R. H. 1992. Tropical Reef-Fishes of the Western
Pacific Indonesia and Adjacent Waters. PT Gramedia
Pustake Utama, Jakarta, xiii + 314 pp.

Kuiter, R. H. 1998. Photo Guide to Fishes of the Maldives.

Atoll Editions, Apollo Bay, Victoria. 257 pp.

Kuiter, R. H. & T. Tonozuka. 2001. Indonesian Reef Fishes.

Zoonetics, Melbourne, iv + 893 pp.

Laboute, P. & R. Grandperrin. 2000. Poissons deNouvelle-
Caledonie. Editions Catherine Ledru, Noumea. 520

pp.

Lieske, E. & R. F. Myers. 2004. Coral Reef Guide Red Sea.

Smithiana Bulletin 9: 3-13

The Canthigaster coronata species complex 11

Harper Collins, London. 384 pp.

Lobel, P. S. 2003. The Marine Life of Johnston Atoll. Natural
World Press, Vida, OR. 128 pp.

Masuda, H., K. Amaoka, C. Araga, T. Uyeno & T. Yoshino
(eds.). 1984. The Fishes of the Japanese Archipelago.
Vol. 1 (text: xxii + 437 pp.) and vol. 2 (plates). Tokai
University Press, Tokyo.

Masuda, H. & Y. Kobayashi. 1994. Grand Atlas of Life
Fish Modes. Tokai University Press, Tokyo. 465 pp.
(in Japanese).

Matsuura, K. 1986. A new sharpnose pufferfish,
Canthigaster flavoreticulata, collected from the South
Pacific. Japanese Journal of Ichthyology 33(3): 223-224.

Matsuura, K. 1992. A new sharpnose puffer, Canthigaster
punctata (Teleostei: Tetraodontidae) from the
Mascarene Submarine Ridge, Western Indian Ocean.
Bulletin of the National Science Museum (Tokyo), ser.
A (Zool.) 18(3): 127-130.

McCulloch, A. R. 1922. Notes and illustrations of
Queensland fishes. No. 3. Memoirs of the Queensland
Museum 7(4): 241- 245.

Myers, R. F. 1999. Micronesian Reef Fishes. Coral Graphics,
Guam, vi + 330 pp.

Randall, J. E. 1983. Red Sea Reef Fishes. IMMEL
Publishing, London. 192 pp.

Randall, J. E., G. R. Allen & R. C. Steene. 1990. Fishes
of the Great Barrier Reef and Coral Sea. University of
Hawaii Press, Honolulu, xx + 507 pp.

Randall, J. E. & A. C. Anderson. 1993. Annotated
checklist of the epipelagic and shore fishes of the
Maidive Islands. Bulletin of the J.L.B. Smith Institute
of Ichthyology 59: 1-47.

Randall, J. E. & A. Cea Egana. 1989. Canthigaster
cyanetron, a new toby (Teleostei: Tetraodontidae)
from Easter Island. Revue frangaise d'Acjuariologie

15(3) (1988): 93-96.

Richardson, J. 1845. The Zoology of the Voyage ofH.M.S.
Sulfur, Captain Sir Edward Belcher, during the years
1836-42. Ichthyology. - Part III. Smith, Elder and Co.,
Comhill. 99-150 pp.

Rocha, L. A. 2004. Mitochondrial DNA and color pattern
variation in three western Atlantic Halichoeres
(Labridae), with the revalidation of two species.
Copeia 2004: 770-782.

Rocha, L. A., M. T. Craig & B. W. Bowen. 2007.
Phylogeography and the conservation of coral reef
fishes. Coral Reefs 26: 501-512.

Shen, S.-C. & P.-C. Lim. 1974. Study on the plectognath
fishes - B. The family Canthigasteridae. Bulletin of
the Institute of Zoology, Academia Sinica 13(1): 15-34.

Smith, M. M. & P. C. Heemstra (eds.). 1986. Smiths' Sea
Fishes. Macmillan South Africa, Johannesburg, xx +
1047 pp.

Struhsaker, P. 1973. A contribution to the systematics
and ecology of Hawaiian bathyal fishes. PhD thesis.
University of Hawai'i, Honolulu, xv + 482 pp.

Tyler, J. C. 1967. A diagnosis of the two transversely
barred Indo-Pacific pufferfishes of the genus
Canthigaster ( valentini and coronatus ). Proceedings of
the Academy of Natural Sciences of Philadelphia 119(2):
53-73.

Tyler, J. C. 1980. Osteology, phylogeny, and higher
classification of the fishes of the Order Plectognathi
(Tetraotdontiformes). NOAA Technical Report NMFS
Circular 434: xi + 422 pp.

Vaillant, L. L. & H. E. Sauvage. 1875. Note sur quelques
especes nouvelles de poissons des lies Sandwich.
Revue et Magasin de Zoologie, ser. 3, 3: 278-2871.

Whitley, G. P. 1931. New names for Australian fishes.
Australian Zoologist 6(4): 310-334.

Smithiana Bulletin 9: 3-13

12 Randall, Williams & Rocha

PLATE 1

A. Canthigaster coronata, BPBM 8497, 73 mm, 0‘ahu,
Hawaiian Is. (J. E. Randall).

C. Canthigaster axiologa, BPBM 7267, 54 mm,
Shirahama, Japan (J. E. Randall).

E. Canthigaster axiologa, Palau, ROM 79420, 33 mm
(R. Winterbottom).

G. Canthigaster axiologa, Lan Yu, Taiwan (J. E.
Randall).

B. Canthigaster coronata, 0‘ahu, Hawaiian Is. (J. E
Randall).

D. Canthigaster axiologa, Guam, Mariana Is. (R. F.
Myers).

H. Canthigaster axiologa, Bali, Indonesia (R. F.
Myers).

Smithiana Bulletin 9: 3-13

The Canthigaster coronata species complex 13

PLATE 2

C. Canthigaster cyanospilota, holotype, BPBM 13898,
85 mm, Gulf of Aqaba (J. E. Randall).

E. Canthigaster cyanospilota, Gulf of Aqaba (J. E.
Randall).

G. Canthigaster cyanospilota, Mauritius (J. E.
Randall).

B. Canthigaster axiologa, Lady Musgrave I., Great
Barrier Reef (J. E. Randall).

D. Canthigaster cyanospilota, Gulf of Aqaba (J. E.
Randall).

F. Canthigaster cyanospilota, BPBM 20022, 64 mm,
Reunion (J. E. Randall).

H. Canthigaster cyanospilota, North Male Atoll,
Maidive Islands (J. E. Randall).

Smithiana Bulletin 9: 3-13

Cirrhitops mascarenensis, a new species of hawkfish from
the Mascarene Islands, southwestern Indian Ocean

John E. Randall1 and Jennifer K. Schultz2

bishop Museum, 1525 Bernice St, Honolulu, HI 96817-2704, USA
2Hawaii Institute of Marine Biology, University of Hawaii,
P.O. Box 1346, Kaneohe, HI 96744, USA

Received 26 April 2008, accepted 1 July 2008

Abstract. The hawkfish Cirrhitops mascarenensis is described as a new species from 12 specimens collected
from 4-62 m on reefs of Mauritius (type locality) and Reunion, and is also reported from Madagascar. It has
long been identified as C. fasciatus (Bennett), otherwise known only from the Hawaiian Islands. Although
there is some difference in life colour of fish between the two archipelagoes, as would be expected from the
vast distance separating them, it could not be linked to any definitive morphological or meristic differences,
except for apparent larger size in the Hawaiian Islands (largest specimen, 91 mm SL, compared to 75 mm SL in
the Mascarene Islands). However, mitochondrial DNA comparisons (cytochrome b and cytochrome c oxidase
I) reveal high levels of divergence (11% and 6%, respectively), consistent with species-level designation.

Keywords: Cirrhitidae, Cirrhitops, new species, Mascarene Islands

INTRODUCTION

The hawkfish Cirrhitops fasciatus was described by E.T.
Bennett (1828: 39) as Cirrhites fasciatus (the generic name
a frequent misspelling of Cirrhitus), with a type locality
of Sandwich Islands (Hawaiian Islands). Cuvier in
Cuvier & Valenciennes (1829: 76, pi. 47) described a
new hawkfish with the same name, giving the type
locality as Pondichery, India. Gunther (1860: 73)
believed that Bennett's date of publication was 1829,
but later in the same year that Cuvier's description
of fasciatus appeared, so he provided the replacement
name Cirrhites cinctus for Bennett's species. He listed
four specimens in the British Museum (now the
Natural History Museum): Bennett's holotype from
the Hawaiian Islands (we provide its photograph here

Fig. 1. Holotype of Cirrhitops fasciatus (Bennett),
BMNH 1855.12.26.495, 71.5 mm, Mauritius.

as Fig-. 1), one from Madagascar, one from Mauritius,
and a fourth from an unstated locality, noted as "not in
good state." Fowler (1938: 49) realized that the correct
date for Bennett is 1828; therefore Cuvier's C. fasciatus
is the junior homonym. He proposed the new name
Ambly cirrhitus indicus for Cuvier's specimen. However,
Randall (2001: 870) showed that Cuvier's C. fasciatus
from India is the western Atlantic Ambly cirrhitus pinos
Mowbray in Breder (1927), a result of locality error, and
Fowler's replacement name is invalid.

Smith (1951: 637) reviewed the Cirrhitidae of the
western Indian Ocean. He created the new genus
Cirrhitops for Cirrhites fasciatus Bennett, which he
mistakenly regarded as a synonym of C. cinctus
(Gunther). He also erred in writing, " Ambly cirrhites
hubbardi Schultz, 1943, is almost certainly a juvenile of
this species."

In a review of the Cirrhitidae, Randall (1963) recog¬
nized the genus Cirrhitops for two species, C. fasciatus
and C. hubbardi, the latter then known from the Phoenix
Islands (type locality) and the Tuamotu Archipelago,
now recorded west to Tonga in the South Pacific and
the Ogasawara Islands in the North Pacific. He listed
C. fasciatus from the Hawaiian Islands, Yokohama
(this Japanese locality subsequently determined as an
error), and the Gunther records from Mauritius and
Madagascar.

The first author collected and photographed
Cirrhitops fasciatus in 1973 in Mauritius (Fig. 2) and
Reunion. He later photographed it underwater in
Mauritius (Fig. 3). There are some differences in colour

Smithiana Bulletin 9: 15 - 20

16 Randall & Heemstra

from the species in the Hawaiian Islands (Fig. 4),
where it is known throughout the archipelago from the
island of Hawaii to Midway (but not Johnston Atoll to
the south). Fish in the Mascarene Islands have a fifth
narrow reddish brown bar on the body before the large
oval black spot on the caudal peduncle, compared to
only a trace of a fifth bar on the Hawaiian fish. Also,
the first four dark bars do not extend as far ventrally
on the body in the Mascarene individuals, and there
are large reddish blotches instead of a single narrow
bar in the pale ventral interspaces. No morphological
or meristic differences were found to distinguish
Mascarene from Hawaiian specimens. Both have the
same fin-ray counts, 49-52 lateral-line scales, 17-19 gill
rakers, and the same number of preopercular serrae
(increasing with growth). Over the years, no specimens
of C. fasciatus have been found in the vast distance
between the Mascarene Islands and the Hawaiian
Islands, and C. fasciatus has continued to be regarded as
a single species with a remarkable disjunct population
(Randall, 2007: 202).

We recently asked Daniel Pelicier, an aquarium-fish
collector in Mauritius, if he could provide specimens of
Cirrhitops fasciatus preserved in ethanol. He sent us two.
The second author made a comparison of the DNA with
fresh material of the species collected on O'ahu by the
first author. Her results (Fig. 5) indicate species-level
differentiation. We describe the Mascarene hawkfish
here as a new species.

MATERIALS AND METHODS

Type specimens are deposited at the Natural History
Museum, London (BMNH); Bernice P. Bishop Museum,
Honolulu (BPBM); Museum National d'Histoire
Naturelle, Paris (MNHN); National Museum of Nature
and Science, Tokyo (NSMT), and the National Museum
of Natural History, Washington, D. C. (USNM).

Lengths of specimens are given as standard length
(SL), measured from the median anterior point of the
upper lip to the base of the caudal fin (posterior end of
the hypural plate); body depth is the maximum depth;
body width is measured at the base of the pectoral fins;
head length (HL) from the front of the upper lip to the
posterior end of the opercular membrane, and snout
length from the same anterior point to the nearest fleshy
edge of the orbit; orbit diameter is the greatest fleshy
diameter, and interorbital width the least fleshy width;
upper-jaw length is taken from the front of the upper lip
to the end of the maxilla; caudal-peduncle depth is the
least depth, and caudal-peduncle length the horizontal
distance between verticals at the rear base of the anal
fin and the caudal-fin base; lengths of spines and rays
are measured from the extreme base of these elements;
caudal- and pectoral-fin lengths are the length of the
longest ray; caudal concavity is the horizontal distance

between tips of the longest and shortest principal
caudal rays; pelvic-fin length is measured from the
base of the pelvic spine to the tip of the longest soft
ray. The counts of lateral-line scales include one pored
scale on the base of the caudal fin. The gill-raker counts
contain rudiments; the raker at the angle is included
in the lower-limb count. Morphometric data presented
in Table 1 as percentages of the SL. Proportional
measurements in the text are rounded to the nearest
0.05. Data in parentheses refer to paratypes.

For genetic analyses, a 1 mm fin clip was obtained
from two Mascarene specimens and three Hawaiian
specimens. A single specimen of Amblycirrhitus
bimacula (on display at the Waikiki Aquarium) was
used as an outgroup. We were unable to obtain
congeneric specimens of Cirrhitops hubbardi, due to
its scarcity and remote distribution. Total genomic
DNA was isolated by heating the fin clip in 50mM
NaOH at 95° C for 20 minutes and neutralizing the
solution with lOuL of 1M Tris, following the protocol
devised by Meeker et al. (2007). We amplified a 750
base pair region of the mitochondrial cytochrome b
gene using primer sequences designed by Song et al.
(1998) and Taberlet et al. (1992), respectively: heavy
strand 5'GTGACTTGAAAAACCACCGTTG and light
strand 5' A AT AGG A AGT AT C. ATT CGGGTTTG ATG.
We also amplified a 650 base pair region of the
mitochondrial cytochrome c oxidase I gene (also
known as the DNA barcoding gene) using primer
sequences described in Ward et al. (2005): FishF2
5'TCGACTAATCATAAAGATATCGGCAC and
FishR2 5'ACTTCAGGGTGACCGAAGAATCAGAA.
All reactions consisted of 0.26 pM each primer, 2 mM
dNTPs, 3 mM MgCl2, 0.5 units of polymerase, and
30-80ng extracted DNA in the following PCR protocol:
an initial denaturation step at 94 °C for four minutes,
followed by 35 cycles of 94°, 60 s; 50°, 30 s; 72° 45 s
and a final extension at 72 °C for 10 minutes. The PCR
product was prepared for automated sequencing using
a 1:1 exonuclease: shrimp alkaline phosphatase mix
(USB Corp., Cleveland OH). Sequencing in the forward
and reverse direction was performed on an ABI 3730XL
DNA Analyzer by the University of Hawaii Advanced
Studies of Genomics, Proteomics and Bioinformatics
Facility. DNA sequences were edited using Sequencher
version 4.52b (Gene Codes Corporation, Ann Arbor,
MI.) and are available in Genbank (accession nos.
EU684131-EU684140). Pairwise sequence comparisons
were used to calculate genetic distances as performed
in PAUP version 4.0 (Swofford 2002). Phylogenetic
trees were constructed in PAUP using maximum
parsimony and maximum likelihood methods, via an
exhaustive search. Amblycirrhitus bimacula sequences
were used to root the tree. Confidence in tree topology
was evaluated by bootstrapping over 1000 replicates
(Felsenstein 1985).

Smithiana Bulletin 9: 15-20

New Cirrhitops from the Mascarene Islands 17

Cirrhitops mascarenensis sp. nov.

Figs. 2, 3; Table 1

Cirrhites cinctus (in part) Gunther, 1860: 73 (Mauritius
and Madagascar).

Cirrhitops fasciatus (non Bennett) Randall, 1963: 420
(Madagascar and Mauritius, after Gunther, 1860).

Holotype. BPBM 20207, 59 mm, Mauritius, east coast,
100 m south of pass to Trou d'Eau Douce, fringing reef
in 5 m, rotenone, J. E. Randall, 7 November 1973.

Paratypes. BPBM 20067, 2: 37-56 mm. Reunion, west
coast. Cap la Houssaye, fringing reef, 12 m, rotenone, J.
E. Randall, 23 October 1973; MNHN 2008-1189, 57 mm,
and NSMT-P 79975, 56 mm, same data as preceding;
USNM 349784, 56 mm, Mauritius, west coast, Baie de
la Petite Riviere, off Albion Fisheries Research Center,
20°12'30"S, 57°23'E, 10-12 m, P. C. Heemstra, D. G.
Smith, and A. C. Gill, 26 April 1995; USNM 349785, 55
mm, same locality, except 57°23'30"E, 4-8 m, A. C. Gill,
D. G. Smith, M. J. Smale, B. Galil, and P. Clark, 4 May
1995; USNM 349786, 59 mm, Mauritius, west coast. Flic
en Flac, 30 m north of pass, 20°16' S, 57°22'E, 4-10 m, P.
C. Heemstra, A. C. Gill, D. G. Smith, and M. J. Smale,
5 May 1995; USNM 349787, 2: 51-64 mm, Mauritius,
southwest coast, Le Morne (Passe de l'Ambulante),
20°26"10"S, 57°17,36"E, 25-26 m, P. C. Heemstra, A. C.
Gill, D. G. Smith, M. J. Smale, P. Clark, and B. Galil,
18 May 1995; BPBM 40889, 53 mm, Mauritius, Rampart
Serpent, off Belle lie, 25 m, D. Pelicier, hand net, 8 May
2007; BPBM 40890, 75 mm, Mauritius, off Womar,
Chameau la Pirogue, 62 m, hand net, D. Pelicier, 15
January 2008.

Fig. 2. Holotype of Cirrhitops mascarenensis, BPBM
20207, 59 mm SL, Mauritius.

Diagnosis. Dorsal rays X,14; anal rays 111,6; pectoral rays
14 (rarely 15), the lower 6 unbranched and thickened;
gill rakers 4-5 + 13-14; lateral-line scales 49-52; scales
above lateral line to origin of dorsal fin 4; serrae on
margin of preopercle 14-24 (increasing, in general, with
growth); caudal fin slightly emarginate; red dorsally,
white ventrally, with five slightly oblique, reddish
brown bars on body below dorsal fin; a large oblong

black spot anteriorly on caudal peduncle; a dark brown
spot on opercle; ventral half of body with brownish red
blotches of eye to pupil size; largest specimen, 75 mm
SL.

Description. Dorsal-fin rays X,14, all soft rays branched;
anal-fin rays 111,6, the soft rays branched except first;
pectoral-fin rays 14 (15 on one side of one paratype), the
uppermost and lower 6 unbranched; pelvic-fin rays 1,5;
principal caudal-fin rays 15, the middle 13 branched;
upper and lower procurrent caudal-fin rays 13 or 14,
the posterior 2 segmented; lateral-line scales 50 (49-52);
scales above lateral line to origin of dorsal fin 4; scales
below lateral line to origin of anal fin 12; oblique rows of
large scales on cheek 5; circumpeduncular scales 25; gill
rakers 5 + 14 (4-5 + 13-14); pseudobranchial filaments
9; branchiostegal rays 6; vertebrae 26.

Body depth 2.95 (2. 9-3. 3) in SL; body compressed,
the width 2.35 (1.95-2.3) in body depth; head length
2.7 (2. 7-2. 8) in SL; snout length 3.15 (3. 1-3.3) in HL;
orbit diameter 4.15 (3.4-4.35) in HL; interorbital space
distinctly concave, the least width 7.2 (6.8-7.45) in HL;
caudal-peduncle depth 2.7 (2.65-3.0) in HL; caudal-
peduncle length 1.8 (1.75-1.9) in HL.

Mouth terminal and oblique, forming an angle of
about 20° to horizontal axis of body; maxilla reaching
between verticals at anterior edge of orbit and centre
of eye, the upper-jaw length 2.65 (2.6-2 .7) in HL; upper
jaw with an outer row of stout conical teeth that curve
slightly medially and posteriorly, the three at corner
of jaw largest (about one-third pupil diameter in
length), with a pair of smaller teeth in symphyseal gap;
remaining teeth of outer row continuing progressively
shorter to end of jaw; a broad band of villiform teeth
behind anterior conical teeth, progressively narrower
posteriorly; lower jaw with an outer row of stout
conical teeth, four or five nearly half way back in jaw
much larger (the largest as long as largest upper tooth);
a broad band of villiform teeth anteriorly in lower jaw
behind conical teeth, narrowing and ending medial to
large conical teeth on side of jaw; vomer and palatines
with incurving villiform teeth in two irregular rows,
those on vomer in a broad V-shape. Tongue strongly
pointed, the tip nearly reaching vomerine teeth when
mouth closed. Gill rakers moderately long, the longest
at angle as long as longest gill filament of first row.

Opercle ending posteriorly in a flat pointed spine, the
tip forming an angle of about 70°; opercular membrane
extending a pupil diameter posterior to spine; edge of
preopercle broadly rounded, the upper half with 24
(14-24) coarse serrae, the number increasing, in general,
with growth; scale-like free end of posttemporal with 5
(4-6) small serrae.

Anterior nostril before upper edge of pupil about
one-third distance to base of upper lip, consisting of a
short membranous tube with a posterior flap ending
in about 8 long cirri that extend well beyond posterior
nostril when laid back; posterior nostril oval, with
a short rim, one nostril diameter behind and slightly

Smithiana Bulletin 9: 15-20

18 Randall & Heemstra

medial to anterior nostril.

Scales cycloid and adherent; scales on nape extending
forward to above posterior margin of orbit; scales
on cheek in straight oblique rows; scales on opercle
embedded, small anteriorly, becoming as large as body
scales posteriorly; scales ventrally on head small and
embedded; no scales on snout or maxilla; small scales
basally on fins, progressively smaller distally, those
on caudal fin reaching at least two-thirds distance to
posterior margin of fin (scales on fins easily lost).

Origin of dorsal fin above opercular spine, the
predorsal length 2.8 (2.8-2. 9) in SL; dorsal spines with
a tuft of 7-9 slender cirri (as few as 4 on small paratype)
extending dorsally from distal end of fin membrane
behind spine tip; first dorsal spine 4.3 (4.2-4.65) in HL;

sixth dorsal spine usually longest, but fifth and seventh
spines subequal, 2.1 (2.0-2.2) in HL; first dorsal soft ray
longest, 1.6 (1.65-1.85) in HL; origin of anal fin below
base of second to third dorsal soft ray, the preanal
length 1.45 (1.5-1.55) in SL; first anal spine 2.7 (2.7-3.0)
in HL; second anal spine clearly longest, 1.85 (1.65-
1.85) in HL; second anal soft ray longest, 1.7 (1.5-1. 7)
in HL; caudal-fin length (fin tips broken in holotype
and largest paratype) 1.35-1.5 in HL; caudal concavity
9.0-13.7 in HL; lower five pectoral rays thickened, the
tenth to twelfth abruptly longer, the tenth or eleventh
longest, 2.95 (2.6-2.95) in SL; pelvic fins below base of
fifth dorsal spine, the prepelvic length 2.3 (2.3-2.4) in
SL; first pelvic soft ray longest, reaching or extending
slightly posterior to anus, 1.65 (1.45-1.7) in HL.

Table 1. Proportional measurement of type specimens of Cirrhitops mascarenensis as percentages of the
standard length.

Holotype

Paratypes

BPBM

20702

BPBM

20067

USNM

349787

BPBM

20067

MNHN

08-1189

USNM

349786

USNM

349787

BPBM

40890

Standard length (mm)

59

37

51

56

57

59

64

75

Body depth

33.7

30.2

32.4

33.3

31.7

32.5

32.3

34.7

Body width

14.3

13.8

15.5

14.3

15.7

15.6

15.3

15.4

Head length

36.7

36.7

36.9

37.2

36.8

37.1

37.2

35.9

Snout length

11.7

11.1

11.6

11.6

11.9

12.0

11.8

10.8

Orbit diameter

8.9

10.8

9.6

9.0

9.1

9.0

8.7

8.3

Interorbital width

5.1

5.4

5.1

5.3

5.1

5.0

5.4

5.3

Upper -jaw length

13.9

13.6

13.9

13.7

14.0

14.2

14.1

13.9

Caudal-peduncle depth

13.5

13.4

12.4

12.6

12.3

12.3

12.4

13.6

Caudal-peduncle length

20.3

21.2

20.7

20.5

19.3

20.2

19.3

19.4

Predorsal length

35.4

34.9

34.8

35.6

34.9

34.4

34.3

34.7

Preanal length

68.4

64.6

65.6

66.3

65.4

66.3

65.5

66.6

Prepelvic length

43.6

41.7

43.0

42.4

43.2

43.5

42.5

43.7

Dorsal-fin base

61.7

57.9

57.5

60.2

61.2

57.8

58.1

61.9

First dorsal spine

8.5

8.4

8.8

8.2

8.5

8.4

8.0

8.0

Longest dorsal spine

17.5

18.2

18.0

16.9

17.1

17.0

17.2

16.9

Longest dorsal ray

23.0

22.4

22.2

21.7

21.5

20.0

22.7

23.4

Anal-fin base

16.0

16.2

16.3

16.4

16.9

16.7

16.8

16.6

First anal spine

13.6

13.3

13.5

12.3

13.5

13.6

12.5

12.4

Second anal spine

20.1

20.9

22.1

21.5

19.9

22.0

21.8

20.0

Longest anal ray

21.4

23.1

23.5

21.7

23.2

21.9

22.3

23.9

Caudal-fin length

broken

27.1

27.0

24.7

26.3

27.3

24.4

broken

Pectoral-fin length

33.6

38.4

37.6

34.0

35.2

35.9

36.4

34.6

Pelvic spine

15.6

16.3

16.9

14.6

14.7

15.5

15.2

15.0

Pelvic-fin length

22.1

25.1

25.2

21.8

23.3

23.2

22.2

23.6

Smithicma Bulletin 9: 15-20

New Cirrhitops from the Mascarene Islands 19

Colour of holotype in alcohol pale yellowish brown
with five, slightly oblique, faint dark bars below dorsal
fin that extend about half way down on body; first
dark bar merging dorsally with dark area on nape; pale
interspaces on body about half width of dark bars; a
large oblique, oval, darker brown spot anteriorly on
caudal peduncle; a dark brown spot nearly as large as
eye posteriorly on opercle; fins pale yellowish.

Fig. 3. Underwater photograph of Cirrhitops

mascarenensis, Mauritius.

Paratypes collected from below about 20 m have
red bars in life that are lost in alcohol; however, the
black spot on the caudal peduncle and the dark brown
spot on opercle persist in preserved specimens. The
paratypes of BPBM 40889, BPBM 40890, and USNM
349787 were collected deeper than 25 m, and all are
uniformly pale in alcohol except for the opercular and
peduncular black spots.

Colour of holotype when fresh as in Fig. 2. The
underwater photograph of Fig. 3 shows the life colour.

We compared Mascarene and Hawaiian Cirrhitops
specimens at two mitochondrial genes: a 741 base
pair region of the cytochrome b gene and a 643 base
pair region of the cytochrome c oxidase I gene.

- — - Amblyeirrhitus bimacula

Hawaii (2)

99/100

100/100

Hawaii (1)

Cirrhitops spp.
Mauritius (1)

Cytochrome b analyses revealed 86 variable nucleotide
sites of which 80 were parsimony informative, with
a transition: transversion ratio of 5:1. There were two
haplotypes in three Hawaiian specimens and two
Mascarene haplotypes. Pairwise genetic distances
between locations ( d = 0.11) were 15 to 100 times
greater than within location distances ( d = 0.001, 0.007
Hawai'i and Mauritius respectively). Cytochrome c
oxidase I analyses were similarly robust. Of 41 variable
nucleotide sites, 39 were parsimony informative, with
a transition: transversion ratio of 12:1. There were two
haplotypes in three individuals collected from Hawai'i
and two Mascarene haplotypes. Pairwise genetic
distances between locations ( d = 0.06) were lower than
observed at the cytochrome b gene, but at least an order
of magnitude greater than within location distances (d
= Q.0016).

Genetic distances between Cirrhitops and the
outgroup, Amblyeirrhitus bimacula (cytochrome b, d
= 0.20; cytochrome oxidase, d = 0.18, 0.21 Hawaii
and Mauritius, respectively) were high. Phylogenetic
analyses converged on a single tree topology for
both mitochondrial markers and using two methods
of analysis (Fig. 5). High bootstrap values (99-100)
reflect strong differentiation between Mascarene and
Hawaiian specimens.

Fig. 4. Underwater photograph of Cirrhitops fasciatus,
0‘ahu, Hawaiian Islands.

Material of Cirritops fasciatus examined. Hawaiian
Islands, O'ahu: BPBM 349, 87 mm; BPBM 1806-1808, 3:
70-80 mm; BPBM 2111-2113, 3: 74-80 mm; BPBM 4128,
5: 77-91 mm; BPBM 6348, 6: 33-78 mm; BPBM 6454, 69
mm; BPBM 8899, 2: 33-35 mm; BPBM 40485. 81 mm.
Hawai'i: BPBM 25913, 31 mm. Nehoa: BPBM 9163, 33
mm. Midway: BPBM 34818, 2: 56-81 mm.

Etymology. This species is named Cirrhitops mascaren¬
ensis for its occurrence in the Mascarene islands of
Mauritius and Reunion.

L Mauritius (1)

, y>

— — — 0.05 substitutions/site

Fig. 5. Maximum likelihood phylogenetic tree of
the cytochrome b gene. Number of specimens
in parentheses. Numbers on branches reflect
bootstrap support for maximum parsimony/
maximum likelihood analyses.

Remarks. Our record of Cirrhitops mascarenensis from
Madagascar is the listing by Gunther (1860: 73) as Cirrhites
cinctus, an unnecessary replacement name. Gunther's
specimen, 71 mm SL, collected by J. E. Gray, was found
unregistered by James Maclaine in the Natural History
Museum, London. It was assigned the number BMNH
2008.4.14.1. A photograph of the specimen was readily

Smithiana Bulletin 9: 15-20

20 Randall & Heemstra

identified by us as C. mascarenensis.

This species was not reported from Rodrigues, the
most eastern of the Mascarene Islands, in a preliminary
checklist of the fishes of the island (Heemstra et al.,
2004), but it might be expected from there.

Gunther regarded his specimens from the
Madagascar and Mauritius as the same species as
Bennett's holotype of Cirrhitops fasciatus from the
Hawaiian Islands, and he was followed by Randall
(1963) in a review of the family. Although we later
noticed a difference in life colour in the two widely
separated populations, no morphological differences
were found, and the ranges in lateral-line scale and gill-
raker counts are the same. However, the DNA results
are unequivocal as two species.

There is reciprocal monophyly and high
sequence divergence between the Mascarene and
Hawaiian specimens. Eleven percent divergence at
the mitochondrial cytochrome b gene, which has a
divergence rate of 2% per million years as calibrated
in multiple fish species (Bowen et al., 2001), constitutes
approximately 5.5 million years of reproductive
isolation. A barcoding survey of 200 fish species
performed by Ward et al. (2005) reports an average of
0.39% divergence within species and 9.9% divergence
within genera. We find 0.16% divergence within species
and 6.2% divergence between Mascarene and Hawaiian
specimens at the barcoding gene (cytochrome c oxidase
I). Therefore, genetic analyses support species-level
differentiation.

Based on existing museum material, the Hawaiian
species is larger. The largest of our 14 type specimens
of Cirrhitops mascarenensis measures 75 mm SL. Twelve
of our 26 Bishop Museum specimens of C. fasciatus are
larger than 75 mm, the largest 91 mm SL.

ACKNOWLEDGEMENTS

We are indebted to Daniel Pelicier for providing the
specimens of Cirrhitops mascarenensis from Mauritius
for our DNA analysis; Gordon Tribble for logistic
support in obtaining fresh material of C. fasciatus on
O'ahu; Charles Delbeek of the Waikiki Aquarium for
tissue sample of our outgroup species, Amblycirrhitus
bimacula; James Maclaine of the Natural History
Museum in London for data of Bennett and Gunther
specimens of C. mascarenensis and Phil Hurst for their
photographs (copyright Natural History Museum,
London); Jeffrey T. Williams for the loan of specimens
from the National Museum of Natural History; and
Ofer Gon for data on specimens in the fish collection
of the South African Institute for Aquatic Biodiversity.
Funding for DNA sequencing was provided by the U.
S. National Science Foundation (IGE05-49514 to JKS via
B.A. Wilcox). The manuscript was reviewed by Gerald
R. Allen, Philip C. Heemstra and Helen A. Randall.

LITERATURE CITED

Bennett, E. T. 1828. Observations on the fishes contained
in the collection of the zoological society. On some
fishes from the sandwich islands. Zoological Journal
4 (13): 31-42.

Bowen, B. W., A. L. Bass, L. A. Rocha, W. S. Grant
& D. R. Robertson. 2001. Phylogeography of the
trumpetfish ( Aulostomus spp.): ring species complex
on a global scale. Evolution 55: 1029-1039.

Breder, C. M., Jr. 1927. Scientific results of the first
oceanographic expedition of the "Pawnee" 1925.
Fishes. Bulletin of the Bingham Oceanographic
Collection, Yale University 1(1): 1-90.

Cuvier, G. & A. Valenciennes. 1829. Histoire Naturelle des
Pozssozzs,vol.3.ChezF.G.Levrault,Paris.xxvii+500pp.

FelsensteinJ. 1985. Confidence limits on phylogenies: an
approachusingthebootstrap.Euo/zzfzo;z39(4):783-791.

Fowler, H . W. 1 938. Descriptions of new fishes obtained by
the United States Bureau of Fisheries steamer
"Albatross," chiefly in Philippines seas and adjacent
waters. Proceedings of the United S tates National Museu m
85: 31-135.

Gunther, A. 1860. Catalogue of the Acanthopterygian
Fishes in the Collection of the British Museum. British
Museum, London, xxi + 548 pp.

Heemstra, E., P. Heemstra, M. Smale, T. Hooper & D.
Pelicier. 2004. Preliminary checklist of coastal fishes
from the Mauritian island of Rodrigues. Journal of
Natural History 38: 3315-3344.

Meeker, N. D., S. A. Hutchinson, L. Ho & N. S. Trede. 2007.
Method for isolation of PCR-ready genomic DNA
from zebrafish tissues. BioTechnicjues 43: 610-614.
Randall, J. E. 1963. Review of the hawkfishes
(family Cirrhitidae). Proceedings of the United States
National Museum 114: 389-451.

Randall, J. E. 2001. Hawkfish Amblycirrhitus indicus
Fowler, 1938: a junior synonym of Amblycirrhitus
pinos (Mowbray, 1927), the result of locality error.
Copeia 2001 (3): 870-871.

Randall, J. E. 2007. Reef and Shore Fishes of the Hawaiian
Islands. Sea Grant College Program of the University
of Hawaii, Honolulu, xvii + 546 pp.

Smith, J. L. B. 1951. The fishes of the family Cirrhitidae
of the western Indian Ocean. Annals and Magazine of
Natural History, ser. 12, 4: 625-652.

Song, C. B., T. J. Near & L. M. Page. 1998. Phylogenetic
relations among percid fishes as inferred from
mitochondrial cytochrome b DNA sequence data.
Molecular Phylogenetics and Evolution 10: 343-353.

Swofford, D. L. 2002. PAUP: phylogeny analysis using
parsimony Version 4. Sinauer Associates, MA. 144 pp.
Taberlet, P., A. Meyer & J. Bouvet. 1992. Unusually
large mitochrondrial variation in populations of the
blue tit, Parus caeruleus. Molecular Ecology 1: 27-36.

Ward, R. D., T. S. Zemlak, B. H. Innes, P. R. Last &
P. D. N. Hebert. 2005. Barcoding Australia's fish
species. Philosophical Transactions of the Royal Society
of London, ser. B, no. 360: 1847-1857.

Smithiana Bulletin 9: 15-20

Ammodytoides xanthops, a new sp ecies of sandlance
(Perciformes: Ammodytidae) from Mozambique

John E. Randall1 and Phillip C. Heemstra2

bishop Museum, 1525 Bernice St, Honolulu, HI 96817-2704, USA
2South African Institute for Aquatic Biodiversity,

Private Bag 1015, Grahamstown, South Africa

Received 30 June 2008, accepted 20 September 2008

Abstract. The sandlance Ammodytoides xanthops is described as a new species from 19 specimens, 104-122
mm SL, collected by trawl off Mozambique from 26-62 m. It is distinct from the other species of the genus
in the following combination of characters: dorsal rays 48 or 49; anal rays 23 or 24; pectoral rays 15 or 16;
lateral-line scales 106-112; no small scales dorsally on opercle; vertebrae 57-59; body depth 10.0-11.7% SL;
eye diameter 3.3-3.5% SL; a blackish posterior border on caudal fin, broader toward lobe tips; a series of 6 or
7 black spots at edge of dorsal fin; no black dots in fins; interorbital and most of head anterior to eye yellow
in life.

Keywords: Ammodytidae, Ammodytoides, new species, Mozambique

INTRODUCTION

The small slender fishes of the family Ammodytidae,
popularly known as sandlances, feed in aggregations
on zooplankton over open sand bottom. Adaptations
for zooplankton feeding include a protrusible
premaxilla, relatively short snout for close binocular
vision, reduced to absent dentition, and long gill
rakers. When threatened, they form compact schools
that swim at remarkable speed. Their specializations
for swift swimming include their streamlined elongate
body, protective adipose eyelid, forked caudal fin, and
low dorsal and anal fins that fit into a groove. Their
eyes near the centre of the head enable them to view
predators above and below. As a last resort to escape
a predator, they dive into the sand, aided by their
pointed projecting lower jaw and having their fins fold
into grooves.

As scuba divers, we have known the frustration
of trying to collect sandlances. The first author shot
an explosive- tipped -spear at the sand near a school,
expecting the fish to be killed or shinned. The result
was only an increase in speed. Later it was determined
that sandlances lack a swim bladder (fishes with this
gas-filled sac are vulnerable to an explosion).

The Ammodytidae consists of eight genera and 25
species (Ida et al. 1994; Collette & Randall 2000; Randall
& Earle 2008). In addition to the characters mentioned
above, they have small cycloid scales partly fused to
form oblique scale rows, no spines in the fins, a long
dorsal fin, relatively short anal fin, and no pelvic fins
(except for one species with rudimentary pel vies).

The genus Ammodytes Linnaeus, from temperate

and cooler seas of the North Atlantic and North Pacific,
contains six species. It was the largest genus, but recent
discoveries of new species of Ammodytoides Duncker
& Mohr from the Indo-Pacific region have made it the
largest genus, with eight species.

Bean (1895) described the first species of Ammody¬
toides as Bleekeria gilli from an unknown locality in the
Pacific Ocean. Collette & Robertson (2001) redescribed
the species and determined its range from Baja
California to Ecuador and Islas Galapagos. They also
showed that Ammodytes lucasanus Beebe & Tee-Van
1938 is a junior synonym. McCulloch & Waite (1916)
described the second species as Bleekeria vaga from a
single specimen of unknown habitat from Lord Howe
Island. Duncker & Mohr (1939) concluded that this
species does not belong in Bleekeria and proposed the
genus Ammodytoides, with B. vaga as the type species.
Unaware of Ammodytoides, Smith (1957) named the
third species Bleekeria renniei from the east coast of South
Africa at Fekwini (33°25'S) from three specimens found
on the beach after the onset of cold weather. Pietsch &
Zabetian (1990) published an osteological study of the
family Ammodytidae, featuring Embolichthys mitsukurii
(Jordan & Evermann). Ida & Randall (1993) described
Ammodytoides kimurai as a fourth species of the genus
from six specimens collected in the Ogasawara Islands.
The fifth, A. pylei, was described by Randall et al.
(1994) from 10 specimens from the Hawaiian Islands;
these authors also provided information on feeding
and spawning. Ida et al. (1994) revised the generic
classification of the family, adding two new genera
and recognizing Bleekeria for three species, B. kallolepis
Gunther, B. mitsukurii, and B. viridianguilla Fowler.

Smithiana Bulletin 9: 21- 25

22 Randall & Heemstra

Collette & Randall (2000) described A. leptus as a sixth
species of the genus from 23 specimens taken at Pitcairn
Island in the South Pacific. Collette in Carpenter & Niem
(2001) followed Ida et al. (1994) in recognizing Bleekeria
as distinct from Ammodytoides by the presence of teeth
in the jaws and the continuous subocular sensory canal.
Randall & Earle (2008) added two new species, A. idai
from seven specimens collected in the D'Entrecasteaux
Islands, Papua New Guinea, and A. praematura from
one specimen from the Chagos Archipelago. We
suspect that more species of these elusive fishes remain
to be discovered.

The second author and Elaine Heemstra participated
in a recent expedition in the western Indian Ocean
aboard the R/V Fridtjof Nansen. On 16 October 2007
they collected a surprising 18 specimens of a species
of Ammodytoides in one otter trawl haul in 26-28 m at
hours 0715-0742 off the coast of Mozambique. The
specimens are ripe males and females, the ova of the
females fully hydrated. The Hawaiian A. pyle is known
to commence spawning 1.5 hours before sunset. It
might also spawn at the same light level in early
morning. Ordinarily, we would expect species of this
genus to escape an advancing trawl by either speed
or taking refuge in sand. While spawning, however,
they swim higher in the water column and would be
more vulnerable to capture by trawl. On 19 October an
additional specimen was collected by trawling in 62 m.
We describe this species here, following a key to the
species of Ammodytoides.

MATERIALS AND METHODS

Type specimens are deposited in the Australian
Museum, Sydney (AMS); Bernice P. Bishop Museum,
Honolulu (BPBM); California Academy of Sciences,
San Francisco (CAS); Museum National d'Histoire
Naturelle, Paris (MNHN); National Museum of Nature
and Science, Tokyo (NSMT); Royal Ontario Museum,
Toronto (ROM); South African Institute for Aquatic
Biodiversity, Grahamstown (SAIAB); and the National
Museum of Natural History, Washington, D.C.
(USNM).

Lengths recorded for specimens are standard length
(SL), measured from the front of the upper lip in the
median plane to the midbase of the caudal fin (end of
hypural plate). Body depth is the maximum depth from
the base of the dorsal fin to the ventralmost edge of the
abdomen, and body width is the greatest width. Head
length (HL) is taken from the front of the upper lip to
the posterior end of the opercular membrane. Orbit
diameter is the maximum fleshy diameter (measured
to edges of the adipose eyelid), and interorbital width
is the least fleshy width. Caudal-peduncle depth is the
least depth, and caudal-peduncle length the horizontal
distance between verticals at the rear end of the anal
fin and the caudal-fin base. Lengths of dorsal and anal
rays are measured from tip to the body contour (not to
their bases within the groove into which the fins fold).

Caudal-fin length is measured horizontally from the
caudal-fin base to a vertical at the tip of the longest ray;
caudal concavity is the horizontal distance between
verticals at the tips of the longest and shortest caudal
rays.

Gill-raker counts were made on the first gill arch and
include rudiments; the raker at the angle is contained
in the lower-limb count. Vertebral counts include the
hypural.

Data in parentheses in the description of the new
species refer to paratypes. Proportional measurements
in the text are ratios with the standard length, body
depth, and head length, rounded to the nearest 0.05.

KEY TO THE SPECIES OF
AMMODYTOIDES

la Dorsal rays 48-53; lateral-line scales 104-118 .

. 2

lb. Dorsal rays 44-48; lateral-line scales 85-107 .

. 7

2a. Body very slender, the depth 8. 6-9.5% SL;

vertebrae 61-63; dorsal rays 50-53; no dark

markings on fins (Pitcairn Island) . leptus

2b. Body less slender, the depth 9.5-11.7% SL;

vertebrae 56-61 ; dorsal rays 48-51 ; dark markings
on fins present or absent . 3

3a. No small scales dorsally on opercle . 4

3b. Two to four small scales dorsally on opercle (may

be embedded) . 5

4a. Eye diameter 2.8-3.3% SL; a broad blackish zone

at base and middle of each caudal lobe; vertebrae
59-61; lateral-line scales 104-109 (Ogasawara

Islands) . kimurai

4b. Eye diameter 3.3-3. 5% SL; a broad blackish

zone on outer third to half of each caudal-fin
lobe; vertebrae 57-59; lateral-line scales 106-112
(Mozambique) . xanthops, new species

5a. A curved blackish submarginal bar across each

caudal-fin lobe; numerous black dots in dorsal
and anal fins; vertebrae 56-58 (southeastern

Africa) . renniei

5b. No blackish submarginal bar across each caudal

lobe (caudal lobe tips may be broadly blackish);
no black dots in dorsal and anal fins; vertebrae
58-60 . 6

6b. Lateral-line scales 109-116; vertebrae 59-60;

pectoral-fin length 8.4-9. 2% SL; interorbital
width 3.5-4. 1% SL; a row of prominent blackish
spots at edge of dorsal fin, and caudal fin with
a broad dusky posterior margin (Hawaiian

Islands) . pylei

6b. Lateral-line scales 107; vertebrae 58; pectoral-fin

Smithiana Bulletin 9: 21-25

New Ammodytoides species 23

length 10.0% SL; interorbital width 4.3% SL; no
dark markings in fins (one specimen. Lord Howe
Island) . vagus

7a. Head length 25.4=27.8% SL; predorsal length

25.1- 26.9% SL; pectoral-fin length 9.9-11.1% SL;

lateral-line scales 85-98; no small scales dorsally
on opercle (Baja California to Ecuador and Islas
Galapagos) . gilli

7b. Head length 23.9-25.3% SL; predorsal length

23.2- 25.3% SL; pectoral-fin length 9. 0-9. 6% SL;

lateral-line scales 103-107; two to four small
scales dorsally on opercle . 8

8a. A row of about 10 black spots at margin of dorsal
fin except posteriorly; caudal fin with a dusky
posterior margin that broadens toward lobe tips,
at least in males; body width 8. 0-8. 8% SL; longest
dorsal ray 5.2— 5.6% SL; longest anal ray 5. 9-6. 7%

SL (Papua New Guinea) . idai

8b. No black spots at margin of dorsal fin; caudal
fin with a curved blackish bar across each lobe;
body width 6.9% SL; longest dorsal ray 6.9% SL;
longest anal ray 8.2% SL (one 61-mm specimen,
Chagos Archipelago) . praematura

Fig. 1. Holotype of Ammodytoides xanthops, SA1AB 80762, 120 mm SL, Mozambique (photo by P.C. Heemstra).

Ammodytoides xanthops, sp. nov.

Fig. 1; Table 1

Holotype. SAIAB 80762, male, 120 mm SL, Mozambique,
20°33.3,S, 35°47.6'E-20o34,8'S, 35°47.6'E, 62 m, otter
trawl, R/V Fridtjof Nansen Station 75, 19 October 2007.

Paratypes. AMS 1.44650-001, 121 mm; BPBM 40904, 4:
106-122 mm; CAS 227043, 114 mm; MNHN 2008-1232,
110 mm; NSMT- P 91026, 118 mm; ROM 83933, 112 mm;
SAIAB 80761, 7: 104-122 mm; USNM 393562, 2: 107-
121 mm, all from Mozambique, 22°34.0'S, 35°34.0'E-
22°35.4'S, 35°34.1'E, 26-28 m, otter trawl, R/V Fridtjof
Nansen Station 62, 16 October 2007.

Diagnosis. Dorsal rays 48 or 49; anal rays 23 or 24;
pectoral rays 15 orl6 (usually 15); lateral-line scales
106-112; no small scales dorsally on opercle; gill rakers
5-6 + 22-25; vertebrae 57-59; body depth 10.0-11.7%
SL; eye diameter 3. 3-3. 5% SL; colour when fresh dark
purplish gray dorsally, pale silvery blue on sides and
ventrally; interorbital and most of head anterior to eye
yellow; front of snout and tip of lower jaw dusky; a
series of six or seven black spots at edge of dorsal fin;
no black dots in fins; caudal fin with a broad blackish
posterior border; largest specimen, 122 mm SL.

Description. Dorsal rays 48 (48 or 49), the first two
rays unbranched; anal rays 23 (23 or 24), the first three
rays unbranched; pectoral rays 16 (15 or 16), the upper
two and lowermost rays unbranched: no pelvic fins;
principal caudal rays 15, the middle 13 branched;
upper and lower procurrent caudal rays about 15, the

posterior three segmented; lateral line incomplete, the
tubed scales 109 (106-112) + 4 (3-6) pored (non-tubed)
scales to caudal-fin base; predorsal scales 11; gill rakers
6 + 24 (5 or 6 + 22-25); branchiostegal rays 7; vertebrae
58 (57-59); predorsal vertebrae 6; postdorsal vertebrae
10; vertebrae posterior to anal fin 8; first two dorsal
pterygiophores in space between fourth and fifth
neural spines; third dorsal pterygiophore in following
space, next two pterygiophores in space between fifth
and sixth neural spines, and remaining pterygiophores
single in a space.

Body depth 10.0 (8. 5-9. 6) in SL; body width 1.45
(1.2-1. 5) in body depth; head pointed, its length 4.25
(4.15-4.3) in SL: snout length 3.25 (3.2-3.45) in HL; eye
diameter (maximum to edges of adipose eyelid) 7.15
(6.85-7.2) in HL; interorbital width 5.85 (5.65-5.9) in
HL; caudal-peduncle depth 5.0 (4.95-5.4) in HL; caudal-
peduncle length 2.3 (2. 2-2. 4) in HL.

Lower jaw strongly projecting, sharply pointed,
ending in a cartilaginous knob; maxilla narrowing
posteriorly, reaching slightly posterior to a vertical at
anterior edge of eye, the upper-jaw length 2.8 (2.8-3. 1)
in head length; premaxilla protrusible; mouth slightly
oblique, forming an angle of about 15° to horizontal
axis of body; no teeth in jaws or on palate.

Gill opening broad, the dorsal end at level of
upper edge of eye, the anterior end reaching a vertical
through centre of eye. Gill membranes not attached to
isthmus. Gill rakers slender, the longest as long as gill
filaments.

Nostrils small, dorsally on snout, the anterior a
narrow, oblique aperture with a slight dorsoposterior
rim, midway between a vertical at fleshy edge of orbit

Smithiana Bulletin 9: 21-25

24 Randall & Heemstra

and tip of lower jaw; posterior nostril smaller, less
oblique, without a rim, and nearly directly behind
anterior nostril; intemarial distance and distance
between posterior nostrils equal to pupil diameter.
Cephalic sensory canals and pores essentially the same
as illustrated for Ammodytoides kimurai Ida & Randall
(1993: fig. 2) and A. pylei Randall, Ida & Earle (1994: fig.
2 A); subocular canal interrupted below eye.

No spine on opercle; margins of opercular bones
smooth; opercular flap extending to or slightly posterior
to a vertical at base of lower pectoral-fin rays.

Scales on body small, thin, cycloid, and joined in
straight oblique rows with only posterior margin free
(except above lateral line where upper and lower edges
of scales more evident); head naked; scales dorsally
on nape extending slightly anterior to a vertical at
upper free end of preopercle; tubed scales of lateral
line ascending from upper end of gill opening to
within a pupil diameter of origin of dorsal fin, passing
posteriorly parallel to dorsal contour of body, and

ending on caudal peduncle three to six scale rows
before base of caudal fin (these posterior scales with
a few tiny pores); fins naked except for a sheath of
specialized scales extending out on caudal rays about
three-fourths length of fin.

Origin of dorsal fin above twelfth lateral-line scale,
the predorsal length 4.15 (4. 1-4.4) in SL; first dorsal ray
short, 6.9 (5.95-8.0) in HL; longest dorsal ray (sixth-
from-last in holotype) 4.15 (4.0-4.4) in HL; first anal
ray short, slender, and closely spaced to second ray
9.4 (6.6-9.45) in HL; third or fourth anal ray longest,
3.55 (3.3-3. 7) in HL; caudal fin forked, 1.9 (1.85-2.0) in
HL; caudal concavity 3.9 (3. 7-4.0) in HL; pectoral fins
short and pointed, the third or fourth ray longest, 2.45
(2.4-2.55) in HL.

Colour of holotype in alcohol: light grayish brown,
paler ventrally; head anterior to posterior edge of
preopercle translucent grey, the light brown brain
visible; dorsal half of snout from posterior nostrils
forward blackish, as well as tip of lower jaw; fins

Table 1. Proportional measurements of type specimens of Ammodytoides xanthops as percentages of the
standard length.

Holotype

Paratypes

SAIAB

80762

SAIAB

80761

SAIAB

80761

SAIAB

80761

SAIAB

80761

SAIAB

80761

SAIAB

80761

SAIAB

80761

Standard length (mm)

120

104

106

109

113

117

120

122

Sex

male

male

female

female

male

female

male

female

Body depth

10.0

10.4

11.3

10.5

11.5

11.7

11.6

10.5

Body width

6.9

8.5

8.5

8.4

8.0

8.5

8.5

7.1

Head length

23.5

23.7

24.0

24.2

23.2

23.7

23.3

23.6

Snout length

7.2

7.2

7.1

7.0

7.2

7.3

7.1

7.4

Orbit diameter

3.3

3.5

3.5

3.4

3.3

3.3

3.3

3.3

Interorbital width

4.4

4.0

4.1

3.9

4.1

4.2

4.1

4.4

Upper-jaw length

8.5

7.8

7.9

7.8

7.9

8.4

8.1

8.4

Caudal-peduncle depth

4.7

4.8

4.7

4.5

4.6

4.4

4.6

4.7

Caudal-peduncle length

10.1

10.7

9.9

10.4

10.5

10.0

10.5

9.9

Predorsal length

24.0

24.1

24.3

23.0

22.9

24.4

22.7

23.4

Preanal length

66.0

64.2

66.1

64.5

66.3

65.5

64.3

65.1

First dorsal-fin ray

3.4

4.0

3.9

2.9

2.9

3.3

3.4

3.4

Longest dorsal-fin ray

5.7

5.4

5.6

5.5

5.5

5.8

5.8

5.7

First anal-fin ray

2.5

2.9

2.8

3.5

3.5

3.7

3.2

2.5

Longest anal-fin ray

6.6

6.7

6.6

6.5

7.0

6.5

6.6

6.5

Caudal-fin length

12.3

12.2

12.5

12.3

12.1

12.1

11.6

12.6

Caudal concavity

6.0

6.2

6.5

6.4

5.9

6.2

6.1

5.9

Pectoral-fin length

9.6

9.8

9.6

9.4

9.7

9.4

9.5

9.5

Smithiana Bulletin 9: 21-25

New Ammodytoides species 25

translucent grey, with a prominent black spot distally
between dorsal rays 2-4, 7-8, 12-14, 18-19, 24-24 and
27-28; caudal fin with a broad blackish posterior margin
except principal and median rays, the dark pigment on
distal half of outer rays rays, and one-third of inner
rays. Colour when fresh as in Fig. 1

Etymology. This species is named Ammodytoides
xanthops from the Greek xanthos for yellow and ops for
face, in reference to the dominant yellow colour of the
head dorsally and anterior to the eye.

Remarks. The holotype is a mature male. It was the only
specimen caught by the trawl haul of 19 October 2007.
No colour photograph or colour note was made of the
19 specimens that were collected in the trawl haul of
16 October. As mentioned, these 19 fish are fully ripe
males and females and may have been reproductively
active at the time of capture. Randall et al. (1994: 86-
87) described the spawning of Ammodytoides pylei. The
head of some, if not all of the fish, was yellow at this
time. The colour of the female holotype of P. pylei was
described as follows: "dorsal part of head and nape
yellow with dusky markings." The yellow colouration
is much more extensive on the head of A. xanthops.

Ammodytoides xanthops is clearly distinct from the
two other species of the genus known for the western
Indian Ocean, A. renniei (Smith) from the east coast
of Africa south of 33°S, and A. praematura Randall &
Earle, described from one specimen from the Chagos
Archipelago. It has fewer dorsal rays and more lateral¬
line scales than A. renniei, and more pectoral rays and
lateral-line scales than A. praematura, along with colour
differences from both. It is most similar to A. idai
Randall & Earle from Papua New Guinea, A. kimurai
Ida & Randall from the Ogasawara Islands, and A. pylei
Randall, Ida & Earle from the Elawaiian Islands, all
of which share a series of black spots at the margin of
the dorsal fin, a broad blackish zone in the caudal fin,
and essentially the same fin-ray and lateral-line scale
counts. Ammodytoides idai and A. pylei have small scales
dorsally on the opercle, which are lacking in A. kimurai
and A. xanthops. As shown in the key, A. xanthops is
differentiated from A. kimurai by having a larger eye,
modally 58 compared to 60 vertebrae, and the blackish
pigment in the outer part of the caudal fin.

ACKNOWLEDGMENTS

We are grateful to Tore Stromme and Michel
Lambeouf of the United Nations Food and Agriculture
Organization for the invitation to join the Mozambique
cruise of the R/V Fridtjof Nansen. We thank the captain
and the crew for their assistance and tolerance of our
collections of marine life, and Oddgier Alvheim for

his help in fish photography and logistics. Loreen R.

O'Hara took X-rays of the type specimens, and John L.

Earle reviewed the manuscript.

LITERATURE CITED

Bean, T. H. 1895. Description of a new fish Bleekeria
gilli. Proceedings of the United States National Museum
17:629-630.

Beebe, W. & J. Tee-Van. 1938. Eastern Pacific expeditions
of the New York Zoological Society, XV. Seven new
marine fishes from Lower California. Zoologica
(N.Y.) 23: 299-312.

Carpenter, K. E. & V. H. Niem (eds.). 2001. The Living
Marine Resources of the Western Central Pacific.
Volume 6. Bony fishes part 4 (Labridae to Latimeriidae),
estuarine crocodiles, sea turtles, sea snales and marine
mammals. Food and Agriculture Organization of the
United Nations, Rome.

Collette, B. B. & J. E. Randall. 2000. Ammodytoides
leptus, a new species of sand lance (Teleostei:
Ammodytidae) from Pitcairn Island. Proceedings of
the Biological Society of Washington 113: 397-400.

Collette, B. B. & D. R. Robertson. 2001. Redescription
of Ammodytoides gilli, the tropical eastern Pacific
sand lance (Perciformes: Ammodytidae). Revista de
Biologia Tropical 49, suppl. 1: 111-115.

Dunker, G. &E. Mohr. 1939. Revision der Ammodytidae.
Mitteilungen aus dem Zoologischen Museum in Berlin
24: 8-31.

Ida, H. & J. E. Randall. 1993. Ammodytoides kimurai, a
new species of sand lance (Ammodytidae) from the
Ogasawara Islands. Japanese Journal of Ichthyology 40:
147-151.

Ida, H., P. Sirimontaporn & S. Monkolprasit. 1994.
Comparative morphology of the fishes of the family
Ammodytidae, with a description of two new
genera and two new species. Zoological Studies 33:
251-277.

McCulloch, A. R. & E. R. Waite. 1916. Additions to the
fish-fauna of Lord Howe Island. No. 5. Transactions
and Proceedings of the Royal Society of South Australia
40:437-451.

Pietsch, T. W. & C. P. Zabetian. 1990. Osteology and
interrelationships of the sand lances (Teleostei:
Ammodytidae). Copeia 1990: 78-100.

Randall, J. E. & J. L. Earle. 2008. Two new sandlances
of the genus Ammodytoides (Perciformes:
Ammodytidae). Pacific Science 62(4): 603-612.

Randall, J. E., H. Ida & J. L. Earle. 1994. Ammodytoides
pylei, a new species of sand lance (Ammodytidae)
from the Hawaiian Islands. Pacific Science. 48: 80-
89.

Smith, J. L. B. 1957. Four interesting new fishes from
South Africa. South African Journal of Science 53:
219-222.

Smithiana Bulletin 9: 21-25

'

'

'

■

.

Ipj

'

■

ISSN 1684-4130

Published by the South African Institute for Aquatic Biodiversity
Private Bag 1015, Grahamstown, South Africa, 6140
www.saiab. .ac.za