Full text of "Animal Genetic Resources of India : Cattle and Buffalo"

See other formats

ANIMAL GENETIC RESOURCES

OF INDIA

0.4 . [

A. E. NIVSARKAR
P. K. VI J
M. S. TANTIA

Hiinlags

ICAR

INDIAN COUNCIL OF AGRICULTURAL RESEARCH

NEW DELHI

■

Animal Genetic Resources of India
Cattle And Buffalo

ANIMAL GENETIC RESOURCES OF INDIA
CATTLE AND BUFFALO

A E NIVSARKAR

Director

PKVIJ

Scientist (Senior Scale)

MSTANTIA

Scientist (Senior Scale)

National Bureau of Animal Genetic Resources, Karnal

ICAR

Directorate of Knowledge Management in Agriculture
Indian Council of Agricultural Research
Krishi Anusandhan Bhavan, Pusa
New Delhi-110 012

Printed :
Reprinted :

March 2000

March 2013

Project Director (DKM A) :

Dr Rameshwar Singh

In charge ( English Editorial Unit) :

Dr R P Sharma

Assistant Editor :

Aruna T Kumar

Associate :

Dr Sudhir Pradhan

Chief Production Officer :
Technical Officer ( Production ) :

Dr V K Bharti

Ashok Shastri

AH Rights Reserved

ISBN : 978-81-7164-125-3

Price : Rs 700

Published by Dr Rameshwar Singh, Project Director, Directorate of Knowledge Management
in Agriculture, Indian Council of Agricultural Research, Krishi Anusandhan Bhavan, Pusa,
New Delhi and Printed at M/s Chandu Press, D-97, Shakarpur, Delhi-110092

FOREWORD

The vast diversity of animal genetic resources available in India have considerable
adaptability to local environment particularly tolerance to heat and tropical diseases,
and are eminently suited for economic-purpose. In India, most of the cultivated land is
small and fragmented, and bullocks are required for various agricultural operations.
Cattle and buffaloes are therefore indispensable components of our agriculture. Buffa¬
loes are mainly kept for milk, yet their males are extensively used in draught work,
mainly traction and transport, especially in marshy areas.

There are 30 breeds of cattle and 10 breeds of buffaloes in addition to a large num¬
ber of nondescripts. The total population of well-defined breeds has not been estimated.
The majority of cattle breeds are small in size and have low productivity. These breeds
are distributed in different agro-climatic conditions. The geographical location of each
breed and marking of their main breeding areas on maps have been attempted.

In each breed, as in any population, there are gradation of morphological features
or production. Many of the breeds may not be intrinsically different from one another
but their distinctiveness is in respect of external conformation and appearance. It is
difficult to comprehend a type of breed unless a comparative picture is available. This
book presents excellent photographs of different indigenous breeds with full descrip¬
tion of important characteristics and their habitat, and would serve as an important
material for students at all levels, research workers, policy planners and common people.

The characteristics of breeds defined earlier were based on isolated studies mostly
maintained in organized herds. Evaluation of breeds in situ is a very important compo¬
nent of sustainable animal production. The breed characterization procedure and evalu¬
ation strategies for different indigenous cattle and buffalo breeds described in this book
will be useful in project planning and implementing animal conservation programmes.

The compilation of information on lesser-known cattle and buffalo breeds is also a
very good attempt by the authors. These breeds would be considered for detailed stud¬
ies in times to come and may be added to rich reservoir of already defined breeds. The
data depicted in appendices provide information on these two species of livestock. The
authors deserve appreciation for their valid attempt in compiling such a useful book.

(R.S. PARODA)

Secretary, DARE and Director General, ICAR

Digitized by the Internet Archive
in 2018

https://archive.org/details/animalgeneticresOOOOnivs

PREFACE

Animal Genetic Resources contribute to a great extent to the agrarian economy of the
country. The cattle and buffalo constitute major portion of domesticated animal genetic
resources. They are the backbone of the agriculture and dairy industry having distinct
utility in the various agro-climatic conditions. Cattle and buffalo breeds have been
evolved through selective breeding by the farmers/breeders using the traditional and
scientific knowledge, and today we have 30 recognized breeds of cattle and 1 0 of buf¬
faloes. Cattle and buffaloes account for nearly 75% of the gross output of the livestock
sector.

The breeds were initially identified and described in early 30s on the basis of a few
undefined subjective parameters. Over the years mechanization of agriculture and in¬
tensification of animal husbandry have greatly changed animal genetic resources sce¬
nario. A few specialized breeds have recorded increased utility while others either due
to limited use or utility have lost ground.

Identification and description of these breeds was felt necessary for conservation
and judicious utilization. Information on cattle and buffalo breeds of India is very scanty.
During the last five decades, cattle and buffalo husbandry has seen a sea change and the
situation has completely altered due to various natural and artificial forces. Most of the
students of Animal Sciences do not get a chance to see all the breeds, and find it diffi¬
cult to identify and differentiate between breeds.

This book gives detailed account of the cattle and buffalo genetic resources along
with distribution maps and coloured photographs. We hope, this will help in better
understanding of the breed characteristics. Besides breeds, this book also deals with
other important aspects like origin and distribution, breed improvement programmes,
strategies for improvement and conservation, and latest statistics in cattle and buffalo
genetic resources in India.

We are grateful to Dr R.S. Paroda, Secretary, DARE, Ministry of Agriculture and
Co-operation and Director-General, ICAR, Krishi Bhavan, for his keen interest, en¬
couragement and granting permission to publish this book by the Directorate of Infor¬
mation and Publication on Agriculture, ICAR. We are greatly indebted to Dr M. L.
Madan, former Deputy Director-General (Animal Sciences), ICAR, for his constant
encouragement and guidance.

We thank Shri R. R. Lokeshwar, former Chief Editor, Directorate of Information
and Publications on Agriculture, ICAR for his efforts in helping us in developing the

book and constructive criticism which has helped in improving the quality of the manu¬
script.

We acknowledge the help of Dr S.D.Sharma, Director, Dr Randhir Singh, Prin¬
cipal Scientist and In-charge, GIS Laboratory, and Dr Anil Rai, Scientist (Sr Scale),
IASRI, New Delhi, for providing GIS facilities to prepare distribution maps.

We thank the Directors of State Animal Husbandry Departments and State Agri¬
cultural Universities, especially of Punjab, Haryana, Sikkim, Rajasthan, Uttar Pradesh,
Tamil Nadu, Madhya Pradesh, Maharashtra and Gujarat, for their constant help during
the surveys conducted by the NBAGR, Karnal. We thank Dr Sosamma Iype, Professor,
Kerala Agricultural University, Thrissur, for providing information on Vechur; and Dr
E.K. Charyulu, Retired Professor, Acharya N G Ranga Agricultural University,
Hyderabad, for providing information and photographs of Punganur cattle. Thanks are
also due to Dr N. Kandasami, Professor, Veterinary College, Namakkal, and Dr K. R.
Tajane and Dr J. V. Solanki, Professors, Gujarat Agricultural University, for providing
valuable information. We thank our colleagues Dr S.C. Gupta, Dr Neelam Gupta, Dr
Goutam Sahana, Dr Anand Jain, Dr R.K. Vijh, DrGurmej Singh and Shri Avnish Kumar
who have not only helped us in collection of information but also in the development of
the manuscript. Shri Moti Ram, Photographer has been responsible for the excellent
photographs in this publication. The help rendered by Smt Anita Chanda and Smt Indu
Bala in the form of secretarial assistance; Shri Sanjeev Mathur in computer formatting
the manuscript; and Shri Satpal, Draftsman in preparing distribution maps is duly ac¬
knowledged. Shri Subhash Chander, T-2 and other staff assisted us directly/indirectly
in collecting information from the field and writing of this book.

A.E. NIVSARKAR
P.K. VIJ
M.S. TANTIA

CONTENTS

Foreword

Preface

vii

Introduction

1-5

Origin and Domestication

6-15

Movement of Germplasm

16-23

Classification of Breeds

24-32

Cattle Breeds

33-168

Amritmahal

Bachur

Bargur

Dangi

Deoni

Gaolao

Gir

Hallikar

Hariana

Kangayam

Kankrej

Kenkantha

Kherigarh

Khillari

Krishna Valley

Malvi

100

Mewati

104

Nagori

107

Nimari

112

Ongole

116

Ponwar

123

Punganur

127

Rathi

131

Red Kandhari

135

Red Sindhi

140

Sahiwal

144

Siri

150

Tharparkar

155

Umblachery

160

Vechur

165

Buffalo Breeds

169-215

Bhadawari

169

Jaffarabadi

175

Marathwada

180

Mehsana

184

Murrah

189

Nagpuri

195

NilLRavi

198

Pandharpuri

202

Surti

206

Toda

210

Lesser Known Strains

216-234

Evaluation of Breeds

235-290

Breed Improvement Programmes

291-317

Strategies for Conservation

318-333

References

334-350

Appendices

35 1 -370

index

371-382

INTRODUCTION

Livestock farming is an age-old tradition for millions of Indian rural households. Live¬
stock play a pivotal role in the agrarian economy. Nearly 70 million rural households
own livestock of one kind or the other, and 60 million among them own either cattle
and/or buffaloes. Almost two-thirds of these families are resource poor, being small
and marginal farmers or landless agricultural labourers. Livestock farming is a major
source of supplementary income for 73% of rural households. There is less inequity as
regards the livestock holding than the land holding. Throughout the country the aver¬
age livestock holding in general and cattle and buffaloes in particular is 2-3 head per
family. Each household is virtually a self-contained production system fulfilling its
own requirements with no purchased inputs and in the process also generating a little
income.

Animal husbandry is the most important activity in rural India next to crop produc¬
tion. Cattle and buffaloes form the backbone of agriculture and dairy industry in India,
and have played an integral role in the cultural and socio-religious development of
civilization. In addition to milk, they provide much of the draught power for farm op¬
erations and transport, meat, hides and dung throughout the Indian subcontinent.

Livestock sector has been one of the few leading growth sectors in rural India over
the past five decades of post-independence and its contribution to the GDP has in¬
creased from about 5% in 1980-81 to about 10% in 1997-98, whereas agriculture as a
whole has gone down in its contribution from 34 to 26% over the same period. The
share of livestock in agricultural gross domestic product has risen from about 17% in
1980-81 to 26% in 1996-97 (Birthal etal., 1999). This, in turn, is about 26% of the total
gross domestic product (GDP) of the economy. Outputs of different livestock species
have been growing at annual rate ranging from 4 to 7% and are comparable to that
achieved by other important sectors of the economy. The value of output of livestock
sector has grown from about Rs 58,950 million in 1950-51 to Rs 197,940 million in
1991-92 at constant (1980-81) prices. This indicates a three-fold increase in 41 years,
which is at par with the growth in the agricultural sector (Kohli and Kulshreshtha,
1 997). Livestock sector has also been a great source of employment and employs 8% of
the labour force. Nearly 36.07 million man years were employed during 1987. This is
a rural self-employment sector with a steady increase of 4.5% per annum as compared
to only 1.75% in rural employment and 1.1% in agriculture (Project Report, 1997).
This has another advantage as almost 90% of rural women are engaged in cattle/buffalo

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

rearing. Investment in this sector can bring substantial prosperity to rural areas. The
Government of India is providing Rs 4,000 million for animal sector annually but 90%
of the amount is used for the salary of the staff.

Cattle and buffaloes are the most preponderant species among all livestock in India
and they account for over 75% of the total output value of the livestock sector. In 1 996
among all the farm produce, milk emerged as the single largest contributor to Indian
agriculture, both in quantity and value terms. Cattle and buffaloes generated output
valued at Rs 295 billion in milk, Rs 3 1 billion in work/draught, Rs 43 billion in dung
and some Rs 40 billion in meat, hides and offal out. of a total output value of Rs 470
billion for all livestock produce in 1991 (Project Report, 1997). In 1992 the country
had 204 million cattle and 83.5 million buffaloes registering a growth of nearly 32%
over the 1 95 1 population in the case of cattle and almost doubling in the case of buffa¬
loes. The annual growth between 1987 and 1992 was 0.48% in cattle and 1.91% in
buffaloes.

The radical changes within the cattle population over the last two decades indicate
a shift in the priority of the farming community from production of work animals to
milch animals. The proportion of females in the population increased steadily with
1972 as the turning point. Between 1972 and 1982 the number of working males in the
cattle population declined sharply (by 12 million); among females the proportion of
adult females increased (63% in native and 61% in crossbreds). There was a gradual
but steady decline in the proportion of native cows and phenomenal growth in that of
crossbred cows. Crossbreds increased from 8.80 million in 1982 to 1 1.59 million in
1987 (+31.70%) and to 15.22 million (+31.32%) in 1992. Uttar Pradesh, Tamil Nadu,
Maharashtra, Kerala and Punjab were the states with large number of crossbreds, and
together they accounted for nearly 65% in the country in 1992. Northern region has a
considerable population of crossbreds (40%), followed by southern region (34%) and
western region (15%). Eastern region has traditional rainfed agriculture and is mainly
dependent on draught animals for draught power. It has the highest proportion of na¬
tive cows and lowest of crossbreds (1 1%).

Increase in buffalo population, particularly after 1970, indicates the preference of
farmers and dairy industry for buffalo milk. Buffalo milk fetches higher price than cow
milk. The percentage of female buffaloes steadily improved from 72 in 1961 to over
80 in 1991. Among them 64% were adults.

The Indian sub-continent occupies a pre-eminent position in so far as its animal
genetic resources are concerned. It is endowed with a veritable gold mine of farm
animals and poultry. Animal germplasm of economic utility includes numerous breeds
of cattle (30), buffalo (10), sheep (40), goat (20), poultry (18), camel (4), horse (6),
mule, pig, donkey, mithun and yak. India possesses 1 /9th of all the recognized cattle
breeds and almost all the recognized buffalo breeds of the world. Besides these, there

INTRODUCTION

are lots of other strains/varieties that need to be evaluated to be considered as distinct
breeds.

Despite being a reservoir of vast genetic diversity, our farm animals still remain
under-developed in terms of genetic improvement and production. It is indeed a strange
paradox that though India possesses a vast population of farm animals which continues
to increase even after being far in excess of the stocking capacity, yet the economic
returns are distressingly less remunerative. Traditional and often unscientific animal
husbandry practices coupled with other factors like chronic shortage of feeds and fod¬
der, grossly inadequate health-cover and over-population of low yielders have reduced
the productivity of Indian farm livestock than of their European counterparts. It would
be pertinent to mention here that powerful and influential Animal Breed Associations
or Societies exist in Europe and America which not only extend their patronage but also
espouse the cause of breeds for development and upkeep of their genetic purity. Such
bodies still do not exist in India and are needed. The Rare Breed Survival Trust of the
UK and the Minor Breed Conservancy of the USA are models worthy of emulation by
conservationists. Too many established Indian breeds have either lost their identity or
have undergone substantial dilution and degeneration due to infusion of exotic germplasm
and breed replacement. All these development efforts warrant our concern and atten¬
tion.

Identification and description of the breeds were initially done in early thirties on
the basis of a few undefined subjective parameters. The extent of genetic variability
prevalent in native livestock breeds was not taken into consideration in the description
of animals. Over the years, intensification of animal husbandry and widespread intro¬
duction of exotic breeds have completely altered Animal Genetic Resources scenario.
There is perceptible increase in a limited number of specialized breeds, while several
indigenous livestock and poultry breeds have suffered decline and degeneration over
the years, mainly due to their being uneconomical in the present-day production sys¬
tem. Their admittedly low levels of production are offset by their ability to thrive on
less food and food of lower quality than crossbred cattle, and thus to produce some milk
or meat where the latter can not survive. Usefulness of various types of animals particu¬
larly their genetic worth has not been fully explored. In such a situation, it cannot be
postulated as to which animal type would be required in future and when. Hence, the
need for conservation of diverse animal types and breeds as a part of genetic security.

There is a growing realization all over the world that conservation and judicious
utilization of all forms of genetic resources are of paramount importance for the contin¬
ued survival of human race. Life-sustaining biological molecules, in over 4,000 mil¬
lion years of evolution, have undergone sea changes under the impact of forces of natu¬
ral selection and to a lesser extent due to human interventions. This process bequeathed
immense richness in the form of infinite varieties of species in plants and animals. We,

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

of the present generation, are merely custodians of genetic wealth and owe it to the
future and posterity to pass on this genetic diversity untampered and intact. Unfortu¬
nately, in recent past mankind has been depleting, damaging and even manipulating
this wealth for short-term gains unmindful of perilous consequences.

The need for conservation of animal genetic resources has been accepted globally
for sustainable development. The conservation of Animal Genetic Resources is now a
multidimensional activity which encompasses not only preservation and maintenance
of existing breeds but also their improvement and proper management. The overall aim
is sustainable utilization, restoration and enhancement of resources so as to meet the
needs of mankind at present and in future.

Earlier some efforts were made to document the information on livestock breeds in
the form of books (Joshi and Phillips, 1953; Payne, 1970; ICAR, 1979; Bhat et al.,
1981; Singh and Moore, 1982; Basu, 1985; Bhat and Taneja, 1987;Maule, 1990; Payne
and Hodges, 1 997). But all these books except the one by Joshi and Phillips (1953) have
very limited information on the livestock breeds in India. The emphasis, therefore, is on
other aspects of livestock production. The book ‘Zebu Cattle of India and Pakistan’ by
Joshi and Phillips (1953) was published about 45 years back. Though this served the
purpose very well at that time but there are lot of changes during the last 5 decades in
livestock production owing to selection pressure, both natural and artificial. Priorities
of the farming community have also changed over the years. As a result of these fac¬
tors, the total scenario has changed. Distribution of some of these breeds has extended
to more areas while for others it has shrunk. A few of the breeds are nearly extinct and
some new ones have found their way into the list during these years. Moreover, the
characteristics of these breeds have also undergone considerable changes due to adap¬
tation to agro-climatic conditions and market demand. None of the earlier books con¬
tained detailed information on their performance, maps showing distribution of breed
and coloured photographs. Some publications contain only one black and white photo¬
graph of a breed. Most of the students and even the faculty of animal sciences do not get
a chance to see all the breeds and find it difficult to identify and differentiate between
breeds.

This book contains a detailed account of cattle and buffalo genetic resources of
India along with distribution maps and colour photographs. The authors hope that this
will help in better understanding of the characteristics of these breeds and differences
among them. Efforts have been made to include the latest information as far as possible
by conducting surveys in native tracts of these breeds. Some information is also given
on the breeds which are not recognized but their names exist either in literature or are
known locally. Besides breeds, this book also deals in other related aspects like origin
and distribution of breeds, movement of germplasm, genetic architecture, breed im¬
provement programmes, evaluation of breeds under field conditions, and strategies for

INTRODUCTION

improvement and conservation. Latest statistics on cattle and buffalo genetic resources
of India are also included in this book. It is hoped that this book will be of interest to
students, professionals and policy planners, and will help in understanding characteris¬
tics of different breeds and planning strategies for their improvement and conservation.

□

ORIGIN AND DOMESTICATION

CATTLE

Evolution

Domesticated cattle (in the strict sense of the word) are the descendants of a group of
races of Bos primigenius, the urus or aurochs. Their economic significance increased
as civilization advanced, and today they are the most important of all the domesticated
animals as producers of meat, milk, energy and hides. It is certain that domestication
was undertaken before 4000 BC, but nothing is known of its actual beginning. The
aurochs are said to have been domesticated before 6000 BC (Mason, 1987). Many
theories have been postulated about types of wild cattle.

Wild cattle belong to the genus Bos, which is different from that of the bison
(Bison), the yak ( Poephagus ) and the gaur (Bibos). But these so-called genera are so
closely related that they can interbreed and produce fertile progeny. Some authorities
have given recognition to this by uniting all bovine cattle in one large genus Bos. They
all belong to the sub-family Bovinae. The relationship between wild and domestic spe¬
cies is shown in Fig. 1 .

The true cattle (Bos in the strict sense) is most closely related to the south Asiatic
gaur and banteng, from which it appears to have separated in the course of the Upper
Pleiocene (Fig. 2). Bos acutifrons has been said to occur in the Siwaliks of India. Pil¬
grim (1939) regarded it as the possible ancestor of the Pleistocene wild cattle, i.e. of
both Bos nomadicus of India and Bos primigenius of Europe (Zeuner 1963). Some
observed that separate species of wild cattle existed in South Asia, North Africa and
Europe. Epistein and Mason (1984) proposed separate geographical races, viz. Bos
primigenius nomadicus in South-West and southern Asia, B. primigenius primigenius
in northern Asia and Europe, and B. primigenius opisthonomus in Egypt and northern
Africa. An Asiatic origin of the group is possible, because the aurochs are rare or alto¬
gether absent in the Lower Pleistocene of Europe.

The external appearance of wild cattle is well known. The last survivor died in a
Polish park in 1627. Several good descriptions of it including illustrations are avail¬
able. Bulls were large, up to 1 .95 m at the shoulder, and often equipped with very long
horns. The best surviving picture was recorded by the British Zoologist Hamilton Smith
in an Augsburg shop early in the last century (Zeuner, 1963). It must be noted, how¬
ever, that it does not represent the large type of bulls which were so common in the late

ORIGIN AND DOMESTIC A TION

Sub

family....

Group

Genus.

Wild species.

Domesticated species

— Bos

Bos primigenius Bojanus
(extinct)

— Bos taurus breeds
(cattle)

Bos indicus breeds
(cattle)

— Bos (bibos) banteng Wagner . Bos (bibos) banteng

(benteng: tsine) (cattle)

Bovinae-

Bovina

Bos (bibos)

Bos (bibos) gaurus Smith
(gaur: seladang)

Bos (bibos) sauveli Ubain
(kouprey: may be extinct)

Bos (bibos) frontalis
(Mithun; Dulong)

Poephagus - Poephagus mutus Przewalski - Poephagus grunniens

(yak) (domestic yak)

— Bison

— Bison bison Linnaeus
(American bison)

■ Bison bonasus Linnaeus
(European bison)

— Bubalus arnee Kerr -

(Asian wild buffalo: arnee)

Bubalina - Bubalus

Bubalus mindorensis Hende
(tamarao)

Bubalus bubalus
(all domestic breeds
of river and swamp
buffalo)

— Bubalus depressicornis Bohlken
— B.d. depressicornis (lowland anoa)
'—B.d. quarlesi (mountain anoa)

Syncerina — Syncerus - Syncerus caffer Sparrman

—S.c. caffer (black or Cape buffalo)
S.c. nanus (red or Congo buffalo)

Fig. 1. Relationship between wild and domestic species of the sub-family Bovinae
Source: Payne and Hodges (1997)

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Recent

Pleistocene

3“

rcsPilocene

Miocene

AFRICAN CATTLE CATTLE BISON
BUFFALO Bos (Bos) Bos (Bibos)

Bos

primigenius

ASIAN

BUFFALO

Bison

proscus

Epileptobos

Hemibos

Leptobos

Alep his

Ugandax

Proamphibos

Paiabos

Pachyportax

latidens

Fig. 2. Possible evolutionary paths for modern species ofBovinae
Source: Payne and Hodges (1997)

ORIGIN AND DOMESTICATION

Pleistocene and the early Holocene. This type had horns which turned first outward
and then forward, with the tips slightly turned upward.

The description of various characteristics of the aurochs, such as size and shape of
horn, stature and coloration, are still found in certain domesticated breeds, but all these
characters are not found in one breed. In 1921 an idea occurred to Lutz and Heck that it
might be possible to reconstitute the aurochs by crossing breeds of cattle that exhibit
certain characteristics of the wild ancestor. The attempt was remarkably successful.
Heck, the Director of the Munich Zoo, crossed Hungarian, Podolian Steppe, Scottish
Highland, grey and brown Alpine, piebald Friesians and Corsican cattle breeds. After
some years of breeding 1 male and 1 female having the characters of aurochs were
selected. These reconstituted aurochs continued to breed fairly true to type. By 1951
there were 40 oristics of these reconstituted aurochs (Heck, 1951). These aurochs not
only appeared but also behaved like wild animals.

The wild cattle on the friezes in the Aurignacian cave of Lascaux in southwest
France are so well drawn that they deserve close study. They are the best prehistoric
pictures available of the wild ancestors of domesticated cattle, and all belong to Bos
primigenius. In his monograph on this cave, Windels (1950) attributed certain speci¬
mens to Bos longifrons, thus implying that a separate wild species also existed at that
time.

Domestication

The Neolithic revolution changed the economic life of the human population from
hunter/gatherer to farmer/stock breeder. It was a slow and erratic revolution and there is
no absolute certainty as to why and where it began (Payne and Hodges, 1997).

There are many evidences which conclude that this revolution began in Western
Asia around ca 9000 BC. This region was the primary centre of domestication. Plants
were domesticated before animals, and sheep and goats were the first herbivores to be
domesticated. As per Payne and Hodges (1997) these were domesticated between ca
9000-8000 BC and cattle some 1,000 years later. They also suggested that apart from
Western Asia domestication was also undertaken at other centres and called them copy¬
cat domestication centres.

As dogs, sheep and goats were already domesticated so the knowledge existed with
the human beings of the advantages of domestication. Food was one of the major mo¬
tives for domestication of the aurochs. The man continued to be a hunter even after the
domestication of cattle. The other reason could be to save their cultivated crops from
the wild animals.

The size and ferocity of the large beast must have fascinated the man and posed the
challenge, and the Neolithic men might have taken up the challenge to have control
over the large herbivores. Domestication might have been accidental also (Serpell,

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

1989). The young calf could have been kept as a pet and nourished by the man. This
association might have grown and made man realize the potential of domestication.

Domestication of cattle by Neolithic men must have taken hundreds of years, and
many generations of man must have contributed to this. The domesticated specimen
certainly had desired characters and were more tractable in comparison to their wild
ancestors. With these domesticated livestock the nomadic pastoralists migrated from
Western Asia to various other parts in Europe, Central, East and South Asia, and Africa
in search of grazing lands.

Zarins (1989) suggested the period ca 5000-3500 BC as migration period of
pastoralists with sheep, goat and cattle.

Western Asia

The wild cattle Bos primigenius was first domesticated in the region between the
Mediterranean and Iran, called the ‘Fertile Crescent’ (Fig. 3). This is the region where
evidences suggest that the wild ancestors Bos primigenius and Bos nomadicus existed,

Fig. 3. Western Asia: the 'fertile cresent '

ORIGIN AND DOMESTICATION

and that the Neolithic revolution was more advanced in this area than in any other part
of the world. Payne and Hodges (1997) on the basis of various evidences concluded
that emmer wheat and barley were grown by ca 7000 BC and cattle were domesticated
by ca 6000 BC. Mixed agriculture was practised and it spread to low lands by ca 5000
BC followed by irrigated agriculture.

The earliest evidence of cattle domestication in Western Asia is from Catal Hwjuk
on the Southern Anotolian plateau (ca 6400 BC) where bones of sheep and cattle were
found with that of wild animals. There are other sites in the Western Asia where evi¬
dences of cattle domestication have been found.

The Western Asia is considered to be not only the primary centre for the domestica¬
tion of Bos primigenius but also the evolution centre of 3 major types of domestic
cattle, either within the region or at adjacent centres. The 3 major types of cattle breeds
are the humpless long hora (Bos taurus ), the humpless short horn ( Bos taurus ) and the
humped zebu (Bos indicus).

The long horn type cattle by their physical characters like long, narrow head, flat
forehead, and shape and position of horns resemble Bos primigenius. Various anatomi¬
cal and archaeological evidences also support the theory that the long horn type cattle
were the first domesticated ones. The nomadic pastoralists moved with these cattle
herds.

Short horn type ( Bos taurus ) are medium sized, and have narrow dished forehead,
and small and high set horns. Earlier authors grouped these cattle under Bos brachyceros
(Owen, 1 846; Zeuner, 1 962). Hughes ( 1 896) described it as a very small animal, prob¬
ably not larger than a Kerry cow. However, the Neolithic cattle were not inferior in size
to many of the modern breeds. Their small size was probably due to large number of
immature specimens found in prehistoric sites. Hescheler and Kuhn ( 1 949) pointed out
that small specimens were available at most sites.

The fact that longifrons cattle can be distinguished from primigenius- derived cattle
has aroused controversy. Some believe firmly that wild ancestors must have existed,
while others consider longifrons as a descendant of the wild Bos primigenius. This was
also supported by Zeuner (1963) considering the fact that the fossil skulls of male
primigenius were compared with skulls of longifrons cows.

The archaeological evidence for the sudden appearance of a well-characterized,
small, domesticated breed is, however, strongly against local domestication, and the
centre of origin of the longifrons breed was probably outside Europe.

Domestication certainly results in reduction of size. But these breeds were not as
small as the Neolithic longifrons of Europe. The other possibility of reduced size may
be because of unhealthy conditions and starvation diet (Zeuner, 1 963). It is evident that
large cattle could not have easily moved from place to place, and that a population
which lived in temporary settlements and practised shifting agriculture might have pre-

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

ferred large numbers of small-size cattle to small numbers of large-size cattle.

In some cases the primigenius and the longifrons stocks have been kept compar -
lively pure. The Alpine cattle, the Jersey breed, and the Shorthorn belong to lmS>frons
stock On the other hand, the Hungarian and Podolian Steppe cattle, the arge- o
cattle of the Romagna in Italy, the Scottish Highland race and the fighting cattle of
Spain all represent the primigenius stock. But crossing has been practised to such an
extent that the vast majority of modem breeds must be regarded as intermediates. I
Friesian cattle, for instance, it is possible to find skulls ranging from the pnmgentus

tvoe to characteristic longifrons type (Zeuner 1963). , . f

Pyane and Hodges (1997) also reviewed various theories like the descent fr

zebu (Bos indicus ), dwarf type of aurochs (Bos primigemus) and Asian urns (Bo
nomadicus ) and common ancestor with long horn type cattle. Epstern (1971) also
refuted all other theories except the one of common ancestor with longhorn type, a
considered that this type of cattle originated in the eastern area of the Fertile Crescent

the mountainous region of Iran. „uannf>A c,nH smaller

With the developments in agriculture the situation possibly changed and sm

and lighter animals were preferred over large long horn type due to easy control. The

selection for desired characters over generations led to evolution of short horn (Bos

towns) type of domesticated cattle. These became more prominent in Mesopotamia (ca

3000 BC)which coincides with the beginning of urban life. They also spread into A

rica, Europe and Asia with migratory people.

HUmWithCits hump, the zebu superficially resembles members of the Bibos group .of
wild cattle, present in India, Myanmar and the Sunda archipelago. Gau 0»l£ha£
ever pointed out that the structure of the skull is so different in t Bibos .that the zebu
cannot be regarded as a domesticated descendant of this genus. The other possibility
would be to assume that the primigenius breed of cattle was crossed with a species of
Bibos (Zeuner 1963). Hump of the zebu is an enlarged muscle without any support
vertebrae asln the gaur (Mason, 1972). Hump ofthe Bor indicus is different from he
crest of Bibos spp. Bos indicus is more like Bos taurus than Btbos spp. in most of
bodv charactersP especially the cranial osteology (Grigson, 1980). In spite of these fin
St ymoTe explained why humped cattle are restricted to ho, and dry climates.
The hump is a genetically fixed character already well developed in the calf at but .

Zeuner (1963) andNaik (1978) advocated that humped cattle existed in India and
zebu^has originated3 from Bos nomadicus in India. Naik (1978) opined that there were
to deferent centres of domestication in India - one in North an id . ^
The Neolithic culture appeared in India several thousand years later than in Western
Isia^Vishnu-Mittre, 1978) and probably the migrant pastoralists introdueed domestic

ORIGIN AND DOMESTIC A TION

cattle. Thapar (1957) and Fairservis (1975), based on archaeological evidences, stated
that humpless short homed cattle existed in southern and northern India and became
extinct by 400 BC and 800 BC respectively.

There are evidences that Bos taurus and Bos indicus have been introduced from
Western Asia by migrant pastoralists. Bos taurus, the humpless cattle, were introduced
earlier but due to hot humid environment, did not last long. Meadow (1984) hypoth¬
ecated that humped cattle were domesticated from Asian urus Bos nomadicus in
Baluchistan. Payne and Hodges (1997) considered the south-eastern or north-eastern
edge of ‘Fertile Crescent’ or the edge of Iranian desert as the possible centre for domes¬
tication of zebu cattle.

The zebu with its long face, steep horns and hump is so distinct an animal that its
origin has been discussed frequently. In view of the fact that zebu and primigenius
cattle were sharply distinguished by the Mohenjo-Daro people, a separate origin of the
two is likely. That the primigenius breed came from temperate or western Asia is
evident from the distribution of their wild ancestor in these parts. In India, however, a
closely related wild cattle Bos nomadicus is found throughout the Pleistocene and it is
conceivable that the zebu is its direct descendant.

Cytogenetic studies of various genera of Bovidae show that the fundamental num¬
ber in the diploid chromosomal complement is 58 (ISCNDA, 1989). The genus Bos has
60 chromosomes: 58 autosomes acrocentric in morphology and 2 sex chromosomes X
and Y. The X-chromosome is sub-metacentric in morphology. The difference in the
morphology of Y-chromosome in taurus and indicus also show that they had different
ancestors. The Y-chromosome is sub-metacentric in taurus and acrocentric in indicus.
Even with various types of high resolution bandings like GTG, RBG and QFQ the
idiogram of individual chromosomes could not yield any difference between zebu and
taurus in any other chromosome. The morphological difference in the Y-chromosome
was also revealed by high resolution banding. The difference in morphology may be
due to pericentric inversion in the Y-chromosome. This view is held to be correct by the
recent research on mitochondrial DNA which confirms that African and European cattle
had an ancient separation. Bos indicus and Bos taurus have an estimated lineage diver¬
gence time of 200 000 to 1000 000 BC (Cunningham etal., 1994; Meghen etal., 1994;
Bradley et al., 1996).

Some authors have held the opinion that the zebu was introduced into India from
Africa. There is no pre-historic evidence to support this, nor is there any palaeontological
evidence, as no wild race of Bos is known from tropical Africa in the Pleistocene. One
might think of southern Arabia as a possible country where zebu could have originated,
but there is absolutely no evidence available for or against such a view. Its presence in
very early pre-historic sites in India makes its Indian origin virtually a certainty. The
Indus Valley civilization has provided abundant representations of humped cattle,

ANIMAL GENETIC RESOURCES OE INDIA - CA TTLE AND BUFFALO

especially from Mohen-jo-Daro. The zebu became popular in Egypt in New Kingdom
times. There are many illustrations dating from the eighteenth dynasty. Two kinds
appear to have been bred - a short horned one and one with normal sized horns.

Spread of Domestic Cattle in Indian Sub-continent

The domestic cattle appeared in the northwest region of the sub-continent from
Western Asia after 3,000 years. The Harappan civilization in the Indus Valley dates
from ca 2300 BC. The valley had a well-developed low-land agricultural system and
extensive livestock husbandry. Fairservis (1975) predicted that the tradition of food
production was derived from Iranian culture which in turn received such cultural traits
from Mesopotamia. These cattle slowly spread through pastoralists to the Deccan. Bos
taurus cattle became extinct by ca 400 BC in the Deccan also. Pastoral people herding
their livestock also moved eastwards from the Indus to the valley of Ganges and came
in contact with the rice-cultivating people. These cattle were introduced into Bihar and
Bengal by ca 1500 BC (Payne and Hodges, 1997). According to the Rigveda, Aryans
with their cattle, sheep, goats and horses invaded the Indus Valley and introduced Bos
indicus type of cattle into India. Payne and Hodges (1997) assumed that Bos indicus
type cattle were introduced as far south as Karnataka and as far east as Bengal by ca
1500 BC.

The cattle were used for the production of meat until the ban on cow slaughter that
is considered to have been activated by Hindus about 2,000 years ago. According to
Thomas ( 1 989) cattle were also used for sacrifice, a practice that continues among non-
Hindu people in the northeast region of the sub-continent. No direct evidence of dairy
industry was found until ca 1300 to 1200 BC. Wheeled carts pulled by bullocks were
known in pre-Harappan cultures. They were certainly common in the Harappan period,
terra-cotta wheeled carts being found in Mohenjo-Daro and Harappan excavations
(Allchin and Allchin, 1968).

BUFFALOES

There are two quite distinct groups of buffaloes, viz. Indian and African, classified
under genera Bubalus and Syncerus. Of these the African has never been domesticated.
The latter are distributed over the whole of the non-arid parts of Africa and ocurred in
northwest Africa well into the Neolithic, if not later. The only African area where they
appear to have been absent is Egypt.

The true Indian buffalo or arnee was originally confined to India and Sri Lanka.
These large beasts lived in grass jungles near the water in which they liked to wallow.
Domesticated buffaloes have retained this habit. They have changed very little, com¬
pared with their wild ancestor. Interbreeding with wild specimens is quite frequent.
The Indian buffalo, given the specific name bubalus by Linnaeus, has a thin coat of hair

ORIGIN AND DOMESTICATION

which it loses with age (Cockrill, 1974). Hair is black or reddish; very rarely white
specimens occur in nature. Horns are flat above and strongly ribbed, a character that
distinguishes them from other members of Bovidae. They are more closely related to
yak, bison, gaur and banteng than to cattle.

Domestication of the buffalo took place at an early age. Buffalo’s proximity to man
became possibly due to its crop destroying nature. These are known to be domesticated
during Indus Valley civilization (3250 to 2750 BC) as evident from seals and recovery
of bones from Mohen-jo-Daro sites which has been further confirmed from archeologi¬
cal finds in the Deccan plateau (Nagarcenkar, 1975).

The buffalo’s westward progress has been slow and restricted, but the beast proved
to be an outstanding success in the Far-East. From India its use spread to Indo-China
and the Sunda archipelago. It first reached China and then Japan. In all these countries
it is of real importance in connection with rice-growing. The muddy rice fields are the
very environment in which buffaloes thrive. This close association may be regarded as
evidence that the original domestication of the buffalo was located in the rice-growing
area, and it is conceivable that it lay in Indo-China or South China rather than in India.
But there is no archaeological material to support this view (Zeuner, 1963).

The domesticated buffalo is found in southern and western China, particularly in
the swampy lowlands, where rice is cultivated. In such places buffaloes are consider¬
ably more resistant to diseases than cattle. In northern China they are gradually re¬
placed by cattle of various types. Breeds are distinguished by body size, length and
shape of horns, degree of hairiness and colour. It varies in height from 1 10 to 150 cm
at the withers. Horns may be as much as 1 m long. Cross-sections of the horn often
retain the triangular shape characteristic of the wild species.

The buffalo is first and foremost a beast of labour, employed in the preparation of
rice fields, pulling of carts, and working of mills and wells. It is comparatively stronger
than domestic cattle.

From the domesticated stocks of cattle and buffaloes various specialized breeds
have been evolved according to need and climate of the region. These breeds have been
developed through systematic selection for the desired traits. They are now being bred
pure for these traits and are being continuously improved by artificial selection as well
as natural evolution. _

MOVEMENT OF GERMPLASM

In India there is vast and varied biodiversity in farm animals distributed over its large
geographical area. Various breeds of different species of domestic livestock have been
developed over the centuries through natural selection in different agro-ecological zones
and in the process they acquired adaptation to hot climatic stress and resistance to dis¬
eases. These breeds have been exported to various tropical countries to upgrade the
local livestock for improving milk production, draughtability and other animal uses.
Cattle and buffaloes particularly in the neighbouring countries represent a variable mix¬
ture of several Indian breeds. These breeds were imported mainly for their hardiness,
heat tolerance and tick resistance qualities as well as high butter- fat content of milk.

CATTLE

The Indian zebu cattle are now spread to various countries particularly to hot and
tropical regions in Africa, Asia, North and South Americas, and Australia (Table 1).
The history of the movement of Indian breeds to other countries shows that although
several cattle breeds were involved only three have actually left their mark. These are
Ongole, Gir and Kankrej. Brazil and southern states of the United States of America
imported quite a good number of Indian zebu cattle. These cattle were also imported by

Jamaica, Cuba, Trinidad and other Caribbean countries.

Indonesia, Malaysia, the Philippines, Fiji, Afghanistan, Thailand, Cambodia, Viet¬
nam, Sri Lanka, Nepal, Korea, Iran, Iraq, Saudi Arabia in Asia; Kenya, Tunisia, Tanza¬
nia, Seychelles, Mauritius in Africa; the USA, Brazil, Cuba, and the Caribbean coun¬
tries in North and South Americas; and Australia are some of the countries where In¬
dian zebu cattle had been exported and utilized in cattle-breeding programmes.

Introduction of Indian Breeds to Different Countries

Some zebu cattle were shipped to Brazil during 17th and 18th centuries, and were
crossbred with Brazilian cattle of Iberian origin (Santiago, 1978).

The first reliable records of imports date from 1875 when a zebu bull and a cow
were taken to Rio-de-Janeiro from the London Zoo. This was followed in 1881 by the
import of the first Kankrej (Gujarat) bull. Systematic importations from India began at

MOVEMENT OF GERM PLASM

the end of the 19th century and continued until 1930, with one further importation in
1952.

The first large-scale purchase in 1906 consisted of 50 head, and included Hisar,
Malvi, Mewati and Mysore cattle. Between 1918 and 1921 much larger importations

Table 1. Export of Breeds from India to Other Countries

Breed

Homeland

Exported to

Ongole

(Nellore)

India

Brazil, USA, Sri Lanka, Indonesia, Fiji, Indochina,Malaysia,
West Indies, Australia, Jamaica, Switzerland, Argentina,
Paraguay, Mexico, Columbia, Mauritius and Philippines

Kankrej

(Gujarat)

India

Brazil, Mauritius, Taiwan, from Brazil to Mexico
and USA

Krishna Valley

India

Brazil and USA

Gir

India

Brazil and thence to USA, Venezuela, Mexico, Cambodia,
Nepal and Myanmar (Burma)

Red Sindhi

Pakistan
and India

Afghanistan, Nepal, Myanmar, Cambodia, Vietnam,
Malaysia, Brunei, BanglaDesh, Thailand, Sarawak, Sri Lanka,
Indonesia, Philippines, Taiwan, Korea, Iran, Iraq and Saudi
Arabia in Asia; Tunis, Kenya, Tanzania, Seychelles and
Mauritius in Africa; the United States of America, Brazil and
Cuba in America

Sahiwal

Pakistan
and India

Mauritius, Kenya, Tanzania, Sierra, Leone, Malaysia,
Philippines, Vietnam, Thailand, Myanmar, Bangladesh, Sri
Lanka, Nepal, Brazil, Jamaica, Trinidad, Australia and New
Zealand

Mysore breeds

(Kangayam,

Amritmahal)

Southern India

Sri Lanka, Brazil and Malaysia

took place, mainly of the big grey-white cattle of northern India, including Kankrej,
which the Brazilians called Gujarat, later changed to Gujera, Nellore (spelt Nelore in
Brazil), Bhagnari, Krishna Valley, Hariana and Gir. Between 1890 and 1921 over
5,000 zebu cattle were exported to Brazil from India. In 1930, the Brazilian Govern¬
ment imported 192 cattle of Gir, Nellore and Gujarat, and these have been maintained
in pure form since then. In 1962, Kangayam animals were also imported.

Large number of zebu cattle were exported from India to Latin America every year
till there was cessation due to outbreak of the First World War. The imports to Brazil

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

were resumed again in 1918 but were discontinued for some years since 1930 for fear
of outbreak of rinderpest.

Three breeds, viz. Gujera, Nelore and Gir, have played a major part in the Brazilian
cattle industry. By 1960 there were 48,500 registered zebu cattle, of which the Gir
accounted for 36%, Indo-Brazilian 36%, Nelore 1 8% and Gujera 3%. However, today
the Nelore is probably the most numerous breed. Nelore continued to increase in popu¬
larity as a beef animal because of tight sheath. Brazil has also herds of Sahiwal and Red
Sindh i cattle.

Asian Countries

Amongst Asian countries, Taiwan imported Kankrej and Red Sindhi breeds during
1 894 to 1945 to improve body size and draughtability of local Taiwan cattle. Majority
of Taiwan draught cattle now show the influence of these two breeds, and the graded
animals have been named as Taiwan Zebu. The Philippines imported 1 bull and 7 cows
of Red Sindhi in 1932, and 2 bulls, 36 cows and 16 calves in October 1934, and devel¬
oped a Red Sindhi purebred breeding herd at Alabang Stock Farm, Bureau of Animal
Industry. In 1950 another import of 6 Sahiwal bulls, 9 cows, 71 heifers and 2 calves
was made from India. In the Philippines, the Sahiwal was also used for crossbreeding
with Brown Swiss in order to evolve a dairy cattle breed. During French occupation,
Vietnam imported Red Sindhi, Hariana and Sahiwal. Thailand imported Tharparkar in
1980. Some South Asian countries like Indonesia, Malaysia and Thailand imported
Indian zebu crossbred cattle heifers from Australia and New Zealand.

Kenya

Kenya is the third leading country with major Sahiwal cattle genetic resources pri¬
marily developed from Sahiwal cattle acquired from India and Pakistan. It serves as an
important source of breeding stock and germplasm for whole of the African continent.
In 1939, improvement of Kenya’s local cattle through upgrading was started with im¬
port of 4 Sahiwal bulls from Pusa, India. By 1963, 60 bulls and 12 cows of Sahiwal
cattle from India and Pakistan were imported. A national Sahiwal herd has been estab¬
lished at Naivasha for futher improving and utilizing its germplasm for propagation,
upgrading and crossbreeding with temperate cattle breeds.

Ongoles

Ongoles are our mute ambassadors to several countries. South American countries
keep pure Ongoles (Nath, 1981). The United States of America imported the Ongole
but mixed it with other Indian breeds to develop Brahman. South America developed
Indu-Brazil by mixing Ongole with Gir and Kankrej. The last shipment of Nellore
bulls into Jamaica was in 1921 . Until mid-1920s, most of the zebu cattle in the USA
were of Nellore type.

MOVEMENT OF GERMPLASM

Brazil imported Ongoles first in 1875. In 1906, a large contingent of 200 Ongole
cows and bulls was brought to Uberaba in Brazil. During 1961-62 Brazilians pur¬
chased 107 Ongole cows and a few bulls. Between 1890 and 1921, more than 5,000
zebu cattle were taken from India to Brazil (Sreemannarayana, 1981). While early
Indian cattle taken to Brazil were of Mysore type, after 1900 many Nellores were also
imported.

The first import of an Indian bull and cow into the USA was in 1 854. In 1878 the
USA imported 4 bulls and 1 cow. In 1 885, it imported 2 Nellore bulls. Again in 1 890,
1 Ongole bull and 1 cow were imported. Most of these bulls and the 3 cows were of
Ongole breed. Of the 9 Indian breeds, viz. Sindhi, Sahiwal, Gir, Kankrej, Ongole,
Hallikar, Kangayam, Hisar and Krishna Valley, introduced into other countries Ongoles
were in largest numbers and are the most widely distributed (Nath, 1993). Traits of
hardiness, disease resistance and capacity to thrive on scanty and dry fodder by Nellore
and Ongole breeds have been quite successfully exploited for improving and upgrading
the local stock of European origin.

Ongoles have been imported by the USA for beef, Brazil for beef and milk, Sri
Uanka, Fiji and Jamaica for draught, Australia for heat tolerance and beef, and Switzer¬
land for disease resistance. Ongoles have been imported by many other countries like
Argentina, Paraguay, Mexico, Columbia, Mauritius, Indonesia, the Philippines and
Malaysia (Rao, 1995).

Contribution of Indian Cattle to the Development of Synthetic Cattle Strains

Different Indian cattle breeds exported to foreign countries have been maintained
as purebreds in some cases, but were mainly used for crossbreeding with cattle breeds
of temperate countries and upgrading the native cattle of these countries. Crossbreed¬
ing for combining characteristic features of hardiness, adaptation to climatic stress and
resistance to tick-borne diseases of Indian zebu cattle with high milk and beef produc¬
tivity of cattle breeds of temperate countries resulted in creating various internationally
reputed synthetic crossbred cattle breeds. Some of these are described in the following
pages.

American Brahman cattle

Brahmans are like Indian humped zebu cattle. They had been developed in the Gulf
area of the South-West USA between the years 1 854 and 1926. Different cattle breeds
of Indian origin, viz. Kankrej, Ongole, Gir, Krishna Valley, Hariana and Bhagnari, are
considered to be used as constituents of Brahman cattle. The foundation stock of Indian
cattle were either imported directly into the USA or indirectly through Brazil and Mexico.
Brahman cattle normally have very light grey coat colour but red, or black coat-coloured
animals are also found. This breed has been developed essentially for beef production.

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

In the USA and many other countries, it has been widely used for crossbreeding purpose,
particularly to produce zebu x temperate beef cattle breeds that are well adapted to
tropical and sub-tropical environment. Brahman, as zebu cattle breed, had also been
used in crossbreeding the Aberdeen Angus, Hereford and Charolais resulting in Brangus
(Brahman x Angus), Brayford (Brahman x Hereford) and Charbray. Santa Gertrudis,
another crossbred cattle breed with 3/8 zebu cattle and 5/8 shorthorn cattle, was devel¬
oped in Texas, USA.

Jamaica Hope

This cattle breed has been developed from a herd established in Jamaica in 1910.
Different temperate region cattle breeds, viz. Holstein-Friesian, Jersey, Ayrshire and
Red Pole, were introduced to the originally stocked Criollo cows. Indian cattle inherit¬
ance was introduced in the formation of Jamaica Hope in 1920 through 2 Sahiwal bulls
imported from Sahiwal herd at Pusa, India. The Jamaica Hope cattle breed constitutes
about 70 to 75% of Jersey and about 20% of Sahiwal and small fraction of Criollo
cattle. The Jamaica Hope resemble more to Jersey. They are now widely distributed
throughout Jamaica and have been exported to other Caribbean and Central and South
American countries.

Indu-Brazilian Crossbred Cattle

In Brazil various types of Indian cattle had been maintained as separate cattle breed
herds. Some were interbred resulting in the formation of Indu-Brazilian crossbred cattle
breed. This breed was developed through indiscriminate crossbreeding between Indian
cattle breeds, mainly Kankrej, Gir and Ongole, with Brazilian cattle. In initial stages
Brazilian cattle were crossed with Kankrej and later on with Gir. The Indu-Brazilian
breed development started mainly during the decade of 1920 because of ban on import¬
ing Indian cattle from 1921 to 1930. The modern Indu-Brazilian cattle have morpho¬
logical characteristics resembling those of Gir cattle and have also similarity with
American Brahman. This breed has been developed for beef production.

Mpwapwa (Indo-African Zebu Cattle Breed)

In East African countries, the development of Mpwapwa cattle breed for both milk
and beef production was started in 1958. The average genetic composition of the foun¬
dation cattle stock of this breed was 32% Red Sindhi, 30% Sahiwal, 19% Tanzanian
short-horned zebu, 10% Boran, 9% European breeds (mainly Ayrshire) and Shorthorn.

Australian-Friesian Sahiwal (AFS)

Sahiwal bulls were crossed with Holstein-Friesian cows in early sixties in Austra¬
lia in order to combine resistance to Boophilus microplus exhibited by the Sahiwal

MOVEMENT OF GERMPLASM

cattle with milk production ability of Holstein-Friesian. As a result of this crossing, a
tick-resistant dairy cattle breed was developed. Further progeny-testing programme on
young AFS bulls for tick resistance was also started. In Queensland, milk and fat
yields of AFS were found to be about 75 and 82 % of those of Holstein-Friesian cows,
and similar to other Bos taurus breeds. However, data from humid tropics of Northern
territories indicated AFS cows outyielding Holstein-Friesian and other Bos taurus cows.
There is further scope for spread of such synthetic cattle germplasm to wet tropics of
Southeast Asian and Central Asian countries. Sahiwal x Bos taurus crossbred calves
from Australia and New Zealand have been imported to Malaysia.

Australian Milking Zebu (AMZ)

Another crossbred synthetic cattle strain was developed in Australia incorporating
Red Sindhi and Sahiwal zebu cattle inheritance. In the first stage of breed develop¬
ment, Sahiwal and Red Sindhi males were crossed with Jersey females, and were inter-
se mated up to Fr The Red Sindhi and Sahiwal crossbreds were kept separate. The
second stage was based on progeny testing of young bulls from meritorious dams and
mated to top 10% elite cows of each co-operating herd for production of young bulls for
future testing. The young bulls under testing were further exposed to two screening
tests, viz. (i) artificial climatic stress and (ii) infestation of cattle ticks. In the third
stage, only sons of progeny-tested sires and high-yielding dams were subjected to screen¬
ing and progeny testing. The ultimate aim was to develop animals containing between
3/8 and 1/2 of Bos indicus inheritance, and select for milk production, tolerance to
climatic stress and resistance to ticks.

BUFFALOES

The river buffalo seems to have originated from the Indus Valley and the Indo-
Gangetic plains in the Indian subcontinent, and from there it spread to other parts of
Asia and the world. The river buffaloes are now found in all the continents and in about
40 countries spread from South China to Taiwan, the Philippines, Thailand, Indonesia,
all the Indo-China States, the Far-East and Australia. Recently, buffaloes have multi¬
plied surprisingly very fast in some of the countries, especially Trinidad and Tobago,
Peru, Surinam, Guyana, Venezuela, Columbia, Bolivia, Brazil and Australia. Origi¬
nally, the buffaloes were introduced from South East Asia into some of these countries
as a draft animal for sugarcane cultivation by European settlers. Subsequent introduc¬
tions have taken place from time to time of river type buffaloes from the Indian Penin¬
sula (Rao and Nagarcenkar, 1977).

Records are not available for the export of animals prior to 1 895 . However, migra¬
tion of river buffaloes occurred from time to time along with invaders, pilgrims and
crusaders (Table 2). Brazil seems to be the first country to purchase buffaloes from

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

India in 1895. After that various countries like Trinidad, the Philippines, China, Bul¬
garia, Thailand, Uganda, former USSR, Vietnam and Nepal have imported river buffa¬
loes from India. Thailand, Bulgaria and the Philippines have also imported frozen se¬
men doses from India.

Among the buffalo breeds imported by various countries from India, Murrah seems
to be the most preferred one, followed by Nili-Ravi. A few animals of Jaffarabadi and
Surti breeds have also been exported.

In India, Rohtak and Jind districts of Haryana state, the native tract of Murrah
buffaloes, are the main trading centres. Large number of buffaloes are purchased from
this area and sent to other parts of the country and abroad. This trade in Haryana ac¬
counts for a turnover of about Rs 70 million. Movement of cryopreserved germplasm
in the form of semen and embryos is easy, and is on the increase. Murrah is considered
to be the best milch breed of buffaloes and is being preferred over other breeds all over
the world.

Table 2. Export of Buffalo Breeds from India to Other Countries

Sr.

Exported to

Year

No. & type of animals

How movement of animals occurred

No.

or semen doses

Mesopotamia

500 BC

Variable no.of river

Along with early invaders and

Iraq, Iran, USSR

buffaloes

followers of Alexander

Egypt

Mid

Variable no.of river

Along with Arab invaders

700 AD

buffaloes

Bulgaria

800

Variable no.of river

Along with pilgrims and crusaders

buffaloes

from Mesopotamia

1979

1,000 doses of frozen
semen of Nili-Ravi

As germplasm exchange

1961,

Murrah, Nili-Ravi, Surti,

As germplasm exchange

1970

Jaffarabadi

Italy

Between

Murrah, Nili-Ravi, Surti,

As germplasm exchange

475

and 900

Jaffarabadi

European

1000

Murrah, Nili-Ravi, Surti,

Along with pilgrims and

countries

Jaffarabadi

crusaders from the holy land

like Hungary,
Romania,

former Yugoslavia,
Greece

MOVEMENT OF GERMPLASM

Table 2. Concluded

1 2

6. Brazil

1895

Murrah, Nili-Ravi, Surti,
Jaffarabadi

Through purchase and shipment

7. Trinidad

1903-

1906

Variable No.
of Nili/Ravi, Jaffarabadi,
Surti, Nagpuri,

Bhadawari buffaloes

Along with migrants

1948

6 Murrah bulls

Along with migrants

8.. The Philippines

1917

57 river buffaloes

Through purchase and shipment

1918

57 river buffaloes

Through purchase and shipment

1947

85 river (Nili/Ravi buffaloes) Through purchase and shipment

1947

50 Murrah

Through purchase and shipment

1950

119 Murrah (3 males,

116 females)

Through purchase and shipment

1953

100 Murrah males

Through purchase and shipment

1955

323 Murrah

Through purchase and shipment

1956

98 Murrah females

Through purchase and shipment

1982

1,000 doses of frozen
semen of Murrah

As germplasm exchange

1984

1,000 doses of frozen
semen of Murrah

As germplasm exchange

1985

1,000 doses of frozen
semen of Murrah

As germplasm exchange

9. China

1957

55 Murrah

As germplasm exchange

10. Thailand

1962

Murrah (variable no.)

Migration with Indian peoples’
relative

1979

1 00 Murrah

Government purchase as a
germplasm exchange

1979

1,000 doses of frozen
semen of Murrah

Donation by Government of India

11. Uganda

1969

13 Murrah

(12 females, 1 male)

Through purchase and shipment

12. Former USSR

1970’s

Murrah

Government purchase as a
germplasm exchange

13. Vietnam

Late 1970’s
and early
1980’s

Murrah

Government purchase as a
germplasm exchange

14. Nepal

Late 1970’s

Murrah

Government purchase as a
germplasm exchange

Source: Balaine (1988).

□

CLASSIFICATION OF BREEDS

CATTLE

India has several breeds or types of cattle. These breeds have been evolved over centu¬
ries to suit to the agro-climatic conditions of the region where they are bred and reared.
Many of these breeds have been named after their place of origin. Some of the breeds
are completely different from each other in respect of morphological characteristics,
whereas the others have some common characteristics. Many researchers tried to
classify the breeds into different groups according to their place of origin, type and
physical characteristics especially horn shape and size, and coat colour. The major
types identified are humpless ( Bos taurus), humped (Bos indicus) and crossbreds be¬
tween these two. Olver (1938) was, perhaps, the first to classify zebu cattle of the In¬
dian sub-continent into 6 groups on the basis of similarities in some physical character¬
istics. Ware (1942) agreed to this classification with some modifications. Phillips
(1944) assigned appropriate breeds to these groups. Joshi and Phillips (1953) summa¬
rized these groups.

CLASSIFICATION BY JOSHI AND PHILIPS (1953)

Group I

Breeds of this group are lyre-homed grey cattle with wide forehead, prominent
orbital arches, and thin, flat or dished face. Kankrej, Malvi, Kenkatha, Kherigarh and
Tharparkar belong to this group. Tharparkar breed seems to be intermediate between
groups I and II and it can be included in group II also.

Group II

Short-horned white or light grey cattle with long coffin-shaped skulls but not so
prominent orbital arches and slightly convex face are included in this group. Hariana,
Ongole, Mewati, Gaolao, Krishna Valley, Nagori, Rath and Bachaur breeds belong to
this group. Hariana and Ongole breeds are distinct and important types of this group.
The Krishna Valley breed seems to carry Ongole blood whereas all the remaining breeds
of this group seem to have evolved from a Hariana base.

Group III

This group comprises animals of heavy type having pendulous dewlap and sheath,

CLASSIFICA TION OF BREEDS

prominent forehead, and lateral and often curled horns. They are spotted either red and
white or completely red or brown. The Gir is the most important breed of this group
and seems to have influenced all other breeds of this group. Other breeds of this group
are Red Sindhi, Sahiwal, Dangi, Deoni and Nimari.

Group IV

Cattle of this group are medium sized, compact animals having powerful quarters
and tight sheaths. Forehead is prominent. Horns emerge from the top of poll fairly
close together in an upward and backward direction ending in pointed tips. Colour
varies from almost white to steel grey or black. The ‘Mysore typ’ cattle, viz. Amritmahal,
Hallikar, Kangayam, Khillari and Bargur breeds, are included in this group.

Group V

This group includes cattle of mixed type. They are small, black, red or dun cattle
often with large patches of white markings. Poll and hump are covered with coarse
hair. Horns are small or sometimes slightly lyre-horned. These animals are found
mostly in hills. Ponwar and Siri belong to this group. In almost all breeds of this group,
the position of hump may be described as cervico-thoracic, but in Siri cattle it is tho¬
racic. Ware (1942) and Payne (1970) reported that Siri breed has cervico-thoracic
hump. During a survey, the authors of this book observed that hump is slightly forward
in Siri as compared to that in other Indian breeds.

Group VI

This group is represented by Dhanni breed of cattle from the part of Punjab, now
in Pakistan. These animals are medium sized, compact and active. Dewlap and sheath
are tight. Colour varies from almost white with evenly scattered black or red spots over
the whole body to black or red with spots on certain parts.

Payne (1970) listed following difficulties in completely accepting this classifica¬
tion: (i) this classification is not complete as Bos (Bibos) spp. and their crossbreds are
excluded; (ii) in some groups there are important exceptions to the conformational
characteristics used for classification; (iii) the Dhanni breed is placed in a separate
group although it has obvious conformational and other similarities with group IV
breeds; and (iv) the Siri which possesses a cervico-thoracic hump, is classified with
group V breeds that are said to possess thoracic humps.

He further suggested that any classification of breeds in Indian sub-continent should
include Bos (Bibos) spp. and crossbreds between these and humped cattle, and that
within humped type there should be a more rational classification. He classified these
breeds as:

1 . Short-horned zebu with white or light grey coat, non-prominent orbital arch and
long coffin-shaped skull. The Hariana and Ongole are the 2 most distinct and

ANIMAL GENETIC RESOURCES OE INDIA - CA TTLE AND BUFEALO

important breeds. Bachaur, Nagori and Rathi breeds are probably related to the
Hariana breed while the Gaolao breed appears to be related to Ongole breed and
should be included in this group. The Mewati breed demonstrating the influence of
the lyre-homed cattle, the Gir and the Krishna Valley, a breed of recent origin dem¬
onstrating even more mixed ancestry, should also be included in this group.

2. Lateral-horned zebu with curved horns. The Gir is the most important breed in this
group. The Dangi, Deoni and Nimari breeds are of more recent origin, but should
be included in this group. The Dhanni breed classified by Joshi and Phillips (1953)
in a separate group may also be included. Although the Red Sindhi and Sahiwal
breeds are undoubtedly related to the hill cattle breeds, they also appear to possess
Gir blood; they are tentatively classified in this group though they do not possess
true lateral horns.

3. Lyre-horned zebu with grey coat and prominent orbital arches. The Kankrej and
Malvi are the two most important breeds. The Tharparkar breed should be included
in this group though it could equally be classified in group 1 (Joshi and Phillips,
1953). The Hisar breed is of minor importance.

4. Long-horned zebu with grey coats. The hom is very distinctive and these cattle are
known as ‘Mysore type’. The major breeds included in this group are the Amritmahal,
Hallikar, Kangayam and Khillari. The Bargur and Alambadi breeds are minor
breeds.

5. Small short-horned or lyre-horned zebu found in the hills and peripheral areas.
Major breeds are the Lohani, Ponwar and Sinhala. The Kumauni, Shahabadi and
Punganoor are minor breeds. The Lohani breed is in Pakistan while Sinhala is in Sri
Lanka.

It was also suggested that the Siri should not be classifed as a zebu but as a stabi¬
lized indigenous crossbred as it possesses a cervico-thoracic hump and is in many ways
similar to other breeds of this type found in Southeast Asia. The classification for cattle
of the Indian sub-continent and Sri Lanka is suggested as follows:

CLASSIFICATION OF CATTLE OF INDIAN SUB-CONTINENT AND SRI LANKA
Humped cattle

1. Short-horned zebu (Bachaur, Gaolao, Hariana, Krishna Valley, Mewati, Nagori,
Ongole, Rathi)

2. Lateral-horned zebu (Gir, Dangi, Deoni, Nimari, Dhanni, Red Sindhi, Sahiwal)

3. Lyre-horned zebu (Kankrej, Malvi, Tharparkar, Hisar)

4. Long-horned zebu (Amritmahal, Hallikar, Kangayam, Khillari, Bargur, Alambadi)

5. Small short-horned or lyre-horned zebu (Kumauni, Lohani, Ponwar, Shahabadi,
Punganoor, Sinhala)

CLASSIFICA TION OF BREEDS

Humpless x Humped Cattle

1 . Stabilized indigenous (Siri)

2. Recent (Taylor)

Bos (Bibos) spp
1 . (Gaur)

Bos (Bibos) spp x humpless and/or humped cattle

1 . Intermediate (Gayal)

CLASSIFICATION BY ACHARYA AND BHAT (1984)

Acharya and Bhat (1984) conducted studies on breed classification and divided the
grey- white cattle of India into two groups as follows:

1 . The broad-faced, lyre-homed, grey- white cattle of western India. The Kankrej breed
is the representative breed and appears to have followed the route taken by Rig
Vedic Aryans after entering India through northern passes, turned west, north of
Aravalli range to reach Sind, Gujarat and southern Rajasthan. These are related to
bulls depicted in Mohenjo-Daro seals.

2. The white, narrow-faced, stumpy-homed breeds, e.g. Hariana, Rathi, Gaolao and
Ongole breeds. These are located along the route taken by the Rig Vedic Aryans
from northern passes through central India to the South.

CLASSIFICATION BY MAULE (1990)

Maule (1990) classified typical cattle under 5 groups with zebu (thoracic humped)
cattle in group I and Sanga (cervico-thoracic humped) cattle in group II. Group III
comprises humpless cattle, group IV crosses between humped and humpless cattle,
and group V Bos bibos and crosses. Cattle breeds under group I comprising Indo-
Pakistan region has been classified into 6 subgroups based on physical characteristics
such as hom shape, coat colour and body size. These subgroups are :

1 . Lyre-horned grey

2. Short-horned, white or grey,
coffin-shaped skull

3. Lateral-horned, red, red and
white or black and white

Kankrej, Tharparkar, Malvi, Kenkatha,
Kherigarh

Hariana, Krishna Valley, Mewati, Nagori,

Ongole, Rath, Bachaur

Sahiwal, Red Sindhi, Gir, Nimari, Deoni,

Dangi

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

4. ‘Mysore ’ breeds; grey, long

Alambadi, Amritmahal, Hallikar, Khillari,
Kangayan, Bargur
Lohani, Ponwar, Siri, Terai
Sinhala, Tamakaduwa

backward pointing horns

5. Small hill cattle

6. Cattle of Sri Lanka

CLASSIFICATION BY PAYNE AND HODGES (1997)

Payne and Hodges (1997) classified humped cattle of the Indian sub-continent ac¬
cording to their utility and not by horn type as was done by Payne (1970). They recog¬
nized the major breed types of Indian sub-continent as humped ( Bos indicus) and those
resulting from crossing between Bos taurus and Bos indicus, and gave the following
classification:

Humped Cattle

a. Dairy type

Red Sindhi and Sahiwal

b. Dairy/draught type

Gir and Tharparkar

c. Draught/dairy type

Deoni, Gaolao, Hariana, Kankrej, Krishna Valley, Ongole, Punganur and Rathi

d. Draught type

Amritmahal, Bachaur, Bargur, Bengali, Dangi, Hallikar, Jellicut, Kangayam,
Khillari, Kumauni, Ladakhi, Malvi, Mewati, Nagori, Nimari and Ponwar

Cattle of Crossbred Origin

a. Stabilized indigenous

Siri

b. Intermediate

No indigenous breeds in this category

c. Recent

Karan Fries, Karan Swiss, Sunandini and Taylor.

Presently there are 30 recognized breeds of cattle in India. These breeds can be
broadly classified according to their utility under the following 3 categories.

CLASSIFICATION BASED ON UTILITY

Dairy Breeds

Cows of these breeds are high milk producers, but bullocks are of poor draught
quality. These animals are generally ponderous in build, and have pendulous dewlap
and sheath. Skin is loose. Dairy type breeds are Sahiwal, Red Sindhi, Gir and Rathi.

CLASSIFICA TION OF BREEDS

•t ■>

Z'-

{27

-r*

. J

v *

f ;r

v a-% v?

v 'r
f \ x
£ k< "x

'vVl J >iw /
/ 23 V94k 2h

iJN.

\ Or/ ^<W'''d

Xfw

fci k.

>— V-V-*'

^ ' \i

stS'n

V / \ *

*y «, r

y -v \

■ ('

\ 1 *U_ ,

I . ^

Ho 2bI

1 Amntmah.il

1 ■ FA.lv*

2 Barhaur

1 ; r. V V> , i t 1

4 Bargur

If-; Nag on

4 Dangt

1'f Nthftart

f> [^"oni

20 Gogol* ■

0 Ga< > fat >

21 PttU'.var

/ Gtr

22 Bungalow

P> Hallik.tr

2 1 Rat hr. J

*t Manana

24 H- H Kara

10 Kartgayatt"!

2' • Vil a -a at

11 Kahkr. |

,** > Sj n

12 Ktukatha

2/ Tharp ark

14 Kh* f Kjarlt

2$ l Imbiat ht

14 Khrffari

2*4 V«h hot

1 1 > K rt« .1 •> ( i

Distribution of cattle breeds in India

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

; 4

1 Bhadawan
J.»f .if.ii'.H it
fvlaraf h*,va< j.i

4 MHhfHtna
'■ Murr.*h

* N.iqf -tin
Nth Raw t
h Khh !f .‘if port
v Surti
io Tod a

Distribution of buffalo breeds in India

k y

CLASSIFICA TION OF BREEDS

Draught Breeds

The majority of the indigenous breeds belong to this group. Cows produce little
amount of milk but are reared only to produce bullocks. Bullocks are powerful and
good draught animals. Proportioned body, strong limbs, long barrel, tight sheath, tight
skin, fast gait and alertness are the chief characteristics of this group. Amritmahal,
Bachaur, Bargur, Dangi, Hallikar, Kangayam, Kenkatha, Kherigarh, Khillari, Malvi,
Nagori, Nimari, Ponwar, Red Kandhari and Siri breeds belong to this group. Siri is a
humped cattle as has been proved by cytogenetic studies ( Tantia etal., 1996). It should
be grouped with Bos indicus, and not as of crossbred origin as was suggested by Payne
(1970) and Payne and Hodges (1997).

Dual-purpose Breeds

Cows of this group are fairly good milkers and bullocks provide good draught power.
This group includes Deoni, Gaolao, Hariana, Kankrej, Krishna Valley, Mewati, Ongole
and Tharparkar breeds.

CHARACTERISTICS OF ZEBU CATTLE

Zebu cattle have certain specific characteristics and belong to Bos indicus group.
These characteristics are described below.

Physical Characteristics

The most obvious feature is the presence of a hump. Its position distinguishes zebu
cattle from the closely related Sanga cattle. In zebu cattle, hump is thoracic, i.e. situ¬
ated over the withers, whereas it is cervico-thoracic in Sanga cattle, i.e. it is further
forward than in zebu cattle.

Zebu cattle have a narrower body, longer legs and a well-developed dewlap than
the Bos taurus which have deep body, short legs and a small dewlap. Backline is
uneven, slopes behind the hump, rises to peak between hip bones and then drops
sharply to the tail head. Skin of zebu cattle is generally much looser than that of Bos
taurus. Dewlap and sheath are very pendulous.

Fitness Characters

Zebu cattle are adapted to harsh agro-climatic conditions because of their low meta¬
bolic rate at high temperature than temperate breeds. They can survive and produce on
less feed and fodder and that too of poor quality. They are more resistant to tropical
diseases as compared to European breeds. They have a long breeding life up to 10-12
years. Bullocks provide excellent draught power for agricultural operations.

Genetic Characters

The karyotype of Bos taurus and Bos indicus are similar except forthe difference in

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

the Y-chromosome. The Y-chromosome is sub-metacentric (non-acrocentric) in Bos
taurus and acrocentric in Bos indicus (Gupta et al., 1974; Benjamin and Bhat, 1977).

BUFFALO

Macgregor (1939) named black dairy type buffaloes having curled or sickle-shaped
horns as river buffaloes. These differ from Swamp buffaloes in colour, conformation
and use. The Indian sub-continent has most of the important buffalo breeds, among
which a few are the best in the world. Cockrill (1974) classified Indian breeds into the
following 5 groups:

Group

1 . Murrah

2. Gujarat

3. Uttar Pradesh

4. Central India

5. Southern India

Breeds

Murrah and Nili-Ravi
Jaffarabadi, Mehsana and Surti
Bhadawari and Tarai

Jerangi, Kalahandi, Manda, Nagpuri, Pandharpuri

and Sambalpur

South Kanara and Toda

Acharya and Bhat (1984) also classified domesticated buffaloes into 2 main cat¬
egories, viz. swamp and river buffaloes. They belong to the same species but have
very different habits. Swamp buffalo is more or less a permanent denizen of marshy
lands, where it wallows in mud and feeds on coarse marsh grass. They classified Nagpuri/
Pandharpuri, Toda and Marathwada buffalo as swamp type. The river buffaloes are
found throughout India where clean water of rivers, irrigation canals and ponds are
available to wallow. This type was specially developed for milk production with high
fat percentage. It is docile. Important breeds of milch buffalo, viz. Murrah, Nili-Ravi,
Surti, Mehsana, Jaffarabadi and Bhadawari, are from this group.

Cytogenetic studies have proved that Nagpuri, Pandharpuri, Toda and Marathwada
breeds also belong to riverine group (Nair et al. ,1986) along with Bhadawari, Jaffarabadi,
Mehsana, Murrah, Nili-Ravi and Surti. Buffaloes in coastal districts and Paralakhemundi
area of Orissa posses 2n = 48 chromosomes (Rao, 1981; Bidhar, 1985) and are classi¬
fied as swamp buffaloes.

Khanna (1973) reported genetic differentiation between various buffalo breeds us¬
ing blood protein variants and blood group data. Various Murrah herds located in
different agro-climatic regions were shown to diverge from the base population of Hisar
herd and were genetically closely inter-related. Nili-Ravi was having less genetic dis¬
tance from Murrah. Marathwada and Pandharpuri were reported to have closer genetic
relationship. These two are reported to be strains of same variety and nearer to Nagpuri
breed. Surti was reported as a distinct genetic identity. These results agreed with the
physical and geographical relations between the buffalo breeds. □

CATTLE BREEDS

AMRITMAHAL

Origin and Distribution

The Amritmahal breed is found in Hassan, Chikmagalur and Chitradurga districts of
Karnataka state in southern India. It is a famous draught breed known for its power and
endurance. Animals are fiery and active. Bullocks are especially suited for trotting and
quick transportion. Cows are poor milkers.

The Amritmahal originated from a herd established by the rulers of Mysore State
between 1572 and 1636 AD. They reared these cattle to supply milk and milk products
to the palace, and to produce bullocks
to be utilized for movement of army
equipments. These cattle consisted of 3
distinct strains: Hallikar, Hagalvadi and
Chitaldoorg. Thus the foundation cattle
from which the breed was developed
were of the Hallikar and closely related
types. Between 1572 and 1617 AD
Vijaynagar dynasty brought a group of
Hallikar cows to Srirangapatnam, which
was later taken over by the Wodeyars
of Mysore. From these cattle, royal
families of Mysore (Shri Chamaraja
Wodeyar) established Amritmahal
kavals between 1617 and 1636 AD.

These herds were further strengthened
by Shri Kanteerava Narasaraja Wodeyar
between 1638 and 1658 AD and by Sri
Chikka Devaraja Wodeyar between
1672 and 1704 AD. Nawab Hyder Ali
Khan (1704 to 1799 AD) kept around
60,000 bullocks for movement of army
equipage. Nawab Tipu Sultan trained

ARABIAN SEA

KERALA1

TAMIL!! ADU

WS'M

Breeding tract

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

these males and classified them as gun, pack and plough bullocks. He used these
bullocks successfully in wars against the British. He also changed the name of these
cattle to Amritmahal which literally means department of milk.

Location and Topography

The breeding tract lies between latitude 1 1° 36' and 15° north, and longitude 74° 4'
and 78°4' east. The area is an undulating table land much broken by chains of rocky
hills and scores of deep rivers. Its form is that of a triangle with the apex to the south at
the point where the Western and Eastern Ghat ranges of the hills converge in the group
of Nilgiri hills of the south. The altitude ranges fromt 540 to 900 m above msl.

Soil

Soils in the east are red loam or clay loam. These are generally deficient in phos¬
phorus. Stony and widespread pasture grounds in the central parts of the region repre¬
sent very poor soil with coarse grasses. The plains in the north are of black soil and are
used for crops such as cotton and millets. Tracts in the south and west are irrigated by
channels drawn from rivers. Sugarcane and rice are grown here.

Climate

The climate is pleasant throughout the year. Temperature ranges from 1 4° to 35°C.
The tract gets rains from both southwest as well as northeast monsoons. The rainy
season begins in early June and continues with some intervals in August and September
to the middle of November, closing with heavy rains of the northwest monsoon. These
later rains are very useful for pastures. Annual rainfall ranges from 70 to 90 cm. Then
the mild cold season begins, which is dry and lasts until the end of February. The hot
season then sets in and increases in intensity to the end of May with occasional relief
owing to thunderstorms.

Management Practices

This breed is purely used for draught purpose. Calves are not weaned. Bull calves
are allowed to suck all milk from their dams. Calves of very poor milkers are some¬
times given extra quantity of milk. After 3 months calves are allowed to graze.
Amritmahal cattle are reared mostly in small numbers. They are owned by well-to-do
cultivators and large breeders who maintain herds in the vicinity of hills where good
grazing is available. Breeders sell calves to cultivators, who after training them for
yoke sell them at the cattle fairs. These animals are kept in the open all the time and
trees are the only source of protection from rain and sun. This weeds out the weaklings
automatically. Bull calves are castrated at the age of 18 months but under village
conditions this age may be as high as 4 years. Depending on the soil and irrigation
facilities, various crops are grown. In black cotton soil in the north, cotton, millets.

CATTLE BREEDS

Amritmahal bull

Amritmahal cow

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

sorghum and oilseeds are extensively
grown. In the south sugarcane and
paddy are grown. Grasses commonly
observed are Andropogon sp., Arislida,
C. dactyl on, etc.

Amritmahal calf

Physical Characteristics

Amritmahals are grey cattle but
their shade varies from almost white to
nearly black. In some animals white-
grey markings are present on face and
dewlap. Muzzle, face and tail switch are
usually black but in older animals the
colour looks lighter. Cows are white,
bullocks slightly white and bulls dark,
rusty white and even interlace to some
extent. Typical characteristics of this
breed are head shape and horns. Head
is long and tapering towards muzzle.

Forehead is narrow, bulging out with a furrow in the middle. Homs are long and emerge
from the top of the poll fairly close together in backward and upward direction, turn in
and end in sharp black points. Sometimes the long, sharp points touch each other and
appear like torch light. Eyes are bright. Ears are small, horizontal and taper to a point.
Hump is well developed and is carried slightly forward. Dewlap is fine and does not
extend very far. Sheath and navel flap are very small and close to the body. Legs are
medium in length and well proportioned. Hooves are hard, close together and small.
Skin is thin, smooth, tight and jet black with short glossy hair. Udder is small, and
compact with hard and small teats.

Morphometric and Performance Parameters

Body length, height and heart girth average 130, 150 and 170 cm, respectively, in
males, and 1 30, 1 50 and 1 50 cm, respectively, in females. An adult male weighs around
500 kg and female around 318 kg. Age at first calving is 1,337.6±1 15.52 days and milk
yield is 572±24 kg. Calving interval is 577.6±24.32 days and lactation length 299±10
days.

Breeding Farms

1 . Cattle Breeding Station, Ajjampura, Karnataka

2. Composite Livestock Farm, Hessarghatta, Bangalore, Karnataka

CATTLE BREEDS

Amritmahal herd

Contact Agencies

1 . State Animal Husbandry Department, Karnataka

2. BAIF, Pune, Maharashtra

3. University of Agricultural Sciences, Bangalore, Karnataka

4. People’s Trust, Bangalore, Karnataka

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

BACHAUR

Synonym: Sitamarhi
Origin and Distribution

This breed was found in Sitamari and some parts of Madhubani, Darbhanga,
Samastipur and Muzaffarpur districts of Bihar but a recent survey has revealed that the
original breeding tract has shrunken and the Bachaur cattle are now concentrated in the
areas adjoining Nepal border comprising Bachaur and Koilpur subdivisions of Sitamarhi
district. It is known for its draught qualities and ability to thrive on poor fodder re¬
sources. This breed has very close similarity to the Hariana breed. A pair of bullocks
fetches around Rs 5,000 to 35,000.

Location and Topography

The breeding tract is situated in the north-central part of Bihar, lying approximately
between 26° and 26°6' north latitude, and 85° and 85°6' east longitude.

Soil

The area consists of low-lying allu¬
vial plain traversed at intervals by ridges
of high ground. Beds of nodular lime¬
stone are occasionally found in the tract.
Major portion of the area is fertile with
high cropping intensity.

Climate

The climate of the area is hot and hu¬
mid. Maximum temperature in summer
is about 45°C and in winter about 2 1 °C.
Minimum temperature during winter is
about 9°C. Average rainfall of the area
is 125-140 cm. Humidity ranges from
66 to 90%.

Paddy, barley, wheat, chickpea, mus¬
tard, lentils and sugarcane are the most
important crops. No special fodder
crops are grown in the area for cattle
except Lathyrus sativus in paddy fields
and mustard sown with high seed rate
as a winter crop and then gradually
thinned and used as green fodder.

ORISSA

UTTAR PRADESH

WEST BENGAL

MADHYA PRADESH

Breeding tract

CATTLE BREEDS

Bachaur bullocks

Bachaur cow

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Management Practices
The Bachaur breed is maintained by
the Koir and Ahir communities. Ma¬
jority of them have few animals but a
few have large herds. Cattle are grazed
in the nearby grassland areas. Cow hav¬
ing male calf is not milked at all and
the calf is allowed to take all the milk.
Males are castrated at the time of erup¬
tion of horns, i.e. at about 1 to 1 Vi years
of age.

The males produced in the village area
are valuable and traded everyday in
small ‘Hatia’ being arranged privately
or by the government. These practices
are being followed for many centuries.
Small and marginal farmers buy
Bachaur bullocks from these trade cen¬
tres for various agricultural operations.

Physical Characteristics

The cattle are of grey colour, compact with straight back, well rounded barrel, short
neck and muscular shoulders. Muzzle is either black or brown. Eyelids are black for
animals having black muzzle and white for animals having brown muzzle. Face is short,
forehead broad and flat or slightly convex.

Poll is almost absent. Eyes are large and prominent. Horns are medium sized,
stumpy curving outward and upward. Ears are small and drooping. Hump is compact,
firm and medium sized. Legs are short and thin. Sheath and navel flap are light and
close to the body. Dewlap is medium sized. Tail is short and thick, and usually does
not go far beyond the hock. Tail switch is either black or white. Udder is small, trough
shaped with cylindrical teats having rounded tips. Colour of skin is black.

Morphometric and Performance Parameters

Length of a bull is around 110-120 cm, height 1 10-125 cm and heart girth 140-170
cm. Length, height and heart girth of females are around 95-1 15, 100-120 and 135-165
cm respectively. Adult body weight is around 385 kg in males and 318 kg in females.
Average age at first calving is 1,453.24±21 .75 days. Cows are poor milkers and pro¬
duce around 540 kg of milk (range 495 to 605 kg) in a lactation of 254.34±2.49 days.
Average calving interval is 487.8±5.92 days. Bullocks can work for about 8 hours
without any break.

Bachaur calf

CATTLE BREEDS

Bachaur herd

Breeding Farms

1 . The Bachaur Cattle Breeding Farm, Pusa, Bihar
Contact Agencies

1 . State Animal Husbandry Department, Bihar

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

BARGUR

Origin and Distribution

Bargur is a draught breed found around Bargur hills in Bhavani taluk of Erode district
of Tamil Nadu, and are bred extensively by Lingaiys and Lambadis of that area. This
area was earlier a part of Coimbatore district. Animals are of Mysore-type, but smaller
and more compact. They are very restive and fiery in disposition, and are difficult to
train. They are light in built and are developed mainly for carrying out agricultural
operations in the uneven and hilly terrain. Cattle of this breed are unsurpassed in speed
and endurance in trotting.

Location and Topography

The breeding tract lies between 1 1°40' and 12° north latitude, and between 77°20'
and 77°70' east longitude.

Soil

Mostly red sandy followed by black and alkaline. Soil is shallow in depth and

texture ranges from sandy to gravel.

Climate

Climate is usually hot. Maximum tem¬
perature varies from 30° to 38° C and
minimum from 19° to 26° C. Annual
rainfall is about 65 cm and mean rela¬
tive humidity varies from 53 to 77%.

Management Practices
These cattle are mainly reared in the
forest area in semi-wild conditions and
penned in enclosures called pattys. They
are tended by hired local tribal labourers
called Lingaiys. Each patty has 50 to
200 heads of cattle. For most part of
the year, these cattle remain in the inte¬
rior of forest and graze on the existing
vegetation. They are brought back to
villages for harvest operations and sent
back to forest area after the next sow¬
ing is over. All these cattle are driven
to salt licks about 43 km north of Bar-

Breeding tract

CATTLE BREEDS

Bargur bullock

Bargur cow

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

gur by about January for a few days and then driven to forest again. Cows are not
usually milked. Calves remain with their dams throughout.

Physical Characteristics

Bargur cattle are of brown colour with white markings. Some white or dark brown
animals are also seen. Calves are generally brown in colour. Colour does not change
with age as in Kangayam and Umblachery breeds. Animals are well built, compact and
medium in size. Head is brownish, well shaped, long and tapering towards the muzzle.
Forehead is slightly prominent and has a deep furrow between the roots of horns. Muzzle
is moderate and black in colour. Eyes are prominent and bright. Ears are moderately
long and erect. Horns are of light brown colour, moderate length, closer at the roots,
inclining backward, outward and upward with a forward curve and sharp at the tip.
Neck is fairly long and thin. Hump is moderately developed in females and well devel¬
oped in males. Dewlap is thin and short extending up to sternum only. Navel flap is
present in many animals. Sheath is tucked up. These cattle have thin and bony limbs.
Thighs are well developed. Hindquarters are well developed and slightly dropping.
Tail is well set, fairly long (below hocks) and thin, tapering to a good brownish switch.
Tail length is 85 to 105 cm. Cows have small udders applied close to the body. Teats
are small and well set apart. Skin is loose, mellow with fine short hair.

Bargur calves

CATTLE BREEDS

Bargur herd

Morphometric and Performance Parameters

Average body length of cows is 120.5 cm ( range 98 to 147 cm), and of bulls 1 76.6
cm (range 172 to 201 cm). Average height is 121.6 cm in cows and 125.6 cm in bulls.
Average heart girth in cows is 123.8 cm (range 120 to 148 cm) and 156.2 cm in bulls
(range 140 to 169 cm). Average length and width of face are 43.5 and 26.8 cm, respec¬
tively, in cows and 46.5 and 34.8 cm, respectively, in bulls. Average horn length is 30.8
cm in cows, 33.5 cm in bulls and 35.8 cm in bullocks. Thickness of horns at base is
18.7, 20.1 and 30.9 cm in cows, bulls and bullocks respectively. Average birth weight
in males and females is 18.9 and 18.1 kg respectively, and adult weight is around 340
kg in males and 295 kg in females. Cows are poor milkers, and produce 250 to 1,300
kg of milk in a lactation period of 270 to 3 1 0 days. Mostly cows calve once in 1 6 to 18
months and sometimes once in a year also.

Breeding Farm

1 . Agricultural Research Station, Bhavanisagar, Tamil Nadu
Contact Agencies

1 . State Animal Husbandry Department, Tamil Nadu

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

DANGI

Synonyms: Kanada, Konkani and Ghauti
Origin and Distribution

Dangi is a draught breed found in a small area of Nasik and Ahmednagar districts in
Maharashtra state including an area in the Western Ghats known as Dangs from which
the breed takes its name. They are well known for their excellent working qualities in
heavy rainfall areas, rice fields and hilly tracts.

Location and Topography

The approximate latitudinal position of the tract is between 20° and 22° north while
the longitudinal position is between 73° and 74° east. The whole area is hilly, broken
by deep ravines. Towards the centre and west there are dense forests while to the east
there are larger clearings. It is a hilly tract with heavy rainfall and poor agricultural

production. These hills run north to
south, with spurs on the eastern side.
Though the average altitude of this re¬
gion is about 600 m, the highest eleva¬
tion rises to 1,350 m above msl.

Soil

In the valleys and depressions good
black soil exists, whereas on the slopes
and uplands the soil is red or black with
boulders.

Climate

The climate on the whole is pleasant.
Average maximum temperature ranges
from 28° to 38°C and minimum from
1 1 ° to 3 1 °C. The cold season lasts from
November to February and is dry, Av¬
erage rainfall in the area may be about
250 cm. The Dangi breed has adapted
very well to these agro-climatological
conditions.

Management Practices
Dangi breeders are semi-nomadic.

Breeding tract

CATTLE BREEDS

Dahgi bull

'-.'Vs

Dangi cow

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

They belong to Kanadi, Mahadeo Koli,
Thakar and Maratha communities, who
practice seasonal migration and remain
away from their villages for about 9
months in a year (January to Septem¬
ber). During the hot and dry season,
the breeders migrate towards coastal ar¬
eas where grass, tree fodder and water
are available to some extent. During the
period of heavy rainfall, they settle
down at the foothills for protection
from the cold draught. Green grasses
are available in forest areas during July
to September. Paddy and Eleusine
coracana are extensively grown in the
area. Byproducts from these crops are
used for feeding cattle. Only breeding
bulls are fed with concentrates.

Dangi calf

Physical Characteristics

Dangi cattle have distinct white coat colour with red or black spots distributed
unevenly over the body. Animals are medium in size with deep bodies. Head is usually
small with a slightly protruding forehead. Muzzle is large. Homs are short and thick.
Ears are small. Dewlap is slightly pendulous. Hump is firm and medium in size. Hooves
are black, flint-like and exceptionally hardy. Skin exudes an oily secretion which
protects the animals from heavy rain. Coat is shiny.

Morphometric and Performance Parameters

Body length, height and heart girth average 140, 130 and 150 cm, respectively, in
males. Average birth weight is around 18.4 kg in male and 17.5 kg in female calves.
An adult male weighs around 363 kg.

Milk yield averages 530 kg (range 32 to 1 ,228 kg) in an average lactation period of
269 days (range 100 to 396 days). Average fat%inmilkis 4.3. Average dry period is
190 days (range 0 to 934 days). Average ages at first oestrus, at first fertile service and
at first calving are 1,107, 1,154 and 1,351 days respectively. Average service period
and calving interval are 185.6±9.7 and 474.1±10.2 days respectively. Gestation period
is around 285 days. Conception rate is around 60.45% and the number of services per
conception is around 1.65. Postpartum oestrus interval is 159.2 ± 8.1 days. Dangi
cattle are extensively used for ploughing, harrowing and other field operations, and
also for carting timber from the forest areas.

CATTLE BREEDS

Dangi herd

Breeding Farms

1 . Dangi Cattle Breeding Farm, Igatpuri, Maharashtra
Contact Agencies

1 . State Animal Husbandry Department, Maharashtra

2. Mahatama Phule Krishi Vidyapeeth, Rahuri, Maharashtra

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

DEONI

Synonyms: Dongerpati, Dongari, Wannera, Waghyd, Balankya, Shevera

Origin and Distribution

The Deoni is a very popular dual purpose breed of cattle of Marathwada region of
Maharashtra state and adjoining parts of Karnataka and Andhra Pradesh states. Its
breeding tract lies in the Balaghat range of Sahyadri hills. The actual place of origin is
Deoni, Udgir and Ahmadpur taluks of Latur district. It is also found in Parbhani, Nanded
and Osmanabad districts of Maharashtra and Bidar district of Karnataka.

Deoni cattle is believed to have been developed from Gir cattle about 280-300
years back. The tribes Rabaris, Bharwadas, Charans, Maldars, Ahirs etc. used to move
with their cattle from Gujarat in search of fodder during scarcity period towards the
southern parts of the country. During these periods, Gir herds also come from Gujarat
state to Marathwada region. The migration of Girs to Marathwada led to the increasing
admixture of Gir blood with local herds, contributing to the development of Deoni

cattle. This breed has derived its name
from the habitat i.e. Deoni taluk of Latur
district. The estimated population of
Deoni breed in 1998 was 119,000.
Breedable females, breeding bulls and
bullocks constituted 33.6, 1.5 and 41.1
% respectively.

Location and Topography
Breeding tract of Deoni cattle covers
an area of about 1 1,240 km This area
lies between 17°35' and 20°0T north,
and 75° 16' and 78° 15' east. The whole
area is hilly with an average altitude of
409 and 455 m above msl. 2 major riv¬
ers, viz. Manjra and Mnyad, flow
through this area.

Soil

Soils are deep black and heavy vary¬
ing from medium light to black cotton.

Climate

Climate is generally hot throughout

ARABIANSEA

Breeding tract

CATTLE BREEDS

Deoni cow

Deoni bull

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

the year except some winter months.
Mean maximum temperature ranges
from 29° to 44°C while mean minimum
temperature varies from 9° to 27°C. The
average rainfall is 75 to 89 cm with
maximum precipitation from mid of
July to end of September. Average rela¬
tive humidity ranges from 49 to 54%.

The entire area is open with very
scanty vegetation and poor grass cover.
Grazing facilities as such are scanty.
Sorghum, pearlmillet, pigeonpea,
groundnut, sunflower, cotton, blackgram
and green pea are the major kharif
crops, and rabi sorghum, wheat, Ben¬
gal gram are the major rabi crops.

Management Practices
Deoni calf Herd size is small, mainly of 1 or 2

cows, a pair of bullocks and some young stock. Deoni cattle are maintained under
semi-intensive system. Animals are housed mostly in open houses. Most of the animals
are given individual care. Calves are not weaned. Male calves are nursed better and
longer as compared to female calves. Animals are taken to pastures during day time.
Generally animals are maintained on grazing only. Common grasses are marvel
(. Dicanthium annulatum), kuntha ( Teachninusum pilosum ), dongri (Heteropogan
contratus) and pawana ( Sahima nurvestum). Bullocks, bull calves and milking cows
are offered some crop residues, viz. sorghum ( kadbi ), wheat straw, gram and ground¬
nut, and some concentrates like groundnut-cake, cotton seed, chickpea and millets.
Males are castrated at about 30 months of age and used for transportation from about 3
years of age.

Physical Characteristics

Body colour is usually spotted black and white. This breed has 3 strains, viz. (i)
complete white animals without any spot on the body ( balankya ), (ii) complete white
animals with partial black face ( wannera ), and (iii) black and white spotted animals
(weghyd or Shevera). Ears are grey-white, or complete white with black pinna. Ears
are drooping like in the Gir. In some animals ear tip is slightly curved. Forehead is
prominent and slightly bulged similar to that of the Gir. Homs emerge from the side of
the poll behind and above the eyes in outward and upward direction, slightly backward
and again curving upward. Horns tips are blunt. Eyes are prominent and bright, with

CATTLE BREEDS

black eyebrows and black eyelashes. Hump is massive and well developed in males but
not so in females. Limbs are clean, straight and powerful. Hooves are black and sym¬
metrically placed. Dewlap and sheath are of medium size. Switch of the tail is black and
white reaching below hock joint. Skin is thick, loosely attached with the body. Udder is
moderately developed. Teats are black, cylindrical with rounded tips, and are squarely
placed. Animals are docile and calm. Albinism, pendulous dewlap, heavy sheath, loose
skin, legginess, narrow and long-drawn mouth with slightly roman arched face are some
undesirable characteristics.

Morphometric and Performance Parameters

Length, height and heart girth range from 105 to 150, 127 to 164 and 152 to 201 cm,

respectively, in males, and 1 10 to 139, 1 16 to 132 and 145 to 165 cm, respectively, in
females. Birth weight averages 23.4±2.48 kg (range 20 to 25 kg). Adult body weight
ranges from 620 to 680 kg in males and from 432 to 485 kg in females. Age at first
calving ranges from 894 to 1 ,540 days with an average of 1 ,39 1±26.74 days. Milk yield
in Deoni cows ranges from 636 to 1,230 kg with an average of 940 kg. Lactation length
ranges from 169 to 475 days with an average of 299.0±7.83 days. Calving interval
averages 447 days. Milk contains 4.3% fat, 9.69% SNF and 13.99 % total solids. Deoni
bullocks are preferred for heavy work. A pair of Deoni bullocks can pull 10 to 11 q of
load using wooden heavy cart with wooden wheels on kutcha roads and 28 to 30 q using

Deoni herd

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

light steel cart with tyre wheels on tar roads. These can plough 594 m2 and harrow 1,61 5
m2 of land per hour. Deoni bullocks reach the maximum potential around 5 to 6 years of
age and maintain it effectively up to 12 years of age.

Breeding Farms

1 . Deoni Cattle Breeding Farm, Gudaripalli, Andhra Pradesh

2. Cattle Breeding Farm: Kampasagar; Zahirabad, Andhra Pradesh

3. Deoni Cattle Breeding Farm, Bidar, Karnataka

4. University of Agricultural Sciences, Dharwad, Karnataka

5. Cattle Breeding Farm, Udgir, Maharashtra

6. Agriculture College-cum-Dairy Farm, Parbhani, Maharashtra

Contact Agencies

1 . Marathwada Agricultural University, Parbhani, Maharashtra

2. State Animal Husbandry Department, Maharashtra

CATTLE BREEDS

GAOLAO

Synonyms: Arvi, Gaulgani
Origin and Distribution

The Gaolao is a dual-purpose breed reared for draught (mainly fast transportation)
and milk production. This breed is found in Wardha district of Maharashtra; and
Balaghat, Chhindwara, Durg, Rajnandgaon (earlier part of Durg) and Seoni districts of
Madhya Pradesh. There is a close similarity between the Ongole and the Gaolao except
that the latter is much lighter with greater agility. In the eighteenth century the Marathas
developed this breed as a fast trotting type suitable for quick army transport in hills.

Location and Topography

The breeding tract lies between 20°25' and 22°45' north latitude, and between 78°20'
and 82°5' east longitude. Most of the areas in the breeding tract is hilly and consists of
a long strip of land extending from northwest to southeast. The average altitude is
about 600 m above msl.

Soil

The whole area consists of a thin
covering of black or brown soil over a
sheet of trap rock. Shallow brown soil
mixed with sand is found in the hilly
regions.

Climate

Climatic environment is sub-tropi¬
cal. Summer becomes oppressive, par¬
ticularly during April to July. Winters
are very mild. Temperature varies from
10° to 39°C.

Management Practices

Herd size is normally 6 to 8 but
some farmers have large herds. Animals
are grazed in the grasslands preserved
by the forest department. Grazing is
usually available from middle of July
to the end of October. Sorghum is the
principal crop of the area. Grains are

Breeding tract

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Gaolao bull

Gaolao cow

CATTLE BREEDS

used for human consumption while the stover is fed to cattle. Cows and young stock are
usually undernourished but bullocks and young male calves ready for sale are well fed.
Cotton seed, linseed or groundnut are given as concentrates. Bullocks are particularly
trained to run fast.

Physical Characteristics

Gaolao animals are white or light grey. Males are generally grey over the neck,
hump and quarters, medium sized, light built, narrow and long. Head is markedly long
and narrow usually tapering towards the muzzle. Forehead is usually flat, though it
appears to recede at the top, giving a slightly convex appearance. Eyes are almond
shaped and placed slightly at angles. Ears are of medium size and carried high. Homs
are short and stumpy, blunt at the points and curve slightly backward. Hump is well
developed, loose and hangs on one side. Dewlap is voluminous but the sheath is mod¬
erately developed. Tail is short, reaching just below hocks.

Morphometric and Performance Parameters

Average length, height and heart girth of a Gaolao animal is around 118, 143 and
180 cm, respectively, in males, and 108, 125 and 173 cm, respectively, in females.
Average body weight is around 430 kg in males and 340 kg in females. Average age at
first calving is around 1,300 days. Milk production is about 600 kg (range 470 to 725

Gaolao calves

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Gaolao herd

kg) in a lactation of about 240 days. Fat is about 5.5%. Average service period is
around 93 days and calving interval around 387 days.

Breeding Farms

1. Central Breeding Institute, Hetikundi, Wardha, Maharashtra

2. Cattle Breeding Farm: Fletikundi; Pohara; Yeotmal, Maharashtra

Contact Agencies

1 . State Animal Husbandry Department, Maharashtra

2. State Animal Husbandry Department, Madhya Pradesh

CATTLE BREEDS

GIR

Synonyms: Bhodali, Desan, Gujarati, Kathiawari, Sorthi, Surati

Origin and Distribution

The Gir is a very good milch breed and is found in the Gir hills and forests of Kathiawar
comprising Junagarh, Bhavnagar and Amreli districts of Gujarat.

The Gir is a world-renowned breed known for its tolerance to stress conditions.
Having faced scarcity for a number of years, it has the capacity for yielding more milk
with less feeding and is resistant to various tropical diseases. The Gir has proved its
utility not only for milk but also for draught. Though very lethargic due to its pendu¬
lous sheath and heavy built, Gir bullocks can drag heavy loads on all kinds of soils, be
it sandy, black or rocky. It is a hardy animal, and can survive and produce in difficult
environment. It has been imported by Brazil, the USA, Venezuela and Mexico and
bred there successfully.

Location and Topography

The native tract covers around
6,000-7,000 km2, and lies between 20°5'
and 22°6' north. The longitudinal posi¬
tion is approximately between 70° and
72° east. Surface of the area is for most
part undulating. Altitude varies from
125 to 600 m above msl. Some of the
low-lying valleys between Gir ranges
are liable to floods. Gir forest is exten¬
sively used for pasture purpose.

Soil

Gir hills being volcanic in origin,
consist of trap and basalt. There is much
variety in the texture, quality and depth
of soil habited by the breed. Soil is gen¬
erally black with scattered tracts of the
lighter kind of soil. Soils of the Gir for¬
ests and adjacent areas are either light
coloured or red. Black soil is supposed
to be very fertile but the lighter coloured
red soils respond well to irrigation.

Breeding tract

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Gir bull

Gir cow

CATTLE BREEDS

Climate

Climate in general is monsoon
tropical. Maximum temperature varies
from 30° to 36°C. Rainfall ranges from
50 to 100 cm. It is usually dry and hot
or dry and pleasant in winter. In
Junagarh area it is hot and humid in
monsoon, humid and moderate in win¬
ter, and hot, humid and windy in sum¬
mer.

Management Practices

Gir cattle are largely bred by pro¬
fessional breeders known as Rabaris,

Bharwads, Maldharis, Ahirs and Char-
ans. They lead a nomadic life moving
their cattle from place to place in search
of grazing. Good pasture is available
from July to December; there after the Gir cai ^

pastures are scanty and migration of herd begins to adjoining districts. Calves are
allowed to suck for 8 to 12 months. Milking cows are usually retained in the village
while dry cows and young stock are sent for grazing. Concentrate mixture is prepared
from wheat bran, crushed pulses, grain husk, oilcakes, cotton seed etc. and is fed to
bullocks and milking cows only. Shelter is provided only to milking cows, bullocks
and young calves. Animals are herded in a field for 3 or 4 nights by the farmers as it
provides manure in the form of dung and urine.

Physical Characteristics

Colour pattern of the Gir is very distinctive. Basic colour of skin is white with
patches of red or sometimes black. Most of the Gir animals seen today are purely red
though some are speckled red. The typical characteristics of the Gir breed are: A broad
convex forehead like a bony shield. It narrows sharply and bends down at an angle on
the nasal bone to end in a broad muzzle and large nostrils. This broad bony forehead
overhangs eyes such that they appear to be partially closed giving the animals a sloppy
appearance. Long and pendulous ears are folded like a leaf with a notch at the tip.
Their inside faces forward and always remains hanging from the base.

Horns are peculiarly curved. Starting at the base of the crown they take a down¬
ward and backward curve and again incline a little upward and forward taking a spiral
inward sweep, finally ending in a fine taper - thus giving a half moon appearance.

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Gir herd

Dewlap is moderately developed. Sheath in males is usually large and pendulous. Tail
is long and whip like. Skin is loose and pliable. Hair is short and glossy. Hooves are of
medium size and black.

Morphometric and Performance Parameters

Length, height and heart girth average 150, 140 and 180 cm, respectively, in males.
The corresponding figures in females are 125.5, 121.2 and 160.4 cm. Birth weight
averages 23.9 kg with a range of 20 to 27 kg. Adult body weight averages 544 kg in
males and 3 1 0 kg in females. Age at first calving ranges from 1 ,200 to 1 ,800 days with
an average of about 1,552 days. Gir cows are very good milkers. Milk yield averages
2,1 10 kg ( range 800 to 3,300 kg) in a lactation of about 308 days (range 250 and 375
days). Calving interval ranges between 400 and 600 days with an average of 516 days.
Fat averages 4.4%.

Breeding Farms

1 . Cattle Breeding Farm, Copardem, Goa

2. Akshar Purushottam Mandir Gaushala, Gondal, Gujarat

3. Bochasanwasi Shree Akshar Purushottam Gaushala Trust, Bochasan, Gujarat

4. Lok Bharti Gaushala, Sanosara, Gujarat

5. Sabarmati Ashram Gaushala, Bidaj, Gujarat

CATTLE BREEDS

6. Gujarat Agricultural University, Junagarh, Gujarat

7. Cattle Breeding Farm: Bhuttwad, Rajkot; Dhoraji, Gujarat

8. BAIF Magazari Farm, Zamp, Gujarat

9. Kasturba Krishi Khetra, Indore, Madhya Pradesh

10. Jawaharlal Nehru Krishi Vishwa Vidyalaya, Jabalpur, Madhya Pradesh

1 1 . Bombay Pinjrapole, Mumbai

12. Mumbai Gou-Rakshak Mandali, Mumbai

13. Pinjrapole Sanstha Sangli, Sangli, Maharashtra

14. Shree Nasik Panchvati Pinjrapole, Nasik, Maharashtra

15. Cattle Breeding Farm: Kopargaon; Jath, Maharashtra

16. Cattle Breeding Farm, Dag, Jhalawar, Rajasthan

Contact Agencies

1 . State Animal Husbandry Department, Gujarat

2. Gujarat Agricultural University, Anand, Gujarat

3. State Animal Husbandry Department, Rajasthan

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

HALLIKAR

Origin and distribution

The Hallikar is a typical Mysore type breed of cattle found mainly in Mysore, Mandya,
Bangalore, Kolar, Tumkur, Hassan and Chitradurga districts of Karnataka state. It is
one of the best draught breeds of southern India. Most of the present-day South Indian
breeds have originated from the Hallikar.

Location and Topography

The breeding tract lies between 12° and 1 4°3 1 ' north latitude, and between 75°5'
and 78° 1 5' east longitude. The native tract of the Hallikar in general is undulating with
an average altitude of 800 m above msl. On the western side, there are Western Ghats
known as Malnad. Towards the east, the area is at a slightly lower level. In the west and
south, there are extensive pasture areas. The east is intensely cultivated. Rice, pulses,
oilseeds, sugarcane and coffee are the major crops.

Soil

Soil in the depression of undulations
is composed of rich red sedimentary de¬
posits and red laterite on the grass-cov¬
ered hills. There are extensive tracts
with gravelly sandy soil, particularly on
the top of rising grounds. Most of the
soils in the east are deficient in nitro¬
gen.

Climate

The temperature of the area is moder¬
ate throughout the year. The mean maxi¬
mum temperature varies from 26° to
35°C and mean minimum temperature
from 15° to 21°C. Humidity ranges
from 68 to 81 %. Average rainfall is
around 80 cm.

Management Practices
Hallikar cattle are bred both by pro¬
fessional breeders and cultivators. A
few families in each village have been
breeding these cattle for generations.

Breeding tract

CATTLE BREEDS

Hallikar bull

Hallikar cow

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Hallikar females being used for ploughing

They maintain their own stud bulls and also provide service to others for a nominal fee.
A couple of decades back cows were not milked and were kept only for production of
bullocks. However, with the change in the economic scenario, cows are generally milked.
Milk yield is 1.5 to 2.5 kg. In the entire tract bullocks are given special attention.
Females are being used for all kinds of farm operations. They can also work in water
logged fields and contribute to the farming system.

They are fed in verandahs by the owners with their own hands. Mostly fmgermillet,
grass, sorghum or pearlmillet are offered as green fodder. Animals are loosely tied in
sheds and fed simultaneously. Such practices do not exist for females. Price of each
bullock ranges from Rs 5,500 to Rs 10,000. This is probably the only consideration for
personal attention in the feeding and management of the males.

Physical Characteristics

Colour is grey to dark grey with deep shadings on the fore- and hind-quarters.
Frequently, there are light grey markings on the face, dewlap and under the body. Hallikar
cattle are medium sized, compact and muscular in appearance.

The forehead is prominent giving a slight bulgy appearance and is farrowed in the
middle. The face is long and tapers towards the muzzle, which is usually grey to black.
Horns emerge near each other from the top of poll and are carried backward, each in a
straight line for nearly half their length and then with a gentle and graceful sweep bend

CATTLE BREEDS

forward and slightly inward toward the
tips which are black and sharp. Horns
almost touch the neck in front of hump
when the animal is feeding with its head
downward. Eyes are small and clear.

Ears are small tapering to a point. Dew¬
lap is thin and moderately developed.

Sheath is very small and is tucked up
with the body. Tail is fine with a black
switch which reaches little below hocks.

Morphometric and Performance Param¬
eters

The length, height and heart girth
range from 190 to 200, 132 to 140 and
170 to 200 cm, respectively, in males.

In females, these average around 170,

118 and 150 cm respectively. Adult
males and females weigh around 340
and 227 kg respectively. Age at first calving ranges from 915 to 1,800 days with an
average of about 1 ,370 days. Lactation milk yield is around 540 kg ranging from 227 to
1,134 kg. Lactation length ranges from 210 to 310 days averaging of about 285 days.
Fat is about 5.7%. Average calving interval is 598.9±27.36 days.

Males are castrated when they are 3 to 4 years of age and are then gradually broken
to yoke. A pair of bullocks can pull continuously a maximum draught of 13 to 16% of
their body weight for 6 hr. The average speed and power under average load and cli¬
matic conditions are 3 km/hr and 0.91 hp/pair.

Breeding Farms

1 . Composite Livestock Farm and Research Station, Hessarghatta, Karnataka

2. Cattle Breeding Farm: Kunikenahalli, Tumkur; Koila, Karnataka

Contact Agencies

1 . State Animal Husbandry Department, Karnataka

2. University of Agricultural Sciences, Dharwar, Karnataka

Hallikar calf

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

HARIANA

Origin and Distribution

The Hariana, a prominent dual-purpose breed of northern India, was primarily reared
for bullock production. Its native breeding tract encompasses large parts of Rohtak,
Hisar, Jind and Gurgaon districts of Haryana.

These animals are also reared in Jodhpur, Alwar, Loharu and Bharatpur districts of
Rajasthan. Meerut, Bulandshahar and Aligarh districts of western Uttar Pradesh also
have sizable population of this breed. This is one of the most widely spread breed in the
Indo-Gangetic plains. According to some reports the purebred Hariana cattle were abun¬
dant in Jhajjar, Beri and Jahajgarh pockets of Rohtak district.

It is difficult to speculate the origin and ancestry of this breed. Hariana cattle take
their name from the region known as Haryana in the erstwhile east Punjab. There were
two strains of cattle - Hisar and Hansi, known after the names of their native towns.
Hariana cattle seems to have originated from these strains. Harianas are somewhat similar
to the Gaolao, Mewati and Ongole breeds. Shahabadi and Gangatiri are closely

related types.

No systematic scientific studies have
been made to evaluate the work effi¬
ciency of our well-known draught ani¬
mals. Therefore, the Indian Council of
Agricultural Research has initiated a
progeny testing scheme for the conser¬
vation of Hariana breed, and improve¬
ment of its draughtability and milk
yield. The scheme is run by the Project
Directorate on Cattle, Meerut, and
Haryana Agricultural University, Hisar,
in collaboration with the Government
Livestock Farm, Hisar, 4 livestock
farms in Uttar Pradesh and one in
Bharatpur (Rajasthan). The 6 co-oper¬
ating herds number about 900 breedable
females, for which, allowing for infer¬
tility and mortality, it is expected to pro¬
duce annually 200 male and 200 female
progeny. Young males (bullocks) from
selected sires are being tested for
known measures of draught capacity.

Breeding tract

CATTLE BREEDS

Location and Topography

The native breeding tract lies between 28°30' and 30° north latitude, and 75°45' and
76°80' east longitude. This area is irregular in shape, with its long axis lying northwest
and southeast. On the northwest it is bound by the Ghaggar valley; and on the west,
southwest and south by the Bagar and Dhaundauti or sandy tracts which are a continu¬
ation of the Rajasthan desert. On the east it is bound by the Yamuna river. The average
altitude of the area is about 200 m above msl.

Soil

Soils in the breeding belt fall into two groups, viz. arid soils and entisoils. They are
light textured, sandy and loamy sand. Soils are deficient in organic carbon, and medium
to high in phosphorus and potassium contents. In Rohtak district, soil is mostly light
coloured alluvial loam. In Hisar, soft loam with reddish tinge is interspersed with sand
and clay. In some parts sand hills are present. In low-lying parts clay is hard. Calcar¬
eous limestone is also found in some parts of the area. All soils give excellent crop
returns with sufficient rains but, unless irrigated, fail entirely in times of drought, though
sandy soils as are prevalent in this area can yield good crops even with less rain. Salin¬
ity is not uncommon where the drainage lines have been obstructed. The average water
level is quite deep, ranging from 18 to 30 m, except in land of canal areas where the
water-table is 9 or 12 m deep.

Climate

The climatic environment is sub-tropical and semi-arid. This tract has a relatively
dry climate. The southwest monsoon brings rains during July and August, contributing
80 to 85 % of the total annual rainfall. The annual rainfall ranges from 30 cm in arid
zone to 50 cm in semi-arid areas. The weather remains almost dry from October to mid-
April. Temperature ranges from 0°C in winter to 46°C in summer. Important rainfed
crops are pearlmillet, sorghum and clusterbean during kharif season, and gram, mus¬
tard and barley during rabi season. In areas under irrigation, major crops grown are
rice, wheat, barley, lucerne, maize and mustard.

Management Practices

Land holding size in the breeding tract has decreased from 8-10 ha during fifties to
1 .52 ha in 1994 along with a reduction in the number of Hariana cattle from 6.8 to 0.43
per household. Cattle are traditionally reared mainly by grazing on common pasture
lands of the village and along the banks of canals and roadsides with little supplemen¬
tary feeding of crop residues like wheat bhusa, stalks of pearlmillet, sorghum, millet,
straws from pulse crops, weeds and grasses. Calves are not weaned. Since Hariana
cows are mainly reared for producing bullocks, greater attention is paid to rearing of
male calves than of female calves. High-yielding cows, bullocks and young males are

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Hariana bull

Hariana cow

CATTLE BREEDS

Hariana calves

given green fodder and concentrate in addition to grazing. Animals are tied in the open
or under the shade of trees. Housing is provided during extreme weather conditions.
Animal houses have mostly kutcha floor and good drainage facilities, and are separate
from human dwellings. This region has a good network of AI and this is the common
method used to breed the animals. However, breeding bulls are also available in vil¬
lages. Males are usually castrated at about 3 years of age. Bullocks are used for plough¬
ing, transportation etc.

Physical Characteristics

Hariana animals are white or light-grey in colour. In bulls, colour in between fore-
and hind-quarters is relatively dark or dark grey. Skin is black. Hariana cattle have
compact and proportionately built body. They are characterized by a long and narrow
face, flat forehead and a well marked bony prominence at the centre of the poll. They
have small horns. Muzzle is usually black. Eyes are large and prominent. Typical
animals have black eyelashes. Head is carried high and gives them a graceful appear¬
ance. Hump is of medium size in cows and large in males. Legs are moderately long
and lean with small, hard and well shaped feet. Sheath is small. Udder is capacious and
extends well forward with a well-developed milk-vein. Teats are well developed,
proportionate and medium sized. Tail is rather short, thin and tapering. There is a
black switch reaching just below hocks. A coat colour other than white or grey as well

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Hariana herd

as white switch of tail is considered a marked deviation from the typical attributes and
a disqualification from the stand point of breed registration.

Morphometric and Performance Parameters

Body length, height and heart girth measure 136, 144 and 160 cm, respectively, in
males, and 137.5, 135 and 155.6 cm, respectively, in females. Birth weight averages
23 .34 kg for male calves (range 20 to 25 kg), 2 1 .73 kg for female calves (range 1 7 to 24
kg) with an overall average of 22.46 kg (range 17 to 25 kg). Adult body weight is
around 499 and 325 kg in males and females respectively. Age at first calving ranges
from 1,067 to 1,809 days with an average of 1,567 days. Average milk yield is around
997 kg with a range of 692 to 1 ,754 kg. Lactation length is about 272 days ranging from
238 to 330 days. Average service period is 232 days (range 126 to 305 days), dry
period 255 days (range 133 to 571 days) and calving interval 483 days (range 415 to
561 days). Fat ranges from 4.3 to 5.3%, with an average of about 4.5%; SNF is around
9.1%.

Breeding Farms

1 . State Livestock Farm: Barpeta, Kamrup; Guwahati; Jagduar, Sibsagar; Khanikar,
Dibrugarh; Manja; Pachmile, Darrang; Lumbajang, Darrang, Assam

2. Cattle Breeding Farm: Dumraon, Shahbad; Sairakela, Singhbhum; Pumea, Bihar

3. Birsa Agricultural University, Ranchi, Bihar

CATTLE BREEDS

Hariana bullocks

4. Shri Gaushala, Bhagalpur, Bihar

5. Government Livestock Farm, Hisar, Haryana

6. Choudhary Charan Singh Haryana Agricultural University, Hisar, Haryana

7. Shri Gaushala Society, Panipat, Haryana

8. Cattle Breeding Farm: Minora, Tikamgarh; Kiratpur, Itarsi; Imlikhera; Pakaria,
Madhya Pradesh

9. Cattle Breeding Farm: Hetikundi; Kopergaon, Maharashtra

10. Bull Rearing Centre, Nagpur, Maharashtra

1 1 . Panjabrao Krishi Vidayapeeth, Warud, Maharashtra

12. Livestock Breeding and Dairy Farm, Bhojanagar, Ganjam, Orissa

13. Cattle Breeding Farm: Bolangir; Boudh; Chiplima; Keonjhar, Orissa

14. Cattle Breeding Farm, Kumher, Bharatpur, Rajasthan

15. Regional Exotic Cattle Breeding Farm, Agartala, Tripura

1 6. State Livestock-cum-Agricultural Farm: Niblet, Barabanki; Hastinapur, Meerut;
Babugarh, Ghaziabad; Neelgaon, Sitapur; Saidpur, Lalitpur, Uttar Pradesh

1 7. Mathura Brindavan Hasanand Gochar Bhumi Trust, Mathura, Uttar Pradesh

1 8. Central Research-cum-Breeding Centre, Haringhatta, Nadia, West Bengal

Contact Agencies

1 . Choudhary Charan Singh Haryana Agricultural University, Hisar, Haryana

2. State Animal Husbandry Department, Haryana

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

KANGAYAM

Synonyms: Kanganad, Kongu

Origin and Distribution

The Kangayam, a draught breed of cattle, is distributed in Kangayam, Dharapuram,
Perundurai, Erode, Bhavani and part of Gobichettipalayam taluks of Erode district,
Palani, Vedasandur and part of Dindikgul taluks of Dindigul district; Karur and
Aravakurichi taluks of Karur district; Udumalpet, part of Avinashi and Tirupur taluks
of Coimbatore district; and Tiruchengodu and part of Sankaridrug taluks of Namakkal
district of Tamil Nadu. Animals true to type are seen in Kangayam, Dharapuram and
Karur taluks. Kangayam cattle have extended into areas other than the original breed¬
ing tract, viz. Tiruchengodu and parts of Sankaridrug taluks of Namakkal district. On
the other hand, replacement of Kangayam cattle by exotic crosses is high in Udumalpet,
Pollachi, Palladam and Tirupur taluks of Coimbatore district, and Erode taluk of Erode
district. These districts were earlier considered as part of main breeding tract. This

breed derives its name from its habitat,
Kangayam taluk of Coimbatore district.

The Kangayam breed was developed
by the efforts of the late Pattogar of
Palayakottai, Sri Rai Bahadur N.
Nallathambi Sarkaria Manradiar. This
breed is most closely related to the
Umblachery breed of cattle. Kangayam
animals are well built and heavier than
Umblachery cattle and are found in drier
climate, whereas Umblachery are found
in the hot humid tract. The estimated
total population in the breeding tract is
479,200. Bulls, bullocks and breedable
females constitute about 0.15, 22.79 and
43.52 % of the population respectively.

Location and Topography
The Kangayam breeding tract lies ap¬
proximately between 10° 12' and 1 1°48'
north latitude, and 77°12' and 78°12
east longitude. Total area is approxi¬
mately 17,000 km2. The area is on a
plateau with undulation. Average alti-

IMWAHOCfAN

Breeding tract

CATTLE BREEDS

tude is about 400 m above msl. Though two major rivers, viz. Bhavani and Amaravathi,
are flowing through this area, water is a major constraint for agricultural production.

Soil

Soil type is predominantly red followed by black soil. Red soil is shallow in depth
with texture ranging from sandy to gravel with a calcareous sub-soil.

Climate

Climate of the tract is generally hot throughout the year except during rainy season.
Winters are mild and summers not excessively warm. Mean maximum temperature
varies from 30° to 38°C and mean minimum temperature from 19° to 26°C. Rainfall is
spread throughout the year averaging around 65 cm/annum. The tract receives maxi¬
mum rainfall during northeast monsoon (September to December). Mean relative hu¬
midity varies from 53 to 77 %.

Cereals are the main cultivated crops in the breeding tract. Cereal crops grown are
sorghum ( Sorghum vulgare ), pearlmillet ( Pennisetum typhoides), paddy ( Oryza sativa)
and fingermillet (Eleusine coracana). Other main cultivated crops are groundnut (Ara-
chis hypogoea ), sugarcane ( Saccharum officinarum ) and cotton ( Gossypium hirsutum )
in addition to certain pulses.

Management Practices

Kangayam cattle are maintained under semi-intensive system of management. They
are traditionally reared on grazing in dry lands kept as pasture land by farmers for cattle
and sheep in the breeding tract. The pasture land is divided into many paddocks by live
fencing. A thorny shrub mullukiuvai (Balsamode ndron berryi) is grown as fence.
Within the grazing area, facility for drinking water is provided by keeping small ce¬
ment water trough.

The predominant grass on the pasture in this tract is kolukkattai grass (Cenchrus
ciliaris and Cenchrus setigerus). This grass with bulbous root stock can maintain its
vitality through the severest drought. Seeds are freely shed and rain at any time causes
their rapid germination, resulting in lush green pasture which grows to 30 cm or more
in height within a few weeks time. A system of rotational and priority grazing is being
adopted. Velvaelam trees ( Acacia leucocephala) are also seen extensively in grazing
areas. They provide shade to animals in rest during grazing.

Calves are allowed to suck as much milk from their dams as they require up to first
6 weeks. Later green grass is provided to the calves and in due course they are allowed
to go for grazing along with their dams. Suckling is gradually reduced as calves grow.
However, weaning is never practised and calves are allowed to suck throughout lacta¬
tion.

Males which are not selected for breeding are castrated usually between 1 8 and 30

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Kangayam bull

Kangayam cow

CATTLE BREEDS

months of age and trained for ploughing. Bullocks at the age of above 4 years are used
for load hauling. Young stock and adults are allowed for grazing from 7.00 am to 5.00
pm. They are brought back from the pasture in the evening and mostly housed in the
open during night near owners’ residence. Average herd size is 3.5.

Besides grazing, animals are also fed with dry fodder like sorghum and pearlmillet
stovers, groundnut haulms and paddy straw. The quantity of dry fodder fed depends on
the availability of green grass in grazing field. During dry seasons when grazing is
scarce, concentrate feed consisting of rice bran, groundnut-cake, soaked cotton seed,
and ground sorghum and pearlmillet are fed only to cows in milk and working animals.
Palmyra leaves (Borassus flabellifer) are also fed with other fodder during drought.
Kangayam young stock and adult are able to utilize poor quality roughages efficiently.

Physical Characteristics

Coat is red at birth, but changes to grey at about 6 months of age. Bulls are grey
with dark colour in hump, fore- and hind-quarters, face and legs. Bullocks are grey.
Cows are grey or white and grey. However, animals with red, black, fawn and broken
colour are also observed. Such animals comprise approximately 1 to 2 % of the total
population. Homs, muzzle, eyelids, tail switch and hooves are black. Skin is also black.

Animals are strong and active with compact body. Legs are short and stout with
strong hooves. Forehead is broad and level with a groove at the centre. Face is straight.

Colour variation among Kangayam calves

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Ears are short, erect and pointed. Eyes are prominent with dark rings around them and
are elliptical. Horns are long and strong, taking backward, outward and upward sweep,
and then curving inward with tips tending to meet each other thus nearly completing a
circle. Hump is large in males and medium in females. Dewlap and navel flap are
small. Penis sheath is small and tucked up with body. Tail is broad at the base and
tapered towards the end with a black switch which extends well below the hock. Udder
is small, mostly tucked up. Teats are small and cylindrical with rounded tips.

Morphometric and Performance Parameters

Averages of body length, height and heart girth are 144.9±0.87, 140.1±0.97 and
176.5±1.65 cm, respectively, in males, and 131.4±0.76, 124.9±0.58 and 156.1±0.85
cm, respectively, in females. Birth weight is around 21 kg. Adult body weight aver¬
ages 640 kg in males and 380 kg in females. Age at first calving is around 1,330 days
(range 1,100 to 1,500 days). Milk yield ranges from 600 to 800 kg with an average of
about 540 kg in a lactation of about 270 days. Average dry period is about 175 days.
Averages of fat and SNF are 3.88±0.07 and 6.96±0.05 % respectively. Calving interval
is around 498 days (range 365 to 670 days).

Bullocks are used for all agricultural operations like ploughing, threshing and cart¬
ing. Bullocks have a good capacity for work. They are capable of carting with load
even on a sunny cloudless summer day with ambient temperature of 30° to 35°C. Usu¬
ally the cart owners start at about 6.00 am in the morning. Double animal two-wheeled
carts of a specified design are made with strong wood and steel frame and pneumatic
tyres similar to those used for heavy vehicles. A pair of bullocks is able to pull 3,644±69
kg (including cart weight), i.e. 3.82 times of their body weight, over a distance of 10 to
21 km without rest. Bullocks usually take 4 to 6 hr to cover 1 8 to 21 km distance with
load. The travelling time for a single trip, i.e. with load to mill and back with empty
cart, varies from 7 to 1 1 hours.

Bullocks reach the maximum potential for this type of work at about 6 years and
maintain it effectively till 1 1 years of age. Kangayam bullocks alone are used for
sugarcane load hauling, though different draught type Mysore breeds, viz. Hallikar and
Alambadi, are available in this area. This quality of Kangayam bullocks facilitates the
cart owners to earn their livelihood solely on transportation of sugarcane in and around
the sugar mill.

Breeding Farms

1 . Cattle Farm, South Arcot, Tamil Nadu

2. Livestock Research Station, Hosur, Tamil Nadu

Contact Agencies

1 . State Animal Husbandry Department, Tamil Nadu

2. Tamil Nadu Veterinary and Animal Sciences University, Chennai

CATTLE BREEDS

KANKREJ

Synonyms: Wadad or Waged, Vagadia, Talabda, Nagar and Bonnai

Origin and Distribution

The Kankrej is one of the heaviest breeds of cattle in India and is found in southeast
Rann of Kutch comprising Mehsana, Kutch, Ahmedabad, Kaira, Sabarkantha and
Banaskantha districts of Gujarat, and Barmer and Jodhpur districts of Rajasthan. It
takes its name from the name of a geographical area in north Gujarat.

Location and Topography

The area covered by this breed is roughly 1 8,000 km2 and lies between 2 1 0 and 24°
north latitude, and between 71° and 74° east longitude. The Kankrej breeding tract is
low-lying and dry. Most parts of the area are sandy, treeless plains with some sand hills
and valleys of black clay between them.

Soil

In the southwestern part of the re¬
gion the soils are sandy loam and heavy
black, whereas on the eastern side they
are mostly sandy with some sandy loam
areas. In some areas, the soil is whit¬
ish-grey clay loam. The sub-soil is yel¬
lowish white. Usually in black soils rice,
wheat, millets, sorghum and sugarcane
are grown. In light soils pulses, oil¬
seeds, sorghum and millets are exten¬
sively grown.

Climate

Climate is tropical to sub-tropical
and dry varying greatly with the distance
from the sea. Average rainfall is 50 to
76 cm and is usually concentrated dur¬
ing July to October. Temperature var¬
ies from 4°C in winter to 49°C in sum¬
mer.

Management Practices

Pastures are seasonal. These are
available from July to October. No

Breeding tract

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Kankrej bull

Kankrej cow

CATTLE BREEDS

fodder crops are grown as such. Only
stovers and straws are fed to cattle. Cot¬
tonseed and oilcakes are widely used
as concentrates. The Rabaris, the
Maldharis, the Bharwads, the Ahirs and
the Charans are the main communities
associated with breeding of the
Kankrej.

Kankrej cattle have a very impor¬
tant role to play in the economy of the
region. Agricultural operations and
road transport in village areas are car¬
ried out mainly by bullocks of this
breed. Animals are not tied. They are
kept in paddocks of thorny bushes near
human dwellings. Animals are taken out
for grazing. They cover long distances
during scarcity periods but during rainy
season when pastures are available,
they graze in nearby areas. Calves are not weaned. Male calves are cared better than
female calves. Castor, rapeseed and sesamum are common among the oilseeds.
Clusterbean ( Cyamopsis psoraloides or C. tetragonoloba) seed is used as a cattle feed.
Cottonseed and oilcake are used as concentrate.

Physical Characteristics

Colour of the animal varies from silver-grey to iron-grey or steel-black. In males,
forequarters, hindquarters and hump are slightly darker than the rest of the body. Fore¬
head is broad and slightly dished in the centre. Face is short and nose slightly upturned.
Ears are large, pendulous and open - characteristic of this breed. Homs are strong, and
curved outward and upward in a lyre-shaped fashion. They are covered with skin to a
longer distance as compared to other breeds. Polls, forequarters and hindquarters are
rusty red in newborn calves, but the colour disappears later on. Hump is well devel¬
oped. Dewlap is thin and pendulous; sheath is pendulous.

The gait of Kankrej is peculiar to the breed; the action is smooth, there is hardly any
movement of the body, the head is held noticeably high, the stride is long and even, and
the hind hoof is placed well ahead of the impression of fore hoof. This gait is called 1 XA
paces ( sawai chat) by the breeders.

Morphometric and Performance Parameters

Body length, height and heart girth average 148, 158 and 194 cm, respectively, in

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Kankrej herd

males, and 1 13.6, 133.6 and 166.2 cm, respectively, in females. Average birth weight
is 23 kg (range 21-26 kg). Adult body weight is 500 - 550 kg in males and 325 - 400 kg
in females.

Average age at first calving is 1,438. 1±10. 95 days (range 1,030 to 1,700 days).
Average milk yield is around 1,746 kg (range 1,097 to 3,194 kg). Lactation length
averages 294 days (range 275 to 350 days) and calving interval is around 490 days
(range 407 to 639 days). Fat is around 4.8% (range 4.66 to 4.99%).

Breeding Farms

1. Cattle Breeding Farm: Bhuj; Mandvi; Thara, Gujarat

2. Gujarat Agricultural University, Anand, Gujarat

3. BAIF, Magazari Farm, Zamp, Gujarat

4. Bidda Pinjrapole and Gaushala, Mandvi, Gujarat

5. Bochasenwari Shri Akshar Purushottam Gaushala Trust, Bochasan, Gujarat

6. Mansa Gaushala Trust, Vijapur, Gujarat

Contact Agencies

1 . State Animal Husbandry Department, Gujarat

2. Gujarat Agricultural University, Sardar Krushinagar, Gujarat

CATTLE BREEDS

KENKATHA

Synonym: Kenwaria
Origin and Distribution

The Kenkatha cattle take their name from the River Ken, for they are bred along the
banks of this small river in the area of Bundelkhand comprising Lalitpur, Hamirpur
and Banda districts of Uttar Pradesh, and Tikamgarh district of Madhya Pradesh. This
breed is similar to the Malvi breed.

Location and Topography

The area where the breed is prevalent lies approximately between the Tropic of
Cancer and 26° north latitude, and between 78°5' and 81°6' east longitude. It is a
rugged area traversed by ranges of the Vindhya Hills, which never rise above 600 m
msl.

Soil

Three types of soils are commonly
found in the area. One type is reddish
brown, and is very coarse-grained. It is
shallow in depth, poor in plant nutrients
and usually found on high-lying areas
where it produces very poor crops. The
second type is brown with greater depth,
and is usually underlaid with a zone of
calcium carbonate accumulation. It is
suitable for cultivation provided manur¬
ing and irrigation facilities are available.

The third type is dark brown to black,
and is the most fertile soil of the local¬
ity.

Climate

The maximum temperature during
summer exceeds 45°C during May and
June. Winters are comparatively mild.

Air movement throughout the year is
rapid. The average rainfall of the area
is 90 to 100 cm. Most of the rainfall is
concentrated during July and August.

Breeding tract

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Kenkatha bull

Kenkatha cow

CATTLE BREEDS

Kenkatha herd

The growing season of the grasses is thus short and they become coarse very quickly.
Millets are grown extensively in this area.

Management Practices

Kenkatha animals are very popular for light draught on the road and for cultiva¬
tion. The animals of this breed are no more preferred as Hariana and Tharparkar graded
animals are becoming popular. They have strong feet and are well adapted to the agro-
climatic conditions of this region as they have to cover long distances in search of
grazing pastures. They thrive on poor feed and fodder resources. Straws and husks
from crops are utilized as cattle feeds. Only a few animals are maintained by each
cultivator. Cows and young stock are maintained on grazing only. Pasture is scanty and
generally consists of coarse grasses of low nutritive value. Bullocks are usually fed
good-quality straws. All the animals of one village are taken by villagers turn by turn.

Physical Characteristics

The Kenkatha cattle are small, sturdy and fairly powerful, varying in colour from
grey on the barrel to dark grey on the rest of the body. Head is short and broad. Fore¬
head is dished. Homs emerge from the outer angles of poll in a markedly forward
direction and terminate in sharp points. Ears are sharply pointed and do not droop.
Body is short, deep and compact. Hump is well-developed. Sheath is somewhat pen-

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

dulous and ends with a black tip. Dewlap is moderately heavy. Tail grows beyond
hocks.

Morphometric and Performance Parameters

Body length, height and heart girth average 119.4, 127.0 and 177.8 cm, respec¬
tively, in males, and 114.3, 132.1 and 167.6 cm, respectively, in females. An adult
male weighs around 350 kg, whereas an adult female weighs around 300 kg.

Contact Agencies

1 . State Animal Husbandry Department, Uttar Pradesh

CATTLE BREEDS

KHERIGARH

Synonyms: Kheri, Kharigarh, Khari

Origin and Distribution

The Kherigarh breed is closely allied to the Malvi breed. This breed is mostly found in
the Lakhimpur- Kheri district of Uttar Pradesh, but some animals are also found in the
adjoining Pilibhit district. This breed has been named after the area. The local people,
however, do not know anything about its name and just call it as desi. Population of
Kherigarh breed has decreased considerably over the last few years because of large-
scale deforestation for crop production. The grazing areas are now restricted to road¬
sides and canal banks only.

Location and Topography

The Kheri district of Uttar Pradesh is located between 27°4' and 28°4' north latitude
and between 80°2' and 81°2' east longitude. Kheri is divided by the rivers which flow
through the area into different tracts of
varying conditions. There are many
small lakes and swamps in the district.

Soil

The southwest region between the
rivers Sukheta and Gomti consists of
fertile loam soils. The area between riv¬
ers Gomti and Kathna is sandy, and is
called Parehar tract; here the best
Kherigarh cattle are bred. The most fer¬
tile part of the district is along the banks
of the River Sarda in the northern re¬
gion. The predominant soil consists of
deep alluvium with occasional nodular
limestone.

Climate

The climatic environment might be
defined as sub-tropical medium altitude
with a relatively good rainfall. It is a
submontane area having high humidity.

During summer the maximum day tem¬
perature may go as high as 45° C.

Breeding tract

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

Kherigarh bull

Kherigarh cow

CATTLE BREEDS

During winter months the minimum
temperature rarely goes below 20°C.

The mean annual temperature is around
25°C. Annual rainfall is 1 15 to 165 cm.

Rainfall is heavier in the northeast part
of the area.

Management Practices

Animals are maintained on grazing
only. No additional fodder or concen¬
trate is provided. Housing is also not
provided. They are tied in the open area.

Males are castrated at about 3-3 Vi years
of age and used for work. Uncastrated
males are used both for breeding and
work purposes. No separate breeding
bulls are maintained. Animals are re¬
sistant to diseases and the expenditure
on treatment is almost nil. Kherigarh calf

Sugarcane is grown extensively. Among other field crops rice, maize, wheat, bar¬
ley, chickpea, lentils and oilseeds such as mustard and rape are largely grown. The
region has an abundance of coarse grasses and most of the cattle are maintained on
grazing. Calves are reared mostly on milk. In some cases cow is not at all milked.

Physical Characteristics

Kherigarh cattle have white coat colour. Some animals have grey colour distrib¬
uted all over body especially on face. The grey colour might have appeared due to
interbreeding among different breeds.

These are small-sized, very active animals, reared mainly for draught purpose.
Face is small. Forehead is flat and broad. Eyes are large, bulging and bright. Horns are
medium (about 1 5 cm) and upstanding, curving outward and upward. These are thick at
the base. Horn formation is typical of the lyre-horned Malvi type. Animals of this breed
are much lighter in general appearance than the Malvis. Ears are small and horizontal.
Muzzle is black. Neck is short. Hump is small in females and medium sized in males.
Dewlap is thin and pendulous, starts from right under the chin and continues up to
brisket. Sheath is small. Legs are light and straight. Hooves are small and black. Tail
is long almost touching the ground and ending in a black switch. Some animals have
white switch also. Udder is small and tightly attached with the body. Teats are small
and cylindrical. Skin is slightly loose and black. Bullocks are very good for draught
purposes. They run very fast.

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Kherigarh herd

Morphometric and Performance Parameters

Average body length, height and heart girth are around 130, 120 and 180 cm, re¬
spectively, in males, and 130, 130 and 150 cm, respectively, in females. Adult body
weight is around 476 kg in males and 3 1 8 kg in females.

Cows are poor milkers. They produce about 1 to 1.5 litres of milk in a day and for
about 1 year. Age at first calving is 1 , 1 00 to 1 ,300 days. Service period is around 150
days and calving interval 420 to 450 days. Bulls mature at an age of about 3 years and
start servicing.

An animal fair is held every Friday at Dhubagha, Lakhimpur-Kheri for the trade of
Kheri type of animals. Only males are brought for sale/purchase. A bullock, 2 to 2'A
years old, fetches about Rs 1 ,000 to 1 ,200. There are no purchasers for the females. A
large number of animals are marketed through this fair during August and September.

Contact Agencies

1 . State Animal Husbandry Department, Uttar Pradesh

CATTLE BREEDS

KHILLARI

Synonyms: Mandeshi, Shikari

Origin and Distribution

The Khillari breed of cattle is known for the quick draught capabilities of its bullocks.
This breed is found in Kolhapur, Solapur, Sangli and Satara districts of Maharashtra,
and Belgaum, Bijapur and Dharwad districts of Karnataka. This breed seems to have
originated from Hallikar or Amritmahal breed of cattle. Unlike most of the Indian breeds,
it does not take its name from a geographical area. Khillar means a herd of cattle and
the herdsman is known as Khillari or Thillari. Four types of Khillaris are prevalent in
different parts of the breeding tract: Atpadi Mahal in southern Maharashtra, Mhaswad
in Solapur and Satara areas, Thillari in Satpura range of hills and Nakali in the
adjoining areas ot these regions.

Location and Topography

This area lies approximately be¬
tween latitude 16° and 22°2' north, and
longitude 70°25' and 76°24' east. The
altitude of the area is around 5 1 0 to 600
m above msl.

Soil

Soil type is light shallow in some
parts and deep rich loam having black
to deep black hue suited for cotton in
other parts. Light soils mixed with grav¬
els are good for growing millets,
groundnut and sorghum.

Climate

The climate is tropical and dry. Day
temperature may go as high as 40°C
during summer but the nights are pleas¬
ant. Minimum temperature during win¬
ter is around 12°C. The area has scanty
rainfall and famines are quite frequent.

Annual rainfall is about 150 cm
spreading mostly over 3 months from
June to August. Average wind velocity

MADHYA PRADESH

ANDHRA

PRADESH

TAMIL NADU

GUJARAT

INDIA

ARABIAN SEA

Breeding tract

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Khillari bull

Khillari cow

CATTLE BREEDS

is 6.8 km/hr. Average humidity is 85%
in the morning and 50% in the evening.

Management Practices

Breeders pay more attention to male
calves as compared to female calves be¬
cause of their draught qualities. Usu¬
ally the male calf is allowed to suck all
the milk it can take until the dam goes
dry. Cow is partially milked if it has a
female calf. Males are castrated at about
5- 5 Vi years of age. Sorghum vulgare
and Pennisetum typhoideum are exten¬
sively grown in the area. Grains are
used for human consumption while
stalks are fed to cattle. Maize and some
varieties of sorghum are also grown as
fodder crops.

Physical Characteristics

Khillaris of the Deccan plateau, the Mhaswad and the Atpadi Mahal types are
greyish-white. Males are dark over the forequarters and hind quarters, with peculiar
grey and white mottled markings on the face. The Tapti Khillari is white with carroty
nose and carroty hooves. The Nakali Khillari is grey with tawny or brick dust colour
over the forequarters. Newborn calves have rusty red polls, but this colour disappears
within a couple of months.

A typical Khillari animal is compact and tight skinned, with clean cut features.
Appearance is like a compact cylinder with stout, strongly set limbs. There is a slight
rise in the level of the back towards the hook bones. Forehead is long and narrow with
a gradual convex bulge backward toward the horns. A distinct groove runs in the centre
of the forehead from the nasal bridge to the centre of the poll. Face is lean and long
with smooth, tightly drawn skin. Nasal bridge is sharp and prominent. Muzzle is
frequently rrupttled in colour. Pink muzzle is not liked by some breeders. Eyes are set in
elongated fashion and are rather small, though prominent and a little bulging. Thick,
wavy skin folds around the eyes give them a dull appearance. Ears are small, pointed
and always held sideways. Horns are long and pointed, and follow the backward curve
of the forehead. They are placed close together at the root, grow backwards for half the
length and then turn upwards in a smooth bow shape peculiar to this breed. The horns
are thick at the base and taper to a fine point.

Dewlap is light with very few folds. Hump in males is firm, fleshy and of moderate

Khillari calf

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Khillari herd

size. Hooves are black with digits closely set. Navel flap and sheath are tight and tucked,
up with the body. Tail just touches the hock joint and has a black switch. Skin is soft
and pliable though tightly drawn over the body. Hair are fine, short and glossy.

Morphometric and Performance Parameters

Body length, height and heart girth range from 125 to 150, 130 to 145 and 185 to
210 cm, respectively, in males, and from 100 to 125, 115 to 140 and 150 to 200 cm,
respectively, in females. Birth weight ranges from 17 to 20 kg in female calves and 18
to 21 kg in male calves. Adult body weight ranges from 450 to 625 kg in males and
from 300 to 350 kg in females.

Average age at first calving is 1,428 days (range 1,050 to 1,930 days). Lactation
milk yield averages 384 kg (range 240 to 515 kg). However, cows producing up to
1,200 kg milk per lactation have been found in Pandharpur area of Maharashtra. Aver¬
age lactation length is 228 days (range 190 to 275 days). Average calving interval is
450 days. Bulls mature at about 2 to 2Vi yjears of age.

Khillari bullocks are highly valued as fast powerful draught cattle, for they can
travel miles without showing any signs of fatigue. Bullock pair is very popular and
fetches very good price. The cost of a pair of bullocks varies from Rs 10,000 to
Rs 30,000. Cattle of this breed have been exported to north-western Sri Lanka to im¬
prove the draught qualities of Sinhala breed. Female stocks produce very little milk.
However, they nurse calves satisfactorily.

CATTLE BREEDS

Khillari bullocks

Breeding Farms

1. Cattle Breeding Farm: Junoni, Solapur; Hingoli; Jath, Maharashtra

2. Cattle Breeding Station, Bankapur, Dharwar, Karnataka

Contact Agencies

1 . State Animal Husbandry Department, Maharashtra

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

KRISHNA VALLEY

Synonym: Kistna Valley
Origin and Distribution

The Krishna Valley breed of cattle is a heavy draught breed and is used exclusively in
the black cotton soil of the watershed of the River Krishna. It is mainly found in
Solapur, Sangli and Satara districts of Maharashtra, and Belgaum, Bijapur and Raichur
districts of Karnataka. It is understood that Gir cattle from Kathiawar, Ongole cattle
from Andhra Pradesh, Kankrej cattle from Gujarat, and local cattle having Mysore-
type blood in them have contributed to the origin of the Krishna Valley breed.

Location and Topography

The home tract of this breed lies approximately between 15°8' and 17°8' north
latitude, and 74° and 78° east longitude. The whole area is on a plateau east of the
Sahyadri range of hills, also known as Western Ghats. The average altitude of the area

ranges from 540 to 750 m above MSL.

Soil

Soil belongs to 3 main classes: red in
the hills, black near the river banks, and
a third type of light grey colour and full
of gravel. Black soil is widely distrib¬
uted in the Krishna Valley.

Climate

The climate is generally mild and dry.
During April and May there is consid¬
erable heat during the day, but nights
are pleasant and cool. Even during sum¬
mer months there are occasional show¬
ers of rain with thunder, causing a con¬
siderable decrease in temperature.
Temperature varies from 15° to 35°C.
Annual rainfall ranges from 125 cm in
the west to approximately 75 cm in the
east.

Breeding tract

Management Practices
Grazing lands in the area are

CATTLE BREEDS

Krishna Valley bull

Krishna Valley cow

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Krishna Valley calves

extremely limited. Cattle are usually allowed to graze only after the grasses have been
harvested for hay making. All animals are stall-fed throughout the year. Sorghum,
maize, beans and grasses are fed as green fodder. Concentrates are fed to milking cows
and bullocks.

Shevri {Sesbania aegyptiaca ) is grown extensively along the banks of rivers; the
plant remains green throughout the summer. Loppings are used for feeding cattle. Cot¬
ton is extensively grown in this area. Sugarcane, tobacco, betelvines and various garden
crops are grown where irrigation facilities exist.

Male calves are allowed to suck 2 teats and female calves 1 teat. At 2!4 years of
age, young males are broken into work, and at 3 to 4 years they are castrated and sold as
bullocks.

Physical Characteristics

Large variation exists in the physical characteristics of this breed because of contri¬
bution from at least 3 distinct breeds, i.e. Gir, Ongole and local Mysore type cattle, to
its development. The common colour is grey-white with a darker shade on fore¬
quarters and hind-quarters in males. Adult females are more whitish in appearance.
Brown and white, black and white, and mottled colours are often seen. Animals are
large, having a massive frame with deep, loosely built short body, and large barrel.
Forehead has a distinct bulge surmounted by small curved horns which usually emerge

CATTLE BREEDS

Krishna Valley bullocks

in an outward direction from the outer angles of the poll and curve slightly upward and
inward. Dewlap is well-developed and pendulous. Sheath is also slightly pendulous.
Ears are small and pointed; breeders prefer them not to droop too much. Tail almost
reaches the ground.

Morphometric and Performance Parameters

Average body length, height and heart girth measure 153.4, 144.8 and 195.8 cm,
respectively, in males, and 132.1, 121.9 and 167.6 cm, respectively, in females. Body
weight of an adult male is 550 kg and that of an adult female 325 kg. Average age at
first calving is 1 ,400 to 1 ,500 days. Bullocks of this breed have been exported to Brazil
and the United States of America.

Contact Agencies

1 . State Animal Husbandry Department, Maharashtra

2. State Animal Husbandry Department, Karnataka

100

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

MALVI

Synonyms: Mahadeopuri, Manthani

Origin and Distribution

The Malvi is primarily a draught breed found in a large area comprising Indore, Dewas,
Ujjain, Shajapur, Mandsaur, Ratlam, and Rajgarh districts of Madhya Pradesh, and
Jhalawar district of Rajasthan. There are 3 strains of Malvi breed: light, medium and
heavy. The Umatwara strain bred in Rajgarh and Narsingarh is a heavy type animal;
the Saugar strain in the Malwa tract of Madhya Pradesh is a lighter type. In the west
adjoining Rajasthan the breed is larger, while in Madhya Pradesh it is smaller. Malvi
bullocks are well known for quick transportation, endurance and ability to carry heavy
loads on rough roads.

Location and Topography

The breeding tract of Malvis lies between 22°4' and 25°9' north latitude, and 74°3'

and 78°5' east latitude. The average al¬
titude is about 480 m above msl.

Soil

Majority of the area has black cotton
soil of heavy loam type. Lighter soils
with greater sand proportions are also
prevalent.

Climate

Climate is dry and moderate. Maxi¬
mum temperature during summer is
around 40°C. Nights are cool and pleas¬
ant.

Management Practices
Plenty of grasses are available for
grazing. Cattle owners take their cattle
to grazing areas during day time and
bring them back in the evening. Wher¬
ever irrigation facilities exist fodder
crops such as sorghum and maize are
grown. Concentrate is given only to
Breeding tract bullocks.

CATTLE BREEDS

101

'• F--r i ,

Malvi bull

Malvi cow

102

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Physical Characteristics
Malvi cattle are grey- darker in males,
with neck, shoulders, hump and quar¬
ters almost black. Cows and bullocks
become nearly pure white with age.
Malvi cattle have short, deep and com¬
pact body. Legs are short but power¬
ful, and hooves are strong and black.
Dewlap is well developed and the
sheath is pendulous. Head is short and
broad with dished forehead. Muzzle is
dark and slightly upturned. Horns are
strong and pointed, and emerge from
the outer angles of poll in an outward
and upward direction. Tail switch is
black.

Morphometric and Performance Param-

Malvi calf eters

Average body length, height and heart girth are about 150, 140 and 200 cm, respec¬
tively, in males, and 140, 130 and 170 cm, respectively, in females. Average birth

Malvi herd

CATTLE BREEDS

103

weight of the calf is around 20 kg, male calves being slightly heavier (21 kg) than
female calves (19 kg). Adult male weighs 499 kg and adult female 340 kg. Average
age at first calving is 1,432 days (range 1,175 to 2,009 days). Average milk yield is
1,074 kg (range 627 to 1,227 kg). Average lactation length is 306 days (range 275 to
320 days). Average calving interval is 419 days (range 41 1 and 530 days). Average
dry period is 180 days (range 125 and 265 days) and service period 178 days.

Breeding Farms

1 . Cattle Breeding Farm, Agar, Shajapur, Madhya Pradesh

2. Cattle Breeding Farm, Dag, Jhalawar, Rajasthan

Contact Agencies

1 . State Animal Husbandry Department, Madhya Pradesh

2. State Animal Husbandry Department, Rajasthan

104

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

MEWATI

Synonyms: Kosi, Mehwati

Origin and Distribution

The Mewati breed of cattle is found in the tract known as Mewat, comprising Alwar
and Bharatpur districts of Rajasthan. These cattle are also found around Mathura and
Kosi in western Uttar Pradesh, and Faridabad and Gurgaon districts of Hariana. The
breed is sometimes spoken of as Kosi, on account of the sale of large number of cattle
of this breed at the Kosi market. Presently this market has become buffalo dominated
and few cows are being brought for sale. Mewati cattle are similar in type to the Hariana
but there are traces of influence of the Gir, Kankrej and Malvi breeds.

Location and Topography

The breeding tract lies between 27° 15' and 27° 55' north latitude, and 76°35' and
77°4' east latitude. The area in the breeding tract is flat, rocky and sandy, and is inter¬
sected by the lower ranges of the Aravali
hills.

Soil

Soils of this region may be divided
into 3 classes: a stiffish clay; loamy soil,
easier to work but requiring heavy ma¬
nuring; very fertile sandy type, found
at the foot of hills and along the banks
of streams, being only suitable for
lighter crops.

Climate

The climate is sub-tropical and dry
throughout the year except during July,
August and September when it is hot
and humid. Maximum temperature
may go as high as 47°C during May and
June. Average annual rainfall of the area
is about 55 to 65 cm.

Management Practices

Very little grazing is available only for
a limited period of about 2 months in

HtMACHAl

PRADESH

PHTUAS

SWDJA

PAKjST AT4

Breeding tract

CATTLE BREEDS

105

Mewati bull

Mewati cow

106

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

August and September, otherwise they
are stall-fed. Cattle depend mostly on
the byproducts of cereals, sorghum,
millets, Cajanus cajan, Phaseolus
radiatus, P. mungo, wheat, barley,
chickpeas, etc. Concentrates such as
oilcakes and crushed grains are given
to bullocks only. Calves are not weaned.
Male calves receive greater attention
than female calves since the breed is
basically reared for draught purposes.
Males are castrated at 3 years of age.

Physical Characteristics
Mewati cattle are usually white with
neck, shoulders and quarters of a darker
shade. Face is long and narrow with
forehead slightly bulging. Horns
emerge from the outer angles of poll
and are inclined to turn backward at the
points. Eyes are prominent and surrounded by a very dark rim. Muzzle is wide and
square. Upper lip is thick and overhanging, giving the upper part of the nose a con¬
tracted appearance. Muzzle is pitch black. Ears are pendulous but not so long. Dewlap,
though hanging, is not very loose. Sheath also is loose but not pendulous. Tail is long,
the tuft nearly reaching the heels. Cows usually have well-developed udders.

Morphometric and Performance Parameters

Average body length, height and heart girth are 155, 152 and 1 88 cm, respectively,
in bulls, and 122, 122 and 152 cm, respectively, in cows. Bull weighs around 385 kg
and mature cow 325 kg.

Mewati cattle are powerful and docile, and are useful for heavy ploughing, carting
and drawing water from deep wells.

Contact Agencies

1 . State Animal Husbandry Department, Rajasthan

"'a •,

■ ' - .A.. . -

•rr'yv-**

*¥■

r. ”

jl.-I , * ^ .

1 v

r-5r.. * A- ujeIZs

' 22. c — «; .

■■■ni

Mewati calf

CATTLE BREEDS

107

NAGORI

Origin and Distribution

The Nagori is a reputed breed. It is primarily reared for draught quality of its bullocks.
Its home tract lies in the Nagaur district of Rajasthan in western India. A sizable popu¬
lation of the breed is also found in the adjoining Jodhpur district and Nokha tehsil of
Bikaner district. The traditional breeding tract covers an area of 17,718 km2.

Population statistics of the Nagori breed is not available as such. However, as the
breed is largely confined to Nagaur district of Rajasthan, overall cattle population of
this district can provide a basis for making logical deductions. Approximately 35% of
the indigenous cattle in this district are true to Nagori breed and there may be around
0.173 million Nagori animals in Nagaur district on the basis of livestock census con¬
ducted in 1992. Although the population appears to be quite impressive, yet the actual
position in the field presents a dismal picture. Since the demand for bullocks is de¬
creasing day by day due to mechanization of agriculture and transport means, its popu¬
lation is decreasing at a considerable rate. The economy of this region depends heavily
on the livestock resources and Nagori
cattle forms a major component of their
farm animal wealth. The decline in
population of these locally adapted ani¬
mal breeds of this desert region may
have serious effects on its eocnomy.

Location and Topography

The latitudinal position of the area

lies approximately between 24°37' and

26°37' in the north; the longitudinal

position is between 63°05' and 75°22'

in the east. Major part of the breeding

tract of Nagori cattle lies in the sandy

plain at an average altitude of 215 m

above msl. Extremely meagre rainfall

and inadequate irrigation facilities are

great constraints in agricultural produc¬
tion.

Soil

Most of the area covered by the
tract is sandy plains, except towards the

Breeding tract

108

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

Nagori bull

Nagori cow

CATTLE BREEDS

109

west nearing the ranges of Aravali hills,
where the soil in the foothills is sandy
loam. The scanty vegetation is semi-
arid, comprising mainly of tall bushes
and some trees.

Climate

Being an arid desert, the climate of
the region remains dry even in the mon¬
soon period. It is also characterized by
extreme variation in temperature. The
maximum temperature ranging between
47° and 49°C is not uncommon during
the peak summer season. The average
annual rainfall is around 32 cm. Winds
blow at great velocity during April to
June and during this period sand storms
occur very frequently.

Management Practices

Farmers generally maintain mixed herds of Nagori and Rathi cattle. Animal feed
resources including water are scarce. Main fodders available in the area are some trees
like khejri, kabli keekar, jal, aakh and sewan grass. Animals are taken out for grazing
and they cover long distances in search of fodder. Bullocks are usually stall-fed. Ani¬
mals are kept in open areas fenced either by bushes or by small mud-walls. These are
located in the close vicinity or even within the human dwellings. During extreme weather
conditions a temporary shelter of thatched roof is provided. Milk letdown is through
suckling, and calves are allowed to suck milk as long as their dams give milk. In case
of female calves, milk feeding is reduced to half within a month. Male calves are
nursed longer and fed better as compared to female calves. Males are castrated at about
6 months of age. Natural mating is generally practised in the field and there is very
little of artificial insemination.

Physical Characteristics

Nagori animals are fine, upstanding, very alert and agile, ’and generally white or
light grey. In some cases head, face and shoulder are slightly greyish. Eyelids are
white or light grey. Muzzle, hooves and horns are black. Skin is tight and black.
Forehead is flat and not so prominent. Face is long and narrow like that of horse.
Eyelids are heavy and overhanging, whereas eyes are small, clear and bright. Ears are

Nagori calf

110

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Nagori herd

medium in size with pinkish inside. Poll is very small and is almost absent in animals
true to the breed. Horns are of medium size emerging from the outer angles of poll.
They extend in an outward direction and are carried upwards with a gentle curve to turn
in at points. Shoulder blade is prominent. Hump is well developed; back straight; legs
long and straight with small, strong and compact hooves. Dewlap is small, fine and
buttoned up with the body. Navel sheath is very small, tucked up with the abdomen like
a button. Tail is high set and is of moderate length (below hock) ending in a black
switch. Cows have small and shallow udder. Bullocks are big and powerful. They are
capable of heavy draught work in deep sands. There is a tendency to legginess and
lightness of bone, though feet are strong. This characteristic has given the breed its
agility and ease of movement. It runs like a horse.

Morphometric and Performance Parameters

Average body length, height and heart girth ranges from 140 to 1 50, 145 to 152 and
191 to 203 cm, respectively, in males, and from 130 to 148, 1 18 to 132 and 157 to 175
cm, respectively, in females. Average birth weight of calf is around 16.9 kg. Adult
body weight is around 363 kg in males and 318 kg in females.

Average age at first calving in Nagori cows is 1,440 days (range 1,287 and 1,505
days). Cows are poor milkers. Average milk yield is 603 kg (range 479 to 905 kg).
Average lactation period is 267 days (range 237 to 299 days). Dry period ranges from

CATTLE BREEDS

111

Nagori bullocks

82 to 155 days. Average service period is 172 (range 121 to 203 days) and calving
interval 461 days (range 423 to 549 days).

The Nagori is mainly a draught breed. Its bullocks are used for transportation and
in agricultural operations such as ploughing, cultivation and drawing water from well.
They are usually broken for light work at about 3 years of age when they weigh around
275 kg. A pair of bullocks cost approximately Rs 15,000.

Breeding Farm

1 . Government Cattle Breeding Farm, Nagaur, Rajasthan
Contact Agencies

1 . State Animal Husbandry Department, Rajasthan

2. Rajasthan Agricultural University, Bikaner, Rajasthan

112

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

NIMARI

Synonyms: Khargaon, Khargoni, Khurgoni

Origin and Distribution

The Nimari breed is found in Nimar tract of Narmada valley in Madhya Pradesh com¬
prising Khandwa, Khargon and Barwani districts. Some animals are also found in
Jalgaon district of Maharashtra. Animals are active. Bullocks are known for their draught
work but cows are poor milkers.

The Nimari breed seems to have originated from crossing of the Gir and the Khillari.
Gir blood has contributed to its coat colour, massive body structure and convexity of
forehead, and Khillari blood to its hardiness, agility and temper.

Khamla found in Satpura ranges of Madhya Pradesh and Khamgoan in Berar are
very similar to Nimari and may be its strains.

Location and Topography

The breeding tract known as Nimar
lies between 21° and 23° north latitude,
and 70° and 76° east longitude. The
whole surface is hilly and undulating.
Throughout the area the geological for¬
mation is the trap rock of enormous
thickness. Near the Narmada river,
sand-stones, limestones and other strata
appear in places. The ridges and hills
have forest cover.

Soil

Soil of the area is formed from disin¬
tegrated trap rock and is partly alluvial.
Soil type is rich black along the banks
of streams, ordinary black in the val¬
leys and shallow brown on high lying
level ground. Soil condition in Nimar
demands use of heavier implements
which require powerfull bullocks.

Climate

Climate is dry and healthy. Days are
very hot during summer but nights are

Breeding tract

CATTLE BREEDS

113

* / ' - ^ *> 55

Nimari bull

Nimari cow

114

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

cool and pleasant. Winters are mild.
Average maximum temperature varies
from 25° to 40°C and average minimum
temperature from 7° to 26° C. Rainfall
is light. Average humidity varies from
25 to 80%.

Management Practices
In the monsoons, there are lot of
grasses and cattle are sent for grazing.
Bullocks are generally stallfed. In ad¬
dition to harvested grasses, they are also
fed concentrates such as cottonseed,
crushed chickpeas and groundnut or
sesamum-cakes. In winter all the cattle
are stall-fed. Green sorghum is exten¬
sively fed. During summer when there
is scarcity of feed and fodder, tree
Nimari calf loppings are given. Special attention is

paid to the rearing of male calves as they form an important source of income to the
farmers. Bullocks are usually castrated and put to light work at about 3 to 3.5 years of
age. Only a few cows are milked while the rest only feed calves.

Physical Characteristics

Nimari cattle are red with large splashes of white on various parts of the body.
Head is moderately long with a somewhat bulging forehead. It is carried alertly and
gives the animal a graceful appearance. Horns usually emerge in a backward direction
from the outer angles of the poll, somewhat in the same manner as in Gir cattle, turning
upward and outward and finally backward at the points. Occasionally, horns are also
like those of Khillaris in size and shape, copper coloured and pointed. Ears are moder¬
ately long and wide, but are not pendulous. Muzzle in many animals is either copper-
or amber-coloured.

Dewlap and sheath are moderately developed, though the sheath has the tendency
to be pendulous. Hump in bulls is well developed and sometimes hangs over. Tail is
long and thin with the black switch reaching to the ground. Hooves are strong and can
stand rough wear on stony ground. Skin is fine and slightly loose. Cows usually have
well-developed udder.

Morphometric and Performance Parameters

Body length, height and heart girth measure around 145, 155 and 175 cm, respec-

CATTLE BREEDS

115

Nimari herd

tively, in males,' and 120, 135 and 160 cm, respectively, in females. Adult body weight
is around 390 kg in males and 3 18 kg in females. Age at first calving is around 1,477
days. Average milk yield is about 360 kg (range 3 10 to 495 kg) in a lactation of about
237 days (range 220 to 260 days). Milk fat is around 4.9%. Average calving interval is
482. 5±1 1.6 days (range 400 to 530 days).

Breeding Farm

1 . Cattle Breeding Farm, Rodhia, Khargon, Madhya Pradesh

2. Cattle Breeding Farm, Bod, Maharashtra

Contact Agencies

1 . State Animal Husbandry Department, Madhya Pradesh

116

ANIMAL GENETIC RESOURCES OE INDIA - CATTLE AND BUFFALO

ONGOLE

Synonym: Nellore
Origin and Distribution

The Ongole belongs to short-homed group of zebus which were brought by Aryans into
India more than 4,000 years ago as original stock from north-west to Indus river basin
and further to Indo-Gangetic plains and towards South along Godavari, Krishna and
Pennar basins.

The Ongole breed takes its name from the geographical area in which it is reared. It
is also called the Nellore breed since the Ongole taluk was earlier included in Nellore
district but now it is included in Guntur district.

The original breed is now confined to the tract between Paleru and Gundlakamma
rivers in Prakasam district though the major breeding tract extends between Pennar and
Godavari rivers. The original breeding tract consists of the erstwhile Ongole, Guntur
and Narasaraopet taluks, and parts of Sattena palli, Vinukonda, Darsi and Kandukur

taluks. The present breeding tract ex¬
tends all along the coast from Nellore
to Vizianagaram, and Chittoor,
Kurnool, Cuddapah, Anantapur,
Nalgonda, Mahabubnagar and
Khammam districts of Andhra Pradesh.

Considerable efforts have been made
for the development of Ongole cattle in
India. The Nellore District Collector
started the Ongole cattle show in 1858
to encourage the breeding of good qual¬
ity Ongoles in the breeding zone. This
event was conducted annually until
1871. The shows were a great encour¬
agement for small and big breeders to
produce better stock. In addition to
these shows, in 1867, the Government
laid down a principal that out of its un¬
cultivated land, each village should re¬
serve for common grazing an area
equivalent to 30% of its land under cul¬
tivation, thereby providing additional
pasture land for the Ongole. A key
village scheme was launched by the

KARNATAKA

I A Mi l NADtl

Breeding tract

CATTLE BREEDS

117

Ongole bull

Ongole cow

118

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

State Government at two places in the main Ongole breeding zone in 1952 and at two
more places in 1956. In the area covered by the scheme all scrub bulls were castrated.
To provide an additional boost to the breeding operation, bulls were stationed at several
centres under various schemes such as Premium scheme, District Board scheme and
free Bull Distribution scheme. The period between 1958 and 1980 saw the emergence
of crossbreeding and even the Ongole breed was not spared. Development of Ongole
breed suffered further with the introduction of Land Ceiling Act and removing of re¬
striction for pasture land. After almost half a century, the Ongole cattle show was
revived in March 1981. A seminar was also held to discuss the reasons for the sad state
ofOngoles in their homeland. An important outcome of this seminar was the formation
and registration of the Indian Ongole Cattle Breeders’ Association.

The agricultural college dairy at Coimbatore maintained Ongole cows till 1 924-25.
Ongole cows were maintained till 1 933-34 at the Hosur Farm which was established in
1919. Ongole cows were also kept at the Chintaladevi farm which was started in 1918.
The objectives of this farm were to improve the milk yield, reduce the intercalving
period and attain early maturity in the Ongole as well as produce large number of pedi¬
gree bulls for distribution in villages of the breeding area. The cows were shifted to the
Lam farm in 1928. The Lam farm which was established in 1926 at Ongole initially for
some time and again during 1964-75. The Mahanandi farm was started with Ongole
cows in 1954. An Ongole cattle breeding farm was established at Ramatheertham in
1980. A composite livestock farm with Ongole cows and Nellore sheep was started at
Chintaladevi in 1986 by the Animal Husbandry Department. An Ongole cattle
germplasm centre was established by the Agricultural University at the Lam farm in
1986. Ongole cattle were also maintained at the Visakhapatnam and Kakinada farms
earlier.

An Ongole Cattle Breeders’ Association was formed on 27 August 1951. There is
also a Central Herd Registration Scheme functioning at Ongole since 1978 with the
objectives of survey of breeding tract, location of milk recording units, registration of
animals, milk recording and formation of breeders’ association. With a view to stem
the decline in population of Ongole breed, the Andhra Pradesh Agricultural University
has launched a Network Project on genetic improvement through associate herd testing
in Ongole breed with the co-operation of State Animal Husbandry Department and the
financial support of the Indian Council of Agricultural Research. An Ongole cattle
germplasm unit was started at the Lam farm with a bull rearing, semen freezing and
data processing centre. The Ongole cattle breeding farms of the Animal Husbandry
Department at Ramatheertham in Prakasam district and Chitaladevi in Nellore district
and University farm at Mahanandi in Kurnool district became associated herds. A
University farm associated herd and a farmers’ field associated herd were added at the
Lam Farm in 1994.

CATTLE BREEDS

119

Ongoles are our mute ambassadors to several countries. South American countries
keep Ongoles pure. The United States of America imported Ongoles but mixed it with
other Indian breeds to develop Brahman. South Americas developed Indu-Brazil by
mixing the Ongole with the Gir and the Kankrej. The last shipment of Nellore bulls
into Jamaica was in 1921. Until mid- 1920s, most of the zebu cattle in the USA were of
Nellore type. Brazil imported Ongoles first in 1895. In 1906, a large contingent of 200
Ongole cows and bulls were brought to Umeraba in Brazil. During 1961-62 Brazilians
purchased 107 Ongole cows and a few bulls. The Nellore or Ongole breed’s hardiness,
disease resistance and its capacity to thrive on scanty and dry fodder have been quite
successfully exploited for improving and upgrading the local stock of European origin.
Ongoles have been imported by the USA for beef: by Brazil for beef and milk; by Sri
Lanka, Fiji and Jamaica for draught; by Australia for heat tolerance and beef; and by
Switzerland for disease resistance. Ongoles have been imported by many other coun¬
tries like Argentina, Paraguay, Mexico, Columbia, Mauritius, Indonesia, the Philip¬
pines and Malaysia.

Location and Topography

The latitudinal position of the area is approximately between 14° and 16°50' north
and the longitudinal between 79° and 80°55' east. The Ongole tract is mostly flat but
the hilly ranges begin as one moves west. There are a number of perennial streams and
rivers running through the tract. The banks of these rivers form excellent grazing areas.

Soil

Soils in general are very fertile and are broadly classified as black cotton, red loamy
and sandy loam. Soils towards the sea coast are alluvial and of very good quality. As
one goes further from the sea this soil is mostly black cotton soil containing plenty of
lime. As one reaches the eastern ranges of hills, soil becomes poorer and is full of
gravel. Soil on the slopes of hills is mostly red.

Climate

The climate of the tract is dry and mild, and is not subject to sudden changes. Sea
breeze makes the area near the coast generally cooler than the inland areas. Average
temperature varies from 1 8° to 40°C throughout the year. Average rainfall for the tract
varies from 75 to 90 cm.

Management Practices

About 30 years ago, an average ryot used to maintain 4 to 8 cows but it is only 1 or
2 at present. Most of the villages had 1 or 2 breeding bulls. Ongoles constitute about
5% of total cattle population of Andhra Pradesh and were approximately 0.5 million in
1993.

120

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

The predominant crops grown in the area are paddy, sorghum, pearlmillet among
cereals, blackgram, greengram among pulses, and cotton, chillies, tobacco among non¬
food and commercial crops. There are some permanent pastures in the dry areas of the
tract. Grasses consist mainly of Isecilema (Anthistiria) wightii and Andropogon
monticolus ( Chrysopogon montanus). Paddy straw and other cultivated crops such as
lentils are fed to animals. Stovers from sorghum (Panicum miliaceum) are also fed.
Cotton-cakes and cottonseeds are extensively used for cattle feeding. Cattle are sent
for grazing in groups with professional grazers known as Lambadis. Male calves are
nursed better than female calves. They are allowed more milk and for longer duration
as compared to female calves.

Physical Characteristics

Ongoles have a glossy white coat called padakateeru by the breeders. Males have
dark grey markings on head, neck and hump, black points on knees and pasterns, black
muzzle, black eye-lashes with a ring of black skin around eyes. Tips of ears and testes
are black. Calves are generally white but sometimes are bom with reddish-brown patches
or reddish-brown colour. As they grow up to 6 months or 1 year, coat colour changes
to white or grey as in adults. The glossy coat colour is due to the nature of the soil
which is high in calcium, phosphorus and other elements. This characteristic coat colour
is not observed in animals outside the breeding tract.

Ongole calves

CATTLE BREEDS

121

Ongoles are large and heavy animals with loosely knit frames, great muscularity
and long limbs. They have a majestic gait. Forehead is broad between eyes and slightly
prominent. Face moderately long and coffin shaped. Bridge of nose is straight, slightly
prominent with a shallow furrow. Muzzle is black with wide nostrils. Lower lip is also
black. Eyes are elliptical with black eyelashes, a ring of black hair around eyelids 0.6 to
1 .3 cm wide. Ears are alert and with moderately short black tip; inside of ear has white
silky hair. Horns are short and stumpy, growing outward and backward from the outer
angles of the poll, thick at the base and firm without cracks. In cows, horns are longer
and thinner than in bulls. Horns in cows generally extend outward, upward and inward.
Neck is short and thick in males, and moderately long in females. Black hair on neck is
present in males. Hump in males is well developed and erect, filled up on both sides
and not concave or leaning to either side. Dewlap is large, fan-shaped, fleshy and
slightly pendulous, and hanging in folds, extending up to navel flap. Dewlap is serrated
with smooth flowing folds instead of narrow constrictions. Folds are covered with soft
fine hair in females. Chest is deep, wide and broad between forelimbs. Forelegs are
strong, clean, medium in length, wide apart, firmly and squarely set under the body.
Hooves and knees are black. In cows, navel flap is common and prominent. Tail head
is sloping, well set, deeply moulded and not coarse. Switch of tail is black and extends
up to the middle of the distance from the point of hock to the ground level. In males,
sheath is not pendulous, but is well tucked with thin black hair on tip. Testes are well-

Ongole herd

122

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

developed, covered with silky hair and with no fleshy patches and not too pendulous.
In females, there is a flap of skin in the position of sheath. Udder is well formed with
well-placed and well-developed teats. Hind portion of udder is well developed. Skin
is smooth and is of medium thickness, mellow and loose. Thin skin is preferred. Hair
are white, silky and fine.

The points of disqualification are: red colour and red patches on body, white switch
of tail, white eyelashes, white preputial hair, partly or fully flesh-coloured muzzle,
light-coloured hooves, dark mottled spots and albino patches on body, black markings
on hind-quarters, long neck in male, long drooping ears, raised poll, hollows in temples,
presence of groove below inner canthes to bridge of nose, biconcave hump, leafy hooves,
floating or uneven ribs on either side, short tail with switch ending above the hock joint,
straight hock, supernumerary teats, rubbing hooves while walking, single testis (cryp-
torchid), winged shoulders, swinging hind limbs at hip joints and loose horns.

Farmers identify the Ongole breed with 3 lengths (legs, shoulders and back), 7
shorts (muzzle, ears, neck, dewlap, flank, sheath and tail) and 9 blacks (muzzle, eyes,
tip of ears, knees, fetlocks, sheath, switch of tail, anal region and tip of testes).

Morphometric and Performance Parameters

Body length, height and heart girth average 171.1±0.95 (range 155 to 190 cm),
152.4±0.61 (range 140 to 165 cm) and 203.8±1.03 cm (range 186 to 230 cm), respec¬
tively, in males, and 133.3±1.0, 133.5±0.7and 166.0±1.2 cm, respectively, in females.
Average birth weight is around 27 kg (range 24 to 30 kg). Adult weight is from 545 to
615 kg in males and from 409 to 454 kg in females.

Age at first calving in Ongole cows ranges from 1,150 to 1,820 days (average 1,473
days). Average milk yield is 688 kg (range 475 to 1,000 kg) in a lactation period of
about 230 days (range 160 to 270 days). Average dry period is 262±13.74 days (range
145 to 400 days), average service period 191 days (range 128 to 310 days), average
calving interval 500 days (range 420 to 720 days) and average fat is 4.2% (range 4. 1 to
4.8%).

Breeding Farms

1 . Cattle Breeding Farm: Banavasi; Kakinada; Kampasagar; Mahanandi;

Visakhapatnam, Andhra Pradesh

2. Livestock Research Station, Lam Farm, Guntur, Andhra Pradesh

3. Ongole Cattle Breeding Farm, Ramathiratham, Andhra Pradesh

Contact Agencies

1 . State Animal Husbandry Department, Andhra Pradesh

2. Andhra Pradesh Agricultural University, Lam, Guntur, Andhra Pradesh

CATTLE BREEDS

123

PONWAR

Synonym: Purnea
Origin and Distribution

The Ponwar is a small hill type breed found in the Puranpur Tehsil of Pilibhit district of
Uttar Pradesh. Animals true to breed are found in Mainakot, Mazara, Bhirkhera,
Faizulaganj and Rajpur Semra villages falling under Madhotanda Veterinary Hospital
area of Puranpur. A few animals are also found in Lakhimpur-Kheri district. A careful
look at the physical characteristics reveals that this breed may be a mixture of hill cattle
and plains cattle. As the breeding tract is near the Nepal border it seems possible that
Nepalese hill cattle (Morang) and local white cattle might have contributed to the ori¬
gin of this breed. The breed is largely reared by Tharu tribe in large herds. Cattle
rearing is their profession. Passi and Yadavs also maintain it to some extent. Local
people call it kabri, means mixture of colours.

Ponwar breed is maintained primarily for draught operations. Bullocks are fast
movers and good for agricultural operations. Bullocks are also a good source of in¬
come to the farmers. A bullock fetches
Rs 500 to Rs 600. Cows are reared only
to produce bullocks and they produce
very little, just sufficient to feed calves.

Location and Topography

The breeding tract lies in the foot¬
hills of Himalayas approximately be¬
tween latitude 28°4' and 28°8' north,
and between longitude 79° and 80°4'
east. The area is only a short distance
from the outer ranges of Himalayas.

The entire area consists of level plains
but no hills. Large parts of the area are
covered by forests.

Soil

The breeding tract consists almost
entirely of alluvial soil.

Climate

The climatic environment of the
area is very humid and submontane. Breeding tract

RAJASTHAN

124

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Ponwar bull

Ponwar cow

CATTLE BREEDS

125

Temperature fluctuations are not much
due to proximity to hills. Annual rain¬
fall varies from 125 to 165 cm. This
area is covered by dense forests and
there is a lot of vegetation around. As
the watertable is high because of canals
and poor drainage, only those crops
which can withstand water-logging con¬
ditions are grown. Paddy is grown
extensively in this region.

Management Practices

Ponwar cattle are raised entirely on
grazing in the forest area and no supple¬
mentary feed is provided. Animals of
the whole village are taken for grazing
by one or two persons in the morning
at about 7 am and brought back at about
7 pm. The animals cover as long as 1 0
km in the forest. Because of the predators, animals have a nervous nature and move in
groups putting their heads in between each other. It is very difficult, rather impossible,
to take out one animal from the group. Animals behave just like semi-wild type and are
very difficult to handle. Females are not milked. Calves are allowed to suck all the
milk. Bullocks are used for transportation and agricultural operations. Other stock is
rarely handled. Animals are kept in the open.

Physical Characteristics

Ponwar cattle are usually brown or black with white patches. There is no particular
pattern but black and white patches are intermixed. Animals possess a small, narrow
face, small ears, and big, bright eyes. Forehead is slightly concave and has a white
marking. Horns are medium in size emerging outward, upward and then curving in¬
ward with pointed tips. Sometimes, horns curve backward in the end. Sheath is small.
Dewlap is light and thin. Hump is small in females and well developed in males. Tail
is long ending in a white switch. Cows have small udders.

Morphometric and Performance Parameters

Body length, height and heart girth measure around 132 to 135, 130 to 135 and 160
to 165 cm, respectively, in males, and 127 to 130, 122 to 125 and 157 to 160 cm,
respectively, in females. An adult male weighs between 3 1 5 and 360 kg and a female

126

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Ponwar herd

between 270 and 295 kg. Heifers calve for the first time at about 1,800 days. Milk
production is very low, cows are rarely milked.

Contact Agencies

1 . State Animal Husbandry Department, Uttar Pradesh

CATTLE BREEDS

127

PUNGANUR

Origin and Distribution

The Punganur breed is short- statured cattle found in Chittoor district of Andhra Pradesh.
Its home tract is Punganur town of Chittoor district. These animals are also found in
Vayalpadu, Madanapalli and Palamaner taluks of Chittoor district. This breed was
developed by Rajahs of Punganur. Hence this breed is known as ‘Punganur’. These are
reared for milk. There are a very few animals left in the breeding tract. Only 21 cows
of Punganur breed could be located during a survey conducted in the breeding tract
covering about 150 villages under an ad hoc scheme entitled ‘Preservation and Im¬
provement of Punganur Breed of Cattle’ by Acharya N.G.Ranga Agricultural Univer¬
sity, Palamaner. This breed is almost on the verge of extinction. These animals were
used for agricultural operations on light soils. Bullocks were used for carts like tongas
and special races.

Location and Topography

The breeding tract lies between
13° 10' and 13°40' north latitude, and
78°40' and 79° 10' east latitude. The na¬
tive tract is at an altitude of about 765
m above msl.

Soil

The soil of the region is very light
and deficient in calcium. Soil type
ranges from red, sandy to loamy. Ma¬
jor source of irrigation is through tanks.
Paddy and sugarcane are the major
crops under wetland cultivation, and
groundnut and fingermillet are the ma¬
jor crops under dryland agriculture. In
addition pearlmillet, sorghum and maize
are grown in some places.

Climate

The area receives 550 to 800 mm
rainfall per year. Rainfall is spread from
June to November and is low. This area
is thus sometimes subject to drought.

Breeding tract

128

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

Punganur bull

Punganur cow

CATTLE BREEDS

129

Temperature ranges from 12°C during
winter to 40°C during summer. Aver¬
age humidity ranges from 60 to 87%.

Management Practices

Average herd size ranges from 2 to

1 5 animals which include cows, buffa¬
loes and bullocks. Average family size
in the breeding tract ranges from 4 to
15. Literacy rate ranges from 0 to 60%.

Average land-holding ranges from 0 to

16 ha. Large number of people live as
agricultural labourers. Women and
children of the family look after ani¬
mals. Animals are housed in a small
shed made with the help of bamboos
and stone pillars. Stacks of paddy straw
and groundnut form the roof of cattle
sheds. Animal houses are located just
by the side of residential accommodation. Animals are housed only during the night.
Animals are grazed in the wastelands and in nearby forests. Soon after the harvest of
paddy, animals are allowed to graze over paddy stubbles. Paddy straw forms the major
component of fodder. In addition, sugarcane tops, groundnut halms, fingermillet straw
and mulberry leaves are fed to cattle. Milking cows are fed 1-1.5 kg concentrate (rice
bran mixed with groundnut-cake) at the time of milking. About 60-70% of farmers
practise AI for breeding their cattle.

Physical Characteristics

Punganur cattle are white, grey or light brown to dark brown. White mixed with red
or black colour animals are also available. Combination of white with brown or black
patches is not uncommon. Skin, muzzle, eyelids and hooves are black. Animals of this
breed are compact with comparatively tighter skin, extensive hanging dewlap, short
legs, long body with well sprung ribs. Forehead is concave and broad. Horns are black,
small and crescent shaped, and often loose curving backward and forward in males and
lateral and forward in females. Homs are stumpy in males and slightly longer in fe¬
males. Horn length ranges from 10 to 15 cm. Forehead is broad and prominent. Ears are
small ( 1 7 to 1 8 cm) and erect. Eyes are bright. Neck is long. Hump is of small size in
females and medium but inclined to be drooping in males. Legs are short, well set with
hard and compact hoofs for helping them for grazing on the slopes of hillocks in the

Punganur calf

130

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

area. Tail is long (about 72 cm) with black switch almost touching the ground. Navel
flap is medium in size. Cows are nervous and difficult with strangers. Their udder is
small and bowl shaped with cylindrical teats having round tips. Bulls are more docile
than females. Males have a prominent forehead with grey colour on neck and hump.
Penis sheath flap is hanging.

Morphometric and Performance Parameters

Body length, height and heart girth average 113, 107 and 151 cm, respectively, in
males, and 108, 97 and 128 cm, respectively, in females. Birth weight averages
12.8±0.29 kg (range 9 to 18 kg) in male calves, and 1 1.4±0.48 kg in female calves
(range 6 to 18 kg) . Overall average birth weight is 12.3±0.24 kg. Adult weight aver¬
ages 244.0±3.5 kg in males (200 to 270 kg) and 178.0±3.0 kg in females (130 to 200
kg). Age at first heat was around 878 days and first calving 1,125 days. Lactation milk
yield is 546.0±30.6 litres (range 194 to 1,099 litres), lactation length 263.4±16.5 days
(range 98 to 445 days), service period 182.8±20.5 days (range 38 to 578 days), dry
period 232.3±19.64 (range 83 to 595 days) and calving interval 452.4±18.7 (range 317
to 832 days). On an average milk of Punganur cows contains 5% fat (range 3.11 to
10.0%) and 9.5±0.06% SNF (range 7.69 to 10.56%). Average number of insemina¬
tions per conception is 1 .35.

Breeding Farms

1 . Livestock Research Station, Acharya N.G. Ranga Agricultural University,
Palamaner, Chittoor, Andhra Pradesh

Contact Agencies

1 . State Animal Husbandry Department, Andhra Pradesh

2. Acharya N.G. Ranga Agricultural University, Palamaner, Chittoor, Andhra
Pradesh

CATTLE BREEDS

131

RATHI

Origin and Distribution

The Rathi is an important milch breed of cattle found in the western part of Rajasthan.
It takes its name from a pastoral tribe called Raths who are Muslims of Rajput extrac¬
tion and lead a nomadic life. The home tract lies in the heart of Thar desert and
includes Bikaner, Ganganagar and Jaisalmer districts of Rajasthan. These animals are
particularly concentrated in the Loonkaransar tehsil of Bikaner district which is also
known as ‘Rathi Tract’. These animals are different from grey- white Hariana type
animals called Rath found in the Alwar region of Rajasthan.

Rathi cattle seem to have originated from the mixture of Sahiwal, Red Sindhi,
Tharparkar and Dhanni breeds, apparently with a preponderance of Sahiwal blood.
Population of Rathi breed has sharply declined in the breeding tract and it may be
around a few thousands only.

Soil

Soils 3re desert soil types having
very little moisture retention capacity.

This area is covered by sandy to loamy
sand soils occurring in the form of sand
dunes, parabolic dunes, etc., and are pri¬
marily infertile.

Climate

This region has harsh climate, re¬
ceives very low, highly erratic and un¬
certain rainfall. Annual rainfall varies
from 10 to 20 cm and temperature from
2° to 50°C. Groundwater is scarce and
saline.

Management Practices

The home tract of Rathi breed is the Breeding tract

Location and Topography

The area lies between 27° and 30° north latitude, and between 72° and 75° east
longitude. This is a typical arid region.

It has large but less fertile soil re¬
sources, very low land productivity, low
population pressure and fragile eco-sys-
tem.

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Rathi bull

Rathi cow

CATTLE BREEDS

133

Thar desert where scarcity of fodder and
water is endemic and becomes acute
during summer. Vegetation is very
poor. Animals graze on the sparse grass
and small bushes. Most of the animals
afe owned and bred by nomads, who
move with their herds in the tract from
one place to another depending on the
availability of water and grazing pas¬
tures. Animals are their mainstay and
they earn their livelihood by selling
milk, ghee as well as milch animals.

Feeding practices followed by most
of the farmers in Bikaner include ad lib.
feeding of roughages (generally
of wheat straw), pala leaves ( Zizyphus
nummularia) and chaffed sewan grass
( Lasiurus sindicus ). Chaffed sorghum
and pearl millet when available are
substituted for grass and leaves. Dry stalks of sorghum and pearlmillet are also fed in
the lean season. Lactating animals are provided concentrate mixture in proportion to
their production. Mineral mixture or vitamins are usually not provided. Animals are
generally not provided with shelter except during extreme weather. Animal houses are
near human dwellings and are made up of kutcha walls with thatched roofs. Natural
service is generally practised as AI services are inadequate. Calves are raised with their
mothers and are not weaned.

Physical Characteristics

Rathi is a medium-sized breed with symmetrical body. The animal is usually brown
with white patches all over the body, but animals having completely brown or black
coats with white patches are often encountered. The lower body parts are generally
lighter in colour as compared to the rest of the body. Face is broad between eyes and
slightly dished. Muzzle and hooves are black. Eyelids are brown or black in colour.
Horns are short to medium in size, curving outward, upward and inward. Ears are of
medium length, while dewlap is voluminous. Navel flap is large. Hump is of large size
in male and sheath pendulous. Tail is long, fine, tapering to a good black switch well
below hock. Udder is well developed with prominent milk-vein. Females are docile
and average milkers.

Rathi calf

134

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Rathi herd

Morphometric and Performance Parameters

Averages of body length, height and heart girth are 132.63, 121.24 and 164.23 cm,
respectively, in females. Average birth weight ranges from 19 to 22 kg in female calves
and from 19 to 23 kg in male calves. Adult body weight is around 295 kg for females.
Age at first calving averages 1,411 days (range 1,104 to 1,581 days). Milk yield is
1,560 kg (range 1,062 to 2,810 kg). Average lactation length is 336 days (range 306 to
431 days), service period 205 days (range 168 to 208 days), dry period 181 days
(range 132 to 234 days) and calving interval 519 days (range 445 to 617 days). Fat is
3.7% (range 3.3 to 4.0%).

Breeding Farms

1 . College of Animal Sciences, Rajasthan Agricultural University, Bikaner, Rajas¬
than

2. Livestock Research Station, Rajasthan Agricultural University, Nohar, Sri
Ganganagar, Rajasthan.

Contact Agencies

1. Rajasthan Agricultural University, Bikaner, Rajasthan

2. State Animal Husbandry Department, Rajasthan

CATTLE BREEDS

135

RED KANDHARI

Synonym: Lakhalbunda
Origin and Distribution

The Red Kandhari breed of cattle in purest form is found in Kandhar, Mukhed, Nanded
and Biloli tehsils of Nanded district; some pockets of other districts like Ahmadpur;
Parli and Hingoli tehsils of Latur district; and Bid and Parbhani districts of Marathwada
region.

Red Kandhari animals in impure form and its crosses with Deoni and non-descripts
are seen sporadically in all the 7 districts of Marathwada, Akola and Amravati districts
of Vidarbha and border districts of Andhra Pradesh, viz. Adilabad and Nizamabad,
which are close to Kinwat and Degloor tehsils of Nanded district of Maharashtra State.

In Kandhar tehsil the Red Kandhari breed of cattle is more common. It is said that
this breed was taken up by the royal dynasty of King Somadevraya as far back as 4th
Century A.D. Raja Somdeorai was the son of Raja Kanhar and ruled over Kandhar.
The name Red Kandhari appears to be
the corrupt name from Raja Kanhar.

This cattle breed having red colour also
naturally acquires the name Red
Kandhari. The breed could have been
named by Raja Somdeorai in memory
of his father as Red Kanhari, now
misnomered as Red Kandhari. Red
Kandhari breed supplies bullock power
to northern part of Marathwada. In mar¬
kets like Parbhani and Puma in Parbhani
district, and Loha Kundalwadi and Nai-
gaon in Nanded district facilities are
available for sale and purchase of these
animals. In the last two named mar¬
kets, bulls and cows of pure breed are
available for breeding purpose.

The Government of Maharashtra
and Marathwada Agricultural Univer¬
sity have made various efforts for the
development and improvement of this
breed. In 1950, the Department of Ani¬
mal Husbandry, Hyderabad, kept 10
pairs of Red Kandhari bulls and cows

ARABIAN

SEA

ANDHRA

PRADESH

KARNATAKA

Breeding tract

136

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Red Kandhari bull

Red Kandhari cow

CATTLE BREEDS

137

at Sitarampet hospital to initiate scientific breeding to study the draught and milk po¬
tential in this breed. In 1951, 8 selected Red Kandhari bulls were also introduced at the
Government Cattle Breeding Farm, Hingoli, district Parbhani by the then State Gov¬
ernment of Hyderabad, of which 2 were kept at the Cattle Breeding Farm, Hingoli and
6 were posted in nearby villages for natural service to generate bullock power for the
farmers of that area. As a result of this breeding, the Red Kandhari breed was estab¬
lished in Hingoli tehsil of Parbhani district-. In the year 1956-57, a key village centre
was established at the Hingoli Cattle Breeding Farm with its 6 sub-centres in interior
villages, of which 3 were establised at Isapur, Pimpri and Nandapur. At these sub¬
centres artificial insemination work with Red Kandhari semen was carried out up to
1962, as a result of which 3,000 Red Kandhari calves were born which are on records at
the Hingoli Cattle Breeding Farm. However, the Red Kadhari herd at the Hingoli farm
was discontinued and presently the farmers of this region are responsible for propagat¬
ing the breed.

After the formation of the Maharashtra state in 1962 till 1980, this breed did not
receive any attention. The State Government undertook crossbreeding of local cattle
with Jersey and Holstein extensively with liquid semen from the year 1968 and with
frozen semen from 1984. This work checked breeding with pure breed semen and
indirectly it was a threat for pure breeds specially for those pure breeds which had no
government farms for pure breeding like Red Kandhari. In the year 1984-85, Zila
Parishad, Nanded undertook intensive breeding programme of Red Kandhari breed by
keeping 10 pure Red Kandhari breeds in breeding tract of the district.

In 1 974, the Government of Maharashtra started an animal unit with 1 8 Red Kandhari
cows at the College of Veterinary and Animal Sciences, MAU, Parbhani. In 1982, the
State Government of Maharashtra sanctioned a scheme on Red Kandhari cattle for re¬
search and education, and consequently 82 cows and 2 bulls were added for selective
breeding. As a result of selective breeding and rigorous culling, a purebred herd of Red
Kandhari breed with known and fixed characters is established at this farm.

Location and Topography

The breeding tract lies between 18°25' and 19°37' north latitude, and 76°50' and
78°30' east latitude.

Soil

The soil is typically black cotton type and possesses material of calcareous rudi¬
mentary rocks. Fertility index is low with respect to nitrogen in Parbhani and phospho¬
rus in all districts of this region.

Climate

Climate is dry and semi-arid type. Southwest monsoon accounts for 70-95% of

138

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

total rainfall. Annual rainfall varies
from 30 to 1 1 0 cm. Maximum tempera¬
ture reaches 40°C and minimum 8° to
10° C.

Management Practices
Herd size is small. Generally, animals
are maintained on grazing alone. Small
quantities of concentrate is offered only
to bullocks, bull calves and milking fe¬
males. Calves are not weaned. Male
calves are nursed better and longer as
compared to female calves. Most of the
animals are given individual care.

Physical Characteristics
Red Kandhari is a medium-sized,
strong and robust animal. The body is
Red Kandhari calf compact, squarely built, but not mass¬

ive, with well-proportionate limbs. The colour is uniform deep dark-red, but variations
from a dull red to almost dark brown are found. Bulls, as a rule, are a shade darker
than cows. Fore-head is broad between eyes and is slightly bulging. Ears are long,
drooping sideways and have rounded tips. Eyes are shining with a black colour around
the eye. Muzzle is black. Horns are evenly curved and medium sized. Horns are thick
at the base and taper to a blunt point. Dewlap is medium sized with a few folds. Hump
is tightly formed and large in males. Hoofs are black and digits closely set. Black hair
around the coronet encircles forming a ring. Navel flap is very small in cows. Sheath
is well tucked-up to the body. Tail is well set on the body. It is fairly broad, tapering
and is moderately long with a good black switch which extends well below hocks, and
reaches coronet. Skin is tightly drawn over the body but is soft and pliable (not loose)
with small short glossy hair. Udder is small and tucked up. Teats are small but squarely
placed.

Morphometric and Performance Parameters

Average body length, height and heart girth measure 133 (range 120 to 148 bm),
128 (range 120 to 137 cm ) and 173 cm (range 155 to 190 cm), respectively, in males;
and 124 (range 106 to 140 cm), 1 18 (range 103 to 132 cm) and 146 cm (range 129 to
169 cm), respectively, in females. Average birth weight is 20.1±0.74 kg. Average
lactation yield is 597.6±1 8.32 kg in a lactation period of 259.8±4.26 days. Average fat
content in milk is4.57±0.03% and SNF content 8.62±0.01%. Milk of Red Kandhari has

CATTLE BREEDS

139

Red Kandhari herd

yellowish tinge which is transferable to its products. Average calving interval is
444.2±9.62 days.

Red Kandhari bullocks are used for heavy work. A pair of bullocks, yoked for
different operations produce following qualities of work: (i) harrowing 1,586.7 m2/hr;
(ii) single line sowing ( mogada ) 1,651.6 m2/hr; and (iii) ploughing 562.6 m2/hr. Bul¬
locks are capable of carting 3 and 20 q of load at the speed of 4.7 and 3.6 km/hr respec¬
tively.

Breeding Farm

1 . College of Veterinary and Animal Sciences, Marathwada Agricultural Univer¬
sity, Parbhani, Maharashtra.

Contact Agencies

1 . Marathwada Agricultural University, Parbhani, Maharashtra

2. State Animal Husbandry Department, Maharashtra

140

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

RED SINDHI

Synonyms: Malir (Baluchistan), Red Karachi and Sindhi
Origin and Distribution

The Red Sindhi breed is mostly found in Karachi and Hyderabad districts of Pakistan.
Some organized herds of this breed are also found in India in the states of Orissa, Tamil
Nadu, Bihar, Kerala and Assam.

Red Sindhi is considered to have originated from Las Bela cattle found in the state
of Las Bela, Baluchisthan. The original herd was established at Malir outside Karachi.
Red Sindhi cattle are somewhat similiar to Sahiwal and may also be related to Afghan
and Gir cattle.

Red Sindhi cattle have been exported to Afghanistan, Nepal, Myanmar, Thailand,
Cambodia, Vietnam, Malaysia, Brunei, Sarawak, Sri Lanka, Indonesia, the Philippines,
Taiwan, Korea, Iran, Iraq and Saudia Arabia in Asia; Tunis, Kenya, Tanzania, Seychelles
and Mauritius in Africa; the United States of America, Brazil and Cuba in the Ameri¬
cas; and Australia.

Red Sindhi is one of the important dairy cattle breeds in Indian sub-continent.
Realizing its potential, the Government of India established 1 Central Cattle Breeding
Farm at Chiplima, Orissa on 15.01.1 968. The original mandate of the farm was to carry
out progeny testing for Red Sindhi. In each set, 2 bulls were to be selected from 8 bulls
which were to be used extensively through frozen semen technology. In addition, the
farm was also to produce 80 high graded bulls to be distributed to different states. In
1989-90, the mandate was revised as:

(a) 50 elite and best Red Sindhi cows and followers would be kept as nucleus herd
to conserve the indigenous germplasm of Red Sindhi breed. Total herd strength should
not exceed 120; and

(b) 50 Red Sindhi cows next in superiority to the (a) above should be kept for
production of crossbred bulls and heifers. The total herd strength should not exceed
120.

Location and Topography

Red Sindhi is native to hilly region in the north and in the west (900 to 1, 200 m
above msl). In the south it is found at low altitude.

Climate

Diurnal temperature variation in most parts of the area is not large. Average tem¬
perature during most part of the year ranges from 17° to 32°C. Major crops grown in
the area are paddy, sorghum, pulses, clover, wheat, linseed and cotton. Straws and
stovers from these are fed to cattle.

CATTLE BREEDS

141

Red Sindhi cow

142

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

Physical Characteristics
This breed has distinctly red colour.
Red shades vary from dark red to dim
yellow. Though patches of white are
seen on dewlap and sometimes on
forehead, no large white patches are
present on the body. In bulls, colour is
dark on the shoulders and thighs. Hair
is soft and short, and skin is loose.

Head is well proportioned with an
occasional bulge on the forehead.
Horns are thick at the base and emerge
laterally and curve upward. Ears are
moderately sized and drooping. Hump
s well developed in males. Dewlap and
sheath are pendulous. Udder is capa¬
cious and pendulous.

Red Sindhi calf

Morphometric and Performance Parameters

Averages of body length, height and heart girth are around 140, 130 and 180 cm,
respectively, in males, and 140, 120 and 140 cm, respectively, in females. Birth weight
in male calves is 22.5 kg (range 20 to 28 kg) and in female calves 2 1 .4 kg (range 1 9 to
24 kg) with an overall average of 22 kg. Adult body weight is around 450 kg in males
and 320 kg in females. The Red Sindhi cow calves for the first time at an average age of
about 1 ,324 days (range 972 to 1 ,560 days). Milk production is around 1 ,840 kg (range
1,100 to 2,600 kg) and lactation length 296 days (range 260 to 330 days). Fat is around
4.5% (range 4.0 to 5.2%). Service period is on an average 148 days (range 90 to 175
days). Calving interval is on an average 443 days (range 380 to 550 days).

Breeding Farms

1 . Cattle Breeding Farms:

- Barpeta; Jagdaur; Silchar, Assam

- Gauriakarma, Hazaribagh, Bihar

- Dhat, Goa

- Beli Charana, Jammu & Kashmir

- Koila, Karnataka

- Kodapanakunnu, Kerala

- Bolangir, Orissa

CATTLE BREEDS

143

Red Sindhi herd

- Pudukkottai; Chetinad; Hosur; Orthanad; Tirunelveli, Tamil Nadu

- Kalsi, Uttar Pradesh

2. Punjabrao Krishi Vidayapeeth, Warud, Maharashtra

3. Central Cattle Breeding Farm, Chiplima, Sambalpur, Orissa

Contact Agencies

1 . State Animal Husbandry Department, Tamil Nadu

2. State Animal Husbandry Department, Bihar

3. State Animal Husbandry Department, Orissa

4. Department of Animal Husbandry and Dairying, Government of India, New
Delhi

144

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

SAHIWAL

Synonyms: Lambi Bar, Lola, Montgomery, Multani, Teli

Origin and Distribution

The Sahiwal is one of the best dairy breeds of zebu cattle. Though its original breeding
tract lies in Montgomery (now Sahiwal) district of Pakistan, yet some herds are also
found in India along the Indo-Pak border in Ferozepur and Amritsar districts of Punjab,
and Sri Ganganagar district of Rajasthan. Sahiwal cattle may be related to cattle of
Afghanistan and may contain some Gir blood also. It is closely related to Red Sindhi,
Afghan and Gir breeds.

A few herds (around 70) of pure Sahiwal cattle are now available around Fazilka
and Abohar towns in Ferozepur district of Punjab (India). About 200 years ago, the
Maharaja of Bikaner invited Sahiwal breeders from Montgomery area. These breeders
migrated and settled in various parts of Bikaner state because of pressure on pasture
lands in the breeding tract. During the partition many breeders went back to Pakistan

but some remained in India. Rearing
of these cattle was the sole occupation
and livelihood of these breeders. With
the advent of Rajasthan canal, more land
came under crops and free pasture lands
were reduced. These breeders again
looked for alternatives and migrated
from their homes to the outskirts of vari¬
ous towns in Sri Ganganagar and Fero¬
zepur districts. The closeness to urban
population provided better market for
milk and milk products, and they settled
there temporarily.

Sahiwal breed, because of its desir¬
able traits, is being utilised widely for
improvement of local stock or for ini¬
tial crossbreeding of the indigenous
stock before undertaking upgrading
with European breeds in many warm hu¬
mid countries of the world. Efforts were
made to improve its production poten¬
tial by establishing some herds. One
such farm was established at Chak
Ganjaria, Uttar Pradesh in 1950 and

HIMACHAL

PRADESH

PAKISTAN

INDIA

awn BftiT

Breeding tract

CATTLE BREEDS

145

Sahiwal bull

Sahiwal cow

146

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

another at Anjora, Durg, Madhya Pradesh in 1956. Sahiwal herd was also established
at the National Dairy Research Institute, Karnal (earlier known as cattle-cum-dairy
farm) in 1951 and at the Government Livestock Farm, Hisar, during the III Five-Year
Plan. These farms have the mandate of developing herds of purebred Sahiwal, produc¬
tion of superior sires and distribution of these sires/semen for cattle breeding projects.

It is known to have been introduced into 17 other countries, besides Pakistan and
India. These are: Mauritius, Kenya, Tanzania, Sierra Leone, Malaysia, the Philippines,
Vietnam, Thailand, Myanmar, Bangladesh, Sri Lanka, Nepal, Brazil, Jamaica, Trinidad,
Australia and New Zealand. In Jamaica, Sahiwal animals were crossed with Jersey
and provided part of the foundation stock for the breed known as the Jamaica Hope. In
Kenya they have been used in upgrading small East African zebu cattle for milk pur¬
pose. Sahiwal semen is now being produced on a large scale at one of the farms estab¬
lished in Queensland (Australia) for export to New Zealand. In the latter country, after
contract matings by use of the Sahiwal semen on Jersey and Friesian cows, crossbred
heifers are produced for commercial export to South-East Asian countries, namely Thai¬
land, the Philippines, Malaysia and Indonesia.

Location and Topography

The breeding tract in India lies between 29°10' and 30°55' north latitude, and 73°6'
and 74°4' east longitude. The area is an undulating plain. The main crops grown in the
area are wheat, barley, cotton, chickpea, lentil and rapeseed. Grazing areas are limited
as pasture lands have been converted into agricultural fields. These are now available
only along the river banks and road sides.

Soil

Sandy loam and loam soils are predominant in this area. A very large proportion of
agricultural land is now under irrigation either through canals or through tubewells.

Climate

Weather in this area is extremely hot during summer (April to August) and ex¬
tremely cold during winter (December to February) with temperature varying between
0° and 48°C. The climatic environment is sub-tropical and arid. Annual rainfall is
around 25 to 30 cm. Heavy dust storms occur frequently during summer.

Management Practices

The Sahiwal breeders around Fazilka and Abohar towns are landless Muslim fami¬
lies solely dependent on cattle rearing. They prefer to be called as ‘Joiay ‘ or ‘ Gujar’.
Average family size is 6.9 and literacy percentage is only 4.8. Male and female
members of the families are almost equally involved (3.36 vs 2.51) in cattle rearing.
Animals are not provided with any type of house. They are kept loose in an open area.

CATTLE BREEDS 147

Only calves are provided with bush en¬
closures. It is very difficult to differen¬
tiate between breeders, huts and cattle
enclosure. Practically they share their
own enclosure with cattle. Animals are
kept under very poor sanitary condi¬
tions; still they are resistant to most of
the tropical diseases. Herd size is 30
to 70 animals with 15 to 25 milking
cows.

Animals are taken for grazing in the
morning. Milking cows return early
while the rest return at sunset. They
are also fed green and dry fodder. Milk¬
ing cows are provided supplementary
feeding in the form of cotton seed, bar¬
ley and cakes. Feed is given in soaked
form at the time of milking. Animals
are fed in groups. The source of drink¬
ing water is hand pump. Special attention is paid to calves. They are reared on whole
milk up to 1 month of age after which some green fodder is also fed. Calves are al¬
lowed to suck 1-2 teats up to 6 months of age. The number of male and female calves
are almost equal but the sex ratio becomes imbalanced after 1-1.5 years of age. Males
are selected for breeding at very young age on the basis of dam’s yield and body confor¬
mation. The selected males are fed and cared properly while the rest are disposed off.

Heifers are reared with utmost care and fed properly. Breeders are more careful
after the heifers attain puberty. Natural service is practised for mating.

Physical Characteristics

Coat colour is usually reddish dun but pale red or brown occasionally mixed with
white spots is also not uncommon. The Sahiwal is a heavy breed with symmetrical
body and loose skin. Animals are long, deep, fleshy and comparatively lethargic. Fore¬
head is medium sized in females but broad and massive in males. Horns are short and
stumpy. Ears are medium sized with black hair on the fringes. Dewlap is large and
heavy. Hump in males is massive and frequently falls on one side. Navel flap is loose
and hanging. Sheath in males is also pendulous. Tail is long and fine with a black
switch reaching almost to the ground. Udder is generally large, bowl shaped, pliable,
firmly suspended from the body. Pendulous udder is also found in high producing
females. Teats are large and cylindrical in shape.

Sahiwal calf

148

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Sahiwal herd

Morphometric and Performance Parameters

Average body length, height and heart girth are 150, 170 and 190 cm, respectively,
in males, and 131, 124 and 164, respectively, in females. Birth weight is 20 to 25 kg in
male calves and 1 8 to 23 kg in female calves. Average birth weight is around 22 kg.
Adult body weight is around 540 kg in males and 327 kg (range 301 to 360 kg) in
females. Average age at first calving is 1,183 days (range 940 to 1,520 days). Average
milk yield is 2,326 kg-(range 1 ,600 to 2,750 kg). Average lactation length is 3 1 8 days
(range 285 to 375 days). Fat is 4.8 to 5.1% (average 4.93%). Service period averages
176 days (range 140 to 200 days). Calving interval averages 451 days (range 390 to
550 days).

Breeding Farms

1 . Cattle Breeding Farm: Jagduar; Pachmile; Silchar, Assam

2. Sabarmati Ashram Gaushala, Bidaj, Gujarat

3. Government Livestock Farm, Hisar, Haryana

4. National Dairy Research Institute, Karnal, Haryana

5. Satguru Hari Singh Animal Breeding Farm, Sri Jiwan Nagar, Sirsa, Haryana

6. Shri Gaushala Society (Regd), Panipat, Haryana

7. Government Cattle Breeding Farm, Beli Charana, Jammu & Kashmir

8. Cattle Breeding Farm: Anjora, Durg; Imlikhera, Madhya Pradesh

CATTLE BREEDS

149

Housing and feeding practices

9. Government Cattle Breeding Farm, Bod, Wadsa, Maharashtra

1 0. Government Cattle Breeding Farm, Nabha, Punjab

1 1 . Pinjrapole Gaushala, Amritsar, Punjab

12. Tamil Nadu Co-operative Milk Producers’ Federation Ltd, Udhagamandalam,
Tamil Nadu

13. State Livestock-cum- Agricultural Farm, Chakganzaria, Uttar Pradesh

14. Military Farm, Meerut, Uttar Pradesh

Contact Agencies

1 . State Animal Husbandry Department, Punjab

2. State Animal Husbandry Department, Rajasthan

150

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

SIRI

Synonym: Trahbum

Some of the related types of Siri are:

(a) Kachha Siri : This is a Nepal x Siri cross, and is very similar to the Siri, but is
distinguished from it by the colour pattern and position of hump and horn.

(b) Tarai : This type is found in Nepal and is sometimes referred to as Siri.

Origin and Distribution

The Siri is a small-sized zebu cattle of hill region. It is found in upper reaches of
Darjeeling district in West Bengal and Sikkim States in India, and Bhutan and Nepal.
Bhutan is said to be the real home of this breed. This is the only Indian breed with a
cervico-thoracic type of hump. Similar cattle are found in the Sikong Province of China,

northeast of Bhutan.

Over the last few years the population
of this breed has been declining due to
extensive crossbreeding with Jersey
germplasm. Cattle in Sikkim are either
Siri or crossbreds. Despite an increase
in the overall cattle population in
Sikkim (6.28%) between 1982 and
1988, the population of indigenous
r cattle was almost constant. Siri animals
are now confined only to the remote and
inaccessible areas of Sikkim. Very few
Siri breeding bulls are available even
in the remote villages. This would af¬
fect the development of this breed. The
interior areas are now becoming acces¬
sible with the ongoing development pro¬
grammes and Jersey semen is reaching
these areas too. This would further af¬
fect the status of the Siri population.
The crossbred cows have higher milk
production and lower age at first calv¬
ing as compared to Siri cattle.

BHUTAN

BAY OF BENGAL

Breeding tract

CATTLE BREEDS

151

Siri bull

Siri cow

152

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Location and Topography

The breeding tract lies between 27° and 28° T north latitude, and 88° and 90° east
longitude. The breeding tract is between 1,200 and 3,000 m above msl. Hills are steep
and separated by deep narrow valleys. Sikkim is situated in the eastern Himalayas
between 27°5' and 28° 10' north latitude, and between 88°4' and 88°58' east longitude.
It comprises an area of about 7,300 km2. The state is bound in the north and northeast
by the Tibetan region of China, in the southeast by Bhutan, in the south by the Darjeeling
district of West Bengal and in the west by Nepal. The mountainous terrain of Sikkim
possesses a series of interlacing ridges rising range above range from south toward the
snow-clad northern hills. Terrace agriculture is being practised. Rice, maize, ginger,
soyabean and millets are the major crops. Agriculture is rainfed and suffers from water
scarcity. Livestock provide organic manure as the acidic nature of soils limits the use
of inorganic fertilizers.

Soil

The soil is acidic with pH ranging from 5.0 to 6.0. The lime requirement is quite
high. Soil has low availability of NPK.

Climate

Climatic variation in the breeding tract is considerable depending on the altitude.
The important feature of its climate is dampness. Rainfall is heavy and well distributed
during May to September, moderate during April and October and low during Novem¬
ber to February. Rainfall varies from 3 to 55 cm during different months. While the
monsoon contributes to the major part of the rains, local evaporation, condensation and
precipitation greatly account for the substantial rainfall during pre-monsoon and post¬
monsoon periods. Winters are severe and chilly. Maximum temperature varies from
8° to 24°C and minimum from 0° to 14°C. Average relative humidity is about 80%.

Management Practices

Animals are mostly taken for grazing in forests or in fields. In East Sikkim, espe¬
cially Aritar block (2, 1 00 m above msl) large herds (herd size 1 0-30) of Siri animals are
seen grazing in the forest area as compared to those in West Sikkim where the average
herd size is around 2-3.

Animals of the entire village are taken to forest by one person in the morning at
about 7 am. They graze on steep slopes in thick forests. Cows in milk return by the
milking time, i.e. around 4 pm, whereas the remaining animals return late in the evening.
Animals are also fed leaves of forest trees like khanyu {Ficus cunia Ham.), gogun
{Saurauvia nepalensis DC), kairalo {Bauhima variegata Linn.), chuletro {Brassaiopsis
mitis ), and residues of crops like ginger leaves and paddy straw. In very few cases
cultivated fodder like Napier and Gotamala grasses and maize are fed to animals.

CATTLE BREEDS

153

Milking cows are also offered
home-made concentrates. Concentrate
mixture is prepared by boiling together
maize and rice grains, raddish with
leaves, kuish fruit and mustard-cake.

This mixture is then offered to the ani¬
mals as such. Milking is done twice a
day. Only the front teats are milked
while the rear teats are left for the calf
to suck. Animals are housed on the
slope of hills in open houses which are
small in size and have galvonised iron
sheet roofs. Sheds are so small that an
animal can hardly stand in it. These
sheds are usually without drainage fa¬
cilities and have kutcha floor with very
poor sanitation. There is scarcity of
drinking water and no provision is made
in sheds. Bullocks are the only source
of draught power for agriculture in the hilly terrains of Sikkim. They are castrated at
about 4 years of age.

Physical Characteristics

Animals are either black with white patches or brown with white patches. In some
cases they are totally black or brown. Skin is grey, and muzzle and eyelids black.
Black and white pattern is similar to that of Holstein-Friesian. Tail switch is black or
white and hooves are black. Forehead is convex, wedge shaped with white patches.
Horns are of medium size and curved outward, forward, slightly upward and inward
with prominent hairy poll. Ears are of medium size and horizontal. Abdomen and
inner part of legs are generally light in colour. Hump is cervico-thoracic and covered
with a tuft of long coarse hair. It is of medium size in males and small size in females.
Dewlap is small to medium. Navel flap is almost absent. Udder is of small size with
firm attachments. Teats are centrally placed and cylindrical in shape with rounded tips.
Males have small sheath.

Morphometric and Performance Parameters

Body length, height and heart girth measure 121.8±16.82, 119.8±14.04 and
147.4±15.34 cm, respectively, in adult males, and 119.7±11.47, 118.5±8.85 and
147.9±8. 1 8 cm, respectively, in adult females. Age at first calving ranges between 1 ,450
and 1,700 days.

Siri calf

154

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Cattle shed

Milk yield is around 2-6 kg/day with lactation length of about 210 to 274 days.
Calving interval ranges from 425 to 490 days. A large amount of variation is observed
in the performance of Siri animals. Their performance can be improved further by
proper selection and distribution of sires in the breeding tract.

The fat content is 2.8 to 5.5%, SNF 7.56 to 9.37%, total solids 10.36 to 14.24%,
protein 3.0 to 4.10% and ash 0.701 to 0.732% at different stages of lactation.

Contact Agencies

1 . State Animal Husbandry Department, Sikkim

2. State Animal Husbandry Department, West Bengal

CATTLE BREEDS

155

THARPARKAR

Synonyms: White Sindhi, Gray Sindhi, Thari

Origin and Distribution

The Tharparkar is an important dual-purpose breed raised primarily for its milking
potential. The name Tharparkar has been derived from the place of its origin - the Thar
desert. The home tract of this breed is in the Tharparkar district of southeast Sind in
Pakistan. Tharparkar animals are also found in the vicinity of Amarkot, Nakot, Dhoro
Naro and Chor in Pakistan. This tract covers an area of around 120,000 km2, and con¬
sists largely of arid desert famous for sand dunes. In India, these animals are now
found along the Indo-Pak border covering western Rajasthan and up to Rann of Kutch
in Gujarat. Animals with typical characteristics of breed are found in Jodhpur, Barmer,
Jaisalmer, districts of Rajasthan and Kachch region of Gujarat. Some animals are also
available in Suratgarh tehsil of Sri Ganganagar district of Rajasthan

Tharparkar is not a homogeneous breed but it has the influence of the Kankrej, Red
Sindhi, Gir and Nagori breeds. On the
western side of the habitat the influence
of the Red Sindhi is prominent, and on
the north and northeast of the Nagori.

In other parts influence of the Kankrej
is predominant. A sprinkling of the Gir
is also evident. In spite of all the het¬
erogeneity, a medium type breed
adapted to the desert conditions has been
developed.

Location and Topography

The Tharparkar district of Pakistan
lies between 24° 1 3' and 26°2' north lati¬
tude, and 68°40' and 71°1 T east longi¬
tude. In India, the breeding tract lies
between 23° 15' and 29° 19' north lati¬
tude, and between 68°4' and 74° east
longitude. The whole area consists of
sand-dunes 30 to 90 m in height.

Soil

The breeding tract consists largely
of sand-dunes or ridges locally called

PUNJAB

HARVi

INDIA

PAKISTAN

ARABIAN SEA

Breeding tract

1 56 ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

Tharparkar bull

Tharparkar cow

CATTLE BREEDS

157

bhits. During the hot, windy season, fine sand from the deltaic region and Rann of
Kutch is blown over forming dunes or ridges. These ridges are irregular, nearly parallel
and enclose valleys where animals graze.

Climate

The habitat of Tharparkar breed lies in the arid region, and has very harsh agro-
ecological conditions. The temperature variation in 24 hours is very sharp. During
winter season the day is fairly warm. The minimum temperature in the night occa¬
sionally dips up to sub-zero level. In summer the maximum day temperature goes up
as high as 48° to 49°C but the nights are cool and comfortable. Rainy season lasts only
for a very short duration and the average annual rainfall is 1 0 to 1 5 cm. Drought for 3
to 4 years at a strech is not very uncommon in this area.

Management Practices

These areas suffer from endemic scarcity of fodder and water which becomes acute
during summer season, particularly between April and June. The whole area is sandy
bereft of vegetation except small bushes. Only at a few places kheri or khejri ( Prosopis
cinereria) trees are available. Sewan ( Lasiurus sindicus ) is the only staple fodder avail¬
able, either as green grass or hay. Concentrate is offered only to cows in advance
pregnancy or to lactating cows. The availability of water to livestock particularly in the
summer season is very scarce. In earlier days, water was provided on alternate days.
But in the recent past, many villages have been provided with drinking water facility.
Livestock owners provide water trough at one common point near a tap where cattle
come in groups for drinking water. Animals are generally not provided with shelter or
houses throughout the year, except during certain chilly nights or during extreme sum¬
mer season. Animal houses are made up of kutcha walls and have thatched roof of
senia grass. In most of the villages, there is no planned mating system but usually
farmers select bulls on the basis of phenotype and sometimes dam’s milk yield. Natu¬
ral service is the common method for breeding animals.

Physical Characteristics

Animals are white or light grey. Face and extremities are of a darker shade than the
body. In bulls neck, hump and fore- and hind-quarters are also dark. Hair are fine,
short and straight, but in males they are slightly curly on the forehead. Head is of
medium size. Forehead is broad and flat or slightly convex above eyes. The front of
horns and face are practically in one plane. In bulls the convexity may be slightly more
pronounced. A boldly convex forehead is not acceptable. Face is lean, fine and slightly
dished to muzzle. Nostrils are broad and black. Lips are muscular and jaws strong.
Eyes are full and placid. Ears are somewhat long, broad and slightly pendulous. Ani¬
mals with rich yellow colour of the skin inside the ear are preferred. Horns are set well

158

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

apart curving gradually upward and
outward in the same line as that of the
poll, with blunt points inclined inward;
moderately thick at the base, i.e. 12.5-
17.5 cm in circumference just above
the skin. In males, the horns are thick¬
er, shorter and straighter than in fe¬
males. Homs much thicker at the
base or unduly long are not preferred.
Dewlap is loose and flexible but not vo¬
luminous. Skin is fine and mellow.
Hump is moderately well developed in
males, firm and placed in front of the
withers. In females, there is a well-
defined flap of skin at the navel corre¬
sponding to the sheath in males, but is
not coarse or long. The sheath is of
moderate length and not markedly pen¬
dulous. Tail is thin, supple and hangs
loosely so that the end of the switch is 5 to 1 5 cm off ground. Switch is black. Udder is
large and well developed in front and rear, and is carried well up at the back. Floor of
udder is nearly level and not deeply cut between quarters. Skin of the udder is fine and
mellow with a yellow tinge and prominent veins. Teats are 7.5 to 10 cm long, uniform
in thickness and set at even distances. Skin is of fine quality, loose and mellow to
touch. Colour of skin is black, except on the udder, under the belly and inside of ears
where it is rich yellow.

Morphometric and Performance Parameters

Average body length, height and heart girth are 142, 133 and 184 cm, respectively,
in males, and 132, 130 and 173 cm, respectively, in females. Average birth weight is
23.1 kg (range 21 to 25 kg) in male calves, and 22.4 kg (range 21 to 25 kg) in female
calves. Body weight of an adult male is around 450 to 500 kg and that of an adult
female about 295 kg. Tharparkar cows calve for the first time at an average age of
about 1,247 days (range 1,1 16 to 1,596 days). Average milk yield is 1,749 kg (range
913 to 2,147 kg), lactation length 286 days ( range 240 to 377 days), dry period 138
days (range 115 to 191 days), service period 128 days (range 108 to 191 days) and
calving interval 431 days (range 408 to 572 days). Fat is about 4.88% (range 4.72 to
4.90%) and SNF 9.2% (range 8.9 to 9.7%).

CATTLE BREEDS

159

Tharparkar herd

Breeding Farms

1 . Cattle Breeding Farm: Kampasagar; Karimnagar; Mamnoor, Andhra Pradesh

2. Cattle Breeding Farm: Pumea; Sairakela; Patna, Bihar

3. Birsa Agricultural University, Ranchi, Bihar

4. Government Livestock Farm, Hisar, Haryana

5. National Dairy Research Institute, Kamal, Haryana

6. Choudhary Charan Singh Haryana Agricultural University, Hisar, Haryana

7. Cattle Breeding Farm, Ratona, Sagar, Madhya Pradesh.

8. Cattle Breeding Farm: Pohara; Yeotmal, Maharashtra

9. Central Cattle Breeding Farm, Suratgarh, Rajasthan

10. Livestock Research Centre, Rajasthan Agricultural University, Chandan,
Rajasthan

1 1 . Government Livestock Farm, Chettinad, Tamil Nadu

12. State Livstock-cum- Agricultural Farm, Barari, Jhansi, Uttar Pradesh

13. Central Cattle Breeding Farm, Andeshnagar, Lakhimpur Kheri, Uttar Pradesh

Contact Agencies

1 . State Animal Husbandry Department, Rajasthan

2. Rajasthan Agricultural University, Bikaner, Rajasthan

3. Department of Animal Husbandry and Dairying, Government of India, New
Delhi

160

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

UMBLACHERY

Synonyms: Jathi madu, Mottai madu, Molai madu, Southern, Tanjore, Therkathi madu
Origin and Distribution

The Umblachery breed of cattle, one of the best draught breeds of Tamil Nadu, is found
in Thanjavur, Thiruvarur and Nagappattinam districts. It derives its name from its
home tract, Umblachery, a small village 10 km away from Thiruthuraipoondi town in
Nagapattinam district. This breed is considered to be developed by crossing Kangayam
with local animals of Thanjavur, and is very similar to Kangayam except in the appear¬
ance of head and smaller size. These are light built draught animals developed for work
in the marshy paddy fields. About 60-70% of cattle in this area belong to Umblachery
breed. Estimated population is around 283,000. Breedable females, breeding bulls and
bullocks constituted 41.66, 0.26 and 24 % respectively.

Location and Topography
The breeding tract lies between 1 0° 1 8'
and 10°55' north latitude, and 79°T and
79°5' east latitude. Total geographical
area of the breeding tract is about 3,500
km2. Alivation of this area ranges from
0 to 50 m above msl. The tract lies in
Cauvery delta region.

Soil

The soil in the breeding tract is mostly
alluvial and requires suitable type of
animals for working in paddy fields so
that they may not sink into the knee-
deep mire. The Umblachery breed be¬
ing light in weight serves this purpose
well. .

Climate

Climate in the breeding tract is sub-
humid with medium rainfall. Mean
maximum temperature is 32.9°C (range
28.2° to 37.9°C) during May. Mean
minimum temperature is 23.6°C (range

Breeding tract

CATTLE BREEDS

161

Umblachery bull

Umblachery cow

162

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Umblachery calves

20° to 27°C). Total rainfall is around 150 cm spread over about 72 days in a year.
Rainfall is maximum during November and minimum during April. Relative humid¬
ity is 83% (range 70 to 91%). Wind velocity is around 7 km/hr ( range 4.2 to 13.3 km/
hr).

Paddy ( Oryza saliva ) is the main cultivated crop. Sorghum {Sorghum vulgare ) ,
bajra {Pennisetum typhoides) and ragi ( Ellucine coracana ) are the other cereals. Ground¬
nut {Arachis hypogea), sugarcane {Saccharum officinarum ) and cotton ( Gossypium
hirsutum ) are also cultivated. Neem (Azadirachta indica ), palmyra {Borassus Jlabellifer),
coconut {Cocos nilotica), tamarind {Tamarindus indica ), black babul {Acacia nilotica )
and bamboo {Bamboos bamboosa ) are the trees available in the breeding tract.

Management Practices

Average herd size is 3. Animals are housed during night and rainy season. Houses
are mostly closed and of kutcha type. In the day time the animals are tethered in the
wood packs or tree trunks. Most of the cows are not milked. Calves are allowed to suck
their dams. Cows are not bred till calves are weaned. Paddy straw is the main fodder
both in summer and winter. Bullocks and milking females are offered groundnut/sesame
oilcakes. Rice bran and cotton seed are also fed. Animals are also sent for grazing.
Herdsmen collect animals from various households in January or February and graze
them for about 6 months. Usual herd strength of such groups ranges from 250 to 400
animals. Sometimes the animals are taken even for 50 to 100 km for grazing. They are

CATTLE BREEDS

163

Umblachery females are used for ploughing

herded together for manuring the fields. Calves, young males and females are not taken
with these herds. The practice of dehorning bullocks is peculiar in Umblachery cattle.
Horn buds are removed at 6 months of age by singeing with red hot iron. Ears are
pruned and hot iron branding is done. Heifer calves and bull calves considered good for
breeding purpose are not dehorned. Natural service is mostly practiced.

Physical Characteristics

Umblachery calves are generally red or brown at birth with all the characteristic
white markings on the face, on limbs and tail. This colour changes to grey at about 6
months of age. In adult females, the predominant coat colour is grey with white mark¬
ings on face and legs. The intensity of colour varies from grey with admixture of black
to full grey. Males are dark grey with black patches on head, back and pelvis. Bullocks
are grey in colour. All the legs below hocks have white marks either ‘socks’ or ‘stock¬
ings’ even a portion of hooves is white. Switch of tail is white or partially white.
Forehead is fairly broad, sometimes with a slight groove in the middle. It is well pro¬
nounced with white star. Face is short and straight. Muzzle is broad and black. Eyes
are prominent and bright with black eyelashes. Ears are short, erect and laterally placed.
Homs are very small, curving outward and inward and sometimes spreading laterally.
These are thick in bulls and thin in cows. Hump is medium in size, not fleshy, generally
erect. Dewlap is thin and short extending to the sternum. There are white markings on
dewlap also. Navel flap is very small in cows. Sheath is not pendulous and well tucked

164

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

up to the abdomen. Tail is well set, long and tapering gradually below hocks. In cows,
udder is moderately developed with small and squarely placed teats. Milk-vein is not
prominent. Skin is black, soft and gives a glossy appearance. Bullocks are small, swift
and suited for agricultural operations.

Morphometric and Performance Parameters

Average body length, height and heart girth are 1 19 ( range 100 to 143), 117 (range
103 to 123) and 15 1 cm (range 125 to 165), respectively, in males, and 109 (range 90 to
125), 105 (range 85 to 115) and 135 cm (range 120 to 145), respectively, in females.
An adult male weighs around 385 kg and female 325 kg. Average age at first calving is
around 1,593 days. Daily milk yield is around 2 kg. The female produces 300 to 500
litres of milk in a lactation. On an average, milk contains 4.94±0.06% fat and 7.80±0.03%
SNF. Calving interval is around 446±4 days.

Umblachery bullocks are used for ploughing, carting, thrashing and paddling. The
bullocks are capable of doing work for 6 to 7 hours under hot sun. A pair of bullocks
can pull a total load (including cart weight) of 2 to 2.2 tonne over a distance of 20 km in
about 7 hours. Price of a pair of bullocks ranges from Rs 1 0,000 to 1 5,000.

Breeding Farm

1 . Cattle Breeding Farm, Korukkai, Umblachery, Tamil Nadu
Contact Agencies

1 . State Animal Husbandry Department, Tamil Nadu

2. Tamil Nadu Veterinary and Animal Science University, Chennai, Tamil Nadu

CATTLE BREEDS

165

VECHUR

Origin and Distribution

The Vechur, a small cattle breed found in hills of Kerala, had its origin in Vechur, a
small place by the side of Vembanad lake near Vaikam in Kottayam district of South
Kerala. The dwarf cattle are also available in Kasargod district. Milk production in
Vechur cattle is relatively higher than in other local cows. The movement of animals
was restricted because of the barriers like rivers, canals and backwaters. The social
requirement as well as the heavy rain and hot humid climate of the area coupled with
low input available to the animals led to the selection of a small adaptable animal by
man as well as nature. This was the basis for the evolution of Vechur animals.

Considering the importance of this breed to the local people, the Indian Council of
Agricultural Research has initiated a scheme entitled “Conservation of Germplasm of
Vechur Cattle of the Coastal Area and Other Dwarf Cattle of High Ranges of Kerala” at
the Kerala Agricultural University, Mannuthy, Thrissur on 1 January 1996. The scheme
is intended to characterize, evaluate and conserve the germplasm and to select a type of
cattle weighing around 125 kg and
yielding about 900 kg of milk/lactation.

Location and Topography

The breeding tract lies between 9°3'
and 9°5' north latitude, and 76°34' and
77° east latitude. Kerala is a southern¬
most state in India, a narrow strip of land
bordered by western ghats in the east
and Arabian sea in the west.

Soil

The soil in the breeding tract can
be classified into 3 types locally known
as kari, karappadom and kayal soils.

Kari lands which are inferior swampy
areas with black peaty soil with acididc
nature are seen in Vaikom and Vechur
areas. Karappadom soils are black, very
loose, peaty with decomposed organic
matter and are seen on the banks of the
rivers. Kayal lands are those which are
reclaimed from the backwaters with
heavy clay soil. Breeding tract

KARNATAKA

INDIA

ARABIAN SEA

Kfittav.im

166

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Vechur bull

Vechur cow

CATTLE BREEDS

167

Climate

The climate of the area is hot (23°
to 35°C) and humid (81%) due to prox¬
imity of backwaters. The place has
heavy rainfall (294 cm). The principal
crops are rice, coconut, tea, coffee and
spices.

Management Practices

Animals in Kasargod district are
mainly kept for manure. Animals from
each house are let loose in the morn¬
ing. These animals herd together and
go for grazing in bigger groups. Breed¬
ing bulls are also present in the grazing
area, some of them belonging to
temples. Cows conceive out of natural
mating from these bulls. Controlled
breeding is not the practice. Animals Vechur calf

return home in the evening. Sometimes animals remain in the hillside for months. But
certainly they return after calving. Instances when cows come back to the owners and
the house accurately after a long lapse of time and after calving even when the owners
are not able to recognize the animal are common. Animals in milk return home at the
exact time for milking. Generally animals are confined to sheds in the nights. Tree
leaves are spread in sheds as bedding. Additional leaves are spread on alternate days
on the previous layer. Daily cleaning of sheds is not done as in other parts of the state.
Manure is removed 3 or 4 times a year and used as mulch (organic manure) for cultiva¬
tion.

Physical Characteristics

Vechur animals are light red, black or fawn and white. They are extremely small in
size and have compact body. Head is long with narrow face. Homs are small, thin
curving forward and downward. In some cases they are extremely small, and are hardly
visible. Hump is prominent in males. Sheath is small and tucked up with the body.
Legs are short. Tail is long almost touching the ground. Udder is well developed with
squarely placed small tapering teats. Milk-vein is well developed. Skin is smooth and
glossy.

Morphometric and Performance Parameters

Body length, height and heart girth measure 108.8±1.79, 98.2±1.41 and 132.3±3.11

168

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

cm, respectively, in bulls, and 93.4±0.98, 89.0±0.68 and 122.2±1.03 cm, respectively,
in cows. Average birth weight is 1 1.2 kg in male calves and 10.2 kg in female calves.
Average adult body weight is 1 78 kg (range 1 30 to 200 kg ) in males, and 1 32 kg (range
95 to 150 kg) in cows. Average age at first calving is 1,073±46.4 days. Milk yield
averages 514.0±37.1 kg in an average lactation of 232±16.7 days. Fat is 5 to 7.5%
(average 6.2%). Calving interval is around 450 days.

Breeding Farm

1 . Kerala Agricultural University, Mannuthy, Thrissur, Kerala

Contact Agencies

1 . Kerala Agricultural University, Thrissur, Kerala

2. State Animal Husbandry Department, Kerala

Vechur herd

BUFFALO BREEDS

BHADAWARI

Synonym: Etawah
Origin and Distribution

The Bhadawari buffaloes are known for high content of butter fat in the milk. They are
found in the ravines of Yamuna, Chambal and Utangan rivers spread over in Uttar
Pradesh and Madhya Pradesh. The breeding tract and natural habitat of this breed are
Bah tehsil of Agra, Chakamagar and Barhpura blocks of Etawah (Uttar Pradesh); Ambah
and Porsa tehsils of Morena, and Mahangaon tehsil of Bhind district (Madhya Pradesh).
These are traditionally the high density
zones of Bhadawari buffaloes. This
breed was the pride animal of the
Bhadauria clan of the former Bhadawar
state before independence of India. The
term Bhadawari breed possibly was
coined from the word Bhadawar, the
home tract of this breed. The estimated
population of this breed on the basis of
1977 Livestock Census was around
160,000 of which 70,000 were
breedable females. The population de¬
clined at an alarming rate from 1977 to
1991, particularly in Uttar Pradesh. In
the survey conducted in 1991 by the
Animal Husbandry Department, it was
speculated that around 29,000 animals
existed. The survey in the breeding tract
conducted by the National Bureau of
Animal Genetic Resources during 1993
to 1995 presented a very gloomy pic¬
ture about the population status of
this breed. Most of villages had 2 to 5

Breeding tract

170

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Bhadawari bull

Bhadawari she buffalo

BUFFALO BREEDS

171

Bhadawari animals. Hardly 3 to 4 villages had 20 or more buffaloes. The total popula¬
tion of this breed in the whole breeding tract was estimated to be 37,700. However, this
figure also is on the higher side and if the trend continues then very soon this breed
would come under threatened category.

The importance of Bhadwari buffaloes was well understood and some attempts
were made for making improvement in their performance. In 1985, a project was initi¬
ated at Chandra Shekhar Azad University of Agriculture and Technology, Kanpur, with
the assistance of ICAR, New Delhi with 58 breedable females. However, in 1990 only
16 buffaloes were left and the project was terminated. The State Government of Uttar
Pradesh has also initiated some steps for its conservation. A Bhadawari buffalo farm
was established at Saidpur in 1971-72 which was later shifted to Etawah in 1988-89.
The mandate of this farm is genetic improvement through selective breeding and distri¬
bution of selected bulls in the field for breeding Bhadawari buffaloes. About 63 bulls
were selected on the basis of dams’ milk yield; 58 of these bulls were distributed in the
breeding tract for natural service and 5 were used for semen collection and freezing.
However, Murrah bulls, semen were also distributed in the breeding tract of Bhadawari
buffaloes which has affected the progress of improvement programme on Bhadawari
buffaloes. Murrah bulls, semen should not be distributed in the breeding tract of
Bhadawari buffaloes which should be bred pure so as to save this breed from extinc¬
tion.

Location and Topography

The breeding tract lies approximately between latitudes 26° and 27° 14' north, and
longitudes 78° and 79°51' east. The entire breeding tract is spread in the ravines of
Yamuna, Chambal and Utangan rivers.

Crops and cropping pattern in this area have undergone drastic changes during the
last two and a half decades mainly because of introduction of irrigation through canal
and tubewells. Wheat, barley, rapeseed, mustard, pigeon-pea, maize and pearlmillet
are the prominent crops. The area under fodder cultivation is 0.5% of the total geographial
area. Jharberi, pilua and deshi karaunda shrubs; and ruani and chhonkra trees are
found in ravines. Plantation of vilayati babool {Prosopis juliflora ) to control in ravines
by the Forest Department of Uttar Pradesh by aerial spray of seeds is a great threat to
survival of the natural vegetation which is also one of the important causes of decline in
Bhadawari population.

Soil

The area has mainly alluvial soil. The soil in general is deficient in nitrogen, low to
medium in phosphorus and medium to high in potassium.

Climate

Rainy season is well defined from July to September. Average rainfall in Bhind is

ANIMAL GENETIC RESOURCES OE INDIA - CATTLE AND BUFFALO

172

57 cm, and in Agra and Etawah districts
635 to 792 mm. There is wide varia¬
tion in the ambient temperature of this
area. In winter, temperature goes as low
as 2°C and in summer as high as 49°C.
This can be further classified as (i) long
duration summer, and (ii) short dura¬
tion winter. Relative humidity is maxi¬
mum (81%) during August and mini¬
mum (around 30%) during May.

Management Practices
Integrated animal husbandry is prac¬
tised in this tract, i.e. all species of live¬
stock like cattle, buffalo, sheep and goat
are reared together. Animals are housed
both in kutcha and pucca types, and in
most of the cases animal houses are part
Bhadawari calf of farmers’ residence. Animals are

grazed in the field, particularly after rainy season when plenty of grasses are available.
This is supplemented with green fodder in the form of berseem ( Trifolium alexandrium ),
lucerne ( Medicago sativa), pearlmillet, maize (Zea mays) and sorghum ( Sorghum
vulgar e)\ and by dry fodder in the form of wheat bhusa ( Triticum aestivum ), karbi of
pearlmillet ( Pennisetum typhoides ),' maize and sorghum. Majority of the farmers pro¬
vide concentrate in the wet form. Concentrate mixture is prepared by mixing grains of
barley, maize, oat, etc. and fed after either soaking in water or boiling. Animals are
generally stallfed. Some farmers provide fodder in cane baskets. Calves are allowed to
suck dam’s milk. Weaning is not practised. AI is not common in this region and natural
mating is practised most of the times.

Physical Characteristics

Bhadawari buffaloes are medium sized with wedge-shaped body. Animals are nar¬
row in front and wide behind giving distinctive conformation. Colour pattern of the
body varies from blackish-copper to light copper. Colour of legs is usually like wheat
straw which is peculiar to this breed. Hair are scanty. Calves are generally lighter in
colour than adults. Skin colour is generally grey or greyish-black. Two white lines
‘Chevron’, locally called as kanthi, are present at the lower side of the neck similar to
that of Surti buffaloes. Head is comparatively small, bulging between horns. In some
cases forehead has white markings on it. Homs are black, curling slightly outward,
downward before running backward parallel and close to neck, and finally turning

BUFFALO BREEDS

173

upward. Eyelids are generally copper coloured but some animals have light brown or
black eyelids. Ears are horizontal and medium in size. There are grey hair on the lower
part of jaw and ears. Hooves are black. Tail is thick and long, sometimes touching the
ground and ending in a brown or white switch. Udder is small and not well developed.
Teats are cylindrical and centrally placed with pointed tips.

Morphometric and Performance Traits

Average body length, height and heart girth are 1 16.9, 122.8 and 184.5 cm, respec¬
tively, in adult males, and 115.0, 123.1 and 184.3 cm, respectively, in adult females.
Average birth weight of calves is 25.3±0.23 kg (range 24 to 27 kg). Body weight of
adult males is around 475 kg and that of adult females around 425 kg (range 300 to 540
kg).

Age at first calving is around 1,477 days (range 1,335 to 1,550 days). Bhadawari
buffaloes are low milk producers. Average lactation milk yield is 780±25.4 kg (699 to
1,165 kg) and 300-day milk yield is 71 1 kg , in first lactation, and 903 kg (658 to 1,142
kg) and 812 kg, respectively, in overall lactations. On an average, these buffaloes pro¬
duce milk for 272 days. Lactation period varies from 140 to 350 days. Average dry
period is about 190 days (range 145 to 295 days). Fat varies from 6 to 12.5% (average
8.6%). Total solids in milk are around 17%. Average service period is 179 days (range
83 to 317 days) and interval between successive calvings is 478. 7±1 1.55 days (range
390 to 630 days).

Bhadawari herd

174

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Bhadawari buffaloes survive and produce on low quality feed and fodder resources
available in this area. This breed is an efficient converter of coarse feed into butterfat
and is known for its high butterfat content. Better marketing facilities for fluid milk is
tempting the farmers to cross these buffaloes with Murrah buffaloes. The Uttar Pradesh
State Government is also recommending use of Murrah semen in the breeding tract of
Bhadawari buffaloes, and hardly any emphasis is being laid on selective breeding of
Bhadawari buffaloes or on distribution of Bhadawari bulls/semen. As a result, the
population of pure Bhadawari buffaloes has declined considerably. On the other hand,
Murrah-type animals being large in size require comparatively more quantity of good
quality feed and fodder, a major constraint in this area. Bhadawari breed being of
medium size and adapted to these conditions over the years is most suited to this area.
This breed also provides good draught power in the area specially for farmers having
small land holding. Even females are used for draught.

Breeding Farms

1 . Bhadawari Farm, Agriculture College, Gwalior, Madhya Pradesh

2. Bhadawari Buffalo Breeding Farm, Etawah, Uttar Pradesh

3. Chandra Shekhar Azad University of Agriculture and Technology, Kanpur,
Uttar Pradesh

4. State Livestock-cum-Agricultural Farm, Saidpur, Uttar Pradesh
Contact Agencies

1 . Department of Animal Husbandry, Uttar Pradesh, Lucknow

2. Chandra Shekhar Azad University of Agriculture and Technology, Kanpur,
Uttar Pradesh

BUFFALO BREEDS

175

JAFFARABADI

Synonyms: Bhavanagri, Gir or Jaffari

Origin and Distribution

The Jaffarabadi is the heaviest of all the Indian breeds of buffaloes. It is found in Juna-
garh, Bhavnagar and Amreli districts of Saurashtra region of Gujarat. It is named after
the town of Jaffarabad. These buffaloes are found in large numbers in this area, espe¬
cially in the Gir forest area which is inhabited by the Indian lion. They constitute about
80% of the food for the lions in these forests. In spite of such difficult situations, the
Maldhari herdsmen in the region continue to rear these buffaloes, which are the main
source of their livelihood.

Location and Topography

The breeding tract lies between 20°5' and 22°6' north latitude, and between 70°
and 72° east longitude. Most of the area is undulating. Agro-climatic conditions of the
tract are mostly semi-arid. Semi-arid
area ranges from 65 to 99% of total land
area of these districts. Approximate area
of distribution is 64,339 km2. Average
elevation of land is 60 m above msl.

Soil

Soils are silty clay to clay, typical
medium black, giving mild cracking in
dry season, high water holding capac¬
ity, highly calcareous and slightly alka¬
line with no salinity problem. The pH
ranges from 7.9 to 9.4. Wells and ca¬
nals are the sources of irrigation. Rice,
millet, sorghum, maize and oat are the
main cereal crops, and gram and
pigeonpea are the main leguminous
crops grown in this area. Other crops
grown are cotton, groundnut, castor,
sugarcane and sesamum.

Climate

Climate in general is monsoon
tropical. Rains are common during

RAJASTHAN

INDIA

ARABIAN SEA

Breeding tract

176

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Jaffarabadi bull

Jaffarabadi she buffalo

BUFFALO BREEDS

177

June to September. Rainfall ranges from
50 to 100 cm. Average temperature
ranges from 20° to 36°C. Sometimes
maximum temperature goes as high as
46°C and minimum as low as 11°C.

Mean relative humidity is 80 % during
July to September and 20 to 40 % dur¬
ing rest of the year.

Baniyan, pipal, raintree, neem,
babul, etc. are the major fodder trees,
and oriya and vela veli are fodder shrubs
available in the native tract of
Jaffarabadi animals. Major native
grasses are Cynodon, Dicanthium,

Aristidica, Brachiaria, Eleuropus, etc.

Main cultivated crops grown in this area
are pearl-millet, sorghum, wheat, gram,
tur, castor, cotton, onion, sugarcane,
garlic, etc.

Management Practices

Average size of buffalo herd is 2-4. Most of the farmers provide some type of
housing to the animals during day and night. Most of the animal houses are closed,
kutcha and separate from the farmer’s residence. Inside the forest areas, the Maldharis
keep their animals in ‘ Nesdas ’ where the animal house forms a part of the farmer’s
house and is heavily barricated in front to protect the animals from lions and other wild
animals. As the animals are massive, they are heavy grazers. They are maintained on
natural pastures throughout the year. The main green fodder fed to Jaffarabadi animals
are maize, sorghum, groundnut fodder, sugarcane tops and lucerne; and dry fodder are
sorghum and maize kadbis, groundnut fodder, groundnut husk, groundnut hulls, wheat
straw, wheat bhusa etc. The common concentrates fed to Jaffarabadi buffaloes are
groundnut-cake, cottonseed and cottonseed-cake and compounded (pelleted) feed of
the Gujarat Dairy Development Corporation. In some areas of Bhavnagar district people
also feed coconut-cake. Mostly natural mating is practised.

Physical Characteristics

The usual colour of the breed is black but a few animals having grey colour or
white spots on forehead, feet and tail switch are also seen. The latter type of buffaloes
are called ‘Nav-Chandra’ and are considered lucky by the Maldharis (livestock own¬
ers). Hair are medium in length, straight and glossy. Skin colour is black. Horns,

Jaffarabadi calf

178

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Jaffarabadi herd

muzzle, eyelashes, hooves and tail switch are black. Forehead is very prominent, broad
and convex. Horns are long (about 50 cm) and exhibit wide variation, but usually
emerge out by compressing the head, go downward sideways, upward, inward and fi¬
nally forming a ring- like structure. It makes eyes to look small, termed as study eye,
especially in males. Sometimes it leads to blindness. Ears are long and horizontal.
Average length is about 26.76±1 .00 cm. Head and neck are massive. Navel flap and
penis sheath are medium in size. Udder is well developed. Pendulous and round ud¬
ders are found in almost equal proportions. Fore-quarter is slightly larger than the hind
quarter. Teats are mostly funnel shaped and have pointed tips. Quite a large number of
buffaloes have cylindrical teats. Milk-vein is medium in size. Jaffarabadi buffaloes are
of mild temperament.

Morphometric and Performance Traits

The averages of body length, height and heart girth are 127.7±2.20, 126. 1±2.1 8 and
207.7±3.58 cm, respectively, in adult males, and 132.6±0.55, 129.1±0.54 and 202.9±0.84
cm, respectively, in adult females. Birth weight is around 36 to 38 kg. On an average,
adult Jaffarabadi males and females weigh up to 1,000 and 700 kg respectively. In
exceptional cases, Jaffarabadi bulls weigh as much as 2,000 kg.

Age at first service is around 1,000 days and at first calving is 1,361 .7 days. Aver¬
ages of total lactation milk yield and lactation length are 2, 1 5 1 .3±1 30.53 kg and
3 19.44±17.3 1 days, respectively, in first lactation, and 2,238.7±74.87 kg and 305.1±9.61

BUFFALO BREEDS

179

days, respectively, in overall lactations. Averages of dry period, service period and
calving interval are 144.9±8.4, 93.4±0.69 and 440.3±14.32 days respectively. Average
number of services per conception is 1 .5 (range 1 to 2). Average fat is 7.68% (range 6.8
to 8.5%). Males are good draught animals for hauling heavy loads.

Breeding Farms

1 . Buffalo Breeding Centre, National Dairy Development Board, Nekarikallu,
Andhra Pradesh

2. Cattle Breeding Farm, Gujarat Agricultural University, Junagarh, Gujarat

3 . Akshar Purushottam Mandir Gaushala, Gondal, Gujarat

4. Sabarmati Ashram Gaushala, Bidaj, Gujarat

5. BAIF Development Research Foundation, Uruli-Kanchan, Maharashtra
Contact Agencies

1 . Gujarat Agricultural University, Junagarh, Gujarat

2. Department of Animal Husbandry, Gujarat

180

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

MARATHWADA

Synonym: Dudhana Thadi
Origin and Distribution

Marathwada buffaloes in the Marathwada region of Maharashtra state are entirely
different from that of western and northern types, and clearly represent a very ancient
indigenous type characterized with lighter built and long flat horns. These buffaloes are
mainly found in Parbhani, Nanded, Bid and Latur districts of Maharashtra.

There are two agricultural divisions, viz. Aurangabad and Latur, in the region. The
region is predominantly agrarian. Rainfed agriculture is the principal occupation of
rural population. The geographical area of this region is 6.48 million ha and cultivable
area is 4.8 million ha.

Location and Topography

The Marathwada region lies between 1 7° 35’ and 20° 40' north latitude, and 74° 40'

and 78° 1 5' east longitude. It forms part
of the vast Deccan plateau. The entire
Marathwada region is situated at an av¬
erage height of about 650 m above msl,
gradually sloping from west to east, and
is traversed by hill ranges originating
from the Sahyadris in the west. Differ¬
ent ranges derive their names from lo¬
cal resources, the northern being Ajanta-
Satmala ranges and the southern the
Balaghat ranges. In addition , there are
scattered hillocks of varying heights
throughout the region.

Godavari is the main river flowing
from west to east and south-east, col¬
lecting water on its way from several
large and small tributaries. It enters
Andhra Pradesh and ultimately merges
into the Bay of Bengal. Most of the
tributaries are seasonal and dry up soon
after the monsoon. The region suffers
from heavy drainage due to west-east
slope, ultimately affecting agriculture
to a great extent.

Breeding tract

BUFFALO BREEDS

181

Marathwada bull

Marathwada she buffalo

182

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

Soils

Soils of Marathwada region are typi¬
cally black cotton type vertisols and
possess material of calcareous rudimen¬
tary rocks, basic igneous, basalt
alloevium and alluviam material com¬
monly known as Deccan trap. It in¬
cludes 32.5 million ha of medium black
soils, 12.1 million ha of deep black soils
and 12.4 million ha of coarse shallow
soils. The fertility index with respect
to nitrogen is low in Parbhani and
Nanded districts, and medium in
Aurangabad, Jalna, Bid, Osmanabad
and Latur districts. In case of phospho¬
rus, fertility index was low in almost
all the districts. Contrary to this, it was
very high for potash throughout the
Marathwada calf region in 1 993 . The average use of

fertilizer was 50 and 39 kg/ha in Latur and Aurangabad divisions respectively.

Climate

The climate of Marathwada region is dry to semi-arid and sub-tropical rainy. The
major feature of rainfall is that the south-west monsoon (June-September) accounts for
70 to 95% of annual rainfall. The monsoon as well as the annual rainfall show large
fluctuations from year to year, but there is no significant evidence of any trend or peri¬
odicity in either of them. The annual rainfall varies from 300 to 1 , 1 00 mm with 3 5 to 65
rainy days. The coefficient of variation of monthly rainfall is as high as 40 to 50% even
in the rainiest month of July. The variability of weekly or fortnightly rainfall is still
high.

There are 3 distinct agro-seasons. Kharif (monsoon) ranges between June and
September, followed by rabi (post-monsoon) between October and January, and sum¬
mer between February and May. The maximum temperature is around 40±2°C during
April-May and minimum about 8 to 10°C during December-January.

The Marathwada region is endowed with assured rainfall except in some talukas of
Aurangabad, Jalna, Bid and Osmanabad districts.

Management Practices

Farmers maintain mixed herds of cattle and buffaloes. Generally, animals are housed
in open close to farmers’ residence. Sorghum and paddy straw, grasses, sugarcane leaves
and tops are usually fed to animals. Concentrate is offered only to milking females.

BUFFALO BREEDS

183

Marathwada herd

Physical Characteristics

Marathwada buffaloes are of light to medium built with compact stature, and have
adult weight of 300 and 370 kg. Coat colour varies from greyish-black to jet black,
although white markings on forehead and on lower parts of the limbs with white switch
of tail are not uncommon. Horns are medium in length, parallel to neck, reaching up to
shoulder but never beyond shoulder blade like those commonly seen in Pandharpuri
buffaloes and usually not flat. Forehead is moderately broad, and eyes are generally red
tinged. Neck is short. Legs and feet are properly set which in males suit for draught and
transportation in hilly tract. Tail is of moderate length reaching up to hock.

Morphometric and Performance Traits

Average birth weight of male and female calves is 24.5 and 23.7 kg respectively.
Adult body weight ranges from 320 to 400 kg. Age at first calving is around 1 ,670 days.
Lactation yield ranges from 845 to 960 kg in a lactation of about 302 days. Gestation
period, calving interval and dry period in Marathwada buffaloes are 310, 430 and 134
days respectively.

Contact Agencies

1 . Marathwada Agricultural University, Parbhani, Maharashtra

2. Department of Animal Husbandry, Maharashtra

184

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

MEHSANA

Synonyms: Mahesani, Mehsani, Banni
Origin and Distribution

The Mehsana, a dairy breed of buffaloes, is centered around the town of Mehsana in
Gujarat from where it derives its name. It is also common in Banaskantha, Sabarkantha,
Gandhinagar and Ahmedabad districts. Typical animals are seen in the towns of
Mehsana, Patan, Sidhpur, Vijapur, Kadi, Kalol and Radhanpura. The breed is consid¬
ered to be a cross between Murrah and Surti. Approximate population of this breed is
around 0.4 million. Males are moderately tractable while females are docile. Male
calves are not cared properly.

Location and Topography

Mehsana district lies in the north of Gujarat between latitude 23.02° and 24.90°
north, and longitude 71.26° and 72.52° east. It covers an area of 9,027 km2. The

Sabarmati, Rupel and Saraswati are the
main rivers of the district. There are a
number of small and a few large ponds
in the breeding tract. About 1.78% of
the area is under forest. From the north¬
east part to north-west part of the
Mehsana district, the surface is plain
and slopy. The north-east part is hilly.
Average elevation of the area is around
104.37 m (range 69.5 to 154.5) above
msl.

Soil

The borne tract forms a part of the
sandy alluvial plains of north Gujarat.
Soil is sandy loam and ‘goradu’. In the
southern parts it merges into black cot¬
ton soil area. Soil of eastern zone is
highly fertile, and of western zone salty,
sandy and clay where trees are less in
number.

Climate

Summers are very hot and winters

Breeding tract

BUFFALO BREEDS

185

Mehsana bull

Mehsana she buffalo

186

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

very cold. Mean maximum temperature ranges from 21° to 45°C and mean minimum
temperature from 5° to 29°C. Average rainfall is around 57 cm (range 12 to 88 cm).
Average relative humidity is around 51% (range 12 to 95%).

Management Practices

Farmers maintain animals as commercial production units. Average herd size is of
4.33 animals/unit (range 1 to 12). Breeding is performed mainly through AI using
frozen semen of progeny-tested bulls. Grazing is practised in rainy season along road¬
side and on river beds. Lucerne is grown as major green fodder. Hay is made from
pearlmillet. Concentrate is fed to buffaloes and it contains sorghum/maize, wheat bran,
rice bran, groundnut-cake, sunflower, rapeseed, clusterbean kurma and molasses. Usu¬
ally pelleted concentrate feed supplied by the National Dairy Development Board is fed
to animals. Wallowing is generally restricted due to scarcity of water. Animals are tied
mostly at a place over day and night. Houses in the form of temporary sheds of thatched
roofs and wooden partitions are provided. Calves are weaned at about 6 to 8 months.
Female calves are cared more while male calves are generally neglected.

Physical Characteristics

The Mehsana buffalo is a medium-sized animal with a low set deep body. Body is
mostly black. A few animals are black-brown or brown. Muzzle and horns are black.
Forehead is wide with a slight depression in the middle, sloping toward the root of
horns. Face is long and straight with a wide muzzle and wide open nostrils. Eyes are
very prominent, black and bright, bulging from their sockets, with folds of skins on
upper lids. Ears are medium sized and pointed at the apex. There is generally a promi¬
nent hairy growth inside ears. Horns are generally sickle shaped with the curve more
upward than in the Surti breed and less curved than in the Murrah breed. They are
generally bent downward and then take a curve like the horns of a ram.

Neck is long and well set on shoulders. Skin over the region has folds. In males,
neck is massive and dewlap is almost absent. Chest is deep with broad brisket. Shoul¬
ders are broad and blend well with body. Legs are of medium to short length with clean
bones and broad, black hooves.

Barrel is long and deep, with well-sprung ribs. In females, fore-quarters are light,
hind quarters wide and heavy giving a wedge-shaped appearance. In males, fore¬
quarters are massive, giving a heavy appearance with hind quarters set fairly wide.
Back is barely straight and strong with pelvic joint higher than withers. Navel flap is
very small.

Hind quarters are well developed, wide and deep, with udder well attached at the
back and in front. Hips are high and prominent with points well apart. Thighs are well
developed with a good curve above hock. Buttocks are muscular merging well into

BUFFALO BREEDS

187

rump. Pin-bones are not prominent in
well-fed animals. Flanks are fine.

Hocks are strong with good curve. Tail
is of medium thickness and is long with
black switch. Switch is sometimes
brown or white.

Skin is thin, pliable, soft and gen¬
erally black. Hair are rough and scanty.

Udder is well-developed and bowl
shaped. In good specimens, it is carried
well behind. Generally, rear udder is
more developed than fore-udder. Teats
are fairly thick, cylindrical, long and
pliable. Milk-veins are prominent.

Morphometric and Performance Traits

Averages of body length, height
and heart girth are 153.7 cm (range 139
to 166 cm), 133.7 cm (range 120 to
144 cm) and 200.6 cm (rangel68 to 218 cm), respectively, in males, and 141.7 cm
(range 1 17 to 164 cm), 127.5 cm (range 1 1 1 to 142 cm) and 189.3 cm (range 160 to 21 1
cm), respectively, in females. Average birth weight of male calves is 29.5 kg (range 16
to 44 kg) and of females 28.5 kg (range 14 to 40 kg). The overall average birth weight
of calves is about 29 kg. Average adult body weight is around 565 kg in males (range
400 to 602 kg) and 484 kg in females (range 3 15 to 580 kg). Average weight at first
calving is 478 kg (range 228 to 575 kg).

Age at first service is about 830 days (range 349 to 2,178 days) and at first calving
about 1,266 days (range 677 to 2,500 days). Total lactation milk yield, 305-day milk
yield, lactation length and dry period average 1,940 kg (range 598 to 3,221 kg), 1,893
kg ( range 598 to 3,146 kg), 308 days (range 163 to 513 days) and 179 days ( range 44
to 584 days), respectively, in first lactation, and 1,988 kg (range 598 to 3,597 kg), 1,912
kg (range 598 to 3,269 kg), 317 days (range 157 to 513 days) and 167 days (range 14 to
656 days), respectively, in all lactations. Milk contains about 7% fat (range 5.2 to
9.5%). Average service period is about 161 days (range 24 to 646 days). Calving
interval is about 476 days (range 3 13 to 945 days). Females exhibit regularity of repro¬
duction throughout the year, but breeding and calving are more pronounced during
August to January and July to December respectively. This breed is reputed for its
persistency of milk production. Age at semen collection is about 1,013 days (range 680
to 1,352 days).

188

ANIMAL GENETIC RESOURCES OE INDIA - CA TTLE AND BUFFALO

Mehsana herd

Breeding Farms

1 . Buffalo Breeding Centre, National Dairy Development Board, Nekarikallu,
Andhra Pradesh

2. Livestock Research Station, Gujarat Agricultural University, Sardar
Krushinagar, Gujarat

Contact Agencies

1 . Department of Animal Husbandry, Gujarat

2. Gujarat Agricultural University, Sardar Krushinagar, Gujarat

BUFFALO BREEDS

189

MURRAH

Synonyms: Delhi, Kundi, Kali (India), Kerban-banleng (Sumatra), Kerban-shungei or
Karban-Sapi (Malaysia)

Origin and Distribution

Buffaloes in the northwest region of India have long been selected for milk yield and
have curled horns. They were named as Murrah meaning curled. These buffaloes were
also named as ‘Delhi’ referring to the centre of their origin. Murrah is considered to be
the best milch-cum-meat breed of buffaloes. Its home tract stretches around the south¬
ern part of Haryana comprising the districts of Rohtak, Jind, Hisar and Gurgaon, and
the Union Territory of Delhi. However, this breed has spread to almost all parts of the
country and is being bred either in pure form or is being used for grading up local
buffaloes. In fact, this breed has even found an important place in the livestock indus¬
try of many developing countries like Bulgaria, the Philippines, Malaysia, Thailand,
China, Indonesia, Bangladesh, Nepal, former USSR, Myanmar, Vietnam, Brazil and
Sri Lanka, and is being bred there ex-
tensively.

With increase in the popularity of
Murrah buffaloes as dairy animals,
farmers in different parts of the coun¬
try started maintaining either Murrah
buffaloes or got their local buffaloes
mated to Murrah bulls for increased
milk production. This has resulted in a
great demand for genetically superior
Murrah bulls in different states through¬
out the country. To meet this demand
the Government of India established the
Central Buffalo Breeding Farm for
Murrah breed on 1 April 1973 at Awadi,

Chennai, by taking over the main Tamil
Nadu State Salvage Farm for dry cows.

The mandate of the farm is to produce
and supply good quality Murrah buffalo
bulls to different state governments and
other developmental agencies for im¬
proving milk production in buffaloes in
the country. The farm has supplied 656
Murrah buffalo bulls to Andhra Pradesh, Breeding tract

190

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Tamil Nadu, Bihar, Orissa, Maharashtra, Kerala, Gujarat, Madhya Pradesh and
Karnataka during the last 10 years. Besides the males, the farm also supplied 220
heifers and many adult females to different organizations.

Location and Topography

The native tract lies between 28° 15' and 30° north latitude, and 75°45' and 70°80'
east longitude.

Soil

Soils of the area fall basically into two groups, viz. arid soils and enti soils. These
are mostly light- textured, sandy and loamy soils. In some parts of the breeding tract,
soils are sandy loam, surface soils are light in texture and heavier in lower horizons.
Soils are deficient in organic carbon and available nitrogen, and medium to high in
phosphorus and nitrogen.

Climate

The tract has relatively hot and dry climate. Maximum temperature goes as high as
45°C during summer. Minimum may reach near freezing point in winter with frost for
a few days. Annual rainfall is around 300 mm in arid zone and 500 mm in semi-arid
parts of the tract. These rains are caused mostly by southwest monsoon during July to
September contributing around 80-85% of annual rainfall.

The major rainfed crops are pearlmillet, sorghum and clusterbean during kharif ,
and gram, mustard and barley during rabi. Major crops grown under irrigated cropping
system are wheat, barley and mustard.

Management Practices

In the breeding tract, these buffaloes are kept in a mixed type of housing system.
Mostly they are tied to a tree or a pole in the open, but shelter is provided during
extreme weather conditions. Houses are well ventilated and mostly made up of pucca
walls with kutcha floor. Animals are stallfed. Berseem, oat and mustard are the green
fodder in rabi, and pearlmillet, sorghum and clusterbean in kharif. In lean season
Murrahs are maintained on wheat and pulse straws in conjunction with oilcakes and
other concentrates. Mostly, women are engaged in buffalo rearing (90%), and all the
activities pertaining to feeding, milking, cleaning, etc. are looked after by them. Calves
are not weaned. Very few farmers rear bulls exclusively for breeding purposes, other¬
wise males are used both for breeding as well as draught purposes. Natural service is
mostly practised in the field.

Physical Characteristics

Murrah animals are jet black and massive with long and deep body. Head of fe¬
males is short, fine and clear cut. Bulls are heavy and broad with prominent cushion of

BUFFALO BREEDS

191

Murrah bull

Murrah she buffalo

192

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

short and dense hair. Homs are short
and tightly curved in a spiral form. Eyes
are bright, active and prominent in fe¬
males but slightly shrunken in males.
Ears are short, thin and alert. Neck is
long and thin in females, and thick and
massive in males. Hips are broad.
Fore- and hind-quarters are drooping.
Tail is long reaching below the hock
up to fetlock and ending in a white
switch. Udder is capacious extending
from hind legs to just behind navel flap
with prominent milk-veins. Teats are
long and placed uniformly wide apart.
Hind teats are generally longer than the
fore ones.

Morphometric and Performance Traits
Averages of length, height and heart
girth of males are 150, 142 and 220 cm, respectively, and of females 148 (range 143 to
163), 133 (range 129 to 140) and 202 (range 197 to 220) cm respectively. Average
birth weight of male calves is 28 to 34 kg (average 3 1 .7 kg), and that of female calves
26 to 33 kg (average 30 kg). Overall weight at birth is 30.3 kg (range 26 to 34 kg).
Average body weight at first calving ranges from 470 to 520 kg. Adult body weight
ranges from 450 to 800 kg (average 567 kg ) in males and from 350 to 700 kg (average
516 kg) in females. Average age at first service is around 943.4 days (range 920 to
1,355 days), and average age at first calving is 1,319 days (range 1,214 to 1,647 days).
Total lactation milk yield, 305-day milk yield, lactation length and dry period average
1,678.4 kg ( range 904-2,041 kg), 1,675.1 kg (range 1,355 to 1,964 kg), 307.0 days
(range 254 to 373 days) and 187.6 days (range 145 to 274 days), respectively, in first
lactation; and 1,751.8 kg (range 1,003 to 2,057 kg), 1,660.1 kg (range 1,472 to 1,962
kg), 298.7 days (range 269-337 days) and 154.8 days (range 127-176 days), respec¬
tively, for overall lactations. On an average, milk contains about 7.3% fat (range 6.9 to
8.3%). Service period averages 177.1 days (range 141 to 281 days) in first parity and
1 36.3 days (range 1 25 to 1 87 days) in overall parities. First calving interval varies from
455 to 632 days (average 488.1 days), and overall calving interval varies from 430 to
604 days (average 452.9 days). Number of services per conception varies from 1 .75 to
2. 1 5 (average 1 .93). Murrah males are used extensively for draught and meat purposes.

BUFFALO BREEDS

193

Murrah herd

Breeding Farms

1 . Buffalo Breeding Centre, NDDB, Nekarikallu, Andhra Pradesh

2. Government Livestock Farm: Banavasi; Horesikullu; Karimnagar; Kakinada;
Mamnoor; Reddipalli; Visakhapatnam, Andhra Pradesh

3. Government of Assam: Barpeta; Berhampur; Guwahati; Jagdaur; Khanikar;
Pachmile; Silchar, Assam

4. Government of Bihar: Sairakela; Sepaya, Bihar

5. Government of Goa, Dhat

6. Amul Research and Development Association, Ode, Gujarat

7. Sabarmati Ashram Gaushala, Bidaj, Gujarat

8. Government Livestock Farm, Hisar, Haryana

9. Central Institute for Research on Buffaloes, Hisar, Haryana

1 0. Choudhary Charan Singh Haryana Agricultural University, Hisar, Haryana

1 1 . National Dairy Research Institute, Kamal, Haryana

12. Central Cattle Breeding and Research Farm, Beli-Charna, Jammu & Kashmir

13. National Dairy Research Institute, Southern Regional Station, Bangalore,
Karnataka

14. ' Government of Karnataka: Bankapur; Hessarghatta; Koila; Kurikuppi; Torongal

1 5 . Government of Kerala, Kodapanakunnu, Kerala

194

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

16. Kerala Livestock Development Board Ltd.: Dhoni; Kulathupuzha; Mattupetty;
Peermade

17. Government of Madhya Pradesh: Anjora, Durg; Kiratpur; Ratona

1 8. BAIF Development Research Foundation, Uruli-Kanchan, Maharashtra

19. Government of Punjab, Mattewara, Punjab

20. Punjab State Coop. Milk Producers’ Federation Ltd., Bhattian, Punjab

2 1 . Central Cattle Breeding Farm, Avadi, Chennai, Tamil Nadu

22. Agricultural College and Research Institute, Coimbatore, Tamil Nadu

23. Government of Tamil Nadu: Hosur; Ooty; Orthand; Pudukottai; Tirunelveli;
Chettinad

24. Government of Uttar Pradesh: Hastinapur; Lakhimpur; Manjhara; Neelgaon

25. Pradeshik Co-operation Dairy Federation, Moradabad, Uttar Pradesh

26. Government of West Bengal, Haringhatta, West Bengal

Contact Agencies

1 . Central Institute for Research on Buffaloes, Hisar, Haryana.

2. National Dairy Research Institute, Karnal, Haryana

3 . Department of Animal Husbandry, Haryana

4. Department of Animal Husbandry and Dairying, Ministry of Agriculture,
Government of India, New Delhi

BUFFALO BREEDS

195

NAGPURI

Synonyms: Berari, Ellichpuri, Gaulani, Gauli, Varadi
Origin and Distribution

The Nagpuri is a dual-purpose breed of buffaloes and is native to the Vidarbha region
of Maharashtra. This breed is commonly found in Nagpur and Wardha districts. This
breed has 4 distinct strains, viz. Pumathadi (Akola District), Ellichpuri (Amravati dis¬
trict), Gaulani (Wardha district) and Nagpuri (Nagpur district). All these strains are
commonly known as Nagpuri or Berari buffaloes. These buffaloes are used for heavy
draught purposes. Farmers of Vidarbha region prefer to maintain this breed mainly due
to its low maintenance cost, efficiency of feed conversion, moderate production and
better adaptation to local climatic conditions.

Location and Topography

The home tract of Nagpuri buffaloes lies between 19° 5 T and 22° 15 north latitude,
and 76° and 79° 2T east longitude.

Soil

Black or brown soil is mostly found
in this region. Hilly region has brown
soil mixed with sand.

Climate

The home tract is predominantly a
dry tract. Maximum temperature
reaches more than 44°C and minimum
temperature about 14°C. Winters are
comparatively mild. Annual rainfall is
about 95 cm.

Management Practices

Buffaloes and heifers are reared in
this area as source of extra income.

They are mainly reared for fat produc¬
tion. Regularity in breeding, high fat in
milk, resistance to diseases and adapta¬
tion to hot climate are some of the char¬
acteristics of this breed. Maintenance
cost is very low.

196

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Nagpuri bpll

Nagpuri she buffalo

BUFFALO BREEDS

197

Physical Characteristics

These are black-coloured animals
with white patches on face, legs and tail
tip. Puranthadi strain is slightly brown¬
ish with a predominant white patch on
forehead. Horns are long (50-65 cm),
flat, curved and carried back on side of
the neck nearly to shoulders. Horns of
this type have a distinct advantage in
that they help the animals to protect
themselves from wild animals while
moving through forests. Horns are
heavier in males than in females. Face
is long, thin and cone shaped with
straight nasal bone. Neck is somewhat
long. Brisket is heavy. Dewlap is ab¬
sent. Ears are medium in size with
pointed tips. Limbs are long and light.

Navel flap is mostly absent and even if
present, is very short. Tail is comparatively short in some buffaloes; it reaches below
the hock. Switch of the tail is white.

Morphometric and Performance Traits

Body length, height and heart girth average 180, 140 and 210 cm, respectively, in
males. In females, average body length ranges from 1 12 to 132 cm (average 129 cm),
height from 120 to 138 cm (average 123 cm), and heart girth from 160 to 200 cm (1 82
cm). Average birth weight of males is 29.0±0.32 and of females 28.1±0.14 kg (overall
average 28.6±0.27 kg). Adult body weight of Nagpuri buffaloes ranges from 340 to
400 kg. Some females even weigh more than 400 kg. Males weigh up to 520 kg.

Heifers mature late and average age at first calving is 1,672 days. Females are
fairly good milkers and produce about 780 to 1,520 kg of milk (average 1,055 kg).
Lactation length averages 286 days. Fat varies from 7.0 to 8.5%. Average service
period is about 116 days (range 34 to 435 days). Average dry period is 129.1±4.85
days. Intercalving period ranges from 350 to 721 days (average 430 days).

Breeding Farms

1 . Nagpur Veterinary College, Nagpur, Maharashtra
Contact agencies

1 . Department of Animal Husbandry, Nagpur, Maharashtra

2. Nagpur Veterinary College, Nagpur, Maharashtra

198

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

NILI-RAVI

Origin and Distribution

This breed is similar to Murrah in almost all respects except for some white markings
on extremities and walled eyes. Home tract lies in Pakistan. In India, these buffaloes
are found in Fazilka, Ferozepur, Jira and Makhu tehsils of Ferozepur district, and Patti
and Khemkaran tehsils of Amritsar district of Punjab. The breeding tract is spread all
along the Sutlej river on the Indo-Pak border. The name Nili is supposed to have
derived from the blue waters of the River Sutlej. Ravi buffaloes are mostly bred in
Pakistan around the River Ravi, after which they are named.

Before 1938, Nili and Ravi breeds of buffaloes were considered as in the milieu of
Murrah breed only, while at the First All-India Cattle Show held in that year they were
shown as separate. In the subsequent second and third shows, they were separately
distinguished and described as independent entities in 1952. Nili and Ravi were origi¬
nally two distinct breeds as they belonged to geographically isolated areas. Frequent
movement of animals with improvement in communication means has resulted in their

mixing. At present, it is very difficult
to find typical animals of either breed.
For this reason, they are generally clas¬
sified as Nili-Ravi and were shown as
one breed in 1960 All-India Cattle
Show.

The breeding tract has mixed type of
buffaloes and animals true to the breed
are very rare. Only 9.4% of the total
buffaloes in the breeding tract are of
Nili-Ravi breed. Ferozepur district con¬
sidered to be the home tract of Nili-
Ravi buffaloes has 53.1% buffaloes of
Murrah type and only 10.8% of Nili-
Ravi type. The percentage in Amritsar
district is 18.7 and 8.7 respectively.

Location and Topography
The breeding tract lies between 74°04'
and 75° east longitude, and 30°25' and
31°25' and 3 1°1 O' north latitude.

Soil

Sandy loam and loam soils are pre-

Breeding tract

BUFFALO BREEDS

199

Nili-Ravi bull

Nili-Ravi she buffalo

200

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Management Practices
Most of the farmers (97.6%) tie their
buffaloes all the time. Animal houses
though separate are located in the same
premises as the residence of the farmer
in most of the cases (85.6%). Ani¬
mal houses are usually open (56.9%),
made up of mud (48.8%) and bricks
(46.5%), full walled (54.3%), and have
mud floor (66.4%). These are well ventilated (91%) and clean (88%). Drainage is
provided in 5 1% of the houses. Most of the farmers grow fodder (73%) for feeding to
their animals and on an average a farmer has 0.50 ha of land under fodder production.
Most of the farmers chaff the fodder and feed the animals ingroups. Natural service
is mostly practised (67%).

Nili-Ravi calf

dominant in this area. Irrigation net¬
work through canals and tubewells is
well developed.

Climate

Climate is hot and dry for most parts
of the year. Summers are very hot while
winters are very cold. Rainfall is re¬
stricted mainly to July and August.

Physical Characteristics

Skin and hair are normally black-brown; fawn and grey animals are not uncom¬
mon. They are usually wall eyed and have white markings on forehead, face, muzzle,
legs and tail. The most desired character of the female is the possession of white mark¬
ings known as ‘Panch Kalyani’. Typical animals are rarely found these days. Most of
the animals have white markings on hind legs but not on forelegs. Moustache is white.

Nili-Ravi buffaloes are of medium size, and have deep and low-set frames. Head is
elongated, bulging at top and is depressed between eyes.

Muzzle is fine but with wide nostrils. Double chin is conspicuous. Homs are
small, tightly curled and circular in cross-section. Neck is long, thin and fine. Rump is
broad, long and slightly sloping. Pin bones are prominent and set well apart. Tail is
thick at the base, gradually tapers toward the end and extends below hocks with a white
switch. Udder is well-shaped, capacious and extends well forward up to navel flap.
Teats are long and centrally placed. Milk-veins are prominent, long and tortuous.

BUFFALO BREEDS

201

Morphometric and Performance Traits

Average body length, height and heart girth are 160, 140 and 230 cm, respectively,
in Nili-Ravi males, and 165.4, 134.2 and 207.7 cm, respectively, in females. Birth
weight ranges from 27 to 39 kg (average 35 kg). Adult weight is about 567 and 454 kg
in males and females respectively.

Average age at first conception is 1,125.05±37.12 days. Average age at first calv¬
ing is 1,359 days (range 1,216 and 1,617 days). First lactation milk yield, pooled lacta¬
tion milk yield and 305-day milk yield average about 1,483, 1,850 and 1,820 kg respec¬
tively. Average lactation length is about 294 days (range 263 to 3 1 6 days). Fat content
varies from 5.1 to 8% (average 6.8%). Dry period is about 151 days (range 1 15 to 202
days) and service period about 202 days (range 169 to 290 days). Average first calving
interval is 520.50±2.58 days and overall calving interval about 488 days (range 3 13 to
945 days). Average number of services per conception is 2.38.

Breeding Farms

1 . Buffalo Breeding Centre, NDDB, Nekarikallu, Andhra Pradesh

2. Central Institute for Research on Buffaloes, Nabha Campus, Nabha, Punjab

3. Government of Punjab, Mattewara

4. Military Dairy Farm, Ferozepur, Punjab

5. Punjab Agricultural University, Ludhiana, Punjab

6. Punjab State Co-operative Milk Producers’ Fedaration, Bhattian, Punjab

Contact Agencies

1 . Central Institute for Research on Buffaloes, Hisar, Haryana

2. Department of Animal Husbandry, Punjab

202

ANIMAL GENETIC RESOURCES OE INDIA - CATTLE AND BUFFALO

PANDHARPURI

Synonyms: Dharwari
Origin and Distribution

The Pandharpuri buffalo is a native of Kolhapur, Solapur, Sangli and Satara districts in
south Maharashtra. These buffaloes are named after the name of the geographical area,
i.e. Pandharpur block in Solapur district. It is hardy and well suited to dry conditions in
this area. Today, there are approximately 0.19 million Pandharpuri buffaloes. These
buffaloes are concentrated in Pandharpur, North Solapur, South Solapur, Barshi,
Akkalkot, Sangola and Mangalvedhatehsils of Solapur district; Miraj, Walwa, Jath and
Tasgaon tehsils of Sangli district; and Karveer, Shirol, Panhala, Radhanagri,
Hatkanangale and Gadhinglaj tehsils of Kolhapur district. These buffaloes are also found
in adjoining Belgaum district of Karnataka. Communities like Gawali and Joshi are
local breeders. They maintain these buffaloes.

Breeding tract

Location and Topography

The breeding tract is a sub-montane
zone. It lies between 70°25' and 76°24'
east longitude, and between 16° and
22°2' north latitude. The average alti¬
tude of the area is 1,700 to 2,000 m
above msl.

Soil

Soil type is deep rich loam having
black to deep black hue in some parts
and light shallow in other parts. Black
soil is good for cotton, and light soil
mixed with gravels for millets, ground¬
nut and sorghum.

Climate

Mean maximum temperature varies
between 25° and 37°C, and mean mini¬
mum temperature between 11° and
22°C. There are rains for about 74 days
in a year and annual rainfall is about
150 cm. Average wind velocity is about
6.8 km/hr (range 2 km/hr in December

BUFFALO BREEDS

203

Pandharpuri bull

Pandharpuri she buffalo

204

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

to 1 7 km/hr in July). Average duration of sunshine is 7.8 hr/day. Mean relative humid¬
ity is 85% in the morning and 50% in the evening.

Management Practices

Animals are usually housed in the open close to human dwellings. In the Kolhapur
area, some farmers provide conventional sheds/bams for housing buffaloes. These are
either part of residence or are separately constructed. Thatched sheds with sugarcane
trash roofs and temporary field shelters are sometimes found. Floor is generally un¬
even and kutcha without any drainage facilities. Natural service is practised for
breeding as semen of Pandharpur bulls is not available. Weaning is practised in
cities but not in rural areas. Milk let-down is not a problem. Farmers take animals to
customers’ doors and supply milk as per requirement. This act is repeated several
times in mornings and evenings for each animal. This unique behaviour of the breed is
in total variance with the physiology of let down of milk based on release of oxytoxin
and completion of milking within 6 to 8 minutes. In many animals, milking is contin¬
ued even for 30 to 40 animals at regular interval. Calves are weaned by a large number
of farmers, particularly in urban areas, within 24 to 48 hours. Knuckling method is
usually followed for milking. Complete udders are rarely washed but teats are usually
washed before milking.

Paddy straw, sorghum straw (jowar kadbi ), dry mixed grasses, green grasses, sug¬
arcane leaves and sugarcane tops are mainly used as fodder. Maize, sorghum, napier
grass, etc. are grown on a very small scale as cultivated fodder crops. Concentrate
mixture is prepared from wheat bran, rice husk, crushed maize grains, pulse chunnis,
groundnut-cake and safflower-cake. Concentrates around 2.5 to 3 kg are usually soaked
and fed at the time of milking. Normally herd size in cities is around 1 5 to 20 buffaloes
and in rural areas around 3 to 4.

Physical Characteristics

The Pandharpuri buffalo is a medium-sized animal with long narrow face. Skin
colour is usually black but it varies from light black to deep black. White markings are
also found on the forehead, legs and tail in a few cases. Frontal bone is comparatively
long and straight. Nasal bone is very prominent, long and straight. Horns are very long
extending beyond shoulder blade, sometimes up to pin bones and are of three types: (i)
bharkand (53%) curving backward and usually twisted; (ii) toki (36%) curving back¬
ward, upward and usually twisted outwards; and (iii) meti (11%) long, flat, running
downward from sides of head and usually twisted. Neck is long and thin. Switch of the
tail is white in majority of animals and extends just below the hock. Hooves are usually
black. Hook bones are prominent and well placed. Legs are long and straight. Udder is
of medium size, compact, somewhat hidden in between hind-quarters with firm attach¬
ment. Shape of udder is mostly trough (41%) followed by bowl (31%) and round
(17%) shape. Udder texture is smooth and collapsible. Teats are cylindrical and squarely

BUFFALO BREEDS

205

Pandharpuri herd

placed. Mostly teat tips are rounded and sometimes pointed. Milk-vein is prominent.
Animals are mild in temperament and easily manageable.

Morphometric and Performance Traits

Averages of body length, height and heart girth of Pandharpuri females are 132.9,
130 and 192.8 cm respectively. Male and female calves weigh 28+0.91 and 25.6+0.74
kg respectively. Overall birth weight is around 26.8 kg. Adult body weight of Pandharpuri
females is around 416 kg. Average weight at puberty is 260 kg and at first conception
304 kg.

Pandharpuri buffaloes produce, on an average, 1,502 kg of milk in a lactation pe¬
riod of 330 days. Total lactation and 305-day milk yield average 1,197 and 1,142 kg,
respectively, in first lactation. Milk contains about 7% fat and 9.28% SNF. These
buffaloes have high reproductive efficiency and low feed intake. Averages of age at
puberty, age at first conception, age at first calving, dry period, service period and
intercalving period are 795, 945, 1,255, 144, 165 and 465 days respectively.

Breeding Farms

1 . Zonal Agricultural Research Station, Kolhapur, Maharashtra
Contact Agencies

1 . Department of Animal Husbandry, Maharashtra

2. Mahatama Phule Krishi Vidyapeeth, Rahuri, Maharashtra

206

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

SURTI

Synonyms: Charotar, Deccani, Gujarati, Nadiadi, Surati and Talabda
Origin and Distribution

The home tract of Surti buffaloes is in the southwestern part of Gujarat comprising
Kheda, Vadodara, Bharuch and Surat districts. The Surti buffalo is lighter in body
weight, as compared to heavy breeds, consumes less feed, thrives well both on stovers
and on limited or no green fodder, and produces milk with high fat and SNF content. It
is popular with landless, small and marginal farmery.

The development of Surti breed received a major boost with the establishment of a
Central Breeding Farm at Dhamrod in Surat district of Gujarat state in November 1968.
The main focus of this farm is on genetic improvement of Surti buffaloes for milk
production; testing bulls to make available proven sires and their distribution for breed¬
ing in the field; and production, storage and distribution of semen of proven sires.

The Indian Council of Agricultural Research initiated the All-India Co-ordinated

Research Project on Buffaloes in 1970-
7 1 , and Vallabhnagar and Dharwar cen¬
tres were identified for medium sized
breeds, viz. Surti and Mehsana. Field
units were also attached to these cen¬
tres during the V Five-Year Plan. The
emphasis was on production of supe¬
rior sires through progeny testing by in¬
cluding both farm and field animals. In
addition to this, a Reproductive Biol¬
ogy Research Unit was started during
1976 at the Gujarat Agricultural Uni¬
versity, Anand, Gujarat, to study the en¬
docrinological aspects of Surti buffa¬
loes.

Location and Topography
The breeding tract is located between
21° 12' and 23° 15' north latitude, and
between 72° and 74° east longitude.

Soil

The breeding tract has a sandy loam
type soil. Rice, maize, pearlmillet, tob-

BUFFALO BREEDS

207

Surti bull

Surti she buffalo

208

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

acco, cotton and groundnut are the
major crops of this area.

Climate

Maximum temperature varies from
28° to 41 °C and minimum temperature
from 8.8° to 26°C. Annual rainfall is
about 80 cm. Relative humidity varies
from 58 to 92% in the morning and
from 21 to 78% in the evening. Aver¬
age wind speed is about 5.5 km/hr and
average sunshine is 8.5 hr/day.

Management Practices
Majority of farmers maintain mixed
herds of buffaloes and cows. Animal
shed is mostly a part of human resi¬
dence but some farmers provide sepa-
Surticalf rate house for these animals. About

50% of animal houses are of open type and the remaining 50% closed ones. Almost all
houses have kutcha walls. Wallowing is practised only in 10% cases. As the perfor¬
mance is not recorded in the field except in certain villages around Anand, farmers by
their experience have developed some techniques for selection of buffaloes. In the
Surti breeding tract, buffaloes having bigger area of chehra (area between two pin-
bones and hook bones) and medium soft skin are preferred over others.

Physical Characteristics

Coat colour of Surti buffaloes varies from rusty brown to silver-grey. Skin is
black or brown. Animals are of medium size, having a straight back. Head is elon¬
gated, fairly broad and rounded (convex) between horns. Homs are flat, of medium
length, sickle shaped and are directed downward and backward, and then turn upward
at the tip to form a hook. Face is clean and sharply narrowed below eyes, with big
nostrils and muzzle. Eyes are round and bulging. Ears are medium sized with reddish
colour inside. Neck is long in females, and thick and heavy in males with white collar.
There are two white bands (Chevron) below the neck. Udder is well developed, finely
shaped and squarely placed between hind legs. Teats are of medium size and squarely
placed. Tail is fairly long, thin and flexible ending in a white tuft.

Morphometric and Performance Traits

Average body length, height and heart girth are 142, 130 and 190 cm, respectively,

BUFFALO BREEDS

209

in males, and 119, 125 and 184 cm, respectively, in females. Average birth weight of
calves ranges from 24 to 30 kg for males and from 23 to 29 kg in females (overall
average 25.2 kg). Weight at first calving is around 3 80 kg (range 3 1 5 to 4 1 5 kg). Adult
body weight is around 500 kg in males and 383 kg in females. Age at first service is
around 750 days (range 485 to 970 days). Average age at first calving is around 1,693
days (range 1,050 to 1,770 days). Total lactation milk yield and 305-day milk yield
average 1,396.5 (range 1,208 to 2,203) and 1,065.3 (range 997 to 1,363) kg, respec¬
tively, in first lactation, and 1,285.4 (range 1,256 to 2,208) and 1,289.5 (range 1,1 10 to
1,292) kg, respectively, in overall lactations. Lactation length, dry period, service pe¬
riod and calving interval are 352.2 (range 280 to 373), 242.1 (range 212 to 289), 249.6
(range 92 to 316) and 584.6 (range 482 to 630) days, respectively, in first parity, and
344.7 (range 280 to 405), 185 (range 160 to 205), 142.6 (range 93 to 164) and 534.7
(range 430 to 564) days, respectively, in overall lactations. Number of services per
conception ranges from 1 .5 to 3.0 ( average 2.8). Fat ranges from 7.5 to 8.3% which is
slightly higher than that of other breeds mainly because of high proportion of fodder in
the feed.

Breeding Farms

1 . Buffalo Breeding Centre, NDDB, Nekarikallu, Andhra Pradesh

2. Government of Goa, Dhat

3. Central Cattle Breeding Farm, Dhamrod, Gujarat

4. Gujarat Agricultural University, Anand, Gujarat

5. Kaira District Co-operative Milk Producers’ Union, Anand, Gujarat

6. Sabarmati Ashram Gaushala, Bidaj, Gujarat

7. Amul Research & Development Association, Ode, Gujarat

8. National Dairy Research Institute, Southern Regional Station, Bangalore,
Karnataka

9. University of Agricultural Sciences, Dharwad, Karnataka

10. Buffalo Breeding Station, Tegur, Karnataka

1 1 . Buffalo Breeding Farm, Thiruvazhun, Kerala

1 2 . Government of Kerala, Kodapanakunnu

13. BAIF Development Research Foundation, Uruli Kanchan, Maharashtra

14. Cattle Breeding Farm, Hingoli, Maharashtra

Contact Agencies

1 . University of Agricultural Sciences, Dharwad, Karnataka

2. Gujarat Agricultural University, Anand, Gujarat

3. Department of Animal Husbandry, Gujarat

4. Department of Animal Husbandry & Dairying, Ministry of Agriculture,
Government of India, New Delhi

210

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

TODA

Origin and Distribution

The Toda breed is known after its herdsmen, the Toda tribe of the Nilgiris. The native
tract of these is the Nilgiris district of Tamil Nadu. Probably, due to genetic isolation,
they developed into a fine breed of animals which could withstand the extreme climatic
variations prevailing in the region. This is one of the important breeds of buffaloes
other than Kaziranga buffaloes of Assam which thrives well in the high rainfall and
high humid areas. The breed has attained pre-eminence not because of its milk produc¬
ing capacity, but because of its association with all the cultural (ritual) activities of the
Toda tribe. The Todas are responsible for the development of this breed from its origi¬
nal form to its present state. Other communities of the district, especially the Badagas,
Kotas and Irulas who have been herding these buffaloes for several centuries, were also
responsible for the development of this breed. Earlier it was thought that Toda buffa¬

loes were of swamp type but karyological
type.

Breeding tract

studies have established that they are of river

Toda buffalo herds are distributed in
all the 4 taluks of the Nilgiris, viz.
Udhagamandalam, Gudalur, Coonoor
and Kotagiri. Their distribution is un¬
even with varying densities. Herds
maintained by Toda tribes are located
mostly in the ‘Wenlock downs’, an
area of about 50 km2 of grassland lying
immediately west of Udhagamandalam.
A few herds owned by Kota tribes are
also located in the Toda mainland. Sev¬
eral herds maintained by non-Todas are
clustered around the Masinagudi area
of Gudalur taluk.

The total population of Toda buffa¬
loes, surveyed as in May 1994, was
3,531-1,955 adult females, 12 males,
74 male and 621 female young stock,
and 869 calves (321 males and 548
females). Todas herded 52% of Toda
buffaloes and non-Todas the remaining.
Average herd size in the Toda hamlets
is 34 as compared to 16 buffaloes in
non-Todas. Overall herd size is 22.

BUFFALO BREEDS

211

Toda bull

Toda she buffalc

212

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

Toda calf (fawn)

Location and Topography

TheNilgiri district is the smallest dis¬
trict of Tamil Nadu. It is spread over
an area of 2,545.5 km2 and is located
between latitudes 1 1 0 1 5' and 11°30'
north, and longitudes 76° 15' and 77°
east. The entire district is hilly, with
an average elevation of 1,83 1 m rang¬
ing from 668 to 2,634 m above msl.

Soil

The predominant soil type in the pla¬
teau of the hilly terrrain is laterite de¬
rived from chamockites. The surface
is generally covered by a layer of clayey
soil. Soil is moderately fine textured
ranging from clay loam to silty clay
loam and silt loam. Water-holding ca¬
pacity of soils is 50 to 60%. The pH of
soil is between 4.5 and 5.9.

Climate

The Nilgiris is a high rainfall, high al¬
titude region. Mean annual rainfall is
84 to 148 cm. Mean maximum tem¬
perature is 18.8° to 19.4°C and mini¬
mum 10.2° to 10.8°C. Average rela¬
tive humidity is 8 1 .5 and 67.9 % in the
morning and evening, respectively. Av¬
erage wind velocity is 4.4 km/hr (range
1.3 to 6.9 km/hr).

Management Practices

Calves and adults thrive solely on
grazing. No supplementary feed is
given. Normally, young calves were
left out for grazing 3 weeks after birth.
They are grazed in the vicinity of the
hamlet and are not allowed to mingle
with adults for the first 3 to 4 months

Toda calf (grey)

BUFFALO BREEDS

213

to prevent them from sucking. Usually
young calves are led to grasslands a
little later in the day. Adults are let out
for grazing around 8 am after milking.

When calves are young, adults return
to the hamlet by themselves for the
evening milking. The grasslands of the
‘Wenlock downs’ predominantly con¬
sist of kikiyu grass ( Pennisetum
clandestinum) interspersed with white
clover ( Trifolium repens ) and hariyali
grass ( Cynodon dactyl on). Other wild
grasses and weeds include Oxalis
corniculata, Amaranthus paniculatus,

Centella asiatica, Sonchus branchyotus,

Embelia gardeneria, Briza minor,

Cotula australis and Pteridium
aquilinum. Fodder trees in the region
are Acacia melanoxylon, Dendrocala-
mus str ictus and Celtis sp. Young ones are sheltered in calf pens constructed as tempo¬
rary structures using wooden stalks for the side walls and roof. The rest are normally
kept in an open pen during the night, but occassionally in a circular enclosure of uneven
floor with unhygienic conditions without roof.

Toda buffaloes, maintained for years in the remote northeastern borders of the dis¬
trict where summer temperature exceeds 30° C, shed their body coat and take to wal¬
lowing in summer, whereas buffaloes dwelling continuously in hills grow thick hair on
their body. Wallowing is not normally observed in these buffaloes; occasionally they
submerge themselves in small puddles in marshy areas. These changes in Toda buffa¬
loes (growth or loss of hair coat and wallowing) appear to be transitory and habitat
related and not a permanent one.

Physical Characteristics

Coat colour of the calf is generally fawn at birth. Other coat colour variations are
grey, light grey (cream) and dark grey (blackish-grey). In growing calves, at about 2
months, the fawn colour changes to ash-grey. The change in colour starts at the skin
end of the hair and continues in the direction of the free end. In adult cows, the pre¬
dominant coat colours are fawn and ash-grey. A few cream-coloured animals are also
seen. Face, neck and anterior half of the body of adult cows are thickly covered with
hair. In the posterior half hair are sparcely distributed. A narrow band of dense hair
covers the topline from the crest of neck to the point of origin of tail. This band consists

Toda calf (cream)

214

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

of black hair or an admixture of brown and black hair in most calves with fawn coat.
Cream to dull white hair cover belly, groin, inside of thigh and leg regions. Occa¬
sionally a band of white or brown hair fully encircle the leg forming a ring in the pas¬
tern. In ash-grey adult females, head and face are darker in shade and in males it is still
darker. In some animals two characteristic chevron markings are present, varying from
dull white to brown- one just around the jowl and the other anterior to the brisket.

Toda buffaloes are medium sized. Body is fairly long with a broad and deep chest.
Head is large and heavy, and carried to the level of the body. Forehead is broad, convex
in calves and concave in adults. There is no hump. Ears are held horizontally. Muzzle
and eyelids are black.

Homs are long (55 to 70 cm), variable in shape, and of slate colour. They are
usually set wide apart, outward, slightly downward and upward with the points being
recurved inward, forming characteristically a cresent shape or semicircle. Distance
between horns at mid point is approximately 52 to 65 cm, and between tips 39 to 53
cm. Homs are thick at the base (20-21 cm), and tapering and sharp at the tip (3.6 to 4.0
cm). They are marked by concentric rings, running across them. In old females and
males, these rings when viewed from the front appear as distinct pockets of depres¬
sions.

Legs are short, strong and sturdy. Hooves are black. Dewlap is absent. Navel
sheath is small. Penis sheath flap is medium sized. Tail is long (70 to 75 cm) and slim,

Toda herd

BUFFALO BREEDS

215

extending beyond hock joint. Switch is black. Udder is not so prominent and is round.
Teats are cylindrical and round at tip. Milk-vein is not prominent.

Morphometric and Performance Traits

Average body length, height at withers, chest girth, face length, face width and ear
length ofToda buffalo cows measure 132.7±0.08, 121.8±0.56, 180.4±1.14, 40.79±0.34,
22.12±0.16 and 20.98±0.16 cm respectively. Average skin thickness is 7.53±0.18 mm.
Mean birth weight ofToda buffalo calves is 27.9±0.43 kg. Birth weight of male and
female calves is almost the same (27.9 vs 28.0 kg). Mean body weight at 6 months of
age is 65.67±3.84 kg and at 9 months 67.00 kg.

Age at first calving varies from 1 ,200 to 1 ,400 days. Toda buffaloes produce around
500 kg of milk in a lactation of about 200 days. The mean fat is 8.22±0.08% and
protein 4.45±0.12%. Calving interval is around 480 days (range 425 to 550 days). Av¬
erage carcass weight was 27.17±3.94 kg in calves, 50.83±6.83 kg at 1.5 to 2 years,
69.00±7.50 kg at 2.5 to 3 years, and 1 42. 1 3±1 0.10 kg in adults.

Contact Agencies

1 . Tamil Nadu Veterinary and Animal Science University, Chennai, Tamil Nadu

2. Department of Animal Husbandry, Tamil Nadu

□

LESSER KNOWN STRAINS

India had about 204 million cattle and 84 million buffalo population during 1992. Only
20% of these animals have been classified as recognized breeds and the rest are gener¬
ally called non-descript. Thus almost 80% of the animals have either not been evalu¬
ated properly and assigned to a specific breed or their characteristics have not been
fixed to qualify for a breed. Majority of these animals play an important role in the
economy of the region in which they are present. These animals are known by some
names in their breeding tract. They may be strains/types of the already described breeds
but now are known by different names possibly because of slight variation in physical
characters due to their adaptation to a particular agro-climatic region. Most of these
animals are known after the name of the region in which they are reared. Some of the
strains have been synthesized by crossing indigenous animals with exotic breeds. These
are mostly known by the combination of names of the place of their origin and the
breeds involved in their formation. Some of these find their names in literature but
overall very little documentation is available on the characteristics of these strains/
types. These lesser known breeds are described in the following pages.

CATTLE

Sporadic information on the various lesser known breeds have been available in the
literature in different parts of the country. Some strains of cattle which are not recog¬
nized as breeds have been reported by Maule (1990), Mason (1996), and Payne and
Hodges (1997).

Alambadi

Alambadi bulls are dark grey, almost black and cows grey or white (broken coloured).
They have the typical backward curving horns of Mysore type cattle. They are active,
useful draught animals but not fast trotters. Cows are poor milkers. This type of ani¬
mals are used for draught purposes. They are found in hilly areas of Coimbatore dis¬
trict in Tamil Nadu and in Bangalore district in Karnataka State. Alambadi animals
resemble Hallikar breed and seem to have originated from the latter.

Bengali

These are small cattle found in West Bengal, India and Bangladesh. Bengali is also

LESSER KNOWN STRAINS

217

known by the name Chittagong Red in Bangladesh.

Binjharpuri

Binjharpuri cattle have been evolved after 6 generations of upgradation of local
cows with Hariana bulls and are distributed in Jajpur sub-division of Cuttack district of
Orissa (Sahoo and Mishra, 1990). The climate in the breeding tract is hot and humid.
Temperature ranges from 13.8° to 41 ,5°C. Average relative humidity varies from 74 to
80% and rainfall from 2 to 27 cm. These cattle constitute about 27% of the total cattle
population of Cuttack district. Binjharpuri cattle are grazed along the river and canal
sides. They are tied in the open at night. Thatched housing is provided only during
rainy season and adverse weather conditions. Concentrate is fed only to milch cows
and bullocks.

Body is more or less proportionate and compact, and it is moderately long with a
graceful appearance. Adult cows are whitish to grey, while bullocks and bulls show
dark colour around their eyes and in the region of face, neck, hump and quarters. Calves
at heel are white with reddish colour in polar and forehead region. In some calves, the
red colour extends along the top line from the poll to base of the tail. However, with
increase in age the body colour changes from white to whitish grey and the red colour
disappears completely. Head is medium and is carried high. Face is moderately long
and narrow with flat to slightly dished forehead. Horns are broad at the base and short
at early age. Adult animals have medium to large horns which are broader at the base,
tapering outward, upward and slightly inward at the tip. Crest bone at pole is small and
not prominent. Ears are medium, sharp and slightly pendulous. Muzzle is black with
pinkish patch at the centre or at its lower region towards the upper jaw. Neck is thin and
somewhat long. Dewlap is of medium size and slightly pendulous. Hump in cows is
medium, being large and massive in the bull. Sheath is short, navel flap is absent. Legs
are moderately long and lean. Pin bones are prominent and wide apart in female but
relatively close in male. Tail is long, thin and tapering, reaching slightly above the
hock with completely black switch extending well below the hock. Frequently the
black switch has an admixture of white and brown hair (Sahoo and Mishra, 1990).

Average birth weight is 1 8.23±0.36 kg in male calves and 14.68±0.34 kg in female
calves. Average adult body weight is 402.9±2.82 kg in males, and 334.0±4.07 kg in
females. Average body length, height and heart girth are 146.5±0.67, 137.9±.02 and
172.5±0.58 cm, respectively, in males, and 130.3±7.90, 133.7±4.78 and 144.8±7.70
cm, respectively, in females (Sahoo and Mishra, 1990).

Binjharpuri cattle are reared for their draught capacity. A pair of Binjharpuri bul¬
locks weighing 645.65±1 1 .04 kg and working @ 8 hours a day ploughed 4,469.67±69.37
m2 with a ploughing capacity of 599.43% in terms of their body weight. They pulled a
total load (cart + load) of 2,279.16±19.90 and 1,395.83±17.90 kg with a carting capac¬
ity of 305.66 and 187.19 % of their body weights with a speed of 6,125.00±132.22 and

218

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

3,729. 17±1 1 1.37 m/hr in plain pucca and undulated kutcha roads respectively (Sahoo
and Mishra, 1990).

Frieswal

This strain has been developed at military dairy farms by crossing the exotic Frie¬
sian with indigenous Sahiwal and maintaining the exotic inheritance at 3/8 to 5/8 level.
The total strength of Frieswal female cattle at various miliary farms is around 5,000
with 1,200 breedable females.

Animals of this breed are mostly black and white or brown and white. In very few
cases total brown to black individuals are found. Muzzle is black. Face is slightly con¬
vex. Body is deep having clear wedges as dairy character. Hump is almost absent.
Dewlap is small and thin. Navel flap is also very small. Udder is very well developed
with firm attachments and is above the hock. Sheath is small and tight in males. Teats
are small and cylindrical. Tail switch is white or black.

Age at first calving, service period and calving interval average 923.8, 169.2 and
443.8 days respectively. First lactation milk yield, overall lactation milk yield, lacta¬
tion length and dry period average 2,926.4 kg, 3,323.3 kg, 340.9 days and 122.3 days
respectively.

Ghumsuri

Ghumsuri cattle are distributed in Ghumsur sub-division of Cuttack district in Orissa.
The temperature in the breeding tract varies from 15° to 35°C, humidity from 73 to
81% and rainfall from 20 to 86 cm. Almost all cattle in this tract belong to Ghumsuri
type. These cattle are reared on grazing alone, and are fed paddy straw and green grass
in rainy season when they cannot go out for grazing. Animals are kept in the open or
under tree shade for most part of the year. These cattle are used for draught purposes.

Cows are silver-grey in colour, bullocks are white and bulls are silver-grey with
dark colour from hump through neck to head region. Calves at birth are white in colour
changing to silver-grey with age. Head is small, with forehead being flat, broad and
depressed in between the eyes. Neck, particularly of bullock, is moderately thick and
muscular and somewhat long and lean. Muzzle and hooves are deep black. Homs are
medium in size, emerging from the poll, coming upward and inward on either sides.
Ears are medium in size and tubular in shape. Dewlap is thin and short. Skin, sheath
and navel flap are tight. Fore- and hind- quarters, particularly of bullocks, are medium
in size and well proportioned with strong knee, hock, fetlock and pastern joints with
rounded hooves. Udder, teats and milk-vein are ill developed (Sahoo and Mishra, 1989).

A pair of bullocks weighing 432.5 kg and working @ 8 hours a day ploughed
3,879. 1 7±76,73 m2 with an efficiency of 897.00% of their body weight, and pulled cart
loads of 1,125.00±167 and 789.28±12.87 kg, i.e. 260.11 and 182.56% of their body

LESSER KNOWN STRAINS

219

, %

. r ' v

1 Alsmbadi

2 Bengali

3 Binjharpuni

4 Privswiil

5 (ihyimiir)

6 Jetlicut

7 Jers>iwih

ft Kiiiau rite- »

9 Karan
to Ktimaum

11 Ladakhi

12 Mifnad Gtdda

13 Mampan

14 r<lr>fta|Mf t
1*t IMbiit

16 Purm-a

1? Shahlnid*

1 0n * t ii ?i it ih jy* i ' ■

1»* Litas

-at

Distribution of lesser known cattle strains

220

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

weights, in plain pucca and undulated kutcha roads with a speed of 5.348±0.656 km/hr
respectively (Sahoo and Mishra, 1989).

Jellicut

These animals are found around Chennai, South India and are of little importance.
The population is very small and no information on their production performance is
reported in the literature.

Jersind

This name was given in the 1950s to a cross between the exotic Jersey and the
indigenous Red Sindhi, made at the Allahabad Agricultural Institute, Naini, Uttar Pradesh.
At that time these crossbred cows gave substantially more milk than the indigenous
Red Sindhi and showed promise of becoming a useful dairy breed. First lactation milk
yield of Jersind cows varied from 1,377 to 1,894 kg and lactation length from 338 to
491 days (Prasad and Pereira, 1985). However, the numbers involved were probably
too few to consolidate the early success, and there has been little or no recent informa¬
tion about the Jersind. This crossbred could never get established. They have almost
come under threatened category.

Karan Fries

The Karan Fries is a dairy type animal developed at the National Dairy Research
Institute, Karnal, by crossing the exotic Friesian with Tharparkar breed. The strain is
similar to Frieswal but Tharparkar is the zebu breed in this case instead of Sahiwal.

Animals of this breed are black and white or dark brown and white. A few animals
have complete black or brown colour. Muzzle is black. Ears are short. Head is straight.
Forehead is flat. Eyes are full. Body is deep with wide rib cage. Rump is wide. Dewlap
is small. Udder is well developed with centrally placed teats. Teats are medium in size.
Tail switch is either black or white.

Average birth weight is 29.5±0.52 kg (range 13 to 41 kg) for males and 26.3±0.64
(range 7 to 42 kg) for females. Adult body weight is 696. 5±1 9.52 kg (range 600 to 960
kg) in males and 420.2±4.62 kg (range 300 to 600 kg) in females. Average body length,
height and heart girth are 149.7±0.51 (range 126 to 181), 139.0±0.32 (range 115 to
144) and 181.1±0.70 (range 153 to 209) cm, respectively, in cows.

Average age at first calving, service period and calving interval are 1,039.9 (range
745 to 1,462), 143 (range 42 to 389) and 398.5 (range 1 1 1 to 579) days respectively.
First lactation milk yield, lactation milk yield, lactation length and dry period average
3,547.4 kg, 3,873.7 kg, 310.8 days and 74 days respectively.

Karan Swiss

This is another dairy type crossbred strain developed at the National Dairy Re¬
search Institute, Karnal, using the exotic Brown Swiss semen on Sahiwal and Red Sindhi

LESSER KNOWN STRAINS

221

Karan Fries cow

Karan Swiss cow

222

ANIMAL GENETIC RESOURCES OE INDIA - CATTLE AND BUFFALO

cows. The exotic inheritance has been maintained around 50%. Animals of this strain
vary from light grey to deep brown. Face is flat or slightly concave. A white band is
present on muzzle and upper eyelid. Eyes are full, and ears are small and hairy from
inside. Barrel is long and deep. Navel flap is generally tight. Hip-bones and pin-bones
are wide apart. Rump is long. Tail is below the hock and sometimes touches the ground.
Skin is tight with fine hair coat. In males sheath is tight and rudimentary teats are
common. Udder is deep and wide, bowl shaped; teats are medium sized, cylindrical
with round or pointed tips. Milk-vein is very well developed.

Birth weight varies from 15 to 49 kg averaging 37.6±0.66 in males and 30.4±0.56
kg in females. Adult weight is 720±45.83 kg (range 630 to 740 kg) and 429.8±16.77 kg
(range 250 to 570 kg) in males and females respectively. Averages of body length,
height and heart girth are 148.9±0.9, 127.2±0.5 and 175.8±0.9 cm, respectively, in fe¬
males, and 151.3±4.3, 136.8±2.7 and 189.8±4.1 cm, respectively, in males. Age at first
calving, service period, calving interval and number of services/conception average
949.1 days, 104.6±3.3 days, 404 days and 1.8±0.1 respectively. First lactation milk
yield, lactation milk yield, lactation length and dry period are 2,860 kg, 3,228 kg, 325
days and 75 days respectively.

Kumauni

These are small cattle with a compact body and powerful short limbs. Coat colour
is jet black, or pale to dark red with white patches. Head is long and horns are short.
These cattle have been named after their habitat, i.e. Kumaun hills of northern Uttar
Pradesh. Climate in the breeding tract is sub-tropical. Hump is almost cervico-thoracic
in position. As the hump is almost cervico-thoracic in position and blood group studies
suggest a different origin (Singh, 1945) from other Indian breeds, these cattle might
have evolved from crossbreds. Kumauni cattle are poor milkers and are used for work
and production of manure.

Ladakhi

A local variety of the Indian hill cattle found in the Ladakh region of Jammu &
Kashmir. No information on their production performance has been reported in the
literature.

Malnad Gidda

Cattle found in coastal areas and Malnad district bordering the coastal area in
Karnataka state are known as Malnad Giddas. These cattle cannot be classified into
any breed. Majority of them have dark coat. They are small in size but have extraordi¬
nary power of endurance for climatic variation and are resistant to many diseases. These
cows calve for the first time at about 39 months of age. Malnad Gidda cows produce
about 21 8 kg of milk in a lactation period of about 250 days. Performance records at

LESSER KNOWN STRAINS

223

the District Livestock Farm, Koila, Karnataka, showed that average age at first calving
for these cows was 1 1 57.7± 1 75.34 days, milk yield 218.3±6.15 kg, lactation length
249.6±3.85 days, dry period 141.7±8.95 days, service period 100.4±8.72 days and calv¬
ing interval 403.8±7.52 days (Hegde et al., 1978).

Mampati

This is a minor local type found in Madhya Pradesh with very little contribution to
the economy of the farmers. No work on their performance and status has been re¬
ported in the literature.

Manapari

This is a cross between Kangayam and a local type found in Chennai, Tamil Nadu,
India. Their population is very small and no information is available on their perfor¬
mance.

Motu

Motu cattle are distributed in Malkangiri sub-region of Koraput district of Orissa.
They are also found in Khanta block of Madhya Pradesh and border areas of Andhra
Pradesh. Temperature in the breeding tract varies from 7°C in December to 37°C in
May. Relative humidity ranges from 6 1 % in March to 9 1 % in August and rainfall from
0.7 cm in January to 79 cm in August. The climate is pleasant. Almost all cattle in the
breeding tract are of Motu type. These cattle are used by Koyya tribe for ploughing and
carting. The animals are kept in open, together about 30 to 40 cattle tied around their
neck. They strive on grazing alone.

Motu cattle are dwarf, small and compact having red coat colour intermixed with
white spots in the regions of chest, abdomen and dewlap. Males show darker colour in
the regions of hump and neck. Bullocks also show such darkness, which might be due
to late castration at 1-12 years of age. Hair coat is thick throughout the body, being
prominent in the regions of neck and thigh. Calves at birth are brown and they change
to red colour with age. Head is small with forehead slightly dished. Nasal bridge is
short. Muzzle is black. Eyes are bright, ears tubular, and horns very rudimentary or
stumpy. Dewlap is thin and short, and skin, sheath as well as navel are tight. Legs are
short with deep black rounded hooves. Tail is thin and long with black switch stretch¬
ing up to the pastern. Udder is poorly developed with small teats (Panda and Mishra,
1990).

Average birth weight is 8.73±0.61 and 6.55±0.39 kg in male and female calves
respectively. Body weight at 5 to 5.5 years is about 160.7±0.60kginmalesand 152±0.94
kg in females. Average body length, height and heart girth are 109.5±5.20, 104.3±5.20,
123.0±0.54 cm, respectively, in males, and 98.2±5.98, 96.1±2.03, 121.6±0.76 cm, re-

224

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

spectively, in females. A pair ofMotu bullocks weighing 369. 22±7.91 kg and working
@ 8 hours per day ploughed 2,564.29±0.74 m2 with a ploughing capacity of 694.5 1% of
their body weight and pulled cart load of 1,264.00±32.14 and 996.42±41 .05 kg with a
carting capacity of 342.34% and 269.87 % of their body weight in plain pucca and
undulated kutcha roads with a speed of 4,750.00±86.95 and 2,321 .43±44. 71 m/hr re¬
spectively (Panda and Mishra, 1990).

Purnea

A small black or red hill type cattle found in north-east Bihar. These are similar to
Morang cattle of Nepal. The name appears to be derived from the place of its origin,
the Purnea district.

Shahabadi

The Shahabadi cattle belongs to the group of short homed white or light gray cattle.
This is similar to Hariana and is also known as small Hariana and Gangotari. These
cattle are found in the Gangetic plains of Shahabad and Saron districts of Bihar and
some parts of eastern Uttar Pradesh. This breed also seems to be derived by the upgrad¬
ing of local cows with the Hariana. Cows produce about 645 to 895 kg of milk in a
lactation period of about 225 to 235 days. Age at first calving ranges from 42 to 53
months. Calving interval is about 14-15 months.

Sunandini

This breed has been developed by the Kerala Livestock Development Board (KLDB).
The origin of Sunandini can be traced to the importation of 22 Brown Swiss bulls and
45 cows during the period from 1964 to 1967. The bulls were mated to a nucleus stock
of 140 non-descript cows. Subsequently, semen from 11 more bulls was imported.
About 40 Jersey bulls of Australian or New Zealand origin were also used in cross¬
breeding programme. The KLDB later imported two consignments of exotic bull se¬
men for the production of FI bulls. These include Jersey, American Brown Swiss and
Holstein (Chacko, 1994).

Breeding policy for Sunandini was redefined taking into consideration the recom¬
mendations of the Committee to Evaluate and Formulate Breeding Programmes and
policies in the state of Kerala. The present policy is aimed at creating a new synthetic
breed out of a crossbred population with exotic inheritance of around 50% from Jersey,
Brown Swiss and/or Holstein. Young bulls are produced by mating superior Sunandini
cows maintained in the nucleus farm with proven bulls, mating superior Sunandini
cows maintained by farmers in the milk recorded areas with proven Sunandini bulls,
and mating local non-descript zebu cows with superior Jersey/Holstein or American
Brown Swiss bulls. All the young bulls are progeny tested in the milk recorded area

LESSER KNOWN STRAINS

225

and only the top bulls are used for the production of next generation of bulls. There are
more than 2 million Sunandini cattle in Kerala.

Phenotypic appearance of Sunandini is heterogenous. Colour varies from different
shades of grey to brown. The only phenotypic characteristic that can now be consid¬
ered typical to Sunandini is the straight back and comparatively short flat head.

Average birth weight of male calves is 30.4 kg and that of female calves 28.3 kg.
Adult male and female weigh about 547 and 375 kg respectively. Average height and
hearth girth are 128 and 189 cm, respectively, in males, and 120 and 163 cm, respec¬
tively, in females. Average age at first calving, milk yield, lactation length and fat are
32.2±0.19 months, 2,435±24.2 kg, 279.8±1.05 days and 3.89±0.01% respectively.

Tarai

This is a lyre horned, white or grey variety of the Indian hill cattle found in north¬
east Uttar Pradesh. These cattle have probably some blood of Hariana and Tharparkar
catttle. They are used mainly for draught; milk yield is low. Cows weigh 270-370 kg.

Taylor

The Taylor is the first crossbred strain developed in the country. It is found in
Patna, Bihar and is known after the name of the person responsible for its origin. In
1 856 Mr Taylor, the then Commissioner of the district, imported four bulls believed to
be Shorthorns or possibly of Jersey or Guernsey breeds. A crossbred strain was evolved
by crossing these with the local zebu cows. This became gradually acclimatized and it
proved to be a useful milker, giving 5-6 kg milk per day, and exceptionally as much as
15-20 kg per day.

Cows are red, brown, black and white or brown and white. They have no hump.
Animals of this type are rarely found now.

BUFFALOES

Rao (1984) described some draught buffaloes found in various parts of India as
different breeds. However, detailed studies are needed to evaluate these buffalo popu¬
lations so that either they can be established as distinct breeds or merged with already
known breeds. These buffalo breeds/strains are described below.

Assamese/Mongoor

This is a medium-sized animal. Face is conical with broad forehead. Homs are
small and flattened at the base, round, triangular in the middle, pointed at the tip and
they run upward and backward. Body is generally black and densely covered with hair.
Milk yield is low.

226

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Godavari

Godavari buffaloes are believed to have originated from crossing of native buffa¬
loes with Murrah bulls. The main breeding tract of these buffaloes lies in East and West
Godavari districts of Andhra Pradesh. These are found in Tanuku, Bhimavaram,
Narasapur, Ramchandrapuram, Kothapeta and Alamuru taluks; parts of Tadepalligudem
and Kovvur taluks and Krishna deltaic areas of Gudlavalluru, Gudivada, Avanigadda,
Kankipadi and Vuyyura taluks (Bhat and Taneja, 1987). Soils in the Krishna-Godavari
zone are mainly deltaic alluvial and black. Some parts have red sandy soils. This
region has humid to sub-humid climatic conditions, characterized by heavy rains dur¬
ing September-October. The temperature touches 44° to 45°C during summer. Rela¬
tive humidity is high (95 % or more) in the coastal districts. The animals are medium
statured with compact body. Colour is predominantly black with a sparse hair coat of
coarse brown hair. Head is clean cut with a lean face, convex forehead and prominent
bright eyes. Homs are short, flat, curved slightly downward, backward and then for¬
ward with a loose ring at the tip. Chest is deep with well-sprung ribs. Barrel is massive
and long with straight back and a broad level rump. Udder is medium in size and
mostly bowl shaped. Teats are cylindrical in shape. Tail is thin and extends below the
hocks with or without a white switch.

Average body length, height and heart girth is 143, 128 and 192 cm, respectively,
in female buffaloes, and 151, 143 and 204 cm, respectively, in male buffaloes. An

Godavari she buffalo

LESSER KNOWN STRAINS

227

adult male and female weighs around 520 kg and 452 kg respectively. Average age at
first calving, peak yield, lactation length, dry period, service period and calving interval
are44.2±0.37 months, 9.3±0.19 litres, 417.9±8.80 days, 149.0±4.68 days, 266.0±10.37
days and 570. 2±1 0.66 days respectively (Kumar, 1990). The best animals even pro¬
duce about 2,000 litres in a lactation. The animals are hardy and possess good resis¬
tance against majority of the prevailing diseases.

Jerangi or Zerangi

These buffaloes are found in Jerangi hills in Ganjam district of Orissa and northern
parts of Visakhapatnam district of Andhra Pradesh.

This is a small-sized buffalo and has a maximum height of just 114 cm. It has a
short face, small barrel and very short tail, not exceeding 46 cm. Skin is thin, horns
conical, small and run backward. Colour is black. These buffaloes are very useful for
ploughing in water-logged paddy fields. A pair of males can pull one and a half cart
load easily. They cannot withstand high temperature as their body colour is dark.

Kalahandi/Peddakimedi

This is known as Peddakimedi in the eastern hill regions of Andhra Pradesh and as
Kalahandi in the adjoining areas of Orissa. These buffaloes were brought and bred by
Peddakimedi people of Kalahandi Samsthan of Orissa, and are named after them.

The usual colour is grey or ash grey with medium long tail ending in a white switch.
Forehead slightly protrudes forward, horns are broad and set apart, half curved and run
backward. Eyes are prominent and large without narrow red margin around the lids.
Neck is round and forequarters large and well developed. Chest is wide and distinct.
Flanks are flat and broad. Kalahandi buffaloes can tolerate sun heat better than the
black-coloured buffaloes because of their light colour. Its feed costs are low and water
needs less. The animal is of docile temperament but quite hardy in work and good for
draught purpose to carry heavy loads on to the hill tops. The male buffaloes are particu¬
larly used for ploughing paddy fields on plains and pulling carts in towns. These buffa¬
loes are used mostly for crushing sugarcane. Milk yield is medium but the cost of
production is low.

Kujang

Buffaloes present in Cuttack district of Orissa are known as Kujang buffaloes. These
are distributed in eight blocks and two NACs of Jagatsinghpur sub-division of this
district. This area has hot and humid climate with temperature ranging from a mini¬
mum of 13.8°C in winter to a maximum of41.5°C in summer. Average relative humid¬
ity ranges from 72 to 80% and rainfall from 2 to 27 cm. About 16% of the total buffa¬
loes of Cuttack district are of Kujang type. These buffaloes are grazed along the river
and canal sides during day time and are tied at night in the outskirts of villages along the

228

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

river or canal side. Concentrate mixture is fed to lactaing buffaloes along with paddy
straw prior to milking in the morning and evening.

The body is of medium size and relatively less compact, tending to be loose. It is
moderately long. The calves at heel are brown with longer hair on the body. With
increase in age the brown colour changes to brownish black appearing first in head,
neck and wither, subsequently spreading over the entire body. The body coat hair also
become shorter with age. Adult buffalo cows are brownish black (brownish hair on
light black skin). However, buffalo bulls and bullocks show relatively darker colour
around the eyes and in the region of face, neck and wither. Skin is soft, smooth and
loose. White markings are noticed frequently in switch followed by forehead and legs.
Very rarely such markings appear on face and muzzle. Head is relatively longer and
heavier. Forehead is dished with slight longitudinal central depression. Homs are long
and loosely curled extending backward, upward and inward. Ears are tubular, slightly
elongated, laterally disposed and alert. Muzzle is black. Neck is relatively longer and
heavier. Brisket is prominent. Hump and dewlap are non-existent. Hips are broad and
quarters are drooping. Limbs are long and slender. Hooves are small and moderately
broad. Switch is invariably white extending nearly mid-way below the hock and fet¬
lock. Udder is medium sized and squarely placed. Hind quarters of udder are usually
larger than the forequarters. Milk vein is less prominent (Dash and Mishra, 1990),

Average adult body weight is 520.3±5.35 kg in males and 405.0±2.67 kg in fe¬
males. Average body length, height and heart girth are 143.7±1.07, 130.3±0.75 and
198.0±1.34 cm, respectively, in males, and 133.8±0.61, 125.0±0.84 and 181.41±0.88
cm, respectively, in females. Average age at maturity and at first calving in Kujang
buffaloes are 1,246.4±33.7 and 1,563.6±33.4 days respectively. Average daily milk
yield is about 3 kg and lactation yield about 915 kg (Dash and Mishra, 1990).

Manda

Herds of Manda buffaloes are found around Kakriguma, Laxmipur, the hills of
Damanjodi, the Patraput area and the Petta hills near Jeypore, Gupteswar, Jolapur,
Balimela, Pedabial and the Arku Valley hills of Koraput district in Orissa. The owners
move to different areas with the herd in search of pasture, water and shade. These
animals are found on hills 3,000 to 1,050 m above msl, graze in deep forests of the hills
and come down to the foot-hills at the onset of winter (around November). The number
of these buffaloes is decreasing gradually (Patro and Komel, 1987).

Body colour is mostly ash grey and grey with copper-coloured hairs. Mice-black
and silvery animals are sometimes seen in herds, but such animals are not used for
breeding by the owners. Yellowish tufts of hair on the knees and fetlock are always
present. Homs are broad and emerge slightly laterally, extending backward and inward
in females; in males horns remain apart permitting the gait of the yoke to be positioned.

LESSER KNO WN STRAINS

229

/ Godavari

A Jof',>IKJt

• I Kal.ih.tf idi
h Ku|.m« )

< • Puruluklitnundi

I Fvlinda

M %,:mtbvdf.<un
•I Sik,mt*'v-

10 South Kumhu

Distribution of lesser known buffalo strains

230

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

This may be due to conscious selection of the owners. Forehead is flat; muzzle is short;
and jaws, nostrils and backbone are prominent. Horn length is around 56 cm. Limbs
are strong and stout. Collar bones and ribs are strong. Chest is wide and spacious, heart
girth is more than the paunch girth in males.

Average body length, height at withers, heart girth and paunch girth are
1 15.42±2.723, 124.46±1.851, 174.50±3.330, 212.56±5.031 cm respectively.

She-buffaloes yield on an average 1 .5 litres of milk/day on a single milking basis.
Animals yielding up to 4 kg of milk/day are also found.

These buffaloes are reared only on grazing. They are semi-wild under forest graz¬
ing conditions but are docile when reared in villages. Only newborn calves (up to 10
days) are provided some type of housing otherwise no housing facilities are provided.
Calves are allowed to suck the dams all the time except during night. Breeding bulls
are inducted in the herd after the rainy season (September) and retained there until the
end of winter season (February). Therefore, most of the calvings occur in the rainy
season. Cows with sucking calves are not bred because milk yield stops shortly after
conception.

The bulls are chosen for breeding at 2-tooth age and allowed to continue until 4-
tooth age. Good and exceptional bulls are kept up to 6-tooth age. After the breeding
period, bulls are removed from the herd and kept out in a village. Those which are no
longer wanted for breeding are sold out as bullocks at a very high price. Selection of
the bulls is done by considering the thickness of cannon bone, pastern, stifle, knee and
hock joints. A large, black and strong hoof is a must. Besides this, body colour, fore-
and hind-quarter conformation, horn shape, straightness of the back and pasture are
also considered. Manda bullocks are famous for longevity, hard work and length of
working life. These buffaloes are very good for carrying heavy loads in hilly tracts and
for strenuous agricultural work.

Paralakhemundi

Paralakhemundi buffaloes are found in Paralakhemundi and Gunpur area of Orissa
and around Mandasa, Bobli and Srikakulum of Andhra Pradesh, mostly in the down
hill plains of eastern ghats (Patro and Kornel, 1987). The marketing centres of these
buffaloes are the cattle fairs in Ganjam and Vishakapatnam districts. These animals are
reared on the natural herbage in jungles and are brought down to the plains in large
herds for sale through auctions. These buffaloes are hardy, heat resistant and live on
roadside grazing with straw supplementation. These animals can thrive in diversified
conditions.

Littlewood (1936) and Narayana Reddi (1939) named the buffaloes in
Paralakhemundi part of Ganjam district as Manda, while Kaura (1952) called these
animals as Paralakhemundi. Rao (1981) observed the chromosome number of buffaloes

LESSER KNOWN STRAINS

231

Paralakhemundi she buffalo

in coastal Orissa to be 2n = 48, which is different from that of riverine buffaloes. Bidhar
et al. (1986) also found chromosome number of Paralakhemundi buffaloes to be 2n =
48 and classified these buffaloes as swamp type.

The usual colour varies from blackish grey to grey with brown hair, and sometimes
grey hair on the skin. Calves are bom with light red-silver-grey and mixed fawn colours.
Homs are long (around 53 cm), broad and semicircular, extending backward and in¬
ward. Head is narrow, forehead is flat, muzzle is short and nostrils are wide and
prominent. Neck is short and thin. Abdomen is large and spacious. Chest is wide.
Legs are short, stout and comparatively thin. An arch-like curved white ring around the
chest is found in some animals. It varies from locality to locality.

Average body length, height at withers, heart girth and paunch girth are
1 14.69±2.167, 122.89±1 .470, 1 84.48±3.952, 205.62±4.520 cm respectively.
Paralakhemundi buffaloes mature at around 2.5 years and calve almost every year.
These animals start calving in September and continue until January, but most of the
calvings occur during November.

These are essentially excellent draught buffaloes. Animals are slow moving but do
an unmatchable job of heavy hauling, especially the pudding operations in heavy soils
known for paddy cultivation. Bullocks are docile and slow, and can carry heavy loads
and plough in paddy fields in hot sun. Females yield about 3-4 kg of milk per day on an
average but females yielding up to 7 kg/day are known. The lactation period continues

232

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

for more than 300 days if conception does not take place. Bulls are preferred to bul¬
locks because of the supremacy of their draught value for agricultural operations.

Sambalpuri/Kimedi/Gowdoo

The breeding tract of this buffalo is referred to be the Sambalpur area of Orissa.
Nevertheless, these buffaloes are also found around Bilaspur district in Madhya Pradesh,
from where the calves are brought by Gowdoo herdsmen (hence the name) to Sambalpur.
They are reared and then sold in cattle markets in Visakhapatnam and East and West
Godavari districts of Andhra Pradesh in the name of Kimedi buffaloes.

Body is black, but brown and ash grey specimens are not uncommon. The animal is
quite large, powerful, having long and narrow barrel; and prominent, broad and flat
forehead. Neck is narrow and thin in females and in castrated males. Fore-quarters are
shallow, and less developed than hind quarters. Homs are short, narrow, curled in a
semi-circular fashion, and extend backward, upward and then forward ending in pointed
tips. Tail is long and narrow with a white switch. In well-maintained stocks where
normal feeding and management are taken care of, these buffaloes do calve regularly
with fairly good quantity of milk than any other breed in the region with a daily average
of over 7 kg in good milkers. Narayan Reddi (1939) reported an average milk yield of
2,270-2,720 kg in 340-370 days lactation period. Males are known for their fast run¬
ning and heavy carting, but they cannot work for long hours in hot summer.

Sambalpuri she buffalo

LESSER KNOWN STRAINS

233

Sikamese

This is a very small sized hill buffalo of the State of Sikkim. It weighs just 250-400
kg. These are hardy animals with compact, thick, black or grey coat. The buffalo is a
poor milker.

South Kanara

This is a famous medium built breed around Mangalore region on the west coast
owned by a sect of Hindus known as Jain Banto (Cockrill, 1974). These animals are
active, fast moving, hardy and have got particular significance during the local festivi¬
ties. These animals are used for race in water-bound fields as a part of annual sports
race. Males are popular in wet-land agricultural operations.

These buffaloes are also known as Kanara, Kanarese and Malabar. These buffaloes
are medium sized and well built with medium size, curved and flat horns projecting
backward, sideward and downward at the neck region. Chromosomal complement is
typical to that of river buffaloes (2n = 50).

Swamp

The buffalo population of Assam is basically swamp type. These buffaloes are
hardy and quite adapted to the local warm humid conditions of the region. They live
mostly on naturally available feeds and fodder which comprised aquatic, semi-aquatic,
hill and highland grasses. These buffaloes are used by the farmers both for milk and
work. Animals are suitable for many agricultural activities particualrly in low lying wa¬
ter merged areas for ploughing paddy fields. It is preferred for prepartion of curd, ghee,
etc. because of higher fat percentage in milk, which fetches high price.

Climate of Assam is characterized by high rainfall and high relative humidity. Av¬
erage maximum temparature ranges from 24.6°C (January) to 35.4°C (June) and mini¬
mum from 7.3°C (January) to 23.3°C (August).

Swamp buffaloes of Assam are reared under three systems of management, viz.
semi-domesticted, nomadic and settled. In semi-domesticated system, buffaloes are let
loose so that they can graze freely in the jungles to feed on the grasses, shrubs and
leaves. Animals are practically wild except that they return in the evening for shelter
and whatever little care is provided by the owner. In nomadic system, animals are
grazed and moved year round from place to place in search of fodder growing land. In
this system, animals are usually reared in large herds and during their transit, temporary
camps called “ khutis ” are set up for the shelter of the animals. Khutis are shifted from
place to place according to fodder availability and also to protect animals from natural
calamities like flood or draught. In settled system, buffaloes are reared as small indi¬
vidual holdings in the farmers house either in intensive or in semi-intensive manner.
Usually, swamp buffaloes spend most of their day time by wallowing in muddy water

234

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

or beneath the trees, and graze during morning time in winter and evening time in
summer.

Body colour of the swamp buffaloes is primarily black with varying shades from
dark slaty gray to black. Skin colour is light black to slaty black. Albinoids are also
found. Horn pattern is characteristic, essentially macrocerous being nearly straight and
turning at the ends. Spirocerous type of horn - curving upwards to form a circle, is also
not very uncommon. However, miscellaneous type of horns with a varying pattern be¬
tween spirocerous and macrocerous are also found.

Body length, height at withers and heart girth is around 142, 125 and 169 cm,
respectively, in females, and 148, 132 and 186 cm, respectively, in males. Average age
at first calving, lactation milk yield, lactation length, dry period, service period and
calving interval are 59.03±0.42 months, 506.0±3.14 kg, 283.4±1.44 days, 224.6±1.17
days, 181.7±2.39 days and 507.8±2.39 days, respectively. Average fat percentage is
8.48±0.067.

Swamp buffaloes have 48 chromosomes (24 pairs), out of which 4 pairs are sub-
metacentric, 1 metacentric and 19 acrocentric. X-chromosome is the largest acrocen¬
tric while Y is the smallest (AAU, 1998).

Tarai

Buffaloes found in the tarai area of Uttar Pradesh, particularly between Tanakpur
and Ramnagar, are known as Tarai buffaloes. Kaura (1950, 1952) described some
characteristics of these buffaloes.

Colour varies from black to brown. Sometimes there is a white blaze on the fore¬
head. Horns are usually long and flat with coils, bending backwards and upwards. A
typical Tarai buffalo possesses a moderate body with coarse head slightly convex at the
centre, drooping towards the base of the horns, and a prominent nasal bone with slight
depression under the eyes. Eyes are small, ears are long. Legs are short but strong.
Tail is long, reaching below the hocks. Tail switch is white.

These buffaloes produce 2-3 kg of milk per day averaging around 450 kg in a
lactation period of about 250 days.

□

EVALUATION OF BREEDS

The Asian continent has been the heart-land of the early civilization and thus has wit¬
nessed very early domestication of various farm livestock and poultry species. In the
course of time many distinct animal types/breeds were developed to meet the ever
increasing demand of the human population. Organized animal husbandry practices
and quest for development of need-based animal types resulted in identification of breeds.
So far, almost all the indigenous breeds are described on the basis of a few subjective
evaluation criteria and their parameterization is also done on limited data obtained from
some organized herds. Therefore, breed description is grossly inadequate in scope and
coverage, and falls short in describing the range of genetic variations. There is paucity
of information on all the breeds regarding their physical description, breeding tracts,
demographical and geographical distribution patterns, etc. Various qualitative, quanti¬
tative, morphological and production attributes of the native animal population still
remain to be enumerated and quantified. Therefore, planned scientific surveys of all
types of indigenous animal germplasm resources are warranted. These surveys will fill
the lacunae in our knowledge and reveal the status of breed vis-a-vis its economic
importance along with the identification of animals of the superior germplasm with the
potential of higher production and reproduction. The animal types which are declining
in number or are on the verge of extinction too can be identified by comprehensive
surveys. These surveys will reveal the extent of genetic variability including rare vari¬
ants which can be protected and conserved.

The precise characterization and evaluation of breeds in addition to morphometric
traits and specific genetic markers like biochemical, mutagenic and cytogenic have
already been established for temperate breeds. These provide firm basis for the charac¬
terization of animal types and breeds. There is need for such an indepth study on the
animal germplasm resources of Asia.

It is known for quite some time now that chromosomes are repository of genetic
information, but systematic molecular genetic studies of farm animals have remained
neglected for a long time as practical utility of these in germplasm evaluation was not
fully understood. Genetic evaluation of breeds assumes special significance as most of
them though known by different names are almost similar, and differences only at the
molecular level can reveal if these are different or not. Hence, such evaluations should
also form an integral component of programmes related to characterization, evaluation
and conservation of breeds, strains, types, varieties etc.

236

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

PHENOTYPIC EVALUATION

Animals maintained under field conditions and adapted to specific agro-climatic
condition should be evaluated by collecting information on geographical distribution,
socio-economic status of the farmers, management conditions and performance char¬
acters. Scientific surveys need to be conducted in the breeding tract by following mod¬
em sampling designs and suitable formats and questionnaires (Annexure I) for collect¬
ing all possible relevant information for a particular breed inhabiting a defined zoo-
geographical zone. This information will lead to the preparation of breed descriptors
(Annexure II). Such surveys of breeds/animal types must ensure mandatory recording
of the following information.

(i) Demographical and geographical distribution

(ii) Native environment

(iii) Enumeration of breeds in terms of age and sex in a population

(iv) Management practices and utility

(v) Qualitative and quantitative characterization of breeds in relation to morphological
traits, production potential, reproductive status etc.

(vi) Qualitative and quantitative description of unique animals, elite producers and rare
or unusual characteristics in certain specimen.

Survey Plan

The breeding tract of each breed should be divided into 3 regions (conveniently the
administrative districts) representing the complete variation in the breed. Each region/
district would have 1 supervisor and 5 enumerators. In the first half of the first year, the
supervisor and enumerators would be engaged in determining demographical and geo¬
graphical distribution of the breeds. Subsequently, 3 enumerators would continue for 2
years recording information on the performance of animals and the remaining 2 enu¬
merators would be engaged in recording management practices. The supervisor would
continue for all the 214 years.

Demographical and geographical distribution

On the assumption that the breeding tract of a breed is spread over adjoining/con¬
tiguous districts in one or more states, stratified two-stage sampling design would be
adopted. Different zones within a district would be identified which would constitute
different strata. Villages within the stratum would constitute the first unit and houses
within the village the second unit. Totally 3 districts and within each district 4 strata
would be randomly selected. From each stratum, 5 villages would be randomly se¬
lected for complete enumeration for the purpose of deriving demographic distribution
of the breed.

EVALUA TION OF BREEDS

237

This study would cover the following information:

(a) Age-wise and sex-wise distribution

(b) Group enumeration for calves (up to 6 months), young stock (6-24
months), adults (24-42 months), milking females, dry females,
working males, stud bulls and others

When the complete information is obtained by stratified survey, data regarding
groupwise, sexwise and breedwise total population in the breeding tracts would be
enumerated by superimposing the proportion obtained by survey on the livestock cen¬
sus data already available.

In total, 1 5 enumerators would be engaged in the study. During the first 6 months,
all the enumerators and 3 supervisors would be engaged in conducting demographical
study and subsequently they would take up other aspects which are given below.

During survey if individual animals with exceptionally high producing capacity or
with rare genetic variation is located, they should be brought under organizational sup¬
port or purchased for further studies.

Breed characterization and management practices

This study would be conducted in 3 districts. In each district, 200 animals under
each of the following groups would be studied for aspects given against the group.
Thus, there would be 1,400 animals in a district which would be randomly selected
from 4 randomly selected zones (from each zone 350 animals from randomly selected
households would be surveyed). The group classification is given below:

Group

(a) Calf (1-6 months)

Study coverage

(e) Dry females

(d) Milking females

(b) Young stock (6-24 months)

Physical traits, feeding and
management practices
Physical traits, feeding, management
practices and growth traits
Physical and reproductive traits,
feeding and management practices,
and growth traits
Physical traits, feeding and
management practices, utility, milk
production traits, and reproductive
traits (e.g. oestrous cycle and service
period)

Physical and reproductive traits, and
feeding and management practices

238

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

(f) Working males

Physical traits, feeding and
management practices, and utility
Physical and reproductive traits, and
feeding and management practices

(g) Breeding bulls

Milking animals and calves

As mostly calves are expected to be along with their mothers, groups (a) and (d)
would be taken together for studies. The following scheme would be followed for
detailed recording:

(a) Milk recording would be done once in a month from the first month of lactation
to the end

(b) Milk-fat and SNF would be estimated every month from morning milk only

(c) Physical measurements for the mothers would be recorded during the first/
second and 8-10 months of lactation, and for calves measurements would be
taken for every month

(d) While feeding practices for calves would be recorded every month, feeding of
mothers would be done once in 3 months

(e) Disease and other management aspects would be recorded by observations and
by the information provided by the farmer

(f) Reproductive aspects of these animals would be covered by observations and
by the information provided by the farmer

(g) Qualitative and quantitative descriptions of individual animals other than the
above which are given in the breed descriptor would be covered once

Assuming that an enumerator would be able to cover 3 pairs of cows and calves per
day for the scheme of work given above, he would be able to take care of 66 such pairs
in a month leaving out holidays and moving period. Thus, for a district 3 enumerators
are required and for all the 3 districts 9 enumerators would be engaged for a period of
2 years.

Rest of the groups

For young stock under groups (a) and (c) body measurements would be recorded
once in every 6 months and for others only once. However, for feeding and manage¬
ment practices, one recording would be done once in every 3 months. During the visits
in each season, reproductive and disease management aspects would be recorded by
observations and by the information provided by the farmer. Among the groups, breed¬
ing bulls might not be available in sufficient numbers and therefore studies would be
limited to whatever is available in the area of coverage.

In addition to the above, other aspects as given in the breed descriptor would be
covered once for all the animals.

E V A L UA TION OF BREEDS

239

For the 5 groups of animals, there would be 1,000 animals in each district. As the
enumerator has to repeat recording on the same individual animal once in every 3 months
for a period of 1 year, an enumerator would be able to cover 500 animals in 3 months by
approximately recording 8 animals in a day. Thus, for every district 2 enumerators
would be required, and for 3 districts 6 enumerators for a period of 1 year would be
sufficient.

GENETIC EVALUATION

Various individuals of breeds within a species are distinguished phenotypically
with more similarities within a breed. There are variations within a breed also but all
the individuals of a particular breed can be grouped as representative of one breed due
to similarities. These similarities are having a genetic base as they are fixed from one
generation to next generation. To elucidate the genetic basis of similarity within a
breed and of differences between breeds, studies need to be undertaken on cytogenet¬
ics, biochemical polymorphism, blood groups and DNA polymorphism.

A large quantum of work has been conducted on cytogenetic architecture of vari¬
ous breeds within a species. This included karyotyping, idiograms, NORs, SCE, vari¬
ous bandings such as G, C, R, GTG and GBG. All these studies could reveal a definite
cytogenetic profile of a species but no difference could be highlighted between breeds
of one species.

Blood group studies also had their limitations as a limited number of loci could be
studied. From these loci it was not possible to clearly distinguish various populations
within a species. This technique has been found to be very useful and cost effective for
parentage confirmation.

Biochemical polymorphism studies on various proteins and enzymes have also been
conducted on various breeds of different species. But these studies have been taken
with different objectives and rarely the objective was to find genetic distance between
the breeds within a species. Data from various reports are sporadic and could not be
compiled to achieve any meaningful conclusion.

Cytogenetic Architecture

In the last four decades, especially after the use of tissue cultures and pre-treatment
of cells in different ways, there has been rapid progress in the mammalian cytogenet¬
ics. Earlier the results were based exclusively on observations obtained through direct
study of certain tissues, such as bone marrow and gonads. Knowledge of the chromo¬
somes of different breeds of cattle and buffaloes remains very incomplete in spite of
the technical improvement. Simplified methods facilitating cytogenetic investigations
of a large number of animals in a short period of time have recently been found out.

240

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

It is a well-known fact that chromosome number and structure are characteristic for
all higher species. However, spontaneous structural rearrangements may take place or
can be induced. These structural aberrations cause phenotypic effects. Normally there
is a lethal negative selection against structural aberrations in embryos both at pre- or
post-implantation stages. The karyotype variation tolerated within a species is deter¬
mined by several factors, and it is probable that individuals with different karyotypes
may have different adaptive value in natural selection. In most of the cases polymor¬
phic population appears to have higher fitness value than the monomorphic ones.

Chromosomal Profile of Cattle

A normal karyotype of cattle comprises 2n=60 chromosomes (Gustavsson, 1969;
Gupta et al., 1974). The diploid count (2n) in all the cattle breeds has been reported to
be 60. Of these chromosomes, 29 pairs are acrocentric autosomes and 1 pair sex
chromosomes. In females, both these chromosomes are X, whereas in male one is X
and the other is Y, coming from female and male parents respectively.

The major morphological difference between cattle species is the Y-chromosome.
All humped cattle ( Bos indicus ), American bison and Wisent (European bison) have an
acrocentric Y ( Gupta et al., 1974) whereas those without hump ( Bos taurus ) have sub-
metacentric Y (Table 3). Quite interestingly, the dwarf zebu of Sri Lanka had a small
sub-metacentric Y chromosome (Hadziselimovic, 1971). However, this could be due to
unrecorded introgression from Bos taurus during colonial times. In fact, it might be that
the acrocentric Y of Bos indicus represents the evolution of an isolating mechanism
which could be less important on Sri Lanka than on the mainland where Bos indicus
overlaps with other species of cattle.

Table 3. Chromosome numbers and morphology in different species

Species

Sm/n

Acrocentrics

Bos indicus (zebu)

Bos taurus (exotic)

Bos banteng (Bali cattle)

Bos grunniens (yak)

Bos mutus (wild yak)

' 58

Bos frontalis (mithun)

Bos gaurus (gaur)

Bos gaurus hubbacki

(seladeng)

Bison bonasus (Wisent)

Bison bison (American bison) 60

EVALUA TION OF BREEDS

241

The difference between Bos taurus and Bos indicus in the Y-chromosome has made
this a convenient marker. Among African cattle, the Kouri (a taurus type) cattle has
sub-metacentric type Y-chromosome. The Y-chromosome of Sanga cattle is also sub-
metacentric type. Sub-metacentric type Y-chromosomes have also been reported in
Yellow cattle of China and Taiwan, though they have hump like typical zebu. Korean
cattle which are considered to have indicine ancestry had the taurine type Y-chromo-
some. However, the Brahman cattle bulls have shown both types of acrocentric or sub-
metacentric Y-chromosomes depending upon the bull sire used. Similar type of Y chro¬
mosome is found in Bos taurus and Bos indicus crossbred males in India.

Chromosomes are identified by both shape as well as size and are numbered ac¬
cordingly. The size of chromosomes is expressed in terms of relative length of each
chromosome as its percentage of total haploid genome size. The relative length of cattle
chromosome is described in Table 4.

Banding Patterns

Information on banding patterns provides better understanding of the chromosomal
organization. This can also be used as markers for chromosome identification with
respect to normal as well as anomalous conditions, due to their universality and speci¬
ficity. Various banding patterns using differential staining procedures have been evolved.

C-banding

Constitutive heterochromatin region is visualized through C-banding technique in
metaphase chromosomes. The C-bands are created by Giemsa staining and these ap¬
pear primarily due to the greater loss of chromatin in non-repetitive regions than in
repetitive regions.

Autosomes: Irrespective of their morphological features, all the autosomes show
large and distinct staining of the chromatin in the centromeric region. Some variation
in the amount of centromeric heterochromatin could be observed in some of the homo-
logues. No other heterochromatic region is present.

Sex chromosomes: No centromeric heterochromatin is present in X-chromosome,
so is in Y-chromosome, though the latter stain darker than X-chromosome. Redun¬
dancy of the DNA material may be due to the presence of heterochromatin in Y-chro¬
mosome.

Although C-bands are restricted to the centromeric regions of the chromosomes,
species-specific variation in the band characteristics regarding size of the band exists.
Considerable reduction in the amount of centromeric heterochromatin has been ob¬
served in bi-armed chromosomes relative to acrocentric chromosomes. Loss of centro¬
meric heterochromatin because of centric fusion of chromosomes during evolutionary
process, may be the probable cause of less intense bands in sub-metacentric autosomes.

242

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Table 4. Relative length of chromosomes in male and female cattle

Chromosome No.

Male

Female

5.405±0.158

5.478±0.136

4.795±0.167

5.044±0.187

4.425±0.230

4.8 14±0.200

4.285±0.138

4.616±0.151

4.210±0.108

4.418±0.1 13

4.120±0.094

4.272±0.1 12

3.980±0.083

4.218±0.1 15

3.875±0.085

4.080±0.066

3.780±0.064

3.922±0.074

3.650±0.076

3.778±0.021

3.545±0.033

3.654±0.029

3.455±0.069

3.476±0.064

3.280±0.075

3.348±0.050

3.240±0.049

3.262±0.067

3.100±0.076

3.134±0.066

2.975±0.063

3.034±0.074

2.860±0.086

2.904±0.076

2.765±0.074

2.800±0.082

2.695±0.099

2.694±0.067

2.625±0.072

2.632±0.077

2.555±0.074

2.550±0.086

2.475±0.088

2.460±0.096

2.420±0.060

2.388±0.092

2.335±0.062

2.302±0.079

2.245±0.121

2.192±0.101

2.165±0.082

2.066±0.088

2.125±0.085

1.980±0.127

1.995±0.098

1.874±0.061

1.850±0.136

1.764±0.102

5.240±0.218

5.306±0.178

2.035±0.227

G-Banding

Any chemical agent, which can alter protein structure is capable of producing G-
bands. There are various methods available, but mostly proteolytic enzyme treatment
is used to hydrolyse the proteins of nucleo-protein complex. Subsequent staining with
Giemsa reveals alternate dark and light regions, which represent A-T and G-C enriched

EVALUA TION OF BREEDS

243

DNA contents respectively. The DNA in positive G-bands is relatively rich in the bases
adenine and thymine (A+T rich), whereas that in the negative G-bands is relatively rich
in guanine and cytosine (G+C rich). G-banding is regarded as an outcome of DNA-
protein interactions on the chromosomes. The number, intensity and location of occur¬
rence of such band patterns along the chromosome length is a characteristic of a par¬
ticular chromosome pair (Table 5) and no other pair exhibit similar bands. The homo-
logues are identical in this respect, making pairing and subsequent identification of
chromosomes unambiguous (Fig. 4).

R- banding

Chromosomes are stained by using a specialized staining protocol for reverse banding
(R-banding). These bands are opposite to G-bands (Table 5). The positive R-bands are
early replicating, late condensing and represent G+C rich regions (Fig. 5).

Nucleolar Organiser Regions (NORs)

The nucleolar organiser regions in all bovine species is more or less fixed. The 4
large chromosomes positive for NORs in cattle are 2, 3, 4 and 1 1 (Fig. 6). The fifth pair
with NOR site is chromosome No. 28. However, there may be some variation in the
number or site of their locations on these chromosomes among individual animals.

Sister Chromatid Exchanges

The sister chromatid exchanges are the differential staining with 5 bromo-deoxy-
uridine showing late replicating chromosomal arms coming from each of parental cell
lines to daughter cells (Fig. 7). In normal replicating cells, this number is more or less
fixed in each species. Any alteration in this frequency depicts the disturbance in the
mitotic cell cycle by the agent or disease profile of the animal. Therefore, knowing the
modal number of sister chromatid exchange (SCEs) frequency is a good indicator of
the stability of the genome. The normal frequency of SCEs in cattle is 4.06/cell or 2.03
exchanges /cell/generation ( Vijh et al., 1996)

Chromosomal Profile of Buffaloes

The diploid chromosome number in water buffalo is 50. In swamp type buffalo it is
48. However some exceptions have been reported in different buffalo populations. In
swamp buffaloes from Sri Lanka 2n number is 50, suggesting that this population is
derived from the Indian river buffalo but has acquired swamp habits (Bongso and
Hilmi, 1982). In contrast Taiwan water buffaloes and Australian feral populations
have 2n=48. The chromosomal profile of different buffalo species are summarized in
Table 6.

244

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

EVALUATION OF BREEDS

245

Fig. 5. R-banded karyotype of cattle

246

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Fig. 6. NORs in cattle

Fig. 7. Sister chromatid exchanges in cattle

EVALUA TION OF BREEDS

247

Table 5. Details of euchromatic bands of cattle

Ch.

No.

G-band

R-band

21 G-bands; 2 negative central bands
separated by a positive band; chromosome
divided into 4 regions.

21 R-bands; divided into 4 regions; 3
prominent bands; 2 central which may be
joined; one terminal.

20 G-bands; 4 regions; 4 positive bands
in the proximal half of chromosome.

20 R-bands; divided into 4 regions; 1
prominent positive band in the proximal
half; 3 positive bands in the distal half.

1 5 G-bands; 3 regions; 2 prominent cen¬
tral positve bands separated by a large
negative band.

17 R-bands divided into 3 regions.

19 G-bands; 3 regions.

19 R-bands; divided into 3 regions; 1
prominent positive band in the proximal
half.

1 5 G-bands; divided into 3 regions sepa¬
rated by a group of 3 positive bands which
are equally distributed.

1 5 R-bands; 3 regions, 3 prominent posi¬
tive bands, 1 proximal; 1 central and 1 ter¬
minal.

15 G-bands; divided into 3 regions sepa¬
rated by a group of 3 positive bands which
are equally distributed.

17 R-bands; 3 regions; 2 prominent nega¬
tive bands.

13 G-bands; divided into 2 regions;
prominent positive bands 1 each in proxi¬
mal and distal region.

13 R-bands, 2 regions; 1 large proximal
positive band.

16 G-bands; divided into 2 regions; 4
positive bands in 2 separated by a large
negative band.

16 R-bands; 2 regions; 1 cluster of three
positive bands in the distal half.

17 G-bands; 2 regions; 2 bands each in
proximal and distal region.

17 R-bands; divided into 2 regions; 1
prominent central positive band, followed
by a broad negative band.

17 G-bands; 3 regions.

19 R-bands; 3 regions.

14 G-bands; 2 regions.

16 R-bands; 2 regions.

248

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

Table 5. (continued)

1 2
12 ll G-bands; 2 regions; 1 prominent
subcentromeric band.

_ 3 _

1 1 R-bands; 2 regions, a negative
subcentromeric band, followed by 2
prominent positive bands.

11 G-bands; 2 regions; 1 prominent
subcentromeric band followed by 2 posi¬
tive bands proximally.

1 1 R-bands; 2 regions; 1 large negative
centromeric band; 1 cluster of 3 strong
positive bands in the distal half.

14 15 G-bands; 2 regions; 4 small positive 15 R-bands; 2 regions, 4 positive bands

bands equally distributed in the proximal equally distributed in the proximal half,
half of the chromosome.

13 G-bands; 2 regions; 1 prominent
subcentromeric positive band and a large
negative band.

12 G-bands; 2 regions; 1 broad negative
band; 2 small positive bands in the distal
half.

12 R-bands; 2 regions; 4 positive bands
clustered in the distal part.

1 1 G-bands; 2 regions; 2 prominent cen¬
tral positive band.

1 1 G-bands; 2 regions.

10 G-bands; 2 regions; 1 submetacen-
tric band followed by 3 positive bands.

1 1 G-bands; 2 regions; 1 prominent posi¬
tive band in the distal part is main identi¬
fying feature.

1 1 G-bands; 2 regions; 2 subcentromeric
positive bands closed to each other.

9 G-bands; 2 regions.

1 1 R-bands; 2 regions; 2 broad central
negative bands followed by 2 prominent
terminal positve bands.

1 1 R-bands; 2 regions; 1 terminal positive
band with positive telomere.

10 R-bands; 2 regions; 4 broad positive
bands, usually joined and giving impres¬
sion of 1 broad positive region.

1 1 R-bands; 2 regions; 1 subcentromeric
negative band and 3 positive bands in the
proximal part.

1 1 R-bands; 2 regions; 2 subcentromeric
negative bands.

7 R-bands; 2 regions; 1 small
subcentromeric negative band followed by
a broad positive band.

EVALUATION OF BREEDS 249

Table 5. (concluded)

1 2

23. 10 G-bands; 2 regions; 1 prominent

subcentromeric band followed by 2 nega¬
tive bands separated by a small positive
band.

10 R-bands; 2 regions; 1 prominent cen¬
tromeric negative band.

24. 12 G-bands; 2 regions; 1 subcentromeric

negative band and 1 negative telomere.

10 R-bands; 2 regions; 1 subcentromeric
positive band followed by a wide negative
band.

25. 9 G-bands; 2 regions.

9 R-bands; 2 regions; 1 centromeric nega¬
tive band followed by a wide negative
band.

26. 7 G-bands; 2 regions; 2 prominent posi¬

tive bands; 1 subcentromeric band and 1
distilled band.

7 R-bands; 2 regions; wide subcentromeric
band and 2 prominent positive bands.

27. 10 G-bands; 2 regions; centromeric nega¬

tive band followed by positive bands.

8 R-bands; 2 regions; pronounced
subcentromeric band.

28. 9 G-bands; 1 region; a subcentromeric

positive band.

9 R-bands; 1 region; 3 positive bands; 1
proximal; 1 central and 1 terminal.

29. 9 G-bands; 1 region; 2 proximal positive

bands and a negative telomere.

9 R-bands; 1 region; 2 small positive
bands.

X 8 G-bands; 2 regions in the p arm; 4 re¬

gions in the q arm with 4 positive bands
in proximal and distal part.

8 R-bands; 2 regions in the upper arm (p);
a distal positive band, a small subtelomeric
negative band and positive telomere; 4 re¬
gions in the lower arm (q), a cluster of three
positive bands at the centre of the arm. A
large negative band above the cluster and
two negative bands separated by a small
positive band.

Y 2 regions with a clearly discernible posi¬

tive band in the middle.

250

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Table 6. Chromosomal profile of buffaloes

Species

sm/m

Acrocentric

River buffalo

Swamp buffalo

Afrikander buffalo

(Synercus caffer caffer)

Congo buffalo

(Synercus caffer nanus)

The karyotype of Anoa buffaloes ( Anoa depressicornis ) is 48. However consider¬
able variation in chromosome number of different types of Anoa has been reported
(Hsu and Benrischke, 1967, 1977; Amano et al., 1987). The diploid count of Afri¬
kander buffaloes ( Synercus caffer caffer ) and Congo buffaloes ( Synercus caffer nanus )
is 52 and 54 respectively. The hybrids of swamp and river buffaloes have 2n=49. Both
parental types have similar type of sex chromosomes, with X the largest acrocentric
and Y the smallest acrocentric. The lesser number of autosomes in swamp buffaloes is
considered to be due to centric fusion of autosomes 4 and 9 of river buffalo.

In river buffaloes the first 5 pairs of autosomes are sub-metacentric types. If all the
autosomes are counted for acrocentric arms, buffaloes also conform to the fundamental
number of 60 chromosomes typical of most of the members of family Bovidae. The
relative length is given in Table 7.

C-banding

All the acrocentrics show distinct heterochromatic bands, whereas sub-metacentric
and metacentric chromosomes show very little heterochromatin.

Autosomes: First 5 pairs of sub-metacentric autosomes show a faint C-band. Acro¬
centric (19 pairs) chromosomes possess distinct bands in the centromeric region.

Sex chromosomes: X-chromosome exhibits large prominent triangular C-band at
the centromere, extended down into the arms of the chromatids. Some workers con¬
sider that there are 3 large bands one in the centromere and 2 down in the chromatids.
Y-chromosome, though an acrocentric, exhibits a characteristic C-band negative feature.

G- and R-Banding

River buffalo chromosomes have revealed a large number of banding homologies
with cattle both at early metaphase (Di Berardino etal., 1981) and prometaphase stages
(Iannuzzi et al., 1 990). In particular each of the 5 river buffalo biarmed pairs originates
from centric fusion translocation between 2 of 10 homologous cattle autosomes. The
five translocations were accompanied by loss of constitutive heterochromatin (Iannuzzi
et al., 1 987) and a pericentric G-positive band in chromosomes 1 p, 2q, 4p and 5q (Iannuzzi
et al., 1990). Brief description of band characteristics of various chromosomes as per
Iannuzzi (1994) is given in Table 8 and banded karyotypes are given in Figs 8 and 9.

EVAL UA TION OF BREEDS

251

Table 7. Relative length of chromosomes of buffaloes

Chromosome No.

Male

Female

7.17±0.09

7.1 1±0.08

7.07±0.03

6.96±0.05

6.55±0.02

6.74±0.1 1

5.74±0.01

5.93±0.03

4.92±0.04

4.94±0.04

4.66±0.07

4.59±0.06

4.41±0.02

4.44±0.02

4.10±0.02

4.40±0.02

4.10±0.03

4.34±0.02

3.89±0.04

4.10±0.06

3.89±0.05

3.88±0.04

3.76±0.04

3.65±0.03

3.69±0.04

3.55±0.05

3.58±0.04

3.52±0.03

3.49±0.03

3.46±0.02

3.43±0.04

3.26±0.03

3.07±0.02

2.96±0.04

2.87±0.01

2.76±0.03

2.68±0.02

2.66±0.02

2.46±0.01

2.37±0.04

2.37±0.02

2.32±0.02

2.25±0.01

2.18±0.03

2.05±0.02

2.07±0.04

1.84±0.01

1.77±0.02

6.10±0.08

6.74±0.04

1.37±0.01

Nucleolar Organiser Regions

Silver staining of metaphase chromosomes revealed the localization of nucleolar
organiser regions (NORs) on the telomeric ends of short arms of chromosomes 3 and 4,
and on terminals of chromsomes 6, 21, 22 and 24.

Chromosomal Aberrations and their Implications

There are several types of chromosomal aberrations giving rise to interspecific
polymorphism and their role in speciation has been well documented. A specific type
of chromosomal re-arrangement, viz. the translocation or centric fusion known as
Robertsonian translocation, has been thoroughly studied in cattle. Initially, this was
observed by Gustavsson and Rockborn (1964) in Swedish White cattle during an inves¬
tigation of blood leukosis. Later studies revealed a polymorphic chromosome system

252

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

Table 8. Details of euchromatic bands of buffalo

Ch. G-band

No.

1 2

1 p: 2 regions; 4 positive G-bands of which
1 is proximal and large, and 1 is telomeric
and small.

q: 4 regions; 12 positive bands; a large
negative central region with a small G-
positive band divides the arm into 2 parts
with 6 close positive bands in the proxi¬
mal half and 5 positive bands in the distal
half.

2 p: 2 regions; 5 positive bands; 3 positive
bands are almost equally spaced.

q: 3 regions; 9 positive bands; 2 large
negative bands divide the arm into 3 parts,
1 proximal with a prominent positive
band, 1 central with 6 equally spaced posi¬
tive bands and 1 distal with 2 positive
bands; telomere negative.

3 p: 2 regions; 5 positive bands; 5 positive
bands are equally spaced; 1 is large and
subcentromeric.

q: 2 regions; 8 positive bands; 4 promi¬
nent proximal positive bands; equally
spaced, 1 is central and large; telomere
psotive.

4 p: 1 region; 3 positive bands of which 2
are close and proximal and 1 is large and
distal, almost telomeric.

q: 3 regions; 8 positive bands; 3 regions;
1 is proximal with 2 bands; 1 is central
with 3 bands and 1 is distal with 3 bands
telomere negative.

5 p: 1 region; 4 positive bands; 1 is
subcentromeric, 2 are proximal and 1 is
distal; telomere negative.

q: 2 regions; 6 positive bands of which 2
are proximal, large and close, and 4 are
distal and small; telomere negative.

R-band

p: 4 positive bands of which 1 is larger
than the other 3 and distantally located.

q: 12 positive bands; 3 evident regions; 1
proximal and small, 1 large and central, 1
telomeric; telomere positive

p: 5 positive bands; 1 large proximal posi¬
tive region and the other has 2 small close
bands; telomere positive,
q: 10 positive bands; 3 prominant positive
bands; 1 proximal, 1 distal and 1 telomeric;
telomere positive.

p: 4 positive bands very large and close;
telomere negative.

q: 7 positive bands; proximal part with 3
small equally spaced positive bands; dis¬
tal part has 3 distinct positive bands; te¬
lomere negative.

p: 4 positive bands, 1 subcentromeric and
another distal and prominent; small
telomeric positive band,
q: 8 positive bands; 3 quite evident, 1
proximal, 1 distal and 1 telomeric.

p: 4 positive bands; 1 proximal, 1 small
central, 2 are distal and prominent, telom¬
ere positive.

q: 7 positive bands; subcentromeric posi¬
tive band, large proximal negative region
and a distal part with 5 close positive
bands, telomere positive.

Table 8. (continued)
1

EVALUA TION OF BREEDS

253

3 regions; 1 1 positive bands; 1 is
subcentromeric, 3 are proximal, 2 are dis¬
tal and prominent; typical central nega¬
tive band; small telomeric positive band.

3 regions; 9 positive bands; a large nega¬
tive band divides 4 positive bands. 2
proximal and 2 central; prominent distal
positive band; small telomeric positive
band.

3 regions; 8 positive bands; 4 large, close
and proximal positive bands almost
equally spaced; distal evident positive
band; telomere negative.

2 regions; 10 positive bands;
subcentromeric positive band, prominent
proximal positive band and 5 close posi¬
tive bands distally located.

2 regions; 7 positive bands; 3 close proxi¬
mal bands and 1 large positive band cen¬
trally located; small telomeric positive
band.

3 regions; 9 positive bands; small posi¬
tive bands of which 1 is subcentromeric,
1 proximal and 2 rather evident close and
distal; large almost telomeric positive
band.

1 0 positive bands; 2 large positive regions,
1 proximal with 3 bands and 1 distal with
3 bands; central positive band.

8 positive band; large proximal positive
bands and 2 close distal positive bands.

8 positive bands; 2 small proximal posi¬
tive bands and 2 rather evident central posi¬
tive bands; telomere positive.

10 positive bands; 1 large negative band
divides the chromosome into 2 large posi¬
tive regions; 1 proximal with 2 positive
bands, 1 central with 4 close positive
bands; telomere positive.

6 positive bands; 4 large positive, 1 proxi¬
mal , 3 distal; large central negative band.

9 positive bands; 2 proximal, 3 central and
2 prominent distal; small telomeric posi¬
tive band.

3 regions; 9 positive bands of which 5 are
proximally and distally located; typical
central negative band; telomere negative.

2 regions; 5 positive bands of which 1 is
subcentromeric, 2 distal and 1 almost
telomeric.

2 regions; 4 positive bands equally spaced
and with decreasing size starting from
centromere.

9 positive bands; 3 prominent proximal, 1
central and 2 close distal positive bands; 2
close telomeric positive bands.

5 positive bands; 2 large proximal, 1 small
central and 1 large distal; very small
telomeric positive band.

4 positive bands; 1 proximal, 1 central and
2 close distal; telomere positive.

254

ANIMAL GENETIC RESOURCES OE INDIA - CATTLE AND BUFFALO

Table 8. (concluded)

2 regions; 7 positive bands; 3 rather evi¬
dent positive bands, 1 central and 2 very
close and distal; telomere positive.

6 positive bands; proximal half with 4 close
positive bands, 1 distal positive band; te¬
lomere negative.

2 regions; 8 positive bands; 2 rather evi¬
dent positive bands are close and
subcentromeric and 3 are distal and
equally spaced; telomere positive.

7 positive bands; 3 large close positive
bands centrally located; telomere negative.

2 regions; 6 positive bands of which 2 are
proximal and close, and 3 large, close and
centrally located.

6 positive bands; 2 proximal and close; 2
large and very close at the telomere.

2 regions; 5 positive bands, 1
subcentromeric, 3 central and 1 telomeric.

4 positive bands; 1 proximal, 1 large dis¬
tal; telomere negative.

2 regions; 6 positive bands, 1 is large and
distal.

6 positive bands; proximal half with 4 large
positive bands; distal negative band; 2
small and telomeric positive bands.

2 regions; 5 positive bands, 2 are proxi¬
mal and 2 distal and close; large central
negative region.

5 positive bands; 2 central and very close
and 1 telomeric.

2 regions; 3 positive bands, 1
subcentromeric and 2 distal, large and
close; telomere negative.

3 positive bands; 1 large proximal, 1 small
central and 1 telomeric.

2 regions; 4 positive bands; 2 proximal,
large and close, and 2 distal and small.

5 positive bands; 1 subcentromeric, 3 large
distal; telomere positive.

2 regions; 5 positive bands; 1
subcentromeric, 1 central and quite promi¬
nent; small telomeric positive band.

4 positive bands; 2 close proximal and 2
close distal.

2 regions; 4 positive bands; all small and
almost equally spaced; telomere negative.

4 positive bands equally spaced; telomere
positive.

4 regions; largest acrocentric; 12 positive
bands; 3 evident and centrally located.

12 positive bands; 1 large proximal and 4
close distal.

2 regions; 6 positive bands; 5 are very
close and 4 of these are large; telomere
positive.

5 positive bands; 4 very small equally
spaced and 1 large telomeric; telomere
negative.

EVALUATION OF BREEDS

255

f'f

%** *€

t a

«>

* P*

.3jfc y».

•*** * ■»

«N ■•
•tO-

m m

,s$ Jg$

■

x y

Fig. 8. GTG-banded buffalo karyotype (Source: lannuzzi, 1994)

256

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Fig. 9. RBG-banded buffalo

EVALUA TION OF BREEDS

257

karyotype (Courtesy R. K. Vijh)

258

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

(Gustavsson, 1 966). The number of chromosome polymorphisms that have been found
in farm animals is very surprising in view of the relatively small number of animals that
have been studied. The chromosomal profile has also helped in solving various other
syndromes in cattle, buffaloes and other farm species.

Robertsonian translocation in cattle: Cytogenetic studies of individual animals and
population samples from cattle breeds have revealed diploid chromosome number of
58 and 59 as well as 60. The reduction in the diploid chromosome number has been
associated with the presence of one or two large metacentric or sub-metacentric auto-
somes, thought to be the result of translocation of the Robertsonian or centric fusion
type.

The 1/29 Robertsonian translocation, found in several breeds, was associated with
the impaired fertility in Swedish red and white breeds, as daughters of the sires het¬
erozygous for 1/29 centric fusion displayed lower non-return to service, although the
sires themselves were of normal fertility (Gustavsson, 1969). Consequently, several
populations of bulls in artificial insemination studs in different countries were screened
and several other types of Robertsonian translocation were also observed involving
other autosomes.

The structural autosomal heritable translocation like reciprocal translocation was
found to cause severe phenotypic effects on the animal. The reciprocal translocations
are known to cause skeletal defects. Herzog and Hohn (1971) reported congenital ab¬
normalities in the calves carrying centric fusions and tandem fusions. Mayr etal. (1983)
studied in 50 German Simmental bulls a reciprocal translocation involving (8; 15) and
(21; 24) with no apparent effect on the bulls. Robertsonian translocation which reduced
the diploid number of chromosomes by one or more depending upon the number of
chromosomes involved, could be a cause of specification in the course of evolution
(Sahai and Mathur, 1981).

XXIX Y chimerism and freemartin syndrome: A freemartin can be defined as “a sexu¬
ally imperfect, usually a sterile female partner of a heterosexual twin.” Hafez and
Jainudeen (1966) defined freemartin as “a twin in which the development of the gonad
has been controlled by the inter-circulating system of the male and female twin foet¬
uses”. In the light of the above definition and later findings, Hafez (1968) redefined the
freemartin condition to include the reception of cells from a male foetus during gesta¬
tion.

Not even a single case has been reported in which a bovine heifer exhibiting the
evidence of choriovascular anastomosis with a male twin has been found to be fertile.
The confirmation of vascular anastomosis would definitely indicate that a female mem¬
ber of heterosexual co-twin is certainly a freemartin which can be proved by clinical
examination, homograft tolerance, blood cell chimerism or by any other method.

EVAL UA TION OF BREEDS

259

Blood Groups

Inherited blood characteristics are controlled through the antigenic structure of the
red cells. Evidence for the existence of species differences in blood of animals was
noticed as early as 1 898. Individual serological differences in the red blood cells within
a species led to the recognition of the ABO blood group system in human beings. These
antigenic specifications have been referred to as blood groups or blood types (Stormont,
1962). Among farm animals cattle blood groups have been studied in detail, and now
12 loci which control polymorphisms are known (Khanna 1968a). These polymorphic
traits have been used as important tools in animal breeding.

In Cattle

Blood group studies in Indian cattle were initiated using complement dependent
haemolytic technique with the method of Ferguson (1941) by IVRI workers in 1958.
These reports confirmed that the red cell antigens of Indian cattle possessed blood fac¬
tors that were identified in Western cattle breeds (Ram and Khanna, 1961; Naik et al.,
1965). Subsequently, several monospecific reagents isolated in zebu had specificities
different from standard reference reagents used in international comparison test con¬
ducted by the ES ABR. Certain unknown antigenic factors were observed in these com¬
parison tests. The identity of these factors and the blood group system to which it
belonged could not be established. However, it was speculated that these mostly be¬
longed to the complex system like B, C or S (Stormont, 1972). Some of these blood
group factors might be zebu specific.

In cattle blood grouping, the red cells of animals are screened for lysis by using
standard antisera in the presence of compliment. There are 12 well-recognized blood
group systems in cattle (Table 9). Their complexity ranges from the simplest L (with 2
alleles and 2 blood types) to B (with over 600 alleles and over 60,000 blood types). The
large number of specificities in the B and C systems make them very useful for parent¬
age pedigree exclusion and breed differentiation. Since most of the blood groups like
other biochemical traits are inherited according to simple Mendelian laws, the inherit¬
ance can thus be controlled independent of herd book records.

The A system phenogroup A1D2Z1 has its origin in Bos indicus. This allele has the
frequency of 0.02 and 0.04 in American Guernsey and Jersey breeds. The occurrence
of A1D2Z1 in Channel Island cattle provided strong evidence that one of the ancestral
lines of these breeds could be traced to Bos indicus (Stormont, 1962).

The extreme discriminatory power of cattle blood typing using 2-3 scores of re¬
agents is tantamount to fingerprinting of the surface of red cell membrane. The com¬
plexity of blood group genetically determined factor was first reflected in the discovery
that a number of blood group factors (B and C systems) segregated in a variety of
unique combinations referred to as phenogroup (Stormont 1950, 1951). It is debatable

260

ANIMAL GENETIC RESOURCES OE INDIA - CATTLE AND BUFFALO

whether the phenogroups of complex B and C systems of cattle are coded by a single
series of allelic genes or by a cluster of closely linked genes. At least 1 1 phenogroups
are distinguishable in the A system, 1,000 in the B system and 100 in the C system.
Knowing the fact that the phenogroups or blood groups in any one system are inherited
independently of those in all other systems, the amount of phenotypic variations in
cattle blood type is almost beyond comprehension (Stormont, 1982). Earlier it was
conservatively estimated that the number of possible blood types was approximately
two trillions (Stormont, 1967).

Table 9. Blood group systems in cattle

System

No. of phenogroups

No. of genotypes

No. of phenotypes

A-H

164

12,530

10,000

630

200

F-V

J-OC

S-V

Source: Stormont (1978).

The most important direct application of the genes controlling blood group factors
lies in the identification of population and maintenance of purity of the breeds. For any
breeding programme, it is imperative that correct records of parentage and pedigree are
available. The reliable and effective check of the pedigree information is particularly
important in this country in view of extensive use of artificial insemination being car¬
ried out in cattle and buffaloes.

The great deal of genetic variations controlled by blood group genes provide a
reliable tool for studying the phylogenetic relationship. Singh and Bhat (1981) ob¬
served a closeness of grey cattle breeds, viz. Hariana, Tharparkar and Ongole, using
biochemical polymorphic alleles. The coloured breeds, viz. Gir, Red Sidhi and Sahiwal,
formed another group. More defined and clear-cut relationship between these breeds is
likely to come out from the information on blood group alleles.

EVAL UA TION OF BREEDS

261

In Buffaloes

Buffalo blood groups studies were initiated 6 decades ago (Singh, 1942). How¬
ever, till date blood typing reagents used are from cattle. In isolated efforts buffalo
blood group reagents have been prepared for blood factor B in water buffalo by iso¬
immunization. Repeated intramuscular injection of small amount of blood ( 1 0 cc) over
a period of 3-4 weeks is done to evoke the products of anti-B and anti-C in the recipi¬
ent.

Khanna (1968b) carried out immunization experiments on buffaloes and developed
33 different blood typing reagents by iso- and heteroimmunizations. The antigens were
designated as A, B, C, etc. in order of their detection. According to Ram et al. (1964),
Murrah water buffaloes reacted with 16 of the 35 cattle reagents.

Reagents have also been produced from hetero-allo-immunization of swamp buf¬
faloes. Cells from river buffalo did not react with the anti-swamp reagents, but cells
from hybrids between swamp and river buffaloes did react (Amano, 1982).

Later, investigations on the blood groups of buffaloes were made using cattle blood
typing reagents. Loypetjra (1962) typed 120 Siamese buffaloes using blood typing
reagents belonging to 9 cattle blood group systems A, B, FV, J, L, M, SU, Z and R S.
He reported that the red cells of buffaloes reacted with the blood typing reagents indi¬
cating cross-reacting antigenic specificities between the two species. Datta and Stone
(1963) typed 40 Indian buffaloes using anti-F, anti-V, anti-J and anti-Z blood typing
reagents of cattle. Only anti-J showed reaction. Ram et al. (1964) typed 150 Indian
buffaloes using 35 cattle blood typing reagents, viz. anti- A, E, G, J, K, L, M, Q, R, Ul,
V, W, XI, Z and 21 unidentified reagents. The buffalo red cells showed crossreactions
with 1 6 reagents including anti-J. These reagents were anti-A, E, G, J, K, L, Q, U, Z
and 7 unidentified reagents. Egyptian buffaloes showed cross-reactivity between the A,
H, O, P, S and J antigenic factors in cattle and buffaloes. Cattle antigenic factors A, B,
K, Y, O, W L, SH, R, U, J , F, V, Z and J had corresponding factors on the red blood
cells of buffaloes from Italy (Bettini and Iannelli, 1967). Bulgarian and Indian buffa¬
loes and their crossbreds were typed against 36 bovine blood typing sera (Mokaveev,
1968, 1970). He observed that Bulgarian buffaloes reacted positively with 28, Indian
buffaloes with 17 and their crosses with 19 blood typing reagents respectively. A close
genetic relationship between Bulgarian and Indian buffaloes was suggested. Out of 36
cattle blood typing reagents used in the typing of red blood cells of Romanian water
buffaloes 13 reagents, Al, B, C2, J, L, P, S, U, V, Y2, El, I and O, showed cross¬
reactivity.

Khanna (1973) blood typed 1,734 buffaloes belonging to 6 breeds, viz. Marathwada,
Murrah, Nagpuri, Nili, Pandharpuri and Surti, against 22 reagents. Distribution of the
factors showed that no factor was exclusively present in a particular population, though
the frequency varied from population to population (Table 10).

262

ANIMAL GENETIC RESOURCES OE INDIA - CA TTLE AND BUFFALO

Table 10. Estimation of gene frequencies at the B blood group system

Breeds/herds No.

tested

BBY

Murrah

Bareilly

0.191+0.034

0.150+0.032

0.058+0.024

0.601+0.0412

Haringhatta

142

0.194+0.027

0.032+0.013

0.129+0.022

0.645+0.0321

Hisar

132

0.043+0.016

0.142+0.026

0.219+0.028

0.596+0.0349

Izatnagar

140

0.107+0.021

0.034+0.013

0.147+0.122

0.712+0.0296

Ludhiana

0.124+0.031

0.091+0.027

0.198+0.034

0.587+0.0433

Mathura

0.107+0.025

0.028+0.014

0.095+0.023

0.770+0.0334

Meerut

129

0.110+0.023

0.044+0.015

0.164+0.026

0.682+0.0322

Pantnagar

122

0.051+0.016

0.005+0.005

0.165+0.025

0.779+0.0284

Visakapatnam

113

0.056+0.017

0.017+0.010

0.163+0.026

0.764+0.0303

Pandharpuri

0.271+0.0889

0.238+0.087

0.327+0.093

0.164+0.0811

Source: Khanna (1973).

Biochemical Polymorphism

Biochemically variable traits have been found to be inherited according to simple
Mendelian laws. These can be useful in identification of pedigrees. The advancement
in immunogenetics and biochemical genetics was stimulated by the hope of finding
direct relationships between biochemically polymorphic and performance traits. Dur¬
ing recent years, a variety of biochemical variants were studied in cattle and buffaloes.

Protein Polymorphism

Protein polymorphisms are usually detected by electrophoresis. This process sepa¬
rates the charged molecules in solutions exposed to a voltage gradient and electric im¬
pulse. The migration of each molecular species is influenced by a variety of factors,
viz. electrostatic charge of the molecule, strength of the voltage gradient and the nature
of medium used for electrophoresis. A variety of staining procedures have been devel¬
oped to identify each polymorphic band. A number of proteins have been studied for
their differential movement under electrophoresis and their polymorphism in cattle
and buffaloes studied in different laboratories. Some of these are given below.

Haemoglobins

Haemoglobins are one of the most thoroughly investigated protein molecules.
Haemoglobins are large spheroid molecules having a haemprosthetic group combined

EVAL UA TION OF BREEDS

263

with a protein moiety, globin. Each molecule consists of 4 polypeptide chains nor¬
mally occurring in 2 pairs of identical chains. It is now well established that differences
in the globin portion of the haemoglobin are responsible for interspecies and intraspe¬
cies haemoglobin differences. Haemoglobin polymorphism has been found in many
species. The incidence of different variants in a species, however, varies from strain to
strain and breed to breed.

In Cattle

Polymorphism in haemoglobin types has been reported in different breeds of cattle.
Naik et al. (1965) reported haemoglobin polymorphism in 5 indigenous breeds of cattle.
Among a Khillari bull, a unique haemoglobin variant named Khilari was idenitified.
Lehman (1959) reported that the gene frequencies of haemoglobin types Hb Aand Hb B
were more or less equal in randomly selected animals of Gir breed, but the genotypic
frequency of HbAB was higher than either of HbAA and HbBB types. However, Naik
et al. (1965) showed higher gene frequency of Hb B in 5 Indian breeds. Balakrishnan
and Nair (1966) reported the gene frequency of Hb A in Red Sindhi, Sahiwal and
Tharparkar cattle to be 0.632, 0.619 and 0.894 respectively. Sen et al. (1966) reported
the gene frequency of HbB to be 0.422, 0.375, 0.300, 0.0176 and 0.295 in Hariana,
Sahiwal, Tharparkar, Red Sindhi and non-descript type cattle respectively. Mangalraj
et al. (1968) reported the frequency of Hb B allele to be 0.36, 0.32 and 0.34 in Ongole,
Kangayam and non-descript cattle respectively.

In Buffaloes

The distribution of haemoglobin types in buffaloes has been reported to be quite
uniform. About 99.1% of samples showed an electrophoretic separation into 2 bands
where the average concentration of haemoglobin was 71 and 29% for the faster and the
slower bands respectively (Khanna,1973). Similar observations were reported by other
workers in the water buffaloes. Naik and Sukumaran (1967), however, reported ab¬
sence of slower bands in a few samples.

The occurrence of the 2-band pattern indicates the existence of polypeptide chains,
one of which may be common for the two bands. The structural studies on haemoglo¬
bin of water buffalo by Balani and Barnabas (1965) showed that the two components
differed from one another in oc-chains while B-chains were common. The oc-chains
were thought to differ in 2 or probably more amino acid residues. More than one type
of cc-chains have been observed in other species also. Ranjekar and Barnabas (1969)
considered that a duplication of the oc-chain genes followed by mutation was respon¬
sible for the presence of two variants oc-chain genes in buffaloes.

The quantitative differences in haemoglobin ratios in the two components were
observed in one of the haemoglobin variant. The haemoglobin ratio was approximately
85/15 in the Al and A2 bands. Abe et al. (1969) found 3 animals which possessed a

264

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

faster haemoglobin component and a faint slower component with much less haemo¬
globin quantity as compared to the normal slower band. Barnabas ( 1 973) also observed
a few buffaloes which had shown comparable quantitative differences.

Another possible explanation is the existence of more than one oc-chain genes
giving rise to quantitative differences in haemoglobin ratio in buffaloes. This could
have resulted by point mutation in one of the several duplicated genes present. It has
been recognized by amino acid sequence studies that the gene duplication and point
mutation generate most genetic variations in the protein structure (Feeney and Allison,
1969; Manwell and Baker, 1970). It has also been reported that DNA present in the
mammalian cells is in excess of what is required to contain all the genetic information.
It has been further deduced that many amino acid substitutions in proteins which be¬
came fixed in different species were caused by selectively neutral mutations.

A total of 1 ,746 buffaloes belonging to 7 buffalo breeds were examined for haemo¬
globin variation using starch-gel electrophoresis. Of these 1,730 animals showed 2
bands designated as A1 and A2 in order of decreasing mobility towards anode, in alka¬
line pH (Khanna, 1973). The concentration of haemoglobin in A 1 and A2 bands was 71
and 29%, respectively, when quantification was done by excising haemoglobin frac¬
tions after performing starch-gel electrophoresis and then measuring the haemoglobin
quantities spectrophotometrically.

No difference in electrophoretic mobility was observed between foetal and adult
haemoglobins in buffaloes. In all, 90 calves below 1 month of age and 14 foetuses
ranging from 6 to 15 weeks of age were examined. One foetus aged 6-7 weeks, how¬
ever, showed a third faint band having slowest mobility.

Transferrins

The transferrin or siderophilin is a specific iron-binding protein. Its major function
is transportation of iron to the bone marrow and tissue storage organs. Transferrin
plays a significant role in the cyclic process whereby iron derived from the catabolism
of haemoglobin and other proteins is conserved by its return to the haemopoietic tis¬
sues. The transferrin also participates directly in the regulaion and control of iron
absorption, and protects against iron intoxication.

In Cattle

The variation in the gene frequency of different transferrin alleles has been re¬
ported by various workers for different breeds of zebu cattle. A high frequency of TFE
among Indian breeds has been observed by many workers. Singh (1974) and Prasad et
al. (1978) reported a high TFE allele in Red Sindhi, Sahiwal and Tharparkar breeds;
however, a low frequency of TFB was also delineated in these breeds. Similar observa¬
tions were also recorded by Singh et al. (1972) in other Indian breeds, viz. Hariana,
Kankrej, Ongole and Gir breeds. According to Singh et al. (1972) occurrence of TfF

EVALUATION OF BREEDS

265

allele in Hariana, Ongole and Kankrej breeds was quite frequent. The occurrence of
different types of transferrin types in Indian cattle breeds are summarized in Table 1 1 .

Table 11. Transferrin phenotypes in Indian milch breeds

Breed Transferrin types

Total

Tharparkar

326

Sahiwal

111

121

290

Red Sindhi

Overall

121

128

220

148

132

736

Source: Shanker (1979).

In Buffaloes

Loypetjra (1962) described polymorphism of transferrin in Siamese water buffa¬
loes. He reported 3 phenotypes having mobilities equivalent of TfAA, TfAD and TfDD
of cattle. Mokaveev (1968, 1970) reported polymorphism in water buffaloes from
Bulgaria, imported Indian water buffaloes and in crosses between the two types of
buffaloes.

He found 3 phenotypes controlled by 2 co-dominant alleles called TfB and TfC.
Khanna (1969) described 3 phenotypes designated as DD, DK and KK in decreasing
order of mobilities towards the anode governed by the alleles having no dominance.
Three transferring phenotypes controlled by 2 co-dominant alleles mirrored in different
nomenclatures have been reported in buffaloes from various countries.

Out of the 3 variants, viz. TfD, TfK and TfN, observed in Indian water buffaloes,
the TfN variant was not reported earlier. This variant was observed in a low frequency
in Nili and Surti breeds (Table 12). These two breeds belong to different regions of
India and have little similarity in their biometrical and morphological characteristics.

In other species of buffaloes from other parts over the world, viz. American bison
{Bison bison), European bison {Bison bonasus) and African buffalo {Syncerus caffer ),
the transferrin are monomorphic. On the basis of segregation of the transferrin pheno¬
types it can be concluded that co-dominant alleles were involved in control of transfer¬
rin polymorphism.

Transferrin polymorphism was studied in 1 ,729 buffaloes, using horizontal starch-
gel electrophoresis ( Khanna, 1973). Five transferrin phenotypes, viz. TfDD, TfDK,
TfKK, TfDN and TfKN, were observed. The family data showed that these patterns
were controlled by 3 co-dominant alleles called as TfD, TfK and TfN in order of de¬
creasing anodic mobilities. The autoradiography confirmed the iron-binding charac¬
teristic of the electrophoretically separated proteins. The neuraminidase treatment

266

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Table 12. Transferrin gene frequencies in different buffalo breeds/herds

Buffalo breeds/

herds

No. of animals
typed

TfD‘

TfK

TfN

Bhadawari

0.06±.017

0.94±.017

Marathwada

Murrah:

0.05±.025

Ambala

171

0.06±0.013

0.94±0.013

Haringhatta

149

0.18±0.022

0.82±0.022

Hisar

129

0.10±0.018

0.90±0.01 8

Izatnagar

210

0.16±0.017

0.84±0.017

Jhansi

108

0.22±0.028

0.78±0.028

Ludhiana

0.15±0.027

0.85±0.027

Mathura

0.08±0.026

0.92±0.026

Meerut

108

0.12±0.022

0.88±0.022

Pantnagar

118

0.26±0.028

0.74±0.028

Vishakapatnam

109

0.12±0.022

0.88±0.022

Nagpuri

0.05±0.018

0.95±0.018

Nili

115

0.1 1±0.020

0.87±0.022

0.02±0.009

Pandharpuri

0.09±0.036

0.91±0.036

Surti

139

0.1H0.018

0.88±0.019

0.01±0.006

Source: Khanna (1973).

reduced the mobilities of the transferrin phenotypes but did not change band pattern.
Each allele produced 3 electrophoretically separated zones. The TfK allele was most
frequent while TfD and TfN were found in low frequencies. Out of 7 breeds studied,
TfN was confined to 2 breeds, viz. Nili and Surti. Age and sex had no detectable effect
on distribution of the transferrin phenotypes. All the populations studied were in Hardy-
Weinberg equilibrium. Significant differences were observed in the gene frequencies
between breeds and herds.

Albumin

Albumin is one of the major serum proteins which has been studied very widely. It
is of paramount importance because of its relative abundance, homogeneity, osmotic
and transport functions. The physiological consequences of the iron binding behaviour
of the serum albumin and affinity for dyes, drugs and other molecules have been em¬
phasized. Albumin has a molecular weight ranging from 65,000 to 70,000 in different
mammalian species.

In Cattle

Albumin polymorphism in exotic cattle imported in India have been studied by
several workers ( Juneja and Chaudhary, 1971; Singh, 1974; Singh and Bhat, 1980a).

EVALUA TION OF BREEDS

267

Three albumin phenotypes were controlled by 2 alleles Alb A and Alb B . However, AlbA
allele was universally common in all the breeds of exotic cattle. In Hariana cattle, only
AlbBB phenotype was prevalent. However, the polymorphism of Alb A and AlbB alle¬
les was reported in Hariana cattle by Khanna and Singh (1974) and Singh and Bhat
(1980a). The albumin polymorphism was also reported to be present in Kankrej, Ongole
and Gir cattle breeds by Singh (1981). Singh and Bhat (1980a) revealed the presence of
4 albumin variants, viz. AlbA> Alb B, Alb c and Alb D, but Alb B was more frequent
among zebu breeds.

In Buffaloes

Albumin polymorphism in Indian water buffaloes was reported by Khanna and
Braend (1968). Three phenotypes controlled by 2 co-dominant alleles called as AlbF
and AlbS were demonstrated. Similar findings were reported by Mokaveev (1968,
1970) in water buffaloes of Bulgarian and Indian origin, by Masina et al. (1971) in
Italian water buffaloes and by Juneja and Choudhary (1971) in Indian buffaloes. Abe
et al. (1969) in Formosan water buffaloes and Osterhoff et al. (1970) in African buffa¬
loes found only 1 type of albumin when subjected to starch-gel electrophoresis. It was
found appropriate to study more buffalo populations of India for this polymorphism, to
look for eventual new variants and for differences between breeds/herds of buffaloes.

Khanna (1973) studied albumin polymorphism in 1,715 buffaloes belonging to 7
breeds. Two electrophoretically separated components called AlbF and AlbS were
observed. Each component consisted of 1 zone. The family material indicated that co¬
dominant alleles were involved in the control of albumin polymorphism in buffaloes.
All 16 populations studied were in genetic equilibrium with respect to the genes con¬
trolling albumin types. Age and sex had no effect on distribution of the albumin pheno¬
types. The frequency of AlbF varied from 0.04 to 0.29. Significant differences were
observed in the gene frequencies between breeds and between herds within a breed. It
was further observed that there was no phenotypic association between the transferrin
and albumin types.

Amylase

Of the various enzymes which catalyse the hydrolysis of the homopolysaccharides,
amylases are the most important enzymes. Their substrate include starch and glycogen.
Amylase has molecular weight of around 45,000. The optimum pH for the enzymatic
activity is 6.9. The enzyme is very stable at room temperature. There are 2 types of
amylases differing considerably in their mode of action. The mammalian amylase or
alpha-amylase degrades starch and glycogen to disaccharide maltose by hydrolysing
1,4 -glycosidic bonds. Plants and micro-organisms contain fi-amylase which produces
maltose units from the non-reducing end of the carbohydrate chains.

268

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

In Buffaloes

In a material consisting of 1,539 serum samples from 7 breeds of buffaloes (Table
13), the amylase was observed to occur in 3 forms by Khanna (1973). The amylase
isozymes were designated as AmC, AmA and AmB in order of decreasing anode mo¬
bilities in the starch-gel. Each amylase isozyme was characterized with 1 electrophoreti-
cally separated zone. A distinct extra shower zone of amylase activity was observed on
addition of calcium chloride ions. This zone remained very near the insertion line of
the samples.

The AmA isozyme was most frequent while the other two variants existed in very
low frequencies. It was assumed that co-dominant alleles were involved in the control
of amylase polymorphism in buffaloes. The limited family data supported this hypoth¬
esis. Further, a very good agreement was found between the observed and expected
amylase phenotypes. The populations studied were in Hardy-Winberg equilibrium. The
gene frequency for AmA ranged from 0.85 to 1 .00, while the frequencies for AmC and
AmB were 0 to 0.03 and 0 to 0.12 respectively. The differences in the gene frequencies
amongst different populations were not very much marked.

Table 13. Amylase gene frequencies in different buffalo breeds/herds

Breeds/herds No.

of animals typed

AmC

AmA

AmB

Bhadawari

0.93±,019

0.07±0.019

Marathwada

10.00

Murrah:

Ambala

171

10.00

Haringhatta

126

0.03±0.010

0.85±0.022

0.12±0.020

Hisar

129

0.01±0.006

0.98±0.009

0.01±0.006

Izatnagar

134

0.93±0.016

0.07±0.016

Jhansi

108

0.96±0.012

0.04±0.012

Ludhiana

0.97±0.013

0.03±0.013

Meerut

108

0.95±0.015

0.05±, 0.015

Pantnagar

0.96±0.016

0.04±0.016

Vishakapatnam

109

0.97±0.01 1

0.03±0.01 1

Nagpuri

0.98±0.01 1

0.02±0.011

Nili

115

0.02±0.009

0.95±0.014

0.03 0.012

Pandharpuri

0.96±0.024

0.04±0.024

Surti

139

0.01±0.006

0.94±0.014

0.05±0.013

Ceruloplasmin

Ceruloplasmin is a blue alpha globulin with a molecular weight of 151,000
(Holmberg and Laurell, 1948). Its purification, function and biological variation have
been reviewed by Laurell (1960). Ceruloplasmin is a glycoprotein and has oxidase

EVALUA TION OF BREEDS

269

activity. Each molecule binds 8 atoms of copper and virtually all of the copper in
plasma is so bound. This protein is of great biochemical and clinical interest, as there is
a regular variation in the ceruloplasmin level in various diseases and during pregnancy.
However, the biological function of this protein is still obscure.

In Cattle

Ceruloplasmin polymorphism was reported in indigenous cattle breeds and their
crosses with exotic breeds by a number of workers. Singh and Bhat (1980b) reported a
pattern of 3 ceruloplasmin variants ( Cp A, Cp B and Cp c) in 6 different combinations,
viz. CpAA, CpAC, CpAB, Cp BB, CpBC and CpCC.

In Buffaloes

Five hundred serum samples of the buffaloes were subjected to starch-gel electro¬
phoresis for the ceruloplasmin typing by Khanna (1973). All the animals were ob¬
served with one band only, showing no polymorphism in this protein.

A number of studies have been conducted to establish the relationship of the blood
groups and biochemical variants with production, reproduction and fitness traits. Some
positive correlations were found among a particular gene frequency with quantitative
traits but, definite relationships could not be established due to lack of data on large
samples from random-bred populations to carry out marker-aided selection for faster
improvement at farm level production.

Molecular Approach

Recently, a more powerful tool in terms of molecular genetics has acquired promi¬
nence in the study of genetic basis for any phenotypic trait/character. This technique
needs to be used in a comprehensive manner to achieve the desired results of genetic
distancing between breeds within a species. It is more powerful because a large number
of loci are studied and meaningful results are expected. Various methods and markers
have been used for identifying the genetic variability or studying the polymorphism
such as RFLPs, RAPDs, AFLPs, micro-satellites and mini-satellites. Micro-satellites
which represent the short simple repeat of DNA sequences are more or less spread in
most eukaryotic genome and can be used for such work. The amount of polymorphism
for micro-satellite loci and the comparative ease of their typing make them ideal mark¬
ers to study genetic variation in population. The information is also vital to determine
the unique genes/genetic groups for taking rational decision for conservation of the
breeds and their genetic variability. After considerable experience the technique of
micro-satellite polymorphism using a set of primers recommended by the FAO (An-
nexure III) for the global genetic distancing project has been finalized under the Net¬
work Project on Animal Genetic Resources for genetic characterization of the cattle
breeds.

270

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

The micro-satellites are the repeats of nucleotides (up to 10 bases) in the genome.
In case of cattle and buffaloes the dinucleotide repeats are maximum followed by
tetranucleotides. Among dinucleotide repeats also CA repeats are reported to be high¬
est. The micro-satellites are less spontaneous to mutations and thus can be used to
characterize a close population breed within a species. The primers have been selected
for dinucleotide CA repeats. All these selected primers are amplifiable with GC content
less than 50% and little changes of mutual dimerization.

The selected primers for micro-satellites are to be screened on 50 unrelated indi¬
viduals of a breed. The detailed technical programme includes isolation of DNA, poly¬
merase chain reaction and polyacrylamide-gel electrophoresis. The allelic frequencies
are to be calculated by using gel documentation system.

Based on these allelic frequencies of various alleles with all the selected primers it
is expected that various breeds within a species can be characterized.

Quantitative Trait Loci (QTL)

Most of the economically important traits of livestock are quantitative in nature
and are controlled by a number of genes and influenced by environment. The genes
influencing quantitative traits have pleiotropic effects and some are linked to each oth¬
ers. Selection of animals is being carried out by man since time immemorial for these
quantitative traits. In the past selection was mostly based on stature/size of the animals
and characters like body colour and horn type. The animal breeders/farmers were al¬
ways interested in enhancement of economic returns from livestock rearing. The method
of selection of animals has changed with the advance in knowledge of genetics. The
selection method used was mostly based on biometrics technique based on the animals’
own phenotypic performance or its relatives performance. However, these techniques
need recording of performance of economic traits in large number of animals to have
substantial genetic gain over the generations. Other limiting factors are that important
economic traits in livestock are sex limited, i.e. expressed in one sex only, e.g. milk
yield and egg production, or are measurable after the slaughter of the animal, e.g. meat
quality. The measurement of quantitative traits in individuals also increases the gen¬
eration interval thereby reducing the gain per year. Moreover, the large genetic varia¬
tion and recording of information under different environmental conditions are also
problems in following the traditional breeding practices. Besides, conventional breed¬
ing techniques do not facilitate exploitation of the individual gene influencing the quan¬
titative traits.

If genetic and other effects on the traits are known at the DNA level, it would be
possible to estimate breeding value of a quantitative trait without phenotypic observa¬
tion of that animal. This would not only result in reduction of generation interval but
also would have more reliability as the observations are not influenced by the environ¬
ment.

EVAL UA TION OF BREEDS

271

Also many breeds in the world have reached the plateau and further improvement
in the performance of these breeds has slowed down. Breeders have started looking for
other tools such as genetic engineering wherein use of genetic markers can be of some
use to them for improving the performance of their livestock. The information gener¬
ated on polymorphic micro- satellite markers will also be useful for construction of
genome map which would be important in mapping and cloning of major genes of
economic importance. This genome map or genetic map in farm animals will help in
identifying the cloned genes which are controlling number of traits of economic impor¬
tance. Availability of such methods would remove the constraints which are being faced
in the genetic map of the animals using conventional methods. It will also be possible
to identify gene markers linked with major genes controlling qualitative traits and to
use them for commercial selection programme. In the long term, such maps would also
facilitate identification and isolation of genes, and creation of animals with pre-deter-
mined phenotype by direct manipulation of candidate genes. The confirmation of par¬
entage record in progeny testing and genetic improvement can also be achieved using
these markers. If a complete map of animals is available, it will be useful to identify
QTL with desirable effect for various traits and selection can be much more effective,
particularly for traits having low heritability, and also economical because animals can
be selected at an early age for those traits expressed in the later part of the life on the
base of QTL marker association.

Geldermann (1975) introduced the term quantitative trait locus (QTL) as a conve¬
nient acronym for a locus which affects performance of a quantitative trait. The same
was described as economic trait locus (ETL) by George and Massey (1991) to empha¬
size the fact that marker-assisted selection (MAS) is concerned with economic traits in
livestock improvement. MAS depends on identifying association between polymor¬
phic genetic markers and linked QTL with useful effects. Its use may be family-
specific, depending on the linkage phase and heterozygosity at the QTL, or apply across
the population if there is linkage disequilibrium. The use of MAS in the genetic im¬
provement of economic merit is limited by several factors. Some of these are: family-
specific nature of information, erosion by recombination, incomplete tracking rates,
site and complexity of the genetic formulation needed and statistical methods required.
These limitations would be substantially reduced if close linkages of markers with QTL
could be found.

The number of QTL with effect on a trait which are enough to be useful in MAS is
likely to be small. The additive genetic effect (a) of QTL is measured (in standard
deviation (SD) units) as half the difference in the economic trait between the homozy¬
gotes at that locus (Falconer, 1989). QTL with small effect are difficult to identify,
estimation will be less precise and individually they will contribute little to the selec¬
tion response. The loci with large desirable effect will be of high frequency due to

272

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

selection. Both theoretical (Falconer, 1989) and deterministic simulation (Smith, 1982)
results show that after 2-5 generations of selection for the economic traits, any gene of
moderate or large effect would have been largely exploited. If the initial frequency of
the favourable allele is low, then exploitation may take 5-10 generations. The number
of QTL with moderate (a = 0.5 SD) effect is limited by the total genetic variation for the
economic trait. The maximum possible number of QTL of moderate effect and inter¬
mediate gene frequency P (0. 1 <P < 0.9) ranges from 1 to 20, with 2- 1 0 covering most
of the cases (Smith and Simpson, 1986).

Marker Assisted Selection (MAS)

Most of the authors agree that MAS is likely to complement rather than replace
conventional selection systems leading to increase in rates of genetic change. MAS
allows selection in early life or selection for sex limited traits. So far, the number of
markers available for selection of QTL is limited and also there is little linkage disequi¬
librium to allow selection across the population. The QTL effects and recombination
rates with markers can be estimated from data on many families using mixed model
method (Kennedy et al., 1992). To determine whether the QTL is segregating within a
family and establishing the linkage phase will require a large number of progeny per
family to be typed for the marker and tested for the economic trait (Weller et al., 1990).
With close linkage there will be more and more disequilibrium, and selection on the
markers will become more effective. Close markers are of value both in the identifica¬
tion phase and in the utilization phase. They will allow to check the QTL and also give
better estimate of its effect. This will also help to separate the recombination rate and
the QTL effect, which tends to be confounded in the estimate of the QTL-marker asso¬
ciation. The use of close markers in within-family selection will allow increase in accu¬
racy of selection and lead to fewer recombination errors and less erosion of information
across generations.

The micro-satellites are simple dinucleotide, trinucleotide and tetranucleotide re¬
peats present in most eukaryotic genome. The polymorphism in these sequences stems
from very large number of simple repeats present at given loci in individual genetic
population. The high level of polymorphism and more or less even distribution of the
simple repeats all over the genome combined with the use of polymorphic chain reac¬
tion for micro-satellite analysis have made them ideal markers for studying genetic
structure of population and evolution for building up linkage maps. These markers will
help in studying genetic diversity, identification of unique genetic resources for parent¬
age confirmation and development of linkage map.

About 200-250 markers would be needed to provide (with 90% probability) a marker
within an average of 10 cM of an individual QTL (Beckmann and Soller, 1983). The
marker density should be sufficient for the initial detection of marker-QTL associa¬
tions. The micro-satellite markers are highly polymorphic repeats that are present at a

EVALUA TION OF BREEDS

273

density of about 2-3 per 1 0 6 bp (Weber, 1 990), and individual loci can be typed by PCR
using specifically designed oligonucleotide primers. Screening for QTL associations is
more efficient if there are many markers with known map positions, so that a subset can
be chosen to give uniform spacing and high levels of heterozygosity .

Mapping QTL in Crosses between Segregating Populations

The QTL may be traced by crossing extreme lines, or of selected and exotic stocks.
The QTL or markers linked to them may be detected in the segregating F2 or back-
crosses. The other route may be to use band sharing of multilocus probes of DNA
fingerprints on the pooled DNA of high- and low-performing progeny of individual
sires (Plotsky et al., 1990). This information is sire family-specific. Unless there is
linkage disequilibrium with the QTL and it has moderate to large effect on the trait
these cannot be detected.

A number of theoretical advances have been taken place with particular relevance
to marker-QTL mapping in cattle. Marker-QTL methods of application to the bovine
genome have been considered in terms of mapping QTL within a particular population.
This is appropriate for most traits of interest in cattle or other animals species, because
such populations are generally polymorphic at both marker alleles and QTL. In some
cases, however, breeds may differ radically in QTL affecting a particular trait, e.g.
resistance to trypanosomiasis of the west African N’Dama breed of cattle or tick resis¬
tance of zebu cattle. In this case it is not possible to map the loci involved by within
breed analyses, because genetic variation at the QTL is not present within either resis¬
tant or sensitive populations. In this case it is possible to cross the two breeds/popula¬
tions and carry out marker-QTL linkage studies by following co-segregation of mark¬
ers and traits within families, pooling results over many families.

Methods of Detecting QTL

Selective genotyping

This method helps in reducing the number of offsprings that need to be scored for
markers by scoring increased number of offsprings for the quantitative traits. This is
particularly important for dairy cattle, because quantitative data on large number of
dairy cows are routinely collected for purpose of herd management and progeny test¬
ing. This method was based on the observation of Stuber et al. (1969), that selection of
quantitative traits changed marker allele frequencies in segregating populations.

The QTL may be traced by crossing extreme lines, or selected and exotic stocks.
The QTL or markers linked to them may be detected in the segregating F2 or back-
crosses. The other range may be to use band sharing of multilocus probes of DNA
fingerprints on the pooled DNA of high and low performing progeny of individual sires
(Plotsky et al., 1990). This information is sire family-specific; unless there is linkage

274

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

disequilibrium with the QTL and it has moderate to large effect on the trait these cannot
be detected.

Grand daughter designs

The second method for reducing number of offsprings scored for markers, at the
expense of increased numbers scored for the quantitative traits, is to progeny test the
offspring to decrease the error variance of quantitative trait evaluation. Application to
dairy cattle is based on the fact that a small number of elite sires father most of the
young progeny-tested sires of any given generation. In this method, sons rather than
daughters of a heterozygous elite sire are scored for markers and divided into two groups
on the basis of the marker allele transmitted from their sire. Each son would then be
progeny tested to estimate his quantitative trait value.

Present Status of QTL in Cattle

Several workers have analyzed QTL-marker linkage for various economic traits in
cattle. Some of the significant observations are given below.

Bovenhuis (1992) estimated direct and linked effects of milk protein genes on milk
production traits. Significant effects of beta-lactoglobulin genotypes on fat percentage
were observed. The beta-lactoglobulin B allele was associated with a higher fat con¬
tent. Animals carrying beta-lactoglobulin AIB genotype had a higher fat content. Kappa-
casein and beta-casein genotypes had significant effects on protein percentage.

Rocha et al. ( 1 992) observed that 3 growth hormones-Taq 1 alleles, viz. B, C and D,
are associated with decrease in birth weight and shoulder width of calves at birth. Cows
homozygous for the B, C or D alleles gave birth to calves that were 4.0 kg lighter than
calves of cows homozygous for A allele.

Georges et al. (1993) reported that a genetic disorder, progressive degenerative
myoencephalopathy ( weaver disease) in cattle was associated with increased milk pro¬
duction. This association resulted from a pleiotropic effect of a single gene, or from
linkage disequilibrium between the gene causing weaver disease and a QTL for milk
yield. A micro-satellite locus (TGLA1 16) closely linked to weaver gene was identified.

Georges et al. (1994) studied genotypes of 1,5 1 8 progeny tested sires from 14 pa¬
ternal halfsib families using 1 59 autosomal micro-satellites markers. The result showed
strong evidence of linkage between these micro-satellites and loci controlling yields of
milk, fat and protein. Each of the mapped QTL affected the traits differently: the QTL
on chromosome 9 increased milk yield without affecting fat or protein content; the
QTL on chromosomes 6 and 20 increased milk yield and reduced fat and protein per¬
centages; the QTL on chromosomes 1 and 10 increased milk yield but seemed to have
opposite effects on milk composition. Ron et al. (1993) typed 7 sires and 101 sons from
a dairy cattle population, suitable for determining linkage of a QTL by grand daughter
design for 5 micro-satellites. The mean number of alleles per locus was 8.2. They con-

EVALUATION OF BREEDS

275

eluded that compared with diallelic markers, the use of multiallelic micro-satellites for
the detection of QTL would enable at least 60% grandsire families to be included in the
analysis and the number of sons typed to be reduced by 40%. Kuhn et al. (1996) ana¬
lyzed 5 German Holstein halfsib families, using grand daughter design to detect QTL
for milk production traits. They observed significant differences in mean breeding val¬
ues between sons receiving alternative alleles in 3 families. The results also suggested
the existence of a quantitative trait locus with positive effects on milk yield and fat and
protein yields in close proximity to 2 markers.

Freyer et al. (1996) used loci controlling alphal-, beta- and Kappa-casein as mark¬
ers. The QTL effect on milk, fat and protein yields estimated by maximum likelihood
method was significant. Liu et al. (1994) also detected significant QTL effects for milk
and protein yields.

Hetzel et al. (1997) typed 16 micro-satellite markers in 7 large halfsib US Holstein
cattle families using grand daughter design. Potential QTL for somatic cell score, fat
yield, fat percentage, protein yield and protein percentage were identified. The result
supported the presence of QTL for milk yield and protein yield on chromosome 21 .

Moody et al. (1997) reported that reasonable power (P>0.75) could be achieved
using a grand progeny design for QTL having moderate effects (0.3 SD) on weaning
weight and large effects (0.4-0.5 SD) on birth, yearling and maternal weaning weights
by genotyping 500 animals.

Taylor et al. (1998) used PCR primers that amplify a 441 bp fragment of GHI to
screen a cattle bacterial artificial chromosome (B AC) library comprising 60,000 clones
and with a 95% probability of containing a single copy sequence. Micro-satellite KHGH1
was isolated from BAC-1 10R2C3 and scored in 529 reciprocal backcross and F2 fullsib
progeny from 41 resource families derived from American Angus and Brahman cattle.
Interval analysis localized effects of Angus vs Brahman alleles on subcutaneous fat and
the percentage of ether-extractable fat from the longissimus to the region of BTA19
containing GHI.

Grape and Schwerin (1998) studied the genotype of 527 bulls of 10 paternal halfsib
families for 7 micro-satellite loci covering 81cM of chromosome 23. They reported
that locus BoLa ADRB3 accounted for approximately 5 and 3% of the additive genetic
variance for dystocia and stillbirths respectively. They also observed QTL on telomeric
region of chromosome 23 affecting milk yield and milk-fat, and the magnitude of the
effects were 1.2 and 4.5% respectively.

Davis et al. (1998) collected data from 599 progeny of Fj Charolais x Brahman
sires mated to dams from a composite population for birth weight and genotyped these
animals for 167 DNA markers. They detected QTL for birth weight on 5 chromosomes:
5, 6, 14, 18 and 21 . The estimates of allele substitution effects ranged from 1 .8 to 3.8
kg. The QTL detected accounted for 31 -40% of phenotypic variance within sire families.

276

ANIMAL GENETIC RESOURCES OE INDIA - CA TTLE AND BUEEALO

Mosig et al. (1998) used pooled DNA from daughters of 7 sires for marker analy¬
sis. The DNA pools were genotyped for 38 markers on chromosomes 1-17 and the
marker spacing was 30 cM. They observed highly significant associations with milk
protein percentage for 9 markers. Statistical analysis showed that selective pooling of
DNA was able to access 81% of the information that would have been available through
individual selective genotyping or total population genotyping. Lipkin et al. (1998)
also reported that selective DNA pooling accessed 80.6 and 48.3%, respectively, of this
information that would have been available through individual selective genotyping or
total population genotyping. Lindersson et al. (1998) used grand-daughter design to
estimate marker-QTL linkage for 5 milk production traits and observed significant ef¬
fects of QTL on fat and protein percentage.

Several genes with major effects on economic traits in domestic animals have been
identified. Methods have been developed for screening of dairy cattle population sys¬
tematically for each gene. The large network for progeny testing in cattle for sire evalu¬
ation provide quantitative traits data and also provide pedigree information. The QTL-
marker linkage has given an opportunity to select animals at very early age. It is a
matter of time when QTL analysis data will be routinely utilized along with conven¬
tional selection methods to bring faster genetic improvement in economic traits of live¬
stock.

EVALUA TION OF BREEDS

277

ANNEXURE I

EVALUATION OF BREEDS UNDER FIELD CONDITIONS
Questionnaire 1 . General information about the householder and animals

Date of visit: . District/Stratum: . Code: ...

Tehsil/Taluka/Zone: . Village:

Code: . Household Number: .

Name & Address .

Name of Enumerator: .

I. General Information

Ag. holding (ha): .

Irrigated (ha): .

Unirrigated (ha): .

Fodder grown: Yes (1) / no (2):

Profession: .

Annual income (Rs.): .

No. of family members:

No. of literate members: .

No. of members engaged in dairying:
Sale / purchase of animals:

II. Utility

Cattle

1. Milk production

2. Agricultural operation:

3. Breeding:

4. Religion:

5. Any other:

III. Management Practices

Housing

during day (1) / night (2)/ both day and night (3) / none (4): .

a) Open (1) / closed (2): . b) Kutcha (1) / Pucca (2): ....

c) Separate (1) / part of residence (2): ....d) Flooring: Kutcha { 1) / Pucca (2):
e) Full walled (1) / half walled (2): . f) Well ventilated: yes (l)/no (2): ...

Winter: . Summer:

Male: . Female:

1) Animal fair: .

2) Middle man: .

3) Any other: .

Buffalo

278

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

g) Sanitary condition of the stall: very clean: Yes (1) / no (2): ....

h) Pucca drain for urine to drain out: Yes (1) / no (2): ....
Wallowing

Morning: ....

Yes (1) / no (2)
Fodder Grown (Yes / no)
Green Fodder

Noon: .

Yes (1) / no (2)

Evening: .

Yes (1)/ no (2)

Dry Fodder

Winter: .

Summer: .

Chaffed (1) / unchaffed (2): ...

Winter: .

Summer: ....

Chaffed (1) / unchaffed (2): ...

Feed

Seeds/grains: . Cakes/concentrate: .

Others: . Feeding: Soaked/cooked/raw: .

Feeding: Mixing with fodder / alone: .... At milking time/other times: .

Cleaning of milking utensils: Yes (1) / no (2): ....

Udders washed before milking: Yes (1) / no (2): .

Health

Disease Treatment Herbal (1)/ Allopathic (2) /Local (3)

Vaccination

Breeding method: Natural (1)/ artificial Insemination (2)

HERD STRENGTH

EVA L DA TION OF BREEDS

279

C/5

-2

T”H

Cl.

-4-*

<L>

1 *
£ §

.3 o
•a *

s i

OQ §

■3

C/5

•3 -o

o a>
a> iu
CX >r
co CQ

Others

280

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

Questionnaire 2. Feeds and feeding practices (individual animals)

Date of visit: .

Tehsil/Taluka/Zone: .
Code: .

Name & Address .

Name of Enumerator:

Allotted No .

Date of birth: .

Dam No.: .

District/Stratum: . Code: ...

. Village:

Household Number: .

Breed: . Classification:

Age .

Sire No.: .

Feeding

a) Grazing Distance (km) Time (hr)

Morning (1) . .

Evening (2) . .

b) Individual (1) / Group feeding (2) .

c) Feed

Morning Noon Evening

Name Qty (kg) Name Qty (kg) Name Qty (kg)

Green fodder
Dry fodder
Concentrate
Minerals

d) Water: Adequate (1) / inadequate (2): . Qty:

Water source (name): .

e) Feeding (green fodder/dry fodder)

a) Green fodder mixed in dry fodder: .

b) Drying method of fodder: .

c) Silage making: .

EVALUA TION OF BREEDS

281

Questionnaire 3. Physical and qualitative traits (individual animals)

District/Stratum:

Code: ..,
Village:

Household Number:

Date of visit: .

Tehsil/Taluka/Zone: .

Code: .

Name & Address .

Name of Enumerator: .

Allotted No: . Breed: . Classification: .

Date of birth: . Age .

Dam No.: . Sire No.: .

Purpose of breeds: milk (1) / meat(2) / draught(3) / others (specify): ....

Hair characters

a. Length Short(l) / medium(2) / long(3): .

b. Sheen Glossy (1) / dull(2): ....

c. Curl Curly (1) / straight(2): ....

Colour

a. Coat (hair): .

b. Skin: .

c. Muzzle: .

d. Eyelids: .

e. Hoofs: .

f. Tail switch: .

Horns

Present (l)/absent (2)

a. Colour: Black (1)/ brown (2)/ white (3)/ others (specify): .

b. Size (cm): .

c. Shape: Straight (1)/ curved (2): .

d. Orientation: .

e. Lateral pointing tips (1)/ inward pointing tips (2)/upward pointing tips (3)/

downward pointing tips (4)/ forward pointing tips (5)/backward pointing tips

(6): .

Ears

a. Length(cm): .

b. Orientation: horizontal l)/dropping(2): .

Head

a. Length(cm): .

b. Poll prominent (l)/not prominent (2): .

c. Any other peculiar character (specify): ....

282 ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

Body

a. Hump: large (l)/medium (2)/small (3): .

b. Dewlap: large (l)/medium (2)/small (3): .

c. Navel flap: large (l)/medium (2)/small (3): .

d. Penis sheath flap: large (l)/medium (2)/small (3)/absent (4): .

e. Basic temperament: docile (l)/moderate (2)/tractable (3)/wild (4): ....

Udder

a. Shape: bowl (l)/round (2)/trough (3)/pendulous (4): ....

b. Fore udder size: large (l)/medium (2)/small (3): .

c. Rear udder size: large (l)/medium (2)/small (3): .

d. Teat shape: cylindrical (l)/funnel (2)/pear (3): .

e. Teat tip: pointed (l)/round (2)/flat (3): .

f. Milk vein: large (l)/medium (2)/small (3): .

Body size

Massive/large/medium/small

Weight (kg) Measurements

a. Birth weight: .... a. Chest girth (cm): .

b. 6-month weight: .... b. Body length (cm): ......

c. 12-month weight: .... c. Height at withers: .

d. 24-month weight: .... d.Tail length (above hock/at hock/ below hock/

e. Weight at 1st mating: . touching the ground)

f. Weight at 1st calving: .

Reproduction (females)

a. Age at 1st oestrus (months): .

b. Oestrous cycle duration (days): .

c. Oestrus duration (hr): .

d. Age at first mating (months): .

e. Age at first calving (months): .

f. Interval from calving to first conception (days):

g. No. of services/conception: .

h. Calving interval (days): .

i. Gestation length (days): .

j. No. of calvings: .

Reproduction (males)

a. Age at training of bull: .

b. Age at first ejaculation/mounting (days): ....

c. Age at first mating (N. S.): .

d. Age at first collection of quality semen (AI): ...

EVALUA TION OF BREEDS

283

Abnormalities

a. Twinning: .

b. Dystocia: .

c. Placental retention: .

d. Abortions: .

e. Stillbirths: .

f. Post-gestational mortality: .

g. Others (specify): .

Type of work

a) Drought tolerance

(allocate grades 1 to 5, l=high)

b) Heat tolerance

(allocate grades 1 to 5, l=high)

c) Purpose: ploughing ( 1 )/threshing (2)/power (3)/etc.

d) Capacity for work: hard (l)/medium (2)/light (3)

e) Average duration of work per day (hr): .

284

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Questionnaire 4. Milk Recording

Name: . s/o: . Village: .

Block: . District: . Milk recorder: .

Animal No: . Breed: . Date of Birth/Age:

Home-bred/purchased: .

1 . Age at first service: .

3. Age of first conception: .
5. Age/date at first calving:

7. Date of conception: .

9. Date of drying: . .

2. Order of lactation: .

4. Date of calving: .

6. Sex of calf & number: . weaned/

unweaned

8. No. of services: . Natural/A. I

No Date of _ Milk yield _ Fat% SNF Remarks

recording Morning Evening Total

Total

EVAL UA TION OF BREEDS

285

ANNEXURE II

BREED DESCRIPTOR

I. General Description

1 . Name of the breed

2. Background for such a name

3. Species name

4. Most closely related breeds

(in appearance)

5. Since when the breed is known

6. a. Native tract of distribution in terms of longitude and latitude

b. Approximate area of distribution (in km2)

7. a. Communities responsible for developing the breed

b. Description of community (farmers/nomads/isolated/tribals)

8. Native environment

a. Soil description

b. Average temperature (10 years record)

c. Minimum temperature: . month of minimum: ...

d. Maximum temperature: . month of maximum: ..

e. Average humidity

f. Minimum humidity: . month of minimum: ...

g. Maximum humidity: . month of maximum: ..

h. Annual rainfall

i. Peak rain: . month of peak: .

j. Annual duration of rain in months

k. Annual duration of drought

l. Annual duration of flood

m. Elevation of land: . mean: . range: .

n. Sub-soil water depth during summer (in metres)

o. Sub-soil water depth during rainy season (in metres)

p. Forest area (in km2)

q. Wet cultivated area

r. Dry cultivated area

s. Uncultivated area

t. Main cultivated cereals

u. Main cultivated pulses

v. Other crops

286

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

9. Feed

a. Major fodder trees

b. Major fodder shrubs

c. Major native fodder grass

d. Cultivated legume fodder and monocot grass

e. Cultivated tubers

f. Source of dry fodder

g. Seed and grain feed

h. Cakes and other concentrates

i. Any reported deficiency of minerals in water

j. Any reported minerals in harmful quantity and source

10. Housing

a. Only during the day

b. Only at night

c. Day and night

d. None

e. Type of housing

1 1 . Herd size

a. Number of breeding females

b. Number of replacement females

c. Number of bullocks

d. Number of calves

12. Mating method

a. Natural service (%)

b. Artificial insemination (%)

II. Physical Characters

\. Colour Male Female

a. Coat colour

b. Skin colour

c. Muzzle

d. Eyelids

e. Tail

f. Hooves

2. Horns Male Female

a. Colour

b. Size

c. Shape (straight/curved)

d. Orientation

EVALUA TION OF BREEDS

287

3 . Ears

a. Length

b. Orientation (horizontal/drooping)

4. Head

a. Forehead (convex/concave/straight)

b. General description

5. Body Male Female

a. Hump (large/medium/small)

b. Dewlap (large/medium/small)

c. Navel flap (large/medium/small)

d. Penis sheath flap

e. Basic temperament

6. Udder

a. Shape (bowl/round/trough/pendulous)

b. Fore-udder size (large/medium/small)

c. Rear-udder size (large/medium/small)

d. Teat shape (cylindrical/funnel/pear)

e. Teat tip (pointed/round/flap)

f. Mi lk- vein (large/medium/small)

III. Performance

1 . Body Weight (kg)

a. Birth weight

b. Pre-weaning weight

c. 12-month weight

d. 24-month weight

e. Weight at first mating

f. Weight at first calving

2. Body Measurements

a. Chest girth

b. Body length

c. Height at withers

3 . Dairy Performance

a. Daily milk yield

b. Peak milk yield

c. Days to reach peak yield

d. Lactation length

e. Lactation milk yield

Male Female

Lactation

II III IV

Pooled

288

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

f. Fat %

g. SNF %

h. Milking rate (litres/min.)

i. Productive life span (month)

j. Dry period

k. Feed conversion for milk

l. Percentage of animals in different lactations

4. Reproduction

a. Males

(i) Age at first ejaculation (days)

(ii) Age at first mating (days)

b. Females

(i)

age at first oestrus

(ii)

oestrous cycle duration (days)

(iii)

oestrus duration (hr)

(iv)

age at first mating

(V)

age at first calving

(vi)

interval from calving to first conception

(vii)

conception rate

(viii)

No. of services per conception

(ix)

service period

(x)

calving interval and range

(xi)

gestation length and range

(xii)

twinning percentage

(xiii)

dystocia percentage

(xiv)

placental retention (%)

(XV)

abortions (%)

(xvi)

stillbirths (%)

(xvii)

post-gestational mortality (%)

5 . Type of Work

a. Purpose (ploughing, threshing, power etc.)

b. Capacity for work (hard/medium/light)

c. Average duration of work per day (hr)

6. Drought Tolerance

(Allocate grades 1-5, 1= high)

7. Heat Tolerance

(Allocate grades 1-5, 1= high)

8. Diseases and Parasites

EVALUA TION OF BREEDS

289

ANNEXURE III

LIST OF PRIMERS OF SELECTED MICRO-SATELLITE MARKERS

Marker

Chromo

some

Primer sequences (5'-3')

Reference*

1 . ETH 225
(D9S1)

GATCACCTTGCCACTATTTCCT

ACATGACAGCCAGCTGTACT

Steffen et al.

(1993)

2. ETH 152
(D5S1)

TACTCGTAGGGCAGGCTGCCTG

GAGACCTCAGGGTTGGTGATCAG

Steffen et al.

(1993)

3.HELI 15
(D15S10)

CAACAGCTATTTAACAAGGA

AGGCTACAGTCCATGGGATT

Kaukinen

&Varvio(1993)

4. ILSTS005
(D10S25)

GGAAGCAATGAAATCTATAGCC

TGTTCTGTGAGTTTGTAAGC

Brezinsky et al.

(1993a)

5. HEL5 21
(D21S15)

GCAGGATCACTTGTTAGGGA

AGACGTTAGTGTACATTAAC

Kaukinen and

Varvio (1993)

6. INRA0052
(D12S4)

CAATCTGCATGAAGTATAAATAT

CTTCAGGCATACCCTACACC

Vaiman et al.

(1992)

7. INRA035
(D16S11)

ATCCTTTGCAGCCTCCACATTG

TTGTGCTTTATGACACTATCCG

Vaiman et al.

(1994)

8. INRA063
(D18S5)

ATTTGCACAAGCTAAATCTAACC

AAACCACAGAAATGCTTGGAAG

Vaiman et al.

(1994)

9. MM8 2
(D2s29)

CCCAAGGACAGAAAAGACT

CTCAAGATAAGACCACACC

Mommens et al.

(1994)

10. HEL9
(D8S4)

CCCATTCAGTCTTCAGAGGT

CACATCCATGTTCTCACCAC

Mommens et al.

(1994)

11. CSRM60
(D10S5)

AAGATGTGATCCAAGAGAGAGGCA

AGGACCAGATCGTGAAAGGCATAG

Moore et al.

(1994)

12. CSSM663
(D14S31)

ACACAAATCCTTTCTGCCAGCTGA

AATTTAATGCACTGAGGAGCTTGG

Barendse et al.

(1994)

290

ANIMAL GENETIC RESOURCES OE INDIA - CATTLE AND BUFEALO

13. HAUT24
(D22S26)

CTCTCTGCCTTTGTCCCTGT

AATACACTTTAGGAGAAAAATA

Harlizius (pers.
comm.)

14. HAUT27
(D26S21)

TTTTATGTTCATTTTTTGACTGG

AACTGCTGAAATGTCCATGTTA

Harlizius (pers.
Comm.)

15. ETH3
(D19S2)

GAACCTGCCTCTCCTGCATTGG

ACTCTGCCTGTGGCCAAGTAGG

Solinas Toldo et
al. (1993)

\1 6. ETH104
(D5S3)

GTTCAGGACTGGCCCTGCTAACA

CCTCCAGCCCACTTTCTCTTCTC

Solinas Toldo et
al. (1993)

17. INRA0325
(D11S9)

AAACTGTATTCTCTAATAGCAC

GCAAGACATATCTCCATTCCTTT

Vaiman et al.

(1994)

18. BM2113
(D2S26)

GCTGCCTTCTACCAAATACCC

CTTAGACAACAGGGGTTTGG

Bishop et al.

(1994)

19. BM1818
(D23S21)

AGCTGGGAATATAACCAAAGG

AGTGCTTTCAAGGTCCATGC

Bishop et al.

(1994)

20. ILSTS006
(D7S8)

TGTCTGTATTTCTGCTGTGG

ACACGGAAGCGATCTAAACG

Brezinsky et al.

(1993b)

21. ILSTS030
(D2S44)

CTGCAGTTCTGCATATGTGG

GACCTGGTTTAGCAGAGAGC

Kemp et al. (1995)

22. ILSTS0344
(D5S54)

AAGGGTCTAAGTCCACTGGC

GACCTGGTTTAGCAGAGAGC

Kemp et al. (1995)

23. ILSTS0332
(D12S31)

TATTAGAGTGGCTCAGTGCC

ATGCAGACAGTTTTAGAGGG

Kemp etal. (1995)

24. ILSTS01 13
(D14S16)

GCTTGCTACATGGAAAGTGC

CTAAAATGCAGAGCCCTACC

Brezinsky et al.

(1993c)

25. ILSTS0541
(D21S44)

GAGGATCTTGATTTTGATGTCC

AGGGCCACTATGGTACTTCC

Kemp et al. (1995)

* fide FAOs’ MoDAD project: Micro- sate llite markers for the analysis of genetic dis¬
tances in domestic animal species, http:dad.fao.org/dad-is/data/molecula/modad.htm

BREED IMPROVEMENT PROGRAMMES

In the beginning of the twentieth century it was realized that a large number of good
breeds of cattle and almost all the breeds of buffaloes which could provide a good
foundation stock under the improvement programmes were available in India. The
Royal Commission on Agriculture recommended that since rearing of bulls would not
be remunerative for the farmers, the Government should build herds of pedigree cattle
for production of superior bulls in large numbers. The establishment of livestock farms
was a major step in this direction. In 1938-39 there were 53 cattle-breeding farms
which have now increased to about 150. The objectives of these farms are to produce
and preserve pure strains of indigenous animals and to improve nucleus herds of these
breeds. These farms produce superior bulls of known pedigree and performance. These
bulls are not only used for production of semen under AI programme but also for distri¬
bution in the field. A number of schemes and programmes were introduced in the field
for improvement of livestock.

CENTRAL HERD REGISTRATION SCHEME (CHRS)

Registration of cattle is considered to be one of the essential steps towards the
improvement of their economic traits. The herd registry associations came into exist¬
ence in various countries in the 1 9th Century and an international convention on the
subject was held in Rome in October 1936. India adopted the main recommendation,
viz. there should be only one herd book for a single breed in each country. This provi¬
sion was made particularly to avoid conflicting standards or methods of recording within
the same country, which may give different interpretation in the international exchange
of animals. This also ensures uniformity in the system of recording, enabling a correct
assessment of the value of animals from its records. Necessary steps are taken to lay
down breed and production standards for several recognized breeds of national impor¬
tance and to open their herd books.

Herd book is a list of animals which qualify the conditions of production and breed
characteristics, laid down under Herd Book Rules & Regulations. Through this process
of certification meritorious pure breed animals are brought on books, thus including
selective breeding on a larger scale resulting in greater multiplication of superior stock.
Registration is also a certificate of quality to help the breeders in sale and purchase of

292

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

the breeding stock. Registration of cattle is the important part of cattle development
activities and improving their economical characters.

In 1941, the Indian Council of Agricultural Research established a nucleus organi¬
zation for the registration of important breeds. By 1949, herd-books had been started
for Sindhi, Sahiwal, Tharparkar, Hariana, Gir, Ongole, Kangayam and Kankrej breeds
of cattle, and for Murrah buffaloes. This scheme was extended to breeding tracts of
important breeds during the Third Five-Year Plan to organize breeders’ societies and to
encourage them to take up this work through their own societies. One such unit was set
up at Rohtak in 1963-64 for Hariana cattle and Murrah buffaloes covering Haryana,
western Uttar Pradesh, north-eastern parts of Rajasthan and Delhi. A similar unit was
set up at Ahmedabad in Gujarat in 1969 for Gir and Kankrej cows.

Registration Procedure

On receipt of the application on prescribed proforma from the breeder, the animal
is primarily selected within one month of calving. Stockman records the first milk
yield. He immediately informs the concerned Field Inspector and also the Assistant
Registrar about his selection.

The Field Inspector is under obligation to visit the animal within 2 months of first
recording for confirmation of breed characteristics and in case he is satisfied he inserts
a brass bottom in the ear bearing the identification number of the animal. The Stock-
man thereafter continues to record morning and evening milk yield exactly at 28 days
intervals till the animal becomes dry. One or two test checkings of milk yield/record¬
ing could be conducted by the Field Inspector and/or by the Assistant Registrar of the
Scheme/officials of the State Animal Husbandry Directorate for individuals under re¬
cording during the entire lactation.

After approval of the Ministry the Final Registration Programme is arranged in
consultation with the State Animal Husbandry Department. The Registration Commit¬
tee examines the recordings and also verifies the breed characteristics and identifica¬
tion of the animals. The animals finally approved are branded on the horn as token of
having been approved.

Formula for calculation of estimated lactation yield

Summation or recorded yield in kg

Estimated lactation = - x

Total No. of recordings

305 days or actual
number of days in
lactation which¬
ever is less

Registration standards

To qualify for registration, the animal, besides being true to its breed characteris¬
tics in respect of type, colour, etc., must produce a minimum quantity of milk during a

BREED IMPROVEMENT PROGRAMMES

293

lactation of 300 days. Initially, the standards were set as: Sahiwal, 1,700 kg; Red Sindhi,
1,400 kg; Tharparkar, 1,400 kg; Hariana, 1,100 kg; Gir, 1,100 kg; Kankrej, 700 kg;
Ongole, 700 kg; Kangayam, 500 kg; and Murrah, 1,400 kg.

The criteria for registration of animals have been revised from time to time taking
into consideration the utility of the breed and the improvement in production levels
over the years. The performance of the Central Herd Registration Scheme was reviewed
in February 1998 and the following recommendations were made:

(a) It was decided that the CHRS should henceforth aim at registering elite animals
only so as to identify the best germplasm. These should then be procured by the
National Semen Grid or its state components for breed improvement. The revised
criteria for registration as laid down by the Ministry is given in Table 14.

Table 14. Revised criteria for su pport to farmers for rearing elite indigenous bovines (1997-98)

Species

Breed

Revised criteria (milk yield in kg)

Category I

Category II

Cattle

Gir

3,500 & above

3,000 to 3,499

Hariana

2,700 & above

2,500 to 2,699

Kankrej

3,000 & above

2,700 to 2,999

Ongole

2,500 & above

2,250 to 2,499

Buffalo

Murrah

3,800 & above

3,200 to 3,799

Jaffarabadi

4,000 & above

3,200 to 3,999

Mehsani

3,300 & above

3,000 to 3,299

Surti

2,900 & above

2,700 to 2,899

(b) It was also decided that the CHRS should expand its activities and cover the entire
breeding tract of a particular breed. Following incentives were also recommended
for maintaining the elite calves as well as the elite mothers under registration:

Category I

-Rs 1,000 per year for the dam for 4 years to cover expenses on insurance cost,
breeding inputs as well as treatment/vaccination.

-Rs 2,000 for the male calf during the first year as support towards feeding and
rearing cost, health cover, insurance cost, breeding inputs as well as treatment/
vaccination.

-All subsequent male calves born out of animals falling in category I will be eli¬
gible for this support.

-The CHRS will enter into an agreement with the recipient of the support who
would be required to rear male calves of elite dams up to the age of 2 years.

294

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Category II

-Farmers whose animals are fit to be registered but do not qualify for the support
money would be given consolation prizes of Rs 500 per animal.

(c) Bulls used for natural service in the area would also be registered on the basis of
breed characteristics and production criteria fixed for that breed.

KEY-VILLAGE SCHEME

This scheme was launched on all-India scale in the First Five-Year Plan to meet the
shortage of bulls. A key-village unit is defined as an area covering a group of contigu¬
ous villages having a population of 1,000 cows and buffaloes. All inferior males are
castrated or removed and the required number of exotic bulls are located in the area.
Simultaneously, measures are directed to protect animals against prevalent contagious
diseases and improve feeding, management and marketing facilities to get the produce
sold to the best advantage of the producer. A key-village may thus be regarded as a
co-operative or a collective farm, which gives advice to the villagers. Records of breed¬
ing, feeding, milk production and disease incidence are maintained by the staff ap¬
pointed by the Government.

A group of 6 to 10 such key-village units form a key-village block having an artifi¬
cial insemination station. Semen is supplied from the main centre to all these units to
provide better breeding facilities. At present there are 550 key-village blocks of differ¬
ent sizes.

INTENSIVE CATTLE DEVELOPMENT PROJECT

Cattle development programmes started earlier could not make much impact on
improvement of stocks because of lack of sufficient inputs and proper marketing facili¬
ties. An area development approach, popularly known as Intensive Cattle Develop¬
ment Project (ICDP), was started in 1966-67 as special development programme - Crash
Programme. It was envisaged to cover 0. 1 million cows/she buffaloes and take under
each project care of all aspects of cattle development such as breeding, feeding and
health control duly supported with extension activities. Each project is linked with a
dairy project to provide marketing facilities. The programme was expected to achieve
a breeding coverage of about 70% of the cattle population of each project and an in¬
crease in milk production by about 30% over a period of 5 years. There are about 130
ICDPs at present.

PROGENY-TESTING SCHEME

A progeny-testing scheme was started in the Third Five-Year Plan to ensure pro¬
duction and identification of superior bulls tested on the basis of performance of their

BREED IMPROVEMENT PROGRAMMES

295

progenies rather than dam’s yield. The tested bulls were used extensively through AI
for achieving higher genetic gain. This programme was first started with Hariana and
Murrah breeds at Hisar (Haryana). The following farms were selected for initiating
progeny-testing programme during the Fourth Five-Year Plan:

1 . State Cattle Breeding Farm, Chakganjaria, Lucknow, Uttar Pradesh Sahiwal

2. State Cattle Breeding Farm, Durg, Madhya Pradesh Sahiwal

3. State Cattle Breeding Farm, Bharatpur, Rajasthan Hariana

4. State Cattle Breeding Farm, Hosur, Tamil Nadu Red Sindhi

5. State Cattle Breeding Farm, Junagarh, Gujarat Gir

6. State Cattle Breeding Farm, Banvasi, Andhra Pradesh Murrah

Buffalo improvement through progeny testing was taken up at several state and
central government livestock farms, e.g. for Murrah breed at Alamadi Farm, Madras
(Chennai); Government Livestock Farm, Banavasi; Government Cattle Breeding Farm,
Anjora; and Government Livestock Farm, Hisar (presently Central Institute for Re¬
search on Buffaloes); and Surti breed at the Government Livestock Farm, Dhamrod.
Progeny-testing programmes were also started at Government Livestock Farms,
Babugarh and Madhurikunj, Uttar Pradesh. At none of these farms, this programme
could yield desired results mainly because of small herd size, absence of proper record¬
ing system, etc. and ultimately it was suspended.

ALL-INDIA CO-ORDINATED RESEARCH PROJECT (AICRP)

Cattle

A co-ordinated research project on cattle breeding was launched by the Indian Coun¬
cil of Agricultural Research with the objective of evolving high-yielding cattle breeds
which could suit local environments in different agro-climatic zones and have high
breeding efficiency. It involved crossing of indigenous cattle breeds like Hariana,
Ongole, Gir, Tharparkar, Sahiwal, Red Sindhi and local with superior exotic breeds like
Holstein-Friesian, Jersey or Brown Swiss. A Central Frozen Semen Bank was set up at
Hessarghatta (Karnataka) for collection, processing, storage and transport of frozen
semen. The AICRP had also the mandate for assessing the production and reproduction
performance of the crossbreds in different regions, and ascertaining the effectiveness
of the level of exotic inheritance and the impact of inter-se breeding crossbreds at dif¬
ferent levels so as to determine the best genetic groups. The results indicated that 3/4th
breeds produced from the different exotic breeds did not perform better than halfbreds
due to various disease and management problems (Bhattacharya, 1984).

The crossbreds maintained between 50 and 62.5% level of exotic inheritance per¬
formed better than all other exotic crosses. Therefore, it has been recommended that

296

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

crossbred progenies (F,) should be covered with crossbred bulls having 50 to 62.5%
exotic inheritance level under field conditions. Crossbreeding with superior exotic
dairy breeds, especially Holstein and Jersey, is being resorted to for increasing milk
production. However, in Kerala, the Brown Swiss is also being used under the cross¬
breeding programme.

Buffalo

The Indian Council of Agricultural Research realizing the importance of buffaloes
as a dairy animal and with a view to pool the resources available to test large number of
bulls at different locations, started the All-India Co-ordinated Research Project on Buf¬
faloes in 1970 at 4 centres, viz. National Dairy Research Institute (NDRI), Karnal;
Punjab Agricultural University (PAU), Ludhiana; University of Agricultural Sciences
(UAS), Dharwar; and University of Udaipur, Vallabhnagar. The main objective of this
programme was to identify bulls of high genetic merit through progeny testing. Young
bulls produced by mating proven bulls with elite buffaloes will be distributed to various
farms in the country. Ludhiana and Karnal centres were given the responsibility of the
Murrah breed, and the other two centres of the Surti breed. During the V Plan major
emphasis was given to transfer of technology and field units were attached to each of
the 4 centres for testing of sires.

Each of the 4 centres would maintain 220 breedable females and a separate elite
herd of 70 buffaloes. Prior to 1 980 the technical programme envisaged evaluation of 8
bulls at each centre; of these 2 were to be finally selected for mating with an elite herd.
Since 1980, 12 sires were to be used for test mating every 2 years in the 2 herds for each
type of buffaloes. The best 2 bulls were to be selected for mating in the elite herds of
Karnal and Ludhiana, as one unit for large-sized breed, and of Vallabhnagar and Dharwad
as a unit for medium-sized breed. It was also recommended to cover a breedable fe¬
male population of 3,000-4,000 animals in field units attached to each centre. Semen of
each bull was to be used both in the herds and the 2 field units simultaneously. It was
recommended that a minimum of 2,000 doses of semen of each bull would be frozen
and 700 doses of each bull would be distributed among the 2 herds and other associated
herds. The bull then should be disposed off for utilization by any other service organi¬
zation. It was also recommended to intensify the sire evaluation programme by using
associated herds besides the existing centres of the project on a voluntary basis. The
technical programme was modified in 1985. Dharwad and Vallabhnagar centres were
advised to keep only the Surti breed while the NDRI and the main centre of the Central
Institute for Research on Buffaloes, Hisar were asked to co-operate in progeny-testing
programme for the Murrah. The PAU, Ludhiana Centre was asked to change over to
the Nili-Ravi and collaborate with the Nabha centre of the CIRB which would also
maintain the Nili-Ravi in place of the existing herd of the Murrah breed.

BREED IMPROVEMENT PROGRAMMES

297

ASSOCIATED HERD PROGENY TESTING PROGRAMME

The institutional programmes on progeny testing did not yield desired results mainly
because of small herd size, thereby allowing a few sires to be tested. This problem was
solved by associating in this programme different herds spread over different localities
and testing sires simultaneously on all the herds. This increases the accuracy of selec¬
tion and also allows more number of sires to be tested. The genotype x environment
interaction is also taken care of. So far the programme has been initiated for 3 breeds,
viz. the Sahiwal, under the leadership of the National Dairy Research Institute, Karnal;
and the Ongole and Hariana breeds under the Project Directorate of Cattle, Meerut. The
population of the Sahiwal breed in various herds is around 3,000 breeding females. The
herd size varies from 50 to about 250 breeding females, spread over a number of loca¬
tions. Initially 3 locations were involved. Later on some more herds were added to the
programme. Most of these herds had varying levels of inbreeding, ranging from 0 to
about 12%. Average milk production in 305 days was about 1,600 kg, body weight at
first calving around 320 kg, and mature weight 360 kg. Calving interval is 450 days and
herd life about 9 years. At present, this programme is going on in 3 herds, one each at
NDRI, Karnal, State Cattle Breeding Farm, Durg, and State Cattle Breeding Farm,
Chakganjaria, Lucknow. All other herds at Flisar, Meerut, Nabha and Nagpur have
been left out because of small herd size.

It was decided that for the purposes of breeding, herds should be treated as one
breeding nucleus and out of all the bulls in service in 1980, based on the performance of
their progeny, dams and sisters, 6 bulls were selected for breeding. Their semen was
frozen, and distributed among these herds. Another set of 13 young bulls was also
selected. Out of these 6 bulls were selected on the basis of their growth performance
and semen test. Breeding plan involves progeny testing of 6 bulls in each set and
subsequently 2 best bulls are selected for nominated matings and improvement. These
bulls are being used on Sahiwal pockets in the country or outside. At present the fifth
set of bulls is under test. The Associted Herd Progeny Testing Programme on Ongole
and Sahiwal is discussed separately under the programmes of the Project Directorate on
Cattle.

MILITARY DAIRY FARMS

Cattle

The military farms of the Union Ministry of Defence maintains large herds of cattle
and buffaloes for milk production. These farms function on the lines of quasi-commer¬
cial departments. The National Commission on Agriculture, 1976 reported the origin
and history of military farms in India. In the latter half of the nineteenth century a large
number of British troops and their families were inducted in India. The responsibility

298

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

for providing rations to these people was vested with the Master General of Supplies.
Milk and milk products were important articles of diet for them and these were being
arranged from local sources. The incidence of diseases among the British troops and
their families was high, and this was attributed to poor quality milk supplied to them.
This situation forced the military establishment to start a dairy of its own in 1889 at
Allahabad. The successful functioning of this farm led to the establishment of more
farms in many other cantonments. On 1 April 1975 there were 24 military farms with
9,835 animals (7,231 cows and 2,604 buffaloes).

Military farms were the first to take up organized crossbreeding of indigenous cattle
with European breeds on a large scale. This was found necessary because of poor milk
yield of indigenous cattle as well as their late maturity and long calving intervals. The
first importation of Ayrshire stock was made in 1907. Military dairy farms formed the
basis for testing the merits of different imported breeds for crossbreeding work. The
RCA was of the view that the military farms had effected great improvement in the
milk yield of their herds, chiefly through crossbreeding and selection, although feeding
and management of cattle had also contributed to this.

Crossbreeding work with European breeds was continued till 1952, when a Com¬
mittee of Experts recommended that in view of dependence on foreign countries for
exotic bulls crossbreeding work should be discontinued and that crossbred stock at
military farms should be backcrossed with bulls of indigenous breeds. It was also
recommended that herds of Indian zebu breeds of cattle should be introduced in these
farms and improved by selective breeding. Crossbreeding was therefore discontinued
and indigenous breeds of cows like Sahiwal, Sindhi, Hariana, Gir and Tharparkar were
introduced. The ban on crossbreeding in military farms was removed in 1958 on the
recommendation of the Reorganization Committee which viewed that crossbred herds
should be enlarged and crossbreeding work undertaken with Friesian bulls. Mainte¬
nance of exotic inheritance at 50% level in crossbreds was suggested by this Commit¬
tee.

The following cattle breeding policy was introduced in the military dairy farms:

1 . Purebreeding of Sahiwal and Sindhi cows yielding or expected to yield 2,000 kg
or more of milk in a single lactation of 300 days.

2. Crossbreeding of Sahiwal and Sindhi cows which yield or are expected to yield
less than 2,000 kg of milk in a single lactation of 300 days, and that of Tharparkar,
Gir and Hariana cows with Friesian breeds to get crossbreds.

3. Forward crossing of crossbred cows with 62.5% or less exotic inheritance with
the Friesian breed.

4. Backcrossing of crossbred cows with over 62.5% exotic inheritance with the
Sahiwal breed.

BREED IMPROVEMENT PROGRAMMES

299

5. Development of a small herd of purebred Friesian cows at Meerut through use
of superior Friesian bulls.

At present military farms in collaboration with the Project Directorate on Cattle,
Meerut, are involved in evolving a new milch strain through interbreeding and selec¬
tion of Friesian-Sahiwal crossbreds available with them. The project was inaugurated
on 23 May 1985 at the Military Farm, Meerut, by the late General A.S.Vaidhya, PSVM,
MVC, AVSM, ADC, the then Chief of Army staff. The main objective of the programme
was to evolve a strain of Flolstein-Sahiwal crossbred cattle yielding 4,000 kg of milk in
a mature lactation of 300 days and with a fat content of not less than 4%. The strain has
been named as ‘FrieswaF.

Buffalo

Military dairy farms maintain a large numbers of buffaloes - mostly graded ones
to meet the requirements of defence personnel. A policy of culling and selection is
being followed for the improvement of buffaloes at these farms. Initially, the culling
level for replacement stock was 1 ,350 kg for the first lactation. It was revised to 1 ,600
kg in 1966 and to 1,800 kg in 1968. In 1978, this was further revised to 2,700 kg for
selection of male calves and to 2,400 kg for female calves (Dahiya, 1978). As a result
of these efforts, lactation milk yield of buffaloes at military farms has increased from
1 ,443 kg to 2,080 kg (Dev, 1 978).

GAUSHALAS

Gaushalas are in existence for the last two centuries. These are being maintained on
account of religio-economic considerations. These institutions are mostly concentrated
in the northern parts of the country. Considering the resources available and the scope
offered by them in supplementing governmental efforts for improvement of cattle for
milk production, the Animal Husbandry Wing of the Board of Agriculture and Animal
Husbandry suggested the need for their reorganization and development.

The reorganization and development of gaushalas as centres for cattle breeding and
milk production started with the setting up of a Central Gaushala Development Board
by the Government of India in 1949. Later, the Central Council of Gosamvardhana
(CCG) was established in 1952 by the Government of India to act as the central co¬
ordinating and advisory body on cattle development. The CCG undertook a detailed
countrywide survey to assess the resources of the gaushalas and to evolve a suitable
scheme for their development.

The survey showed that there were 1,020 organized gaushalas in 21 states which
maintained about 130,000 cattle, produced about 7,500 kg of milk and about 1,400
breeding bulls. About 1 1,000 persons were regularly employed by these institutions,
and on an average, a gaushala possessed 60 ha of grazing area and about 25 ha of

300

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

cultivable land. This worked out to an average of about 0.4 ha of grazing area and 0.2 ha
of cultivable area per head of cattle (NCA, 1976).

The CCG sponsored an ad-hoc scheme for the development of gaushalas and
pinjrapoles in the states and their smooth functioning. Some of the states appointed
Gaushala Development Officers for extending technical assistance and guidance to the
gaushala managements. A comprehensive Gaushala Development Scheme was included
under the Second Plan for the development of 346 gaushalas. In all 242 gaushalas were
assisted during the Plan period. The scheme was continued under the Third Plan for
developing 168 more gaushalas. From the Fourth Plan the scheme was transferred to
the state sector and this programme received very low priority in the allocation of funds.

Most of the gaushalas did not get adequate financial assistance from Central and
State Governments and hence could not follow the advice and guidance rendered by
State Animal Husbandry departments. As such these gaushalas could make little im¬
pact on the improvement in milk production. However, gaushalas at some places like
Nasik, Uruli-Kanchan, Amritsar, Indore and Ahmednagar made a remarkable progress
during these years. This shows that there is great possibility of improving the livestock
wealth of gaushalas if proper assistance is provided. If planned properly, these gaushalas
can become important sources for in-situ conservation of indigenous breeds of live¬
stock. These can also be used for progeny testing large number of bulls as the institu¬
tional farms are not adequate for getting required number of daughters per sire. Some
of these gaushalas are already participating in Associated Herd Progeny Testing Scheme.
Wherever, the gaushalas have non-descript animals, these can be used for crossbreed¬
ing work to improve milk production of these animals.

PROJECT DIRECTORATE ON CATTLE

The Project Directorate on Cattle was established on 3 November 1987 at Meerut
(Uttar Pradesh) to enhance milk production through crossbreeding on the one hand,
and through improvement of indigenous cattle and implementation of field progeny
testing programme in the country on the other hand. The mandate of the Directorate is
to evolve a new breed of cattle ‘FrieswaF (Friesian-Sahiwal) and other crossbred geno¬
types, and undertake programmes on genetic improvement of crossbred genotypes for
high milk yield, and indigenous breeds of cattle for rriilk and draught through progeny
testing using existing set up of organized herds and animals with the farmers (PDC,
1995-96).

Frieswal Project

The objective of this project has been to evolve in collaboration with Military
Farms Directorate a cattle strain ‘FrieswaF, a Holstein-Sahiwal cross, yielding 4,000
kg milk in a mature lactation in 300 days.

BREED IMPROVEMENT PROGRAMMES

301

Initially, crossbred females having 50% and above exotic inheritance, named higher
crosses (HC), of halfbred Holstein x Sahiwal bulls were inseminated with liquid/frozen
semen. The crossbred females having less than 50% exotic inheritance, called lower
crosses (LC), were inseminated with imported frozen semen of proven Friesian bulls to
raise the exotic inheritance of progeny above 50%.

The Frieswal females are being bred in successive generations with the frozen se¬
men of 5/8 bulls. These bulls are the progenies of 3/8 elite cows inseminated with the
imported frozen semen of proven Holstein-Friesian bulls with sire index above 9,000
kg. Further, for interbreeding of Frieswal females, the elite 5/8 Frieswal bull mothers
have also been selected. Bull calves bom to these females are being reared as future
Frieswal bulls.

In the first phase, females (about 1,000) at the Military Farm, Meerut were in¬
cluded in the breeding programme. This continued till the first lactation yield became
available. After the study of performance of progenies at Meerut, the second phase of
the programme comprising about 4,000 females was started at military farms at: Dehra
Dun, Lucknow, Jalandhar, Ambala, Panagarh, Pimpri, Secunderabad, Bangalore,
Binaguri and Bareilly.

The third phase of the programme will include all the military farms covering 1 0,000
to 15,000 cattle. Cows with 5/8 Friesian inheritance have been designated as Frieswal.

Indigenous Breeds Project

Conservation and genetic improvement of important indigenous breeds of cattle
has been taken up by the Project Directorate on Cattle in their respective breeding tracts
through establishing germplasm units and a number of associated herds to be used as
test herds. So far Ongole and Hariana breeds are taken up. In the next phase Gir and
Tharparkar will be included.

The breeding programme for each breed envisages mating of about 75 breedable
females with 4 to 5 genetically superior proven bulls for production of future young
bulls. Out of the male progenies 8 to 10 bulls will be selected at maturity on the basis
of their expected breeding values. About 3,000 doses of semen of each bull will be
frozen. Out of these, about 1,000 doses will be used for sire evaluation at associated
herds and 1,000 each will be maintained at the Germplasm Unit and the Project Direc¬
torate on Cattle. Each bull will be mated with 60 to 70 females at associated herds to
get first lactation milk production records of at least 20 progenies per bull (PDC, 1 995-
96). Herd strength at the Germplasm Unit for Ongole was 55 adult cows and 1 1 bulls,
and that for Hariana was 76 cows and 24 bulls with their followers on 3 1 March 1996.
The total number of females in all the associated herds were 845 and 1,069 for Ongole
and Hariana respectively. Similar programmes are envisaged on other important breeds
of cattle like Tharparkar and Gir.

302

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

Breed
1. Ongole

2. Hariana

Germplasm Unit _

Livestock Research Station,
Lam, Guntur (Andhra Pradesh)

CCS Haryana Agricultural
University, Hisar (Haryana)

_ Associated herds _

1 .Cattle Project, Livestock
Research Station, Lam, Guntur
(Andhra Pradesh).

2. Govemment Livestock Farm,
Chintaladevi, Nellore
(Andhra Pradesh)

3. Government Livestock Farm,
Ramtheertham, Prakasam (Andhra
Pradesh).

4. Government Livestock Farm,
Mahanandi, Kumool (Andhra
Pradesh).

1 .Government Livestock
Farm, Hisar (Haryana).

2. Gaushala,Bhiwani (Haryana).

3. Kurukshetra Gaushala, Hisar
(Haryana).

4. Gaushala, Jind (Haryana).

FIELD PROGENY TESTING

Progeny testing of crossbred bulls was taken up by the PDC during the VIII Five-
Year Plan at 3 fields, viz. BAIF, Uruli Kanchan, Maharashtra; PAU, Ludhiana, Punjab;
and Kerala Agricultural University Mannuthy, Kerala, in continuation of earlier ad-hoc
schemes at these units. In each batch 30 Holstein-Friesian crossbred bulls having 50-
75% exotic inheritance and a minimum of 4,500 kg dam’s mature equivalent milk yield
are tested during a period of 1 5 months. The target is to record at least 40 daughters per
bull spread over different units (PDC, 1995-96).

ANAND MILK PRODUCERS’ UNION LIMITED (AMUL)

Milk production in India is not well organized, and the marketing of milk is domi¬
nated by sheer exploitation by middlemen buyers and distress sale by producers. The
small dairy farmers of Kaira district in Gujarat formed the first primary level milk co¬
operative in 1946 under the guidance of Sardar Vallabh Bhai Patel. He encouraged
them by becoming the Chairman of the Union. This was the first attempt by rural milk
producers to directly reach the urban market without middlemen. It was decided that
milk producers’ co-operative societies should be organized in each village which will

BREED IMPROVEMENT PROGRAMMES

303

federate into a district union. This gave birth to AMUL, an organizational instrument
which services the rural dairy household at both ends - production as well as marketing.
AMUL is the brand name adopted by the Kaira District Milk Producers’ Union Limited
which has its headquarters at Anand, a district town of Kaira district of Gujarat and
located 425 km north of Bombay. AMUL is the abbreviation of the Anand Milk Pro¬
ducers’ Union Limited and means priceless.

The dairy co-operative structure is a 2-tier one. The village society, the first tier, is
mainly concerned with milk production and collection of milk. A milk producer be¬
comes a member by paying Re 1 as registration fee and buying a share of Rs 10. The
second tier is the district union (Kaira District Co-operative Milk Producers’ Union
Ltd, Anand) which represents all the village societies.

The union of milk producers, which had only 924 members of 13 village milk co¬
operatives and was collecting 1,136 tonnes of milk in 1948, grew over the years and
had 532,670 members of 954 co-operatives collecting 229,210 tonnes of milk in 1994-
95 (Vyas, 1997). As the co-operatives grew in size and number, there was a surplus of
milk which the Bombay Milk Scheme was not able tojiandle and the farmers were
again forced to sell it at low rates to the middle men. To cope up with this problem, a
modern new dairy was built at Anand in 1955, with the assistance from the UNICEF,
New Zealand and FAO. It was later expanded in 1958 and then in 1960. The Kaira
Union in 1964, set up a balanced cattle feed plant, donated by OXFAM under the
freedom from Hunger Campaign of the FAO. The Union also provides animal health
care and breeding facilities. It runs a semen production centre at the ODE Farm, 1 8 km
from Anand, to make artificial insemination facilities available to the milk producers.

OPERATION FLOOD (OF)

The Anand pattern of dairy co-operatives has shown a way of getting over many of
the associated problems by effectively organizing milk production, procurement, pro¬
cessing and marketing. In 1963, the National Dairy Development Board (NDDB) was
established at Anand in Gujarat under the aegies of the Government of India as an
autonomous body with the objective of setting up milk producers’ co-operatives on the
Anand pattern in all the country’s major milk-sheds. In 1969, the NDDB conceived
and formulated a programme toward the development of dairy industry in India - the
Operation Flood (Table 15). This programme was established by the Indian Dairy Co¬
operation (IDC). The aim was to create a ‘flood’ of rurally produced milk, assuring the
farmer of remunerative price and a ready market to the urban consumer of wholesome
milk at stable and reasonable prices. The programme was implemented in three phases.

Operation Flood-I (1970-81)

The programme laid emphasis on setting up of Anand Pattern rural milk producers’

304

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

co-operative organizations to procure, process and market milk, and to provide some of
the essential technical input services for increasing milk production. OF-I was launched
in 1 970 following an agreement with the World Food Programme (WFP), which under¬
took to provide as aid 1 26,000 tonnes of skim-milk powder (SMP) and 42,000 tonnes of
butter-oil (BO) for financing the programme.

The programme involved organizing dairy co-operatives at the village level, pro¬
viding the physical and institutional infrastructure for milk procurement, processing,
marketing and production enhancement services at the Union level and establishment
of city dairies. The overall objective of Operation Flood-I was to lay the foundation of
a modern dairy industry in India which would adequately meet the country’s need for
milk and milk products. B) the end of its period, about 13,300 Dairy Co-operative
Societies (DCS) were organized in 27 milksheds, enrolling 1.8 million farmer mem¬
bers. OF-I was extended up to 3 1 March 1981.

Operation Flood-II (1981-85)

The background of the institutional framework of Operation Flood-II essentially
comprised the successful replication of the Anand pattern, a 3-tier co-operative struc¬
ture of societies, unions and federations. OF-II was designed to build on the foundation
already laid in OF-I and the IDA-assisted dairy development projects in Karnataka,
Rajasthan and Madhya Pradesh. The programme was approved by the Government of
India for implementation during the Sixth Plan period, with an outlay of Rs 2,730 mil¬
lion. The project expanded the number of village co-operative societies to 34,500 cov¬
ering 3.6 million farmer members. The major objectives of the Operation Flood-II were
to:

(i) enable some 10 million rural milk producers’ families to build a viable, self-
sustaining dairy industry by mid 1985,

(ii) enable milk producers to rear a National Milch Herd of some 1 4 million cross¬
bred cows and upgraded buffaloes during the 1980s, and

(iii) erect a National Milk Grid which will link the rural milksheds to the major
demand centres with urban populations totalling some 150 million.

Operation Flood-Ill (1985-96)

Phase III aimed at consolidation of the gains of the earlier phases. The main focus
of the programme was on achieving financial viability of milk unions/state federations
and adopting the salient institutional characteristics of the Anand pattern co-operatives.
The programme covered some 170 milksheds of the country by organizing 70,000 pri¬
mary dairy co-operative societies. Its major emphasis was to consolidate the achieve¬
ments gained during the earlier phases by improving the productivity and efficiency of
the co-operative dairy sector and its institutional base for its long-term sustainability.
For improving the productivity of dairy cattle and thereby milk production the OF

BREED IMPROVEMENT PROGRAMMES

305

programme provided animal health and breeding facilities. Nearly 40,313 DCS have
been covered with the animal health programme, and 16,280 DCS with artificial in¬
semination facilities.

Table 15. Operation Flood at a glance

Parameters Phase I

Phase II

Phase III

1981

1985

1990

1994

1995

1996

No. of milksheds

136

170

No. of DCSs (thousands)

13.3

34.5

60.8

67.3

69.6

72.7

No. of farmer members

(million)

Average milk

25.6

57.8

98.1

111.4

102.0

109.4

procurement (kg)

Processing capacity (II pd)

Rural dairies

35.9

87.8

140.3

167.5

193.7

Metro dairies

29.0

35.0

37.9

38.8

52.30

72.40

Milk marketing (II pd)

27.9

50.1

72.5

86.24

94.0

93.38

Milk drying capacity

261.0

507.5

663.0

831.5

842.0

974.0

(tonnes/day)

Investments (Rs million) 1,165

2,772

4,116

6,906

8,962

13,031

Source: Gupta (1997).

The year 1 995-96 marked the termination of Operation Flood III, funded by a World
Bank loan, EEC food aid and internal resources of the NDDB. At the conclusion of the
Operation Flood III, 72,744 DCSs in 170 milksheds of the country, having a total mem¬
bership of 94 million had been organized. The targets set have either been effectively
achieved or exceeded.

The conditions for long-term growth in procurement were created. An assured
market and remunerative producer prices for raw milk, technical input services includ¬
ing AI, balanced cattle feed and emergency veterinary health services have all contrib¬
uted to sustained increase in milk production.

Operation Flood has been able to modernize the dairy sector to a level from where
it can take off to meet not only the country’s demand for milk and milk products in the
next century but can also exploit global market opportunities.

CATTLE BREEDING POLICIES

Cattle rearing in India mainly centered around production of bullock power for
agricultural operations and transportation. Hardly any emphasis was laid on production
of milk from these cows. The Royal Commission on Agriculture (RCA) felt that the

306

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

most suitable cow under these conditions would be the one capable of producing strong
calf and yielding about 450 to 700 kg of milk. Since this quantity of milk would not be
sufficient for meeting the requirements of urban population, the RCA anticipated that
commercial dairy farms were likely to start crossbreeding for supplying milk to the
cities. However, it felt that the public sector department should concentrate only on
improving indigenous breeds like Sahiwal, Sindhi and Hariana. Olver (1936) noted that
systematic improvement of indigenous breeds by selective breeding, better feeding and
improved management appeared to be a better alternative as compared to introduction
of European breeds for improving milk production. Wright ( 1 937) and Peppevall ( 1 945)
also strongly opposed adoption of large-scale crossbreeding and suggested that steps
should be taken to improve milk production potential of indigenous cattle. It was also
emphasized that the breeding policy must take into consideration the environment un¬
der which these animals had to live and produce.

In 1949, the Goseva Sangh, Wardha advised the Government of India that the ulti¬
mate aim in the development of cattle should be the production of dual-purpose ani¬
mals and that the buffalo might also be treated as a dual-purpose animal in those areas
where male buffaloes were used for cultivation purposes. The ICAR considered the
above suggestion of the Goseva Sangh and recommended adoption of the following
course for the improvement of cattle in the country:

1 . Since a large percentage of our cattle population comprises non-descript animals, it
is essential in the interest of producing a general utility animal that it should
combine in itself, draught and milk qualities to the optimum extent; in other words
if in non-descript cattle these two qualities are combined to an average degree to
start with the purpose will be served.

2. In areas where specific types (as distinct from well-defined breeds) exist the policy
should be to effect improvement by selective breeding with a view to improving
both milk and work qualities.

3 . In the case of well-defined breeds, the objective should be to put in as much milk in
them as possible without materially impairing the work quality.

4. In the case of well-defined milch breeds, the number of animals of which has con¬
siderably decreased after partition, the Committee'is of considered view that it will
be in the larger interests of the country as a whole to develop their milking capacity
to the maximum by selective breeding and to utilize them principally for the devel¬
opment of cattle in under-developed areas.

In 1 959, the Government of India set up an expert committee to review the progress
of the Key-Village Scheme. The Committee recommended that no crossbreeding should
be permitted in areas where specialized breeds already existed, but milk production

BREED IMPROVEMENT PROGRAMMES

307

should be increased by undertaking improvement in buffaloes and even by crossbreed¬
ing non-descript cattle with exotic cattle breeds in areas where environmental condi¬
tions are favourable. This view was recommended by the Animal Husbandry Wing at
its Fourteenth Meeting in 1961.

The cattle breeding policy in general and the policy to be adopted concerning cross¬
breeding with exotic breeds were examined in 1961 by a Committee set up by the
Central Council of Gosamvardhana. The Committee recommended that crossbreeding
programmes should be taken up in an intensive manner using two or more exotic breeds
in 3 selected areas, one each in the plateau, the plains and the hills. It was also sug¬
gested by the Committee that while taking up crossbreeding on a large scale in new
areas, the places should be carefully selected so that crossbreeding might not conflict
with the needs and preferences of the local farmers. It was further proposed that in the
plains crossbreeding should be started in areas where the holdings are small, agricul¬
ture is intensive, cattle are stall-fed and farmers are interested in breeding cows for milk
production.

The Scientific Panel on Animal Husbandry reviewed the cattle breeding policy in
1965 and suggested that all improvement programmes should be undertaken in an in¬
tensive and co-ordinated manner along with simultaneous provision of favourable en¬
vironment. Crossbreeding was adopted as the major breeding policy in the Fourth
Five-Year Plan. It was stressed that the success of crossbreeding programme would
depend upon the quality of crossbred bulls used for inter-se mating. The Royal Com¬
mission on Agriculture in its report concluded that breeding for milk production should
be concentrated in milk-shed areas that could be conveniently linked up with the dairy
projects. Milk production should be attempted through a system of planned cross¬
breeding, selective breeding and grading up of indigenous cattle. The Commission
further suggested among the indigenous breeds the following that show promise for
either selective breeding or grading up cattle in other areas: Hariana for large tracts of
Haryana, Punjab, Uttar Pradesh, Madhya Pradesh, Rajasthan and Bihar; the Tharparkar
for Rajasthan, Madhya Pradesh and Uttar Pradesh; the Sindhi for Kerala, Tamil Nadu,
Orissa, Assam and hill areas; and the Kankrej for Rajasthan, Gujarat and Madhya Pradesh.
Selective breeding either through AI or natural service should be undertaken in the
tracts of these breeds. This will preserve, improve and multiply animals of these breeds.
Progeny-tested bulls should be used for breeding. Graded stock should be further im¬
proved through the use of superior bulls selected on the basis of their pedigree perfor¬
mance. Specialized draught breeds like Nagori, Amritmahal, Hallikar and Deoni should
be improved for draught quality of their bullocks as the breeders in these areas derive
a large income by sale of bullocks.

With the advent of AI and the introduction of crossbreeding in 1961, the official
policy recognized crossbreeding of non-descript cattle with exotic donor breeds as a

308

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

tool for improving milk production. The policy for crossbreeding was to use the non¬
descript cattle as the foundation stock and to limit the exotic inheritance to 50% - one
generation of breeding of the indigenous cows with exotic breeds to create crossbreds
and then to inter-se mate the to ensure a 50% exotic inheritance enabling both
endurance and productivity. The exotic donor breeds used initially were Jersey, Brown
Swiss, Red Dane and Holstein-Friesian. The choice of the exotic donor has now nar¬
rowed down to Holstein and Jersey, with Holstein predominating the market.

Crossbreeding was initially restricted to hill areas and areas with a preponderance
of non-descript cattle. There was no intention to crossbreed pure Indian breeds of
cattle. But the immediate economic gains lured the farmers to go for crossbreeding on
a large scale. This coupled with faulty breeding plans and non-availability of indig¬
enous purebred breeding bulls has led to the expansion of the crossbreeding programme
nation-wide, even in the home tracts of the pure Indian breeds.

The policy for pure breeding the Indian breeds of cattle did not take off for various
reasons: (i) improvement in production and productivity was gradual - not spectacular
enough to encourage farmers to progressively support it; (ii) non-availability of proven
sires among these breeds - all efforts of states to produce proven sires in their cattle
farms failed; (iii) quality, coverage and effectiveness of the extension support system
for breeding services were all inadequate; and (iv) above all, the absence of breeders
organizations for each of these breeds in their respective home tracts, capable of pro¬
viding both technical as well as advisory services required by the breeders.

Though crossbreeding was taken up on a large scale with much expectation, yet
crossbreds were unable to deliver the goods under field conditions. The main reasons
for the poor performance of crossbreds were: (i) non-adaptability to local agro-climatic
conditions; (ii) availability of low quality feed and fodder resources; (iii) poor resis¬
tance to tropical diseases; (iv) instability of crossbred populations; and (v) non-avail-
ability of superior F crossbred bulls for inter-se mating and more recently because of
farmers’ preference for buffalo milk especially in northern parts of India like Punjab,
Haryana and western Uttar Pradesh. On the other hand, the indigenous breeds are
evolved in this type of environment and are adapted to these conditions. They are able
to survive on low quality roughage and are resistant to tropical diseases. The input-
output benefit ratio goes in favour of indigenous breeds rather than crossbreds as most
of them survive and produce under zero-input conditions. It is important to produce
sufficient quantities of milk to meet the demands of growing human population, but
simultaneously it is also important to conserve and improve indigenous breeds for fu¬
ture use. Under these circumstances, breeding policy should be formulated separately
for each region taking into consideration the availability of infrastructure, local agro-
climatic conditions and specific type of animals.

BREED IMPROVEMENT PROGRAMMES

309

Pure Breeding

Red Sindhi, Sahiwal, Tharparkar and Gir breeds are good and efficient milk pro¬
ducers. If developed and bred properly, these breeds can be comparable with exotic
breeds. These should be bred in pure form in their respective breeding tracts. Elite
females (above 2,500 kg) should be maintained for production of future bulls. Young
male calves should be selected on the basis of their dams’ yield and physical appear¬
ance. These bulls should be progeny tested under field. Female and male calves
should then be selected out of these bulls and brought to the elite herd to repeat the
cycle. This will help in continuous supply of superior bulls and improve the breed.
Surplus males should be castrated at an early age and used for draught purpose. Selec¬
tive breeding should also be followed for other important dual and draught breeds. The
existing farms of these breeds should be strengthened to make them bull mother sta¬
tions. At least one bull mother station for each breed should be established in the
breeding tract.

Crossbreeding

In areas, where resources are available in terms of feed and fodder, health cover,
etc. low producing non-descript cattle should be crossed with superior exotic breeds.
Exotic breed should be selected depending upon the agro-climatic conditions of the
area. The Holstein-Friesian should be introduced in areas where irrigation facilities are
available and fodder can be cultivated. In hilly regions, the Jersey is the best choice
because of its short size and low feed requirements. In Kerala, the Brown Swiss is
being used for crossbreeding.

The level of exotic inheritance should be maintained at 50%. Exotic inheritance up
to 75% should only be allowed in areas where very good infrastructure facilities are
available like in Punjab, some parts of Haryana and Tarai regions of Uttar Pradesh.
Inter-se mating should be practised among FjS. Crossbred bulls (FjS) of superior ge¬
netic potential should be selected through progeny testing and then used extensively
among crossbreds. Necessary health measures should also be taken to avoid outbreak
of any epidemic.

Grading Up

Majority of the indigenous cattle survive in areas where feed and fodder resources
are negligible, climatic conditions are extreme and agriculture production is very low.
Crossbreds are unable to survive and produce efficiently in these conditions. Non-descript
cattle of these regions should be upgraded with the superior breeds to improve their
productivity. The choice of the improved breed should be according to the specific
requirements of the particular region.

310

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

BUFFALO BREEDING POLICIES

India possesses the best dairy breeds of buffaloes. Hence there is no scope for
introducing superior germplasm from outside as has been done for improving local
cattle. Improvement in buffaloes can, therefore, be brought only through selection.
With the existing range of variation from a few hundred to 4,500 kg or more of milk
production, it is obvious that there is great scope for bringing about genetic improve¬
ment of the buffalo stock. To bring in genetic improvement for milk production in
buffaloes, selection within superior dairy breeds such as the Murrah, Nili-Ravi, Mehsana,
Surti and Jaffarabadi needs to be done, and also upgrading of low producing and non¬
descript buffaloes with these superior dairy breeds. The success of the breeding
programme is dependent on the skills of the animal breeder in selecting superior sires
and dams for future replacement and of future sires. Young males should be selected
for breeding purpose on the basis of pedigree programme and then subjected to progeny
testing.

Progeny testing is the most efficient method for selection of bulls because it brings
maximum genetic improvement (110-140 kg) as compared to selection of bulls from
high yielding dams (70-90 kg), or by selecting sons of elite dams by mating with
proven bulls (110-115 kg) (Dev and Tiwana, 1978). A major limitation in this regard is
the absence of any planned programme for progeny testing and availability of sufficient
records per sire for estimating its breeding value with high degree of accuracy. A few
institutional herds under test have limited accuracy and produce extremely small num¬
ber of progeny-tested bulls. Consideration of farm recording with the recording of
progenies of sires under test in the field have not yielded any additional information
which could be used fruitfully. Field recording of performance data will allow testing
of large number of bulls with reasonably high accuracy. But it requires standardization
of techniques in terms of identification of progenies, recording of data under field con¬
ditions, etc.

Crossbreeding in Buffaloes

Except for large populations of established breeds of the buffaloes, most of buffa¬
loes can be improved by crossing them with Murrah or Nili-Ravi. In Gujarat, farmers
have been breeding Surti buffalo cows with the Murrah or Jaffarabadi bulls. The Mehsana
is said to be a breed developed from the crossing of Surti buffalo cows with Murrah
bulls. The Surti is well known for high reproductive efficiency and the Murrah for high
milk production. The age at first calving of the Murrah x Surti crossbreds was 41.00
months compared to 41 .97 and 48.20 months in Murrah and Surti heifers respectively.
First lactation milk production in the crossbred buffaloes was 1,415.6 kg compared to
1,109.8 kg in the Surti. Mass selection would have taken at least 30 years to achieve

BREED IMPROVEMENT PROGRAMMES

311

this increase in milk yield. The lactation length of the crossbreds was similar to that of
Murrah buffaloes but longer than of the Surti. The present increase in production in
crossbreds per generation was almost 27.5% which is considerably high. The average
dry period of the crossbreds was 106.67 days in comparison to 157.93 and 165.07 days
in Murrah and Surti purebreds respectively. Similarly, the average calving interval of
the crossbreds was 41 1 .33 days in comparison to 468.92 and 487.84 days in Murrah
and Surti breeds respectively (Basu, 1 985). The crossbreds surpassed the performances
of both the parental breeds. Murrah bulls/semen have been used indiscriminately for
crossbreeding with, almost all other breeds like the Surti, Nagpuri, Jaffarabadi,
Pandharpuri and Bhadawari, thus genetically diluting these breeds. Local buffaloes of
coastal areas of Andhra Pradesh have been graded up with the Murrah and the resulting
animals are now called the Godavari buffaloes. Godavari is very similar to the Murrah
in physical conformation and performance. Cattle and buffalo breeding policies in dif¬
ferent states are given in Tables 16 and 17 respectively.

MULTIPLE OVULATION AND EMBRYO TRANSFER

Genetic gain of one standard deviation of selected trait per generation can be ob¬
tained if the progeny-testing programmes are well organized and supported by reliable
field recording. Unfortunately, field recording of the production traits on a meaningful
scale is the main obstacle and n6 breeding plan could be efficiently applied in the ab¬
sence of sufficiently large and reliable records.

In recent years the possibility of increasing animal productivity by controlled breed¬
ing has been explored. Embryo transfer, often viewed as counterpart of artificial in¬
semination, is one of the techniques of controlled breeding where a superior animal, i.e.
a donor, is superovulated. More than one embryo can be recovered at a time and trans¬
planted into recipient females to increase the number of progeny per female. In 1987,
the Government of India initiated a National Science and Technology Project on Em¬
bryo Transfer in Cattle and Buffaloes implemented by the Department of Biotechnol¬
ogy, Ministry of Science and Technology, jointly with the Ministry of Agriculture and
Science and the Indian Council of Agricultural Research (ICAR). The project was
implemented at the National Dairy Development Board (NDDB) as the lead agency, in
collaboration with the National Institute of Immunology (Nil), New Delhi, the Na¬
tional Dairy Research Institute (NDRI), Karnal, the Indian Veterinary Research
Institute (IVRI), Izatnagar, and the Central Frozen Semen Production and Training In¬
stitute (CFSP&TI), Hessarghatta, as the collaborating agencies. Under the project, 4
regional centres have been established at Nasik, Nekarikallu, Rae-Bareli and
Hessarghatta. The research component is being looked after by the collaborative agen¬
cies. They are providing research input to lead implementing agency which has the
responsibility to maintain a nucleus herd of superior animals for breeding purposes and

312

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND P UFFALO

Table 16. Cattle breeding policy in different states

State Breed Breeding Policy

1 2 3

Andhra Pradesh

Ongole

Malvi

Hallikar

Assam

Local cattle

Arunachal Pradesh

Local cattle

Bihar

Local cattle

Delhi

Hariana

Non-descript

Gujarat

Gir

Kankrej

Goa

Local cattle

Haryana

Hariana

Sahiwal

Non-descript

Himachal Pradesh

Local cattle

Jammu & Kashmir

Local cattle

Kerala

Local cattle

Crossbred cattle

(Sunandani

breed)

Karnataka

Deoni

Krishna Valley
Khillari

Selective breeding in Ongole: grading up of
non-descript with Ongole
Selective breeding in Malvi in pockets, grading
up of Malvi with Tharparkar and Deoni
Selective breeding in Hallikar; grading up of non¬
descript with Hallikar

Grading up with Hariana and Red Sindhi; cross
breeding with Jersey

Grading up with Red Sindhi and Hariana; cross
breeding with Jersey

Grading up with Tharparkar, Hariana and Red
Sindhi; crossbreeding with Jersey
Selective breeding

Grading up with Hariana and Tharparkar; cross¬
breeding with Holstein-Friesian
Selective breeding in Gir and Kankrej; grading
up of non-descript with Gir and Kankrej; cross¬
breeding with Holstein-Friesian and Jersey
Grading up with Red Sindhi; crossbreeding with
Jersey

Selective breeding
Selective breeding

Grading up with Hariana, Tharparkar and
Sahiwal; crossbreeding with Jersey and Holstein-
Friesian

Grading up with Hariana and Red Sindhi; cross¬
breeding with Jersey

Grading up with Red Sindhi, Kangayam and
Tharparkar; crossbreeding with Jersey and
Brown Swiss

Selective breeding; use of ¥] crossbred bulls ob¬
tained by crossing indigenous cattle with
progeny-tested Jersey, Brown Swiss and Holstein
Friesian bulls
Selective breeding
Selective breeding
Selective breeding

Table 16. (concluded)

BREED IMPROVEMENT PROGRAMMES

313

2 3

Amritmahal

Selective breeding

Hallikar

Selective breeding

Non-descript

Grading up with Red Sindhi crossbreeding with
Jersey and Holstein-Friesian

Madhya Pradesh

Nimari

Selective breeding

Malvi

Selective breeding

Kenkatha

Selective breeding

Non-descript

Grading up with Gir, Tharparkar, Hariana,
Sahiwal and Ongole; crossbreeding with Jersey

Maharashtra

Khillari

Selective breeding

Dangri

Selective breeding

Gaolao

Selective breeding

Nimari

Selective breeding

Non-descript

Grading up with breeds of the region and
Hariana; crossbreeding with Jersey

Manipur

Local cattle

Grading up with Red Sindhi; crossbreeding with
Jersey

Orissa

Local cattle

Grading up with Red Sindhi and Hariana; cross¬
breeding with Jersey

Punjab

Local cattle

Grading up with Sahiwal and Hariana; cross¬
breeding with Holstein-Friesian

Rajasthan

Nagori

Selective breeding

Malvi

Selective breeding

Rathi

Selective breeding

Non-descript

Grading up with Hariana, Gir and Tharparkar;
crossbreeding with Jersey

Tamil Nadu

Kangayam

Selective breeding; grading up with Tharparkar

Hallikar

Selective breeding

Umblacherry

Selective breeding

Bargur

Selective breeding

Non-descript

Grading up with Hallikar; crossbreeding with
Jersey

Tripura

Local cattle

Grading up with Tharparkar; crossbreeding with
Jersey

Uttar Pradesh

Kenkatha

Selective breeding

Non-descript

Grading up with Sahiwal, Tharparkar, Red Sindhi
and Hariana crossbreeding with Jersey and
Holstein-Friesian

West Bengal

Local cattle

Grading up with Hariana, Tharparkar and
Sahiwal; crossbreeding with Jersey

Source: Singh and Gumani (1997).

314

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Table 17. Buffalo breeding policy in different states

State

Breed

Breeding Policy

Andhra Pradesh

Gan jam

Selective breeding in Ganjam

Local

Grading up with Murrah

Assam

Local

Grading up with Murrah

Bihar

Local

Grading up with Murrah

Delhi

Murrah

Selective breeding

Non-descript

Grading up with Murrah

Gujarat

Jaffarabadi

Selective breeding

Mehsana

Selective breeding

Surti

Selective breeding, crossing with Murrah

Goa

Local

Grading up with Murrah

Haryana

Murrah

Selective breeding

Local

Grading up with Murrah

Kerala

Local

Grading up with Surti

Karnataka

Local

Grading up with Murrah and Surti

Madhya Pradesh

Local

Grading up with Murrah

Maharashtra

Nagpuri

Selective breeding

Pandharpuri

Selective breeding

Non-descript

Crossing with Surti and grading up with Murrah

Orissa

Local

Grading up with Murrah

Punjab

Nili-Ravi

Selective breeding

Murrah

Selective breeding

Local

Grading up with Murrah and Nili-Ravi

Rajasthan

Local

Grading up with Murrah

Tamil Nadu

Local

Grading up with Murrah

Uttar Pradesh

Bhadawari

Selective breeding and grading up with Murrah

Non-descript

Grading up with Murrah

West Bengal

Local

Grading up with Murrah

Source: Singh and Gumani (1997).

also to take this technology to the field for benefit of the farmers. The NDDB has set up
a main ET laboratory, 3 regional centres and 14 state centres (till March 1995) for
achieving these objectives. The state centres are planned to be increased to 25. The ET
project successfully completed its eighth year in March 1995 fulfilling most of its ob¬
jectives. It has been monitored at various levels. Among its notable achievements are
the birth of a cattle calf from a split embryo half at the Nil, the first ever IVF buffalo
calf at the NDRI and the world’s first buffalo calf produced through transfer of a frozen
embryo. A diagnostic kit has been developed for the detection of pregnancy/heat in
cattle and buffaloes and is being commercialized.

The technique of AI has made it possible to increase the utility of a male. It has

BREED IMPROVEMENT PROGRAMMES

315

now also become possible to in¬
crease the influence of the geneti¬
cally superior females by the use
of embryo transfer. Introduction of
a Multiple Ovulation and Embryo
Transfer (MOET) scheme will in¬
crease the selection intensity
through increased progeny per buf¬
falo per annum in the herd.

The MOET scheme allows
progeny testing of both males and
females, and can increase the ge¬
netic gain per annum over what is
possible by artificial insemination
alone. More sires can be tested
within a short period and at low cost
by using the semen of the male to
be tested on a few donors and trans¬
ferring the embryos recovered to
the required number of recipients.
To test a bull 8 donors and 27 recipients with 1 0 recorded daughters in the first lactation
are required. However, these techniques are required to be precisely standardized for
practising in regular breeding programmes.

OPEN NUCLEUS BREEDING SYSTEM

The practical application of progeny-testing methodology requires that the farm¬
ers’ herd size should be fairly large so that adjustment for various non-genetic factors
by contemporary comparisons is possible. This condition does not exist in India as the
average herd size is around 1 to 2 adult females. Milk recording under field conditions
is quite expensive. Moreover, farmers are not under any obligation to retain the ani¬
mals till the lactation is completed. The generation interval is also very long as it takes
about 6-7 years by the time complete record on progeny is available. The net conse¬
quence of application of conventional progeny testing programmes in developing coun¬
tries is that the effective genetic improvement is small. Use of the ‘best’ proven bulls
on the elite cows, which are the best 5 to 10% of the cows in the population to generate
future bulls for breeding would take further time for the benefits of genetic improve¬
ment in the population to occur. The net genetic gains in the herds, considering the
‘actual’ genetic improvement from various parent-offspring paths, is around 0.7% per
annum. Considering the above situations in developing countries it has been proposed

“Pratham”

The first-ever buffalo calf born following
in-vitro fertilization of oocyte and subsequent
embryo transfer has been reported at the Na¬
tional Dairy Research Institute (NDRI), Karnal.

The buffalo oocyte was ‘harvested’ from
slaughterhouse ovaries and fertilized in-vitro
in the laboratory.

The embryo, thus produced, was transferred
to a suitably prepared recepient in the first week
of January 1990. The calf born with a birth
weight of 38 kg was named ‘Pratham’

Source: Acharya (1992).

316

ANIMAL GENETIC RESOURCES OE INDIA - CATTLE AND BUFFALO

Fig. 4. Dairy selection scheme involving village herds and government nucleus herds
Source: Cunningham (1979).

that ‘nucleus’ herds be created where males from best cows are obtained. The ‘nucleus’
herds would be open in the sense that the lowest yielding cows are culled every year
and are replaced by procurement of that many high-yielding cows from farmers’ herds
(Fig. 4). The nucleus herds are utilized entirely for production of males for breeding
purposes in the population. With the availability of Multiple Ovulation Embryo Trans¬
fer Technology (MOET), the possibility of utilizing Open Nucleus Breeding Schemes
(ONBS) for genetic selection of sires can be taken up with much larger advantage. A
nucleus herd should not have less than 200 females. Such a scheme would require
maintenance of a small number of donor and recipient females, and will allow a large
number of bulls to be tested for their genetic merit. The males are to be evaluated on the
basis of their pedigree information when selected at the early age of 12 months or so.
This is called ‘juvenile-MOET’. Then the males are selected on the basis of the expected
performance of their half-sisters and full-sisters at the age of around 45 to 5 1 months.
This system is called ‘adult-MOET’ (Gurnani, 1990). This reduces the generation
interval and makes it possible to prove young bulls at the age of 3 to 4 years instead of
7 years in conventional breeding plans. Although accuracy of such a test is lower than
progeny information but because of reduction in the generation interval, the genetic
gains through the use of ONBS would be similar to that of progeny testing. Some of the

BREED IMPROVEMENT PROGRAMMES

317

advantages of ONBS-MOET schemes are:

1. Under ONBS-MOET, the evaluation and selection of males and females is con¬
ducted within the nucleus herd, so there would be greater degree of control on the
determinants of genetic change, i.e. intensity of selection, generation interval and
estimation of changes in levels of inbreeding.

2. Recordings of performance will be more accurate.

3. It will facilitate measurement of influence of other factors of production of eco¬
nomic importance like feed conversion efficiency, reproductive efficiency, disease
resistance, body conformation, ease of calving and ease of milking. Such informa¬
tion is not easy and would be very expensive to collect in progeny testing schemes.

4. Overall cost of breed improvement programmes is reduced. Less facilities are
needed to be created for storage of frozen semen doses.

5. Breed improvement programme is feasible as the recording of farmers’ cows is not
conducted. Recording of farmers’ cows in some situations and in some seasons
may be difficult due to difficulties of transportation and communication.

STRATEGIES FOR CONSERVATION

The cattle and buffalo genetic resources of India are represented by 30 and 10 well-
established and recognized breeds respectively. Most of the cattle breeds are suited for
draught work but produce very little amount of milk. In recent times, several of these
breeds have suffered decline and degeneration mainly due to their becoming uneco¬
nomical in the present day production system. In this age of competition, the animal
breeding and production system needs to be geared up to meet the market demands.
Usefulness of a breed is now judged not only on the basis of physical fitness and utility
but also on monetary returns. Utility of these breeds as draught animal has decreased
over the years owing to mechanization of agriculture and transport. Advances in animal
breeding, especially artificial insemination technique, have changed the animal breed¬
ing scenario completely and made it much easier and quicker to introduce superior
exotic breeds on a large scale. This has lead to the development of highly productive
strains and breeds. Although the native breeds are better adapted to the local agro-
ecological conditions of the region and are capable of producing on almost zero input,
yet they are facing decline and degeneration. These breeds need to be conserved for a
number of reasons. Some of these are:

1 . No organized efforts have been made to improve the genetic potential of indig¬
enous breeds. This coupled with imbalanced growth in livestock population vis-
a-vis inputs and poor management has resulted in overall deterioration of these
breeds.

2. Crossbreds are more productive as compared to native breeds but their tendency
to wilt under Indian conditions of low input and harsh climate, susceptibility to
tropical diseases, drop in production levels beyond F, s warrant the conservation
of indigenous breeds for future use.

3 . Usefulness of various types of indigenous animals has not been fully explored. In
such a situation, it cannot be postulated which animal type/gene would be re¬
quired in future and when. Hence the need for conservation of these breeds is
necessary as a part of genetic security.

4. The non-renewable sources of energy are bound to exhaust sooner or later. If this
does happen, then we may have to fall back on our animal wealth for providing
draught power and hence we cannot take risk of letting these breeds go extinct.

5. Various genotypes or gene combinations may be required for new technologies

STRA TEGIES FOR CONSER VA TION

319

like embryo transfer, sexing, cloning and gene manipulation. This requirement
can only be met by maintaining a wide gene pool of animal genetic resources.

6. Some of the breeds like Sahiwal, Red Sindhi and Nili-Ravi do not have their
breeding tracts within the geographical boundaries of the country but these are
important to our country and deserve conservation.

7. The domesticated breeds are integral part of our eco-system, culture and heri¬
tage. Hence, these need to be preserved.

WHEN A BREED IS IN DANGER

Management and conservation of animal genetic resources need involvement and
support of farmers and groups of people with active support of the government agen¬
cies, legal coverage and institutional financing. They should be need based and the
measures taken should not upset the natural environment. The economic condition of
the farmers vis-a-vis requirement of funds need proper balancing. The understanding of
farmers and acceptance of the conservation concepts by the society are the key factor
for the success of conservation.

Participation of farmers/individuals in the conservation programme is very much
important. In fact the approach/initiative should come from the farmers and there par¬
ticipation should be effective. The degree of their participation would depend on the
need of the programme. Different approaches should always be compared for assessing
the benefits. The management group must know the exact nature of the farmer’s par¬
ticipation and the activities. The conservation of animal genetic resources and needs of
farmers go together. The conservation programme should have an effective legislation
and regulatory framework to have maximum returns.

Population Dynamics

Population dynamics affects the degree and rate of use of natural resources. Rapid
population growth puts more pressure on resources. The growth of population should
be properly managed and controlled. Declining resources puts a pressure on the popu¬
lation. Similarly population increase or decrease will also influence conservation
programme. Lack of knowledge of these factors can lead to failure in conservation,
initiatives. Selection and migration of animals are two major factors influencing popu¬
lation dynamics.

The endangered status of an animal breed can be determined by the size of breeding
stock which can be expressed by the number of breeding females, sex ratio or effective
population size. These may vary for different species. The estimates of minimum popu¬
lation size of different species for declaring endangered status have been given by vari¬
ous workers (Alderson, 1981 ; Maijala, 1982; Campo and Orozco, 1982; Pirchner, 1983;

320

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Maijala et al., 1984; Dohy, 1988). Conservation status of a breed can be determined on
the basis of breeding females and estimated effective population sizes and sex ratios as
given in Table 18. Due weightage should be given to the current trends in population
for declaring the status at a particular time. Different population estimates suggested
for consideration of endangered status of breeds in 5 species of livestock are given in
Table 19. These estimates are for the developed countries where all the necessary fa¬
cilities for ex-situ conservation are available. Moreover, these population estimates are
for registered animals with Breed Societies or by Rare Animal Trusts. They can switch
over to different livestock raising systems without any loss of time. Simak (1991) has
given much higher numerical figures (5,000-15,000) for declaring rare breeds in West
Germany. The FAO has a working rule that when breed population size approaches
5,000 breeding females (total population of about 10,000 animals), the survival risk of
the breed should be studied. However, much will depend upon the local circumstances
such as breed management system, extent of crossbreeding, rate of decline and overall
utility of breed under the prevalent agro-climatic conditions.

Table 18. Population size and sex ratio of breeding females for determining the conservation
status

Status No. of breeding Estimated effective average population size

females

5:1

10:1

30:1

50:1

100:1

Normal

>10,000

33,333

18,181

6,201

3,921

195

Insecure

5,000-10,000

5,000

2,727

930

588

Vulnerable

1,000-5,000

1,666

909

309

196

Endangered

100-1,000

333

182

Critical

<100

Table 19. Population estimates for endangered status of breed

Country

Cattle

Sheep

Goat

Pig

Horse Reference

England

750

1,500

500

150

1,000

Alderson

(1981)

West Germany

7,500

15,000

5,000

—

5,000

Simak

(1991)

Europe

1,000

500

200

Maijala

(1982)

General*

10,000

FAO

* Number of pure breeding females is 5,000.

STRA TEGIES FOR CONSER VA TION

321

The situation in India is altogether different. Here even the preliminary breed-wise
census has not been conducted and the breeding policies for each breed are framed
generally on population estimates based on census report for the species. It is normally
assumed while framing the breeding policies that all the animals in the breeding tract
are of that particular breed. No consideration is given for the non-descript population or
the crossbreds available in that area. However, preliminary surveys conducted on a few
breeds revealed that their number may be a few thousands only. The population size for
the consideration of status of a breed under Indian conditions for different species is
given in Table 20 (Nivsarkar et al., 1994).

Table 20. Population size of a breed for its status (’000)

Species

Normal

Insecure

Vulnerable

Endangered

Critical

Cattle

15-25

5-15

2-5

Buffaloes

20-30

10-20

5-10

Sheep

30-50

15-30

8-15

Goats

20-30

10-20

5-10

Camels

15-20

5-15

2-5

Horses

15-20

5-15

2-5

Pigs

5-10

1-5

0. 5-1.0

<0.5

However, the population estimates for determining status of cattle and buffalo breeds
seem to be slightly on the lower side taking into consideration low percentage of breedable
females vis-a-vis population size, mortality rate, poor growth rate, late maturity, poor
fertility rate, recurrent draughts, etc. These estimates may even be higher in buffaloes
as compared to those of cattle because of their low conception rate, high mortality,
longer age at first calving, longer calving interval, etc. The criteria recommended is
given in Table 21.

Table 21. Recommended population estimates for a breed

Species

Normal

Insecure

Vulnerable

Endangered

Critical

Cattle

>30

20-30

10-20

5-10

Buffaloes

>35

25-35

15-25

10-15

<10

A breed is automatically conserved if it is economically viable. Therefore, efforts
should be made to improve the performance of indigenous breeds by formulating ap¬
propriate breeding plans. Breeding plans should be separate for each breed taking into

322

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

consideration the utility of that breed. For draught breeds weightage should be given to
draught parameters like strength of ligament of Nuchae, tendons and muscle structures,
leg size and hoof qualities, along with production parameters. The existing farms should
be declared as bull mother farms. Initially, young bulls should be selected on the basis
of conformation traits and dam’s performance. At present progeny testing is not fea¬
sible for all the breeds but wherever possible these bulls should be tested on the basis of
performance of their progeny. Farmers’ herds should be included in the programme to
increase the number of records per sire so that the accuracy of test is increased. Efforts
should be made to extend the programme of progeny testing to all breeds. Top 20% of
the bulls should be selected for production of future bulls. Sufficient quantity of semen
of these bulls should be frozen. These bulls should then be distributed to the develop¬
ment agencies/breed societies to propagate the breed in the breeding tract. About 20%
of the poor performing animals at the bull mother station should be replaced by good
animals from the field to minimize the level of inbreeding. This will help in simulta¬
neous improvement and conservation of the breed.

WHY A BREED IS IN DANGER

It has been observed that most of the developing countries have rich quality
biodiversity but are poor in resources and hence the potentiality of the resources can not
be fully exploited. There are various factors influencing the domesticated animal diver¬
sity (DAD) causing decline in the population status of many breeds and some of these
breed resources are threatened with extinction. These factors are discussed below.

Farmers’ Holding and Resource Availability

The conservation of animal genetic resources under sustainable management at the
fanners’ door is one of the most effective and practical way of conserving the animals
with minimum of inputs. This approach also does not involve large financial inputs and
would be feasible under the normal conditions. The production system during the last
3 to 4 decades has completely changed due to increased human population pressure,
high density and availability of low inputs. More and more land is now coming under
crop production, but the land holding has started dwindling. The average herd size of
cattle during earlier days was 25-30 and that of buffalo 8-10, but over the years with
the reduction in the land holding and common grazing area the average herd size has
reduced and now 1 or 2 buffaloes or cows are kept. Similarly, a small farmer with poor
resources cannot afford to keep a bull for breed improvement and has to depend largely
on the available germplasm in or around the village. In most of the cases the available
bulls are not selected and in many cases the working uncastrated bullocks serve as a
breeding bull. The normal practice in villages is that male and female animals are sent

STRA TEGIES FOR CONSER VA TION

323

out together for grazing and the scrub bull(s) in the herd continue mating of females in
oestrus. Thus, there is not only deterioration in the performance of the animals but also
genetic dilution. It would, therefore, be necessary to make efforts for maintaining only
quality animals and to provide selected bulls or semen of progeny-tested bulls under
the genetic improvement programme so that the breeds become economically viable
and are conserved at the farmers’ doors. A breeding plan has to be developed for the
genetic improvement of pure /indigenous breeds by each state/breed societies.

Breed Characterisation

India is bestowed with large number of breeds of various species of livestock and
poultry. However, it is very difficult to locate the basis of categorization of these breeds,
because of lot of variation between different reports. The numbers in cattle breeds re¬
ported to vary from 26 to 56, buffaloes from 7 to 15, sheep from 30 to 55 and so on for
the other species. The exact source of the breed accreditation has yet to be documented
but it has been reported in some literature that British army officers while conducting
tours in the rural areas have described the breeds of the area on the basis of its morpho¬
metric characteristics and local names as prevalent in the area were given. Further the
studies were conducted on these resources under intensive managemental conditions.
The information generated on these breeds is based on a few herds maintained in the
organized farms of the state and central departments/agricultural universities on small
populations. It has not been properly documented and cannot be considered as a true
descriptor for the breed. The performance need to be recorded on large population
under extensive management condition at the farmers’ door to have a correct picture in
the breed number has become a serious issue as many breeds have been reported on
which either little or no information is available. Possibly such breeds have come out of
fascination of a few people or the local names given to a group of animals of a particu¬
lar tract. There is a need for undertaking systematic studies on the livestock resources
by conducting surveys and recording the information on these genetic resources. Tak¬
ing the earlier available reports as base information. The recording of such observa¬
tions on large and random population would help in describing norms of a breed, and
descriptor for each breed can be prepared which can be subsequently used for recording
the status and performance of breed. This will not only help in gaining knowledge but
will also be useful in planning breed improvement and conservation programme.

Suitability of Selection of Breeds

The selection of breeds as described earlier was based on the morphometric charac¬
teristics without giving any weightage for the production performance. The selection of
the genetic material was also done on the basis of the physical parameters with a very
rigorous scale. This has resulted in sharp decline in the population of recognized breeds

324

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

because any slight variation in these morphometric traits would result in the rejection
of the animals.

It is proposed that a systematic approach be developed where in addition to the
morphometric parameters, emphasis is also to be laid on the economic traits for the
improvement of breeds. This would simultaneously result in genetic and economic
viability of breeds, and with a possibility of sustainable rrianagement of these animals
breeds.

Economical Viability and Acceptance by Farmers

There has been a major change in the management and production system of ani¬
mal genetic resources after 1960. The major emphasis for selection of cattle was on its
draughtability with either very little or no emphasis on the production performance.
This resulted in Indian cattle being considered only as draught animals and buffaloes as
milch animals. However, during the last 3-4 decades the requirement of the draught
power has gone down due to large-scale mechanization and because of low milk pro¬
duction their utility has almost dwindled. Draught animals hence became economically
unviable and farmers either accepted introduction of improver breeds/exotic inherit¬
ance for upgrading of their livestock or disposed them off. This has resulted in im¬
mense loss to the genetic purity of the indigenous breeds which were highly adaptive to
tropical conditions and could survive and produce under extreme climatic conditions,
zero input management and steep competition due to increased livestock density. It
would, therefore, be necessary to link up the programmes of conservation with breed
improvement on a large scale so that there would be improvement in the overall perfor¬
mance of these animals and would thus be acceptable to the farmers, failing which there
is a danger of losing these breeds.

Feed and Fodder Resources

In India, most of the livestock in rural areas are maintained with zero-input system.
They are sent for grazing from morning and hardly any supplement is offered excepting
for bullocks and lactating animals. Fodder production in earlier years was considered a
luxury and grazing was supplemented with some concentrates and crop residues. Some
of the progressive farmers realized the importance of nutritional requirement for cattle
and buffaloes and brought some of the land under fodder cultivation. But the overall
scenario has not changed. The possible reason is the increase in human population
pressure resulting in shrinking of grazing areas. In the last few decades because of steep
economic competition and the higher population density, the farmers find it difficult to
maintain uneconomical animals and have replaced such animals with more productive
animals, as stated in earlier para, resulting in genetic dilution or replacement of breeds.
It would thus be necessary to improve the management practices by bringing more

STRA TEGIES FOR CONSER VA TION

325

wasteland under fodder production so that the animals would have enough grazing
resources and availability of nutrients and these indigenous genetic resources can be
maintained economically. Moreover, fodder production needs and nutrient require¬
ments have to be linked with breed improvement programmes so that the animals can
be reared at the farmer’s door under sustainable management.

Changing Pattern of Agricultural Operations

There is not only change in the production and management system of animal ge¬
netic resources but large-scale changes have also taken place in the agricultural opera¬
tions. This is not only because of human population pressure but also due to high eco¬
nomic returns by using modern agricultural farming practices which has resulted in
more and more land coming under crop production. The decision of selecting a crop
would depend on the need of the people and marketing facilities. This approach de¬
pends on the economic utility of the crops, which not only changes the cropping pattern
but also have very large impact on the management of animal genetic resources which
are largely dependent on the agricultural by-products. In the states where these changes
are more evident, the farmers have totally changed the livestock management system
and in certain cases have also either reduced or totally replaced the species/breeds de¬
pending upon the prevalent situation.

Legal Issues

In spite of widespread concern being raised about the decline and disappearance of
domesticated animal genetic resources, there is very little emphasis on the creating of
legal coverage for the conservation of these resources. Some of the legal coverages for
domesticated animals have been implemented by the state and central governments but
most of these legal coverage are for breed identification and breed improvement
programme. The Ministry of Environment has already taken steps for giving a legal
coverage to wild animals and plant species. On realization of having legal coverage it
was decided to approach an agency which would help in creating a legal form and
frame the bye-laws for protecting the animals and also for their conservation under the
sustainable management system. It would be necessary to start with the proper identifi¬
cation of these resources by making a provision in the law and this should be monitored
continuously and amendments if any may be incorporated. These laws should be obliga¬
tory which would help in preparing comprehensive animal biodiversity inventories.
Though there will not be any insurance against the natural forces, a legal coverage can
be given for protecting the animals from the artificial forces to prevent decline in the
biodiversity. Biodiversity tools help the improvement programme but if misused can
make drastic genetic alterations which may subsequently prove a threat to biodiversity
and conservation. It should be mandatory for all the state and central departments to
have an effective legal cell which would help in giving protection to such resources.

326

ANIMAL GENETIC RESOURCES OE INDIA - CATTLE AND BUFFALO

CONSERVATION METHODS

The most appropriate means of conservation is in the form the animals exist in
nature, i.e. in-situ conservation. In-situ conservation of germplasm will not be practised
by those engaged with commercial livestock production because of economic impera¬
tives. This activity will shrink in terms of number of animals with farming community.
However, wilfully maintained animal conservation farm would be a judicious assem¬
blage of large segments of biodiversity of a particular breed. The in-situ conservation
may not be appropriate for the breeds which are uneconomical and are likely to be lost
due to economic pressures. The only other way to handle such a situation is through ex-
situ conservation of sperms, oocytes, embryos, DNA and embryonic stem cells. A breed
can be resurrected from the cryopreserved germplasm as and when required for produc¬
tion or research.

In-situ Conservation

Live animal conservation has several advantages as the breed can gradually adapt
to the changing environmental conditions besides improvement by selective breeding.
However, the high cost in keeping of large herds is the major limiting factor. It is very
important to know the minimum population size of a breed for conservation in situ.
Smith (1984) estimated the minimum size of a breeding unit and the number of breed¬
ing animals that would be replaced annually to keep the inbreeding levels to about 0.2%
a year. Brem (1988) considered that an inbreeding level of 1.1% per generation could
be tolerated. In order to continue to breed and select successfully on quantitative traits
a herd size of about 100 breedable females is necessary. Institutional farms having a
nucleus herd of 500 breedable females kept at 3 or 4 locations can be useful for selec¬
tive breeding and improvement besides the conservation in situ.

Ex-situ Conservation

It is possible now to store a wide variety of living cells for long periods of time.
Outstanding progress has been made with sperms of most domestic species and tech¬
niques are now routine. Embryos of several mammalian species may now be frozen and
subsequently used to produce a normal animal. These techniques can be used for the
conservation of endangered animal genetic resources ex situ. Ex-situ conservation can
be done by: (i) deep freezing of sperms and oocytes, (ii) deep freezing of embryos, and
(iii) storage of DNA templates.

(a) Sperms and oocytes : Deep freezing of semen is suitable for most of the species
of domestic animals and facilities are available at many places. The technique of freez¬
ing, storing and thawing of semen is well documented for cattle and buffaloes. About
2,000 doses of semen per bull should be obtained from 15-20 bulls and stored for the

STRA TEGIES FOR CONSER VA TION

327

conservation of a breed. Smith (1984) estimated that 25 sires of a breed are essential to
prevent inbreeding when males are used rotationally on each other’s daughters. Fur¬
ther, with the refinement of in-vitro fertilization technique, the cryogenic storage of
oocytes side by side of semen may be very useful.

(b) Embryos : Cryopreservation of embryos of cows, buffaloes, sheep, goats and
horses has successfully been done to produce offsprings. This is an excellent tool for
conservation as all the genetic information are stored in one diploid zygote. However, it
is still relatively expensive but should be used for conservation of at least endangered
breeds. Brem (1988) estimated the number of frozen embryos required for conservation
of a breed (Table 22).

Table 22. Number of frozen embryos per breed for preservation in cattle

Survival rate Pregnancy rate (%)

616

411

308

247

206

513

342

257

206

171

440

293

220

176

147

385

257

193

154

129

343

228

171

137

114

(c) Storage of DNA : Cryogenic storage of DNA is another method of preservation
of genetic material. It has several advantages over the live cells, avoiding the complica¬
tion of spreading of disease during transportation. Within and across different coun¬
tries, the storage of uncatalogued DNA is already possible but the genome maps of
different farm species are not yet available. This may prevent it from becoming the
normal method of preservation at present. Serious efforts are now being made in sev¬
eral laboratories all over the world for mapping of genes in livestock species. Neverthe¬
less, in planning for a long-term preservation of endangered breeds, the prospects of
DNA storage must be taken very seriously.

(d) Cloning of somatic cells: Cloning offers the advantage of producing series of
exact replica/copy of the concerned animals. The developing embryo can also be fro¬
zen to serve as the voucher specimen to serve the need in exigency.

Presently there are two techniques for the cloning of the animals, viz. Roslin and
Honolulu techniques. In both the techniques the egg cell is enucleated to eliminate
majority of the genetic information. The donor cell is forced to G° stage of cell cycle,
making its nucleus acceptable by the recipient cell, either by cell fusion or transplan¬
tation. The developing embryo is transplanted in a surrogate mother.

In Roslin technique the donor and the recipient cells are synchronized for proper

328

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

acceptance of the nucleus. The donor cell is forced to remain in dormant cell stage (G°).
The donor cell (udder cell ) is cultured in vitro to produce multiple copies of same
nucleus. The donor cell is brought at G° stage by shutting down the active genes by
selective starvation. The enucleated recipient cells and nucleated donor cell are fused
by electric pulse to develop into an embryo. If embryo survives it is incubated in sheep’s
oviduct and finally placed in uterus of surrogate mother ewe.

In Honolulu technique the cumulus cells are used which either remain in G° or G1
state. Unfertilized mouse egg cells were used as the recipient of donor nucleus. This
technique has advantage as there is no need of in vitro culture of donor cells. The donor
nuclei were taken from cells within minutes of each cell’s extraction from mouse thus
it is a quicker method than Roslin technique. After acceptance in new nucleus, the egg
cell is grown in a chemical culture to jump start the the cell’s growth mimicking the
fertilization . The cytochalsin B present in the culture prevents the polar body forma¬
tion. The developing embryo are transplanted in surrogate mother. The cumulus cells
give most successful results and are widely being used.

(e) Embryonic stem cells: Embryonic stem (ES) cells are derived from culture of
inner cell mass of a young blastocyst. These embryonic cells are totipotent and have
potential to develop into several embryos. Unlike the cloning of somatic cells here the
single fertilized zygote gives rise to many embryos which can be frozen for a very long
period and subsequently can be utilized in the conservation programme.

Cell lines of ES cells are easily obtained from disaggregating morulae
(Eistetter,1989). A feeder layer is generally used to isolate ES cells and to support their
successive passages (Suemori and Nakatsuji, 1987). The main role of feeder cells is to
provide growth factors necessary for proliferation and correlative inhibition of differ¬
entiation.

ES cells share the potentialities of the ICM cells from which they are derived. They
are able to differentiate in vitro. When ES cells are cultured at high cell density on a
non-adhesive surface (bacterial culture plastic), they form round embroid bodies show¬
ing many similarities with embryo development in vivo (Doetschemann et al., 1985).

ES cells are maintained by repeated passage on feeder layers, usually non-prolif-
erative mitomycin-C treated or matrix-coated substrate in conditioned medium, in or¬
der to prevent spontaneous differentiation (Wiles, 1993; Abbondanzo et al, 1993).
The presence of differentiation factors such as retinoids may be eliminated by the use
of neutralizing antibodies (Tamura et al., 1990) or by charcoal treatment (Flechon,
1997). The presence of such factors may explain the so called ‘spontaneous’ differen¬
tiation of ES cells.

CONSERVATION APPROACH

All strategies for conservation of biological resources in ultimate analysis should
strive for their sustainable utilization. It is, therefore, imperative that conservation of

STRA TEGIES FOR CONSER VA TION

329

animal biodiversity, particularly of our domesticated animals, should be an integral
component of an overall national plan of biodiversity conservation. A number of agen¬
cies with diverse objectives directly or indirectly deal with animal genetic resources.
Their activities cover breeding, maintenance, management, development, utilization,
conversion into value-added products and marketing. For a meaningful conservation
programme, it would be necessary to dove-tail diverse interests and generate a holistic
approach. Nivsarkar et al. (1994) suggested a network model for conservation of ani¬
mal genetic resources in India (Fig. 10).

Fig. 10. Nework Model for Conservation of Animal Genetic Resources in India (Source: Nivsarkar et al.,
1994).

330

ANIMAL GENETIC RESOURCES OF INDIA - CA TTLE AND BUFFALO

The livestock and poultry development programmes have traditionally been geared
mainly for increasing production potential of animals and their overall economic value
rather than to conserve and maintain the genetic purity of the breeds. Thus, dilution,
degeneration or endangerment of breeds was not given due consideration in the formu¬
lation of livestock development strategies. Livestock development and conservation
activities should be so oriented that they actually become complementary to each other.
The following activities are recommended for conservation of indigenous breeds of
livestock.

Evaluation of Genetic Resources in the Natural Habitat

So far the information available on animal genetic resources pertains to animals
reared on organized farms. No information is available on the status of animals under
field conditions. Quinquennial livestock census which is the only source of information
regarding population is also conducted species-wise and not breed-wise. Therefore, the
population of a breed in a particular geographical area is not known and this is a basic
parameter to formulate any type of conservation and improvement programme. Some
efforts have been made to estimate the population of different breeds from the livestock
census figures on the basis of following assumptions: (i) the breeding tract was divided
into central, adjacent and territorial parts, and district was considered a unit; and (ii)
certain percentage of total population was considered as breed population based on
reports of the state government agencies and survey studies of the National Bureau of
Animal Genetic Resources (Table 23). However, these estimates may not be close to
the actual population as has been revealed by preliminary estimates on many breeds.
Hence, it is very essential to conduct surveys in the breeding tract to establish the status
of a breed in terms of its population, management practices, physical characteristics,
utility and performance, and then plan its improvement and conservation programmes.
Agro-climatic conditions in breeding tract are all inter-related and should be recorded
if the breeding plans are to be successful. In addition, the surveys will reveal the extent
of genetic variability in the breeds including the rare variants which must be conserved
at any cost.

Establishment of Livestock Conservation Boards

At present systematic records are maintained only by some organized farms. In¬
ventories on animals in their breeding tract reared by farming community do not exist.
This is an essential pre-requisite for planning any programme on animal genetic re¬
sources. Proper cataloguing, documentation and upkeep of livestock inventories should
be made mandatory. A livestock conservation board should be established in each state
where inventories pertaining to the entire state should be maintained in computerized
form.

STRA TEGIES FOR CONSER VA TION

331

Table 23. Population dynamics of various breeds (’000)

Breed

Total

population

Breedable

females

Females
bred pure

Stud

bulls

Trend

Cattle

Malvi

568

197

138

3.3

Increasing

Gir

537

154

3.0

Increasing

Kankrej

465

149

2.4

Increasing

Ongole

378

131

6.0

Dangi

348

168

118

6.0

Hariana

331

112

0.9

Decreasing

Gaolao

291

0.9

Increasing

Kangayam

266

1.4

Decreasing

Nimari

252

0.8

Increasing

Nagori

229

103

0.5

Decreasing

Amritmahal

217

1.7

Increasing

Hallikar

201

1.5

Increasing

Kenkatha

181

0.6

Increasing

Krishna Valley

175

1.1

Deoni

175

1.0

Bachaur

156

0.3

Tharparkar

146

1.6

Increasing

Kherigarh

145

0.5

Decreasing

Khillari

128

1.1

Rathi

115

0.2

Decreasing

Siri

0.7

Decreasing

Mewati

0.1

Decreasing

Bargur

0.2

Decreasing

Ponwar

0.2

Decreasing

Sahiwal

0.2

Red Sindhi

0.2

Buffaloes

Murrah

1384

753

600

12.5

Increasing

Mehsana

543

296

207

1.1

Increasing

Surti

472

260

182

1.8

Increasing

Nili-Ravi

462

230

184

10.0

Nagpur i

357

154

123

6.5

Increasing

Jaffarabadi

289

161

128

1.8

Increasing

Bhadawari

173

0.6

Increasing

Toda

0.1

Decreasing

NA:Not Available
Source: Tantia et al. (1994).

332

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Establishment of a National Data Bank

A national data bank should be established to maintain complete information on all
animal genetic resources of the country. Data banks at state livestock conservation
boards should be linked to the national data bank through a computer network. The
state livestock conservation boards will have the responsibility of updating information
pertaining to their region and breeds. The national data bank will emerge as a nodal
agency for all information with capabilities of linking with international organizations.

Live Animal Repositories

(a) Breeding farms: There are one or more breeding farms for some of the indig¬
enous breeds. The existing farms of indigenous breeds should be declared as germplasm
repositories and used for production of bulls and semen. Only purebreeding should be
practised at these farms. Efforts should be made to establish at least one farm for each
breed in the breeding tract.

(b) Gaushala : Some of the gaushalas have purebred animals of indigenous breeds
but they do not have the resources for maintaining and improving these animals. Such
gaushalas should be supported to maintain indigenous breeds. Semen from bull mother
station and other necessary supplement inputs should be given to these gaushalas free
of cost. But then these should be under an agreement not to resort to crossbreeding or
other such practices which may dilute the purity of a breed.

Establishment of Breed Societies and Breed Survival Trusts

Considerable success has been achieved in European countries in the conservation
of some breeds which were not economical. Their population trend is upward now.
This has been possible through Breed Societies or Rare Animal Trusts. In India, live¬
stock is raised by farmers and no data recording system is followed in the field. There¬
fore, proper evaluation of indigenous animals for further improvement is not feasible at
present. Although India was one of the signatories in 1936 for the Herd Registration
programme initiated at Rome and the Ministry of Agriculture, the Government of India
launched the Herd Registration Scheme for the registration of outstanding animals of 6
breeds of cattle and 2 breeds of buffaloes in their respective home tract. Not much
headway could be made. It may be very important to form breed societies in India for
the conservation of rare and endangered breeds. Moreover, the improvement of indig¬
enous livestock breeds can be taken up simultaneously in collaboration with these breed
societies through selection of outstanding animals true to their breed types from the
larger population maintained in the breeding tract.

Creation of Public Awareness

No enterprise can be successful unless it is accepted by the community. The endan¬
gered breeds can be popularized amongst the people of the area and some tourist interest

STR/t TEGIES FOR CONSER VA TION

333

can be created by providing wide publicity. Some special products from the endangered
breed for which it is efficient may be popularized. Publicity for endangered domestic
livestock may be as important as proved in the conservation of wild life. Conservation
in the form of live animals was largely limited to breeds of curious appearance as hobby
of individuals. In Western countries the Livestock Parks of rare breeds are growing in
popularity for show to the public. Elsewhere payments are made to the owners for each
animal of a recognized endangered breed which they have and breed regularly. The
conservation of prolific Taihu sheep in China is an example of this method. In India
also there are some farmers who consider it a status symbol in keeping the purebred
animals of popular breeds of their area. Such farmers if encouraged through financial
and veterinary help, may end up in success story for the preservation of endangered
breeds in situ.

Establishment of Gene Banks

Germplasm repositories in the form of semen and embryo banks should be estab¬
lished in different regions/institutions/farms. Such gene banks should have co-opera¬
tive linkages with live animal farms for collection of material. The existing semen
banks should be strengthened to serve as gene banks. A national gene bank should also
be established which will maintain half of the quantity of cellular material, the other
half being maintained by regional gene banks. Rare and endangered breeds should be
taken first for ex-situ conservation

Human Resource Development Programmes

At present, there is a dearth of trained personnel for undertaking conservation
programmes. Curricula of animal and veterinary science education should be suitably
revised to include course on conservation, evaluation and sustainable utilization of ani¬
mal genetic resources. Training programmes should be organized for persons involved
in evaluation of animal genetic resources under field conditions.

Publication of Literature

There is a paucity of information on animal genetic resources. Available informa¬
tion on various breeds should be published in the form of breed monograms, maps,
calendars, etc. This is essentially to create general awareness and promote activities
related to development and conservation. A national watch list should be published
regularly to reveal about the status of different breeds. This will help in preparing im¬
mediate action plans for the threatened breeds.

□

REFERENCES

Abbondazo S J, Gadi I and Stewart C L. 1993. Derivation of embryonic stem cell lines.
Methods in Enzymology 225: 803-23.

Abe T, Olishi T and Suzuki S. 1969. Haemoglobin, transferrin and albumin variants in
Formosan water buffalo. Proceedings of Japan Academy 45: 767-71.

Acharya R M. 1992. Buffalo: The Dominant Force. Dairy India. (Ed.) Gupta P R. pp
51-60. A-25, Priyadarshini Vihar, Delhi-1 10 092, India.

Acharya R M and Bhat P N. 1984. Livestock and Poultry Genetic Resources of India.

Research Bulletin No. 1, Indian Veterinary Research Institute, Izatnagar, U.P.
Alderson L. 1981. The Conservation of Animal Genetic Resources in United Kingdom.

FAO Animal Production and Health Paper No. 24, pp 53-76. FAO, Rome.

Allchin B and Alllchin F R. 1968. The Birth of Indian Civilization. Penguin:
Harmondsworth, UK.

Amano T. 1982. Blood groups and biochemical polymorphisms of water buffaloes in
East Asia. XVIII International Conference on Animal Blood Groups and Biochemi¬
cal Polymorphisms, Ottawa, Canada, 18-24 July 1982.

Amano T, Namikawa T, Okada I, Hasnath M A, Faruque M O and Majid M A. 1987.
Karyotypes and blood protein polymorphisms of native water buffaloes in
Bangladesh. Genetic Studies on Breed Differentiation of the Native Domestic Ani¬
mals in Bangladesh, pp. 1 17-28.

Balain D S. 1988. Movement of buffalo germplasm by exporting countries. Proceed¬
ings of II World Buffalo Congress, New Delhi. Vol. 2, pp. 389-98.

Balakrishnan C R and Nair P G. 1966. Haemoglobin polymorphism in Indian cattle.

Indian Journal of Genetics and Plant Breeding 6:374-85.

Balani A S and Barnabas J. 1965. Polypeptide chains of buffalo haemoglobins. Nature
{London) 205: 809-15.

Barnabas J. 1 973. fide Biochemical Polymorphism and Blood Groups in Indian Buffa¬
loes (Bubalus bubalis). Khanna, N.D. 1973. Embassy Press, Delhi.

Basu S B. 1985. Genetic Improvement of Buffaloes. Kalyani Publishers, New Delhi.
Beckmann J S and Soller M. 1983. Restriction fragment length polymorphisms in ge¬
netic improvement: methodologies, mapping and costs. Theoretical and Applied
Genetics 67: 35-43.

Benjamin B R and Bhat P N. 1977. Chromosomal studies in cattle with special refer¬
ence to crossbreeding. Indian Journal of Animal Sciences 47: 4.

REFERENCES

335

Bettini T M and Iannelli D. 1967. Blood groups in buffaloes. 1. Typing of buffalo
erythrocytes with antisera specific for blood antigen of cattle. Identification of a
soluble antigen in the serum and on surface of the erythrocytes by means of natu¬
rally occurring agglutinins. Produzione Animate 6: 1 19-24.

Bhat P N and Taneja V K. 1987. Genetics and Breeding of River Buffalo. Research
Bulletin No. 5, Indian Veterinary Research Institute, Izatnagar, U.P.

Bhat P N, Bhat P P, Khan B U, Goswami G B and Singh B. 1981. Animal Genetic
Resources in India. Bulletin No. 192, National Dairy Research Institute, Karnal.

Bhattacharaya P. 1984. Cattle and buffalo breeding - Past, present and future. Souve¬
nir, Diamond Jubilee, 1983-84. National Dairy Research Institute, Karnal.

Bidhar G C. 1985. Karyotype of buffaloes in Paralakhemundi Region of Orissa. M.V.Sc.
thesis submitted to the Orissa University of Agriculture and Technology,
Bhubaneswar, Orissa.

Bidhar G C, Pattnaik G R, Rao P K and Patro B N. 1986. Chromosome number and
morphology of Paralakhemundi buffaloes in Orissa. Buffalo Bulletin 5(3): 54-56.

Birthal P S, Kumar A, Ravishankar A and Pandey U K. 1 999. Sources of growth in the
livestock sector. Policy paper 9, National Centre for Agricultural Economics and
Policy Research, New Delhi.

Bongso T A and Hilmi M. 1982. Chromosome banding homologies of a tandem fusion
in river, swamp and crossbred buffaloes ( Bubalus bubalis). Canadian Journal of
Genetics and Cytology 24: 667-73.

Bovenhuis, H. 1992. Mapping QTL in dairy cattle using milk protein genes as genetic
markers. Journal of Dairy Science 75 (Supplement 1): 285.

Bradley D G, MacHugh D E, Cunningham E P and Loftus R T. 1996. Mitochondrial
diversity and the origins of African and European cattle. Proceedings of National
Academy of Sciences, USA 93: 5131-35.

Brem G. 1988. Ex-situ Kryokonservierung von Genome and Gene gefahrdeter
Rinderrassen. ( fide Hudges, J. 1990. Conservation of Animal Genetic Resources
in Developing Countries. Genetic Conservation of Domestic Livestock. (Ed.)
Lawrence Alderson. pp 128-45. CAB International, England).

Campo J L and Orozco F. 1982. Conservation and genetic study of chicken breeds. In
Proceedings of II World Congress on Genetics Applied to Livestock Reproduction,
Madrid.

Chacko C T. 1994. Development of the Sunandini cattle breed in India. World Animal
Review 80/81: 71-79.

Cockrill W R. 1 974. The Husbandry and Health of Domestic Buffalo. FAO, Rome.

Cunningham E P. 1979. The importance of continuous genetic progress in adapted
breeds. Report of the FAO Expert Consultation on Dairy Cattle Breeding in the
Humid Tropics, pp 21-29. FAO, Rome.

336

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Cunningham E P, Loftus R Y, MacHugh D E and Bradley D. 1994. Molecular evolu¬
tion of African, European and Asian cattle. Proceedings of the V World Congress
on Genetics Applied to Livestock Production. (Eds) Smith C, Gavora J S and Benkel
B. Vol. 21, pp 86-89. Department of Animal and Poultry Science, University of
Guelph, Guelph, Canada.

DAH. 1 997. Basic Animal Husbandry Statistics'. A Report of the Technical Committee
of Direction for Improvement of Animal Husbandry and Dairying Statistics. AHS
Series 6, Department of Animal Husbandry and Dairying, Ministry of Agriculture,
Government of India, New Delhi.

Dahiya B S. 1978. Experience in buffalo management in military farms. Proceedings
of the Indo-Soviet Symposium on Buffalo Breeding, 16-18 November 1978. Na¬
tional Dairy Development Board, Anand.

Dash T and Mishra M. 1990. Characteristics and performance of Kujang buffaloes.
Indian Journal of Animal Production and Management 6(4): 207-12.

Datta S P and Stone W H. 1963. Blood typing of Indian water buffaloes with reagents
for antigenic factors of cattle. Nature (London) 199: 797-805.

Davis G P, Hetzel D J S, Corbet N J, Scacheri S, Lowden S, Renaud J, Mayne C,
Stevenson R, Moore S S and Byrne K. 1998. The mapping of quantitative trait loci
for birth weight in a tropical beef herd. Proceedings of the 6th World Congress on
Genetics Applied to Livestock Production, Armidale, Australia, 11-16 January 1 998.
Vol. 26:441-44.

Dev D S. 1978. Selection programmes in buffaloes in the past and the present. Pro¬
ceedings of the Indo-Soviet Symposium on Buffalo Breeding, 16-18 November 1978.
National Dairy Development Board, Anand.

Dev D S and Tiwana M S. 1978. Selection programmes in buffaloes in the past and the
present. Proceedings of the Indo-Soviet Symposium on Buffalo Breeding, 16-18
November 1978. National Dairy Development Board, Anand.

Di Berardino D, Iannuzzi L, Bettini T M and Matassino D. 1981. Ag-NORs variations
and banding homologies in two species of Bovidae: Bubalus bubalis L. and Bos
taurus L. Canadian Journal of Genetics and Cytology 23: 89-99.

Doetschman T C, Eistetter H, Katz M, Schmidt W and Kemler R.1985. The in vitro
development of blastocysts derived embryonic stem cell lines: formations of vis¬
ceral yolk-sac, blood islands and myocardium. Journal of Embryology and Experi¬
mental Morphology 87: 27-45

Dohy J. 1988. Genetic problems in the maintenance of rare, non-commercial popula¬
tions of domestic animals. In Animal Genetic Resources, Strategies for Improved
Use and Conservation. F AO Animal Production and Health Paper 66, pp 3 1 6.

Eistetter H R. 1989. Pluripotent embryonal stem cell line can be established from dis¬
aggregated mouse morulae. Development, Growth and Differentiation 31: 275-82.

REFERENCES

337

Epstein H. 1971. The Origin of the Domestic Animals of Africa. Vol. 1. Africana Pub¬
lishing Corporation, New York, USA.

Epstein H and Mason I L. 1 984. Cattle. Evolution of Domesticated Animals. (Ed). Mason
1 L. pp. 6-27 . Longman: London.

Fairservis W A. 1975. The Roots of Ancient India. 2nd edn. The University of Chicago
Press, Chicago, USA.

Falconer D S. 1989. Introduction to Quantitative Genetics. 3rd edn. Longman, Harlow,
UK.

Feeney R E and Allison R G. 1969. Evolutionary Biochemistry of Proteins, pp. 290.
Wiley International Science, New York.

Ferguson L C. 1941 . Heritable antigens in the erythrocytes of cattle. Journal of Immu¬
nology 40: 213-42.

Flechon J E. 1997. What are ES cells? Transgenic Animals. Generation and Use.
(Ed.) Houdebine L M. pp. 1 57-66. Harwood Academic Publishers, The Nether¬
lands.

Freyer G, Liu-ZengTing, Erhartdt G, Panicke L and Liu Z T. 1996. Estimation of QTL
effects for milk production traits and examination of genetic linkage to casein mark¬
ers using multipoint analysis. Archiv-fur-Tierzucht 39: 369-85.

Gaus H. 1915. Benteng and Zebu Undihr Gegenseitiges Verhaltnis Kuhn Archaeol.
Halle 6 (cattle).

Geldermann H. 1975. Investigations on inheritance of quantitative characters in ani¬
mals by gene marker. Theoretical and Applied Genetics 46:319-30.

Georges M and Massey J M. 1991. Velogenetics or the synergistic use of marker as¬
sisted selection and germ like manipulation. Theriogenology 35:151-59.

Georges M, Dietz A B, Mishra A, Nielsen D, Sargeant L S, Sorensen A, Steele M R,
Zhao X, Leipold H, Womack J E and Lathrop M. 1993. Microsatellite mapping of
the gene causing weaver disease in cattle will allow the study of associated quan¬
titative trait locus. Proceeding of the National Academy of Sciences of the United
States of America Vol. 90:1058-62.

Georges M, Nielsen D, Mackinnon M, Mishra A, Okimoto R, Pasquino AT, Sargeant
LS, Sorensen A, Steele, Dr.Mehar Khatka M R, Zhao X, Womack JE, Hoeschele I,
Smith C, (Ed), Gavora J S (Ed), Benker B (Ed), Chesnais J (Ed), Fairfull W(Ed),
Gibson J P (Ed), Kennedy BW I(Ed) and Burnside E B. 1994. Using a complete
microsatellite map and the grand-daughter design to locate polygenes controlling
milk production. Proceedings of the 5th World Congress on Genetics Applied to
Livestock Production. University of Guelph, Ontario, Canada, 7-12 August 1994.
Vol.21:81-85.

GrigsonC. 1980. The craniology and relationship of four species of Bos. 5. Bos indicus
L. Journal of Archaeological Science 7(1): 3-32.

338

ANIMAL GENETIC RESOURCESOF INDIA - CATTLE AND BUFFALO

Grupe S and Schwerin M. 1998. Mapping of quantitative trait loci on chromosome 23
in German Holstein cattle families. Archiv -fur -Tier zucht 41:225-35.

Gupta P, Singh L and Raychoudhari S P. 1974. Chromosomes of Indian breeds of
cattle. The Nucleus 17 (2): 129.

Gupta P R. (Ed.). 1997. Dairy India 1997. 5th edn, pp. 148. A-25, Priyadarshini
Vihar, Delhi -1 10 092, India.

Gurnani M. 1 990. Open nucleus breeding systems. Proceedings of the XV Dairy Hus¬
bandry Officers Workshop , 27 to 28 December 1990. National Dairy Research In¬
stitute, Karnal

Gustavsson I. 1966. Chromosomal abnormality in cattle. Nature, London 211:865-66.

Gustavsson I. 1969. Cytogenetics, distribution and phenotypic effects of a transloca¬
tion in Swedish cattle. Hereditas 68:169.

Gustavsson I and Rockborn G. 1964. Chromosome abnormality in three cases of lym¬
phatic leukaemia in cattle. Nature, London 203:990.

Hadziselimovic F.1971. The karyotype and sex chromatin of dwarf Indian zebu ( Bos
indicus nanus) in Ceylon. Acta Anatomica 80:41 8-25.

Hafez E S E. (Ed.). 1968. Reproduction in Farm Animals. 2nd edn, xii + 440 pp. Phila¬
delphia, Pa: Lea and Febiger, London.

Hafez E S E and Jainudeen M R. 1 966. Intersexuality in farm animals. Animal Breeding
Abstract 34:1-15.

Heck H. 1951. The breeding back of the Aurochs. Oryx, London 1(3): 1 17-22 (Cattle).

Hegde B P, Rai A V and Goni S K. 1978. Studies on production parameters of Malnad
Gidda cattle. Indian Veterinary Journal 55: 870-73.

Herzog A and Hohn H. 1 97 1 . Autosomal trisomy in lethal brachygnathia of cattle. Cyto¬
genetics 10:347-65.

Hescheler K and Kuhn E. 1949. Die Tiermelt. Tschumi O. Urgeschichte der Schveiz.
pp 120-368. Frauenfeld (cattle)

Hetzel D J S, Davis G P, Corbet N J, Shorthose W R, Stark J, Kuypers R, Seacheri, S,
Mayne C, Stevenson R, Moore S S and Byrne K. 1997. Detection of gene markers
linked to carcass and meat quality traits in a tropical beef herd. Proceeding of the
12th Conference, Dubbo, NSW, Australia, 6-10 April 1997: Part 1, pp. 442-46.

Holmberg C G and Laurell C B. 1948. Investigations in serum copper. 2. Isolation of
the copper containing protein and a description of some of its properties. Acta
Chemica Scandinavica 2: 550-56.

Hsu T C and Benirschke K. 1967-77. An Atlas of Mammalian Chromosomes. Volume
1-10. Springer Verlag, New York Inc.

Hughes T McKenny. 1896. The more important breeds of cattle which have been
recognised in the British Isles. Archaeologia 55: 125-58 (Cattle).

Iannuzzi L. 1994. Standard karyotype of the river buffalo ( Bubalus bubalis L. 2n = 50).
Cytogenetics and Cell Genetics 67: 1 02-13.

REFERENCES

339

Iannuzzi L, Di Berardino D, Gustavsson I, Ferrara L and Di Meo G P. 1987. Centro¬
meric loss in translocation of centric fusion type in cattle and water buffalo. Hereditas
106:73-81.

Iannuzzi L, Di Meo G P, Perucatti A and Ferrara L. 1990. A comparison of G- and R-
banding in cattle and river buffalo prometaphase chromosomes. Cytologia 43:283-
90.

ICAR. 1979. Characteristics of Cattle and Buffalo Breeds. Indian Council of Agricul¬
tural Research, New Delhi.

ISCNDA. 1989. The II International Conference on Standardization of Domestic Ani¬
mal karyotypes. Cytogenetics and Cell Genetics 53:65-79.

Joshi N R and Phillips R W. 1953. Zebu Cattle of India and Pakistan. FAO Agricul¬
tural Studies, No. 19. FAO, Rome.

Juneja R Kand Chaudhary R P. 1971 . Albumin polymorphism in some breeds of Indian
cattle and water buffaloes. Journal of Animal Morphology and Physiology 18:
176-81.

Kaura R L. 1950. Cattle Development in Uttar Pradesh. Department of Animal
Husbandry, Uttar Pradesh, 167 p.

Kaura R L. 1952. Indian Breeds of Livestock (Including Pakistani Breeds). Prem
Pubisher, Lucknow, 1 19 p.

Kennedy B W, Quinton M and Van Arendonk JAM. 1992. Estimates of effects of
single genes on quantitative traits. Journal of Animal Science 70:2000-12.

Khanna N D. 1968a. Studies on blood groups of ten Indian cattle breeds. Thesis
(Associateship). pp. 138. Indian Veterinary Research Institute, Izatnagar.

Khanna N D. 1968b. Serology of buffalo blood group factors. Indian Journal of Vet¬
erinary Science and Animal Husbandry 38: 46-5 1 .

Khanna N D. 1969. Studies on transferrin polymorphism in Indian water buffaloes.
Indian Journal of Animal Sciences 39: 21-26.

Khanna N D. 1973. Biochemical Polymorphism and Blood Groups in Indian Buffaloes
(Bubalus bubalis). Embassy Press, Delhi.'

Khanna N D and Braend M. 1968. Haemoglobin and albumin polymorphisms in In¬
dian water buffaloes. Acta Veterinary Scandinavica 9: 3 1 6-327 .

Khanna N D and Singh H. 1972. Serum albumin polymporphism in four Indian cattle
breeds. A Note. Indian Journal of Animal Sciences 42: 470-71.

Kolli R and Kulshreshtha A C. 1997. Contribution of livestock to national income.
Dairy India. (Ed.) Gupta P R. 5th edn, pp 77-79. A-25, Priyadarshini Vihar, Delhi-
11 0 092, India.

Kuhn C, Weikard R, Goldammer T, Grupe S, Olsaker I and Schwerin M. 1996. Isola¬
tion and application of chromosome 6 specific microsatellite markers for detection
of QTL for milk production traits in cattle. Journal of Animal Breeding and Genet¬
ics 113:355-62

340

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Kumar V S. 1 990. Studies on the performance of Godavari buffaloes under field condi¬
tions. M.V.Sc. Thesis, Andhra Pradesh Agricultural University, Hyderabad.

Laurell C B. 1960. Metal binding plasma proteins and cation transport. “The Plasma
Proteins”. (Ed.) Putnam F W. Vol. 1, pp. 349-78. Academic Press, New York.

Lehman H. 1959. The haemoglobin of 103 Indian Gir cattle. Man 59: 66-67.

Lindersson M, Andersson-Eklund L, Koning D J de, Lunder A, Maki-Tanila A,
Andersson L and De-Koning D J. 1 998. Mapping of serum amylase- 1 and quantita¬
tive trait loci for milk production traits to cattle chromosome 4. Journal of Dairy
Science 81: 1454-61 .

Lipkin E, Mosig M O, Darvasi A, Ezra E, Shalom A, Friedmann A and Soller M. 1 998.
Quantitative trait locus mapping in dairy cattle by means of selective milk DNA
pooling using dinucleotide micro satellite markers: Analysis of milk protein per¬
centage. Genetics 149:1557-67.

Littlewood R W. 1936. Livestock of Southern India. Superintendent, Government Press,
Madras. VIII: 23 p.

Liu Z, Simianer H, Haussmann H, Smith C (ed), Gavora J S (ed), Bankel B (ed), Chesnais
J (ed), Fairfull W (ed), Gibson J P (ed), Kennedy B W (ed) and Burnside E B. 1 994.
Marker assisted complex segregation analysis of milk protein traits in dairy cattle.
Proceedings of the V World Congress on Genetics Applied to Livestock Produc¬
tion, University of Guelph, Guelph, Ontario, Canada, 7-12 August 1994, 19: 307-
10.

Loypetjra P. 1962. Undersogelser over blodtyper samt haemoglobin-og serum typer
hos thailandske Vandbofler. Aarsheretn. Inst. Sterilitetsforskn K. Vet.-og
Landbohojsk. (Kbh.), 1962, pp 221-26.

Macgregor R. 1939. The domestic buffalo, fide Cockrill W R. 1974. The Husbandry
and Health of Domestic Buffalo .F AO, Rome, pp 14.

Maijala K. 1982. Preliminary report of the working party on animal genetic resources
in Europe. In Conservation of Animal Genetic Resources. Session 1 . Commission
on Animal Genetics, EAAP, G.I. @ Leningrad.

Maijala K, Chevekaev A V, Devillard J M, Reklewski Z, Rognoni G, Simon D L and
Steane D E. 1984. Conservation of animal genetic resources in Europe (EAAP
working party report). Livestock Production Science 11: 3-22.

Makaveev Ts. 1968. Study of biochemical polymorphism and blood groups in buffalo
(Bos bubalus ). Zhivotnov 'dni Nauki 5: 3-20.

Makaveev Ts. 1 970. Albumin, transferrins, serum amylase and blood groups in Bulgar¬
ian water buffalo. Proceedings of XI European Conference of Animal Blood
Group and Biochemical Polymorphism, Warsaw, 1967, 235-38.

Man gal raj D, Satchidanandam V and Nambiar K T K. 1968. Haemoglobin polymor¬
phism in cattle. Indian Veterinary Journal 45:996-1002.

REFERENCES

341

Manwell C and Baker C M A. 1 970. Molecular Biology and the Origin of Species. 394
pp. Sidgwick and Jackson, London.

Masina P, Iannelli D and Bettini T M. 1971 . Serum albumin and transferrin variants in
Italian buffaloes ( Bos bubalis L.). Experientia 27: 587-89.

Mason I L. 1972. The history and biology of humped cattle. Symposium on Zebu Cattle
Breeding and Management, Venezuela, 6-10 August 1972. Animal Production and
Health Division, FAO, Rome.

Mason I L. 1987. Domestication and breed formation in cattle. World Review of Animal
Production 23: 71-76.

Mason I L. 1996. A World Dictionary of Livestock Breeds, Types and Varieties. 4th
edn. CAB International, Wallingford, UK.

Maule J P. 1990. The Cattle of the Tropics. Centre for Tropical Veterinary Medicine,
University of Edinburgh, UK.

Mayr B, Krutzler H, Auer H and Schleger W.1983. Reciprocal tranlocation 60, XY
t(8, 1 5) (21,24) in cattle. Journal of Reproduction and Fertility 69: 629-30.

Meadow R H. 1984. Notes on the faunal remains from Mehrgarh with a focus on cattle
(Bos). In: Proceedings of the VI International Conference of the Association of
South African Archaeologists in Western Europe, 5-19 July 1981, pp. 34-40. Cam¬
bridge University Press, Cambridge.

Meghen C, MacHugh D E and Bradley D G. 1994. Genetic characterisation and West
African cattle. World Animal Review 78: 59-66.

Moody D E, Pomp D and Buchanan D S. 1997. Feasibility of the grand progeny design
for quantitative trait loci (QTL) detection in purebred beef cattle. Journal of Ani¬
mal Science 75: 941-49.

Mosig M O, Lipkin E, Darvasi A, Ezra E, Friedmann A and Soller M. 1998. Mapping
QTL affecting milk protein per cent in Israel Holstein dairy cattle by selective
DNA pooling with dinucleotide microsatellite markers. Proceeding of the VI World
Congress on Genetics Applied to Livestock Production, Armidale, Australia, Janu¬
ary 11-16, 1998. Vol. 26:253-56.

Nagarcenkar R. 1975. The role of buffalo in the developing world. Indian Dairyman
27: 301-04.

Naik S N. 1978. Origin and domestication of zebu cattle (Bos indicus ). Journal on
Human Evolution 7(1): 23-30.

Naik S N and Sukumaran P K. 1967. Haemoglobin polymorphism in water buffaloes.
Proceedings of XI European Conference of Animal Blood Group and Biochemi¬
cal Polymorphism, Paris, 1966, pp. 401-05.

Naik S N, Sukumaran P K and Sanghvi L D.1965. A note on blood groups and haemo¬
globin polymorphism in cattle. Animal Production 7:275-77 .

Nair P G, Balakrishnan M and Yadav B R. 1986. The Toda buffaloes of Nilgiris.
Buffalo Journal 2: 167-78.

342

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Narayana Reddi M L. 1939. The buffalo in the Madras Presidency. Madras Agriculture
Journal 27: 50-58.

Nath M N. 1981. Ongoles abroad. International seminar and show on Ongole cattle.
Scientific Bulletin 1:2.

NathMN. 1993. The Ongole cattle: A versatile resource for the tropics. World Animal
Review 76:2-1 1

NCA. 1976. Animal Husbandry. Part VII. Government of India, Ministry of Agricul¬
ture and Irrigation, New Delhi.

Nivsarkar A E, Gupta S C, Vij P K and Sahai R. 1994. Identification and conservation
of endangered breeds of livestock - strategies and approach. Proceedings of the
National Symposium on Livestock Production and Management held at Gujarat
Agricultural University, Anand, 21 to 23 February 1994.

Owen R. 1 846. A History of British Mammals and Birds. 560 pp. London.

Olver A. 1936. The systematic improvement of livestock in India. Agriculture and
Livestock in India. Vol. 9.

Olver A. 1938. A Brief Survey of Some of the Important Breeds of Cattle in India.
Miscellaneous Bulletin 1 7, Imperial Council of Agricultural Research, New Delhi.

Osterhoff D R, Young E and Wardcox I S. 1970. A study of genetic blood variants in
African buffaloes. Journal of South African Veterinary Medical Association 41:
33-37.

Panda L K and Mishra M. 1990. Characteristics and performance of Motu cattle. In¬
dian Journal of Animal Production and Management 6(4): 213-17.

Patro B N and Kornel Das. 1987. Paralakhemundi and Manda buffaloes of Orissa. Buf¬
falo Bulletin 6(3): 60-64.

Payne W J A. 1970. Cattle Production in the Tropics. Vol. I. General Introduction,
Breeds and Breeding. Longman, London.

Payne W J A and Hodges Johan. 1997. Tropical Cattle. Origin, Breeds and Breeding
Policies. 328 pp. Blackwell Science Ltd, London.

PDC. 1995-96. Annual Report. Project Directorate on Cattle, Meerut, India.

PepperallRA. 1945. The dairy industry of India, fide NCA .1976 . Animal Husbandry.
Part VII. Government of India, Ministry of Agriculture and Irrigation, New Delhi.

Phillips R W. 1944. The cattle of India. Journal of Heredity 35 (9): 273-88.

Pilgrim G E. 1939. The fossil Bovidae of India. Palaeontologia Indica. N.S. 26, Mem¬
oir No. 1.

Pirchner F. 1983. Population Genetics in Animal Breeding. Plenum, New York.

Plotsky Y, Cuhaner A, Haberfield A, Lavi U and Hillet J. 1990. Analysis of genetic
association between DN A fingerprint bands and quantitative traits using DNA mixes.
Proceedings of the IV World Congress on Genetics Applied to Livestock Produc¬
tion 13:133-37.

REFERENCES

343

Prasad J and Pereira M B. 1985. Effect of month of calving on the subsequent lactation
milk yield and length in Jersindh cows. Livestock Adviser 15-17.

Prasad S K, Pandey R S, Shankar V, Nair KGS and Nair P G. 1978. Genetic polymor¬
phism of serum transferrins in zebu and crossbred cattle. Indian Journal of Experi¬
mental Biology 16:1 09- 1 0.

Project Report. 1997. National Project for Cattle and Buffalo Breeding. Door step
delivery of breeding services and total coverage of breedable cows and buffaloes.
Department of Animal Husbandry and Dairying, Government of India.

Ram C and Khanna N D. 1 96 1 . Studies on blood groups of Indian cattle. Indian Journal
of Veterinary Science and Animal Husbandry 31:257-67.

Ram C, Khanna N D and Prabhu S S.1964. Studies on Indian bovine blood groups. 1 .
Buffalo blood antigenic factors detected through cattle blood group reagents. In¬
dian Journal of Veterinary Science and Animal Husbandry 34:84-88.

Ranjekar P K and Barnabas J. 1969. Haemoglobin phenotypes in water buffalo ( Bos
bubalus) during development. Comparative Biochemistry and Physiology 28: 1 395-
1401.

Rao G N. 1995. Evaluation and improvement of germplasm of cattle in Andhra Pradesh
- Ongole Breed. Presented at the XXVI Research and Extension Advisory Council
Meeting. Andhra Pradesh Agricultural University, Hyderabad.

Rao M K and Nagarcenkar R. 1977. Potentialities of the buffalo. World Review of
Animal Production 13(3): 53-62.

Rao P K. 1981. The chromosomes of local and Murrah buffaloes. M.V. Sc. Thesis
submitted to the Orissa University of Agriculture and Technology, Bhubaneswar,
Orissa (India).

Rao Y A. 1984. Sturdy buffalo breeds for emboldened draughtiness. Livestock Adviser
9:39-42.

Rocha J L, Baker J F, Womack J E, Sanders J O and Taylor J F. 1992. Statistical
associations between restriction fragment length polymorphisms and quantitative
trait in beef cattle. Journal of Animal Science 70:3360-70.

Ron M, Band M, Wyler A and Weller J I. 1993. Unequivocal determination of sire
allele origin for multiallelic microsatellite when only the sire and progeny are
genotyped. Animal Genetics 24: 171-76.

Sahai R and Mathur P K. 1 98 1 . Chromosomal basis of species interrelationship in bovidae.
Journal of Animal Morphology and Physiology 28:62-72.

Sahoo S P and Mishra M. 1989. Characteristics and performance of Ghumsuri cattle.
Indian Journal of Animal Production and Management 5(3): 1 05-1 1 .

Sahoo U K and Mishra M. 1990. Characteristics and performance of Binjharpuri cattle.
Indian Journal of Animal Production and Management 6(4): 218-23.

Santiago A A Z. 1978. Evolution of zebu cattle in Brazil. The Zebu Journal 1(3): 6.

344

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Sen A, Roy D, Bhattacharya S and Deb N C. 1966. Haemoglobins of Indian zebu cattle
and the Indian buffalo. Journal of Animal Science 25: 445-48.

Serpell J. 1989. Pet keeping and animal domesticaion: a reappraisal. In: The Walking
Larder. (Ed.) Clutton-Broch J. pp. 10-21. Unwin-Hyman: London.

Shanker V. 1979. Studies on serum transferrins of cattle and buffalo. Ph.D. Thesis,
National Dairy Research Institute, Karnal.

Simak E. 1991 . The conservation of rare breeds in West Germany. In Genetic Conser¬
vation of Domestic Livestock. (Ed.) Lawrence Alderson. pp. 65-69. CAB Interna¬
tional, London.

Singh B. 1942. The blood group of Indian cattle and buffaloes. Lndian Journal of
Veterinary Science and Animal Husbandry 12: 12-23.

Singh B. 1945. The blood group identification of various Indian breeds of cattle in
India. Indian Journal of Veterinary Science and Animal Husbandry 15: 1 09- 1 9.
Singh B K. 1974. Genetic studies on some breeds of Indian and crossbred cattle. Ph.D.
Thesis, Panjab University, Chandigarh.

Singh C B and Gumani M. 1 997. Cattle and Buffalo Breeding Policy in India - Present
Status and Strategy for Future. National Dairy Research Institute, Karnal, India.
Singh H 1981. Status of albumin and amylase polymorphism in Kumani-Hill cattle.
Indian Veterinary Journal 58: 104.

Singh H, Batabyal A K, Bhatia S S and KhannaN D. 1972. Serum transferrin polymor¬
phism in cattle breeds: A note. Indian Journal of Animal Sciences 42:650-52.
Singh H and Bhat P N. 1980a. Genetic studies on albumin polymorphism in the blood
of Indian cattle. Indian Journal of Animal Sciences 50: 224-33
Singh H and Bhat P N. 1980b. Genetic studies On ceruloplasmin polymorphism in the
blood of Indian cattle. Indian Journal of Animal Sciences 50: 219-24.

Singh H and Bhat P N. 1981 . Phylogenetic relationship between Indian cattle breeds.

Indian Journal of Animal Sciences 51: 691-97.

Singh H and Moore E N. 1 982. Livestock and Poultry Production. 2nd edn. Prentice-
Hall of India Private Limited, New Delhi- 1 10 001.

Smith C. 1982. Estimates of trends in the halothana gene in pig stocks with selection.

Journal of Animal Breeding and Genetics 99:232-40.

Smith C. 1984. Estimated costs of genetic conservation in farm animals. F AO Animal
Production and Health Paper 44 (1): 21-30.

Smith C and Simpson S P. 1986. The use of polymorphisms in livestock improvement.

Journal of Animal Breeding and Genetics 103:205-17.

Sreemannarayana O. 1981 . The history of export ofNellore/Ongole cattle to Brazil and
America. International Seminar and Show on Ongole cattle. Scientific Bulletin 1:5.
Stormont C. 1950. Additional gene control antigenic factors in the bovine erythrocytes.
Genetics 35: 76-94.

REFERENCES

345

Stormont C.1951. An example of recessive blood groups in sheep. Genetics 36: 577-
78.

Stormont C. 1962. Current status of blood groups in cattle. Annals of New York Acad¬
emy of Sciences 97: 251-68.

Stormont C. 1967. Contribution of blood typing to dairy science progress. Journal of
Dairy Science 50: 253-60.

Stormont C. 1972. The language of phenogroups .Haematologia 6: 73-79.

Stormont C. 1982. Blood groups in animals. Journal of the American Veterinary Medi¬
cal Association 181: 1 120-24.

Stuber C W, Moll RH, Goodman M M, Shaffer H E and Weir B S. 1969. Allozyme
frequency changes associated with selection for increased grain field in maize
(Zea mays L.). Genetics 95:225.

Suemori H and Nakatsuji N. 1987. Establishment of the embryo derived stem (ES) cell
lines from mouse blastocysts: effects of feeder cell layers. Development, Growth
and Differentiation 29: 133-39.

Tamura K, Oshugi K and Ide H. 1990. Distribution of retinoids in the chick limb bud:
analysis with monoclonal antibody. Developmental Biology 119: 813-21

Tantia M S, Kumar P, Joshi B K, Vij P K and Nivsarkar A E. 1 994. Population status of
cattle and buffalo breeds of India. Journal of Dairying, Foods and Home Science
13(4): 192-94.

Tantia M S, Vij P K, Vijh R K, Kumar P, Joshi B K, Nivsarkar A E and Sahai R. 1996.
Siri: The cattle of eastern Himalayas. Animal Genetic Resources Information 19:
41-49.

Taylor J F, Coutinho L L, Herring K L, Gallagher D S Jr, Brenneman R A, Burney N,
Sanders J O, Turner J W, Smith S B, Miller R K, Saveli J W and Davis S K. 1998.
Candidate gene analysis of GH1 for effects on growth and carcass composition of
cattle. Animal Genetics 29: 1 94-20 1 .

ThaparBK. 1957. Maski 1954: A Chalcolithic site of the southern Deccan. In '.Ancient
India. Bulletin No. 13, pp. 4-142. Archaeological Society of India, Government of
India: New Delhi.

Thomas P K. 1989. Utilization of domestic animals in pre- and prehistoric India. In:
The Walking Larder. (Ed.) Clutton-Brock J. pp. 108-12. Unwin Hyman, London.

Vijh R K, Tantia M S, Vij P K, Kumar P and Sahai R. 1996. Sister chromatid differen¬
tiation in Rathi cattle. Indian Journal of Animal Sciences 66: 83-85.

Vishnu-Mittre. 1978. Origin and history of agriculture in the Indian sub-continent.
Journal of the Human Evolution 7(1): 3 1-36.

Vyas K. 1997. Amul in 59. Dairy India 1997. (Ed.) Gupta P R. 5th edn, pp 67-71. A-
25, Priyadarshini Vihar, Delhi -110 092, India.

WareF. 1942. The cattle of India and their development. Indian Journal of Veterinary
Science and Animal Husbandry 12: 62-72.

346

ANIMAL GENETIC RESOURCES OF INDIA - CATTLE AND BUFFALO

Weber J L. 1990. Informativeness of human (dC-dA), (dG-dT)n polymorphisms.
Genomics 7: 524-30.

Weller J I, Kashi Y and Soller M. 1990. Power of daughter and grand daughter designs
for determining linkage between marker loci and quantitative trait loci in dairy
cattle. Journal of Dairy Science 73: 2525-37 .

Wiles M V. 1993. Embryonic stem cell differentiation in vitro method. Enzymology
225:900-18.

Windels F. 1950. The Lascaux Cave Paintings. Viking: New York, USA.

Wright N C. 1937. Report on the development of the cattle and dairy industry in India.
fide NCA. 1976. Animal Husbandry. Part VII. Government of India, Ministry of
Agriculture and Irrigation, New Delhi.

Zarins J. 1989. Pastoralism in southwest Asia: the second millennium BC. The Walk¬
ing Larder. (Ed.) Clutton-Brock J. pp 127-55. Unwin Hyman: London.

Zeuner F E. 1962. Summary of the Symposium on Man and Cattle. Royal Anthropol¬
ogy Institute Symposium, Cattle, London 1960.

Zeuner F E. 1963. A History of Domesticated Animals. 560 pp. Hutchinson and Co.
Ltd, London.

Internet Archive Audio

Featured

Top

Images

Featured

Top

Software

Featured

Top

Books

Featured

Top

Video

Featured

Top

Mobile Apps

Browser Extensions

Archive-It Subscription

Save Page Now

Full text of "Animal Genetic Resources of India : Cattle and Buffalo"

See other formats